Setiembre 2010 - Asociacion Medica de Puerto Rico

Transcription

B LETÍN
Asociación Médica de Puerto Rico
CONTENIDO
3
MENSAJE DEL PRESIDENTE
Rolance Chavier Roper, MD
Editorial Article/Articulo Editorial
4
Editorial
José Ginel Rodríguez, MD, FAAP
Original Articles/Articulos originales
62
Failure To Pass Meconium
68
Instrucciones para los autores / Instructions to
Authors
Luis Lizardo Sánchez MS, Humberto Lugo-Vicente, MD
Case Reports / Reporte de Casos
69
Late Presentation Of Familial Mediterranean Fever: A Case Report
72
Rectal Stricture: A Rare Presentation Of Primary Amyloidosis
76
Development Of Grave’s Disease Seven Months
After Hashimoto’s Thyroiditis: A Rare Occurrence
5
Membrane Potential And Ph-Dependent Accumula-
tion Of Decynium-22 (1,1’-Diethyl-2,2’-Cyanine Iodi
de) Flourencence Through Oct Transporters In As-
trocytes
13
Prevalence Of Drug Resistance And Associated
Mutations In A Population Of Hiv-1+ Puerto Ricans In 2005
21
Effects Of Gravitational Perturbation On The
Expression Of Genes Regulating Metabolism In Jurkat Cells
79
Hidden In Plain Sight: Macrophage Activation Syndrome Complicating Adult Onset Still’s Disease
28
83
Cardiovascular Events During General Elections In Bayamon, Puerto Rico
Acute Hepatitis A Infection: A Predisposing Factor For Severe Leptospirosis
35
Gender Differences In Social And Developmental Factors Affecting Puerto Rican Adolescents During The Early Stage
45
Changes In The Socio-Demographics, Risk
Behaviors, Clinical And Immunological Profile Of A Cohort Of The Puerto Rican Population Living With Hiv: An Update Of The Retrovirus Research
Center (1992-2008)
55
Variation Of The Posterior Cerebral Artery And Its Embryological Explanation: A Cadaveric Study
Mikhail Inyushin, Yuri Kucheryaykh, Lilia Kucheryavykh, Priscilla Sanabria, Carlos Jiménez-Rivera Irina Strugano-
va Misty Eaton, Serguei Skatchkov
Luis A. Cubano PhD, Luz Cumba, Lycely del C. Sepúlve-
da-Torres, Nawal Boukli, Eddy Ríos-Olivares
Kanika Singh, Luis Cubano PhD, Marian Lewis
Arnaldo E. Pérez-Mercado MD, Gerónimo Maldonado-
Martínez MPH, José Rivera del Rio MD, Robert F. Hunter Mellado MD
Christine Miranda MPHE, Diana M. Fernandez EdD,
Geronimo Maldonado MPH, Raul O. Ramon MS, Miriam Velázquez MS, Angel M. Mayor MD, Robert F. Hunter-
Mellado, MD
Wilson R. Veras T. MD, Gary W. Elhert MD
Clinical Studies Support A Role For Trem-Like
Transcript-1 During The Progression Of Sepsis
Limaris Russe Gomez MD, Robert Hunter Mellado MD
Jaime Rodríguez Santiago MD, Jennifer Oppenheimer Catalá MD, José Ramírez Rivera MD
Wilfredo Eddy Bravo-Llerena MD,
Rodrigo J. Valderrabano-Wagner MD, Juan Quevedo-
Quevedo MD, Luis M. Reyes-Ortiz MD
Lourdes Benitez MD, Salvador Vila MD, Robert Hunter Mellado MD
Juan M. Quevedo Quevedo MD, Rodrigo Valderrabano Wagner MD, Wilfredo Bravo Llerena MD, Melba Colón Quintana MD, José Ramírez Rivera MD
86
Semblanza del Dr. Rafael Fernandez Feliberti
88
CEM Credits / Questions
Wanda I. Figueroa Cosme MD, Christine Miranda MPHE, 90
Diana M. Fernandez EdD, Johanna Maysonet BSHE, Raul O. Ramon MS
Review Articles / Articulos de Reseña
59
CEM Credits / Answers
Catalogado en Cumulative Index e Index Medicus
Listed in Cumulative Index and Index Medicus No. ISSN-0004-4849
Registrado en Latindex -Sistema Regional de Información en Línea para
Revistas Científicas de América Latina, el Caribe, España y Portugal
BOLETÍN - Asociación Médica de Puerto Rico
Ave. Fernández Juncos Núm. 1305
P.O.Box 9387 - SANTURCE, Puerto Rico 00908-9387
Tel.: (787) 721-6969 - Fax: (787) 724-5208
e-mail:[email protected]
Web site: www.asociacionmedicapr.org
Web site para el paciente: www.saludampr.org
Portada:
Dr. Rafael Fernández Feliberti y fachada del edificio de la Asociación
Médica de Puerto Rico
Omar Esponda MD, Jessica Morales BS, Alexandra
Aguilar, Michael Gomez, A. Valance Washington PhD
Diseño Gráfico e Ilustración digital de cubierta realizados por Juan Carlos Laborde en el Departamento de Informática de la AMPR
E-mail: [email protected]
JUNTA DE DIRECTORES
Dr. Rolance G. Chavier Roper
Presidente
Dra. Wanda G. Velez Andujar
Presidente Distrito Sur
Presidente Consejo de Educación Médica
Dr. Raúl G. Castellanos Bran
Presidente Electo
Dr. Eduardo Rodríguez Vázquez
Presidente Saliente
Dr. José C. Román de Jesus
Presidente Consejo Ético Judicial
Dr. Pedro Zayas Santos
Secretario
Dra. Hilda Rivera Tubéns
Presidente Consejo Relaciones y Servicios Públicos
Dr. José R. Villamil Rodríguez
Tesorero
Dr. Salvador Torros Romeu
Presidente Consejo Servicios Médicos
Dra. Hilda Ocasio Maldonado
Vicepresidente
Dr. Jaime M. Diaz Hernandez
Presidente Consejo Salud Pública y Bienestar Social
Dr. Natalio Izquierdo Encarnación
Vicepresidente
Dr. Raúl A. Yordán Rivera
Vicepresidente
Dr. Arturo Arché Matta
Presidente Cámara Delegados
Dr.a. Ilsa Figueroa
Presidente Consejo Política Pública y Legislación
Dr. Eugenio R. Barbosa del Valle
Presidente Comité de Planes Prepagados y Seguros Médicos
Dr. Héctor L. Cáceres Delgado
Presidente Comité Afiliación y Credenciales
Dr. Juan Rodríguez del Valle
Vicepresidente Cámara de Delegados
Dr. Ney Modesti Tañon
Presidente Comité Ad-hoc de Compañerismo
Dr. Gonzalo González Liboy
Delegado AMA
Dr. José A. Rodríguez Ruiz
Presidente Comité de Historia, Cultura y Religión
Dr. Rafael Fernández Feliberti
Delegado Alterno AMA
Presidente del Comité Asesor del Presidente
Dr. Luis A. Román Irizarry
Presidente Comité Médico Impedido
Dr. Benigno López López
Presidente Distrito Este
Dra. Luisa Marrero Santiago
Presidente Comité de Seguros
Dr. Ángel E. Michel Terrero
Presidente Distrito Sur
Dr. José I. Gerena Díaz
Presidente Comité Ad-hoc Clínicas Multifásicas
Dra. Mildred R. Arché Matta
Presidente Distrito Central
Dr. Félix N. Cotto González
Presidente Comité Ad-hoc de Reclutamiento y
Servicios al Médico Joven
JUNTA EDITORA
Humberto Lugo Vicente, MD
Presidente
Luis Izquierdo Mora, MD
Juan Aranda Ramírez, MD
Melvin Bonilla Félix, MD
Francisco J. Muñiz Vázquez, MD
Carlos González Oppenheimer, MD
Walter Frontera, MD
Eduardo Santiago Delpin, MD
Mario. R. García Palmieri, MD
Francisco Joglar Pesquera, MD
Natalio Izquierdo Encarnación, MD
Yocasta Brugal, MD
José Ginel Rodríguez, MD
President Message/Mensaje del Presidente
Dr. Rolance G. Chavier Roper
Presidente de la Asociación Médica de Puerto Rico
Distinguidos colegas:
E
s para mi un honor presentar el tercer número del corriente año de nuestra revista científica
Boletín. En esta ocasión, el contenido de los artículos
científicos es producto del esfuerzo de la facultad de
la Escuela de Medicina Universidad Central del Caribe con la colaboración de algunos de sus estudiantes.
Nos llena de esperanzas el ver la dedicación con la
que futuras generaciones de médicos, se esfuerzan
por lograr la excelencia en su entrenamiento. La calidad de los artículos que van a leer, habla por sí sola.
La educación médica es cada vez más importante y debemos destacar que nuestra pequeña isla
de 100 x 35 millas cuenta con cuatro (4) escuelas de
medicina acreditadas por el Comité de Enlace de Educación Médica (LCME, por sus siglas en inglés). Debemos sentirnos orgullosos de este logro, ya que hay
otras jurisdicciones donde apenas hay una. Ante esta
situación, es importante que organizaciones como la
Asociación Médica de Puerto Rico sigan apoyando la
educación médica a todos los niveles. Mediante esta
publicación, cooperamos con las universidades y programas postgraduados ofreciendo un importante foro
para la divulgación de resultados de investigaciones
clínicas, que son tan necesarias para mantener las
acreditaciones de los talleres académicos.
La Asociación Médica de Puerto Rico, además,
realiza múltiples actividades que apoyan la formación
de nuevos galenos. Este año 2010, hemos celebrado
cuatro (4) grandes clínicas multifásicas de salud. Los
municipios de Moca, Añasco, Adjuntas y Jayuya, han
recibido el servicio gratuito de docenas de miembros
de nuestra Asociación Médica, que han provisto servicio a mas de 3,500 pacientes. En estas actividades,
hemos sido apoyados especialmente por estudiantes
de la Escuela de Medicina San Juan Bautista, quienes
han estado presentes demostrando lo que es verdadera vocación de servicio.
Aprovechando que este numero está tan relacionado a la educación médica, hemos querido dedicarlo a un medico excepcional, que ha sido un pasado
presidente de nuestra institución y a su vez, ha estado
ligado a la capacitación de médicos, específicamente
en el área de ortopedia. Se trata del Dr. Rafael Fernández Feliberti, ícono del profesionalismo y la seriedad
a la que debe aspirar todo médico. El Dr. Fernández,
quien fue director de ortopedia y del programa de residencia en ortopedia de la Universidad de Puerto Rico
recinto de ciencias médicas, por más de treinta anos,
se mantiene activo aportando a esta institución y forjando el futuro de nuestra profesión. Más adelante,
podrán disfrutar de una breve semblanza de nuestro
amigo y mentor.
Finalmente, hago un llamado a todos los lectores a que activen su membresía en nuestra institución.
Hoy en día, es más importante que nunca pertenecer
a una organización que está tan activa y cubre tantos
flancos a la vez como la nuestra.
En educación médica, servicio público y a la
comunidad, servicio a su membresía, publicaciones,
medios de comunicación electrónica, defensa de los
médicos en “issues de importancia” y tecnología, estamos a la vanguardia.
Pronto, estaremos ampliando nuestros servicios y ofreciendo una excelente alternativa a la hora
de entrar al mundo de “record” medico electrónico.
Nuestro norte será la credibilidad, la calidad del producto y servicio y el costo efectividad...
3
Editorial Article/Articulo Editorial
UNIVERSIDAD CENTRAL DEL CARIBE
APARTADO 60327
BAYAMON, P.R. 00960-6032
José Ginel Rodríguez, MD, FAAP
Presidente y Decano de Medicina
Universidad Central del Caribe
L
a publicación en el Boletín de la Asociación Médica de Puerto Rico de varios proyectos
de investigación realizados en la Escuela de Medicina de la Universidad Central del Caribe (UCC)
nos llena de mucho orgullo y esperanza.
La Escuela de Medicina de la UCC es una institución sin fines de lucro fundada en el 1976. Al presente se encuentra acreditada por el LCME. Esta
institución desde sus comienzos ha demostrado
su compromiso con la investigación. La labor investigativa de nuestros científicos ha sido reconocida en y fuera de Puerto Rico por su dedicación y
por sus iniciativas en temas que resultan en beneficio de la salud de los pacientes en Puerto Rico y
los Estados Unidos. Un gran número de nuestros
investigadores han recibido fondos de instituciones nacionales como National Institute of Health,
mejor conocido como el NIH.
académico, nuestros logros son significativos.
Los logros se demuestran con publicaciones propuestas logradas y nuevos RO1, como por ejemplo el grant del Dr. Serguei Skatchkov en el área
de Neurociencias. Este es nuestro segundo RO1
y nos llena de mucha esperanza por los cuatro
(4) proyectos pilotos en el área de enfermedades
degenerativas. Estos proyectos fortalecerán la
agenda de investigación del RO1 de la Dra. María
Bykovskaia, facultad del Departamento de Neurociencias, el nuevo doctorado en Biología Celular
Molecular así como el Doctorado en Neurociencias el cual próximamente será parte de nuestra
oferta académica y de investigación.
En estos momentos presido esta universidad y es de mucho orgullo compartir con Puerto
Rico y el mundo esta publicación que representa
el entusiasmo y el esfuerzo de la buena investigación que se logra uniendo las capacidades
Los artículos seleccionados para este bole- de la facultad, directores y estudiantes. La UCC
tín de la Asociación Médica asignado a la Escuela comparte con ustedes los artículos que cuidadode Medicina de la UCC demuestra la productividad samente han sido seleccionados. Los temas de
de la investigación en nuestro quehacer científico. éstos son amplios y representan la diversidad de
La diversidad de la investigación en la UCC y el temas, así como los planteamientos científicos infuturo de la misma es prometedora. La realidad novadores que confiamos redunden en la salud
es que a pesar del clima de la investigación, los del paciente y el bienestar de poblaciones que así
factores internos y externos que inciden la agen- lo necesitan.
da de invetigación de cualquier centro médico,
4
Original Articles/Articulos originales
Membrane Potential And Ph-Dependent
Accumulation Of Decynium-22
(1,1’-Diethyl-2,2’-Cyanine Iodide)
Flourencence Through Oct Transporters
In Astrocytes
Mikhail Inyushin1
Yuri Kucheryaykh2
Lilia Kucheryavykh2
Priscilla Sanabria1
Carlos Jiménez-Rivera3
Irina Struganova4
Misty Eaton2
Serguei Skatchkov1,2,
From the Departments of Physiology1 and Biochemistry2,
Universidad Central del Caribe, School of Medicine, Bayamón, PR; Department of Physiology3, University of Puerto
Rico, Medical Sciences Campus, San Juan, PR and Department of Physical Sciences4, Barry University, Miami,
FL.
Address reprints requests to: Serguei Skatchkov, PhD, Department of Physiology and Department of Biochemistry,
Universidad Central del Caribe, School of Medicine, P.O.
Box 60327, Bayamón PR 00960-6032. E-mail: sergueis50@
yahoo.com
INTRODUCTION
Monoamines play important roles in several disorders such as Parkinson’s disease, Alzheimer’s disease and drug addiction. There are several families
of monoamine transporters in the CNS: (i) transporters
with high affinity but low capacity (like DAT, NET) and
(ii) transporters with low affinity but high capacity (like
organic cation transporters; OCTs) (1-3). Non-neuronal
uptake through OCTs was found in glia and glial cells
outnumber neurons about ten times in the brain. This
suggests a prominent role of glial cells in the regulation
of extracellular monoamines.
The members of the organic cation transporter (OCT) family can move endogenous monoamines
across cell membranes (4, 5). 1,1'-Diethyl-2,2'-cyanine
iodide (decynium22) is an organic cation widely used
as a blocker for OCT transporters since it has a very
high affinity for all members of this family in both human and rat cells (6, 7). Importantly, it has little effect
ABSTRACT
1,1'-Diethyl-2,2'-cyanine iodide (decynium22; D22)
is a potent blocker of the organic cation family of
transporters (EMT/OCT) known to move endogenous monoamines like dopamine and norepinephrine across cell membranes. Decynium22 is a
cation with a relatively high affinity for all members
of the OCT family in both human and rat cells. The
mechanism through which decynium22 blocks
OCT transporters are poorly understood. We tested the hypothesis that denynium22 may compete
with monoamines utilizing OCT to permeate the
cells. Using the ability of D22 to aggregate and
produce fluorescence at 570 nm, we measured
D22 uptake in cultured astrocytes. The rate of D22
uptake was strongly depressed by acid pH and
by elevated external K+. The rate of uptake was
similar to that displayed by 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP+), a well established substrate for OCT and high-affinity Na+dependent monoamine transporters. These data
were supported by measurement of electrogenic
uptake using whole cell voltage clamp recording.
Decynium22 depressed norepinephrine, but not
glutamate uptake. These data are also consistent
with the described OCT transporter characteristics. Taken together, our results suggest that decynium22 accumulation might be a useful instrument
to study monoamine transport in the brain, and
particularly in astrocytes, where they may play a
prominent role in monoamine uptake during brain
dysfunction related to monoamines (like Parkinson
disease) and drug addiction.
Index Words: astrocytes, OCT transporter, decynium22, ASP+, fluorescence
on high affinity monoamine transporters such as the
dopamine transporter (DAT) and norepinephrine transporter (NET) (6, 8). This makes decynium22 an important tool to distinguish between the transporter families. This substance has been shown to block uptake
of 1-Methyl-4-phenylpyridinium (MPP), a prototypical
substrate for specific non-neuronal transporter system
(uptake 2) mediated by the OCT3 transporter in cultured rat astrocytes (9).
5
The mechanisms through which the quinoline
derivatives, decynium22 and quinine, block the OCT
are poorly understood. It has been shown that quinine
is a competitive blocker for the rat OCT2 transporter
from the cytoplasmic side (10), but the same authors
have found that quinine is a noncompetitive blocker for
the rat OCT1/OCT2 transporter from the extracellular
side (11). This prompted the question of whether quinoline derivatives can enter the cell. Arndt et al., (11)
measured radiolabeled-quinine uptake in Xenopus oocytes and established that it does go inside the cell,
but found no corresponding substrate-coupled current.
As the OCT transport is known to be electrogenic, they
proposed that the quinine molecule can be transported
into the cell in an uncharged form by simple diffusion.
The same paper claims that decynium22 also is a noncompetitive blocker for OCT transporters from outside of the cell, but Schömig et al., (8), the group who
first introduced decynium22 as potent blocker of OCT
family transporters, established that decynium22 is a
competitive blocker. The possibility that decynium22
may be captured by the cells has not been evaluated.
The fluorescence of this dye in monomeric form
is practically absent, however it forms molecular aggregates (J-aggregates) characterized by very strong
superradiant emission with a maximum near 570-580
nm. (12-14). Therefore, if decynium22 is captured by
the cells it may form J-aggregates that can be measured as fluorescence in astrocytes. Thus, we tested the
hypothesis that decynium22 may compete with monoamines using OCT and permeate glial cells. We found
that, indeed, incubation with decynium22 caused a
time dependent increase of fluorescence in astrocytes.
Pharmacological characterization of decynium22 uptake in astrocytes suggested that uptake was through
OCT transporters. Preliminary data were reported in
abstract form (15).
METHODS
Materials Used: 1,1’-Diethyl-2,2’-cyanine iodide
(decyinium22); 4-(4-(dimethylamino)-styryl)-N-methylpyridinium (ASP+) and all other substances used were
purchased from Sigma Chemical Co. (St. Louis, MO).
Astrocyte primary cultures: Primary cultures
of astrocytes were prepared from the neocortex of 1-2
day old rats. Brains were removed after decapitation
and the meninges stripped away to minimize fibroblast
contamination. The forebrain cortices were collected
and dissociated using the stomacher blender method.
The cell suspension was then allowed to filter by gravity only through a #60 sieve and then through a #100
sieve. After centrifugation, the cells were suspended
in modified Eagle’s medium (containing 30 mM glucose, 2 mM glutamine, 1 mM pyruvate and 10% fetal
bovine serum, 100 units/ml of penicillin/streptomycin)
and plated on uncoated 75 cm2 flasks at a density of
100,000 cells/cm2. The medium was exchanged with
fresh culture medium about every 5 days. At confluence (about 12-14 days), the mixed glial cultures were
treated with 50 mM leucine methylester (pH 7.4) for
60 min to effectively kill microglia. Cultures were then
allowed to recover for at least one day in growth medium
6
prior to reseeding. Astrocytes were dissociated by trypsinization and reseeded onto coverglasses at least two
days prior to the imaging experiments. The purity of
the astrocyte cultures was greater than 95% as assessed by immunocytochemical staining for glial fibrillary
acidic protein (GFAP; data not shown). The “Principles
of laboratory animal care” (NIH publication No. 85-23,
revised 1985) were followed.
Microscopy and image analysis: On the day
of the experiment, a coverglass with astrocytes was
mounted in a closed imaging chamber (Warner Inst,
UT). After the chamber was connected to the perfusion system, cells were immediately mounted on an
Olympus 1X70 microscope with Lambda DG4 computer-driven excitation system, and the microscope was
focused on the center of the monolayer of cells. During
the measurement, cells remained in a closed chamber
and could be perfused with experimental solutions. The
external buffer was composed of (in mM): 145 NaCl, 2
KCl, 2.5 CaCl2, 2.5 MgCl2, 10 HEPES(Na), pH 7.4. In
some experiments, KCl was substituted by NaCl, the
appropriate monoamine substrates and inhibitors were
added or the pH was adjusted to 6.4 or 8.4.
Background autofluorescence was established
by collecting images prior to the addition of 1mM decynium22 or 2mM of ASP+. Time-series fluorescent images were recorded using a 40x oil immersion objective.
The excitation was 480/30x nm; the emitted light was
filtered with a 495- to 575-nm band pass filter (mean
535 nm). The gain (contrast) and offset (brightness) for
the DCC camera tube was set to avoid detector saturation at the concentration used in these experiments (1
µM of decynium22 and 2mM of ASP+). The acquisition
rate was 1 frame every 10 sec to prevent photobleaching of decynium22 and ASP+ sequestered inside the
cell, with exposure of 100 or 200 msec.
The fluorescent images were processed using
MetaMorph imaging software (Universal Imaging Corp.,
Downington, PA). Fluorescence accumulation was established by measuring the average pixel intensity of
fluorescent images of a cell identified from the differential interference contrast (DIC) image. Decynium22
or ASP+ accumulation were defined as the fluorescence of the cells minus background fluorescence by
automatic background subtraction (standard feature of
MetaMorph). In the current experiments, background
fluorescence was negligible.
Whole cell recordings.
Membrane currents
were measured with the single electrode whole-cell
patch-clamp technique. Cells were visualized using a
Nikon 300 inverted microscope (Nikon, Japan). Two
Narishige hydraulic micromanipulators (Narishige,
MMW-203, Japan) were used for (1) voltage-clamp recording, and (2) positioning a micropipette with 30 - 50
µm tip diameter for application of test solutions. A five
valve system for fast drug application (MS Concentration Clamp; VS-2001, Vibraspec, PA), controlled by a
second computer, was connected to the outlets.
Electrodes from hard glass (GC-150-10 glass
tubing, Clark Electromedical Instruments, England)
were pulled in four steps using a Sutter P-97 puller
(Novato, CA). After filling with intracellular solution
(ICS) containing (in mM): KCl 141, MgCl2 1, CaCl2 1,
EGTA 10, HEPES 10, Na2ATP 3, pH adjusted to 7.2
with NaOH/HCl, they had resistances of 4-6 MW; after cell penetration, the access resistance was 10-15
MW, compensated by at least 75%. The extracellular
solution (ECS) contained (in mM): NaCl 138, CaCl2 2,
MgCl2 1.9, and HEPES 10. High frequencies (>1 kHz)
were cut off, using an Axopatch-200B amplifier and a
CV-203BU headstage, and digitized at 5 kHz through
a DigiData 1200A interface (Axon Instruments, USA).
The pClamp 7 and 9 (Axon Instrument, USA) software
packages were used for data acquisition and analysis.
Statistics: GraphPad Prism was used to present
and analyze imaging data. Linear regressions and an
unpaired t-test were used to show the difference in the
slope of accumulation. Calculation of correlation coefficients (Pearson r) was used to show similarity between
accumulation of ASP+ and decynium22. Confidence
levels of 0.95 were used in this study.
Figure 1.
RESULTS
Due to the expected low fluorescence yield
(estimated to be 0.001), we did not anticipate substantial fluorescence of decynium22 (16). Initially,
we planned experiments using decynium22 as a
non-fluorescent substance to block accumulation
of
4-(4-(dimethylamino)-styryl)-N-methylpyridinium
(ASP+), a well-established substrate for OCT (17), and
high-affinity Na+-dependent monoamine transporters
(18), inside cultured astrocytes. Surprisingly, we discovered that after being perfused with a solution containing 1mM decynium22, astrocytes accumulated the
fluorescence of decynium22 (Fig. 1a). One possible
way to explain the strong fluorescence of decynium22
can be aggregation of the dye inside the astrocytes.
While the fluorescence of this dye in monomeric form
is very weak, it is known to form molecular aggregates
(J-aggregates) characterized by very strong superradiant emission with a maximum near 570-580 nm (1214). The parameters we used (see Methods) are suitable for the excitation of fluorescence of J-aggregates
of decynium22 as 480 nm falls near a short wavelength
peak of the excitation spectrum of these aggregates
Figure 1. Accumulation
of
1,1'-diethyl-2,2'cyanine iodide
(decynium22 or
D22) in cultured cortical astrocytes during
perfusion with
buffer containing
1 µM of D22.
A
Photocount
B
a. From left to
right: Differential Interference
Contrast (DIC)
image of cultured astrocytes
(40x Oil immersion); fluorescence after 5
min of perfusion
with D22; fluorescence after
15 min of perfusion with D22.
40
30
20
10
0
0
50
100
x 10 sec
150
200
b.
Graph
showing mean
(± S.D.) fluorescence with time
after application
of Decynium22
(1 µM) to cultured cortical astrocytes (n = 14
astrocytes).
7
The accumulation curve of decynium22 can be
divided into three parts: very fast initial growth, then a
linear part and, finally, saturation. In the majority (95%)
of cells, accumulation of 1 µM decynium22 was nearly
linear during at least 15 minutes (i.e., without saturation) (Fig. 1b). The accumulation timescale was different for different astrocytes, some had no accumulation
of decynium22, and some had relatively fast accumulation that leads to the brighter final image of these
cells (Fig. 1a, 15 min of accumulation). Very few cells
showed fast saturation.
In order to determine the influence of membrane potential on decynium22 accumulation, we examined the effect of increased external K+ on decynium22
accumulation using HEPES buffer with Na+ substituted by K+. Increasing external K+ depolarizes the
membrane potential of astrocytes. Application of 1 µM
decynium22 in the following buffer (in mM): 145 KCl,
Photocount
D22
30
wash-out
145 mM
20
2 KCl, 2.5 CaCl2, 2.5 MgCl2, 10 HEPES(Na) significantly reduced decynium22 uptake (p<0.05), thus abolishing the accumulation (Fig. 2a). The slope in normal
buffer was 0.5534 ± 0.02075, and in high K+ buffer it
was 0.008723 ± 0.04400, while after wash-out it became 0.5535 ± 0.03214 (n=16). Note that the slope
in high K+ was about 1/60th of normal. As the ratio of
slopes reflects the speed of accumulation, this means
that the speed of decynium22 accumulation in high K+
was about 60 times lower than in normal conditions.
Previously, we found (data not shown) that
cultured astrocytes can accumulate the well-established fluorescent OCT substrate 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP+; (17)). We found that
ASP+ accumulation was also dependent on external
K+ concentration (Fig. 2b). Therefore, we calculated
the correlation coefficient between the ASP+ and decynium22 accumulation curves in normal external K+ to
determine if they have similar shape. The correlation between both processes was found
significant with the possibility of no similarity
being less then 0.001 (Correlation coefficient
(Pearson r) = 0.9540). This similarity suggests an equivalent mechanism of transport
of these two substances.
10
0
0
25
Photocount
30
50
x 10 sec
75
100
30mM
146mM
20
10
ASP+
0
0
25
50
x 10 sec
75
Figure 2. Effect of high [K+]o on accumulation of ASP+ (a fluorescent analog of MPP) and decynium 22 (D22) in cultured astrocytes.
a. Effects of application of buffer containing different K+ concentrations and containing 1 µM of decynium22 on accumulation of D22 fluorescence in astrocytes (n=16).
b. Effects of application of buffer containing different K+ concentrations and containing 2 µM of ASP+ on accumulation of
ASP+ fluorescence in astrocytes (n=17).
Note: The speed of D22 as well as ASP+ accumulations were
significantly reduced in high K+ concentration and returned to
normal after wash-out.
8
We next determined the pH dependence of decynium22 (Fig. 3a) and ASP+
(Fig. 3b) accumulation inside these cells, by
incubating astrocytes with either 1 µM decynium22 or 2 µM ASP+ in buffers of different
pH (pH = 6.4, 7.4 and 8.4). If decynium22
were being transported into astrocytes in the
same manner as ASP+, we expected that the
rate of accumulation would increase in alkaline pH and decrease in acid pH. The slopes
of accumulation of decynium22 in pH 7.4, 8.4
and 6.4 were 0.07170 ± 0.004729, 0.1952 ±
0.01916 and -0.03220 ± 0.01409 (n=8), respectively (Fig. 3a). Some loss of fluorescence
was seen at pH 6.4 accounting for the negative slope. The slopes were all statistically
different from each other. The accumulation
speed of decynium22 was 2.72 times greater
in pH 8.4 than in pH 7.4.
100
Similarly, the slopes of accumulation
of ASP+ in pH 7.4, 8.4 and 6.4 were 0.08387
± 0.004401, 0.5318 ± 0.03500 and -0.1473
± 0.02123 (n=15), respectively (Fig. 3b). A
comparison of pH influence on ASP+ and decynium22 accumulation in cultured astrocytes
found them to be very similar (Fig. 3a and b).
Correlation of both processes was significant,
with the possibility of their bearing no similarity
being less then 0.001 (Correlation coefficient
(Pearson r) = 0.9319). This similarity as well
suggests an equivalent mechanism of transport of both decynium22 and ASP+.
In support of this, we found that some
astrocytes accumulate ASP+, whereas others
do not and an equivalent distribution of decynium22 accumulation was observed in these
cells (Fig. 4), i.e. cells without uptake of ASP+ also
have no accumulation of decynium22 (Fig. 4 white arrowheads). This is most likely due to a lack of
transporters for ASP+ and decynium22 present in their
membrane. This finding strengthens the idea that
ASP+ and decynium22 are transported into the cell by
the same mechanism. For the purposes of this study,
we first perfused the cells with 2 µM ASP+ containing
buffer, recording its accumulation by astrocyte culture
for 5 min (a time where little to no saturation of fluorescence was observed). We then washed out free ASP+
from the preparation for 1 min with the buffer alone,
and subtracted the background fluorescence image
(this subtraction also subtracted the ASP+ fluorescence accumulated inside the cells). Following that, we
added decynium22 (1µM) and recorded its accumulation for 5 min in the standard manner (Fig. 4).
ASP+
20
pH=6,4
Photocount
Photocount
D22
9
8
7
6
5
4
3
2
1
0
In patch-clamp experiments, we directly applied decynium22 (10µM) to the astrocyte membrane in wholecell voltage-clamp mode with a holding potential of –80
mV. In these conditions, astrocytes generated inward
membrane currents of about 20-30 pA amplitude (Fig.
5a). Generation of the current means decynium22 is
probably a substrate for the transporter. The current
amplitude for the 10µM decynium22 was similar to the
current generated by the application of 250 µM norepinephrine (NE) (Fig. 5b) or 250 µM of prazosine (data
not shown) known substrates of the OCT transporters
(1, 4, 6, 7). To demonstrate an interaction between decyinium22 and norepinephrine, either norepinephrine
(250 µM) or decynium22 (10 µM) were applied 3-6 sec
prior to co-application of these substances. The resulting recordings demonstrated that these substances
interact, producing mutual inhibition.
pH=8,4
pH=7,4
pH 8
pH 7,4
10
pH 6,4
n=8
0
0
25
50
x 10 sec
75
100
0
25
50
x 10 sec
75
100
Figure 3. Effect of pH on accumulation of ASP+ (a fluorescent analog of MPP) and decynium 22 (D22) in
cultured astrocytes.
a. Effects of application of buffer with different pH (pH=7.4; pH=8.4 and pH=6.4, subsequently) containing 1
µM of decynium22 on accumulation of D22 fluorescence in astrocytes (n=8).
b. Effects of application of buffer with different pH (pH=7.4; pH=8.4 and pH=6.4, subsequently) containing 2
µM of ASP+ on accumulation of ASP fluorescence in astrocytes (n=4). Note the striking similarity of pH dependence of accumulation of these dyes which suggests a similar pathway of transport.
Figure 4. ASP+ and Decynium22 accumulation in astrocytes.
Decynium22 (right panel; green cells) was accumulated by the same cells that had previously accumulated
ASP+ (middle panel; red cells). From left to right: 40x oil immersion image of cultured astrocytes in bright field;
accumulation of ASP+ fluorescence in the same astrocytes population (middle panel, red), accumulation of D22
fluorescence (right panel, green). Please note, that cells, that have not accumulated ASP+ also have no accumulation of decynuim22 (D22, and vise versa, cells that accumulate one of these dyes, also accumulated the other
one). Note: that ASP+ and D22 probably share the same transporter pathway.
9
Application of norepinephrine induced inward current
(Fig. 5b1) that was partially blocked by decynium22
application. Similarly, application of decynium22 induced inward current that was partially blocked by NE
(Fig. 5b2). The fact that current amplitude after coapplication is reduced confirmed that these substrates
probably share the same permeation pathway. Conversely, co-application of glutamate (250 µM) and decynium22 (Fig. 5b3) do not show any interaction.
DISCUSSSION
Our imaging experiments show that decynium22
is transported inside cultured astrocytes. This process
was studied by measuring the time-dependent accumulation of decynium22 fluorescence inside the cells. In
its monomeric form decyinium22 is very weakly fluorescent, whereas in aggregation this substance has very
strong superradiant emission with a maximum near 570580 nm (12-14). Recently, it was found that J-aggregation of cyanine dyes can be templated by DNA (19), and
it is possible that some other biological molecules may
also promote aggregation. Therefore, it is possible that
decynium22 can form J-aggregates inside the cells.
Although the pathway for decynium22 entry
into the cell has not been definitively determined, decynium22 competes with monoamines (Fig.5) and is
accumulated similar as ASP+ in the same target cells
(Fig.4). In addition, pharmacological characteristics of
ASP+ and D22 uptakes are identical (Figs. 2,3). Therefore, previously noted that D22 is a potent blocker
Figure 5
of OCT-type transporters could be wrong. Our experiments simply explain that these transporters a likely
pathway for both decynium22 as well as for ASP+ and
probably other bioamines. Decynium22 has a very
high affinity to OCT transporters in a variety of species
(1, 6 21, 22) and OCT transporters have been clearly
detected in astrocytes. By partial sequencing, it was
found that a splice variant for OCT1 identical to the
monoamine Uptake 2 system, with only partial sequence identity to hOCT is present in glioma cells (5). Recently, it was also established that Uptake 2 in cortical
astrocytes is mediated by the OCT3 transporter (9).
The same group of authors has demonstrated by RTPCR that astrocytes express OCT1, OCT2 and OCT3
mRNA (3).
Our data support the idea that decynium22 entry
into astrocytes may be through OCT type transporters.
Our patch clamp experiments have shown that decynium22 transport is electrogenic, as external application of decynium22 elicited the inward ion current
in clamped astrocytes (Fig.5). The current elicited by
decynium22 was antagonized by norepinephrine (NE),
a known substrate for the OCT transporter and vice
versa with decynium22 antagonizing norepinephrineinduced current (Fig.5B1, B2). A reciprocal relationship
between norepinephrine and decynium22 can be explained as competition for the transporter where decynium22 and norepinephrine share the same transporter
pathway. Indeed, D22 is specific and is not competing
with glutamate transport (Fig. 5 B3) where glutamate
elicited current was not antagonized by decynium22
suggesting that decynium22 does not go through the
well characterized glutamate transporter of astrocytes.
OCT transporters have been suggested to be
driven by the external/internal K+ gradient that determines the membrane potential of cells (5, 6, 9 23). Our
results show that decynium22 uptake in cultured astrocytes is reduced in elevated external K+, suggesting
that uptake may be through an OCT type transporter
(Fig. 2). Furthermore, we found that the rate of decynium22 uptake by astrocytes was pH sensitive (Fig. 3)
and increased in alkaline solutions (pH=8.4), while inhibited in acidic pH (6.4). These data are also consistent
with the described OCT transporter characteristics, as
these transporters show significant cis inhibition of uptake when the external pH is reduced (H+ increased)
(21). It is known that decynium22 aggregates better in
alkaline than in acidic solutions, and in strongly acidic solutions the dye does not fluoresce at all (13, 14).
However, in the pH range of the present study (pH 6.4
- 8.4) there is no appreciable difference in aggregation
and fluorescence, therefore, fluorescence accumulation changes in the present study can be attributed
to changes in uptake velocity. Furthermore, these pH
experiments can differentiate between decynium22
uptake through plasma membrane monoamine transporters (PMAT) recently cloned from human brain (24)
that have similar characteristics as OCT transporters
and OCT transporters themselves. PMAT transporters
are greatly stimulated by acid pH (25), whereas OCT
transporters are inhibited (21) as also shows Figure 3.
Recently and finally, it was confirmed that PMAT transporters are not present in astrocytes (26).
10
In summary, in support of decynium22 entering the cell through an OCT transporter, we have
demonstrated significant similarity of decynium22 uptake and 4-(4-(dimethylamino)-styryl)-N-methylpyridinium (ASP+) uptake in astrocytes (Figs. 1-4). ASP+
is a known substrate for OCT-type transporters (17)
because of the chemical similarity of this fluorescent
dye to 1-Methyl-4-phenylpyridinium (MPP) (18). There
was a high correlation (about 0.95) between the accumulation of decynium22 and ASP+ in astrocyte, as
well as very similar effects of pH and K+ ion gradient
on ASP+ and decynium22 uptake. Furthermore, we
have shown that only astrocytes that had previously
accumulated ASP+ then accumulated decynium22.
This suggests that the same transporters are involved in dye accumulation. Decynium22 is transported
into astrocytes in a pH and K+ sensitive manner where it displays a strong fluorescence probably due to
aggregation within the cell. The regulation of uptake
speed, and similarity with ASP+ uptake suggest that
OCT transporters may mediate decynium22 accumulation. Decynium22 fluorescence can be a useful instrument to study monoamine transporters in the brain.
Acknowledgements
The authors wish to thank Ms. Natalia Skachkova and Paola López Pieraldi for their fine technical assistance. This work was supported by
NIH-NINDS and NCRR SNRP-NS39408, NIH-MBRSSO6-GM50695,
NIH-RCMI-G12RR03035,
NIHSNRP-NS39405
and
NIH-MBRS-S06-GM08224.
REFERENCES
1.Gründemann D, Gorboulev V, Gambaryan S, Veyhl M, Koepsell
H (1994) Drug excretion mediated by a new prototype of polyspecific transporter. Nature. 372(6506):549-52.
2. Wu X, Kekuda R, Huang W, Fei Y-J, Leibach F H, Chen J, Conway
S J, Ganapathy V. (1998) Identity of the organic cation transporter
OCT3 as the extraneuronal monoamine transporter (uptake2) and
evidence for the expression of the transporter in the brain. J Biol
Chem. 273:32776–32786.
3.Inazu M, Takeda H, Matsumiya T (2005) Molecular and functional
characterization of an Na+-independent choline transporter in rat
astrocytes. J Neurochem 94: 1427 - 1437.
4. Gründemann D, Liebich G, Kiefer N, Koster S, and Schomig E
(1999) Selective substrates for non-neuronal monoamine transporters. Mol Pharmacol 56: 1 – 10.
5. Busch A E, Karbach U, Miska D, Gorboulev V, Akhoundova A,
Volk C, Arndt P, Ulzheimer J C., Sonders M S., Baumann C, Waldegger S, Lang F, and Koepsell H (1998) Human neurons express
the polyspecific cation transporter hOCT2, which translocates
monoamine neurotransmitters, amantadine, and memantine. Mol
Pharmac 54:342 – 352.
6. Hayer-Zillgen M, Bruss M, Bonisch H (2002) Expression and
pharmacological profile of the human organic cation transporters
hOCT1, hOCT2 and hOCT3. Br J Pharmacol 136: 829 – 836.
7. Gründemann D, Koschker A-C, Haag C, Honold C, Zimmermann
T, Schömig E (2002) Activation of the extraneuronal monoamine
transporter (EMT) from rat expressed in 293 cells, Br J Pharmacol
137: 910 -918.
8. Schömig E, Babin-Ebell J, Russ H (1993) 1,1’-Diethyl-2,2’-cyanine (decynium22) potently inhibits the renal transport of organic
cations. Arch Pharm 347: 379 – 383.
9. Inazu M, Takeda H, Matsumiya T (2003) Expression and functional characterization of the extraneuronal monoamine transporter in
normal human astrocytes. J Neurochem 84: 43 – 52.
10. Budiman T, Bamberg E, Koepsell H, Nagel G (2000) Mechanism of electrogenic cation transport by the cloned organic cation
transporter 2 from rat. J Biol Chem 275: 29413 – 29420.
11. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, UlzheimerTeuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H (2001) Interaction of cations, anions, and weak base quinine
with quinine with rat renal cation transporter rOCT2 compared with
rOCT1. Am J Physiol Renal Physiol 281:454 – 468.
12. Jelley EE (1936) Spectral absorption and fluorescence of dyes
in the molecular state. Nature 138: 1009 – 1010.
13. Stiel H, Daehne S, Teuchner K (1988) J-aggregates of pseudoisocyanine in solution: New data from nonlinear spectroscopy. J
Lumines 39: 351 – 357.
14. Struganova IA (2000) Dynamics of formation of 1,1’-diethyl2,2’-cyanine iodide J-aggregates in solution. J Physical Chem A
104: 9670 – 9674.
15. Inyushin MY, Kucheryavykh YV, Kucheryavykh LY, Struganova IA, Eaton MJ, Skatchkov SN, Jimenez-Rivera CA, Sanabria P
(2006) Membrane potential and pH-dependent accumulation of decynium22 (1,1’-diethyl-2,2’-cyanine iodide) fluorescence in astrocytes. Program No. 489.19. 2006 Neuroscience Meeting Planner.
Atlanta, GA: Society for Neuroscience, 2006. Online.
16. Tredwell CJ, Keary CM (1979) Picosecond time resolved fluorescence lifetimes of the polymethine and related dyes. Chem Phys
43: 307 – 316.
17. Çetinkaya I, Ciarimboli G, Yalçinkaya G, Mehrens T, Velic A,
Hirsch J R., Gorboulev V, Koepsell H, and Schlatter E ( 2003) Regulation of human organic cation transporter hOCT2 by PKA, PI3K,
and calmodulin-dependent kinases. Am J Physiol Renal Physiol
284: F293-F302,
18. Schwartz JW, Blakely RD, DeFelice LJ (2003) Binding and
transport in norepinephrine transporters: real-time, spatially resolved analysis in single cells using a fluorescent substrate. J Biol
Chem 278: 9768 – 9777.
19. Hannah KC, Armitage BA (2004) DNA-templated assembly of
helical cyanine dye aggregates: A supramolecular chain polymerization. Acc Chem Res 37: 845 - 853.
20. Russ H, Sonna J, Keppler K, Baunach S, Schömig E (1993)
Cyanine-related compounds: a novel class of potent inhibitors of
extraneuronal noradrenaline transport. Naunyn Schmiedebergs
Arch Pharmacol 348: 458 – 465.
21. Gründemann D, Babin-Ebell J, Martel F, Ording N, Schmidt A,
Schomig E (1997) Primary structure and functional expression of
the apical organic cation transporter from kidney epithelial LLCPK1 cells. J Biol Chem 272:10408 - 10413.
22. Koepsell H, Gorboulev V, Arndt P (1999) Molecular pharmacology of organic cation transporters in kidney. J Membr Biol 167:
103 - 117.
23. Urakami Y, Okuda M, Masuda S, Saito H, Inui KI. (1998) Functional characteristics and membrane localization of rat multispecific
organic cation transporters, OCT1 and OCT2, mediating tubular
secretion of cationic drugs, J Pharmacol Exp Ther 287(2):800805.
24. Engel K, Zhou M, Wang J (2004) Identification and characterization of a novel monoamine transporter in the human brain. J Biol
Chem 279: 50042 – 50049.
25. Xia L, Engel K, Zhou M, Wang J (2007) Membrane localization and pH-dependent transport of a newly cloned organic cation
transporter (PMAT) in kidney cells. Am J Physiol Renal Physiol
292:F362-F690.
26. Dahlin A, Xia L, Kong W, Hevner R, Wang J (2007) Expression and immunolocalization of the plasma membrane monoamine
transporter in the brain., Neuroscience, 146(3):1193-211.
11
RESUMEN
1,1'-Diethyl-2,2'-cyanine
iodide
(decynium22; D22) es un potente bloqueador de los
transportadores de la familia de “transportadores
de los cationes orgánicos” (EMT/OCT), conocidos
por su movimiento de las monoaminas endógenas, como la dopamina y la norepinephrina, atraves de la membrana celular. Decynium22 es un
catión con relativamente alta afinidad para todos
los miembros de la familia OCT en células de origen humano al igual que en células de ratas. Se
conoce poco sobre el mecanismo por el cual decynium22 bloquea los transportadores OCT. Nosotros verificamos la hipótesis de que denynium22
puede competir con monoaminas utilizando OCT
para entrar a la célula. Aprovechando la habilidad
del D22 de agregarse y producir la fluorescencia
de 570 nm, nosotros medimos la captura de D22
en los astrocitos cultivados. La velocidad de captura del D22 fue profundamente reducida por el
pH acídico, y por elevación de potasio externo.
La velocidad de captura fue semejante a la velocidad de la captura de 4-(4-(dimethylamino)-styryl)N-methylpyridinium (ASP+), un substrato conocido
de los OCT y también de los transportadores de las
monoaminas dependientes de sodio. Estos datos
fueron confirmados por la medición de la corriente
