William Camargo - Actividad Cultural del Banco de la República

Transcription

FACULTEIT LANDBOUWKUNDIGE
EN TOEGEPASTE BIOLOGISCHE
WETENSCHAPPEN
Academiejaar 2001-2002
CHARACTERISATION OF ARTEMIA POPULATIONS FROM
COLOMBIA FOR USE IN AQUACULTURE
KARAKTERISATIE VAN ARTEMIA POPULATIES UIT
COLOMBIA VOOR GEBRUIK IN DE AQUACULTUUR
door
WILLIAM CAMARGO NAVARRO
Thesis submitted in fulfillment of the requirements for the degree of Doctor (Ph. D.) in Applied
Biological Sciences
Proefschrift voorgedragen tot het bekomen van de graad van Doctor in de Toegepaste Biologische
Wetenschappen
On the authority of
Op gezag van
Rector : Prof. Dr. A. De Leenheer
Decaan:
Prof. Dr. ir. O. Van Cleemput
Promotor :
Prof . Dr. P. Sorgeloos
Co-promotor :
Prof. Dr. G. Gajardo
The author and his promoters authorize consultation and partial reproduction of this thesis for
personal use. Any other uses or reproduction is subjected to copyright protection. Citation of
results should clearly mention the reference of this work
De auteur en de prpmotoren geven de toelating dit proefschrift voor consultatie beschikbaar te
stellen en delen ervan te kopiëren voor persoonlijk gebruik. Elk ander gebruik valt onder de
beperkingen van het auteursrecht, in het bijzonder met betrekking tot de verplichting uitdrukkelik
de bron te vermelden bij het aanhalen van resultaten uit dit proefschrift.
Ghent, July 1, 2002
De promoter/
Promotor :
Prof . Dr. P. Sorgeloos
De co-promoter/
Co-promotor :
Prof. Dr. G. Gajardo
De auteur/
Author :
William Camargo N.
If we knew what it was we were doing, it would not be called
research, would it ?
A. Einstein
To my parents,
my source of inspiration and struggle.
Table of Contents
Chapter 1. Introduction
1.1. Actual state of Artemia production in the world ........................................................................1
1.2. Artemia studies conducted in Colombia .....................................................................................3
1.3. Importance of Artemia in aquaculture ........................................................................................4
1.4. Relevance of this thesis in the Colombian context .....................................................................5
1.5. Research objectives ....................................................................................................................6
1.6. Thesis outline..............................................................................................................................7
Chapter 2. Literature review
2.1. Artemia biology and ecology..................................................................................................9
2.2.
Life history traits and population dynamics ..........................................................................13
2.3. Water chemistry......................................................................................................................16
2.4.
Latinamerican and Caribbean Artemia biogeography ...........................................................20
2.5.
Taxonomy..............................................................................................................................23
2.5.1. Artemia phylogeny and taxonomy .........................................................................................23
2.5.2. Bisexual species.....................................................................................................................24
2.5.3. Parthenogenetic populations ..................................................................................................28
2.6.
Discriminant factors in relation to Artemia taxonomy ..........................................................28
2.6.1. Cytogenetics of the genus Artemia .......................................................................................28
2.6.2. Electrophoretic analysis and DNA markers...........................................................................31
2.6.3. Biometry and morphology of adult Artemia..........................................................................36
2.6.4. Artemia reproductive isolation...............................................................................................37
2.7.
Importance of Artemia in aquaculture and salt production ...................................................38
2.7.1. Role of Artemia in aquaculture..............................................................................................38
2.7.2. Role of Artemia in salt production.........................................................................................40
2.8.
Factors determining Artemia quality for aquaculture............................................................41
2.8.1. Cyst and naupliar size ............................................................................................................41
2.8.2. Cysts hatching characteristics ................................................................................................42
2.8.3. FAME content as an important factor to determine cyst and biomass
quality ....................................................................................................................................42
2.9.
Population distribution patterns in relation to the assessment of
Artemia density......................................................................................................................43
Chapter 3. Colombian Artemia survey and morphometric analysis
Part 1. Report on the presence of Artemia franciscana in six
locations in the Colombian Caribbean
47
Part 2. Morphometric characterization of thalassohaline Artemia
populations from the Colombian Caribbean..........................................................................59
Chapter 4. Effects of environmental variables on the reproduction
of some Colombian strains
Part 1. Reproductive strategies and cyst quality................................................................................70
Part 2. Influence of some physicochemical parameters on Artemia biomass
and cyst production in some thalassohaline aquatic environments from
the Colombian Caribbean ......................................................................................................72
Chapter 5. Preliminary genetic data on some Caribbean Artemia
franciscana strains based on RAPDs .............................................................................85
Chapter 6. Effects of lunar cycles on Artemia density in hypersaline
environments ................................................................................................................93
Chapter 7. Conclusions and prospect research
Conclusions ........................................................................................................................................108
Prospect research................................................................................................................................115
Literature cited .................................................................................................................................116
Summary
Samenvatting
Acknowledgements
Curriculum Vitae
1.1
Actual state of Artemia production in the world
Aquaculture is one of the fields where opportunities to increase food production in a
relatively short time and at a reasonable cost, seem very promising (Goyens, 1985). Hence,
developing nations with a desire and capacity to exploit intensively their aquatic resources, can
obtain excellent economic benefits when choosing development initiatives that include Artemia
(brine shrimp) and the introduction of new techniques for their culture. Further, in aquaculture of
marine fishes and crustaceans, the brine shrimp Artemia has played a significant role as a live
food (Bengtson et al., 1991) due to its biological and practical characteristics that are discussed in
this thesis.
Artemia has been of high food value for some decades for the aquaculture industry (Van
Stappen and Sorgeloos, 1993), reaching near 3,000 metric tons (MT) of cysts and about 1,000
metric tons of biomass commercially harvested worldwide per year. The worldwide demand of
Artemia cysts increased from an average of 15% in the mid 70s, to about 40% at the end of 80s
(23 MT per year in 1975 to 400 MT per year in 1989-1990) (Amat, 1996).
According to Lavens and Sorgeloos (1998, 2000), in the early 1950s, commercial sources
of cysts (mainly used by the aquarium pet-trade industry) initially originated from the coastal
saltworks in the San Francisco Bay (SFB), California, USA and an inland biotope, the Great Salt
Lake (GSL) in Utah, USA.
Some decades later, GSL became the major Artemia supplier
covering near 90 to 95% (Sorgeloos, 1995; Amat, 1996) of the cyst market worldwide. However,
cyst supply at GSL suffered a drastic decline in 1995/96 producing only near 45% of Artemia
cysts to the worldwide market, while the Karabogazgol (Turkmenistan) coupled with Siberian
(Russia) resources supplied another 45% with the remainder coming mostly from Kazakhstan and
China (Newman, Desert Lake Technologies, pers. com.). Moreover, in 2001 GSL cyst supply
(Fig. 1) increased again covering about 85 to 90% of the market (Newman, Desert Lake
Technologies, pers. com.).
1
Iran
0.4%
Russia
5.7%
China
5.0%
USA
85.3%
Figure 1. Distribution of world cyst supply based on the main producing countries.
Only at the end of the 80s, shortage symptoms were noticed by the Great Salt Lake
governmental regulating authorities, because of water management and overexploitation issues.
Additionally, according to Newman (Desert Lake Technologies, pers. com.) in 1983 Utah
experienced the drastic effects of ¨El Niño¨ that inundated the GSL with freshwater dropping the
salinity of the South-arm (the arm traditionally harvested) from 170 g.l-1 to 45-50 g.l-1. The
North-arm, which was at saturation, dropped to 140 g.l-1 and became the productive arm for cyst
harvest. Moreover, the supply situation by the end of the 80s changed particularly due to the
remarkable cyst demand from the Asian region (Newman, Desert Lake Technologies, pers.
com.). According to the same source, in the 80s, Thailand was the biggest consumer, followed
by China, Indonesia, Vietnam, India, Taiwan, Japan and the Philippines, and the isolated case of
Ecuador, which demonstrated by then a tremendous increase in the practice of aquaculture.
According to Dhont and Sorgeloos (in press), the dramatic impact of the cyst shortage on
the expanding aquaculture industry invigorated research on the rationalization of the use of
Artemia and exploration of new cyst resources. Consequently, in that period the commercial
exploitation was initiated for several new locations with natural Artemia populations (China,
Argentina, Australia, Canada, Colombia and France) and some saltworks were managed as new
Artemia production sites (Brazil and Thailand).
It is important to emphasize the great commercial value of Artemia cysts in the
international market, with a price of about $14 USD/lb, depending on the quality, up to $100/lb
(for cysts with biometric and nutritional superiority) for Artemia cysts and more than 5 USD/lb
2
($6 to 7/lb in Colombia) for Artemia biomass (wet weight) (Newman, Desert Lake Technologies,
pers. com.). Currently, there is a cyst world market of about 2,000 MT (processed product).
According to some estimates (Amat, 1996) in the late 80s the availability of cysts in
Colombia was in the order of 7 metric tons. It is not possible to present an updated estimate due
to the absence of a follow-up program of this valuable resource.
1.2.
Artemia studies conducted in Colombia
In Colombia, potential Artemia habitats are exclusively limited to the Atlantic Coast,
because the Pacific coast is generally under an intense precipitation regime (Newmark, 1988).
Artemia has been reported in three localities along the Caribbean coast: Manaure (11° 45´ N; 72°
22´ W) in the Guajira department, Pozos Colorados (11° 9.6´ N; 74° 13.6´ W) in the Magdalena
department and Galerazamba (10° 49´ N; 75° 12´ W) in the Bolívar department (Camargo et al.,
2000).
The Colombian Institute of Industrial Promotion (IFI) with the collaboration of the
University of the Andes (Bogotá, Colombia) conducted studies on the economic feasibility of
Artemia cysts and biomass production in Galerazamba and Manaure saltworks, concluding that
the two locations had a great exploitation potential (Rozo and Pinzón, 1983). Similarly, Doullet
and Newmark (1982), and Newmark (1988) conducted field and laboratory reproduction and
ecological studies at the same two locations, and additionally in Pozos Colorados. The Artemia
species present along the Colombian Caribbean coast is believed to be A. franciscana, at least
that has been the result of strains crossing studies done so far (Doullet and Newmark, 1982).
According to Sorgeloos (in Rozo and Pinzón, 1983) the potential for Galerazamba is to produce
Artemia biomass, whereas Manaure is to produce cysts (calculated to be near 8 tons of cysts).
Further, in literature several independent ecological, physiological and even economical
studies have been conducted, mostly on the Manaure and Galerazamba Artemia populations
(Bruggeman et al., 1980; Sorgeloos et al., 1980; Persoone and Sorgeloos, 1980; Tobias et al.,
3
1980; Vanhaecke and Sorgeloos, 1980a, b; Cárdenas, 1981; Vanhaecke and Sorgeloos, 1982;
Abreu-Grobois and Beardmore, 1982; Doullet and Newmark 1982; Rozo and Pinzón, 1982,
1983; Pinzón and Rozo, 1983; Tackaert et al., 1987; Newmark, 1988; Bengtson and Simpson,
1989; Vanhaecke and Sorgeloos, 1989; Zapata et al., 1990; Hontoria and Amat, 1992b; AlvarezLeón and Van Aken-Lodewyckx, 1994; Camargo et al., 2000; Correa et al., unpublished data)
and very few on the Pozos Colorados population (Newmark, 1988; Tobón, 1988).
Little
information is yet available concerning Artemia ecology, morphology and genetics, all which are
critical to identify, improve and manage strains with desirable traits for aquaculture.
1.3.
Importance of Artemia in aquaculture
A concerted effort at worldwide level has concentrated on the development of inert
microdiets as possible alternatives that could emulate the nutritional value of live food.
However, these innovative inert diets cannot mimic live food in all aspects; as an example
Artemia generates visual and chemical stimuli that induce the predator larvae to increase the rate
of nutritional ingestion at levels superior to 120 % compared to that of inert diets (Amat, 1996).
Additionally, live food can be improved (Lavens and Sorgeloos, 1996) through the use of
emulsions rich in docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), vit. C, etc.
Further, Artemia contains high levels of highly unsaturated fatty acids (HUFAs), carotenoids,
proteins, vitamins and several enzymes that increase the digestibility of the food consumed by
diverse species of crustaceans and fish larvae of commercial interest in aquaculture (Lavens and
Sorgeloos, 1996).
On the other hand, Artemia nauplii are a convenient food that can be easily stored and
readily used off-the-shelf, requiring only 24 hrs of incubation from cyst to nauplius (Lavens and
Sorgeloos, 2000). Its small size (470-550 µm) is convenient for the small mouth of the fragile
and not fully developed larvae (Lavens and Sorgeloos, 1996).
4
Several strain and batch linked quality factors have been evaluated to determine Artemia
cyst quality for aquaculture use (Sorgeloos et al., 1986). According to Lavens and Sorgeloos
(1996), a good quality cyst product should contain a minimal quantity of impurities (i.e. sand,
empty shells, etc.). Some of the evaluation factors utilized to characterize the quality of cyst
batches present advantages over other quality evaluation factors.
For instance, hatching
efficiency (HE - number of nauplii hatched per gram of cysts) may be a better criterion than
hatching percentage (H% - total percentage of cysts that hatch out of a 100 full cysts), as it takes
also into account the content of impurities (Lavens and Sorgeloos, 1996). Further, hatching
efficiency values as low as 100,000 nauplii.g-1 of commercial cyst product are common, while
premium quality cysts from Great Salt Lake might yield up to 270,000 nauplii.g-1 (H% > 90%).
Moreover, Artemia batches of small cysts (i.e. San Francisco Bay strains) may yield even higher
HE values, up to 320,000 nauplii.g-1.
1.4.
Relevance of this thesis in the Colombian context
According to the author of this thesis, the unpredictable shortage and the high cost of live
food (i.e. Artemia nauplii) for the feeding of crustacean larvae (i.e. shrimps) and ornamental fish
are the two main limitations for the development of the aquaculture industry in Colombia.
Further, an integrated plan has not yet been developed that assembles a diversity of studies to
evaluate the Colombian Caribbean Artemia stocks.
The author of this thesis identifies the
following research areas that are deficient or absent to accomplish this type of integrated
evaluation plan:
• Determination of annual Artemia cysts and biomass production considering physicochemical
parameters during different cyclic climatic regimes.
• Determination of population distribution and maximum sustainable yield.
• Evaluation of cyst and nauplius quality (fatty acids content, hatching percent and hatching
efficiency, cyst and nauplius biometry).
5
• Genetic and morphometric characterization of local strains to identify, select and manage these
strains through the possible introduction of more suitable strains.
The exploitation of this important natural resource has great potential not only for the ever
growing world aquaculture industry, but can also improve the economic conditions of the local
inhabitants (i.e. the Wayu Indians, farmers and fishermen) of the zones where the saltworks and
hypersaline ecosystems are located.
1.5.
I.
Research objectives
Evaluate the state of cysts and biomass production in the hypersaline ecosystems of the
Colombian Caribbean
General objective
Evaluate the quantity and quality of Artemia in the major Colombian thalassohaline
aquatic ecosystems in order to develop and apply the technology required to culture, harvest and
process Artemia cysts and biomass in a sustainable form.
Specific objectives
A. Explore new potential Artemia sites along the Colombian Caribbean coast.
B. Evaluate Artemia cysts and biomass availability in a two-year period in the main
thalassohaline ecosystems of the Colombian Caribbean.
C. Determine the most appropriate sampling time to have a more accurate estimate of
Artemia density, hence improving the management of this valuable natural resource.
6
D. Monitor water quality (percent O2 saturation, temperature, salinity, pH and nutrients) and
determine population dynamics (physicochemical and biological variability) for two
years in the main thalassohaline ecosystems.
E. Characterize the cyst quality of each population determining hatching percentage,
hatching efficiency, effects of prolonged storage, number of cysts per gram, cyst
diameter, chorion thickness, naupliar length, and FAME whenever enough cyst samples
are collected.
II. Characterize genetically the Colombian Artemia populations in relation with the Caribbean
populations using Randomly Amplified Polymorphic DNA (RAPD) and morphometric
multivariate discriminant analysis.
1.6.Thesis outline
Chapter 1 (Introduction and General objectives) presents the actual state of the Artemia industry
worldwide providing production figures of both biomass and cysts from the major producing
countries. Additionally, this chapter highlights the research conducted on Colombian Artemia,
mostly on Manaure, Galerazamba and Pozos Colorados saltworks.
Chapter 2 (Literature review) reviews the Artemia literature in different fields relevant for this
thesis: biology and ecology, life history and population dynamics, water chemistry,
biogeography,
taxonomy,
cytogenetics,
electrophoresis
analysis
and
DNA
markers,
morphometry, reproductive isolation, importance in aquaculture and saltworks, factors
determining Artemia quality for aquaculture and population distribution patterns.
Chapter 3 (Artemia survey in the Colombian Caribbean and morphometric analysis) explores
the actual state of Artemia stocks in the Colombian Caribbean, as well as its Artemia biotopes.
Moreover, biometric measurements (cyst and nauplius) and FAME analysis are determined for
the main populations during a two-year sampling campaign. Finally, morphometric discriminant
7
multivariate analysis are utilized in this chapter as a tool to differentiate these populations, as
well as to select key traits for taxonomic and management purposes.
Chapter 4 (Effects of environmental variables on the reproduction of some Colombian strains)
describes the reproductive performance of Artemia populations from the largest Colombian
saltworks, and their annual biomass and cyst production potential. Information was also
generated experimentally on the reproductive strategies of several Colombian Artemia
populations to test the main reproductive strategy of each strain under controlled conditions at
two different salinities. Additionally, standard cyst quality evaluation parameters were applied to
cysts collected during a two-year period in different Colombian locations.
Finally,
physicochemical and meteorological data were collected monthly to correlate it later using
multivariate discriminant analysis with monthly biomass and cyst production potential at each
location surveyed.
Chapter 5 (Preliminary genetic data on some Caribbean Artemia franciscana strains based on
RAPDs) describes the genetic relationships among some Artemia populations in the Caribbean,
including two “foreign” blanks (SFB and A. persimilis).
Chapter 6 (Effects of lunar cycles on Artemia density in hypersaline environments) explores the
relationships between medium term cycles (lunar cycles), sampling time and Artemia pond
distribution.
Additionally, this chapter discusses the cyclic ecological behavior of Artemia
influenced by temperature and dissolved oxygen.
Chapter 7 (Conclusions and Perspectives) briefly discusses the results obtained in this work in
the framework of the research objectives. Further, it draws conclusions and presents perspectives
for future research related to the subjects in this thesis.
List of References
8
2.1 Artemia biology and ecology
Information on the ecology of the brine shrimp Artemia in its natural habitat is scarce
compared to the vast information available in other fields such as morphology, biochemistry,
development, behavior and genetics (Collins, 1977; Persoone and Sorgeloos, 1980; Haslett and
Wear, 1985). The ecological conditions in the saline ecosystems where brine shrimp thrives are
extreme, favoring the evolutionary development of one of the best osmoregulating systems
known in the animal kingdom (Sorgeloos, 1980). Even though, according to Olaveson (2000)
most of the extreme environments are relatively rare on the present day Earth, but were abundant
in the early history of the planet, when the first life forms developed. Thus, it is more probable
that organisms lost some adaptive traits over the course of evolution in adjusting to environments
that are more moderate rather than gained (developed) them over time. Artemia can tolerate
between 80 to 220 g.l-1, and in rare occasions it has been found at salinities up to 340 g.l-1 (Post
and Youssef, 1977). At those salinity levels, the high ionic concentrations become a limiting
factor, increasing the energy requirements for osmoregulation. On the other hand, as such
condition favors the absence of predators and food competitors, Artemia develops successfully in
these extreme biotopes, frequently at very high densities.
Moreover, with respect to
microorganisms, brines are very productive (Ollevier et al., 1994, in Pavlovich, 1998).
According to Grant and Ross (1986), archaeobacterial halophiles and halotolerant microalgae
dominate naturally occurring brines as the concentration of salts approaches saturation.
Consequently, with little or no competition at all for nutrients, halobacteria and algae also bloom,
coloring water red, blue or green depending on the species (Sorgeloos, 1980).
Artemia is a non-selective filter feeder, consuming mostly halophilic bacteria, microalgae,
protozoans and detritus finely divided, with a size inferior to 60 µm. Filtration takes place by the
action of the water current generated by the thoracopods (Cannon, 1933; Barlow and Sleigh,
1980; Amat, 1985). The presence of a limb gland at the base of each thoracopod (Schrehardt,
1987b) produces a mucous secretion apparently functioning as cement to join particles together
into a clump (Fryer, 1983). The setular mesh of the trunk limbs functions as a sifter, and the
collected food is transported toward the mandibles ground by the mouthparts and ingested
through the stoma. The grinded food particles are then passed to the hook-shaped alimentary
canal composed of the esophagus, midgut and hindgut (Schrehardt, 1987b).
9
It has been observed that at low food-particle concentrations Artemia grows slower since
it spends more energy for filter-feeding. Vanhaecke and Cooreman (1979) using Dunaliella
viridis determined that the optimal algae feeding density for each nauplius at day one was 12x105
cells, from day two through four 24x105 cells, days five through six 36x105 cells and day seven
onwards 48x105 cells. For adult Artemia (Castro and Gallardo, 1993) it has been estimated at
10,000 cells per adult/ml.
The genus Artemia includes bisexual (A. franciscana, A. salina, A. urmiana, A. sinica,
Artemia sp., A. tibetiana and A. persimilis) as well as parthenogenetic populations.
Parthenogenetic types and bisexual Artemia species can have a life span from 60 to 80 days under
ideal laboratory conditions, although some have been reported to live up to 7 months under
controlled conditions (Suyama and Iwasaki, 1976; McCourt, 1987). Artemia reaches sexual
maturity between the first and the third week after hatching.
According to Amat (1985),
copulation stimulus in dioic strains (bisexual) can be tactile or hormonal. Some strains do not
require an external stimulus for reproduction.
These are the parthenogenetic types (A.
parthenogenetica), which generate exclusively females (Amat, 1985). The Colombian strains of
A. franciscana are exclusively dioic (Newmark, 1987, Camargo et al., 2000).
According to Chow (1968), the coloration acquired by adult females is also an indicator
of the mode of reproduction: as dissolved oxygen decreases, hemoglobin synthesis is activated.
Consequently, a pale female will be a strong indication for the ovoviviparous mode of
reproduction (Fig. 1), and a red colored one indicates a tendency towards the oviparous mode of
reproduction.
10
Figure 1. Artemia life cycle
Although Artemia is a euryhaline and eurythermic crustacean, variation in embryogenic
development, hatching, survival and ulterior development indicates that strains exhibit different
tolerances to salinity and temperature (Amat, 1980b). Some Artemia strains are predominantly
oviparous at high salinities (i.e. Lake Urmia, Lake Grassmere, some Spanish and Colombian
populations; Berthélémy-Okazaki and Hedgecock, 1987; Camargo et al., 2000), while other
strains primarily exhibit ovoviviparous mode of reproduction at high salinities (i.e. Great Salt
Lake, USA; some Colombian populations; Amat, 1982; Camargo et al., 2000; Gajardo et al.,
2001a). Further, cyst production has also been shown to be affected by photoperiod, temperature,
hypoxia, brood number and iron level in the food or in the culture medium (Dutrieu, 1960; Baker,
1966; Chow, 1968; Bowen et al., 1969; Sorgeloos et al., 1975; Provasoli and Pintner, 1980;
Amat, 1982; Berthélémy-Okazaki, 1986; Berthélémy-Okazaki and Hedgecock, 1987).
Brine shrimp cysts float and are blown by the wind or thrown by the waves ashore where
they accumulate, and are exposed to the drying action of the sun (Sorgeloos, 1980; Tackaert and
Sorgeloos, 1993). These apparently inert golden-brown or sometimes whitish-brown minute
particles between 200 to 300 µm in diameter and each weighing between 2.8 to 4.0 µg (Clegg
11
and Conte, 1980) are actually dormant dry cysts. The cysts will remain viable under diapause for
several decades as long as they are maintained dehydrated (appear like deflated balloons) and
under anaerobic conditions. Upon immersion in low salinity water (i.e. seawater) they will
hydrate, and within the shell the metabolism of the embryo is activated. Shortly after (12 to 24
hrs depending on the strain, among other factors), the outer membranes of the cyst burst
(“breaking” or E-1 stage) by inner and outer hydrostatic differences (Clegg, 1964) and the
embryo appears surrounded by the hatching membrane (“umbrella stage”), through which a
naupliar eye can be observed. Hours later the embryo leaves the cyst shell (E-2 stage) and
undergoes further embryogenetic transformations for some hours still inside the naupliar
membrane, until it ruptures this membrane and swims freely as a nauplius. This first Instar larva,
which is colored brownish-orange due to the presence of yolk, has three pairs of appendages:
antennulae, antennae and rudimentary biramous mandibles. An unpaired red ocellus (naupliar
eye) is located between the antennulae, and within the ventral side, a large labrum can be
discerned (Clegg and Conte, 1980; Sorgeloos, 1980; Schrehardt, 1987a).
The larva grows and differentiates (metanauplius), the trunk and abdomen elongates; the
digestive track becomes functional. From the 10th Instar on, important morphological changes
take place: the antennae lose their primitive locomotory function. In males, the antennae become
hooked graspers to hold the female before and during copulation, while in females they
degenerate taking a foleaceous form (Sorgeloos, 1980; Schrehardt, 1987a).
The adult animal, initially 7-9 mm long, has two large peduncles (each ending up on a
complex eye), sensorial antennae, linear digestive tract, and 11 pairs of functional thoracopods.
The head, thorax and abdomen are clearly recognized. In the male Artemia, the antennae are
transformed into muscular graspers, which have a frontal knob at their inner side. In the posterior
part of the trunk region a paired penis can be observed (Sorgeloos, 1980).
The abdomen has eight apodite (leg-like) segments. Those closest to the thorax are the
genital segments with a paired set of penis; the other six end on the telson with a caudal furca.
The gonads are paired and are disposed in the form of thin strings that reach the fifth and sixth
abdominal segments. In the females, the paired ovaries are located at both sides of the digestive
12
tract behind the thoracopods. The ripe oocytes are transported from the ovaries into the unpaired
brood pouch or uterus via two oviducts (Sorgeloos, 1980).
Precopulation in adult brine shrimp is initiated by the male in grasping the female with its
claws. In this “riding position”, the couples can swim around for long periods. Signaled by the
prevailing environmental conditions the fertilized eggs develop into free-swimming nauplii,
which are set free by the mother (ovoviviparous reproduction under favorable conditions), or the
embryological development is stopped at the blastula or early gastrula stage. The embryos are
then surrounded by a thick polysaccharide layer (shell) and are deposited as cysts (oviparous
reproduction under adverse conditions) (Sorgeloos, 1980; Amat, 1985). The cysts dehydrate by
the sun action and brine water, and will not develop until rehydration occurs at low salinity
(Nimura, 1967; Amat, 1985).
2.2.
Life history traits and population dynamics
Artemia is a very adequate organism to study life history traits, because predictions can be
directly evaluated through experimentation under controlled conditions, presenting a relatively
easy culture and a very short life cycle. Due to cyst availability from a wide range of geographic
areas, it is possible to compare original populations from a wide range of habitats (Browne, 1983;
Browne et al., 1984, 1991; Lenz, 1987; Browne and Hoopes, 1990). According to Lenz and
Browne (1991), bisexual species and parthenogenetic Artemia types are characterized by
extensive levels of genetic variation, which may explain the high variation in its life history traits.
Under laboratory conditions, longevity, fecundity, and reproductive period vary greatly between
Artemia species and populations (Browne, 1980a, b, 1983, 1988; Lenz, 1984, 1987; Dana and
Lenz, 1986; Browne and Hoopes, 1990; Williams and Mitchell, 1992).
Experimental studies revealed that optimum temperature and salinity differ between
Artemia populations (Vanhaecke et al., 1984; Wear and Haslett, 1986; Wear et al., 1986; Browne
et al., 1988). A. franciscana populations have a high reproductive capacity up to senescence
13
(Browne et al., 1984). Browne et al. (1988) revealed that A. franciscana is the most plastic
species with respect to temperature, followed by the parthenogenetic types.
Artemia populations have been subjected to a great variety of selective pressures and this
is reflected in reproductive characteristics and longevity of local populations (Lenz and Browne,
1991). Wear and Haslett (1986) and Wear et al. (1986) reported on the effects of temperature
and salinity on reproduction and longevity of A. franciscana populations in Lake Grassmere
(New Zealand), which were inoculated there during the early 50s. The results of these studies
indicated that the optimum conditions for growth, maturation and reproductive capacity were
between 20 and 28 °C (temperature range) and between 100 and 170 g.l-1 (salinity range). The
salinity and temperature levels in Lake Grassmere are sufficiently high to maintain an Artemia
population year round (Wear and Haslett, 1986). Similarly, A. franciscana from San Francisco
Bay was introduced in the late 1970s to the saltworks of Macau, Brazil, suffering selective
pressure to the point that the original SFB strain’s high temperature tolerance was modified.
Moreover, Gajardo et al. (1995) demonstrated that several alleles of the original population
(SFB) have been lost in a very short period after introduction.
Lenz (1987) observed that zooplankton population dynamics are influenced by abiotic
factors and by biological interactions. Por (1980) and Lenz (1987) observed that biological
interactions are more restricted in hypersaline communities due to low species diversity, and that
the abiotic parameters, particularly those that regulate seasonal characteristics, are eminently
important. Although biotic interactions are reduced, they do exist, as it is mentioned in Figure 2.
Artemia Population Dynamics
Abiotic parameters:
Salinity (45 g.l-1 up to saturation
point)
• Temperature (6 to 40 °C)
• Nutrients concentration (NO2-,
NO3- and PO4-3).
•
Periodicity:
• Seasonal
• Non seasonal
Biological interactions:
• Predation (birds, fish, etc)
• Competition
• Grazers
Figure 2. Critical factors determining Artemia population dynamics (from
Triantaphyllidis, 1997).
14
Artemia has diversified in various habitats ranging from permanent environments to
highly temporal ones (Lenz, 1987). In habitats such as the great temperate lakes (i.e. Great Salt
lake and Mono Lake), where annual salinity changes are relatively small and seasonality is
determined primarily by the temperature cycles, animals are adapted to a rapid regeneration at the
beginning of the season through ovoviviparity, followed by a long cyst production period to
assure survival during an inhospitable cold winter period (Lenz, 1987; Lenz and Browne, 1991).
Permanent habitats tend to promote ovoviviparity. However, the distinction between a seasonal,
unstable habitat and a permanent one should be better established. Some permanent lakes, for
example, can exhibit seasonal cycles of salinity and temperature.
Lake Grassmere presents a relative environmental stability (Wear et al., 1986);
accordingly, a low cyst production and a high ovoviviparity level are selectively advantageous
for Artemia. Conversely, the encysting mode might cause a delay in population growth that
could be disadvantageous under relatively stable conditions (Browne, 1980a). In Manaure,
Colombia (Camargo et al., 2000), an abundant cyst production was reported for some years
(Rozo and Pinzón, 1983; Bengtson and Simpson, 1989) before hurricane Joan in 1988. The
floods caused by the hurricane considerably damaged the levees; thereby joining several
evaporation ponds in the salt production circuit and causing salinity and temperature to fluctuate
very little for several years. Consequently, Artemia primarily exhibited the ovoviviparous mode
of reproduction for several years.
Only until recently, salinity has increased in the same
evaporating ponds, above the tolerance limit for Artemia, thus producing appreciable amounts of
cysts.
These types of relatively stable environments can result in a low but permanent
reproduction capacity and a multiplicity of asynchronic generations each year (Lenz, 1987).
The reports of Artemia biomass and cyst production (Table 1) in natural habitats have not
been uniform since different units (i.e. ind.l-1, g.m-3 wet weight vs. dry weight) and even
methodologies (i.e. plankton towing nets, sampling containers, sampling size) have been used to
evaluate the stock. Moreover, high temperatures, especially in shallow salt-ponds, can influence
the production outcome, since no refuge will be present for Artemia to escape from high
temperatures.
15
Table 1. Artemia biomass and cyst production from different habitats (modified from Persoone and
Sorgeloos, 1980)(DW=dry weight, N.D.= not determined).
Biomass
Period
Cyst
Alviso Salt Ponds,
California (USA)
Location
13 g.m-3
Summer
N.D.
Burgas-Pomorije
Saltwork (Bulgaria)
2.75 adults.l-1
Jun - Sept.
838 g.m-3
0.47 g.m-3 (DW)
monthly
La Mata Lagoon,
Alicante (Spain)
11,460 g.m-3
May
180-280 g.m-2
Long Island salina
(Bahamas)
Manaure, Guajira
(Colombia)
25-100.l-1
May - Sept
N.D.
1.72 g.m-3 (DW)
annual
0.74 g.m-3
Mono Lake, California
(USA)
400 adults.l-1
Aug - Sept
N.D.
Lenz (1980)
Urmia Lake (Iran)
1.2 adults.l-1
N.D.
N.D.
Parker (1900)
Slagbaai, Bonaire (Neth.
Ant.)
200-360.l-1
Oct. - Jun.
N.D.
Rooth (1965)
Salin de Giraud,
Camargue (France)
0.02-0.2 g.l-1
Mar. - Oct.
N.D.
Isenmann (1975)
San Francisco Bay,
California (USA)
5,000 g.ha-1
per week
Great Salt Lake, Utah
(USA)
Reference
Carpelan (1957)
Lüdskanova (1974)
38,850 cysts.m-3 (INVE - Marden & Curl 2001,
pers. com.)
Amat et al. (1991)
Davis (1978)
Camargo et al. (2000)
18 kg.ha-1
Baker (1966); Rakowicz (in
(4 month/year) Helfrich, 1973)
Finally, an important consideration should be taken into account when conducting long
term experiments with Artemia populations, since rapid and pronounced inbreeding can be the
cause of the observed reductions of life span, brood size, cyst hatchability, number of broods,
survival to adulthood, net reproductive rate, intrinsic rate of increase and sterility of some males
(McCourt, 1987). The same author reported that in two out of the six lines utilized for a longterm population experiment, fecundity became zero in the third generation.
2.3.
Water chemistry
Artemia is a typical inhabitant of hypersaline lakes and ponds, which are characterized by
low species diversity and simple trophic structures, compared to those of marine or fresh water
environments (Por, 1980; Lenz, 1987). The diversification of the Artemia environments varies
16
considerably in terms of anionic composition, climatic conditions and altitude (Triantaphyllidis et
al., 1998).
Aquatic chemistry in North America has been studied more extensively. Cole and Brown
(1967) classified lakes where Artemia lives in three categories based on their anionic
composition:
1. Chloride rich (most lakes, i.e. Chaplin Lake in Saskatchewan, Canada).
2. Sulfate rich (i.e. Penley and Cameron Lake, Washington).
3. Carbonate rich (i.e. Sturgeon Lake, Nebraska).
The same authors determined that chloride rich lakes are the most adequate for Artemia
development. Some lakes present more than one predominant anion (Hammer et al., 1975;
Bowen et al., 1985; Bowen et al., 1988; Comin and Conte, 1988), for example:
1. Two dominant anions: i.e. Green Lagoon in Arizona (USA): sulfate and
carbonate, Albert
Lake in Oregon (USA): chloride and carbonate, Little Manitou (Canada): chloride and sulfate.
2. Three dominant anions: i.e. Mono lake in California and Lake Jesse in Nebraska (USA), are
chloride, carbonate, and sulfate.
As a consequence of the marked differences in water chemistry of Artemia habitats (Table
2 in next page), some populations do not tolerate a different water chemistry composition (mainly
of the dominant ions) and so exhibit a sort of ecological isolation (Bowen, 1964; Lenz, 1980;
Bowen et al., 1985, 1988). Artemia can withstand environments in which the ratio of the major
anions and cations reaches extreme values in comparison with natural seawater (Persoone and
Sorgeloos, 1980). Bowen et al. (1985) noticed that Artemia thriving naturally in 5% sulfate
waters could prosper in waters up to six-fold its original sulfate concentration.
The cations can also be limiting in the survival of Artemia in some biotopes. Croghan
(1958a, b) determined that potassium can be very toxic to Artemia because of its concurrence
