Bovicin HJ50, a novel lantibiotic produced by

Microbiology (2004), 150, 103–108
DOI 10.1099/mic.0.26437-0
Bovicin HJ50, a novel lantibiotic produced by
Streptococcus bovis HJ50
Haijie Xiao,1 Xiuzhu Chen,1 Meiling Chen,1 Sha Tang,3 Xin Zhao1
and Liandong Huan1,2
Correspondence
Liandong Huan
[email protected]
Received 23 April 2003
Revised
13 October 2003
Accepted 13 October 2003
1,2
Molecular Microbiology Research Center1 and State Key Laboratory of Microbial Resources2,
Institute of Microbiology, Chinese Academy of Sciences, PO Box 2714, Beijing, PR China
3
Department of Microbiology, University of California, Riverside, CA 92521, USA
A bacteriocin-producing strain was isolated from raw milk and named Streptococcus bovis HJ50.
Like most bacteriocins produced by lactic acid bacteria, bovicin HJ50 showed a narrow range
of inhibiting activity. It was sensitive to trypsin, subtilisin and proteinase K. Bovicin HJ50 was
extracted by n-propanol and purified by SP Sepharose Fast Flow, followed by Phenyl Superose
and Sephadex G-50. Treatment of Micrococcus flavus NCIB8166 with bovicin HJ50 revealed
potassium efflux from inside the cell in a concentration-dependent manner. The molecular mass
of bovicin HJ50 was determined to be 3428?3 Da. MS analysis of DTT-treated bovicin HJ50
suggested that bovicin HJ50 contains a disulfide bridge. The structural gene of bovicin HJ50 was
cloned by nested PCR based on its N-terminal amino acid sequence. Sequence analysis
showed that it encodes a 58 aa prepeptide consisting of an N-terminal leader sequence of 25 aa
and a C-terminal propeptide domain of 33 aa. Bovicin HJ50 shows similarity to type AII
lantibiotics. Chemical modification using an ethanethiol-containing reaction mixture showed
that two Thr residues are modified.
INTRODUCTION
Bacteriocins are antimicrobial peptides, proteins or complex proteins produced by certain bacteria (Allison &
Klaenhammer, 1999; Jack et al., 1995; McAuliffe et al., 2001).
Many species of bacteria produce bacteriocins, but bacteriocins produced by lactic acid bacteria (LAB) are of particular interest because of the relationship between LAB and
humans. Since nisin was found in 1928, over 70 kinds of
bacteriocin produced by LAB have been found. Nisin, the
best studied bacteriocin, has been approved as a food preservative in over 50 countries. During the last few decades
a lot of research into bacteriocins produced by LAB has
been carried out. Bacteriocins are one of the antimicrobial
substances produced by LAB and it is thought that they
play an important role in inhibiting other bacteria in the
same environment.
Bacteriocins have been categorized into four groups according to their chemical properties (Klaenhammer, 1993):
group I, lantibiotics which contain unusual amino acid
Abbreviations: LAB, lactic acid bacteria; MALDI-TOF, matrix-assisted
laser desorption/ionization-time of flight.
The GenBank accession numbers for the 16S rDNA sequence of
S. bovis HJ50 and bovA reported in this paper are AY173079 and
AY271354.
0002-6437 G 2004 SGM
residues, such as lanthionine, 3-methyllanthionine, 2,3didehydroalanine and 2,3-didehydrobutyrine; group II,
small, heat-stable peptides; group III, large, heat-labile
proteins; group IV, complex proteins, composed of protein
plus lipid or carbohydrate. Group IV bacteriocins are somewhat questionable because of inadequate data. Bacteriocins
from groups I and II are the best studied. A great deal of
research into bacteriocins and their uses has been carried
out, including characterization of new bacteriocins, modification of bacteriocins by protein engineering (Chen et al.,
1998; Rollema et al., 1995), construction of food-grade
vectors (Takala & Saris, 2002), regulation and expression of
heterologous proteins (de Ruyter et al., 1996), control of
flavour and other characterisitcs of fermented food, and
pharmaceutical and veterinary applications of bacteriocinproducing bacteria, etc. Originally, the potential use of
bacteriocins as food preservatives stimulated research into
bacteriocins produced by LAB which has led to a greater
understanding of these important bacteria.
