Paenibacillus curdlanolyticus

Table of Contents
The C-terminal region of xylanase domain in Xyn11A
from Paenibacillus curdlanolyticus B-6 plays an important role
in structural stability
Junjarus Sermsathanaswadi & Somsak Pianwanit & Patthra Pason & Rattiya Waeonukul &
Chakrit Tachaapaikoon & Khanok Ratanakhanokchai & Krisna Septiningrum &
Akihiko Kosugi
Received: 7 February 2014 / Revised: 31 March 2014 / Accepted: 2 April 2014 / Published online: 1 May 2014
# Springer-Verlag Berlin Heidelberg 2014
Abstract Paenibacillus curdlanolyticus B-6 produces an extracellular multienzyme complex containing a major xylanase
subunit, designated Xyn11A, which includes two functional
domains belonging to glycosyl hydrolase family-11 (GH11)
and carbohydrate binding module family-36 (CBM36) and
possesses a glycine and asparagine-rich linker (linker). To
clarify the roles of each functional domain, recombinant proteins XynXL and XynX (CBM36 deleted and CBM36 and
linker deleted, respectively) were constructed. Their xylanase
activities were similar toward soluble xylan, whereas XynXL
showed decreased hydrolysis activity toward insoluble xylan
while XynX had no xylanase activity. To determine the significance of the linker and its neighbor region, XynX was
subjected to secondary structural alignments using circular
dichroism (CD) spectroscopy and three-dimensional (3D)
structural analysis. A seven amino acid (NTITIGG) neighbor
linker sequence was highly conserved among GH11 xylanases
of Paenibacillus species. Although XynX exhibited a typical
GH11 xylanase structure, conformational gaps were observed
in the β6- and β12-sheets and in CD spectra. Flipping of the
Arg163 side chains in the subsite was also observed upon
analysis of superimposed models. Docking analysis using
xylohexaose indicated that flipping of the Arg163 side chains
markedly affected substrate binding in the subsite. To identify
the amino acids related to stabilizing the substrate binding site,
XynX with an extended C-terminal region was designed. At
least seven amino acids were necessary to recover substrate
binding and xylanase activity. These results indicated that the
seven amino acid neighbor Xyn11A linker plays an important
role in the activity and conformational stability of the xylanase
domain.
J. Sermsathanaswadi
Department of Chemical Technology, Faculty of Science and
Technology, Suan Dusit Rajabhat University, 295 Rajasrima Rd.,
Dusit, Bangkok 10300, Thailand
J. Sermsathanaswadi : K. Ratanakhanokchai
School of Bioresources and Technology, King Mongkut’s University
of Technology Thonburi, Bangkuntien, Bangkok 10150, Thailand
J. Sermsathanaswadi : K. Septiningrum : A. Kosugi
Biological Resources and Post-harvest Division, Japan International
Research Center for Agricultural Sciences (JIRCAS), 1-1 Ohwashi,
Tsukuba, Ibaraki 305-8686, Japan
Keywords Paenibacillus curdlanolyticus . Xylanase .
GH family-11 . CBM . Xylan degradation
S. Pianwanit
Department of Chemistry, Faculty of Science, Chulalongkorn
University, Bangkok 10330, Thailand
Introduction
P. Pason : R. Waeonukul : C. Tachaapaikoon
Pilot Plant Development and Training Institute, King Mongkut’s
University of Technology Thonburi, Bangkuntien, Bangkok 10150,
Thailand
Plant biomass contains a complex mixture of polysaccharides,
such as cellulose, hemicellulose (xylan and galactomannan),
pectic substances (galacturonan and arabinogalactan) and other polysaccharides (e.g., type II arabinogalactan and fucoxyloglucan; Caffall and Mohnen 2009; McNeil et al. 1984;
Scheller and Ulvskov 2010), and is expected to be utilized as
an abundant renewable resource. Therefore, complete and
K. Septiningrum : A. Kosugi (*)
University of Tsukuba Graduate School of Life and Environmental
Sciences, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8572, Japan
e-mail: [email protected]
Reproduced from Appl. Microbiol. Biotechnol. 98: 8223–8233 (2014).
Khanok Ratanakhanokchai: Participant of the 18th UM, 1990-1991.
213
rapid hydrolysis of these polysaccharides requires not only β1,4-glycosidic chain-cleaving enzymes, such as endo-β-1,4glucanase, cellobiohydrolase and β-glycosidase, but also the
cooperation of numerous enzymes such as xylanolytic enzymes and side chain-cleaving enzymes like β-1,4-xylanase
and α-L-arabinofuranosidase (Caffall and Mohnen 2009;
McNeil et al. 1984). Among these plant cell wall degradable
enzymes, β-1,4-xylanases catalyze the hydrolysis of the β1,4-D-xylosidic linkage in xylan, one of most abundant plant
cell wall polysaccharides. The enzymatic hydrolysis of xylan
has various potential industrial applications in areas such as
food engineering, bio-ethanol production, and cellulose pulp
production (Pauly and Keegstra 2010; Saha 2003).
The β-1,4-xylanases are generally included in glycosyl
hydrolase family-10 (GH10) and -11 (GH11) based on primary structure similarity and three-dimensional (3D) structure
homology. GH11 xylanases are highly specific, displaying
exclusive substrate specificity toward xylose-containing substrates and a preference for insoluble polymeric substrates.
The structures of GH11 are highly homologous and contains a
single major α-helix and two extended pleated β-sheets which
form a jelly-roll fold (Paës et al. 2012). The structural features
include a compact globular structure and a thumb-like structure as an 11-residue long loop that connects β-strands β8 and
β7, and a long cleft that spans the entire molecule and contains
the active site (Paës et al. 2012; Wakarchuk et al. 1994). The
catalytic machinery is composed of two glutamate residues,
acting as a nucleophile and an acid/base catalyst, located in the
middle of the long cleft (Paës et al. 2012). Presently, 874
GH11 xylanase sequences are available in the CAZy database
(http://www.cazy.org/Home.html) and 27 structures for GH11
xylanases have been deposited in the Protein Data Bank
(PDB; http://www.pdb.org/pdb/home/home.do; Berman
et al. 2003; Paës et al. 2012).
