Libro 1.indb - Biología Chile

Comments

Transcription

Libro 1.indb - Biología Chile
209
Biological
Research
Editor-in-Chief
Biological
Research
Manuel J. Santos
Pontificia Universidad Católica de Chile
Santiago, Chile.
is the continuation since 1992 of
ARCHIVOS DE BIOLOGÍA Y
MEDICINA EXPERIMENTALES
founded in 1964
Founding Editor:
Jorge Mardones
Past Editors:
Tito Ureta,
Patricio Zapata,
Manuel Krauskopf
Jorge Garrido
Associate Editors
This Journal is the official organ of the
SOCIEDAD DE BIOLOGÍA DE CHILE
Legal personality No 2.521 (4.6.54)
RUT 70-397.400-7
Legal address: Canadá 308
Santiago 9, Chile
(Legal Advisor and Representative)
Jaime Altamirano P.
This journal is partly subsidized by the
“Funds for Publication of Scientific
Journals” of the National Comission of
Scientific and Technological
Research (CONICYT), Chile
Yearly subscription US$ 250
Payable to
Sociedad de Biología de Chile
Correspondence to
BIOLOGICAL RESEARCH
Sociedad de Biología de Chile
Canadá 253, piso 3o, Dpto. F.
PO Box 16164, Santiago, Chile
Fax (56-2) 225 8427
Phone (56-2) 209 3503
E-mail [email protected]
Internet: www.biologiachile.cl
Indexed by Scielo, Medline, Biosis,
Embase, Lilacs, Periodica, Research Alert,
Science Citation Index Expanded (ISI),
Web of Science (ISI)
Abstracted in Biological Abstracts, Excerpta
Medica, Index Medicus and Medlars
ISSN: 0716-9760
ISSN electronic version: 0717-6287
Gloria Montenegro Pontificia Universidad Católica de Chile, Chile.
Christian González Universidad de Chile, Chile.
Mauricio González Universidad de Chile, Chile.
Rosalba Lagos Universidad de Chile, Chile.
Ricardo Moreno Pontificia Universidad Católica de Chile, Chile.
Victoria Velarde Pontificia Universidad Católica de Chile, Chile.
Assistants to the Editors
Yolanda Zambrano (Production)
Rubén Carrasco (Production)
George Montgomery (Editing and Proofreading)
Sociedad de Biología de Chile
Editorial Board
Oscar Burrone International Centre for Genetic Engineering and Biotechnology (ICGEB)
Trieste, Italy.
Enrique Brandan Pontificia Universidad Católica de Chile, Chile.
Néstor Bianchi Instituto Multidisciplinario de Biología Celular (IMBICE) La Plata, Argentina
Philipe Bouvet École Normale Supérieure du Lyon, France.
Francisco Bozinovic Pontificia Universidad Católica de Chile, Chile.
Juan José Cazzulo Universidad Nacional San Martín, Argentina.
Víctor Cifuentes Universidad de Chile, Chile.
Inés Contreras Universidad de Chile, Chile
Leopoldo De Meis Universidad Federal Río de Janeiro, Brazil.
Sonia Dietrich Institute of Botany, São Paulo, Brazil.
Raúl Fernández Donoso Universidad de Chile, Chile.
Gonzalo Gajardo Universidad de Los Lagos, Chile.
Joan Guinovart Universidad de Barcelona, Spain.
Cecilia Hidalgo Universidad de Chile, Chile.
Luis Felipe Hinojosa Universidad de Chile, Chile.
Carlos Hirschberg Boston University, U.S.A.
Tsuneo Imanaka Toyama University, Japan.
Nibaldo Inestrosa Pontificia Universidad Católica de Chile, Chile.
Ramón Latorre Centro de Neurociencia de Valparaíso, Chile.
Sergio Lavandero Universidad de Chile, Chile.
Lisette Leyton Universidad de Chile, Chile.
Martín Montecino Universidad de Concepción, Chile.
Juan Olate Universidad de Concepción, Chile.
Adrián Palacios Universidad de Valparaíso, Chile.
Manuel Rieber Instituto Venezolano de Investigaciones Científicas (IVIC) Venezuela.
Gloria Riquelme Universidad de Chile, Chile.
Flavio Salazar O. Universidad de Chile, Chile.
José Luis Santos Universidad de Chile, Chile.
M.A.Q. Siddiqui State University of New York, U.S.A.
Eugenio Spencer Universidad de Santiago de Chile, Chile.
Marc Thiry Université de Liège, Belgium.
Tito Ureta Universidad de Chile, Chile.
Carlos Valenzuela Universidad de Chile, Chile
Pablo Valenzuela Fundación Ciencia para la Vida, Chile.
Claudio Vásquez Universidad de Santiago de Chile, Chile.
Sociedad de Biología de Chile
Directorio Sociedad de Biología de Chile 2011-2012
Mesa Directiva
Dr. Patricio Ojeda
Presidente
Facultad de Ciencias Biológicas
P. Universidad Católica de Chile
Alameda 340
Fono: 3542879
[email protected]
Dra. Rosalba Lagos
Vicepresidenta
Facultad de Ciencias
Universidad de Chile
Las Palmeras 3425
Fono: 9787348
[email protected]
Dr. Marco Tulio Núñez
Past president
Facultad de Ciencias
Universidad de Chile
Las Palmeras 3425
Fono: 9787360
[email protected]
Dr. Héctor Toledo
Tesorero
Facultad de Medicina
Universidad de Chile
Independencia 1027
Fono: 9786053
[email protected]
Dr. Eduardo Palma
Secretario
Facultad de Ciencias Biológicas
P. Universidad Católica de Chile
Alameda 340
Fono: 3542192
[email protected]cl
Dra. María Antonieta Valenzuela
Directora
Facultad de Ciencias Químicas y
Farmacéuticas
Universidad de Chile
Vicuña Mackenna 20
Fono: 9782957
[email protected]
Dr. Rodrigo Iturriaga
Director
Facultad de Ciencias Biológicas
P. Universidad Católica de Chile
Alameda 340
Fono: 3542852
[email protected]
Presidentes de Sociedades
Afiliadas
Sociedad de Ecología de Chile
Dra. Bárbara Saavedra
Wildlife Conservation Society
Fono: 56-2-6351095
e-mail: [email protected]
Sociedad de Biología Celular de Chile
Dra. María Rosa Bono
Facultad de Ciencias
Universidad de Chile
Fono: 56-2-9787339
E-mail: [email protected]
Sociedad de Bioquímica y Biología
Molecular de Chile
Dra. Victoria Guixé
Facultad de Ciencias
Universidad de Chile
Fono: 56-2-9787335
E-mail:[email protected]
Sociedad de Reproducción
y Desarrollo
Dra. Carmen Romero
Facultad de Medicina
Hospital Clínico J.J. Aguirre
Fono: 56-2-9788305
E-mail:[email protected]
Sociedad de Botánica de Chile
Dra. Gloria Rojas Villegas
Museo Nacional de Historia Natural
Fono: 56-2-6804619
Fax: 56-2-680460
E-mail: [email protected]
Sociedad Chilena de Ciencias
Fisiológicas
Dr. Julio Alcayaga
Facultad de Ciencias
Universidad de Chile
Fono: 56-2-9787366
E-mail: [email protected]
Sociedad de Microbiología de Chile
Dr. Omar Orellana Orellana
ICBM- Facultad de Medicina
Universidad de Chile
Fono: 56-2-9786325
E-mail: [email protected]
Sociedad de Genética de Chile
Dr. Juan Carlos Marín
Facultad de Ciencias
Universidad del Bío-Bío
Fono: 56-42-253153
E-mail: [email protected]
Sociedad Chilena de Inmunología
Dr. Ángel Oñate
Facultad de Ciencias Biológicas
Universidad de Concepción
Fono: 56-41-2204118
E-mail: [email protected]
Sociedad Chilena de Evolución
Dr. Pedro Victoriano
Facultad de Ciencias Naturales y
Oceanográficas
Universidad de Concepción
Fono: 56-41-2203058
E-mail: [email protected]
Sociedad de Farmacología de Chile
Dr. Juan Carlos Prieto
Facultad de Medicina
Universidad de Chile
Fono: 56-2-9786044
E-mail: [email protected]
Secciones
Sección Zoología
Mauricio Canals
Índice
211
2011 - vol. 44 - no 3
Articles
213 GIANCARLO A STATTI, FILOMENA CONFORTI, FEDERICA MENICHINI,
MARIANGELA MARRELLI, GANGALE CARMEN, ROSA TUNDIS, MONICA R LOIZZO,
MARCO BONESI and FRANCESCO MENICHINI
Protective effect of Hypericum calabricum Sprengel on oxidative damage and its inhibition of nitric
oxide in lipopolysaccharide-stimulated RAW 264.7 macrophages
219 CAMILLA V PASTORE, FEDERICA PIRRONE, SILVIA MAZZOLA, MANUELA RIZZI,
MANUELA VIOLA, GIUSEPPE SIRONI, MARIANGELA ALBERTINI
Mechanical ventilation and volutrauma: study in vivo of a healthy pig model
229 MARTA G. AMARAL, VINICIUS F. CAMPOS, FABIANA K. SEIXAS, PAULO V. CAVALCANTI,
LISIANE P. R. SELAU, JOÃO C. DESCHAMPS, TIAGO COLLARES
Testis-mediated gene transfer in mice: comparison of transfection reagents regarding transgene
transmission and testicular damage
235 MARCOS L M GOMES, JULIANA C MONTEIRO, KARINE M FREITAS,
MARIANA M SBERVELHERI, HEIDI DOLDER
Association of the infusion of Heteropterys aphrodisiaca and endurance training brings
spermatogenetic advantages
243 MARITZA C SOLER, JESSICA L MOLINA, HUGO A DÍAZ, VIVIAN C PINTO,
YASENKA L BARRIOS, KAN HE, MARC ROLLER, CAROLINE R WEINSTEIN-OPPENHEIMER
Effect of the standardized Cimicifuga foetida extract on Hsp 27 expression in the MCF-7 cell line
251 FLÁVIA MM DE PAULA, ANTONIO C BOSCHERO, EVERARDO M CARNEIRO,
JOSÉ R BOSQUEIRO, and ALEX RAFACHO
Insulin signaling proteins in pancreatic islets of insulin-resistant rats induced by glucocorticoid
259 JOSÉ L TLACHI-LÓPEZ, AURORA LÓPEZ, KURT HOFFMAN, JAVIER VELÁZQUEZMOCTEZUMA, MARIO GARCÍA-LORENZANA and ROSA ANGÉLICA LUCIO
Rat dorsal prostate is necessary for vaginal adhesion of the seminal plug and sperm motility in the
uterine horns
269 KEYLA M GÓMEZ, ANDREA RODRÍGUEZ, YESSEIMA RODRÍGUEZ, ALVARO H RAMÍREZ
and TOMÁS ISTÚRIZ
The subsidiary GntII system for gluconate metabolism in Escherichia coli: Alternative induction of
the gntV gene
277 OSCAR A. CERDA, FELIPE NÚÑEZ-VILLENA, SARITA E. SOTO, JOSÉ MANUEL UGALDE,
REMIGIO LÓPEZ-SOLÍS and HÉCTOR TOLEDO
tlpA gene expression is required for arginine and bicarbonate chemotaxis in Helicobacter pylori
Índice
283 CARLOS Y VALENZUELA
Heterogeneous periodicity of drosophila mtDNA: new refutations of neutral and nearly neutral
evolution
295 FERNANDO P PONCE, GONZALO R QUINTANA, ANDREW S. PHILOMINRAJ,
EDGAR H VOGEL
Habituation the eyeblink response in humans with stimuli presented in a sequence of incremental
intensity
301 GONZALO ENCINA, FERNANDO EZQUER, PAULETTE CONGET, YEDY ISRAEL
Insulin is secreted upon glucose stimulation by both gastrointestinal enteroendocrine K-cells and
L-cells engineered with the preproinsulin gene
212
Biol Res 44: 213-218, 2011
Protective effect of Hypericum calabricum Sprengel on oxidative
damage and its inhibition of nitric oxide in lipopolysaccharidestimulated RAW 264.7 macrophages
Giancarlo A Statti1, Filomena Conforti1*, Federica Menichini1, Mariangela Marrelli1, Gangale Carmen2,
Rosa Tundis1, Monica R Loizzo1, Marco Bonesi1 and Francesco Menichini1
1
2
Department of Pharmaceutical Sciences, Faculty of Pharmacy, Nutrition and Health Sciences, University of Calabria, Italy.
Natural History Museum of Calabria and Botanic Garden, University of Calabria, Italy.
ABSTRACT
The present study shows for the first time the phenolic composition and the in vitro properties (antioxidant and inhibition of nitric
oxide production) of Hypericum calabricum Sprengel collected in Italy. The content of hypericins (hypericin and pseudohypericin),
hyperforin, flavonoids (rutin, hyperoside, isoquercetrin, quercitrin, quercetin and biapigenin) and chlorogenic acid of H. calabricum, have
been determined. The ethyl acetate fraction from the aerial parts of H. calabricum exhibited activity against the radical 1,1-diphenyl-2picrylhydrazyl (DPPH) with IC50 value of 1.6 μg/ml. The test for inhibition of nitric oxide (NO) production was performed using the murine
monocytic macrophage cell line RAW 264.7. The ethyl acetate fraction had significant activity with an IC50 value of 102 μg/ml and this
might indicate that it would have an anti-inflammatory effect in vivo.
Key terms: antiradical activity, hypericaceae, Hypericum calabricum Sprengel; phenolic compounds.
INTRODUCTION
Plant species of the genus Hypericum are well known for their
use in traditional medicine due to their therapeutic efficacy.
One of the most important and commercially recognized
species of the genus is H. perforatum L. (St. John’s wort), which
has been used in herbal medicine, externally for the treatment
of skin wounds, eczema and burns, and internally for disorders
of the central nervous system, the alimentary tract and other
ailments (Bombardelli and Morazzoni, 1995; Barnes et al.,
2001). The main constituents of the Hypericum species are:
naphthodianthrones, primarily represented by hypericin
and pseudohypericin; flavonoids, e.g., hyperoside, rutin or
quercitrin; and phloroglucinol derivatives, e.g., hyperforin and
adhyperforin (Nahrstedt and Butterweck, 1997; Smelcerovic et
al., 2006).
The use of traditional medicine is widespread and plants
still represent a large source of natural antioxidants that might
serve as leads for the development of novel drugs. Therefore,
the Hypericum genus has attracted much attention in the
investigation of metabolites from this genus.
The aim of present study was to determine the chemical
composition, antioxidant potential and inhibition of nitric
oxide (NO) production of Hypericum calabricum Sprengel
(Hypericaceae). Therefore, the 1,1-diphenyl-2-picrylhydrazyl
(DPPH) radical-scavenging activities and production of NO
in murine monocytic macrophage cell line RAW 264.7 of ethyl
acetate fraction were determined.
METHODS
Chemicals
Ethanol and dimethyl sulfoxide were obtained from VWR
International s.r.l. (Milan, Italy). Ascorbic acid, 1,1-diphenyl-
2-picrylhydrazyl (DPPH), Griess reagent [1% sulfanamide and
0.1% N-(1-naphthyl) ethylenediamine dihydrochloride in 2.5%
H 3PO 4], 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT), Dulbecco’s modified Eagle’s medium (DMEM),
L -glutamine, fetal bovine serum, antibiotic/antimycotic
solution (penicillin/streptomycin), lipopolysaccharide (LPS),
indomethacin, standard compounds were obtained from SigmaAldrich S.p.A. (Milan). All other reagents, of analytical grade,
were products of Carlo Erba (Milan).
Plant materials
H. calabricum is a herbaceous perennial plant, the distribution
area of which is limited to Calabria, Italy (Fig. 1) (Conti et al.,
2005; Brullo et al., 2007). The aerial parts of H. calabricum used
in this study were collected in June 2002 in Calabria (Southern
Italy) and authenticated by Dr. Carmen Gangale, Natural
History Museum of Calabria and Botanic Garden, University
of Calabria (Italy). A voucher specimen was deposited in the
Botany Department Herbarium at the University of Calabria
(CLU-9307).
High-performance liquid chromatography analysis
The dried aerial parts of H. calabricum (720 g) were extracted
with methanol, and successively fractioned with n-hexane,
dichloromethane and ethyl acetate (1.1 L each). The ethyl
acetate fraction was subjected to HPLC analysis (JASCO - PU980 pumps; JASCO-MD-910 Multiwavelength Detector with
UV-Diode Array) water-H3PO2 mixture (10:90, 20:80, 40:60,
60:40, 80:20 and 100:0). The preparative reversed-phase HPLC
analysis (C18 column 250 x 4.6 mm, 5 mm; mobile phase: 0-15
min, isocratic 100% water; 15-45 min gradient 30% ACN in
water; 45-55 min, gradient 80% ACN in water; isocratic 100%
ACN; flow-rate: 1 ml/min) was used.
* Corresponding author: Dr. Filomena Conforti, Department of Pharmaceutical Sciences, University of Calabria, I-87036 Rende (CS), Italy, Tel: +39 0984 493063, Fax: +39 0984 493298,
E-mail: [email protected]
Received: November 23, 2009. In revised form: July 14, 2010. Accepted: August 5, 2010.
214
STATTI ET AL. Biol Res 44, 2011, 213-218
The quantification of the constituents was done by the
external standard method, using a solution containing 15 μg/
ml of each reference compound in methanol. The reference
compounds were chlorogenic acid, rutin, hyperoside,
isoquercitrin, quercetin, biapigenin, hypericin and hyperforin
salt. Flavonols and flavones were quantified at 350 nm,
hyperforins at 260 nm and hypericins at 590 nm. Other
flavonols and cinnamic acid type compounds were quantified
at 350 nm, such as quercetin and chlorogenic acid equivalents,
respectively. All the samples were analyzed in triplicate.
Free radical-scavenger activity
Free radical-scavenger activity was determined by the
1,1-diphenyl-2-picrylhydrazyl (DPPH) assay, as described
previously (Silva and Dias, 2002). The antiradical activity of
each fraction was evaluated using a dilutions series, in order to
obtain a large spectrum of sample concentrations. Additionally,
relative free radical scavenging activity was assessed using
fractions with equivalent dry-weight biomass concentrations.
The reaction solution consisted of 0.2 ml of sample and 0.8
ml of a DPPH stock solution (1.0 × 10-4 M, methanol 100%).
The absorbance was monitored continuously at 517 nm with
a Perkin-Elmer UV/VIS Spectrometer Lambda, assuring
that the reaction was complete (plateau state). Methanol
was used as a blank and ascorbic acid was used as a positive
control. All determinations were performed in triplicate. The
percentage of reduced DPPH at steady state (DPPH R) was
calculated and these values were plotted against the log10 of
the concentrations of individual fractions. A decrease by 50%
of the initial DPPH concentration was defined as the IC50. The
amount of reduced DPPH was estimated after 30 min at the
dilution factor closest to the estimated value IC50. This activity
is given as a percentage of DPPH radical scavenging, which is
calculated with the equation:
% DPPH radical-scavenging = [1-(sample absorbance with DPPHsample absorbance without DPPH/control absorbance)] x 100.
The DPPH solution without sample solution was used
as control. All the parameters were calculated graphically
using the software GraphPad 4.0 (Prism, USA). All tests were
performed in triplicate.
Cell culture
The murine monocytic macrophage cell line RAW 264.7
(European Collection of Cell Cultures, London, UK) was
grown in plastic a culture flask in DMEM with L-glutamine
supplemented with 10% fetal bovine serum and 1% antibiotic/
antimycotic solution (penicillin/streptomycin) under 5%
CO 2 at 37°C. After 4-5 days cells were removed from the
culture flask by scraping and centrifuged for 10 minutes. The
medium was then removed and the cells were resuspended
with fresh DMEM. Cell counts and viability were assessed
using a standard trypan blue cell counting technique. The cell
concentration was adjusted to 1 × 106 cells/ml in the same
medium. One hundred microliters of the above concentration
was cultured in a 96-well plate for 1 day to become nearly
confluent. Concentrations of the samples ranging from 10 to
100 μg/ml were prepared from the stock solutions by serial
dilution in DMEM to give a volume of 100 μl in each well of a
96-well microtiter plate. Then cells were cultured with vehicle
or H. calabricum ethyl acetate fraction in the presence of 1 μg/
ml LPS for 24 hours.
Assay for cytotoxic activity
Cytotoxicity was determined using the MTT assay reported by
Tubaro and co-workers (1996) with some modifications. The
assay for each sample analyzed was performed in triplicate,
and the culture plates were kept at 37°C with 5% (vol/vol) CO2
for 1 day. After 24 hours of incubation, 100 μl of medium was
removed from each well. Subsequently, 100 ml of 0.5% (wt/vol)
MTT, dissolved in phosphate-buffered saline, was added to
each well and allowed to incubate for a further 4 hours. After 4
hours of incubation, 100 μl of dimethyl sulfoxide was added to
each well to dissolve the formazan crystals. Absorbance values
at 550 nm were measured with a microplate reader (model
DV 990 B/V, GDV, Rome). Cytotoxicity was expressed as 50%
inhibitory concentration (IC50), which is the concentration to
reduce the absorbance of treated cells by 50% with reference to
the control (untreated cells).
Inhibition of NO production in LPS-stimulated RAW 264.7 cells
Fig. 1: Distribution of Hypericum calabricum Sprengel in Italy.
The presence of nitrite, a stable oxidized product of NO,
was determined in cell culture media by Griess reagent
[1% sulfanamide and 0.1% N-(1-naphthyl) ethylenediamine
dihydrochloride in 2.5% H 3PO 4] (Green et al., 1982). One
hundred microliters of cell culture supernatant was removed
and combined with 100 ml of Griess reagent in a 96-well plate
followed by spectrophotometric measurement at 550 nm using
STATTI ET AL. Biol Res 44, 2011, 213-218
the DV 990 B/V microplate reader. Nitrite concentration in the
supernatants was determined by comparison with a sodium
nitrite standard curve.
Statistics
Data were expressed as mean ± SD values. Statistical analysis
was performed by using Student’s t test or by one-way
analysis of variance followed by the Dunnett’s test for multiple
comparisons of unpaired data. Differences were considered
significant at P ≤ .05. The IC50 was calculated from the Prism
(GraphPad, San Diego, CA, USA) dose-response curve
(statistical program) obtained by plotting the percentage of
inhibition versus the concentrations.
RESULTS
Phenolic composition
Several papers have reported the analysis of H. perforatum
extracts. However, most of them focus only on some individual
compounds, such as the hypericins or the phloroglucinols;
LC-MS studies have also been done (Fuzzati et al., 2001;
Tolonen et al., 2002). In this work, we fully analyzed the
ethyl acetate fraction of H. calabricum by HPLC-DAD and the
major compounds were identified and characterized. Phenolic
compounds were identified by their UV spectra. Ethyl acetate
fraction was composed of a complex mixture of compounds,
most of them already known to be present in Hypericum
extracts (Dias et al., 1999; Erdelmeier et al., 2000; Jürgenliemk
and Nahrstedt, 2002). Figure 2 shows the data obtained by
HPLC-DAD of the most representative phenolics present in H.
calabricum.
215
A major group of compounds was identified as flavonols,
due to their characteristic UV spectra. Compound 1 has
similar UV-spectra, characteristic of chlorogenic-type acids.
The utilization of chlorogenic acid commercial standards
confirmed the identification of compound 1. Compounds
2 and 3 have UV-spectra characteristic of flavonols
glycosylated at C3 (257, 265sh, 355 nm). Compound 2
was putatively identified as rutin while compound 3 as
hyperoside. The utilization of rutin, hyperoside commercial
standards confirmed the identification of compounds 2 and
3. Compounds 4 and 5 have an UV-spectrum (255, 265sh,
301sh, 349) consistent with those of isoquercetrin and
quercetrin. The identification was confirmed by spiking
with a commercial standard of quercetin 3-rhamnoside.
Compound 6 has a UV-spectrum (255, 265sh, 370 nm)
consistent with those of quercetin. The identification
was confirmed by spiking with a commercial standard
of quercetin. Compound 7 has a UV-spectrum (268, 333
nm), similar to that of amentoflavone. These data and its
localization in the chromatogram are compatible with
biapigenin. Compounds 8 and 9 were identified as hypericins
according to their characteristic UV-Vis spectra (Kurth and
Spreemann, 1998). Confirmation of hypericin identity was
supported by data consistent with that already published
(Tolonen et al., 2002). Hyperforin was identified as described
elsewhere (Dias and Ferreira, 2003).
The preparative reversed-phase HPLC analysis of ethyl
acetate fraction resulted in the quantification (mg/g) of
phenolic compounds: flavonoids: rutin 0.72, hyperoside 10.94,
isoquercetrin 3.35, quercitrin 2.17, quercetin 1.04, biapigenin
(not detected); naphthodianthrones: pseudohypericin (not
detected), hypericin 0.03, hyperforin 3.45; chlorogenic acid
1.27.
Fig. 2: HPLC chromatogram of H. calabricum ethyl acetate fraction. Compounds are identified in the figure by numbers: 1 - chlorogenic
acid; 2 - rutin, 3 - hyperoside; 4 - isoquercetrin, 5 - quercitrin, 6 - quercetin, 7 - biapigenin; 8 - pseudohypericin, 9 - hypericin, 10 hyperforin.
216
STATTI ET AL. Biol Res 44, 2011, 213-218
Radical scavenging activity
The model of scavenging stable DPPH free radicals can be used
to evaluate antioxidant activity in a relatively short time. The
absorbance decreases as a result of a color change from purple
to yellow as the radical is scavenged by antioxidants through
donation of hydrogen to form the stable DPPH-H molecule
(Gadov et al., 1997), although a recent article suggests that, on
the basis of kinetic analysis of the reaction between phenols
and DPPH, the reaction in fact behaves like a single electron
transfer reaction (Foti et al., 2004). It was found that the ratedetermining step for this reaction consists of a fast electron
transfer process from the phenoxide anions to DPPH. The
hydrogen atom abstraction from the neutral ArOH by DPPH
becomes a marginal reaction path because it occurs very slowly
in strong hydrogen-bond-accepting solvents, such as methanol
and ethanol. The scavenging effects of extract on DPPH were
examined at different concentrations (range between 0.1 and
100 μg/ml). Ethyl acetate fraction from the aerial parts of H.
calabricum was able to reduce the stable free radical DPPH to
the parent yellow-colored DPPH with an IC50 value of 1.6 μg/
ml (Table 1). This result is very significant in comparison to the
positive control, ascorbic acid, which showed an IC50 value of 2
μg/ml (Fig. 3).
TABLE 1
IC50 values of antioxidant and inhibition of NO production of H.
calabricum: IC50 values.
Assay
Inhibition of NO production
Indomethacinb
IC50 μg/mla
102 ± 1.2
53 ± 0.8
DPPH
1.6 ± 0.001
Ascorbic acidb
2.0 ± 0.001
a)
b)
± S.D. (n = 3).
Positive control.
Inhibition of NO production
An activity of H. calabricum ethyl acetate fraction relative
to reduction of inflammation was studied in vitro by
analyzing their inhibitory effects on the chemical mediator NO
released from macrophages. Once activated by inflammatory
stimulation, macrophages produce a large number of cytotoxic
molecules. The treatment of RAW 264.7 macrophages with
LPS (1 μg/ml) for 24 hours induces NO production, which
can be quantified by utilizing the chromogenic Griess reaction
measuring the accumulation of nitrite, a stable metabolite
of NO. NO is considered to play a key role in inflammatory
response, based on its occurrence at inflammatory sites and its
ability to induce many of the hallmarks in the inflammatory
response. The benefi cial effect of H. calabricum extract on
the inhibition of production of infl ammatory mediators in
macrophages can be mediated through oxidative degradation
of products of phagocytes, such as O2– and HOCl. As shown
in Figure 4, incubation of RAW 264.7 cells with extract of
H. calabricum induced a significant inhibitory effect on the
LPS-induced nitrite production. The extract of H. calabricum
showed significant inhibition of LPS-induced NO production
in RAW 264.7 cells in a dose-dependent manner, with an
IC50 value of 102 μg/ml. Cytotoxic effect of the sample in the
presence of LPS (1 μg/ml) was also evaluated. H. calabricum
extract did not show any cytotoxicity up to 500 μg/ml
concentration.
DISCUSSION
Oxidative damage may initiate and promote the progression
of a number of chronic diseases, including inflammation. The
present work showed for the first time the in vitro activity of
H. calabricum extract and its chemical composition. Further
in vivo investigations are needed for a possible usefulness of
this extract in the treatment of inflammation. In this study we
have demonstrated that the extract of H. calabricum exhibited
signifi cant antioxidant activity and an inhibitory effect on
production of NO (an inflammatory mediator) in macrophages.
The observed in vitro activities suggest that the investigated
plant extract might also exert in vivo protective effects against
oxidative and free radical injuries occurring in different
pathological conditions.
Fig. 3: Dose-dependent activity of H. calabricum ethyl acetate fraction using DPPH radical. Data are mean ± S.D. (n = 3).
STATTI ET AL. Biol Res 44, 2011, 213-218
217
Fig. 4: Dose-dependent activity of H. calabricum ethyl acetate fraction on NO production in the murine monocytic macrophage cell line
RAW 264.7. Data are mean ± S.D. (n = 3).
According to a study of Silva et al. (2005), phenolic
compounds other than hypericins should be relevant for DPPH
activity. Taking into account the activity of the H. perforatum
fractions tested, the hydroxycinnamic acids and flavonoids were
highly relevant for both radical-scavenging and inhibition of
lipid peroxidation activities. Our previous study (Conforti et
al., 2002) evaluated the antioxidant potential of H. triquetrifolium
and we showed that this activity could be related to the content
of flavonoids. The antioxidant activity of an H. androsaemum
infusion was also related to its phenolic content (Valentao et
al., 2002). Some of the identified phenols in the H. androsaemum
infusion extract were flavonoids, specifically quercetin and
glycosylated derivatives, also present in ethyl acetate fraction
of H. calabricum. These types of compounds are well known
antioxidants. They have structural aspects, such as the presence
of a catechol moiety in the ring, a 2,3-double bond in conjunction
with a 4-oxo group in the C-ring, and the presence of hydroxyl
groups at positions 3 and 5, which are all determinants of high
antioxidant activity (Halliwell et al., 1995; Rice-Evans et al., 1997).
Oxidative stress has been implicated in exacerbated
inflammation, a process of cellular aggression mainly mediated
by reactive oxygen/nitrogen species (ROS/RNS). Our results
suggest that ethyl acetate fraction of H. calabricum could have
a beneficial role in inflammatory disorders by trapping an
important mediator of inflammatory processes: nitric oxide
(NO). Previous studies have reported that compounds also
present in H. calabricum extracts, such as chlorogenic acid and
flavonoids, are efficient scavengers of NO (Firuzi et al., 2004;
Kono et al., 1997).
Therefore, we propose here the potential benefits of
H. calabricum extract on the basis of the phytochemical
characteristics and the observed bioactive properties.
The antioxidative and anti-inflammatory properties of
naturally occurring compounds appear to contribute to their
chemopreventive or chemoprotective activity.
The anti-inflammatory activity of H. calabricum extract was
evaluated to obtain an insight into the beneficial effects of this
plant species in conditions related to inflammation, reduced
risk for cardiovascular diseases, and cancer prevention by
acting as anti-inflammatory agents. Further studies of the plant
extracts and/or the identified compounds from H. calabricum
on the pharmacokinetics or mode of action on mechanisms
of chemopreventive properties are warranted. As well, the
extraction technique should be investigated more widely,
particularly in view of the application of supercritical fluids.
Another point that should be strongly evaluated is the use of
emulsions instead of solution in real applications, with the aim
of preventing degradation of extract activity due to oxygen
exposure. In conclusion, this work reveals that H. calabricum
can be an interesting source of anti-inflammatory and
antioxidant principles, with a potential use in different fields
(the food, cosmetics, and pharmaceutical).
ACKNOWLEDGEMENT
The authors are grateful to Dr. Carmen Gangale, Botanic
Garden, University of Calabria, Italy, for supplying the herb
sample.
REFERENCES
BARNES J, ANDERSON LA, PHILLIPSON JD (2001) St. John’s wort
(Hypericum perforatum L.): a review of its chemistry, pharmacology and
clinical properties. J Pharm Pharmcol 53:583-600.
BOMBARDELLI E, MORAZZONI P (1995) Hypericum perforatum. Fitoterapia
66, 43-58.
BRULLO S, GANGALE C, UZUNOV DH (2006) Taxonomic remarks on the
endemic flora of Sila Massif (S Italy). Bocconea 21:5-14.
CONFORTI F, STATTI GA, TUNDIS R, MENICHINI F, HOUGHTON
P (2002) Antioxidant activity of methanolic extract of Hypericum
triquetrifolium Turra aerial part. Fitoterapia 73:479-483.
CONTI F, ABBATE G, ALESSANDRINI A, BLASI C (2005) An Annotated
Checklist of the Italian Vascular Flora. Palombi, Roma.
DIAS ACP, FERREIRA MF (2003) Production of phenolics by in vitro
cultures of Hypericum perforatum: A case study. In A. P. Rauter, M. E.
Ara_ujo, F. B. Palma, J. Justino, & S. P. Santos (Eds.), Natural products
in the new millenium: Prospects and industrial applications (pp. 367374). Kluwer Academic Publishers.
DIAS ACP, SEABRA RM, ANDRADE PB, FERREIRA MF (1999) The
development and evaluation of a HPLC-DAD method for the analysis
of the phenolic fractions from in vivo and in vitro biomass of Hypericum
species. Journal of Liquid Chromatography 22:215-227.
218
STATTI ET AL. Biol Res 44, 2011, 213-218
ERDELMEIER CAJ, KOCH E, HOERR R (2000) Hypericum perforatum - St.
John’s wort chemical, pharmacological and clinical aspects. In Atta-urRahman (Ed.), Studies in natural products chemistry - bioactive natural
products (Part C) (Vol. 22, pp. 643-716). New York: Elsevier Direct.
FIRUZI O, MLADENKA P, PETRUCCI R, MARROSU G, SASO L (2004)
Hypochlorite scavenging activity of flavonoids. The Journal of
Pharmacy and Pharmacology 56:801-807.
FOTI MC, DAQUINO C, GERACI C (2004) Electron-transfer reaction
of cinnamic acids and their methyl esters with the DPPH radical in
alcoholic solutions. J Org Chem 69:2309-2314.
FUZZATI N, GABETTA B, STREPPONI I, VILLA F (2001) Highperformance
liquid chromatography-electrospray ionization mass spectrometry and
multiple mass spectrometry studies of hyperforin degradation products.
Journal of Chromatography A, 926:187-198.
GADOW A, JOUBERT E, HANSMANN CF (1997) Comparison of the
antioxidant activity of aspalathin with that of other plant phenols of
rooibos tea (Aspalathus linearis), a-tocopherol, BHT, and BHA. J Agric
Food Chem 45:632-638.
GREEN LC, WAGNER DA, GLOGOWSKI J, SKIPPER PL, WISHNOK JS,
TANNENBAUM SR (1982) Analysis of nitrate, nitrite, and [15N]nitrate
in biological fluids. Anal Biochem 126:131-138.
HALLIWELL B, AESCHBACH R, LÖLIGER J, ARUOMA OI (1995) The
characterization of antioxidants. Food and Chemical Toxicology 33:601-617.
JÜRGENLIEMK G, NAHRSTEDT A (2002) Phenolic compounds from
Hypericum perforatum. Planta Medica 68:88-91.
KONO Y, KOBAYASHI K, TAGAWA S, ADACHI K, UEDA A, SAWA Y,
SHIBATA H (1997) Antioxidant activity of polyphenolics in diets. Rate
constants of reactions of chlorogenic acid and caffeic acid with reactive
species of oxygen and nitrogen. Biochimica Biophysica Acta 1335:335-342.
KURTH H, SPREEMANN R (1998) Phytochemical characterization of
various St. John’s wort extracts. Advances in Therapy 15:117-128.
NAHRSTEDT A, BUTTERWECK V (1997) Biologically active and
other chemical constituens of the herb of Hypericum perforatum L.
Pharmacopsychiatry 30:129-134.
RICE-EVANS CA, MILLER NJ, PAGANGA G (1997) Antioxidant properties
of phenolic compounds. Trends in Plant Science 2:152-159.
SILVA BA, FERRERES F, MALVA JO, DIAS ACP (2005) Phytochemical and
antioxidant characterization of Hypericum perforatum alcoholic extracts.
Food Chemistry 90:157-167.
SILVA BC, DIAS ACP (2002) Evaluation of the free radical scavenger activity
of Hypericum perforatum alcoholic extracts. Revista de Fitoterapia,
2(Suppl 1), 133.
SMELCEROVIC A, VERMA V, SPITELLER M, AHMAD SM, PURI SC, QAZI
GN (2006) Phytochemical analysis and genetic characterisation of six
Hypericum species from Serbia. Phytochemistry 67:171-177.
TOLONEN A, UUSITALO J, HOHTOLA A, JALONEN J (2002)
Determination of naphthodianthrones and phloroglucinols from
Hypericum perforatum extracts by liquid chromatography/tandem
mass spectrometry. Rapid Communications in Mass Spectrometry
16:396-402.
TUBARO A, FLORIO C, LUXICH E, VERTUA R, DELLA LOGGIA R,
YASUMOTO T (1996) Suitability of the MTT-based cytotoxicity assay to
detect okadaic acid contamination of mussels. Toxicon 34:965-974.
VALENTAO P, FERNANDES E, CARVALHO F, ANDRADE PB, SEABRA
RM, DE LOURDES BASTOS M (2002) Antioxidant activity of Hypericum
androsaemum infusion: Scavenging activity against superoxide radical,
hydroxyl radical and hypochlorous acid. Biological and Pharmaceutical
Bulletin 25:1320-1323.
Biol Res 44: 219-227, 2011
Mechanical ventilation and volutrauma: study in vivo of a healthy
pig model
Camilla V Pastore1, Federica Pirrone1, Silvia Mazzola1, Manuela Rizzi2, Manuela Viola2, Giuseppe Sironi3,
Mariangela Albertini1
1 Department of Animal Pathology, Hygiene and Public Veterinary Health, Section of Biochemistry and Physiology, University of Milan, Italy; 2Department of Experimental
and Clinical Biomedical Sciences, University of Insubria, Italy; 3Department of Animal Pathology, Hygiene and Public Veterinary Health, Section of Veterinary Pathological
Anatomy and Avian Pathology, University of Milan, Italy.
ABSTRACT
Mechanical ventilation is essential in intensive care units. However, it may itself induce lung injury. Current studies are based on rodents,
using exceptionally large tidal volumes for very short periods, often after a “priming” pulmonary insult. Our study deepens a clinically
relevant large animal model, closely resembling human physiology and the ventilator setting used in clinic settings. Our aim was to
evaluate the pathophysiological mechanisms involved in alveolo/capillary barrier damage due to mechanical stress in healthy subjects.
We randomly divided 18 pigs (sedated with medetomidine/tiletamine-zolazepam and anesthetised with thiopental sodium) into three
groups (n=6): two were mechanically ventilated (tidal volume of 8 or 20 ml/kg), the third breathed spontaneously for 4 hours, then animals
were sacrificed (thiopental overdose).
We analyzed every 30’ hemogasanalysis and the main circulatory and respiratory parameters. Matrix gelatinase expression was evaluated
on bronchoalveolar lavage fluid after surgery and before euthanasia. On autoptic samples we performed zymographic analysis of lung,
kidney and liver tissues and histological examination of lung.
Results evidenced that high VT evoked profound alterations of lung mechanics and structure, although low VT strategy was not devoid of
side effects, too. Unexpectedly, also animals that were spontaneously breathing showed a worsening of the respiratory functions.
Key terms: gelatinases, mechanical ventilation, pig, ventilator induced lung injury (VILI).
INTRODUCTION
Mechanical ventilation is essential to sustain ventilatory
function in patients with respiratory failure and during general
anaesthesia. However, this is a potentially harmful therapeutic
intervention, since it can initiate lung injury also in healthy
lungs (Dreyfuss and Saumon, 1998; ARDS network 2000).
Despite the life-saving potential of this assistance, several
drawbacks and complications have been identified early in
the use of mechanical ventilation, so the concept of ventilatorinduced lung injury (VILI) was introduced (Pingleton, 1988).
VILI has recently received much attention in both experimental
and clinical fields (Amato et al., 1998), and many studies have
been performed to evaluate the effects of sustained elevation
in lung volume (Ricard et al., 2003). The underlying molecular
mechanisms of VILI have not been fully elucidated, but the
histological appearance of the lung tissue is similar to acute
lung injury/acute respiratory distress syndrome (ALI/ARDS)
(Nakos et al., 2006). Clinical studies demonstrate that if the use
of large tidal volumes (VT ≥ 10-12 ml/kg) is associated with a
poor prognosis, also a “lung-protective” ventilation strategy
(VT ≤ 10-12 ml/kg), associated with a suitable positive endexpiratory pressure, reduces but does not prevent the onset of
VILI (Vaneker et al., 2007). To further improve the outcome of
critically ill patients, a better understanding of the detrimental
mechanisms of VILI is therefore required.
The cytopathological changes of the lungs caused by
overdistension are characterized by loss of blood gas barrier
integrity and namely haemorrhage, edema and inflammatory
cells influx (Ricard et al., 2003). Edema formation in
alveolar spaces causes profound changes in pulmonary
mechanics and gas exchange, that may be important limitingperformance factors, especially when correlated with hypoxia
(Wirtz and Dobbs, 2000). The development of interstitial
pulmonary edema has been associated with the degradation
of the proteoglycans and a weakening of intramolecular
bonds between fibres, causing a disorganization of the threedimensional extracellular matrix (ECM) fibre mesh and an
increase of the amount of water that can be accommodated
in the tissue (Dreyfuss et al., 1985). In this process various
proteolytic enzymes are involved, including metalloproteinases
(MMPs), holding a major role. MMPs are a family of zincdependent endopeptidases that can cleave virtually all
components of the extracellular matrix, and currently
are viewed also as modulators of cell-cell and cell-matrix
interactions (Albaiceta et al., 2008). Expression of MMPs in the
lung is modulated by a wide range of factors, including the
mechanical stimuli that continuously change airway pressure
as part of the dynamic breathing cycle (Greenlee et al., 2007).
Particularly, the gelatinases are secreted as latent forms by
a variety of cell types and they are activated in extracellular
spaces by serine proteases and other MMP members (Woessner,
1991; Tomashefski, 1990). MMP-2 (gelatinase A, 72 kDa) and
MMP-9 (gelatinase B, 92 kDa) have the capacity to degrade
gelatine, elastin, fibronectin and type IV collagen, which are
the major structural components of the basement membrane
(Woessner, 1991). MMP-9 is stored in neutrophils granules
and rapidly released after cellular activation. MMP-9 has been
* Corresponding Author: Silvia Mazzola, Department of Animal Pathology, Hygiene and Public Veterinary Health, Faculty of Veterinary Medicine, Via Celoria 10, Milan 20133, Italy.
Telephone: +39 02 50318130, Fax: +39 02 50318135. E-mail: [email protected]
Received: December 18, 2009. In revised form: October 19, 2010. Accepted: January 21, 2011.
220
PASTORE ET AL. Biol Res 44, 2011, 219-227
implicated in extracellular matrix remodelling and in cell
migration during acute inflammation, and, since it has been
found to be raised in patient with ALI, it has been investigated
in lung injury research protocols (Albaiceta et al., 2008).
MMP-2 is the most widely distributed MMP and is
constitutively expressed by various cell types, including
endothelial and epithelial cells. Under physiological
conditions, small amounts of MMP-2 are present in the lining
fluid of the lung, while MMP-9 is upregulated under many
pathological conditions.
Current studies on VILI are mainly based on rodents,
models that do not allow the proper measurements of
the changes in respiratory mechanics, pulmonary arterial
pressure, gas exchanges evolution and alveolo-capillary barrier
permeability, consequent to MV. In addition, rodents are often
ventilated with high tidal volumes for a very short period of
time, mainly after a “priming” pulmonary insult. Our large
animals model, based on healthy pigs, has the peculiarity
of being clinically relevant, since it is well know that swine
physiology is very close to that of the human race, and the
ventilator setting that we adopted is compatible with those
currently used in the clinical arena.