Many bacteriocin-producing LAB have been isolated from
raw milk; Lactococcus spp., Lactobacillus spp. and Leuconostoc spp. are the most abundant. Production strains for
nisin, lacticin 481 and garviecin L1-5 (Villani et al., 2001)
were isolated from milk. From raw milk provided by a dairy,
we isolated a strain producing a novel bacteriocin. In this
paper, the biochemical and genetic characterization of this
bacteriocin is studied.
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
Printed in Great Britain
103
H. Xiao and others
METHODS
Bacterial strains and media. The bacteriocin-producing strain
(Streptococcus bovis HJ50) was isolated from raw milk provided by
the Qutou Dairy of Beijing and was grown anaerobically in M17
medium with 5 g glucose l21 at 37 uC. An indicator strain, Micrococcus flavus NCIB8166, was grown in S1 medium at 30 uC.
Characterization of the bacteriocin-producing strain. S. bovis
HJ50 was tested for growth temperature, growth at pH 9?6, hydrolysis
of arginine and aesculin, production of catalase and amylase, Voges–
Proskauer reaction, growth in 6?5 % NaCl and acid production from
several carbohydrates.
Total DNA was extracted according to Lewington et al. (1987). Two
primers were used for 16S rDNA analysis: 27f (59-AGAGTTTGATCNTGGCTCAG-39) and 1541r (59-AAGGAGGTGATCCAGCC-39).
PCR was performed under the following conditions: 94 uC for 5 min
followed by 30 cycles of denaturation at 94 uC for 1 min, annealing at
52 uC for 1 min and polymerization at 72 uC for 3 min. The PCR product was ligated into pGEM-T vector (Promega) for DNA sequencing.
Detection of bacteriocin activity and susceptibility to proteases. A culture of S. bovis HJ50 was centrifuged to remove the
cells. The cell-free supernatant was adjusted to pH 7?0 for the detection of bacteriocin activity by the well-diffusion method. A neutral
solution was also used to measure activity against other bacteria to
determine the antimicrobial spectrum of bovicin HJ50. Susceptibility to proteases was examined according to Aktypis et al. (1998).
A neutral solution of bovicin HJ50 was also treated with trypsin,
subtilisin and proteinase K at 37 uC for 1 h.
Extraction and purification of bovicin HJ50. Bovicin HJ50 was
extracted with n-propanol according to Cheeseman & Berridge
(1957). Briefly, a culture of S. bovis HJ50 was adjusted to pH 2 with
HCl. After centrifugation, 0?1 vols n-propanol was added into the
broth supernatant, then 300 g NaCl was added. The supernatant/npropanol solution was collected and the residual broth was extracted
with 30 ml n-propanol per litre of broth for a second time. All of
the n-propanol solution was collected and 2 vols cold acetone was
added to obtain a precipitate of bovicin HJ50. The precipitate was
dissolved in 0?05 M citric acid buffer (pH 4?2) to obtain a crude
extract of bovicin HJ50.
The crude extract was dialysed against 0?05 M citric acid buffer
(pH 4?2) and applied to an SP Sepharose Fast Flow column previously
equilibrated with the same buffer. Bovicin HJ50 was eluted with a
0–1 M NaCl gradient by using a fast performance liquid chromatography (FPLC) system. Active fractions were combined and dialysed
against 0?05 M citric acid buffer (pH 4?2) containing 1?5 M NaCl. A
Phenyl Superose column was used for hydrophobic interaction
chromatography, eluted with a 1?5–0 M NaCl gradient. Active fractions were combined and lyophilized. Then the bacteriocin sample was
applied to a Sephadex G-50 column for gel filtration. The active
fractions were collected and lyophilized. Protein concentration was
measured by the method of Bradford (1976).