A facultative anaerobic bacterium Paenibacillus
curdlanolyticus B-6 (BCC no. 11175, National Center for
Genetic Engineering and Biotechnology Thailand), isolated
from an anaerobic digester which was fed pineapple waste, is
a true cellulolytic/xylanolytic organism (Pason et al. 2006).
Recently, we determined that P. curdlanolyticus B-6 is able to
produce an extracellular multienzyme complex composed of a
280 kDa protein, several minor xylanases and cellulases, and
major xylanases of about 40 kDa. The major xylanase subunit
known as Xyn11A contains two functional domains belonging to GH11 and carbohydrate binding module family-36
(CBM36) and a relatively unique glycine and asparaginerich long linker (linker; Pason et al. 2010).
In this study, the roles of the functional domains of
Xyn11A for xylan degradation activity were investigated
through enzymatic characterization and conformational analysis using recombinant proteins that included truncated
linkers and CBM36. We confirmed the important role of a
seven amino acid neighbor linker in the xylan degradation
activity of Xyn11A. This is first report to confirm the importance of the C-terminal region of the GH11 xylanase catalytic
domain for a Paenibacillus species.
Materials and methods
Bacterial strains and plasmids
P. curdlanolyticus B-6 (Pason et al. 2006) was deposited with
the BIOTEC Culture Collection of the National Center for
Genetic Engineering and Biotechnology (BIOTEC) Thailand,
with the accession number BCC no. 11175. P. curdlanolyticus
B-6 was grown on Berg’s mineral salt medium at pH 7.0 (Berg
et al. 1972; Pason et al. 2010) containing 2 g of sodium nitrate,
0.5 g of K2HPO4, 0.2 g of MgSO4 ·7H2O, 0.02 g of MnSO4 ·
H2O, 0.02 g of FeSO4 ·7H2O, and 0.02 g of CaCl2 ·2H2O, and
supplemented with 5 g of oat spelt xylan (Sigma-Aldrich, St
Louis, MO, USA) per liter of distilled water. Chemicals were
purchased from Wako Pure Chemical (Osaka, Japan).
Escherichia coli JM109 (Takara Bio, Shiga, Japan) and
BL21 (DE3), and plasmids pET19b (Merck, Darmstadt, Germany) served as cloning hosts, expression hosts and vector,
respectively. E. coli cells were grown at 37 °C in Luria–
Bertani (LB) medium containing ampicillin (100 μg/ml).
Preparation of recombinant Xyn11A proteins
from P. curdlanolyticus B-6
Genomic DNA was prepared by phenol/chloroform extraction
(Pason et al. 2010) and plasmid DNA using a QIAprep spin
miniprep kit in accordance with the manufacturers’ protocols
(Qiagen, Frederick, MD). The oligonucleotide primers used in
this research are listed in Table 1. To produce the recombinant
proteins Xyn11A, XynXL, XynX, LS11, LS7, LS4, and LS1
in E. coli, expression plasmids pET-XynA, pET-XynXL, pETXynX, pET-LS11, pET-LS7, pET-LS4, and pET-LS1 were
prepared using the xyn11A gene (GenBank accession number
FJ956758) from P. curdlanolyticus B-6 (Fig. 1a). Polymerase
chain reaction (PCR) was performed with Ex Taq polymerase
or PrimeSTAR® HS DNA Polymerase (Takara Bio) under
standard conditions according to the manufacturer’s instructions. Amplified fragments were inserted between the NdeI
and Bpu1102I sites of pET19b. The constructed plasmids
were transformed into E. coli competent cells, and positive
clones were verified by DNA sequencing.
Production and purification of Xyn11A and its derivatives
The E. coli BL21(DE3) strains harboring pET-XynA, pETXynXL, pET-XynX, pET-LS7 pET-LS4, pET-LS3, and pETLS1 were grown at 37 °C in 300 ml of LB medium supplemented with ampicillin (100 μg/ml) until the absorbance
214
Table 1 Oligonucleotide primers used for construction of Xyn11A and
its derivatives
Primer
ATTGCTCAGCGCCGCCGATTGTAATCGTAT
Mini Profinity IMAC and a Bio-Gel P6 desalting cartridge in
accordance with the manufacturer’s instructions (Bio-Rad
Laboratories, Hercules, CA, USA). Protein concentrations
were determined using the Pierce BCA assay kit (Thermo
Fisher Scientific, Waltham, MA) with bovine serum albumin
as the standard. The homogeneity of the purified proteins was
analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). SDS-PAGE was performed on 5 to
20 % gradient polyacrylamide gels (Atto, Tokyo, Japan) according to manufacturer’s instructions. Samples used for
SDS-PAGE were boiled for 5 min in sample buffer containing
dithiothreitol (DTT; Sigma-Aldrich). After electrophoresis,
gels were stained with Coomassie brilliant blue R-250 (BioRad Laboratories). Molecular mass standards were from BioRad Laboratories.
ATTGCTCAGCTGTAATCGTATTGCTTGTAA
TTGTCGCGCT
Enzyme activity
Sequence 5′ → 3′
Xyn11A
XYNW-for*
XYNW-rev
XynXL
GGAATTCCATATGGTA ACGATTACGAAT
XL-rev
XynX
X-rev
LS11
LS11-rev
LS7
LS7-rev
LS4
LS4-rev
ATTGCTCAGCACCTGTATTACCGCCGCCA
ATTGCTCAGCATTGATTTCCAAATAATCGA
ATTGCTCAGCCGCGCTTCCGCTGCTTTGGT
ATTGCTCAGCGCCGCCGCCGTTGCC
LS1
LS1-rev
Xylanase activity was measured by determining the amount of
reducing sugar released from birchwood xylan, oat-spelt xylan, and arabinoxylan (Sigma-Aldrich; Okada and Shinmyo
1988). The reaction mixture consisted of 0.9 ml of 0.5 % (w/v)
xylan substrate in 0.1 M sodium acetate buffer at pH 6.0 and
0.1 ml enzyme (Pason et al. 2010). After incubation for
10 min, the reaction was stopped by boiling, and the mixture
was separated by centrifugation at 12,100×g for 10 min.