generada por la captura electro génica usando el
método de “voltage clamp” en el modo de “célula
completa”. Decynium22 actúa reduciendo la captura de la norepinephrina, pero no del glutamato.
Todos estos datos están de acuerdo con las características de los transportadores de familia OCT.
Nuestros resultados sugieren que la acumulación
del decynium22 puede ser un instrumento importante para estudiar el transporte de monoaminas en
el cerebro, y en los astrocitos en particular, donde
este tipo de transportadores pueden jugar un papel
importante durante la adicción a drogas y también
durante alteraciones de monoaminas en el cerebro,
como Parkinsonismo.
The concept of Kendo
is to discipline the human
character through
the application of
the principles of the Budo
The purpose of Kendo is:
To mold the mind and body,
To cultivate a vigorous spirit,
And through correct
and rigid training,
To strive for improvement
in the art of Kendo;
To hold in esteem human
courtesy and honor,
To associate with others
with sincerity,
And to forever pursue
the cultivation of oneself.
ABSTRACT
This is a continuation of our efforts to maintain a
record of the evolution of HIV-1 infection in Puerto
Rico by monitoring the expression levels of antiretroviral resistance-associated mutations. Samples
from 2005 were analyzed (458: 270 males, 137 females, 51 anonymous), using the TRUGENE HIV-1
Genotyping Kit and the OpenGene DNA Sequencing System. Results show that 60.1% of males
and 50.2% of females had HIV-1 with resistance
to at least one medication. The average number of
HIV mutations in males was 6.27, while the average number of HIV mutations in females was 5.49.
The highest levels of resistance were to Zalcitabine, Lamivudine, and Stavudine. The reverse transcriptase mutations with the highest frequency of expression were M184V, K103N and D67N. Protease
mutations with the highest rate of expression were
L63P, M36I and L90M. Significant differences between men and women were recorded in the levels
of HIV-1 expressed mutations and resistance.
Index words: prevalence, drugs, resistance, mutations, population, Puerto Rico, HIV
INTRODUCTION
T
he HIV infection in Puerto Rico is charac
terized by patients with a medium age of 35, mostly
Hispanic (98.8%) males (77.7%) and differs from the
characteristics of other countries, including the USA,
because the major risk of infection in Puerto Rico is
drug abuse (54.3%) (1, 2). Puerto Rico has one of the
highest incidences of HIV-1/AIDS cases per 100,000
population in the USA. For 2005 the number of persons
living with AIDS was 10,685 with 29,092 cumulative cases, 42% related to drug use, and a per capita rate of
26.4/100,000 population (3) while for 2007 the numbers had increase to 11,503 living with AIDS, 36,736
cumulative cases, 40% related to drug use, with a per
capita rate of 21.5/100,000 (4).
The number of deaths attributed to HIV has noticeably decreased in regions of the world that have full
access to antiretroviral drugs (5). Currently, HIV therapy typically includes a combination of reverse transcriptase (RT) inhibitors, protease inhibitors (PI), integrase
inhibitors, and fusion or entry inhibitors that inhibit HIV
at different stages of the viral life cycle (6). However,
there is concern about the development and transmission of drug-resistant HIV strains since the combined
genetic diversity of the virus and the high resistance
mutation rate produce numerous resistant strains (7)
that affect treatment efficiency leading to virologic failure and increased mortality (8). Therapy for persons
infected with multidrug-resistant HIV can be complicated and create difficult patient management issues for
clinicians (9). Furthermore, HIV-infected persons with
resistant strains continue HIV risk behaviors and transmit resistant strains to newly infected persons (10).
Prevalence Of Drug
Resistance And
Associated
Mutations In
A Population Of
Hiv-1+ Puerto
Ricans In 2005
Luis A. Cubano PhD1
Luz Cumba,2
Lycely del C. Sepúlveda-Torres,2
Nawal Boukli,1
Eddy Ríos-Olivares 1
From the 1Department of Microbiology and Immunology,
Universidad Central del Caribe, Bayamón, PR, and 2School
of Science and Technology, Universidad Metropolitana, San
Juan, PR.
Address reprints requests to: Luis Angel Cubano, PhD - Universidad Central del Caribe, P.O. Box 60327, Bayamón, PR
00960-6032.Email: [email protected]
HIV-genome sequence data has been collected and
analyzed in Puerto Rico since 2000 for the RT and the
protease genes (11, 12). The activity of HIV-1 RT is
essential for viral replication and is specifically required
for the conversion of single-stranded viral RNA into double-stranded viral DNA, which is later integrated into
the host genomic DNA. For this reason, HIV-1 RT inhibitors are powerful inhibitors of HIV-1 replication and
represent an important class of antiretroviral agents.
The HIV-1 protease cleaves viral Gag and Gag-Pol
polyproteins into structure and replication proteins that
are necessary for the virus to become infectious and
therefore, PI inhibitors are important for HIV therapy. In
this study, we determined the prevalence of resistant
genotypic mutations in a population of HIV-1+ Puerto
Ricans tested for HIV-1 infection in 2005 and analyzed gender differences in mutation expression profiles
to the two aforementioned genes. The highest mutation frequencies were M184V for RT inhibitor resistance and L63P for PI resistance. Significant differences
were recorded for various viral mutations and drug resistance between men and women.
MATERIALS AND METHODS
Samples
HIV-1 genotyping results (458: 270 males, 137
females, 51 anonymous) for 2005 from the Immunoretrovirus Research Laboratory located at the Universidad Central del Caribe in Bayamón, Puerto Rico were
analyzed. The sex of the patients was the only demographic data known. Patient clinical data were unknown.
13
RNA Isolation
HIV-1 viral RNA was extracted using the QIAGEN QIAamp Viral RNA Mini Kit (QIAGEN, Valencia
CA). Briefly, serum (140 µl) was added to buffer AVL
containing Carrier RNA in a microcentrifuge tube. Following incubation at room temperature for 10 min, 560
µl of ethanol was added and mixed. An aliquot of 630
µl was added to the QIAamp spin column and centrifuged at 8,000 rpm for 1 min (2x). The QIAamp spin
column was placed into a clean 2-ml collection tube.
Then, 500 µl of Buffer AW1 was added and centrifuged
at 8,000 rpm for 1 min, followed by 500 µl of Buffer
AW2 and centrifuged at 14,000 rpm for 3 min. The
QIAamp spin column was placed in a clean 1.5-ml microcentrifuge tube and 60 µl of Buffer AVE was added.
The tube was incubated at room temperature for 1 min
and centrifuged 8,000 rpm for 1 min. Viral RNA was
stored at -80°C.
significant difference in resistance between males
and females to Atazanavir (P=0.0103), Nelfinavir
(P=0.0103), Saquinavir (P=0.0427), and Lopinavir +
Ritonavir (P= 0.0103).
RT resistance-associated mutations
Table II. compares the levels of RT resistanceassociated specific mutations. Analysis of RT mutations for 2005 demonstrated that the highest degree of
expression was for M184V (41.3%), K103N (25.3%),
and D67N (20.5%). For women, P225H was among
the top ten mutations (6.6%) while in males its expression was 1.9%. Significant differences between men
and women for the expression of K103N (P=0.0456)
and P225H (P=0.006) were recorded. Of interest is to
note that all the aforementioned mutations have been
recognized as major mutations associated with resistance to RT inhibitors (7).
Mutational Analysis
PI resistance-associated mutations
Whole blood from HIV-1 infected patients was
collected in tubes containing ethylenediaminetetraacetic acid (EDTA) as anticoagulant. Plasma was separated and stored at -80°C until isolation of RNA,
which was followed by analysis using the TruGene HIV1 Genotyping Kit and the OpenGene DNA Sequencing
System (Bayer Diagnostics, Tarrytown, NY).
As shown in Table III, the PI resistance-associated specific mutations with the highest degree of expression for 2005 were L63P (73.6%), M36I (26.2%),
and L90M (21.0%). For women, N88D was among the
top ten mutations (11.7%) while in males its expression
was 9.3%. There was a significant difference between
men and woman for L90M (P= 0.0337) and M46I (P=
0.0424), two major mutations associated with resistance to PI inhibitors (7).
Statistical Analysis
InStat 3 for Macintosh (GraphPad Software,
Inc, La Jolla, CA) was used to perform the analysis.
Chi-square test was performed. Statistical significance
was set at P≤ 0.05.
RESULTS
General gender distribution of resistant mutations
to antiretrovirals
The aim of this study was to assess the prevalence of genetic changes in either the HIV RT or protease genes in a cohort of patients from Puerto Rico.
Serum samples from HIV patients from 2005 collected
by the Immunoretrovirus Research Laboratory at UCC
were analyzed using TruGene HIV-1 Genotyping Kit,
an integrated system that includes target gene amplification and DNA sequencing chemistry that was developed for the detection of mutations in the HIV-1 protease and reverse transcriptase sequences. From a
sample size of 458 patients, 60.1% of males and 50.2%
of females had resistance to at least one medication.
The average number of mutations in males was 6.27
while the average number of mutations in females was
slightly less (5.49).
Levels of resistance to antiretrovirals as determined by TrueGene HIV-1 genotyping
As shown in Table I., the 2005 patients showed
the highest levels of HIV-1 resistance to the following antiretrovirals: Zalcitabine (50.9%), Lamivudine (44.5%),
and Stavudine (39.1%). In addition, there was a
14
Table I. HIV-1 Resistance for antiretrovirals as
determine by TrueGene
Numbers indicate the percentage of resistance against
antiretrovirals expressed by HIV-1 as determined by the
TrueGene system. * indicates a significant difference
between men and women.
% of resistance
Antiretroviral Drug Men Women
Total
Zalcitabine
Lamivudine
Stavudine
Abacavir
Atazanavir *
Nelfinavir *
Nevirapine
Efavirenz
Zidovudine
Delavirdine
Indinavir
Ritonavir
Saquinavir *
Tenofovir
Didanosine
Amprenavir
Lopinavir + Ritonavir *
50.9
44.5
39.1
38.6
38.6
38.0
37.8
37.8
37.3
35.8
31.7
31.7
29.3
26.4
26.2
26.0
23.8
54.6
47.6
42.1
42.4
42.1
44.6
35.4
35.4
40.2
33.2
36.5
36.5
34.7
29.2
28.0
30.3
29.2
50.7
44.9
38.2
36.8
38.2
30.9
40.4
40.4
37.5
38.2
28.7
28.7
24.3
25.7
25.7
22.1
16.9
Table II. Most Prevalent HIV-1 RT Resistant Mutations
Numbers express the percentage of expression of the
most prevalent mutations as determined by the TrueGene system. * indicates a significant difference between
men and women.
% of expression
Mutation Men Women Total
M184V
K103N *
D67N
M41L
V118I
T215Y
K70R
L210W
K219Q
L100I
43.7
21.1
21.9
22.2
18.1
16.3
15.6
13.3
12.6
8.1
41.3
25.3
20.5
20.3
16.6
15.9
15.5
12.9
11.6
7.4
41.6
30.7
20.4
19.0
14.6
17.5
16.8
13.9
12.4
5.8
Table III. Most Prevalent HIV-1 PI Resistant
Mutations
Numbers express the percentage of expression of the
most prevalent mutations as determined by the TrueGene system. * indicates significant difference between men and women.
% of expression
Mutation Men Women
L63P
M36I
L90M *
L10I
A71V
M46I *
A71T
I54V
V82A
D30N
75.9
25.9
25.9
22.6
23.0
18.5
12.6
14.4
12.2
10.7
70.1
24.8
16.1
20.4
16.1
10.2
12.4
8.0
10.2
10.2
Total
73.6
26.2
21.0
20.5
19.4
14.6
12.0
11.4
10.7
10.3
DISCUSSION
This study is an effort to establish a HIV-1 resistance-monitoring system in Puerto Rico and a continuation of reports published in 2002 and 2008 that
examined the prevalence of HIV-1 resistant mutations
in the island from 2000 to 2004 (11, 12). Statistically
significant differences were observed in mutation incidence and resistance between genders. In the case of
the protease mutations, a statistically significant difference for L90M has been noticed since 2003 and the
statistically significant difference observed for M46I in
2003 reappeared in 2005. K103N was the only statistically significant mutation in the RT gene obtained in the
2005 data. The statistical significance for Saquinavir
noticed in 2004 remained in 2005 while the statistically
significant difference for Nelfinavir noticed in 2003 reappeared in 2005. On the other hand, new statistically
significance differences were observed for Atazanavir
and Lopinavir + Ritonavir. These differences, although
outside of the scope of the current study, deserve further attention. Their implications may be more evident
once subsequent annual data are added to the analyses.
Although deaths of persons with HIV/AIDS reported to the national HIV/AIDS surveillance system
and U.S. Vital Statistics have followed similar patterns
across most demographic and behavioral strata, including gender, age, geographic distribution, and race/
ethnicity; substantial variation exists in the percentages of decline among different subgroups (13). Even
though no racial/ethnic or gender disparities have been
observed in antiretroval (ARV) therapy receipt, minority racial/ethnic groups were faster to discontinue ARV
therapy and experience virologic failure (14). Therefore, more research targeted towards the understanding
of HIV/AIDS prevalence in women and minority groups
is needed to detect emerging incidence trajectories in
these groups and to determine how HIV infection as a
chronic disease affects these individuals and their communities. In the particular case of the race/ethnicity vs.
drug-resistance correlation, studies reporting HIV drugresistance rates between races are contradictory since
race is accounted for differences in some publications
(10) while others noticed no differences attributable to
race (15). In the case of ARV therapy tolerance, race
has been correlated with alterations in metabolic and
anthropometric measures where Latinos experienced
the most unfavorable changes (16). Minorities are also
at higher risks of experiencing specific adverse events
but not in the overall adverse event rates, all-cause
mortality, or rates of toxicity-related treatment discontinuations (17).
Gender differences in ARV treatment outcomes
and drug-resistance mutations are also of interest.
Treatments for HIV-infected women are usually based
on efficacy and tolerability studies conducted in men
since women are typically underrepresented in ARV
treatment clinical trials (18). Pharmacokinetic data suggest similar response to treatment and similar outcomes
in men and women but females are more susceptible
to: (i) ARV treatment delay (19), (ii) experience more
side effects (20), and (iii) higher drug exposure due to
physiological and metabolic differences affecting drug
absorbance, toxicity and retention (18). Consequently,
women may experience more treatment changes than
men and are more likely to poor treatment adherence
due to physiological and psychosocial factors affecting
treatment compliance (21).
This report contains the 10 most common mutations in the RT and the protease genes as well as
their current ARV drug resistance interpretations. We
observed statistically significant differences between
males and females for several mutations. The K103N
RT mutation was more common in women while the
protease mutations L90M and M46I were more prevalent in men. Our results show that 60.1% of males and
15
50.2% of females tested in 2005 had HIV-1 with resistance to at least one medication. . The average number
of HIV mutations in males was 6.27, while the average
number of HIV mutations in females was 5.49. Several
cohort studies have not identified gender as a predictor for primary drug resistance (22) while others report
that mutation prevalence is higher in males (10). More
research is needed to establish correlations between
HIV mutations, drug resistance and gender in predominantly Hispanic populations since people of Hispanic
origin are underrepresented in many mutation prevalence reports.
HIV drug resistance is becoming a growing problem around the globe and monitoring must play a part
in the surveillance and control of the epidemic worldwide (23). However, it has been difficult to compare
national, regional, and local estimates of transmitted
resistance because of differences in study design and
because estimates have been based on different lists
of resistance mutations (24). In one of the largest HIV
drug resistance surveys ever performed in the USA,
the estimated prevalence of HIV drug resistance was
76% with 48% of infected individuals harboring multidrug-resistant strains (25). Even though no specific
data has been published for 2005, resistant rates may
be similar between Puerto Rico and the USA due to the
observed shared infection pattern maintained by the
high level of travel between the 2 countries (26).
Our study is limited by the lack of demographic,
clinical and behavioral data that would allow the performance of multivariate statistical analyses that could
explain the driving forces behind the reported statistically significant differences. Furthermore, the assay
can detect any mutation in the coding regions of the
RT and protease genes but does not detect mutations
in other regions of the viral genome that could contribute to ARV therapy resistance. In addition, software
upgrades in the TRUGENE system present a technical
limitation since the software is periodically updated to
reflect the current state of knowledge of mutation – resistance correlations. Since privacy issues impede the
electronic storage of patient data, previously analyzed
data cannot be reanalyzed to detect formerly unknown
resistance patterns. Commercial screening platforms
are also affected by the presence of minority viral variants in patients that can rapidly grow under drug selection pressure and can contribute to treatment failure
(27). However, the current techniques available to detect their presence are difficult to manage and are not
likely to become part of routine clinical care in the near
future (28). Until better technologies are available, it is
standard practice to monitor HIV drug resistance using
either genotypic or phenotypic resistance assays. The
use of resistance assays can instruct drug selection,
help in patient management, and improve therapy
outcomes (29). The vast majority of adherent patients
without resistance on standard resistance testing become virologically suppressed (28).
The fact that there are differences between
sexes in HIV mutations in Puerto Rican patients could
point out possible differences in ARV treatment efficiency. Our data could serve as baseline for prospective
16
cohort studies where scientists, patients and physicians collaborate to study these differences in more
detail with the goal of establishing HIV mutation and
resistance models tailored to the needs of the Puerto
Rican population.
REFERENCES
1.
Gomez MA, Fernandez DM, Otero JF, Miranda S, Hunter
R: The shape of the HIV/AIDS epidemic in Puerto Rico. Rev Panam Salud Publica 2000; 7: 377-83.
2.
Gomez MA, Velazquez M, Hunter RF: Outline of the Human Retrovirus Registry: profile of a Puerto Rican HIV infected population. Bol Asoc Med PR 1997; 89: 111-16.
3.
Centers for Disease Control and Prevention. HIV/AIDS
Surveillance Report, 2005. Vol. 17. Rev ed. Atlanta: U.S. Department of Health and Human Services, Centers for Disease Control and Prevention; 2007
4.
Centers for Disease Control and Prevention. HIV/AIDS
Surveillance Report, 2007. Vol. 19. Atlanta: U.S. Department of
Health and Human Services, Centers for Disease Control and Prevention; 2009
5.
Bhaskaran K, Hamouda O, Sannes M, Boufassa F, Johnson AM, Lambert PC, Porter K: CASCADE Collaboration. Changes
in the risk of death after HIV seroconversion compared with mortality in the general population. JAMA 2008; 300: 51-59.
6.
Kozal MJ: Drug-resistant human immunodefiency virus.
Clin Microbiol Infect 2009; 15 Suppl 1:69-73.
7.
Johnson VA, Brun-Vezinet F, Clotet B, et al: Update of the
Drug Resistance Mutations in HIV-1: December 2009. Top HIV Med
2009; 17: 138-45.
8.
Hogg RS, Bangsberg DR, Lima VD, et al: Emergence
of drug resistance is associated with an increased risk of death
among patients first starting HAART. PLoS Med 2006; 3:e356.
9.
Paredes R, Clotet B: Clinical management of HIV-1 resistance. Antiviral Res 2010; 85: 245-65.
10.
Weinstock HS, Zaidi I, Heneine W, et al: The epidemiology
of antiretroviral drug resistance among drug-naive HIV-1-infected
persons in 10 US cities. J Infect Dis 2004; 189: 2174-80.
11.
Torres B, Vallés V, and Ríos-Olivares E. Prevalence of
Primary and Secondary Resistance Mutations to Antiretroviral Drug
in a Population of Puerto Rican Infected with HIV. PRHSJ 2002; 21:
329-36.
12.
Cubano LA, Sepúlveda-Torres L del C, Sosa G, et al:
Prevalence of drug resistance and associated mutations in HIVpositive Puerto Ricans: sex variations. Ethn Dis 2008; 18 (2 Suppl
2): S2-132-6.
13.
Hariri S, McKenna MT: Epidemiology of human immunodeficiency virus in the United States. Clin Microbiol Rev. 2007; 20:
478-88.
14.
Pence BW, Ostermann J, Kumar V, Whetten K, Thielman
N, Mugavero MJ. The influence of psychosocial characteristics and
race/ethnicity on the use, duration, and success of antiretroviral
therapy. J Acquir Immune Defic Syndr 2008; 47: 194-201.
15.
Grubb JR, Singhatiraj E, Mondy K, Powderly WG, Overton
ET. Patterns of primary antiretroviral drug resistance in antiretroviral-naïve HIV-1-infected individuals in a Midwest university clinic.
AIDS 2006; 20: 2115-16.
16.
Gibert CL, Shlay JC, Sharma S, et al: Community Programs for Clinical Research on AIDS; International Network for
Strategic Initiatives in Global HIV Trials. Racial differences in changes of metabolic parameters and body composition in antiretroviral
therapy-naive persons initiating antiretroviral therapy. J Acquir Immune Defic Syndr 2009; 50: 44-53.
17.
Tedaldi EM, Absalon J, Thomas AJ, Shlay JC, van den
Berg-Wolf M: Ethnicity, race, and gender. Differences in serious adverse events among participants in an antiretroviral initiation trial:
results of CPCRA 058 (FIRST Study). J Acquir Immune Defic Syndr
2008; 47: 441-8.
18.
Floridia M, Giuliano M, Palmisano L, Vella S: Gender differences in the treatment of HIV infection. Pharmacol Res 2008; 58:
173-82.
19.
Mocroft A, Gill MJ, Davidson W, Phillips AN: Are there
gender differences in starting protease inhibitors, HAART, and disease progression despite equal access to care? J Acquir Immune
Defic Syndr 2000; 24: 475-82.
20.
Currier JS, Spino C, Grimes J, et al: Differences between
women and men in adverse events and CD4+ responses to nucleoside analogue therapy for HIV infection. The Aids Clinical Trials
Group 175 Team. J Acquir Immune Defic Syndr 2000; 24: 316-24.
21.
Kempf M-C, Pisu M, Dumcheva A, Westfall AO, Kilby
M, Saag S: Gender differences in discontinuation of antiretroviral
treatment regimens. J Acquir Immune Defic Syndr 2009; 52: 33641.
22.
Yerly S, von Wyl V, Ledergerber B, et al: Swiss HIV Cohort
Study. Transmission of HIV-1 drug resistance in Switzerland: a 10year molecular epidemiology study. AIDS 2007; 21: 2223-2229.
23.
Langford SE, Ananworanich J, Cooper DA: Predictors
of disease progression in HIV infection: a review. AIDS Res Ther
2007; 4: 11.
24.
Shafer RW, Rhee SY, Pillay D, et al: HIV-1 protease and
reverse transcriptase mutations for drug resistance surveillance.
AIDS 2007; 21: 215-23.
25.
Richman DD, Morton SC, Wrin T, et al: The prevalence of
antiretroviral drug resistance in the United States. AIDS 2004; 18:
1393-401.
26.
Noel RJ Jr, Chaudhary S, Rodriguez N, et al: Phylogenetic
relationships between Puerto Rico and continental USA HIV-1 pol
sequences: a shared HIV-1 infection. Cell Mol Biol (Noisy-le-grand)
2003; 49: 1193-98.
27.
Simen BB, Simons JF, Hullsiek KH, et al: Community
Programs for Clinical Research on AIDS. Low-abundance drugresistant viral variants in chronically HIV-infected, antiretroviral
treatment-naive patients significantly impact treatment outcomes.
J Infect Dis 2009; 199: 693-701.
28.
Grant PM, Zolopa AR: The use of resistance testing in the
management of HIV-1-infected patients. Curr Opin HIV AIDS 2009;
4: 474-80.
29.
Panel on Antiretroviral Guidelines for Adults and Adolescents. Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents. Department of Health and Human
Services 2009; 1-161.
Acknowledgments
The authors acknowledge the work performed by Andrea Rivera and Ismael Burgos Tirado for their assistance. This research was supported by RCMI grant
2G12RR003035.
RESUMEN
Este reporte es una continuación de esfuerzos para mantener un record de la evolución
del HIV-1 en Puerto Rico a través del monitoreo de
niveles de expresión de mutaciones asociadas a
resistencia a antiretrovirales. Muestras del 2005
fueron analizadas (458: 270 hombres, 137 mujeres, 51 anónimos), usando el TRUGENE HIV-1
Genotyping Kit y el OpenGene DNA Sequencing
System. Los resultados demuestran que 60.1%
de hombres y 50.2% de mujeres expresaban resistencia a por lo menos un medicamento. El
numero promedio de mutaciones en HIV en hombres era 6.27 y en mujeres era 5.49 Los niveles
mas altos de resistencia eran a Zalcitabine, Lamivudine y Stavudine. Las mutaciones TR con la
frecuencia mas alta eran M184V, K103N y D67N.
Las mutaciones en la proteasa con los índices
mas altos de expresión eran L63P, M36I y L90M.
Diferencias significativas entre hombres y mujeres en niveles de mutaciones y resistencia fueron
documentados.
El “Boletín” se distribuye a los médicos y estudiantes de medicina de Puerto
Rico y se publica en versión digital en www.asociacionmedicapr.org.
Todo anuncio que se publique en el Boletín de la Asociación Médica de
Puerto Rico deberá cumplir con las normas establecidas por la Asociación
Médica de Puerto Rico y la Asociación Médica Americana.
La Asociación Médica de Puerto Rico no se hace responsable por los productos o servicios anunciados.
La publicación de los mismos no necesariamente implica el endoso de la
Asociación Médica de Puerto Rico.
OFICINAS ADMINISTRATIVAS
SUBSCRIPCIONES Y ANUNCIOS
PO Box 9387 • SANTURCE, Puerto Rico 00908-9387
Tel 787-721-6969 • Fax: 787- 724-5208
Email: [email protected]
ANUNCIOS EN BOLETIN Y WEB SITE
Tel.: (787) 721-6969
Web Site: www.asociacionmedicapr.org
Todo anuncio para ser publicado debe reunir las normas establecidas por
la publicación. Todo material debe entregarse listo para la imprenta y con
sesenta días de anterioridad a su publicación.
La AMPR no se hará responsable por material y/o artículos que no cumplan
con estos requisitos.
Todo artículo recibido y/o publicado está sujeto a las normas y reglamentos
de la Asociación Médica de Puerto Rico. Ningún artículo que haya sido
previamente publicado será aceptado para esta publicación. La Asociación
Médica de Puerto Rico no se hace responsable por las opiniones expresadas o puntos de vista vertidos por los autores, a menos que esta opinión
esté claramente expresada y/o definida den tro del contexto del artículo.
Todos los derechos reservados. El Boletín está totalmente protegido por la
ley de derechos del autor y ninguna persona o entidad puede reproducir
total o parcialmente el material que aparezca publicado sin el permiso escrito de los autores.
17
“Qué manera
de despertar, tuve
un infarto cardiaco
a los 57 años”
~John E.
Lafayette, CA
Infarto cardiaco:
16 de agosto de 2007
“Debí haber hecho algo más sobre mi colesterol. Aprendí mi lección de la manera
más difícil. Ahora le confío mi corazón a Lipitor. Hable con su médico acerca de
su riesgo y acerca de Lipitor.”
●
Cuando la dieta y el ejercicio no son suficientes, añadir Lipitor puede ayudar. A diferencia de otros
medicamentos para reducir el colesterol, Lipitor está aprobado por la Administración de Drogas
y Alimentos (FDA por sus siglas en inglés) para reducir el riesgo de ataques cardiacos y eventos
cardiovasculares en pacientes con múltiples factores de riesgo como historial familiar, presión arterial
alta, bajo nivel de HDL (colesterol “bueno”), edad y fumar.
●
LIPITOR es uno de los medicamentos más estudiados con más de 16 años de investigaciones. Lipitor está
respaldado por más de 400 estudios continuos y completados.
INFORMACIÓN IMPORTANTE: LIPITOR es un
medicamento con receta. Se le administra a pacientes con
múltiples factores de riesgo de enfermedad cardiaca, como
historial familiar, presión arterial alta, edad, bajo nivel de HDL
(colesterol “bueno”) o ser fumador para reducir el riesgo de
infartos cardiacos, accidentes cerebrovasculares y ciertos tipos
de cirugías del corazón. Cuando la dieta y el ejercicio solos no
son suficientes, se usa LIPITOR junto con una dieta baja en
grasas y ejercicios para disminuir el colesterol.
LIPITOR no es para todo el mundo. No es para aquellas
personas con problemas de hígado ni para mujeres que
estén lactando, estén embarazadas o que puedan quedar
embarazadas. Si toma LIPITOR, infórmele a su médico sobre
cualquier dolor o debilidad muscular nuevos. Esto pudiera
ser señal de efectos secundarios musculares raros, pero
serios. Infórmele a su médico sobre todos los medicamentos
que usa. Esto puede ayudar a evitar interacciones serias entre
medicamentos.Su médico debe hacerle pruebas de sangre para
verificar su función hepática antes y durante el tratamiento y
podría ajustar su dosis. Los efectos secundarios más comunes
son gases, estreñimiento, dolor estomacal y acidez. Estos
tienden a ser leves y, a menudo, desaparecen.
Cuando la dieta y el ejercicio no son suficientes, añadir
LIPITOR puede ayudar. LIPITOR es una de muchas
opciones de tratamiento para reducir el colesterol que usted
y su médico pueden considerar.
Sírvase ver información adicional importante en la próxima
página.
Hable de corazón a corazón con su médico acerca de su riesgo. Y sobre Lipitor.
Llame al 1-888-LIPITOR (1-888-547-4867) o visite www.lipitor.com/john
Le exhortamos a notificar a la Administración de Drogas y Alimentos (FDA)
sobre los efectos secundarios negativos de los medicamentos con receta.
Visite www.fda.gov/medwatch o llame al 1 800 FDA 1088.
2008 Pfizer Inc. Todos los derechos reservados. LPU01085
DATOS IMPORTANTES
PARA DISMINUIR SU NIVEL
ALTO DE COLESTEROL
El nivel alto de colesterol es más que un simple número.
Es un factor de riesgo que no se debería ignorar. Si su
médico le dijo a usted que tiene un nivel alto de colesterol,
podría estar en riesgo de sufrir un infarto cardiaco; pero la
buena noticia es que usted puede tomar medidas para
disminuir su colesterol.
Con la ayuda de su médico y un medicamento para
disminuir el colesterol como LIPITOR, y junto con una
dieta y ejercicios, usted podría estar en camino a disminuir
su colesterol.
¿Listo para comenzar a comer bien y ejercitarse más?
Hable con su médico y visite la página Web de la
Asociación Americana del Corazón,
www.americanheart.org.
POSIBLES EFECTOS
SECUNDARIOS DE LIPITOR
Serios efectos secundarios en un pequeño número de
personas:
• Problemas musculares que pueden conducir a problemas
renales, incluso fallo renal. Su probabilidad de tener
problemas musculares es mayor si toma otros
medicamentos específicos con LIPITOR.
• Problemas hepáticos: Su doctor puede hacerle pruebas de
sangre para verificar su hígado antes de tomar LIPITOR y
mientras lo está tomando.
Los síntomas de problemas musculares o hepáticos incluyen:
• Debilidad o dolor muscular inexplicable, especialmente si
tiene fiebre o siente mucho cansancio
• Náusea, vómitos o dolor estomacal
• Orina de color marrón u otro color oscuro
• Siente más cansancio de lo usual
• Su piel y la parte blanca de sus ojos se ponen amarillas
Si tiene estos síntomas, llame a su médico de inmediato.
Los efectos secundarios más comunes de LIPITOR
son:
¿PARA QUIÉN ES LIPITOR?
Quién puede tomar LIPITOR:
• Personas que no pueden disminuir su colesterol lo
suficiente con dieta y ejercicio
• Adultos y niños mayores de 10 años
Quién NO debería tomar LIPITOR:
• Mujeres embarazadas, que pueden estar embarazadas o
pueden quedar embarazadas. LIPITOR puede hacerle
daño al bebé por nacer. Si usted queda embarazada, pare
de tomar LIPITOR y llame a su médico de inmediato.
• Mujeres que están lactando. LIPITOR puede pasar a la
leche materna y puede hacerle daño a su bebé.
• Personas con problemas hepáticos.
• Personas alérgicas a cualquier ingrediente de LIPITOR.
• Dolor de cabeza • Estreñimiento
• Diarrea, gas
• Malestar o dolor estomacal
• Erupción cutánea • Dolor muscular y articular
Por lo general, los efectos secundarios son leves y pueden
irse por sí solos. Menos de 3 personas en 100 dejaron de
tomar LIPITOR debido a los efectos secundarios.
CÓMO TOMAR LIPITOR
Qué hacer:
• Tome LIPITOR según recetado por su médico.
• Intente comer alimentos saludables para el corazón
mientras toma LIPITOR.
• Tome LIPITOR en cualquier momento del día, con o sin
comida.
• Si se olvida de tomar una dosis, tómesela tan pronto se
acuerde, pero espere si han pasado más de 12 horas desde
que olvidó la dosis. Tómese la próxima a su hora
establecida.
Qué no hacer:
ANTES DE TOMAR LIPITOR
Háblele a su médico :
• Acerca de todos los medicamentos que está tomando,
incluso medicamentos con receta, medicamentos sin
receta (OTC, por sus siglas en inglés), vitaminas y
suplementos herbáceos
• Si tiene dolores o debilidad muscular
• Si ingiere más de dos bebidas alcohólicas al día
• Si tiene diabetes o problemas renales
• Si tiene un problema de la tiroides
ACERCA DE LIPITOR
LIPITOR es un medicamento con receta. Disminuye, junto
con la dieta y el ejercicio, el colesterol “malo” en la sangre.
También puede aumentar el colesterol “bueno” (HDL-C,
por sus siglas en inglés).
LIPITOR puede disminuir el riesgo de infartos cardiacos o
accidentes cerebrovasculares en pacientes que tienen
factores de riesgo de enfermedad cardíaca, tales como:
• Edad, ser fumador, presión arterial alta, bajos niveles
de HDL-C, enfermedades cardíacas en la familia
• DiabetesLP278791-A
con un factor de riesgo como problemas
oculares y renales, ser fumador o presión arterial alta
• No cambie su dosis ni pare de tomársela sin antes hablar
con su médico.
• No comience a tomar nuevos medicamentos sin antes
hablar con su médico.
• No le dé su medicamento LIPITOR a otras personas. Esto
puede hacerles daño aún si tienen los mismos problemas
que usted.
• No rompa la tableta.
¿NECESITA MÁS INFORMACIÓN?
• Pregúntele a su médico o proveedor de servicios de
salud.
• Hable con su farmacéutico.
• Vaya a www.lipitor.com o llame al 1-888-LIPITOR
Lipitor está incluido en el programa de ahorros en
medicamentos con receta “Together RX Access™”.
Para información adicional llame al 1-800-444-4106
o visite www.TogetherRxAccess.com
Sólo con
receta
Fabricado por Pfizer Ireland Pharmaceuticals
Dublín, Irlanda
Distribuido por Parke-Davis, Division de Pfizer, Inc.
Nueva York, NY 10017 USA
© 2005 Pfizer Ireland Pharmaceuticals
Todos los derechos reservados. Impreso en los EUA.
LPIF Rev 2, Dic. 2005
LPU01085
ABSTRACT
Gravitational perturbation altered gene expression and increased glucose consumption in
spaceflown Jurkat cells. The purpose of this study
was to determine if the acceleration experienced
during launch was responsible for these changes.
In ground-based studies, cells were subjected to typical launch centrifugal acceleration (3g of force for
eight minutes) and centrifugal force of 90g for five
minutes (commonly used to sediment cells) in a laboratory centrifuge. Controls consisted of static cultures. Gene expression was analyzed by RT-PCR.
pH and glucose concentrations were evaluated to
monitor metabolic changes. Comparison with controls indicated no significant change in pH or glucose use. Gene expression of Jurkat cells subjected
to 3g or 90g of force was altered for only two genes
out of seven tested. This research suggests that
the changes observed in Jurkat cells flown on STS95 were not a result of launch acceleration but to
other conditions experienced during space flight.
Index words: gravitational, perturbation, espression
genes, metabolism, jurkat, cells
INTRODUCTION
L
ife on Earth has evolved in the presence of
gravity, and the development of all species has been
deeply impacted it. Gravity has not been investigated
from the perspective of its effect on life on Earth until
recently (1, 2) because humans have always lived on
the surface of the planet in the presence of practically
uniform gravity. Man is today capable of venturing into
space and has established human habitats in outer space, spending extended periods aboard space stations.
While these expeditions in microgravity conditions have
been valuable for furthering scientific knowledge, they
have also entailed some compromises to the health of
astronauts as demonstrated by changes in the immune
system and decrease in bone mass (3).
Effects have been notice on humans (4), animals (5, 6) and several types of mammalian cells (711) exposed to altered gravity conditions and hypergravity has been found to have effects on growth factor
levels (12) and metabolism (13). Furthermore, altered
gravity conditions modify cell structure, disturb nuclear
architecture and the cytoskeletal network as well as
affect gene expression (14-16) and aberrations occur
in the signaling pathways responsible for integration of
cellular regulatory cues (17).
Unlike bacteria and paramecia, some mammalian cells appear to experience a two to three fold
decrease in growth rate in microgravity compared to
ground controls and human T lymphocyte growth is
severely blunted (1). Although reasons for decreased
growth are not completely understood, there is evidence that retarded cell growth may be an outcome
of cellular adaptation involving changes in cellular
Effects Of
Gravitational
Perturbation On
The Expression
Of Genes
Regulating
Metabolism In
Jurkat Cells
Kanika Singh1
Luis Cubano PhD2
Marian Lewis1
From the 1 Department of Biological Sciences, University
of Alabama in Hunstville, and 2Department of Anatomy and
Cell Biology, School of Medicine, Universidad Central del
Caribe, Bayamón, PR.
Address reprints requests to: Luis A. Cubano PhD – Universidad Central del Caribe, PO Box 60327, Bayamon, PR,
00960-6032. E-mail: [email protected]
membranes or the cytoskeleton (14, 18). Another plausible reason is starvation due to depletion of nutrients
in the local microenvironment around the cell. This can
occur because the lack of sedimentation in microgravity results in absence of convective mixing leaving
cells without adequate access to nutrients required for
growth. Also, the spent metabolic products may accumulate around the cells. Brownian motion and diffusion
are not affected in microgravity, hence some limited
mixing can occur. Lewis et al. (1998) reported a lack
of increase in cell growth in samples held static in spaceflight or subjected to an in-flight 1g centrifuge, which
could promote some metabolite mixing. This showed
that even with some mixing, cells still did not grow in
microgravity (14) indicating that the reason cells cease
to grow could be a response to other factors in the microgravity environment.
Spaceflight altered gene expression in lymphocytes flown on the space shuttle STS-95 mission (16).
Microarray gene analysis showed that numerous structural and metabolic genes were either up- or down-regulated. In the present study, tests were conducted to
determine if expression of the metabolic genes (Thioredoxin, Transketolase, Apolipoprotein C-IV, Xanthine
dehydrogenase, Prostaglandin endoperoxide synthase1, Glyceraldehyde-3-phosphate dehydrogenase,
Lactate dehydrogenase A) would be affected in cells
subjected to simulated shuttle launch acceleration (3g)
compared to static controls and cells centrifuged at
90g (the force generally used to sediment cells for laboratory experiments). Genes were selected based on
results from the STS-95 mission (Table 1).
21
Table 1
Gene
Expression Time point
Thioredoxin
-2.21
48hrs
Transketolase 3.76
48hrs
Apolipoprotein C-IV 3.0
24hrs
expressed as the mean
and standard deviation of
total cells in five grids.
Hypergravity
Jurkat cells were
subjected to hypergravity in a Damon/IEC DiviXanthine dehydrogenase 26.8
48hrs
sion tabletop centrifuge
Prostaglandin endoperoxide synthase 1 2.30
48hrs
(model: I.E.C.HN-S), to
produce a centrifugal forGlyceraldehyde-3-phosphate dehydrogenase -2.49
48hrs
ce of 3g (200rpm) and
90g (1,000rpm). These
Lactate dehydrogenase A -3.42
48hrs
centrifugal force calculations were done using
Table 1 Expression of Metabolic Genes during Spaceflight
the formula RCF=1.12R
Relative expression of metabolic genes during STS-95. Ground controls were compared with space(N/1000)2 where R is raflown samples at 24 h and 48 h by cDNA microarray (16).
dius in millimeters from the
center
of
the
centrifuge
spindle
to the tip of the tube,
The information gained from a better understanding of the effects of altered gravity on metabolic and N is the speed of the centrifuge in RPM. In a typigenes in these ground-based studies as well as cells cal shuttle launch, the shuttle experiences 3g of force
flown in space can lead to the development of new for approximately eight minutes (19). A 90g centrifugal
biopharmaceutical products, may aid in the refinement force was tested because this is the speed generally
of countermeasures to offset the negative physiologi- used to sediment cells for laboratory experiments.
cal effects of long-duration spaceflight, and may also
For 24 hours before the centrifugation test, the
be applied to health problems on Earth.
cells were cultured in RPMI 1640 medium with 2%
FBS. Just prior to centrifugation, medium with 22%
MATERIAL AND METHODS
serum was added to bring the serum concentration to
10% and stimulate growth. This procedure mimics the
Cell Culture
handling of cells flown on STS-95.
The human lymphoblastoid cell line, Jurkat cloCells, suspended in medium, were loaded wine E6-1, was obtained from the American Type Cultu- re Collection (ATCC, Rockville, MD). Jurkat cells were thout headspace into 5 ml syringes and the syringes
used as they are easily cultured, their use reduces were placed in 50ml centrifuge tubes for centrifugation.
growth variables associated with peripheral lympho- Each syringe contained 1.5 million cells/ml in 5ml of
cytes preparations, and results from these experiments medium. After centrifugation, the cells were resuspencan be compared with those from previous spaceflight ded by gently inverting the syringes. The syringes were
experiments, such as STS-95, in which Jurkat cells then placed in the tissue culture incubator and samples
were taken for evaluation at 4, 24 and 48hrs respectiwere used.
vely, with the exception of the 0hr sample, which was
Culture medium was identical to that used for sampled immediately.
spaceflight experiments conducted in STS-95. The
For all tests, the cell solution was placed into
medium was prepared in the following manner: to 500ml of RPMI 1640 medium (Irvine Scientific, Santa two 2ml microcentrifuge tubes and spun at 1,000 rpm
Ana, CA), 5ml of 2mM L-glutamine (Life Technologies, for 1 minute. The medium was immediately decanted
Grand Island, NY), 6.25ml of 12.5mM Hepes buffer into 2ml microcentrifuge tubes and stored for glucose
(Life Technologies, Grand Island, NY), 5ml of 100X and pH analyses while the pellets were quick-frozen at
non- essential amino acids (Life Technologies, Grand -80°C until RNA extraction was performed.
Island, NY), 5ml of 1mM sodium pyruvate (Life Technologies, Grand Island, NY), 5ml of 100 units Penicillin Primers
and 100mg/ml Streptomycin (Life Technologies, Grand
Gene sequences for RT-PCR analysis were
Island, NY), and 50ml of 10% FBS (Summit Biotechno- logies, Santa Ana, CA) were added. The cells were cul- obtained from the Entrez Nucleotide website. These
tured at 37°C in a humidified CO2 incubator. The cells sequences were entered into MacVector 6.0 (Accelrys
were maintained at a density of approximately 200,000 Inc., San Diego, CA) that provided a list of possible
to one million cells/ml. Cell viability was determined by primers. The selected primers (Table 2) were obtained
Trypan blue dye (Life Technologies, Grand Island, NY) from Research Genetics, Inc (Huntsville, AL).
exclusion.
RNA Extraction
Cell Growth Evaluations
The RNA extraction was performed using Tri
At each time point tubes were gently inverted zol (Life Technologies, Grand Island, NY) according to
several times to uniformly suspend the cells and a manufactures instructions.The RNA concentration was
sample was removed for cell growth evaluation. Cells determined using a spectrophotometer (Gene Quant II,
were counted using a hemocytometer and growth was
22
Table 2
Sequence Name
Forward Sequence (5’-3’)
Reverse Sequence (5’-3’)
Thioredoxin
CAACCCTTTCTTTCATTCCCTCTC
GCAGATGGCAACTGGTTATGTCTTC
Transketolase(Trans)
TCAAGCCCCTGGACAGAAAAC
GCACCTTTCCCAGAATCTCAG
Prostaglandin endoperoxide
synthase 1 (PGH1)
GCTCGTATCCCAAATCTGTCAGC
AGCTGCCATGAGTCAAGACCTG
ApolipoproteinC-IV
(apoC-IV)
AAGACAGCCTCTTGAAGAAGACCC
TTGAAGTCCCCCATTCTCCG
Lactate dehydrogenase
A (LDHA)
ACGGTAAACATCCACCTGGCTC
TGACTCTGACTTCTGAGGAAGAGGC
Glyceraldehyde phosphate
dehydrogenase (GADP)
TCTCCTTGACTTCAACAGCGAC
TGGATACATGACAAGGTGCGG
Xanthine dehydrogenase
TTTGGCAGCATCCCCATTG
CTCTTTAGACCCTCACAGACCAGG
Table 2 Primer Sequences
Primers selected from list of candidates provided by MacVector 6.0 as described in Materials and Methods.
Pharmacia Biotech, Cambridge, England). The absorbance at 260 and 280 was recorded and agarose gels
run at 120 volts for 40 minutes were used to assess the