This study allowed us to evaluate continuously, during
mechanical stress, the pathophysiological changes in alveolocapillary barrier functionality and the most important cardio
respiratory parameters that are an irreplaceable presence in
intensive care units. Moreover, in the ex vivo part of the study,
the gelatinase zymography and the histological analysis
performed gave us the opportunity to compare and eventually
confirm the “bedside data”, obtained in the four hours of the in
vivo part of the study.
METHODS
Animals
The study was performed using 18 Large White pigs (Sus
domesticus) of either sex (Istituto Zooprofilattico della Lombardia
e dell’Emilia, Brescia, Italy), weighing 22.07 ± 2.51 kg (mean
± SD), fed with a standard diet with free access to water, and
deprived of food for 12 h before experimentation. Animal care
and treatment were conducted in accordance with institutional
guidelines in compliance with national (D.L. n.116 G.U., suppl.40,
18/02/1992; Circolare n.8, G.U., 14/07/1994) and international
(EEC Council Directive 86/609, OJL358-1, December 1987; Guide
for the Care and Use of Laboratory Animals, U.S., National
Research Council, 1996) laws and policies.
ventilator (Siemens-Elema, Sweden) for 240 min. The third
group (n = 6) was used to test the animal response to the
experimental procedures and studied for the same period
in spontaneous breathing (SB). Ventilator settings consisted
of a fixed tidal volume of 8 ml/kg or 20 ml/kg, which was
started immediately after intubation. The ratio of inspiratory
to total breathing cycle duration was 0.33 ± 0.01. A positive
end-expiratory pressure (PEEP) of 4 cmH 2O was selected
for the two mechanically ventilated groups. To reduce
the effects of the compliance of the system connecting the
animal to the ventilator on the mechanics measurements,
a fixed-length standard low-compliance tube was used (2
cm internal diameter, 60 cm long) and the humidifier was
omitted from the inspiratory line. The equipment dead space
was 29.5 ml. The tracheal cannula was connected to a Fleisch
pneumotachograph no.2 (Fleisch, Lausanne, Switzerland)
to record the respiratory airflow and, by integration, the
tidal volume. The pressure drop across the two ports of the
pneumotachograph was measured with a differential pressure
transducer (Statham PM 15, 10846). The static compliance
of the respiratory system (Crs) was obtained as described
previously (Clement et al., 1998). Polyethylene catheters were
inserted into the right femoral artery to monitor the systemic
arterial pressure and into the right femoral vein for drug
and fluid (normal saline) administration. A fluid strategy to
adequately compensate fluid loss and to keep the animals
haemodynamically stable were adopted.
A balloon-tipped catheter (Pediatric Swan-Ganz 5F) was
introduced into the pulmonary artery to measure pulmonary
arterial pressure. Systemic and pulmonary arterial pressures
were recorded by connecting the catheters to a fluid-filled
capacitance manometer (4-422 Bell and Howell). All signals
were calibrate independently and recorded simultaneously on
a six-channel pen recorder (Nec San-ei Instruments Polygraph
mod. 8K40, Ltd).
PiCCO catheters (PiCCO device, Pulsion Medical System,
Munich, Germany) were inserted into the left jugular vein
and into the left femoral artery for extravascular lung water
(EVLW), extravascular lung water index (EVLWi), pulmonary
blood volume (PBV) and cardiac index (CI) evaluation.
All the hemodynamic and respiratory parameters were
continuously monitored and registered at baseline and every
30 min until the end of the experiment.
At the end of the experimental time, all the animals
were sacrificed with a thiopental overdose, and lung, liver
and kidney tissue samples were harvested and fixed in 10%
formalin or immediately frozen in liquid nitrogen and keep at
-80°C until use.
Experimental protocol and procedures
Hemogasanalysis
Pigs were sedated with medetomidine (0.03 ml/kg i.m., Pfizer
Italy s.r.l.) and tiletamine-zolazepam (4 mg/kg i.m., Virbac
S.r.l., Italy), and anesthetised with 15 mg/kg of thiopental
sodium (Farmitalia Carlo Erba, Milan, Italy) injected into the
auricular vein. A steady depth of anesthesia was maintained
during the experimental protocol by continuous infusion of
dilute solution of thiopental sodium (9 mg/kg/h). Animals
were tracheostomized, intubated, and randomly divided into
three groups.
The first group (n = 6; tidal volume of 8 ml/kg - VT8)
and the second group (n = 6; tidal volume of 20 ml/kg V T 20) were mechanically ventilated using a 900C Servo
Arterial blood samples were collected in heparin (Parke-Davis,
Milan, Italy) every 30 min and hemogasanalysis (PaCO2 and
PaO2), pH and hematocrit were immediately evaluated (IL
1640, Instrumentation Laboratory System).
Bronchoalveolar lavage fluid analysis
Bronchoalveolar lavage fluid (BALF) was performed after
surgical procedure and at the end of the experiment, with
saline (30 ml heated to 37°C) injected and re-aspirate by
a polyethylene catheter inserted into the tracheal cannula
PASTORE ET AL. Biol Res 44, 2011, 219-227
and advanced into a segmental bronchus. BAL fluid was
centrifuged (1200 g for 10 min at 4°C) and the recovered
supernatant was frozen and stored at -20°C until further
processing. The quantification of MMP-2 and MMP-9 in BALF
was done by using the ELISA kit Matrix Metalloproteinase-2
and Matrix Metalloproteinase-9 Biotrack Activity Assay System
(Amersham Biosciences, Little Chalfont, UK) following the
manufacturer’s instruction. To determine total MMPs activity
(i.e., pro- plus active MMPs), samples were treated with
p-aminophenylmercuric acetate (APMA) and then tested with
the ELISA kit reported above.
Zymography
Frozen lung, liver and kidney tissue samples were used
to detect MMP-2 and MMP-9 activities by zymography, as
previously described (Vigetti et al., 2006). Briefly, tissues were
homogenized in 10 mM Tris-HCl, 150 mM NaCl, 20 mM EDTA,
pH 7.5 and the protein content was assessed by the Bradford
method. The same amount in protein of each extract (5 μg)
was loaded on a SDS polyacrylamide gels containing 1 mg/
ml gelatine and the samples were run at 150 V for 1 hour in
a minigel apparatus. The samples were loaded in the gels
without heat denaturation and reducing agents. After the run,
the gels were washed at room temperature for 2 h in 2.5%
Triton X-100 and incubated overnight at 37°C in 10 mM CaCl2,
150 mM NaCl, and 50 mM Tris-HCl, pH 7.5 buffer. The gel was
stained in 2% (v/v) Coomassie Blue G-250 in fixing solution
and photographed on a light box after appropriate destaining.
Proteolysis was detected as white bands in a dark blue field
and evaluated using an imaging densitometer (model GS700,
BioRad Lboratories, Hercoles, CA) and the band density was
measured by ImageJ software (National Institutes of Health,
Bethesda, MD).
Histological Analysis
Lung tissue samples fixed in 10% buffered formalin were used
for histological analysis. Lung sections (4mm) were stained
with hematoxylin-eosin and analysed by a pathologist who
was blinded to group identity. To identify VILI a quantitative
scale scoring alveolar emphysema, interstitial emphysema,
atelectasia and inflammation response (scored from 0 to 4 each)
was used according to the following scheme: 0 – no lesions,
1 – mild, focal lesions, 2 – mild, diffuse lesions, 3 – moderate
lesions, 4 – severe lesions. The presence of bronchospasm was
also evaluated and scored as: 0 – no lesions, F – focal, W –
widespread.
Statistical Analysis
Data are presented as means ± SD. The statistical significance
of difference between or within the groups for all parameters
was evaluated by ANOVA for repeated measures. Multiple
comparisons were performed using a post hoc Tukey test
(SPSS Version 15.0, Inc., Chicago, IL, USA). Differences are
considered significant at p<0.05.
RESULTS
In figure 1 is reported the mean pulmonary arterial blood
pressure in all experimental groups. Animals of the SB group
221
showed a significant increase of MPAP between 120 and 180
min both in comparison with the others two groups and with
time 0 min.
In figure 2 are described the changes in EVLWi (fig. 2a)
and in the EVLW/PBV ratio (fig. 2b). In the SB group, EVLWi,
which represents a precise but non-specific index of presence
of interstitial fluid in the lung, was significantly increased after
240 min, evidencing edema formation. (fig. 2a). This parameter
at 240 min was significantly higher in SB group than in VT8
and VT20 groups. The EVLW/PBV ratio (fig. 2b) is an accurate
index of pulmonary capillary district permeability. At 240 min,
this value was significantly higher in the VT20 group than the 0
time and than in the other two groups.
In figure 3, the changes in the respiratory system
compliance (Crs) are shown. Comparing time 0 to 240 min,
the values were not significantly different in all groups. The
analysis among groups showed that at time 0 Crs value was
significantly higher in the VT20 group than in the other two
groups, and at 240 min Crs value was significantly lower in SB
group than in the VT8 and VT20 groups.
The tidal volume in spontaneously breathing group
reached a value of 6.3 ± 1.8 ml/kg at time 0 min and of 7.2 ±
1.7 ml/kg at time 240 min. The difference between time 0 min
and time 240 min was statistically significant (p<0.05) (data not
reported).
Figure 4 evidences the changes in PaO2 (fig. 4a) and in
PaCO2 (fig. 4b). As expected, in animals ventilated with high
volumes, oxygenation levels were higher than in the other
two groups. This difference becomes significant at 30 min and
between 90 and 240 min, reaching PaO2 values of about 120
mmHg. In all the observation times PaCO2 was significantly
higher in the VT8 group than in the SB and VT20 groups,
reaching severe hypercapnic levels. In the SB group PaCO2
values remained within the physiological range and the
VT20 group was hypocapnic. As a consequence, at the end of
the experiments, pH levels reached a value of 7.4 ± 0.009 in
spontaneously breathing pigs, of 7.20 ± 0.15 in VT8 group and
of 7.6 ± 0.03 in VT20 group. The levels in VT20 group were
significantly higher than in the other two groups (p<0.001).
Figure 5 shows the changes in cardiac output (CO). The
SB group showed significantly higher values than the VT8 and
VT20 groups, both at time 0 min and at time 240 min.
The mean systemic arterial blood pressure and the heart
rate remained stable in all animals for the duration of the
experiment, with no relevant difference among the groups
(data not reported).
MMP-2 and MMP-9 levels were analyzed as zymogen
and as active form in lung, kidney and liver autoptic samples
by zymography. In the lung, both forms of MMP-2 (fig. 6a)
were detected in all the animals, and the level of activated
MMP-2 was significantly higher in all groups than the inactive
form. Therefore, analyzing the differences among groups, the
activated MMP-2 was significantly higher in VT20 group than
in the other two groups. In the kidney, the inactive form of
MMP-2 (fig. 6b) was significantly higher in the spontaneously
breathing group than in the VT8 and VT20 groups, and it was
significantly higher than the MMP-2 in the SB and VT8 groups.
The MMP-2 activation was specular: indeed, the active form
was mainly expressed in the VT20 group, in which it reached
significantly higher levels than in the other two groups and
than the inactivated form. In the liver, the proMMP-2 (fig. 6c)
was synthesized in all the animals, but it was significantly
222
PASTORE ET AL. Biol Res 44, 2011, 219-227
EVLWi
25
*#
20
15
ml
lower in the V T 20 group than in the other two groups.
Similarly, the MMP-2 activated form was significantly lower in
the VT20 group than the SB and VT8 groups. In all groups, the
proMMP-2 was significantly higher than the activated form.
The active form of MMP-9 was never observed in all
groups and in all samples. In the lung (fig. 7a), the inactive
form of MMP-9 was present in all the animals, but in the VT20
group the expression was significantly higher than in the other
two groups. In the kidney (fig. 7b) and in the liver (fig. 7c), the
inactive form of the MMP-9 was synthesized in all subjects
without any significant difference among groups.
Data of gelatinases in BALF, evaluated with ELISA analysis,
are presented in Figure 8 (MMP-2 8a; MMP-9 8b). At time
0 min, MMP-2 was detectable, in both forms in all groups
without significant differences. At the end of the experiment,
MMP-2 was synthesized and activated in all the subjects, but
in VT8, the MMP-2 activated form was significantly higher
than in the other two groups. In the SB and VT20 groups, the
proMMP-2 was significantly higher at time 240 min than at
time 0 min (fig.8a). At time 0 min, MMP-9 was detectable
in all groups in both forms without significant differences,
while at 240 min activated MMP-9 in the VT8 group reached
significantly higher values in comparison to the SB and VT20
groups. (fig. 8b).
The results of histological analysis are briefly summarized
in table 1. In the SB group samples, modest alterations
related to acute alveolar emphysema, interstitial emphysema,
atelectasia and inflammation (score 1) were noted. In the
specimens of the VT8 group, minor acute alveolar emphysema
injuries, interstitial emphysema and atelectasia (score 1)
were present, associated with focal bronchoconstriction. In
the sections analyzed, inflammation (moderate, score 2),
with granulocyte marginalization and diapedesis, alveolar
macrophages desquamation and moderate fibrin deposition
were found. In VT20 subjects, the acute alveolar emphysema
lesions were diffuse, with widespread alveolar septa breaking
(score 4). Moderate interstitial emphysema (score 1) was
pointed out. Bronchospasm (score W) was evident in numerous
sections of bronchi and bronchioles, atelectasia (score 2) and
inflammatory processes (score 3) were also observed, with
haemorrhagic diathesis and neutrophilic diapedesis.
10
5
0
SB
VT8
EVLW/PBV
** ##
60
50
40
30
20
10
0
SB
VT8
Crs
*#
*#
40
*#
35
ml/cmH2O
35
mmHg
VT20
Figure 2. Extravascular lung water index (EVLWi) and extravascular
lung water/pulmonary blood volume (EVLW/PBV) ratio. EVLWi (a)
and EVLW/PBV (b) changes in the three experimental groups (n =
6). White bars: time 0 min; black bars: time 240 min. The values
are expressed as means ± SD. a) * p<0.05 vs time 0 min in SB
group; # p>0.05 vs V T8 and V T20 groups at time 240 min. b) **
p<0.001 vs time 0 min in V T20 group; ## p<0.001 vs SB and V T8
groups at time 240 min.
MPAP
45
40
VT20
30
25
20
15
*
30
#
25
20
15
10
10
VT8
5
VT20
SB
5
0
0
0
30
60
90
120
150
180
210
240
SB
VT8
VT20
time (min)
Figure 1. Pulmonary arterial blood pressure (MPAP). Time course
of MPAP changes in all experimental groups (n = 6). The values
are expressed as means ± SD.* p<0.05 vs V T8 and V T20 groups; #
p<0.05 vs time 0 min.
Figure 3. Respiratory system compliance (Crs). Crs changes in the
three experimental groups (n = 6). White bars: time 0 min; black
bars: time 240 min. The values are expressed as means ± SD. *
p<0.05 vs SB and V T20 groups at time 0 min; # p<0.05 vs V T8 and
V T20 at time 240 min.
223
PASTORE ET AL. Biol Res 44, 2011, 219-227
MMP-2 LUNG
160
140
mmHg
*
*
120
*
*
*
*
*
100
80
60
40
VT8
20
VT20
SB
0
0
30
60
90
120
150
180
210
240
Gel densitometry (arbitrary units)
PaO2
3500
2000
1500
1000
500
0
**
**
**
**
**
VT20
**
**
SB
**
**
60
40
20
0
0
30
60
90
120
150
180
210
240
** †
3500
3000
2500
2000
1500
* #
#
1000
500
0
SB
l/min
CO
#
VT8
VT20
Figure 5. Cardiac output (CO). CO changes in the three
experimental groups (n = 6). White bars: time 0 min; black bars:
time 240 min. The values are expressed as means ± SD. * p<0.05
vs V T8 and V T20 groups at time 0 min; # p<0.05 vs V T8 and V T20
groups at time 240 min.
VT20
4000
3500
3000
#
#
2500
#†
2000
1500
1000
*
500
0
SB
SB
VT8
MMP-2 LIVER
Gel densitometry (arbitrary units)
Figure 4. PaO2 and PaCO2. Time course of PaO2 (a) and PaCO2
(b) changes in all experimental groups (n = 6). The values are
expressed as means ± SD. a) * p<0.05 vs SB and V T8 groups. b) **
p<0.001 vs SB and V T20 groups.
*
VT20
4000
time (min)
4,5
4,0
3,5
3,0
2,5
2,0
1,5
1,0
0,5
0,0
VT8
MMP-2 KIDNEY
Gel densitometry (arbitrary units)
mmHg
80
SB
VT8
120
**
2500
PaCO2
140
100
**
3000
time (min)
160
** †
4000
VT8
VT20
Figure 6. Pro and activated MMP-2 in lung, kidney and liver
samples. MMP-2 changes in the lung (a), in the kidney (b) and
in the liver (c) samples in the three experimental groups (n =
6). White bars: proMMP-2; black bars: activated MMP-2. a) †
p<0.05 vs activated MMP-2 in SB and V T8 groups; **p<0.001 vs
proMMP-2. b) * p<0.05 vs proMMP-2 in V T8 and V T20 groups;
** p<0.001 vs activated MMP-2 in SB and V T8 groups; † p<0.05
vs proMMP-2; # p<0.05 vs activated MMP-2. c) † p<0.05 vs
proMMP-2 in SB and V T8 groups; * p<0.05 vs MMP-2 in SB and
V T8 groups; # p<0.05 vs activated MMP-2.
224
PASTORE ET AL. Biol Res 44, 2011, 219-227
MMP-2 BALF
8000
*
7000
6000
ng/ml
Gel denistometry (arbitrary units)
MMP-9 LUNG
9000
5000
4000
3000
2000
1000
0
SB
VT8
VT8
9000
8000
7000
6000
5000
4000
3000
2000
1000
10
9
8
7
6
5
4
3
2
1
0
*
0
SB
SB
VT8
VT20
MMP-9 BALF
ng/ml
Gel densitometry (arbitrary units)
#
*
*
SB
VT20
MMP-9 KIDNEY
VT8
VT20
VT20
Figure 8. Pro and activated MMP-2 and pro and activated MMP9 in bronchoalveolar lavage fluid (BALF). MMP-2 (a) and MMP-9
(b) changes in BALF evaluated in all experimental groups (n =
6) at time 0 min and at time 240min. a) white bars: proMMP-2
time 0 min; grey bands: activated MMP-2 time 0 min; dark grey
bands: proMMP-2 time 240 min; black bars: activated MMP-2
time 240 min. b) white bars: proMMP-9 time 0 min; grey bands:
activated MMP-9 time 0 min; dark grey bands: proMMP-9 time
240 min; black bars: activated MMP-9 time 240 min. The values
are expressed as means ± SD. a) *p<0.05 vs proMMP-2 at time
0 min in SB and V T20 groups; # p<0.05 vs activated MMP-2 in SB
and V T20 groups at time 240 min; b) *p<0.05 vs activated MMP-9
in SB and V T20 groups at time 240 min.
MMP-9 LIVER
Gel densitometry (arbitrary units)
10
9
8
7
6
5
4
3
2
1
0
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
SB
VT8
VT20
Figure 7. Pro and activated MMP-9 in lung, kidney and liver
samples. MMP-9 changes in the lung (a), in the kidney (b) and
in the liver (c) samples in the three experimental groups (n =
6). White bars: proMMP-9; activated MMP-9: not detectable. The
values are expressed as means ± SD. a) * p<0.05 vs proMMP-9 in
SB and V T8 groups.
TABLE I
Type and grading of lesions in histological lung samples in
all experimental groups
GROUP
AAE
IE
Atl
Brsp
Infl
SB
1
1
1
0
1
VT 8
1
1
1
F
2
VT 20
4
1
2
W
3
AAE: acute alveolar emphysema; IE: interstitial emphysema; Atl: atelectasia;
Brsp: bronchospasm; Infl: inflammation.
Score - 0: no lesions; 1: light and focal lesions; 2: light and widespread lesions;
3: moderate lesions; 4: severe lesions; F: focal; W: widespread.
PASTORE ET AL. Biol Res 44, 2011, 219-227
DISCUSSION
The challenge of this study was to evaluate the onset of
ventilator induced lung injury in a clinically relevant,
validated and well-studied model, which closely resembles
human physiology and the ventilator setting currently used
in the clinical arena. Mechanical ventilation constitutes an
indispensable tool for basic life support in the intensive care
units and for major surgical procedures, and is undoubtedly
essential for patients with acute lung injury/acute respiratory
distress syndrome (ALI/ARDS). Despite the progress in
medicine and biology, the underlying molecular mechanisms
of ventilator induced lung injury (VILI) have not been fully
elucidated, and the death rate of patients with ALI/ARDS
remains quite high. Moreover, current studies on VILI are
mainly based on rodent models that do not allow an accurate
measurement of all the data regarding the changes in
respiratory mechanics, in pulmonary arterial pressure and the
evolution of gas exchanges and the permeability of alveolocapillary barrier. In recent years, it has become clear that
mechanical ventilation can be injurious: repeated application of
transalveolar pressures, that exceed those corresponding to the
inflation capacity, causes tissue stresses leading to ventilator
induced lung injury, with similar histological appearance
to ALI/ARDS. These histological disorders are related to
injury of the alveolar epithelium, basement membrane and
microvascular endothelium and are characterized by highpermeability pulmonary edema (Nakos et al., 2006).
Our study demonstrates that both animals undergoing
mechanical ventilation with high volumes and non-assisted
breathing animals develop a massive lung edema, as revealed
by extra-vascular lung water values. It is a daily dilemma
for an intensivist to determine the mechanisms responsible
for the EVLWi increase; in fact, this can be caused by an
extravasation of fluid toward the interstitium, due to increased
hydrostatic pressure into the pulmonary vascular bed, or by
an increased permeability of the lung capillary membrane
due to its damage, as during ALI or ARDS. Discriminating
between these two mechanisms is an important issue, since
the appropriate therapy differs (Hickling and Joyce, 1995).
EVLWi is the only parameter assessable at the bedside, through
which it is possible to evaluate the alveolo-capillary integrity,
while the EVLW/PBV ratio is a rigorous index of permeability
of pulmonary capillary district. Our results show that in the
animals ventilated with high tidal volumes, the EVLW/PBV
ratio reaches pathological levels, while in the SB group it
remained almost unchanged. As expected, the alveolar overdistension induced cellular ultrastructural abnormalities only
in animals subjected to high VT and not in those where lung
distension was limited, as in our VT8 group, or absent, as in the
SB group.
Our data show irrefutably that the severe edema formation
noticed in spontaneously breathing animals was clearly related
to the increase in pulmonary arterial pressure observed, which
induced the extravasation of fluid into lung parenchyma. This
may be related, at least in part, to breathing difficulties induced
by the non-physiological supine position in which the animals
were placed during the surgical and the experimental phases,
and to the inhibitory effect on respiratory function induced by
thiopental sodium used for anesthesia.
The compliance of the respiratory system typically
decreases in correlation with the extravasation of fluid
225
into lung parenchyma. In our data, unexpectedly, none of
the groups of animals showed any statistically signifi cant
change during the experimental time. The Crs values were
significantly different only when comparing time 0’ or time
240’ among groups. Pigs ventilated with high volume showed,
at the beginning of the experimental time, an increase of Crs
values, probably due to the compressing action exerted by the
servoventilator, which, in the very first part of the experiment,
has been shown to benefit also in terms of oxygenations, since
PaO2 was significantly higher than in the other groups and
PaCO2 significantly lower than in the VT8 group and close
to that of SB animals. At the end of the experimental time,
spontaneously breathing animals showed Crs values that were
significantly lower than in the other two groups, reflecting
the liquid extravasations induced by higher MPAP levels,
confirming EWLVi data. Despite the increase of the pulmonary
capillary district permeability, at 240’ VT20 animals did not
show any significant change compared to time 0 min. This
finding remains without a plausible explanation, especially
considering that the histological analysis highlighted the worse
lung injury status in the animals ventilated with high tidal
volumes, that presented widespread and severe emphysema,
inflammatory response, bronchoconstriction and atelectasia.
As expected, despite the alveolo-capillary injury, the
oxygenation levels were significantly higher in the VT20 group.
Oxygenation of the spontaneously breathing animals was
impacted from the low tidal volumes and from the increase
in MPAP, and thus resulted lower than the physiological
range. It is well known that the organism is more sensitive to
an increase of PaCO2 than to an increase of PaO2, indeed, in
the SB group this condition was countered by an increase in
pulmonary ventilation (data not reported) and, consequently,
the values were into the physiological range. Contrarily,
animals in the V T 8 group, breathing with mechanical
ventilation, could not modify respiratory frequency. Indeed,
the ventilation strategy with VT8 leads to a moderate and
not significant decrease of PaO2 concentration, while PaCO2
reached a severe and significant status of hypercapnia.
However, hypercapnia is considered by some authors to play
a protective role. Supporting this thesis, the infl ammatory
status developed in the VT8 group was moderate, as confirmed
by histological analysis, probably through an attenuation of
activation of nuclear factor-kappaB (NF-kB), a key regulator of
the expression of multiple genes involved in the inflammatory
response (Amato et al., 1998).
The protective effects of so called ‘therapeutic hypercapnia’
remain experimental at present, but promising laboratory
studies suggest potential roles for eventual selective
application at the bedside (Kavanagh and Laffey, 2006;
Chonghaile et al., 2005). This ‘permissive hypercapnia’ is
progressively catching on in critical care of adult, pediatric
and neonatal patients requiring mechanical ventilation.
Hickling and Joyce (1995) have demonstrated that hypercapnia
improves cellular oxygen supply, but directly reduces the
contractility of myocardium and vascular smooth muscle. Our
results evidence that all animals presented a worsening of
cardiac efficiency, and the impressive levels of PaCO2 achieved
by VT8 group leads to a significant deterioration of cardiac
function, confirming Hickling and Joyce findings. The stability
in mean arterial blood pressure and heart rate, noted in all
animals with no difference among the groups, was facilitated
by fluid (normal saline) administration.
226
PASTORE ET AL. Biol Res 44, 2011, 219-227
Since ventilator induced lung injury is the result of a
complex interplay among various mechanical forces acting
on lung structures, including the extracellular matrix, we
have also focused our attention on the gelatinases (Pelosi and
Rocco, 2008). The expression of MMPs in the lung is a highly
regulated process, and understanding its regulation could, in
part, shed light into their biological function in physiological
developmental processes and in many pathological conditions,
including VILI (Greenlee et al., 2007).
In the lung sections examined, the proMMP-2 and his
active form were expressed in all the animals, significantly in
VT20 group, and the proportion between the two forms was
largely in favor of the active one. Since MMP-2 is constitutively
expressed, seems clear that the stretching stimulus by high
VT was sufficient to induce its expression and activation, as
already reported in literature (Haseneen et al., 2003; Greenlee
et al., 2007).
All the lung samples presented high level of expression
of the proMMP-9, which was significantly predominant in
the VT20 group. None of the lung specimens revealed the
presence of MMP-9 active form, underlining the fact that the
stimulus was not suitable, or maybe not of sufficient duration,
to its activation. On the contrary, the ELISA test on BAL fluid
revealed the presence of MMP-9 active form, that surprisingly
was extremely high in the VT8 group.
One of the possible mechanisms leading to the MMP-9 nonactivation in our lung tissue may be related to the mechanism
of synthesis, release and activation of this gelatinase. The most
important source of MMP-9 is represented by neutrophils and
macrophages, which are recruited from the circulation. MMP9 is stored in latent form within gelatinases cellular granules,
before being released into the extracellular space, following
cell activation, and it needs, to attain full catalytic activity, a
conformational change and auto-cleavage (Owen et al., 2003).
At present, the in vivo physiological activator remains unclear,
but in vitro studies indicated that other proteinases and
reactive oxygen species can induce MMP-9 (Chow et al., 2007).
The mechanism that underlies the over-expression in BALF of
VT8 group remains unclear.
The same high values were evidenced by MMP-2 ELISA
analysis: in BALF of V T 8 animals, at time 240 min, an
impressive upregulation of activated MMP-2 was present,
significantly higher than in BALF of the SB and VT20 groups.
Unlike proMMP-9, the MMP-2 zymogen was expressed in all
the animals at the end of the experimental time and reached
significant higher values than time 0 min in the SB and VT8
groups. This finding may be related to the fact that MMP-2 is
a constitutive gelatinase and, so, each type of stimulus is able
to upregulate it; although, again, the rationale underlying the
increased expression of activated MMP-2, and also of MMP-9,
in the VT8 group remains unclear.
In order to characterize the systemic inflammatory
response due to mechanical ventilation, we analyzed the
gelatinases expression and activities in kidney and liver,
since it has been described that most patients suffer from
multisystem organ failure (ARDS network, 2000). In the
kidney, the mechanical stress by high VT induced the almost
complete activation of MMP-2, while, in the other two groups,
the stimulus evoked the expression of the inactive form, but
was not sufficient to determine its activation, except for a
minimum part in VT8 animals. It is well known that mechanical
ventilation may induce acute renal damage by three proposed
mechanisms: through effects on arterial blood gases, through
effects on systemic and renal blood flow and by triggering a
pulmonary inflammatory reaction, with systemic release of
vasoactive factors (Kuiper et al., 2005).
As with lung and liver tissues, the kidney MMP-9 was
expressed only in pro-active form, underlining the fact that,
once again, the stimulus was not suitable, or maybe not
of sufficient duration, to its activation. Liver MMP-2 was
expressed in all the animals as zymogen and as active form,
even if, surprisingly, in animals treated with high V T the
expression and the activation was significantly lower than in
the other groups.
It is clear that mechanical ventilation strategies profoundly
affects lung parenchyma integrity and functionality, and the
choice of a ventilation strategy that avoids these damages,
ensuring at the same time an appropriate exchange of gases, is
firmly based on experimental literature and clinical experience.
Thanks to the use of a model that closely resembles human
physiology, we have observed the trend of the main parameters
evaluated in intensive care units, parameters “lifesaving” for
many patients who are forced to use mechanical ventilation.
Although the use of low tidal volumes may reduce the onset
of lung injury, in any case MV is harmful and further studies
will be desirable in order to shed light on the mechanisms of
VILI, to some extent still obscure. Further investigation will be
necessary to better understand the underlying mechanisms of
gelatinases synthesis, release and activation.
ACKNOWLEDGMENTS
This work was supported by MIUR (PRIN 2005) grant and
FIRST 2006. The authors are grateful to Mr. Marco Costanzi for
his valuable technical assistance.
REFERENCES
ALBAICETA GM, GUTIÉRREZ-FERNÁNDEZ A, PARRA D, ASTUDILLO
A, GARCÍA-PRIETO E, TABOADA F, FUEYO A (2008) Lack of matrix
metalloproteinase-9 worsens ventilator-induced lung injury. Am J
Physiol Lung Cell Mol Physiol 294: L535-43.
AMATO MB, BARBAS CS, MEDEIROS DM et al. (1998) Effect of a
protective-ventilation strategy on mortality in acute respiratory distress
syndrome. N Eng J Med 338: 195-199.
ARDS - THE ACUTE RESPIRATORY DISTRESS SYNDROME - NETWORK
(2000) Ventilation with lower tidal volumes as compared with
traditional tidal volumes for acute lung injury and the acute respiratory
distress syndrome. N Engl J Med 342: 1301-1308.
CLEMENT MG, MARZANI M, DIMORI M, ALBERTINI M (1998) Prostanids
counterbalance the bronchoconstrictor activity of endothelin-1 in pigs.
Prost Leuk and Ess Fatty Acids 58:177-183.
CHONGHAILE M, HIGGINS B, LAFFEY JG (2005) Permissive
hypercapnia: role in protecting lung ventilator strategies. Curr Opin
Crit Care 11:56-62.
CHOW AK, CENA J, SCHULZ R (2007) Acute actions and novel targets of
matrix metalloproteinases in the heart and vasculature. Br J Pharmacol
152: 189-205.
DREYFUSS D, SAUMON G (1998) Ventilator-induced lung injury: lessons
from experimental studies. Am J Respir Crit Care Med 157: 294-323.
DREYFUSS D, BASSET G, SOLER P, SAUMON G (1985) Intermittent
positive-pressure hyperventilation with high inflation pressures
produces pulmonary microvascular injury in rats. Am Rev Respir Dis
132:880-884
GREENLEE KJ,WERB Z, KHERADMAND F (2007) Matrix
metalloproteinases in lung: multiple, multifarious and multifaceted.
Physiol Rev 87: 69-98.
HASENEEN NA, VADAY GG, ZUCKER S, FODA HD (2003) Mechanical
stretch induces MMP-2 release and activation in lung endothelium: role
of EMMPRIN. Am J Physiol Lung Cell Mol Physiol 284: L541-L547.
PASTORE ET AL. Biol Res 44, 2011, 219-227
HICKLING KG, JOYCE C (1995) Permissive hypercapnia in ARDS and its
effects on tissue oxygenation. Acta Anaesthesiol Scand 107: 201-208.
KAVANAGH KG, LAFFEY JG (2006) Hypercapnia: permissive and
therapeutic. Minerva Anaestesiol 72: 201-208.
KUIPER JW, GROENEVELD ABJ, SLUTSKY AS, PLOTZ FB (2005) Mechanical
ventilation and acute renal failure. Crit Care Med 33: 1408-1415.
NAKOS G, BATISTATOU A, GALIATSOU E, KOSTANTI E, KOULOURAS
V, KANAVAROS P, DOULIS A, KITSAKOS A, KARACHALIOU A,
LEKKA M, BAI M (2006) Lung and ‘end organ’ injury due to mechanical
ventilation in animals: comparison between the prone and supine
position. Crit Care 10: R38.
OWEN CA, HU Z, BARRICK B, SHAPIRO SD (2003) Inducible expression of
tissue inhibitor of metalloproteinases-resistant matrix metalloproteinase-9
on the cell surface of neutrophils. Am J Respir Cell Mol Biol 29: 283-294.
PELOSI P, ROCCO PR (2008) Effects of mechanical ventilation on the
extracellular matrix. Intensive Care Med 34:631-639.
PINGLETON SK (1988) Complications of acute respiratory failure. Am Rev
Resp Dis 137: 1463-1493.
227
RICARD JD, DREYFUSS D, SAUMON G (2003) Ventilator-induced lung
injury. Eur Resp J 22: 2s-9s.
TOMASHEFSKI JF JR (1990) Pulmonary pathology of the adult respiratory
distress syndrome. Clin Chest Med 11: 593-619.
VANEKER M, HALBERTSMA FJ, VANEGMOND J, NETEA MG, DIJKMAN
HB, SNIJDELAAR DG, JOOSTEN LA, VANDERHOEVEN JG,
SCHEFFER GJ (2007) Mechanical ventilation in healthy mice induces
reversible pulmonary and systemic cytokine elevation with preserved
alveolar integrity. Anesthesiology 107: 419-426.
VIGETTI D, MORETTO P, VIOLA M, GENASETTI A, RIZZI M, KAROUSOU
E, PALLOTTI F, DE LUCA G, PASSI A (2006) Matrix metalloproteinase 2
and tissue inhibitors of metalloproteinases regulate human aortic smooth
muscle cell migration during in vitro aging. Faseb J 20: 1118-1130.
WIRTZ HR, DOBBS LG (2000) The effects of mechanical forces on lung
functions. Respir.Physiol 119:1-7
WOESSNER JF JR (1991) Matrix metalloproteinases and their inhibitor in
connective tissue remodelling FASEB J 5: 2145-2154.
Biol Res 44: 229-234, 2011
Testis-mediated gene transfer in mice: comparison of transfection
reagents regarding transgene transmission and testicular damage
Marta G. Amaral, Vinicius F. Campos, Fabiana K. Seixas, Paulo V. Cavalcanti, Lisiane P. R. Selau,
João C. Deschamps, Tiago Collares*
Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade Federal de Pelotas, Campus Universitário, CEP 96010-900 - Pelotas, RS, Brazil.
ABSTRACT
Testis-mediated gene transfer (TMGT) has been used as in vivo gene transfer technology to introduce foreign DNA directly into testes,
allowing mass gene transfer to offspring via mating. In this study, we used plasmid DNA (pEGFP-N1) mixed with dimethylsulfoxide
(DMSO), N,N-dimethylacetamide (DMA) or liposome (Lipofectin) in an attempt to improve TMGT. Males receiving consecutive DNA
complex injections were mated to normal females to obtain F0 progeny. In vivo evaluation of EGFP expression, RT-PCR and PCR were used
to detect the expression and the presence of exogenous DNA in the progeny. We also evaluated possible testicular damage by histological
procedures. PCR and RT-PCR analyses revealed that liposome and DMSO increased the rate of TMGT. Histological analyses demonstrated
that repeated (4 times) injections of DNA complexes can affect spermatogenesis. DMSO was the most deleterious among the reagents
tested. In this study, we detected the presence of transgene in the progeny, and its expression in blood cells. Consecutive injections of
DNA complexes were associated with impaired spermatogenesis, suggesting requirement of optimal conditions for DNA delivery through
TMGT.
Key-words: TMGT, DMA (N,N-dimethylacetamide), Liposome, mice, transgenesis, histological damage.
INTRODUCTION
The use of spermatozoa has been studied in recent years for gene
transfer in transgenic animal technology and several distinct
approaches have been used. The first report that exogenous
DNA could be introduced into sperm was made by Brackett et
al. (1971). Several studies in distinct species have reported the
generation of transgenic animals using spermatozoa as vectors
to carrier foreign DNA to the ova (Lu et al., 2002; Webster et
al., 2005; Shen et al, 2006; Hoelker et al., 2007, Collares et al.,
2010, Campos et al., 2011a, Campos et al., 2011b, Campos et al.,
2011c). One approach of sperm-mediated gene transfer (SMGT)
is the direct introduction of foreign DNA into testes, so-called
testis-mediated gene transfer (TMGT), which allows for natural
mating and mass gene transfer. This technique exempts the use
of other procedures such as in vitro fertilization (IVF) and embryo
transfer (ET). Sato et al. (2002) demonstrated this method by
way of direct, but surgical injection of DNA solution into testes
with subsequently “in vivo” electroporation to improve the
uptake of foreign DNA by epididymal epithelial cells. Shen et
al. (2006) demonstrated efficient generation of rabbits and mice
through TMGT using surgical injection in testes with a DMSO/
DNA complex to improve uptake of foreign DNA by sperm
cells. In addition, Dhup and Majumdar (2008) demonstrated
transgenesis via permanent integration of genes in repopulating
mice spermatogonial cells in vivo. Further advancement on
TMGT technique might offer an easy way to generate transgenic
animals or an important route for germ line therapy in humans,
since gene transfer into testicular somatic cells in order to rescue
failing spermatogenesis may one day become a reality (Coward,
2007).
On the other hand, intracellular cryoprotectants such as
DMSO can improve DNA uptake by sperm cells as previously
demonstrated in rabbits, mice and chicken (Li et al., 2006; Shen
et al., 2006, Collares et a., 2011). Therefore other intracellular
cryoprotectants such as N, N-dimetylacetamide (DMA) that
have been used recently in boar sperm cryopresenvation
(Bianchi et al., 2008) could also be used to increase the uptake
of exogenous DNA by spermatozoa as demonstrated for
chickens (Collares et al., 2011).
Here we demonstrate the efficient EGFP transgene
transmission to mice offspring by TMGT with a non-surgical
injection of DNA solution and without electroporation of
epididymis, reducing the injury to the male and laborious
handling. As transfectants we tested DNA complexes
containing DMSO (dimethylsulfoxide), liposomes (Lipofectin®
Transfection Reagent, Invitrogen®, USA) and for the first time,
to our knowledge, DMA (N,N-dimethylacetamide), to improve
the uptake of foreign DNA by sperm cells, substituting the
in vivo electroporation. In addition, we evaluated injuries
due to continuous injections of DNA complexes on testes by
histological procedures.
METHODS
Animals
Five groups of five male BALB/c mice, 3-6 months old, were
used. After treatments each male mated with two female
BALB/c. The animals were kept according to the guidelines of
the Ethics Committee in Animal Experimentation of UFPel.
* Corresponding author: Tiago Collares, Centro de Biotecnologia – Universidade Federal de Pelotas, Caixa Postal 354 • CEP 96010-900, Pelotas – RS / Brazil, Phone: +55 53 32757588,
[email protected]
Received: February 2, 2010. In revised form: December 2, 2010. Accepted: December 14, 2010.
230
AMARAL ET AL. Biol Res 44, 2011, 229-234
Transfection Solutions
Detection of EGFP expression
Twenty micrograms of circular eukaryotic expression vector
pEGFP-N1® (Clontech®, USA) complexed with three different
transfectants: DMSO 3%, DMA 3%, and Lipofectin 3%, all
diluted in phosphate-buffered saline (PBS), pH 7.2, were used.
As well, 20 μg of pEGFP diluted in PBS represents the fourth
group. The control group received only PBS. All treatments
received 0. 1% of trypan blue (Invitrogen®, USA).
After birth, in vivo EGFP fl uorescence was assessed using
GFsP-5 miner lamp and goggles (BLS ®, Hungary), which
is a goggle system containing a filter set to detect EGFP
fluorescence and a light to excite protein fluorescence
(excitation maximum = 488 nm; emission maximum = 507
nm). EGFP expression was also evaluated by RT-PCR. Blood
samples collected for PCR analysis were also used for RNA
extraction. Blood was frozen and stored in liquid nitrogen
until analysis. Total RNA extraction and cDNA synthesis was
as described previously (Campos et al., 2010). Briefly, RNA
samples were isolated using TRIzol® Reagent (Invitrogen™,
Carlsbad, USA) and samples were DNase-treated with a
DNA-free® kit (Ambion™, USA) following the manufacturer’s
protocol. First-strand cDNA synthesis was performed
with 200 ng of RNA using a High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems ™ , UK) according
to the manufacturer ’s protocol. RT-PCR reactions were
conducted using EGFP (5’ CACGTCATTTTCCTCCTGCAT
3’ and 5’ GCATAGCGGCTCGTAGAGGTA 3’ – product with
209 bp) and β-actin (5’ TCGCTGCGCTGGTCGTCG 3’ and 5’
GCCAGATCTTCTCCATGTCGTCCCA 3’ – product with 246
bp) primers. PCR conditions for both genes were: 35 cycles
of 94°C for 15 sec, 50 °C for EGFP and 60ºC for β-actin for
30 sec and 72 °C for 30 sec, with an additional initial 1 min
denaturation at 94°C and a 5 min final extension at 72°C. PCR
products were electrophoresed on a 1% agarose gel containing
0.5 μg ml-1 ethidium bromide.
Non-surgical testis injection
Before testis injection, animals were sedated with 2 mg/
kg of acepromazine (Vetnil ®, Brazil) intraperitoneally. The
testes were exposed in scrotal sack by a digital pressure in the
abdomen and were fixed with the tip of the fingers to avoid
retraction during the injection. Asepsis of the scrotal sack was
carried out with 70% ethanol. Briefly, 30 μl of each solution
described previously was slowly injected into each testis with
30- G needle (BD Biosciences®, USA) attached to 1-ml plastic
disposable syringe at a depth of 3-4 mm through the scrotal
sack. After injection the needle was removed very slowly
to avoid leakage of the injected solution. Both testes were
injected. Twenty-four hours after injection, each male mated
for one week with two BALB/c female without superovulation.
This procedure was repeated three times once a week, with the
same males but mated with new females.
pEGFP vector detection
Sixty days after birth, blood was collected for DNA
extraction with PureLink™ Genomic DNA Purifi cation Kit
(Invitrogen®, USA). To detect the presence of vector DNA,
polymerase chain reaction was performed using EGFP-specific
oligonucleotides (5’- CGGGACTTTCCAAAATGTCG -3’ and
5’-GAAGATGGTGCGCTCCTGGA -3’) to amplify a 500 bp
fragment. PCR reactions were conducted with the following
parameters: initial denaturation at 94 °C for 2 min followed by
30 cycles at 94 °C for 1min, 50 °C for 1 min and 72 °C for 1 min,
plus a final extension at 72 °C for 7 min. All PCR products were
sequenced in automatic DNA sequencer MegaBACE 1000 (GE
Healthcare, USA).
