1. Health - CORALZOO

Transcription

H
1
CORALZOO
3.7. HEALTH CONTROL: PROTOCOLS FOR DIAGNOSIS AND TREATMENT OF CORAL
DISEASES, PARASITES and PESTS
3.7.1. Introduction
Gian Marco Luna
Coral reefs are probably the most complex and biologically diverse marine ecosystems on
Earth and provide ecological, environmental and economic services to millions of people, in
terms of tourism and recreation, food resources, coastal protection and the ornamental
aquarium trade. In the last years, the global trade of tropical stony corals for ornamental,
educational or scientific purposes has increased significantly. This is also due to the
increasing number of public exhibits showing live Scleractinian corals (aquariums, zoos and
museums) and private hobbyists breeding stony corals in their private tanks.
Diseases and disease-like syndromes of Scleractinian corals in natural reefs have
increased significantly in the last decade, and they are now recognized as important
phenomena capable of altering the structure and composition of tropical reef ecosystems.
There is increasing evidence that diseases of wildlife populations, including Scleractinian
corals, have increased in frequency in the last years as a consequence of an increased
anthropogenic pressure, including global and local threats acting alone or in a complex array
of synergistic interactions. The complexity of these interactions make it extremely difficult to
identify factors and causes for the observed diseases.
According to Weil et al. (2004), “disease” is defined as any “impairment of an
organism’s vital organ, system and/or body function”, manifested by a characteristic set of
clinical signs. Such a definition includes both “infectious” diseases, i.e. those caused by
pathogenic organisms (bacteria, protozoa or fungi) or biological entities (viruses), and “noninfectious” (or “abiotic”) diseases, i.e. those caused by genetic mutations, malnutrition and/or
environmental stressors (such as, for instance, chemicals, sedimentation of particles and
other causes). “Abiotic” diseases also include inherent or congenital defects, which – in turn
– may manifest themselves as a result of environmental stress. In coral health and disease
studies, the term “disease” is generally applied to all those conditions in which the causative
agent has been identified, while “syndrome” is generally used when causative agents are not
known. “Biotic” diseases are generally infectious (can be transmitted from affected to
unaffected corals living in the same tank). To complicate this picture, infectious diseases can
also be caused by microorganisms that are non-infectious under ambient environmental
conditions, but become pathogenic in response to environmental changes (e.g. increase in
temperature). In addition, many microorganisms that are the presumed cause of a disease
may be “opportunistic” pathogens and manifest their virulence only when the host is stressed
or the host's immune system is altered (Lesser et al. 2007).
In the aquarium, diseases and/or abnormal conditions of stony corals can include:
i)
non-infectious physiological and morphological changes
ii)
parasitic infections by protozoans and/or metazoans
iii)
growth anomalies (e.g. tumors)
iv)
infectious diseases (caused by agents such as bacteria, fungi or viruses and
transmittable between hosts living in the same tank).
Many abnormalities are not adequately characterized and are indistinguishable to the
untrained eye. In addition, the diagnostic processes for investigation of many coral diseases
are still in their infancy (Ainsworth et al. 2007). Difficulties in diagnosing coral disease are
due to lack of adequate knowledge about most frequent diseases (most diseases being
characterized only based on gross descriptions of lesions), confusions in disease
terminology (many existing descriptions are ambiguous and thereforesubjected to open
interpretation even among scientists) and lack of useful and easy-to-use diagnostic tools for
the scientific or commercial market. The observed difficulty in disease identification among
September 2009
H
2
CORALZOO
the hobbyist community reflects the confusion and disagreement often reported even among
coral disease researchers (Work and Aeby, 2006).
It is now evident that the field of coral health and disease is a multi-disciplinary topic,
which cannot be sufficiently covered by means of simple, observation-based approaches. A
combination of microbiological, histological, molecular and cellular biology tools is required
for a complete monitoring of the health of captive corals. Given the complexity of the
holobiont physiology and its interactions with the surrounding environment, the concerted
work of coral biologists, environmental microbiologists, veterinarians and veterinary
pathologists, toxicologists and biochemists, histo-pathologists and even virologists is ideally
needed. The study of coral disease requires a slightly different approach compared to that
utilised for investigating diseases of terrestrial organisms, as well as that of other aquatic
organisms. The coral diagnostician must possess also a broad knowledge about the
functioning of the marine environment, in order to try to relate clinical findings to
environmental conditions or – in case of the aquarium - the tank environment. With all these
limitations in mind, it is evident that intensive and multidisciplinary laboratory investigations
are required in many cases for determining the exact causes of a lesion/disease observed in
a stony coral colony in aquarium.
We present in this Section some practical and laboratory protocols, which can be
used by aquarium curators for the possible identification and treatment of diseases or other
abnormal conditions observed in aquarium stony corals. The Chapter “Flow chart for
interpreting lesions and identifying diseases or abnormal conditions in aquarium stony corals”
describes a series of steps which can be adopted for investigating coral lesions or for
diagnosing coral diseases. Finally, the chapter “Guidelines for treatment and prevention of
several common predators and pests in marine aquaria” contains some general guidelines
for the treatment of the most common predators, parasites and pests of stony corals in
aquaria.
References
Ainsworth, T.D., E. Kramasky-Winter, Y. Loya, O. Hoegh-Guldberg and M. Fine, 2007.
Coral disease diagnostics: what’s between a plague and a band? Appl. Environ. Microbiol.
73: 981-992.
Lesser, M.P., J.C. Bythell, R.D. Gates, R.W. Johnstone and O. Hoegh-Guldberg, 2007. Are
infectious diseases really killing corals? Alternative interpretations of the experimental and
ecological data. J. Exp. Mar. Biol. and Ecol. 346: 36-44.
Weil, E., G. Smithand and D.L. Gil-Agudelo, 2006. Status and progress in coral reef disease
research. Dis. Aquat. Org. 69:1-7.
Work, T.M. and G.S. Aeby, 2006. Systematically describing gross lesions in corals. Dis.
Aquat. Org. 70: 155-160.
September 2009
H
3
CORALZOO
3.7.2. General guidelines for treatment and prevention of several common predators,
pests and pathogens in marine aquaria. Chapter of CORALZOO Book of Protocols.
Tim Wijgerde
Coral aquaria harbour an impressive array of marine species, of which not all may be
desirable to the keeper or viewer. An aquarium is an unnatural, unbalanced vivarium which
contains only a fraction of an ecosystem’s species. This often leads to imbalances in the
overall population of the aquarium, after which one or several species may quickly dominate
it. These so-called pest species will often outcompete other, more desirable ones. The most
common pest species in marine aquaria are Aiptasia sp. (sea anemones which contain
symbiotic zooxanthellae), Planaria (non-parasitic flatworms), corallivore polyclad flatworms,
Nudibranchs (a group of shell-less snails), parasitic crustaceans (Acropora ‘red bugs’),
polychaetes (bristle worms) and Myrionema sp. (a group of Hydrozoans). This chapter offers
some general background on and guidelines for treatment of these species. It must be noted
that biological treatment methods, such as the introduction of specific predators, should be
preferred over chemical ones.
A. Biological and chemical treatment methods
Aiptasia:
Aiptasia is a genus of symbiotic sea anemones which comprises several species such as
Aiptasia pallida. Similar to corals, they harbour dinoflagellate algae from the genus
Symbiodinium which provide them with nutrients through photosynthesis. They also capture
plankton with their tentacles, and they quickly multiply (a)sexually in aquaria. Although being
interesting animals, they harm many aquarium inhabitants with their potent stinging cells.
They are now considered as pest species due to their proliferative and destructive nature,
and they are actively removed by many aquarists.
Fig.1. Aiptasia mirabilis on aquarium
window (photograph Jorick Hameter
Biological treatment:
Several natural predators for Aiptasia exist, and these
include butterfly fish, shrimp and Nudibranchs. Members
from the Chaetodontidae family, which includes many
species of butterfly fish such as Chelmon rostratus, are an
excellent choice for keeping Aiptasia populations in check
(Carl, 2008). These fish are attractive as well, but not all
of them are easy to keep alive for prolonged periods.
These fish need adequate space, and should be able to
ingest live food such as Aiptasia, Mysids and adult
Artemia. This will also decrease feeding on corals, zoanthids and tube worms. Chelmon
rostratus is a hardy species when kept in tanks with ample sources of live food. It will often
also accept commercial feeds such as live or frozen Artemia and Mysis. For large systems,
significant specimens will be required to combat Aiptasia. This also depends on other
anemone predators present in the system. As a rule of thumb, one butterfly fish per 5,00010,000L may be introduced for keeping Aiptasia in check.
Some species of shrimp will also actively prey on small anemones, such as Lysmata
wurdemanni, commonly referred to as the peppermint shrimp (Carl, 2008). This species is
most active at night, and usually only preys on younger Aiptasia. This still makes them
suitable for keeping these anemones in check; adult specimens may be removed chemically.
September 2009
H
4
CORALZOO
Combining predators such as C. rostratus and L. wurdemanni may prove to be highly
effective.
Another suitable predator is the aeolid nudibranch Aeolidiella stephanieae (probably
erroneously referred to as Berghia verrucicornis, Valdés, 2005). Although Nudibranchs can
be destructive species, they are quite selective about their diet. B. verrucicornis will only prey
on Aiptasia; this species will target both young and adult anemones, making them an
excellent choice (Kempf & Brittsan, 1996). They will also reproduce by laying eggs.
Chemical treatment:
Chemically treating Aiptasia in large exhibits is far too time-consuming. Moreover, many
anemones simply cannot be reached due to their secluded lifestyle. This strategy is therefore
only suitable for smaller tanks. It is recommended to only remove adult specimens by
chemical treatment; the often abundant smaller ones can be effectively combated by
inserting natural predators.
Several chemicals work well for eliminating Aiptasia, of which calcium hydroxide (Ca(OH)2) is
the most suitable option. This chemical dissolves poorly, and will quickly precipitate out of the
water. By adding calcium hydroxide to fresh or marine water at a concentration of 2-3 g/l, the
solution becomes supersaturated. This mixture can immediately be dosed to any easily
accessible anemone by means of a syringe. The precipitated salt will ensure proper contact
with the animal, instead of being washed away quickly. It is highly recommended to
temporarily shut down flow pumps to ensure maximum contact with the anemones. The
result is a dissolving anemone, although it may regenerate if not destroyed completely. The
hydroxides will also have a positive effect on aquarium pH.
Planaria:
The Planariidae family is a group of non-parasitic flatworms, which belongs to the Turbellaria
class and phylum Platyhelminthes. Flatworms are truly cosmopolitan, occurring all over the
globe, in both fresh and salt water bodies. Some species are even terrestrial and are found
on plant-life, especially in humid environments. They move around by beating cilia located on
the ventral epidermis, allowing them to glide along on a film of mucus (Campbell et al, 1999).
Although Planaria is now the common term for describing marine flatworms, many genera
and species exist. Observed specimens in coral display tanks are often classified as
Dugesia, Waminoa or Convolutriloba sp. (Delbeek and Sprung, 2005).
Flatworms have several natural predators such as wrasses, dragonets and Nudibranchs.
Effective treatment with the species Halichoerus chrysus (Golden/Canary wrasse) and
Pseudocheilinus hexataenia (Sixline wrasse) has been reported repeatedly in the literature
(Carl, 2008, pers. obs.). These species are hardy animals, and will thrive in many reef tanks.
It must be noted that wrasses will jump from time to time, and they should therefore be kept
in well-closed off aquaria. They are also quite territorial, so it is recommended not to
overstock them. Finally, wrasses prefer aquaria with ample substrate as they often partially
bury themselves during night-time. Flatworm-infestations in aquaria have been reported to
quickly diminish after introduction of these wrasse species.
The nudibranch Chelidonura varians also is an effective flatworm predator, and is able to
track its prey by chemosensory organs (Sprung & Delbeek, 1996). It does not seem to prey
on other aquarium inhabitants.