Determination of potassium efflux. Potassium efflux was deter-
mined according to Chen & Montville (1995). Cells of M. flavus
NCIB8166 were grown in S1 medium supplemented with 2?5 mmol
KCl l21 at 30 uC. Cells were harvested at mid-exponential phase
(OD600=0?6–0?7) for cell dry weight and potassium efflux determination. Cells were washed in 0?1 M MES buffer (pH 6?3) containing
0?2 % glucose and 0?6 mmol KCl l21 and resuspended in the same
volume of MES buffer. Purified bovicin HJ50 was added to the cell
suspension at different concentrations. A cell suspension with no
bacteriocin added served as a blank control. One hour after treatment
104
with bovicin HJ50, the suspension was centrifuged at 12 000 r.p.m. for
10 min to remove the cells. The supernatant was applied to a plasma
spectrum (Prodigy; Leeman Labs) for determination of potassium.
MS analysis of bovicin HJ50. The molecular mass of purified
bovicin HJ50 was determined by matrix-assisted laser desorption/
ionization-time of flight (MALDI-TOF) MS on a BIFLEX III TOFMS instrument. Bovicin HJ50 treated with 4 mmol DTT l21 for
15 min at 60 uC was also used for MS analysis.
N-terminal sequence analysis of bovicin HJ50. The N-terminal
sequence of purified bovicin HJ50 was determined on an Applied
Biosystems 477A automatic sequence analyser by using the Edman
degradation method.
Cloning of the gene encoding bovicin HJ50. Three degenerate
primers: P1, P2 and P3 (Table 1), designed according to the Nterminal sequence of bovicin HJ50, were used to clone the gene
encoding bovicin HJ50. Cys was tentatively used to substitute the
third position because of the homology between bovicin HJ50 and
type AII lantibiotics. PCR was performed with 2 mM each primer
mix, P1 or P2 with P3, under the following conditions: 94 uC for
5 min followed by 40 cycles of denaturation at 94 uC for 50 s,
annealing at 49 uC for 50 s and polymerization at 72 uC for 20 s. A
44 bp PCR product was obtained for sequence analysis. The remaining part of the gene was cloned by nested PCR. Briefly, total DNA
cut with a set of restriction endonucleases was ligated into the plasmid pBluescript II SK(+) cut with the same restriction enzymes. These
ligation mixtures were used as PCR templates with gene-specific
(P4 and P5) and vector-specific primers (T3 and SK). The PCR product was sequenced and primer P6 was designed based on the resulting DNA sequence. PCR for chromosome walking was performed
under the following conditions: 30 cycles of denaturation at 94 uC
for 1 min, annealing at 53 uC for 1 min and polymerization at 72 uC
for 3 min.
Chemical modification of bovicin HJ50. Chemical modification
of bovicin HJ50 was performed according to Meyer et al. (1994).
Bovicin HJ50 (8 mg) was dried under vacuum and resuspended in
50 ml of a modification mixture. The reaction mixture was incubated
under nitrogen for 1 h at 50 uC followed by the addition of 2 ml
acetic acid to stop the reaction. The reaction mixture was dried
under vacuum and resuspended in water for MALDI-TOF MS analysis and peptide sequencing by Edman degradation.