with sodium, which becomes lethal when the Na/K ratio in weight decreases below 5.90,
17
although Goldschmidt (1952, in Amat et al., 1991) encountered that in Tso Kar lake (Tibet) and
in ponds where potash is extracted along the Dead Sea, Artemia is present at Na/K ratios between
3 and 4.
Table 2. Presence of characteristic anions in lakes: chlorides, carbonates and sulfates (expressed
together with salinity in g.l-1). The relative percentage of each with respect to the total is
given in parenthesis (from Amat et al., 1991)
Salinity
Cl-
SO4-2
CO3-2
Chloride rich
La Mata Lagoon, Spain
146.7
Leslie, California, USA
318.2
La Sal del Rey, Texas, USA
177.9
13.25
(14.28)
29.53
(14)
1.10 (1)
Chott Ouargla, Algeria
67.8
Great Salt Lake, Utah, USA
203.5
Urmia Lake, Iran
258.0
Sambar Lake, India
115.0
79.38
(85.60)
179.20
(86)
106.90
(99)
34.60
(72.20)
111.10
(88)
146.00
(92.40)
60.80
(86.80)
10.04
(22.42)
14.85
(11.70)
11.70
(7.40)
6.73
(9.60)
0.11
(0.12)
trace
amounts
0.11
(0.1)
0.13
(0.29)
0.18
(0.1)
0.18
(0.1)
2.52
(3.60)
23.30
(30.80)
11.70
(24.40)
1.90
(0.70)
51.72
(68.40)
35.07
(73.30)
243.55
(98.50)
0.51
(0.60)
1.05
(2.20)
1.50
(0.60)
Location
Reference
Amat et al., 1991
Clarke, 1924
Deevey, 1957
Beadle, 1943
Adams, 1964
Löffler, 1961
Clarke, 1924; Baid, 1958
Sulfate rich
Little Manitou, Canada
106.9
Rawson and More, 1944
Tso Kar Lake, Tibet
72.8
Hot Lake, Washington, USA
261.2
Carbonate rich
Mono Lake, California, USA
54.1
12.50
(38.40)
6.93
(21.96)
12.12
(39.61)
Dunn, 1953
Jesse Lake, Nebraska, USA
86.8
Cook Lake, Nebraska, USA
80.8
4.10
(7.80)
4.30
(7.30)
13.80
(26.39)
8
(13.58)
34.38
(65.76)
46.58
(79.11)
McCarraher (1991, in Amat et
al., 1991)
McCarraher (1991, in Amat et
al., 1991)
Hutchinson, 1937
Anderson (1958, in Hammer,
1986)
In nature Artemia is found in neutral to alkaline waters. However, information is limited
about the influence of pH on juveniles or adults (Bonilla, 1984). According to Vos (1979) and
Vos and de la Rosa (1980), naupliar growth decreases and the overall appearance of adults
deteriorates at pH lower than 7.0. The same authors concluded that the optimum pH for Artemia
growth was from 8.0 to 8.5. Additionally, Sato (1967) determined that cyst hatching efficiency
was greatly compromised at pHs below 8.0. Carpelan (1957) evaluated the influence of CO3-2
18
and HCO3- over pH in hypersaline environments at salinities superior to 80 g.l-1 determining that
CaCO3 precipitated and CO3-2 was no longer present. Therefore, very little influence on pH was
observed from these very significant ions at high salinities.
As salinity increases, the biotic diversity decreases rapidly, according to Amat et al.
(1991), concentrating in a small but dominant group of microalgae, of the class chlorophyceae,
order volvocales (Dunaliella salina and D. viridis). These are, however, replaced by moderate
and extreme halobacteria of the superkingdom archaebacteria (Halobacterium sp. and
Haloccocus sp.) as salinity increases.
Under aerobic conditions, halobacteria can utilize
carbohydrates as an energy source (Tomlinson and Hochstein, 1976), but are better characterized
by reducing nitrates to nitrites and even to N2. Soliveri et al. (1984) have isolated several strains
of this halobacteria from the Imon salt ponds (Guadalajara, Mexico), and found that 50% of them
present nitrate to nitrite reduction activity. Additionally, Crane (1974) has shown their capacity
to produce ammonia from proteins and aminoacids. Moreover, Carpelan (1957) has suggested
that during winter, when microbial activity is low, an inverse bacterial process could occur where
ammonia is oxidized to nitrate and then reduced to nitrite.
The determination of primary productivity according to Margalef (1983) could be easily
correlated to the Chlorophyll a concentration. Amat et al. (1991) reports that very few references
mention high primary productivity in hypersaline environments.
Moreover, the most
photosynthetically productive hypersaline environments (Hammer, 1986) are the hypohalines and
mesohalines.
Furthermore, it is widely accepted that salinities higher than 50 g.l-1 hinder
considerably primary productivity (Table 3) in hypersaline ecosystems perhaps because of an
ionic complex formation of the dissolved macronutrients or because of a generic biologic
phenomenon of a drastic specific reduction of microalgae, also occurring at higher salinities
(Amat et al., 1991).
19
Table 3. Chlorophyll a levels in some saline lakes and saltworks (from Amat et al., 1991)
Lake type
Hyposaline
Mesosaline
Hypersaline
Sambar lake (India)
Aveiro Saltwork (Portugal)
Huelva saltwork (Spain)
2.4.
Chl a
(mg.m-3)
16 - 2,170
2.10 - 1,050
13 - 800
2.06 - 10.31
0.92 - 28.23
7.67 - 23.95
References
Hammer, 1986
Hammer, 1986
Hammer, 1986
Alam and Bhargava, 1979
Oliveira, 1985
Martinez-Planells (in Amat et al., 1991)
Latin American and Caribbean Artemia biogeography
The common feature of all Artemia biotopes is their high salinity.
Salinity is the
predominant abiotic factor determining the presence of Artemia and consequently limiting its
geographical distribution to some particular hypersaline biotopes throughout the world (Persoone
and Sorgeloos, 1980; Browne and MacDonald, 1982; Vanhaecke et al., 1987).
Yet, their
distribution in these biotypes is typically patchy which is a consequence of Artemia’s natural
occurrence being restricted to relatively few salt lakes with an adequate anionic composition.
This could give origin to endemic Artemia populations. The impact of other parameters such as
temperature, light intensity, primary food production, etc. on Artemia distribution is limited to the
quantitative population development of brine shrimp or may cause only a temporary absence of
Artemia (Vanhaecke et al., 1987).
The first attempt to classify known Artemia populations was made by Abonyi (1915)
reporting 80 Artemia sites located in 21 different countries. Later Artom (1922), surprisingly,
only mentioned 18 sites followed by Stella (1933) and Barigozzi (1946) who compiled lists with
28 and 29 populations respectively.
Nonetheless, the first systematic effort was made by
Persoone and Sorgeloos (1980) who provided a list of 243 sites distributed over 48 countries in
the five continents. In a revision made by Vanhaecke et al. (1987), this list was expanded to 360
sites (82 in Latin America and the Caribbean) distributed in 57 countries. The listings of Artemia
sites cited by Vanhaecke et al. (1987) do not cover temporal Artemia populations mostly
introduced through inoculation in seasonal salt operations. However, Triantaphyllidis et al.
(1998) in a more recent biogeographic review reported 504 brine shrimp sites (104 in Latin
20
America and the Caribbean) in 58 countries. As a consequence of favorable climatic conditions
and/or specific management allowing for year-round storage of brine, some of these inoculated
strains might, however, become established as natural strains and should be added to the listings
in due time (Vanhaecke et al., 1987).
Recently a new biogeographic review was made for Artemia sites in Latin America and
the Caribbean (Gajardo et al., 1998; Amat, 1999; Camargo et al., 2000; Van Stappen, in press).
The list (Table 4) has recently been expanded from the 104 locations in 22 Latin American and
Caribbean countries reported by Triantaphyllidis et al. (1998) to 147 locations (43 newly
reported) in 24 Latin American and Caribbean countries (including Cuba and Jamaica). The new
Artemia reports in Latin America are mainly due to increasing efforts by Latin American
researchers from Argentina, Brazil, Chile, Colombia, Cuba, Peru, Puerto Rico, Mexico and
Venezuela to explore more remote locations.
In Colombia only two Artemia locations (Manaure and Galerazamba) were reported
overseas (Persoone and Sorgeloos, 1980; Vanhaecke et al., 1987; Triantaphyllidis et al., 1998),
although some Colombian researchers (Cárdenas, 1981; Newmark, 1988; Tobón, 1988) had
reported a third one (Pozos Colorados, Magdalena department).
The lack of standardization concerning both procedures and information to be gathered
during the surveying of potential Artemia sites has created some confusion on the report of novel
populations. Some of the information that should be collected includes:
• Habitat size (area and volume) and soil type.
• Mode of verification for Artemia presence (cysts or biomass) and population distribution (cyst,
nauplius, juveniles and adults), with production units expressed as cysts and dry biomass (g.m3
or g.l-1) and density units expressed as ind.m-3 or ind.l-1.
• Habitat ionic content (Na+, Ca2+, Mg2+, Fe, K+, Cl-, SO42-, HCO3- and CO32-) and conductivity
(mSiemens/cm).
• Salinity (g.l-1), pH and temperature (ºC).
• Nutrients (nitrate, nitrite, ammonia, orthophosphate in mg. l-1).
21
Table 4. Recent reports of Artemia distribution in Latin America.
Country
Argentina
Callaqueo, La Pampa
Colorada Chica, La Pampa
Las Tunas, Cordoba
Río Colorado “Esteros”
Salinas Chicas, Chubut
Brazil
Grossos, Rio Grande do Norte
Areia Branca, Rio Grande do Norte
Galinhos, Rio Grande do Norte
Guamaré, Rio Grande do Norte
Chile
Salar de Tara, Tarapaca
Laguna Amarga, Torres del Paine
Salina El Convento, Valparaiso
Laguna de los Cisnes
Colombia
Pozos Colorados, Magdalena
Salina Cero, Bolívar
Chengue-Tayrona, Magdalena
Bahía Hondita, Guajira
Pusheo, Guajira
Warrego, Guajira
Kangarú, Magdalena
Cuba
Frank Pais, Guantanamo
Jamaica
Yallahs
Mexico
Salinas "Sol de Fuego", Sinaloa
Salinas "El Marquez", Oaxaca
Salinas Laguna Grande, Oaxaca
Salinas Las Coloradas, Oaxaca
San José, Baja California
Tres Hermanos, Sonora
Salinas Casa Blanca, Coahuila
El Barranco, Tamaulipas
Peru
Bocapan, Tumbes
Colán, Piura
Salinas de Ramón, Piura
Mar Brava, Ancash
Los Chimus, Ancash
Playa Salinas, Ancash
Casma, Ancash
Ventanilla, Lima
El Hípico, Lima
Lago Muerto, ICA
Lago Salinas, Puno
Laguna Las Salinas, Arequipa
Venezuela
Cumaraguas, Paraguana
1
Species
Geographical coordinates
References
A. persimilis
A. persimilis
A. persimilis
A. persimilis
A. persimilis
38º 32’ S; 63º 30’ W
38º 15’ S; 63º 50’ W
33º 45’ S; 62º 33’ W
39º 01’ S; 64º 05’ W
42º 38’ S; 63º 50’ W
2
2
1
1
2
A. franciscana
A. franciscana
A. franciscana
A. franciscana
4º 58’ S;
4º 57’ S;
5º 05’ S;
5º 06’ S;
37º 09’ W
37º 08’ W
36º 16’ W
36º 19’ W
3
3
3
3
Artemia spp.
A. persimilis
A. franciscana
A. franciscana
23º 01' S; 67º 18' W
50º 29’ S; 73° 45’ W
Not available
Not available
4
5
6
7
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
11° 09’ 45” N; 74° 13’ 34” W
10° 46’ 29” N; 75° 15’ 55” W
11° 19’ 03” N; 74° 08’ 13” W
12° 19’ 28” N; 71° 44’ 13” W
12° 20’ 47” N; 71° 44’ 17” W
12° 19’
N;
71° 54’ W
11° 59’ 28” N; 74° 32’ 21” W
8
9
9
9
9
9
9
A. franciscana
20° 03’ N; 75° 06’ W
10
A. franciscana
17° 51’ 20’’N; 76 33’ 30’’W
11
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
23° N; 108° W
15° N; 95° W
15° N; 95° W
15° 33’ N; 95° 33’ W
29° 15’ N; 114° 53’ W
26° 40’ N; 109° 35’ W
29° 36’ N; 99° 20’ W
24° N; 98° W
12
12
12
13
12
12
14
15
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. franciscana
A. persimilis*
3° 42’ S; 80° 43’ W
5° 02’ S; 81° 03’ W
5° 35’ S; 80° 36’ W
9° 18’ S; 78° 29’ W
9° 20’ S; 78° 28’ W
9° 20’ S; 78° 26’ W
9° 27’ S; 78° 22’ W
11° 50’ S; 77° 20’ W
12° 13’ S; 77° 02’ W
14° 01’ S; 76° 16’ W
14° 59’ S; 70° 07’ W
16° 22’ S; 71° 09’ W
16
16
16
16
16
16
16
16
16
16
16
16
A. franciscana
12° 06’ N; 69° 53’ W
17
A. persimilis according to morphometry, but A. franciscana according to electrophoretic analysis
22
Table references: 1: Graciela Cohen, 1999, pers. com.; 2: Cohen et al., 1999; 3: Marcos Camara, 2002, pers. com.; 4:
RAMSAR, 1996; 5: Gajardo et al., 1998; 6: Gajardo et al., 1999; 7: Gonzalo Gajardo, pers. com.; 8: Cardenas, 1981;
9: Camargo et al., 2000; 10: Rafael Tizol pers. com.; 11: Young and Royan, 1997; 12: Thalia Castro pers. com.; 13:
Castro et al., 1995; 14: Castro et al., 1997, 2001; 15: Contreras, 1987; 16: Victor Vera, 2002, pers. com.; 17: Alvarez
and Sánchez, 1994.
• Primary productivity (Chlorophyll a in mg.m-3).
• Precipitation (mm) and evaporation.
Moreover, Artemia presents both positive (nauplius) and negative (adults) phototaxis
(Mason, 1966; Lenz, 1980; Bradley, 1984) during different developmental periods of its life
cycle (Aiken, 1978). Thus, sampling time is also an important determinant factor to consider
when planning a sampling campaign.
2.5.
Taxonomy
2.5.1. Artemia phylogeny and taxonomy
Branchiopods have existed since at least the Devonian period (about 410 million years)
and share a constellation of primitive features, whilst the Order Anostraca goes back to the lower
Cretaceous (Fryer, 1987). Its closest relative ancestors inhabit exclusively freshwater or brackish
water ecosystems, and belong to the genus Branchinecta, Branchinella, Branchipus,
Streptocephalus, etc. (Margalef, 1953). From the phylogenetic viewpoint, Old World bisexual
populations are believed to be the closest ancestor to all other Artemia, with A. urmiana inferred
as the closest extant bisexual species to the parthenogenetic lineage (Abreu-Grobois, 1987).
This organism initially described by Schlösser in 1755 was named Cancer salinus
Linnaeus 1758 and subsequently as Artemia salina Leach 1819. Genetic studies in the late 1800s
revealed the existence of two different reproduction modes in Artemia: parthenogenesis (with
different ploidy levels) and zygogenesis (diploid form - bisexual) (Artom, 1906, 1907a, b, 1922,
1931; Brauer, 1983). The species was divided in several varieties based merely on morphology,
until Gilchrist (1960) found that morphological changes in Artemia produced by salinity, were
not inherited characters, which allowed to find the true genetic differences.
23
The taxonomy of Artemia in general is intricate because of the lack of reliable traits, and
due to the fact that the speciation process in the genus turns out to be complex as many elements
participate in a non-exclusive manner (Gajardo et al., in press). Several biotypes were grouped
under the binomen A. salina following similar guidelines as those followed by Artom (1931) who
named the different forms according to chromosome number and reproduction mode.
Reproduction isolation was first reported by Kuenen (1939) between the Californian (USA) and
Sardinian (Italy) Artemia. Later Gilchrist (1960) and Bowen (1965) demonstrated that an evident
geographical barrier was present between the Californian and Mediterranean Artemia. A few
years later Piccinelli and Prosdocimi (1968) and Halfer-Cervini et al. (1968) found sexual
isolation between the allopatric Artemia from Sardinia (Italy) and the one from Hidalgo
(Mexico). Piccinelli and Prosdocimi (1968) denominated the new species Artemia persimilis,
and since it was morphologically similar to the Mediterranean bisexual species A. salina, HalferCervini et al. (1968) introduced the term “fraternal species” to the Artemia genus. Barigozzi
(1974), Abreu-Grobois and Beardmore (1982), and Browne and Bowen (1991) later
demonstrated that the Artemia genus encompasses a complex of bisexual species and
superspecies as well as parthenogenetic types with various degrees of ploidy. Paradoxically,
Branchiopods and perhaps the genus Artemia whose existence has been calculated to be more
than 400 million years old comprehends less than a dozen Artemia species, although it is an
organism rapidly evolving over relatively short periods.
In contrast, the branching of
parthenogenetic types from bisexual Artemia would be older than five million years (AbreuGrobois and Beardmore, 1982; Perez et al., 1994).
2.5.2.
Bisexual species
The identification of bisexual Artemia species has been established by combination of
cross-breeding tests, morphological differentiation, cytogenetics, allozyme studies, nuclear and
mitochondrial (mtDNA) DNA sequencing (Gajardo et al., in press).
i)
A. franciscana Kellogg 1906
Is widely distributed along the American continent and is reported to be present
practically from one extreme of the continent to the other; from Chile (Gajardo et al., 1995) up to
24
Little Manitou (51° 48’ N) in Eastern Canada (Vanhaecke et al., 1987; Bowen et al., 1988;
Triantaphyllidis et al., 1998). According to Bowen et al. (1985) and Browne and Bowen (1991)
A. franciscana Kellogg 1906 is a superspecies (i.e. cluster of incipient species in statu nascendi)
A. monica Verril 1869 being a special case of a population resembling typical A. franciscana but
described for an ecologically unique habitat (Mono Lake, California) (Gajardo et al., in press).
Likewise, there are populations from Nebraska (USA) inhabiting low chloride and high carbonate
content lakes (Browne and Bowen, 1991). A. franciscana populations present a high mean
genetic distance (Nei’s D=0.126) as compared to some other Artemia species from the Old
Continent (Nei’s D=0.014 to 0.091), indicating a substantial divergence of the species
(Beardmore et al., 1995). Furthermore, reproductive isolation between Old and New World
bisexual Artemia is a prominent feature in the evolution of these species (Abreu-Grobois, 1987).
Because of several factors (ecologic barriers, recolonization, cycles of extinction, etc.) that
separate several A. franciscana populations, an incipient speciation is taking place with this
species (Bowen et al., 1985; Abreu-Grobois, 1987; Beardmore et al., 1995). In contrast, values
of genetic variation observed by Abreu-Grobois (1983) for the heavily commercially exploited
San Francisco Bay A. franciscana population are among the lowest of all the Artemia populations
analyzed. The genetic differentiation of A. franciscana populations according to Browne and
Bowen (1991) is mainly due to chemical differences in their habitats. However, there are many
other factors, as stated by Gajardo et al. (in press) that require further investigation.
ii)
A. persimilis Piccinelli and Prosdocimi 1968
Present in Argentina, Chile (Gajardo et al., 1998) and in Peru (Vera, 2001, pers. com.),
however it has also been reported in the Mediterranean basin (Barigozzi, 1989) in Sardinia
(Italy). This species has 44 chromosomes, contrary to all the other bisexual species with 42
(Piccinelli and Prosdocimi, 1968). Gajardo et al. (1999, 2001b) believe that the A. persimilis
population found in Torres del Paine (Chile) is likely to be a hybrid population. This population
exhibits peculiar genomic characteristics, some of them typical of A. persimilis such as its diploid
number (2n=44) and Nei’s (Nei, 1972) genetic distance between populations (as compared to an
A. franciscana sample). According to Gajardo et al. (2001b), the chromocenter frequency of this
Chilean population corresponds to that of A. franciscana. Perhaps this condition has led some
authors to describe it, based on morphological traits, as A. franciscana (Zuñiga et al., 1999) and
25
later as A. persimilis (De Los Rios and Zuñiga, 2000). Recently, Papeschi et al. (2000) have
provided evidence, based on cytogenetic data, that A. franciscana is found in Argentina and
seems to hybridize in nature with A. persimilis.
Hence, the current distribution paradigm
considering, A. persimilis restricted to a few sites in Argentina (Triantaphyllidis et al., 1998) is
challenged by the finding of the species in southern Chile at Laguna Amarga, Torres del Paine
(50o latitude South) (Gajardo et al., 1999); likewise, by the finding of A. franciscana in Argentina
(Papeschi et al., 2000).
iii)
A. salina Bowen and Sterling 1978
This species groups the bisexual populations of the Mediterranean basin. Schlosser in
1755 was the first one to describe Artemia, collecting samples from the salt evaporation
depressions in Lymington (England) (Kuenen and Baas-Becking, 1938). In 1819, Leach named
this taxon A. salina (Artom, 1931). Bowen and Sterling (1978) suggested to assign the name A.
salina exclusively to the extinct species from Lymington (England) and to use the term A.
tunisiana to describe the bisexual populations of the Mediterranean region. Moreover, Barigozzi
and Baratelli (1993) suggested maintaining the denomination A. salina for the Italian populations,
while the North-African populations could be named A. tunisiana. According to Triantaphyllidis
et al. (1997), the fact that several scientists are still using the binomen A. salina or A. tunisiana to
refer to the same population is causing great confusion and misidentification. The same author
using morphological and molecular (allozyme and AFLP) characters determined that A. tunisiana
and A. salina were the same species; hence, the binomen A. salina had priority over A. tunisiana
(the Principle of Priority Code, Article 23).
iv)
A. urmiana Günther 1890
This species is endemic to Lake Urmia (Iran). Under laboratory conditions A. urmiana is
fertile when crossed with A. sinica and a population from Kazakhstan (Pilla and Beardmore,
1994). Barigozzi et al. (1987) determined from a Lake Urmia sample that this population is
exclusively parthenogenetic; with different ploidy levels (di-, tri- and even tetra-) suggesting the
possible coexistence between bisexual and parthenogenetic populations with different ecological
preferences or a possible overturn and/or disappearance of the bisexual population. A. urmiana
according to Pilla and Beardmore (1994) presents a high genetic variation value, and among Old
26
World populations it has the highest mean number of alleles per locus (2.3) and percentage
polymorphic loci (65 %).
v)
A. sinica Cai 1989
Distributed in the North and Central provinces in China.
This species exhibits
morphological differences, as well as a genetic distance that adjusts to the congeneric scale of the
genus as compared to other species of the American Continent or the Old Continent (Pilla and
Beardmore, 1994).
Furthermore, these authors showed that A. sinica presents the highest
heterozygosity value (9.7 %) among the Old World populations.
vi)
Artemia sp. Kazakhstan Pilla and Beardmore 1994
This population exhibits great genetic and morphometric differentiation compared with
the previous species mentioned. Artemia sp. Kazakhstan is fertile when crossed with A. urmiana
and A. sinica (Pilla and Beardmore, 1994). However, the genetic distance among the fertile
crosses of these three species ranged between 0.249 to 0.346 which is higher than the estimated
values for conspecific populations of A. franciscana (0.13) and A. salina (0.09) (Pilla and
Beardmore, 1994; Abreu-Grobois, 1983, 1987). Considering the geographic isolation between
Lake Urmia, China and Kazakhstan (but considering the limited knowledge of the biogeography
of Artemia in Asia) the population from Kazakhstan is a good candidate according to
Triantaphyllidis (1996) to become a new species.
vii)
A. tibetiana (Abatzopoulos, Zhang and Sorgeloos 1998)
This bisexual species exhibits great morphometric differences with the other bisexual and
with parthenogenetic species. It has been characterized (Abatzopoulos et al., 1998, 2002) using
different methods: i.e. biometrics of cysts and nauplii, morphometry of adults, cytogenetics,
allozyme and DNA analyses and crossbreeding/fertility tests with known Artemia species. This
species has been reported in Lagkor Co Lake, which is according to Mianping (1997), a
carbonate lake situated 4,490 m above sea level in the arid-temperate plateau zone of Tibet (32º
03’ N; 84º 13’ E). This salt lake has a salinity of 60 g/l, with alkaline water (pH 8.8) and the
temperature varies from a maximum of 24 ºC to a minimum of -26 ºC, with average annual air
temperature of 1.6 ºC.
Dong et al. (1982, in Mianping, 1997) characterized the Artemia
27
population from Lagkor Co Lake as a cryophilic Artemia.
2.5.3. Parthenogenetic populations:
Additionally to the bisexual Artemia populations, several parthenogenetic populations
exist and are endemic to the Old Continent (Triantaphyllidis, 1996). Parthenogenetic types tend
to predominate in more disturbed, stressful conditions of salinity, temperature and food
availability (Browne and Bowen, 1991; Lenz and Browne, 1991). Asexual Artemia types usually
are geographically segregated from sexual forms, and are predominantly found in low and high
latitudes (<25o N and >40o N), whilst bisexuals occur in temperate regions (35-40o N) (Gajardo et
al., in press). These populations have different levels of ploidy: di-, tri-, tetra- and pentaploidy
(Persoone and Sorgeloos, 1980; Barigozzi and Baratelli, 1982; 1993; Abatzopoulos et al., 1986)
and are grouped under the A. parthenogenetica denomination for taxonomic convenience
(Barigozzi, 1974, 1980, 1989).
However, the International Study on Artemia (ISA) group
recommends not to use the binomen Artemia parthenogenetica anymore, as, according to strict
taxonomic principles, a species that reproduces by parthenogenesis can not be defined as a
'species' (i.e. cross breeding tests etc.). Although it is a very rare phenomenon (0.4 % according
to Stefani, 1964, and 1-4 % according to Amat et al., 1991) for parthenogenetic Artemia to bear
males, these males are sterile. This phenomenon has been reported with di- and tetraploid
Mediterranean parthenogenetic populations by Abonyi (1915) in Capodistria (Slovenia), Artom
(1931) in Sête (France), Ventura (1963) and Stefani (1963, 1964) in Cerdeña (Italy) and Amat et
al. (1991) in La Mata Lagoon (Spain).
2.6.
Discriminant factors in relation to Artemia taxonomy
2.6.1. Cytogenetics of the genus Artemia
The analysis of the chromosome set in maturing Artemia eggs led in the early 1900s to the
discovery of polyploidy in animals (Barigozzi, 1989). Very few researchers have conducted
studies on cytogenetics in Artemia since the pioneer work of Artom (1931) who used
28
chromosome number and reproduction mode as a discriminant factor to classify particularly
parthenogenetic species, which, as mentioned before, present several levels of polyploidy
(Barigozzi, 1942; Bowen, 1962; Nakanishi et al., 1962; Mitrofanov et al., 1976, 1982).
At the present time, early larval stages (Instar I) are used for Artemia cytogenetic studies
rather than using mature eggs as in former studies (Barigozzi, 1989). The larval cells from Instar
I have advantages (Barigozzi, 1942) for the following reasons: i) they can provide a larger
frequency of mitoses, which decreases strongly during its development; ii) the prophase (the most
useful stage for structural analysis of chromosomes) is better identifiable at this stage; iii) the
nauplius can be easily squashed directly on a slide.
The actual Artemia chromosomes staining technique formulated by Barigozzi and
Baratelli (1982) consists on treating freshly hatched nauplii with a hypotonic solution, and
subsequently staining them with acetic orcein or with C-banding Giemsa (Barigozzi and
Badaracco, 1984).
As development progresses, larger nuclei appear as a product of cell
polyploidization which may originate from endoreduplication (Abatzopoulos et al., 1986;
Freeman and Chronister, 1988). Chromocenters are heavily stained heterochromatic areas with
highly repetitive DNA (repeated in the order of 6x105 copies per haploid genome of A.
franciscana) family of the type Alu I (113 bp), also named satellite I, in the interface nuclei I
(Barigozzi et al., 1987). This genome trait varies between and within species, and is correlated to
some extent with genetic differentiation based on Nei’s distances (Abreu-Grobois and
Beardmore, 1982; Colihueque and Gajardo, 1996) as well as with the amount of repetitive DNA.
Several researchers have presented data on the chromosomes and chromocenters of
Artemia species as a way to understand the role of chromosomal evolution in the speciation
pattern observed in brine shrimp (Goldschmidt, 1952; Barigozzi and Tosi, 1959; Stefani, 1963;
Beardmore and Abreu-Grobois, 1983; Abatzopoulos et al., 1986; Abreu-Grobois, 1987;
Barigozzi, 1989; Sun et al., 1995; Colihueque and Gajardo, 1996; Rodriguez-Gil et al., 1998;
Papeschi et al., 2000). A. franciscana shows the highest concentration of repetitive DNA as well
as the highest chromocenter frequency (Gajardo et al., 2001b). No such structures have been
reported in Old World species such A. salina and A. urmiana, nor in parthenogenetic populations.
29
According to the same author, New World species, particularly A. franciscana, would then
represent a derived state likely to have arisen by sequence amplification from an original
common ancestor by a mechanism yet not fully understood (unequal crossing over according to
Badaracco et al., 1987).
Nearly all chromosomes lack centric constrictions (diffused centromeres) and the
homologous chromatids are usually not conspicuous due to supercoiling or spiralization (Stefani,
1963; Abatzopoulos et al., 1986; Barigozzi, 1989).
Because of these problems, Artemia
karyotypes or karyograms have been described only very occasionally (Mitrofanov et al., 1976,
1982; Abatzopoulos et al., 1986, 1987). Even more, the lack of a centromeric constriction makes
the statistical evaluation (essential for comparisons of chromosome length between different
populations and/or species) particularly difficult.
Giemsa C-banding karyotypes have been
constructed only for A. franciscana, and distinct heterochromatic regions can be seen in
populations that exhibit also distinct chromocenters (Abatzopoulos et al., 1987).
All bisexual species are diploid (2n=42) including the particular case for A. persimilis, as
previously mentioned, with two extra chromosomes (2n=44) (Beardmore and Abreu-Grobois,
1983). According to Abatzopoulos et al. (1998) in parthenogens, a great variety of ploidies has
been observed
(Barigozzi, 1974; Abatzopoulos et al., 1986; Triantaphyllidis et al., 1996).
Abatzopoulos et al. (1998) observing chromosomes from A. tibetiana determined that it is diploid
(2n=42) with a high percentage of aneuploid nuclei, without chromocenters present in resting
nuclei, which is rather expected for species from the Eastern Old World.
According to
Beardmore and Abreu-Grobois (1983) the presence of chromocenters in nuclei is limited to New
World populations and those populations resulting from transplantation of such populations.
Triantaphyllidis et al. (1996) worked on Artemia populations from Namibia and Madagascar.
They observed that nauplii from Namibia were mostly diploid (2n=42) and rarely tetraploid
(4n=84), while those from Madagascar were only triploid (3n=63). Neither the Namibian nor the
Madagascar populations presented distinct chromocenters in the nuclei as observed earlier by
Barigozzi and Baratelli (1982) for different populations of A. franciscana and A. persimilis.
30
2.6.2. Electrophoretic analysis and DNA markers
The study of individual genes in Artemia started with morphological variation research
conducted by Bowen (1962, 1963, 1965; Bowen et al., 1966) and in A. franciscana, specifically,
by Barigozzi et al. (1969). Bowen et al. (1969) carried out the first genetic biochemical Artemia
study.
In the mid 1960s, the pioneer work on allozymic protein gel electrophoresis of Harris
(1966), and Lewontin and Hubby (1966) proved how allozyme electrophoresis could provide a
richness of Mendelian information on populations in a relatively short period. This method offers
great advantages since the data generated are more objective.
The phenotypes obtained
electrophoretically through this method are evaluated as a direct expression of the gene loci and
are not susceptible to direct modification by environmental factors; thus, becoming ideal to
examine the genetic composition of biological systems (Beardmore and Abreu-Grobois, 1983).
This technique utilizes specific isozyme “dyes”, and the analysis of the resulting bands, which
corresponds to particular allelic frequencies, is interpreted using different distance and similarity
indices to find species or even population relationships.
In the early 1980s, a technique called isoelectrofocusing was developed to obtain higher
precision using thin polyacrylamide gel, which separates macromolecules according to their
isoelectric point, since some proteins contain acid and basic groups in their molecules. The pH in
the gel increments from the anode to the cathode, thus molecules will stop traveling through the
gel once they find their respective isoelectric (pH) point. This technique has been applied in the
study of Artemia populations by Seidel et al. (1980), Seidel and Simpson (1984), and Requintina
and Simpson (1987). In the 90s, Abatzopoulos and Triantaphyllidis (1996, in Triantaphyllidis,
1996) utilized a new technique called amplified fragment length polymorphism (AFLP)
developed by Vos et al. (1995) to differentiate successfully Artemia strains of the same species.
Extensive research also during the 1980s on Artemia allozyme polymorphism
demonstrated that brine shrimp characteristically displays high levels of genetic variability
(Bowen et al., 1980; Abreu-Grobois and Beardmore, 1980, 1982; Abreu-Grobois, 1983, 1987;
Beardmore and Abreu-Grobois, 1983; Abatzopoulos, 1988; Abatzopoulos et al., 1993). In the
31
1990s, more genetic information was available on the genus from the western side of the Old
World (A. urmiana, A. sinica, A. tibetiana and Artemia sp. from Kazakhstan) (Abreu-Grobois and
Beardmore, 1991; Pilla, 1992; Pilla and Beardmore, 1994; Thomas, 1995; Abatzopoulos et al.,
1998). In the same decade, Williams et al. (1990), and Welsh and McClelland (1990) described a
procedure that uses a single short primer of arbitrary sequence to amplify genomic DNA. This
technique, called randomly amplified polymorphic DNA (RAPD) has also been used successfully
to detect extensive polymorphisms in several species and in analyzing relationships among
Artemia species and strains (Sun et al., 2000; Camargo et al., 2002a).
According to Garcia and Benzie (1995), these polymorphisms have proved the source of
many useful markers that have been used to assist in breeding programs and gene mapping.
RAPD reactions have been carried out using different primers such as ERIC1R (5’
ATGTAAGCTCCTGGG
GATTCAC
3’)
and
ERIC1RA
(5’
ATGTAAGCTCCTGGGGATTCAG 3’) in single primer reactions. Sun et al. (2000) utilized
seventy, ten-base synthetic oligonucleotides to amplify 458 distinct fragments. The same authors
determined that significant differences are present between bisexual sibling species and
parthenogenetic types; the later one provided 94 specific molecular markers, while bisexual
sibling species presented only 27 specific molecular markers.
The levels of genetic variability for Artemia are among the highest within crustaceans and
are comparable to the mean obtained from a variety of invertebrate species (Abreu-Grobois,
1987, and Browne and Bowen, 1991). The Artemia genome has been studied mostly in A.
franciscana from San Francisco Bay (Marco et al., 1991). The species has a nuclear DNA
content of about 1.6x109 bp/haploid genome, representing approximately 70 Mbp per average
chromosome. Fifty nine percent of the nuclear genome is single copy, twenty percent moderately
repeated and fifteen percent is highly repetitive DNA, with a relative low G+C content (32.4%).
Concerning extra-nuclear DNA, the complete mitochondrial DNA of A. franciscana has been
sequenced. It has a total length of 15,822 bp, with a G+C content of 35%, and encodes 37 genes
in a highly compact organization, i.e. with few intergenic spacings (in Gajardo et al., in press).
32
The geographical separation between Old and New World species show the greatest
differentiation (D=1.497 - 1.952) (in Gajardo et al., in press).
A quite similar amount of
divergence (D=1.073) is observed between A. franciscana and A. persimilis. Within the Old
World, genetic distance values for inter-specific comparisons range from 0.254 to 0.808 (AbreuGrobois, 1983; Pilla, 1992; Thomas, 1995). Conspecific populations of A. franciscana show
mean genetic distances of D=0.126, though some populations in South America, for example,
exhibit genetic distances well above this value revealing high inter-population divergence and,
perhaps, incipient speciation stages (Gajardo et al., 1995).
However, the standard errors
associated with these values are often relatively high (1/2 or 1/3 of the genetic distance
estimates).
According to Gajardo (1999, in Amat, 1999), the correspondence between morphological
and genetic (allozymic) data suggests that the corporal structure of Artemia is genetically
regulated. Further, the absence of relatedness between allozymic and cytogenetic data for the
populations studied can indicate that these two levels of biological organization exercise separate
influence over the phenotype. According to the same author, there is a necessity to focus future
allozymic Artemia studies to realize new explorations on Artemia abundance and distribution in
Chile and Peru, to confirm the real distribution of A. persimilis in these two countries, as well as
to determine the reproductive isolation criteria between the species present in the continent.
The fact that A. persimilis is the most divergent species led Perez et al. (1994) and
Badaracco et al. (1995) to consider it a close relative (a primitive species) to the original
ancestor. From this primitive species (condition also endorsed by the very low chromocenter
numbers) originated, at different times, A. salina, A. sinica and A. franciscana. However, the
origin of A. franciscana is somewhat confusing since it is the only one showing satellite DNA
(Alu I), a trait not seen in the Eurasian populations (in Gajardo et al., in press).
Recent electrophoretic assays (Gajardo and Beardmore, 1989) with A. franciscana from
Great Salt Lake (Utah, USA) have shown a positive correlation between the percentage of
zygotes produced as cysts and the level of heterozygosity (determined) in the mother. More
33
heterozygous females also produce more zygotes, have more broods and start to reproduce at a
younger age than less heterozygous females.
Moreover, Zapata et al. (1990) showed an increased male mating success with
heterozygosity in a population of A. franciscana from Manaure (Colombia). Males heterozygous
for three and four loci exhibited higher fitness values (2.99 and 2.55, respectively) in comparison
to homozygous genotypes with an arbitrarily assigned fitness value of one. Moreover, Correa et
al. (unpublished data) using starch gel electrophoresis analyzed 21 A. franciscana gene loci from
Yallahs lagoon populations (Jamaica), which presented 17 monomorphic loci and a
heterozygosity value of 0.055, similar to that (He=0.049) of the Galerazamba population
(Colombia).
The same authors found that the genetic identity value between these two
populations was 0.967.
Besides natural populations, Artemia inoculation schemes provide excellent opportunities
for the study of fitness-related traits and their association to genetic variability (Gajardo et al., in
press).
One striking feature of Artemia is its high potential for fast genetic changes after
colonization or introduction to novel environments. This exposition to a new environment might
end up in reproductive isolation, thus being important to speciation, as Orr and Smith (1998) have
pointed out. A. franciscana has been the most common species used for introductions around the
world, due to its great phenotypic plasticity, genetic richness and extended gene pool and its high
value for aquaculture applications. An extensive case study conducted over the last few years has
been the inoculation of A. franciscana strain from San Francisco Bay (SFB - USA) into Vietnam
in 1982. Kappas (2001) investigated five fitness-related attributes from five different SFB strains
introduced into Vietnam (the Vietnamese strain - VC, and its subsequent 4 year classes Y1 to Y4)
and one reference (SFB original inoculation source). The number of cysts produced per female
was significantly different among strains (P=0.0057).
Of the remaining four fitness traits,
significant differences were found for the number of broods per female (P=0.0185) and the
number of encysted broods (P=0.0003), but not for the number of nauplii or total zygotes
produced. The level of multi-locus heterozygosity was positively correlated with the number of
cysts in the Y3 strain (P=0.009) and negatively with the number of broods in the Y4 strain
(P=0.039). In the same study, correlations for number of nauplii, zygotes and broods per female
34
in the VC strain also approached the borderline of significance (P values ranged from 0.053 to
0.069).
In a follow-up study (Kappas, 2001), three A. franciscana strains (SFB, VC, Y1) were
cultured in 80 g.l-1 salinity and 2 temperatures (26 and 30 oC). The number of cysts revealed a
highly significant (P=0.00053) reduction of cyst production at 30 oC. Pronounced interactions
(P<10-5) were observed for the number of nauplii, zygotes and the rank of broods. Briefly, the
pattern that emerged was of decreasing encystment and offspring production and increasing
ovoviviparity and reproduction at higher temperature. Finally, when correlation coefficients to
individual heterozygosity were calculated, significance was not established. Temperature is
thought to be one of the major factors that shape the gene pool at latitudes as that of Vietnam.
Certainly, other factors such as food availability, population density, etc., could greatly influence
the genetic makeup. However, temperature fluctuations can trigger a chain reaction of the events
and, consequently, are more or less a significant component of the biotic and abiotic interplay