September 2009
H
5
CORALZOO
Chemical treatment:
Flatworms are sensitive to a range of toxins, of which levamisole has been identified as a
potent one. This chemical is available under several commercial brand names such as
Concurrat. Levamisole is a so-called alkaline-phosphatase enzyme inhibitor, and a
neurotoxic agent which interferes with the flatworm's nervous system (Geary et al, 1992; van
Belle, 1972). For its ability to kill many (parasitic) flatworms, it is also classified as a member
of the antihelminthics. It is highly recommended to isolate a coral colony for quarantine
treatment, as the decay of large amounts of flatworms may release harmful toxins and
decrease water quality. Other invertebrate animals will also be negatively affected by such a
treatment. For detailed instructionsl on Planaria treatment including dosages and incubation
times, see protocol no. 3.7.4.1, 3.7.4.2 and 3.7.4.3 in this chapter.
Some flatworms do not respond to regular levamisole treatment. Polyclad flatworms which
often live on Acropora corals, commonly referred to as AEFW (Acropora eating flatworms,
Order Polycladida), may require higher levamisole dosages or alternative treatment. Applying
levamisole at a high concentration of 40 mg/l for 1 hour seems to be effective (Carl, 2008).
After 4 consecutive treatments, AEFW's may not return.
If the flatworms remain unresponsive, treatment with Ivomectin can be considered (Janse,
2008). Ivomectin is a common deworming medicine for cattle, sheep and pigs; it kills both
internal and external parasites. This product is also used to treat teleost and elasmobranch
fish against nematodes.
Care has to be taken regarding treatment duration, which seems effective after 3-6 hours
exposure time at a concentration of 2-4 mg/l Ivomectin. Shaking the colonies regularly during
treatment will help detach flatworms. Eggs seem insensitive to treatment, therefore the
procedure should be repeated at least once a week later, to break reproductive cycles by
killing young offspring. Three or four repetitive treatments over a one-month period is
recommended.
Iodine solutions, such as Lugol's solution1, have also proven to be effective (Carl, 2008).
Incubation times should be 30-60 seconds at a concentration of 1.32 ml Lugol's/l of
seawater. Treatment should be combined with rinsing and shaking the colonies, to detach
Nudibranchs from the coral. This will also remove egg clusters. Eggs seem insensitive to
treatment, therefore the procedure should be repeated several times. Four consecutive
treatments of once per week have proven to be successful.
Finally, using powerful jets of fresh water, AEFW's may be removed from corals still residing
in coral exhibits (Nosratpour, 2008). For this purpose, a hose with nozzle, fed by a
pressurized system, can be used to spray off flatworms from the corals. Many fish species,
including wrasses and surgeon fish, subsequently feed on the detached worms while floating
in the water column.
Nudibranchs:
Nudibranchs are members of the suborder Nudibranchia, class Gastropoda and phylum
Mollusca. These molluscs lack a mantle cavity and shell. They are hermaphrodites, but rarely
self-fertilize. Their primitive eyes are able to discern between light and dark. They breathe
through a fine network of bushy protrusions on their back, rather than using gills. Other
species have brightly colored tentacles, called cerata, which are used for breathing, digestion
and excretion. Nudibranchs are carnivores, and feed on a variety of animals such as
sponges, tunicates, corals, anemones, Hydrozoans, Bryozoans and bivalves. Some species
are cannibalistic. These animals sometimes appear in coral reef aquaria, and will often feed
on desirable species such as Montipora plate corals. Other species such as Phestilla
sibogae feed exclusively on corals of the genus Porites, which are located and recognized by
chemical cues (Murphy and Hadfield, 1997). One of the few desirable species in reef tanks is
the brightly coloured Chelidonura varians, which preys on flatworms (see Planaria section).
September 2009
H
6
CORALZOO
Another species, Berghia verrucicornis, actively preys on Aiptasia anemones (see Aiptasia
section).
Montipora plate corals are primary targets for many Nudibranchs (Carl, 2008, pers. obs.),
and these should be carefully inspected upon arrival. Any areas of exposed skeleton should
be checked very thoroughly as this is a good indication that nudibranchs may be present.
During daylight hours, Montipora eating Nudibranchs are most commonly found in crevices
where they are safe from potential predators. The same applies for egg masses, which are
routinely present.
Nudibranchs have several natural predators, including various species of wrasses. Effective
treatment of Montipora-eating Nudibranchs with the species Halichoerus chrysus
(Golden/Canary wrasse) and Pseudocheilinus hexataenia (Sixline wrasse) has been
reported repeatedly. When introducing wrasses to coral systems, the same guidelines apply
as described in the Planaria section. As chemical treatment has not been proven to be fully
effective, the introduction of predators is preferable.
Chemical treatment:
Similar to flatworms, Nudibranchs are sensitive to neurotoxic agents such as levamisole
(Carl, 2008). Optimal dosages seem to be quite higher for Nudibranchs; a levamisole
treatment at 40 mg/l for 4 hours effectively paralyses them. Treatment should be combined
with carefully brushing off colonies, to remove Nudibranchs from the corals. At least 4
consecutive dips spread over a month are recommended, as even after such a treatment,
Nudibranchs may reappear. A 5% loss of treated corals after 4 dips of 4 hours each was
reported by Carl.
Iodine solutions such as Lugol's may also be effective, although this has not been proven
sufficiently. Treatment should again be combined with brushing off colonies, to remove
Nudibranchs. This will also remove egg clusters. Eggs seem insensitive to treatment,
therefore the procedure should be repeated at least once a week later to break reproductive
cycles by killing young offspring.
Freshwater dips for about 10 seconds can also be effective, creating a strong osmotic
pressure within the nudibranch tissue. This will also affect coral cells and zooxanthellae, and
therefore this treatment should be considered as a last resort. Make sure temperature and
pH levels of the water match those of the aquarium from which the animal was collected.
Ciliates:
Ciliates have been implicated in a coral disease called "Brown Jelly Syndrome" or "Brown
Jelly Infection" (Carl, 2008). This disease is apparent by the formation of jelly-like lesions on
coral tissue, which quickly spreads over the whole colony. The disease seems to mainly
infect large-polyped stony corals such as Trachyphyllia and Euphyllia sp.
The manifestation of the disease is likely related to decreased coral health caused by e.g.
bleaching, malnutrition or transport shock. When ciliate infection is prominent by the
appearance of brown lesions, action should be taken immediately.
No means of Biological treatment is currently known.
Chemical treatment:
The first step is siphoning off all diseased parts of the colony, by using aquarium tubing.
Next, the remaining unaffected tissue can be treated by iodine (such as Lugol's solution1 at a
concentration of 1.3 ml Lugol's/l) or freshwater dips. Temperature and pH levels should
match those of the aquarium from which the colonies were collected.
September 2009
H
7
CORALZOO
Red bugs:
"Red bug" infestations are becoming more frequent nowadays. Red bugs are actually
copepods (Tegastes acroporanus, Carl, 2008; Delbeek and Sprung, 2005), and they actively
feed on Acropora tissue. Most often they do not kill the corals, therefore they could be
classified as coral parasites rather than predators.
Symptoms of T. acroporanus infestation include reduced polyp extension, loss of coral and
zooxanthellae pigments, reduced growth, tissue detachment and death.
Several species actively prey on these copepods, which include wrasses, pipefish and
dragonets (Carl, 2008). Symbiotic crabs such as Trapezia sp. will also help prevent
infestations. All of these species will help control populations, but will not likely remove the
copepods completely. Trading such corals is therefore not without risk to the receiving
parties.
Chemical treatment:
Effective treatment has been reported by using the drug Milbemycin (commercially available
as Interceptor, a common anti-heartworm drug for canines). A recommended dosage is
0.016 mg Milbemycin oxide/l aquarium water (Carl, 2008). Treatment duration should be
between 5 to 10 hours. It is highly recommended the procedure is performed in a separate
treatment tank, as the drug will kill other crustaceans as well, including ornamental crabs and
shrimp. Six treatments (twice per week, for three consecutive weeks) have been reported to
completely remove T. acroporanus (Carl, 2008).
Polychaetes:
Most polychaete worms are quite harmless, and even benefit coral reef systems. They are
introduced to any system together with live rock, and readily reproduce in most aquaria.
Their larvae provide food for aquarium inhabitants, and their nocturnal movements aerate
substrates
preventing
hydrogen
sulfide
buildup. Finally, they
consume uneaten (fish)
food, thereby helping
the aquarium recycling
waste products.
Some species, however,
may prey on corals and
other
marine
ornamentals. The best
known example is the
Fire
worm,
or
Hermodice carunculata.
Eunice sp. grow into
especially
large
specimens, and can do
so within one or two
years. In small systems,
these worms can wreak
havoc and are best
removed.
September 2009
H
8
CORALZOO
Diplodus cervinus (Zebra sea bream) is known to consume polychaete worms (Bauchot and
Hureau, 1986), but this may be restricted to smaller specimens. The zebra sea bream also
occurs only in the Mediterranean and Atlantic, and therefore may not be an ideal choice for
introduction to an Indo-Pacific tank. Manual removal of large, corallivore worms is
recommended. This can be done by placing a container with an easily closable lid on the
aquarium bottom, and inserting bait such as clams. In the morning or several hours after
dark, large worms may sometimes be encountered after which they can be trapped and
removed. Be aware that some species may inflict injury with their powerful jaws.
Chemical treatment:
No chemical treatment is optional, as this would be detrimental to many other invertebrates
inhabiting the system.
Myrionema sp.:
Myrionema sp., such as Myrionema amboiensis, belong to the class Hydrozoa of the and
phylum Cnidaria. They harbour symbiotic algae similar to corals, which is why they often
thrive in reef tanks. Due to their proliferative nature, they often outcompete corals, zoanthids
and other sessile invertebrates. In some cases, counteracting their growth may be required.
Some natural predators for Myrionema amboiensis may be butterfly fish, such as Chaetodon
lunula (Carl, pers. comm). Manual removal of substrate remains most effective. Removal of
hydroids from their substrate inside of the system is not recommended; this will disperse
Myrionema throughout the entire aquarium.
Chemical treatment:
Calcium hydroxide can be used to remove hydroids, similar to Aiptasia treatment. A
supersaturated solution of 2-3 g/l will precipitate in marine water and cover the target area.
Water current should be deactivated before treatment. Similar to Aiptasia, hydroids often
return after treatment. This method therefore only serves to keep Myrionema populations in
check.
According to the popular literature, covering an infested area with aluminum foil for several
weeks has also proven to be effective. This strategy is not recommended, however.
Aluminum foil and aluminum oxide may be released to the water, possibly harming aquarium
inhabitants.
B. Measures for preventing pest outbreaks in aquaria:
Preventing outbreaks of any pathogen is a daunting task, and no measure ever is fail-safe.
However, when certain protocols are followed, chances of introducing parasites or other pest
species may be reduced. A key measure has always been quarantining newly arrived
animals. Setting a maximum quarantine time is difficult, as some species such as
Nudibranchs may survive for months without coral hosts. It would therefore be prudent to
maximize quarantine periods for corals and live rock. For fish, several weeks of quarantine
may reveal most infections such as Cryptocaryon irritans (salt water ich). Inspect all corals
and other animals carefully during the isolation period, and do not simply add them to a main
display without prior check-ups. Treat all corals as if they were infected and properly
quarantine each new specimen.
September 2009
H
9
CORALZOO
Montipora colonies are prime suspects for harbouring corallivore Nudibranchs, and
Acropora’s are known to carry red bugs; inspect corals from these genera carefully. Any
areas of freshly exposed skeleton on Montipora corals should be checked very thoroughly as
this is a good indication that nudibranchs may be present. Crevices may also be inspected
for egg masses with optical instruments.
Prophylactic treatment of animals is common, although not recommended for corals.
Freshwater baths and iodine immersions are not easily handled by corals, and may lead to
increased colony losses.
Note:
1. Lugol’s solution consists of 5 g iodine (I2) and 10 g potassium iodide (KI) mixed with 85 ml distilled
water, creating a solution with a total iodine content of 130 mg/ml. Potassium iodide renders the
elementary iodine soluble in water through the formation of the I3- ion.
References
Bauchot, M.L. and J.C. Hureau, 1986. In , Whitehead, P.J.P., M.L. Bauchot J.C. Hureau, J.