Table 1. Primers used for cloning of bovA
Primer
P1
P2
P3
P4
P5
P6
SK
T3
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
Sequence (5§–3§)
GA(T/C)CGNGGNTGGAT(A/T/C)AA
GA(T/C)AG(A/G)GGNTGGAT(A/T/C)AA
AC(A/G)TTNGG(A/G)CA(A/G)TC(T/C)TT
GGGTGGATTAAGACTTTAAC
GACTTTAACAAAGATTGCCC
TCTAACAGGTCTCTTGTAGC
CCGCTCTAGAACTAGTGGAT
AATTAACCCTCACTAAAGGG
Microbiology 150
Novel lantibiotic produced by S. bovis
RESULTS
Extraction, purification and characterization of
bovicin HJ50
Identification of the bovicin HJ50-producing
strain
Like nisin and acidocin B (ten Brink et al., 1994), bovicin
HJ50 could be extracted with n-propanol because of its
hydrophobic properties. Most bovicin HJ50 remained in
solution in n-propanol. In comparison with ammonium
sulfate precipitation, the yield from n-propanol extraction
was high (data not shown). After extraction, bovicin HJ50
was purified by ion exchange with SP Sepharose Fast Flow,
followed by hydrophobic reaction chromatography with
Phenyl Superose and gel filtration on Sephadex G-50.
The bacteriocin-producing strain was a Gram-positive,
amylase-positive, catalase-negative coccus able to grow at
45 uC and at pH 9?6. However, it failed to grow at 10 uC and
in broth containing 6?5 % NaCl. It gave a negative Voges–
Proskauer reaction and produced no ammonia from the
hydrolysis of arginine. The hydrolysis of aesculin was
negative. It showed acid production from lactose, galactose
and maltose, but not from inulin, mannitol, raffinose,
ribose, salicin, sorbitol and trehalose.
16S rDNA analysis showed that the strain shares 99 % homology with S. bovis NCD02127. Thus, the strain was named
S. bovis HJ50.
Antimicrobial spectrum and susceptibility to
proteases
As shown in Table 2, bovicin HJ50 was active against
Lactobacillus curvatus LTH1174, Bacillus subtilis AS1.1087,
Bacillus megaterium AS1.941, M. flavus NCIB8166, Leuconostoc dextranicum 181 and Leuconostoc mesenteroides
AS1.2, but it showed no activity against Listeria monocytogenes. Like most other bacteriocins produced by LAB, bovicin HJ50 could only inhibit some strains of Gram-positive
bacteria. Bovicin HJ50 could be inactivated by trypsin,
subtilisin and proteinase K (data not shown).
Bovicin HJ50 increased the potassium permeability of
M. flavus NCIB8166 in a concentration-dependent fashion
(data not shown) and 20 AU bovicin HJ50 ml21 gave
maximum potassium efflux.
MS (Fig. 1b) showed that the molecular mass of bovicin
HJ50 was 3428?3 Da, which was very close to the result of
Tricine/SDS-PAGE (data not shown). The molecular mass
of bovicin HJ50 reduced with DTT (Fig. 1a) was about
2?4 Da higher than that of untreated bovicin HJ50, indicating that bovicin HJ50 probably contains a disulfide bridge.
Edman degradation analysis revealed the N-terminal amino
acid sequence of bovicin HJ50 to be Ala-Asp-Arg-Gly-TrpIle-Lys-X-Leu-X-Lys-Asp-X-Pro-Asn-Val-Ile-Ser-Ser-Ile. X
at positions 8, 10 and 13 indicated blank cycles in which no
Table 2. Antimicrobial spectrum of bovicin HJ50
Strain
Bacillus cereus
Bacillus coagulans AS1.949
Bacillus megaterium AS1.941
Bacillus subtilis AS1.1087
Escherichia coli
Enterococcus faecalis
Lactobacillus acidophilus
Lactobacillus brevis
Lactobacillus buchneri AS1.40
Lactobacillus curvatus LTH1174
Lactobacillus plantarum
Leuconostoc mesenteroides AS1.2
Leuconostoc dextranicum 181
Listeria monocytogenes
Micrococcus flavus NCIB8166
Pseudomonas aeruginosa 10105
Shigella flexneri 51285
Staphylococcus aureus 26071
*–, No inhibition.
http://mic.sgmjournals.org
No. of
strains
tested
Zone of
inhibition
(mm)*
3
1
1
1
3
3
2
3
1
1
4
1
1
2
1
1
1
1
–
–
14
12
–
–
–
–
–
13
–
10
13
–
21
–
–
–
Fig. 1. MALDI-TOF mass spectrum of bovicin HJ50 treated
with (a) and without (b) DTT.