quality of the RNA. The remainder of the sample was
stored at -80°C until the RT-PCR reaction was performed.
One-Step Reverse Transcriptase-PCR
The RT-PCR reaction was performed on a
cold block at 10°C using the SuperScript One-Step
RT-PCR kit (Life Technologies, Grand Island, NY). To
each microcentrifuge tube, 25µl of 2X-reaction mixture,
1µl of RT/Taq mix, forward and reverse primers, 1µl
each, (Research Genetics, Huntsville, AL) were added.
Between 0.5 and 1µg of RNA was added to the tube.
DEPC water was added to bring up the volume to 50µl.
The cDNA was synthesized by one cycle at 55°C for
30 minutes and 94°C for two minutes. The PCR cycles
were 94°C for 30 seconds; annealing temperature for
30 seconds; and 72°C for one minute. 35 cycles were
performed. Samples were run on a 1% agarose gel at
115 volts for 40 minutes.
RESULTS
Analysis of Growth and Metabolic Activity
There is no notable difference in the rate of cell
growth at 24 hours among the gravity conditions of 3g,
90g and static control. However, after 24 hours, the
rate of growth of cells subjected to 90g is greater than
that at 3g and the static control (Figure 1A).
Jurkat cells perturbed by hypergravity showed
no difference in metabolic activity. The pH of the media
(3g, 90g and static) decreased equally over the 48 hour
culture period (Figure 1B). shows Glucose consumption increased over the 48 hour period in cells under all
gravity conditions, 3g and 90g and in the static control
(Figure 1C).
Figure 1
A. Growth Curve
Band intensities were determined using the National Institute of Health Image 6.0 software. Ratios
between control and test samples were calculated. Ratio differences of 2.0 or above were considered significant changes in expression.
Glucose and pH Analysis
At each time point, the pH was obtained from
medium samples using a 170 pH/Blood Gas System
(CIBA-Corning, Medfield, MA). In order to determine
the glucose levels in the medium, a Beckman II Glucose Analyzer (Beckman Coulter, Fullerton, CA) was
used. Culture medium samples were evaluated in triplicate readings, and the mean and standard deviation
were calculated for each sample.
23
B. pH
Figure 1 Growth Curve, pH and Glucose Consumption for 3g, 90g
and Static Control
Cells were suspended in medium with 2% serum 24 h before centrifugation to mimic the STS-95 shuttle flight experiment, as described in Materials and Methods. A) Cell Growth Curve: Cells were
counted after centrifugation (0 h). Subsequent counts were made
4, 24 and 48 hrs. Each data point represents the mean and SD
of cells counted in five hemacytometer squares. The pH (B) was
obtained from medium samples using a 170 pH/Blood Gas System
and glucose levels (C) using a Beckman II Glucose Analyzer. Culture medium samples were evaluated in triplicate readings, and the
mean and standard deviation were calculated for each sample.
Analysis of Metabolic Genes Expression
A 3g (200 rpm) force was simulated by using
a laboratory tabletop centrifuge to investigate whether
gene expression, could be affected by shuttle launch
acceleration. The 90g centrifugal force was also tested
because this is the speed generally used to sediment
cells for laboratory experiments.
C. Glucose Consumption
Thioredoxin, transketolase, prostaglandin endoperoxide synthase 1, glyceraldehyde 3 phosphate
dehydrogenase were expressed in 3g, 90g and static
control (Figure 2). However xanthine dehydrogenase
and apolipoprotein C-IV were variably expressed in
these gels. The intensity ratios (Table 3) indicate that
gene expression was not affected significantly in the 3g
or 90g test condition when compared to the control except for apolipoprotein C-IV and xanthine dehydrogenase. Apolipoprotein C-IV was up-regulated at 0 hour
by a factor of 2.5 times at 3g and by 10 times at 90g.
Xanthine dehydrogenase was down-regulated at 3g.
DISCUSSION
Jurkat cells exposed to spaceflight manifest
differential gene expression for metabolic genes (Table 1), growth arrest and increase in glucose utilization
(14, 16). These led us to consider whether metabolism
in these cells may be altered by space shuttle launch
acceleration and to determine if it could cause metabo-
Table 3
Lane #
Gene
Ratio of Expression
3g/Static
90g/Static
1
100 bp Ladder
2
Thioredoxin (thio)
1.1
1.1
3
Transketolase (tran)
1.2
1.0
4
Prostaglandin Endoperoxide Synthase 1 (PGH1)
1.4
1.6
5
ApolipoproteinC-IV (apoC-IV)
2.5
10.0
6
Lactate dehydrogenase A (LDHA)
0.83
0.7
7
Glyceraldehyde-3-phosphate dehydrogenase (GADP)
1.2
1.0
8
Xanthine dehydrogenase A (XDH)
0.5
.63
Table 3 Ratio of Expression – Centrifugal Acceleration at 0 Hour
Densitometry values were obtained as described in Materials and Methods. With the exception of apolipoprotein C-IV and xanthine
dehydrogenase, centrifugal acceleration of 3g and 90g appears to have no notable effect on the expression of the metabolic genes
tested in Jurkat cells.
* 0.5 – 1.5: Normal expression; >2.0: Up-regulation; <0.5: Down regulation
24
Figure 2 Gene Expression – Centrifugal Acceleration at 0 Hour
mRNA was extracted and RT-PCR was conducted as described in Materials
and Methods. Representative PCR gels are shown for static control, 3g and
90g. Lanes for each panel are as follows: lane 1 DNA ladder; lane 2 Thioredoxin; lane 3 Transketolase, lane 4 Prostaglandin Endoperoxide Synthase 1;
lane 5 ApolipoproteinC-IV; lane 6 Lactate dehydrogenase A; lane 7 Glyceraldehyde-3-phosphate dehydrogenase; lane 8 Xanthine dehydrogenase A.
Figure 2
lic gene expression changes. Data indicates that exposing cells
to 3g and 90g only affected the expression of Apolipoprotein
C-IV (apoC-IV) and Xanthine dehydrogenase A (XDH) at the
examined time point. Experiments performed to test the effect of centrifugal
acceleration on growth and metabolism of Jurkat cells showed
that 3g did not affect Jurkat cell proliferation (Figure 1A). There
was no major difference in the rate of cell growth at 24 hours
between 3g, 90g and static control. However, after 24 hours,
the rate of growth of cells subjected to 90g was significantly higher than that of 3g and the static controls. Cogoli and Tschopp
demonstrated that lymphocytes when subjected to increasing
hypergravity show increased growth rate when compared to
their static counterparts (20). This increase is probably due to
the increased production of cMyc, which increases cell growth
(21). Since the response of Jurkat cells to hypergravity is opposite to microgravity (retarded cell growth), it is proposed that
there is a continuum of morphological effects from microgravity
to hypergravity (22).
Static: 0 Hour
The pH of the media (3g, 90g and static) fell over the
48 hour culture (Figure 1B). This decrease in pH indicated that
as the cells increased in number. The dissolved carbon dioxide levels increased as a function of time while the dissolved
oxygen levels decreased (data not shown), further illustrating
that the cells were engaged in metabolic activity. Figure 1C
indicates that glucose consumption increased over the 48 hour
period in cells exposed to 3g and 90g and in the static control.
These data demonstrate that cells were actively metabolizing
and clearly illustrate that centrifugal acceleration at 3g and 90g
does not inhibit cell growth or metabolic activity in Jurkat cells.
With the exception of apolipoprotein C-IV and xanthine
dehydrogenase, which showed significant changes in expression, centrifugal acceleration of 3g and 90g appears to have no
notable effect on the expression of the metabolic genes tested
in Jurkat cells. Hence, the differences in expression of metabolic genes observed in spaceflown cells (STS-95) appears
to be a result of other factors characteristic of spaceflight or
the microgravity environment per se. The effects of centrifugal acceleration on gene expression at the 24 and 48hrs time
points needs to be examined as well as the effects of vibration
and radiation, factors also associated with spaceflight. There
is a critical need for future opportunities to fly cells in space to
address to resolve why T lymphocytes do not grow in microgravity as the function of these cells is vital to human health.
3g: 0 Hour
REFERENCES
1.
Cogoli, A: Gravitational physiology of human immune cells: A review
of in vivo, ex vivo and in vitro studies. J. of Grav Physiol 1996; 3: 1-10.
2.
Horneck G, Klaus DM, Mancinelli RL. Space microbiology. Microbiol
Mol Biol Rev. 2010; 74: 121-56.
3.
Williams D, Kuipers A, Mukai C, Thirsk R. Acclimation during space
flight: effects on human physiology. CMAJ 2009; 180: 1317-23.
90g: 0 Hour
25
4.
Crucian BE, Stowe RP, Pierson DL, Sams CF. Immune
system dysregulation following short- vs long-duration spaceflight.
Aviat Space Environ Med. 2008; 79: 835-43.
5.
Gridley DS, Slater JM, Luo-Owen X, Rizvi A, Chapes SK,
Stodieck LS, Ferguson VL, Pecaut MJ. Spaceflight effects on T
lymphocyte distribution, function and gene expression. J Appl Physiol. 2009; 106: 194-202.
6.
Baqai FP, Gridley DS, Slater JM, Luo-Owen X, Stodieck
LS, Ferguson V, Chapes SK, Pecaut MJ. Effects of spaceflight on
innate immune function and antioxidant gene expression. J Appl
Physiol. 2009; 106: 1935-42.
18.
Lewis, M. Space: A New “Laboratory” for Cell Biology Research. Earth Space Review. 1994; 3: 22-26.
19.
Fitzergerald, A. and Hughes-Fulford, M. Gravitational
loading of a stimulated launch alters mRNA expression in osteoblasts. Exp Cell Research. 1996; 228: 168-167.
20.
Tschopp, A. and Cogoli, A. Hypergravity promotes cell
proliferation. Experimentia. 1983; 39: 1323-29.
21.
Kumei, Y. et al. Reduction of G1 phase duration and enhancement of c-myc gene expression in Hela cells at hypergravity.
J Cell Science. 1989; 93: 221-6.
7.
Hammond TG, Benes E, O'Reilly KC, Wolf DA, Linnehan
RM, Taher A, Kaysen JH, Allen PL, Goodwin TJ. Mechanical culture conditions effect gene expression: gravity-induced changes on
the space shuttle. Physiol Genomics. 2000; 3: 163-73.
22.
Vasques, M. et al. Comparison of hyper and microgravity
on rat muscle, organ weights and selected plasma constituents.
Aviation, Space and Environmental Medicine. 1998; 69: A2-A8.
8.
Kaysen JH, Campbell WC, Majewski RR, Goda FO, Navar
GL, Lewis FC, Goodwin TJ, Hammond TG. Select de novo gene
and protein expression during renal epithelial cell culture in rotating
wall vessels is shear stress dependent. J Membr Biol. 1999; 168:
77-89.
Acknowledgments
9.
Ward NE, Pellis NR, Risin SA, Risin D. Gene expression
alterations in activated human T-cells induced by modeled microgravity. J Cell Biochem. 2006; 99: 1187-202.
Funded by NASA grant NAG2-985. The authors
will like to express their thanks to Dr. Joseph Leahy
and Stephanie Aikman for assistance in designing primer sequences and acquisition of reagents.
10.
Cubano, L. and Lewis, M. Fas/Apo1 protein is increased
in spaceflown lymphocytes (Jurkat). Exp Gerontol. 2000; 35: 389400.
11.
Cubano LA, Lewis ML. Effect of vibrational stress and
spaceflight on regulation of heat shock proteins hsp70 and hsp27
in human lymphocytes (Jurkat). J Leukoc Biol. 2001; 69:755-61.
12.
Oshima M, Suzuki H, Guo X, Oshima H. Increased level
of serum vascular endothelial growth factor by long-term exposure
to hypergravity. Exp Anim. 2007; 56: 309-13.
13.
Lintault LM, Zakrzewska EI, Maple RL, Baer LA, Casey
TM, Ronca AE, Wade CE, Plaut K. In a hypergravity environment
neonatal survival is adversely affected by alterations in dam tissue
metabolism rather than reduced food intake. J Appl Physiol. 2007;
102: 2186-93.
14.
Lewis, M. et al. (1998) Spaceflight alters microtubules
and increases apoptosis in human lymphocytes. FASEB. 12:
1007-1018.
15.
Hughes-Fulford M, Rodenacker K, Jütting U. Reduction of
anabolic signals and alteration of osteoblast nuclear morphology in
microgravity. J Cell Biochem. 2006; 99:435-49.
16.
Lewis ML, Cubano LA, Zhao B, Dinh HK, Pabalan JG,
Piepmeier EH, Bowman PD. cDNA microarray reveals altered
cytoskeletal gene expression in space-flown leukemic T lymphocytes (Jurkat). FASEB J. 2001; 15:1783-85.
17.
Boonyaratanakornkit JB, Cogoli A, Li CF, Schopper T, Pippia P, Galleri G, Meloni MA, Hughes-Fulford M. Key gravity-sensitive signaling pathways drive T cell activation. FASEB J. 2005; 19:
2020-22.
RESUMEN
Perturbaciones de gravedad alteran expresión de genes y aumentan el consumo de glucosa
en células Jurkat que han volado en el espacio. El
propósito de este estudio fue determinar si la aceleración a la cual son expuestas las células durante el despegue fue responsable de los cambios.
Células fueron expuestas a la aceleración típica
de un despegue (3g) y a 90g por cinco minutos.
Controles fueron células que se mantuvieron estáticas. Expresión de genes fue analizada por RTPCR. pH y consumo de glucosa fueron evaluados
para examinar cambios metabólicos. No hubieron
diferencias significativas en cambios en pH y uso
de glucosa entre controles y muestras experimentales. La expresión de genes en células sujetas a
3g y 90g cambio en dos de los siete genes examinados. Estos resultados sugieren que cambios
observados en experimentos realizados en STS95 no fueron resultado de aceleración durante el
despegue pero otras condiciones durante el vuelo.
Educación
Médica
Continua
Mantengase informado visitando
periódicamente nuestro website
www.asociacionmedicapr.org
26
Cardiovascular
Events During
General Elections
In Bayamon,
Puerto Rico
Arnaldo E. Pérez-Mercado MD
Gerónimo Maldonado-Martínez MPH
José Rivera del Rio MD
Robert F. Hunter Mellado MD
From the Internal Medicine Department, Universidad Central
del Caribe, School of Medicine, Call Box 60-327, Bayamón,
PR 00960-6032.
Address reprints requests to: Robert F. Hunter Mellado, MD Retrovirus Research Center, Internal Medicine Department,
Universidad Central del Caribe, School of Medicine, Call
Box 60-327, Bayamón, PR 00960-6032. Email: [email protected]
INTRODUCTION
T
he association between emotional stress
and cardiovascular events has long been suspected
and proposed. There are studies linking anger, hostility, and depression to increased rates of coronary heart
disease [1, 2]. Several studies have also documented a
link between typically stressful situations and coronary
events. In 2005 Jette Moller and colleagues reported
that sudden increases in work demands were associated with six times the risk of myocardial infarction
[3]. Ching-Hong Tsai and colleagues reported in 2004
that admissions for myocardial infarction rose significantly following the Taiwan earthquake on September
21, 1999 [4], and similar findings were reported when
coronary events were studied following the Iraqi missile war [5]. While these studies all support the role of
stress as a trigger for coronary events, they fundamentally represent a physiologic response to unexpected
events. One might consider whether anticipated events
in which subjects participate willingly would provoke similar responses.
Several studies evaluating coronary events
surrounding football matches in Europe shed light on
this subject. One study performed in the German population showed significant increases in the incidence of myocardial infarction and arrhythmia in the days
surrounding the 2006 World Cup [6]. Similar studies
carried out in English and Dutch populations showed
similar trends [7,8]. In this paper we present data on
whether general elections in Puerto Rico, events which
are highly charged with emotion and in which subjects
also participate willingly, are associated with an increase in acute coronary events.
28
ABSTRACT
Emotional stress has been linked to acute
coronary events. We examined whether the emotional response to elections in Puerto Rico induced a similar response. Methods: We reviewed records at HIMA San Pablo Hospital (HIMASP) and
Ramon Ruiz Arnau University Hospital (HURRA)
in Bayamón and identified patients admitted with
ICD-9 codes 410, 411, and 413 or corresponding
diagnoses during a period surrounding the general
elections and compared them with the same time
period in non-election years. Results: Cardiovascular events accounted for 3.24% of election-year
admissions vs. 5.51% during non-election years
in HURRA (p=0.036, N=37), while accounting for
2.86% of election-year admissions in HIMASP vs.
3.27% during non-election years (non-significant).
Discussion: There was a trend towards a lower rate
of admission for cardiovascular events during general elections in both hospitals, reaching statistical
significance at HURRA. Further study may elucidate reasons for this behavior and determine whether
similar trends hold true in other populations.
Index words: cardiovascular, events, general, elections, Bayamon, Puerto Rico
METHODS
We were interested in examining different sectors of our community and as such we selected two tertiary hospitals in the region of Bayamon, Puerto Rico
for our study. The first was the University Hospital Ramón Ruiz Arnau (HURRA). This is a teaching hospital
which is sponsored and funded by the Department of
Health of Puerto Rico. The second hospital was HIMA
San Pablo in Bayamon (HIMASP). This is private hospital which is located within 3 miles of the first. Both
receive and treat adult patients with acute cardiovascular events. Utilizing the International Classifications
of Diseases sourcebook, we identified the ICD-9 codes
which are commonly used to codify admitting and discharge diagnoses for acute cardiovascular events in
the hospitals of Puerto Rico. From this sourcebook we
selected the following codes which were felt to identify
patients with acute coronary events.
410: Acute Myocardial Infarction
411: Acute Subacute Ischemic Heart Disease
413: Angina Pectoris
We selected a time period corresponding to
seven days before and after the general elections in
Puerto Rico for the years 2000 and 2004 in both hospitals, and we included the 2008 year in the data abstracted from HURRA. We tabulated the total number of
adult admissions corresponding to the selected ICD-9
codes or any of their subcategories in both hospitals
during the specified time periods. As a control group
we studied the admissions with identical ICD-9 codes
during a similar period of time for the non election years
of 1999, 2001, 2003, 2005 and 2007. The specific
Figure 1: Comparison of Admission Rates for Cardiovascular Events during Election Years and Non-Election Years at HIMASP and HURRA. (HIMASP=HIMA San Pablo Hospital. HURRA=Hospital Universitario Ramon Ruiz Arnau. NS=Non-significant.)
AUTHOR: Arnaldo E. Pérez-Mercado, M.D.
dates in question were as follows: October 31, 1999
– November 14, 1999; October 31, 2000 – November
14, 2000 (General elections held November 7, 2000);
October 31, 2001 – November 14, 2001; October 26,
2003 – November 9, 2003; October 26, 2004 – November 9, 2004 (General elections held November 2,
2004); October 26, 2005 – November 9, 2005; October
29, 2007 – November 11, 2007; October 29, 2008 –
November 11, 2008 (General elections held November
4, 2008).
descriptive analysis were used. In order to select the
correct parametric or non parametric test, a normality test was performed in all the variables involved in
our study. Differences among medians were evaluated
using the two-independent samples Mann-Whitney U
test. The significance level was set in 0.05. The Statistical Package for the Social Sciences (SPSS 14, Chicago IL) was used to analyze the data.
The patients were identified and selected from
a perusal of the electronic data banks in HIMASP and
through a manual review of admission and discharge
records in HURRA. When available, the age and sex of
the patients was recorded and tabulated. Only patients
over 18 years of age were used in the study. We also
identified the total number of adult admissions during
the specified time frame in both hospitals in order to
analyze proportions with acute coronary events. There was some doubt on the exact number of adult admissions between 2000 and 2004 for the time periods
studied in HIMASP. This was related to the fact that the
raw number of total admissions in these years was a
total raw number that did not exclude patients under
the age of 18. We decided to analyze the number of
admissions during the months of November and December between 2005-2008, determine the proportion
of adults over the age 18 admitted during this time frame, take an average proportion of admissions over the
age 18 vs. under the age of 18 and use that number
to estimate the number of adult admissions during the
index elections years.
UNIVERSITY HOSPITAL RAMON RUIZ ARNAU (HURRA), See TABLE I
Statistical Methods
A total of 46 admissions for the specified coronary events out of 1606 adult admissions were tabulated for the election years 2000 and 2004. This accounts
29
To describe the study group, percentages and
RESULTS
During election years a total of 9 out of 278 admissions with acute coronary events were documented. This number accounts for 3.24% of adult admissions during this time. There were 6 men and 3 women
with a mean patient age of 55 years. During non-election years there were 28 out of 508 adult admissions
accounting for 5.51% of all adult admissions related to
acute coronary events. Of these, 18 (64%) were male
and 10 (36%) were female. Mean patient age was 66
(SD, 13). Thus during election years the number admissions due to acute coronary events was 3.24% as
compared to 5.51% in the control years (See Figure 1).
The Mann-Whitney U test analysis comparing the rate
of election year admissions for cardiovascular events
to those on non-election years showed significant difference. (p=0.036).
HIMA SAN PABLO BAYAMON (HIMASP), See TABLE II
Dx
Year
1999
2000
2001
2003
2004
2005
2007
2008
410
8
1
3
0
2
4
1
1
(3.94%)
(0.60%)
(1.81%)
(0.0%)
(1.64%)
(2.94%)
411
0
0
0
0
(0.0%)
(0.0%)
(0.0%)
(0.0%)
413
4
5
4
1
(1.97%)
Total
12
(5.91%)
(3.61%)
Admissions
203
166
(3.01%)
6
(2.41%)
7
(4.22%)
166
(2.56%)
0
(0.0%)
0
(4.35%)
(0.0%)
1
2
(4.35%)
(2.56%)
23
78
(7.27%)
1
(1.82%)
0
(0.0%)
5
(9.09%)
55 2
(3.28%)
0
(0.0%)
0
0
(0.0%)
(0.0%)
3
1
(4.92%) (2.94%)
61
34
Table I: Patients Admitted to HURRA with a Diagnosis of Ischemic Heart Disease. The numbers in parentheses represent the percentage of total adult admissions for that particular diagnosis and year. The numbers outside parentheses represent the actual number
of patients admitted.
Dx
Year 1999
2000
2001
2003
2004
2005
410 15(1.57%)
15(1.73%)
11(1.26%)
9(1.29%)
4(0.54%)
18(2.23%)
411 16(1.67%)
9(1.04%)
15(1.72%)
8(1.14%)
16(2.17%)
9(1.12%)
413 4(0.42%)
2(0.23%)
2(0.23%)
0(0.0%)
0(0.0%)
2(0.25%)
Total 35(3.65%)
26(3.00%)
28(3.21%)
17(2.43%)
20(2.71%)
29(3.60%)
868
873
699
738
807
Admissions* 958
Table II: Patient Admissions to HIMASP with a Diagnosis of Ischemic Heart Disease. The numbers in parentheses represent the
percentage of total adult admissions for that particular diagnosis and year. The numbers outside parentheses represent the actual
number of patients admitted.
*Exact adult admission numbers for the time periods studied were unavailable. The number of adult admissions during these time
periods was estimated based on the average number of adults admitted during the months of October and November between 2005
and 2008.
for 2.86% of adult admissions during the specified time
frame. The number of admissions for the specified coronary events in non-election years was 109 out of an
estimated total 3337 adult admissions, accounting for
3.27% of the admission. Based on the methodology
outlined above we estimated that the average percent
of patients over the age of 18 years admitted during
the time period studied was 81.4% of patients. Thus in
election years the proportion of admissions in the time
period allotted was 2.86% as compared to 3.27% in the
control time frame (see Figure 1). Statistical comparison of admission rates for cardiovascular events on
election years vs. non-election years showed no significant difference.
DISCUSSION
The results of this study are noteworthy in that
they reveal an unexpected trend towards fewer admissions for acute cardiovascular events during the week
preceding and following general elections in Puerto
Rico. Although this trend was noted at both of the studied institutions, it was statistically significant only at
HURRA. Such a finding would seem to suggest that
elections convey some degree of protection against
coronary events amongst patients of this institution
or that patients delay seeking health care from acute
30
cardiovascular events during this time period. Puerto
Ricans are highly involved in the electoral process as
evidenced by their high voter turnout (78.04% of inscribed voters in 2008 participated in the general election
[9], compared to 61.7% of the voting eligible population
in the 2008 US general election [10]. An additional potential explanation for these findings is that patients are
more diligent in their self-care during this time period
in order to partake in the electoral activities. While the
charged emotions surrounding this event would suggest an elevated level of stress, one could also surmise that those who find the proceedings enjoyable
would instead be protected against coronary events or
their symptoms by the production of endogenous endorphins. These findings, however, would contradict
the findings of the previously cited studies conducted around the World Cup, an event which spectators
presumably also find enjoyable. A key difference between the World Cup and the electoral process is that
the latter extends for a period of time which precedes
the date of the election, with events such as campaign
rallies and debates occurring throughout the election
year. It’s conceivable that the emotional impact of Election Day is diluted by this and that any coronary events
induced by stress surrounding the process are distributed throughout the entire year possibly peaking prior to
the election rather than near it.
An alternate interpretation, however, is those
patients avoid seeking medical attention during the
time period surrounding the general election. The desire to partake in the proceedings might cause patients
to ignore symptoms that might otherwise prompt a
hospital visit. The fact that the difference in admission
rates was only significant at HURRA, whose patient
population is predominantly composed of uninsured
patients or those insured by the public health system,
could suggest that socioeconomic factors, such as
concern about the potential costs of health care, make
patients less inclined to visit physicians around general
elections. However, it is worth noting that the HURRA
sample size is small and represents a narrow segment
of the population. Thus, these results may not be generalizable to other hospitals or populations.
In addition to a small sample size, the study
is limited in that it did not analyze mortality data, and
thus we do not know whether there is any difference
in the magnitude of the coronary event during the time
periods studied. Although one may assume that a decrease in admission rates would suggest a decrease
in patient mortality, patients who died prior to arrival at
the hospital or in the emergency room before a formal
admission wound result in an under detection of the
event with our methodology.
The study only included patients admitted to
the hospital with the specified diagnostic codes used
in the study; patients admitted under alternate diagnostic codes and later identified as having experienced an acute coronary event or those evaluated in the
emergency room for coronary symptoms but who were
discharged from the hospital were not included in the
study. Both of these events are potential reasons for a
decreased detection rate of this diagnosis. We would,
nevertheless expect that a similar effect would be occurring during the control years, offsetting this possible
confounding factor. The difficulties in obtaining precise data on adult admissions in one of the institutions
along with other demographic information sheds some
light into the limitations of doing research using computerized record-keeping software.
In conclusion, there is a significant decline in
admission rates for cardiovascular events during the
two weeks surrounding the general elections at HURRA; a similar trend of less magnitude was seen in
the sister hospital at HIMASP. Further studies are needed to assess whether similar decreases occur in other
hospitals in Puerto Rico, whether these trends translate into an appreciable difference in patient outcome,
and whether any medical or cultural interventions are
necessary to modify these trends.
REFERENCES
1.
Chida, Y. Steptoe, A. The association of anger and hostility
with future coronary heart disease: a meta-analytic review of prospective evidence. J Am Coll of Cardiol. 2009 Mar 17;53(11):93646.
2.
Whang, W. Kubzansky, L. Kawachi, I. Depression and risk
of sudden cardiac death and coronary heart disease in women:
results from the Nurses’ Health Study. J Am Coll of Cardiol. 2009
Mar 17;53(11):950-8.
3.
Moller, J. Theorell, T. De Faire, U. et al. Work related
stressful life events and the risk of myocardial infarction. Casecontrol and case-crossover analyses within the Stockholm heart
epidemiology programme (SHEEP) J Epidemiol Community Health
2005;59:23–30.
4.
Tsai, C. Lung, F. Wang, S. The 1999 Ji-Ji (Taiwan) Earthquake as a Trigger for Acute Myocardial Infarction. Psychosomatics 2004;45:477-482.
5.
Meisel SR, Kutz I, Dayan KI, Pauzner H, Chetboun I, Arbel Y, David D. Effect of Iraqi missile war on incidence of acute
myocardial infarction and sudden death in Israeli civilians. Lancet.
1991;338(8768):660-1.
6.
Wilbert-Lampen, U. Leistner, D. Greven, S. Cardiovascular
Events during World Cup Soccer. N Engl J Med 2008;358(5):47583.
7.
Carroll, D. Ebrahim, S. Tilling, K. et al. Admissions for
myocardial infarction and World Cup football: database survey.
BMJ 2002;325:1439–42.
8.
Witte, D. Bots, M. Hoes, A. et al. Cardiovascular mortality
in Dutch men during 1996 European football championship: longitudinal population study. BMJ 2000;321:1552–4.
9.
Comisión Estatal de Elecciones: Elecciones 2008, Noche
del Evento, retrieved on-line at:
http://196.42.5.130/staticpub/ELECCIONES_GENERALES_2008_4/NOCHE_DEL_EVENTO_7/default.html on February
10, 2010.
10.
United States Election Project: 2008 General Election Turnout Rates, retrieved on-line at http://elections.gmu.edu/
Turnout_2008G.html on February 10,2010.
11.
Statistical Package for the Social Sciences (SPSS), version 14, Chicago, IL. 2005.
RESUMEN
El estrés emocional ha sido relacionado
con los episodios de afecciones coronarias agudas. Examinamos si la respuesta emocional a las
elecciones generales en Puerto Rico induce una
respuesta similar. Métodos: Se revisaron los expedientes médicos de los hospitales HIMA San
Pablo y Ramon Ruiz Arnau en Bayamón e identificamos un cohorte de pacientes admitidos con
códigos 410, 411 y 413 del ICD-9 o diagnósticos
correspondientes durante periodos de elecciones generales y se compararon contra un mismo
periodo sin elecciones generales. Resultados:
Los episodios cardiovasculares representaron
un 3.24% de las admisiones totales durante el
periodo eleccionario vs. 5.51% de las admisiones durante los periodos no eleccionarios en el
Hospital Universitario Ramon Ruiz Arnau (p =
0.036, N = 37), mientras que para el HIMA San
Pablo los episodios cardiovasculares representaron un 2.86% de las admisiones totales durante el periodo eleccionario vs. 3.27% de las
admisiones durante periodos no eleccionarios
(estadísticamente no significativo). Discusión:
Se observó una tendencia hacia una menor tasa
de admisiones por episodios cardiovasculares
durante las elecciones generales en ambos hospitales, alcanzando significancia estadística en
el Hospital Universitario Ramon Ruiz Arnau. Estudios adicionales podrían aclarar las razones y
determinar si tendencias similares son validas en
otras poblaciones iguales a las estudiadas.
31
3 Websites para servir a la salud:
ts 0
i
h 1
7 e 20
1
9 r
. mb
2
8 ie
t
Se
www. asociacionmedicapr.org
para los profesionales de salud
ts 0
i
h 1
1 e 20
8
2 r
. mb
6
4 ie
t
Se
www.saludampr.org
para información del paciente
ts 0
i
h 1
8 e 20
1
8 r
. mb
9
1 ie
t
Se
www.cstmpr.net
tecnología informática de salud (HIT)
“Caduet es una pastilla* para mi
presión arterial alta ...
®
y para mi
colesterol elevado.”
Caduet® combina dos medicamentos comprobados en una sola pastilla:
Norvasc® (besilato de amlodipina) para la presión arterial alta y
Lipitor® (atorvastatina cálcica) para reducir el colesterol elevado.
"Caduet hace más fácil manejar mis dos condiciones.” Caduet es
una pastilla que, conjuntamente con la dieta y el ejercicio,
reduce efectivamente tanto la presión arterial alta como el colesterol elevado. Caduet viene en una variedad de dosis de manera
que su médico puede elegir la dosis adecuada para usted.
Pregunte a su médico sobre Caduet.
Caduet. Dos medicamentos, una pastilla.
Aprenda más en www.Caduet.com
*Caduet puede usarse solo o en combinación con
otros medicamentos antihipertensivos.
Por favor vea el resumen sobre información
al paciente en la siguiente página.
INFORMACION IMPORTANTE: Caduet® es un medicamento
para venta con receta que combina 2 medicamentos, Norvasc y
Lipitor. Norvasc se usa para tratar la presión arterial alta
(hipertensión), el dolor de pecho (angina) o las arterias cardiacas
bloqueadas (enfermedad de las arterias coronarias). Lipitor se usa,
junto con la dieta y el ejercicio, para reducir el colesterol elevado.
Se usa también para reducir el riesgo de ataques cardiacos y
derrames en personas con factores múltiples de riesgo de
enfermedad cardiaca, como historial familiar, presión arterial alta,
edad, HDL-C bajo o fumar.
Caduet no es para todo el mundo. No es para personas con
problemas del hígado ni para mujeres que lactan, que están
embarazadas o que puedan quedar embarazadas. Si usa Caduet,
infórmele a su médico si siente algún dolor o debilidad muscular
nuevos. Esto podría ser señal de efectos secundarios musculares
poco comunes, pero graves. Informe a su médico sobre todas las
medicinas que usa para ayudar a evitar interacciones graves de
fármacos. El médico debe ordenarle exámenes de sangre para
verificar su función hepática antes del tratamiento y durante el
mismo y podría ajustar la dosis. Si tiene algún problema cardiaco,
asegúrese de informárselo a su médico. Los efectos secundarios más
comunes son edema, dolor de cabeza y mareo. Éstos tienden a ser
leves y, a menudo, desaparecen.
Caduet es una entre varias opciones para tratar la presión arterial
alta y el colesterol elevado, además de la dieta y el ejercicio, que
usted y su médico pueden considerar.
Le exhortamos a notificar a la Administración de Drogas y Alimentos (FDA) sobre los efectos secundarios negativos de los medicamentos con receta.
Visite www.fda.gov/medwatch o llame 1-800- FDA-1088.
©2006 Pfizer Inc. Todos los derechos reservados. CTU00211PR
(CAD-oo-et)
DATOS IMPORTANTES
PARA DISMINUIR LA PRESIÓN ARTERIAL
ALTA Y EL COLESTEROL ELEVADO.
La presión arterial alta y el colesterol elevado son más que simples
números. Son factores de riesgo que no deben ignorarse. Si su médico
le informó que tiene la presión arterial alta y el colesterol elevado, usted
puede estar expuesto a un riesgo mayor de sufrir un ataque cardiaco o
un accidente cerebrovascular. Sin embargo, la buena noticia es que
usted puede tomar los pasos necesarios para disminuir su presión arterial
y su colesterol.
Con la ayuda de su médico y medicamentos como CADUET,
conjuntamente con dieta y ejercicio, usted podría estar en vías de
disminuir su presión arterial y su colesterol. ¿Está listo para comenzar
una alimentación adecuada y ejercitarse un poco más? Hable con su
médico y visite la página en Internet de la Sociedad Americana del
Corazón, www.americanheart.org.
¿PARA QUIÉN ES CADUET?
Quién puede tomar CADUET:
• Los adultos que necesitan disminuir su presión arterial alta Y que
no pueden reducir suficientemente su colesterol con dieta y ejercicio
Quién NO debería tomar CADUET:
• Mujeres que están embarazadas o piensan que puede estarlo o tiene
planes de quedar embarazadas. CADUET puede perjudicar a su bebé
por nacer. Si queda embarazada, deje de tomar CADUET y llame de
inmediato a su médico.
• Mujeres que están lactando. CADUET puede pasar a la leche
materna y perjudicar a su bebé.
• Personas que tienen problemas del hígado.
• Personas alérgicas a algún ingrediente de CADUET.
POSIBLES EFECTOS SECUNDARIOS DE CADUET
Efectos secundarios graves en un número pequeño de personas:
Problemas musculares que pueden conducir a problemas renales,
incluso insuficiencia renal.
Usted tiene una mayor probabilidad de tener problemas musculares si está tomando otros medicamentos junto con CADUET.
Problemas hepáticos. Su médico puede hacerle análisis de sangre
para verificar la función del hígado antes de comenzar a tomar
CADUET y mientras lo está tomando.
Los síntomas de problemas musculares y hepáticos incluyen:
• Debilidad, sensibilidad o dolor que ocurre sin una buena razón,
especialmente si también tiene fiebre o se siente más cansado que
de costumbre
• Náuseas, vómitos, dolor estomacal
• Orina de color marrón o de tonalidad oscura
• Se siente más cansado que de costumbre
• La piel o la parte blanca de los ojos se torna amarilla
Dolor de pecho. A veces el dolor de pecho no desaparece o
empeora o puede sufrir un ataque cardiaco. Si esto sucede, llame
al médico o vaya de inmediato a la sala de emergencia.
Los efectos secundarios más comunes de CADUET incluyen:
• dolor de cabeza
• cansancio
• dolor estomacal
• gases
• estreñimiento
• mareos
• somnolencia extrema
• náuseas
• erupción
• diarrea
• hinchazón de las piernas o los tobillos (edema)
• sensación de calor en la cara (ruborización)
• latidos irregulares del corazón (arritmias)
• latidos bien rápidos del corazón (palpitaciones)
• dolor en los músculos y en las articulaciones
Hable con su médico o con su farmacéutico sobre los efectos
secundarios que le molestan o que no desaparecen. Hay otros
efectos secundarios de CADUET. Pida una lista completa a su
médico o a su farmacéutico.
CÓMO TOMAR CADUET
ANTES DE TOMAR CADUET
Háblele a su médico:
• Acerca de todos los medicamentos que está tomando, incluso
medicamentos con y sin receta, las vitaminas y los suplementos
herbáceos.
• Si ha sufrido enfermedades cardiacas
• Si ha tenido dolor o debilidad muscular
• Si toma más de dos bebidas alcohólicas al día
• Si tiene diabetes o problemas de los riñones
• Si ha tenido problemas de la tiroides
INFORMACIÓN SOBRE CADUET
CADUET es un medicamento con receta que combina Norvasc®
(besilato de amlodipina) para tratar la presión arterial alta y Lipitor®
(atorvastatina cálcica) que se usa para disminuir el colesterol elevado,
en una pastilla. CADUET, conjuntamente con dieta y ejercicio, trata
tanto la presión arterial alta (hipertensión) como el colesterol elevado.
CADUET puede disminuir el riesgo de un ataque cardiaco o accidente
cerebrovascular en pacientes con factores de riesgo de enfermedades
cardiacas como: historial familiar de enfermedades cardiacas, presión
arterial alta, HDL-C bajo, diabetes, fumar o ser mayor de 55 años.
CTU00211PR
Qué hacer:
• Tome CADUET una vez al día, exactamente como le indique el médico.
• Intente ingerir alimentos saludable para el corazón mientras toma CADUET.
• Tome CADUET todos los días a cualquier hora del día, con o sin
alimentos.
• Si olvida una dosis, tómela tan pronto se acuerde. Pero si han
transcurrido más de 12 horas desde que olvidó la dosis, espere. Tome la
próxima dosis a la hora establecida.
Qué no hacer:
• No parta las tabletas de CADUET antes de tomarlas.
• No deje de tomar nitroglicerina si la toma para el dolor de pecho (angina).
• No cambie o deje de tomar su dosis sin hablar antes con su médico.
• No comience a tomar medicamentos nuevos o deje de tomar cualquier
medicamento que esté tomando sin antes hablar con su médico.
¿NECESITA MAYOR INFORMACIÓN?
• Pregúntele a su médico, proveedor de servicios de salud o farmacéutico.
Este documento es sólo un resumen de la información más relevante.
• Vaya a www.caduet.com.
CADUET está incluido en el programa de ahorros en
medicamentos con receta “Together RX Access™”,
Para información adicional llame al 1-800-444-4106 o visite
www.TogetherRxAccess.com
Rx únicamente
Fabricado por Pfizer Ireland Pharmaceuticals, Dublin, Irlanda
Distriubido por Pfizer Labs, División de Pfizer, Inc. Nueva York, NY 10017
© 2008 Pfizer, Inc. Todos los derechos reservados. Impreso en los Estados Unidos de Norteamérica.
CTIF Rev. 1, 01.08
ABSTRACT
Background: Adolescence is associated with
risky behaviors related with social and developmental factors. Objectives were to describe social and developmental factors affecting Puerto
Rican early adolescent by gender and type of
school at study entry. Methods: Cross-sectional
study design. The study group was composed by
168 seventh grade adolescents from private and
public schools. Descriptive and non-parametric
comparisons were performed. Results: Significance differences among proportions for gender
by type of school were found in the following variables: self-esteem and HIV/AIDS attitudes in
public school and peer pressure and sensation
seeking in private school. Discussion: Our study
revealed that public school adolescents are characterized by males with higher self-esteem and
less attitude for HIV/AIDS, while in private school
the males has more peer pressure and seeking
sensation than females. Future studies could
analyze factors related with changes in developmental factors, this step is important to evaluate
the effectiveness of ASUMA interventions.
Index words: gender, differences, social, developmental, factors, Puerto Rico
Gender Differences
In Social And
Developmental
Factors Affecting
Puerto Rican
Adolescents During
The Early Stage
Wanda I. Figueroa Cosme MD
Christine Miranda MPHE
Diana M. Fernandez EdD
Johanna Maysonet BSHE
Raul O. Ramon MS
From the Retrovirus Research Center, Internal Medicine Department, Universidad Central del Caribe, School of Medicine, Call Box 60-327, Bayamon, PR 00960-6032.
Address reprints requests to: Wanda I. Figueroa Cosme
MD - Universidad Central del Caribe School of Medicine,
PO Box 60-327, Bayamon, PR 00960-6032. Email: wanda.
[email protected]
INTRODUCTION
R
isk taking, sexual debut, experimentation, exploration, impulsiveness, and a sense of invulnerability
are experience during adolescence. (1) Teenagers are
a high risk group because they are in search of their
sexual identity. Adolescents are influenced by peer
pressure and feel invulnerable because they cannot
foresee long-term consequences. (1) They are more
likely to engage in high risk behaviors, such as drugs
and alcohol and as a result, they are more vulnerable
to sexual transmitted infections (STIs), including HIV.
Developmental factors including cognitive immaturity, struggle for psychological autonomy, peer influences, physical development, undefined sexual identity,
and cultural and ethnic identity issues may enhance
adolescent’s propensity for HIV risk behavior. (2)
The Youth Risk Behavior Surveillance System
(YRBSS) is conducted every two years and provides
data representative of ninth through twelfth grade students in public and private schools throughout the United States (U.S.) and dependent territories. (3) Last
data available that includes Puerto Rico was collected
in 2005. A comparison between U.S. and Puerto Rico
(P.R.) related to alcohol use, tobacco use and sexual
intercourse among ninth grade adolescents for the first
time before the age of 13 revealed the following: 6.2%
of U.S. adolescents and 7.0% of P.R. adolescents had
sexual intercourse; 54.3% of U.S. adolescents and
36.3% of P.R. adolescents have tried cigarette smoking; 25.6% of U.S. adolescents and 26.7% of P.R.
adolescents drank alcohol and 8.7% of U.S. adoles-
cents and 3.9% of P.R. adolescents tried marihuana.
(3) This data revealed that cigarette smoking, alcohol
use, and had sexual intercourse were more frequently
reported in males than females for both, U.S. and P.R.
(3)
Recent research indicates that despite prevention efforts, adolescents are still engaging in sexual
practices at early ages. Early sexual activity in adolescence is also associated with participation in other
risky behaviors such as alcohol and illicit drug use.
(4) Malow et al (2004) stated that adolescent exhibits
high levels of sexual impulsivity and curiosity; engage
in sexual activities often unprotected, and lack of adequate knowledge, motivation, and skills to implement
safer sex behaviors. If an adolescents experiment with
drugs or alcohol before they engage in sexual activity;
lack of judgment and impulse control and a tendency to
underestimate the risk of acquiring HIV can result. (2)
Moscoso et al (2004) conducted a study with
a representative sample of public and private junior
school students during 2003-2004 that explored risky
behavior in P.R. (5) The most common risky behavior
among early-adolescents in seventh grade was alcohol use (43.7%) at any time in their lives. Among those,
18.7% reported alcohol use during the last month. Cigarette smoking was reported in 13.2% of seventh graders. Also, the use of marihuana and inhalants were
reported (4.6% vs. 3.1%; respectively) by the students
at any time in their lives. Cigarette smoking (9.3% vs.
35
6.2%), alcohol use (33.7% vs. 29.0%), and illicit drug
use (7.9% vs. 5.0%) were more frequently reported in
seventh grader males than in females. (5)