responsible for genotype representation in a particular strain (Gajardo et al., in press).
Likewise, Gajardo et al. (1995) detected electrophoretically the presence of some new
alleles in a SFB strain, previously introduced in Macau (Brazil), which were absent in the original
SFB strain. Drastic changes are likely imposed on the gene pool and consequently have an effect
on a certain phenotypic response, for instance cyst production or temperature tolerance (Tackaert
and Sorgeloos, 1991).
Furthermore, Macau (A. franciscana) shows increased survival at
temperatures above 30 oC as compared to the original SFB strain.
Moreover, Browne et al. (2002) measured reproductive and life span traits for two
obligate parthenogenetic and three sexual (two A. franciscana and one A. sinica) brine shrimp
populations. They found that for all traits, the environmental component of variance is greater
than the genetic component measured. The average genetic component of variation for the 10
traits was 23.44%, ranging from 5.26% for number of cysts to 44.87% for number of nauplii.
The change in variance due to rearing in different environments, when averaged for all traits and
all populations, increased variability by 9.9%, and was 44.2% higher for sexual than
35
parthenogenetic populations, with significant differences in number of broods, total number of
offspring, and number of nauplii.
2.6.3. Biometry and morphology of adult Artemia
Morphological characters have been used as a taxonomic tool for over a century to
describe and discriminate the various species of Artemia based on furca morphology and spine
number, ovisac form, frontal knobs shape and penis spines presence or absence in males
(Schmankewitsch, 1875, 1877; Anikin, 1898; Samter and Heymons, 1902; Kellogg, 1906; Artom,
1907a, 1907b; Abonyi, 1915; Martin and Wilbur, 1921; Heath, 1924; Bond, 1933; Warren et al.,
1938; Kuenen, 1939; Bateson, 1984). Nonetheless, years later Weisz (1946), Gilchrist (1956,
1960) and Baid (1963) conducted studies on the influence of salinity over growth, body form and
changes on its proportions.
The different morphometric changes observed, sometimes
erroneously classified some individuals coexisting in the same biotope as a different form, type,
race, species, subgenus or even genus (Belk and Brtek, 1995).
Amat (1980a, b) in a study considering bisexual and parthenogenetic Spanish populations,
as well as A. franciscana, made a detailed morphological comparison concluding the following:
a. the increase in salinity reduced the furca length and the number of setae in the furca;
b. the relative length of the abdomen (to the total length of the animal) increased with salinity;
c. furca shape and size, as well as setae number, display a more drastical decrease in length
when salinity increases;
d. high salinities favored sexual maturity; the bisexual Artemia reached sexual maturity when
the ovisac length was smaller than that of parthenogenetic Artemia.
After the work of Amat, several authors (Abatzopoulos et al., 1987, 1989; Cai, 1987;
Castritsi-Catharios et al., 1987; Majié and Vukadin, 1987; Sherif, 1989) began to use
standardized culture conditions and presented detailed adult Artemia measurements based on the
standard characters that Amat (1980a) introduced. All these studies used uni- and multivariate
measurements in an effort to distinguish and to compare several populations.
36
Although multivariate procedures and specially the discriminant function techniques were
known since the 1930s, Hontoria and Amat (1992a, b) were the first in introducing and applying
discriminant multivariate procedures to study populations of Artemia in Spain, Italy and USA.
Their results demonstrated that this technique could discriminate Artemia species, and group
populations that are geographically near and share environments with similar ionic compositions.
Doubtlessly, the studies of Hontoria and Amat (1992a, b) offered new perspectives in the
morphometry of Artemia.
However, these studies were performed exclusively on female
characters in Artemia populations.
Later, Pilla and Beardmore (1994) studied bisexual
populations of the Eastern region of the Old Continent and evaluated characters of females as
well as that of males; they concluded: “the global discrimination based on male characters was
better than that of the females, confirming the importance of the male characteristics in this type
of analysis”.
Hontoria and Amat (1992a, b) introduced other secondary male sexual characters: frontal
knob size of the first antenna and paired penis size. In addition, in this case the analysis perfectly
discriminated the Peruvian populations belonging to two different species, classifying most of the
populations studied into the A. franciscana group of the American continent, whereas the
population of the Arequipa lagoon (Peru), was classified as the A. persimilis species, also present
in Argentina and Chile (Gajardo et al., 1998).
The external morphology of Artemia cysts does not show any variation, contrary to other
species of Anostracans (i.e. genus Chirocephalus) (Mura, 1986). The cysts of Artemia seem to
be very uniform when comparing the studies made by Mura (1986) on parthenogenetic
populations with those presented by Wheeler et al. (1979) for A. franciscana populations.
2.6.4. Artemia reproductive isolation
There are examples showing that morphologically distinct species that have been
separated for a long period are sexually compatible (Wiman, 1979; Maeda-Martinez et al., 1992).
37
Intrapopulation experimental crosses and cross-fertility tests have been performed in individual
crosses of laboratory-reared populations of A. franciscana and A. persimilis (Gajardo et al.,
2001a). The populations compared displayed significant variability in fecundity (total offspring,
brood size) and in the ratio oviparity/ovoviviparity. Hybrid offspring was abundantly produced
in cross-fertility tests and showed a pronounced switch to the encystment mode, particularly in
crosses with A. persimilis.
A possibility might exist that some Artemia populations have only completed the first stage
of the allopatric speciation process (i.e. geographical separation) but have not completed the
second stage required for the development of pre-mating isolating mechanisms (Mayr, 1969;
Coyne, 1992). In addition, A. franciscana and A. persimilis are recently diverged according to
Browne and Bowen (1991), and so are in the process of developing efficient barriers to gene
exchange (Abreu-Grobois, 1987; Gajardo et al., 2001a).
The above observations, together with the fact according to Gajardo et al. (in press) that
the Biological Species Concept does not apply to the parthenogenetic Artemia, emphasize the
need to reevaluate the application of this definition to the Artemia genus. A number of concepts
maintain that reproductive isolation is not necessarily a key aspect of the Biological Species
Concept, as many clearly differentiated species are able to maintain their genetic identity without
substantial reproductive isolation (Cohesion Species Concept - Templeton, 1989).
2.7.
Importance of Artemia in aquaculture and salt production
2.7.1. Role of Artemia in aquaculture
Among the live diets used in the larviculture of fish and crustaceans, brine shrimp nauplii
according to Bengtson et al. (1991) constitute the most used food source worldwide. Lavens and
Sorgeloos (1998) reported that more that 2,500 metric tons of Artemia dry cysts are consumed
annually by the aquaculture industry, and most of them come from Great Salt Lake (Utah, USA).
The shrimp industry is the major consumer of Artemia. According to Vinatea (1999, pers. com.),
38
the production of a million penaeid post-larvae requires around 10 kg of Artemia cysts from
Great Salt Lake (hatching efficiency of 120,000 nauplii/g).
The nutritional effectiveness of a food organism is mainly determined by its digestibility
and consequently by its size and form (Lavens and Sorgeloos, 1996). Prey size is outmost
important for marine fish larvae that have very small mouths and swallow their prey in one bite.
However, Artemia strains vary greatly in naupliar size (Vanhaecke and Sorgeloos, 1980a).
Moreover, a high correlation exists between Artemia naupliar length and larval fish mortality, for
example in the marine silverside Menidia menidia (Beck and Bengtson, 1982).
Hence,
characterization studies are relevant to improving and selecting an Artemia strain with the proper
size.
Furthermore, Artemia is also important for its high nutritional value. This Anostracan
contains high levels of carotenoids, and the strain-bound concentration of essential fatty acids
[DHA (22:6n-3) and EPA (20:5n-3)].
The latter according to Léger et al. (1986) are not
biosynthesized from shorter unsaturated fatty acids by most marine fishes and crustaceans. In
contrast, the amino acid composition of Artemia nauplii seems to be remarkably similar for all
strains, suggesting that it is not environmentally determined in the way the fatty acids are (Lavens
and Sorgeloos, 1996). Additionally, analysis of Artemia cysts from San Francisco Bay (USA)
have shown to contain various vitamins, particularly high levels of thiamine (7-13 µg.g-1), niacin
(68-108 µg.g-1), riboflavin (15-23 µg.g-1), pantothenic acid (56-72 µg.g-1) and retinol (10-48 µg.g1
) (Léger et al., 1986). A stable form of vitamin C (ascorbic acid 2-sulphate) is also present in
Artemia cysts. This derivative is hydrolyzed to free ascorbic acid during hatching, later reaching
levels in nauplii between 300 and 550 µg.g-1 dry weight (Lavens and Sorgeloos, 1996). The
nutritional content of Artemia can be manipulated through enrichment (bioencapsulation)
techniques.
This procedure takes advantage of the relatively primitive non-selective filter-
feeding behavior of Artemia, through the incorporation of specific nutritional components to the
nauplii or adults before offering them as a prey to the predator (Léger et al., 1986).
39
2.7.2. Role of Artemia in salt production
Over the centuries, thousands of hectares of saltpans have been constructed all over the
world in tropical and subtropical areas, to produce solar salt (Van Stappen and Sorgeloos, 1993).
In saltworks Artemia is found in the evaporation ponds only at intermediate salinity levels from
about 100 g.l-1, the upper tolerance level of predators, to about 250 g.l-1, when food becomes
limiting and brine shrimp need more energy for osmoregulation, or when the water becomes
more toxic in ionic composition as a result of selective crystallization (Tackaert and Sorgeloos,
1993).
Optimal production of saltworks in terms of both quality and quantity is highly
dependable on hydrobiological activity and requires a well-established balance between primary
and secondary producers, with brine shrimp grazing on phytoplankton constituting the major
interaction (Davis, 1978, 1980; Sorgeloos, 1980; Tackaert and Sorgeloos, 1993). According to
Tackaert and Sorgeloos (1993), algal blooms, induced by natural availability of organic and
inorganic nutrients, are generally beneficial, since they insure increased solar heat absorption,
resulting in faster evaporation and increased salt yields. However, if they are not metabolized in
time, algal excretion and decomposition products, such as the dissolved carbohydrates, act as
chemical traps and consequently prevent early precipitation of gypsum which will contaminate
the sodium chloride in the crystallizes, thus reducing salt quality. Furthermore, such organic
impurities as algal agglomerations, which turn black on oxidation, may contaminate the salt and
reduce the size of the crystals and hence the salt quality. In the worst situation, high water
viscosity may completely inhibit salt crystal formation and precipitation.
The presence of
Artemia in sufficient numbers is essential, not only for controlling algal blooms (Davis, 1980),
but also for providing essential nutrients from Artemia metabolites and/or decaying animals as
suitable substrate for development of Halobacterium in the crystallization ponds (Jones et al.,
1981).
High concentrations of red halophilic bacteria promote heat absorption, thereby
accelerating evaporation, and reduce concentration of dissolved organics. Lower viscosity levels
promote the formation of larger size crystals, thereby, improving salt quality (Sorgeloos, 1983;
Haxby and Tackaert, 1987).
40
2.8.
Factors determining Artemia quality for aquaculture
2.8.1. Cyst and naupliar size
D’Agostino (1965) and Claus et al. (1977, 1979) reported that Artemia exhibit different
cyst diameters according to its geographical origin, and that within the same strain the mean cyst
size remains constant between batches, collected at different periods of the year. However, the
work of Vanhaecke and Sorgeloos (1980b) and Camargo et al. (2000) indicates that in a few
cases the mean cyst diameter varies significantly among batches of the same strain. Many of
these differences in cyst size and naupliar length between several populations of Artemia are
presently well documented. Certain physicochemical parameters as salinity have also been
reported to affect cyst size and chorion thickness (Vanhaecke and Sorgeloos, 1980b).
Vanhaecke and Sorgeloos (1980b) reported cyst diameters as small as 224 µm for the San
Francisco Bay strain (California, USA) and Abatzopoulos et al. (1998) reported cyst diameters as
large as 330 µm for the recently reported bisexual species A. tibetiana, surpassing even the well
known large cyst diameters of the polyploid parthenogenetic populations with a typical diameter
near 280 µm. Within the same species, populations present different cyst diameters as well as
different chorion thickness. Cysts from Great Salt Lake (Utah, USA) have a larger cyst diameter
compared with those from San Francisco Bay (California, USA). According to Amat (pers. com.,
1999) as a rule, A. persimilis strains tend to present a chorion thickness superior to 12 µm.
According to biometrical studies performed by Vanhaecke and Sorgeloos (1980b) on
several populations from different geographical origin concluded that the biometrical parameters
that they studied were mainly strain specific. The same authors determined that naupliar length
of Instar-I can vary between 430 and 520 µm. Naupliar size is non-critical for the feeding of
crustacean larvae, which can capture and manipulate nutritional particles with their appendices
for feeding (Bengtson et al., 1991). In contrast, prey size is very critical for fish larvae, which do
not have appendices to feed themselves and must take particles imprisoned from a single bite.
According to Beck and Bengston (1982), the correlation between the size of nauplius and the
mortality of the larvae of fish indicates that 20% of the larvae die of hunger when being offered
nauplii to them of a size greater than 480 µm in the first stages of feeding. Thus, depending on
41
the developmental stage of the cultured fish larvae, selecting an appropriate naupliar size as a live
food is critical.
2.8.2. Cyst hatching characteristics
A different Artemia cyst harvest presents different hatching characteristics. Sorgeloos et
al. (1986) and Lavens and Sorgeloos (1996) explain that the characteristics of a harvest of
Artemia can be evaluated using the following criteria:
i) Hatching percentage: number of nauplii that can be produced out of 100 full cysts.
ii) Hatching efficiency: number of nauplii that can be produced per gram of cysts.
iii) Hatching output: naupliar biomass (mg dry weight) produced per gram of cysts.
iv) Hatching rate: time lapse for full hatching from start of incubation until nauplius release, and
considers a number of time intervals (T0…T10).
v) Hatching synchrony: period of time during which most nauplii hatch (i.e. Ts = T90 – T10).
According to the same authors, it is imperative to consider all the criteria mentioned
before in order to obtain an exact and better description of the quality of a particular harvest. It
must be taken into account that each of these criteria implies restrictions; for example, hatching
percentage does not take into account the impurities present in the cysts such as empty cysts,
sand, salt crystals, insects, etc. The knowledge of the exact hatching characteristics is essential,
not only for commercial purposes when they are used in aquaculture laboratories, but also for
fundamental investigations when the capacity and the exact stage of development are important.
2.8.3. FAME content as an important factor to determine cyst and biomass quality
The composition of Artemia fatty acids is probably the most studied component among
all.
The works of Watanabe et al. (1978, 1980) on Artemia fatty acids demonstrated the
variability in the long essential fatty acid chains. Further, Bengtson et al. (1991) showed that
42
most of the Artemia populations studied contained linoleic acid levels [18:3(n-3)] superior to
20% and EPA levels lower than 5% of the total fatty acids present. The same authors determined
that other Artemia populations contained linoleic acid levels lower than 10% and EPA levels
between 5 and 13% of the total fatty acids present. These differences in linoleic acid and EPA
levels provided the same authors with a solid tool to classify Artemia in two general groups, fresh
water type and marine type, according to the amounts of linoleic acid and EPA respectively.
Only Artemia of the marine type can be successfully provided to marine organisms that seem to
require EPA levels higher than to 5%, but both types can be fed to fresh water organisms.
Further, Artemia fatty acid levels are determined by environmental and non-genetic factors
(Bengtson et al., 1991). This has been demonstrated by Millamena et al. (1988) and Lavens et al.
(1989) who showed that adult Artemia fatty acid profiles are similar to those of their offspring
produced (cysts), thus reflecting the fatty acids composition provided by the maternal brine
shrimps regardless the strain used.
2.9.
Population distribution patterns in relation to the assessment of Artemia density
Information available in the literature on Artemia population dynamics and biomass
estimation is scarce and restricted mostly to small natural hypersaline ecosystems and to artificial
environments (saltworks) (Van Stappen et al., 2002). The most successful work evaluating
Branchiopods population dynamics with a 95 % confidence limit of 40-50% of the estimated total
mean population density was conducted by Marchant and Williams (1977) in Victoria (Australia)
on Parartemia zietziana, an ecologically and physiologically analogous species to Artemia
(Geddes, 1980).
Further, some of the most extensive fieldwork studies on Artemia were
conducted by Winkler et al. (1977) and Lenz (1980, 1987) in Mono Lake (USA), by Haslett and
Wear (1985, 1986) in Lake Grassmere (New Zealand), Solovov and Studenikina (1992) in
Siberia (Russia), Van Stappen et al. (2002) in Urmia Lake (Iran) and Camargo et al. (2000) in
Colombia.
According to Persoone and Sorgeloos (1980), the distribution of Artemia over the entire
habitat is seldom homogeneous; consequently, it is extremely difficult to calculate exact
43
productions.
Moreover, according to Van Stappen et al. (2002), due to this extreme
heterogeneity in spatial distribution, expected estimation errors of at least 25% are common.
This is undoubtedly due to the difficulties associated with sampling this animal, which
reproduces very rapidly and is frequently densely but contagiously distributed in large shallow
ponds in which the hydrological condition regime often markedly changes (Haslett and Wear,
1985).
A
B
C
Figure 3. Distribution patterns or intrapopulation dispersion.
The individuals of a population can distribute themselves according to Odum (1986) in
three general patterns (Figure 3): a) random, b) uniform (more regular than random) and c)
agglomerate or contagious (irregular, nonrandom with great empty spaces between groups).
Each rectangle contains approximately the same number of individuals. The term dispersion, as
it is used in statistics, refers to the distribution of the events around the mean, and in an ampler
sense to the distribution pattern of individuals within a population. The random distribution
occurs where the environment is uniform (i.e. water surface destratified) and when there are no
gregarious tendencies.
The uniform distribution appears where the competition between
individuals is acute or when there is a positive antagonism (i.e. mild wind) that promotes regular
spacing. The agglomerations, in their different degrees, represent the most common pattern when
motile organisms are studied. Nevertheless, when individuals tend to form groups of certain size
(i.e. reproductive pairs between the animals) the distribution of the groups tends to be random or
even uniform.
According to Odum (1986), the determination of the type of distribution is important in
the selection of the sampling methods. The three general distribution patterns break up into five
44
subtypes of distribution: 1) uniform, 2) random, 3) randomly agglomerated, 4) uniformly
agglomerated and 5) agglomerated by groups. Without doubt, all these types of distribution are
present in nature.
When taking a small sample from each of the three populations in Figure 3, it is obvious
that different results will be obtained.
A small sample of a population with agglomerate
distribution tends to produce a too large or too small density when the number of individuals in
the sample is multiplied to obtain the total population. This sampling error is not very large in
the randomly distributed populations or in those that have a tendency to distribute uniformly.
Consequently, for the 'agglomerated' populations carefully planned sampling techniques
are needed with perhaps larger sample size than the non-agglomerate ones (Odum, 1986).
Several methods have been suggested to determine the type of spacing and the degree of
agglomeration between the individuals of a population (when it is not obvious). Two of these
methods use the comparison of the real frequency from different size groups obtained in a series
of samples through a Poisson series, which indicates the frequency whereupon the groups of 0, 1,
2, 3...n of individuals (randomly distributed) are encountered.
The two methods generate these results:
1) if the occurrence of small groups (including empty spaces) and large groups is more frequent
and the presence of medium groups is less frequent than expected, the distribution is
agglomerated;
2) in the opposite case, if the occurrence of small and large groups is less frequent than the
presence of medium groups is more frequent than expected, the distribution is uniform.
According to the same author, statistical tests can be used to determine if the observed
deviation with respect to the Poisson curve is significant, but that general method has a
disadvantage, since the sample size can affect the results. A general property of the random
distribution is that the variance (v) is equal to the mean (m). A variance greater than the mean
indicates an agglomerate distribution (v/m > 1), whereas a variance minor than the mean (v/m <
1) has a uniform pattern (regular) (Odum, 1986).
45
Haslett and Wear (1985) developed a method to assess standing Artemia biomass at any
instant in four ponds sampled in triplicate, using 86 sample stations, twice a month (one year)
using a polycarbonate sample box fitted with a removable watertight lid and a sliding base to
contain a 0.25 m deep volume of water of exactly 18.0 lit. Further, the same authors developed
an unbiased estimate of biomass using the arithmetic mean, together with confidence interval
estimates based on the bootstrap method giving 95% confidence bound estimates within 25% of
the estimated total Artemia biomass in each sampled pond.
Similarly, Jellison et al. (1995) tested three models (linear-transfer and lag-Manly
models) of zooplankton cohort development using data generated from a third more realistic
model (multi-transfer model) to estimate development rates on Artemia monica. A comparison
of the models' performances under different simulated sampling regimes recommended the multitransfer model over the other two models. According to the same authors, the experimental
conditions and sampling regime resulted in high relative standard errors in stage abundance
estimates not atypical of zooplankton sampling regimes in lakes.
46
Part 1. Report on the presence of Artemia franciscana in six new locations in the Colombian Caribbean
Camargo, W. N., Durán, G.C., Hernández, L.C., Rada, O.C., Linero, J.C. and Sorgeloos, P.
Submitted to the Journal of the World Aquaculture Society on April, 2002
Abstract
From July 1998 to June 2000 a sampling campaign of most of the thalassohaline aquatic
environments along the Colombian Caribbean coast was performed in order to determine the presence of
Artemia. Six new locations (Tayrona and Kangarú - Magdalena department, Salina Cero - Bolívar
department, Pusheo, Bahía Hondita and Warrego - La Guajira department) were registered for the
Colombian Caribbean, besides the other three locations (Manaure, Galerazamba and Pozos Colorados)
reported in the literature near three decades ago. Biometrical measurements, fatty acid analysis, and other
physicochemical parameters (salinity, dissolved oxygen, temperature, pH and habitat ionic composition)
were recorded to assist in the characterization of some of the biotopes where Artemia thrives naturally
along the Colombian Caribbean coast. All habitats sampled showed a predominance by the chloride anion
as expected, because of their thalassohaline (marine) origin.
An additional tool to assist with the
characterization of the Colombian strains was biometry and FAME analysis. The biometric analysis
showed that cysts from Tayrona present the smallest size of all, followed by Galerazamba, Kangarú,
Manaure, Salina Cero and Pozos Colorados. Similarly, the measured chorion thickness is consistent with
the set range for A. franciscana, with Galerazamba being the thinnest, followed by Tayrona, Salina Cero,
Manaure, Pozos Colorados and Kangarú. Additionally, the nauplius from Galerazamba presented a small
size followed by Manaure, Salina Cero and Tayrona. All locations where enough cyst samples were
collected to perform FAME analysis presented high EPA and low DHA levels, demonstrating that Artemia
sampled from all four locations (Manaure, Galerazamba, Salina Cero and Tayrona) are suitable for marine
aquaculture in general, only if fortified with DHA rich emulsions. Further, significant variations in the
EPA levels were observed, contrasting with the low DHA levels that varied only slightly. Consequently,
the DHA/EPA ratio was overall very low (lower than 0.1), with the ratios ranking as follows: Manaure >
Salina Cero > Tayrona > Galerazamba. As a final remark, all locations studied have great Artemia
production potential and require different degrees of water quality and/or infrastructure management
(brine concentration in the different basins and nutrients) going from severe in most cases (Manaure,
Galerazamba, Pozos Colorados, Bahia Hondita, Pusheo and Warrego) to medium degree of management
(Kangarú, Salina Cero, Tayrona).
47
Introduction
Two Artemia species, A. persimilis and A. franciscana, have been reported on the
American continent, the latter being the most cosmopolitan of all (Abreu-Grobois and
Beardmore, 1980; Abreu-Grobois, 1983; Vanhaecke et al., 1987; Bowen et al., 1988; Gajardo et
al., 1992, 1993, 1998, 1999, 2001; Zuñiga et al., 1999; Papeschi et al.; 2000; Camargo et al.,
2000). However, A. persimilis has also been reported in the Mediterranean basin (Barigozzi,
1989) in Sardinia (Italy). RAPD genetic work (Camargo, 2002a) and multivariate analysis using
morphometric characters (Camargo et al., submitted) indicate that the Artemia present in
Colombia is Artemia franciscana.
Artemia cyst and nauplii biometry, essential fatty acids and cyst hatching characteristics
have been used as additional quality evaluation tools (described in Chapter 2, section 2.8) by the
aquaculture industry to further characterize Artemia strains.
Particular attention has been
concentrated on the larval rearing of marine organisms to search for Artemia strains high in
essential fatty acids, eicosapentaenoic acid (EPA: 20:5n-3) and the even more important
docosohexaenoic acid (DHA: 22:6n-3) (Lavens and Sorgeloos, 1996). According to the same
authors, in view of the importance of DHA in marine fish species (Kanazawa, 1991; Watanabe,
1993) much effort has been made to explore means to incorporate high levels of DHA and high
ratios of DHA/EPA in the live food. Further, it has been shown that feeding of Artemia enriched
with n-3 highly unsaturated fatty acids (HUFA) results in increased larval growth and survival of
several marine species (Bengtson et al., 1991; Léger and Sorgeloos, 1992; Rees et al., 1994;
Naessens et al., 1995; Narciso et al., 1999). The DHA/EPA ratio is very variable in non-enriched
Artemia, with values often inferior to 1. Moreover, through the addition of DHA fortified
emulsions the DHA/EPA ratio has been increased up to 7, obtaining meta-nauplii that contain 33
mg
DHA.g-1 DW (Lavens and Sorgeloos, 1996). The success of the enrichment is strain
dependent (i.e. particular Chinese strains), through variations in DHA catabolism.
Artemia is a typical inhabitant of extreme environments, which are typically low in
species diversity and present simple trophic structures (Lenz, 1987).
According to
Triantaphyllidis (1996), the diversification of the hypersaline environments were Artemia thrives
48
naturally varies considerably in terms of ionic composition, climatic conditions and altitude. As
a general rule, chloride rich lakes are the most adequate for Artemia development (Cole and
Brown, 1967). Although, some Artemia strains require carbonate (Mono lake Artemia, USA) or
sulfate rich waters (Tso Kar Lake Artemia, Tibet) for survival. Conversely, some ions can be
deleterious to Artemia survival. Croghan (1958a, b) determined that potassium could be very
toxic to Artemia because of its concurrence with sodium. In view of the importance of water
composition for Artemia survival, hypersaline ecosystems where Artemia lives, have been
classified in three categories based on their anionic composition: chloride, sulfate and carbonate
rich (Cole and Brown, 1967).
The present study intends to contribute to the knowledge of hypersaline Artemia biotopes
on the American continent, evaluating the possibility of commercial exploitation of these
biotopes. This could accommodate the desperate need of the aquaculture industry to find new
Artemia biotopes for commercial use.
Materials and Methods
The explorations took place mostly in the northern region of the Colombian Caribbean,
from July 1998 until June 2000. Artemia franciscana (Camargo et al., 2002a) cyst samples were
collected directly from six thalassohaline locations along the Colombian Caribbean coast
(Manaure, Galerazamba, Salina Cero, Kangarú, Pozos Colorados and Tayrona). Cyst diameter
and chorion thickness were determined according to Sorgeloos et al. (1986) in 200 cysts.
Standard deviations were calculated for all the cyst diameter determinations. Equally, naupliar
length was determined for 200 nauplii according to Vanhaecke and Sorgeloos (1980b).
The ionic composition of all the locations sampled during the 24 months (Table 3) was
determined using a Unicam 939/959 atomic absorption spectrophotometer. All samples had to be
diluted with deionized water because of the very high ionic concentration.
49
Nauplii from Galerazamba, Manaure, Salina Cero and Tayrona to perform the FAME (fatty
acids methyl esters) analysis were obtained according to the standard procedure described by
Sorgeloos et al. (1986). The methodology to determine FAME in freshly hatched nauplii was a
modification of the direct esterification described by Lepage and Roy (1984). This method
implicates a direct acid catalysed transesterification without prior extraction of total fat, on dry
sample amounts ranging from 10 to 150 mg. Ten percent of an internal standard 20:2 (n-6) was
added prior to the reaction. FAME were extracted with hexane. After evaporation of the solvent
the FAME were prepared for injection by redissolving them in iso-octane (2 mg/ml). Quantitative
determination was done by a Chrompack CP9001 gas chromatograph equipped with an
autosampler and a TPOCI (temperature programmable on-column injector). Injections (0.2 µl)
were performed on-column into a polar 50 m capillary column, BPX70 (SGE Australia), with a
diameter of 0.32 mm and a layer thickness of 0.25 µm connected to a 2.5 m methyl deactivated
pre-column. The carrier gas was H2, at a pressure of 100 kPa and the detection mode FID. The
oven was programmed to rise from the initial temperature of 85°C to 150 °C at a rate of 30
°C/min, from 150 °C to 152°C at 0.1°C/min, from 152 °C to 172 °C at 0.65 °C/min, from 172 °C
to 187°C at 25 °C/min and to stay at 187 °C for 7 min. The injector was heated from 85 °C to
190 °C at 5 °C/sec and stayed at 190 °C for 30 min. Identification was based on standard
reference mixtures (Nu-Chek-Prep, Inc., U.S.A.). Integration and calculations were done on
computer with a software program : Maestro (Chrompack).
Study area
Galerazamba: this small thalassohaline saltwork has five ponds (3 to obtain brine and 2
crystallizers) with a total extension of 220 ha. It is located approximately 20 km to the North of
the city of Cartagena, at the borderline of the Bolívar department (Fig. 1, Table 1). This saltwork
was built in a natural saline lagoon, surrounded by some mangroves (sandy-clay and loamy-clay
soil type). This lagoon was flooded with saltwater during high tide throughout the year (Rozo
and Pinzón, 1983; Newmark, 1988; Camargo et al., 2000).
Salina Cero or Ciénaga Prieto: this small thalassohaline lagoon of 18 ha was explored in
September 1998 (Camargo et al., 2000, submitted). It is located at only 3 km of Galerazamba,
Bolivar department (Fig. 1, Table 1). For several decades salt has been manually extracted
50
occasionally once or twice per year. The local fisherman has noticed the presence of Artemia for
over five decades at this site (Camargo et al., 2000).
Kangarú: the exploration to this area took place in July 2000 (Camargo et al., 2000). It is
located in the northern region, in the Salamanca Island National Natural Park, Magdalena
department (Fig. 1, Table 1). This natural thalassohaline saltwork consists of three small ponds
of less than four ha. Salt has been exploited for decades occasionally. This location was over
three decades ago an important bird migration spot, but lost importance because of mangrove
destruction as a consequence of the construction of a highway through the park (Camargo et al.,
2000).
Pozos Colorados: A small and very old thalassohaline saltwork, of approximately 65 ha,
that is presently abandoned, is located near the city of Santa Marta, Magdalena department (Fig.
1, Table 1), contiguous to the road that connects the cities of Barranquilla and Santa Marta
(Tobón, 1988; Newmark, 1988; Camargo et al., 2000). This saltwork consists of only five
irregularly shaped shallow ponds that cover a total water surface of only 4 ha.
Tayrona National Natural Park1 (Chengue natural saltwork): is located in the Magdalena
department (Camargo et al., 2000, 2002a, b) (Table 1, Fig. 1). The Tayrona National Natural
Park encompasses a small number of saline ponds, which do not crystallize, Chengue is the only
one that does, and the only one where Artemia has been reported to date. The Chengue Inlet is
situated approximately in the middle of the Tayrona National Natural Park, which presents a
series of small bays and inlets that extend from the city of Santa Marta to Cañaverales to the East.
This small natural thalassohaline saltwork of approximately 2.5 ha is wide and hypersaline due to
definite closure by a dynamic sedimentation pattern of the only communication channel to the
inlet (Alvarez-Leon et al., 1995). The salt pond is flooded, during most of the year, by the
stational winter and serves as a saltwork during summer (Bula-Meyer, 1985). Chengue salt
exploitation existed long before the prehispanic period (Vargas, 1948).
1
The name of the Artemia population ‘Tayrona’ really refers to Chengue’s natural pond Artemia.
51
Manaure: located west contiguous to the town of Manaure, in the center of La Guajira
department, near the city of Riohacha (Camargo et al., 2000, 2002a, b) (Table 1, Fig. 1). This
saltwork is a thalassohaline shallow aquatic ecosystem that extends over 4000 ha.
Water
movement through the saltwork system is achieved both by pumping and through gravity. There
are six pumping stations (S1…S6) that increase water volume to a predetermined water level,
thereafter water will flow by gravity or because of topographic differentials. This zone was
originally a natural lagoon, still surrounded in some small areas by mangroves. The deposits
were constructed using the natural topography of the terrain, with some modifications. The
levees were built by compacting large amounts of clay material brought from the margins of the
saltwork (Rozo and Pinzón, 1983).
Warrego: Located in the northern tip of La Guajira department, near the Puerto Nuevo
village (Table 1, Fig. 1). It is a large thalassohaline saltern of approximately 600 ha (2 miles
long). Occasionally the Wayu Indians exploit salt when the brine crystallizes. No water samples
were collected at this location since the saltern was completely dried up in an exploration realized
on January 18, 2000, giving positive results for the presence of only very few Artemia cysts
(Camargo et al., 2000).
Bahía Hondita: Located in La Guajira department (Table 1, Fig. 1).
This natural
thalassohaline saltern of approximately 3000 ha was projected to become the largest saltwork in
Colombia during the end of the 1970s, through a proposal to join three major neighboring saline
lagoons to create a saltwork over 10,000 ha. Occasionally the Wayu Indians exploit salt when
the brine crystallizes (Camargo et al., 2000). The exploration to this area was conducted on
January 18, 2000, giving positive results for the presence of only Artemia cysts (Camargo et al.,
2000).
Pusheo: Located in the northern tip of La Guajira department (Table 1, Fig. 1), near Punta
Gallinas, of approximately 400 ha was the northernmost thalassohaline saltern explored.
Occasionally the Wayu Indians exploit salt when the brine crystallizes (Camargo et al., 2000).
The exploration to this area took place on January 18, 2000, giving positive results for the
presence of only Artemia cysts (Camargo et al., 2000).
52
Table 1. Biogeographic distribution of Artemia in the Colombian Caribbean.
Longitude
Latitude
References
Galerazamba, Bolívar (220 ha)
10° 47’ 38”
75° 14’ 48”
Salina Cero, Bolívar (18 ha)
10° 46’ 29”
75° 15’ 55”
Cárdenas (1981), Personne and Sorgeloos
(1980), Tobias et al. (1980), Bruggeman et al.
(1980), Vanhaecke and Sorgeloos (1980a, b,
1982), Abreu-Grobois and Beardmore (1982),
Doullet and Newmark (1982), Rozo and Pinzón
(1982, 1983), Pinzón and Rozo (1983),
Vanhaecke et al. (1987), Tackaert et al. (1987),
Newmark (1988), Alvarez-León and Van AkenLodewyckx (1994), and Camargo et al. (2000,
2002a, b, submitted)
Camargo et al. (2000, submitted)
Location
Kangarú, Magdalena (4 ha)
11° 59’ 28”
74° 32’ 21”
Pozos Colorados, Magdalena (64 ha)
11° 09’ 45”
74° 13’ 34”
Tayrona, Magdalena (2.5 ha)
11° 19’ 03”
74° 08’ 13”
Newmark (1988), Tobón (1988) and Camargo et
al. (2000)
Camargo et al. (2000, 2002a, b)
Manaure, Guajira
11° 46’ 32”
72° 29’ 27”
12° 19’
71° 54’
12° 19’ 28”
71° 44’ 13”
12° 20’ 47”
71° 44’ 17”
(4000 ha)
Warrego, Guajira
(600 ha)
Bahía Hondita, Guajira (3000 ha)
Pusheo, Guajira
(400 ha)
Cárdenas (1981), Abreu-Grobois and Beardmore
(1982), Rozo and Pinzón (1983), Vanhaecke et
al. (1987), Tackaert et al. (1987), Newmark
(1988), Bengtson and Simpson (1989), Zapata et
al. (1990), Alvarez-León and Van AkenLodewyckx (1994), and Camargo et al.. (2000,
2002a, b, submitted)
Results
The cysts of samples (Table 2) collected from Tayrona (233.4 ± 12.4 µm) presented the
smallest size of all followed by Galerazamba (239.4 ± 11.0 µm), Kangarú (239.9 ± 12.3 µm),
Manaure (241.1 ± 10.1 µm), Salina Cero (249.8 ± 10.5 µm) and Pozos Colorados (252.9 ± 10.7
µm). The nauplius (Instar I) of samples collected from Galerazamba presented the smallest size
(390.3± 24.5 µm), followed by Manaure (414.2 ± 29.3 µm), Salina Cero (431.7 ± 31.4 µm) and
Tayrona (451.9 ± 25.1 µm).
53
Table 2. Biometric determination of cyst and Instar I Artemia nauplius of several populations in the
Colombian Caribbean (units in µm). (ND= Not determined)
Location
Cyst diameter
Chorion thickness
Nauplius length
Galerazamba
239.4 ± 11.0 / 233.9 ± 8.2
2.8
390.3 ± 24.5
Salina Cero
249.8 ± 10.5 / 234.2 ± 10.1
7.8
431.7 ± 31.4
Pozos Colorados
252.9 ± 10.7 / 226.5 ± 10.2
13.2
442.0 ± 24.0 (Tobón, 1988)
Kangarú
239.9 ± 12.3 / 212.1 ± 11.0
13.9
ND
Tayrona
233.4 ± 12.4 / 227.2 ± 8.2
3.1
451.9 ± 25.1
Manaure
241.1 ± 12.1 / 223.9 ± 10.2
8.6
414.2 ± 29.3
Note: Cyst diameter represents both non-decapsulated and decapsulated values respectively.
The ionic composition ranking of the locations sampled is a follows: Galerazamba (basin
D-4): Na+ > K+ > Ca2+ > Mg2+ > Fe cations and Cl- > SO42- > HCO3- anions (CO32- = ND: Not
