RhCG is the major putative ammonia transporter

Transcription

Am J Physiol Renal Physiol 296: F1279–F1290, 2009.
First published April 8, 2009; doi:10.1152/ajprenal.00013.2009.
RhCG is the major putative ammonia transporter expressed in the human
kidney, and RhBG is not expressed at detectable levels
Alice C. N. Brown,1 Dalila Hallouane,2 William J. Mawby,1 Fiona E. Karet,3 Moin A. Saleem,4
Alexander J. Howie,2 and Ashley M. Toye1
1
Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol; 2Department of Pathology,
University College London, London; 3Cambridge Institute for Medical Research, Cambridge; and 4Academic Renal Unit,
Southmead Hospital, Bristol, United Kingdom
Submitted 9 January 2009; accepted in final form 7 April 2009
Rh glycoprotein; MDCK; distal tubule; acid-base homeostasis
THE MAMMALIAN RH-ASSOCIATED
glycoproteins RhAG, RhBG,
and RhCG comprise a recently identified branch of the Mep/
Amt/Rh protein superfamily (21, 22, 26). The inaugural member, RhAG is exclusively expressed in erythrocytes, where it is
proposed to form part of a multiprotein complex of membrane
and cytoskeletal proteins including the major integral erythrocyte membrane protein anion exchanger 1 (eAE1) (5, 12).
RhBG and RhCG are homologous non-erythroid proteins expressed in a wide variety of tissues including the ␣-intercalated
cells (IC) of the kidney (30, 39), where a truncated isoform of
Address for reprint requests and other correspondence: A. M. Toye, Dept. of
Biochemistry, School of Medical Sciences, Univ. Walk, Bristol BS8 1TD, UK
(e-mail:[email protected]).
http://www.ajprenal.org
AE1 is present in the basolateral membrane (19, 40). We
initiated the work presented in this manuscript to investigate
the suggestion that a putative kidney Rh:kAE1 complex could
exist in the basolateral membrane of IC, similar to that of the
erythrocyte complex (28).
The Mep/Amt proteins, found mostly in nonvertebrate organisms, are functionally characterized as channels for ammonia transport. However, the physiological role for the related
mammalian Rh glycoproteins is less well defined (14, 20, 26).
Complementation studies in Mep deletion strains of yeast and
multiple functional studies of Rh proteins confirmed an ability
of the Rh proteins to transport ammonia (1, 25, 31, 42– 44).
Since ammonia transport cannot be monitored directly, the
⫹
nature of the substrate, NH3 or NH⫹
4 /H exchange, is controversial. The recent demonstration that mice lacking Rhcg have
an incomplete form of distal renal tubular acidosis (dRTA) due
to impaired ammonia excretion, is supportive of an involvement in ammonium transport (3). However, studies in Rh null
red blood cells suggested that RhAG might also transport CO2
(11, 36), and subsequently both nitrous oxide and oxygen have
been proposed as putative substrates (6, 29). An ability to
perhaps transport multiple substrates is similar to that of the
water channel aquaporin-1 (AQP1), which may transport CO2
and O2 (8, 11, 27). One possibility is that Rh protein substrate
selectivity might depend on the physiological context in which
the proteins are localized.
To further understand the potential role of the RhBG and
RhCG in human ammonium excretion and investigate the
possibility of a putative membrane protein complex with
kAE1, it is important to firmly establish the localization of the
proteins in the human kidney both in terms of their cellular and
membrane distribution. To date, multiple studies in mouse and
rat tissue suggest that RhBG is basolaterally and RhCG is
apically and, in some cases basolaterally, localized in the same
cells of the distal convoluted tubule (DCT), connecting tubule
(CNT), and collecting duct (CD) (10, 16, 30, 33, 34, 39).
No studies of RhBG protein localization in the human
kidney are currently published. Interestingly, genetic ablation
of RhBG in mice had no observed phenotype even after
chronic acid loading of the animals, and RhBG is not upregulated under metabolic acidotic conditions in rats (7). Hence the
importance of RhBG to kidney acid-base balance has yet to be
established. Only one localization study has been carried out
for RhCG in human tissue, in which a predominantly basolateral and partially apical localization were observed, a result
therefore not entirely consistent with animal studies (13).
Given the discrepancies of RhCG localization between animal studies and human tissue, and the lack of RhBG charac-
0363-6127/09 $8.00 Copyright © 2009 the American Physiological Society
F1279
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.246 on October 14, 2016
Brown AC, Hallouane D, Mawby WJ, Karet FE, Saleem MA,
Howie AJ, Toye AM. RhCG is the major putative ammonia transporter expressed in the human kidney, and RhBG is not expressed at
detectable levels. Am J Physiol Renal Physiol 296: F1279 –F1290, 2009.
First published April 8, 2009; doi:10.1152/ajprenal.00013.2009.—Rhesus glycoprotein homologs RhAG, RhBG, and RhCG comprise a
recently identified branch of the Mep/Amt ammonia transporter family. Animal studies have shown that RhBG and RhCG are present in
the kidney distal tubules. Studies in mouse and rat tissue suggest a
basolateral localization for RhBG in cells of the distal tubules including the ␣-intercalated cells (␣-IC), but no localization of RhBG has
been reported in human tissue. To date RhCG localization has been
described as exclusively apical plasma membrane in mouse and rat
kidney, or apical and basolateral in humans, and some mouse and rat
tissue studies. We raised novel antibodies to RhBG and RhCG to
examine their localization in the human kidney. Madin-Darby canine
kidney (MDCKI) cell lines stably expressing human green fluorescent
protein-tagged RhBG or RhCG and human tissue lysates were used to
demonstrate the specificity of these antibodies for detecting RhBG
and RhCG. Using immunoperoxidase staining and antigen liberation
techniques, both apical and basolateral RhCG localization was observed in the majority of the cells of the distal convoluted tubule and
IC of the connecting tubule and collecting duct. Confocal microscopic
imaging of normal human kidney cryosections showed that RhCG
staining was predominantly localized to the apical membrane in these
cells with some basolateral and intracellular staining evident. A
proportion of RhCG staining labeled kAE1-positive cells, confirming
that RhCG is localized to the ␣-IC cells. Surprisingly, no RhBG
protein was detectable in the human kidney by Western blot analysis
of tissue lysates, or by immunohistochemistry or confocal microscopy
of tissue sections. The same antibodies, however, could detect RhBG
in rat tissue. We conclude that under normal conditions, RhCG is the
major putative ammonia transporter expressed in the human kidney
and RhBG is not expressed at detectable levels.