Baez et al (2008) conducted study in Puerto Rico related to early initiation of injection drug use
(IDU) before 13 years old in a cohort of HIV patients.
They reported that early injection drug users were
more likely to have a history of smoking tobacco, use
of alcohol, suicide attempts, and incarceration. (6) As
previously published, HIV risk behavior (alcohol use,
drugs use and/or sexual intercourse) was measured
among early-adolescents in ASUMA project at study
entry; none of them reported illicit drug use, 26.3% reported alcohol use at any point in their lives and 1.2%
reported sexual intercourse at any time in their lives.
(7)
Figure 1. ASUMA theoretical framework developed by Dr. Diana
M. Fernandez-Santos and Dr.
Wanda I. Figueroa-Cosme.
Several researchers have studied the difference
between risk-protection approach and applied developmental factors. (8) Protective factors are conceptualized as characteristics or processes that decrease the
likelihood of negative developmental outcomes, whereas developmental factors are conceptualized as characteristics or process that increase the likelihood of positive developmental outcomes. (8) A Supportive Model
for HIV Risk Reduction in Early Adolescent (ASUMA)
developed by Dr. Diana M. Fernandez-Santos and Dr.
Wanda I. Figueroa-Cosme is a theoretical intervention
developed to modify HIV risk behaviors among Puerto
Rican early-adolescents. (Figure 1) The theoretical framework that supports this study explains that HIV risk
behaviors among early-adolescents can be decrease
by increasing parent support, and self-efficacy. Conversely, a decrease in sensation seeking has to occur.
An increase in HIV/AIDS knowledge and
positive attitudes towards HIV/AIDS among
early-adolescents are a result of a decrease in invulnerability. Self- esteem among
early-adolescents is increase by a decrease in negative peer pressure. Researches
indicate that the more factors adolescents’
posses, the less likely they were to have
engaged in risky behaviors and the more
likely to demonstrate positive behaviors.
(9)
HIV infection is associated with
a lack of HIV/AIDS knowledge. Attitudes
towards HIV infection is often the denial of
any chance of infection and belief of invulnerability among adolescents. (10) Also, it is
known that without appropriate knowledge
a change in attitude cannot be achieved.
As cited by Akpabio et al (2009) according to Asuquo et al, it appears that developing a positive attitude toward sexual
health or HIV/AIDS preventive measures
could produce tangible desirable behavioral changes in HIV/AIDS risk behavior.
(11) They stay even when adolescents
appreciate the risks of HIV/AIDS; many of
them believe that they are not vulnerable.
(12)
36
Invulnerability is define as the property of being
incapable of being hurt or damage physically or emotionally. Morojele (2006) found that sexual risk behaviors
results from the limited power in sexual relationship
among girls and having multiple partners is related to
boy’s perceived invulnerability to HV infection. Alcohol
as well drugs was considered to exacerbate underlying
invulnerabilities to risky sexual behavior mainly due to
drug’s effects on adolescents’ inhibition, rational thinking and safer sex negotiation skills. (13)
Peer pressure can positively or negatively contribute to adolescent risky sexual behaviors. According to DiClemente, adolescents’ perception about the
sexual behaviors of their peers can have a greater influence on his/her decision about sex. (1) In addition,
positive peer pressure is related to a delay in sexual
initiation, and increase in condom use and with smoking cessation. (14)
DiClemente suggested that adolescents that
perceived positive family support, family closeness,
parental monitoring and parent- adolescent communication are less likely to perform risky sexual behaviors.
(1) Moreover, a study conducted in Puerto Rico by
Robles (2007) found that adolescents whose parents
reported poor or little communication, monitoring, or
control over their children were almost three times
more likely to engage in early sexual activity. (15)
Self-esteem has proven to be a predictor of risk
behaviors (e.g. smoking initiation and alcohol use) in
adolescents and adults which predispose them to poor
physical health. (16) A nationally representative longitudinal study characterized self-esteem among male
and female adolescents. Researchers found that boys
were more likely than girls to report high self-esteem
in all grades (8th, 10th and 12th) (p < 0.001). (16) In
grade 8, 39.2% of boys versus 27.4% of girls reported
high self-esteem. Factors common to both boys and
girls included positive family communication, and baseline self-esteem. (16) An adolescent with low selfesteem can be more expose to peer pressure than an
adolescent with adequate self-esteem. A longitudinal
study followed over two years period was conducted
with seventh grade students reveled that boys with higher self-esteem were 2.4 times more likely to initiate
intercourse, while girls with higher self-esteem were
more likely to remain virgin than those with lower selfesteem who were 3 times more likely to initiate intercourse. (17)
Zuckerman (1994) suggested that sensation
seeking is a personality trait defined by the need for
novel, complex, intense, and ambiguous experiences
and the willingness to take risks to obtain such experiences. (18) Sensation seeking has been found to be
a strong positive predictor of smoking, alcohol use, and
drug use, and other risky health behaviors. According
to Zuckerman (1994) males are higher in sensation
seeking than females. (18) He also explained that older adolescents are higher in sensation seeking than
younger adolescents.
Experimentation is a normal part of adolescent’s
development; unfortunately this stage of their developAsociación Médica de Puerto Rico
ment put them at risk for a number of health risks, including HIV/AIDS. Adolescents are continuously struggling about being independent; they pursue the development of their own identity, opinions and values. (19)
Prevention efforts could be directed to impact factors
related with HIV risk behaviors in late stages of adolescence.
Given this consideration, it is necessary to describe and analyze the social and developmental factors
that contribute to a latter exposure to risky behaviors
among early-adolescents. The study objectives are
1) to describe social and developmental factors affecting Puerto Rican early-adolescents at study entry; 2)
to describe social and developmental factors affecting
Puerto Rican early-adolescents by gender and type of
school at study entry; and 3) to identify gender differences in social and developmental factors affecting Puerto Rican early-adolescents by type of school at study
entry.
ASUMA was a longitudinal cohort study conducted between August 2004 and May 2008 in four
conveniently selected junior schools located in Bayamon and Guaynabo, Puerto Rico. The four schools
were randomly assigned to the intervention or control
group (one public school and one private school in
each group). (20) A total of 224 seventh graders were
invited to participate; an informed consent was completed by the parents or legal guardians and an assent was completed by the students. A sample of 173
seventh grader students was obtained. Students were
followed until they reached ninth grade. This is a crosssectional study of a longitudinal cohort comprised of
168 students in seventh grade from public and privates
schools in Puerto Rico that completed the first measurement of ASUMA.
A self-administered questionnaire was developed and validated in terms of face and content validity and construct validity. The minimal acceptable
level of internal consistency reliability is 0.70. A good
internal consistency was obtained from developmental factors scales as followed: self esteem (Cronbach
α =0.60), peer pressure (Cronbach α =0.66), invulnerability (Cronbach α=0.46), parent support (Cronbach
α=0.62), sensation seeking (Cronbach α=0.77), HIV/
AIDS knowledge (Cronbach α=0.86) and HIV/AIDS attitudes (Cronbach α=0.70). (7) The final questionnaire
was approved by the Institutional Review Board at the
Universidad Central del Caribe.
The curriculum design used pragmatic strategies to facilitate the process of active learning. (7) The
intervention considered the cultural aspects of the target population; it included coping skill strategies. A total
of eight workshops were conducted: 4 workshops in the
first implementation year, 2 in the second year and 2 in
the third year. The workshop topics of the first 2 years
were designed to affect developmental and HIV risk related factors, whereas the focus on the last year was
designed to reinforce previous messages and behaviors. (7, 20) Also a parent support workshop was given
37
to 35 parents of the intervention group. The parents curriculum was adapted from program “Taking with kids
about AIDS” from Cornell University (21). A 4-hour workshop adaptation that included effective communication skills with kids, HIV knowledge and attitudes was
given. Participants were provided with snacks and a
certificate for completing the workshops. A pragmatic
approach was used to develop the methods and activities for the first workshop activities included group
discussion, audiovisual aids, debates, brainstorming,
patient testimony, reflection, and critical thinking. The
control group did not attend the workshop but received
written HIV/AIDS educational material. (7, 20)
We examined several variables in this study:
type of school (public/ private); sociodemographic
(age, sex, parents living together (yes/no), parent’s
highest level of education (high school or less/more
than high school), adolescents’ academic high performance (includes all students with A’s and B’s) (yes/no);
and developmental factors (self esteem [Rosenberg
Self-esteem Scale], HIV/AIDS knowledge [Paniagua et
al HIV/AIDS Knowledge Scale] (22), self-efficacy, peer
pressure, invulnerability, parent support, sensation
seeking [Zuckerman Sensation Seeking Scale adapted by Goma` I Freixanet et al]. (23)
Statistical analysis was done using descriptive (frequencies and percentages) and nonparametric
comparisons (using Mann–Whitney U test). The statistical software used was SPSS 14.0. The overall significance level was set to p<0.05.
RESULTS
fathers with highest education level by gender in both
public and private school was observed. A comparison
between mothers and fathers in both type of schools;
revealed that parents of adolescents in private school
have higher educational level. Academic high performance in the public school was higher in females than
in males (77.1% vs. 22.9%). Mean rank differences in
academic high performance were observed among females and males in the public school (p<0.05). Gender
differences in developmental factors affecting Puerto
Rican early-adolescents by type schools at study entry
are presented in table II. Mean rank differences between by gender and type of school were observed.
Significant differences in self-esteem (41.6 females vs.
53.0 males; p<0.05), and HIV/AIDS attitudes (51.6 female vs. 39.8 male; p<0.05) by adolescent’s gender in
public schools were observed. Also significant differences in mean rank comparisons in private schools by
gender were found in peer pressure (31.2 females 43.6
males; p<0.05) and sensation seeking (30.1 females
vs. 44.3 males; p<0.05).
DISCUSSION
Several differences in the social and developmental factors affecting Puerto Rican early-adolescents
were presented. ASUMA is an intervention based on a
theoretical framework that proposed an explanation of
why early-adolescents engage in risky behaviors related to HIV infection (e.g. drug use, alcohol use and
sexual intercourse). Early-adolescents are more likely
to engage in risk behavior, which makes them more
vulnerable to HIV infection. Addressing behavior factors related with risky behaviors at earlier age has proven to be effective in modifying these behaviors and
ultimately preventing diseases. Also the development
A total of 168 early-adolescents in seventh grade in public (n=
92; 54.8%) and private (n=76; 45.2%)
schools participated in the first measurement of ASUMA. From those 50.6%
were male and 49.4% were female.
Most of the adolescents were 12 years
old at study entry (79.0%); followed
by 11 years old (12.7%); 13 years old
(7.0%) and 14 years old (1.3%). Figure
2 show gender differences by school
type.
In table I, gender differences in
social factors affecting Puerto Rican
early-adolescents by types of school
at study entry are presented. A significant difference was found in gender
composition by type of school; 56.5%
females in public schools vs. 40.8%
females in private schools and 43.5%
males in public schools vs. 59.2% males in private schools (p<0.05). Significant differences were observed
related to the parents living together
variable in the private schools by the
adolescent’s gender (p<0.05). Different percentage among mothers and
38
Figure 2. Gender differences among Puerto Rican early-adolescents
by types of school at study entry: ASUMA Project
and implementation of culturally appropriate instruments and interventions are a key element in disease
prevention for a specific population.
As previously published, a low percentage of
early-adolescents reported any HIV risk behaviors. (7)
Nevertheless, alcohol use is a major risk factor that
is particularly related to our culture. Alcohol use may
reduce inhibitions and impair decision making putting
adolescents at risk for HIV. In Moscoso et al (2004),
alcohol use was reported by 43.7% seventh graders
Table I. Gender differences in social factors affecting
Puerto Rican early-adolescents by types of school at
study entry: ASUMA Project
Sociodemographic
factors
at any time in their lives. (5) In Fernandez et al (2008)
alcohol use was the mayor risk behaviors presented in
seventh graders (26.3%) of at any time in their lives. A
similar percentage in alcohol use was documented in
the YRBSS for USA and PR in 2005 (25.6% and 26.7%
respectively).
Significant differences were found among
parent’s marital status in the private schools by the
adolescent’s gender. A larger percent of parents in the
private school live together. In a study conducted in
Puerto Rico, Velez-Pastrana et al (2007) found that
adolescents with both parents living together were less
likely to be sexually active than those adolescents with
only one parent living in the household. (24) As cited in
Public School
Female
Male
p value
Private School
Female
Male
n
n
%
n
%
%
n
p value
%
Parents living together
0.138*
Yes
26
52.0 27
67.5
25
80.6 35
77.8
No
24
48.0 13
32.5
6
19.4 10
22.2
Parents highest
education level
Mother
0.495*
High school or less 13
33.3 8
25.8
2
8.0
0
0
More than high
26
66.7 23
74.2
23
92.0 31
100
school
Father
0.755*
High school or less 16
48.5 12
44.4
2
7.7
1
3.4
More than high
17
51.5 15
55.6
24
92.3 28
96.6
school
Academic High
0.001*
Performance
Yes
27
77.1 10
37.0
16
66.7 25
67.6
No
8
22.9 17
63.0
8
33.3 12
32.4
0.010*
0.195**
0.598**
0.942*
*Pearson Chi-square
** Fisher’s Exact Test
Table II. Gender differences in developmental factors affecting Puerto Rican early-adolescents by type
schools at study entry: ASUMA Project
Developmental
factors
Public School
Female
Male
p value
Private School
Female
Male
p value
n
Mean n
Mean
n
Mean n
Mean
Rank
Rank
Rank
Rank
Communication with 52
45.1 40
48.3 0.502
31
35.8 45
40.4 0.244
Parents
HIV Knowledge
52
47.7 40
45.0 0.625
31
42.7 45
35.6 0.171
Self-esteem
52
41.6 40
53.0 0.034**
31
38.0 45
39.0 0.838
Peer Pressure
52
46.1 40
47.0 0.854
31
31.2 45
43.6 0.009**
Self-efficacy
51
46.8 39
43.7 0.504
30
42.3 45
35.1 0.134
Attitude
52
51.6 40
39.8 0.035**
31
43.1 44
34.4 0.091
Parent Support
52
44.0 40
49.8 0.287
31
33.9 45
41.7 0.124
Invulnerability 52
45.3 40
48.0 0.631 31
33.6 43
40.3 0.185
Sensation Seeking 52
46.0 40
47.2 0.822
31
30.1 45
44.3 0.006**
*Mann Whitney U test
** Significance differences in Mean Rank p≤0.05.
39
Velez-Pastrana, Upchurch et al (1999) suggested that
having both parents in the same household is a factor
associated with the delay of sexual intercourse. Also,
Sokol-Katz (1992) found that Puerto Ricans adolescents living in female-headed households have higher
rates of overall risk-taking behaviors than those living
with both parents. (25)
In addition, parents of adolescents in private
school have higher educational level. In study conducted by Villarruel et al (2008) parents with higher education levels scored higher in HIV knowledge and general communication. Fathers had higher total sexual
knowledge while mothers perceived higher sexual
communication than fathers. (26)
Significant differences were found in gender
composition by type of school. Our study revealed that
public school adolescents are characterized by males with higher self-esteem and less attitude for HIV/
AIDS; while in private school, males have more peer
pressure and seeking sensation than females. According to Shrier et al (2001) and Shier et al (2002) and
Spencer (2002), adolescents with low self-esteem are
more likely to engage in behaviors associated with HIV
transmission. (26)
A higher level of self esteem was found among
males from public schools. Birndorf et al (2005) found
that boys were more likely than girls to report high selfesteem. (16) Peer pressure was higher among males
than female in private schools, but no significant differences were found in public schools. This compare
with Sumter et al (2009) where they stayed that general resistance to peer influence increased during adolescence. In addition, gender differences were most
pronounced during mid-adolescence, when girls were
more resistant to peer influence than boys. (17) Attitude
was higher in females than males from public schools.
We did not found literature that supports these gender differences. Nevertheless, researches have found
that without appropriate knowledge a change in attitude cannot be achieved. (11) Sensation seeking was
significant higher in males than in females from public
school, while no differences were observed among public schools. Significant differences were found in selfesteem and HIV/AIDS attitudes by gender in the public
schools. Finally we could observe a lightly trend to higher developmental factors scores in public schools.
A comparison by gender and type of school was done
to compare differences in developmental factors. No
significant differences were found among gender and
type of groups in HIV/AIDS knowledge, self-efficacy,
invulnerability, and parent support.
ASUMA was developed based on the previously cited developmental factors and HIV risk behaviors that early-adolescent face every day. Successful
programs are delineated by a theoretical framework
and are specifically tailored to a particular subgroup of
a population. (27) According to DiClemente et al (2008)
interventions that focus on self-concept, self-esteem,
and social competency skills are also effective in the
reduction of risky sexual behaviors in adolescents.
(27)
40
Future studies could analyze factors related
with changes in developmental factors by gender and
type of school. This step is important to evaluate the
appropriateness after the implementation of ASUMA
interventions by gender and type of school environment.
A study limitation is that the sample is not probabilistic but it represent early-adolescents enrolled in
both public and privates schools in Puerto Rico.
REFERENCES
1.
Fernandez DM, Gomez MA, Figueroa WI, et al. A comparison of the sociodemographic, risk behavior amd substance abuse
profile of young vs. older HIV infected Puerto Ricans patients. Ethn
Dis. 2005; 15(Suppl 5):S25-S29.
2.
Malow RM, Jean-Giles MM, Dévieux JG, Rosenberg R,
Russell A. Increasing access to preventive health care through
cultural adaptation of effective HIV prevention interventions: A
brief report from HIV prevention in Haitians youths study. ABNF J.
2004;127-132.
3.
Youth Risk Behavior Surveillance —United States, 2005.
MMWR. 2006; 55(SS-5):1-112. Available from: http://www.cdc.gov/
mmwr/PDF/SS/SS5505.pdf
4.
Rose A, Koo HP, Bhaskar B, Anderson K, White G, Jenkins RR. The influence of primary caregivers on the sexual behavior of early adolescents. J Adolesc Health. 2005; 37(2):135-44.
5.
Moscoso MR, Colón HM, Parrilla I, Reyes JC. El uso de
substancias en los escolares puertorriqueños. Consulta Juvenil VI,
2002–2003 al 2003–2004. Administración de Servicios de Salud
Mental y Contra la Adicción y Universidad Central del Caribe. Puerto Rico: 2004; 6–8.
6.
Báez-Feliciano DV, Gómez MA, Fernández-Santos DM,
Quintana R, Ríos-Olivares E, Hunter-Mellado RF. Profile of Puerto
Rican HIV/AIDS Patients with Early and Non-Early Initiation of Injection Drug Use. Ethn Dis. 2008; 18(Suppl 2): S99 - S104.
7.
Fernandez DM, Figueroa WI, Gomez MA. Changes in
developmental factors and HIV risk among HIV/AIDS knowledge
among early adolescents in Puerto Rico. Ethn Dis. 2009, in press.
8.
Schwartz SJ, Patin H, Coatsworth JD, Szapocznik J.
Addressing the challenges and opportunities for today’s youth:
toward an integrative model and its implication for research and
intervention. The Journal of Primary Prevention. 2007;28:117-44.
9.
Bradshaw CP, Southwick-Brown J, Hamilton SF. Applying
positive youth development and life-course research to the
treatment of adolescents involved with the judicial system. Journal
of Addiction and Offender Counseling. 2006;27:2-16.
10.
Mason PJ, Olson RA, Parish KL. AIDS, hemophilia, and
prevention within a comprehensive care program. Am Psychol.
1998; 43(11):971-976.
11.
Spencer JM, Zimet GD, et al. Self-esteem as a predictor
of initiation of coitus in early adolesdcents. Pediatrics. 2002 Apr;
109 (4):581-4.
12.
Akpabio II, Asuzu MC, Fajemilehin BR, Ofi AB. Effects of
school health nursing education interventions on HIV/AIDS-ralated
attitudes of students in Akwa Ibon State, Nigeria. Adolesc Health.
2009 Feb;44(2):118-23. Epub 2008 Oct 18.
13.
Morojele NK, Brook JS, Kachieng'a MA. Perceptions of
sexual risk behaviours and substance abuse among adolescents
in South Africa: a qualitative AIDS Care. 2006 Apr;18(3):215-9.
14.
Morrison DM, Casey EA, Beadnell BA, Hoppe MJ, Rogers M, Wilsdon A. Effects of friendship closeness in an adolescent
group HIV prevention intervention. Prev Sci. 2007;8:274–284.
15.
Robles RR, Matos TD, Reyes JC, Colon HM, Negron
J, Calderon J, Shepard EW. Correlates of early sexual activity
among Hispanic children in middle adolescence. P R Health Sci J.
2007;26:119–126.
16.
Birndorf S, Ryan S, Auinger P, Aten M. High self-esteem
among adolescents: Longitudinal trends, sex differences, and protective factors. Journal of Adolescent Health. 2005; 37 (2005):194–
201.
17.
Sumter SR, Bokhorst CL, Steinberg L, Westenberg PM.
The developmental pattern of resistance to peer influence in adolescence: will the teenager ever be able to resist? J Adolesc. 2009
Aug;32(4):1009-21. Epub 2008 Nov 6.
18.
Zuckerman M. (1994). Behavioral expression and bioso
cial bases of sensation seeking. Massachusetts, Cambridge University Press.
19.
Miller PH. Theories of adolescent development. In Worrell
J & Danner F (Eds). The adolescent as decision-maker. San Diego,
Academic Press. 1989; 13-46.
20.
Fernandez DM, Figueroa WI, Gomez MA, Maysonet J,
Rios Olivares E, Hunter F. Changes among HIV/AIDS knowledge
among early adolescents in Puerto Rico. Ethn Dis. 2008; 18(Suppl
2):S146-S150.
21.
Tiffany J, Tobias D, Raqib A, Ziegler J. Talking with Kids
about AIDS: A Program for Parents and Other Adults Who Care Department of Human Services Studies, Cornell Cooperative Extension, Cornell University. Available at: http://www.twkaha.org/. Last
accessed: Nov 2, 2009.
22.
Paniagua FA, O’Boyle MD, Wagner KD. The assessment
of HIV/AIDS knowledge, attitudes, self-efficacy and susceptibility
among psychiatrically hospitalized adolescents. J HIV AIDS Prev
Educ Adolesc Child. 1997; 1:65–104.
23.
Goma` I Freixanet M, Puyane I Grau P. Personalidad en
alpinistas vs. otros grupos que practican actividades relacionadas
con la montaña. Psicothema. 1991; 3:73–78.
24.
Vélez-Pastrana MC, González-Rodríguez RA, BorgesHernández A. Family functioning and early onset of sexual intercourse in Latino adolescents. Adolescence. 2005; 40, 160: 777791.
25.
Sokol-Katz JS, Uibrich PM. Family structure and adolescent risk-taking behavior: a comparison of Mexican, Cuban, and
Puerto Rican Americans. Int J Addict. 1992 Oct.27(10):1197-209.
26.
Gallegos EC, Villarruel AM, Gómez MV, Onofre DJ, Zhou
Y. Research brief: sexual communication and knowledge among
Mexican parents and their adolescent children. J Assoc Nurses
AIDS Care. 2007 Mar-Apr;18(2):28-34.
27.
DiClemente RJ, Crittenden CP, Rose E, et al. Psychological predictors of HIV-associated sexual behaviors and the efficacy
of prevention interventions in adolescents at risk for HIV infection:
What works and what doesn’t work? Psychosom Med. 2008; 70:5:
598–605.
ACKNOWLEDGMENTS
This study was supported by Grant Number
2G12RR03035 from National Center for Health Resources (NCRR) a component of National Institute of
Health.
RESUMEN
Antecedentes. Los factores de desarrollo
y sociales afectan las conductas de riesgo en los
adolescentes. Objetivo: describir los factores sociales y de desarrollo que afectan a los adolescentes puertorriqueños por género y tipo de escuela
al inicio del estudio. Metodología. Estudio transversal con 168 adolescentes de séptimo grado de
escuelas privadas y públicas. Se realizó una comparación descriptiva y no-paramétrica. Resultados.
Diferencias significativas entre género y tipo de escuela: en autoestima y actitudes hacia el VIH/SIDA
en escuela pública; presión de grupo y búsqueda
de sensaciones en escuela privada. Discusión. Los
adolescentes de escuela pública poseen una alta
autoestima y menos actitudes positivas hacia el
VIH/SIDA. Los varones de escuela privada tienen
mayor presión de grupo y búsqueda de sensaciones que las adolescentes. En futuros estudios se
pueden analizar factores relacionados con cambios
en factores de desarrollo, este paso es importante
para evaluar la efectividad del proyecto ASUMA.
Corporación de Servicios
Tecnológicos para la Medicina, corp
H.I.T.
Creada por la Asociacón Médica de Puerto Rico para servir a los
profesionales de salud en todo lo relacionado con Tecnología Informática
de Salud (HIT)
Registros Electrónicos de Salud (eHr)
Receta Electrónica (eRx)
Billing, Schedule, etc.
www.cstmpr.net
Acredite su actividad
de Educacion Continua en el
ACCME y TEM
con nuestro
Instituto de Educación Médica
Continua
(787) 721-6969
CONTINUE IN PAGE 46
ABSTRACT
Objectives: We describe the changes in
the socio demographic, risk behavior, immunological and clinical trends profiles of
a cohort HIV patients followed at the Retrovirus Research Center, at baseline and
study periods interval by periods intervals:
1992-1997, 1998-2003, and 2004-2008.
Methods: This is a cross-sectional study
of a longitudinal cohort comprised of 4016
HIV/AIDS patients admitted to the RRC since January 1992. Data collected include
socio-demographic variables; risk related
variables; psychological variables; and clinical variable by periods of study. Results.
The most common AIDS defining conditions
observed in patients were: Pneumocistis
Cariini pneumonia (PCP), toxoplasmosis
of brain (TP), and wasting syndrome (WS).
Chronic conditions are more prevalent than
AIDS-defining conditions in the cohort of patients. Conclusions: Understanding the socio demographic, HIV risk behavior profile;
and the immunological and clinical trends
among HIV patients is critical for redesigning services and programs oriented in HIV
patient care.
Index words: socio-demographic, risk, clinical, immunological, profile, HIV/AIDS, patients, Puerto Rico
INTRODUCTION
T
he prevalence of the most critical cli
nical presentations associated to the Acquired
Immunodeficiency Syndrome (AIDS) infection
has decreased over the last 20 years (1). The
fundamental explanation for this change in the
epidemiology of the HIV infection from an oftenlethal disease to a highly treatable chronic condition can be attributed almost exclusively to the
availability of antiretroviral therapy (2). Despite
improvements in the therapeutic index for HIV
infection, the persistence of racial and ethnic disparities are still evident which result in disparities
in the access of effective HIV therapy and as a
consequence an increase in the rate of new infections in this part of society (3). Similar to other
infectious processes the success of prevention
and treatment efforts will depend on the accurate
and complete identification of the infected population as well as those at high risk for acquiring
the infection. The collection, analysis, and interpretation of surveillance data remain critical for
keeping abreast of the evolving nature of the epidemic (4-5).
Hariri & McKenna have indicated that the
first decade of the HIV epidemic was characterized
Changes In The
Socio-Demographics,
Risk Behaviors,
Clinical And
Immunological
Profile Of A Cohort Of
The Puerto Rican
Population Living
With Hiv: An Update
Of The Retrovirus
Research Center
(1992-2008)
Christine Miranda MPHE
Diana M. Fernandez EdD
Geronimo Maldonado MPH
Raul O. Ramon MS
Miriam Velázquez MS
Angel M. Mayor MD
Robert F. Hunter-Mellado, MD
From the Retrovirus Research Center and the Internal Medicine
Department, Universidad Central del Caribe, School of Medicine,
Call Box 60-327, Bayamon, PR 00960-6032
Address reprints requests to: Christine Miranda, MPHE - Retrovirus Research Center, Internal Medicine Department, Universidad
Central del Caribe, School of Medicine, Call Box 60-327, Bayamon, PR 00960-6032. Email: [email protected]
by an increase in the incidence of AIDS cases as a direct
consequence of improved diagnostic and therapeutic milestones that facilitated the process of identifying and monitoring the clinical manifestations of the infection (6). In 1993,
AIDS was the eighth leading cause of death in men and
women aged 25 to 44 years, and accounted for 2% of all
deaths in the United States (U.S.) (7). The numbers of reported AIDS cases and deaths in the United States declined
between 1995 and 1998 with rates of 28%, 45%, and 18%
each year, remaining relatively stable, at approximately
40,000 infections each year up until 2004 (8). This decline
has been explained by the widespread use of improved antiretroviral therapy in the mid-1990s (9); the increased use of
prophylaxis for opportunistic infections; and primary prevention interventions (10). In the early years of the epidemic,
HIV/AIDS was characterized as a disease of white men who
had sex with men (MSM) (8). Twenty percent of cases were
related to injection drug use, while heterosexuals and females from all transmission categories accounted for about 5%
and 8% of all reported cases, respectively (11).
45
According to the mandatory HIV reporting system, Puerto Rico had the second highest rate of HIV
infection among 33 U.S. states and 5 territories in
2006 (12). For that same year, the incidence rate of
HIV was 45.0 cases per 100,000 population in Puerto
Rico which was twice the rate for the 50 U.S. states
and District of Columbia (DC) (22.8 per 100,000) and
1.5 times the estimated rate for Hispanics in the U.S.
(29.4 per 100,000) (12). According to the CDC, the incidence rate among males in Puerto Rico was 1.8 times
the rate among U.S. males (34.3 per 100,000) and 1.4
times the rate among U.S. Hispanic males (43.1 per
100,000). In addition, the incidence rate among females in Puerto Rico was 2.5 times the rate among U.S.
females (11.9 per 100,000) and 2.0 times the rate in
U.S. Hispanic females (14.4 per 100,000). The overall
incidence of HIV was twice as high in males than in
females (62.0 vs. 29.8 per 100,000). In 2006, Puerto
Ricans aged 30-39 years accounted for 38% of new
HIV infections; with 39% of new infections associated
to illicit-drug injection risk behavior, 37% associated
to high-risk heterosexual contact, and 24% to maleto-male sexual contact (12). In the continental United
States, male-to-male sexual contact represented 72%
of new infections among males, including 72% among
Hispanics living in the US. Among U.S. females, highrisk heterosexual contact was the predominant transmission category (80%) (12).
The number of people living with HIV worldwide
continued to grow in 2008, reaching an estimated 33.4
million which was more than 20% higher than in the
year 2000 (13). In 2008, an estimated 2.7 million new
HIV infections were reported and an estimated death
of 2 million individuals death due to AIDS-related illnesses (13).
In the Caribbean HIV/AIDS claimed an estimated 12,000 lives in 2008 making HIV one of the leading
causes of mortality amongst adults between 15-44
years. A total of 240,000 individuals are currently living
with HIV in this region, which represents the second
highest level of adult HIV prevalence in the world (13).
In 2008, 20,000 newly infected patients were estimated to have occurred in this region with unprotected heterosexual intercourse as the main risk factor. Although
national adult HIV prevalence has been stabilized in
several Caribbean countries, AIDS still remains one of
the leading causes of death among people between 25
to 44 years old. In the Caribbean, women account for
approximately half of all HIV infections with a prevalence particularly elevated among adolescent and young
women, who tend to have infection rates significantly
higher than males of their own age (13).
As of April 30, 2009, the Puerto Rico AIDS Surveillance Program has reported a cumulative total of
33,373 AIDS (including HIV diagnosis) cases (14). In
males, 87.0% were aged between 25 to 54 years old at
diagnosis with females representing 24.5% of all AIDS
cases (14). The main modes of transmission for males was injection drug use (53.0%) followed by male
to male sexual contact (22.0%). In females, the most
common modes of transmission were heterosexual
contact (62.0%) and illicit-drug injection (36.0%).
46
Since the establishment of mandatory HIV case reporting on April 2003, a total of 7,548 new HIV cases have
been reported as of April 2009. Of these 33.0% were
female and 67.0% were males. In the cohort of 25 to
44 years old the mean age at HIV diagnosis was similar in males and females (64.0% vs. 60.0%). The most
common modes of transmission for new infections were
similar to those reported with AIDS; illicit-drug injection
and male to male sexual contact for males (44.0% vs.
22.0%) and heterosexual contact and illicit-drug injection for females (63.0% vs. 24.0%) (14).
The Retrovirus Research Center (RRC) is located in the Bayamon Health Region of the Commonwealth of Puerto Rico. This health region is composed by 11 municipalities which include: Barranquitas,
Comerio, Corozal, Naranjito, Orocovis, Bayamon, Toa
Alta, Vega Alta, Cataño, Dorado, and Toa Baja. In 2008,
the Bayamon Health Region population was estimated
at 642,516 inhabitants (15). This corresponds to 16.2%
of the estimated population of Puerto Rico. As of april
2009 a total of 5,630 cumulative AIDS cases had been
reported in this health region, supersded only by San
Juan with 7,840 cumulative AIDS cases (14).
The RRC is a multidisciplinary research center for the study of HIV/AIDS, which has been operating since 1992. It has grown and has become more
efficient in integrating the resources and capabilities
of the investigators interested in HIV research within
and external to our institution. The goal of the RRC is
to promote and stimulate the study of HIV infection as
a multidisciplinary research arena that incorporates
the clinical features of the infection including the immunological, virological, psychological and behavioral
variables relevant to the study of this disease. The longitudinal nature of the HIV/AIDS database of our Center allow studies on factors which influence survival
and mortality including medication compliance, health
care access, and changing patterns of risk behavior
amongst our predominantly Hispanic cohort. The RRC
works closely with the Data Management and Statistical Research Support Unit (DMSRSU) who helps in the
integration of the variables of the databank, the quality
control process, implementation of analytical strategies
and appropriate study methodology. The HIV Registry
had over 4,000 registered patients between 1992 and
2009.
The objectives of this research paper are to: 1)
describe the sociodemographic, HIV risk behavior, immunological and clinical profile of HIV/AIDS patients
who have enrolled in the Registry, 2) report on variables through three defined periods of time 1992-1997,
1998- 2003, and 2004-2008, and 3) assess changes in
the clinical and laboratory presentation of our patients
in the pre HAART and post HAART era.
RESEARCH DESIGN AND METHODS
Methods
This is a cross-sectional study of a longitudinal
cohort comprised of a non-probabilistic sample of 4016
HIV/AIDS patients admitted to the RRC since January
1992. Patients who arrive to our inpatient or outpatient
HIV health care facilities are invited to participate in
the registry. Prior to enrollment an informed consent is
discussed and signed. An initial interview and a comprehensive evaluation of relevant variables pertaining
to the HIV diagnoses are administered to all patients
that agree to participate. Medical record abstraction
is performed to complement the interview information.
The methods for data collection have been described
previously (16).
Measurement Instruments
2003; and Period 3: 2004-2008. These periods were
selected since the first period includes patients four
years before the introduction of HAART and one year
after its implementation (1992-1997), the second period represents the implementation phase of HAART
therapy (1998-2003), and the third interval is one in
which HAART was generally available (2004-2008). A
descriptive analysis using frequencies and percents
was performed to describe the changes in interested
variables in these time frames. Differences among
proportions were assessed using Pearson Chi-square
distribution statistics and Fisher’s exact test (for cell
counts less than 5% of the total sample). The significance level was set in a p < 0.05. The Statistical Package for the Social Sciences (SPSS) version 14 was
used to analyze the data (17).
The HIV Registry Initial and Follow-up Questionnaire (interview and data abstraction) were created
by researchers of the RRC and have been in use since
1992. New modules and new variables are continually
assessed and incorporated in both instruments as the RESULTS
knowledge base of HIV increases. The HIV Registry
initial questionnaire currently includes a total of 336 Socio-demographic characteristics
variables. The data collected includes socio-demographic variables (e.g. age, gender, education, em- From January 1992 to December 2008, 4016
ployment status, civil status, and housing); risk related patients have agreed to participate in the RRC and
variables (e.g. sexual risk practices and drug, tobacco were included in this analysis. The majority of patients
and alcohol use profiles); clinical variables (e.g. medi- were found to belong to the first period (56.0%), 27.0%
cal history, the presence of AIDS defining conditions, to the second period, and 17.0% to the third period.
the presences of other conditions or other non-AIDS
opportunistic infections, the presence of constitutional Table I shows an outline of the socio demograsigns and symptoms); therapeutic variables (e.g. the- phic profile of our patients across the three periods of
rapeutic and prophylactic drugs related to AIDS con- time. In all three time frames most of our participants
ditions); and laboratory data (e.g. immunological and were male (74.9%, 67.8% and 67.3%), with 70.8%,
hematological parameters) (16). Complementary ins- 77.2% and 75.8% having between 31 and 54 years of
truments are also used in our patients and kept as a age. Educational status of at least a 12 grade education
separate databank. These include the Adult Spec- Table I. Sociodemographic characteristics of Puerto Rican HIV/AIDS patients
trum of Disease (ASD) at the RRC by periods of study.
Questionnaire that was
1992-1997 1998-2003 2004-2008 p (value)
created by the Centers for n
%
n
%
n
%
Disease Control and Pre- Variable
0.001*, 0.001**
vention, the health dis- Gender
parity questionnaire and Female
570 25.1 348 32.2 219 32.7
the mortality evaluation Male
1697 74.9 732 67.8 450 67.3
instrument. Follow-up in- Age
0.001*, 0.001**
terviews are scheduled at ≤30
568 25.1 179 16.6 104 15.5
six-month intervals after 31-54
1606 70.8 834 77.2 507 75.8
the initial visit.
≥55
93
4.1
67
6.2
58
8.7
Employment
status
0.001*, 0.001**
Variables
Non-Employee
1625 82.6 849 80.5 479 71.8
342 17.4 206 19.5 188 28.2
Highly
active Employee
0.001*, 0.001**
antiretroviral
therapy Education
(HAART) in Puerto Rico Less than 12th grade 721 36.8 260 25.5 205 30.8
became available in 1996; 12th grade or higher 1236 63.2 772 74.8 461 62.9
coinciding with the intro- Partner status
0.593*, 0.309**
duction of Puerto Rico’s No
1466 71.2 741 70.1 461 69.3
last major health reform Yes
592 28.8 316 29.9 204 30.7
movement (18). For the Familiy status
0.345*, 0.183**
purpose of this article, we No
364 32.4 371 34.9 235 35.2
have grouped the repor761 67.6 693 65.1 433 64.8
ted patients population Yes
Children
status
0.002*, 0.025**
according to the year of
825 42.1 358 35.5 259 39.1
entry to the registry. Study No
1135 57.9 651 64.5 404 60.9
periods were defined as Yes
follows: Period 1; 19921997; Period 2: 1998- * Pearson Chi-square, **Pearson Chi-square for linear trends
47
was 63.2%, 74.8% and 69.2% respectively with most
patients reported being unemployed with a decreased
prevalence during the last period (82.6%, 80.5% and
71.2%), the majority of patients reported not having a
current partner (71.2%, 70.1% and 69.3%), the majority lived with family members (67.6%, 65.1% and
64.8%) and reported having children (57.9%, 64.5%
and 60.9%). Significant differences across the years
was seen in the following variables: female gender
(25.1%, 32.2% and 32.7%, respectively), and patients
55 years old or more (4.1%, 6.2% and 8.7%, respectively). Significant differences were seen also seen in
the employment status, education, and the variable of
having children.
HIV risk behavior profile
Table II describes our data as it pertains to the
risk behavior profile of HIV/AIDS patients since the inception of the RRC. Studies of proportion showed little
differences in heterosexual sex as risk factor for HIV
infection (84.2%, 84.0% and 85.8%). A significant increase in homosexual relationship as risk factor was
seen (13.2%, 13.5% and 23.1%, respectively), increased in psychoactive drug use (29.2%, 27.8%, and
32.3%), increase in the proportion of patients reporting
amphetamines use (10.6%, 18.9% and 27.8%), crack
use (27.8%, 23.5% and 28.8%), and cannabis use
(44.3%, 41.3% and 49.5%) was seen. A decrease in
illicit-drug injection (60.9%, 44.1% and 32.8 %), heroin
use (57.1%, 47.0% and 35.6%), cocaine use (58.7%,
55.6% and 51.4%), and the mix of heroin and cocaine
(speedball 32.9%, 39.3% and 31.5%) was observed
between period 1 to period 3. In addition, a decrease
in tobacco use (82.1%, 73.4% and 74.0%) and alcohol
use (56.9%, 46.4% and 55.5%) was observed among
period 1 and 3. Significant differences were seen
across the three periods of years in the following variables (p < 0.05): tobacco use, alcohol use, intravenous
drug use, heroin, cocaine, speedball, amphetamines,
crack, cannabis and homosexual practices.
Table II. HIV risk behavior profile of Puerto Rican HIV/AIDS patients at the RRC
by periods of study.
1992-1997 1998-2003 2004-2008
Variable
n
%
n
%
n
%
Tobacco use
No
183 17.9 278 26.6 174 26.0
Yes
838 82.1 767 73.4 494 74.0
Alcohol use
No
413 43.1 557 53.6 297 44.5
Yes
546 56.9 483 46.4 370 55.5
Psychoactive drug use
No
496 70.8 728 72.2 450 67.7
Yes
205 29.2 280 27.8 215 32.3
IV drug use
No
868 39.1 595 55.9 449 67.2
Yes
1352 60.9 470 44.1 219 32.8
Heroin use
No
897 42.9 563 53.0 430 64.4
Yes
1194 57.1 499 47.0 238 35.6
Cocaine use
No
860 41.3 471 44.4 324 48.6
Yes
1222 58.7 589 55.6 343 51.4
Heroin & cocaine use
No
1262 67.1 626 60.7 457 68.5
Yes
618 32.9 405 39.3 210 31.5
Amphetamines use
No
1650 89.4 834 81.1 480 72.2
Yes
196 10.6 194 18.9 185 27.8
Crack use
No
614 72.2 789 76.5 474 71.2
Yes
236 27.8 242 23.5 192 28.8
Cannabis use
No
474 55.7 609 58.7 336 50.5
Yes
377 44.3 429 41.3 329 49.5
Heterosexual relationship
No
337 15.8 167 16.0 95
14.2
Yes
1795 84.2 875 84.0 575 85.8
Homosexual relationship*
No
1712 86.8 881 86.5 512 76.9
Yes
261 13.2 137 13.5 154 23.1
* Pearson Chi-square, **Pearson Chi-square for linear trends
48
p (value)
0.001*, 0.001**
0.001*, 0.254**
0.134*, 0.221**
0.001*, 0.001**
0.001*, 0.001**
0.003*, 0.001**
0.001*, 0.649**
0.001*, 0.001**
0.025*, 0.797**
0.004*, 0.072**
0.564*, 0.431**
0.001*, 0.001**
Clinical and Immunological profile
Table III shows
the clinical, immunological and treatment
profile of RRC HIV/
AIDS patients at the
three periods of time. At
study entry, the proportion of patients with HIV
(non-AIDS)
infection
was 51.5%, 46.5% and
50.7%, with the proportion of patients with
CD4 cells count greater
than 200 cells count/
µL being 50.0%, 53.3%