Detectable). Salina Cero saline lagoon: Na+ > Ca2+ > K+ > Mg2+ > Fe cations and Cl- > SO42- >
HCO3- anions, (CO32- = ND). Kangarú salt pond: Na+ > Ca2+ > K+ > Mg2+> Fe cations and Cl- >
CO32- > HCO3- anions (SO42- = ND). Pozos Colorados saltwork (basin 4): Na+ > Mg2+> K+ >
Ca2+ > Fe cations and Cl- > SO42- > HCO3- anions (CO32- = ND). Chengue saline pond in
Tayrona NNP: Na+ > K+ > Mg2+ > Ca2+ > Fe cations and Cl- > SO42- > HCO3-, anions (CO32- =
ND). Manaure saltwork (basin D-3): Na+ > Ca2+ > Mg2+ > K+ > Fe cations and Cl- > SO42- >
HCO3- > CO32- anions. Bahía Hondita saltern: Na+ > Ca2+ > Mg2+ > Fe > K+ cations and Cl- >
SO42- > CO3- anions (CO32- = ND). Pusheo saltern: Na+ > Ca2+ > Mg2+ > K+ > Fe cations and Cl> SO42- > HCO3- anions (CO32- = ND).
The characteristic anions (chloride, sulfate and
carbonate) used by Cole and Brown (1967) to classify hypersaline ecosystems are displayed in
Table 3.
54
Table 3. Characteristic anion composition (g.l-1) of all extreme environments where Artemia has been
reported in the Colombian Caribbean (Gz: Galerazamba saltwork, SC: Salina Cero lagoon, Kan: Kangarú
salt pond, PC: Pozos Colorados saltwork, Tay: Chengue salt pond in the Tayrona Natural National Park,
Ma: Manaure saltwork, BH: Bahía Hondita saltern, Pu: Pusheo saltern).
Ions
Gz
Cl55.00
SO4212.90
HCO3
0.11
CO32*
*below detection limit.
SC
11.86
3.36
0.19
*
Kan
8.00
ND
0.14
0.176
PC
60.00
3.47
0.29
*
Tay
75.00
3.78
0.97
*
Ma
137.50
11.14
0.23
*
BH
11.50
8.24
0.11
*
Pu
35.00
3.98
0.21
*
Note: Ionic concentrations represent one single sample per pond or salt concentration basin at the sites where
Artemia was reported and must not be used for comparison purposes, since ionic concentration might vary
periodically especially in managed (saltworks with several concentration levels as well as different viscosities in the
system) compared to unmanaged ecosystems (single evaporation basin).
The cyst samples collected from Galerazamba presented the highest EPA of all locations
analyzed (Table 4), followed by Tayrona, Salina Cero and Manaure. The FAME analysis of four
of the nine locations where Artemia has been registered in the Colombian Caribbean
demonstrated that Artemia from all locations are suitable for marine aquaculture, only if fortified
with DHA rich emulsions. Further, significant variations in the always high EPA levels were
observed, contrasting with the much lower DHA levels which remained constant for all four
strains. Consequently, the DHA/EPA ratio (Table 4) was overall very low, with the ratios
ranking as follows: Manaure > Salina Cero > Tayrona > Galerazamba.
Table 4. FAME analysis of some samples collected in the Colombian Caribbean
(Tay: Tayrona Oct 98, Gz: Galerazamba Jan 99, Ma: Manaure Mar 00,
SC: Salina Cero Oct 98)
Dry Wt. (mg/g)
Tay
Gz
Ma
SC
EPA 20:5(n-3)
4.1
6.5
3.5
3.8
DHA 22:6(n-3)
0.1
0.1
0.1
0.1
DHA/EPA
0.02
0.02
0.03
0.03
55
Discussion and Conclusions
Along the Colombian Caribbean coast ten potential Artemia habitats were explored. Six
of them proved to be positive for the Anostracan.
The Colombian Artemia habitats analyzed are of marine (thalassohaline) origin, thus all
locations were expected to be chloride rich. The ionic analysis for all locations registered
predominance by the chloride anion, as expected.
All hypersaline biotopes analyzed are according to Cole and Brown (1967) appropriate
habitats for Artemia development. Further, the chloride rich Colombian Artemia franciscana
(Camargo et al., 2002a) biotopes are similar to other American chloride dominant hypersaline
biotopes such as Leslie saltworks (California - USA), La Sal del Rey (Texas - USA) and Great
Salt Lake (Utah - USA). Thus, it can be derived that Artemia from any of these habitats might be
used to further enhance cyst production capacity of afore mentioned Colombian populations.
Cysts from Tayrona showed the smallest size of all, followed by Galerazamba, Kangarú,
Manaure, Salina Cero and Pozos Colorados.
Similarly, the measured chorion thickness is
consistent with the set ranges for A. franciscana, thus Galerazamba was the thinnest, followed by
Tayrona, Salina Cero, Manaure, Pozos Colorados and Kangarú. Additionally, the nauplius from
Galerazamba presented the smallest size followed by Manaure, Salina Cero and Tayrona.
According to the results of the analysis (biometry and FAME) performed in this study,
most of the Colombian Artemia strains are suitable for the aquaculture industry. Overall the
strains from Manaure and Galerazamba (the major Colombian saltworks, 4000 and 220 ha,
respectively) present a good potential since they posses small cysts (more cysts per gram) and
relatively small nauplii appropriate for most marine larviculture applications. Contrasting, the
strains from Kangarú, Salina Cero, Tayrona and Pozos Colorados also quality wise suitable but
limited to important Artemia cyst and biomass production quantities (export) because of their
small surface area (i.e.); nonetheless, Artemia could be exploited at these locations for local
aquaculture applications.
56
Furthermore, all locations where enough cyst samples were collected to perform FAME
analysis presented high EPA (Galerazamba > Tayrona > Salina Cero > Manaure) and low DHA,
demonstrating that all four populations sampled are suitable for marine aquaculture applications,
only if enriched with high levels of DHA. Finally, the DHA/EPA ratio was overall very low (less
than 0.1), with the ratios ranking as follows: Manaure > Salina Cero > Tayrona > Galerazamba.
As a final remark, all locations studied have great Artemia production potential and
require different degrees of water quality and/or infrastructure management (brine concentration
in the different basins and nutrients) going from severe in most cases (Manaure, Galerazamba,
Pozos Colorados, Bahia Hondita, Pusheo and Warrego) to medium degree of management
(Kangarú, Salina Cero, Tayrona).
Acknowledgments
This study was financed by a doctorate scholarship and a research project “Evaluación y
aprovechamiento del recurso natural Artemia en las salinas de Manure y Galerazamba, Caribe
colombiano”, directed by William Camargo (code 1116-09-343-97) and granted by the
Colombian Council of Science and Technology “Francisco José de Caldas” (COLCIENCIAS)
and by the Universidad del Atlántico, Barranquilla, Colombia.
The sampling fieldwork during the explorations and monthly data collection was possible
thanks to the very valuable cooperation received from Igor Muelles, Jandro Bolaño, Tania Acuña,
Karime Coha, Saul Pereira and Victor Escorcia and all the members of the Artemia Research
Group (GIA), Uniatlántico. The ionic analysis was made thanks to the cooperation from AAA,
Barranquilla. We express our most sincere gratitude to Els Vanden Berghe, Gilbert Van Stappen
and to the anonymous evaluators for their recommendations on the preparation of this paper.
57
Caribbean Sea
Wa BH Pu
PC/Tay Ma
Ka
SC/Gz
Venezuela
Pacific Ocean
Colombia
Figure 1. Location of the Colombian Caribbean sample collection sites.
SC: Salina Cero, Gz: Galerazamba, Kan: Kangarú, PC: Pozos Colorados,
Tay: Chengue in the Tayrona National Natural Park, Ma: Manaure, Wa:
Warrego, BH: Bahía Hondita, and Pu: Pusheo.
58
Part 2. Morphometric characterization of thalassohaline Artemia populations from the
Colombian Caribbean
Camargo, W. N., Ely, J.S. and Sorgeloos, P.
Section of the paper submitted to the Journal of Biogeography on January 9, 2002.
Abstract
Artemia populations were studied from the Colombian Caribbean coast (Manaure,
Galerazamba, Salina Cero and Tayrona) and a similar thalassohaline reference population from
San Francisco Bay (SFB-USA) to establish possible interpopulation relationships. Discriminant
analyses were performed on male and female morphometric measurements (studied in vitro under
standardized conditions) according to type (North America and Caribbean coast populations) and
geographic origin of population (Manaure, Galerazamba, Salina Cero, Tayrona and SFB).
Optimal discriminant variables for males grouped by the type of population, were the left setae
and antenna length, and for females they were abdominal length and antenna length. However,
for males grouped by their geographical origin, the optimal variables were furca length, left setae,
antenna length, eyes separation, abdominal width and abdominal length, and for the females, they
were furca length, abdominal length, left setae, and eye separation. Male and female Colombian
Caribbean populations were separated from the North American populations. However, our
results show that the classification based on male characters provides the best group membership
than for females among all discriminant analyses. Male morphometric characters separated the
type of population groups more clearly than the female characters, since all Colombian
populations were correctly positioned in the Caribbean coast group and the SFB population into
the North American group, with no overlapping between the two types, as was the case for the
female individuals. Likewise, male individuals correctly position the Salina Cero population to
its neighboring Galerazamba population, and to the other Colombian populations. In contrast,
female individuals from Salina Cero did not cluster with the other Colombian coast populations
(Galerazamba, Tayrona and Manaure) or with the SFB population.
59
Introduction
Brine shrimp is favored by the absence of predators and food competitors and develops
successfully from nauplii to adult in extreme physicochemical biotopes, frequently at very high
densities; as a result, only a relatively minute number of halobacteria and microalgae species can
survive (Sorgeloos, 1980) and serve as a food source to this very efficient non-selective filter
feeder.
Ecological and physiological differences have been previously reported among the several
populations of Artemia franciscana (Sorgeloos et al., 1975; Abreu-Grobois and Beardmore,
1982; Bowen et al., 1985). These differences have an important impact over Artemia population
distribution, as well as on the biomass and cyst production by influencing the reproductive
strategies. Further, Abreu-Grobois and Beardmore (1982) studying electrophoretic patterns of 16
different systems of isozymes described the Caribbean populations group as being increasingly
differentiated from the rest of the American populations.
Gilchrist (1960) showed that Artemia body form is influenced by a series of intrinsic
factors when cultured under standard conditions. Moreover, this influence varies according to
gender, size and population origin, and each locality has its own pattern when populations are
cultured under the same conditions. Further, the effect of high salinity has been shown to
decrease the length of some morphometric characters in A. franciscana and some Old World
species (Amat, 1980a; Triantaphyllidis et al., 1996).
Amat (1980a) also revealed that the
increase in salinity reduced the furca length and the number of setae in the furca. Additionally,
high salinities also favored sexual maturity; the bisexual Artemia reached maturity when the
ovisac length was smaller to that of parthenogenetic Artemia.
Hontoria and Amat (1992a), in the American populations work classified 25 American
populations into three groups and determined that the populations from the Caribbean coast group
are more related to each other as compared to other American populations studied with the
exception of three populations.
The latter exceptions are: 1) Yucatan (Mexico) similar to
SFB (USA), 2) Manaure (Colombia) similar to GSL (USA) and 3) Bahía Salinas
60
(Puerto Rico) dissimilar to all the others. Their results demonstrated that this technique could
discriminate Artemia species and group populations that are geographically near and share
similar environments (ionic composition). The studies of the same authors without any doubt
offered a new perspective in the morphometry of Artemia.
However, these studies were
performed exclusively on female characters in bisexual populations. Later, Pilla (1992) studied
bisexual populations of the Eastern region of the Old World and evaluated characters of females
and males; they concluded: “the global discrimination based on male characters was better than
that of the females, confirming the importance of the male characteristics in this type of
analysis”.
The main objective of this study was to determine differences among several Artemia
populations collected from different locations along the Colombian Caribbean coast (Manaure,
Galerazamba, Salina Cero and Tayrona) and a similar thalassohaline reference population from
San Francisco Bay (USA) using male and female morphometric measurements.
Artemia franciscana cyst samples were collected directly from four thalassohaline
locations in the Colombian Caribbean coast (Manaure, Galerazamba, Salina Cero and Tayrona)
and one from San Francisco Bay, USA (ARC 1258, donated by the Artemia Reference Center).
Cysts were hatched under controlled conditions in artificial sea water (Instant Ocean®) at 35 g.l-1
salinity at 25 °C, pH 8.3 and fed ad libitum a mixture of suspended Nannochloropsis sp.,
Tetraselmis sp. and Isochrysis sp. tahitian (Phytoplex®, Kent Marine Inc., USA), and constant
bottom aeration and illumination (Sorgeloos, 1985). Nauplii were cultured according to Hontoria
and Amat (1992a) until approximately half of the population reached sexual maturity (except our
populations were harvested at 11 or 14 days). Random samples of twenty males and twenty
females were taken from each population and anesthetized with a drop of formalin-saturated
seawater (Gilchrist, 1960). Variable Artemia morphometric characters (total length, abdominal
length, furca length, ovisac width, abdominal width, head width, antenna length, eye diameter,
eye separation, right setae, left setae) were measured under a previously calibrated light
61
stereoscope according to Hontoria and Amat (1992b). The measurements were made on females
as well as on males.
Forward stepwise discriminant analysis using the statistical software SPSS (V.10) was
used (Hontoria and Amat, 1992a, b) to assign group membership among male and female
Artemia individuals by the type of population to which they belong (North America and
Caribbean coast). Type classifications were based on populations grouped according to previous
differentiations made by morphometric analyses (Hontoria and Amat, 1992b), electrophoretic
work (Abreu-Grobois and Beardmore, 1982) and RAPD techniques (Camargo et al., 2002a).
Individuals were also classified by their geographic origin (Salina Cero, Galerazamba, Tayrona,
Manaure and San Francisco Bay). The α level for all discriminant analyses was set at 0.05 to
enter and 0.10 to remove. Discriminant analysis is sensitive to outliers and heterogeneous
variances (Tabachnick and Fidell, 1989).
According to Amat (1980a), bisexual Artemia reaches sexual maturity when the ovisac
length is smaller to that of parthenogenetic Artemia. Furthermore, Vanhaecke and Sorgeloos
(1980b) provided evidence that growth rate is strain dependent (i.e. Manaure and Galerazamba
Colombian strains present high growth rate).
Further, Artemia franciscana from the San
Francisco Bay strain matures at around 14 days, and for some Colombian strains maturity is
reached between 8 to 10 days (Camargo et al., 2000). The growth difference between the strains
used in the experiment (SFB vs. Colombian strains, particularly for the Tayrona strain) created an
unequal treatment of the populations, thus the data had to be normalized.
The data were
normalized by dividing all variables (Annex, Tables 1 and 2) by the total length.
This
compensates for the short maturation period (11 days) of the Tayrona population; thus providing
normal distributions among all morphological characters within each population. The latter
transformation also makes better biological sense than other types of transformation (i.e. natural
log, square root) because Amat (1980b) showed that certain characters such as the length of the
first pair of antennas, abdominal length, ovisac width, abdominal width, head width, furca length
and number of setae in the furca, were positively correlated with the individual total length.
Furthermore, the square root transformation of combined setae number (left and right) as
recommended by Pilla and Beardmore (1994) was found to be an inappropriate character in our
62
discriminant analyses since it did not contribute to any additional discriminant resolution; thus,
the separate right and left setae number characters were used in all analyses. Although Pilla and
Beardmore (1994) did not use the abdominal length and body length ratio proposed by Hontoria
and Amat (1992a, b) we used the ratio but with a slight modification of applying actual values
and not percentages.
The Wilk’s Lambda shows that the variability within populations is
insignificant as compared to the total variability; thus, most of the variability could be attributed
to differences between the populations (Hontoria and Amat, 1992a).
Table 1. Artemia franciscana populations measured for the morphometric study
(n=20 for each population).
Geographic origin
San Francisco Bay, California (USA)
Type
North American (SFB 1258)
Galerazamba, Bolívar (Colombia)
Salina Cero, Bolívar (Colombia)
Tayrona, Magdalena (Colombia)
Manaure, Guajira (Colombia)
Caribbean coast (Gz)
Caribbean coast (SC)
Caribbean coast (Tay)
Caribbean coast (Ma)
Moreover, we also analyzed the data combining both males and females for the
individuals grouped by the type of population to which they belong according to Gajardo et al.
(1998) without the inclusion of ovisac width measurement and body length to abdominal length
ratio, just using the previous normalization of the data by dividing all morphometric
measurements by total length, with no further enhancement in the populations discrimination
(males 77% and females 83% vs. 71% combining males and females).
Similarly, the
classification from male and female individuals combined analysis by their geographical origin
did not improve the classification results (males 94% and females 92% vs. 92% combining males
and females).
Results
The first eigenvalue accounted for 100.0% of the variance for both females and males
grouped by the type of population (North America and Caribbean coast) to which they belong. In
contrast, the two eigenvalues (corresponding to the first 2 discriminant functions) to discriminate
63
individuals grouped by their origin was 77.2 and 20.8 for females, and 88.8 and 6.6 for males.
Thus, for the analysis of the females (Table 2) grouped according to the type of population to
which they belong, abdominal length and antenna length were used as discriminant variables and
for the males they were left setae and antenna length.
Table 2. Females and males grouped by the type of population to which
they belong (North America and Caribbean coast) pooled
within-groups correlations between discriminating variables and
standardized canonical discriminant functions.
Discriminant function
Abdominal length
Abdominal width
Antenna length
Eye diameter
Eyes separation
Furca length
Head width
Left setae
Right setae
Ovisac width
a
Female
0.466a
- 0.174a
0.147
- 0.246a
- 0.315a
- 0.576a
- 0.386a
- 0.109a
- 0.357a
- 0.107a
Male
- 0.376a
0.441a
-0.365
0.054a
0.068a
0.385a
0.377a
0.945
0.854a
-
This variable was not used in the analysis.
However, for males (Table 3) grouped by their geographical origin the discriminant
variables were furca length, left setae, antenna length, eyes separation, abdominal width and
abdominal length, and for the females, they were furca length, abdominal length, left setae and
eye separation.
The discriminant functions obtained for males and females of individuals grouped by the
type of population to which they belong were 94% and 92% (respectively) of original group cases
correctly classified. Likewise, the combined male and female data of the individuals grouped by
their geographical origin was 77% and 83% (respectively) of original group cases correctly
classified.
64
Table 3. Females and males grouped by their geographical origin (Salina Cero,
Galerazamba, Tayrona, Manaure and San Francisco Bay) pooled withingroups correlations between discriminating variables and standardized
canonical discriminant functions.
Female
Male
Function
1
2
1
2
Abdominal length
-0.189
-0.785*
-0.360
0.179
Abdominal widthb
0.175
0.372*
0.395
0.307
Antenna lengthb
-0.082
0.124
-0.461
0.568*
Eye diameterab
0.187
0.404*
-0.112
0.184
Eyes separation
0.102
0.349
-0.063
0.196
Furca length
-0.595*
0.558
0.360*
0.056
Head widthab
0.013
0.486*
0.264*
-0.095
Left setae
0.497
0.693*
0.565
0.769*
Right setaeab
0.420
0.648*
0.506
0.671*
0.066
0.488*
Ovisac widthab
* Largest absolute correlation between each variable and any discriminant function
a
This variable was not used in the female analysis and b not used in male analysis.
Discussion
Males and female individuals were 100% placed into their proper type of population
(North American and Caribbean coast) to which they belong (Fig. 1a and 1b) by one discriminant
function and this is consistent with the findings of Hontoria and Amat (1992b). However, male
morphometric characters (Fig. 1b) separated the type of population groups more clearly than the
female characters (Fig. 1a), since all Colombian populations were correctly positioned in the
Caribbean coast group and the SFB population into the North American group, with no
overlapping between the two types, as was the case for the female individuals.
Similarly, for Artemia populations classified by their geographic origin, male and female
individuals again separate the Colombian populations from the North American (SFB)
populations (Fig. 1c and 1d) according to actual geographical distances, but separating Salina
Cero from the Colombian populations. However, male measured variables ‘correctly’ assigned
(Fig. 1d) the membership to Colombian Caribbean populations according to actual geographical
distances with some expected overlapping among the Colombian populations. Furthermore,
according to the analysis, Salina Cero male (Fig. 1d) population is similar to its geographically
neighboring Galerazamba population, and is also related to the other Colombian populations and
is consistent with findings by Camargo et al. (2002a) using RAPDs (see Chapter 5). In addition,
65
they were able to identify a possible geographical barrier, the mountainous area of Sierra Nevada
de Santa Marta, which separates the two Colombian Artemia populations: 1) the lower Caribbean
to the South (Galerazamba and Salina Cero), 2) middle Caribbean to the North (Pozos Colorados,
Tayrona and Manaure).
Figure 1. Group centroids (maps based on 90% confidence intervals; Sokal and Rohlf, 1995) solved by: I.
the first discriminant function grouped by their type of population a) female and b) male individuals (1.
Caribbean coast and 2. North American); II. the first two discriminant functions grouped by their
geographical origin c) female and d) male individuals. (1. Galerazamba, 2. San Francisco Bay, 3. Salina
Cero, 4. Manaure, 5. Tayrona).
6
a
a
COL Centroid
NA Centroid
4
60
1
20
0
Discriminant Function 2
2
a
0
Row Number
2
2
40
b
COL Centroid
NA Centroid
60
4
c
b
2
1
2
3
4
5
0
2
20
b
5
-2
1
1
40
3
1
Dis_1_P_1 vs Dis_2_P_1
Dis_1_P_55vs Dis_2_P_5
pop_1_1 vs pop_2_1
pop_1_2 vs pop_2_2
4
pop_1_3 vs pop_2_3
pop_1_4 vs pop_2_4
pop_1_5 vs pop_2_5 1
2
3
d
-1
0
-2
-6
-4
-2
0
2
4
-6
6
-4
-2
0
2
4
6
8
Similarly, the discriminant function 1 for male individuals (Fig. 1d) separates
Galerazamba and Salina Cero populations from the other Colombian Caribbean populations
(Manaure and Tayrona), although some overlapping is still present. Nonetheless, the variables
measured for Salina Cero female individuals (Fig. 1c) behaved in a very particular manner.
Salina Cero did not cluster with the other Colombian female Artemia populations studied
(Galerazamba, Tayrona and Manaure) or with the SFB population.
66
Our results support the work of Pilla and Beardmore (1994) in that male morphometric
analyses proved at least as informative as the female characters. It should be noted that the
salinity of our adult culture media was less than that of Pilla and Beardmore (1994) (35 g.l-1 Vs.
62 g.l-1, respectively). Further, the higher salinity (62 g.l-1) used by Pilla and Beardmore (1994)
may have somehow altered particularly the female morphology, which is less dependent than
males to environmental changes and requires some physiological adaptations that occur both fast
and slow and even undergoing some slow morphological adaptations according to Gilchrist
(1960).
In summary, we have provided evidence that male Artemia morphometric characters
provide a better classification than females for both type and geographic groups and support the
type of population classificatory findings of Hontoria and Amat (1992b). Moreover, male
measured variables correctly assigned the membership to Colombian Caribbean populations
according to actual geographical distances. Further, we provide a better transformation of
characters (by dividing each character by total length). This transformation makes biological
sense in contrast to standard transformations or multiple transformations commonly employed.
The latter is consistent with the square root transformation of combined setae number (left and
right) recommended Pilla and Beardmore (1994).
Acknowledgments
and by the Universidad del Atlántico, Barranquilla, Colombia.
We express our most sincere gratitude to Christopher Kohler and to the anonymous
evaluators for their recommendations on the preparation of this paper.
67
Annex
Table 1. Males morphometry (TL: total length, AbL: abdominal length, FL: furca length, AW:
abdominal width, HW: head width, AL: antenna length, ED: eye diameter, ES: eye separation, RS:
right setae, LS: left setae, AbL*100/TL: abdominal length to total length ratio).
Gz
SFB
SC
Ma
Tay
Males
Mean
STD Dev
Min
Max
Mean
STD Dev
Min
Max
Mean
STD Dev
Min
Max
Mean
STD Dev
Min
Max
Mean
STD Dev
Min
Max
TL
4.32
0.51
3.02
5.03
4.24
0.46
3.45
5.23
3.87
0.49
3.08
4.82
5.20
0.78
3.28
6.10
5.58
0.76
3.75
7.24
AbL
1.77
0.31
1.07
2.21
1.61
0.29
1.14
2.28
1.58
0.29
1.14
2.08
2.29
0.44
1.34
2.81
2.59
0.50
1.88
4.22
FL
0.13
0.03
0.07
0.18
0.16
0.04
0.10
0.27
0.13
0.03
0.08
0.19
0.14
0.04
0.08
0.22
0.14
0.03
0.08
0.18
AW
0.32
0.04
0.23
0.40
0.36
0.04
0.30
0.47
0.29
0.04
0.27
0.40
0.36
0.06
0.27
0.47
0.40
0.06
0.27
0.54
HW
0.46
0.06
0.34
0.54
0.49
0.06
0.34
0.57
0.43
0.05
0.37
0.54
0.48
0.07
0.34
0.60
0.54
0.08
0.40
0.80
68
AnL
0.40
0.12
0.20
0.60
0.27
0.10
0.13
0.54
0.26
0.12
0.13
0.60
0.54
0.20
0.13
0.74
0.66
0.14
0.34
0.94
ED
0.13
0.03
0.07
0.17
0.14
0.03
0.10
0.20
0.11
0.02
0.10
0.13
0.15
0.04
0.07
0.20
0.17
0.03
0.13
0.20
ES
0.77
0.11
0.54
0.97
0.74
0.11
0.60
1.01
0.66
0.09
0.54
0.80
0.88
0.19
0.50
1.14
1.03
0.10
0.67
1.14
RS
6.05
1.73
0.00
8.00
10.70
1.69
7.00
14.00
6.40
1.67
3.00
11.00
7.30
2.36
4.00
12.00
7.45
1.23
5.00
10.00
LS
6.35
0.93
5.00
8.00
10.80
1.79
8.00
15.00
6.25
1.48
3.00
9.00
7.35
2.50
3.00
12.00
7.50
1.36
5.00
11.00
AbL*100/TL
40.76
3.28
34
49
37.87
3.23
33.01
44.62
40.63
3.73
33.33
47.37
43.74
3.45
37.35
48.28
46.29
3.61
41.38
58.33
Table 2. Females morphometry (TL: total length, AbL: abdominal length, FL: furca length, OW: ovisac width, AW: abdominal
width, HW: head width, AL: antenna length, ED: eye diameter, ES: eye separation, RS: right setae, LS: left setae, AbL*100/TL:
abdominal length x 100 to total length ratio).
Females
Gz
Mean
STD
Dev
Min
Max
SFB Mean
STD
Dev
Min
Max
SC
Mean
STD
Dev
Min
Max
Ma
Mean
STD
Dev
Min
Max
Tay
Mean
STD
Dev
Min
Max
TL
4.75
0.87
AbL
2.07
0.50
FL
0.14
0.03
OW
0.44
0.14
AW
0.33
0.06
HW
0.47
0.07
AnL
0.31
0.10
ED
0.13
0.03
ES
0.79
0.18
3.02
7.30
4.53
0.75
1.14
3.28
1.68
0.43
0.10
0.19
0.16
0.03
0.27
0.87
0.42
0.07
0.23
0.47
0.37
0.07
0.37
0.67
0.49
0.06
0.20
0.54
0.26
0.09
0.10
0.20
0.21
0.35
0.50 4.00 4.00
1.24 13.00 13.00
0.76 10.20 10.35
0.12 1.88 2.01
4.34
9.83
9.90
2.30
3.35
6.10
4.16
0.54
1.07
2.75
1.76
0.32
0.08
0.22
0.12
0.02
0.34
0.54
0.39
0.04
0.27
0.50
0.30
0.03
0.40
0.57
0.44
0.04
0.13
0.47
0.24
0.08
0.10
1.68
0.11
0.02
0.57 7.00 7.00
1.01 14.00 15.00
0.66 6.50 6.60
0.08 1.15 1.27
5.97
14.05
7.12
1.35
3.25
5.09
5.45
0.86
1.21
2.48
2.56
0.51
0.08
0.16
0.14
0.03
0.34
0.47
0.45
0.09
0.27
0.34
0.34
0.04
0.40
0.54
0.50
0.06
0.13
0.47
0.33
0.06
0.10
0.13
0.13
0.02
0.54
0.80
0.79
0.11
5.00
9.00
7.00
1.89
3.87
9.55
5.48
1.44
4.09
7.10
5.14
0.67
1.81
3.42
2.34
0.35
0.06
0.18
0.11
0.03
0.34
0.67
0.47
0.06
0.27
0.40
0.35
0.05
0.34
0.60
0.48
0.05
0.20
0.47
0.34
0.07
0.10
0.17
0.14
0.01
0.57 5.00 5.00
1.01 12.00 11.00
0.80 6.55 6.65
0.11 1.50 1.53
3.54
8.53
4.79
1.32
3.95
6.83
1.81
3.28
0.05
0.16
0.40
0.60
0.27
0.40
0.40
0.54
0.20
0.47
0.13
0.20
0.67
1.07
2.47
7.46
69
RS
7.20
1.88
5.00
8.00
7.00
2.08
LS
7.25
1.83
4.00 4.00
9.00 10.00
AbL*100/TL
6.94
1.71
Chapter 4. Environmental variables and Colombian strains reproduction
Part 1.
Reproductive strategies and cyst quality
Reproductive experiments were conducted (Duran et al., 2001) according to
Vanhaecke et al. (1984) with several Colombian Artemia strains to test the main
reproductive strategy of each strain under controlled conditions at two different
salinities 80 and 120 g.l-1 (Instant Ocean® synthetic salt) at the same temperature of 25
± 1 °C and same feeding regime with brewers yeast (Coutteau et al., 1992).
Additionally cyst quality studies (Rada, 2001) were performed according to Sorgeloos
et al. (1986) with several Artemia batches collected, irregularly during two years, in
different locations along the Colombian Caribbean coast, obtaining the following
results:
Manaure: Low mean cyst production per female, surprisingly, at low salinity in
vitro (34 cysts per female at 80 g.l-1) and the lowest mean oviparity percentage in vitro
(55.2 % at 120 g.l-1). This strain also exhibits a high number of cysts per gram (267,970
cysts.g-1), the second highest hatching percentage (51% /24 hrs) and the highest
hatching efficiency (155,555 nauplii.g-1 cyst) responding negatively to prolonged cold
storage at 8-10 °C.
Galerazamba: Very low mean cyst production per female in vitro (14.9 cysts per
female at 120 g.l-1), this population shows the highest mean oviparity percentage in
vitro (99.6 % at 120 g.l-1). This strain exhibits a lower number of cysts per gram
(208,260 cysts.g-1) compared to other commercial cyst types, the highest hatching
percentage (53.1% /24 hrs - stored at 8-10 °C for 18 months) and with the second
highest hatching efficiency of the three evaluated populations for this parameter
(125,888 nauplii.g-1 cyst), responding positively to prolonged cold storage.
Tayrona: The second highest mean cyst production per female in vitro (57.8
cysts per female at 120 g.l-1) and the third highest mean oviparity percentage in vitro
(74.6 % at 120 g.l-1). Tayrona exhibits the lowest hatching percentage (23.0% /24 hrs)
70
and the lowest hatching efficiency (65,889 nauplii.g-1 cysts). No data on cold storage or
number of cysts per gram, because very few cysts were collected (< 1 g.) irregularly.
Salina Cero: The highest mean cyst production per female in vitro (127.6 cysts
per female at 120 g.l-1) and a high oviparity percentage in vitro (88.7 % at 120 g.l-1).
This strain has a high number of cysts per gram (230,680 cysts.g-1), but a low hatching
percentage (46.7% / 24 hrs) and the lowest hatching efficiency (98,666 nauplii/g cysts),
responding negatively to prolonged cold storage.
Pozos Colorados: Presented the second highest cyst per female production
potential at low salinity in vitro (105 cysts per female at 80 g.l-1).
71
Part 2. Influence of some physicochemical parameters on Artemia biomass and
cyst production in some thalassohaline aquatic environments from the
Colombian Caribbean
Camargo W.N., Ely J.S., Duran G.C., Sorgeloos P.
Paper submitted to the J. World Aquaculture Society, on January 13, 2002.
Abstract
From July 1998 to June 2000 four thalassohaline aquatic environments along the
Colombian Caribbean coast (Manaure, Galerazamba, Salina Cero and Tayrona) were
surveyed monthly to determine the influence of salinity, percent O2 saturation, pH,
temperature and nutrients (NO2-, NO3- and PO4-3) on Artemia (Crustacean, Anostracan)
biomass production and cyst production potential.
The effects of the regularly
measured physicochemical parameters on biomass and cyst production potential were
analyzed using univariate analysis of variance (SPSS V10.0).
The influence of
physicochemical parameters on biomass production was not significant (p > 0.05). In
contrast, there was a significant interaction (p < 0.05) of salinity, percent O2 saturation
and nitrate on cyst production potential. Moreover, decreasing nitrate levels seem to
increase cyst production potential; thus supporting the notion that food starvation could
contribute to cyst production.
Introduction
Increasing sampling efforts in Latin America for potential Artemia (Crustacean,
Anostracan) sites during the mid 1990s have resulted in numerous Artemia populations
reported. These newly reported sites have culminated in the characterization of Artemia
habitats (Camargo et al., 2002), particularly with respect to remote thalassohaline
aquatic environments.
72
Lenz (1987) observed that zooplankton population dynamics is influenced by
abiotic factors (salinity, temperature and nutrients concentration) and by biological
interactions (predation, competition and grazers). Further, Por (1980) and Lenz (1987)
showed that biological interactions are limited in hypersaline communities due to its
low species diversity, and that the abiotic parameters, particularly those that regulate
seasonal characteristics, are eminently important.
Bisexual and parthenogenetic Artemia species are characterized by an extensive
genetic variation resulting in difference in their life history traits (Lenz and Browne,
1991). Under laboratory conditions, longevity, fecundity and reproductive period vary
one order of magnitude among Artemia species and populations (Browne, 1980a, 1988;
Lenz, 1984, 1987; Dana and Lenz, 1986; Browne and Hoopes, 1990). Browne et al.
(2002) measured reproductive and life span traits for two obligate parthenogenetic types
and three sexual (on two A. franciscana and one A. sinica) brine shrimp populations and
determined that, for all traits studied, the environmental component is greater than the
genetic component measured. However, every trait has a genetic component that can
potentially be acted upon by selection. The average genetic component of variation for
the 10 traits was 23.44%, ranging from 5.26% for number of cysts to 44.87% for
number of nauplii.
have been previously reported among the several populations of A. franciscana
(Sorgeloos et al., 1975; Abreu-Grobois and Beardmore, 1982; Bowen et al., 1985).
These differences Ecological and physiological differences have an important impact
over Artemia populations distributed worldwide by influencing reproductive strategies
through biomass and cyst production.
In saltworks, Artemia is found abundantly in the evaporation ponds at salinity
levels between 80 to 220 g.l-1 (depending on the strain and/or species), and in rare
occasions it has been found at salinities up to 340 g.l-1 (Post and Yourssef, 1977). At
these salinity levels, the high ionic concentrations become a limiting factor, thus
increasing the energy requirements for osmoregulation.
73
Artemia populations are
favored by the absence of predators and food competitors and develop successfully in
these extreme biotopes and frequently at high densities. Further the dominance of these
hypersaline habitats is shared with archaeobacterial halophiles (Grant and Ross, 1986)
and halotolerant microalgae as the concentration of salts approaches saturation. Further,
a relatively small number of these halobacterias and microalgae species serve as a food
source to this very efficient, non-selective filter feeder (Sorgeloos, 1980).
Some Artemia strains are predominantly oviparous at high salinities (e.g. Lake
Urmia, Lake Grassmere, some strains from Spain and Manaure strains - BerthélémyOkazaki, 1986; Camargo et al., 2000), while other strains primarily opt for the
ovoviviparous mode of reproduction at high salinities (e.g. Great Salt Lake, Salina Cero
strains - Amat, 1982; Camargo et al., 2000).
Depending on the strain and the
hydrobiological conditions of the pond (i.e. high water retention, high evaporation,
primary productivity), cyst production is induced by brood number, salinity,
photoperiod, temperature, hypoxia and iron rich foods (Dutrieu, 1960; Baker, 1966;
Bowen et al., 1969; Sorgeloos et al., 1975; Provasoli and Pintner, 1980; Amat, 1982;
Berthélémy-Okazaki, 1986). Cyst production can be produced seasonally or annually.
Studies in vitro revealed that optimum temperature and salinity varies between
Artemia populations (Vanhaecke et al., 1984; Wear et al., 1986; Browne et al., 1988;
Camargo et al., submitted).
A. franciscana populations have a high reproductive
capacity up to senescence (Browne et al., 1984). Browne et al. (1988) further revealed
that A. franciscana is the most plastic Artemia species with respect to temperature
followed by the parthenogenetic type.
In nature, Artemia is found in neutral to alkaline waters. According to Vos
(1979), nauplii growth decreases and the overall appearance of adults deteriorates with
pH values below 7.0, and they concluded that the optimum pH for Artemia growth
ranges from 8.0 to 8.5.
Additionally, Sato (1967) determined that cyst hatching
efficiency was greatly compromised at pHs below 8.0.
74
The aim of this research was to identify physicochemical variables that influence
monthly Artemia biomass production in vivo and monthly cyst production potential of
some wild Colombian populations (Manaure, Galerazamba, Tayrona and Salina Cero)
for potential use in aquaculture.
Additionally, this study further expands the
understanding of the complexity of hypersaline biotopes and their intricate relation with
Artemia biodiversity in general.
Twenty Artemia samples were taken randomly every month at each site
(Manaure, Galerazamba, Tayrona and Salina Cero) with a 14-liter acrylic box (Haslett
and Wear, 1985). The samples were collected in several representative marked sectors
where Artemia biomass was previously observed. Samples were counted and classified
to determine population distribution (females, males, juveniles and nauplius).
Samples containing a known number of adults (males and females) were strained
and dried in an oven at 80 °C for 24 hrs. Individual average weight from each of the
four locations was calculated by dividing the sample dry weight by the number of adults
in each sample. Finally, to calculate total dry biomass production, the individual dry
weight was multiplied by the number of adults counted at each of 20 stations in the 14liter box and was extrapolated to the pond volume. Our assumption for the mean weight
is that all individuals from each population weigh the same.
Additionally, the following physicochemical parameters were determined at
each location: salinity (temp. compensated refractometer), percent O2 saturation and
temperature (Oxymeter WTW® 330), pH (pHmeter WTW® 330), nitrates, nitrites and
phosphates (colorimetric method using Hatch® 4000 spectrophotometer) and
Chlorophyll a (seston using acetone extraction and Hatch® 4000 spectrophotometer).
Chlorophyll a analysis very often suffered interference because of the high ionic content
of the surveyed sites. Thus the originally planned dark and light bottle method had to
75
be abandoned; instead, the seston method was used.
This slightly improved the
outcome, although some periodical interference remained. Thus, we decided to use an
indirect method, by correlating a limiting nutrient (nitrate) to primary productivity.
Further, the N salt form (nitrate) was used rather than nitrites or phosphates, since
nitrites as well as phosphates showed very low values, sometimes below detection
levels (Fig. 1).
Besides, no trend was established statistically between nitrite or
phosphate and cyst and biomass production (Figures 2h, 2i, 2a and 2b). For reasons of
availability of the necessary reagents at the beginning of the 2-year sampling campaign,
ammonium was not analyzed.
Reproductive experiments were conducted according to Vanhaecke et al. (1984)
under controlled conditions (at two salinities 80 and 120 g.l-1) in order to determine the
mean cyst production potential for each site. The density of females in the pond was
determined by extrapolating the density of females per volume of water sampled with
the pond volume at each site. Pond volume was estimated from pond mean depth and
surface area. Total cyst production potential was calculated at each site by multiplying
the mean number of cysts per female (in vitro) of a given population by the total number
of females in the pond.
Finally, the effects of the measured physicochemical parameters (Table 1) on
biomass production and cyst production potential were analyzed using univariate
ANOVA with Tukey post-hoc tests (SPSS V10.0) among populations.
Variables
(salinity, percent O2 saturation, nitrate, and temperature) selected for the analyses were
based on observed relationships between physicochemical parameters and dependent
variables.
Water temperature was excluded from the final analysis because its