Histological damage analyses of injected testis
Seven days after the last injection, the males were sacrificed
and the testes were dissected, fixed in Bouin’s fixative for 24 h
at 4°C and then subjected to standard histological procedure.
Sections of 5-6 μm thickness from each testis were stained by
hematoxylin-eosin (HE). Three testis regions and three slides
per testis region were evaluated. To compare treatments,
testicular damages were ranked according to the scores
described in table I. A score was attributed to each slide.
Comparison among treatments was conducted using the mean
score from all slides of each treatment.
TABLE 1
Score description used for histological analysis
Score
Testicular damage description
0
Without histological damage
1
Testes with a small number of ST that show low GE
2
Testes with a small number of ST that show low GE
3
Testes with a high number of ST that show low EG and some without EG.
4
Testes with a predominance of ST that show low EG and some without EG and small area of fibrosis in the stroma
5
Testes in absence of GE in the ST and with largest area of fibrosis in the stroma and presence of lymphocytic inflammation.
ST – seminiferous tubules
GE – germ epithelium
231
AMARAL ET AL. Biol Res 44, 2011, 229-234
showed the presence of pEGFP-N1 vector in the PCR analysis.
In vivo EGFP fluorescence was not detected in any mice born,
however, RT-PCR analysis of PCR positive animals showed
EGFP expression in blood samples in several animals from
all treated groups. The lipofectin group had a higher ratio
of animals expressing EGFP in comparison to other groups.
(Figure 1 and Table II).
Data analyses
Data from PCR, RT-PCR and histological analyses were
compared using one-way ANOVA followed by Tukey’s test for
multiple comparisons. Significance was considered at p<0.05.
RESULTS
Transgene transmission to F0 offspring by non-surgical testis injection
PCR analysis indicated that several mice born after mating
with TMGT-treated males showed the presence of pEGFP-N1
vector in all treatments. The sequencing analysis showed that
all PCR products belonged to the pEGFP-N1 vector (data not
shown). The transgene transmission was compared among
treatments only in the second injection procedure, due to the
presence of mice born in all treatments (table II). Liposome
and DMSO provided higher degree of gene transmission than
DNA alone and DMA. No mice born in the control group
Figure 1. Gene expression analyses by RT-PCR of F0 transgenic
mice obtained after mating with the injected mice males. Upper
panel shows EGFP amplification and lower panel shows β-actin
amplification. Lane 1 – lipofectin, Lane 2 – DMSO, Lane 3 – DMA,
Lane 4 - DNA alone, Lane 5 – control (PBS alone).
TABLE II
Comparison of transfection reagents with respect to transgene transmission evaluated by PCR and transgene expression in
blood cells evaluated by RT-PCR in F0 offspring obtained after TMGT
Tranfections reagentes used
Lipofectin
1ª Injection
DMSO
DMA
DNA alone
Control (PBS alone)
N°
mice
PCR +
(%)
EGFP
mRNA
(%)
N°
mice
PCR +
(%)
EGFP
mRNA
(%)
N°
mice
PCR +
(%)
EGFP
mRNA
(%)
N°
mice
PCR +
(%)
EGFP
mRNA
(%)
N°
mice
PCR
+
(%)
EGFP
mRNA
(%)
36
1 (2.7)
0
24
0 (0)
0
14
0 (0)
0
0
0 (0)
0
12
0 (0)
0
9
(55.5)ab
18
(27.8)bc
26
(11.5)c
2ª Injection*
10
8(80.0)a
5
0 (0)
0
3ª Injection
8
2 (25.0)
0
0
0 (0)
0
29
3 (10.3)
1
15
0 (0)
0
13
0 (0)
0
4ªInjection
11
3 (27.3)
1
1
0 (0)
0
0
0 (0)
0
9
0 (0)
0
7
0 (0)
0
5
(50)a
5
2
(22.3)ab
5
3
(16.6)ab
3
1
(3.84)c
*Different letters indicate statistical differences among treatments.
Histological damage analysis of injected testis
Each testis was histologically inspected 7 days after 4
consecutive injections. In the control group (injection with PBS
alone) no testicular damage (scored 0) was found (Table III;
Fig. 2/A). For treatment with DNA alone, DNA/liposome, or
DNA/DMA, testicular damages were scored between 1.6 and
3.0 (Table III; C-E of Fig. 2/C-E), but no significant differences
were found among them. On the other hand, injections of
DNA/DMSO complex resulted in high degree of damages
(scored 3.4; Table III). These testes had atrophic seminiferous
tubules lacking spermatogonia and Sertoli cells together with
stromal fibrosis, absence of Leydig cells and lymphocytic
infiltration (B of Fig. 2/B).
DISCUSSION
The present study reports on the non-surgical testis injection
coupled to DNA complexes as an innovative DMA (N,
N-dimethylacetamide) to improve transgene transmission.
Although we did not obtain the best results with DMA,
this compound demonstrated a good potential for TMGT
procedures. Further studies should be conducted focused on
the optimal concentration, exogenous DNA concentration,
incubation temperature and sperm damage to improve DMA
utilization to generate transgenic TMGT.
TABLE 3
Histopatolological analyses of testis damage after four injections
Treatment
Control (PBS alone)
Histological damage*
0a
DNA alone
1.6 ± 0.26 b
DNA/Lipofectin complex
2.7 ± 0.25 b
DNA/DMA complex
3.0 ± 0.21 b
DNA/DMSO complex
3.4 ± 0.22 c
*Data are expressed as means ± SEM (n=10) and represent the mean of scores
(Table I) in each treatment. Different letters indicate statistical differences among means.
232
AMARAL ET AL. Biol Res 44, 2011, 229-234
Non-surgical TMGT was able to transmit the pEGFP-N1
vector to the offspring. The use of DNA complexes to
enhance uptake of exogenous DNA by sperm was previously
demonstrated by Sato et al. (2002) and Shen et al. (2006).
Shen et al. (2006) carried out experiments with DNA/DMSO
complex and subsequent injection into to mouse and rabbit
testes and demonstrated that respectively 61 and 55% of
offspring born was genetically transformed. In our study, we
obtained similar results using DMSO transfection and when
the exogenous DNA was injected without transfectant.
Liposome and DMSO were found to increase the rate of
TMGT. Kim et al. (1997) carried out the experiments with
commercial liposome transfection agent. They observed a
low transfection efficiency of the seminiferous tubule cells in
mice at 1 to 12 weeks after injection. Therefore, the transgene
was transferred by sperm to F0 progeny, but it was lost from
most tissues during growth. Using a lipid-based method
of transfection, Celebi et al. (2002) reported the transient
transmission of a transgene in the progeny of male mice
undergoing in vivo germ cell transfection. Yonezawa et al.,
(2001) produced transgenic rats by means of TMGT using
liposomes and showed that one month after birth only
4% of the progeny were foreign-DNA-positive. Here, we
demonstrated that two months after birth we still detect the
EGFP gene in 80% of offspring using TMGT associated with
liposome.
In this work, the transgene was successfully transmitted
to offspring but in vivo EGFP fluorescence in the body was
not detected. Yonezawa et al., (2001) demonstrated that more
than 80% of morula-stage embryos expressed EGFP. Then they
detected introduced DNA in the progeny by PCR and found
that the ratio of animals carrying the foreign DNA decreased
Figure 2. Hematoxylin and eosin staining of testes injected with different DNA complexes. (A) Control (injections of PBS alone),
seminiferous tubules without any histological damage are seen. (B) Injections of DNA/DMSO complex, atrophic seminiferous tubules
lacking germ cells and Sertoli cells are seen (asterisks). Stromal fibrosis and absence of Leydig cells are indicated by arrowhead and
lymphocytic infiltration (arrows) are also evident in the interstitial space. (C) Injections of DNA/DMA complex, seminiferous tubules with
reduced number of spermatogonial cells are seen (arrow). (D) Injections of DNA alone, some seminiferous tubules exhibit a reduced
number of spermatogonial cells (arrow). (E) Injections of DNA/liposome complex, some seminiferous tubules exhibit a reduced number of
spermatogonial cells (arrows). The magnification is x 400 in all panels.
AMARAL ET AL. Biol Res 44, 2011, 229-234
as they developed, and that only a part of postpartum
progeny were foreign-DNA-positive with high incidence of
mosaicism. Here, we believe that absence of EGFP expression
in the body could by caused by the mosaicism, since EGFP
expression was detected by RT-PCR in blood cells of some
animals. This result coincides with previous reports that
CMV promoter could drive EGFP expression for leucocytes
of transgenic chickens, produced by sperm-mediated gene
transfer (Harel-Markowitz et al., 2009). Using mouse model,
Kato et al. (1999) reported that 40% of morula-stage embryos
that had been subjected to pronuclear microinjection of the
same gene construct used in the present study were EGFPpositive, among which 62% showed mosaic fluorescence.
Thus, the efficiency in transferring foreign DNA into the egg
is much higher by the TMGT method than by the pronuclear
microinjection method. The reason for this difference may be
that foreign DNA is introduced into the egg under much more
physiological condition by the TMGT method, using the sperm
as a vector, than with the microinjection method. In addition,
the difference in the timing of the introduction of foreign
DNA into the egg between the TMGT method (at the time of
fertilization) and the microinjection method (after formation of
the pronucleus) could account for the difference in the ratio of
mosaic embryos.
The highest ration of transgene transmission was obtained
in the second injection/mating. Shen et al. (2006) performed
weekly consecutive injections, but did not evaluate transgene
transmission after each injection. After the fourth injection,
a severe reduction was observed, and in some cases the
absence of progeny. We observed the presence of vaginal
plugs, indicating the occurrence of mating in the females
after injections in all treatments. In addition, no behavioral
changes were observed in males, leading to the conclusion
that this reproductive deficiency was caused by the reduced
spermatogenesis observed after multiple injections.
Injections into testes could produce testicular damage
as demonstrated by our histological analysis. In the control
group no damage was observed. In contrast, testes injected
with DNA alone, DNA/DMA or DNA/liposome complex
were significantly damaged (see Table 3; A vs. C-E of Fig. 1).
Remarkably, the testes injected with DNA/DMSO complex
showed a high degree of damage (see table 3; Fig. 2/B). All
of these testes examined exhibited fibrosis and lymphocytic
infiltration. We believe that consecutive injections of DMSOcontaining solution can induce testicular degeneration and
reduce vascularization around seminiferous tubules. As a
result, spermatogenesis is impaired, as evidenced by a reduced
number of spermatogonial cells.
In summary, we reported transgene transmission in mice
by non-surgical TMGT using different transfectants. As well,
we demonstrated reduction of germ epithelium of testes after
DNA complex injections, fact that must be elucidated to further
applications of TMGT for in vivo gene transfer technology.
AKNOWLEDGEMENTS
This work was supported by FAPERGS/Edital PROADE III (#
05/2328.6). V. F. Campos is a student of the Graduate Program
in Biotechnology at Universidade Federal de Pelotas and is
supported by CAPES. J.C. Deschamps is a research fellow of
CNPq.
233
REFERENCES
BIANCHI I, CALDERAM K, MASCHIO EF, MADEIRA EM, DA ROSA
ULGUIM R, CORCINI CD, BONGALHARDO DC, CORRÊA EK,
LUCIA T JR, DESCHAMPS JC, CORRÊA MN (2008) Evaluation of
amides and centrifugation temperature in boar semen cryopreservation.
Theriogenology 69:632-638.
BRACKETT BG, BORANSKA W, SAWICKI W, KOPROWSKI H (1971)
Uptake of heterologous genome by mammalian spermatozoa and its
transfer to ova through fertilization. Proc Natl Acad Sci USA 68:353-357.
CAMPOS VF, AMARAL MG, SEIXAS FK, POUEY JLF, SELAU LPR,
DELLGOSTIN OA, DESCHAMPS JC, COLLARES T (2011b) Exogenous
DNA uptake by South American catfish (Rhamdia quelen) spermatozoa
after seminal plasma removal. Anim Reprod Sci (in press).
CAMPOS VF, COLLARES T, DESCHAMPS JC, SEIXAS FK, DELLAGOSTIN
OA, LANES CFC, SANDRINI J, MARINS, LF, OKAMOTO M, SAMPAIO
LA, ROBALDO RB (2010) Identification, tissue distribution and
evaluation of brain neuropeptide Y gene expression in the Brazilian
flounder Paralichthys orbignyanus, J Biosc 35:405-413.
CAMPOS VF, KOMNINOU ER, URTIAGA G, LEON PM, SEIXAS FK,
DELLAGOSTIN OA, DESCHAMPS JC, COLLARES T (2011a)
NanoSMGT: transfection of exogenous DNA on sex-sorted bovine sperm
using nanopolymer. Theriogenology 75:1476-1481.
CAMPOS VF, LEON PM, KOMNINOU ER, DELLAGOSTIN OA,
DESCHAMPS JC, SEIXAS FK, COLLARES T (2011c) NanoSMGT:
transgene transmission into bovine embryos using halloysite clay
nanotubes or nanopolymer to improve transfection efficiency.
Theriogenology (in press).
CELEBI C, AUVRAY P, BENVEGNU T, PLUSQUELLEC D, JEGOU B,
GUILLAUDEUX 209 T (2002) Transient transmission of a transgene in
mouse offspring following in vivo transfection of male germ cells. Mol
Reprod Dev 62:477-482.
COLLARES T, CAMPOS VF, LEON PMM, CAVALCANTI PV, AMARAL
MG, DELLAGOSTIN OA, SEIXAS FK, DESCHAMPS JC (2011)
Transgene transmission in chicken by sperm-mediated gene transfer
after seminal plasma removal using exogenous DNA complexed with
dimethylsulfoxide or N,N-dimethylacetamide. J Biosci (in press).
COLLARES T, CAMPOS VF, SEIXAS FK, CAVALCANTI PV, DELLAGOSTIN
OA, MOREIRA HL, DESCHAMPS JC (2010) Transgene transmission in
South American catfish (Rhamdia quelen) larvae by sperm-mediated gene
transfer. J Biosci 35:39-47.
COWARD K, KUBOTA H, PARRINGTON J (2007) In vivo gene transfer into
testis and sperm: developments and future application. Arch Androl
53:187-197.
DHUP S, MAJUMDAR SS (2008) Transgenesis via permanent integration of
genes in repopulating spermatogonial cells in vivo. Nat Methods 5:601603.
HAREL-MARKOWITZ E, GUREVICH M, SHORE LS, KATZ A, STRAM Y,
SHEMESH M (2009) Use of sperm plasmid DNA lipofection combined
with REMI (Restriction Enzyme- Mediated Insertion) for production
of transgenic chickens expressing EGFP (Enhanced Green Fluorescent
Protein) or Human follicle-stimulating hormone. Biol Reprod 80:10461052.
HOELKER M, MEKCHAY S, SCHNEIDER H, BRACKET BG, TESFAYE
D, JENNEN D, THOLEN E, GILLES M, RINGS F, GRIESE J,
SCHELLANDER K. 2007. Quantification of DNA binding, uptake,
transmission and expression in bovine sperm mediated gene transfer
by RT-PCR: Effect of transfection reagent and DNA architecture.
Theriogenology 67:1067-1107.
KATO M, YAMANOUCHI K, IKAWA M, OKABA M, NAITO K, TOJO H
(1999) Efficient selection of transgenic mouse embryos using EGFP as a
marker gene. Mol Reprod Dev 54:43-48.
KIM JH, JUNG-HA HS, LEE HT, CHUNG KS. 1997. Development of a
positive method for male stem cell-mediated gene transfer in mouse and
pig. Mol Reprod Dev 46:515-526.
LAVITRANO M, CAMAIONI A, FAZIO VM, DOLCI S, FARACE MG,
SPADAFORA C (1989) Sperm cells as vectors for introducing foreign
DNA into eggs: Genetic transformation of mice. Cell 57:717-723.
LI L, SHEN W, MIN L, DONG H, SUN Y, PAN Q (2006) Human lactoferrin
transgenic rabbits produced efficiently using dimethylsulfoxide-spermmediated gene transfer. Reprod Fertil Dev 18:689-695.
LU JK, FU BH, WU JL, CHEN TT (2002) Production of transgenic silver sea
bream (Sparus sarba) by different gene transfer methods. Mar Biotech
4:328-337.
234
AMARAL ET AL. Biol Res 44, 2011, 229-234
OGAWA S, HAYASHI K, TADA N, SATO M, KURIHARA T, IWAYA M (1995)
Gene expression in blastocysts following direct injection of DNA into
testis. J Reprod Dev 41:379-238 382.
SATO M, ISHIKAWA A, KIMURA M (2002) Direct injection of foreign
DNA into mouse testis as a possible in vivo gene transfer system via
epididymal spermatozoa. Mol Reprod Dev 61:49-56.
SHEN W, LI L, PAN QJ, MIN LJ, DONG HS, DENG JX (2006) Efficient and
simple production of transgenic mice and rabbits using the new DMSOsperm mediated exogenous DNA transfer method. Mol Reprod Dev
73:589-594.
WEBSTER NL, FORNI M, BACCI ML, GIOVANNONI R, RAZZINI R,
FANTINATI P, ZANNONI A, FUSETTI L, DALPRA L, BIANCO MR,
PAPA M, SEREN E, SANDRIN MS, MCKENZIE I, LAVITRANO M
(2005) Multi-transgenic pigs expressing three fluorescent proteins
produced with high efficiency by sperm mediated gene transfer. Mol
Reprod Dev 72:68-76.
YONEZAWA T, FURUHATA Y, HIRABAYASHI K, SUZUKI M, TAKAHASHI
M, NISHIHARA M (2001) Detection of transgene in progeny at different
developmental stages following testis-mediated gene transfer. Mol
Reprod Dev 60:196-201.
Biol Res 44: 235-241, 2011
Association of the infusion of Heteropterys aphrodisiaca and
endurance training brings spermatogenetic advantages
Marcos L M Gomes1*, Juliana C Monteiro2, Karine M Freitas3, Mariana M Sbervelheri3, Heidi Dolder3
1
2
3
Departamento de Ciências de Saúde, CEUNES, Universidade Federal do Espírito Santo, São Mateus, ES, Brasil.
Departamento de Ciências Agrárias e Biológicas, CEUNES, Universidade Federal do Espírito Santo, São Mateus, ES, Brasil.
Departamento de Biologia Estructural e Funcional, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, SP, Brasil.
ABSTRACT
The species Heteropterys aphrodisiaca is commonly used as a stimulant by popular medicine in the Cerrado, a savanna-like biome, Brazil.
Recent studies have proved its protective effects on testes of animals submitted to treatment using Cyclosporine A, as well as its stimulus
effect in increasing testosterone secretion. Therefore, the present study was designed to analyze whether the association of the plant
infusion and endurance exercise could potentiate the stimulating effect. The animals were separated into 4 groups: two control (sedentary
and trained) receiving water and two treated (sedentary and trained) receiving the plant infusion daily (104mg/day). The proportion of
the seminiferous tubule compartment and interstitium was analyzed. Within the seminiferous epithelium, the number of Sertoli and germ
cells were counted in order to evaluate whether the treatment would alter the spermatogenic dynamics, analyzing: the spermatogenic
yield, the mitotic and meiotic indexes, the total number of germ cells and the Sertoli cell support capacity. Trained and treated animals
showed increased spermatogenic yield and spermatogonia mitosis, and no significant differences in apoptotic indexes. Despite the results
showing the same pattern regarding yield and mitotic index, the meiotic index was higher in the sedentary/treated group. Therefore, the H.
aphrodisiaca infusion increased both the testosterone production and the spermatogonia mitosis, thus increasing the spermatogenic yield.
Key words: germ cells, phytotherapy, seminiferous epithelium, spermatogenesis, testosterone.
INTRODUCTION
Nowadays, there is growing scientific interest in research on
plants used in folk medicine, resulting in several studies of
their active components (Pitman, 1996, Srivastava et al., 2005).
The use of these plants in therapy is driven by the potential
production of more affordable drugs and because of the wide
popular acceptance of natural products, especially in countries
with lower economic resources, such as Brazil (Corrêa et
al., 2000). Despite the potential richness of medicinal flora,
scientific studies and journals that address this theme are still
scarce. In general, Brazil has not made satisfactory use of its
biodiversity and the popular knowledge for the development
of herbal agents and compounds (Calixto, 2005).
The species, Heteropterys aphrodisiaca, is a shrub that
belongs to the Malpighiaceae Family, found mainly in the
Cerrado region, a savanna-like biome, in the states of Mato
Grosso, Goiás and northern Minas Gerais (Pio Corrêa, 1984). Its
roots have been used as tonic or stimulant, as well as to treat
nervous system weaknesses (Pio Corrêa, 1984; Pott and Pott,
1994; Guarim Neto, 1996). On the other hand, H. aphrodisiaca is
one of the most famous aphrodisiacs in the Middle-West Brazil,
popularly known as nó-de-cachorro, raiz de Santo Antônio and
cordão de São Francisco (Pott and Pott, 1994; Guarim Neto,
1996).
Endurance exercise elicits several physiological responses
and chronic adaptations that are critical for increasing
muscular strength, hypertrophy and tolerance to physical
activity. Several studies correlate the effects of exercise to the
production and release of LH and testosterone (Häkkinen et al.,
1988; Fry et al., 1998; Nindl et al, 2001; Tremblay et al., 2004).
From the perspective of an athlete, the increased hormonal
levels may act by improving performance and results,
since testosterone stimulates the development of muscle
and strength, as well as decreasing fat tissue accumulation
(Tremblay et al., 2004).
Based on previous studies, which inferred that H.
aphrodisiaca could increase male libido and act as an
aphrodisiac species (Chieregatto, 2005; Monteiro et al.,
2008), the present study was designed to assess the possible
stimulating effects of H. aphrodisiaca infusion on the
seminiferous epithelium mainly by inducing germ cell
division, in the testes of adult Wistar rats, maintained
sedentary or trained on a treadmill.
MATERIAL AND METHODS
Herb harvesting and experimental groups
The H. aphrodisiaca samples were harvested in Nova Xavantina
(Mato Grosso, Brazil) and identified by comparison to samples
kept in the Herbarium of the Federal University of Mato
Grosso, under the registration number 23,928.
The roots were dried at room temperature, protected from
direct incidence of sunlight, and then fragmented. Infusions
were made of fragments (25g) put into 100mL of distilled water
at boiling point. The infusion remained for four hours to cool
down, then was filtered and stored at 4oC for up to four days,
as proposed by Chieregatto (2005). The rats were weighed
every week and the variation was considered in order to
calculate the concentration of the infusion to be prepared.
The Central Animal House (Centro Multidisciplinar para
Investigação Biológica na Área da Ciência em Animais de
Laboratório - CEMIB) in the State University of Campinas
* Corresponding author: Marcos L M Gomes, Rodovia BR 101, Km 60, s/n. Bairro Litorâneo. DCS/CEUNES/UFES. CEP 29932-540. São Mateus, ES, Brasil. Tel: (+55) 27 3312 1543, Fax:
(+55) 27 3312 1510. Email: [email protected]
Received: March 17, 2010. In revised form: January 28, 2011. Accepted: March 2, 2011.
236
GOMES ET AL. Biol Res 44, 2011, 235-241
(Unicamp) provided the male Wistar rats (Rattus norvegicus
albinus) (90 days old) used in this study. The animals were
divided into 4 groups (n = 10): a control sedentary (CS) and a
control trained group (distilled water) (CT), a sedentary treated
with H. aphrodisiaca (104mg/day) (HS) and a group that was
trained and treated (HT). Food (commercial diet) and water
were provided ad libitum. The plant infusion was given daily
by gavage (0.5mL/animal). The same procedure was repeated
with the control animals, which only received distilled water.
The treatment lasted eight weeks.
The animals were kept in the Animal Facility of the
Department of Cell Biology and handled in accordance with
the rules of the Ethics Committee of the Institute of Biology,
UNICAMP. The project had been previously submitted to the
same Committee (protocol number: 734-1) and its acceptance is
registered under the number 1234-1.
Training protocol
The trained animals were submitted to a training protocol that
consisted of running on a treadmill built specially for small
animals, with 7 individual lanes and manual control of speed,
five days a week for 8 weeks, based on previously set protocols
(Moraska et al., 2000; Smolka et al., 2000; Demirel et al., 2001).
First, all animals were subjected to an adaptation period (pretraining), until they reached the optimal degree of effort for the
initial training phase (Table I).
Biological samples
Forty-eight hours after the end of the training protocol (56
days), animals were weighed and anesthesia was injected in
the left hind leg with a mixture of Xylazine and Ketamine, 5
and 80 mg/kg, respectively. The blood was collected by cardiac
puncture of the left ventricle and centrifuged at 10000 rpm
(4oC) for 5 minutes. The testosterone assay was performed by
chemiluminescence.
The animals were perfused with saline solution (0.9%) and
fixed with Karnovsky’s fixative (4% paraformaldehyde and
4% glutaraldehyde in 0.1 mol/L phosphate buffer at pH 7.2)
for 20 minutes each. After perfusion, the testes were removed,
weighed and put into new Karnovsky’s fixative, at the same
concentration, where they remained for 24h.
After fi xation, the fragments were dehydrated in ethyl
alcohol for embedding in glycol methacrylate. The blocks were
TABLE I
Treadmill protocol
Event
Treadmill
adaptation
Training
cut with a manual microtome (4μm) and the sections stained
with toluidine blue/sodium borate, 1%.
Testicular morphometry
The gonadosomatic index (GSI) was calculated dividing the
gonadal weight (GW) by the body weight (BW): GW/BWx100.
The volume of the testicular parenchyma was obtained by
subtracting the tunica albuginea volume from the testis
volume. According to Paula et al. (2002), as the density of the
testicle is approximately 1 (1.03 - 1.04), the testicular mass was
considered equal to its volume.
The volumes (mL) of the testicular parenchyma
components (seminiferous tubules and interstitium) were
estimated from the proportion (%) occupied by them within
the testis. A total of 15 digital images (400x), per animal, were
used in order to calculate the proportion between the two
compartments. The images were analyzed using the software
Image Pro Plus (v. 6.0). A grid containing 200 intersections
was placed on the images and the points on the tubular and
interstitial compartments were counted.
The mean seminiferous tubule diameter was obtained
by randomly measuring 30 tubular cross sections, as circular
as possible. Since the tubular diameter remains constant in
adult male rats throughout the seminiferous cycle, it was
unnecessary to consider the stage of the epithelium within
the cycle (França and Russell, 1998). These sections were also
used to measure the seminiferous epithelium height, which
was taken from the basal membrane to the tubular lumen.
The epithelium height for each tubule was the average of
four diametrically opposed measurements. The total length
(TL) of the seminiferous tubules, per testicle, was estimated
from previous knowledge of the volume occupied by these
structures within the parenchyma, as well as from the mean
tubular diameter: STV/πr2 (STV = seminiferous tubule volume;
πr2 = tubule cross section area; r = diameter/2).
Germ cell line counting
The estimated populations of different cell types that make up
the seminiferous epithelium in Stage 1 were based on counts of
the nuclei of germ cells and nucleoli of Sertoli cells (Swierstra,
1968, Curtis and Amann, 1981, Amann and Schanbacher, 1984).
The following populations were quantified in 10 seminiferous
tubule cross sections: type A spermatogonia (SPTGA), primary
spermatocytes at pre-leptotene/leptotene (SPT Pl/L) and
pachytene (SPT P), round spermatids (RSPD) and Sertoli cells
(S). Cell populations were corrected numerically considering
section thickness and nuclear or nucleolar diameter, the latter
in the case of Sertoli cells, as done by Amann and Almquist
(1962). The average nuclear diameter is the average of 30 nuclei
diameters of each cell type studied, for each animal.
The following were determined from these populations:
efficiency coefficients of spermatogonial mitosis (SPT Pl/L/
SPTGA), spermatogenesis yield (RSPD/SPTGA), meiotic index
(RSPD/SPT P) and Sertoli cell supporting index by the total of
spermatogenic cells ((SPTGA + SPTC Pl/L + SPTC P + RSPD)/S).
Week
Velocity (m/min)
Duration (min)
1
10.68
5
2
12.42
7.5
3
14.16
10
1
14.16
20
2
19.62
30
TUNEL assay
3
19.62
40
4-8
22.92
45
In order to detect apoptosis, the TUNEL technique (Terminal
deoxynucleotidyl transferase dUTP nick end labeling) was
GOMES ET AL. Biol Res 44, 2011, 235-241
performed on paraformaldehyde fixed sections (5μm). TUNEL
assay was made according to the Calbiochem kit protocol
(#QIA33). In brief, tissue sections were deparaffined and
hydrated in ethyl alcohol, incubated with proteinase K 1%
(20 minutes at room temperature), washed in distilled water
and incubated with 3% hydrogen peroxide in methanol for
5 minutes, to quench endogenous peroxidase activity. Slides
were then incubated with Tdt Equilibrium Buffer in distilled
water in a humid chamber at room temperature for 20 minutes
and subsequently with Tdt enzyme in Tdt mix for an hour
(37oC). Immunoreactive cells were detected by incubating the
sections with a mixture of 3,3-diaminobenzidine tetrachloride
(DAB), for 13 minutes in a dark humid chamber. Sections
were counterstained with Harris’ hematoxylin, dehydrated
in ethanol, cleared in xylene and mounted. Apoptotic nuclei
were stained in brown. Extra slides of the same material were
used as negative and positive controls. No color reaction was
observed when TdT enzyme was omitted from the procedure.
Positive control slides were incubated with DNAse (1,500U/
μl) in tris-buffered saline (TBS) containing MgCl2 (10mM) and
bovine serum albumin (1mg/mL) for 10 minutes, prior to the
endogenous peroxidase blocking process (Figure 1A-C). The
same TUNEL staining steps described above were taken. Four
slides, one per group, were stained at each time, avoiding
discrepancies when comparing results.
237
was no interaction between training on a treadmill and the
infusion of the plant in the final outcome of total testosterone
(two-way ANOVA).
Apoptotic index
Two hundred and fifty round seminiferous tubule cross
sections from five animals per experimental group were
evaluated for the appearance of apoptotic nuclei, at 400x
magnification. Counting was based on previous studies of
Turner et al. (1997), Kimura et al. (2003), and Li et al. (2009).
The mean number of apoptotic cells per tubule cross section
was recorded, as well as the maximum number of positive
cells per cross section. The proportion of apoptotic cells was
also calculated considering only positive (+) tubules. In order
to determine apoptotic rates, the number of each type of
TUNEL-positive germ cell was divided by the total number of
the corresponding type of germ cell within the seminiferous
sections.
Statistic analysis
Analysis of variance (one-way ANOVA) plus Duncan’s test
was used to compare differences between groups. Values of
p<0.05 indicate significant differences. Two-way ANOVA was
used to determine whether either the H. aphrodisiaca infusion
or training protocol infl uenced the patterns analyzed, and
whether there was interaction between the infusion and
exercise. The software Statistica (v. 8.0, Tulsa, OK, USA) was
used for all statistical analysis. All values were expressed as
mean ± SEM.
RESULTS
Hormonal assay
The sedentary animals that received the plant infusion showed
significant increase in total testosterone concentration (Fig.
2). The trained animals did not show any alterations in this
parameter compared to the control sedentary animals. There
Figure 1. Histological view of the testicular parenchyma showing
several seminiferous tubule cross sections in negative (A) and
positive (B) TUNEL controls. Brown color shows apoptotic nuclei.
C: apoptotic germ cells within the seminiferous epithelium
(arrows). In the inset, note the dense chromatin on the edges of a
characteristically apoptotic nucleus (arrow head). ST: seminiferous
tubule; Int: interstitium; star: lymphatic space. Bars: A and B =
100µm; C = 25µm; detail = 5µm.
238
GOMES ET AL. Biol Res 44, 2011, 235-241
Testicular morphometry
There were no signifi cant alterations in the testicular and
body weight throughout the study, as well as the GSI. The
proportions between seminiferous tubules and interstitium
remained constant among the experimental groups (Table II).
On average, both groups submitted to the exercise protocol
showed significantly lower tubular diameters compared to
the sedentary ones. On the other hand, the sedentary animals
showed shorter seminiferous tubules, so that, despite the
differences, the final volume remained constant among
all treatments (Table III). The epithelium height was not
significantly altered.
highest spermatogenesis yield average and spermatogonial
mitosis rate, compared with the control trained group and with
both sedentary groups. The mitotic index and spermatogenesis
yield showed the same tendency among the groups, however,
for the meiotic index, the sedentary group receiving the
infusion showed the highest average when compared to the
two control groups, sedentary and trained (Fig. 3).
Germ and Sertoli cells
The number of spermatogonia decreased in animals treated
and trained compared to the control trained animals (Table
IV). There was also a decrease in the number of pre-leptotene
and pachytene cells in animals treated with H. aphrodisiaca,
both sedentary and trained. However, the number of round
spermatids remained constant (Table IV).
The spermatogenic yield, the meiotic index and
spermatogonial mitosis were calculated using the average
values of the germ cell populations. Animals that received the
infusion and were submitted to the exercise protocol had the
Figure 2. Testosterone concentration (ng/mL) (mean ± SD; n=10).
Same letters do not differ by Duncan’s test (p > 0.05).
TABLE II
Body and testicular weight, gonadosomatic index and tubules/interstitium ratio of Wistar rats treated with
Heteropterys aphrodisiaca infusion and/or submitted to treadmill endurance training
(mean ± SD, for body and testicular weight and GSI, whereas mean ± SEM for seminiferous tubules and interstitium)
Parameters
CtlTra
HATra
CtlSed
HASed
403.60 ± 33.17a
416.30 ± 40.92a
417.10 ± 25.47a
410.40 ± 44.48a
Testicular weight (g)
3.37 ± 0.14a
3.58 ± 0.10a
3.43 ± 0.08a
3.54 ± 0.01a
GSI (%)
0.83 ± 0.03a
0.86 ± 0.04a
0.82 ± 0.02a
0.86 ± 0.02a
Seminiferous tubules (%)
86.36 ± 0.82ª
86.97 ± 0.63ª
85.56 ± 0.81ª
85.88 ± 1.22ª
Interstitium (%)
13.64 ± 0.82ª
13.03 ± 0.63ª
14.44 ± 0.81ª
14.12 ± 1.22ª
Body weight (g)
*Same superscripts indicate lack of statistical difference as analyzed by Duncan’s test (p>0.05; n=10). CtlSed and CtlTra: Control Sedentary and Trained, respectively;
HASed and HATra: Sedentary/Treated and Trained/Treated, respectively.
TABLE III
Testicular morphometry of adult Wistar rats treated with Heteropterys aphrodisiaca infusion
and/or submitted to treadmill endurance training (mean ± SEM)
Parameter
CtlTra
4.84a
HATra
310.56 ±
7.46a
CtlSed
295.84 ±
HASed
3.75b
297.28 ± 4.74b
Tubular diameter (μm)
316.28 ±
Epithelium height (μm)
107.26 ± 1.68a
104.31 ± 3.01a
100.03 ± 1.73a
103.38 ± 2.60a
0.76b
0.89ab
0.57a
21.25 ± 1.08a
1.39 ± 0.04a
1.46 ± 0.05a
Tubular length/testis (m)
17.48 ±
Tubular volume/testis (mL)
1.37 ± 0.06a
19.09 ±
1.43 ± 0.05a
20.27 ±
*Same superscripts indicate lack of statistical difference as analyzed by Duncan’s test (p>0.05; n=10). CtlSed and CtlTra: Control Sedentary and Trained, respectively;
HASed and HATra: Sedentary/Treated and Trained/Treated, respectively.
GOMES ET AL. Biol Res 44, 2011, 235-241
239
this group. None of the germ cells populations showed any
significant alterations. Besides, apoptosis was noted mainly in
spermatogonia and primary spermatocytes, and occasionally in
round spermatids.
DISCUSSION
Figure 3. Spermatogenesis dynamics. A. Spermatogenic yield; B.
Spermatogonial mitosis and; C. Meiotic index. Values are mean ±
SEM (Means with the same letters do not differ significantly; Duncan
test; p>0.05, n=10). CtlTra: Control trained, HATra: Treated and
trained, CtlSed: Control sedentary and HASed: Treated and sedentary.
Apoptotic assay
All apoptotic results are listed on Table V. Sedentary rats
that received plant treatment showed the lowest number
of apoptotic cells per tubule and per positive tubule cross
sections (p<0.05). As well, the proportion of tubules showing
at least one apoptotic germ cell was significantly lower in
The presented data showed that both biometric data and
spermatogenesis were not affected by the proposed endurance
protocol. However, H. aphrodisiaca infusion seems to play an
important role in improving testosterone secretion, as well as cell
division, increasing spermatogenesis yield and the meiotic index.
Morphometry techniques have frequently been used to
help in comparisons between experimental groups, thus
adding more reliability to the final diagnosis. The present
study was based on the principles of morphometry and
stereology, in order to describe possible alterations within the
testicular functions and structure of Wistar rats under exercise
and/or treatment with Heteropterys aphrodisiaca infusion.
According to the protocol suggested for the present study
there were no differences in the body and testicular weights
after treatments, thus the gonadosomatic index did not show
significant variations among groups. However, Chieregatto
(2005) and Monteiro et al. (2008) working with the same animal
strain and infusion dose found a greater weight gain in rats
treated with H. aphrodisiaca infusion, which was correlated
with the increased testosterone secretion in those animals.
Although the sedentary, treated animals showed an increase
in testosterone concentrations, there were no alterations in the
weight of reproductive organs.
The seminiferous tubule compartment occupies most of the
testicular parenchyma (86%), containing somatic (Sertoli cells)
and germ cell lineages (Russell and França, 1995), and thus is
important during the entire spermatogenic process. Several
studies have related tubular diameter and length, as well as
the seminiferous epithelium height and the tubular proportion
within the parenchyma to the daily sperm production. The
intraperitoneal injection of alcoholic extracts of Momordica
charantia (Naseem et al., 1998), and piperine (Malini et al., 1999)
in rats led to a reduction of the tubular diameter, thus reducing
sperm production by severe modifications of the epithelium.
On the other hand, Chieregatto (2005) reported that after
treating rats with Anemopaegma arvense infusion, it was possible
to increase those parameters, while not increasing the total
tubular volume within the parenchyma. The present study
showed significant decrease of tubular diameter in sedentary
rats. Seminiferous tubules are made of three basic components:
tunica propria, seminiferous epithelium and lumen, where
sperm is released after spermiogenesis (Ross et al., 2003). Once
the epithelium height and total length did not change after
treatment and/or exercise, and the tunica propria is really thin
and was apparently normal in all animals, the decrease of
diameter could be due to a smaller lumen.
Morphological analysis did not show any damage or major
alterations due to the administration of H. aphrodisiaca infusion
and/or the endurance exercise. The total volume occupied by
the seminiferous tubules remained statistically the same among
the experimental groups, despite the numerical variations of
such parameters as diameter and length. Since the volume
formula for the tubular compartment calculation includes both
tubular diameter and length, the association of the variations
observed for these parameters was related to the maintenance
240
GOMES ET AL. Biol Res 44, 2011, 235-241
of the total volume of the seminiferous tubules. The longer the
tubules, the narrower their diameters, while the shorter the
tubules, the wider their diameters.
The Sertoli cell population established during the initial
development of the male reproductive system determines
daily sperm production in normal and sexually mature animals
(Orth et al., 1988; Hess et al., 1993). This hypothesis is based
on the fact that each Sertoli cell is able to support a limited
number of germ cells (Russell and Peterson, 1984; França and
Russell, 1998). Daily spermatogenic efficiency, which is the
number of spermatozoa produced daily per gram of testis, is
positively related to the number of germ cells supported by the
Sertoli cell (Russell and Peterson, 1984; Sharpe, 1994; França
and Russell, 1998), since the interactions between Sertoli and
germ cells are crucial to maintain normal sperm production
(Griswold, 1995). In the present study, the number of Sertoli
cells was constant for all treatments, which was also observed
for the total number of germ cells.
The number of spermatogonia and primary spermatocytes
in leptotene and pachytene was signifi cantly lower in the
treated, trained animals, leading to a higher mitotic index.
Besides, the lower number of cells is not due to apoptosis,
as was shown by the TUNEL technique. On the contrary,
the number of apoptotic cells was significantly lower in
the sedentary and treated animals, suggesting that the
administration of the drug could act as a substance protecting
the tubules by preventing apoptosis and/or seminiferous
damage, as shown by Monteiro et al. (2008), who used
Heteropterys aphrodisiaca infusion to protect the seminiferous
epithelium against cyclosporine A administration.
Even with a lower number of primary spermatocytes in
both HA treated groups, the meiotic indexes of these groups
were higher than those of the controls. Meiosis seemed to occur
more efficiently, producing as many round spermatocytes as in
the control groups, as well as the same total number of germ
cells.
Several drugs, such as Bisphenol A (Li et al., 2009), increase
apoptotic cell types within either the seminiferous epithelium
(spermatogonia, primary spermatocytes and spermatids)
or the interstitium (Leydig cells), causing loss of germ cell
TABLE IV
Germ cells populations within seminiferous epithelium of Wistar rats treated with Heteropterys aphrodisiaca infusion
and/or submitted to treadmill endurance training (mean ± SEM)
Number of cells (x106)
CtlTra
HATra
0.74a
11.15 ±
CtlSed
0.71a
13.43 ±
HASed
0.72a
12.66 ± 0.76a
Sertoli/gram of testis
11.57 ±
Spermatogonia
1.35 ± 0.08a
1.04 ± 0.14b
1.18 ± 0.08ab
1.25 ± 0.07ab
0.77a
0.97b
1.04a
26.51 ± 0.88b
Spermatocytes (Pre-leptotene/Leptotene)
29.33 ±
Spermatocytes (Pachytene)
29.48 ± 0.58a
25.62 ± 0.76b
27.94 ± 0.87a
25.58 ± 0.96b
Round spermatids
83.30 ± 2.69a
80.64 ± 1.70a
84.81 ± 3.51a
86.39 ± 3.40a
3.46a
2.87a
5.02a
139.73 ± 4.97a
Germ cells (Total)
143.46 ±
26.68 ±
133.98 ±
29.57 ±
143.51 ±
*Same superscripts indicate lack of statistical difference as analyzed by Duncan’s test (p>0.05; n=10). CtlSed and CtlTra: Control Sedentary and Trained, respectively;
HASed and HATra: Sedentary/Treated and Trained/Treated, respectively.
TABLE V
Apoptotic cells detected by TUNEL technique (mean ± SEM)
Parameters/Groups
CtlTra
0.45a
HATra
3.00 ±
1.47a
CtlSed
3.00 ±
HASed
1.05a
0.40 ± 0.24a
Maximum/tubule
2.50 ±
Mean/tubule
0.16 ± 0.07ab
0.19 ± 0.09a
0.15 ± 0.06ab
0.01 ± 0.005b
Mean/+tubule¥
1.72 ± 0.35a
1.60 ± 0.67a
1.59 ± 0.26a
0.40 ± 0.24b
2.87a
3.16a
2.32a
0.80 ± 0.49b
% Tubules apoptosis
8.50 ±
8.00 ±
8.40 ±
Cell type (%)
Spermatogonia
11.08 ± 1.18a
12.12 ± 7.18a
7.27 ± 4.54a
2.50 ± 2.50a
1.18a
0.75a
1.91a
0.00 ± 0.00*
0.43 ± 0.18a
0.00 ± 0.00*
Primary spermatocyte
3.22 ±
Round spermatid
0.31 ± 0.18a
1.84 ±
0.14 ± 0.14a
3.31 ±
Same superscripts indicate lack of statistical difference as analyzed by Duncan’s test (p>0.05; n=5). CtlSed and CtlTra: Control Sedentary and Trained, respectively;
HASed and HATra: Sedentary/Treated and Trained/Treated, respectively.
¥Analysis carried on only on cross sections containing apoptotic cells.
*Absence of apoptotic primary spermatocyte and spermatid in the analyzed slides.
GOMES ET AL. Biol Res 44, 2011, 235-241
lineages and decreased fertility rates, as well as decrease in
plasma testosterone levels and testis weight, associated with
morphological changes, sperm count and motility (Takao et al.,
1999; Aikawa et al., 2004). Germ cell apoptosis can also be related
to a combination of factors, such as alterations in hormonal
parameters and testicular oxidative stress (Chaki et al., 2006).
