Seminario Glúcidos 3 y lípidos 1. Comente los mecanismos de

Transcription

Seminario Glúcidos 3 y lípidos 1. Comente los mecanismos de regulación del ciclo de Krebs. Los productos que se obtienen del ciclo, en que otras vías metabólicas participan. 2. A partir de glucosa, describa el destino de los diferentes carbonos a través de las rutas metabólicas en que participa. 3. Describa el modo de acción de Celulasas. 4. Describa el mecanismo de acción de la ATP sintasa. 5. Que relación existe entre la síntesis de ácidos grasos y el ciclo de Krebs? 6. Describa diferencias y similitudes de la ácido graso sintasa de vertebrados, levadura y bacterias. Cómo es el mecanismo de acción? 7. Se adjuntan algunos trabajos científicos relacionados con el tema, como lectura complementaria. Puede escoger alguno(s) para leer y comentarlos en clases. Si tiene dudas específicas de los papers puede venir a consultarme, el día miércoles 6 de noviembre a las 17 hrs. Sobre el paper de las celulasas, se le puede consultar a una de las autoras, que trabaja en el laboratorio de bioquímica. Marcela Vega, [email protected]. OXIDATION
OF FATTY
ACIDS
AND TRICARBOXYLIC
CYCLE INTERMEDIATES
BY ISOLATED
RAT
LIVER
MITOCHONDRIA*
BY EUGENE
(From
the
Departments
P. KENNEDYt
of Biochemistry
AND
ALBERT
L. LEHNINGER
and Surgery, University
(Received for publication,
ACID
of Chicago,
Chicago)
March 2, 1949)
* Thii investigation was supported by grants from the American Cancer Society
(recommended by the Committee on Growth of the National Research Council),
Mr. Ben May, Mobile, Alabama, and the Nutrition
Foundation,
Inc.
t Nutrition Foundation Fellow in Biochemistry.
957
Downloaded from www.jbc.org at Boston University Medical Library on March 20, 2008
Beginning with the fundamental observation of Warburg in 1913 (1) it
has been a general finding that the more highly organized enzyme systems of
animal tissues responsible for oxidation of metabolites by molecular oxygen
are associated with the insoluble particulate portion of the cell. Among
the several approaches which have been used to study the morphology and
composition of such catalytically active particulate material, the most fruitful has been the differential centrifugation technique for separation of
nuclei, mitochondria or “large granules,” and other substructures developed
by Bensley and his school (2) and refined by Claude (3,4) and Hogeboom,
Schneider, and Pallade (5, 6). Considerable work on the composition and
enzymatic activity of the various particulate fractions has been described
by the Rockefeller group (7, 8), Schneider (9), and other investigators.
For instance, quantitative assayshave revealed that most of the succinoxidase and cytochrome oxidase activity is present in the mitochondria or
“large granules” (7).
In this laboratory studies have been made on the enzymatic oxidation of
fatty acids to acetoacetate and also via the Krebs tricarboxylic acid cycle.
These complex and highly organized reactions take place in suspensionsof
particulate material separated from rat liver homogenates by centrifugation
(10, 11). Certain observations on the properties of this enzyme system
(11) suggested that the activity was to some extent dependent on osmotic
factors, and Potter, on the basis of measurementsof “cytolysis quotients,”
suggestedthat the activity was present only in intact cells (12).
With the publication of what appears to be a definitive method for the
isolation of mitochondria or “large granules” by Hogeboom, Schneider, and
Pallade (5,6), it was possibleto demonstrate that mitochondria isolated by
this method bear all the demonstrable fatty acid oxidase activity of whole
rat liver. The particulate material isolated by this method is stated to be
homogeneousand identical in morphology and vital staining characteristics
958
OXIDATION
OF
FATTY
ACIDS
with the mitochondria
of the intact cell (6); mitochondria
isolated by
the earlier procedures of Bensley and Hoerr (2) and Claude (3) apparently
represent partially damaged forms without these properties.
Since the publication of our preliminary note on the localization of fatty
acid oxidase activity in these particles (13), Schneider has published a confirmatory report (14). This paper is concerned with the experimental details of the basic experiments.
Analytical Methods-Octanoate
was determined by the method of Lehninger and Smith (15), acetoacetate by a modification of the method of Greenberg and Lester (16), and citrate by the method of Speck, Moulder, and
Evans (17). Manometric measurements of oxygen uptake were made at
30” in Warburg vessels of conventional design with air as the gas phase.
Flasks were equilibrated for 5 minutes prior to closing of the taps. Determinations of inorganic and total phosphorus were made according to the
method of Gomori (18) and partition of the phosphorus of the enzyme
preparations was carried out according to methods described by Schneider
(19) and Schmidt and Thannhauser (20). Radioactivity
measurements
were made on thin layers of aqueous solutions by means of a Geiger-Mtiller
counting tube and recording apparatus of standard commercial type. Separations of esterified phosphate for these measurements were performed as
described elsewhere (21).
Preparation of Mitochondria from Rat Liver-The
procedure of Hogeboom,
Schneider, and Pallade (5, 6) was used for the preparation of the particulate fractions of rat liver. Normal adult albino rats of Sprague-Dawley
stock were used throughout this study. The animals were killed by decapitation and exsanguinated.
The livers were quickly removed and chilled
in cracked ice. All operations during the preparation of the fractions
were carried out in a room maintained at 2” and all reagents and apparatus
were previously chilled. The fresh, chilled rat liver was homogenized in
9 volumes of cold 0.88 M sucrose in a glass homogenizer of the type described by Potter and Elvehjem (22). Nuclei, whole cells, stroma, and
erythrocytes were removed by three successive centrifugations, each of 3
minutes duration, at about 1500 X g in the Sorvall model SP centrifuge.
The mitochondria were then sedimented from the cleared supernatant by
centrifugation in a Sorvall model SS-1 centrifuge at 18,000 X g for 20 minutes. The sedimented mitochondria
were washed by resuspension in 10
volumes of 0.88 M sucrose, followed by resedimentation for 20 minutes at
18,000 X g. The supernatant was carefully decanted and the washed mitochondria were taken up in sufhcient ice-cold 0.15 M KC1 or water (about
5.0 ml. for each gm. of whole tissue used as starting material) to yield a sus-
EXPERIMENTAL
E.
P.
KENNEDI’
AND
A.
L.
LEHNINGER
959
pension containing about 1 mg. of total nitrogen per ml. The fmal concentration of KC1 in the fatty acid oxidase test system was about 0.05 M,
a value shown to be near the optimum for fatty acid oxidation in a previous study (11). In experiments in which the mitochondria were taken
up in distilled water, sufficient KC1 was added to the test flasks to provide a fmal concentration of about 0.05 M.
Throughout these fractionations, it was found essential that low temperatures be maintained in order to preserve enzyme activity.
We have found
that the Sorvall angle centrifuges are especially well adapted for this purpose, since the temperature rise during centrifugation in the cold room is
held to a minimum.
The International
refrigerated centrifuge has also
been used with complete success. Although these fractions can be obtained
at higher temperatures, their ability to oxidize fatty acids and Krebs
cycle intermediates then becomes greatly attenuated or lost, probably because of enzymatic destruction of as yet unidentified cofactors.
Microscopic examination showed that the mitochondria so prepared were
free of whole cells, nuclei, and dhbris, confirming the work of Hogeboom
et al. who have stated that this procedure yields morphologically
intact
mitochondria free of extraneous elements (6). We have found that these
preparations are contaminated to a small degree with erythrocytes.
These
extraneous elements may be removed by taking up the unwashed pellet
of mitochondria which had been sedimented once in 10 volumes of 0.88 M
sucrose as described above, and subjecting the suspension at this point
to two or three preliminary sedimentations at low speed (2000 X g), each
of 5 minutes duration.
The main bulk of the mitochondria, now freed of
red blood cells, is then sedimented by means of a 20 minute centrifugation
at 18,000 X g. This procedure also reduces the desoxypentose nucleic acid
phosphorus content of the mitochondria preparations to vanishingly small
values. The phosphorus distribution in the mitochondria is discussed more
fully in a later section of this paper.
To avoid the necessity of a high speed centrifuge for the preparation of
mitochondria, we have also used an abridged procedure which yields preparations of mitochondria which are entirely satisfactory for the study of the
enzyme systems involved in this report. The 0.88 M sucrose extract of rat
liver, freed of nuclei and whole cells exactly as described above, is sedimented at 2400 X g for 30 minutes at 0” in the Sorvall model SP angle
centrifuge.
The supernatant is decanted and the mitochondria are then
washed by resuspension in 10 volumes of 0.15 M KC1 and resedimented by
centrifugation for 7 minutes at 2400 X g. While the yield of mitochondria
obtained by this procedure is not so large as in the standard procedure, the
material appears to be identical in composition and enzymatic activity.
A second abridged procedure has also been used for preparing mitochondria.
960
OXIDATION
OF
FATTY
ACIDS
The 0.88 M sucrose extract of rat liver, after removal of nuclei, etc., by
preliminary
centrifugations
as outlined by Hogeboom et al., is treated
with 0.1 volume of 1.5 M KC1 and allowed to stand in an ice bath for
5 to 10 minutes.
The addition of salt causes agglutination
of a large
part of the mitochondria and they are now sedimentable in 5 to 10 minutes
at 2000 X g. The sedimented material can then be washed with 0.15 M
KC1 solution to free it of sucrose.
Such material appears to be identical
in enzymatic behavior with the material obtained by the original method
of Hogeboom et al. and is obviously more convenient to prepare.
All experiments reported in this paper were done with mitochondria
prepared by the original method of Hogeboom et al. with or without the
additional low speed centrifugations
to remove extraneous erythrocytes.
Distribution
of Fatty Acid Oxidme Activity in Particulate Fractions of
Rat Diver-The
three principal fractions obtained from 0.88 M sucrose
homogenates by the procedure of Hogeboom et al. described above were
tested for fatty acid oxidase activity.
Sodium octanoate was used as substrate in the standard test system described previously
(11). The fractions tested were the “nuclear precipitate,”
containing principally nuclei,
whole cells, erythrocytes,
and stroma, together with some mitochondria;
the mitochondria
or “large granules” of the rat liver, in a purified condition
almost entirely free of extraneous structures;
and the supernatant,
containing “microsomes”
(6), ultramicroscopic
particles, and the soluble material of the rat liver homogenates.
In these experiments, the “nuclear
precipitate”
was washed once with ice-cold isotonic KC1 to free it of oxidizable metabolites.
No attempt was made to free the final supernatant
of sucrose, which was thus present in the flasks at about isotonic concentrations.
Previous work has shown that this concentration
of sucrose is
somewhat inhibitory to the oxidation.
Typical results of such tests are summarized in Table I. It is seen that
only the mitochondrial
fraction has the ability to oxidize octanoate as evidenced by octanoate disappearance, oxygen uptake, and acetoacetate formation.
In comparable amounts as judged by total nitrogen determination, the “nuclear fraction”
and the supernatant
were quite inactive in
fatty acid oxidation.
Furthermore,
other experiments in which suspensions of mitochondria were tested in combination with the nuclear fraction
and with the supernatsnt
indicated that there was no stimulation of fatty
acid oxidation over that shown by the mitochondria
alone, nor was there
any significant inhibition.
Schneider (14) has found that the addition of
either the nuclear fraction or the supernatant or both to the mitochondrial
fraction increased the activity of the latter slightly.
However, Schneider
did not add to his test system catalytic amounts of the Gdicarboxylic
acids needed for the full activity of the fatty acid oxidase system (11).
E.
P.
KENNEDY
AND
A.
L.
961
LEHNINGER
It is possible that the other fractions contributed trace amounts of such
compounds, accounting for the small stimulation
observed by Schneider.
These preparations of mitochondria
showed activity in the oxidation of
fatty acid, based on total enqme nitrogen values, at least as great as the
most active preparations obtained previously from isotonic saline homogenates. The &oz of such preparations (cmm. of oxygen taken up per
Acid
Oxidase
Activity
of Fractions
Prepared
of Rat Liver
from
0.88
111Sucrose
Homogenates
The Warburg vessels contained a final volume of 5.0 ml. The final concentrations
of added substances were as follows: KCl, 0.05 M; sodium L-malate, 0.0005 M;
MgSO1, 0.005 M; phosphate buffer, pH 7.4, 0.01 M; adenosine triphosphate,
0.0005
M; and cytochrome c, 1 X 10-S M. Water was substituted for sodium octanoate,
0.002 M, in control vessels. The flasks were incubated at 30” for 45 minutes with
air as the gas phase. An aqueous suspension of the nuclear precipitates and mitochondrial fractions was added to the respective test systems in amounts representing
the yields from 450 mg. of fresh, wet tissue in Experiment 1, and 375 mg. in Experiment 2. The supernatant fraction was derived from 150 mg. of fresh tissue in each
experiment.
-
EXp.26
malt
NO.
1
-
Octmoate
FtaCth
1
Mitochondria..
“Nuclear
2
-
.. .
ppt.“.
Supernatant
.
Mitochondria.
.
“Nuclear
Supernatant
ppt.“.
.
. .
. ..
..
.
.
.-
m.
w
2.7
2.7
3.5
3.5
4.5
4.5
6.1
23.2
1.5
2.3
1.3
1.0