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
105
H. Xiao and others
Fig. 2. Nucleotide sequence of bovA. The putative ”10 region
of the bovA promoter and the ribosome-binding site (RBS)
region are underlined. The vertical arrow indicates the cleavage
site between the leader peptide and bovicin HJ50 propeptide.
The inverted repeat sequence downstream of bovA indicates
the putative transcriptional terminator sequence.
amino acid derivative was detected. Comparison of this
sequence with sequences in the SWISS-PROT database
showed that bovicin HJ50 is a novel peptide.
Analysis of the gene encoding bovicin HJ50
bovA, the structural gene of bovicin HJ50, was obtained by
PCR using degenerate primers based on the N-terminal
amino acid sequence, followed by nested PCR. As shown in
Fig. 2, DNA sequencing confirmed the results of N-terminal
sequencing of bovicin HJ50. The translation initiation site
was arbitrarily assigned to the first of two ATG codons. bovA
encodes a 58 aa prepeptide with a leader sequence of 25 aa.
The leader peptide is hydrophilic, strongly charged and
predicted to contain an a-helical conformation. It shows
similarity with sequences of leader peptides of type AII
lantibiotics (Fig. 3), including streptococcin A-FF22 (SAFF22), lacticin 481, variacin (Pridmore et al., 1996), mutacin
II (Woodruff et al., 1998) and salivaricin A (Ross et al.,
1993). It contains a GG (double-glycine) motif immediately
preceding the cleavage site, and a conserved EL sequence
(Sablon et al., 2000; Chen et al., 2001). The leader peptide of
bovicin HJ50 contains a TVS motif instead of the conserved
EVT/EVS sequences. The propeptide is a 33 aa peptide with
a calculated mass of 3467?96 Da and a pI of 8?2. DNA
sequencing revealed that the eighth and tenth amino acids of
the bovicin HJ50 propeptide are both Thr and the thirteenth
is Cys. The bovicin HJ50 propeptide also shows similarity
with sequences of type AII lantibiotics (Fig. 3), especially
salivaricin A. Propeptides of bovicin HJ50 and salivaricin
A share 29?4 % identity. Although bovicin HJ50 shows
similarity with the sequences of type AII lantibiotics, the
identity is low. The bovicin HJ50 propeptide is composed of
33 aa, whereas other AII lantibiotics range from 22 to 27 aa.
The C-terminal sequence of bovicin HJ50 differs from that
of type AII lantibiotics. Furthermore, the bovicin HJ50
propeptide contains four Cys residues, while other type AII
lantibiotics contain only three.
A putative promoter is underlined in Fig. 2. The promoter
contains a TG doublet 1 bp upstream of the 210 region
(TATTAT). Approximately half of the lactococcal promoter
sequences studied possess this characteristic (de Vos & Simons,
1994). In addition, downstream of bovA, a 20 bp palindrome
may serve as a r-independent transcription terminator.
Chemical modification of bovicin HJ50
Chemical modification of lantibiotics has been used to
determine the number of dehydrated amino acid residues
in pep5, gallidermin (Meyer et al., 1994), mutacin I and
mutacin III (Qi et al., 2000). To confirm that bovicin HJ50
contains modified amino acids, we performed an ethanethiol modification of bovicin HJ50. Edman degradation
analysis of ethanethiol-modified bovicin HJ50 revealed the
Fig. 3. Alignment of the leader peptides and propeptides of bovicin HJ50 and lantibiotics of type AII. Identical amino acid
residues are indicated with black boxes. Positions where at least three amino acid residues are identical are indicated with
shaded boxes. Consensus residues are shown below. The arrow indicates the cleavage site.