and 59.1%. No history
of antiretroviral therapy was seen in 97.7%,
65.0% and 79.1% of
patients. The proportion
of patients with immunologic AIDS was seen
to be gradually increasing between Period
1 to Period 3 (20.6%,
34.5% and 43.3%, respectively). Conversely,
a decrease in patients
with clinical AIDS diagnosis was evident with
27.9%, 19.0% and
6.0%. The proportion of
patients who were enrolled with a CD4 cells
count of less than 200
cells count/µL decreased from 50.0% in Period 1 to 40.9% in Period 3. As anticipated
an increase in a history
of HAART use was ob-
served between period
one and two (2.3% vs.
35.0%,
respectively)
with a decrease in period
three (20.9%).
An increase in
several non-AIDS defining conditions among
our population of patients
was evident. An increase inpatients with diabetes was seen (1.0%,
5.8% and 6.5%), hypertension (1.0%, 10.4%
and 11.6%), Hepatitis A
(0.2%, 2.2% and 1.8%),
Hepatitis B (1.9%, 4.1%
and 4.2%) and Hepatitis C (0.8%, 32.9% and
35.3%). An increase in
diabetes, hypertension
and Hepatitis C was observed through the three
periods. HIV constitutional signs and symptoms
that were more frequently
reported were diarrhea
(24.2%, 2.3% and 0.0%),
headaches (28.3%, 2.2%
and 0.0%), night sweats
(29.8%, 3.6%, 0.0%)
and weight loss of more
than 10 pounds (18.1%,
12.1% and 7.2%). These conditions decreased
significantly between the
three periods of time studied.
Table III. Immunological, clinical and treatment profile among Puerto Rican
HIV/AIDS patients attending the RRC by periods of time.
Variables
1992-1997 1998-2003 2004-2008 p (value)
n
%
n
%
n
%
HIV status at study entry
0.001*, 0.001**
Clinical AIDS
631 27.9 204 19.0 37
6.0
Immunologic AIDS 467 20.6 370 34.5 265 43.3
HIV infection
1167 51.5 498 46.5 310 50.7
CD4 cells count/µL
0.001*, 0.001**
<200
733 50.0 447 46.5 250 40.9
≥200
732 50.0 515 53.3 361 59.1
HAART use
0.001*, 0.001**
No
2214 97.7 697 65.0 484 79.1
Yes
51
2.3
375 35.0 128 20.9
Hypertension
0.000*, 0.000**
No
2243 99.0 961 89.6 541 88.4
Yes
22
1.0
111 10.4 71
11.6
Nephrolithiasis
0.000*, 0.000**
No
2263 99.9 1055 98.4 604 98.7
Yes
2
.1
17
1.6
8
1.3
Pancreatitis
0.000*, 0.000**
No
2262 99.9 1059 98.8 606 99.0
Yes
3
.1
13
1.2
6
1.0
Diabetes
0.000*, 0.000**
No
2242 99.0 1010 94.2 572 93.5
Yes
23
1.0
62
5.8
40
6.5
Hepatitis A
0.000*, 0.000**
No
2260 99.8 1048 97.8 601 98.2
Yes
5
.2
24
2.2
11
1.8
Hepatitis B
0.000*, 0.000**
No
2222 98.1 1028 95.9 586 95.8
Yes
43
1.9
44
4.1
26
4.2
Hepatitis C
0.001*, 0.001**
No
2247 99.2 719 67.1 396 64.7
Yes
18
.8
353 32.9 216 35.3
Diarrhea
0.000*, 0.000**
No
1718 75.8 1047 97.7 612 100.0
Yes
547 24.2 25
2.3
0
0.0
Headaches
0.000*, 0.000**
No
1624 71.7 1048 97.8 612 100.0
Yes
641 28.3 24
2.2
0
0.0
Night sweats
0.000*, 0.000**
No
1590 70.2 1033 96.4 612 100.0
Yes
675 29.8 39
3.6
0
0.0
Weight loss >10 lbs
0.000*, 0.000**
No
1854 81.9 942 87.9 568 92.8
Yes
411 18.1 130 12.1 44
7.2
In Table IV we
present the changes in
the clinical profile of AIDS
patients in the three periods of time. The most
common AIDS defining
conditions among patients were: Pneumocistis Cariini pneumonia
(PCP) (34.1%, 16.2%
and 2.7%), toxoplasmo- * Pearson Chi-square, **Pearson Chi-square for linear trends
sis of brain (TP) (18.4%,
13.7% and 8.15), and wasting syndrome (WS) (20.1%, States, including Hispanics living in the United States
45.1% and 0.0%). A significant decrease was observed (12). The RRC cohort remains predominantly male,
from Period 1 to Period 3 in all three conditions. Other with an increase in the female population observed in
AIDS defining conditions reported among patients with the last five years. In the Caribbean and Puerto Rico,
clinical AIDS were: candidiasis of the lung, herpes sim- an increase in HIV infections among women has been
plex, Kaposi Sarcoma, lymphoma of the brain and tu- also reported in the last five years (13, 14). The most
berculosis. It is relevant that none of these conditions common HIV transmission mode is still illicit-drug injecwere reported in the last period.
tion, but an increase in heterosexual sex and men having sex with men has been reported more often in the
last period. In Puerto Rico, the most common modes of
DISCUSSION
transmission continue to be injection drug use followed
The HIV epidemic in Puerto Rico is notably by risky heterosexual contact and finally male to male
different from the epidemic in the continental United sexual contact (14).
49
Table IV. Changes among the clinical profile of AIDS diagnosed patients at study entry attending the RRC
by periods of time.
AIDS defining conditions
1992-1997N=631
1998-2003N=204
2004-2008N=37
n
%
n
%
n
%
Candidiasis lungs
No
623 98.7
200 98.0
37
100.0
Yes
8
1.3
4
2.0
0
0.0
Herpes simplex
No
603 95.6
194 95.1
37
100.0
Yes
28
4.4
10
4.9
0
0.0
Kaposi Sarcoma
No
601 95.2
196 96.1
37
100.0
Yes
30
4.8
8
3.9
0
0.0
Lymphoma primary of brain
No
628 99.5
204 100.0
37
100.0
Yes
3
.5
0
0.0
0
0.0
Tuberculosis
No
615 97.5
202 99.0
37
100.0
Yes
16
2.5
2
1.0
0
0.0
Pneumocistis Cariini
No
416 65.9
171 83.8
36
97.3
Yes
215 34.1
33
16.2
1
2.7
Toxoplasmosis of the brain
No
515 81.6
176 86.3
34
91.9
Yes
116 18.4
28
13.7
3
8.1
Wasting syndrome
No
504 79.9
112 54.9
37
100.0
Yes
127 20.1
92
45.1
0
0.0
* Pearson Chi-square, **Pearson Chi-square for linear trends
In the United States for the same year, male-to-male sexual contact represented 72% of new infections
among males; for females, high-risk heterosexual contact was the predominant transmission category (80%)
(12). We have also seen an increase in alcohol consumption, and the use of psychoactive drugs which
may be factors which increase the risky practices associated to HIV infection.
Of relevance is the finding that AIDS-defining
illnesses and conditions have been substituted by new
co-morbid conditions (19). These conditions include
cardiovascular disease, renal and hepatic disorders,
osteopenia, endocrine and metabolic abnormalities,
and non– AIDS-defining neoplasm (20). The increased
survival associated to HAART therapy is likely a major
reason for the presence of these chronic conditions.
Analysis of the clinical and immunological spectrum of
the disease in our cohort revealed a significant decrease of several AIDS-defining conditions commonly observed in HIV/AIDS patients during the last decades.
The presence of toxoplasmosis of the brain, wasting
syndrome and pneumocistis cariini pneumonia has
clearly decreased from Period 1 to Period 3 in patients
with clinical AIDS. This finding may be explained by the
improvement of CD4 cell count at study entry of many
of our patients, the frequent use of prophylactic therapy against CE, PCP and TP and the use of HAART and
ART among our patients. (21-25) Patterns of HIV morbidity among patients have significantly changed over
the last two decades. The introduction of HAART in
developed countries has increased the life expectancy
50
p (value)*
0.581*, 0.464**
0.398*, 0.524**
0.365*, 0.215**
0.563*, 0.314**
0.265*, 0.105**
0.000*, 0.000**
0.106*, 0.034**
0.000*, 0.000**
of HIV infected persons (24-28). HAART suppress the
HIV viral load and improves immunological and clinical
well-being. (24-28) Consequently, AIDS-defining conditions have declined substantially (23-31).An improvement of general well-being of HIV infected patient that
entered our Center among the three periods of time is
evident. In these periods of time, HIV infected patients
have a higher CD4 cells count (≥ 200 mm/cm3) and a
decreased manifestation of AIDS-defining conditions.
The study of the interplay of the multiple chronic conditions which often are seen in the generation of
recently HIV infected patients will require further consideration and study in the future. Early diagnosis and
effective treatment for these conditions may enhance
the quality of life of HIV-infected patients. A recent US,
HIV outpatient study has shown that although the death rate from AIDS-related causes fell significantly between 1996 and 2004, the proportion of deaths from
non-AIDS-related diseases is increasing (22, 33). This
increase was especially prominent in non-AIDS malignancies; hepatic disease and cardiovascular disease.
The findings can help to guide future implementation
of HIV prevention programs, and services culturally
appropriate for this patient population.
REFERENCES
1.
Karon JM, Fleming PL, Steketee RW, and De Cock KM.
HIV in the United States at the turn of the century: an epidemic in
transition. Am J Public Health, 2001; 91: 1060–1068.
2.
Pomerantz RJ, Horn and DL. Twenty years of therapy for
HIV-1 infection. Nat Med 2003; 9:867–873.
3.
United States of America, Centers for Disease Control
and Prevention; Divisions of HIV/AIDS Prevention, National Center
for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. Racial/ethnic disparities in diagnoses of HIV/AIDS—33 states, 2001–2004.
2006. Morb. Mortal. Wkly. Rep. 55:121–125.
4.
and Prevention; Divisions of HIV/AIDS Prevention, National Center
for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. December
2005.HIV/AIDS surveillance report, 2004, vol. 17. U.S. Department
of Health and Human Services, Centers for Disease Control and
Prevention, Atlanta, GA.
h t t p : / / w w w. c d c . g o v / h i v / t o p i c s / s u r v e i l l a n c e / r e s o u r c e s /
reports/2004report/pdf/2004SurveillanceReport.pdf.
5.
World Health Organization. 2006, posting date. Second
generation surveillance for HIV/AIDS. World Health Organization,
Geneva, Switzerland.
http://www.who.int/hiv/topics/surveillance/2ndgen/en/.
6.
Hariri S, McKenna MT. Epidemiology of human immunodeficiency virus in the United States. Clin Microbiol Rev. 2007;
20(3):478-88.
7.
and Prevention; Divisions of HIV/AIDS Prevention, National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. 1996.
Update: mortality attributable to HIV infection among persons
aged 25–44 years—United States, 1994. Morb. Mortal. Wkly. Rep.
45:121–125.
8.
and Prevention; Divisions of HIV/AIDS Prevention, National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. 1981.
Kaposi’s sarcoma and Pneumocystis pneumonia among homosexual men—New York City and California. Morb. Mortal. Wkly.
Rep. 30:305–308.
9.
United States of America, Centers for Disease Control and
Prevention; Divisions of HIV/AIDS Prevention, National Center for
HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. 1994. Plan and
operation of the Third National Health and Nutrition Examination
Survey, 1988–94. Series 1: programs and collection procedures.
Vital Health Stat. 1:1–407.
10.
Fleming PL, Ward JW, Karon JM, Hanson DL, and De
Cock KM. Declines in AIDS incidence and deaths in the USA: a
signal change in the epidemic. AIDS 1998; 12(Suppl. A):S55–S61.
11.
Holtgrave DR. Causes of the decline in AIDS deaths, United States, 1995–2002: prevention, treatment or both? Int. J. Sex
Transm. Dis. Acquir. Immune Defic. Syndr. 2005; 16:777–781.
12.
United States of America, Centers for Disease Control and
Prevention; Divisions of HIV/AIDS Prevention, National Center for
HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. Subpopulation
Estimates from the HIV Incidence Surveillance System -United States, 2006. MMWR September 12, 2006 57(36); 985-989. Available
from:
http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5736a1.
htm.
13.
Joint United Nations Programme on HIV/AIDS (UNAIDS)
and World Health Organization (WHO). 2009 AIDS Epidemic
Update. Available from: http://data.unaids.org/pub/Report/2009/
JC1700_Epi_Update_2009_en.pdf.
14.
Commonwealth of Puerto Rico; Department of Health,
Central Program for AIDS and Sexually Transmitted Diseases.
AIDS Surveillance Report, April 2009. San Juan (Puerto Rico): Department of Health; 2009.
15.
Estado Libre Asociado de Puerto Rico. Negociado del
Censo Federal, Oficina del Censo, Junta de Planificación de Puerto Rico. Definiciones: Áreas Metropolitanas [Web page]. Available
from:
http://www.gobierno.pr/Censo/GeografiaCensal/Definiciones/
areasMetropolitanas.htm
16.
Gómez MA, Velázquez M, Hunter-Mellado RF. Outline of
the Human Retrovirus Registry: Profile of a Puerto Rican HIV infected population. Bol Asoc Med P Rico. 1997; 89(7-9):111-116.
17.
Statistical Package for the Social Sciences (SPSS), v. 14.
Chicago, IL. 2005
18.
Baez-Feliciano DV, Thomas JC, Gomez MA. Changes in
the AIDS epidemiological situation in Puerto Rico following health
care reform and the introduction of HAART. Pan Am J Public Health.
2005; 17(2):92-101.
19.
Llibre JM, Falco V, Tural C, et al. The changing face of
HIV/AIDS in treated patients. Curr HIV Res. 2009; 7(4):365-77.
20.
Buchacz K, Rangel M, Blacher R, Brooks JT. Changes
in the Clinical Epidemiology of HIV Infection in the United States:
Implications for the Clinician. Current Infectious Disease Reports.
2009; 11:75–83.
21.
Baez-Feliciano DV, Quintana R, Gomez MA. Trends in the
HIV and AIDS epidemic in a Puerto Rican cohort of patients: 19922005. Bol Asoc Med P Rico. 2006; 98(3):174-181.
22.
Jain MK, Skiest DJ, Cloud JW. Changes in mortality related
to human immunodeficiency virus infection: comparative analysis
of inpatient death in 1995 and in 1999-2000. Clin Infect Dis. 2003;
36:1030-1038.
23.
Palella FJ, Delaney KM, Moorman AC, et al. Decline morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV outpatients study investigation. N
Engl J Med. 1998; 338:523-860.
24.
Valdez H, Chowdhry TK, Asaad R. Changing spectrum of
mortality due to human immunodeficiency virus: analysis of 260
deaths during 1995-1999. Clin Infect Dis. 2001; 32:1487-1493.
25.
Mayor AM, Gómez MA, Ríos-Olivares E, et al. Mortality
trends of HIV-Infected patients after the introduction of highly active antiretroviral therapy: analysis of a cohort of 3,322 HIV-infected
persons. Ethn Dis. 2005; 15:S5-57-62.
26.
Van Sighem AI, Van de Wiel MA, Ghanic AC, et al. Mortality and progression to AIDS after starting highly antiretroviral therapy. AIDS. 2003; 17:2227-2236.
27.
Ledermann MM, Valdez H. Immune restoration with antiretroviral therapies: implications for clinical management. JAMA.
2000; 284:223-228.
28.
Kroon FP, Rimmelzwaan GF, Roos MT, et al. Restored
humoral immune response to influenza vaccination in HIV-infected
adults treated with highly active antiretroviral therapy. AIDS. 1998;
12:F217-F223.
29.
Wolff AJ, O’Donnell EA. Pulmonary manifestation of HIV
infection in the era of highly active antiretroviral therapy. Chest.
2001 120:1888-1893.
30.
Lewden C, Raffi F, Chene G, et al. Mortality in a cohort of
HIV-infected adults started on a protease inhibitor-containing therapy. J Acquir Immune Defic Syndr. 2001 26:480-482.
31.
Escolano Hortelano CM, Ramos Rincon JM, Gutierez
Rodero F. Changes in the spectrum of morbidity and mortality in
hospital admission of HIV-infected patients during the HAART era.
Med Clin (Barc). 2004; 122:21-23.
32.
Bica I, McGovern B, Dhar R, et al. Increasing mortality
due to end stage liver disease in patients with human immunodeficiency virus infection. Clin Infect Dis. 2001 32:492-497.
33.
Palella FJ, Jr, Baker RK, Moorman AC, et al. Mortality in
the highly active antiretroviral therapy era: changing causes of death and disease in the HIV outpatient study. J Acquir Immune Defic
Syndr. 2006; 43:27–34.
ACKNOWLEDGMENTS
This research was sponsored by grant number
G12RR03035 from the National Center for Health Resources (NCRR) a component of the National Institutes of Health. We thank Mrs. Johanna Maysonet, Mrs.
Gisela I. Cestero, Ms. Glenda L. Ortiz, Mrs. Heidy Ortiz, Mrs. Magaly Torres, and Mrs. Wanda I. Marin.
RESUMEN
Objetivos: Se describe el perfil sociodemográfico,
factores de riesgo y los patrones clínicos e inmunológicos de enfermedades asociadas y no asociadas al VIH/SIDA de los pacientes del RRC durante
tres periodos de estudio: 1992-1997, 1998-2003,
y 2004-2008. Método: Este estudio cros-seccional
de un cohorte longitudinal analiza a 4,016 pacientes con VIH/SIDA. Se analizaron variables sociodemográficas, factores de riesgo, y clínicas e inmunológicas a través del 3 periodos en el tiempo.
Resultados: Las enfermedades asociadas con el
SIDA más comunes en esta cohorte de pacientes
fueron: pneumocistis cariini neumonía, toxoplasmosis, y síndrome de desgaste progresivo. La
diabetes y la hipertensión en estos pacientes ha
aumento a través de los periodos de tiempo establecidos. Conclusiones: Un buen entendimiento de
los factores sociodemográfico, de riesgo y clínicos
e inmunológicos de los pacientes VIH/SIDA es primordial para el rediseño de programas y servicios
de salud dirigidos al cuido de estos pacientes.
51
(In vitro data; clinical significance unknown.
Full course of therapy is complete in 7 days.)1,2
n
ZYMAR® ophthalmic solution rapidly eradicates
key pathogens in vitro, including:
S aureus: eradicated in 15 minutes1,*
S epidermidis: eradicated in 30 minutes1,*
S pneumoniae: eradicated in 10 minutes2,*
H influenzae: eradicated in 5 minutes2,*
* Time to reach kill threshold. 10 CFU/mL is the lower limit of detection and is
indistinguishable from complete kill.
ZYMAR® ophthalmic solution is indicated for the treatment of bacterial conjunctivitis caused by susceptible strains
of the following organisms: Corynebacterium propinquum,† Staphylococcus aureus, Staphylococcus epidermidis,
Streptococcus mitis,† Streptococcus pneumoniae, and Haemophilus influenzae. (†Efficacy for this organism was studied
in fewer than 10 infections.)
Important Safety Information: NOT FOR INJECTION. ZYMAR® ophthalmic solution should not be injected
subconjunctivally, nor should it be introduced directly into the anterior chamber of the eye. As with other antiinfectives, prolonged use may result in overgrowth of nonsusceptible organisms, including fungi. If superinfection
occurs, discontinue use and institute alternative therapy. Patients should
be advised not to wear contact lenses if they have signs and symptoms of
bacterial conjunctivitis.
®
The most frequently reported adverse events occurring in approximately 5%
to 10% of the overall study population were conjunctival irritation, increased
lacrimation, keratitis, and papillary conjunctivitis.
Please see brief prescribing information on adjacent page.
1. O’Brien TP. Antimicrobial efficacy of ZYMAR® and Vigamox® against Staphylococcus species. Refract Eyecare Ophthalmol. 2003;7(12):15-18. 2. Novosad BD, Callegan MC.
Killing of Streptococcus pneumoniae, methicillin-resistant Staphylococcus aureus (MRSA), and Haemophilus influenzae ocular isolates by fourth-generation fluoroquinolones.
Poster presented at: 78th Annual Meeting of the Association for Research in Vision and Ophthalmology; April 30-May 4, 2006; Fort Lauderdale, FL.
©2009 Allergan, Inc., Irvine, CA 92612 www.allergan.com ® marks owned by Allergan, Inc.
ZYMAR® is licensed from Kyorin Pharmaceutical Co., Ltd., Tokyo, Japan. APC50TC09 803807
mí sinceramente me gustaba
“ Afumar,
y en realidad jamás
pensé que lo dejaría.
”
ex fumadora desde ‘07
Lisa dejó de fumar con CHANTIX y con apoyo.
Con CHANTIX puedes fumar durante la primera semana de tratamiento. Además, es una pastilla sin nicotina
que funciona al concentrarse en los receptores de nicotina en el cerebro, adherirse a ellos y bloquear la
nicotina antes de que llegue a los receptores. En los estudios, el 44% de los usuarios de CHANTIX había
dejado de fumar durante la 9ª a 12ª semana del tratamiento (comparado con 18% que tomaron placebo). Para
saber más acerca de CHANTIX y escuchar a otros ex fumadores, visite www.chantix.com.
Hable
su médico
paraque
verusted
si CHANTIX
el medicamento
apropiado
para usted.
CHANTIX
es unacon
opción
de tratamiento
y su médicoes
pueden
considerar. Llame
al 1-877-CHANTIX
(242-6849).
CHANTIX es una opción de tratamiento que usted y su médico pueden considerar. Llame al 1-877-CHANTIX (242-6849).
Información Importante de Seguridad:
Algunas personas han tenido cambios en el comportamiento, hostilidad, agitación, estado de ánimo deprimido,
pensamientos o conducta suicida mientras están usando CHANTIX para ayudarlas a dejar de fumar. Algunas personas
han tenido estos síntomas cuando comenzaron a usar CHANTIX, mientras otras los manifestaron luego de varias
semanas de tratamiento o después de que dejaron de usar CHANTIX. Si usted, su familia o la persona que le cuida
observan agitación, hostilidad, depresión o cambios de comportamiento, pensamiento o estado de ánimo, que no son
típicos en usted, o si manifiesta pensamientos o conducta suicida, ansiedad, pánico, agresión, coraje, manía,
sensaciones anormales, alucinaciones, paranoia o confusión, deje de tomar CHANTIX y llame a su médico
inmediatamente. Dígale también a su médico si tiene un historial de depresión u otros problemas de salud mental,
antes de tomar CHANTIX, puesto que estos síntomas se pueden agravar mientras toma CHANTIX.
Algunas personas pueden tener reacciones cutáneas graves mientras están tomando CHANTIX, algunas de las cuales pueden ser
potencialmente mortales. Estas pueden incluir erupción, hinchazón, enrojecimiento y descamación de la piel. Algunas personas pueden
tener reacciones alérgicas a CHANTIX, algunas de las cuales pueden ser potencialmente mortales e incluyen: hinchazón de la cara,
boca y garganta, las cuales pueden causar problemas respiratorios. Si tiene estos síntomas o tiene una erupción con piel descamada o
ampollas en la boca, deje de tomar CHANTIX y busque ayuda médica de inmediato.
Los efectos secundarios más comunes son náuseas, problemas para dormir, estreñimiento, gases y vómitos. Si tiene efectos
secundarios que le incomodan o persisten, llame a su médico.
Los pacientes también informaron que tuvieron problemas para dormir y sueños demasiado intensos, inusuales o extraños. Tenga
cuidado al manejar u operar maquinaria hasta que sepa cómo CHANTIX le puede afectar.
Puede que necesite una dosis más baja de CHANTIX si tiene problemas renales o recibe diálisis. Antes de comenzar a tomar
CHANTIX, infórmele a su médico si está embarazada, espera quedar embarazada, o si toma insulina, medicamentos para el asma o
anticoagulantes.
Medicamentos como estos pueden funcionar de manera distinta cuando deje de fumar. CHANTIX no se debería tomar con otros
medicamentos para dejar de fumar. Si tiene una recaída y vuelve a fumar, siga intentando dejar de fumar.
CHANTIX es un medicamento con receta para ayudar a adultos de 18 años o más a dejar de fumar.
Por favor véase el resumen del paciente de "Important Facts about Chantix” en la próxima página.
Le exhortamos a informar al FDA sobre efectos secundarios adversos de los medicamentos recetados.
Visite www.fda.gov/medwatch or call 1-800-FDA-1088.
CHU01195SP © 2009 Pfizer Inc. Todos los derechos reservados.
ABSTRACT
The posterior cerebral arteries are paired
vessels that usually originate from the basilar artery
at the level of the pontomesencephalic fissure and
are joined by the posterior communicating artery to
close the posterior portion of the Circle of Willis (circulus arteriosus cerebri). There is a considerable
variation in the presence of the arterial segments
of the circle of Willis. In the fetal type posterior cerebral artery there is an embryonic derivation of this
vessel from the internal carotid artery. The irrigation of the posterior cerebral artery territory is thus
completely dependent on the internal carotid artery.
The term fetal-type posterior cerebral artery is used
whether or not there is a communication with the
basilar artery through a small pre-communicating
segment (P1) of the posterior cerebral artery. This
study deals with the variations of the posterior part
of the circle of Willis, especially the origin of the posterior cerebral artery (PCA). The size of the posterior communicating artery (PComA) in comparison
with the size of posterior cerebral artery is one of
the principal differences between the fetal and adult
forms of the circulus arteriosus cerebri. There are
three configurations regarding posterior cerebral
and posterior communicating arteries according to
compare their diameters.
Variation Of The
Posterior Cerebral
Artery And Its
Embryological
Explanation:
A Cadaveric Study
Wilson R. Veras T. MD*
Gary W. Elhert MD**
From the* Department of Anatomy and Cell Biology, and **
School of Medicine Universidad Central del Caribe, Bayamon, PR.
Address reprints requests to: Wilson R. Veras MD – Department of Anatomy and Cell Biology, School of Medicine,
Universidad Central del Caribe. Call Box 60-327, Bayamón,
PR 00960-6032. Email: [email protected]
Index words: posterior cerebral, artery, embryology,
variations
INTRODUCTION
T
homas Willis was not the first to describe the circulus arteriosus cerebri, but in 1664 he was the first to
do so completely and with an illustration of the vascular network at the base of the brain. Gabriel Fallopius
(1523-1563) gave an incomplete description in 1561.
Giulio Casserio (1561-1616) was the first to draw the
circle later described by Johann Vesling (1598-1649)
in a treatise in 1653 along with the Swiss physician
Johann Jakob Wepfer (1620-1695) in 1658 (1). The recognition and description of anatomic variants in the
circle of Willis are extremely important because this
information may be helpful during surgical and radiological interventions. The posterior cerebral artery arises
from the rostral end of the basilar artery and divides
into four segments (P1 to P4). When this artery arises
from the internal carotid artery is known as a fetal-type
posterior posterior cerebral artery. Alpers et al, 1959
(2), realized a largest study of the circulus arteriosus
cerebri, on 837 brains they have found that the embryonic derivation of the posterior cerebral artery (fetaltype) was present on one side in 31% and in both sides
in 25% cases.
The term fetal-type posterior cerebral artery is
also used when there exists a communication with the
basilar artery through a hypoplastic initial segment of
the posterior cerebral artery. In this case the P2 segment derives from the internal carotid artery while the
P1 arises hypoplastic from the basilar artery.
Figure 1. Circle of Willis. Normal Type. ICA: Internal Carotid Artery, PComA: Posterior Communicating Artery, PCA: Posterior Cerebral
Artery
In the present study 68 posterior cerebral arteries were dissected looking for variations at its site of
origin and its participation in the formation of the circulus arteriosus cerebri (graphic 1). The posterior cerebral arteries were obtained from 34 embalmed adult
cadaver brains. The age of the cadavers ranged from
62 to 89 with a mean of 75.9 years. The brains were
55
evaluated without regard to sex. Before removal of the
brains the internal carotid arteries were cannulated and
injected with red colored latex. The origin, course, and
topography of structures related to the posterior cerebral artery was evaluated under Carl Zeiss loupe (4X).
The photographs of the specimens were taken with a
Sony Cyber shot S85 4.1 mega pixels digital camera.
To avoid differences in picture views, the photographs
were taken in a perpendicular plane of the circulus arteriosus cerebri. Measurements of the diameters of the
posterior cerebral and posterior communicating arteries were made. To make this study consistent with the
literature, hypoplastic vessels were defined as those
with external diameters less than 1 millimeter.
RESULTS
Posterior Cerebral Artery
The average diameter of the posterior cerebral
artery was 1.7 – 3.4 mm (mean of 2.24 mm) on the left
side, and 1.5 – 3.1 mm (mean of 2.1 mm) on the right
side. When the posterior cerebral artery arises from
the left internal carotid artery (fetal type) the diameter
was between 2.0 – 2.7 mm (mean of 2.35 mm). When
the posterior cerebral artery arises from the right internal carotid artery (fetal type) the diameter was between 1.5 – 3.2 mm (mean 2.35). In 50 specimens the
P1 segment was found to be larger than the posterior
communicating artery (adult configuration 73.52 %),
(Figure 1), in 10 specimens the P1 segment was smaller than the posterior communicating (partial fetal type
configuration 14.70 %) (Figure 2), and in two specimens it was found to equal in both vessels (transitional
configuration 2.94 %) (Figure 3). Two specimens present an absence of the P1 segment corresponding to a
full fetal type (2.94 %).
DISCUSSION
At the 4- to 5.7 mm stage of the embryo (28–30
days), the internal carotid artery (ICA) is formed. It develops as a cranial extension of the paired dorsal aorta, is formed (3). Padget’s (4) embryological description (1948) revealed that at 4 weeks after conception
(Stage II, C-R length 5-4 mm) the P1 segment has not
yet developed. At seven weeks after conception (Padget Stage VII, C-R length 40 mm) the trunk of the mesencephalic and diencephalic vessels forms the stem
of the future posterior cerebral artery. The P2 segment
represents the first segment of the true PCA system
formed by P2, P3, and P4 segments (4). The PCA belongs to the internal carotid artery (ICA) system and
constitutes its caudal terminal branch. The upper basilar artery distal to the trigeminal artery remnant, the P1
segment of the PCA and the PCoA, are included in this
system. Embryologically, the PCA is a diencephalomesencephalic artery, which gathers its telencephalic supply by the distal annexation of the anterior choroidal
artery (AChA) territory (5). So the PCA, and the P1 and
P2 have been formed, and the circle of Willis has been
closed. According to Padget (1948)(4) at this time an
ideal circle of Willis has developed, which consists of
segments of equal and slender size. The posterior bifurcation of the PCA has a transitional configuration.
56
Figure 2. Circle of Willis. Partial Fetal Type
Paired longitudinal neural arteries appear along
the hindbrain and coalesce to form the basilar artery at
the 5 to 8 mm stage. The vertebrobasilar system develops and thus participates in the supply of the PCA
through the segment between the basilar artery and
the post-communicating part of the PCA, the P1 segment. In that phase, the component vessels of the circle of Willis all have the same caliber.
In the remaining fetal period, the circle develops into one of three variants: an adult configuration,
a transitional configuration or a fetal (embryonic) configuration (4). In the adult configuration, the P1 segment
has a larger diameter than the PCoA. In the transitional
configuration, the PCoA and P1 have an equal diameter. Both the basilar artery and the ICA thus contribute
equally to the PCA. The fetal or embryonic configuration is the variant in which the P1 is smaller than the
PCoA and the ICAs are the main blood suppliers to the
occipital lobes. It has been shown that these variations
in morphology arise during fetal brain development (6).
In this period, the frequency of adult and fetal configurations increases, while the number of transitional
configurations decreases.
The posterior communicating artery is the proximal remnant of the posterior, dorsal, or caudal division
of the embryonic internal carotid artery. It may then either regress as the posterior cerebral artery becomes
annexed by the basilar artery or may persist to preferentially give rise to the posterior cerebral artery with
corresponding agenesis of the ipsilateral P1 segment
(5).
The embryonic derivation of the posterior cerebral artery from the internal carotid artery is widely
studied by many authors. This variation was seen to
be present in 5–13.7% on the right side, 5–13% on the
left side and 2–6% on both sides (7,8,9)). Our study
reports 4.41% on the right side, 10.29 % on the left
side, and 2.94 % on both sides. The variation may occur between 11 – 24% cases (10, 11, 12). In our study we have a 14.70 % of cases with variations in the
posterior cerebral artery origin. When the fetal type
posterior cerebral artery is present the vascularization
of its territory is completely dependent on the internal
carotid artery. In case of an obstruction of the latter the
irrigation cannot be compensated by the development
of leptomeningeal vessels between the posterior cerebral and middle cerebral arteries because they are
derived from the same vessel and the tentorium prevents cerebellar vessels from connecting to the PCA
territory (13). Moreover they stated that the patients
with fetal-type posterior cerebral artery could be more
prone to develop vascular insufficiency. Battacharji et
al(14), studied 49 brains with infarcts and 88 without,
more fetal type posterior cerebral artery were found in
brains with infarcts than in brains without (27 vs. 17%).
Kameyama et al(15), described 167 brains with infarcts
and 90 without, also more fetal type posterior cerebral
artery was present in the brains with infarcts.
Many authors have stated that the incidence of
variations in the circle of Willis was shown to be significantly higher in the aneurysm series than in the control (16, 17, 18, 19). It has long been suspected that
variations in the circle of Willis may play some role in
the development of cerebral aneurysms. There is a
clear correlation between variations of the circulus arteriosus cerebri and cerebral aneurysms, which leads
one to the assumption that the variations are a factor
in the occurrence of aneurysms. Padget in 1944 (20)
described the association of variations and aneurysms
and state an argument in favor of a congenital theory
of aneurysmal development; it should be interpreted
in terms of the hemodynamic stress caused by variations.
CONCLUSIONS
The present study reveals that the degree of
contribution from the ICA to the origin of the PCA in
Figure 3. Circle of Willis. Transitional Type
twelve cases; ten cases corresponding to a partial fetal
type configuration (14.70%), and two cases corresponding to a full fetal type (2.94%). In two cases, both the
ICA and the basilar arteries contributed to the PCA,
corresponding to the transitional type (2.94%). The recognition and description of anatomical variants in the
circle of Willis are extremely important because these
variations play some role in the development of cerebral aneurysms. Infarcts and vertebro-basilar ischemia
have been described in the presence of fetal-type posterior cerebral artery. The knowledge of this variation
is very important during surgical and radiological interventions.
REFERENCES
1.
Enersen O. D. Willis' circle. 1994-2010. http://www.whonamedit.com/synd.cfm/323.html.
2.
Alpers BJ, Berry RG, Paddison RM: Anatomical studies
of the circle of Willis in normal brain. AMA Arch Neurol Psychiatry
1959; 81:409–418.
3.
Okahara M, Kiyosue H, Mori H, Tanoue S, Sainou M, Nagatomi H: Anatomic variations of the cerebral arteries and their embryology: a pictorial review. Eur Radiol 2002; 12: 2548–2561.
4.
Padget DH: The development of the cranial arteries in the
human embryo. Contrib Embryol 1948; 32: 205–261.
5.
Lasjaunias P, Berenstein A, TerBrugge KG. Intradural arteries. In: Surgical neuroangiography 1: Clinical vascular anatomy
and variations. Berlin, Germany: Springer-Verlag; 2001:480–629
6.
Van Overbeeke JJ, Hillen B, Tulleken CA: A comparative
study of the circle of Willis in fetal and adult life: the configuration
of the posterior bifurcation of the posterior communicating artery. J
Anat 1991; 176: 45–54.
7.
Wald DS, Law M, Morris JK. Homocysteine and cardiovascular disease: evidence on causality from meta-analysis.
BMJ2002;325:1202–1206
8.
Lawrence de Koning AB, Werstuck GH, Zhou J, Austin RE.
Hyperhomocysteinemia and its role in the development of atherosclerosis. Clin Biochem 2003;36:431–441
9.
Graham IM, Daly LE, Refsum HM, et al. Plasma homocysteine as a risk factor for vascular disease: the European Concerted
Action Project. JAMA 1997;277:1775–1781
10.
Kamath S., Observations on the length and diameter of
vessels forming the circle of Willis, J Anat, 1981, 133(3):419–423.
11.
Jain P. N., Kumar V., Thomas R. J., Longia G. S., Anomalies of human cerebral arterial circle (of Willis), J Anat Soc India,
1990, 39(2):137–146.
12.
Jayasree N., Sadasivan G., Variations
of circle of Willis in man, J Anat Soc India, 1981,
30(2):72–77.
13.
Van Raamt AF, Mali WPTM, van Laar PJ,
van der Graaf Y: The Fetal Variant of the Circle of
Willis and Its Influence on the Cerebral Collateral
Circulation. Cerebrovasc Dis 2006; 22:217-224.
14.
Battacharji S. K., Hutchinson E. C., MCcall A. J., The circle of Willis. The incidence of developmental abnormalities in normal and infarcted
brains, Brain, 1967, 40:747–758
15.
Kameyama M, Okinaka SH: Collateral
circulation of the brain with special reference to
atherosclerosis of the major cervical and cerebral
arteries. Neurology 1963; 13: 279–286.
16.
Kalula n. T. Kayembe, M.D., Masakiyo
Sasahara, M.D., and Fumitada Hazama, M.D.
Cerebral aneurysms and variations in the circle of
Willis. Stroke vol 15, no 5, 1984
17.
Riggs HE, Rupp C: Miliary aneurysms:
Relations of anomalies of circle of Willis to formation of aneurysms. Arch Neurol Psychiat 49: 615616, 1943
18.
Stehbens WE: Aneurysms and anatomical variation of the cerebral arteries. Arch Pathol
75: 45-63, 1963
19.
Vare A. M., Bansal P. C., Arterial pattern
at the base of the human brain, J Anat Soc India,
1970, 19(3):71–79.
20.
Padget DH: The circle of Willis: Its embryology and anatomy. In Dandy WE (ed) Intracranial arterial aneurysms. Comstock Publishing Co,
New York, 67-90, 1944
57
RESUMEN
Acredite
su actividad
de Educacion
Continua en el
ACCME y TEM
con nuestro
Instituto de
Educación Médica
Continua
Las arterias cerebrales posteriores son vasos pares que se originan usualmente de la arteria basilar
a nivel de la fisura pontomesencefálica, se unen
con la arteria comunicante posterior para cerrar por
detrás el círculo arterial cerebral. Existen considerables variaciones en los diferentes segmentos del
círculo de Willis. La arteria cerebral posterior tipo
fetal se deriva de la arteria carótida interna directamente. En estos casos la irrigación del territorio
de la arteria cerebral posterior depende completamente del sistema de la carótida interna. El termino
cerebral posterior tipo fetal se utiliza independientemente si existe o no comunicación con la arteria basilar a través del segmento pre-comunicante
de la arteria cerebral posterior (P1). Este estudio
se ocupa de las variaciones de la parte posterior
del círculo de Willis, especialmente el origen de la
arteria cerebral posterior (PCA). El tamaño de la
arteria comunicante posterior (PComA) en comparación con la arteria cerebral posterior es una de
las diferencias principales utilizadas para clasificar
el circulo arterial cerebral entre las formas fetales y
adultas. Existen tres tipos de configuraciones con
respecto a la arteria cerebral posterior y la arteria
comunicante posterior cuando se comparan los
diámetros de ambos vasos: tipo adulto, tipo fetal y
de transición.
(787) 721-6969
United States Kum Do Association
Puerto Rico Medical Association Dojan
1305 Fernandez Juncos Ave. - Santurce, PR
Phone: (787) 696-1520 - Email: [email protected]
Website: www.uksda.webs.com
Review Articles / Articulos de Reseña
ABSTRACT
Sepsis is a multi-factorial disease that kills
an estimated 1,400 people a day worldwide. The
Triggering Receptor Expressed in Myeloid (TREM)
cells Like Transcript (TLT)-1 is a platelet receptor
expressed on activated platelets. Translational
studies of TLT-1 suggest that TLT-1 affects hemostatic and immunological parameters that lead to
the formation of disseminated intravascular coagulation (DIC). Evaluation of mice suffering from
endotoxic shock shows a dramatic increase of
soluble TLT-1 (sTLT-1) in their blood. Accordingly,
when we evaluated the blood of septic patients we
find increased levels of sTLT-1 that correlate with
the presence of DIC in humans. Based on current
data we hypothesize that TLT-1 plays an important
role in maintaining vascular integrity during sepsis;
perhaps by modulation of both the immune and
hemostatic systems, and that TLT-1 makes an attractive target not only for better understanding of
sepsis, but also as a point of therapeutic intervention as well.
Index words: TREM, transcript, sepsis
INTRODUCTION
M
ore than 200,000 individuals succumb
to sepsis yearly making sepsis a major health issue
(1). Sepsis is caused by the body over response to
bacterial infection leading to both the inflammatory
and hemostatic systems proceeding in disarray. The
inflammation is necessary during bacterial infection
to control infection and the hemostatic measures are
important to maintain blood volume in response to
vascular leakage caused by leukocytes and cytokine
inflammatory mediators (1,2). Sometimes these processes go away causing a global inflammation and a
systemic, as opposed to a localized, activation of hemostasis. Systemic activation leads to consumption of
clotting factors and platelets with an increase in non
specific micro thrombi also known as a syndrome called Disseminated Intravascular Coagulation (DIC) (3).
Even in the face of extensive clotting, consumption of
clotting factors and platelets allow bleeding in the sinusoids and volume loss. The microthrombi are prone to
wedge in the capillary beds contributing to the lowering
of oxygen delivery to the organs contributing to organ
failure (4). Once organs start to fail, the prognosis is
often bleak. Preservation of platelets and their function
are important to survival.
Platelets
Platelets play an indispensible role during
Clinical Studies
Support A Role For
Trem-Like
Transcript-1 During
The Progression Of
Sepsis
Omar Esponda MD1
Jessica Morales BS2
Alexandra Aguilar3
Michael Gomez4
A. Valance Washington PhD1,3
From the 1Department of Internal Medicine, Luis Arnau Hospital Regional, Bayamon PR 00959, 2Departamento de Bioquímica Universidad Central del Caribe, Bayamon PR 00959
3Departamento de Biologia, University of Puerto Rico- Recinto Mayaguez, Mayaguez PR 00681; 3Departamento de
Biologia, University of Puerto Rico – Recinto Cayey, Cayey
PR 00736
Address reprints requests to: A. Valance Washington, Department of Anatomy, Universidad Central del
Caribe,Bayamon,PR,00960.E-mail:[email protected]
hemostasis and an often unappreciated role during inflammation (5). It is well known that activation of platelets by thrombin, ADP, or collagen will cause the integrin GP IIbIIIa to bind fibrin initiating a fibrin clot (6).
Little account is given to the fact that activated platelets
release many cytokines mediators such as IL-1b, TGFb, and RANTES (regulated on Activated normal T=Cell
Expressed and Secreted) and they express adhesion
molecules such as p-selectin that mediate platelet adhesion to leukocytes and endothelial cells (7). Together
the triad of platelets, leukocytes, and endothelial cells
maintain our vascular integrity and protects us from
bacterial invasion. Recent studies have demonstrated
a role for the contents of the platelet a-granules to mediate hemostasis during inflammation without the major players of hemostasis fibrinogen, GP IIbIIIa, GP1b,
or p-selectin (8). These studies demonstrate that there
are yet undiscovered mechanisms of platelet function
that may provide clues to our understanding of diseases like sepsis.
Trem Like transcript -1 (TLT-1)
TLT-1 is a single Ig domain receptor found on
platelets and megakaryocytes (9,10). Like the adhesion molecule p-selectin, TLT-1 is stored in the platelet
α-granules until activation when it is quickly bought to the
surface (9). The TLT-1 gene (treml-1) is situated in the
TREM cluster, amongst a group of immuneregulatory
59
receptors that are found on leukocytes and endothelial
cells (11). (11). TLT-1 is the only member of the cluster
found on platelets giving it a unique role that may include securing the link of hemostasis with inflammation.
There are two published forms of TLT-1 which include a long form that has several interesting motifs in
the cytoplasmic domain and a splice variant form that
only has a 16 amino acid tail (11). Interactions with the
phosphatases SHIP-1, -2 and moesin have been described but the significance of these interactions have
not been uncovered (10,12,13). Even though TLT-1
signaling remains an enigma, a role has been defined
for TLT-1 in diseases such as sepsis where the dynamic relationship of the balance between coagulation
and inflammation is challenged (12).
There is a soluble form of TLT-1 (sTLT-1) that
is released upon activation as well, but debate over its
molecular origins remains (14). It has been demonstrated in cultured systems that the murine form of TLT-1 is
cleaved off of transiently transfected HEK293 cells and
found in the medium suggesting a mechanism where
TLT-1 is cleaved off of the surface of platelets in vivo
(14). However, this does not preclude the possibility of
a molecular form of TLT-1 that is secreted as well. The
soluble fragment appears in serum, but is non-existent
or at very low levels in the plasma of healthy individuals. Identification of TLT-1 in plasma would suggest
platelet activation as well TLT-1 function.
TLT-1 plays an important enhancing role during platelet activation. The first clues to TLT-1 function
were given when TLT-1 was shown to mediate calcium
influx in a transiently transfected retinoblastoma cell
line prescribing an enhancing role during cellular activation. This surprising affect was linked to an immune tyrosine inhibitory motif in the cytoplasmic tail (10).
However, TLT-1 is stored in the α-granules of platelets
until after the activation and the calcium spike that
allows fusion of the granules to the membrane, thus