3.0
16.1
2.9
3.4
2.9
3.3
.
-
-
Iry
8.0
0.9
5.1
0.0
w
0.3
8.5
0.3
1.1
0.2
0.2
0.5
4.1
0.0
0.9
mg. of dry weight per hour at 38” in the presence of octanoate substrate) is
approximately 65 to 70. Due to variable losses of activity during preparation, it is probable that these values are not maximal.
It was of considerable interest to determine whether the cofactor requirements of the fatty acid oxidase complex in the mitochondria
were
essentially the same as those previously described (11) for saline-washed
particulate material of rat liver. The requirements of the suspensions of
mitochondria for added cofactors needed for fatty acid oxidation are sum-
I
TABLE
Fatty
962
OXIDATION
OF
FAlTY
ACIDS
Requirements
The system is identical
for 70 minutes.
When the
tain the volume constant.
containing about 1.3 mg.
by washing with isotonic
TABLE
II
of Fatty Acid Oxidation
with that described in Table I, except that incubation was
components were omitted, water was substituted to mainThe mitochondria
were added as an aqueous suspension,
of enzyme N per flask, after sucrose had been removed
KCl.
Oa uptake
Complete system ...........
Octanoate omitted. ........
Malate omitted. ...........
MgSO,
“
............
Cytochrome c omitted. . ,
KC1 omitted. ..............
ATP
.“
...............
in Mitochondria
Octanoate
A&to&ate
diS~ppCCLIaIlCe
PM
PM
w
12.3
2.5
0.93
3.6
8.5
3.2
0.45
2.7
2.2
0.5
0.4
0.6
1.4
0.5
0.2
0.2
0.0
1.3
0.0
0.0
a requirement
for added KC1 or other solute, previously shown to be
necessary for the enzyme complex, can be demonstrated for the purified
mitochondria only if these particles are first washed free of sucrose, which
otherwise completely replaces added KCl, as previous work has shown (11).
Schneider (14) reported that mitochondria
isolated from 0.88 M SUcrose homogenates showed very low rates of octanoate oxidation.
However, he did not supplement his test system with the G-dicarboxylic acids.
As the data in Table II show, the presence of malate is absolutely essential
for oxidation of octanoate in mitochondria prepared by this method and
this fact probably explains his failure to find appreciable activity.
Localization of the fatty acid oxidase activity in the mitochondria prepared from 0.88 M sucrose suspensions implies that the saline-washed particulate material previously studied (11) actually was enzymatically active
that
marized in Table II. It can be seen that they are identical with those previously reported, magnesium ions, neutral salt, adenosine triphosphate,
cytochrome c, and catalytic amounts of malate being necessary for full
activity.
In the mitochondria, however, the oxidation proceeds at about
half the optimum rate in the absence of added cytochrome c. The water
suspensions of saline-washed enzyme previously studied were almost completely dependent upon added cytochrome c for activity (11). This difference is most probably due to the fact that the method used for the preparation of the purified mitochondria allows these structures to be obtained
in a more nearly undamaged form, without loss of cytochrome c by “leaching out” during the course of the preparation.
It should be noted further
E.
P.
KENNEDY
AND
A.
L.
963
LEHNINGER
TABLE
Activity of Mitochondria
Isolated
Mitochondria
III
from Saline-Washed
Enzyme
Isolated
Directly
from Fresh
System
Liver
Compared
with
The test system is the same as that in Table I, except that the octanoate concentration was 0.001 M. Water was added to replace octanoate in control flasks, and
incubation was for 60 minutes.
Mitochondria
derived from 375 mg. of fresh tissue
were added to each flask.
-----7-Mitochondria
I
From fresh liver
Isolated
from saline-washed
enzyme
1
+
+
Ij
CcY
i
3.3
15.3
1.7
14.9
/I
PM
PM
I
5.0
i
/
5.0
j
/
/
0.1
5.7
0.2
4.9
saline-washed particulate enzyme system previously studied contains sufficient particulate material, having sedimentation characteristics identical
with those of mitochondria from fresh whole liver extracts, to account for
all the fatty acid oxidase activity observed in the crude preparation.
The
finding that the mitochondria, as isolated by the sucrose procedure from the
whole liver cells, are the site of the enzymatic oxidation of fatty acid, and
that apparently identical particles can be extracted by the same procedure
from particulate rat liver enzyme preparations show identical activity,
strongly supports the view that the mitochondria
or “large granules” are
the sole intracellular structures of the rat liver active in fatty acid oxidation under the test conditions used. It should be stressed that the fatty
acid oxidase system is made up of many individual enzymes and is obviously extremely complex. It is conceivable that the nuclear fraction or
the supernatant may actually contain some of the individual enzymes neces-
because of its content of mitochondria.
In order to settle this point conclusively, a saline-washed preparation of the particulate matter of rat
liver was made (ll), suspended in 10 volumes of 0.88 M sucrose, and lightly
homogenized.
This suspension was then subjected to the procedure of
Hogeboom et al. for obtaining mitochondria
from whole liver. Three
centrifugations at 2000 X g were made to remove nuclei, erythrocytes,
and whole cells. The mitochondria remaining in the suspension were then
sedimented at high speed and washed as usual. A control preparation of
mitochondria made from the same weight of the same rat liver was isolated
directly by the technique described in the preceding section. Both suspensions of enzyme were tested for fatty acid oxidase activity.
The results are summarized in Table III.
The data clearly indicate that the
964
OXIDATION
OF
FAT’PY
ACIDS
sery for fatty acid oxidation but may be totally deficient in one or more
enzymes of the system, causing over-all inactivity.
Oxidation of Krebs Tricarboxylic Acid Cycle Intermediates in MitochondriaSince the saline-washed particulate material previously studied contains
all the enzymes involved in the Krebs cycle and since the mitochondria had
previously been shown to contain considerable succinoxidase activity (7),
it was of interest to determine whether isolated mitochondria also possessed
IV
Fractions of Rat Liver in Ozidation of Intermediate Compounds
of Krebs Cycle
The flask contents were as follows: glycylglycine buffer, pH 7.2,0.033 M; adenosine
triphosphate,
0.0005 M; cytochrome c, 1 X UF M; MgSO+ 0.005 M; 0.1 ml. of orthophosphate containing Pa*, 359,000 counts per minute (the phosphate esterification
data are in Table VI). The final concentration
of substrates was 0.01 Y in each
case, except for oxalacetate and pyruvate which were added together at a concentration of 0.005 M each. Mitochondria
and nuclear precipitate fractions were added,
so that each flask contained an amount of material derived from 225 mg. of fresh wet
liver tissue. The flasks containing
supernatant
were tested with the material
derived from 90 mg. of tissue. The final volume wss 3.0 ml.; incubation
for 40
minutes with air as gas- phase.
Substrate
Fraction
Oxygen
uptake
PJf
Mitochondria
“Nuclear
ppt.”
Supernatant
-
Citrate
cu-Ketoglutarate
Pyruvate + oxalacetate
None
Citrate
a-Ketoglutarate
None
Citrate
a-Ketoglutarate
None
7.1
6.3
7.1
0.18
1.9
1.7
0.98
0.0
0.54
0.0
1.4
0.31
the enzymatic equipment necessary for the oxidation of pyruvate and other
intermediates of the Krebs cycle. The results of a typical experiment in
Table IV indicate that intermediate
compounds of the Krebs cycle are
readily oxidized by suspensions of rat liver mitochondria.
The nuclear
and microsome fractions showed slight activity, which may have been due
to contamination
of these fractions by mitochondria.
The substrates
tested in this experiment were pyruvate plus oxalacetate, citrate, and
cr-ketoglutarate.
These oxidations represent key enzymatic steps of the
Krebs cycle. In addition, these mitochondrial
preparations are capable
TABLE
Activity of Subcellular
E.
P.
KENNEDY
AND
A.
L.
965
LEHNINQER
TABLE
V
from Malate and Pyruvate
in Mitochondria
The flask contents were as follows: 0.05 M KCl, 0.005 M MgSOd, 0.01 M phosphate,
pH 7.4, 0.0005 M adenosine triphosphate,
and 1W5 M cytochrome c. The final concentration of malate and pyruvate was 0.01 M in each case, and the final volume
was 3.0 ml. Each flask contained mitochondria suspended in 0.15 M KC1 equivalent
to about 1 mg. of enzyme N. The time of incubation was 65 minutes at 30” with
air as the gas phase.
Citrate
Formation
Substrate
Pyruvate only.
Malate only. . .
.
Pyruvate + malate. . .
None.............................
oxygen
.
..
upt&
Pyruvate
used
Citrate
formed
PM
PM
10.1
10.7
13.5
0.5
18.4
3.9
9.4
2.3
10.4
0.0
oxidations and to fatty acid oxidation is present in purified mitochondria,
such oxidations were carried out in the presence of inorganic phosphate
labeled with P32. At the completion of the incubation, the carrier-diluted
inorganic phosphate was removed from the neutralized trichloroacetic
acid filtrates by repeated magnesia precipitation (21) and the radioactivity
of the esterified phosphorus fractions determined. The data are presented
in Table VI. It can be seenfrom these data that both Krebs cycle oxidations and octanoate oxidation in the suspensionsof mitochondria cause
extensive incorporation of the P32into the esterified fraction.
Phosphorus Distribution in Purified Mitochondria-Previous
workers in
describing the chemical constitution of the mitochondria (4, 23) have emphasized the high content of phospholipide in these structures and the
fact that they contain nucleic acid of the pentose nucleic acid type. The
distribution of phosphorus in a typical preparation of mitochondria made
of catalyzing the condensation of oxalacetate and pyruvate to yield citrate.
The experiment summarized in Table V shows aerobic citrate formation
from pyruvate when malate served as a source of oxalacetate.
Ester$.cation of Phosphate Coupled to Oxidation in Mitochmdrial
Preparations-The
oxidation of fatty acids and of the intermediate compounds of
the Krebs cycle proceeds with the release of considerable amounts of energy.
It is now well known that energy released during oxidations over the Krebs
cycle may be recovered in part by coupled esterification of inorganic phosphate.
More recently it has been shown that oxidation of octanoate by
particulate rat liver preparations
also caused coupled esterification
of inorganic phosphate (11). In order to determine whether the enzymatic
equipment necessary for esterification of phosphate coupled to Krebs cycle
966
OXIDATION
OF
FA’ITY
ACIDS
by the standard method of Hogeboom et al. (5) is presented in Column I
of Table VII.
Characteristically
high values of phospholipide phosphorus,
VI
Ozidations in Mitochondria
The conditions of Experiment 1 (Krebs cycle oxidations) were exactly aa described
for experiments summarized in Table IV. In Experiment 2 (fatty acid oxidation)
vessels contained 0.005 M MgClr, 0.01 M glycylglycine buffer, pH 7.4, 1 X lo+ M
cytochrome c, 0.001 M adenosine triphosphate,
0.0001 M malate, 0.05 M KCl, 0.001 M
octanoate, and inorganic orthophosphate
labeled with 157,000 counts per minute
of Pn. Octanoate was omitted in the control vessel. The time of incubation was
20 minutes at 30”.
TABLE
Esterijication
of Phosphaie
Coupled
to
1
1
2
/
None
Citrate
a-Ketoglutarate
None (0.0001 M malate present)
Octanoate
TABLE
Distribulion
of Phosphorus
in Mitochondria
of Rat
EstePed
Pm
esterflied
CM
‘I
per CnJ
0.18
7.1
6.3
7.1
0.5
4.5
24.2
106
113
113
37
121
0.67
31.3
39.3
32.6
3.2
27.8
OJ uptske
VII
Derived
Livers
from
0.88 kr Sucrose
Homogenates
Total nucleic acid phosphorus was determined by the method of Schneider (19).
Pentose nucleic acid was differentiated
from desoxypentose nucleic acid by the
method of Schmidt and Thannhauser
(20). In Column 1 are listed values obtained
for mitochondria
isolated by the original method of Hogeboom et al. (6). In Column
2, values are given for such mitochondria
which had been freed of erythrocytes and
other extraneous elements by the modification described in the test.
Per cent of totar P
FW3iO!J
Acid-soluble P.. . . . . . . . . . . . . . . . . . . . . . . .
Lipide P....................................
Total nucleic acid P. . . . . . . . .‘. . . . . . . . .
“Protein”P................................
Desoxypentose nucleic acid P. . . . . . . . . . . . .
Pentose nucleic acid P.. . . . . . . . . . . . . . . . . . . .
PNA-P:DNA-P
. . ... ... ... ... ... .. .... ... ..
Methode~f~ogeboom
-
(1)’
Modified method
(2)
21.3
56
19.3
6.0
1.6
17.8
11.8
15
66
21.3
7.2
0.5
20.8
41.6
and the predominance of pentose nucleic acid, with only small amounts of
desoxypentose nucleic acid, are to be noted. These figures are in fair
Suhstrste
E.
P.
KENXEDY
AEiD
A.
L.
LEHNINGER
967
Fatty Acid Ox&se
Activity of Mitochmdria
Obtained by Other Procedures-
It was found in the course of this work that the choice of solvents in which
the rat liver was homogenized prior to fractionation was of critical importance in the distribution of the fatty acid oxidase activity.
When distilled
water or distilled water made slightly alkaline by the addition of NaOH
(“neutral water”) was used as the medium for the preparation of mitochondria and other particulate fractions according to the procedure of
Schneider (9), no activity in the oxidation of fatty acid could be detected
in any fraction.
Hogeboom et at. (6) have stated that “large granules” obtained by the
use of water as the dispersing medium do not possess the characteristic
morphology and vital staining reactions exhibited by these structures in
the intact liver cell. Our inability to find activity in such preparations supports the view of Hogeboom et al. that “large granules” obtained in this
manner may have undergone irreversible structural changes due to the
hypotonic conditions, which may have caused rupture or leaching out of
necessary components of the enzyme system.
When homogenates of rat liver in isotonic saline solutions are fractionated
according to the technique described by Claude (4), the distribution
of
activity in the oxidation of fatty acids is far different from that observed in
