16S rDNA - International Journal of Philippine Science and

Transcription

International
Journal of
Philippine
Science and
Technology
(formerly Philippine Science Letters)
Volume 8 Number 2
International Journal of Philippine Science and Technology, Vol. 08, No. 2, 2015
1
ARTICLE
Levels and sources of potassium,
calcium, sulfur, iron and
manganese in major paddy soils
of the Philippines
Jehru C. Magahud*1, Rodrigo B. Badayos2,
Pearl B. Sanchez2, and Pompe C. Sta. Cruz2
1Philippine
Rice Research Institute, Science City of Muñoz,
Nueva Ecija, Philippines 3119
2University of the Philippines Los Baños, College,
Laguna, Philippines 4031
Abstract—Nutrient levels in rice areas can be translated to the soils’ capacity to supply the essential
elements for rice, while information about nutrient sources can be used to formulate management options to
areas deficient or toxic in nutrients. This study was then conducted to assess the potassium (K), calcium
(Ca), sulfur (S), iron (Fe) and manganese (Mn) levels in the Philippines’ major rice areas. The study also
determined the contributions of soil properties, land uses, irrigation water, and farm practices to the nutrient
levels. Strategic collection of soil and plant samples, laboratory analyses of samples, and farmer interviews
were done. Potassium concentrations of rice plants in La Paz (Tarlac) and Sta. Rosa City (Laguna)
exceeded the toxic concentration of 3%. These K concentrations can be due to the increase of the nutrient’s
availability owing to the neutral soil pH levels in the two sites. The highest total Ca levels were found in the
Polangui (Albay), La Paz, and Villasis (Pangasinan) soils. These Ca levels can be ascribed to the occurrence
of Ca in sand and silt-sized soil fractions. Total Fe and Mn concentrations were very high in the Sta. Cruz
(Zambales) soil due to the input of mine wastes. The San Leonardo (Nueva Ecija) soil’s high total Fe
concentration is probably due to the occurrence of Fe in clay-sized soil fractions. Iron and Mn levels of rice in
most Central Luzon sites exceeded the toxic concentrations of 1000 mg kg-1 for Fe and 300 mg kg-1 for Mn.
These concentrations can be due to the high total soil Fe and Mn levels, and their increased plant uptake
due to periodic soil submergence and increased soil acidity from continuous cropping. The study implies that
K, Ca, Fe and Mn are enriched in rice areas due to soil properties and farm practices.
Keywords—potassium, calcium, sulfur, iron, manganese, paddy soils
INTRODUCTION
Rice is mostly grown in flooded lowland conditions in bunded fields or paddy
soils. Paddy soils are characterized by a plow plan and specific morphological
features resulting from tilling the wet soil (puddling) and periodic flooding and
drainage regimes.
Philippine paddy soils have higher Fe oxide (7.73%), Mn oxide (0.23%) and
Ca oxide (2.83%) contents, but have lower potash (K2O) (0.99%) contents than
most paddy soils in tropical Asia. Philippine paddy soils also have relatively high
levels of exchangeable macronutrients such as Ca (14.8 cmol(+)kg-1) and K (0.5
cmol(+)kg-1) (Kawaguchi and Kyuma 1974). Such total and exchangeable levels of
soil nutrients may become available to rice depending on the nutrients’ chemical
nature, on soil properties, and on crop management and environmental factors.
*Corresponding Author
Email Address: [email protected]
Submitted: December 17, 2014
Revised: March 27, 2015
Accepted: May 11, 2015
Published: July 1, 2015
Soil retention of nutrients is controlled by soil properties (Zeng et al. 2011)
and by the intensity of puddling operations employed in rice fields (Sharma and De
Datta 1984). Use of fertilizers increases the concentrations of some nutrients in
soils and in plants, while the use of pesticides that contain S can result in elevated
concentration of this nutrient (Lu 2011). Irrigation water affects the soil nutrient
levels depending on the water’s nutrient concentration and irrigation intensity.
Intensive cropping reduces the soil nutrient levels if the amounts of removed
nutrients exceed those returned to the soil. Based on nutrient bioavailability, the
amount of nutrients retained in the soil determines the amount absorbed by rice.
Some agricultural soils are near the perceived heavy metal sources like urban
areas, highways, and mining areas. Higher quantities of metals are dissolved in the
water or suspended in the air of such areas, where soils and plants can be enriched
with metals.
Such scenarios highlight the need for assessing the levels and sources of
nutrients in the major rice-producing areas of the Philippines. Nutrient levels in
paddy soils and in rice can be translated to the soils’ capacity to supply the ____________________________________________________________________________________________________________
www.philscitech.org
essential elements for rice. Nutrient sources, on the other hand, can be used to
formulate management options in areas that are deficient or toxic in nutrients.
The study assessed the K, Ca, S, Fe and Mn levels in soils and plants of the
Philippines’ major rice areas. It also determined the sources of these nutrients
relative to soil properties, land uses, irrigation water, and farm input levels. The
study sites were selected based on a detailed morphological, mineralogical,
chemical and physical characterization of lowland soils in the Philippines (Miura et
al. 1995). These sites are the major soil series devoted to lowland rice production
across different agroclimatic conditions of the country’s rice-growing areas.
Nutrient values established by the present study can be a good reference for future
studies that will assess the nutrient levels of rice and paddy soils in the country.
MATERIALS AND METHODS
Sampling Sites
Thirty-two sites were studied: three in Cagayan Valley, 14 in Central Luzon,
four in Laguna, five in Bicol, and three each in the Visayas and Southern Mindanao
(Figure 1, Table 1). Thirty sites are rice areas, while two control sites—Jaen and
Sta. Rosa City a—are mango orchard and uncultivated grassland, respectively.
2
Sample Collection Protocol
Plant and soil samples were collected during the period between maximum
tillering and harvesting of rice. Rice plants were uprooted. Rhizophere soils and
the whole rice-aboveground biomass (tops) were placed in clean separate plastic
bags. Rhizosphere soils were collected to determine the relationship between soil
properties and plant nutrient levels. Two or three soil and plant samples were
collected per site depending on the lengths of the farm. Samples were collected
from May 2012 to December 2013. Levels of Nutrients
Soil samples were air-dried, pulverized, and passed through 2-mm (US#10)
and 0.422-mm (US #40) mesh sieves. Whole aboveground biomass was washed,
oven-dried for 3 days at 60-700C, and ground using a stainless steel grinder. Nondestructive analyses of total nutrient concentrations of soil and biomass samples
were performed in the National Institute of Molecular Biology and Biotechnology,
University of the Philippines Los Baños, Laguna. The equipment used was the
handheld NITON® XL3T x-ray fluorescence analyzer manufactured by Thermo
Fisher Scientific Inc.
Total nutrient levels in soils were compared to the mean of total nutrient
levels in Philippine paddy soils (Miura et al. 1995, Domingo and Kyuma 1983).
Nutrient levels in plants were compared to the values reported as normal, toxic and
deficient in mature leaf tissues for various species and for rice tops. Levels
reported by Kabata-Pendias and Pendias (2001), Marschner (2012), Kitagishi and
Yamane (1981), and Dobermann and Fairhurst (2000) were used.
Soil Properties and Land Uses that affect Nutrient Levels
Soil samples were analyzed for pH, available phosphorus (P), and organic
matter (OM) following standard procedures (PCAARRD 1980). Correlation
analyses of data on soil properties and total nutrient levels in soils and in plant
tissues were done. Nutrient levels in different land uses (deep-well and rainfed
areas, dam and river-irrigated areas, mine area-adjacent sites, urban area-adjacent
sites, and highway-adjacent sites) (Table 1) were compared. Kruskal-Wallis and
Mann-Whitney U tests were used.
Irrigation Water that affects Nutrient Levels
Soil and plant samples were collected from dam-irrigated sites to determine
the effect of irrigation water on nutrient levels in paddy fields (Table 1).
Collections were done at three varying distances from the irrigation entrance: close
(2–5 m), middle (42–45 m), and far (82–85 m).
Figure 1. Map of the Philippines showing the study sites (labels in Table 1)
TABLE 1. Classification of sites based on land use or contamination source.
Classification
Site
Deep-well and rainfed sites
without solid wastes in
irrigation water
1) Solana, Cagayan; 2) Villasis, Pangasinan;
3) La Paz, Tarlac a; 4) Jaen, Nueva Ecija (N.E.);
5) Sara, Iloilo
Dam and river-irrigated
sites with solid wastes in
irrigation canals
6) Cabatuan, Isabela*; 7) Echague, Isabela*;
Analyses of total Fe and Mn concentrations of irrigation water samples from
mine area-adjacent sites (Table 1) were done in the Regional Standards Testing
Laboratory, Department of Science and Technology Regional Office III, San
Fernando City, Pampanga. Water samples were digested using nitric and
hydrochloric acids, and their total Fe and Mn concentrations were measured in a
flame atomic absorption spectrophotometer. Total Fe and Mn concentrations in
irrigation water were compared with the standards of the Philippines and other
countries (Department of Agriculture 2007, Ayers and Westcot 1994, USEPA and
USAID 1992, ANZECC and ARMCANZ 2000).
Farm Inputs and Activities that affect Nutrient Levels
Tarlac*;
8) San Manuel,
9,10) Muñoz City, N.E.
11) Llanera, N.E. *; 12) Talavera, N.E. *;
A questionnaire was used to survey the levels of puddling operations and the
amounts of fertilizers and pesticides applied by farmers. Pearson correlation
analysis determined the association of farm input levels with the nutrient levels.
Identifying the Source of Nutrients
a*,
b*;
13) Zaragoza, N.E.; 14,15) San Leonardo, N.E. a*, b*;
Source of nutrients was determined only in sites with toxic or with the highest
level of a particular nutrient among the sites. Sources of nutrients were determined
based on the results of analysis of soil properties, land uses, irrigation water, and
farm inputs that affect the nutrient levels. The analytical framework for
determining the sources is shown in Figure 2.
16) San Miguel, Bulacan*; 17) Sta. Cruz, Laguna;
18) Bay, Laguna; 19) Canaman, Camarines Sur;
20) Minalabac, Camarines Sur*; 21) Polangui, Albay*;
22) Casiguran, Sorsogon*; 23) San Miguel, Iloilo*;
24) Cotabato City, Maguindanao;
25) Kabacan, North Cotabato*;
26) Tacurong City, Sultan Kudarat*
Mine area-adjacent sites
with deposits of mine
tailings
27) Sta. Cruz, Zambales;
28) Sipalay City, Negros Occidental*
Urban area-adjacent sites
with urban wastes
29, 30) Sta. Rosa City, Laguna a, b
Highway-adjacent sites with
vehicular wastes
31) La Paz, Tarlac b; 32) Milaor, Camarines Sur
*sites
subjected to comparison of nutrient levels at varying distances from irrigation entrance
Figure 2. Analytical framework for determining the sources of nutrients in
study sites.
RESULTS AND DISCUSSION
Total concentrations of K, Ca, S, Fe and Mn were included in this report.
Total concentrations of other elements, such as chromium, nickel, copper, cobalt, ____________________________________________________________________________________________________________
www.philscitech.org
zinc, arsenic, molybdenum, cadmium, mercury, lead, strontium, rubidium, titanium
and zirconium, were also analyzed. For convenience of interpretation, these total
element concentrations were not included in this report.
Total Nutrient Levels in Soils
Total soil nutrient levels were compared to the mean values for Philippine
paddy soils (Table 2). The highest total K level among the paddy soils studied was
found in Kabacan. The second highest level was observed in San Miguel (Iloilo),
while the third highest was found in Cabatuan.
The Polangui soil had the highest total Ca concentration. The La Paz a and
Villasis soils had the second and third highest concentrations, respectively.
The highest total Fe level was found in Zambales. The second highest level
was observed in Sta. Rosa City a, while the third highest was found in San
Leonardo a.
The highest total Mn level was found in Sta. Rosa City a. The second highest
level was observed in Jaen, while the third highest was found in Zambales.
Nutrient Levels in Rice Tops
Nutrient levels in rice were also compared to values considered as normal,
toxic, and deficient in mature leaf tissues for various species and for rice tops
(Table 3). Rice in La Paz a had the highest K level. Rice in Sara and Sta. Rosa City
b had the second and third highest levels, respectively. Moreover, rice in Tacurong
City, Sipalay City, Muñoz City a, and Milaor also had K concentrations above the
toxic level.
For all sites, Fe levels exceeded the toxic level for rice tops (Dobermann and
Fairhurst 2000) and for various species (Marschner 2011). The highest Fe
concentrations were found in rice tops collected from Muñoz City a, San Miguel
(Bulacan), and San Leonardo a.
Manganese levels in Zaragoza, San Manuel, and San Miguel (Bulacan) sites
exceeded the toxic level for rice tops (Dobermann and Fairhurst 2000).
Based on nutrient concentrations, no toxic levels of Ca, or deficient levels of
K, Ca, Fe and Mn in rice were found.
3
TABLE 2. Total nutrient levels in soils as compared to background values and
guidelines of countries.
K
Ca
Fe
Mn
cmol(+)kg-1
cmol(+)kg-1
%
%
Mean for Philippine paddy soils (N=34)
(Miura et al., 1995)
0.76% K2O
=8.07 K
2.58% CaO
=92.01 Ca
9.40 Fe2O3
=3.29 Fe
0.17 MnO2
=0.11 Mn
Mean for Philippine paddy soils (N=54)
(Domingo and Kyuma, 1983)
0.99% K2O
=10.51 K
2.83% CaO
=100.93 Ca
7.73 Fe2O3
=2.70 Fe
0.23 MnO2
=0.15 Mn
Solana, Cagayan
15.10
44.16
4.10
0.09
Cabatuan, Isabela
21.71
67.36
4.49
0.07
Echague, Isabela
2.88
7.37
1.30
0.01
Muñoz City, Nueva Ecija (N.E.) a
8.15
64.56
3.09
0.05
Muñoz City, N.E. b
5.33
50.99
3.71
0.06
Talavera, N.E.
7.34
59.84
4.66
0.06
Llanera, N.E.
1.59
21.43
1.95
0.05
Zaragoza, N.E.
8.79
63.65
2.31
0.04
San Leonardo, N.E. a
7.70
38.49
5.22
0.07
San Leonardo, N.E. b
7.95
44.72
4.97
0.08
Jaen, N.E.
10.77
56.73
4.34
0.11
San Miguel, Bulacan
11.09
29.67
4.28
0.07
San Manuel, Tarlac
10.47
75.11
3.00
0.09
La Paz, Tarlac a
7.88
89.55
2.14
0.05
La Paz, Tarlac b
9.27
55.99
3.76
0.07
Villasis, Pangasinan
17.77
85.30
4.04
0.10
Sta. Cruz, Zambales
1.24
23.44
7.34
0.11
Sta. Rosa City a
8.84
30.91
5.29
0.13
Sta. Rosa City b
9.89
41.74
5.12
0.09
Bay
6.55
37.69
4.01
0.06
Sta. Cruz
11.33
61.02
3.02
0.04
Milaor, Camarines Sur
8.13
38.07
4.54
0.08
Canaman, Camarines Sur
5.66
53.48
2.67
0.03
Minalabac, Camarines Sur
8.18
36.24
3.60
0.03
Polangui, Albay
15.62
133.72
3.38
0.06
Casiguran, Sorsogon
13.81
18.71
1.31
0.01
Sara, Iloilo
20.19
58.51
3.28
0.07
San Miguel, Iloilo
26.96
45.02
3.21
0.03
Sipalay City, Negros Occidental
21.23
40.64
2.08
0.04
Cotabato City, Maguindanao
16.71
54.12
4.25
0.05
Kabacan, North Cotabato
38.34
34.98
1.91
0.02
Tacurong City, Sultan Kudarat
15.89
84.68
1.75
0.05
Nutrient Guidelines and Values/Site
Cagayan Valley
Central Luzon
Soil Properties that affect Nutrient Levels
Significantly positive correlations were found for soil pH vs. plant K (Tables
4 and 5). A significantly negative correlation was observed for soil pH vs. plant
Mn.
Significantly negative correlations were found for sand vs. plant Ca, clay vs.
plant K, sand vs. total soil Fe, and clay vs. total soil Ca. Significantly positive
correlations were observed for clay vs. total soil Fe, and sand and silt vs. total soil
Ca.
Significantly negative correlations were found for OM vs. plant Mn.
Significantly positive correlations were observed for available P vs. total soil Ca,
plant K, and total soil Mn.
Laguna
Influence of Soil pH on Nutrient Concentration
A significantly positive correlation for soil pH vs. plant K was observed
because slightly acidic paddy soils allow less amounts of K for leaching and more
for plant uptake. Chen and Barber (1990) showed that nutrient-uptake model
accurately predicted the effect of soil pH on K uptake (Y = 67 + 0.94X, R2 =
0.99). Also, strongly acidic paddy soils, with more solution concentration of H+,
probably decrease the function of root plasma membrane, and promote loss of K or
inhibition of the nutrient’s uptake (Alam et al. 1999).
A significantly negative correlation for soil pH vs. plant Mn was found
because slightly acidic paddy soils adsorb and precipitate high amounts of Mn,
limiting the nutrient’s availability for uptake. Mitsios et al. (2005) also found a
significantly negative correlation between soil pH and DTPA-extractable Mn.
Influence of Soil Texture on Nutrient Concentration. A significantly
negative correlation for sand vs. plant Ca was found because paddy soils with high
sand content (loam) probably allow leaching of Ca, while those with low sand
content (clay) adsorb and accumulate this nutrient. This result agrees with the
findings of Kahlon et al. (2013).
A significantly negative correlation for clay vs. plant K was observed because
paddy soils with high clay contents adsorb high amounts of K, resulting in the
reduced uptake of the nutrient.
A significantly positive correlation for clay vs. total soil Fe, and a
significantly negative correlation for sand vs. total soil Fe were found because the
stable forms of soil Fe occur as clay-sized particles. Soil Fe occur as free oxides
(Zhang et al. 2012) or as coatings of clay minerals (Rengasamy and Oades 1977) in
the clay-sized soil fractions. Furthermore, Fe in the soils studied possibly occur as
structural component of clay minerals. Clay minerals in the soils studied are
primarily smectites and vermiculite (Miura et al. 1995).
A significantly positive correlation for sand and silt vs. total soil Ca, and a
significantly negative correlation for clay vs. total soil Ca were observed because
the stable forms of soil Ca occur in sand and silt-sized particles. Calcium is a
structural component of minerals in the sand and silt-sized soil fractions. Pyroxene,
amphibole and plagioclase are minerals in the fine sand fractions of the soils Bicol
Visayas
Mindanao
____________________________________________________________________________________________________________
www.philscitech.org
4
TABLE 3. Nutrient levels in plant tissues as compared to values considered as
normal, toxic and deficient in mature leaf tissues for various species and for rice tops.
K
Ca
Fe
Mn
Nutrient Guidelines and Values/Site
TABLE 4. Pearson correlation coefficients of soil properties vs. soil nutrient levels.
Soil Properties
N
K
Ca
Fe
Mn
soil pH
85
0.04
0.20
0.57**
0.58**
%
%
mg kg-1
mg kg-1
sand, %
85
0.10
0.43**
-0.44**
-0.10
Normal level for various speciesa
-
-
-
30-300
silt, %
85
0.06
0.25*
-0.05
0.02
Toxic level for various speciesa
-
-
-
400-1000
clay, %
85
-0.11
-0.47**
0.36**
0.06
Toxic levels for various speciesb
-
-
>500
>200
organic matter, %
85
-0.11
-0.43**
0.15
-0.19
Toxic levels for rice topsc
-
-
500-1000
300-1000
available P, mg kg-1
85
0.18
0.37**
0.20
0.31**
>3.00
>0.70
>300
>800
-
-
50-150
10-20
<1.20
<0.15
<70
<20
Toxic levels for rice
topsd
Deficient levels for various speciesb
Deficient levels for rice topsd
Cagayan Valley
Solana, Cagayan
2.21
0.37
1656.49
581.63
Cabatuan, Isabela
2.65
0.57
1805.95
746.54
Echague, Isabela
2.01
0.37
972.97
295.37
Central Luzon
3.17
0.48
4109.12
558.33
Muñoz City, N.E. b
2.53
0.55
1665.24
603.22
Talavera, N.E.
2.34
0.42
1263.22
460.59
Llanera, N.E.
2.06
0.43
819.81
681.39
Zaragoza, N.E.
2.12
0.47
927.01
1.83
0.64
1885.62
TABLE 5. Pearson correlation coefficients of soil properties vs. plant nutrient levels.
Soil Properties
N
K
soil pH
80
0.28*
sand, %
80
0.12
silt, %
80
0.21
clay, %
80
-0.22*
organic matter, %
80
-0.22
available P, mg kg-1
80
0.46**
Ca
S
Fe
Mn
-0.12
0.08
-0.17
-0.30**
-0.22*
-0.10
-0.17
0.11
0.02
-0.08
0.03
-0.06
0.154
0.13
0.11
-0.05
-0.03
0.18
-0.14
-0.30**
0.05
0.19
-0.07
-0.41**
*correlated at 5% significance level; **correlated at 1% significance level
TABLE 6. Comparison of nutrient levels in soils of different land uses1.
Land Uses
N
K
Ca
Fe
Mn
1095.79
Deep-well and rainfed areas
9
a
a
b
a
628.42
Dam and river-irrigated areas
60
a
b
b
b
6
a
c
ab
ab
1.79
0.61
1672.57
561.10
San Miguel, Bulacan
1.68
0.55
3381.24
803.43
4
a
bc
a
a
San Manuel, Tarlac
2.71
0.50
1063.64
1002.84
Highway-adjacent sites
6
a
bc
b
a
8.51
0.69
1694.53
<55
La Paz, Tarlac a
2.45
0.35
482.55
512.22
La Paz, Tarlac b
4.33
0.40
1171.64
600.89
Sta. Cruz, Zambales
1.88
0.39
765.65
138.91
Laguna
Sta. Rosa City b
3.86
0.47
680.88
312.25
Bay
2.98
0.40
796.37
280.98
Sta. Cruz
2.51
0.36
711.82
161.85
3.12
0.42
1648.76
231.20
2.81
0.41
964.71
217.45
2.34
0.54
887.90
789.87
Polangui, Albay
2.42
0.43
1703.13
195.70
Bicol
Casiguran, Sorsogon
1.62
0.50
1358.57
202.83
Visayas
Sara, Iloilo
4.12
0.64
1630.47
729.92
3.22
0.54
484.42
519.63
Mindanao
TABLE 7. Comparison of nutrient levels in plant tissues of different land uses1.
Land Uses
N
K
Ca
S
Fe
Mn
Deep-well and rainfed areas
7
ab
a
ab
a
a
Dam and river-irrigated areas
57
c
a
b
a
a
6
bc
a
ab
a
a
4
a
a
ab
a
a
Highway-adjacent sites
6
ab
a
a
a
a
1Kruskal-Wallis
and Mann-Whitney U tests; same letters are not different at 5% significance level; different letters are different at
5% significance level
TABLE 8. Comparison of nutrient levels in soils collected close, middle and far
from irrigation entrance (IE)1.
Distance from IE
N
K
Ca
Fe
Mn
close (0-2 m)
17
ab
a
a
a
middle (40-42 m)
17
b
a
a
a
far (80-82 m)
17
a
a
a
a
TABLE 9. Comparison of nutrient levels in plant tissues collected close, middle
and far from irrigation entrance (IE)1.
Distance from IE
N
K
Ca
Fe
Mn
2.73
0.45
594.25
240.42
close (0-2 m)
16
a
a
b
a
2.34
0.39
581.96
210.12
middle (40-42 m)
16
a
a
a
a
3.25
0.42
488.03
378.49
far (80-82 m)
16
a
a
ab
a
aKabata-Pendias
and Pendias (2001), bMarschner (2012), cKitagishi and Yamane (1981), dDobermann and Fairhurst (2000)
1pairwise
comparison using Sign test; same letters are not different at 5% significance level; different letters are different at 5%
significance level
____________________________________________________________________________________________________________
www.philscitech.org
studied (Miura et al. 1995). Pyroxenes are present in soils as diopside or
hedenbergite. Amphiboles occur as tremolite or hornblende, while plagioclase can be
present as anorthite (van der Weijden 2007).
Influence of Organic Matter on Nutrient Concentration. A significantly
negative correlation for OM vs. plant Mn was observed because paddy soils with
high OM contents chelate high amounts of Mn and enhance the nutrient’s leaching.
Furthermore, as OM-bound Mn reaches the rhizosphere, the oxidized soil
condition possibly mineralizes the OM, and transforms Mn into less available
forms (oxides). The combined leaching and adsorption or precipitation of Mn
reduced its plant uptake.
5
Deep-well and rainfed sites had higher total soil Mn levels because these sites
are probably being deposited with Mn oxides from exhausts of farm tractors and
threshers. These sites are employed with 9, 10, 14 and 112 mechanized farm
operations per year.
Irrigation Water as Source of Nutrients
Nutrient Levels for Area Close vs. Middle vs. Far from Irrigation Entrance.
Generally, soil samples far from the irrigation entrance had higher total K
concentrations than those in the middle (Table 8). Rice plants collected in the
middle had higher Fe contents than those collected close to the irrigation entrance
(Table 9).
A significantly negative correlation for OM vs. total soil Ca was found
because of the strong affinity between the OM and clay fractions of the paddy
soils. There was a highly significant correlation (0.73**) between OM and clay
contents of the 85 soil samples analyzed in this study. Soils with low OM contents
have high levels of nutrients that are concentrated in sand-sized particles.
Silt particles were more abundant in the soils near the irrigation canal than
those in the middle (Table 10). This abundance suggests that irrigation water in
such sites carries upstream particles and deposits them in areas close to the
irrigation entrance. Nguyen et al. (2006) also noted that soil texture in a paddy field
was altered due to runoff and sediments from the uplands.
Influence of Available P on Nutrient Concentration. A significantly positive
correlation for available P vs. total soil Ca was found because Ca and P
concentrations in the solutions of paddy soils possibly increase during
submergence (Ponnamperuma 1972), and enhance the precipitation of Ca
phosphates. If cation concentrations are too high to be adsorbed on the soil, the
available P or phosphate can precipitate with cations to form phosphate
compounds. Available Ca and P are required in the formation of Ca phosphate in
soils (Tunesi et al. 1999). Patrick and Mahapatra (1968) also reported that an
increase in pH due to submergence increases the amount of Ca phosphates.
Calcium phosphates are sparingly soluble, and this insolubility possibly prevents
the leaching of Ca from the paddy soils.
Spatial variability of total K concentrations in paddy soils and Fe
concentrations in rice is probably controlled by soil texture. Silt particles were less
abundant in soils in the middle than those near the irrigation entrance (Table 10).
Hence, K leaching is probably higher in the middle than near the irrigation canal.
Also, silt particles possibly allow the leaching of Fe, limiting the nutrient’s
availability for uptake. Fullen and Brandsma (1995) found that mean silt content
decreased from 27.8% to 19.6% after soil erosion, and such change in soil texture
was accompanied by a decrease in K and Fe.
A significantly positive correlation for available P vs. plant K was found
because high P availability during submergence of paddy soils is probably coupled
with high amounts of K available for plant uptake. Nutrients, such as P and K,
become more available in paddy soils upon submergence (De Datta 1981) due to
their release from adsorption sites (Ponnamperuma 1972) or their presence in
irrigation water. Husnain et al. (2010) reported that irrigation water contains as
much as 7.2 mg L-1 K and contributed 93% of the total K input.
A significantly negative correlation for available P vs. plant Mn was found.
An increase in nutrient availability during submergence of paddy soils possibly
enhances the formation of Fe and Mn plaques on rice roots. These plaques limit the
uptake of Mn. Tavakkoli et al. (2011) also observed that silicon application can
decrease Mn contents of rice. Application of P (Haldar and Mandal 1981), lime,
nitrogen (N)-PK + lime, NPK, K (Alam et al. 2003), Ca or Mg (Ramani and
Kannan 1974) can also decrease the Mn concentration of rice.
Land Uses that affect Nutrient Levels
Urban area-adjacent sites had higher total soil Fe and Mn concentrations, and
higher plant K concentrations than the other sites (Tables 6 and 7). Deep-well and
rainfed sites were enriched with soil Ca and Mn. Highway-adjacent sites had
higher total soil Mn and plant S concentrations than the other sites.
Urban area-adjacent soils had higher total Fe and Mn concentrations because
these soils are probably being deposited with these nutrients from urban sources.
Iron and Mn are possibly carried by the contaminated run-off water, atmospheric
particles, and solid wastes that are mixed with the soils. Edori and Edori (2012)
suggested that the increased Fe concentrations in soils of machine shops can be due
to dumping of Fe scraps, unused body parts of vehicles, tin can, solvents, hydraulic
fluid and spent lubricants. Lytle et al. (1995) found that soil Mn concentrations in
high traffic areas were up to 100 fold higher than that recorded for lead.
The Sta. Rosa City b site was also irrigated with water containing urban
wastes. Total Fe level was higher in the soil collected near than that collected far
from the irrigation entrance (52.0% vs. 50.3 %). This higher level indicate that the
polluted irrigation water enriched the soil with Fe. Aydinalp et al. (2010) also
found that agricultural soils in a highly populated and industrialized area were
enriched with Fe due to long-term irrigation of water from a polluted river.
Urban area-adjacent sites had higher plant K concentrations because the soils
in these sites have neutral pH levels and clay textures. These soil properties
contribute to low amounts of K leached, and increased concentration of the nutrient
in plants.
Deep-well and rainfed paddy soils had higher total Ca levels because such
soils have high sand and silt contents. Significantly positive correlations for soil Ca
levels vs. sand and silt contents were observed (Table 4). Also, Ca leaching is
limited in these soils due to less irrigation intensity compared to other paddy soils.
Highway-adjacent sites had higher total soil Mn levels because they were
probably deposited with Mn oxides from vehicle exhausts. Lytle et al. (1995) also
found that soil Mn levels in high traffic areas were up to 100 fold higher than those
recorded for lead. Highway-adjacent sites had higher plant S concentrations because rice in
these sites probably absorb sulfur dioxide from vehicle emissions. Sulfur was
detected only in rice collected at 5 and 45 m from the nearby highway in the
Milaor site. Huseyinova et al. (2009) also noted that plants near highways (1417 –
3387 mg kg-1) were higher in S concentrations than plants far from highways (71 –
1111 mg kg-1).
TABLE 10. Comparison of soil properties in soils collected close, middle and far
from irrigation entrance (IE)1.
Distance from IE
N
Soil
pH
OM
%
Sand
%
Silt
%
Clay
%
Avail P
mg kg-1
close (0-2 m)
17
a
a
a
a
a
a
middle (40-42 m)
17
a
a
a
b
a
a
far (80-82 m)
17
a
a
a
ab
a
a
1pairwise
comparison using Sign test; same letters are not different at 5% significance level; different letters are different at 5%
significance level
Iron and Mn Levels of Irrigation Water from Two Mine-Adjacent Areas.
Iron concentration in irrigation water of the Zambales site was higher than the
Philippine, and Australia and New Zealand standards. Iron concentration in
irrigation water of the Sipalay City site was ten times higher than the Philippine
standard, and two times higher than the FAO and Saudi Arabia standards (Table
11). Manganese concentrations in the irrigation water of the two sites did not
exceed the standards.
TABLE 11. Comparison of mine-contaminated irrigation water (mg L-1) from
study sites with irrigation water standards.
Country/Organization
Fe
Mn
Philippines (Department of Agriculture, 2007)
1.00
0.200
FAO (Ayers and Westcot, 1994)
5.00
0.200
Saudi Arabia (USEPA and USAID, 1992)
5.00
0.200
Australia and New Zealand1
0.20
0.200
Sta. Cruz, Zambales
1.14
0.024
10.18
0.075
1Australian
and New Zealand Environment and Conservation Council, and Agriculture and Resource Management Council of
Australia and New Zealand (2000)
The Sipalay City site is adjacent to a Cu mining area. The elevated Fe
concentration in irrigation water of the site can be due to the seepage from the
mine tailing pond or old open pit. The river, as source of irrigation water, flows
along the length of the tailing pond. Moreover, the Zambales site is adjacent to a
Ni mining area. The elevated Fe concentration in irrigation water of the site can
also be due to seepage from the waste rock piles. Rainwater in these two sites
probably collects nutrients within the basin and carry them into the river. Copper
porphyry is present in the Sipalay City’s Maricalum Mining Corporation (Vigar et
al. 2011). Furthermore, Jopony and Tongkul (2009) found that seepage water in the
pit area of an abandoned Cu mine had elevated Fe concentration. Johnson et al.
(2000) also reported that the oxidation of sulfide minerals in an abandoned Ni–Cu
mine released up to 9.8 g L-1 of Fe.
High Fe concentration in irrigation water of the Zambales and Sipalay City
sites can result in elevated concentration of this nutrient in soils and rice. Abbas et
al. (2007) found that irrigating paddy soils with industrial effluents carrying
micronutrients will increase the concentrations of the same micronutrients.
Farm Management Practices as Source of Nutrients
Annual one-hectare input levels in study sites are presented in Table 12.
Results of correlations for the amounts or levels of farm inputs vs. total soil
nutrient levels are presented in Table 13. Amounts of farm inputs were not
significantly correlated with total soil nutrient levels. ____________________________________________________________________________________________________________
www.philscitech.org
TABLE 12. Annual one-hectare farm input levels in study sites.
Site
TABLE 12. continued
Puddling
operations
Granular
fertilizers
Foliar
fertilizers
Nitrogen in
granular
fertilizers
no.
bag
load
kg
Site
Phosphate in
granular
fertilizers
Potash in
granular
fertilizers
Foliar
pesticides
Solid
pesticides
kg
kg
load
kg
Cagayan Valley
Cagayan Valley
0.0
198.4
Solana, Cagayan
23.4
23.4
50.0
6.3
12.5
0.0
242.5
Cabatuan, Isabela
17.5
17.5
40.6
0.0
10.8
12.3
102.4
Echague, Isabela
73.9
43.1
33.8
1.5
8
24.2
0.0
236.3
133.4
116.7
10.0
4.0
Solana, Cagayan
8
11.1
Cabatuan, Isabela
12
Echague, Isabela
8
Central Luzon
Central Luzon
6
Muñoz City, N.E. b
9
17.0
0.0
165.5
Muñoz City, N.E. b
98.0
98.0
45.0
2.0
Talavera, N.E.
12
27.0
0.0
345.0
Talavera, N.E.
136.0
86.0
27.0
2.0
Llanera, N.E.
8
15.0
24.0
151.5
Llanera, N.E.
84.0
84.0
81.0
2.0
66.01
9.3
50.0
3.3
84.0
6.0
Zaragoza, N.E.
8
12.3
2.0
174.8
Zaragoza, N.E.
13
38.0
44.0
253.0
79.0
49.0
12
13.8
0.0
264.0
21.0
21.0
52.2
2.5
Jaen, N.E.
0
1,081.7
300.0
31.9
Jaen, N.E.
2.7
2.7
300.0
0.0
San Miguel, Bulacan
8
15.2
20.0
145.5
San Miguel, Bulacan
106.0
56.0
98.3
0.0
San Manuel, Tarlac
8
6.0
20.0
73.0
San Manuel, Tarlac
28.0
28.0
72.0
0.0
La Paz, Tarlac a
9
12.5
0.0
215.4
La Paz, Tarlac a
11.7
11.7
0.0
0.0
28.0
28.0
137.5
34.0
8
22.0
0.0
385.0
La Paz, Tarlac b
111
26.0
5.0
399.0
84.0
84.0
77.0
51.0
Sta. Cruz, Zambales
12
17.1
6.4
228.8
Sta. Cruz, Zambales
40.0
40.0
15.0
0.0
La Paz, Tarlac b
Laguna
Laguna
Sta. Rosa City a
0
0.0
0.0
0.0
Sta. Rosa City a
0.0
0.0
0.0
0.0
Sta. Rosa City b
9
21.4
0.0
482.0
Sta. Rosa City b
0.0
0.0
128.6
81.4
Bay
8
17.1
0.0
297.0
Bay
14.0
14.0
114.3
0.0
147.0
Sta. Cruz
13.2
13.2
23.8
1.2
Sta. Cruz
6
7.8
0.0
Bicol
Bicol
14
1.7
5.2
37.4
0.0
0.0
197.3
3.7
13
2.0
0.0
29.5
7.0
7.0
40.0
21.0
10
10.0
16.9
134.4
21.6
47.7
66.2
1.5
Polangui, Albay
14
13.3
0.0
258.4
Polangui, Albay
18.6
18.6
53.3
0.0
Casiguran, Sorsogon
13
4.3
0.0
52.0
Casiguran, Sorsogon
20.0
20.0
30.0
1.4
Visayas
Visayas
Sara, Iloilo
10
12.0
0.0
177.0
Sara, Iloilo
42.0
42.0
80.8
0.0
56.0
56.0
285.9
0.4
70.4
70.4
157.4
1.7
0.0
0.0
61.5
0.0
San Miguel, Iloilo
12
92.0
80
146.0
San Miguel, Iloilo
15
22.7
72
387.5
8
1.5
9.2
34.7
14
13.3
16.7
184.3
0.0
37.7
241.7
2.2
180.0
0.0
0.0
147.9
0.0
Mindanao
Mindanao
10
16.0
48.0
____________________________________________________________________________________________________________
www.philscitech.org
TABLE 13. Pearson correlation coefficients of nutrient levels in soils vs. amount
or levels of farm inputs.
Farm Inputs1
N
K
Ca
Fe
Mn
puddling operations, no.
32
0.19
0.26
0.04
0.15
granular fertilizers, bag
32
-0.00
0.04
0.11
0.31
foliar fertilizers, sprayer load
32
0.11
-0.02
0.01
0.20
32
0.08
0.28
0.14
0.09
phosphate in granular fertilizers, kg.
32
-0.24
-0.10
-0.04
-0.15
potash in granular fertilizers, kg.
32
-0.07
-0.10
-0.09
-0.18
foliar pesticides, sprayer load
32
0.26
0.01
-0.02
0.16
32
-0.04
0.14
0.11
0.21
solid pesticides,
kg.1
Results of correlation for the amounts of farm inputs vs. plant nutrient levels
are presented in Table 14. Significantly positive correlations were found for the
amounts of phosphate and potash applied vs. plant Fe levels. Loads of foliar
fertilizers applied had a significantly negative correlation with plant Fe levels.
Loads of foliar pesticides applied had a significantly positive correlation with plant
S levels, and a significantly negative correlation with plant Fe levels. Amounts of
solid pesticides applied had a significantly positive correlation with plant K levels.
TABLE 14. Pearson correlation coefficients of nutrient levels in plant tissues vs.
amount or levels of farm inputs.
7
seedlings, and causes poor crop stand and reduced yield (Cagauan and Joshi 2002).
Commercial molluscicide formulations, including metaldehyde pellets, resulted in
up to 69% golden apple snail mortality during the dry season and 90% during the
wet season (Dela Cruz and Joshi 2001).
CONCLUSION
Potassium concentrations of rice plants in La Paz (Tarlac) and Sta. Rosa City
(Laguna) exceed the toxic concentration of 3%. These K concentrations can be due
to the increase of the nutrient’s availability owing to the neutral soil pH levels in
the two sites. The Polangui (Albay), La Paz, and Villasis (Pangasinan) soils
contain the highest total Ca levels. These total Ca levels can be ascribed to the
occurrence of Ca in sand and silt-sized soil fractions.
Total Fe and Mn concentrations are very high in the Sta. Cruz (Zambales) soil
due to the input of mine wastes. The San Leonardo (Nueva Ecija) soil’s high total
Fe concentration is probably due to the occurrence of Fe in clay-sized soil
fractions. Iron and Mn levels of rice in most Central Luzon sites exceed the toxic
concentrations of 1000 mg kg-1 for Fe and 300 mg kg-1 for Mn. These
concentrations can be due to the high total soil Fe and Mn levels, and their
increased plant uptake due to periodic soil submergence and increased soil acidity
from continuous cropping. The study implies that K, Ca, Fe and Mn are enriched in
rice areas due to soil properties and farm practices.
ACKNOWLEDGEMENTS
The research is part of the senior author’s M.S. thesis, and was funded by the
Philippine Rice Research Institute, and the Department of Science and Technology
—Accelerated Science and Technology Human Resource Development Program.
Farm Inputs1
N
K
Ca
S
Fe
Mn
puddling operations, no.
30
0.21
-0.13
0.01
-0.04
0.05
30
0.17
0.14
-0.20
0.16
-0.03
foliar fertilizers, sprayer load
30
-0.01
0.13
-0.03
-0.27
0.00
30
0.31
0.06
-0.25
-0.08
0.00
phosphate in granular fertilizers, kg.
30
-0.00
0.21
-0.19
0.50** 0.32
CONTRIBUTIONS OF INDIVIDUAL AUTHORS
potash in granular fertilizers, kg.
30
0.12
0.23
-0.21
0.41*
foliar pesticides, sprayer load
30
0.12
-0.14
0.40* -0.41* -0.29
solid pesticides, kg.1
30
0.51** 0.08
Jehru C. Magahud, Rodrigo B. Badayos, Pearl B. Sanchez, and Pompe C. Sta.
Cruz conceptualized and designed the study, analyzed and interpreted the data, and
revised the manuscript for important intellectual content. Jehru C. Magahud
collected the data and drafted the manuscript.
-0.04
-0.13
0.19
-0.26
CONFLICT OF INTEREST
There are no conflicts of interest arising from this study.
*correlated at 5% significance level; ** correlated at 1% significance level; 1solid pesticides=pellet, powder or granular pesticides
Fertilizers. The significantly positive correlation for the amounts of phosphate
and potash applied vs. plant Fe levels can be due to the enhanced soil availability
and plant uptake of Fe owing to the strong soil acidity from continuous high-yield
cropping. The Central Luzon sites are the ones applied with the highest amounts of
P and K fertilizers (Table 12). These sites also produce the highest rice yields, and
their rice plants had the highest Fe concentrations (Table 3). Significantly negative
correlations were found for soil pH vs. amounts of phosphate and potash applied.
These indicate that higher amounts of phosphate and potash applied are associated
to strongly acidic soil pH. Through their long-term field experiment, Belay et al.
(2002) also found that basic cation contents and soil pH levels declined more in
NPK treatments with significantly higher yield than single fertilizer treatments.
Rice roots release H+ to balance cation-anion intake or maintain electrical
neutrality across the root-soil interface. Modern irrigated rice varieties remove 3.0
kg K, 4.0 kg Ca, and 3.5 kg magnesium in a ton of grain yield (Dobermann and
Fairhurst 2000).
Pesticides. A significantly positive correlation for the amounts of foliar
pesticides vs. plant S levels was found. Sulfur, a component of foliar pesticides’
active ingredients (AI) used in the sites studied, can be absorbed by the leaves of
rice. Sulfur-containing AIs were also found in plants and plant products applied
with foliar pesticides containing the same AIs. Such AIs are chlorpyrifos (Lu
2011), thiamethoxam (Liu et al. 2009) and mancozeb (Patsakos et al. 1992).
A significantly negative correlation for the amounts of foliar pesticides vs.
plant Fe levels was observed because pesticide applications possibly stress the rice
plants, and cause the production of phenols and decrease the Fe concentration in
rice. Saladin and Clement (2005), and Siddiqui and Ahmed (2006) showed the
depressing effects (reduced growth and dry matter accumulation) of foliar
pesticides by the increased production of phenolic compounds in plants. Frossard
et al. (2000) mentioned that phenolic compounds inhibit Fe absorption. Phenols
also reduce and release ferritin Fe, a multi-subunit protein in higher plants (Boyer
et al. 1990).
A significantly positive correlation for the amounts of solid pesticides vs.
plant K concentrations was found. Solid pesticides, as they effectively control
pests, can increase the growth and biomass accumulation of rice. Carbofuran and
metaldehyde are the most common solid pesticides used in the study sites.
Accordingly, an increase in growth and biomass of rice in the sites studied can be
due to the effective control of insect pests by carbofuran granules and the effective
control of golden apple snails by metaldehyde pellets. The increase in growth and
biomass probably leads to the efficient uptake of K. Carbofuran can effectively
control certain rice insect pests (Ukwungwu 1987), and can increase rice growth
and yield (Xiao et al. 1995). Furthermore, snail infestation damages young rice
REFERENCES
Abbas ST, Sarfraz M, Mehdi SM, Hassan G, Obaid-Ur-Rehman. Trace elements
accumulation in soil and rice plants irrigated with the contaminated water.
Soil Tillage Res 2007; 94(2):503-509.
Alam S, Kamei S, Kawai S. Amelioration of manganese toxicity in young rice
seedlings with potassium. J Plant Nutr 2003; 26(6):1301-1314.
Alam SM, Naqvi SSM, Ansari R. Impact of Soil pH on Nutrient Uptake by Crop
Plants. In: Handbook of Plant and Crop Stress. 2nd ed. CRC Press, 1999:
51-60.
[ANZECC and ARMCANZ] Australian and New Zealand Environment and
Conservation Council, and Agriculture and Resource Management Council of
Australia and New Zealand. Australian and New Zealand Guidelines for
Fresh and Marine Water Quality. vol 1, The Guidelines. Australian Water
Association, or NZ Water and Wastes Association, 2000: 314 p.
Aydinalp C, Fuleky G, Tolner L. The comparison study of some selected heavy
metals in the irrigated and non-irrigated agricultural soils. Bulg J Agric Sci
2010; 16(6):754-768.
Ayers RS, Westcot DW. Water Quality for Agriculture. FAO Irrigation and
Drainage Paper ver 29 rev 1. Food and Agriculture Organization of the United
Nations, 1994. Retrieved August 29, 2013 from the World Wide Web: http://
fao.org
Belay A, Claassens A, Wehner F. Effect of direct nitrogen and potassium and
residual phosphorus fertilizers on soil chemical properties, microbial
components and maize yield under long-term crop rotation. Biol Fertil Soils
2002; 35(6):420-427.
Boyer RF, McArthur JS, Cary TM. Plant phenolics as reductants for ferritin iron
release. Phytochemistry 1990; 29(12):3717-3719.
Cagauan AG, Joshi RC. Golden apple snail Pomacea spp. in the Philippines.
Presented at the 7th ICMAM Special Working Group on Golden Apple Snail,
22 October, 2002.
Chen JH, Barber SA. Soil pH and phosphorus and potassium uptake by maize
evaluated with an uptake model. Soil Sci Soc Am J 1990; 54(4):1032-1036.
De Datta SK. Principles and Practices of Rice Production. John Wiley & Sons,
Inc., 1981: 618 p.
Dela Cruz MS, Joshi RC. Efficacy of commercial molluscicide formulations
against the golden apple snail Pomacea canaliculata Lamarck. Philipp Agric
Sci 2001; 84(1):51-55.
Department of Agriculture. Guidelines on the procedures and technical
requirements for the issuance of a certification allowing the safe re-use of
wastewater for purposes of irrigation and other uses. BSWM technical
publication no. 2. Department of Agriculture, Office of the Secretary, 2007:
56 p. ____________________________________________________________________________________________________________
www.philscitech.org
Dobermann A, Fairhurst TH. 2000. 1st ed. Rice: Nutrient Disorders and Nutrient
Management. Potash and Phosphate Institute, 2000: 191 p.
Domingo LE, Kyuma K. Trace elements in tropical Asian paddy soils. Soil Sci
Plant Nutr 1983; 29(4):439-452.
Edori OS, Edori ES. Effect of automechanic works on lead and iron content in two
mechanic villages in Port Harcourt, Rivers State Nigeria. Journal of Applied
Sciences and Environmental Management 2012; 16(4):317-321.
Frossard E, Bucher M, Machler F, Mozafar A, Hurrell R. Potential for increasing
the content and bioavailability of Fe, Zn and Ca in plants for human nutrition.
J Sci Food Agric 2000; 80(7):861-879.
Fullen MA, Brandsma RT. Property changes by erosion of loamy sand soils in east
Shropshire, UK. Soil Technology 1995; 8(1):1-15.
Haldar M, Mandal LN. Effect of phosphorus and zinc on the growth and
phosphorus, zinc, copper, iron and manganese nutrition of rice. Plant Soil
1981; 59(3):415-425.
Huseyinova R, Kutbay HG, Býlgýn A, Kiliç D. Sulphur and some heavy metal
contents in foliage of Corylus avellana and some roadside native plants in
Ordu Province, Turkey. Ekoloji 2009; 18(70):10-16.
Husnain H, Masunaga T, Wakatsuki T. Field assessment of nutrient balance under
intensive rice-farming systems, and its effects on the sustainability of rice
production in Java Island, Indonesia. Journal of Agricultural, Food and
Environmental Sciences 2010; 4(1):1-11.
Johnson RH, Blowes DW, Robertson WD, Jambor JL. The hydrogeochemistry of
the Nickel Rim mine tailings impoundment, Sudbury, Ontario. J Contam
Hydrol 2000; 41(1-2):49-80.
Jopony M, Tongkul F. Acid mine drainages at Mamut Copper Mine, Sabah,
Malaysia. Borneo Science 2009; 24:83-94. Retrieved August 29, 2013 from
the World Wide Web: http://borneoscience.ums.edu.my.
Kabata-Pendias A, Pendias H. Trace Elements in Soils and Plants. 3rd ed. CRC
Press, Boca Raton, 2001: 413 p.
Kahlon UZ, Murtaza G, Murtaza B, Hussain A. Differential response of soil
texture for leaching of salts receiving different pore volumes of water in
saline-sodic soil column. Pak J Agri Sci 2013; 50(2):191-198.
Kawaguchi K, Kyuma K. Paddy soils in tropical Asia. Part 2. Description of
Material Characteristics. Southeast Asian Studies 1974; 12(2):177-192.
Kitagishi K, Yamane I (editors). Heavy Metal Pollution in Soils of Japan. Japan
Scientific Societies Press, 1981: 302 p.
Liu B, Guo DL, Mao JS, Zhao SC, Wang YT. Residue detection and degradation of
thiamethoxam in spinach. Agrochemicals 2009; 9. Retrieved September 25,
2013 from the World Wide Web: http://en.cnki.com.cn
Lu JL. Insecticide residues in eggplant fruits, soil, and water in the largest
eggplant-producing area in the Philippines. Water Air Soil Pollut 2011;
220(1-4):413-422.
Lytle CM, Smith BN, McKinnon CZ. Manganese accumulation along Utah
roadways: a possible indication of motor vehicle exhaust pollution. Sci Total
Environ 1995; 162(2-3):105-109.
Nguyen V.D., D.V. Tran, Nguyen T.L. 2006. Impact of upstream soil nutrient losses
on soil fertility in paddy fields, pp. 167-178. In: Proceedings of Sustainable
Sloping Lands and Watershed Management International Conference, Luang
Prabang, Lao PDR, 12-15 December 2006. National Agriculture and Forestry
Research Institute, Vientiane, Lao PDR.
Marschner H. 2012. Marschner's Mineral Nutrition of Higher Plants. Marschner P.
(Ed.). Academic Press.
Mitsios IK, Golia EE, Tsadillas CD. Heavy metals concentrations in soils and
irrigation waters in Thessaly Region, Central Greece. Commun Soil Sci Plant
Anal 2005; 36(4-6):487-501.
8
Miura K., Badayos RB, Briones AM. Pedological Characterization of Lowland
Areas in the Philippines. Department of Soil Science, College of Agriculture,
University of the Philippines Los Baños, 1995: 282 p.
Patrick WH Jr., Mahapatra IC. Transformation and Availability to Rice of Nitrogen
and Phosphorus in Waterlogged Soils. In: Advances in Agronomy, volume 20.
Academic Press Inc., 1968:323-359.
Patsakos PG, Liapis K, Miliadis GE, Zafiriou K. Mancozeb residues on field
sprayed apricots. Bull. Environ. Contam Toxicol 1992; 48(5):756-761.
PCAARRD. Philippine Council for Agriculture and Resources Research. 1980.
Standards Methods for Analysis for Soil, Plant Tissue, Water and Fertilizer.
Farm Resources and Systems Research Division, PCAARRD, Laguna,
Philippines. 194 p.
Ponnamperuma FN. The chemistry of submerged soils. In: Advances in Agronomy,
volume 24. Academic Press Inc., 1972:29-96.
Ramani S, Kannan S. Effects of certain cations on manganese absorption by
excised rice roots. Commun Soil Sci Plant Anal 1974; 5(5)427-436.
Rengasamy P, Oades JM. Interaction of monomeric and polymeric species of metal
ions with clay surfaces. II. Changes in surface properties of clays after
addition of iron (III). Aust J of Soil Res 1977; 15(3):235-242.
Saladin G, Clement C. 2005. Physiological side effects of pesticides on non-target
plants. In: Agriculture and Soil Pollution: New Research (pp. 53-86). Nova
Science Publishers, Inc. New York.
Sharma PK, De Datta SK. Puddling influence on soil, rice development, and yield.
Soil Sci Soc Am J 1984; 49(6):1451-1457.
Siddiqui ZH, Ahmed S. 2006. Combined effects of pesticide on growth and
nutritive composition of soybean plants. Pak. J. Bot., 38(3):721-733.
Tavakkoli E, English P, Guppy C. Interaction of silicon and phosphorus mitigate
manganese toxicity in rice in a highly weathered soil. Commun Soil Sci Plant
Anal 2011; 42(5):503-513.
Tunesi S, Poggi V, Gessa C. Phosphate adsorption and precipitation in calcareous
soils: the role of calcium ions in solution and carbonate minerals. Nutri Cycl
Agroecosyst 1999; 53(3):219-227.
Ukwungwu MN. Some effect of plant densities and carbofuran on the damage by
Diopsis thoracia West, and Maliarpha separatella Rag. and yield of rice in
Nigeria. Int J of Pest Manag 1987; 33(4):280-282.
[USEPA and USAID] U.S. Environmental Protection Agency and U.S Agency for
International Development. Water reuse outside the U.S. In: Guidelines for
Water Reuse. 1992:241-286. Retrieved August 29, 2013 from http://
www.iwmi.cgiar.org
Van der Weijden CH. Cahiers of Geochemistry Weathering I: Processes.
Department of Geosciences–Geochemistry, Utrecht University, The
Netherlands. 2007: 56 p.
Vigar AJ, Motton NT, Taylor I. Competent Person’s Report on the Basay Copper
Project, Negros Oriental Province, Philippines. Mining Associates Limited,
2011: 84 p.
Xiao H, Fan Z, Cheng D, Wu G. Effects of carbofuran on the growth and
physiological processes of rice seedling. Journal of Fujian Teachers
University (Natural Science) 1995; 2. Retrieved June 28, 2014 from the World
Wide Web: http://en.cnki.com.cn
Zeng F, Ali S, Zhang H, Ouyang Y, Qiu B, Wu F, Zhang G. The influence of pH
and organic matter content in paddy soil on heavy metal availability and their
uptake by rice plants. Environ Pollut 2011; 159(1):84-91.
Zhang ZW, Zhu ZX, Fu WL, Wen ZL. Morphology of soil iron oxides and its
correlation with soil-forming process and forming conditions in a karst
mountain. Environmental Science 2012; 6):042. ____________________________________________________________________________________________________________
www.philscitech.org
9
COMMENTARY
The “Land for Skills” Program:
A Mechanism for Conserving
Research and Human Resources in
a Developing Country in the Era of
Globalization
Teodoro Tigno Jr., M.D.
The author, Teodoro Tigno Jr., M.D., is a Senior Research Scientist on
Neurosurgery Service in the Department of Surgery at Walter Reed National
Military Medical Center, Henry Jackson Foundation, Bethesda MD, USA.
Email: [email protected]
The problem of developing countries in transitioning their emerging economies into the relative stability of
fully developed ones has never been more closely reflected during the era of Globalization, than in the
crucial factor of conserving human resources for their own development. In this working paper, the author
analyzes the bases of this predicament for developing countries in general and proposes a pathway for
sustaining Research and Development (R&D) manpower in a pilot project in the Philippines. BACKGROUND
Since the dawn of agriculture and domestication that transformed the Fertile
Crescent and other regions into early economic empires, Land has been accepted
as an unquestioned economic resource more enduring and therefore more valuable
than the human resource which transformed the land.
In fact, the wars that ensued among these empires and later colonial powers
displayed a denigration of the human resource value as it employed slavery,
conscripted armies and sacrificed human lives in pursuit of territories where
geographical maps had to be constantly redrawn. With the advent of the First
Industrial Revolution1, touted as an upgrade from the practice of slavery, as
common land or arable farming in open fields became regulated, the dissolution of
the monasteries led to Enclosure farming where lands were fenced (enclosed) and
deeded or titled to individual owners2. Land then became the default vehicle by
which landed classes were created and the majority non-landed classes became the
receptive participants not only of an emerging market of the Manufacturing Age
but as military manpower for the conquest of more lands. In a sense, Man became
a secondary enabler for Land, the principal goal in wealth creation of that era or
Man in the service of Land.
The Digital Age of Information Technology (IT) which came at the heels of
the Second Industrial Revolution3 however, not only transformed the conduct of
economic enterprises across territories or countries on a global scale, but also
instilled the existence of a cyber- “territory” other than Land that competed for its
value and spurred the awareness that its conquest entailed an influence on the
human resource which controlled it. It was a different landscape altogether where
cyberspheric links superseded geographical location in the creation of wealth. In
the arena of competing forces, with all variables being equal, it could even be
argued that the possessor of technology or fruits of information technology could
very well defeat the possessor of a geographical entity, no matter how wellendowed in natural resources the land is. This we see in the current US
developments on capturing gas from shale rock by fractional distillation (fracking)
versus its former state of dependence on Organization of Oil-Producing
Countries(OPEC) states for energy. In effect, IT was challenging the traditional
paradigm that placed the primacy of Land over Labor as an economic asset. To put
it more directly, the value of human capital versus Land is once again revisited in a
bottomline question: which now has the more enduring value, Land or Labor? In
applying this basic question to the economic goals of a developing country, what is
the relation of Land to Labor in this Era of Globalization?
As a former Balik-Scientist awardee (1984) who together with fellow
awardees Drs. Ben Pecson, Ruben Umali and Roberto Ingles, underwent the
frustrating experience of establishing an early Research and Development (R&D)
infrastructure component for the Philippines through the Society of Balik-Scientist
Awardees, Inc4., I posed the question to a Filipino-Chinese businessman who was
affiliated to some of the successful business ventures in the Philippines asking him:
If he could choose only one of two projects to invest on in the Philippines, Land or
Labor, which would he choose? After much thought, the very revealing answer –
Land – confirmed the cautionary Pre-Digital Age mindset prevailing in the
Philippine business sector, a potential ally in nurturing and maintaining R&D
human resources in the Philippines.
I came to understand with later developments that this mindset was part of a
host of socio-economic confounders brought in by advent of Globalization itself. ____________________________________________________________________________________________________________
www.philscitech.org
GLOBALIZATION CONFOUNDERS IN THE ECONOMIC
DEVELOPMENT OF A DEVELOPING COUNTRY
There are both active and passive factors in wealth creation . Goods and
services, being created from direct efforts of an individual are clearly the active
generators of wealth while Property, as represented mainly by Land identifies as
the passive factor. Then4 as now, the value of Land is not only subject to the
market forces of supply and demand but also reflect an under-appreciation of the
role Land plays in furthering man’s development. One only had to note the
observation that John Locke5 made during his time that most of the landed gentry
lived beyond their estates and ended up selling their land at rock bottom prices to
pay their debts- to understand that man can undervalue or over-value Land. Taxes
are supposed to serve as a fair estimate of the value of these factors of wealth
creation, to include a fair estimate of the value of Land, but early economists6,
stemming from the belief that men should own what he creates and that by itself,
ownership of land which belongs to Nature only increases speculation and nonproductivity, advocated that Land and not income should be the sole form of
taxation to help generate wealth7. Speculation is applied to these estimates of
wealth creation when enhancements to these factors (in wealth creation) are
implemented for a given period of time. Enhancements are non-essential additives
given to goods, services or properties which do not affect its basic function but add
in the estimation of its cost, as exemplified by packaging, advertisements and
delivery costs. With Land, the basic nature of its productivity or non-productivity,
enabled by human effort, already attaches its basic value. Enhancements to Land
value are determined when the aspects of Location, Accessibility to Water, Power
and Transportation and of course the land’s natural resources are factored in. In the
Digital Age, enhancements for Land is taken a step further in the form of
forecasting of a locality’s strategic value in say, 5 years akin to futures trading of
agricultural crops. This is where hairs split between determining the boundaries of
how reliably reflective or how artificial an IT-created enhancement to Land is to
the actual value of Land.
In the Digital world, the rate at which IT-created enhancements are
implemented can be increased within a compressed period of time causing an
efficient rise in the market value of goods and services and a consequent global
concentration of capital. Instead of using the capital to generate more goods and
services and provide jobs in the pre-crash period of 2008, this efficiency instead
prompted increased speculations which funneled investment funds for short-term
capital gains. For Land, this increased speculation led as well to the search for
capital gains where real estates were repackaged as IT-created Commodity
Derivatives and sold and resold through investment institutions to include lending
banks which later led to the housing bubble and the economic crash of 2008. The
fruits of a digital world did increase global wealth as surplus capital, but because
what was being subsequently pursued as a wealth-multiplier was a digital construct
without serious concerns on its validation to the actual basic goods, services and/or
properties, the result was an over-evaluation of both and the ever-rising debt
needed to service them which rose further with every reselling and repackaging.
Due to the extent of multinational connections of these lending institutions,
defaulting of their debt servicing created a ripple effect on the global economy
causing a stagnation of real and lower middle incomes worldwide and a depressed
demand for goods and services. As a result growth for the most dynamic markets
as the US and Europe has slowed and Japan has remained in a slump for years
showing a slow recovery as of late.
“In the 1990s, modern communications and the world-wide opening of capital markets
have given an enormous impetus to this inflow. In just three years, from 1990 to 1993, the
amount of internationally mobile capital almost tripled to $3 trillion. Most of these funds
can be poured into or withdrawn from a market with a few keystrokes on a computer.
Rather than being invested in productive activities that generate jobs, it circulates through
the international financial circuit in search of capital gains. In other words, it is used for
speculation” 9.
“…budget cuts and a growing debt load have reduced the demand for goods and services
by the state. Up to now, the decline in purchasing power has been masked by deficit
financing. However, the end of this strategy is coming in sight: both governments and
consumers are more indebted than ever before. Both are attempting to lower their debt.
There is now a virtual consensus in Washington that the budget must be balanced; in
Europe, the monetary union projected since 1999 forces all countries but tiny Luxembourg
to cut their deficits.”9.
During the troubled period however, the Philippine economy relatively
sheltered from capital gains involvement and focused on basic housekeeping (anticorruption campaigns, etc) seem to have fared well as shown by its resiliency to
the effects of global trade based on comparative metrics with the developed
economies.
COUNTRY
Philippines
USA
Germany
Japan
ANNUAL GROSS DOMESTIC PRODUCT GROWTH %
2008
2009
2010
4.153
1.148
7.632
(-0.3 %)
(-3.1%)
1.0%
(-4.69%)
(-5.5%)
1.6%
2012
2013
3.6%
6.8%
7.2%
1.8%
2.8%
1.9%
4.0%
3.1%
0.7%
0.4%
4.7%
(-0.6%)
2.9%
2011
Sources: World Bank, Bureau of Economic Analysis, CIA World FactBook
2.0%
1.2%
10
So in summary, the prevailing business mindset in the Philippines reflects the
cautionary mood of the global economy where despite a surplus global capital
which normally would spell employment and investments at full throttle, there is
instead inhibition of employment and depression for consumer demand due to the
debt servicing incurred which is still being addressed. Despite a resilient
performance of the Philippine economy which buffered itself from a downturn
period in the global economy, its business sector, following the global economic
mindset, is still not a ready and reliable ally in initiating a sustainable R&D
strategy for the Philippines.
THE ROLE OF GOVERNMENT AND ITS OVERSEAS HUMAN
RESOURCE IN THE PHILIPPINE ECONOMY
Traditionally, the Philippine government has been a passive regular recipient
of hard-earned higher valued non-Philippine currencies from the skilled labor it
exports to the Middle East and Southeast Asia, as well as from the Philippine
diaspora of technical and scientific skilled workers who poured into other
developed countries to the benefit of their host countries during its Martial Law
and immediate post-Martial Law period. Although recognizing the value of its
human resource, the Philippine government also carried the burden of having to
lose the skilled labor it needed to sustain its growth. Among its skilled labor,
medical and non-medical scientists and engineers hold a crucial place in its R&D
development strategy. It is basically because the Philippine infrastructure has not
developed to the level that it could nurture this skilled human resource that it could
not retain it, to the detriment of its further development. The previous BalikScientist programs have been laudable in this respect but a quick review of the
outcome of its efforts started since the inception of the program will show that it is
not enough for the government to sponsor an overseas scientist for a year or two.
The ongoing arrangements of the overseas scientist linking up with the Philippinebased scientist is commendable as well but the attraction of a developed
infrastructure friendly to further scientific growth as is found in developed
countries will always be a motivating factor in attracting these scientists to invest
their skills elsewhere other than the Philippines. If the goal is sustainability of
economic growth and eventual breakthrough as an emerging developed economy,
then the retention of R&D manpower is crucial. If we think of sound research and
development proposals or programs, these are long-term commitments evaluated
on a five-yearly basis. This will entail nurturing a homegrown community of R&D
manpower for the long-term. So how will the Philippine government build this
R&D-friendly infrastructure to be competitive with the attraction of existing
scientist-friendly infrastructures in developed countries already beckoning for their
migration? Will the overseas scientist workforce be able to effectively counter this
skilled manpower drain by ‘mentoring’ Philippine-based scientists alone? Certainly
remote supervision can only go so far. The Philippines will need a homegrown
skilled workforce on its ground and the solution will involve ensuring that this
workforce stay for the long-term to be able to implement the R&D development
programs they started out with. Yet with the unreliability of capital from a cautious
business community to invest in an R&D-friendly infrastructure, the burden for
now seems to fall mainly on the Philippine government which needs the same
capital to maintain the over-all economic growth it has attained. How do we now
break this chicken-and-egg situation involving Government, Capital, Land and
Labor?
THE “LAND FOR SKILLS” PROGRAM: WHAT AND HOW
What It is:
The “Land For Skills” Program (LFSP) is a Research and Development
strategy to be applied by a developing country to spur its economic development to
the level comparable to that of a developed country by defining for its crucial R&D
sector a pathway for landownership which is consistent with the R&D worker’s
contribution to national economic progress. The author’s background as a former
returning scientist and his familiarity with the Philippine condition contributes to
the applicability of this program as a pilot project in the Philippines .
It is accepted that a developing country has meager resources which explains
its reliance on outside sources for the capital it will need for growth. Capital from
its natural resources coming from its reliable asset, Land, has had setbacks of
plunder and exploitation from its colonial and autocratic past, but it still remains,
largely unused because of lack of investment capital, and speculated on by real
estate developers, who ironically block these lands for any use other than
speculation. There is no existing national R&D strategy nor perspective attached to
real estate development in the Philippines. If at all, it would be by way of
additional real estate taxes that would fill government coffers but would this alone
lead to sustaining an active R&D community in the Philippines? This link of Land
to Labor and to subsequent national development does not exist as an actionable
policy because the primacy of the human resource over Land has still not been
accepted even if multiple examples of it can be given.
Let us take as a primary example the yield of a common agricultural crop
from the Land in the Philippines – coconuts. The Philippines' coconut exports
averaged $1.5 billion annually in the past five years. World-wide, the Southeast
Asian country ranks second only behind Indonesia in terms of total coconuts
produced, according to the United Nations.
Even with the loss of an estimated 15 million trees in typhoon Haiyan’s path
in the more than 41,660 hectares affected in six provinces with total damage of $38
million as estimated by its government—the Philippines will still remain a huge
player in the global market, with more than 300 million coconut trees remaining.
But what about the skilled human resource researching on the downstream ____________________________________________________________________________________________________________
www.philscitech.org
11
8,000 acres in Stanford University. The more revealing aspect was the context
in which this historical note was presented.
“About 60 years ago, Stanford University had some financial problems. The
authorities of university tried to resolve these problems by leasing part of the
university land to high-tech companies for 99 years.”
“In the 1950's, the idea of building an industrial park arose. The university had plenty
of land over 8,000 acres....but money was needed to finance the University's rapid
postwar growth. The original bequest of his farm by Leland Stanford prohibited the
sale of this land, but there was nothing to prevent its being leased. It turned out that
long-term leases were just as attractive to industry as out right ownership; thus, the
Stanford Industrial Park was founded. The goal was to create a center of high
technology close to a cooperative university17.”
coconut-generated products in the field of medicine, engineering and agriculture?
Could not for example, research and development on the beneficial health effects
of coconut oil be pursued further than what had already been arduously done by
Filipino and other pioneering scientists in the field10, 11, 12, 13, 14 ? The economic
benefit to be derived by investing on an R&D team pursuing work on this field
alone would be exponential. It is after all, the human resource which is the
wealth-multiplier and not the Land. In pursuit of retaining skilled human resource
to sustain R&D development, it is Land which can now be used to sustain a
science and technology community in the Philippines turning the paradigm back
into Land in the service of Man. It is so for the following reasons:
(1) Land means geographical commitment. As a motivator for the overseas
skilled human resource , a salary, financial and tax incentives can only go so
far as the capital provided for it will go. Land as an incentive remains and
when linked to the skilled human resource, will commit the skilled labor to
focus on development affecting the geographical entity surrounding the Land
he has been made responsible for as a Lessee for 25 years or as its final
owner- whether that entity be the province, the region or the country. There
may be other compensatory incentives linked to the award but such as
livelihood, a stipend or consulting fees but land will remain as the main
motivator in ensuring that the R&D worker remains committed to
implementing and completing a development project in the Philippines.
(2) The role of Land in sustaining R&D development for a cash-strapped
developing country complements its need to retain skilled manpower. In the
Philippine colonial period, enconmienda classes were created by decrees
awarding feudal lords vast tracts of land without assurances of development
from those awarded but as part of a primordial system of taxation of the
Spanish empire. In the Digital Age, strengthening the link of Land to its
needed skilled human resource would address its development needs without
heavy reliance on outside capital which may have to encumber on the
economy as later payment of loans.
