Kerstin Caroline Hahn - TiHo Bibliothek elib

Transcription

Hannover 2014
Verlag: Deutsche Veterinärmedizinische Gesellschaft Service GmbH
35392 Gießen · Friedrichstraße 17 · Tel. 0641 / 24466 · Fax: 0641 / 25375
E-Mail: [email protected] · Internet: www.dvg.de
Kerstin Caroline Hahn
ISBN 978-3-86345-248-3
Bibliografische Informationen der Deutschen Bibliothek
Die Deutsche Bibliothek verzeichnet diese Publikation in der
Deutschen Nationalbibliografie;
Detaillierte bibliografische Daten sind im Internet über http://dnb.ddb.de abrufbar.
1. Auflage 2015
© 2015 by Verlag: Deutsche Veterinärmedizinische Gesellschaft Service GmbH,
Gießen
Printed in Germany
ISBN 978-3-86345-248-3
Verlag: DVG Service GmbH
Friedrichstraße 17
35392 Gießen
0641/24466
[email protected]
www.dvg.de
University of Veterinary Medicine Hannover
Department of Pathology
Center for Systems Neuroscience
In vitro and in vivo characterization of pathomechanisms of inherited neurodegenerative
disorders in dogs
Thesis
Submitted in partial fulfilment of the requirements for the degree
DOCTOR OF PHILOSOPHY
(PhD)
awarded by the University of Veterinary Medicine Hannover
by
Völklingen
Hannover, Germany 2014
Supervisor:
Prof. Dr. Wolfgang Baumgärtner, Ph.D.
Supervision Group:
Prof. Dr. Peter Claus
Prof. Dr. Herbert Hildebrandt
1st Evaluation:
Department of Pathology,
University of Veterinary Medicine Hanover
Prof. Dr. Peter Claus
Institute of Neuroanatomy,
Hannover Medical School
Prof. Dr. Herbert Hildebrandt
Department of Cellular Chemistry,
Hannover Medical School
2nd Evaluation:
Date of final exam:
Prof. Dr. Tosso Leeb
Institute of Genetics
Vetsuisse Faculty, University of Bern
13.03.2015
Kerstin Caroline Hahn was supported by the Department of Pathology, University of
Veterinary Medicine Hannover and the Foundation of German Business (Stiftung der
Deutschen Wirtschaft).
Parts of the thesis have been published:
Gerhauser I, Hahn K, Baumgärtner W, Wewetzer K. 2012.
Culturing adult canine sensory neurons to optimise neural repair.
Vet Rec 170:102.
Parts of the thesis have been presented at congresses:
Hahn K, Rhodin C, Jagannathan V, Wohlsein P, Baumgärtner W, Grandon R, Jäderlund KH,
Drögemüller C.
Tectonin beta-propeller repeat-containing protein 2 (TECPR2) missense mutation associated
with neuroaxonal dystrophy in Perros de Agua Espanol.
Second joint European Congress of the ESVP, ECVP and ESTP; Berlin, 2014.
Drögemüller C.
Tectonin beta-propeller repeat-containing protein 2 (TECPR2) missense mutation associated
with neuroaxonal dystrophy in Perros de Agua Espanol.
Second International Workshop of Veterinary Neuroscience; Hannover, 2014.
Drögemüller C.
Neuroaxonale Dystrophie beim Spanischen Wasserhund infolge einer Mutation im Tectonin
beta-propeller repeat containing protein 2 (TECPR2) Gen
57. Jahrestagung der Fachgruppe Pathologie der Deutschen Veterinärmedizinischen
Gesellschaft. Fulda 2014. Tierärztliche Praxis Kleintiere: A15-A25.
To my parents and my
brother Christian
There is only one thing that makes a dream impossible to achieve: the fear of failure.
(Paulo Coelho, The Alchemist)
Contents
I
Contents
1 General introduction
1
1.1
The dog as a translational model for human inherited neurodegenerative diseases
1
1.2
Dorsal root ganglia cultures as an in vitro model in neuroscience
2
1.3
GM1-ganglioside in ageing, age-associated neurodegenerative diseases and GM1gangliosidosis
3
1.4
Autophagy in mammalian cells
6
1.4.1
Overview and subtypes of autophagy
6
1.4.2
The molecular mechanisms of macroautophagy
7
1.4.3
Autophagosome formation
9
1.4.4
Fusion of autophagosomes with lysosomes or endosomes
11
1.4.5
Reformation of lysosomes from autophagolysosomes
13
1.4.6
Transcriptional regulation of lysosomal network proteins
14
1.4.7
Selective autophagy
15
1.4.8
Autophagy modulating factors and signaling mechanisms
15
1.4.9
Autophagy, ER stress, unfolded protein response and ER-associated degradation
16
1.4.10
Autophagy and the ubiquitin proteasome system
17
1.4.11
The lysosomal network: coupling of endocytosis and autophagy
18
1.4.12
Impairments of the lysosomal network in inherited neurodegenerative diseases
20
1.5
Human hereditary spastic paraparesis and neuroaxonal dystrophies in humans
and dogs
2 Canine dorsal root ganglia cell cultures as an in vitro model to characterize
pathomechanisms of inherited neurodegenerative disorders in dogs
23
27
2.1
Culturing adult canine sensory neurons to optimise neural repair
27
2.2
GM1 ganglioside promotes synaptophysin accumulations and cytoskeletal changes in
neurons and non-neuronal cells from adult dorsal root ganglia cultures
28
3 Neuroaxonal dystrophy in Spanish water dogs as an in vivo model to characterize
pathomechanisms of inherited neurodegenerative disorders in dogs
3.1
Tectonin beta-propeller repeat-containing protein 2 (TECPR2) missense mutation –
disturbances of the autophagy pathway associated with neuroaxonal dystrophy in
Spanish water dogs
4 General discussion
67
67
105
II
Contents
4.1
Adult canine dorsal root ganglia neurons as an in vitro model to study neuron-glia
interactions and GM1 and/or growth factor-mediated effects
105
4.2
Spontaneously occurring inherited CNS diseases in dogs as a translational in vivo
model to study pathomechanisms of neurodegeneration
108
4.3
Concluding remarks
110
5 Summary
113
6 Zusammenfassung
117
7 References
121
8 Acknowledgements
155
Abbreviation list
III
Abbreviation list
AD:
Alzheimers disease
ALR:
autophagic lysosome reformation
ALS:
amyotrophic lateral sclerosis
AMPK:
AMP-activated protein kinase
AP:
adaptor protein (AP)
ARHGEF16:
rho guanine nucleotide exchange factor 16 (also termed Nbr)
ATG:
autophagy-related genes in mammals
Atg:
autophagy-related genes in yeast
ATP:
adenosine triphosphate
ATP13A2:
lysosomal type 5 P-type ATPase encoding gene
BDNF:
brain-derived neurotrophic factor
BECN1:
beclin-1
BNIP3L:
BCL2/adenovirus E1B 19kDa interacting protein 3-like (also termed Nix)
BPAN:
beta-propeller associated neurodegeneration
BSA:
bovine serum albumin
C19orf12:
chromosome 19 open reading frame 12
2+
Ca :
calcium
CLEAR:
coordinated lysosomal expression and regulation (CLEAR) consensus sequence
CNPase:
2’,3’-cyclic nucleotide 3’-phosphohydrolase
CNS:
central nervous system
COPI:
coatomer complex I
CSF1R:
colony stimulating factor 1 receptor encoding gene
DME:
Dulbecco’s modified Eagle
DMEM:
Dulbecco’s modified Eagle medium
dps:
days post seeding
DRG:
dorsal root ganglia
IV
Abbreviation list
EGF:
epidermal growth factor
EGR2:
early growth response 2
ER:
endoplasmatic reticulum
ERAD:
ER-associated degradation
ESCRT:
endosomal sorting complex required for transport
FCS:
fetal calf serum
FGF2:
fibroblast growth factor 2
FIG:
figure
FYCO1:
FYVE (phenylalanine, tyrosine, valine, glutamic acid) and coiled-coil domain
containing protein 1
GAN:
gigaxonin encoding gene
GAP43:
growth associated protein 43
GBA:
glucocerebrosidase encoding gene
GFAP:
glial fibrillary acidic protein
GGAs:
Golgi-localized γ-ear-containing ADP ribosylation factor-binding proteins
GLB1:
acid β galactosidase
GM1:
GM1-ganglioside
GS:
glutamine synthetase
GSK-3:
glycogen synthase kinase-3
HBSS:
Hank's Balanced Salt Solution
HD:
Huntingtons disease
HDAC6:
histone deacetylase 6
HDLS:
hereditary neuroaxonal leukodystophy with spheroids
HE:
haematoxylin/eosin
HOPS:
homotypic vacuole fusion and vacuole protein sorting (HOPS) complex
HSP:
human hereditary spastic paraparesis/ paraplegia
Hsp70:
heat shock cognate protein 70
Iba1:
ionized calcium-binding adapter molecule 1
Abbreviation list
KFERQ:
amino acid motiv: lysine (K), phenylalanine (F), glutamic acid (E), arginine (R),
Glutamine (Q)
LAMP:
lysosomal-associated membrane protein
LC3:
microtubule-associated protein-light chain 3
LFB-CV:
Luxol fast blue-cresyl violet
LIR:
LC3-interacting regions
LL:
large light (neurons)
LRRK2:
leucine-rich repeat kinase 2 encoding gene
LSD:
lysosomal storage disorders
MAP2:
microtubule-associated protein 2
MFN2:
mitofusin 2
ml:
milliliter
MPAN:
mitochondrial membrane protein associated neurodegeneration
MPRs:
mannose-6-phosphate receptors
mTORC1:
mammalian or mechanistic target of rapamycin complex 1
MVB:
multivesicular body
NAD:
neuroaxonal dystrophy
NBIA:
neurodegeneration with brain iron accumulation
NBR:
ARHGEF16 homolog in Drosophila melanogaster
NDP52:
nuclear dot protein 52
ng:
nano-gram
NGF:
nerve growth factor
Nix:
also termed BNIP3L
nm:
nano meter
nNF:
non-phosphorylated neurofilament
OCT:
optimum cutting temperature
OECs:
olfactory ensheathing cells
OPTN:
optineurin
p53:
tumor protein p53
V
VI
Abbreviation list
p62:
p75
also termed SQSTM1
NTR
:
low affinity neurotrophin receptor
PANK2:
pantothenate kinase 2 encoding gene
PARK2:
Parkin encoding gene
PARK6 :
PINK1 encoding gene
Parkin:
Parkin RBR E3 ubiquitin protein ligase
PD:
Parkinson’s disease
PE:
phosphatidylethanolamine
pH:
potentia Hydrogenii
PI3KC3:
class III phosphoinositide 3-kinase (also termed Vps34)
PINK1:
PTEN induced putative kinase 1
PIP3:
phosphatidylinositol 3-phosphate
PKAN:
pantothenate kinase-associated neurodegeneration
PLA2G6:
phospholipase A2, group VI encoding gene
PLAN:
PLA2G6-associated neurodegeneration
PLOSL:
Polycystic Lipomembranous Osteodysplasia with Sclerosing
Leukoencephalopathy
pNF:
phosphorylated neurofilament
PNS:
peripheral nervous system
POLD :
pigmentary orthochromatic leukodystrophy
Rab:
Ras-related proteins in brain GTPase
RabGAPs:
Rab GTPase-activating proteins
ROS:
reactive oxygen species
Rubicon:
RUN domain cysteine rich domain containing, beclin-1 interacting protein
S100:
S100-protein
SA-GLB1:
senescence-associated β-galactosidase
SD:
small dark (neurons)
SGCs:
satellite glial cells
Sirt1:
sirtulin 1
Abbreviation list
SNARE:
N-ethylmaleimide-sensitive-factor attachment receptor protein
SNCA:
synuclein encoding gene
SOX2:
sex-determining region Y-box 2
SPG11:
spastic paraplegia 11 or spatacsin
SPG15:
zinc finger FYVE domain-containing protein 26 or spastizin
SPG49:
tectonin beta-propeller repeat-containing protein 2 (TECPR2)
SPG60:
WD repeat-containing protein 48
SQSTM1:
sequestosome 1(also termed p62)
SV:
synaptic vesicles
Tau1:
Tau 1-protein
TECPR2:
tectonin beta-propeller repeat-containing protein 2 or SPG49
TFEB:
transcription factor EB
TREM2:
triggering receptor expressed on myeloid cells 2 encoding gene
Trk:
tyrosine kinase
TYROBP:
TYRO protein tyrosine kinase binding protein encoding gene
ULK:
Unc51-like kinase
UPR:
unfolded protein response
UPS:
ubiquitin proteasome system
V-ATPase:
vacuolar-type H+-ATPase
VCP:
p97/valosin-containing protein
WDR:
WD (tryptophan, aspartatic acid) repeat domain-containing protein
WIPI:
WD (tryptophan, aspartic acid) repeat domain phosphoinositide-interacting
protein
ZKSCAN3:
zinc finger with KRAB and SCAN domains 3
βIII tubulin:
neuronal class III β tubulin
μm:
micro meter
μM:
micro mole
VII
General introduction
1
1.1
1
The dog as a translational model for human inherited neurodegenerative diseases
During recent years, the relevance of the dog as a translational large animal model for
human neurodegenerative conditions including lysosomal storage disorders (LSD),
amyotrophic lateral sclerosis (ALS), Alzheimer´s disease (AD), epilepsy, spinal cord injury, but
also physiological ageing has significantly increased (Katz et al., 2005; Hytönen et al., 2012;
Bock et al., 2013; Head, 2013; Morgan et al., 2013; Potschka et al., 2013). All these naturally
occurring conditions in humans and dogs are modulated or even determined by genetic
factors (Ball et al., 1982; Platt et al., 2012; Tanzi, 2012; Browne et al., 2014; Busch et al.,
2014; Deelen et al., 2014). Consequently, understanding the genetic basis and the
corresponding pathogenetic mechanisms of neurodegenerative diseases in animals and
humans is essential to develop therapeutic approaches. Since the beginning of the twentieth
century, the foremost model for laboratory studies in mammals has been the mouse
(Paigen, 1995; Karlsson and Lindblad-Toh, 2008; Webster et al., 2014). However, the mouse
has several restrictions as a model for complex human disease such as AD, ALS, and spinal
cord injury, which was highlighted by the limited therapeutic success compared to promising
preclinical data based on studies in rodent models (Benatar, 2007; Tator et al., 2012;
Cavanaugh et al., 2014). The reasons for this frequent observation are generally unknown,
but morphological, physiological, and genetic differences might partly account for difficulties
to extrapolate data from murine models to humans. In contrast, structure and organization
of the canine and human central nervous system (CNS) is similar to a large extent
(Techangamsuwan et al., 2008; Omar et al., 2011; Wewetzer et al., 2011). Furthermore, the
dog genome is less diverged from the human than the mouse genome (Lindblad-Toh et al.,
2005; Karlsson and Lindblad-Toh; 2008). The successful treatment of inherited blindness in
dogs by gene therapy demonstrates that the canine model provides a useful approach to
test novel therapies in vitro and in vivo (Bennicelli et al., 2008). Furthermore, the
identification of causative loci in dogs can identify genes and pathways that help to
understand and modulate the pathogenesis of human diseases.
2
1.2
Dorsal root ganglia cultures as an in vitro model in neuroscience
The paravertebral located dorsal roots of the spinal cord contain sensory ganglia. These
dorsal root ganglia (DRGs) are composed of afferent, pseudounipolar neurons, ensheathing
satellite glial cells (SGCs), and connective tissue cells (Hanani, 2005). DRG neurons transmit
autonomic and sensomotoric signals from the periphery to the CNS. According to
ultrastructural properties, DRG neurons were classified into two main subtypes termed as
“large light” (LL) and “small dark” neurons (SD; Lawson, 1992). LL neurons give rise to Aα
fibers and Aβ fibers (myelinated, fast conducting, nociceptive or non-nociceptive). Aγ fibers
(thinly myelinated, slow conducting, nociceptive) arise from the smaller population of LL
neurons, with a diameter similar to SD neurons, whereas C type fibers (non-myelinated, slow
conducting, nociceptive) originate from SD neurons (Harper and Lawson, 1985; Ruscheweyh
et al., 2007). However, due to overlapping sizes of the neuronal cell body and also
differences in sensory quality this classification just reflects tendencies (Ruscheweyh et al.,
2007). SGCs form a sheath around the DRG neurons, control their microenvironment, and
carry receptors for numerous neuroactive agents. Moreover, they communicate with
neighboring cells including DRG neurons. Consequently, SGCs represent an essential
component of signal processing and transmission within the DRG and functionally substitute
the lacking blood-brain barrier in sensory ganglia (Hanani, 2005; Krames, 2014).
DRG neurons from neonatal and adult rodents, chicken, pigs, and primates can easily be
accessed in order to cultivate them in vitro (Bray et al., 1978; Li, 1998; Roggenkamp et al.,
2012; Ramesh et al., 2013). Consequently, DRG cultures represent a widely used model to
study the pathogenesis and underlying molecular mechanisms of pathogen-host
interactions, neuropathic pain, and its pharmacological modulation (Ramesh et al., 2013;
Biggs et al., 2014; Liu et al., 2014; Krames, 2014). Additionally, DRG in vitro systems enable
the characterization of neuron-glia interactions, axonal growth and their modulation by
various types of neurotrophins and neuropharmacological compounds (Sondell et al., 1999;
Zhao et al., 2006; Päiväläinen et al., 2008). Neonatal murine and adult DRGs from rats
represent a potential source of stem/progenitor cells, which might originate from the SGCs
in adults (Namaka et al., 2001; Li et al., 2007). In vitro these cells can differentiate into glia,
3
smooth muscle cells, and neurons and seem to be involved in the recovery of neuronal
numbers in the DRG after peripheral nerve injury (Groves et al., 2003; Li et al., 2007). These
DRG inherent precursors might represent interesting candidates for gene therapy and/or
homologous cell transplantation assays as a treatment option for neurodegenerative
conditions.
Furthermore DRGs are affected in lysosomal storage disorders such as GM 1-gangliosidosis or
Tay-Sachs disease (Abe et al., 1985; Bieber et al., 1986). Ganglioside accumulations are also
induced in DRG neurons after application of compounds such as chloroquine or suramin that
selectively accumulate in the lysosomes (Klinghardt et al., 1981; Gill and Windebank, 1998).
Additionally, many other disorders with potential mitochondrial or cytoskeletal impairments
including ALS, AD, Parkinson's disease (PD), and diabetic and giant axonal neuropathy affect
DRGs (Tshala-Katumbay et al., 2005; Sasaki et al., 2007; Figueroa-Romero et al., 2008;
Sábado et al., 2014). Neuroaxonal dystrophy (NAD) in aged sympathetic ganglia, manifesting
as swollen, dystrophic, preterminal axons compressing or displacing the perikarya represents
also a common finding in humans and animals, whose pathogenesis is unknown (Schmidt et
al., 1990).
Consequently, DRGs may represent a valuable in vitro system to study the pathogenetic
mechanisms of lysosomal, mitochondrial, and/or age-associated neurodegenerative
conditions as well as therapeutically options.
1.3
GM1-ganglioside in ageing, age-associated neurodegenerative diseases and GM1gangliosidosis
Gangliosides represent sialic acid-containing glycosphingolipids found in cellular membranes
(Leeden et al., 1998). The highest ganglioside concentrations are present in neurons, in
which they account for 10 % of the total lipid content (Ledeen, 1978). GM 1-ganglioside (GM1)
represents the most commonly used ganglioside in brain-related research and seems to
influence cellular ageing, age-related neurodegenerative conditions and is involved in the
pathogenesis of lysosomal storage disorders as GM1-gangliosidosis (McJarrow et al., 2009;
Pernber et al., 2012; Wu et al., 2012; Regier and Tifft, 2013).
4
The brain ganglioside content changes in an age-related manner. In the fetal brain of
humans and rodents GM1 accumulates during synaptogenesis and early stages of
myelination (Irwin et al., 1980; Skaper et al., 1989). In humans, ageing is accompanied by a
decrease in brain GM1 content, whereas GM1 levels increase with ageing in the rodent brain
(Aydin et al., 2000). Species-specific and age-associated differences in GM1 degradation
pathways might account for the differences in GM1 content in the aged rodent and human
brain. For instance, mice possess an alternative GM1 asialo degradation pathway in contrast
to humans and dogs (Suzuki et al., 1988; Hahn et al., 1997). The relevance of this pathway in
murine GM1 degradation and its age-associated alterations are not known. However,
differences in the GM1 content between rodent and human brains should be considered in
the extrapolation of experimental results.
GM1 levels are also determined by its lysosomal degradation rate and depend on the activity
of the enzyme acid β-galactosidase (GLB1). The GLB1 activity detectable at suboptimal pH
6.0 was defined as senescence-associated β-galactosidase (SA-GLB1) and is a widely used
marker for neuronal senescence (Dimri et al., 1995; Geng et al., 2010). SA-GLB1 seems to
represent the accumulation of GLB1 in lysosomes, which might explain its activity also at
suboptimal pH conditions (Lee et al., 2006). Consequently, the age-associated variations in
GM1 metabolism might reflect impairments of the endosomal/autophagy pathway.
The age-associated decline of GM1 in the human brain parallels the age-dependent synaptic
loss and is discussed as a factor involved in the pathogenesis of several age-related
neurodegenerative conditions including AD and PD (Pernber et al., 2012; Wu et al., 2012).
This hypothesis is supported by the successful application of GM 1 to improve motoric and
cognitive skills in these diseases but also in patients with brain lesions due to vascular
disorders and peripheral neurotoxicity associated with chemotherapeutical agents (Battistin
et al., 1985; Zhu et al., 2013). Furthermore, age-associated alterations in GM1 distribution at
presynaptic neuritic terminals were discussed in AD patients to promote amyloid β-protein
fibrillogenesis (Yamamoto et al., 2007).
The lysosomal storage disorder GM1-gangliosidosis represents a pathological condition of
increased neuronal GM1 content, which clinically manifests in neurological symptoms. This
autosomal recessive inherited disease is described in humans, dogs, and several animal
5
species and results from a deficiency of the lysosomal GM1 degrading enzyme GLB1. The
progression of the disease depends on the residual GLB1 activity (Regier and Tifft, 2013).
However, the molecular mechanisms involved in disease pathogenesis are still incompletely
understood (Brunetti-Pierri and Scaglia, 2008). Neuronal apoptosis, endoplasmatic reticulum
(ER) stress, abnormal axoplasmic transport resulting in myelin deficiency, disturbed
neuronal–oligodendroglial interactions, and mitochondrial dysfunction have been proposed
to play a role in GM1- gangliosidosis (Kaye et al., 1992; Folkerth, 1999; Tessitore et al., 2004;
van der Voorn et al., 2004; d'Azzo et al., 2006; Brunetti-Pierri and Scaglia, 2008; Takamura et
al., 2008). Consequently, despite the accumulations of other substrates in GM 1gangliosidosis, the study of GM1 modulatory effects on neurons, glia cells, and cellular
senescence might reveal new therapeutic approaches for the different types of GM 1gangliosidosis.
To address the question how changes in GM1 metabolism result in neurotropic effects or
neuropathology, numerous in vitro and in vivo studies were performed. GM1 was
demonstrated to promote neurite outgrowth, arborization, as well as neuronal
differentiation in vitro and neuronal repair in vivo (Ferrari et al., 1983; Leon et al., 1984;
Wang et al., 1995). This effect seems to depend on structural synaptic alterations,
modulations of Ca2+ influx, potentiation of receptor-mediated neurotrophin signaling, and/
or regulation of receptor trafficking (Cuello et al., 1989; Di Patre et al., 1989;
Hadjiconstantinou et al., 1992; Fong et al., 1995; Ando et al., 1998; Wu et al., 2007; Suzuki et
al., 2011; Prendergast et al., 2014). Furthermore, GM1 might function as a receptor or coreceptor and/or might modulate receptor-ligand interactions as demonstrated for fibroblast
growth factor 2 (FGF2) signaling (Rusnati et al., 1999; Rusnati et al., 2002; Chinnapen et al.,
2012). FGF2 neurotrophic effects were partly considered as secondary and astrocytes,
oligodendrocytes as well as microglia may represent the primary mode of FGF2/GM1 action
(Perkins and Cain 1995). In Schwann cells, GM1 was described to reduce cell proliferation
and to promote a phenotype with extremely elongated processes (Sobue et al., 1988). In
addition, GM1-mediated NGF production by Schwann cells was reported (Ohi et al., 1990). In
general, the effects of external added GM1 on glia cells and glia cell differentiation were not
characterized in detail.
6
However, the impact of GM1 on the metabolism of neurons and glial cells and its role in agerelated neurodegeneration is complex. In this regard, the detailed characterization of GM1
mediated effects in different physiological and pathological conditions provides the basic for
successful therapeutic applications of GM1 and its saver and more potent semisynthetic
derivatives.
1.4
Autophagy in mammalian cells
1.4.1 Overview and subtypes of autophagy
Autophagy (from the Greek, “auto” oneself, “phagy” to eat) defines a primarily degradative
pathway that takes place in all eukaryotic cells (Feng et al., 2014). The term “autophagy” was
defined by the Nobel laureate Christian de Duve in 1963, based on his discovery of
lysosomes (De Duve et al., 1955). Autophagy implies the delivery of cytoplasmic cargo to the
lysosome and its subsequent degradation to generate macromolecular building blocks and
energy under stress conditions, to remove superfluous and damaged organelles, to adapt to
changing nutrient conditions, and to maintain cellular homeostasis (Levine and Kroemer,
2008; Feng et al., 2014). Autophagy and the endocytic compartment are structurally and
regulatory closely connected forming the lysosomal network (Nixon, 2013).
Under non-stress conditions, low levels of autophagy (basal autophagy) perform essential
housekeeping and quality control functions preserving cellular homeostasis, whereas under
stress conditions the autophagic flux is upregulated (activated autophagy; Glick et al., 2010).
Autophagy is classified according to the mode of cargo delivery to the lysosome into
macroautophagy, microautophagy, and chaperone-mediated autophagy (Nixon, 2013). Both
micro- and macroautophagy can be selective or non-selective (Shintani and Klionsky, 2004).
In macroautophagy, the double-membrane-delimited autophagosome sequesters parts of
the cytoplasm and then fuses directly with the lysosome or after preceeding fusion events
with late endosomes (Klionsky, 2005; Figure 1.4.2).
Microautophagy refers to the direct engulfment of cytoplasm by the endosome or lysosome.
In microautophagy, the lysosomal/vacuolar membrane is randomly invaginated and
differentiates to the autophagic tubes enclosing portions of the cytosol. Subsequent vesicle
7
formation at the top of the tube incorporates the cytosolic components into the endosome
or lysosome (Li, et al., 2012). The formation of multivesicular bodies (MVB) also determined
as late endosomes are suggested as one type of microautophagy in mammalian cells (Sahu
et al., 2011).
Chaperone-mediated autophagy implies the recognition of proteins with a KFERQ or a
KFERQ-like motif by the heat shock cognate protein 70 (Hsp70) and the subsequent binding
of the protein-chaperon complex to the lysosomal-associated membrane protein (LAMP)
2A mediating the transfer into the lysosomal lumen (Agarraberes et al., 1997).
Non-selective autophagy is used for the turnover of dispensable cytoplasm under starvation
conditions, whereas selective autophagy specifically targets damaged or superfluous
organelles (Feng et al., 2014).
A further subclassification of selective autophagy refers to the substrate for lysosomal
degradation and implies e.g. mitophagy (Lemasters, 2014), lipophagy (Zechner and Madeo,
2009), aggrephagy of protein aggregations (Hyttinen et al., 2014), ribophagy (Kristensen et
al., 2008; Baltanás et al., 2011), reticulophagy (Rubio et al., 2012), pexophagy of
peroxisomes (Jiang et al., 2014a), crinophagy of secretory granules (Glaumann, 1989),
lysophagy (Hung et al., 2013), heterophagy of exogenous proteins (Ohshita et al., 1986), and
xenophagy of infectious agents (Alexander and Leib, 2008; Pujol et al., 2009).
1.4.2 The molecular mechanisms of macroautophagy
The molecular understanding of autophagy in mammals is largely based on genetic studies
and the definition of autophagy-related genes in yeast (Atg), enabling the identification of
mammalian homologs (ATG; Tsukada and Ohsumi, 1993, Klionsky, 2003). The first step in
macroautophagy implies the formation of a membranous structure, termed phagophore.
Phagophore formation is initiated from different membranous cellular origins, as discussed
later. The phagophore elongates and encloses the substrate for degradation and fuses to a
double-membrane
vesicular
structure,
the
autophagosme.
The
autophagosome
subsequently fuses directly with lysosomes and forms the autophagolysosome. An
alternative way, coupling autophagy and the endocytic compartment comprises the
8
formation of autophagosome-late endosome hybrid organelles termed amphisomes that
subsequently fuse with the lysosome (Gordon and Seglen, 1988; Figure 1.4.2).
Figure 1.4.2: Overview of macroautophagy
The molecular degradation products, released from the autophagolysosome represent a regulatory component
of the autophagy controlling complex mammalian target of rapamycin complex-1 (mTORC1). Inhibition of
mTORC1 results in signaling complex translocation, autophagy induction and formation of the phagophore. The
extending membrane encloses dispensable cytoplasm, protein aggregates or organelles for degradation. The
autophagosome represents a double membrane-structure, generated by the closure of the inner and outer
bilayers of the elongating phagophore. Autophagosomes fuse predominantly with late endosomes to hybridorganelles termed amphisomes. The amphisome fuses subsequently with the lysosome, where hydrolytic
degradation occurs. The direct autophagosome-lysosome fusion is considered as a less frequently event
(Modified from Nixon, 2013).
9
1.4.3 Autophagosome formation
The majority of the proteins encoded by the ATG genes are involved in the autophagosome
formation process (Figure 1.4.3). The membrane sources for phagophore nucleation and
expansion is still a matter of discussion. Cell imaging studies suggested the endoplasmatic
reticulum (ER; Hayashi-Nishino et al., 2009), the Golgi apparatus (Yen et al., 2010), the
plasma membrane (Ravikumar et al., 2010), recycling endosomes (Puri et al., 2013),
mitochondria (Hailey et al., 2010), and ER-mitochondria contact sites (Hamasaki et al., 2013)
as potential origins of pre-autophagosomal structures.
On the molecular level, autophagosome generation is primarily regulated by different
cellular stress signals, including lowered concentrations of essential amino acids, adenosine
triphosphate (ATP), growth factors, hypoxia, occurrence of protein aggregates, and ER stress
(Kroemer et al., 2010). These signals mediate mammalian (or mechanistic) target of
rapamycin complex-1 (mTORC1) inhibition or AMP-activated protein kinase (AMPK)
activation and trigger the Unc51-like kinase (ULK) complex (Kim et al., 2011).
Phosphorylation of ULK1 mediates the translocation of a multiprotein complex containing
beclin-1 (BECN1) and class III phosphoinositide 3-kinase (PI3KC3 or Vps34) from the
cytoskeleton to the phagophore (Fimia et al., 2007; Suzuki et al., 2007; Di Bartolomeo et al.,
2010). The subsequent expansion of the phagophore is mediated by PI3KC3 activity that
phosphorylates phosphatidylinositol to generate phosphatidylinositol 3-phosphate (PIP3).
PIP3 binds to two proteins namely WD repeat domain phosphoinositide-interacting (WIPI)1
and WIPI2 (Proikas-Cezanne et al., 2004; Polson et al., 2010). Both were suggested to
regulate the formation of the ATG5-ATG12-ATG16L complex, essential for further
phagophore maturation and elongation (Fujita et al., 2008). The ATG5–ATG12–ATG16L
complex decorates pre-phagophore structures and phagophores but dissociates from
completed autophagosomes (Mizushima et al., 2003; Zavodszky et al., 2013). Microtubuleassociated protein-light chain 3 (LC3) is cleaved by the involvement of mammalian Atg4
homologs to form cytoplasmic LC3-I, which is subsequently activated by ATG7, transferred to
ATG3, and conjugated to phosphatidylethanolamine (PE) forming LC3-II (Tanida et al., 2001,
2002; Hemelaar et al., 2003; Zavodszky et al., 2013). This transfer reaction is supported by
10
the ATG5–ATG12–ATG16L complex, which may also determine the site of the production of
LC3–PE and therefore the phagophore formation site (Fujita et al., 2008).
Both, the mammalian Atg 4 homologs and ATG9 are involved in autophagosome formation
and maturation but the distinct function in the mammalian autophagy pathway is only
poorly defined. Humans and mice possess ATG4A, ATG4B, ATG4C, and ATG4D, all functioning
as cysteine proteases, which are suggested to interact with the seven different mammalian
Atg8 homologs , with broad diversity in the catalytic efficiency among different ATG4-ATG8
pairs (Mariño et al., 2003; Li et al., 2011). The function of the different ATG4 subtypes in LC3
lipidation and redistribution has still to be defined in detail.
ATG9 represents a dynamic component that is concentrated under basal conditions in the
juxtannuclear soma, associated to the trans-Golgi network and/or recycling endosomes or
late endosomes. Autophagy induction results in ATG9 redistribution to peripheral
endosomal membranes and is suggested to co-localize with phagophores (Orsi et al., 2012;
Young et al., 2006). It is discussed, that ATG9 vesicles interact dynamically with phagophores
and autophagosomes without finally becoming incorporated into them (Orsi et al., 2012;
Zavodszky et al., 2013). WIPI2 is involved in removing and recycling ATG9 from the
association to phagophores (Orsi et al., 2012).
11
Figure 1.4.3: Autophagy induction and autophagosome biogenesis.
Autophagy is initiated via mammalian target of rapamycin complex-1 (mTORC1) inhibition or AMP-activated
protein kinase (AMPK) activation. These regulatory instances catalyze the phosphorylation of Unc51-like
kinase1 (ULK1) and activation of the ULK complex. This complex activates the class III phosphoinositide 3-kinase
(PI3KC3) complex and mediates its subsequent relocation to the phagophore formation membrane. Vps34
generates phosphatidylinositol 3 phosphate (PI3P) that binds to WD repeat domain phosphoinositideinteracting proteins (WIPIs) and catalyzes the first of two ubiqutination-like reactions. The first reaction implies
the ATG7 and ATG10-mediated formation of the ATG-5-ATG12-ATG16L complex. The attachment of this
complex on the phagophore induces the microtubule-associated protein-light chain 3 (LC3) lipidation cascade.
The resulting LC3 II (LC3 bound to phosphatidylethanolamine; PE) facilitates the closure of the phagophore.
(Modified from Nixon, 2013).
1.4.4 Fusion of autophagosomes with lysosomes or endosomes
Autophagosomes fuse either directly with lysosomes or secondary after preceding fusion
with early or predominantly late endosomes (Klionsky et al., 2012). The primary generation
of autophagolysosomes occurs accentuated in the juxtanuclear region, where lysosomes are
concentrated near the microtubule-organizing centre (Lee et al., 2011). In neurons, a high
12
proportion of autophagosomes fuse with late endosomes during the transport along axons
or dendrites towards the soma (Lee et al., 2011; Nixon, 2013).
The detailed mechanisms controlling the fusion of completed autophagosomes with
endosomes and lysosomes are not completely understood (Shen and Mizushima, 2014).
Most studies in mammalian cells focused on the fusion of late endosomes with lysosomes,
whereas autophagosome- or amphisome-lysosome fusion is less characterized. The
endosomal sorting complex required for transport (ESCRT) is suggested to be essential for
delivery of the fusion machinery to lysosomes or autophagosomes (Metcalf and Isaacs,
2010). Tethering of lysosomes to autophagosomes is mediated by the Ras-related proteins
in brain GTPase (Rab) 7 and the homotypic vacuole fusion and vacuole protein sorting
(HOPS) complex (Pawelec et al., 2010; Jiang et al., 2014b). Rab7 and LC3 form a complex
with the FYVE and coiled-coil domain containing protein 1 (FYCO1), and promote the
trafficking of autophagosomes towards the lysosome (Pankiv et al., 2010; Weidberg et al.,
2011; Deegan et al., 2013). Furthermore, HOPS complex interactions with soluble Nethylmaleimide-sensitive-factor attachment receptor (SNARE) proteins e.g. Syntaxin 17
participate in autophagosome-lysosome fusion (Itakura and Mizushima, 2013; Jiang et al.,
2014b). Lysosomal membrane components as vacuolar-type H+-ATPase (V-ATPase) complex
and the lysosomal-associated membrane protein (LAMP) 1 as well as Rubicon were also
characterized as positive or negative regulators of autophagosome- and also endosomelysosome fusion and could interact with the ESCRT pathway (Yamamoto et al., 1998;
Matsunaga et al., 2009; Metcalf and Isaacs, 2010). Other proteins suggested to mediate
autophagosome fusion with endosomes or lysosomes include LAMP2 (Saftig et al., 2008),
Rab11 (Fader et al., 2008), histone deacetylase 6 (HDAC6; Lee et al., 2010), the ubiquitinbinding proteins ubiquilin (N'Diaye et al., 2009), and p97/valosin-containing protein (VCP; Ju
et al., 2009; Metcalf and Isaacs, 2010). Additionally, deletion of the dynein-dynactin complex
results in autophagosome accumulation, defining the intact microtubule-based transport as
a crucial event in autophagosome-lysosome fusion (Kimura et al., 2008). The fusion event is
also influenced by the lipid content of autophagosomes (Koga et al., 2010) and the lysosomal
pH, independently of V-ATPase activity (Kawai et al., 2007).
13
Many of these proteins including Rab7, ESCRT complex, and SNARE proteins not only
mediate autophagosome fusion with lysosomes, but are also involved in endosomelysosome fusion, for which several models were currently discussed (Luzio et al., 2007). The