Nielsen and E. Tortonese (eds.), 1986. Fishes of the north-eastern Atlantic and the
Mediterranean, volume 2, UNESCO, Paris, France: 883-907.
Campbell, N.A., J.B. Reece and L.G. Mitchell, 1999. Biology, fifth edition. Benjamin
Cummings, :604-605.
Carl, M., 2008. Predators and pests of captive corals. Chapter 5 in, Leewis, R.J. and M.
Janse(editors), 2008. , Advances in Coral Husbandry in Public Aquariums. Public Aquarium
Husbandry Series, Volume 2 Burgers' Zoo, Arnhem, The Netherlands: 31-36.
Delbeek, J.C. and J. Sprung, 2005. The Reef Aquarium Volume Three: Science, Art, and
Technology. Ricordea Publishing, Inc. Coconut Grove, Florida, USA.
Geary, T.G. et al., 1992. The nervous systems of helminths as targets for drugs. J.
Parasitol., 78: 215–230.
Janse, M., 2008. CORALZOO periodic activity report P3: 103-110.
Kempf, S.C. and M. Brittsan, 1996. Berghia verrucicornis, A Nudibranch Predator Of The
Aquarium "Weed" Anemone Aiptasia., Proceedings of AZAA Regional Conference, Audubon
and Zoological Garden in New Orleans: 95-99.
Murphy, B.F. and M.G. Hadfield, 1997. Chemoreception in the nudibranch gastropod
Phestilla sibogae. Comparative Biochemistry and Physiology Part A: Physiology 118: 727735.
Nosratpour, F., Observations of a polyclad flatworm affecting acroporid corals in captivity,
2008. Chapter 6 in, Leewis, R.J. and M. Janse (editors), 2008. Advances in Coral Husbandry
in Public Aquariums, Public Aquarium Husbandry Series, Volume 2, Burgers' Zoo, Arnhem,
The Netherlands: 37-46.
Sprung, J. and J.C. Delbeek, 1996. The Reef Aquarium Volume Two: A Comprehensive
Guide to the Identification and Care of Tropical Marine Invertebrates, Ricordea Publishing,
Inc. Coconut Grove, Florida, USA.
Valdés, A., 2005. A new species of Aeolidiella Bergh, 1867 (Mollusca, Nudibranchia:
Aeolidiidae) from the Florida Keys, USA. The Veliger, 47: 218-223.
Van Belle, H., 1976. Alkaline phosphatase. I. Kinetics and inhibition by levamisole of purified
isoenzymes from humans. Clin. Chem., 7: 972–6.
September 2009
H
10
CORALZOO
3.7.3. A Flow chart for interpreting lesions and identifying diseases or abnormal
conditions in aquarium stony corals
Prof. Roberto Danovaro & dr. Gian Marco Luna
Diagnostics for aquarium corals is still in its infancy, with the same problem also recently
posed for wild coral diseases (Ainsworth et al. 2007). Indeed, the process of producing a
correct diagnosis can be extremely long and - in most cases – not properly be performed by
home aquarists. In the case of coloured, band-forming disease (such as the “Black Band
Disease”), the diagnostic step can be facilitated by the presence of visible, macroscopical
symptoms. However, these diseases are not common in aquarium-kept corals. In addition,
recent investigations suggested that the only observation of macroscopic signs can be
misleading and can lead to incorrect diagnoses (Ainsworth et al. 2007). Thus, at least for the
well-characterized infectious diseases, the presence of pathogen(s) on coral tissue must be
confirmed in the laboratory, by means of laboratory-based diagnostic tools. Microbiological
methods can include conventional culture-dependent methods and molecular techniques
(PCR, FISH / CARD-FISH). However, these microbiological tools cannot be used when the
specific pathogenic cause has not been determined. Precise diagnostic tools do not exist for
many of the “white syndrome” events observed in aquaria. Diagnostic analyses rely upon
sophisticated techniques and laboratory instrumentation, which are not available for home,
as well for some large public aquaria. Easy-to-use diagnostic tools are not yet available,
which hampers the achievement of proper diagnoses in diseased aquarium corals.
A proper monitoring program of stony corals in aquaria include daily inspections of
the visible status of the colony. In case of the appearance of visible and/or gross changes on
the coral colony, a series of actions should be immediately initiated. These actions are
hereafter reported for some of the most common visible changes in the coral status.
A typical case of colour change is “bleaching”, a condition representing without doubt
the most frequent and evident change occurring in captive-kept corals. Bleaching is very
frequently observed in aquaria and its appearance in captivity is almost always related to
changes in the environmental conditions within the tank, such as lighting, temperature, UVradiation, water current and nutrient content. In addition, paleness in colour is often observed
during coral acclimation in a new tank. In case of the occurrence of bleaching in a colony, the
re-establishment of the proper environmental conditions within the tank will lead, with good
chances, to the original condition. The remedial actions will be mostly devoted towards an
accurate check of all the environmental variables in the tank. In case of evidence for
alteration in a parameter, the tank curator will dedicate its efforts toward the re-establishment
of the proper conditions. In case no clear environmental alterations are detected, the
translocation of the colony towards a quarantine tank (where water quality parameters can
be easily controlled compared to, for instance, large aquarium systems hosting multiple large
colonies) represents a possible strategy to allow the coral to recover.
Conversely, in case of the appearance of tissue lesions on the coral, which may be
an indication of the occurrence of a coral disease, a standardised approach should be
applied to reach a final diagnosis. Given the complexity of the coral disease topic, the
adoption of a standardised protocol is crucial for preserving the health of affected corals.
To provide practical tips to the aquarium curators for producing a reliable diagnosis,
we hereby propose a three-step approach. This approach is derived by adapting methods
used by coral researchers for identifying stony coral diseases in natural reefs. It is based on
the application of a series of steps, which can be used to reach a morphological and/or an
etiological diagnosis. Its application will avoid misdiagnosing diseases and allow intervention,
in case of a proper diagnosis, with possible remedial actions. The approach is described in
Figure 1 and includes:
September 2009
H
11
CORALZOO
1) Detection of the possible disease and description of the observed macroscopic
features.
It involves the identification of four descriptive categories: presence of colour changes, tissue
loss, skeletal damage and irregular growth. The observer will also record other gross visible
signs, such as the location and distribution of the lesion, condition of the affected tissue, the
extent of tissue loss and, especially in aquaria, the presence of parasites (flatworms,
nudibranchs and others; see the dedicated chapter). Some of these parasites can be difficult
to observe and may require sub-sampling followed by optical microscope observations.
2) Description of the morphological and histopathological changes in the coral.
It involves a more detailed examination of affected and unaffected tissues collected from the
diseased coral (and compared to representative presumed healthy corals) using histological
techniques. This approach can also be useful to identify the presence of microorganisms and
to describe morphological changes occurring to the tissue. This step must be carried out by
one (or more) “coral health specialists”, which will examine the lesions and will conduct a
number of diagnostic histopathological analyses. The combined results of all observations
will lead to a morphologic provisional diagnosis. This step requires at least a minimal knowhow of histological techniques and knowledge of the most common diseases which may
affect stony corals. In this regard, the Coral Disease and Health Consortium
(http://www.coralreef.gov/cdhc/) has recently developed the “International Registry of Coral
Pathology (IRCP)” which acts as a repository of pathological material to facilitate the
identification of disease aetiologies and develop diagnostic criteria. It has been established to
achieve advancement in the understanding and interpretation of health and disease in corals
by expanding the application of histopathology to coral disease investigations. A centralized
repository of coral tissues (tissue blocks, fixed tissues and related photographs), a
microscope slide reference collection, and a web-accessible database are being made
available to the coral research community to better understand similarities and differences of
host responses to a variety of disease agents. In addition, the website
http://mrl.cofc.edu/oxford/coralreprint.html is a comprehensive bibliography about coral
pathology, useful to the coral research community for studying, teaching and correct
breeding purposes.
3) Evaluation of morphological changes in the coral associated with the advancement
of the lesions, determination of the cause and of the physiologic changes in the coral.
In case no evident or putative diagnosis can be made on the basis of the histopathological
information, the third step will involve a more detailed set of laboratory analyses on the coral,
which will be carried out to identify and confirm the presence of proposed causative agent(s)
or toxins, or other factors responsible for the manifestation of the disease. In case of
suspicion of an infectious disease, microbiological analyses should be carried out to identify
and quantify already described pathogens. Some of these microbiological analyses are
described in the “Research Protocols” presented in this chapter. Possibly, an additional
laboratory test to be carried out is the demonstration of Koch's postulate - where a presumed
pathogen is isolated, grown in pure culture, identified and used to infect a presumably
healthy host. If the disease signs appear, and the presence of the presumed pathogen is
confirmed, this can be assumed to be the cause and an etiological diagnosis can be
assigned. Thus, Step 3 needs to be carried out by different diagnosticians having different
expertises in the field of classical and molecular microbiology and toxicology.
The sum of all the information gained from the application of these steps will then be used to
make a final diagnosis.
September 2009
H
12
CORALZOO
Reference
1) Ainsworth, T.D., E. Kramasky-Winter, Y. Loya, O. Hoegh-Guldberg and M. Fine,2007.
Coral disease diagnostics: what’s between a plague and a band? Appl. Environ. Microbiol.
73:981-992.
Appearance of lesions
on the coral
Detection of the possible disease,
description of visible features
Step 1
If no diagnosis,
proceed to step 2
Description of histological changes to
the tissues
Step 2
If no diagnosis,
proceed to step 3
Perform laboratory analyses, identify
possible causative agents, set-up of
pathogenicity experiments
Step 3
Sum of all collected information and
final diagnosis
Fig. 1. A “three-steps” approach proposed for investigating the origin of lesions appearing on
captive corals: the flow chart.
September 2009
H
13
CORALZOO
3.7.4. PROTOCOLS
CORALZOO WORK PROTOCOL
---------------------------------------------------------------------------------------------------------------3.7.4.1. Acropora flatworm treatment with Ivermectin in Scleractinia
Acquired at Burgers’ Zoo, department Burgers’ Ocean, Arnhem, The Netherlands
Basic information provided by Max Janse, Miranda Verbeek and Bas Arentz
Contact: Max Janse
e-mail: [email protected]
---------------------------------------------------------------------------------------------------------
Purpose
Acropora flatworms (Planaria) are parasites on many different species within
the genus of Acroporids. They feed on the mucous and tissue of the Acropora
sp.. Also they shade the zooxanthellae and irritate the polyps. The protocol
describes a method of removing of Acropora flatworms from Acroporids by
means of a dip bath of Ivomec. Removal of 100% of the flatworms from
colonies may be expected. However they may get infected again due to
flatworms within the aquarium system.
Methods and materials
• Ivomec (Ivomec 1% injectable solution containing 10 mg ivermectine
per ml; Merck Sharp & Dohme, Haarlem, The Netherlands)
• 2 buckets of 10 litre each
• Small water pump (1000 l/h)
• Timer
• Gloves
Procedures
Important: The procedure is done outside the aquarium.
Treatment:
• Fill bucket no. 1 and bucket no. 2 both with 10 L seawater from the aquarium system.
• Aerate the water.
• Add 2 ml 1% Ivomec (equals 2 mg ivermectin/L) solution to the 10 L seawater in
bucket no. 1.
• Mix well.
• Place the pump in the bucket to get some water movement.
• Place the coral in the solution for 5 hours.
• In the last minute, shake the coral a little to help the planaria to detach from the coral.
•
Place the coral in Bucket no. 2 to get rid of the last planaria and medicine.
September 2009
H
14
CORALZOO
•
•
•
Shake the coral again for 1 minute.
Place the coral back in the aquarium
system.
Repeat procedure after 14 days.
Figure 1. Example
treatment
Background information and research
Many Acroporids in captivity are infected by Acropora eating flatworms (AEFW). Due to
exchange of corals this infection easily spreads in between aquaria and lack of natural
predators of the flatworms can increase the infection pressure. Stress may possibly increase
the susceptibility of AEFW or the outbreak of a destructive population of flatworms (Arentz,
pers. com.).
An Acropora flatworm (Figure 1) was described as Apidioplana sp. (Block, 1926)
(Nosratpour, 2008) (Polycladida, Tubellaria, Platythelminthes). Carl (2008) describes two
types of flatworms on acroporids and mentions that more may exist. Little is known about the
taxonomy of this type of flatworms.