106
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
Microbiology 150
Novel lantibiotic produced by S. bovis
eighth and tenth amino acids were both b-methyl-Sethylcysteine. However, no derivative was detected for the
thirteenth residue. Two major peaks were generated after
ethanethiol modification of bovicin HJ50 (Fig. 4). The two
peaks showed molecular masses of 3490 and 3552 Da,
respectively, which could be accounted for by bovicin HJ50
plus one or two molecules of ethanethiol. Our results
revealed that Thr8 and Thr10 are modified, but probably
none of the other Thr or Ser residues are modified.
DISCUSSION
In this study, we isolated a bacteriocin-producing strain
from raw milk. Bacterial characters and phylogenetic analysis indicated that the bovicin HJ50-producing strain was
S. bovis, a normal inhabitant of the cow rumen. Like most
other bacteriocins produced by LAB, bovicin HJ50 is a small
cationic peptide and could cause permeabilization of the
target cell membrane. Bovicin HJ50 showed a narrow range
of inhibitory activity.
involved in the formation of unusual amino acids. In lantibiotic sequence analysis, Edman cleavage of a residue forming lanthionine or 3-methyllanthionine would result in a
blank cycle; however, the subsequent reactions would continue. Sequencing by Edman degradation is often blocked
by a dehydro residue (Sahl et al., 1995). Therefore, Thr8
and Thr10 may be involved in the formation of 3methyllanthionine with two Cys residues. Another two
Cys residues form a disulfide bridge. Thus, bovicin HJ50 has
two thioether bridges and a disulfide bridge. This would give
a peptide with a calculated molecular mass of 3429?96 Da.
This value was in a good agreement with the molecular mass
of 3428?3 Da obtained by MS of bovicin HJ50.
MS analysis of bovicin HJ50 reduced with DTT indicated
that bovicin HJ50 contains a disulfide bridge. However,
when assayed in the presence of DTT, the titre of bovicin
HJ50 against M. flavus NCIB8166 was neither decreased
nor increased (data not shown). Lantibiotics containing a
disulfide bridge are an anomaly in the bacteriocin world. To
our knowledge, only sublancin 168 produced by Bacillus
subtilis 168 (Paik et al., 1998) and plwa produced by Lactobacillus plantarum LMG 2379 (Holo et al., 2001) contain
disulfide bridges.
Antibiotics are routinely fed to beef cattle in the USA to alter
ruminal fermentation. As antimicrobial substances, bacteriocins produced by ruminal bacteria may have similar effects
on ruminal fermentation. Several studies have been performed to investigate whether bacteriocins produced by
S. bovis in the rumen have such an effect (Lee et al., 2002,
Mantovani et al., 2002, Whitford et al., 2001). Bovicin HC5
produced by S. bovis HC5 has a wide inhibitory spectrum
and could inhibit a variety of freshly isolated S. bovis
strains without causing adaptation. It is thought that it
could be used to control the ruminal ecological environment. Further work is needed to investigate if bovicin HJ50
has a similar effect.
ACKNOWLEDGEMENTS
The evidence presented here shows that bovicin HJ50 is
a lantibiotic. In lantibiotics, Ser, Thr and Cys are usually
This work was supported by a grant (no. 39970391) from the National
Natural Science Foundation of China.
At present most of the bacteriocins produced by Streptococcus strains are lantibiotics, such as salivaricin A, SA-FF22,
mutacin I (Qi et al., 2001), mutacin II and mutacin III (Qi
et al., 1999), etc., while bovicin 255 and mutacin IV are
regarded as non-lantibiotics. Bovicin HJ50 is a lantibiotic
with the unusual characteristic that it contains a disulfide
bridge.
Fig. 4. MALDI-TOF mass spectrum
ethanethiol-modified bovicin HJ50.
http://mic.sgmjournals.org
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
of
107
H. Xiao and others
REFERENCES
derivatization procedures allow a fast access to complete Edman
degradation. Anal Biochem 223, 185–190.