F1280
RhCG AND RhBG LOCALIZATION IN THE HUMAN KIDNEY
MATERIALS AND METHODS
Antibodies. The monoclonal NH2-terminal anti-AE1 antibody
BRIC170 (17 ␮g/ml) was used to detect human kAE1 (37). Monoclonal anti-Na⫹-K⫹-ATPase antibody was obtained from Upstate
Biotechnology (Lake Placid, NY), polyclonal anti-GFP antibody from
Abcam (Cambridge, UK), and polyclonal anti-actin obtained from
Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal horseradish
peroxidase (HRP)-conjugated rabbit anti-mouse and swine anti-rabbit
immunoglobulin antibodies were purchased from Dako (Cambridge,
UK), and Alexa 488- or 594-conjugated antibodies were obtained from
Molecular Probes (Paisley, UK). Synthetic peptides MAGSPSRAAGRRLQLPLLC and CGEHEDKAQRPLR, corresponding
to regions within the NH2 and COOH termini of human RhBG, and a
synthetic peptide CPSVPSVPMVSPLPMASSVPLVP, corresponding
to the COOH terminus of human RhCG, were synthesized and
purified to ⬎95% purity by the University of Bristol peptide synthesis
facility. Rabbit polyclonal antibodies were raised to each peptide
using standard techniques to produce a NH2-terminal RhBG antibody
(␣RhBG-NT); an affinity purified COOH-terminal RhBG antibody
(␣RhBG-CT1); and two COOH-terminal RhCG antibodies (␣RhCGCT1 and ␣RhCG-CT2). A third rabbit polyclonal antibody to the
COOH-terminal region of RhBG (␣RhBG-CT) and the peptide to
which it was raised were kindly supplied by Dr. Yves Colin (Institut
National de la Transfusion Sanguine, Paris, France) (30). We also
raised two separate antibodies to the NH2 terminus of RhCG (RhCGNT), but these exhibited low reactivity on Western blotting to RhCGGFP expressed in MDCK cells or human kidney lysate, and they also
did not prove useful for imaging by indirect immunofluorescence or
by immunohistochemistry (results not shown).
MDCKI stable cell lines. RhBG and RhCG cloned into pEGFP-C1
or pEGFP-N3 and designated GFP-RhBG, GFP-RhCG or RhBGGFP, RhCG-GFP, respectively were a gift from Dr. Chen Huang
(New York Blood Center). MDCKI cells cultured in DMEM supplemented with 10% FCS were transfected with 1 ␮g of GFP-RhBG,
GFP-RhCG, RhBG-GFP, or RhCG-GFP using Genejuice reagent
(Novagen, Madison, WI). After 24 h, transfected cells were selected
with 600 ␮g/ml G418, grown for a further 48 h, and then cloned by
serial dilution to allow the selection of single colonies, as previously
described (38). MDCKI cell clones stably expressing GFP-tagged
RhBG or RhCG were identified by imaging GFP fluorescence. Positive clones were expanded and continuously cultured in media containing G418.
Cell line polarization and immunofluorescence microscopy. Stable
cell lines expressing GFP-RhCG, GFP-RhBG, RhCG-GFP, or RhBGGFP were polarized by seeding at high density (2.5 ⫻ 105 cells) onto
permeable filters (Nunc, FisherScientific, Leicestershire, UK) and
AJP-Renal Physiol • VOL
grown for 2–3 days as described previously (37). Cells were fixed in
60/40 methanol/acetone and blocked with 4% BSA. GFP-tagged
RhBG and RhCG localization was then investigated using rabbit
anti-GFP and mouse anti-Na⫹-K⫹-ATPase primary antibodies and
compatible goat anti-rabbit Alexa 488 and anti-mouse Alexa 594
secondary antibody detection. To test the novel polyclonal RhBG and
RhCG antibodies’ performance in immunofluorescence studies, stable
cell lines were seeded at low density onto coverslips for 24 h then
fixed and permeabilized in 60/40 methanol/acetone and blocked with
4% BSA. Cells were incubated with a 1:50 dilution of the polyclonal
anti-RhCG COOH-terminal antibodies or anti-RhBG antibodies. Primary antibodies were detected using anti-rabbit Alexa 594 and visualization of GFP fluorescence. All confocal imaging was carried out
on a Leica AOBS SP2 Confocal imaging system attached to a Leica
DM IRE2 inverted epifluorescence microscope (Leica Microsystems,
Milton Keynes, UK). Images were processed using Adobe Photoshop
CS2 and Adobe Illustrator CS2.
Western blot analysis of MDCKI stable cell lines. To assess the
specificity of the novel RhBG and RhCG antibodies by Western
blotting, MDCKI cells stably expressing GFP-RhBG or GFP-RhCG
were treated for 16 h with 5 mM Na butyrate to induce protein
expression and then lysed in 10% SDS sample buffer containing 1:100
PMSF (vol/vol) and 1:100 anti-protease inhibitor cocktail V (vol/vol,
Calbiochem, Nottingham, UK). Lysates were then boiled at 95°C for
5 min with 20 mM DTT and separated by 10% SDS-PAGE. Separated
proteins were transferred to polyvinylidene difluoride membranes, and
nonspecific antibody binding was blocked by incubation for 1 h with
5% nonfat milk, in Tris-buffered saline containing 0.2% Tween 20.
Western blots were analyzed using ␣RhCG-CT, ␣RhBG-CT,
␣RhBG-CT1, or ␣RhBG-NT antibodies, or an anti-GFP antibody, all
diluted 1:1,000 in 5% milk and incubated for 1 h. After three washes,
membranes were incubated for 1 h with swine anti-rabbit IgGconjugated HRP antibody diluted 1:2,000 in 5% milk. Membranes
were washed, developed using Western Lightening (PerkinElmer,
Waltham, MA), and exposed to Hyperfilm (GE Healthcare, Amersham).
RT-PCR. cDNA from the human kidney and liver (Clontech) or
sterile water (negative control) were used as template to amplify
RhBG or RhCG, with primers cagcgcagtgccacgtcaca and gtagcagccagtcagcatcttc (RhBG) or gatttatggtctcttggtgaccctg and ctagctaggtcagcaccagctc (RhCG). These specific intron-spanning primer pairs were
designed from the relevant Ensembl sequences and following 35
rounds of PCR, products were visualized by electrophoresis in agarose
gel. Bands were excised from gel, purified, and sequenced by standard
methods.
Human and rat kidney tissue. Institutional ethical permission to use
human tissues was given for the Academic Renal Unit, Southmead
Hospital (Bristol, UK), Royal Free Hospital and Medical School, and
Cambridge Institute for Medical Research. Anonymized specimens
were used. Human and rat renal cortical and whole kidney protein
lysates were prepared as previously described (35). Lysates were
stored at ⫺80°C until use. Human renal cortical cryosections and a
third human renal cortical protein lysate were obtained from kidneys
that were unsuitable for transplant at Southmead Hospital. For immunohistochemical experiments, human kidney and liver specimens
were from unaffected areas of organs removed for renal cell carcinoma and metastatic colonic carcinoma, respectively.
Western blot analysis of kidney lysates. Human and rat renal tissue
lysate was diluted in 10% SDS sample buffer containing 1:100 PMSF,
1:100 anti-protease inhibitor cocktail V, and 20 mM DTT, boiled for
5 min, and electrophoresed on 10% SDS-polyacrylamide gels (50,
␮g/lane). Proteins were transferred to polyvinylidene difluoride and
blocked in 5% milk for 1 h. To assess RhCG expression, membranes
were incubated with ␣RhCG-CT1 or ␣RhCG-CT2. To assess RhBG
expression, membranes were incubated with ␣RhBG-NT, ␣RhBGCT, and ␣RhBG-CT1 antibodies. To confirm specificity, the antibodies were also preincubated with 1 mg/ml of peptide to which the
296 • JUNE 2009 •
www.ajprenal.org
terization in the human kidney, we raised novel RhCG and
RhBG antibodies to assess expression and distribution of both
proteins in the human kidney. These antibodies were first fully
characterized using Madin-Darby canine kidney (MDCKI) cell
lines stably expressing green fluorescent protein (GFP)-tagged
human RhBG or RhCG and shown to be specific to RhBG or
RhCG by Western blotting and immunofluorescence. We confirm using our RhCG antibodies that RhCG is present in human
kidney lysates and is localized to the apical and basolateral
membranes of cells of the human DCT, CNT, and CD, including kAE1-expressing ␣-IC cells. We also demonstrate that
RhBG is detectable in rat but not in healthy human kidney
tissue when analyzed using Western blotting of renal lysate, by
indirect immunofluorescence, or immunohistochemical techniques. We suggest that in humans, RhCG is the major putative
ammonia/ammonium transporter under normal conditions,
while RhBG is not essential for normal acid-base homeostasis.