principles may be equally considered for autophagosome/amphisome-lysosome fusion. The
maturation model suggests the gradual formation of lysosomes from late endosomes by
adding lysosomal molecules while removing endosomal components (Roederer et al., 1987;
Murphy, 1991). The vesicular hypothesis implies vesicles budding from the late endosome
delivering the content to the lysosome (Thilo et al., 1995). The “kiss and run” model suggests
a transient fusion of late endosome and lysosome and an exchange of contents (kiss)
followed by a separation of the two organelles (run; Storrie and Desjardins, 1996; Duclos et
al., 2003). The forth model hypothesizes, that endosomes and lysosomes fuse to a hybrid
organelle containing lysosome and late endosome components and subsequent lysosome
recycling by the selective removal of late endosome constituents (Luzio et al., 2000).
However, the relevance of these models for autophagosome/amphisome-lysosome fusion
has to be clarified in experimental studies.
1.4.5 Reformation of lysosomes from autophagolysosomes
The restoration of lysosomes from hybrid organelles is essential to maintain the proper
function of the endosomal, autophagosomal, and lysosomal network and maintainance of
cellular homeeostasis. This process implies on the one hand recycling of lysosomal
components from autophagolysosomes as well as de novo protein synthesis of lysosomal
membrane proteins and lysosomal hydrolases.
Autophagic lysosome reformation (ALR) is suggested to be regulated by mTORC1 through
Rab7 and requires an intact microtubule network. ALR starts with the budding of LAMP1
positive tubules from autophagosomes and subsequent segregation of vesicles as protolysosomal structures (Yu et al., 2010). Clathrin participates in ALR and is directed to
autophagolysosomes via phosphatidylinositol-4,5-bisphosphate (Rong et al., 2012).
Prolonged starvation decreases autophagy and promotes ALR. This is mediated by mTORC1
reactivation due to lysosomal amino acid release as a result of autophagic degradation (Yu et
14
al., 2010). This process deserves as a self-regulatory feedback mechanism ensuring the
recycling of lysosome membranes and the restoration of lysosome number (Yu et al., 2010).
Newly synthesized acid hydrolases are tagged with mannose-6-phosphate in the cis-Golgi
compartment and subsequently bind to mannose-6-phosphate receptors (MPRs) in the
trans-Golgi network (Rouillé et al., 2000). Clathrin, adaptor protein (AP) complex
components, and Golgi-localized γ-ear-containing ADP ribosylation factor-binding proteins
(GGAs) mediate the vesicular transfer to endosomes. The MPRs dissociate and recycle to the
trans-Golgi compartment whereas the hydrolases were transferred to the lysosome
(Dell'Angelica et al., 2000; Hirst et al., 2001). The transfer of de novo synthesized lysosomal
membrane proteins occurs directly via late endosomes or indirectly via the plasma
membrane. AP3 is considered as a regulatory component in both pathways (Ihrke et al.,
2004).
1.4.6 Transcriptional regulation of lysosomal network proteins
The transcription of lysosomal and autophagy-associated genes is regulated by a signaling
axis between mTORC1, the transcription factor EB (TFEB), the transcription factor zinc finger
with KRAB and SCAN domains 3 (ZKSCAN3), as well as the lysosome and lysosomeassociated complexes.
Autophagy inducing conditions such as nutrient starvation, metabolic and lysosomal stress
mediate an inhibition of the negative regulator of autophagy mTORC1. This results in the
dephosphorylation of TFEB and its translocation from the cytoplasm to the nucleus (PeñaLlopis and Brugarolas, 2011). Subsequent binding of TFEB to a coordinated lysosomal
expression and regulation (CLEAR) consensus sequence activates de novo gene transcription
of lysosomal network proteins (Sardiello et al., 2009; Settembre and Ballabio, 2011; Martina
et al., 2012; Settembre et al., 2013). ZKSCAN3 functions as a suppressive factor of
autophagy-associated gene transcription that is cytoplasmatically sequestered during
starvation conditions (Chauhan et al., 2013). Similarly, the autophagy is negatively regulated
via lysosomal amino acids that activate mTORC1 via V-ATPase and Ragulator and subsequent
inhibition of TFEB (Sancak et al., 2010; Zoncu et al., 2011).
15
1.4.7 Selective autophagy
In response to starvation, autophagy comprises non-selective and mainly selective
degradative processes. In conditions of amino acid deprivation, cytosolic proteins are
primary autophagy targets, whereas proteins linked to various complexes and organelles are
degraded later (Kristensen et al., 2008). Receptors for selective autophagy are characterized
by the presence of one or multiple LC3-interacting regions (LIR), which interact with the
autophagosome membrane-bound LC3 family members (Birgisdottir et al., 2013). Cargo
binding occurs via one or multiple cargo binding domains except for adaptors that are
transmembrane proteins and consequently directly linked to their cargo (Kirkin et al., 2009).
The selectivity of adaptor proteins for their respective cargo is mediated by distinct types of
cargo ubiquitination patterns. The adaptor molecule undergoes degradation together with
the ubiquitinated cargo (Schreiber and Peter, 2014).
Several proteins including Sequestosome 1 (SQSTM1 or p62), Rho Guanine Nucleotide
Exchange Factor 16 (ARHGEF16 or Nbr), BCL2/Adenovirus E1B 19kDa Interacting Protein 3Like (BNIP3L or Nix), Nuclear Dot Protein 52 (NDP52), and optineurin (OPTN), but also
ATG4B and ULK1 were identified as LIR containing selective autophagy receptors (Schreiber
and Peter, 2014). p62 and/or ARHGEF16 are involved in the selective degradation of various
substrates as aggregated protein complexes, mitophagy and xenophagy (Bjørkøy et al., 2005;
Zheng et al., 2009). Nix and the Parkinson disease-associated proteins PTEN induced
putative kinase 1 (PINK1) and the Parkin RBR E3 Ubiquitin Protein Ligase (Parkin) mediate
mitophagy (Ding et al., 2010). NDP52 and OPTN have been described as important mediators
for the targeting of invasive pathogens to the autophagosome (Thurston et al., 2009; Wild et
al., 2011).
However, for several forms of selective autophagy, the adaptor molecules or the possible
involvement of known adaptors are not defined yet.
1.4.8 Autophagy modulating factors and signaling mechanisms
Autophagy is a highly sensitive process induced by almost every stressful condition affecting
cellular homeostasis (Kroemer et al., 2010). Changes in molecular concentrations of amino
16
acids, ATP, and oxygen levels are related to the cellular balance of anabolic and catabolic
processes reflecting the cells or the bodies nutrient state (Russell et al., 2014). The lysosome
is considered as the key side of amino acid sensing (Zoncu et al., 2011). Coupling of
autophagy to ATP and oxygen levels is related to complex mechanisms involving the
mitochondrial production of reactive oxygen species (ROS), mitochondrial and ER Ca 2+
homeostasis, and the unfolding protein response (Høyer-Hansen et al., 2007; Moore et al.,
2011; Chang et al., 2012; Filomeni et al., 2014).
These factors modulate the activity of mTORC1, AMPK and sirtulin1 (Sirt1), a nutrientsensing deacetylase (Lee et al., 2008; Russell et al., 2014). Furthermore, starvation induces
lipophagy, an alternative, catabolic pathway to hydrolytic enzyme and lipase-mediated
degradation of lipid droplet-associated triglycerides and cholesterol (Liu and Czaja, 2013).
Lipophagy represents a compensatory mechanism to adapt to nutrient deprivation by
generating energy from increased oxidation of free fatty acids, but is also important to
handle conditions of lipid excess, that might otherwise result in cytotoxic effects (Singh and
Cuervo, 2012). Sphingolipids, as components of the plasma membrane and internal
membrane systems including autophagosomes and lysosomes and their metabolism display
another autophagy modulating factor (Hamer et al., 2012; Li et al., 2014). Ceramide, the
central molecule in sphingolipid metabolism, regulates autophagy in a cytoprotective
manner but also induces autophagy-mediated cell death (Daido et al., 2004; Spassieva et al.,
2009). However, underlying mechanisms and the influences of dysregulations in sphingolipid
metabolism on autophagosomal, endosomal, and lysosomal membrane properties, fusion
events, and cytoskeletal transport were not studied in detail.
These considerations underline the relevance of autophagy as a sentinel and executive
pathway to maintain cellular homeostasis and the coupling to mitochondrial and ER
metabolism.
1.4.9 Autophagy, ER stress, unfolded protein response and ER-associated degradation
Protein folding occurs in the rough ER and is mediated by chaperones (Gotoh et al., 2011).
Glucose deprivation, ER Ca2+ release, and hypoxia result in the accumulation of misfolded
17
proteins in the ER and induce the unfolded protein response (UPR), but also inhibit mTORC1
and induce autophagy (Wouters and Koritzinsky, 2008; Mekahli et al., 2011; de la Cadena et
al., 2014). The UPR serves as a mechanism to sustain cell viability by attenuating protein
synthesis and restoring cellular homeostasis. UPR coupled processes activate transcription
factors, which regulate the expression of genes encoding chaperones, components of the
ER-associated degradation (ERAD) system, and proteins associated with autophagy (Ding et
al., 2007; Ron et al., 2011). ERAD implies the cytosolic degradation of misfolded ER proteins
by the ubiquitin proteasome system (UPS) (Vembar and Brodsky, 2008). The UPS serves in
parallel to autophagy as a mechanism to remove incorrectly folded ER proteins (Vembar and
Brodsky, 2008). These considerations underline the coupling of ER stress, UPR, ERAD, the
UPS and autophagy.
1.4.10 Autophagy and the ubiquitin proteasome system
Autophagy and the UPS degrade ubiquitinated cargo and therefore regulate cellular toxicity
due to misfolded or aggregated proteins, especially implicated in the pathogenesis of
neurodegenerative diseases. Proteasomal protein degradation serves on the one hand as a
basic mechanism providing amino acids, but also controls cell homeostasis by targeted
degradation of regulatory proteins or processing of protein precursors (Palombella et al.,
1994). The UPS and autophagy are suggested to fulfill roughly different tasks in protein
catabolism with proteasomal degradation of short lived proteins and autophagy-mediated
degradation of long lived, endocytosed, or aggregated proteins (Fuertes et al., 2003; Metcalf
and Isaacs, 2010). Despite these distinct functions, autophagy and the UPS represent a
communicating network, with one pathway dependent on the other, but not able to
compensate completely the impairment of one system.
Several studies revealed that proteasome inhibition results in upregulation of
macroautophagy (Korolchuk et al., 2009). This triggering of autophagy may be related to the
accumulation of proteins and to the decay in cellular amino acid concentrations. However,
autophagy is not sufficient to compensate the lack of amino acids normally provided by
proteasomal degradation, whereas the accumulation of proteins is tolerated by the cell
18
(Suraweera et al., 2012). Additionally, the proteasomal impairment might result in the
accumulation of autophagy triggering regulatory proteins such as p53 (Tavernarakis et al.,
2008; Zhang et al., 2009).
Furthermore, inhibition of autophagy results in reduced proteasomal degradation of
proteins. It has been suggested that the delay in proteasomal protein degradation depends
on the cargo adaptor p62. This selective autophagy adaptor protein is stabilized upon
inhibition of autophagy and sequestrates other autophagy adaptors as well as ubiquitinated
substrates. This results in a delayed delivery of polyubiquitinated substrates to the
proteasome. Additionally, accumulation of p62 might compete with the deubiquitinating
components of the regulatory subunit of the proteasome complex and result in decreased
feeding of substrates into the proteasome catalytic core (Korolchuk et al., 2009).
The UPS and autophagy are also directly linked on the molecular level by proteins as
ubiquilin, functioning in autophagosome fusion and as a shuttle factor that regulates the
translocation of proteolytic substrates to the proteasome (Ko et al., 2004; N'Diaye et al.,
2009). Other aspects of autophagy and UPS interactions include the degradation of the
catalytic core of the proteasome in conditions of nutrient deprivation through
macroautophagy (Cuervo et al., 1995). Furthermore, UPS and autophagy-associated genes
were co-regulated at the transcriptional level (Zhao et al., 2007; Schreiber and Peter, 2014).
1.4.11 The lysosomal network: coupling of endocytosis and autophagy
The convergence of autophagy and the endosomal pathway involves multiple steps including
the formation of amphisomes, the endosomal transmission of extracellular signals to the
autophagy triggering machinery, the generation of phagophores, and the transfer of
lysosomal components from the ER-Golgi network to lysosomes. Furthermore, multiple
regulatory molecules modulate different steps of both, autophagy and endocytosis.
Endocytotic cargoes as ligand receptor complexes were internalized from the plasma
membrane, undergo fusion events with further endocytic vesicles and form tubulovesicular
compartments termed early endosomes. In these structures receptors such as the low
density lipoprotein receptor dissociate from their ligands, whereas other receptors including
19
the epidermal growth factor (EGF) receptor remain associated with their binding partners
(Luzio et al., 2007). The dissociated receptors can be returned to the plasma membrane via
recycling endosomes, representing structures that separate from the primary endocytosed
vesicles. Cargos for further degradation such as ligands or receptor ligand complexes remain
in the vesicular elements of the early endosome (Luzio et al., 2007). After further fusion
events, early endosomes mature to late endosomes, also termed multivesicular bodies. Late
endosomes fuse directly with lysosomes or more frequently with autophagosomes to form
amphisomes. These amphisomes further fuse with lysosomes to generate the
autophagolysosomes (Nixon, 2013).
Internalized receptors including the EGF and insulin receptors activate signaling pathways
such as the PI3K/Akt pathway, which are involved in the regulation of autophagy (Han et al.,
2011, Chan et al., 2012). Consequently, the endocytic pathway serves as a mechanism
transferring extracellular growth or nutrition state signals to the autophagy machinery.
It is suggested, that phagophores originate from different membrane sources including the
plasma membrane, the ER, but also endosomes (Axe et al., 2008; Ravikumar et al., 2010;
Longatti and Tooze, 2012). Several molecules mediating phagophore formation perform also
functions in the endocytic system. For example SNARE proteins were suggested to be
involved in endocytosis, fusion events of early endosomes and the generation of
phagophores from the plasma membrane (Moreau et al., 2011; Wu et al., 2014).
Additionally, SNAREs mediate autophagosome-lysosome and endosome-lysosome fusion
characterizing them as molecules involved in multiple steps of endocytosis and autophagy
(Luzio et al., 2007; Itakura and Mizushima, 2013). Further molecules regulating both
endocytosis and autophagy include coat proteins such as coatomer complex I (COPI), Rab
GTPases (Rab 5, Rab7, and Rab11) and their specific inhibitors Rab GTPase-activating
proteins (RabGAPs), as well as BECN1 complex regulating molecules such as RUN domain
cysteine rich domain containing, beclin-1 interacting protein (Rubicon; Ravikumar et al.,
2008; Razi et al., 2009; Tabata et al., 2010; Zeigerer et al., 2012; Lamb et al., 2013).
The lysosome represents the final degradative compartment of autophagy and the endocytic
pathway. The maintenance of lysosomal degradation depends on endosomal delivery of
20
lysosomal hydrolyases, the acidifying machinery (V-ATPase), as well as the transporters and
permeases to the lysosome (Singh and Cuervo, 2011; Lamb et al., 2013).
This active communication between the endocytic and autophagic degradative
compartments and the numerous regulatory mechanisms shared between these pathways
emphasizes the use of the term ‘lysosomal network’ and underlines that impairments of
autophagy and the endocytic system should be regarded as a unity in the pathogenesis of
autophagy-associated disease conditions.
1.4.12 Impairments of the lysosomal network in inherited neurodegenerative diseases
Impairments of the lysosomal network were implicated in the pathogenesis of numerous
neurodegenerative diseases such as AD, PD, Huntington’s disease (HD), ALS, LSD, various
types of neuroaxonal dystrophies, and neuroaxonal dystrophy (NAD) -related conditions.
Neuronal loss, accumulation of autophagic vesicles and/or the occurrence of misfolded
proteins or peptide aggregations represent pathological features found in all of the above
mentioned diseases, but also in physiological ageing (Bethlem and Den Hartog Jager, 1960;
Mukaetova-Ladinska et al., 2000; Yu et al., 2005; Settembre et al., 2008; Yao et al., 2009;
Song et al., 2012; Fink, 2013; Nixon, 2013; Levi and Finazzi, 2014; Martin et al., 2014).
Lysosomal storage disorders are predominantly caused by primary lysosomal dysfunction. In
other neurodegenerative conditions, the role of autophagy as a primary or secondary
mechanism and the relevance of specific steps remain to be defined. Furthermore, especially
AD and PD represent “classical” old age-associated neurodegenerative conditions, whose
progression might be promoted by the decline in neuronal autophagy and mitochondrial
impairments (Navarro and Boveris, 2004; He et al., 2013).
Disorders of the autophagy machinery frequently involve the CNS. Neurons as extremely
specialized, postmitotic cells with a high-energy demand seem especially vulnerable to
disturbances of the autophagy machinery (Lee et al., 2011). In neurodegenerative
conditions, accumulations of autophagic vesicles were found accentuated at synapses, but
also axons. The axonal involvement might be related to the long distance that autophagic
vacuoles must travel to reach lysosomes, which are concentrated mainly in the neuronal
21
soma (Lee et al., 2011; Nixon, 2013). Synapses represent regions of high-energy demand and
protein turnover and contain abundant mitochondria and polyribosomes, which makes them
more susceptible to the consequences of dysfunctional autophagy (Son et al., 2012).
Likewise, synaptic pathology is accompanied by abnormal accumulation of autophagosomes
in the hippocampus of young AD model mice (Sanchez-Varo et al., 2012). In G2019S- leucinerich repeat kinase 2 (LRRK2) transgenic mice, an animal model for PD, autophagosomes
appear in synaptic terminals in the cerebral cortex of old mice (Ramonet et al., 2011; Yang et
al., 2013). In addition, synaptic alterations, accumulations of autophagic vesicles in neurites
and synapses, and mitochondrial dysfunctions are detected before the occurrence of
neuritic plaques or Lewy bodies in AD and PD, respectively (Yu et al., 2005; Yao et al., 2009;
Hattingen et al., 2009). These accumulations might result from the disruption of the neurite
transport machinery, impairment of autophagic fusion, and also an excessive autophagy
induction. The latter is controversially discussed in HD but also ALS pathogenesis (Nixon et
al., 2005; Ma et al., 2010; Yang et al., 2013; Martin et al., 2014).
Autophagy-related
factors
considered
to
modulate
AD
pathogenesis
include
autophagosomal impairment due to accumulation of amyloid-precursor-protein or tau
aggregates, reduced expression of BECN1, destabilization of lysosomal membranes,
disturbances of lysosomal acidification, abnormal up-regulation of Rab5, and excessive
endocytosis as well as mitochondrial alterations and ROS generation (Cataldo et al., 2000; Ji
et al., 2006; Cataldo et al., 2008; Pickford et al., 2008; Lee et al., 2011; Pinho et al., 2014).
The recessive inherited PD types caused by mutations in Parkin (PARK2) or PINK1 (PARK6)
are clearly associated with disturbances of mitophagy (Kitada et al., 1998; Valente et al.,
2004; Gasser, 2005; Kawajiri et al., 2010). The dominant synuclein (SNCA) and LRRK2
mutation-associated forms of PD seem to be induced by disturbances of macroautophagy
and chaperon-mediated autophagy, but the precise mechanism is not defined yet (Yu et al.,
2009; Winslow et al., 2010; Manzoni et al., 2013; Tanik et al., 2013). Further Parkinsonrelated genes such as glucocerebrosidase (GBA) and lysosomal type 5 P-type ATPase
(ATP13A2) are also associated with lysosomal impairments (Ramirez et al., 2006; Mazzulli et
al., 2011; Pan and Yue, 2014).
22
HD, caused by a repetitive DNA sequence in the huntingtin gene, seems to result from
complex disturbances of autophagy (Duyao et al., 1993; Kegel et al., 2000; Martin et al.,
2014). Wild-type huntingtin is suggested to function as an autophagy adaptor, to mediate
trafficking of autophagosomes along microtubules, and to modulate mitophagy (Ravikumar
et al., 2005; Kalvari et al., 2014; Rotblat et al., 2014). Consequently, mutant huntingtinassociated disturbances of autophagy involve the formation of toxic protein aggregates
sequestering mTOR, ongoing with autophagy upregulation and excessive formation of
autophagosomes as well as disruption of autophagosome motility and subsequent
impairment of autophagosome-lysosome fusion (Ravikumar et al., 2004; Martinez-Vicente et
al., 2010; Roscic et al., 2011; Wong and Holzbaur, 2014).
In familial and sporadic ALS, numerous underlying genetic mutations were identified many
of them associated with primary or secondary functions in the autophagy pathway (Guo et
al., 2010; Iguchi et al., 2013). Impairments of autophagy including increased numbers of
autophagosomes occur early in the disease together with numerous accumulations of
aberrant proteins in affected neurons (Guo et al., 2010; Zhang et al., 2011). In addition, ALSassociated mutations in the dynein and dynactin gene indicate that disturbances of lysosome
or autophagosome transport play a major role in ALS pathogenesis (Moughamian and
Holzbaur, 2012 a, b).
LSD are among the first diseases linking lysosomal dysfunctions and neurodegeneration
(Klein and Futerman, 2013). LSD are caused by defects in lysosomal enzymes (e.g. acid βgalactosidase in GM1–gangliosidosis, β-glucocerebrosidase in Gaucher disease), lysosomal
enzyme trafficking (e.g. N-acetyl glucosamine phosphoryl transferase α/β in mucolipidosis
type II), soluble non-enzymatic lysosomal proteins (e.g. cholesterol binding NPC in NiemannPick disease type C2), and lysosomal membrane proteins (e.g. LAMP2 in Danon disease;
Suzuki and Chen, 1968; Tsuji et al., 1987; Canfield et al., 1998; Nishino et al., 2000; Park et
al., 2003; Platt et al., 2012). Furthermore, secondary effects such as impairments of
lysosome reformation, failure of endo- and autolysosomal clearance, accumulation of
protein aggregates, and deficient mitophagy can increase cargo storage in autophagic
vesicles (Tessitore et al., 2009; Goldman und Krise, 2010).
23
In NAD and NAD-related conditions such as human hereditary spastic paraparesis (HSP)
mutations in genes encoding autophagy-associated proteins including WD repeat domaincontaining protein 45 (WDR45), spatacsin (SPG11), zinc finger FYVE domain-containing
protein 26 (Spastizin or SPG15), tectonin beta-propeller repeat-containing protein 2
(TECPR2 or SPG49), and WD repeat-containing protein 48 (WDR48 or SPG60) were
characterized (Haack et al., 2012; Oz-Levi et al., 2012; Khundadze et al., 2013; Chang et al.,
2014; Novarino et al., 2014; Vantaggiato et al., 2014). Spatacsin and Spastizin mutations are
associated with impairment of autophagosome maturation, accumulation of immature
autophagosomes, and autophagic lysosome reformation (ALR; Chang et al., 2014;
Vantaggiato et al., 2014). WDR45 is suggested to regulate autophagosome formation,
whereas the deubiquitinating enzyme WDR48 is associated with the endosomal/lysosomal
compartment and interacts with mTOR regulating proteins (Park et al., 2002; Lu et al., 2011;
Gangula and Maddika, 2013; Saitsu et al., 2013). TECPR2 is suggested to interact with the
mammalian Atg8 homologs and to function as a positive regulator of autophagosome
accumulation (Behrends et al., 2010; Oz-Levi et al., 2012).
All these findings underline the relevance of autophagy in ageing and neurodegeneration
and suggest this pathway as a potential therapeutic target. In addition, they might partially
explain the influence of nutrition and other environmental factors on the progress of
degenerative CNS diseases. However, the association of autophagy and senescence as well
as the dependence of neuronal subpopulations on autophagic pathways is far from
understood provoking future studies.
1.5
Human hereditary spastic paraparesis and neuroaxonal dystrophies in humans and
dogs
Human hereditary spastic paraparesis (HSP) and neuroaxonal dystrophies represent a group
of heterogeneous neurodegenerative conditions with clinical and pathological overlapping
features (Vaher et al., 2001, Fink, 2013; Schneider et al., 2013). Furthermore, neuroaxonal
dystrophy (NAD) and HSP-associated mutations affect similar pathways.
24
Hereditary spastic paraparesis (HSP) comprises a clinico-genetic syndrome in humans (a) in
which bilateral lower extremity weakness and spasticity (each of variable degree) are the
predominant (but often not only) manifestations; and (b) for which a gene mutation is the
major causative factor (Fink, 2013). Further clinical sub-classification differentiates
‘‘uncomplicated HSP’’ characterized by lower extremity spasticity and weakness and subtle
lower extremity dorsal column impairment and ‘‘complicated HSP’’, associated with
additional neurologic or systemic abnormalities including dementia, ataxia, mental
retardation, neuropathy, distal wasting, loss of vision, epilepsy, or ichthyosis (Harding, 1983;
Fink, 2013). To date 72 HSP-associated mutations were identified that were inherited in an
autosomal dominant, recessive, or X-linked manner (Fink, 2013; Novarino et al., 2014;
Esteves et al., 2014). The most frequent HSP-associated mutation is found in the spastinencoding gene responsible for around 40 % of familial and about 20 % of sporadic cases (Lo
Giudice et al., 2014).
The age of symptom onset as well as the clinic may be quite variable even within a genetic
type of HSP (Fink, 2013). The HSP-associated proteins participate in multiple cellular
pathways implicated in ER morphology, endosome membrane trafficking, vesicle formation,
selective vesicular protein uptake, microtubule processing, axonal transport, protein
misfolding, mitochondrial function, and phospholipid and fatty acid metabolism (Fink, 2013).
Although distal neuropathy accentuated in descending corticospinal tract axons and less
frequently ascending fibers (funiculus gracilis and spinocerebellar tracts) is often reported in
postmortem examination of HSP cases, it defines primarily a clinico-genetic syndrome rather
than a neuropathologic feature (Harding, 1983; Blackstone, 2012; Fink, 2013; Lo Giudice et
al., 2014). Furthermore, histopathological lesions are dependent on the mutation and
disease progress and vary in regard to the involvement of CNS nuclei and peripheral nerves
(Fink, 2013). Treatment is symptomatic and does not prevent gait impairment (Fink, 2013; Lo
Giudice et al., 2014).
The term ‘neuroaxonal dystrophy’ refers to a pathological definition and summarizes a group
of clinically and genetically heterogeneous neurodegenerative conditions in humans and
animals where NAD is the main pathological feature (Lowe and Leigh, 2002; Sisó et al., 2006;
Nardocci and Zorzi, 2013).
25
Pathologically, NAD describes the occurrence of axon swellings, the larger are termed
spheroids. It is suggested that degeneration starts in the distal axon and progresses
proximally eventually resulting in the death of the neuronal cell body. Nevertheless, the
pathogenesis of the development of axonal swellings is still obscure. A further subclassification distinguishes primary, senile and secondary, reactive NAD (Lowe and Leigh;
2002).
The nomenclature of primary human neuroaxonal dystrophies is complex because the
subtypes of NAD are classified according to i) historical terminations, ii) underlying genetic
mutations, iii) the presence or absence of iron accumulations, or iv) the age of onset and
clinical symptoms. Primary NAD in humans includes infantile NAD (formerly Seitelberger
disease),
late
infantile,
juvenile
and
adult
NAD,
neuroaxonal
leukodystrophy,
neurodegeneration with brain iron accumulation type 1 (NBIA 1) (formerly Hallervorden
Spatz Syndrome), Nasu-Hakola disease, and giant axonal neuropathy (Lowe and Leigh; 2002).
Further clinical, genetical, and histopathogical characterization of cases with NBIA revealed
further diseases with a ‘Hallervorden Spatz’ like phenotype and prominent spheroid
formation including mitochondrial membrane protein-associated neurodegeneration
(MPAN; NBIA 4) and beta-propeller associated-neurodegeneration (BPAN, NBIA 5), which
might also be considered as NAD (Kruer, 2013).
In most types of NAD, spheroids are accentuated in the nuclear areas of the gray matter in
the brain and spinal cord, whereas in neuroaxonal leukodystrophies and Nasu Hakola
disease spheroids are mainly present in the white matter (van der Knaap et al., 2000).
Electron microscopic studies have shown that dystrophic axons contain tubulovesicular
structures as well as accumulations of smooth membranes, membranous aggregates
reminiscent of myelinic and residual bodies, and few neurofilaments (De Leon and Mitchell,
1985; Sisó et al., 2006).
Among dogs, familial NAD is described in young Rottweilers, Chihuahua dogs, Collie
sheepdogs, Papillon dogs, and Jack Russell terriers (Bennett and Clarke, 1997; Christman et
al., 1984; Cork et al., 1983, Braund, 2003; Sisó et al., 2006). According to clinical and
histological criteria, the familial NAD in Jack Russell Terriers corresponds to the human
infantile type of NAD, whereas the disease manifestation in young Rottweilers models the
26
late infantile form of the human disease (Bennett and Clarke, 1997; Chrisman et al., 1984;
Cork et al., 1983). In Rottweilers, clinical signs start at the age of one year with hypermetria
of the thoracic limbs and progress to a full cerebellar syndrome over one to two years (Sisó
et al., 2006). Sensory systems are predominantly affected with dystrophic axons in areas
such as the nucleus thoracicus, dorsal horns of the spinal cord and dorsal column nuclei (Sisó
et al., 2006). In canine NAD, iron accumulation was not detected so far. In addition, only one
mutation in mitofusin 2 (MFN2) involved in mitochondrial fusion and clearance of damaged
mitochondria via selective autophagy is described as associated with fetal onset of canine
NAD (Fyfe et al., 2011).
Canine dorsal root ganglia
2
27
Canine dorsal root ganglia cell cultures as an in vitro model to
characterize pathomechanisms of inherited neurodegenerative disorders
in dogs
2.1
Culturing adult canine sensory neurons to optimise neural repair
(published manuscript)
Gerhauser I, Hahn K, Baumgärtner W, Wewetzer K. 2012.Vet Rec 170:102.
Author contributions:
Conceived and designed the experiments: KW, IG. Performed experiments: IG, KH; Analyzed
data: IG, KW, KH. Wrote the paper: IG, KW.
28
2.2
GM1 ganglioside promotes synaptophysin accumulations and cytoskeletal changes
in neurons and non-neuronal cells from adult dorsal root ganglia cultures
(submitted manuscript)
K. Hahn1,2,4, A. Lehmbecker1,4, Y. Wang1,2,4, A. Habierski1, K. Kegler1,2, V. Pfankuche1, W.
Tongtako1,2, K. Schughart3, W. Baumgärtner1,2,5,6, I. Gerhauser1,5
1
Department of Pathology, University of Veterinary Medicine Hannover, Bünteweg 17, D-
30559 Hannover, Germany
2
Center of Systems Neuroscience Hannover, Germany
3
Department Infection Genetics, Helmholtz Centre for Infection Research, Inhoffenstraße 7,
D-38124 Braunschweig, Germany; University of Veterinary Medicine Hannover, Germany;
University of Tennessee Health Science Center, Memphis, USA
4
Authors contributed equally to the manuscript and are considered as first authors
5
Authors contributed equally to the manuscript and are considered as last authors
6
Corresponding author:
Prof. Dr. Wolfgang Baumgärtner, Dipl. ECVP
Department of Pathology; University of Veterinary Medicine Hannover
Bünteweg 17, D-30559 Hannover, Germany
Tel.: +49 (0) 511 953 8620; Fax: +49 (0) 511 953 8675
E-mail: [email protected]
29
Words: Abstract: 170; Introduction: 634; Material and Methods: 639; Results: 1268;
Discussion: 1489; Acknowledgments: 68; References: 1809, Figure legends: 592; Tables: 188;
Total: 6857; Figures: 6; Tables: 1
Key words: basic fibroblast growth factor 2; dog; glial fibrillary acidic protein; glutamine
synthetase; nerve growth factor; retrograde axonal transport
Abstract
Age-dependent reduction in brain GM1-ganglioside (GM1) content is accompanied by
synaptic loss characteristic for neurodegenerative diseases. The present study investigated
the influence of GM1, nerve growth factor (NGF) and/or basic fibroblast growth factor (FGF2)
on adult canine dorsal root ganglia (DRG) cultures. Neurons grown with GM1 and NGF
showed increased neurite outgrowth associated with accumulations of synaptophysin,
dynein, and mitochondria in neurites and cytoplasmic multivesicular bodies. This indicates
GM1 modulated synapse formation, retrograde signaling, and activation of autophagic
pathways. GM1 also reduced the FGF2-mediated increase in Tau1 expressing neurons, an
effect possibly implicated in degenerative conditions including Alzheimer’s disease.
Furthermore, GM1 is suggested to inhibit, while FGF2 favored astrocytic differentiation of
vimentin-positive cells. This might be pivotal to modulate astrogliosis and glial scar
formation. Moreover, GM1 induced glutamine synthetase expression in non-neuronal cells,
which might affect extracellular glutamate levels. Summarized, adult canine DRG cultures
represent a valuable in vitro model to study GM1 mediated anti-degenerative effects and to
reveal pathogenetic mechanisms of neurodegenerative diseases necessary to develop new
treatment strategies.
30
Introduction
Gangliosides represent sialic acid-containing glycosphingolipids found in plasma and nuclear
membranes. The highest ganglioside concentrations are present in neurons constituting 10
% of the total lipid content (Ledeen, 1978). In the fetal brain GM 1-ganglioside (GM1)
accumulates during synaptogenesis and early stages of myelination (Skaper et al., 1989).
Ageing is accompanied by synaptic loss.The latter is pronounced in various pathologic
conditions including Parkinson’s disease (PD) and Alzheimer’s disease (AD; Scheff et al.,
2014). Moreover, humans show a decrease in brain GM1 content during ageing associated
with an increased number of neuritic plaques in AD (Kracun et al., 1992). GM 1 was
successfully applied to treat several disorders of the central (CNS) and peripheral nervous
system (PNS) including AD, PD, and peripheral neuropathy to improve motoric and cognitive
skills (Schneider et al., 2010; Svennerholm et al., 2002; Zhu et al., 2013). Additionally, the
development of semisynthetic and more potent GM1 compounds (Bachis et al., 2002)
indicates that GM1 represents a promising substance for future clinical applications.
In contrast to the age-associated decrease in GM1 content in the human brain, GM1 levels in
the rodent brain increase with ageing (Aydin et al., 2000). Furthermore, in contrast to
humans (Hahn et al., 1997) and dogs (Suzuki et al., 1988) mice possess an alternative GM 1
asialo degradation pathway. The difference in GM1 metabolism indicates that other species
besides mice should be used, in addition, to study ganglioside related pathomechanisms.
Recent investigations that characterized the canine GM1 metabolism revealed that dogs can
be considered as an appropriate model for the different forms of the human lysosomal
storage disorder GM1-gangliosidosis caused by beta galactosidase deficiency (Kreutzer et al.,
2008), thus indicating a similar GM1 metabolism in dogs and humans.
GM1 influences synaptic transmission via regulation of neurotransmitter release and
modulation of Ca2+ influx (Ando et al., 1998). In addition, GM1 is a main component of lipid
rafts, which represent cholesterol-rich signaling platforms that accumulate high affinity