Aktypis, A., Kalantzopoulos, G., Huis in’t Veld, J. H. J. & ten Brink, B.
(1998). Purification and characterization of thermophilin T, a novel
Paik, S. H., Chakicherla, A. & Hansen, J. N. (1998). Identification
bacteriocin produced by Streptococcus thermophilus ACA-DC 0040.
J Appl Microbiol 84, 568–576.
Allison, G. E. & Klaenhammer, T. R. (1999). Genetics of bacteriocins
and characterization of the structural and transporter genes for,
and the chemical and biological properties of, sublancin 168, a
novel lantibiotic produced by Bacillus subtilis 168. J Biol Chem 273,
23134–23142.
produced by lactic acid bacteria and their use in novel industrial
applications. In Manual of Industrial Microbiology and Biotechnology,
2nd edn, pp. 789–808. Edited by A. L. Demain & J. E. Davies.
Washington, DC: American Society for Microbiology.
Variacin, a new lanthionine-containing bacteriocin produced by
Micrococcus varians: comparison to lacticin 481 of Lactococcus lactis.
Appl Environ Microbiol 62, 1799–1802.
Bradford, M. M. (1976). A rapid and sensitive method for the quanti-
Qi, F., Chen, P. & Caufield, P. W. (1999). Purification of mutacin III
tation of microgram quantities of protein utilizing the principle of
protein–dye binding. Anal Biochem 72, 248–254.
Cheeseman, G. C. & Berridge, N. J. (1957). An improved method
from group III Streptococcus mutans UA787 and genetic analyses
of mutacin III biosynthesis genes. Appl Environ Microbiol 65,
3880–3887.
for preparing nisin. Biochem J 65, 603–608.
Qi, F., Chen, P. & Caufield, P. W. (2000). Purification and
Chen, Y. & Montville, T. J. (1995). Efflux of ions and ATP depletion
biochemical characterization of mutacin I from the group I strain
of Streptococcus mutans, CH43, and genetic analysis of mutacin I
biosynthesis genes. Appl Environ Microbiol 66, 3221–3229.
induced by pediocin PA-1 are concomitant with cell death in Listeria
monocytogenes Scott A. J Appl Bacteriol 79, 684–690.
Chen, P., Novak, J., Kirk, M., Barnes, S., Qi, F. & Caufield, P. W.
(1998). Structure-activity study of the lantibiotic mutacin II from
Streptococcus mutans T8 by a gene replacement strategy. Appl Environ
Microbiol 64, 2335–2340.
Chen, P., Qi, F., Novak, J., Krull, R. E. & Caufield, P. W. (2001). Effect
Pridmore, D., Rekhif, N., Pittet, A.-C., Suri, B. & Mollet, B. (1996).
Qi, F., Chen, P. & Caufield, P. W. (2001). The group I strain of
Streptococcus mutans, UA140, produces both the lantibiotic mutacin
I and a nonlantibiotic bacteriocin, mutacin IV. Appl Environ
Microbiol 67, 15–21.
Rollema, H. S., Kuipers, O. P., Both, P., de Vos, W. M. & Siezen, R. J.
(1995). Improvement of solubility and stability of the antimicrobial
of amino acid substitutions in conserved residues in the leader
peptide on biosynthesis of the lantibiotic mutacin II. FEMS Microbiol
Lett 195, 139–144.
peptide nisin by protein engineering. Appl Environ Microbiol 61,
2873–2878.
de Ruyter, P. G., Kuipers, O. P. & de Vos, W. M. (1996). Controlled
Ross, K. F., Ronson, C. W. & Tagg, J. R. (1993). Isolation and
gene expression systems for Lactococcus lactis with the food-grade
inducer nisin. Appl Environ Microbiol 62, 3662–3667.
de Vos, W. M. & Simons, G. F. M. (1994). Gene cloning and
characterization of the lantibiotic salivaricin A and its structural gene
salA from Streptococcus salivarius 20P3. Appl Environ Microbiol 59,
2014–2021.
expression systems in Lactococci. In Genetics and Biotechnology of
Lactic Acid Bacteria, pp. 52–105. Edited by M. J. Gasson & W. M.
de Vos. Glasgow: Blackie.