making it unclear how TLT-1 would influence calcium
signaling in platelets. Never the less, an activation role
for TLT-1 was supported when single chain antibodies
specific to TLT-1 were shown to inhibit platelet aggregation in the presence of low levels of agonist in vitro
(15). These results support an enhancing role for TLT-1
and suggest that TLT-1 may play an important role in
maintaining platelet activation.
TLT-1 in vivo studies
To better understand TLT-1’s potential in vivo,
a null mouse model was developed (12,16). The TLT-1
mouse is viable with negligible differences seen in platelet counts. During platelet aggregation assays, the null
platelets show reduced aggregation abilities compared
to wild type mice especially with the agonists ADP and
the thromboxane A2 mimetic U46619 suggesting that
TLT-1 may play a role during the recruitment phase of
platelet plug formation. Consistent with these results,
tail bleeding assays demonstrate and overall increase
in time to secession of bleeding compared to wild type
mice confirming a role for TLT-1 in hemostasis.
60
In an endotoxin model where the mice are
challenged with lipopolysaccaride (LPS), TLT-1-/- mice
succumb faster and have a significantly lower survival
rate than wild type mice, demonstrating the importance
of TLT-1 function during the acute phases of sepsis.
Null mice display a distortion of both hemostatic and
immunological parameters. Plasma levels of one of
the major inflammatory mediators, tissue necrosis factor- α-(TNF- α-), is also elevated in the null mouse, demonstrating TLT-1 either directly or indirectly modulates immune function. Platelet counts in the null mouse
are significantly lower, while the levels of d-dimers are
elevated. These two important markers of sepsis, platelet count and d-dimers suggest the presence of a
more severe DIC in the null mouse (12).
The severity of DIC in the null mouse compared
to the wild type mouse was further supported in the localized Shwartzman model of vasculitis (12). The localized Shwartzman reaction, which correlates well with
the presence of DIC in humans, challenges the animal
subcutaneously with the inflammatory mediators LPS
and TNF-α and subsequently the lesion is evaluated
for hemorrhage, clotting, and leukocyte infiltration. Null
mice showed slightly increased amounts of microclots,
and neutrophil infiltration, however the quantity of hemorrhage was twofold and the area of the lesion was
almost three fold greater than in wild type mice (12).
These results are indicative of an important role in
maintaining vascular integrity and management of the
of DIC severity during sepsis.
Interestingly, levels of sTLT-1 increased after
LPS treatment in wild type mouse. After a spike at 6
hours sTLT-1 levels showed an increasing trend over a
24 hour period, potentially indicating an ongoing role for
TLT-1 or possibly sTLT-1 during sepsis. Based on this
study we would predict that in humans similar processes are occurring and we would see elevated sTLT-1 in
the plasma of patients suffering from sepsis. This exact
question was addressed in a clinical cross sectional
study evaluating sTLT-1 levels in patients diagnosed
with sepsis in the hospital Regional in Bayamon Puerto
Rico. This study revealed a substantial difference in
the levels of sTLT-1 in persons suffering from sepsis
compared to normal individuals, supporting an ongoing
role for TLT-1 during sepsis progression (12). This study was further supported by a second and independent
study in Nancy, France. In a longitudinal study, investigators evaluated critical care patients and showed that
not only are the sTLT-1 levels elevated, but that they
correlate with the presence of DIC as was predicted by
the murine studies (12). In fact, based on comparison
of ROC (receiver operator curve) values from d-dimers
and sTLT-1 with DIC scores, sTLT-1 may be a better
indicator of DIC than d-dimers, however more investigations need to be completed.
TLT-1 seems to have direct effect on hemostasis and at least an indirect effect on immune function.
The phenotype of the TLT-1-/- mice are vaguely reminiscent to the experiments eluted to above, where
the platelet α-granules were linked to the regulation
of thrombocytopenia induced bleeding. In a series of
experiments, Ho-Tin-Noe et al. (17) used thrombocytopenic mice to witness hemorrhage in the tumors
of thrombocytopenic mice and subsequently reduced
the bleeding using resting as opposed to activated platelets. The difference in platelet activation state clearly
point to the α-granules as the mediators of hemostasis
in thiese experiments. Further experimentation tied the
bleeding TNF-α recruitment of leukocytes to the tissues
there by increasing plasma leakage and bleeding (18).
Where the α-granules rescued the phenotype in thrombocytopenic mice with tumors, tumor growth in various
gene deficient mice shown to have moderate to severe
bleeding phenotypes including B3 (IIb IIIa), the collagen receptor - GP VI and fibrinogen nulls did not hemorrhage unless made thrombocytopenic (18,19). These
results suggested that the ability to form a stable clot
or platelet adhesion was not important to stop the capillary leakage. In our model, we can witness similar
etiologies without rendering our mice thrombocytopenic, suggesting that TLT-1 may mediate its control over
bleeding, at least in part, by regulation of neutrophils,
TNF-?, or both (unpublished observations).
CONCLUSION
Current data suggests that a possible mechanism where TLT-1 binding of fibrinogen signals to
the cytoskelatal scaffolding molecule moesin to bring
about changes or enhancement in platelet activation.
However, in the most recent publication we show that
in the presence of sTLT-1 increases platelet adhesion
to endothelial cells (20). A potential mechanism for the
increased adhesion may be that in the presence of
sTLT-1, platelets have greatly increased actin polymerization and increased spreading on glass slides which
could easily translate to increased platelet/endothelial
cell interaction (20). This data is also consistent with
the enhanced platelet aggregation induced by sTLT1 and suggests that TLT-1 identified interactions with
moesin and fibrinogen are probably small parts of a
much bigger picture.
Our published data indicates that TLT-1 plays
a role in sepsis. Understanding TLT-1 function will provide clues to the interactions of both immune and hemostatic function and mechanisms of cross talk during
the progression of sepsis. Use of the TLT-1 null mice
has already given us good insights into what we can
expect to learn from TLT-1. Ongoing work in our laboratory suggests TLT-1 may affect not only hemostasis,
but modulate the immune response as well. Taken together, these studies suggest that TLT-1 is a potential
therapeutic target for anti-thrombotic and potentially
anti-inflammatory intervention. We are looking toward
ongoing TLT-1 investigations to decipher TLT-1’s potential.
REFERENCES
(1) Cohen J. The immunopathogenesis of sepsis. Nature
2002;420(6917):885-91.
(2) Levi M, de JE, van der PT. Sepsis and disseminated intravascular coagulation. J Thromb Thrombolysis 2003;16(1-2):43-7.
(3) Levi M, van der PT. Coagulation in sepsis: all bugs bite
equally. Crit Care 2004;8(2):99-100.
(4) Dressler DK. DIC: coping with a coagulation crisis. Nursing 2004;34(5):58-62.
(5) Levi M. Platelets at a crossroad of pathogenic pathways in
sepsis. J Thromb Haemost 2004;2(12):2094-5.
(6) George JN. Platelets. Lancet 2000;355(9214):1531-9.
(7) Bouchard BA, Tracy PB. Platelets, leukocytes, and coagulation. Current Opinion in Hematology 2001;8(5):263-9.
(8) Ho-Tin-Noe B, Goerge T, Wagner DD. Platelets: guardians
of tumor vasculature. Cancer Res 2009;69(14):5623-6.
(9) Washington AV, Schubert RL, Quigley L et al. A TREM family member, TLT-1, is found exclusively in the alpha-granules of
megakaryocytes and platelets. Blood 2004;104(4):1042-7.
(10) Barrow AD, Astoul E, Floto A et al. Cutting edge: TREMlike transcript-1, a platelet immunoreceptor tyrosine-based inhibition motif encoding costimulatory immunoreceptor that enhances, rather than inhibits, calcium signaling via SHP-2. J Immunol
2004;172(10):5838-42.
(11) Allcock RJ, Barrow AD, Forbes S et al. The human TREM
gene cluster at 6p21.1 encodes both activating and inhibitory single IgV domain receptors and includes NKp44. Eur J Immunol
2003;33(2):567-77.
(12) Washington AV. TREM-like transcript-1 protects against
inflammation-associated hemorrhage by facilitating platelet aggregation in mice and humans. J Clin Invest 2009;0(0):0.
(13) Washington AV, Quigley L, McVicar DW. Initial characterization of TREM-like transcript (TLT)-1: a putative inhibitory receptor
within the TREM cluster. Blood 2002;100(10):3822-4.
(14) Gattis JL, Washington AV, Chisholm MM et al. The structure of the extracellular domain of triggering receptor expressed on
myeloid cells like transcript-1, and evidence for a naturally occurring soluble fragment. J Biol Chem 2006.
(15) Giomarelli B, Washington VA, Chisholm MM et al. Inhibition of thrombin-induced platelet aggregation using human singlechain Fv antibodies specific for TREM-like transcript-1. Thromb
Haemost 2007;97(6):955-63.
(16) Gomez-Rodriguez J, Washington V, Cheng J et al. Advantages of q-PCR as a method of screening for gene targeting in
mammalian cells using conventional and whole BAC-based constructs. Nucleic Acids Res 2008;36(18):e117.
(17) Ho-Tin-Noe B, Carbo C, Demers M et al. Innate immune
cells induce hemorrhage in tumors during thrombocytopenia. Am J
Pathol 2009;175(4):1699-708.
(18) Ho-Tin-Noe B, Goerge T, Cifuni SM et al. Platelet granule
secretion continuously prevents intratumor hemorrhage. Cancer
Res 2008;68(16):6851-8.
(19) Goerge T, Ho-Tin-Noe B, Carbo C et al. Inflammation induces hemorrhage in thrombocytopenia. Blood 2008;111(10):495864.
(20) Morales J, Villa K, Gattis J et al. Soluble TLT-1 modulates platelet-endothelial cell interactions and actin polymerization.
Blood Coagul Fibrinolysis 2010.
RESUMEN
La sepsis es un proceso inflamatorio multifactorial que diaramente mata a 1.400 personas
en el mundo. En plaquetas activadas se expresa el
receptor Transcripto-1 TREM-L (TLT-1). Estudios
de traslación de TLT-1 sugieren que su expresión
en plaquetas afecta los parámetros hemostáticos
e inmunológicos que conducen a la formación de
la coagulación intravascular diseminada (CID).
Modelos experimentales, de shock por toxemia en
ratones, muestran un aumento dramático de TLT1 soluble (sTLT-1) en sangre. Como resultado, en
la evaluación de sangre, en pacientes sépticos se
encuentran niveles de sTLT-1 que correlacionan
con la presencia de la CID en seres humanos.
Datos actuales, proponen que TLT-1 tiene un rol
importante en el mantenimiento de la integridad
vascular durante la sepsis, probablemente, por la
modulación tanto, de los sistemas inmunológico y
hemostático, que hace de TLT-1 un sujeto de estudio interesante no sólo para una mejor comprensión de la sepsis, pero también como parte de la
intervención terapéutica.
61
Failure To Pass
Meconium
ABSTRACT
Failure to pass meconium during the first
twenty-hours of life is a cardinal sign of a congenital low alimentary tract obstruction. This review
article discusses a systematic approach when confronting such problem to help clinicians arrive to
a correct diagnosis. Prenatal and postnatal diagnosis, imaging investigation, differential diagnosis
and management of the more common causes of
failure to pass meconium are reviewed.
Luis Lizardo Sánchez MS*
Humberto Lugo-Vicente, MD**
From the *UPR School of Medicine, and **Section of Pediatric Surgery, Department of Surgery, UPR School of Medicine.
Address reprints requests to: Humberto Lugo-Vicente MD
– PO Box 10426, San Juan, PR 00922. E-mail: titolugo@
coqui.net
Index words: failure, meconium, bowel, obstruction
INTRODUCTION
F
ailure to pass normal amounts of meco
nium during the first twenty-hours of life is a cardinal
sign of congenital low alimentary tract obstruction. Normal meconium is composed of amniotic fluid, debris
(squamous cells and lanugo hairs), succus entericus
and intestinal mucus. Meconium is sticky, dark green
or black, and up to 250 grams may be passed rectally.1
This review will discuss a systematic approach when
confronting this problem to help clinicians arrive to a
correct diagnosis.
diagnosis of fetal GI obstruction Progressive bowel dilatation in the third trimester and hyperperistalsis with
a dilated bowel loop are frequently found in cases of
small bowel obstruction, whereas intra-abdominal calcifications and ascites are nonspecific findings.4, 5
Prenatal History
Postnatal History
With the advent of maternal sonography many
neonatal surgical conditions in the fetus are diagnosed
before birth. With earlier accurate imaging diagnosis is
possible and special attention has to be directed toward
multidisciplinary counseling. The gastrointestinal (GI)
system is the most common site of birth defects, but it
is also the one wherein lies the greatest hope for a successful neonatal outcome. Prenatal diagnosis permits
appropriate counseling, planned delivery, and prompt
postnatal resuscitation and surgery with a good prognosis in most cases.2, 3
The baby that does not pass meconium early in
life usually shows vomiting and abdominal distension.
The vomiting associated with failure to pass meconium
is usually bilious in nature since the obstruction is distal to the ampulla of Vater. In newborn infants bilious
vomiting is always abnormal and an early sign of intestinal obstruction. When associated with abdominal
distension the diagnosis of low intestinal obstruction is
made.6-7
Findings in prenatal sonography alerting the
physician that a congenital GI anomaly should be suspected includes the presence of polyhydramnios, abnormal bubbles or cystic configurations, dilated bowel,
ascites and calcifications. Polyhydramnios is the first
clue of a high fetal intestinal obstruction since amniotic fluid elimination depends on absorption through the
first 30-40 centimeters of small bowel. The fetal GI tract
begins ingestion and absorption of amniotic fluid by
the 14th week. This fluid contributes to 17% effective
nutrition; proximally obstructed gut can cause growth
retardation. Fetal intestinal obstruction is caused by:
failure of recanalization (duodenal atresia), vascular
accidents (intestinal atresias), intrauterine volvulus, intussusception, or intraluminal obstruction (meconium
ileus). Polyhydramnios may not be present early in
gestation or with a distal obstruction. High GI obstruction such as pyloric, duodenal and jejunal atresia can
be suspected with findings of a single, double or triple
bubble respectively. Presence of abnormal cystic structures with a gravity-dependent sediment layering effect
within the fetal abdomen provides a specific sign in the
Cornerstone diagnostic aids in neonatal intestinal obstruction are prenatal ultrasound, simple abdominal films and colon contrast studies findings (see
Table 1). Early diagnosis depends largely on prompt
detection of obstructive manifestations by the clinician
and the subsequent accurate interpretation of radiographic findings. Plain films of the abdomen are key in
determining the level of obstruction and usually dictates, with clinical symptoms, the choice of the contrast
study to perform.8 Dilated bowel loops and air-fluid levels suggest surgical obstruction and is a common feature associated with intestinal atresias, Hirschsprung’s
disease, hypoplastic colon syndrome and intestinal
hypoperistalsis (Table 1). The absence of air-fluid levels with ground glass (soap water) appearance in the
right lower quadrant suggests meconium ileus. Dilated
bowel, air-fluid levels and calcifications is diagnostic of
complicated meconium peritonitis. Gasless distended
abdomen with an eggshell calcification is seen in giant
cystic meconium peritonitis.
62
Other anomalies including family history of
Hirschsprung's disease, cystic fibrosis, diabetic mother
and jejunal atresia are clues associated with prenatal
fetal intestinal obstruction.
Imaging Investigation
The aim of contrast enema studies is to
differentiate the various types of low intestinal obstruction (Table 1). Significant findings in contrast studies
are retention of barium past the first 24 hours of the
study, transitional zone, microcolon, cecum in an abnormal position, or meconium-plug within the colon.
Microcolon is a manifestation of intestinal obstruction
in utero seen in intestinal atresias, meconium ileus,
complicated meconium peritonitis and hypoperistalsis
syndrome.
Ultrasound (US) and CT-Scan are ancillary
imaging rarely needed to establish a diagnosis in neonatal intestinal obstruction. In meconium ileus and ileal
atresia both conditions can have similar plain abdominal films and both show a microcolon in the face of a
small bowel obstruction. US can help distinguish one
from the other as meconium ileus have multiple loops
of bowel filled with very echogenic thick meconium and
patients with ileal atresia have dilated loops of bowel
filled with fluid and air but no echogenic contents.9 US
features of inversion of the superior mesenteric artery
and superior mesenteric vein could aid in the diagnosis
of malrotation.10
A systematic diagnostic algorithm in cases of
newborns with failure to pass meconium associated
with bilious vomiting and abdominal distension is depicted in Figure 1.
Table 1. Imaging findings in neonatal intestinal
obstruction.
Differential Diagnosis
Failure to pass meconium (obstipation) in early
life is most commonly associated with the following
surgical obstructive conditions:
Intestinal atresia
Hirschsprung’s disease
Meconium Ileus
Complicated meconium peritonitis
Left hypoplastic colon syndrome
Meconium plug syndrome
Megacystis, Microcolon Intestinal Hypoperistal-
sis Syndrome
Imperforate anus (an obvious physical diagno-
sis)
Management
After the airway is secure, the infant is hydrated
and started in broad spectrum antibiotics. During initial
evaluation the baby is maintained in a warm humidified
environment to avoid hypothermia. A nasogastric tube
of appropriate size can help decompress the stomach
while placed in low intermittent suction (less than 20
cm of water suctioning pressure). If the neonate is in
a community or general hospital and has to be transferred to a neonatal intensive care facility, precise preevaluation and management during transportation is
extremely important in reducing morbidity and mortality.
PRENATAL US
ABDOMINAL FINDINGS
SIMPLE ABDOMINAL
FILMS FINDINGS
CONTRAST STUDY
FINDINGS
MOST PROBABLE
DIAGNOSIS
Dilated loops with fluid
Multiple dilated bowel
loops with air-fluid levels
Microcolon
Intestinal atresia
Bowel distension
Multiple bowel dilatation
with air-fluid levels
Transitional zone, barium retained beyond 24
hours
Hirschsprung disease
Microcolon, meconium
pellets
Meconium Ileus
Multiple bowel dilatation,
Multiple bowel loops,
echogenic thick meconium ground-glass appearance, no air fluid levels
Large cyst, extraluminal
calcifications, ascites
Bowel dilatation with
calcifications,Gasless
abdomen with eggshell
calcification
Microcolon or normal
colon
Meconium Peritonitis
Progressive dilatation of
fetal intestine
Bowel dilatation
Plug
Meconium Plug
Syndrome
Dilated bowel loops
Dilated bowel loops
Transitional zone in
splenic flexure
Left Hypoplastic Colon
Syndrome
Dilated stomach, dilated
bladder, dilated urinary
tract, absence of oligohydramnios (10)
Dilated bowel loops with
air-fluid levels
Microcolon
Megacystis, Microcolon
Intestinal Hypoperistalsis
Syndrome
Air above the pubo-coccygeal line
No need
Imperforate Anus
Dilated loops of bowel,
intraluminal calcifications
(11)
63
Figure 1. Diagnostic algorithm
for low neonatal intestinal obstruction
The infant weight is determined, and baseline
laboratory data, including complete blood and platelet
count, blood urea nitrogen, bilirubin, glucose, calcium,
pH, arterial blood gases, serum electrolytes, and types
and crossmatch (20 cc/ kg of weight) are obtained by
micro technique. Infant is taken to the operating room
in a thermally neutral environment. Operating room is
kept at 75 to 80 F. The patient is placed under a heat
lamp and the arms and the legs cover with cotton roll.
Monitoring of blood pressure, electrocardiogram; pulse
oximeter end-tidal carbon dioxide and temperature are
routine in each case.
Specific Conditions
Intestinal Atresias
Intestinal atresias are the product of a late intrauterine mesenteric vascular accident. Incidence has
been reported to occur in 1:5000 live births.11-13 They
are equally distributed from the ligament of Treitz to the
ileocecal junction. Classification is based in anatomic location and extent of atresia.14 There is bowel dilatation,
with distal (unused) micro-bowel. The diagnosis is suspected with maternal history of polyhydramnios (the higher the atresia), bilious vomiting, abdominal distension
and failure to pass meconium. At physical exam a white or gray plug can be obtained after rectal stimulation.
64
Simple films shows “thumb-size” dilated bowel loops,
and barium enema a microcolon of disuse. After preoperative stabilization, treatment consists of exploratory
laparotomy, resection of proximal dilated intestine, and
end to oblique anastomosis in distal jejuno-ileal atresias. Tapering jejunoplasty with anastomosis is preferred in proximal defects.15-16 The procedure of choice
for congenital duodenal obstruction is duodenoduodenostomy.17
Hirschsprung’s Disease
Hirschsprung’s disease is the congenital absence of parasympathetic innervation of the distal intestine. The primary etiology is attributed to failure of neural
crest cell migration during enteric nervous system development. Occurs 1-2 per 10,000 live births with a 4:1
male predominance for rectosigmoid disease and 1:12:1 for longer segment disease. The majority of these
neonates are born at term.18 Symptoms usually begin
at birth with delayed passage of meconium, vomiting,
and abdominal distention. In some infants, the presentation is that of complete intestinal obstruction. Others
have few symptoms until several weeks of age, when
the classic symptom of constipation has its onset. Initial
evaluation includes an unprepped barium enema (the
first enema should be a barium enema!). The aganglionic rectum appears of normal caliber or spastic, there
is a transition zone and then dilated colon proximal to
the aganglionic segment.19 Rectal suction biopsy remains as the gold standard diagnostic tool.20 After obtaining an adequate specimen, the procedure confirms
the diagnosis by demonstrating Acetylcholinesterase (AchE) positive nerve fibers in lamina propia and
muscularis mucosae, thick nerve trunks and absent
ganglion cells in the submucosa.21 Difficulty in interpreting the specimen would require a full-thickness
biopsy for definitive diagnosis. Conventional surgical
management of Hirschprung’s disease consisted in a
two or three- stage operation. First, a “leveling” colostomy is performed in the most distal colon with ganglion cells present. Placement of the colostomy in an
area of aganglionosis will lead to persistent obstruction.
Once the child has reached an adequate size and age
a formal pull-through procedure is done. Several modifications for the Soave, Duhamel and Swenson procedures (modified endorectal pull through) have evolved
during the past several years. Although a comprehensive review of surgical procedures showed that there is
no superior operation method, there is increasing interest among pediatric surgeons in performing a 1-stage
laparoscopic colonic pull through.22, 23 Moreover, a
prospective study comparing the Transanal one-stage
endorectal pull-through (TOSEPT) with the staged procedures demonstrated a significant decrease in postoperative pain, surgical complications, hospital stay and
cost burden.24
Meconium Ileus
Meconium Ileus (MI) is a neonatal intraluminal
intestinal obstruction associated with Cystic Fibrosis
(10-20%). The distal ileum is packed with an abnormally thick, viscous, inspissated meconium. The meconium has a reduced water content which is a result of
decreased pancreatic enzyme activity and a prolonged
small bowel intestinal transit time. MI can be classified
as simple or complicated. Simple MI appears in the first
48 hrs of life with abdominal distension and bilious vomiting. Complicated MI is more severe (< 24 hrs) with
progressive abdominal distension, respiratory distress,
and peritonitis. X-Ray findings are: dilated bowel loops,
absent air-fluid levels, “soap-bubble” granular appearance of distal ileum due to a mixture of air with the
tenacious meconium. Therapy consists of Gastrografin
enema for simple cases: hyperosmolar solution draws
fluid to the bowel lumen causing an osmotic diarrhea.
Operative therapy is reserved for failed gastrografin
attempts and complicated cases (associated to volvulus, atresias, gangrene, perforation or peritonitis). Surgical procedures have included: T-tube ileostomy with
irrigation, resection with anastomosis, and resection
with ileostomy (Mikulicz, Bishop- Koop and Santulli).
Post-operative management includes: 10% acetylcysteine p.o., oral feedings (pregestimil), pancreatic enzyme replacement, and prophylactic pulmonary therapy.
Long-term prognosis depends on the degree of severity and progression of cystic fibrosis pulmonary disease.25-32
Meconium Peritonitis
Meconium peritonitis (MP) is a chemical peritonitis
that occurs following bowel perforation during fetal life.
It is generally looked upon as benign, resulting in no
long-term sequelae. The peritonitis occurs when the
meconium leaves the bowel, enters the peritoneal cavity and spreads throughout causing a sterile inflammatory reaction. Most common site of bowel perforation
is the distal ileum, and 50% of babies with MP develop
intestinal obstruction. Prenatal ultrasound findings include ascites, intraabdominal masses, bowel dilatation
and the development of intraabdominal calcifications.
Bowel disorders which lead to MP in utero are those
resulting in bowel obstruction and perforation, such as
small bowel atresias, volvulus and meconium ileus.
MP can be divided into simple or complex. Cases with
spontaneously healed perforation (simple MP) need observation as they rarely develop symptoms. Newborns
with complex MP are born with bowel obstruction a/
or pseudocyst formation (localized collection of meconium contained in a cyst made of fibrous granulation
tissue). Complex MP needs surgical therapy based on
resection of peforated bowel and anastomosis.33-36
Left hypoplastic Colon Syndrome/Meconium Plug
Syndrome
The left (small) hypoplastic colon syndrome
(LHCS) is a very rare cause of colonic obstruction
identified in newborns with characteristic roentgenographic features resembling those of Hirschsprung’s
disease. Manifesting in the first 24-48 hours of life,
LHCS is a functional disturbance related to immaturity
of the intrinsic innervation of the colon that is especially
common in low birth weight neonates or of diabetic mothers. Intestinal perforation, sepsis, hypoglycemia and
death may occur. The diagnosis is suggested in a barium enema when the caliber of the left colon is small
with a transitional zone at the splenic flexure. Management consists of hypoglycemia correction, antibiotics,
nasogastric decompression and observation. In most
babies the obstruction clears in 48-72 hours. When
the clinical diagnosis is not readily apparent a rectal
biopsy and sweat chloride test should be done to differentiate LHCS from Hirschsprung disease and cystic
fibrosis respectively. The narrowed left colon remains
narrow in follow-up. In meconium plug syndrome, the
child expels a grey meconium or the barium enema will
delineate the plug. The association with Hirschsprung
disease is significant and rectal biopsy in these cases
is indicated. 37-39
Megacystis, Microcolon Intestinal Hypoperistalsis
Syndrome
First described by Berdon in 1976, the Megacystis, Microcolon Intestinal Hypoperistalsis Syndrome
(MMIHS), represents a rare lethal form of neonatal intestinal obstruction with 182 cases reported in the literature. It is seen in newborn girls showing complete
intestinal obstruction (absent meconium output and
bilious vomiting), large bladder causing a distended
abdomen (dilated urinary and upper gastrointestinal
tracts without distal anatomic obstruction), microcolon,
absent peristaltic activity, lax abdominal musculature,
and malrotation. Positive family history suggests autosomal recessive inheritance. Usual diagnostic studies
65
display: KUB (lacking gas shadow with ground glass
appearance), barium enema (malrotated, unused microcolon), cystogram (dilated bladder without distal
obstruction), IVP (hydroureter and hydronephrosis),
UGIS (foreshortened midgut), and suction rectal biopsy (ganglion cell present). Surgical and postmortem
specimens’ describe thin longitudinal muscle coats
with vacuolation and degeneration of smooth muscle
cells of bowel and bladder, increase connective tissue
between them, and abundant mature ganglion cells
(referred as hollow visceral myopathy). Recently, lack
of functional alpha subunits of the nicotinic acetylcholine receptor in MMHIS mice models may provide useful
information in the pathogenesis of this condition. Initial
management is gastrointestinal decompression, and
parenteral nutrition (TPN). Multivisceral transplantation
has been the only accepted modality treatment for this
condition, with limited success. The outcome is generally fatal; 23 of the 182 reported patients were alive,
the oldest being 18 years old.40-42
Imperforate Anus The incidence for this condition is 1 in 40005000 live births15. The vast majority of cases are
easily detected upon inspection of the perineal area.
Once the physical diagnosis of imperforate anus is
made, a nasogastric tube is passed to decompress the
stomach and rule out esophageal atresia. Further work
up should in include a whole body x-ray, cardiac and
renal ultrasonography to search for associated anomalies (VACTERL).43-44 In addition, it is of paramount
importance for the pediatric surgeon to rule out the presence of coexisting genitourinary malformations with
abdominal ultrasonography, which will further determine the rationale of the surgical approach. Currently,
surgical management options are Peña’s Posterior
Sagital Anorectoplasty and Georgeson’s laparoscopicassisted anorectoplasty.45 The addition of intraoperative MRI has been postulated as a promising adjunct in
refining the surgical procedure.46 The most common
postoperative challenges are related to incontinence
and remain to be determined with functional outcomes
studies. 7, 10, 47
References
1- Loening-Baucke V, Kimura K: Failure to pass meconium: diagnosing neonatal intestinal obstruction. Am Fam Physician 60 (7):
2043-50, 1999
2- Jassani MN, Gauderer MW, Fanaroff AA, Fletcher B, Merkatz IR:
A perinatal approach to the diagnosis and management of gastrointestinal malformations. Obstet Gynecol 59 (1): 33-9, 1982
3- Ruiz MJ, Thatch KA, Fisher JC, Simpson LL, Cowles RA: Neonatal outcomes associated with intestinal abnormalities diagnosed
by fetal ultrasound. J Pediatr Surg 44 (1): 71-4, 2009
4- Hernanz-Schulman M: Imaging of neonatal gastrointestinal obstruction. Radiol Clin North Am 37 (6): 1163-86, 1999
5- Barnewolt CE: Congenital abnormalities of the gastrointestinal
tract. Semin Roentgenol 39 (2): 263-81, 2004.
6- Kimura K, Loening-Baucke V: Bilious vomiting in the newborn:
rapid diagnosis of intestinal obstruction. Am Fam Physician 61(9):
2791-8, 2000
7- Hajivassiliou, CA: Intestinal Obstruction in Neonatal/Pediatric
Surgery. Seminars in Pediatric Surgery 12 (4): 241-253, 2003
8- De Backer AI, De Schepper AM, Deprettere A, Van Reempts
P; Vaneerdeweg W: Radiographic manifestations of intestinal obstruction in the newborn. JBR-BTR 82 (4): 159-66, 1999
66
9- Neal MR, Seibert JJ, Vanderzalm T, Wagner CW: Neonatal ultrasonography to distinguish between meconium ileus and ileal atresia. J Ultrasound Med 16(4):263-66, 1997
10- Macharia E, Huddart S: Neonatal abdominal conditions: a review of current practice and emerging trends. Pediatrics and Child
Health 20 (5): 207-14, 2010
11- Fairbanks TJ, Sala FG, Kanard R, Curtis JL, Del Moral PM, De
Langhe S, Warburton D, Anderson KD, Bellusci S, Burns RC: The
fibroblast growth factor pathway serves a regulatory role in proliferation and apoptosis in the pathogenesis of intestinal atresia. J
Pediatr Surg 41(1):132-36, 2006
12- Komuro H, Hori T, Amagai T, Hirai M, Yotsumoto K, Urita Y, Gotoh C, Kaneko M : The Etiologic Role of Intrauterine Volvulus and
Intussusception in Jejunoileal Atresia. J Pediatric Surg 39 (12):
1812-14, 2004
13- Sweeney B, Surana R, Puri P : Jejunoileal Atresia and Associated Malformations: Correlation With the Timing of In Utero Insult. J
Pediatr Surg 36 (5): 774-76, 2001
14- Stollman T, Blaauw I, Wijnen M, Frans H, Van der Staak P, Rieu
P, Draaisma J, Wijnen R: Decreased mortality but increased morbidity in neonates with jejunoileal atresia; a study of 114 cases over
a 34-year period. J Pediatric Surg 44: 217-21, 2009
15- Pierro A, Hall N, Chowdhury M: Gastrointestinal surgery in the
neonate. Current Paediatrics 16 (3): 153-64, 2006
16- Wales PW, Dutta S: Serial transverse enteroplasty as primary
therapy for neonates with proximal jejunal atresia. J Pediatric Surg
40: E31-E34, 2005
17- Escobar MA, Ladd AP, Grosfeld JL, West KW, Rescorla FJ,
Scherer LR , Engum SA, Rouse TM, Billmire DF: Duodenal Atresia and Stenosis: Long-Term Follow-Up Over 30 Years. J Pediatric
Surg 39 (6): 867-71, 2004
18- Haricharan R, Georgeson K: Hirschsprung disease. J Pediatric
Surg 17 (4): 266-275, 2008
19- Lewis NA, Levitt MA, Zallen GS, Zafar MS, Iacono KL, Rossman
JE, Caty MG, Glick PL: J Pediatr Surg 38 (3): 412-6, 2003
20- Martucciello G, Pini Prato A, Puri P, Holschneider AM, MeierRuge W, Jasonni V, Tovar JA, Grosfeld JL: Controversies concerning diagnostic guidelines for anomalies of the enteric nervous
system: a report from the fourth International Symposium on
Hirschsprung's disease and related neurocristopathies. J Pediatr
Surg 40 (10): 1527-31, 2005
21- Pini-Prato A, Martucciello G, Jasonni V: Rectal suction biopsy in
the diagnosis of intestinal dysganglionoses: 5-year experience with
Solo-RBT in 389 patients. J Pediatr Surg 41 (6): 1043-8, 2006
22- Marquez TT, Acton R, Hess D, Duval S, Saltzman D: Comprehensive review of procedures for total colonic aganglionosis. J
Pediatr Surg 44: 257–65, 2009
23- Keckler S, Yang J, Fraser J, Aguayo P, Ostlie D, Holcomb G,
St Peter S: Contemporary practice patterns in the surgical management of Hirschsprung's disease. J Pediatr Surg 44 (6): 1257-60,
2009
24- Aslanabadi S, Ghalehgolab-Behbahan A, Zarrintan S: Transanal one-stage endorectal pull-through for Hirschsprung's disease:
a comparison with the staged procedures. Pediatr Surg Int 24 (8):
925-929, 2008
25- Gorter R, Karimi A, Sleeboom C, Kneepkens C, Heij H: Clinical
and Genetic Characteristics of Meconium Ileus in Newborns With
and Without Cystic Fibrosis. J Pediatr Gastroenterol Nutr 50 (5):
569-72, 2010
26- Maheshwari P, Abograra A, Shamam O: Sonographic evaluation of gastrointestinal obstruction in infants: a pictorial essay. J
Pediatr Surg 44 (10): 2037–2042, 2009
27- Emil S, Nguyen T, Sills J, Padilla G: Meconium obstruction in
extremely low birth weight neonates: guidelines for diagnosis and
management. J Pediatr Surg 39 (5): 731-37, 2004
28- Burke M, Ragi J, Karamanoukian H, Kotter M, Brisseau G, Borowitz D, Irish M, Glick P: New strategies in Nonoperative Management of Meconium Ileus. J Pediatr Surg 37 (5): 760-64, 2002
29- Copeland D, St Peter S, Sharp S, Islam S, Cuenca A, Tolleson
J, Dassinger M, Little D, Jackson R, Kokoska E, Smith S: Diminishing role of contrast enema in simple meconium ileus. J Pediatr
Surg 44 (11): 2130-32, 2009
30- Jawaheer J, Khalil B, Plummer T, Bianchi A, Morecroft J,
Rakoczy G, Bruce J, Bowen J, Morabito A: Primary resection and
anastomosis for complicated meconium ileus: a safe procedure?
Pediatr Surg Int 23 (11): 1091-93, 2007
31- Mak GZ, Harberg FJ, Hiatt P, Deaton A, Calhoon R, Brandt ML:
T-tube ileostomy for meconium ileus: four decades of experience. J
Pediatr Surg 35 (2): 349-52, 2000
32- M Kappler, M Wassilewa, C Schröter, A Kraxner, M Griese:
Long-term outcome after meconium ileus. Journal of Cystic Fibrosis 6, Supplement 1: S46, 2007.
33- Shyu MK, Shih JC, Lee CN, Hwa HL, Chow SN, Hsieh FJ:
Correlation of prenatal ultrasound and postnatal outcome in meconium peritonitis. Fetal Diagn Ther 18 (4): 255-61, 2003
34- Chan KL, Tang MH, Tse HY, Tang RY, Tam PK: Meconium peritonitis: prenatal diagnosis, postnatal management and outcome.
Prenat Diagn 25 (8): 676-82, 2005
35- Nam SH, Kim SC, Kim DY, Kim AR, Kim KS, Pi SY, Won HS,
Kim IK: Experience with meconium peritonitis. J Pediatr Surg 42
(11): 1822-25, 2007
36- Tsai MH, Chu SM, Lien R, Huan HR, Luo CC: Clinical manifestations in infants with symptomatic meconium peritonitis. Pediatr
Neonatol 50 (2): 59-64, 2009
37- Keckler SJ, St Peter SD, Spilde TL, Tsao K, Ostlie DJ, Holcomb GW 3rd, Snyder CL: Current significance of meconium plug
syndrome.J Pediatr Surg 43 (5): 896-98,2008
38- Ellis H, Kumar R, Kostyrka B: Neonatal small left colon syndrome in the offspring of diabetic mothers-an analysis of 105 children.
J Pediatr Surg 44 (12): 2343-46, 2009
39- Burge D, Drewett M: Meconium plug obstruction. Pediatr Surg
Int 20 (2): 108-10, 2004
40- WE Berdon, DH Baker, WA Blanc, B Gay, TV Santulli, C Donovan: Megacystis-microcolon-intestinal hypoperistalsis syndrome: a
new cause of intestinal obstruction in the newborn. Report of radiologic findings in five newborn girls. Am J Roentgenol 126 (5):
957-64, 1976
41- Puri P, Shinkai M: Megacystis microcolon intestinal hypoperistalsis syndrome. Sem Pediatr Surg 14: 58-63, 2005
42- Raofi V, Beatty E, Testa G, Abcarian H, Oberholzer J, Sankary
H, Grevious M, Benedetti E: Combined living-related segmental liver and bowel transplantation for megacystis-microcolon-intestinal
hypoperistalsis syndrome. J Pediatr Surg 43 (2): e9-e11, 2008
43- Pena A, Hong A: Advances in the management of anorectal
malformations. Am J Surg 180 (5): 370-76, 2000
44- Chen CJ: The Treatment of Imperforate Anus: Experience With
108 Patients. J Pediatr Surg: 34 (11): 1728-32, 1999
45- Ichijo C, Kaneyama K, Hayashi Y, Koga H, Okazaki T, Lane
GJ, Kurosaki Y, Yamataka A: Midterm postoperative clinicoradiologic analysis of surgery for high/intermediate-type imperforate anus:
prospective comparative study between laparoscopy-assisted and
posterior sagittal anorectoplasty. J Pediatr Surg 43 (1): 158-62,
2008
46- Raschbaum GR, Bleacher JC, Grattan-Smith JD, Jones RA:
Magnetic resonance imaging-guided laparoscopic-assisted anorectoplasty for imperforate anus. J Pediatr Surg 45 (1): 220-23,
2010
47- Hashish MS, Dawoud HH, Hirschl RB, Bruch SW, El Batarny
AM, Mychaliska GB, Drongowski RA, Ehrlich PF, Hassaballa SZ,
El-Dosuky NI, Teitelbaum DH. Long-term functional outcome and
quality of life in patients with high imperforate anus. J Pediatr Surg
45 (1): 224-30, 2010.
RESUMEN
La ausencia de meconio durante las primeras veinticuatro horas de vida de un recién
nacido es un signo cardinal de que podría existir una obstrucción congénita del tracto gastrointestinal bajo. Este articulo de reseña discute como desarrollar un abordaje sistemático a
este problema ayudando al clinico en obtener
un diagnostico certero. Se repasan el diagnostico prenatal y postnatal, uso de imágenes,
diagnostico diferencial y manejo de las causas
mas comunes de obstrucción congénita intestinal.
AUTORES
AUTHORS
Los invitamos a continuar colaborando con sus artículos en nuestro Boletín
Médico-Científico.
Por favor, antes de enviar su material
lea las instrucciones para autores en la
página siguiente.
We invite you to colaborate with your
articles in our medical-scientific “Boletin”.
Please, before send your writings, read
our instructions for authors in the next
page.
NO ENVIE PAPEL
DON’T SEND
PAPERS
B LETÍN
ASOCIACIÓN MÉDICA DE PUERTO RICO
Instrucciones para los Autores
Sólo serán considerados los artículos que cumplan estas instrucciones.
Instructions to Authors
We will take only articles that follow this instructions.
ACEPTAMOS SOLO DOCUMENTOS DIGITALES
WE ACCEPT DIGITAL DOCUMENTS, ONLY
El “Boletín” acepta para publicación artículos relativos a medicina,
cirugía y las ciencias afines. Igualmente acepta artículos especiales
y correspondencia que pudiera ser de interés general para la profesión
médica. Se requiere que los autores se esfuercen en perseguir claridad,
brevedad, e ir a lo pertinente en sus escritos, no importa el tema o formato
del manuscrito. El artículo, si se aceptara, será con la condición de que se
publicara únicamente en la revista.
The “Boletín” will accept for publication contributions relating to the various
areas of medicine, surgery and allied medical sciences. Special articles
and correspondence on subjects of general interest to physicians will also
be accepted. All material is accepted with the understanding that is to be
published solely in this journal. All authors are urged to seek clarity, brevity,
and pertinence in the manuscripts regardless of subject or format.
FORMATO:
FORMAT:
Textos: Word (.doc) u OpenOffice (.odt), solamente. Letra arial 12 regular,
texto justificado, espacio simple, doble espacio entre parrafos. Titulos en
negrita.
Texts: Word (.doc) or OpenOffice (.odt), only. Arial Font size 12 regular, text
justified, single space, double space between paragraphs. Tittles in bold
letters.
Fotos, ilustraciones, tablas, graficos: Archivos jpg, pdf, png o tif. No los incruste en los archivos de textos, envielos por separado y ponga en el texto
la referencia donde va cada uno.
Photos, Ilustrations, tables, and graphics: Jpg, pdf, png or tif files. Don’t
embed your ilustrations into text files, sent them by separate, and reference
your texts with each ilustration.
DESTINO:
DESTINATION:
Solo aceptaremos trabajos enviados por e-mail a:
We will accept works sent by e-mail, only, to:
[email protected]
Deberá incluirse lo siguiente: título, nombre de autor(es) y su grado (ej.: MD,
FACP), ciudad donde se hizo el trabajo, el hospital o institución académica,
patrocinadores del estudio, y si un artículo ha sido leído en alguna reunión
o congreso, así debe hacerse constar como una nota al calce.
El articulo debe comenzar con una breve introducción en la cual se
especifique el propósito del mismo. Las secciones principales (como por
ejemplo: materiales y métodos) deben identificarse con un encabezamiento
en letras mayuscula negritas (bold).
Artículos referentes a resultados de estudios clínicos o investigaciones
de laboratorio deben organizarse bajo los siguientes encabezamientos:
introducción, Materiales y Métodos, Resultados, Discusión, Resumen (en
español e inglés), Reconocimiento y Referencias.
Artículos referentes a estudios de casos aislados deben organizarse
en la siguiente forma: Introducción, Materiales y Métodos si es
aplicable,Observaciones del Caso, Discusión, Resumen (en español e
inglés), Reconocimientos y Referencias.
• Nomenclatura
Deben usarse los nombres genéricos de los medicamentos. Podrán usarse
también los nombres comerciales, entre paréntesis, si así se desea se
usará con preferencia el sistema métrico de pesos y medidas.
• Resumen
Un abstracto no mayor de 250 palabras en estudios clínicos y no mayor
de 150 palabras en reporte de casos o reseña. Debe incluir los puntos
principales que ilustren la substancia del artículo y la exposición del
problema, métodos, resultados y conclusiones. El resumen debe estar
escrito en inglés y en español.
• Referencias
Las referencias deben ir numeradas sucesivamente de acuerdo a su
aparición en el texto. Los números deben aparecer en paréntesis al nivel
de la línea u oración y no como subindices ni ninguna otra forma de
referencia. Al final de cada artículo las referencias deben aparecer en el
orden numérico en que se citan en el texto. Deben utilizarse solamente
las abreviaturas para títulos de revistas científicas según indicadas en el
“Cumulative Index Medicus" que publica la Asociación Médica Americana.
Las referencias deben seguir el patrón que se describe a continuación.
1. Para artículos de revistas: Apellido(s) e iniciales del nombre del autor(es),
título del artículo, nombre de la revista, año, volumen, páginas. Por ejemplo:
Villavicencio R: Soplos inocentes en pediatría, Bol Asoc Méd P Rico 198 1;
73: 479-87. Si hay más de 7 autores, incluir los primeros 3 y añadir et al.
2. Para citación de libros donde el autor(es) del capítulo citado es a su
vez el (los) editor(es): Apellido(s) e iniciales del autor(es), título del libro,
número de edición, ciudad, casa editora, año y página. Por ejemplo: Keith
JD, Rowe RD, Vlad P: Heart disease in infancy and childhood, 3d. Ed., New
York, MacMillan, 1978: 789
3. Para citación de libros donde el editor(es) no es el autor(es) del capítulo
citado se añade el autor(es) del capítulo y el título del mismo. Por ejemplo:
Olley PM: Cardiac arrythmias; In: Keith ID, Rowe RD, Vlad P Eds. Heart
disease in infancy and childhood, 3d Ed., New York, MacMillan, 1978: 275301
[email protected]
Abstract in Spanish and English.
Should include the following: title, authors and their degrees (e.g. MD,