tyrosine kinase (Trk) and low affinity neurotrophin receptors (p75 NTR) mediating
neurotrophic effects of mature nerve growth factor (NGF; Pryor et al., 2012). Cell membrane
associated GM1 was also described as a functional co-receptor for fibroblast growth factor
31
(FGF) 2, whereas exogenously added GM1 seems to inhibit FGF receptor binding (Rusnati et
al., 2002). In the CNS, FGF2 plays an important role in neurogenesis, differentiation, axonal
branching, and neuron survival in degenerative disorders and repair processes following
different types of brain and peripheral nerve lesions (Haynes, 1988; Mocchetti and Wrathall,
1995). These neurotrophic effects are partly mediated by astrocytes, oligodendrocytes, and
microglia expansion (Perkins and Cain, 1995). FGF2 also induces the proliferation of neuronal
precursor cells in postnatal mice dorsal root ganglion (DRG) cultures (Namaka et al. 2001).
High-density clustering of GM1 gangliosides at presynaptic neuritic terminals promoting
amyloid β-protein fibrillogenesis was observed in AD patients (Yamamoto et al., 2008).
Moreover, an age-dependent increase in anti-GM1 antibodies was found in AD patients
correlating with the degree of severity of dementia (Koutsouraki et al., 2014). GM1
additionally induces morphological changes of astroglial cells and decreases Schwann cell
proliferation (Facci et al., 1988; Sobue et al., 1988). However, the underlying mechanisms of
GM1-mediated effects in AD patients and on glial cells remain unclear.
Rodent DRG cultures have been used to study the growth promoting effects of GM 1 and
possible interactions with NGF and FGF2 (Namaka et al., 2001). However, a detailed in vitro
study in a culture system from a species with similar GM 1 metabolism to humans
characterizing the GM1 influence on synaptophysin expression, neuronal transport systems,
and glial cells has not been performed so far. To close this gap canine adult DRGs,
representing a suitable translational approach, were used to characterize neuro- and
gliotrophic effects of GM1, NGF, and FGF2 with special emphasis on i) neuronal network
formation, ii) cytoskeletal protein expression, and iii) glial precursor cell differentiation.
32
Materials and methods
Tissues used
Antigen-specific immunoreaction was evaluated in DRGs of five healthy Beagle dogs (dog 15; from each dog one DRG of the 3rd cervical nerve). In addition, DRGs of cervical, thoracic,
and lumbar spinal cord segments from 12 healthy Beagle dogs (dog 6-17; 6 months to 2
years old) were used for cell culture experiments and transmission electron microscopy. The
dogs were euthanized in the context of other studies, conducted in compliance with the law
of animal welfare, Germany (permission numbers: 33.9-42502-05-12A241 for in vivo
investigation; 501/A79; 33.9-42502-05-13A346 and 33.9-42502-05-14A443 for cell culture
experiments).
Immunohistochemistry
Immunohistochemistry was performed with antibodies specifically detecting kinesin (1:200),
dynein (1:100), synaptophysin (1:100) and Tau1 (1:2000) as described (Czasch et al., 2006;
Gerhauser et al., 2012a). The total number of immunopositive and immunonegative neurons
was counted per DRG. For this analysis only neurons with nuclei on the section level were
included.
Cell culture and immunofluorescence
Cell isolation was performed as previously described with slight modifications (Gerhauser et
al., 2012b). Briefly, DRG neurons were separated by enzymatic digestion for 30 min at 37°C
(25 ganglia per tube) in a mixture of type IV-S hyaluronidase (H3884), type IV collagenase
(C5138) and type XI collagenase (C7657; Sigma-Aldrich Chemie GmbH, Taufkirchen,
Germany) in a 0.2% solution (each enzyme) in 1x Hank's Balanced Salt Solution (HBSS;
Gibco®, Invitrogen GmbH, Darmstadt, Germany). After 30 min, type I trypsin (T8003; 0.2%
solution) was added followed by 30 min incubation at 37°C. For mechanical dissociation
successively narrowed flame-constricted Pasteur pipettes were used and DNase I (0.2%;
Roche Diagnostics Deutschland GmbH, Mannheim, Germany) was added. Cell suspension
was pelleted by centrifugation (5 min, 300 x g, 4°C), and re-suspended in Dulbecco’s
modified Eagle medium (DMEM; Gibco®, Invitrogen) with 10% fetal calf serum (FCS;
33
Biochrom AG, Berlin, Germany) and 1% penicillin-streptomycin (PAA Laboratories GmbH,
Pasching, Austria). The purification step included a two-step density gradient centrifugation
(15 min, 450 x g, 4°C) in 25% and 27% Percoll (GE Healthcare Europe GmbH, Freiburg,
Germany) diluted in 1x HBSS. Finally, neurons were seeded in Sato’s medium (Bottenstein
and Sato, 1979) with 1% bovine serum albumin (BSA; PAA Laboratories GmbH; Pasching,
Austria) at a density of 70 neurons per well in 96 Half Area Well Microplates (CLS 3696;
Corning®, Sigma-Aldrich) coated with poly-L-lysin (0.1 mg/ml; Sigma-Aldrich) and laminin (0.1
mg/ml; Becton Dickinson GmbH, Heidelberg, Germany).
For ganglioside titration, DRG neurons were supplemented with 30 ng/ml human β nerve
growth factor (NGF; 450-01; PeproTech GmbH, Hamburg, Germany) and 0, 10, 50, 80, 100,
150, 200 and 300 µM GM1 (G7641; Sigma-Aldrich). The number of neuronal processes was
counted at 2 days post seeding (dps). For the characterization of neurons and other cells at 2
dps, DRG preparations were cultured with i) 30 ng/ml NGF, ii) 30 ng/ml FGF2 (100-18B;
PeproTech GmbH, Hamburg, Germany), iii) 80 µM GM1; iv) 30 ng/ml NGF and 80 µM GM1, v)
30 ng/ml FGF2 and 80 µM GM1, or vi) without supplements (medium only). All experiments
were performed in triplicates and analyzed using immunofluorescence (Ziege et al., 2013).
Antibodies and dilutions used are shown in table 1.
Tab.1: Antibodies used to characterize adult canine dorsal root ganglia neurons and non- neuronal cells by
immunofluorescence.
Antigen
βIII tubulin
neuronal class III β tubulin
Cleaved caspase 3
CNPase
2’,3’-cyclic nucleotide 3’phosphohydrolase
Dynein
EGR2
Early growth response protein 2
GAP43
Growth associated protein 43
GFAP
Glial fibrillary acidic protein
GS
Glutamine synthetase
Antibody/Company
Dilution
Covance; MRB-435P; rmAb
1:1000
Cell Signaling; Asp175, 9961; rpAb
1:500
Millipore; MAB326; mmAb
1:300
Covance; MMS-400R; mmAb
1:500
LSBio, LS-B3577, rpAb
1:100
Millipore; AB5220; rpAb
1:250
Sigma-Aldrich; Clone G-A-5; rpAb
1:400
Santa Cruz, sc-9067, rpAb
1:10
34
Iba1
Ionized calcium-binding adapter
molecule 1
Kinesin-5A
MAP2 (2a+2b)
Microtubule-associated protein 2
nNF
Non-phosphorylated neurofilament
pNF
Phosphorylated neurofilament
p75NTR*
Low affinity neurotrophin receptor
SOX2
sex-determining region Y-box 2
Synaptophysin
S100*
Tau1
Vimentin
Wako; rpAb
1:400
Sigma; K0889; rpAb
Sigma-Aldrich; Clone AP-20;
mmAb
1:1000
Covance; SMI311; mmAb
1:1500
Covance; SMI312; mmAb
1:2000
ATTC, clone HB8737; mmAb
1:2
Cell Signaling; 3579, rpAb
1:40
Dako; clone SY38; mmAb
Sigma; S-2644; rpAb
Millipore; clone PC1C6M; mmAb
Sigma-Aldrich; clone V9; mmAb
1:10
1:50
1:200
1:400
1:500
mmAb = mouse monoclonal antibody; rmAb = rabbit monoclonal antibody; rpAb = rabbit polyclonal
antibody; * = vital staining
Transmission electron microscopy
For transmission electron microscopy, 2240 neurons were seeded on 6 well plates, fixed for
24 h in 2.5% glutaraldehyde solution, rinsed with 0.1% sodium cacodylate buffer (pH 7.2),
post-fixed in 1% osmium tetroxide, and embedded in EPON 812 (Serva, Heidelberg,
Germany). Sections were stained with lead citrate and uranyl acetate and investigated using
an EM 10C (Carl Zeiss Jena GmbH, Oberkochen, Germany; Ulrich et al., 2014).
Statistical analysis
Statistical analysis was performed using GraphPad software (Prism 6; GraphPad Software,
Inc., La Jolla, CA, USA). Data were evaluated using a one-way analysis of variance (ANOVA)
followed by multiple post-hoc tests with Tukey alpha adjustment. P values < 0.05 were
considered statistically significant. Median values are given in the results part.
35
Results
Growth promoting effects of GM1 on DRG neurons
GM1 titration
The highest number of neurons displaying neuronal class III β-tubulin (βIII tubulin) -positive
processes was observed at a GM1 concentration of 80µM (Supplementary Fig. 1). This
concentration was used for further cell culture experiments.
GM1 promotes synaptophysin accumulations
Immunohistochemistry revealed an in vivo cytoplasmic synaptophysin expression in 19% of
neurons per ganglion (range: 12% - 24%; Fig. 1). In vitro almost all neurons displayed a
somatic synaptophysin expression (Supplementary Fig.3). Within neuronal processes,
significant more synaptophysin accumulations were detected in GM 1 treated neurons (7183%) compared to neurons grown without GM1 (33-54%;). In addition, the percentage of
neurons displaying neurite associated synaptophysin accumulations was significantly higher
under NGF/GM1 culture conditions (83%) compared to GM1 (71%), NGF (54%), or FGF2
supplementation (45%; Fig. 2, 3).
GM1/NGF positively effects neurite formation
In vitro, more than 93% of neurons were positive for βIII tubulin (Supplementary Fig.3).
Significant more βIII tubulin-positive processes per neuron were detected in NGF/GM1
containing medium (5.7) in comparison to NGF (4.1), FGF2 (2.8), FGF2/GM 1 (2.4) and
medium only controls (2.3). In addition, neurons grown in non-supplemented media showed
significant less processes compared to GM1 (4.1) or NGF alone (Fig. 2, Supplementary Fig. 5).
Similar results were obtained for neurofilament expression. Approximately 95% of neurons
revealed non-phosphorylated (nNF) and phosphorylated neurofilament (pNF) expression
except for neurons cultured in medium only (86-90%; Supplementary Fig. 4). The highest
percentage of cells with nNF- or pNF-positive processes was observed in NGF/GM1
containing medium (nNF: 68%; pNF: 72%). Significant lower percentages of cells grown in
NGF or GM1 supplemented conditions displayed nNF- (NGF: 50%; GM1: 39%) and pNF-
36
positive processes (NGF: 66%; GM1: 49%). The lowest percentage of neurons with nNF(20%) or pNF-positive processes (30%) was found in cultures with medium only
(Supplementary Fig. 4, 8).
A significant higher percentage of neurons grown with GM1 combined with NGF or FGF2
displayed growth-associated protein (GAP) 43-positive processes (GM1/NGF: 67%;
GM1/FGF2: 63%; compared to NGF (49 %) and medium only (46%; Supplementary Fig. 4, 7).
In vivo, 100% of neurons were positive for dynein and kinesin (Supplementary Fig. 2).
Similarly in vitro more than 90% of neurons displayed a positive staining. Lowest expression
levels were observed in neurons supplemented with FGF2 (92% and 93%, respectively).
Interestingly, accumulations of dynein and kinesin were observed bulging out the neurites.
FGF2 also produced the lowest amount of accumulations (66% and 55%, respectively). In
addition, there was a significant positive effect of GM1 on the presence of dynein
accumulations in combination with FGF2 (80%) compared to FGF2 alone (65%). The highest
percentage of neurons with dynein (83%) and kinesin accumulations (81%) was found after
supplementation with NGF and GM1 (Fig. 2, 3; Supplementary Fig. 6).
Immunohistochemisty demonstrated that all DRG neurons displayed microtubule-associated
protein (MAP) 2 expression in vivo, whereas Tau1 was detected in 79% (range: 62%-78%) of
neurons (Fig. 1, Supplementary Fig. 2). In vitro, MAP2 antigen was observed in 88% to 97% of
DRG neuronal somata. MAP2 was additionally detected in 1-3 neurites. The percentage of
cells with MAP2-positive processes was significantly increased in all GM1 culture conditions
(GM1: 48-52%; without GM1: 32-34%; Fig. 2; Supplementary Fig. 7). The expression of the
microtubule-associated protein Tau1 varied between 64 % of control neurons (medium only)
and 78-89% after addition of growth factors. No significant effect was found for GM 1
supplementation alone (72%) but significant more Tau1-positive cells were observed in
NGF/GM1 (86%) and FGF2/GM1 (91%) containing medium in contrast to neurons cultured
with GM1 (72%) additives only (Fig. 2; Supplementary Fig. 7).
37
NGF- or FGF2-mediated p75NTR internalization and/or down-regulation
A significantly lower p75NTR expression was observed in FGF2/GM1 (48%) and NGF/GM1
(51%) grown cells compared to neurons supplemented with GM1 (68%) alone or grown in
medium only (74%; Supplementary Fig. 5, 6).
GM1 supplementation does not affect EGR2 expression or neuronal apoptosis
Only few cells expressed early growth response (EGR) 2 in vivo (Supplementary Fig. 1),
whereas the percentage of EGR2-positive neurons ranged from 95% to 98% in vitro
(Supplementary Fig. 3, 5). Neurons grown in medium only displayed a significant higher
percentage of cleaved caspase 3 expression (22%) compared to supplemented media
(GM1/NGF: 10% to NGF: 14%; Supplementary Fig. 8).
Ultrastructural changes induced by GM1
Neurons grown in NGF/GM1 compared to NGF supplemented medium displayed a higher
density of mitochondria, multivesicular bodies, and small amounts of concentrically and
loosely arranged membranous structures measuring up to 200 nm in diameter. NGF/GM 1
condition revealed multiple neurite associated nodular enlargements characterized by
accumulations of mitochondria partly with dissociated cristae (Fig. 4).
Pleiotropic effects of GM1 on non-neuronal cells
GM1 increases vimentin expression in DRG non-neuronal cells
In vitro, 87% to 92% of non-neuronal cells were vimentin-positive. Significantly more
vimentin expressing cells were observed in media containing GM 1 alone (91%) or in
combination with NGF (92%) or FGF2 (91%) compared to medium only controls (87%; Fig. 5,
6).
FGF2 and GM1/FGF2 promote a multipolar morphology of vimentin-positive cells
Vimentin expressing non-neuronal cells demonstrated three different morphologies:
amoeboid shaped cells without processes (38-46%), bipolar cells with two long processes (613%), and multipolar cells with multiple short and/or long processes of varying length (3241%). The lowest percentage of amoeboid shaped cells was present in culture with GM 1/NGF
38
supplemented medium (38%), with a significant difference compared to NGF (46%),
FGF2/GM1 (46%) and medium only (43%). The second lowest percentage of these cells (40%)
was observed in FGF2 containing culture conditions. The multipolar phenotype was
significantly increased in FGF2 (41%) and NGF/GM1 (40%) containing media compared to
medium only (32%). Culture conditions did not influence the percentages of bipolar cells
(Fig. 5, 6, Supplementary Fig. 9).
GM1/FGF2 reduces the number of GFAP expressing cells
DRGs and the respective culture preparations contain glial fibrillary acidic protein (GFAP) and
2’,3’-cyclic nucleotide 3’-phosphohydrolase (CNPase) co-expressing cells. In vitro, the
percentage of CNPase-positive non-neuronal cells ranged from 87% (GM1/FGF2) to 95%
(NGF) with no significant differences between culture conditions. Lowest percentages of
GFAP expressing cells were found with FGF2/GM1 (69%). Significant higher percentages were
present after supplementation with FGF2 (78%), GM1 (79%), NGF (83%), and medium only
(85%). Similarly, only 68% of cells grown with FGF2/GM1 were positive for CNPase and GFAP
(Fig. 5, 6, Supplementary Fig. 9).
GM1 increases glutamine synthetase positive cells
The highest percentages of glutamine synthetase (GS) -positive cells were found in media
containing GM1 (47%), GM1/NGF (45%) and GM1/FGF2 (43%). Cells grown in FGF2 containing
medium (35%) or medium only controls (32%) displayed a significant lower percentage of GS
expression compared to all other culture conditions (Fig. 5, 6).
FGF2 promotes the number of Iba1-positive but reduces the number of p75NTR-expressing
non-neuronal cells
The percentages of ionized calcium-binding adapter molecule (Iba) 1 expressing cells ranged
from 10% in medium only to 18% in GM1/FGF2 supplemented medium. Significantly higher
numbers of Iba1-positive non-neuronal cells were found with FGF2 or FGF2/GM1
supplemented medium compared to GM1, NGF or non-supplemented medium (Fig. 5, 6).
The percentages of 75NTR-positive non-neuronal cells ranged from 5% in FGF2 to 10% in GM1
39
culture conditions. In FGF2/GM1 and GM1 supplemented media, a significant higher number
of cells were p75NTR-positive compared to FGF2 supplements only (Supplementary Fig. 10).
GM1 has no influence on S100, GAP43, or SOX2 expression in non-neuronal cells
A high percentage of satellite glial cells expressed sex-determining region Y-box (SOX) 2 in
vivo (Fig. 1). No significant differences concerning S100, GAP43, and SOX2 expression were
observed between the different culture conditions. Expression levels for S100 varied from
16% (pure medium) to 31% (NGF). Approximately 70% of non-neuronal cells were positive
for SOX2 and GAP43 (Supplementary Fig. 9, 10).
Discussion
Age-dependent alterations in GM1 metabolism are a modulating or even one of the
causative factors in the pathogenesis of neurodegenerative diseases. The present study
revealed that GM1 especially in combination with NGF triggers neurite outgrowth and
synaptophysin accumulations in processes of adult canine DRG neurons, which might
indicate new synapse formation. This effect may result from increased neuronal arborization
causing an enlarged contact area for synapse formation or a direct GM 1-mediated effect on
synaptic density. However, an increased endocytosis and/or retrograde transport of synaptic
vesicles (SV) or an enhanced anterograde transport may also explain the presence of
synaptophysin accumulations. NGF is described to cause an intracellular shift of
synaptophysin from the soma to the neurites in newborn rat trigeminal ganglion neurons in
cultures with low numbers of non-neuronal cells (Tarsa and Balkowiec, 2008). In adult canine
DRG neurons synaptophysin accumulations were induced by GM 1, independent of nonneuronal cells. The observation that i) synaptophysin binds to cholesterol (Thiele et al.,
2000), ii) GM1 and cholesterol are major components of lipid rafts (Suzuki et al., 2011), iii)
human GM1 brain levels decrease with age (Seglar-Stahl et al., 1983), iv) synaptic loss is a
hallmark of AD, and v) GM1 and cholesterol metabolism are implicated in AD pathogenesis,
indicates that a beneficial effect on synaptophysin metabolism might explain the observed
findings following GM1 treatment.
40
Neurite associated synaptophysin accumulations were primarily stimulated by GM 1, whereas
neurite outgrowth was also dependent on NGF. GM1 and NGF induce an increase in neuronal
processes in vitro (Mohiuddin et al., 1996) and in vivo (Figliomeni et al., 1992). NGF and GM1
also enhanced neurite outgrowth in the present study associated with higher numbers of ßIII
tubulin, nNF, MAP2, and GAP43-positive neuronal processes. Moreover, the age-associated
decline of GM1 as observed in humans might contribute to the decreased plasticity of aged
brains via the disruption of the temporal and anatomical coordination of GAP43 expression
(Schmoll et al., 2005). However, adult human DRG neurons are negative for synaptophysin,
whereas 15-20% of canine DRG neurons express this membrane component of synaptic
vesicles (Suburo et al., 1992). This might result from a high synthesis rate or a slow transport
of the protein (or vesicles) to nerve endings in dogs (Bonfanti et al., 1991).
Synaptogenesis and synaptic maintenance are largely driven by retrograde messengers
(Regehr et al., 2009). Similar to neurite outgrowth, NGF but not FGF2 supplementation
increased the cytoplasmic expression of the transport protein dynein. Neurotrophin
retrograde signaling is completely dependent upon the formation of signaling endosomes
carried to the cell body by dynein (Heerssen et al., 2004; Cosker et al., 2008). Therefore, an
amplified binding, internalization, and retrograde transport of NGF receptors by dynein
(Saxena et al., 2005) might explain higher dynein levels in neuronal somata. Moreover, the
formation of dynein accumulations seemed to be dependent on GM 1. These accumulations
of dynein might be induced by a molecular traffic jam due to an increased retrograde
transport. Interestingly, dynein mutations also affect the autophagic clearance with
consecutive impaired degradation of protein aggregates (Ravikumar et al., 2005). A similar
mechanism is also implicated in part for AD pathogenesis.
Furthermore, electron microscopy of GM1/NGF grown neurons revealed an increase in
cytoplasmatic multivesicular bodies and mitochondria within neuronal bulbs. Multivesicular
bodies might implicate an enhanced membrane receptor internalization and/or autophagic
clearance (Katzmann et al., 2002). In AD pathogenesis, intraneuronal accumulations of
certain forms of β amyloid in multivesicular bodies triggering synaptical alterations has been
described (Takahashi et al., 2004). In addition, GM1 might increase the dynein-mediated
transport of damaged mitochondria to the neuronal soma for further degradation. Tau1
41
expression was primarily influenced by growth factors and not GM 1 supplementation. A
FGF2-mediated up-regulation of Tau1 expression and phosphorylation by glycogen synthase
kinase-3 (GSK-3) was demonstrated in vitro (Tatebayashi et al., 1999) and indicated its
participation in the formation of neurofibrillary tangles in AD (Cummings et al., 1993). GM 1
inhibits GSK-3 and might prevent Tau phosphorylation (Kreutz et al., 2011). Moreover, the
age-related impaired dynein function results in Tau accumulations (Kimura et al., 2007).
Therefore, increased FGF2 levels and an age-associated decrease of GM1 levels in the human
brain might result in neurofibrillary tangle formation.
EGR2 was expressed in more than 95% of cultured neurons, whereas in vivo only 20% of DRG
neurons were EGR2-positive. Growth conditions did not affect EGR2 expression excluding a
prominent role of EGR2 in the regulation of neurite outgrowth. Neurotrophic effects of
supplements were also confirmed by the GM1-, FGF2-, and NGF-mediated decrease in
neuronal cleaved caspase 3 expression. Anti-apoptotic effects were also described for NGF
(Scuteri et al., 2010) and GM1 (Ferrari et al., 1995) in rodents, whereas FGF2 seems to induce
apoptosis in murine DRG neurons after sciatic nerve injury (Jungnickel et al., 2004).
Glials cells have a strong impact on the physiological and pathological functions of neurons.
Consequently, neuron-glial cell interactions have to be included in the development of in
vitro models used in CNS research. NGF, FGF2, and GM1 are known to influence morphology,
growth factor production, differentiation and/or proliferation of non-neuronal cells including
satellite glial cells, macrophages, fibroblasts, and Schwann cells. In canine DRG cell cultures
GM1 and NGF increased the percentage of GS-positive cells, which might affect extracellular
glutamate levels revealing a mechanism to explain beneficial treatment effects in
neurodegenerative diseases. Glutamate-mediated neurotoxicity and impairment of
glutamatergic neurotransmission plays a pathogenetic role in AD, PD, schizophrenia,
multiple sclerosis, and amyotropic lateral sclerosis (Willard and Koochekpour, 2013).
The current study demonstrated differences in vimentin expression and morphology of nonneuronal cells depending upon the growth factors used. GM 1 induced a mild increase in the
percentage of vimentin expressing cells. This intermediate filament is typically found in
reactive
and
immature
astrocytes
(Seehusen
et
al.,
2007)
and
reactive
microglia/macrophages under various pathological conditions including AD und PD (Yamada
42
et al., 1992). Vimentin was also suggested to be involved in intracellular ganglioside
transport (Tettamanti, 2004.). Thus GM1 might influence the differentiation state of glial
cells and its own intracellular transport via vimentin. Interestingly, fibroblasts isolated from
familial AD patients showed a unique aberration of vimentin fiber distribution, while other
cytoskeletal fibers remained intact (Takeda et al., 1990). However, the possible relationship
between vimentin and the positive effects of GM1 treatment in AD remains unclear.
The vimentin expressing non-neuronal cells showed three different phenotpyes, whose
relative proportions were influenced by growth conditions. FGF2 supplementation increased
the percentage of multipolar cells reminiscent of astrocytes, whereas the fraction of
amoeboid cells was reduced. The percentage of GFAP-positive cells was increased in cultures
supplemented with FGF2 compared to GM1/FGF2 most likely due to the antagonism of
gangliosides and FGF2 (Rusnati et al., 1999). Similarly, GM1 treatment of adult rats reduced
the lesion-induced increase in GFAP (Oderfeld-Nowak et al., 1993). Consequently, FGF2
seems to favor astrocytic differentiation of glial cells, which might be inhibited by GM 1.
However, further studies are necessary to characterize the influence of gangliosides and
growth factors on glial scar formation in different CNS disorders.
The low affinity neurotrophin receptor p75 NTR was expressed in 5 to 10 % of non-neuronal
cells. Similar to neurons, growth factors decreased the percentage of p75NTR-positive cells. A
growth factor-mediated internalization of p75NTR might result in lower numbers of p75NTRpositive cells. A lower proportion of Schwann cells in DRG cell cultures can also be explained
by lower numbers of p75NTR-positive non-neuronal cells after FGF supplementation.
However, no influence of the different culture conditions was found for S100 expressing
cells, which represents another commonly used Schwann cell marker. Higher numbers of
Iba1 expressing cells most likely representing microglia/ macrophages, were found in FGF2
supplemented cultures substantiating previous observations that FGF2 activates
microglia/macrophages in vivo (Goddard et al., 2001). Culture conditions had no influence
on the high percentages of non-neuronal cells expressing CNPase, GAP43, and SOX2 in vitro.
Similar to the high GAP43 expression in dogs, more than 60% of non-neuronal cells
expressed this nervous system-specific protein in cultures of adult rat DRGs (Woolf et al.,
1990). GAP43 is predominantly found in differentiating and regenerating neurons,
43
precursors of astrocytes and oligodendrocytes and non-myelinating Schwann cells in vitro
and in vivo (Curtis et al., 1992; Li et al., 1996; Sensenbrenner et al., 1997). These findings
underline the plasticity of DRG satellite cells, which might even have stem cell-like properties
with the capacity to differentiate into myelin-forming cells (Zujovic et al., 2010).
In summary, the results of the current study support the use of adult canine DRGs as a
valuable in vitro model to study the molecular pathogenesis of different human
neurodegenerative diseases including AD or PD (Pekcec et al., 2011), which might even begin
in and spread from the PNS (Beach et al., 2010; Pan-Montojo and Reichmann, 2014)..
Moreover, the present investigation confirms neurotrophic effects of GM1 characterized by
decreased neuronal death, increased neurite outgrowth and possibly enhanced synaptic
density. In addition, GM1 might counteract FGF2-mediated glial scar formation and
glutamate-mediated neurotoxicity. Further in vivo studies are needed to substantiate the
presumed beneficial effects of GM1 on synaptogenesis and neurite outgrowth.
Acknowledgments
The authors thank Danuta Waschke, Caroline Schütz, Kerstin Schöne, Kerstin Rohn, Bettina
Buck, Petra Grünig, and Claudia Herrmann for excellent technical assistance. The study was
supported by grants from the German Research Foundation (DFG; BA 815/12-1; BA 815/102; SCHU 634/6-1), “Stiftung der Deutschen Wirtschaft“ (K. H.), Chinese government (Y. W.),
“Deutscher Akademischer Austauschdienst“ (K. K.), “Akademie für Tiergesundheit e.V” (V.
P.), and “Royal Thai Government Scholarship” (W. T.).
Author contributions
K. Hahn designed and coordinated the study, did the cell culture experiments including
photographical documentation, designed figures and drafted the manuscript.
A. Lehmbecker was involved in the coordination of the study and cell culture experiments,
performed electron microscopy
Y. Wang performed the analysis of immunofluorescence data.
44
A. Habierski, K. Kegler I. Spitzbarth, W. Tongtako, and V. Pfannkuche provided support for
cell culture experiments, provided antibodies, and helped with the photographical
documentation.
K. Schughart edited the manuscript and obtained funding.
W. Baumgärtner participated in the design of the study, edited the manuscript, and obtained
funding.
I. Gerhauser was involved in the coordination of the study, performed statistical analysis,
designed figures, and edited the manuscript.
Conflicts of interest
The authors have no potential or existing conflicts of interest.
45
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Ando S, Tanaka Y, Waki H, Kon K, Iwamoto M, Fukui F. Gangliosides and sialylcholesterol
as modulators of synaptic functions. Ann NY Acad Sci 1998; 845:232-9.
Aydin M, Cengiz S, Agaçhan B, Yilmaz H, Isbir T. Age-related changes in GM1, GD1a,
GT1b components of gangliosides in Wistar albino rats. Cell Biochem Funct 2000;18:415.
Bachis A, Rabin SJ, Del Fiacco M, Mocchetti I. Gangliosides prevent excitotoxicity
through activation of TrkB receptor. Neurotox Res 2002;4:225–34.
Beach TG, Adler CH, Sue LI, Vedders L, Lue L, White Iii CL, Akiyama H, Caviness JN, Shill
HA, Sabbagh MN, Walker DG; Arizona Parkinson's Disease Consortium. Multi-organ
distribution of phosphorylated alpha-synuclein histopathology in subjects with Lewy
body disorders. Acta Neuropathol 2010;119:689-702.
Bonfanti L, Bellardi S, Ghidella S, Gobetto A, Polak JM, Merighi A. Distribution of five
peptides, three general neuroendocrine markers, and two synaptic-vesicle-associated
proteins in the spinal cord and dorsal root ganglia of the adult and newborn dog: an
immunocytochemical study. Am J Anat 1991;191:154-66.
Bottenstein JE, Sato GH. Growth of a rat neuroblastoma cell line in serum-free
supplemented medium. Proc Natl Acad Sci USA 1979;76:514–7.
Cosker KE, Courchesne SL, Segal RA. Action in the axon: generation and transport of
signaling endosomes. Curr Opin Neurobiol 2008;18:270-5.
Cummings BJ, Su JH, Cotman CW. Neuritic involvement within bFGF immunopositive
plaques of Alzheimer's disease. Exp Neurol 1993;124:315-25.
Curtis R, Stewart HJ, Hall SM, Wilkin GP, Mirsky R, Jessen KR. GAP-43 is expressed by
nonmyelin-forming Schwann cells of the peripheral nervous system. J Cell Biol
1992;116:1455-64.
Czasch S, Paul S, Baumgärtner W. A comparison of immunohistochemical and silver
staining methods for the detection of diffuse plaques in the aged canine brain.
Neurobiol Aging 2006;27:293-305.
Facci L, Skaper SD, Favaron M, Leon A. A role for gangliosides in astroglial cell
differentiation in vitro. J Cell Biol 1988;106:821-8.
Ferrari G, Anderson BL, Stephens RM, Kaplan DR, Greene LA. Prevention of apoptotic
neuronal death by GM1 ganglioside. Involvement of Trk neurotrophin receptors. J Biol
Chem 1995;270: 3074-80.
Figliomeni B, Bacci B, Panozzo C, Fogarolo F, Triban C, Fiori MG. Experimental diabetic
neuropathy. Effect of ganglioside treatment on axonal transport of cytoskeletal
proteins. Diabetes 1992;41:866-71.
46
14. Gerhauser I, Wohlsein P, Ernst H, Germann P-G, Baumgärtner W. Lack of detectable
diffuse and neuritic plaques and neurofibrillary tangles in the brains of aged hamsters.
Neurobiol Aging 2012a;33:1716-9.
15. Gerhauser I, Hahn K, Baumgärtner W, Wewetzer K. Culturing adult canine sensory
neurons to optimise neural repair. Vet Rec 2012b;170:102.
16. Goddard DR, Berry M, Kirvell SL, Butt AM. Fibroblast growth factor-2 induces astroglial
and microglial reactivity in vivo. J Anat 2002; 200:57-67.
17. Hahn CN, del Pilar Martin M, Schröder M, Vanier MT, Hara Y, Suzuki K, Suzuki K, d'Azzo
A. Generalized CNS disease and massive GM1-ganglioside accumulation in mice
defective in lysosomal acid beta-galactosidase. Hum Mol Genet 1997;6:205-11.
18. Haynes LW. Fibroblast (heparin-binding) growing factors in neuronal development and
repair. Mol Neurobiol 1988;2:263-89.
19. Heerssen HM, Pazyra MF, Segal RA. Dynein motors transport activated Trks to promote
survival of target-dependent neurons. Nat Neurosci 2004;7:596-604.
20. Jungnickel J, Claus P, Gransalke K, Timmer M, Grothe C. Targeted disruption of the FGF-2
gene affects the response to peripheral nerve injury. Mol Cell Neurosci . 2004; 25:44452.
21. Katzmann DJ, Odorizzi G, Emr SD. Receptor downregulation and multivesicular-body
sorting. Nat Rev Mol Cell Biol. 2002; 3: 893-905.
22. Kimura N, Imamura O, Ono F, Terao K. Aging attenuates dynactin-dynein interaction:
down-regulation of dynein causes accumulation of endogenous tau and amyloid
precursor protein in human neuroblastoma cells. J Neurosci Res 2007;85:2909-16.
23. Koutsouraki E, Hatzifilippou E, Michmizos D, Banaki T, Costa V, Baloyannis The Probable
Auto-Antigenic Role of Lipids (Anti-Ganglioside Antibodies) in the Pathogenesis of
Alzheimer's Disease. J Alzheimers Dis. 2014;
24. Kracun I., Kalanj S, Talan-Hranilovic J, Cosovic C. Cortical distribution of gangliosides in
Alzheimer's disease. Neurochem Int 1992;20:433-8.
25. Kreutz F, Frozza RL, Breier AC, de Oliveira VA, Horn AP, Pettenuzzo LF, Netto CA, Salbego
CG, Trindade VM. Amyloid-β induced toxicity involves ganglioside expression and is
sensitive to GM1 neuroprotective action. Neurochem Int 2011;59:648-55.
26. Kreutzer R, Kreutzer M, Pröpsting MJ, Sewell AC, Leeb T, Naim HY, Baumgärtner W.
Insights into post-translational processing of beta-galactosidase in an animal model
resembling late infantile human G-gangliosidosis. J Cell Mol Med 2008;12:1661-71.
27. Ledeen RW. Ganglioside structures and distribution: are they localized at the nerve
ending? J Supramol Struct 1978;8:1-17.
28. Mocchetti I, Wrathall JR. Neurotrophic factors in central nervous system trauma. J
Neurotrauma 1995; 12:853-70.
47
29. Li GL, Farooque M, Holtz A, Olsson Y. Increased expression of growth-associated protein
43 immunoreactivity in axons following compression trauma to rat spinal cord. Acta
Neuropathol 1996;92:19-26.
30. Mohiuddin L, Fernyhough P, Tomlinson DR. Acidic fibroblast growth factor enhances
neurite outgrowth and stimulates expression of GAP43 and T alpha 1 alpha-tubulin in
cultured neurones from adult rat dorsal root ganglia. Neurosci Lett 1996;215:111-4.
31. Namaka MP, Sawchuk M, MacDonald SC, Jordan LM, Hochman S. Neurogenesis in
postnatal mouse dorsal root ganglia. Exp Neurol 2001;172:60-9.
32. Oderfeld-Nowak B, Jegliński W, Skup M, Skangiel-Kramska J, Zaremba M, Koczyk D.
Differential effects of GM1 ganglioside treatment on glial fibrillary acidic protein content
in the rat septum and hippocampus after partial interruption of their connections. J
Neurochem 1993;61:116-9.
33. Pan-Montojo F, Reichmann H. Considerations on the role of environmental toxins in
idiopathic Parkinson's disease pathophysiology. Transl Neurodegener 2014;3:10.
34. Pekcec A, Schneider EL, Baumgärtner W, Stein V, Tipold A, Potschka H. Age-dependent
decline of blood-brain barrier P-glycoprotein expression in the canine brain. Neurobiol
Aging 2011;32:1477-85.
35. Perkins LA, Cain LD. Basic fibroblast growth factor (bFGF) increases the survival of
embryonic and postnatal basal forebrain cholinergic neurons in primary culture. Int J
Dev Neurosci 1995;13:51-61.
36. Pryor S, McCaffrey G, Young LR, Grimes ML. NGF causes TrkA to specifically attract
microtubules to lipid rafts. PLoS One 2012;7:e35163.
37. Ravikumar B, Acevedo-Arozena A, Imarisio S, Berger Z, Vacher C, O'Kane CJ, Brown SD,
Rubinsztein DC. Dynein mutations impair autophagic clearance of aggregate-prone
proteins. Nat Genet. 2005;37:771-6.
38. Regehr WG, Carey MR, Best AR. Activity-dependent regulation of synapses by
retrograde messengers. Neuron 2009;63:154-70.
39. Rusnati M, Urbinati C, Tanghetti E, Dell'Era P, Lortat-Jacob H, Presta M. Cell membrane
GM1 ganglioside is a functional coreceptor for fibroblast growth factor 2. Proc Natl Acad
Sci USA 2002;99:4367-72.
40. Rusnati M, Tanghetti E, Urbinati C, Tulipano G, Marchesini S, Ziche M, Presta M,
Interaction of fibroblast growth factor-2 (FGF-2) with free gangliosides: biochemical
characterization and biological consequences in endothelial cell cultures. Mol Biol Cell
1999;10:313-27.
41. Saxena S, Bucci C, Weis J, Kruttgen A. The small GTPase Rab7 controls the endosomal
trafficking and neuritogenic signaling of the nerve growth factor receptor TrkA. J
Neurosci. 2005; 25:10930-40.
48
42. Scheff SW, Neltner JH, Nelson PT. Is synaptic loss a unique hallmark of Alzheimer's