The results observed after long term treatment with the
infusion of Heteropterys aphrodisiaca showed that there were
no negative changes within the seminiferous epithelium, even
after a prolonged treadmill endurance protocol. Indeed, the
results showed a significantly lower number/proportion of
apoptosis in the testis of the treated, sedentary animals. The
protective potential of this species was shown previously
by Mattei et al. (2001) and Monteiro et al. (2008), who
demonstrated the increasing of antioxidant species in the
brain of old rats or protection of the seminiferous epithelium
after exposition to Ciclosporine A, respectively. Corroborating
the above cited results, the testosterone concentration in the
plasma of the same experimental group was significantly
higher, also showing that the Leydig cells were preserved and
not affected by the treatment.
Therefore, according to the presented data, Heteropterys
aphrodisiaca infusion seems to play an important role in
increasing testosterone secretion and spermatogonial behavior,
inducing mitosis and increasing spermatogenic yield.
ACKNOWLEDGMENTS
The authors wish to thank the Fundação de Amparo a Pesquisa
do Estado de São Paulo (FAPESP) and the Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES/
PROEX) for financial support.
REFERENCES
AIKAWA H, KOYAMA S, MATSUDA M, NAKAHASHI K, AKAZOME Y,
MORI T (2004) Relief effect of vitamin A on the decreased motility of
sperm and the increased incidence of malformed sperm in mice exposed
neonatally to bisphenol A. Cell Tissue Res. 315: 119–124.
AMANN RP, ALMQUIST JO (1962) Reproductive capacity of dairy bulls.
VIII. Direct and indirect measurement of testicular sperm production. J
Dairy Sci 45:774-781.
AMANN RP, SCHANBACHER BD (1984) Physiology of male reproduction. J
Anim Sci 57:380-403.
CALIXTO JB (2005) Twenty-five years of research on medicinal plants in
Latin America: a personal view. J Ethnopharmacol 100:131–134.
CHAKI SP, MISRO MM, GAUTAM DK, KAUSHIK M, GHOSH D, CHAINY
GB (2006) Estradiol treatment induces testicular oxidative stress and
germ cell apoptosis in rats. Apoptosis 11:1427–1437.
CHIEREGATTO LC (2005) Efeito do tratamento crônico com extratos de
Heteropterys aphrodisiaca O. Mach. e Anemopaegma arvense (Vell) Stellf. no
testículo de ratos Wistar adultos. Viçosa: UFV. pp:67.
PIOCORRÊA AD, BATISTA RS, QUINTAS LEM (2000) Plantas medicinais.
Do cultivo à Terapêutica. Petrópolis: Editora Vozes. pp:247.
CURTIS SK, AMANN RP (1981) Testicular development and establishment
of spermatogenesis in holstein bulls. J Anim Sci 53:1645-1657.
DEMIREL HA, POWERS SK, NAITO H, HUGHES M, COOMBES JS (2001)
Exercise-induced alterations in skeletal muscle myosin heavy chain
phenotype: dose-response relationship. J Appl Physiol 86:1002–1008.
FRANÇA LR, RUSSELL LD (1998) The testis of domestic animals.
In: MARTINEZ F, REGADERA J (eds) Male Reproduction. A
Multidisciplinary Overview. 1st ed. Madrid: Churchill Livingstone.
pp:197–219.
FRY AC, KRAEMER WJ, RAMSEY LT (1998) Pituitary-adrenal-gonadal
responses to high intensity resistance exercise overtraining. J Appl
Physiol 85:2352-2359.
GRISWOLD MD (1995) Interaction between germ cells and Sertoli cells in
the testis. Biol Reprod 52:211-216.
241
GUARIM NETO G (1996) Plantas medicinais do Estado do Mato Grosso.
Brasília: Instituto de Biociências (ABEAS). pp:72.
HÄKKINEN K, PAKARINEN A, ALÉN M, KAUHANEN H, KOMI PV
(1988) Neuromuscular and hormonal adaptations in athletes to strength
training in two years. J Appl Physiol 65:2406-2412.
HESS RA, COOKE PS, BUNICK D, KIRBY JD (1993) Adult testicular
enlargement induced by neonatal hypothyroidism is accompanied by
increased Sertoli cell and germ cell number. Endocrinology 132:2607–
2613.
KIMURA M, ITOH N, TAKAGI S, SASAO T, TAKAHASHI A, MASUMORI
N, TSUKAMOTO T (2003) Balance of Apoptosis and Proliferation of
Germ Cells
Related to Spermatogenesis in Aged Men. J Androl 242: 185-190.
LI YJ, SONG TB, CAI YY, ZHOU JS, SONG X, ZHAO X, WU XL (2009)
Bisphenol A Exposure Induces Apoptosis and Upregulation of Fas/FasL
and Caspase-3 Expression in the Testes of Mice Toxicol Sci 108: 427–436.
MALINI T, MANIMARAN RR, ARUNAKARAN J, ARULDHAS MM,
GOVINDARAJULU P (1999) Effects of piperine on testis of albino rats. J
Ethnopharmacol 64:219-225.
MATTEI R, BARROS MP, GALVÃO SMP, BECHARA EJH, CARLINI ELA
(2001). Heteropteris aphrodisiaca O. Machado: effects of extract BST 0298
on the oxidative stress of young and old rat brains. Phytoth Res 15:
604–607.
MONTEIRO JC, PREDES FS, MATTA SLP, HEIDI DOLDER (2008)
Heteropterys aphrodisiaca Infusion Reduces the Collateral Effects of
Cyclosporine A on the Testis. Anat Record 291:809–817.
MORASKA A, TERRENCE D, ROBERT LS, DAVID R, MONIKA F (2000)
Treadmill running produces both positive and negative physiological
adaptations in Sprague-Dawley rats. Am J Physiol Reg I 279:1321–1329.
NASEEM MZ, PATIL SR, PATIL SR, PATIL RS (1998) Antispermatogenic
and androgenic activities of Momordica charantia (Karela) in albino rats J
Ethnopharmacol 61:9-16.
NINDL BC, KRAEMER WJ, DEAVER DR, PETERS L, MARX JO, HECKMAN
T, LOOMIS GA (2001) LH secretion and testosterone concentrations are
blunted after resistance exercise in men. J Appl Physiol 91:1251-1258.
ORTH JM, GUNSALUS GL, LAMPERT AA (1988) Evidence from Sertoli
cell-depleted rats indicates that spermatid number in adults depends
on numbers of Sertoli cells produced during perinatal development.
Endocrinology 122:787–794.
PAULA TAR, COSTA DS, MATTA SLP (2002) Avaliação histológica do testículo
de capivaras (Hydrochoerus hydrochaeris) adultas. Biosci J 18:121-136.
PIOCORRÊA, M. (1984) Dicionário de Plantas Úteis do Brasil e das Exóticas
Cultivadas. Rio de Janeiro: Ministério da Agricultura/Instituto
Brasileiro de Desenvolvimento Florestal. pp: 293.
PITMAN V (1996) Fitoterapia. As plantas medicinais e a saúde. Lisboa:
Estampa. pp: 188.
POTT A, POTT VJ (1994) Plantas do Pantanal. Corumbá: Embrapa-SPI. pp:
320.
ROSS MH, KAYE GI, PAWLINA W (2003) Histology: A text and atlas. 4th ed.
LWW. pp. 682-724.
RUSSELL LD, FRANÇA LR (1995) Building a testis. Tissue Cell 27:129-147
RUSSELL LD, PETERSON RN (1984) Determination of the elongate spermatidSertoli cell ratio in various mammals. J Reprod Fertil 70:635–664.
SHARPE RM (1994) Regulation of spermatogenesis. In: KNOBIL E, NEILL JD
(eds) The Physiology of Reproduction. 2nd ed. New York: Raven Press.
pp.1363-1434.
SMOLKA MB, ZOPPI CC, ALVES AA, SILVEIRA LR, MARANGONI S,
PEREIRADASILVA L, NOVELLO JC, MACEDO DV (2000) HSP72 as a
complementary protection against oxidative stress induced by exercise
in the soleus muscle of rats. Am J Physiol Reg I 279:1539-1545.
SRIVASTAVA SR, KESARWANI S, KESHRI G, SINGH MM (2005) Evaluation
of contraceptive activity of a mineral-herbal preparation in SpragueDawley rats. Contraception 72:454-458.
SWIESTRA, E. E. (1968) A comparison of spermatozoa production and
spermatozoa output of Yorkshire and Lacombe boars. J Reprod Fertil
17:459-469
TAKAO T, NANAMIYA W, NAGANO I, ASABA K, KAWABATA K,
HASHIMOTO K (1999) Exposure with the environmental estrogen
bisphenol A disrupts the male reproductive tract in young mice. Life Sci.
65: 2351–2357.
TREMBLAY MS, COPELAND JL, HELDER WV (2004) Effect of training
status and exercise mode on endogenous steroid hormones in men. J
Appl Physiol 96:531-539.
TURNER TT, TUNG KSK, TOMOMASA H, WILSON LW (1997) Acute
Testicular Ischemia Results in Germ Cell-Specific Apoptosis in the Rat.
Biol Reprod 57:1267-1274
Biol Res 44: 243-249, 2011
Effect of the standardized Cimicifuga foetida extract on Hsp 27
expression in the MCF-7 cell line
Maritza C Soler1, Jessica L Molina2, Hugo A Díaz3, Vivian C Pinto4, Yasenka L Barrios5, Kan He6, Marc Roller7,
Caroline R Weinstein-Oppenheimer5
1
Departamento de Química y Bioquímica, Facultad de Ciencias, Universidad de Valparaíso.
Carrera de Tecnología Médica, Facultad de Medicina, Universidad de Valparaíso.
Departamento de Biología y Ciencias Ambientales, Facultad de Ciencias, Universidad de Valparaíso.
4 Carrera de Química y Farmacia, Facultad de Farmacia, Universidad de Valparaíso.
5 Departamento de Bioquímica, Facultad de Farmacia, Universidad de Valparaíso, Valparaíso, Chile.
6 Department of Research and Development, Naturex, Inc. South Hackensack, New Jersey 07606, USA.
7 Naturex SA, Site d’Agroparc BP 1218, 84911 Avignon Cedex 9, France.
2
3
ABSTRACT
Cimicifuga foetida, an Asian Cimicifuga species, has been employed as a cooling and detoxification agent in traditional Chinese medicine
since ancient times. For this herb, two cycloartane triterpene glycosides isolated from the rhizomes have demonstrated cytotoxicity on rat
tumor and human cancer cell lines. Since human Hsp27 is increased in various human cancers and exhibits cytoprotective activity that
affects tumorigenesis and the susceptibility of tumours to cancer treatment, the purpose of this research was to study the expression of
this protein in MCF-7 breast cancer cells. To accomplish this aim, MCF-7 cells were exposed to different concentrations of Cimicifuga foetida
extract showing a reduction in cell number measured by the sulforhodamine assay. In addition, the expression of Hsp-27 mRNA detected by
RT-PCR and Hsp-27 protein detected by immnofluorescence was present in all conditions, except when using the highest concentration of
Cimicifuga foetida extract (2,000 μg /L). We conclude that Hsp 27 expression at 2,000 μg /L Cimicifuga foetida extract is diminished. This is the
first report showing the Hsp-27 expression after exposure to Cimicifuga foetida extract in MCF-7 cells.
Key terms: Cimicifuga foetida, cytotoxicity, Hsp-27, Immunofluorescence, MCF-7 cells, RT-PCR.
INTRODUCTION
There is a great need to improve cancer therapies through the
search for new medicines with anticancer properties. The herbs
used in traditional medicine for cancer treatment are promising
candidates.
The genus Cimicifuga (Ranunculaceae) consists of more
than 18 species whose roots and rhizomes have been widely
used in traditional medicine worldwide (Tian et al., 2007).
Cimicifuga racemosa, (syn. Actea racemosa) a famous North
American species has shown remarkable antitumor activities
in diverse studies. Extracts from black cohosh (C. racemosa)
have been traditionally used by Native Americans for the
treatment of rheumatism, dyspepsia, epilepsy, kidney ailments,
dysmenorrhoea and the relief of pain during menses and
childbirth (Borrelli and Ernst, 2002). The roots and rhizomes
of these plants contain two major classes of compounds,
triterpene glycosides and phenylpropanoids (Einbond et
al., 2008). For this perennial herb, it has been demonstrated
antiproliferative effects, induction of cell cycle arrest and
apoptosis in the breast cancer cell line, MCF-7 (Hostanska et
al., 2004a, b). Several kinds of extracts from rhizomes of C.
racemosa were demonstrated the capabilities of killing estrogen
receptor-positive (MCF-7), estrogen receptor-negative (MDAMB231 and MDA-MB-453) human breast carcinoma and
androgen-sensitive LNCaP human prostate cancer-derived cell
lines (Einbond et al., 2004; Hostanska et al., 2004a, 2005; Jarry
et al., 2005; Seidlova-Wuttke et al., 2006).
C. foetida, an Asian Cimicifuga species, has been
employed as a cooling and detoxification agent in traditional
Chinese medicine since ancient times (Tian et al., 2007).
Recently, two cycloartane triterpene glycosides isolated from
the rhizomes of C. foetida, have demonstrated cytotoxicity on
the Ehrlich ascites carcinoma (EAC) rat tumor cell line and
on SGC7901 and MDA-MB-A231 human cancer cell lines
(Sun et al., 2007).
Heat shock proteins (Hsps), which are molecular
chaperones, appeared overexpressed and implicated in tumor
cell proliferation, metastasis and death. Hsp 27 is a family
member of the small heat shock proteins (sHsps), which
represent an abundant and ubiquitous family of stress proteins
with a monomeric mass ranging between 15 and 30 kDa
(Parcellier et al., 2005). This protein has been associated with
α estrogen receptors (Erα) in female breast carcinomas and
endometrial carcinomas, but not associated with Erα in male
breast carcinomas, cervical uterine carcinomas, hepatocellular
carcinomas and meningiomas, tissues that may express Erα
(Ciocca and Calderwood, 2005).
Since human Hsp27 is increased in various human cancers
and exhibits cytoprotective activity that affects tumorigenesis
and the susceptibility of tumors to cancer treatment (Fortin et
al., 2000), it is interesting to study the expression of this protein
in MCF-7 breast cancer cells.
Hsp27 protein and mRNA levels are induced by heat shock,
β-estradiol and antagonists of the estrogen receptor such as
ICI 164,384, tamoxifen and hidroxi-tamoxifen in estrogen
* Corresponding author: Maritza Clarisa Soler Chaparro; Av. Gran Bretaña 1111, Playa Ancha, Valparaíso, Chile, Email: [email protected], phone: 56-32-2508071 fax: 56-32-2508063
Received: April 14, 2010. In revised form: February 7, 2011. Accepted: March 8, 2011.
244
SOLER ET AL. Biol Res 44, 2011, 243-249
receptor positive MCF-7 cells, while its expression is lower
when exposed to dioxins as 2,3,7,8-tetrachlorodibenzo-p-dioxin
(Edwards et al., 1981; Porter et al., 2001).
Considering that C. foetida contains similar triterpenoids
and also the reported antitumor activity of C. racemosa (Tian et
al., 2007), we performed experiments to detect the expression
of Hsp-27 in MCF-7 cells treated with different concentrations
of C. foetida extract (CFE) and report the results herein.
RNA Isolation
MATERIALS AND METHODS
Total cellular RNA was isolated utilizing the Trizol (Invitrogen)
method. The cells were directly lysed with 1ml TRIZOL reagent
per 1cm2 of cell culture surface, following the manufacturer
instructions. The RNA pellets were air dried and resuspended
in 50-100 μL of diethyl pyrocarbonate treated ultrapure water
(0.01% DEPC, Sigma). The yield and purity of the isolated
RNAs were determined in a NanoDrop spectrophotometer. The
RNA was kept at – 70ºC until used.
Chemicals and Reagents
Primers for the RT-PCR reactions
All chemicals were reagent or molecular biology grade.
β-estradiol stock was 0.2 mM in ethanol, tamoxifen stock was
1 mg/mL in ethanol and C. foetida extract (CFE) stock was 0.1
g/L in phosphate buffer saline (PBS). All stock solutions were
kept at -20ºC.
The primers for the β2 microglobulin RT-PCR reactions were
those published by Laffon et al (2001). The sequences were
5`CCA GCA GAG AAT GGA AAG TC3` for sense and 5`GAT
GCT GCT TAC ATG TCT CC3` for antisense primers.
The primers for the Hsp-27 RT-PCR reactions were those
published by Cubano and Lewis (2001). The sequences were
5`TGT CCC TGG ATG TCA ACC ACT TC3` for sense and
5`AAA AGA ACA CAC AGG TGG CGG3` for antisense
primers.
Plant materials
Commercial dried powder of C. foetida was obtained from
Stryka Botanics (lot BC031021) and the species qualification
was performed using high performance liquid chromatography
(HPLC) with evaporative light scattering detection (ELSD) for
fingerprint analysis.
Cell culture
The human breast adenocarcinoma cell line MCF-7 (American
type culture collection, Rockville, MD, USA) was grown
in DMEM (Invitrogen, Carlsbad, CA, USA) supplemented
with 10% fetal bovine serum (FBS, PAA Laboratories GmbH,
Linz, Austria), 2mM glutamine, 10U/L penicillin and 100μg/
mL streptomycin. The cells were cultured in a humidified
incubator with a 5% CO2 atmosphere.
Phenol red free media with 10% activated charcoaladsorbed FBS to remove steroids, was used in all experiments
to expose the MCF-7 cells to β-estradiol, tamoxifen and CFE.
This media was also used as the control condition in all the
experiments.
Sulforhodamide assay
MCF-7 cells were trypsinized and 5,000 cells/well seeded
in 96-well plates. Selected dilutions of CFE, tamoxifen and
β-estradiol, were then added 24 hours after cell seeding
and cells were incubated for an additional two days. Each
treatment was performed in triplicate. After this, the treatmentcontaining media was removed and fresh media was added to
allow the remaining viable cells to proliferate. One day later,
the cells were fixed by precipitation with 60% tricloroacetic
acid for one hour. After extensive washing with water, the cells
were stained with 0.4% sulforhodamine in 1% acetic acid, for
10 minutes and extensively washed with 1% acetic acid, then
the plates were air-dried and the dye solubilized in 10mM
Trizma Base. The optical density was read in a Merckscan
(Anthos Labtec Instruments, Salzburg, Austria) plate reader at
540 nm. Survival was calculated by subtraction of the optical
densities of the control condition from the experimental
condition (Skehan et al., 1990). Negative values mean death or
proliferation inhibition.
Reverse transcriptase reaction
The reaction was performed using 0.5 μg of primer for 1.0 μg
RNA and following the directions of the manufacturer for
AMV reverse transcriptase (Promega).
Polymerase Chain Reaction
In the same reaction tube used for the cDNA synthesis, the
following reaction mixture was added: 4.6μL MgCl2 (25 mM),
4μL PCR buffer 10X (Promega), 6.4μL dNTPs mixture (1.25 mM
each), 4μL of sense and 4μL anti-sense primers (10 μM, each),
0.5μL Taq DNA polymerase (2,5 U. Promega) and ultrapure/
DEPC water to complete 40μL. For Hsp-27 its specific primers
were used and the following program in a Thermo PXE 0.5
Thermocycler: an initial 3 minutes step at 95ºC, 30 cycles of
1.5 minutes at 95ºC, 1 minute at 56ºC, 2 minutes at 72ºC and
a final step of 5 minutes at 72ºC. For β2 microglobulin, the
same reaction mixture was used with its specific primers and
the following program in a Thermo PXE 0.5 Thermocycler: an
initial 5 minute step at 95ºC, 30 cycles of 45 seconds at 95ºC, 35
seconds at 56ºC, 1 minute at 72ºC and a final step of 1minute at
72ºC.
Detection of Hsp-27 by Immunofluorescence
MCF-7 cells were grown on silanized slides immersed in cell
culture medium inside Petri plates. Before reaching confluence,
the cells were exposed for 24 hours to phenol red free media
with 10% activated charcoal adsorbed FBS. Then, the cells were
grown for 48 hours in cell culture media containing either CFE
(2,000, 200, 20 or 2 μg/L), or βestradiol (325 pM), or tamoxifen
(240 ng/mL) or phenol red free media 10% adsorbed FBS. To
fix the cells on the slides, 4% p-formaldehide in PBS was used
for twenty minutes at 4ºC.
Anti-Hsp-27 c-20 (sc-1048 goat polyclonal antibody raised
against Hsp-27 of human origin, Santa Cruz Biotechnology,
Inc.) in a 1:50 dilution in PBS was utilized as the primary
antibody.
SOLER ET AL. Biol Res 44, 2011, 243-249
245
As secondary antibody, donkey anti-goat IgG-FITC (sc
2024, Santa Cruz Biotechnology, Inc) was used in a 1:100
dilution in PBS. The mounting medium was VectashieldDapi (4,6-diamidino-2-phenylindole) to stain the nuclei
(UltraCruzTM Mounting Medium: sc 24941). All samples were
visualized with an Olympus BX 51 Fluorescence microscope
provided with a U-MWU2 Olympus filter. Most of the
images were taken at a magnification of 40X, except for the
control and CFE 200 μg/L, to privilege a better image of the
immunofluorescence.
goat IgG-AP (sc-2022 linked to alkaline phosphatase, Santa
Cruz Biotechnology, Inc.) (1:10,000 in blocking solution). After
three five-minute washes with TBST, an alkaline phosphatase
reaction was performed utilizing the Western BlueR Stabilized
substrate for Alkaline Phosphatase (Promega). The blots were
scanned and subjected to densitometry analysis. The signals
for Hsp27 were normalized against the actin signal for each
condition.
Western blot Analysis
Fingerprinting of the Cimicifuga foetida extract
Pre-confluent cells were lysed in lysis buffer (20 mM Tris, pH
7,5; 5 mM EDTA, 1% Triton X-100) containing HaltR Protease
Inhibitor Cocktail Kit (Pierce, Rockford, Il, USA). The lysate
equivalent to 20 μg (Hsp27) or 40 μg (actin) of protein was
electrophoresed in a 10% poliacrilamide gel. The proteins were
electrotransferred to a PVDF membrane, using an electroblot
semi-dry apparatus (BIO RAD). The membranes were blocked
overnight with blocking solution (2% BSA in TBST: 25 mM Tris,
pH 8.0; 125 mM NaCl, 0.1% Tween 20).The membranes were
then incubated for 2 hours with the primary antibody, antiHsp27 c-20 (sc-1048 goat polyclonal antibody raised against
Hsp-27 of human origin, Santa Cruz Biotechnology, Inc.)
(Fig. 5A) or anti-actin c-11 (sc-1615 goat policlonal IgG, Santa
Cruz Biotechnology, Inc.)(Fig. 5A), diluted 1:5,000 in blocking
solution and after three five-minute washes with TBST, they
were incubated for 2 hours in secondary antibody donkey anti-
The extract was analyzed by HPLC with ELSD detector. The
chromatogram obtained shows a typical rhizomes and roots
of C. foetida profile (Fig. 1). The analysis confirmed by LC/MS
detected cimifugin and cimifugin glycoside, which are marks
of Asian Cimicifuga species (He et al., 2006).
RESULTS
Cell growth
Using the sulforhodamine assay, the effect of the CFE (Fig.
2A) on cell growth was assessed and compared to the known
effect of the SERM tamoxifen (Fig. 2B). The results of this assay
are presented as dot graphics, in which each dot represents
the difference between the OD of the cells grown under the
experimental condition and cells grown in control cell culture.
Every dot under the zero line represents cell death. The cell
number progressively diminishes at 24, 48 and 72 hours of
Figure 1: Fingerprinting of the Cimicifuga foetida extract. HPLC-ELSD fingerprint chromatogram of CFE showing a typical C foetida profile
(top). LC-MS analysis confirms this Asian species by detection of cimifugin and its glucoside (bottom).
246
SOLER ET AL. Biol Res 44, 2011, 243-249
culture in the presence of 2,000 μg/L of the CFE (Fig. 2A). This
is comparable to the effect observed for tamoxifen (480ng/mL)
on the same experimental setting (Fig. 2B).
Hsp 27
Hsp 27 was detected through RT-PCR for mRNA and by
immunofluorescence and Western blotting for protein
detection. RT-PCR analysis revealed that the message for
Hsp27 did not change when MCF-7 cells were grown in either
control media (Fig. 3A, lane 1), CFE 2, 20, 200 μg/L (Fig. 3A,
lanes 2, 3 and 4), tamoxifen (Fig. 3A, lane 7), or β-estradiol
(Fig. 3A, lane 8). However, when MCF-7 cells were grown in
the presence of 2,000 μg/L of CFE, the message for Hsp 27
was not detectable (Fig. 3A, lane 6). The RT-PCR analysis for
the constitutive gene β2 microglobulin for each cell culture
condition is shown in Figure 3B.
Interestingly, the immunofluorescence analysis showed that
the expression of Hsp27 at the protein level was undetectable
only when the cells were grown on CFE 2,000 μg/L (Fig. 4).
Western blot analysis showed protein expression for cells
cultivated in the presence of all concentrations of CFE (Fig.
5A). Densitometry analysis showed a modest reduction in
Hsp27 expression as compared to control or β-estradiol grown
cells (Fig. 5B).
DISCUSSION
We first evaluated the activity of the C. foetida extract (CFE)
using a proliferation assay and the result showed a reduction
in MCF-7 cell number (Fig. 2). This result is in agreement with
a previous report using black cohosh extracts that displayed
growth inhibitory activity in MCF-7 (Gaube et al 2007) and in
MDA-MB-453 human breast cancer cells (Einbond et al 2008).
Figure 2: Cimicifuga foetida cytoxicity on MCF-7 cells. Sulforhodamine assay for MCF-7 cells grown in cell culture media containing
tamoxifen (Panel A) or Cimicifuga foetida extract (Panel B) for different time periods. Each dot represents the difference between the
absorbance registered for cells grown under experimental conditions and control conditions for an individual replicate.
A
B
Figure 3: RT-PCR for Hsp-27 and β2-microglobulin on MCF-7 cells. RT-PCR in MCF-7 cells grown on the following conditions. Channel 1:
Control, Channel 2: CFE 2 µg/L, Channel 3: CFE 20 µg/L, Channel 4: CFE 200 µg/L, Channel 5: DNA ladder (100 bp), Channel 6: CFE 2000
µg/L, Channel 7: Tamoxifen 480 ng/mL, Channel 8: β Estradiol 315 pM. Panel A: amplicons for Hsp27 (400 bp) and Panel B: amplicons for
β2-microglobulin (267 bp), used as constitutive control.
SOLER ET AL. Biol Res 44, 2011, 243-249
247
Control FITC 20X, 20 Seg
Control DAPI 20X, 450Mseg
CFE 200μg/L FITC 20X, 20Seg
CFE 200μg/L DAPI 20X, 450Mseg
CFE 2μg/L FITC 40X, 20Seg
CFE 2μg/L DAPI 40X, 20Seg
CFE 2000μg/L FITC 40X, 20Seg
CFE 2000μg/L DAPI 40X, 450Mseg
CFE 20μg/L FITC 40X, 20Seg
Tamox. 480ng/ml FITC 40X, 20Seg
CFE 20μg/L DAPI 40X, 400Mseg
F i g u r e 4 : H s p 27 d e t e c t i o n b y i m m u n o f l u o r e s c e n c e .
Immunofluorescence for MCF-7 cells grown in the following
conditions: control media, CFE 2 µg/L, CFE 20 µg/L, CFE 200 µg/L,
CFE 2000 µg/L, β-estradiol 315 pM and tamoxifen 480 ng/mL. The
left column represents immunofluorescence utilizing a first antibody
against Hsp-27 that was 1:50 and a secondary anti-goat-FITC
antibody utilized at 1:100 dilutions. The right column represents the
fluorescence of nuclei stained with DAPI for all conditions.
A
ȕestradiol 315pM FITC 40X, 20Seg
Tamox. 480ng/ml DAPI 40X, 450Mseg
ȕestradiol 315pM DAPI 40X, 450Mseg
B
Hsp 27
Actin
Figure 5: Hsp 27 detection by immunoblot. Panel A. Immunoblot for MCF-7 cells grown in the following conditions: channel 1: control
media, channel 2: β-estradiol 315 pM, channel 3: tamoxifen 480 ng/mL, channel 4: CFE 2 µg/L, channel 5: CFE 20 µg/L, channel 6: CFE
200 µg/L, channel 7: CFE 2000 µg/L. Anti-hsp-27 antibody was 1: 5,000 and anti-actin antibody was 1:5,000. In both cases the secondary
antibody was donkey anti goat-AP 1: 10,000. Panel B. Histogram for the densitometry analysis of the electrophoretic bands. Results are
shown as the rate of Hsp27 over actin signals.
248
SOLER ET AL. Biol Res 44, 2011, 243-249
In addition, we report for the first time the study of
Hsp-27 expression after MCF-7 cells were exposed to
CFE. The stressful conditions characteristic of the tumors’
microenvironment facilitate the expression of heat shock
proteins. Increased expression of Hsp-27, proportional to the
levels of estrogen receptors, has been detected in breast and
ovarian cancer cell lines and primary tumors (Langdon et al.,
1995, Porter et al., 1996). Moreover, Hsp-27 has been strongly
associated with tumor aggressiveness due to several effects,
such as apoptosis inhibition, immunosuppressant activity
and drug resistance (Rane et al., 2003, Uozaki et al., 1997,
Lee et al., 2007). In this study, MCF-7 cells were exposed to
different concentrations of CFE and to other stimuli including
β-estradiol and tamoxifen. When MCF-7 cells were stimulated
with β-estradiol at 315 pM, which is within the physiological
range for a premenopausal woman, the expressions of Hsp-27
mRNA and protein were detected by RT-PCR (Fig. 3, lane 8)
and protein immnofluorescence (Fig. 4), as well as Western
blot (Fig. 5A, lane 2), respectively. These results are consistent
and expected according to the literature (Edwards et al., 1981,
Porter et al., 1996).
It has been reported that exposure of MCF-7 cells to
tamoxifen resulted in decreasing cell proliferation and cell
cycle arrest in G0/G1 and G2 phases (Ichikawa et al, 2008). Our
results showed that it did not inhibit the Hsp-27 mRNA (Fig.
3, channel 7) or protein expression (Fig.4, Fig.5A) after treating
MCF-7 cells with tamoxifen. This result was not expected, since
tamoxifen is a known estrogen receptor antagonist in breast
tissue. However, it is in agreement with previous research
showing that certain antagonists of the estrogen receptor
had transcriptional activity on the Hsp-27 gene (Porter el
al, 2001). Some control experiments were performed with
hydroxy-tamoxifen, a known in vivo metabolite of tamoxifen
and showed no differences on Hsp-27 expression (result not
shown).
Our results, upon stimulation using low concentrations
of CFE (2, 20, 200 μg / L), showed Hsp-27 expression in
both Hsp-27 mRNA (Fig. 3A, channels 2, 3, 4) and protein
(Fig. 4, Fig.5A). It is suggested that the cytoplasmatic and
perinuclear immunofluorescence signal in these cells could
be explained by phosphorylated Hsp27 binding to denatured
F-actin (Pivovarova et al., 2007) in these parts of the cell upon
the stress induced by CFE. Similar results were obtained
by Einbond et al (2008), but using actein. Actein has been
reported producing stress and also inducing apoptosis in
MCF-7 and MDA-MB45 cells. The mechanism of action used
by the Hsp27 to protect the cytoskeleton, and therefore tumor
cell survival, is still not sufficiently understood (Pivovarova et
al., 2007).
With a higher concentration of CFE (2,000 μg /L), similar to
that used in MCF-7 cells stimulated with C. racemosa (Zierau et
al., 2002), no Hsp-27 mRNA or protein expression was detected
by RT-PCR (Fig. 3A, channel 6), or protein immunofluorescence
(Fig. 4). We speculate that at 2,000 μg/L of CFE, Hsp-27
expression might be reduced, as well as its cytoprotective
effect on MCF-7 cells. However, Western blot analysis using
whole cell lysates showed protein expression at this CFE
concentration (Fig. 5A). Previous publications have described
the possibility that Hsp-27 translocates to the nucleus in some
extension, which is in agreement with reports of Ciocca et al
(1998) in clinical samples. More experiments will be needed to
elucidate these interesting results, especially because the Hsp
family and their transcription factors have been considered
as a new gateway for cancer therapy since they are required
for cell survival during tumor progression and metastasis
(Volloch and Sherman 1999, Hoang et al 2000, Nylandsted
et al 2000a,b, Jones et al 2004). Hsp 27 can be the target of
antisense oligonucleotide therapies, which has resulted in
increased apoptosis in human prostate cancer cells (So et al
2005) and also enhanced apoptosis and delayed progression of
prostate tumors (Rocchi et al 2004). This is a promising result
considering the association between tumor aggressiveness and
Hsp-27 expression, which underscores the potential of the CFE
as a new source of antineoplasic molecules. For this reason,
it is also necessary to determine which CFE components are
mediating its effect on Hsp-27. These might be the ones that
are exclusive for Cimicifuga foetida, such as cimifugoside H-1,
cimicifugin or cimicifugin glucoside (He et al., 2006). We
support this statement in unpublished results using Cimicifuga
racemosa, which showed a different dose response effect on
Hsp-27 protein expression.
ACKNOWLEDGEMENTS
This work was supported by grants from the Dirección de
Investigación de la Universidad de Valparaíso, Chile (DIPUV
13/04 and 05/06).
REFERENCES
BORRELLI F, ERNST E (2002) Cimicifuga racemosa: a systematic review of its
clinical efficacy. Eur J Clin Pharmacol 58: 235-241.
CIOCCA DR, GREEN S, ELLEDGE RM, CLARK GM, PUGH R, RAVDIN P,
LEW D, MARTINO S, OSBORNE CK (1998) Heat shock proteins Hsp27
and Hsp70: Lack of correlation with response to tamoxifen and clinical
course of disease in estrogen receptor-positive metastatic breast cancer
(A southwest oncology group study). Clin Cancer Res 5: 1263-1266.
CIOCCA DR, CALDERWOOD SK (2005) Heat shock proteins in cancer:
diagnostic, prognostic, predictive, and treatment implications. Cell
Stress Chaperones 10: 86–103.
CUBANO L, LEWIS ML (2001) Effect of vibrational stress and spaceflight
on regulation of heat shock proteins hsp70 and hsp27 in human
lymphocytes (Jurkat) J Leukocyte Biology 69: 755-761.
EDWARDS DP, ADAMS DJ, MCGUIRE WL (1981) Estradiol stimulates
synthesis of a major intracellular protein in a human breast cancer cell
line (MCF-7). Breast Cancer Res Treat 1: 209-223.
EINBOND LS, SHIMIZU M, XIAO MD, NUNTANAKORN P, LIM JT, SUZUI
M, SETER C, PERTEL T, KENNELLY EJ, KRONENBERG F, WEINSTEIN
IB (2004) Growth inhibitory activity of extracts and purified components
of black cohosh on human breast cancer cells. Breast Cancer Res Treat
83: 221–231.
EINBOND LS, WEN-CAI Y, HE K, WU H, CRUZ E, ROLLER M,
KRONENBERG F (2008) Growth inhibitory activity of extracts and
compounds from Cimicifuga species on human breast cancer cells.
Phytomedicine 15: 504–511.
FORTIN A, RAYBAUD-DIOGENE H, TETU B, DESCHENES R, HOUT J,
LANDRY J (2000) Overexpression of the 27 kDa heat shock protein is
associated with thermoresistance and chemoresistance but not with
radioresistance. Int J Radiat Oncol Biol Phys 46:1259-1266.
GAUBE F, WOLFL S, PUSCH L, KROLL TC, HAMBURGER M (2007) Gene
expression profiling reveals effects of Cimicifuga racemosa (L.) NUTT.
(black cohosh) on the estrogen receptor positive human breast cancer
cell line MCF-7. BMC Pharmacol 7: 11- 29.
HE K, PAULI GF, ZHENG B, WANG H, BAI N, PENG T, ROLLER M,
ZHENG Q (2006) Cimicifuga species identification by high performance
liquid chromatography-photodiode array/mass spectrometric/
evaporative light scattering detection for quality control of black cohosh
products. J Chromatogr A 1112: 241-254.
HOANG AT, HUANG J, RUDRA-GANGULY N, ZHENG J, POWELL WC,
RABINDRAN SK, WU C, ROY-BURMAN P (2000) A novel association
between the human heat shock transcription factor 1 (HSF1) and
prostate adenocarcinoma. Am J Pathol 156: 857-864.
SOLER ET AL. Biol Res 44, 2011, 243-249
HOSTANSKA K, NISSLEIN T, FREUDENSTEIN J, REICHLING J, SALLER R
(2004a) Cimicifuga racemosa extract inhibits proliferation of estrogens
receptor-positive and negative human breast carcinoma cell lines by
induction of apoptosis. Breast Cancer Res Treat 84: 151–160.
HOSTANSKA K, NISSLEIN T, FREUDENSTEIN J, REICHLING J, SALLER
R (2004b) Evaluation of cell death caused by triterpene glycosides and
phenolic substances from cimicifuga racemosa extract in human MCF-7
breast cancer cells. Biol Pharm Bull 27: 1970–1975.
HOSTANSKA K, NISSLEIN T, FREUDENSTEIN J, REICHLING J, SALLER
R (2005) Apoptosis of human prostate androgen-dependent and
-independent carcinoma cells induced by an isopropanolic extract of
black cohosh involves degradation of cytokeratin (CK) 18. Anticancer
Res 25: 139–147.
ICHIKAWA A, ANDO J, SUDA K (2008) G1 arrest and expression of cyclindependent kinase inhibitors in tamoxifen-treated MCF-7 human breast
cancer cells. Hum Cell 21: 28-37.
JARRY H, THELEN P, CHRISTOFFEL V, SPENGLER B, WUTTKE W (2005)
Cimicifuga racemosa extract BNO 1055 inhibits proliferation of the human
prostate cancer cell line LNCaP. Phytomedicine 12: 178–182.
JONES EL, ZHAO MJ, STEVENSON MA, CALDERWOOD SK (2004) The 70
kilodalton heat shock protein is an inhibitor of apoptosis in cancer. Int J
Hyperthermia 20: 835-849.
LAFFON B, PÁSARO E, MÉNDEZ J (2001) Effects of styrene-7,8-oxide over
p53, p21, bcl-2 and bax expression in human lymphocyte cultures.
Mutagenesis 16: 127-132.
LANGDON SP, RABIASZ GJ, HIRST GL, KING JB, HAWKINS RA, SMYTH
JF, MILLER WR (1995) Expression of the heat shock protein Hsp27 in
human ovarian cancer. Clin Cancer Res 1: 1603-1609.
LEE JH, SUN D, CHO KJ, KIM MS, HONG MH, KIM IK, LEE JS, LEE JH
(2007) Overexpression of human 27kDa heat shock protein in laryngeal
cancer cells confers chemoresistence associated with cell growth delay. J
Cancer Res Clin Oncol 133: 37-46.
NYLANDSTED J, BRAND K, JAATTELA M (2000a) Heat shock protein 70 is
required for the survival of cancer cells. Ann N Y Acad Sci 926: 122-125.
NYLANDSTED J, RHODE M, BRAND K, BASTHOLM L, ELLING F,
JAATTELA M (2000b) Selective depletion of heat shock protein 70
(Hsp70) activates a tumor- specific death program that is independent
of caspases and bypasses Bcl-2. Proc Natl Acad Sci USA 97: 7871-7876.
PARCELLIER A, SCHMITT E, BRUNET M, HAMMANN A, SOLARY E,
GARRIDO C (2005) Small heat shock proteins Hsp27 and alpha Bcrystallin: cytoprotective and oncogenic functions. Antioxid Redox
Signal 7: 404-413.
PIVOVAROVA AV, CHEBOTAREVA NA, CHERNIK IS, GUSEV NB,
LEVITSKY DI (2007) Small heat shock protein Hsp27 prevents heat-
249
induced aggregation of F-actin by forming soluble complexes with
denatured actin. Febs Journal 274: 5937-5948.
PORTER W, WANG F, WANG W, DUAN R, SAFE S (1996) Role of estrogen
receptor/Sp1 complexes in estrogen-induced heat shock protein 27 gene
expression. Mol Endocrinol 10: 1371-1378.
PORTER W, WANG F, WANG W, DUAN R, QIN C, CASTRO-RIVERA E,
KIM K, SAFE S (2001) Transcriptional activation of heat shock protein 27
gene expression by 17 β-estradiol and modulation by antiestrogens and
aryl hydrocarbon receptor agonists. J Mol Endocrinol 26: 31-42.
RANE MJ, PAN Y, SINGH S, POWELL DW, WU R, CUMMINS T, CHEN Q,
MCLEISH KR, KLEIN JB (2003) Heat shock protein 27 controls apoptosis
by regulating Akt activation. J Biol Chem 278: 27828–27835.
ROCCHI P, SO A, KOJIMA S, SIGNAEVSKY M, BERALDI E, FAZLI
L, HURTADO-COLL A, YAMANAKA K, GLEAVE M (2004) Heat
shock protein 27 increases after androgen ablation and plays a
cytoprotective role in hormone-refractory prostate cancer. Cancer Res
64: 6595-6602.
SEIDLOVA-WUTTKE D, THELEN P, WUTTKE W (2006) Inhibitory effects
of a black cohosh (Cimicifuga racemosa) extract on prostate cancer. Planta
Medica 72: 521–526.
SKEHAN P, STORENG R, SCUDIERO D, MONKS A, MCMAHON J,
VISTICA D, WARREN JT, BOKESCH H, KENNEY S, BOYD MR (1990)
New colorimetric cytotoxity assay for anticancer-drug screening. J Natl
Cancer Inst 82: 1107-1112.
SO A, ROCCHI P, GLEAVE M (2005) Antisense oligonucleotide therapy in
the management of bladder cancer. Current Opinion in Urology 15: 320327.
SUN LR, QING C, ZHANG YL, JIA SY, LI ZR, PEI SJ, QIU MH, GROSS
ML, QIU SX (2007) Cimicifoetisides A and B, two cytotoxic cycloartane
triterpenoid glycosides from the rhizomes of Cimicifuga foetida inhibit
proliferation of cancer cells. Beilstein J Org Chem 3: 3-8.
TIAN Z, PAN RL, CHANG Q, SI J, XIAO PG, WU E (2007) Cimicifuga foetida
extract inhibits proliferation of hepatocellular cells via induction of cell
cycle arrest and apoptosis. J Ethnopharmacol 114: 227–233.
UOZAKI H, HORIUCHI H, ISHIDA T, IIJIMA T, IMAMURA T,
MACHINAMI R (1997) Overexpression of resistance-related proteins
(metallothioneins, glutathione-S-transferase pi, heat shock protein 27
and lung resistance-related protein) in osteosarcoma. Relationship with
poor prognosis. Cancer 79: 2336-2344.
VOLLOCH VZ, SHERMAN MY (1999) Oncogenic potential of Hsp 72.
Oncogene 18: 3648-3651.
ZIERAU O, BODINET C, KOLBA S, WULF M, VOLLMER G (2002)
Antiestrogenic activities of Cimicifuga racemosa extracts. J Steroid
Biochem Mol Biol 80:125-130.