fractions of 0.88 M sucrose homogenates.
Data of such an experiment are
given in Table VIII.
It is seen that the fatty acid oxidase activity is concenI DNA, deeoxypentoee
nucleic acid; PNA, pentose nucleic acid.
agreement with those published by Hogeboom et al. (6) and Schneider (9).
Their data did not include direct measurement of both nucleic acids on the
mitochondrial
fraction but did show that almost all of the desoxypentose
nucleic acid was in the first nuclear precipitate.
Our direct analysis of the
mitochondria shows the presence of appreciable amounts of DNA,’ which
may be due to contamination
by other morphological elements.
In Column 2 is given the phosphorus distribution
in another preparation of
mitochondria which had been subjected to more extensive removal of extraneous elements by repeated centrifugation at low speed prior to the resedimentation of the washed particles at high speed as already described.
It can be seen that this procedure has reduced the amount of DNA and
raised the ratio of PNA:DNA
from 11.8 to 41.6. This ratio represents
the analytical limit of the methods of Schneider and Schmidt and Thannhauser for measuring pentose nucleic acid and DXU’A in our hands. Preparations with very low DNA values thus obtained were found to be active in
the oxidation of fatty acids. It is difficult to determine whether the last
trace of DNA phosphorus in the preparations studied is analytically significant. It is of course conceivable that trace amounts of DNA are present
normally in the mitochondria.
968
OXIDATION
OF
FATTY
ACIDS
TABLE
Distn%ution
VIII
of Fatty Acid Oxidaae Activity in Subcellular Fractions
Zsotonic Saline Homogenates of Rat Liver
Derived from
The test conditions were the same as those described in Table I, except that the
final volume was 3.0 ml. Incubation was for 30 minutes at 30”.
-
FraCtiOn
“Large
Egrr’&N
granules”
w.
1.1
ppt.”
2.2
“Nuclear
Supernatant
2.3
o%Ete
+++
01 uptake
PJf
-
1.6
1.25
1.6
11.0
0.0
0.5
PJf
0.60
0.31
0.6
3.4
0.60
0.49
The fact that the lesseasily sedimentable fraction called “large gra.nules”
by Claude (4), obtained upon more prolonged centrifugation of saline
homogenates in the experiment summarized in Table VIII, is inactive in
the oxidation of fatty acids may possesssome significance. Apparently
the “large granules” derived from saline homogenates are not identical
with those prepared by the hypertonic sucrose method, or they may be
partially disorganized mitochondria of different sedimentation and enzymatic properties. Results of a similar nature reported by Chantrenne
(23) lend some support to this view-point.
These findings point to the possibility that the fatty acid oxidase activity
may be used as an enzymatic indicator for the detection of liver mitochondria in more or less the native condition, in conjunction with microscopic
examination and staining techniques.
Intracellular Distribution of Some Glycolytic Enzymes--The finding that
highly organized respiratory systems are localized in the mitochondria
trated in the “nuclear precipitate,”
containing nuclei, ddbris, and whole cells,
and that the “large granule” fraction is without
activity.
It has been
pointed out by Hogeboom et al. (6) that this first fraction of nuclei and
debris may actually contain a large proportion of the mitochondria
of the
homogenate, since these particles are very largely agglutinated by contact
with isotonic saline solutions and are therefore sedimented with the nuclear
As a matter of fact, it is this fraction which has been used in
fraction.
this laboratory in the past for preparation of the fatty acid oxidase system.
When this fraction is suspended in 0.88 M sucrose, a large part of the mitochondria is redispersed, and is sedimentable only at higher speeds, as the
experiment in Table III indicates.
E.
P. KENNEDY
AND
A.
L.
969
LEHNINQER
Activity
of Some
TABLE
IX
Glycolytic
Enzymes
in
Liver
Fractions
In the oxidation-reduction
system assay the Warburg vessels contained 0.03 M
fructose-1,6-diphosphate,
0.092 M arsenate, 0.02 M sodium fluoride, 0.02 M sodium
pyruvate, 0.048 M NaHCOa, 0.02 M nicotinamide,
and 0.001 M diphosphopyridine
nucleotide.
The liver fractions in amounts specified were tipped in from the side
arm after temperature equilibration.
Total volume, 2.0 ml.; gas phase, 95 per cent
N1-5 per cent CO*; temperature,
30”; time of incubation,
1 hour.
co2 liberated
Nuclear. . . . . . . . . . . . . . . . . . . . . .
Mitochondria..
.. ... .,. ... ... .
Supernatant. . . . . , . . . . . . . . . . . . .
Whole homogenate. . . . . . . . . . . .
w.
c.mm.
60
60
20
20
18
10
90
110
Oxidationreduction
activity*
+or ted
AIdolase
activityt
of faw
5.4
3.0
81.7
WV
* The && (30”) of the whole liver homogenate under these conditions
t &rmp (24) at 38” of whole liver homogenate was 56.
was 27.5.
Fluoride was added to inhibit enolase and the end-point measured manometrically indicated the formation of 3-phosphoglyceric acid, which causes
CO9 liberation from a bicarbonate buffer. The conditions used were found
to give approximately linear results with varying concentrations of an
extract of rabbit muscle. When the different fractions were assayed for
the presence of the three enzymes involved in the reaction, the mitochondria and the nuclear precipitate contained only a very small fraction
of the activity, whereas the supernatant, containing all the soluble material
of rat liver as well as difficultly sedimentable particles (“microsomes,”
etc.), contained 82 per cent of the activity shown by the original unfractionated homogenate (see Table IX).
Also shown in Table IX is the distribution of aldolase in the different fractions, measured by the method of
Sibley and I&ringer
(24). It is seen that the particulate fractions con-
raises the question of the intracellular location of other organized enzyme
systems.
In contrast to the respiratory systems, which are associated with
particulate matter, the glycolytic enzymes all appear to be readily soluble
and several have been crystallized.
It was therefore of interest to examine
the different fractions of rat liver for their ability to catalyze the oxidation-reduction
reactions of glycolysis.
The system studied involved fructose-l ,6-diphosphateassubstrate,
aldolase, triose phosphatedehydrogenase,
diphosphopyridine
nucleotide, and arsenate to “decouple” the phosphorylation step, and lactic dehydrogenase and pyruvate as hydrogen acceptors.
970
OXIDATIOE;
OF
FATTY
ACIDS
DISCUSSION
The data reported in this paper show that the complex enzyme systems
responsible for the oxidation of fatty acids and Krebs cycle intermediates
and esterification of phosphate coupled to these oxidations are localized in
that fraction of rat liver which consists of morphologically
intact mitochondria or “large granules,” almost completely free of other formed elements. As has been pointed out, it is not possible with our present knowledge of these complex systems to assay individual enzymes of these systems
quantitatively
and it is therefore conceivable that other elements such as
the nuclei, “microsomes,” or soluble material may be capable of many of
the enzymatic transformations involved in the over-all reactions studied.
The striking fact is that all the individual enzymes concerned in these
complex systems should be found in one species of morphological element.
These findings in some measure justify the early views of Altmann (27)
that these bodies are fundamental biological units and possess a certain
degree of autonomy and certainly, together with the considerable work
already done on their enzymatic and chemical composition by the Rockefeller school, Schneider, and others, provide considerable basis for the apt
designation “intracellular
power plants” conferred on the mitochondria
by Claude.
Although the mitochondria appear to be the major site of these activities,
it would appear from our examination in vitro that these bodies are not
completely autonomous with respect to their respiratory behavior, since
they must be supplemented with certain cofactors such as adenosine tri-
tain only a very small fraction of the total aldolase of rat liver, 96 per cent
being present in the soluble fraction.
Although assay of all the individual enzymes of glycolysis in these fractions may eventually show that one or more of these enzymes are present
in the mitochondria, it appears certain that the mitochondria do not possess
the complete enzymatic machinery for the conversion of glycogen or glucose to lactic acid at a rate comparable to the rate of respiration of these
bodies. LePage and Schn >:der have recently shown that particulate fractions of rat tumors or r&&t liver have little or no ability to glycolyze
glucose, most of the activity being in the soluble fraction (25).
In addition to these data, it has been found by Friedkin in this laboratory (cf. (26)) that isolated mitochondria a.re capable of incorporating inorganic phosphate labeled with PE into pentose nucleic acid, phospholipide,
and an unidentified acid-insoluble “phosphoprotein”
fraction coupled to
the oxidation df substrates of the Krebs tricarboxylic acid cycle. It would
therefore appear that these bodies are also capable of at least one type of
reaction leading to synthesis of these intracellular materials.
E.
P.
KENNEDY
AND
A.
L.
LEHNINGEB
971
Morphologically
homogeneous mitochondria (“large granules”) separated
from rat liver dispersions by the hypertonic sucrose method of Hogeboom,
Schneider, and Pallade contain essentially all the measurable activity of
the liver in the oxidation of fatty acids. Likewise, the integrated reactions
of the Krebs tricarboxylic acid cycle are found in this fraction.
Esterification of inorganic phosphate accompanies these oxidations in purified
preparations of mitochondria.
These bodies have insignificant glycolytic
activity.
“Mitochondria”
prepared by other methods involving saline
or water as the dispersing media are inactive in these reactions, possibly
because of osmotic damage.
phosphate and Mg++. It appears likely that in the cell there is a rapid
interchange of these factors, substrates, and inorganic phosphate between
the cytoplasm and the mitochondria.
It also would appear that these
bodies are dependent on the cytoplasm for certain preparatory metabolic
activities such as glycolysis, since, as our data show, they are almost completely lacking in glycolytic activity.
Claude has found that isolated mitochondria
are quite sensitive to
changes in osmotic pressure (4). Adverse osm(i:;j’n conditions may therefore be responsible for the inactivity of the mitochondria
in catalyzing
fatty acid oxidation in hypotonic reaction media; when the concentration
of neutral salts or non-electrolytes approximates isotonicity, the system
shows maximum activity.
No attempts have been made to determine
whether the mitochondria
are morphologically
intact in all stages of the
enzymatic reaction.
It is also of some interest that mitochondria are capable of causing oxidation-coupled incorporation of labeled inorganic phosphate into nucleic acids
and phospholipides of these structures (cf. (26)). The work of Hill and
Scarisbrick (28) and Warburg and Liittgens (29) on the photochemical
activity of isolated chloroplaats or granules derived therefrom provides
some indication that highly organized enzyme systems are localized in
analogous structures of plant cells.
The localization of organized respiratory activity in mitochondria poses
some problems in connection with the separation and purification of the
individual enzymes involved.
The difficulties in rendering such enzymes
as cytochrome oxidase and succinoxidase soluble are well known (30, 31).
Recent work in this laboratory indicates that the separation from mitochondrial preparations in soluble form of simple dehydrogenase proteins
which might be expected to be readily soluble is also quite difficult and a
variety of drastic procedures has failed to release any signif&nt
amount
of such proteins into soluble form.
972
OXIDATIOlU
OF
FATTY
ACIDS
BIBLIOGRAPHY
1.
2.
3.
4.
5.
6.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
7.
Warburg, O., Arch. ges. Physiol., 164, 599 (1913).
Bensley, R. R., and Hoerr, N. L., Anat. Rec., 60, 251 (1934).
Claude, A., Proc. Sot. Exp. Biol. and Med., 59, 398 (1938).
Claude, A., J. Ezp. Med., 64. 51, 61 (1946).
Hogeboom, G. H., Schneider, W. C., and Pallade, G. E., Proc. Sot. Ezp. Biol.
and Med., 66, 320 (1947).
Hogeboom, G. H., Schneider, W. C., and Pallade, G. E., J. Biol. Chem., 173, 619
(1948).
Hogeboom, G. H., Claude, A., and Hotchkiss, R. D., J. Biol. Chem., 165, 615
(1946).
Schneider, W. C., Claude, A., and Hogeboom, G. H., J. Biol. Chem., 172, 451
(1948).
Schneider, W. C., J. Biol. Chem., 165, 585 (1946).
Lehninger, A. L., J. Biol. Chem., 164, 291 (1946).
Lehninger, A. L., and Kennedy, E. P., J. Biol. Chem., 173. 753 (1948).
Potter, V. R., J. Biol. Chem., 163, 437 (1946).
Kennedy, E. P., and Lehninger, A. L., J. Biol. Chem., 172, 847 (1948).
Schneider, W. C., J. Biol. Chem., 176, 259 (1948).
Lehninger, A. L., and Smith, S. W., J. Biol. Chem., 173, 773 (1948).
Greenberg, L. A., and Lester, D., J. Biol. Chem., 164, 177 (1944).
Speck, J. F., Moulder, J. W., and Evans, E. A., Jr., J. Biol. Chem., 164, 119
(1946).
Gomori, G., J. Lab. and Clin. Med., 27, 955 (1942).
Schneider, W. C., J. Biol. Chem., 16l, 293 (1945).
Schmidt, G., and Thannhauser,
S. J., J. Biol. Chem., 161, 83 (1946).
Lehninger, A. L., J. Biol. Chem., 178, 625 (1949).
Potter, V. R., and Elvehjem, C. A., J. Biol. Chem., 114, 495 (1936).
Chantrenne, H., Biochim. et biophys. acta, 1, 437 (1947).
Sibley, J. A., and Lehninger, A. L., J. Biol. Chem., 177, 859 (1949).
LePage, G. A., and Schneider, W. C., J. Biol. Chem., 176, 1021 (1949).
Friedkin, M., and Lehninger, A. L., J. Biol. Chem., 177, 775 (1949).
Altmann, R., Elementarorganismen,
Leipzig (1890).
Hill, R., and Scarisbrick, R., Nature, 146, 61 (1940).
Warburg, O., and Lattgens, W., Natunuissenschujten,
32, 161, 301 (1944).
Wainio, W. W., Cooperstein, S. J., Kollen, S., and Eichel, B., J. Biot. Chem., 173,
145 (1948).
Hogeboom, G. H., J. Biol. Chem., lSa, 739 (1946).
Enzyme and Microbial Technology 49 (2011) 485–491