RhBG, kidney sections were subjected to pretreatment for 20 min in
Tris-EDTA buffer, pH 9.0, in a microwave oven at 900 W, and then
incubated with ␣RhBG-NT, ␣RhBG-CT, and affinity-purified ␣RhBGCT1 at dilutions ranging from 1:50 to 1:2,000 (vol/vol) for 1 h at room
temperature. Controls were ␣RhBG-CT1 or ␣RhCG-CT antibodies
preabsorbed with their respective immunizing peptides. Following
incubation with the primary antibodies, sections were thoroughly
washed, covered for 30 min with goat anti-rabbit secondary antibodies, and HRP coupled to a dextran backbone (Envision Detection
System, Dako). After washing, sections were covered with a solution
of diaminobenzidine and hydrogen peroxide, washed, counterstained
with Mayer’s hematoxylin, dehydrated, and mounted.
To identify regions of the kidney that were positive for RhCG-CT1,
serial sections were cut, and alternate sections were immunostained
with anti-RhCG-CT1 as described. Each of the intervening sections
was immunostained with one of the following antibodies: sheep
anti-uromodulin (Tamm-Horsfall protein, uromocoid) at 1:4,000;
sheep anti-sodium-potassium-2 chloride cotransporter (furosemide
inhibited) at 1:6,000; sheep anti-sodium-chloride cotransporter (thiazide inhibited) at 1:4,000; sheep anti-AQP2 at 1:8,000; sheep antiepithelial sodium channel ␤-subunit (amiloride inhibited) at 1:4,000;
and sheep anti-11␤-hydroxysteroid dehydrogenase type 2 at 1:4,000
(raised by The Binding Site, Birmingham, UK, against peptide se-
Fig. 1. Polarized localization of green fluorescent protein (GFP)-tagged Rh glycoprotein homolog (RhBG) and GFP-RhCG in Madin-Darby canine kidney
(MDCKI) stable cell lines. MDCKI cells stably transfected with NH2 terminally GFP-tagged RhCG (A) or RhBG (B) were polarized on filters. Cells were stained
with rabbit anti-GFP and mouse anti-Na⫹-K⫹-ATPase antibodies and then visualized with anti-rabbit Alexa 488 (green) and anti-mouse Alexa 594 antibodies.
Images were taken in a subapical plane both parallel (xy) and perpendicular to the cells (along the white line in the xy panel, xz). Merged images of the
perpendicular sections demonstrate the majority of RhCG is apically localized, and RhBG has a nonpolarized localization. Bar ⫽ 20 ␮m.
296 • JUNE 2009 •
www.ajprenal.org
antibody was raised. Membranes were also incubated with mouse
monoclonal anti-human kAE1 (BRIC170) and rabbit anti-actin antibodies. All incubations were carried out in 5% milk for 1 h with
antibodies diluted 1:1,000. All primary antibodies used were unpurified serum, except for RhBG-CT1, which was affinity purified. Secondary antibodies used were HRP-conjugated swine anti-rabbit or
rabbit anti-mouse (1:2,000), and blots were developed using Western
Lightning (PerkinElmer).
Immunoperoxidase staining. Human kidney and liver and rat kidney sections were fixed in formal saline, embedded in paraffin wax,
sectioned, and mounted on coated slides. After dewaxing, endogenous
peroxidase was blocked by hydrogen peroxide in methanol. Generally, antibodies do not react with formalin-fixed, paraffin-embedded
tissues unless the material is pretreated in one of a range of ways, such
as by heating or proteolytic digestion, which are presumed to reveal
antigenic epitopes. A number of preliminary experiments were conducted to optimize the antibody dilutions used, and also a variety of
epitope liberation techniques were conducted to determine the optimum conditions for staining of sections. To observe RhCG localization, kidney sections were subjected to 2 min in citrate buffer, pH 6.0,
in a pressure cooker at 100 kPa and then incubated for 1 h at room
temperature with ␣RhCG-CT1 and ␣RhCG-CT2 antibodies at an
optimal dilution of 1:2,000 (vol/vol) in 0.04 M Tris-PBS, pH 7.6. For
F1281
F1282
RESULTS
Stable expression of GFP-RhBG and GFP-RhCG in MDCKI
cells. MDCKI cell lines stably expressing GFP-tagged human
RhCG or RhBG were created to validate the specificity of the
novel anti-human RhCG and RhBG antibodies for use in
Western blotting and immunofluorescence studies. All cell
lines expressing GFP-RhBG and GFP-RhCG when nonpolarized exhibited a plasma membrane expression with some
intracellular staining. Since MDCKI cells are a cell line that
can be polarized into distinct apical and basolateral membrane
domains, these stably transfected cell lines provided an opportunity to investigate the polarized localization of GFP-tagged
RhBG and RhCG. In polarized MDCKI cells, the GFP-RhCG
fusion protein was predominantly localized to the apical membrane of the cells with a small amount of overlap with the
basolateral marker Na⫹-K⫹-ATPase (Fig. 1, merged image). In
comparison, GFP-RhBG expression in polarized MDCKI cells
was present at both the lateral (colocalizing with the basolateral
marker Na⫹-K⫹-ATPase) and apical membranes (Fig. 1,
merged image). This result was surprising as previous MDCKI
expression using untagged RhBG (23) and studies of RhBG in
rat and mouse tissues suggested a purely basolateral localization of this protein (30, 33, 39). However, the distribution of
RhBG to the apical as well as basolateral membrane in our
model is probably due to the GFP tag interfering with normal
trafficking of the protein or because the high level of protein
expression overwhelming the basolateral targeting system, resulting in mistrafficking to the apical membrane. A similar
apical and basolateral localization of both RhCG and RhBG
was seen when the GFP tag was attached to the COOH
terminus. Although further work is necessary to confirm the
localization of untagged RhCG and RhBG in MDCKI cells,
this is not needed here because we are using the cell lines for
the sole purpose of validating novel antibodies by western blot
or immunofluorescence experiments.
Novel polyclonal antibodies to human RhCG and RhBG. To
permit investigation of the expression and localization of
RhCG and RhBG in the human kidney, we raised two novel
antibodies specific to human RhCG (␣RhCG-CT1 and ␣RhCGCT2) and two novel antibodies specific to human RhBG
(␣RhBG-CT1 and ␣RhBG-NT). We also used another COOHterminal RhBG antibody (␣RhBG-CT) reported previously by
others (30).
We confirmed the specificity of these antibodies to human
RhCG and RhBG proteins by Western blotting experiments
using lysates from MDCKI GFP-RhCG and GFP-RhBG cell
lines (Fig. 2). Figure 2A shows using an anti-GFP antibody that
GFP-RhCG and GFP-RhBG were expressed at the correct size
(⬃80 kDa) in MDCKI cells. GFP-RhBG cells also exhibited a
smaller band, which is likely to be a differently glycosylated
form of the protein. Figure 2, B and C, demonstrates that the
RhCG antibodies bound specifically to GFP-RhCG with no
cross-reactivity with GFP-RhBG. For RhBG, all antibodies,
␣RhBG-CT1, ␣RhBG-CT, and ␣RhBG-NT, specifically detected the GFP-RhBG protein and did not cross-react with
RhCG (Fig. 2, D–F). This validation of the antibodies raised to
RhCG and RhBG is important as it demonstrates that all
antibodies used in these studies detect the correct protein and
are specific to either human RhCG or RhBG.