correlation with cyst and biomass production was insignificant. In order to apply the
univariate statistical analysis to the field data, we had to use a scoring method for
physicochemical parameters ranges, rather than reporting partial missing data or
deleting rows of incomplete data, because of the periodically partial or total (some or no
water in the pond) crystallization of some locations and its negative effect on the
analysis. Dependent variables (biomass and cyst production) can have values equal to
76
zero, contrasting with independent variables (i.e. pH, temp. salinity and percent O2
saturation), which could not be measured upon crystallization of the pond, thus
presenting a blank. The values for each variable were scored consistently from 1 to 3,
as follows: each physicochemical parameter analyzed was divided into three data
groups (containing 0 to the maximum value recorded in the field), where crystallization
of the basin (0 or no data) was represented by rank No. 1 and the subsequent measured
values within the two ranges were set to 2 and 3, respectively. The scoring was done,
rather than using the original values, in order to determine possible relationships. The
alpha (α) was set at 0.05 for all analyses.
Results
Population site characteristics:
Manaure: This location presented a good mean population distribution in the
female (F), male (M), juveniles (J) and nauplius (N) composition. The distribution was
22:16:28:35 (F:M:J:N), with a female to male (F:M) ratio of 1:0.84.
production was maintained for 21 months out of the 24 surveyed.
Biomass
This saltwork
presented, in August 1998, the highest monthly biomass value (Fig. 1a), reaching a
maximum production of 1.33 g.m-3 (DW), salinity near 170 g.l-1, a percent O2 saturation
from 56 to 99 %, NO3- 11.75 mg.l-1.
Salina Cero: Mean Artemia population distribution presented a low composition
in the proportion of adults (males and females) compared with that of the juveniles and
nauplii. This odd distribution might be caused by the low salinity and high pluviosity
presented by this saltwork during whole sampling period. From September 1998 to
June 2000, mean population composition was 11: 8:26:55 (F:M:J:N), and the F:M ratio
was 1:0.84. Salina Cero is considered the site with the lowest biomass production (Fig.
1b), although paradoxically, it has the highest mean cyst production per female in vitro.
77
Twenty-two inspections were conducted, collecting Artemia biomass in only three of
them. In June 1999, production reached its maximum value with a biomass of 0.53 g.m3
(DW), salinity near 22 g.l-1, a percent O2 saturation of 84%, and NO3- 4.85 mg.l-1.
Tayrona: The mean population distribution from November 1998 to June 2000
presented a high composition of adults (males and females) compared to that of
juveniles and nauplius being 36:46:10:8 (F:M:J:N), but with a low F:M ratio of 0.88:1,
contrary to the other three populations. Eighteen sampling campaigns were conducted,
collecting Artemia biomass in only six occasions, and very rarely cysts. Production
reached its maximum value (Fig. 1c) in September 1999 with a biomass of 0.99 g.m-3
(DW), salinity near 55 g.l-1, a very low percent O2 saturation of 23.3 % and NO3- 3.7
mg.l-1.
Galerazamba: This saltwork also presented, in general, a good mean population
distribution.
The population distribution, between July 1998 and April 2000, was
20:16:26:38 (F:M:J:N) and F:M ratio was 1:0.88. Twenty-four sampling campaigns
were realized in this saltwork, collecting Artemia biomass in 19 of them; thus, achieving
the most constant biomass production estimates of all sites. This saltwork showed an
increase in biomass and salt production in the second semester of the second sampling
year. In January 2000, biomass production reached its maximum value (Fig. 1d) with
0.79 g.m-3 (DW), salinity near 120 g.l-1, a percent O2 saturation of 91% and NO3- 9.8
mg/l.
78
Figure 1. Interaction of significant physicochemical parameters over monthly Artemia biomass
production and cyst production potential at the four locations.
5.0
400
a) Manaure, July 1998 to April 2000
4.5
350
4.0
300
3.5
250
3.0
200
2.5
150
2.0
100
1.5
1.0
50
0.5
0
-50
0.0
J
A
S
O
N
D
J
F
M
A M
J
J
Sam pling date
A
S
O
N
D
J
F
M
A
b) Salina Cero, Sept 1999 to June 2000
5.0
400
4.5
350
4.0
300
3.5
250
3.0
200
2.5
150
2.0
100
1.5
50
1.0
0
0.5
0.0
-50
S
O
N
D
J
F
5.0
M
A
M
J
J
A
S
Sam pling date
O
N
D
J
F
M
A
M
J
400
c) Tayrona (Chengue), January 1999 to March 2000
4.5
350
4.0
300
3.5
250
3.0
200
2.5
150
2.0
100
1.5
1.0
50
0.5
0
0.0
-50
J
F
M
A
M
J
J
A
S
O
N
D
J
F
M
Sam pling date
d) Galerazamba, July 1998 to June 2000
5.0
400
4.5
350
4.0
300
3.5
250
3.0
200
2.5
150
2.0
100
1.5
50
1.0
0
0.5
-50
0.0
J
A
S
O
N
D
J
F
M
A
M
J
J
A
S
O
N
D
J
F
M
A
M
J
Sam pling date
Monthly cyst prod.pot. (g.m-3)
Monthly dry biomass (g.m-3)
NO3- (mg.l-1)
% O2 Saturation
79
Salinity (g.l-1)
The results of the in vitro experiment (Table 1) for the number of Artemia cysts
produced per female at two salinities (80 and 120 g.l-1) showed that Galerazamba,
Tayrona and Salina Cero females produced more cysts at the higher salinity (120 g.l-1)
than Manaure (80 g.l-1).
Table 1. Mean cysts per female, and biotic and abiotic parameters: salinity
range, pH range, temperature range, nutrients range (NO2-, NO3and PO4-3), max. precipitation, and Chl a of four Colombian
Artemia populations (July 1998 though June 2000).
Parameters
Mean cyst/female
Salinity (g.l -1)
pH
Percent O2 sat.
Temp. (°C)
NO2- (mg.l -1)
NO3- (mg.l -1)
PO4-3 (mg.l -1)
Precipitation (mm)
Chl. a (mg.m-3)
1
2
Manaure
1
34.0
148 - 275
7.6 - 7.9
56 - 99
24.9 - 31.3
0.005 - 0.025
0.29 - 20.45
0.05 - 1.27
79.6
ND
Galerazamba
2
14.9
65 - 295
7.2 - 8.1
70 - 150
26.6 - 35.5
0.120 - 0.005
1.4 - 33.7
0.33-1.98
326.7
0.01 - 0.11
Tayrona
2
57.8
34 – 330
7.9 - 8.8
23 –131
23.4 - 33.8
0.002 - 0.018
2.15 - 22.1
0.32 - 2.83
288.2
0.01 – 0.39
Salina Cero
127.62
19 - 204
6.7 - 8.6
53 - 131
27.5 - 35.1
0.003 - 0.115
0.4 - 18.75
0.21 - 5.05
326.7
0.09 - 3.04
Highest cyst production at 80 g.l-1 in vitro
Highest cyst production at 120 g.l-1 in vitro
The influence of physicochemical parameters (Fig. 2) on biomass production
was not significant (p>0.05).
Conversely, the interaction of salinity, percent O2
saturation and nitrate on cyst production was significant (p <0.05). Salina Cero had the
highest mean cyst production potential at the lowest salinity, percent O2 saturation, and
nitrate concentration (Fig. 2) and Tayrona was characterized by higher salinity and
nitrate concentration but low percent O2 saturation.
In addition, Manaure and
Galerazamba had a relatively low cyst production potential at higher salinity, percent O2
saturation and nitrate concentrations.
80
Figure 2. Mean values with standard errors for a) Artemia cyst production potential, b) Artemia
biomass production (DW), c) pH, d) salinity, e) temperature, f) percent O2 saturation,
g) nitrate, h) nitrite and i) phosphates. (Chengue: Tayrona NNP).
4
0.5
b
3
2
1
0
c
0.4
8
0.3
pH
Biomass Production (g.m-3)
Cyst Production (g.m-3)
a
10
6
0.2
0.1
4
0.0
35
e
100
Percent Saturated O2 (%)
d
30
o
Temperature ( C)
Salinity (g.l-1)
150
100
50
25
20
15
10
0
g
60
40
10
20
i
8
1.5
1.0
-
-
8
6
6
-3
NO2 (mg.l-1)
10
NO3 (mg.l-1)
80
h
PO4 (mg.l-1)
12
f
0.5
4
4
2
0.0
2
0
Manaure
Galerazamba Chengue
Salina Cero
Manaure
Galerazamba Chengue
Salina Cero
Manaure
Galerazamba
Chengue
Salina Cero
Population
Discussion
Overall, Manaure, Galerazamba and Salina Cero presented a stable mean
population distribution with a balanced adult (38%, 36% and 19%, respectively) to J:N
proportion (62%, 64% and 81%, respectively), as well as a good F:M ratio (1:0.84,
1:0.88 and 1:0.84, respectively). In contrast, Tayrona presented a poor population
distribution with a high proportion of adults (82%) and low J:N (18%) and F:M ratio
(0.88:1), thus recruitment is below sustainable levels (i.e. after a systematic biomass or
cyst harvesting).
81
According to Wear et al. (1986), Lake Grassmere presents a relative
environmental stability with a low cyst production and a high ovoviviparity level, which
is selectively advantageous for Artemia to be able to maximize the success of
intraspecific competence. Moreover, the encysting mechanism might cause a delay in
population growth that could be disadvantageous under relatively stable conditions
(Browne, 1980a). Further, in the Manaure saltwork, Colombia (Camargo et al., 2000)
an abundant cyst production was reported for some years (Rozo and Pinzon, 1983;
Bengtson, and Simpson, 1989) before hurricane Joan, in 1988. The floods caused by
the hurricane damaged considerably the levees; therefore, joining several evaporation
ponds in the salt production circuit and causing salinity and temperature to fluctuate
very little for several years.
Consequently, Artemia primarily exhibited the
ovoviviparous mode of reproduction for several years. Only until recently, salinity has
increased in the same evaporating ponds, above the tolerance limit for Artemia, thus
producing appreciable amounts of cysts. These types of relatively stable environments
can result in a low but permanent reproduction capacity and a multiplicity of
asynchronic generations each year (Lenz, 1987).
The results of the reproductive experiment (mean cyst production per female) do
not entirely agree with the estimated cyst production potential at each site and may be
due to a combination of certain parameters (i.e. salinity, percent O2 saturation, low
nitrate and/or starvation of the Artemia population after reaching a high density,
particularly of the female portion) on cyst production, particularly in the case of Salina
Cero.
An additional explanation to these contradictory results may be due to the
controlled conditions where Artemia was fed ad libitum (constant food availability). In
contrast, these conditions do not occur naturally in the field.
The latter may be
supported, in part, by the observation of low nitrate levels during the peak cyst
production potential during this study. Further, nitrate levels and cyst production show a
negative trend and do not add to cyst production, thus providing evidence that food
limitation might contribute to cyst production.
According to Amat (1985) at low
salinities and percent O2 saturation, the factor influencing Artemia oviparity was
82
invariably hypoalimentation, particularly prolonged starvation periods (Ballardin and
Metalli, 1963). Román and Rodríguez (1986) affirm that cyst production in Cadiz
saltworks (Spain) is given when the Chlorophyll and Artemia density ratio decreased.
Similarly, according to Newman (Pers. Com., 2001) food quantity (density) might be the
determining factor for Artemia to select an oviparous mode of reproduction rather than
food quality. This could be related to a pH signal, since when food density is low, pH
swings diminish and reduces food density. There are times wherein a particularly poor
algae strain dominates and Artemia cannot break down the cell wall and at that point they
will most likely switch reproductive modes, prior to their demise. However, D’Agostino
and Provasoli (1968) also recognized that food quality and quantity could induce
oviparity.
Moreover, according to Hernandonena (1974), with increasing salinity,
Artemia energy requirements decrease and protein intake for albumin increases.
In addition, for all four locations nitrate levels were directly proportional to
salinity (Fig. 2d, g). Similarly, Nyonje et al. (1995) showed that in the saltworks at
Gongoni (Kenya) chlorophyll a increased with increasing salinity and related this to
elevated levels of nitrates in the ponds. According to Slinn (1974) in the North-West
Irish Sea, nitrate disappeared during the summer and thus would be the limiting
nutrient. Even more, the lack of nitrate limits photosynthetic activity in the surface
ocean layers (Knapp-USGS in Conomos and Gross, 1968).
To summarize we were able to show a relationship between three
physicochemical parameters (nitrate, percent O2 saturation, and salinity) and Artemia
cyst production potential for the four locations surveyed. In contrast, no significant
relationship could be established for any physicochemical variable and Artemia biomass
production. Further, nitrate and salinity were shown to be negatively correlated to cyst
production potential. The previous observation may be supported by indications that
hypoalimentation plays an important role on cyst production as shown by D’Agostino
and Provasoli (1968), Ballardin and Metalli (1963) Amat (1985), Roman and Rodríguez
(1986).
83
Although temperature interaction was shown to be insignificant in this study,
temperature has been shown to have an important effect on the hatchability of Artemia
cysts and their biomass production (Vanhaecke et al., 1984). Moreover, the effect of
temperature on hatching and growth performance varies as a function of the
geographical origin of the cysts.
Acknowledgments
This study was financed by a doctorate scholarship and a research project
“Evaluación y aprovechamiento del recurso natural Artemia en las salinas de Manaure y
Galerazamba, Caribe colombiano”, directed by William Camargo (code 1116-09-34397) and granted by the Colombian Council of Science and Technology “Francisco José
de Caldas” (COLCIENCIAS) and by the Universidad del Atlántico, Barranquilla,
Colombia.
The sampling fieldwork during the explorations and monthly data collection was
possible thanks to the very valuable cooperation received from Juan Carlos Linero,
Licet Hernandez, Jandro Bolaño, Javier Garcia, Tania Acuña, Karime Coha, Saul
Pereira, Victor Escorcia and all the members of the Artemia Research Group (GIA),
Uniatlántico. We express our most sincere gratitude to Christopher Kohler, Els Vanden
Berghe and to the anonymous evaluators for their recommendations on the preparation
of this paper.
84
Chapter 5. Preliminary genetic data on some Caribbean A. franciscana
W. N. Camargo, P. Bossier, P. Sorgeloos and Y. Sun
Paper published in 2002, Hydrobiologia 468:245-249.
Abstract
A total of fourteen Artemia samples from Colombia, Venezuela, Curaçao (Netherlands Antilles),
Puerto Rico, and reference samples from U.S.A. (San Francisco Bay, SFB) belonging to the superspecies
Artemia franciscana, and Argentina (A. persimilis), were analyzed with the RAPD technique in order to
demonstrate genetic dissimilarities. Pearson’s correlation coefficients between the DNA banding patterns
were calculated. They served as input values for the construction of UPGMA dendrograms. The results
indicate that, within the collection of Colombian, Venezuelan and the two Netherlands Antilles Artemia
cyst samples examined, two different groups seem to exist. Geographically, the mountainous area of
Sierra Nevada de Santa Marta separates these two groups (lower Caribbean to the South and middle
Caribbean to the North). Although the Caribbean, North and South American populations belong to A.
franciscana, genetic discontinuities are to be expected due to habitat differences and geographic isolation.
The Sierra Nevada (with an altitude of about 5800 m) emerges as the barrier very likely to explain the
observed RAPD differences.
Little genetic variability was present in the Colombian samples from
Manaure that were collected almost every ten years, nor in the samples from Galerazamba collected
almost two decades apart, although these samples were more likely subjected to different prevailing
environmental conditions. The SFB population did not show a very close relation with all Caribbean
populations analyzed, including the Puerto Rican. All A. franciscana populations analyzed were divergent
from A. persimilis (Argentina).
Introduction
The crustacean anostracan Artemia franciscana is widely distributed along the American
continent. This cosmopolitan brine shrimp is reported to be present practically from one extreme
of the American continent to the other; from Torres del Paine salt lagoon (50° 29′ S) in Chile
(Gajardo et al., 1992; Gajardo and Beardmore, 1993; Gajardo et al., 1998) up to Little Manitou
(51° 48′ N) in Eastern Canada (Vanhaecke et al., 1987; Bowen et al., 1988; Triantaphyllidis et
al., 1998). Yet their distribution over this area is typically patchy which is a consequence of their
85
natural occurrence being restricted to salt lakes. These salt lakes are characterized by their own
physicochemical characteristics. This could give origin to endemic Artemia populations. Despite
their isolation by distance and environmental conditions, Artemia populations in all these lakes
could be linked. It is very likely that birds play an important role in dispersing Artemia,
principally in natural and artificial coastal saline lagoons.
Aquatic migratory birds (i.e.
flamingos) have been reported by several authors (Löffler, 1964; Proctor, 1964) to be potential
passive vectors for transporting brine shrimp cysts in their digestive tract or attached to their
feathers or claws. According to Lincoln and Peterson (1979) birds are the most mobile creatures
on Earth, as they travel from the northern USA or even from northern Canada to winter quarters
in the West Indies, Central, or South America in a relatively short time. In the Caribbean region,
a good active candidate for Artemia cyst dispersal could be the Caribbean flamingo (Rooth, 1965;
Sprunt, 1976; Ogilvie and Ogilvie, 1986). Therefore, in genetic terms there is potential for gene
flux among these isolated populations. Recently some researchers (Lovejoy, 1998; Adams, 1998)
have cast some light on the possible geological landscape transformation of the American
continent, especially for South America. According to Behling et al. (1998) some parts of the
Andes may have been both cooler and moister than at present around 50 000 years ago. A midaltitude site in the southern Colombian Andes shows this pattern of cooler and possibly moister
conditions.
Genetic differences can be studied by a wide variety of techniques. With respect to
decapod crustaceae Nelson and Hedgecock (1980) and Hedgecock et al. (1982) used enzyme
polymorphism. Garcia and Benzie (1995) conducted research using RAPD markers in breeding
programs of crustaceans (penaeid shrimp).
Some of these tools have also served for the
characterization of anostracans of the genus Artemia using the cysts (Abatzopoulos et al., 1997;
Triantaphyllidis et al., 1997). Perez et al. (1994) studied mitochondrial DNA analysis of bisexual
and parthenogenetic brine shrimp.
In this paper we wanted to test the hypothesis that Artemia populations in the Caribbean
area and the North of South America that are separated by the Sierra Nevada de Santa Marta can
be easily distinguished by the RAPD technique.
86
Materials and methods
Most samples were collected directly from each locality (Fig. 1) and were processed
avoiding any possible cross contamination. The rest of the samples were obtained from the cyst
bank of the Laboratory of Aquaculture and Artemia Reference Center (ARC).
DNA extraction from cysts
For each strain (Table 1) 100 mg of decapsulated cysts (Sorgeloos et al., 1986) were resuspended
in 1 ml SE buffer (750 mM NaCl; 250 mM Na2EDTA) to which 10 µl Tris buffer was added
Table 1. List of samples used in this study, their abbreviations and ARC code numbers.
Label
Bon
PR
Cur
SFB
A. pers
Gz80
Gz98
Ma30
Ma439
Ma98
PC
PAV
SC
Tay
Species /strain
Description
A. franciscana, Bonaire
A. franciscana, Bahía Salinas
A. franciscana, Curaçao Fuik
A. franciscana, SFB
A. persimilis
A. franciscana, Galerazamba
A. franciscana, Galerazamba
A. franciscana, Manaure
A. franciscana, Pozos Colorados
A. franciscana, Puerto Araya
A. franciscana, Salina Cero
A. franciscana, Tayrona
Netherlands Antilles, ref. ARC28
Puerto Rico, ref. ARC36
Netherlands Antilles, ref. ARC502
San Francisco Bay, USA, ref. ARC1258
Argentina, ref. ARC1321
Colombia, 1980 ref. ARC469
Colombia, 1998 ref. ARC
Colombia, 1977, ref. ARC30
Colombia, 1980’s, ref. ARC439
Colombia, 1998
Venezuela, 1980’s, ref. ARC1006
(Tris stock 1M at pH 8). The samples were homogenized at 4 °C with a potter (Braun, Germany)
at 1000 rpm during 1 min. To 500 µl of homogenate 20 µl of proteinase K (stock 10 mg/ml), 50
µl of homogenate 20 µl of proteinase K (stock 10 mg/ml) and 50 µl SDS (stock 10%) were
added. After 30 min incubation at 65 °C, the sample was extracted once with 500 µl phenolchloroform (1:1) and once with 500 µl of chloroform. To the supernatant (12 000 rpm, 5 min),
650 µl of water and 1300 µl ice-cold isopropanol was added. The precipitated DNA (1 h at 20 °C) was pelleted at 12 000 rpm during 15 min and resuspended in water. The RNA in the
samples was degraded by incubation in the presence of RNAse A (0.2 mg/ml) at 37 °C during 15
min. The DNA samples were stored at -80 °C. Alternatively DNA was extracted from cysts
using the Wizard® genomic DNA purification kit (PromegaTM, mouse tail protocol). The DNA
87
concentration was measured with a spectrofluorophotometer (ShimadzuTM RF-1501). Therefore,
aliquots of the sample were dissolved in water containing ethidium bromide (final concentration
0.3 µg/ml) and excitated at 325 nm. Light emission was measured at 563 nm. At those light
wavelength settings, residual proteins in the samples do not interfere with the measurement. The
readings were converted to DNA concentrations with the help of herring sperm DNA (RocheTM
Molecular Biochemical) standard series (0 to 333 pg/µl). The DNA in the sample was adjusted
to 50 ng/µl.
RAPD reactions
RADP reactions were performed with two primers (EurogentecTM, Belgium), namely
ERIC1R
(5′ ATGTAAGCTCCTGGGGATTCAC 3′) and ERIC1RA (5′ ATGTAAGCTC-
CTGGGGATTCAG 3′) in single primer reactions. The PCR (Hybaid PCR express,
LabsystemsTM, Belgium) conditions were as follows: 1 time at 94 °C for 2 min; 5 times at 94 °C
for 30 sec, at 40 °C for 2 min, at 68 °C for 8 min; 25 times at 94 °C for 30 sec, at 65 °C for 1 min,
at 72 °C for 2 min and a final extension at 72 °C during 5 min. Therefore 100 ng total DNA and
1U DNA polymerase mixture (ExpandTM High Fidelity PCR system, RocheTM Molecular
Biochemicals) were mixed into 10 mM Tris HCl, 50 mM KC1, 5 mM MgC12 containing 20 µM
primer and 0.2 mM dNTP’s (final reaction volume: 50 µl).
Electrophoresis and gel processing
The generated DNA fragments were separated on an agarose gel (2%) and stained with
ethidium bromide (referred to as first experiment, results shown) or on an ExcelGel® system
(horizontal polyacrylamide gel electrophoresis) and silver stained (PharmaciaTM) (referred to as
second experiment, results not shown). A 100 bp ladder (PromegaTM) was loaded as a reference.
Agarose gels were photographed with a Polaroid film. Pictures or silver stained gels were
scanned and the images were processed with the Gelcompar® software (Applied Math, Kortrijk,
Belgium). Composed gels were made using the banding patterns generated by the two different
primers. Pearson's correlation coefficient between the patterns was calculated which served as
input for an UPGMA (unweighted pair-group method of arithmetic averages) dendrogram.
88
Results and discussion
In a first experiment 14 Artemia strains including one A. persimilis were tested (Table 1
and Fig. 2).
The RAPD reaction products were separated by agarose eletrophoresis and
visualized by ethidium bromide staining. The generated dendrogram contained 5 clusters:
Cluster 1: Ma439, Ma98, PC, Tay, PAV, Ma30, Bonaire and Curaçao.
Cluster 2: Gz80, Gz98 and SC
Cluster 3: SFB
Cluster 4: Puerto Rico
Cluster 5: A. persimilis
For convenience, the first cluster is called middle Caribbean and the second lower
Caribbean. In a second, identical and independent experiment (in which the same RAPD markers
were separated by horizontal PAGE and stained by silver) restricted to the strains of cluster 1 and
2, these two clusters were produced again, each of them containing the same strains (except for
Bonaire and Curaçao which were not included in this experiment). This second experiment
demonstrated that the results were reproducible (results not shown).
The clustering pattern obtained in the first experiment, corroborated by the clustering
pattern obtained in the second dendrogram, suggests that the populations in these two clusters are
not identical and that some genetic dissimilarities between them might exist. The Pearson
coefficients in the Colombian samples from Manaure that were collected in 1977 (Ma30), mid
1980’s (Ma439) and 1998 (Ma98) were very high, as well as in the samples from Galerazamba
collected in 1980 (Gz80) and 1998 (Gz98), although these samples were collected during
different years and more likely subjected to different prevailing environmental conditions. This
suggests high genetic similarities between these samples.
The splitting of the populations from Colombia, Venezuela, Bonaire and Curaçao into two
clusters: (1) Middle Caribbean: from the North of the Sierra Nevada to Bonaire and Curaçao; and
(2) Lower Caribbean: from the South of the Sierra Nevada to Salina Cero), coincides with the
89
existence of a geographical barrier in Colombia named the Sierra Nevada de Santa Marta. This
important mountainous mass is a remote derivation of the Andes Mountain range, which
gradually plunges from its 5775 m highest peak into the sea. The Sierra Nevada might constitute
a barrier to shorebirds and hence Artemia cyst dispersal. The dendrogram also illustrates the
relationship of the five Colombian, the Puerto Araya (Venezuela), Bonaire and Curaçao
populations to the other populations included in the first experiment. The Puerto Rican and San
Francisco Bay populations were demonstrated to be further apart than the five Colombian, the
Venezuelan and the other Caribbean (Bonaire and Curaçao) populations.
Yet, all these
populations, considered to be A. franciscana, were very distinct from A. persimilis.
Further biogeographical research on Artemia franciscana should include more American
populations from as far as Canada (Chaplin Lake) up to Chile and more genetic markers, in an
attempt to solve the puzzle on the phylogeography of this species on the American continent.
This study should be assisted by parallel studies on shorebird routes along existing aquatic
hypersaline environments at different latitudes of the continent.
Acknowledgements
We express our most sincere gratitude to Luc Sanders and Christ Mahieu for their
invaluable collaboration in the processing of the samples, and to Gilbert Van Stappen, Filip
Volckaert, and the anonymous evaluators for their recommendations on the preparation of this
paper. My greatest appreciation for the cooperation in cyst and data collection goes to my
research assistants Gabriel Duran, Juan Carlos Linero, Licet Hernandez and Jandro Bolaño, and
to all members of the Artemia Research Group (GIA), Uniatlántico.
This study was financed by a doctorate scholarship and a research project granted by the
and by The Universidad del Atlántico, Barranquilla, Colombia.
90
PR
Tay
Bon Cur
Tay Ma
PC
SC Gz
PAV
Sierra Nevada
de Santa Marta
Figure 1. Location of the Caribbean sample collection sites. SC: Salina Cero;
Gz: Galerazamba; PC: Pozos Colorados; Tay: Tayrona National
Natural Park; Ma: Manaure; PAV: Puerto Araya, Venezuela;
Bon: Bonaire, Cur: Curaçao; PR: Puerto Rico.
91
A. pers
PR
SFB
Gz80
Gz98
SC
Ma30
PAV
Tay
PC
Ma98
Ma439
Cur
Bon
100
90
80
70
60
50
40
30
Figure 2. Dendrogram based on LM Agarose gel (Software optimization 0.5%) SC:
Salina Cero; Gz: Galerazamba; PC: Pozos Colorados; Tay: Tayrona
National Natural Park; Ma: Manaure, PAV: Puerto Araya; Bon: Bonaire;
Cur: Curaçao; SFB: San Francisco Bay; PR: Puerto Rico.
92
Chapter 6. Effects of lunar cycles on Artemia density in hypersaline environments
Camargo, W.N., Van Vooren, L. and Sorgeloos, P.
Paper published 2002 in Hydrobiologia 468:251-260.
Abstract
The effects of lunar cycles are known to have an influence, although not yet clear, on the
behavior of aquatic organisms. A study was conducted in two different locations (Manaure,
Guajira and Tayrona, Magdalena, Caribbean coast, Colombia) during July and August, 1997 and
November, 1998 to determine the effects of medium term cycles (lunar cycles) on the presence of
Artemia franciscana (Crustacea: Anostraca) density. Samples were collected every 4 hours from
each of twenty fixed stations in a salt production pond during a 24-hour sampling period at the
peak of the four lunar phases. The data was analyzed using a mixed ANOVA model, setting
lunar phases and sampling time intervals as fixed effects, station as the random effect and density
as the dependent variable. No significant difference was determined between increasing and
decreasing moon. Artemia density was not significantly (P>0.05) higher during new moon
compared to full moon. The influence of temperature over Artemia sampling density was clearly
noticed, and was a shading factor over the possible effects of any particular lunar phase over
Artemia density at any particular sampling time. Finally, the authors recommend conducting
Artemia surveys preferably late in the evening or alternatively during early morning since
Artemia tends to distribute more uniformly during the evening (dark and cool), when water
temperature is lower, particularly in saltworks, where the evaporation basins are shallow
93
Chapter 6. Cycles influencing Artemia pond distribution
Introduction
Accurate quantitative Artemia density estimation in large shallow ponds is uncertain due
to its rapid reproduction and gregarious behavior (Haslett and Wear, 1985). Summed to these
ecological characteristics, an external, not well comprehended factor might interfere with this
already complex biomass estimative process, more particularly the effect of lunar cycles.
Three relevant time scales: long-term (seasonal cycle), medium-term (lunar cycle) and
short-term (solar and tidal cycles) influence animal behavior, particularly that of reproduction in
aquatic organisms.
In crustaceans (decapods), lunar cycles influence molting and mating;
according to Nascimento et al. (1991) Penaeus schmitti mating peaked during full and new
moons, while molting generally occurs between these periods. According to Garcia (1992), in
the marine fish Lates calcarifer, based on egg collection records, spontaneous spawning activity
of sea bass reared in floating net cages followed a semi-lunar cycle. Similarly, Hay (1990)
reported a significant spawn increment during neap tides following a new moon. Furthermore,
the negative effect of full moon (light) phase on fisheries has been well documented (Caillart,
1988; Pet et al., 1997), showing that during this moon phase, marine fish catches become
inactive. Studies conducted by Courtney et al. (1995) to test fisheries showed that shrimp
(Penaeus plebejus) catches increase leading up to full moon demonstrated that abundance of
breeding females are partly dependent on the lunar phase at sampling.
For aquatic wading birds (zooplankton grazers), lunar phases seem to be particularly
important in affecting the distribution and activity of the birds. Moves of lapwings (Vanellus
vanellus, Linnaeus) occur on the colder and on the wetter days in several months, and around the
full moon period when feeding activity is particularly prevalent. A higher proportion of lapwings
tend to feed on colder days and around the new moon (dark phase) period, while daytime leafing
increases around the full moon period (Kirby, 1997).
Circaseptan cycles (cycles lasting 7-8 days) not only influence animal behavior, but also
affect primary production, through the increment of certain phytoplanktonic organisms in
94
estuaries. Iriarte et al. (1997) demonstrated temporal variations in chlorophyll a concentration
and this was primarily associated to changes in the lunar cycle and the following rain events.
Artemia presents both positive (nauplius) and negative (adults) phototaxis (Mason, 1966;
Lenz, 1980; Bradley, 1984; Lenz et al., 1986) during different developmental periods of its life
cycle (Aiken and Hillman, 1978). Considering this behavior, which influences pond Artemia
distribution, the present study was undertaken to determine the most appropriate sampling time to
have a more accurate estimate of Artemia density, hence improving the management of this
valuable natural resource.
Study area
The Manaure saltwork (11° 46’ 32” N; 72° 29’ 27” W) is a thalassohaline shallow aquatic
hypersaline ecosystem which extends over 4,000 ha, located west contiguous to the town of
Manaure, in the center of La Guajira Department, Caribbean coast, Colombia (Fig. 1). Water
movement through the saltwork system is achieved both by pumping and through gravity. There
are six pumping stations (S1…S6) that increase water volume to a predetermined water level,
thereafter, water will flow by gravity or because of topographic differentials.
This zone was originally a natural lagoon, still surrounded in some small areas by
mangroves. The deposits were constructed using the natural topography of the terrain, with some
modifications. The levees were built by compacting large amounts of clay material brought from
the margins of the saltwork (Rozo and Pinzon, 1983). The sampling took place in a 73 ha
evaporation pond, 40-50 cm deep, labeled D-2 on the map (Fig. 1).
The natural salt pond of Chengue, in the Tayrona National Natural Park, where the 1998
sampling year was realized, is a 5 ha thalassohaline shallow pond (80 cm). It is located in the NE
(11° 19’ 03” N; 74° 08’ 13” W), of the Magdalena Department (Fig. 1). This pond is wide and
hypersaline due to definite closure by a dynamic sedimentation pattern of the only
communication channel to the inlet.
Chengue salt exploitation existed long before the
95
prehispanic period (Vargas, 1948). The Chengue Inlet is situated approximately in the middle of
the Tayrona National Natural Park, which presents a series of small bays and inlets that extend
from the city of Santa Marta to Cañaverales to the East. The Western coast is influenced by
strong waves and the alisian winds that blow mostly in NE direction from December to April, and
the SW to W from July to August (Werding and Erhardt, 1976; Bula-Meyer, 1985).
These winds have little influence on the hypersaline lagoon due to shielding effect of the
surrounding mountains. The climate of the area is tropical, with a mean annual temperature of
27.9 °C and a mean precipitation of 613 mm, with a marked rainfall period from May to
November and a hydrogradient W to E.
Materials and methods
In the field, Artemia samples were collected from each of the 20 stations, separated every
10 meters and symmetrically positioned in a 4 x 5 grid marked with stout pegs. A clear acrylic
sample box was used for this purpose, provided with a removable, watertight lid and a sliding
base to contain a volume of 14.0 liters modified from Haslett and Wear (1985). The filtering
mesh at the opening of the sliding base was 130 µm. The sample collected was washed out with
a hand sprayer and collected in a 500 ml plastic beaker. Samples were taken within 50 cm of the
surface. The samples were preserved individually for each station in 50 ml plastic bottles with
tight screwing lids in a 1:1 pH buffered formalin to alcohol mixture for its posterior analysis.
Water physicochemical (salinity, temperature, pH, dissolved oxygen, depth and turbidity) and
climatic parameters (wind speed and direction, cloud covering and photoperiod) were taken.
Samples were collected every four hours from each of twenty fixed stations in each of the
two salt production ponds (Manaure in 1997 and Tayrona in 1998) during a 24-hour sampling
period at the peak of the four lunar phases.
96
In the laboratory, the collected samples were counted and classified by maturity stage
under a stereomicroscope. Artemia density was determined from the number of adults and
juveniles counted per liter.
The null hypothesis that nighttime Artemia density is higher during new moon than during
full moon was tested. For all statistical tests, a critical significance level α=0.05 was chosen.
The software SPSS 9.0, more particularly the GLM (General Linear Model) procedure was used
for the statistical data analysis.
Results
Artemia density presented a normal distribution and homogenic variability within
sampling years, 4 moon cycles and 6 sampling times (Fig. 2). From Tables 2 and 3 and Figure 3,
it can be noticed that for both years, a very significant interaction between moon phase and
sampling time during the day and night exists. Thus, the effect of lunar cycle should not be
interpreted separately from the effect of sampling time. Additionally, the effect of sampling
station on Artemia density was slightly significant (P=0.035) in 1997 and not significant
(P=0.819) in 1998.
Post-hoc comparisons of the mean Artemia density for the four lunar cycles, analyzed for
the separate sampling times showed no statistical difference between crescent (1st quarter) and
decreasing (3rd quarter) moon phases (results not shown). Further, Artemia density was not
significantly (P>0.05) higher during new moon compared to full moon.
The residual variance (S2 =96.6) for 1997 was greater compared to that of 1998 (S2=7.1).
At the current stage, no particular reason for this phenomenon was found. From the data
generated from the nighttime sampling, during both sampling years, the hypothesis that density is
higher during new moon than during full moon cannot be accepted. Thus, another explanation to
the presence of Artemia at any given sampling time might be possible.
97
The stability of the physicochemical parameters, dissolved oxygen (D.O.), salinity and
pH, make it unlikely that these factors could explain a particular Artemia distribution during both
years (Table 1), which was confirmed by the fact that no correlation was found between these
physicochemical parameters and Artemia density at each sampling station, time nor moon phase.
Conversely, water temperature presented an inversely proportional relation with Artemia density
during both years (Fig. 4). The Pearson correlation coefficient was significant for 1997 r=-0.329,
P=0.000 and not significant for 1998 r=-0.022, P=0.623. This inverse relation was very clear
during 1997 for full (r=-0.547, P=0.000), new (r=-0.208, P=0.023) and crescent moon (r=-0.365,
P=0.000), and for 1998 only at decreasing moon (r=-0.234, P=0.010).
Moreover, water
(max./min.) temperature range was higher during 1997 (Manaure) at full moon compared to new
moon, and equal at decreasing and crescent moon (Table 1). This was also the case for 1998
(Tayrona) where full and new moon followed a similar pattern to that of 1997, but decreasing and
crescent moon did not, temperatures being higher during decreasing moon than at crescent moon.
Table 1. Physicochemical parameters measured during the two sampling years at the two locations
(Manaure and Tayrona).
1997
1998
Full
Decre
Temp. (°C)
29-38
26-34
25-32
26-34
27-36
27-36
27-33
27-34
pH
7.5-8.0
8.1
7.7-8.1
8.1-8.5
8.2-8.6
8.4-8.9
8.2-8.6
8.1-8.5
N.D.
N.D.
N.D.
N.D.
67-118
58-128
45-127
68-140
110
110
110
150
75
85
85
95
Parameters
% O2 Sat.
-1
Salinity (g.l )
-
-1
New
Cresc.
Full
Decre
New
Cresc.
NO2 (mg.l )
N.D.
0.66
0.24
N.D.
0.02
0.01
0.01
0.01
NO3- (mg.l-1)
N.D.
N.D.
0.80
N.D.
7.10
7.30
2.60
5.70
N.D.
0.55
1.15
3.2
0.80
0.68
1.67
1.47
-3
-1
PO4 (mg.l )
N.D. = Not Determined
Another possible determinant factor on Artemia density is wind speed. During both years
wind was not strong enough to affect Artemia pond distribution, since wind speed (<14 m/s) was
not higher than the Artemia swimming speed determined by Haslett and Wear (1985) during any
of the sampling years, it is improbable this factor influenced the Artemia distribution.
1997 sampling year:
For this sampling year, there was no interaction between sampling time and station (Table
2, P=0.995).
A strong interaction effect of lunar phase over sampling time was observed
98
(P=0.000), which can be explained by the effect of lunar phase being different for different
sampling times. The effect of station was also not significant (P=0.035). A small significant
effect of stations (P=0.035) on Artemia sampling could be viewed during this sampling year.
Moon phase and sampling time interaction was very high (at P=0.000, std. dev. 96½ = 9.8
was the experimental error or unexplained variability) and their effects could not be interpreted
separately. For this sampling year the null hypothesis that nighttime density sampling is higher
during new moon than during full moon can be accepted (statistical calculations not shown),
because during new moon, Artemia density was higher during the night profile (Fig. 4, at 6 pm, 2
am and 6 am) compared to the full moon night profile. Increasing and decreasing moon phases
were similar.
1998 sampling year:
No significant effect of the station (Table 3, P=0.819) over Artemia sampling was
observed during this sampling year. Again, significant differences between sampling time and
moon cycle were present during this year (P=0.000).
Consequently, no straightforward
conclusion could be asserted.
No general conclusion was possible about the influence of moon phases on the presence
of Artemia without considering the sampling time factor. It is not possible to accept nor to reject
the above-formulated null hypothesis, based solely on the analysis of the possible effects of a
lunar cycle over Artemia sampling. It is necessary to consider jointly the effects of sampling time