Contents lists available at SciVerse ScienceDirect
Enzyme and Microbial Technology
journal homepage: www.elsevier.com/locate/emt
Cloning of novel cellulases from cellulolytic fungi: Heterologous expression of a
family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris
Alejandro Salinas a , Marcela Vega a , María Elena Lienqueo a , Alejandro Garcia b , Rene Carmona b ,
Oriana Salazar a,∗
a
b
Centre for Biochemical Engineering and Biotechnology, Department of Chemical Engineering and Biotechnology, University of Chile, Beauchef 850, Santiago P.O. 8370448, Chile
Department of Wood Engineering and their Biomaterials, Faculty of Forest Sciences and Nature Conservation, University of Chile, Santa Rosa 11315, Santiago Box 9206, Chile
a r t i c l e
i n f o
Article history:
Received 15 February 2011
Received in revised form
15 September 2011
Accepted 11 October 2011
Keywords:
Endoglucanase
Heterologous expression
Lignocellulose hydrolysis
Pichia pastoris
Trametes versicolor
White rot fungi
a b s t r a c t
Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of
sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were
identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding
for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68%
identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH
family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein
was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and
22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family
1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZ␣B vector and
expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary
studies suggest that T. versicolor could be useful for lignocellulose degradation.
© 2011 Elsevier Inc. All rights reserved.
1. Introduction
The study of microbial cellulases has recovered attention in
the last years, mainly because of the increased interest in the
optimization of processes of manufacture of bio-products derived
from lignocellulosic residues, e.g. bioethanol [1]. The cellulosic
bioethanol process requires basically three steps: pretreatment to
loosen up the lignin-cellulose fiber entanglement, hydrolysis of cellulose and fermentation to ethanol. The cellulose hydrolysis is a
complex and expensive process, due mainly to the lignocellulose
structure and recalcitrance. Developments in the field are still necessary in order to decrease the impact of this stage in the whole
process’s economy.
Cellulose hydrolysis is carried out mostly by the action of
cellulases, enzymes acting in concert to release soluble sugars from cellulose [2]. These enzymes are glycoside hydrolases
breaking ␤-1,4-linkages in cellulose with different specificities.
Abbreviations: CBM, carbohydrate binding module; cDNA, complementary
deoxyribonucleic acid; CMC, carboxymethyl cellulose; DNS, dinitrosalicylic acid;
GH, glycoside hydrolase; RT-PCR, reverse transcription polymerase chain reaction.
∗ Corresponding author. Tel.: +56 2 9784711; fax: +56 2 6991084.
E-mail addresses: [email protected] (A. Salinas), [email protected]
(M. Vega), [email protected] (M.E. Lienqueo), [email protected]
(A. Garcia), [email protected] (R. Carmona), [email protected],
[email protected] (O. Salazar).
0141-0229/$ – see front matter © 2011 Elsevier Inc. All rights reserved.
doi:10.1016/j.enzmictec.2011.10.003
Endo-␤-1,4-glucanase (EG; EC 3.2.1.4) hydrolyzes internal glycosidic bonds in cellulose, while exo-␤-1,4-glucanase, or cellobiohydrolase (CBH; EC 3.2.1.91), releases cellobiose from the reducing
or non-reducing ends of the cellulose chain; finally, cellobiase (EC
3.2.1.21) hydrolyzes cellobiose to glucose, which can be consumed
by fermenting microorganisms. Cellulases are typically multidomain proteins consisting of a catalytic core domain linked to a
carbohydrate-binding module (CBM) via a flexible linker region
[3]. Catalytic domains of glycoside hydrolases (GHs) are classified
according to their sequence in more than 120 families [4], while
61 CBMs families have been described up to now (CarbohydrateActive enZYmes Database, http://www.cazy.org/) [5]. Now it is well
understood that other enzymes are also necessary components to
complete and efficient hydrolysis of lignocellulose [6].
Cellulases are produced by many different microorganisms in
nature. Lignocellulolytic enzyme-producing fungi are widespread,
and include species from phylum Ascomycota (e.g. Trichoderma reesei), Basidiomycota including white-rot fungi (e.g. Phanerochaete
chrysosporium), brown-rot fungi (e.g. Fomitopsis palustris) and
other anaerobic species. Historically cellulases have been derived
from Trichoderma species, due to the great capacity of production
of this fungus. T. reesei produces two major cellobiohydrolases
belonging to GH families 6 and 7 (Cel6A and Cel7A, or CBHI and
CBHII, respectively) and at least five endoglucanases classified as
GH families 7, 5, 12, 61 and 45 (Cel7B, Cel5A, Cel12A, Cel61A, and
Cel45A or EGI, EGII, EGIII, EGIV, and EGV) [7]; these enzymes, which
486
A. Salinas et al. / Enzyme and Microbial Technology 49 (2011) 485–491
are produced exclusively when cellulose is available as carbon
source [8], act synergistically to hydrolyze the cellulose [9,10].
Investigations addressed the search and characterization of
novel and more efficient cellulases have driven scientists toward
fungi responsible of white rot in woods, specifically basidiomycetous fungi [6]. In this group, Trametes versicolor has been studied
largely because its ligninolytic properties, which have potential
applications in bioremediation of pulp and paper mill effluents.
Activities of selected wood-degrading enzymes such as cellobiase and cellulase have been monitored in T. versicolor [9,10]. The
existence of an endoglucanase activity in the supernatant of a T.
versicolor culture was reported some years ago [11] but no cloning
or recombinant expression of the enzyme has been informed yet.
Also, a cellobiohydrolase-encoding cDNA from T. versicolor has
been cloned and expressed in Aspergillus niger [9]. In summary,
the potential of T. versicolor as producer of cellulolytic enzymes
is widely recognized, but a systematic study of the functionality of
the T. versicolor cellulases is still incomplete.
The aim of this study was the identification and cloning of
novel endoglucanase genes from native Chilean cellulolytic fungi.
In particular, a new T. versicolor endoglucanase was expressed as
a recombinant protein in Pichia pastoris, a first step addressed to
the enzyme overproduction and future characterization of the cellulolytic properties of this enzyme. The long term purpose is the
isolation of cellulases having efficient hydrolytic action on wood
chips of trees that are abundant in Chile. In this work we have
used Nothofagus pumilio (Lenga beech or Lenga) as lignocellulosic
substrate. Lenga, a native hardwood tree belonging to the family
Nothofagaceae, comprises about 25% of native forest surface and is
an important source of lignocellulosic waste in Chile.
2. Materials and methods
2.1. Nucleic acid manipulations
DNA manipulations were carried out as described [12]. PCR products were purified from agarose gel after electrophoresis using the QIAEXII kit (QIAGEN). PCR
products were cloned into the pGEM-T Easy vector (Promega) and transformed
into Escherichia coli DH5␣ cells. Plasmid DNA was isolated using the QIAprep Spin
Miniprep kit (QIAGEN). Primers, restriction enzymes and Taq DNA polymerase
were supplied by Integrated DNA Technologies, New England Biolabs and Promega,
respectively.
2.2. Fungal growth conditions
A battery of seven Chilean native cellulolytic fungi was supplied by the Laboratory of Biodegradation and Wood Preservation of the Faculty of Forest Sciences and
Nature Conservation of the University of Chile. Cultures of T. versicolor, G. applanatum, Poria placenta, Fusarium oxysporum, Pleurotus ostreatus, Lentinus edodes and
Peniophora gigantea were maintained on potato dextrose agar (PDA) at 4 ◦ C. For
RNA isolation, the fungi were cultured in agar plates at 28 ◦ C for 10 days on induction media [13] including 0.5% (w/v) carboxymethyl cellulose (CMC; Megazyme) or
Avicel (Merck). For induction in liquid medium the same medium was used without
agar.
2.3. Evaluation of the cellulase production by cellulolytic fungi
The production of carboxymethycellulase activity (CMCase) in liquid medium
supplemented with cellulose was evaluated by measuring reducing sugars released
from CMC, after six days inoculation with 1 cm2 PDA culture. The enzymatic reaction was performed as follow: a mixture of 50 ␮L of fungal culture supernatant and
100 ␮L of 1% (w/v) CMC in 50 mM sodium citrate pH 4.8 was incubated for 30 min at
37 ◦ C; reducing sugars were quantified by reaction with dinitrosalicylic acid (DNS)
[14]. Absorbance at 550 nm was measured in a microplate reader (Asys UVM 340,
Eugendorf, Austria) and values were converted to enzyme units by use of a glucose calibration curve. One enzyme unit was defined as the amount of enzyme that
releases 1 ␮mol of glucose equivalent per minute.
2.4. Hydrolysis of N. pumilio wood chips
Supernatant of fungi cultured in induction medium was concentrated by ammonium sulfate precipitation at 80% saturation. Pellets were suspended in 50 mM
sodium acetate buffer pH 6 and dialyzed over night against the same buffer. The
hydrolysis assays were conducted in 50 mM sodium acetate pH 5, using 50 mg mL−1
ionic liquid-pretreated N. pumilio wood chips (0.1–0.2 mm) [15], 0.25 paper filter units (FPU) per mL of concentrated fungal cellulase or Celluclast (Novozyme),
equivalent to 5 FPU g−1 substrate, and 2.5 g L−1 Tween 20. Hydrolysis was conducted
at 50 ◦ C with orbital agitation (300 rpm) for 1.5, 25 or 50 h. Reducing sugars were
measured as indicated in point 2.3. FPU activity was measured as described [16].
2.5. Primers design and bioinformatic analyses
cDNA sequences of fungal GH family 5, 7 and 61 endoglucanase (EC 3.2.1.4)
were obtained from EMBL-EBI database and aligned using ClustalX 2.0.9 [17].
The accession numbers of the sequences used to design the degenerated primers
were Q75UV6, Q5W7K4, Q9C3Z8, O74706, Q4WN62, O59951, Q5TKT6, Q2VRK9,
Q8WZD7, Q12638, Q12624, Q12637 and Q04469 for GH family 5; P07981, Q12714,
Q4WCM9, O13455, Q8NK01, Q4WAJ6, Q12622, P56680, P46237 and Q9HGT3 for GH
family 7 and O14405, Q4WF08, A2QJX0, Q6MYM8, Q7Z9M7 and A2R5N0 for GH family 61. For identification of the partial cellulase sequences, consensus-degenerate
primers were designed based on these alignments, using the CODEHOP strategy
[18]. Specific primers were designed by hand in order to complete the TvEG cDNA
sequence. The primer sequences are shown in Table 1.
Homology analysis was carried out using the BLAST software [19] from the
National Center for Biotechnology Information (NCBI); putative functional domains
identification was carried out by search the Conserved Domain Database (CDD) [20].
2.6. RNA isolation and cDNA synthesis
Total RNA was isolated from fungal mycelium grown in solid induction media.
The mycelium was harvested from the plate and lysed with TRI reagent (Ambion) in
liquid nitrogen using a mortar and pestle, according to the manufacturer’s directions.
Single strand cDNA (sscDNA) was synthesized with the Oligo(dT)15 primer using
the Reverse Transcription System kit (Promega) according to the manufacturer’s
directions. PCR was performed in a reaction mixture containing: 1.4 mM MgCl2 ,
0.2 mM dNTPs, 1 ␮M reverse primer, 1 ␮M forward primer, buffer Taq 1×, 1 U Taq
DNA polymerase and 0.5 ␮L of template sscDNA in a final volume of 25 ␮L. Reactions
were carried out in an Eppendorf Master Cycler Gradient; gel-purified PCR products
were cloned into pGEM-T Easy vector, and sequenced by Macrogen (Korea).
2.7. Phylogenetic analysis
Multiple alignments of sequences of glycoside hydrolases from families 5, 7 and
61 obtained from the EMBL-EBI data base were performed using ClustalX 2.0.9. Information on the accession number of the sequences used as templates are available
in Supplementary Material 1. Construction and visualization of a radial neighborjoining phylogenetic tree were done with the TreeView version 1.6.6 program [21].
2.8. Expression of the endoglucanase gene in P. pastoris X-33
The cloning and recombinant expression of the full length T. versicolor endoglucanase gene was carried out using the Easy-Select Pichia expression kit (Invitrogen).
Specific primers TvEGPP1 For and TvEGPP1 Rev (Table 1) were designed in order to
add XhoI and XbaI restriction sites at the ends of the endoglucanase gene. The PCR
product was digested with these enzymes and the fragment was cloned into the
pPICZ␣B vector. The forward primer contained a XhoI recognition site, a Kex2 signal
cleavage and the sequence encoding for the five first amino acids of the mature TvEG
enzyme. The reverse primer contained the sequence encoding for the last four amino
acids of the protein, followed by six histidine codons and a stop codon. Recombinant
plasmid was introduced into P. pastoris X-33 by electroporation, following the supplier recommendations. Transformants were selected in YPD plates supplemented
with 1 M sorbitol and 100 ␮g mL−1 Zeocin. Clones having multiple insertions in the
yeast genome were selected in YPD plates supplemented with 500 ␮g mL−1 Zeocin.
The correct sequence of the construction was confirmed by automatic sequencing
at Macrogen. Recombinant protein production was carried out according to the kit
provider directions. The confirmed clone was cultured in BMGY (Buffered complex
medium containing glycerol) until OD600 4. For the induction phase, cells were transferred to BMMY medium (Buffered complex medium with 0.5% (v/v) methanol),
repeating the addition of methanol every 24 h. Recombinant expression was monitored every 24 h in aliquots of the culture supernatant by measuring activity on CMC
and by electrophoresis. For this, a four mL aliquot of each supernatant was concentrated by ultracentrifugation using a Centricon centrifugal device YM-3 (Millipore).
The concentrated fractions were analyzed by SDS–PAGE and CMC-zymogram. For