We tested the suitability of the various polyclonal antibodies
to RhCG and RhBG proteins in confocal microscopic immu-
Fig. 2. Novel RhBG and RhCG antibodies are specific to GFP-RhBG or GFP-RhCG when analyzed by Western blotting. MDCKI cells stably expressing
GFP-tagged RhBG or RhCG were treated with sodium butyrate to increase protein expression, lysed, and immunoblotted with polyclonal antibodies to GFP (A),
␣RhCG-CT1 (B), ␣RhCG-CT2 (C), ␣RhBG-CT1 (D), ␣RhBG-NT (E), and ␣RhBG-CT (F). All RhBG and RhCG antibodies bind specifically to the Rh
glycoprotein against which they were raised.
296 • JUNE 2009 •
www.ajprenal.org
quences of the appropriate antigen, and their immunoreactivity was
removed by incubation with the appropriate peptide). After washing,
the second stage was rabbit anti-sheep immunoglobulin, HRP conjugated, at 1:200.
Immunolabeling and fluorescence microscopy. For the RhBG and
RhCG localization studies, human tissue sections were rinsed three
times in PBS then either fixed for 5 min at ⫺20°C in 60/40 methanol/
acetone (vol/vol) or fixed with 3% paraformaldehyde, washed several
times in PBS, 40 mM glycine added, and permeabilized with 0.03%
Triton X-100. All samples were then washed in PBS and blocked for
15 min with 4% BSA. We know from our experience of imaging cell
lines stably expressing RhBG, RhCG or kAE1 that methanol/acetone
fixation gives the best signal for immunofluorescence imaging of
these membrane proteins. Therefore, methanol/acetone was used in
our attempts to detect RhBG by immunofluorescence. Fixed sections
were incubated for 1 h with 1:50 dilutions in 4% BSA of polyclonal
␣RhBG-NT, ␣RhBG-CT, ␣RhBG-CT1, ␣RhCG-CT1, or ␣RhCGCT1 preincubated with 1 mg/ml of peptide to which the antibody had
been raised. After three PBS washes, sections were incubated with
neat BRIC170 (AE1 antibody) for 1 h and then incubated with goat
anti-rabbit Alexa 488 and goat anti-mouse Alexa 594 (Molecular
Probes). Fluorescence microscopy was carried out on a Leica AOBS
SP2 Confocal imaging system attached to a Leica DM IRE2 inverted
epifluorescence microscope (Leica Microsystems).
nofluorescence experiments using the MDCKI GFP-RhBG and
GFP-RhCG stable cell lines (Fig. 3). Both ␣RhCG-CT1 and
␣RhCG-CT2, showed specific GFP-RhCG detection, overlaying with the GFP signal at the cell plasma membrane, and did
not cross-react with GFP-RhBG-expressing cells (Fig. 3, A and
F1283
B; data not shown). In the same way, the three anti-RhBG
polyclonal antibodies specifically detected RhBG, overlapping
with the GFP signal at the plasma membrane of MDCKI GFPRhBG cells (Fig. 3, C–E) but did not cross-react with MDCKI
cells stably expressing GFP-RhCG (results not shown).
296 • JUNE 2009 •
www.ajprenal.org
Fig. 3. Novel RhBG and RhCG antibodies are
specific for GFP-RhBG or GFP-RhCG in immunofluorescence experiments. MDCKI cells
stably expressing NH2 terminally GFPtagged RhCG (A and B) or RhBG (C–E) were
fixed and immunolabeled with polyclonal antibodies ␣RhCG-CT1 (A), ␣RhCG-CT2 (B),
␣RhBG-CT (C), ␣RhBG-CT1 (D), or
␣RhBG-NT (E). GFP-RhBG or GFP-RhCG
expression was visualized by GFP fluorescence (column 1) and RhBG/RhCG antibody
binding by anti-rabbit Alexa 594 secondary
antibody (column 2). Bar ⫽ 50 ␮m.
F1284
␣RhCG-CT1 reacted very strongly with specific parts of the
kidney nephron but not the glomeruli and proximal tubules
(Fig. 5B). Adjacent sections stained for uromodulin (Fig. 5C) and
the sodium-potassium-2 chloride cotransporter (not shown)
shared no overlap with RhCG, and so RhCG is not expressed
in the thick ascending limb of the loop of Henle (TAL) (2). In
the cortex, ␣RhCG-CT1 stained every cell in the DCT, and
reactivity was mainly on the apical membrane, although there
was also staining of the basolateral membrane and, to a lesser
extent, the cytoplasm (Fig. 5D). Sometimes in the outer cortex,
and more commonly in the inner cortex and medulla, reactivity
was confined to individual cells, mainly on the basolateral
membrane (Fig. 5E). The cortical tubules, identified by
␣RhCG-CT1 to have expression of RhCG in all cells (Fig. 5F),
were shown in the adjacent section to express the DCT marker
sodium-chloride cotransporter (Fig. 5G) (2).
The staining of adjacent sections for RhCG and amiloridesensitive epithelial sodium channel (2) showed that cortical
tubules with individual cells expressing RhCG were connecting tubules (Fig. 5, H and I). Further comparison with the
distribution of 11␤-hydroxysteroid dehydrogenase type 2,
which is found in the DCT and CNT (4) confirmed the different
pattern of expression of RhCG in these segments (Fig. 5, H and
J). The single cells that expressed RhCG in the CNT (Fig. 5K)
were shown to be IC cells between the principal cells that
expressed AQP2 (17) (Fig. 5L). These immunohistochemical
results suggest that RhCG is both an apically and basolaterally
targeted protein in the kidney, which is expressed in all cell
types of the DCT and the IC of the CNT and CD.
RhBG protein is not detectable in human renal tissue. We
tested the RhBG antibodies (␣RhBG-NT, ␣RhBG-CT, and
␣RhBG-CT1) to assess the protein levels of RhBG in human
renal cortex lysate, whole kidney lysates, and rat renal cortex
lysates by Western blot analysis. We found no detectable
RhBG protein that could be competed by preincubation with
immunizing peptide, despite using three independent human
kidney tissue samples. We successfully detected RhCG, kAE1,
and ␤-actin in the same lysates by Western blotting, suggesting
that this lack of detection is not due to protein degradation (see
Fig. 4). In comparison, both COOH-terminal antibodies (␣RhBG-CT
and ␣RhBG-CT1) detected a clear band in rat tissue of the
correct molecular weight for RhBG that could be competed by
Fig. 4. Novel antibodies to RhCG bound specifically to human RhCG when human and rat
kidney lysate was analyzed by Western blotting. Fifty micrograms of human or rat renal
cortex lysate were loaded, subjected to SDS
PAGE, and analyzed by immunoblotting. AntiRhCG antibodies, ␣RhCG-CT1 (A) and
␣RhCG-CT2 (B), detect a ⬃52- to 55-kDa
polypeptide, which for ␣RhCG-CT1 was specifically competed by addition of 1 mg/ml of
immunizing peptide to ␣RhCG-CT1 before
incubation with the membrane (A). Blots
were also incubated with antibodies against
human erythrocyte membrane protein anion
exchanger 1 (kAE1; Bric170; C) and ␤-actin
(D) to demonstrate loading of human and rat
samples.