disease? Biochem Pharmacol 2014;88:517-28.
43. Schneider JS, Sendek S, Daskalakis C, Cambi F. GM1 ganglioside in Parkinson's disease:
Results of a five year open study. J Neurol Sci 2010; 292: 45-51.
44. Schmoll H, Ramboiu S, Platt D, Herndon JG, Kessler Ch, Popa-Wagner A. Age influences
the expression of GAP43 in the rat hippocampus following seizure. Gerontology
2005;51:215-24.
45. Scuteri A, Galimberti A, Ravasi M, Pasini S, Donzelli E, Cavaletti G, Tredici G. NGF
protects dorsal root ganglion neurons from oxaliplatin by modulating JNK/Sapk and
ERK1/2. Neurosci Lett 2010;486:141-5.
46. Seehusen F, Orlando EA, Wewetzer K, Baumgärtner W. Vimentin-positive astrocytes in
canine distemper: a target for canine distemper virus especially in chronic demyelinating
lesions? Acta Neuropathol 2007;114:597-608.
47. Segler-Stahl K, Webster JC, Brunngraber EG. Changes in the concentration and
composition of human brain gangliosides with aging. Gerontology 1983;29:161-8.
48. Sensenbrenner M, Lucas M, Deloulme JC. Expression of two neuronal markers, growthassociated protein 43 and neuron-specific enolase, in rat glial cells. J Mol Med (Berl)
1997;75:653-63.
49. Skaper SD, Leon A, Toffano G. Ganglioside function in the development and repair of the
nervous system. From basic science to clinical application. Mol Neurobiol1989;3:173–99.
50. Sobue G, Taki T, Yasuda T, Mitsuma T. Gangliosides modulate Schwann cell proliferation
and morphology. Brain Res 1988;474:287-95.
51. Suburo AM, Gu XH, Moscoso G, Ross A, Terenghi G, Polak JM. Developmental pattern
and distribution of nerve growth factor low-affinity receptor immunoreactivity in human
spinal cord and dorsal root ganglia: comparison with synaptophysin, neurofilament and
neuropeptide immunoreactivities. Neuroscience 1992;50:467-82.
52. Suzuki Y, Hirabayashi Y, Sagami F, Matsumoto M. Gangliosides in the blood plasma:
levels of ganglio-series gangliosides in the plasma after administration of brain
gangliosides. Biochim Biophys Acta 1988;962: 277-81.
53. Svennerholm L, Bråne G, Karlsson I, Lekman A, Ramström I, Wikkelsö C. Alzheimer
disease - effect of continuous intracerebroventricular treatment with GM1 ganglioside
and a systematic activation programme. Dement Geriatr Cogn Disord 2002;14:128-36.
54. Takahashi RH, Almeida CG, Kearney PF, Yu F, Lin MT, Milner TA, Gouras GK.
Oligomerization of Alzheimer's beta-amyloid within processes and synapses of cultured
neurons and brain. J Neurosci 2004;24:3592-9.
55. Takeda M, Tanaka M, Kudo T, Nakamura Y, Tada K, Nishimura T. Changes in adhesion
efficiency and vimentin distribution of fibroblasts from familial Alzheimer's disease
patients. Acta Neurol Scand 1990;82:238-44.
49
56. Tarsa L, Balkowiec A. Nerve growth factor regulates synaptophysin expression in
developing trigeminal ganglion neurons in vitro. Neuropeptides 2009;43:47-52.
57. Tatebayashi Y, Iqbal K, Grundke-Iqbal I. Dynamic regulation of expression and
phosphorylation of tau by fibroblast growth factor-2 in neural progenitor cells from
adult rat hippocampus. J Neurosci 1999;19:5245-54.
58. Tettamanti G. Ganglioside/glycosphingolipid turnover: new concepts. Glycoconj J
2004;20:301-17.
59. Thiele C, Hannah MJ, Fahrenholz F, Huttner WB. Cholesterol binds to synaptophysin and
is required for biogenesis of synaptic vesicles. Nature Cell Biol 2000; 2:42–9.
60. Ulrich R, Imbschweiler I, Kalkuhl A, Lehmbecker A, Ziege S, Kegler K, Becker K, Deschl U,
Wewetzer K, Baumgärtner W. Transcriptional profiling predicts overwhelming homology
of schwann cells, olfactory ensheathing cells, and schwann cell-like glia. Glia 2014; doi:
10.1002/glia.22700. [Epub ahead of print]
61. Willard SS, Koochekpour S. Glutamate signaling in benign and malignant disorders:
current status, future perspectives, and therapeutic implications. Int J Biol Sci
2013;9:728-42.
62. Yamada T, Kawamata T, Walker DG, McGeer PL. Vimentin immunoreactivity in normal
and pathological human brain tissue. Acta Neuropathol. 1992;307: 1282-8.
63. Yamamoto N, Fukata Y, Fukata M, Yanagisawa K. GM1-ganglioside-induced Abeta
assembly on synaptic membranes of cultured neurons. Biochim Biophys Acta
2008;1768:1128-37.
64. Ziege S, Baumgärtner W, Wewetzer K. Toward defining the regenerative potential of
olfactory mucosa: establishment of Schwann cell-free adult canine olfactory
ensheathing cell preparations suitable for transplantation. Cell Transplant 2013;22:35567.
65. Zhu Y, Yang J, Jiao S, Ji T. Ganglioside-monosialic acid (GM1) prevents oxaliplatin-induced
peripheral neurotoxicity in patients with gastrointestinal tumors. World J Surg Oncol
2013;25:11-9.
66. Zujovic V, Thibaud J, Bachelin C, Vidal M, Coulpier F, Charnay P, Topilko P, Baron-Van
Evercooren A. Boundary cap cells are highly competitive for CNS remyelination: fast
migration and efficient differentiation in PNS and CNS myelin-forming cells. Stem Cells
2010;28:470-9.
50
Figures:
Figure 1:
Fig. 1: In vivo Synaptophysin, Tau1, and SOX2 expression in an adult canine dorsal root ganglion.
Immunohistochemistry using the avidin-biotin-peroxidase complex method, the chromogen 3,3′-diaminobenzidine, and Mayer's hematoxylin as counterstain. (A) Few neurons were synaptopyhsin-positive in vivo. (B)
A moderate to severe Tau1 signal was detected in most neuronal somata. (C) SOX2 expression was restricted to
nuclei of satellite glial cells. Bar, 40 μm.
51
Figure 2:
Fig. 2: Adult canine dorsal root ganglia neurons grown in medium only (control) or supplemented with GM 1ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or nerve growth factor (NGF) at 2 days post seeding.
Shown are individual values of 3 dogs and means. Statistically significant differences (p < 0.05) between growth
conditions are marked with identical Arabic letters. (A) The highest number of βIII tubulin-positive processes
per neuron was found with GM1/NGF supplementation. (B) Note positive effect of GM1 on the formation of
neurite associated synaptophysin accumulations. (C) Percentage of dynein expressing neurons and (D) neurons
with neurite associated dynein accumulations. Note positive effect of GM1 on the formation of dynein
accumulations. (E) Significantly more Tau1-positive cells were observed in NGF/GM1 and FGF2/GM1
supplemented medium in contrast to neurons cultured with GM 1 only. (F) Note significantly increased numbers
of neurons with microtubule-associated protein (MAP) 2-positive processes in all GM1 culture conditions.
52
Figure 3:
Fig. 3: Immunofluorescence double-labeling of adult canine dorsal root ganglia neurons for (A, B) neuronal
class III β tubulin (green) and synaptophysin (red) or C) kinesin (green) and dynein (red) supplemented with
(A, C) GM1/NGF or (B) NGF. Note high numbers of synaptophysin and dynein accumulations (arrowhead) in
processes of neurons supplemented with GM1/NGF. Kinesin accumulations (arrow) were observed in all
conditions. Bars, 50 μm.
53
Figure 4:
Fig. 4: Transmission electron microscopy revealed in (A, B) NGF/GM1 grown neurons higher numbers of
mitochondria and multivesicular bodies (insert) in the cytoplasm as well as neurite associated accumulations of
mitochondria partly with dissociated christae compared to (C, D) neurons cultivated in NGF supplemented
medium. Bars, 1,5 µm; inserts: 750 nm.
54
Figure 5:
Fig. 5: In vitro characterization of non-neuronal cells isolated from adult canine dorsal root ganglia grown in
medium only (control), GM1-ganglioside (GM1), fibroblast growth factor 2 (FGF2), and/or nerve growth factor
(NGF) at 2 days post seeding. Shown are individual values of 3 dogs and means. Statistically significant
differences (p < 0.05) between growth conditions are marked with identical Arabic letters. (A) Note increased
vimentin expression in non-neuronal cells cultured with GM1 containing media. (B) The lowest percentage of
amoeboid-shaped vimentin expressing cells was observed in cultures supplemented with FGF2 or GM 1/NGF.
(C) Note that FGF2 and GM1/FGF2 promote the occurrence of multipolar vimentin-positive cells. (D) The
percentage of glial fibrillary acidic protein (GFAP)–positive cells was lowest in cultures supplemented with
FGF2/GM1. (E) The lowest percentages of glutamine synthetase-positive cells were found in control medium
and with FGF2 supplementation. (F) FGF2 promotes the number of ionized calcium-binding adapter molecule
(Iba) 1-positive cells.
55
Figure 6:
Fig. 6: Immunofluorescence labeling of non-neuronal cells isolated from adult canine dorsal root ganglia
supplemented with GM1-ganglioside and nerve growth factor at 2 days post seeding. (A) Vimentin (red)
expressing cells demonstrated three different morphologies: amoeboid-shaped cells (thin arrow), bipolar cells
with two long processes (thick arrow), and multipolar cells (arrowhead). (B) Note 2’,3’-cyclic nucleotide 3’phosphohydrolase (CNPase) (red)/glial fibrillary acidic protein (GFAP) (green), (C) vimentin (red)/GFAP (green),
and (D) CNPase (red)/growth associated protein (GAP) 43 co-expressing cells. E) Glutamine synthetase
expression was found in 45% of cells with amoeboid morphology. F) Note less than 20% ionized calciumbinding adapter molecule (Iba) 1-positive small cells with polygonal morphology. Bars, 50 μm.
56
Supplementary figures:
Supplementary figure 1:
Supplementary Fig. 1: GM1 titration in adult canine dorsal root ganglion neurons of four dogs. The number of
neuronal class III β tubulin positive processes per neuron was evaluated 2 days post seeding. The highest
number of processes was observed with 80 µM GM1.
57
Supplementary Fig. 2: Immunohistochemistry of an adult canine dorsal root ganglion using the avidin-biotinperoxidase complex method, the chromogen 3,3′-diamino-benzidine, and Mayer's hematoxylin as counterstain.
(A) Dynein, (B) kinesin and (C) microtubule-associated protein (MAP) 2 expression was detected in all neurons.
(D) Early growth response (EGR) 2 was found in the cytoplasm of neurons and few non-neuronal cells. Bars, 40
μm
58
Supplementary Fig. 3: Adult canine dorsal root ganglia neurons grown in medium only (control) or
supplemented with GM1-ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or nerve growth factor (NGF)
at 2 days post seeding. Shown are individual values obtained from 3 dogs and means. Statistically significant
differences (p < 0.05) between growth conditions are marked with identical Arabic letters. (A) neuronal class III
β tubulin expression was lowest in neurons grown in FGF2 supplemented medium. For (B) synaptophysin, (C)
microtubule-associated protein (MAP) 2, and (D) early growth response (EGR) 2 no significant differences were
observed between growth conditions.
59
supplemented with GM1-ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or nerve growth factor (NGF),
at 2 days post seeding. Shown are individual values of 3 dogs and means. Statistically significant differences (p
< 0.05) between growth conditions are marked with identical Arabic letters. (A, B) Non-phosphorylated
neurofilament (nNF), (C, D) phosphorylated neurofilament (pNF), and (E, F) growth-associated protein (GAP)
43. Note high GM1/NGF associated neurite formation for nNF and GAP43, whereas no significant differences
were observed for pNF expression in the cytoplasm or neurites.
60
Supplementary Fig. 5: Immunofluorescence labeling of adult canine dorsal root ganglia neurons for (A, B)
NTR
neuronal class III β tubulin (green) and p75 neurotrophin receptor (p75 ; red). Note fewer and shorter
NTR
neurites and reduced p75
immunoreactivity in neurons grown in medium supplemented with GM 1ganglioside and fibroblast growth factor 2. (C) Immunofluorescence revealed cytoplasmatic early growth
response (EGR) 2 (red) expression in the majority of neurons. (D) Phase contrast microscopy. Bars, 100 μm.
61
supplemented with GM1-ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or nerve growth factor (NGF)
at 2 days post seeding. Shown are individual values of 3 dogs and means. Statistically significant differences (p
< 0.05) between growth conditions are marked with identical Arabic letters. (A) Kinesin expression and (B) the
NTR
formation of neurite associated kinesin accumulations were not influenced by growth conditions. (C) p75
expression was significantly lower in FGF2/GM1 and NGF/GM1 grown cells compared to neurons only
supplemented with GM1 or grown in pure medium. (D) Growth conditions did not influence formation of
NTR
p75 -positive neurites.
62
Supplementary Fig. 7: Immunofluorescence labeling of adult canine DRG neurons for (A, B) growth-associated
protein (GAP) 43 (red). Note GAP43-positive neurites in neurons supplemented with GM 1-ganglioside (GM1)
and nerve growth factor (NGF). (C, D) Immunofluorescence double-labeling for kinesin (green) and
microtubule-associated protein (MAP) 2 (red) revealed MAP2 immunoreactivity in 1-3 large neurites in all
media containing GM1. (E, F) Note that significantly more Tau1-positive cells can be found following
supplementaion with GM1 and fibroblast growth factor (FGF) 2 in contrast to neurons cultured with GM1 only.
A-D: Bars, 50 μm. E, F: Bars, 100 μm.
63
Supplementary Fig. 8: (A) Cleaved caspase 3 expression in adult canine dorsal root ganglia neurons grown in
medium only (control) or supplemented with GM1-ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or
nerve growth factor (NGF) at 2 days post seeding. Shown are individual values of 3 dogs and means. Note
reduced numbers of caspase 3-positive neurons incubated in medium supplemented with GM 1, FGF2, and NGF
compared to medium only. (B, C) Immunofluorescence double-labeling of canine DRG neurons with cleaved
caspase 3 (green) and non-phosphorylated neurofilament (nNF; red) grown in (B) NGF or (C) medium only.
Bars, 50 μm.
64
Supplementary Fig. 9: In vitro characterization of non-neuronal cells isolated from adult canine dorsal root
ganglia grown in medium only (control), GM1-ganglioside (GM1), fibroblast growth factor (FGF) 2, and/or nerve
growth factor (NGF) at 2 days post seeding. Shown are individual values of 3 dogs and means. Statistically
significant differences (p < 0.05) between growth conditions are marked with identical Arabic letters. (A) No
significant differences between growth conditions were observed for 2',3'-cyclic-nucleotide 3'phosphodiesterase (CNPase). (B) Reduced CNPase/glial fibrillary acidic protein (GFAP) co-expression results
from low numbers of GFAP-positive cells in FGF2 supplemented media. (C) Vimentin-positive bipolar shaped
cells and (D) growth-associated protein (GAP) 43 expression in non-neuronal cells were not influenced by
growth conditions.
65
Supplementary Fig. 10: (A, C, E) In vitro characterization of non-neuronal cells isolated from adult canine
dorsal root ganglia grown in medium only (control), GM 1-ganglioside (GM1), fibroblast growth factor (FGF) 2,
and /or nerve growth factor (NGF) at 2 days post seeding. Shown are individual values of 3 dogs and means.
Statistically significant differences (p < 0.05) between growth conditions are marked with identical Arabic
letters. (B, D, F) Immunofluorescence labeling of (B) S100, (D) sex-determining region Y-box (SOX) 2, and (F)
NTR
low affinity neurotrophin receptor (p75 ). Note few S100-positive cells, mainly found in association to
NTR
NTR
neurons, nuclear SOX2 expression, and single p75 -positive, spindle shaped cell (arrow). Numbers of p75
expressing non-neuronal cells were significantly decreased by FGF2 supplementation, an effect reversed by
GM1. Bars, 50 μm.
66
Neuroaxonal dystrophy in Spanish water dogs
3
67
Neuroaxonal dystrophy in Spanish water dogs as an in vivo model to
characterize pathomechanisms of inherited neurodegenerative disorders
in dogs
3.1
Tectonin beta-propeller repeat-containing protein 2 (TECPR2) missense mutation –
disturbances of the autophagy pathway associated with neuroaxonal dystrophy in
Spanish water dogs (submitted manuscript)
Hahn K*1,6, Rohdin C*2,7, Jagannathan V3, Wohlsein P1, Baumgärtner W1,6, Grandon R4,
Drögemüller C3,#, Jäderlund KH2,5#
*/# These authors contributed equally to this work
Author affiliations:
1
University of Veterinary Medicine Hannover, Department of Pathology, Hannover,
Germany
2
University Animal Hospital, Swedish University of Agricultural Sciences, Uppsala, Sweden
3
Institute of Genetics, Vetsuisse Faculty, University of Bern, Bern, Switzerland
4
Department of Biomedical Sciences and Veterinary Public Health, Division of Pathology,
Pharmacology and Toxicology, Swedish University of Agricultural Sciences, Uppsala,
Sweden
5
Department of Companion Animal Clinical Sciences, Norwegian University of Life Sciences,
Oslo, Norway
6
Center for Systems Neuroscience, Hannover, Germany
7
Anicura, Albano Small Animal Hospital, Danderyd, Sweden
Corresponding author:
[email protected]
68
Summary
Clinical, pathological and genetic examination revealed an uncharacterized juvenile-onset
neuroaxonal dystrophy (NAD) in Spanish water dogs. Affected dogs presented with various
neurological deficits including gait abnormalities, and behavioral deficits. Histopathology
demonstrated spheroid formation accentuated in the grey matter of cerebral hemispheres,
cerebellum, brain stem and the spinal cord sensory pathways. Iron accumulation was absent.
Ultrastructurally spheroids contained predominantly closely packed double-membrane
vesicles. The family history of the four affected dogs suggested an autosomal recessive
inheritance. SNP genotyping showed a single genomic region of extended homozygosity of
4.5 Mb in four cases on CFA 8. Linkage analysis revealed a maximal parametric LOD score of
2.5 at this region. By whole genome re-sequencing of one affected dog, a perfectly
associated single non-synonymous coding variant in the canine tectonin beta-propeller
repeat-containing protein 2 (TECPR2) gene affecting a highly conserved region was detected
(c.4009C>T or p.R1337W). This canine NAD form displays etiologic parallels to an inherited
TECPR2 associated type of human hereditary spastic paraparesis (HSP). In contrast to the
canine NAD, the spinal cord lesions in most types of human HSP involve the motor pathways.
Furthermore, the canine NAD form reveals similarities to cases of human NAD defined by
widespread spheroid formation without iron accumulation in the basal ganglia. Thus TECPR2
should also be considered as candidate for human NAD. The ultrastructural findings further
support the assumption, that TECPR2 regulates autophagosome accumulation in the
autophagic pathways. Consequently, the results presented emphasize the association of
autophagy impairments and neurodegeneration, provide the first genetic characterization of
a juvenile canine NAD form, and describe the previously unknown neuropathology
associated with a TECPR2 mutation.
69
Authors summary
Neuroaxonal dystrophies (NAD) comprise a heterogeneous group of neurodegenerative
diseases occurring in human and animal, characterized by prominent swellings of nerve
axons (spheroids). NAD was diagnosed in four closely related Spanish water dogs, also called
Perros de Agua Español, displaying various neurological deficits including gait abnormalities
and behavioral deficits. Genetic analysis identified a causative mutation in TECPR2 encoding
a WD repeat-containing protein. The TECPR2 protein participates in autophagy, a
physiological process of cellular “self-eating” to compensate energy deficits and to remove
damaged organelles by engulfment into vesicular structures (autophagosomes) followed by
further degradation. Cells undergoing permanent division are less sensible to disorders of
the autophagy pathway. Neurons are non-dividing cells with a high energy demand that
depend on autophagy. In human, a mutation in TECPR2 was suggested to cause an inherited
movement disorder clinically dominated by limb spasticity designated as hereditary spastic
paraparesis (HSP) 49. The study provides a well characterized large animal model for human
HSP and NAD disorders of unknown etiology.
Introduction
Neuroaxonal dystrophies (NAD) in humans and animals represent a group of heterogeneous
inherited neurodegenerative conditions with clinical and pathological overlapping features
[1], [2]. Although they all share the characteristic pathologic feature, i.e. the development of
spheroids, there is variation in clinical neurological manifestation, progression of the disease
and lesion distribution between, but also within, species. Besides presenting as a primary
central nervous system disorder, NAD like findings may occur associated with aging and
secondary to several metabolic-toxic conditions [3]. The nomenclature of primary human
NADs is complex due to the classification of the subtypes according to i) historical
terminations, ii) underlying genetic mutations, iii) the presence or absence of iron
accumulations in the basal ganglia, or iv) the age of onset and clinical symptoms (Table S1).
The most frequent genetic associations for human NAD comprise the autosomal recessive
inherited mutations in pantothenate kinase 2 (PANK2), phospholipase A2, group VI
70
(PLA2G6), and chromosome 19 open reading frame 12 (C19orf12), whereas other types of
NAD are less frequent [5-7]. Recently, one X-linked variant associated with a mutation in the
autophagy related WD repeat domain 45 (WDR45) gene was reported, representing the first
direct link between the autophagy machinery and neurodegeneration [8]. However,
numerous idiopathic types of late infantile, juvenile, and adult NAD are genetically not
classified [9]. The histological hallmark of NAD is defined by localized axonal swellings
(spheroids) with distal axonal atrophy and secondary myelin degradation [9]. Spheroids
containing protein aggregations, membranous vesicular structures, mitochondria, and/or
neurofilaments are also found in amyotrophic lateral sclerosis, Huntington’s disease,
Alzheimer’s and familial Parkinson’s disease as well as human hereditary spastic paraparesis
(HSP) [10– 16]. In all these neurodegenerative conditions, impairment of autophagy is
discussed as a crucial pathomechanism [17].
Autophagy, which is part of normal cell homeostasis, is involved in the basal constitutive
turnover of cytosolic components and is activated by stress signals such as nutrient
starvation and oxidative stress. The first step in this process implies the sequestration of
damaged organelles, long-lived proteins, and protein aggregations into double-membrane
vesicles called autophagosomes. Fusion of autophagosome and lysosome provides further
degradation and subsequent release of amino acids and other molecules into the cytoplasm
[18]. Autophagy is especially important for the metabolic homeostasis of neurons as postmitotic cells with a high energy demand [17]. Due to genetic associations and corresponding
experimental studies, the relevance of this pathway and its implication as a therapeutic
target in the treatment of neurodegenerative diseases is a current topic in neuroscience.
Despite the reported occurrence of canine NAD in various breeds [2], up to now only one
form of canine NAD with fetal onset has been characterized at the molecular level [19]. The
affected gene encodes mitofusin 2 (MFN2), a protein mediating mitochondrial fusion but
also clearance of damaged mitochondria via selective autophagy. The present study reports
positional cloning of a TECPR2 missense mutation causing NAD in Spanish water dogs, with
evidence of disturbances of the neuronal autophagy pathway.
71
Results
Clinics and histopathology reveal an uncharacterized neuroaxonal dystrophy in dogs
Four Spanish water dogs presented with slowly progressing neurological signs starting
between six and eleven months of age. Owners reported gait abnormalities, behavioral
changes including dullness and nervousness (Video S1), and incontinence alone or in
combination with uncontrolled defecation. Neurologic examination further revealed mild
cerebellar signs, decreased to absent patellar reflexes as well as loss of muscle tone without
obvious muscle atrophy. Additionally, hypermetria of the thoracic limbs, compulsory pacing,
proprioceptive- and menace deficits, visual disturbances and nystagmus were seen in some
of the affected dogs. Based on the neurological examination, lesion localization was
multifocal in the nervous system. Complete blood count and chemistry profile were within
reference ranges. Analysis of the cerebrospinal fluid showed normal cell counts and protein
values. All affected dogs were euthanized at the owners request between 12 and 23 months
of age.
In all affected dogs, morphological findings were restricted to the central nervous system
(CNS). In the brain, neuronal loss and spheroid formation of variable degree was present
accentuated within the grey matter including cerebral hemispheres, cerebellum, and brain
stem. The lesions were most prominent and consistently found in the dorsolateral nuclei of
the brain stem, including the cuneate and vestibular nuclei and the nucleus of the spinal
tract of the trigeminal nerve. Sporadic spheroids were also present in the white matter of
the brain. In the spinal cord neuronal loss and/or spheroid formation was restricted to the
sensory pathways including the dorsal horn as well as the gracile and the cuneate funiculi.
The spheroids were characterized as demarcated nodular swellings with accumulations of a
finely granular eosinophilic material. Several spheroids displayed a central hypereosinophilic
target-like core structure (Figure 1A). Similar structural alterations were additionally
detected in few neurons associated with the soma (Figure 1B). Using Turnbull’s blue and
Prussian blue staining, no iron deposition was observed within the CNS. No spheroid
formation was observed in the peripheral nerves. Transmission electron microscopy of spinal
spheroids revealed a loss of myelin sheets. Spheroids composed predominantly of closely
72
packed accumulations of double membrane-bound vacuoles. These structures were defined
as autophagosomes and contained amorphous material of variable electron density or
organelles in various stages of degeneration (Figure 2).
Canine NAD maps to a 4.5 Mb region on CFA 8
To characterize a possible gene defect, blood samples from four affected dogs and 15
related dogs were collected (Figure 3). Both, female and male offspring were affected.
Parents of affected dogs showed no clinical signs of the disease. The four affected dogs
could be traced back to common ancestors (Figure 3). Therefore, the pedigree indicated a
monogenic autosomal recessive inheritance of NAD. Under this scenario the NAD affected
dogs were considered to be identical by descent (IBD) for the causative mutation and
flanking chromosomal segments. A homozygosity mapping approach was therefore applied
to determine the position of the mutation in the canine genome. More than 170 000 evenly
spaced SNPs of the four affected and 13 phenotypically healthy Spanish water dogs were
genotyped. The four cases were analyzed for extended regions of homozygosity with
simultaneous allele sharing. A total of four genomic regions were identified being IBD in the
genotyped cases. Only on CFA 8, in a region containing 288 SNP markers corresponding to a
4.47 Mb interval from 67.54 to 72.01 Mb all affected dogs were homozygous in contrast to
the 13 phenotypical healthy controls. The other three regions of shared homozygostiy
among the four cases were located on CFA 13, 25, and 32 and contained only 69, 55, and 3
SNPs corresponding to 0.88, 0.71, and 0.03 kb, respectively. For linkage analysis, the
pedigree was split into two sub-pedigrees because of inbreeding loops and missing DNA
samples. The estimated maximal parametric LOD score of 2.5 at 70 Mb on CFA 8 confirmed
the linkage of NAD to the candidate region identified before (Figure S1).
A TECPR2 missense mutation is associated with NAD in Spanish water dogs
A total of 58 genes and loci are annotated in the critical interval on CFA 8. To obtain a
comprehensive overview of all variants in the critical interval the whole genome of one NAD
affected Spanish water dog was sequenced. The recessive inheritance and the fatal effect of
73
the mutation suggested a loss of function mutation affecting the coding sequence of the
gene responsible for this type of NAD. Therefore, special emphasis was paid to variants
located within the coding sequences or within the splice sites of the annotated genes in the
targeted region of the canine genome. SNP and indel variants were characterized with
respect to the reference genome of a presumably non-affected Boxer (CanFam 3.1).
Additionally, the genotypes of the affected dog were aligned with 119 dog genomes of
various breeds that had been sequenced in the course of other ongoing studies. The
pedigree analysis and the large size of the IBD segment indicated a relatively young origin of
the mutation. Thus it was hypothesized that the mutant allele of the causative variant
should be completely absent in all other dog breeds except the Spanish water dogs. It was
considered unlikely that the mutant allele would have been introgressed into any other
breeds outside the Spanish water dog. Within the critical interval on CFA 8, 63 private
variants were noticed, of which only a single one was predicted to affect the coding
sequence of an annotated gene. Only the affected dog had the homozygous variant
genotype and all other 119 sequenced dogs carried the homozygous wildtype genotype. This
remaining private non-synonymous variant in the tectonin beta-propeller repeat-containing
protein 2 gene (TECPR2 c.4009C>T) was genotyped in larger cohorts of dogs including the
family members, unrelated controls of Spanish water dogs, and dogs of related breeds like
other Iberian dog breeds (Table 1). The TECPR2 variant remained perfectly associated with
the NAD phenotype in more than 250 Spanish water dogs. Within the family material, only
affected dogs were homozygous TT and available parents and grandparents were
heterozygous CT. The variant was absent from a selection of dogs from other breeds.
The NAD associated mutation does not affect TECPR2 expression but implicates an
impaired TECPR2 function
The NAD associated mutation in Spanish water dogs is located within the tectonin beta
propeller repeat domaine 6 of the TECPR2 protein (Figure 4A) resulting on protein level in an
exchange of the basic amino acid arginine against the nonpolar, aromatic tryptophan
(p.R1337W). Multiple species protein alignment showed that the wildtype residue at the
74
affected position is conserved across all known TECPR2 orthologs in vertebrates including
the zebrafish (Danio rerio; Figure 4B). Alignment with the related TECPR1 paralogs revealed
that the affected protein motive is highly conserved including the fruit fly paralog (Figure
4C). Software based analysis of the NAD associated TECPR2 amino acid exchange predicted
the mutation as destabilizing (PoPMuSiC) and highly damaging (PolyPhen 2), whereas no
effect on the secondary structure and disorder were supposed (NetTurnP, NetSurfP, CFSSP,
Phyre 2). Obviously, the NAD associated mutation did not influence the TECPR2 expression
in neurons and glial cells of the CNS as determined by immunohistochemistry in comparison
to an unaffected, age-matched Beagle dog (Figure 1C-F).
Discussion
The successful positional cloning study identified a missense mutation in TECPR2 as highly
likely cause for a previously unknown juvenile-onset form of canine NAD in Spanish water
dogs. The affected TECPR2 protein is involved in the autophagy pathway, whose function is
largely unknown [20], [21]. A recent study described a TECPR2 mutation causing hereditary
spastic paraparesis (HSP) in humans, designated as SPG49 [20]. Human patients displaying a
TECPR2 mutation were presented with hypotonia during their second year of life and some
individuals developed a progressive spasticity until the end of the first decade of life [20].
Histopathology of the human SPG49 patients was only performed from muscle biopsies that
were unremarkable similar to the absence of lesions in the muscles from NAD affected dogs
[20]. Clinically diseased dogs displayed ataxia and paresis characterized by loss of muscle
tone and decreased to absent patellar reflexes with no signs of spasticity or muscle atrophy.
The distribution of the pathologic lesions was widespread in the CNS and involvement of the
afferent pathways in the spinal cord was consistent with the clinical picture indicating
predominantly sensory deficits (Figure 5). However, all affected dogs in this study were
euthanized and the natural progression of NAD in the Spanish water dog needs to be further
studied and characterized The neuropathology of SPG 49 patients is not yet described.
However, in the spinal cord of different murine HSP and various types of human HSP autopsy
cases, lesions were consistently found in the descending, motor pathways [16]. The loss of
motor signal transmission from the brain to the body periphery via the pyramidal tract and
75
the spinal cord ventral horn neurons results in motor signs and pyramidal symptoms,
respectively, as muscle weakness and/or spasticity due to increased vigor of spinal reflexes
[16] (Figure 5).
Interestingly, clinical findings and spinal cord lesions corresponding to NAD affected Spanish
water dogs have been described in other human disorders. Especially one case report of
NAD with disease onset at 18 month of age, clinical symptoms as tetraparesis, hyporeflexia
and visual disturbances, resembles the NAD in Spanish water dogs [22]. Histopathology
revealed absence of iron accumulations, spheroid formation accentuated in the brain stem
and spinal cord, restricted to the dorsal horns, whereas peripheral nerves were
unremarkable [22]. The genetic association of this case is unknown. Consequently, TECPR2
might represent a potential candidate for late infantile or juvenile cases of NAD in humans
that are not associated with a mutation in PLA2G6 and are characterized by the lack of iron
accumulations, absence or progressive development of spasticity, visual disturbances and
absence of peripheral nerve lesions. In this regard, it has to be considered that PLA2G6
associated NAD involves the dorsal and ventral horns of the spinal cord as well as peripheral
nerves, as demonstrated in humans and murine PLA2G6 models [23-25].
Except of cases with underlying PLA2G6 mutations the accumulation of iron in defined brain
regions is frequently present in human NAD [26]. Iron deposition was not reported in SPG49
patients comparable to NAD affected Spanish water dogs [20]. In humans, it is suggested
that iron deposition may be lacking in the early phase of neurodegeneration with brain iron
accumulation (NBIA) [1], [27]. Similarly, due to the early euthanasia of the NAD affected
Spanish water dogs aged between 1 and 2 years, an iron deposition in later stages of the
disease cannot be excluded. Recently, a novel NBIA type associated with a mutation in
WDR45 was reported and defined as “beta-propeller protein-associated neurodegeneration
(BPAN)” [8], [28]. The WDR45 protein possesses such as TECPR2 an N-terminal WD domain
and is suggested to regulate autophagosome accumulation [29]. Necropsy of a BPAN patient
revealed large numbers of spheroids and prominent iron deposits [28]. The presence of
spheroids implicating axonal degeneration and the absence of iron deposits in NAD affected
Spanish water dogs and also Atg7 knock-out mice [30] suggests that the iron deposits
represent a secondary event in autophagy related neurodegeneration.
76
On the molecular level, SPG49 was associated with a single base deletion within exon 16 of
TECPR2 that introduces a frame shift, results in a premature stop codon and leads to
subsequent proteasomal degradation of the truncated protein [20]. In neurons and glial cells
from NAD affected Spanish water dogs, no obvious difference in TECPR2 expression was
observed compared to a control animal. Furthermore, TECPR2 accumulations were not
detected in spheroids. This finding suggests that the neuropathology, especially the axonal
swellings and vacuolar accumulations, was not the consequence of axonal or somatic
TECPR2 aggregations, but result from deficits in TECPR2 function. The functional relevance of
the arginine residue mutated in canine NAD is supported by its evolutionary high
interspecies conservation, even in the non-vertebrate paralog TECPR1. Similar to TECPR1,
TECPR2 was suggested to regulate autophagosome maturation and accumulation [31], [21],
[20]. Spheroids in NAD affected Spanish water dogs contained high proportions of vesicles
with a double-layered membrane. These structures defined as autophagosomes, support