(3) The ‘incubator’ concept for R&D growth is geographical. The successful
examples of Silicon Valley and even the Research Triangle area of North
Carolina are R&D communities living in a defined geographical space or
Land. There are other less known examples in Japan (RIKEN), Germany and
the (Brazil, Russia, India and China) BRIC emerging economies.
True, the companies who pioneered at Silicon Valley did have venture capital
but they were not yet the tech giants the world now recognize them to be. They
were initially middle-sized companies and many were startups. The combination
that actually worked was an entrepreneur-scientist–friendly environment and space
to implement R&D work. Does this automatically mean a university from the
start? Not necessarily. Although a change agent by itself, universities tend to
follow in areas after development has taken place. Here we distinguish between a
pioneer area where development has set in and a frontier area where only scarce
development has taken place. An example of a pioneer area would be the Clark
Green City at the Clark Special Economic Zone in Pampanga where an industrial
park with its attendant university (UP) is to be built. A frontier area as exemplified
by Palawan province at the southwest regional area in which an R&D-friendly
infrastructure has yet to be built. Although universities are the ideal institutions to
carry out R&D work in developed pioneer areas, it is difficult for universities to
venture into frontier areas where the student population is not yet viable. Business
companies however, have to a large extent managed to integrate this capability of
R&D work into their own infrastructure and what attracts them to a particular
geographical area is land availability, the existing tax rates and the existence of
basic infrastructure (light, water, housing and nowadays, health, security concerns
and internet capability). Through a government-sponsored LFS Program, these
companies with venture capital may be attracted to initiate R&D with locally-based
skilled manpower in a frontier area ..and move development forward. If this
momentum is sustained with more companies, it may reach a later level of
development attractive to universities where an industrial park can now emerge
and be sustained.
The Philippines, however, cannot remain Manila-centric in its pattern of
development forever. Today, there are enclaves of rising communities which offer
housing facilities and other amenities for Filipino engineers built in pioneering
areas of neighboring Indonesia to spur their growth. To survive regionally, we can
do no less than invest in our own. Instead of having idle lands for real estate
speculation, these lands will serve as the very capital needed to attract skilled
manpower to spur growth. In the LFS Program, the government, not individuals,
initially takes the burden of this startup venture capital by providing the Land,
lease to own for 25 years to deserving Filipino skilled manpower.
HOW TO IMPLEMENT THE ‘LAND FOR SKILLS ‘ PROGRAM (LFSP)
The guiding principles in implementing the LFSP are Accountability,
Reliability and Goal-Orientation. In the Philippine model, each principle can be
translated and implemented in relation to its national, provincial and awardee
levels:
1) Accountability: A mechanism for accountability in the implementation of
the LFSP will be defined on the national, provincial and the awardee
level. The proportion of disciplines among the awardees will be
determined by the geographical area on which a LFSP pilot area will be
implemented as well as the economic priorities of the provincial and
national economic planners.
a)
On the national level, the LFSP will be the responsibility of the
National Economic and Development Authority (NEDA) as the lead
government agency working with the Land Management Bureau
under the Department of Environment and Natural Resources
(DENR) and the Dept. of Science and Technology (DOST). The
metrics upon which the LFSP will be evaluated will be determined
by NEDA sourcing data regarding the awardee performance and
land utilization from DOST and Land Management Bureau
(DENR), respectively and the rendering of periodical executive
reports as to its national economic impact to the Office of the
President. Land taxation may be frozen to its pre-LFSP levels but
its reimposition should be resolved by a concensus statement from
NEDA, DOST and the Land Management Bureau (DENR)
b)
On the Provincial level. Administrative boundaries are already
defined in the 26 provinces of the Philippine archipelago. Although
the top executive provincial post belongs to the Provincial
Governor, the Governor’s office has historically been shown to be
vulnerable to changing political climate affecting the sustainability
of long-term programs such as that of the LFSP. Strategically, the
burden of implementing LFSP on the provincial level will be with
the Vice Governor’s office working with the Governor’s office.
Traditionally, the Governor has been mainly concerned with shortterm political activities and the upcoming provincial elections while
the office of the Vice-Governor has been largely underutilized, if at
all. Expecting no immediate change in this political culture, the
long-term LFSP program has better chances of surviving from
provincial governor to provincial governor when placed under the
Vice-Governor’s office when the arrangement with the Governor is (4) Earlier defined uses of Public Lands will lessen its non-productive use . Upon
the inception of the American period, public lands were estimated to be 83.5%
of the archipelago’s land area15. The Land Management Bureau under the
Philippine Department of Environment and Natural Resources (DENR) lists
the unused land for public domain ( in land area) distributed throughout the
periods since then.
Period
Public Lands Distributed
1930-1940
93,694 patents with 289 for judicial titling
1950-1960
1.4 million hectares
1970-1980
>2 million hectares
1990-2000
1.32 million hectares
Of the Philippine total land area estimated at 30 million hectares
estimated by the DENR16, 15.05 hectares or 50% are classified forestland,
with unclassified forestland spanning 0.755 million hectares or 3%. The
remaining 47% or 14.9 million hectares are alienable and disposable (A &D)
lands. In trying to estimate the area needed for the historical model of an
R&D community (Silicon Valley), our web search turned out to have elusive
results due to the continuing expanding growth of the area, so we focused on
the original acreage Silicon Valley started out with which was registered as
____________________________________________________________________________________________________________
www.philscitech.org
c)
that he is to take political credit when the LFSP succeeds in his
province.
c)
On the Awardee level. The LFSP will be reserved for top Filipino
graduates in Science, Technology, Literature, Music and Arts
during the period of the program implementation. The awardee will
be Filipino citizens and should consent to a legal contract with the
Philippine government for non-transferrable lease-to-own rights to
habitable property within the pilot project area of the LFSP for a
period of 25 years in which the awardee will agree:
i)
ii)
iii)
iv)
v)
vi)
vii)
viii)
ix)
x)
xi)
xii)
that the awardee’s primary residence will be within the LFSP
pilot implementing area for the duration of his property
contract, to be confirmed by a NEDA-DOST-DENR
verification system related to his work project within the pilot
implementing area.
that his work project be evaluated by the DOST and NEDA as
to its feasibility, safety and provincial and national economic
impact on a yearly and 5-yearly basis.
that if on the 10th year of his project’s evaluation, his/her
project’s has been evaluated as being favorable for an
extension, the comparative lease value of the land will be
considered half-paid.
that if on the 15th year of his evaluation, his/her project has
been given a favorable evaluation for extension or market
implementation, the comparative lease value of the land will
be considered 3/4ths paid.
that if on or before the 25th year of his/her project, a
manufacturing business entity had resulted whose NEDA,
DOST and Phil. Chamber of Commerce (PCC) evaluations
had deemed the project favorable for success, the comparative
lease value of the land will be considered fully paid and the
necessary deed and title to the land be given to the awardee.
as a full land owner on or before the 25th year of his project
evaluation, the awardee will be granted permanent resident
status of the R&D community in the Philippines and will be
entitled to join a community of elders having advisory function
to guide future awardees and the conduct of the LFSP in the
Philippines.
the attainment of a successful small business entity based on
R&D work evaluated by DOST, NEDA and the PCC
mechanisms at a period shorter than the timelines
approximated will be duly recognized and given the full leaseto-own award.
the awardees may work together with other fellow awardees
from different disciplines on the R&D project to ensure its
success. A collaborative venture must identify the roles and %
efforts of the individual awardee and the NEDA-DOST-PCC
mechanisms must apply the corresponding credit towards the
achievement of the award.
that failing to meet the evaluation hurdles within the time
frame for evaluations will keep the lease-to-own award in an
unpaid status.
the lease-to-own award can only be in an unpaid status for a
maximum of 25 years after which if still with unearned lease
payment, it will be given to the next deserving awardee.
the lease-to-own award cannot be paid through any means
other than the periodic evaluated performance of the awardee
during his award period through the NEDA-DOST-PCC
mechanisms.
during the period of this lease-to-own contract, the awardee
will have the privilege of further training/education abroad for
a total period of five (5) years which may be allocated
according to the status of his project and the need for further
training.
The length of the award (lease to own for 25 years) has already
defined the period of funding for salaries which should be covered
by Philippine laws as to what the fair amount for a starting awarded
scientist should be. Since this is best taken up by government
agencies dealing with scientists and the national budget and are
subject to the changing costs of living, they are not detailed in the
general LFS Program. The funding sources to tap mentioned in part
on (a) National Level, p. 10 are international bodies (meaning i.e.,
World Bank, Asian Development Bank) and/ or private sector (i.e,
Ayala Foundation, Metrobank Foundation and other regional and
global funding institutions) who would like to see a share of
government investment in their own growth before they reciprocate
funding which they rate as having the potential to move the national
or regional economies forward. In the case of the LFS Program, the
government share as Land is defined. The corresponding value of
land can be used to translate what the corresponding funding being
applied for from the international bodies will be.
2)
Reliability
a)
On the national level. The evaluation measures of performance
should have a national equivalent through an annual NEDA-based
ranking scale of each province on all aspects of good governance.
This should be a public event where the best-ranked province for
12
good governance is acclaimed nationally and the NEDA ranking of
each province shown. By generating public interest on the national
economic goals, the Philippine government will increase the
stakeholders for these goals, thus garnering their moral and/or
material support as well. The Land Management Bureau (DENR)
working with the DOST and Provincial government will identify
the lands to be included under the LFSP. Upon the 5–yearly
evaluation of the awardee project, the DOST will invite the
participation of the business sector (represented by the Phil.
Chamber of Commerce [PCC]) to help evaluate the market
feasibility or potential of the awardee’s project.
3)
b)
On the Provincial level. The Office of the Provincial Vice-Governor
will be the hub of this NEDA-DOST-DENR-PCC program. The
office will host the necessary offices and infrastructure where the
awardees’ projects are evaluated and implemented. Yearly
evaluations will be presented before the Governor and the
Provincial Board and the five-yearly evaluation presented before
the NEDA-Bureau of Lands-PCC bodies. The final evaluation of
the award where the Land award will convert from lease to own
will be presented before the Office of the President.
c)
On the Awardee level. Aside from individual competence in their
respective fields, the criterion of enthusiasm in sharing multi-or
interdisciplinary teamwork or team-building will hold a significant
weight in the awardee selection criteria. An awardee candidate no
matter how competent or gifted cannot work in secrecy nor
isolation from his fellow R&D workers when the bottomline goals
of the LFSP involve the economic progress of an entire nation and
the reliance on scientific-based communication among and between
different disciplines to achieve this.
Goal Orientation. An R&D-friendly infrastructure in the Philippines is
the goal of the LFSP and as such it cannot be other than socioeconomically holistic in nature. This means that the human resource on
which the success of this program depends on should reflect the diversity
of an R&D community. Although science and technology workers form a
crucial part of this manpower, non-academic inventors, and gifted
individuals in the arts, literature and music should form part of this
community as well. Creativity is an important factor in R&D process and
the instead of a situation where a sterile environment is mandated from
above, a fertile environment nurtured by the experience of its own
inhabitants in the LFSP, is nurtured from below. The infrastructure being
sought for this skilled manpower are those that will answer the basic
needs for an R&D worker: Housing, Water and Food resources, Power
and internet accessibility, Social interaction with co-workers in the same
field, Health and Security and educational opportunities for him/herself
and his/her family. It is obvious that not all aspects of this ideal
infrastructure will be immediately available to the awardee, but with the
availability of the land upon which he will live, the impetus to achieve
the other components, by working with fellow awardees in related
disciplines and with the provincial government, will be better within
reach.
a)
On the national level. To a significant extent, the national
government, in tapping international bodies or the private sector
who see the same potential in investing in R&D human resources,
can utilize these channels to invest in their needed domiciles to
answer for housing of the awardees within the pilot area.
b)
On the Provincial level. These domiciles need not be luxurious
condos but will be functional and modest abodes with reasonable
amenities for weather acclimatization, containing the same number
of rooms, to include a working room for the awardee. The
proximity of domiciles of awardees having the same, similar or
related disciplines will be given due consideration. The Provincial
Government under the Office of the Vice-Governor shall establish a
Housing Board which will maintain architectural standards to
visually identify the R&D area as a distinct functioning unit. The
Provincial Government shall also provide the necessary security
personnel whose main task is to secure the area from interlopers
and develop a security policy in keeping with the potential
proprietary issues that may arise from the R&D nature of work
done within its area of administration.
c)
On the Awardee level. Engineer-awardees can for example, as a
start, apply their individual or group projects towards providing
innovative water and energy-efficient power sources affecting the
R&D pilot area. Architects and artist-awardees can design
functionally efficient facilities to house transformative institutions
of learning of various disciplines within the R&D area. Computer
engineers and artists can combine their skills to bring animation and
gaming to the competitive heights required for this age. Chemists,
Botanists, Marine scientists, Pharmacists working with veterinary
and human medical staff will form the nidus of a long awaited
Philippine pharmaceutical industry which focuses on the
archipelago’s biodiverse flora and fauna. Aeronautical engineers
and Physicists can initially focus on developing energy efficient
aero-mobile security forces for the R&D Pilot area if not for the
Province before focusing on exploiting the Philippines’
epiequatorial position in efficiently bringing geostationary satellites ____________________________________________________________________________________________________________
www.philscitech.org
d)
in position. Physician awardees can focus on developing emergency
room services and address public health problems within the R&D
pilot area with the long-term vision of eventually developing a
medical center and teaching institution which can provide health
coverage for the R&D area’s future population while all disciplines
can participate in the development of an educational structure in
stages appropriate for the R&D Pilot area. The collaborative
possibilities are only limited by one’s imagination.
FACTORS IN IDENTIFYING THE PILOT (FRONTIER) AREA FOR THE
LFSP IN THE PHILIPPINES
Although this topic is best discussed in higher-level circles involving national
policies, allow me to mention some factors that I think are important in
identifying the R&D pilot area for the Philippines.
A. Economic. The economic progress of the R&D pilot area should neither
be as progressive as the urban centers or capitals of developing countries
nor should it be so depressed that the time and effort in solving the basic
security, health and education needs would encroach on the efforts
needed to get the basic R&D initiatives started. It cannot be the National
Capital Region (NCR) for example since the measure of the LFSP
outcome may be confounded by the basic economic strides already
achieved by the NCR. Jolo, in Sulu province, even with the peace pact
arrived at by the government with the Moro Islamic Liberation Front
(MILF) may not provide the proper incentive for the awardee since its
economic and security stability may take a period longer than the midway evaluation needs of the individual awardee, assuming that the area
attracts enough applicants. The presence of potential natural resources,
although not fully tapped in the region is also a factor in bringing in the
role of LFSP in the area.
B.
Political. Certain regions of the Philippines are noted by their fealthy to a
traditional politician. A region traditionally identified as the political
bailiwick of a traditional politician often colors whatever R&D gains
attained in a pilot R&D area and may discourage the institutional
(Congressional) follow-up support it needs specially when congressional
politicians identify the project as their opponent’s. In effect, the over-all
influence of this factor may be negative in terms of bringing the full
scale support it needs.
C.
Security. Security concerns are usually a component of economic growth
and they may be overtly expressed as in the aforementioned example of
Jolo but security concerns may also be impending for which the bringing
in of economic catalysts as in the LFSP may provide a solution.
Based on the 3 factors mentioned, the province of Palawan may be the ideal
region to test the economic results from an LFSP implemented in its administrative
area.
A.
Economic. The region is neither on the forefront of Philippine economic
progress but neither is it a laggard. In the approximation of neurosurgical
coverage, in the author’s previous experience basing health care as a
measure of economic growth, the Southwestern sector is frequently
bypassed for the more lucrative areas of Cebu in the middle Visayas and
Davao of the Southern region of Mindanao. The relatively newly
discovered Malampaya Oil and Gas fields is within its administrative
jurisdiction of Palawan although the distribution of oil and gasgenerated resources from those fields have not yet been finalized to its
favor. If there will be a place where economic outcome can be fairly
measured based on the input of an LFSP, it will be in Palawan.
13
B.
Political. The Province of Palawan has not been known as either an
incumbent’s or opposition bailiwick. It therefore does not have the
encumbrances inherent to a region personified by a traditional Filipino
politician.
C.
Security. The recent territorial claims by neighboring nations conflicting
with the Philippines’ Exclusive maritime Economic Zone are taking
place within reach of the Palawan coastline. In 1998, Abu Sayyaf pirates
using a southern route from the Sulu seas hostaged tourists from
neighboring Malaysia to hide them in Palawan. Although, the pirates
were subsequently subdued and most of the hostages freed, the hostage
taking situation revealed the pirates’ traditional claims of
institutionalizing a cross-insular caliphate from the Sulu seas to include
Palawan. These security concerns are not issues to ignore, but can be
better addressed or supported with the robust growth of economy in
Palawan.
REFERENCES
Ashton, Thomas S. “The Industrial Revolution (1760–1830)”. Oxford University
Press. (1948).
Belloc, Hillaire. “The Serville State.” T.N. Foulis, London & Edinburgh, 1912.
Mantoux, Paul (First English translation 1928, revised 1961). "The Industrial
Revolution in the Eighteenth Century". The Macmillan Company, New York,
1961
Constitution and By-Laws of the Society of Balik-Scientist Awardees, Inc., Archives
the Securities and Exchange Commission,Manila Philippines, 1985.
Locke, John. "Some Considerations of the Consequences of the Lowering of
Interest and the Raising the Value of Money". [Letter to Members of
Parliament, 1691 Retrieved 22 December 2013.
Smith, Adam "Chapter 2, Article 1: Taxes upon the Rent of Houses". The Wealth of
Nations, Book V, 1776.
George, Henry (1879). "2". Progress and Poverty: An Inquiry into the Cause of
Industrial Depressions and of Increase of Want with Increase of Wealth VI.
Retrieved 2008-05-12.
George, Henry (1881), The Land Question: What It Involves, and How Alone It
Can Be Settled. First published as “The Irish Land Question” New York,
February 28, 1881
Doorman F. Flat taxes, flat markets and economic crisis: consequences of the
global concentration of capital. Global Development: Towards Sociallly Just
and Economically Sustainable Growth. http://home.online.nl/f.j.doorman/
PaEnFlatTax.htm. Accessed 5/27/2014.
Lim-Sylianco CY . Anticarcinogenic effect of coconut oil. Phil. Journ of Coconut
Studies, 1987; XII : 89-102.
Kaunitz H, Dayrit CS. Coconut Oil Production and coronary heart disease.
Philippine Journal of Coconut Studies. 1992; Vol XVII (2):18-20.
Kumar PD. The role of coconut and coconut oil in coronary heart disease in
Kerala, south India. Trop Doc , Oct, 1997; 27(4): 215-7.
Enig M. Lauric oils as antimicrobial agents: theory of effect, scientific rationale
and dietary application as adjunct nutritional support for HIV-infected
individuals. Chapter Five, Nutrients and Foods in AIDS. Ed. Watson RR,
CRC Press, 1998.
Shamina Azeez. "Fatty acid profile of coconut oil in relation to nut maturity and
season in selected cultivars/hybrids", British Food Journal, 2007; Vol. 109
Iss: 4, pp.272 – 279.
McDiarmid AM. Agriculture Land Policy in the Philippines during the American
Period. Citing Report to the Philippine Commission, 1900, Vol IV, p. 91; ibid
1903, Pt. 2, p. 623. Phil. Law Journal. June, 1905; 28(6): 852-890.
http://www.denr.gov.ph/index.php/component/content/article/55.html.
Accessed
June 22, 2014.
Tajnai C. Fred Terman, The father of Silicon Valley , Stanford University Computer
Forum,
March
1995.
http://www.netvalley.com/silicon_valley/
Fred_Terman_Father_of_Silicon_Valley.html ____________________________________________________________________________________________________________
www.philscitech.org
14
ARTICLE
Isolation and characterization
of culturable thermophilic
bacteria from hot springs in
Benguet, Philippines
Socorro Martha Meg-ay V. Daupan1 and
Windell L. Rivera*1,2
1Institute
of Biology, College of Science, University of the Philippines, Diliman,
Quezon City, 1101, Philippines
2Natural Sciences Research Institute, University of the Philippines, Diliman,
Quezon City, 1101, Philippines
Abstract—Despite the numerous geothermal environments in the Philippines, there is limited information on
the composition of thermophilic bacteria within the country. This study is the first to carry out both culture and
molecular-based methods to characterize thermophilic bacteria from hot springs in the province of Benguet
in the Philippines. The xylan-degrading ability of each isolate was also investigated using the Congo red
method. A total of 14 phenotypically-different isolates (7 from Badekbek mud spring and 7 from Dalupirip hot
spring) were characterized. Phylogenetic analysis based on the nearly complete 16S rDNA sequences
revealed that all the isolates obtained from Badekbek were affiliated with Geobacillus, whereas the isolates
from Dalupirip clustered into 3 major linkages of bacterial phyla, Firmicutes (72%) consisting of the genera
Geobacillus and Anoxybacillus; Deinococcus-Thermus (14%) consisting of the genus Meiothermus; and
Bacteroidetes consisting of the genus Thermonema (14%). In addition, xylan-degrading ability was observed
in all isolates from Badekbek and in 2 isolates from Dalupirip which showed high sequence similarity with
Geobacillus spp. The results are also essential in understanding the roles of the physico-chemical properties
of hot spring water as a driver of thermophilic bacterial compositions.
Keywords—16S rDNA sequencing, hot springs, Philippines, thermophilic bacteria
INTRODUCTION
The discovery of thermophilic bacteria capable of carrying out life processes
in the boiling hot springs of Yellowstone National Park has become a foundation of
developments in medicine and biotechnology. Since then, thermophiles have been
isolated in geothermal features all over the world. Thermophilic bacteria are found
in various geothermally-heated regions of the earth such as hot springs, deep sea
hydrothermal vents and volcanic craters (Stetter et al. 1993). They can also live in
fermenting materials that can produce heat such as compost piles and garbage
landfills (Fujio and Kume 1991). The ability of thermophiles to proliferate at
elevated temperatures is attributed to the thermally-stable macromolecules they
possess (Zeikus et al., 1998). As a consequence of growth at high temperatures and
unique macromolecular properties, thermophiles exhibit high metabolic rates,
thereby generating greater end-products despite lower growth rates compared to
mesophiles. They also provide physically and chemically stable enzymes that are
of significant use to industries (Haki and Rakshit 2003). Thermophiles have
provided an interesting and challenging platform for researchers since the time of
their discovery. However, due to difficulties in isolation and maintenance of the
pure culture, their diversity in thermal habitats remains to be explored (Kikani and
Singh 2011).
Submitted: January 10, 2015
Revised: March 22, 2015
Accepted: March 22, 2015
The Philippines is geographically situated in the Pacific Ring of Fire and is
subject to numerous active volcanoes. The country boasts of bountiful natural
resources including hot springs that provide good conditions for thermophilic
bacterial growth. However, there is limited knowledge on the thermophile
community in Philippine hot springs. Hot springs in Los Baños, Laguna,
Philippines have been shown to harbor unique thermophiles. Fluorescence in situ
hybridization (FISH) analysis showed that this site is dominated by microbial
community belonging to domain Archaea, of which 63% were Crenarchaeota and
8% were Euryarchaeota and 17% were bacteria and the remaining 12% were
unidentified (Lantican et al. 2011). Two novel hyperthermophilic crenarchaeotes
have also been discovered from the same hot spring and the proposed names for
these isolates were Caldivirga maquilingensis and Caldisphaera lagunensis (Itoh
et al. 1999, Itoh et al. 2003). Hongmei and colleagues, on the other hand, described
thermophilic microbial mats from Laguna hot springs (Hongmei et al. 2005).
This present study therefore aimed to isolate and characterize thermophilic
bacteria from two hot springs in Benguet, Philippines and to assess their
phylogenetic relationships.
Sampling Sites
Benguet was selected because of its unique temperate climate compared to
other provinces of the country (National Statistical Coordination Board 2005). Out
of its 13 municipalities, hot springs are found in five of them. Two hot springs were ____________________________________________________________________________________________________________
www.philscitech.org
randomly selected for the isolation of thermophilic bacteria (Figure 1). These hot
springs include Badekbek mud spring in Bokod and Dalupirip hot spring in Itogon.
The temperature and pH of the hot springs were measured during sampling and the
turbidity was visually assessed. The selected hot springs were found to vary greatly
in terms of their physico-chemical properties. Badekbek mud spring had a
temperature range of 78-80°C and Dalupirip hot spring had lower temperature
range of 45-48°C. In terms of pH, the former had lower pH ranging from 3-4 and
the latter had nearly neutral pH of 7-8.
15
new tube and stored at -20°C until use. The nucleic acid concentration of the crude
DNA was estimated using NanoDrop 2000 (Thermo Scientific).
PCR amplification
Amplification of the 16S rRNA gene was conducted using a pair of universal
primers, 27F/1492R (Lau et al. 2009). All PCR reactions were carried out under
the following conditions: 4 minutes at 94°C, 30 cycles of 1 minute at 92°C, 1
minute at 45°C, 1 minute at 72°C; followed by 10 minutes at 72°C. PCR products
were purified using ExpinTM PCR SV Purification Kit according to the
manufacturer’s instructions. The PCR products were separated by gel
electrophoresis at 100V for 25 minutes on 1X TAE buffer (Tris: Acetic acid:
EDTA) and analyzed by staining with ethidium bromide under UV light. The
purified PCR products were sent to Macrogen, Inc., South Korea for sequencing.
Phylogenetic analyses
The sequences consisting of 1,400-1,500 nucleotides were determined and
assembled using MEGA 5.05 (Tamura et al. 2011). The sequences were then
compared with those available in GenBank using BLAST search (http://
www.ncbi.nlm.gov/blast/). All sequences were aligned using Clustal W algorithm
in BioEdit 7.0.5.3 (Hall, 1999). A total of 24 sequences were consolidated. The
optimal model for DNA substitution was determined using Bayesian Information
Criterion (BIC) as selection strategy in jModelTest (Posada 2008). The site
saturation test (Xia test) in DAMBE (http://dambe.bio.uottawa.ca/dambe.asp) was
also performed to check for extreme substitution saturation that could be present in
the sequence data (Xia et al. 2003). If saturation was observed in the sequence
data, the succeeding phylogenetic analysis was discarded.
!
Figure 1. Map showing the geographical location of the sampling sites in
Benguet, Philippines (marked with red star) and municipalities with hot
springs (marked with yellow circle).
Sample Collection
Water samples were collected in triplicates at different points from the
sampling sites using sterile thermal flasks (Ledbetter et al. 2007). All samples were
immediately transported to the laboratory and directly inoculated onto solidified
Thermus medium (ATCC medium 697) plates. This medium has the following
composition (in micrograms per liter of deionized water): CaSO4·2H2O, 60;
MgSO4·7H2O, 100; NaCl, 1000; KNO3, 103; NaNO3, 689; Na2HPO4, 111; FeCl3,
2.8; MnSO4·H2O, 22; ZnSO4·7H2O, 5; H3BO3, 5; CuSO4, 0.2; Na2MoO4·2H2O,
0.3; CoCl2·2H2O, 0.5; and EDTA, 6 (Brock and Freeze 1969). Yeast extract
(0.08%) and peptone (0.05%) were added and the medium was solidified with
Phytagel (Sigma) at 1% final concentration. MgSO4 (0.5%) was also added to
make the solidifying agent heat stable. Concentrated H2SO4 (0.5ml) was added to
dissolve the salts and the pH of the medium was adjusted to 7.0. All plates were
then incubated for a maximum of 3 days at 60°C. Purification and preservation of the isolates
Colonies were selected from each plate and were subjected to streaking on
solidified Thermus medium at least three times. Single colony was picked and restreaked on fresh solid media to obtain pure cultures. The colonies were observed
under the microscope after several streaking to check for purity by assessing the
homogeneity of cell morphology. Pure isolates were grown at 60°C for 24 hours
and were suspended in Thermus broth containing 15% glycerol and stored at -70°C
until use.
Phylogenetic trees were constructed from the aligned dataset using the
neighbor-joining (NJ) (Saitou and Nei 1987) and maximum-likelihood (ML)
(Cavalli-Sforza and Edwards 1967; Felsenstein 1981) methods with 1,000
bootstrap resamplings. A total of 1,510 unambiguously aligned nucleotide sites
were used for the phylogenies using the nearly complete 16S rRNA dataset. NJ and
ML trees were generated using PAUP* 4.0 (Swofford 2002) and PhyML 3.0
(Guindon 2010) programs, respectively.
Nucleotide sequence accession numbers
All DNA sequences were deposited in GenBank, under accession numbers
KC252975-KC252981 for Badekbek isolates and KC252983-KC252989 for
Dalupirip isolates.
RESULTS
Phenotypically different colonies that appeared after incubation on Thermus
medium at 60°C from each hot spring site were selected for purification and
characterization. A total of 14 thermophilic bacterial isolates (7 from each site)
were obtained. It was noted that the isolates were either Gram-negative or Gramvariable. All the isolates had circular colony form and the cells were rod-shaped of
several different morphologies from slender, long rods (thread-like) to small,
nearly rounded rods. Several pigmented colonies were also obtained. Motility
varied among the isolates, of which 79% were found to be motile (Table 1).
TABLE 1. Phenotypic characteristics of the 14 thermophilic bacterial isolates from
Badekbek (Ba 1-7) and Dalupirip (Da 1-7) hot springs in Benguet, Philippines.
Isolate
Gramstain
Cultural characteristics
Cell shape
Catalase
activity
Oxidase
activity
Motility
Xylanolytic
activity
Color
Form
Size (mm)
Ba1
light yellow
circular
0.5-1
−
rods (in pair,
forming v-shape)
−
−
+
+
Ba2
light yellow
circular
0.25-0.5
−
rods (in pair,
forming v-shape)
−
−
+
+
The morphological and biochemical characterizations of the isolates were
done according to the methods of Elnasser et al. (2007) and Narayan et al. (2008)
using 18 to 24-hour old cultures. These include examination of cultural
characteristics, Gram staining, motility test, Kovac’s oxidase and catalase test.
Ba3
light yellow
circular
0.25-0.5
V
rods (short and
long)
−
−
+
+
Ba4
light yellow
circular
0.25-0.5
V
rods (short and
long)
−
+
+
+
Screening for xylan-degrading isolates
Ba5
light yellow
circular
0.25-0.5
−
short rods
−
−
−
+
Ba6
light yellow
circular
0.25-0.5
V
rods (short and
long)
−
+
+
+
Ba7
light yellow
circular
0.25-0.5
V
rods (short and
long)
−
−
+
+
+
−
−
−
Phenotypic characterization
Pure isolates were tested for xylan-degrading ability because xylanases offer a
wide range of industrial and environmental significance since these enzymes are
being used to replace chlorinated compounds in bleaching of wood for paper
production (Kaur et al. 2010). The screening was done by inoculating a loopful of
each isolate to Thermus medium containing 0.5% xylan. After incubation of the
plates for 48 hours, 0.1% Congo red solution was poured onto the plates. The
plates were incubated for 30 minutes at 65°C and washed with 1M NaCl solution.
Clear zones surrounding the colonies on the red background dyed with Congo red
solution is indicative of positive activity for xylanase since Congo red binds only
to carbohydrate polymers (Cordeiro et al. 2002; Teather and Wood 1982).
Da1
yellow
circular
0.5-0.75
−
long rods (threadlike)
Da 2
white
circular
0.5-0.75
−
Rods
+
−
+
+
Da 3
white
circular
1-1.5
−
rods in pairs
+
+
+
+
Da 4
white
circular
0.5-1
−
small rods
−
−
−
−
Da 5
pink
circular
0.5-0.75
−
rods
+
−
+
−
Da 6
white
circular
0.5-0.75
−
small rods
+
−
+
−
Da 7
white
circular
1-1.25
−
small rods
−
−
+
−
DNA extraction
Cells from each of the 18 to 24-hour old cultures were harvested by
centrifugation for 2 minutes at 10,000 rpm. The pellet was washed with 1X PBS;
after which, it was resuspended in 10μl sterile distilled water. A 200μl aliquot of
5% Chelex was then added and the mixture was mixed vigorously. The mixture
was incubated for 20 to 30 minutes in water bath at 56°C and spun at high speed
using a vortex. The product was incubated for 8 minutes in a boiling water bath
and spun for 2 to 3 minutes at 13,000 rpm. The supernatant was transferred to a
____________________________________________________________________________________________________________
www.philscitech.org
All the isolates from Badekbek mud spring and 2 more isolates from
Dalupirip hot spring showed xylan-degrading ability as indicated by the cleared
zones that formed on xylan plates following the Congo red method. Isolate Da3
exhibited the largest clearing zones. The other isolates had clearing zones with
diameter ranging from 0.8mm to 1.5mm (Figure 2).
Da3
Da
16
Ba5
clades are represented by 3 major lineages, namely: Firmicutes (72%) consisting of
the genera Geobacillus and Anoxybacillus; Deinococcus-Thermus (14%)
consisting of the genus Meiothermus; and Bacteroidetes consisting of the genus
Thermonema (14%). This third clade was observed to form distinct lineage from
the first two clades. The xylan-degrading isolates clustered within the clade of
Firmicutes and the brightly-pigmented isolates that did not exhibit xylan-degrading
ability formed separate clades. Interestingly, 2 isolates (Da 6 and Da 7) that did not
exhibit xylan-degrading ability formed a separate cluster within the first clade. It is
also noted that isolates from Badekbek mud spring did not exhibit great diversity
and all isolates fell under the first clade showing their close association with G.
thermoparaffinivorans. The dendrogram also shows clustering of a member of the
genus Bacillus to Geobacillus spp.
!
Figure 2. Thermus plates with 0.5% xylan showing clearing zones following
the Congo red method. (a) Large clearing zones from plate inoculated with
Da3 (previously assigned with code I4-b) (b) small rounded clearing zones
from plate inoculated with Ba5 (previously Ba5-a).
BLAST searches based on the nearly complete 16S rDNA sequences of the 14
isolates showed that there was a strong similarity (> 98%) between the test isolates
and representative strains of Geobacillus, Thermonema, Meiothermus and
Anoxybacillus. Isolates fom Badekbek had high sequence similarity with either G.
thermoparaffinivorans or G. thermoleovorans. In contrast, isolates from Dalupirip
hot spring showed high sequence homology to the aforementioned genera (Table
2).
TABLE 2. Identity of the 14 thermophilic bacterial isolates based on BLAST
searches.
Code
(accession
number)
Identity based on BLAST
searches
Ba1(KC252975)
Geobacillus
Max
Identity
(%)
GenBank
Accession
No.
E-value
(Query
Coverage %)
100
EU214615
0.0 (98)
99.9
EU214615
0.0 (99)
99.8
EU214615
0.0 (99)
99.7
EU214615
0.0 (99)
99.9
CP003125
0.0 (100)
99.9
EU214615
0.0 (99)
100
EU214615
0.0 (99)
99.4
Y08957.1
0.0 (96)
99.8
BA000043
0.0 (99)
99.4
JF713055
0.0 (99)
99.8
EU816689
0.0 (98)
thermoparaffinivorans it-12
Ba2(KC252976)
Geobacillu
sthermoparaffinivorans it-12
Ba3(KC252977)
Geobacillus
Ba4(KC252978)
Geobacillus
Ba5(KC252979)
Geobacillus
thermoleovoransCCB
Ba6(KC252980)
Geobacillus
Ba7(KC252981)
Geobacillus
Da1(KC252983)
Thermonema rossianum strain
SC-1
Da2(KC252984)
Geobacillus kaustophilus
HTA426
Da3(KC252985)
Geobacillus stearothermophilus
P4
Da4(KC252986)
Anoxybacillus flavithermus clone
LK4
Da5(KC252987)
Meiothermus sp. SK3-2
99.9
GU129930
0.0 (94)
Da6(KC252988)
99.0
AY491497
0.0 (99)
Da7(KC252989)
98.9
AY491497
0.0 (98)
The aligned sequences for the nearly complete 16S rRNA had a length of
1,510 bp. Site saturation test (Xia test) revealed little saturation in the sequences.
The optimal models of DNA substitution for the 16S rRNA as determined by
jModelTest (Posada 2008) using Bayesian Information Criterion (BIC) was TRN
+G. The phylogenetic relationships of the 14 thermophilic bacterial isolates and
closely-related species were determined using the neighbor-joining (NJ) (Saitou
and Nei 1987) and maximum-likelihood (ML) (Cavalli-Sforza and Edwards 1967;
Felsenstein 1981) methods. The branches that corresponded to partitions
reproduced below 50% bootstrap replicates were collapsed. The generated
dendrogram revealed 3 clades supported by high bootstrap values (Figure 3). These
!
Figure 3. Maximum-likelihood tree of the 14 isolates and their closest
relatives based on the nearly complete 16S rRNA gene (1,510 bp) using
TRN+G as model of DNA substitution. The two values at the nodes
represent the bootstrap values from ML and NJ. Only bootstrap values
above 50% are shown at the nodes (based on 1000 bootstrap
resamplings). Scale bar indicates 5 nucleotide changes for every 1,000
nucleotides. Bullets indicate xylan-degrading isolates.
DISCUSSION
This study is the first to describe thermophilic bacterial compositions in
Benguet hot springs in the Philippines using both culture-based methods and
molecular techniques. Non-culturable bacteria may play significant roles in
nutrient cycling and can be identified by molecular techniques such as denaturing
gradient gel electrophoresis (DGGE) and FISH. Despite potential significant
ecological roles, non-culturable bacteria will be of little significance for industrial
applications. Among the 14 isolates, 79% were found to be closely-related to the
genus Geobacillus based on BLAST searches. Representatives of this genus have
been found in both natural and man-made habitats throughout the world, indicating
that these groups of thermally-adapted bacteria are widespread in various habitats
and may have significant impact on soil and water geochemistry (Rahman et al.
2007). The growth temperature for Geobacillus ranges from 35 to 78°C and the
major fatty acids are iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso
17:0) (Rahman et al. 2004). Members of the genus Geobacillus have rod-shaped
cells, occurring singly or in short chains; colonies may show variable shape and
may exhibit pigmentation (Nazina et al. 2001). All isolates from Badekbek mud
spring had light yellow pigmentation and were found to be affiliated with
Geobacillus. Although most species of Geobacillus are Gram-positive, their cell
wall structure using Gram stain may vary between positive or negative (Nazina et
al. 2001). Members of the genus Geobacillus have been previously shown to
produce xylanases. G. stearothermophilus T-6, for instance, produces two selective
family 10 xylanases that complete the degradation of xylan (Solomon et al. 2007).
Research has focused mainly on two of families of xylanase containing glycoside
hydrolase and these are families 10 and 11. Family 10 xylanases have been isolated
from various thermophilic and hyperthermophilic microorganisms including
species of Thermotoga, Caldocellulosiruptor, Rhodothermus, and Bacillus. The
other enzymes with xylanase activity that belong to other families are also studied,
albeit to a lesser extent. Most of the xylanases that are of bacterial origin have
optimum activity at approximately 40 to 60°C and a number of extremophilic
xylanases have been described due to the industrial demand for such enzymes that
can operate under process conditions (Collins et al. 2005). In the present study,
only 2 isolates with high sequence similarity to Geobacillus did not exhibit xylandegrading ability.
Isolate Da4 was found to be affiliated with Anoxybacillus. Members of the
genus Anoxybacillus are predominantly aerotolerant anaerobe although aerobic
growth has been observed in some species (Pikuta et al. 2003).
One isolate (Da5) was found to be affiliated with Meiothermus ruber. In
natural environments, representative strains of this genus are exclusively found in
thermal limnetic systems, predominantly in terrestrial hot springs (Zhang et al.
2010). This isolate showed similar phenotypic properties with Meiothermus sp.
SK3-2 having circular colony form with smooth margin and glistening surface with ____________________________________________________________________________________________________________
www.philscitech.org
pink pigmentation (Goh et al. 2011). Although this isolate was not able to degrade
xylan, its pigmentation is noteworthy. Pigments from bacteria are being exploited
for the production of natural dyes since bacteria produce better yields as opposed
to dye extraction from eukaryotes. Natural dyes are preferred over synthetic ones
since the former exhibit better biodegradability (Ahmad et al. 2012).
Another isolate (Da1) showed high sequence similarity with Thermonema
rossianum, a bacterium that has been found to be polyextremophile being both
thermophilic and halophilic. This isolate exhibited yellow pigmentation and
filamentous cellular morphology typical of T. rossianum (Tenreiro et al. 1997). The
yellow pigment is probably carotenoid.
The clustering of the genus Geobacillus with Bacillus caldotenax as seen in
Figure. 3 may suggest the need for further reclassification of certain members of
the genus Bacillus. The genus Bacillus is a diverse group of bacteria that has
progressively been subdivided into the novel genera Brevibacillus, Paenibacillus,
Salibacillus, and most recently, Geobacillus based on separate phylogenetic
groupings derived from the 16S rRNA gene sequence information (Nazina et al.
2001). This also supports the conclusion of stating that 16S rDNA analysis alone
may be insufficient to distinguish between some closely-related species possibly
because of the existence of multiple 16S rRNA operons and the occurrence of
recombination within the strain (Meintanis 2008; Vandamme et al. 1996). A more
reliable approach to discriminate thermophilic bacteria even at strain levels would
be the use of other genomic fingerprint method, like REP-PCR.
The constructed phylogenetic tree also shows that culturable thermophilic
bacterial community in Dalupirip hot spring is more diverse in comparison to that
of Badekbek, which is sulfur, acidic mud spring. This implies the importance of
physico-chemical properties of hot spring water as a driver of thermophilic
bacterial compositions.
CONCLUSION
This study has identified the thermophilic bacterial compositions of hot
springs in Benguet and revealed the industrial significance of the isolates,
particularly in xylan degradation. The sites were found to be dominated by species
of Geobacillus. Members of Meiothermus, Thermonema, and Anoxybacillus were
also isolated in Dalupirip hot spring. Dalupirip hot spring showed greater diversity
of bacteria because of the difference in physico-chemical characteristics of the
location. It had a lower temperature range of 45-48°C that can support more
bacteria. The higher temperature range in Badekdek hot spring supports the
existence of the genus Geobacillus, which have been previously shown to produce
xylanases. The clustering of Bacillus caldotenax with Geobacillus spp. in the
generated dendrogram suggests the need for further analysis and possibly
reclassification of certain species of Bacillus to Geobacillus. The results also imply
the need to develop medium for culturing higher number of thermophilic bacteria.
This work paves the way for a comparative diversity studies for thermophilic
bacteria in other hot springs of the Philippine archipelago that have different
climatic regimes.
ACKNOWLEDGEMENTS
This work was supported by research grants from the Department of Science
and Technology-Accelerated Science and Technology Human Resource
Development Program (DOST-ASTHRDP) of the Philippines and the UNU &
GIST Joint Programme on Science and Technology for Sustainability operated by
the International Environmental Research Center, Gwangju Institute of Science and
Technology (IERC-GIST) in South Korea. The authors are also grateful to the
technical support given by Dr. In-Seop Chang of the Energy and Biotechnology
Laboratory of the IERC-GIST.
The authors declare that there is no conflict of interests regarding the
publication of this article.
SMMVD and WLR conceptualized this study. The experiments were
conducted by SMMVD. SMMVD and WLR prepared the manuscript.
REFERENCES
Ahmad W, Wan Ahmad W, Zakaria Z., and Yusof N. Application of bacterial
pigments as colorant: the Malaysian perspective. Springer Berlin, 2012.
Brock T, and Freeze H. Thermus aquaticus gen. n. and sp. n., a non-sporulating
extreme thermophile. J Bacteriol 1969; 98(1): 289-297.
Cavalli-Sforza L, and Edwards A. Phylogenetic analysis. Models and estimation
procedures. Am J Human Genet 1967; 19: 233-257.
Collins C, Gerday C, and Feller G. Xylanases, xylanase families and extremophilic
xylanases. FEMS Microbiol Rev 2005; 29(1): 3-23.
Cordeiro C, Martinez M, Luciano A, and de Silva R. Production and properties of
xylanase from Bacillus sp. Braz Arch Biol Technol 2002; 45: 413-418.
Elnasser Z, Maraga A, Owais W, and Khraisat A. Isolation and characterization of
new thermophilic bacteria in Jordan. Internet J Microbiol 2007; 3(2):
201-227.
Felsenstein J. Evolutionary trees from DNA sequences: a maximum likelihood
approach. J Mol Evol 1981; 17(6): 368-376.
Fujio Y, and Kume S. Isolation and identification of thermophilic bacteria from
sewage sludge compost. J Ferment Bioengineer 1991; 72(5): 334-337.
17
Goh K, Voon C, Chai Y, and Illias R. Meiothermus sp. SK3-2: a potential source
for the production of trehalose from maltose. Afr J Biotechnol 2011; 10:
12775-12783.
Guindon S, Dufayard J, Lefort V, Anisimova M, Hordijk W, and Gascuel O. New
algorithms and methods to estimate maximum-likelihood phylogenies:
assessing the performance of PhyML 3.0. Syst Biol 2010; 59(3): 307-321.
Haki G, and Rakshit S. Developments in industrially important thermostable
enzymes: a review. Bioresour Technol 2003; 89(1):17-34.
Hall T. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999; 41: 95-98.
Hongmei J, Aitchison J, Lacap D, Peerapornpisal Y, Sompong U, and Pointing S.
Community phylogenetic analysis of moderately thermophilic cyanobacterial
mats from China, the Philippines and Thailand. Extremophiles 2005; 9(4):
325-332.
Itoh T, Suzuki K, Sanchez P, and Nakase T. Caldisphaera lagunensis gen. nov., sp.
nov., a novel thermoacidophilic crenarchaeote isolated from a hot spring at
Mt. Makiling, Philippines. Int J Syst Evol Microbiol 2003; 53:1149-1154.
Itoh T, Suzuki K, Sanchez P, and Nakase T. Caldivirga maquilingensis gen. nov.,
sp. nov., a new genus of rod-shaped crenarchaeote isolated from a hot spring
in the Philippines. Int J Syst Bacteriol 1999; 49(3): 1157-1163.
Kaur, A., Mahajan R., Singh A., Garg G. and Sharma J. Application of cellulosefree xylano-pectinolytic enzymes from the same bacterial isolate in
biobleaching of kraft pulp. Biores. Technol. 2010; 101: 9150-9155.
Kikani B, and Singh S. Single step purification and characterization of a
thermostable and calcium independent α-amylase from Bacillus
amyloliquefaciens TSWK1-1 isolated from Tulsi Shyam hot spring reservoir,
Guijarat (India). Int J Biol Macromol 2011; 48(4):676-681.
Lantican N, Diaz M, Cantera J, de los Reyes F, and Raymundo, A. Microbial
community of a volcanic mud spring in the Philippines as revealed by 16S
rDNA sequence analysis and fluorescence in situ hybridization. World J
Microbiol Biotechnol 2011; 27(4):859-867.
Lau M, Aitchison J, and Pointing S. Bacterial community composition in
thermophilic microbial mats from five hot springs in central Tibet.
Extremophiles 2009; 13(1): 139-149.
Ledbetter R, Connon S, Neal A, Dohnalkova A, and Magnuson T. Biogenic
mineral production by a novel arsenic-metabolizing thermophilic bacterium
from the Alvord Basin, Oregon. Appl Environ Microbiol 2007; 73(18):
5928:5936.
Meintanis C, Chalkou K, Kormas K, Lymperopoulou D, Katsifas E, Hatzinikolaou
D, and Karagouni A. Application of rpoB sequence similarity analysis, REPPCR and BOX-PCR for the differentiation of species within the genus
Geobacillus. Lett Appl Microbiol 2008; 46(3): 395-401.
Narayan V, Hatha M, Morgan H, and Rao D. Isolation and characterization of
aerobic thermophilic bacteria from the Savusavu hot springs in Fiji. Microbes
Environ 2008; 23(4): 350-352.
National Statistical Coordination Board. Benguet province at a glance. La
Trinidad: Cordillera Executive Board.
Nazina T, Tourova T, Poltaraus A, Novikova E, Grigoryan A, Ivanova A, Lysenko
A, Petrunyaka V, Osipov G, Belyaev S, and Ivanov M. Taxonomic study of
aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen.
nov., sp. nov.and Geobacillus uzenensis sp. nov. from petroleum reservoirs
and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus,
Bacillus
thermoleovorans,
Bacillus
kaustophilus,
Bacillus
thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the
new combinations G. stearothermophilus, G. thermocatenulatus, G.
thermoleovorans, G. kaustophilus, G. thermoglucosidasiusand G.
thermodenitrificans. Int J Syst Evol Microbiol 2001; 51(2): 433-446.
Pikuta E, Cleland D, and Tang J. Aerobic growth of Anoxybacillus pushchinoensis
K1T: emended descriptions of A. pushchinoensis and the genus Anoxybacillus.
Int J Syst Evol Microbiol 2003; 53(5): 1561-1562.
Posada D. jModelTest: phylogenetic model averaging. Mol Biol Evol 2008; 25(7):
1253-1256.
Rahman R, Leow T, Salleh A, and Basri M. Geobacillus zalihae sp. nov., a
thermophilic lipolytic bacterium isolated from palm oil mill effluent in
Malaysia. BMC Microbiol 2007; 7: 77-87.
Rahman T, Marchant R, and Banat I. Distribution and molecular investigation of
highly thermophilic bacteria associated with cool soil environments. Biochem
Soc T 2004; 32: 209-213.
Saitou N, and Nei M. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol 1987; 4(4): 406-425.
Solomon V, Teplitsky A, Shulami S, Zolotnitsky G, Shoham Y, and Shoham G.
Structure-specificity relationships of an intracellular xylanase from
Geobacillus stearothermophilus. Acta Crystallogr Sect D: Biol Crystallogr
2007; 63(8): 845-859.
Stetter K, Huber R, Blöchl E, Kurr M, Eden R, Fielder M, Cash H, and Vance I.
Hyperthermophilic archaea are thriving in deep North Sea and Alaskan oil
reservoirs. Nature 1993; 365(6448):743-745.
Swofford D. PAUP*. Phylogenetic analysis using parsimony (*and other
methods).Version 4. Sinauer Associates, Sunderland, Massachussets, USA,
2002.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S. MEGA 5:
molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol Biol Evol
2011; 28(10): 2731-2739.
Teather R, and Wood P. Use of Congo red-polysaccharide interactions in
enumeration and characterization of cellulolytic bacteria from the bovine
rumen. Appl Environ Microbiol 1982; 43(4): 777-780.
Tenreiro S, Nobre M, Rainey F, Miguel C, and da Costa M. Thermonema
rossianum sp. nov., a new thermophilic and slightly halophilic species from
saline hot springs in Naples, Italy. Int J Syst Bacteriol 1997; 47(1): 122-126. ____________________________________________________________________________________________________________
www.philscitech.org
Vandamme P, Pot B, Gillis M, de Vos P, Kersters K, and Swings J. Polyphasic
taxonomy, a consensus approach to bacterial systematics. Microbiol Rev
1996; 60(2): 407-438.
Xia X, Xie Z, Salemi M, Chen L, and Wang Y.An index of substitution saturation
and its application. Mol Phylogenet Evol 2003; 26(1): 1-7.
18
Zeikus J, Vieille C, and Savchenko A. Thermozymes: biotechnology and structurefunction relationships. Extremophiles 1998; 2(3): 179-183.
Zhang X, Zhang W, Wei B, Xu, X, Zhu X, and Wu M. Meiothermus cateniformans
sp. nov., a slightly thermophilic species from north-eastern China. Int J Syst
Evol Microbiol 2010; 60(4): 840-844. ____________________________________________________________________________________________________________
www.philscitech.org
19
SHORT COMMUNICATION
Development of microsatellite
markers for genetic diversity
analysis in Glossogobius giuris
(Hamilton, 1822) and Rhinogobius
giurinus (Rutter, 1897)
Abriel S. Bulasag*1, Nathalie T. del Agua2, Aprill S.
Punongbayan2, and Maria Genaleen Q. Diaz2
1UP
Rural High School, UP Los Baños, College, Laguna
of Biological Sciences, UP Los Baños, College, Laguna
2Institute
Abstract—Microsatellite-enriched libraries were constructed from Glossogobius giuris and Rhinogobius
giurinus. BLAST analysis revealed significant homology of the clones with microsatellite-rich regions in other
teleosts and other members of Gobiidae. Eight microsatellite primers were designed and tested for crossamplification in two other goby species, Glossogobius celebius and Gobiopterus lacustris. Four primer pairs
amplified putative microsatellite loci in all four species. Four other primer pairs amplified loci in at least two
species. Primer Rh18 was the most informative and exhibited the greatest number of polymorphic alleles
(PIC=0.7262; Na=7). Two other primers, Rh51 and Gi47 were also informative markers with PIC values ≥ 0.5.
Using five primers, both G. giuris and R. giurinus samples exhibited moderately high values of genetic
diversity based on the number of alleles (~5), percent polymorphism (53%), and observed (61%) and
expected (58%) heterozygosities.
Keywords—microsatellites, genetic diversity, subtractive hybridization, Glossogobius giuris Hamilton,
Rhinogobius giurinus Rutter, Gobiidae
INTRODUCTION
Family Gobiidae is one of the largest fish families, with approximately 2,000
species and 200 genera (Froese & Pauly, 2008). Though only few species are
commercially important, they play a very important role as prey species for
commercially important fishes like sea bass. Some gobies have potential as
aquarium fishes. They may be keystone species (having disproportionate
importance) in freshwater environments in small oceanic islands because of their
prevalence in these habitats (Allen & Robertson, 1994; Helfman et al., 1997).
The diversity in form is a hint of the tremendous genetic variability that exists
within the family. Most gobies are adapted to marine environments and are
abundant in brackish water and estuarines (lower reaches of rivers, mangrove
swamps, and salt marshes). Of 315 Philippine freshwater goby species listed in
FishBase, 70 are native, while 16 can only be found in the Philippines (Froese &
Pauly, 2010). These figures further present the significance of gobies in Philippine
ecosystems. Despite this, there is a dearth of researches about their nature of
diversity, genetics and population genetic structure. These parameters are very
important in understanding population dynamics, ecology, as well as for
conservation studies.
Protection of biodiversity is anticipated to be both crucial and ongoing in the
21st century (Oliveira et al., 2006). Conservation genetics has been given primary
Submitted: March 24, 2015
Revised: May 14, 2015
Accepted: May 19, 2015
importance for avoiding extinction of endangered species alongside the political,
economic and ecological aspects of biodiversity protection. With the advent of
molecular approaches, the examination of the genetics of species in danger of
extinction proves to be a useful tool in conservation research. The impact on
genetic diversity is quite critical, as genetic variation is needed for species
adaptation and taxa speciation (Hughes et al., 1997). DNA analyses promote
increased knowledge on the genetic structure of fish species and their response to
environmental changes (Piorski et al., 2008). Several molecular tools have been
used to assess genetic variation (Strecker et al., 2003; Barroso et al., 2005),
determine population genetic structure (Hatanaka & Galetti, 2003; Spruell et al.,
2003) and gene flow among animal species (Mallet, 2005). Traditional molecular
markers have, in general, provided insufficient statistical power and accuracy for
estimating genetic differences (Oliveira et al., 2006). However, with the discovery
of highly variable loci such as microsatellites or simple sequence repeats (SSRs),
the statistical power for determining differentiation between species groups at risk
of extinction is now usually very high (Hedrick, 2001).
Microsatellite markers are dubbed as the most versatile molecular markers
with various applications in population genetics, conservation biology, and
evolutionary biology (Abdul-Muneer, 2014). Microsatellite data sets are important
starting points for studies involving parentage analysis, proper identification, and
phylogeographic studies. They provide answers to genetic questions that were
previously viewed as dead blocks and present insights as to how genetic variation
is partitioned among populations, giving reliable estimates of population
differentiation that are crucial to understand the connectivity among populations
and represent important tools to develop conservation strategies (Balloux &
Moulin, 2002). They are the most preferred PCR-based tool for fish population
genetic studies (Beckman & Soller, 1990; Shabani et al., 2013) and have been ____________________________________________________________________________________________________________
www.philscitech.org
identified as robust and valuable tools in fish genetics (Wright & Benzen, 1994). In
the absence of full genome sequences, the most preferred technique is to produce
highly enriched microsatellite libraries first described by Edwards et al. (1996). In
addition, cross-amplification among related taxa has been found to be
commonplace especially among several fish species (Leclerc et al., 2000; Cairney
et al., 2000; Vyskocilova et al., 2007).
This study isolated, characterized, and developed microsatellite primers from
Glossogobius giuris and Rhinogobius giurinus, two goby species that are abundant
in the Southern Tagalog, Philippines. The developed primers were used for cross
species amplification and genetic diversity analysis.
A
20
was indicated by the observed smearing at 300-1500 bp in agarose gel (100V for 2
hours). A microsatellite enrichment protocol developed by Glenn & Schable (2005)
was used to fish out SSR-rich regions in the genomes of G. giuris and Rhinogobius
giurinus through subtractive hybridization. Repeat-enriched genomic DNA was
amplified in 50 μL reaction containing 10 μL repeat-enriched DNA, 5 μL 10x PCR
Buffer S (Vivantis, Malaysia), 4 μL dNTPs (10 mM), 4 μL of Rsa21 (10 μM), 0.3
μL of Taq pol (5U/μL), and 26.7 μL sterile distilled water was placed in a thermal
cycler as follows: 1 cycle for 5 min at 940C, 30 cycles for 30 sec at 940C, 1 min at
600C, 1 min at 680C, and a final extension for 7 min at 680C. To avoid high
redundancy in the library, the PCR reaction was performed with 20 to 25 cycles.
The microsatellite PCR products were cleaned using Qiaquick Purification Kit
(Qiagen, Germany). The purified PCR product was ligated to pGEM T-Easy Vector
(Promega, USA) and transformed into E. coli JM109 competent cells (Promega,
USA) according to manufacturer’s specifications. Isolated plasmids from 17
different transformants for each species were sent to Macrogen, Inc. (Korea) for
sequencing.
Microsatellite Primer Design
B
The quality of sequences were first analyzed using ChromasPro 2.1 software
(Technelysium Pty Ltd, Tewantin QLD, Australia). The presence of specific SSR
repeat motifs were analyzed using Microsatellite Finder program, available online
(http://biophp.org/minitools/microsatellite_repeats_finder/demo.php). Eight primer
pairs were designed using Primer3-BLAST Software Package (Rozen & Staletsky,
2000). The primers were sent to Invitrogen for synthesis. Table 1 shows the
designed primers including standard parameters.
Genetic Diversity Assessment and Primer Data Analysis
C
PCR profile for touchdown protocol was used to enhance the success of the
amplifications based on Ghiasi et al. (2009) with minor variations in melting and
annealing temperatures. The touchdown PCR profile consists of the following
steps: initial denaturation at 94˚C for 5 min; 20 cycles of 94˚C denaturation for 30
sec, annealing with 0.5˚C decrement in temperature every cycle (a 10˚C range) for
45 sec, and extension at 72˚C for 2 min; a final extension at 72˚C for 5 min.
Polyacrylamide Gel Elecrophoresis (PAGE) was then used to genotype PCR
profiles of the G. giuris and R. giurinus. Polymorphism Information Content (PIC),
a measure of polymorphism for a marker locus used in linkage analysis, was
computed for each of the primers used, as well as other parameters like: number of
alleles, allele size range, expected product size, number of polymorphic alleles, and
observed (Ho) and expected (He) heterozygosities. Parameters were computed
using Powermarker Version 3.0 devised by Jack Liu from North Carolina State
University.
TABLE 1. Characteristics of eight (8) SSR primer pairs based on
microsatellite-enriched libraries of Glossogobius giuris and Rhinogobius giurinus
used in species cross-amplification and genetic diversity analysis.
PRIMER
SEQUENCE (5’TO 3’)
D
Gi21-F
REPEAT
TYPE
AGTGCATACCGACGCCAGGAC
LENGTH
(bp)
21
(GA)19
Gi21-R
CGGATGATGCGGGCGTTTG
Gi47-F
CTGTCTCTCTCCCGTTGCGCACG
AGCCGCTAGCCGAACAGAGC
Figure 1. Fish specimens used in the study: A. Glossogobius celebius
(Valenciennes, 1837); B. Glossogobius giuris (Hamilton, 1822); C.
Rhinogobius giurinus (Rutter, 1897); D. Gobiopterus lacustris (Herre, 1927)
(Photograph by Labatos, 2013).
Gi51-F
CCAGCTACGAAGAGAAGAG
Gi51-R
CTCTTTAGAAGGAAAACGC
Rh4-F
AGCCGGAGTCTGGGTAGTCC
R. giurinus and G. giuris fish samples were collected from the UPLB
Limnological Station and Dampalit River in Los Baños, Laguna and Lake Ticob in
Quezon Province. DNA used in library construction was isolated from pooled fish
fin samples using DNeasy Blood and Tissue Kit (Qiagen, Germany). For species
cross-amplification, two other species were collected (Gobiopterus lacustris and G.
celebius) (Figure 1) and their DNA extracted. For assessment of genetic diversity,
thirty-three (33) R. giurinus and thirty (30) G. giuris individuals were collected.
DNA extraction was done from fins and muscles following a standard phenolchloroform extraction protocol (Wasko et al., 2003). DNA quality and quantity
were checked using electrophoretic and spectrophotometric (Nanodrop®)
techniques.
Microsatellite Enrichment and Library Screening
RsaI-digested genomic DNA (approx. 10μg) was ligated with 20 μM
oligonucleotide linkers (Linker1: 5’- GTTTAGCCTTGTAGCAGAAGC -3’,
Linker2: 5’- p GCTTCTGCTACAAGGCTAAACAAAA-3’) using supplier
prescribed conditions (Invitrogen, USA). PCR was performed using primers
specific for the linkers. To confirm ligation of linkers to the genomic DNA, PCR
was performed in a volume of 20 μL containing 2 μL ligated DNA, 2 μL 10x PCR
buffer, 1.6 μL dNTPs (10mM), 1.6 μL of linker (Rsa 21), 0.5 U of Taq polymerase
in a thermal cycler as follows: 1 cycle for 5 min at 94 0C, 30 cycles for 30 sec at
940C, 1 min at 600C, 1 min at 720C, and final extension for 7 min at 720C. Ligation
Rh4-R
GCTCAAAGGGCAACCACCAAC
Rh18-F
ATACCGCTGCACACACACAC
GATACGTCAGGGCGTGAGAT
Rh37-F
CAGGAATTATCACTCCATCC
20
ACAGTATGATCATGTCGAC
Rh23-F
ACTGATCATGTGACAGCAGCTG
TGGATACAATACGTTGCCGAC
Rh51-F
TGCCAGAAGCCCTCTCATTG
19
TCACCACGATAATGAAACAGCC
45
46.00
20
56.91
343
21
54
56.85
20
55.51
194
20
52
55.58
20
47.08
314
19
45
46.11
22
55.09
263
22
51
55.79
20
(GT)12
Rh51-R
48.55
123
(AT)3; (CA)6
Rh23-R
54
59.22
19
(TGC)3;
(GA)21
Rh37-R
61.88
76
(CA)5; (CA)15
Rh18-R
56
59.11
23
(TG)27
55.04
140
22
ANNEALING
TEMP/Ta (0C)
58.93
20
(GA)12
Samples and DNA Extraction
MELTING
TEMP/Tm
(0C)
339
(CA)13;(AT)4
Gi47-R
EXPECTED
PRODUCT
SIZE (bp)
53
53.18
____________________________________________________________________________________________________________
www.philscitech.org
21
TABLE 3. Cross-amplification of microsatellite-containing loci across four species
of Family Gobiidae.
Isolated Microsatellite Loci and Species Cross-amplification
Seventeen sequences (100%) from G. giuris and 14 of 17 (82.4%) from
Rhinogobius giurinus contained microsatellites. There were more GA/CT clones
(58.8%) than CA/GT ( 41.2%) clones despite previous reports (Stallings et al.,
1991) stating CA/GT repeats are more common among animals. Since only a
fraction of the total library clones were screened, there is still a possibility that the
other clones contain different motifs.
Almost all sequences had BLAST hits with microsatellites from the model
zebrafish (Danio rerio) genome, with maximum identity of ≥75% (Table 2). There
were also a great number of BLAST hits with microsatellite sequences from carp
(Cyprinus carpio) and other teleosts such as perch (Perca schrenkii), salmon
(Salmo salar), and Chinese perch (Siniperca chuatsi). These suggest the robustness
of the procedure employed in selecting microsatellite-containing DNA fragments
and microsatellites’ ubiquity among teleosts. Rico et al. (1996) provided evidence
that sequence homology of the flanking regions of microsatellites are quite
conserved in fishes and that this might be due to the low rate of base substitution
observed in aquatic organisms compared to terrestrial animals. This was further
corroborated by the observations on the family Cyprinidae by Zardoya et al.
(1996).
TABLE 2. BLAST hits of the different microsatellite sequences from different
teleosts in the NCBI GenBank.
Microsatellite
Gi47
Gi52
Rh18
Rh23
Rh51
NCBI Accession
(Gene ID)
Organism
Max. Identity
JN757775.1
Cyprinus carpio clone 650568 microsatellite sequence
87%
CR388371.8
Zebrafish DNA sequence from clone DKEY-78N12
96%
CR396586.8
Zebrafish DNA sequence from clone DKEY-184A18
99%
Y08605.1
S.salar DNA segment containing GT repeat, 348bp
97%
JN765143.1
92%
DQ487866.1
Siniperca chuatsi clone Sc31 microsatellite sequence
93%
EU780049.1
Perca schrenkii clone Y01 microsatellite sequence
91%
JN765601.1
93%
AF470013.1
Oncorhynchus mykiss microsatellite OMM1233
sequence
90%
FP085435.5
Zebrafish DNA sequence from clone CH73-228D8
70%
JN784454.1
92%
JN761082.1
94%
CU861887.12
Zebrafish DNA sequence from clone CH211-91M11
94%
AY543923.1
Salmo salar clone Rsa225 microsatellite sequence
93%
The eight primer pairs successfully amplified the microsatellite-containing
loci in the DNA samples from four species (G. celebius, G. giuris, Gobiopterus
lacustris, and Rhinogobius giurinus). In some interspecies amplifications, PCR
products were not uniform in size, suggesting variation in the number of tandem
repeats in the DNA template.
Results from cross-amplification implies that there is diversity in the
characteristic length of allelic forms of microsatellite loci. Table 3 summarizes the
results of cross-amplification across the species. Inter-specific cross-amplification
of DNA segments may provide a more cost-effective approach in population
genetics. Cross-species amplification, which was evident in this study, is an
indication that the primer sequences used are greatly conserved across the family
as suggested by Moore et al. (1991) and Peakall et al. (1998) and that they may be
quite useful in investigating other goby species’ population genetic structure.