and moon phase effects. This could be explained because the influence of lunar phases has
shown on this sampling year to be somehow different for each sampling time.
Discussion
Apparently, from the results of the present study, the conglomerates formed by brine
shrimp are asynchronous, thus no circaseptan rhythmicity is statistically compatible with the
density of Artemia at any of the two sampling years. Further, light intensity differentials between
99
full and new moon phases (not statistically significant) and sunrise and sunset (statistically
significant) can possibly have an effect on the gregarious behavior of Artemia. According to
Forward and Hettler (1992) light serves as a directional cue for the ascent response (positive
phototaxis) of brine shrimp nauplii. The results of these authors partially corroborates our
findings and provides behavioral evidence to support their hypotheses that descent at sunrise
during diel vertical migration functions for predator avoidance and ascent at sunset functions for
feeding. These results could explain the ontogeny of behavioral responses of Artemia on the
presence of its most common natural predator, wading birds. Artemia is a slow swimming
organism, being an easy prey during bright nights (full moon) and dusk compared to dark nights
(new moon) and dawn.
Moreover, the strong effect of sampling time, station depth and temperature on Artemia
density overwhelms the possible determination of the influence of circadian cycles over Artemia
density during the two sampling years at different locations and during different years.
Artemia in Mono Lake (USA), according to Lenz (1980), follows a circadian migration
from deep water (day) to shallow water (night) cued by the negative phototactic behavior of the
adults. According to the authors the disruption of the gregarious (cluster forming) behavior that
could account for this circadian (cycles exhibiting approximately 24-hour periodicity) migration
are: 1) synodic (period for the Moon to complete a revolution relative to the Earth-Suns line)
lunar cycle, 2) circaseptan harmonics and 3) the four-hour interval sampling. Summoned to the
light factor, the strong influence of temperature on Artemia density was clearly noticed, and was
a masking factor of the possible effects of any particular lunar phase on Artemia density.
This important parameter together with salinity is determinant on the amount of dissolved
oxygen present at any given sampling interval, and will evoke Artemia migration towards lower
temperature. According to Vanhaecke et al. (1984), in laboratory experiments for the San
Francisco Bay Artemia 50% mortality occurs at 29-30 °C, whereas subtle differences are
observed for different strains (Macau, Brazil 30-31 °C, Barotac Nuevo, the Philippines 32 °C)
particularly at the upper end of the scale. Drawing conclusions on Artemia mortality at a given
time during sampling, from previous laboratory data, is difficult. It is known that Artemia in the
100
field is subjected to lethal upper limit temperature scales for brief periods of time, just 1 or 2
hours at the most, while they swim to deeper (cooler) water or water that is cooled down
posterior to sunset. Additionally, temperature (max./min.) ranges were higher during full moon
than during new moon, being a clear influential parameter on Artemia distribution on the water
column at night (cooler temperatures) compared to daytime (warmer temperatures). Balling and
Cerveny (1995) also observed the previous effect of lunar phase on temperature. These authors
demonstrated that ocean temperature is approximately 0.02 °K warmer under a full moon
globally than under a new moon.
Further studies should focus on the antagonistic circaseptan cycles (new and full moon
phases) and their interaction with temperature and dissolved oxygen and their influence on
Artemia migration.
Conclusions
After analyzing the data collected during the two sampling years, no significant difference
was found between increasing and decreasing moon. Additionally, Artemia density was not
significantly (P>0.05) higher during new moon compared to full moon.
The influence of a physical parameter (temperature) on Artemia sampling density was
clearly noticed, and was a shading factor over the possible effects of any particular lunar phase on
Artemia density at any particular sampling time.
Temperatures (max./min.) were higher during full than during new moon, being a clear
influential parameter on Artemia distribution in the water column at night (cooler temperatures)
compared to daytime (warmer temperatures).
The authors recommend conducting Artemia surveys preferably late in the evening or
alternatively during early morning since Artemia tends to distribute more uniformly during the
101
evening (dark and cool), when water temperature is lower, particularly in saltworks, where the
evaporation basins are shallow.
Acknowledgments
and by The Universidad del Atlántico, Barranquilla, Colombia.
The sampling fieldwork was possible thanks to the valuable cooperation received from
Juan Carlos Linero, Igor Muelles, Licet Hernández, Diana Arzuza, Luzmila García and Robin
Casalla.
102
D-2, 73 ha
b
c
a
Figure 1. Map of the two sampling sites for the 1997 and 1998 sampling years: a) sampling
locations, b) Manaure saltwork and c) Chengue salt pond in the Tayrona NNP.
103
20
18
Density (artemia/l)
16
14
Sampling time
12
10
6pm
8
10pm
6
2am
4
6am
2
10am
0
2pm
full
decreasing
new
crescent
Moon Cycle 1998
100
90
80
Density (artemia/l)
70
Sampling time
60
50
6 pm
40
10 pm
30
2 am
6 am
20
10 am
10
0
2 pm
full
decreasing
new
crescent
Moon cycle 1997
Figure 2. Clustered box plots for Artemia density at four moon phases and six
different sampling times for the 1997 (Manaure) and 1998 (Tayrona)
sampling years. Note: * = extreme points, o = outliners.
104
Mean Density (artemia/l)
40
30
20
Moon Phase
full
decreasing
10
new
0
6pm
crescent
10pm
2am
6am
10am
2pm
Sampling time 1997
7
Mean Density (artemia/l)
6
5
Moon Phase
4
full
3
decreasing
2
1
6pm
new
crescent
10pm
2am
6am
10am
2pm
Sampling time 1998
Figure 3. Interaction charts for Artemia density at four moon phases and six different sampling times for
the 1997 (Manaure) and 1998 (Tayrona) sampling years.
105
Table 2. Tests of Between-Subjects Effects for Artemia density during the 1997 sampling in Manaure
Dependent Variable: Density (artemia/l)
Type III
Sum of
Squares
df
Mean
Square
F
Sig.
Hypothesis
80039.4
1
80039.4
440.854
.000
Error
3449.6
19
181.6 a
Hypothesis
10271.2
5
2054.2
33.314
.000
Error
5858.0
95
61.7 b
Hypothesis
2411.3
3
803.8
7.005
.000
Error
6540.1
57
114.7 c
Hypothesis
3449.6
19
181.6
2.275
.035
Error
1673.3
20.968
79.8 d
Hypothesis
10943.0
15
729.5
7.552
.000
Error
27530.5
285
96.6 e
Hypothesis
5858.0
95
61.7
.638
.995
1.188
.184
Source
Intercept
TIME
PHASE
STATION
TIME * PHASE
TIME * STATION
PHASE * STATION
e
Error
27530.5
285
96.6
Hypothesis
6540.1
57
114.7
Error
27530.5
285
96.6 e
a. MS(STATION)
b. MS(TIME * STATION)
c. MS(PHASE * STATION)
d. 1.000 MS(TIME * STATION) + MS(PHASE * STATION) - 1.000 MS(Error)
e. MS(Error)
Table 3. Tests of Between-Subjects Effects for Artemia density during the 1998 sampling in Tayrona NNP
Dependent Variable: Density (artemia/l)
Type III
Sum of
Squares
df
Mean
Square
F
Sig.
Hypothesis
7175.9
1
7175.9
1273.650
.000
Error
107.1
19.010
5.6 a
Hypothesis
306.6
5
7.224
.000
Error
807.6
95.130
Hypothesis
177.0
3
59.0
8.515
.000
Error
395.3
57.064
6.9 c
Hypothesis
107.0
19
5.6
.676
.819
Error
325.5
39.076
8.3 d
5.961
.000
1.198
.131
.977
.526
Source
Intercept
TIME
PHASE
STATION
TIME * PHASE
TIME * STATION
PHASE * STATION
61.3
8.5 b
Hypothesis
633.7
15
Error
2012.9
284
42.2
7.1 e
Hypothesis
806.7
95
8.5
Error
2012.9
284
7.1 e
Hypothesis
394.9
57
6.9
Error
2012.9
284
7.1 e
a. 1.000 MS(STATION) - 1.927E-14 MS(TIME * STATION) + 2.077E-04 MS(Error)
b. .999 MS(TIME * STATION) + 8.189E-04 MS(Error)
c. .999 MS(PHASE * STATION) + 5.499E-04 MS(Error)
d. .999 MS(TIME * STATION) + 1.000 MS(PHASE * STATION) - .999 MS(Error)
e. MS(Error)
106
e ) Fu ll m o o n - 1998
a) Fu ll m o o n - 1997
40
40
37
T .water
D ensity
35
37
35
r=-0.547,p=0.000
33
30
35
25
33
20
31
35
r=-0.064,p=0.487
T .W ater
D ensity
30
25
20
31
15
15
29
29
10
10
27
5
27
25
0
25
18:00
22:00
02:00
06:00
10:00
14:00
5
0
18:00
22:00
S am pling tim e
2:00
6:00
10:00
14:00
S am pling tim e
f) De cr e as in g m o o n - 1998
b ) De cr e as in g m o o n - 1997
40
40
37
37
35
r=-0.019,p=0.835
35
T .W ater
D ensity
33
35
25
33
20
31
35
r=-0.234,p=0.010
30
30
T .W ater
D ensity
25
20
31
15
15
29
29
10
10
27
5
27
25
0
25
18:00
22:00
02:00
06:00
10:00
5
0
18:00
14:00
22:00
2:00
6:00
10:00
14:00
S am pling tim e
S am pling tim e
c) Ne w m o o n - 1997
g ) Ne w m o o n - 1998
40
40
37
37
35
r=-0.208,p=0.023
35
35
30
T .W ater
D ensity
33
31
35
r=-0.132,p=0.149
25
33
20
31
30
T .W ater
D ensity
25
20
15
15
29
29
10
10
27
5
27
25
0
25
18:00
22:00
02:00
06:00
10:00
5
0
18:00
14:00
22:00
S am pling tim e
2:00
6:00
10:00
14:00
S am pling tim e
d ) C r e s ce n t m o o n - 1997
h ) C r e s ce n t m o o n - 1998
40
40
37
37
r=-0.365,p=0.000
35
T .W ater
D ensity
35
35
r=-0.013,p=0.888
30
35
33
25
33
31
20
T .W ater
D ensity
30
25
20
31
15
29
15
29
10
10
27
27
5
25
0
18:00
22:00
02:00
06:00
10:00
5
25
14:00
0
18:00
S am pling tim e
22:00
2:00
6:00
10:00
14:00
S am pling tim e
Figure 4. Influence of temperature on Artemia density for the two sampling years at different sampling times and
locations (Manaure and Tayrona). Pearson correlation coefficient for 1997 r=-0.329 and p=0.000, and 1998 r=-0.022
and p=0.623.
107
Conclusions:
The series of studies accomplished and compiled in the present work intend to evaluate the
suitability of the Colombian Artemia for the aquaculture industry, and to illustrate the actual state
of Artemia stocks in this country, including an evaluation of six newly reported populations
(Salina Cero, Kangarú, Tayrona, Bahía Hondita, Pusheo and Warrego). Most of these novel
populations are located in remote and/or inhospitable regions (Tayrona, Bahía Hondita, Pusheo
and Warrego) in the Colombian Caribbean coast.
In addition to the description of biotypes provided in Chapter 3 (Artemia survey in the
Colombian Caribbean and morphometric discriminant multivariate analysis as a tool to further
characterize some Colombian Artemia populations), physicochemical parameters (ionic content,
salinity, pH, conductivity, temperature, percent O2 saturation, chlorophyll a and nutrients) were
recorded for each population studied. This information allowed to further characterize these
extreme habitats as a contribution to the knowledge of A. franciscana habitats which are complex
ecosystems.
The ionic content analysis shows that all habitats sampled are predominantly
chloride rich as expected, because of their thalassohaline (marine) origen.
Therefore, all
hypersaline biotopes sampled in the Colombian Caribbean are according to Cole and Brown
(1967) appropriate habitats for Artemia development.
Further, the chloride-rich Colombian A. franciscana biotopes are similar to other American
chloride dominant hypersaline biotopes i.e. Leslie saltworks (California - USA), La Sal del Rey
(Texas - USA) and SFB (California - USA), among others. Thus, it can be derived that Artemia
from any of these habitats might be used to further enhance cyst production capacity of the
Colombian populations.
The application of biometric tools (Chapter 3) to determine possible cyst and nauplius
size differences among the different Colombian populations has been successful at further
separating some of the most promising Artemia populations for potential aquaculture use. In
aquaculture, the live prey (i.e. Artemia nauplii) size must fit the small mouth of the fragile and
not fully developed larvae (Lavens and Sorgeloos, 1996). Hence selecting a live prey of suitable
size constitutes one of the most important determinant factors, which might be critical for the
108
success of the venture.
Cysts from Tayrona show the smallest size of all, followed by
Galerazamba, Kangarú, Manaure, Salina Cero and Pozos Colorados. Similarly, the measured
chorion thickness is consistent with the range set (<12 µm) for A. franciscana (Vanhaecke and
Sorgeloos, 1980b). Regarding chorion thickness Galerazamba has the thinnest one, followed by
Tayrona, Salina Cero, Manaure, Pozos Colorados and Kangarú. Additionally, nauplii from
Galerazamba present a small size followed by Manaure, Salina Cero, Pozos Colorados and
Tayrona.
Additionally, strain quality also depends on the nutritional content, particularly that of the
essential fatty acids. The concentration of the Artemia strain-bound DHA (22:6n-3) and EPA
(20:5n-3), are of utmost importance, especially in marine aquaculture, since these essential fatty
acids are not biosynthesized from lower unsaturated fatty acids (i.e. 18:3n-3) by most marine
fishes and crustaceans (Léger et al., 1986). The determination of FAME (Chapter 3) from all
locations where enough cyst samples were collected to perform the analysis, suggested high EPA
and low DHA. Hence, all four populations sampled (Manaure, Galerazamba, Salina Cero and
Tayrona) are suitable for marine aquaculture, only if fortified with DHA rich emulsions. Further,
significant variations in the EPA levels were observed, contrasting with the low DHA levels that
varied only slightly. Consequently, the DHA/EPA ratio was overall very low (<0.1), with the
ratios ranking as follows: Manaure > Salina Cero > Tayrona > Galerazamba.
The cyst quality study in Chapter 4 (Reproductive performance and biomass and cyst
production), conducted on cyst batches, collected irregularly from four populations, shows that
cyst collection and processing techniques need to be improved in order for them to be suitable for
the growing Colombian aquaculture industry. According to Lavens and Sorgeloos (1996), a good
quality Artemia cyst product should contain a minimal quantity of impurities (i.e. sand, empty
shells, etc.). Compared to other commercial cyst types Manaure exhibits a high number of cysts
per gram (267,970 of cysts.g-1), similar to that of Salina Cero (230,680 cysts.g-1) and followed by
Galerazamba with a lower number (208,260 cysts.g-1). No data is available for Tayrona, since
very few cysts were collected irregularly.
Further, cysts from Galerazamba have the highest
hatching percentage (53.1%/24 hrs), followed by those from Manaure (51% / 24 hrs), Salina Cero
(46.7%/24 hrs) and Tayrona (23.0%/24 hrs). Similarly, cyst samples collected from Manaure
have the highest hatching efficiency (155,555 nauplii/g cysts, responding negatively to prolonged
109
cold storage at 8-10 °C, followed by those from Galerazamba (125,888 nauplii/g cysts, reacting
positively to prolonged storage at 18 months), Salina Cero (98,666 nauplii/g cysts, reacting
negatively to cold storage) and Tayrona (65,889 nauplii/g cysts, no data on cold storage effect).
Finally, the cyst harvesting and processing procedure requires some improvements to increase
hatching efficiency and hatching percentage, to be able to compete on the foreign cyst market.
Otherwise, cysts will be limited to local aquaculture use.
Lenz (1987) observed that zooplankton population dynamics is influenced by abiotic
factors and by biological interactions. Further, the biological interactions are more restricted in
hypersaline communities due to low species diversity, and the abiotic parameters, particularly
those that regulate seasonal characteristics, are eminently important (Por, 1980; Lenz, 1987). The
outcome of the survey presented in Chapter 4, shows Manaure, Galerazamba and Salina Cero as
having a stable mean population distribution with a balanced adult (38%, 36% and 19%,
respectively) to J+N proportion (62%, 64% and 81%, respectively), as well as a stable F:M sex
ratio (1:0.84, 1:0.88 and 1:0.84, respectively).
In contrast, Tayrona exhibits an unstable
population distribution with a high proportion of adults (82%) and low J+N (18%) and F:M ratio
(0.88:1), thus recruitment of the juvenile and nauplius cohort to assure continuity (survival) of the
species in this biotope is below sustainable levels (i.e. after a systematic biomass or cyst
harvesting).
The results presented also in Chapter 4, for the reproductive experiments (mean cyst
production per female) do not entirely agree with the estimated in situ cyst production potential.
The differences in this results are likely to be due to the in situ interaction among the three
parameters (salinity, percent O2 saturation, and nitrate) on cyst production, particularly in the case
of Salina Cero. Moreover, percent O2 saturation and water salinity are inversely proportional,
since water looses the gas (O2) retention capacity at higher salinities, a situation that was very
commonly registered during the field sampling. Similarly, nitrate levels might be correlated to
salinity (see explanation in next paragraph). Another possible explanation to these contradictory
results could be the controlled conditions used (i.e. Artemia was fed ad libitum, thus constant food
availability, a condition not often observed in nature). The latter may be supported, in part, by the
observation of low nitrate levels during the peak of cyst production during this study.
110
In addition, the results of the study on the influence of physicochemical parameters on
biomass and cyst production (Chapter 4) show that for all four locations (Manaure,
Galerazamba, Salina Cero and Tayrona) nitrate levels are correlated to salinity.
Similarly,
Nyonje et al. (1995) showed that in the saltworks at Gongoni (Kenya) chlorophyll a increased
with increasing salinity and related this to elevated levels of nitrates in the ponds.
The
genetic
(RAPD)
and
morphometric
(multivariate
discriminant
analysis)
characterization among different Artemia strains can assist with the identification, selection and
management of Artemia strains. As mentioned before, the selection of a suitable Artemia strain is
a key for aquaculture or production purposes.
The genetic study presented in Chapter 5
(Preliminary genetic data on some Caribbean Artemia franciscana strains based on RAPDs),
allowed standardizing and using RAPD genetic markers (2 primers: ERIC1R and ERIC1RA in a
single primers reaction) to the identification, characterization and comparison of Colombian
populations. RAPD markers use a single short primer of arbitrary sequence to amplify genomic
DNA. The separation resolution could be improved by using more genetic markers (i.e. AFLP),
hence more clarity can be brought particularly to strains from close by locations. Nevertheless,
the 2 primers used in this study have been successful in detecting extensive polymorphisms in the
2 species included in this study and in analyzing relationships among Artemia species and strains
at a lower cost. These markers generated two similar dendrograms with the same separation for
the two Colombian Caribbean clusters:
Cluster 1 (middle Caribbean populations): Ma439, Ma98, PC, Tay and Ma30.
Cluster 2 (lower Caribbean populations): Gz80, Gz98 and SC
Moreover, the clustering pattern obtained suggests that the populations in these two
clusters are not genetically identical. The Colombian samples from Manaure that were collected
in 1977 (Ma30), mid 1980’s (Ma439) and 1998 (Ma98) were very highly correlated according to
Pearson’s coefficient; correspondingly, a high correlation was present in the samples from
Galerazamba collected in 1980 (Gz80) and 1998 (Gz98). Although the Manaure and
Galerazamba samples were collected almost a decade apart and more likely were subjected to
111
different prevailing environmental conditions, the high Pearson’s coefficients registered could
suggest high genetic similarities between samples collected during different years at each of two
locations.
Further, the splitting of the Artemia populations from Colombia, Venezuela, Bonaire and
Curaçao into two clusters: (1) Middle Caribbean: from the North of the Sierra Nevada to Bonaire
and Curaçao; and (2) Lower Caribbean: from the South of the Sierra Nevada to Salina Cero),
coincides with the existence of a geographical barrier in Colombia named the Sierra Nevada de
Santa Marta. The Sierra Nevada might constitute a geographic barrier to shorebirds and hence
prevent Artemia cyst dispersal further south. Thus, the difference between the two groups could
be attributed to isolation, or lack of genetic flow due to this physical barrier.
Additionally, the dendrograms also illustrate the relationship of the five Colombian, the
Puerto Araya (Venezuela), Bonaire and Curaçao populations to other A. franciscana populations.
Furthermore, the Puerto Rican and San Francisco Bay populations have been demonstrated to be
further apart than the five Colombian, the Venezuelan and the other Caribbean (Bonaire and
Curaçao) populations. Yet, all these populations, considered to be A. franciscana, are very
distinct from A. persimilis.
The discriminant analysis based on morphometric characters in Chapter 3, assigns male
and female individuals into their proper population group (North American and Caribbean coast)
to which they belong by only one discriminant function (100% confidence), and this is consistent
with the findings of Hontoria and Amat (1992b). However, male morphometric characters
separate better population groups than the female characters, since all Colombian populations are
correctly clustered in the Caribbean coast whereas the SFB population fall into the North
American group, with no overlapping between both, as it happens with females.
Similarly, for Artemia populations classified by their geographic origin, male and female
individuals again separate the Colombian populations from the North American (SFB)
populations, but separating Salina Cero from the Colombian populations.
However, male
measured variables ‘correctly’ assigned the membership to Colombian Caribbean populations
according to actual geographical distances with some expected overlapping among the
112
Colombian populations according to actual geographical distances. Furthermore, according to
the morphometric discriminant analysis, the Salina Cero male population is similar to its
geographically neighboring Galerazamba population and is also related to the other Colombian
populations, and this is consistent with the previous findings using RAPDs (Chapter 5) and also
likely to be explained by the existence of a geographic barrier (Sierra Nevada de Santa Marta).
Similarly, the discriminant function 1 for male individuals separates Galerazamba and Salina
Cero populations from the other Colombian Caribbean populations (Manaure and Tayrona),
although some overlapping is still present. Nonetheless, the variables measured for Salina Cero
female individuals do not cluster this population with the other Colombian female Artemia
populations studied (Galerazamba, Tayrona and Manaure) or with the SFB population.
Sampling time is an important determinant factor to consider when planning a sampling
campaign, since Artemia presents both positive (nauplius) and negative (adults) phototaxis
(Mason, 1966; Lenz, 1980; Bradley, 1984) during different developmental periods of its life
cycle (Aiken, 1978). Apparently, as deduced from the influence of lunar cycles and the sampling
time study presented in Chapter 6 (Cycles influencing Artemia pond distribution), the
conglomerates formed by brine shrimp are asynchronous. Thus, no circaseptan (cycles lasting 7
to 8 days) rhythmicity is statistically compatible with the density of Artemia at any of the two
sampling years. Further, light intensity differentials between full and new moon phases (not
statistically significant) and sunrise and sunset (statistically significant) can possibly have an
effect on the gregarious behavior of Artemia. The results of Forward and Hettler (1992) partially
corroborate our findings providing behavioral evidence to support their hypotheses that descent
(of the animals in the water column) at sunrise during diel vertical migration functions for
predator avoidance and ascent at sunset functions for feeding. These results support the ontogeny
of behavioral responses of Artemia on the presence of its most common natural predator, wading
birds. Artemia is a slow swimming organism, being an easy prey during bright nights (full moon)
and dusk compared to dark nights (new moon) and dawn. Likewise, according to the authors the
disruption of the gregarious (cluster forming) behavior that could account for this circadian
(cycles exhibiting approximately 24-hour periodicity) migration are: 1) synodic (period for the
Moon to complete a revolution relative to the Earth-Suns line) lunar cycle, 2) circaseptan
harmonics and 3) the four-hour interval sampling.
113
Additionally, the strong influence of
temperature on Artemia density has been clearly noticed, and is a masking factor of the possible
effects of any particular lunar phase on Artemia density.
Further, the authors recommend
conducting Artemia surveys preferably late in the evening or alternatively during early morning
since Artemia tends to distribute more uniformly during the evening (dark and cool), when water
temperature is lower, particularly in saltworks, where the evaporation basins are shallow.
Additionally, temperature together with salinity are determinant on the amount of
dissolved oxygen present at any given sampling interval, and will evoke Artemia migration
towards lower temperature. It is known that Artemia in the field is subjected to lethal upper limit
temperature scales for brief periods of time, just 1 or 2 hours at the most, while they swim to
deeper (cooler) water or water is cooled down posterior to sunset. Additionally, temperature
(max./min.) ranges were higher during full moon than during new moon, being a clear influential
parameter on Artemia distribution in the water column at night (cooler temperatures) compared to
daytime (warmer temperatures).
Finally, it would be important to emphasize the multidisciplinary approach used in this
work as a way to cope with the planned objectives.
The techniques used as well as the
conceptual framework of this thesis should have a relevant impact, especially on Colombian
marine aquaculture.
Prospect research:
The quality of cysts collected from the studied locations, along the Colombian Caribbean
coast, needs further improvement not only on the collection and processing methods, but also on
the water quality and infrastructure management, particularly of the major saltworks (Manaure
and Galerazamba) evaluated.
Further biogeographical genetic research on Artemia franciscana should include more
American populations from as far as Canada (Chaplin Lake) up to Chile and more genetic
114
markers, in an attempt to solve the puzzle on the phylogeography of this species on the American
continent.
Biogeographical studies should be assisted by parallel studies on shorebird routes along
existing aquatic hypersaline environments at different latitudes of the continent.
Prospect research is needed to address standardization of culture media (i.e. ionic
composition and salinity) to consistently control the effects of intrinsic factors on Artemia
morphology.
Future studies on the periodicity effects on biomass should focus on the antagonistic
circaseptan cycles (new and full moon phases) and their interaction with temperature and
dissolved oxygen and their influence on Artemia (horizontal and vertical) migration in the water
column.
115
Literature cited
Abatzopoulos, Th.J. (1988). Study of the Northern Greek Artemia populations. Ph.D. Thesis,
Aristotle University of Thessaloniki, Greece, 175p.
Abatzopoulos, Th., Kappas, I., Bossier, P., Sorgeloos, P. and Beardmore, J.A. (2002.). Genetic
characterization of Artemia tibetiana (Crustacea: Anostraca). Biol J linnean Soc 75:333344.
Abatzopoulos, Th., Karamanlidis, G., Léger, P. and Sorgeloos, P. (1989). Further characterization
of two Artemia populations from Northern Greece: biometry, hatching characteristics,
caloric content and fatty acid profiles. Hydrobiologia 179:211-222.
Abatzopoulos, Th.J., Kastritsis, C.D. and Triantaphyllidis, G.V. (1986). A study of karyotypes
and heterochromatic associations in Artemia, with special reference to two N. Greek
populations. Genetica 71:3-10.
Abatzopoulos, Th.J., Triantaphyllidis, G.V., Beardmore, J.A. and Sorgeloos, P. (1997). Cyst
membrane protein composition as a discriminant character in the genus Artemia
(International Study on Artemia. LV). J Mar Biol Ass UK 77:265-268.
Abatzopoulos, Th.J., Triantaphyllidis, G.V. and Kastritsis, C.D. (1987). Preliminary studies on
some Artemia populations from northern Greece. In: Artemia research and its applications.
Vol. 1. Morphology, Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A.
Bengtson, W. Decleir and E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 107-114.
Abatzopoulos, Th., Triantaphyllidis, C. and Kastritsis, C. (1993). Genetic polymorphisms in two
parthenogenetic Artemia populations from Northern Greece. Hydrobiologia 250:73-80.
Abatzopoulos, T., Zhang, B. and Sorgeloos, P. (1998). Artemia tibetiana: preliminary
characterization of a new Artemia species found in Tibet (People's Republic of China).
International Study on Artemia. LIX. Int J Salt Lake Res 7:41-44.
116
Literature cited
Abonyi, A. (1915). Experimentelle Daten zum Erkennen der Artemia-Gattung. Z Wiss Zool
114:95-168.
Abreu-Grobois, F.A. (1983).
Population genetics of Artemia. Ph.D. Thesis, Department of
Genetics, University College of Swansea, U.K. 438p.
Abreu-Grobois, F.A. (1987). A review of the genetics of Artemia. In: Artemia research and its
applications. Vol. 1. Morphology, Genetics, Strain characterization, Toxicology. P.
Sorgeloos, D.A. Bengtson, W. Decleir and E. Jaspers (eds). Universa Press, Wetteren,
Belgium, pp. 61-99.
Abreu-Grobois, F.A. and Beardmore, J.A. (1980). International Study on Artemia. II. Genetic
characterization of Artemia populations - an electrophoretic approach. In: The brine shrimp
Artemia. Vol. 1. Morphology, Genetics, Radiobiology, Toxicology. G. Persoone, P.
Sorgeloos, O. Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 133-146.
Abreu-Grobois, F.A. and Beardmore, J.A. (1982). Genetic differentiation and speciation in the
brine shrimp Artemia. In: Mechanisms of speciation. C. Barigozzi (ed). Alan R. Liss, Inc.,
N.Y., USA, pp. 345-376.
Abreu-Grobois, F.A. and Beardmore, J.A. (1991). Genetic characterization and intrageneric
relationships of Artemia monica Verill and A. urmiana Gunther. Hydrobiologia
212:151-168.
Adams, J. (1998).
South America during the last 150,000 years. Compilation. Oak Ridge
National Laboratory. Oak Ridge, TN, USA. Home Page http://www.esd.ornl.gov/projects/qen/nercSOUTH AMERICA.html.
Adams, T.G. (1964). Salt migration to the Northwest body of Great Salt Lake. Utah Science
143:1027-1029.
117
Literature cited
Aiken, R.B. and Hillman, J.P. (1978). Positive phototaxis of the brine shrimp Artemia salina to
monochromatic light. Can J Zool 56:708-711.
Alam, M. and Bhargava, S.C. (1979). Diurnal variations in chlorophyll pigments in relation to
some hydrological factors at Sambar Lake, Rajasthan. Trans Istd And Ueds 4:7-10.
Alvarez, Z. and Sánchez, R. (1994). Evaluación de la calidad de la cepa de Artemia las
Cumaraguas, Paraguana, Venezuela. Cienc Mar 20(3):287-299.
Alvarez-León, R. and Van Aken-Lodewyckx, Y. (1994). La Artemia en Colombia: Antecedentes,
avances y perspectivas de su utilización. Lima , Peru. Rev Latin Acui (43):91-102.
Alvarez-León, R., Ramirez-Triana, G. and Wedler, E. (1995). Registro de las condiciones
ambientales de la Laguna Sur (Bahía de Chengue, Caribe colombiano) entre 1981 - 1984. Abril de 1995. Bogotá, Colombia. Rev Acad Col Cienc 21(74):509-525.
Amat, F. (1980a). Diferenciación y distribución de las poblaciones de Artemia de España. II.
Incidencia de la salinidad en su morfologia y desarrollo. Inv. Pesquera 44(3):485-503.
Amat, F.D. (1980b). Differentiation in Artemia: strains from Spain. In: The brine shrimp Artemia.
Vol. 1. Morphology, Genetics, Radiobiology, Toxicology. G. Persoone, P. Sorgeloos, O.
Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium. pp. 19-39.
Amat, F.D. (1982). Diferenciación y distribución de las poblaciones de Artemia de España. III.
Oviparismo y ovoviviparismo. Estudio cualitativo y cuantitativo. Inv Pesq 46(1):3-13.
Amat, F. (1985). Biología de Artemia. Informe Técnico Instituto de Investigaciones Pesqueras
(INVEMAR), Santa Marta, Colombia. pp. 126-127.
Amat, F.D. (1996). Notas para una propuesta de proyecto IBEROEKA, Instituto de acuicultura
de Torre de La Sal (CSIC), Ribera de Cabanes, Castellón, España.
118
Literature cited
Amat, F.D. (1999). Localización, caracterización y evaluación del potencial extractivo de
Artemia en Iberoamerica con destino a la acuicultura. Proyecto de Coordinación II - A/2
CYTED, Quinta Reunión Ibero- Americana, Universidad Autónoma Metropolitana Xochimilco, México D.F. Octubre 18 al 22, 1999.
Amat, F.D., Hontoria, F.D., Navarro, J.C.T., Gozalbo, A.E. and Varo, I.V. (1991). Bioecología de
la Artemia (Crustacea, Branchiopoda) en la laguna de La Mata, Torrevieja, Alicante.
Instituto de Torre de la Sal (CSIC), Castellón, España.
Anikin, W.P. (1898). Einige biologische Beobachtungen über die Crustacea der Gattung Artemia.
Zool Zbl 6:757-760.
Artom, C. (1906). Ricerche sperimentali sul modo di riprodursi dell'Artemia salina Lin. di
Cagliari. Biol Zentralbl 26:26-32.
Artom, C. (1907a). La maturazione, la fecondazione e i primi stadi di sviluppo dell'uovo
dell'Artemia salina (Linn). di Cagliari. (Race Sci Biol) Biologica 1:495-515.
Artom, C. (1907b). La variazione dell'Artemia salina (Linn) di Cagliari sotto l'influsso della
salsedine. Memorie Accad Sci Torino 57: 221-254.
Artom, C. (1922). Nuovi datti sulfa distribuzione geografica e sulla biologia delle due specie
(microperenica e macroperenica) del genere Artemia. Atti Accad Naz Lincei Rc 31:529-532.
Artom, C. (1931). L' origine e l'evoluzione della partenogenesi attraverso i different biotipi di una
specie collettiva (A. salina) con speciale riferimento al biotipo diploide partenogenetico di
Sete. Mem R Accad Ital C1 Sci Fis Mat Nat 2:1-57.
Badaracco, G., Baratelli, L., Ginelli, E., Meneveri, R., Plevani, P., Valsasnini, P. and Barigozzi,
C. (1987). Variations in repetitive DNA and heterochromatin in the genus Artemia,
Chromosoma 95:71-75.
119
Literature cited
Badaracco, G., Bellorini, M. and Landsberger, N. (1995). Phylogenetic study of bisexual
Artemia using random amplified polymorphic DNA, J Molec Evol 41:150-154.
Baid, I.C. (1958). Occurrence of Artemia salina in Sambar Lake, Rajasthan. Current Sci 27:5859.
Baid, I.C. (1963). The effect of salinity on growth and form of Artemia salina (L.). J exp Zool
153(3): 279-283.
Baker, M.J. (1966). Autecology of Artemia: factors influencing hemoglobin synthesis and cyst
production. San Francisco State College San Francisco, USA. 117 p.
Ballardin, E. and Metalli, P. (1963). Osservazioni sulla biologia di Artemia salina (L.) Istituto
Lombardo, Acc di Sci E lettere 97:194-254.
Balling, Jr., R.C. and Cerveny, R.S. (1995). The influence of lunar phase on daily global
temperatures. Science 267:1481-1482.
Barigozzi, C. (1942). I fenomeni cromosomici nelle cellule somatiche di Artemia salina Leach.
Chromosoma 2:251-292.
Barigozzi, C. (1946). Uber die geographische Verbreitung der Mutanten von Artemia salina
Leach. Chromosoma 6:549-575.
Barigozzi, C. (1974). Artemia: a survey of its significance in genetic problems. Evol Biol
7:221-252.
Barigozzi, C. (1980). Genus Artemia: Problems of systematics. In: The brine shrimp Artemia.
Vol. 1. Morphology, Genetics, Radiobiology, Toxicology. G. Persoone, P. Sorgeloos, O.
Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 147-153.
120
Literature cited
Barigozzi, C. (1989). Cytogenetics and speciation of the brine shrimp Artemia. Atti Acc Lincei
Mem Fis 19:57-96.
Barigozzi, C. and Badaracco, G. (1984). Heterochromatin in genus Artemia. Chromosoma 90:
332-337.
Barigozzi, C. and Baratelli, Z.L. (1982). Presence and absence of chromocenters in populations
of Artemia. Rend Acc Naz Lincei 71:122-125.
Barigozzi, C. and Baratelli, Z.L. (1993). New data for defining the species Artemia tunisiana
Clark and Bowen. Rend Fis Acc Lincei 4:39-42.
Barigozzi, C. and Tosi, M. (1959). New data on tetraploidy of amphigonic A. salina Leach and
on triploids resulting from crosses between tetraploids and diploids. Ricerca Sci 29:3-6.
Barigozzi, C., Piccinelli, M. and Prosdocimi, T. (1969).
Description of some spontaneous
mutants of Artemia salina. Atti Assoc Gnet Ital 14:169-181.
Barigozzi, C., Valsasnini, P., Ginelli, E., Badaracco, G., Plevani, P. and Baratelli, L. (1987).
Further data on repetitive DNA and speciation in Artemia. In: Artemia Research and its
Applications. Vol. 1. Morphology, Genetics, Strain characterization, Toxicology. P.
Sorgeloos, D.A. Bengtson, W. Decleir and E. Jaspers (eds). Universa Press, Wetteren,
Belgium. pp. 103-105.
Barlow, D.J. and Sleigh, M.A. (1980). The propulsion and use of water currents for swimming
and feeding in larval and adult Artemia. In: The brine shrimp Artemia. Vol. 1. Morphology,
Genetics, Radiobiology, Toxicology. G. Persoone, P. Sorgeloos, O. Roels and E. Jaspers
(eds). Universa Press, Wetteren, Belgium. pp. 61-73.
121
Literature cited
Bateson, W. (1984). Brachyonus and Artemia. In: Materials for the study of variation.
MacMillan, London, U.K., pp. 96-101.
Beadle, L.C. (1943). An ecological survey of some island saline waters of Algeria. J Limnol Soc
Zool 43:218-242.
Beardmore, J.A. and Abreu-Grobois, F.A. (1983). Taxonomy and evolution in the brine shrimp
Artemia. In: Protein polymorphism: adaptive and taxonomic significance. G.S. Oxford and
D. Rollinson (eds). Academic Press, London,U.K. pp. 153-164.
Beardmore, J.A., Pilla, E.J. and Thomas, K.M. (1995). Genetic variation in Artemia: speciation,
reproductive mode and potential for exploitation. In: Book of abstracts of contributions
presented at the International Conference "Improvement of the commercial production of
marine aquaculture species". G. Gajardo and P. Coutteau (eds), Puerto Montt, Chile, Dec.
5-9.
Beck, A.D. and Bengtson, D.A. (1982). International Study on Artemia. XXII. Nutrition in
aquatic toxicology: diet quality of geographical strains of the brine shrimp Artemia. In:
Aquatic Toxicology and Hazard Assessment: Fifth Conference. J.G. Pearson, R.B. Foster
and Bishop, W.E. (eds). American Society for Testing and Materials, Philadelphia, PA. pp.
161-168.
Behling, H., Negret, A.J. and Hooghiemstra, H. (1998). Late Quaternary vegetational and
climatic change in the Popayan region, Southern Colombian Andes. J Quaternary Sci 13:43–
53.
Belk, D. and Brtek, J. (1995). Checklist of the Anostraca. Hydrobiologia 298:315-353.
Bengtson, D.A. and Simpson, K.L. (1989). Factibilidad de explotación comercial de Artemia en
Manaure, Colombia. Reporte para Proexpo, Bogotá, Colombia. University of Rhode Island,
April 1989.
122
Literature cited
Bengtson, D.A., Léger, P. and Sorgeloos, P. (1991).
Use of Artemia as a food source for
aquaculture. In: Artemia Biology. R.A. Browne, P. Sorgeloos and C.N.A. Trotman (eds).
CRC Press, Inc., Boca Raton, Florida, USA, pp. 255-285.
Berthélémy-Okazaki, N.J. (1986). Environmental, biochemical, and genetic factors regulating
oviparity in Artemia. Ph.D. Thesis. University of California, Davis, USA.
Berthélémy-Okazaki, N.J. and D. Hedgecock. (1987). Effect of environmental factors on cyst
formation in the brine shrimp Artemia: In: Artemia Research and its Applications. Vol. 3.
W. Decleir, L. Moens, H. Slegers, E. Jaspers and P. Sorgeloos (eds). Universa Press,
Wetteren, Belgium, pp. 167-182.
Blanchard, C.E. (1987). A scanning electron-microscope study of the development of the
phyllopods in Artemia. In: Artemia Research and its Applications. Vol. 1. Morphology,
Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A. Bengtson, W. Decleir and
E. Jaspers (eds). Universa Press, Wetteren, Belgium, p. 53.
Bond, R.M. (1933). Observations on Artemia "franciscana" Kellogg, especially on the relation of
environment to morphology. Int Revue yes Hydrobiol Hydrogr 28(1/2):117-125.
Bonilla, L.A.S. (1984). A study of the brine shrimp, Artemia (Crustacea: Anostraca) in Puerto
Rico. Ph.D. Thesis. Department of Marine Sciences, University of Puerto Rico, Mayaguez.
250 p.
Bowen, S.T. (1962). The genetics of Artemia salina. I. The reproductive cycle. Biol Bull
122:25-32.
Bowen, S.T. (1963). The genetics of Artemia salina. II. White eye, a sex-linked mutation. Biol
Bull 124:17-23.
123
Literature cited
Bowen, S.T. (1964). The genetics of Artemia salina. IV. Hybridization of wild populations with
mutant stocks. Biol Bull 126: 333-344.
Bowen, S.T. (1965). The genetics of Artemia salina. V. Crossing over between the X and Y
chromosomes. Genetics 52:695-710.
Bowen, S.T. and Sterling, G. (1978). Esterase and malate dehydrogenase isozyme
polymorphisms in 15 Artemia populations. Comp Biochem Physiol 61(B):593-595.
Bowen, S.T., Buoncristiani, M.R and Carl, J.R. (1988). Artemia habitats: Ion concentrations
tolerated by one superspecies. Hydrobiologia 158:201-214.
Bowen, S.T., Davis, M.L., Fenster, S.R., and Lindwall, G.A. (1980). Sibling species of Artemia.
In: The brine shrimp Artemia. Vol. 1. Morphology, Genetics, Radiobiology, Toxicology. G.
Persoone, P. Sorgeloos, O. Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium.
pp. 151-167.