Released reducing sugars were quantified by the Somogyi–
Nelson method with xylose as a standard (Wood and Bhat
1988). Xylanase activity (1 unit) was defined as the amount of
enzyme that liberated 1 μmol of reducing sugar in 1 min under
the above conditions (Okada and Shinmyo 1988).
Endoglucanase, mannanase, and pectinase activities were
measured based on the amount of reducing sugar liberated
from carboxymethylcellulose (CMC), barley glucan, carob
ATTGCTCAGCATTGCTTGTAATTGTCGCGC
NdeI and Bpu1102I restriction sites are underlined.
*
XYNW-for was used for the construction of all forward primers
reached 0.6–0.8 at 600 nm. Protein expression was carried out
at 18 °C with the addition of 1 mM isopropyl-thio-β-D-galactoside (IPTG) to the culture media. After cultivation for 16 h,
E. coli cells were harvested by centrifugation (5,000×g,
10 min, 4 °C) and were frozen at −80 °C for 24 h. The frozen
cell pellet was resuspended in 50 mM sodium phosphate
buffer (pH 7.4), and recombinant proteins were extracted by
sonication. Cell free extracts were separated into lysates and
cell debris by centrifugation (12,100×g, 10 min, 4 °C). Each
recombinant protein was purified with the Profinia affinity
chromatography protein purification system using Bio-Scale
Fig. 1 Schematic representation
of the molecular architecture of
Xyn11A (a) and its truncated
derivatives (b). The molecular
architecture of each domain
designed based on CDD analysis.
Capital letters indicate a part of
the amino acid sequence of the
GH11 domain, the linker region
and CBM36. Boxed amino acids
indicated highly conserved amino
acids of GH11 xylanases of
Paenibacillus and Bacillus
species Histidine tags of each
recombinant protein are indicated
as H- in the N-terminal region.
Numbers in parentheses show the
predicted molecular mass
215
based on Xyn11A. Molecular graphics were prepared using
the homology model of the UCSF Chimera program
(Beckham et al. 2010), and energy minimization was performed using the AMBER10 software package (Case et al.
2005; Salomon-Ferrer et al. 2013).
galactomannan, arabinan, and polygalacturonic acid (all from
Sigma-Aldrich), respectively, at a 0.5 % (v/w) final concentration. β-Glucosidase, β-xylosidase, and α-Larabinofuranosidase activities were based on measurement
of p-nitrophenol release from p-nitrophenyl β-D-glucoside
(PNPG), p-nitrophenyl β-D-xyloside (PNPX), and p-nitrophenyl β-D-arabinopyranoside (PNPA), respectively (all from
Sigma-Aldrich; Matsuo and Yasui 1988). The optimal pH
was determined with birchwood xylan in buffer at pHs 4.0
to 9.0 at 60 °C. Buffers used were 0.1 M sodium acetate buffer
for pH 4.0 to 6.0, 0.1 M phosphate buffer for pH 6.0 to 8.0,
and 0.1 M Tris–HCl buffer for pH 8.0 to 9.0. For pH stability,
the enzyme was preincubated without substrate in buffers of
different pHs for 1 h at 37 °C, and then the xylanolytic activity
was measured at 60 °C for 10 min (pH 6.0). The optimal
temperature was determined at pH 6.0 (sodium acetate buffer)
from 40 to 80 °C. Thermostability was monitored by preincubating the enzyme without substrate in sodium acetate
buffer (pH 6.0) for 30 min at 40 to 100 °C. Residual enzyme
activity in each case was then assayed under standard assay
conditions. For the determination of kinetics parameters, Km
and Vmax values for the purified recombinant enzymes were
analyzed using the Lineweaver–Burk method. Enzyme activity was assayed for 10 min at 60 °C in sodium acetate buffer
(pH 6.0) containing 1 to 10 mg/ml birchwood xylan.
Circular dichroism spectroscopy
Circular dichroism (CD) spectroscopy was performed on a
J-820 spectropolarimeter (Jasco, Easton, MD) using a rectangular quartz cell with a 1 mm path length. Spectra were
acquired using a 1-s time response and a 20 nm/min scan
speed; the spectra were averaged for four acquisitions. Individual proteins were analyzed at 7.97 μM in MilliQ water. The
percentage of beta-pleated sheets were calculated by secondary structural analysis using JWSSE-480 program (Jasco,
Easton, MD; Chang et al. 1978).
Energy minimization
All hydrogen atoms were added to the homology-modeled
structure of Xyn11A using the builder module, followed by
energy minimization with the AMBER 10 software package
(Case et al. 2005; Salomon-Ferrer et al. 2013). The protein
then was solvated with ~9100 TIP3P water molecules in a
12 Å cubic box (Jorgensen et al. 1983). Sodium ions were
added to neutralize the system. Subsequently, the solvated
protein was minimized. First, the steepest descent algorithm
was used for 1,000 steps to remove close van der Waals
contacts, followed by 2,000 steps of the more efficient conjugate gradient algorithm until a tolerance of 0.01 kcal/mol/Å
was reached. After minimization, the layer water was removed. Validation of the model was carried out using a
Ramachandran plot calculation computed with the Procheck
program (Laskowski et al. 1993).
Hydrolysis activity of xylooligosaccharides using Xyn11A
and its derivatives
Xyn11A, XynXL, and XynX were incubated in sodium acetate
buffer (pH 6.0) containing 0.5 % (w/v) xylooligosaccharides
(X2–X6; xylobiose, xylotriose, xylotetraose, xylopentaose,
and xylohexaose; Megazyme International, Wicklow, Ireland)
overnight at 60 °C. After incubation, the reactions were
stopped by boiling, and the mixtures were separated by centrifugation at 12,100×g for 10 min. The monodsaccharide and
oligosaccharide contents in the supernatants were measured by
high-performance liquid chromatography (HPLC; Shimadzu,
Kyoto, Japan) with a refractive index (Shimadzu RID-10A)
detector on a Bio-Rad Aminex HPX-87P column (Bio-Rad
Laboratories) operated at 80 °C with MilliQ-filtered water
(Millipore, Billerica, MA, USA) at a flow rate of 0.4 ml/min.
Molecular docking
Xylooligosaccharides that are likely to be involved in substrate binding were generated by the SWEET-II program
(Bohne et al. 1998, 1999), and energy minimization was
performed with HyperChem 8.0 (Hypercube, Gainesville,
FL). The program GOLD version 3.0.1 (Verdonk et al.