296 • JUNE 2009 •
www.ajprenal.org
RhBG and RhCG mRNA expression in human kidney and
liver. We independently confirmed the presence of both RhBG
and RhCG mRNA in the human kidney and liver. We included
liver because ammonia metabolism occurs in the liver, and
both RhBG and low levels of RhCG have previously been
detected in the liver in mice (41). We made gene-specific
intron-spanning primers to RhBG and RhCG and were able to
detect both RhBG and RhCG mRNA expression in the human
kidney and liver (Supplemental Fig. 1; all supplemental material for this article is available on the journal web site).
Sequencing of the 285- and 342-bp bands conformed exactly to
those published for RhBG and RhCG, respectively (21, 22).
RhCG expression in human tissue. To confirm the presence
of RhCG protein in the human kidney, we conducted Western
blotting using ␣RhCG-CT1 and ␣RhCG-CT2 on human renal
cortical and whole kidney lysate. Figure 4, A and B, shows
representative results. In the human kidney, both COOHterminal antibodies detected a major ⬃52-kDa band and a
minor slightly larger ⬃55-kDa band (most likely a glycosylated form of RhCG) similar to that previously observed in rat
tissue (30). The specificity of ␣RhCG-CT1 for human RhCG is
demonstrated by loss of both bands when the antibody was
preincubated with specific immunizing peptide (Fig. 4A). Figure 4, A and B, also shows that ␣RhCG-CT1 and ␣RhCG-CT2
are specific for human RhCG and do not detect rat RhCG. This
is consistent with the fact that the human and rat sequences
exhibit ⬍20% homology in the COOH-terminal region of
RhCG to which the antibodies were raised. The blot using an
antibody specific to human kAE1 confirmed the orientation
of the human to rat kidney lysate. The ␤-actin blot shows
similar protein loading between human and rat lysate (Fig.
4, C and D).
Localization of RhCG in human kidney. To investigate the
localization of RhCG in the human kidney, we conducted
immunoperoxidase staining using both ␣RhCG-CT1 and
␣RhCG-CT2 antibodies on paraffin-embedded human kidneys.
The distribution of staining using either RhCG-CT1 or RhCGCT2 antibodies was similar and is shown in Fig. 5 for ␣RhCGCT1, with comparisons to markers of identified parts of the
nephron. The immunoreactivity of each antibody was removed
by preincubation with their respective immunizing peptide
(Fig. 5A).
F1285
preincubation of the antibody with specific immunizing peptide
(Fig. 6, A and B). For ␣RhBG-CT, this result supports previously published work on rat lysate utilizing this antibody, and
for ␣RhBG-CT1, this is consistent with a 70% sequence
homology between the human and rat RhBG sequence in the
region to which the antibody was raised (30). For the NH2AJP-Renal Physiol • VOL
terminal antibody ␣RhBG-NT, no specific binding was observed in rat lysate, a result that is consistent with a complete
lack of homology between rat and human RhBG in the NH2terminal region (Fig. 6C).
To confirm the result observed by Western blot analysis, the
anti-RhBG antibodies were also used for immunoperoxidase
296 • JUNE 2009 •
www.ajprenal.org
Fig. 5. Immunoperoxidase staining of a human kidney with rabbit ␣RhCG-CT1 antibody and various markers of parts of the tubule. A: control section of cortex
stained by ␣RhCG-CT1 preincubated with the immunizing peptide. B: low-magnification view of the cortex (c) and outer medulla (m). Glomeruli and proximal
tubules are not stained. Only some parts of tubules are detected, and the staining appears mostly continuous in the cortex and intermittent in the medulla. The
arrows indicate parts of tubules that show staining for RhCG-CT1 but not for uromodulin in an adjacent section (C) or vice versa. RhCG is therefore not expressed
in the thick limb of the loop of Henle. D: high-magnification image of the cortex to show that in some tubules every cell expresses RhCG, and the arrows indicate
that the apical membrane is most strongly stained, although there is also staining of the basolateral membrane and to a lesser extent the cytoplasm.
E: high-magnification image of the inner medulla to show that only some cells in collecting ducts (cd) are stained, mainly on the basolateral membrane (arrowed).
In F there is a group of tubules expressing RhCG, and G shows that the same tubules in an adjacent section express the sodium-chloride cotransporter on their
apical membrane (arrows). This confirms expression of RhCG in the distal convoluted tubule. In H, RhCG-CT1 immunostaining is seen in cortical tubules not
only continuously as in C and F, but also discontinuously (arrows). Adjacent sections show that the discontinuous part expresses the amiloride-sensitive epithelial
sodium channel (I) and that both parts express 11␤-hydroxysteroid dehydrogenase type 2 (J). This shows that the continuous staining of the distal convoluted
tubule changes to staining only of intercalated cells in the connecting tubule. In K, a connecting tubule has RhCG-CT1 staining only in intercalated cells, while
in an adjacent section principal cells express aquaporin-2 on their apical membrane (arrows; L).
F1286
staining and immunofluorescence experiments on human kidney sections. In previous studies in mice and rats, RhBG has
been shown to be localized in cells of the DCT, CNT, and CD
and to costain cells expressing RhCG or kAE1 (39). Importantly, immunoperoxidase staining for RhBG under a range of
antibody dilutions and antigen-retrieval techniques showed no
detectable RhBG in the human kidney or liver. ␣RhBG-CT1 at
high concentrations, especially at 1:50, gave a slight cytoplasmic stain in the cells of the TAL that was competed by peptide
(Fig. 7, C and D), but no membrane staining was detected, and
there was no reactivity at dilutions comparable to those at
which the RhCG antibodies reacted. Even at such high antibody concentrations, ␣RhBG-CT revealed no detectable reactivity (Fig. 7, A and B). Since both the RhBG COOH-terminal
antibodies used here detected a protein in rat tissue lysate (Fig.
6), we also assessed the ability of the antibodies to stain rat
kidney sections. Visualization of the stained rat sections revealed strong plasma membrane reactivity of the RhBG-CT
antibodies in the DCT, CNT, and CD (Fig. 7F), a result
consistent with previously published RhBG localization in
animal studies (30, 33, 39).
Human liver sections were also stained to assess whether
RhBG or RhCG was expressed, because RhBG and low levels
of RhCG are reported to be expressed in the mouse liver (40).
The antibodies ␣RhCG-CT1 and ␣RhCG-CT2 reacted with
RhCG at the cell membrane of isolated, scattered hepatocytes
in normal liver, without obvious restriction to any part of
lobules (Fig. 7G). This reactivity was abolished by absorption
of the antibody with immunizing peptide (Fig. 7H). The antibody to RhBG, ␣RhBG-CT1, showed no reactivity in the liver
(Fig. 7I). Therefore, similarly to the kidney, although there is
detectable RhCG expression in the human liver, no RhBG was
detectable.
Furthermore, we also attempted costaining of healthy human
renal cortex cryosections with RhBG and kAE1. Visualization
showed no detectable levels of RhBG in either the kAE1expressing ␣-IC cells or any other cell type within the kidney
cortex when assessed by immunofluorescence (Fig. 8, C–E)
despite identical techniques showing clear staining in the ␣-IC
cells for the RhCG protein (Fig. 8A).
Taken together, the immunostaining results using paraffinembedded sections and cryosections are consistent with the
lack of detection of RhBG by Western blotting. Since we have
already demonstrated that human RhBG can be detected when
stably overexpressed in MDCKI cells both by Western blotting
and by confocal imaging, with an equivalent sensitivity to that
of the RhCG antibodies, we conclude that RhBG is not expressed at significant levels in healthy human kidneys.