Bowen, S.T., Fogarino, E.A., Hitchner, K.N., Dana, G.L., Chow, V.H.S., Buoncristiani, M.R. and
Carl, J.R. (1985). Ecological isolation in Artemia: population differences in tolerance of
anion concentrations. J Crust Biol 5(1):106-129.
Bowen, S.T., Hanson, J., Dowling, P. and Poon, M. (1966). The genetics of Artemia salina. VI.
Summary of mutations. Biol Bull 131:230-250.
Bowen. S.T., Lebherz, H.G., Poon, M.C., Chow, H.S. and Crigliatti, T. (1969). The hemoglobins
of Artemia salina L. I. Determination of phenotype by genotype and environment. Comp
Biochem Physiol 31:733-747.
Bradley, D.J. and Forward, R.B. Jr. (1984). Phototaxis of adult brine shrimp, Artemia salina.
Can J Zool 62:2357-2359.
124
Literature cited
Brauer, A. (1983). Zur Kenntnis der Reifung des parthenogenetischen sich entrichlenden. Eies
von Artemia salina. Arch Mikrosk Anat 43:162-222.
Browne, R.A. (1980a).
Reproductive pattern and mode in the brine shrimp. Ecology
61(3):466-470.
Browne, R.A. (1980b). Acute response versus reproductive performance in five strains of brine
shrimp exposed to copper sulfate. Mar. Env. Res. 3:185-193.
Browne, R.A. (1983). Divergence of demographic and reproductive variables over 25 years in
1aboratory and natural populations of the brine shrimp Artemia. Crustaceana 45:164-168.
Browne, R.A. (1988). Ecological and genetic divergence of sexual and asexual brine shrimp
(Artemia) from the Mediterranean basin. Nat Geog Res 4(4):548-554.
Browne, R.A. and Bowen, S.T. (1991). Taxonomy and population genetics of Artemia. In:
Artemia Biology. R.A. Browne, P. Sorgeloos and C.N.A. Trotman (eds), CRC Press, Inc.,
Boca Raton, Florida, USA, pp. 221-235.
Browne, R.A. and Hoopes, C.W. (1990). Genotype diversity and selection in asexual brine
shrimp (Artemia). Evolution. 44(4):1035-1051.
Browne, R.A. and MacDonald, G.H. (1982).
Biogeography of the brine shrimp, Artemia:
distribution of parthenogenetic and sexual populations. J Biogeogr 9:331-338.
Browne, R.A., Davis, L.E. and Sallee, S.E. (1988). Effects of temperature and relative fitness of
sexual and asexual brine shrimp Artemia. J exp mar Biol Ecol 24:1-20.
Browne, RA., Maotang, L., Wanigasekera, G., Simonek, S., Brownlee, D., Eiband, G. and
Cowan, J. (1991). Ecological, physiological and genetic divergence of sexual and asexual
125
Literature cited
(diploid and polyploid) brine shrimp (Artemia). In: Advances in Ecology. Vol.1. J. Menon
(ed), Council of Research Integration, Trivandrum, India, pp. 41-52.
Browne, R.A., Moller, V., Forbes, V.E. and Depledge, M.H. (2002). Estimating genetic and
environmental components of variance using sexual and clonal Artemia. J Exp Mar Biol
Ecol 267(1):107-119.
Browne, R.A., Sallee, S.E., Grosch, D.S, Segreti, W.O. and Purser, S.M. (1984). Partitioning
genetic and environmental components of reproduction and lifespan in Artemia. Ecology
65(3):949-960.
Bruggeman, E., Sorgeloos, P. and Vanhaecke, P. (1980). Improvements in the decapsulation
technique of Artemia cysts. In: The brine shrimp Artemia. Vol. 3. Ecology, culturing, use
in aquaculture. G. Persoone, P. Sorgeloos, O.A. Roels and E. Jaspers (eds). Universa Press,
Wetteren, Belgium. pp. 261-269.
Bula-Meyer, G. (1985). Un nucleo nuevo de surgencia en el Caríbe colombiano, detectado en
correlación con las macroalgas. Univ. Jorge Tadeo Lozano. Bogotá, Colombia. Bol Ecotróp
12:3-26.
Cai, Y. (1987). Observations on parthenogenetic and bisexual brine shrimp from the People's
Republic of China. In: Artemia research and its applications. Vol. 1. Morphology, Genetics,
Strain characterization, Toxicology. P. Sorgeloos, D.A. Bengtson, W. Declair and E.
Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 227-232.
Cai, Y. (1989).
A redescription of the brine shrimp (Artemia sinica). Wasmann J Biol
47:105-110.
Caillart, B. (1988). Study of a small scale fishery of the Tuamotu archipelago (French Polynesia).
Biology, ethology and population dynamics of a characteristic species: Naso brevirostris
126
Literature cited
(Pisces, Acanthuridae). Inst. Fr. Rech. Sci. Dev. Coop., Orstom, France. Notes Doc
Oceanogr Cent Tahiti 38:235.
Camargo, W.N., Bossier, P., Sorgeloos, P. and Sun, Y. (2002a). Preliminary genetic data on some
Caribbean Artemia franciscana strains based on RAPDs. Hydrobiologia 468:245-249.
Camargo, W.N., Coha, K.V. and Durán, G.C. (2000). “Evaluación y aprovechamiento del
recurso natural Artemia en las salinas de Manaure y Galerazamba, Caribe colombiano”,
(código 1116-09-343-97) Colciencias y Universidad del Atlántico, Colombia. Informe
Final. 46 p.
Camargo, W.N., Van Vooren, L. and Sorgeloos, P. (2002b). Effects of lunar cycles on Artemia
density in hypersaline environments. Hydrobiologia 468:251-260.
Camargo, W.N., Ely, J.S., Duran, G.C. and Sorgeloos, P. (submitted). Influence of some
physicochemical parameters on Artemia biomass and cyst production in some
thalassohaline aquatic environments from the Colombian Caribbean. J World Aqua Soc.
Camargo, W.N., Ely, J.S., and Sorgeloos, P. (Submitted). Morphometric characterization of
thalassohaline Artemia populations from the Colombian Caribbean. J Biogeography.
Cannon, H.G. (1933). On the feeding mechanism of the Branchiopoda. Phil Trans Roy Soc
London. 222b:267-353.
Cárdenas, R. (1981). Resultados preliminares comparativos en Artemia salina, colectada en dos
localidades diferentes del Caribe colombiano. En : Divulgación Pesquera. Inderena (1977).
17(45):1-12.
Carpelan, 0.L.H. (1957). Hydrobiology of the Alviso salt ponds. Ecology 38(3):375-390.
127
Literature cited
Castritsi-Catharios, J., Christodoulopoulou, M., Atzidou, A. and Kiortsis, B. (1987). Biometrics
of Artemia from Milos (Greece). In: Artemia research and its applications. Vol.1.
Morphology, Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A. Bengtson,
W. Decleir and E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 219-220.
Castro, T.B. and Gallardo, C.R. (1993). Artemia sp., Cuadernos CBS. Universidad Autonoma
Metropolitana, Xochimilco, México.
Castro, T., Castro, G., Castro, J., Malpica, A. and De Lara, R. (1997). Características
morfométricas y calidad de los quistes de Artemia sp. (Crustacea: Anostraca), habitante de
aguas sulfatadas de Coahuila, México. Cienc Mar 23(4):491-503.
Castro, T., Malpica, A., Castro, J., Castro, G. and De Lara, R. (2001). Environmental and
biological characteristics of Artemia ecosystems in Mexico: An updated review. Aquatic
Ecosystems of Mexico: Status and Scope. S.G., Maunawar, S.G., Lawrence, I.F. Munawar,
and D.F. Malley (eds). Backhuys Publishers, Leiden, the Netherlands. pp 191-201.
Castro, M.J., Malpica, S.A., Rodríguez, G.S.A., Castro, B.T. and De Lara, R. (1995). Análisis
morfométrico de la Artemia spp. En la Salina “La Colorada”, Oaxaca, México.
Oceanología 2(6):116-128.
Chow, V. (1968). Physiology of Artemia: effect of nutrition and oxygen tension on survival and
haemoglobin production. Thesis. San Francisco State College, USA. 106 p.
Clarke, F.W. (1924). The data of geochemistry. US Geol Survey Bull 5:841.
Claus, C., Benijts, F. and Sorgeloos, P. (1977). Comparative study of different geographical
strains of the brine shrimp Artemia salina. In: Fundamental and applied research on the
brine shrimp, Artemia salina (L.) in Belgium. E. Jaspers and G. Persoone (eds). European
Mariculture Society, Special Publication No.2. Bredene, Belgium, pp. 91-105.
128
Literature cited
Claus, C., Benijts, F., Vandeputte, G. and Gardner, W. (1979). The biochemical composition of
the larvae of two strains of Artemia salina (L.) reared on two different algal foods. J exp
mar Biol Ecol 36:171-183.
Clegg, J.S. (1964). The control of emergence and metabolism by external osmotic pressure and
the role of free glycerol in developing cysts of Artemia salina. J Exp Biol 41:879-892.
Clegg, J.S. and Conte, F.P. (1980). A review of the cellular and developmental biology of
Artemia. In: The brine shrimp Artemia. Vol. 2. Physiology, Biochemistry, Molecular
Biology. G. Persoone, P. Sorgeloos, O.A. Roels and E. Jaspers (eds). Universa Press,
Wetteren, Belgium. pp. 11-54.
Cohen, R.G., Amat, F., Hontoria, F. and Navarro, J.C. (1999). Preliminary characterization of
some Argentinian Artemia populations from La Pampa and Buenos Aires provinces. Int J
Salt Lake Res 8:329-340.
Cole, G.A. and Brown, R.J. (1967). The chemistry of Artemia habitats. Ecology 48:858-861.
Colihueque, N. and Gajardo, G. (1996). Chromosomal analysis in Artemia populations from
South America. Cytobios 88:141-148.
Collins, N.C. (1977). Ecological studies of terminal lakes – their relevance to problems in
limnology in population biology. In: ‘Proceedings of the International Conference on
Desertic terminal Lakes’. D.C. Greer (ed.) Utah Water Research Laboratory, Logan, Utah.
pp. 411-420.
Comin, F.P. and Conte, P.A. (1988). Abundance and spatial distribution of Artemia salina in
Lake Albert, Oregon. Hydrobiologia 158:237-247.
Conomos, T.J. and Gross, M.G. (1968). Mixing of Columbia river and ocean waters in summer.
ASCE proc. J Sanit Eng Div Vol 94, No SA5, Pap 6187, Oct. 1968, pp. 979-994.
129
Literature cited
Contreras, J.A. (1987). Estudio prospectivo del camarón salado (Artemia sp.) en las marismas
del ejido Aquiles Serdán (El Barranco), Mpo. de Altamira, Tamaulipas. Tesis. Universidad
del Noreste. Escuela de Ciencias Biológicas, Tampico, Tamaulipas, México. 39 p.
Correa, F. S., Rodriguez, D.C, Castro, T.B., Camargo. W.N. and De la Rosa, J. (Unpublished
data).
Variabilidad alozímica en poblaciones de Artemia franciscana de Jamaica y
Colombia. Universidad Autónoma de Baja California Norte, Instituto de Investigaciones
Oceanológicas, México.
Courtney, A.J., McGilvray, J.G. and Die, D.J. (1995). Lunar variation in population structure and
reproductive activity in Penaeus plebejus. Workshop. Proceedings of the workshop on
spawning stock recruitment relationships, Courtney, A.J.; Cosgrove, M.G. (ed.), Brisbane,
Qld, Australia pp. 93-94.
Coutteau, P., Brendonck, L., Lavens, P. and Sorgeloos, P. (1992). The use of manipulated baker's
yeast as an algal substitute for the laboratory culture of Anostraca. Hydrobiologia 234:25-32.
Coyne, J.A. (1992). Genetics and speciation, Nature 355:511-515.
Crane, J.L. (1974). Characterization of selected bacteria from the North Arm of the Great Salt
Lake. M.Sc thesis. Utah State University. Logan, Utah, USA.
Croghan, P.C. (1958b). The survival of Artemia salina (L.) in various media. J Exp Biol
35(1):213-218.
Croghan, P.C. (1958a). The osmotic and ionic regulation of Artemia salina (L.). J Exp Biol
35(1):219-233.
D'Agostino, A.S. (1965). Comparative studies of Artemia salina (development and physiology).
Thesis, New York University, 83p.
130
Literature cited
D'Agostino, A.S. and Provasoli, L. (1968). Effects of salinity and nutrients on mono- and
diaxenic cultures of two strains of Artemia salina. Biol Bull 134(1):1-14.
Dana, G.L. and Lenz, P.H. (1986). Effects of increasing salinity on an Artemia population from
Mono Lake, California. Oceanologia 68:428-436.
Davis, J.S. (1978). Biological communities of a nutrient enriched salina. Aquat Bot 4:23-42.
Davis, J.S. (1980). Experiences with Artemia at solar saltworks. 3:51-55.
De Los Rios, P. and Zuñiga, O. (2000). Biometric comparison of the frontal knob in American
populations of Artemia (Anostraca, Artemiidae), Rev Chil Hist Nat 73:31-38.
De Pauw N. and De Leenheer, L. (1979). Mass culturing of marine and freshwater algae on
aerated swine manure. In: Cultivation of fish fry and its live food. EMS Special Pub 4:441473.
Deevey, E.S. (1957). Limnologic studies in Middle America. Trans Conn Acad Arts Sci 39:213328.
Dhont, J. and Sorgeloos, P. (In press). Applications of Artemia. Artemia: Basic and applied
Biology. Abatzopoulos, T.J., Beardmore, J.A., Clegg J.S. and Sorgeloos, P. (eds). Kluwer
Academic Publishers, Dordrecht, 2002.
Doullet, P.G. and Newmark, R.F. (1982). Comparación de la producción de huevos de Artemia
salina (Leach, 1819), (cepa Galerazamba), en dos medios diferentes y a diversas
salinidades, utilizando alimentación ad-libitum. B.S. Thesis. Universidad Jorge Tadeo
Lozano, Bogotá, Colombia.
Dunn, J.R. (1953). The origin of the deposits of tufa in Mono Lake. J Sediment Petrol 23:18-23.
131
Literature cited
Durán, G.C. and García, J.N. (2001). Influencia de la salinidad y temperatura en el modo de
reproducción de la Artemia (Crustacea, Anostraca) de varias localizaciones del Caribe
Colombiano. B.S. Thesis. Universidad del Atlántico, Facultad de Biología. Barranquilla.
Colombia.
Dutrieu, J. (1960). Observations biochimiques et physiologiques sur le développement d 'Artemia
salina Leach. Arch Zool Exp Gén 99:1-134.
Flett, R., Schindler, D., Hamilton, R. and Campbell, N. (1980). Nitrogen fixation in Canadian
precambrian shield lakes. Can J Fish Aquat Sci 37:494-505.
Forward, R.B. Jr and Hettler, W.F. Jr. (1992). Effects of feeding and predator exposure on
photoresponses during diel vertical migration of brine shrimp larvae. Limnol Oceanogr
37(6):1261-1270.
Freeman, J.A. and Chronister, R.B. (1988). Cell-specific endopolyploidy in developing Artemia.
Roux’s Archives of Developmental Biology 197:490-495.
Fryer, G. (1983). Functional ontogenetic changes in Branchinecta ferox (Milne-Ewards)
(Crustacea: Anostraca). Phil Trans R Soc Lond B3O3:229-343.
Fryer, G. (1987). A new classification of the branchiopod Crustacea. Zool J linnean Soc 91:357383.
Gajardo, G.M. and Beardmore, J.A. (1989). Ability to switch reproductive mode in Artemia is
related to maternal heterozygosity. Mar Ecol Prog Ser 55:191.
Gajardo, G.M. and Beardmore, J.A. (1993). Electrophoretic evidence suggests that the Artemia
found in the Salar de Atacama, Chile, is A. franciscana Kellogg. Hydrobiologia 257:65-71.
132
Literature cited
Gajardo, G., Beardmore, J.A. and Sorgeloos, P. (2001a). International study on Artemia. LXII.
Genomic relationships between Artemia franciscana and A. persimilis, inferred from
chromocentre numbers. Heredity 87:172-177.
Gajardo, G., Colihueque, N., Parraguez, M. and Sorgeloos, P. (1998). International study on
Artemia LVIII. Morphologic differentiation and reproductive isolation of Artemia
populations from South America. Int J Salt Lake Res 7:133-151.
Gajardo, G., da Conceicao, M., Weber, L. and Beardmore, J.A. (1995). Genetic variability and
interpopulational differentiation of Artemia strains from South America, Hydrobiologia
302:21-29.
Gajardo, G., Kappas, I., Abatzopoulos, T.J. and Beardmore, J.A. (In press). Evolution and
speciation. Artemia: Basic and applied Biology. Abatzopoulos, T.J., Beardmore, J.A.,
Clegg J.S. and Sorgeloos, P. (eds). Kluwer Academic Publishers, Dordrecht, 2002.
Gajardo, G., Mercado, C., Beardmore, J.A. and Sorgeloos, P. (1999). International study on
Artemia. LX. Allozyme data suggest that a new Artemia population in southern Chile (50º
29’ S; 73º 45’ W) is A. persimilis. Hydrobiologia 405:117-123.
Gajardo, G., Parraguez, M., Beardmore, J.A. and Sorgeloos, P. (2001b). Reproduction in the brine
shrimp Artemia: evolutionary relevance of laboratory cross-fertility tests. (London). J Zool
253:25-32.
Gajardo, G.M., Wilson, R. and Zuñiga, O. (1992). Report on the occurrence of Artemia in a
saline deposit of the Chilean Andes (Branchiopoda, Anostraca). Crustaceana 63(2):169174.
Garcia, D.K. and Benzie, J.A.H. (1995). RAPD markers of potential use in penaeid prawn
(Penaeus monodon) breeding programs. Aquaculture 130:137-144.
133
Literature cited
Garcia, L.M.B. (1992). Lunar synchronization of spawning in sea bass, Lates calcarifer (Bloch):
effect of luteinizing hormone-releasing hormone analogue (LHRHa) treatment.
Aquaculture Department, Southeast Asian Fisheries Development Center, Tigbauan, Iloilo,
Philippines. J Fish Biology 40(3):359-370.
Geddes, M.C. (1980). The brine shrimps Artemia and Parartemia in Australia. In: The brine
shrimp Artemia. Vol. 3. Ecology, Culturing, Use in Aquaculture. G. Persoone, P.
Sorgeloos, O.A. Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium. pp. 57-65.
Gilchrist, B.M. (1956). The oxygen consumption of Artemia salina (L.) in different salinities.
Hydrobiologia 8:54-65.
Gilchrist, B.M. (1960). Growth and form of the brine shrimp Artemia salina (L.). Proc Zool Soc
Lond 134:221-235.
Goldschmidt, E. (1952). Fluctuation in chromosome number in Artemia salina. J Morphology
91(1):111-133.
Goyens, J.P. (1985). Artemia Research and its Applications. Opening Address. Proceedings of
the Second International Symposium on the brine shrimp Artemia, Vol. 3, Universa Press,
Wetteren, Belgium.
Grant, W.D. and Ross, H.N.M. (1986). The ecology and taxonomy of halobacteria. Grant, W.D.
and M., Kogut (eds.). EMBO-FEMS Workshop on the Molecular Basis of Haloadaptation
in Microorganisms, Obermarchtal (FRG). pp. 9-15.
Günther, R.T. (1890). Crustacea. In: Günther, R.T (ed) Contributions to the Natural History of
Lake Urmi, N.W. Persia and its neighbourhood. J linnean Soc (Zoology) 27:394-398.
Halfer-Cervini, A.M., Piccinelli, M., Prosdocimi, T. and Baratelli-Zambruni, L. (1968). Sibling
species in: Artemia (Crustacea: Brachiopoda). Evolution 22:373-381.
134
Literature cited
Hammer, U.T. (1986). Saline lake ecosystems of the world, Dordrecht, The Netherlands: Kluwer
Acad. Pub. Grp. 616p
Hammer, U.T., Haynes, R.C., Heseltine, J.M. and Swanson, S.M. (1975). The saline lakes of
Saskatchewan. Verh Internat Verein Limnol 19:589-598.
Harris, H. (1966). Enzyme polymorphisms in man. Proc R Soc Ser B 164:298-310.
Haslett, S.J. and Wear, R.G. (1985). Biomass estimation of Artemia at Lake Grassmere,
Marlborough, New Zealand. Aust J Mar Freshwater Res 36(4):537-557.
Haslett, S.J. and Wear R.G. (1986). General biomass estimation techniques applied to the
Artemia population of Lake Grassmere, Marlborough, New Zealand. pp.1-122.
Haxby, R.E. and Tackaert, W. (1987). Workshop report: Role of Artemia in solar salt operations.
In: Artemia research and its applications. Ecology, culturing, use in aquaculture. Vol. 3. G.
Persoone, P. Sorgeloos, O.A. Roels and E. Jaspers (eds). Universa Press, Wetteren,
Belgium. pp. 291-293.
Hay, D.E. (1990). Tidal influence on spawning time of Pacific herring (Clupea harengus pallasi).
Dep. Fish. and Oceans, Biol. Sci. Branch, Nanaimo, Canada. Can J Fish Aqua Sci
47(12):2390-2401.
Heath, H. (1924). The extemal development of certain phyllopods. J Morphol 38:453-483.
Hedgecock, D., Tracey, M.L. and Nelson, K. (1982). Genetics. In: The Biology of Crustacea.
Abele, L. G. (ed.), Academic Press, New York: 284-403.
Helfrich, P. (1973). The feasibility of brine shrimp production on Christmas Island. Sea Grant
Technical Report. UNIHI-SEAGRANT-TR-73-02. 172 p.
135
Literature cited
Hernandonena, A. (1974). Effects of salinity on nutritional requirements of Artemia salina. Biol
Bull 146(2):238-238.
Hontoria, F. and Amat, F. (1992a). Morphological characterization of adult Artemia (Crustacea,
Branchiopoda) from different geographical origins. American populations. J Plank Res
14(10):1461-1471.
Hontoria, F. and Amat, F. (1992b). Morphological characterization of adult Artemia (Crustacea,
Branchiopoda) from different geographical origin. Mediterranean populations. J Plankton
Res 14(7):949-959.
Hutchinson, G.E. (1937). Limnological studies in Indian Tibet Int Rev Hydrobiol 35:134-177.
Iriarte, A., deMadariaga, I., Diez-Garagarza, F., Revilla, M. and Orive, E. (1997). Primary
plankton production, respiration and nitrification in a shallow temperate estuary during
summer. Univ Pais Vasco; Ehu, Zientzi Fak, Ekol Lab Landare Fisiol and Ekol Saila, Bilbao;
Spain. Jan 3 1997. J Exp Mar Biol Ecol 208(1-2):127-151.
Isenmann, P. (1975). Observation sur la mouette pygmée (Larus minutus) en Camargue de 1971 à
1974. Terre et Vie 29(1):77-88.
Jellison, R., Dana, G.L. and Melack, J.M. (1995). Zooplankton cohort analysis using systems
identification techniques. J Plankton Res 17(11):2093-2115.
Jones, A.G., Ewing, C.M. and Melvin, M.V. (1981). Biotechnology of solar saltfields.
Hydrobiologia 82:391-406.
Kanazawa, A. (1991). Recent advances in penaeid shrimp nutrition in Japan. In: Proceedings of
Aquaculture Nutrition Workshop. Allan G.L. and W. Dall (eds). NSW Fisheries,
Brackishwater Fish Culture Research Station, Salamander Bay, Australia. pp. 64-72.
136
Literature cited
Kappas, I. (2001). Microevolution and genetic differentiation in brine shrimp Artemia. Ph.D.
Thesis, University of Wales Swansea, Wales, UK.
Kellogg, V.L. (1906). A new Artemia and its life conditions. Science N S 24:594-596.
Kirby, J.S. (1997). Influence of environmental factors on the numbers and activity of wintering
lapwings and golden plovers. Wildfowl and Wetlands Trust, Glos, England. British Trust
Ornithol, England. Bird-Study Mar 44(1):97-110.
Kuenen, D.J. (1939). Systematical and physiological notes on the brine shrimp, Artemia Arch
néerl Zool 3:365-449.
Kuenen, D.J. and Baas-Becking, L.G.M. (1938). Historical notes on Artemia salina (L.). Zool
Med 20:222-230.
Lavens, P. and Sorgeloos, P. (eds). (1996). Manual on the production and use of live food for
aquaculture. FAO Fisheries Technical Paper 361:175-180.
Lavens, P. and Sorgeloos, P. (1998). Present status and prospects of the use of Artemia cysts and
biomass in shrimp farming. Proceedings Aquaculture Brazil '98 Conference, Nov. Recife.
pp. 147-162.
Lavens, P. and Sorgeloos, P. (2000). The history, present status and prospects for the availability
of Artemia cysts for Aquaculture. Aquaculture 181:397-403.
Lavens, P., Léger, P. and Sorgeloos, P. (1989). Manipulation of the fatty acid profile in Artemia
offspring produced in intensive culture systems. In: Aquaculture-a biotechnology in
progress. N. De Pauw, E. Jaspers, H. Ackefors and N. Wilkins (eds). European
Aquaculture Society, Bredene, Belgium. pp. 731-739.
137
Literature cited
Leach, W.E. (1819). Entomostraca. In: Dictionaire des sciences naturelles 4:524-543.
Léger, Ph. and Sorgeloos, P. (1992). Optimized feeding regimes in shrimp hatchery. In: Marine
shrimp culture: principle and practices. Fast A.W. and L.J. Lester (eds). Elsevier sciences
Publisher BV, The Netherlands. pp. 225-244.
Léger, Ph., Bengtson, D.A., Simpson, K.L. and Sorgeloos, P. (1986). The use and nutritional
value of Artemia as a food source. Oceanogr Mar Biol Ann Rev 24:521-623.
Lenz, P.H. (1980). Ecology of an alkali-adapted variety of Artemia from Mono Lake, California,
USA. In: The Brine Shrimp Artemia. Vol. 3. Ecology, Culturing, Use in Aquaculture. G.
Persoone, P. Sorgeloos, O. Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium,
pp. 79-96.
Lenz, P.H. (1984). Life history analysis of an Artemia population in a changing environment. J
Plank Res 6(6):967-983.
Lenz, P.H. (1987). Ecological studies on Artemia: a review. In: Artemia Research and its
Applications. Vol. 3, Ecology, Culturing, Use in Aquaculture. P. Sorgeloos, D.A.
Bengtson, W.Decleir and E.Jaspers (eds), Universa Press, Wetteren, Belgium. pp. 5-18.
Lenz, P.H. and Browne, R.A. (1991). Ecology of Artemia. In: Artemia Biology. R.A. Browne,
P.Sorgeloos and C.N.A. Trotman (eds), CRC Press, Inc., Boca Raton, Florida, USA. pp.
237-253.
Lenz, P.H. and Dana, G.L. (1987). Life-cycle studies in Artemia: a comparison between a
sub-tropical and a temperate population. In: Artemia Research and its Applications. Vol.3.
Ecology, Culturing, Use in Aquaculture. P. Sorgeloos, D.A. Bengtson, W. Decleir and E.
Jaspers (eds). Universa Press, Wetteren, Belgium. pp. 89-100.
138
Literature cited
Lenz, P.H., Cooper, S.D., Melack, J.M. and Winkler, D.W. (1986). Spatial and Temporal
Distribution Patterns of Three Trophic Levels in a Saline Lake. November 1986. J Plank
Res 8(6):1051-1064.
Lepage, G. and Roy, C.C. (1984). Improved recovery of fatty acid through direct
transesterification without prior extraction or purification. J Lipid Res 25:1391-1396.
Lewontin, R.C. and Hubby, J.L. (1966). A molecular approach to the study of genic
heterozygosity in natural populations. II. Amount of variation and degree of heterozygosity
in natural population of Drosophila pseudoobscura. Genetics 54:595-609.
Lincoln, F.C. and Peterson, S.R. (1979). Migration of birds. Circular 16, U.S. Department of the
Interior, U.S. Fish and Wildlife Service, Washington, D.C. Northern Prairie Wildlife
Research
Center
Webpage:
http://www.npwrc.usgs.gov/resource/othrdata/
migratio/migratio.htm.
Löffler, H. (1961). Beitrage zur Kenntnis der Iranischen Binnengewasser. II. Regional Limnologische Studie mit besonderer Berucksichtigung Crustaceenfauna. Int Revue ges
Hydrobiol 44:227-276.
Löffler, H. (1964). Vogelzug und Crustaceenverbreitung. Zool Anz Suppl 29:311–316.
Lovejoy, N.R. (1998). Marine incursion into South America. Nature 396:421-422.
Lüdskanova, J. (1974). Die Entwicklung von Artemia salina L. in den Teichen der Salzgarten von
Burgas und Pomorije. Arch Hydrobiol 74(4):473-478.
Maeda-Martínez, A.M., Obregon-Barboza, H. and Dumont, H.J. (1992). Branchinecta belki n. Sp.
(Branchiopoda: Anostraca), a new fairy shrimp from Mexico, hybridizing with B. packardi
Pearse under laboratory conditions, Hydrobiologia 239:151-162.
139
Literature cited
Majié, A. and Vukadin, I. (1987). Preliminary report on the brine shrimp (Artemia) from
Yugoslav saltworks. In: Artemia research and its applications. Vol. 3. Ecology, Culturing,
Use in Aquaculture. P. Sorgeloos, D.A. Bengtson, W. Decleir and E. Jaspers (eds).
Universa Press, Wetteren, Belgium, pp. 357-372.
Marchant, R. and Williams, W.D. (1977). Population dynamics and production of a brine shrimp,
Parartemia zietziana Sayce (Crustacea: Anostraca) in two salt lakes in Western Victoria,
Australia. Aust J Mar Freshwater Res 28:417-438.
Marco, R., Garesse, R., Cruces, J. and Renart, J. (1991). Artemia molecular genetics, in R.A.
Browne, P. Sorgeloos and C.N.A. Trotman (eds.), Artemia Biology, CRC Press, Boca Raton,
Florida, pp. 1-19.
Margalef, R. (1953). Los crustáceos de las aguas continentales ibéricas. Inst. Forest. Invest. Exp.
Madrid (España). 243 p.
Margalef, R. (1983). Limnología. Ediciones Omega, Barcelona (España). 1010 p.
Martin, E.G. and Wilbur, B.C. (1921). Salt antagonism in Artemia. Amer J Physiol 55:290-291.
Mason, D.T. (1966). Density Current Plumes. Science, Washington D.C. 152:354-356.
Mayr, E. (1969). Principles of Systematic Zoology, McGraw-Hill, New York.
McCourt, R.P. (1987). The radiobiology of Artemia: a review. In: Artemia research and its
applications. Vol. 3. Ecology, Culturing, Use in Aquaculture. P. Sorgeloos, D.A. Bengtson,
W. Decleir and E. Jaspers (eds). Universa Press, Wetteren, Belgium. pp 278-308.
Mianping, Zheng. (1997). An introduction to saline Lakes on the Qinghai - Tibet plateau.
Dumont, H.J. and Werger, M.J.A. (eds.). Kluwer Academic Publishers, Dordrecht, The
Netherlands.
140
Literature cited
Millamena, O.M., Bombeo, R.F., Jumalon, N.A., and Simpson, K.L. (1988). Effects of various
diets on the nutritional value of Artemia sp. as food for the prawn Penaeus monodon. Mar
Biol 98:217-221.
Mitrofanov, Y.A., Ivanofsky, Y.A. and Lesnikova, L.N. (1982). Chromosome numbers and
karyotypes of some populations of Artemia salina. Physio Gene 4:11-14.
Mitrofanov, Y.A., Otradnova, V.V. and Val'vach, A.A. (1976). The karyotype of Artemia salina.
Tsitologia 18:233-237.
Mura, G. (1986). SEM morphological survey on the egg shell in the italian Anostracans
(Crustacea, Branchiopoda). Hydrobiologia 134:273-286.
Naessens, E., Van Hauwaert, A., Cobo, M.L., Townsend, S., Ramos, X., Wouters, R. and Lavens,
P. (1995). Dietary (n-3) HUFA and DHA/EPA requirements of Penaeus vannamei
postlarvae. In: LARVI ’95. Fish and Shellfish Larviculture Symposium. P. Lavens, E.
Jaspers and I. Roelants (eds). European Aquaculture Society Special Publication No. 24,
Ghent, Belgium.
Nakanishi, Y. H., Iwasaki, T., Okigaki, T. and Kato, H. (1962). Cytological studies of Artemia
salina. I. Embryonic development without cell multiplication after the blastula stage in
encysted dry eggs. Annot Zool Japan 35:223-228.
Narciso, L., Pousao-Ferreira, P., Passos, A. and Luis, O. (1999). HUFA content and DHA/EPA
improvements of Artemia sp. with commercial oils during different enrichment periods.
Aqua Res 30(1):21-24.
Nascimento, I.A., Bray, W.A., Trujillo, J.R.L. and Lawrence, A. (1991) Reproduction of ablated
and unablated Penaeus schmitti in captivity using diets consisting of fresh-frozen natural
141
Literature cited
and dried formulated feeds. Institute of Biology, Federal University of Bahia, Salvador,
Brazil. Aquaculture ‘99: 3(4):387-398.
Nei, M. (1972). Genetic distance between populations. Am Nat 106:283-292.
Nelson, K. and Hedgecock, D. (1980). Enzyme polymorphism and adaptive strategy in the
decapod Crustacea. Am Nat 116: 238-280.
Newmark, R.F. (1988). Comparación experimental de la producción de biomasa y quistes de las
cepas colombianas de Artemia (Galerazamba, Manaure y Pozos Colorados) con
anotaciones sobre sus estrategias reproductivas. M.Sc. Thesis. Universidad Nacional de
Colombia, Facultad de Ciencias, Santa Marta, Colombia.
Nimura, Y. (1967). Biology of the brine shrimp. (Japanese). Bull Jap Soc Sci Fish 33(7):690-702.
Nyonje, B.M., Munga, D. and Radull, J. (1995).
Benefits of Artemia production in solar
saltworks: A case study. Fisheries Soc. of Africa. First Pan African Fisheries Congress on
Sustainable Development of Fisheries in Africa, Nairobi (Kenya), 31 Jul - 4 Aug 1995, p.
72-73.
Odum, E.P. (1986). Fundamentos de Ecología. Primera edición en Español. Interamericana.
México. 422 p.
Ogilvie, M. and Ogilvie, C. (1986). Flamingos. Alan Sutton Publishing Limited. pp. 95–103.
Olaveson, M. (2000). An examination of the relationships between microorganisms and their
environment.
Course
notes.
University
of
Webpage:http://citd.scar.utoronto.ca/BGYC55/Eval-2001.htm
142
Toronto,
Canada.
Literature cited
Oliveira, V.M. (1985). Caracterizaçao ecologica de uma salina em funcionamento. Aveiro.
Seminario do 5° ano do curso de Biologia. Facultade de Ciencias. Universidade do Porto,
Potugal (no publicado). 113 p.
Orr, M.H. and Smith, T.B. (1998). Ecology and speciation, Trend Ecol Evol 13:502-506.
Papeschi, A.G., Cohen, R.G., Pastorino, X.I. and Amat, F. (2000). Cytogenetic proof that the
brine shrimp Artemia franciscana (Crustacea, Branchiopoda) is found in Argentina,
Hereditas 133:159-166.
Parker, G.H. (1900). Lake Urmia. Am Nat 34:315.
Pavlovich, J.B. (1998). The in-situ extraction of halobacteria within brine inclusions from
bedded salt deposits; a new approach for the isolation of microorganisms within halite.
B.Sc. Thesis. Princeton University. Princeton, N.J., U.S.A. 66 p.
Perez, M.L., Valverde, J.R., Batuecas, B., Amat, F., Marco, R. and Garesse, R.
(1994).
Speciation in the Artemia genus: mitochondrial DNA analysis of bisexual and
parthenogenetic brine shrimps, J Molec Evol 38:156-168.
Persoone, G. and Sorgeloos, P. (1980). General aspects of the ecology and biogeography of
Artemia. p. 3-24. In: The brine shrimp Artemia. Vol. 3. Ecology, Culturing, Use in
aquaculture. Persoone, G., Sorgeloos, P. and Jaspers, E. (eds). Universa Press, Wetteren,
Belgium. 428 p.
Pet, J.S., Vandensen, W.L.T., Machiels, M.A.M., Sukkel, M., Setyohadi, D., Tumuljadi, A.
(1997). Catch, effort and sampling strategies in the highly variable sardine fisheries around
East Java, Indonesia Agr Univ Wageningen; Dept Fish Culture and Fisheries, Wageningen
Inst Anim Sci, Wageningen, Netherlands. Jul, 31 Fish Res (1-2):121-137.
143
Literature cited
Piccinelli, M. and Prosdocimi, T. (1968). Descrizione tassonomica delle due specie Artemia
salina L. Artemia persimilis. Rend. Inst. Lomb. Sci Lett Classe Sci 102(B):113-118.
Pilla, E.J.S. (1992). Genetic differentiation and speciation in Old World Artemia. Ph.D. Thesis,
University of Wales, Swansea, UK. 356p.
Pilla, E.J.S. and Beardmore, J.A. (1994). Genetic and morphometric differentiation in Old World
bisexual species of the brine shrimp (Artemia). Heredity 72: 47-56.
Pinzón, O. and Rozo, M. (1983). Informe de Actividades desarrolladas concernientes al estudio
de factibilidad sobre la explotación comercial del Camarón salmuera, Artemia salina,
Galerazamba, UNIANDES.
Por, F.D. (1980). A classification of hypersaline waters, based on trophic criteria. Mar Ecol Prog
Ser 1:121-131.
Post, F.J. and Youssef, N.N. (1977). A prokaryotic intracellular symbiont of the Great Salt Lake
brine shrimp Artemia salina (L.). Can J Microbiol 23(9):1232-1236.
Proctor, V.W. (1964). Viability of crustacean eggs recovered from ducks. Ecol 45(3):656–658.
Provasoli, L. and Pintner, I.J. (1980). Biphasic particulate media for the culture of filter-feeders.
In: The brine shrimp Artemia. Vol. 3. Ecology, Culturing, Use in Aquaculture. G. Persoone,
P. Sorgeloos, O. Roels and E. Jaspers (eds). Universa Press, Wetteren, Belgium. pp 47-54.
Rada, O.C. (2001). Evaluación de la calidad de los quistes de Artemia (Crustacea, Anostraca) de
Manaure, Galerazamba, Salina Cero y Tayrona (Caribe Colombiano) de uso potencial en
la acuacultura. B.S. Thesis. Universidad del Atlántico, Facultad de Biología, Barranquilla,
Colombia.
144
Literature cited
RAMSAR. (1996). A Directory of Wetlands of International Importance. The Ramsar Library,
6th
edition,
Ramsar
web
page,
1999,
http://www.wetlands.org/RDB/Ramsar_Dir/Chile/Cl004d99.doc
Rawson, D.S. and More, J.E. (1944). The saline lakes of Saskatchewan. Can J Res 22:141-201.
Rees, J.F., Cure, K., Pyatiratitivorakul, S., Sorgeloos, P. and Menasveta, P. (1994). Highly
unsaturated fatty acid requirements of Penaeus monodon postlarvae: an experimental
approach based on Artemia enrichment. Aquaculture 122:193-207.
Requintina, P.J.D. and Simpson, K.L. (1987). International Study on Artemia. XLV. Geographical
and developmental changes in isozymes of Artemia as separated by isoelectrofocusing. In:
Artemia Research and its Applications. Vol. 2. Physiology, Biochemistry, Molecular
Biology. P. Sorgeloos, D.A. Bengtson, W. Decleir and E. Jaspers (eds). Universa Press,
Rodríguez-Gil, S., Papeschi, A.G. and Cohen, R.G. (1998). Mitotic and meiotic chromosomes of
Artemia (Branchiopoda) from populations of La Pampa Province, Argentina, J Crustac Biol
18:36-41.
Román, M and Rodriguéz, A. (1986). Cultivo de Artemia en estanques de salinas de Cádiz
(España). Inv Pesq 50(3):407-419.
Rooth, J. (1965). The flamingos on Bonaire. Habitat, diet and reproduction of Phoenicopterus
ruber ruber. Natuurwetenschappelijke Studiekring Voor Suriname en de Nederlandse
Antillen, Utrecht. No. 41:5-13.
Rozo, M. and Pinzón, O. (1982). Artemicultura en las salinas de Galerazamba, en Bolívar,
Colombia, PROANDES.
145
Literature cited
Rozo, M. and Pinzón, O. (1983). Artemicultura en las salinas de Manaure y Galerazamba.
Universidad de los Andes e Instituto de Fomento Industrial (IFI). Bogotá, Colombia. pp.
40-42.
Samter, M. and Heymons, R. (1902). Die variationen bei Artemia salina Leach, und ihre
Abhangigkeit von ausseren Einflüssen. Abh. preuss. Akad. Wiss. 2:1-62.
Sato, N.L. (1967). Enzymatic contribution to the encystment of Artemia salina. Sci Rep Tohoku
Univ 33:319-327.
Schindler, D. (1977). The evolution of phosphorous limitation in lakes. Science 1995:260-262.
Schmankewitsch, W.J. (1875). Ueber das verhaltniss der Artemia salina Miln. Edw. zur Artemia
muhlhausenii Miln. Edw. und dem Genus Branchipus Schaeff. Z Wiss Zool Suppl
25:13-116.
Schmankewitsch, W.J. (1877). Zur Kenntniss der Einflusses der ausseren Lebensbedingungen auf
die Organisation der Thiere. Z Wiss Zool 29:429-494.
Schrehardt, A. (1987a). A scanning electron-microscope study of the post-embryonic
development of Artemia. In: Artemia Research and its Applications. Vol. 1. Morphology,
Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A. Bengtson, W. Decleir and
E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 5-32.
Schrehardt, A. (1987b). Ultrastructural investigations of the filter-feeding apparatus and the
alimentary canal of Artemia. In: Artemia Research and its Applications. Vol. 1.
Morphology, Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A. Bengtson,
W. Decleir and E. Jaspers (eds). Universa Press, Wetteren, Belgium, pp. 33-52.
Seidel, C.L. and Simpson, K.L. (1984). Rapid identification of Artemia spp. populations by thin
layer isoelectrofocusing. Aquacult Eng 3:303-316.
146
Literature cited
Seidel, C.R, Krymowek, J. and Simpson, K.L. (1980). International Study on Artemia. XI.
Amino acid composition and electrophoretic protein patterns of Artemia from five
geographical locations. In: The brine shrimp Artemia. Vol. 3. Ecology, Culturing, Use in
Aquaculture. G. Persoone, P. Sorgeloos, O. Roels and E. Jaspers (eds). Universa Press,
Sherif, M.S. (1989). Comparative studies of Egyptian Artemia (Crustacea, Anostraca). Ph.D.
Thesis, Suez Canal University. 166 p.
Slinn, D.J. (1974). Water circulation and nutrients in the North-West Irish Sea. Liverpool Univ.
(England). Dept. of Marine Biology. Estuarine and Coastal Marine Science, 2(1):1-25.
Smith, V. (1983). Low nitrogen to phosphorous ratios favor dominance by blue-green algae in
lake phytoplankton. Science 22:669-671.
Sokal, R.R. and F.J. Rohlf. (1995). Biometry: The Principles and Procedures of Statistics in
Biological Research. 3 ed. W.H. Freeman, San Francisco.
Soliveri, J., Arias, M.E. and La Borda, F. (1984). Estudio de bacterias halofilas extremas aisladas
de habitats salinos no litorales. Microbiol Españ 37:17-25.
Solovov, V.P. and Studenikina, T.L. (1992). Osobennosti dinamiki chislennosti populyatsii
zhabronogogo rachka Artemia salina (L.) v ozerakh Yugo-Zapadnoj Sibiri i perspektivy
ispol'zovaniya ego resursov. Novosib. Otd., Barnaul, Russia. J Gidrobiol Zh Hydrobiol
28(2):33-41.
Sorgeloos, P. (1980). Life history of the brine shrimp Artemia. In: The brine shrimp Artemia.
Vol.1, G. Persoone, P. Sorgeloos, O. Roels and E. Jaspers (eds), Universa Press, Wetteren,
Belgium. pp. 19-23.
147
Literature cited
Sorgeloos, P. (1983). Brine shrimp Artemia in coastal saltworks: inexpensive source of food for
vertically integrated aquaculture. Aqua. Mag. 9:25-27.
Sorgeloos, P. (1995). Artemia cyst shortage: the Artemia Reference Center’s point of view.
Larviculture & Artemia Newsletter 35:19.
Sorgeloos, P. Baeza-Mesa, M., Benijts, F. and Persoone, G. (1975). Research on the culturing of
the brine shrimp Artemia salina L. at the State university of Ghent (Belgium). pp. 473-495.
Sorgeloos, P., Lavens, P., Léger, P., Tackaert, W. and Versichele, D. (1986). Manual for the
culture and use of brine shrimp Artemia in aquaculture. State University of Ghent, Belgium,
319 p.
Sorgeloos, P., McCourt, P., Lavens, P., Spektorova, L. and Khalaf, A.N. (1980). Updated
bibliography on the brine shrimp Artemia. Bredene: European maricultue society, IZWO. 1274.
Sprunt, A. (1976). A new Colombian site for the American flamingo (Phoenicopterus ruber).
C.C.A. Ecology Conference Bonaire, September 1975. Netherlands Antilles National Parks
Foundation “STINAPA” No. 11. Curaçao.
Stefani, R. (1963). La digametria femminile in Artemia salina Leach e la constituzione del
corredo cromosomico nei biotipi salini di Cagliari. Caryologia 16(3):625-636.
Stefani, R. (1964). L'origine dei maschi nelle populazione parthenogenetiche di Artemia salina.
Riv Biol 21:74-87.
Stella, E. (1933). Phaenotypical characteristics and geographical distribution of several biotypes
of Artemia salina L. Z. indukt. Abstamm -u Vererbungslehre 65:412-446.
148
Literature cited
Sun, Y., Song, W.Q., Zhong, Y.C., Zhang, R.S. and Chen, R.Y. (2000). Phylogenetic study of
Artemia from China using RAPD and AFLP markers. Acta Gen Sinica 27(3):210-218.
Sun, Y., Su, X. and Sun, G. (1995). Relationships between biological characteristics and
chromosomal ploidy in Artemia from the coast of China. Thai J Aquacult Sci 2:1-10.
Suyama, I. and Iwasaki, T. (1976). Radiation-induced life span shortening of Artemia under
different temperature conditions. Exp Gerontol 11:133-140.
Tabachnick, B.G. and Fidell, L.S. (1989). Using Multivariate Statistics.
Harper Collins
Publishers, Inc., Second ed. California State University. p. 746.
Tackaert, W. and Sorgeloos, P. (1991). Semi-intensive culturing in fertilized ponds, In: Artemia
Biology R.A. Browne, P. Sorgeloos and C.N.A. Trotman (eds), CRC Press, Boca Raton,
Florida, pp. 287-315.
Tackaert, W. and Sorgeloos, P. (1993).
The use of brine shrimp Artemia in biological
management of solar salt works. Proc.7th Intl. Symposium on Salt, Kakihana 1:617-622.
Tackaert, W., Vanhaecke, P. and Sorgeloos, P. (1987). Preliminary data on the heritability of
some quantitative characteristics in Artemia. In: Artemia Research and its Applications.
Vol. 1. Morphology, Genetics, Strain characterization, Toxicology. P. Sorgeloos, D.A.
Bengtson, W. Decleir and E. Jaspers (eds). Universa Press, Wetteren, Belgium. pp. 241248.
Templeton, A.R. (1989). The meaning of species and speciation: a genetic perspective, In:
Speciation and its Consequences, D. Otte and J.A. Endler (eds.), Sinauer Associates Inc.,
USA, pp. 3-27.
Thomas, K.M. (1995). Genetic variation and differentiation in Asian populations of Artemia.
Ph.D. Thesis, U. of Wales, U.K. 265p.
149
Literature cited
Tobias W.J., Sorgeloos P., Roels O.A., Sharfstein B.A. (1980). International study on Artemia.
XIII. A comparison of production data of 17 geographical strains of Artemia in the St.
Croix artificial upwelling- mariculture system. pp. 384-392.
Tobón, F. (1988). Alimentación del Colossoma macropomum con biomasa de Artemia. B.S.
Thesis. Departamento de Ing. Pesquera, Universidad del Magdalena, Santa Marta,
Colombia.