Acropora flatworms are hard to find on the corals due to perfect camouflage.
Figure 1. An Acropora eating flatworm (AEFW) on
an Acropora sp.
When feeding on coral tissue the flatworms seem to
incorporate zooxanthellae from the coral into their
own tissue (Carl, 2008). They produce brown eggs
(Figure 2).
Signs of infestation (Figure 1) include pale color of
the coral, little or no polyp extension and loss of
tissue (Carl, 2008; Nosratpour, 2008). Acroporids
that produce large amounts of mucous (like
Acropora yongei)seem to be not
affected by the flatworms (Carl, 2008; Nosratpour, 2008). Fine branched Acroporids seem to
have less problems with AEFW (Arentz, pers. com). They seem to prefer species of
Acropora that have shorter polyps, and are most commonly found on Staghorn types and
Tricolor species (www1).
September 2009
H
15
CORALZOO
Figure 2. Eggs of Acropora eating flatworm. The color
of the eggs should be brown on the picture.
Different treatments against Acropora flatworms have been described in literature:
i) Bath treatments with 2-4 mg/l PVP-Jod weakens the corals, especially in the higher
dosage range (Staiger, 2001).
ii) Levamisol at 4 and 8 mg/l for 1 hour showed none to minor results against the
Acropora flatworm (Nosratpour, 2008).
iii) At Omaha Zoo a higher dosage of 40 mg Levamisol/l for 1 hour, also the egg masses
were manually removed (Carl, 2008). This sometimes resulted in bleaching of
acroporids.
iv) Also 30 seconds freshwater dips may help (Carl, 2008).
v) The normal salinity decreasing towards 22 (for 21 minutes),15 (for 3 minutes) and 12
ppt (for 3 minutes) had no effect on the flatworms, while at 6 ppt (for 30 seconds)
the worms dropped of the coral (Nosratpour, 2008).
vi) Joe Yaiullo sprayed freshwater on the corals with kept the infection of Acropora
flatworms under control. (Nosratpour, 2008).
Biological control of Acropora flatworms with Haliochoeres chrysus (Kokott and Mrutzek,
2007), H. leucurus (Delbeek and Sprung, 2005), H. melanurus (Delbeek and Sprung, 2005),
Pseudochromis sp. (Carl, 2008), Pseudocheilinus hexataenia (Kokott and Mrutzek, 2007;
Muller, 2007), Synchiropus ocellatus (Kokott and Mrutzek, 2007; Carl, 2008), S. marmoratus,
(Kokott and Mrutzek, 2007) S. stellatus (Kokott and Mrutzek, 2007; Muller, 2007). Also the
nudibranch Chelidonura varians (Kokott and Mrutzek, 2007) or coral crabs (Carl, 2008) may
feed on the Acropora flatworms
Changes of abiotic factors may also help to reduce the flatworm population. Increase in
water movement has a negative effect on the flatworm population (Muller, 2007). The same
authors also describe some interesting observations with the placement of heavily infested
Acropora colonies onto sandy areas, which resulted in significant decrease in planaria.
Research at Burgers’ Zoo
A first experiment has been conducted at Burgers’ Zoo with Ivomectin (Ivomec 1% injectable,
Merck Sharp & Dohme®) to find out the sensitivity of corals and acoel planaria to
the medicine. The experiment was conducted with Galaxea fascicularis. All corals are the
similar in size, 8x8 cm. Corals were treated in a 10 L bucket for 3 hours. The same water
was used where the corals were living in. Prior to removal of the coral from the treatment
bucket the corals were shaken quietly for 15 seconds in the water which resulted in the
September 2009
H
16
CORALZOO
removal of many extra planaria from the coral (see also PROTOCOL XXXX). The coral was
rinsed in a second bucket without medicine so excessive medicine was removed and more
planaria could be removed from the coral, before placing back in the system. Results of this
experiment are shown in Table 1.
Table 1 Results of Ivomec treatment on Galaxea fascicularis infested with acoel
flatworms
I
Concentration
mg ivomectin/l
0.01 mg/l
II
0.05 mg/l
III
0.1 mg/l
IV
0.2 mg/l
V
0.2 mg/l
VI
1 mg/l
VII
2 mg/l
VIII
4 mg/l
t=3h
t=24h
100% alive; and active
movement over the bottom
100% alive, but are all
smaller, some are inactive
20% dead; rest is much
smaller and inactive
100% alive; still active on the
bottom of the bucket
100% alive; about 90% is
smaller
100% alive, but are all smaller,
some are inactive
10% alive
100% dead
100% dead
All corals are in perfect condition after 1 day and still after 14 days after the treatment. The
result show a sensitivity of acoel planaria towards ivomec at concentration higher than 1
mg/l. However the best result was at 2 mg/l or higher.
A second experiment was undertaken to see if ivomec should be used in a longer bath. Two
colonies of Galaxea fascicularis (approximately 8x8 cm in size) with many acoel planaria on
it were treated at 2 mg ivomec/L for 6 and 24 hours. The planaria detached in both
treatments. The colony of 6 hours treatment was fine after treatment and polyps were
extended normally after 30 hours, but the colony that was treated for 24 hours was expelling
zooxanthallae at the end of the treatment. The bleeching went on during the next day. After
three days the colony was white, with little tissue left.
A third experiment had to show if ivomec would work against polyclad flatworms. One
Acropora sp. colony had clearly one flatworm (Figure 1), but possibly more. The colony was
treated in 5 L water in a bucket for 6 hours at 2 mg ivomec /L. After 45 minutes within the
medicine 13 flatworms detached from the colony, after 90 minutes again 5. They were all still
alive. Two days after treatment the coral was still fine.
The result show ivomec to be a possible medicine for treating Acropora corals against a
polyclad flatworm, however care had to be taken with the duration of the treatment. The
following treatment regime was used on 20 Acroporids of different species at Burgers’
Ocean: 2 mg ivomec/L for 5 hours. This treatment was repeated 3 times. Treatment 2 on day
20 and treatment 3 on day 40. The corals were shaken at the end of the treatment. The
results are promising. During treatment 1 there were many flatworms, after treatment 2 there
were only small flatworms and after treatment 3 no flatworms could be found. Since this
species is producing eggs it may be expected that all life flatworms were killed after
treatment 1. The
September 2009
H
17
CORALZOO
eggs hatched and the young flatworms were killed during treatment 2. So repeated treatment
is necessary to be able to remove all Acropora flatworms from the system when using
ivomec.
Reinfection may occur when more Acroporids are within the system. Treaments at Burgers’
Ocan showed good results on the treated colonies, but after a few months the colonies were
infected again via the system.
References
Carl, M., 2008.Predators and pests of captive corals. In: R. Leewis and M. Janse (eds.)
Advances in coral husbandry in public aquariums. Public Aquarium Husbandry
Series, Volume 2. Burgers’ Zoo, Arnhem, The Netherlands, p. 31-36.
Delbeek, J.C. and J. Sprung, 2005. The reef aquarium. Science, Art, and technology.
Volume three. Two Little Fishes, Cocnout Grove, USA. 680 p.
Kokott, J. and M. Mrutzek, 2007. Canthigaster valentine as biological control against
flatworms. Der Meerwasser Aquarianer 11(1):36-41. (in german)
Müller, P., 2007. Experiences with Acropora flatworms. Der Meerwasser Aquarianer
11(1):18-25. (in german)
Nosratpour, F., 2008. Observations of a Polyclad flatworm affecting acroporid corals in
captivity. Chapter 6 in: Leewis, R.J. and M. Janse (eds.) Advances in coral husbandry
in public aquariums. Public Aquarium Husbandry Series, Volume 2. Burgers’ Zoo,
Arnhem, The Netherlands, p. 37-46.
Ogunlana, M.V., M.D. Hooge, Y.I. Tekle, Y. Benayahu, O. Barneah and S. Tyler. 2005.
Waminoa brickneri n. sp. (Acoela: Acoelomorpha) associated with corals in the Red
Sea. Zootaxa 1008:1-11.
Staiger, B., 2001. Polyvinylpryrrolidon-Jod (PVP-Jod). The new triumph from an old
medicine. Der Meerwasser Aquarianer 5(1):8-11 (in german).
www1: Foster and Smith. Pests Invading the Reef Aquarium Hobby: Part 2 - Flatworms,
Snails & Limpets.
http://www.liveaquaria.com/general/general.cfm?general_pagesid=362
September 2009
H
18
CORALZOO
CORALZOO
WORK PROTOCOL
---------------------------------------------------------------------------------------------------------------3.7.4.2. Planaria treatment with Ivermectin in Scleractinia
Acquired at Burgers’ Zoo, department Burgers’ Ocean
, Arnhem, The Netherlands
Contact: Max Janse
---------------------------------------------------------------------------------------------------------
Purpose
Planaria often occur as a commensal on the tissue of scleractinia. They
possibly feed on the mucous of the scleractinia and more important shade the
zooxanthellae and irritate the polips. The protocol decribes a method of
removing planaria from the coral with ivermectin, with only little stress for the
coral itself, by means of placing the coral in a dip bath of Ivomec for 5 minutes.
Removal of 100% of the planaria may be expected.
Required materials
• Ivomec (Ivomec 1% injectable solution containing 10 mg ivermectine
per ml; Merck Sharp & Dohme, Haarlem, The Netherlands)
• 2 bucket of 10 litre each
• Small water pump (1000 l/h)
• Timer
• Gloves
Procedures
Important: The procedure is done outside the aquarium. The procedure has been tried on
Galaxea fascicularis and Acropora sp.. Care must be taken when using this on other coral
species.
1. Fill bucket no. 1 and bucket no. 2 both with 10 L seawater from the aquarium system.
2. Aerate the water.
3. Add 2 ml 1% Ivomec (equals 2 mg ivermectin/L)
solution to the 10 L seawater.
4. Mix well.
5. Place pump in bucket to get some water movement.
6. Place the coral in the solution for 5 hours.
7. Shake the coral in the last minute a little to help the
planaria to detach from the coral.
8. Place the coral in Bucket no 2, to get rid of the last
planaria and medicine.
9. Shake the coral for 1 minute.
10. Place the coral back in the aquarium system.
Fig. 1. Example treatment
September 2009
H
19
CORALZOO
Acoel flatworms or planaria (Platyhelminthes, Tubellaria) are often found living on the
tissue of scleractinia (Fossa and Nilsen, 1996) (
Figure 2). Some papers describe them under the name Convolutribola
(Hendelberg and Akesson, 1991; Akesson et al., 2001; Carl, 2008). They often occur
on fleshy species. Especially on
corals kept under low flow conditions
(Carl, 2008). A few problems occur
when planaria live on corals: they
irritate the coral which may cause
the polyps to contract and thus have
a smaller surface to catch food for
the coral or to catch light for the
zooxanthellae. Large number of
planaria will shade the
zooxanthellae and thus will have
less photosynthesis of the symbiotic
algae and planaria possibly feed on
the mucous.
Figure 3 Acoel planaria on Euphyllia paradivisa
The nudibranch Chelidonura varians will eat planaria (Carl, 2002).
Other options are commercial available products like Blue Life USA flatworm control,
Concurat-L (=levamisol) and Salifert Flatworm Exit. The effect of these products are
not tested within this study.
September 2009
H
20
CORALZOO
A first experiment has been conducted with Ivomectin (Ivomec 1% injectable, Merck Sharp &
Dohme®) to find out the sensitivity of corals and acoel planaria to the medicine. The
experiment was conducted with Galaxea fascicularis. All corals are similar in size, 8x8 cm.
Corals were treated in a 10 L bucket for 3 hours. The same water was used where the corals
were living in. Prior to removal of the coral from the treatment bucket the corals were shaken
quietly for 15 seconds in the water which resulted in the removal of many extra planaria from
the coral. The coral was rinsed in a second bucket without medicine so excessive medicine
was removed and more planaria could be removed from the coral, before placing back in the
system.