Half of the primers (Gi47, Rh23, Rh4, and Rh18) were successful in
amplifying DNA fragments across all four species used. This suggests that these
primer sequences are effectively conserved across the four species. Two primer
pairs (Rh51 and Gi51) amplified DNA fragments in three out of four species.
While two other primer pairs (Rh37 and Gi21) were successful in amplifying
DNA fragments for two out of four species. Gi21, on the other hand, amplified
DNA fragments only for the two Glossogobius species. As expected, all eight
primers amplified microsatellite DNA of the respective source organisms, G. giuris
and R. giurinus. The primers were effective in amplifying not only the source DNA
but also DNA from close relatives. This is in support of previous studies on the
effectiveness of heterologous primers across species in the same family
(Larmuseau et al., 2007; Lin et al., 2007; Yaraguntappa et al., 2007).
SPECIES
PRIMER
G. celebius
G. giuris
Gobiopterus lacustris
Rhinogobius
giurinus
Gi21
+
+
-
-
Gi51
-
+
+
+
Gi47
+
+
+
+
Rh23
+
+
+
+
Rh4
+
+
+
+
Rh18
+
+
+
+
Rh37
-
+
-
+
Rh51
+
+
-
+
Genetic Diversity Assessment
Table 4 summarizes the result of the diversity analysis on G. giuris based on
five microsatellite loci. Amplification with primers Gi51 and Gi47 exhibited SSR
loci with lowest numbers of alleles observed (Na=2) and correspondingly had
lowest PIC values (0.0905 and 0.3610, respectively). These two were the least
informative or not at all informative among the five primers used. In contrast,
Rh18, which produced seven polymorphic alleles, had the highest PIC value of
0.7981. Two primers, Rh18 and Rh51 are considerably informative (PIC≥0.5)
markers for the G. giuris population. Deviations from expected heterozygosities
may indicate important population dynamics. Based on this premise, three markers
(Rh18, Gi47, and Rh51) provide promising insight into the diversity that exist
within the G. giuris population. The mean observed heterozygosity approximates
the value of the expected heterozygosity. Moreover, heterozygosity values are
greater than 0.5 suggesting a high value of genetic diversity. For the loci
considered, genetic diversity is quite evident in the G. giuris population.
TABLE 4. Genetic diversity analysis of Glossogobius giuris population using the
following parameters: number of alleles (Na), allele size range, no. of polymorphic
alleles, polymporphism information content (PIC), and observed (Ho) and expected
(He) heterozygosities.
ALLELE
SIZE (bp)
PRIMER
Na
Min
Max
EXPECTED
SIZE RANGE
(bp)
NO. OF
POLYMORPHIC
ALLELES
PIC
Ho/He
Gi47
2
60
120
70-100
2
0.3610
0.77/0.47
Gi51
2
108
124
100-140
2
0.0905
0.10/0.10
Rh18
7
108
220
160-200
7
0.7981
0.57/0.82
Rh23
3
250
280
250-280
3
0.4345
0.50/0.52
Rh51
5
110
190
120-160
5
0.6011
0.83/0.66
Total
19
Mean
3.8
0.4570
0.55/0.51
19
Table 5 summarizes the results for the genetic diversity analysis on R.
giurinus. Number of alleles ranged from two to five. Rh51 was the most
informative marker (PIC=0.6987), followed by Gi47 (PIC=0.6345). Rh23 and
Gi51 were the least informative having PIC values lower than 0.4. This may be in
part due to the low number of polymorphic alleles observed in Rhinogobius
population using these two markers. However mean PIC still approximates the
value 0.5, which means the markers are still informative and hence may be used in
diversity studies. Mean observed heterozygosity is slightly higher than expected
and may be attributed to inherent variability of the population. A high level of
average heterozygosity in terms of the observed heterozygosity is expected to
correlate with high genetic variation at loci which are important for adaptive
response to environmental stresses (Kotze & Muller, 1994; Lieutenant-Gosselin &
Bernatchez, 2006). Hence, this would strengthen the effectivity of the markers ____________________________________________________________________________________________________________
www.philscitech.org
developed for future genetic diversity studies not only of important freshwater
goby species but of other important endemic and native freshwater species.
TABLE 5. Genetic diversity analysis of Rhinogobius giurinus population using the
following parameters: number of alleles (Na), allele size range, no. of polymorphic
alleles, polymporphism information content (PIC), and observed (Ho) and expected
(He) heterozygosities.
ALLELE
SIZE (bp)
PRIMER Na
EXPECTED
NO. OF
SIZE
POLYMORPHIC
ALLELES
Min Max RANGE(bp)
Gi47
4
60
120
70-100
Gi51
2
108
124
Rh18
3
108
Rh23
2
Rh51
5
Total
16
Mean
3.2
PIC
Ho/He
4
0.6245
0.79/0.68
100-140
2
0.3713
0.70/0.49
220
160-200
3
0.4442
0.70/0.51
210
280
250-280
2
0.2078
0.27/0.24
110
190
120-160
5
0.6987
0.88/0.74
0.4693
0.67/0.53
16
CONCLUSION
Microsatellite loci can be effectively isolated from Philippine freshwater fish
species through microsatellite-enrichment protocols. SSR primers can be designed
and utilized in future investigations on genetic diversity of native and endemic
Philippine freshwater goby species. They can also be potentially utilized for other
applications such as studies on parentage analysis, phylogenetic relationships,
breeding, and others.
ACKNOWLEDGEMENTS
The authors would like to thank Dr. Pablo P. Ocampo of the UPLB
Limnological Station, the program leader of the Fish Ark Program which provides
direction for the conservation of endemic and native Philippine freshwater fishes,
and DOST-PCAMRD, for funding the research.
The authors report no conflict of interest.
ASB drafted the manuscript. ASB, ASP and NTDA conducted all
experiments. ASB and ASP participated in the field collection of the fish
specimens. MGQD conceptualized the research and helped write the manuscript.
REFERENCES
Abdul-Muneer, PM. (2014). Application of Microsatellite Markers in Conservation
Genetics and Fisheries Management: Recent Advances in Population
Structure Analysis and Conservation Strategies. Genetics Research
International Volume 2014 (2014), Article ID 691759, 11 pages http://
dx.doi.org/10.1155/2014/691759
Allen G, Robertson D. (1994). Fishes of the Tropical Eastern Pacific. Honolulu,
HI: University of Hawaii Press
Balloux F, Lugon-Loulin F. (2002). The estimation of population differentiation
with microsatellite markers. Molecular Ecology 11, 155–165
Barroso, RM, Hilsdorf AWS, Moreira HLM, Cabello PH, and Traubcseko YM.
(2005). Genetic diversity of wild and cultured populations of Brycon
opalinus (Cuvier, 1819) (Characiforme, Characidae, Bryconiae) using
microsatellites. Aquaculture 247(1-4): 51-65
Beckmann, JS and Soller, M. (1990). Toward a unified approach to genetic
mapping of eukaryotes based on sequence tagged microsatellite sites. Bio/
Technology 8:930– 932
Cairney M, Taggart JB, Hoyheim, B. (2000). Characterization of microsatellite and
minisatellite loci in Atlantic salmon (Salmo salar L.) and cross-species
amplification in other salmonids. Mol. Ecol. 9:2175–2178
Edwards KJ, Barker JHA, Daly A, Jones C, and Karp A. (1996). Microsatellite
libraries enriched for several microsatellite sequences in plants. Biotechniques
20: 758–760
Froese R, Pauly D (eds). (2008). FishBase World Wide Web Electronic
Publication. www.fishbase.org.version(04/2008)
Froese R, Pauly D. (2010). List of Freshwater Fishes for Philippines, summarized
from FishBase country checklist freshwater fishes. world wide web electronic
publication. www.fishbase.org, version (11/2010)
22
Ghiasi N, Rashid ZA, Hooshmand S, Yusoff K, Tan SG, Bhassu S. (2009). The Use
of Locus Specific Microsatellite Markers for Detecting Genetic Variation in
Hatchery bred Probarbus jullienii. Biotechnology 8: 166-170
Glenn TC, Schable M. (2002). Microsatellite Isolation with Dynabeads.
Unpublished manual. Savannah River Ecology Laboratory, Aiken, South
Carolina
Hatanaka T and Galetti JR. (2003). RAPD markers indicate the occurrence of
structured populations in a migratory freshwater fish species. Genet. Mol.
Biol. 26(1): 19-25
Hedrick W. (2001). Conservation genetics: Where are we now? Trends in Ecology
and Evolution 16:629-636
Helfman G, Collete D, and Facey D. (1997). The Diversity of Fishes. Malden, MA:
Blackwell
Hughes JB, Daily GC and Ehrlich PR. (1997). Population diversity: its extent and
extinction. Science 278(5338): 689-694
Kotzé A. and Muller, G.H. 1994. Genetic relationship in South African cattle
breeds. In: Proceedings of the 5th world congress on genetics applied to
livestock production, Guelph, Canada. University of Guelph, Guelph,
Ontario, Canada. Volume 21: 413–416.
Labatos, BVJ and Briones, ND. (2014). Freshwater Fishes of Tikub Lake, Tiaong,
Quezon, Philippines. Asian Journal of Biodiversity 5:41-53
Larmuseau MHD, Hellemans B, Van Houdt JKJ, and Volcakaert FAM. (2007).
Development and characterization of nine polymorphic microsatellite markers
in the sand goby Pomatoschistus minutus (Gobiidae). Molecular Ecology
Notes 7(1): 147–149
Leclerc D, Wirth T, Bernatchez L. (2000). Isolation and Characterization of
Microsatellite Loci in the Yellow Perch (Perca flavescens) and Cross-species
Amplification within the Family Percidae. Mol. Ecol. 9:995-997
Lieutenant-Gosselin, M and Bernatchez, L. (2006). Local Heterozygosity-Fitness
Correlations with Global Positive Effects on Fitness in Threespine
Stickleback. Evolution 60(8): 1658-1668
Lin CJ, Wang JP, Lin HD, and Chiang TY. (2007). Isolation and characterization of
polymorphic microsatellite loci in Hemibarbus labeo (Cyprinidae) using
PCR-based isolation of microsatellite arrays (PIMA). Molecular Ecology
Notes 7(5): 788–790
Mallet J. (2005). Hybridization as an invasion of the genome. Trends Ecol.
Evol 20:229–237. doi:10.1016/j.tree.2005.02.010
Moore SS., Sargeant LL, King TJ, Mattick JS, Georges M, Hetzel DJ. (1991). The
Conservation of dinucleotide microsatellites among mammalian genomes
allows the use of heterologous PCR primer pairs in closely related species.
Genomics 10 (3):654-660
Oliveira EJ, Padua JG, Zucchi MI, Vencovsky R and Vieira MLC. (2006). Origin,
evolution and genome distribution of microsatellites. Genetics and Molecular
Biology 29(2): 294-307
Peakall R, Gilmore S, Keys W, Morgante M, Rafalski (1998). A. Cross-species
amplification of soybean (Glycine max) simple sequence repeats (SSRs)
within the genus and other legume genera: implications for the transferability
of SSRs in plants. MolBiolEvol 15(10):1275-1287
Piorski NM, Garavello JC, Arce H, and Perez MHS. (2008). Platydoras
brachylecis, a new species of thorny catfish (Siluriformes: Doradidae) from
northeastern Brazil. Neotrop. Ichthyol. 6(3): 481-494
Promega. (2007). pGEM Tand pGEM T-Easy Vector Systems Technical Manual
Instructions for Use of Products A1360, A1380, A3600 and A3610 Part #
TM042. Printed in USA, Revised 5/07
Rico C, Rico I, Hewitt G. (1996). 470 Million Years of Conservation of
Microsatellite Loci among Fish Species. Proceedings: Biological Sciences
263 (1370): 549-557
Rozen S, Skaletsky H. (2000). Primer3 on the WWW for general users and for
biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics
Methods and Protocols: Methods in Molecular Biology. Humana Press,
Totowa, NJ, pp 365-386
Shabani A, Askari G, and Moradi A. (2013). Genetic variation of Garra rufa fish in
Kermanshah and Bushehr provinces, Iran, using SSR microsatellite markers.
Molecular Biology Research Communications 2(3): 81-88
Spruell P, Hemmingsen AR, Howell PJ, Kandal N, and Allendorf FW. (2003).
Conservation genetics of bull trout: geographic distribution of variation at
microsatellite loci. Conserv. Genet. 4(1): 17-29
Stallings AF, Nelson D, Torney DC, Hildebrand CE, and Moyzis RK. (1991).
Evolution and distribution of (GT)n repetitive sequences in mammalian
genomes. Genomics 10: 807-815
Strecker U, Bernatchez L, and Wilkens H. (2003). Genetic divergence between
cave and surface populations of Astyanax in Mexico (Characidae,
Teleostei). Mol. Ecol., 12(3): 699-710
Tozaki T, Mashima S, Hirota K, Miura N, Choi-Miura N, Tomita M. (2001).
Characterization of Equine Microsatellites and Microsatellite Linked
Repetitive Elements (eMLREs) by Efficient Cloning and Genotyping
Methods. DNA Research 8:33–45
Vyskocilova M, Ondrackova M, Šimkova A, and Martin JF. (2007). Isolation and
characterization of microsatellites in Neogobius kessleri (Perciformes,
Gobiidae) and cross-species amplification within the family Gobiidae.
Molecular Ecology Notes 7: 701–704
Wasko AP, Martins M, Oliveira C, and Foresti F. (2003). Non-destructive Genetic
Sampling in Fish. An improved Method for DNA samples in fish fins and
scales. Hereditas 138(3):161-165
Wright JM, Benzen P. (1994). Microsatellites: genetic markers for the future. In:
Reviews in
Fish Biology and Fisheries (eds Carvalho GR, Pitcher
TJ), pp. 384–388. Chapman & Hall, London
Yap IV, Nelson RJ. (1996). WinBoot: UPGMA bootstrapping for binary data. IRRI
Discussion Paper, Series No. 14, pp. 1-20 ____________________________________________________________________________________________________________
www.philscitech.org
Yaraguntappa B, Prasad DT, Rani K, Kumar KP, Naika UD, Jahageerdar S,
PrakashSrivastava P, Penman DJ, Mair GC. (2007). Genetic diversity in
common carp stocks assayed by random-amplified polymorphic DNA
markers
Aquaculture
Research
38(2):
147–155
doi:10.1111/j.
1365-2109.2006.01639.x
23
Zardoya R, Vollmer DM, Craddock C, Streelman JT, Karl S, and Meyer A. (1996).
Evolutionary Conservation of Microsatellite Flanking Regions and their Use
in Resolving the Phylogeny of Cichlid Fishes (Pisces:Perciformes).
Proceedings: Biological Sciences 263 (1376): 1589-1598 ____________________________________________________________________________________________________________
www.philscitech.org
24
ARTICLE
Molecular profiling of culturable
bacteria from portable drinking water
filtration systems and tap water in
three cities of Metro Manila, Philippines
Edward A. Barlaan*, Janina M. Guarte,
and Chyrene I. Moncada
Molecular Diagnostics Laboratory, Institute of Biology, College of Science,
University of the Philippines, Diliman, Quezon City, 1101, Philippines
Abstract—Many consumers drink filtered water from portable filtration system or directly from tap water.
However, microbial community composition in portable drinking water filtration systems has not yet been
investigated. This study determined the molecular profile of culturable bacteria in biofilms and filtered water
from portable drinking water filtration systems and tap water in three key cities of Metro Manila, Philippines. A
total of 97 isolates were obtained using different growth media and characterized based on 16S rRNA gene
sequences. Most bacteria were isolated from biofilms, followed by filtered water and the least from tap water.
Many isolates were affiliated with Proteobacteria (α, β, and γ), Actinobacteria, Firmicutes and Bacteriodetes;
some had no matches or low affiliations in data bank. Many isolates were associated with bacteria that were
part of normal drinking water flora. Some were affiliated with opportunistic bacterial pathogens, soil bacteria
and activated sludge bacteria. The presence of soil and opportunistic bacteria may pose health risks when
immunocompromised consumers directly drink the tap water. Some isolates had very low percentage
homology with bacterial affiliates or without matches in the data bank suggesting different identities or
novelty of the isolates. Further studies are needed for different portable filtration systems available in the
market, drinking water quality status of other areas and functions of the isolated bacteria. This study is the
first report on the use of potato dextrose agar for isolation of bacteria from water environment. It is also the
first report on molecular profiling of culturable bacteria in biofilms and filtered water in portable drinking water
filtration systems.
Keywords—microbial community, drinking water, portable filtration systems, biofilms, water flora, 16S rRNA
INTRODUCTION
Safe drinking water is a necessity for human and other domestic consumption.
While many consumers drink bottled water, others use tap water directly or drink
the filtered water from portable filtration system. Some consumers are reluctant to
drink tap water directly due to experiences or reported cases of stomach or
diarrheal problems. Thus, some households install portable filtration systems as
source of drinking water. However, no studies have been reported yet on the
bacterial community composition of the drinking water portable filtration systems.
Therefore, there is a need to investigate the composition of cultivable bacteria from
biofilm deposits on filters and filtered water from the system in comparison with
tap water. Although drinking water source has originally undergone treatment, the
distribution systems and installations may have inadvertently introduced possible
sources of contamination. Therefore, the bacteria found on ceramic filters of the
portable filtration system would reflect the strains or species that would have been
taken in directly by the consumers using the tap water.
Waterborne diseases in many urban and rural areas in Philippines remain a
severe public health concern. Over 500,000 diarrheal diseases with an estimate of
Submitted: March 17, 2015
Revised: June 15, 2015
Accepted: July 3, 2015
more than 13,000 deaths are reported annually in the Philippines (Hutton et al.,
2008). The challenges in the country include limited access to sanitation and in
particular to sewers; high pollution of water resources; often poor drinking water
quality and poor service quality (ADB, 2007; ADB, 2013). Poor sanitation
infrastructure, fluctuations in water pressure caused by power outages, leaky pipes
and cross connections between drinking water and sewage systems lead to
introduction of waterborne pathogens and water contamination (Kumpel & Nelson,
2013). Drinking water distribution systems are, therefore, compromised and
become vulnerable to biological contamination (Fawell & Nieuwenhuijsen, 2003;
Emmanuel et al., 2009). Drinking water pathogens that cause serious problems
include bacteria such as Salmonella, Campylobacter, Shigella, Vibrio, Escherichia,
Yersinia, Legionella), protozoa including Entamoeba, Naegleria, Cryptosporidium,
Giardia) and viruses like Norovirus, Rotavirus, Adenovirus (Ashbolt, 2004).
Various technologies have been used to detect and analyze pathogens in
drinking water including traditional microscopic techniques, biochemical tests,
culture-based method, membrane filtration, multiple tube method and the most
probable number method (WHO, 2011). Other methods include biosensors
(Wilkins et al., 1999), in-situ hybridization techniques, immunological techniques
(Servais et al., 2002) and immunomagnetic-electrochemiluminescent techniques
(Yu & Bruno, 1996). However, these methods are either time-consuming,
expensive or have low sensitivity (O’Kennedy et al., 2003; Alain & Querellou,
2009; Zengler, 2009). Alternatively, polymerase chain reaction (PCR) technology
is a rapid, highly-sensitive and cost-effective method to detect a range of ____________________________________________________________________________________________________________
www.philscitech.org
waterborne pathogens in a single water sample (Tissier et al., 2012).
Pyrosequencing is another molecular approach for comprehensive understanding
of microbial community and diversity in drinking water (Navarro-Noya, et al.
2013; Liu et al., 2014). Despite the limitation, culture-dependent technique
continues to be practically useful as it provide researchers with live bacteria that
can be conserved as pure cultures and repositories of microbial strains. It also
allows practical and direct approach in assessing environmental samples,
particularly in detection of contaminants, pathogens and economically important
strains in soil, water or other environments. In bacteria, 16S rRNA gene is
commonly used and is a very powerful tool in identification.
This present study aimed to isolate bacteria from ceramic filter biofilms and
filtered water of portable drinking water filtration systems and tap water; to
identify the isolated bacteria using 16S rRNA gene sequencing; to determine
associations of isolates with other bacteria available in nucleotide data bank; and to
assess phylogenetic relationships among the isolates collected from water samples
in three cities in Metro Manila.
Sample collection
Metro Manila derives its water from the Angat Dam about 40 km to the
Northeast of Manila. The water flows through the Angat River to smaller Ipo Dam
where the water is diverted through tunnels to La Mesa Basins. From these basins,
water is provided to West Manila and East Manila, where the two private water
companies treat the raw water. The water treatment processing for East Manila
water supply involves chlorination, coagulation, flocculation, passage to settling
basins, filter beds and chlorine gas injection before it reaches the taps. Three cities
namely, Quezon City, Marikina City and Mandaluyong City were selected for
sampling to represent the East Manila. Samples were collected from an office in
the University of the Philippines in Quezon City, from a residential kitchen in
Barangay Barangka, Marikina City, and from a kitchen in Rizal Technological
University in Mandaluyong City, Philippines. New portable drinking water
filtration system (Megafresh Ceramic Water Filter System, Shen Hung Enterprise
Co., Taiwan) was installed in each site. The portable drinking water filtration
system had two cartridges: (a) cartridge with 0.9-µm ceramic water filter and (b)
water filter cartridge with granular activated carbon and silver. After one-week use,
100-ml samples were collected each from tap water, filtered water and biofilms on
ceramic filter chamber. Chlorinated tap water samples were obtained directly from
the faucet. Filtered water was collected from portable drinking water filtration
system. Biofilm microbial samples were scraped off the ceramic filter chamber and
washed with sterile water. Samples were collected in sterile 100-ml reagent bottles
and processed immediately after collection.
25
Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST) to identify
closest matches. To determine the distribution of bacterial isolates in sampling
locations, culture growth media and isolation sources, Venn diagrams were created
using Venn Diagram Generator (2015). The nucleotide sequences were aligned
using ClustalW of the MEGA 6 software (Tamura et al., 2013). The phylogenetic
tree was constructed using the Maximum-Likelihood (ML) method. Genetic
distances were computed using Kimura 2-Parameter (K2+G) model with 1000
bootstrap replicates. Methanopyrus kandleri, an archaeal methanogen, was rooted
as outgroup due to its distant affinity with bacteria.
RESULTS
Bacterial isolates
A total of 97 bacterial isolates were obtained from different culture growth
media, isolation sources and three cities (Table 1). There were 57, 30 and 10
bacteria isolated from NA, TSA and PDA, respectively (Table 1A). Most of
bacterial species or strains grew in specific medium; few strains thrived also in
different medium. The strains that grew both in NA and TSA were
Stenotrophomonas sp. Hy3tC5 (MK-BN4 and MD-BT1), Delftia sp. C-5 (MDBN5, MD-FT1 and MD-BT3) and Pseudomonas sp. SBR25 (Q-BN3 and Q-BT3)
while in NA and PDA was Pseudomonas sp. Cf0-4 (Q-BN2, Q-BP2 and Q-FP1)
(Fig. 1A). There were more bacteria isolated in biofilms (n=63), followed by
filtered water (n=31) and the least in tap water (n=3) (Table 1B). While most of the
bacteria species or strains were isolated in specific isolation source, there were
strains that were found in both biofilms and filtered water. These include
Pseudomonas sp. Cf0-4 (Q-BN2, Q-BP2 and Q-FP1), Pseudomonas sp. J4AJ (QBT1, Q-FT1, Acinetobacter sp. A17 (MD-BN4, MD-FN7), Delftia sp. C-5 (MDBN5, MD-BT3 and MD-FT1) and Cupriavidus sp. TSA49 (Q-BP3 and MD-FP1)
(Fig. 1B). Among the three cities, Quezon City had 19, Marikina City had 35 and
Mandaluyong City had 43 isolates (Table 1). Most of the bacterial strains were
exclusive to the sampled city. However, a few strains were commonly found in
Mandaluyong City and Quezon City like Cupriavidus sp. TSA49 (Q-BP3 and MDFP1) and in Marikina City and Mandaluyong City such as Stenotrophomonas sp.
Hy3tC5 (MK-BN4 and MD-BT1). Based on 16S rRNA gene sequence and BLAST
analyses, isolates were associated with bacteria belonging to Proteobacteria (α, β,
and γ), Actinobacteria and Firmicutes and uncultured clones. Some isolates had no
significant matches or associates in the nucleotide data bank (Fig. 2).
TABLE 1. Number of bacterial isolates in different (A) culture media and (B)
isolation sources from three cities of Metro Manila.
Quezon City
Marikina City
Mandaluyong City
Total
A. Culture Medium
Bacterial culture and isolation
NA
9
24
24
57
One hundred microliters (100 µl) of each tap water, filtered water and biofilm
samples were inoculated on sterilized nutrient agar (NA), potato dextrose agar
(PDA) and trypticase soy agar (TSA) (HiMedia Laboratories, India) using spread
plate method. Preparations for each culture medium were made in three replicates.
All growth media were prepared according to the instructions of manufacturers.
Culture plates were incubated at 37°C for 48 hrs. Colonies were carefully selected
based on distinct morphological differences such as colony shape, margin,
elevation, color and diameter described by Brown (2007). Isolates were further
purified via the streak plate method. In cases when two or more isolates with exact
similar morphological characters within the same culture medium and sample
source and showed exactly the same DNA sequences and homologies in BLAST
analysis, only one isolate was considered for analysis to avoid duplication.
TSA
5
10
15
30
DNA extraction
DNA of each bacterial isolate was extracted using Zymo Research Fungal/
Bacterial DNA MiniPrep (ZymoResearch Corporation, USA) according to the
manufacturer’s protocol with minor modifications. Vortexing was increased to 15
min instead of 5 min for cell lysis. DNA extracts were eluted in 100 µl DNA
Elution Buffer (ZymoResearch). DNA purity and yield were determined using the
QUANTUS Fluorometer (Promega, USA).
PDA
5
1
4
10
Total
19
35
43
97
Biofilm
12
19
32
63
Filtered water
6
15
10
31
Tap water
1
1
1
3
Total
19
35
43
97
B. Isolation Source
NA= Nutrient Agar; TSA= Trypticase Soy Agar; PDA= Potato Dextrose Agar PCR amplification and gel electrophoresis
Amplification of the 16S rRNA gene was carried out on a Veriti® 96-Well
Thermal Cycler (Thermo Fisher Scientific Inc., USA) with a 25 µl reaction mixture
containing 50 ng of DNA, 2.5 µl 10X PCR buffer (Clonetech Laboratories, USA),
1 µl 50 mM MgSO4(Clonetech), 0.5 µl 10 mM dNTP mixture (Invitrogen Life
Technologies Corporation, USA), 10 µM each of forward primer (27F:
AGAGTTTGATCMTGGCTCAG)
and
reverse
primer
(1492R:
GGYTACCTTGTTACGACTT) (Weisburg et al., 1991; Long & Azam, 2001),
0.5µl Titanium Taq Polymerase (Clonetech) and 38.8 µl PCR-grade water. The
PCR program was set as follows: an initial denaturation step at 95°C for 1 min; 25
cycles at 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, followed by a final extension
at 72°C for 3 min. Amplicons were analyzed on 0.8% agarose gel stained with
GelRed (Biotium, Hayward, CA) in 0.5X TAE buffer run at 100 V for 30 min. A
100-bp ladder (Vivantis Technologies, Selangor, Malaysia) was used as molecular
weight marker. The gels were visualized under LED transilluminator (Maestrogen,
Nevada, USA) and photographed using Alpha Imager Mini Imaging System
(ProteinSimple, USA).
A
Sequence and data analysis
Amplicons obtained from the 16S rRNA gene amplification were sent to First
BASE Laboratories (Malaysia) for sequencing. Sequences were searched against
the GenBank database through the BLASTN program of the National Center for
C
B
Figure 1. Venn diagrams showing
the specificity and overlap of
bacterial species and strains in
different growth media (A) Nutrient
Agar, Trypticase Soy Agar and
Potato Dextrose Agar,
isolate
sources (B) biofilm, filtered water and
tap water, and sampling locations (C)
Quezon City, Marikina City and
Mandaluyong City. Numbers within
circle and overlaps indicate number
of bacterial species or strains.
____________________________________________________________________________________________________________
www.philscitech.org
TABLE 2. Bacterial isolates from three cities of Metro Manila, biofilms and
filtered water of filtration systems and tap water with different information of the
closest match in NCBI data bank.
Isolate*
Closest Match
Homology
GenBank
Accession
No.
Taxonomic
Classification
MK-BT3
Bacterium clone
nck307a03c1
96%
KF106088.1
-
skin
MK-BT4
Bacterium clone
nbw665f06c2
89%
GQ111345.1
-
skin microbiome
MK-BT5
Bacterium clone
nbw168a02c1
74%
GQ075084.1
-
skin microbiome
MK-BT6
No significant matches
-
-
-
-
MK-BT7
-
-
-
-
MK-FN1
Chryseobacterium sp.
AG1-2
86%
KC560016.1
Bacteroidetes
moss
MK-FN2
-
-
-
-
MK-FN3
Barrientosiimonas
humi strain 39
96%
NR_126227.1
Actinobacteria
soil
Sources/Roles of
Associated Bacteria
Quezon City
26
Q-BN1
Pseudomonas otitidis
strain T3946d
92%
DQ298037.1
γ- proteobacteria
otitis infection
Q-BN2
Pseudomonas sp.
Cf0-4
92%
JN836274.1
γ- proteobacteria
ether enrichment
culture
Q-BN3
Pseudomonas sp.
SBR25
96%
KC936277.1
γ- proteobacteria
sludge reactor
Q-BN4
Bacterium clone
ncd1843d02c1
82%
JF158641.1
-
skin microbiome
MK-FN4
-
-
-
-
Q-BP1
Ralstonia sp. NAH8
81%
AF361022.1
β- proteobacteria
PAHs biodegradation
MK-FN5
-
-
-
-
78%
KC464453.1
γ- proteobacteria
soil
Q-BP2
Pseudomonas sp.
Cf0-4
94%
JN836274.1
γ- proteobacteria
ether enrichment
culture
MK-FN6
Pseudoxanthomonas
japonensis ZKB-2 4-4
Q-BP3
Cupriavidus sp. TSA49
88%
AB542403.1
β- proteobacteria
oligotrophic denitrifier
MK-FN7
-
-
-
-
Q-BP4
Bacterium clone
nbw97e10c1
89%
GQ008855.1
-
skin microbiome
MK-FN8
-
-
-
-
MK-FN9
-
-
-
Q-BT1
Pseudomonas sp.
J4AJ
92%
KF668329.1
γ- proteobacteria
club-rush endophyte
MK-FN10
Alpha proteobacterium
clone O-5-58
87%
KF827248.1
α- proteobacteria
biofilm
Q-BT2
Pseudomonas sp.
clone B3-51
88%
KF448083.1
γ- proteobacteria
petroleum reservoirs
MK-FN11
Enrichment culture
clone Lpl3-225
83%
JX963071.1
β- proteobacteria
landfill
Q-BT3
Pseudomonas sp.
SBR25
94%
KC936277.1
γ- proteobacteria
sequencing batch
reactor
MK-FN12
-
-
-
-
MK-FT1
Agrobacterium
tumefaciens strain
E3-2
95%
JX110584.1
α- proteobacteria
sea sediment
MK-FT2
Rhizobium massiliae
strain CCNWQLS35
82%
JX840367.1
α- proteobacteria
soil legumes
MK-FT3
Staphylococcus sp.
M5-7-5
81%
FJ832082.1
Firmicutes
fish sauce
-
-
-
-
MD-BN1
Bacterium clone
P3D1-451
93%
EF509146.1
-
endotracheal aspirate
MD-BN2
Stenotrophomonas
maltophilia strain Ysm
93%
KF278963.1
γ- proteobacteria
crowdipper endophyte
MD-BN3
Pseudomonas putida
strain JC186
90%
KJ534476.1
γ- proteobacteria
Triticum sp.
endophyte
MD-BN4
Acinetobacter sp. A17
97%
JX195717.1
γ- proteobacteria
activated sludge
MD-BN5
Delftia sp. C-5
96%
KC702840.1
β- proteobacteria
soil
MD-BN6
Pseudomonas
aeruginosa strain
SMVIT-1
93%
KJ671465.1
γ- proteobacteria
oil spill soil sample
MD-BN7
Ponticoccus gilvus
strain 19-DR
95%
JN712171.1
Actinobacteria
bark beetle gut
MD-BN8
Micrococcus luteus
strain LHR-04
89%
HE716930.1
Actinobacteria
reed necrotic lesion
MD-BN9
Pseudomonas
aeruginosa strain
SZH16
93%
GU384267.1
γ- proteobacteria
phenol-degradation
MD-BN10
Pseudomonas
aeruginosa strain
L1R2-2
96%
EU139850.1
γ- proteobacteria
soil
MD-BN11
Pseudomonas
aeruginosa strain
L1R2-3
94%
EU139850.2
γ- proteobacteria
soil
MD-BN12
Pseudomonas
aeruginosa strain MBL
79%
KF811604.1
γ- proteobacteria
Clarias gariepinus
lesion
MD-BN13
Bacterium clone L3B53
93%
KJ548976.1
-
hydrothermal field
water
MD-BN14
Bacterium clone
P7D1-424
82%
EF509404.1
-
endotracheal aspirate
Q-BT4
Bacterium clone
ncd1521h06c1
83%
JF132930.1
-
skin microbiome
Q-FN1
Pseudomonas sp.
P7(2009b)
87%
GU113077.1
γ- proteobacteria
lake water
Q-FN2
Pseudomonas sp.
BND-BHI2
86%
HQ613832.1
γ- proteobacteria
mosquito midgut
Q-FN3
Bacterioplankton clone
E305B_42
94%
KC002489.1
-
seawater surface
MK-TN1
Mandaluyon
g City
Q-FN4
Kocuria sp. 97H2c
86%
KJ744013.1
Actinobacteria
soil
Q-FP1
Pseudomonas sp.
Cf0-4
89%
JN836274.1
γ- proteobacteria
ether enrichment
culture
Q-FT1
Pseudomonas sp.
J4AJ
97%
KF668329.1
γ- proteobacteria
club-rush endophyte
Q-TN1
Brachybacterium sp.
clone iso5_d
Actinobacteria
salt-secreting desert
tree
78%
EU175952.1
Marikina
City
MK-BN1
Kocuria rhizophila
strain DC2201
97%
NR_074786.1
Actinobacteria
soil
MK-BN2
Bacterium clone B38
96%
HQ697426.1
-
activated carbon
MK-BN3
-
-
-
-
MK-BN4
Stenotrophomonas sp.
Hy3tC5
97%
KJ563080.1
γ- proteobacteria
bark beetle
MK-BN5
Staphylococcus
arlettae strain LCR34
98%
FJ976543.1
Firmicutes
paddy field soil
MK-BN6
Bacterium clone
nck177d11c1
96%
KF093565.1
-
skin
MK-BN7
Bacterium clone
nbw158b08c1
85%
GQ073811.1
-
skin microbiome
MK-BN8
Bacterium clone
ncd2424c04c1
81%
JF210534.1
-
skin microbiome
Pseudomonas
alcaligenes strain
B2M2O
84%
MK-BN10
-
-
-
-
MK-BN11
-
-
-
-
MK-BP1
Bacterium clone
nbw1134b02c1
87%
GQ080114.1
-
skin microbiome
MK-BT1
-
-
-
-
MD-BN15
Bacillus pumilus strain
FeRB-FL1404
93%
KM405294.1
-
soil
MK-BT2
Bacterium clone
ncm71c06c1
73%
KF108464.1
-
skin
MD-BN16
Pseudomonas sp.
SSKSD6
98%
KF751674.1
Firmicutes
river
MK-BN9
JN644066.1
γ- proteobacteria
river biofilm
____________________________________________________________________________________________________________
www.philscitech.org
MD-BP1
Bacterium clone
ncd2190f07c1
94%
JF190687.1
-
skin microbiome
MD-BP2
Vibrio sp. 442
93%
AB081772.1
γ- proteobacteria
Japanese flounder
MD-BP3
Pseudomonas sp.
RPT-52
96%
JF756593.1
γ- proteobacteria
soil
MD-BT1
Stenotrophomonas sp.
Hy3tC5
95%
KJ563080.1
γ- proteobacteria
beetle
MD-BT2
Stenotrophomonas
maltophilia strain
BBE11-1
95%
JQ619623.1
γ- proteobacteria
keratin wastes
biodegradation
MD-BT3
Delftia sp. C-5
98%
KC702840.1
β- proteobacteria
soil
MD-BT4
Pseudomonas
aeruginosa strain F4
91%
HF572851.1
γ- proteobacteria
soil
MD-BT5
Pseudomonas
aeruginosa strain
GiTPA
92%
FJ823152.1
γ- proteobacteria
oral cavity
MD-BT6
Pseudomonas
aeruginosa strain
HOB1
89%
EU849119.1
γ- proteobacteria
canal sediment
MD-BT7
Pseudomonas
aeruginosa isolate D2
93%
LK391633.1
γ- proteobacteria
soil
MD-BT8
Bacterium clone
nbw227d02c1
91%
GQ068996.1
-
skin microbiome
MD-BT9
Proteus mirabilis strain
SZH18
88%
GU384269.1
γ- proteobacteria
phenol-degradation
MD-BT10
Bacterium clone
16sps26-3h01.p1ka
83%
FM997495.1
-
sputum
MD-BT11
Pseudomonas
aeruginosa strain
PGPR 10
87%
KF640236.1
γ- proteobacteria
tomato root surface
MD-BT12
Pseudomonas sp.
LJLP1-15
90%
DQ140184.1
γ- proteobacteria
biofilm
MD-BT13
Pseudomonadaceae
bacterium ALE_F7
93%
GQ128373.1
γ- proteobacteria
activated carbon filters
MD-FN1
Delftia sp. X-a12
94%
JX997845.1
β- proteobacteria
oil production water
MD-FN2
Bacterium clone
FPURT2-B01
79%
GU166615.1
-
citrus roots/
rhizospheres
MD-FN3
Bacterium clone
ncd759d10c1
89%
HM295740.1
-
skin microbiome
MD-FN4
Bacterium clone
nbw124g01c1
92%
GQ024639.1
-
skin microbiome
MD-FN5
Pseudomonas
aeruginosa isolate L1
92%
LK391632.1
γ- proteobacteria
soil
MD-FN6
Microbacterium
oleivorans strain DSR8
96%
JQ342859.1
Actinobacteria
soil
MD-FN7
Acinetobacter sp. A17
97%
JX195717.1
γ- proteobacteria
activated sludge
MD-FP1
Cupriavidus sp. TSA49
94%
AB542403.1
β- proteobacteria
oligotrophic denitrifier
MD-FT1
Delftia sp. C-5
95%
KC702840.1
β- proteobacteria
soil
MD-FT2
Micrococcus luteus
strain SCAU-A-105
95%
KJ671455.1
Actinobacteria
salt lake in China
MD-TN1
Bacterium clone
ncd1554h06c1
94%
JF135142.1
-
skin microbiome
27
26
Bacterial community composition in Marikina City
Most of the bacterial isolates in Marikina City (66%) were associated with
uncultured bacterial clones or without significant matches found in data bank
(Table 2). With known associates, isolates were related to Proteobacteria (MKBN4, MK-BN9, MK-FN6, MK-FN10, MK-FN11, MK-FT1 and MK-FT2)
specifically to genera Stenotrophomonas, Pseudomonas, Pseudoxanthomonas,
Agrobacterium and Rhizobium; Actinobacteria (MK-BN1 and MK-FN3) to
genera Kocuria and Barrientosiimonas; and Firmicutes (MK-BN5 and MK-FT3)
to Staphylococcus. Genera Staphylococcus, Chryseobacterium, Barrientosiimonas,
Pseudoxanthomonas, Agrobacterium and Rhizobium were exclusively found in
Marikina.
There were relatively more isolates obtained in biofilms (19) than in filtered
water (15) while only one isolate in tap water (Table 1B). Isolates from biofilm
were related to genera Kocuria, Stenotrophomonas, Staphylococcus, Pseudomonas
and mostly uncultured bacterial clones or without matched associates (Table 2).
Bacterial isolates from filtered water were affiliated with Chryseobacterium,
Barrientosiimonas, Pseudoxanthomonas, Agrobacterium, Staphylococcus and
uncultured clones or unknown associates. Isolate from tap water had no known
relative in the data bank. Except for isolates MK-BN1, MK-BN4 and MK-BN5, all
other isolates had relatively lower percentage homology (73-96%).
Bacterial community composition in Mandaluyong City
*Q= Quezon City; MK= Marikina City; MD= Mandaluyong City; B= Biofilm; F= Filtered water; T= Tap water; N=
Nutrient Agar; T= Trypticase Soy Agar; P= Potato Dextrose Agar.
Bacterial community composition in Quezon City
Majority of bacterial isolates (63%) from Quezon City were affiliated to
Phylum Proteobacteria (Table 2). About 53% belonged to γ Proteobacteria
particularly to genus Pseudomonas (Q-BN1, Q-BN2, Q-BN3, Q-BP2, Q-BT1, QBT2, Q-FN1, Q-FN2, Q-FP1 and Q-FT1) and 10% to β Proteobacteria specifically
to genera Ralstonia (Q-BP1) and Cupriavidus (Q-BP3). Other isolates belonged to
Phylum Actinobacteria particularly to genera Kocuria (Q-FN4) and
Brachybacterium (Q-TN1) and some were associated with unidentified and
uncultured bacterial clones (Q-BN4, Q-BP4, Q-BT4 and Q-FN3). In comparison
with other cities, the genera Ralstonia and Brachybacterium were exclusively
found in Quezon City.
There were 12 isolates obtained from biofilm, which were associated with
genera Pseudomonas, Ralstonia, Cupriavidus and uncultured clones; six isolates
from filtered water, which were related to Pseudomonas, Kocuria and uncultured
clones; and one from tap water with close association to Brachybacterium (Table
1B, Table 2). Except Q-FT1, most isolates had relatively low percentage homology
(78- 96%) with their associates.
Many bacterial isolates were related with Proteobacteria (64%) in
Mandaluyong City (Table 2). Among the three cities, it comprised more genera
under Proteobacteria such as Stenotrophomonas (MD-BN2, MD-BT1 and MDBT2), Pseudomonas (MD-BN3, MD-BN6, MD-BN9 – MD-BN12, MD-BP3,
MD-BT4 – MD-BT7, MD-BT9, MD-BT11 – MD-BT13 and MD-FN5),
Acinetobacter (MD-BN4 and MD-FN7), Delftia (MD-BN5, MD-BT3, MD-FN1
and MD-FT1), Vibrio (MD-BP2), Proteus (MD-BT9) and Cupriavidus (MD-FP1).
Other bacterial isolates belonged to Actinobacteria including genera Ponticoccus
(MD-BN7), Micrococcus (MD-BN8) and Micrococcus (MD-FT2) and Firmicutes
with genus Bacillus (MD-BN16). Genera Ponticoccus, Micrococcus, Bacillus,
Proteus, Vibrio, Microbacteriumo and Micrococcus were exclusively found in
Mandaluyong City.
There were 32 bacteria isolated from biofilm, 10 from filtered water and 1
from tap water (Table 1B). Isolates from biofilm were associated with one or more
species of Pseudomonas, Stenotrophomonas, Acinetobacter, Delftia, Vibrio and
Proteus (Table 2). Different strains of Pseudomonas aeruginosa and
Stenotrophomonas maltophilia were notably observed. In filtered water, bacterial
isolates were related to Delftia, Pseudomonas, Microbacterium, Acinetobacter,
Cupriavidus and uncultured clones. Isolate from tap water was associated with
uncultured bacterial clone. Except for MD-BN4, MD-BN17, MD-BT3 and MDFN7, isolated bacteria had relatively lower % homology (79- 96%) to the
associated bacteria.
Phylogenetic analysis
Phylogenetic analysis revealed that most of bacterial isolates generally
clustered according to the city where they were sampled (Fig. 2). However, some
isolates were found to cluster with other locations or phyla particularly those
isolates associated with uncultured bacterial clones, without significant matches in
the data bank or isolates that were common to one more locations. Based on
phylogenetic analysis, 97 isolates from three cities belonged to Phyla
Proteobacteria, Actinobacteria, Firmicutes and bacterial group without matches or
low affiliations in database (Fig. 2). Proteobacteria constitute the two clusters of
the topmost clade encompassing most of the isolates from Quezon City and
Mandaluyong City. Actinobacteria and Firmicutes comprised the clusters in middle
clade. Branching out from the three phyla were clusters of bacterial groups with no
matches or bacteria with generally low affiliations in the databank, which
constituted bacterial isolates mostly from Marikina City.
DISCUSSION
Many consumers use filtered water from portable filtration systems or tap
water directly from the faucet for drinking or other household consumption.
However, there is limited information on the bacterial community composition in
these environments. This present study elucidates the bacterial composition based
on the molecular profiles of culturable bacteria isolated from biofilms and filtered
water in portable filtration systems and tap water in three cities of Metro Manila.
These bacteria were isolated using different growth media such as NA, TSA and
PDA. The use of multiple non-selective media in isolation from environmental
samples increases the opportunity to isolate more cultivable bacteria. This was
shown by diverse bacterial composition and number in each culture medium. Many
of the bacterial isolates grew in specific growth medium except for some isolates
like Q-BN2 and Q-BP2 (both associated with Pseudomonas sp. Cf0-4) that grew in
NA and PDA and MD-BN5 and MD-BT3 (both related to Delftia sp. C-5) that
thrived in NA and TSA. PDA is a known medium specific for fungal culture and
isolation. However, it has not been utilized for bacterial isolation from
environments. PDA has been used in some studies to test bacterial inhibition of
fungal growth, where bacterial isolates were only allowed to diffuse onto PDA
culture plates (Molva & Baysal, 2014; Sivanantham et al., 2013; Khan et al.,
2010). This present study is the first report on the use of PDA for isolation and
culture of bacteria from water environment. Further studies are needed to
investigate the extended use of PDA for bacterial culture and isolation from
different environments including the mechanisms of bacterial growth in PDA.
Despite using different growth media, still the number of bacteria isolated was
relatively few (97 isolates). This could be expected because in freshwater ____________________________________________________________________________________________________________
www.philscitech.org
environments only 0.25 % of bacteria are culturable (Amann et al., 1995).
Alternatively, pyrosequencing or metagenomics may be used in future studies for
comprehensive identification of bacteria in biofilms and filtered water in portable
filtration systems and tap water.
64
54
77
92
96
70
88
90
62
51
98
58
78
63
73
50
58
88
97
80
96
56
52
87
66
93
54
58
60
58
62
64
97
Q-BN1
Q-FT1
Q-BT3
Q-BN2
Q-BN3
Q-BP2
Q-FP1
Q-FN2
Q-BT1
Q-BT2
Q-FN1
MD-BN4
MD-FN7
MK-BT4
Q-BP4
Q-BT4
MD-BN3
MK-BN2
MK-BN9
MD-BP2
MD-BT9
MD-BN2
MD-BT1
MD-BN13
Proteobacteria
MD-BT2
MK-BN4
MD-FN4
Q-BP3
MD-FP1
Q-BP1
MD-FN1
MD-BN5
MD-BT3
MD-FT1
MD-BN9
MD-BN16
MD-FN5
MD-BP3
MD-BN1
MD-BT4
MD-BT6
MD-BT5
MD-BN6
MD-BT7
MD-BN10
MD-BN11
MD-BN12
MD-BT11
MD-BT12
MK-BT6
MK-BT7
MK-BN11
MD-BT13
MD-BN14
MD-BT10
MK-BN1
MK-FN3
Q-FN4
Actinobacteria
MD-FT2
Q-TN1
MK-BT1
MD-BT8
MK-BN8
MD-FN6
MD-BN7
MD-TN1
MK-BN3
MD-BN8
MK-BT5
MD-FN2
MK-BN10
MK-BP1
MK-FT3
MK-BN7
Firmicutes
MK-BT2
MK-BT3
MD-BN15
MD-BP1
Q-BN4
MK-BN5
MK-BN6
MK-TN1
MK-FN6
MK-FN4
MK-FN5
MK-FN7
Bacteria with no matches
MK-FN2
MK-FN9
MK-FN8
MK-FN11
MK-FN12
Q-FN3
MK-FN10
MD-FN3
Other bacteria
MK-FT1
MK-FT2
MK-FN1
Methanopyrus kandleri
Figure 2. Phylogenetic relationship of bacterial isolates from biofilms,
filtered water and tap water in three sampled cities. The phylogenetic tree
was constructed using the Maximum-Likelihood method. Genetic distances
were computed using Kimura 2-Parameter (K2+G) model. Numbers beside
branches represent bootstrap scores above 50% from 1000 bootstrap
iterations.
28
Based on 16S rRNA gene sequences of isolated bacteria, BLAST and
phylogenetic analyses revealed more bacterial diversity in isolates obtained from
Mandaluyong City than other cities. It was composed of isolates associated with
different genera of β and γ Proteobacteria, Actinobacteria and Firmicutes. Besides,
it also showed different strains of Pseudomonas aeruginosa and Stenotrophomonas
maltophilia. While isolates in Quezon City were predominated with Proteobacteria
associates like Pseudomonas, 60% of the isolates in Marikina City were associated
with uncultured bacterial clones and without affiliates in the data bank. This would
suggest that these isolates have different identities or these are novel species or
strains. It is also interesting to note that while most of the isolates were exclusive
in specific city, some strains were found also in other cities. This is exemplified by
Cupriavidus sp. TSA49, same associate of isolates Q-BP3 in Quezon City and
MD-FP1 in Mandaluyong City and Stenotrophomonas sp. Hy3tC5, an affiliate of
isolates MD-BT1 of Mandaluyong City and MK-BN4 of Marikina City. This might
be expected because these three cities have a common source for drinking water.
Absence of other isolates in across cities might be attributed to specificity, scarcity
or less abundance of the strains in sampled location or difference in sampling
dates.
There were differences in number and composition of isolates obtained from
biofilm of ceramic filters, filtered water and tap water. Generally, more bacteria
were isolated in biofilms than in filtered water in three cities; tap water consistently
had the least. Although water treatment plants ensure removal of impurities from
drinking water, many factors can adversely affect water quality on the way to its
consumers. One is the introduction of bacteria to the distribution networks via
mechanical failures such as breaks and leakages of the pipelines in the distribution
systems (Momba et al., 2000). Another factor is the formation of biofilms which
can colonize drinking water filters or water distribution pipes (Daschner et al.,
1996). This could also occur in portable filtration systems since biofilms develop
on all surfaces in contact with non-sterile water (Flemming, 2011). It was reported
that 95% of the bacterial population in a drinking water system are located not on
the water phase but on biofilms growing on the surface of the container or
distributing pipe (Flemming et al., 2002).
In this study, it was observed that filtered water also contained bacteria but
with different composition and lower number than that of the biofilms. It was
evident that on the ceramic filters many bacterial species and strains were trapped
like the different species of Pseudomonas in Quezon City and strains of
Pseudomonas aeruginosa in Mandaluyong City. However, there was a reduction in
number of different species or strains or loss of some species in filtered water.
Nevertheless, this has implication on the imperative use of portable filtration
systems in households to minimize or if not completely control the intake of
impurities and opportunistic bacterial pathogens. On the other hand, some species
or strains isolated on ceramic filter were also found in filtered water. This was
apparent in Quezon City-isolated bacteria such as Q-BP2, which was found in
ceramic filters and Q-FP1 in filtered water, which were both were associates of
Pseudomonas sp. Cf0-4 and Q-BT1 from biofilm and Q-FT1 from filtered water,
which were both affiliates of Pseudomonas sp. J4AJ. This was also observed in
Mandaluyong City isolates like MD-BN4 in biofilm and MD-FN7 in filtered water,
which were related to Acinetobacter sp. A17 and isolates MD-BT3 in biofilm and
MD-FT1 in filtered water, both were affiliated with Delftia sp. C-5. This could be
attributed to filter overflow or ceramic filters not cleaned due to excessive deposits
of biofilms. Filter overflow increases the bacterial load of filtered water when water
from the filter lip seeps onto the rim of the collection receptacle (Baumgartner et
al., 2007). There is, therefore, a need to clean the ceramic filter regularly
particularly when deposits of biofilms occur due to prolonged use to prevent or
minimize contaminations in filtered water. Besides, the portable filtration system
used in the study contained 0.9-µm ceramic filter, which may not completely trap
the bacterial cells in ceramic filter cartridge. Thus, allowing some bacteria to thrive
in water filter cartridge with granular activated carbon and silver. Although
granular activated carbon in portable filtration system aids in disinfection, it does
not guarantee the destruction of all bacteria (USEPA, 2001). Further studies are
needed for different portable filtration systems available in the market in improving
the quality of drinking water and their effects in human health. While ceramic
filters and filtered water contained many bacteria, unexpectedly, only a single
isolate was cultured in tap water for each city. This could be attributed to
chlorination and disinfecting residues causing decline in bacterial phylotypes
(Poitelon et al., 2010). Besides, continuous supply or flushing of water might have
limited the growth of bacteria in tap water. Bacteria were detected less frequently
and at lower concentrations in samples from taps supplied continuously compared
to those supplied intermittently (Kumpel & Nelson, 2013).
Isolated bacteria from biofilms, filtered water and tap water in three sampled
cities were related to different genera or species. Based on BLAST and
phylogenetic analyses, these isolates were associated with bacteria found in natural
water flora, opportunistic bacterial pathogens, soil bacteria or activated sludge
bacteria. Stenotrophomonas, Pseudomonas and Acinetobacter are representative
genera that are naturally found in potable water (Rusin et al., 1997). Byrd et al.
(1991) pointed out that Pseudomonas spp. attained the highest survival in drinking
water compared to other gram-negative bacteria. Silby et al. (2011) supported it
with a comprehensive report on the metabolic flexibility of Pseudomonas spp.
enabling them to adapt to various terrestrial and aquatic environments. Different
strains of Pseudomonas aeruginosa (MD-BN6, MD-BN9, MD-BN10, MD-BN11,
MD-BN12, MD-BT4, MD-BT5, MD-BT6, MD-BT7, MD-BT11 and MD-FN5),
many of which were from soil , were isolated mostly from biofilms in
Mandaluyong City. P. aeruginosa is a ubiquitous soil and waterborne opportunistic
pathogen that constitutes a health risk to immunocompromised patients (Herath et
al., 2014). In addition, it is regarded as an indicator of fecal contamination
(Warburton, 1993; Clesceri et al., 1998). Stenotrophomonas maltophilia is an
important nosocomial pathogen of immunocompromised patients (Safdar & ____________________________________________________________________________________________________________
www.philscitech.org
Rolston, 2007). Cases of S. maltophilia outbreaks due to defective sink drain and
contaminated storage tanks for deionized water were previously reported (Verweij
et al., 1998). So far, there were no bacterial isolates associated with water bacterial
pathogens that cause serious problems like Salmonella, Campylobacter, Shigella,
Vibrio, Escherichia, Yersinia and Legionella. From three sampled cities, there were
other isolates found to be associated with soil bacteria. These include the following
isolates with their corresponding associates: Q-FN4 (Kocuria sp. 97H2c), MKBN1 (Kocuria rhizophila), MK-BN5 (Staphylococcus arlettae), MK-FN3
(Barrientosiimonas humi), MK-FN6 (Pseudoxanthomonas japonensis), MK-FN11
(Beta proteobacterium clone Lpl3-225), MD-BN5, MD-BT3 and MD-FT1 (Delftia
sp. C-5), MD-BN10, MD-BN11, MD-BT4, MD-BT7 and MD-FN5 (Pseudomonas
aeruginosa), MD-BN15 (Bacillus pumilus) and MD-FN6 (Microbacterium
oleivorans). The presence of soil bacteria in biofilms and filtered water would
suggest pipe leakage and entry of soil bacteria in distribution systems or water
supply. There were also isolates associated with bacteria involved in activated
sludge such as MK-BN2 (Bacterium clone B38), MD-BN4 (Acinetobacter sp.
A17) and MD-BT13 (Pseudomonadaceae bacterium ALE_F7). These bacteria
maybe involved in breaking down of organic matter into carbon dioxide, water,
and other inorganic compounds. The bacterial composition found on ceramic filters
of portable filtration system, either as a result of bacterial growth or trap on the
filters, has implications to consumers. This may reflect the bacterial strains or
species that would have been taken in when the consumers directly drink the tap
water, that is, without the use of portable filtration systems.
Many of the isolates have relatively low percentage homology (73- 98%) with
the associated bacteria. Although this study showed associations of isolates with
different types of bacteria in drinking water environment, further investigations are
needed to verify the roles and functions of the isolates. There were also many
isolates with very low percentage homology with bacterial affiliates or without
matches in the data bank. These would suggest different identities or novelty of
isolated bacteria. Further studies are needed using molecular, biochemical and fatty
acid profiling approaches to confirm their identities. There have been studies on
microbial communities in filtration systems; however, these are restricted to large
scale membrane filtration systems (Chen et al., 2004; Kwon et al., 2011). Other
studies include microbiological contamination of drinking water in commercial
household water filter systems but it was limited to bacterial counts (Daschner et
al., 1996). Some were restricted to microbial community analysis but in potable
drinking water (Pindi & Yadav, 2011). So far, this present study is the first report
on molecular profiling of culturable bacterial community in drinking water
portable filtration systems.
CONCLUSIONS
This study reports the molecular profile of culturable bacteria found in
biofilms and filtered water from portable drinking water filtration systems and tap
water. It showed differences in bacterial community compositions of the three
sampled cities. Some of the genera identified were part of the normal water flora;
however, some genera were associated with soil bacteria, opportunistic bacterial
pathogens and activated sludge bacteria. The soil bacteria in filtration systems may
be attributed to pipeline leakages, installation and maintenance in distribution
systems or supplied water itself. The presence of opportunistic pathogens in
drinking water would pose public health risks particularly for the vulnerable adults
and children. Although the use portable filtration system has been emphasized,
further studies are needed for the different portable filtration systems available in
the market to investigate their efficiency in improving the quality of drinking water
including the effects to the consumers. In this study, there were more isolates in the
filter effluent than in the tap water. It could be possible that the prolonged use of
water filters may degrade the water quality, by allowing biofilm to grow and the
chlorine residual to dissipate. Future studies should focus on expanding the
investigation of drinking water quality status in other areas or countries and on
examining the roles and functions of the isolated bacteria.
ACKNOWLEDGEMENTS
The authors would like to especially thank Cassandra Elize M. Perez and
Rachel Grace F. Macabaso for technical support and assistance in manuscript
preparation and the staff of the Molecular Diagnostics Laboratory, Institute of
Biology, University of the Philippines, Diliman for technical assistance. We are
grateful to Dr. Jonas P. Quilang and Dr, Gil M. Penuliar for their critical reading
and valuable suggestions for the improvement of the manuscript.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest related to the study, and in the
preparation and submission of the manuscript.
CONTRIBUTION OF INDIVIDUAL AUTHORS
Dr. Edward A. Barlaan conceptualized the study, designed the experiments
and wrote the manuscript. Janina M. Guarte and Chyrene I. Moncada performed
the experiments.
REFERENCES
Asian Development Bank (ADB) (2007). Achieving Water Security for Asia: Asian
water development outlook, 2007. Asian Pacific Water Forum.
29
Asian Development Bank (ADB) (2013). Measuring Water Security in Asia and
the Pacific: Asian water development outlook 2013. Asian Pacific Water
Forum.
Alain, K., & Querellou, J. (2009). Cultivating the uncultured: limits, advances and
future challenges. Extremophiles, 13(4), 583-594.
Amann, R. I., Ludwig, W., & Schleifer, K. H. (1995). Phylogenetic identification
and in situ detection of individual microbial cells without cultivation.
Microbiological reviews, 59(1), 143-169.
Ashbolt, N. J. (2004). Microbial contamination of drinking water and disease
outcomes in developing regions. Toxicology, 198(1), 229-238.
Baumgartner, J., Murcott, S., & Ezzati, M. (2007). Reconsidering 'appropriate
technology': the effects of operating conditions on the bacterial removal
performance of two household drinking-water filter systems. Environmental
Research Letters, 2(2), 1-6.
Brown, A.E. (2007). Benson’s Microbiological Application: Laboratory Manual in
General Microbiology. Boston: Mc Graw –Hills Higher Education.
Byrd, J. J., Xu, H. S., & Colwell, R. R. (1991). Viable but nonculturable bacteria in
drinking water. Applied and Environmental Microbiology, 57(3), 875-878.
Chen, C. L., Liu, W. T., Chong, M. L., Wong, M. T., Ong, S. L., Seah, H., & Ng,
W. J. (2004). Community structure of microbial biofilms associated with
membrane-based water purification processes as revealed using a polyphasic
approach. Applied Microbiology and Biotechnology, 63(4), 466-473.
Cleceri, L. S., Greenberg, A. E., & Eaton, A. D. (1998). Standard methods for the
examination of water and wastewater. American Public Health Association,
American Water Works Association, and Water Environment Association,
Washington, DC, USA.
Daschner, F. D., Rüden, H., Simon, R., & Clotten, J. (1996). Microbiological
contamination of drinking water in a commercial household water filter
system. European Journal of Clinical Microbiology and Infectious
Diseases, 15(3), 233-237.
Emmanuel, E., Pierre, M. G., & Perrodin, Y. (2009). Groundwater contamination
by microbiological and chemical substances released from hospital
wastewater: Health risk assessment for drinking water consumers.
Environment International, 35(4), 718-726.
Fawell, J., & Nieuwenhuijsen, M. J. (2003). Contaminants in drinking water:
environmental pollution and health. British Medical Bulletin 68(1): 199-208.
Flemming, H., Percival, S., & Walker, J. (2002). Contamination potential of
biofilms in water distribution systems. Water Supply, 2(1), 271-280.
Flemming, H. C. (2011). Microbial biofouling: Unsolved problems, insufficient
approaches, and possible solutions. In Biofilm highlights (pp. 81-109).
Springer Berlin Heidelberg.
Herath, A. T., Abayasekara, C. L., Chandrajith, R., & Adikaram, N. K. B. (2014).
Pseudomonas aeruginosa in bottled drinking water in Sri Lanka: a potential
health hazard. Water Science & Technology: Water Supply, 14(6), 1045-1050.
Hutton, G., Rodriguez, U. E., Napitupulu, L., Thang, P., & Kov, P. (2008).
Economic impacts of sanitation in Southeast Asia. Washington DC: World
Bank, Water and Sanitation Program.
Kumpel E., & Nelson K. L. (2013). Comparing microbial water quality in an
intermittent and continuous piped water supply. Water Research 47(14):
5176-88.
Kwon, S., Moon, E., Kim, T. S., Hong, S., & Park, H. D. (2011). Pyrosequencing
demonstrated complex microbial communities in a membrane filtration
system for a drinking water treatment plant. Microbes and
Environments, 26(2), 149-155.
Liu, G., Bakker G. L., Li, S., Vreeburg, J. H., Verberk, J. Q. Medema, G. J., Liu,
W. T., & Van Dijk J. C. (2014). Pyrosequencing reveals bacterial communities
in unchlorinated drinking water distribution system: an integral study of bulk
water, suspended solids, loose deposits, and pipe wall biofilm. Environmental
Science & Technology, 48(10), 5467-76.
Long, R. A., & Azam, F. (2001). Microscale patchiness of bacterioplankton
assemblage richness in seawater. Aquatic Microbial Ecology, 26, 103-113.
Khan, M.R., Brien, E.O., Carney, B.F., and Doohan, F.M. (2010) A fluorescent
pseudomonad shows potential for the control of net blotch disease of barley.
Biological Control, 54, 41-45.
Molva, C., & Baysal, A. H. (2014) Effect of sporulation medium on wet-heat
resistance and structure of Alicycobacillus acidoterrestris DSM 3922-type
strain spores and modeling of the inactivation kinetic in apple juice.
International Journal of Food Microbiology, 189, 82-88.
Momba, M. N. B., Kfir, R., Venter, S. N., & Cloete, T. E. (2000). An overview of
biofilm formation in distribution systems and its impact on the deterioration
of water quality. Water SA, 26(1), 59-66.
Navarro-Noya, Y. E., Suárez-Arriaga, M. C., Rojas-Valdes, A., Montoya-Ciriaco,
N. M., Gómez-Acata, S., Fernández-Luqueño, F., & Dendooven, L. (2013).
Pyrosequencing analysis of the bacterial community in drinking water wells.
Microbial Ecology, 66(1), 19-29.
O’Kennedy, R. Leonard, P., Hearty, S., Brennan, J., Dunne, L., Quinn, J., &
Chakraborty, T (2003). Advances in biosensors for detection of pathogens in
food and water. Enzyme and Microbial Technology, 32(1), 3-13.
Pindi, P., & Yadav, P. R. (2011). Bacterial diversity in potable drinking water of
Mahabubnagar District (A.P) India. Bioscience Discovery: An International
Journal of Life Sciences, 2(1), 32.
Poitelon, J. B., Joyeux, M., Welté, B., Duguet, J. P., Prestel, E., & DuBow, M. S.
(2010). Variations of bacterial 16S rDNA phylotypes prior to and after
chlorination for drinking water production from two surface water treatment
plants. Journal of Industrial Microbiology & Biotechnology, 37(2), 117-128.
Rusin, P. A., Rose, J. B., Haas, C. N., & Gerba, C. P. (1997). Risk assessment of
opportunistic bacterial pathogens in drinking water. In Reviews of
environmental contamination and toxicology (pp. 57-83). Springer New York. ____________________________________________________________________________________________________________
www.philscitech.org
Safdar, A., & Rolston, K. V. (2007). Stenotrophomonas maltophilia: changing
spectrum of a serious bacterial pathogen in patients with cancer. Clinical
Infectious Diseases, 45(12), 1602-1609.
Servais, P., Rompré, A., Baudart, J., de-Roubin, M. R., & Laurent, P. (2002).
Detection and enumeration of coliforms in drinking water: current methods
and emerging approaches. Journal of Microbiological Methods, 49(1), 31-54.
Silby, M. W., Winstanley, C., Godfrey, S. A., Levy, S. B., & Jackson, R. W. (2011).
Pseudomonas genomes: diverse and adaptable. FEMS Microbiology
Reviews, 35(4), 652-680.
Sivanantham, T., Rasaiyah, V., Satkunanathan, N., & Thavaranjit, A.C. (2013). In
vitro screening of antagonistic effect of soil borne bacteria on some selected
phytopathogenic fungi. Archives of Applied Science Research, 5 (1), 1-4.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:
molecular evolutionary genetics analysis version 6.0. Molecular Biology and
Evolution, 30(12), 2725-2729.
Tissier, A., Denis, M., Hartemann, P., & Gassilloud, B. (2012). Development of a
rapid and sensitive method combining a cellulose ester microfilter and a realtime quantitative PCR assay to detect Campylobacter jejuni and
Campylobacter coli in 20 liters of drinking water or low-turbidity waters.
Applied and Environmental Microbiology, 78(3), 839-845.
U.S. Environmental Protection Agency (USEPA) (2001) Controlling disinfection
by-products and microbial contaminants in drinking water. EPA/600/R-01/110,
Office of Research and Development, Washington D.C.
30
Venn Diagram Generator (2015). Venn Diagram Generator [online software].
Retrieved from: http://www.pangloss.com/seidel/Protocols/venn.cgi
Verweij, P. E., Meis, J. F. G. M., Christmann, V., Van der Bor, M., Melchers, W. J.
G., Hilderink, B. G. M., & Voss, A. (1998). Nosocomial outbreak of
colonization and infection with Stenotrophomonas maltophilia in preterm
infants associated with contaminated tap water. Epidemiology and
Infection, 120(03), 251-256.
Warburton, D. W. (1993). A review of the microbiological quality of bottled water
sold in Canada. Part 2. The need for more stringent standards and regulations.
Canadian Journal of Microbiology, 39(2), 158-168.
Weisburg, W. G., Barns, S. M., Pelletier, D. A., & Lane, D. J. (1991). 16S
ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology,
173(2), 697-703.
Wilkins, E., Ivnitski, D., Abdel-Hamid, I., & Atanasov, P., (1999). Biosensors for
detection of pathogenic bacteria. Biosensors and Bioelectronics, 14(7),
599-624.
WHO, Geneva. (2011). Guidelines for drinking-water quality. World Health
Organization.
Yu, H., & Bruno, J. G. (1996). Immunomagnetic-electrochemiluminescent
detection of Escherichia coli O157 and Salmonella typhimurium in foods and
environmental
water
samples. Applied
and
Environmental
Microbiology, 62(2), 587-592.
Zengler, K. (2009). Central role of the cell in microbial ecology. Microbiology and
Molecular Biology Reviews, 73(4), 712-729. ____________________________________________________________________________________________________________
www.philscitech.org
31
ARTICLE
An individual-based model of long-term
forest growth and carbon sequestration
in planted mangroves under salinity and
inundation stresses
Severino G. Salmo III*1 and Dranreb Earl O. Juanico2,3
1Department
of Environmental Science, Ateneo de Manila University,
Loyola Heights, 1108, Quezon City, Philippines
2Technological Institute of the Philippines, Quiapo, 1001, Manila, Philippines
3The Oscar M. Lopez Center, Ortigas, 1605, Pasig City, Philippines
Abstract—We developed a spatially explicit individual-based model of forest development trajectories of
monospecific Rhizophora mucronata plantations. The model incorporates stochastic initial seedling spacing,
propagule dispersal, recruitment, and mortality. We simulated and compared the growth, development and
accumulation of carbon stocks of restored mangroves between optimal and sub-optimal settings. Salinity is
considered as a stressor, while flooding effects are described as an inundation stress factor. In the optimal
setting, the simulated mangrove population accumulated large aboveground carbon stocks (of around 140 T/
ha) after 100 years. Under sub-optimal conditions, we observed delayed maturity by at least 10 years near
the salinity threshold and the carbon stock decreased through time towards much lower values (25 T/ha).
More importantly, the continuous presence of stressors may lead to forest population collapse (at 50 yrs
post-planting) probably as a result of the accumulated effects of physiological stresses. Thus, restored
mangrove populations that are located in highly saline and frequently inundated sites, may eventually
collapse even though they may appear to be healthy in the early stages of forest development. Our results
imply that current and future restoration practices should carefully consider site selection in order to ensure
viable long-term forest development and to have an optimum contribution to carbon sequestration.
Keywords—mangroves, individual-based model, growth, forest development, restoration trajectory, salinity,
inundation, carbon sequestration
INTRODUCTION
Mangrove restoration programs have long been implemented in the
Philippines (Walters 2003) receiving funding from the local government, national
government, non-government organizations and international funding agencies.
Mangrove restoration has recently been considered as a climate change adaptation
and mitigation strategy because of its potential role in the sequestration of
atmospheric CO2 (Donato et al. 2011). The effectiveness of a mangrove restoration
program, however, depends on the growth and survival of the planted mangroves
and, subsequently, the long-term stability of the forest.
In the Philippines, most mangrove plantations are located in sub-optimal
settings that are highly saline and frequently inundated (Samson and Rollon 2008).
The coastal fringe is considered sub-optimal for mangrove planting. Most
restoration programs commonly use Rhizophora spp. due to their relative ease of
sourcing and transplanting propagules as compared to the more appropriate
Sonneratia or Avicennia spp. But Rhizophora mucronata, in particular, is known to
be stenohaline and thus disadvantaged in areas where tidal frequencies (hence,
salinity fluctuations) are high. Waves further make the coastal fringes less suitable
for R. mucronata as wave action will erode the substrate and reduce the stability of
the planted seedlings. Most mangrove planting programs are implemented in
Submitted: May 18, 2014
Revised: May 29, 2015
Accepted: June 16, 2015
numerous sites deemed biophysically unsuitable for R. mucronata. Primavera and
Esteban (2008) cite policy-related reasons for the persistence of such restoration
malpractice. Most of the planted seedlings have stunted growth and poor survival.
However, monitoring the growth and survival as well as the success or failure of
these mangrove restoration programs is largely not undertaken. If any monitoring
is conducted, the findings are rarely reported.
Due to the long periods of time needed for the growth and development of
mangrove forests, assessment of the success of mangrove restoration programs is
challenging. Mathematical models offer a way to circumvent this challenge.
However, available mangrove forest models such as KiWi (Berger and
Hildenbrandt, 2000) and FORMAN (Chen and Twilley 1998) have built-in
assumptions regarding environmental conditions that are more applicable for subtropical mangrove systems (Berger et al. 2008). In their original configuration,
these existing models are not ideal for mangrove systems in the Philippines, which
thrive under remarkably different environmental conditions. On the other hand, the
MANGRO model (Doyle and Girod, 1997) is more applicable to the Philippine
setting because it considers the effect of tidal flooding on tree growth. However, it
does not provide a mechanism for seedling or sapling dispersal (Berger et al.
2008).
Here, we used model simulations to compare the long-term trajectories of
forest development and carbon stock accumulation between settings that mimic
typical reforested sites in the Philippines and those considered biophysically
optimal for R. mucronata. The model we developed for this study combines the ____________________________________________________________________________________________________________
www.philscitech.org
strengths of KiWi in describing resource competition and salinity sensing, and of
MANGRO in considering tidal inundation as a stressor that attenuates the growth
rate and survival of individual mangroves. In addition, our model incorporates
stochastic recruitment, dispersal, and mortality, which are not considered
simultaneously in any of the said models. We do not account for wave exposure in
this study by assuming that extreme wave action does not occur frequently. The
biophysical parameters of planted R. mucronata required to specify the model
inputs are deduced by fitting simulation results with actual growth monitoring data