DISCUSSION
Here, we present the first study of RhCG and RhBG localization in human tissue that utilizes multiple antibodies specifically raised and validated against the human proteins. The
novel RhCG COOH-terminal antibodies specifically bind a
⬃52- to 55-kDa protein, a band of the predicted size for human
RhCG, but do not bind RhCG in rat lysate due to the known
species-specific differences in the COOH-terminal sequence.
Using these antibodies, by immunohistochemistry and indirect immunofluorescence, we have shown that RhCG is
apically and basolaterally localized in all cells of the human
DCT and the IC cells of the CNT and CD, with some
intracellular protein distribution. This is similar to a previous study on human tissue using an anti-mouse RhCG
COOH-terminal antibody, except here the apical expression
is more evident (13).
Using two novel RhBG antibodies and a third antibody to
human RhBG previously used in rat kidney tissue (30), we
have carried out the first investigation of RhBG protein expression in the human kidney and have observed that RhBG is
not present at levels that are detectable on Western blots or in
immunofluorescence experiments using healthy human renal
cortical tissue. We also did not detect significant RhBG in the
kidney DCT, CNT, CD, or in human liver sections by immunoperoxidase methods using these antibodies at dilutions comparable to those used for the RhCG antibodies. Given that
RhBG mRNA was detected in the human kidney and liver and
that mice and rats have RhBG at the basolateral membrane of
cells in the DCT, CNT, and CD, the result is initially surprising. However, the presence of detectable mRNA by RT-PCR
296 • JUNE 2009 •
www.ajprenal.org
Fig. 6. RhBG is detectable on Western blot of rat kidney lysate but not of healthy human kidney lysate. Fifty micrograms of each lysate were prepared as in
Fig. 4. Two COOH-terminal antibodies, ␣RhBG-CT (A) and affinity-purified ␣RhBG-CT1 (B) bind a ⬃54-kDa polypeptide in rat cortex tissue that can be
specifically competed by preincubation of the antibodies with 1 mg/ml of immunizing peptide. Neither antibody detects an equivalent polypeptide in human tissue
that can be specifically competed. The NH2-terminal RhBG antibody, ␣RhBG-NT, binds nonspecifically in both rat and human tissue with equivalent background
bands detected in the presence or absence of immunizing peptide (C).
F1287
does not guarantee the presence of functional protein that can
be detected by Western blotting. In healthy individuals, this
could be explained by a rapid degradation of the mRNA before
translation occurs, inefficient translation of the RhBG mRNA,
or because of posttranslational regulation of RhBG protein
expression. Such differences between detectable mRNA transcripts and levels of protein isoforms have been demonstrated
for other mammalian proteins, for example myosin heavy
chain in horse skeletal muscle (9). Although we could not
detect RhBG under the conditions used here, we cannot exclude the possibility that RhBG protein is expressed at some
point during the different metabolic stresses experienced by the
kidney. Furthermore, detectable RhBG protein may also occur
in individuals with renal disease phenotypes (e.g., renal cell
carcinoma or dRTA) which we intend to explore in future
studies. Interestingly, genetic ablation of Rhbg in mice resulted
in no observed effects on acid-base homeostasis under normal
conditions or after acid loading, the abundance of ␣-IC cells in
the DCT, CNT, or CD, or on the protein levels or membrane
distribution of the IC proteins RhCG, kAE1, or H⫹-ATPase
(7). Rhbg distribution and expression levels are also unchanged
in rats with chronic metabolic acidosis (33). These observations, when considered in conjunction with the absence of
detectable RhBG protein expression in the human kidney,
suggest that RhBG is not essential to maintaining acid-base
balance or normal ammonium excretion in the mammalian
kidney.
Since we have shown that RhCG is present and RhBG is
apparently absent in the human DCT, CNT, and CD, we
conclude that RhCG is the significant putative ammonia/ammonium transporter in the human kidney. However, the defin⫹
itive nature of the transport species (NH3 or NH⫹
ex4 /H
change) for RhBG and RhCG have yet to be fully established
and have not been explored here. In the distal tubule and CD,
the approximate total interstitial and intracellular NH⫹
4 /NH3
concentrations are ⬍5 and ⬍8 mM, respectively, while the
intraluminal concentration can be as high as 200 mM (18, 24).
Apical and basolateral RhCG ammonia/ammonium transport
in conjunction with apical H⫹ secretion by the H⫹-ATPase
would make physiological sense in terms of maintaining a high
luminal ammonium concentration and hence adequate acidification of the urine. Thus, although RhBG abatement had no
detectable phenotype in mice, we would predict that because of
the ubiquitous nature of RhCG expression in the kidney and,
due to its role as a putative ammonia/ammonium transporter
with obvious importance for acid secretion, the absence of this
protein will have a detectable phenotype in knockout animals.
Importantly, during the preparation of this manuscript, it has
been shown that mice lacking Rhcg were found to have
abnormal urinary acidification due to impaired ammonium
296 • JUNE 2009 •
www.ajprenal.org
Fig. 7. RhBG is not detectable by immunoperoxidase stain on human renal cortex, renal medulla, or liver sections but is detectable on immunoperoxidase-stained
rat kidney. Human renal cortex and medulla sections were stained with ␣RhBG-CT (A and B) and ␣RhBG-CT1 (C and D) at a high concentration (1:50). There
is no reactivity to RhBG using ␣RhBG-CT in any region of the cortex (A) or medulla (B) and only a faint cytoplasmic staining in thick ascending limbs using
␣RhBG-CT1 (C and D). Preincubation of ␣RhBG-CT1 with immunizing peptide did remove this antibody reactivity (E). Rat renal cortex immunostained with
␣RhBG-CT showed basolateral RhBG staining in the distal tubules (F). Human liver sections were first stained with ␣RhCG-CT1 antibody (G). A few scattered
hepatocytes show strong membrane staining (G), which is removed following preincubation of ␣RhCG-CT1 antibody with immunizing peptide (H). Liver
immunostained with ␣RhBG-CT1 showed no reactivity in any cell type (I).
F1288
Fig. 8. RhCG but not RhBG can be detected by
immunofluorescence staining of healthy human
renal cortex sections. Renal cortex sections of a
human kidney were costained with rabbit
␣RhCG-CT1 antibody (column 1, A and B) and
a mouse antibody to ␣-intercalated cell (IC)
basolaterally localized protein kAE1 (column 2).
Immunofluorescence visualization using antirabbit Alexa 488 and anti-mouse Alexa 594
antibodies show RhCG and kAE1 costain ␣-IC,
where RhCG is predominantly apically localized and kAE1 is basolaterally localized (A).
Preincubation with immunizing peptide competed RhCG binding; hence staining of the tissue for RhCG was no longer observed (B).
Human renal cortex sections were also stained
for RhBG, using ␣RhBG-CT (A), affinity-purified ␣RhBG-CT1 (B) and ␣RhBG-NT (C) antibodies, and costained for kAE1 using Bric170.
No RhBG immunoreactivity was observed with
any of the three RhBG antibodies in any region
or cell type of the kidney cortex including the
kAE1-positive ␣-IC. This result was observed in
several independent tissue samples. Bar ⫽ 50 ␮m.
secretion on acid loading (i.e., incomplete dRTA). We therefore suggest that, in humans, the movement of ammonia/
ammonium across the apical and basolateral membrane of the
human distal tubules is facilitated by RhCG. This also highlights RhCG as a potential candidate gene for association with
dRTA.