Biol Res 44: 251-257, 2011
Insulin signaling proteins in pancreatic islets of insulin-resistant rats
induced by glucocorticoid
Flávia MM De Paula,1 Antonio C Boschero,1 Everardo M Carneiro,1 José R Bosqueiro,2 and Alex Rafacho1,2,3
1
2
3
Department of Anatomy, Cell Biology and Physiology and Biophysics, Institute of Biology, Universidade Estadual de Campinas - UNICAMP, Campinas, SP, Brazil and
Department of Physical Education, School of Sciences, Universidade Estadual Paulista -UNESP, Bauru, SP, Brazil
Department of Physiological Sciences, Center of Biological Sciences, Universidade Federal de Santa Catarina - UFSC, Florianópolis, SC, Brazil
ABSTRACT
Chronic administration of glucocorticoids induces insulin resistance that is compensated by an increase in β-cell function and mass. Since
insulin signaling is involved in the control of β-cell function and mass, we investigated the content of insulin pathway proteins in pancreatic
islets. Rats were made insulin resistant by daily administration of dexamethasone (1mg/kg, b.w., i.p.) for 5 consecutive days (DEX), whilst
control rats received saline (CTL). Circulating insulin and insulin released from isolated islets were measured by radioimmunoassay
whereas the content of proteins was analyzed by Western blotting. DEX rats were hyperinsulinemic and exhibited augmented insulin
secretion in response to glucose (P < 0.01). The IRα-subunit, IRS-1, Shc, AKT, p-p70S6K, ERK1/2, p-ERK1/2, and glucocorticoid receptor
protein levels were similar between DEX and CTL islets. However, the IRβ-subunit, p-IRβ-subunit, IRS-2, PI3-K, p-AKT and p70S6K protein
contents were increased in DEX islets (P < 0.05). We conclude that IRS-2 may have a major role, among the immediate substrates of the
insulin receptor, to link activated receptors to downstream signaling components related to islet function and growth in this insulin-resistant
rat model.
Key terms: dexamethasone, glucocorticoid, insulin resistance, insulin signaling, pancreatic islets.
INTRODUCTION
Numerous compounds with glucocorticoid activity have
been synthesized. Among them, dexamethasone has a 50-fold
greater affinity for the glucocorticoid receptor, relative to
cortisol. In clinical practice, dexamethasone administration is
indicated for the suppression of the inflammation (Schäcke et
al., 2002; Czock et al., 2005), and the alleviation of the emesis
associated with chemotherapy (Maranzano et al., 2005).
Administered in excess, dexamethasone can induce adverse
effects such as peripheral insulin resistance (Stojanovska
et al., 1990; Binnert et al., 2004; Korach-André et al., 2005).
Based on this information, dexamethasone is used as a tool
for the induction of experimental insulin resistance in rodents
(Stojanovska et al., 1990; Korach-André et al., 2005; Burén et al.,
2008; Rafacho et al. 2008a; Rafacho et al., 2010a) and transitory
insulin resistance in humans (Beard et al., 1984; Nicod et al.,
2003; Binnert et al., 2004) and in rodents (Rafacho et al., 2010b).
Dexamethasone-induced insulin resistance is mediated by
direct impairment of insulin action both in hepatic and extrahepatic tissues such as muscle and adipose tissue (Saad et al.,
1993; Nicod et al., 2003; Ruzzin et al., 2005; Burén et al., 2008).
It has been proposed that hyperinsulinemia in dexamethasonetreated individuals is a compensatory mechanism of the
endocrine pancreas to counteract insulin resistance (Karlsson
et al., 2001; Nicod et al., 2003; Rafacho et al., 2010a). The
mechanisms that support the increased circulating insulin
levels under insulin resistance include the augment in islet
response to metabolic and nonmetabolic signals, especially
glucose (Karlsson et al., 2001; Rafacho et al., 2008a) and an
increase in β-cell proliferation and mass (Rafacho et al., 2008b;
Rafacho et al., 2009).
Insulin signaling proteins participate in the control of
β-cell function and growth (Kulkarni et al., 1999a; Kulkarni et
al., 1999b; Otani et al., 2004; Cantley et al., 2007). The insulin
pathway includes the insulin receptor that may be constituted
of insulin receptor type A (IR-A) and/or insulin receptor type
B (IR-B) and the insulin-like growth factor-1 receptor (IGF1R). The receptors are tetrameric structures composed of ‘half
receptors’, each of which in turn comprises an α-subunit,
which is predominately an extracellular binding domain, and
a β-subunit which is predominately an intracellular domain
that has tyrosine kinase activity regulated by ligand binding
(Pollak, 2008, Leibiger et al., 2010). The immediate insulin
receptor substrates, also known as the adapter proteins,
include the insulin receptor substrate (IRS) proteins IRS-1to
IRS-6, growth factor receptor binding protein 2 (Grb-2), and
some lower-molecular-weight substrates such as Shc, p60,
and Gab1 (reviewed in Wirkamäki et al., 1999; Leibiger et al.,
2008). The adapter proteins link the activated insulin receptors
to downstream effector proteins such as phosphatidylinositol
3-kinase (PI3-K) isoforms, isoforms of protein kinase B
(PKB, also called AKT), the mammalian target of rapamycin
(mTOR), the S6 ribosomal protein kinase (p70 S6K) as well
as the phospholipase Cγ (PLCγ) (all these effectors form the
metabolic branch of insulin signaling). The receptor substrates
may also be linked to the proteins of the mitogen-activated
protein kinase (MAPK) pathway, such as extracellularregulated-signal kinase-1/2 (ERK1/2), which is activated by
the proto-oncogenes Ras and Raf (mitogenic branch of insulin
signaling) (reviewed in Wirkamäki et al., 1999; Leibiger et al.,
2008).
The aim of this study was to investigate the protein
content of some important components of the insulin
* Corresponding Author: Dr. A. Rafacho. Departamento de Ciências Fisiológicas, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina (UFSC), 88040-900, Florianópolis,
SC, Brazil. E-mail address: [email protected]
Received: April 19, 2010. In revised form: January 18, 2011. Accepted: January 21, 2011.
252
PAULA ET AL. Biol Res 44, 2011, 251-257
pathway in pancreatic islets from insulin-resistant rats
induced by dexamethasone. We found that IRS-2, but not
IRS-1 and Shc protein contents are higher in islets from
dexamethasone-treated rats than in control islets. This increase
was accompanied by an augmentation in the PI3-K and p-AKT,
but not in p-p70S6K and p-ERK1/2 protein levels.
METHODS
Materials
D e x a m e t h a s o n e p h o s p h a t e ( D e c a d ro n ®) w a s f ro m
Aché (Campinas, SP, Brazil). The reagents used in the
insulin secretion protocol, radioimmunoassay (RIA) and
immunobloting were from Mallinckrodt Baker, Inc. (Paris,
Kentucky, France), Merck (Darmstadt, Germany), Sigma (St.
Louis, MO, USA) and Bio-Rad (Hercules, CA, USA). The
125I-labeled insulin (human recombinant) for RIA assay was
purchased from Amersham Biosciences (Little Chalfont,
Buckinghamshire, UK). Anti insulin, anti IRα-subunit,
anti IRβ-subunit, anti phosphorylated IRβ-subunit (Tyr
1162/1163) (p-IRβ-subunit) anti IRS-1, anti Shc, anti AKT,
anti phosphorylated AKT (Thr 308) (p-AKT), anti p70 S6K,
anti phosphorylated ERK1/2 (Tyr 204) (p-ERK1/2), anti
glucocorticoid receptor α/β (GRα/β), and anti α-tubulin
antibodies were from Santa Cruz Biotechnology (Santa
Cruz, CA, USA). Anti IRS-2, and anti phosphorylated p70S6K
(p-p70S6K) was from Cell Signaling Technology (Beverly, MA,
USA). Anti PI3-K, and anti ERK1/2 were from Upstate (Lake
Placid, NY, USA).
Animals
Experiments were performed on two groups of 10 males
Wistar rats (3 months old). The rats were obtained from
the University of Campinas Animal Breeding Center and
were kept at 24ºC on a 12 h light/dark cycle (light period
06:00 – 18:00). The rats had access to food and water ad
lib. The experiments with animals were approved by the
institutional Campinas State University Committee for
Ethics in Animal Experimentation and conform to the Guide
for the Care and Use of Laboratory Animals published by
the US National Institutes of Health (NIH publication No.
85-23 revised 1996).
Dexamethasone treatment
A group of rats received daily i.p. injection of 1mg/kg b.w.
dexamethasone (DEX rats) or saline - NaCl 0.9% - (CTL rats),
between 7:30 – 8:30 h, for 5 consecutive days (Rafacho et al.,
2008a).
Blood glucose and serum insulin measurement
Blood was collected from the tail tip of fed rats and blood
glucose levels were measured with a glucometer (“one touch”
- Johnson & Johnson). Immediately afterwards, animals were
sacrificed (exposure to CO2 followed by decapitation) the trunk
blood was collected. The serum, obtained by centrifugation,
was used to measure the insulin content by RIA, utilizing
Guinea-pig anti-rat insulin antibody and rat insulin as
standard.
Isolation of islet and static secretion protocols
Islets were isolated by collagenase digestion of the pancreas.
Insulin content and secretion were measured as described in
detail previously (Giozzet et al., 2008; Rafacho et al., 2008a).
Briefly, after islet isolation, groups of five islets were first
incubated for 1 h at 37 ºC in 1 mL Krebs-bicarbonate buffer
solution containing 5.6mmol/L glucose, supplemented
with 0.5% of bovine serum albumin and equilibrated with a
mixture of 95% O2: 5% CO2, pH 7.4. The medium was then
replaced by 1 mL fresh buffer solution containing 5.6 or 11.1
mmol/L glucose and incubated for a further 1 h period. At
the end of the incubation, the supernatant was collected and
appropriately stored at –20ºC for subsequent measurement of
insulin content by RIA, as described above.
Protein extraction and immunoblotting
Protein extraction and immunoblotting were carried out as
previously reported (Rafacho et al., 2008b, Rafacho et al.,
2010b). Pools of isolated islets were homogenized in icecold cell lysis buffer (Cell Signaling, MA, USA). Protein
concentration from total cell lysate was determined by the
Bradford method, according to the manufacturer (Bio-Rad, CA,
USA). Protein obtained from islets (100 μg) was used for each
experiment. Immunoblotting experiments were performed at
least 6 times using different samples (each sample consisting
of islets obtained from one rat). After 2h blocking in 5% nonfat milk solution at room temperature, immunodetection was
performed following an incubation with rabbit polyclonal IRαsubunit (1:1000 dilution), rabbit polyclonal IRβ-subunit (1:1000
dilution), goat polyclonal p-IRβ-subunit (1:500 dilution), rabbit
polyclonal IRS-1 (1:750 dilution), rabbit polyclonal IRS-2
(1:500 dilution), rabbit polyclonal Shc (1:1000 dilution), mouse
monoclonal PI3-K (1:1000 dilution), rabbit polyclonal AKT
(1:1000 dilution), rabbit polyclonal p-AKT (1:500 dilution),
mouse monoclonal p70S6K (1:1000 dilution), rabbit polyclonal
p-p70S6K (1:500 dilution), mouse monoclonal GRα/β (1:1000
dilution), rabbit polyclonal ERK1/2 (1:5000 dilution), mouse
monoclonal p-ERK1/2 (1:500 dilution) and mouse monoclonal
α-tubulin (1:1000 dilution) antibody. Membranes were then
exposed to specific secondary peroxidase-conjugated antibody
(anti IgG (H+L)–HRP, Calbiochem, Darmstadt, Germany)
at room temperature, and visualized by chemiluminescence
(SuperSignal, Pierce Biotechnology Inc., Rockford, IL, USA).
The bands were quantified using the Scion Image software
(ScionCorp., Frederick, MD, USA).
Statistical analysis
Results are expressed as the means ± S.E.M. of the indicated
number (n) of experiments. Statistical analyses were performed
using Student’s t-test and when necessary Welch’s corrected t-test
was applied. P < 0.05 was considered statistically significant.
RESULTS
Insulin-resistant rats
As observed previously (Rafacho et al., 2008a, Rafacho
et al., 2009) DEX rats exhibited marked fasting and fed
hyperinsulinemia. This augmentation was 8.6-fold in DEX
PAULA ET AL. Biol Res 44, 2011, 251-257
compared to CTL rats (fed serum insulin values were 4.3 ± 0.2
and 36.9 ± 2.1 ng/dL for CTL and DEX rats, respectively; n =
10, P < 0.01). Blood glucose levels were similar between the
two groups of rats (99.7 ± 1.5 and 108.8 ± 4.2 mg/dL for CTL
and DEX rats, respectively; n = 10). As expected (Rafacho et al.,
2008a; Rafacho et al., 2010b), islets isolated from DEX rats also
secreted more insulin than CTL rats in response to 5.6 or 11.1
mmol/L glucose concentrations (Fig 1; n = 10 wells, P < 0.001).
The insulin values were 0.56 ± 0.04 and 2.21 ± 0.18 ng/islet.mL1.h-1 for 5.6 mmol/L glucose and 8.42 ± 0.36 and 29.37 ± 1.24
ng/islet.mL-1.h-1 for 16.7 mmol/L glucose for CTL and DEX
islets, respectively.
Insulin receptor and immediate adapter proteins
Substrates from the insulin receptor, also known as adapter
proteins, such as IRS and Shc proteins are involved in the
control of β-cell function and growth. The protein content
of IRα-subunit, IRβ-subunit, IRS-1, IRS-2, Shc and p-IRβsubunit proteins were investigated in pancreatic islets
lysates by Western blotting. The levels of IRα-subunit were
similar between DEX and CTL islets (Fig. 2A). No alteration
in the expression of IRS-1 and the two subunits of the lowmolecular-weight substrate Shc was noticed in DEX, compared
to CTL islets (Figs. 2C,E,F, respectively; n = 6). However, an
augmentation of 209% for IRβ-subunit, 60% for the IRS-2 and
148% for p-IRβ-subunit protein contents were observed in
DEX, compared to CTL islets (Figs. 2B,D,G, respectively; n =
6, P < 0.05). The ratio between p-IRβ-subunit by the total IRβsubunit protein was not changed in DEX, compared to CTL
islets (data not shown).
11.1 mmol/L G
Insulin release
(ng/islet.mL-1.h-1)
35
*
30
25
20
15
10
5
0
5.6 mmol/L G
*
CTL DEX
CTL DEX
Figure 1. Increased glucose-stimulated insulin secretion in DEX
rats. Cumulative static insulin secretion from isolated islets in
response to basal or stimulating glucose concentrations. Insulin
release was higher in islets from DEX rats at both 5.6 and 16.7
mmol/L glucose. Data are means ± S.E.M. *significantly different vs
CTL. n = 10 wells, P < 0.05 for unpaired Student t-test.
253
Downstream signaling components
We next measured the levels of some downstream effectors
of insulin signaling such PI3-K, AKT, p70 S6K and ERK1/2
proteins. The protein content of AKT and ERK1/2 was not
altered between DEX and CTL rat islets (Figs. 3B and F,
respectively; n = 6). However, an augmentation in PI3-K
(30%) and in p70S6K (34%) protein levels in DEX, compared
to CTL islets was observed (Fig. 3A and D, respectively; n =
6, P < 0.05). We also measured the content of phosphorylated
AKT, p70S6K and ERK1/2 proteins. The former increased 31%
in DEX, compared to CTL islets (P < 0.05), but no significant
alterations were observed with p-p70 S6K and p-ERK1/2
proteins (Figs. 3C,E,G, respectively). The ratio values between
the phosphorylated and the total content for the above proteins
revealed a significant increase of 58% for AKT (P < 0.05) in
DEX, compared to CTL islets (0.91 ± 0.05 and 1.44 ± 0.18 for
CTL and DEX respectively).
Glucocorticoid receptor
The glucocorticoid receptor modulates the gene transcription
activity. We next investigate whether this protein could be
altered in islets from DEX rats. Figure 4A shows that the islet
content of GRα/β protein was similar between DEX and CTL
groups (n = 6).
DISCUSSION
Insulin maintains blood glucose concentration within narrow limits
by regulating the uptake of glucose in peripheral tissues (muscle
and fat) as well as regulating hepatic glucose output. For this
purpose, pancreatic β-cells secrete adequate amounts of insulin
to face to the respective blood glucose levels, a process often
referred to as the stimulus-secretion coupling (Weir et al., 2001).
Under the pathological condition of insulin resistance, induced
or not by administration of glucocorticoids, both the uptake of
glucose by muscle and fat tissues and the hepatic glucose output
are impaired, which results in increased demand for insulin to
maintain the glycemia at physiological range (Weir et al., 2001;
Nicod et al., 2003; Burén et al., 2008). The increase in insulin
secretion and in β-cell mass are among the adaptive compensations
in the endocrine pancreas that counteract the peripheral insulin
resistance and guarantee the high levels of circulating insulin (Weir
et al., 2001; Rafacho et al., 2009). In the present study we made
rats insulin resistant by 5 days of dexamethasone administration.
These insulin-resistant rats (DEX) exhibited hyperinsulinemia and
increased glucose-stimulated insulin secretion, which agreed with
the endocrine pancreas compensations that occur under insulin
resistance to maintain glycemia at normal or near-physiological
ranges (Weir et al., 2001; Rafacho et al., 2008a).
Insulin signaling components may modulate the β-cell
function and mass (Kulkarni et al., 1999a; Kulkarni et al.,
1999b; Otani et al., 2004; Cantley et al., 2007). Herein, we
showed that IRβ-subunit, p-IRβ-subunit, and IRS-2 protein
contents are augmented in pancreatic islets from DEX rats (Fig.
2). It has been demonstrated that the secreted insulin may be
essential for insulin exocytosis or even have a positive effect
on its own release (Aspinwall et al., 1999). Islets from mice
with a systemic knockout of IRS-1 (Kulkarni et al., 1999b), or
with a β-cell knockout of insulin receptor (IR) (Kulkarni et al.,
1999a; Otani et al., 2004), IGF-1R (Kulkarni et al., 2002), or with
254
140
120
100
80
60
40
20
0
CTL
DEX
160
140
120
100
80
60
40
20
0
CTL
DEX
E
Islet conten of Shc / D-tubulin
(% from CTL)
F
Islet content of p-IRE-subunit / D-tubulin
(% from CTL)
G
95 KDa
*
350
300
250
200
150
100
50
0
CTL
DEX
D
180 KDa
Islet content of IRS-2 / D-tubulin
(% from CTL)
Islet content of IRS-1 / D-tubulin
(% from CTL)
C
Islet content of IRE-subunit / D-tubulin
(% from CTL)
B
125 KDa
55 KDa
180
160
140
120
100
80
60
40
20
0
CTL
DEX
Islet content of Shc / D-tubulin
(% from CTL)
A
Islet content of IRD-subunit / D-tubulin
(% from CTL)
PAULA ET AL. Biol Res 44, 2011, 251-257
185 KDa
*
180
160
140
120
100
80
60
40
20
0
CTL
DEX
43 KDa
400
350
300
250
200
150
100
50
0
CTL
DEX
95 KDa
*
300
250
CTL
DEX
H
51 KDa
Į-tubulin
200
150
100
50
0
CTL
DEX
Figure 2. Increase of IRβ-subunit, p-IRβ-subunit and IRS-2 protein levels in DEX islets. Protein levels of IRα-subunit (A), IRβ-subunit (B),
IRS-1 (C), IRS-2 (D), two subunits of Shc (E,F), p-IRβ-subunit (G), and representative control blot for α-tubulin (H). Note the significant
increase in IRβ-subunit, IRS-2 and p-IRβ-subunit protein contents in islet lysates from DEX rats. The protein levels of IRα-subunit, IRS-1 and
Shc proteins were similar between DEX and CTL islets. The figures are representative immunoblots performed at least six times on separate
islet extracts. Data are means ± S.E.M. *significantly different vs CTL. P < 0.05 for unpaired Student t-test.
255
PAULA ET AL. Biol Res 44, 2011, 251-257
G
Islet content of AKT / D-tubulin
(% from CTL)
120
100
80
60
40
20
0
CTL
DEX
D
*
140
120
100
80
60
40
20
0
CTL
DEX
70 KDa
120
100
80
60
40
20
CTL
100
80
60
40
20
0
CTL
DEX
70 KDa
*
140
120
100
80
60
40
20
0
CTL
DEX
F
140
0
56 KDa
43 KDa
Islet content of ERK1/2 / D-tubulin
(% from CTL)
Islet content of p-AKT / D-tubulin
(% from CTL)
Islet content of p-p70S6K / D-tubulin
(% from CTL)
E
B
*
140
56 KDa
Islet content of p-ERK1/2 / D-tubulin
(% from CTL)
C
83 KDa
Islet content of p70S6K / D-tubulin
(% from CTL)
Islet content of PI3-K / D-tubulin
(% from CTL)
A
DEX
43 KDa
140
120
100
80
60
40
20
0
CTL
CTL
DEX
DEX
H
120
100
51 KDa
Į-tubulin
80
60
40
20
0
CTL
DEX
Figure 3. Increase of PI3-K, p-AKT and p70S6K protein levels in DEX islets. Protein levels of PI3-K (A), AKT (B), p-AKT (C), p70S6K (D),
p-p70S6K (E), ERK1/2 (F), p-ERK1/2 (G), and representative control blot for α-tubulin (H). Note the significant increase in PI3-K, p-AKT and
p70S6K protein contents in islet lysates from DEX rats. The protein levels of AKT, ERK1/2 and p-ERK1/2 proteins were similar between DEX
and CTL islets. The figures are representative immunoblots performed at least six times on separate islet extracts. Data are means ± S.E.M.
*significantly different vs CTL. P < 0.05 for unpaired Student t-test.
256
PAULA ET AL. Biol Res 44, 2011, 251-257
an islet cell knockout of IRS-2 (Cantley et al., 2007), exhibit
a marked defect in insulin secretion in response to glucose.
However, overexpression of IRS-2 in isolated rat islets leads
to increased basal and glucose-stimulated insulin secretion
(Mohanty et al., 2005). These data emphasize the importance
of IR and IRS proteins for the adequate control of insulin
secretion in pancreatic β cells. Although we cannot rule out
the participation of IRS-1, the increase in IRβ-subunit, p-IRβsubunit and IRS-2 protein levels in DEX islets may exert a
positive role on the augmented insulin secretion observed in
our insulin-resistant rats induced by dexamethasone.
Mice knockout for IR, specifically in β cells, show a
decrease in β-cell mass in an age-dependent manner (Kulkarni
et al., 1999a). In addition, the global knockout of IRS-2 lead
to a type 2 diabetes mellitus-like phenotype due to reduced
β-cell mass (Withers et al., 1998; Kubota et al., 2000). A similar
reduction in β-cell mass was observed in mice with ablation of
IRS-2 in β-cells by a pancreas-restricted knockout, using the
pancreatic-duodenal homeobox factor-1 (PDX-1)-promoterdriven Cre system (Cantley et al., 2007). Nevertheless, β-cell
proliferation significantly increases in rat islets overexpressing
IRS-2 whilst IRS-1 seems to be less effective (Mohanty et al.,
2005). These results demonstrate the participation of IR and
IRS proteins in the regulation of β-cell growth. The increased
levels of IRβ-subunit, p-IRβ-subunit and IRS-2 proteins in
islets from DEX rats may favor the augmentation in the β-cell
mass and proliferation that is found in this insulin-resistant
90 KDa
Islet content of GRD/E / D-tubulin
(% from CTL)
A
100
80
60
40
20
0
CTL
CTL
DEX
DEX
B
51 KDa
Į-tubulin
Figure 4. Glucocorticoid receptor protein content. Protein content
of glucocorticoid receptor (GRα/β) (A) and representative control
blot for α-tubulin (B). Note the similar levels of GRα/β protein in
islet lysates from DEX and CTL rats. The figure is representative
immunoblot performed at least six times on separate islet extracts.
Data are means ± S.E.M. *significantly different vs CTL. P < 0.05 for
unpaired Student t-test.
model (Rafacho et al., 2009, Rafacho et al., 2010b, Rafacho et
al., 2011).
We also observed higher levels of the PI3-K, p-AKT, and
p70S6K, but not of the AKT, p-p70S6K, ERK1/2, and p-ERK1/2
in islets from DEX rats (Fig. 3). These proteins are among
the several downstream effectors of insulin signaling and
also modulate the β-cell function and growth (Vasavada et
al., 2006). Overexpression of AKT in mice leads to a marked
increase in β-cell mass and proliferation (Bernal-Mizrachi et
al., 2001). Although our present results showed similar AKT
levels between DEX and CTL rats, we demonstrated that
the phosphorylated levels of AKT increases in DEX islets,
which agreed with previous observations (Rafacho et al.,
2009), and may support the increase of β-cell function and
proliferation observed in DEX rats. Similarly, p70S6K has also
been demonstrated to exert a positive effect on β-cell function
and growth (Pende et al., 2000) supporting our observation, at
least in part, of an increased p70S6K protein levels in DEX islets.
The ERK1/2 proteins are the effectors of the MAPK signaling
pathway, a mitogen branch of insulin signaling, but total and
phosphorylated levels of these proteins were found similar in
both groups. Thus, ERK1/2 proteins seem not to be the major
signal for pancreatic β-cell mass expansion that was observed
previously in this model (Rafacho et al., 2008b, Rafacho et al.,
2009, Rafacho et al, 2010b, Rafacho et al., 2011). Based on these
data we suggest that insulin signaling effectors such as PI3-K
and AKT may have the major positive role in the endocrine
pancreas adaptations developed by insulin-resistant rats.
Glucocorticoid receptor (GR) is a ligand-activated
transcripton factor that upon ligand binding dissociates from
the heat shock proteins, translocates into the nucleus and bind
as homodimer to GR responsive elements in promoter regions of
glucocorticoid responsive genes, modulating gene transcription
(Schäcke et al., 2002). In the present study, we did not detect
differences in GR protein levels between DEX and CTL islets (Fig.
4). Although this does not exclude GR as a key regulator of gene
transcription in islets from DEX rats, we are tempted to suggest
that insulin signaling may exert a role in this process. Circulating
insulin is significantly elevated in DEX rats after 24 h of
dexamethasone treatment and remains high for the follow 4 days
in our DEX model (Rafacho et al., 2011). Insulin stimulates amino
acid uptake in cells, inhibits protein degradation and promotes
protein synthesis (Saltiel and Kahn, 2001). Thus, it is feasible that
insulin modulates the intracellular pro-protein synthesis events
and modulates the increase of insulin secretion and β-cell mass
through activation of IRS-2/PI3-K/AKT pathway.
In summary, dexamethasone induces insulin resistance
that leads to an increase in circulating insulin levels and
enhancement of glucose-induced insulin secretion. IRS-2, but
not IRS-1, and Shc protein contents are higher in islets from
dexamethasone-treated rats than in control islets. This increase
was accompanied by an augmentation in the PI3-K and p-AKT,
but not in p-p70S6K and p-ERK1/2 protein levels. We conclude
that IRS-2 may have a major role among the immediate
substrates of the insulin receptor to link activated receptors
to downstream insulin signaling components related to islet
function and growth in this insulin-resistant rat model.
ACKNOWLEDGMENTS
This study was supported by grants from Fundação de Amparo
à Pesquisa do Estado de São Paulo (Fapesp).
PAULA ET AL. Biol Res 44, 2011, 251-257
REFERENCES
ASPINWALL CA, LAKEY JR, KENNEDY RT (1999) Insulin-stimulated insulin
secretion in single pancreatic beta cells. J Biol Chem 274:6360-6365.
BEARD JC, HALTER JB, BEST JD, PFEIFER MA, PORTE D Jr (1984)
Dexamethasone-induced insulin resistance enhances B cell responsiveness
to glucose level in normal men. Am J Physiol 247:E592-E596.
BERNAL-MIZRACHI E, WEN W, STAHLHUT S, WELLING CM, PERMUTT
MA (2001) Islet beta cell expression of constitutively active Akt1/PKB
alpha induces striking hypertrophy, hyperplasia, and hyperinsulinemia.
J Clin Invest 108:1631-1638.
BINNERT C, RUCHAT S, NICOD N, TAPPY L (2004) Dexamethasoneinduced insulin resistance shows no gender difference in healthy
humans. Diabetes Metab 30:321-326.
BURÉN J, LAI YC, LUNDGREN M, ERIKSSON JW, JENSEN J (2008) Insulin
action and signaling in fat and muscle from dexamethasone-treated rats.
Arch Biochem Biophys 474:91-101.
CANTLEY J, CHOUDHURY AI, ASARE-ANANE H, SELMAN C, LINGARD
S, HEFFRON H, HERRERA P, PERSAUD SJ, WITHERS DJ (2007)
Pancreatic deletion of insulin receptor substrate 2 reduces beta and
alpha cell mass and impairs glucose homeostasis in mice. Diabetologia
50:1248-1256.
CZOCK D, KELLER F, RASCHE FM, HÄUSSLER U (2005) Pharmacokinetics
and pharmacodynamics of systemically administered glucocorticoids.
Clin Pharmacokinet 44:61-98.
GIOZZET VAG, RAFACHO A, BOSCHERO AC, CARNEIRO EM,
BOSQUEIRO JR (2008) Dexamethasone treatment in vivo counteracts
the functional pancreatic islet alterations caused by malnourishment in
rats. Metabolism 57:617-624.
KARLSSON S, OSTLUND B, MYRSÉN-AXCRONA U, SUNDLER F, AHRÉN
B (2001) Beta cell adaptation to dexamethasone-induced insulin
resistance in rats involves increased glucose responsiveness but not
glucose effectiveness. Pancreas 22:148-156.
KORACH-ANDRÉ M, GAO J, GOUNARIDES JS, DEACON R, ISLAM
A, LAURENT D (2005) Relationship between visceral adiposity and
intramyocellular lipid content in two rat models of insulin resistance.
Am J Physiol Endocrinol Metab 288:E106-E116.
KUBOTA N, TOBE K, TERAUCHI Y, ETO K, YAMAMUCHI T, SUZUKI
R, TSUBAMOTO Y, KOMEDA K, NAKANO R, MIKI H, SATOH S,
SEKIHARA H, SCIACCHITANO S, LESNIAK M, AIZAWA S, NAGAI
R, KIMURA S, AKANUMA Y, TAYLOR SI, KADOWAKI T (2000)
Disruption of insulin receptor substrate 2 causes type 2 diabetes
because of liver insulin resistance and lack of compensatory beta-cell
hyperplasia. Diabetes 49:1880-1889.
KULKARNI RN, HOLZENBERGER M, SHIH DQ, OZCAN U, STOFFEL M,
MAGNUSON MA, KAHN CR (2002) Beta-cell-specific deletion of the
Igf1 receptor leads to hyperinsulinemia and glucose intolerance but
does not alter beta-cell mass. Nat Genet 31:111-115.
KULKARNI RN, BRÜNING JC, WINNAY JN, POSTIC C, MAGNUSON MA,
KAHN CR (1999a) Tissue specific knockout of the insulin receptor in
pancreatic β cells creates an insulin secretory defect similar to that in
type 2 diabetes. Cell 96:329-339.
KULKARNI RN, WINNAY JN, DANIELS M, BRÜNING JC, FLIER SN,
HANAHAN D, KAHN CR (1999b) Altered function of insulin receptor
substrate-1-deficient mouse islets and cultured beta-cell lines. J Clin
Invest 104:R69-R75.
LEIBIGER IB, BRISMAR K, BERGGREN PO (2010) Novel aspects of
pancreatic beta-cell signal-transduction. Biochem Biophys Res Commun
396:111-115.
LEIBIGER IB, LEIBIGER B, BERGGREN PO (2008) Insulin signaling in the
pancreatic beta-cell. Annu Rev Nutr 28:233-251.
MARANZANO E, FEYER PCh, MOLASSIOTIS A, ROSSI R, CLARK-SNOW
RA, OLVER I, WARR D, SCHIAVONE C, ROILA F (2005) Evidencebased recommendations for the use of antiemetics in radiotherapy.
Radiother Oncol 76:227-233.
MOHANTY S, SPINAS GA, MAEDLER K, ZUELLIG RA, LEHMANN R,
DONATH MY, TRÜB T, NIESSENS M (2005) Overexpression of IRS2 in
257
isolated pancreatic islets causes proliferation and protects human betacells from hyperglycemia-induced apoptosis. Exp Cell Res 303:68-78.
NICOD N, GIUSTI V, BESSE C, TAPPY L (2003) Metabolic adaptations to
dexamethasone-induced insulin resistance in healthy volunteers. Obes
Res 11:625-631.
OTANI K, KULKARNI RN, BALDWIN AC, KRUTZFELDT J, UEKI K,
STOFFEL M, KAHN CR, POLONSKY KS (2004) Reduced beta-cell
mass and altered glucose sensing impair insulin-secretory function in
betaIRKO mice. Am J Physiol Endocrinol Metab 286:E41-E49.
PENDE M, KOZMA SC, JAQUET M, OORSCHOT V, BURCELIN R, LE
MARCHAND-BRUSTEL Y, KLUMPERMAN J, THORENS B, THOMAS
G (2000) Hypoinsulinaemia, glucose intolerance and diminished betacell size in S6K1-deficient mice. Nature 408:994-997.
POLLAK M (2008) Insulin and insulin-like growth factor signaling in
neoplasia. Nat Rev Cancer 8:915-928
RAFACHO A, ABRANTES JLF, RIBEIRO DL, PINTO ME, BOSCHERO
AC, BOSQUEIRO JR (2011) Morphofunctional alterations in endocrine
pâncreas of short- and long-term dexamethasone-treated rats. Horm
Metab Res 43:275-281.
RAFACHO A, MARROQUÍ L, TABOGA SR, ABRANTES JL, SILVEIRA
LR, BOSCHERO AC, CARNEIRO EM, BOSQUEIRO JR, NADAL
A, QUESADA I (2010a) Glucocorticoids in vivo induce both insulin
hypersecretion and enhanced glucose sensitivity of stimulus-secretion
coupling in isolated rat islets. Endocrinology 151:85-95.
RAFACHO A, QUALLIO S, RIBEIRO DL, TABOGA SR, PAULA FM,
BOSCHERO AC, BOSQUEIRO JR (2010b) The adaptive compensations
in endocrine pancreas from glucocorticoid-treated rats are reversible
after interruption of treatment. Acta Physiol 200:3543-3554.
RAFACHO A, CESTARI TM, TABOGA SR, BOSCHERO AC, BOSQUEIRO
JR (2009) High doses of dexamethasone induce increased beta-cell
proliferation in pancreatic rat islets. Am J Physiol Endocrinol Metab
296:E681-E689.
RAFACHO A, GIOZZET VA, BOSCHERO AC, BOSQUEIRO JR (2008a)
Functional alterations in endocrine pancreas of rats with different
degrees of dexamethasone-induced insulin resistance. Pancreas
36:284-293.
RAFACHO A, RIBEIRO DL, BOSCHERO AC, TABOGA SR, BOSQUEIRO JR
(2008b) Increased pancreatic islet mass is accompanied by activation of
the insulin receptor substrate-2/serine-threonine kinase pathway and
augmented cyclin D2 protein levels in insulin-resistant rats. Int J Exp
Pathol 89:264-275.
RUZZIN J, WAGMAN AS, JENSEN J (2005). Glucocorticoid-induced insulin
resistance in skeletal muscles: defects in insulin signaling and the effects of
a selective glycogen synthase kinase-3 inhibitor. Diabetologia 48:2119-2130.
SAAD MJ, FOLLI F, KAHN JA, KAHN CR (1993) Modulation of insulin
receptor, insulin receptor substrate-1, and phosphatidylinositol 3-kinase in
liver and muscle of dexamethasone-treated rats. J Clin Invest 92:2065-2072.
SALTIEL AR, KAHN CR (2001) Insulin signalling and the regulation of
glucose and lipid metabolism. Nature 414:799-806.
SCHÄCKE H, DÖCKE WD, ASADULLAH K (2002) Mechanisms involved in
the side effects of glucocorticoids. Pharmacol Ther 96:23-43.
STOJANOVSKA L, ROSELLA G, PROIETTO J (1990) Evolution of
dexamethasone-induced insulin resistance in rats. Am J Physiol
258:E748-E756.
VASAVADA RC, GONZALEZ-PERTUSA JA, FUJINAKA Y, FIASCHI-TAESCH
N, COZAR-CASTELLANO I, GARCIA-OCAÑA A (2006) Growth factors
and beta cell replication. Int J Biochem Cell Biol 38:931-950.
VIRKAMÄKI A, UEKI K, KAHN CR (1999) Protein-protein interaction in
insulin signaling and the molecular mechanisms of insulin resistance. J
Clin Invest 103:931-943.
WEIR GC, LAYBUTT DR, KANETO H, BONNER-WEIR S, SHARMA A
(2001) Beta-cell adaptation and decompensation during the progression
of diabetes. Diabetes 50 Suppl:S154-S159.
WITHERS DJ, GUTIERREZ JS, TOWERY H, BURKS DJ, REN JM, PREVIS
S, ZHANG Y, BERNAL D, PONS S, SHULMAN GI, BONNER-WEIR S,
WHITE MF (1998) Disruption of IRS-2 causes type 2 diabetes in mice.
Nature 391:900-904.
Biol Res 44: 259-267, 2011
Rat dorsal prostate is necessary for vaginal adhesion of the seminal
plug and sperm motility in the uterine horns
José L Tlachi-López1, Aurora López1, Kurt Hoffman2, Javier Velázquez-Moctezuma3, Mario García-Lorenzana3
and Rosa Angélica Lucio1*
1
Centro Tlaxcala de Biología de la Conducta, Universidad Autónoma de Tlaxcala, Carretera Tlaxcala-Puebla km 1.5 s/n, Loma Xicotencatl 90062, Tlaxcala, México.
Centro de Investigación en Reproducción Animal. Universidad Autónoma de Tlaxcala-CINVESTAV, Carretera San Martín Texmelucan-Tlaxcala km 10.5 s/n, San Felipe
Ixtacuixtla 90120, Tlaxcala, México.
3 Área de Neurociencias, Universidad Autónoma Metropolitana-Iztapalapa, Av. Michoacán y la Purísima 38340 Iztapalapa 55535. México, DF, México.
2
ABSTRACT
The rat prostate comprises dorsal, ventral and lateral lobes that are morphologically and biochemically distinct. Lesions to these structures
are expected to affect the quality of the ejaculate and male fertility. In experiment 1, we analyzed ejaculate parameters of males that had
chemical lesions of the dorsal or ventral lobes. At pre-lesion and at 5 and 20 days post-lesion males were mated, and after ejaculation,
seminal fluid and seminal plug were obtained from the mated females. In experiment 2, the ventral lobes were ablated, and the ejaculate
was analyzed. In experiment 3, the fertility of males with chemically-lesioned dorsal lobes or ablation of the ventral lobes was evaluated.
Chemical lesion of the dorsal lobe prevented the adhesion of the seminal plug to vaginal walls. When these males were tested at 5-days
postlesion, no sperm were found in uterus, and at 20-days post-lesion, the few sperm encountered showed slow progressive motility. None
of the females that mated with dorsal lobe-lesioned males became pregnant. However, chemical lesion or ablation of the ventral lobes did
not affect ejaculate or fertility. Our results indicate that the dorsal prostatic lobes are indispensable for reproductive success in males, and
define parameters of ejaculate with which fertility can be estimated.
Key terms: ejaculation, characteristics of semen, copulatory plug, prostate, seminal analysis, sperm number.
INTRODUCTION
In the rat, secretions of the accessory sexual glands and
spermatozoa are deposited into the vagina during ejaculation.
Immediately after, seminal fluids coagulate to form the
copulatory plug (Matthews Jr and Adler, 1978). This seminal
plug facilitates transcervical sperm transport (Blandau, 1945;
Matthews and Adler, 1977; Matthews Jr and Adler, 1978).
Approximately 1% of the ejaculate contains spermatozoa; the
rest corresponds to secretions of the accessory sexual glands,
which include the bulbourethral and coagulating glands,
seminal vesicles and prostate (Setchell et al., 1994). These sex
glands differ among males of different species with respect
to number and shape, but also some of these sex glands
are absent. Nevertheless, the prostate is present in all male
mammals (Luke and Coffey, 1994).
The rat prostate is a large gland comprising dorsal, ventral
and lateral portions, with each having a right and left lobe
(Hayashi et al., 1991; Jesik et al., 1982). The dorsal lobes are
located inferior and posterior to the urinary bladder, below
and behind the attachment of the seminal vesicles and
coagulating glands (Hayashi et al., 1991). The ventral lobes
are found on the ventral aspect of the urethra immediately
below the urinary bladder. The lateral lobes lie just below the
seminal vesicles and coagulating glands, partially overlapping
the ventral lobes and, dorsally, blend with the dorsal lobes.
Morphological analysis by micro-dissection reveals that all
lobes are composed of ducts that emerge from the urethra and
arborize distally. The dorsal lobes have 5-6 pairs of main ducts
with true acinar termini (Hayashi et al., 1991). Each ventral
lobe has 2-3 slender main ducts, whereas each lateral lobe has
5-7 long main ducts and 5-6 short main ducts. The rat prostate
secretes a variety of substances that enter the urethra to form
the prostatic portion of the semen. The secretion products
are biochemically heterogeneous according to their lobe of
origin. The dorsal lobes secrete dorsal-protein I and dorsalprotein II, among other products (Seitz et al., 1990), and are
the major sites of fructose secretion (Humphrey and Mann,
1949; Mann, 1964). Ventral lobe secretions include citrate,
spermine and spermidine (Price and William-Ashman, 1961),
aminopeptidases (Vanha-Perttula and Jauhiainen, 1983), and
plasminogen activator (Wilson et al., 1988). Finally, lateral lobes
are the major zinc-secreting portion of the prostate (Gunn and
Gould, 1957).
These lobe-specific secretions most likely contribute
significantly to reproductive success. Therefore, the aim of
the present work was to determine the characteristics of
the ejaculate obtained from males having dorsal or ventral
prostatic lobe lesions, and evaluate the fertility of these males.
MATERIALS AND METHODS
In pilot studies, attempts were made to extirpate the dorsal
prostatic lobes. We encountered two difficulties: first, the
surgical manipulation required to remove these lobes damaged
adjacent pelvic structures, particularly the base of the urinary
bladder and the urethral dorsal wall. For this reason, we did
not ablate the dorsal lobes in the present study; instead, we
lesioned them chemically. Second, surgical removal of the
lateral lobes eliminates the autonomic innervation of the penile
erectile tissue and other reproductive organs. This innervation
arises from the major pelvic ganglia, which are attached to the
* Corresponding author: Dra. Rosa Angélica Lucio. Phone number: +52 (246) 462-1557. Email: [email protected]
Received: July 6, 2011. In revised form: November 17, 2010. Accepted: December 2, 2010.
260
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
lateral lobes of the prostate (Hebel and Stromberg, 1986; Dail
et al., 1989). Ablation of these lobes abolishes penile erection,
thereby preventing the male from intromitting and ejaculating.
For this reason, ablation of the lateral lobes was not attempted.
Likewise, chemical lesioning was not attempted because, due
to the transparency of the sclerosing agent, it was not possible
to determine the extent of its diffusion within the tissue. Thus,
the present experimental procedures included chemically
lesioning the dorsal lobes, and chemical lesion or surgical
ablation of the ventral ones.
Hamilton syringe (dorsal lobes, n=6 males; ventral lobes, n=6
males). Tetradecyl sodium sulphate is a sclerosing agent, used
successfully in clinical studies, which promotes an increase in
fibrotic processes, thereby resulting in drastic and irreversible
impairment of tissue function (Griffin et al., 1986). This
solution was injected into five different sites of each lobe (2 μl/
site; Fig. 1). After each administration, the needle remained in
place for one minute to prevent the solution from escaping.
Animals recovered for 5 days. Previous observations in our
laboratory had indicated that with this procedure and these
doses, the prostatic lobes showed a clear fibrotic response.
Animals
Collection and macroscopic and microscopic evaluation of ejaculate
Adult male (300-450 g of body weight and female (200-300 g
of body weight) Wistar were used rats in this study, obtained
from the vivarium of the Tlaxcala Center for Behavioral
Biology. Rats were kept under standard vivarium conditions,
in a room with controlled temperature and under an inverted
12/12 light-dark cycle, with food (Purina Chow) and water
available ad libitum. All procedures described in this study
were in accordance with the guidelines of the Laws and Codes
of Mexico in Article Seven of the Regulations of the General
Law of Health Regarding Health Research, and followed the
guidelines of the NIH for the use of animals (Laws and Codes
of Mexico, 1995).
Experiment 1. Chemical lesion of dorsal and ventral prostatic lobes and
analysis of ejaculate:
Chemical lesion procedure
Under deep sodium pentobarbital anesthesia (Pfizer; 26 mg/
kg; intraperitoneal) male rats were submitted to a surgical
manipulation by which the prostatic lobes were exposed.