2003) was used to generate and rank initial potential binding
poses for xylooligosaccharides to the protein target. Flexible
xylooligosaccharides were docked to the active site of
Xyn11A using a Lamarckian Genetic Algorithm. The simulation consisted of 100 docking runs, with 10,000 generations in
each run (at a maximum of 1,000,000 energy evaluations).
After docking, all structures generated for the single compound were assigned to clusters based on a tolerance of 2 Å
for all atom root-mean-square deviations (RMSDs) from the
lowest energy structure.
Homology modeling
ESPript was used for sequence based alignment (http://espript.
ibcp.fr/ESPript/ESPript/) (Gouet et al. 1999). Protein structure
modeling of a family 11 xylanase from Bacillus sp. 41 m-1
obtained from the SWISS-MODEL protein-modeling server
(http://swissmodel.expasy.org/: PDB accession number
2DCJ_A, chain A of alkaliphilic Xynj from Bacillus sp.
41 m-1) was used as the template structure for building the
three-dimensional (3D) structure of the recombinant proteins
216
kDa
Results
M 1 2 3 4 5 6 7
150
100
75
Enzymatic properties of Xyn11A and the role of CBM36
Xyn11A, the 40 kDa major xylanase subunit in the extracellular multienzyme complex of P. curdlanolyticus B-6, was
cloned and sequenced previously (Pason et al. 2010). Xyn11A
is composed of two major functional domains: a catalytic
domain belonging to family-11 glycosyl hydrolases (GH11),
and a carbohydrate binding module classified as family-36
(CBM36). A glycine- and asparagine-rich linker was present
between the two domains (Fig. 1a). The two functional domains of GH11 and CBM36 were subsequently characterized
for their enzymatic functions and protein structures (Boraston
et al. 2004; Paës et al. 2012). First, to evaluate the carbohydrate
hydrolysis ability of Xyn11A, the enzymatic properties were
characterized using recombinant Xyn11A for xylan and other
carbohydrate substrates. Xyn11A had a high specific activity
for birchwood xylan (89.7±1.2 U/mg protein), oat-spelt xylan
(60.5±1.0 U/mg protein) and arabinoxylan (33.6±1.4 U/mg
protein), while no activity was observed with PNPG, PNPX,
PNPA, carboxymethylcellulose, glucan, arabinan, mannan, or
pectin. The pattern of hydrolyzed xylooligosaccharides was
analyzed by HPLC. Xyn11A mainly produced xylobiose and
xylotriose from xylooligosaccharides, but was not active with
xylobiose and was less active with xylotriose than other
xylooligosaccharides. The optimal pH for xylanase activity
of Xyn11A was 6.0 and the enzyme stability was in the range
of pH 6.0 to 7.0. The temperature for maximum activity was
found to be 60 °C at pH 6.0. These enzymatic properties and
the narrow substrate specificity of Xyn11A correspond to those
of other known GH11 xylanases. To measure substrate affinity
and catalytic efficiency, the kinetic parameters of Xyn11A
toward birchwood xylan were determined by Michaelis–
Menten analysis. The initial reaction rates were determined
from the kinetic curves of each reaction, which contained
different xylan concentrations. The Km and Vmax values for
Xyn11A were estimated to be 1.5±0.1 mg/ml and 137.0±
1.0 μmol/min/mg protein, respectively.
CBM36 is known to be a calcium-dependent xylan binding
module that can form direct interactions with the substrate
through a single atom of the bivalent metal (Boraston et al.
2004). To understand the role of CBM36 in Xyn11A, xylan
degradation activities were compared with those of XynXL
constructed as a recombinant protein with a truncated CBM36
(Figs. 1b and 2). Although there were no differences in xylan
degradation activity or other properties between XynXL and
Xyn11A when soluble xylan (birchwood xylan) was used as a
substrate, the degradation activity of Xyn11A and XynXL for
insoluble xylan (oat-spelt xylan) was 31.4±1.7 and 17.9±
2.5 U/mg protein, respectively. These results indicate that
CBM36 in Xyn11A helps improve the accessibility to the
catalytic domain for an insoluble xylan substrate.
50
37
25
20
Fig. 2 SDS-PAGE analysis of purified Xyn11A and its truncated derivatives. The designed recombinant proteins were produced by Escherichia
coli harboring each plasmid (see “Materials and methods” section). Lane
M, standard protein molecular mass makers; lane 1, intact Xyn11A; lane
2, XynXL (truncated CBM36); lane 3, XynX (truncated linker and
CBM36); lane 4, LS11 (XynX with NTITIGGNGGG of the linker
sequence); lane 5, LS7 (XynX with NTITIGG of the linker sequence);
lane 6, LS4 (XynX with NTIT of the linker sequence); lane 7, LS1 (XynX
with N of the linker sequence). Each lane contains 1 μg of protein
Role of the amino acid sequence neighbor linker
on the xylanase activity of Xyn11A
A glycine- and asparagine-rich linker sequence is located
between GH11 and CBM36 in Xyn11A (Fig. 1a). The linker
sequence has unique features including a relatively long amino acid sequence that is located from amino acid positions 236
to 268 and consists of 20, 9, and 4 residues of glycine,
asparagine, and threonine from a total of 33 amino acids
residues, respectively (Fig. 1a). The linker sequence has been
frequently observed in several bacterial xylanases belonging
to GH11. On the other hand, according to the conserved
domain database (CDD; http://www.ncbi.nlm.nih.gov/cdd/),
the conserved GH11 xylanase domain included residues 46
to 230 in Xyn11A (Fig 1a). When the amino acid sequence of
the N-terminal side neighbor linker sequence of Xyn11A was
compared with that of other GH11 xylanases with similar
overall structures, it was observed that the 11 amino acid
(NTITIGGNGGG) sequence was relatively conserved for
other sequences possessing GH11 xylanases of Paenibacillus
and Bacillus species (Fig. 3). To determine the role of the 11
amino acids in Xyn11A, XynX, in which the linker sequence
including the 11 amino acids was removed from XynXL, was
also constructed as a recombinant protein (Figs. 1b and 2). When
the xylan hydrolysis activity of XynX was measured using
arabinoxylan, birchwood xylan, and oat-spelt xylan as substrates,
the degradation activities markedly decreased to almost undetectable levels (<0.3±0.05 U/mg protein). XynX also showed a
loss of hydrolysis activity for xylooligosaccharides. Although
similar research characterizing xylanase activity using
217
Fig. 3 Amino acid sequence alignment of linker sequences and bacterial
GH11 xylanases. The listed xylanases have high homology of over 56 %
for GH11 of Paenibacillus curdlanolyticus B-6 Xyn11A (top) from
BLAST analysis. Accession numbers are shown in parentheses. Strictly
and highly conserved residues are marked with asterisks and periods on
the bottom of the sequences
derivatives with truncated CBM and linker sequences has been
reported for other GH11 xylanases (Kosugi et al. 2002; Morris
et al. 1998; Paloheimo et al. 2007), in many cases, the xylanase
activity was not influenced by truncation of these domains. Thus,
the 11 amino acid neighbor linker sequence of Xyn11A appears
to play an important role in the catalytic domain.