that TECPR2 regulates autophagosome accumulation also in neurons. In general, this finding
may result from increased autophagosome production, disturbances of vesicle transport
and/or impairments of autophagosome fusion with late endosomes or lysosomes (Figure 6).
TECPR1 was demonstrated to provide autophagosome-lysosome fusion [31]. However, in
neurons the fusion between autophagosomes and lysosomes is suggested to occur in the
soma [32]. Histology of NAD affected Spanish water dogs identified primary axonal lesions,
whereas only few neuronal cell bodies were affected. Consequently, disturbed
autophagosome-lysosome fusion seems not the main pathomechanism in TECPR2 mutation
associated autophagosome accumulation. Additionally, neuronal loss and spheroid
formation were restricted to specific brain and spinal cord localizations. This finding
indicates that specific neuronal subpopulations depend on TECPR2 function or autophagy in
general, whereas compensatory mechanisms may exist in other neurons.
NAD and HSP both represent neurodegenerative diseases with overlapping clinical and
histopathological features. A distinct classification without knowledge of the underlying
genetics remains challenging [1]. After the identification of WDR45 mutations linking
autophagy and neurodegeneration, the association of other NAD or HSP related genes
including SPG11, SPG15, and SPG60 was demonstrated [8], [34-36]. Further NAD and HSP
77
associated genes encode proteins involved in mitochondrial and lipid metabolism, axonal
transport, endoplasmatic reticulum (ER) morphology, ER protein quality control, ERassociated protein degradation as well as endosome or membrane trafficking and vesicle
formation [7], [16]. Interestingly, all these pathways are closely linked to autophagy (Figure
6) [37-41]. Therefore, autophagy modulation has to be anticipated for numerous other NAD,
NBIA, and especially SPG associated genes. Thus, HSP and NAD pathogenesis may primary
involve disturbances of different subcellular compartments, which generally affect the
autophagy pathway. Consequently, the analysis of the functions of NAD, NBIA, and SPG
associated proteins as well as their interactions might provide critical clues for a deeper
understanding of neuronal autophagy and autophagy associated neurodegeneration.
Summarized, a disease causing mutation in the canine TECPR2, a known human HSP
associated gene, was identified as the highly likely cause of NAD in Spanish water dogs. In
addition, TECPR2 may represent a suitable candidate for canine and human NAD cases with
unknown genetic etiology. However, the identification of new NAD and HSP candidate genes
enables an early diagnosis but therapy is still restricted to symptomatic and palliative
treatments. This study shows that the identification of disease associated mutations in dogs
adds valuable insights into the understanding of specific pathomechanisms of similar
diseases in humans. Especially the length of the canine axon makes dogs more suitable for
human comparative studies in comparison to mice. Therefore, NAD affected Spanish water
dogs represent a valuable large animal model enabling not only detailed studies on TECPR2
function but also on the relevance of autophagy in neuronal maintenance.
Materials and Methods
Ethics Statement
Affected Spanish water dogs were examined with the consent of their owners and under
ethical approval from the Uppsala Animal Experiment Ethics Board, Sweden. The tissue of
the control Beagle dog used for immunohistochemistry derived from the archive of the
Department of Pathology, University of Veterinary Medicine Hannover, Germany.
78
Clinical characterization of NAD
Three affected dogs underwent a complete neurological examination according to
standardized protocols by a veterinary neurologist because of gait abnormalities, behavioral
changes, and incontinence with an insidious onset between six and eleven months of age.
The forth dog was examined by another veterinarian; however a video-recording showing
the dogs gait was available for evaluation. A complete blood count and chemistry profile
were analysed in all affected dogs. A cerebrospinal fluid sample was collected from the
cisterna magna in two of the affected dogs. One dog was anesthetized with propofol
intravenously for inspection of the vocal folds. Due to the progression of clinical signs
affected dogs were euthanized within a few months to over a year after clinical signs
became obvious to the owners.
Pathological examination
Complete necropsies were performed of three affected dogs. In the fourth case, only the
brain was available for examination. Pathological examination was performed according to
standardized procedures at the Department of Pathology, Pharmacology and Toxicology,
Swedish University of Agricultural Sciences, Uppsala. Representative samples of all organs
and tissues were collected, fixed in 10% neutral buffered formalin, and routinely processed
in paraffin wax. Five µm thick tissue sections were stained with haematoxylin and eosin.
Electron microscopy
For transmission electron microscopy, sections of formalin fixed cervical spinal cord and
brain stem were fixed for 24 h in 2.5% glutaraldehyde solution, rinsed with 0.1% sodium
cacodylate buffer (pH 7.2), postfixed in 1% osmium tetroxide, and embedded in EPON 812
(Serva) as described (Bock et al., 2013). Sections were stained with lead citrate and uranyl
acetate and investigated using an EM 10c (Carl Zeiss Jena GmbH).
79
Immunohistochemistry
Immunohistochemistry was performed as described [42] on formalin-fixed, paraffinembedded tissue sections using a human TECPR2 specific antibody (HPA000658; SigmaAldrich, dilution 1:50 in PBS). To block endogenous peroxidase tissue sections were treated
with 0.5% H2O2 diluted in 80% ethanol, heated in sodium citrate buffer, and incubated with
20% goat serum to block non-specific binding sites. Subsequently, sections were incubated
with the TECPR2 antibody overnight at 4°C. Control sections were incubated with normal
rabbit serum (R4505; Sigma Aldrich). Biotinylated goat-anti-rabbit IgG (BA-1000; Vector
Laboratories; dilution: 1:200) was used as secondary antibody. As detection system, the
avidin-biotin-peroxidase complex (ABC) method (Vector Laboratories) was applied using 3,3′diamino-benzidine tetrahydrochloride (DAB) as chromogen. Sections were slightly
counterstained with Mayer's hematoxylin and mounted
Animals
Blood samples from four NAD affected Spanish water dogs, their healthy littermates (n= 9),
sires (n=2), dams (n=3), a single grand sire, as well as of 234 unrelated control dogs of this
breed were collected. Genomic DNA was isolated from blood using the Nucleon Bacc2 kit
(GE Healthcare) and the DNeasy blood and tissue kit (Qiagen) according to manufacturer
instructions. DNA samples of phenotypically related dog breeds like Barbet (n= 20), Briard
(n=5), Cão da Serra de Aires (n= 15), Cão de Água Português (Portuguese Waterdog) (n= 3),
Lagotto Romagnolo (n= 67), Standard Poodles (n = 12), as well as 146 control dogs of various
other breeds were collected during the course of other research projects at the Institute of
Genetics, University of Bern, Switzerland.
Genetic mapping
Genomic DNA from four cases and thirteen related phenotypically healthy dogs was
genotyped on the Illumina CanineHD BeadChip containing more than 170,000 evenly spaced
and validated SNPs derived from the CanFam3.1 assembly. To identify extended
80
homozygous regions with allele sharing across cases and controls, the following PLINK
software commands were used:--maf 0, --max-maf 1.0, --geno 0.01, --hwe 0, --mind 0.15, -homozyg, --homozyg-match 1, --homozyg-group [43]. All given positions correspond to the
CanFam3.1 genome assembly. Multipoint parametric linkage analyses were performed with
MERLIN software version 1.1.2 [44]. For parametric linkage, LOD scores were calculated
under both, homogeneity and heterogeneity, under the assumption of NAD segregating as a
biallelic autosomal recessive trait, with complete penetrance. The frequency of the disease
allele in the considered population is unknown and there is no data available that would
make it possible to estimate the frequency in a reliable manner. For the calculations a
frequency of 0.01 for the mutated allele was assumed.
Whole genome sequencing of one affected Spanish water dog
A standard fragment library was prepared with 300 bp insert size and one lane of illumina
HiSeq2000 paired-end reads (2×100 bp) was collected. 189 million 100 bp paired-end reads
were collected corresponding to roughly 10x coverage of the genome. The reads were
mapped to the dog reference genome using the Burrows-Wheeler Aligner (BWA) version
0.5.9-r16 with default settings [45]. PCR duplicates were labelled with Picard tools
(http://sourceforge.net/projects/picard/). Local realignment was performed using the
Genome Analysis Tool Kit (GATK version v2.3-6) to perform and to produce a cleaned BAM
file [46]. The genome data has been made freely available under accession no. PRJEB7903 at the
European Nucleotide Archive. Variant calls were then made with the unified genotyper module
of GATK. Variant data for each sample were obtained in variant call format (version 4.0) as
raw calls for all samples and sites flagged using the variant filtration module of GATK. Variant
calls that failed to pass the following filters were labelled accordingly in the call set: (i) Hard
to Validate MQ0 ≥4 & ((MQ0/(1.0 * DP)) >0.1); (ii) strand bias (low Quality scores) QUAL
<30.0 || (Quality by depth) QD <5.0 || (homopolymer runs) HRun >5 || (strand bias) SB
>0.00; (iii) SNP cluster window size 10. The snpEFF software [47] together with the CanFam
3.1 annotation was used to predict the functional effects of detected variants. The following
snpEFF
categories
of
variants
were
considered
as
non-synonymous:
NON_SYNONYMOUS_CODING,
81
CODON_DELETION,
CODON_CHANGE_PLUS_CODON_DELETION,
CODON_INSERTION,
CODON_CHANGE_PLUS_CODON_INSERTION,
FRAME_SHIFT, EXON_DELETED, START_GAINED, START_LOST, STOP_GAINED, STOP_LOST,
SPLICE_SITE_ACCEPTOR, SPLICE_SITE_DONOR.
Mutation analysis of canine TECPR2
Primers for the amplification of the TECPR2 variant (forward GACAGACGGACACCCTGTTC,
reverse
CAGATCCACCACCCTCAATC)
were
designed
with
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)
the
after
software
masking
Primer3
repetitive
sequences with RepeatMasker (http:// http://www.repeatmasker.org). For sequencing, a
490 bp PCR product was amplified using AmpliTaqGoldH360 DNA polymerase (Applied
Biosystems). The subsequent re-sequencing of the PCR products was performed after rAPid
alkaline phosphatase (Roche) and exonuclease I (New England Biolabs) treatment with the
ABI BigDye Terminator Sequencing Kit 3.1 (Applied Biosystems) on an ABI 3730 genetic
analyzer. Sequence data were analyzed with Sequencher 4.9 (GeneCodes).
Protein sequence analysis
Multiple
sequence
alignment
was
performed
with
ClustalW
(http://www.ebi.ac.uk/Tools/msa/clustalw2/). GeneBank accession numbers used for DNA,
RNA or protein alignments were: i) for TECPR2: NC_006590, XM_005623828.1 (canis lupus
familiaris), NP_055659.2 (homo sapiens), NP_001179619.1 (bos taurus), NP_001276439.1
(mus musculus), XP_006225935.1 (rattus norvegicus), XP_421376.4 (gallus gallus),
NP_001038644.1 (Danio rerio); ii) for TECPR1: XP_546986.4 (canis lupus familiaris),
NP_056210.1 (homo sapiens), XP_001256207.3 (bos taurus), NP_081686.1 (mus musculus),
NP_001032268.1 (rattus norvegicus), XP_004945159.1 (gallus gallus), XP_009304955.1
(Danio rerio), Peroxin-23: UniProtKB/Swiss-Prot: Q9VWB0.2 (Drosophila melanogaster).
Impact of the mutations on the protein stability and structure was predicted with the
following software tools: PolyPhen2 [48], NetTurnP [49], NetSurfP [50], the Chou&Fasman
82
secondary structure prediction server CFSSP [51] (Chou and Fasman, 1974), PoPMuSiC [52],
and Phyre2 [53].
Acknowledgments
The authors would like to thank Michèle Ackermann, Bettina Buck, Brigitta Colomb,
Michaela Drögemüller, Muriel Fragnière, Petra Grünig, Claudia Herrmann, Kerstin Rohn,
Kerstin Schöne, and Caroline Schütz for expert technical assistance. Doreen Becker, Tosso
Leeb, Leonardo Murgiano, and Natalie Wiedemar are acknowledged for helpful discussions.
We would like to express our appreciation to the University of Bern for the use of the Next
Generation Sequencing Platform in performing the whole genome re-sequencing
experiment and the Vital-IT high-performance computing centre of the Swiss Institute of
Bioinformatics for performing computationally intensive tasks (www.vital-it.ch/). The
authors would also like to thank all the dog owners and the Swedish Kennel Club for
donating samples and sharing pedigree data.
Author Contributions
Conceived and designed the experiments: CD, WB, PW, CR, KJ. Performed the necropsies:
RG. Performed and analyzed histology: PW, WB, KH. Analyzed the data: CD, KH, VJ. Wrote
the Paper: CD, KH.
83
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Schneider SA, Dusek P, Hardy J, Westenberger A, Jankovic J, et al. (2013) Genetics and
Pathophysiology of Neurodegeneration with Brain Iron Accumulation (NBIA). Curr
Neuropharmacol 11: 59-79.
Sisó S, Hanzlícek D, Fluehmann G, Kathmann I, Tomek A, et al. (2006)
Neurodegenerative diseases in domestic animals: a comparative review. Vet J 171: 2038.
Summers BA, Cummings JF, de Lahunta A (1995) Degenerative diseases of the central
nervous system. In: Summers BA, Cummings F, de Lahunta A, editors. Veterinary
Neuropathology. New York, Mosby. pp. 315-317.
Zhou B, Westaway SK, Levinson B, Johnson MA, Gitschier J, et al. (2001) A novel
pantothenate kinase gene (PANK2) is defective in Hallervorden-Spatz syndrome. Nat
Genet 28: 345-349.
Morgan NV, Westaway SK, Morton JE, Gregory A, Gissen P, et al. (2006) PLA2G6,
encoding a phospholipase A2, is mutated in neurodegenerative disorders with high
brain iron. Nat Genet 38: 752-754.
Hartig MB, Iuso A, Haack T, Kmiec T, Jurkiewicz E, et al, (2011) Absence of an orphan
mitochondrial protein, c19orf12, causes a distinct clinical subtype of neurodegeneration
with brain iron accumulation. Am J Hum Genet 89: 543-550.
Levi S, Finazzi D (2014) Neurodegeneration with brain iron accumulation: update on
pathogenic mechanisms. Front Pharmacol 5: 99.
Haack TB, Hogarth P, Kruer MC, Gregory A, Wieland T, et al. (2012) Exome sequencing
reveals de novo WDR45 mutations causing a phenotypically distinct, X-linked dominant
form of NBIA. Am J Hum Genet 91: 1144-1149.
Lowe JS, Leigh N (2002) Disorders of movement and system and degeneration. In:
Graham DI, Lantos PL, editors. Greenfield’s Neuropathology. New York: Oxford
University press. p. 390.
Bouley DM, McIntire JJ, Harris BT, Tolwani RJ, Otto GM, et al. (2006) Spontaneous
murine neuroaxonal dystrophy: a model of infantile neuroaxonal dystrophy. J Comp
Pathol 134: 161-170.
Xiao S, McLean J, Robertson J (2006) Neuronal intermediate filaments and ALS: a new
look at an old question. Biochim Biophys Acta 1762: 1001-1012.
Inoue M, Yagishita S, Itoh Y, Koyano S, Amano N, et al. (1996) Eosinophilic bodies in the
cerebral cortex of Alzheimer's disease cases. Acta Neuropathol 92: 555-561.
Wirths O, Weis J, Kayed R, Saido TC, Bayer TA (2007) Age-dependent axonal
degeneration in an Alzheimer mouse model. Neurobiol Aging 28: 1689-1699.
84
14. Marangoni M, Adalbert R, Janeckova L, Patrick J, Kohli J, et al., (2014) Age-related axonal
swellings precede other neuropathological hallmarks in a knock-in mouse model of
Huntington's disease. Neurobiol Aging 35: 2382-2393.
15. Halliday GM, Holton JL, Revesz T, Dickson DW (2011) Neuropathology underlying clinical
variability in patients with synucleinopathies. Acta Neuropathol 122: 187-204.
16. Fink JK. (2013) Hereditary spastic paraplegia: clinico-pathologic features and emerging
molecular mechanisms. Acta Neuropathol 126: 307-328.
17. Nixon RA. (2013) The role of autophagy in neurodegenerative disease. Nat Med 19: 983997.
18. Luzio JP, Pryor PR, Bright NA (2007) Lysosomes: fusion and function. Nat Rev Mol Cell
Biol 8: 622-632.
19. Fyfe JC, Al-Tamimi RA, Liu J, Schäffer AA, Agarwala R, et al. (2011) A novel mitofusin 2
mutation causes canine fetal-onset neuroaxonal dystrophy. Neurogenetics 12: 223-232.
20. Oz-Levi D, Ben-Zeev B, Ruzzo EK, Hitomi Y, Gelman A, et al. (2012) Mutation in TECPR2
reveals a role for autophagy in hereditary spastic paraparesis. Am J Hum Genet 91:
1065-1072.
21. Behrends C, Sowa ME, Gygi SP, Harper JW (2010) Network organization of the human
autophagy system. Nature 466: 68-76.
22. Cowen D., Olmstead EV (1963) Infantile neuroaxonal dystrophy. J Neuropathol Exp
Neurol 22: 175-236.
23. Shinzawa K, Sumi H, Ikawa M, Matsuoka Y, Okabe M, et al. (2008) Neuroaxonal
dystrophy caused by group VIA phospholipase A2 deficiency in mice: a model of human
neurodegenerative disease. J Neurosci 28: 2212-2220.
24. Wada H, Yasuda T, Miura I, Watabe K, Sawa C, et al. (2009) Establishment of an
improved mouse model for infantile neuroaxonal dystrophy that shows early disease
onset and bears a point mutation in Pla2g6. Am J Pathol 175: 2257-2263.
25. Gregory A, Kurian MA, Maher ER, Hogarth P, Hayflick SJ (2008) PLA2G6-Associated
Neurodegeneration. In: Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, et al.
editors. GeneReviews®[Internet]. Seattle: University of Washington. Accessed 12.
December 2014.
26. Colombelli C, Aoun M, Tiranti V (2014) Defective lipid metabolism in neurodegeneration
with brain iron accumulation (NBIA) syndromes: not only a matter of iron. J Inherit
Metab Dis: in press.
27. Kurian MA, Morgan NV, MacPherson L, Foster K, Peake D, et al. (2008) Phenotypic
spectrum of neurodegeneration associated with mutations in the PLA2G6 gene (PLAN).
Neurology 70: 1623–1629.
85
28. Hayflick SJ, Kruer MC, Gregory A, Haack TB, Kurian MA, et al. (2013) β-Propeller proteinassociated neurodegeneration: a new X-linked dominant disorder with brain iron
accumulation. Brain 136: 1708-1717.
29. Saitsu H, Nishimura T, Muramatsu K, Kodera H, Kumada S, et al. (2013) De novo
mutations in the autophagy gene WDR45 cause static encephalopathy of childhood with
neurodegeneration in adulthood. Nature Genet 45: 445-449.
30. Komatsu M, Wang QJ, Holstein GR., Friedrich VL, Iwata J, et al. (2007) Essential role for
autophagy protein Atg7 in the maintenance of axonal homeostasis and the prevention
of axonal regeneration. Proc Natl Acad Sci USA 104: 14489–14494.
31. Chen D, Fan W, Lu Y, Ding X, Chen S, et al. (2012) A mammalian autophagosome
maturation mechanism mediated by TECPR1 and the Atg12-Atg5 conjugate. Mol Cell 45:
629-641.
32. Lee S, Sato Y, Nixon RA (2011) Lysosomal proteolysis inhibition selectively disrupts
axonal transport of degradative organelles and causes an Alzheimer's-like axonal
dystrophy. J Neurosci 31: 7817-7830.
33. Khundadze M, Kollmann K, Koch N, Biskup C, Nietzsche S, et al. (2013) A hereditary
spastic paraplegia mouse model supports a role of ZFYVE26/SPASTIZIN for the
endolysosomal system. PLoS Genet 9: e1003988.
34. Vantaggiato C, Clementi E, Bassi MT (2014) ZFYVE26/SPASTIZIN: a close link between
complicated hereditary spastic paraparesis and autophagy. Autophagy 10: 374-375.
35. Chang J, Lee S, Blackstone C (2014) Spastic paraplegia proteins spastizin and spatacsin
mediate autophagic lysosome reformation. J Clin Invest: in press.
36. Novarino G, Fenstermaker AG, Zaki MS, Hofree M, Silhavy JL, et al. (2014) Exome
sequencing links corticospinal motor neuron disease to common neurodegenerative
disorders. Science 343: 506-511.
37. Filomeni G, De Zio D, Cecconi F (2014) Oxidative stress and autophagy: the clash
between damage and metabolic needs. Cell Death Differ: in press.
38. Settembre C, Ballabio A (2014) Lysosome: regulator of lipid degradation pathways.
Trends Cell Biol 24: 743-750.
39. Lebrand C, Corti M, Goodson H, Cosson P, Cavalli V, et al. (2002) Late endosome motility
depends on lipids via the small GTPase Rab7. EMBO J 21: 1289-1300.
40. Deegan S, Saveljeva S, Gorman AM, Samali A (2013) Stress-induced self-cannibalism: on
the regulation of autophagy by endoplasmic reticulum stress. Cell Mol Life Sci 70: 24252441.
41. Lamb CA, Dooley HC, Tooze SA (2013) Endocytosis and autophagy: Shared machinery for
degradation. Bioessays 35: 34-45.
86
42. Seehusen F, Baumgärtner W (2010) Axonal pathology and loss precede demyelination
and accompany chronic lesions in a spontaneously occurring animal model of multiple
sclerosis. Brain Pathol 20: 551-559.
43. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, et al. (2007) PLINK: a tool set
for whole-genome association and population-based linkage analyses. Am J Hum Genet
81: 559-575.
44. Abecasis GR, Cherny SS, Cookson WO, Cardon LR (2002) Merlin-rapid analysis of dense
genetic maps using sparse gene flow trees. Nat Genet 30: 97-101.
45. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler
transform. Bioinformatics 25: 1754–1760.
46. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, et al. (2010) The genome
analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing
data. Genome Res 20: 1297-1303.
47. Cingolani P, Platts A, Coon M, Nguyen T, Wang L, et al. (2012) A program for annotating
and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the
genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 6: 80-92.
48. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, et al. (2010) A method
and server for predicting damaging missense mutations. Nat Methods 7: 248–249.
49. Petersen B, Petersen TN, Andersen P, Nielsen M, Lundegaard C (2009) A generic method
for assignment of reliability scores applied to solvent accessibility predictions. BMC
Struct Biol 9: 51.
50. Petersen B, Lundegaard C, Petersen TN (2010) NetTurnP--neural network prediction of
beta-turns by use of evolutionary information and predicted protein sequence features.
PLoS One 5: e15079.
51. Chou PY, Fasman GD (1974) Prediction of protein conformation. Biochemistry 13: 222345.
52. Dehouck Y, Kwasigroch JM, Gilis D, Rooman M (2011) PoPMuSiC 2.1: a web server for
the estimation of protein stability changes upon mutation and sequence optimality.
BMC Bioinformatics 12: 151.
53. Kelley LA, Sternberg MJE (2009) Protein structure prediction on the web: a case study
using the Phyre server. Nat Protocols 4: 363–371.
87
Tables:
Table 1. Association of the TECPR2 missense mutation with the NAD phenotype in Spanish water dogs.
TECPR2 (c.4009C>T)
CC
CT
TT
Spanish water dog (Perro de Agua
Español)
Cases
4
Relatives
3
12
Controls
220
14
Related dog breeds
Barbet
20
Briard
5
Cão da Serra de Aires
15
Portugese Waterdog (Cão de Água
Português)
3
Lagotto Romagnolo
67
Standard Poodle
13
Other breeds
146
Total
419
26
4
88
Figures:
Figure 1:
Figure 1. Histology and TECPR2 immunohistochemistry of NAD in Spanish water dogs. (A, B) Histology of the
brain stem (cuneate nucleus) stained with hematoxylin and eosin revealed numerous large granular axonal
swellings (spheroids; arrow). Note the hypereosinophilic central target-like core structure of distinct spheroids
(A). Single neurons displayed an accumulation of a finely or coarse granular, intensely eosinophilic material
associated with the soma (arrow) displacing the Nissl substance. A high proportion of neurons adjacent to
affected areas was displayed a normal morphology with equally distributed Nissl substance (arrowhead, B). (CF) TECPR2 immunohistochemistry of the spinal cord using the avidin-biotin-peroxidase complex method, the
chromogen 3,3′-diamino-benzidine tetrahydrochloride, and Mayer's hematoxylin as counterstain. In the NAD
affected dogs TECPR2 was detected in axons and glial cells of the white matter, whereas spheroids were
negative or weakly positive (C). TECPR2 expression was also detected in neurons in the grey matter of affected
dogs (D). Similar expression patterns were found in an age-matched Beagle dog in the spinal white matter (E)
and neurons (F). Bar: 20 µm. C-F: Nomarski differential interference-contrast optic.
89
Figure 2:
Figure 2. Transmission electron microscopy of spinal cord spheroids. Ultrastructurally, spheroids lacked
myelin sheaths and contained closely packed accumulations of membrane-bound vacuolar structures. High
numbers of vacuoles were rimmed by a double layered membrane and defined as autophagosomes. The
vacuoles contained amorphous material of variable electron density or organelles in various stages of
degeneration (insert). Bar: overview: 2 µm; insert 200 nm.
90
Figure 3:
Figure 3. Pedigree of the collected Spanish water dogs with NAD. Note the inbreeding loops and the likely
common ancestors appearing 8 to 9 generations ago. Only for the numbered animals DNA was available.
Affected animals are shown with black symbols; genotyped carriers of the causative mutation are indicated
with half-filled symbols; females are shown as circles and males as squares.
91
Figure 4:
Figure 4. TECPR2 domain structure and p.R1337W mutation associated with NAD in Spanish water dogs. (A)
TECPR2 possesses three N-terminal WD (tryptophan-aspartic-acid dipeptide) repeats (red), a polylysine tract
(green), and six C-terminal tectonin beta-propeller repeat (TECPR) domains (blue). (B+C) The arginine at
position 1337 that is substituted by a tryptophan residue is located in the sixth TECPR domain. Note that the
mutation affects a conserved amino acid residue in all known TECPR2 orthologs and the TECPR1 or Peroxin-23
paralog. Highly conserved residues are marked in red.
92
Figure 5:
Figure 5. Distribution of thoracical spinal cord spheroids in Spanish water dogs with NAD compared to mostly
affected areas in human hereditary spastic paraparesis (HSP). In NAD affected Spanish water dogs (left),
spheroids and neuronal loss were restricted to the sensory, ascending pathways localized to the grey matter of
the spinal cord dorsal horn and single large spheroids were detected within the cuneate and gracile fasciculus.
This might explain the clinical signs as gait disturbances, proprioceptive deficits, decreased spinal reflexes and
urinary incontinence. In other human forms of NAD, HSP and Plasg6 knock-out mice (right), descending motor
pathways including the ventral horns as well as in descending, lateral funiculi of the spinal cord white matter
were mainly affected. Spheroids were inconstantly found in the ascending spinocerebellar tracts. Note that
spinal cord histology of TECPR2 associated HSP in humans is unknown.
Ascending, sensory pathways (transmission of sensory signals from the periphery (red arrow) via dorsal horn
(DH) neurons towards the brain): Dorsal funiculus composing of gracile fasciculus (GF) and cuneate fasciculus
(CF); Spinocerebellar tracts with: dorsal spinocerebellar tract (DST) and ventral spinocerebellar tract (VST);
Descending, motor pathways (cross; signal transmission via the ventral horn (VH) neurons towards the
muscles; blue arrow): Pyramidal tracts with lateral corticospinal tract (LCT) and ventral corticospinal tract (VCT).
93
Figure 6:
Figure 6. The autophagy network and its impairment by mutant TECPR2 and involvement of subcellular
compartments associated with HSP and NAD pathogenesis. The autophagic flux depends on a network
involving the endocytic compartment, the Golgi apparatus, the endoplasmatic reticulum (ER) as well as the
cytoskeleton as the scaffold for vesicle transport. The function of TECPR2 in autophagy is poorly characterized,
but mutations are associated with hereditary spastic paraplegia in humans (SPG49) and autophagosome
accumulation. Autophagosome accumulation can result from increased phagophore production (orange
arrows) as well as impaired autophagosome fusion or transport (red arrows). Phagophores originate from
different membrane sources including the ER, the Golgi apparatus or early endosomes and fuse predominantly
with late endosomes to amphisomes. These fuse with lysosomes and form autophagolysosomes. Alternatively,
direct autophagosome-lysosome fusion may occur. Autophagic lysosome reformation that is impaired in SPG11
and SPG15 involves tubulation and vesiculation events for gradual removement of autophagosomal/endosomal
elements and transfer of newly synthesized lysosomal components via late endosomes. Many HSP and NAD
associated proteins are involved in mitochondrial and lipid metabolism, axonal transport, endoplasmatic
reticulum (ER) or Golgi morphology, ER protein quality control, ER-associated protein degradation as well as
endosome or membrane trafficking and vesicle formation. Consequently, NAD and HSP pathogenesis may
involve numerous molecular pathways that primary or secondary impair the autophagic flux. These include ATP
depletion, increased production of reactive oxygen species (ROS), calcium (Ca) release form mitochondria or
the ER, accumulation of misfolded proteins in the ER, ER associated protein degradation and amino acid
availability. All these factors modulate the autophagy key regulators mammalian target of rapamycin complex 1
(mTORC1) and AMP-activated protein kinase (AMPK).
94
Supporting information:
Video S1. Clinical presentation of a NAD affected Spanish water dog aged 23 months
Figure S1. Linkage analysis of NAD in Spanish water dogs. Graphical LOD score statistics for
NAD are shown per dog chromosome.
Table S1. Classification of inherited or idiopathic neuroaxonal dystrophies in humans.
Supplementary figures:
Figure S1: Linkage analysis of NAD in Spanish water dogs. Graphical LOD score statistics for NAD are shown per
dog chromosome.
95
96
97
98
99
100
101
102
Supplementary references:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Lowe JS, Leigh N (2002) Disorders of movement and system and degeneration. In:
Graham DI, Lantos PL, editors. Greenfield’s Neuropathology. New York: Oxford
University press. p. 390.
Kruer MC (2013) The neuropathology of neurodegeneration with brain iron
accumulation. Int Rev Neurobiol 110: 165-194.
Orphanet: an online database of rare diseases and orphan drugs. Copyright, INSERM
1997. Available at http://www.orpha.net Accessed (29 November 2014).
Hallervorden J, Spatz H (1922) Eigenartige Erkrankung im extrapyramidalen System
mit besonderer Beteiligung des Globus pallidus und der Substantia nigra. Z
Gesammte Neurolog Psychiatr 79: 254-302.
Gregory A, Polster BJ, Hayflick SJ (2009) Clinical and genetic delineation of
neurodegeneration with brain iron accumulation. J Med Genet 46: 73-80.
Levi S, Finazzi D (2014) Neurodegeneration with brain iron accumulation: update on
pathogenic mechanisms. Front Pharmacol 5: 99.
Gilman S, Barrett RE (1973) Hallervorden-Spatz disease and infantile neuroaxonal
dystrophy. Clinical characteristics and nosological considerations. J Neurol Sci 19:
189-205.
Schneider SA, Hardy J, Bhatia KP (2012) Syndromes of neurodegeneration with brain
iron accumulation (NBIA): an update on clinical presentations, histological and
genetic underpinnings, and treatment considerations. Mov Disord 27: 42-53.
Colombelli C, Aoun M, Tiranti V (2014) Defective lipid metabolism in
neurodegeneration with brain iron accumulation (NBIA) syndromes: not only a
matter of iron. J Inherit Metab Dis: in press.
Hogarth P, Gregory A, Kruer MC, Sanford L, Wagoner W et al. (2013) New NBIA
subtype: genetic, clinical, pathologic, and radiographic features of MPAN. Neurology
80: 268-275.
Kimura Y, Sato N, Sugai K, Maruyama S, Ota M, et al. (2013) MRI, MR spectroscopy,
and diffusion tensor imaging findings in patient with static encephalopathy of
childhood with neurodegeneration in adulthood (SENDA). Brain Dev 35: 458-461.
Saitsu H, Nishimura T, Muramatsu K, Kodera H, Kumada S, et al. (2013) De novo
mutations in the autophagy gene WDR45 cause static encephalopathy of childhood
with neurodegeneration in adulthood. Nat Genet 45: 445-449.
Wider C, Van Gerpen JA, DeArmond S, Shuster EA, Dickson DW, et al. (2009)
Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD).
A single entity? Neurology 72: 1953-1959.
14.
15.
16.
17.
18.
19.
20.
103
Kleinfeld K, Mobley B, Hedera P, Wegner A, Sriram S, et al. (2013) Adult-onset
leukoencephalopathy with neuroaxonal spheroids and pigmented glia: report of five
cases and a new mutation. J Neurol 260: 558-571.
Kinoshita M, Kondo Y, Yoshida K, Fukushima K, Hoshi K, et al. (2014) Corpus callosum
atrophy in patients with hereditary diffuse leukoencephalopathy with neuroaxonal
spheroids: an MRI-based study. Intern Med 53: 21-27.
Riku Y, Ando T, Goto Y, Mano K, Iwasaki Y, et al. (2014) Early pathologic changes in
hereditary diffuse leukoencephalopathy with spheroids. J Neuropathol Exp Neurol 73:
1183-1190.
Paloneva J, Kestilä M, Wu J, Salminen A, Böhling T, et al. (2000) Loss-of-function
mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts. Nat
Genet 25: 357-361.
Paloneva J, Manninen T, Christman G, Hovanes K, Mandelin J, et al. (2002)Mutations
in two genes encoding different subunits of a receptor signaling complex result in an
identical disease phenotype. Am J Hum Genet 71: 656-662.
Yang Y, Allen E, Ding J, Wang W (2007) Giant axonal neuropathy. Cell Mol Life Sci 64:
601-609.
Gordon N (2004) Giant axonal neuropathy. Dev Med Child Neurol 46: 717-719.
104
General discussion
4
105
General discussion
The first aim of the present study was to establish an in vitro system to cultivate adult canine
dorsal root ganglia (DRG) neurons and to investigate the impact of GM 1-ganglioside (GM1)
on cellular growth and differentiation. These experiments aimed to model the early phase of
GM1-gangliosidosis with a progressive increase of GM1 concentrations and its modulation by
nerve growth factor (NGF) and fibroblast growth factor (FGF) 2. Furthermore, the
hypothetical relevance of the observed effects in regard to the pathogenesis of other
neurodegenerative conditions in humans is discussed. The second part describes the clinical,
pathological, and genetic characterization of an inherited neuroaxonal dystrophy in Spanish
water dogs. This novel canine in vivo model of a genetic human disorder underlines the
relevance of the dog in translational neuroscience. In dog breeds with emerging inherited
diseases involving the nervous system cases, siblings, as well as related and unrelated
control animals and especially necropsy cases are available compared to idiopathic or
familial-associated central nervous system (CNS) diseases in humans. Consequently, detailed
workup including cell culture experiments of diseased and control animals according to
established protocols provides a valuable system to characterize gene functions and neuroglial pathomechanisms of inherited neurodegenerative diseases.
4.1
Adult canine dorsal root ganglia neurons as an in vitro model to study neuron-glia
interactions and GM1 and/or growth factor-mediated effects
As demonstrated in rodents, DRG neuronal cell cultures represent a valuable in vitro system
to study mechanisms and protective neuro- and gliotrophic effects in neurodegeneration.
Since protocols suitable for the isolation of adult canine DRG neurons have not been made
available so far, the preparation of adult canine DRG neuronal cell cultures was established
and optimized. The method was based on previously introduced procedures for the
preparation of adult rat DRG cultures (Grothe and Unsicker, 1987). Despite the use of higher
digesting enzyme concentrations and two subsequent Percoll centrifugation steps, the
fraction of non-neuronal cells in the canine culture preparations was higher compared to the
rat. Similar to the rodent model, myelin and connective tissue fragments were almost
106
General discussion
completely removed. NGF is crucial for survival of neonatal but not for adult rat sensory
neurons (Grothe and Unsicker, 1987; Acheson et al., 1995). Due to the lack of highly purified
cultures of adult canine DRGs, the mechanisms of NGF independency remain undetermined
so far. Principally, an autocrine production of brain-derived neurotrophic factor (BDNF) or
NGF provided by non-neuronal cells including satellite glial cells may explain the
independency from NGF supplementation (Acheson et al., 1995; Zhou et al., 1999). In
contrast to the upregulation of the low affinity neurotrophin receptor (p75 NTR) in DRG
explant cultures of adult rats, a downregulation of p75 NTR was observed in dissociated adult
canine DRG neurons (Zhou et al., 2005). This discrepancy may result from species-specific
differences between canine and rat DRG neurons. Furthermore, the down-regulation may be
related to different culture conditions such as the rapid proliferation of non-neuronal cells in
dissociated canine DRG cultures.