Concentration
I
mg ivomectin/l
0.01 mg/l
II
0.05 mg/l
III
0.1 mg/l
IV
0.2 mg/l
V
0.2 mg/l
VI
1 mg/l
VII
2 mg/l
VIII
4 mg/l
Results at
t=3 h
t=24 h
100% alive; about 90% is
smaller
100% alive, but are all smaller,
some are inactive
10% alive
100% dead
100% dead
All corals are in perfect condition after 1 day and still after 14 days after the treatment. The
result show a sensitivity of acoel planaria towards ivomec at concentration higher than 1
mg/l. However the best result was at 2 mg/l or higher.
A next experiment was undertaken to see if ivomec should be used in a longer bath. Two
colonies of Galaxea fascicularis (approximately 8x8 cm in size) with many acoel planaria on
it were treated at 2 mg ivomec/L for 6 and 24 hours. The planaria detached in both
treatments. The colony of 6 hours treatment was fine after treatment and polyps were
extended normally after 30 hours, but the colony that was treated for 24 hours was expelling
zooxanthallae at the end of the treatment. The bleaching went on during the next day. After
three days the colony was white, with little tissue left. The coral still survived the procedure.
For further background information and research see also Protocol 3.7.4.1. and 3.7.4.3.
September 2009
H
21
CORALZOO
CORALZOO
WORK PROTOCOL
---------------------------------------------------------------------------------------------------------------3.7.4.3. Planaria treatment with levamisol in Scleractinia
Contact: Max Janse
--------------------------------------------------------------------------------------------------------Purpose
Planaria often occur as a commensal on the tissue of scleractinia. They
possibly feed on the mucous of the scleractinia and more important shade the
zooxanthellae and irritate the polyps. The protocol decribes a method of
removing planaria from the coral with levamisol, with only little stress for the
coral itself, by means of placing the coral in a dip bath of levamisol for 5
minutes. Removal of 100% of the planaria may be expected.
Required materials
• Levamisol (Levacol 7.5 % (Eurovet) injectable solution containing 75
mg levamisol hydrochloride per ml)
• Bucket of 10 liter (2x)
• Small pump (1000 l/h)
• Timer
• Gloves
Procedure
Treatment:
• Fill bucket no. 1 and bucket no. 2 both with 10 L seawater from the aquarium system.
• Add 3 ml 7.5% levamisol (equals 22.5 mg levamisol/L) solution to the 10 L seawater.
• Mix well.
• Place pump in bucket to get some water movement.
• Place the coral in the solution for 5 minutes.
• Shake the coral in the last minute a little to help the planaria to detach from the coral.
• Place the coral in Bucket 2 to get rid of the last
planaria and medicine.
• Shake the coral for 1 minute.
• Place the coral back in the aquarium system.
Figure 1. Example treatment
Important: The procedure is done outside the aquarium. Also the procedure has been
successful without negative impact on the species mentioned in Table 1. Care must be taken
when using this on other species of corals.
September 2009
H
22
CORALZOO
Acoele flatworms or planaria (Platyhelminthes, Tubellaria) are often found living on
the tissue of scleractinia (Fossa and Nilsen, 1996) (
Figure 2).
Some papers describe them
under the name
Convolutribola (Hendelberg
and Akesson, 1991;
Akesson et al., 2001; Carl,
2008). They often occur on
fleshy species. Especially on
corals kept under low flow
conditions (Carl, 2008). A
few problems occur when
planaria live on corals: they
irritate the coral which may
cause the polyps to contract
and thus have a smaller surface to catch food for the coral or to catch light for the
zooxanthellae.
Figure 2. Acoel planaria on Euphyllia
paradivisa
Large numbers of planaria will shade the zooxanthellae and thus will cause less
photosynthesis of the symbiotic algae and planaria possibly feed on the mucous.
The nudibranch Chelidonura varians will eat planaria (Carl, 2002).
Other options are commercial available products like Blue Life USA flatworm control,
Concurat-L (=levamisol) and Salifert Flatworm Exit. The effect of these products are
not tested within this study.
Table 1 gives an overview of species that have been treated with levamisol to remove
acoel flatworm. Most species show no negative effect towards the use of levamisol.
However the result of the removal of planaria varies considerable. It was decided to
conduct an experiment at Burgers’ Zoo to find the best concentration of levamisol to
remove planaria without harming the coral.
September 2009
H
23
CORALZOO
Table 2 Levamisol treatment at on different scleractinia species to remove acoel flatworms
Species
Blastomussa merleti
Blastomussa merleti
Caulastrea echinulata
Caulastrea furcata
Time
(min)
2
5
30
2
Removal of
planaria
No result
gone
OK
Only after shacking
they felt off
OK
No result
OK
Cynarina lacrymalis
Duncanopsammia axifuga
Duncanopsammia axifuga
30
1
Echinopora lamellosa
Euphyllia divisa
Euphyllia glabrescens
Euphyllia paradivisa
Fungia fungites
Fungia fungites
Pachyseris speciosa
Pavona sp.
Seriatopora caliendrum
Stylophora pistillata
Trachyphyllia
Tubastrea sp.
5
30
Gone
OK
5
2
5
2
2
5
5
2
2
Turbinaria peltata
2
OK
No result
Gone
No result
No result
Gone
Gone
No result
Only after shacking
they felt off
Only after shacking
they felt off
Coral
OK
OK
OK
OK
OK
Not so
good
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
Different concentrations of levamisol (7.5% levacol Freefarm; with 75 mg
levamisolhydrochlorid per ml) were used to define the right treatment, with the least effect on
the corals. Euphyllia divisa (1 colony) and Euphyllia paradivisa (2 colonies in experiment I to
IV and 1 colony in experiments V to VIII) were used per treatment. All corals are similar in
size. Corals were treated using the above mentioned protocol over a period of 5 minutes in a
10 l bucket, within the same system water where the corals were living in. The corals were
removed from the bucket after 5 minutes in the medicine. Prior to removal of the coral from
the treatment bucket the corals were shaken quietly for 15 seconds in the water which
resulted in the removal of many extra planaria from the coral. The coral was rinsed in a
second bucket without medicine so excessive medicine was removed and more planaria
could be removed from the coral. The planaria were left inside the bucket with the medicine
to analyse the effect of the different concentrations on the health of the planaria. Death is
defined when planaria are not moving and detach from the bucket with only slight water
movement.
September 2009
H
24
CORALZOO
Table 3 Result of different concentrations of levamisol treatments (5 min) on the removal of
planaria from Euphyllia divisa and Euphyllia paradivisa
Concentration
Result at
I
mg levamisol/l
1.88 mg/l
t=1 min
Planaria
were moving
fast
II
3.75 mg/l
Planaria
were moving
fast
III
5.63 mg/l
IV
7.5 mg/l
Planaria
were moving
fast; first
planaria drop
from colony
Planaria
were moving
fast
V
7.5 mg/l
VI
22.5 mg/l
VII
37.5 mg/l
VIII
75 mg/l
September 2009
Planaria
were moving
fast
Planaria
were moving
fast
Planaria
were moving
fast
Planaria
were moving
fast
t=1 h
all planaria
alive and
moving
slowly
all planaria
alive and
moving
slowly
all planaria
alive and
moving
slowly
t=24 h
all alive
t=48 h
10% death
all alive
10% death
all alive, but
not moving
25% death
all planaria
alive and
moving
slowly
Most of
planaria are
still moving
Only a few
are moving
slowly
Only a few
are moving
slowly
Only a few
are moving
slowly
20% death,
rest is not
moving
70% death
50% death,
rest is not
moving
90% death
90% death
100% death
100% death
100% death
H
25
CORALZOO
Figure 4 Result Treatment I
Figure 5 Result Treatment III
Figure 4 Result Treatment II
Figure 6 Result Treatment IV
Figure 3 to 6 show the number of planaria after the different treatments. It’s not possible to
compare the figures since we could not define the number of planaria on the corals before
the treatment. However, the first three treatments show significant less planaria than
treatment IV. Also not many planaria could be found on the corals of treatment IV, while the
other three still showed some planaria on the coral tissue. Again this is all impossible to
quantify.
September 2009
H
26
CORALZOO
Table 4 Reaction of corals towards different concentrations of levamisol
Concentration
Result corals Result corals
mg levamisol/l
at t=5min
at t=5d
I
1.88 mg/l
polyps still
no adverse
extented
effect
II
3.75 mg/l
polyps still
no adverse
extented
effect
III
5.63 mg/l
polyps still
no adverse
extented
effect
IV
7.5 mg/l
polyps still
no adverse
extented
effect
V
7.5 mg/l
polyps still
no adverse
extented
effect
VI
22.5 mg/l
polyps still
no adverse
extented
effect
VII
37.5 mg/l
polyps still
no adverse
extented
effect
VIII
75 mg/l
polyps still
no adverse
extented
effect
The results show a clear reaction of the planaria on the treatment. The treatment time and
concentration had no negative effect on coral health. The most successful concentration to
kill planaria was larger than 22.5 mg/l, however also 7.5 mg/l showed already a reasonable
result. A second study to quantify the number of planaria that are removed from the coral will
be necessary.
References
Åkesson, R., J. Gschwentner, P. Hendelberg, J. Ladurner, R. Müller and R. Rieger, 2001.
Fission in Convolutriloba longifissura : asexual reproduction in acoelous turbellarians
revisited. Acta Zoologica 82():231-239.
Carl, M. 2002. Personal communication, Omaha Zoo, USA
Carl, M., 2008. Predators and pests of captive corals. Chapter 5 in: Leewis, R.J. and M.
Janse (eds.) Advances in Coral Husbandry in Public Aquariums. Public Aquarium
Husbandry Series. Vol. 2. Burgers' Zoo, Arnhem, The Netherlands p. 31-36.
Fossa, S. and A.J. Nilsen, 1996. Coral reef aquarium, part 2. Birgit Schmettkamp Verlag,
Bornheim (in german)
Hendelberg, J. and B. Akesson, 1991. Studies of the budding process in Convohtriloba
retrogemma (Acoela, Platyhelminthes). Hydrobiologia 227():11-17.
September 2009
H
27
CORALZOO
CORALZOO
WORK PROTOCOL
---------------------------------------------------------------------------------------------------------------3.7.4.4. Technique for multiple day medical coral treatment
Contact: Max Janse
--------------------------------------------------------------------------------------------------------Purpose
Description of a system that will make multiple day treatments of corals possible, without
creating too much stress and keeping the water quality at high standards, by means of
placing the coral in a separate coral system and make a flow through with medicinated water.
This simple technique allows to make trails on coral treatments over a multiple day period.
Required materials
• two tanks/containers (300 L) on top of each other
• heater 300W
• aeration of water
• circulation pump (e.g. EHEIM 1060 or Oceanrunner 3500)
• light (e.g. adjustable T5)
• timer
Procedures
N.B.: In principle the corals are treated in one tank with an overflow and fresh medicinated
water is put in a second tank with will drain slowly into the treatment tank. The medicine is
placed in both tanks. Volume of the two tanks for this example is 300 L (Figure 1).
•
•
•
•
•
•
•
•
•
Close valves 1 and 2, open valve 3
Fill tank 1 and 2 with water from a coral system
Place corals in tank 2
Place heater (300W) and circulation pump (e.g. EHEIM 1060 or Oceanrunner 3500) in
tank 2
Aerate both tanks
OPTIONAL: Place T5 light above tank 2, with timer (10L:14D) (some medicines are light
sensitive (e.g. oxytertracycline) so than no light can be used)
OPTIONAL: Place a bag with active trickler rings (originating from a healthy system) in
tank 2 (this depends on the type of medicine used; antibiotics will can affect the nitrifying
bacteria on the rings)
Add the medicine to both tanks
Depending on the number of corals and the volume used tank 1 should drain 1 or 2 times
in 24 hours (adjustable via valve 1). To assure good water quality.
September 2009
H
28
CORALZOO
tank 1
1
2
tank 2
3
Bacterial diseases in corals are subject to research in the wild. Also in captivity health
problems do occur on a regular basis. Rapid tissue necrosis and other bacterial problems
have been described in captivity (Borneman, 2001; Calfo, 2003; Delbeek and Sprung, 2005).
Coral treatments are still in their experimentation phase. One of the problems when treating
corals is the deterioration of the water quality. Also corals can be very susceptible against the
medicine. More information should be gathered on treatments of corals and their success.