obtained from our recent field observations (Salmo III et al. 2013). We tracked the
development trajectories of virtual mangrove forests over a period equivalent to
100 years, although the model could be simulated over longer periods of time.
Model development
The model is a spatially explicit, individual-based model founded upon a
description of the rate of change of the diameter-at-breast-height, dbh. The dbh is
used as a gauge for the growth of individual mangroves. Allometric relations can
estimate the growth rate of other aspects of mangrove structure (i. e., crown
diameter) and biomass by extrapolating dbh (Botkin 1972). In the model, growth
stressors are represented by a salinity stress factor and inundation stress factor
where the value 1 indicates the absence of the stressor (hence, optimal condition).
Competition between individual mangroves is computed based on the Field of
Neighborhood (FON) approach and the Zone of Influence (ZOI) concept in the
KiWi model (Berger and Hildenbrandt 2000). In the presence of stressors and
resource competition, the growth of an individual mangrove is given in Equation 1
(for convenience, dbh is renamed as D), as:
(1)
32
density for most mangrove restoration sites in the Philippines (Samson and Rollon,
2008).
The simulated mangrove forest was assumed to have uniform, unchanging
salinity level. We also assumed that the tidal exposure of the forest leads to a
uniform, unchanging inundation stress. Here, we consider inundation stress as a
time-averaged effect of tidal exposure over a long period of time. Note that
inundation stress does not denote tidal cycle. Since the mangrove plantation is
monospecific, then all parameters listed in Table 1 were fixed at the beginning of a
simulation. The simulations were run for five times for each S and E setting.
Growth
Equation 1 was numerically solved for each mangrove in the patch. Using ∆t
= 1, the solution was implemented using Euler’s forward scheme. Consequently,
the dbh of an individual mangrove was increased by an amount approximately
equal to the right-hand side of Equation 1 at time t. The life stage of the mangrove
was determined by means of the following standard classification based on dbh:
seedling, 0.50 ≤ dbh < 2.50 cm; sapling, 2.50 ≤ dbh < 5.0 cm; and tree, dbh ≥ 5.0
cm. By implementing a positivity constraint on Equation 1, the value of dbh was
only expected to increase as time progresses.
Recruitment
Based on our field data (Salmo III et al. 2013), an annual average of five
seedlings from each mature R. mucronata tree was recruited. Established seedlings
have initial dbh of 0.50 cm, and were scattered randomly within a 5 m radius
around the parent tree. The recruitment by each mature mangrove was also taken
as a stochastic process with a constant probability per unit time. Therefore, the
total number of recruits at any given time was a random variable. This randomness
reasonably accounted for the probabilistic survival of recruits due to many other
confounding factors, e.g., predation, disease, or wave-current action, which were
not explicitly accounted for in the present model.
Mortality
where α = 0.95 and β = 2 are allometric constants for height and tree crown,
respectively, as a power function of D. The constant Ω, is a conversion factor with
a value of 0.25 to harmonize the left and right sides of Equation 1. The values for α
and Ω were derived from the growth and biomass of planted mangroves as
reported in Salmo III et al. (2013) while β was derived from the allometric relation
of D and leaf area index (LAI; Botkin 1972). Thus, the simulation of a given time
scale (i.e. day, month, year) can be changed without necessarily losing its
generality. Meanwhile, γ and Dmax are set based on the maximum possible height
Hmax = 130 m (Koch et al. 2004). Because an individual mangrove is confronted by
resource competition in a forest, the growth rate is slower on average within a
forest or within patches of trees than in isolation. Lastly, the factor C represents the
attenuation to the growth rate of an individual mangrove caused by competition
with other mangroves. Competition is further explained in a later section.
The stress factors S and E due to salinity and inundation, respectively, are
valued between 0 and 1. Coastal fringe conditions are represented by 0, whereas
mid-intertidal conditions by 1. Based on Equation 1, a value close to zero would
decrease growth with time such that the individual mangrove grows at a slower
pace. In particular, E attenuates the average growth rate because of stress caused
by submergence (partially or totally) under waterlogged condition. The diurnal
cycles of the tides also cause fluctuations in salinity levels. Although tidal flooding
and salinity appear correlated, we assume in our model that these factors are
separable. While this assumption adds tractability, it is nevertheless a limitation of
the model. In our model, we set the mangroves to grow optimally if salinity is ≤ 25
ppt and will be stressed if salinity will be 27 ppt (S = 0.38), 29 ppt (S = 0.27) and
40 ppt (S = 0.02). The associated values of S are determined from salinity x by a
sigmoidal response function: S = S(x) = {1+exp[0.25(x – 25)]}–1. Similarly, growth
of mangroves will be optimal if they are not inundated (E = 1; representing mean
tidal level) but will be constrained if they are inundated for 4-6 hours (E = 0.90),
6-8 hours (E = 0.75) and 8-12 hours (E = 0.50) per 24-hr cycle (Table 1).
The loss of individuals due to mortality was described as a stochastic process
with a probability of death that approximated the total mortality rate of the entire
population. Due to confounding factors, such as predation or pest infestation, each
individual mangrove has a constant chance of dying at any given point in time. The
rate of mortality becomes higher as tree density increased due to more intense
resource competition or as the available growing spaces are occupied (cf. Oliver
and Larsson 1996).
Mangrove mortality rates are expected to conform with Type III survivorship
curves, as any plant in general (Schaal and Leverich 1982). The life stage (e.g.,
seedling, sapling or tree) determines the mortality rate. Seedlings have the highest
mortality rates, whereas trees have the lowest. Dying in the population is treated as
a Poisson process. Any mangrove has a chance of dying at any given point in time.
The probability of dying within a certain time period of a mangrove at a given life
stage is related to its mortality rate. Because progression through life stages by
growth is constrained by resource competition, the probability of dying is
indirectly related to population density.
Competition
We modeled tree-to-tree competition following the approach in the KiWi
model. One of the strengths of the KiWi model is its generic approach in
describing resource competition in a forest. We followed closely the FON approach
for calculating the intensity of competition based on the dbh size and the position
of an individual mangrove in the forest (Berger and Hildenbrandt 2000). In this
method, an individual mangrove is affected by competition with its neighbors. The
effect on the individual is a slowdown to its growth. Neighbors at a distance
contribute to this effect through an extended root system below the ground and a
tree crown aboveground. The aggregate effect on an individual from all other
mangroves is best described mathematically using field variables. If the aggregate
field on a mangrove at position (x,y) is F, then the attenuation factor it contributes
toward the slowdown of the growth rate is C(x,y) given below:
TABLE 1. Growth factors due to R. mucronata for salinity (regulator) and
inundation (hydroperiod) in optimal and sub-optimal settings.
Factor
Description
Optimal value
Sub-optimal values
S
Salinity stress factor
1.0
0.38, 0.27, 0.10, 0.05, 0.02
E
Inundation stress factor
1.0
0.90, 0.75, 0.50
We explored the long-term growth, development, and carbon stock
accumulation of restored R. mucronata forests by comparing different salinity and
inundation settings. Each setting is mathematically represented as an ordered pair
(S, E) of the two factors listed in Table 1. The software implementation of the
model was made using the C++ programming language on a Unix platform in a 1.7
GHz Intel Core i5 machine. A detailed description of a related model using the
“Overview-Design-Detail” (ODD) framework is provided in Juanico and Salmo III
(2014).
Initialization
A 40m × 40m (= 0.16 ha) mangrove patch is initialized. The simulation
moves forward with an annual time step (∆t = 1 year). In the beginning, there are
100 seedlings of R. mucronata with initial dbh of 0.5 cm that are scattered
somewhat randomly at 1.0 – 1.5 m distance apart. Thus, the distance of one
seedling to another is about 1.0 – 1.5 m, which approximates the typical planting
(2)
Carbon stock
Biomass evidently increases as the mangrove grows. Because the model
tracks growth by observing the dbh, we used an allometric equation (cf. Komiyama
et al. 2008) to convert a mangrove’s dbh to above-ground biomass (AGB, in kg per
tree):
(3)
Dispersal
A propagule from a tree may establish and grow anywhere within an annular
region surrounding the tree. This annular region has an inner radius equal to the
parent tree's crown radius. On the other hand, its outer radius is equal to the
product between time and dispersal rate. The dispersal rate is species-specific. For
R. mucronata, we assume that this rate is about 26.67 cm per day deduced from
measurements by Sousa et al. (2007). Stochasticity was incorporated by assigning
a random position with respect to the vertical axis of the parent tree. The stochastic
dispersal addresses the uncertainty in tracking the exact site where a seedling
establishes. ____________________________________________________________________________________________________________
www.philscitech.org
RESULTS
Spatial distribution
The snapshots of mangrove forest growth and development under the optimal
setting, (S, E) = (1, 1) for t at 5, 25, 50, and 100 years are shown in Figure 1. The
perimeter enclosing all mangroves is called the convex hull where all mangrove
individuals (seedlings, saplings and mature trees) per simulation are confined. The
values for tree density, aboveground biomass, and carbon stocks were computed
based on the set area of the mangrove patch. The use of the convex hull, rather
than the entire patch, shows a more accurate description of the actual spatial
distribution of mangroves. The density of mature trees increased with time. As
time progressed, there was an apparent increase in the number of mature trees
accompanied by the decrease in available growth spaces as a result of tree-to-tree
competition. The fact that the tree density is increasing at the optimal setting (1,1)
implied that AGB also increased as time progressed.
33
There was a pronounced difference in the carbon stock trajectories between
the optimal setting and the most extreme sub-optimal setting. Simulations showed
a continuous accumulation of carbon stock due to increasing tree density for up to
100 years since initial planting for the optimal setting (Figure 3). In contrast, in the
most extreme sub-optimal setting (S = 0.02; E = 0.05), seedling density decreased
rapidly within the first 10 years, then the remnant population (composed of
surviving saplings that eventually matured as trees) finally collapsed around 50
years (Figure 4B). Consequently, the carbon stock in living mangroves was nonexistent after 50 years (Figure 4A). For sub-optimal settings, S and E are smaller
than unity, so that plants would linger in the less mature state for a longer time (see
Equation 1). Since immature trees are more susceptible to mortality than mature
trees, then other instantiations of the sub-optimal settings are likely to lead to
decreases in populations and carbon stock over time.
Figure 3. Trajectory of (A) carbon stock, and (B) density of trees, saplings
and seedlings over 100 years in a single realization of the model for the
optimal setting (S =1, E = 1).
Figure 1. Development of restored mangrove forest over 100 years for the
optimal setting (S = 1, E = 1). The zero (0) point in the Y-axis denotes the
edge of the shoreline. Each graph represents a snapshot of mangrove
distribution 5, 25, 50, and 100 years post-planting. Each dot represents the
top view of the crown (computed from dbh) of an individual mangrove. The
indicated perimeter is the convex hull, which encloses the area occupied by
all mangrove individuals.
Long-term carbon stock accumulation
Based on the different possible ordered pairs (S, E) of values listed in Table 1,
the time-averaged levels of aboveground carbon stock at 100 years increased with
time [n = five replicates of each (S, E)]. Figure 2 depicts the long-term mean
carbon stock of the forest under different settings provided in Table 1 (S = {0.02,
0.05, 0.10, 0.27, 0.38, 1.00} and E = {0.50, 0.75, 0.90 and 1.00}. The average
aboveground carbon stock at 100 years for the optimal setting (1,1) is about 140
tC/ha. Compared to the sub-optimal settings, the optimal result was found to be
considerably higher by at least 60 tC/ha. Generally, for any value of S considered,
the trend for carbon stock with respect to E was positive except for S = 0.38. On
the other hand, the long-term carbon stock significantly declined when S was less
than 0.1, to levels at least an order of magnitude lower than the optimal value
(Figure 2).
Figure 4. Trajectory of (A) carbon stock, and (B) density of trees, saplings
and seedlings over 100 years in a single realization of the model for the
extreme sub-optimal setting (0.02, 0.50).
Effect of salinity stress
Simulations suggested that the density of mature trees (> 0.5 cm dbh) under
different values of S (with a fixed value E = 1) will increase through time for S =
0.27, 0.38, and 1.0 (Figure 5). The forest growth rate is indicated by the slope of
the trajectory, which is most positive (i.e., highest rate of increase in tree density)
for the optimal case S = 1. On the other hand, below an unidentified threshold (ca.
0.02 < S < 0.27), the trajectory trends downward or the slope is negative. For S =
0.02, the development of mature trees occurred at a later time than for the other
less stressful S values. The delay could be explained by the slow growth, and thus
slow transition, of individual mangroves (from seedling to sapling then from
sapling to tree) in a sub-optimal salinity setting even in the absence of inundation
stress.
Figure 5. Trajectory of changes in tree density with time for the different
values of the salinity stress factor S at the optimal value of the inundation
stress factor, E = 1. Each line is a single realization of the (S, E) setting.
Effect of inundation stress
Figure 2. Long-term carbon stock accumulated after 100 years for different
The density of mature trees (with a fixed value S = 1) had an upward
(S, E) settings. Each data point represents the average of five simulations
trajectory through time regardless of E values considered (Figure 6). The slope was
for a given setting. The error bars indicate the standard deviation from the
highest for the optimal case (E = 1), indicating fastest forest growth rate. The
mean. The deviation from the expected monotonic trend for (0.27, 1) and
highest tree density 100 years post planting was achieved at the optimal value.
(0.38, 1) can be explained in part by the salinity response S(x). The
Unexpectedly, tree density after 100 years was higher for E = 0.5 as compared to E
sigmoidal graph of S(x) puts the salinity levels associated with S = 0.27
= 0.75. This may have been an artifact of the simulations due to stochasticity. The and S = 0.38 at the transition part. The transition is associated with more
____________________________________________________________________________________________________________
statistical
uncertainty.
www.philscitech.org
fact that tree density had a consistent upward trend regardless of E values
considered strongly suggests that R. mucronata is less sensitive to wide variations
to inundation stress compared to salinity stress.
34
1996) were occupied. Such contrasting results between the two studies can be
attributed to the effect of inundation (which was not explicitly accounted for by
Berger and Hildenbrandt 2000) as well as the combined effects of salinity and
inundation. The presence of these stressors will most likely result in better
establishment and growth of individual trees in areas closer to the shoreline.
The trajectories suggest that the density of mature trees rapidly increases
within a very short time (<10 years) to about 150-400 trees/ha in all scenarios,
except when S = 0.2, E = 1 (Figures 5 and 6). Furthermore, the increase was
apparently the steepest for the optimal setting, S = 1, E = 1, between the 10th and
70th years. Compared to the baseline, the increase in the trend for sub-optimal
settings is relatively flatter in the said period.
The simulated aboveground biomass and carbon stocks here are remarkably
lower compared to published reports (see Donato et al. 2012 for example).
However, the low carbon stock values are similar to those reported for Philippine
mangrove plantations (55 – 60 tC/ha; Salmo III et al. 2013). Even in the optimal
settings (S = 1, E = 1), the biomass and carbon stocks are also low (between 71 and
209 tC/ha at 100 years in the simulations) which can probably be accounted for by
the low diversity of the restored system (see also Isbell et al. 2013). Also, the
model implies that to have optimum growth, Rhizophora seedlings must be planted
above the mean tidal level.
Figure 6. Trajectory of changes in tree density with time for the different
values of the inundation stress factor E at the optimal value of the salinity
stress factor, S = 1. Each line is a single realization of the (S, E) setting.
DISCUSSION
Individual-based model for restored monospecific mangroves
Our model provides a platform that analyzes the restoration trajectory of
planted monospecific mangroves, in this case of the species Rhizophora
mucronata. We adapted the Field of Neighborhood approach and the concept of
Zone of Influence from the KiWi model (Berger and Hildenbrandt 2000).
However, we incorporated several improvements based on actual R. mucronata
plantation data in the Philippines (Salmo III et al. 2013) and adjusted other model
assumptions to approximate Philippine environmental conditions. Hence, our
model can be used to project the possible development or demise of typical
mangrove restoration programs in the Philippines.
We evaluated the effects of different levels of salinity and inundation in the
model. These parameters are the main stressors that can strongly constrain the
growth and survival of planted mangroves (see Samson and Rollon 2008 for
example). The growth of mangroves, particularly of the species R. mucronata, is
physiologically sensitive to high salinity (>25 ppt) and prolonged periods of
inundation (>4 hours submergence per 24-hour cycle). The salinity and inundation
settings that we used in the model were derived from long-term field observations
(10 years or more) at various mangrove restoration sites across the Philippines
(Salmo III et al. 2013). In our simulations, we evaluated the effects of salinity
levels that were not higher than 40 ppt. Note, however, that most replanted sites
can have extreme salinity levels of up to 60 ppt, which will have stronger adverse
effects on mangrove growth and survival.
We also modified the mechanism of propagule dispersal, mortality and
stochasticity from the KiWi model. The propagules are transported and able to
successfully establish only within a 5 m radius from the parent tree. This limited
range of dispersal is consistent with observations in the field. This is probably due
to the limited buoyancy of the propagules as well as the fact that propagules can
often be stranded in the dense network of prop roots of R. mucronata. Mortality in
the model is probabilistic. The probability of dying is negatively associated with
age and positively associated with the rate of increase in the diameter of an
individual tree, hence mortality rate is higher for seedlings and lower for mature
trees. In terms of stochasticity, we did not define the time to which an individual
mangrove can transition from seedling to sapling or from sapling to tree, but
instead let the change in dbh determine its life stage.
Our modifications of the KiWi model are consistent with our field
observations. However, we acknowledge some possible limitations of our model.
Factors such as spatial gradients in salinity and inundation levels as well as the
strength and direction of water currents in the entire patch relative to distance from
the shoreline will obviously have an effect on the growth and survival of each
individual mangrove. These limitations are currently being addressed in an
ongoing complementary study. Nonetheless, we believe that the present model was
able to capture the general pattern of growth of individual mangrove and critical
parameters in the dynamics of mangrove populations. This would then enable the
simulation and assessment of long-term restoration trajectories of planted
mangroves.
Optimal vs. sub-optimal conditions
As expected, the restoration trajectories (in terms of changes in tree density,
aboveground biomass and carbon stock with time) of mangroves varied widely
between optimal and sub-optimal settings (Figures 2, 4, 5 and 6). Under optimal
conditions, the mature trees (> 5 cm dbh) appeared to be sporadically distributed at
the 5th and 25th yr but tend to be more congregated on the 50th and 100th yr (Figure
1). Such a distribution pattern was probably due to the limited range of propagule
dispersal (only 5 m from the parent tree) that we imposed for R. mucronata in the
model. These results are also consistent with our field observations. However, they
contrast with the results of simulations by Berger and Hildenbrandt (2000) for R.
mangle, a neotropical mangrove species. In their study, the trees were almost
uniformly distributed until the available growing spaces (cf. Oliver and Larsson
A striking result of our simulations is the sudden collapse of the mangrove
population (and subsequently carbon stock) at 50 years post planting particularly
under the most extreme sub-optimal conditions (Figure 4). Such a population
collapse, while still largely undocumented for current mangrove restoration sites in
the Philippines, makes sense ecologically because of the persistent presence of
physiological stressors that could eventually lead to the demise of the planted
mangroves. A monospecific plantation is known to be less resilient against
stressors as compared to a more diverse mangrove forest system (Gunderson
2000). Thus, while we acknowledge that mangrove restoration programs can
contribute to carbon sequestration, the amount and rates of carbon sequestered by
typical mangrove restoration efforts are likely to be very low and there is a
possibility that the planted mangroves may perish in the long run.
Management implications
Mangrove restoration has long been practiced in the Philippines (see TalaueMcManus et al. 1999; Walters 2003; Salmo et al. 2007; Primavera and Esteban
2008; among others). However, very few successful cases have been reported.
Many programs have failed basically because of inappropriate species-substrate
matching and planting in unsuitable locations (Samson and Rollon 2008). These
monospecific restoration programs have long been criticized due to the stunted
growth and poor survival of mangroves and their potential effect of reducing
mangrove species diversity (Primavera and Esteban 2008).
The use of mangrove restoration programs to mitigate the impacts of global
warming seems like a viable strategy and provides additional incentives for
mangrove managers. Planted mangroves can of course contribute to the
sequestration of atmospheric CO2. However, restored mangroves will be effective
in carbon sequestration over the long term only if the mangrove population will
have steady growth and maintain its stability. Unfortunately, this is not the case yet
for most mangrove plantations in the Philippines.
In our simulation results, we demonstrated that mangroves (Rhizophora sp.)
planted in sub-optimal conditions would have much lower levels (up to 100%) of
aboveground biomass and carbon stock 100 years post-planting compared to those
planted in optimal conditions due to mortality. In addition, the population collapse
that may occur around 50 years post-planting implies the need for frequent
replanting at the same site in order to maintain the population. Thus, although the
planted mangroves may initially appear to be healthy (for example even at 20 years
post-planting), there is a possibility that the population will collapse in the long run
because of the persistence of stressors and the cumulative effects of physiological
stresses. Therefore, the accumulated carbon stocks in the restored mangrove
systems planted in sub-optimal conditions may be in danger of being lost over
time. Hence, we emphasize the importance of the appropriateness of the planting
site in terms of the levels of salinity and inundation stresses. There are other factors
that have not been considered explicitly, such as wave stress. However, in the
model we presented here, we focused on evaluating the impacts of extreme salinity
and inundation stress levels in the backdrop of tree competition and seed dispersal.
Despite its limitations, the model offered some important insights about long-term
forest growth and carbon sequestration. We considered the presence of stressor
gradients in a separate study (see Juanico and Salmo III 2014).
ACKNOWLEDGEMENTS
This research was funded by the Commission on Higher Education (CHED) –
Philippine Higher Education Research Network (PHERNet), and was presented at
the PAMS 12 conference in Tacloban City in October 2013.
None
Dr. Salmo conceptualized and implemented the study. Dr. Salmo wrote the
introduction and discussion sections. Dr. Juanico developed the model and
analyzed the results of simulations. Dr. Juanico also wrote the methods and results
sections. ____________________________________________________________________________________________________________
www.philscitech.org
REFERENCES
Berger U, Rivera-Monroy V, Doyle TW, Dahdouh-Guebas F, Duke NC, FontalvoHerazo M, Hildenbrandt H, Koedam N, Mehlig U, Piou C, Twilley RR.
Advances and limitations of individual-based models to analyze and predict
dynamics of mangrove forests: a review. Aquat Bot 2008: 26-274.
Berger U, Hildenbrandt H. A new approach to spatially explicitly modelling of
forest dynamics: spacing, ageing and neighbourhood competition of
mangrove trees. Ecol Model 2000; 132:287-302.
Botkin D, Janak JF, Wallis JR. Some ecological consequences of a computer model
of forest growth. J Ecol 1972: 849-872.
Chen R, Twilley RR. A gap dynamic model of mangrove forest development along
gradients of soil salinity and nutrient resources. J Ecol 1998; 86(1): 37-51.
Donato DC, Kauffman JB, Murdiyarso D, Kurnianto S, Stidham M, Kanninen M.
Mangroves among the most carbon-rich forests in the tropics. Nat Geosci
2011; 4:293-297.
Doyle, TW, Girod, GF. The frequency and intensity of Atlantic hurricanes and their
influence on the structure of south Florida mangrove communities. In
Hurricanes 1997: 109-120. Springer Berlin Heidelberg.
Gunderson LH. Ecological resilience: in theory and practice. Annu Rev Ecol Syst
2000; 31:425-439.
Isbell F, Reich PB, Tilman D, Hobbie SE, Polasky S, Binder S. Nutrient
enrichment, biodiversity loss, and consequent declines in ecosystem
productivity. Proc Natl Acad Sci USA 2013; 29:11911-11916.
Juanico DE, Salmo III SG. Simulated effects of site salinity and inundation on
long-term growth trajectory and carbon sequestration in monospecific
Rhizophora mucronata plantation in the Philippines. ArXiV Preprint 2014;
arXiv:1405.6944
Koch GW, Sillett SC, Jennings GM, Davis SD. The limits to tree height. Nature
2004; 428: 851-854.
35
Komiyama A, Ong JE, Poungparn S. Allometry, biomass and productivity of
mangrove forests: a review. Aquat Bot 2008; 89: 128-137.
Masera OR, Garza-Caligaris JF, Kanninen M, Karjalainen T, Liski J, Nabuurs G,
Pussinen A, de Jong BHJ, Mohren GMJ. Modeling carbon sequestration in
afforestation,
agroforestry and forest management projects: the
CO2FIX V.2 approach. Ecol Model 2003; 164:177-199.
Oliver CD, Larsson BC. Forest stand dynamics. Wiley Inc., New York, USA. 1996;
520 pp.
Primavera JH, Esteban JMA. A review of mangrove rehabilitation in the
Philippines: successes, failures and future prospects. Wetl Ecol Manag 2008;
16(5): 345-358.
Schaal BA, Leverich WJ. Survivorship patterns in an annual plant community.
Oecologia 1982; 54: 149–151.
Salmo III SG, Lovelock CE, Duke NC. Vegetation and soil characteristics as
indicators of restoration trajectories in restored mangroves. Hydrobiologia
2013; 720:1-18.
Salmo III SG, Torio DD, Esteban JMA. Evaluation of rehabilitation strategies and
management schemes for the improvement of mangrove management
programs in
Lingayen Gulf. Sci Diliman 2007; 19(1): 24-34.
Samson MS, Rollon RN. Growth performance of planted mangroves in the
Philippines: revisiting forest management strategies. Ambio 2008;
37:234-240.
Sousa WP, Kennedy PG, Mitchell BJ, Ordonez, BM. Supply-side ecology in
mangroves: do propagule dispersal and seedling establishment explain forest
structure? Ecol Monog 2007; 77: 53-76.
Talaue-McManus L, Yambao AC, Salmo III SG, Aliño PM. Bolinao, Northern
Philippines: Participatory planning for coastal development. In: Buckles D,
ed. Cultivating Peace: Conflict and Collaboration in Natural Resource
Management. International Development Research Center/World Bank:
Ottawa, 2000: 151-161.
Walters BB. People and mangroves in the Philippines: fifty years of coastal
environmental change. Environ Conserv 2003; 30(2): 293-303. ____________________________________________________________________________________________________________
www.philscitech.org
36
POP SCIENCE
Coconuts and the
Filipino Diaspora
by Augustine Doronila
The author, Augustine Doronila, Ph.D., a balikscientist, is a research
fellow at the School of Chemistry of University of Melbourne,
Australia. Email: [email protected]
Niyog, Lubi (Cocos nucifera L.)
The common coconut tree niyog in tagalog or lubi in my parents ilongo has
given me a strong sense of my roots to the Philippines. It may be argued that
strictly speaking it is not an indigenous tree as it is grown far and wide in the
tropical regions of the world. Its geographical distribution in fact has been so
intimately connected with the major waves of human migration around the tropical
regions of the Pacific, Indian and also the Atlantic oceans. We are taught from an
early age that it is the "The Tree of Life" because of the abundant number of
products and by-products derived from its various parts. To the 1st seafaring
migrants from the Indo-Malay (including the Philippines) region and further afield
it was a portable source of food, water, fuel and building materials.
Today, the Philippines, the 2nd largest coconut grower in the world provides
livelihood to one-third of the country's population. Among the well-known
products for food, fuel and shelter derived from the different parts of the tree are:
coconut fruit for milk, copra, and oil; leaves for thatch roofing and baskets; trunk
for timber; flowers for lambanog - a nectar base alcoholic spirit, etc. There are also
new beneficial products being discovered, for example, extracts from the roots
have been made into medicinals, beverages and dyestuffs. Cold pressed coconut oil
has been demonstrated to retard the effects of aging and degenerative diseases of
the heart, pancreas, liver and the intestines. Activated carbon made from coconut
shell charcoal is a high value product. It is utilized in the industrial recovery of
gold, which has been liberated through chemical extraction. Moreover, it is
effective at removing a larger number of contaminants in air filtration (eg.
domestic air conditioners and industrial gas purification systems) and water
purification systems.
My mother was one of the 1st people from her town in Negros to migrate to
Manila after the war in order to become an analytical chemist. Her upbringing on a
farm made her quite adept on growing all sorts of plants. The 1st 9 years of my
childhood were spent in highly urbanized San Juan. In 1968 we moved to our
home in a new subdivision near Libis. At that time all you could see was a very
wide expanse of talahib, quite different to the recently constructed concrete jungle
of Eastwood. My mother planned to create a lush and productive garden, which
would garland the house. I helped her plant many ornamental species and fruiting
trees but the ones I particularly remember were the 3 young coconut seedlings,
which were planted in our front of yard. These were put there for each of us three
siblings. The many blisters I got in the palm of my hands were a result of digging
holes, which had to be done to my mother’s satisfaction. She wanted to make sure
that these trees were going to live out the term of their natural life.
In 1970, these young coconuts survived in a span of a month the battering of 3
successive super typhoons Sening, Titang and Yoling, which left the
neighbourhood with the debris from many new houses with torn and twisted roofs,
collapsed walls and upended electricity poles. As they were less than 3 meters in
height they were not so exposed to the roaring winds but nonetheless were battered
by all the flying objects as well being scorched by a bolt of lightning.
However, the difficult political situation of the 70’s forced us to leave the
country for Australia. Our home was eventually sold and demolished by the new
owners and my mothers beautiful garden was gone forever. Serendipity came in
when my mother’s older sister was moving into a new house in Mandaluyong. She
was able to provide a new dwelling place for quite a number of ornamental shrubs
but most important of all was she wanted to shift the three sibling coconuts into her
garden. Over these past 40 years of occasionally visiting the Philippines I cannot
but be overjoyed by the sight of that flourishing, mature, tree that has withstood the
trials of life.
Recent genetic research1 has produced strong evidence that the coconut palm
was not domesticated once, but twice: in India and on the Malay Peninsula. Dr.
Kenneth Olsen and his team investigated the coconut's domestication history and
its population genetic structure as it relates to human dispersal patterns. According
to Olsen “the lack of universal domestication traits together with the long history
1Gunn,
Lithograph of Cocos nucifera L. from Blanco F.F. Flora de Filipinas 3rd edition.
of human interaction with coconuts, made it difficult to trace the coconut's
cultivation origins strictly by morphology". They performed DNA analysis of more
than 1,300 coconuts from around the world that revealed the coconut was brought
under cultivation in two separate locations, one in the Pacific basin and the other in
the Indian Ocean basin. They discovered that despite the coconut’s complicated
history, the underlying genetic structure of coconut populations is simple. Most
coconuts belonged to one of two genetically distinct groups. One population traces
back its ancestry to palms on the coasts of India, the other group descended from
palms in Southeast Asia. The coconut palms that were domesticated in India spread
westwards. They demonstrated that coconut genetics also preserve a record of
prehistoric trade routes and of the colonization of the Americas.
The great voyages of Austronesian seafarers throughout the open expanses of
the Pacific Ocean originated in the Philippines and Indonesia approximately 5000
years ago. In domesticating the coconut, our ancestors, these sea faring migrants
would have taken the Niyog to the Polynesian islands (Niu in most Pacific islander
languages), and eventually to the Pacific coast of Central America.
I have a feeling that my
mother planted these coconuts
not just for aesthetics or for its
fruit but to plant something
enduring in my psyche and of
my siblings. It worked for me
as every time, I see those
coconut trees it happily jogs
my mind not to forget where I
come from. The story of the
coconut travelling so far
across the sea to germinate
and establish on a new shore
is certainly one I can identify
with as it is an analogy of the
vitality of our rich Filipino
culture which has allowed me
to dig deep and flourish in a
new land.
“My coconut tree after
typhoon Glenda 2014.”
B.F., L. Baudouin, and K.M. Olsen (2011). Independent origins of cultivated coconut (Cocos nucifera L.) in the Old World Tropics. PLoS ONE 6: e21143. DOI: 10.1371/journal.pone.0021143
____________________________________________________________________________________________________________
www.philscitech.org
37
ARTICLE
Resilience to thermal stress
of coral communities in
Talim Bay, Lian, Batangas
Norievill B. España*1,2, Wilfredo Y. Licuanan1,3,
and Porfirio M. Aliño2
1Br.
Alfred Shields FSC Oceans Research Center, De La Salle University,
2401 Taft Avenue, 1004 Manila
2The Marine Science Institute, University of the Philippines, Diliman, 1101
Quezon City
3Biology Department, De La Salle University, 2401 Taft Avenue, 1004 Manila
Abstract—Climate change driven disturbances such as increases in sea surface temperature (SST) pose a
critical threat to coral reefs. Increased understanding of the mechanisms that maintain coral community
structure (i.e., coral cover and species diversity) now allows for the assessment of resilience of coral
communities to thermal stress. Such an assessment was conducted in Talim Bay, Lian, Batangas and
sought to quantify factors that relate to resistance (i.e., coral community structure) and recovery potential
(i.e., coral recruitment, topography of the reef and historical data on mortality and recovery). The Bay was
found to be dominated by bleaching-resistant coral species, suggesting high resistance to thermal stress.
Recovery potential was also assessed to be high and was associated with the physical characteristics of the
reef, the coral size structure, and the presence of adjacent reefs for reseeding. Sedimentation and nutrient
loading were found to have a significant role in determining the status of the coral communities of Talim Bay.
Insights from this resilience assessment may inform coastal communities of management measures which
are necessary to alleviate stress on coral reefs to minimize coral reef degradation and phase shifts.
Keywords—Coral community structure, Resilience, Climate Change
INTRODUCTION
The growth, abundance, and distribution of corals in a coral reef are
influenced by natural disturbances that may be physical (e.g., storms, change in sea
level and temperature) or biological (e.g., predation and grazing, coral disease and
bleaching, crown-of-thorns outbreaks; Hughes & Connell, 1999; Nyström et al.,
2000). Coral communities naturally have the capacity to recover from such
disturbances and retain their structure and function (Nyström & Folke, 2001).
However, such capacity is undermined by anthropogenic impacts and climate
change. For example, increased frequency and severity of anomalous sea surface
temperatures driven by climate change (IPCC, 2007) are expected to lead to more
coral bleaching events (Hoegh-Guldberg, 1999; Obura & Grimsditch, 2008; Burke
et al., 2012; McClanahan et al., 2012). The same disturbances may also impede
resilience, and result in further degradation and changes in community structure of
the reef (Berumen & Pratchett, 2006).
The suite of ecological and environmental factors that determine the potential
to recover from, or resist disturbances are quantified in various resilience
assessment protocols (e.g., Obura & Grimsditch, 2009; Maynard et al., 2010;
McClanahan, 2012). Most branching coral genera such as Acropora, Montipora,
Pocillopora, Seriatopora, and Stylophora are prone to bleach; while most massive
Submitted: February 22, 2014
Revised: June 2, 2015
Accepted: June 23, 2015
Published: August 25, 2015
Porites and lagoon-resident Pavona do not readily bleach (Marshall &
Schuttenberg, 2006). One can thus project a reef community’s tendency to bleach
by examining its coral community structure. Recovery potential, on the other hand,
can be assessed by looking at levels of coral recruitment and connectivity, and the
physical condition of the reef habitat (Obura & Grimsditch, 2009; McClanahan et
al., 2012).
We assessed the levels of resilience in 20 reef stations at Talim Bay, Lian,
Batangas that have been exposed to anomalous warming of up to 12 degree heating
weeks in 1998 and 2010 (http://coralreefwatch.noaa.gov/satellite/baa.php). A
degree heating week (DHW) is defined as the prolonged warming of the sea
surface and accumulation of thermal stress experienced by coral communities
resulting to bleaching and mortality (Wilkinson & Souter, 2008). The assessment
in Talim Bay was meant to provide the basis of efforts at managing human impacts
on reefs in the face of changes driven by climate change.
Study area and biophysical profile
Talim Bay, Lian, Batangas is located at the southwestern part of Luzon,
Philippines (13°58' N; 120°37' E; Fig. 1). Talim Bay has a total coastline length of
about 16 km. The inner bay is 850 hectares in area and bay mouth is
approximately 3 km wide. Water currents flow southward during flood tide and
northwards during ebb tide. These currents are normally weak due to the Bay’s
shallow depth and bottom topography (David et al., 2010). Based on the National ____________________________________________________________________________________________________________
www.philscitech.org
38
predators), fish groups (e.g., herbivores), connectivity factors (e.g., dispersal
patterns, presence of adjacent reef), anthropogenic factors (e.g., fishing pressure,
nutrient loading, sedimentation), and management intervention.
Mapping and Resource Information Authority (NAMRIA, 1979) topographic maps
and Google Earth ® satellite images, there is an estimated 183 ha of coral reefs,
225 ha of seagrass, and 30 ha of mangroves in the area. Coral reefs of Talim Bay
are of the fringing type and occur at depths of up to 20 m. Talim Bay is home to at
least 200 species of corals, which represent about 40% of the 484 species found in
the Philippines (http://coenomap.philreefs.org).
Data for the benthic factors were gathered using the photo-transect method
described earlier. A detailed coral community structure study will be presented in a
separate paper (España et al., in prep.), only relevant data and information to
elucidate bleaching resistance such as coral cover and diversity was used here.
Quibilan, M.C. (coral settlement rates), Hilomen, V.V. (reef fish abundance and
diversity), David, L.T. (physical setting), Villanoy, C.L. (hydrography and
currents), Siringan, F.P. (geo-morphology and sediment dynamics) provided
unpublished data and information that supplemented the authors’ observations and
anecdotal information gathered from interviews of local residents.
Resilience was assessed by assigning scores for each indicator using the 5point Likert scale wherein a score of 1 designates low/poor/negative condition and
a score of 5 designates a high/good/positive condition. For indicators which can be
quantified, scores were based on the range and distribution of measurement values
(e.g., of coral cover and coral size-distribution). The average scores for all the
resilience indicators was used to produce a ranking of the stations from highest to
lowest overall resilience. The average scores for each indicator across all the 20
stations were also computed in order to identify which indicators had more
influence on the resilience ranking. Detrended correspondence analysis (DCA;
using PC-Ord ® ordinations) was also used to better visualize the patterns in the
assessed resilience. The difference between the minimum and maximum average
scores was divided by three in order to get a range and further classify resilience as
low, moderate, or high.
Overall, Talim Bay coral reef stations were characterized by 67% algae
(mostly algal turfs), 20% hard coral, and 13% abiotics (i.e., silt, rock) including
soft corals and other organisms. Of the 20% hard coral cover, 9% were
categorized to have high bleaching-resistance, 6% moderate and 5% were low (Fig.
2).
Figure 1. Map of Talim Bay with inset map showing location of Talim Bay,
Lian, Batangas in the Verde Island Passage, Philippines. Shown here are
the location of sampling stations and corresponding resilience indices (i.e.,
green: high, yellow: moderate, and red: low resilience).
Information on coral community structure
Data collection was conducted in April 2010. During the conduct of this
study, there was an observed increase in sea surface temperature from 28°C to
31°C. There were 20 stations, 100 m to 250 m apart, which were sampled for this
study (see Fig. 1). At each station, 20 m transect lines were laid at 2 m depth
intervals starting from the shallowest portion of the reef (~1m) down to the reef
base (17 m maximum) where hard corals can still be found. Benthic data were
gathered using the phototransect method (van Woesik et al., 2009). Coral Point
Count with Microsoft Excel extensions (CPCe; Kohler & Gill, 2006) was used to
overlay 10 randomly positioned points on each transect photograph to help in
estimating percent cover of hard coral, soft coral, fleshy algae, turf algae, crustosecoralline algae, rubble, sand, and silt. Hard corals that were scored were assigned
to one of 75 taxonomic amalgamated units (TAUs). These globally standardized
TAUS are typically coral genus-growth form combinations for coral taxa
recognizable from transect images (van Woesik et al., 2009).
Resistance of coral communities and resilience assessment and
ranking
The resistance level of the coral communities in the 20 reef sampling stations
was initially computed by assigning the TAUs found to one of three bleaching
resistance categories (“low” “moderate” and “high”). An example for resistance is
the response of coral taxa to increase in sea surface temperature (SST) which
causes coral bleaching. Branching coral species that grow rapidly are more prone
to bleaching compared to the slower-growing genera with dome-shaped or
encrusting forms. The top ten hard corals that have low resistance to bleaching
during an increase in sea surface temperature are: Millepora spp., Isopora spp.,
tabular Acropora spp., Pocillopora damicornis, Stylophora pistillata, arborescent
Acropora spp., Seriatopora hystrix, Pachyseris spp., Montipora – plates, Merulina
spp. (Marshall & Baird, 2000; Marshall & Schuttenberg, 2006). The coral cover of
each of these TAUs were then added to compute an aggregate resistance score per
station.
The resilience assessment protocol of Obura and Grimsditch (2009) was also
used in this work. The protocol is based on 61 factors grouped into nine (9)
indicators of resilience of coral reefs to increase in sea surface temperature. The
nine indicator categories are benthic factors (e.g., coral cover, algal cover, other
benthos), physical factors (e.g., substrate morphology), coral condition (e.g.,
current and historic records on mortality, recovery), coral population factors (e.g.,
size classes, recruitment rates), coral associates (e.g., urchins, other non-fish
!
Figure 2. Top panel: Mean benthic cover across stations; Lower panel:
Abundance of high-, moderate- and low-resistant coral species across
stations. Error bars indicate standard deviation. Refer to study area map for
the location of each station in the Bay.
Most of the stations located outside the bay (northeastern: Station 1, 2, 4 to 9
and southern: 18, 19 and 20) were dominated by high bleaching-resistant corals
such as Diploastrea heliopora, Heliopora coerulea, Favites spp., and massive
Porites; except for station 3 which had high abundance of bleaching-prone corals
such as tabulate and corymbose Acropora spp. The stations at the central part of
the bay (stations 10 to 17) were dominated by moderate bleaching-resistant corals
such Goniastrea spp., Favia spp., Favites spp., and Platygyra spp.; and bleachingprone corals such as Acropora and Montipora. High coral cover (36%) of lagoon
species massive Porites, Pavona frondifera, and P. decussata) made Station 8
unique (Fig. 2, Table 1).
The station with the highest resilience score was station 18 and the lowest
score was at station 16 (Table 2). DCA analysis superimposing the average scores
for each of the resilience variables showed that resilience varied across stations
because of differences in coral cover, the abundance of bleaching-resistant species, ____________________________________________________________________________________________________________
www.philscitech.org
39
TABLE 1. Summary of bleaching resistance levels of corals species, and coral cover (abundance) across the sampling stations.
TABLE 2. Summary of ranking and resilience scores for all stations and the indicators that influence resilience.
____________________________________________________________________________________________________________
www.philscitech.org
coral recruitment rate, transport, and presence of adjacent coral reefs thereby
improving connectivity, and cooling and flushing promoted by the topography of
the reef (Fig. 3).
40
None
España, N.B. collected and analyzed the data, and led the writing of this
manuscript. Licuanan, W.Y. supervised in the collection of data. Both Licuanan,
W.Y. and Aliño, P.M. contributed to the conceptualization of the research, sampling
design, and revision of the manuscript.
REFERENCES
Figure 3. DCA biplots showing the influence of ecological and
environmental variables to the resilience of the coral communities in the
sampling stations.
Classifying resilience scores showed that two stations (stations 12 and 18) had
high resilience, four stations (stations 1, 6, 13 and 17) with low resilience, and the
rest of the 14 stations had moderate resilience (see Fig. 1). High resilience is
attributed to high coral cover, abundance of bleaching resistant corals such as
Fungia spp. (e.g., station 12), close proximity to deeper, cooler water (e.g., station
18) where nutrient levels are low and benthic quality is favorable for coral recruits
to settle (Graham et al., 2015). Stations with moderate resilience had high species
diversity and also abundance of bleaching-resistant corals such as massive Porites,
Symphyllia spp., Favia spp., D. heliopora and H. coerulea. Some of these stations
are located outside the bay (e.g., stations 2, 3, 4, 19 and 20) with deep reef bases,
unobstructed water movement and continuous flushing. The stations which
exhibited low resilience had low coral cover and species diversity (e.g., station 6),
low potential for acclimatization of corals to temperature due to a shallower reef
base (stations in the inner bay), high sedimentation (e.g., station 13 and 17),
occasional exposure during low tide, and a high cover of bleaching-prone coral
species (e.g., tabulate, branching Acropora).
The average scores of the resilience indicators showed that anthropogenic
pressures, such as sedimentation and nutrient loading, had a high impact on the
resilience of the reef in Talim Bay (Table 2). High sedimentation in this part of the
bay is brought about by coastal run-off from denuded land; farming and sugar cane
plantations; and the building of hard structures (e.g., groynes and small docks for
tourist boats). The latter structures have altered water movement and the
distribution of sediments inside the bay. Areas in Talim Bay that can directly
benefit from management interventions are those with high and moderate
resilience, especially those situated in the inner bay (e.g., station 10, 11, 14, 15 and
16). Regulation of the construction of hard structures, as well as the protection and
rehabilitation of coastal vegetation (e.g., through mangrove planting) should help
reduce sedimentation. Another possible mitigation measure is the reduction of
fishing pressure, which will allow for the recovery reef fishes stocks, especially
those of herbivores which feed on algae and provide more space for coral recruits
(Szmant, 2002).
This study shows that overall resilience of Talim Bay is driven by the current
state of the coral community (i.e., high abundance of bleaching-resistant corals)
and the physical attributes of the reef that contribute to acclimatization of corals,
and cooling and flushing of coral habitats. In undertaking a resilience assessment,
we were able to characterize the sensitivity of corals to thermal stress and its
implications to overall resilience to a combination of exacerbating threats (e.g.
siltation, overfishing). Management should consider using the approach taken in
this work as a baseline for assessing progress of management interventions.
Coastal management efforts should be geared towards addressing anthropogenic
stressors and in the long-term, improving overall coral reef resilience through
integrated management.
ACKNOWLEDGEMENTS
This work has been made possible through the funding of the Department of
Science and Technology RESILIENT SEAS Project and De La Salle University –
Br. Alfred Shields FSC Ocean Research Center. The authors would also like to
thank Dr. Laurie Raymundo (University of Guam), Dr. Cesar Villanoy and Dr.
Fernando Siringan (University of the Philippines – The Marine Science Institute)
and anonymous reviewers for providing their comments to the contents of the
manuscript, as well as Miledel Christine Quibilan, Eznairah-Jeung Narida, Monica
Aiza Orquieza and Maricar Samson, for helping in the data analysis and for the
helpful conversations. This paper was presented at the 12th National Symposium
on Marine Science (PAMS 12) in Tacloban City in October 2013.
Berumen, M.L. & Pratchett, M.S. (2006). Recovery without resilience: persistent
disturbance and long-term shifts in the structure of fish and coral communities
at Tiahura Reef, Moorea. Coral Reefs 25: 647-653. DOI 10.1007/
s00338-006-0145-2.
Burke, L., Reytar, K., Spalding, M. & Perry, A. (2012). Reefs at risk revisited in
the Coral Triangle. World Resources Incorporated. 74 pp.
David, L.T., Rollon, R.N., Trono, G.Jr., Villanoy, C.L., Yñiguez, A.T., San DiegoMcGlone, M.L., Pante, J., Borja, R., Luna, A.P., Cayabyab, N., Martin, M.,
Camoying, M., Magno-Canto, M., Peñaflor, E., & Barrera, C. (2010).
Integrated Coastal Enhancement: Coastal Research, Evaluation and Adaptive
Management (ICE CREAM). Project 1: Climate Change and the Coast:
Vulnerability of the Bentho-Pelagic Productivity (CCC-BP) midyear technical
report – Year 2. The Marine Science Institute, University of the Philippines
Diliman. Unpublished report, 39 pp.
Graham, N.A.J., Jennings, S., MacNeil, M.A., Mouillot, D., & Wilson, S.K.
(2015). Predicting climate-driven regime shift versus rebound potential in
coral reefs. Nature 518: 94-97.
Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the
world's coral reefs. Marine and freshwater research, 50(8): 839-866.
Hughes, T.P. & Connell, J.H. (1999). Multiple stressors on coral reefs: A long-term
perspective. Limnology and Oceanography 44: 932-940.
IPCC (Intergovernmental Panel on Climate Change). (2007). Climate change 2007:
Synthesis report. Contribution of Working Groups I, II and III to the Fourth
Assessment Report of the Intergovernmental Panel on Climate Change. Core
writing team Pachuari, RK and A Reisinger (eds) IPCC, Geneva, Switzerland.
104 pages.
Kohler, K.E. & Gill, S.M. (2006). Coral point count with excel extensions (CPCe):
A visual basic program for the determination of coral and substrate coverage
using random point count methodology. Computers and Geosciences 32:
1259-1269.
Marshall, P.A. & Baird, A.H. (2000). Bleaching of corals on the Great Barrier
Reef: differential susceptibilities among taxa. Coral Reefs 19: 155-163.
Marshall, P.A. & Schuttenberg, H. (2006). A reef manager’s guide to coral
bleaching. Great Barrier Reef Marine Park Authority, Townsville, Australia,
163 pp.
Maynard, J.A., Marshall, P.A., Johnson, J.E., & Harman, S. (2010). Building
resilience into practical conservation: identifying local management responses
to global climate change in the Southern Great Barrier Reef. Coral Reefs 29:
381-391.
McClanahan, T.R., Donner, S.D., Maynard, J.A., MacNeil, M.A., Graham, N.A.J.,
Maina, J., Baker, A.C., Alemu, J.B.I., et al. (2012). Prioritizing key resilience
indicators to support coral reef management in a changing climate. PLoS
ONE 7(8): e42884. doi:10.1371/journal.pone.0042884.
NAMRIA topographic map. (1979). National Mapping and Resource Information
Authority (NAMRIA ) Topographic Map reprinted 1979.
Nyström, M., Folke, C. & Moberg ,F. (2000). Coral reef disturbance and resilience
in a human-dominated environment. Trends in Ecology and Evolution 15
(10): 413-417.
Nyström, M. & Folke, C. (2001). Spatial resilience of coral reefs. Ecosystems 4:
406-417.
Obura, D. & Grimsditch, G. (2008). Resilience-integrating science and
management in coral reefs relevant to climate change. In Obura, D.O., J.
Tamelander and O. Linden (eds) Ten years after bleaching – facing the
consequences of climate change in the Indian Ocean. CORDIO Status Report
(2008). Coastal Oceans Research and Development in the Indian Ocean/ SidaSAREC. Mombasa. http//:www.cordioea.org.
Obura, D.O. & Grimsditch, G. (2009). Resilience assessment of coral reefs - rapid
assessment protocol for coral reefs, focusing on coral bleaching and thermal
stress. IUCN working group on Climate Change and Coral Reefs. IUCN,
Gland, Switzerland. 70 pp.
Szmant, A.M. (2002). Nutrient enrichment on coral reefs: is it a major cause of
coral reef decline? Estuaries 25 (4b): 743-766.
Walker, B.H., Anderies, J.M., Kinzig, A.P, & Ryan, P. (2006). Exploring resilience
in social-ecological systems through comparative studies and theory
development: introduction to the special issue. Ecology and Society 11(1): 12.
Wilkinson, C.R., & Souter, D. (eds). (2008). Status of Caribbean coral reefs after
bleaching and hurricanes in 2005. Global Coral Reef Monitoring Network,
Reef and Rainforest Research Center, Townsville, 152 pp. ____________________________________________________________________________________________________________
www.philscitech.org
41
SHORT COMMUNICATION
Green Synthesis of Bimetallic
PdAg Nanowires as Catalysts for
the Conversion of Toxic Pollutants
Jose Isagani B. Janairo
Biology Department, College of Science, De La Salle University, 2401 Taft
Avenue, Manila 0922, Philippines
Material Science and Nanotechnology Unit, Center for Environmental and
Natural Sciences Research, De La Salle University, 2401 Taft Avenue, Manila
0922, Philippines
Abstract—The green synthesis of bimetallic PdAg nanowires which were created under ambient conditions
and in the absence of any stabilizers and harsh reagents is herein reported. The straightforward synthesis
involved a one-pot set-up containing only the HEPES buffer, metal salt and reductant. The PdAg nanowires
were efficient catalysts toward the reduction of common and toxic nitrophenol pollutants. The nanowires
exhibited high turnover frequency and were able to achieve total conversion of the starting material. The
bimetallic materials were also superior catalysts relative to other materials reported in literature. Taken
together, the method and material presented have the potential to be of great use and value to
environmental catalysis.
Keywords—Environmental catalysis, bimetallic materials, PdAg nanowires, nitrophenol reduction
INTRODUCTION
Catalysis is an important component of environmental management since it
has the capacity to offer realistic solutions to many ecological problems (Centi et
al, 2002). Catalysts help the environment at two fronts: efficient use of resources
that will lead to waste minimization; and reduction of the harmful effects of toxic
pollutants through degradation. Hence, it can be said that developing efficient
catalytic systems will directly benefit the environment. One of the approaches in
developing more efficient catalysts is utilizing bimetallic systems. Bimetallic
nanostructures exhibit higher catalytic activity over their monometallic
counterparts due to the synergism that exists between the two metals (Singh and
Xu, 2013). Among the different bimetal combinations, palladium and silver
bimetallic materials are highly sought after since both metals complement each
other. Palladium is an important element in catalysis, wherein it is involved in
numerous reactions such as the different C-C couplings (Balanta et al, 2011).
Palladium however has very weak optical properties, in contrast to silver which
often exhibit strong surface plasmon resonance (SPR) within the visible range.
SPR refers to the collective oscillations of the surface electrons of the metal at
specific wavelengths (Stewart et al, 2008). Hence, silver nanostructures are often
used as sensors that exploit this phenomenon (Homola 2003). Thus, by combining
the two important metals together, nanostructures with high catalytic performance
and adequate optical properties may be achieved (He et al, 2010). Colloidal-based
methods are the common routes in which bimetallic nanostructures are prepared
(Gu et al, 2012). Stabilizers are essential constituents of the synthesis since they
prevent aggregation and influence the shape formation of the nanostructures.
Common stabilizers used in the formation of PdAg nanostructures include sodium
bis(2-ethylhexyl)sulfosuccinate
(AOT)
(Chen
et
al,
2006),
cetyltrimethylammonium bromide (CTAB) (He et al, 2010), among others. Taking
into consideration the environmental impacts of the synthesis, it is more desirable
to devise a minimalist method which will involve less components and benign
Corresponding Author
Revised: July 15, 2015
Accepted: August 15, 2015
Published: September 17, 2015
reaction conditions. Bearing this in mind, we report here the green synthesis of
bimetallic PdAg nanowires which were created in the absence of any stabilizers
and harsh reagents, less amount of reagents and under ambient conditions. The
PdAg nanowires exhibited excellent catalytic activity towards the conversion of
common toxic pollutants.
METHODOLOGY
Nanomaterial Synthesis
The synthesis of the bimetallic materials was carried out in aqueous
environment and under normal atmosphere, pressure and room temperature. In a 20
mM HEPES-buffered solution at pH 7.4, K2PdCl4 was added to yield a final
concentration of 30 µM. The palladium ions were reduced upon the addition of 200
µM NaBH4. After ten minutes, 30 µM of AgNO3 was added and the solution was
allowed to stand for 90 minutes. Reduction was stopped through the 10-fold
dilution of the resulting solution. Characterization of the materials involved bright
field- scanning electron microscopy (BF-STEM), energy dispersive X-ray
spectroscopy (EDX) and UV-Vis spectrophotometry. For BF-STEM and EDX, 5
µL of the diluted sample was introduced onto a carbon coated copper disk. For
UV-vis measurements, the diluted sample was placed inside a glass cuvette.
Catalytic Activity Determination
The reduction of nitrophenol into aminophenol was used as the probe reaction
wherein the three different kinds of isomers were used as the substrate (2nitrophenol, 3-nitrophenol and 4-nitrophenol). In a glass cuvette with a micro
stirring bar, 50 µM of the nitrophenol substrate and 10 mM of NaBH4 were added.
Upon the addition of the bimetallic material which corresponds to 0.8 mol% with
respect to both metals, the colored substrate immediately faded signifying that
reduction has taken place. The progress of the reaction was monitored for five
minutes by time-resolved UV-vis measurements at the following wavelengths: 2nitrophenol = 414 nm; 3-nitrophenol = 391 nm; 4-nitrophenol = 398 nm. NaBH4 is
necessary for the reduction to take place. In the absence of any catalyst however,
the reaction does not take place even after 30 minutes to 24 hours as signified by ____________________________________________________________________________________________________________
www.philscitech.org
42
Figure 1. BF-STEM images of PdAg bimetallic nanowires. Scale bar = 50 nm
the unchanged absorbance readings of the starting material at their respective
wavelengths. Catalytic activity was assessed by calculating the rate constant and
turnover frequency.
The nanostructures formed are characterized as having slender and elongated
morphologies (Figure 1). The nanowires form networks and branch off at several
points. The composition of the nanowires was determined to be a mixture of both
palladium and silver according to UV-vis and EDX measurements. The UV-vis
spectrum of the PdAg nanowires is different from the typical spectra of
monometallic Pd and Ag nanostructures (Figure 2). The obtained UV-vis spectrum
has an increasing absorbance from 400 – 800 nm and a weak peak at 350 nm. The
absorption spectrum of the nanowires appears to be a combination from that of Pd
and Ag. This is because Pd nanostructures of different shapes and sizes usually
have a featureless absorption spectrum from 200-800 nm (Janairo and Sakaguchi,
2014). On the other hand, silver nanostructures exhibit surface plasmon resonance
(SPR) upon irradiation with light (Wiley et al, 2006). This leads to a UV-vis
spectrum characterized by having a strong absorption at the wavelength in which
the surface electrons resonate with. Moreover, the obtained UV-vis spectrum
shares similarities with that of the PdAg nanostructures produced by He et al
(2010). The EDX spectrum of the PdAg nanowires supports the UV-vis spectrum
and confirms that indeed the obtained structures were bimetallic (Figure 3). The
faint signals of palladium and silver from the K line are conclusive evidence in
addition to the overlapping signals from the L lines. The strong copper signal is
from the copper grid in which the sample was placed. It should be noted that the
synthesis of the PdAg nanowires was carried out in environmentally-friendly
conditions. Stabilizers and harsh reagents were not utilized, in addition to very
dilute conditions. This demonstrates efficient use of materials which will have
minimal wastes. In the absence of any stabilizers, non-aggregated structures were
still formed. The presence of the HEPES buffer may have helped stabilize the
structures since the presence of a buffer influences nanostructure formation
(Janairo and Sakaguchi, 2014). This is possible since HEPES possesses sulfonic
acid and hydroxyl moieties that have the ability to bind with metal surfaces. The
buffer may thus be involved in capping the growth of the nanostructure resulting in
the regulation of its morphology. The HEPES buffer also regulates nanostructure
growth by maintaining the pH since the rate of metal reduction is dependent on the
pH (Li et al, 2015).
Figure 3. EDX spectrum of the PdAg nanowires
used to study catalytic systems such as Pt-Ni bimetallic structures (Ghosh et al,
2004), composites of silver/iron oxide (Chiou et al, 2013), among others. It
follows pseudo-first order reaction kinetics, provided that NaBH4 is in a large
excess amount compared to the substrate. Once the pseudo-first order kinetic state
is reached, increasing the amount of NaBH4 will not affect the reaction. Table 1
shows the calculated catalytic parameters for the PdAg nanowires. The calculated
rate constants for the PdAg nanowires for all substrates were much higher than the
monometallic Pd nanostructures at identical catalyst loading and reaction
conditions (Janairo et al, 2014). This signifies that alloying palladium with silver
did enhance the catalytic activity of the resulting nanostructures. Furthermore, the
calculated turnover frequency values of the PdAg nanowires for all substrates were
also superior relative to other nanocatalysts reported in literature (Table 2). This
indicates that the prepared PdAg nanowires are efficient catalysts for the
conversion of common nitrophenol pollutants. In addition to the synergistic effect
of alloying, the unique overall architecture of the nanowires may have endowed the
material with excellent catalytic properties. The layers and networks formed by the
PdAg nanowires provided an overall porous structure for the material which can
aid in enhancing the catalytic properties of the material (Rolison, 2003). Porous
materials have high surface areas, therefore more exposed surface ready to
accommodate reactions (Fang et al, 2012). Aside from this, the porosity of the
materials aids catalytic activity by facilitating the passivity and diffusion of the
reagents (Bhandari and Knecht, 2011).
Table 1. Comparison of the pseudo-first order rate constant (x10-3 s-1) of the PdAg
nanowires and previously synthesized Pd nanoparticles at identical reaction
conditions.
2-nitrophenol
3-nitrophenol
4-nitrophenol
PdAg Nanowires
14.8 ± 5.3
56.5 ± 3.3
96.6 ± 11.7
Pd nanoparticles
(Janairo et al, 2014)
1.97 ± 0.06
4.07 ± 0.85
4.23 ± 0.21
CONCLUSION
Figure 2. UV-vis spectrum of the PdAg nanowires
The catalytic activity of the PdAg nanowires towards the conversion of
pollutants was assessed using nitrophenol isomers as the substrates. All three
nitrophenol isomers are common toxic pollutants that are by-products of industrial
wastes (Megharaj et al, 1991). The catalytic reduction of nitrophenol into
aminophenol is well-known and often used to study the properties of catalysts. It
follows an adsorption-reaction-desorption mechanism which makes it ideal to be
used to study catalytic surfaces (Blaser et al, 2009). This reaction has been often
In summary, we have presented a simple and straightforward approach in
synthesizing catalytically active bimetallic PdAg nanowires. The synthesis
involves very ambient and environmentally-friendly reaction conditions. The
nanowires were characterized by BF-STEM, UV-Vis spectrophotometry and EDX
which revealed the slender and elongated structures made up of both metals. The
PdAg nanowires were efficient catalysts toward the reduction of common and toxic
nitrophenol pollutants. The bimetallic materials were also superior catalysts
relative to other materials reported in literature. Taken together, our method and
material have the potential to be of great use and value to environmental catalysis. ____________________________________________________________________________________________________________
www.philscitech.org
43
Table 2. Comparison of turnover frequency (h-1) of PdAg nanowires with other materials reported in literature.
Wu et al, 2013
ACKNOWLEDGEMENT
The author would like to thank Prof. Kazuyasu Sakaguchi of Hokkaido
University for his assistance.
None
REFERENCES
Balanta A., Godard C., Claver C. Pd nanoparticles for C-C coupling reactions.
Chem Soc Rev 2011; 40: 4973-4985
Bhandari R., Knecht MR. Effects of the material structure on the catalytic activity
of peptide-templated Pd nanomaterials. ACS Catal 2011; 1: 89-98
Blaser H., Steiner H., Studer M. Selective catalytic hydrogenation of
functionalized nitroarenes: an update. ChemCatChem 2009; 1: 210-221
Centi G., Ciambelli P., Perathoner S., Russo P. Environmental catalysis: trends and
outlook. Catal Today 2002; 75: 3-15
Chen CH., Sarma LS., Wang GR., Chen JM., Shih SC., Tang MT., Liu DG., Lee
JF., Chen JM. and Hwang BJ. Formation of bimetallic Ag-Pd nanoclusters via
the reduction between Ag nanoclusters and Pd2+ ions. J Phys Chem B 2006;
110: 10287-10295