(Fig. 4). When the secondary structure of XynX was compared
with that of XynXL, both alignments exhibited a typical GH11
xylanase structure consisting of 12 β-sheets and one major αhelix (Fig. 4). Although the alignment of XynX exhibited an
overall β-jelly roll shape, gaps were observed in the beginning
position (Leu100-Ser101) of β6 and the end position (Thr229Leu235) of the β12-sheets compared with XynXL (Fig. 4). On
the other hand, to insure the proteins were not improperly folded,
CD spectroscopy was performed to compare the secondary
structures of XynXL and XynX individually. Deconvolution of
the CD spectra indicated that XynXL and XynX have a predominant β-sheet and the ratio of β-sheet exhibits 99 and 91 %,
respectively. These results may reflect the gap of β6- and β12sheets with XynX. Although the spectra of XynXL and XynX
showed a slightly misfitting and deepening at 220 nm (Fig. 5),
the spectrum of XynX was almost the same as XynXL. Thus, the
3D structure of GH11 with or without the linker sequence
including the 11 amino acids in Xyn11A
XynX truncated by 11 amino acids (NTITIGGNGGG) showed a
loss of the ability to degrade xylan for all substrates. Truncation
of the conserved amino acid sequences may affect the structure
of the GH11 domain. To confirm whether truncation of the 11
amino acids influences GH11 structure, a secondary structural
alignment of XynXL and XynX was carried out using ESPript
Fig. 4 Sequence-based alignment of the GH11 domain of XynXL and XynX. Secondary structural elements are shown above for the 3D solved
structure. Differences in structural elements are highlighted in yellow
218
Mol. ellip. (x10-3 dg.cm2/dmol)
6
5
XynXL
4
XynX
org/) based on the X-ray structure of Bacillus sp. 41 m-1 Xynj
(PDB accession number 2DCJ, chain A), which showed the
highest identity percentage (68 %) among the available amino
acid sequences (Fig. 6a). In modeling of XynXL and XynX,
significant differences could not be observed between them
with or without vector-derived amino acid sequences such as
the His-tag. The gaps in the β6- and β12-sheets in XynX were
represented as short β-strands in the 3D structure (Fig. 6a).
When molecular graphics were generated based on the 3D
structures of Xyn-XL and Xyn-X using the UCSF chimera
program (Beckham et al. 2010), small grooves were observed
in the β-jelly roll hold area near the β6- and β12-sheets, where
fingers in the GH 11 structure are observed (Fig. 6b). On the
other hand, when the superimposed models were compared
using the 3D structures of XynXL and XynX, no differences in
the positions and angles of the two active site glutamates
(Glu128 and Glu218) located on either side of the long open
cleft were noted (Fig. 7). Thus, it appears that the xylanase
activity loss upon truncation of XynX was not related to the
GH11 active site.
3
2
1
0
-1
200
210
220
230
240
250
-2
-3
-4
Wavelength (nm)
Fig. 5 CD spectra of XynXL and XynX. XynXL is shown by the solid
line, XynX is shown by the dotted line
reduced activity of XynX may be not due to drastic alteration in
the structure. These results suggested that a minimum of NTITI
in the conserved amino acid sequence is not only a part of the
GH11 xylanase domain, but is also important for configuring its
β6- and β12-sheets.
The three-dimensional (3D) structures of XynXL and XynX
were generated using the homology model of the SWISSMODEL protein-modeling server (http://swissmodel.expasy.
Fig. 6 Comparison of the GH11
structure of XynXL and XynX.
Schematic and surface
representation of XynXL and
XynX are shown above (a) and
below (b), respectively. The αhelices and β-strands of each
GH11structure are labeled as α,
α1, β6, and β12, respectively.
The N and C termini of each GH
structure are labeled. Dotted
circles indicate conformational
differences due to truncation of
the linker sequence (a). The small
groove is indicated by the black
arrow on the surface model of
XynX (b)
Properties of substrate docking in XynX
On the superimposed models of XynXL and XynX, flipping
of the side chains of Arg163 (Fig. 7), where the subsite related
to substrate binding is located, was observed. To date, the
a
N
N
12
α1
12
6
C
6
C
XynXL
b
219
XynX
α
analyzed for XynXL and XynX. Analysis of the docking
model using xylohexaose as a model substrate revealed that
XynXL has a high binding energy of −8.28 kcal/mol in the
open cleft area containing the active site, while XynX showed
no binding affinity in that area (Table 2). The arginine side
chain of the neighboring active site is known to play an
important role in substrate binding at subsite (−1) via strong
hydrogen bonds (Cuyvers et al. 2011; Jommuengbout et al.
2009; Sabini et al. 1999; Vandermarliere et al. 2008). On the
other hand, XynX was able to bind xylohexaose at the secondary binding site located on the “fingertips” (Cuyvers et al.
2011; Table 2). Thus, the loss of xylanase for XynX may be
caused by marked decreases in substrate binding affinity at the
subsite due to flipping of the Arg163 side chains, indicating
that the conserved 11 amino acids also contribute to the
stability of the GH11 structure in Xyn11A.