The results of this study are also significant when one
considers the existence of a putative Rh protein:kAE1 membrane complex. In the red blood cell, RhAG has been shown by
coimmunoprecipitation experiments to associate with eAE1
and the related Rh polypeptides RhCE and RhD (5). It was
consequently proposed by Bruce et al. (5) that these membrane
296 • JUNE 2009 •
www.ajprenal.org
ACKNOWLEDGMENTS
10.
11.
12.
13.
14.
15.
16.
17.
We thank Dr. Chen Huang (New York Blood Center) for the kind provision
of GFP-tagged RhBG and RhCG constructs and Dr. Yves Colin (Institut
National de la Transfusion Sanguine, Paris, France) for the RhBG C-terminal
antibody.
18.
19.
GRANTS
This work was funded by a Kidney Research UK and GlaxoSmithKline
industrial PhD studentship to A. M. Toye for A. C. N. Brown, a NHS Blood
and Transplant Wellcome Trust Fellowship awarded to A. M. Toye, and the
NIHR Biomedical Research Programme.
20.
21.
REFERENCES
1. Bakouh N, Benjelloun F, Hulin P, Brouillard F, Edelman A, CherifZahar B, Planelles G. NH3 is involved in the NH4⫹ transport induced by
the functional expression of the human Rh C glycoprotein. J Biol Chem
279: 15975–15983, 2004.
2. Biner HL, Arpin-Bott MP, Loffing J, Wang X, Knepper M, Hebert
SC, Kaissling B. Human cortical distal nephron: distribution of electrolyte
and water transport pathways. J Am Soc Nephrol 13: 836 – 847, 2002.
3. Biver S, Belge H, Bourgeois S, Van Vooren P, Nowik M, Scohy S,
Houillier P, Szpirer J, Szpirer C, Wagner CA, Devuyst O, Marini AM.
A role for Rhesus factor Rhcg in renal ammonium excretion and male
fertility. Nature 456: 339 –343, 2008.
4. Bostanjoglo M, Reeves WB, Reilly RF, Velazquez H, Robertson N,
Litwack G, Morsing P, Dorup J, Bachmann S, Ellison DH. 11Betahydroxysteroid dehydrogenase, mineralocorticoid receptor, and thiazidesensitive Na-Cl cotransporter expression by distal tubules. J Am Soc
Nephrol 9: 1347–1358, 1998.
5. Bruce LJ, Beckmann R, Ribeiro ML, Peters LL, Chasis JA, Delaunay
J, Mohandas N, Anstee DJ, Tanner MJ. A band 3-based macrocomplex
of integral and peripheral proteins in the RBC membrane. Blood 101:
4180 – 4188, 2003.
6. Burton NM, Anstee DJ. Structure, function and significance of Rh
proteins in red cells. Curr Opin Hematol 15: 625– 630, 2008.
7. Chambrey R, Goossens D, Bourgeois S, Picard N, Bloch-Faure M,
Leviel F, Geoffroy V, Cambillau M, Colin Y, Paillard M, Houillier P,
Cartron JP, Eladari D. Genetic ablation of Rhbg in the mouse does not
impair renal ammonium excretion. Am J Physiol Renal Physiol 289:
F1281–F1290, 2005.
8. Echevarria M, Munoz-Cabello AM, Sanchez-Silva R, Toledo-Aral JJ,
Lopez-Barneo J. Development of cytosolic hypoxia and hypoxia-inducible factor stabilization are facilitated by aquaporin-1 expression. J Biol
Chem 282: 30207–30215, 2007.
9. Eizema K, van den Burg M, Kiri A, Dingboom EG, van Oudheusden
H, Goldspink G, Weijs WA. Differential expression of equine myosin
22.
23.
24.
25.
26.
27.
28.
29.
30.
heavy-chain mRNA and protein isoforms in a limb muscle. J Histochem
Cytochem 51: 1207–1216, 2003.
Eladari D, Cheval L, Quentin F, Bertrand O, Mouro I, Cherif-Zahar
B, Cartron JP, Paillard M, Doucet A, Chambrey R. Expression of
RhCG, a new putative NH3/NH⫹
4 transporter, along the rat nephron. J Am
Soc Nephrol 13: 1999 –2008, 2002.
Endeward V, Cartron JP, Ripoche P, Gros G. RhAG protein of the
Rhesus complex is a CO2 channel in the human red cell membrane.
FASEB J 22: 64 –73, 2008.
Eyers SA, Ridgwell K, Mawby WJ, Tanner MJ. Topology and organization of human Rh (rhesus) blood group-related polypeptides. J Biol
Chem 269: 6417– 6423, 1994.
Han KH, Croker BP, Clapp WL, Werner D, Sahni M, Kim J, Kim
HY, Handlogten ME, Weiner ID. Expression of the ammonia transporter, Rh C glycoprotein, in normal and neoplastic human kidney. J Am
Soc Nephrol 17: 2670 –2679, 2006.
Huang CH, Liu PZ. New insights into the Rh superfamily of genes and
proteins in erythroid cells and nonerythroid tissues. Blood Cell Mol Dis
27: 90 –101, 2001.
Huber S, Asan E, Jons T, Kerscher C, Puschel B, Drenckhahn D.
Expression of rat kidney anion exchanger 1 in type A intercalated cells in
metabolic acidosis and alkalosis. Am J Physiol Renal Physiol 277: F841–
F849, 1999.
Kim HY, Verlander JW, Bishop JM, Cain BD, Han KH, Igarashi P,
Lee HW, Handlogten ME, Weiner ID. Basolateral expression of the
ammonia transporter family member Rh C glycoprotein in the mouse
kidney. Am J Physiol Renal Physiol 296: F543–F555, 2009.
Kim J, Kim YH, Cha JH, Tisher CC, Madsen KM. Intercalated cell
subtypes in connecting tubule and cortical collecting duct of rat and
mouse. J Am Soc Nephrol 10: 1–12, 1999.
Knepper MA, Packer R, Good DW. Ammonium transport in the kidney.
Physiol Rev 69: 179 –249, 1989.
Kollert-Jons A, Wagner S, Hubner S, Appelhans H, Drenckhahn D.
Anion exchanger 1 in human kidney and oncocytoma differs from erythroid AE1 in its NH2 terminus. Am J Physiol Renal Fluid Electrolyte
Physiol 265: F813–F821, 1993.
Li XD, Lupo D, Zheng L, Winkler F. Structural and functional insights
into the AmtB/Mep/Rh protein family. Transfus Clin Biol 13: 65– 69,
2006.
Liu Z, Chen Y, Mo R, Hui C, Cheng JF, Mohandas N, Huang CH.
Characterization of human RhCG and mouse Rhcg as novel nonerythroid
Rh glycoprotein homologues predominantly expressed in kidney and
testis. J Biol Chem 275: 25641–25651, 2000.
Liu Z, Peng J, Mo R, Hui C, Huang CH. Rh type B glycoprotein is a
new member of the Rh superfamily and a putative ammonia transporter in
mammals. J Biol Chem 276: 1424 –1433, 2001.
Lopez C, Metral S, Eladari D, Drevensek S, Gane P, Chambrey R,
Bennett V, Cartron JP, Le Van Kim C, Colin Y. The ammonium
transporter RhBG: requirement of a tyrosine-based signal and ankyrin-G
for basolateral targeting and membrane anchorage in polarized kidney
epithelial cells. J Biol Chem 280: 8221– 8228, 2005.