Prostatic lobes were injected with 10 μl of a 2% solution
of tetradecil sodium sulphate (Aldrich 293938-1G) using a
Sexually experienced males and ovariectomized virgin
females were used. Females were brought into estrous by
sequential treatment with 10 μg of estradiol benzoate (SigmaAldrich E-8515) and 2 mg of progesterone (Sigma-Aldrich
P-0130), administered by subcutaneous injection 44 h and 4
h, respectively, before the copulatory encounters. Males were
placed into a plexiglass cylinder (50 cm diameter/50 cm high)
with wood shavings on the floor. Each male was tested three
times: before performing the chemical lesion and at 5 and
20 days post-lesion. Each test consisted of one ejaculatory
series registering the copulatory parameters (mount latency,
intromission latency, ejaculation latency, number of mounts
and number of intromissions). Once the male ejaculated, the
female was immediately transferred from the arena to an
empty cage where she was left quiet for 5 min before being
anesthetized with pentobarbital (26 mg/kg; intraperitoneal;
Pfizer; DF, México). After an abdominal incision, their uterine
horns were tied proximally and distally, removed from the
abdominal cavity, and immersed in a Petri dish containing
saline solution (0.9%) at 37°C. This is the easiest way to
eliminate blood, fat tissue and external uterine vessels, but also
serves to maintain seminal fluid at a stable temperature.
Figure 1: a) Dorsal, b) ventral views of the prostatic lobes, showing the injection sites (
• =injection site); Bar=1 cm.
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
Seminal content of both uterine horns was placed in a 1.5
ml micro-centrifuge tube, and maintained in a thermo-bath at
37°C. The samples of ejaculate collected in this manner were
used to evaluate the following parameters of the semen:
1) Color, distinguished as off-white or transparent.
2) Viscosity, measured by the length (in mm) of a thread
formed after introduction and withdrawal of a tip of a
transfer pipette into the semen.
3) pH, measured placing a drop of semen on a pH indicator
paper.
4) Sperm motility, individual motility of spermatozoa. We
classified motility using a 4-category scale, according
to the time in seconds the spermatozoa took to cross a
horizontal line running across the observed field (the line
was drawn into one of the microscope’s objectives). Thus,
spermatozoa whose heads were in the proximity of the
horizontal line were designated to one of four categories:
rapid progressive (those taking 2-3 sec to cross the line);
slow progressive (those taking more than 4 sec); and in situ
(those with non-progressive motility, generally circular or
local motility); and immobile (no movement). The reading
was from left to right using the 20x microscope objective,
and counting 100 spermatozoa. The obtained value was
expressed in percentage. The sperm motility of each sample
was filmed in order to confirm the obtained results.
5) Sperm viability, nigrosin-eosin and sodium citrate stains
were used to distinguish live (unstained) or dead (stained)
sperm. 100 sperm were counted using the 100x microscope
objective. This parameter was also expressed in percentage.
6) Sperm morphology, nigrosin-eosin and sodium citrate
stains were used to distinguish normal (having a sickleshape head and large flagella) or abnormal (those with
double head and fragmented or zig-zag flagella) sperm. 100
sperm were counted using the 100x microscope objective.
Sperm morphology was expressed in percentage.
7) Sperm concentration, semen suctioned by a Shali
pipette (diluted with 2% formaldehyde and shaken
until homogenized semen was obtained) was placed
in a Neubauer hemocytometer, where the sperm were
counted under a 20x microscope objective. The number of
spermatozoa was expressed in millions per ml (Lucio et al.,
2009).
The seminal plug was removed from the vagina by
separating the pubic symphysis and cutting the dorsal vaginal
wall longitudinally. Using a spatula, short movements were
performed to detach the seminal plug from lateral and ventral
vaginal walls and from cervix, before carefully removing it. We
recorded the following parameters:
1) Consistency, seminal plug solidity, qualitative parameter
determined by direct tactile inspection.
2) Weight, seminal plug mass, expressed in mg.
3) Size, length and width of the seminal plug, expressed in
mm.
4) Volume, mass occupied by the seminal plug, expressed in
mm3.
5) Cytological elements including number of single heads,
single flagella and complete spermatozoa, expressed in
percentage. For this, the seminal plug was cut transversely
at the proximal end (approximately 1 mm from the surface
that had been attached to the cervix), at the distal end
(approximately 1 mm from the surface that had been at
the vaginal orifice), and at the equatorial region (half way
261
between the prior two cuts). The cut surface of each of
these three sections was slid horizontally from left to right
over a clean microscope slide, “drawing” four parallel
lines, while taking care not to overlap them (Lucio et al.,
2009). After collecting the semen and the seminal plug, the
females were sacrificed.
Statistical analysis
Copulatory parameters were quantified according to methods
described in previous studies (Meisel and Sachs 1994), and the
quantitative data were analyzed using a Friedman test. Data
from the assessment of seminal content and seminal plug were
analyzed using a Friedman test. Results obtained before lesion
were compared with those obtained at day 5 and 20 postlesion. Significance level was set at 0.05 (Zar, 1999).
Evaluation of chemical lesion
After the ejaculate analysis on day 20 post-lesion, all males
were injected intraperitoneally with an overdose of sodium
pentobarbital (Pfi zer; DF, México). Additional males were
lesioned (or not, in the case of 4 control males) in their dorsal
(n=4) or ventral (n=4) prostatic lobes, and then sacrificed on
day 5 post-lesion, corresponding to the first day of ejaculate
analysis. In this way, we obtained a histological view of intact
and chemically-lesioned prostates on days 5 and 20 postlesion.
Histological analysis was done by dissecting and removing
the prostatic lobes, cutting sagitally. Tissue was fixed with
bouin Duboscq (Humason, 1972), rinsed with 70% ethanol,
dehydrated with 80%, 96%, 100% ethanol and cleared in a 1:1
mix of 100% ethanol-xylene and pure xylene. Inclusion was
performed with Paraplast (Oxford Labware). 5-micrometer
serial sections were obtained using a microtome (Leica RM
2135). Prostatic sections were stained using hematoxylin-eosin
(Presnell and Schreibman, 1997). The sections were analyzed
under a clear field light microscope (Axioskope II, Carl Zeiss).
Experiment 2. Ablation of ventral prostatic lobes and analysis of ejaculate
Surgical lesion procedure
Under deep sodium pentobarbital anesthesia (Pfizer; 26
mg/kg; intraperitoneal) and in a supine position, a midline
abdominal incision was made in male rats (n=6). After the
identification of the urinary bladder, ventral lobes of the
prostate were carefully dissected and excised. Abdominal
musculature and abdominal skin were sutured and the animals
were placed into individual cages to recover. At 5 and 20 days
post-lesion, semen and seminal plug samples were obtained
and evaluated, and statistical analysis of the data was done as
described for experiment 1.
Experiment 3. Assessment of the fertility of males with chemical lesions
of the dorsal lobes or surgical ablation of the ventral lobes
Chemical lesion and surgical ablation
The dorsal prostatic lobes of 7 males were chemically lesioned
and the ventral prostatic lobes of a separate group of 7 males
were surgically ablated, as described above.
262
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
Assessment of fertility
Before the chemical or surgical lesion and again at 20 days
post-lesion, reproductive units were constituted (Manzo et al.,
2000; Lucio et al. 2001). Each male was placed in a cage with
three intact adult females during a test period of 15 days, after
which the females were transferred to individual cages. The
date of parturition, if one occurred, was recorded in order to
determine the exact date of insemination. For analysis, the
test period (15 days) was divided into 3 intervals: days 1-5,
6-10, and 11-15. The number of pregnant females within each
of the three periods was determined, and the number of nonpregnant females was also recorded. Treatment groups were
compared with respect to the number of pregnant females
within each of the three periods. Data of fertility were analyzed
using a G test (Zar, 1999).
RESULTS
Experiment 1. Effect of chemical lesion of dorsal and ventral prostatic
lobes
Statistical analysis did not show behavioral alterations in males
with chemically lesioned dorsal or ventral prostatic lobes (data
not shown).
Analysis of seminal fluid
Five days after chemically lesioning the dorsal prostatic lobe,
none of the semen samples obtained from the uterine horns
were off-white, due to the absence of sperm. In these cases,
therefore, the evaluated viscosity corresponds only to the
uterine fluid, explaining why the obtained value was zero. By
contrast, at 20 days post-lesion, no alterations were observed in
macroscopic parameters (color, viscosity or pH; Table I).
The microscopic analysis could not be performed at 5
days post-lesion due to the absence of spermatozoa in the
uterus; therefore, the sperm concentration was zero. At 20
days post-lesion, the negative effect continued because we
observed a significant reduction in sperm concentration as
well as a significant decrease in the percentage of spermatozoa
with rapid progressive motility, compared to pre-lesion data.
Interestingly, a high percentage of spermatozoa in the uterus
exhibited in situ motility compared to before the lesion. Sperm
viability and sperm morphology at 20 days post-lesion were
similar to that observed before the lesion (Table I).
In contrast to the marked effects of the dorsal lobe lesions,
chemically lesioning the ventral prostatic lobes did not
significantly affect any seminal fluid parameters. Thus, prelesion data of this group of males were similar to that shown in
Table I, and no changes in any parameter of seminal fluid were
observed at either 5 or 20 days post-lesion (data not shown).
Analysis of the seminal plug
In the case of dorsal-lobe lesioned males, when the seminal
plug was obtained, the perivaginal region was observed to be
wet. In many cases, leakage of seminal fluid from the vagina
was easily observed (Fig. 2a). Removal of seminal plug from
the vagina was easy because it was not attached to vaginal
walls and it was wet from seminal fluid. Thus, the chemical
lesion of the dorsal lobes prevented the adhesion of the
seminal plug to the vaginal walls and cervix. Surprisingly,
the macroscopic parameters (consistency, weight, size and
volume), showed no signifi cant changes at either 5 or 20
days after the lesion, compared to pre-lesion (Table II).
TABLE I
Seminal fluid macroscopic and microscopic values before and after chemical lesion of the dorsal prostatic lobes (n=6)
Macroscopic
Seminal fluid Parameters
1) Off-white (% samples)
5 days
20 days
After lesion
100a
0b
100
2) Viscosity (mm)
2a
0b
2.5
3) pH
8
8
8.25
53a
sperm absence
13.5b
24a
sperm absence
32.25b
in situ (% spz)
15.5a
sperm absence
41b
immotility (% spz)
7.5a
sperm absence
13b
motility rate (0-1)
0.7a
sperm absence
0.4b
5) Sperm viability (% spz)
71
sperm absence
71
6) Sperm morphology (% spz)
100
sperm absence
99.5
7) Sperm concentration (106/ml)
13a
0b
7.5b
4) Sperm motility sperm rapid progressive (% spz)
slow progressive (% spz)
Microscopic
Before lesion
Data of parameters were expressed as median. spz=spermatozoa. Friedman test, bP<0.05.
263
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
Microscopic parameters of the seminal plug were altered
only in the proximal end, and only at 5 days after the lesion;
these parameters were unaltered compared to control at 20
days post-lesion. Thus, the smear of the proximal end of
the seminal plug at 5 days post-lesion revealed millions of
agglutinated spermatozoa (for this reason they could not be
quantified; Fig. 2b), many of them displaying in situ motility.
By contrast, in intact males, the smear of this end of the
seminal plug normally showed single heads, single flagella
(typically having a greater percentage of heads than flagella),
and few complete spermatozoa (Fig. 2c). The smear of the
equatorial and distal portions of the seminal plug of lesioned
males showed no differences when compared with smears
from these same males obtained before lesion, either at 5 or 20
days post-lesion.
Chemically lesioning the ventral prostatic lobes did not
affect any of the seminal plug parameters. Thus, pre-lesion
data of this group of males were similar to that shown in Table
II, and no changes in any parameter of the seminal plug were
observed at either 5 or 20 days post-lesion (data not shown).
Figure 2: a) Photograph of the vaginal orifice of a female inseminated by a male with chemically-lesioned dorsal prostatic lobes. Leakage
of seminal fluid can be observed. b) Photomicrograph of a smear from the proximal portion of the seminal plug from a lesioned male.
Millions of spermatozoa can be observed. c) Photomicrograph of a smear of the proximal portion of the seminal plug from an intact male.
Single heads, single flagella, and spermatozoa can be observed. (Bar=200 µm).
TABLE II
Seminal plug macroscopic and microscopic values before and after chemical lesion of the dorsal prostatic lobes (n=6)
Macroscopic
Seminal fluid Parameters
Before lesion
5 days
20 days
After lesion
1) Hardened consistency (% of seminal plugs)
100
100
100
2) Weight (mg)
112
109
111
3) Size length (mm)
13.1
12.1
12.6
5.4
5.4
5.4
4) Volume (mm3)
width (mm)
100
98.99
98.35
5) Cytologic elements
53a
sperm absence
13.5b
single heads (%)
51.11
undistinguishable
54.31
single flagella (%)
37.43
undistinguishable
32.92
spermatozoa (%)
11.44
millions
12.76
single heads (%)
69.68
60.26
86.89
single flagella (%)
17.27
19.19
11.61
spermatozoa (%)
13.03
20.53
1.49
Microscopic
proximal portion
equatorial portion
distal portion
single heads (%)
81.79
47.92
88.31
single flagella (%)
16.41
18.72
11.68
spermatozoa (%)
1.79
33.34
0
Data of parameters were expressed as median. Friedman test, bP<0.05.
264
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
Histological changes in the prostatic lobes after chemical lesion
Experiment 2. Effect of surgical ablation of the ventral prostatic lobes
Figure 3a; b; c shows the histological changes apparent as a
result of the dorsal prostatic lobe lesion. At day 5 post-lesion,
the dorsal lobes showed a massive infiltration of leukocytes
in both the stroma and in the acini. When the histological
examination was done 20 days post-lesion, the infiltration of
leukocytes was diminished. Figure 3d; e; f shows the tissue
organization of the ventral prostatic lobe. The administration
of the sclerosing solution induced only minor damage to
this tissue. The microscopic analysis of the prostatic gland at
day 5 after the chemical lesion showed a significant presence
of macrophages and sparse leukocytes (neutrophyles)
in the stroma, suggesting an inflammatory process. This
inflammatory process was diminished when the tissue was
analyzed 20 days after the lesion.
In order to address the possibility that the lack of an effect
of chemically-lesioning the ventral prostatic lobes could
have been due to insufficient damage to this tissue, we did a
second experiment in which the ventral prostatic lobes were
completely removed surgically. No behavioral effects of ventral
lobe ablation were observed either at 5 or 20 days post-surgery.
Moreover, this procedure did not alter any seminal fluid or
seminal plug parameters. Thus, pre-lesion data were similar to
those shown in Tables I and II, respectively, and no changes in
any seminal fluid or seminal plug parameter were observed at
5 or 20 days post-ablation (data not shown).
Experiment 3. Assessment of fertility after chemically lesioning the dorsal
prostatic lobes or ablation of the ventral prostatic lobes
Figure 4 shows the percentage of females that became pregnant
in different time periods (1-5, 6-10 and 11-15 days) of a 15-day
test period. Most females became pregnant within the first
5 days of cohabitation with unlesioned males. However, 20
days after chemically lesioning their dorsal prostatic lobes,
Figure 3: Histological sections taken from dorsal (left panels)
and ventral (right panels) prostatic lobes before and after
chemical lesion. a, d) Before lesion the acinus and stroma show
their normal morphological characteristics, with no leukocyte
infiltration. b, e) Prostatic tissue 5 days after chemical lesion
shows the presence of macrophages and sparse neutrophyles
in the stroma, indicating an infl ammatory process. c, f) The
inflammatory process is diminished in the prostatic tissue at day
20 after lesion. (arrow=inflammatory process; slices stained with
hematoxiline-eosine; Bar=200 µm). acinus (a); stroma (s)
Figure 4: Percentage of females that became pregnant after
cohabitation with males before (upper panel) and after (lower
panel) they received a chemical lesion of dorsal prostate lobes
(white bars) or surgical ablation of ventral prostate lobes (diagonal
lines bars). Induction of pregnancy was identified at different
periods (1-5, 6-10 and 11-15 days).
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
cohabitation with these same males did not result in a single
pregnancy across the 15 day test period (Fig. 4a). In striking
contrast, ablation of the ventral lobes had no effect of fertility
(Fig. 4b).
DISCUSSION
The rat prostate comprises dorsal, ventral, and lateral lobes.
In the present study, we focused on the participation of
the dorsal and ventral prostatic lobes in the production of
ejaculate and their importance for fertility. Dorsal or ventral
prostatic lobes were chemically or surgically lesioned, and the
resulting changes in the characteristics of the seminal fluid,
seminal plug, and fertility were examined. Lesions of the
lateral prostatic lobes were not performed due to their close
anatomical association with the major pelvic ganglia, which
innervate penis erectile tissue, bulbourethral glands, and other
reproductive structures (Hebel and Stromberg, 1986; Dail et al.,
1989). Thus, lesioning the lateral prostatic lobes would result in
collateral damage to these nervous ganglia, producing a failure
of penile erection and preventing the display of intromission
and ejaculation motor patterns. In fact, the removal of the
dorsolateral prostatic lobes resulted in complete infertility
(Queen et al., 1981).
Our findings are novel relative to those of Queen et al.
(1981) in several important respects. In our study, the damage
due to injection of the sclerosing agent into the dorsal or
ventral prostatic lobes was restricted to the injected lobe;
no histological damage was observed in the non-injected
adjacent prostatic lobe or in the adjacent tissues. In this way,
we were able to test the unique contribution of the dorsal
prostatic lobe without damaging the lateral one; by contrast,
in the study of Queen et al. (1981), both dorsal and lateral
lobes were removed. Moreover, in our study the effect of
dorsal or ventral prostate damage on copula, ejaculate and
fertility was evaluated at 5 and 20 days post-lesion, whereas
in the Queen et al. (1981) study only fertility was analyzed.
Thus, we found that neither dorsal nor ventral prostatic lobe
affected copulatory parameters. Notably, in the Queen et al.
study, the authors did not register copulatory parameters of
the male, therefore, they were not able to distinguish whether
reduced fertility was due to negative effects of the ablation on
copulatory behavior or ejaculate quality.
Lesioning the dorsal prostatic lobes produced two major
effects on the ejaculate. First, the adhesion of the seminal
plug to the vaginal walls was prevented. Although seminal
plugs were coagulated and maintained their weight, size,
and volume, their wet surface, consisting of seminal fluid
containing motile spermatozoa, prevented their vaginal
adhesion. Therefore, sperm transport was affected, probably
due to a lack of hydrostatic pressure exerted by the seminal
plug, which normally pushes spermatozoa from the vagina
through the cervix, to the uterine horns (Blandau, 1945).
As a consequence, the uterine horns contained only uterine
fluid, for that reason, the samples collected showed a value
of zero for viscosity. Nevertheless, it has been described in
intact males, that viscosity depends on the secretions from the
accessory sexual glands (Blandau, 1945).
Previous studies have shown that ablations of different
portions of the seminal vesicles affect seminal plug weight:
when a greater amount of tissue is excised, a lighter seminal
plug is obtained (Carballada and Esponda, 1992). Removal
265
of seminal vesicles also produced infertility in male rats
(Queen et al. 1981). Moreover, it was demonstrated that when
coagulating glands were totally removed, no seminal plug
formed after coitus, and sperm transport to the uterus did not
occur, therefore, males were completely sterile (Carballada and
Esponda, 1992). In intact males, once the seminal plug is firmly
lodged into vagina, many spermatozoa reach the uterine horns
(Matthews Jr and Adler, 1978).
In other studies, reduced fertility has also been associated
with an improperly positioned seminal plug. Male rats treated
with finasteride, a 5 alfa-reductase inhibitor, show reductions
in the weight of both seminal vesicles and prostate, and
deposit small and inadequately positioned seminal plugs,
resulting in reduced fertility (Cukierski et al., 1991).
Our results indicate that adhesion of the seminal plug
to the vaginal walls is critical for sperm transport, and this
adhesion requires secretions of the dorsal prostatic lobes. Using
histochemical markers, it has been demonstrated that dorsal
prostate secretes glycoconjugates. Dorsal lobes are rich in Man,
GlcNac, Fuc, Gal/GalNac and oligosaccharides (Chan and Ho,
1999). Furthermore, dorsal prostate secretes dorsal-proteins I
and II (Seitz et al., 1990). Dorsal-protein I is a major protein of
the dorsal prostate (Kinbara and Cunha, 1996), and, compared
to dorsal-protein I, dorsal-protein II has higher carbohydrate
content (Wilson and French, 1980). The role of dorsal-proteins
has not yet been established, but they apparently do not have
an enzymatic function, since they are at a high concentration in
cytosol (Wilson and French, 1980). It remains to be determined
whether some of these secretions of the dorsal prostatic lobes
promote seminal plug adhesion to the vaginal walls. In the
present study, because sperm transport was disturbed by
lesioning the dorsal lobes, sperm concentration in the uterine
horns was also altered. At 5 days post-lesion, no spermatozoa
were found in the uterus, and at 20 days post-lesion, sperm
concentration (Austin and Dewsbury, 1986) was dramatically
lower compared to that obtained from the same males before
surgery, as well as compared to that reported previously (Lucio
et al., 2009).
The second effect of dorsal prostatic lobe lesions was on
sperm motility in the uterus. At day 20 post-lesion, when
spermatic transport occurred, more than 40% of spermatozoa
presented in situ motility versus 53% of spermatozoa with rapid
progressive motility in intact males. This decrease in sperm
motility was unexpected, because sperm motility is typically
associated with zinc, which is secreted mainly by the lateral
prostatic lobes (Lin et al., 2000). Immotile spermatozoa are
stored in the cauda epididymis. Sperm motility is induced
when spermatozoa are in contact with secretions from the
accessory sex glands at ejaculation (Lindholmer, 1974). The
prostate produces proteins giving an adequate medium for the
survival of sperm, and enhances their motility in the female
reproductive tract (Chow and O, 1998). Human semen includes
semenogelin; this protein inhibits sperm progressive motility,
nevertheless, prostate-specific antigen (PSA) hydrolyses
semenogelin, resulting in sperm motility (Robert and Gagnon,
1996). Patients having low sperm mobility also showed low
PSA levels (Ahlgren et al., 1995). Therefore, it is possible
that secretions of the rat dorsal prostate include hydrolytic
enzymes that, when released into the seminal fluid, facilitate
sperm motility through the female reproductive tract. In fact,
it has been described that the vertebrate prostate, among
another glands, produces glycosidases, exopeptidasas, and
266
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
phospholipases. These enzymes digest proteins in the seminal
plasma and on the surface of the spermatozoa, resulting in the
facilitation of sperm motility (Vanha-Perttula et al., 1990).
In addition to the aforementioned enzymes, other factors
are known to promote sperm motility. Fructose, secreted
mainly by the dorsal prostate and coagulating glands,
is reported to be a source of energy for the motility of
spermatozoa (Mann, 1964). Since coagulating glands were
intact in our experimental males, it seems that the presence
of zinc from lateral prostate and the amount of fructose
secreted by coagulating glands are not sufficient, and that
additional components secreted by the dorsal prostatic lobes
are necessary, for normal sperm motility. Besides fructose,
prostatic secretion contains high concentrations of monovalent
and divalent cations such as Na, K, Zn, Ca and Mg, as well
as citric acid and many enzymes (Wilson et al., 1993). The
interaction of some of these secretions and ions secreted by
the dorsal prostate may affect the metabolism and function of
spermatozoa. Considering the low sperm concentration and
the reduced percentage of spermatozoa with rapid progressive
motility, it was not surprising that all males with dorsal
prostatic lesions were infertile.
We do not know exactly why the ventral prostatic lobe
suffered less damage from the sclerosing agent, but it is
possible that differences in tissue morphology between
the dorsal and ventral lobes could have influenced the
inflammatory response to this compound. The acini of the
dorsal lobes are quite large and less convoluted than either
the ventral or lateral lobes and are loosely distributed
within the stromal tissue, which consists of an assortment
of tissue elements that include extracellular material, small
nerve endings, blood vessels, fibromuscular material, and
fibroblasts. The acini are lined mainly with cuboidal cells,
the secretions of which stain with an intensity between that
of the lateral and ventral lobes (Jesik et al., 1982). These
morphological characteristics could be related to the intensity
of the inflammatory response of the prostatic lobes. In
humans, for example the peripheral zone of the prostate is the
most susceptible to inflammation and is where the majority
of carcinomas occur versus the central zone, which is more
resistant (Cunha et al., 1987). It has been described that the
dorsal and lateral prostatic lobes in the rat are equivalent to the
prostate peripheral zone in man (Price, 1963). Tissue damage
caused by inflammation could impair prostatic function,
perhaps causing a decreased secretion of the kallikrein-like
proteolytic enzyme and an increase in the pH of semen,
resulting in inadequate medium for sperm physiology (Motrich
et al., 2009). In our study, the poor motility shown by the sperm
from dorsal prostatic lesioned males could be another cause for
their lack of fertility.
In contrast to the dramatic effects of dorsal lobe lesions,
chemical lesion or ablation of the ventral prostate did not
change the characteristics of the semen or seminal plug. In
agreement with the results obtained by Queen et al. (1981),
we found that removal of ventral lobes had no effect on the
latency to become pregnant or on the percentage of females
that became pregnant, indicating that these prostatic lobes do
not play a critical role in reproductive parameters of male rats.
Thus, the present results indicate that, in the male rat,
dorsal prostatic lobes are crucial for reproductive success,
whereas the ventral lobes apparently are not necessary for
reproduction, or participate only marginally. This is the first
study in which the parameters of semen and seminal plug were
evaluated using a simple method involving semen acquired
from naturally inseminated females. It will be necessary to
focus on dorsal prostatic lobe to determine the biochemical
components that allow the adhesion of seminal plug to vaginal
walls and also its participation in sperm motility.
ACKNOWLEDGMENTS
This work was partially supported by Consejo Nacional
de Ciencia y Tecnología (CONACYT 105502 to RAL). JLTL
(188574) and AALG (198782) were fellows from CONACYT.
REFERENCES
AHLGREN G, RANNEVIK G, LILJA H (1995) Impaired secretory function of
the prostate in men with oligo-asthenozoospermia. J Androl 16:491-498.
AUSTIN D, DEWSBURY D (1986) Reproductive capacity of male laboratory
rats. Physiol Behav 37:627-632.
BLANDAU RJ (1945) On the factors involved in sperm transport through the
cervix uteri of the albino rat. Am J Anat 77:253-272.
CARBALLADA R, ESPONDA P (1992) Role of fluid from seminal vesicles
and coagulating glands in sperm transport into the uterus and fertility
in rats. J Reprod Fertil 95:639-648.
CHAN FL, HO SM (1999) Comparative study of glycoconjugates of the rat
prostatic lobes by lectin histochemistry. Prostate 38:1-16.
CHOW PH, O WS (1998) Effects of male accessory sex glands on sperm
transport, fertilization and embryonic loss in golden hamsters. Int J
Androl 12:155-163.
CUKIERSKI MA, SINA JL, PRAHALADA S, WISE LD, ANTONELLO JM,
MACDONALD JS, ROBERTSON RT (1991) Decreased fertility in male
rats administered the 5 alfa-reductase inhibitor, finasteride, is due to
deficits in copulatory plug formation. Reprod Toxicol 5:353-362.
CUNHA GR, DONJACOUR AA, COOKE PS, MEE S, BIGSBY RM, HIGGINS
SJ, SUGIMURA Y (1987) The endocrinology and developmental biology
of the prostate. Endocrinol Rev 8:338-362.
DAIL WG, TRUJILLO D, DE LA ROSA D, WALTON G (1989) Autonomic
innervation of reproductive organs: analysis of the neurons whose axons
project in the main penile nerve in the pelvic plexus of the rat. Anat Rec
224:94-101.
GUNN SA, GOULD TC (1957) A correlative anatomical and functional study
of the dorsolateral prostate of the rat. Anat Rec 128:41-53.
GRIFFIN DJ, OKE EJ, CHO KJ, GIKAS PW (1986) Chemical ablation of
the canine kidney using sodium tretradecyl sulphate (Sotradecol). A
histopathologic study. Invest Radiol 21:217-220.
HAYASHI N, SUGIMURA Y, KAWAMURA J, DONJACOUR AA, CUNHA
GR (1991) Morphological and functional heterogeneity in the rat
prostatic gland. Biol Reprod 45:308-321.
HEBEL R, STROMBERG MW (1986) Anatomy and Embriology of the
Laboratory Rat. Germany: BioMed Verlag Wörthree. pp:1-271.
HUMASON GL (1972) Animal Tissue Techniques. San Francisco: WH
Freeman and Co. pp:1-641.
HUMPHREY GF, MANN T (1949) Studies on the metabolism of semen; citric
acid in semen. Biochem J 44:97-105.
JESIK CJ, HOLLAND JM, LEE C (1982) An anatomic and histology study of
the rat prostate. Prostate 3:81-97.
KIMBARA H, CUNHA GR (1996) Ductal heterogeneity in rat dorsal-lateral
prostate. Prostate 28:58-64.
LAWS AND CODES OF MÉXICO (1995) Seventh Title. The Regulations of
the General Law of Health Research. México. 12th updated Porrúa ed.
pp:430-431.
LINDHOLMER C (1974) The importance of seminal plasma for human
sperm motility. Biol Reprod 10:533-542.
LIN YC, CHANG TC, TSENG YJ, LIN YL, HUANG FJ, KUNG FT, CHANG
SY (2000) Seminal plasma zinc levels and sperm motion characteristics
in infertile samples. Chang Gung Med J 23:260-266.
LUCIO RA, FLORES-ROJAS G, AGUILAR F, ZEMPOALTECA R, PACHECO
P, VELÁZQUEZ-MOCTEZUMA J (2001) Effects of genitofemoral nerve
transection on copulatory behavior and fertility in male rats. Physiol
Behav 73:487-492.
LUCIO RA, TLACHI JL, LÓPEZ AA, ZEMPOALTECA R, VELÁZQUEZMOCTZUMA J (2009) Analysis of the parameters of the ejaculate in the
laboratory Wistar rat: technical description. Vet Mex 4:205-215.
TLACHI-LÓPEZ ET AL. Biol Res 44, 2011, 259-267
LUKE MC, COFFEY DS (1994) The male sex accessory tissues. KNOBIL E,
NELLY JD (eds) In The Physiology of Reproduction. Raven Press: New
York. pp:1435-1489.
MANN T (1964) The Biochemistry of Semen and of the Male Reproductive
Tract. Methuen, London. New York. pp:493.
MANZO J, VÁZQUEZ MI, CRUZ MR, HERNÁNDEZ ME, CARRILLO P,
PACHECO P (2000) Fertility ratio in male rats: Effects after denervation
of two pelvic floor muscles. Physiol Behav 68:611-618.
MATTHEWS M, ADLER NT (1977) Facilitative and inhibitory influences
of reproductive behavior on sperm transport in rats. J Comp Physiol
Psychol 91:727-741.
MATTHEWS MK Jr, ADLER NT (1978) Systematic interrelationship of
mating, vaginal plug position, and sperm transport in the rat. Physiol
Behav 20:303-309.
MEISEL RL, SACHS BD (1994) The physiology of male sexual behaviour.
KNOBIL E, NELLY JD (eds) In The Physiology of Reproduction. Raven
Press: New York. Vol 2 pp:3-106.
MOTRICH RD, MACKERN-OBERTI JP, MACCIONI M, RIVERO V (2009)
Effects of autoimmunity to the prostate on the fertility of the male rat.
Fertil Steril 91:2273-2280.
PRESNELL JK, SCHREIBMAN MP (1997) Animal Techniques. Baltimore The
Johns Hopkins University Press. pp:1-572.
PRICE D, WILLIAMS-ASHMAN HG (1961) The accessory reproductive
glands of mammals. YOUNG ED WC (ed) In Sex and Internal
Secretions. Baltimore Williams & Wilkins Press. pp: 366-448.
PRICE D (1963) Comparative aspects of development and structure in the
prostate. Natl Cancer Inst Monogr 12:1-27.
267
QUEEN K, DHABUWALA CB, PIERREPOINT CG (1981) The effect of the
removal of the various accessory sex glands on the fertility of male rats.
J Reprod Fertil 62:423-426.
ROBERT M, GAGNON C (1996) Purification and characterization of the
active precursor of a human sperm motility inhibitor secreted by the
seminal vesicles: identity with semenogelin. Biol Reprod 55:813-821.
SETCHELL BP, MADDOCKS S, BROOKS DE (1994) Anatomy, vasculature,
inervation and fluids of the male reproductive tract. KNOBIL E, NELLY
JD (eds) In The Physiology of Reproduction. Raven Press: New York. Vol
1 pp:1063-1177.
SEITZ J, KEPPLER C, RAUSCH U, AUMULLER G (1990)
Inmunohistochemistry of secretory transglutaminase from rodent
prostate. Histochemistry 93:525-530.
VANHA-PERTTULA T, JAUHIAINEN A (1983) Aminopeptidases of the
rat prostatic complex and seminal vesicles: secretion and effect of
castration. Mol Cell Endocrinol 32:195-204.
VANHA-PERTTULA T, RONKKO S, LAHTINEN R (1990) Hydrolases from
bovine seminal vesicle, prostate and Cowper´s gland. Andrologia 22:10-24.
WILSON MJ, GARCIA B, WOODSLON M, SINHA AA (1993) Gelatinolytic
and caseinolytic proteinase activities in the secretions of the ventral,
lateral and dorsal lobes of the rat prostate. Biol Reprod 48:1174-1184.
WILSON EM, FRENCH FS (1980) Biochemical homology between rat dorsal
prostate and coagulating gland. Purification of a major androgeninduced protein. J Biol Chem 25:10946-109WILSON MJ, SINHA AA,
POWELL JEH, ESTENSEN RD (1988) Plasminogen activator activities in
the developing rat prostate. Biol Reprod 38:723-731.
ZAR JH (1999) Biostatistical Analysis. Prentice-Hall Inc. pp:1-663.
Biol Res 44: 269-275, 2011
The subsidiary GntII system for gluconate metabolism in Escherichia
coli: Alternative induction of the gntV gene
Keyla M Gómez, Andrea Rodríguez, Yesseima Rodriguez, Alvaro H Ramírez and Tomás Istúriz
Laboratorio de Fisiología y Genética de Microorganismos. Departamento de Biología Celular, Centro de Biología Celular e Instituto de Biología Experimental,
Facultad de Ciencias, Universidad Central de Venezuela, Apartado 47557, Caracas 1041-A, Venezuela.
ABSTRACT
Two systems are involved in the transport and phosphorylation of gluconate in Escherichia coli. GntI, the main system, consists of high and
low-affinity gluconate transporters and a thermoresistant gluconokinase for its phosphorylation. The corresponding genes, gntT, gntU and
gntK at 76.5 min, are induced by gluconate. GntII, the subsidiary system, includes IdnT and GntV, which duplicate activities of transport
and phosphorylation of gluconate, respectively. Gene gntV at 96.8 min is divergently transcribed from the idnDOTR operon involved in
L-idonate metabolism. These genetic elements are induced by the substrate or 5-keto-D-gluconate. Because gntV is also induced in cells
grown in gluconate, it was of interest to investigate its expression in this condition. E. coli gntK, idnO<>kan mutants were constructed to
study this question. These idnO kan-cassete inserted mutants, unable to convert gluconate to 5-keto-D-gluconate, permitted examining gntV
expression in the absence of this inducer and demonstrating that it is not required when the cells grow in gluconate. The results suggest that
E. coli gntV gene is alternatively induced by 5-keto-D-gluconate or gluconate in cells cultivated either in idonate or gluconate. In this way,
the control of gntV expression would seem to be involved in the efficient utilization of these substrates.
Key terms: E. coli, gluconate, GntII, gntV.
INTRODUCTION
The genetics and physiology of transport and phosphorylation
of gluconate (Gnt) in Escherichia coli have turned out to be
highly complex (Fig. 1). Previous work has described the
genes involved, as well as their regulation. There are two
systems encoded by operons distinctly regulated and located
in different regions of the bacterial chromosome (Bächi and
Kornberg, 1975, Istúriz et al., 1979). GntI, the main system,
consists of high and low affinity gluconate transporters (GntT,
GntU) and a thermoresistant gluconate kinase (GntK, Fig.1A).
The gntT and the gntKU genes constitute two operons located
in the bioH-asd region of the chromosome at 76.4 and 77.1 min,
respectively, on the E. coli map (Fig.1B). These operons, as well
as that of the Entner Doudoroff pathway (EDP, edd-eda), are
induced by gluconate and negatively controlled by the gntR
gene product (77.1 min) in a regulatory network known as the
gntR regulon (Zwaig et al., 1973, Tong, et al., 1996, Izu et al.,
1997, Peekhaus and Conway, 1998).
GntII, the subsidiary system, contains another high affinity
gluconate transporter (IdnT) and also a thermosensitive
gluconate kinase (GntV, Fig.1A). It was revealed by the
gluconate negative phenotype of BBI, an E. coli mutant
carrying two lesions linked to fdp and malA markers, affecting
a subsidiary gluconate transporter and the regulatory gntR
gene respectively (Bächi and Kornberg, 1975). Later, it was
confirmed by the selection in mineral medium with gluconate
of spontaneous fermenting pseudorevertants of E. coli
HfrG6∆MD2, a bioH-gntTKUR-asd deleted mutant that cannot
grow in gluconate. One representative pseudorevertant,
mutant C177 (∆gntR), expressed the dehydratase (edd, 41 min)
in mineral medium with glucose and formed when grown in
media with gluconate, both a high-affinity transporter for this
substrate and the thermosensitive gluconokinase. The lesion
responsible for this gluconate positive phenotype designated
as gnt177 was located at 96 min on the map, 76% linked to pyrB
(Istúriz et al., 1979).
Much has been learned about the GntII system over the
present and past two decades. Gene gntV, located at 96.8 min
(Istúriz et al., 1986, Burland et al., 1995), is monocistronic and
divergently transcribed from the idnDOTR operon (Fig.1B),
which encodes enzymes that metabolizes L-idonic acid (Idn) to
D-gluconate (Bausch et al., 1998). Enzyme IdnD, an L-idonate
5-dehydrogenase, converts incorporated idonate to 5-ketoD-gluconate (5KG), which in turn is transformed to gluconate
by IdnO, a 5-keto-D-gluconate 5-reductase. Gluconate is then
phosphorylated to 6-phosphogluconate by GntV (IdnK),
whose gene is coordinately induced with the idnDOTR operon.
IdnT was found to function as a permease for transport of
both idonate and gluconate, indicating that the GntII system
contains the enzymes of a pathway for idonate catabolism
where gluconate is an intermediate (Fig. 1A). IdnR was
identified as a positive regulator of the idnR regulon with 5KG
as the inducer (Bausch et al., 1998). A negative regulatory effect
of IdnR on the gntT, gntKU and edd-eda operons (not shown in
Fig.1) is indicative of a cross-regulation between the gntR and
idnR regulons (Tsunedomi et al., 2003a, Ramírez et al., 2007).
The fact that gntV is also induced in wild type cells grown
in gluconate led us to wonder whether this expression is also
under the positive control of the 5KG-IdnR complex. Previous
reports do not favor this possibility, so the present work was
undertaken to resolve the question. Although cells grown in
gluconate display a poor induction of the idnDOTR operon,
there is strong induction of GntK and GntV expression (Istúriz
et al., 1986, Bausch et al., 2004). Moreover, in gluconate-limited
mineral medium continuous culture, the total gluconate
* Corresponding author: Tomás Istúriz. Instituto de Biología Experimental, Facultad de Ciencias, Universidad Central de Venezuela, Apartado 47557, Caracas 1041-A, Venezuela.
[email protected] Fax: 58 212 7535897; Telephone. 58 212 7510766 ext. 2164
Received: August 4, 2010. In revised form: January 1, 2011. Accepted: January 11, 2011.
270
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
mutation the E. coli idnR regulon is induced by 5KG formed
from gluconate by IdnO activity (Ramírez 2004, Ramirez et
al., 2007). The fact that gntK, idnO<>kan mutants grow in
gluconate despite being disabled from converting it to the
inducer 5 KG , revealed that in this case gntV expression is
independent of that of the idnDOTR operon and presumably
is induced by gluconate. This alternative induction displayed
by gntV seems to be important for an efficient utilization of the
involved substrates. The results permit a better understanding
of the cross-regulation between GntI and GntII systems.
kinase activity, consisting of GntV at very low dilution
rates (D), is gradually repressed as the induction of GntK
increases as a consequence of the progressive increase of D
and corresponding increment in the concentration of limiting
substrate. These findings indicated that gntV induction,
contrary to that of gntK, occurs mainly at low gluconate
concentrations (Coello and Istúriz, 1992).
The possibility that gntV expression occurs independently
of the IdnR-5KG complex is also suggested by the complexity
of the intergenic regulatory region between gntV and idnD.
This region includes promoter-operator sequences for the gntV
gene and the idnDOTR operon, each with a binding element for
GntR or IdnR. These regulators have 42% similarity between
their entire primary sequences and 70% identity between their
DNA-binding motifs. In addition, there are two binding sites
for cAMP-CRP complex and another for GntR or IdnR (Izu et
al., 1997, Tsunedomi et al., 2003b).
Here we demonstrate that the induction of gntV in E. coli
grown in gluconate occurs in the absence of 5KG and is not
coordinated with that of the idnDOTR operon; furthermore,
in this condition gluconate is suggested as the inducer. The
study involved the construction and analysis of two E. coli
gntK, idnO<>kan sets of mutants, differentiated by the presence
of the mutation gnt177 in one of them. In the presence of this
MATERIALS AND METHODS
Bacterial strains
The Escherichia coli strains used in this study are listed in Table
I. The genetic markers were previously reported (Berlyn et al.,
1996).
Media
E. coli strains were grown in Luria-Bertani broth (LB) or
mineral medium [MM (Tanaka et al., 1967)] or on LB plates,
MM plates or gluconate bromthymol blue indicator plates
A
Pentose Phosphate
Pathway
D- Gluconate
GntT
GntU
IdnT
Gnd
GntK
D-Gluconate
GntV
EntnerDoudoroff
Pathway
6P-Gluconate
IdnO
L-Idonate
Idn T L-Idonate IdnD
5KG
B
0/100
idn R
idn T idn O idn D
5KG
i
gnt T
gnt V
Gnt-GntR
gnt U gnt K
96.8
GntII
77.0 GntI
76.4
E. coli Genome
41.6
gnt R
eda-edd
Fig. 1. Enzymes and respective genes of L-Idonate (Idn) and Gluconate (Gnt) catabolisms. Abreviations: 5KG, 5-keto-D-gluconate; GntT and
GntU, GntI permeases; GntK and GntV, GntI and GntII gluconate kinases respectively; IdnT idonate and gluconate permeases; IdnD, idonate
dehydrogenase; IdnO, 5KG reductase; IdnR, idnR regulon regulator; GntR, gntR regulon regulator; Edd, Entner-Doudoroff dehydratase; Eda,
Entner-Doudoroff aldolase.
271
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
[GBTB (Istúriz, et al., 1986)]. MM was supplemented with
carbon source as indicated at 2 g l-1, 5 μg ml-1 of thiamine
hydrochloride, and 20 μg ml-1 of L-amino acids as required. If
necessary, MM and rich media were supplemented with 500
and 40 μg ml-1 DL-a-e-diaminopimelic acid (DAPA) respectively.
When required tetracycline (Tet) was used at 15 μg ml -1,
kanamycin (Kan) at 30 mg ml-1, and 5KG at 0.4%.
Enzyme assays
Growth conditions
The preparation of P1 lysates and generalized transductions
were performed as reported (Miller, 1992) using a P1 phage
stock kept in the laboratory.
Cells were routinely grown aerobically at 37 °C, in volumes of
10 ml for growth curves and 20 ml for enzyme assays in 125 ml
flasks fitted with side arms, on a gyratory water bath (model
G76, New Brunswick) at about 200 cycles min-1. In each case,
the growth was monitored by reading the optical density in a
Klett colorimeter with a N° 42 filter.
Gluconokinase activity and its heat inactivation were assayed
as previously described (Fraenkel and Horecker, 1964, Istúriz et
al., 1986). Activities are reported as nmol min-1 (mg protein)-1.