Chiou JR., Lai BH., Hsu KC., Chen DC. One-pot green synthesis of silver/oxide
composite nanoparticles for 4-nitrophenol reduction. J Hazard Mater 2013;
248-249: 394-400
Fang X., Liu Z., Hsieh MF., Chen M., Liu P., Chen C., Zheng N. Hollow
mesoporous aluminosilica spheres with perpendicular pore channels as
catalytic nanoreactors. ACS Nano 2012; 6: 4434-4444
Ghosh SK., Mandal M., Kundu S., Nath S., Pal T. Bimetallic Pt-Ni nanoparticles
can catalyze reduction of aromatic nitro compounds by sodium borohydride in
aqueous solution. Appl Catal A-Gen 2004; 268: 61-66
Gu J., Zhang YW., and Tao F. Shape control of bimetallic nanocatalysts through
well-designed colloidal chemistry approaches. Chem Soc Rev 2011; 41:
8050-8065
He W., Wu X., Liu J., Hu X., Zhang K., Hou S., Zhou W. and Xie S. Design of
AgM bimetallic alloy nanostructures (M = Au, Pd, Pt) with tunable
morphology and peroxidase-like activity. Chem Mater 2010; 22: 2988-2994
Homola J. Present and future of surface plasmon resonance biosensors. Anal
Bioanal Chem. 2003; 377: 528-539
Janairo JIB. and Sakaguchi K. Effects of buffer on the structure and catalytic
activity of palladium nanomaterials formed by biomineralization. Chem Lett
2014; 43: 1315-1317
Janairo JIB., Sakaguchi T., Hara K., Fukuoka A. and Sakaguchi K. Effects of
biomineralization peptide topology on the structure and catalytic activity of
Pd nanomaterials. Chem Commun 2014; 50: 9259-9262
Kaur B., Tumma M. and Srivastava R. Transition-metal-exchanged nanocrystalline
ZSM-5 and metal-oxide-incorporated SBA-15 catalyzed reduction of
nitroaromatics. Ind Eng Chem Res 2013; 52: 11479-11487
Li J., Shi XY., Bi YY., Wei JF. and Chen ZG. Pd nanoparticles in ionic liquid
brush: a highly active and reusable heterogeneous catalytic assembly for
solvent-free or on-water hydrogenation of nitroarene under mild conditions.
ACS Catal 2011; 1:657-664
Li S., Zhang W., Chen E., Chen R. One-pot hydrothermal synthesis of Pd/Fe3O4
nanocomposite in HEPES buffer solution and catalytic activity for Suzuki
reaction. Mat Res Bull 2015; 66: 186-191
Megharaj M., Pearson HW. and Venkateswarlu K. Toxicity of phenol and three
nitrophenols toward growth and metabolic activities of Nostoc linckia,
isolated from soil. Arch Environ Contam Toxicol 1991; 21: 578-584
Rolison DR. Catalytic nanoarchitectures – the importance of nothing and the
unimportance of periodicity. Science 2003; 299: 1698-1701
Singh AK. and Xu Q. Synergistic catalysis over bimetallic alloy nanoparticles.
ChemCatChem 2013; 5: 652-676
Stewart ME., Anderton CR., Thompson, LB., Maria J., Gray SK., Rogers JA.,
Nuzzo RG. Nanostructured plasmonic sensors. Chem Rev 2008; 108: 494-521
Wiley BJ., Im SH., Li ZY., McLellan J., Siekkinen A. and Xia Y. Maneuvering the
surface plasmon resonance of silver nanostructures through shape-controlled
synthesis. J Phys Chem B 2006; 110:15666-15675
Wu X., Lu C., Zhang W., Yuan G., Xiong R. and Zhang X. A novel reagentless
approach for synthesizing cellulose nanocrystal-supported palladium
nanoparticles with enhanced catalytic performance. J Mater Chem A 2013; 1:
8645-8652
Zeng T., Zhang X., Wang S., Ma Y., Niu H. and Cai Y. A double-shelled yolk-like
structure as an ideal magnetic support of tiny gold nanoparticles for
nitrophenol reduction. J Mater Chem A 2013; 1: 11641-11647 ____________________________________________________________________________________________________________
www.philscitech.org
44
POP SCIENCE
Integrative Societal Resilience
or ‘One Resilience’ Approach:
Towards Optimal Health and Wellbeing
by Noel Lee J. Miranda, DVM, MSc
The author, Noel Lee J. Miranda, DVM, MSc, is an independent senior consultant on emerging infectious diseases, One Health, One Resilience and continuity of operations
planning. He has over 30 years experience as a government officer and in the private sector (national and regional- Philippine Department of Health, WHO, ASEAN, ADB, USAID,
IFRC and EU funded projects). He is an expert on whole-of-society multi-sectoral pandemic/all-hazards preparedness and response planning at regional and country levels. He
recently served as ADB Regional Coordinator for Ebola virus disease. Email him at: [email protected]
Background and Rationale
Emerging pandemic threats (EPT) are recognized as real challenges to health
and global security. The technical, political, socio-economic, environmental and
comprehensive security challenges posed by EPTs require holistic collaborative
efforts- going beyond the health sector. Lack of preparedness is anticipated to
result in massive socio-economic disruptions and loss of lives, as conveyed by the
West African Ebola virus disease (EVD) outbreaks where the combination of
spreading fear and uncertainty, and the imposition of movement restrictions and
quarantine have heavily impacted on livelihood, business and essential services
and economic activities, that have led to social devastation and unrest.
EPT is just one among the challenges in attaining optimal health. Disaster
threats, which are multi-hazards and multifaceted in nature- including poverty,
have the potential to result in massive socio-economic disruptions and loss of lives.
Such negative consequences hinge on the extent and effectiveness of sectoral and
systems collaboration, which is countered by the prevalence of sectoral and
disciplinary silos- silos being basically characterized as the lack of collaborations
of systems or sectoral efforts and resources being separately spent on common
concerns. It is believed that lack of collaboration on overlapping concerns can be
magnified upon further elaboration of the potential for collaboration and synergy
among systems.
Therefore, ‘One Resilience’1 is introduced here as a proposed rallying point,
movement and approach towards strategic systems’ integration for attaining
optimal health. One Resilience movement may be defined as the integration of
security systems capacities along areas of sectoral interdependencies and synergies
for the unitive attainment of health, food/water, energy, social, environmental and
disaster resilience. By this approach, multi-systems and stakeholders (including
political, military, civil society organizations, private citizens etc.) impacted by a
human health problem (e.g. Ebola virus infection outbreaks) are expected to work
better together to address the common problem. The initiation of a One Resilience
movement may be likened to the now popular One Health movement, which was
kick-started through the promulgation of the twelve Manhattan Principles in 20042,
aiming to promote an international and interdisciplinary approach to attain optimal
health for people, animals and the environment. Since then, One Health has been
able to harness growing support from the human, animal and environmental health
sectors.
Focus Areas and Objectives
Under the proposed more encompassing One Resilience approach, while
health systems-focused efforts through approaches such as One Health must
continue, broader sectoral and systems’ actions to multi-spectral issues/concerns
that are commensurate to infectious disease emergence/disaster risk and impacts
must be mounted. The focus of actions should include, among others, services
disruptions; disaster risk and impact reduction; climate change adaptation; poverty
reduction; terrorism; atrocities and armed conflicts; population displacement;
social discrimination; and regressive governance, social, traditional, and agroindustrial practices. These could encompass the unitive promotion of robust
community-based farming and marketing, development of appropriate
technologies, education to the poor, efficient land utilization and distribution,
prevention of environmental degradation, peace and public security negotiations at
all levels and angles, imposition of self-regulation, universal health coverage, etc.
Therefore, it is implied here that societal resilience is the condition whereby
optimal health and wellbeing of people is sustained.
One Resilience aims for the realization of optimal health through the
attainment of systems’ resilience (the ability of communities/society to be less
impacted by disruptions- that in the face of disruptions, integrated systems are able
to regain normalcy without unnecessary delays). One Resilience specifically aims
for more holistic systems’ restructuring and refining, beyond just effective multisectoral and interdisciplinary collaborations- e.g. biosecurity being merely focused
1History
on the interface of animal-human-environmental health. One Resilience aims for
broad security-resilience systems integration, focused on the interface of all
interdependent systems.
Expected Outcome
Health, food, water, energy, social and environmental security and resilience
are attained collectively through the strengthening of cross-system dependency and
synergy. Poverty reduction is a very relevant entity, as generally poverty alleviation
means vulnerability reduction- this has been documented in relation to the
likelihood of infectious disease emergence in impoverished community settings3.
And, this is clearly demonstrated in the case of the spread of Ebola in West Africa.
A One Resilience approach is expected to penetrate deeper into societal issues and
problems.
One Resilience should ensure that long-term investments of money, time and
effort directed to various societal security entities, are sufficiently protected,
especially when disasters and disruptions hit. People and essential service sectors
should be drawn to naturally support and depend on each other.
Proposed Key Actions
Targeted initiatives must promote broad resilience objectives, cognizant that
absolute efficiency of systems, especially in relation to mega disasters, is
contingent on the interdependencies of sectoral approaches, and the capacity to
enable strategic systems synergies. Of prime importance are the enabling of
institutional mindset-change, whole-of-community mobilization, and enhanced
integrative leadership, good governance and sectoral stewardship. In this regard,
below are proposed key actions (or steps) for concerned multi-sectoral
stakeholders and national/regional governments to pursue:
1. The first critical step (Step 1) is to elaborate the One Resilience approach and
conceptual framework, and conduct a deeper analysis of systems’
interdependencies and interconnectedness, and associated costs and benefits.
Policy development could follow, and governance and resources committed.
2. The succeeding steps, as informed by Step 1, would include institutional
restructuring (see below) and innovative systems capacity building. Capacity
building is expected to be facilitated by better collaboration among stakeholders.
Examples of capacity building agenda are presented in Annex 2.
3. Institute heightened measures on whole-of-society pandemic/disaster risk and
impact reduction.
Institutionalize sectoral leadership and operational
interoperability. This requires strategic integration of interrelated issues within
an integrative all-hazards risk and impact management framework and
mechanism. These call for whole-of-government to mobilize and coordinate all
relevant government departments and agencies. It requires enhanced systems
management in an integrated sciences framework (including natural-healthsocial-industrial-security sciences) that forms systematic and sustainable bonds
among a cadre of civil servants and private practitioners.
4. Strategically change the mindset of leaders, civil servants and all other actorsthat no discipline or sector is marginalized and elimination of sectoral silos is
achieved. Non-conventional approaches to cross-disciplinary learning must
continue to be introduced—aiming to produce a global One Resilience
workforce that can broadly manage integrated security-resilience systems at all
levels.
5. Address above challenges as regional blocks and as a global community. There
must rise a One Resilience leadership that can provide assurance that prevention,
risk reduction and preparedness efforts across security systems are
commensurate to pandemic/hazard risk and potential impacts, and that holistic
approach for global good and inclusive benefit will ensure that no nation will be
more vulnerable and disadvantaged than others.
Science and policy research promotion bodies must set these actions in the
context of ‘systems innovation’ (involving enacting legislation, capacity-building of One Health, http://www.cdc.gov/onehealth/people-events.html
Global Attention to Emerging Pandemic Threats and Risks: The need to strengthen One Health systems and Whole-of-Society preparedness, http://philscitech.org/2015/1/1/013.html
2Sustained
of poverty and likely zoonoses hotspots, http://www.ilri.org/node/1244
____________________________________________________________________________________________________________
www.philscitech.org
3Mapping
and policy advocacy). As One Resilience embodies regeneration of an integrative
social, economic, political-security and governance paradigm, and implies
overhauling collaborative mechanisms, policy research plays an important role in
laying down the foundation and enabling integrative sectoral capacity building,
which entails innovation in products, processes, services and systems. Thus, the
first critical step proposed is the methodical analysis of systems’ interdependencies
and interconnectedness (refer to Annex 1 for the proposed approach to Step 1).
From this step, strategies to whole-of-systems resilience can be methodically
developed and their feasibility further explored. Considering the nature of this
initiative, all sectoral stakeholders are required to work collaboratively to see the
proposed actions through.
Guiding Principles
The case presented here is beyond mere terminologies or catchphrases. It is
about the ability of sectors and systems to be driven to think and work together as
one for achieving optimal health and wellbeing, and societal resilience.
Philosophically, the One Resilience approach should bring about ‘unity of
humanity in mind and action’. It is hoped that the call for unbiased involvement of
all sectors and systems will effectively remove disciplinary and sectoral
boundaries, and enable “whole-of-government” mobilization and coordination to
better promote innovation and ensure national competitiveness.
Annex 1.
Step 1: Establishing the One Resilience Conceptual Framework
The first key step to One Resilience implementation is to construct a
conceptual framework showing relationships of all societal stakeholders and
synergistic functional systems towards achieving “Optimal Health”. For instance,
the following are the existing functional systems that have not been effectively
synergized, or have traditionally operated in silos:
1)
2)
3)
4)
5)
6)
7)
8)
Biosecurity (including One Health)
Health security (Referring to primary health care and universal health
coverage)
Food security
Energy security
Environmental security (including conservation)
Social security (all aspects of poverty reduction, education, social services)
Protection security (referring to peace and order)
Disaster security
Defining Security-Resilience Interrelationships and interrelatedness
The above security systems are disaster/crisis vulnerable- in the face of mega
disasters, all security systems must be robust enough to better cope with the
destruction and disruptions, and be able to recover faster- e.g. food production
systems (How secure are national and global systems?)
What are interdependencies among areas of concern?- e.g. how does food
security-resilience relate to biosecurity? How does one impact on the other?
Infectious Disease (ID) Outbreaks have been documented to impact on food
security, energy security, livelihood, and other systems. Specifically, Ebola virus
disease in West Africa heavily impacted agricultural production and commercetherefore- bioenergy crop production, services operations and supply chains,
livelihood, public security (prompting riots, criminality), and general human
(family) health and wellbeing are disrupted.
The integration of systems into a broader platform or framework recognizes
the multi-faceted nature of Optimal Health (i.e. all aspects of harm, hazards and
poverty risk reduction). The conceptual framework for integrated security systems
needs to be established (this integration is called One Resilience Approach)
To do this, all systems stakeholders should engage in a cross-system dialogue
(a workshop) where a synergy matrix will be developed, as below:
Security-Resilience Interrelationships and interrelatedness- an exercise where
participants (government, industry and university sectors), will provide inputs on
cross-system impacts. The outputs of this exercise will further benefit from a
review of related literature.
Example for Biosecurity in relation to other systems
SecurityResilience
Entities
How is Bio-security impacted by
the lack in the other securityresilience entities?
How does lack of Biosecurity
impact on other securityresilience entities?
Health
•
Compromised disease
prevention
Food and
Water
•
•
•
•
Non-biosecure farming practices • Lack of workforce
• Threat to agriculture
Debilitation of health states
• Water contamination
Compromised human health and welfare
Proliferation of wildlife trade
•
Burden on entire health
system
45
Energy
Production
• Compromised hospital care
and laboratory testing
• Compromised farm biosecurity
• Compromised human health
and welfare
Mass housing
•
Exposure to biohazards
•
Sustainable
livelihood
•
This impacts on poverty, which
will counter multiple aspects
• Lack of workforce- and
inputs
Education and
community
outreach
•
Inefficient health delivery
•
Public Safety
and Security
•
Disrupted access to health
care
inputs
Disaster risk
reduction,
mitigation and
response
•
Disrupted access to health
care
Burden on health services
capacities
•
Environmental
protection
•
Burden on health services
capacities
inputs
•
inputs
Lack of workforce- and
inputs
inputs
inputs
Determining shared needs and capacities:
NEEDED
SUPPORT
Biosecurity
Biosecurity
xxxxxxx
Health security
Health
security
Food
security
Energy
security
Environmental
security
Social
security
Protection
security
xxxxxxx
Food security
xxxxxxx
Energy security
xxxxxxx
Environmental
security
xxxxxxx
Social security
xxxxxxx
Protection
security
xxxxxxx
The above matrix should show what support one needs from others. The
following should show what support each can offer to others.
OFFERED
SUPPORT
Biosecurity
Biosecurity
xxxxxxx
Health security
Food security
Energy security
Environmental
security
Social security
Protection
security
Health
security
Food
security
Energy
security
Environmental
security
Social
security
Protection
security
xxxxxxx
xxxxxxx
xxxxxxx
xxxxxxx
xxxxxxx
xxxxxxx
These should be based on real capacities of systems to provide support across
other systems. This is what we have not yet realized very well because these
systems have traditionally operated in silos.
If we can fill these matrices completely, then the conceptual framework will
be formed and actions can be actualized through policies and institutional changes,
and strategic action-implementation plans. The process must instill in everyone the
‘crisis mentality’- for people naturally unite when faced with life and death
situations. We must perceive the continuing state of poverty as such.
However, before reaching the synergy matrix stage, the initial step is for each
system to map out its key essential functions, and the enabling functions or
elements- e.g. for biosecurity to effectively prevent infectious disease emergence
and outbreaks, this must be enabled by numerous elements including providing
families with means to acquire food and earn livelihood- so that they need not ____________________________________________________________________________________________________________
www.philscitech.org
depend on wildlife trade (as we can see poverty reduction is a key focus area).
This is just an example. There should be more aspects involved.
•
•
•
Example:
System
Key Essential Functions
Enabling Elements/Functions
Biosecurity
Prevent infectious disease emergence and
outbreaks/ pandemic impacts
Providing families with means to acquire food
and earn livelihood- so that they need not
depend on wildlife trade
•
•
•
•
•
•
•
•
•
•
Summary of One Resilience System Management Considerations
(examples)
•
All-hazards (multi-impact) approach
46
High-level National Platform (e.g. Non-Traditional Security Council)
Multi-sectoral-disciplinary sub-platforms (per security-resilience entity)
Designation of most qualified line agency as lead and oversight (per subplatform)
Designation of multidisciplinary RRTs/ TWGs (per sub-platform)
Designation of Institutional Disaster Focal Point(s) (per stakeholder
organization)
Define links between authorities (Sub-platform Interrelatedness)
Leadership and governance (national & regional/global)
Whole-of-systems approaches
Systems’ interdependencies
Costs-Benefits
Policies
Resources
Mind-set change Annex 2.
Proposed One Resilience Capacity Building in Relation to All-hazards Preparedness
Strategic Areas
A.
Governance, Coordination
and Preparedness Planning:
National and Sub-national
This takes into consideration that
impacts of disasters on society
could escalate beyond the
concerns of just one sector
Gaps
•
•
•
•
•
•
Proposed Activities
Need to define the command and control structure that is able to mobilize wholeof-society disaster preparedness and response.
Need to define the system of command interoperability and multi-sectoral
engagements to best ensure crisis-specific responses and continuity of essential
operations.
Uncertainty as to who takes charge in relation to evolving disaster/crisis
challenges.
Multi-sector-wide planning needs to be promoted. Countries still lack whole-ofsociety representation.
Institutionalization of integrated national oversight requires strategic changing of
mindset of leaders, civil servants and other actors
The following are general issues/deficiencies in preparedness and response
planning:
o Decentralized policy and geographic constraints
o Developing, updating and streamlining Preparedness and Response
policies, plans and SOPs, with clear designation of roles and
responsibilities
o Strengthening and broadening designations of multi-disciplinary rapid
response teams (RRT) and defining the terms of reference
o Interagency communication
o Strengthening community participation
o Logistics preparedness/readiness
o Workforce augmentation and training across key expertise and functions.
Training of trainers is key.
o Technology development and innovations
o Conducting periodic whole-of-society simulation exercises
o Monitoring and evaluation capacities
o Dedicated and sustained funds and resources for capacity building
•
Whole-of-society continuity of essential services planning has not been fully
taken up in most countries and at regional level. Countries generally do not have
operations continuity plans, or need to finalize and implementing their operations
continuity plans.
Community resilience initiatives need to be promoted
Need to address the fundamental vulnerability that uniformly applies to all
sectors- i.e. the anticipated high absenteeism in the face of direct impact of
illness/death, preoccupation with caring for others, and growing fear vis-à-vis
increasing infection, deaths and social unrest.
There is need to ensure efficient and coordinated movement of goods and
persons across borders during severe disasters such as pandemics and other
crises. Among others, this would include trade in essential goods and services;
food; spare parts
•
•
•
•
•
•
Establish interoperable integrated multi-sectoral (whole-of-society) oversight and coordination within an all-hazards/
comprehensive security framework (e.g. through the National Security Council or other high-level bodies under the office of
the President or Prime Minister). This requires close examination of the state of integrated hazards risk and impact
management (framework and mechanism).
Establish linkages with non-governmental and civil society organizations (NGOs and CSOs) and private sector groups.
Pursue the systematic involvement of services providers, NGOs/CSOs, and the military, based on identified areas of sectoral
interdependencies. Therefore, establish Partners Coordination Mechanism.
For the security sector to develop their specific Preparedness and Response Plan that is supportive to the national plan
— e.g. elaborating the military’s role, such as building surge capacities and supporting services continuity such as logistics
and farming. Joint civil-military planning and coordination may be strengthened and properly contextualized
Build support-manpower resources. It is important that there is a systematic mechanism for augmenting manpower with
skilled/trained manpower according to sector/skill-specific demands under a severe crisis (all-hazards framework)
In relation, define the sources of trained manpower, as well as the triggers for engagement of these resources.
Develop sector-specific training programs within sectors and systems, but with inter-sectoral and cross system inputs.
The following are key enabling activities:
•
•
•
•
Clearly define the authority, mandate/role and capacitation of the high-level inter-ministerial oversight body for multisectoral coordination. This may involve legislative review.
Ensure that comprehensive threats preparedness plans (including sector-wide continuity of sectoral operations) are in
place at all levels (vertical and horizontal). These plans must define sectoral platforms, leadership, and roles of whole-ofsociety and sectoral actors such as private service providers, law enforcement, military, etc. Establish community-based plan
implementation
Allocate/mobilize the enabling budget/resources
Conduct periodic tests and simulation exercises. Develop exercise tools.
•
B. Protection and Continuity of
Essential Services Planning
In the event of possible wide-scale
disruptions of essential services
•
•
•
•
•
•
•
•
•
•
•
Initiate or pursue continuity of essential services/ protection of critical infrastructures planning within individual sectors
and inter-sectorally, and among systems (i.e. identify essential service sectors and formulate policies and guidelines,
information and communication strategies, addressing the specific needs of vulnerable groups etc.). This may require
forming technical working groups to draft plans.
Promote civil-military cooperation
Promote internal continuity of operations planning or business continuity planning (BCP) in both public and private sectors.
Conduct social vulnerability assessments to identify most-at-risk populations.
Develop templates and checklists, advocacy materials, BCP capacity building, pilot mechanisms, and explore publicprivate partnerships
Promote cooperation with service providers and supporting organizations (private sector, NGOs, and humanitarian
organizations)
Establish resilient/disaster-ready farming communities that are self-sustainable in relation to essential goods and
livelihood. This requires piloting/modeling and exploring public-private partnerships. Effective linking with poverty
reduction programs.
Promote innovations in delivery of essential services and emergency relief
In relation to promoting community resilience:
• Establish standards and checklist on community-based capacity building for continuity of operations/services.
Cross cutting elements
•
•
•
•
•
•
Participatory community-based approaches
Institutional mindset-change approaches
Enhancing systems’ integration leadership, good governance and sectoral
stewardship
Systems piloting
Conducting appraisals/assessments of ongoing national nontraditional/human
security systems and continuity of essential operations capacity building
initiatives, and the challenges within countries.
Inter-regional collaborations
The inputs to Annex 2 are based on past assessments, correspondences and
interviews with regional focal points, regional work plans, reports, and
discussions and recommendations from regional biopreparedness workshops,
consultations and meetings (refer to list of references).
REFERENCES
Regional Guidance Documents, Work Plans, Reports, Workshops and
Exercises, Correspondences, others
•
Develop community-level assessment survey/ tool/ exercises; and undertake (e.g. by local government)
preparedness mapping (to include service provider business continuity plans and risk communication plans). Create
feedback loop/ mechanism with communities.
•
Establish an ASEAN regional database on best practices, and institute sharing of information and promotion of best
practices.
•
Conduct regional consultation on community resilience involving selected representatives from local government,
community-based and civil society organizations, and humanitarian and risk reduction organizations.
•
Establish community-based resilience programs with focus on individual security systems within comprehensive securitydesign targeted outreach, education, etc. (attention to vulnerable segments of communities)
Key areas include food and agriculture bio-security
Establish targeted higher education/training programs (consider online training)
Conduct piloting in selected communities/settings (promote best practices in the process)
Conduct appraisals of capacities through ASEAN—set benchmarks/ and springboard from previous experiences/tools
•
•
•
•
ASEAN Work Plan on Multi-sectoral Pandemic Preparedness and Response,
2012-2015, ASEAN Working Group on Pandemic Preparedness and
Response
ASEAN Medium Term Plan on Emerging Infectious Diseases (MTP for EID),
2011-2015, ASEAN Expert Group on Communicable Diseases
ASEAN Plus Three Health Ministers Special Meeting on Ebola Preparedness and
Response, 14-15 December 2014, Bangkok
IFRC Southeast Asia Pandemic and Public Health Emergencies Preparedness
Workshop, 17-20 November 2014, Singapore
Biosecurity in Southeast Asia Workshop, 3-7 November 2014, Manila (Asia
Pacific Center for Security Studies) ____________________________________________________________________________________________________________
www.philscitech.org
USAID-STRIDE Workshop: Innovations in Essential Services and Emergency
Relief in the Immediate Aftermath of a Disaster, 17 June 2014, Manila
ASEAN Regional Forum Cross-Sectoral Security Cooperation on BioPreparedness and Disaster Response: Inception Planning Workshop, 3-5
September 2013, Manila
USAID PREPARE Pandemic Preparedness Project (2009-2013) Final Report
The Prince Mahidol Award Conference 2013- “A world united against infectious
diseases: cross-sectoral solutions”, 28 January - 2 February 2013, Bangkok
Regional Framework for Multi-sectoral Pandemic Disaster Security Preparedness
and Response, ASEAN, 2012
Pandemics as Threats to Regional and National Security High-Level CrossSectoral Consultation– Part 2: Advancing the ASEAN Regional Multisectoral Pandemic Preparedness Strategic Framework, 9-11 January 2013,
Manila (PREPARE Project)
An Interim Arrangement to Establish a Desk for the Implementation
(Operationalization) of the ASEAN Regional Framework in Responding to
the Impacts of Pandemics, Concept Note, December 2012
Philippines Multi-sectoral Pandemic Disaster Exercise, 10-14 September 2012,
Makati City, Philippines (PREPARE Project)
Towards a Safer World conference- ‘’Beyond pandemics: a whole-of-society
approach to disaster preparedness’’, 15-16 September 2011, Rome
47
Southeast Asia Regional Multisectoral Pandemic Preparedness and Response
Table Top Exercise: Managing the Impact of Pandemics on Societies,
Governments and Organizations, 16-20 August 2010, Phnom Penh
One Health assessment in Asia, 2011 (unpublished data complied by reviewer)
National Multi-sectoral Pandemic Preparedness and Response: Consolidated
Assessment Report, September 2011 (ASEAN-US Technical Assistance and
Training Facility)
Animal and Pandemic Influenza: A Framework for Sustaining Momentum, UN
System Influenza Coordination and the World Bank, Fifth Global Progress
Report July 2010
Asia Pacific Strategy for Emerging Diseases (APSED) 2010, WHO-WPRO/
SEARO
APSED Progress Report, WPRO, 2014
Ebola Virus Disease (EVD) Preparedness in the Western Pacific Region:
Summary of Online Survey, WPRO, 5 November 2014
Global Health Security Agenda: Toward a World Safe and Secure from Infectious
Disease Threats, 2014
WHO Emergency Response Framework (ERF), 2013
Consultations/Correspondences with key representatives from ASEAN
governments, ASEAN Secretariat, WPRO, SEARO, US CDC, USAID,
IFRC, DFAT ____________________________________________________________________________________________________________
www.philscitech.org
48
SHORT COMMUNICATION
Potential of Endophytic Fungi of Barnyard Grass
Weed for Biological Control of the Rice Sheath
Blight Pathogen, Rhizoctonia solani Kühn
Dindo King M. Donayre*1 and Teresita U. Dalisay2
1Crop
Protection Division, Philippine Rice Research Institute Central
Experiment Station, Maligaya, Science City of Muñoz, Nueva Ecija,
Philippines
2Crop Protection Cluster, College of Agriculture, University of the Philippines
Los Baños, College, 4301 Laguna, Philippines
Abstract—Endophytic fungi are group of microorganisms that colonize internal tissues of plants but do not
cause any harm to their hosts. Although it has been reported that endophytic fungi from weeds have the
potential as biological control agents against disease-causing pathogens of crops, the efficacy of those from
barnyard grass weeds against sheath blight disease of rice caused by Rhizoctonia solani Kühn has not yet
been studied. This study determined the potential of endophytic fungi of barnyard grass weed (Echinochloa
glabrescens Munro ex Hook. f.) as biological control agents of R. solani and identified the most effective of
these endophytic fungi.
Of 577 endophytic fungal isolates studied, rapid mycelial growth over R. solani was shown by sterile
mycelia (SM EF-ds61-73, SM EF-ds375-97), EF-ds68-129, Geotrichum sp. EF-ds104-16 and Mucor sp. EFds158-2 in in vitro pre-screening tests. In dual culture tests, however, EF-ds68-129, Geotrichum sp. EFds104-16 and SM EF-ds375-97 exhibited mycelial growth increments of 17.0, 13.3 and 14.2 mm,
respectively, resulting in 24% growth inhibition of R. solani. Closer observation revealed that only Geotrichum
sp. EF-ds104-16 showed hyperparasitism through coiling and disruption of R. solani hyphae at 6 and 8 days
after initial contact.
Keywords—Endophytic fungi, barnyard grass, Echinochloa glabrescens, sheath blight, Rhizoctonia solani,
weed, rice, biological control, hyperparasitism, dual culture
INTRODUCTION
Rice, Oryza sativa L., is the staple food of 90% of the Filipino population and
carries the largest weight of a single commodity in the consumer price index. It is
used as a barometer for inflation in the whole country (PhilRice 2003). Attaining
higher yield in rice is sometimes not met due to occurrence of several factors like
insect pests, weeds and diseases. Sheath blight of rice, caused by Rhizoctonia
solani Kühn, is one of the major fungal rice diseases in tropical, sub-tropical and
temperate regions of Asia, Africa and Americas (Ou 1985). The disease was first
reported in Japan in 1909 and thereafter in Taiwan in 1912, Philippines in 1918 and
India in 1920. In terms of severity and economic importance, sheath blight is
considered second in rank after rice blast (Donayre et al. 2013; Endino et al. 2013;
Banniza and Holderness 2001). Depending on the severity of infection, yield losses
due to sheath blight range from 5 to 50% (Agres 2012; Raymundo 2006; Xuan and
Alcala 2008). The durability of recently developed rice varieties with resistance to
R. solani is uncertain due to the pathogen’s wide host range and variability in terms
of interaction with its host and environmental conditions (Perialde et al. 2013;
Rillon and Duca 2013; Eizenga et al. 2002; Shahjahan and Mew 1992).
Consequently, the use of fungicides is the main method of control despite the
potential health risks and development of fungicidal resistance by the pathogen
(Groth 2005; Slaton et al. 2003; Manila 1980).
Submitted: October 27, 2014
Revised: August 4, 2015
Biological control is considered an innovative approach to management of
plant pathogens. This is of interest in sustainable agriculture due to increasing
regulation and restriction of pesticides as well as the unsuccessful attempts to
control diseases by other means (Maloy 1993). In plant pathology, this approach
emphasizes the manipulation of microorganisms to control plant pathogens.
Weeds have been proven as good sources of beneficial organisms that can
potentially be utilized to protect plants from infection. These beneficial
microorganisms, called endophytes, include bacteria and fungi that colonize
internal plant tissues (Petrini and Carroll 1981). Weed species like Centella
asiatica (L.) Urb., Parthenium hysterophorus L., Imperata cylindrica (L.) Beauv.
and Cenchrus echinatus L., have been reported to harbor several genera of
endophytic fungi like Acremonium, Alternaria, Aspergillus, Bipolaris,
Cladosporium, Colletotrichum, Curvularia, Cylindrocarpon, Fusarium,
Glomerella, Guignardia, Myriogenospora, Nigrospora, Penicillium, Periconia and
Thialophora (Rakotoniriana et al. 2008; Romero et al. 2001; Rachdawong 2002).
In the course of studying endophytic fungi on rice weeds, Donayre et al. (2014)
found that barnyard grass, Echinochloa glabrescens Munro ex Hook. f., is a host of
different species of endophytic fungi. None of the many endophytic fungal isolates
recovered from 7,680 tissue segments of barnyard grass, however, has been
evaluated for biological control potential against R. solani. This study, therefore,
was conducted to (a) determine the potential of endophytic fungi of barnyard grass
weed as biological control against R. solani and (b) identify the most effective
endophytic fungi against R. solani. ____________________________________________________________________________________________________________
www.philscitech.org
49
Figure 1. Rapid mycelial expansion of endophytic fungal isolates over Rhizoctonia solani.
biocontrol agents overlapped, cover slips were removed and placed on separate
glass slides with a drop of lactophenol cotton blue and sealed for examination
using a microscope with an attached digital camera (Olympus DP72-BSW).
Collection of Isolates and Preparation of Media
Methodologies on collection of barnyard grass and isolation of endophytic
fungi are discussed in Donayre et al. (2014). Two different culture media, namely
potato dextrose agar (PDA) and malt extract agar (MEA) prepared by mixing 39 g
and 33 g of their powder preparations, respectively, each in a liter of distilled
water, were used to grow the endophytic fungi (EF). Each mixture of culture
medium was transferred separately to storage bottles of 500 ml capacity, mixed and
dissolved by heating in a microwave for 15 min, and sterilized in an autoclave for
15 min at 121ºC.
Isolation of Rhizoctonia solani
Sheath blight infected rice leaves were collected at the nursery of the Crop
Protection Division, Philippine Rice Research Institute, Muñoz, Nueva Ecija for
the isolation of R. solani (Rs). Five cut pieces of infected tissues each measuring
25 mm2 were surface sterilized with 10% NaOCl, rinsed thrice in sterile water, and
then transferred to sterile petri plates filled with congealed PDA. The plates were
incubated for 5 days at room temperature. To obtain pure cultures of the pathogen,
a portion of its mycelial growth was transferred to PDA slants. Slant cultures with
the pathogen were then kept under laboratory conditions.
Preliminary Bio-efficacy In Vitro Screening
A total of 577 EF isolates from barnyard grass samples during the dry season
were used in this part of the study (Donayre et al. 2014). Four EF isolates were
seeded against R. solani in a petri plate. Seven-day old mycelial growth of each EF
and Rs was excised with sterilized 10 mm cork-borer. A disc of EF was placed
equidistantly on four sides with one mycelial disc of Rs at the center of the plated
PDA. The interaction between the endophytic fungi and the pathogen was visually
rated. EF isolates that developed fast and overgrew the pathogen’s hyphae within
three days were selected and further evaluated using the dual culture test.
Dual Culture Test (DCT)
Each disc of EF and Rs were equidistantly placed on the plated PDA. EF and
Rs, seeded in separate plates, served as controls. The interaction between the EF
and Rs was evaluated using the rating scale of Bell et al. (1982) as follows: 1 = the
antagonist completely overgrew the pathogen and covered the entire medium
surface, 2 = antagonist overgrew the pathogen at least two-thirds of the medium
surface, 3 = both the antagonist and the pathogen colonized one-half of the
medium surface, 4 = pathogen overgrew the antagonist at least two-thirds of the
medium surface, and 5 = pathogen completely overgrew the antagonist and
occupied the entire medium surface. An endophytic fungus was considered
antagonistic to the pathogen if the mean score for a given comparison when
rounded to the nearest whole stage is less than or equal to two. High antagonism
was not considered if the number was greater than or equal to three (Rebuta 2008).
The growth of EF and Rs on DCT was compared to the growth of Rs or EF alone.
The plates were incubated under room temperature for three days. Increment of
growth (IG) was computed as IG (day 1 to 3) = [growth(day 3) – growth(day1)]/ 2
while inhibition of the pathogen’s growth was determined by measuring the
percentage reduction in colony diameter (CD) using the equation below:
Growth inhibition (%) =
CD(pathogen alone) — CD(pathogen in DCT)
✕ 100
CD(pathogen alone)
The experiment was arranged in a Completely Randomized Design (CRD)
with five replications and five Petri plates per replication. All data gathered were
subjected to statistical analysis using analysis of variance (ANOVA) while
computed means were compared using FLSD values at 5% level of significance.
The computer package SAS 9.1.3 was utilized in the analysis.
Test for Hyperparasitism
Agar blocks (10mm2), cut from plated PDA with a sharp and flame-sterilized
scalpel were placed on opposite ends of a sterile glass slides. Mycelia of Rs and
those EF that showed potential as biocontrol agents were placed on each of these
agar blocks. A sterile cover slip was placed on top of each agar block. These agar
blocks inside sterile petri plates were then incubated for 5 days with moistened
sterile tissue paper. When visible growth of both the pathogen and the potential
Preliminary Bio-efficacy In Vitro Screening
Of 577 EF isolates that were tested, only five, coded as sterile mycelia (SM
EF-ds61-73, SM EF-ds375-97), EF-ds68-129, Geotrichum sp. EF-ds104-16 and
Mucor sp. EF-ds158-2, showed rapid mycelial growth over R. solani after 3 days
of incubation in PDA culture medium (Figure 1).
Dual Culture Test
In dual culture tests (DCT), all four of the five promising EF grew faster than
the test pathogen with Mucor sp. EF-ds158-2 as the exception (Table 1). SM EFds61-73, EF-ds68-129, Geotrichum sp. EF-ds104-16 and SM EF-ds375-97 had
mycelial growth increments of 11.1, 17.0, 13.3 and 14.2 mm, respectively. In terms
of growth inhibition, only EF-ds68-129, Geotrichum sp. EF-ds104-16 and SM EFds375-97 were antagonistic by inhibiting 24% of the pathogen’s growth (Figure 2).
Based on Bell’s rating, however, the three EF isolates only overgrew two-thirds of
the mycelial growth of the pathogen in PDA medium. Nevertheless, the three EF
isolates showed inhibitory effect on the pathogen by limiting its growth on the
substrate. In studying endophytic fungi as biocontrol agents against R. solani,
Lanceta (2010) reported that Penicillium and Aspergillus isolates effectively
reduced the radial growth of the pathogen in the form of hyperparasitism and
antibiosis. Sadoral (2010) also had similar findings on the effect of two endophytic
fungi against pathogenic Colletotrichum sp. causing leaf spot on Jatropha curcas
L. Both studies found out that Geotrichum and Aspergillus isolates effectively
inhibited the growth of the pathogen by 46.74 and 44.74%, respectively, in dual
culture tests. Naik et al. (2009) also reported that Chaetomium globosum, an EF
isolated from rice, inhibited the mycelial growth of Nigrospora oryzae (64.29%
inhibition), R. solani (62.13%), Altenaria alternata (62.15%), and Phoma sorghina
(61.11%) in dual culture tests. They added that Penicillium chrysogenum greatly
decreased mycelial growth of Macrophomina phaseoli by 79.81%. Moreover, Tian
et al. (2004) also reported that endophytic fungal isolates from four rice varieties
[Qilisimiao (Q-1), Huajingxian (H-1). Huaza35 (H-35), Jinfengzhan (J-1)], namely
Fusarium, Penicillium and Aspergillus showed 58.8, 20.0 and 18.5% antagonism
against Magnaporthe grisea, Rhizoctonia solani, Xanthomonas oryzae pv. oryzae
and Fusarium moniliforme, respectively.
Table 1. Antagonistic activity of potential endophytic fungal isolates in dual
culture test.
GROWTH
INCREMENT
(mm)1/
GROWTH
INHIBITION
(%)2/
BELL’S
RATING3/
SM EF-ds61-73
11.1 c
6.4 b
3b
EF-ds68-129
17.0 a
24.2 a
2a
Geotrichum sp. EF-ds104-16
13.3 b
24.2 a
2a
6.1 e
1.6 c
3b
SM EF-ds375-97
14.2 b
24.8 a
2a
Rhizoctonia solani
9.4 d
-
-
FLSD
0.89
4.35
0.00
EF ISOLATES
Mucor sp. EF-ds158-2
Means with the same letters are not significantly different at 5% level of significance using FLSD.
1/ - Growth increment (%) (day 1 to 3) = {[growth(day 3) – growth(day1)] /2} x 100
2/ - Growth inhibition (%) = colony diameter (pathogen alone) – colony diameter (pathogen in DCT) x 100
Colony diameter (pathogen alone)
3/ - Bell’s rating: 1 = the antagonist completely overgrew the pathogen and covered the entire medium surface, 2 = antagonist
overgrew the pathogen at least two-thirds of the medium surface, 3 = both the antagonist and the pathogen colonized onehalf of the medium surface, 4 = pathogen overgrew the antagonist at least two-thirds of the medium surface, and 5 =
pathogen completely overgrew the antagonist and occupied the entire medium surface ____________________________________________________________________________________________________________
www.philscitech.org
50
Figure 2. Antagonistic activity of three potential endophytic fungal isolates against Rhizoctonia solani in a dual culture test.
Hyperparasitism
Of the three potential EF isolates, only Geotrichum sp. EF-ds104-16 showed
hyperparasitism against R. solani. Initially observed as hyphal contact with the
pathogen’s hyphae as early as 2 days after inoculation (DAI), this was followed by
penetration, coiling and disruption of R. solani’s hyphae at 4, 6 and 8 DAI,
respectively (Figure 3). As there is no previous report on the effect of Geotrichum
against any pathogen, it can be inferred that the degradation of hyphae might be
the result of various enzymatic hydrolysis and cellular activities by chitinases such
as 1,4-β-acetylglucosaminidases (GlcNAcases), endochitinases and exochitinases
much like the secretions by Trichoderma (Kubicek et al. 2001 and Howell 2003).
Gao et al. (2005) also found similar manner of mycoparasitism when they cocultivated Chaetomium spirale Zoft ND35, a dominant endophyte c fungal strain
isolated from Populus tomentosa Carr., with R. solani using the agar-block culture
technique. Their observations under the light microscope and transmission electron
microscope revealed that C. spirale Zoft ND35 densely coiled around the hypha of
R. solani with intracellular growth coming from its penetration peg. At a later stage
of the antagonism process, they found several hyphae of R. solani that were
strongly degraded, emptied and abnormally shaped. When they incubated ultrathin
sections from individual colonies of either C. spirale Zoft ND35 or R. solani with
gold-labelled wheat germ agglutinin (WGA) for localizing N-acetylglucosamine
residues (chitin), they concluded that chitinases might be involved in the cell-wall
degradation of R. solani.
Figure 3. Hyperparasitism of Geotrichum sp. EF-ds104-16 (G) on
Rhizoctonia solani (Rs) under the light microscope at 1000x magnification:
(a) hyphal contact at 2 days after inoculation (DAI), (b) penetration inside
the hyphae at 4 DAI, (c) coiling around the hyphae at 6 DAI, and (d)
disruption of the pathogen’s hyphae at 8 DAI.
CONCLUSION
This study confirmed that endophytic fungi of barnyard grass weed have the
potential as biological control agents against R. solani. More specifically,
endophytic fungal isolates EF-ds68-129, Geotrichum sp. EF-ds104-16, and SM
EF-ds375-97 were found effective against the pathogen. It is recommended that
additional tests, including experiments under field conditions, be undertaken to
confirm their effectiveness. Likewise, a bio-assay to determine their effect on other
major disease-causing rice pathogens, such as Pyricularia grisea Sacc.,
Xanthomonas oryzae pv. oryzae ex Ishiyama, and Bipolaris oryzae (Breda De
Haan) Shoemaker, must be conducted.
ACKNOWLEDGEMENT
Special thanks to the Department of Agriculture-Philippine Rice Research
Institute; Department of Science and Technology-Science Education Institute; and
Philippine Council for Agriculture, Aquatic and Natural Resources Research and
Development for the thesis support granted to the corresponding author.
CONFLICT OF INTERESTS
The authors declare no conflict of interest.
Both authors contributed in the conceptualization of the study. DKM Donayre
was responsible for the implementation of the study, gathering and analysis of data,
and writing of the paper while TU Dalisay for the editing of the paper.
REFERENCES
Agres EP, Pojas SV, Inocencio LG, Simon LF. Assessment of damage caused by
major rice pests under rainfed ecosystem. In PhilRice (eds.). Philippine Rice
R&D Highlights 2011. Philippine Rice Research Institute, Maligaya, Science
City of Muñoz, Nueva Ecija, Philippines, 2012: 483-484.
Banniza S, Holderness M. Rice sheath blight: pathogen biology and diversity. In
Screenivasaprasad S, Johnson R (eds.). Major Fungal Diseases of Rice:
Recent Advances. Kluwer Acad. Pub., Dordrecht, 2001: 201–211.
Bell DK, Wells HD, Markham CR. In vitro antagonism of Trichoderma species
against six fungal plant pathogens. Phytopathology 1982; 72: 379-382.
Donayre DKM, Endino CA, Ciocon IMG. Rice pest incidence and farmers’ pest
management practices in Western Visayas. In PhilRice (Ed.). Philippine Rice
R&D Highlights 2012. Philippine Rice Research Institute, Maligaya, Science
City of Muñoz, Nueva Ecija, Philippines, 2013: 44-48.
Donayre DKM, Dalisay TU, Bayot RG, Baltazar AM. Diversity and tissue
specificity of endophytic fungi in barnyard grass weed (Echinochloa
glabrescens Munro ex Hook. f.). Asia Life Sciences 2014; 23(2): 725-742.
Eizenga GC, Lee FN, Rutger JN. Screening Oryza species plants for rice sheath
blight resistance. Plant Disease 2002; 86: 808–802.
Endino CA, Ciocon IMG, Donayre DKM. Plant health assessment at PhilRice
Negros seed production area. In PhilRice (Ed.). Philippine Rice R&D
Highlights 2012. Philippine Rice Research Institute, Maligaya, Science City
of Muñoz, Nueva Ecija, Philippines, 2013: 10-13.
Gao K, Liu X, Kang Z, Mendgen K. Mycoparasitism of Rhizoctonia solani by
endophytic Chaetomium spirale ND35: ultrastructure and cytochemistry of
the interaction. Phytopathology 2005; 153: 280–290.
Groth DE. Azoxystrobin rate and timing effects on rice sheath blight incidence and
severity and rice grain and milling yields. Plant Disease 2005; 89: 1171-1174.
Howell CR. Mechanisms employed by Trichoderma species in the biological
control of plant diseases: The history and evolution of current concepts. Plant
Disease 2003; 87(1): 4-10.
Kubicek CP, Mach RL, Peterbauer CK, Lorito M. Trichoderma: from genes to
biocontrol. Journal of Plant Pathology 2001; 83(2): 11-23.
Lanceta KL. Colonization Frequencies of Endophytic Fungi in Irrigated Lowland
Rice Cultivars and Their Antagonistic Activity on Rhizoctonia solani Kuhn,
Causal Pathogen of Sheath Blight of Rice (Oryza sativa L.). Unpublished BS
Thesis, University of the Philippines Los Baños, College, Laguna,
Philippines, 2010: 63.
Maloy OC. Plant Disease Control: Principles and Practice. John Wiley & Sons,
N.Y., 1993: 346.
Manila CE. Adaptation of Rice Isolate of Rhizoctonia solani Kühn to Benomyl,
PCNB and Thiopanale Methyl In Vitro and In Vivo. Unpublished MS Thesis,
University of the Philippines Los Baños, College, Laguna, Philippines, 1980:
122.
Naik BS, Shashikala J, Krishnamurthy YL. Study on the diversity of endophytic
communities from rice (Oryza sativa L.) and their antagonistic activities in
vitro. Microbiological Research 2009; 164(3): 290-296.
Ou SH. Rice Diseases. 2nd Ed. Commonwealth Mycological Institute, England,
1985: 380.
Perialde ES, Flores C, Bauzon IML, Tadle FPJ, Elicot ARA. Evaluation of
breeding lines for pest resistance. In PhilRice (ed.). Philippine Rice R&D
Highlights 2012. Philippine Rice Research Institute, Maligaya, Science City
of Muñoz, Nueva Ecija, Philippines, 2013: 2-5.
Petrini O, Carroll G. Endophytic fungi in foliage of some Cupressaceae in Oregon.
Canadian Journal of Botany 1981; 59: 629–636.
PhilRice. Philippine Rice Production Training Manual. Maligaya, Science City of
Muñoz, Nueva Ecija, 2003: 229.
Rachdawong S. Collection and isolation of endophytic fungi from diverse species
of the Gramineae in the Central region of Thailand. Retrieved November 9,
2009, from National Centre for Genetic Engineering and Biotechnology ____________________________________________________________________________________________________________
www.philscitech.org
National Science & Technology Development Agency database on World
Wide Web, 2002: http://www.biotec.or.th/rdereport/prjbioteceng.asp
Rakotoniriana EF, Munaut F, Decock C, Randriamampionona D,
Andriambololoniaina M, Rakotomalala T, Rakotonirina EJ, Rabemanantsoa
C, Cheuk K, Ratsimamanga SU, Mahillon J, El-Jaziri M, Quetin-Leclercq J,
Corbisier AM. Endophytic fungi from leaves of Centella asiatica: occurrence
and potential interactions within leaves. Antonie van Leeuwenhoek 2008; 93:
27–36.
Raymundo AD. Lost Harvest: Quantifying the Effect of Plant Diseases on Major
Crops in the Philippines. University of the Philippines Los Baños, College,
Laguna, Philippines, 2006: 233.
Rebuta AMJ. Internal Mycobiota of Banana Cultivars and Their Antagonistic
Activity on Fusarium oxysporum f.sp. cubense (E.F. Smith) Snyder and
Hansen. Unpublished BS Thesis, University of the Philippines Los Baños,
College, Laguna, Philippines, 2008: 86.
Rillon JP, Duca MSV. Evaluation of rice lines for resistance to major pests. In
PhilRice (ed.). Philippine Rice R&D Highlights 2012. Philippine Rice
Research Institute, Maligaya, Science City of Muñoz, Nueva Ecija,
Philippines, 2013: 12 - 13.
Romero A, Carrion G, Rico-Gray V. Fungal latent pathogens and endophytes from
leaves of Parthenium hysterophorus (Asteraceae). Fungal Diversity
2001:7:81-87.
51
Sadoral JP. Survey and Characterization of Leaf Spot Diseases of Jatropha curcas
L. in the Philippines and Utilization of Fungal Endophytes and Epiphytes as
Biological Control Agents Against Colletotrichum sp. Unpublished MS
Thesis, University of the Philippines Los Baños, College, Laguna,
Philippines, 2010: 130.
Shahjahan AKM, Mew TW. Response of sheath blight development to rice crop
management in lowland and upland environments. Philippine Phytopathology
1992; 28(1&2): 34–44.
Slaton NA, Cartwright RD, Meng J, Gbur EE Jr, Norman RJ. Sheath blight
severity and rice yield as affected by nitrogen fertilizer rate, application
method, and fungicide. Agronomy Journal 2003; 95: 1489-1496.
Stone JK, Polishook JD, White JF JR. Endophytic fungi. In Mueller, GM, GF Bills
and MS Foster (eds). Biodiversity of Fungi: Inventory and Monitoring
Methods. Elsevier Academic Press, London, UK, 2004: 241–270.
Tian XL, Cao LX, Tan HM, Zeng QC, Jia YY, Han WQ, Zhou SN. Study on the
communities of endophytic fungi and endophytic actinomycetes form rice and
their antipathogenic activities in vitro. World Journal of Microbiology and
Biotechnology 2004; 20: 303–309.
Xuan TH, Alcala AVC. Rice diseases. In PhilRice (ed.). Outsmarting Rice Pests
and Diseases. Philippine Rice Research Institute, Maligaya, Science City of
Muñoz, Nueva Ecija, 2008: 2-35. ____________________________________________________________________________________________________________
www.philscitech.org
52
SHORT COMMUNICATION
Incidence and molecular detection of
Salmonella enterica serogroups and spvC
virulence gene in raw and processed meats
from selected wet markets in Metro Manila,
Philippines
Shiela A. Soguilon-Del Rosario1 and Windell L. Rivera*1,2
1Institute
of Biology, College of Science, University of the Philippines Diliman,
Quezon City 1101, Philippines
2Natural Sciences Research Institute, University of the Philippines Diliman,
Quezon City 1101, Philippines
Abstract—A simple and specific detection method for Salmonella enterica was applied to determine its
incidence in raw and processed meats purchased from selected wet markets in Metro Manila, Philippines. A
total of 320 raw and processed meat samples were analysed for the presence of S. enterica and S. enterica
possessing spvC gene of the virulence plasmid. Polymerase chain reaction (PCR) revealed that 30.63%
(98/320) were positive for S. enterica and 2.81% (9/98) of S. enterica-positive samples were also positive for
the spvC gene. S. enterica was identified from chicken samples (67.5%), ground pork (65%), beef (52.5%),
sausage (longganisa) (25%), cured pork meat (tocino) (20%), burger patty (12.5%), and meatloaf (embotido)
(2.5%). Positive samples were further analysed for O-serogrouping targeting S. enterica serogroups A, B,
C1, C2, D, and E1. Our findings revealed that the raw and processed meats tested were contaminated with
more than one serogroup in a sample. Samples were found positive for S. enterica serogroups E1 (78.57%),
C1 (29.59%), C2 (20.41%), B (17.35%) and D (6.1%). No samples were found positive for S. enterica
serogroup A. This is the first report on the use of multiplex PCR for the detection and characterization of S.
enterica in raw and processed meats in the Philippines. Data on incidence of S. enterica and its serogroups
found in raw and processed meats in selected Philippine wet markets gathered from this study can be used
for further research on epidemiology and related topics.
Keywords—Salmonella enterica, serogroups, spvC gene, raw and processed meats, wet markets, Metro
Manila
INTRODUCTION
Potential biological hazards in meat include bacteria, toxins, viruses, protozoa
and parasites. Of these, bacteria cause a large proportion (approximately 90%) of
all foodborne illnesses. The bacterial pathogens that are most likely to be found in
commonly slaughtered livestock (cattle, sheep, and swine) and poultry (chicken
and turkey) include Salmonella enterica, Campylobacter sp., and Listeria
monocytogenes. These pathogens have been implicated in widely publicized
foodborne disease outbreaks associated with the consumption of meat and poultry
products (Food Safety and Inspection Service 1999). Salmonellosis, which is
caused by Salmonella, is one of the leading causes of foodborne bacterial enteritis
in many countries (Centers for Disease Control and Prevention 2004a; Tirado and
Schmidt 2001). Outbreaks of diseases are reported frequently, implicating different
kinds of food contaminated with S. enterica (Centers for Disease Control and
Prevention 2004b; Ethelberg et al. 2004; Fielding et al. 2003; Matsui et al. 2004).
S. enterica is a common cause of human gastroenteritis and bacteremia worldwide
(Hendriksen et al. 2009; Morpeth et al. 2009; Schlundt et al. 2004; Voetsch et al.
2004). A wide variety of animals, particularly food animals, have been identified as
reservoirs of non-typhoidal Salmonella (Bangtrakulnonth et al. 2004; Guard-Petter
2001; Vindigni et al. 2007). Currently, Salmonella consists of 2,659 different
serovars (Issenhuth-Jeanjean et. al. 2014) and based on the Salmonella Serotype
Statistics, approximately 60% belong to subspecies I, S. enterica subsp. Enterica
(Centers for Disease Control and Prevention 2008).
Raw and processed meats in the Philippines are typically sold in two types of
markets, supermarkets and wet markets. The supermarkets, which are indoor
markets, often display pre-packaged raw meat under refrigeration. In contrast, the
wet markets usually display unwrapped raw and processed meats at ambient
temperatures which are easily contaminated with foodborne pathogens. Reports of
S. enterica contamination on raw and processed meats in the country are limited.
Reliable detection methods are therefore required for diagnosis and prevention of
food contamination and foodborne outbreaks. Traditional microbiological
techniques, such as the International Organization for Standardization (ISO)
method 6579 for detecting Salmonella in food, take up to 5 days to obtain a
positive result. This ISO method includes pre-enrichment and selective enrichment
in liquid culture, and biochemical and serological confirmation of colonies grown
on agar plates (International Organization for Standardization 2002). Delays
caused by the identification procedure can hinder the appropriate response to an
outbreak of disease. For a more reliable and fast analysis, polymerase chain ____________________________________________________________________________________________________________
www.philscitech.org
reaction (PCR) has been applied in various stages of the diagnostic procedure:
confirmation of suspected colonies grown on agar plates, analysis of enrichment
broths, and direct analysis of suspected foodstuffs. PCR employs specific primers
to detect the presence of pathogens in a shorter period of time. Various studies used
this technique for the detection of Salmonella spp. (Chiu and Ou 1996; Kawasaki
et al. 2009; Pritchett et al. 2000). Furthermore, studies on the application of
molecular methods in detection and characterization of S. enterica isolates in the
Philippines are limited. Multiplex PCR of S. enterica isolates, for instance, is not
widely performed in the Philippines. As such, known serogroups are not accurately
documented.
This study aimed to determine the presence of S. enterica in raw and
processed meats from four wet markets in Metro Manila, Philippines:
Commonwealth, Balintawak, Cubao, and Caloocan. Samples included raw meat
such as cut chicken, minced pork, cut beef and processed meats, such as
homemade meatloaf (locally called embotido), sausage (locally called longganisa),
cured pork meat (locally called tocino), burger patty, and ham. Specifically, this
study aimed to: (1) detect S. enterica via multiplex PCR targeting the invA and
spvC genes; and (2) characterize S. enterica isolates via multiplex PCR detection
of the somatic (O) antigen.
53
buffered saline (PBS), centrifuged at 15,330 × g for 5 min. The supernatant was
again discarded, and the pellets were suspended in 50 μl sterile distilled water for
DNA extraction (O’Regan et al. 2008). The suspension was heated at 99 ºC for 10
min (Shanmugasamy et al., 2011), and then pelleted by centrifugation at 2,656 × g
for 5 min. The DNA extracts were immediately cooled on ice.
Multiplex PCR detection of invA and spvC genes
DNA amplification was performed in a reaction volume of 25 μl. Each
reaction mixture contained 12.5 μl of 2× GoTaq® Green Master Mix (Promega), 1
μl each of 10 μM forward and reverse primers of invA and spvC genes (Table 2), 7
μl of sterile double distilled water, and 1.5 μl DNA template extracted from RVS
broth. PCR was performed under the following conditions: initial denaturation at
95 °C for 2 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s,
extension at 72 °C for 30 s and final extension at 72 °C for 5 min. Amplicons were
visualized by a UV transilluminator (BioRad®) after electrophoresis on 1.5%
agarose gel stained with ethidium bromide (0.5 µg/ml). The Salmonella
Typhimurium UPCC 1360 obtained from MRSL was used as positive control,
while sterile double distilled water was used as negative control.
Table 2. Primer sequences used for multiplex PCR methods for the detection of
Salmonella enterica.
Collection of samples
Primer
Three hundred twenty (320) raw and processed meat samples were randomly
obtained from selected wet markets in Metro Manila, Philippines: Balintawak,
Caloocan, Commonwealth, and Cubao (Table 1). Ten samples of each type of meat
were collected in each of the four wet markets. All samples were placed in a cooler
(approximately 5 °C) during transport and immediately processed in the laboratory
for pre-enrichment. Samples were labeled according to their location, sample type
and numbered from 1 to 10.
Table 1. Incidence of Salmonella enterica in raw and processed meat samples
collected in selected wet markets in Metro Manila, Philippines.
Meat
Sample
Raw
Processed
Code
Number of
samples
per site
Number
of
samples
in 4 wet
markets
Number
of
culturepositive
samples
Cut
chicken
C
10
40
Ground
pork
GP
10
40
Type of
Meat
Number of PCRpositive samples
invA
spvC
26
27
6
26
26
0
Cut beef
B
10
40
20
21
0
Burger
patty
P
10
40
5
5
3
Embotido
E
10
40
1
1
0
Ham
H
10
40
0
0
0
Longganisa
L
10
40
10
10
0
Tocino
T
10
40
8
8
0
Total
80
320
96
98
9
F-invA
Sequence (5’-3’)
Amplification
target
Amplicon
length
(bp)
S. enterica
244
ACAGTGCTCGTTT
ACGACCTGAAT
R-invA
AGACGACTGGTAC
TGATCGATAAT
F-spvC
ACTCCTTGCACAA
CCAAATGCGGA
R-spvC
TGTCTTCTGCATTT
CGCCACCATCA
F-abe1
GGCTTCCGGCTTT
ATTGG
R-abe1
TCTCTTATCTGTTC
GCCTGTTG
F-tyv
GAGGAAGGGAAAT
GAAGCTTTT
R-tyv
TAGCAAACTGTCT
CCCACCATAC
F-prt
CTTGCTATGGAAG
ACATAACGAACC
R-prt
CGTCTCCATCAAA
AGCTCCATAGA
F-wbaDmanC
ATTTGCCCAGTTC
GGTTTG
R-wbaDmanC
CCATAACCGACTT
CCATTTCC
F-abe2
CGTCCTATAACCGA
GCCAAC
R-abe2
CTGCTTTATCCCTC
TCACCG
F-wzx–
wzy
GATAGCAACGTTC
GGAAATTC
R-wzx–
wzy
CCCAATAGCAATAA
ACCAAGC
Tm
( °C)
50.6
Reference
Chiu and
Ou 1996
48.9
65.6
S. enterica
plasmid
virulence
571
B group
561
65.2
45.2
47.9
46.0
D group
614
50.2
50.9
A & D group
256
50.6
43.8
C1 group
341
47.3
48.7
C2 group
397
48.7
45.3
E1 group
Chiu and
Ou 1996
281
45.3
Hong et al.
2008
Hirose et al.
2002
Hirose et al.
2002
Hong et al.
2008
Hong et al.
2008
Hong et al.
2008
Multiplex PCR detection of O-antigen genes
Cultivation of S. enterica
To determine the presence of S. enterica in the samples, conventional culture
method was used. Twenty five (25) grams of sample was suspended into 225 ml
buffered peptone water (BPW, Difco) and incubated at 37 °C for 18-24 h. One
hundred microliters of pre-enriched culture was simultaneously transferred to 10
ml Rappaport Vassiliadis Soy enrichment broth (RVS, Merck) and incubated at 42
°C for 18-24 h. Enriched RVS culture was inoculated in xylose lysine deoxycholate
agar (XLD, Merck) and brilliant green agar (BGA, Difco), and then incubated at
37 °C for 24-48 h at aerophilic condition. Growth on either BGA or XLD was
considered culture-positive. S. enterica serovar Typhimurium UPCC 1360 obtained
from the University of the Philippines-Culture Collection (UPCC) in the
Microbiological Research and Services Laboratory (MRSL) of the Natural
Sciences Research Institute (NSRI), was used as positive control.
DNA extraction
In each sample, 500 µl of the RVS-enriched culture was collected from
triplicate tubes into a microfuge tube and centrifuged at 15,330 × g for 5 min. The
supernatant was discarded, and the cell pellets were suspended in 1 ml phosphate
DNA amplification was performed in a reaction volume of 25 μl. Each
reaction mixture contained 12.5 μl of 2× KAPA2G Fast multiplex mix (KAPA
Biosystems), 0.5 μl (0.2 μM each) of forward and reverse primers: prt, abe1, tyv,
wzx-wzy, wbaD-manC, abe2 (Table 2), 3.5 μl of PCR grade water, and 2 μl DNA
template. Multiplex PCR of the O-antigen was performed under the following
cycling conditions: an initial denaturation at 95 °C for 3 min, followed by 30
cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and extension
at 72 °C for 60 s. Final extension was done at 72 °C for 10 min. The positive
control used is a mixture of DNA extracts consisting of Salmonella serogroups B
(abe1-positive), C1 (wbaD-manC-positive), C2 (abe2-positive), D (tyv- and prtpositive), and E1 (wzx-wzy-positive), which were previously confirmed by DNA
sequencing (Ng and Rivera, 2015), while sterile double distilled water was used as
negative control.
Agarose Gel Electrophoresis
For the invA-spvC assay, amplicons were visualized by a UV transilluminator
(BioRad®) after electrophoresis (Mupid®-2 Plus) at 100 V for 25 min. These were
run on 1.5% agarose gel stained with ethidium bromide (0.5 µg/ml). The sizes of
the target sequences were estimated using a Universal DNA Ladder (KAPA ____________________________________________________________________________________________________________
www.philscitech.org
Biosystems). The amplicons for the O-antigen assay were viewed similarly, but on
2% agarose gel and using a 100 bp DNA ladder (Vivantis) to estimate band sizes.
RESULTS
Incidence of S. enterica
A total of 320 raw and processed meat samples were included for the
detection of S. enterica. Ninety-six (96) out of 320 samples were culture-positive
for S. enterica (30%), while PCR detection showed that 98 samples were positive
for S. enterica (30.63%).
Distribution of S. enterica among raw and processed meat samples
Notably, a higher incidence of S. enterica was found in raw meats compared
to processed meats. A large percentage of chicken samples (67.5%) was positive
for S. enterica, followed by ground pork (65%), beef (52.5%), longganisa (25%),
tocino (20%), burger patty (12.5%), and embotido (2.5%). S. enterica was not
detected in ham samples (Figure 1).
54
genus Salmonella. The expression of this gene enables Salmonella to invade the
epithelial cells of its host (Shanmugasamy et al. 2011). Ninety-six (96) out of 320
samples were culture-positive for S. enterica (30%), while PCR detection showed
98 samples positive for S. enterica (30.63%). Nine samples harbored the virulence
plasmid spvC gene, which reflects a relatively lower incidence than those in other
published reports (Amini et al. 2010; Chiu and Ou 1996). Nevertheless, the
presence of this gene indicates that these isolates may cause systemic disease
(Heithoffet al. 2008).
The positive result for invA in two samples but negative for S. enterica in
culture-based method suggests that the latter methods may overlook the presence
and underestimate the number of S. enterica in a sample. El Shamy et. al. (2008)
noted that conventional culture media may not be universally sensitive for the
detection of Salmonella, depending on sample type or serotype.
The PCR-based detection used in this study is simpler, more rapid, and more
specific for the detection of S. enterica compared to culture/traditional method of
detection of S. enterica. The traditional method normally takes 7 days. With the
multiplex PCR used in this study, identification of serogroups of S. enterica could
be done in 3 days. Boiling method was selected for the preparation of the DNA
template because of the convenience of the method. Centrifugation and washing
steps were sufficient to remove the PCR inhibitors from the culture medium.
A large percentage of chicken (67.5%), ground pork (65%), and beef (52.5%)
samples were positive for S. enterica. Several outbreaks and studies of
salmonellosis in chicken/poultry have been reported (Rajagopal and Mini 2013;
Wegener and Baggesen 1996). Ground meat (e.g. ground pork, burger patty) is
among the food items frequently associated with outbreaks of salmonellosis. It is
predisposed to contamination because many processing steps are involved in its