the CMCase activity assays, aliquots of supernatant were analyzed directly, while the
electrophoretic analysis was carried out using the concentrated fractions. SDS–PAGE
was carried out in 12.5% polyacrylamide gel in Miniprotean II (BioRad), as recommended. For the zymogram analysis the protein separation was carried out in
a similar protocol except that the gel contained 0.2% (w/v) CMC and the protein
samples were not heated before the electrophoresis. SDS removal for protein renaturation in the gel was carried out by incubating with 0.25% (v/v) Triton X-100 for one
hour at room temperature, and then the gel was incubated for one hour at 37 ◦ C in
50 mM sodium acetate pH 5.0. The activity bands were revealed by staining with 0.1%
(w/v) Congo Red and distaining with 1 M NaCl. In all the experiments P. pastoris X-33
transformed with the vector pPICZ␣B was analyzed in parallel and used as control.
487
Table 1
PCR primers used for cDNA amplification and plasmid construction.
Primer name
Sequence (5 → 3 )a
Target/use
F5fwd
F5rev
F7fwd
F7rev
F61fwd
F61rev
106EN5For
106EN5Rev
TvEGPP1 For
TvEGPP1 Rev
TGATCTTCGACATCATGAACGARYMHCAYRA
CCCCCACCAGGAGCCDKYDKCCCA
CGACGAGGAGACCTGCGSNVANAAYTG
CACGTAGCACTGGGCGTCRCARTANCC
TGGACAAGACCACCAACAAGTKBKTNAARAT
ACTTCTAGATGTTGATGAAGATGCCNGSRTCNGT
GGACCCGAACAACAACATTGCTA
GCGAGGATGAGCTGGCTGGT
CTCGAGAAAAGAGTCTGGCGGCAGTG
TCTAGATCAATGATGATGATGATGATGCTGGAACGCCTTG
GH family 5
GH family 5
GH family 7
GH family 7
GH family 61
GH family 61
Specific primer for TvEG cDNA cloning
Specific primer for TvEG cDNA cloning
Cloning full length TvEG in pPICZ␣B
Cloning full length TvEG in pPICZ␣B
a
The IUPAC nomenclature for degenerate primers is used.
3. Results and discussion
3.2. Cloning of the fungal cellulase genes
3.1. Evaluation of the cellulase activity produced by fungi
Total RNA was obtained from the fungi cultured in solid medium
supplemented with CMC. Afterward cDNA was amplified by PCR
with degenerate primers designed for targeting GH families 5,
7 and 61. These primers were designed based on the alignment
of cellulases belonging to the IUBMB classification EC 3.2.1.4,
which contains most of the fungal endo-␤-1,4-glucanases (see
Supplementary Material 1 for details on the accession number of
the sequences used as templates). Five fragments were identified
(see Supplementary Material 2 for details of the cDNA sequences),
and the BLAST homology analysis revealed that the amino acid
sequence of these fragments effectively shares important identity
with cellulases from families 5, 7 and 61, respectively (Table 2).
One of the fragments isolated from F. oxysporum resulted to be
identical to the gene encoding for the EG I already described by
Sheppard et al. [22]. The endoglucanase I (EG I) from the F. oxysporum consists of a 411 amino acid catalytic core and it lacks a
CBM. The enzyme belongs to glycoside hydrolase family 7, which
also includes the cellobiohydrolase I from T. reesei. The second fragment from F. oxysporum resulted to be a non described sequence;
the highest alignment was to a putative, uncharacterized GH family
61 cellulase from G. graminicola.
Analysis of the cDNA isolated from G. applanatum revealed a
non-described GH with 58% identity in 86 amino acids to the GH
family 61 of the fungus Laccaria bicolor, specifically the sequence
comprising the catalytic domain of the enzyme. This is the first
description of a GH61 from G. applanatum. GH61 are enigmatic
The production of cellulase activity by native Chilean strains of
T. versicolor, G. applanatum, P. placenta, F. oxysporum, P. ostreatus,
L. edodes and P. gigantea was evaluated. P. placenta, P. ostreatus,
L. edodes and P. gigantea did not produce any significant activity
of CMC hydrolysis (data not shown). T. versicolor, G. applanatum
and F. oxysporum were selected based on the cellulase activity produced under conditions of induction with CMC, microcrystalline
cellulose and N. pumilio lignocellulose. As shown in Fig. 1, regardless of the type of inducer present in the medium, production of
the enzymes needed for CMC hydrolysis was highest in G. applanatum, followed by T. versicolor and F. oxysporum. Considering that
the polymer substrate must be previously hydrolyzed to be used a
carbon source and also to be effective for cellulase gene induction,
the growth in lignocellulose can be a good marker of the cellulases functionality on lignocellulose. This notion was confirmed by
results in Fig. 2, where the hydrolysis of N. pumilio wood chips by
the crude cellulase from T. versicolor and G. applanatum is shown.
These fungi exhibit significant hydrolyzing activity on lignocellulose. Despite in both cases the hydrolytic activity is lower than
the activity exhibited by the commercial preparation of T. reesei, these results are helpful as they indicate that these white rot
fungi are good producers of competent enzymes for lignocellulose
hydrolysis.
Fig. 1. Production of CMCase activity by Trametes versicolor, Fusarium oxysporum
and Ganoderma applanatum. The fungi were cultured for 6 days at 28 ◦ C using CMC
(hatched bars); Avicel (white bars); N. pumilio (black bars) as carbon sources. CMCase
activity was measured in fungi culture supernatants using 1% (w/v) CMC as substrate, at 37 ◦ C for 60 min. All points represent averages of at least three experimental
values. Standard deviation was always less of 10%.
Fig. 2. Hydrolysis of N. pumilio lignocellulose by T. versicolor, G. applanatum and T.
reesei cellulases. The crude enzymes from the fungal culture supernatant, concentrated by ammonium sulfate precipitation, were incubated with 5% N. pumilio wood
chips at 50 ◦ C for 1.5 h (hatched bars), 25 h (white bars) or 50 h (black bars) and
reducing sugars were determined by the DNS method. All points represent averages
of at least three experimental values. Standard deviation was always less of 10%.
488
Table 2
Analysis of the cDNA sequences encoding for the cellulases identified in this work.
Fungus
Fusarium oxysporum
Fusarium oxysporum
Ganoderma applanatum
Trametes versicolor
Trametes versicolor
a
b
c
d
Highest alignmentb
cDNA
a
GH family (CDD e-value)d
c
Code
Fraction sequenced (%)
Microorganism
Accession code
Identity (%)
Fof7
Fof61
Gaf61
TvEG
Tvf7
23
28
26
95
22
Fusarium oxysporum
Glomerella graminicola
Laccaria bicolor
Trametes hirsuta
Polyporus arcularius
AAG09047
EFQ31130
XP 001883194
BAD01163
BAF80326
100
68
58
96
82
7 (10−38 )
61 (10−30 )
61 (10−27 )
5 (10−14 )
7 (10−44 )
Assuming as 100% the size of the enzyme with the highest alignment in the BLASTX analysis [19].
According to the results of the BLASTX analysis.
EMBL database.
Results of the Conserved Domain Database search [20].
proteins that lack measurable hydrolytic activity by themselves,
but can accomplish an auxiliary role during the hydrolysis catalyzed by classical cellulases [23]. As an example, Harris et al.
were able to reduce by 2-fold the total protein loading required
to hydrolyze lignocellulosic biomass by incorporating the gene for
one GH61 protein into a commercial T. reesei strain producing high
levels of cellulolytic enzymes [24]. In consequence, these GH61
proteins are attractive enzymes to be considered at the moment
of producing optimized cellulolytic mixtures.
Analysis of the cDNA obtained from T. versicolor allowed the
isolation of sequences encoding for putative GH family 7 and 5.
cDNA cloning of a GH family 7 cellobiohydrolase from T. versicolor
52P was recently reported [25], but the sequence is not available
in public data bases; in consequence, is not possible to know if the
sequence identified in this work corresponds to cel7A present in T.
versicolor 52P.
Similitude analysis of the second fragment from T. versicolor,
Tvf5, suggests that the gene encodes for a novel GH family 5
endoglucanase [4]. The complete cDNA for the mature protein was
reconstructed using RT-PCR with specific primers and the protein
was named TvEG. The sequence of a GH family 5 endoglucanase
from T. versicolor has not been reported so far. An endoglucanase
from this fungus was described in 1963 by Pettersson [11] but
the molecular weight reported was significantly lower (11 kDa)
than the 38.6 kDa estimated for TvEG, suggesting that the enzyme
described by Pettersson is either a different enzyme or a proteolytic
fragment of TvEG. Similarly, Idogaki and Kitamoto reported the
purification and brief characterization of an endoglucanase from a
culture of Coriolus versicolor (formerly T. versicolor) strain TD-7 [26];
comparison of the molecular weight estimated for that CMCase
(29 kDa) suggests that TvEG and the endoglucanase from strain TD7 could be the same enzyme. Information regarding the amino acid
sequence of this or any other endoglucanase from T. versicolor is
not available so far. Comparison of the biochemical and molecular
properties should be very useful to clearly identify these enzymes
and to define the complete set of T. versicolor endocellulases.
A phylogenetic tree was constructed based on the alignment of
the amino acid sequences of fungal known endoglucanases from
GHs families 5, 7 and 61. Three main branches were obtained, each
one corresponding to each GH family. As shown in Fig. 3, the cellulase sequences identified in this work are distributed in the tree
according to the primers used in the cDNA screen. From these
results is clear that the use of degenerate primers designed based
on homology regions is a strong strategy to identify novel enzymes,
being highly specific for the targeted glycoside hydrolase family.
3.3. Analysis of the TvEG amino acid sequence
TvEG full length cDNA encoded a 364 amino acid protein, with
a predicted molecular weight of 38.6 kDa. The BLAST homology
analysis of the deduced amino acid sequence of TvEG in Fig. 4
showed the highest overall identity with endoglucanases from
Fig. 3. Phylogenetic analysis of the new cellulases. The alignments were constructed
using CLUSTAL X program [17]. The tree was visualized by TREEVIEW [21]. Glycoside hydrolase families are surrounded by ellipses. Arrows highlight the sequences
identified in this work. Sequences were obtained from the Europe Bioinformatics
Institute database. The length of the braches indicates the divergence among the
amino acid sequences. Bar, 0.1 substitutions per site. The accession numbers and
species used to generate the tree are available in Supplementary Material 1.
Trametes hirsuta ThEG (96% identity, accession Q75UV6) [27], Irpex
lacteus En-1 (65%, Q5W7K4) [28], Volvariella volvacea EGI (57%,
Q9C3Z8) [29], Humicola insolens EGL2 (58%, Q12624) [30] and T.
reesei EG II (22%, P079829) [31]. All these sequences are members
of the GH family 5 and have a family 1 CBM.
TvEG has a multi-domain structure composed of a N-terminal
CBM, a Ser-/Thr-rich linker, and a catalytic domain (Fig. 4). The
CBM of T. versicolor EG belongs to the CBM family 1, which is
characteristic of fungi [32]. It contains four cysteines which form
two disulfide bridges (Cys31-Cys48 and Cys42-Cys58, according to
numbering in Fig. 4), four aromatic amino acid residues (Trp28,
Phe36, Tyr54 and Tyr55), and two glutamines (Gln30 and Gln57);
all these amino acid residues are highly conserved in this family
and are essential for the adsorption capacity [33]. In the catalytic
domain is possible to distinguish the conserved motifs Asn-Glu-Pro
and Glu-X-Gly, corresponding to the acid catalyst (Glu229) and stabilizing anion/nucleophile (Glu339), respectively [34]. Also, Glu229
and Glu339 are the only Glu residues that are conserved throughout the catalytic domain, suggesting that they are involved in the
catalysis.
The BLAST analysis showed that the T. hirsuta and I. lacteus endoglucanases are the most similar to TvEG (Fig. 4). It is
489
Fig. 4. Sequence alignment of T. versicolor EG and other fungal endoglucanases. Black and grey boxes indicate identical and similar amino acid, respectively. Brackets A and
B define the CBM and the catalytic domain, respectively. The black circles indicate residues that are predicted to participate in disulfide bridges. The black triangles indicate
the residues that are predicted to be critical in the catalysis. Abbreviations: T.v., T. versicolor; T.h., T. hirsuta; I.l., I. lacteus; V.v., V. volvacea; and H.i., H. insolens; T.r., T. reesei.
interesting that T. hirsuta endoglucanase activity ratio CMC/Avicel
is significantly lower than the same index for I. lacteus endoglucanase [26,37]. This effect was attributed by the authors to a higher
accessibility of the T. hirsuta catalytic domain to the substrate,
facilitated by a shorter linker [27]. As shown in the alignment in
Fig. 4, this structural characteristic is also present in TvEG; the
conservation of this feature and the high identity level between
TvEG and ThEG suggest that TvEG also could be highly reactive
on microcrystalline cellulose. Considering that this is a desirable
characteristic in endoglucanases used for lignocellulosic biomass
conversion, this possibility must be investigated by extensive
characterization and study of the real potential of TvEG for
application in insoluble cellulose breakdown.
3.4. Recombinant expression of TvEG in P. pastoris
The sequence corresponding to the mature TvEG (from amino
acid 27 to 405, Fig. 4), was cloned into the expression vector
pPICZ␣B and transformed into P. pastoris X-33. The TvEG gene was
cloned downstream the Saccharomyces cerevisiae ␣ factor signal
sequence and the Kex2 cleavage sequence. The Kex2 signal cleavage
was conveniently introduced in the forward primer TvEGPP1 For,
490
in order to promote the correct N-terminal processing of TvEG and
reduce the possibility of non-native amino acids in the enzyme. For
the same reason, a sequence encoding for six histidine codons was
included in the reverse primer, TvEGPP1 Rev, just after the 3 end
of the gene and before the stop codon. This design should avoid
the presence of the C-myc epitope at the C-terminal of TvEG, still
permitting the purification by affinity to the polyhistidine tail. Consequently, TvEG should be secreted to the extracellular space, with
a native N-terminal and a six-histidine tag at the C-terminal.