To predict what length of amino acid sequence is necessary
to recover structure and activity, docking models were analyzed using several XynX models with different amino acids
in the conserved sequence. When four XynX models (Fig. 1b)
with the conserved amino acid sequence N (LS1), NTIT
(LS4), NTITIGG (LS7), and NTITIGGNGGG (LS11) were
docked with xylohexaose, the LS1 and LS4 models were
unable to bind the xylohexaose in the open cleft near the
active site, whereas LS7 and LS11 were found to bind it in
the cleft area (Table 2). In addition to the restitution of substrate binding, superimposed models of XynXL, LS7, and
LS11 showed that the flipped side chain of Arg163 in XynX
returned to its original angle by addition of a linker sequence
of 7 or 11 amino acids. To confirm whether the docking
models corresponded to actual xylan hydrolysis ability, LS1,
LS4, LS7, and LS11 were constructed as recombinant proteins
(Figs. 1b and 2) and assessed for xylanase activity. The
activity of LS1 and LS4 remained low (10 and 30 %,
Arg163
Glu128
Glu218
N
C
Fig. 7 Structure-based alignment of the GH11 domains of XynXL and
XynX. Superposition of the GH11 domains of XynXL (blue) with XynX
(yellow) is shown. Two glutamic acids (Glu128 and Glu218) and arginine
(Arg163) located in the substrate binding site were superimposed to
confirm angles
substrate binding sites of several GH11 xylanases have been
determined to be involved in xylan degradation (Cuyvers et al.
2011; Jommuengbout et al. 2009; Vandermarliere et al. 2008;
Wakarchuk et al. 1994). To determine whether the xylan
binding ability is influenced by truncation of the 11 amino
acid sequence, substrate docking and binding energies were
Table 2 Comparison of the binding interaction and xylanase activity between XynXL and its derivatives
Designed proteina
XynXL
XynX
LS1
LS4
LS7
LS11
-8.28
N.D.c
-1.47
-4.5
-7.99
-7.97
100
N.D.c
10
30
94
99
Docking modelb
Binding energy b
(kcal/mol)
Relative xylanase
activity (%)d
N.D. not detected
a
Features of designed proteins are shown in Fig. 1
b
Docking models and binding energy were obtained with SweetII and HyperChem 8.0 software, respectively, as described in “Materials and methods”
section. The xylohexaose molecule was modeled in the energetically highest binding region for each protein structure
c
Relative activity is given as a percentage of xylanase activity. Values are means of triplicate experiments
d
Relative activity is given as a percentage of xylanase activity. Values are means of triplicate experiments
220
why flipping of the side chain of Arg163 occurred from deletion of the C-terminal amino acids: flipping of the side chain of
Arg163 significantly influences the substrate binding ability to
the subsite adjacent to the active site. In GH11 xylanases of
Bacillus circulans, Bacillus firmus K-1, Bacillus
agaradhaerens, and Streptomyces sp. 38, the side chains of
arginine and hydrophobic amino acids, such as proline and
tyrosine neighboring the active site, are known to have important roles, such as forming hydrogen bonds between the side
chains and hydroxyl groups of the xylose moiety in the subsite
(de Lemos Esteves et al. 2004; Jommuengbout et al. 2009;
Sabini et al. 1999; Wakarchuk et al. 1994). Similarly, when site
direct mutation for the arginine related to subsite -1 was performed in GH11 xylanases of B. circulans, xylanase activity
was also significantly decreased compared with the activities
after other mutations in the subsite (Wakarchuk et al. 1994).
We recently determined that P. curdlanolyticus B-6 is able to
produce an extracellular multienzyme complex that was composed of a highly glycosylated 280 kDa protein with xylanase
activity, two xylanases of 40 kDa (Xyn11A) and 48 kDa, and
60 and 65 kDa proteins having both xylanase and CMCase
activities (Pason et al. 2010). From gene sequence analysis of
Xyn11A, we concluded that the multienzyme complex produced by P. curdlanolyticus B-6 should assemble by a mechanism distinct from the cohesin–dockerin interactions known in
cellulosomes because of the absence of dockerin-like homology sequences observed in cellulosomal enzyme subunits (Doi
and Kosugi 2004; Fontes and Gilbert 2010; Pason et al. 2010).
To elucidate the role of each subunit in xylan degradation and
complex formation, characterization of the possible 280 kDa
scaffolding subunit and Xyn11A should be first clarified
through understanding the structures and functions of the two
major subunits. Fungal and bacterial glycosyl hydrolases are
frequently subjected to post-translational modifications, such
as N- and O-glycosylation, and CBMs can also be involved in
binding polysaccharides in the bacterial cell wall and in enzymes (Ezer et al. 2008; Montanier et al. 2009). Further research on the structure and functions of these enzyme subunits
is necessary to clarify the mechanisms of complex formation.
respectively; Table 2) using birchwood xylan as a substrate,
while the activities of LS7 and LS11 recovered to 94 and 99 %
compared with that of XynXL, respectively. These results
were in good agreement with the predictions from the substrate docking model analysis using LS1, LS3, LS4, and LS7,
and the NTITIGG sequence was confirmed to be necessary to
stabilize the structure of GH11 xylanase.
Discussion
In this study, the xylan degradation ability of P. curdlanolyticus
B-6 Xyn11Awas characterized. The GH11 domain and CBM36
of Xyn11A have high homology with the endo-β-1,4 xylanase
from Paenibacillus xylaniclasticus (99 % identity, AFN70714),
Paenibacillus sp. Aloe-11 (75 % identity, WP_007429110),
Paenibacillus peoriae (75 % identity, WP_010347573),
Paenibacillus campinasensis (71 % identity, AGG82434),
Gracilibacillus lacisalsi (69 % identity, WP_018932277), and
Bacillus sp. YA-335 (68 % identity, CAA41784). It is known
that glycoside hydrolases that possess CBMs facilitate attack on
natural substrates (Boraston et al. 2004). CBMs are thought to
target the enzyme toward specific cell wall regions and maintain
it in the proximity of the substrate (Boraston et al. 2004). In fact,
XynXL shows decreased hydrolysis activity for insoluble xylan
substrates as compared with XynX. The CBM36 from
Paenibacillus polymyxa xylanase 43A shows calciumdependent binding of xylan and xylooligosaccharides (JamalTalabani et al. 2004). It is also known that CBM36 has structural
similarities with CBM6, which has been demonstrated to have a
cellulose-binding function (van Bueren et al. 2005). We also
found that the CBM domain of Xyn11A was able to bind xylan
as well as soluble and insoluble celluloses, such as carboxymethylcellulose, amorphous cellulose, and microcrystalline cellulose (Sermsathanaswadi 2012), suggesting that Xyn11A is
able to show flexible binding for complex plant cell wall
polysaccharides.