The above described technique may be a handhold towards more treatment trails in coral
disease treatment or prophylactic treatments.
September 2009
H
29
CORALZOO
During the development of this protocol a few changes have been made. First the corals
were treated with 100% water changes every 24 hours (Table 1). Still the water quality
deteriorated quickly within 24 hours and the shock of water change was too big. Ofcourse
this depends also on the size of the coral and health state of the tissue. A flow through
system diminished this problem. Table 2 gives an overview of the latest technique described
in this protocol. The results were variable. When corals were already in very bad shape, the
results were negative. This technique is a tool to allow more research on treatments of
captive corals, both to compete the pathogen and to increase the knowledge on sensitivity of
corals towards the medicine. Different medicines have been used until now: oxytetracycline,
levamisol and doxyciline (2.5 mg/L)
Table 1 Overview of batch treatments with 100 % water changes every 24 hours
Species
Treatment
Problem
Results
Blastomussa wellsi
3 mg doxyciline/L Transport damage
Did not get worse,
in 137 L for 1.5 d
colony survived
Blastomussa wellsi
3 mg doxyciline/L Tissue necrosis
Corals died
in 137 L for 1.5 d
Catalaphyllia jardinei
3 mg doxyciline/L Decrease of tissue
Once stopped the
in 137 L for 2 d
volume
decrease, one coral
died
Caulastrea echinulata
2.5 mg
Retrieving tissue
Not registered
doxyciline/L for 2
d
Cynarina lacrymalis
Corals died
in 137 L for 2 d
Favites sp.
Coral survived
in 137 L for 2 d
Heliofungia sp.
3 mg doxyciline/L Tissue retention
Coral looked better,
in 137 L for 2 d
stopped retention
Heliofungia sp.
3 mg doxyciline/L Tissue retention
Coral looked better,
in 137 L for 1.5 d
stopped retention
Hydnophora exesa
2.5 mg
Rapid tissue
Not registered
doxyciline/L for 2 necrosis
d
Lithophyllon edwardsi 2.5 mg
Rapid tissue
Not registered
d
Scolomia sp.
Corals died
in 137 L for 2 d
Trachyphyllia geofroyi 3 mg doxyciline/L Decrease of tissue
Colony looked worse
in 137 L for 1.5 d volume
September 2009
H
30
CORALZOO
Table 2. Overview of continuous treatments following the procedure described in this
protocol.
Species
Treatment
Problem
Results
Montipora sp.
2.5 mg
unknown
doxyciline/l for 2
d
Seriatopora
1.7 mg
Rapid tissue
Corals died
caliendrum
d
Seriatopora hystix
30 mg
Rapid tissue
Coral died, except
oxytetracycline/L necrosis
for small part that
for 3 days
was cut off
Euphyllia divisa
0.3 ml 7.5%
planaria
Planaria died, corals
levamisol/L for 2
OK
d
Euphyllia paradivisa
0.3 ml 7.5%
planaria
Planaria died, corals
levamisol/L for 2
OK
d
Echinopora lamellosa
1.7 mg
Brown jelly disease
It stopped the
doxyciline/L in
problem, but after
300 L for 2 days
treatment corals still
died
References
Borneman, E. 2001. Aquarium corals. Selection, Husbandry, and natural History. TFH
publications, Neptune City, USA. 464 p.
Calfo, A., 2003. Book of coral propagation. Reef gardening for aquarists. Reading Trees
publication
Delbeek, J.C. and J. Sprung, 2005. The reef aquarium. Science, Art, and technology.
Volume three. Two Little Fishes, Cocnout Grove, USA. 680 p.
September 2009
H
31
CORALZOO
RESEARCH PROTOCOLS
The following protocols concern mostly complicated issues, requiring sophisticated
instrumentation, which probably is not at the disposal of all aquarists. If still necessary, such
activities may therefore be left to neighbouring specialised laboratories or universities. They
are included here for the sake of completeness only.
3.7.4.5. DIRECT COUNTING OF TOTAL PROKARYOTES ON STONY CORAL TISSUES
USING EPIFLUORESCENCE MICROSCOPY
-------------------------------------------------------------------------------------------------------------------------Acquired at CoNISMa, Ancona, Italy
Basic information provided by Prof. Roberto Danovaro & Dr. Gian Marco Luna
Contact: Gian marco Luna e-mail [email protected]
--------------------------------------------------------------------------------------------------------------------------Purpose The determination of total Prokaryote (Bacteria and Archaea) abundance
associated with diseased tissues of stony corals represents the initial evidence of an ongoing
bacterial infection, thus being a first step in the identification of possible bacterial pathogens
infecting the coral. Diseased tissues generally host higher abundances of Prokaryotes as
compared to healthy tissues. Further analyses are however required in order to ascertain the
presence of potential pathogens, to identify them at the species level and to evaluate their
role in the specific disease.
The determination of total Prokaryote abundance associated with coral tissues can be
achieved using culture-dependent and culture-independent methods. Both methods have
advantages and limitations. The results from the two approaches should thus be integrated
and compared for investigating a coral disease event. The method presented here is a
culture-independent method, based on the staining of Prokaryotes using fluorochromes and
their subsequent observation using an epifluorescence microscope.
The protocol here presented is the one described by Noble & Fuhrman (1995), as adapted to
coral samples by Koren & Rosenberg (2006).
Materials:
- Laboratory instrumentation: epifluorescence microscope, special ocular grid for counting,
laminar flow hood, vortex, filtration apparatus (Millipore or similar), vacuum pump (Millipore
or similar), analytical balance, autoclave, centrifuge.
-Laboratory material: pipettes, sterile tips, test tubes, microscopic slides, Anodisc filters,
vernier calliper, forceps, immersion oil, sterile tweezers, sterile pestle.
- Solutions:
- Artificial SeaWater (35 g/L) sterilised in autoclave (121°C, 20 minutes)
- 2% Formalin solution, buffered first with sodium tetraborate, (20 g per L of pure
formaldehyde), then diluted with Artificial SeaWater (ASW), then pre-filtered (using a
syringe filter having 0.2 µm pore size
- Ultrapure, autoclaved (121°C, 20 minutes) Milli- Q water
- Sybr Green I solution (Molecular Probes), prepared by diluting the purchased
solution by 1:20 with milli-Q water
- Antifade solution (50% PBS – 50% Glycerol – 0.01% Ascorbic Acid)
Procedure:
a. Preparation of samples
1) Bring the necessary materials under the laminar flow hood (i.e. under sterile conditions) to
avoid contamination of the coral samples.
2) Collect a coral sample of at least 0.5 cm in length.
September 2009
H
32
CORALZOO
3) Take a calliper, carefully rinse it with ethanol and flame it to sterilize it.
4) Accurately measure the dimension of the coral sample along the 3 axes (x, y and z), using
the calliper.
5) After measurements, weigh the coral, using an analytical balance.
6) Put the coral into a sterile test-tube (15 ml) and add 5 ml of Artificial Seawater (ASW)
7) Vortex for a few seconds and centrifuge (2500 x g, 3 minutes). At the end, remove the
coral sample (by using sterile tweezers) and place into a new 15-ml centrifuge tube
containing 5 ml of ASW. [This procedure is needed to eliminate coral mucus and mucusassociated bacteria]
8) Vortex and centrifuge again as described
9) Remove the coral sample and place into a new 15-ml centrifuge tube
10) Add 4 ml of Formalin solution to fix the prokaryotic cells and crush the coral sample,
using a sterile pestle. Take particular care at this stage to avoid flushing of formalin drops
towards the operator.
11) Vortex the crushed coral for 1 minute.
12) Let the particulate material settle for one minute.
13) Collect an appropriate aliquot of the suspension from the upper phase of it, and transfer it
to a new test-tube (15 ml). The appropriate aliquot is the one leading to a number of 40 – 80
prokaryotic cells per optical field. The sample cannot be determined a priori and must be
evaluated for each coral sample, by collecting different aliquots and analysing them as
described below.
14) Add 2 ml of sterilised Artificial Seawater.
15) Filter onto Anodisc (Whatman) filters (porosity 0.2 µm) using the filtration apparatus.
Prepare three filters per each crushed sample (i.e. 3 replicated filters from each coral
sample).
16) Put a drop of (20 µl) of Sybr Green I solution into a Petri dish.
17) Transfer the filter on that Petri dish, taking care to place it onto the Sybr Green I solution
(in order to let the fluorochrome diffuse all around the filter).
18) Incubate for 15 minutes in the dark.
19) Put the filter on the filter apparatus again.
20) Wash the filter twice with 1 ml of Milli-Q water, to eliminate the excess of fluorochrome.
21) Take a microscopic slide, and put a drop(20 µl) of antifade solution on it.
22) Place the filter onto the microscopic slide on top of the antifade solution.
23) Put another drop of antifade solution over the filter.
24) Cover this with a cover slip.
25) Place a drop of immersion oil over the cover slip.
b. Counting
1) View the filter under epifluorescence microscopy under blue light excitation (magnification
1000X). Prokaryotic cells will appear as green-stained fluorescing cells.
2) Install the special ocular grid onto the microscope.
3) Count the cells in each optical field, using this special ocular grid.
4) Count at least 10 randomly-selected optical fields, and at least 400 cells per filter.*
c. Analysis
1) Transfer the obtained data to a personal computer into a Microsoft excel sheet
2) Calculate the abundance. Express as cells/cm² or as cells/g Wet Weight of coral.
3) The abundance is expressed as the average of the three (filters) replicates plus a
standard error.
* This is necessary to achieve appropriate statistical significance.
References
1) Noble, R.T., and J. A. Fuhrman, 1998. Use of SYBR Green I for rapid epifluorescence
counts of marine viruses and bacteria. Aquat. Microb. Ecol. 14:113–118.
September 2009
H
33
CORALZOO
2) Koren, O. and E. Rosenberg, 2006. Bacteria associated with Mucus and Tissues of
the Coral Oculina patagonica in summer and winter. Appl. Environ. Microb. 72(5):
254-5, 259.
September 2009
H
34
CORALZOO
3.7.4.6. ENUMERATION AND ISOLATION OF CULTURABLE HETEROTROPHIC
BACTERIA AND OF VIBRIO SPP. ON STONY CORAL TISSUES
--------------------------------------------------------------------------------------------------------------------------Acquired at CoNISMa, Ancona, Italy
--------------------------------------------------------------------------------------------------------------------------Purpose.
This work instruction allows the enumeration and isolation of pure cultures of aerobic
heterotrophic bacteria associated with the tissue of stony corals. In particular, it describes
how to i) enumerate the number of culturable bacteria; ii) isolate them in pure cultures and
store for subsequent analyses (such as identification of the isolates) and iii) (by using the
TCBS selective medium) estimate the abundance of certain potential pathogens, i.e. Vibrio
spp. Results obtained can be used for several purposes, such as determination of the
abundance of culturable bacteria (as opposed to total prokaryotic abundance determined via
epifluorescence microscopy) or the identification of the most abundant isolates at the
genus/species level, possibly including known bacterial pathogens (see Work instruction
3.7.4.7.: Identification of bacterial colonies using PCR and 16S rDNA sequencing).
Despite possible biases deriving from the low culturability of many marine bacteria (Bythell et
al. 2002), the cultivation-based approach here proposed represents a commonly utilised
method for studying bacterial infections of corals and for achieving possible diagnosis (Luna
et al. 2007; Cervino et al. 2008)." When coupled with other bacteriological analyses (such as
those described in this Chapter and recently developed molecular methods), it is a useful
complement for obtaining diagnosis of an infectious disease on stony corals.
Required materials:
- Laboratory instrumentation: laminar flow hood, sterile pestle, vortex, incubator, analytical
balance, autoclave.
-Laboratory material: pipettes, sterile tips, test tubes, Petri dishes, vernier calliper, glass
spreader, sterile tweezers.
- Solutions: - Bacteriological media: Marine Agar 2216 (for total heterotrophic bacteria),
TCBS agar (for Vibrio spp.) both media having been previously prepared using
deionized water, according to the indications provided by the company
(OXOID, BD or similar).