FACP), city where the work was done, hospital or academic institutions,
acknowledgments of financial sponsors, and if the paper has been at a
meeting the place and date should be given.
The article should start with a brief introductory paragraph or paragraphs
which should state its purpose. The main sections (for example, Materials
and Methods) should be identified by heading in bold capital letters.
Articles reporting the results of clinical studies or laboratory investigation
should be organized under the following headings: Introduction, Materials
and Methods, Result if indicated, Discussion, Summary in English and
Spanish, Acknowledgments if any, and References.
• Nomenclature
Generic names of drugs should be used; trade names my also be given
in parenthesis, if desired, metric units of measurement should be used
preferentially.
• Abstract
An abstract not longer than 250 words for clinical studies and no longer than
150 words for case reports and reviews. It must include the main points that
present the core of the article and the exposition of the problem, method,
results, and conclusions. The Abstract should be written both in Spanish
and English.
• References
These should be numbered serially as they appear in the text. The number
should be enclosed in parentheses on the line or writing and not as
superscript or subscripts, numbers. At the end of the article references
should be listed in the numerical order in which they are first cited in the
text.The titles of journals should be abbreviated according to the style used
in the "Cumulative Index Medicus" published by the American Medical
Association. The correct forms of references are as given below:
1. For periodicals: Surname and initials of author(s), title of article, name
of journal, year, volume, pages. For example: Villavicencio R.: Soplos
inocentes en pediatría. Bol Asoc Med P Rico 198 1; 73: 479 87. If there are
more than 7 authors list only 3 and add et al.
2. For books when the authors of the cited chapter is at the same time the
editor: Surname and initials of author(s), title, edition, city, publishing house,
~ear and page. For example: Keith JD, Rowe RD, Vlad P: Heart disease in
infancy and childhood, 3d Ed., New York, MacMillan, 1978: 789
3. For chapter in book when the author of the chapter is not one of the Olley
PM: Cardiac arrythmias: In: Keith JD, Rowe RD, Vlad P. Eds. Heart disease
in infancy and childhood, 3d Ed. New York, MacMillan, 1978, 275-301
DON’T SEND PAPERS. SEND EMAIL
NO ENVIE PAPEL. ENVIE EMAIL
Case Reports / Reporte de Casos
ABSTRACT
Familial Mediterranean Fever (FMF) is an
autosomal recessive disorder predominantly affecting people of Mediterranean origin. It is characterized by recurrent episodes of fever and polyserositis of unexplained origin. Most patients with FMF
experience their first attack in early childhood with
90% suffering their first bout of pain by the age of
20. We present a case of a 68 years old woman
who presented with fevers of 9 months of evolution
which culminated with a diagnosis of Familial Mediterranean Fever after successful treatment with
Colchicine.
Index words: familial, Mediterranean, fever
INTRODUCTION
F
amilial Mediterranean Fever (FMF) is an autosomal recessive disorder characterized by recurrent
episodes of fever and polyserositis (5). The histologic
findings are non specific inflammation with neutrophil
infiltration and formation of exudates of the involved tissue. The acute attacks are variable in frequency often
with recurrent episodes of pain and fever on a weekly
basis with periods of remission which may last years.
The involved serosa may include the peritoneum, synovial membranes or pleura. It affects primarily people
of Mediterranean origin, particularly Sephardic Jews,
Armenians, Arabs and Turks. Most patients with FMF
experience their first attack in early childhood with initial attacks occurring before the age of 20 years. The
majority of patients (65%) suffer the first attack before
the age of 10 with less than 10% of patients reporting
initial symptoms after the age of 20. We present a 68
years old Puerto Rican woman with a history of recurrent episodes of fevers and abdominal pain for nine
months diagnosed with FMF after a negative work up
and successful therapy with Colchicine.
Case History
This is the case of a 68 years old woman with
a nine month history of intermittent episodes of fever
accompanied with abdominal pain. The fever was
episodic in nature often occurring on a weekly basis,
they spontaneously abated after 24 hours and usually occurred in the same day of the week. This pattern
was reported for the initial weeks and then it evolved
to twice weekly for nine months. The fever was accompanied with non specific diffuse abdominal pain,
without nausea, vomiting or changes in the bowel movements. Additional symptoms included incapacitating
body aches and arthralgias predominantly in large joints. Antipyretics were unsuccessful in control the fever
or her other symptoms. She denied the presence of
Late Presentation
Of Familial
Mediterranean
Fever:
A Case Report
Limaris Russe Gomez MD
Robert Hunter Mellado MD
PR 00960-6032
Address reprints requests to: Robert Hunter Mellado, MD
-Internal Medicine Department, Universidad Central del Caribe, School of Medicine, Call Box 60-327, Bayamón, PR
00960-6032. Email: [email protected]
cough, shortness of breath, diarrhea, dysuria, weight
loss, pruritus or night sweats.
A past history of osteoarthritis since the age of
25 years was obtained, hypertension, hypothyroidism
for more than 20 years ago, bronchial asthma and chronic gastritis for the last 10 years. Her current medications included nonsteroidal anti-inflammatory agents,
ibersartan and levoxyl. A history of a total abdominal
hysterectomy in her early 40’s was obtained. No history of smoking, drug or alcohol use was reported. A
childhood history of pneumonia and possibly malaria
was elicited. Her family history was negative for similar
symptoms of fever and her ancestors for at least two
generations were from Puerto Rico.
On examination she was found febrile (39.5)
with otherwise normal pulse and vital signs. Diffuse
abdominal tenderness was present with questionable
rebound tenderness. Bowels sounds were active and
no involuntary guarding was present. The rest of the
physical examination was unremarkable, specifically
normal joints, heart and lung exam. Subsequent reexamination 4 days later when she was a febrile was
normal.
Complete blood cell count and differential revealed mild neutrophilia. Peripheral blood smear was
normal. Blood and urine cultures were negative. Antinuclear antibodies test was negative. Serum Protein
Electrophoresis revealed polyclonal gamma globulin
pattern. The serum immunofixation did not reveal a
monoclonal protein. Elisa tests for HIV and CMV were
negative for infection. The sedimentation rate and urine
analysis were also normal. Magnetic Resonance Imaging of the chest, abdomen and pelvis demonstrated
evidence of hysterectomy, colonic diverticulosis, prior
coccygeal fracture, lumbar dextroscoliosis with spondylosis and degenerative joint disease. A subcentimeter
69
hepatic cyst was seen, a left renal simple cyst and questionable nephrolithiasis were identified. The Gallium
Scan and PET/CT SCAN were normal. All imaging
studies were non contributory as to the explanation for
the febrile events. A posterior iliac bone aspiration and
biopsy was performed demonstrating a normocellular
bone marrow with a normal immunophenotypic profile.
The biopsy was normal with no evidence of granulomas or foreign cells. A colonoscopy showed internal
hemorrhoids along with distal diverticulosis.
At this point the possibility of Familial Meditarrenean Fever was considered and colchicine (0.6mg
tid) was added to her therapy. After 16 days of colchicine therapy her episodes of fever and abdominal pain
abated.
DISCUSSION
Familial Mediterranean Fever is a disorder characterized by sporadic, paroxysmal attacks of fever
and serosal inflammation. It is inherited as an autosomal recessive trait and has been described primarily in
ethnic groups originating from the Mediterranean litoral – Sephardics Jews, Armenians, Turks, North Africans, Arabs, and less commonly Greeks and Italians.
The disease is not restricted to these groups since the
FMF has been diagnosed in other ethnic groups. For
this reason ancestry should not be used to rule out the
diagnosis if the signs and symptoms of the disease are
present (6, 7).
Most patients with FMF experience their first
attack in early childhood. The typical manifestations of
the disease are recurrent attacks of severe pain due
to serositis and fever, lasting from one to three days,
and then resolving spontaneously (5). The majority of
the serositis (95%) includes the abdomen (peritonitis)
which in many cases mimics a surgical abdomen. Other
common areas of serositis are the pleura, which could
manifest as a transient pleural effusion; and synovitis.
Less common manifestations include erysipelas-like
skin lesions, pericarditis, orchitis, aseptic meningitis
or dermal vasculitis. Between attacks, patients are asymptomatic (8).
As there is no specific serologic or molecular
test sensitive enough to establish a diagnosis of FMF,
the diagnosis is usually based on the Tel-Hashomer
Criteria (Table I). This formula contains major and minor criteria which if met carry a very high sensitivity and
specificity (Figure 1). Our patient has 2 major criteria
– fever alone and response to colchicine, 1 minor criteria – incomplete abdominal symptom and 3 supportive
criteria, providing a sensitivity of 57% with a specificity
of 99%.
Diagnosis may be extremely difficult to establish in the presence of atypical signs or in patients
with a late onset of manifestations. The absence of a
family in the setting of an atypical ethnic background
adds to the diagnostic challenge. It is nevertheless critical to think of FMF in the appropriate setting to avoid
the debilitating manifestations of the disease and offer
the opportunity for remission with colchicines therapy.
70
Colchicine is an efficient therapy for the acute attacks and
the prevention of amyloidosis which may be seen as a
chronic sequelae of FMF (9). It is unclear if the tissue deposition of amyloid is due solely to the by-products of recurrent systemic inflammation or whether there is a contribution from the underlying genetic defect of the disease.
The presence of amyloidosis is usually heralded by the
development of proteinuria with progression to end stage
renal disease from 2 to 13 years (10, 11).
Recent description of a particular genetic marker
for the disease has been reported. The MEFV gene probe establishes the future possibility of a molecular based
diagnosis. This FMF gene is situated in the short arm of
chromosome 16 and encodes for the protein pyrin. It is a
major regulatory component of the inflammasome, a complex of proteins that, when activated, trigger the release
of IL-1 beta and are mediators of apoptosis. Dysregulation of the inflammasome complex is thought to underlie
the autoinflammatory disease state. Other mutated genes
within this complex of proteins are in the process of identification. Evidence that another gene may modulate the
clinical expression of the MEFV gene is the segregation
of different alleles of the major histocompatibility class I
chain-related gene A (MICA) among FMF patients with different clinical features (3, 12, 13).
Table I. Tel-Hashomer Criteria (1)
Major Criteria
Minor Criteria
Typical attacks
Incomplete attacks involving one or more site:
Peritonitis
Abdomen
Pleuritic (unilateral)
or pericarditis
Chest
Monoarthritis
(hip, knee, ankle)
Joint
Fever alone
Exertion leg pain
Favorable response to colchicines
Supportive criteria:
1. Family history of FMF
2.
Appropriate ethnic origin
3. Age < 20 years at disease onset
4.
Features of attacks (independently):
a. severe, requiring bed rest
b. spontaneous remission
c. symptom free interval
d. transient inflammatory response, with one or more abnormal test result for the WBC, Sed rate, serum amyloid A, and/or fibrinogen
5. Episodic proteinuria.
6. Unproductive laparotomy or removal of white appendix
7. Consanguity of parents.
CONCLUSION
This case illustrates an atypical case of Familial Mediterranean Fever diagnosed at 68 years old following Tel-Hashomer criteria. This case emphasizes
the importance of including FMF in the evaluation of
fever of unknown origin. Therapy with Colchicine is
effective for the control of clinical manifestations.
REFERENCES
FIGURE 1: Familial Mediterranean Fever: Signs &
Symptoms (1) AUTHOR: Limaris Russe Gomez, MD
Figure 2: Classification
tree using the detailed criteria for the diagnosis of
familial mediterranean fever (2) AUTHOR: Limaris
Russe Gomez, MD
1.
Haghighat M. Dearschashan A, Karamsfas H. Familial Mediterranean Fever. Shiraz
E. Medical Journal. Vol 7. Num. 2, April 2006.
2.
Livneh, A. Langevitz, P. Zemer, D, et al.
Arthritis. Rheum. 1997; 40, 1879.
3.
Samuels, J. Aksentijevich, I. Torosyan,
Y. et al. Familial Mediterranean Fever at the millenim. Clinical spectrum, ancient mutation and a
variety of 100 American referrals of the National
Institutes of Health. Medicine (Baltimore) 1998;
77:268.
4.
Sohar, E, Gafni, J, Pras, M, Heller, H.
Familial Mediterranean fever. A survey of 470
cases and review of the literature. Am J Med
1967; 43:227.
5.
Lidar, M, Yaqubov, M, Zaks, N, et al.
The prodrome: a prominent yet overlooked preattack manifestation of familial Mediterranean
fever. J Rheumatol 2006; 33:1089.
6.
Ben-Chetrit, E, Levy, M. Familial Mediterranean Fever. Lancet 1998; 351:659
7.
Ertekin, V, Selimoglu, MA, Alp, H, Yilmaz, N. Familial Mediterranean fever protracted
febrile myalgia in children: report of two cases.
Rheumatol Int 2005; 25:398.
8.
Kees, S, Langevitz, P, Zemer, D, et al.
Attacks of pericarditis as a manifestation of familial Mediterranean fever (FMF). QJM 1997;
90:643.
9.
Vander Hilst, JC, Simon, A, Drenth, JP.
Hereditary periodic fever and reactive amyloidosis. Clin Exp Med 2005; 5:87.
10.
Ozen, S, Ben-Chetrit, E, Bakkaloglu, A,
et al. Polyarteritis nodosa in patients with Familial Mediterranean Fever (FMF): a concomitant
disease or a feature of FMF? Semin Arthritis
Rheum 2001; 30:281.
11.
Pras, M. Amyloidosis of familial Mediterranean fever and the MEFV gene. Amyloid
2000; 7:289.
12.
Tunca, M, Akar, S, Onen, F, et al. Familial Mediterranean fever (FMF) in Turkey: results
of a nationwide multicenter study. Medicine (Baltimore) 2005; 84:1.
13.
Heller, H, Sohar, E, Gafni, J, Heller, J.
Amyloidosis in familial Mediterranean fever. An
independent genetically determined character.
Arch Intern Med 1961; 107:539.
RESUMEN
Fiebre Mediterránea Familiar
(FMF) es un desorden autosómico
recesivo que afecta predominantemente a personas de antecesores
mediterráneos, especialmente judíos, sefarditas, armenios, turcos y
árabes. Se caracteriza por episodios
recurrentes de fiebres y serositis.
La mayoría de los pacientes experimenta su primer ataque durante
la niñez; 90% son diagnosticados
antes de los 20 años de edad. Este
es un caso de una mujer de 68 años
con fiebre de 9 meses de evolución
y que fue diagnosticada con Fiebre
Mediterránea Familiar después que
sus fiebres cesaran con tratamiento
con Colchicina.
71
Rectal Stricture: A
Rare
Presentation
Of Primary
Amyloidosis
Jaime Rodríguez Santiago MD
Jennifer Oppenheimer Catalá MD
José Ramírez Rivera MD
From the Internal Medicine Department, Universidad Central del Caribe, School of Medicine, Bayamon, PR.
Address reprints requests to: José Ramírez Rivera MD –
Universidad Central del Caribe, Department of Internal Medicine, Call Box 60327, Bayamón, PR 00960-6032. E-mail:
[email protected]
Presented in part as a poster. Third prize winner in the Associates Clinical Vignette Competition of the American College
of Physicians on October 31, 2009 at the Embassy Suites
Hotel, Dorado, Puerto Rico.
ABSTRACT
Amyloidosis is a process were an abnormal protein deposits in tissues. This deposit accumulates and may eventually cause a variety
of nonspecific symptoms. Primary amyloidosis
refers to amyloidosis caused by an underlying
plasma cell disorder. Protein electrophoresis
showing a monoclonal band is suggestive of the
disease but in order to make the diagnosis, the
presence of amyloid deposition on tissues must
be shown by biopsy. We present a woman in
whom primary amyloid is manifested as a rectal
stricture. She came to the gastroenterology clinics complaining of hematochezia, weight loss,
decreased appetite and abdominal pain. Her
only sign of organ damage was mild to moderate
proteinuria (80mg per day). The patient also had
an unusual retroperitoneal infiltration with encasement of the abdominal aorta.
Index words: rectal, stricture, amyloidosis, primary
INTRODUCTION
A
myloidosis is a rare condition characterized by the extracellular deposition of insoluble polymer
fibrils with a characteristic appearance on electron microscopy and ability to bind Congo Red. The resulting
crystalloid has a green birefringence under polarized
microscopy. In 1854, Rudolf Virchow adopted the term
“amyloid”, introduced by Schleiden in 1838 to describe
the tissue deposits of material that stained in a similar
manner to cellulose when exposed to iodine(1).
Although twenty-five different human and five
animal amyloidal subunits have been described (2),
the most common types of amyloidosis are primary
(AL), secondary (AA), dialysis-related, heritable, agerelated (senile) systemic and organ-specific amyloidosis. AL and AA are the most common type of amyloidosis. AL or primary amyloidosis refers specifically to the
form of amyloidosis in which the precursor proteins are
monoclonal immunoglobulin light chains. Fibrils are
derived from the variable region of lambda light chains
in approximately 75 percent of cases and from the kappa chain in the remaining 25 percent (3-5). AL can
occur alone or in association with multiple myeloma,
Waldenstrom’s macrogloglobulinemia or with malignant disorders of lymphoplasmatic cells. We describe
a patient with rectal bleeding, an unusual presenting
symptom for AL amyloidosis.
Case History
A 58-year-old-woman with arterial hypertension effectively controlled with atenolol, verapamil and
enalapril was referred to the gastroenterology outpatient clinics. She had a lifelong history of constipation
and hemorrhoids, and easy bruising around eyes and
72
extremities, but a barium enema during the previous
year was negative. During the three months preceding
admission, she had lost her appetite, developed constant right lower abdominal pain and documented a 30
pound weight loss. She had noted previously hematochezia about once a month, but during the last month
bright red blood accompanied almost every stool; and
the caliber of stools was reduced. She denied recurrent
fever, a Mediterranean background, rheumatic disease,
blood transfusions, heart failure, nephrotic syndrome,
coagulation anomalies, liver abnormalities, multiple
myeloma or kidney dysfunction. The patient was allergic to penicillin and sulfa drugs (rash and tachycardia
respectively). She had had two cesarean sections, a
tubal ligation, a cholecystectomy and a tonsillectomy.
No other hospitalizations.
Physical examination revealed an overweight
(5’6’’, 150lbs) clear-skinned Puerto Rican woman who
appeared acutely ill. Her temperature was 36.8C, heart
rate 74, respiratory rate 18, and blood pressure 150/80
mmHg. She showed no macroglossia. The cardiac
rhythm was regular and there were no murmurs. The
lungs were clear. There was minimal abdominal distension, without visible peristaltic waves, herniations or
collateral circulation (spider angiomas or caput medusa). The abdomen was soft; there was tenderness to
palpation in the right lower quadrant, but no rebound
tenderness. The liver span was 9 cm. Liver and spleen
were not palpable. Small external hemorrhoids were
noted.
The electrocardiogram showed a normal sinus
rhythm with normal axis and a heart rate of 78 beats per
minute. No electrocardiographic criteria for myocardial
hypertrophy were noted. Colonoscopy revealed a tight
stricture at 30 cm from the anus associated with friable
mucosa and active bleeding (Figure 1). Mucosal biopsy
revealed “granulation tissue and fibrino-purulent debris
and absence of microorganisms or neoplasia”. Abdominopelvic CT scan showed a small left base pleural
effusion, a normal liver and an encasement of the abdominal aorta and an engrossed descending colon (Figures 2).
seen in hematoxylin and eosin stain of peritoneum and
omentum (Figure 3). The presence of amyloid deposits was confirmed with Congo red stain and polarized
microscopy (Figures 4). Fat biopsy from the abdominal
area was normal. Serum and urine samples submitted for immunofixation and electrophoresis revealed,
proteinuria of 80 mg per day and a monoclonal plasma cell disorder with lambda light chain immunoglobulin overproduction and decreased gamma globulin
Figure 3: H and E light microscopy showing nodular
and amorphous material in vessel wall (omentum).
Figure 1: Colonoscopy – Stricture and friable colonic
mucosa observed at 30 cm.
Figure 2: CT Scan – Aorta (retroperitoneal) with mesenteric encasement.
Figure 4: Congo Red stain viewed with polarized light
showing green birefrin-gence in vessel walls.
An exploratory laparotomy showed a mesenteric inflammatory process thought to represent vasculitis. A loop colostomy was performed in order to bypass
the colonic obstruction. Abdominal fat, omental and
mesenteric biopsies were obtained. No further surgical
procedures were performed. Nodular eosinophillic deposits of amorphous substance involving arteries was
production. Bone marrow revealed a normal trilineage hematopoesis and a plasma cell dyscrasia of 20
to 30% cellularity. Amyloid deposition compromising
1% of the medullary space was observed with marked predominance of plasma cells positive for lambda in immunophenotypic staining (Figures 5 and 6).
73
Figure 5: Congo Red stain of bone marrow showing
focal amyloid material present compromising 1% of
medullary space.
Figure 6: Immunoperoxidase stain of bone marrow
showing intense staining for lambda light chains.
DISCUSSION
AL is a form of amyloidosis which arises from
a monoclonal plasma cell proliferation disorder. It is
characterized by deposition of light chain fragments in
antiparallel beta-pleated sheet configuration (as noted
on X-ray diffraction) (6). Organs affected by amyloidosis have a “waxy” or “lardaceous” appearance on gross
examination and “amorphous” or “hyaline” deposits under light microscopy (7). Electron microscopy reveals
straight and unbranching fibrils approximately 8 to10
nm wide (8). The amyloid fibril can be further characterized using immunohistology or by immunoelectron
microscopy.
Primary amyloidosis should be differentiated
form other forms of amyloidosis since the course of the
disease and required treatment will vary. The plasma
cell dyscrasia in AL leads to an abnormal level of a paraprotein which can be seen in as a monoclonal band
in protein electrophoresis and immunofixation in up to
90% of the cases (9, 10). It may also be seen in the
urine. This diagnosis must be confirmed by biopsy of
clinically affected organs. Kidney and liver biopsy are
positive in 90% of the cases. If this is not feasible, less
invasive procedures can provide a high success rate:
abdominal fat pad 60-80%, rectal biopsy 50-70%, bone
marrow biopsy 50-55% and skin 50% (9, 11-13).
Although hepatic involvement is common in
both AL and AA amyloidosis, the frequency of clinically apparent gastroenterological involvement varies
with the type. Sixty percent of patients with secondary
amyloidosis (AA) have gastrointestinal involvement
(14). In primary amyloidosis (AL), the incidence is much
lower: 8% to 1% of the cases (15). The most common
oral manifestation in AL is macroglossia which can be
found in 10-20% (10) of the patients. This can cause
dysphonia or dysphagia and progress to eventually
cause airway obstruction (16, 17). Amyloid deposition
74
is greatest at the small intestine with 31% of patient
affected at autopsy (18). In the colon, manifestations
may include polypoid lesions, ulcerations or nodules.
The endoscopic findings were varied and included:
fine granular appearance, polypoid protrusion, mucosal erosion and ulceration, mucosal friability and wall
thickening.
Gastrointestinal complications can result in significant morbidity but are not usually the cause of death.
Renal failure, restrictive cardiomyopathy and ischemic
heart disease are more common causes of mortality.
Patients with primary amyloidosis may show increased
survival by treatment with melphalan and prednisone.
Case series have suggested higher response rates
and increased survival with autologous stem cell transplantation compared with conventional chemotherapy
(19). However, substantial treatment-related toxicity
has been observed, including toxic megacolon and
other gastrointestinal toxicities.
CONCLUSIONS
Amyloidosis is a rare disease to which most
physicians are exposed during medical school and may
never again encounter. The symptoms of amyloidosis
are nonspecific therefore a high index of suspicion is
required or the diagnosis will be missed. This is a case
where the initial presentation of primary amyloidosis
was a rectal stricture causing hematochezia. There
were no overt signs of cardiac, hepatic or renal involvement except for proteinuria. Omental involvement with
aortic encasement of this severity is uncommon. It is
remarkable that the skin and the rectal biopsies where
negative when the diagnostic yield of these two areas
is fairly high.
REFERENCES
1.
Virchow R, Lecture XVII: Amyloid degeneration. Inflammation. In: Cellular pathology: as based upon physiological and
pathological histology, 2nd Edition, Berlin, Germany: (translated by
Frank Chance, BA, MB, printed in London, England), 1858: 367383.
2. Westermarck P, Benson MD, Buxbaum, JN, et
al. Amyloid: toward terminology clarification. Report from the Nomenclature Committee of the International Society of Amyloidosis.
Amyloid 2005; 12(1): 1-4.
3. Harris AA, Wilkman AS, Hogan SL, et al. Amyloidosis and
light chain deposition disease in renal biopsy specimens: pathology, laboratory data, demographics and frequency (abstract). J Am
Soc Nephrol 1997; 8:537A.
4. Bellotti V, Merlini G, Bucciarelli E, et al. Relevance of
class, molecular weight and isoelectric point in predicting human
light chain amyloidogenicity. Br Haematol 1990; 74:65.
5.
Perfetto V, Casarini S, Palladini G, et al. Analysis
of V(lambda)-(lambda) expression in plasma cells from primary(AL)
amyloidosis and normal bone marrow identifies 3r (lambda III) as
a new amyloid-associated germline gene segment. Blood 2002;
100:948.
6.
Merlini G, Bellotti V. Molecular mechanisms of amyloidosis. N Engl J Med 2003; 349:583-96.
7. Kyle, RA. Amyloidosis: The Last Three Centuries. In: Bely,
M, Apathy, A, eds. Amyloid and Amyloidosis. 2001; 10-13.
8.
Cohen, AS, Calkins, E. Electron microscopic observations on a fibrous component in amyloid of diverse origins.
Nature 1959; 183:1202.
9.
Kyle, RA, Greipp, PR. Amyloidosis (AL). Clinical and laboratory features in 229 cases. Mayo Clin Proc 1983;
58:665.
10.
Kyle, RA, Gertz, MA. Primary systemic amyloidosis: clinical and laboratory features in 474 cases. Semin Hematol
1995; 32:45.
11.
Duston, MA, Skinner, M, Shirahama, T, Cohen,
AS. Diagnosis of amyloidosis by abdominal fat pad aspiration.
Analysis of four years' experience. Am J Med 1987; 82:412.
12.
Duston, MA, Skinner, M, Meenan, RF, Cohen,
AS. Sensitivity, specificity, and predictive value of abdominal fat
aspiration for the diagnosis of amyloidosis. Arthritis Rheum 1989;
32:82.
tic value of bone marrow biopsy in patients with renal disease secondary to familial Mediterranean fever. Kidney Int 1993; 44:834.
14.
Lachmann, HJ, Goodman, HJ, Gibertson, JA, et
al. Natural history and outcome in systemic AA amyloidosis. N Engl
J Med 2007; 356:2361.
15.
Okuda, , Y, Takasugi, K, Oyama, T, et al.
Amyloidosis in rheumatoid arthritis: Clinical study of 124 histologically proven cases. Ryumachi 1994; 34:939.
13.
Sungur, C, Sungur, A, Ruacan, S, et al. DiagnosY, Takasugi, K, Oyama, T, et al. Amyloidosis in rheumatoid arthritis: Clinical study of 124 histologically proven cases. Ryumachi
1994; 34:939.
16.
Jacobs P, Sellars S, King HS. Massive macroglossia,
amyloidosis and myeloma. J Postgrad Med 1988; 64: 696–8.
17.
Al-Hashimi I, Drinnan AJ, Uthman AA, et al. Oral amyloidosis: Two unusual case presentations. Oral Surg OralMed Oral Pathol 1987; 63: 586–91.
18.
Ebert, EC, Nagar, M Gastrointestinal manifestations of
amyloidosis. Am J Gastroenterol.2008; 103:776-787.
19.
Gertz MA, Lacy MQ, Dipenzieri A. Myeloablative chemotherapy with stem cell rescue for the treatment of primary systemic amyloidosis: a status report. Bone Marrow Transplant 2000;
25:465.
RESUMEN
La amiloidosis es una enfermedad que en
la cual se deposita una substancia en el área extracelular. Esta substancia es el producto final de
la transformación de una paraproteína. La substancia depositada denominada fibrila, tiene como
características afinidad por la tinción de “Congo
Red” y la capacidad de birrefringencia verde al ser
expuesto a luz polarizada. En amiloidosis primaria (AL) esta paraproteína es producto de un desorden de células plasmáticas. Los órganos afectados con más frecuencia son el riñón, el hígado y
el corazón. Este es un caso donde la presentación
inicial fue de estrechez del recto, diagnosticada
por colonoscopía, a raíz de una queja principal de
hematoquecia. La paciente no tenía señal de daño
a otros órganos, con la excepción de tener una
proteína moderada (80 mg por día). Durante la cirugía exploratoria, se tomaron muestras de omento y mesenterio las cuales mostraron depósitos
de amiloideos en las paredes de los vasos sanguíneos. La electroforesis de proteínas en orina y
suero mostró un desorden de células plasmáticas,
lo cual fue corroborado con una biopsia de médula
ósea.
3 Websites para servir a la salud:
www. asociacionmedicapr.org
para los profesionales de salud
www.saludampr.org
para información del paciente
www.cstmpr.net
tecnología informática de salud (HIT)
Development Of
Grave’s Disease
Seven Months After
Hashimoto’s
Thyroiditis:
A Rare Occurrence
Wilfredo Eddy Bravo-Llerena MD
Rodrigo J. Valderrabano-Wagner MD
Juan Quevedo-Quevedo MD
Luis M. Reyes-Ortiz MD
PR 00960-6032
Address reprints requests to: Robert F. Hunter-Mellado, MD
- Internal Medicine Department, Universidad Central del Caribe, School of Medicine, Call Box 60-327, Bayamón, PR
ABSTRACT
Hashimoto’s thyroiditis (HT) and Graves’ disease
(GD) are two opposite poles in the spectrum of autoimmune thyroid disease. On one extreme, HT or
Chronic Lymphocytic thyroiditis (CLT) courses, as
its name implies, with lymphocytic infiltrates replacing thyroid follicles, resulting in a loss of hormoneproducing cells and, thus, primary hypothyroidism.
On the other extreme, GD is characterized by primary hyperthyroidism due to stimulating autoantibodies against thyroid-stimulating hormone receptors (TSHRs) localized on thyrocytes’ membranes
of intact thyroid follicles. The presence of HT after
GD or the concomitant combination of these two
autoimmune entities ending in HT-depending hypothyroid state is well known. However, occurrence of
GD after primary hypothyroidism due to CLT is very
rare since thyrocytes with their TSHRs are promptly
lost. We report a case in which hyperthyroidism occurred seven months after presentation of primary
hypothyroidism and discuss potential mechanisms
involved.
Index words: Grave’s, disease, Hashimoto, thyroiditis
INTRODUCTION
H
ashimoto’s thyroiditis (HT) (named after
Dr. Hakaru Hashimoto, who first described the symptoms in 1912) and Graves’ disease (GD) (named after
Dr. Robert J. Graves, who first described a case of goiter with exophtalmos in 1835) are two opposite poles
in the whole spectrum of autoimmune thyroid disease.
(1, 2, 3, 5, 7, 11, 13) On one extreme, HT or Chronic
Lymphocytic thyroiditis (CLT) courses, as its name implies, with lymphocytic infiltrates replacing thyroid follicles, resulting in a loss of hormone-producing cells
and, thus, primary hypothyroidism(10), presenting with
weight gain, depression, mania, sensitivity to cold, fatigue, bradycardia, dyslipidemia, reactive hypoglycemia,
constipation, migraines, weakness, infertility, and hair
loss.(10) On the other extreme, GD is characterized
by primary hyperthyroidism due to stimulating autoantibodies against thyroid-stimulating hormone receptors
(TSHRs) localized on thyrocytes’ membranes of intact
thyroid follicles(9), and may present with exophtalmos,
fatigue, weight loss, tachycardia, weakness, heat intolerance, increased bowel movements, and hair loss.(9)
The presence of HT after GD or the concomitant combination of these two autoimmune entities ending in
HT-depending hypothyroid state is well known.(1, 2, 3,
4, 5, 11, 12) However, occurrence of GD after primary
hypothyroidism due to CLT is very rare (1, 2, 3, 4, 5, 11)
since thyrocytes with their TSHRs are promptly lost.
There are, nonetheless, few well documented cases of
hyperthyroidism which developed spontaneously after
primary hypothyroidism(1, 2, 3, 4, 5, 11) (about 40 cases are reported so far in the English medical literature
(1, 2)). Although autoimmunity is obviously considered
the basic pathogenesis of this phenomenon, the exact
mechanism is still obscure.(1, 2)
76
We report a case in which hyperthyroidism
occurred seven months after presentation of primary
hypothyroidism and discuss potential mechanisms involved.
Case History
A 25-year-old Puerto Rican man with medical
history of primary hypothyroidism secondary to CLT
(diagnosed by his primary care physician [PCP] on August, 2008, and treated, since then, with levothyroxine
137 mcg daily –strict compliance was referred--), and
no other systemic illness, who was referred by internist to endocrinologist evaluation (on February 10th,
2009) due to development of 2 palpable small nodules
on right thyroid lobe, marked weakness, irritability, nervousness, mild resting tremors, sporadic episodes of
palpitations, heat intolerance, hair loss, decreased libido, asthenia, sweatiness, and non-intentional weight
loss (around 10 pounds) in a time span of 1 month.
No jaundice, respiratory symptoms or increased bowel
movement were specified. The patient stated that his
problems started on June 2008 when symptomatology
was “…the opposite to the one experienced on January
and February, 2009…”, and included: weight gain,
“slowness”, constipation, and cold intolerance, due to
which he decided to visit his PCP on July, 2008. The
patient was seen again on August, 2008 and laboratory
investigations at that time (August 18th, 2008) revealed
a thyroid-stimulating hormone (TSH) result of 392.300
uIU/ml (0.270-4.200); total 3,5,3’,5’ tetraiodothyronine (T4): 0.66 ug/dl (4.60-12.00); 3,5,3’ triiodothyronine uptake (T3-U): 24.9% (28.0%-41.0%), free thyroid
index (FTI): 0.16 (1.42-4.92), cholesterol: 262 mg/dl
(113-200), triglycerides: 153 mg/dl (0-150), low-den- and the patient remained fairly asymptomatic with mesity lipoprotein (LDL): 185 mg/dl (66-100), anti-thyroid thimazole alone for the subsequent 3 months when he
peroxidaseantibodies (TPO): 974.1 IU/ml (0-19.9), discontinued visits and was lost to follow up.
anti-thyroglobulin antibodies: above 1000
IU/ml (0-44.9) (see Table I), very mild increase in liver function tests, and mild Table I.
renal insufficiency. In addition, a thyroid
ultrasound demonstrated heterogeneous Thyroid Function Test Results by Date.
appearance of both lobes with small bilateral nodules. CLT was diagnosed, and Date
TSH
T4
Antibody Titers
levothyroxine 137 mcg daily was started.
392.300 (Total T4)
Anti-TPO: 974.1 IU/ml
On January, 2009, after occurrence of August 18th
new symptoms, the patient is referred to 2008
uIU/ml
0.66 ug/dl Anti-TG: >1,000 IU/ml
endocrinologist evaluation.
February 25th
The patient denied any history
0.009
(Free T4)
TSI: 354.0% of
of allergies, bronchial asthma, hospita- 2009
lizations, surgeries, sexual transmitted uIU/ml
2.72 ng/dl basal activity
diseases, promiscuity, illegal drug consumption, alcohol abuse, or sick contact
of any kind. The patient did smoke around
15 to 18 cigarettes a day for the last 10 years (8.5 DISCUSSION
pack-year). His family medical history was negative
for any psychiatric disorder, albinism, vitiligo, collagen GD and CLT are thought to be on a continuing
disease, bronchial asthma, pernicious anemia, thyroid spectrum of an autoimmune syndrome sharing a comdisorders, multiple sclerosis, myasthenia gravis, pri- mon ethiopathogenesis.(1, 2, 3, 5, 7, 11, 13) Clinical
mary biliary cirrhosis, primary sclerosing colangitis, ce- Graves’ hyperthyroidism with concurrent histological
liac disease, inflammatory bowel disease, lymphoma/ Hashimoto’s thyroiditis and spontaneous evolution to
MALToma, or any multiple endocrine disorder. The pa- final hypothyroidism is well known, but the reverse is
tient was employed as loader and unloader in a ware very rare.(1, 2, 3, 4, 5, 11)
house, where strong physical activity was needed as
daily basis.
One possible mechanism may be related to
the degree of thyroid tissue destruction in CLT. This
Physical examination on February 10th, 2009 degree of thyroid gland destruction might determine
revealed a mildly overweight (weight: 143 lbs., height: and modulate the occurrence or not of hyperthyroidism
5’-5”, ideal body weight [IBW]: 134 lbs., body mass when TSAbs are present. If relatively enough follicular
index [BMI]: 25) Caucasian Hispanic man, with mild epithelial cells are preserved, TSAbs might have the
irritability and lack of attention. Vital signs were signifi- chance to produce thyrocyte hyperstimulation. In concant only for mild resting tachycardia (105 beatings per trast, a severely destroyed gland cannot be stimulated
minute). Skin was warm; hands were sweaty and with even in the presence of TSAbs.(1, 2, 5) This mechafine resting tremor; mild bilateral ocular proptosis with nism alone, although logical, fails to explain some of
lid-lag was evident; and very mild thyromegaly was the reported cases where hyperthyroidism has occupalpable. No jaundice, skin maculas, vitiligo, alope- rred several years after CLT diagnosis (5) and where
cia, neck hums or bruits, cardiac murmurs or gallops, complete gland destruction would have been evident
adventitious respiratory sounds, abdominal bruits or by that time. Therefore, there is a present tendency to
tenderness, or hyperactive deep tendon reflexes were implicate more than one ethiopathological mechanism
present. Levothyroxine was stopped, propranolol 40 in these complex and rare cases.
mg three times a day was commenced and the patient
was seen again on February 25th, 2009 for verification Another mechanism which has been proposed
of fine needle aspiration (FNA) of thyroid nodules re- involves the balance of blocking and stimulatory actisults and evaluation of new laboratory tests. These re- vities of present anti-thyroid antibodies.(1, 2, 3, 4, 5,
vealed a TSH value of 0.009 mIU/L, Free T4: 2.72 ng/ 11) The responsiveness of the thyroid gland to such
dl (0.75-1.54), Thyroid-Stimulating Immunoglobulins Abs. may also play an important role.(1, 5) As in many
(TSI or Thyroid-Stimulating Antibodies [TSAb]): 354.0 other autoimmune diseases, CLT with concomitant GD
% of basal activity (0-124.0), negative myasthenia gra- may course, at the same time, with a whole variety of
vis panel, sedimentation rate: 4.0 mm/hr (0.00-20.0) blocking and stimulatory types of autoantibodies.(1, 2,
(see Table I), negative chest X-ray (posterior-anterior 3, 4, 4, 5, 11) This variety of autoantibodies includes
and lateral), urine total protein: 58 mg/24hr (0-150), those that directly interact with the TSHR [classically
normal liver function tests and no dyslipidemia. FNA described on GD], and those that do not interact with
revealed marked cellularity in sheets of follicular cells the TSHR [classically described on CLT] (See Table
and lymphocytic infiltrates with GD and CLT interlap- II). The epitopes for the TSHR autoantibodies (both
ping morphologic changes. Methimazole 10 mg three stimulating and inhibiting) on the TSHR ectodomain
times a day was then added and verbal advice was overlap with, but are not precisely the same as, the
given to avoid iodine-containing food and dyes, and to TSH-binding site.(7) While epitopes for stimulating Abs
quit smoking. Symptoms abated over a 2-month period are located towards the N-terminal third of the TSHR
77
Table II.
Autoantibodies in Thyroid Immune Disease
Active Interac- Thyroid Stimulating Hormotion with TSHR ne-binding inhibiting immunoglobulins (TBII) (inhibitory/
stimulating activity)
Thyroid stimulation-blocking
antibody (TSBAb) (inhibitory
activity)
No Interaction anti-TPO Ab(thyroid-destructing activity)
with TSHR
anti-thyroglobulin
Ab
(thyroid-destructing activity)
ectodomain, blocking Abs have a tendency to bind on
epitopes on the C-terminal region(7), interestingly, TBII
have the potential to bind epitopes both on the C and
N-terminals of the TSHR ectodomain and therefore
may originate both inhibitory and stimulatory activity.
(7, 9) The factors that may induce activity predominance of one type of Ab over the other during time are not
well elucidated yet.
Therefore, the mechanism involved in our case
may be related to the concurrent presence of (although
not measured) inhibitory and stimulating anti-thyroid
autoantibodies whose predominance of one type over
the other in time may have dictated this rare clinical
progression: hyperthyroidism following hypothyroidism.
CONCLUSIONS
This case illustrates an unusual presentation of
thyroid autoimmune disorder in which a hyperthyroid
state presented seven months after development of
hypothyroidism. It is important to keep in mind that clinical thyroid status can be changed according to the
preponderant functional character of TSHR autoantibodies. This phenomenon is considered to be evidence that GD and CLT are on the spectrum of a syndrome sharing a common pathogenic mechanism. Further
evaluation of these cases and studies into the role of
factors inducing expression of one type of autoantibody over the other is warranted as it may potentially improve present treatment.
REFERENCES
1.
Shong YK, Cho BY, Hong SK, Lee HK, Koh CS, Min HK:
Pathogenic Role of Thyrothropin Receptor Antibody in the Development of Hyperthyroidism Following Primary Hypothyroidism. The
Korean Journal of Internal Medicine 2:118, 1989.
2.
Fatourechi V, Gharib H: Hyperthyroidism Following Hypothyroidism. Arch Intern Med 148:976, 1988.
3.
McDermott MT, Kidd GS, Dodson LE, Hofeldt FD: Hyperthyroidism Following Hypothyroidism. Am J Med Sci 291:194,
1986.
4.
Chung Y, Ou H, Wu T: Development of Hyperthyroidism
Following Primary Hypothyroidism: A Case Report. The Kaohsiung
Journal of Medical Sciences 20:188, 2009.
5.
Takasu N, Yamada T, Sato A, Nakagawa M, Komiya I,
Nagasawa Y, Asawa T: Graves' Disease Following Hypothyroidism
due to Hashimoto's Disease: Studies of Eight Cases. Clinical Endocrinology 33:687, 1990.
6.
Singh SK, Singh KK, Sahay RK: Hashimoto's Thyroiditis
with Orbitopathy and Dermopathy. Journal of Postgraduate Medicine 46:286, October-December, 2000.
78
TSI or TSAb (stimulating
activity
7.
Rapoport B, Chazenbalk GD, Jaume JC, McLachlan S:
The Thyrothropin (TSH)-Releasing Hormone Receptor: Interaction
with TSH and Autoantibodies. Endocrine Reviews 19:673, 1998.
8. Nakazawa D: The Autoimmune Epidemic, 2008 Simon &
Schuster pp 32-35, ISBN 0-7432-77775-4.
9.
Brown RS: Immunoglobulins Affecting Thyroid Growth: A
Continuing Controversy. J Clin Endocrinol Metab 80:1506, 1995.
10.
Tamimi DM: The Association Between Chronic Lymphocytic Thyroiditis and Thyroid Tumors. Int J Surg Pathol 10:141,
2002.
11.
Takeda K, Takamatsu J, Kasagi K, Sakane S, Ikegami Y,
Isotani H, Majima T, Majima M, Kitaoka H, Iida H, Ikekubo K, Konishi J, Mozai T: Development of Hyperthyroidism Following Primary
Hypothyroidism: A Case Report With Changes in Thyroid-Related
Antibodies. Clinical Endocrinology 28:341, 2008.
12.
Cronin CC, Higgins TM, Murphy D, Ferris JB: Concomitant Graves’ Disease and Hashimoto’s Thyroiditis, Presenting As
Primary Hypothyroidism. Ir Med J 89:141, 1996.
13.
Wartofsky L, Schaaf M: Graves’ Disease with Thyrotoxicosis Following Subacute Thyroiditis. Am J Med 83:761, 1987.
RESUMEN
La tiroiditis de Hashimoto (TH) y la enfermedad de Graves (EG) son los polos opuestos
en el espectro de los trastornos tiroideos autoinmunes. Por un lado, la TH o tiroiditis linfocítica crónica (TLC) cursa, como lo indica su
nombre, con un infiltrado linfocítico que remplaza los folículos tiroideos y que finalmente
origina una pérdida de las células productoras
de hormonas terminando en hipotiroidismo
primario. Por otro lado, la EG se caracteriza
por un hipertiroidismo primario debido a la actividad de autoanticuerpos estimuladores en
contra de los receptores de la hormona estimuladora tiroidea (RHETs) localizados en las
membranas de los tirocitos de los folículos
tiroideos intactos. Se conoce bien en la actualidad la presencia de TH después de EG
o la combinación concomitante de estas dos
enfermedades autoinmunes culminando en un