manufacture (e.g. grinding), which potentially contribute to an increase of S.
enterica counts in the final product (Stock and Stolle 2001). Thus, the incidence of
S. enterica in ground pork could come from improper handling and use of
unsanitary mechanical grinder in meat processing in wet markets.
Figure 1. Incidence of S. enterica in raw and processed meat products
from selected wet markets in Metro Manila, Philippines.
Molecular identification of S. enterica by PCR targeting invA and the
virulence gene, spvC
In this study, invA gene was present in 98 samples. The spvC gene was
present in 2.8% of the S. enterica-positive samples. S. enterica possessing spvC
was found in six chicken and three burger patty samples only.
Figure 2. Presence of spvC (571-bp) and invA (244-bp) in selected S.
enterica isolates. L –KAPA Universal DNA ladder, PC - positive control,
NTC – no template control, 1-13 - isolates.
S. enterica serogroups and their distribution among raw and
processed meats
The amplicons produced intense bands of different expected sizes,
representing five targeted serogroups (Table 2). Of the 98 invA-positive S. enterica
samples, 78.57% were positive for serogroup E1, followed by C1 (29.59%), C2
(20.41%), B (17.35%) and D (6.1%). There were no samples positive for
serogroup A.
Figure 3. S. enterica O-serogroups (614-bp: tyv for D, 561-bp: abe1 for B,
397-bp: abe2 for C2, 341-bp: wbaD-manC for C1, 281-bp: wzx-wzy for E1,
and 256-bp: prt for A and D). L –Vivantis VC 100bp DNA ladder, PC positive control, NTC - no template control, 1-14 - isolates.
DISCUSSION
S. enterica was detected in raw and processed meat samples from selected wet
markets using culture and multiplex PCR methods. These methods yielded high
incidence of S. enterica, which supported the results of previous studies that
showed the sensitivity of targeting the invA gene of S. enterica as a reliable
detection method (Amini et al. 2010; Chiu and Ou 1996; Shanmugasamy et al.
2011). The invA gene has been recognized as international standard for detection of
S. enterica was also present in processed meat: longganisa (25%), tocino
(20%), burger patty (12.5%), and embotido (2.5%), despite the presence of
preservatives and additives (Table 1). Handling and transport were the most
probable reasons for cross-contamination. The absence of S. enterica in ham
samples could be attributed to thermal processing during the manufacturing
process.
The highest incidence of 78.57% observed for S. enterica serogroup E1 was
similar to the results of Balala et al. (2006) and Lee et al. (2009), which also
showed the predominance of serogroup E1 among isolates from clinical and food
samples collected in the Philippines. The multiplex PCR also detected S. enterica
from serogroups C1 (29.59%), C2 (20.41%), B (17.35%) and D (6.1%). Four
isolates were not characterized in multiplex PCR for O-serogrouping. Only six
serogroups were targeted using the primers abe1, tyv, prt, wbaD-manC, abe2 and
wzx-wzy in the O-serogrouping assays. Hence, these isolates could belong to other
40 Salmonella serogroups (Grimont and Weill 2007) that were not tested in this
study.
Obtaining DNA extracts from the RVS-enriched medium allows for the
detection of multiple S. enterica serogroups in one sample. It eliminates the need
for a pure isolate of every serotype of S. enterica in a sample, thus saving time and
effort. The multiplex PCR assay used for the serogrouping of the isolates may also
be considered less expensive compared to conventional serotyping assuming that
PCR and post-PCR equipment are available.
CONCLUSION
In this study, a simple and specific detection method for S. enterica was
applied in raw and processed meat samples collected from selected wet markets in
Metro Manila, Philippines. Through molecular characterization by targeting a
portion of the invA and spvC genes, S. enterica isolates were detected and
successfully characterized serologically via PCR-based detection of somatic (O)
antigen. More than one serogroup were present in a sample; 78.57% (77 samples)
with the predominance of S. enterica serogroup E1. The methods used in this study
can greatly reduce the reliance on the costly and tedious conventional serotyping.
They can be applied by any facility that lacks the expensive typing sera and
expertise needed for conventional serotyping but is equipped with basic PCR
facilities. Likewise, multiplex PCR can be useful especially during outbreaks when
rapid detection is necessary.
This is the first report on the use of multiplex PCR for the detection and
characterization of S. enterica in raw and processed meats in the Philippines. This
study, likewise, was able to establish incidence data for S. enterica and its
serogroups found in raw and processed meats in selected Philippine wet markets
which could be used for further research in epidemiology and related topics. The
relatively high incidence of S. enterica in raw and processed meats illustrates the
risk for Salmonella infection due to poorly processed meat.
ACKNOWLEDGEMENT
We thank Phyllis Anne P. Paclibare, Pauline Dianne M. Santos, and Alyzza
Marie B. Calayag for the technical assistance. This study was supported by
research grants from the Department of Agriculture-Biotechnology Program
Implementation Unit (Project Code DABIOTECH-R1212) and the Office of the
Vice-Chancellor for Research and Development of the University of the
Philippines Diliman (Project Code 151515 PNSE). ____________________________________________________________________________________________________________
www.philscitech.org
CONFLICT OF INTERESTS
The authors declare no conflict of interests regarding the publication of this
article.
SASDR and WLR conceptualized this study. The experiments were
conducted by SASDR. SASDR and WLR prepared the manuscript.
REFERENCES
Amini K, Salehi T, Nikbakht, G, Ranjbar R., Amini J., Ashrafganjooei S.
Molecular detection of invA and spv virulence genes in Salmonella enteritidis
isolated from human and animals in Iran. Afr J Microbiol Res 2010; 4(21):
2202-2210.
Balala L, Rovira H, Vizmanos M, Bernardo F, Divina B. Isolation, serologic
identification and antibiotic sensitivity testing of Salmonella spp. in chickens.
Philipp J Vet Med 2006; 43(2): 65-70.
Bangtrakulnonth A, Pornreongwong S, Pulsrikarn C, Sawanpanyalert P,
Hendriksen R, Lo Fo Wong D, Aarestrup F. Salmonella serovars from humans
and other sources in Thailand, 1993-2002. Emerg Infect Dis 2004; 10(1):
131-136.
Centers for Disease Control and Prevention. Preliminary FoodNet data on the
incidence of infection with pathogens transmitted commonly through food-selected sites, United States, 2003. Morbidity and Mortality Weekly Report
2004a; 53(16): 338–343.
Centers for Disease Control and Prevention. Diagnosis and management of
foodborne illnesses: a primer for physicians and other health care
professionals. Morbidity and Mortality Weekly Report. Recommendations
and reports/Centers for Disease Control 53 2004b; (RR-4): 1-33.
Centers for Disease Control and Prevention. Salmonella surveillance: annual
summary, 2006. Atlanta, Georgia: US Department of Health and Human
Services, CDC 2008.
Chiu C, Ou J. Rapid identification of Salmonella serovars in feces by specific
detection of virulence genes, invA and spvC, by an enrichment broth culturemultiplex PCR combination assay. J Clin Microbiol 1996; 34 (10):
2619-2622.
El Shamy H, Bakr W, Gomaa N, Barheem O. Evaluation of two enrichment broths,
three plating media and ELISA technique for the isolation of Salmonella from
dairy products. J Egypt Public Health Assoc 2008; 83(1&2): 133-145.
Ethelberg S, Lisby M, Torpdahl M, Sorensen G, Neimann J, Rasmussen P, Bang S,
Stamer U, Bertil Hansson H, Nygard K, Lau Baggesen D, Moller Nielsen E,
Molbak K, Helms M. Prolonged restaurant-associated outbreak of multidrugresistant Salmonella Typhimurium among patients from several European
countries. Clin Microbiol and Infect 2004; 10(10): 904–910.
Fielding, J.E., Raupach, J., Milazzo, A., Del Fabbro, L., Snell, P. An outbreak of
Salmonella Typhimurium phage type 4 linked to cold set cheesecake.
Commun Dis Intell 2003; 27 (4): 513–514.
Food and Drug Administration Philippines. Revised guidelines for the assessment
of microbiological quality of processed foods, 2013. Retrieved from http://
www.fda.gov.ph/attachments/article/71149/Annex%20I%20%20FC
%20203-010%20Microbiological%20Standard%20for%20Processed
%20Food.pdf.
Food Safety and Inspection Service. FSIS microbiological hazard identification
guide for meat and poultry components of products produced by very small
plants, 1999. Retrieved from http://www.fsis.usda.gov/Oa/haccp/higuide.pdf?
redirecthttp=true.
Grimont P, Weill F. Antigenic formulae of the Salmonella serovars. 9th ed. World
Health Organization, Paris 2007; 1-166.
Guard-Petter J. The chicken, the egg and Salmonella enteritidis. Environ Microbiol
2001; 3 (7): 421-430.
Heithoff D, Shim, W, Lau P, Badie G, Enioutina E, Daynes R, Bynre, B, House, J,
Mahan, M. Human Salmonella clinical isolates distinct from those of animal
origin. Appl Environ Microbiol 2008; 74(6): 1757-1766.
Hendriksen R. Global epidemiology of non-typhoidal Salmonella infections in
humans. PhD Dissertation, National Food Institute, 2010. Retrieved from
http://www.dtuaqua.dk/upload/f%C3%B8devareinstituttet/food.dtu.dk/
publikationer/2010/global%20epidemiology%20of%20non-typhoidal
%20salmonella%20infe ctions %20in%20humans.pdf.
55
Hendriksen R, Mikoleit M, Kornschober C, Rickert R, Duyne S, Kjelso C, Hasman
H, Martin C, Dik M, Threlfall J, Angulo F, Aarestrup F. Emergence of
multidrug-resistant Salmonella concord infections in Europe and the United
States in children adopted from Ethiopia, 2003–2007. The Pediatr Infect Dis J
2009; 28(9): 814-818.
Hirose K, Itoh K-I, Nakajima H, Kurazono T, Yamaguchi M, Moriya K, Ezaki T,
Kawamura Y, Tamura K, Watanabe H. Selective amplification of tyv (rfbE),
prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of
Salmonella enterica serovars Typhi and Paratyphi A. J Clin Microbiol 2002;
40(2): 633-636.
Hong Y, Liu T, Lee M, Hofacre C, Maier M, White D. Rapid screening of
Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium
using a serologically-correlative allelotyping PCR targeting the O and H
antigen alleles. BMC Microbiol 2008; 8:178.
International Organization for Standardization. ISO 6579:2002 Microbiology of
food and animal feeding stuffs-- horizontal method for the detection of
Salmonella spp. International Organization for Standardization, Geneva,
Switzerland 2002.
Issenhuth-Jeanjean S, Roggentin P, Mikoleit M, Guibourdenche M, de Pinna E,
Nair, S, Fields P, Weill F-X. Supplement 2008-2010 (no. 48) to the WhiteKauffmann-Le Minor scheme. Res Microbiol 2014; 165: 526-530.
Kawasaki S, Fratamico P, Horikoshi N, Okada Y, Takeshita K, Sameshima T,
Kawamoto S. Evaluation of a multiplex PCR system for simultaneous
detection of Salmonella spp., Listeria monocytogenes, and Escherichia coli
O157:H7 in foods and in food subjected to freezing. Foodborne Pathog Dis
2009; 6(1): 81-89.
Lee H, Su L, Tsai M, Kim S, Chang H, Jung S, Park K, Perera J, Carlos C, Tan B,
Kumarasinghe G, So T, Chongthaleong A, Hsueh P, Liu J, Song J, Chiu C.
High rate of reduced susceptibility to ciprofloxacin and ceftriaxone among
nontyphoid Salmonella clinical isolates in Asia. Antimicrob Agents
Chemother 2009; 53(6): 2696-2699.
Matsui T, Suzuki S, Takahashi H, Ohyama T, Kobayashi J, Izumiya H, Watanabe
H, Kasuga F, Kijima H, Shibata K, Okabe N. Salmonella Enteritidis outbreak
associated with a school-lunch dessert: cross-contamination and a long
incubation period, Japan, 2001. Epidemiol Infect 2004; 132(5): 873–879.
Morpeth S, Ramadhani H, Crump J. Invasive non-Typhi Salmonella disease in
Africa. Clin Infect Dis 2009; 49(4): 606-611.
Ng K, Rivera, W. Multiplex PCR-based serogrouping and serotyping of
Salmonella enterica from tonsil and jejunum with jejunal lymph nodes of
slaughtered swine in Metro Manila, Philippines. J Food Prot 2015; 78 (5):
873-880.
O’Regan E, McCabe E, BurgessC, McGuinness S, Barry T, Duffy G, Whyte P,
Fanning S. Development of a real-time multiplex PCR assay for the detection
of multiple Salmonella serotypes in chicken samples. BMC Microbiol 2008;
8:156.
Pritchett L, Konkel M, Gay J, Besser T. Identification of DT104 and U302 phage
types among Salmonella enterica serotype Typhimurium isolates by PCR. J
Clin Microbiol 2000; 38(9): 3484–3488.
Rajagopal R, Mini M. Outbreaks of salmonellosis in three different poultry farms
of Kerala, India. Asian Pac J Trop Biomed 2013; 3(6): 496-500.
Schlundt J, Toyofuku H, Jansen J, Herbst S. Emerging food-borne zoonoses. Revue
Scientifique et Technique-Office International des Epizooties 2004; 23(2):
513-534.
Shanmugasamy M, Velayutham T, Rajeswar J. invA gene specific PCR for
detection of Salmonella from broilers. Vet World 2011; 4(12):562-564.
Stock K, Stolle A. Incidence of Salmonella in minced meat produced in a European
Union-approved cutting plant. J Food Protect 2001; 64(9):1435-1438.
Tirado C, Schmidt K. WHO surveillance programme for control of foodborne
infections and intoxications: preliminary results and trends across greater
Europe. J Infect 2001; 43(1): 80-84.
Vindigni S, Srijan A, Wongstitwilairoong B, Marcus R, Meek J, Riley P, Mason C.
Prevalence of foodborne microorganisms in retail foods in Thailand.
Foodborne Pathog Dis 2007;4(2): 208-215.
Voetsch A, Van Gilder T, Angulo F, Farley M, Shallow S, Marcus R, Cieslak P,
Deneen V, Tauxe R. FoodNet estimate of the burden of illness caused by
nontyphoidal Salmonella infections in the United States. Clin Infect Dis 2004;
38(Suppl 3): 127-134.
Wegener H, Baggesen D. Investigation of an outbreak of human salmonellosis
caused by Salmonella enterica ssp. enterica serovar Infantis by pulsed field
gel electrophoresis. Int J Food Microbiol 1996; 32(1):125-131.
World Health Organization. Global Salmonella Survey, 2004.www.who.int. ____________________________________________________________________________________________________________
www.philscitech.org
56
ARTICLE
Copper-resistant, biofilm-forming bacteria
for potential use in rehabilitation of
copper-contaminated wastewater
Opulencia, R. B.*1, Bambase, M. E. Jr.2, Perdigon, K. M. D.1, Demafelis,
R. B.2, Llamado, A. A.1, Franco, R. A. G.1, Mogul, R. T.1, and Raymundo,
A. K.1
1Microbiology
Division, Institute of Biological Sciences, College of Arts and Sciences,
University of the Philippines Los Baños, College, Laguna
2Department of Chemical Engineering, College of Engineering and Agro-Industrial
Technology, University of the Philippines Los Baños, College, Laguna
Abstract—Ninety bacterial isolates from copper-contaminated wastewater from a local semiconductor
company were screened for resistance to varying concentrations of copper. Of the copper-resistant isolates,
49 produced biofilm at varying thickness on microtiter plate using Tryptic Soy Broth as substrate. Isolate T21
could tolerate up to 125 ppm copper and was provisionally identified as Bacillus megaterium based on
comparative analysis of 16S rRNA sequences. Isolate T21 was immobilized as biofilm on a 30-liter fixed-bed
upflow reactor using polyvinyl chloride corrugated pipe and Tryptic Soy Broth combined with alcohol distillery
slop (75:25 v/v) as carrier and growth medium, respectively. When used to treat copper-containing
wastewater effluent from a local semiconductor company, the immobilized biofilm reduced copper to as much
as 65.95%, showing potential to clean up copper-contaminated wastewater.
Keywords—biofilm, bioremediation, copper, metal resistance, Bacillus megaterium
INTRODUCTION
Copper is an important engineering metal that functions as a conductor of heat
and electricity, a building material, and a constituent of various metal alloys in
several industries that include electric motors, electronics, and architecture.
However, copper, at high levels, is toxic posing some serious threats to man, plants
and animals. The excessive amounts of copper in fresh water resources and aquatic
ecosystem damage the osmo-regulatory mechanism of fresh water animals (Lee et
al., 2010) and cause mutagenesis in humans (Shawabkeh et al., 2004). It has
known deleterious effects on soil biota and on many plant species (Lamb et al.,
2012). The levels of copper in various segments of the environment, including air,
water, soil and biosphere, have increased due to emissions from various industries
such as mining, smelting, electroplating and electrolysis, and natural sources
(Wang and Che, 2009; Dwivedi and Vankar, 2014). Copper contamination of water
is contributed by copper discharged into effluents of various municipal and
industrial wastes such as solid wastes from mines, mine water, water treatment
plant discharge, bled electrolyte from electro-refining plant, etc. (Bhatia, 2002).
Various techniques have been employed to treat wastewaters with toxic
metals, including adsorption, chemical precipitation, ion-exchange, membrane
filtration, coagulation–flocculation, flotation, electrocoagulation, and adsorption
(Bilal et al., 2013). However, these conventional methods have become either
expensive, inefficient or require the use of aggressive conditions if wastewater or
water are to be treated to low concentrations such as the permissible fraction of
mg/l or µg/l (Schiewer and Volesky, 2000; Chojnacka, 2010).
Bioadsorption is one of the available efficient processes for heavy metal
removal at low concentrations. It is a simple physicochemical process resembling
conventional adsorption or ion exchange but the sorbent is of biological origin bacterial, fungal, plant or animal -, which can bind the soluble chemicals to its
Published: October 5, 2015
cellular surfaces through surface complexation and precipitation, physical
adsorption or ion exchange (Chojnacka, 2010). Inexpensive material, speed and
regeneration of bioadsorbents are advantages of this method (Demirbas,
2008). Recent development in the field of environmental microbiology have
focused on the use of microbial-based potential biosorbents such as yeast, bacteria
and fungi (Pradhan and Rai, 2001; Liu et al., 2004; Tunali et al., 2006).
Biosorption can be carried out either by immobilized biomass or in suspension but
the former improves mechanical strength, rigidity, porosity and the overall metal
ions removal capacity, as well as life time of the biosorbent (Rangsayatorn et al.,
2004).
In nature, microorganisms are commonly found in close association with
surfaces and interfaces as multicellular aggregates called biofilms (Lazar and
Chifiriuc, 2010). Biofilms can be formed by single bacterial species or a
consortium of many species of bacteria, fungi, and protozoa in environments where
there is sufficient nutrient flow and surface attachment. These attached cells are
frequently embedded within a self-produced matrix of extracellular polymeric
substance (EPS), which is a polymeric conglomeration generally composed of
extracellular DNA, proteins, and polysaccharides (Lear and Lewis, 2012).
The main objective of this study was to isolate a copper-resistant, biofilmforming bacterium that could be immobilized as biofilm in a bioreactor to clean up
copper-contaminated wastewater.
Isolation and Purification of Copper-Resistant Microorganisms
One hundred ml of each of “raw” and “treated” wastewater samples collected
from a local semiconductor company were centrifuged at 5000 rpm for 5 min. The
“raw” wastewater was the water used to wash the electronic board after the etching
process to remove residual copper. The “treated” wastewater was the raw
wastewater that had gone through ion exchange to reduce copper. Each of the
resulting pellet was dissolved in 1 ml of the respective wastewater sample. One ____________________________________________________________________________________________________________
www.philscitech.org
tenth ml of each suspension was spread plated onto duplicate plates of Nutrient
Agar (NA), NA + 1 ppm Cu, NA + 10 ppm Cu, and NA + 20 ppm Cu. The plates
were incubated at 37°C until growth was observed, typically 3 days. Well-isolated
colonies were streaked for isolation on NA + 20 ppm Cu. Isolated colonies from
these plates were re-streaked for isolation on NA + 20 ppm Cu until a pure colony
was obtained as determined by microscopic observation of Gram-stained samples.
Screening for Copper Resistance
Purified isolates were grown on Tryptic Soy Agar (TSA) + 20 ppm Cu, and
TSA + 90 ppm Cu. Isolates that grew on 20 ppm Cu were inoculated onto separate
TSA plates with 50, 70, or 100 ppm Cu. Isolates that grew on 90 ppm Cu were
inoculated onto separate TSA with Cu up to 500 ppm.
Screening for Biofilm Formation using Tryptic Soy Broth
All isolates that grew at copper concentrations between 50 to 500 ppm were
screened for biofilm formation as previously described (O’Toole and Kolter, 1998).
Each isolate was inoculated in 5 ml Tryptic Soy Broth (TSB) and incubated for 24
h. One-tenth ml of 0.5 OD600nm of the isolates was inoculated to 9.9 ml TSB. One
hundred µL was inoculated onto each of 3 wells of sterile microtiter plates, which
were then incubated at 37°C for 5 days. Fresh medium was added when necessary
to prevent drying of isolates. Planktonic bacteria were removed by briskly shaking
the microtiter plates in an autoclavable bag. The microtiter plates were washed
with sterile distilled water and then vigorously shaken to remove the liquid. The
wells were then stained for 10 min at ambient temperature with 125 µL of 0.1% v/
v crystal violet solution (in distilled water). Excess crystal violet solution was
removed, then the plates were washed with sterile distilled water until the liquid
was devoid of crystal violet pigment. The plate was inverted, tapped vigorously on
paper towels, and air-dried. The ability to form biofilm was scored visually by
comparing the thickness of the biofilm formed by the positive control,
Pseudomonas aeruginosa, one of the model organisms for biofilm studies
(Spoering and Lewis, 2001). When the biofilm was as thick as that produced by P.
aeruginosa, the test organism was judged a strong biofilm former under tested
conditions. P. aeruginosa was obtained from a colleague, Prof. Noel G. Sabino,
who isolated and identified said isolate. The negative control included the culture
medium only.
Isolation of Copper-resistant, Biofilm-forming Microorganisms
Isolation of Genomic DNA
57
most suitable model for phylogenetic tree analysis (Posada and Crandall, 2001).
Thus, maximum likelihood was used to infer phylogenetic tree using Kimura 2parameter with gamma distribution as the suitable substitution model. The
robustness of the resulting tree was evaluated by bootstrap analyses based on 1,000
reiterations.
Screening for Cheaper Growth Medium and Substrate for Biofilm
Formation
Isolate T21 and Pseudomonas aeruginosa, the control organism, were each
inoculated in 5 ml TSB and incubated at ambient temperature for 24 h. One-tenth
ml of 0.5 OD600nm of each of the isolate was inoculated into 9.9 ml of each of the
following media combinations: TSB, 75% TSB + 25% slops, 50% TSB + 50%
slops, 25% TSB + 75% slops, and slops only. The slops were obtained from an
ethanol production plant in Batangas, and were the residual fraction of the
fermentation mixture after distilling off the ethanol using sugarcane as the raw
material.
All media combinations were prepared in 0 ppm and 10 ppm copper
concentrations. After 24 h incubation, 1 ml was taken from each of the media and
was transferred to 9 ml of 0.85% NaCl. Successive ten-fold dilution series was
prepared up to 10-5 dilution. One-tenth ml of each of the dilution was plated on
duplicate TSA plates. CFU ml-1 was calculated after 24 h of incubation. Biofilm
formation of each of isolate T21 and Pseudomonas aeruginosa was also
determined on these different media combinations as described above.
Construction of a 30-L Bioreactor
A 30-L upflow fixed-bed column reactor with recirculation from a separate
culture vessel was constructed (Figure 1). The reactor was designed and fabricated
at the University of the Philippines Los Baños. The main body of the reactor was
made of plexiglass. The dish bottom and top cover of the column, ball valves, and
other connection fittings were made of stainless steel. Perforated support and
restrainer plates were installed inside the column to contain the biofilm carriers
during operation. Ball valves were placed at the top and bottom of the column to
regulate the flow. A 1.0-HP regular water pump was used for recirculation from the
culture vessel to the column reactor. Prior to use, the biofilm reactor, culture vessel,
and all accessory components were disinfected with 5.25% (v/v) hypochlorite
solution. Aeration was provided in the culture vessel by bubbling air at the bottom
using an air pump.
The total genomic DNA of the isolates were extracted using the ZR Fungal/
Bacterial DNA Kit™ (Zymo Research, California, USA) by following the
manufacturer’s instructions. Eluted DNA was analyzed by agarose gel
electrophoresis. Five μl of the eluted DNA and 2 μl 2X loading dye (New England
Biolabs Inc., Massachusetts, USA) were loaded into the wells of a 1% (w/v)
agarose gel prepared in 0.5X TAE buffer (20 mM Tris-acetate, pH 8.0, 0.5 mM
EDTA). A 100 bp DNA molecular weight marker (New England Biolabs Inc.,
Massachusetts, USA) was also loaded into the gel. Electrophoresis was performed
in 0.5x TAE buffer at 100 volts using Mupid® submarine electrophoresis system
(Advance Corporation, Tokyo, Japan) for 20-30 min until the tracking dye had run
about two-thirds of the gel length. DNA was visualized under UV transillumination using Gel Doc™ XR+ System (Bio- Rad Laboratories Inc., California,
USA) after staining with ethidium bromide (5 μg ml-1).
PCR Amplification of 16S rRNA
Amplification of the 16S rRNA was performed in a 50 μl reaction volume that
contained 1X Taq Master Mix (Vivantis Technologies, USA), 1.5 mM MgCl2, 0.3
μM of each primer [8F: (5’AGAGTTTGATCCTGGCTCAG; Liu et al., 1997) and
1525R (5’AAGGAGGTGATCCAGCC; Embley, 1991)] and 3 μl of template
DNA. The thermal cycling program used was as follows: 3 min initial
denaturation at 95°C, followed by 35 cycles of 40 sec denaturation at 94°C, 50 sec
primer annealing at 52°C, 1 min extension at 72°C, and a final 10 min extension at
72°C. A negative control using sterile distilled water instead of template DNA was
included in the amplification process. The PCR product was examined by
electrophoresis as previously described.
Sequencing
The PCR products were sent to Macrogen, Inc., (Seoul, South Korea) for
purification and normal automatic sequencing. Both strands of the DNA molecule
were sequenced using the universal primers 8f and 1525r (Lane, 1991).
Sequence Analysis
Bioinformatics tools were used to analyze resulting sequences from
Macrogen, Inc. Forward and reverse sequences were aligned using ClustalW2
(Larkin et al., 2007) to obtain overlapping sequences into consensus sequence.
During the process of alignment, individual bases were verified by comparison
with the fluorescent signal for each sequence in chromatogram. Subsequently,
overhang sequences and ambiguous nucleotides were excluded using ChromasPro
(ChromasPro ver. 1.3; www.technelysium.com .au. chromas.html). The consensus
sequence was used as query sequence to search for similar sequences in GenBank
using Basic Local Alignment Tool (BLAST) program (Altschul et al., 1990).
To reveal the general taxonomic placement of the unknown isolate, the most
similar reference sequences were selected for the subsequent phylogenetic
analysis. The reference sequences with 97-100% similarity were considered for the
multiple sequence alignment in ClustalW found in MEGA 6 software. Test for the
best-fit substitution model was performed in MEGA 6 software to select for the
Figure 1. Schematic diagram of the biofilm reactor with culture vessel.
Immobilization of the Biofilm on the Bioreactor
Progressive inoculation of the organism was performed to achieve 27 L of
suspended culture of isolate T21 starting with a pure culture of the organism in
tube slants. Isolate T21 was cultivated in TSB media solution except in the final
inoculation stage when 25% by volume of slops was added to the media. The final
population of T21 was 4.75 x 108 CFU ml-1. Incubation period for every stage of
inoculation was fixed at 24 h. Corrugated PVC pipes with a nominal diameter of
1/2” were used as biofilm carrier. The PVC pipes were cut into 5-10 mm in length
to minimize the void volume when packed inside the reactor, and roughened to
create a grated surface to improve the attachment of the biofilm.
At the start of recirculation, about 31.5 L of mixed medium (75:25 v/v
TSB:slops) were added into the system to fill with isolate T21 cells. The contents
of the culture vessel were drained at the bottom and pumped into the bioreactor in
an upflow direction to completely submerge the carrier. The overflow from the
bioreactor would go back into the culture vessel. Recirculation rate was fixed at
0.172 L/min. Medium was replenished every 2 days by withdrawing 20 L of spent
media and replacing with the same volume of medium. The biofilm was allowed to
develop for 10 days.
Scanning Electron Microscopy
The resulting biofilm on PVC support was sent for analysis using scanning
electron microscopy at the National Institute of Molecular Biology and
Biotechnology at University of the Philippines Los Baños. Briefly, PVC pipes were
cut open and first fixed in solution of 2.5% glutaraldehyde in 0.1 M Sorensen's
phosphate buffer pH 6.8 then with 1% osmium tetroxide solution, dehydrated in
ethanol from 50% to 100% alcohol and incubated in alcohol-isoamyl acetate
mixtures with volume proportion of 50%-50% and 0-100%. Samples were dried ____________________________________________________________________________________________________________
www.philscitech.org
58
with carbon dioxide to a critical point, mounted on aluminum stubs, sputter coated
with gold-palladium (JEOL JFC-1100, Japan), and observed on scanning electron
microscope (Inspect S50, Netherland) operated at an accelerating voltage of 5kV.
Assessment of the Efficiency of the Biofilm Bioreactor in Removing
Copper from Wastewater Discharge
After 10 days, copper was introduced into the system by including copper
sulfate (CuSO4) in the medium used for replenishment. In another run, wastewater
effluent from a local semiconductor company was added. The copper concentration
of the semiconductor wastewater was diluted from 35,000 ppm to about 4 ppm.
Upon addition of copper or wastewater effluent, no further medium replenishment
was done to avoid lowering copper concentration.
The first sample was withdrawn from the biofilm reactor after 3 times the
hydraulic retention time (HRT) elapsed. For the given flow rate, the estimated
HRT for the bioreactor was 3.68 h. Samples were withdrawn daily for 6 days for
residual copper analysis using atomic absorption spectroscopy (AAS) at Soils
Science Division, College of Agriculture, UPLB.
RESULTS
Figure 3. Phylogenetic tree of the 16S rRNA genes of isolate T21 and
reference strains.
A
B
Figure 2. Biofilm formation on microtiter plate. A: top view; B: side view.
Ninety isolates from ‘treated’ wastewater sample were randomly selected and
screened for resistance to varying concentrations of copper (50 to 500 ppm Cu).
The highest concentration of copper that any of the isolates could tolerate was 250
ppm. Forty-nine of the isolates were capable of producing biofilm at varying
thickness on microtiter plate using TSB as substrate (for representative plate, refer
to Figure 2). The purple stain along the walls of the plate indicates the extent of
biofilm formed by the organism. The intensity of the color of the dye is
proportional to the thickness of the biofilm.
Several of the isolates, selected based on high tolerance to copper and strong
formation of biofilm, have been provisionally identified as Pseudomonas
aeruginosa, Bacillus megaterium, Ochrobactrum sp., Brucella sp.,
Pseudochrobactrum sp. and Bacillus sp. based on comparative analysis of 16S
rRNA sequences. Pseudomonas aeruginosa, a well-documented biofilm former, is
an opportunistic pathogen, which can infect the pulmonary tract, urinary tract,
burns, wounds, and can also cause other blood infections (Iglewski, 1996).
Ochrobactrum spp. are increasingly recognized as emerging pathogens. Most
Ochrobactrum infections occur in immunocompromised patients (Apisarnthanarak
et al., 2005) or associated with contaminated allografts (Chang et al., 1996) but
Ochrobactrum can also cause infections in healthy humans (Galanakis et al.,
2002). The close relatives of the genus Pseudochrobactrum are Brucella and
Ochrobactrum (Kämpfer et al., 2006). The genus Brucella is a serious intracellular
pathogen that causes brucellosis in animals and humans. Infections
with Brucella spp. are highly infective and chronic, and difficult to produce
vaccine (Taguchi et al., 2015). The isolate closely matched to Bacillus species
grew very slowly. There is no known report on the potential pathogenicity of B.
megaterium. Isolate T21, which is resistant to 125 ppm copper and identified as B.
megaterium (Figure 3), was thus used in succeeding activities. The taxonomic
placement was determined using 1164 bp of the 1466 bp expected 16S rRNA PCR
product.
To further reduce the cost of the proposed process of utilizing isolate T21 in
treatment of copper contamination, the commercially available growth medium
TSB was tested in various combinations with distillery slops, an alcohol distillery
waste, as growth substrate for biofilm production. Table 1 shows that the
combination of 75% TSB and 25% slops can support growth of T21 closely similar
to pure TSB. After 5 days of incubation, biofilm formation was also evident in the
microtiter plate (Figure 4). The intensity of the color of the dye is proportional to
the thickness of the biofilm as interpreted in Table 1, using Pseudomonas
aeruginosa as positive control. Hence, the combination of 75% TSB and 25%
slops was further used in our succeeding experiments with isolate T21.
Figure 4. Biofilm formation of isolate T21 and Pseudomonas aeruginosa on
different media combinations. In rows A to C, cells in lanes 1-6 and lanes
7-12 were grown in TSB and 75%TSB + 25% slops, respectively. In rows D
to F, cells in lanes 1-6 and lanes 7-12 were grown in 50% TSB + 50% slops
and 25% TSB + 75% slops, respectively. The medium used for all lanes in
rows G and H was purely slops. The media in lanes 1-3 and 7-9 did not
contain copper but lanes 4-6 and 10-12 contained copper at 10 ppm. Rows
A and D were inoculated with T21, B and E with Pseudomonas aeruginosa,
while rows C, F and H contained no microbial cells. In row G, lanes 1-6
were inoculated with T21 while lanes 7-12 were inoculated with P.
aeruginosa.
Table 1. Standard plate count (CFU ml-1) and biofilm formationa of bacterial
isolates using different substrates supplemented with varying concentrations of
copper and incubated at 37ºC for 5 days.
Pseudomonas aeruginosa
Isolate T21
Copper (ppm)
Substrate
0
10
0
10
CFU ml-1
Biofilm
CFU ml-1
Biofilm
CFU ml-1
Biofilm
CFU ml-1
Biofilm
Tryptic Soy Broth
(TSB)
6.1x108
+++
9.0x107
+++
1.3x107
++
1.0x107
+
75% TSB + 25%
alcohol distillery
slops
1.5x108
++,+++,+++
9.9x107
+++
5.9x106
++,++,+++
3.3x106
+++
50% TSB + 50%
alcohol distillery
slops
<100
-,-,+
<100
+,+,-
<100
+,+,++
<100
+
25% TSB + 75%
alcohol distillery
slops
<100
+,+,-
<100
-,-,+
-,-,+
<100
+
<100
-,-,+
alcohol distillery
slops
<100
+,-,-
<100
+,-,-
<100
+,-,-
<100
+,-,-
a
Results were observed from triplicate. If the result was reproducible, a single entry of the result was presented. Otherwise, result
from each of the triplicate was presented in the table.
+++ = strong former
++ = moderate former
+ = weak former
- = no biofilm formation ____________________________________________________________________________________________________________
www.philscitech.org
A
59
B
Figure 5. Scanning electron micrographs of biofilms on PVC of isolate T21 in the bioreactor using tryptic soy broth:distillery slops in a 75:25 ratio. A.
Biofilms attached on a PVC with width ranging from 0.07 mm to 0.37 mm under 100x magnification. B. Detailed structure of the biofilm showing the
matrix.
SEM showed biofilm attached on PVC pipes with width from 0.07 mm to
0.37 mm (Figure 5). Assessment of efficiency of the system showed reduction in
copper concentration for all the bench-scale runs using aqueous copper solution
and diluted actual semiconductor wastewater to as much as 65.95% of the copper
in wastewater (Table 2).
Table 2. Residual copper content of samples after treatment in the bioreactor with
biofilm of isolate T21.
Residual Copper Content (ppm)a
Day
Cu Solution
Diluted Wastewater
0
78.30 ± 1.32
4.20 ± 0.01
1
73.29 ± 4.84
2.31 ± 0.00
2
68.18 ± 6.77
1.73 ± 0.00
3
64.67 ± 0.19
1.65 ± 0.00
4
38.18 ± 19.49
1.46 ± 0.00
38.58 ± 8.69
1.49 ± 0.00
5
aAverage
values and standard deviations represent repeated measurements.
DISCUSSION
Heavy metal-resistant bacteria are preferred for bioremediation as they remain
viable when challenged by heavy metal-contaminated wastes. Previous studies
have shown that compared to dead cells, living cells are more effective in
removing heavy metals as demonstrated by Escherichia coli and Bacillus sp. in
removing cadmium and copper, respectively (Chelliah et al., 2008; Rani et al.,
2010), and by living cells of Pseudomonas putida CZ, which showed significantly
higher binding capacity to copper and zinc than its nonliving cells (Xin et al.,
2005). Cell viability, hence, resistance to heavy metal, is required if the mechanism
of biosorption depends not only on the physico-chemical interaction between the
metal and the functional groups on the cell surface but also on the physiological
activities of the cell. At certain concentrations, some heavy metals may be taken up
inside the cell and used as cofactor of enzymes (Vest et al., 2013). The mechanism
of biosorption by isolate T21 was not determined in this study. However, several
reports indicate that B. subtilis sequesters heavy metal both extracellularly and
intracellularly (Bai et al., 2014; Pan et al., 2007) while a strain of B. megaterium
absorbs arsenic at its cell wall (Miyatake and Hayashi, 2009). Resistance to heavy
metal is particularly necessary if the working microorganism is employed in a
continuous bioreactor as used in this study.
The microorganism selected is not only copper-resistant but also biofilmforming for possible treatment of copper contamination. Several groups in biomass
such as structural polysaccharides, amino and phosphate groups of nucleic acids,
amide, amine, sulfhydryl and carboxyl groups in the proteins (Ahluwalia and
Goyal, 2007) could attract and sequester different heavy metals (Pradhan et al.,
2007). The EPS in biofilm can greatly contribute to metal ions adsorption because
of polysaccharides and proteins it mainly contains that often carry carboxyl and
phosphate groups (Pal and Paul, 2008). The presence of EPS corresponds to an
increase in the number and type of functional groups on the surface of
Hymenobacter aerophilus that is reflected by the increased metal adsorption
relative to that for EPS-free cells (Baker et al., 2010). Investigations on the proton
and metal binding behavior of isolated EPS found that EPS exhibited great ability
to complex heavy metals, the mechanisms of which may include proton exchange,
global electric field or micro-precipitation of metals (Guibaud et al., 2009; Fang et
al., 2010).
Hohapatra et al. (1993) reported that resting cells of a strain of B.
megaterium can remove up to 39.1 mg of Cu per g of cell dry weight. Other
bacteria, pure or in consortia, have shown better Cu removal than that reported
here when conditions such as pH, contact time, and Cu concentration have been
optimized or when employed in conjunction with another biosorption material. For
instance, the copper-resistant bacterium Stenotrophomonas maltophilia PD2 can
reduce 90% Cu under optimized conditions (Ghosh and Das Saha, 2013). The
anaerobic, sulfate reducing bacteria (SRB) + iron (Fe0) system exhibited removal
ratio of Cu2+ at above 95% at all influent Cu2+ concentrations (Bai et al., 2013).
Almost total removal of Cu was achieved with B. megaterium in combination with
activated carbon up to a Cu concentration of 100 mg per liter (Hohapatra et al.,
1993). Several parameters such as pH, contact time and temperature in the system
described in this study may still be optimized for maximum absorption of Cu by
isolate T21.
Polyvinyl chloride (PVC) is one of the most manufactured plastics and has
been used extensively in water pipe systems due to its low cost, durability and
inability to corrode. In this study, PVC was used as biofilm carrier as it has been
proven to efficiently support biofilm formation (Zhao et al., 2011) comparable to
other materials such as polyethylene (Rożej et al., 2015) and stainless steel
(Zacheus et al., 2000). The PVC employed in this study was corrugated since
grated surfaces increase surface roughness, which facilitates cell attachment
(Qureshi et. al., 2001, Zhao et. al., 2011), hence, enhance biofilm formation.
Thus, this study designed an inexpensive and effective system with a potential
to treat copper-contaminated wastewater by utilizing an easily cultivable bacterium
that can form biofilm on a cheap carrier, PVC, and growth substrate composed of
distillery waste product. The process may be incorporated as a part of hybrid or
integrated installations for wastewater treatment.
ACKNOWLEDGEMENT
The study described on this paper was funded entirely by the Philippine
Council for Industry, Energy and Emerging Technology Research and
Development of the Department of Science and Technology.
The authors declare no conflicts of interest.
RB Opulencia is the project leader and main author of the paper but all
authors contributed to the writing of the paper. AK Raymundo conceptualized the ____________________________________________________________________________________________________________
www.philscitech.org
framework of the project. RB Opulencia, AA Llamado and AK Raymundo
supervised the microbiology portion of the study. ME Bambase Jr. and RB
Demafelis supervised the engineering aspect of the study. KMD Perdigon, RAG
Franco and RT Mogul served as research assistants and performed portions of the
project.
REFERENCES
Ahluwalia, S.S., Goyal, D., (2006). Microbial and plant derived biomass for
removal of heavy metals from wastewater. Bioresource Technology, 98,
2243-2257
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J. (1990). Basic local
alignment search tool. Journal of Molecular Biology, 215, 403– 410
Apisarnthanarak, A., Kiratisin, P., Mundy, L.M. (2005). Evaluation
of Ochrobactrum intermedium bacteremia in a patient with bladder cancer.
Diagnostic Microbiology and Infectious Disease, 53,153–155
Bai, H., Kang, Y., Quan, H., Han, Y., Sun, J., Feng, Y. (2013). Bioremediation of
copper-containing wastewater by sulfate reducing bacteria coupled with iron.
Journal of Environmental Management, 129, 350-356
Bai, J., Yang, X., Du, R., Chen, Y., Wang, S., Qui, R. (2014). Biosorption
mechanisms involved in immobilization of soil Pb by Bacillus subtilis DBM
in a multi-metal-contaminated soil. Journal of Environmental Sciences, 26,
2056-64
Baker, M.G., Lalonde, S.V., Konhauser, K.O., Foght, J.M. (2010). Role of
extracellular polymeric substances in the surface chemical reactivity of
Hymenobacter aerophilus, a psychrotolerant bacterium. Applied and
Environmental Microbiology, 76, 102-109
Bhatia, S. C. (2002). Handbook of Industrial Pollution Control in Chemical
Processes and Allied Industries (Vol II). Publishers and Distributor, New
Delhi
Bilal, M., Shah, J. A., Ashfaq, T., Gardazi, S. M. H., Tahir, A. A., Pervez, A.,
Haroon, H., Mahmood, Q. (2013). Waste biomass adsorbents for copper
removal from industrial wastewater- a review. Journal of Hazardous
Materials, 263, 322-333
Chang, H.J., Christenson, J.C., Pavia, A.T., Bobrin, B.D., Bland, L.A., Carson,
L.A., Arduino, M.J., Verma, P., Aguero, S.M., Carroll, K., Jenkins, E., Daly,
J.A. , Woods, M.L., Jarvis, W.R. (1996). Ochrobactrum anthropi meningitis in
pediatric pericardial allograft transplant recipients. The Journal of Infectious
Diseases, 173, 656–660
Chelliah, E.R., Sundaresan, S., Govindan, S.S., (2008). Adaptive and cross
resistance to cadmium (II) and zinc (II) by Pseudomonas aeruginosa BC15.
Biologica, 63, 461-465
Chojnacka, K. (2010). Biosorption and bioaccumulation--the prospects for
practical applications. Environmental International, 36, 299-307
Demirbas, A. (2008). Heavy metal adsorption onto agro-based waste materials: a
review. Journal of Hazardous Materials, 157, 220-229
Dwivedi, A.K., Vankar, P.S. (2014). Source identification study of heavy metal
contamination in the industrial hub of Unnao, India. Environmental
Monitoring and Assessment, 186, 3531-3539.
Embley, T. M. (1991). The linear PCR reaction: a simple and robust method for
sequencing amplified rRNA genes. Letters in Applied Microbiology, 13, 171–
174
Fang, L.C., Huang, Q.Y., Wei, X., Liang, W., Rong, X.M., Chen, W.L., Cai, P.
(2010). Microcalorimetric and potentiometric titration studies on the
adsorption of copper by extracellular polymeric substances (EPS), minerals
and their composites. Bioresource Technology, 101, 5774–5779
Galanakis, E., Bitsori, M., Samonis, G., Christidou, A., Georgiladakis, A.,
Sbyrakis, S., Tselentis, Y. (2002). Ochrobactrum anthropi bacteraemia in
immunocompetent children. Scandinavian Journal of Infectious Disease, 34,
800–80
Ghosh, A., Das Saha, P. (2013). Optimization of copper bioremediation by
Stenotrophomonas maltophilia PD2. Journal of Environmental Chemical
Engineering, 1, 159-163
Guibaud, G., Hullebusch, E.V., Bordas, F., D’Abzac, P., Joussein, E. (2009).
Sorption of Cd(II) and Pb(II) by exopolymeric substances (EPS) extracted
from activated sludges and pure bacterial strains: modeling of the metal/
ligand ratio effect and role of the mineral fraction. Bioresource Technology,
100, 2959–2968
Hohapatra, S. P., Siebel, M. A., Alaerts, G. J. (1993). Effects of Bacillus
megaterium on removal of copper from aqueous solutions by activated
carbon. Environmental Science and Engineering and Toxicology, 28, 615-629
Iglewski, B.H. (1996). Pseudomonas. In: Baron's Medical Microbiology, eds.
Baron, S. et al. 4th ed. University of Texas Medical Branch.
Kämpfer, P., Rosselló-Mora, R., Scholz, H., Welinder-Olsen, C., Busse, H.J. (2006). Description of Pseudochrobactrum gen. nov., with the two
species Pseudochrobactrum saccharolyticum sp. nov. and Pseudochrobactrum
saccharolyticum sp. nov. International Journal of Systematic and
Evolutionary Microbiology, 56, 1823–1829
Lamb, D.T., Naidu, R., Ming, H., Megharaj, M. (2012). Copper phytotoxicity in
native and agronomical plant species. Ecotoxicology and Environmental
Safety, 85, 23–29
Lane, D. J. (1991). 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in
Bacterial Systematics, eds. Stackebrandt, E., Goodfellow, M. Wiley, New
60
York.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A.,
McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson,
J.D., Gibson, T.J., Higgins, D.G. (2007). Clustal W and Clustal X version 2.0.
Bioinformatics, 23, 2947-2948
Lazar, V., Chifiriuc, M. C. (2010). Architecture and physiology of microbial
biofilms. Roumanian Archives of Microbiology and Immunology, 69, 95-107
Lear, G., Lewis, G. D. (eds). (2012). Microbial Biofilms: Current Research and
Applications. Caister Academic Press
Lee, J.A., Marsden, I.D., Glover, C.N. (2010). The influence of salinity on copper
accumulation and its toxic effects in estuarine animals with differing
osmoregulatory strategies. Aquatic Toxicology, 99, 65–72
Liu, H., Chen, Y., Lan, Y., Cheng, Y. (2004). Biosorption of Zn(II) and Cu(II) by
the indigenous Thiobacillus thiooxidans. Chemical Engineering Journal,
97,195–201
Liu, W. T., Marsh, T. L., Cheng, H. Forney, L. J. (1997). Characterization of
microbial diversity by determining terminal restriction fragment length
polymorphisms of genes encoding 16S rRNA. Applied Environmental
Microbiology, 63, 4516–4522
Miyatake, M., Hayashi, S. (2009). Characteristics of arsenic removal from aqueous
solution by Bacillus megaterium strain UM-123. Journal of Environmental
Biotechnology, 9, 23-129
O’Toole, G.A., Kolter, R. (1998). Initiation of biofilm formation in Pseudomonas
fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a
genetic analysis. Molecular Microbiology, 3, 449-61
Pal, A., Paul, A.K. (2008). Microbial extracellular polymeric substances: central
elements in heavy metal bioremediation. Indian Journal of Microbiology, 48,
49-64
Pan, J., Liu, R., Tang, H. (2007). Surface reaction of Bacillus cereus biomass and
its biosorption for lead and copper ions. Journal of Environmental Sciences,
19, 403–408
Posada, D., Crandall, K. A. (2002). The effect of recombination on the accuracy of
phylogeny reconstruction. Journal of Molecular Evolution, 54, 396-402.
Pradhan, S., Rai, L.C. (2001). Biotechnological potential of Microcystis sp. in Cu,
Zn and Cd biosorption from single and multimetallic systems. Biometals, 14,
67–74
Pradhan, S., Singh, S., Rai, L.C. (2007). Characterization of various functional
groups present in the capsule of Microcystis and study of their role in
biosorption of Fe, Ni and Cr. Bioresource Technology, 98, 595–601
Qureshi, F. M., Badar, U., Ahmed, N. (2001). Biosorption of copper by a bacterial
biofilm on a flexible polyvinyl chloride conduit. Applied Environmental
Microbiology, 67, 4349-4352
Rangsayatorn, N., Pokethitiyook, P., Upatham, E.S., Lanza, G.R. (2004). Cadmium
biosorption by cells of Spirulina platensis TISTR 8217 immobilized in
alginate and silica gel. Environment International, 30, 57-63
Rani, M. J., Hemambika, B., Hemapriya, J., Kannan, V. R. (2010). Comparative
assessment of heavy metal removal by immobilized and dead bacterial cells: a
biosorption approach. African Journal of Environmental Science and
Technology, 4, 77-83
Rożej, A., Agnieszka, C., Beata, K., Kowalski, D. (2015). Structure and diversity
of microbial biofilms on different pipe materials of a model drinking water
distribution systems. World Journal of Microbiology and Biotechnology, 31,
37-47
Shawabkeh, R., Al-Harahsheh, A., Al-Otoom, A. (2004). Copper and zinc sorption
by treated oil shale ash. Separation and Purification Technology, 40, 251–257
Schiewer, S., Volesky, B. (2000). Biosorption Processes for Heavy Metal Removal.
In: Environmental Microbe-Metal Interactions. ASM Press, Washington D.C.
Spoering, A. L., Lewis, K. (2001). Biofilms and planktonic cells of Pseudomonas
aeruginosa have similar resistance to killing by antimicrobials. Journal of
Bacteriology, 183, 6746-6751
Taguchi, Y., Imaoka, K., Kataoka, M., Uda, A., Nakatsu, D., Horii-Okazaki, S.,
Kunishige, R., Kano, F., Murata, M. (2015). Yip1A, a novel host factor for the
activation of the IRE1 pathway of the unfolded protein response
during Brucella infection. PLOS Pathogens. 11(3): e1004747. doi:10.1371/
journal.ppat.1004747
Tunali, S., Cabuk, A., Akar, T. (2006). Removal of lead and copper ions from
aqueous solutions by bacterial strain isolated from soil. Chemical Engineering
Journal, 115, 203–211
Vest, K. E., Hashemi, H. F., Cobine, P. A. (2013). The Copper Metallome in
Prokaryotic Cells. In: Metallomics and the Cell. Metal Ions in Life
Sciences 12, ed. Banci, L. Springer Science + Business Media Dordrecht 2013
Wang, J., Chen, C. (2009). Biosorbents for heavy metals removal and their future.
Biotechnological Advances, 27, 195–226
Xin, C. C., Yuan P. W., Qi L., Ji Y. S., Wei X. W., Ying X. C. (2005) Biosorption of
copper(II) and zinc(II) from aqueous solution by Pseudomonas putida CZ1.
Colloids and Surfaces B: Biointerfaces, 46, 101–107
Zacheus, O. M., Iivanainen, E. K., Nissinen, T. K., Lehtola, M. J., Martikainen, P.
J. 2000. Bacterial biofilm formation on polyvinyl chloride, polyethylene and
stainless steel exposed to ozonated water. Water Research, 34, 63-70
Zhao, G., Ye, L., Huang, Y., Yang, D., Li, L., Xu, G., Lei, Y. (2011). In vitro Model
of Bacterial Biofilm Formation on Polyvinyl Chloride Biomaterial. Cell
Biochemistry and Biophysics, 61, 371-376 ____________________________________________________________________________________________________________
www.philscitech.org
61
REVIEW
Bacteriocins from Lactic Acid Bacteria:
A Review of Biosynthesis, Mode of Action,
Fermentative Production, Uses, and
Prospects
Rodney H. Perez*1, Maria Teresa M. Perez2, and Francisco B. Elegado2
1Department
of Education, Eastern Visayas State University—Ormoc City Campus, Ormoc
City, Leyte 6541, Philippines
2National Institute of Molecular Biology and Biotechnology, BIOTECH, University of the
Philippines Los Baños, College, Laguna 4031, Philippines
Abstract—Bacteriocins are antimicrobial peptides that help bacteria fight competing bacteria in
microecological systems. Bacteriocins of lactic acid bacteria (LAB) have attracted much interest in recent
years because of their properties that make them suitable as natural food preservatives against specific food
pathogens, and as possible supplement to antibiotics against drug resistant bacterial strains. LAB
bacteriocins are generally classified into the lantibiotics and non-lantibiotics, the latter divided into four subgroups. To date, only nisin and to a lesser extent, pediocin are the commercially applied bacteriocins for food
use. Clinical applications are still limited to animal health. One of the more exciting prospects on the use of
bacteriocins is the possibility of subjecting them to bioengineering to either increase antimicrobial activity or
further specify their target microorganism. The latter would make it less damaging to the natural gut
microflora, which is a common drawback of conventional antibiotic therapy.
This paper focuses on the nature, biology, and applications of bacteriocins based on knowledge gained
abroad and in the Philippines during the last two decades.
Keywords—lactic acid bacteria, antimicrobial peptides, bacteriocin, bacteriocin application, bacteriocin
biosynthesis, bacteriocin prospects
INTRODUCTION
In microbial ecosystems, some microorganisms synthesize antimicrobial
compounds, such as bacteriocins, that destroy or inhibit the growth of other
microorganisms (Cleveland et al. 2001). It has been suggested that more than half
to almost all bacterial species synthesize bacteriocins (Riley & Wertz 2002; Cotter
et al. 2005). Bacteriocins comprise a huge family of ribosomally synthesized
peptides that usually show antimicrobial activity to strains that are closely-related
to the producer strain (narrow-spectrum bioactivity) and sometimes to strains
across genera (broad-spectrum bioactivity) (Diep & Nes 2002; Perez et al. 2014).
Bacteriocins from lactic acid bacteria (LAB) have attracted a lot of attention
from many industries due to their various attributes that have potential for
applications. Bacteriocins are a new trend in food packaging, as these substances
can be incorporated into the extruder when the antimicrobial film or co-extruded
film is produced (Deshmukh & Thorat 2013). The “generally regarded as
safe” (GRAS) distinction of LAB and their by-products given by the U.S. Food
and Drug Administration (FDA) highlighted the applicability of bacteriocins as
safe food preservatives (U.S. Federal Register 1988). Although bacteriocins, in a
sense, can be considered as antibiotics, they differ from conventional antibiotics in
numerous aspects (Zacharof & Lovitt 2012; Perez et al. 2014). The subtlest
differences are summarized in Table 1. Bacteriocins are inherently tolerant to
higher thermal stress and are more active at a wider pH range than conventional
antibiotics. These antimicrobial peptides are colorless, odorless, and tasteless,
making them ideal for use as food preservatives. Development of resistant strains
among their target bacteria is unlikely as they have fast-acting antimicrobial
mechanisms that are highly potent even at very low concentrations. Furthermore,
Published: October 30, 2015
their proteinaceous nature minimizes resistance development as they are easily
degraded by proteolytic enzymes, thus lessening the chances of target strains
developing any resistance machinery. Perhaps the most promising advantage of
bacteriocins over conventional antibiotics is their primary metabolite nature that
makes them easily subjected to bioengineering to either increase their bioactivity
or to specify their target microorganisms (Perez et al. 2014).
Despite the tremendous application potential of bacteriocins in various fields,
they have remained underutilized. Currently, nisin and to a lesser extent pediocin
PA-1/AcH are the only bacteriocins that are commercially used in food
applications; and their use in clinical settings has been limited to animal, not
extending to human health (Cotter et al. 2005). On the other hand, the approval of
nisin for application in food by the Joint Food and Agriculture Organization/World
Health Organization Expert Committee on Food Additives, as well as the approval
by the US Food and Drug Agency (FDA) for its use in pasteurized, processed
cheese spreads, should establish a legal precedent for the use of other bacteriocins
as food preservative. In clinical settings, the increasing number of researches done
on the development of bioengineered bacteriocins with enhanced bioactivity
against clinical pathogens should fast-track their widespread use as therapeutic
agents.
In this review, the nature and biology of bacteriocins, their applications and
prospects in various fields are discussed. The status and potential of bacteriocin
research in the Philippines are also highlighted.
LAB Bacteriocin Classification
Over the years, various classification schemes of LAB bacteriocins have been
suggested (Klaenhammer 1993; Diep & Nes 2002; Cotter et al. 2005; Heng et al.
2007). The classification scheme suggested by Cotter & co-workers (2005) is the
most widely accepted, limiting the grouping in just two classes (Table 2); the
lantibiotics (class I) and non-lantibiotics-containing bacteriocins (class II). The
____________________________________________________________________________________________________________
www.philscitech.org
62
Table 1. Main differences between LAB bacteriocins and conventional antibiotics
(Perez et al. 2014).
Factor Considered
Bacteriocins
Antibiotics
Application
Food/Clinical
Clinical
Synthesis
Ribosomal
Secondary metabolite
Bioactivity spectra
Mostly narrow
Mostly broad
Intensity of bioactivity
Active at nano-to-micro molar
range
Active at micro-to-milli
molar range
Proteolytic enzyme
degradability
High
Moderate-to-hardly
Thermal stability
High
Low
Active pH range
Wide
Narrow
Taste/color/odor
No
Yes
Amenability to
bioengineering
Yes
No
Possible mechanism of
target cell developing
resistance
Adaptation through changes in cell
membrane composition
Genetically transferable
determinant that
inactivates the active
compound
Mode of action
Pore formation on cell membrane,
inhibition of cell wall biosynthesis
Cell membrane or
intercellular targets
Toxicity towards
eukaryotic cells
Relatively no
Yes
Table 2. Classification of Bacteriocins (Cotter et al. 2005).
Class
Features
I
Antibiotics, small (<5 kDa) peptides containing
lanthionine and 3-methyllanthionine
II
Small (<10 kDa), heat-stable, non-lanthioninecontaining peptides
III
↑
Representative
Bacteriocins
Nisin A, Nukacin ISK-1
IIa
Small heat-stable peptides, synthesized in a
form of precursor which is processed after two
glycine residues, active against Listeria, have
a consensus sequence of YGNGVXC in the Nterminal
Pediocin PA-1/AcH,
Saracens A and P,
Leucocin A,
Carnobacteriocin
IIb
Two component systems: two different
peptides required to form an active portion
complex
Lactoccins G and F,
Lactation F, Plantaricin EF
and JK, Brochocin C
IIc
N- and C- termini are covalently linked,
resulting in a circular structure
Enterocin As-48,
Lactocyclicin Q
IId
Other class II bacteriocins, including secdependent bacteriocins and leaderless
bacteriocins
Acidocin, Enterocin P,
Enterocin B, Lacticin Q
Large molecules heat sensitive peptides
Helveticins J, Acidophilucin
A, Lactacins A and B
↑suggested that they be called bacteriolysins and no longer considered bacteriocins.
most notable change in this new scheme is the suggested exclusion of class III
bacteriocins and renaming them as bacteriolysins since they are lytic enzymes
rather than peptides. Recently, Heng & co-workers (2007), although agreeing
broadly with this classification scheme, suggested a further modification in which
circular bacteriocins should be grouped into a different class.
Class I bacteriocins or lantibiotics (lanthionine-containing antibiotics) are
small peptides (<5 kDa) that possess unusual post-translationally modified amino
acid residues such as lanthionine or 3-methyllanthionine (McAuliffe et al. 2001).
These unusual amino acid residues form covalent bridges between amino acids that
result in the formation of internal “ring” or cyclic structure that gives the stability
to the whole molecule (Willey & van der Donk 2007; Asaduzzaman & Sonomoto
2009). The first reported and most extensively studied bacteriocin, nisin A, belongs
to this class.
Class II bacteriocins or the non-lantibiotics are the most naturally-occurring
bacteriocins. These bacteriocins are relatively small (<10 kDa), heat-stable, nonlanthionine-containing peptides, which unlike lantibiotics, do not undergo
extensive post-translational modification. This group is further divided into four
sub-classes by Cotter et al. (2005): “pediocin-like” bacteriocins (class IIa), twopeptide bacteriocins (class IIb), circular bacteriocins (class IIc), and unmodified,
linear, non-pediocin-like bacteriocins (class IId) (Table 2).
Class IIa bacteriocins have a distinct conserved sequence YGNGV in the Nterminal region that gives this group a very strong inhibitory ability against the
highly pathogenic food-borne pathogen Listeria monocytogenes (Ennahar et al.
2000; Fimland et al. 2005). This group is oftentimes called pediocin-like because
the first discovered bacteriocin belonging to this group was pediocin PA-1/AcH
(Fimland et al. 2005; Drider et al. 2006). While class IIb bacteriocins are twopeptide bacteriocins that require both peptides to work synergistically to be fully
active (Oppegard et al. 2007; Nissen-Meyer et al. 2010), class IIc bacteriocins,
arguably the most poorly understood, are grouped based on the circular
configuration of their structure. The N- and C- termini of class IIc bacteriocins are
covalently linked that results to a very stable molecular structure (Maqueda et al.
2008; van Belkum et al. 2011). On the other hand, class IId bacteriocins comprise
the remaining bacteriocins that are combined as miscellaneous or one-peptide nonpediocin linear group (Cotter et al. 2005; Iwatani et al. 2011; Masuda et al. 2012).
Sec-dependent bacteriocins (Cintas et al. 2000) and the growing number of
bacteriocins that do not have leader peptides and therefore known as leaderless
bacteriocins (Fujita et al. 2007), belong to this class.
Bacteriocin Biosynthesis
Bacteriocins have relatively simpler biosynthetic machinery because they are
primary metabolites (gene-encoded and synthesized through the ribosome) while
conventional antibiotics are secondary metabolites. Bacteriocin coding genes are
often associated with transferable elements such as conjugative transposons or
plasmids (Klaenhammer 1993; Riley & Wertz 2002). Genes related to the
biosynthesis of bacteriocins are generally clustered together with the minimum
genetic machinery consisting of the structural gene and the cognate immunity
genes (Klaenhammer 1993). Bacteriocins are synthesized as biologically-inactive
precursor peptides that contain the N-terminal leader peptides attached to the Cterminal propeptides. These would then undergo enzymatic processes (often
referred to as bacteriocin maturation) to yield the “mature” active bacteriocins
(Klaenhammer 1993; Diep & Nes 2002; Riley & Wertz 2002). The leader peptide
(i) functions as a recognition site for the biosynthetic enzymes involved in the
maturation process and its transport to the extracellular space, (ii) protects the
producer strain from the bacteriocin's inhibitory activity by keeping the bacteriocin
in an inactive state (precursor peptide form) while inside the producer cell, and (iii)
interacts with the propeptide domain of the precursor peptide to ensure a suitable
conformation essential for the enzyme-substrate interaction (precursor peptide and
the biosynthetic enzyme(s)) (Klaenhammer 1993; van der Meer et al. 1994; van
Belkum et al. 1997; Oman & van der Donk 2009).
To illustrate further the mechanism of bacteriocin biosynthesis, a schematic
diagram of the biosynthesis of the most extensively studied bacteriocin, nisin A, is
shown in Fig. 1 (Perez et al. 2014). Nisin A is synthesized through the ribosome of
the producer strain as an inactive peptide NisA, a gene product of the structural
gene nisA. NisA consists of an N-terminal leader peptide attached to the propeptide
moiety. The biosynthetic gene cluster that encodes the biosynthetic machinery
responsible for the modification, transport, immunity, and production regulation, is
encoded directly upstream of the nisA structural gene. The modification enzymes,
NisB and NisC, dehydrate and cyclize the propeptide, respectively, and
subsequently the ABC transporter, NisT, translocates the modified precursor
peptide into the extracellular space. The protease, NisT, then recognizes the leader
peptide of the modified precursor peptide and cleaves off the leader peptide,
releasing the mature (active form) nisin A. The lipoprotein, NisI, can bind to the
nisin A molecules around the producer cell, thereby providing protection from its
antimicrobial action. The multi-protein ABC transporter complex, NisFEG,
provides additional protection to the producer cells by expelling the nisin A
molecules away from the cell.
The production regulation of nisin biosynthesis is controlled by a twocomponent regulatory system, composed of a histidine kinase, NisK, and a
response regulator, NisR, where the nisin A molecule itself serves as the peptide
pheromone. The NisK protein senses the nisin A molecule, causing it to
autophosphorylate and subsequently transfers the phosphoryl group to NisR; the
phosphorylated NisR then initiates the transcription of the nisA gene cluster by
activating the promoters (Fig. 1).
Recently, a growing number of bacteriocins lacking the leader sequences have
been reported (Iwatani et al. 2011; Masuda et al. 2012). This group of new
bacteriocins is very interesting as they are in their active forms right after
translation. Many questions arise about the details of their biosynthetic mechanism
such as how the producer cell protects itself from the inhibitory action of the
bacteriocin while it is inside the cell. Do the producer cells have a unique
mechanism of transport of the bacteriocin molecule to the extracellular space?
From an application perspective, these bacteriocins offer promising commercial
potential applications as they can be readily synthesized without having the need to
cleave off the leader peptide. This makes them easily applicable for scaling up
production using different systems, even possibly using eukaryotic heterologous
production systems (Perez et al. 2014).
Killing Mechanisms of Bacteriocins
Bacteriocins are known for their very high potency against their target strains.
In general, bacteriocin activity is limited to strains that are closely related to the
bacteriocin producer strain (narrow-spectrum bioactivity) although recently, many
____________________________________________________________________________________________________________
www.philscitech.org
63
ions, amino acids, nucleotides and other cytoplasmic solutes, resulting in the
termination of all biosynthetic processes, leading to cell death (Ruhr & Sahl 1985;
Sahl et al. 1987). Nisin is extremely potent against its target bacterial strains,
showing antimicrobial activity even at a single-digit nanomolar concentration. At
lower concentrations, nisin has been shown to kill target bacteria through enzyme
inhibition. The nisin molecule has been shown to bind to lipid II, which is the main
transporter of peptidoglycan subunits from the cytoplasm to the cell wall (Fig. 2).
Peptidoglycan is the main component of the bacterial cell wall. The binding of
nisin to lipid II results in the prevention of proper cell wall synthesis, thereby
causing cell death. Furthermore, at higher concentrations, the nisin-lipid II
molecule complex initiates membrane insertion that creates pores in the bacterial
cell membrane. Thus, the binding of nisin to lipid II facilitates its dual mode of
preventive action involving cell wall synthesis and membrane pore formation
(Breukink et al. 1999; Wiedemann et al. 2001).
Class II bacteriocins (non-lantibiotics)
Figure 1. A schematic diagram of the biosynthesis of nisin A. Nisin A
is ribosomally synthesized as an inactive prepeptide, NisA, consisting of
an N-terminal leader sequence attached to a propeptide moiety.
Modification enzymes, NisB and NisC, dehydrate and cyclize the
propeptide respectively, and subsequently the ABC transporter, NisT,
translocates the modified prepeptide into the extracellular space. The
protease, NisP, then cleaves off the leader peptide, releasing the mature
(active form) nisin A. The lipoprotein NisI that can bind to nisin A, and the
multi- protein ABC transporter complex NisFEG, which expels nisin A from
the cell, comprise the self-immunity system for nisin A. The two-component
regulation system that is responsible for the up-regulation of the nisin gene
cluster is composed of a histidine kinase, NisK, and a response regulator,
NisR. Nisin A serves as the signal peptide that activates this regulation
system.
Non-lantibiotics are the most commonly occurring bacteriocins. Most
members of class II bacteriocins exert their antimicrobial action by inducing
membrane permeabilization that subsequently leads to the leakage of cytoplasmic
molecules, causing cell death of the target bacteria. The mechanisms of
antimicrobial action of class II bacteriocins differ among subclasses (Perez et al.
2014).
Class IIa bacteriocins (pediocin-like bacteriocins)
Members of class IIa bacteriocins are known for their high potency against L.
monocytogenes, a highly pathogenic and robust food-borne bacterium. Class II
bacteriocins have been shown to bind to mannose phosphotransferase system
(Man-PTS) proteins, the sugar-uptake system of target bacteria, as docking
molecule for their killing mechanism. The conserved YGNGV amino acid
sequence at the N-terminal region of class IIa bacteriocins is responsible for the
anti-listerial antimicrobial activity, whereas the less conserved C-terminal domain
is responsible for their antimicrobial activity against other target strains (Fimland
et al. 2005; Johnsen et al. 2005).
Class IIb bacteriocins (two-peptide bacteriocins)
bacteriocins have shown antimicrobial activity against a wide range of genera
(broad-spectrum bioactivity). The killing mechanism of bacteriocins is specific to
each group of bacteriocins. Moreover, the general cationic nature of bacteriocins
plays a very important role in their initial interaction with the cell membrane of
their target strains. The negative charge of bacterial cell membranes and the
positive charge of bacteriocin molecules create an electrostatic interaction between