- Artificial Seawater (ASW) (35 g/L) sterilised in autoclave (121°C, 20 minutes)
- Deionized water
Procedure:
1. Place the necessary instruments, materials and solution into a laminar flow hood. All
following operations must be done here (i.e. under sterile conditions) to avoid
contamination of the sample.
2. Collect a coral sample of 0.5 cm in length.
3. Take a calliper, carefully rinse it with ethanol and flame it to sterilize it.
4. Accurately measure the dimension of the coral sample along the 3 axes (x, y and z),
using the calliper.
5. After measurements, weigh the coral using an analytical balance.
6. Put the coral into a sterile test-tube (15 ml) and add 5 ml of Artificial Seawater (ASW)
7. Vortex for a few seconds and centrifuge (2500 x g, 3 minutes). At the end, remove
the coral sample (by using sterile tweezers) and place into a new 15-ml centrifuge
tube containing 5 ml of ASW. (This procedure is needed to eliminate the coral mucus
and mucus-associated bacteria).
8. Vortex and centrifuge again as described.
September 2009
H
35
CORALZOO
9. Remove the coral sample and place into a new 15-ml centrifuge tube.
10. Add 5 ml of Artificial Seawater (ASW).
11. Crush the coral sample using a sterile pestle.
12. Vortex the crushed sample for 1 minute.
13. Let the particulate material settle for 3 minutes (to allow the crushed skeleton to
sediment).
14. Collect 0.1 ml from the upper phase of the liquid.
15. Spread this aliquot directly onto both media using a sterile glass spreader. Both the
media (MA2216 and TBCS) have been previously prepared using deionized water,
according to the indications provided by the respective companies. Plate triplicate
samples of this aliquot.
16. Collect another 0.1 ml sample from the suspension.
17. Dilute 10–1 – 10–5 in ASW and spread 0.1 ml aliquots on the media. Plate triplicate
samples of each dilution.
18. Incubate aerobically at 26°C – 30°C.
19. Count the colonies formed after 24 hours (on TCBS medium, for Vibrio spp.) or 48
hours (on MA2216 medium). To achieve optimal statistical significance, between 30
and 300 colonies should be counted on those plates.
20. Write down the results as the number of CFU (Colony Forming Units) per cm² or,
alternatively, number of CFU per g WW (Wet Weight) of coral, obtained as the
average of all the replicates plus a standard error.
To identify the colonies grown, it is necessary to purify each colony by re-streaking it one-two
times onto Petri plates containing fresh medium. The colony can further be identified using
16S rDNA sequencing (see Protocol 3.7.4.7. Identification of Bacterial Colonies using
PCR and 16S rDNA sequencing, in this chapter).
References
Bythell, J.C., M.R. Barer, R.P Cooney, J.R. Guest, A.G. O’Donnell A.G., O. Pantos and
M.D.A. Le Tissier, 2002. Histopathological methods for the investigation of microbial
communities associated with disease lesions in reef corals. Lett. Appl. Microbiol. 34: 359–
364
Cervino, J.M., F.L. Thompson, B. Gomez-Gil, E.A. Lorence, T.J. Goreau, R.L. Hayes, K.B.
Winiarski-Cervino, G.W. Smith, K. Hughen and E. Bartels, 2008. The Vibrio core group
induces yellow band disease in Caribbean and Indo-Pacific reef-building corals. J. Appl.
Microb.105: 1658-1671
Luna, G.M., F. Biavasco and R. Danovaro, 2007. Bacteria associated with the Rapid Tissue
Necrosis (RTN) of stony corals. Environ. Microbiol. 9:1851-1857
September 2009
H
36
CORALZOO
3.7.4.7. IDENTIFICATION OF BACTERIAL COLONIES USING PCR AND 16S rDNA
SEQUENCING
--------------------------------------------------------------------------------------------------------------------------Purpose:
Isolated bacteria are here identified using PCR (Polymerase Chain Reaction) and
sequencing of the 16S rRNA gene. This molecular procedure represents a valid alternative to
other time-consuming traditional methods, which are based onto morphological, biochemical
and/or enzymatic testing. Compared to traditional identification techniques, the 16S rDNA
method allows achieving the putative identification of bacteria on a phylogenetic basis, by
finding its closest relative within 16S rRNA databases. This method may be, however, not
sufficient for Vibrio identification at the species level, for which other molecular markers have
been recently proposed. In addition, the method may be not easily straightforward to be
applied by an operator not possessing at least basic training in both microbiology and
molecular biology. As a valid alternative for many aquarists, bacterial isolates can be sent to
private or university laboratories who can perform the identification procedure.
This work instruction describes the necessary steps for identifying bacteria which have
previously been isolated onto microbiological media, in a reliable and precise way (see Work
Instruction: Enumeration and isolation of culturable heterotrophic bacteria and of Vibrio spp.
on stony coral tissues).
Required materials:
- Laboratory instrumentation: laminar flow hood, incubator, microcentrifuge, vortex,
thermalcycler, spectrophotometer, electrophoresis apparatus, microwave, trans-illuminator,
autoclave, (capillary sequencer)
-Laboratory material: pipettes, sterile tips, Petri dishes, PCR test-tubes (200 µl)
- Solutions: - Bacteriological media: Marine AGAR 2216 (for total heterotrophic bacteria),
TCBS agar (for Vibrio spp.)
- Ultrapure, autoclaved (121°C, 20 minutes) Milli -Q water
- Reagents for PCR reaction (Taq polymerase, dNTPs, buffers)
- Unlabelled oligonucleotides (see below for their nucleotide sequence)
- Agarose powder
- TBE buffer
- DNA purification kit (Wizard PCR clean-up system, Promega, Wisconsin,
USA or similar)
Procedure:
a. Obtaining a pure culture
1) Take a Petri dish containing a growth medium (i.e. MA2216 for total heterotrophic
bacteria, TCBS agar for Vibrio spp.)*, in which bacterial colonies have grown.
2) Select a well isolated colony.
3) Take this colony up and “streak” it onto a Petri dish containing fresh medium of the same
type utilised for the first enrichment. To "streak" the colony, use a sterile inoculation loop (it
can be made of plastic or metal).
4) Incubate overnight at the same temperature utilised for the isolation.
5) When new colonies have grown, repeat this procedure one more time to achieve a pure
culture.
September 2009
H
37
CORALZOO
b. Preparation for DNA extraction
1) To obtain a crude DNA extract (which is of sufficient purity to be amplified), fill a PCR testtube with 20 µl of sterile milliQ water.
2) Gently touch a well-separated colony in the Petri dish with a sterile plastic tip and immerse
it for a few seconds into the PCR test-tube.
c. DNA extraction
3) Heat the test-tube to 95°C for 5 minutes.
4) Centrifuge for 5 minutes at 10.000 x g to separate the supernatant (containing the DNA)
from the detrital cellular material.
d. Amplification
1) Amplify the 16S rRNA gene sequence by utilising the universal bacterial primers 27F (5’ AGAGTTTGATCCTGGCTCAG - 3’) and 1492R (5’ - GGTTACCTTGTTACGACT - 3’).
Perform the PCR reactions in a thermalcycler in a final volume of 50 µl, using either one of
the many available Taq Polymerase kits. The reactions can be carried out according to the
procedure described in the kit. Prepare all reagents as a master-mix, before the addition of
template DNA (i.e. 1 µl of the supernatant). Use 30 PCR-cycles, consisting of 94°C for 1 min,
55°C for 1 min and 72°C for 2 min, preceded by 3 mi n of denaturation at 94°C and followed
by a final extension of 10 min at 72°C. Run a nega tive control for each PCR reaction,
containing the PCR-reaction mixture but no DNA templates (to check for eventual
contaminations of reagents utilised) and a positive control, containing the PCR-reaction
mixture plus genomic DNA of Escherichia coli.
e. Checking PCR-products
1) After amplification, check PCR-products (using a 5 µl aliquot of each PCR reaction) on
agarose-TBE gel (1%), containing ethidium bromide for DNA staining and visualization. The
electrophoresis run also allows to check for the presence of unwanted or unspecific PCR
products. The gel can be prepared by dissolving the agarose powder in 1X TBE (1% agarose
concentration) using a microwave.
f. Purification
1) Purify each PCR product using the Wizard PCR clean-up system (Promega, Madison,
Wis.) or similar. If unspecific PCR products are observed, it is possible to purify the PCR
product directly (you mean if NO unspecific PCR products are observed?). Conversely, if
unspecific amplicons are observed during the agarose run, it will be necessary to separate
the PCR products by electrophoresis, then excise the band of proper size and subsequently
purify the PCR product from the gel matrix with the same clean-up system or similar. Elute
the purified DNA in 50 µl of water supplied with the clean-up system and then quantify the
concentration of PCR products using a spectrophotometer.
g. Sequencing
1a) The sequencing protocol includes a subsequent reaction using a commercial sequencing
kit (such as the ABI Prism BigDye Terminator kit or similar), purification of the PCR product
and run onto DNA capillary sequencer.
1b) As an alternative, it is possible to contact one of the several companies which offer rapid
and inexpensive sequencing of DNA fragments. This choice indeed provides several
advantages, such as bypassing the purchase of an expensive instrument (i.e. a capillary
sequencer) and providing the technical support needed for obtaining high quality results.
h. Analysis
1) Analyse the sequence obtained for each isolate available using bioinformatics tools, such
as the commonly utilised BLAST (http://www.ncbi.nlm.nih.gov/BLAST/), which allows the
identification of the closest bacterial relatives.
September 2009
H
38
CORALZOO
* For the preparation of each microbiological medium, consult Protocol 3.7.4.6.:
“Enumeration and isolation of culturable heterotrophic bacteria and of Vibrio spp. on stony
coral tissues”.
September 2009
H
39
CORALZOO
3.7.4.8. PREPARATION OF STONY CORALS SAMPLES FOR SEM (SCANNING
ELECTRON MICROSCOPY) OBSERVATIONS
Purpose: The Scanning Electron Microscope (SEM) is a particular type of electron
microscope, which images the sample surface by scanning it with a high-energy beam of
electrons and reveals information about the sample's surface topography, composition and
other properties. A wide range of possible magnifications is available (up to x 250,000). It
can be used in the framework of coral disease investigations to gather information about the
presence of possible microorganisms or structures associated with the tissue.
This protocol describes how to prepare stony coral samples for Scanning Electron
Microscopy (SEM). SEM allows higher magnifications, and other ways of observation than
conventional optical microscopy. It may thus be useful to detect the presence of microscopic
organisms or other microscopic structures on the diseased tissues, which may be linked to
the appearance of the observed disease. With SEM it is possible to visualise prokaryotic
cells, aggregates or biofilms on the coral surface, as well as other potentially pathogenic
eukaryotic microorganisms (e.g. protists, fungi or microalgae) or cellular forms (e.g.
nematocysts) released by other corals. SEM analysis by itself cannot support the hypothesis
of a microbial origin of the observed disease, but indeed can add important information to the
results obtained using the other microbiological assays (Johnston and Rowher 2007).
Required materials:
- Laboratory instrumentation: laminar flow hood, SEM, Critical Point Dryer, SEM Gold
Coater
-Laboratory material: pipettes, sterile tips, test-tubes, SEM material (aluminium stubs
designed for treatment under a Critical Point Dryer), forceps.
- Solutions:
- 2.5% glutaraldehyde, diluted with Artificial SeaWater (35 g/L), then pre-filtered
(using a syringe
filter with 0.2 µm poresize)
- Absolute ethanol (100%)
- Deionized, 0.2 µm filtered water (to prepare ethanol dilutions)
Procedure:
1) Collect a small coral fragment (0.5 cm in length or less) under sterile conditions (a laminar
flow hood) using sterile forceps.
2) Put the coral into an Eppendorf sterile test-tube (1.5 ml).
3) Add 1 ml of the 2.5% glutaraldehyde solution. Incubate for 1 hour.
4) Discard the glutaraldehyde carefully using a pipette.
5) Add 1 ml of 10% ethanol. Incubate for 10 minutes.
6) Discard 10% ethanol and add 1 ml of 30% ethanol. Incubate for 10 minutes.
9) Discard 95% ethanol and add 1 ml of absolute ethanol. Incubate overnight.