The kinetic of the recombinant enzyme production was studied following the appearance of the CMCase activity in the culture
broth and in extracts of the intracellular fraction. Only the results of
the extracellular content are shown. Estimates showed that more
that the 95% of the activity was released to the extracellular space
(data not shown), suggesting that the secretion signal from the S.
cerevisiae ␣-factor correctly signaled the exportation of TvEG. The
CMCase activity increased consistently in the supernatant until the
third day (72 h), reaching a plateau after that. The production of
CMCase activity was 18 U L−1 at the end of the monitoring experiment. SDS–PAGE analysis of the extracellular proteins produced by
the control (P. pastoris X-33/pPICZ␣B) and the recombinant culture (P. pastoris X-33/pPICZ␣B-TvEG) during the induction with
methanol revealed in P. pastoris X-33/pPICZ␣B-TvEG, the appearance of a faint band around 35 kDa, consistent with the 38.6 kDa
estimated for the recombinant TvEG (Fig. 5B); the zymographic
analysis (Fig. 5C) showed an activity signal consistent con this protein, demonstrating the functional expression of TvEG in P. pastoris.
The activity gel also showed a high molecular weight protein
having activity on CMC, present in both cultures. This activity is
probably responsible of the background observed in supernatants
of the control culture in Fig. 5A. Genomic sequences encoding for
glycoside hydrolases have been described in P. pastoris GS115, a
close variant of the X-33 strain. These sequences belong to families 2, 3, 10, 20, 45, 53 and 88 [35]; among them, families 20
and 45 have members with putative hydrolytic activity on endo␤-1,4-glycosidic bonds (EC 3.2.1.4), that could be responsible of
the background activity observed in our experiments. Not enough
experimental information is available in literature for clearly identify the origin of these bands.
The zymogram in Fig. 5C shows that TvEG in the supernatant is
not a homogeneous population of protein molecules; several bands
around the expected molecular weight are visible. The origin of this
heterogeneity in the protein size could be on potential proteolytic
cleavage of the endoglucanase in the linker region, which, by separating the CBD could create active forms of the enzyme slightly
smaller. A second possibility is the modification of the enzyme by
addition of a variable number of carbohydrate molecules (glycosylation). It is recognized that P. pastoris is capable of adding both Oand N-linked carbohydrate moieties to secreted proteins [36]. At
this point is not possible to discard any of these possibilities.
Preliminary evaluation of the endoglucanase activity on CMC
in the IMAC-purified recombinant TvEG (not shown) gave a specific activity of 35–40 U mg−1 . Using this value a simple estimate
gives approximately 0.5 mg of recombinant TvEG per L of culture
broth. This production level is significantly lower than the expression level of V. volvacea and A. niger endoglucanases [37,38] in
P. pastoris; these enzymes were produced at 65 and 40 mg L−1 ,
respectively. We are currently studying experimental alternatives
for improvement of the TvEG expression level by optimization of
the fermentation conditions.
4. Conclusions
Fig. 5. Time course of recombinant full length TvEG production by P. pastoris X-33.
Cells were induced in BMMY (buffered methanol-complex medium) for the times
indicated. (A) CMCase activity measured in culture broth of P. pastoris X-33 transformed with pPICZ␣B-TvEG (white circles) or pPICZ␣B (black circles). The Optical
Density at 600 nm (OD600 ) of the recombinant culture during the induction is shown
(black diamonds). SDS–PAGE (B) and zymogram (C) of the extracellular fractions
concentrated by ultrafiltration from the experiment shown in A. Induction times
(h) are indicated on top of the wells; lane M, molecular mass markers (kDa). The
arrow head indicates the recombinant enzyme.
1. This study demonstrates that the Chilean native strains of G.
applanatum and T. versicolor analyzed in this work produce
enzymes able of degrading the cellulose present in lignocellulose
from N. pumilio.
2. The screening of cellulolytic fungi carried out by reverse transcription and PCR with degenerate primers resulted to be a
fruitful strategy. Despite the primers were designed based on
consensus sequences, results reported in this work indicate that
is possible to identify sequences that diverge of the established
consensus and still maintain the targeted specificity.
3. TvEG, an endoglucanase from T. versicolor, has been cloned and
expressed as a functional recombinant enzyme. The enzyme
shares high identity with ThEG, an endoglucanase from T. hirsuta with high activity on crystalline cellulose. This fact and
the presence of a CBM in the enzyme suggest that TvEG could
have interesting applications for hydrolysis of insoluble cellulosic substrates.
4. The yeast P. pastoris produces the fungal endoglucanase as an
active enzyme, but with low yield. The system needs to be optimized in order to improve the production of recombinant TvEG.
Acknowledgements
This work was supported by the Domeyko Research Programme,
University of Chile; CONICYT through its Bicentennial Programme
CCF05 and The Institute for Cell Dynamics and Biotechnology
(ICDB). We thank the Vice Presidency of Research and Development, University of Chile and the Academy Direction of the Faculty
of Physical Sciences and Mathematics for travel support for attending to the 14th IBS Congress.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.enzmictec.2011.10.003.
References
[1] Dashtban M, Schraft H, Qin W. Fungal bioconversion of lignocellulosic residues;
opportunities & perspectives. Int J Biol Sci 2009;5:578–95.
[2] Bhat MK, Bhat S. Cellulose degrading enzymes and their potential industrial
applications. Biotechnol Adv 1997;15:583–620.
[3] Gilkes NR, Henrissat B, Kilburn DG, Miller Jr RC, Warren RA. Domains in
microbial beta-1,4-glycanases: sequence conservation, function, and enzyme
families. Microbiol Rev 1991;55:303–15.
[4] Henrissat B, Davies GJ. Structural and sequence-based classification of glycoside
hydrolases. Curr Opin Struct Biol 1997;7:637–44.
[5] Boraston AB, Bolam DN, Gilbert HJ, Davies GJ. Carbohydrate-binding modules:
fine-tuning polysaccharide recognition. Biochem J 2004;382:769–81.
[6] Baldrian P, Valaskova V. Degradation of cellulose by basidiomycetous fungi.
FEMS Microbiol Rev 2008;32:501–21.
[7] Vinzant TB, Adney WS, Decker SR, Baker JO, Kinter MT, Sherman NE, et al.
Fingerprinting Trichoderma reesei hydrolases in a commercial cellulase preparation. Appl Biochem Biotechnol 2001;91–93:99–107.
[8] Schmoll M, Kubicek CP. Regulation of Trichoderma cellulase formation: lessons
in molecular biology from an industrial fungus. A review. Acta Microbiol
Immunol Hung 2003;50:125–45.
[9] Henrissat B, Driguez H, Viet C, Schülein M. Synergism of cellulases from
Trichoderma reesei in the degradation of cellulose. Biotechnology 1985;3:
722–6.
[10] Nidetzky B, Steiner W, Hayn M, Claeyssens M. Cellulose hydrolysis by the cellulases from Trichoderma reesei: a new model for synergistic interaction. Biochem
J 1994;298(Pt 3):705–10.
[11] Pettersson G, Cowling EB, Porath J. Studies on celluloytic enzymes. I. Isolation of
a low-molecular-weight cellulase from Polyporus versicolor. Biochim Biophys
Acta 1963;67:1–8.
[12] Sambrook J, Russell DW. Molecular cloning. A laboratory manual. Cold Spring
Harbor: Cold Spring Harbor Laboratory Press; 2001.
[13] Lee CC, Wong DW, Robertson GH. Cloning and characterization of two cellulase
genes from Lentinula edodes. FEMS Microbiol Lett 2001;205:355–60.
[14] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing
sugar. Anal Chem 1959;31:426–8.
[15] Pezoa R, Cortinez V, Hyvarinen S, Reunanen M, Hemming J, Lienqueo ME,
et al. Use of ionic liquids in the pretreatment of forest and agricultural
residues for the production of bioethanol. Cellul Chem Technol 2010;44:
165–72.
[16] Xiao Z, Storms R, Tsang A. Microplate-based filter paper assay to measure total
cellulase activity. Biotechnol Bioeng 2004;88:832–7.
[17] Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H,
et al. ClustalW and ClustalX version 2. Bioinformatics 2007;23:2947–8.
491
[18] Rose TM, Henikoff JG, Henikoff S. CODEHOP (COnsensus-DEgenerate Hybrid
Oligonucleotide Primer) PCR primer design. Nucleic Acids Res 2003;31:3763–6.
[19] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res 1997;25:3389–402.
[20] Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott
C, et al. CDD: a Conserved Domain Database for the functional annotation of
proteins. Nucleic Acids Res 2011;39:D225–9.
[21] Page RDM. TREEVIEW: an application to display phylogenetic trees on personal
computers. Comput Appl Biosci 1996;12:357–8.
[22] Sheppard PO, Grant FJ, Oort PJ, Sprecher CA, Foster DC, Hagen FS, et al. The use
of conserved cellulase family-specific sequences to clone cellulase homologue
cDNAs from Fusarium oxysporum. Gene 1994;150:163–7.
[23] Merino ST, Cherry J. Progress and challenges in enzyme development for
biomass utilization. Adv Biochem Eng Biotechnol 2007;108:95–120.
[24] Harris PV, Welner D, McFarland KC, Re E, Navarro Poulsen J-C, Brown K,
et al. Stimulation of lignocellulosic biomass hydrolysis by proteins of glycoside hydrolase family 61: structure and function of a large, enigmatic family.
Biochemistry 2010;49:3305–16.
[25] Lahjouji K, Storms R, Xiao Z, Joung KB, Zheng Y, Powlowski J, et al. Biochemical
and molecular characterization of a cellobiohydrolase from Trametes versicolor.
Appl Microbiol Biotechnol 2007;75:337–46.
[26] Idogaki H, Kitamoto Y. Purification and some properties of a carboxymethyl
cellulase from Coriolus versicolor. Biosci Biotechnol Biochem 1992;56:970–1.
[27] Nozaki K, Seki T, Matsui K, Mizuno M, Kanda T, Amano Y. Structure and
characteristics of an endo-beta-1,4-glucanase, isolated from Trametes hirsuta, with high degradation to crystalline cellulose. Biosci Biotechnol Biochem
2007;71:2375–82.
[28] Toda H, Takada S, Oda M, Amano Y, Kanda T, Okazaki M, et al. Gene cloning of an
endoglucanase from the basidiomycete Irpex lacteus and its cDNA expression
in Saccharomyces cerevisiae. Biosci Biotechnol Biochem 2005;69:1262–9.
[29] Ding SJ, Ge W, Buswell JA. Endoglucanase I from the edible straw mushroom,
Volvariella volvacea. Purification, characterization, cloning and expression. Eur
J Biochem 2001;268:5687–95.
[30] Takashima S, Nakamura A, Masaki H, Uozumi T. Cloning, sequencing, and
expression of a thermostable cellulase gene of Humicola grisea. Biosci Biotechnol Biochem 1997;61:245–50.
[31] Saloheimo M, Lehtovaara P, Penttila M, Teeri TT, Stahlberg J, Johansson G, et al.
EGIII, a new endoglucanase from Trichoderma reesei: the characterization of
both gene and enzyme. Gene 1988;63:11–22.
[32] Linder M, Teeri T. The roles and function of cellulose-binding domains. J
Biotechnol 1997;57:15–28.
[33] Linder M, Mattinen ML, Kontteli M, Lindeberg G, Stahlberg J, Drakenberg T, et al.
Identification of functionally important amino acids in the cellulose-binding
domain of Trichoderma reesei cellobiohydrolase I. Protein Sci 1995;4:1056–64.
[34] Clarke AJ, Drummelsmith J, Yaguchi M. Identification of the catalytic nucleophile in the cellulase from Schizophyllum commune and assignment of the
enzyme to Family 5, subtype 5 of the glycosidases. FEBS Lett 1997;414:359–61.
[35] De Schutter K, Lin Y-C, Tiels P, Van Hecke A, Glinka S, Weber-Lehmann J, et al.
Genome sequence of the recombinant protein production host Pichia pastoris.
Nat Biotechnol 2009;27:561–6.
[36] Macauley-Patrick S, Fazenda ML, McNeil B, Harvey LM. Heterologous protein
production using the Pichia pastoris expression system. Yeast 2005;22:249–70.
[37] Quay DHX, Bakar FDA, Rabu A, Said M, Illias RM, Mahadi NM, et al. Overexpression, purification and characterization of the Aspergillus niger endoglucanase,
EglA, in Pichia pastoris. Afr J Biotechnol 2011;10:2101–11.
[38] Ding S-J, Ge W, Buswell JA. Secretion, purification and characterisation of a
recombinant Volvariella volvacea endoglucanase expressed in the yeast Pichia
pastoris. Enzyme Microb Technol 2002;31:621–6.
letters to nature
We also investigated the possibility of making recordings in the
gels by pattern-wise irradiation of the mixture followed by flood
exposure. During the first exposure, polymerization takes place in
irradiated areas and diffusion of reactive molecules to these areas
occurs owing to formation of a concentration gradient of unreacted
species. After flood exposure, the rest of the reactive molecules
within the system become polymerized. As a result of diffusion and
the nature of the network formed at various steps of polymerization,
the threshold voltage for switching in various regions becomes
different. In this way, complicated patterns can be recorded into
such a gel and made visible upon application of an electric field. We
have used this technique in the production of a switchable binaryphase planar Fresnel lens7. A cell containing the monomeric mixture
was irradiated through a mask containing concentric rings defining
the zones of the lens placed above the cell. Subsequently the mask
was removed and the cell was exposed to ultraviolet light. As a result,
the structure became transferred into the gel in the form of regions
with high and low switching voltages. Applying a voltage activated
the lens function, as neighbouring regions with high and low
refracting indices are formed within the cell. Upon application of
an electric field, a beam of light could be focused to a point. In the
same way, more complicated recordings could be made. Figure 4
shows a recording made into a gel by illumination through a photo
negative: before application of an electric field no recording is
visible, but application of an electric field switches the areas with
䡺
low threshold voltage, making the image visible.
Received 17 November 1997; accepted 21 January 1998.
1. Gray, G. W. in Thermotropic Liquid Crystals 74 (Wiley, Chichester, 1987).
2. Gerber, P. R. Voltage induced cholesteric structure transformation in thin layers. Z. Naturforsch. 36,