The 11 amino acid (NTITIGGNGGG) neighbor linker was
highly conserved in other GH11 xylanases, such as
Paenibacillus sp. Aloe11, P. peoriae, P. campinasensis,
Bacillus sp., and G. lacisalsi (Fig. 3). In particular, the
NTITIGG sequence might play an important role in stabilizing
GH11 structures, similar to the case with Xyn11A. In fact, loss
of the C-terminal seven amino acid neighbor xylanase domain
in Xyn11A resulted in the loss of xylanase activity due to
structural destabilization which was provoked by gaps in the
β6- and β12-sheets. These β-sheets are located dorsal to the
active site (Glu 218) of the GH11 xylanase catalytic domain.
Thus, the short stretch may involve a part of the catalytic
domain of GH family-11 xylanases. These structural features
suggested that at least a NTITIGG sequence including a part of
the linker is necessary for structural stabilization of the GH11
catalytic domain of Xyn11A. On the other hand, it is unclear
Acknowledgments This work was partly supported by Suan Dusit
Rajabhat University, Thailand. We would like to thank Dr. Surapong
Pinitglang (University of the Thai Chamber of Commerce, Thailand)
for useful suggestions and discussion of 3D modeling.
References
Beckham GT, Bomble YJ, Matthews JF, Taylor CB, Resch MG,
Yarbrough JM, Decker SR, Bu L, Zhao X, McCabe C, Wohlert J,
Bergenstråhle M, Brady JW, Adney WS, Himmel ME, Crowley MF
(2010) The O-glycosylated linker from the Trichoderma reesei
family 7 cellulase is a flexible, disordered protein. Biophys J
99(11):3773–3781. doi:10.1016/j.bpj.2010.10.032
221
protein structures. J Appl Crystallogr 26(2):283–291. doi:10.1107/
S0021889892009944
Matsuo M, Yasui T (1988) β-Xylosidases of several fungi. Meth
Enzymol 160:684–695
McNeil M, Darvill AG, Fry SC, Albersheim P (1984) Structure and
function of the primary cell walls of plants. Annu Rev Biochem
53(1):625–663. doi:10.1146/annurev.bi.53.070184.003205
Montanier C, van Bueren AL, Dumon C, Flint JE, Correia MA, Prates
JA, Firbank SJ, Lewis RJ, Grondin GG, Ghinet MG, Gloster TM,
Herve C, Knox JP, Talbot BG, Turkenburg JP, Kerovuo J,
Brzezinski R, Fontes CMGA, Davies GJ, Boraston AB, Gilbert HJ
(2009) Evidence that family 35 carbohydrate binding modules display conserved specificity but divergent function. Proc Natl Acad
Sci U S A 106(9):3065–3070. doi:10.1073/pnas.0808972106
Morris DD, Gibbs MD, Chin CWJ, Koh M-H, Wong KKY, Allison RW,
Nelson PJ, Bergquist PL (1998) Cloning of the xynB gene from
Dictyoglomus thermophilum Rt46B.1 and action of the gene product
on kraft pulp. Appl Environ Microbiol 64(5):1759–1765
Okada H, Shinmyo A (1988) Xylanase of Bacillus pumilus. Meth
Enzymol 160:632–637
Paës G, Berrin J-G, Beaugrand J (2012) GH11 xylanases: structure/
function/properties relationships and applications. Biotechnol Adv
30(3):564–592. doi:10.1016/j.biotechadv.2011.10.003
Paloheimo M, Mäntylä A, Kallio J, Puranen T, Suominen P (2007)
Increased production of xylanase by expression of a truncated
version of the xyn11A gene from Nonomuraea flexuosa in
Trichoderma reesei. Appl Environ Microbiol 73(10):3215–3224.
doi:10.1128/aem.02967-06
Pason P, Kosugi A, Waeonukul R, Tachaapaikoon C, Ratanakhanokchai
K, Arai T, Murata Y, Nakajima J, Mori Y (2010) Purification and
characterization of a multienzyme complex produced by
Paenibacillus curdlanolyticus B-6. Appl Microbiol Biotechnol
85(3):573–580. doi:10.1007/s00253-009-2117-2
Pason P, Kyu KL, Ratanakhanokchai K (2006) Paenibacillus
curdlanolyticus strain B-6 xylanolytic–cellulolytic enzyme system
that degrades insoluble polysaccharides. Appl Environ Microbiol
72(4):2483–2490. doi:10.1128/aem.72.4.2483-2490.2006
Pauly M, Keegstra K (2010) Plant cell wall polymers as precursors for
biofuels. Curr Opin Plant Biol 13(3):304–311. doi:10.1016/j.pbi.