Alterations of the neuronal network, the cytoskeleton, and the glial cell differentiation
represent crucial aspects in the pathogenesis of GM 1-gangliosidosis and other hereditary
neurodegenerative diseases. Therefore, the second chapter of the present study focused on
the characterization of GM1, NGF, and FGF2-mediated effects on adult canine DRG neurons
and non-neuronal cells. Comparable studies using DRG culture models from rodents
revealed neurotrophic properties of GM1 that were enhanced by co-application of NGF
(Huang et al., 2007). Similarly, NGF and GM1 also enhanced neurite outgrowth in adult
canine DRG neurons associated with higher numbers of ßIII tubulin-, non-phosphorylated
neurofilament, microtubule-associated protein (MAP) 2-, and growth-associated protein
(GAP) 43-positive neuronal processes. The GM1 and NGF modulated neurotrophic effects are
suggested to result partially from GM1-mediated enhancement of NGF-tyrosine kinase
receptor signaling (Cuello et al., 1989). Lipid rafts as signaling platforms with a high density
of tyrosine kinase receptors are concentrated at synapses and are modulated by GM 1
(Hering et al., 2003; Limpert et al., 2007). However, influences of GM 1 on synaptic molecules
such as synaptophysin are not characterized yet. The experiments revealed that GM 1
especially in combination with NGF triggers synaptophysin accumulations in processes of
adult canine DRG neurons. Synaptophysin is a component of synaptic vesicles and
considered as a standard marker for synapses (Valtorta et al., 2004). Consequently, this
General discussion
107
effect might result from increased neurite length and arborization leading to an enlarged
contact area for synapse formation. Alternatively, synaptophysin accumulations might be
caused by a direct GM1-mediated effect on synaptic density as well as a forced endocytosis
and/or retrograde transport of synaptic vesicles or an enhanced anterograde transport.
Neurotrophin retrograde signaling and maintenance of synapses is completely dependent
upon the formation of signaling endosomes carried to the cell body by dynein (Heerssen et
al., 2004; Cosker et al., 2008). Similar to neurite outgrowth, NGF but not FGF2
supplementation increased the cytoplasmic expression of the transport protein dynein.
Therefore, an amplified binding, internalization, and retrograde transport of NGF receptors
by dynein might explain higher dynein levels in neuronal somata (Saxena et al., 2005).
Moreover, the formation of dynein accumulations seemed to be dependent on GM1. If these
accumulations represent a feature of neurite pathology or improved retrograde transport
has to be determined in future studies.
Glial cells have a strong impact on the physiological and pathological functions of neurons.
Consequently, neuron-glial cell interactions have to be included in the development of in
vitro models used in CNS and peripheral nervous system (PNS) research. NGF, FGF2, and
GM1 are known to influence morphology, growth factor production, differentiation and/or
proliferation of non-neuronal cells including satellite glial cells, macrophages, fibroblasts,
and Schwann cells. In regard to a pathomechanistic significance, the most relevant GM1
modulated effects on non-neuronal cells were observed in glutamine synthetase and GFAP
expression. In adult canine DRG cell cultures GM1 and NGF increased the percentage of
glutamine synthetase-positive cells, which might affect extracellular glutamate levels.
Glutamate-mediated neurotoxicity and impairment of glutamatergic neurotransmission are
involved
in
the pathomechanisms of
amyotrophic lateral sclerosis and other
neurodegenerative conditions with an inherited component (Willard and Koochekpour,
2013). Consequently, modulation of glutamate metabolism might partially explain the
beneficial treatment effects of GM1 in neurodegenerative diseases. Furthermore glutamatemediated effects were suggested to regulate the formation of ectopic neurites in GM 1gangliosidosis that might also be related to synaptophysin and/or dynein accumulations
(Walkley, 2007). The percentage of glial fibrillary acidic protein (GFAP)-positive cells was
108
General discussion
increased in cultures supplemented with FGF2 compared to GM1/FGF2 most likely due to the
antagonism of gangliosides and FGF2 (Rusnati et al., 1999). Similarly, GM1 treatment of adult
rats reduced the lesion-induced increase in GFAP content in the hippocampus (OderfeldNowak et al., 1993). Consequently, FGF2 seems to favor astrocytic differentiation of glial
cells, which might be inhibited by GM1. However, further studies are necessary to
characterize the influence of GM1 and growth factors on glial scar formation in different CNS
and PNS disorders.
In summary, these results support the use of adult canine DRGs as a valuable in vitro model
that might disclose detailed neuron-glia interactions with translational relevance. Moreover,
the present investigation confirms neurotrophic effects of GM 1 characterized by increased
neurite outgrowth and possibly enhanced synaptic density. In addition, GM 1 might
counteract FGF2-mediated glial scar formation and glutamate-mediated neurotoxicity. The
relevance of these observations for the molecular pathogenesis of the early phase of GM 1gangliosidosis, but also the potential therapeutic value for other neurodegenerative diseases
should be addressed in further studies.
4.2
Spontaneously occurring inherited CNS diseases in dogs as a translational in vivo
model to study pathomechanisms of neurodegeneration
The second part of the study demonstrates a positional cloning approach that identified a
missense mutation in the autophagy-associated tectonin beta-propeller repeat-containing
protein 2 (TECPR2) gene as the highly likely cause for a previously uncharacterized type of
NAD in Spanish water dogs. This breed specific canine disease represents a highly interesting
translational model. Recently, a TECPR2 mutation in humans was described causing
hereditary spastic paraparesis (HSP), designated as SPG49 (Oz-Levi et al., 2012). HSP is
defined as a clinico-genetic syndrome mainly characterized by bilateral lower extremity
weakness and spasticity. It is genetically associated with mutations in 72 genes (SPG1SPG72; Fink, 2013; Esteves et al., 2014; Novarino et al., 2014). The neuropathology of SPG49
patients is not characterized yet, but distal axon degeneration of descending corticospinal
tracts, transmitting motor signals from the brain to the body is often reported in
General discussion
109
postmortem examination of HSP patients. The current study revealed neuronal loss and
axonal spheroids in specific brain areas, the spinal cord dorsal horns, and to a lesser extend
in the gracile and cuneate funiculi. The spatial distribution of these lesions indicates that the
TECPR2 mutation in dogs results in disturbances of the ascending pathways, transmitting
sensory signals form the body periphery to the spinal cord. The neuropathological
manifestation of the canine TECPR2 mutation in the sensory tracts contrasts the common
involvement of motor pathways in HSP. These differences in morphology and perhaps
pathomechanism should be investigated in detail in further studies of these two genetically
related diseases.
In humans, genetically characterized as well as idiopathic types of infantile, late infantile,
and adult NAD are described, which are clinically similar to HSP. Interestingly, spinal cord
lesions and clinical findings resembling NAD affected Spanish water dogs were described in
humans and categorized as NAD with “widespread spheroid formation without excessive
abnormal pigment in the basal ganglia” (Gilman and Barrett, 1973). The underlying mutation
in these patients is unknown. Consequently, TECPR2 should be considered as an additional
candidate gene for NAD in humans.
The present study which identified an autophagy-related gene as a cause for canine
neuroaxonal dystrophy underlines the relevance of the autophagy pathway in
neurodegeneration. The neuropathology of the Spanish water dogs clearly indicates that
specific neuronal subpopulations depend on TECPR2 function or autophagy in general,
whereas compensatory mechanisms may exist in other neurons.
Recently, the involvement of several NAD or HSP-associated genes in the autophagy
pathway was reported including WDR45, SPG11, SPG15, and SPG60 (Haack et al., 2012;
Khundadze et al., 2013; Chang et al., 2014; Novarino et al., 2014; Vantaggiato et al., 2014).
Further NAD and HSP-related proteins are involved in mitochondrial and lipid metabolism,
axonal transport, ER morphology, ER protein quality control, ER-associated protein
degradation as well as endosome trafficking and vesicle formation (Fink, 2013; Levi and
Finazzi, 2014). Interestingly, all these pathways are closely linked to autophagy (Lebrand et
al., 2002; Settembre et al., 2008; Deegan et al., 2013; Lamb et al., 2013; Filomeni et al.,
2014). Therefore, autophagy modulation has to be anticipated as a primary or secondary
110
General discussion
pathomechanism for numerous other NAD, and especially HSP-associated genes.
Consequently, the targeted analysis of the encoded proteins as well as their interactions
might provide critical clues for a deeper understanding of neuronal autophagy. The length of
human and dog spinal axons is similar, in contrast to mice. Therefore, NAD affected Spanish
water dogs represent a valuable large animal model enabling not only detailed studies on
TECPR2 function but also on the relevance of autophagy as a crucial pathomechanism in
neuronal degeneration. In conclusion, this study shows that the identification of diseaseassociated mutations in dogs adds valuable insights into the understanding of specific
pathomechanisms of similar diseases in humans.
4.3
Concluding remarks
The structure and organization of the genome and the nervous system are similar to a large
extent in humans and dogs (Lindblad-Toh et al., 2005; Techangamsuwan et al., 2008; Omar
et al., 2011; Wewetzer et al., 2011). Furthermore, many inherited human neurodegenerative
diseases possess naturally occurring breed specific counterparts in the dog with
corresponding clinical, genetic, and neuropathological features defining the dog as a highly
interesting model in translational neuroscience. For example, the lysosomal storage disorder
GM1-ganglioidosis in the Alaskan Husky, but also other progressive neurodegenerative
conditions such as the canine degenerative myelopathy of several breeds modeling familial
amyotrophic lateral sclerosis (ALS) in humans were characterized in detail in a comparative
manner (Kreutzer et al., 2005; Kreutzer et al., 2008; Crisp et al., 2013). These studies
revealed numerous parallels in the molecular pathogenesis and neuropathology of the
human and canine diseases that also affect dorsal root ganglia neurons (Müller et al., 2001;
Kreutzer et al., 2005; Sasaki et al., 2007; Kreutzer et al., 2008; Suzuki and Suzuki; 2008; Crisp
et al., 2013; Morgan et al., 2014). Consequently, the established protocol for the cultivation
of adult canine DRGs enables basic studies of neurite and glia specific pathomechanisms in
vitro as well as its modulation by growth factors and pharmaceutical compounds. GM 1gangliosidosis and ALS were first described in humans and later in the dog. Vice versa, the
third part of the present study demonstrates that the genetic characterization of
General discussion
111
neurodegenerative diseases in dogs can identify genes and pathways relevant to
corresponding diseases in humans. The TECPR2-associated NAD in Spanish water dogs but
also GM1-gangliosidosis and ALS clearly define disturbances involving the endocytic,
autophagy,
and/or
the
lysosomal
pathway
as
a
crucial
pathomechanisms
in
neurodegeneration. To further characterize its molecular pathogenesis, canine diseases
including NAD in Spanish water dogs represent valuable translational models for advanced
clinico-pathologic and cell culture based studies.
112
General discussion
Summary
5
113
Summary
In vitro and in vivo characterization of pathomechanisms of inherited neurodegenerative
disorders in dogs
The relevance of the dog as a translational large animal model in neuroscience has
significantly increased recently. This is related to the similar organization of the canine and
human nervous system, and due to parallels in the genome structure. Furthermore, the
identification of canine models for human diseases is enabled by the targeted genetic
analysis of human disease-associated genes in dogs, displaying a similar clinical and
histologic phenotype. Moreover the genetic characterization of neurodegenerative diseases
in dogs can identify genes and pathways relevant to corresponding diseases in humans with
unknown background. The lysosomal storage disorder GM 1-ganglioidosis, was first described
in humans. The identification of the canine counterpart revealed numerous parallels in the
molecular pathogenesis and neuropathology to the human disease. Interestingly, GM 1gangliosidosis and numerous other inherited neurodegenerative conditions affect dorsal
root ganglia (DRG) neurons. Cell cultures of rodent or chicken DRGs have been widely used
to study the pathogenesis of neurodegenerative processes and its modulation by glia cells
and/or growth factors. Therefore the aims of the present study were (i) the establishment of
a canine DRG culture system and the evaluation of the modulatory effects of GM 1ganglioside (GM1) on neurons and glial cells and (ii) the clinical, genetic and pathological
characterization of an undescribed, inherited, neuroaxonal dystrophy (NAD) in Spanish
water dogs.
The establishment of a protocol suitable for the isolation and culture of adult canine DRG
neurons might provide an interesting in vitro model to study the pathogenesis of inherited
neurodegenerative diseases. A corresponding protocol was successfully established,
optimized, and used to characterize the impact of GM1 and/or the neurotrophins nerve
growth factor (NGF) and fibroblast growth factor (FGF) 2 on neurons and glial cells. GM 1
represents an important structural and functional component of intracellular membranes
and is especially found in high concentrations in neuronal cell membranes and the myelin.
114
Summary
Impairments of lysosomal GM1-degradation represent the initial pathomechanism of the
lysosomal storage disorder GM1-gangliosidosis. Furthermore, age-associated changes in
GM1-metabolism were suggested to play a role in synaptic and myelin pathology of
neurodegenerative conditions. These cell culture experiments revealed a GM 1- and NGFmediated increase in neurite outgrowth, which was associated with accumulations of
synaptophysin and dynein in neuronal processes. This indicates that GM1 has an impact on
synapse formation and the retrograde axonal transport. Moreover, GM1 and NGF increased
the percentage of glutamine synthetase-positive non-neuronal cells in adult canine DRG cell
cultures. Consequently, GM1 and NGF might affect extracellular glutamate levels, thus
influencing the formation of ectopic neurites in GM1-gangliosidosis. The percentage of glial
fibrillary acidic protein (GFAP)-positive cells was increased in cultures supplemented with
FGF2 compared to incubation with GM1/FGF2. Thus, FGF2 seems to favor astrocytic
differentiation of glial cells, which might be inhibited by GM 1. This might be pivotal to
modulate astrogliosis and glial scar formation. Nevertheless, the relevance of these results in
human and canine neurodegeneration has to be confirmed in further studies.
The second part of the study implied the clinical, genetic and pathological characterization of
an inherited NAD in Spanish water dogs to evaluate the relevance of this breed-specific
disease as a translational model for human NAD. Genetic analysis revealed a mutation in the
tectonin beta-propeller repeat-containing protein 2 (TECPR2) gene as a highly likely cause for
NAD in Spanish water dogs. This type of canine NAD displays clinical and etiologic parallels to
one form of recessive inherited human hereditary spastic paraparesis designated as SPG49.
Distal axon degeneration of descending motor tracts of the spinal cord is often reported in
postmortem examinations of HSP patients. Interestingly, the spinal cord histology of the
canine TECPR2 associated NAD was characterized by neuronal loss and axonal spheroids in
the sensory pathways. This finding correlates with the histology of human NAD cases of
unknown genetics. Consequently, NAD in Spanish water dogs and the characterization of the
underlying mutation in TECPR2 identified a potential candidate gene for human NAD.
TECPR2 represents a functionally a poorly characterized protein of the autophagy pathway.
The further characterization of DRG cultures of affected and control animals represents a
highly interesting system to further study TECPR2 function.
Summary
115
Summarized, the current study provides further evidence that disturbances of the
autophagosomal and lysosomal pathway represent a crucial pathomechanism in
neurodegeneration that can be studied using canine cell culture and in vivo models.
116
Summary
Zusammenfassung
6
117
Zusammenfassung
In vitro und in vivo Charakterisierung der Pathomechanismen von erblichen,
neurodegenerativen Erkrankungen des Hundes
In letzter Zeit gewinnt die Spezies Hund bezüglich der Verwendung als translationales Modell
in der Neurowissenschaft zunehmend an Bedeutung. Dies resultiert aus Parallelen in der
Organisation des kaninen und humanen Nervensystems sowie des Genoms. Darüber hinaus
ermöglicht die Charakterisierung von Genen, die bekanntlich mit dem Auftreten definierter
Krankheiten beim Menschen assoziiert sind, die Klassifizierung korrespondierender
Erkrankungen des Hundes. Diese können dann als Tiermodell für die Erforschung der
humanen Erkrankung verwendet werden. Zudem ermöglicht die Charakterisierung erblicher
Erkrankungen des Hundes die Identifizierung von neuen Genen. Diese stellen
möglicherweise potentielle Kandidatengene für Erkrankungen des Menschen dar, deren
genetischer Hintergrund bisher unbekannt ist. Die lysosomale Speicherkrankheit GM1Gangliosidose wurde erstmals bei Menschen beschrieben. Anhand der detaillierten
Untersuchung entsprechender Hundemodelle wurde gezeigt, dass viele Parallelen in der
molekularen Pathogenese und Neuropathologie bei der kaninen und humanen Erkrankung
bestehen. GM1-Gangliosidose und zahlreiche weitere neurodegenerative Erkrankungen mit
erblicher Komponente manifestieren sich unter anderem in den Neuronen der
Dorsalwurzelganglien. Kulturen von Dorsalwurzelganglien von Nagern oder Hühnern stellen
ein etabliertes System dar, das seit langem für die Erforschung der Pathogenese
neurodegenerativer Prozesse und ihrer Beeinflussung durch Gliazellen und/oder
Wachstumsfaktoren verwendet wird. Daher war es das Ziel dieser Studie (i) ein Protokoll für
die Isolierung und Kultur adulter, kaniner Dorsalwurzelganglienneurone zu etablieren und
unter Verwendung dieses Systems die modulierenden Effekte von GM1-Gangliosid (GM1) auf
Neuronen und Gliazellen zu untersuchen. Im Zweiten Teil der Studie (ii) erfolgte die
klinische, genetische und pathologische Charakterisierung einer bisher nicht beschriebenen,
erblichen neuroaxonalen Dystrophie bei Spanischen Wasserhunden.
118
Die
Zusammenfassung
Etablierung
eines
Protokolls
für
die
Isolierung
und
Kultivierung
kaniner
Dorsalwurzelganglienneurone von adulten Hunden stellt ein interessantes in vitro-Modell für
die Erforschung der Pathogenese genetisch-bedingter neurodegenerativer Erkrankungen
dar. Ein entsprechendes Protokoll wurde erfolgreich etabliert sowie optimiert und für die
Charakterisierung von GM1-Gangliosid (GM1), “nerve growth factor“ (NGF) und/oder “
fibroblast growth factor“ (FGF) 2 -assoziierten Effekten auf Neurone und Gliazellen
verwendet. GM1 stellt einen wichtigen strukturellen und funktionellen Bestandteil
intrazellulärer Membransysteme dar. Insbesondere die neuronale Zellmembran sowie das
Myelin weisen hohe GM1-Konzentrationen auf. Beeinträchtigungen des lysosomalen GM1
Abbaus sind als initialer Pathomechanismus der lysosomalen Speicherkrankheit GM 1Gangliosidose anzusehen. Zudem werden alters-assoziierte Veränderungen im GM1
Metabolismus im Zusammenhang mit Alterationen von Synapsen sowie des Myelins in der
Pathogenese neurodegenerativer Erkrankungen diskutiert. Anhand der im Rahmen dieser
Studie durchgeführten Zellkulturexperimente wurde bei Neuronen, die mit GM 1 und NGF
inkubiert wurden, ein verstärktes Neuritenwachstum nachgewiesen. Zudem stellten sich
Akkumulationen von Synaptophysin und Dynein in den Nervenzellfortsätzen dar. Diese
Ergebnisse zeigen, dass GM1 die Synapsenbildung sowie den retrograden, axonalen
Transport moduliert. Zudem steigerten NGF und GM1 den prozentualen Anteil GlutaminSynthetase
exprimierender,
nicht-neuronaler
Zellen
in
adulten
kaninen
Dorsalwurzelganglienkulturen. Folglich ist von einem GM1 und NGF-assoziierten Effekt auf
den extrazellulären Glutamatspiegel auszugehen. Dieser moduliert möglicherweise die
Ausbildung ektopischer Neuriten, deren Auftreten bei der GM 1-Gangliosidose beschrieben
wurde. Unter FGF2 supplementierten Kulturbedingungen stellte sich ein erhöhter Anteil
“glial fibrillary acidic protein“ (GFAP) exprimierender, nicht-neuronaler Zellen dar. Zellen, die
mit GM1 und FGF2 kultiviert wurden, zeigten einen signifikant niedrigeren Anteil GFAP positiver Zellen. Daher schient FGF2 eine astrozytäre Differenzierung von Gliazellen zu
fördern, die durch GM1 inhibiert wird. Dies impliziert, dass GM1 möglicherweise die Bildung
von glialem Narbengewebe hemmt. Die Relevanz dieser vorläufigen Ergebnisse muss
allerdings in weiteren Studien bestätigt werden.
Zusammenfassung
119
Die klinische, genetische und pathologische Charakterisierung einer erblichen NAD bei
spanischen Wasserhunden erfolgte im zweiten Teil dieser Studie. Sie ermöglicht die
Beurteilung der Relevanz dieser rassespezifischen Erkrankung als translationales, kanines in
vivo Modell für NAD Formen des Menschen. Anhand genetischer Analysen wurde gezeigt,
dass die NAD Spanischer Wasserhunde durch eine Mutation im “Tectonin beta-propeller
repeat-containing protein 2“ (TECPR2) Gen verursacht wird. Die NAD Spanischer
Wasserhunde zeigt ätiologische und klinische Parallelen zu einer Form der erblichen
spastischen Paraparese (HSP) des Menschen, die als SPG49 klassifiziert wurde. Histologisch
wird innerhalb des Rückenmarks bei Patienten mit HSP häufig in den absteigenden
Nervenbahnen
des
Rückenmarks
eine
Degeneration
distaler
Axone
festgestellt.
Interessanterweise stellte sich die kanine, TECPR2-assoziierte NAD durch Neuronenverluste
und axonale Sphäroide in aufsteigenden, sensorischen Faserzügen dar. Ähnliche
histologische Befunde wurden bei Fällen von NAD beim Menschen nachgewiesen, deren
genetische Ursache unbekannt ist. Folglich wurde anhand der NAD des Spanischen
Wasserhundes und durch Charakterisierung der kausalen Mutation ein potentielles
Kandidatengen für die NAD des Menschen identifiziert. TECPR2 stellt ein Autophagieassoziiertes Protein dar, dessen Funktion bisher weitgehend unbekannt ist. Die weitere in
vitro Charakterisierung von Dosalwurzelganglienkulturen von betroffenen Hunden und
Kontrolltieren stellt daher ein äußerst interessantes System dar, welches die weitere
funktionelle Charakterisierung des TECPR2-Proteins ermöglichen wird.
Zusammenfassend belegen die Ergebnisse dieser Studie, dass Beeinträchtigungen der
Autophagie sowie der lysosomalen Degradation einen zentralen Pathomechanismus bei der
Pathogenese der Neurodegeneration darstellen, der anhand der Verwendung kaniner in
vivo- und in vitro Modelle weiter untersucht werden kann.
120
Zusammenfassung
References
7
121
References
Abe T, Ogawa K, Fuziwara H, Urayama K, Nagashima K. 1985. Spinal ganglia and peripheral
nerves from a patent with Tay-Sachs disease. Morphological and ganglioside studies. Acta
Neuropathol. 66:239-244.
Acheson A, Conover JC, Fandl JP, DeChiara TM, Russell M, Thadani A, Squinto SP,
Yancopoulos GD, Lindsay RM. 1995. A BDNF autocrine loop in adult sensory neurons
prevents cell death. Nature. 374:450-453.
Agarraberes FA, Terlecky SR, Dice JF. 1997. An intralysosomal hsp70 is required for a
selective pathway of lysosomal protein degradation. J Cell Biol. 137:825-834.
Alexander DE, Leib DA. 2008. Xenophagy in herpes simplex virus replication and
pathogenesis. Autophagy. 4:101-103.
Ando S, Tanaka Y, Waki H, Kon K, Iwamoto M, Fukui F. 1998. Gangliosides and
sialylcholesterol as modulators of synaptic functions. Ann NY Acad Sci. 845:232-239.
Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, Habermann A, Griffiths G, Ktistakis
NT. 2008. Autophagosome formation from membrane compartments enriched in
phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum.
J Cell Biol. 182:685-701.
Aydin M, Cengiz S, Agaçhan B, Yilmaz H, Isbir T. 2000. Age-related changes in GM1, GD1a,
GT1b components of gangliosides in Wistar albino rats. Cell Biochem Funct. 18:41-45.
Ball MU, McGuire JA, Swaim SF, Hoerlein BF. 1982. Patterns of occurrence of disk disease
among registered dachshunds. J Am Vet Med Assoc. 180:519-522.
Baltanás FC, Casafont I, Weruaga E, Alonso JR, Berciano MT, Lafarga M. 2011. Nucleolar
disruption and cajal body disassembly are nuclear hallmarks of DNA damage-induced
neurodegeneration in Purkinje cells. Brain Pathol. 21:374-388.
Battistin L, Cesari A, Galligioni F, Marin G, Massarotti M, Paccagnella D, Pellegrini A, Testa G,
Tonin P. 1985. Effects of GM1 Ganglioside in Cerebrovascular Diseases: A Double-Blind Trial
in 40 Cases Eur Neurol. 24:343–351.
Behrends C, Sowa ME, Gygi SP, Harper JW. 2010. Network organization of the human
autophagy system. Nature. 466:68-76.
Benatar M. 2007. Lost in translation: treatment trials in the SOD1 mouse and in human ALS.
Neurobiol Dis. 26:1-13.
122
References
Bennett PF, Clarke RE. 1997. Laryngeal paralysis in a rottweiler with neuroaxonal dystrophy.
Aust Vet J. 75:784-786.
Bennicelli J, Wright JF, Komaromy A, Jacobs JB, Hauck B, Zelenaia O, Mingozzi F, Hui D, Chung
D, Rex TS, Wei Z, Qu G, Zhou S, Zeiss C, Arruda VR, Acland GM, Dell'Osso LF, High KA,
Maguire AM, Bennett J. 2008. Reversal of blindness in animal models of leber congenital
amaurosis using optimized AAV2-mediated gene transfer. Mol Ther. 16:458-465.
Bethlem J, den Hartog Jager WA. 1960. The incidence and characteristics of Lewy bodies in
idiopathic paralysis agitans (Parkinson's disease). J Neurol Neurosurg Psychiatry. 23:74-80.
Bieber FR, Mortimer G, Kolodny EH, Driscoll SG. 1986. Pathologic findings in fetal GM1
gangliosidosis. Arch Neurol. 43:736-738.
Biggs JE, Boakye PA, Ganesan N, Stemkowski PL, Lantero A, Ballanyi K, Smith PA. 2014.
Analysis of the long-term actions of gabapentin and pregabalin in dorsal root ganglia and
substantia gelatinosa. J Neurophysiol. 112:2398-2412.
Birgisdottir ÅB, Lamark T, Johansen T. 2013. The LIR motif - crucial for selective autophagy. J
Cell Sci. 126:3237-3247.
Bjørkøy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A, Stenmark H, Johansen T.
2005. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective
effect on huntingtin-induced cell death. J Cell Biol. 171:603-614.
Blackstone C. 2012. Cellular pathways of hereditary spastic paraplegia. Annu. Rev. Neurosci.
35:25–47.
Bock P, Spitzbarth I, Haist V, Stein VM, Tipold A, Puff C, Beineke A, Baumgärtner W. 2013.
Spatio-temporal development of axonopathy in canine intervertebral disc disease as a
translational large animal model for nonexperimental spinal cord injury. Brain Pathol. 23:8299.
Braund K. 2003.Degenerative disorders of the Central Nervous System. in Braund KG. (Ed.),
Clinical Neurology in Small Animals – Localization, Diagnosis and Treatment. International
Veterinary Information Service, Ithaca, NY, Available from:<www.ivis.org>
Bray D, Thomas C, Shaw G. 1978. Growth cone formation in cultures of sensory neurons.
Proc Natl Acad Sci U S A. 75:5226-5229.
Browne HA, Gair SL, Scharf JM, Grice DE. 2014. Genetics of obsessive-compulsive disorder
and related disorders Psychiatr Clin North Am. 37:319-335.
References
123
Brunetti-Pierri N, Scaglia F. 2008. GM1 gangliosidosis: review of clinical, molecular, and
therapeutic aspects. Mol Genet Metab. 94:391-396.
Busch RM, Najm I, Hermann BP, Eng C. 2014. Genetics of cognition in epilepsy. Epilepsy
Behav. pii: S1525-5050(14)00200-5.
Canfield W, Bao M, Pan M, Brewer J, Pan ADK, Roe H, Raas-Rothschild B. 1998. A.
Mucolipidosis II and mucolipidosis IIIA are caused by mutations in the GlcNAcphosphotransferase alpha/beta gene on chromosome 12p. Am. J. Hum. Genet. 63:A15.
Cataldo AM, Mathews PM, Boiteau AB, Hassinger LC, Peterhoff CM, Jiang Y, Mullaney K,
Neve RL, Gruenberg J, Nixon RA. 2008. Down syndrome fibroblast model of Alzheimerrelated endosome pathology: accelerated endocytosis promotes late endocytic defects. Am J
Pathol. 173:370-384.
Cataldo AM, Peterhoff CM, Troncoso JC, Gomez-Isla T, Hyman BT, Nixon RA. 2000. Endocytic
pathway abnormalities precede amyloid beta deposition in sporadic Alzheimer's disease and
Down syndrome: differential effects of APOE genotype and presenilin mutations. Am J
Pathol. 157:277-86.
Cavanaugh SE, Pippin JJ, Barnard ND. 2014. Animal models of Alzheimer disease: historical
pitfalls and a path forward. ALTEX. 31:279-302.
Chan SH, Kikkawa U, Matsuzaki H, Chen JH, Chang WC. 2012. Insulin receptor substrate-1
prevents autophagy-dependent cell death caused by oxidative stress in mouse NIH/3T3 cells.
J Biomed Sci. 19:64.
Chang J, Lee S, Blackstone C. 2014. Spastic paraplegia proteins spastizin and spatacsin
mediate autophagic lysosome reformation. J Clin Invest. pii: 77598.
Chang NC, Nguyen M, Shore GC. 2012. BCL2-CISD2: An ER complex at the nexus of
autophagy and calcium homeostasis? Autophagy. 8:856-857.
Chauhan S, Goodwin JG, Chauhan S, Manyam G, Wang J, Kamat AM, Boyd DD. 2013.
ZKSCAN3 is a master transcriptional repressor of autophagy. Mol Cell. 50:16-28.
Chinnapen DJ, Hsieh WT, te Welscher YM, Saslowsky DE, Kaoutzani L, Brandsma E, D'Auria L,
Park H, Wagner JS, Drake KR, Kang M, Benjamin T, Ullman MD, Costello CE, Kenworthy AK,
Baumgart T, Massol RH, Lencer WI. 2012. Lipid sorting by ceramide structure from plasma
membrane to ER for the cholera toxin receptor ganglioside GM1. Dev Cell. 23:573-586.
Chrisman CL, Cork LC, Gamble DA. 1984. Neuroaxonal dystrophy of Rottweiler dogs. J Am
Vet Med Assoc. 184:464-467.
124
References
Colombelli C, Aoun M, Tiranti V. 2014 Defective lipid metabolism in neurodegeneration with
brain iron accumulation (NBIA) syndromes: not only a matter of iron. J Inherit Metab Dis: in
press.
Cork LC, Troncoso JC, Price DL, Stanley EF, Griffin JW. 1983. Canine neuroaxonal dystrophy. J
Neuropathol Exp Neurol. 42:286-296.
Cosker KE, Courchesne SL, Segal RA. 2008. Action in the axon: generation and transport of
signaling endosomes. Curr Opin Neurobiol. 18:270-275.
Crisp MJ, Beckett J, Coates JR, Miller TM. 2013. Canine degenerative myelopathy:
biochemical characterization of superoxide dismutase 1 in the first naturally occurring nonhuman amyotrophic lateral sclerosis model. Exp Neurol. 248:1-9.
Cuello AC, Garofalo L, Kenigsberg RL, Maysinger D. 1989. Gangliosides potentiate in vivo and
in vitro effects of nerve growth factor on central cholinergic neurons. Proc Natl Acad Sci U S
A. 86:2056-2060.
Cuervo AM, Palmer A, Rivett AJ, Knecht E. 1995. Degradation of proteasomes by lysosomes
in rat liver. Eur J Biochem. 227:792-800.
Daido S, Kanzawa T, Yamamoto A, Takeuchi H, Kondo Y, Kondo S. 2004. Pivotal role of the
cell death factor BNIP3 in ceramide-induced autophagic cell death in malignant glioma cells.
Cancer Res. 64:4286-4293.
d'Azzo A, Tessitore A, Sano R. 2006. Gangliosides as apoptotic signals in ER stress response.
Cell Death Differ. 13:404-414.
de Duve C, Pressman BC, Gianetto R, Wattiaux R, Appelmans F. 1955. Tissue fractionation
studies. 6. Intracellular distribution patterns of enzymes in rat-liver tissue. Biochem J.
60:604-617.
Deelen J, Beekman M, Uh HW, Broer L, Ayers KL, Tan Q, Kamatani Y, Bennet AM, Tamm R,
Trompet S, Guðbjartsson DF, Flachsbart F, Rose G, Viktorin A, Fischer K, Nygaard M, Cordell
HJ, Crocco P, van den Akker EB, Böhringer S, Helmer Q, Nelson CP, Saunders GI, Alver M,
Andersen-Ranberg K, Breen ME, van der Breggen R, Caliebe A, Capri M, Cevenini E, Collerton
JC, Dato S, Davies K, Ford I, Gampe J, Garagnani P, de Geus E, Harrow J, van Heemst D,
Heijmans BT, Heinsen FA, Hottenga JJ, Hofman A, Jeune B, Jonsson PV, Lathrop M, Lechner
D, Martin-Ruiz C, Mcnerlan SE, Mihailov E, Montesanto A, Mooijaart SP, Murphy A, Nohr EA,
Paternoster L, Postmus I, Rivadeneira F, Ross OA, Salvioli S, Sattar N, Schreiber S, Stefánsson
H, Stott DJ, Tiemeier H, Uitterlinden AG, Westendorp RG, Willemsen G, Samani NJ, Galan P,
Sørensen TI, Boomsma DI, Jukema JW, Rea IM, Passarino G, de Craen AJ, Christensen K,
Nebel A, Stefánsson K, Metspalu A, Magnusson P, Blanché H, Christiansen L, Kirkwood TB,
van Duijn CM, Franceschi C, Houwing-Duistermaat JJ, Slagboom PE. 2014. Genome-wide
References
125
association meta-analysis of human longevity identifies a novel locus conferring survival
beyond 90 years of age. Hum Mol Genet. 23:4420-4432.
Deegan S, Saveljeva S, Gorman AM, Samali A. 2013. Stress-induced self-cannibalism: on the
regulation of autophagy by endoplasmic reticulum stress. Cell Mol Life Sci. 70:2425-2441.
de la Cadena SG, Hernández-Fonseca K, Camacho-Arroyo I, Massieu L. 2014. Glucose
deprivation induces reticulum stress by the PERK pathway and caspase-7- and calpainmediated caspase-12 activation. Apoptosis. 19:414-427.
de León GA, Mitchell MH. 1985. Histological and ultrastructural features of dystrophic
isocortical axons in infantile neuroaxonal dystrophy (Seitelberger's disease). Acta
Dell'Angelica EC, Puertollano R, Mullins C, Aguilar RC, Vargas JD, Hartnell LM, Bonifacino J.S.
2000. GGAs: a family of ADP ribosylation factor-binding proteins related to adaptors and
associated with the Golgi complex. J Cell Biol. 149:81-94.
Di Bartolomeo S, Corazzari M, Nazio F, Oliverio S, Lisi G, Antonioli M, Pagliarini V, Matteoni S,
Fuoco C, Giunta L, D'Amelio M, Nardacci R, Romagnoli A, Piacentini M, Cecconi F, Fimia GM.
2010. The dynamic interaction of AMBRA1 with the dynein motor complex regulates
mammalian autophagy. J Cell Biol. 191:155-168.
Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I,
Pereira-Smith O. 1995. A biomarker that identifies senescent human cells in culture and in
aging skin in vivo. Proc Natl Acad Sci U S A. 92:9363-9367.
Ding WX, Ni HM, Gao W, Hou YF, Melan MA, Chen X, Stolz DB, Shao ZM, Yin XM. 2007.
Differential effects of endoplasmic reticulum stress-induced autophagy on cell survival. J Biol
Chem. 282:4702-4710.
Ding WX, Ni HM, Li M, Liao Y, Chen X, Stolz DB, Dorn GW 2nd, Yin XM. 2010. Nix is critical to
two distinct phases of mitophagy, reactive oxygen species-mediated autophagy induction
and Parkin-ubiquitin-p62-mediated mitochondrial priming. J Biol Chem. 285:27879-27890.
Di Patre PL, Abbamondi A, Bartolini L, Pepeu G. 1989. GM1 ganglioside counteracts
cholinergic and behavioral deficits induced in the rat by intracerebral injection of vincristine.
Eur J Pharmacol. 162:43-50.
Duclos S, Corsini R, Desjardins M. 2003. Remodeling of endosomes during lysosome
biogenesis involves 'kiss and run' fusion events regulated by rab5. J Cell Sci. 116:907-918.
126
References
Duyao M, Ambrose C, Myers R, Novelletto A, Persichetti F, Frontali M, Folstein S, Ross C,
Franz M, Abbott M. 1993. Trinucleotide repeat length instability and age of onset in
Huntington's disease. Nat Genet. 4:387-392.
Esteves T, Durr A, Mundwiller E, Loureiro JL, Boutry M, Gonzalez MA, Gauthier J, El-Hachimi
KH, Depienne C, Muriel MP, Acosta Lebrigio RF, Gaussen M, Noreau A, Speziani F, DionneLaporte A, Deleuze JF, Dion P, Coutinho P, Rouleau GA, Zuchner S, Brice A, Stevanin G, Darios
F. 2014. Loss of association of REEP2 with membranes leads to hereditary spastic paraplegia
Am J Hum Genet. 94:268-277.
Fader CM, Sánchez D, Furlán M, Colombo MI. 2008. Induction of autophagy promotes fusion
of multivesicular bodies with autophagic vacuoles in k562 cells. Traffic. 9:230-250.
Feng Y, He D, Yao Z, Klionsky DJ. 2014. The machinery of macroautophagy. Cell Res. 24:2441.
Ferrari G, Fabris M, Gorio A. 1983. Gangliosides enhance neurite outgrowth in PC12 cells.
Brain Res. 284:215-221.
Figueroa-Romero C, Sadidi M, Feldman EL. 2008. Mechanisms of disease: the oxidative stress
theory of diabetic neuropathy. Rev Endocr Metab Disord. 9:301-314.