Phages and generalized transductions
DNA manipulations and transformations
Conventional and standard recombinant DNA techniques were
employed (Sambrook et al., 1989).
Preparation of crude extracts
Construction of mutants
Cells were harvested by centrifugation, resuspended in 50 mM
Tris-HCl 10 mM MgCl2 (pH 7.6) and disrupted with a Braun
Sonic 2000 (12T probe, 45 wattage level) by three 20s sonication
pulses (3 pulses) separated by 30s cooling periods. Cell debris
was, in each case, removed by centrifugation at 27000xg for 15
min.
To construct the mutants required for this work, we first
constructed E. coli TK412 (idnO<>kan) using recombineering
[Yu, et al., 2000 (Fig. 2A)]. First, an 1150 bp kanamycine
recombinant cassette with idnO internal sequences on its flanks
was generated by PCR from E. coli Y1088 proA::Tn5, kan (Young
and Davis, 1983) chromosomal DNA, using PCR primers
TABLE I
Strains of E. coli
Strain Source
Phenotypes on Plat
Sex
M1
HfrC
Prototrophic
Y
Gnt+
[6]
C177
HfrG
gnt177, ∆ (bioH –asd)
Y
Gnt+
This Lab.
Y1088
F-
proA::Tn5, KanR
Y
Gnt+
[29]
TAF394
HfrC
λcI857 ∆(cro-bioA)
Y
Gnt+
This Lab.
DY329
F-
∆ lac U169 nadA::Tn10, gal490 λcI857 ∆ (cro-bioA)
Y
Gnt+
[28]
TK411
HfrC
λcI857 ∆(cro-bioA), idnO<>kan
Y
Gnt+
This study
TK412
HfrC
idnO<>kan
Y
Gnt+
This study
TK416
HfrG
Δ(bioH-gntT-malA-glpD, gntKU, gntR asd) his, gnt177, idnO<>kan
W
Gnt-
This study
TGN282
F-
gntK, gntV, his, trp, xyl, gal
W
Gnt-
This Lab.
TK424
HfrG
gntK, gnt177, his, idnO<>kan
W
Gnt-
This study
TK425
HfrG
gntK, gnt177, his
Y
Gnt+
This study
TUR285
F-
malA-glpD-asd, gntV zhg21::Tn10, his, trp, xyl, gal
Y
Gnt+
This Lab.
TK414
HfrC
idnO<>kan, TetR, malA
Y
Gnt+
This study
Wa
Gnt-b
This study
Y
Gnt+
This study
Relevant Characteristics
TetS,
Mal+,
TK428
HfrC
idnO<>kan,
TK430
HfrC
idnO<>kan, TetS, Mal+
gntK
Phenotypes on plates
(24 h) BTB Mineral
Source
All the strains are E. coli K12 derivatives. The genetics markers were as previously described (Berlyn et al., 1996). Y (yellow) and W (white) colonies on BTB gluconate
plates indicate fermenting and non-fermenting phenotypes respectively. The colonies were tested by streaking fresh colonies and scoring after 24 h incubation. Gnt+
and Gnt- indicate growth and no growth, respectively, on mineral agar plates with gluconate. aFermenting phenotypes at 48 h. bGrowth at about 48 h. <> to indicate a
replacement generated by homologous recombination techniques.
272
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
PAHNO1 (5’CAGGTGGCCGTTTACGAAATCAGAGGCTTTTGAAGAAAGGAACA
CCGCATCAGAAGAACTCGTCAAGAAG3’) and PAHNO2 (5’GCAGCAAAAGT
CCAGCTTGTTTTCTAAGAGATAAATAAAGAAATAATACACATGGACAGCAAGCGAA
CCG3’).
Second, the recombinant cassette was used to transform
E. coli TAF394 [(λcI857∆(cro-bioA)], a suitable lambda lysogen
for promoting linear recombination. Third, E. coli TK411
[(λcI857∆(cro-bioA) idnO<>kan] a lysogen KanR transformant,
was cured from the defective prophage by transducing it to Bio+
at 42 0C with P1 phage grown in E. coli M1. Finally, we selected
idnO<>kan transductant E. coli TK412 (idnO<>kan) for later work.
The idnO gene (850 bp) only or kan inserted (1250 bp) were
amplified with primers PAH5: 5’CGGAATTCCGGGGGGCTGTTAAACAGC
CAC3’ and PAH6: 5’CGGGATCCCGAGATAAATAAAGGAATAATA3’(Fig. 3).
To obtain isogenic gntK, idnO<>kan E. coli strains with or
without the gnt177 mutation, phage P1 grown in E. coli TK412
was used to transduce E. coli C177 to KanR (Fig. 2B). E. coli
TK416, a KanR transductant and E. coli C177, were in turn made
gntT+, gntK, gntU+ by transducing them to Mal+, Asd+ and
restoring their bioH-asd regions with phage P1 grown in E. coli
TGN282 (gntK). Two transductants were selected, E. coli TK424
(gntK, idnO<>kan, gnt177) and E. coli TK425 (gntK, gnt177) and
saved for use in this work.
In order to obtain a second and similar pair of E. coli
mutants that lacked the gnt177 mutation, strain TK412 was
made GntV dependent to growth in gluconate by incorporating
it a gntK allele in two steps (Fig. 2A). First, it was transduced
to TetR, Malˉ with P1 phage grown in E. coli TUR285. Second,
a selected transductant E. coli TK414, was in turn transduced
A
to Mal+ with phage P1 grown in E. coli TGN282 (gntK). Among
the TetS transductants, two phenotypes arose on BTB gluconate
plates: one formed white non-fermenting colonies after 24 h
of incubation that became yellow after 48 h incubation. The
other formed unchanging, yellow fermenting colonies. It is
known (Istúriz et al., 1986) and demonstrated below, that such
phenotypes indicate the functioning of the thermosensitive
(GntV) and thermoresistant (GntK alone or mixed with GntV)
gluconate kinases respectively. A transductant of each type,
E. coli TK428 and E. coli TK430 respectively, was saved for
subsequent studies. PCR analysis confirmed the genotypes of
mutants (not shown).
Chemicals
D-gluconic acid (potassium salt), pyrimidine nucleotides,
sugars, amino acids and most other chemicals were purchased
from Sigma. Media were from L-Himedia Lab. Primers were
from Promega and GIBCOBRL.
RESULTS
Characteristics of E. coli mutants TK424 (idnO<>kan, gntK, gnt177)
and TK425 (gntK, gnt177)
Because E. coli mutant TK425 carries the gnt177 and gntK
mutations, its growth in gluconate must depend on the
inducible expression of the idnR regulon (idnDOTR and gntV
B
E. coli M1 (WT)
P1(E. coli DY329)
E. coli TAF394
[ȜcI857 ¨ (cro-bioA)]
Electroporation
Recombinant
kan cassette
E. coli TK425
[gnt177, Mal+, gntK-]
E. coli TK411
(OcI857, idnO<>kan)
P1(E. +coli TGN282)
Mal selection
P1(E. coli M1)
E. coli C177
OcI857
[' (bioH-asd), gnt177 GntII+]
P1(E. coli TK412)
E. coli TK412
Kan R selection
(idnO<>kan)
P1(E. coli TUR285)
TetR selection
E. coli TK416
[' (bioH-asd), gnt177, idnO<>kan]
E. coli TK414
[idnO<>kan, TetR, Mal-]
P1(E. coli TGN282)
+
Mal selection
E. coli TK428
[idnO<>kan, Tets, Mal+, gntK]
E. coli TK430
[idnO<>kan, Tets, Mal+]
Fig. 2. Construction of E. coli mutants: For markers not indicated, see Table I.
P1(E.+ coli TGN282)
Mal selection
E. coli TK424
[gnt177, idnO<>kan, Mal+, gntK-]
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
operons) by the 5KG-IdnR complex (Ramírez, 2004). In this case,
the inducer 5KG is formed from gluconate by the IdnO activity.
Consequently, the set formed by this mutant and its isogenic E.
coli TK424 was suitable to confirm the efficiency of the inserted
kan cassette to abort the IdnO activity.
The above mutants grew on LB plates and mineral plates
supplemented with maltose or fructose but in contrast to the
gntK, gnt177 control strain TK425, E. coli TK424 (idnO<>kan,
gntK, gnt177) was KanR and required 5KG to grow on mineral
plates with gluconate. Moreover, the colonies of E. coli TK424
were white nonfermenting on BTB-gluconate plates, but
yellow fermenting after 48 h incubation if supplemented
with 5KG (Table II). In agreement with these results, although
both mutants displayed normal generation times in MM with
fructose (57 and 59 min) and fructose plus gluconate (58 and 65
min) , E. coli TK424 required 5KG to grow in gluconate and this
growth had a lag period and a doubling time (300 and 242 min,
respectively) that were longer than those of E. coli C177 (240
and 180 min) and the isogenic E. coli TK425 (30 and 80 min)
grown in MM supplemented with gluconate (Table III).
The gluconate kinase activity was also measured in E. coli
TK424 and TK425 grown in MM with fructose, fructose plus
gluconate, and this substrate, with and without 5KG. E. coli
C177 grown in MM with gluconate, was used as an additional
control (Table IV). Where this activity was detected, it was
thermosensitive and expressed in inducible form. The level
displayed by E. coli TK424 grown in gluconate supplemented
with 5KG [44 nmol min-1 (mg protein)-1] was lower than those
expressed in E. coli C177 and TK425 [62 and 106 nmol min1 (mg protein) -1 ] grown in the same medium without 5 KG
respectively (Table IV).
1
2
3
4
5
6
7
1250 bp
1150 bp
850 bp
Fig. 3. Electrophoretic analysis in 0.8 % agarose gel of PCR
products. Lane 1, 1 Kb DNA ladder; lanes 2, 3 and 4, kan
cassettes from E. coli Y1088, TK411 and TK412; lane 5, idnO from
E coli TAF394; lanes 6 and 7, idnO<>kan from E. coli TK411 and
TK412.
273
Characteristics of E. coli mutants TK428 (idnO<>kan, gntK, TetS) and
TK430 (idnO<>kan)
Since these mutants lack the mutation gnt177, the control on
the gntV expression should be as in E. coli wild type, therefore,
they were suitable to investigate whether this expression in
cells grown in gluconate depends on 5KG as inducer and is
coordinated with that of the operon idnDOTR. This is just what
occurs when E. coli is grown in idonate and the inducer 5KG is
formed from idonate by the IdnD activity (Bausch et al., 1998).
Both mutants grew on MM plates supplemented with maltose,
fructose, LB plus kanamycine but, as expected, did not grow
on LB plus tetracycline (Table II). Interestingly, in agreement
with their fermenting phenotypes displayed on BTB-gluconate
plates (Table II), these mutants grew in MM supplemented
with gluconate without requiring 5KG (Table III); however, the
lag period (245 min) and doubling time (155 min) showed by E.
coli TK428 were notably higher than those in E. coli TK430 (50
and 60 min respectively).
The level of specific thermosensitive (70% heat inactivated)
gluconate kinase expressed in E. coli TK428 [40 nmol min-1
(mg protein)-1] did not increase with the addition of 5KG to the
medium and was significantly lower than that displayed by E.
coli TK430 [141 nmol min-1 (mg protein)-1] expressing mainly
the thermoresistant GntK (7% heat inactivated; Table IV).
DISCUSSION
The idnR regulon, induced by 5 KG in E. coli grown in idonate,
includes the gntV gene encoding a thermosensitive gluconate
kinase which is also induced in gluconate grown cells. As it
was not known whether in this case 5 KG is the inducer, the
research presented here was addressed to elucidating this
question. Our results indicate that gntV is expressed in the
absence of 5 KG when gluconate is the substrate. They were
obtained through the construction and comparative analysis
of two sets of isogenic E. coli gntK, idnO<>kan mutants,
differing by the presence of the mutation gnt177 in one of
them.
Because idonate is not commercially available, the
gluconate phenotype displayed by the set of E. coli idnO kan–
cassette inserted mutants carrying the gnt177 mutation, was of
central importance in the present work. Since in these mutants
the idn regulon (idnDOTR operon plus gntV) is induced by 5KG
in cells growing in gluconate, they were not only suitable to
demonstrate the efficiency of the idnO kan–cassete insertion to
abort the IdnO activity, but also permitted determining that in
similar mutants lacking the gnt177 mutation, gntV expression
does not involve 5 KG as the inducer in cells cultivated in
gluconate.
In the above context, it was demonstrated that while 5KG is
essential for E. coli TK424 (idnO<>kan, gntK, gnt177) to grow
in gluconate, it is not required by the isogenic E. coli TK425
(idnO+) control (Table III). Contrary to E. coli TK424, E. coli
TK428 (idnO<>kan, gntK) grows in gluconate without requiring
5KG despite being blocked in the synthesis of this inducer. This
indicates that under this condition gntV is expressed in absence
of idnDOTR operon induction (Table III).The 5KG requirement
of E. coli TK424 for growth on MM with gluconate indicated
that the inserted kan cassette eliminated IdnO activity so it
could be assumed that it is also absent in both E. coli TK428
and E. coli TK430.
274
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
TABLE II
Phenotypes on plates of strains of E. coli
Media
TK424
TK425
TK428
TK430
C177
LB Tetracycline
-
-
-
-
-
Maltose MM
+
+
+
+
-
Fructose MM
+
+
+
+
+
Gluconate MM
Gnt -
Gnt+
Gnt+b
Gnt+
Gnt+
Gluconate MM + 5 KG
Gnt+b
Gnt+
n.d
Gnt+
Gnt+
BTB, Gluconate
W
Y
Wa
Y
Y
BTB, Gluconate + 5 KG
Wa
Y
Wa
Y
Y
+
–
+
+
–
LB Kanamycine.
Y (yellow), W (white), Gnt+, Gnt−,
determined.
a
and
b
respectively, indicate as described in Table I. + and
_
signs indicate growth and no growth on the respective plates. n.d, not
TABLE III
Doubling times (min) of strains of E. coli
TK424
Carbon Source
TK425
TK428
TK430
C177
LP
DT
LP
DT
LP
DT
LP
DT
LP
DT
Fructose
~20
57
~30
59
~20
55
~25
53
n.d
n.d
Fructose + Gluconate
~20
58
~20
65
n.d
n.d
n.d
n.d
n.d
n.d
~40
82
~245
155
~50
60
~240
180
~30
80
~240
222
n.d
n.d
n.d
n.d
Gluconate
no growth
Gluconate + 5KG (0.4 %)
~300
242
Cells were grown aerobically on MM with fructose, collected during the exponential phase, centrifuged (3000 rpm., Sorval SS34), resuspended in the same medium up
to 300 Klett units (KU, about 109 cells ml-1) and starved during 30 min at 37 °C. New cultures were initiated at about 10 UK (approximately 107 cells ml-1) with the
indicated carbon sources at 0.2%. LP, lag phase; DT, doubling time; ~ approximately; n.d, not determined.
TABLE IV
Gluconate kinase activities in E. coli strains
Carbon source
TK424
TK425
TK428
TK430
C177
Fructose
< 0.01
< 0.01
< 0.01
< 0.01
< 0.01
Fructose + Gluconate
< 0.01
47±5 (70)
n.d
n.d
n.d
Fructose + Gluconate + 5KG
< 0.01
61±7
n.d
n.d
n.d
no growth
106±8 (85)
40±4 (70 )
141±7 (7 )
62
44±5 (90)
n.d
36±6 (97)
n.d
n.d
Gluconate
Gluconate + 5KG
Cells were grown as indicated in Table III. New cultures without previous starvation were grown up to120 KU in MM with the indicated carbon sources at 0.2%.
n.d, not determined; Numbers in parenthesis indicate gluconokinase lability (percentage of activity lost after three hours preincubation at 30 °C). The values for the
activities represent means ± standard deviations from two independent experiments. For units, see Materials and methods.
GÓMEZ ET AL. Biol Res 44, 2011, 269-275
As demonstrated, E. coli TK428 gntV expression is activated
by gluconate in the absence of 5KG. Since GntR interacts with
gluconate to control the gntR regulon, and GntR binding sites
are included in the gntV-idnD intergenic regulatory region of
the idnR regulon, this same complex might be also involved
in gntV induction. Interestingly, GntR was found to have
a negative effect on the expression of GntII genes in gntRdisrupted strains carrying single copies of gntV-lacZ or idnDlacZ fusions. This effect was not observed by the addition of
gluconate, presumably due to the formation of a Gnt-GntR
complex (Tsunedomi et al., 2003b).
The lack of idnDOTR expression in E. coli does not alter the gluconate
phenotype
E. coli TK430 (GntK+, idnO<>kan) grows in MM gluconate
with a shorter generation time (60 vs. 155 min; Table III) and
has higher levels of gluconokinase [141 vs. 40 nmol min-1 (mg
protein)-1; Table IV] than E. coli TK428 (GntK–, idnO<>kan).
Notably, while the gluconate kinase expressed in this mutant
is thermosensitive (70% inactivated), that expressed by E. coli
TK430 is mainly thermoresistant GntK (7% inactivated; Table
IV). Despite lacking the ability to form 5KG from the substrate,
this characteristic of E. coli TK430 and its short lag period (25
min; Table III) in MM with gluconate are attributes of a wild
type gluconate phenotype.
The idonate-gluconate crosstalk in E. coli wild type
The characteristics of the two sets of E. coli mutants used here
would seem to reveal an important and novel physiologic
aspect by which the gene gntV is induced by 5KG or gluconate
depending upon whether idonate or gluconate is metabolized.
This alternative induction of gntV might be of importance for
the development of the bacteria in its natural environment
where, as opposed to lab conditions, substrate concentrations
are very low. In such a situation, it is not so obvious for
energy-saving reasons that the utilization of either substrate
requires the induction of both regulons; i.e., idnR and gntR.
The alternative induction of the E. coli gntV gene reported here
would seem to impede this situation by being coordinated with
that of the idnDOTR operon or the gntR regulon depending on
which substrate, idonate or gluconate, is metabolized. It is of
interest to advance in the molecular mechanisms associated
with this alternative expression of gntV.
ACKNOWLEDGEMENTS
This work was supported by FONACIT, Grant N o S12001000704 and CDCH-Universidad Central de Venezuela,
Grant No PI 03 00 6308 2006.
275
REFERENCES
BACHI B, KORNBERG HL (1975) Genes involved in the uptake and
catabolism of gluconate by Escherichia coli. J Gen Microbiol 90: 321-335.
BAUSCH C, PEEKHAUS N, UTZ C, BLAIS T, MURRAY E, LOWARY T,
CONWAY T (1998) Sequence analysis of the GntII (Subsidiary) system
for gluconate metabolism reveals a novel pathway for L-idonic acid
catabolism in Escherichia coli. J Bacteriol 180: 3704-3710.
BAUSCH C, RAMSEY M, CONWAY T (2004) Transcriptional organization
and regulation of the L-idonic acid pathway (GntII System) in Escherichia
coli. J Bacteriol 186: 1388-1397.
BURLAND V, PLUNKET III G, SOFIA KJ, DANIELS DL, BLATTNER FR
(1995) Analysis of the Escherichia coli genome VI: DNA sequence of the
region from 92.8 though 100 minutes. Nucleics Acids Res 23: 2105-2119.
COELLO N, ISTÚRIZ T (1992) The metabolism of gluconate in Escherichia
coli. A study in continuous culture. J Basic Microbiol 32: 309-315.
FRAENKEL DG, HORECKER BL (1964) Pathways of D-glucose metabolism
in Salmonella typhimurium. J Biol Chem 239: 2765-2771.
ISTÚRIZ T, VITELLI-FLORES J, MARDENI J (1979) El metabolismo del
gluconato en Escherichia coli. Estudio de una mutante delecionada en la
región bioH-asd del mapa cromosómico. Acta Cient Vlana 30: 391-395.
ISTÚRIZ T, PALMERO E, VITELLI-FLORES J (1986) Mutations affecting
gluconate catabolism in Escherichia coli. Genetic mapping of the locus for
the thermosensitive gluconokinase. J Gen Microbiol 132: 3209-3219.
IZU H, ADACHI O, YAMADA M (1997) Gene organization and
transcriptional regulation of the gntRKU operon involved in gluconate
uptake and catabolism of Escherichia coli. J Mol Biol 267: 778-793.
MILLER JH (1992) A short course in Bacterial Genetics. Cold Spring Harbor
Laboratory Press. Cold Spring Harbor, New York.
PEEKHAUS N, CONWAY T (1998) Positive and negative transcriptional
regulation of the Escherichia coli gluconate regulon gene gntT by GntR
and the AMP (cAMP)-cAMP receptor protein complex. J Bacteriol 180:
1777-1785.
RAMIREZ A (2004) El metabolismo del ácido glucónico en Escherichia coli.
Estudios moleculares del sistema subsidiario GntII. Tesis Doctoral.
Facultad de Ciencias, Universidad Central de Venezuela, Caracas,
Venezuela.
RAMIREZ A, ROSALES I, PORCO A, DÍAZ JC, ISTÚRIZ T (2007) The
metabolism of gluconate in Escherichia coli. Physiological evidence of a
regulatory effect of IdnR on the expression of the gntR regulon operons.
Acta Cient Vlana 58: 21-28.
SAMBROOK J, FRITSCH E, MANIATIS T (1989) Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, New York.
TA N A K A S S , L E R N E R A , L I N E C ( 1 9 6 7 ) R e p l a c e m e n t o f a
phosphoenolpyruvate-dependent phosphotransferase by a nicotinamide
adenine dinucleotide-linked dehydrogenase for the utilization of
mannitol. J Bacteriol 93: 642-648.
TONG S, PORCO A, ISTURIZ T, CONWAY T (1996) Cloning and molecular
genetic chacarterization of the Escherichia coli gntR, gntK and gntU genes
of GntI, the main system for gluconate metabolism. J Bacteriol 178: 32603269.
TSUNEDOMI R, IZU H, KAWAI T, MATSUSHITA K, FERENCI T, YAMADA
M (2003 a) The activator of GntII genes for gluconate metabolism, GntH,
exerts negative control of GntR-regulated GntI genes in Escherichia coli. J
Bacteriol 185: 1783-1795.
TSUNEDOMI R, IZU H, KAWAI T, YAMADA M (2003 b) Dual control by
regulators, GntH and GntR, of the GntII genes for gluconate metabolism
in Escherichia coli. J Mol Microbiol 6: 41-56
YOUNG RA, DAVIS RW (1983) Yeast RNA polymerase II genes: Isolation
with antibody probes. Science 222: 778-782.
YU D, ELLIS HL, LEE E, JEMKINS UA, COPELAND NG, COURT DL (2000)
An efficient recombination system for chromosome engineering in
Escherichia coli. PNAS 97: 5978-5983.
ZWAIG N, NAGEL DE ZWAIG R, ISTÚRIZ T, WECKSLER M (1973)
Regulatory mutations affecting the gluconate system in Escherichia coli. J
Bacteriol 114: 469-473
Biol Res 44: 277-282, 2011
tlpA gene expression is required for arginine and bicarbonate
chemotaxis in Helicobacter pylori
Oscar A. Cerda#, Felipe Núñez-Villena*, Sarita E. Soto*, José Manuel Ugalde*, Remigio López-Solís*
and Héctor Toledo*&
#
Department of Neurobiology, Physiology and Behavior, University of California, Davis, CA 95616-8519
* Laboratorio de Microbiología Molecular, Programa de Biología Celular y Molecular, ICBM, Facultad de Medicina, Universidad de Chile. Avenida Independencia 1027.
Casilla 70086, Santiago-7, Chile
ABSTRACT
About half of the human population is infected with Helicobacter pylori, a bacterium causing gastritis, peptic ulcer and progression to
gastric cancer. Chemotaxis and flagellar motility are required for colonization and persistence of H. pylori in the gastric mucus layer. It is
not completely clear which chemical gradients are used by H. pylori to maintain its position. TlpA, a chemotaxis receptor for arginine/
bicarbonate, has been identified. This study aimed to find out whether tlpA gene expression is required for the chemotactic response to
arginine/bicarbonate. Wild-type motile H. pylori ATCC 700392 and H. pylori ATCC 43504, a strain having an interrupted tlpA gene, were
used. Also, a tlpA-knockout mutant of H. pylori 700392 (H. pylori 700-tlpA::cat) was produced by homologous recombination. Expression
of tlpA was assessed by a Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) assay. Chemotaxis was measured as a Relative
Chemotaxis Response (RCR) by a modified capillary assay. H. pylori 700392 presented chemotaxis to arginine and sodium bicarbonate. H.
pylori 700-tlpA::cat showed neither tlpA gene expression nor chemotaxis towards arginine and bicarbonate. Besides confirming that TlpA is a
chemotactic receptor for arginine/bicarbonate in H. pylori, this study showed that tlpA gene expression is required for arginine/bicarbonate
chemotaxis.
Key words: tlpA, chemotaxis, Helicobacter pylori, arginine, bicarbonate.
INTRODUCTION
Helicobacter pylori, a motile Gram-negative human pathogen
that causes gastritis and duodenal/gastric ulcers and
represents a high risk of gastric cancer, inhabits the gastric
mucus layer (McGowan et al., 1996). Most of these bacteria
live deep in the layer of mucus gel and close to the surface
of the epithelium. Mucus is continuously secreted by surface
epithelial cells of the gastric glands and is degraded at the
luminal surface of the mucus layer (Schreiber and Scheid,
1997). Because of a rapid mucus turnover, H. pylori cells need
motility and spatial orientation to avoid being dragged into the
lumen, where the acidic pH inhibits growth and paralyzes cell
motility (Schreiber et al., 1999; Worku et al., 1999). Accordingly,
orientation plays a central role both in acute colonization and
chronic persistence of H. pylori.
Motile bacteria sense chemical gradients by means of
chemoreceptor proteins that relay the information to the
flagellar motor (Bren and Eisenbach, 2000). All gastric
Helicobacter species are highly motile. In recent years,
comparative genomics in various Helicobacter species
and related bacteria has facilitated the analysis of genes.
Experiments with H. pylori in different animal models have
shown that flagellar motility is essential to colonize the
gastric mucusa (Ernst and Gold, 2000). H. pylori shows taxis
response towards urea, amino acids and bicarbonate whereas
it moves away from H+ (Cerda et al., 2003; Croxen et al., 2006;
Mizote et al., 1997; Worku et al., 2004). In addition to motility,
recent studies in in vivo systems have shown that H. pylori
chemotaxis is required for colonization and infl ammatory
response induction in gastric mucosa (Andermann et al.,
2002; Williams et al., 2007). However, it is still unclear which
combination of chemical gradients H. pylori uses in vivo to
maintain an optimal position in the gastric mucus layer
(Schreiber et al., 2004). By using genomic analysis it has been
shown that the chemotaxis system of H. pylori is genetically
similar to the one in Salmonella. However, extensive functional
analysis of potentially participating proteins is still necessary.
Only four genes with homology to chemotaxis receptors
have been identified in H. pylori: tlpA, tlpB, tlpC, tlpD (Tomb
et al., 1997). Sensing specifi cities of these four annotated
H. pylori chemosensors have not been comprehensively
described. In vitro negative taxis to acidic pH was found to
be dependent on the sensor protein TlpB (Croxen et al., 2006).
On the other hand, Schweinitzer et al. (2008) reported that
TlpD is a receptor for energy taxis. Positive taxis to arginine
and bicarbonate have been observed in vitro (Cerda et al.,
2003; Mizote et al., 1997; Worku et al., 2004) and reported to
be dependent on TlpA function (HP0099, according to the
annotated genome sequence of H. pylori strain 26695) (Cerda
et al., 2003). The H. pylori sensor TlpA has been expressed
heterologously in E. coli and found to provide tactic movement
towards arginine, bicarbonate and urea (Cerda et al., 2003).
Interestingly, the tlpA gene was found to be interrupted by
a mini IS605 sequence in the H. pylori 43504 strain, which
fails to recognize either arginine or sodium bicarbonate
as chemoattractants (Cerda et al., 2003). However, straindependency has not been discarded yet. In this work, we
present further evidence on the role of TlpA as a chemotactic
receptor by showing that tlpA disruption in the H. pylori wildtype strain ATCC 700392 causes loss of in vitro chemotactic
response to arginine and bicarbonate.
* Corresponding author. Tel.: (56-2) 978-6053; FAX: (56-2) 735-5580. E-mail: [email protected]
Received: October 20, 2010. In revised form: February 28, 2011. Accepted: March 2, 2011.
278
TOLEDO ET AL. Biol Res 44, 2011, 277-282
MATERIALS AND METHODS
H. pylori strains
Bacterial strains used in this study were H. pylori strains
ATCC 700392 and ATCC 43504. In addition, in this study H.
pylori 700tlpA::cat was developed. Frozen stocks and replated
cultures of the H. pylori strains were used. As recommended
by ATCC, the strains were cultivated on TSA agar plates
[trypticase soy agar plates (Becton Dickinson Biosciences)
supplemented with 5% sheep blood (Public Health Institute of
Chile), culture supplement Vitox (Oxoid) and antibiotic culture
supplement Dent (Oxoid)] for 24 h at 37 ºC in 5.5% CO2 and
85% humidity.
Chemotaxis assay
Bacterial cells were scraped from the plates and suspended
in chemotaxis buffer (10 mM potassium phosphate, pH
7.0; 3.0% polyvinylpyrrolidone) at a concentration of 3.0
x 108 cells per ml (OD560 = 0.4). The chemotaxis assay was
done as previously described by Cerda et al. (2003). Briefly,
100 μl of bacterial suspension were placed into a 200-μl
disposable pipette tip. On the other hand, a 100 μl volume
of a solution containing 10 mM of the compound to be tested
for chemotactic response (buffer alone served as control) was
aspirated through a 25 G stainless-steel needle (0.254 mm ID
x 20 mm long) into a 1-ml tuberculin syringe. The needlesyringe system was fitted to the pipette tip in such a way
that most of the needle became immersed into the bacterial
suspension. The system was positioned horizontally and
incubated at 30 ºC for 45 min. Finally, the needle-syringe
system was separated from the bacterial suspension, cleaned
externally and 10-fold serially diluted in chemotaxis buffer.
Dilutions were plated onto 4% (w/v) trypticase soy agar
plates supplemented with 5% horse serum (HyClone),
culture supplement Vitox (Oxoid) and antibiotic culture
supplement Dent with 5.5% CO2 and 85% humidity. Those
culture conditions enhanced visualization of colonies. After
24 h incubation at 37 ºC the number of colony-forming units
(CFUs) per plate was counted. Each assay was performed in
duplicate. Results were expressed as the mean of at least five
independent assays. To ascertain whether a test compound
was or was not an attractant, a relative chemotaxis response
(RCR) was calculated as the ratio between the number of
bacteria entering the needle-syringe system in a dilution
dependent manner and the number of bacteria in the
control condition. A relative chemotaxis response of 2 or
greater was considered significant (Adler, 1973; Cerda et al.,
2003; Mazumder et al., 1999; Moulton and Montie, 1979).
Differences between groups were analyzed statistically by
using the Student’s t-test.
Motility assay
Bacterial cells grown in 5.5% CO2 and 85% humidity at 37 ºC
for 5 days on TSA agar plates were scrapped and suspended
in phosphate saline buffer pH 7.2 (PBS). The suspended cells
were stab inoculated with toothpicks into plates containing
0.3% agar (Difco), trypticase soy broth (Becton Dickinson
Biosciences), 5% horse serum (HyClone), culture supplement
Vitox and antibiotic culture supplement Dent. Cells were
cultured at 37 ºC for 48 h in 5.5% CO2 and 85% humidity.
Motility was scored by measuring the diameter of the growth
zone after 48 h (Cerda et al., 2003).
DNA manipulations and genetic techniques
Chromosomal DNA from H. pylori was isolated as previously
described (Owen and Bickley, 1997). To produce a tlpA
knockout H. pylori mutant, a PCR tlpA amplicon from H.
pylori strain 700392 (Cerda et al., 2003) was fi rstly cloned
into pBR322. Then, the chloramphenicol acetyl transferase
gene (cat) from C. coli (Wang and Taylor, 1990) was inserted
at a SacI restriction site of tlpA to create the plasmid pBR322tlpA::cat. Log phase recipient cells were prepared from
overnight TSA agar plates. To do so, bacteria were scraped
from the agar surface, washed twice in 1 ml of 10% cold
glycerol and recovered after spun down at 2935 xg for 6 min
in an Eppendorf centrifuge 5415C. The bacterial sediment
was resuspended in 0.5 ml of 10% glycerol, mixed with 3-8
μg of pBR322-tlpA::cat plasmid DNA and the suspension was
spotted onto bacterial TSA agar plates followed by incubation
for 12-16 h in 5.5% CO 2 and 85% humidity to enhance
transformation. Bacteria were scrapped from the agar surface
and suspended in a minimal volume of PBS to inoculate
TSA agar plates containing 15 μg ml-1 of chloramphenicol.
Transformed colonies (H. pylori 700-tlpA::cat) were isolated
from the plates after incubation for 4-5 days. Further details
of the procedure for insertion mutation were obtained from
Croxen et al. (2006) and Andermann et al. (2002). Correct
allelic replacement was confirmed by PCR of genomic DNA
isolated from resistant colonies, using TlpA-F and TlpA-R
primers (Table 1). Treatments of DNA with restriction
enzymes, T4 DNA ligase and T4 DNA polymerase were
performed according to protocols recommended by the
supplier (Promega).
mRNA extraction and RT-PCR analysis
Total mRNA from H. pylori 700395, H. pylori 43504 and the H.
pylori 700-tlpA::cat mutant were isolated and purified using
RNeasy Mini Kit (Qiagen). Total cDNA was synthesized using
cDNA CoreKit (Bioline) following manufacturer’s instructions.
PCRs were performed in a PTC-100 MJ Research thermal
cycler using cTlpA-F and cTlpA-R primers and 16S-F and
16S-R as internal control (16S rDNA H. pylori-specific primers)
(Table 1).
RESULTS AND DISCUSSION
Metabolic reconstitutio n experiments based on genomics
data of H. pylori showed the essential character of at least
eight amino acids (i.e. alanine, arginine, histidine, leucine,
methionine, phenylalanine, valine and cysteine) in the
absence of sulphate as sulfur source (Schilling et al., 2002).
Against this background, we tested the chemotactic response
of the H. pylori 43504 and 700392 strains aiming to identify
new TlpA ligands. In these experiments, seven of ten tested
amino acids proved to be non attractants in both strains. In
accordance with previous results (Cerda et al., 2003), both
strains recognized L-serine and L-aspartate as attractants.
However, L-arginine was attractant for H. pylori 700392 but
non attractant for H. pylori 43504 (Fig. 1).
279
TOLEDO ET AL. Biol Res 44, 2011, 277-282
TABLE 1
Primers used in the study
Primer
Sequence
Reference
TlpA-F
5’ CGATTGGACGTCTTTTTAATCC 3’
TlpA-R
5’ CCCGCAAAAGCTTCTTTAGC 3
Cerda et al, 2003
TlpB-F
5´ CCGCATATGATGTTTTCTTCAATGTTTGC 3´
This study
TlpB-R
5´ CCGGGATCCATTAAAACACGCCGTGATCAC 3´ This study
TlpC-F
5´ ATG AAA TC TACA AGA ATT GG 3`
This study
TlpC-R
5´ TTC TTT TAA GGT AAT AGA GG 3´
This study
16S-F
5´GCTAAGAGATCAGCCTAT 3´
This study
16S-R
5´CCTACCTCTCCCACACTCTA 3´
This study
Previously, we had found that tlpA (ORF HP0099) codes
for a receptor protein that recognizes arginine and sodium
bicarbonate as attractants in H. pylori 700392. In addition,
we found that the lack of chemotactic behavior of H. pylori
43504 strain towards arginine and bicarbonate was associated
with a mini-IS605 insertion in the tlpA gene. This observation
provided a knockout model for the TlpA function. In order
to confirm that the loss-of-function of the tlpA gene in the H.
pylori 43504 strain was not a strain-dependent phenomenon
we assayed the effect of disrupting the tlpA gene in H. pylori
700392. This strain is chemotactic to arginine/bicarbonate. To
this end, we inserted a cat cassette into the tlpA gene (Fig. 2A).
Insertion into tlpA was confirmed by PCR amplification and
observation of either the expected ~2 kb, 2.3 kb or 3 kb bands
in H. pylori 700392, H. pylori 43504 and H. pylori 700-tlpA::cat
mutant, respectively (Fig. 2B). No differences in amplicon size
were observed in the MCPs genes tlpB (ORF HP0103) and
Cerda et al, 2003
tlpC (ORF HP0082) from H. pylori 700392, H. pylori 43504 and
H. pylori 700-tlpA::cat strains, thus showing a single allelic
replacement of the tlpA gene (Fig. 2B).
PCR product ~2 kb
A
gDNA H. pylori 700392
tlpA
Direct transformation/
Allelic exchange
cat
pBR322-tlpA::cat
CamR colonies
selection
PCR product ~3 kb
gDNA tlpA::cat mutant
*
B
*
Mr (kb)
1
0
e
e
e
r
e
e
e
te
ine phan
ate inin
ffe
nin
nin stein
din
rta Serin
uc
Bu thio
Ala Histi
y
tam Arg
pa
Le
pto
u
s
C
e
l
y
r
A
M
G
T
Figure 1. H. pylori 700392 is attracted by aspartate, serine and
arginine. Relative chemotactic response (RCR) of H. pylori 43504
(filled bars) and 700392 (empty bars) to 10 mM amino acids. A
buffer solution served as a negative control and 10 mM aspartate
and 10 mM serine as positive controls, as described for strain
700392 (Cerda et al., 2003). Chemotactic responses were tested
using a capillary assay, as described under Materials and Methods.
Each bar represents average and corresponding standard deviation
of at least 5 independent experiments (*p < 0.05, ** p < 0.01).
tlpA
700392
43504
tlpA::cat
*
700392
43504
tlpA::cat
2
*
43504
tlpA::cat
RCR
3
**
*
cat
700392
4
tlpB
tlpC
3.0
2.3
2.0
1.6
Figure 2. Construction of the tlpA::cat mutant in H. pylori 700392.
A. Schematic outline of H. pylori 700tlpA::cat mutant construction
through the allelic replacement of tlpA gene in H. pylori 700392.
Predicted PCR amplicons with TlpA-F/TlpA-R primers from
genomic DNA (gDNA) are shown. B. tlpA, tlpB and tlpC PCR
amplifi cation from H. pylori 700392, 43504 and 700tlpA::cat
gDNA demonstrates the replacement of tlpA gene in H. pylori
700tlpA::cat mutant. No differences between tlpB and tlpC
amplicon sizes were observed.
280
TOLEDO ET AL. Biol Res 44, 2011, 277-282
Synthesis of tlpA mRNA in the H. pylori 700-tlpA::cat
mutant was evaluated by RT-PCR. From the analysis of total
cDNA, no expression was detected in H. pylori 43504 and H.
pylori 700-tlpA::cat mutant, thus showing that the mini-IS605
and the cat insertions cause loss of tlpA expression on both H
pylori strains (Fig. 3A). Next, the motile behavior was tested
as to whether tlpA loss-of-function caused a negative motile
phenotype in the bacterium. Soft agar assays showed that
the H. pylori 700-tlpA::cat mutant and the H. pylori 43504 and
700392 strains present a similar motility behavior. The diameter
of growth halo for the three H. pylori strains ranged between
18 and 24 ± 2 mm after 48 h (Fig. 3B), thus demonstrating that
the tlpA insertion mutation in H. pylori 700-tlpA::cat does not
alter the swimming behavior of the bacteria. Accordingly, we
assayed the chemotactic response towards sodium bicarbonate
and L-arginine using the H. pylori 700-tlpA::cat mutant. This
strain was found to exhibit a similar chemotactic phenotype
as that of H. pylori 43504, that is, no chemotactic response
either to sodium bicarbonate or arginine (Fig. 4, Table 2). These
results confirm our previous conclusion that tlpA codes for a
chemotactic receptor that in H. pylori recognizes arginine and
bicarbonate as attractants.
Motility and chemotaxis have been considered two
important processes in colonization, persistence and
inflammatory response (Andermann et al., 2002; Williams et
al., 2007; Pittman et al., 2001; Ottemann and Lowenthal, 2002;
McGee et al., 2005; Terry et al., 2005; Wunder et al., 2006;
Castillo et al., 2008; Lowenthal et al., 2009). Tlps chemotactic
receptors constitute a well known group of proteins playing
an adaptive role in H. pylori. Various authors have described
the roles of TlpA, and TlpB in H. pylori colonization and
persistence (Croxen et al., 2006; Andermann et al., 2002).
H. pylori niche is the stomach mucus layer in which a pH
gradient is established between lumen (pH 3.0) and epithelium
(pH 7.0). Local pH variations may represent a limit condition
for H. pylori chemotaxis in its niche, thus restricting the
A
Mr (kb)
Condition
N° of CFUs*/syringe (mean ± SD) at 45 min
H. pylori 700392
H. pylori 700tlpA::cat
Buffer
637 ± 25
343 ± 17
Bicarbonate
1.400 ± 38
345 ± 10
Arginine
1.705 ± 43
296 ± 20
(*) CFUs: colony-forming units.
B
B
1.0
0.6
0.4
TABLE 2
Chemotactic response of H. pylori to arginine and bicarbonate
-RT
+RT
-RT
+RT
-RT
+RT
t
ca
92 4
03 350 lpA::
0
7
4
t
local stomach colonization (Schreiber et al., 2004). H. pylori
infection is predominant in antrum and corpus. Positive taxis
towards arginine and bicarbonate could participate in territory
preferences of H. pylori in stomach colonization. On the other
hand, Croxen et al., (2006) demonstrated the role of TlpA in
pH negative taxis and colonization. Urease is the major factor
in acid resistance (Mendz and Hazell, 1996). This enzyme
hydrolyzes urea to ammonia and carbon dioxide, thus favoring
proton neutralization. In addition, bicarbonate secretion
by gastric epithelia is related to local pH neutralization.
Bicarbonate is secreted into the gastric mucosa by a chloridebicarbonate exchanger that is localized in parietal cells whereas
Na+ is secreted by a Na+-H+ exchanger that is localized in
the mucous neck cells, chief cells and surface mucous cells
(Stuart-Tilley et al., 1994). The chemotactic response to sodium
bicarbonate may also contribute to the persistence of H. pylori.
Since the bicarbonate anion is one of the reaction products of
urease activity, this response might be important in the absence
of urea. Arginine uptake may constitute an important survival
mechanism of H. pylori in the stomach niche. In H. pylori,
arginine is both an essential amino acid (Schilling et al., 2002)
PCR: tlpA
A
C
1.0
0.6
0.4
PCR:16S
Figure 3. tlpA loss-of-function does not alter motile phenotype in H. pylori 700tlpA::cat mutant. A. tlpA RT-PCR from 700392, 43504 and
700tlpA::cat total mRNA. Note the lack of tlpA expression in both H. pylori 43504 and H. pylori 700tlpA::cat mutant due to mini-IS605 and
cat cassette insertions, respectively. No reverse transcriptase in the reaction mix (-RT) with H. pylori 700392 mRNAs was used as negative
control. B. Motility assays in soft agar. Cell suspensions of H. pylori 700392 (A), H. pylori 43504 (B) and H. pylori 700tlpA::cat (C) were
stabbed on 0.3% agar TSA plates and incubated as described under Materials and Methods. Both mutant strains spread in clear concentric
rings because of their motility (representative experiment).
TOLEDO ET AL. Biol Res 44, 2011, 277-282
and a substrate for urea cycle, a metabolic pathway implicated
in nitrogen metabolism in this organism (Mendz and Hazell,
1996). Therefore, positive taxis towards arginine could
favor its uptake in the gastric environment, thus producing
metabolic effects. By both avoiding low pH zones, as a primary
mechanism, and approaching regions of the stomach with
high levels of arginine, bicarbonate and other aminoacids, as
a secondary one, bacteria could improve their colonization
fitness. In this regard, crosstalk signaling between TlpA and
TlpB pathways could play a major role in antrum colonization.