Sablon, E., Contreras, B. & Vandamme, E. (2000). Antimicrobial
Holo, H., Jeknic, Z., Daeschel, M., Stevanovic, S. & Nes, I. F. (2001).
Sahl, H.-G., Jack, R. W. & Bierbaum, G. (1995). Biosynthesis and
peptides of lactic acid bacteria: mode of action, genetics and
biosynthesis. Adv Biochem Eng Biotechnol 68, 21–60.
Plantaricin W from Lactobacillus plantarum belongs to a new family
of two-peptide lantibiotics. Microbiology 147, 643–651.
biological activities of lantibiotics with unique post-translational
modifications. Eur J Biochem 230, 827–853.
Jack, R. W., Tagg, J. R. & Ray, B. (1995). Bacteriocins of Gram-
Takala, T. M. & Saris, P. E. (2002). A food-grade cloning vector for
positive bacteria. Microbiol Rev 59, 171–200.
Klaenhammer, T. R. (1993). Genetics of bacteriocins produced by
lactic acid bacteria. FEMS Microbiol Rev 12, 39–85.
Lee, S. S., Hsu, J.-T., Mantovani, H. C. & Russell, J. B. (2002). The
effect of bovicin HC5, a bacteriocin from Streptococcus bovis HC5,
on ruminal methane production in vitro. FEMS Microbiol Lett 217,
51–55.
Lewington, J., Greenaway, S. D. & Spillan, B. J. (1987). Rapid small
scale preparation of bacterial genomic DNA, suitable for cloning and
hybridization analysis. Lett Appl Microbiol 5, 51–53.
Mantovani, H. C., Hu, H., Worobo, R. W. & Russell, J. B.
(2002). Bovicin HC5, a bacteriocin from Streptococcus bovis HC5.
Microbiology 148, 3347–3352.
lactic acid bacteria based on the nisin immunity gene nisI. Appl
Microbiol Biotechnol 59, 467–471.
ten Brink, B., Minekus, M., van der Vossen, J. M. B. M., Leer, R. J. &
Huis In’t Veld, J. H. J. (1994). Antimicrobial activity of lactobacilli:
preliminary characterization and optimization of production of
acidocin B, a novel bacteriocin produced by Lactobacillus acidophilus
M46. J Appl Bacteriol 77, 140–148.
Villani, F., Aponte, M., Blaiotta, G., Mauriello, G., Pepe, O. &
Moschetti, G. (2001). Detection and characterization of a bacter-
iocin, garviecin L1-5, produced by Lactococcus garvieae isolated from
raw cow’s milk. J Appl Microbiol 90, 430–439.
Whitford, M. F., McPherson, M. A., Forster, R. J. & Teather, R. M.
(2001). Identification of bacteriocin-like inhibitors from rumen
McAuliffe, O., Ross, R. P. & Hill, C. (2001). Lantibiotics: structure,
Streptococcus spp. and isolation and characterization of bovicin 255.
Appl Environ Microbiol 67, 569–574.
biosynthesis and mode of action. FEMS Microbiol Rev 25, 285–308.
Woodruff, W. A., Novak, J. & Caufield, P. W. (1998). Sequence
Meyer, H. E., Heber, M., Eisermann, B., Korte, H., Metzger, J. W. &
Jung, G. (1994). Sequence analysis of lantibiotics: chemical
analysis of mutA and mutM genes involved in the biosynthesis of the
lantibiotic mutacin II in Streptococcus mutans. Gene 206, 37–43.
108
Downloaded from www.sgmjournals.org by
IP: 93.91.26.97
On: Tue, 07 Jul 2015 07:57:32
Microbiology 150