Filomeni G, De Zio D, Cecconi F. 2014. Oxidative stress and autophagy: the clash between
damage and metabolic needs. Cell Death Differ. doi: 10.1038/cdd.2014.150.
Fimia GM, Stoykova A, Romagnoli A, Giunta L, Di Bartolomeo S, Nardacci R, Corazzari M,
Fuoco C, Ucar A, Schwartz P, Gruss P, Piacentini M, Chowdhury K, Cecconi F. 2007. Ambra1
regulates autophagy and development of the nervous system. Nature. 447:1121-1125.
Fink JK. 2013. Hereditary spastic paraplegia: clinico-pathologic features and emerging
molecular mechanisms. Acta Neuropathol. 126:307-28.
Folkerth RD. 1999. Abnormalities of developing white matter in lysosomal storage diseases J.
Neuropathol. Exp. Neurol. 58:887-902.
Fong TG, Vogelsberg V, Neff NH, Hadjiconstantinou M. 1995. GM1 and NGF synergism on
choline acetyltransferase and choline uptake in aged brain. Neurobiol Aging. 16:917-923.
Fuertes G, Villarroya A, Knecht E. 2003. Role of proteasomes in the degradation of shortlived proteins in human fibroblasts under various growth conditions. Int J Biochem Cell Biol.
35:651-664.
References
127
Fujita N, Itoh T, Omori H, Fukuda M, Noda T, Yoshimori T. 2008. The Atg16L complex
specifies the site of LC3 lipidation for membrane biogenesis in autophagy. Mol Biol Cell.
19:2092-2100
Fyfe JC, Al-Tamimi RA, Liu J, Schäffer AA, Agarwala R, Henthorn PS. 2011. A novel mitofusin 2
mutation causes canine fetal-onset neuroaxonal dystrophy. Neurogenetics. 12:223-232.
Gangula NR, Maddika S. 2013. WD repeat protein WDR48 in complex with deubiquitinase
USP12 suppresses Akt-dependent cell survival signaling by stabilizing PH domain leucine-rich
repeat protein phosphatase 1 (PHLPP1). J Biol Chem 288: 34545-34554.
Gasser T. 2005. Genetics of Parkinson's disease. Curr Opin Neurol. 18:363-369.
Geng YQ, Guan JT, Xu XH, Fu YC. 2010. Senescence-associated beta-galactosidase activity
expression in aging hippocampal neurons. Biochem Biophys Res Commun. 396:866-869.
Gill JS, Windebank AJ. 1998. Suramin induced ceramide accumulation leads to apoptotic cell
death in dorsal root ganglion neurons. Cell Death Differ. 5:876-883.
Gilman S, Barrett RE. 1973. Hallervorden-Spatz disease and infantile neuroaxonal dystrophy.
Clinical characteristics and nosological considerations. J Neurol Sci. 19:189-205.
Glaumann H. 1989. Crinophagy as a means for degrading excess secretory proteins in rat
liver. Revis Biol Celular. 20:97-110.
Glick D, Barth S, Macleod KF. 2010. Autophagy: cellular and molecular mechanisms. J Pathol.
221:3-12.
Goldman SD, Krise JP. 2010. Niemann-Pick C1 functions independently of Niemann-Pick C2 in
the initial stage of retrograde transport of membrane-impermeable lysosomal cargo. J. Biol.
Chem. 285:4983–4994.
Gordon N. 2004 Giant axonal neuropathy. Dev Med Child Neurol 46: 717-719.
Gotoh T, Endo M, Oike Y. 2011. Endoplasmic reticulum stress-related inflammation and
cardiovascular diseases. Int J Inflam. 2011:259462.
Gordon PB, Seglen PO. 1988. Prelysosomal convergence of autophagic and endocytic
pathways. Biochem Biophys Res Commun. 151:40-47.
Gregory A, Polster BJ, Hayflick SJ. 2009. Clinical and genetic delineation of
neurodegeneration with brain iron accumulation. J Med Genet 46:73-80.
128
References
Grothe C, Unsicker K. 1987. Neuron-enriched cultures of adult rat dorsal root ganglia:
establishment, characterization, survival, and neuropeptide expression in response to
trophic factors. J Neurosci Res. 18:539-550.
Groves MJ, Schänzer A, Simpson AJ, An SF, Kuo LT, Scaravilli F. 2003. Profile of adult rat
sensory neuron loss, apoptosis and replacement after sciatic nerve crush. J Neurocytol.
32:113-122.
Guo Y, Li C, Wu D, Wu S, Yang C, Liu Y, Wu H, Li Z. 2010. Ultrastructural diversity of inclusions
and aggregations in the lumbar spinal cord of SOD1-G93A transgenic mice. Brain Res.
1353:234-244.
Haack TB, Hogarth P, Kruer MC, Gregory A, Wieland T, Schwarzmayr T, Graf E, Sanford L,
Meyer E, Kara E, Cuno SM, Harik SI, Dandu VH, Nardocci N, Zorzi G, Dunaway T, Tarnopolsky
M, Skinner S, Frucht S, Hanspal E, Schrander-Stumpel C, Héron D, Mignot C, Garavaglia B,
Bhatia K, Hardy J, Strom TM, Boddaert N, Houlden HH, Kurian MA, Meitinger T, Prokisch H,
Hayflick SJ. 2012. Exome sequencing reveals de novo WDR45 mutations causing a
phenotypically distinct, X-linked dominant form of NBIA. Am J Hum Genet. 91:1144-1149.
Hadjiconstantinou M, Karadsheh NS, Rattan AK, Tejwani GA, Fitkin JG, Neff NH. 1992. GM1
ganglioside enhances cholinergic parameters in the brain of senescent rats. Neuroscience.
46:681-686.
Hahn CN, del Pilar Martin M, Schröder M, Vanier MT, Hara Y, Suzuki K, Suzuki K, d'Azzo A.
1997. Generalized CNS disease and massive GM1-ganglioside accumulation in mice defective
in lysosomal acid beta-galactosidase. Hum Mol Genet. 6:205-211.
Hailey DW, Rambold AS, Satpute-Krishnan P, Mitra K, Sougrat R, Kim PK, Lippincott-Schwartz
J. 2010. Mitochondria supply membranes for autophagosome biogenesis during starvation.
Cell. 141:656-667.
Hallervorden J, Spatz H. 1922. Eigenartige Erkrankung im extrapyramidalen System mit
besonderer Beteiligung des Globus pallidus und der Substantia nigra. Z Gesammte Neurolog
Psychiatr. 79:254-302.
Hamasaki M, Furuta N, Matsuda A, Nezu A, Yamamoto A, Fujita N, Oomori H, Noda T,
Haraguchi T, Hiraoka Y, Amano A, Yoshimori T. 2013. Autophagosomes form at ERmitochondria contact sites. Nature. 495:389-393.
Hamer I, Van Beersel G, Arnould T, Jadot M. 2012. Lipids and lysosomes. Curr Drug Metab.
13:1371-1387.
References
129
Han W, Pan H, Chen Y, Sun J, Wang Y, Li J, Ge W, Feng L, Lin X, Wang X, Wang X, Jin H. 2011.
EGFR tyrosine kinase inhibitors activate autophagy as a cytoprotective response in human
lung cancer cells. PLoS One. 6:e18691.
Hanani M. 2005. Satellite glial cells in sensory ganglia: from form to function. Brain Res.
48:457-476.
Harding AE. 1983. Classification of the hereditary ataxias and paraplegias. Lancet. 1:11511155.
Harper AA, Lawson SN. 1985. Conduction velocity is related to morphological cell type in rat
dorsal root ganglion neurones. J Physiol. 359:31-46.
Hattingen E, Magerkurth J, Pilatus U, Mozer A, Seifried C, Steinmetz H, Zanella F, Hilker R.
2009. Phosphorus and proton magnetic resonance spectroscopy demonstrates
mitochondrial dysfunction in early and advanced Parkinson's disease. Brain. 132:3285-97.
Hayashi-Nishino M, Fujita N, Noda T, Yamaguchi A, Yoshimori T, Yamamoto A. 2009. A
subdomain of the endoplasmic reticulum forms a cradle for autophagosome formation. Nat
Cell Biol. 11:1433-1437.
He LQ, Lu JH, Yue ZY. 2013. Autophagy in ageing and ageing-associated diseases. Acta
Pharmacol Sin. 34:605-611.
Head E. 2013. A canine model of human aging and Alzheimer's disease. Biochim Biophys
Acta. 1832:1384-1389.
Heerssen HM, Pazyra MF, Segal RA. 2004. Dynein motors transport activated Trks to
promote survival of target-dependent neurons. Nat Neurosci. 7:596-604.
Hemelaar J, Lelyveld VS, Kessler BM, Ploegh HL. 2003. A single protease, Apg4B, is specific
for the autophagy-related ubiquitin-like proteins GATE-16, MAP1-LC3, GABARAP, and Apg8L.
J Biol Chem. 278:51841-51850.
Hering H, Lin CC, Sheng M. 2003. Lipid rafts in the maintenance of synapses, dendritic spines,
and surface AMPA receptor stability. J Neurosci. 23:3262-3271.
Hirst J, Lindsay MR, Robinson MS. 2001. GGAs: roles of the different domains and
comparison with AP-1 and clathrin. Mol Biol Cell. 12:3573-3588.
Hogarth P, Gregory A, Kruer MC, Sanford L, Wagoner W, Natowicz MR, Egel RT, Subramony
SH, Goldman JG, Berry-Kravis E, Foulds NC, Hammans SR, Desguerre I, Rodriguez D, Wilson C,
Diedrich A, Green S, Tran H, Reese L, Woltjer RL, Hayflick SJ. 2013 New NBIA subtype:
genetic, clinical, pathologic, and radiographic features of MPAN. Neurology. 80(3):268-75.
130
References
Høyer-Hansen M, Bastholm L, Szyniarowski P, Campanella M, Szabadkai G, Farkas T, Bianchi
K, Fehrenbacher N, Elling F, Rizzuto R, Mathiasen IS, Jäättelä M. 2007. Control of
macroautophagy by calcium, calmodulin-dependent kinase kinase-beta, and Bcl-2. Mol Cell.
25:193-205.
Huang F, Liu Z, Liu H, Wang L, Wang H, Li Z. 2007. GM1 and NGF modulate Ca2+ homeostasis
and GAP43 mRNA expression in cultured dorsal root ganglion neurons with excitotoxicity
induced by glutamate. Nutr Neurosci. 10:105-111.
Hung YH, Chen LM, Yang JY, Yang W.Y. 2013. Spatiotemporally controlled induction of
autophagy-mediated lysosome turnover. Nat Commun. 4:2111.
Hytönen MK, Arumilli M, Lappalainen AK, Kallio H, Snellman M, Sainio K, Lohi H. 2012. A
novel GUSB mutation in Brazilian terriers with severe skeletal abnormalities defines the
disease as mucopolysaccharidosis VII. PLoS One. 7:e40281.
Hyttinen JM, Amadio M, Viiri J, Pascale A, Salminen A, Kaarniranta K. 2014. Clearance of
misfolded and aggregated proteins by aggrephagy and implications for aggregation diseases.
Ageing Res Rev. 18C:16-28.
Iguchi Y, Katsuno M, Ikenaka K, Ishigaki S, Sobue G. 2013. Amyotrophic lateral sclerosis: an
update on recent genetic insights. J Neurol. 260:2917-2927.
Ihrke G, Kyttälä A, Russell MR, Rous BA, Luzio JP. 2004. Differential use of two AP-3mediated pathways by lysosomal membrane proteins. Traffic. 5:946-962.
Irwin LN, Michael DB, Irwin CC. 1980. Ganglioside patterns of fetal rat and mouse brain. J
Neurochem. 34:1527-1530.
Itakura E, Mizushima N. 2013. Syntaxin 17: the autophagosomal SNARE. Autophagy. 9:917–
919.
Ji ZS, Müllendorff K, Cheng IH, Miranda RD, Huang Y, Mahley RW. 2006. Reactivity of
apolipoprotein E4 and amyloid beta peptide: lysosomal stability and neurodegeneration. J
Biol Chem. 281:2683-2692.
Jiang L, Hara-Kuge S, Yamashita SI, Fujiki Y. 2014a. Peroxin Pex14p is the key component for
coordinated autophagic degradation of mammalian peroxisomes by direct binding to LC3-II.
Genes Cells. doi: 10.1111/gtc.12198.
Jiang P, Nishimura T, Sakamaki Y, Itakura E, Hatta T, Natsume T, Mizushima N. 2014b. The
HOPS complex mediates autophagosome-lysosome fusion through interaction with syntaxin
17. Mol Biol Cell. 25:1327-1337.
References
131
Ju JS, Fuentealba RA, Miller SE, Jackson E, Piwnica-Worms D, Baloh RH, Weihl CC. 2009.
Valosin-containing protein (VCP) is required for autophagy and is disrupted in VCP disease. J
Cell Biol. 187:875-888.
Kalvari I, Tsompanis S, Mulakkal NC, Osgood R, Johansen T, Nezis IP, Promponas VJ. 2014.
iLIR: A web resource for prediction of Atg8-family interacting proteins. Autophagy. 10:913925.
Karlsson EK, Lindblad-Toh K. 2008. Leader of the pack: gene mapping in dogs and other
model organisms. Nat Rev Genet. 9:713-725.
Katz ML, Khan S, Awano T, Shahid SA, Siakotos AN, Johnson GS. 2005. A mutation in the
CLN8 gene in English Setter dogs with neuronal ceroid-lipofuscinosis. Biochem Biophys Res
Commun. 327:541-547.
Kawai A , Uchiyama H, Takano S, Nakamura N, Ohkuma S. 2007. Autophagosome-lysosome
fusion depends on the pH in acidic compartments in CHO cells. Autophagy. 3:154-157.
Kawajiri S, Saiki S, Sato S, Sato F, Hatano T, Eguchi H, Hattori N. 2010. PINK1 is recruited to
mitochondria with parkin and associates with LC3 in mitophagy. FEBS Lett. 584:1073-1079.
Kaye EM, Alroy J, Raghavan SS, Schwarting GA, Adelman LS, Runge V, Gelblum D,
Thalhammer JG, Zuniga G. 1992. Dysmyelinogenesis in animal model of GM1 gangliosidosis.
Pediatr Neurol. 8:255-261.
Kegel KB, Kim M, Sapp E, McIntyre C, Castaño JG, Aronin N, DiFiglia M. 2000. Huntingtin
expression stimulates endosomal-lysosomal activity, endosome tubulation, and autophagy. J
Neurosci. 20:7268-7278.
Khundadze M, Kollmann K, Koch N, Biskup C, Nietzsche S, Zimmer G, Hennings JC, Huebner
AK, Symmank J, Jahic A, Ilina EI, Karle K, Schöls L, Kessels M, Braulke T, Qualmann B, Kurth I,
Beetz C, Hübner CA. 2013. A hereditary spastic paraplegia mouse model supports a role of
ZFYVE26/SPASTIZIN for the endolysosomal system. PLoS Genet. 9:e1003988.
Kim J, Kundu M, Viollet B, Guan KL. 2011. AMPK and mTOR regulate autophagy through
direct phosphorylation of Ulk1. Nat Cell Biol. 13:132-141.
Kimura S, Noda T, Yoshimori T. 2008. Dynein-dependent movement of autophagosomes
mediates efficient encounters with lysosomes. Cell Struct Funct. 33:109-122.
Kimura Y, Sato N, Sugai K, Maruyama S, Ota M, Kamiya K, Ito K, Nakata Y, Sasaki M, Sugimoto
H. 2013. MRI, MR spectroscopy, and diffusion tensor imaging findings in patient with static
encephalopathy of childhood with neurodegeneration in adulthood (SENDA). Brain Dev.
35(5):458-61.
132
References
Kinoshita M, Kondo Y, Yoshida K, Fukushima K, Hoshi K, Ishizawa K, Araki N, Yazawa I,
Washimi Y, Saitoh B, Kira J, Ikeda S. 2014. Corpus callosum atrophy in patients with
hereditary diffuse leukoencephalopathy with neuroaxonal spheroids: an MRI-based study.
Intern Med. 2014;53(1):21-7.
Kirkin V, Lamark T, Sou YS, Bjørkøy G, Nunn JL, Bruun JA, Shvets E, McEwan DG, Clausen TH,
Wild P, Bilusic I, Theurillat JP, Øvervatn A, Ishii T, Elazar Z, Komatsu M, Dikic I, Johansen T.
2009. A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Mol Cell.
33:505-516.
Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M, Mizuno
Y, Shimizu N. 1998. Mutations in the parkin gene cause autosomal recessive juvenile
parkinsonism. Nature. 392:605-608.
Klein AD, Futerman AH. 2013. Lysosomal storage disorders: old diseases, present and future
challenges. Pediatr Endocrinol Rev. 11 Suppl 1:59-63.
Kleinfeld K, Mobley B, Hedera P, Wegner A, Sriram S, Pawate S. 2013. Adult-onset
leukoencephalopathy with neuroaxonal spheroids and pigmented glia: report of five cases
and a new mutation. J Neurol. 260(2):558-71.
Klinghardt GW, Fredman P, Svennerholm L. 1981. Chloroquine intoxication induces
ganglioside storage in nervous tissue: a chemical and histopathological study of brain, spinal
cord, dorsal root ganglia, and retinal in the miniature pig. J Neurochem. 37:897-908.
Klionsky DJ. 2005. The molecular machinery of autophagy: unanswered questions. J Cell Sci.
118:7–18.
Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K, Agholme L,
Agnello M, Agostinis P, Aguirre-Ghiso JA, Ahn HJ, Ait-Mohamed O, Ait-Si-Ali S, Akematsu T,
Akira S, Al-Younes HM, Al-Zeer MA, Albert ML, Albin RL, Alegre-Abarrategui J, Aleo MF,
Alirezaei M, Almasan A, Almonte-Becerril M, Amano A, Amaravadi R, Amarnath S, Amer AO,
Andrieu-Abadie N, Anantharam V, Ann DK, Anoopkumar-Dukie S, Aoki H, Apostolova N,
Arancia G, Aris JP, Asanuma K, Asare NY, Ashida H, Askanas V, Askew DS, Auberger P, Baba
M, Backues SK, Baehrecke EH, Bahr BA, Bai XY, Bailly Y, Baiocchi R, Baldini G, Balduini W,
Ballabio A, Bamber BA, Bampton ET, Bánhegyi G, Bartholomew CR, Bassham DC, Bast RC Jr,
Batoko H, Bay BH, Beau I, Béchet DM, Begley TJ, Behl C, Behrends C, Bekri S, Bellaire B,
Bendall LJ, Benetti L, Berliocchi L, Bernardi H, Bernassola F, Besteiro S, Bhatia-Kissova I, Bi X,
Biard-Piechaczyk M, Blum JS, Boise LH, Bonaldo P, Boone DL, Bornhauser BC, Bortoluci KR,
Bossis I, Bost F, Bourquin JP, Boya P, Boyer-Guittaut M, Bozhkov PV, Brady NR, Brancolini C,
Brech A, Brenman JE, Brennand A, Bresnick EH, Brest P, Bridges D, Bristol ML, Brookes PS,
Brown EJ, Brumell JH, Brunetti-Pierri N, Brunk UT, Bulman DE, Bultman SJ, Bultynck G,
Burbulla LF, Bursch W, Butchar JP, Buzgariu W, Bydlowski SP, Cadwell K, Cahová M, Cai D, Cai
J, Cai Q, Calabretta B, Calvo-Garrido J, Camougrand N, Campanella M, Campos-Salinas J,
References
133
Candi E, Cao L, Caplan AB, Carding SR, Cardoso SM, Carew JS, Carlin CR, Carmignac V,
Carneiro LA, Carra S, Caruso RA, Casari G, Casas C, Castino R, Cebollero E, Cecconi F, Celli J,
Chaachouay H, Chae HJ, Chai CY, Chan DC, Chan EY, Chang RC, Che CM, Chen CC, Chen GC,
Chen GQ, Chen M, Chen Q, Chen SS, Chen W, Chen X, Chen X, Chen X, Chen YG, Chen Y, Chen
Y, Chen YJ, Chen Z, Cheng A, Cheng CH, Cheng Y, Cheong H, Cheong JH, Cherry S, ChessWilliams R, Cheung ZH, Chevet E, Chiang HL, Chiarelli R, Chiba T, Chin LS, Chiou SH, Chisari
FV, Cho CH, Cho DH, Choi AM, Choi D, Choi KS, Choi ME, Chouaib S, Choubey D, Choubey V,
Chu CT, Chuang TH, Chueh SH, Chun T, Chwae YJ, Chye ML, Ciarcia R, Ciriolo MR, Clague MJ,
Clark RS, Clarke PG, Clarke R, Codogno P, Coller HA, Colombo MI, Comincini S, Condello M,
Condorelli F, Cookson MR, Coombs GH, Coppens I, Corbalan R, Cossart P, Costelli P, Costes S,
Coto-Montes A, Couve E, Coxon FP, Cregg JM, Crespo JL, Cronjé MJ, Cuervo AM, Cullen JJ,
Czaja MJ, D'Amelio M, Darfeuille-Michaud A, Davids LM, Davies FE, De Felici M, de Groot JF,
de Haan CA, De Martino L, De Milito A, De Tata V, Debnath J, Degterev A, Dehay B, Delbridge
LM, Demarchi F, Deng YZ, Dengjel J, Dent P, Denton D, Deretic V, Desai SD, Devenish RJ, Di
Gioacchino M, Di Paolo G, Di Pietro C, Díaz-Araya G, Díaz-Laviada I, Diaz-Meco MT, Diaz-Nido
J, Dikic I, Dinesh-Kumar SP, Ding WX, Distelhorst CW, Diwan A, Djavaheri-Mergny M,
Dokudovskaya S, Dong Z, Dorsey FC, Dosenko V, Dowling JJ, Doxsey S, Dreux M, Drew ME,
Duan Q, Duchosal MA, Duff K, Dugail I, Durbeej M, Duszenko M, Edelstein CL, Edinger AL,
Egea G, Eichinger L, Eissa NT, Ekmekcioglu S, El-Deiry WS, Elazar Z, Elgendy M, Ellerby LM,
Eng KE, Engelbrecht AM, Engelender S, Erenpreisa J, Escalante R, Esclatine A, Eskelinen EL,
Espert L, Espina V, Fan H, Fan J, Fan QW, Fan Z, Fang S, Fang Y, Fanto M, Fanzani A, Farkas T,
Farré JC, Faure M, Fechheimer M, Feng CG, Feng J, Feng Q, Feng Y, Fésüs L, Feuer R,
Figueiredo-Pereira ME, Fimia GM, Fingar DC, Finkbeiner S, Finkel T, Finley KD, Fiorito F,
Fisher EA, Fisher PB, Flajolet M, Florez-McClure ML, Florio S, Fon EA, Fornai F, Fortunato F,
Fotedar R, Fowler DH, Fox HS, Franco R, Frankel LB, Fransen M, Fuentes JM, Fueyo J, Fujii J,
Fujisaki K, Fujita E, Fukuda M, Furukawa RH, Gaestel M, Gailly P, Gajewska M, Galliot B, Galy
V, Ganesh S, Ganetzky B, Ganley IG, Gao FB, Gao GF, Gao J, Garcia L, Garcia-Manero G,
Garcia-Marcos M, Garmyn M, Gartel AL, Gatti E, Gautel M, Gawriluk TR, Gegg ME, Geng J,
Germain M, Gestwicki JE, Gewirtz DA, Ghavami S, Ghosh P, Giammarioli AM, Giatromanolaki
AN, Gibson SB, Gilkerson RW, Ginger ML, Ginsberg HN, Golab J, Goligorsky MS, Golstein P,
Gomez-Manzano C, Goncu E, Gongora C, Gonzalez CD, Gonzalez R, González-Estévez C,
González-Polo RA, Gonzalez-Rey E, Gorbunov NV, Gorski S, Goruppi S, Gottlieb RA, Gozuacik
D, Granato GE, Grant GD, Green KN, Gregorc A, Gros F, Grose C, Grunt TW, Gual P, Guan JL,
Guan KL, Guichard SM, Gukovskaya AS, Gukovsky I, Gunst J, Gustafsson AB, Halayko AJ, Hale
AN, Halonen SK, Hamasaki M, Han F, Han T, Hancock MK, Hansen M, Harada H, Harada M,
Hardt SE, Harper JW, Harris AL, Harris J, Harris SD, Hashimoto M, Haspel JA, Hayashi S,
Hazelhurst LA, He C, He YW, Hébert MJ, Heidenreich KA, Helfrich MH, Helgason GV, Henske
EP, Herman B, Herman PK, Hetz C, Hilfiker S, Hill JA, Hocking LJ, Hofman P, Hofmann TG,
Höhfeld J, Holyoake TL, Hong MH, Hood DA, Hotamisligil GS, Houwerzijl EJ, Høyer-Hansen M,
Hu B, Hu CA, Hu HM, Hua Y, Huang C, Huang J, Huang S, Huang WP, Huber TB, Huh WK, Hung
TH, Hupp TR, Hur GM, Hurley JB, Hussain SN, Hussey PJ, Hwang JJ, Hwang S, Ichihara A,
Ilkhanizadeh S, Inoki K, Into T, Iovane V, Iovanna JL, Ip NY, Isaka Y, Ishida H, Isidoro C, Isobe
K, Iwasaki A, Izquierdo M, Izumi Y, Jaakkola PM, Jäättelä M, Jackson GR, Jackson WT, Janji B,
Jendrach M, Jeon JH, Jeung EB, Jiang H, Jiang H, Jiang JX, Jiang M, Jiang Q, Jiang X, Jiang X,
134
References
Jiménez A, Jin M, Jin S, Joe CO, Johansen T, Johnson DE, Johnson GV, Jones NL, Joseph B,
Joseph SK, Joubert AM, Juhász G, Juillerat-Jeanneret L, Jung CH, Jung YK, Kaarniranta K,
Kaasik A, Kabuta T, Kadowaki M, Kagedal K, Kamada Y, Kaminskyy VO, Kampinga HH,
Kanamori H, Kang C, Kang KB, Kang KI, Kang R, Kang YA, Kanki T, Kanneganti TD, Kanno H,
Kanthasamy AG, Kanthasamy A, Karantza V, Kaushal GP, Kaushik S, Kawazoe Y, Ke PY, Kehrl
JH, Kelekar A, Kerkhoff C, Kessel DH, Khalil H, Kiel JA, Kiger AA, Kihara A, Kim DR, Kim DH, Kim
DH, Kim EK, Kim HR, Kim JS, Kim JH, Kim JC, Kim JK, Kim PK, Kim SW, Kim YS, Kim Y, Kimchi A,
Kimmelman AC, King JS, Kinsella TJ, Kirkin V, Kirshenbaum LA, Kitamoto K, Kitazato K, Klein L,
Klimecki WT, Klucken J, Knecht E, Ko BC, Koch JC, Koga H, Koh JY, Koh YH, Koike M, Komatsu
M, Kominami E, Kong HJ, Kong WJ, Korolchuk VI, Kotake Y, Koukourakis MI, Kouri Flores JB,
Kovács AL, Kraft C, Krainc D, Krämer H, Kretz-Remy C, Krichevsky AM, Kroemer G, Krüger R,
Krut O, Ktistakis NT, Kuan CY, Kucharczyk R, Kumar A, Kumar R, Kumar S, Kundu M, Kung HJ,
Kurz T, Kwon HJ, La Spada AR, Lafont F, Lamark T, Landry J, Lane JD, Lapaquette P, Laporte
JF, László L, Lavandero S, Lavoie JN, Layfield R, Lazo PA, Le W, Le Cam L, Ledbetter DJ, Lee AJ,
Lee BW, Lee GM, Lee J, Lee JH, Lee M, Lee MS, Lee SH, Leeuwenburgh C, Legembre P,
Legouis R, Lehmann M, Lei HY, Lei QY, Leib DA, Leiro J, Lemasters JJ, Lemoine A, Lesniak MS,
Lev D, Levenson VV, Levine B, Levy E, Li F, Li JL, Li L, Li S, Li W, Li XJ, Li YB, Li YP, Liang C, Liang
Q, Liao YF, Liberski PP, Lieberman A, Lim HJ, Lim KL, Lim K, Lin CF, Lin FC, Lin J, Lin JD, Lin K,
Lin WW, Lin WC, Lin YL, Linden R, Lingor P, Lippincott-Schwartz J, Lisanti MP, Liton PB, Liu B,
Liu CF, Liu K, Liu L, Liu QA, Liu W, Liu YC, Liu Y, Lockshin RA, Lok CN, Lonial S, Loos B, LopezBerestein G, López-Otín C, Lossi L, Lotze MT, Lőw P, Lu B, Lu B, Lu B, Lu Z, Luciano F, Lukacs
NW, Lund AH, Lynch-Day MA, Ma Y, Macian F, MacKeigan JP, Macleod KF, Madeo F, Maiuri L,
Maiuri MC, Malagoli D, Malicdan MC, Malorni W, Man N, Mandelkow EM, Manon S, Manov
I, Mao K, Mao X, Mao Z, Marambaud P, Marazziti D, Marcel YL, Marchbank K, Marchetti P,
Marciniak SJ, Marcondes M, Mardi M, Marfe G, Mariño G, Markaki M, Marten MR, Martin SJ,
Martinand-Mari C, Martinet W, Martinez-Vicente M, Masini M, Matarrese P, Matsuo S,
Matteoni R, Mayer A, Mazure NM, McConkey DJ, McConnell MJ, McDermott C, McDonald C,
McInerney GM, McKenna SL, McLaughlin B, McLean PJ, McMaster CR, McQuibban GA,
Meijer AJ, Meisler MH, Meléndez A, Melia TJ, Melino G, Mena MA, Menendez JA, MennaBarreto RF, Menon MB, Menzies FM, Mercer CA, Merighi A, Merry DE, Meschini S, Meyer
CG, Meyer TF, Miao CY, Miao JY, Michels PA, Michiels C, Mijaljica D, Milojkovic A, Minucci S,
Miracco C, Miranti CK, Mitroulis I, Miyazawa K, Mizushima N, Mograbi B, Mohseni S, Molero
X, Mollereau B, Mollinedo F, Momoi T, Monastyrska I, Monick MM, Monteiro MJ, Moore
MN, Mora R, Moreau K, Moreira PI, Moriyasu Y, Moscat J, Mostowy S, Mottram JC, Motyl T,
Moussa CE, Müller S, Muller S, Münger K, Münz C, Murphy LO, Murphy ME, Musarò A,
Mysorekar I, Nagata E, Nagata K, Nahimana A, Nair U, Nakagawa T, Nakahira K, Nakano H,
Nakatogawa H, Nanjundan M, Naqvi NI, Narendra DP, Narita M, Navarro M, Nawrocki ST,
Nazarko TY, Nemchenko A, Netea MG, Neufeld TP, Ney PA, Nezis IP, Nguyen HP, Nie D,
Nishino I, Nislow C, Nixon RA, Noda T, Noegel AA, Nogalska A, Noguchi S, Notterpek L, Novak
I, Nozaki T, Nukina N, Nürnberger T, Nyfeler B, Obara K, Oberley TD, Oddo S, Ogawa M,
Ohashi T, Okamoto K, Oleinick NL, Oliver FJ, Olsen LJ, Olsson S, Opota O, Osborne TF,
Ostrander GK, Otsu K, Ou JH, Ouimet M, Overholtzer M, Ozpolat B, Paganetti P, Pagnini U,
Pallet N, Palmer GE, Palumbo C, Pan T, Panaretakis T, Pandey UB, Papackova Z, Papassideri I,
Paris I, Park J, Park OK, Parys JB, Parzych KR, Patschan S, Patterson C, Pattingre S, Pawelek
References
135
JM, Peng J, Perlmutter DH, Perrotta I, Perry G, Pervaiz S, Peter M, Peters GJ, Petersen M,
Petrovski G, Phang JM, Piacentini M, Pierre P, Pierrefite-Carle V, Pierron G, Pinkas-Kramarski
R, Piras A, Piri N, Platanias LC, Pöggeler S, Poirot M, Poletti A, Poüs C, Pozuelo-Rubio M,
Prætorius-Ibba M, Prasad A, Prescott M, Priault M, Produit-Zengaffinen N, Progulske-Fox A,
Proikas-Cezanne T, Przedborski S, Przyklenk K, Puertollano R, Puyal J, Qian SB, Qin L, Qin ZH,
Quaggin SE, Raben N, Rabinowich H, Rabkin SW, Rahman I, Rami A, Ramm G, Randall G,
Randow F, Rao VA, Rathmell JC, Ravikumar B, Ray SK, Reed BH, Reed JC, Reggiori F, RégnierVigouroux A, Reichert AS, Reiners JJ Jr, Reiter RJ, Ren J, Revuelta JL, Rhodes CJ, Ritis K, Rizzo
E, Robbins J, Roberge M, Roca H, Roccheri MC, Rocchi S, Rodemann HP, Rodríguez de
Córdoba S, Rohrer B, Roninson IB, Rosen K, Rost-Roszkowska MM, Rouis M, Rouschop KM,
Rovetta F, Rubin BP, Rubinsztein DC, Ruckdeschel K, Rucker EB 3rd, Rudich A, Rudolf E, RuizOpazo N, Russo R, Rusten TE, Ryan KM, Ryter SW, Sabatini DM, Sadoshima J, Saha T, Saitoh
T, Sakagami H, Sakai Y, Salekdeh GH, Salomoni P, Salvaterra PM, Salvesen G, Salvioli R,
Sanchez AM, Sánchez-Alcázar JA, Sánchez-Prieto R, Sandri M, Sankar U, Sansanwal P,
Santambrogio L, Saran S, Sarkar S, Sarwal M, Sasakawa C, Sasnauskiene A, Sass M, Sato K,
Sato M, Schapira AH, Scharl M, Schätzl HM, Scheper W, Schiaffino S, Schneider C, Schneider
ME, Schneider-Stock R, Schoenlein PV, Schorderet DF, Schüller C, Schwartz GK, Scorrano L,
Sealy L, Seglen PO, Segura-Aguilar J, Seiliez I, Seleverstov O, Sell C, Seo JB, Separovic D,
Setaluri V, Setoguchi T, Settembre C, Shacka JJ, Shanmugam M, Shapiro IM, Shaulian E, Shaw
RJ, Shelhamer JH, Shen HM, Shen WC, Sheng ZH, Shi Y, Shibuya K, Shidoji Y, Shieh JJ, Shih
CM, Shimada Y, Shimizu S, Shintani T, Shirihai OS, Shore GC, Sibirny AA, Sidhu SB, Sikorska B,
Silva-Zacarin EC, Simmons A, Simon AK, Simon HU, Simone C, Simonsen A, Sinclair DA, Singh
R, Sinha D, Sinicrope FA, Sirko A, Siu PM, Sivridis E, Skop V, Skulachev VP, Slack RS, Smaili SS,
Smith DR, Soengas MS, Soldati T, Song X, Sood AK, Soong TW, Sotgia F, Spector SA, Spies CD,
Springer W, Srinivasula SM, Stefanis L, Steffan JS, Stendel R, Stenmark H, Stephanou A, Stern
ST, Sternberg C, Stork B, Strålfors P, Subauste CS, Sui X, Sulzer D, Sun J, Sun SY, Sun ZJ, Sung
JJ, Suzuki K, Suzuki T, Swanson MS, Swanton C, Sweeney ST, Sy LK, Szabadkai G, Tabas I,
Taegtmeyer H, Tafani M, Takács-Vellai K, Takano Y, Takegawa K, Takemura G, Takeshita F,
Talbot NJ, Tan KS, Tanaka K, Tanaka K, Tang D, Tang D, Tanida I, Tannous BA, Tavernarakis N,
Taylor GS, Taylor GA, Taylor JP, Terada LS, Terman A, Tettamanti G, Thevissen K, Thompson
CB, Thorburn A, Thumm M, Tian F, Tian Y, Tocchini-Valentini G, Tolkovsky AM, Tomino Y,
Tönges L, Tooze SA, Tournier C, Tower J, Towns R, Trajkovic V, Travassos LH, Tsai TF, Tschan
MP, Tsubata T, Tsung A, Turk B, Turner LS, Tyagi SC, Uchiyama Y, Ueno T, Umekawa M,
Umemiya-Shirafuji R, Unni VK, Vaccaro MI, Valente EM, Van den Berghe G, van der Klei IJ,
van Doorn W, van Dyk LF, van Egmond M, van Grunsven LA, Vandenabeele P, Vandenberghe
WP, Vanhorebeek I, Vaquero EC, Velasco G, Vellai T, Vicencio JM, Vierstra RD, Vila M, Vindis
C, Viola G, Viscomi MT, Voitsekhovskaja OV, von Haefen C, Votruba M, Wada K, WadeMartins R, Walker CL, Walsh CM, Walter J, Wan XB, Wang A, Wang C, Wang D, Wang F,
Wang F, Wang G, Wang H, Wang HG, Wang HD, Wang J, Wang K, Wang M, Wang RC, Wang
X, Wang X, Wang YJ, Wang Y, Wang Z, Wang ZC, Wang Z, Wansink DG, Ward DM, Watada H,
Waters SL, Webster P, Wei L, Weihl CC, Weiss WA, Welford SM, Wen LP, Whitehouse CA,
Whitton JL, Whitworth AJ, Wileman T, Wiley JW, Wilkinson S, Willbold D, Williams RL,
Williamson PR, Wouters BG, Wu C, Wu DC, Wu WK, Wyttenbach A, Xavier RJ, Xi Z, Xia P, Xiao
G, Xie Z, Xie Z, Xu DZ, Xu J, Xu L, Xu X, Yamamoto A, Yamamoto A, Yamashina S, Yamashita M,
136
References
Yan X, Yanagida M, Yang DS, Yang E, Yang JM, Yang SY, Yang W, Yang WY, Yang Z, Yao MC,
Yao TP, Yeganeh B, Yen WL, Yin JJ, Yin XM, Yoo OJ, Yoon G, Yoon SY, Yorimitsu T, Yoshikawa
Y, Yoshimori T, Yoshimoto K, You HJ, Youle RJ, Younes A, Yu L, Yu L, Yu SW, Yu WH, Yuan ZM,
Yue Z, Yun CH, Yuzaki M, Zabirnyk O, Silva-Zacarin E, Zacks D, Zacksenhaus E, Zaffaroni N,
Zakeri Z, Zeh HJ 3rd, Zeitlin SO, Zhang H, Zhang HL, Zhang J, Zhang JP, Zhang L, Zhang L,
Zhang MY, Zhang XD, Zhao M, Zhao YF, Zhao Y, Zhao ZJ, Zheng X, Zhivotovsky B, Zhong Q,
Zhou CZ, Zhu C, Zhu WG, Zhu XF, Zhu X, Zhu Y, Zoladek T, Zong WX, Zorzano A, Zschocke J,
Zuckerbraun B. 2012. Guidelines for the use and interpretation of assays for monitoring
autophagy. Autophagy. 8:445-544.
Klionsky DJ, Cregg JM, Dunn WA Jr. 2003. A unified nomenclature for yeast autophagyrelated genes. Dev Cell. 5:539-545.
Ko HS, Uehara T, Tsuruma K, Nomura Y. 2004. Ubiquilin interacts with ubiquitylated proteins
and proteasome through its ubiquitin-associated and ubiquitin-like domains. FEBS Lett.
566:110-114.
Koga H, Kaushik S, Cuervo AM. 2010. Altered lipid content inhibits autophagic vesicular
fusion. FASEB J. 24:3052-3065.
Korolchuk VI, Mansilla A, Menzies FM, Rubinsztein DC. 2009. Autophagy inhibition
compromises degradation of ubiquitin-proteasome pathway substrates. Mol Cell. 33:517527.
Krames ES. 2014. The Dorsal Root Ganglion in Chronic Pain and as a Target for
Neuromodulation: A Review. Neuromodulation. doi: 10.1111/ner.12247.
Kreutzer R, Kreutzer M, Pröpsting MJ, Sewell AC, Leeb T, Naim HY, Baumgärtner W. 2008.
Insights into post-translational processing of beta-galactosidase in an animal model
resembling late infantile human G-gangliosidosis. J Cell Mol Med. 12:1661-1671.
Kreutzer R, Leeb T, Müller G, Moritz A, Baumgärtner W. 2005. A duplication in the canine
beta-galactosidase gene GLB1 causes exon skipping and GM1-gangliosidosis in Alaskan
huskies. Genetics. 170:1857-1861.
Kristensen AR, Schandorff S, Høyer-Hansen M, Nielsen MO, Jäättelä M, Dengjel J, Andersen
JS. 2008. Ordered organelle degradation during starvation-induced autophagy. Mol Cell
Proteomics. 7:2419-2428.
Kroemer, G., Marino, G., Levine, B. 2010. Autophagy and the integrated stress response.
Mol. Cell. 40:280–293.
Kruer MC. 2013. The neuropathology of neurodegeneration with brain iron accumulation. Int
Rev Neurobiol. 110:165-194.
References
137
Lamb CA, Dooley HC, Tooze SA. 2013. Endocytosis and autophagy: Shared machinery for
degradation. Bioessays. 35:34-45.
Lawson SN. 1992. Morphologyand biochemical cell types of sensory neurons. in Scott AS,
Sensory Neurons, Diversity, Development and Plasticity. New York: Oxford University Press.
p 27–59.
Lebrand C, Corti M, Goodson H, Cosson P, Cavalli V, Mayran N, Fauré J, Gruenberg J. 2002.
Late endosome motility depends on lipids via the small GTPase Rab7. EMBO J. 21:1289-1300.
Ledeen RW. 1978. Ganglioside structures and distribution: are they localized at the nerve
ending? J Supramol Struct. 8:1-17.
Ledeen RW, Wu G, Lu ZH, Kozireski-Chuback D, Fang Y. 1998. The role of GM1 and other
gangliosides in neuronal differentiation. Overview and new finding. Ann N Y Acad Sci.
845:161-175.
Lee BY, Han JA, Im JS, Morrone A, Johung K, Goodwin EC, Kleijer WJ, DiMaio D, Hwang ES.
2006. Senescence-associated beta-galactosidase is lysosomal beta-galactosidase. Aging Cell.
5:187-195.
Lee IH, Cao L, Mostoslavsky R, Lombard DB, Liu J, Bruns NE, Tsokos M, Alt FW, Finkel T. 2008.
A role for the NAD-dependent deacetylase Sirt1 in the regulation of autophagy. Proc Natl
Acad Sci U S A. 105:3374-3379.
Lee JY, Koga H, Kawaguchi Y, Tang W, Wong E, Gao YS, Pandey UB, Kaushik S, Tresse E, Lu J,
Taylor JP, Cuervo AM, Yao TP. 2010. HDAC6 controls autophagosome maturation essential
for ubiquitin-selective quality-control autophagy. EMBO J. 29:969-980.
Lee S, Sato Y, Nixon RA. 2011a. Lysosomal proteolysis inhibition selectively disrupts axonal
transport of degradative organelles and causes an Alzheimer’s-like axonal dystrophy. J.
Neurosci. 31:7817–7830.
Lemasters JJ. 2014. Variants of mitochondrial autophagy: Types 1 and 2 mitophagy and
micromitophagy (Type 3). Redox Biol. 2:749-754.
Leon A, Benvegnu D, Dal Toso R, Presti D, Facci L, Giorgi O, Toffano G. 1984. Dorsal root
ganglia and nerve growth factor: A model for understanding the mechanism of GM1 effects
on neuronal repair. J. Neurosci. Res. 12:277–287.
Levi S, Finazzi D. 2014. Neurodegeneration with brain iron accumulation: update on
pathogenic mechanisms. Front Pharmacol. 5:99.
Levine B, Kroemer G. 2008. Autophagy in the pathogenesis of disease. Cell. 132:27-42.
138
References
Li HY, Say EH, Zhou XF. 2007. Isolation and characterization of neural crest progenitors from
adult dorsal root ganglia. Stem Cells. 25:2053-2065.
Li M, Hou Y, Wang J, Chen X, Shao ZM, Yin XM. 2011. Kinetics comparisons of mammalian
Atg4 homologues indicate selective preferences toward diverse Atg8 substrates. J Biol Chem.
286:7327-7338.
Li R. 1998. Culture methods for selective growth of normal rat and human Schwann cells.
Methods Cell Biol. 57:167-86.
Li WW, Li J, Bao JK. 2012. Microautophagy: lesser-known self-eating. Cell Mol Life Sci.
69:1125-1136.
Li Y, Li S, Qin X, Hou W, Dong H, Yao L, Xiong L. 2014. The pleiotropic roles of sphingolipid
signaling in autophagy. Cell Death Dis. 5:e1245.
Limpert AS, Karlo JC, Landreth GE. 2007. Nerve growth factor stimulates the concentration of
TrkA within lipid rafts and extracellular signal-regulated kinase activation through c-Cblassociated protein. Mol Cell Biol. 27:5686-5698.
Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M, Clamp M, Chang JL,
Kulbokas EJ 3rd, Zody MC, Mauceli E, Xie X, Breen M, Wayne RK, Ostrander EA, Ponting CP,
Galibert F, Smith DR, DeJong PJ, Kirkness E, Alvarez P, Biagi T, Brockman W, Butler J, Chin
CW, Cook A, Cuff J, Daly MJ, DeCaprio D, Gnerre S, Grabherr M, Kellis M, Kleber M,
Bardeleben C, Goodstadt L, Heger A, Hitte C, Kim L, Koepfli KP, Parker HG, Pollinger JP, Searle
SM, Sutter NB, Thomas R, Webber C, Baldwin J, Abebe A, Abouelleil A, Aftuck L, Ait-Zahra M,
Aldredge T, Allen N, An P, Anderson S, Antoine C, Arachchi H, Aslam A, Ayotte L, Bachantsang
P, Barry A, Bayul T, Benamara M, Berlin A, Bessette D, Blitshteyn B, Bloom T, Blye J,
Boguslavskiy L, Bonnet C, Boukhgalter B, Brown A, Cahill P, Calixte N, Camarata J,
Cheshatsang Y, Chu J, Citroen M, Collymore A, Cooke P, Dawoe T, Daza R, Decktor K, DeGray
S, Dhargay N, Dooley K, Dooley K, Dorje P, Dorjee K, Dorris L, Duffey N, Dupes A,
Egbiremolen O, Elong R, Falk J, Farina A, Faro S, Ferguson D, Ferreira P, Fisher S, FitzGerald
M, Foley K, Foley C, Franke A, Friedrich D, Gage D, Garber M, Gearin G, Giannoukos G, Goode
T, Goyette A, Graham J, Grandbois E, Gyaltsen K, Hafez N, Hagopian D, Hagos B, Hall J, Healy
C, Hegarty R, Honan T, Horn A, Houde N, Hughes L, Hunnicutt L, Husby M, Jester B, Jones C,
Kamat A, Kanga B, Kells C, Khazanovich D, Kieu AC, Kisner P, Kumar M, Lance K, Landers T,
Lara M, Lee W, Leger JP, Lennon N, Leuper L, LeVine S, Liu J, Liu X, Lokyitsang Y, Lokyitsang T,
Lui A, Macdonald J, Major J, Marabella R, Maru K, Matthews C, McDonough S, Mehta T,
Meldrim J, Melnikov A, Meneus L, Mihalev A, Mihova T, Miller K, Mittelman R, Mlenga V,
Mulrain L, Munson G, Navidi A, Naylor J, Nguyen T, Nguyen N, Nguyen C, Nguyen T, Nicol R,
Norbu N, Norbu C, Novod N, Nyima T, Olandt P, O'Neill B, O'Neill K, Osman S, Oyono L, Patti
C, Perrin D, Phunkhang P, Pierre F, Priest M, Rachupka A, Raghuraman S, Rameau R, Ray V,
Raymond C, Rege F, Rise C, Rogers J, Rogov P, Sahalie J, Settipalli S, Sharpe T, Shea T,
Sheehan M, Sherpa N, Shi J, Shih D, Sloan J, Smith C, Sparrow T, Stalker J, Stange-Thomann
References
139
N, Stavropoulos S, Stone C, Stone S, Sykes S, Tchuinga P, Tenzing P, Tesfaye S, Thoulutsang D,
Thoulutsang Y, Topham K, Topping I, Tsamla T, Vassiliev H, Venkataraman V, Vo A, Wangchuk
T, Wangdi T, Weiand M, Wilkinson J, Wilson A, Yadav S, Yang S, Yang X, Young G, Yu Q,
Zainoun J, Zembek L, Zimmer A, Lander ES. 2005. Genome sequence, comparative analysis
and haplotype structure of the domestic dog. Nature. 438:803-819.
Liu D, Bi Y, Liu Z, Liu H, Li Z. 2014. The expression of vesicular glutamate transporter 3 and
vesicular monoamine transporter 2 induced by brain-derived neurotrophic factor in dorsal
root ganglion neurons in vitro. Brain Res Bull. 100:93-106.
Liu K, Czaja MJ. 2013. Regulation of lipid stores and metabolism by lipophagy. Cell Death
Differ. 20:3-11.
Lo Giudice T, Lombardi F, Santorelli FM, Kawarai T, Orlacchio A. 2014. Hereditary spastic
paraplegia: clinical-genetic characteristics and evolving molecular mechanisms. Exp Neurol.
261:518-539.
Longatti A, Tooze SA. 2012. Recycling endosomes contribute to autophagosome formation.
Autophagy. 8:1682-1683.
Lowe JS, Leigh N. 2002. Disorders of movement and system and degeneration. In: Graham
DI, Lantos PL (Ed). Greenfield’s Neuropathology Volume 2. New York: Oxford University
press. p. 389-391.
Lu Q, Yang P, Huang X, Hu W, Guo B, Wu F, Lin L, Kovács AL, Yu L, Zhang H. 2011. The WD40
repeat PtdIns(3)P-binding protein EPG-6 regulates progression of omegasomes to
autophagosomes. Dev Cell. 21:343-357.
Luzio JP, Pryor PR, Bright NA. 2007. Lysosomes: fusion and function. Nat Rev Mol Cell Biol.
8:622-632.
Luzio JP, Rous BA, Bright NA, Pryor PR, Mullock BM, Piper RC. 2000. Lysosome-endosome
fusion and lysosome biogenesis. J Cell Sci. 113:1515-1524.
Ma JF, Huang Y, Chen SD, Halliday G. 2010. Immunohistochemical evidence for
macroautophagy in neurones and endothelial cells in Alzheimer's disease. Neuropathol Appl