them, thereby facilitating the approach of the molecules to the membranes.
However, this interaction is not responsible for the killing of the target bacterial
cells. This interaction is also responsible for the inactivity of most bacteriocins
toward Gram-negative bacterial strains. The composition of Gram-negative
bacterial membrane differs from that of Gram-positive bacterial membrane in that
the former contains a lipopolysaccharide outer membrane. Bacteriocins from LAB
only become active against Gram-negative bacteria when combined with other
agents that compromise the integrity of the outer membrane such as surfactants
(Stevens et al. 1991; Zhang & Mustapha 1999). As mentioned above, the mode of
action of bacteriocins is different among classes. To apply their killing mechanism,
bacteriocins require a receptor molecule or a “docking molecule” found in their
target bacterial cell membrane, which differs among different classes and
subclasses.
Two-peptide bacteriocins require the synergistic activity of both peptides to
promote their killing activity against their target bacteria. These peptides display
very low, if any, bacteriocin activity when tested individually. Thus, the two
peptides of class IIb bacteriocins should be considered as one antimicrobial unit
instead of two independent antimicrobial peptides that show synergistic activity
(Oppegard et al. 2007). Members of class IIb bacteriocins can be classified into
two types: type E (enhanced) and type S (synergistic) peptides (Garneau et al.
2002). The killing mechanisms of class IIb bacteriocins involve membrane
permeabilization of their target bacterial strains, which results in the leakage of
small cytoplasmic molecules such as the monovalent cations, Na+, K+, Li+, Cs+,
Rb+, but not divalent cations such as Mg2+ or phosphates (Oppegard et al. 2007).
Membrane pores formed as a result of class IIb bacteriocins are relatively smaller
in size than those of lantibiotics.
Class IIc bacteriocins (circular bacteriocins)
Compared to other classes of bacteriocins, circular bacteriocins display a
broader spectrum of antimicrobial activity towards various Gram-positive
bacteria, including many food-borne spoilage and pathogenic bacteria. Circular
bacteriocins are bactericidal toward their target bacterial cells. Similar to many
other bacteriocins, circular bacteriocins apply their killing mechanism toward
their target bacteria by permeation of the bacterial cell membrane, resulting in the
leakage of ions, dissipation of membrane potential, and eventually in cell death
(Gabrielsen et al. 2014). Studies on the mode of action on enterocin AS-48,
gassericin A, subtilosin A, and carnocyclin A have suggested that circular
bacteriocins do not require a receptor molecule for their activity. It has been
thought that basic amino acid residues of circular bacteriocins that patch on the
surface of their compact hydrophobic globular structure were responsible for the
electrostatic interaction between the bacteriocin and the surface membrane of the
target cell (van Belkum et al. 2011). However, a later study on garvicin ML, a new
member of circular bacteriocins, has suggested that garvicin ML has a dual mode
of action as in the case of nisin A. Aside from the non-receptor electrostatic
interaction killing mechanism, a maltose ABC-transporter protein serves as a target
receptor of garvicin ML, which facilitates the efflux of intracellular solutes that
eventually leads to cell death (Gabrielsen et al. 2012).
Class IId bacteriocins (miscellaneous bacteriocins)
Figure 2. Killing mechanism of class I bacteriocins. Class I
bacteriocins, such as nisin, have a dual mechanism in killing their target
cells through (a) inhibition of cell wall synthesis and (b) pore formation.
Both mechanisms are facilitated by the binding of the nisin molecule to the
lipid II, which is the main transporter of peptidoglycan subunits – the
building blocks of the bacterial cell wall. At lower concentrations, nisin
prevents the proper cell wall synthesis, which leads to cell death. At higher
concentrations, nisin binds to lipid II that initiates membrane insertion and
pore formation, which leads to the leakage of cellular components such as
ions and ATP.
Class I bacteriocins (lantibiotics)
Lantibiotics, such as nisin, have two known killing mechanisms, although
both systems share a common denominator (Breukink et al. 1999; Wiedemann et
al. 2001; Hsu et al. 2004). It has long been shown that the lantibiotic nisin disrupts
the integrity of the bacterial cell membrane by forming pores that would lead to the
dissipation of the membrane potential and the efflux of small metabolites such as
The killing mechanisms of one-peptide non-pediocin linear and leaderless
bacteriocins are still poorly understood. Unlike the other classes where bacteriocins
within the same grouping share a similar mechanism of antimicrobial action, as
discussed above (i.e. lantibiotics use lipid II whereas pediocin-like bacteriocins
utilize the Man-PTS as receptor molecules respectively), class IId bacteriocins do
not share any common system for their killing mechanisms. This is primarily
because of the fundamental diversity of their primary structures (Iwatani et al.
2011).
On the other hand, the unique killing mechanism of lacticin Q, a leaderless
bacteriocin, has been well characterized (Yoneyama et al. 2009b). While most
bacteriocins require a docking molecule for their antimicrobial action, lipid II for
nisin A and other lantibiotics, and mannose ABC transporter, MptD, for pediocin
PA-1/AcH and its homologue bacteriocins, lacticin Q has been found to cause
high-level membrane permeabilization of target strains without the need of any
specific receptors (Yoneyama et al. 2009a). Lacticin Q forms a huge toroidal pore
(HTP) from around 4.6 to 6.6 nm in size, enough to cause leakage of intracellular
components such as ions and ATP as well as large molecules such as proteins,
____________________________________________________________________________________________________________
www.philscitech.org
thereby causing cell death (Yoneyama et al. 2009b). It has been shown that the
mechanism of HTP formation starts with the electrostatic interaction of the cationic
lacticin Q molecules and the negatively charged membranes. The rapid binding of
lacticin Q to the phospholipid bilayer membranes results in the formation of HTPs
coupled with lipid flip-flop. Intracellular components then escape from these
pores,leading to cell death. The pores formed in the membrane are short-lived
because these HTPs close back as the lacticin Q molecular mass translocates itself
from the outer to the inner cell membrane (Fig. 3) (Yoneyama et al. 2009b).
However, the killing mechanism through HTP formation of lacticin Q is selective
and highly dependent on the physiological features of the outer membrane of target
cells, which explains the non-toxicity of lacticin Q against Gram-negative bacteria
(Yoneyama et al. 2011). Furthermore, very recently, it was suggested that another
mechanism is responsible for the selective antimicrobial activity of lacticin Q, and
this is the accumulation of hydroxyl radicals through Fenton reaction, with
variations within species, and in some cases, even within strains. It was inferred
that the selective toxicity of lacticin Q would depend on the strains’ ability to
scavenge the hydroxyl radicals (Li et al. 2013).
Figure 3. Huge toroidal pore (HTP)
model of the antimicrobial action
of lacticin Q. The highly cationic
lacticin Q molecules rapidly bind to
the negatively charged phospholipid
bilayer membrane (i) that results in
the formation of HTPs coupled with
membrane lipid flip-flop that causes
the leakage of intracellular
components, including ions, ATP, and
small proteins (ii), after which, the
lacticin Q molecular mass
translocates itself from the outer to
the inner membrane as the pore
closes (iii) (Yoneyama et al. 2009b).
Fermentation Studies in LAB
Growth and Bacteriocin Production
Bacteriocin production is growthassociated but the yield of bacteriocin per
unit biomass is affected by several
factors, including the producing strain,
media (carbohydrate and nitrogen
sources, cations, etc.) and fermentation
conditions (pH, temperature, agitation,
aeration and dilution rate in continuous
fermentations) (Anthony et al. 2009;
Thirumurugan et al. 2015). Continuous
fermentation processes with cell recycle
or immobilized cells can result in a
dramatic improvement in productivity
over batch fermentations (Parente et al.
1997; Bhugaloo-Vial et al. 1997; Liu et
al. 2005; Schobitz et al. 2006).
Growth and bacteriocin production in Leuconostoc mesenteroides L124 and
Lactobacillus curvatus L442 were found to be directly proportional to the carbon
to nitrogen ratio (Mataragas et al. 2004). For Lb. pentosus ST151BR, tryptone
stimulated growth and bacteriocin production, whereas lower activity was
observed with meat extract, yeast extract or their combinations. Maltose, lactose or
mannose were preferred carbon sources over sucrose, fructose and glucose. Tween
80 and glycerol also adversely affected bacteriocin production (Todorov & Dicks
2004). Similarly, tryptone and saccharose increased bacteriocin production by
Enterococcus faecium ST311LD by two-fold (Todorov & Dicks 2005). For Lb.
salivarius CRL1328, optimal growth and bacteriocin production in MRS broth
were recorded at an initial pH of 6.5 and 37 °C. In LAPTg (chemically defined
medium composed of 1.5% peptone, 1% tryptone, 1% glucose, 1% yeast extract,
0.1% Tween 80), maximum bacteriocin activity was obtained after 6 h at 37 °C and
at initial pH of 6.5 and 8.0 (Juarez et al. 2002).
Leroy & de Vuyst (2001) have done kinetic modeling of the growth of Lb.
sakei CTC 494 in the chemically-defined medium de Man Rogosa Sharpe (MRS).
They found that growth was inhibited by the accumulation of lactic acid and other
toxic products, and the depletion of nutrients. Bacteriocin production by Lb.
plantarum LPCO10 was optimized in batch culture using plantaricin C in an
integral statistical approach, fractional factorial three-level design experiment
(Sanchez et al. 2002). Callewaert & De Vuyst (2000) have also found that fedbatch fermentation helped stabilize the conditions of the culture broth and the
added nutrients improved growth and bacteriocin production of Lb. amylovorus
DCE 471. Fed-batch fermentation was also found suitable for Lb. curvatus CWBIB28. On the other hand, the bacteriocin from Lb. plantarum LL441, was optimally
produced in chemostat or continuous culture at pH 5.0, 30 °C, 150 rpm and a
dilution rate of 0.05 h—1 using glucose as carbon source at a dilution rate of 0.10 to
0.12 h—1 when sucrose or fructose was used (Barcena et al. 1998).
Biomass and bacteriocin production of some strains of lactic acid bacteria
using natural basal media have been done. Guerra & co-workers (2005) tried fedbatch pediocin production by Pediococcus acidilactici NRRL B-5627 on whey.
Diluted whey supplemented with 2% yeast extract and 1% glucose was used as
initial medium and the fed-batch medium used was concentrated whey (4.8 % total
sugars), 2% yeast extract and 4% glucose. Results showed that the biomass and
64
bacteriocin production were higher than when MRS broth was used. Another
substrate previously investigated was mussel processing waste (Guerra & Castro
2002). Some processes to recover bacteriocins from the culture media have also
been devised. Several simple recovery processes, based on adsorbing bacteriocins
on resins or silica compounds, have been developed and can be used to build
integrated production processes (Parente & Ricciardi 1999).
Bacteriocin Application and Prospects
LAB have been associated with food fermentations dating all the way back to
ancient times due to their beneficial influences on nutritional, organoleptic, and
shelf-life properties of foods (De Vuyst & Leroy 2007). It is, however, their ability
to produce bacteriocins that have made them particularly promising in both food
and pharmaceutical industries. In the food industry, bacteriocins have been widely
utilized for the biopreservation of various foods, either alone, or in combination
with other methods of preservation known as hurdle technology (Chen & Hoover
2003; Ghrairi et al. 2012). Incorporation of bacteriocins into the food packaging
film or surfaces has been explored as well (Galvez et al. 2007). The antimicrobial
activity of many bacteriocins, especially the class IIa bacteriocins, against the
highly pathogenic food-borne L. monocytogenes can be an ideal solution to the
problem on L. monocytogenes contamination on ready-to-eat refrigerated food
products (Chen & Hoover 2003).
There are three common approaches in which bacteriocins can be applied in
food systems: (i) direct inoculation of bacteriocin-producing LAB into the food
system, (ii) addition of the bacteriocin in its purified form as a food preservative,
and (iii) utilization of the product, fermented by a bacteriocin-producing LAB, as a
raw material for food processing (Schillinger et al. 1996).
The increasing incidence of multidrug resistance bacterial pathogens is one of
the most pressing medical problems in recent years (Spellberg et al. 2008; WHO
2014). The clinical application potential of LAB bacteriocins has been the subject
of on-going investigations by many scientists in many countries all over the world
due to the activity of some bacteriocins against Gram-positive human and animal
pathogens including some multi-drug resistant (MDR) pathogens (Cotter et al.
2005). Bacteriocins have been considered to be viable candidates to supplement
the arsenal of antibiotics targeting MDR-associated infections (Cotter et al. 2013).
For example, the two-peptide lantibiotic lacticin 3147 has been found in vitro to be
active against the methicillin-resistant Staphylococcus aureus (MRSA) strain and
vancomycin-resistant Enterococcus faecalis (VRE) strain (Galvin et al. 1999).
Furthermore, because bacteriocins are ribosomally synthesized, they have
relatively simpler biosynthetic mechanisms than that of secondary metabolite
antibiotics. The gene-encoded nature of bacteriocins makes them easily amenable
through bioengineering to either increase their activity or specify their target
microorganism. Owing to this feature of bacteriocins, antibiotic therapy can
become less damaging to the natural gut microflora, which is a common drawback
of conventional antibiotic therapy.
However, there are still some serious bottlenecks hindering the large-scale
application of LAB bacteriocins. It remains a huge challenge to establish a costeffective system for large-scale production and down-stream processing systems
(Yusuf 2013). In addition, cultivation of lactic acid bacteria requires more
expensive complex media compared to other antimicrobial compound-producing
microorganisms. The weak potency of most bacteriocins against Gram-negative
pathogens is also considered a disadvantage since there are numerous Gramnegative food-borne pathogens that are common concerns in many food products.
In order to address this limitation, combinational strategies (hurdle technology) of
food preservation have been studied (Chen & Hoover 2003; Mills et al. 2011).
Moreover, the use of bioengineered bacteriocins, especially for food applications,
can face resistance by misinformed consumer, as in the case of other geneticallymodified organisms (Perez et al. 2014).
For clinical applications of bacteriocins, their mode of administration still
requires more in-depth studies. Although a variety of administration methods have
been proven successful, such as subcutaneous, intravenous, intranasal, intragastric,
intraperitoneal, and topical, their efficacies have not yet been directly compared
(Jabes et al. 2011; Lohans & Vederas 2012). Moreover, some of these methods are
unnecessarily invasive (Lohans & Vederas 2012). Drug therapy for humans usually
prescribes oral administration; however, in such a case, the fate of bacteriocin
molecules in the gastro-intestinal environment still remains a huge question. Due
to its proteinaceous nature, enzymatic degradation of the bacteriocin in the gut is
highly possible.
Nevertheless, these issues have not discouraged many scientists from looking
at bacteriocins for their large-scale applications. This is clearly evident in the
rapidly increasing number of research studies done on their application as food
preservatives and as therapeutic agents (Lohans & Vederas 2012; Arthur et al.
2014; Nigam et al. 2014; Yang et al. 2014).
Bacteriocin Research in the Philippines
The Philippines is one of the countries blessed with the world’s most
abundant biodiversity. It is highly possible that the Philippines has highly diverse
bacterial strains producing novel bacteriocins with exceptional properties. This is
evident in the variety of indigenous fermented food products that are unique to
each of the three-main island groups of the Philippines, namely Luzon, the
Visayas, and Mindanao. These fermented foods often rely entirely on the natural
microflora of the raw material and surrounding environment (Banaay et al. 2013).
Some efforts on the isolation and screening for bacteriocin-producing LAB
strains have been done by the National Institute of Molecular Biology and
____________________________________________________________________________________________________________
www.philscitech.org
65
Biotechnology (BIOTECH) and the Institute of Biological Sciences at the
University of the Philippines Los Baños (UPLB) in Luzon and the Philippine
Rootcrops Research and Training Center (PhilRootcrops) at the Visayas State
University in the Visayas, but no novel bacteriocins have been discovered. Most
bacteriocins produced from the lactic acid bacterial strains were already known and
had been reported elsewhere by foreign scientists (Banaay et al. 2013).
Nevertheless, the Food Safety and Functional Food Biotechnology Program
(FSFFBP) of BIOTECH, UPLB has been doing basic research on the isolation and
characterization of bacteriocin-producing lactic acid bacteria for more than a
decade and has established a collection of identified and well-characterized LAB
isolates from indigenous sources. To date, around thirty (30) bacteriocin-producing
LAB isolates have been characterized genetically and biochemically by the
FSFFBP. Most of these isolates are positive for the papA gene, the pediocin
structural gene (Table 3). Out of the 23 isolates tested for papA gene, 20 have been
found PCR-positive for the gene (Perez et al. 2012). Some of these bacteriocins
have been purified to homogeneity and their properties, such as their tolerance to
low pH, high temperature and bile and adhesion to porcine intestine, thoroughly
elucidated. Two of these promising isolates, namely Lb. plantarum BS (deposited
at the Philippine National Collection of Microorganisms (PNCM 10287)) and P.
acidilactici AA5a (PNCM 10289), have also been fingerprinted for IPR and
patenting purposes (Elegado et al. 2004a and 2004b).
L. plantarum
LP1
L. plantarum M01210
papA -
ATCC 8014 (BAcc. 1074)
L. plantarum P10
papA +
BS (PNCM
10289)
L. plantarum P10
papA +
4B1
L. brevis 0945
papA +
A
L. brevis M0121
papA -
C
L. brevis strain SC13
papA -
D
[100%] L. brevis
KLDS1.0411
papA +
F
L. brevis 0945
papA +
G
L. brevis 0945
papA +
H
[100%] L. brevis 0945
papA +
Lb. casei/
paracasei
030
Lactobacillus paracasei
M0116
papA-
Lb. brevis
Table 3. Genetic screening for papA (pediocin structural gene) in the lactic acid
bacteria (LAB) collection of the Food Safety and Functional Food Biotechnology
Program, BIOTECH, U.P. Los Baños.
16S rDNA PARTIAL
SEQUENCE
HOMOLOGY [99%]
papA
PCR
[450 bp]
Species
ISOLATE/STRAIN/
ACCESSION NO.
Pediococcus
acidilactici
AA-5a (PNCM
10287)
P. acidilactici DSM 20284
papA+
Lb.
fermentum
FM7
[97%] L. fermentum
IMAU50008
papA -
4E2
P. acidilactici NBRC
12231
papA +
Enterococcus
durans
NSRI 1171
E. durans M.D.E.MRSA-5
papA -
4E4
papA +
ML15
E. durans KLDS 6.0606
papA+
4E5
papA +
3B2
Enterococcus faecium
JZ1-1
papA-
4E6
papA +
IF2
E. faecalis YH-10-3
papA-
4BL7
papA +
B-Acc. 1072
Not determined
papA +
3F3
P. acidilactici NBRC12231
papA +
SC1
Lactococcus lactis LC
papA +
3F8
P. acidilactici NBRC12231
papA +
Lactococcus
lactis
Not determined
papA +
papA +
Leuconostoc
mesenteroides
B-Acc. 1493
3F10
3G3
P. acidilactici IMAU20090
papA +
3G8
P. acidilactici UL5
papA +
IG7
P. acidilactici
8D2CCH01MX
papA +
B19
P. acidilactici UL5
papA +
K2A1-1
papA +
K2A2-1
not determined
papA +
K2A2-3
not determined
papA +
K2A2-5
papA +
K3A2-1
not determined
papA +
K3A2-2
P. acidilactici UL5
papA +
K3A2-3
not determined
papA +
S3
papA +
P. lolii
4E10
P. lolii 0510Q
papA -
P. pentosaceous
B- Acc. 1225
[100%] Pediococcus
pentosaceous PP
papA +
E.faecium/
faecalis
Several possible application studies have been done to explore the suitability
of each of these probiotic and bacteriocinogenic LAB isolates as adjunct or sole
inoculum to improve the quality of probiotic foods. Sensory and health-functional
attributes and the keeping quality against pathogenic listeria and staphylococci
have been targets of research (Elegado et al. 2007). Examples of products being
developed using the above probiotic/bacteriocinogenic LAB isolates are probiotic
white cheese from carabao’s milk using BIOTECH microbial rennet and selected
probiotic LAB, probiotic drinks based on carabao’s milk, soybean, vegetable
extracts and selected fruit flavor, and the development of fermented meat sausages
(Marilao et al. 2007). Non-dairy probiotic LAB, preferably with bacteriocin-like
inhibitory substances, are also being tested as to their complementation and
enhancement of preventative or therapeutic attributes of herbal plants (Saguibo &
Elegado 2012), Results have shown in vitro that the bacteriocin of P. acidilactici
K2a2-3 has inhibitory effects against human colon adenocarcinoma (HT29) and
human cervical carcinoma (HeLa) cells (Villarante et al. 2010).
A few applications of purified or semi-purified bacteriocins have also been
done, such as the use of bacteriocins as sanitizing agent against L. monocytogenes
on stainless steel food vessels (Sagpao et al. 2007). Optimization works on
bacteriocin production from P. acidilactici AA5a and Lb. plantarum BS using
various cheap carbon sources such as molasses, coconut water, cheese whey, sago
starch hydrolyzate and extract of spent distillery yeasts have also been conducted
(Elegado et al. 2002; Elegado et al. 2004c; Sagpao et al. 2007).
SUMMARY OF REVIEW & RECOMMENDATIONS
Bacteriocins are antimicrobial peptides produced by many bacterial strains
that inhibit the growth of competing bacterial species in microecological systems.
The potential of bacteriocins produced by lactic acid bacteria (LAB) as natural
biopreservatives for food against resistant Gram-positive pathogens is huge. Once
harnessed, this can result in the minimal use of antibiotics and chemical
preservatives in foods, as preferred by well-informed consumers. Moreover, due to
their strong potency against antibiotic-resistant pathogens, bacteriocins may be a
viable solution to the growing problem of multidrug-resistant pathogens.
Nonetheless, more research still needs to be done in the isolation and
____________________________________________________________________________________________________________
www.philscitech.org
characterization of bacteriocins to maximize their potential in food and
pharmaceutical applications.
The authors declare no conflict of interests.
RHP and FBE outlined the topics of the review. RHP, FBE and MTP drafted
the manuscript. All authors read and jointly approved the final manuscript.
REFERENCES
Anthony, T., Rajesh, T., Kayalvizhi, N., Gunasekaran, P. (2009). Influence of
medium components and fermentation conditions on the production of
bacteriocin(s) by Bacillus licheniformis AnBa9. Bioresource Technol, 100,
872-877.
Arthur, T.D., Cavera, V.L., Chikindas, M.L. (2014). On bacteriocin delivery
systems and potential applications. Future Microbiol, 9(2), 235-248.
Asaduzzaman, S.M., Sonomoto, K. (2009). Lantibiotics: diverse activities and
unique modes of action. J Biosci Bioeng, 107, 475-487.
Banaay, C.G.B., Balolong, M.P., Elegado, F.B. (2013). Lactic Acid Bacteria in
Philippine Traditional Fermented Foods. In: M. Kongo (Ed.), Lactic Acid
Bacteria - R and D for Food, Health and Livestock Purposes. (pp. 571-588)
InTech.
Barcena, B.J.M., Siñeriz, F., Gonzalez de Llano, D., Rodriguez, A., Suarez, J.E.
(1998). Chemostat production of plantaricin C by Lactobacillus plantarum
LL441. Appl Environ Microbiol, 64(9), 3512-3514.
Bhugaloo-Vial, P., Grajek, W., Dousset, X., Boyaval, P. (1997). Continuous
bacteriocin production with high cell density bioreactors. Enzyme Microbiol
Technol, 21(6), 450-457.
Breukink, E., Wiedemann, I., van Kraaij, C., Kuipers, O.P., Sahl, H.G., de Kruijff,
B.(1999). Use of the cell wall precursor lipid II by a pore-forming peptide
antibiotic. Science, 286, 2361-2364.
Callewaert, R., de Vuyst, L. (2000). Bacteriocin production with Lactobacillus
amylovorus DCE 471 is improved and stabilized by fed-batch fermentation.
Appl Environ Microbiol, 66(2), 606-613.
Chen, H., Hoover, D.G. (2003). Bacteriocins and their food applications. Comp
Rev Food Sci Technol, 2, 82-100.
Cintas, L.M., Casaus, P., Herranz, C., Havarstein, L.S., Holo, H., Hernandez, P.E.,
Nes, I.F. (2000). Biochemical and genetic evidence that Enterococcus faecium
L50 produces enterocins L50A and L50B, the sec-dependent enterocin P, and
a novel bacteriocin secreted without an N-terminal extension termed enterocin
Q. J Bacteriol, 182, 6806-6814.
Cleveland, J., Montville, T.J., Nes, I.F., Chikindas, M.L. (2001). Bacteriocins: safe,
natural antimicrobials for food preservation. Int J Food Microbiol, 71, 1-20.
Cotter, P.D., Hill, C., Ross, R.P. (2005). Bacteriocins: Developing innate immunity
for food. Nat Rev Microbiol, 3, 777-788.
Cotter, P.D., Ross, R.P., Hill, C. (2013). Bacteriocins - a viable alternative to
antibiotics? Nat Rev Microbiol, 11, 95-105.
Deshmukh, Pravin, Thorat, P.R. (2013). Bacteriocins: A new trend in antimicrobial
food packaging. Int J Adv Res Eng App Sci, 1(1), 1-12.
De Vuyst, L., Leroy, F. (2007). Bacteriocins from lactic acid bacteria: production,
purification, and food applications. J Mol Microbiol Biotechnol, 13, 194-199.
Diep, D.B., Nes, I.F. (2002). Ribosomally synthesized antibacterial peptides in
Gram-positive bacteria. Curr Drug Targets, 3, 107-122.
Drider, D., Fimland, G., Hechard, Y., McMullen, L.M., Prevost, H. (2006). The
continuing story of class IIa bacteriocins. Microbiol Mol Biol Rev, 70,
564-582.
Elegado, F.B., Abuel, B.J.A., Te, J.T. Jr., Calapardo, M.R., Parungao, M.M. (2007).
Antagonism against Listeria spp. and Staphylococcus aureus by bacteriocinproducing lactic acid bacteria screened from the intestines of Philippine
carabao using Polymerase Chain Reaction. Philipp Agric Scientist, 90(4),
305-314.
Elegado, F.B., Guerra, M.A.R.V., Macayan, R.A., Mendoza, H.A., Lirazan, M.B.
(2004a). Spectrum of bacteriocin activity of Lactobacillus plantarum BS and
fingerprinting by RAPD-PCR. Int J Food Microbiol, 95, 11-18.
Elegado, F.B., Guerra, M.A.R.V., Macayan, R.A., Estolas, M.T., Lirazan, M.B.
(2004b). Antimicrobial activity and DNA fingerprinting of bacteriocinogenic
Pediococcus acidilactici through RAPD-PCR. Philipp Agric Scientist, 87(2),
229-237.
Elegado, F.B., Opina, A.C.L., Bawagan, C.G.O., Dalmacio, I.F. (2002).
Purification, characterization and production in coconut water and cheese
whey of the bacteriocin of Lactobacillus plantarum BS isolated from
Philippine fermented food. Proceedings of International Conference on
Tropical Bio-resources and Green Chemistry Strategy. Osaka International
Convention Center, Osaka, Japan. pp. 364- 371.
Elegado, F.B., Zendo, T., Nakayama, J, Sonomoto, K. (2004c) 16S rRNA gene
characterization of lactic acid bacteria isolated from Philippine fermented
rice-shrimp mixture, bacteriocin purification, and production using raw sago
starch. Biotechnology for Sustainable Utilization of Biological Resources in
the Tropics 17, 20-25.
Ennahar, S., Sashihara, T., Sonomoto, K., Ishizaki, A. (2000). Class IIa
bacteriocins: biosynthesis, structure and activity. FEMS Microbiol Rev, 24,
85-106.
Fimland, G., Johnsen, L., Dalhus, B., Nissen-Meyer, J. (2005). Pediocin-like
antimicrobial peptides (class IIa bacteriocins) and their immunity proteins:
biosynthesis, structure, and mode of action. J Peptide Sci, 11, 688-696.
66
Fujita, K., Ichimasa, S., Zendo, T., Koga, S., Yoneyama, F., Nakayama, J.,
Sonomoto, K. (2007). Structural analysis and characterization of lacticin Q, a
novel bacteriocin belonging to a new family of unmodified bacteriocins of
Gram-positive bacteria. Appl Environ Microbiol, 73, 2871-2877.
Gabrielsen, C., Brede, D.A., Hernandez, P.E., Nes, I.F., Diep, D.B. (2012). The
maltose ABC transporter in Lactococcus lactis facilitates high-level
sensitivity to the circular bacteriocin garvicin ML. Antimicrob Agents
Chemother, 56, 2908-2915.
Gabrielsen, C., Brede, D.A., Nes, I.F., Diep, D.B. (2014). Circular bacteriocins:
biosynthesis and mode of action. Appl Environ Microbiol, 80(22), 6854-6862.
Galvez, A., Abriouel, H., Lopez, R.L., Ben Omar, N. (2007). Bacteriocin-based
strategies for food biopreservation. Int J Food Microbiol, 120, 51-70.
Galvin, M., Hill, C., Ross, R.P. (1999). Lacticin 3147 displays activity in buffer
against Gram-positive bacterial pathogens which appear insensitive in
standard plate assays. Let Appl Microbiol, 28, 355-358.
Garneau, S., Martin, N.I., Vederas, J.C. (2002). Two-peptide bacteriocins produced
by lactic acid bacteria. Biochimie, 84, 577-592.
Ghrairi, T., Chaftar, N., Hani, K. (2012). Bacteriocins: recent advances and
opportunities. In: R. Bhat, A. Karim Alias, & G. Paliyath (Eds.) Progress in
Food Preservation (pp. 485-511). Oxford: Wiley-Blackwell.
Guerra, N.P., Bernardez, P.F., Agrasar, A.T., Maciasand, C.L., Castro, L.P. (2005).
Fed-batch pediocin production by Pediococcus acidilactici NRRL B-5627 on
whey. Biotechnol Appl Biochem, 42, 17-23.
Guerra, N.P., Castro, L.P. (2002). Production of bacteriocins from Lactococcus
lactis subsp. Lactis CECT 539 and Pediococcus acidilactici NRRL B-5267
using mussel-processing wastes. Biotechnol Appl Biochem, 36, 119-25.
Heng, N.C.K., Wescombe, P.A., Burton, J.P., Jack, R.W., Tagg, J.R. (2007). The
diversity of bacteriocins in Gram-positive bacteria. In: M.A. Riley & M.A.
Chavan. (Eds.) Bacteriocins: ecology and evolution. (pp. 45-92). Berlin:
Springer.
Hsu, S.T., Breukink, E., Tischenko, E., Lutters, M.A., de Kruijff, B., Kaptein, R.,
Bonvin, A.M., van Nuland, N.A. (2004). The nisin-lipid II complex reveals a
pyrophosphate cage that provides a blueprint for novel antibiotics. Nat Struc
Mol Biol, 11, 963-967.
Iwatani, S., Zendo, T., Sonomoto, K. (2011). Class IId or linear and non-pediocinlike bacteriocins. In: D. Drider & S. Rebuffat (Eds.). Prokaryotic
antimicrobial peptides: from genes to applications. (pp. 237-253). London:
Springer. Jabes, D., Brunati, C., Candiani, G., Riva, S., Romano, G., Donadio,
S. (2011). Efficacy of the new lantibiotic NAI-107 in experimental infections
induced by MDR Gram positive pathogens. Antimicrob Agents Chemother,
55(4), 1671-1676.
Johnsen, L., Fimland, G., Nissen-Meyer, J. (2005). The C-terminal domain of
pediocin-like antimicrobial peptides (class IIa bacteriocins) is involved in
specific recognition of the C-terminal part of cognate immunity proteins and
in determining the antimicrobial spectrum. J Biol Chem, 280, 9243-9250.
Juarez, T.M.S., Bru, E., Wiese, B., De Ruiz, H.A.A., Nader, M.M.E. (2002).
Influence of pH, temperature and culture media on the growth and bacteriocin
production by vaginal Lactobacillus salivarius CRL1328. J Appl Microbiol,
93(4), 714-24.
Klaenhammer, T.R. (1993). Genetics of bacteriocins produced by lactic acid
bacteria. FEMS Microbiol Rev, 12, 39-85.
Leroy, F., de Vuyst, L. (2001). Growth of the bacteriocin-producing Lactobacillus
sakei strain CTC494 in MRS broth is strongly reduced due to nutrient
exhaustion: a nutrient depletion model for the growth of lactic acid bacteria.
Appl Environ Microbiol, 67(10), 4407-4413.
Li, M., Yoneyama, F., Toshimitsu, N., Zendo, T., Nakayama, J., Sonomoto, K.
(2013). Lethal hydroxyl radical accumulation by a lactococcal bacteriocin,
lacticin Q. Antimicrob Agents Chemother, 57, 3897-3902.
Liu, X., Chung, Y.K., Yang, S.T., Yousef, A.E. (2005). Continuous nisin production
in laboratory media and whey permeate by immobilized Lactococcus lactis.
Process Biochem, 40: 13-25.
Lohans, C.T., Vederas, J.C. (2012). Development of class IIa bacteriocins as
therapeutic agents. Int J Microbiol 2012, 1-13. doi:10.1155/2012/386410.
Maqueda, M., Sanchez-Hidalgo, M., Fernandez, M., Montalban-Lopez, M.,
Valdivia, E., Martinez-Bueno, M. (2008). Genetic features of circular
bacteriocins produced by Gram-positive bacteria. FEMS Microbiol Rev, 32,
2-22.
Marilao, C.G., Calapardo, M.R., Ciron, C.E., Elegado, F.B. (2007). Anti-listerial
action of Pediococcus acidilactici AA5a in pork sausage fermentation.
Philipp Agric Scientist, 90(1), 40-45.
Masuda, Y., Zendo, T., Sonomoto, K. (2012). New type of non-lantibiotic
bacteriocins: circular and leaderless bacteriocins. Beneficial Microbes, 3,
3-12.
Mataragas, M., Drosinos, E.H., Tsakalidou, E., Metaxopoulos, J. (2004). Influence
of nutrients on growth and bacteriocin production by Leuconostoc
mesenteroides L124 and Lactobacillus curvatus L442. Antonie van
Leeuwenhoek, 85(3), 191-198.
McAuliffe, O., Ross, R.P., Hill, C. (2001). Lantibiotics: structure, biosynthesis and
mode of action. FEMS Microbiol Rev, 25, 285-308.
Mills, S., Stanton, C., Hill, C., Ross, R.P. (2011). New developments and
applications of bacteriocins and peptides in foods. Annu Rev Food Sci
Technol, 2, 299-329.
Nigam, A., Gupta, D., Sharma, A. (2014). Treatment of infectious diseases: beyond
antibiotics. Microbiol Res, 169(9-10), 643-651.
Nissen-Meyer, J., Oppegard, C., Rogne, P., Haugen, H.S., Kristiansen, P.E. (2010).
Structure and mode of action of the two-peptide (class-IIb) bacteriocins.
Probiotics Antimicrob Proteins, 2, 52-60.
Oman, T.J., van der Donk, W.A. (2009). Follow the leader: the use of leader
peptides to guide natural product biosynthesis. Nat Chem Biol, 6, 9-18.
Oppegard, C., Rogne, P., Emanuelsen, L., Kristiansen, P.E., Fimland, G., Nissen-
____________________________________________________________________________________________________________
www.philscitech.org
Meyer, J. (2007). The two-peptide class II bacteriocins: structure, production,
and mode of action. J Mol Microbiol Biotechnol, 13, 210-219.
Parente, E., Brienza, C., Ricciardi, A., Addario, G. (1997). Growth and bacteriocin
production by Enterococcus faecium DPC1146 in batch and continuous
culture. J Ind Microbiol Biotechnol, 18(1): 62-67.
Parente, E., Ricciardi, A. (1999). Production, recovery and purification of
bacteriocins from lactic acid bacteria. Appl Microbiol Biotechnol, 52(5)
628-638.
Perez, M.T.M., Apaga, D.L.T., Robidillo, C.J., Elegado, F.B. (2012). Pediocin
structural genes of bacteriocinogenic pediococci isolated from indigenous
Philippine and Vietnamese foods. 2012 International Conference on
Green Technology and Sustainable Development. University of Technical
Education Ho Chi Minh, Vietnam. pp. 131-137.
Perez, R.H., Zendo, T., Sonomoto, K. (2014). Novel bacteriocins from lactic acid
bacteria (LAB): various structures and applications. Microbial Cell Factories,
13, (Suppl1): S3.
Riley, M.A., Wertz, J.E. (2002). Bacteriocins: evolution, ecology, and applications.
Annu Rev Microbiol, 56, 117-137.
Ruhr, E., Sahl, H.G. (1985). Mode of action of the peptide antibiotic nisin and
influence on the membrane potential of whole cells and on cytoplasmic and
artificial membrane vesicles. Antimicrob Agents Chemother, 27, 841-845.
Sahl, H.G., Kordel, M., Benz, R. (1987). Voltage-dependent depolarization of
bacterial membranes and artificial lipid bilayers by the peptide antibiotic
nisin. Arch Microbiol, 149, 120-124.
Saguibo, J.D., Elegado, F.B. (2012). Resistant profile of probiotic lactic acid
bacteria against inhibitory effects of selected plant extracts. Philippine Agr
Sci, 95(1), 22-32.
Sagpao, S.M.N. (2007). Production, partial purification, and characterization of
pediocin as a potential sanitizer for stainless steel surfaces contaminated with
Listeria monocytogenes. Unpublished MS Thesis. University of the
Philippines Los Baños, College, Laguna, Philippines.
Sanchez, M.V.L., Diaz, R.J., Barragan, A.M., Fernandez, A.G., Barba, J.L.R.
(2002). Optimization of bacteriocin production by batch fermentation of
Lactobacillus plantarum LPCO10. Appl Environ Microbiol, 68(9),
4465-4471.
Schillinger, U., Geisen, R., Holzapfel, W.H. (1996). Potential of antagonistic
microorganisms and bacteriocins for the biological preservation of foods.
Trends Food Sci Technol, 7, 158-164.
Schobitz, R.P., Borquez, P.A., Costa, M.E., Ciampi, L.R., Brito, C.S. (2006).
Bacteriocin substance like production by Carnobacterium piscicola in a
continuous system with three culture broths: Study of antagonism against
Listeria monocytogenes on vacuum packaged salmon. Braz J Microbiol, 37:
52-57.
Spellberg, B., Guidos, R., Gilbert, D., Bradley, J., Boucher, H. W., Scheld, W.M.,
Bartlett, J.G., Edwards Jr., (2008). The epidemic of antibiotic-resistant
infections: A call to action for the medical community from the Infectious
Disease Society of America. Clin Inf Dis 46, 155-164.
Stevens, K.A., Sheldon, B.W., Klapes, N.A., Klaenhammer, T.R. (1991). Nisin
treatment for inactivation of Salmonella species and other Gram-negative
bacteria. Appl Environ Microbiol, 57, 3613-3615.
Thirumurugan, A., Ramachandran, S., Gobikrishnan, S. (2015). Optimization of
medium components for maximizing the bacteriocin production by
Lactobacillus plantarum ATM11 using statistical design. Int Food Res J,
22(3): 1272-1279.
67
Todorov, S.D., Dicks, L.M.T. (2004). Effect of medium components on bacteriocin
production by Lactobacillus pentosus ST151BR, a strain isolated from beer
produced by the fermentation of maize, barley and soy flour. World J
Microbiol Biotechnol, 20(6), 643-650.
Todorov, S.D., Dicks, L.M.T. (2005). Optimization of bacteriocin ST311LD
production by Enterococcus faecium ST311LD, isolated from spoiled black
olives. J Microbiol, 43(4), 370-4.
U.S. Federal Register (U.S. Food and Drug Administration). (1988). Nisin
preparation: affirmation of GRAS status as a direct human food ingredient. 21
CFR Part 184, Fed Reg, 53, 11247-11251.
van Belkum, M.J., Martin-Visscher, L.A., Vederas, J.C. (2011). Structure and
genetics of circular bacteriocins. Trends Microbiol, 19, 411-418.
van Belkum, M.J., Worobo, R.W., Stiles, M.E. (1997). Double-glycine-type leader
peptides direct secretion of bacteriocins by ABC transporters: colicin V
secretion in Lactococcus lactis. Mol Microbiol, 23, 1293-1301.
van der Meer, J.R., Rollema, H.S., Siezen, R.J., Beerthuyzen, M.M., Kuipers, O.P.,
de Vos, W.M. (1994). Influence of amino acid substitutions in the nisin leader
peptide on biosynthesis and secretion of nisin by Lactococcus lactis. J Biol
Chem, 269, 3555-3562.
Villarante, K.I., Elegado, F.B., Iwatani, S., Zendo, T., Sonomoto, K., de Guzman,
E.E. (2010). Purification, characterization and in vitro cytotoxicity of the
bacteriocin from Pedicoccus acidilactici K2a2-3 against human colon
adenocarcinoma (HT29) and human cervical carcinoma (HeLa) cells. World J
Microbiol Biotechnol, 27, 975-980.
WHO (2014), Antimicrobial resistance: Global report on surveillance. 254 pp
(ISBN 978 92 4 156474 8).
Wiedemann, I., Breukink, E., van Kraaij, C., Kuipers, O.P., Bierbaum, G., de
Kruijff, B., Sahl, H.G. (2001). Specific binding of nisin to the peptidoglycan
precursor lipid II combines pore formation and inhibition of cell wall
biosynthesis for potent antibiotic activity. J Biological Chem, 276, 1772-1779.
Willey, J.M., van der Donk, W.A. (2007). Lantibiotics: peptides of diverse
structure and function. Ann Rev Microbiol, 61, 477-501.
Yang, S.C., Lin, C.H., Sung, C.T., Fang, J.Y. (2014). Antibacterial activities of
bacteriocins: application in foods and pharmaceuticals. Frontiers Microbiol,
5(241), 1-10.
Yoneyama, F., Imura, Y., Ichimasa, S., Fujita, K., Zendo, T., Nakayama, J.,
Matsuzaki, K., Sonomoto, K. (2009a). Lacticin Q, a lactococcal bacteriocin,
causes high-level membrane permeability in the absence of specific receptors.
Appl Environ Microbiol, 75, 538-541.
Yoneyama, F., Imura, Y., Ohno, K., Zendo, T., Nakayama, J., Matsuzaki, K.,
Sonomoto, K. (2009b). Peptide-lipid huge toroidal pore, a new antimicrobial
mechanism mediated by a lactococcal bacteriocin, lacticin Q. Antimicrob
Agents Chemother, 53, 3211-3217.
Yoneyama, F., Ohno, K,, Imura, Y., Li, M., Zendo, T., Nakayama, J., Matsuzaki,
K., Sonomoto, K. (2011). Lacticin Q-mediated selective toxicity depending
on physicochemical features of membrane components. Antimicrob Agents
Chemother, 55, 2446-2450.
Yusuf, M.A. (2013). Lactic acid bacteria: bacteriocin producer: a mini review.
IOSR J Pharmacy, 3(4), 44-50.
Zacharof, M.P., Lovitt, R.W. (2012). Bacteriocins produced by lactic acid bacteria:
A review article. APCBEE Procedia, 2, 50-56.
Zhang, S., Mustapha, A. (1999). Reduction of Listeria monocytogenes and
Escherichia coli O157:H7 numbers on vacuum-packaged fresh beef treated
with nisin or nisin combined with EDTA. J Food Protection, 62, 1123-1127. ____________________________________________________________________________________________________________
www.philscitech.org
68
REVIEW
Acceptability, nutritional, and
potential health values of sweet
sorghum [Sorghum bicolor (L.)
Moench] coffee substitute
Sheila F. Abacan*1, Wilma A. Hurtada1, Erlinda I. Dizon2,
and Aimee Sheree A. Barrion1
1Institute
of Human Nutrition and Food, College of Human Ecology,
University of the Philippines Los Baños, College, Laguna, Philippines
2Food Science Cluster, College of Agriculture, University of the Philippines
Los Baños, College, Laguna, Philippines
Abstract—Utilization of sorghum to improve nutrition and health among Filipinos is limited due to insufficient
information from research on the crop as a source of valuable nutrients and health promoting
phytochemicals. The objective of this study was to develop an acceptable, nutritious, and healthful coffee
substitute from sweet sorghum grains. The sweet sorghum coffee substitute (SSCS) was made by combining
different roasting time of the grains (50, 60, and 70 min) at 226±5oC, powder to water ratio (16 g/250 mL-1, 24
g/250 mL-1), and brewing time (3 and 6 min). The 12 SSCS brewed samples were subjected to sensory
evaluation composed of 55 untrained coffee drinker panelist. The most acceptable SSCS and the raw
sorghum grain were analyzed for proximate composition, starch, amylose, dietary fiber, fatty acid profile,
phytochemicals (total phenols, flavonoids, tannins) and antioxidant activity. The results showed that roasting
time of the grains had a significant effect on the sensory characteristics and acceptability of the SSCS brew
while powder to water ratio and brewing time have no effect. Roasting sweet sorghum grains for 70 min at
226±5oC and brewing using the powder to water ratio of 16 g/ 250 mL-1 for 3 min produced the most
acceptable sample with characteristic dark brown color, aroma and flavor resembling “rice coffee”, and
coffee-like bitterness. This study also revealed that SSCS could be a potential health and nutritious beverage
as its powder provides energy from carbohydrates and protein, is low in fat particularly saturated fat,
contains essential fatty acids, and has dietary fiber. Moreover, SSCS powder contains phytochemicals, such
as phenols particularly flavonoids, which contribute to its high antioxidant activity. These findings suggest
that, in general, SSCS could be a beneficial in preventing diseases involving oxidative stress and chronic
diseases.
Keywords—antioxidants, coffee substitute, nutrition, phytochemicals, sweet sorghum
INTRODUCTION
Sweet sorghum [Sorghum bicolor (L.) Moench], a multipurpose crop, is used
as food, feed, forage and source of fuel. Its grains can be a staple food to people
while its leaves can be forage for animals (ICRISAT 2012). Over the past decade,
world sorghum production has risen from 60 to 65 million metric tons (US Grains
Council 2013) with the United States, Argentina and Australia as top exporters,
accounting to 93 to 97 percent of total world exports. In the Philippines, the high
demand of ethanol for blending with petrol (gasoline) with sweet sorghum as biofuel source has necessitated large-scale production of this crop (Layaoen et al.
Submitted: June 15, 2014
Revised: January 3, 2015
Accepted: March 1, 2015
Published: November 1, 2015
2011). The North Luzon Super Region (Cordillera Administrative Region, Ilocos,
Cagayan Valley and Central Luzon) has been identified as a suitable area for this
purpose. The stem of sweet sorghum is known to produce high yields of syrup
which is used as the primary feedstock in bio-fuel production. Although the grains
can be processed and utilized as food, sweet sorghum, however, is not popular
consumed as such in the country. Consequently, its multifaceted potential, to a
large degree, remains untapped.
Sorghum offers not only nutritional benefits but also health advantage to
human as it contains a wide range of phytochemicals. Research aimed on
unlocking information regarding valuable health-promoting phytochemical lags
behind other commodities like fruits and vegetables. As a result, utilization of
sorghum in improving nutrition and health among Filipinos is limited.
____________________________________________________________________________________________________________
www.philscitech.org
69
Phytochemicals are bioactive non-nutrient plant compounds in fruits,
vegetables, grains, and other plant foods that have been linked to reducing the risk
of major chronic diseases (Liu 2003). A diet rich in sorghum has a beneficial effect
against diseases with uncontrolled free radical production (Kamath et al. 2004).
According to Awika and Rooney (2004), sorghum is a good source of many
phytochemicals including tannins, phenolic acids, anthocyanins, phytosterols and
policosanols. Sorghums also contains higher amount of polyphenols compared to
wheat, barley, millet or rye, and maize (Ragaee et al. 2006; Bravo 1998).
min, 0.3 mL-1 of 10% AlCl3 was added; and at 6 min, 2.0 mL-1 of 1 M NaOH
was added. Each reaction flask was immediately diluted with 2.4 mL-1 of distilled
water and was mixed. Upon the development of pink color, absorbance of the
mixtures was determined at 510 nm relative to the prepared blank. The total
flavonoid content was expressed as milligrams of quercetin equivalents per 100
gram of dry sample weight (mg of QE/100 g) using the calibration curve of (±)quercetin.
Hot beverages, like coffee, are very popular among Filipinos. However,
caffeine-sensitive individuals and other persons that refrain from taking caffeinated
beverages resort to consuming coffee substitutes. Coffee substitutes are the parts of
roasted plants that are made into a product, which when added with hot water,
provides a coffee-like brew. They serve likewise as a coffee blend. Coffee
substitutes, such as the coffee brew made of chicory or clear drinks prepared from
roasted cereals (Belitz et al. 2009), have been in the market for a long time. Some
common coffee substitutes are made from grains such as rye and barley.
Nonetheless, the potential of sweet sorghum as coffee substitute has yet to be
thoroughly explored. With its nutritional and health benefits, developing coffee
substitute from sweet sorghum grains may increase the crop’s utilization in the
country.
Total tannin was determined using the modified Vanillin Assay (Price 1978).
Fifty (50) mg of sample was mixed with 5.0 mL-1 of absolute methanol. An
aliquot, 1.0 mL-1 of the sample extract was mixed with 5.0 mL-1 of vanillin reagent
in a test tube. The mixture was held for 20 minutes at room temperature. The
absorbance was read at 500 nm. The tannin content was expressed as milligrams
vanillin equivalents per 100 gram of dry sample weight (mg of VE/100 g) using
the calibration curve of (±)-vanillin.
The aims of the present study were: to evaluate the acceptability of the brew
made from the different treatment of sweet sorghum coffee substitute and to
determine the nutritional and phytochemical contents, as well as antioxidant
activity, of the sweet sorghum grains and the most acceptable coffee substitute
powder.
Whole sweet sorghum [S. bicolor (L.) Moench var SPV 422] grain purchased
from a commercial farm in Batac, Ilocos Norte, was utilized in making the coffee
substitute powder. The brewed sweet sorghum coffee substitute (SSCS) were
subjected to sensory evaluation. The most acceptable SSCS sample and the raw
sorghum grain were analyzed for proximate content, total phenolic, total flavonoid,
and tannin contents, as well as total antioxidant activity and fatty acid profile.
Sample Preparation
Sweet sorghum grains were dried, ground, and roasted at 226±5oC.
Afterwards, the powdered sorghum (<0.420 mm) was roasted using convection
oven (La Germania Model M64C71X) at durations of 50, 60, and 70 minutes. The
effects of proportion of powder to water and of brewing time were also tested. The
roasted sorghum powder was brewed using two different powder-to-water
proportions: 16 g powder in 250 mL-1 water and 24 g powder in 250 mL-1 water,
then brewed for 3- and 6-minute durations.
A simple steeping method was used in the preparation of the brew. Hot
distilled water at 92±2 oC and 10 g of white granulated sugar were mixed with the
powder on a glass pitcher. The mixture was stirred, covered, and left to steep for
duration of 3 and 6 minutes. The resulting brewed samples were filtered using
coffee filter (Brew Rite® #2). The samples were contained on a 1.6 L-single
thermal pots and kept at the minimum serving temperature of 70 oC.
Sensory Evaluation
Sensory acceptability test using Hedonic scale was conducted to determine
the most acceptable SSCS from the combinations of different variables, namely
roasting time, powder to water proportion, and length of brewing time. Fifty five
(55) untrained panelists, all coffee drinkers, from faculty members and staff of the
University of the Philippines Los Baños (UPLB) evaluated 12 brew samples.
Two sessions were conducted, with the same environmental conditions, to
evaluate the characteristics and acceptability of all samples. For each session, six
(6) samples were evaluated by the panel. The samples were presented on a tray in
order of increasing flavor strength. Each sample was coded with 3 randomized
numbers. Thirty (30) mL of each sample was served on 1.5-ounce transparent
jigger at minimum temperature of 70oC. Distilled water was provided for each
panelist for mouth rinsing between samples. Sensory attributes of the sweet
sorghum coffee substitute such as color, aroma, taste, and its general acceptability
was rated using a 7-point Hedonic scale (7-like extremely, 1-dislike extremely)
adopted from the study of Naggers et al. (2011).
Determination of nutrient composition
Total Tannin Content
2, 2-diphenyl-1-pierylhydrazyl (DPPH) scavenging activity
The total free radical scavenging capacity of soghum-methanolic extract was
estimated by the DPPH using the modified method of Shimada et al. (1992). One
(1) mL-1 of the extract was adjusted to 5 mL volume with the addition of distilled
water. Freshly prepared, 1 mL-1 DPPH solution (0.1 mM in absolute methanol) was
mixed with the extract. The reaction mixture was shaken well and held for 30 min
at room temperature, and the absorbance of the resulting solution measured at 517
nm against a reagent blank. The radical scavenging activity was measured as a
decrease in the absorbance of DPPH, and expressed as percent radical quenching
compared to that without the extracts.
Statistical Analysis
The sensory evaluation followed a factorial in completely randomized design
(CRD) with three (3) factors namely roasting temperature for 50, 60, and 70 min
duration; powder to water ratio (16 g/250 mL-1, 24 g/250 mL-1); and brewing time
(3 and 6 min). Data from the sensory evaluation were analyzed using the KruskalWallis test and the Wilcoxon Two-Sample Test through the Statistical Analysis
System (SAS) program version 9.1 (SAS – Cary, NC, USA). Moreover, t-test was
used to determine the difference in nutrient and phytochemical composition of the
raw sweet sorghum grain and SSCS. Three replications were used. On the other
hand, Spearman correlation analysis was used to determine the relationship
between phytochemical contents and antioxidant activity of the raw sweet sorghum
grains and SSCS. A probability value of p<0.05 was considered significant among
the tests.
Sensory evaluation of the SSCS brew
Prolonging roasting time from 50 to 70 min with 10-min intervals influenced
the scores for color, aroma, flavor, bitterness, and general acceptability of the
brewed SSCS (Table 1). However, powder to water ratio and brewing time showed
no significant effect on the attributes of the SSCS brew. In terms of roasting time,
the 70-min roasted samples gained the highest acceptability for all sensory
attributes. The acceptability ratings varied from ‘like slightly’ to ‘like very much’
for color (5.29-5.90) and aroma (5.04-5.47). Bitterness (4.53-5.15), flavor
(4.56-5.27), and general acceptability (4.75-5.38) had a varied rating from ‘neither
like’ or ‘dislike’ to ‘like very much’. The brew has the characteristics of dark
brown color, an aroma and flavor resembling “rice coffee”, and a coffee-like
bitterness.
In order to make an acceptable sweet sorghum coffee substitute, the study
suggests that the grains should be roasted for 70 min at 226±5oC and brew using
the powder to water ratio of 16 g/ 250 mL-1 for 3 minutes.
TABLE 1. Evaluation ratings for the characteristics of brewed sweet sorghum
samples.1,2
Roasting
(min)
16
50
24
Proximate analysis, starch, and amylose content were analyzed at the Institute
of Human Nutrition and Food, UPLB. Fatty acid profile was analyzed by the Food
and Nutrition Research Institute, Department of Science and Technology (FNRIDOST).
Total phenolic content
Total phenolic content was measured by the Folin–Ciocalteu method (Oyaizu
1986), with some modifications. The absorbance was measured using a UV–vis
spectrophotometer at 710 nm against a reagent blank. The total phenolic content
was expressed as milligrams of catechin equivalents per 100 gram of dry sample
weight (mg of CE/100 g) using the calibration curve of (±)-catechin.
16
60
24
16
70
Total flavonoid content
The total flavonoid concentration was measured using a calorimetric assay
developed by Zhishen et al. (1990). One (1) mL-1 of appropriately diluted sample
was added to a 10 mL-1 volumetric flask containing 4 mL-1 of diluted water. At
time zero, 0.3 mL-1 of 5% NaNO2 was added to each volumetric flask; then at 5
Powder:Water
(g/250 mL-1)
24
Sensory Characteristics
Brewing
(min)
Color
Aroma
3
3.44c
6
3.40c
Bitterness
General
Acceptability
4.20c 3.95b
3.65b
3.84c
3.91c
3.78b
3.71b
3.84c
3
3.89c
4.67c
4.27b
4.27b
4.53c
6
4.00c
4.67c
4.44b
4.49b
4.65c
3
4.56b
4.56b 4.75a
4.55a
4.65b
6
4.95b
4.85b 4.80a
4.73a
4.84b
3
5.04b
5.20b
4.62a
4.64a
4.91b
6
5.35b
5.18b
5.09a
5.02a
5.13b
3
5.90a
5.47a
5.24a
5.15a
5.35a
6
5.89a
5.47a 5.27a
5.11a
5.38a
3
5.29a
5.05a 4.84a
4.62a
4.82a
6
5.27a
5.04a 4.56a
4.53a
4.75a
Flavor
1Taste
panel scores (n=55) based on a 7-point hedonic scale, where 1-dislike extremely 2-dislike very much 3dislike slightly 4-neither liked nor dislike 5-like slightly 6-like very much 7-like extremely
2Means with different superscripts within a column is significantly different (p<0.05).
____________________________________________________________________________________________________________
www.philscitech.org
70
TABLE 2. Proximate composition of raw sweet sorghum grains (RSSG) and sweet
sorghum coffee substitute (SSCS) powder (per 100g, dry basis).1
TABLE 4. Fatty acid composition of raw sweet sorghum grains (RSSG) and sweet
sorghum coffee substitute (SSCS) powder (g/100g).1
Sample
Moisture
(%)
Crude Fat
(%)
Crude
Protein (%)
Crude
Fiber (%)
Total Ash
(%)
NFE2 (%)
Fatty Acids
RSSG
SSCS
RSSG
11.74±0.16a
3.65±0.35a
9.65±0.25a
2.70±0.00a
1.33±0.03a
70.93±0.19b
Saturated fat
0.72±0.05
0.64±0.08
SSCS
10.52±0.05b
0.78±0.03b
8.33±0.30b
2.52±0.31a
2.00±0.01a
75.85±0.12a
Palmitic (C16)
0.65±0.04
0.58±0.08
Steric (C18)
0.07±0.00
0.06±0.01
Oleic (C18:1)
1.12±0.08
1.14±0.18
Linoleic (C18:2)
0.99±0.08
1.47±0.24
Linolenic (C18:3)
0.03±0.00
0.07±0.01
1Data
are expressed as mean±standard deviation (n=3) on a dry weight basis. Means in each column followed by
different superscripts are significantly different (p<0.05).
(Nitrogen Free Extract)
2NFE
Proximate composition
Raw grain has significantly higher amount of moisture, crude fat, and protein
compared to the SSCS (Table 2). The raw sweet sorghum grains contain 11.74 %
moisture, 3.65 % fat, 9.65 % protein, 2.70 % fiber, 1.33 % ash, and 70.93 %
carbohydrates while the SSCS contains 10.52 % moisture, 30.78 % fat, 8.33 %
protein, 2.52 % fiber, 2.00 % ash, and 75.85 % carbohydrates. This shows that
roasting reduced moisture, fat, and protein of the sweet sorghum grain. Moisture
within food is reduced with the application of dry heat method such as roasting.
According to Kayiteshi et al. (2012), heat application decreases fat as heating
disrupts lipid bodies allowing the oil to be more readily expelled. The decrease in
protein content of the roasted sweet sorghum could possibly be due to the partial or
complete denaturation of protein due to heat during roasting. This result was also
observed in roasted mangrove legume seed of Seena et al. (2008) and on maize of
Oboh et al. (2010). On the other hand, the increased NFE in the SSCS powder
could be due to the evaporation of water during roasting thereby increasing the
concentration of the carbohydrate in the sample. NFE is used to estimate the
carbohydrate content of the sample which is calculated by subtracting the average
of each of the other components (% crude protein, crude fat, crude fiber, moisture
and ash) from 100 (AAFCO 2013). In contrast, data showed that roasting has no
effect on ash and crude fiber content.
Starch, amylose, and dietary fiber
The values recorded for amylose and dietary fiber of SSCS were significantly
lower (p<0.05) than that of the raw sorghum grain (Table 3). On the other hand,
starch content significantly increased by 2% in SSCS. The increase in starch may
be attributed to the evaporation of water during roasting, increasing the
concentration of the starch in the sample.
TABLE 3. Starch, amylose, and dietary fiber content of sweet sorghum grain
(RSSG) and sweet sorghum coffee substitute (SSCS) powder
(per 100g, dry basis).1
Sample
Starch (%)
Amylose (%)
Dietary Fiber (%)
RSSG
73.27±0.18b
24.03±0.86a
2.68±0.03a
SSCS
75.69±0.28a
16.44±0.65b
2.50±0.02b
1Data
are expressed as mean ± standard deviation (n=2) on a dry weight basis. Data presented were not significantly
different at p<0.05.
Fatty acid profile
Raw sweet sorghum and SSCS powder contain saturated fat, which is mainly
composed of palmitic and stearic fatty acids (Table 4). Oleic, linoleic, and linolenic
are the unsaturated fatty acids detected in both raw sweet sorghum and SSCS.
Sajid et al. (2008) found out that the principal fatty acid components in the
sorghum seed oils were palmitic, linoleic, and oleic acids and majority of the
sorghum varieties contain linoleic acid as a major unsaturated fatty acid. Sorghum
and corn have similar fatty acid composition but the former has more unsaturated
fats (Rooney 1978). Oils being the source fatty acids are important in human body,
particularly the linoleic and linolenic, as it cannot produce them. However,
saturated fatty acids particularly lauric, myristic, and palmitic, are found to raise
blood cholesterol levels (Salter and White 1996). On the contrary,
monounsaturated fat, such as oleic acid, lowers blood levels of low density
lipoprotein (LDL) cholesterol (Thomsen et al. 1999). In addition, omega-6 fatty
acids or linoleic acid and omega-3 fatty acid or linolenic acid also help in lowering
blood cholesterol and prevents heart disease (Von Schacky 2000, Willet 2007).
Willet (2007) stated that adequate intakes of both omega-6 and omega-3 fatty acids
are essential for good health and will lower the rates of cardiovascular disease and
type 2 diabetes. Sajid et al. (2008) suggested that the S. bicolor seed oils may serve
as potential dietary source of monounsaturated and polyunsaturated fatty acids.
There was no significant change found in fatty acid composition of the raw
sorghum grain and SSCS upon roasting. Although fats are degraded when
subjected to high temperature on roasting, the effect could possibly be
counterbalanced by the evaporation of water in the sample. Thus, no apparent
differences were observed in the amount of the fatty acids detected in the sorghum
grain and SSCS powder.
Phytochemicals and antioxidant activity
1Data
The raw sweet sorghum grain used in this study has amylose content of
24.03±0.86 % which fell under intermediate amylose content (20-25%) based on
IRRI amylose content classification for rice (IRRI 2006). The SSCS yielded
16.44±0.65 % of amylose classified under low amylose (<20%) (IRRI 2006). The
decrease in amylose in SSCS could be due to the high temperature (226±5oC) used
in roasting the grains. The amylose may have undergone degradation resulting to
shorter amylose molecules with reduced iodine binding capacity thereby lowering
the overall apparent amylose content of starches (Htoon et al. 2009).
The established dietary fiber content of raw sweet sorghum grain was
2.68±0.03 %, which is higher than that of raw corn and rice (FNRI 2002). Dietary
fiber is important as it appears to reduce the risk of developing heart disease
(Rimm et al. 1996), diabetes (Fung et al. 2002) and diverticular disease (Aldoori et
al. 2002). Fiber also helps in preventing constipation parallel with increased water
intake. It also aids in weight control as it adds bulk to the diet, provides satiety and
delays hunger (Whitney et al. 2002). The calculated dietary fiber content of SSCS
was lower than the raw sweet sorghum grain. Kutos et al. (2003) have reported that
thermal processing decreased the insoluble fiber content, and consequently the total
dietary fiber content of beans (Phaseolus vulgaris L.). Increased temperature leads
to a breakage of weak bonds between the polysaccharide chains of the dietary fiber.
Likewise, the glycosidic linkages in the dietary fiber polysaccharides may be
broken (FAO 1998).
The SSCS contains higher amount of total phenols, flavonoids and tannins
than the raw sweet sorghum grain (Table 5). The raw sweet sorghum grains contain
8.29 mg VE/100g tannins, 15.79 mg CE/100g phenols, and 10.46 mg QE/100g
flavonoids while the SSCS contains 21.18 mg VE/100g tannins, 30.63 mg CE/100g
phenols, and 28.49 mg QE/100g flavonoids. In the study of Gallegos-Infante et al.
(2010), roasting barley extracts increased its total phenolic content when compared
to the unprocessed barley. This clearly showed that roasting aids in increasing the
amount of the phytochemicals being studied. Dewanto et al. (2002) reported that
thermal processing may release bound phenolics from cellular constituents. Major
phenolic acids in sorghum can be derivatives of benzoic or cinnamic acid (Hahn et
al. 1983). Wu et al. (2012) identified ferulic acid and p-coumaric acid to be the
most abundant phenolic acids in sorghum grain. Clifford (2000) indicated that
cinnamic acids, such as caffeic, ferulic and p-coumaric acids, are generally found
in a conjugate form and are released after a hydrolysis process such as that
produced during thermal treatment. Free cinnamic acids can be further
decarboxylated and degraded to several types of simple phenolics (Galvez-Ranilla
et al. 2009). These findings could further explain the increase in total phenolic
content of sweet sorghum when roasted to produce SSCS.
TABLE 5. Phytochemical content and total antioxidant of raw sweet sorghum
grains (RSSG) and sweet sorghum coffee substitute (SSCS) powder.1
Sample
Tannins mgVE/
100g)
Phenols (mgCE/
100g)
Flavonoid (mg QE/
100g)
Total Antioxidant (% DPPH2
Scavenging Activity)
RSSG
8.29±0.11b
15.79±0.36b
10.46±0.34b
13.01±0.31b
SSCS
21.18±0.35a
30.63±0.60a
28.49±0.1.30a
91.25±0.15a
1Data
2 diphenyl-1-picrylhydrazyl
2DPPH-2,
____________________________________________________________________________________________________________
www.philscitech.org
In this study, DPPH was used to evaluate antioxidant activity. When DPPH
encounters a proton-donating substance such as an antioxidant, the radical is
scavenged and the absorbance is reduced. Thus, the antioxidant capacity of the
sweet sorghum grain and SSCS can be expressed as its ability in scavenging the
DPPH free radical. The DPPH radical scavenging activity of SSCS is higher than
that of the raw sweet sorghum grain (Table 5). This suggests that the roasting
process enhances the antioxidant activity in sweet sorghum. Although roasting
enhances antioxidant activity in the SSCS, prolonging the roasting process might
not be beneficial in increasing the antioxidant activity. Intense roasting could result
in the degradation of polyphenols (Sachetti et al. 2009).
Total phenols and flavonoids were significantly correlated (r=0.8407) with the
DPPH radical-scavenging activity with the same correlation coefficient, r, of
0.8407 (Table 6). This shows that high amounts of total phenols and flavonoids
contributed to high antioxidant activity of the sweet sorghum grain and SSCS. A
study on malting barley varieties by Zhao et al. (2008) reported that the total
phenolic content of barley was significantly correlated with the antioxidant
capacity, as measured by the DPPH and ABTS assays. Similarly, tannins showed a
strong positive correlation with the antioxidant activity but which was significant
at a lower probability value (r=0.7059, p = 0.1170). Tannins are one among the
flavonoids that constitute the total flavonoid content of sweet sorghum.
TABLE 6. Correlation coefficients of total phenols, flavonoids, tannings and 2, 2
diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity.
DPPH Radical-Scavenging Activity
Correlation coefficient ( r )1
p-value
Total phenols
0.8407
0.0361
Flavonoids
0.8407
0.0361
Tannins
0.7058
0.1170
1Significant
at p < 0.05 (two-tailed, Spearman rho).
In general, the role of antioxidants is to terminate the chain reactions by
removing free radical intermediates and to inhibit other oxidation reactions (Sies
1997). Thus, SSCS could be a beneficial product in preventing diseases that
involves free radical production. These diseases include neurodegenerative
disorders such as Alzheimer’s and Parkinson’s, and chronic diseases such as
cancer, cardiovascular diseases, cataract and inflammation (Temple 2000).
CONCLUSION
A SSCS brew with dark brown color, “rice coffee”-like aroma and flavor, and
coffee-like bitterness was found acceptable. The study also revealed that SSCS
could be a potential health and nutritious beverage as its powder contains
carbohydrates, protein, essential fatty acids, dietary fiber, and is low in fat,
particularly saturated fat. Moreover, the SSCS powder contains phytochemicals
contributing to its high antioxidant activity. These findings suggest that
consumption SSCS may help in preventing diseases in which free radical
production plays a key role.
ACKNOWLEDGEMENTS
The authors would like to acknowledge the Department of Science and
Technology-Science Education Institute (DOST-SEI) and the Commission on
Higher Education (CHED) for their financial support in this study.
The authors declare no conflict of interest.
Sheila F. Abacan is the lead author of the study. She prepared the proposal,
developed the coffee substitute from sweet sorghum grains, performed chemical
analyses, interpreted the results, and wrote the paper for her MS thesis.
Dr. Wilma A. Hurtada is the chair of the advisory committee of the lead
author. She provided guidance in the preparation of the proposal and
accomplishments of the study.
Dr. Erlinda I. Dizon and Dr. Aimee Sheree A. Barrion are members of the
guidance committee of the lead author. They provided essential inputs in the
development of the proposal and the final paper.
REFERENCES
Aldoori WH, Giovannucci EL, Rockett HR, Sampson L, Rimm EB, Willett WC. A
prospective study of dietary fiber types and symptomatic diverticular disease
in men. J Nutr 1998; 128:714-9.
AOAC [Association of Official Agricultural Chemists]. Method 991.39, Fatty
Acids in Encapsulated Fish and Fish Oil Methyl and Ethyl Esters. Gas
71
Chromatographic Method. 18th Ed. Gaithersburg, MD:AOAC Int.,
2005:21-24.
Awika JM, Rooney LW. Sorghum phytochemicals and their potential impact on
human health. Phytochemistry 2004; 65(9): 1199–221.
Belitz HD, Grosch W, Schieberle P. Food Chemistry. 4th ed. Berlin Heidelberg:
Springer-Verlig, 2009: 949.
Bravo L. Polyphenols: Chemistry, dietary sources, metabolism, and nutritional
significance. Nutr. Rev 1998; 56: 317–333.
Clifford MN. Cholorogenic acids and other cinnamates – Nature, occurrence,
dietary burden, absorption and metabolism. J Sci Food Agric 2000; 80(7):
1033–1043.
Dewanto V, Wu X, Liu RH. Processed sweet corn has higher antioxidant activity. J.
Agric. Food Chem 2002; 50: 4959 – 4964.
FAO [FOOD AND AGRICULTURE OFFICE. Carbohydrates in Human Nutrition.
Retrieved September 10, 2013, from World Wide Web: http://www.fao.org/
docrep/W8079E/W8079E00.htm
FNRI [Food and Nutrition Research Institute]. The Philippine Food Composition
Table. Manila, Philippines:FNRI-DOST Foundation, 1997:1-13.
Fung TT, Hu FB, Pereira MA, Liu S, Stampfer MJ, Colditz GA, Willett WC.
Whole-grain intake and the risk of type 2 diabetes: a prospective study in
men. Am J Clin Nutr 2002; 76:535-40.
Gallegos-Infante JA, Rocha-Guzman NE, Gonzalez-Laredo R F, Pulido-Alonso J.
Effect of processing on the antioxidant properties of extracts from Mexican
barley ( Hordeum vulgare ) cultivar. Food Chem 2010; 119(3), 903–906.
Galvez-Ranilla L, Genovese MI, Lajolo F. Effect of different cooking conditions
on phenolic compounds and antioxidant capacity of some selected Brazilian
bean (Phaseolus vulgaris L.) cultivars. J Agric Food Chem 2009; 57(13):
5734–5742.
Hahn DH, Rooney LW, Faubion JM. Sorghum phenolic acids, their HPLC
separation and their relation to fungal resistance. Cereal Chem 1983; 60:255–
259.
Htoon A, Shrestha AK, Flanagan BM, Lopez-Rubio A, Bird AR, Gilbert EP, Gidley
MJ. Effects of processing high amylose maize starches under controlled
conditions on structural organisation and amylase digestibility. Carbohydr
Polym 2009; 75 (2):236-245.
ICRISAT [International Crops Research Institute for the Semi-Arid Tropics].
Sorghum (Sorghum bicolor (L.) Moench). Retrieved August 7, 2012, from the
World Wide Web: http://www.icrisat.org/crop-sorghum.htm
IRRI [International Rice Research Institute].2006. Breeding program management.
Retrieved September 12, 2013 from the World Wide Web: http://
www.knowledgebank.irri.org/ricebreedingcourse/Grain_quality.htm
Kayitesi E, De Kock HL, Minnaar A, Duodu KG. Nutritional quality and
antioxidant activity of marama–sorghum composite flours and porridges.
Food Chem 2012; 131(3):837–842.
Kutoš T, Golob T, Kač M, Plestenjak A. Dietary fibre content of dry and processed
beans. Food Chem 2003; 80(2):231–235.
Layaoen H, Reddy BVS, Dar WD, Srinivasa Rao P and Eusebio JE. 2011. Sweet