Mak DO, Dang B, Weiner ID, Foskett JK, Westhoff CM. Characterization of ammonia transport by the kidney Rh glycoproteins RhBG and
RhCG. Am J Physiol Renal Physiol 290: F297–F305, 2006.
Marini AM, Matassi G, Raynal V, Andre B, Cartron JP, CherifZahar B. The human Rhesus-associated RhAG protein and a kidney
homologue promote ammonium transport in yeast. Nat Genet 26: 341–
344, 2000.
Marini AM, Urrestarazu A, Beauwens R, Andre B. The Rh (rhesus)
blood group polypeptides are related to NH⫹
4 transporters. Trends Biochem
Sci 22: 460 – 461, 1997.
Nakhoul NL, Davis BA, Romero MF, Boron WF. Effect of expressing
the water channel aquaporin-1 on the CO2 permeability of Xenopus
oocytes. Am J Physiol Cell Physiol 274: C543–C548, 1998.
Nicolas V, Mouro-Chanteloup I, Lopez C, Gane P, Gimm A, Mohandas N, Cartron JP, Le Van Kim C, Colin Y. Functional interaction
between Rh proteins and the spectrin-based skeleton in erythroid and
epithelial cells. Transfus Clin Biol 13: 23–28, 2006.
Pawloski JR, Hess DT, Stamler JS. Export by red blood cells of nitric
oxide bioactivity. Nature 409: 622– 626, 2001.
Quentin F, Eladari D, Cheval L, Lopez C, Goossens D, Colin Y,
Cartron JP, Paillard M, Chambrey R. RhBG and RhCG, the putative
ammonia transporters, are expressed in the same cells in the distal
nephron. J Am Soc Nephrol 14: 545–554, 2003.
296 • JUNE 2009 •
www.ajprenal.org
interactions form the core of an erythrocyte protein macrocomplex that includes the cytoskeletal protein components ankyrin
and spectrin. This complex is thought to be essential to maintaining biconcave red cell morphology and efficient gas exchange. The lack of kidney RhBG expression and the fact that
kAE1 abundance at the basolateral membrane is unaffected by
genetic ablation of Rhbg, and unlike RhBG, kAE1 is upregulated in response to metabolic acidosis, suggest that a RhBG:
kAE1 complex is unlikely to occur (15, 32). The possibility of
RhCG:kAE1 interaction occurring during membrane trafficking or at the basolateral membrane in ␣-IC cells however,
cannot be ruled out, but in our preliminary experiments in
HEK293 cells and Xenopus oocytes expressing both human
RhCG and kAE1, neither protein could immunoprecipitate the
other (A. C. N. Brown and A. M. Toye, unpublished observations). In summary, we describe RhCG as the apically and
basolaterally localized Rh glycoprotein homolog and putative
ammonia transporter expressed in the human kidney, and we
observe that RhBG is absent and therefore unlikely to contribute to renal acid-base homeostasis under normal physiological
conditions in humans.
F1289
F1290
38.
39.
40.
41.
42.
43.
44.
larised kidney cells: mis-targeting explains dominant renal tubular acidosis
(dRTA). J Cell Sci 117: 1399 –1410, 2004.
Toye AM, Bruce LJ, Unwin RJ, Wrong O, Tanner MJ. Band 3 Walton,
a C-terminal deletion associated with distal renal tubular acidosis, is
expressed in the red cell membrane but retained internally in kidney cells.
Blood 99: 342–347, 2002.
Verlander JW, Miller RT, Frank AE, Royaux IE, Kim YH, Weiner
ID. Localization of the ammonium transporter proteins RhBG and RhCG
in mouse kidney. Am J Physiol Renal Physiol 284: F323–F337, 2003.
Wagner S, Vogel R, Lietzke R, Koob R, Drenckhahn D. Immunochemical characterization of a band 3-like anion exchanger in collecting
duct of human kidney. Am J Physiol Renal Fluid Electrolyte Physiol 253:
F213–F221, 1987.
Weiner ID, Miller RT, Verlander JW. Localization of the ammonium
transporters, Rh B glycoprotein and Rh C glycoprotein, in the mouse liver.
Gastroenterology 124: 1432–1440, 2003.
Westhoff CM, Ferreri-Jacobia M, Mak DO, Foskett JK. Identification
of the erythrocyte Rh blood group glycoprotein as a mammalian ammonium transporter. J Biol Chem 277: 12499 –12502, 2002.
Westhoff CM, Siegel DL, Burd CG, Foskett JK. Mechanism of genetic
complementation of ammonium transport in yeast by human erythrocyte
Rh-associated glycoprotein. J Biol Chem 279: 17443–17448, 2004.
Zidi-Yahiaoui N, Mouro-Chanteloup I, D’Ambrosio AM, Lopez C,
Gane P, Le van Kim C, Cartron JP, Colin Y, Ripoche P. Human
Rhesus B and Rhesus C glycoproteins: properties of facilitated ammonium
transport in recombinant kidney cells. Biochem J 391: 33– 40, 2005.
296 • JUNE 2009 •
www.ajprenal.org
31. Ripoche P, Bertrand O, Gane P, Birkenmeier C, Colin Y, Cartron JP.
Human Rhesus-associated glycoprotein mediates facilitated transport of
NH3 into red blood cells. Proc Natl Acad Sci USA 101: 17222–17227,
2004.
32. Sabolic I, Brown D, Gluck SL, Alper SL. Regulation of AE1 anion
exchanger and H⫹-ATPase in rat cortex by acute metabolic acidosis and
alkalosis. Kidney Int 51: 125–137, 1997.
33. Seshadri RM, Klein JD, Kozlowski S, Sands JM, Kim YH, Han KH,
Handlogten ME, Verlander JW, Weiner ID. Renal expression of the
ammonia transporters, Rhbg and Rhcg, in response to chronic metabolic
acidosis. Am J Physiol Renal Physiol 290: F397–F408, 2006.
34. Seshadri RM, Klein JD, Smith T, Sands JM, Handlogten ME, Verlander JW, Weiner ID. Changes in subcellular distribution of the ammonia transporter, Rhcg, in response to chronic metabolic acidosis. Am J
Physiol Renal Physiol 290: F1443–F1452, 2006.
35. Smith AN, Skaug J, Choate KA, Nayir A, Bakkaloglu A, Ozen S,
Hulton SA, Sanjad SA, Al-Sabban EA, Lifton RP, Scherer SW, Karet
FE. Mutations in ATP6N1B, encoding a new kidney vacuolar proton
pump 116-kD subunit, cause recessive distal renal tubular acidosis with
preserved hearing. Nat Genet 26: 71–75, 2000.
36. Soupene E, King N, Feild E, Liu P, Niyogi KK, Huang CH, Kustu S.
Rhesus expression in a green alga is regulated by CO2. Proc Natl Acad Sci
USA 99: 7769 –7773, 2002.
37. Toye AM, Banting G, Tanner MJ. Regions of human kidney anion
exchanger 1 (kAE1) required for basolateral targeting of kAE1 in po-

RhCG is the major putative ammonia transporter

Transcription

Similar documents

Kidney infection - BMJ Best Practice

Oct 2015 - National Kidney Foundation

08_cc_sindrome_de_he.. - revista mexicana de urología

ANGIOLOGIA E CIRURGIA VASCULAR

Hayden Scott Knight

Renal function []

for Patient Preferences

November 22, 2008 Beverly Hilton Hotel, Beverly Hills