10) Then store at 4°C.
11) Transfer the coral fragment onto a metal support (aluminium stub), designed for
treatment under a Critical Point Dryer. The drying procedure allows the removal of water
from the sample without damaging biological structures.
12) Dry under the Critical Point Dryer.
September 2009
H
40
CORALZOO
13) After drying, treat the coral fragment for gold coating using a SEM Gold Coater.
14) Observe the coral fragment under SEM.
Nematocysts on the surface of a diseased specimen (Montipora sp.).
A coral specimen suffering from “white-syndrome” (left), characterized by the presence of
several bacterial cells on the tissue (right).
Reference:
Johnston I.S., Rohwer F. (2007) Microbial landscapes on the outer tissue surfaces of the
reef-building coral Porites compressa. Coral Reefs 27:375-383
September 2009
H
41
CORALZOO
3.7.4.9. APPLICATION OF THE DIAGNOSTIC KIT DEVELOPED FOR THE RAPID
DETECTION OF VIBRIO HARVEYI, A BACTERIAL PATHOGEN OF STONY CORALS
Basic information provided by Prof. Roberto Danovaro, Dr. Gian Marco Luna and Dr. Lucia
Bongiorni
Contacts: Gian marco Luna
e-mail [email protected]
Lucia Bongiorni
e-mail [email protected]
---------------------------------------------------------------------------------------------------------------------------
Purpose; On of the goals of the CORALZOO project was the development of an “easy-to-use”
diagnostic tool for the detection/enumeration of the bacterium Vibrio harveyi on coral
samples. The kit is the result of intensive laboratory work, carried out on healthy and
diseased aquarium corals suffering from various types of “White Syndrome”, (sensu Bythell
et al. 2004; Willis et al. 2004; Ainsworth et al. 2007) a condition identified as one of the most
common problems in aquarium-maintained corals. While not all WS events on corals can be
explained by the presence of bacterial infections, the species Vibrio harveyi has been
however implicated in the appearence of WS in many captive stony corals (Luna et al. 2007).
The pathogen is believed to induce symptoms by means of opportunistic infections, possibly
triggered by changing environmental conditions. The availability of a kit for the easy and
rapid detection and enumeration of this bacterium is thus a useful tool in making a diagnosis
and planning efficacious treatments of a WS event observed in aquaria.
This protocol describes how the kit can be applied for detecting V. harveyi on diseased
tissues and in the aquarium water.
Materials:
- Laboratory instrumentation: incubator, (laminar flow hood), (stereomicroscope or
magnification lens)
-Laboratory material: kit content
- Solutions: no solutions are required
a) Isolation from aquarium water
1) Prepare a clean bench and wear gloves.
2) Unwrap a VH agar plate.
3) With the syringe aspire 9 ml of seawater, insert a mono-use syringe filter device and filter
the water into a new test tube. Repeat this procedure twice, in order to have two test tubes
each containing 9 ml of filtered seawater (hereafter defined as “TUBE 1” and “TUBE 2”).
4) Remove the syringe filter device from the syringe.
5) With the syringe aspire 1 mL of aquarium water, add to “TUBE 1” and mix by gentle
shaking (this procedure allows to dilute the water sample).
6) With the syringe aspire 1 mL of water mix from “TUBE 1” and put into “TUBE 2” (this
procedure is needed to improve the subsequent filtration and to achieve an homogeneous
distribution of the diluted sample onto the filter).
7) Mount the wrapped sterile 47 mm-filter onto the filter holder .
8) Holding the piston, insert the filter holder to the syringe.
9) Gently filter the water mix.
10) Carefully unscrew the filter holder and transfer the filter on the surface of a VHA plate
using sterile forceps.
11) Position the filter on the agar plate with grid side facing up .
12) Cover plates with the lids and incubate at 28-30°C for 48 hrs.
September 2009
H
42
CORALZOO
13) After 48 hrs, observe incubation plates macroscopically (possibly with the aid of a
stereomicroscope or with a magnification lens).
14) Vibrio harveyi colonies appear light green, with a dark centre, diameter size ≤ 2 mm,
sometimes with a yellow halo (see picture).
15) Count the number of Vibrio harveyi colonies.
16) Multiply for a factor X10 and write down the results as the number of CFU's per ml of
aquarium water.
2) Isolation from diseased colonies
1) Prepare a clean bench (clean with alcohol and tissue paper) and wear gloves.
2) Unwrap a VH agar plate.
3) Using sterile forceps, hold and remove the target coral from the aquarium tank for a few
seconds during this operation.
4) Pass the cotton swab along the diseased coral tissue and hold the swab-tissue contact for
2 seconds (figure a).
5) Streak the swab three times on a VHA plate (figure b) .
6) Incubate the plate at 28 - 30°C for 48 hrs.
7) After 48 hours, observe growth (figures c and d), possibly with the aid of a
stereomicroscope or with a magnification lens.
8) Check whether the grown colonies display the above described Vibrio harveyi
characteristics.
N.B.: a handy folder about this method has been produced
September 2009
H
43
CORALZOO
a
b
c
d
References
Ainsworth, T.D., E.C. Kvennefors L.L. Blackall M. Fine and O. Hoegh-Guldberg, 2007.
Disease and cell death in white syndrome of Acroporid corals on the Great Barrier Reef.
Mar. Biol. 151: 19-29.
Bythell, J.C., O. Pantos and L.L. Richardson, 2004. White plague and other “white”
diseases. In “Coral health and disease” (Eds. Rosenberg E, Loya Y), Springer-Verlag,
New York. pp. 351-366.
Luna, G.M., F. Biavasco and R. Danovaro, 2007. Bacteria associated with the Rapid
Tissue Necrosis (RTN) of stony corals. Environ. Microbiol. 9: 1851-1857.
Willis, B.L., C.A. Page and E.A. Dinsdale, 2004. Coral disease of the Great Barrier Reef.
In “Coral health and disease” (Eds. Rosenberg E, Loya Y), Springer-Verlag, New York.
pp. 69-104
September 2009
H
44
CORALZOO
3.7.4.10. The comet assay: a marker for genotoxic conditions in public aquariums
-------------------------------------------------------------------------------------------------------------------------Baruch Rinkevich
Although the comet assay methodology is straightforward and does not require sophisticated
equipment, the analysis of the comet images is not so simple. This is the reason why a
specific protocol is not provided here. It is recommended, however, that the potential
genotoxic impacts of light regime and other conditions in the aquarium (oxygen, water
quality, leaching of genotoxic materials from equipment that is in contact with seawater,
including holding facilities, etc.) will be monitored and evaluated from time to time, at least
twice a year. This can be performed by outsourcing the assay to a laboratory that specialized
in comet assay analyses.
The text below is an explanation of the essence of the comet assay.
Corals that are held in public aquaria are exposed to variety of external environmental agents
that may affect biological and physiological parameters. Some of the agents, can not be
evaluated by the eye, others may impose damages without the aquarium keeper even
realizing their existence. One example is the light that on the one hand is highly beneficial to
corals and on the other hand may cause damages to cells and DNA integrity. Another
example is excess oxygen in seawater. Agents that impose DNA damages are collectively
called genotoxic and their impact is termed ‘genotoxicity’. Genotoxicity is directly correlated
to the level of DNA strand breaks and this biological parameter can be used as an early
indicator for exposure to a wide variety of genotoxic agents. As there are so many potential
genotoxic agents, it is wise to employ a nonspecific biomarker for the total genotoxic impacts
on organisms, without specifying the different causes. Such a biomarker, that may highlight
on genotoxic conditions developed in the aquarium, is called ‘an early warning’ biomarker.
The most reliable and sensitive method for evaluating DNA damage is the single cell gel
electrophoresis assay, also known as the comet assay, named for the appearance of
broken DNA fragments as the tail of a comet on the gel electrophoresis field (Figure 1). It
was first introduced by Östling and Johanson (1984) as an assay for detecting DNA doublestrand breaks in irradiated mammalian cells under neutral conditions. Singh et al. (1988) and
Olive et al. (1990) independently modified the assay by developing alkaline versions (pH >
13 and pH=12.3, respectively). More recently Avishai et al. (2003) further compared between
various analyzes that shape the sensitivity of the assay. The alkaline comet assay is capable
of detecting a wide variety of DNA damages such as DNA single-strand breaks, doublestrand breaks, DNA-DNA/ DNA-protein cross links, oxidative-induced base damages, alkalilabile sites, and sites undergoing DNA repair.
Methodology in brief: About 10 µl of cell suspension (~2 x 105 cells) of the organism tested
(cells of corals should be first dissociated; details in Rinkevich et al., 2005) is embedded in
90 µl of 0.65% low-melting agarose layers on a Star-frost microscope slide, pre-coated with
0.65% normal melting agarose. After 20 min of solidification at 4°C, a third layer of 120 µl of
0.65% low-melting agarose is placed on top and left at 4°C for an additional period of 20 min
to allow solidification. The cells are then lysed by immersing the slides overnight in a freshly
prepared lysis solution (2.5 M NaCl, 100 mM EDTA, 10 mM Tris, 1 % Triton X-100, 10%
DMSO, pH 10.0) at 4°C. After lysis, the slides are washed in cold water (x 3) for 15 min and
placed on a horizontal gel electrophoresis tray containing freshly prepared electrophoresis
buffer (1 mM EDTA, 300 mM NaOH, pH 13.0) for 20 min to allow DNA unwinding.
Electrophoresis is then carried out at 20 V and at a starting current of 300 mA for 20 min.
Thereafter, the slides are neutralized with 0.4 M Tris pH 7.5 for 15 min (x3), fixed in ethanol
and dried. The slides are stained with 60 µl of 20 µg/ml ethidium bromide solution and
viewed under a fluorescent microscope using a filter. For each sample it is recommended to
September 2009
H
45
CORALZOO
count at least 50-100 cells for DNA breakage analyzes, using several parameters commonly
used (see Avishai et al., 2003 for more details).
Practical advices: Today, the comet assay is recognized as one of the most sensitive
methodologies available for DNA strand break detection and is distinguished by being
simple, fast and effective, even for extremely small samples of cells, widely used for studies
in genetic toxicology, environmental genotoxicity, and for clinical, radiation biology and DNA
repair investigations.
A clarifying note- Background genotoxicity (total genotoxicity that is associated with all
organisms during their normal life span and is well treated by various repair mechanisms),
should be first determined for each aquarium facility. Only excess genotoxicity is harmful.
Sometimes too high background genotoxicity is also harmful on the long range. All these
issues should be discussed with experts before coming to either conclusion.
Literature cited:
Avishai, N., Rabinowitz, C., Rinkevich, B. 2003. The use of the comet assay for studying
environmental genotoxicity: comparisons between visual and image analyses. Environ.
Mol. Mutagen. 42, 155-165.
Olive PL, Banath JP, Durand RE. 1990. Heterogeniety in radiation-induced DNA damage
and repair in tumor and normal cells measured using the “Comet” assay. Rad. Res. 122,
86-94.
Östling O and Johanson, KJ. 1984. Microelectrophoretic study of radiation-induced DNA
damages in individual mammalian cells. Biochem. Biophys. Res. Commun. 123, 291298.
Rinkevich, B., Avishai, N., Rabinowitz, C. 2005. UV incites diverse levels of DNA breaks in
different cellular compartments of a branching coral species. J. Exp. Biol. 208, 843-848.
Singh NP, McCoy MT, Tice RR, Scheider EL. 1988. A simple technique for quantitation of
low levels of DNA damage in individual cells. Exp. Cell. Res. 175, 184-191.
Figure 1. Different shapes of DNA damages in cell nuclei (the white circles). The left figure
represents undamaged cells, in the right- a case where all DNA content is broken,
found in the tail (the ‘head’ dis)
September 2009

1. Health - CORALZOO

Transcription

Similar documents

2nd Floor • Aquarium Adventure Exhibit 1st Floor • Aquarium

Terumbu Karang dan Perubahan Iklim Coral Reefs

The QM Current - Quality Marine

48x96 poster template

What`s coral reef

Friend or Foe

Biomes Slides

Issue 31 - Coral Park Primary School

November