718–726 (1981).
3. Schadt, M. & Gerber, P. Dielectric electro-optical and phase change properties of liquid crystal guest
host displays. Mol. Cryst. Liq. Cryst. 65, 241–263 (1981).
4. Hikmet, R. A. M. & Lub, J. Anisotropic networks and gels obtained by photopolymerisation in the
liquid crystalline state. Prog. Polym. Sci. 21, 1165–1209 (1996).
5. Kelker, H. & Hatz, R. in Handbook of Liquid Crystals 172 (Verlag Chemie, Weinheim, 1980).
6. Broer, D. J., Lub, J. & Mol, G. N. Wide-band reflective polarizers from cholesteric polymer networks
with a pitch gradient. Nature 378, 467–469 (1995).
7. Patel, J. S. & Rastani, K. Electrically controlled polarisation independent liquid crystal Fresnel lens
arrays. Optics Lett. 16, 532–534 (1991).
centres, or intrinsically spontaneous, such as those of oxidative
phosphorylation in mitochondria. Transmembrane proteins
(such as the cytochromes and complexes I, III and IV in the
electron-transport chain in the inner mitochondrial membrane)
couple the redox reactions to proton translocation, thereby conserving a fraction of the redox chemical potential as p.m.f. Many
transducer proteins couple p.m.f. to the performance of biochemical work, such as biochemical synthesis and mechanical and
transport processes. Recently, an artificial photosynthetic membrane was reported in which a photocyclic process was used to
transport protons across a liposomal membrane, resulting in
acidification of the liposome’s internal volume1. If significant
p.m.f. is generated in this system, then incorporating an appropriate transducer into the liposomal bilayer should make it
possible to drive a non-spontaneous chemical process. Here we
report the incorporation of FOF1-ATP synthase into liposomes
containing the components of the proton-pumping photocycle.
Irradiation of this artificial membrane with visible light results in
the uncoupler- and inhibitor-sensitive synthesis of adenosine
triphosphate (ATP) against an ATP chemical potential of
⬃12 kcal mol−1, with a quantum yield of more than 7%. This
system mimics the process by which photosynthetic bacteria
convert light energy into ATP chemical potential.
The artificial photosynthetic membrane is shown schematically
in Fig. 1, which illustrates a portion of the liposomal bilayer, the
proton-pumping photocycle, and the F-type ATP synthase
enzyme—the bulbous structure, top right. The proton pump is
driven by vectorial photoinduced electron transfer in a carotene–
porphyrin–naphthoquinone molecular triad (1, C–P–Q), which
generates the species C.+ –P–Q.− on excitation by visible light1,2. The
8
Acknowledgements. We thank L. Poels for technical assistance and J. Lub for synthesis of the reactive
molecules.
Correspondence and requests for materials should be addressed to R.A.M.H. (e-mail:
[email protected]).
Light-driven production of ATP
catalysed by F0F1-ATP
synthase in an artificial
photosynthetic membrane
Gali Steinberg-Yfrach*, Jean-Louis Rigaud†,
Edgardo N. Durantini*, Ana L. Moore*, Devens Gust*
& Thomas A. Moore*
Figure 1 Diagram of a liposome-based artificial photosynthetic membrane.
Included in this diagram is the photocycle that pumps protons into the interior of
* Department of Chemistry and Biochemistry and Center for the Study of Early
Events in Photosynthesis, Arizona State University, Tempe, Arizona 85287-1604,
USA
† Institut Curie, Section de Recherche, UMR-CNRS 168 and LCR-CEA 8,
11 rue Pierre et Marie Curie, 75231 Paris Cedex 05, France
the liposome and the CFOF1-ATP synthase enzyme. Triad 1 and Qs were as
.........................................................................................................................
to a final concentration of 0.1 M and valinomycin to the external solution resulted
Energy-transducing membranes of living organisms couple spontaneous to non-spontaneous processes through the intermediacy
of protonmotive force (p.m.f.)—an imbalance in electrochemical
potential of protons across the membrane. In most organisms,
p.m.f. is generated by redox reactions that are either photochemically driven, such as those in photosynthetic reaction
NATURE | VOL 392 | 2 APRIL 1998
reported previously1. For most of the experiments reported here, the triad used
consisted of a mixture of isomers in which the carboxylate group was in the 2 and
3 positions. Experimental details are given in the Methods section. Experiments
in which a diffusion potential was established before irradiation by adding K2SO4
in no change in the rate of ATP synthesis, within experimental error. This is
consistent with electrogenic proton import as proposed herein in which the
necessary p.m.f. is established by the proton pump. The ATP synthase was
activated by addition of 10 ␮M thioredoxin. Oxygen was removed from the
cuvette by flow argon. The ATP synthase was activated by addition of 10 ␮m
thioredoxin.
Nature © Macmillan Publishers Ltd 1998
479
letters to nature
intramolecular redox potential represented by the carotenoid radical
cation and the naphthoquinone radical anion is coupled to proton
translocation by a lipophilic quinone (Qs) which alternates between
reduced and oxidized states. Reduction occurs near the external
bilayer–water interface when Qs accepts an electron from the
naphthoquinone radical anion of 1 to form Qs.−. After protonation
of Qs.− near the external aqueous interface, the semiquinone HQs.,
either by diffusion or self-exchange reactions among the Qs molecules,
delivers the proton and electron to the site of oxidation potential
(C.+ –P–Q) located near the inner membrane surface. Oxidation of
HQs. near the internal aqueous interface results in proton ejection
to the intraliposomal volume and the generation of p.m.f. (These
steps only outline the photocycle. Other species could be involved,
including a mixture of oxidation states of Qs, provided that the
mixture includes protonated species.) On accumulation of
sufficient p.m.f., proton flow through the coupling factor with the
concomitant formation of ATP from adenosine diphosphate (ADP)
and inorganic phosphate (Pi) is thermodynamically allowed.
Proteoliposomes were prepared by incorporation of CFOF1-ATP
synthase and the proton pump into liposomes. The solutions were
illuminated with laser light at a wavelength of 633 nm for a period of
time and then assayed for ATP. The synthesis of ATP was measured
by the luciferin/luciferase assay3. Figure 2 shows the oxyluciferin
luminescence spectrum, recorded as a function of irradiation time,
for a sample of proteoliposomes containing the components shown
in Fig. 1, including ADP and Pi in the external solution. The increase
in luminescence with exposure to actinic light is clear evidence of an
increase in ATP concentration with irradiation.
To establish that this increase was due to p.m.f.-linked synthesis
of ATP, a number of control experiments were carried out. Samples
containing an uncoupler (1 ␮M carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP), which renders the membrane
permeable to protons and thereby prevents the build-up of p.m.f.)
or an inhibitor (2 ␮M tentoxin, which is a specific inhibitor of
CFOF1-ATP synthase) evidenced no ATP production4. Other control
experiments included deletion of either Qs, ADP, Pi, triad 1 or ATP
synthase. In each case the luminescence spectrum after irradiation
was superimposable on that of the spectrum of an unirradiated
control sample, within experimental error. Therefore, ATP synthesis
was observed only in the presence of all of the components indicated
in Fig. 1 and is ascribed to light-generated p.m.f. coupled to ATP
synthesis by CFOF1-ATP synthase.
The efficacy of the artificial energy-transducing membrane can be
defined by three parameters: the quantum yield of ATP production,
the thermodynamic potential of the newly synthesized ATP, and
the turnover number of the enzyme. Experiments to measure the
turnover number and the thermodynamic factors were carried out
under light-saturated conditions, whereas the quantum yield of
ATP was measured under light-limited, linear conditions. Linear
and saturated conditions were operationally defined by the data
shown in Fig. 3, which shows the results of a series of experiments in
which the rate of ATP synthesis was measured as a function of
actinic light intensity. The linear region is shown on the left-hand
side of the graph and the saturated region on the right-hand side.
From the light-limited rate of ATP synthesis shown on the lefthand side of Fig. 3, it is calculated that one ATP molecule is
produced per 14 photons incident on the sample. Because of light
scattering by the liposome solution, there is uncertainty in measuring the fraction of the actinic light absorbed. Spectroscopic determinations suggest that ⬃50% of the incident light was absorbed, so
the actual quantum yield of ATP synthesis is probably near 0.15.
Assuming that four protons are required per ATP synthesized, the
yield of the proton pump must be near 0.6. Therefore, both the
quantum yield of redox equivalents from photoinduced electron
transfer in 1 and the efficiency of proton shuttling by Qs must be
quite high. The high yield of redox equivalents from the photoinduced electron transfer step could arise in part from the slowing of
energy-wasting charge recombination due to migration of the
electrons and holes among the ⬃1,000 molecules of 1 and the
⬃500 molecules of Qs in a proteoliposome. This would require
some form of aggregation involving 1 and possibly Qs, as rapid
intermolecular charge migration requires relatively strong intermolecular electronic interactions. Indeed, the absorption spectrum
of 1 in proteoliposomes shows significant broadening of the
Figure 2 The [ATP]-dependent steady-state luminescence of oxyluciferin3
Figure 3 The rate of ATP synthesis as a function of actinic light intensity. Initial
measured as a function of liposome irradiation times. Shown are data for
conditions are [ATP] ¼ [ADP] ¼ 0:2 mM and [Pi ] ¼ 5 mM. Full saturation was
irradiation times of 0 min (short dashes), 3 min (dash-dot-dot), 6 min (long
reached at actinic light levels of 0.1 mW cm−2. The ATP concentration was
dashes), 12 min (dots), 35 min (medium dashes) and 66 min (solid line). The
determined by the luciferin/luciferase assay shown in Fig. 2. In a typical experi-
irradiation source was a 5 mW beam of 633-nm light from a HeNe laser, and the
ment, aliquots of irradiated solution in which ATP had been formed were with-
sample volume was 250 ␮l (c.p.s., counts per second). The laser beam diameter
drawn as a function of irradiation time and added to an assay solution containing
was expanded to ⬃10 mm, but no effort was made to provide uniform intensity
luciferin, luciferase and buffer. The luminescence spectrum was measured
across the cuvette (as discussed in the text, this level of actinic light saturated the
immediately and the [ATP] determined from a standard curve which was pre-
rate of synthesis of ATP). In this experiment, the ATP concentration before
pared for each experimental run by measuring the steady-state luminescence
irradiation was ⬃2 ⫻ 10 ⫺ 7 M (⬃10−3 times the level of ADP), and was due to
from preparations having known ATP concentrations. In all cases the steady-
ATP contamination in the commercially available ADP. Oxygen was removed from
state luminescence intensity was constant for at least 20 min.
the cuvette by flowing argon.
480
8
letters to nature
porphyrin Soret band which is indicative of aggregate formation.
Because the quantum yield is high and the aggregated form of 1 is
predominant, electron transfer processes between the various oxidation states of Qs and reducing/oxidizing equivalents in aggregates
of 1 must drive the proton pump.
Turning to thermodynamic considerations, the chemical potential of ATP synthesized at constant temperature and pressure, under
conditions of 0.2 mM ATP, 0.02 mM ADP and 5 mM Pi, is
⬃12 kcal mol−1 (using concentration as activity in the Gibbs
equation). As shown in Fig. 4, synthesis proceeds readily under
these conditions. Thus ATP synthesis occurs against a substantial
ATP potential. The slightly lower rate of formation of ATP at
½ATPÿ=½ADPÿ ¼ 10 compared to that at ½ATPÿ=½ADPÿ ¼ 1 could
be due to the lower concentration of ADP in the former rather than
the higher [ATP]/[ADP]. That is, the enzyme may not have been
saturated with respect to ADP.
The synthesis of ATP at high ATP potential demonstrates that
significant p.m.f. is being generated by the proton pumping photocycle. In fact, ATP synthesis against similar ATP potentials has been
reported in isolated chloroplast lamellae5. Detailed experiments to
measure the maximum p.m.f. available from this system are under
way.
To determine the turnover number, conditions were selected such
that the enzyme was saturated with ADP (0.2 mM) and Pi (5 mM)6.
The light-saturated rate of ATP synthesis (right side of Fig. 3) was
used for the calculation. For maximum activity, non-catalytic ATP
binding sites on the F-type ATPases must be occupied7–10. To ensure
this, experiments were carried out with 0.2 mM ATP added before
irradiation. Under these conditions 3:5 ⫻ 10 ⫺ 8 mol of ATP were
synthesized per hour. As there are ⬃9 ⫻ 1011 liposomes in the
irradiated volume and one enzyme molecule per liposome, the
turnover number is 7 ⫾ 1 ATP per CFOF1 per s. This number is
higher than has been reported in hybrid systems using natural
photosystem I preparations as the proton pump, and is similar to
that observed in bacteriorhodopsin/ATPase constructs10,11.
In order to identify factors that control the CFOF1 turnover
number in this system, pH-jump-induced ATP synthesis in proteoliposome preparations containing all of the components of the
proton pump was compared to that in proteoliposomes prepared
without 1 and Qs. Both types of liposomes gave turnover numbers
of ⬃100 s−1. This level of activity under comparable pH-jump
conditions has been reported for similar proteoliposomes, which
indicates that neither 1 nor Qs inhibits the enzyme10. Therefore,
because the pH-jump experiment illustrates that the enzyme is
capable of higher turnover, and the synthesis of ATP against high