2009.12.009
Sabini E, Sulzenbacher G, Dauter M, Dauter Z, Jørgensen PL, Schülein
M, Dupont C, Davies GJ, Wilson KS (1999) Catalysis and specificity in enzymatic glycoside hydrolysis: a 2,5B conformation for the
glycosyl-enzyme intermediate revealed by the structure of the
Bacillus agaradhaerens family 11 xylanase. Chem Biol 6(7):483–
492
Saha B (2003) Hemicellulose bioconversion. J Ind Microbiol Biotechnol
30(5):279–291. doi:10.1007/s10295-003-0049-x
Salomon-Ferrer R, Case DA, Walker RC (2013) An overview of the
Amber biomolecular simulation package. Wiley Interdisciplinary
Reviews. Comput Mol Sci 3(2):198–210. doi:10.1002/wcms.1121
Scheller HV, Ulvskov P (2010) Hemicelluloses. Ann Rev Plant Biol
61(1):263–289. doi:10.1146/annurev-arplant-042809-112315
Sermsathanaswadi J (2012) Influence to xylanase activity by carbohydrate binding modules family 36 with Xyn11A in Paenibacillus
curdlanolyticus B-6. In: Punyauppapath P, Pattanapipitpaisal P,
Wattanakosol A (eds) The 24th annual meeting of the Thai Society
for Biotechnology: renewable energy and global care, Bangkok,
Nov 29–30 2012, vol 24. Thai Society for Biotechnology,
Bangkok, pp 17–22
van Bueren AL, Morland C, Gilbert HJ, Boraston AB (2005) Family 6
carbohydrate binding modules recognize the non-reducing end of β1,3-linked glucans by presenting a unique ligand binding surface. J
Biol Chem 280(1):530–537. doi:10.1074/jbc.M410113200
Vandermarliere E, Bourgois TM, Rombouts S, van Campenhout S,
Volckaert G, Strelkov SV, Delcour JA, Rabijns A, Courtin CM
Berg B, Hofstan BV, Petterson B (1972) Growth and cellulase formation
by Cellvibrio fulvus. J Appl Bacteriol 35(2):201–214
Berman H, Henrick K, Nakamura H (2003) Announcing the worldwide
Protein Data Bank. Nat Struct Mol Biol 10(12):980. doi:10.1038/
nsb1203-980
Bohne A, Lang E, von der Lieth C-W (1998) W3-SWEET: carbohydrate
modeling by internet. J Mol Model 4:33–43. doi:10.1007/
s008940050068
Bohne A, Lang E, von der Lieth CW (1999) SWEET - WWW-based
rapid 3D construction of oligo- and polysaccharides. Bioinformatics
15(9):767–768. doi:10.1093/bioinformatics/15.9.767
Boraston AB, Bolam DN, Gilbert HJ, Davies GJ (2004) Carbohydratebinding modules: fine-tuning polysaccharide recognition. Biochem
J 382(3):769–781
Caffall KH, Mohnen D (2009) The structure, function, and biosynthesis
of plant cell wall pectic polysaccharides. Carbohydr Res 344(14):
1879–1900. doi:10.1016/j.carres.2009.05.021
Case DA, Cheatham TE, Darden T, Gohlke H, Luo R, Merz KM,
Onufriev A, Simmerling C, Wang B, Woods RJ (2005) The
Amber biomolecular simulation programs. J Comput Chem
26(16):1668–1688. doi:10.1002/jcc.20290
Chang CT, Wu C-SC, Yang JT (1978) Circular dichroic analysis of
protein conformation: inclusion of the β-turns. Anal Biochem
91(1):13–31. doi:10.1016/0003-2697(78)90812-6
Cuyvers S, Dornez E, Rezaei MN, Pollet A, Delcour JA, Courtin CM
(2011) Secondary substrate binding strongly affects activity and
binding affinity of Bacillus subtilis and Aspergillus niger GH11
xylanases. FEBS J 278(7):1098–1111. doi:10.1111/j.1742-4658.
2011.08023.x
de Lemos Esteves F, Ruelle V, Lamotte-Brasseur J, Quinting B, Frère J-M
(2004) Acidophilic adaptation of family 11 endo-β-1,4-xylanases:
modeling and mutational analysis. Protein Sci 13(5):1209–1218.
doi:10.1110/ps.03556104
Doi RH, Kosugi A (2004) Cellulosomes: plant-cell-wall-degrading enzyme complexes. Nat Rev Micro 2(7):541–551. doi:10.1038/
nrmicro925
Ezer A, Matalon E, Jindou S, Borovok I, Atamna N, Yu Z, Morrison M,
Bayer EA, Lamed R (2008) Cell surface enzyme attachment is
mediated by family 37 carbohydrate-binding modules, unique to
Ruminococcus albus. J Bacteriol 190(24):8220–8222. doi:10.1128/
jb.00609-08
Fontes CMGA, Gilbert HJ (2010) Cellulosomes: highly efficient
nanomachines designed to deconstruct plant cell wall complex
carbohydrates. Annu Rev Biochem 79(1):655–681. doi:10.1146/
annurev-biochem-091208-085603
Gouet P, Courcelle E, Stuart DI, Métoz F (1999) ESPript: analysis of
multiple sequence alignments in PostScript. Bioinformatics 15(4):
305–308. doi:10.1093/bioinformatics/15.4.305
Jamal-Talabani S, Boraston AB, Turkenburg JP, Tarbouriech N, Ducros
VMA, Davies GJ (2004) Ab initio structure determination and
functional characterization of CBM36: a new family of calciumdependent carbohydrate binding modules. Structure 12(7):1177–
1187. doi:10.1016/j.str.2004.04.022
Jommuengbout P, Pinitglang S, Kyu KL, Ratanakhanokchai K (2009)
Substrate-binding site of family 11 xylanase from Bacillus firmus K-1
by molecular docking. Biosci, Biotechnol, Biochem 73(4):833–839
Jorgensen WL, Chandrasekhar J, Madura JD, Impey RW, Klein ML
(1983) Comparison of simple potential functions for simulating
liquid water. J Chem Phys 79(2):926–935. doi:10.1063/1.445869
Kosugi A, Murashima K, Doi RH (2002) Xylanase and acetyl xylan
esterase activities of XynA, a key subunit of the Clostridium
cellulovorans cellulosome for xylan degradation. Appl Environ
Microbiol 68(12):6399–6402. doi:10.1128/aem.68.12.6399-6402.
2002
Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1993)
PROCHECK: a program to check the stereochemical quality of
222
Table of Contents
(2008) Crystallographic analysis shows substrate binding at the −3
to +1 active-site subsites and at the surface of glycoside hydrolase
family 11 endo-1,4-β-xylanases. Biochem J 410(1):71–79
Verdonk ML, Cole JC, Hartshorn MJ, Murray CW, Taylor RD (2003)
Improved protein–ligand docking using GOLD. Proteins: Struct
Funct Bioinforma 52(4):609–623. doi:10.1002/prot.10465
Wakarchuk WW, Campbell RL, Sung WL, Davoodi J, Yaguchi M (1994)
Mutational and crystallographic analyses of the active site residues
of the Bacillus circulans xylanase. Protein Sci 3(3):467–475. doi:10.
1002/pro.5560030312
Wood TM, Bhat KM (1988) Methods for measuring cellulase activities.
Meth Enzymol 160:87–112
223