Sorghum in the Philippines: Status and Future.Patancheru 502 324, Andhra
Pradesh, India: International Crops Research Institute for the Semi-Arid
Tropics. 116 pp.
Liu RH.Health benefits of fruits and vegetables are from additive and synergistic
combination of phytochemicals. Am. J. Clin. Nutr 2003; 78:517S–520S.
Nagares NDL, Hurtada WA, Rodriguez FM, Dizon EI. Nutritional value, physicochemical properties and acceptability of rice (Oryza sativa L )-corn (Zea mays
L.) composites. Asia Life Sci. 2011; 20 (1):199-214.
Oboh G, Ademiluyi AO, Akindahunsi AA. The effect of roasting on the nutritional
and antioxidant properties of yellow and white maize varieties. Int J Food Sci
2010; 45(6):1236–1242.
Oyaizu M. Studies on products of browning reactions: Antioxidative activities of
browning products of browning reaction prepared from glucosamine. Jpn J
Nutr. 1986;44: 307–315.
Price ML, Butler LG. Rapid visual estimation and sphectrophotometric
determination of tannin content of sorghum grain. J. Agric. Food Chem. 1977;
25:1268-1273.
Ragaee S, Abdel-Aal EM, Noaman M. Antioxidant activity and nutrient
composition of selected cereals for food use. Food Chem 2006; 98:32–38.
Reddy BVS, Ramesh S, Reddy PS, Kumar AA, Sharma KK., Chetty Smk,
Palaniswamy AR. 2006. Sweet Sorghum: Food, Feed, Fodder, and Fuel Crop.
ICRISAT. Retrieved August
10, 2012 from the World Wide
Web:www.icrisat.org
Rimm EB, Ascherio A, Giovannucci E, Spiegelman D, Stampfer MJ, Willett WC.
Vegetable, fruit, and cereal fiber intake and risk of coronary heart disease
among men. J Am Med Assoc 1996; 275:447-51.
Rooney, L.W. 1978. Sorghum and pearl millet lipids. Cereal Chem 55:584-590.
Sacchetti G, Di Mattia C, Pittia P, Mastrocola D. Effect of roasting degree,
equivalent thermal effect and coffee type on the radical scavenging activity of
coffee brews and their phenolic fraction. J Food Eng 2009; 90:74–80.
Sajid, M, Ilkay O, Zaheer A, Sinem A, Muhammad G. Fatty acid composition of
seed oil of different Sorghum bicolor varieties. Food Chem 2008; 109(4):
855-859
Salter AM, White DA. Effect of dietary fat on cholesterol metabolism: Regulation
of plasma LDL concentrations. Nutr Res Rev 1996; 9:241–257.
Seena S, Sridhar KR., Arun AB, Young C. Effect of roasting and pressure-cooking
on nutritional and protein quality of seeds of mangrove legume Canavalia
cathartica from southwest coast of India. J Food Com Anal 2006; 19:284–
293.
Seis H. Oxidative stress: oxidants and antioxidants. Exp Physiol. 1997;82(2):
291-5.
Shimada, K, Fijikawa, K, Yahara, K, and Nakamura, T. Antioxidative properties of
____________________________________________________________________________________________________________
www.philscitech.org
xanthan on the autooxidation of soybean oil in cyclodextrin emulsion. J.
Agric. Food Chem. 1992; 40:945-948.
Temple MJ. Antioxidants and disease: more questions than answers. Nutrition
Research. 2000; 20:449–459.
Thomsen C, Rasmussen O, Lousen T, Holst Jj, Fenselau S, Schrezenmeir, J,
Hermansen K. 1999. Differential effects of saturated and monounsaturated
fatty acids on postprandial lipemia and incretin responses in healthy subjects.
Am J Clin Nut 69(6):1135–43.
United States Grains Council. 2013. World Sorghum Production and Exports.
Retrieved July 12, 2013 from the World Wide Web: http://www.grains.org/
index.php/news-and-events/chart-of-the-week/3673-world-sorghumproduction-and-exports
Von Schacky C. 2000. N-3 Fatty Acids and the Prevention of Coronary
Atherosclerosis. Am J Clin Nut 71(1 Suppl):224S–7S.
72
Whitney EN, Cataldo CB, Rolfes SR.2002.Understanding Normal and Clinical
Nutrition Textbook . 6th ed. Canada:Wadsworth Group. 97-99, 140145 pp.
Willet HS. 2007. Omega-3 fatty acids and cardiovascular disease: A case for
omega-3 index as a new risk factor. Pharmacological Res. 55(3):217-223.
Wu L, Huang Z, Qin P, Ren G. Effects of processing on phytochemical profiles and
biological activities for production of sorghum tea. Food Research
International. 2012; 53 (2): 678-685.
Zhishen J, Mengcheng T, Jianming W. The determination of flavonoid contents in
mulberry and their scavenging effects on superoxide radicals. Food Chem.
1999; 64: 555-559.
Zhao H, Fan W, Dong J, Lu J, Chen J, Shan L, Lin Y, Kong W. Evaluation of
antioxidant activities and total phenolic contents of typical malting barley
varieties. Food Chem. 2008; 107:296–304. ____________________________________________________________________________________________________________
www.philscitech.org
73
SHORT COMMUNICATION
Assessment of bacterial species present
in Pasig River and Marikina River soil
using 16S rDNA phylogenetic analysis
Maria Constancia O. Carrillo*, Paul Kenny L. Ko,
Arvin S. Marasigan, and Arlou Kristina J. Angeles
Department of Physical Sciences and Mathematics, College of Arts and
Sciences, University of the Philippines Manila, Padre Faura St., Ermita,
Manila Philippines 1000
Abstract—The Pasig River system, which includes its major tributaries, the Marikina, Taguig-Pateros, and
San Juan Rivers, is the most important river system in Metro Manila. It is known to be heavily polluted due
to the dumping of domestic, industrial and solid wastes. Identification of microbial species present in the
riverbed may be used to assess water and soil quality, and can help in assessing the river’s capability of
supporting other flora and fauna. In this study, 16S rRNA gene or 16S rDNA sequences obtained from
community bacterial DNA extracted from riverbed soil of Napindan (an upstream site along the Pasig River)
and Vargas (which is along the Marikina River) were used to obtain a snapshot of the types of bacteria
populating these sites. The 16S rDNA sequences of amplicons produced in PCR with total DNA extracted
from soil samples as template were used to build clone libraries. Four positive clones were identified from
each site and were sequenced. BLAST analysis revealed that none of the contiguous sequences obtained
had complete sequence similarity to any known cultured bacterial species. Using the classification output of
the Ribosomal Database Project (RDP) Classifier and DECIPHER programs, 16S rDNA sequences of
closely related species were collated and used to construct a neighbor-joining phylogenetic tree using
MEGA6. Six out of the 8 cloned samples were found to belong to obligate anaerobe species, suggesting
that these species live deep within the sediment layer and do not have access to dissolved oxygen. Three
species were found to be associated with sulfate-reducing bacteria, which suggests an abundance of sulfur
containing compounds in the riverbed. This is the first census report of the Pasig River microbial population
using an approach that utilizes 16S rDNA sequences without culture nor isolation of bacteria. Further studies
employing multiple composite samples and larger sample sizes are recommended for more comprehensive
bacterial taxonomic profiles as well as evaluation of interactions between community members and bacterial
response to environmental perturbations.
Keywords—16S rDNA, metagenomics, Pasig River system, DNA sequence analysis, molecular phylogeny
INTRODUCTION
The Pasig River system (Figure 1) is the major river system in Metro Manila
and is composed of the Pasig River, Marikina River, Taguig-Pateros River, and San
Juan River. The principal river, the Pasig River, traverses the width of Metro
Manila and connects Laguna de Bay and Manila Bay. Due to its location and reach,
the river has traditionally been an important means of transport for city dwellers, as
well as a water source for domestic and industrial use. However, the Pasig River
and all three tributaries are heavily polluted due to the dumping of domestic waste,
and industrial waste from tanneries, textile mills, food processing plants, and
distilleries. The Department of Environment and Natural Resources classifies the
rivers under class D status, which means that river water may be used only for
agricultural applications such as irrigation and livestock watering, and secondary
Revised: July 16, 2015
Accepted: September 23, 2015
Published: November 14, 2015
industrial applications like cooling. In recent years, the riverbed has become more
silted with organic matter and non-biodegradable garbage (Gorme et al. 2010).
Water-saturated sediments make up the bulk of biomass in a river
environment (Fischer and Pusch 2001), usually in the form of microbial biofilms.
These microbes are responsible for the bulk of metabolic activity in river and
stream ecosystems, and 76–96% of total respiration (Craft et al. 2002; Naegeli and
Uehlinger 1997; Pusch 1997; Pusch et al. 1998; Vaque et al. 1992). Bacterial
growth in this environment is dependent on physico-chemical traits, such as
temperature, salinity, pH, as well as presence of pollutants. Fluctuations in these
conditions may result to either an increase or decrease of bacterial growth and may
also result in drastic changes in bacterial populations (Daniel 2005; Fierer et al.
2007; Hidayat et al. 2012). Identification of microbial species present in the
riverbed may be used to assess water and soil quality, and may also help in
assessing a river’s capability of supporting other flora and fauna. Although soil
microbial communities are known to possess incredible diversity with tens of
thousands of species of bacteria and fungi in a gram of soil, they have remained
poorly characterized (Kristiansson et al. 2011). This is due not only to often low
____________________________________________________________________________________________________________
www.philscitech.org
concentrations of each bacterial species present (Engel et al. 2010; Myrold et al.
2014), but also to the difficulty in isolating and culturing individual species.
74
PCR primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’GGTTACCTTGTTACGACTT-3’) were used to amplify targeted 16S rDNA of the
genomic DNA extracted from soil samples. The PCR reaction mixture contained 1
µL of genomic DNA and both primers, and 2X Taq Master Mix (Vivantis).
Amplification conditions were as follows: initial denaturation at 94ºC for 5
minutes, followed by 35 cycles of denaturation (94ºC, 1 minute), annealing (54ºC,
1 minute), and extension (72ºC, 1 minute 45 seconds), ending with a final
extension at 72ºC for 5 minutes. Amplicon size and quality were assessed by 1%
agarose gel electrophoresis.
Amplicons were ligated into pCR™2.1-TOPO® vectors using Invitrogen
TOPO® TA Cloning® kit (California, USA) and the ligation mixtures were used to
transform competent E. coli cells using heat shock process, following the
manufacturer’s protocol. Randomly picked transformants were screened for the
presence of cloned 16S rDNA using colony-PCR with M13 forward (5’GTAAAACGACGGCCAG-3’) and reverse (5’-CAGGAAACAGCTATGAC-3’)
primers. Amplification followed a similar temperature profile as 16S rDNA
amplification from the previous step except for the initial denaturation being set to
10 minutes and the annealing temperature at 55ºC. The presence of cloned 16S
rDNA amplicons was assessed using 1% agarose gel electrophoresis.
DNA sequencing and Data Analysis
Figure 1. Map of Pasig River and its tributaries. The two sampling sites,
Napindan/C6, which is along Pasig river, and Vargas, which is along
Marikinina River, are indicated by black circles (Map courtesy of the Pasig
River Rehabilitation Commission).
A metagenomic approach that employs culture-independent analysis of
genomes from total microbial DNA extracted from an environmental sample (such
as oil, water, fluids and fecal matter) has made possible the rapid identification of
multiple bacterial species present. This approach allows the identification of
previously uncultured (and therefore unknown) bacterial species. Previous studies
have demonstrated that this approach provides a better description of the
taxonomic composition of soil microbial communities or soil microbiome (Myrold
et al. 2014). Various culture-independent studies investigating sediment microbial
populations and their phylogenetic structure have used techniques such as
denaturing gradient gel electrophoresis (DGGE) and clone libraries. Data from
these studies have demonstrated that microbial communities are extremely
sensitive to changes in the physicochemical state of freshwater sediments (Feris et
al. 2004; Feris et al. 2003; Ramsey et al. 2005; Zeglin et al. 2011), and can be used
as indicators of ecological degradation. Metagenomics has also been employed to
assess direct or indirect impact of microbes on health and biogeochemical cycles,
and has even led to the discovery of new genes (Gomez-Alvarez et al. 2009; Huson
et al. 2009; Kröber et al. 2009; Petrosino et al. 2009; Shah et al. 2011; Thomas et
al. 2012). For instance, in a study by Ferrer et al. (2011) on the microbial
community of the anoxic sediments of Laguna de Carrizo in Madrid, Spain,
annotated genes from species found in this site were predominantly related to
sulfur oxidation, sulfur metabolism, thiosulfate reduction, iron-oxidation and
denitrification. Another useful application of metagenomics is the use of
phylogenetics to look at the distribution of bacteria populating an environment
(Devereux and Mundfrom 1994).
In this study, a metagenomics approach that makes use of sequence
comparison of the 16S rDNA from total bacterial genomic DNA extracted from
riverbed soil was employed to obtain a snapshot of the types of bacteria present in
two riverbed sampling sites – Napindan, an upstream site along the Pasig River,
and Vargas, which is along the Marikina River, a tributary to the Pasig.
Phylogenetic tree construction based on sequence comparison, which can help
reveal the evolutionary relationships of the unknown bacteria, was also performed.
The types of bacterial species present in the sampling sites were correlated with the
types or status of the environment in order to obtain necessary information to
assess the state of health of the Pasig River.
METHODOLOGY
Soil sample collection and pH determination
Riverbed soil samples were obtained from the Pasig River Rehabilitation
Commission (PRRC). These were collected by divers from the Philippine Coast
Guard contracted by PRRC, who used shovels and rice sacks to collect soil
sediment samples from the target collection sites. A portion of the samples
collected were transferred to resealable non – sterile plastic bags and immediately
frozen. The sites of the Pasig River Unified Monitoring Stations (Figure 1) used in
this study were Napindan (14.5351º N, 121.1022º E) and Vargas (14.5663º N,
121.0735º E). Soil pH values were determined by mixing sediment and deionized
water at a 1:5 mass to volume ratio.
Soil genomic DNA extraction and construction of 16S rDNA clone
library
Total genomic DNA from each soil sample was extracted using the Mo Bio
Powersoil® DNA isolation kit (California, USA) which was used according to the
manufacturer’s protocol. DNA extract quality was assessed using 1% agarose gel
electrophoresis stained with ethidium bromide and visualized using BIO-RAD UV
transilluminator 2000 (Milan, Italy).
PCR amplicons were sent to Macrogen (Seoul, South Korea) for sequencing
using the Sanger method. Sequences were analyzed using CodonCode Aligner
v4.2.7 (http://www.codoncode.com/aligner/). Contiguous sites of the forward and
reverse sequences were assembled and edited using the same program. The 1400 1600 base pairs sequences were subjected to editing to produce contigs with
around 450 – 1000 base pairs. Sequences were further analyzed using Basic Local
Alignment Search Tool (BLAST) from the National Center for Biotechnology
Information (NCBI) website.
The contig sequences were run through DECIPHER, an online tool used for
deciphering and managing biological sequences, to weed out chimeric sequences
(Wright et al. 2012). The sequences were also classified using Ribosomal Database
Project (RDP) Classifier (Wang et al. 2007). Using the classification output of both
programs, 16S rDNA sequences of closely related species were collated and used to
construct a neighbor-joining phylogenetic tree using MEGA6 (Tamura et al. 2013).
The two sites included in this study are Napindan, which is located near the
outlet of Laguna de Bay to the Pasig River, and Vargas, which is found along the
Marikina River and near the Marikina-Pasig River junction. Being major upstream
contributors of water in the Pasig River, these sites may be considered as
benchmarks for water and soil quality throughout the stretch of the river. The
metagenomics approach, which employs culture-independent sequence-based
analysis of the collective microbial genomes contained in environmental samples,
can detect known as well as unknown (because they have not been cultured, or are
unculturable) bacterial species. The type of bacterial species detected can be
useful in assessing the health of the river because a correlation between bacterial
species present and the quality or health of a river sampling site can be made.
The total genomic DNA profiles of samples taken from two sampling sites
exhibited smears in agarose gel. PCR amplification of 16S rDNA using the
genomic DNA as template, however, produced the expected size bands of about
1400 base pairs (data not shown). PCR using clones that were positive for 16S
rDNA insertion produced amplicons of about 1700 base pairs, suggesting the
inclusion of amplified plasmid DNA. Four positives clones were detected out of 70
colonies picked from each clone library.
Bacterial enumeration and identification in this study was based on sequence
analysis of 16S rDNA amplicons (Table 1). Sequence analysis of the 16S rDNA
amplicons is considered the gold standard for bacterial identification and
characterization studies (Mizrahi-Man et al. 2013). The 16S rDNA from bacteria is
universal and functionally conserved; thus, random sequence changes are
considered to be useful evolutionary markers. Its 1500 base pair gene length,
which includes 9 hypervariable regions, is also sufficiently long for bioinformatics
– based sequence analysis.
Chimeric sequences, which may cause overestimation of species diversity that
can account for most errors in metagenomic data analysis (Janda and Abbott 2007;
Shah et al. 2011), were weeded out using DECIPHER prior to further analysis.
BLAST search to find the closest 16S rDNA sequences hits revealed that none of
the closest matches for each clone (which include 16S rDNA complete and partial
sequences of bacterium from various phyla) had 100% sequence similarity with the
contig sequences (Table 1). The sequences for each clone contig (designated NP-01
to NP-04 for the samples from the Napindan sampling site, and V-01 to V-04 for
samples from the Vargas site) have been submitted to, and are currently accessible
in, GenBank (Accession # KM107850 – KM107853 for NP-01 to NP-04;
KM107856 – KM107859 for V-01 to V-04).
Contig sequences of microbial species from unique DNA sequences run
through the RDP classifier (a Naïve Bayesian classifier) generated taxonomic
classification and sequences of 16S rDNA of related species were collated
according to taxonomic classifications of both RDP and DECIPHER (Table 2). The
sequences used for phylogenetic analysis were restricted to cultured
representatives; therefore, the number of representatives that can be used for each
sample was subject to availability in online databases.
____________________________________________________________________________________________________________
www.philscitech.org
75
Table 1. Top results of contig sequences when run through BLAST including the
max score, total score, query coverage, E value, percentage identity, and the
accession number and description of the closest sequence.
Sample
GenBank
Accession
No.
Description of closest sequence
Max
score
Total
score
Query
cover
E
value
Ident
GenBank
Accession
No.
NP-01
KM107850
Syntrophus aciditrophicus strain SB 16S
ribosomal RNA gene, complete sequence
992
992
100%
0
91%
NR_102776.1
KM107851
Caldilinea aerophila strain DSM 14535 16S
ribosomal RNA gene, complete sequence
NP-02
658
658
100%
0
86%
NR_074397.1
NP-03
KM107852
Syntrophus gentianae strain HQgoe1 16S
ribosomal RNA gene, partial sequence
1461
1461
99%
0
93%
NR_029295.1
NP-04
KM107853
Dethiobacter alkaliphilus strain AHT 1 16S
688
688
100%
0
87%
NR_044205.1
V-01
KM107856
Longilinea arvoryzae strain KOME-1 16S
686
686
99%
0
88%
NR_041355.1
V-02
KM107857
Bellilinea caldifistulae strain GOMI-1 16S
673
673
99%
0
89%
NR_041354.1
V-03
KM107858
Kozakia baliensis strain NBRC 16664 16S
1454
1454
100%
0
95%
NR_113858.1
V-04
KM107859
Desulfuromonas acetexigens strain 2873 16S
1548
1548
100%
0
93%
NR_044770.1
Pelobacter venetianus Gra PEG 1 (NR 044779.1)
98
Pelobacter acetylenicus WoAcy1 (NR 029238.1)
87
Pelobacter carbinolicus DSM 2380 (NR 075013.1)
Desulfuromonas palmitatis SDBY1 (NR 025973.1)
V-04 (KM107859)
Desulfuromonadaceae
Desulfuromonas thiophila NZ27 (NR 026407.1)
44
Desulfuromonas acetoxidans DSM 684 (NR 121678.1)
95
Malonomonas rubra GraMal1 (NR 026479.1)
54
Pelobacter acidigallici MaGal12T (NR 026154.1)
Desulfuromusa succinoxidans Gylac (NR 029276.1)
100
Desulfuromusa bakii Gyprop (NR 026175.1)
100
Desulfuromusa kysingii Kysw2 (NR 029275.1)
80
99
Syntrophus buswellii DM-2 (NR 029294.1)
87
100
100
Syntrophus gentianae HQgoe1 (NR 029295.1)
Syntrophus aciditrophicus SB (NR 102776.1)
98
Syntrophaceae
Smithella propionica LYP (NR 024989.1)
NP-03 (KM107852)
NP-01 (KM107850)
52
Desulfacinum infernum BalphaG1 (NR 044640.1)
100
Desulfacinum hydrothermale MT-96 (NR 028757.1)
86
97
Thermodesulforhabdus norvegica A8444 (NR 025970.1)
Syntrophobacter wolinii DB (NR 028020.1)
95
100
Syntrophobacteraceae
Desulfovirga adipica TsuA1 (NR 036764.1)
Desulforhabdus amnigena ASRB1 (NR 029289.1)
100
Syntrophobacter fumaroxidans MPOB (NR 075002.1)
89
Syntrophobacter pfennigii KoProp1 (NR 026232.1)
89
NP-04 (KM107853)
Dethiobacter alkaliphilus AHT1 (EF422412.2)
80
78
RDP
NP-01
Syntrophobacterales
Root[100%] Bacteria[100%] "Proteobacteria"[98%] Deltaproteobacteria[97%]
Syntrophobacterales[88%] Syntrophobacteraceae[64%] Desulfovirga[39%]
NP-02
Caldilineae
Root[100%] Bacteria[100%] "Chloroflexi"[100%] Caldilineae[57%]
Caldilineales[57%] Caldilineaceae[57%] Caldilinea[57%]
NP-03
Syntrophobacterales
Syntrophobacterales[100%] Syntrophaceae[100%] Smithella[60%]
NP-04
Acidobacteria_Gp22
Root[100%] Bacteria[100%] "Acidobacteria"[100%] Acidobacteria_Gp18[100%]
Gp18[100%]
V-01
Anaerolineaceae
Root[100%] Bacteria[100%] "Chloroflexi"[99%] Anaerolineae[97%]
Anaerolineales[97%] Anaerolineaceae[97%] Longilinea[87%]
V-02
Anaerolineaceae
Root[100%] Bacteria[100%] "Chloroflexi"[100%] Anaerolineae[100%]
Anaerolineales[100%] Anaerolineaceae[100%] Longilinea[43%]
V-03
Acetobacteraceae
Root[100%] Bacteria[100%] "Proteobacteria"[100%] Alphaproteobacteria[100%]
Rhodospirillales[100%] Acetobacteraceae[100%] Granulibacter[54%]
V-04
Desulfuromonadales
Desulfuromonadales[100%] Desulfuromonadaceae[100%] Desulfuromonas[100%]
Desulfuromonas chloroethenica TT4B (NR 026012.1)
100
45
43
DECIPHER
Desulfuromonas acetexigens 2873 (NR 044770.1)
35
100
Table 2. Taxonomic classification of contig sequences from the results of
DECIPHER and RDP.
Name
A phylogenetic tree (Fig. 2) was generated using MEGA6 that employs the
neighbor-joining method. This is a distance based method which joins pairs of
sequences, or “neighbors”, with the least number of differences or evolutionary
distance (Saitou and Nei 1987). A phylogenetic tree using the maximum-likelihood
method (that uses probability for production of optimal trees; Pagel 1999) yielded
similar results, but with varying branch lengths and bootstrap values (data not
shown). Results generated from both phylogenetic trees clearly suggest that the
sequence comparison groups for each sample analyzed were closely related and in
accordance to the classification output from DECIPHER and RDP (Table 2). Both
results were consistent with the top results from BLAST analysis (Table 1), with
the exception of NP-04, which was classified under Acidobacteria by both
DECIPHER and RDP but was grouped under Syntrophomonadaceae according to
the BLAST analysis.
47
able to utilize sulfate and sulfite as electron acceptors (Beeder et al. 1995; Rees et
al. 1995; Sievert and Kuever 2000). NP-02 share common ancestry with Caldilinea
aerophila and Caldilinea tarbellica of the family Caldilineaceae, Phylum
Chloroflexi. Both species are Gram-negative, thermophilic, neutrophilic, and
facultative anaerobic (Gregoire et al. 2011; Sekiguchi 2003). NP-03 share a
common ancestor with the members of the family Syntrophaceae, Class
Deltaproteobacteria. Known representatives of this family, such as Smithella
propionica, Syntrophus buswellii, Syntrophus aciditrophicus, and Syntrophus
gentianae, are all Gram-negative, mesophilic, neutrophilic, and strictly anaerobic
(Auburger and Winter 1995; Jackson et al. 1999; Liu et al. 1999; Mountfort et al.
1984; Wallrabenstein et al. 1995). NP-04 share common ancestry with
Dethiobacter alkaliphilus and Candidatus Contubernalis alkalaceticum of the
family Syntrophomonadaceae, Phylum Firmicutes and Class Clostridia. Both are
Gram-positive, mesophilic, alkaliphilic, and obligate anaerobic. Dethiobacter
alkaliphilus is able to utilize thiosulfate and elemental sulfur or polysulfide as an
electron acceptor (Sorokin et al. 2008; Zhilina et al. 2005).
Candidatus Contubernalis alkalaceticum clone Z-7904 (DQ124682.1)
43
Thermohydrogenium kirishiense strain DSM 11055 (NR 117160.1)
58
Syntrophomonas wolfei (AF022248.1)
76
86
Syntrophomonadaceae
Pelospora glutarica WoGl3 (NR 028910.1)
Thermosyntropha tengcongensis L-60 (NR 109048.1)
100
Thermosyntropha lipolytica JW265 (NR 026356.1)
100
Caldilinea tarbellica D1-25-10-4 (HM134893.1)
100
Caldilinea aerophila DSM 14535 (NR 074397.1)
61
Caldilineaceae
NP-02 (KM107851)
V-01 (KM107856)
100
V-02 (KM107857)
88
100
Anaerolinea thermolimosa IMO-1 (NR 040970.1)
73
Anaerolinea thermophila UNI-1 (NR 074383.1)
Ornatilinea apprima P3M-1 (NR 109544.1)
82
Anaerolineaceae
Leptolinea tardivitalis YMTK-2 (NR 040971.1)
93
Longilinea arvoryzae KOME-1 (NR 041355.1)
97
38
Levilinea saccharolytica KIBI-1 (NR 040972.1)
64
V-01 and V-02 are closely related to the family Anaerolineaceae, Phylum
Chloroflexi. Members of Anaerolinea thermophile, Anaerolinea thermolimosa, and
Ornatilinea apprima are Gram-negative, thermophilic, neutrophilic to slightly
alkaliphilic, and obligate anaerobic (Podosokorskaya et al. 2013; Sekiguchi 2003;
Yamada 2006). V-03 share common ancestry with the members of the family
Acetobacteraceae. Representative species Acetobacter syzygii, Gluconobacter
japonicas, and Gluconobacter kondonii are known to be Gram-negative,
mesophilic, acidophilic, and obligate aerobic (Lisdiyanti et al. 2001; Malimas et al.
2009; Malimas et al. 2007). V-04 share common ancestry with Desulfuromonas
thiophila and Desulfuromonas acetoxidans of the family Desulfuromonadaceae,
Class Deltaproteobacteria. Desulfuromonas thiophila, Desulfuromonas
acetoxidans, Desulfuromonas palmitatis, Desulfuromonas acetexigens, and
Desulfuromonas chloroethenica are Gram-negative, mesophilic, neutrophilic and
obligate anaerobic. They can utilize different forms of sulfur as electron acceptor
(Coates et al. 1995; Finster et al. 1997; Finster et al. 1994; Krumholz 1997;
Pfennig and Biebl 1976).
Bellilinea caldifistulae GOMI-1 (NR 041354.1)
V-03 (KM107858)
Most of the cloned samples belong to families that are obligate anaerobes,
except for NP-02 and V-03, which are grouped with facultative anaerobes and
obligate aerobe families, respectively. These data suggest that the bulk of the
cloned species most likely live deep within the sediment layer and do not have
interaction or access to dissolved oxygen, whereas the facultative anaerobe and
obligate aerobe live near or at the water-sediment boundary. A study by Qian, et al.
(2000) reported that dissolved oxygen (DO) of waters from the surface in the Pasig
River does not necessarily reflect the DO from waters right above the river bed.
However, unlike mid- to downstream sites, upstream sites of the Pasig have
dissolved oxygen near the riverbed.
Acetobacter syzygii 9H-2 (AB052712.1)
97
Figure 2. Phylogenetic tree of contig sequences and 16S rDNA sequences
of closely related species using the neighbor-Joining method with 1000
replicate bootstrap test generated using MEGA6. Escherichia coli was
included as outgroup. Samples from the study are labeled NP-01 to NP-04
and V-01 to V-04.
The temperature determined by the Pasig River Rehabilitation Commission
for the year 2013 was between 26 to 32°C. The pH of the sediments of two sites
(Napindan and Vargas) were 7.90 and 8.66, respectively. These conditions are able
to support the growth of neutrophiles and alkaliphiles, obligate and facultative
anaerobes, and mesophiles and thermophiles. Some of the samples, such as NP-01,
NP-04, and V-04, were also associated with sulfate-reducing bacteria or with
bacteria able to use sulfur compounds as electron acceptor, possibly from the
families
Syntrophobacteraceae,
Syntrophomonadaceae,
and
Desulfuromonadaceae, respectively. This suggests a high abundance of sulfur or
sulfur containing compounds in the riverbed. Sulfate-reducing bacteria are known
to help reduce heavy metal contamination in water by producing sulfides that
easily react with divalent metals, such as cadmium and copper. The heavy metal
sulfides produced have very low solubility, so the compounds can easily precipitate
out (Muyzer and Stams 2008).
Phylogenetic analysis showed that NP-01 and members of the family
Syntrophobacteraceae, Class Deltaproteobacteria, (which include Desulfacinum
infernum, Desulfacinum hydrothermale, and Thermodesulforhabdus norvegica)
share a common ancestor. Members of the Syntrophobacteraceae are Gramnegative and are neutrophilic thermophiles. They are also strictly anaerobic and
This study employs 16S rDNA-targeted sequence analysis to conduct a
phylogenetic analysis of bacterial population in two sampling sites in Pasig River.
The low sensitivity of the clone screening method limited the number of unique
sequences identified. Nevertheless, the study demonstrates the utility of the
culture-independent metagenomics approach in characterizing microbial species in
Acetobacter peroxydans (AB032352.1)
57
100
Gluconobacter japonicus NBRC 3269 (AB178408.1)
Gluconobacter kondonii NBRC 3266 (AB178405.1)
100
98
Acidomonas methanolica NBRC 104435 (AB682176.1)
Acetobacteraceae
Gluconacetobacter takamatsuzukensis T61213-20-1a (AB778531.1)
99
74
Gluconacetobacter tumulisoli T611xx-1-4a (AB778530.1)
Kozakia baliensis NBRC 16664 (AB681100.1)
90
Asaia prunellae T-153 (AB485741.1)
84
100
Asaia lannaensis (AB469044.2)
!
Escherichia coli K-12 (NC 000913.3)
0.02
____________________________________________________________________________________________________________
www.philscitech.org
the Pasig River system. Phylogenetic analysis, which was based on the comparison
of individual clone contigs with gene sequences archived in annotated databases,
produced insights on the types of bacteria present in the riverbed soil samples.
Previous organismic studies of the Pasig River have been limited to rotifers (Lazo
et al. 2010), fish (Chavez et al. 2006), fungi (Yap and Halos 2009), and cultured
bacteria (Dela Cruz and Halos 1997). This study reports for the first time, an
approach of utilizing community 16S rDNA to generate a census of the microbial
population in two sites of the Pasig River system. Future studies using multiple
composite samples, larger sample sizes, and use of other techniques like
pyrotagged sequencing (Hamady et al. 2008 and Muller et al. 2013) are
recommended.
ACKNOWLEDGEMENTS
The authors would like to thank the Pasig River Rehabilitation Commission
for providing the Pasig River soil samples and accompanying data, and the Office
of the Vice President for Academic Affairs, University of the Philippines, for the
Creative Work and Research Grant (awarded to MCC) used to fund the study.
The authors declare that there are no conflicts of interest.
AUTHORS’ CONTRIBUTIONS
Conceived and designed the experiments: PKK AKA MCC. Performed the
experiments: PKK AM AKA. Analyzed the data: PKK. Wrote the paper: PKK
MCC. Read and edited the final version of the manuscript: PKK MCC
REFERENCES
Auburger G, Winter J. Isolation and physiological characterization of Syntrophus
buswellii strain GA from a syntrophic benzoate-degrading, strictly anaerobic
coculture. Appl Microbiol Biotechnol. 1995; 44(1-2):241–8.
Beeder J, Torsvik T, Lien T. Thermodesulforhabdus norvegicus gen. nov., sp. nov.,
a novel thermophilic sulfate-reducing bacterium from oil field water. Arch
Microbiol. 1995; 164(5):331–6.
Chavez JM, de la Paz RM, Manohar SK, Pagulayan RC, Carandang JR. New
Philippine record of south american sailfin catfishes (Pisces: Loricariidae).
Zootaxa. 2006; 1109:57–68.
Coates JD, Lonergan DJ, Philips EJP, Jenter H, Lovley DR. Desulfuromonas
palmitatis sp. nov., a marine dissimilatory Fe(III) reducer that can oxidize
long-chain fatty acids. Arch Microbiol. 1995; 164(6):406–13.
Craft JA, Stanford JA, Pusch M. Microbial respiration within a floodplain aquifer
of a large gravel-bed river. Freshw Biol. 2002; 47(2):251–61.
Daniel R. The metagenomics of soil. Nat Rev Microbiol. 2005; 3(6):470–8.
Dela Cruz J, Halos PM. Isolation, identification and bioremediation potential of
oil-degrading bacteria from Manila Bay and Pasig River [Philippines]. 1997;
Devereux R, Mundfrom GW. A phylogenetic tree of 16S rRNA sequences from
sulfate-reducing bacteria in a sandy marine sediment. Appl Environ
Microbiol. 1994; 60(9):3437–9.
Engel AS, Meisinger DB, Porter ML, Payn RA, Schmid M, Stern LA, et al.
Linking phylogenetic and functional diversity to nutrient spiraling in
microbial mats from Lower Kane Cave (USA). ISME J. 2010; 4(1):98–110.
Feris KP, Ramsey PW, Frazar C, Rillig M, Moore JN, Gannon JE, et al. Seasonal
Dynamics of Shallow-Hyporheic-Zone Microbial Community Structure along
a Heavy-Metal Contamination Gradient. Appl Environ Microbiol. 2004;
70(4):2323–31.
Feris KP, Ramsey PW, Frazar C, Rillig MC, Gannon JE, Holben WE. Structure and
seasonal dynamics of hyporheic zone microbial communities in free-stone
rivers of the estern United States. Microb Ecol. 2003; 46(2):200–15.
Ferrer M, Guazzaroni M-E, Richter M, García-Salamanca A, Yarza P, SuárezSuárez A, et al. Taxonomic and Functional Metagenomic Profiling of the
Microbial Community in the Anoxic Sediment of a Sub-saline Shallow Lake
(Laguna de Carrizo, Central Spain). Microb Ecol. 2011; 62(4):824–37.
Fierer N, Breitbart M, Nulton J, Salamon P, Lozupone C, Jones R, et al.
Metagenomic and Small-Subunit rRNA Analyses Reveal the Genetic
Diversity of Bacteria, Archaea, Fungi, and Viruses in Soil. Appl Environ
Microbiol. 2007; 73(21):7059–66.
Finster K, Bak F, Pfennig N. Desulfuromonas acetexigens sp. nov., a dissimilatory
sulfur-reducing eubacterium from anoxic freshwater sediments. Arch
Microbiol. 1994; 161(4):328–32.
Finster K, Coates JD, Liesack W, Pfennig N. Desulfuromonas thiophila sp. nov., a
new obligately sulfur-reducing bacterium from anoxic freshwater sediment.
Int J Syst Bacteriol. 1997; 47(3):754–8.
Fischer H, Pusch M. Comparison of bacterial production in sediments, epiphyton
and the pelagic zone of a lowland river. Freshw Biol. 2001; 46(10):1335–48.
Gomez-Alvarez V, Teal TK, Schmidt TM. Systematic artifacts in metagenomes
from complex microbial communities. ISME J. 2009; 3(11):1314–7.
Gorme JB, Maniquiz MC, Song P, Kim L-H. The Water Quality of the Pasig River
in the City of Manila, Philippines: Current Status, Management and Future
Recovery. Environ Eng Res. 2010; 15(3):173–9.
Gregoire P, Bohli M, Cayol J-L, Joseph M, Guasco S, Dubourg K, et al. Caldilinea
tarbellica sp. nov., a filamentous, thermophilic, anaerobic bacterium isolated
from a deep hot aquifer in the Aquitaine Basin. Int J Syst Evol Microbiol.
2011; 61(6):1436–41.
Hamada M, Walker JJ, Harris JK, Gold NJ, Knight R. Error-correcting barcoded
primers for pyrosequencing hundreds of samples in multiplex. Nat Methods.
76
2008; 5(3):235–7.
Hidayat T, Abdul Sama MA, bin Elias MA, Hadibarata T. Metagenomic Analysis
of 16S rRNA Sequences from Selected Rivers in Johor Malaysia. J Appl Sci.
2012; 12(4):354–61.
Huson DH, Richter DC, Mitra S, Auch AF, Schuster SC. Methods for comparative
metagenomics. BMC Bioinformatics. 2009; 10(Suppl 1):S12.
Jackson BE, Bhupathiraju VK, Tanner RS, Woese CR, McInerney MJ. Syntrophus
aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids
and benzoate in syntrophic association with hydrogen-using microorganisms.
Arch Microbiol. 1999; 171(2):107–14.
Janda JM, Abbott SL. 16S rRNA Gene Sequencing for Bacterial Identification in
the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. J Clin Microbiol. 2007;
45(9):2761–4.
Kristiansson E, Fick J, Janzon A, Grabic R, Rutgersson C, Weijdegård B, et al.
Pyrosequencing of Antibiotic-Contaminated River Sediments Reveals High
Levels of Resistance and Gene Transfer Elements. Rodriguez-Valera F, editor.
PLoS ONE. 2011; 6(2):e17038.
Kröber M, Bekel T, Diaz NN, Goesmann A, Jaenicke S, Krause L, et al.
Phylogenetic characterization of a biogas plant microbial community
integrating clone library 16S-rDNA sequences and metagenome sequence
data obtained by 454-pyrosequencing. J Biotechnol. 2009; 142(1):38–49.
Krumholz LR. Desulfuromonas chloroethenica sp. nov. Uses Tetrachloroethylene
and Trichloroethylene as Electron Acceptors. Int J Syst Bacteriol. 1997;
47(4):1262–3.
Lazo MAVA, Nieto KKP, Rayel MFS, Sto Domingo DM, Vergara MAM, Papa
RDS. Composition, Abundance and Distribution of Rotifers in the Pasig
River, Philippines. Philipp Sci. 2010; 46:47–64.
Lisdiyanti P, Kawasaki H, Seki T, Yamada Y, Uchimura T, Komagata K.
Identification of Acetobacter strains isolated from Indonesian sources, and
proposals of Acetobacter syzygii sp. nov., Acetobacter cibinongensis sp. nov.,
and Acetobacter orientalis sp. nov. J Gen Appl Microbiol. 2001; 47(3):119–
31.
Liu Y, Balkwill DL, Aldrich HC, Drake GR, Boone DR. Characterization of the
anaerobic propionate-degrading syntrophs Smithella propionica gen. nov., sp.
nov. and Syntrophobacter wolinii. Int J Syst Bacteriol. 1999; 49 Pt 2:545–56.
Malimas T, Yukphan P, Takahashi M, Kaneyasu M, Potacharoen W, Tanasupawat
S, et al. Gluconobacter kondonii sp. nov., an acetic acid bacterium in the
alpha-Proteobacteria. J Gen Appl Microbiol. 2007; 53(5):301–7.
Malimas T, Yukphan P, Takahashi M, Muramatsu Y, Kaneyasu M, Potacharoen W,
et al. Gluconobacter japonicus sp. nov., an acetic acid bacterium in the
Alphaproteobacteria. Int J Syst Evol Microbiol. 2009; 59(3):466–71.
Mizrahi-Man O, Davenport ER, Gilad Y. Taxonomic Classification of Bacterial
16S rRNA Genes Using Short Sequencing Reads: Evaluation of Effective
Study Designs. White BA, editor. PLoS ONE. 2013; 8(1):e53608.
Mountfort DO, Brulla WJ, Krumholz LR, Bryant MP. Syntrophus buswellii gen.
nov., sp. nov.: a Benzoate Catabolizer from Methanogenic Ecosystems. Int J
Syst Bacteriol. 1984; 34(2):216–7.
Muller EEL, Glaab E, May P, Vlassis N, Wilmes P. Condensing the omics fog of
microbial communities. Trends Microbiol. 2013; 21(7):325–33.
Muyzer G, Stams AJM. The ecology and biotechnology of sulphate-reducing
bacteria. Nat Rev Microbiol. 2008; 6:441-54.
Myrold DD, Zeglin LH, Jansson JK. The Potential of Metagenomic Approaches
for Understanding Soil Microbial Processes. Soil Sci Soc Am J. 2014; 78(1):
3.
Naegeli MW, Uehlinger U. Contribution of the Hyporheic Zone to Ecosystem
Metabolism in a Prealpine Gravel-Bed-River. J North Am Benthol Soc. 1997;
16(4):794.
Pagel M. The Maximum Likelihood Approach to Reconstructing Ancestral
Character States of Discrete Characters on Phylogenies. Syst Biol. 1999;
48(3):612–22.
Petrosino JF, Highlander S, Luna RA, Gibbs RA, Versalovic J. Metagenomic
Pyrosequencing and Microbial Identification. Clin Chem. 2009; 55(5):856–
66.
Pfennig N, Biebl H. Desulfuromonas acetoxidans gen. nov. and sp. nov., a new
anaerobic, sulfur-reducing, acetate-oxidizing bacterium. Arch Microbiol.
1976; 110(1):3–12.
Podosokorskaya OA, Bonch-Osmolovskaya EA, Novikov AA, Kolganova TV,
Kublanov IV. Ornatilinea apprima gen. nov., sp. nov., a cellulolytic
representative of the class Anaerolineae. Int J Syst Evol Microbiol. 2013;
63(Pt 1):86–92.
Pusch M, Fiebig D, Brettar I, Eisenmann H, Ellis BK, Kaplan LA, et al. The role of
micro-organisms in the ecological connectivity of running waters. Freshw
Biol. 1998; 40(3):453–95.
Pusch M. Community respiration in the hyporheic zone of a riffle-pool sequence.
In: Gilbert J, Mathieu J, Fournier F, eds. Groundwater/Surface Water
Ecotones: Biological and Hydrological Interactions and Management Options.
USA: Cambridge University Press, 1997: 51–6.
Qian X, Capistrano ET, Lee W, Ishikawa T, Yokoyama K, Shoji H. Field Survey on
the Flow Structure and Water Quality of Pasig River in Metro Manila.
PROCEEDINGS OF HYDRAULIC ENGINEERING. 2000; 44:1101–6.
Ramsey PW, Rillig MC, Feris KP, Gordon NS, Moore JN, Holben WE, et al.
Relationship between communities and processes; new insights from a field
study of a contaminated ecosystem: Contaminated systems; communities,
processes. Ecol Lett. 2005; 8(11):1201–10.
Rees GN, Grassia GS, Sheehy AJ, Dwivedi PP, Patel BKC. Desulfacinum infernum
gen. nov., sp. nov., a Thermophilic Sulfate-Reducing Bacterium from a
Petroleum Reservoir. Int J Syst Bacteriol. 1995; 45(1):85–9.
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol. 1987; 4(4):406–25.
Sekiguchi Y. Anaerolinea thermophila gen. nov., sp. nov. and Caldilinea aerophila
____________________________________________________________________________________________________________
www.philscitech.org
gen. nov., sp. nov., novel filamentous thermophiles that represent a previously
uncultured lineage of the domain Bacteria at the subphylum level. Int J Syst
Evol Microbiol. 2003; 53(6):1843–51.
Shah N, Tang H, Doak TG, Ye Y. Comparing bacterial communities inferred from
16S rRNA gene sequencing and shotgun metagenomics. Pac Symp
Biocomput Pac Symp Biocomput. 2011; 165–76.
Sievert SM, Kuever J. Desulfacinum hydrothermale sp. nov., a thermophilic,
sulfate-reducing bacterium from geothermally heated sediments near Milos
Island (Greece). Int J Syst Evol Microbiol. 2000; 50(3):1239–46.
Sorokin DY, Tourova TP, Mußmann M, Muyzer G. Dethiobacter alkaliphilus gen.
nov. sp. nov., and Desulfurivibrio alkaliphilus gen. nov. sp. nov.: two novel
representatives of reductive sulfur cycle from soda lakes. Extremophiles.
2008; 12(3):431–9.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular
Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013; 30(12):
2725–9.
Thomas T, Gilbert J, Meyer F. Metagenomics - a guide from sampling to data
analysis. Microb Inform Exp. 2012; 2(1):3.
Vaque D, Pace ML, Findlay S, Lints D. Fate of bacterial production in a
heterotrophic ecosystem: Grazing by protists and metazoans in the Hudson
Estuary. Mar Ecol Prog Ser Oldendorf. 1992; 89(2):155–63.
Wallrabenstein C, Gorny N, Springer N, Ludwig W, Schink B. Pure Culture of
Syntrophus buswellii, Definition of its Phylogenetic Status, and Description of
77
Syntrophus gentianae sp. nov. Syst Appl Microbiol. 1995; 18(1):62–6.
Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian Classifier for Rapid
Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl
Environ Microbiol. 2007; 73(16):5261–7.
Wright ES, Yilmaz LS, Noguera DR. DECIPHER, a Search-Based Approach to
Chimera Identification for 16S rRNA Sequences. Appl Environ Microbiol.
2012; 78(3):717–25.
Yamada T. Anaerolinea thermolimosa sp. nov., Levilinea saccharolytica gen. nov.,
sp. nov. and Leptolinea tardivitalis gen. nov., sp. nov., novel filamentous
anaerobes, and description of the new classes Anaerolineae classis nov. and
Caldilineae classis nov. in the bacterial phylum Chloroflexi. Int J Syst Evol
Microbiol. 2006; 56(6):1331–40.
Yap RA, Halos PS. Isolation, Enumeration And Identification Of Oil-Degrading
Fungi In Pasig River. Philipp J Biotechnol. 2009; 6(1).
Zeglin LH, Dahm CN, Barrett JE, Gooseff MN, Fitpatrick SK, Takacs-Vesbach
CD. Bacterial Community Structure Along Moisture Gradients in the
Parafluvial Sediments of Two Ephemeral Desert Streams. Microb Ecol. 2011;
61(3):543–56.
Zhilina TN, Zavarzina DG, Kolganova TV, Tourova TP, Zavarzin GA. “Candidatus
Contubernalis alkalaceticum,” an Obligately Syntrophic Alkaliphilic
Bacterium Capable of Anaerobic Acetate Oxidation in a Coculture with
Desulfonatronum cooperativum. Microbiology. 2005; 74(6):695–703. ____________________________________________________________________________________________________________
www.philscitech.org
78
SHORT COMMUNICATION
Relationship of agro-morphological traits to
water use efficiency of irrigated lowland
rice varieties under screenhouse condition
Ace Mugssy L. Agustin*1,2 and Nina M. Cadiz3
1Graduate
School, University of the Philippines Los Baños,
College, Laguna 4031
2Department of Crop Science, College of Agriculture, Central Luzon State
University, Science City of Muñoz, Nueva Ecija 3120
3Institute of Biological Sciences, College of Arts and Sciences, University of
the Philippines Los Baños, College, Laguna 4031
Abstract—Rice (Oryza sativa L.) is the only cereal food crop that grows in different hydrological conditions.
As staple food in the Philippines, it is cultivated in different parts of the country from irrigated to rainfed
lowland, upland, cool elevated, flood-prone, and saline ecosystems. Among these ecosystems, irrigated
lowland has highest production, however its productivity is threatened by increasing water scarcity. Crop
water use efficiency is widely used to evaluate productivity in terms of water use. However, currently, there
are limited studies in this area particularly on the relationship of agro-morphological traits to water use
efficiency which can be used by breeders to improve rice water use efficiency. Hence, this study aimed to
identify the relationship of agro-morphological traits to biomass production, evapotranspiration, and water
use efficiency of irrigated lowland rice varieties, and to identify growth phase and variety with highest water
use efficiency. Three irrigated lowland rice varieties were grown in the pots with 40cm x 30cm (row x hill)
planting distance under screenhouse condition. This was laid-out in split-plot in Randomized Complete Block
Design with growth phase as main plot and variety as sub-plot, replicated three times. Based on the result,
broad leaf contributed in decreasing evapotranspiration and increasing biomass and water use efficiency.
Broad leaves have higher boundary layer and contribute to better covering of soil surface both of which
reduce evapotranspiration, and contribute to higher light interception for higher biomass production, hence
high water use efficiency. Other traits such as long leaf, high spikelet fertility, heavy grain, and early maturity
also contributed to reduction of evapotranspiration and improvement of water use efficiency. Hence, these
traits might have the potential to improve water use efficiency of irrigated lowland rice varieties. Among
growth phases, reproductive phase had highest water use efficiency due to higher rate of increase in
biomass and lower rate of increase in evapotranspiration than ripening phase. NSIC Rc202H with broadest
leaves and lowest cumulative evapotranspiration had highest water use efficiency than NSIC Rc222 and
PSB Rc18.
Keywords—irrigated lowland rice, agro-morphological traits, biomass, evapotranspiration, water use
efficiency, broad leaf
INTRODUCTION
Rice is a diverse plant species which can grow in a wide range of
environment, particularly in different hydrological conditions. It is the only major
cereal food crop that can grow in flooded condition (Bouman et al., 2007). In the
Philippines, it is the staple food which is cultivated in different parts of the country
from irrigated to rainfed lowland, upland, cool elevated, flood-prone, and saline
ecosystems. Among these ecosystems, irrigated lowland has the highest production
Revised: September 26, 2015
Accepted: October 7, 2015
Published: December 4, 2015
(13.82 M t) with 3.24 M ha cultivated area hence, the major contributor to
domestic rice production (72%) (Bureau of Agricultural Statistics, 2014). However,
aside from challenges in breaking the yield plateau in this ecosystem, there is
increasing threat in existing productivity due to negative effects of climate change
particularly water scarcity. Amount of rainfall will be reduced in some areas
resulting to lower water level of dams (Cruz and Jose, 1999), which is happening
nowadays particularly in Angat (Republic of the Philippines Water Situation
Report, 2006) and Pantabangan dams (Philippine Atmospheric, Geophysical and
Astronomical Services Administration, 2014). Also, competition in water use is
increasing among industry, household and agriculture (RP Water Situation Report,
2006). Different studies have been done to reduce the water application and
increase the genotypic water use efficiency (WUE) of rice. To reduce water
application, there are different technologies and practices, such as: dry soil tillage
____________________________________________________________________________________________________________
www.philscitech.org
79
soon after harvesting, no tillage, proper land levelling, direct seeding, construction
of field channels and bunds, saturated soil culture, and alternate wetting and drying
(AWD) (Tuong and Bhuiyan, 1999 and Bouman et al., 2007). High genotypic
WUE on the other hand, can be achieved by reducing crop growth duration (early
maturity) and increasing the output (high yield) (Tuong and Bhuiyan, 1999).
However, according to Yoshida (1981), the amount of water use is directly related
to biomass. As the biomass increases the water use also increases and might not
give significant change in the value of WUE. According to Blum (2005), it is a
controversial selection parameter for high yield particularly under drought stress.
Furthermore, studies on plant traits in relation to water use are extensive only
under drought stress condition and very limited under irrigated condition. This
study, therefore, aimed to identify the relationship of agro-morphological traits to
biomass production, evapotranspiration (ET) and WUE of high yielding irrigated
lowland rice varieties and to identify growth phase and variety with highest WUE.
Water use efficiency
Water use efficiency of biomass (WUEB) and grain yield (WUEG) for each
variety were determined. For WUEB during vegetative, reproductive, and ripening
phases were computed using Equations 4, 5, and 6, respectively, while equation 7
was used to compute WUEG.
WUEB in vegetative phase
=
Biomass in PI
ET from transplanting to PI
Eqn. 4
WUEB in reproductive phase
=
Biomass in flowering
ET from transplanting to flowering
Eqn. 5
WUEB in ripening phase
=
Biomass in maturity
ET from transplanting to maturity
Eqn. 6
Time and Place of Study
WUEG
=
Grain yield at 14% moisture content
ET from transplanting to maturity
Eqn. 7
This screenhouse study was conducted from October 2014 to February 2015
at the Institute of Biological Sciences, University of the Philippines Los Baños
(IBS-UPLB), Los Baños, Laguna.
Statistical analysis
Experimental Design
The experiment was laid-out in split-plot in Randomized Complete Block
Design (RCBD) as precaution from observed heterogeneity of light availability.
Growth phase was assigned as main plot while variety as sub-plot. This was
replicated three times with two plants for each replication.
Plant Materials
Widely-cultivated irrigated lowland rice varieties with different maturity were
used to determine if the ET is a function of growth duration or other parameters.
NSIC Rc222 (Tubigan 18) is the most popular inbred in Central Luzon particularly
in Nueva Ecija – province with the highest average yield of rice (National
Cooperative Testing), because of its high yield under farmer’s field which is almost
the same with hybrids. Another popular inbred is PSB Rc18 (Ala) which is widelycultivated across the country because of its acceptable yield (5.1 t ha-1), moderate
resistance to pests and diseases, and good eating quality, a late-maturing variety.
Hybrid variety was also tested, NSIC Rc202H, commonly known as Mestizo 19, a
two-line hybrid, early maturing and high-yielding variety (6.7 t ha-1) (Philippine
Rice Research Institute, 2014).
Crop Establishment
Twenty one (21) day old seedlings were transplanted in each pot with one hill
(2-3 seedlings) per pot (25 cm x 25 cm, H x Dm) with 40 cm x 30 cm (row x hill)
planting distance. The pot was filled with clay from rice field up to 20 cm. General
fertilizer recommended rate (90-60-30 kg NPK ha-1) was followed with 0.86 g
14-14-14 applied basally, 0.60 g 16-20-0 and 0.12 g 46-0-0 was topdressed in each
pot during active tillering and panicle initiation (PI) stages, respectively. Weeds
were removed immediately throughout the experiment. Five centimeters depth of
water was provided to each pot when surface water was dropped using graduated
cylinder to measure the applied amount of water.
Analysis of variance (ANOVA) appropriate to split-plot RCBD was used.
Comparison among means was done using least of significance difference (LSD) at
5% level of significance. Pearson correlation analysis was performed to understand
the relationship of agro-morphological traits to biomass, ET, and WUE. These
were performed using STAR (Statistical Tool for Agricultural Research) (version
2.0.1) Statistical Software developed by Biometrics and Breeding Informatics
Group of Plant Breeding, Genetics and Biotechnology Division (PBGBD) of
International Rice Research Institute (IRRI).
RESULTS
Relationship of Agro-morphological Traits to Biomass Production, ET
and WUE
In terms of biomass production, above ground biomass and grain yield
showed very strong linear relationship with each other (Table 1). Both had strong
positive relationship to stem weight and panicle number, while negative strong
relationship to leaf:stem weight ratio. Furthermore, biomass had at least strong
relationship to stem length, leaf width, leaf weight, and maturity while negative
strong relationship to spikelet fertility and flag leaf area. Grain yield, on the other
hand, had negative strong relationship to leaf length. Thus, heavy stem weight,
more panicles and lower leaf:stem weight ratio might contributed to the
productivity of these irrigated lowland rice varieties. Cumulative ET, on the other
hand, had very strong positive linear relationship to stem weight, biomass and
maturity and strong relationship to grain yield. On the other hand, leaf length,
width and area, spikelet fertility, flag leaf area and 1000-grain weight had at least
strong negative relationship to cumulative ET. The relationships of these
parameters, except for grain yield, to WUE were opposite to that of cumulative ET
and these relationships were further supported by daily ET and daily WUE.
Table 1. Correlation coefficients of agro-morphological parameters to
evapotranspiration (ET) and water use efficiency (WUE).
Data Gathered
Evapotranspiration (ET)
This was measured by watering the pot using graduated cylinder. Cumulative
ET for each growth phase was computed by adding the water applied from
transplanting to PI (vegetative), to flowering (reproductive), and to maturity
(ripening). Daily ET for vegetative, reproductive and ripening phases were
computed using Equations 1, 2, and 3, respectively.
Daily ET in
vegetative
phase
Daily ET in
reproductive
phase
Daily ET in
ripening phase
=
Cumulative ET from translating to PI
Number of days from transplanting to PI
Eqn. 1
=
Cumulative ET from PI to flowering
35 days
Eqn. 2
=
Cumulative ET from flowering to maturity
30 days
Eqn. 3
Agro-morphological traits
The following agro-morphological traits were gathered: plant height, number
of tiller per hill, number of leaf per tiller, number of panicle per hill, leaf length,
leaf width, leaf area, stem length, dry weight of above ground biomass (leaf, stem,
and panicles), panicle length, number of spikelet per panicle, spikelet fertility,
1000-grain weight, and grain yield. Biomass for vegetative, reproductive and
ripening phases were gathered by harvesting the plants during PI, flowering, and
maturity, respectively. The leaf area was estimated using conventional method
(Yoshida et al., 1976) wherein the second topmost tiller was selected as sample
tiller. The length and the widest width of all the green leaves in sample tiller were
measured. Leaf area was computed by multiplying length to width then the product
was multiplied by correction factor 0.75. The corrected leaf area of each leaf was
summed-up to get the total leaf area per tiller then multiplied with the number of
tillers to estimate the final leaf area per hill.
LL-leaf length; LW-leaf width; LA- leaf area; SW-stem weight; LWt-leaf weight; L:S-leaf weight and stem
weight ratio; MAT-maturity; PN-panicle number; SN- spikelet number per panicle; SF-spikelet fertility;
FLA-flag leaf area; HI-harvest index; OGW-one thousand grain weight; BM-biomass; GY-grain yield; ETddaily evapotranspiration; WUEd- water use efficiency on daily basis; CumET-cumulative
evapotranspiration; WUE; water use efficiency using BM and CumET. * and ** represent significant levels
of P<0.05 and P<0.01, respectively.
Biomass, Daily and Cumulative Evapotranspiration (ET), Water Use
Efficiency of Biomass (WUEB), and Leaf Width
In terms of biomass, significant difference was found only in growth phase
and not in variety (Table 2). Biomass increased from vegetative to ripening phase.
Herein, 57.81 g of biomass was produced in ripening, 24.06 g in reproductive, and
3.69 g in vegetative phase. As the biomass increases ET also increases, thus ET
increased from vegetative to ripening. Vegetative phase had ET value of 3.29 L,
8.64 L for reproductive, and 24.97 L for ripening. However, unlike biomass, there
was significant difference in ET among varieties. Hybrid NSIC Rc202H had the
lowest ET in all growth phases, 2.24 L, 7.56 L, and 19.65 L in vegetative,
____________________________________________________________________________________________________________
www.philscitech.org
80
Table 2. Biomass, cumulative evapotranspiration (ET), water use efficiency of
biomass (WUEB), daily ET, and leaf width of three irrigated lowland rice varieties
in different growth phases under screenhouse condition.
Growth Phase (GP)/
Variety (Var)
Biomass
(g)
ET
(L)
WUEB
(g L-1)
Daily ET
(ml d-1)
PSB Rc18
125
NSIC Rc222
NSIC Rc202H
Leaf Width
(cm)
93.75
Vegetative
PSB Rc18
4.40
3.78a
1.16b
118.28a
1.00a
NSIC Rc222
3.41
3.84a
0.89c
119.90a
0.86b
NSIC Rc202H
3.26
2.24b
1.47a
112.04a
1.01a
Mean
3.69z
3.29z
1.17z
116.74z
0.95z
PSB Rc18
23.30
8.15b
2.80a
214.41b
1.29b
NSIC Rc222
27.80
10.20a
2.75a
268.42a
1.24b
NSIC Rc202H
21.08
7.56b
2.78a
198.88b
1.46a
Mean
24.06y
8.64y
2.78x
227.24y
1.33y
62.5
Reproductive
31.25
Ripening
PSB Rc18
58.96
25.97b
2.28b
467.61a
1.57b
NSIC Rc222
61.23
29.30a
2.10b
508.83a
1.58b
NSIC Rc202H
53.25
19.65c
2.72a
328.45b
1.80a
Mean
57.81x
24.97x
2.37y
434.96x
1.65x
GP
**
**
**
**
**
Var
ns
**
**
**
**
GP X Var
ns
**
ns
**
ns
* and **, significant at 5 and 1% level, respectively; ns, not significant.
In a column within each growth phase, means followed by a common letter are not significantly different
at 5% level by LSD.
reproductive, and ripening, respectively. Its shortest growth duration might be the
reason for its lowest ET during vegetative phase because in this phase there was no
significant difference in daily ET. On the other hand, NSIC Rc222 had the highest
ET in all growth phases with 3.84 L in vegetative, 10.20 L in reproductive, and
29.30 L in ripening phase. For WUE of biomass (WUEB), significant differences
were both found in growth phase and variety. Highest WUEB was found during
reproductive (2.78 g L-1) followed by ripening (2.37 g L-1) then vegetative phase
(1.17 g L-1). The lower WUEB at ripening than reproductive phase was due to
lower rate of biomass accumulation (24.06 – 57.81 g) which was 2.4 compared to
2.9 of ET (8.64 – 24.97 L). Among varieties, NSIC Rc202H had highest WUEB
during vegetative and ripening. Its shortest growth duration might be the reason for
its lowest ET that gave highest WUEB during vegetative phase because in this
phase there was no significant difference in daily ET among varieties. However,
there were significant variations in daily ET during reproductive and ripening
phases. NSIC Rc202H had comparable daily ET (198.88 ml d-1) to PSB Rc18
(214.41 ml d-1) but lower than NSIC Rc222 (268.42 ml d-1) during reproductive
phase. While it had lowest daily ET of 328.45 ml d-1 during ripening compared to
467.61 ml d-1 of PSB Rc18 and 508.83 ml d-1 of NSIC Rc222. This indicates that
genotypic water use (ET) and WUE of irrigated lowland rice might be improved
not just by considering growth duration. In terms of leaf width, which is the only
trait that reduced ET and increased biomass and WUE (Table 1), significant
variations were both found in growth phases and varieties (Table 2). Leaf width
increased from vegetative to ripening. Hybrid NSIC Rc202H with highest WUEB
and lowest cumulative and daily ET had also widest leaf width during ripening
with 1.80 cm. It had also widest leaf width during reproductive phase with 1.46
cm. On the other hand, leaf width of PSB Rc18 during reproductive (1.29 cm) and
ripening (1.57 cm) were comparable to leaf width of NSIC Rc222 within the same
phase, 1.24 cm and 1.58 cm, respectively.
0
Maturity
CumET
Grain yield
WUEG
Figure 1. Maturity (days after sowing), cumulative evapotranspiration
(CumET, L), grain yield (g plant-1, x 10), water use efficiency of grain yield
(WUEG, g grain L-1, x 10) of three irrigated lowland rice varieties under
screenhouse condition. Data shown are means + SD of three replications.
DISCUSSION
This study was able to identify plant trait – leaf width with strong negative
correlation to cumulative ET (r = -0.76) and at the same time very strong positive
relationship to biomass (r = 0.87) and WUE (r = 0.88) (Table 1). Thus, broad leaf
might contribute to the reduction of water use (ET) and improvement of biomass
production and WUE of irrigated lowland rice varieties. The measured leaf width
of the varieties tested ranged from 0.86 – 1.80 cm from vegetative to ripening
phase (Table 2). Broader leaves may contribute to better covering of soil surface
reducing evaporation and have larger boundary layer that can partially reduce
transpiration (Yates et al., 2010), thus reducing ET. During ripening phase, NSIC
Rc202H had the broadest leaves and lowest daily and cumulative ET, hence
highest WUE (Table 1). Also, broader leaves contribute to higher light interception
(Yoshida, 1981), thus higher canopy photosynthesis for higher biomass production.
Other reported traits such as high culticular wax, numerous leaf hair and vertical
leaf angle can indirectly reduce transpiration by lowering leaf temperature
(Lambers et al., 2008). On the other hand, long leaf length, large leaf and flag leaf
area, high spikelet fertility, heavy grain weight and early maturity were found to
reduce ET and increase WUE. It is interesting to note that leaf dimension had at
least strong negative relationship to cumulative ET but had at least positive strong
relationship to WUE. In this set-up, wherein plants had wider spacing, as the leaf
area increases water use decreases. This might be due to reduction in evaporation
with larger canopy by providing more cover to soil surface. Also, better control of
water loss by stomata than water loss through evaporation particularly when
evaporating power of the atmosphere is high. Moreover, since leaf is the main
photosynthetic organ of the plants, high leaf area will increase biomass (Yoshida,
1981), thus further increasing WUE.
Biomass and grain yield did not vary while ET showed significant difference
among varieties. As the biomass increases from vegetative to ripening phase
amount of ET also increases. The rate of increase in biomass was higher in
vegetative – reproductive while rate of increase in ET was higher in reproductive –
ripening. Hence, highest WUE among growth phases was found in reproductive
phase. During vegetative phase wherein daily ET of varieties had no variation,
there was a significant difference for cumulative ET indicating the effect of growth
duration to water use (ET). However, the result of daily ET under reproductive and
ripening showed variations among varieties indicating the possibility of reducing
ET not just by early maturing variety (growth duration). Other traits that can be
considered aside from early maturing and broad leaf are long leaf length, high
spikelet fertility and heavy grain weight to reduce ET and increase WUE. The
findings of this study, however, particularly on the effect of broad leaves should be
verified under field condition because of the faster wind speed that can reduce or
eliminate the effect of boundary layer in transpiration.
Water Use Efficiency of Grain Yield
CONCLUSION
NSIC Rc202H with highest WUEB had also highest grain yield WUE
(WUEG) with 1.73 g grain L-1. Grain yield WUE of PSB Rc18 (1.35 g grain L-1)
and NSIC Rc222 (1.28 g grain L-1) were comparable to each other. These values
were closed to the range (0.6 – 1.6 g grain L-1) reported by Bouman et al., 2007;
Alberto et al., 2011; and Maina et al., 2014. Grain yield, like biomass, had no
significant difference among varieties while cumulative ET showed significant
variation. NSIC Rc202H with highest WUEG had lowest cumulative ET (19.65 L)
followed by PSB Rc18 (25.97 L) and NSIC Rc222 with highest cumulative ET
(29.30 L). For maturity, NSIC Rc202H had shortest growth duration of only 110
days after sowing (DAS). PSB Rc18 and NSIC Rc222 had comparable growth
duration to each other with 118 DAS and 119 DAS, respectively. NSIC Rc222
extended its growth duration by five days from the expected 114 DAS (Figure 1).
Among agro-morphological traits that were evaluated, only broad leaf was
identified with consistent effects of decreasing ET while increasing biomass and
WUE. Broad leaves have higher boundary layer and contribute to better covering
of soil surface both of which reduce ET, and contribute to higher light interception
for higher biomass production, hence high WUE. Other traits such as long leaf
length, high spikelet fertility, heavy grain weight and early maturity decreased ET
while increased WUE. Hence, these traits can be considered by breeders to
improve the WUE of irrigated lowland rice varieties. On the other hand,
reproductive phase was identified to have highest WUE; the lower WUE of
ripening than reproductive phase was due to lower rate of increase of biomass than
ET from reproductive to ripening phase. Hybrid NSIC Rc202H with broadest
leaves and shortest growth duration was identified to have highest WUE than
inbreds NSIC Rc222 and PSB Rc18.
____________________________________________________________________________________________________________
www.philscitech.org
ACKNOWLEDGEMENT
The authors would like to thank the Institute of Biological Sciences,
University of the Philippines Los Baños (IBS-UPLB) for providing the facilities
for this study.
The authors declare no conflict of interests.
AMLA conducted the study, analyzed the data, and prepared the manuscript
for publication. NMC helped in conceptualization of the study and revision of the
manuscript.
REFERENCES
Alberto MCR, Wassmann R, Hirano T, Miyata A, Hatano R, Kumar A, Padre A,
Amante M. 2010. Comparisons of energy balance and evapotranspiration
between flooded and aerobic rice fields in the Philippines. Agricultural Water
Management 98 (2011) 1417-1430
Baker R, Levine G. 2012. Water productivity in context: The experiences of
Taiwan and Philippines over the past half-century. Colombo, Sri Lanka:
International Water Management Institute. 33p. (IWMI Research Report
145).doi: 10.5337/2012.206
Bureau of Agricultural Statistics. 2014. Retrieved: December 12, 2014 from the
World Wide Web: http://www.bas.gov.ph
Blum A. 2005. Drought Resistance, Water use efficiency, and yield potential – are
they compatible, dissonant, or mutually exclusive? Australian Journal of
Agricultural Research 56:1159-1168
Bouman BAM, Lampayan RM, Tuong TP. 2007. Water management in irrigated
rice: Coping with water scarcity. Los Baños (Philippines): International Rice
Research Institute. 54 p.
Facchi A, Gharsallah O, Chiaradia EA, Bischetti GB, Gandolfi C. 2013.
Monitoring and modelling evapotranspiration in flooded and aerobic rice
fields. Procedia Environmental Sciences 19:794-843
Jose AM, Cruz NA. 1999. Climate change impacts and responses in the
Philippines: Water resources. Clim Res 12:77-84
81
Kang Y, Khan S, Ma X. 2009. Climate change impacts on crop yield, crop water
productivity and food security – A review. Progress in Natural Science
19:1665-1674
Lage M, Bamouh A, Karrou M, El Mourid M. 2003. Estimation of rice
evapotranspiration using a microlysimeter technique and comparison with
FAO Penman-Monteith and pan evaporation methods under Moroccan
condition. Agronomie 23:625-631
Lambers H, Chapin FS, Pons TL. 2008. Plant Physiological Ecology (2nd ed).
604p
Philippine Atmospheric, Geophysical and Astronomical Services Administration.
2014. Retrieved: December 12, 2014 from the World Wide Web: http://
www.pagasa.dost.gov.ph
Peng S, Khush GS, Virk P, Tang Q, Zou Y. 2008. Progress in ideotype breeding to
increase rice yield potential. Field Crops Research 108: 32-38
Prasad PVV, Boote KJ, Allen LH, Sheehy JE, Thomas JMG. Species, ecotype and
cultivar differences in spikelet fertility and harvest index of rice response to
high temperature stress. Field Crop Research 95:398-411
Philippine Rice Research Institute. 2014. Retrieved: December 12, 2014 from the
World Wide Web: http://www.philrice.gov.ph
Republic of the Philippines Water Situation Report. 2006. A project of the League
of Cities of the Philippines
Tuong TP, Bhuiyan SI. 1999. Increasing water use efficiency in rice production:
Farm-level perspectives. Agricultural Water Management 40:117-122
Wailes EJ, Chavez EC. 2012. ASEAN and global rice situation and outlook. ADB
Sustainable Development Working Paper Series.Series No. 22. August 2012
Wang W, Sun F, Luo Y, Xu J. 2012. Changes of rice water demand and irrigation
water requirement in Southeast China under future climate change. Procedia
Engineering 28:341-345
Yang CM. 1994.Response of rice yield in relation to solar radiation and air
temperature under soil water deficit. Chinese Journal of Agrometeology 1(1):
27-34
Yates MJ, Verboom GA, Rebelo AG, Cramer DM. 2010.Ecophysiological
Significance of Leaf Size Variation in Proteaceae from the Cape Floristic
Region. Functional Ecology 24(3):485-492
Yoshida S. 1981. Fundamentals of Rice Crop Science. International Rice Research
Institute. Los Baños, Philippines. 269 p.
Yoshida S, Forno DA, Cock JH, Gomez KA. 1976. Laboratory Manual for
Physiological Studies for Rice. International Rice Research Institute. Los
Baños, Philippines. 83 p. ____________________________________________________________________________________________________________
www.philscitech.org

16S rDNA - International Journal of Philippine Science and

Transcription

Similar documents

Mr. Benel D. Lagua Chief Development Officer Development Bank of

Memorandum

Ika-57 taon na pagdiriwang ng Samahang Wag-Wag

Technical Sheet - Microbes Biosciences

bdbdbd - Barnahjalp.fo

Los Banos Tour - Museum Volunteers of the Philippines

STEM Human Resources - British Council | Philippines

File - Inanglupa Movement

The Philippines: A New Awakening

Untitled