ATP potential illustrates that the p.m.f. is high, the light saturation
of ATP synthesis (⬃0.1 mW cm−2; right side of Fig. 3) at a relatively
low turnover number probably arises from kinetic constraints in the
photocyclic proton pump. The dynamics of the photocyclic proton
pump have not been investigated, but saturation effects could be
due to electron–hole annihilation in the aggregated arrays of 1 in
the membrane or to diffusion-limited transport processes.
We note that the photocyclic system operates efficiently over a
timescale of hours. Figure 4 shows ATP synthesis as a function of
irradiation time under conditions of maximum enzyme turnover.
A single ATP synthase turns over more than 25,000 times per hour.
Also shown are the data for control experiments carried out at
high initial [ATP]. As was the case when ATP was not added before
irradiation, ATP synthesis is uncoupler- and inhibitor-sensitive and
only observed when all of the components indicated in Fig. 1 are
present.
Based on the ATP potential, the quantum yield of formation, and
the energy of 633-nm photons we estimate that up to 4% of the
absorbed light energy is conserved in this system. The steps in the
energy transduction process in the artificial membrane mimic those
by which photosynthetic bacteria convert light energy into redox
potential, p.m.f. and ultimately chemical energy available as ATP.
The assembly of an artificial photosynthetic membrane that demonstrates net energy conservation opens the door to the design of
systems in which energy-requiring biological and biomimetic
processes in cellular-like constructs could be driven from a photo䡺
cyclic energy source.
8
.........................................................................................................................
Methods
Proteoliposomes containing CFOF1-ATPase isolated from spinach chloroplasts
were prepared by adding liposomes to detergent-solubilized protein and slowly
removing the detergent with Biobeads12. This procedure results in the incorporation of an average of one enzyme molecule per liposome, with the F1
subunit having the indicated preferred orientation extending into the bulk
aqueous phase12. The liposomes were prepared from a mixture of egg phosphatidylcholine and egg phosphatidic acid (10:1 by weight) plus cholesterol
(20 mol%)12. For experiments where ATP synthesis was observed, Qs was added
to the phospholipid mixture before liposome formation. Triad 1 was added
to the proteoliposomes by injection of 10 ␮l of a 3.8 mM solution of 1 in
tetrahydrofuran into 250 ␮l of a solution containing proteoliposomes followed
by column chromatography (Sephadex G-100) to remove excess triad.
Approximately 800 ␮l of solution was collected from the column. Analysis of
light-scattering experiments on similar liposome preparations that contained
chlorophyll rather than Qs or 1 yielded a most probable diameter of 150 nm
(ref. 10). Total phosphate analysis of 250 ␮l of a proteoliposome preparation
containing triad 1 and Qs prepared for a typical photochemical experiment
yielded ⬃9 ⫻ 1011 liposomes (assuming 150-nm diameter liposomes and an
area of 58 Å2 for phosphatidylcholine and phosphatidic acid and 38 Å2 for
cholesterol)13. Extraction and spectrophotometric assay yielded ⬃1 ⫻ 103
molecules of 1 per liposome, which is many more than the ⬃40 per liposome
previously found in liposomes formed from other phospholipids and lacking
the protein component1. Based on the amount of Qs added before forming the
liposomes, there were no more than 500 Qs molecules per liposome. The bulk
aqueous phase contained 16 mM Na2SO4, 2.5 mM MgSO4 and was buffered by
16 mM tricine and 5 mM KH2PO4 to a pH of 8. The intraliposomal volume
contained 2 mM tricine and 40 mM Na2SO4 with the pH adjusted to 8 before
liposome formation.
Received 13 November 1997; accepted 16 February 1998.
Figure 4 The synthesis of ATP as a function of irradiation time at different ratios of
[ATP]/[ADP]. Open triangles, [ATP] ¼ [ADP] ¼ 0:2 mM and [Pi ] ¼ 5 mM; filled
circles, [ATP] ¼ 0:2 mM, [ADP] ¼ 0:02 mM and [Pi ] ¼ 5 mM. Also shown are results
for control experiments showing that ATP was not synthesized; open circles,1 ␮M
FCCP; filled triangles, 2 ␮M tentoxin; filled diamonds, [Qs] ¼ 0; open squares,
[ADP] ¼ 0.
1. Steinberg-Yfrach, G. et al. Conversion of light energy to proton potential in liposomes by artificial
photosynthetic reactions centres. Nature 385, 239–241 (1997).
2. Gust, D., Moore, T. A. & Moore, A. L. Molecular mimicry of photosynthetic energy and electron
transfer. Acc. Chem. Res. 26, 198–205 (1993).
3. Schmidt, G. & Gräber, P. The rate of ATP synthesis by reconstituted CF0F1 liposomes. Biochim.
Biophys. Acta 808, 46–51 (1985).
4. Sigalat, C., Pitard, B. & Haraux, F. Proton coupling is preserved in membrane-bound chloroplast
ATPase activated by high concentrations of tentoxin. FEBS Lett. 368, 253–256 (1995).
5. Hangarter, R. P. & Good, N. E. Energy thresholds for ATP synthesis in chloroplasts. Biochim. Biophys.
Acta 681, 397–404 (1982).
481
letters to nature
6. Richard, P. & Gräber, P. Kinetics of ATP synthesis catalyzed by the H+-ATPase from chloroplasts
(CF0F1) reconstituted into liposomes and coreconstituted with bacteriorhodopsin. Eur. J. Biochem.
210, 287–291 (1992).
7. Richard, P., Pitard, B. & Rigaud, J.-L. ATP synthesis by the F0F1-ATPase from the thermophilic Bacillus
PS3 co-reconstituted with bacteriorhodopsin into liposomes. J. Biol. Chem. 270, 21571–21578 (1995).
8. Fromme, P. & Gräber, P. Activatin/inactivation and uni-site catalysis by the reconstituted ATPsynthase from chloroplasts. Biochim. Biophys. Acta 1016, 29–42 (1990).
9. Girault, G., Berger, G., Galmiche, J.-M. & Andre, F. Characterization of six nucleotide-binding sites on
chloroplast coupling factor 1 and one site on its purified b subunit. J. Biol. Chem. 263, 14690–14695
(1988).
10. Cladera, J. et al. Functional reconstitution of photosystem I reaction center from cyanobacterium
Synechocystis sp PCC6803 into liposomes using a new reconstitution procedure. J. Bioenerg.
Biomembr. 28, 503–515 (1996).
11. Pitard, B., Richard, P., Duñach, M. & Rigaud, J.-L. ATP synthesis by the F0F1 ATP synthase from
thermophilic Bacillus PS3 reconstituted into liposomes with bacteriorhodopsin. Eur. J. Biochem. 235,
779–788 (1996).
12. Richard, P., Rigaud, J.-L. & Gräber, P. Reconstitution of CF0F1 into liposomes using a new
reconstitution procedure. Eur. J. Biochem. 193, 921–925 (1990).
13. Petitou, M., Tuy, F. & Rosenfeld, C. A simplified procedure for organic phosphorus determination
from phospholipids. Anal. Biochem. 91, 350–353 (1978).
Acknowledgements. We thank F. Haraux for the gift of purified CF0F1, and both F. Haraux and W. Frasch
for discussions. This work was supported by the US DOE.
Correspondence and requests for materials should be addressed to T.A.M. (e-mail: [email protected]).
Ocean margins as a significant
source of organic matter
to the deep open ocean
James E. Bauer* & Ellen R. M. Druffel†
* School of Marine Science, College of William and Mary, Gloucester Point,
Virginia 23062, USA
† Department of Earth System Science, University of California, Irvine,
California 92697, USA
.........................................................................................................................
Continental shelves and slopes comprise less than 20% of the
world ocean area, yet they are proposed to be quantitatively
important sources of the organic matter that fuels respiration in
the open ocean’s interior1,2. At least certain regions of the coastal
ocean produce more organic carbon than they respire3, suggesting
that some fraction of this non-respired, unburied organic carbon
is available for export from the coastal to the open ocean4.
Previous studies of carbon fluxes in ocean margins1,5,6 have not
considered the potential roles of dissolved organic carbon (DOC)
and suspended particulate organic carbon (POCsusp), even though
both pools are quantitatively far larger than sinking POC. Here we
report natural radiocarbon (14C) abundance measurements that
reveal continental slope and rise waters to contain both DOC and
POCsusp that are concurrently older and in higher concentrations
than DOC and POCsusp from the adjacent North Atlantic and
North Pacific central gyres. Mass-balance calculations suggest that
DOC and POCsusp inputs from ocean margins to the open ocean
interior may be more than an order of magnitude greater than
inputs of recently produced organic carbon derived from the
surface ocean. Inputs from ocean margins may thus be one of the
factors contributing to the old apparent age of organic carbon
observed in the deep North Atlantic and Pacific central gyres7–9.
The radioisotopic form of carbon, 14C (half-life, 5,730 yr), can be
used as an indicator of the average age of bulk marine organic
carbon pools such as DOC and POC. In addition to natural
cosomogenically produced 14C, the increase in the global inventory
of 14C as a result of nuclear weapons testing during the late 1950s
and early 1960s also allows us to use bomb-produced 14C to
constrain the age of more recently formed (over the past ⬃40
years) organic carbon pools10. The D14C (defined as the deviation in
parts per thousand (‰) from the 14C activity of nineteenth century
wood) values of natural marine organic carbon have been found to
range from as low as around −525‰ (14C age of ⬃6,000 yr BP) for
482
deep ocean DOC8 to as high as about +140‰ for suspended POC
samples containing bomb 14C in the mid- to late 1980s (ref. 9).
Samples for 14C isotope analysis of DOC and POCsusp were
collected from the western North Atlantic (WNA) and eastern
North Pacific (ENP) continental margins. In April 1994, samples
were collected from 4 depths at each of three WNA sites located over
the continental slope in the Middle Atlantic Bight region between
eastern Long Island, New York, and Cape Hatteras, North Carolina.
The Bight is characterized by a permanent thermohaline front
between continental shelf and slope waters and a net southwestward
flow of slope water, of which ⬃50% is entrained across the front into
slope waters and the remainder is advected offshore near Cape
Hatteras5. The depth of the WNA mid-slope sites ranged from
⬃1,100–1,500 m. Samples were also collected from the eastern
North Pacific from 1991 to 1993 at a time-series site located at
the base of the continental rise (⬃4,100 m depth) at 34⬚ 50⬘ N,
123⬚ 00⬘ W11,12, and previously in 1985 at a site in the Santa Monica
basin of the California continental borderland13. The ENP site is
located ⬃220 km off the coast of central California within the
California current system and is influenced by spring–summer
maxima in primary productivity and sinking POC fluxes as a
result of seasonal upwelling14.
The D14C values of DOC from shallow surface waters (5 m depth)
of the WNA continental slope were highly variable, ranging over
⬃200‰ (Fig. 1a). In mid-depth slope waters (⬃300 m and 750 m;
Fig. 1a), D14C-DOC values were significantly lower (that is, more
negative in D14C) by 75 to 150‰ relative to DOC from similar
depths in the central north Atlantic gyre (−276 to −260‰ in the
Sargasso Sea (SS)8,9. By 1,000 m depth, the D14C-DOC profiles of
WNA slope water and those of SS water converged towards similar
values. These data indicate the presence of 14C-depleted DOC at
mesopelagic depths in WNA slope waters. On the basis of its ␦13C
values (␦13C range: −21.3 to −22.4‰; J.E.B., unpublished data), this
DOC appears to be predominantly marine in origin (fully marine
DOC has ␦13C values ranging from about −22 to −18‰).
The D14C values of POCsusp from the WNA ranged from −190 to
+80‰ and were significantly lower than D14C of POCsusp from the
SS9 (Fig. 1b). D14C values more positive than about −70 to −40‰ are
considered to be post-bomb (that is, later than early 1950s to early
1960s thermonuclear weapons testing) because the pre-bomb D14C
of the temperate and tropical surface ocean was in this range15. The
␦13C values in POCsusp (range: −22.9 to −24.9‰; J.E.B., unpublished
data) suggest that terrestrial carbon (with an assumed average
␦13 C ⬇ ⫺ 27‰) may have contributed slightly more to POCsusp
than to DOC in WNA slope waters. The similar offsets in D14C for
both DOC and POCsusp between the WNA and the SS (Fig. 1a, b)
suggest that the same or related mechanisms may control inputs of
14
C-depleted DOC and POCsusp to WNA slope waters.
Similar to the WNA, profiles from the ENP also indicate a net
depletion in 14C (that is, more negative D14C values) of both DOC
and POCsusp relative to the central North Pacific (CNP) gyre7,9 (Fig.
1c, d). The lowest D14C-DOC values in the ENP occurred, also like
the WNA, at shallow to intermediate depths (0–700 m), and D14CDOC values in the ENP were lower than in the CNP at all depths
samples (Fig. 1c). The D14C-DOC values in Santa Monica basin were
also, with the exception of the single 850-m sample, lower than
values in the CNP (Fig. 1c). Significantly lower D14C values of
POCsusp were likewise observed at all depths in both the ENP and
Santa Monica Basin13 relative to the CNP gyre (Fig. 1d). The average
difference in D14C-DOC between WNA and SS waters was greater
than the corresponding margin-central gyre difference in the North
Pacific (compare Fig 1a, c); the margin-central gyre offset in D14C of
POCsusp was also greater overall in the North Atlantic (compare Fig.
1b, d). The corresponding d13C values for DOC (range: −20.5 to −
21.7 (ref. 12)) and POCsusp (range: −20.0 to −22.9‰ (ref. 11)) in
ENP waters were greater (more positive) as a whole than for DOC
and POCsusp from the WNA.
8

Seminario Glúcidos 3 y lípidos 1. Comente los mecanismos de

Transcription

Similar documents

TLS® Thermochrome with Advantra Z® and

Test Publisher Summer 2010 - Association of Test Publishers

ffil scRrPPS clrNtc

Biological and non-biological nanomachines

Biologi Kertas 2 Pep Percubaan SPM

(SPEC) Kukui Nut OIl - Natural Sourcing, LLC

Muscles and movement - Pearson Schools and FE Colleges

Algae – Plant Like Protists

Enzyme Kinetics - Rose

Investigations on Mitochondrial Pleomorphy and