Toetz, D. and Mc Farland, M. (1987). Lake loading ratios N:P and lacustrine nitrogen fixation.
Water Resources Bull 23:239-241.
Tomlinson, G.A. and Hochstein, L.I. (1976).
Halobacterium saccharovorum sp. Nov. a
carbohydrate-metabolizing extremely halophyllic bacterium. Can J Microbiol 22:587-591.
Triantaphyllidis, G.V. (1996). Characterization of different populations of Artemia spp.
(Crustacea, Anostraca). Ph.D. Thesis. Ghent University, Belgium, 320 p.
Triantaphyllidis, G.V., Abatzopoulos, T. and Sorgeloos, P. (1998). Review of the biogeography
of the genus Artemia (Crustacea, Anostraca). J biogeography 25:213-226.
Triantaphyllidis, G.V., Criel, G.R., Abatzopoulos, T. and Sorgeloos, P. (1996). International
study on Artemia. LIII Morphological study of Artemia with emphasis to Old World
Strains. I. Bisexual populations. Int. Symp. on Saline Lakes.
Triantaphylidis, G.V., Criel, G.R., Abatzopoulos, T.J., Thomas. K.M., Peleman, J., Beardmore,
J.A. and Sorgeloos, P. (1997). International Study on Artemia LVII. Morphological and
molecular characters suggests conspecificity of all bisexual European and North American
Artemia populations. Mar Biol 129:477-487.
150
Literature cited
Vanhaecke, P. and Cooreman, A. (1979). Vergelijkende studie van de geographische rassen van
het pekelkreeftje, Artemia salina (L.) Jaarverslag F.K. K.O. 2.0010.78.
Vanhaecke, P. and Sorgeloos, P. (1980a). International Study on Artemia. XIV. Growth and
survival of Artemia larvae of different geographical origin in a standard culture test. Mar
Ecol Prog Ser 3(4):303-307.
Vanhaecke, P. and Sorgeloos, P. (1980b). International study on Artemia. IV. The biometrics of
Artemia strains from different geographical origin. In: The brine shrimp Artemia. Ecology,
culturing, use in aquaculture. G. Persoone, P. Sorgeloos, O.A. Roels and E. Jaspers (eds).
Universa Press, Wetteren, Belgium. pp. 393-405.
Vanhaecke, P. and Sorgeloos, P. (1982). International study on Artemia. XVIII. The hatching
rate of Artemia cysts - A comparative study. Aquac Eng 1(4):263-273.
Vanhaecke, P. and Sorgeloos, P. (1989). International study on Artemia. XLVII. The effect of
temperature on cyst hatching larval survival and biomass production for different
geographical strains of brine shrimp Artemia spp. Annls Soc r zool Belg 119:7-23.
Vanhaecke, P., Siddall, S.E. and Sorgeloos, P. (1984). International study on Artemia XXXII
Combined effects of temperature and salinity on the survival of Artemia of various
geographical origin. J Exp Mar Biol Ecol 80:259-275.
Vanhaecke, P., Tackaert, W. and Sorgeloos, P. (1987). The biogeography of Artemia: an updated
review. In: Artemia Research and its Applications. Vol. 1. Morphology, Genetics, Strain
characterization, Toxicology. P. Sorgeloos, D.A. Bengtson, W. Decleir and E. Jaspers
(eds). Universa Press, Wetteren, Belgium. pp. 129-155.
Van Stappen, G. (In press). Zoogeography. Chapter IV. In: Abatzopoulos, Th., Beardmore, J.A.,
Clegg, J.S. and Sorgeloos, P. (eds). “Artemia: basic and applied biology”. Kluwer Academic
Publishers, Dordrecht, the Netherlands. 2002.
151
Literature cited
Van Stappen, G. and Sorgeloos, P. (1993). The cosmopolitan brine shrimp Artemia. INFOFISH
International. 4:45-50.
Van Stappen, G., Fayazi, G. and Sorgeloos, P. (2002). International Study on Artemia LXIII.
Field study of the Artemia urmiana (Günther, 1890) population in Lake Urmiah, Iran.
Hydrobiologia. In press.
Vargas, M.T. (1948). Anotaciones históricas del Magdalena. Ed. Lumen. Bogotá, Colombia.
Ventura, B. (1963). L’ammissi tra I biotopi diploide parthenogenetico in Artemia salina Leach e
la comparsa di maschi in populazioni parthenogenetiche. Rc Semin Fac Sci Univ Cagliari
33:51-54.
Verrill, A.E. (1869). Contributions to zoology from the museum of Yale College. III.
Descriptions of some new American phyllopod Crustacea. Amer J Science Arts Ser
2(43):244-254.
Vieira, N.R. (1989). Contribuçao para o conhecimiento da biologia de Artemia sp. das salinas
de Aveiro. Sua importância em aquacultura ena dinâmica daquele ecossistema. Tesis de
doctorado. Fac. Ciencias. Univ. do Porto, Porto, Portugal. 324 p.
Vieira, N.R., Castro, T.B. and Vera, V. (Unpublished work). Determination of orthophosfates in
hypersaline environments. Fac. Ciencias. Univ. do Porto, Porto, Portugal.
Vos, J. (1979). Brine shrimp Artemia salina inoculation in tropical salt ponds; A preliminary
guide for use in Thailand. FAO report THA/75/008/WP/3, 43 p.
Vos, J. and De La Rosa, N.L. (1980). Manual on Artemia production in salt ponds in the
Philippines. FAO/UNDP-BFAR, 1-48.
152
Literature cited
Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van de Lee, T., Hornes, M. Frijters, A. Pot, J.,
Peleman, J., Kuiper., M. and Zabeau, M. (1995). AFLP: A new concept for DNA
fingerprinting. Keygene N.V., Wageningen, The Netherlands.
Warren, H., Kuenen, D., and Baas Becking, L.G.M. (1938). On the relation between internal and
external medium in Artemia salina (L.)., Amsterdam. Proc Kon Akad Wetensch
41:873-878.
Watanabe, T. (1993). Importance of docosohexanoic acid in marine larval fish. J World Aq Soc
24:152-161.
Watanabe, T., Oowa, F., Kitajima, C. and Fujita, S. (1978). Nutritional quality of brine shrimp,
Artemia salina, as a living feed from the viewpoint of essential fatty acids for fish. Bull Jap
Soc Sci Fish 44:1115-1121.
Watanabe, T., Oowa, F., Kitajima, C. and Fujita, S. (1980). Relationship between dietary value of
brine shrimp Artemia salina and their content of w3 highly unsaturated fatty acids. Bull Jap
Soc Sci Fish 46:35-41.
Wear, R.G. and Haslett, S.J. (1986). Effects of temperature and salinity on the biology of Artemia
franciscana Kellogg from Lake Grassmere, New Zealand. I. Growth and Mortality. J exp
mar Biol Ecol 98:153-166.
Wear, R.G., Haslett, S.J. and Alexander, N.L. (1986). Effects of temperature and salinity on the
biology of Artemia franciscana Kellogg from Lake Grassmere, New Zealand. II.
Maturation, fecundity and generation times. J exp mar Biol Ecol 98:167- 183.
Weisz, P.B. (1946). The space time pattern of segment formation in Artemia salina. Biol Bull
91:119-140.
153
Literature cited
Welsh, J. and McClelland, M. (1990). Firgerprinting genomes using PCR with arbitrary primers.
Nucleic Acid Res 18:7213-7218.
Werding, B. and Erhardt, H. (1976). Formaciones coralinas en la Ensenada de Chengue.
Colombia. Corales y arrecifes coralinos. H. Von Prahl and H. Erhardt (eds). Fondo para la
Protección del Medio Ambiente “José Celestino Mutis” FEN Colombia. Bogotá, 1985. pp.
240-244.
Wheeler, R., Yudin, A.I. and Clark, W.H. Jr. (1979). Hatching events in the cysts of Artemia
salina. Aquaculture 18:59-67.
Williams, B.F. and Mitchell, S.A. (1992). The effect of salinity on the reproductive
characteristics of parthenogenetic Artemia from South Africa. Water S.A., Pretoria.
18(3):181-184.
Williams, G.K., Kubelik, A.R. Livak, K.L., Rafalski, J.A. and Tingey, S.V. (1990). DNA
polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acid
Res 18:6531-6535.
Wiman, F.H. (1979). Mating patterns and speciation in the fairy shrimp genus Streptocephalus.
Evolution 33:172-181.
Winkler, D.W. (ed) (1977). An ecological study of mono Lake, California. The Mono Basin
Research Group. University of California, Davis, USA. Institute of Ecology, Publication No.
12. June, 1977. 190 p.
Young, G. and Royan, J. (1997). The Artemia Project. A technical review. Scientific Research
Council. Kingston, Jamaica. 20 p.
Zapata, C., Gajardo, G. and Beardmore, J.A. (1990). Multilocus heterozygosity and sexual
selection in the brine shrimp Artemia franciscana. Mar ecol prog Ser 62:211-217.
154
Literature cited
Zuñiga, O., Wilson, R., Amat, F. and Hontoria, F. (1999). Distribution and characterization of
Chilean populations of the brine shrimp Artemia (Crustacea, Branchiopoda, Anostraca), Int J
Salt Lake Res 8:23-40.
155
Summary
Chapter 1 (Introduction and General objectives) reviews the actual state of the Artemia
industry worldwide and highlights the past research studies on Colombian Artemia.
Chapter 2 (Literature review) reviews the Artemia literature related to this thesis: biology
and ecology, life history and population dynamics, water chemistry, biogeography, taxonomy,
cytogenetics, electrophoretical analysis and DNA markers, morphometry, reproductive isolation,
importance in aquaculture and saltworks, factors determining Artemia quality for aquaculture and
population distribution patterns.
Chapter 3 (Artemia survey in the Colombian Caribbean and morphometric analysis)
explores the present state of Artemia stocks in Colombia, reviews the actual biotopes of
Colombian Caribbean Artemia populations, together with biometric measurements, FAME
analysis, morphometric discriminant multivariate analysis of the main populations as a tool to
differentiate these populations, as well as to select key traits for taxonomic and management
purposes. The information gathered on the physicochemical parameters allowed to further
characterize these extreme habitats as a contribution to the knowledge of A. franciscana habitats
which are complex ecosystems. The ionic content analysis shows that all habitats sampled are
predominantly chloride rich as expected, because of their thalassohaline (marine) origen. The
application of biometric tools to determine possible cyst and nauplius size differences among the
different Colombian populations was successful at further separating some of the most promising
Artemia populations for potential aquaculture use. Cysts from Tayrona have shown to be the
smallest among the Colombian populations studied, followed by Galerazamba, Kangarú,
Manaure, Salina Cero and Pozos Colorados. The chorion thickness biometrical analysis shows
Galerazamba to have the thinnest shell, followed by Tayrona, Salina Cero, Manaure, Pozos
Colorados and Kangarú. Additionally, nauplii from Galerazamba present a small size followed
by Manaure, Salina Cero, Pozos Colorados and Tayrona. The determination of FAME from
Manaure, Galerazamba, Salina Cero and Tayrona, suggested high EPA and low DHA, as well as
a low DHA/EPA ratio (<0.1). Hence, all four populations sampled are considered suitable for
marine aquaculture only if fortified with DHA rich emulsions, according to actual quality
standards for Artemia. The discriminant analysis based on morphometric characters, assigns male
S-1
Summary
and female individuals into their proper population group (North American and Caribbean coast)
to which they belong by only one discriminant function (100% confidence). However, male
morphometric characters are a better criterion to separate population groups than the female
characters, since they allow grouping all Colombian populations according to their actual
geographical Caribbean coast location, whereas the SFB population falls into the North American
group, with no overlapping between both, as it happens with females. Similarly, for Artemia
populations classified by their geographic origin, male and female individuals again separate the
Colombian populations from the North American (SFB) populations, but separating Salina Cero
from the Colombian populations. However, male measured variables ‘correctly’ assigned the
membership to Colombian Caribbean populations according to actual geographical distances with
some expected overlapping among the Colombian populations. According to the analysis, the
Salina Cero male population is similar to the geographically neighboring Galerazamba population
and it is also related to the other Colombian populations. Moreover, this is consistent with the
findings using RAPDs (Chapter 5) and may be explained by the existence of a geographic barrier
(Sierra Nevada de Santa Marta). Similarly, the discriminant function 1 for male individuals
separates Galerazamba and Salina Cero populations from the other Colombian Caribbean
populations (Manaure and Tayrona), although some overlapping is still present.
Chapter 4 (Effects of environmental variables on the reproduction of some Colombian
strains) explores both experimentally and in situ the reproductive performance of Artemia
populations from the largest Colombian saltworks, and draws parallels between the in vitro and in
situ outcomes. Physicochemical and meteorological data were collected monthly to analyze it
later using multivariate discriminant analysis with monthly biomass and cyst production potential
at each location surveyed. Standard cyst quality evaluation parameters were applied to cysts
collected during a two-year period in different Colombian locations.
The results for the
reproductive experiments (mean cyst production per female) do not entirely agree with the
estimated cyst production potential at each site (in situ results). This difference may be due to the
in situ interaction among the three parameters (salinity, percent O2 saturation, and nitrate) on cyst
production, particularly in the case of Salina Cero. Similarly, nitrate levels might be correlated to
salinity. Another possible explanation to these contradictory results could be the controlled
conditions used (i.e. ad libitum feeding not often observed in nature).
S-2
The latter may be
Summary
supported, in part, by the observation of low nitrate levels during the peak of cyst production
during this study. The outcome of the population distribution study, shows Manaure,
Galerazamba and Salina Cero as having a stable mean population distribution with a balanced
adult (38%, 36% and 19%, respectively) to juvenile+nauplius proportion (62%, 64% and 81%,
respectively), as well as a stable female:male sex ratio (1:0.84, 1:0.88 and 1:0.84, respectively).
In contrast, Tayrona exhibits an unstable population distribution with a high proportion of adults
(82%) and low juvenile+nauplius (18%) and low female:male ratio (0.88:1), thus recruitment of
the juvenile and nauplius cohort to assure continuity (survival) of the species in this biotope is
below sustainable levels. Finally, the cyst quality study, conducted on cyst batches, collected
irregularly from four populations, shows that cyst collection and processing techniques need to be
improved in order for them to be suitable for the growing Colombian aquaculture industry.
Chapter 5 (Preliminary genetic data on some Caribbean Artemia franciscana strains
based on RAPDs) presents the genetic relationships among some Artemia populations in the
Caribbean, including two “foreign” blanks (SFB and A. persimilis) using RAPD genetic markers.
These markers generated two similar dendrograms with the same separation for the two
Caribbean population clusters (middle Caribbean: Pozos Colorados, Tayrona, Manaure,
Venezuela-PAV, Bonaire and Curaçao; lower Caribbean: Galerazamba and Salina Cero).
Moreover, the clustering pattern obtained suggests that the populations in these two clusters are
not genetically identical. Additionally, the Colombian samples from Manaure and Galerazamba
that were collected almost a decade apart and which were probably subjected to different
prevailing environmental conditions, were very highly correlated according to Pearson’s
coefficient. Further, the splitting of the Artemia populations from Colombia coincides with the
existence of a geographical barrier in Colombia named the Sierra Nevada de Santa Marta. The
Sierra Nevada might constitute a geographic barrier to shorebirds and hence prevented Artemia
cyst dispersal to the south. Thus, the difference between the two groups could be attributed to
isolation, or lack of genetic flow due to this physical barrier. Finally, the dendrograms also
illustrate the relationship of the five Colombian, the Puerto Araya (Venezuela), Bonaire and
Curaçao populations to other A. franciscana populations. Moreover, the Puerto Rican and San
Francisco Bay populations have been demonstrated to be further apart than the five Colombian,
S-3
Summary
the Venezuelan and the other Caribbean (Bonaire and Curaçao) populations. Yet, all these
populations, considered to be A. franciscana, are very distinct from A. persimilis.
Chapter 6 (Cycles influencing Artemia pond distribution) explores the relationships
between medium-term cycles (lunar cycles), short-term cycles (sampling time) and Artemia pond
distribution.
Additionally, this chapter discusses the cyclic ecological behavior of Artemia
influenced by temperature and dissolved oxygen. Apparently, as deduced from the influence of
lunar cycles and sampling time study the conglomerates formed by brine shrimp are
asynchronous. Thus, no circaseptan (cycles lasting 7 to 8 days) rhythmicity is statistically
compatible with the density of Artemia at any of the two sampling years. Further, light intensity
differentials between full and new moon phases (not statistically significant) and sunrise and
sunset (statistically significant) can possibly have an effect on the gregarious behavior of
Artemia. These results could explain the ontogeny of behavioral responses of Artemia on the
presence of its most common natural predator, wading birds. Artemia is a slow swimming
organism, being an easy prey during bright nights (full moon) and dusk compared to dark nights
(new moon) and dawn. Likewise, the disruption of the gregarious (cluster forming) behavior that
could account for this circadian (cycles exhibiting approximately 24-hour periodicity) migration
are: 1) synodic (period for the Moon to complete a revolution relative to the Earth-Suns line)
lunar cycle, 2) circaseptan harmonics and 3) the four-hour interval sampling. Additionally, the
strong influence of temperature over Artemia density has been clearly noticed, and is a masking
factor over the possible effects of any particular lunar phase over Artemia density. Additionally,
temperature together with salinity are determinant on the amount of dissolved oxygen present at
any given sampling interval, and will evoke Artemia migration towards lower temperature.
Further, variations in temperatures (max./min.) were higher during full moon than during new
moon, being a clear influential parameter on Artemia distribution on the water column at night
(cooler temperatures) compared to daytime (warmer temperatures). Finally, the authors
recommend conducting Artemia surveys preferably late in the evening or alternatively during
early morning since Artemia tends to distribute more uniformly during the evening (dark and
cool), when water temperature is lower, particularly in saltworks, where the evaporation basins
are shallow.
S-4
Summary
Chapter 7 (Conclusions and Perspectives) briefly discusses the results obtained in this
work in the framework of the research objectives. Further, it draws conclusions and presents
perspectives for future research related to the subjects in this thesis.
S-5
Samenvatting
Hoofdstuk 1 (Inleiding en Algemene doelstelling) bespreekt de huidige situatie in de
Artemia industrie, wereldwijd, en benadrukt daarin het onderzoek op de Colombiaanse Artemia.
Hoofdstuk 2 (Literatuuroverzicht) bespreekt de literatuur over Artemia met betrekking tot
deze thesis : biologie en ecologie, levenscyclus en populatiedynamiek, de chemie van water,
biogeografie, taxonomie, cytogenetica, electroforetische analyse en DNA markers, morfometrie,
geïsoleerde reproductie, belang in de aquacultuur en bij zoutontginning, factoren die de kwaliteit
van Artemia bepalen en patronen in de populatieverdeling.
Hoofdstuk 3 (Onderzoek op Artemia in de Colombiaanse Caraïben en morfometrische
analyse) onderzoekt de huidige toestand van de Artemia reserves in Colombia, bespreekt de
eigenlijke biotopen van de Artemia populaties in de Colombiaanse Caraïben, waarbij een
combinatie van biometrische gegevens, FAME analyse en morfometrische multivariate analyse
van de belangrijkste populaties wordt gebruikt als een middel om de verschillende populaties te
differentiëren, alsook om sleutelfactoren te selecteren voor taxonomische en management
doeleinden. De verzamelde gegevens betreffende de physicochemische parameters lieten toe een
verdere characterisatie van de extreme habitats uit te voeren als bijdrage aan de kennis over de
bijzonder complexe ecosystemen waarin A. franciscana voorkomt. De ionaire analyse van de
onderzochte Colombiaanse habitats waar Artemia tonen voornamelijk een hoog chloridegehalte,
omwille van de marine (thalassohaline) origine. Het gebruik van biometrische gegevens als een
instrument om mogelijke verschillen in de grootte van cyste en nauplius te bepalen tussen
verschillende Colombiaanse populaties onderling was succesvol en bijzonder geschikt voor een
verdere onderverdeling van enkele Artemia soorten met een veelbelovend potentieel voor
aquacultuur. Cysten van Tayrona bleken de kleinste te zijn van alle Colombiaanse soorten die
werden onderzocht, daarbij gevolgd door Galerazamba, Kangarú, Manaure, Salina Cero en Pozos
Colorados. De biometrische analyse van het chorion bij Galerazamba gaf de dunste schaal,
daarbij gevolgd door Tayrona, Salina Cero, Manaure, Pozos Colorados en Kangarú. Bijkomend
waren de nauplii van Galerazamba het kleinst, gevolgd door Manaure, Salina Cero, Pozos
Colorados en Tayrona. De FAME analyse van Manaure, Galerazamba, Salina Cero en Tayrona,
toonde hoge EPA en lage DHA waarden, alsook een lage DHA/EPA ratio. Aldus kunnen alle vier
onderzochte populaties worden beschouwd als geschikt voor gebruik in de marine aquacultuur,
SN-6
Samenvatting
echter enkel indien zij worden aangerijkt via DHA rijke emulsies, afhankelijk van de actuele
kwaliteitsnormen voor Artemia. De analyse van de morfometrische karakteristieken, deelt zowel
de vrouwelijke als mannelijke individuen onder in hun eigen populatiegroep (zijnde NoordAmerika en de Caraïben), daarbij ingedeeld door slechts een enkele discriminerende functie
(100% zekerheid). Toch zijn mannelijke morfometrische karakteristieken betere criteria dan de
vrouwelijke om verschillende populaties van elkaar te onderscheiden, aangezien zij toelaten om
alle Colombiaanse populaties te groeperen naargelang hun eigenlijke geografische spreiding en
ook een onderscheid maken met de SFB populatie die binnen de Noord-Amerikaanse groep valt,
dit in tegenstelling met de vrouwelijke individuen die wel enige overlapping tussen beide groepen
vertonen. Op een gelijkaardige manier zullen mannelijke en vrouwelijke individuen bij de
classificatie volgens geografische origine, een onderscheid maken tussen de Colombiaanse en de
Noord-Amerikaanse (SFB) populaties. Mannelijke kenmerken zullen Salina Cero juist
onderverdelen onder de Colombiaanse Caraïben-groep op basis van eigenlijke geografische
afstand. Volgens de analyses is de Salina Cero mannelijke populatie gelijk aan de naburige
Galerazamba populatie, met ook enige verwantschap aan de andere Colombiaanse populaties.
Bijkomend wordt dit ook nog eens bevestigd door de RAPD techniek (hoofdstuk 5) en kan dit
ook worden verklaard door een geografische barriere (de Sierra Nevada de Santa Marta). De
onderscheidingsfactor 1 voor mannelijke individuen scheidt Galerazamba en Salina Cero
populaties van de andere Colombiaanse Caraïben populaties (Manaure en Tayrona), alhoewel
enige overlapping toch nog aanwezig is.
Hoofdstuk 4 (Effect van omgevingsfactoren op de reproductie van enkele Colombiaanse
soorten) onderzoekt zowel experimenteel als in situ de reproductie van Artemia populaties uit de
grootste Colombiaanse zoutwinningsgebieden, waarbij een parallel wordt getrokken tussen in
vitro en in situ resultaten. Physicochemische en meteorologische gegevens werden verzameld op
maandelijkse basis en werden achteraf geanalyseerd met behulp van multivariate analyse.
Aansluitend werd de maandelijkse potentiele biomassa en cystproductie bepaald voor iedere
onderzochte locatie. Standaard parameters voor de evaluatie van cystkwaliteit werden toegepast
op cysten die gedurende een periode van twee jaar werden verzameld op verschillende locaties in
Colombia. De resultaten van de reproductie-experimenten (gemiddelde cystproductie per
vrouwelijk individu) komen niet volledig overeen met het geschatte cystproductie potentieel van
SN-7
Samenvatting
elke locatie (in situ resultaten). Dit verschil is waarschijnlijk te verklaren door de in situ interactie
van drie omgevingsparameters (saliniteit, procentuele zuurstofverzadiging, nitraat) op de
cystproductie, voornamelijk in het geval van Salina Cero. Bijkomend is het mogelijk dat
nitraatgehalten worden beïnvloed door de saliniteit. Een andere mogelijke verklaring voor deze
contradictoire resultaten kan worden gevonden bij de gemanipuleerde kweekomstandigheden (nl.
een ad libitum voedselbedeling komt in de regel niet voor in de natuur). Deze laatste observatie
wordt gedeeltelijk ondersteund door de lage nitraatwaarden die werden gemeten op het moment
van een piek in de cystproductie. Het uiteindelijk resultaat van de studie van de
populatieverdeling is dat Manaure, Galerazamba en Salina Cero een stabiele gemiddelde
populatieditributie vertonen met een uitgebalanceerde proportionele verhouding tussen volwassen
dieren (38%, 36% en 19% respectievelijk) en juvenielen + nauplii (62%, 64% en 81%
respectievelijk), alsook een stabiele vrouw:man ratio (1:0.84, 1:0.88 en 1:0.84 respectievelijk). In
tegenstelling daarmee vertoont Tayrona een onstabiele populatieverdeling met een hoge
proportionele hoeveelheid volwassen dieren (82%), een laag aantal juvenielen + nauplii (18%) en
een lage vrouw:man ratio (0.88:1). Aldus is het recruteren van juvenielen en nauplii om de
continuiteit (overleving) van de soort in dit biotoop te verzekeren beneden het houdbare niveau.
Een kwaliteitsstudie van de cysten die op onregelmatige tijdstippen werden verzameld van de
vier populaties, toont tenslotte aan dat het verzamelen van de cysten en de verwerkingstechnieken
moeten worden verbeterd opdat ze geschikt zouden zijn voor de Colombiaanse aquacultuur.
Hoofdstuk 5 (Preliminaire genetische gegevens van enkele Caraïbische Artemia
franciscana soorten, gebaseerd op RAPDs) geeft de genetische verwantschap weer tussen enkele
Artemia populaties in de Caraïben, waaronder ook twee "vreemde" soorten (SFB en A. persimilis)
die werden gebruikt als blanco, door middel van het gebruik van RAPD genetische markers.
Deze markers genereerden twee gelijkaardige dendrogrammen met dezelfde scheiding tussen de
twee Caraïbische populatiebundels (clusters) i.e. midden Caraïben : Pozos Colorados, Tayrona,
Manaure, Venezuela-PAV, Bonaire en Curaçao ; lagere Caraïben : Galerazamba en Salina Cero.
Bovendien suggereert het bekomen patroon in de clusters dat de populaties binnen de twee
clusters niet genetisch identiek zijn. Bovendien waren de Colombiaanse stalen voor Manaure en
Galerazamba die werden verzameld met bijna tien jaar verschil tussen, en waarop ongetwijfeld
een invloed merkbaar was van de toen heersende omgevingscondities, zeer goed gecorreleerd
SN-8
Samenvatting
volgens Pearson's coefficient. Bovendien komt de scheiding tussen de Artemia populaties uit
Colombia overeen met het bestaan van een geografische barriere in Colombia genaamd de Sierra
Nevada de Santa Marta. De Sierra Nevada vormt een geografische barriere voor vogels waardoor
een mogelijke verspreiding van Artemia cysten naar het Zuiden werd verhinderd. Zodoende kan
het verschil tussen de twee groepen worden gezocht in geografische isolatie, of gebrek aan
genetische influx als gevolg van deze fysische barriere. Het dendrogram illustreert ook de relatie
tussen de vijf Colombiaanse, de Puerto Araya (Venezuela), Bonaire en Curaçao populaties met
andere A. franciscana populaties. De Puerto Rico en SFB populaties liggen verder uit elkaar dan
de vijf Colombiaanse, de Venezolaanse en de andere Caraïbische (Bonaire en Curaçao)
populaties. Nochtans zijn al deze populaties, beschouwd als A. franciscana, zeer verschillend van
A. persimilis.
Hoofdstuk 6 (Cycli die de spreiding van Artemia in de bekkens beinvloeden) onderzoekt
de relatie van halve termijn cycli (maancycli) en het staalnamemoment met de verspreiding van
Artemia in de bekkens. Daarbij wordt ook de invloed van temperatuur en opgeloste zuurstof op
het cyclisch ecologisch gedrag van Artemia besproken. Het is duidelijk af te leiden uit de invloed
van de maancycli en het staalnamemoment dat de conglomeraten gevormd door pekelkreeftjes
asynchroon zijn. Dus in geen enkele van de twee staalnamejaren is er een statistische
compatibiliteit gevonden tussen de 7 dagen durende (wekelijkse) rytmische cycli en de Artemia
dichtheid. Differentialen in licht intensiteit tussen volle en nieuwe maan (statistisch niet
verschillend) en zonsopgang en zonsondergang (statistisch verschillend) kan mogelijks een effect
hebben op het samenzwermingsgedrag van Artemia. Deze resultaten konden een verklaring
bieden voor het gedragspatroon van Artemia onder invloed van de aanwezigheid van de meest
natuurlijk voorkomende predator, waadvogels. Artemia is een traagzwemmend organisme, een
gemakkelijke prooi tijdens heldere nachten (volle maan) en bij avondschemering in vergelijking
met donkere nachten (nieuwe maan) en ochtendgloren. Evenzo kunnen het verstoren van het
clustervormend gedrag tijdens 1) de synode maancyclus, 2) de zeven dagen (wekelijkse)
harmonie en 3) de staalname om de vier uren een verklaring geven voor deze migratiemet een 24
uren durende periodiciteit. Bijkomend was er een duidelijk verband tussen de temperatuur en de
Artemia dichtheid. Dit is tevens een maskerende factor op de mogelijke effecten van enige
maanfase op de Artemia dichtheid. Ook zijn temperatuur en saliniteit bepalend voor de
SN-9
Samenvatting
hoeveelheid opgeloste zuurstof aanwezig op het moment van de staalnames welke een migratie
van de Artemia zullen veroorzaken naar lagere temperaturen. De temperatuurvariaties
(max./min.) waren hoger tijdens nieuwe maan wat wijst op een duidelijke invloed op de Artemia
verdeling in de waterkolom ‘s nachts (koeler) in vergelijking met overdag (warmer). De auteurs
van deze thesis bevelen aan om Artemia onderzoek te doen ofwel laat op de avond ofwel heel
vroeg ‘s morgens aangezien de verdeling van Artemia meer uniform is gedurende de avond
wanneer
temperaturen
lager
zijn,
voornamelijk
in
zoutwinningsgebieden
waar
de
evaporatiebekkens ondiep zijn.
Hoofdstuk 7 (Conclusies en Perspectieven) bespreekt kort de resultaten die werden
behaald in dit werk in het kader van de onderzoeksobjectieven. Er worden ook besluiten gevormd
en perspectieven geboden voor toekomstig onderzoek in relatie tot deze thesis.
SN-10
Acknowledgments
My deepest sincere gratitude to my Promoter and Professor Dr. Patrick Sorgeloos for his
unconditional assistance and patience on the planning and coordination for this cooperative thesis
work, and for providing an adequate working space at the Laboratory of Aquaculture and Artemia
Reference Center.
I am grateful to my Copromoter Gonzalo Gajardo (University of Los Lagos, Chile),
Gilbert Van Stappen (ARC-Ghent University), Joe Ely (SIUC), and Filip Volckaert (Leuven
University) for their exhaust and thoughtful revision and recommendations on the preparation of
papers and this thesis. I am especially thankful to Prof. dr. ir. M. Verloo (Ghent University),
Prof. dr. Niels De Pauw (Ghent University), Prof. dr. ir. Johan Mertens (Ghent University), Prof.
dr. ir. S. De Smelt (Ghent University), Dr. Peter Bossier (Sea Fisheries, Oostende) and Prof. Dr.
Chistopher C. Kohler (Southern Illinois University at Carbondale, USA) for their extremely
valuable suggestions and critical reviews to improve this thesis.
Els Vanden Berghe thank you very much first of all, for your proof of humanity and
kindness, especially during moments of distress, and secondly for your great translations and
revisions of some parts of this thesis.
I deeply thank Luc Sanders and Christ Mahieu for their invaluable collaboration in the
laboratory work, the ARC staff members, PhD students and the administrative support headed by
the always smiling Magda Vanhooren and her administrative support Katherina Gamrotova and
Alex Pieters.
The colossal sampling fieldwork during the 2 year exploration and monthly data
collection was possible thanks to the very valuable cooperation received from the research and
field assistants Igor Muelles, Juan Carlos Linero Gonzáles, Gabriel M. Durán Cobo, Licet
Hernández Cueto, Jandro Bolaño, Tania Acuña, Karime Coha, Orlando Rada Contreras, Saul
Pereira, Victor Escorcia, Jeffeson A. Puerto Uriana, Adelson S. Fajardo Pana, Diana Arzuza,
Luzmila Garcia, Robin H. Casalla and all the members of the Artemia Research Group (GIA),
Uniatlántico, Barranquilla, Colombia.
SN-11
Acknowledgments
I am grateful to Francisco Amat and his team at the Instituto de Investigaciones Marinas
in Torre de La Sal (CSIC-Spain), CYTED colleagues, Howard Newman (Dessert Lake
Technologies, USA) for their guidance and valuable comments and corrections to part of this
thesis and to Leonor Botero (COLCIENCIAS) for believing in me.
I owed part of the inspiration to pursue the promising field of aquaculture to my earliest
Professor Michael Hartman (Haywood Community College, NC, USA).
I have no words to God, my parents and family to express my thankfulness for all the
support I received through this long years that took us to crystallize what once was only a simple
dream and today has become a reality.
My PhD program was financed thanks to scholarship and a research project “Evaluación y
colombiano” (code 1116-09-343-97) granted by the Colombian Council of Science and
Technology “Francisco José de Caldas” (COLCIENCIAS) and by the Universidad del Atlántico,
Barranquilla, Colombia.
I hope I did not forget anyone, but just in case thank you to you !!!
SN-12
Curriculum Vitae
PERSONAL INFORMATION
NAME & SURNAMES:
William Camargo Navarro
PROFESSION:
Biologist and Aquaculturist
PLACE OF BIRTH:
Barranquilla, Colombia
DATE OF BIRTH:
March 14, 1964
MAILING ADDRESS:
1941 S. Illinois Ave,
Carbondale, USA
TEL:
(618) 351-1169 home
(618) 453-2608 Work
E-MAIL:
[email protected] [email protected]
HIGHER EDUCATION
Ghent University, Belgium
Ph.D. in Aquaculture.
Scholarship awarded by Colciencias.
Date of Graduation: July 1, 2002
Ghent University, Belgium & Wageningen Agricultural
University, The Netherlands.
M.Sc. in Aquaculture.
Scholarship awarded by Colfuturo.
Date of Graduation: July 7, 1995.
"Biology, Seed Production, Culture Techniques, Propagation,
Disease Control in the Marine Environment,
and Pond Water Management for the Culture of Penaeus
japonicus". Yamaguchi Prefectural Naikai Sea
Farming Center, Japan. Scholarship awarded by the
Japanese Government (JICA), from Jan. to Jul., 1991.
Florida-Tech, Melbourne, USA
XIII
Curriculum Vitae
B.S. in Biology & Aquaculture. Date of graduation: March 19,
1989.
Nassau Community College, N.Y.
A.S. in Biology. From June 1984 to July 1986.
WORK HISTORY
Mar 01 to present: Southern Illinois University, Carbondale, USA
Sabatical Year. Coordinator of International Aquaculture and
fisheries projects in the Amazon region.
July 97 to Present: Universidad del Atlántico, Barranquilla, Colombia.
Research project director “Evaluation and utilisation of the natural
resource Artemia in the Manaure and Galerazamba saltworks,
Colombian Caribbean”.
Associate professor on charge of the
course Aquaculture II. Designed a small experimental recirculating
salt water Aqualab.
Jun. 96 to Jan. 97: Marine and Coastal Research Institute (INVEMAR), Santa Marta,
Colombia.
Director, Mariculture Program. Writing project proposals, experimental
design and coordination of a Mariculture research team. Modified the
Mariculture Aqualab, creating a microalgae culture room.
Dec.‘95 - Jun. 96 : Ministry of Environmental Affairs and the United Nations (PNUD),
Bogota, Colombia.
Consultant for environmental ordinance projects with an emphasis on the
water resource. Formulation and revision of regulatory environmental
laws dealing with coastal zoning
and water resource management.
XIV
Curriculum Vitae
Jan. - March. 93 : FL. Game & Fresh Water Fish Commission,
Saint Augustine, FL., USA.
Aquaculture Scientist II. Assistant in the management and
maintenance of Florida's North-eastern wetlands and forest region
(Guana River preservation area). Attend the public and assure
proper functioning of all equipment.
Sept. 91-Nov. 92 : Private Aquaculture Consultant. Worked independently as an
Aquaculture technology consultant, designing and constructing
aquaculture facilities in Colombia.
May 90 - Jan. 91 : Managed family farm in Colombia, and developed an integrated
polyculture system with tilapia, prawns and catfish, fertilizing the
water with non consumed fruits.
June 89 - Feb. 90 : Caribbean Marine Research Center, FL, USA
Research assistant. Maintained and improved Aquaculture
research lab, and conducted research on red tilapia in salt water
systems.
Feb. - June 89 : AquaAmazonic Ornamentals, Melbourne, FL.
Owner. Involved in fresh water tropical fish importing business from
South America to the United States.
June - Dec. 88 : Walt Disney World, The Land, EPCOT Ctr.
Lake Buena Vista, FL. USA
Maintained life-support integrated and closed recirculation systems
with tilapia, catfish, striped bass, paddle-fish, eels, and prawns.
Conducted research on Colossoma sp. (Fish native to the Amazon
River and its tributaries).
XV
Curriculum Vitae
Nov. 87 - Feb. 88 : Private Clam lease, Sebastian, FL.
Seeded and harvested clams of the species Mercenaria mercenaria
in trays and bed of The Indian River.
Oct. - Nov.
87 : Wetland and Aquaculture, Melbourne, FL.
Participated in the design and construction of clam hatchery and
grow-out systems. Maintenance and feeding of clam larvae.
ACTIVITIES
• World Aquaculture Society member.
• American Fisheries Society member.
• American Association for the Advancement of Science member.
• InfoFish member.
• International Center For Living Aquatic Resources Management
(ICLARM) member.
• Latin American Council for Science and Technology (CYTED)
member.
WRITTEN WORK
1. Camargo, W.N. (1988). The use of citrus fruits as a food source for the culture of
Colossoma bidens in the State of Florida". B.S. thesis, Florida Institute of
Technology, March 1988. 12 p.
2. Camargo, W.N. and Nunley, C. (1988). A comparison of the growth rate of
Colossoma bidens by utilizing two different fish feeds. The Land, EPCOT Center,
Walt Disney World. Dec. 1988. 20 p.
3. Camargo, W.N. (1992). The sea: more than life to the Japanese“ ACEJA, JICA
Magazine. Year 8, July, 1992. (translation from Spanish). pp. 5-6.
XVI
Curriculum Vitae
4. Camargo, W.N. (1995). Evaluation of Activated Carbon for Treating Heavy
Metals in Aquaculture” M.Sc. thesis. University of Ghent, Belgium. July 5, 1995.
53 p.
5. Camargo, W.N. (2000). Illustrated manual for the culture, processing and
commercialization of Artemia, Universidad del Atlántico, Colciencias and GIA.
Sept. 2000. 18 p.
6. Camargo, W.N., Coha, K.V. and Duran, G.C. (2000).
“Evaluación y
aprovechamiento del recurso natural Artemia en las salinas de Manaure y
Galerazamba, Caribe colombiano”, (código 1116-09-343-97) Colciencias y
Universidad del Atlántico, Colombia. Informe Final. 100 p.
7. Alcantara, F.B., De Jesus, M.R., Kohler, C.C. and Camargo, W.N. (2001).
Reproducción inducida de Gamitana y Paco, USAID - PD/A CRSP - SIU and IIAP
manual in Spanish. 13 p.
8. Alcantara, F.B., Kohler, C.C., Kohler, S.T., Camargo, W.N., and Colace, M.
(2001). Fish culture and food security in the Peruvian Amazon. Pond
Dynamics/Aquaculture Collaborative Research Support Program Newsletter.
Aquanews 16(3):1-3
9. Alcántara, F.B., Kohler, C.C., Kohler S.T. and Camargo, W.N. (2002). Cartilla de
acuacultura en la Amazonia. USAID - PD/A CRSP - SIU and IIAP manual in
Spanish. 48 p.
10. Camargo, W. N., Bossier, P., Sun, Y. and Sorgeloos, P. (2002). Preliminary data
on some Caribbean Artemia franciscana strains based on RAPDs. Hydrobiologia
468:245-249.
XVII
Curriculum Vitae
11. Camargo, W.N., Van Vooren, L. and Sorgeloos, P. (2002). Effects of lunar cycles
on Artemia density in hypersaline environments. Hydrobiologia 468:251-260.
12. Camargo, W.N., Ely, J.S. and Sorgeloos, P. (Submitted). Morphometric
characterization and temperature and salinity tolerance of thalassohaline Artemia
franciscana populations from the Colombian Caribbean. Blackwell Publishing Ltd.
Oxford, U.K. J. Biogeography. 2002.
13. Camargo, W. N., Duran, G.C., Hernandez, L.C., Rada, O.C., Linero, J.C. and
Sorgeloos, P. (Submitted). Biogeography of six new Artemia populations in the
Colombian Caribbean. J World Aq Soc. 2002.
14. Camargo, W.N., Ely, J.S., Duran, G.C. and Sorgeloos, P. (Submitted). Influence
of some physicochemical parameters on Artemia biomass and cyst production in
some thalassohaline aquatic environments from the Colombian Caribbean.
J
World Aq Soc. 2002.
15. Alcantara, F.B. Chávez, C.V., Rodríguez, L.C., Camargo, W.N., Kohler, C.,
Colace, M. and Tello, S. (Submitted). Gamitana (Colossoma macropomum) and
Paco (Piaractus brachypomus) Culture in Floating Cages in the Peruvian
Amazon. Mag World Aq Soc. 2002.
XVIII

William Camargo - Actividad Cultural del Banco de la República

Transcription

Similar documents

Low budget marine Investigation kit Seawater experiments in your

DNArescue™ Spray Lotion reverses the appearance of

Portfolio - Ramon Feller

Don`t miss this year`s new and exiciting event

spray on perfection

EDITOR: Constantin Munteanu, Ph.D., National Institute of

Reef fish Breeding and Hatchery Production Using

Feeding Behavior in the Hawaiian Zoanthids Palythoa and Zoanthusl

your fish are spawning…now what? adventures in marine live feeds

SI~I - Kansas Wesleyan University