Neurobiol. 36:312-319.
Manzoni C, Mamais A, Dihanich S, Abeti R, Soutar MP, Plun-Favreau H, Giunti P, Tooze SA,
Bandopadhyay R, Lewis PA. 2013. Inhibition of LRRK2 kinase activity stimulates
macroautophagy. Biochim Biophys Acta. 1833:2900-2910.
Mariño G, Uría J A, Puente XS, Quesada V, Bordallo J, López-Otín C. 2003. J. Biol. Chem.
278:3671–3678.
140
References
Martin DD, Ladha S, Ehrnhoefer DE, Hayden MR. 2014. Autophagy in Huntington disease and
huntingtin in autophagy. Trends Neurosci. pii: S0166-2236(14)00158-1.
Martina JA, Chen Y, Gucek M, Puertollano R. 2012. MTORC1 functions as a transcriptional
regulator of autophagy by preventing nuclear transport of TFEB. Autophagy. 8:903-914.
Martinez-Vicente M, Talloczy Z, Wong E, Tang G, Koga H, Kaushik S, de Vries R, Arias E, Harris
S, Sulzer D, Cuervo AM. 2010. Cargo recognition failure is responsible for inefficient
autophagy in Huntington's disease. Nat Neurosci. 13:567-576.
Matsunaga K, Saitoh T, Tabata K, Omori H, Satoh T, Kurotori N, Maejima I, Shirahama-Noda
K, Ichimura T, Isobe T, Akira S, Noda T, Yoshimori T. 2009. Two Beclin 1-binding proteins,
Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nat Cell Biol.
11:385-396.
Mazzulli JR, Xu YH, Sun Y, Knight AL, McLean PJ, Caldwell GA, Sidransky E, Grabowski GA,
Krainc D. 2011. Gaucher disease glucocerebrosidase and α-synuclein form a bidirectional
pathogenic loop in synucleinopathies. Cell. 146:37-52.
McJarrow P, Schnell N, Jumpsen J, Clandinin T. 2009. Influence of dietary gangliosides on
neonatal brain development. Nutr Rev. 67:451-463.
Mekahli D, Bultynck G, Parys JB, De Smedt H, Missiaen L. 2011. Endoplasmic-reticulum
calcium depletion and disease. Cold Spring Harb Perspect Biol. 3:a004317.
Metcalf D, Isaacs AM. 2010. The role of ESCRT proteins in fusion events involving lysosomes,
endosomes and autophagosomes. Biochem Soc Trans. 38:1469-1473.
Mizushima N, Kuma A, Kobayashi Y, Yamamoto A, Matsubae M, Takao T, Natsume T, Ohsumi
Y, Yoshimori T. 2003. Mouse Apg16L, a novel WD-repeat protein, targets to the autophagic
isolation membrane with the Apg12-Apg5 conjugate. J Cell Sci. 116:1679-1688.
Moore CE, Omikorede O, Gomez E, Willars GB, Herbert TP. 2011. PERK activation at low
glucose concentration is mediated by SERCA pump inhibition and confers preemptive
cytoprotection to pancreatic β-cells. Mol Endocrinol. 25:315-326.
Moreau K, Ravikumar B, Renna M, Puri C, Rubinsztein DC. 2011. Autophagosome precursor
maturation requires homotypic fusion. Cell. 146:303-317.
Morgan BR, Coates JR, Johnson GC, Bujnak AC, Katz ML. 2013. Characterization of intercostal
muscle pathology in canine degenerative myelopathy: a disease model for amyotrophic
lateral sclerosis. J Neurosci Res. 91:1639-1650.
References
141
Moughamian AJ, Holzbaur EL. 2012a. Synaptic vesicle distribution by conveyor belt. Cell.
148:849-851.
Moughamian AJ, Holzbaur EL. 2012b. Dynactin is required for transport initiation from the
distal axon. Neuron. 74:331-343.
Müller G, Alldinger S, Moritz A, Zurbriggen A, Kirchhof N, Sewell A, Baumgärtner W. 2001.
GM1-gangliosidosis in Alaskan huskies: clinical and pathologic findings. Vet Pathol. 38:281290.
Mukaetova-Ladinska EB, Hurt J, Jakes R, Xuereb J, Honer WG, Wischik CM. 2000. Alphasynuclein inclusions in Alzheimer and Lewy body diseases. J Neuropathol Exp Neurol. 59:408417.
Murphy RF. 1991. Maturation models for endosome and lysosome biogenesis. Trends Cell
Biol. 1:77-82.
Namaka MP, Sawchuk M, MacDonald SC, Jordan LM, Hochman S. 2001. Neurogenesis in
postnatal mouse dorsal root ganglia. Exp Neurol. 172:60-69.
Nardocci N, Zorzi G. 2013. Axonal dystrophies. Handb Clin Neurol. 113:1919-1924.
Navarro A, Boveris A. 2004. Rat brain and liver mitochondria develop oxidative stress and
lose enzymatic activities on aging. Am J Physiol Regul Integr Comp Physiol. 287:1244-1249.
N'Diaye EN, Debnath J, Brown EJ. 2009. Ubiquilins accelerate autophagosome maturation
and promote cell survival during nutrient starvation. Autophagy. 5:573-575.
Nishino I, Fu J, Tanji K, Yamada T, Shimojo S, Koori T, Mora M, Riggs JE, Oh SJ, Koga Y, Sue
CM, Yamamoto A, Murakami N, Shanske S, Byrne E, Bonilla E, Nonaka I, DiMauro S, Hirano
M. 2000. Primary LAMP-2 deficiency causes X-linked vacuolar cardiomyopathy and
myopathy (Danon disease). Nature. 406:906-910.
Nixon RA. 2013. The role of autophagy in neurodegenerative disease. Nat Med. 19:983-997.
Nixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, Cataldo A, Cuervo AM. 2005. Extensive
involvement of autophagy in Alzheimer disease: an immuno-electron microscopy study. J
Neuropathol Exp Neurol. 64:113-122.
Novarino G, Fenstermaker AG, Zaki MS, Hofree M, Silhavy JL, Heiberg AD, Abdellateef M,
Rosti B, Scott E, Mansour L, Masri A, Kayserili H, Al-Aama JY, Abdel-Salam GM, Karminejad A,
Kara M, Kara B, Bozorgmehri B, Ben-Omran T, Mojahedi F, Mahmoud IG, Bouslam N,
Bouhouche A, Benomar A, Hanein S, Raymond L, Forlani S, Mascaro M, Selim L, Shehata N,
Al-Allawi N, Bindu PS, Azam M, Gunel M, Caglayan A, Bilguvar K, Tolun A, Issa MY, Schroth J,
142
References
Spencer EG, Rosti RO, Akizu N, Vaux KK, Johansen A, Koh AA, Megahed H, Durr A, Brice A,
Stevanin G, Gabriel SB, Ideker T, Gleeson JG. 2014. Exome sequencing links corticospinal
motor neuron disease to common neurodegenerative disorders. Science. 343:506-511.
Oderfeld-Nowak B, Jegliński W, Skup M, Skangiel-Kramska J, Zaremba M, Koczyk D. 1993.
Differential effects of GM1 ganglioside treatment on glial fibrillary acidic protein content in
the rat septum and hippocampus after partial interruption of their connections. J
Neurochem. 61:116-119.
Ohi T, Furukawa S, Hayashi K, Matsukura S. 1990. Ganglioside stimulation of nerve growth
factor synthesis in cultured rat Schwann cells. Biochem Int. 20:739-746.
Ohshita T, Kominami E, Ii K, Katunuma N. 1986. Effect of starvation and refeeding on
autophagy and heterophagy in rat liver. J Biochem. 100:623-632.
Omar M, Bock P, Kreutzer R, Ziege S, Imbschweiler I, Hansmann F, Peck CT, Baumgärtner W,
Wewetzer K. 2011. Defining the morphological phenotype: 2',3'-cyclic nucleotide 3'phosphodiesterase (CNPase) is a novel marker for in situ detection of canine but not rat
olfactory ensheathing cells. Cell Tissue Res. 344:391-405.
Orsi A, Razi M, Dooley HC, Robinson D, Weston AE, Collinson LM, Tooze SA. 2012. Dynamic
and transient interactions of Atg9 with autophagosomes, but not membrane integration, are
required for autophagy. Mol Biol Cell. 23:1860-1873.
Oz-Levi D, Ben-Zeev B, Ruzzo EK, Hitomi Y, Gelman A, Pelak K, Anikster Y, Reznik-Wolf H, BarJoseph I, Olender T, Alkelai A, Weiss M, Ben-Asher E, Ge D, Shianna KV, Elazar Z, Goldstein
DB, Pras E, Lancet D. 2012. Mutation in TECPR2 reveals a role for autophagy in hereditary
spastic paraparesis. Am J Hum Genet. 91:1065-1072.
Paigen, K. 1995. A miracle enough: the power of mice. Nature Med. 1:215–220.
Päiväläinen S, Nissinen M, Honkanen H, Lahti O, Kangas SM, Peltonen J, Peltonen S, Heape
AM. 2008. Myelination in mouse dorsal root ganglion/Schwann cell cocultures. Mol Cell
Neurosci. 37:568-578.
Palombella VJ, Rando OJ, Goldberg AL, Maniatis T. 1994. The ubiquitin-proteasome pathway
is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa
B. Cell. 78:773-785.
Paloneva J, Kestilä M, Wu J, Salminen A, Böhling T, Ruotsalainen V, Hakola P, Bakker AB,
Phillips JH, Pekkarinen P, Lanier LL, Timonen T, Peltonen L. 2000. Loss-of-function mutations
in TYROBP (DAP12) result in a presenile dementia with bone cysts. Nat Genet. 25(3):357-61.
References
143
Paloneva J, Manninen T, Christman G, Hovanes K, Mandelin J, Adolfsson R, Bianchin M, Bird
T, Miranda R, Salmaggi A, Tranebjaerg L, Konttinen Y, Peltonen L. 2002. Mutations in two
genes encoding different subunits of a receptor signaling complex result in an identical
disease phenotype. Am J Hum Genet. 71(3):656-62.
Pan PY, Yue Z. 2014. Genetic causes of Parkinson's disease and their links to autophagy
regulation. Parkinsonism Relat Disord. 20:S154-157.
Pankiv S, Alemu EA, Brech A, Bruun JA, Lamark T, Overvatn A, Bjørkøy G, Johansen T. 2010.
FYCO1 is a Rab7 effector that binds to LC3 and PI3P to mediate microtubule plus enddirected vesicle transport. J Cell Biol. 188:253-269.
Park J, Lee BS, Choi JK, Means RE, Choe J, Jung JU. 2002. Herpesviral protein targets a cellular
WD repeat endosomal protein to downregulate T lymphocyte receptor expression.
Immunity. 17:221-233.
Park WD, O'Brien JF, Lundquist PA, Kraft DL, Vockley CW, Karnes PS, Patterson MC, Snow K.
2003. Identification of 58 novel mutations in Niemann-Pick disease type C: correlation with
biochemical phenotype and importance of PTC1-like domains in NPC1. Hum Mutat. 22:313325.
Pawelec A, Arsić J, Kölling R. 2010. Mapping of Vps21 and HOPS binding sites in Vps8 and
effect of binding site mutants on endocytic trafficking. Eukaryot Cell. 9:602-610.
Peña-Llopis S, Brugarolas J. 2011. TFEB, a novel mTORC1 effector implicated in lysosome
biogenesis, endocytosis and autophagy. Cell Cycle. 10:3987-3988.
Perkins LA, Cain LD. 1995. Basic fibroblast growth factor (bFGF) increases the survival of
embryonic and postnatal basal forebrain cholinergic neurons in primary culture. Int J Dev
Neurosci. 13:51-61.
Pernber Z, Blennow K, Bogdanovic N, Månsson JE, Blomqvist M. 2012. Altered distribution of
the gangliosides GM1 and GM2 in Alzheimer's disease. Dement Geriatr Cogn Disord. 33:174188.
Pickford F, Masliah E, Britschgi M, Lucin K, Narasimhan R, Jaeger PA, Small S, Spencer B,
Rockenstein E, Levine B, Wyss-Coray T. 2008. The autophagy-related protein beclin 1 shows
reduced expression in early Alzheimer disease and regulates amyloid beta accumulation in
mice. J Clin Invest. 118:2190–2199.
Pinho CM, Teixeira PF, Glaser E. 2014. Mitochondrial import and degradation of amyloid-β
peptide. Biochim Biophys Acta. 1837:1069-1074.
144
References
Platt FM, Boland B, van der Spoel AC. 2012. The cell biology of disease: lysosomal storage
disorders: the cellular impact of lysosomal dysfunction. J Cell Biol. 199:723-734.
Polson HE, de Lartigue J, Rigden DJ, Reedijk M, Urbé S, Clague MJ, Tooze SA. 2010.
Mammalian Atg18 (WIPI2) localizes to omegasome-anchored phagophores and positively
regulates LC3 lipidation. Autophagy. 6:506-522.
Potschka H, Fischer A, von Rüden EL, Hülsmeyer V, Baumgärtner W. 2013. Canine epilepsy as
a translational model? Epilepsia. 54:571-579.
Prendergast J, Umanah GK, Yoo SW, Lagerlöf O, Motari MG, Cole RN, Huganir RL, Dawson
TM, Dawson VL, Schnaar RL. 2014. Ganglioside regulation of AMPA receptor trafficking. J
Neurosci. 34:13246-13258.
Proikas-Cezanne T, Waddell S, Gaugel A, Frickey T, Lupas A, Nordheim A. 2004. WIPI-1alpha
(WIPI49), a member of the novel 7-bladed WIPI protein family, is aberrantly expressed in
human cancer and is linked to starvation-induced autophagy. Oncogene. 23:9314-9325.
Pujol C, Klein KA, Romanov GA, Palmer LE, Cirota C, Zhao Z, Bliska JB. 2009. Yersinia pestis
can reside in autophagosomes and avoid xenophagy in murine macrophages by preventing
vacuole acidification. Infect Immun. 77:2251-2261.
Puri C, Renna M, Bento CF, Moreau K, Rubinsztein DC. 2013. Diverse autophagosome
membrane sources coalesce in recycling endosomes. Cell. 154:1285-1299.
Ramesh G, Santana-Gould L, Inglis FM, England JD, Philipp MT. 2013. The Lyme disease
spirochete Borrelia burgdorferi induces inflammation and apoptosis in cells from dorsal root
ganglia. J Neuroinflammation. 10:88.
Ramirez A, Heimbach A, Gründemann J, Stiller B, Hampshire D, Cid LP, Goebel I, Mubaidin
AF, Wriekat AL, Roeper J, Al-Din A, Hillmer AM, Karsak M, Liss B, Woods CG, Behrens MI,
Kubisch C. 2006. Hereditary parkinsonism with dementia is caused by mutations in ATP13A2,
encoding a lysosomal type 5 P-type ATPase. Nat Genet. 38:1184-1191.
Ramonet D, Daher JP, Lin BM, Stafa K, Kim J, Banerjee R, Westerlund M, Pletnikova O,
Glauser L, Yang L, Liu Y, Swing DA, Beal MF, Troncoso JC, McCaffery JM, Jenkins NA,
Copeland NG, Galter D, Thomas B, Lee MK, Dawson TM, Dawson VL, Moore DJ. 2011.
Dopaminergic neuronal loss, reduced neurite complexity and autophagic abnormalities in
transgenic mice expressing G2019S mutant LRRK2. PLoS One. 6:e18568.
Ravikumar B, Acevedo-Arozena A, Imarisio S, Berger Z, Vacher C, O'Kane CJ, Brown SD,
Rubinsztein DC. 2005. Dynein mutations impair autophagic clearance of aggregate-prone
proteins. Nat Genet. 37:771-776.
References
145
Ravikumar B, Imarisio S, Sarkar S, O'Kane CJ, Rubinsztein DC. 2008. Rab5 modulates
aggregation and toxicity of mutant huntingtin through macroautophagy in cell and fly
models of Huntington disease. J Cell Sci. 121:1649-1660.
Ravikumar B, Moreau K, Jahreiss L, Puri C, Rubinsztein D.C. 2010. Plasma membrane
contributes to the formation of pre-autophagosomal structures. Nat Cell Biol. 12:747-757.
Ravikumar B, Vacher C, Berger Z, Davies JE, Luo S, Oroz LG, Scaravilli F, Easton DF, Duden R,
O'Kane CJ, Rubinsztein DC. 2004. Inhibition of mTOR induces autophagy and reduces toxicity
of polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet.
36:585-595.
Razi M, Chan EYW, Tooze SA. 2009. Early endosomes and endosomal coatomer are required
for autophagy. J Cell Biol 185:305–321.
Regier DS. Tifft CJ. 2013.GLB1-Related Disorders.in: Pagon RA, Adam MP, Ardinger HH, Bird
TD, Dolan CR, Fong CT, Smith RJH, Stephens K. GeneReviews®. Seattle (WA): University of
Washington, Seattle: 1993-2014.
Riku Y, Ando T, Goto Y, Mano K, Iwasaki Y, Sobue G, Yoshida M. 2014. Early pathologic
changes in hereditary diffuse leukoencephalopathy with spheroids. J Neuropathol Exp
Neurol. 73(12):1183-90.
Roederer M, Bowser R, Murphy RF. 1987. Kinetics and temperature dependence of exposure
of endocytosed material to proteolytic enzymes and low pH: evidence for a maturation
model for the formation of lysosomes. J Cell Physiol. 131:200-209.
Roggenkamp D, Falkner S, Stäb F, Petersen M, Schmelz M, Neufang G. 2012. Atopic
keratinocytes induce increased neurite outgrowth in a coculture model of porcine dorsal
root ganglia neurons and human skin cells. J Invest Dermatol. 132:1892-1900.
Ron E, Shenkman M, Groisman B, Izenshtein Y, Leitman J, Lederkremer GZ. 2011. Bypass of
glycan-dependent glycoprotein delivery to ERAD by up-regulated EDEM1. Mol Biol Cell.
22:3945-3954.
Rong Y, Liu M, Ma L, Du W, Zhang H, Tian Y, Cao Z, Li Y, Ren H, Zhang C, Li L, Chen S, Xi J, Yu L.
2012. Clathrin and phosphatidylinositol-4,5-bisphosphate regulate autophagic lysosome
reformation. Nat Cell Biol. 14:924-934.
Roscic A, Baldo B, Crochemore C, Marcellin D, Paganetti P. 2011. Induction of autophagy
with catalytic mTOR inhibitors reduces huntingtin aggregates in a neuronal cell model. J
Neurochem. 119:398-407.
146
References
Rotblat B, Southwell AL, Ehrnhoefer DE, Skotte NH, Metzler M, Franciosi S, Leprivier G,
Somasekharan SP, Barokas A, Deng Y, Tang T, Mathers J, Cetinbas N, Daugaard M, Kwok B, Li
L, Carnie CJ, Fink D, Nitsch R, Galpin JD, Ahern CA, Melino G, Penninger JM, Hayden MR,
Sorensen PH. 2014. HACE1 reduces oxidative stress and mutant Huntingtin toxicity by
promoting the NRF2 response. Proc Natl Acad Sci U S A. 111:3032-3037.
Rouillé Y, Rohn W, Hoflack B. 2000. Targeting of lysosomal proteins. Semin Cell Dev Biol.
11:165-171.
Rubio N, Coupienne I, Di Valentin E, Heirman I, Grooten J, Piette J, Agostinis P. 2012.
Spatiotemporal autophagic degradation of oxidatively damaged organelles after
photodynamic stress is amplified by mitochondrial reactive oxygen species. Autophagy.
8:1312-1324.
Ruscheweyh R, Forsthuber L, Schoffnegger D, Sandkühler J. 2007. Modification of classical
neurochemical markers in identified primary afferent neurons with Abeta-, Adelta-, and Cfibers after chronic constriction injury in mice. J Comp Neurol. 502:325-336.
Rusnati M, Tanghetti E, Urbinati C, Tulipano G, Marchesini S, Ziche M, Presta M. 1999.
Interaction of fibroblast growth factor-2 (FGF-2) with free gangliosides: biochemical
characterization and biological consequences in endothelial cell cultures. Mol Biol Cell.
10:313-327.
Rusnati M, Urbinati C, Tanghetti E, Dell'Era P, Lortat-Jacob H, Presta M. 2002. Cell membrane
GM1 ganglioside is a functional coreceptor for fibroblast growth factor 2. Proc Natl Acad Sci
U S A. 99:4367-4372.
Russell RC, Yuan HX, Guan KL. 2014. Autophagy regulation by nutrient signaling. Cell Res.
24:42-57.
Sábado J, Casanovas A, Tarabal O, Hereu M, Piedrafita L, Calderó J, Esquerda JE. 2014.
Accumulation of misfolded SOD1 in dorsal root ganglion degenerating proprioceptive
sensory neurons of transgenic mice with amyotrophic lateral sclerosis. Biomed Res Int.
2014:852163.
Saftig P, Beertsen W, Eskelinen EL. 2008. LAMP-2: a control step for phagosome and
autophagosome maturation. Autophagy. 4:510-512.
Sahu R, Kaushik S, Clement CC, Cannizzo ES, Scharf B, Follenzi A, Potolicchio I, Nieves E,
Cuervo AM, Santambrogio L. 2011. Microautophagy of cytosolic proteins by late endosomes.
Dev Cell. 20:131-139.
References
147
Saitsu H, Nishimura T, Muramatsu K, Kodera H, Kumada S, Sugai K, Kasai-Yoshida E, Sawaura
N, Nishida H, Hoshino A, Ryujin F, Yoshioka S, Nishiyama K, Kondo Y, Tsurusaki Y, Nakashima
M, Miyake N, Arakawa H, Kato M, Mizushima N, Matsumoto N. 2013. De novo mutations in
the autophagy gene WDR45 cause static encephalopathy of childhood with
neurodegeneration in adulthood. Nat Genet. 45:445-9, 449e1.
Sancak Y, Bar-Peled L, Zoncu R, Markhard AL, Nada S, Sabatini DM. 2010. Ragulator-Rag
complex targets mTORC1 to the lysosomal surface and is necessary for its activation by
amino acids. Cell. 141:290-303.
Sanchez-Varo R, Trujillo-Estrada L, Sanchez-Mejias E, Torres M, Baglietto-Vargas D, MorenoGonzalez I, De Castro V, Jimenez S, Ruano D, Vizuete M, Davila JC, Garcia-Verdugo JM,
Jimenez AJ, Vitorica J, Gutierrez A. 2012. Abnormal accumulation of autophagic vesicles
correlates with axonal and synaptic pathology in young Alzheimer's mice hippocampus Acta
Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino VA, Di Malta C,
Donaudy F, Embrione V, Polishchuk RS, Banfi S, Parenti G, Cattaneo E, Ballabio A. 2009. A
gene network regulating lysosomal biogenesis and function. Science. 325:473-477.
Sasaki S, Horie Y, Iwata M. 2007. Mitochondrial alterations in dorsal root ganglion cells in
sporadic amyotrophic lateral sclerosis. Acta Neuropathol. 114:633-639.
Saxena S, Bucci C, Weis J, Kruttgen A. 2005. The small GTPase Rab7 controls the endosomal
trafficking and neuritogenic signaling of the nerve growth factor receptor TrkA. J Neurosci.
25:10930-10940.
Schmidt RE, Chae HY, Parvin CA, Roth KA. 1990. Neuroaxonal dystrophy in aging human
sympathetic ganglia. Am J Pathol. 136:1327-1338.
Schneider SA, Dusek P, Hardy J, Westenberger A, Jankovic J, Bhatia KP. 2013. Genetics and
Pathophysiology of Neurodegeneration with Brain Iron Accumulation (NBIA). Curr
Neuropharmacol 11:59-79.
Schneider SA, Hardy J, Bhatia KP. 2012. Syndromes of neurodegeneration with brain iron
accumulation (NBIA): an update on clinical presentations, histological and genetic
underpinnings, and treatment considerations. Mov Disord 27:42-53.
Schreiber A, Peter M. 2014. Substrate recognition in selective autophagy and the ubiquitinproteasome system. Biochim Biophys Acta. 1843:163-181.
Settembre C, Ballabio A. 2011. TFEB regulates autophagy: an integrated coordination of
cellular degradation and recycling processes. Autophagy. 7:1379–1381.
148
References
Settembre C, De Cegli R, Mansueto G, Saha PK, Vetrini F, Visvikis O, Huynh T, Carissimo A,
Palmer D, Klisch TJ, Wollenberg AC, Di Bernardo D, Chan L, Irazoqui JE, Ballabio A. 2013. TFEB
controls cellular lipid metabolism through a starvation-induced autoregulatory loop. Nat Cell
Biol. 15:647-658.
Settembre C, Fraldi A, Rubinsztein DC, Ballabio A. 2008. Lysosomal storage diseases as
disorders of autophagy. Autophagy. 4:113-114.
Shen HM, Mizushima N. 2014. At the end of the autophagic road: an emerging
understanding of lysosomal functions in autophagy. Trends Biochem Sci. 39:61-71.
Shintani T, Klionsky DJ. 2004. Autophagy in health and disease: adouble-edged sword.
Science. 306:990-995.
Singh R, Cuervo AM. 2011. Autophagy in the cellular energetic balance. Cell Metab. 13:495504.
Singh R, Cuervo AM. 2012. Lipophagy: connecting autophagy and lipid metabolism. Int J Cell
Biol. 2012:282041.
Sisó S, Hanzlícek D, Fluehmann G, Kathmann I, Tomek A, Papa V, Vandevelde M. 2006.
Neurodegenerative diseases in domestic animals: a comparative review. Vet J. 171:20-38.
Skaper SD, Leon A, Toffano G. 1989. Ganglioside function in the development and repair of
the nervous system. From basic science to clinical application. Mol Neurobiol. 3:173–199.
Sobue G, Taki T, Yasuda T, Mitsuma T. 1988. Gangliosides modulate Schwann cell
proliferation and morphology. Brain Res. 474:287-295.
Son JH, Shim JH, Kim KH, Ha JY, Han JY. 2012. Neuronal autophagy and neurodegenerative
diseases. Exp Mol Med. 44:89-98.
Sondell M, Lundborg G, Kanje M. 1999. Vascular endothelial growth factor has neurotrophic
activity and stimulates axonal outgrowth, enhancing cell survival and Schwann cell
proliferation in the peripheral nervous system. J Neurosci. 19:5731-5740.
Song CY, Guo JF, Liu Y, Tang BS. 2012. Autophagy and its comprehensive impact on ALS. Int J
Neurosci. 122:695-703.
Spassieva SD, Mullen TD, Townsend DM, Obeid LM. 2009. Disruption of ceramide synthesis
by CerS2 down-regulation leads to autophagy and the unfolded protein response. Biochem J.
424:273-283.
References
149
Storrie B, Desjardins M. 1996. The biogenesis of lysosomes: is it a kiss and run, continuous
fusion and fission process? Bioessays. 18:895-903.
Suraweera A, Münch C, Hanssum A, Bertolotti A. 2012. Failure of amino acid homeostasis
causes cell death following proteasome inhibition. Mol Cell. 48:242-253.
Suzuki K, Chen GC. 1968. GM1-gangliosidosis (generalized gangliosidosis). Morphology and
chemical pathology. Pathol Eur. 3:389-408.
Suzuki K, Kubota Y, Sekito T, Ohsumi Y. 2007. Hierarchy of Atg proteins in preautophagosomal structure organization. Genes Cells. 12:209-218.
Suzuki K. Suzuki K. 2008.Lysosomal diseases. in Love S, Louis D, Ellison DW. Greenfield's
Neuropathology 2-Volume Set, Eighth Edition Chapter 7.
Suzuki T, Zhang J, Miyazawa S, Liu Q, Farzan MR, Yao WD. 2011. Association of membrane
rafts and postsynaptic density: proteomics, biochemical, and ultrastructural analyses. J
Neurochem. 119:64-77.
Suzuki Y, Hirabayashi Y, Sagami F, Matsumoto M. 1988. Gangliosides in the blood plasma:
levels of ganglio-series gangliosides in the plasma after administration of brain gangliosides.
Biochim Biophys Acta. 962:277-281.
Tabata K, Matsunaga K, Sakane A, Sasaki T, Noda T, Yoshimori T. 2010. Rubicon and
PLEKHM1 negatively regulate the endocytic/autophagic pathway via a novel Rab7-binding
domain. Mol Biol Cell. 21:4162-4172.
Takamura A, Higaki K, Kajimaki K, Otsuka S, Ninomiya H, Matsuda J, Ohno K, Suzuki Y, Nanba
E. 2008. Enhanced autophagy and mitochondrial aberrations in murine G(M1)-gangliosidosis.
Biochem Biophys Res Commun. 367:616-622.
Tanida I, Tanida-Miyake E, Komatsu M, Ueno T, Kominami E. 2002. Human Apg3p/Aut1p
homologue is an authentic E2 enzyme for multiple substrates, GATE-16, GABARAP, and MAPLC3, and facilitates the conjugation of hApg12p to hApg5p. J Biol Chem. 277:13739-13744.
Tanida I, Tanida-Miyake E, Ueno T, Kominami E. 2001. The human homolog of
Saccharomyces cerevisiae Apg7p is a Protein-activating enzyme for multiple substrates
including human Apg12p, GATE-16, GABARAP, and MAP-LC3. J Biol Chem. 276:1701-1706.
Tanik SA, Schultheiss CE, Volpicelli-Daley LA, Brunden KR, Lee VM. 2013. Lewy bodylike asynuclein aggregates resist degradation and impair macroautophagy. J Biol Chem.
288:15194–15210.
150
References
Tanzi RE. 2012. The genetics of Alzheimer disease. Cold Spring Harb Perspect Med. 2:
a006296.
Tator CH, Hashimoto R, Raich A, Norvell D, Fehlings MG, Harrop JS, Guest J, Aarabi B,
Grossman RG. 2012. Translational potential of preclinical trials of neuroprotection through
pharmacotherapy for spinal cord injury. J Neurosurg Spine. 17:157-229.
Tavernarakis N, Pasparaki A, Tasdemir E, Maiuri MC, Kroemer G. 2008. The effects of p53 on
whole organism longevity are mediated by autophagy. Autophagy. 4:870-873.
Techangamsuwan S, Imbschweiler I, Kreutzer R, Kreutzer M, Baumgärtner W, Wewetzer K.
2008. Similar behaviour and primate-like properties of adult canine Schwann cells and
olfactory ensheathing cells in long-term culture. Brain Res. 1240:31-38.
Tessitore A, del P Martin M, Sano R, Ma Y, Mann L, Ingrassia A, Laywell ED, Steindler DA,
Hendershot LM, d'Azzo A. 2004. GM1-ganglioside-mediated activation of the unfolded
protein response causes neuronal death in a neurodegenerative gangliosidosis. Mol Cell.
15:753-766.
Tessitore A, Pirozzi M, Auricchio A. 2009. Abnormal autophagy, ubiquitination, inflammation
and apoptosis are dependent upon lysosomal storage and are useful biomarkers of
mucopolysaccharidosis VI. Pathogenetics. 2:4.
Thilo L, Stroud E, Haylett T. 1995. Maturation of early endosomes and vesicular traffic to
lysosomes in relation to membrane recycling. J Cell Sci. 108:1791-1803.
Thurston TL, Ryzhakov G, Bloor S, von Muhlinen N, Randow F. 2009. The TBK1 adaptor and
autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria. Nat
Immunol. 10:1215-1221.
Tshala-Katumbay DD, Palmer VS, Kayton RJ, Sabri MI, Spencer PS. 2005. A new murine model
of giant proximal axonopathy. Acta Neuropathol. 109:405-410.
Tsuji S, Choudary PV, Martin BM, Stubblefield BK, Mayor JA, Barranger JA, Ginns EI. 1987. A
mutation in the human glucocerebrosidase gene in neuronopathic Gaucher's disease.N Engl J
Med. 316:570-575.
Tsukada M, Ohsumi Y. 1993. Isolation and characterization of autophagy-defective mutants
of Saccharomyces cerevisiae. FEBS Lett. 333:169-174.
Vaher U, Napa A, Nurmiste A, Piirsoo A, Sibul H, Talvik T. 2001. Four siblings with
Hallervorden-Spatz disease. Brain Dev. 23:236-239.
References
151
Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del Turco D,
Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, González-Maldonado R, Deller T, Salvi S,
Cortelli P, Gilks WP, Latchman DS, Harvey RJ, Dallapiccola B, Auburger G, Wood NW. 2004.
Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science. 304:11581160.
van der Knaap MS, Naidu S, Kleinschmidt-Demasters BK, Kamphorst W, Weinstein HC. 2000.
Autosomal dominant diffuse leukoencephalopathy with neuroaxonal spheroids. Neurology.
54:463-468.
van der Voorn JP, Kamphorst W, van der Knaap MS, Powers JM. 2004. The
leukoencephalopathy of infantile GM1 gangliosidosis: oligodendrocytic loss and axonal
dysfunction. Acta Neuropathol. 107:539-545.
Vantaggiato C, Clementi E, Bassi MT. 2014. ZFYVE26/SPASTIZIN: a close link between
complicated hereditary spastic paraparesis and autophagy. Autophagy. 10:374-375.
Valtorta F, Pennuto M, Bonanomi D, Benfenati F. 2004. Synaptophysin: leading actor or
walk-on role in synaptic vesicle exocytosis? Bioessays. 26:445-453.
Vembar SS, Brodsky JL. 2008. One step at a time: endoplasmic reticulum-associated
degradation. Nat Rev Mol Cell Biol. 9:944-957.
Walkley S. 2007. Neurobiology of disease; In Gilman S. Elsevier Academic press; Chapter 1;
p.15
Wang MS, Chen ZW, Zhang GJ, Chen ZR. 1995. Topical GM1 ganglioside to promote crushed
rat sciatic nerve regeneration. Microsurgery. 16:542-546.
Webster SJ, Bachstetter AD, Nelson PT, Schmitt FA, Van Eldik LJ. 2014. Using mice to model
Alzheimer's dementia: an overview of the clinical disease and the preclinical behavioral
changes in 10 mouse models. Front Genet. 5:88.
Weidberg H, Shvets E, Elazar Z. 2011. Biogenesis and cargo selectivity of autophagosomes.
Annu Rev Biochem. 80:125-156.
Wewetzer K, Radtke C, Kocsis J, Baumgärtner W. 2011. Species-specific control of cellular
proliferation and the impact of large animal models for the use of olfactory ensheathing cells
and Schwann cells in spinal cord repair. Exp Neurol. 229:80-87.
Wider C, Van Gerpen JA, DeArmond S, Shuster EA, Dickson DW, Wszolek ZK. 2009.
Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD): a
single entity? Neurology. 72(22):1953-9.
152
References
Wild P, Farhan H, McEwan DG, Wagner S, Rogov VV, Brady NR, Richter B, Korac J, Waidmann
O, Choudhary C, Dötsch V, Bumann D, Dikic I. 2011. Phosphorylation of the autophagy
receptor optineurin restricts Salmonella growth. Science. 333:228-233.
Willard SS, Koochekpour S. 2013. Glutamate signaling in benign and malignant disorders:
current status, future perspectives, and therapeutic implications. Int J Biol Sci. 9:728-742.
Winslow AR, Chen CW, Corrochano S, Acevedo-Arozena A, Gordon DE, Peden AA,
Lichtenberg M, Menzies FM, Ravikumar B, Imarisio S, Brown S, O'Kane CJ, Rubinsztein DC.
2010. α-Synuclein impairs macroautophagy: implications for Parkinson's disease. J Cell Biol.
190:1023-1037.
Wong YC, Holzbaur EL. 2014. The regulation of autophagosome dynamics by huntingtin and
HAP1 is disrupted by expression of mutant huntingtin, leading to defective cargo
degradation. J Neurosci. 34:1293-1305.
Wouters BG, Koritzinsky M. 2008. Hypoxia signalling through mTOR and the unfolded protein
response in cancer. Nat Rev Cancer. 8:851-564.
Wu G, Lu ZH, Kulkarni N, Ledeen RW. 2012. Deficiency of ganglioside GM1 correlates with
Parkinson's disease in mice and humans. J Neurosci Res. 90:1997-2008.
Wu G, Lu ZH, Obukhov AG, Nowycky MC, Ledeen RW. 2007. Induction of calcium influx
through TRPC5 channels by cross-linking of GM1 ganglioside associated with alpha5beta1
integrin initiates neurite outgrowth. J Neurosci. 27:7447-7458.
Wu LG, Hamid E, Shin W, Chiang HC. 2014. Exocytosis and endocytosis: modes, functions,
and coupling mechanisms. Annu Rev Physiol. 76:301-331.
Yamamoto A, Tagawa Y, Yoshimori T, Moriyama Y, Masaki R, Tashiro Y. 1998. Bafilomycin A1
prevents maturation of autophagic vacuoles by inhibiting fusion between autophagosomes
and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell Struct Funct. 23:33-42.
Yamamoto N, Fukata Y, Fukata M, Yanagisawa K. 2007. GM1-ganglioside-induced Abeta
assembly on synaptic membranes of cultured neurons. Biochim Biophys Acta. 1768:11281137.
Yang Y, Allen E, Ding J, Wang W. 2007. Giant axonal neuropathy. Cell Mol Life Sci 64:601-609.
Yang Y, Coleman M, Zhang L, Zheng X, Yue Z. 2013. Autophagy in axonal and dendritic
degeneration. Trends Neurosci. 36:418-428.
References
153
Yao J, Irwin RW, Zhao L, Nilsen J, Hamilton RT, Brinton RD. 2009. Mitochondrial bioenergetic
deficit precedes Alzheimer's pathology in female mouse model of Alzheimer's disease. Proc
Natl Acad Sci U S A. 106:14670-14675.
Yen WL, Shintani T, Nair U, Cao Y, Richardson BC, Li Z, Hughson FM, Baba M, Klionsky DJ.
2010. The conserved oligomeric Golgi complex is involved in double-membrane vesicle
formation during autophagy. J Cell Biol. 188:101-114.
Young AR, Chan EY, Hu XW, Köchl R, Crawshaw SG, High S, Hailey DW, Lippincott-Schwartz J,
Tooze SA. 2006. Starvation and ULK1-dependent cycling of mammalian Atg9 between the
TGN and endosomes. J Cell Sci. 119:3888-3900.
Yu L, McPhee CK, Zheng L, Mardones GA, Rong Y, Peng J, Mi N, Zhao Y, Liu Z, Wan F, Hailey
DW, Oorschot V, Klumperman J, Baehrecke EH, Lenardo MJ. 2010. Termination of autophagy
and reformation of lysosomes regulated by mTOR. Nature. 465:942-946.
Yu WH, Cuervo AM, Kumar A, Peterhoff CM, Schmidt SD, Lee JH, Mohan PS, Mercken M,
Farmery MR, Tjernberg LO, Jiang Y, Duff K, Uchiyama Y, Näslund J, Mathews PM, Cataldo
AM, Nixon RA. 2005. Macroautophagy-a novel Beta-amyloid peptide-generating pathway
activated in Alzheimer's disease. J Cell Biol. 171:87-98.
Yu WH, Dorado B, Figueroa HY, Wang L, Planel E, Cookson MR, Clark LN, Duff KE. 2009.
Metabolic activity determines efficacy of macroautophagic clearance of pathological
oligomeric alpha-synuclein. Am J Pathol. 175:736-747.
Zavodszky E, Vicinanza M, Rubinsztein DC. 2013. Biology and trafficking of ATG9 and
ATG16L1, two proteins that regulate autophagosome formation. FEBS Lett. 587:1988-1996.
Zechner R, Madeo F. 2009. Cell biology: Another way to get rid of fat. Nature. 458:11181119.
Zeigerer A, Gilleron J, Bogorad RL, Marsico G, Nonaka H, Seifert S, Epstein-Barash H,
Kuchimanchi S, Peng CG, Ruda VM, Del Conte-Zerial P, Hengstler JG, Kalaidzidis Y,
Koteliansky V, Zerial M. 2012. Rab5 is necessary for the biogenesis of the endolysosomal
system in vivo. Nature. 485:465-470.
Zhang X, Li L, Chen S, Yang D, Wang Y, Zhang X, Wang Z, Le W. 2011. Rapamycin treatment
augments motor neuron degeneration in SOD1G93A mouse model of amyotrophic lateral
sclerosis. Autophagy. 7:412-425.
Zhang XD, Wang Y, Wang Y, Zhang X, Han R, Wu JC, Liang ZQ, Gu ZL, Han F, Fukunaga K, Qin
ZH. 2009. p53 mediates mitochondria dysfunction-triggered autophagy activation and cell
death in rat striatum. Autophagy. 5:339-350.
154
References
Zhao J, Brault JJ, Schild A, Cao P, Sandri M, Schiaffino S, Lecker SH, Goldberg AL. 2007. FoxO3
coordinately activates protein degradation by the autophagic/lysosomal and proteasomal
pathways in atrophying muscle cells. Cell Metab. 6:472-483.
Zhao L, Huang W, Liu H, Wang L, Zhong W, Xiao J, Hu Y, Li S. 2006. FK506-binding protein
ligands: structure-based design, synthesis, and neurotrophic/neuroprotective properties of
substituted 5,5-dimethyl-2-(4-thiazolidine)carboxylates. J Med Chem. 49:4059-4071.
Zheng YT, Shahnazari S, Brech A, Lamark T, Johansen T, Brumell JH. 2009. The adaptor
protein p62/SQSTM1 targets invading bacteria to the autophagy pathway. J Immunol.
183:5909-5916.
Zhou XF, Deng YS, Chie E, Xue Q, Zhong JH, McLachlan EM, Rush RA, Xian CJ. 1999. Satellitecell-derived nerve growth factor and neurotrophin-3 are involved in noradrenergic sprouting
in the dorsal root ganglia following peripheral nerve injury in the rat. Eur J Neurosci.
11:1711-1722.
Zhou XF, Li WP, Zhou FH, Zhong JH, Mi JX, Wu LL, Xian CJ. 2005. Differential effects of
endogenous brain-derived neurotrophic factor on the survival of axotomized sensory
neurons in dorsal root ganglia: a possible role for the p75 neurotrophin receptor.
Neuroscience. 132:591-603.
Zhu Y, Yang J, Jiao S, Ji T. 2013. Ganglioside-monosialic acid (GM1) prevents oxaliplatininduced peripheral neurotoxicity in patients with gastrointestinal tumors. World J Surg
Oncol. 25:11-19.
Zoncu R, Bar-Peled L, Efeyan A, Wang S, Sancak Y, Sabatini DM. 2011. mTORC1 senses
lysosomal amino acids through an inside-out mechanism that requires the vacuolar H(+)ATPase. Science. 334:678-683.
Acknowledgements
8
155
Acknowledgements
Finally I want to sincerely thank all the people which contributed essentially to the success of
this work, teaching me science and life:
Prof. Dr. Wolfgang Baumgärtner for providing the topic, his friendly and productive support
and for having confidence in me and the project.
Prof. Dr. Peter Claus and Prof. Dr. Herbert Hildebrandt for their encouragement, insightful
comments, and suggestions.
Prof. Dr. Klaus Schughart, Dr. Bastian Hatesuer, Dr. Dagmar Wirth for sharing their
knowledge, teaching me molecular biology and helping me to go on in moments of scientific
desperation.
Prof. Dr. Cord Drögemüller, Dr. Peter Wohlsein, Dr. Cecilia Rohdin, Dr. Karin Hultin
Jäderlund and Dr. Pernilla Syrjä for the international joint venture on behalf of autophagy.
Prof. Dr. Tosso Leeb for all advices.
Ingo Gerhauser for his patient and invaluable assistance, constructive discussions and for
always motivating me. You are the best Ingo ever!
All the members of the technical staff of the department of Pathology, the
Helmholtzzentrum Braunschweig, and the Institute of Genetics from the University of Bern
namely Danuta Waschke, Kerstin Schöne, Caroline Schütz, Petra Grünig, Bettina Buck,
Claudia Herrmann and Kerstin Rohn. You are simply the best and the heart of the institute.
The Foundation of German Business (Stiftung der Deutschen Wirtschaft) for financial
support.
156
Acknowledgements
All my colleagues and friends
Hannover 2014
Verlag: Deutsche Veterinärmedizinische Gesellschaft Service GmbH
35392 Gießen · Friedrichstraße 17 · Tel. 0641 / 24466 · Fax: 0641 / 25375
E-Mail: [email protected] · Internet: www.dvg.de
ISBN 978-3-86345-248-3

Kerstin Caroline Hahn - TiHo Bibliothek elib

Transcription

Similar documents

2015/2016 autofagia

Please visit Northern California Weimaraner Rescue`s booth at one

Apoptosi autofagia 15

Nothing to do - Rabbit Welfare Association

Brookwood Pet Resort 37 Old Boyce Road Canterbury, NH 03224

Saturday 11 July 2015, 11am-4pm Graylingwell Park, off College

Startin pric fro $2,050.00

Helping Guide Dogs PDF

and spend the afternoon enjoying: And so much more!

CHAMPS orientation 2015 presentation slides handout