estado hipotiroideo como consecuencia de la
TH. Sin embargo, la aparición de EG después
un hipotiroidismo primario debido a TLC es
algo realmente raro debido a que los tirocitos
con sus RHETs se pierden rápidamente. En
la presente reportamos un caso en el cual un
estado hipertiroideo se desarrolló siete meses
después de la presentación de un hipotiroidismo primario y discutimos los mecanismos potenciales involucrados.
ABSTRACT
Hemophagocytic Lymphystiocytosis is a
rare and fatal complication of rheumatic diseases,
particularly Adult Onset Still’s Disease (AOSD).
It may be precipitated with immunosuppressive drugs and with viral and bacterial infections.
A diagnosis depends on a high index of suspicion associated to certain clinical manifestations
(fever, rash, Splemomegaly, any cytology blood
dyscrasia, hipertrigliceridemia, hiperfibrinogenemia, and others), as well as pathologic evidence
of hemophagocitosis from bone marrow biopsy
or tissue samples of affected organs. Therapy
consists of high dose corticosteroids and immunosuppressive drugs. We present a 42 year old
woman with AOSD in remission who developed
HLH in spite of receiving therapy with high dose
steroids and immunosuppressive drugs. She had
2 negative bone marrow aspirates. Evidence of
Hemophagocytosis was detected in both bone
marrow biopsies. Timely evaluation and recognition of the signs and symptoms of HLH is crucial
for the prompt management and a decrease in
the mortality associated with this disease.
Index words: macrophage, activation, syndrome,
adult, Still’s, disease
Hidden In Plain
Sight:
Macrophage
Activation
Syndrome
Complicating Adult
Onset Still’s
Disease
Lourdes Benitez MD
Salvador Vila MD
Robert Hunter Mellado MD
From the Internal Medicine Department, Universidad Central del Caribe, School of Medicine
Call Box 60-327, Bayamón, PR 00960-6032
Address resprints requests to: Robert F. Hunter-Mellado,
MD - Internal Medicine Department, Universidad Central del
Caribe, School of Medicine, Call Box 60-327, Bayamón, PR
INTRODUCTION
H
emophagocytic
Lymphohistiocytosis
(HLH) or Macrophage activation syndrome (MAS) is a
rare disease. The syndrome occurs when important
natural regulatory immune mechanisms designed to
stop or terminate immune activation and the inflammatory responses are dysfunctional or impaired. In these
scenarios the persistent activation of the macrophages
as antigen presenting cells and of T lymphocytes/Natural Killer cells result in systemic inflammatory responses that often are overwhelming.
The presence of T cell and Natural Killer cell
dysregulation causes an aberrant and continued cytokine release, resulting in proliferation and activation of
antigen presenting cells (histiocytes, macrophages),
CD8 positive T cells and expansion of T cells in general.
The role of Natural Killer cells under normal conditions
includes maintaining a healthy immune responsiveness to external stimuli and in regulating autoimmune
conditions. NK cells modulate the initial response of
incoming pathogens and attenuate the initial immune
response resulting in a decrease in the intensity of the
immune response and inflammatory conditions. In
the HLH syndrome, NK cells are abnormal in function
although they are quantitatively normal. The presence
of these abnormally stimulated NK result in an unabated immune response and overwhelming systemic
inflammation which are the essential elements of this
syndrome.
The predominant clinical manifestation of HLH
includes fevers, cytopenias, liver dysfunction and Splemomegaly. The presence of Hemophagocytosis is the
hallmark of the disease and results from the prolonged
activation of the macrophages/histiocytes resulting in
the systemic phagocytosis of the red blood cells. (Figure 1) Other common manifestations include maculopapular rash, neurological symptoms, coagulopathy,
renal failure and respiratory failure. (1, 2)
In this
paper we present a case report of a patient with Adult
onset Stills disease which over the course of her disease developed HLH.
Case History
Our patient was a 42 year old woman with Still’s
Disease successfully treated with Azathioprine 50mgs
orally daily and Methylprednisolone 16mgs twice daily
for the last 6 years. A history of hypothyroidism treated
with levoxyl 75mcgs orally daily was also present. A
history of localized shingles two weeks prior to admission was elicited. The Patient was admitted to our institution after 4 days of fever, vomiting, disorientation and
new onset seizure. A lumbar puncture was performed
and a diagnosis of aseptic meningitis was obtained
(colorless, clear CSF with 40 WBC, 99% mononuclear
cells, 1% polymorphonuclear cells and 10% RBC). On
exam the patient was awake, but disoriented, had dry
oral mucosa, was tachycardic, tachypneic, with salmon
79
Figure 1: Hemophagocytosis seen in a spleen tissue
biopsy. AUTHOR: Lourdes Benitez, MD
colored rash and warm skin with poor turgor. Neurologically, there were neither pathologic reflexes nor focal
motor findings. Strength and gait were not fully evaluated due to patient’s poor cooperation; the rest of the
exam was unremarkable.
The laboratory tests on admission revealed
a normocytic anemia and neutrophilia without leukocytosis (, hemoglobin 11.7 gm%, hematocrit 36.5%,
platelets 180,000/ul , white blood cells 6,260/ul, neutrophils 82%, lymphocytes 11%), the prothrombin time
was 12.0 seconds, partial thromboplastin time 27.4 seconds, INR 1.15, albumin was low at 3.0 mg/dl. A head
CT scan indicated vasogenic edema, and a chest x-ray
that was unremarkable. Patient continued with fever
spikes mostly in the evening or early in the morning
with 3 negative blood cultures sets, urine cultures, and
sputum cultures. She was treated for aseptic meningitis with Rocephin 1grm IV every 12hrs, Vancomycin
1gm IV every 12 hrs and Zovirax 600mgs IV every 8hrs
(patient had an attack of shingles 2 weeks prior to admissions). She was also being given her usual doses
of Azathioprine and Methyl-prednisolone.
The patient was hospitalized for 27 days, she
was being followed by rheumatology, infectious diseases and neurology (for waxing and waning mental
status). On the 12th day of her admission she developed renal insufficiency and evidence of decreasing
platelets. Two days later she was transferred to the
intensive care unit due to acute deterioration of kidney function (creatinine at 4.59 mg/dl) with orders for
hemodialysis. Her cognitive function was in decline as
well as her respiratory pattern. She became tachypneic, developed low oxygen saturation (88%), and low
oxygen partial pressure (64 mm/hg) with supplemental
oxygen mask of 50%. She eventually required endotracheal intubation and mechanical ventilation.
80
The patient was being managed for septic shock
and multiorgan dysfunction. Her kidneys continued to
deteriorate, the oxygen requirements continued to increase, and her liver function continued to deteriorate
with (Alkaline phosphatase 269 U/L; Aspartate aminotranspherase 5091 U/L; Alanine aminotranspherase
1676 U/L). Hematology oncology service was consulted due to suspected Disseminated Intravascular coagulation and pancytopenia. Severe thrombocytopenia
of under 20,000/ul was documented with oozing from
the venous puncture sites. Supportive therapy was
continued with blood product support. Two bone marrow aspirates and biopsies and blood smear examinations were done which failed to reveal microangiopathic
hemolytic anemia. Both bone marrow aspirates were
non-diagnostic and no evidence of Hemophagocytosis was seen upon microscopic evaluation of sample.
During her hospitalization she continued with ventilator
support, hemodialysis, and blood product support.
On day 20th of her hospitalization, she was
found in a profoundly comatose state with signs of cerebral death (no pupillary light reflex, no corneal reflex,
no gag reflex, no oculocephalic eye movements, no
spontaneous breathing, no response to pain, without
being on sedation)(9). On the 26th of her hospitalization she was pronounced brain dead by two separate
doctors after an electroencephalogram presented an
isoelectric line. The examination of the bone marrow
biopsies revealed the presence of extensive Hemophagocytosis establishing the diagnosis of HLH post-mortem. Figure 1
DISCUSSION
Adult Onset Still’s Disease (AOSD) is a multisystem inflammatory disorder characterized by high
spiking fevers, evanescent salmon colored rash, arthralgias or arthritis, hepatosplenomegaly, lymphadeno-pathy and sore throat. There is no specific test or
combination of tests that can establish the diagnosis of
AOSD. (14) It is an uncommon disorder (incidence of
0.16 cases/100,000 persons/year). (15) The presence
of secondary HLH is a complication that can be associated to chronic rheumatic diseases. (2) AOSD as
rheumatic disease can be complicated by the development of the macrophage activation syndrome or HLH.
In this scenario it is potentially fatal and may be triggered by an infection in a predisposed patient (3). Typically patients become acutely ill at presentation with
persistent fever, lymphadenopathy, and hepatosplenomegaly. Profound depression of one or more blood
cell lines, low erythrocyte sedimentation rate (ESR),
raised liver cell enzymes, and abnormalities of the clotting profile commonly occur (4). Many of the patients
have clinical and radiologic findings similar to the acute
respiratory distress syndrome, with alveolar-interstitial
opacities and pleural effusions. The pathologic findings
consist in hemophagocytosis of red cells (erythrophagocytosis), other white blood cells, or platelets in the
bone marrow, spleen, or lymph nodes (key diagnostic
finding)(5). HLH has been known to develop in patients
being treated with methotrexate, anti-tumor necrosis
factor alpha, and corticosteroids. (6-8) Our patient was
on corticosteroids and azathioprine, and she had a
herpes Zoster infection 2 weeks prior to hospitalization. The literature suggests that viral infections particularly those associated to the Herpes family may precipitate secondary HLH under the appropriate clinical
circumstances. The literature suggests that infections
with Epstein Barr Virus are the most frequent culprits
for the activation of HLH. Most authors establish that
the diagnosis of HLH can be especially difficult in the
shadow of an underlying infection. (10)
HLH was being considered in the differential
diagnosis of this patient, for which reason two bone
marrows were performed with the intent of improving
the yield of detecting hemophagocytosis. The literature also establishes the difficulty of initiating chemotherapy for patients with secondary HLH due to the presence of concomitant clinical conditions.
In table I we present the criteria established by
the Hystiocytic Society which includes the diagnostic
guidelines to establish HLH. The presence of these
guidelines should help in establishing an earlier diagnosis. (11).
It is rare for patients to develop MAS while on
immune suppressors and high dose corticosteroids.
There has been presentation in the literature about steroid refractory HLH which advocates the use of other
therapy including cyclosporine A (13). Our patient was
most likely one of these cases making diagnosis even
more paradoxical because she never recovered after
she the development of acute renal failure.
As clinicians we need to learn from these cases
in order to be more aggressive in the diagnosis and
timely intervention.
REFERENCES
1.
Maakaroun NR, Moanna A, Jakob JT, Albrecht H. Viral Infections associated with Haemophagocytic Syndrome. Reviews in
Medical Virology, February 1, 2010.
Table I
Diagnostic criteria by the Histiocyte Society for inclusion in the International Registry for Hemophagocytic Lymphohistiocytosis (HLH) is as follows.15
All 5 criteria must be met to establish a diagnosis of
hemophagocytic lymphohistiocytosis:
· Fever - Seven or more days of a temperature as high as 38.5°C (101.3°F)
· Splenomegaly - A palpable spleen greater
than 3 cm below the costal margin
· Cytopenia - Counts below the specified
range in at least 2 of the following cell lineages: Absolute neutrophils less than 1000/µL, Platelets less
than 100,000/µL, Hemoglobin less than 9.0 g/dL.
· Hypofibrinogenemia or hypertriglyceridemia - (1) Fibrinogen less than 1.5 g/L or levels greater than 3 standard deviations below the age adjusted reference range value or (2) fasting triglycerides
greater than 2 mmol/L or levels greater than 3 standard deviations above the age-adjusted reference
range value
· Hemophagocytosis - Must have tissue demonstration from lymph node, spleen, or bone marrow without evidence of malignancy
· Rash - Skin findings in more than half of
patients;1 scaly and waxy lesions; rashes on the
scalp and behind the ear
2.
Tristano AG. Macrophage Activation syndrome: A Frequent but Underdiagnosed Complication of Rheumatic Diseases.
Medical Science Monitor 2008 Mar; 14 (3):RA 27-36.
3.
Sawhney S, Woo P, Murray KJ. Macrophage Activation
Syndrome: a Potential Complication of Rheumatic Diseases. Archives of Diseases of Childhood 2001; 85: 421-26.
4.
Grom AA, Passo M. Macrophage Activation Syndrome in
Systemic Juvenile Rheumatoid Arthritis. Journal of Pediatrics 1996;
129: 750-54.
5.
Reiner AP, Spivak JL. Hematophagic histiocytosis. A Report of 23 New Patients and a Review of the Literature. Medicine
1988; 67: 369-388.
6.
Goldberg J, Nezelof C. Lymphohistiocytosis: A Multi-factorial syndrome of Macrophagic Activation: Clinico-Pathological
Study of 38 Cases. Hematological Oncological Mar. 6 2007; vol. 4
issue 4: 279-289.
7.
Ramanan AV, Schneider R. Macrophage Activation Syndrome Following Initiation of Etanercept in a Child with Systemic
Onset Juvenile Arthritis. Journal of Rheumatology 2003; 30: 4013.
8.
Ravelli, MC Caria, S Buratti, C Malattia, F Temporini, A
Martini J. Rheumatology 2001; 28(4): 865-86.
9.
Cranston RE, Rockoff MA, Thompson JE, Larson MD,
Truog RD, Robinson WM, Broyde MJ, Wijdicks EFM, Capron AM.
The Diagnosis of Brain Death. New England Journal of Medicine
2001; 345: 616-18.
10.
Ravelli A. Macrophage Activation Syndrome. Current Opinion in Rheumatology 2002; 14: 548-52.
11.
Dominik J Schaer, Christian A Schaer, Gabriele Schoedon, Alexander Imhof, Micheal OK. Hematophagocytic Macrophages Constitute a Major Compartment of Heme Oxygenase Expression in Sepsis. European Journal of Haemotology November 2006;
77(5): 432-36.
12.
Castillo L, Carcillo J. Secondary Haemophagocytic Lymphohistiocytosis and Severe Sepsis/Systemic Inflammatory Response
Syndrome/Multiorgan Dysfunction Syndrome/Macrophage Activation Syndrome Share Common Intermediate Phenotypes on a Spectrum of Inflammation. Pediatric Critical Care. May 2006; 10(3): 387-92.
81
13.
Chan Ran You, Hae Rim Kim,Chong Hyeon Yoon, Sang
Heon Lee, Sung Huan Park, Ho Youn Kim. Macrophage Activation
Syndrome in Juvenile Rheumatoid Arthritis Successfully Treated
with Cyclosporine A: A Case Report. Journal of Korean Medical
Science 2006; 21(6): 1124-26.
14.
JB Arlet, D Le Thi Huong, A Marinhuo, Z Amoura, V Weschler, T Papo, JC Piette. Reactive Haemophagocytic Syndrome in
Adult Onset Still’s Disease: A Report of Six Cases and Literature
Review. Annals of Rheumatologic Diseases 2006; 65: 1596-1601.
15.
S. S. Desai, E. Allen, A. Deodhar. Miller Fisher Syndrome
in Adult Onset Still’s Disease: Case Report and Review of the Literature of Other Neurologic Manifestations. Rheumatology 2002;
41: 216-222.
16.
Rafael Chakr, Jose Miguel Dora, Fernando Lopez, Nogueira, Renato Seligman. Adult Onset Still’s Disease Evolving with
Multiple Organ Failure: Case Report and Literature Review. Clinics
2007; 62(5).
17.
Athimalaipet V. Ramanan, Rayfel Schneider. Macrophage
Activation Syndrome-What’s in a name! Journal of Rheumatology
2003; Editorial.
18.
Jan-Inge Henter. Hemophagocytic Lymphohystiocytosis,
Symptoms, Signs and Diagnosis of a Rapidly Fatal Disease. Hystiocytosis Association of America, www.histio.org
RESUMEN
Linfohistiocitosis hemofagocitica (HLH) es
una complicación rara y mortal de las enfermedades reumatológicas, especialmente la enfermedad
de Still’s en adultos. Esta, se puede precipitar después de haber recibido ciertas drogas inmunosupresoras, ciertas infecciones virales y bacterianas.
El diagnostico consiste en reconocer signos y síntomas (rash, fiebre, bazo agrandado, deterioro del
linaje de células sanguíneas, hipertrigliceridemia,
hiperfibrinogenemia). Es necesaria una biopsia de
medula ósea o de cualquiera de los órganos afectados demostrando hemophagocitosis. El tratamiento
consiste en dar esteroides intravenosos en dosis altas y/o inmunosupresores. Presentamos una mujer
de 42 anos con enfermedad de Still’s bajo remisión,
que desarrollo HLH durante una hospitalización a
pesar de estar tratada con esteroides de altas dosis,
inmunosupresoras y antibióticos. Se le realizaron 2
biopsias de medula ose. El examen microscópico
del aspirado fueron negativas para hemofagocitosis. Ambas biopsias de la medula reflejaron evidencia de hemofagocitosis estableciendo el diagnostico. La evaluación y premura en el reconocimiento
de esta enfermedad es crucial para el tratamiento y
la disminución de la mortalidad.
La Asociación Médica de Puerto Rico se ha colocado a la vanguardia de la tecnología en servicios
para los profesionales de la salud. Nuevos proyectos
como la Red de Información de Salud y el Datacenter
en proceso buscan servir a nuestros médicos con
claridad y eficiencia en una era donde la tecnología
informática juega un papel preponderante. Asóciese a la AMPR y sea protagonista en este cambio.
ABSTRACT
Leptospirosis is a rare and potentially fatal
infection that requires a high index of suspicion for
timely diagnosis and treatment. Diagnosis of leptospirosis can be particularly difficult in context of
coexistent viral hepatitis. We present a case of
Weil’s syndrome, in which a concurrent resolving
Hepatitis A virus infection was concomitantly diagnosed. Assessment of epidemiologic risk factors
and serial serology testing were key in making this
diagnosis. The immunologic consequence of the
coexistence of these two infections is also discussed. It is likely that hepatitis A infection predisposed our patient’s leptospirosis infection to progress
to Weil’s syndrome.
Index words: leptospirosis, Weil’s syndrome, hepatitis A
INTRODUCTION
L
eptospirosis is the most widespread zoono
sis throughout the world, though it is infrequently diagnosed in the continental United States. (1) It is more
common in tropical areas, such as the Caribbean,
where local agricultural practices, flood waters, and
poor housing and waste disposal are among primary
reasons. (2)
In 90% of cases, leptospirosis is an acute febrile illness with a biphasic course and an excellent
prognosis. (3) In 10% of cases, however, leptospirosis is associated with a severe hepatic and renal involvement or massive pulmonary hemorrhage which
can progress rapidly to death if untreated. (4-6) Mortality in severe forms remains high even when optimal
treatment is provided. (7) In contrast, Hepatitis A virus
infection rarely has a fulminant course and it is seldom
fatal; it has an estimated fatality rate of 0.14 to 2.0 percent. (8) Symptoms such as fever, headache, malaise, nausea and vomiting, abdominal discomfort and
jaundice are shared by these two conditions. Humans
become infected with leptospira through contact with
water, food, contaminated soil with urine from infected
animals, or direct contact with their urine (9). Hepatitis
A shares many of these routes of infection.
We present a case in which both infections coincided and, despite appropriate and prompt therapy
instituted for leptospirosis, the patient’s clinical course
was complicated by some of the most aggressive manifestations of Weil’s syndrome.
Case History
A 54-year-old woman came to the emergency
department with a 6 day history of epigastric abdominal pain radiating to her back, fever, nausea, and
generalized weakness. She had also noticed a yellowish discoloration of her skin, pruritus, and weakness in lower extremities. On physical examination,
there was marked jaundice with palpation tenderness
Acute Hepatitis A
Infection:
A Predisposing
Factor For Severe
Leptospirosis
Juan M. Quevedo Quevedo MD
Rodrigo Valderrabano Wagner MD
Wilfredo Bravo Llerena MD
Melba Colón Quintana MD
José Ramírez Rivera MD
From the Internal Medicine Department, Universidad Central del Caribe, School of Medicine
Call Box 60-327, Bayamón, PR 00960-6032.
Address reprints requests to: José Ramírez Rivera, MD Internal Medicine Department, Universidad Central del Caribe, School of Medicine. Call Box 60-327, Bayamón, PR
in epigastric and right upper quadrant areas, and
muscular tenderness in lower extremities. An abdominal ultrasound showed an enlarged liver suggestive of hepatitis and a thickened gallbladder wall.
Although admitted with the primary diagnosis
of acute pancreatitis supported by lipase of 1427 IU/L,
serum urea nitrogen of 36 mg/dl and a creatinine of
2.02 mg/dl; additional findings of thrombocytopenia of
125,000, creatinine kinase of 611, and hyperbilirubinemia (Total/direct bilirubin 5.17/ 4.86 mg/dl), prompted
empiric treatment with Doxycycline 100 mg IV twice
daily for suspected Leptospirosis. Upon further interrogation patient admitted to live in rural area, poor hygiene conditions, walking bare foot at times, having flood
waters around home, and presence of rodents.
One day after admission hemoglobin had dropped from 9.2 g/dL to 7.6 g/dL, and the urinalysis revealed proteinuria, large blood and 5-10 RBC/hpf, suggesting a vasculitis. Sed rate was 150 mm/hr. Chest
films showed acinar infiltrates, as well as a prominent
pulmonary vascularity raising the possibility of myocardial involvement and decompensated heart failure.
(Fig 1) Respiratory distress developed. Arterial blood
showed a pH: 7.51; pCO2: 25.7 mmHg; and pO2:64.4
mmHg.
Doxycycline was changed to Ceftriaxone 1 gr
IV daily for dual coverage of Leptospirosis and possible superimposed infections. Ciprofloxacin and Vancomycin were added for broad spectrum coverage,
including potential intra-abdominal infection. Two days
after admission the patient was placed on hemodialysis
due to clinical overload poorly responsive to diuresis,
metabolic acidosis with CO2 of 14.4. Ventilatory assistance was initiated for further worsening of respiratory
83
Figure 1. Acinar infiltrates throughout lung fields. AUTHOR: Juan M. Quevedo Quevedo, M.D.
A hepatitis panel collected on admission showed
presence of IgM antibody against HAV suggesting an
acute hepatitis A infection while Dot Blot method serology yielded an equivocal presence of IgM antibody for
leptospira. This raised the concern for possibility of being dealing with a concomitant infection of hepatitis A
and leptospirosis.
Table I. Lab Progression
Twelve days after
the above hepatitis
11/05 11/06 11/07 11/08 11/09 11/10 11/15 11/19 11/23 11/24 panel result, the IgM
HD
HD
HD
anti-hepatitis A anBUN
36
---
45
24
20
18
40
64
84
56
tibody was no lonCr
2.02 ---
2.36 1.78 1.71 1.05 1.36 2.12 2.95 2.17
ger present and an
CO2
17.4 14.4 17.9 ---
---
---
---
---
13.7 --HAV IgG antibody
T. Bili
5.17 6.44 3.19 1.57 ---
0.81 3.6
9.05 13.5 15.9
had emerged. A poD. Bili
4.86 6.23 2.98 ---
---
---
---
---
---
--sitive IgM detected
AST
203 121 83
58
---
49
88
85
74
62
eighteen days after
ALT
324 215 159 107 ---
76
131 47
26
24
admission
(using
AlkP
---
495 411 359 ---
383 399 402 501 559
same Dot Blot techLDH
---
213 ---
---
---
---
---
---
---
--nique), demonstraLipase
1427 760 281 ---
---
---
---
---
---
--ted the diagnosis of
Amy
214 ---
---
---
---
---
---
---
---
--an acute leptospiroWBC
14.6 18.3 24.5 21.1 34.4 42.6 20.5 15.6 22.8 21.4
sis infection.
Hgb
9.2
7.6
7.9
6.8
6.6
6.7
*7.5 *9.1 6.6
*10.1
Plt
138 125 173 176 136 154 315 220 193 203
Despite
a
prolonged and comHD=hemodialysis * = status post blood transfusion
84
distress, with a respiratory rate of 37, a decreasing
pO2 of 50.8 mmHg and a saturation of 85%. By then
both pancreatic and liver enzymes had significantly improved: lipase level decreased to 760 U/L, aspartate
aminotransferase from 203 to 83 IU/L and alanine aminotransferase from 324 to 159 IU/L. (Table I)
plicated hospital course of 38 days our patient responded to treatment but was many times on the verge of a
fatal outcome.
DISCUSSION
Our patient’s clinical course was complicated
by acute renal failure, respiratory failure, altered sensorium, marked jaundice, and bleeding manifestations;
all of which support progression to Weil’s syndrome.
Only one analogous case has been reported where
diagnosis of Weil’s disease was made in context of
chronic hepatitis B infection and alcohol abuse (10).
There is one case of acute co-infection by leptospira
and hepatitis B virus (11), but there is no previous report of a concomitant infection by leptospira and HAV.
Hepatitis A infections can cause acute pancreatitis, acute renal failure, and jaundice rarely (12). Leptospirosis causes organ involvement more frequently.
It is possible that our patient’s immune response was
compromised by acute hepatitis A infection and this
might explain why the leptospira IgM antibody could
not be detected until the third week after admission. A
depression of immune response could predispose our
patient to undergo a more severe form of leptospirosis.
Our serology results clearly support an acute
infection by leptospira, but seem to be more consistent
with a sub-acute hepatitis A infection. Fig 2
AST 203 IU/L, ALT 324 IU/L were more consistent with
a resolving viral hepatitis infection. But, given the rapid disappearance of IgM HAV antibody, it makes us
presume that an HAV infection had occurred over the
past 8-10 weeks and that initially elevated aminotransferases and perhaps even part of hyperbilirubinemia
could have been residual findings of the past recent
HAV insult. Leptospirosis emerges as the predominant
illness with a rapid clinical deterioration and nearly fatal
outcome.
CONCLUSION
The coexistence of hepatitis A and leptospirosis has been demonstrated by this case. It exemplifies
the challenge of diagnosing leptospirosis, in context of
concurrent viral illness causing similar clinical manifestations. It shows the importance of obtaining epidemiologic risk factors. It suggests that hepatitis A infection
may influence the severity of leptospirosis.
CONCLUSION
The coexistence of hepatitis A and leptospirosis has been demonstrated by this case. It exemplifies
the challenge of diagnosing leptospirosis, in context of
concurrent viral illness causing similar clinical manifestations. It shows the importance of obtaining epidemiologic risk factors. It suggests that hepatitis A infection
may influence the severity of leptospirosis.
RESUMEN
Figure 2. Hepatitis A Time Course of Infection - AUTHOR: Juan M. Quevedo
Quevedo, M.D.
Other findings that support such clinical course are the admission chemistry findings. Though leptospirosis is also known to cause hepatocellular
and cholestatic abnormalities such as high levels of bilirubin, and moderate
elevated alkaline phosphatase, it usually only causes mild elevation of aminotranferases. Thus, the initially observed high levels of aminotransferases,
Leptospirosis es una
infección rara y potencialmente fatal que requiere
de un alto índice de sospecha para un diagnostico
y tratamiento oportuno. El
diagnostico de leptospirosis
puede ser particularmente
difícil en el contexto de una
hepatitis viral coexistente.
Presentamos un caso de un
síndrome de Weil’s en donde se diagnosticó concurrentemente una Hepatitis
A. La evaluación de factores
de riesgo epidemiológico y
pruebas de serología seriadas fueron claves en llegar
a este diagnostico. Discutimos la consecuencia inmunológica de la coexistencia
de estas dos infecciones.
Es probable que la infección
de hepatitis A predispusiera
a que la infección de leptospirosis de nuestro paciente
progresara al síndrome de
Weil’
85
Semblanza del
Dr. Rafael
Fernandez Feliberti
E
l Dr. Rafael Fernández Feliberti nació el 3
de julio de 1932. Hijo primogénito de Nereida Feliberti Quiñones (Yauco) y Rafael P. Fernández Rodríguez
(Caguas). Nació en Caguas, en su casa, y se crió en el
pueblo junto a sus hermanas Migui, Dolly y Mildred.
Cursó escuela elemental en el sistema público. Trabajó desde muy joven ayudando a sus padres
y familiares en la tienda La Aurora. Se encargaba de
vender juguetes en Navidades y durante las fiestas de
Reyes, lo cual hacía con gran entusiasmo y alegría.
Pasaba los veranos en Yauco con sus abuelos, allí compartía con su primo Millito. Fanático leal
y entregado a Los Criollos de Caguas. Acompañaba
a su papá a sus actividades comerciales y cívicas y
forjó una relación íntima con él, que influyó significativamente en su forma de relacionarse con las personas
para poder llegar a ser una persona de integridad y
carácter vertical.
En sus años de adolescencia se destacaba por
ser siempre caballeroso y gentil. Era muy buen bailarín
y sacaba a todas las muchachas a bailar encargándose de que todas salieran a la pista en algún momento.
Se gradúa Valedictorian de la Escuela Superior Gautier Benítez en 1949.
Sus estudios universitarios los cursa en la Universidad de Puerto Rico, Recinto de Río Piedras. Estudia con matrícula de honor los cuatro años. Establece
lazos de amistad y profesionales que aún perduran
con compañeros y profesores. Se une al Coro de la
Universidad y lleva serenatas en muchas ocasiones.
Conoce al amor de su vida, Rosa E. Soltero (Yunyi).
Se gradúa Magna Cum Laude.
el Hospital de Veteranos como residente en Cirugía
General. Nace su hijo Eddie. Solicita a los programas
de ortopedia, pero debe esperar un año para comenzar su residencia en ortopedia. Acepta un trabajo en
el estado de Kentucky como médico del Hospital de la
Unión de Mineros como asistente de cirujano y médico
de emergencia.
En el 1953 comienza sus estudios en la Escuela de Medicina de la UPR, en Puerta de Tierra. Vive en
la Escuela de Medicina junto a la playa. Es nombrado
miembro de la Sociedad de Honor Alfa Omega Alfa. Se
gradúa en la Cuarta Clase de Medicina en el 1957. Se
casa con Rosa al terminar sus estudios.
Del 1963 al 1966 realiza su residencia en la
Clínica Mayo en Rochester, Minnesota. Conoce a su
maestro, mentor y amigo, Dr. Mark Coventry. Nace su
hija Roselle. Conoce los inviernos violentos de Minnesota y decide volver a su querida islita, la cual no
había visitado en cuatro años.
Luego se traslada a Harrisburg, Pennsylvaria,
para comenzar su Internado en el Harrisburg General
Hospital. Nace su hija mayor, Migui. En el 1958 entra
a la Marina de los Estados Unidos y se muda a Camp
Lejeune en Carolina del Norte, llegando a ocupar el
puesto de “Lieutenant Navy Officer”, en donde sirve
por tres años. Participa en una gira por el Mediterráneo como Médico de la Marina. Atiende a marineros
con lesiones y encuentra su pasión por la ortopedia.
Nace su hijo Rafi.
Regresa a Puerto Rico en el 1966 y se une al
Departamento de Ortopedia de la Escuela de Medicina. También, comienza su práctica privada en Bayamón y luego en Santurce. En el 1967 comienza sus clínicas de niños impedidos. Al poco tiempo se establece
la Residencia de Ortopedia y pasa a ser miembro de
la Facultad. El Dr. Aníbal Lugo era el Director de la
Residencia en ese momento. La educación médica se
convierte en su apostolado junto con el cuidado ortopédico de los niños impedidos. En junio de 1971 nace
su hijo Daniel. Al retirarse el Dr. Lugo en el 1976, el Dr.
Rafael Fernández Feliberti es nombrado Director.
86
En el 1961 vuelve a Puerto Rico y trabaja en
En enero de 2000 anuncia su retiro del puesto
de Jefe de Residencia, luego de 33 años dedicados
a la práctica y enseñanza en Puerto Rico, y 23 años
como Jefe del Departamento.
Entre los logros académicos y de liderado del
Dr. Fernández Feliberti se incluyen:
1. Miembro Fundador y Presidente de la Sección de Ortopedia de la Asociación Médica de Puerto
Rico
2. Presidente de la Sociedad de Médicos Graduados de la Escuela de Medicina de la Universidad
de Puerto Rico.
3. Presidente del Congreso y miembro de la
Sociedad Latinoamericana de Ortopedia y Traumatología (SLAOT)
4. Miembro Emeritus de la American Academy
of Orthopedic Surgery y miembro del Comité de Admisiones de la misma por muchos años.
5. Fundador y primer Presidente del Mark Coventry Orthopedic Club, cuyos miembros son ortopedas graduados de la Clínica Mayo.
6. Miembro Senior del Pediatric Orthopedic Society.
7. Miembro y Delegado por Puerto Rico a la
Sociedad Internacional Ortopédica y Traumatología
(SICOT).
8. Miembro de la Junta del American Fracture
Association.
9. Pasado Presidente de la Sociedad Médica
Distrito Este de la Asociación Médica de Puerto Rico.
10. Pasado Presidente de la Asociación Médica de Puerto Rico (diciembre 2001-noviembre 2002)
11. Autor de múltiples publicaciones científicas
en ortopedia, algunas reconocidas internacionalmente.
12. Por su interés en la investigación y la educación, la Sociedad Puertorriqueña de Ortopedia y
Traumatología ha creado una conferencia anual con el
nombre del Dr. Rafael Fernández Feliberti.
Entre sus múltiples actividades fuera del campo de la ortopedia y compartida con sus hijos, queremos mencionar:
1. Arbitro de “baseball”, Pequeñas Ligas
2. Juez y entrenador en los Clubes de Oratoria
y Drama de las Escuelas Superiores de Puerto Rico.
3. Participación en las actividades de Escotismo en Puerto Rico y Estados Unidos, habiendo sido
líder de Webelos.
En su retiro, el Dr. Fernández Feliberti ha aceptado el reto de colaborar con sus colegas en la dirección de la Asociación Médica de Puerto Rico, de la cual
ha sido miembro por cuarenta años. Actualmente, es
Delegado Alterno ante la Asociación Médica Americana (AMA) y preside del Comité Asesor del Presidente
de la Asociación Médica.
Sus cinco hijos son profesionales destacados,
todos ellos casados y es abuelo de 12 nietos.
OBTENGA CRÉDITOS
TEM RESPONDIENDO
LOS CUESTIONARIOS
DEL BOLETÍN DE LA
ASOCIACIÓN MÉDICA
DE PUERTO RICO
ENCUÉNTRELOS
EN LA
PÁGINA
SIGUIENTE
O
87
CME Questions
Boletin Asoc Med PR Volume 102 No 03, 2010
Questions from Article entitled: “PREVALENCE OF
DRUG RESISTANCE AND ASSOCIATED MUTATIONS IN A POPULATION OF HIV-1+ PUERTO RICANS IN 2005”, by Luis A. Cubano PhD Luz Cumba,
Lycely del C. Sepúlveda-Torres, Nawal Boukli, Eddy
Ríos-Olivares.
1- In the USA the estimated prevalence of HIV drug
resistance is
A. 26%
B. 56%
C. 76%
D. 86%
2- The average number of mutations in
A. males was higher than in females
B. males was lower than in females
C. males was the same as in females
3- Women may experience
A. less treatment changes than men and
less likely to poor treatment adherence
B. more treatment changes than men and
more likely to poor treatment adherence
C. more treatment changes than men and
less likely to poor treatment adherence
D. less treatment changes than men and
more likely to poor treatment adherence
are
are
are
are
Questions from article entitled: “EFFECTS OF GRAVITATIONAL PERTURBATION ON THE EXPRESSION
OF GENES REGULATING METABOLISM IN JURKAT
CELLS”, by Kanika Singh and Luis Cubano PhD
4- By 48 hours cells centrifuged at 90g showed
A. marked increase in cell number compared to
3g and the control.
B. marked decrease in cell number compared
to 3g and the control.
C. no difference in cell number compared to 3g
and the control.
5- Centrifugal force generally used to sediment cells
A. 50g centrifugal force is the speed generally
used to sediment cells
B. 60g centrifugal force is the speed generally
C. 80g centrifugal force is the speed generally
D. 90g centrifugal force is the speed generally
6- The dissolved carbon dioxide levels ________ as a
function of time.
A. Dissolved carbon dioxide levels increased
as a function of time
B. Dissolved carbon dioxide levels decreased
as a function of time
C. Dissolved carbon dioxide levels remain the
same as a function of time
88
Questions from article entitled: “CARDIOVASCULAR
EVENTS DURING GENERAL ELECTIONS IN BAYAMON, PUERTO RICO” by Arnaldo E. Pérez-Mercado
MD, Gerónimo Maldonado-Martínez MPH, José Rivera del Rio MD, Robert F. Hunter Mellado MD
7- Admissions for acute cardiovascular events during
the week preceding and following general elections in
Puerto Rico
A. Decreased
B. Increased
C. Stay the same
D. All of the above
E. None of the above
8- Socioeconomic factors, such as concern about the
potential costs of health care, make patients less inclined to visit physicians around general elections. True
or False?
A. True
B. False
9- One study performed in the German population
showed significant decrease in the incidence of myocardial infarction and arrhythmia in the days surrounding the 2006 World Cup. True or False?
A. True
B. False
Questions from article entitled: “CHANGES IN THE
SOCIO-DEMOGRAPHICS, RISK BEHAVIORS, CLINICAL AND IMMUNOLOGICAL PROFILE OF A
COHORT OF THE PUERTO RICAN POPULATION
LIVING WITH HIV: An Update of the Retrovirus Research Center (1992-2008)” by Christine Miranda
MPHE, Diana M. Fernandez EdD, Geronimo Maldonado MPH, Raul O. Ramon MS, Miriam Velázquez MS,
Angel M. Mayor MD, Robert F. Hunter-Mellado, MD
10. How has change the HIV epidemic?
A. It has become a chronic disease.
B. It hasn’t change.
C. It is evident a prolonged life of HIV patients.
D. a and c are correct.
11. Which are the benefits of HAART therapy?
A. Increase in the life expectancy of HIV patients.
B. A decrease of several AIDS-defining conditions.
C. a and b are correct.
D. None of the above.
12. Which are effective to increase the life expectancy
of HIV patients?
A. The use of prophylactic therapy against CE,
PCP and TP and the use of HAART and ART.
B. An early diagnosis.
C. A and b are correct.
D. None of the above.
Questions from article “CLINICAL STUDIES SUPPORT A ROLE FOR TREM-LIKE TRANSCRIPT-1
DURING THE PROGRESSION OF SEPSIS” by Omar
Esponda MD, Jessica Morales BS, Alexandra Aguilar,
Michael Gomez, A. Valance Washington PhD.
13. Platelets are activated by
A. Collagen
B. Thrombin
C. ADP
D. All of the above
14. TREM like transcript-1 is stored in
A. Leukocytes
B. Red blood cells
C. Platelets alpha-granules
D. Endoplasmic reticulum
E. Mitocondria
15. There exist laboratory evidence to suggest that
TLT-1 is a potential therapeutic target for anti-thrombotic and potentially anti-inflammatory intervention. True
or False?
A. True
B. False
Questions from article entitled: “FAILURE TO PASS
MECONIUM” By Luis Lizardo Sánchez MS, Humberto
Lugo-Vicente, MD.
20-Organs most commonly affected by primary
amyloidosis are
A. heart, lungs and skin
B. heart, kidneys and tongue
C. heart, connective tissue and brain
D. heart, liver and kidneys
21-Primary amyloidosis is due to
A. plasma cell disorder
B. chronic inflammation
C. autoimmune disorder
D. infection of affected tissues
Questions from article entitled: “DEVELOPMENT
OF GRAVE’S DISEASE SEVEN MONTHS AFTER
HASHIMOTO’S THYROIDITIS: A Rare Occurrence”,
by Wilfredo Eddy Bravo-Llerena MD, Rodrigo J. Valderrabano-Wagner MD, Juan Quevedo-Quevedo MD,
Luis M. Reyes-Ortiz MD
22- Hashimoto thyroiditis produces
A. Lymphocytic infiltrate replacing thyroid follicles
B. Results in loss of hormone producing cells
C. Primary hypothyroidism
D. All of the above
16. Normal meconium is composed of
A. amniotic fluid
B. debris
C. succus entericus
D. intestinal mucus
E. all of the above
23- Grave’s Disease causes all of the following EXCEPT
A. Primary hyperthyroidism
B. Exophtalmus
C. Decrease stimulating autoantibodies against
thyroid-stimulating hormone receptors
D. Weight loss
E. Tachycardia
17. Findings on prenatal ultrasound alerting the physician that a congenital GI anomaly should be suspected
includes
A. the presence of polyhydramnios
B. abnormal bubbles or cystic configurations
C. dilated bowel
D. ascites and calcifications
E. all of the above
24- The mechanism for development of Grave’s disease after Hashimoto thyroiditis may be related to the
concurrent presence of inhibitory and stimulating antithyroid autoantibodies whose predominance of one
type over the other in time may have dictated this rare
clinical progression. True or False?
A. True
B. False
18. Failure to pass meconium in early life is most commonly associated with
A. Intestinal atresias
B. Hirschsprung’s disease
C. meconium ileus
D. meconium peritonitis
E. all of the above
Questions from article entitled: “ACUTE HEPATITIS A
INFECTION: A predisposing factor for severe Leptospirosis”, by Juan M. Quevedo Quevedo MD, Rodrigo Valderrabano Wagner MD, Wilfredo Bravo Llerena MD, Melba Colón Quintana MD, José Ramírez
Rivera MD
Questions from article entitled: “RECTAL STRICTURE: A rare presentation of Primary Amyloidosis”,
by Jaime Rodríguez Santiago MD, Jennifer Oppenheimer Catalá MD, José Ramírez Rivera MD
25. All of the following are appropriate antibiotic therapy for leptospirosis except?
A. Penicillin
B. Metronidazole
C. Ceftriaxone
D. Doxycicline
19- Amyloidosis exhibits apple green birefringence
when seen with polarized microscopy if stained with
A. hematoxylin and eosin
B. acid fast stain
C. congo red
D. india ink
26. During the evaluation of a patient in whom leptospirosis was suspected, the initial serology did not show
an Ig M antibody against leptospira, what should be
done next?
89
A. Discard leptospirosis as the working diagnosis.
B. Use a different diagnostic technique immediately, but discontinue any empiric antibiotherapy while waiting results.
C. Repeat serology test in 10-14 days, while
continuing proper empiric antibiotic therapy.
D. Call the lab technician and question their
competence.
27. Which of the following is a not a common finding in
Weil’s syndrome?
A. Jaundice
B. Bleeding complications
C. Acute kidney injury
D. High levels of aminotransferases
CME ANSWERS
1- 2- 3- 4- 5- 6- 7- 8- 9- 10-
11- 12- 13- 14-
15-
16- 17- 18- 19-
20-
21- 22- 23- 24-
25-
26- 27-
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(A)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(B)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(C)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(D)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
Cut along the dotted lines and send
answers with check/money order for
(E)
$20.00 payable to:
(E)
(E)
Asociación Medica de Puerto
(E)
Rico
(E)
PO Box 9387
San Juan, PR 00908
(E)
PUERTO RICO
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
(E)
Fill in the following information:
Name _____________________________________________________________ Licence No. ___________
Postal Address____________________________________________________________________________
Telephone _____________Fax ______________ Email:___________________________________________
90
P.O. Box 9387
SAN JUAN, PR 00908-9387
Teléfono (787) 721-6969
SOLICITUD DE INGRESO
Nombre y apellidos (una letra de molde por casillero, deje un casillero vacío en los espacios)
Categoría de socio
ACTIVO
ACTIVO NO-RESIDENTE
INTERNO-RESIDENTE
ACTIVO ESPECIAL
Cuota $
Sociedad Médica Distrito
AFILIADO
ESTUDIANTE
PayPal transacción #
A la Junta de Directores:
Por la presente solicito ser admitido como socio de la Asociación Médica de Puerto Rico, para lo cual someto la siguiente información:
Dirección Postal:
Ciudad
Estado
Codigo postal
(
)
Teléfono
(
)
Teléfono
País
Dirección Oficina:
Horarios de Oficina
Ciudad
Lunes
AM
PM
AM
PM
De:
a:
(
)
Telefono celular
Estado
Martes
(
AM
PM
AM
PM
De:
a:
)
Codigo postal
Miércoles
AM
PM
AM
PM
De:
a:
Fax
País
Jueves
AM
PM
AM
PM
De:
a:
Viernes
Sábados
AM
PM
AM
PM
De:
a:
Marque los que
corresponda
AM
PM
AM
PM
De:
a:
@
Email
Seguro Social # (opcional)
Estado civil
Licencia #
Especialidad
DIA
MES
Fecha de nacimiento
Ciudad y pais
AÑO
Ciudadanía
Escuela de Medicina
Nombre de la madre
Afiliado
Desde
Hasta
MES
AÑO
Año de Graduación
Nombre del padre
Entrenamiento
Interno residente
Desde
Hasta
DIA
Nombre del conyuge
Estudiante
Fecha de graduación
DIA
DIA
MES
AÑO
MES
AÑO
Escuela de Medicina
Por favor responda las siguientes preguntas:
Ha sido convicto por alguna felonía en los últimos 5 años?
Ha sido su licencia para practicar la medicina limitada, suspendida o revocada, en cualquier jurisdicción, en los últimos 5 años?
Ha sido usted objeto de cualquier acción disciplinaria por cualquier Sociedad Médica o Junta de Hospital en los últimos 5 años?
Sí
No
Si ha contestado en afirmativa a cualquiera de estas preguntas, por favor añada una explicación completa en hoja aparte.
Entiendo que la convicción de una felonía o la limitación, suspensión o revocación de la licencia para practicar la medicina o acción disciplinaria por
cualquier Sociedad Médica o Junta de Hospital podrá, después de justo aviso y audiencia, resultar en la censura, suspensión o expulsión de un socio
activo o afiliado.
Certifico que la información arriba brindada es cierta y completa.
____de ____________________________de________
FIRMA DEL SOLICITANTE
Exito Awards 2010

Setiembre 2010 - Asociacion Medica de Puerto Rico

Transcription

Similar documents

tenure track faculty position announcement librarian ii

Nationalist Heroines - Newark Public Library

Cervecera de Puerto Rico

Tropigas de Puerto Rico, Inc.: Employee Productivity and Customer

At UROSTAR, patients are the stars of advanced procedures

Download: Full Company Introduction Presentation

2014 annual report - Para la Naturaleza

Architectural Digest - The Magic of Puerto Escondido

Solid Waste Management in Puerto Rico

sohlatinnewreleasebo..