It is well known that MCPs may form different arrays and
organize complex networks between different receptors, in
which CheW, CheA, CheR and CheB proteins are involved,
thus enhancing signal transduction. Even though in H. pylori
CheB/CheR enzymes have not been yet identified, other
adaptive proteins may play related roles in this organism. For
instance, the CheV paralogs CheV1, CheV2 and CheV3, which
have been proposed as MCPs interacting proteins, have been
found to modulate CheA autophosphorylation (Lowenthal
et al., 2009; Pittman et al., 2001). Future insights on TlpA/
TlpB and accessory protein arrangements will be necessary to
clarify possible cooperative roles of these proteins in H. pylori
colonization.
TlpA seems to be a ubiquitously distributed protein
among the Helicobacter sp., including H. hepaticus, H. mustelae,
H. felis and other sixteen H. pylori strains (http://blast.ncbi.
nlm.nih.gov/Blast.cgi). In addition, Andermann et al. (2002)
have shown that tlpA loss-of-function impairs colonization
capability of H. pylori. This evidence suggests a strong role
of TlpA in H. pylori survival, inflammatory evasion and in
re-population after antibiotic treatment, marking it a possible
target for inhibitor drug design against this receptor and/or
protein partners involved in TlpA signal transduction. Future
4
*
RCR
3
**
*
2
**
1
0
r
ffe
u
B
e
inin
g
r
A
-
O3
HC
Figure 4. tlpA null mutant shows loss of arginine and sodium
bicarbonate chemotactic response. Relative chemotactic responses
(RCR) of H. pylori 700392 (empty bars) and 700tlpA::cat (filled
bars) are shown. Chemotactic properties of the tlpA null strain
differed significantly (*p<0.05, **p<0.01) from the isogenic
parent strain. Averages and means from at least 5 independent
experiments are shown.
281
research in this field will open opportunities for new H. pylori
eradication therapies.
ACKNOWLEDGMENTS
We thank Mr. N. Villarroel for his valuable technical support.
This research was supported by Grant FONDECYT # 1085193.
REFERENCES
ADLER J (1973) A method for measuring chemotaxis and use of the method
to determine optimum conditions for chemotaxis by Escherichia coli. J
Gen Microbiol 74: 77-91.
ANDERMANN TM, CHEN Y, OTTEMANN KM (2002) Two predicted
chemoreceptors of Helicobacter pylori promote stomach infection. Infect
Immun 70: 5877-5881.
BREN A, EISENBACH M (2000) How signals are heard during bacterial
chemotaxis: protein-protein interactions in sensory signal propagation. J
Bacteriol 182:6865-6873.
CASTILLO AR, WOODRUFF AJ, CONNOLLY LE, SAUSE WE, OTTEMANN
KM (2008) Recombination-based in vivo expression technology
identifies Helicobacter pylori genes important for host colonization. Infect
Immun 76:5632-5644.
CERDA O, RIVAS A, TOLEDO H (2003) Helicobacter pylori strain
ATCC700392 encodes a methyl-accepting chemotaxis receptor protein
(MCP) for arginine and sodium bicarbonate. FEMS Microbiol Letters
224:175-181.
CROXEN MA, SISSON G, MELANO R, HOFFMAN PS (2006) The
Helicobacter pylori chemotaxis receptor TlpB (HP0103) is required for pH
taxis and for colonization of the gastric mucosa. J Bacteriol 188:26562665.
ERNST PB, GOLD BD (2000) The disease spectrum of Helicobacter pylori: the
immunopathogenesis of gastroduodenal ulcer and gastric cancer. Ann
Rev Microbiol 54:615-640.
LOWENTHAL AC, SIMON C, FAIR AS, MEHMOOD K, TERRY K,
ANASTASIA S, OTTEMANN KM (2009) A fixed-time diffusion analysis
method determines that the three cheV genes of Helicobacter pylori
differentially affect motility. Microbiology (Reading, England) 155:11811191
MAZUMDER R, PHELPS TJ, KRIEG NR, BENOIT RE (1999) Determining
chemotactic responses by two subsurface microaerophiles using a
simplified capillary assay method. J Microbiol Methods 37:255-263.
McGEE DJ, LANGFORD ML, WATSON EL, CARTER JE, CHEN YT,
OTTEMANN KM (2005) Colonization and inflammation deficiencies in
Mongolian gerbils infected by Helicobacter pylori chemotaxis mutants.
Infect Immun 73:1820-1827.
McGOWAN CC, COVER TL, BLASER MJ (1996) Helicobacter pylori and
gastric acid: biological and therapeutic implications. Gastroenterology
110:926–938.
MENDZ GL, HAZELL SL (1996) The urea cycle of Helicobacter pylori.
Microbiology (Reading, England) 142:2959-2967.
MIZOTE T, YOSHIYAMA H, NAKAZAWA T (1997) Urease-independent
chemotactic responses of Helicobacter pylori to urea, urease inhibitors,
and sodium bicarbonate. Infect Immun 65:1519-1521.
MOULTON RC, MONTIE TC (1979) Chemotaxis by Pseudomonas aeruginosa. J
Bacteriol 37:274-280.
OTTEMANN KM, LOWENTHAL AC (2002) Helicobacter pylori uses motility
for initial colonization and to attain robust infection. Infect Immun
70:1984-1990.
OWEN RJ, BICKLEY J (1997) Isolation of H. pylori genomic DNA and
restriction analysis. In: Methods in Molecular Medicine: Helicobacter
pylori Protocols, pp. 81-88. Edited by C. L. Clayton and H. L. T. Mobley.
Totowa, NJ: Humana Press Inc.
PITTMAN MS, GOODWIN M, KELLY DJ (2001) Chemotaxis in the human
gastric pathogen Helicobacter pylori: different roles for CheW and the
three CheV paralogues, and evidence for CheV2 phosphorylation.
Microbiology (Reading, England) 147:2493-2504.
SCHILLING CH, COVERT MW, FAMILI I, CHURCH GM, EDWARDS JS,
PALSSON BO (2002) Genome-scale metabolic model of Helicobacter
pylori 26695. J Bacteriol 184:4582-4593.
SCHREIBER S, KONRADT M, GROLL C, SCHEID P, HANAUER G,
WERLING HO, JOSENHANS C, SUERBAUM S (2004) The spatial
orientation of Helicobacter pylori in the gastric mucus. Proc Natl Acad Sci
USA 101:5024–5029.
282
TOLEDO ET AL. Biol Res 44, 2011, 277-282
SCHREIBER S, SCHEID P (1997) Gastric mucus of the guinea pig: proton
carrier and diffusion barrier. Am J Physiol Gastrointest Liver Physiol
272:G63-G70.
SCHREIBER S, STÜBEN M, JOSENHANS C, SCHEID P, SUERBAUM S
(1999) In vivo distribution of Helicobacter felis in the gastric mucus of the
mouse: experimental method and results. Infect Immun 67:5151-5156.
SCHWEINITZER T, MIZOTE T, ISHIKAWA N, DUDNIK A, INATSU S,
SCHREIBER S, SUERBAUM S, AIZAWA S, JOSENHANS C (2008)
Functional characterization and mutagenesis of the proposed behavioral
sensor TlpD of Helicobacter pylori. J Bacteriol 190:3244-3255.
STUART-TILLEY A, SARDET C, POUYSSEFUR J, SCHWARTZ MA, BROWN
D, ALPER SL (1994) Immunolocalization of anion exchanger AE2 and
cation exchanger NHE-1 in distinct adjacent cells of gastric mucosa. Am
J Physiol 266:C559–C568.
TERRY K, WILLIAMS SM, CONNOLLY L, OTTEMANN KM (2005)
Chemotaxis plays multiple roles during Helicobacter pylori animal
infection. Infect Immun 73:803-811.
TOMB JF, WHITE O, KERLAVAGE AR, CLAYTON RA, SUTTON
GG, FLEISCHMANN RD, KETCHUM KA, KLENK HP, GILL S,
DOUGHERTY BA, NELSON K, QUACKENBUSH J, ZHOU L,
KIRKNESS EF, PETERSON S, LOFTUS B, RICHARDSON D, DODSON
R, KHALAK HG, GLODEK A, MCKENNEY K, FITZEGERALD LM, LEE
N, ADAMS MD, HICKEY EK, BERG DE, GOCAYNE JD, UTTERBACK
TR, PETERSON JD, KELLEY JM, COTTON MD, WEIDMAN JM, FUJII
C, BOWMAN C, WATTHEY L, WALLIN E, HAYES WS, BORODOVSKY
M, KARP PD, SMITH HO, FRASER CM, VENTER JC. (1997) The
complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature 388:539-547.
WANG Y, TAYLOR DE (1990) Chloramphenicol resistance in Campylobacter
coli: nucleotide sequence, expression, and cloning vector construction.
Gene 94:23-28.
WILLIAMS SM, CHEN YT, ANDERMANN TM, CARTER JE, McGEE DJ,
OTTEMANN KM (2007) Helicobacter pylori chemotaxis modulates
inflammation and bacterium-gastric epithelium interactions in infected
mice. Infect Immun 75:3747-3757.
WORKU ML, KARIM QN, SPENCER J, SIDEBOTHAM RL (2004)
Chemotactic response of Helicobacter pylori to human plasma and bile. J
Med Microbiol 53:807-811.
WORKU ML, SIDEBOTHAM RL, WALKER MM, KESHAVARZ T, KARIM
QN (1999) The relationship between Helicobacter pylori motility,
morphology and phase of growth: implications for gastric colonization
and pathology. Microbiology 145:2803-2811.
WUNDER C, CHURIN Y, WINAU F, WARNECKE D, VIETH M, LINDNER
B, ZÄHRINGER U, MOLLENKOPF HJ, HEINZ E, MEYER TF (2006)
Cholesterol glucosylation promotes immune evasion by Helicobacter
pylori. Nat Med 12:1030-1038.
Biol Res 44: 283-293, 2011
Heterogeneous periodicity of drosophila mtDNA: new refutations of
neutral and nearly neutral evolution
Carlos Y Valenzuela
Programa de Genética Humana, ICBM, Facultad de Medicina, Universidad de Chile. Independencia 1027, Casilla 70061, Santiago, Chile.
ABSTRACT
We found a consistent 3-site periodicity of the χ29 values for the heterogeneity of the distribution of the second base in relation to the first
base of dinucleotides separated by 0 (contiguous), 1, 2, 3 … 17 (K) nucleotide sites in Drosophila mtDNA. Triplets of χ29 values were found
where the first was over 300 and the second and third ranged between 37 and 114 (previous studies). In this study, the periodicity was
significant until separation of 2011K, and a structure of deviations from randomness among dinucleotides was found. The most deviant
dinucleotides were G-G, G-C and C-G for the first, second and third element of the triplet, respectively. In these three cases there were more
dinucleotides observed than expected. This inter-bases correlation and periodicity may be related to the tertiary structure of circular DNA,
like that of prokaryotes and mitochondria, to protect and preserve it. The mtDNA with 19.517 bp was divided into four equal segments
of 4.879 bp. The fourth sub-segment presented a very low proportion of G and C, the internucleotide interaction was weaker in this subsegment and no periodicity was found. The maintenance of this mtDNA structure and organization for millions of generations, in spite of a
high recurrent mutation rate, does not support the notion of neutralism or near neutralism. The high level of internucleotide interaction and
periodicity indicate that every nucleotide is co-adapted with the residual genome.
Key terms: DNA organization, non-protein-coding evolution, ordered nucleotide sequences, inter-base associations, refutation of neutralism.
INTRODUCTION
Studies of evolution have assumed that most or all evolutionary
processes are directly or indirectly related to protein synthesis
and regulation (Nei, 2005; Valenzuela, 2009, 2010a; Nei et al.,
2010). The acquisition and maintenance of the genetic code
(as a whole) have been accepted non-critically as an out-ofevolution process. However, if the genetic code was acquired
and is maintained by selective processes, all the other processes
founded on the code are also selective. This non-critical
position occurs with other aspects related to the structure,
size and shape of the hereditary material (chromosomes,
DNA or RNA segments), non-protein-coding functions and
structures, replication functions (velocity, structural restrictions,
etc.), number of bases, tandem repeat segments, isochores,
signatures and several other properties of the hereditary
material. For example, no systematic evolutionary studies
have been performed on the acquisition and maintenance of
isochores and signatures present in the biotic world for more
than a thousand million years (Valenzuela, 2007, 2009, 2010a).
Recurrent forward and backward point and chromosome
mutations occurring equally (neutrally) at any nucleotide site
destroy inexorably any chromosome or gene organization.
These non-protein-synthesis and regulation-coding functions
cannot be studied by the statistics of mutations, substitutions
or fixations in relation to protein-coding functions (occurring at
the first, second and third position of the codon), or in relation
to associated functions as synonymous or non-synonymous
fixations, or to biases of codon usage. The evolution of the
chromosome structure (its constitution in centromeres, arms
and telomeres) cannot be studied according to the genetic
code for most chromosome segments have non-proteincoding functions. It is necessary to realize that protein-coding
functions are a part of all the coding functions of the hereditary
material. We can mention among these functions the foldingcoding-functions for putting DNA or RNA viruses into their
capsids or envelopes; coiling or hypercoiling-coding functions
of prokaryotes or mitochondrion DNA; information for the
relationships of DNA with histones or other associated proteins,
information for the constitution of telomeres and centromeres,
etc. These non-protein-coding characters and functions behave
with non-Mendelian inheritance. Here, Mendelian inheritance
is synonymous with particulate inheritance (Mendel’s laws
are cases of particulate segregation), in opposition to diffuse
inheritance (Darwin’s belief that the paternal and maternal
“genetic factors” fuse in descendants). Thus, mitochondrial,
prokaryote and virus inheritance, as we study them at present
as far as genes are concerned, are fully Mendelian. The
examination of a point mutation may help us to understand.
When guanine (G) mutes to thymine (T) in a protein-coding
segment, several kinds of phenotypes (pleiotropy) are
produced (a mutation is always pleiotropic). I) a gene change
leading to a synonymous or a non-synonymous mutation
with Mendelian behavior. II) A structural change in the DNA
because G (two chemical rings of purines) is larger than T (one
ring of pyrimidines). This change is inherited as a Lamarckian
character. III) A change in the velocity of replication and
transcription because G-C implies 3 hydrogen bonds and T only
2 (a non-Mendelianly inherited character). IV) A change in the
interactions with the residual genome (the remaining genome
that is not this particular mutated site); this is partially a nonMendelianly inherited trait and is the subject of this article.
Other characters may be produced.
We a n a l y z e d t h e s e n o n - p ro t e i n - c o d i n g f u n c t i o n s
depending on the nucleotide sequences by studying the
relations and correlations (not only statistical) among all
* Independencia 1027, Casilla 70061, Independencia, Chile. FAX (56-2) 7373158; Phone (56-2) 9786302 E. Mail < [email protected] >
Received: April 14, 2010. In revised form: February 7, 2011. Accepted: March 8, 2011.
284
VALENZUELA Biol Res 44, 2011, 283-293
the nucleotides of a RNA or DNA segment, excluding any
reference to protein-coding functions. Our study seeks to
know the sequence information for tertiary or quaternary
DNA structures (in relation to non-DNA molecules). We
seek to affirm or refute neutral, nearly neutral or selective
evolution (Valenzuela and Santos, 1996, Valenzuela, 1997,
2000, 2002, 2007, 2009, 2010a; Valenzuela et al., 2010).
Unexpectedly, we found a very high correlation between
both bases of a dinucleotide separated by 0, 1, 2 …K (K=
35) nucleotide sites in the whole genome of the HIV-1 virus,
and in one env gene of this virus (Valenzuela, 2009). This
correlation has nothing to do with coding-functions (it
occurs between any nucleotide separated from the others
by a number of sites that is or is not a multiple of 3). It is
probably related to the tertiary structure needed to fold the
RNA virus into its capsid. In a second study we found similar
correlations until K= 21, in Drosophila melanogaster mtDNA,
Gene Torso, and in human beta globin (βHb) gene (Valenzuela,
2010a). However, the significance of the interaction was
observed until K = 309 in HIV-1 and until K = 609 in mtDNA
(Valenzuela 2010b). These correlations between nucleotides
separated by more than 4 sites do not support neutral or
nearly neutral evolution and indicate that evolution of HIV1, mtDNA, gene Torso and βHb are rather panselective.
This conclusion follows from the fact that a huge number of
dinucleotides, significantly more frequent than randomly
expected, have been positively selected over hundreds of
millions of cell generations. Dinucleotides that are less
frequent than randomly expected have been negatively
selected over and over again over hundreds of millions of cell
generations. The maintenance of this strong interaction over
hundreds of millions of DNA replication cycles can be only
achieved by a widespread selective process, because recurrent
mutation destroys any non-random nucleotide association.
Moreover, a three nucleotide periodicity was found only in
mtDNA among these strong non-random distributions which is
not related to protein synthesis coding functions (Valenzuela,
2010a, 2010b, this article). This periodicity was seen in the
series of χ29 values [9 degrees of freedom due to four rows (less
one) for the first and fourth columns (less one) for the second
nucleotide of the dinucleotide] that measure the distance to
randomness (neutrality). It should be emphasized that this
periodicity is not related to protein-coding processes due to
definite conditions: I) Among gene segments, both strands of
the mtDNA code for tRNA, rRNA and mRNA in the opposite
3’-5’ sense; however, in the present study the analysis of
correlations is performed in one strand. A few genes overlap a
small part of their sequences, but most of them are separated
by a few nucleotide sites. Thus most if not all correlations
of nucleotides separated by K sites calculated on the whole
mtDNA do not coincide with any long series of codon
positions. II) Within a gene segment the periodicity (for small
K) is found in dinucleotides whose bases belong to the same or
to another codon (see APPENDIX 1). III) When K is large and,
since the largest gene segment (ND5) in this mtDNA has 1723
sites, the two bases belong mostly to different genes. IV) Since
mtDNA codes for tRNA, rRNA and mRNA the correlations
among bases of a dinucleotide separated by large K occur
often between nucleotides belonging to these three kinds of
DNA (coding positions are defined only for mRNA). V) Some
correlations are found between bases belonging to coding and
non-coding segments. VI) We have found that the significant
periodicity extends to more than 600K (Valenzuela, 2010b) or
2000 K (this article), a distance beyond any protein-coding
mtDNA segment.
The extension of this analysis to other mtDNA or
genomes showed the same result (Valenzuela 2010a, 2010b,
2011). To test our program we examined the collagen type I
alpha 2 gene (it is a periodical gene) and as was expected, a
highly significant association of the bases of a dinucleotide
was found every 3 and 9 nucleotide sites. Significant nonrandom associations and periodicities were found in long
prokaryote genes, but not in non-periodical eukaryotes genes
(Valenzuela 2011) or in short prokaryote genes (Valenzuela
unpublished). Signifi cant deviations from randomness and
periodicities were present in these genomes until K = 1007 or
more (Valenzuela 2011, this article). It is possible to think that
these non-random interactions and periodicities are due to
mathematical or statistical artifacts from trivial properties of
polymers; or that the highly significant association between
contiguous nucleotides generates the others. The present study
intends to show that these are not the case and that there is a
systematic genetic structure underlying the base associations
in dinucleotides separated by 0, 1, 2 … K sites, in the Drosophila
melanogaster mtDNA (19,517 bp) and in four equal consecutive
segments of 4,879 bp.
RATIONALE, DATA AND METHOD
RATIONALE
The expected internucleotide correlation under mutation alone
In the present disciplinary matrix of evolution, mutation
occurs independently of the following fate of the mutant
allele or base and independently of the processes of natural
selection or genetic drift (Prevosti, 2000; Valenzuela and
Santos, 1996; Valenzuela, 2000, 2002a, 2011a). The mechanisms
of mutation and repair occur with their own matter-energy
characteristics. Thus, the occurrence of mutation at any site
is mostly independent on the occurrence of mutation at any
other site. This does not mean that mutation occurs at random,
because it is known the variation of the mutation rate (cold, hot-, normal-spots; Valenzuela and Santos, 1996; Li, 1997;
Valenzuela, 2000), and mutation seems to be influenced by the
neighborhood, at least in laboratory conditions with mutagens
acting on viral RNA (Koch, 1971). The mutation rate varies
enormously from organism to organism, but it is similar in
similar organisms with some exceptions (Drake, 1993,1999,
2009; Drake et al., 1998; Mackwan et al., 2008). It is assumed
that equal neighbors have equal mutation rates; that is
mutation rates occur with isotropy in DNA or RNA nucleotide
sites (Valenzuela, 1997). If we consider only mutations, under
neutral evolution the 4 bases are expected to be in a site with
equal probability along with evolution during a number
of generations larger than the inverse of the mutation rate
(Valenzuela and Santos, 1996; Valenzuela, 1997, 2000, 2002).
Then, the expected historical correlation of two neutral bases
located in two different sites is zero. If the neighbor influence
operates depending on one upstream and one downstream
base, there are, for every base, 16 different contexts with 16
different influences on mutation rates that yield an average
mutation rate for all these contexts (with 2 sites of influence
256 contexts are produced). However, these contexts should
VALENZUELA Biol Res 44, 2011, 283-293
285
Thus, the expected average internucleotide correlation under
recurrent forward and backward mutation and genetic drift is
very small or stochastically zero. Gene mutations and genetic
drift are hermeneutically empty biotic processes; they are
similar to Brownian motion. This does not mean that they
cannot give rise to biotic processes, but if they do, they would
present random distributions of their elementary components
(nucleotide or amino-acid sequences), as we shall see.
be, in turn, influenced by their contexts of each upstream base
and each downstream base, and these second sets of contexts
should be influenced by the bases that are 3 up- and 3 downstream sites, and so on. Since all the bases are continuously
mutating (fixation is impossible), it is expected that the
average difference in neighbor influence on every mutation
rate should be small or zero. Independently of these factors,
mutation and its possible neighbor influence cannot generate
the meaning (a wide internucleotide correlation among all the
sites needed to code a protein or a biotic hermeneutics) of the
DNA segments by neighbor influence of bases on the mutation
rate, because it occurs independently of the environmental
requirements for the living being. Mutation is, from a biotic
viewpoint, hermeneutically powerless (Valenzuela, 2009, last
paragraph). Thus the expectation for a correlation between
the bases of a dinucleotide that are separated by 0, 1, 2 …K
sites is zero or near zero. Gatlin (1976) found non-random
distribution of longitudinal nucleotide sequences and
proposed this sequential order was a proof for non-neutral
evolution. Neutralists answered fast (Jukes, 1976; Kimura and
Ohta, 1977) proposing that the neighbor influence of bases
on mutation rates could explain this order. However, this is
an intuitive, ad hoc hypothesis that was never demonstrated
and, as we saw, mutation plus the neighbor influence cannot
produce the meaningful order we see in life (Valenzuela
2009, 2010a; Valenzuela et al., 2010). It is very often proposed
that the genetic code implies a constraint that explains the
order. This argument falls into rational circularity, because
the cause that originated and maintains the genetic code is
sent to the unexplained, non-analyzable or un-debatable set
of evolutionary processes (constraints). Recurrent mutation
inexorably destroys any nucleotide sequence (also sequential
constraints), as is evidenced regularly by the cancers, aging
and genetic diseases of living beings (Valenzuela, 2007, 2009;
Valenzuela et al., 2010).
The only process that can produce permanent biotic functional
sense to sequences is selection, because it is a process of
co-variation between biotic sequences and environmental
requirements (adaptation). Our search for internucleotide
correlations is founded in this feature of the evolutionary
process. If we do not find significant non-random association
between the two bases of dinucleotides, neutral or nearly
neutral evolution is affirmed, but selective evolution is
not refuted. However, if we find significant non-random
associations between the two bases, neutral and nearly
neutral evolution are refuted and selective evolution affirmed.
Neutralists and nearly-neutralists included selection in
their models but stated that their models were not related to
adaptation (Ohta, 1992, 2002; Nei, 2005). They do not accept
the pan-adaptationist condition of the Synthetic Theory
of Evolution (Gould, 2002). Our position emphasizes that
thermodynamically non-random nucleotide sequences cannot
be maintained unless selection operates to do it. Thus, nonrandom sequences are really adaptive sequences that remain
in spite of the strong tendency to entropic distributions.
Dynamic non-random processes are physical conditions for life
production and maintenance; thus, they are synonymous with
adaptation (see also Introduction).
The expected internucleotide correlation under mutation and random drift
DATA
Random fluctuations of genetic frequencies (genetic drift)
could result in frequencies of alleles in a locus or base in a
site reaching frequency 1.0 (substitution), 0.0 (elimination or
loss) or between 0.0 and 1.0 (polymorphism). However, and by
constitution and definition, genetic drift occurs independently
and equally in all the nucleotide sites. Thus, it cannot generate
a stable internucleotide correlation and is hermeneutically
powerless. It may move up or down with the same average
magnitude, but its final contribution is zero. A widespread
error equalizes substitution (a turn-over process) with
fixation (a permanent state). Thus, in early articles neutralists
calculated the probability of what they named fixation, but
it was substitution instead because it was the probability to
attain the frequency 1.0 by random frequency fluctuations
(Kimura 1962; Nei et al., 2010). To calculate the probability of
fixation we need the number of generations over which the
allele or base has remained fixed. The probability to remain
at frequency 1.0 is completely different for alleles or bases
that remain at this frequency for one million generations.
With recurrent forward and backward mutation fixation,
it is physically, logically, mathematically and biologically
impossible (Wright, 1931; Feller, 1951; Valenzuela and Santos,
1996; Valenzuela, 2000, 2002, 2007, 2009, 2010a, 2011). Neither
mutation nor drift can give sense to a DNA or RNA segment.
The Drosophila melanogaster mtDNA (GenBank accession NC
001709, with 19,517 nucleotide sites) was studied.
Only selection gives meaning to nucleotide sequences. Our logic of
demonstration
METHODS
The heterogeneity of the distribution of the second base in
relation to the first base in dinucleotides, whose bases are
separated by 0 (contiguous), 1, 2, … K, nucleotide sites, was
determined by a χ2 test. The total deviation from randomness
of the 16 possible dinucleotides (pairs) was determined by
a χ29 test [9 = degrees of freedom, 3 independent rows (4
possible bases less 1) times 3 independent columns (4 possible
bases less 1)], and the particular deviation of a pair by a χ21
test (its contribution to the total χ29 value). These χ2 tests and
their associated probabilities directly measure the distance to
neutrality (randomness). The first purpose is to know whether
positive (more dinucleotides than expected, ↑) or negative
(fewer dinucleotides than expected, ↓) associations (in relation
to random dinucleotide distribution) are present between the
two bases of dinucleotides (χ2 tests) and the extension in terms
of the number of nucleotide sites (separation of K sites) and
of the neighborhood influence. A second aim is to examine
whether these base associations are homogeneously distributed
along with the whole mtDNA or if they are different in four
286
VALENZUELA Biol Res 44, 2011, 283-293
equal and consecutive sub-segments. For this aim, the total
mtDNA with 19,517 nucleotide sites was divided into four
consecutive and equal segments with 4,879 sites each. A
previous study showed highly heterogeneous composition of
bases and dinucleotides when the mtDNA was divided into
ten segments (unpublished). Abbreviations: A = Adenine, T =
Thymine, G = Guanine, C = Cytosine.
More specific details of the methods are published
(Valenzuela 2009, 2010a). The most important methodological
features are presented with help of APPENDICES 1 and
2. APPENDIX 1 describes the method to calculate the
association for one coding segment. This appendix also
shows that the correlations do not depend on protein-coding
functions. APPENDIX 2 shows the analysis for dinucleotides
whose bases are separated by 17 nucleotides (an example).
Bases found in the 1st and 19th nucleotide sites constitute the
first dinucleotide, the second includes bases at the 2nd and
20th sites, the third with bases at the 3rd and 21st sites, and
so on, until the last dinucleotide whose bases are at the sites
19th, 499th and 19,517th. There are then 19,499 dinucleotides
whose bases are separated by 17 sites. The expected number
of dinucleotides is obtained by the frequency of the first
base, times the frequency of the second base, times the total
number of dinucleotides. Taking the observed frequencies
of bases is the best estimate of the expected historical
action of mutation rates and all the possible neighbor
influences (as average) because these frequencies should be
considered as the expected equilibrium frequencies under
neutral evolution (see Valenzuela et al., 2010). APPENDIX 2
presents dinucleotides ordered according to the significance
of their deviation from randomness. A sign indicates
whether there is more (↑) or fewer (↓) dinucleotides than
expected. Significance at the 0.05 level is found for a χ 21
value equal to 3.84 and for a χ29 with a value equal to 17.
There were 14 significantly deviated dinucleotides among
the 16 possible pairs, 6 with excess and 8 with deficiency.
The total excess was 825.6 and the deficiency added up to
825.5. The excesses are fewer, but larger than the deficiencies.
Excesses are produced by positive selective processes, and
deficiencies by negative selective processes that have been
maintained over million of mitochondria generations to
the present (see Rationale). The selective process occurs
because mutations happen continuously and destroy any
non-random associations. The facts that: i) 14 pairs among
16 are significantly distant to the random (neutral) expected
distribution and i) the incommensurable value of the χ29 test
= 322.2 (P<10 -50) refute neutral evolution definitively. We
observe that most (14/16 = 87.5%) pairs of bases chosen at
random and separated by 17 nucleotide sites are distributed
enormously far from the expected neutral distribution.
Furthermore, and considering that I) this distance to
neutrality has been maintained by millions of mitochondrion
generations, and II) major significances were found with
separations from 0 to more than 2000, we can only conclude
that these evolutionary conditions are impossible under
neutral and nearly neutral evolution.
RESULTS
Table 1 shows the total χ29 value found in the entire Drosophila
mtDNA, when the bases of dinucleotides are separated by 0
(contiguous or consecutive), 1, 2, 3 … 17, nucleotide sites, and
the χ21 contribution to the χ29 value by the five most significant
pairs, ordered according to the value of their significance. The
total significance for the χ29 at the 0.05, 0.025, 0.01, 0.005 and
0.001 critical probability levels is found with 16.9 (17), 19.0
(19), 21.7 (22), 23.6 (24) and 27.9 (28) χ29 values (rounded to
integer number in parentheses), respectively. The significance
of the deviation from the expected randomness of a particular
pair may be evaluated by its contribution to the total χ29 by
the χ21 values that are 3.84 (4), 5.02 (5), 6.64 (7), 7.88 (8) and
10.83 (11) for the same critical probability levels, respectively.
The χ2 values of Table 1 have been rounded to integer figures.
The most significant figure for contiguous (0 separation) bases
was the excess of G-G, followed by excess of C-C, depression
of G-T, excess of G-C and excess of T-T pairs (χ21=27.8); other
deviations were less significant, even though six of them had
χ21 over 4 or a probability of less than 0.05 [(A-C)↓ 25; (T-C)↓
11; (T-G)↓ 11; (A-A)↑ 11; (C-A)↓ 10; (T-A)↓ 5]. The spectrum
of significances changes when K increases, as can be seen in
the table (and in Table 2). The most significant pairs (1st pairs)
showed more observed pairs than expected (↑); the other pairs
showed both possibilities (↑, ↓).
We see a clear periodicity in the χ 2 9 value after the
separation by 1 site. There are triplets of χ29 values, the first
over 300 that we named the head figure, followed by two
consecutive smaller figures between 37 and 114 (tail 1 and tail
2 figures). The largest χ21 contribution for the head figure was
always given by an excess of G-G pairs, while for tail 1 and tail
2 figures it was given by excesses of G-C and C-G, respectively.
There are other ordered distributions in the 2º, 3º, 4º and 5º
pairs, but they are not as exclusive as those found in the most
significant pair. Their analysis is left to the reader.
The periodicity in triplets of the χ29 values indicates the
deviation from the expected random distribution of the second
base in relation to the first base of dinucleotides separated by
0, 1, 2 …17 was observed until 609 K (Valenzuela 2010b). It is
also evident that the most significant pair shows a periodicity
in these triplets: G-G, G-C and C-G, which could be followed
until separation 36, with only one exception (separation 33
where G-C was replaced by G-G). However, it must be noted
that the χ2 test is rough for finding fine nucleotide associations
because its high degree of variance may lead to variable
hierarchical orders. Table 2 presents the analysis for two sets of
10 K: 1000-1009K and 2002-2011K. In both sets the periodicity
is evident, with head values between 48 and 65 and tail values
between 13 and 39 in the range 1000-1009K and head values
between 38 and 49 and tail values between 7 and 21 in the
range 2002-2011K. It is remarkable that in the range 10001009K, 9 among 10 χ29 values are significant with a highest
probability equal to 0.0062 (χ29 = 23), and there are 6 significant
χ29 values with the highest probability 0.0179 (remember the
inverse relationship between significance and probability)
among 10 in the range 2002-2011K. As well, it is remarkable
that the most significant χ21 value was always given by more
observed pairs than expected (↑) and was mostly G-G as head,
G-C and C-G as 1st and 2nd tail, respectively in the 1000-1009K
range. In the 2002-2011K range these last relationships holds,
but it is necessary to consider the five χ21 values to reconstruct
them, given that other pairs appeared as the most deviated
from randomness.
These pair structures are averages found when scanning
large DNA segments. The existence of micro-isochores (subsegments with different base composition; Valenzuela 1997,
287
VALENZUELA Biol Res 44, 2011, 283-293
2009, this article) and micro-signatures (sub-segments with
different dinucleotides compositions) (Valenzuela 2009, this
article) could change the structure of base associations of
dinucleotides. Figure 1 shows that the Drosophila melanogaster
mtDNA has different composition of bases in its segments.
Thus, an analysis of the mtDNA divided into four equal
segments was performed. Tables 3, 4, 5 and 6 show this
analysis for the 1º (sites 1º-4,879º), 2º (4,880º-9,758º), 3º
(9,759º-14,637º) and 4º (14,637º-19,516º) segments, respectively.
The base composition of the segments were: 1º (A = 1,663,
34.08%; T = 2,029, 41.59%; G = 567, 11.62%; C = 620, 12.71%);
2º (A = 2,126, 43.57%; T = 1,712, 35.09%; G = 428, 8.77%;
C = 613, 12.56%); 3º (A = 1,972, 40.42%; T = 1,899, 38.92%;
G = 397, 8.14%; C = 611, 12.52%); 4º (A = 2,391, 49.01%; T
= 2,242, 45.95%; G = 87, 1.78%; C = 159, 3.26%). The high
degree of heterogeneity of base composition of these four
segments is evident (micro-isochores); particularly the G and
C proportions decay around 5 and 3.8 times, respectively in
the fourth segment, with the corresponding increase of A and
T proportions. The χ29 value for the heterogeneity of base
composition of these 4 segments resulted 855.4 (P<10-100). The
pair structure found in the total mtDNA is partially valid for
these segments (especially for the excess of G-G as the most
significant pairs), except segment 4º where non G-G pairs were
the most significant. A detailed analysis and comparison of the
four segments are left to the reader.
DISCUSSION
Highly significant (statistical) interactions were found
between any nucleotide and nucleotides separated as far as
2011 nucleotide sites. This demonstrates that in the mtDNA
organization any nucleotide maintains strong non-random
associations with the whole mtDNA. Moreover, these
interactions include a high significant periodicity between the
bases of dinucleotides, when the bases are separated by at least
by 0, 1, 2 … 2011 sites. The internucleotide correlations we
have just described can be seen as processes of internucleotide
co-adaptation. Those dinucleotides whose frequencies are
over the random expected frequency were positively selected
and are now maintained by positive selection; those that are
below their expected frequencies were and are negatively
selected. These strong associations, maintained over several
million mitochondrion generations (the time during which
Drosophila melanogaster has had this mtDNA) refute the
neutral theory, the nearly neutral theory and the neighbor
influence of a base on mutation rates of its neighborhood as
main factors of evolution. It is impossible to maintain this
organization during that time by random mutation, genetic
drift and weak natural selection (nearly-neutral evolution).
On the contrary, forward and backward recurrent mutation
and drift are processes that should inexorably destroy this
organization (Valenzuela and Santos 1996, Valenzuela 1997,
TABLE 1
Total χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 0, 1, 2 …17 nucleotide sites,
and their χ21 contribution of the 5 most significant dinucleotides
Sep
0
χ 29
485
1st Pair
2nd Pair
3rd Pair
4th Pair
5th Pair
Pair
χ21Co
Pair
χ21Co
Pair
χ21Co
Pair
χ21Co
Pair
χ21Co
[(G-G)↑
124]
[(C-C)↑
113]
[(G-T)↓
91]
[(G-C)↑
50]
[(T-T)↑
28]
1
94
[(C-G)↑
36]
[(C-C)↑
25]
[(C-T)↓
12]
[(A-G)↓
6]
[(T-C)↓
4]
2
405
[(G-G)↑
116]
[(C-C)↑
106]
[(G-C)↑
33]
[(C-G)↑
25]
[(T-G)↓
23]
3
114
[(G-C)↑
23]
[(A-A)↑
22]
[(T-T)↑
15]
[(T-A)↓
11]
[(C-C)↑
9]
4
47
[(C-G)↑
20]
[(A-G)↓
8]
[(A-T)↑
6]
[(C-T)↓
4]
[(G-T)↓
2]
5
381
[(G-G)↑
139]
[(C-C)↑
51]
[(A-G)↓
32]
[(G-C)↑
32]
[(C-G)↑
30]
6
87
[(G-C)↑
38]
[(T-A)↑
14]
[(T-C)↓
12]
[(G-A)↓
6]
[(A-A)↓
5]
7
37
[(C-G)↑
17]
[(C-T)↓
7]
[(T-G)↓
3]
[(G-G)↑
3]
[(T-T)↑
2]
8
375
[(G-G)↑
149]
[(C-C)↑
45]
[(C-G)↑
36]
[(G-C)↑
29]
[(T-G)↓
24]
9
76
[(G-C)↑
34]
[(G-A)↓
16]
[(T-C)↓
12]
[(G-G)↑
8]
[(C-G)↓
2]
10
49
[(C-G)↑
28]
[(A-G)↓
6]
[(C-T)↓
6]
[(A-T)↑
4]
[(T-A)↑
1]
11
367
[(G-G)↑
144]
[(G-C)↑
45]
[(C-C)↑
35]
[(C-G)↑
26]
[(A-G)↓
23]
12
65
[(G-C)↑
34]
[(G-A)↓
13]
[(T-C)↓
8]
[(C-G)↓
3]
[(C-A)↑
2]
13
70
[(C-G)↑
38]
[(A-G)↓
13]
[(A-A)↑
5]
[(G-C)↓
3]
[(C-A)↓
2]
14
310
[(G-G)↑
78]
[(C-G)↑
48]
[(G-C)↑
44]
[(C-C)↑
32]
[(G-A)↓
22]
15
60
[(G-C)↑
34]
[(G-A)↓
10]
[(C-G)↓
6]
[(T-C)↓
3]
[(C-T)↑
2]
16
52
[(C-G)↑
27]
[(A-G)↓
12]
[(A-A)↑
3]
[(C-T)↓
2]
[(C-A)↓
2]
17
322
[(G-G)↑
91]
[(C-G)↑
45]
[(C-C)↑
40]
[(G-C)↑
22]
[(A-A)↑
22]
Sep = number of separation sites; χ21Co = χ21 contribution of this pair to the total χ29 value; ↑ = more pairs observed than expected; ↓ = fewer pairs observed than
expected.
288
VALENZUELA Biol Res 44, 2011, 283-293
Figure 1. Distribution of bases, A in dark blue, T in light blue, G in red, C in yellow, and non-bases in black in the Drosophila melanogaster
mtDNA. The composition with the four bases is at the center.
TABLE 2
Total χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 1000-1009 and 2002-2011 nucleotide sites,
and their 5 most significant dinucleotides χ21 contribution
Sep
χ 29
1st Pair
2nd Pair
3rd Pair
4th Pair
Pair
χ21Co
Pair
χ21Co
Pair
χ21Co
5th Pair
Pair
χ21Co
Pair
χ21Co
1000
52
[(G-G)↑
12]
[(C-C)↑
9]
[(A-G)↓
8]
[(G-C)↑
8]
[(C-A)↑
4]
1001
24
[(G-C)↑
14]
[(T-C)↓
5]
[(C-C)↑
2]
[(G-A)↓
1]
[(C-G)↓
1]
1002
39
[(C-G)↑
10]
[(C-C)↑
8]
[(A-C)↓
6]
[(G-G)↑
3]
[(C-A)↓
3]
1003
48
[(G-G)↑
13]
[(C-C)↑
12]
[(A-G)↑
5]
[(T-C)↓
4]
[(G-C)↑
3]
1004
36
[(G-C)↑
10]
[(G-T)↓
7]
[(A-C)↓
5]
[(G-G)↑
4]
[(C-G)↑
3]
1005
13
[(C-G)↑
4]
[(A-G)↓
3]
[(G-C)↑
2]
[(G-G)↑
2]
[(G-A)↓
1]
1006
65
[(G-C)↑
24]
[(G-G)↑
8]
[(C-G)↑
6]
[(G-A)↓
6]
[(A-G)↓
5]
1007
23
[(G-C)↑
9]
[(C-C)↑
3]
[(A-C)↓
2]
[(A-A)↑
2]
[(G-G)↑
1]
1008
31
[(C-G)↑
10]
[(A-G)↓
10]
[(G-G)↑
2]
[(A-C)↓
2]
[(A-T)↑
2]
1009
59
[(C-C)↑
10]
[(C-G)↑
10]
[(A-G)↓
10]
[(G-G)↑
9]
[(G-C)↑
5]
2002
49
[(C-G)↑
12]
[(G-G)↑
11]
[(C-A)↓
9]
[(G-T)↓
4]
[(T-G)↓
4]
2003
20
[(G-G)↑
7]
[(C-A)↓
2]
[(G-T)↓
2]
[(C-G)↑
2]
[(C-C)↑
2]
2004
21
[(C-C)↑
8]
[(C-G)↑
4]
[(C-T)↓
4]
[(A-G)↓
2]
[(A-C)↓
1]
2005
38
[(G-G)↑
9]
[(C-C)↑
8]
[(G-C)↑
4]
[(A-G)↓
3]
[(C-G)↑
3]
2006
12
[(G-A)↓
4]
[(G-C)↑
3]
[(G-G)↑
1]
[(T-G)↓
1]
[(G-T)↑
1]
2007
13
[(C-C)↑
3]
[(G-G)↑
2]
[(G-A)↓
2]
[(G-C)↑
1]
[(C-T)↓
1]
2008
41
[(G-C)↑
9]
[(G-G)↑
8]
[(C-G)↑
5]
[(G-C)↑
3]
[(C-T)↓
3]
2009
7
[(T-C)↓
2]
[(G-G)↑
1]
[(A-G)↓
1]
[(G-C)↑
1]
[(G-A)↓
1]
2010
12
[(G-C)↑
3]
[(T-C)↓
2]
[(C-C)↑
2]
[(A-G)↓
1]
[(C-G)↑
1]
2011
41
[(C-G)↑
12]
[(G-C)↑
8]
[(C-C)↑
4]
[(T-G)↓
4]
[(G-G)↑
3]
Nomenclature as in Table 1.
289
VALENZUELA Biol Res 44, 2011, 283-293
TABLE 3
χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 0, 1, 2 …17 nucleotide sites,
and their χ21 contribution of the 5 most significant pairs of bases, in the 1º segment of mtDNA (site 1º- 4879º)
Sep
χ 29
1st Pair
Pair
0
2nd Pair
χ2
1Co
3rd Pair
χ2
Pair
[(G-G)↑
1Co
28]
4th Pair
χ2
Pair
136
[(G-T)↓
48]
[(C-G)↓
1
63
[(A-A)↓
12]
[(C-G)↑
9]
2
118
[(C-C)↑
29]
[(G-G)↑
18]
3
44
[(A-G)↑
15]
[(C-G)↓
13]
[(C-A)↑
1Co
5th Pair
χ2
Pair
1Co
9]
Pair
χ21Co
[(G-A)↑
9]
13]
[(T-T)↑
[(A-C)↑
7]
[(G-A)↑
7]
[(A-T)↑
6]
[(C-A)↓
17]
[(A-C)↓
17]
[(A-A)↑
10]
5]
[(A-T)↓
3]
[(G-C)↑
2]
4
28
[(G-C)↓
5]
[(C-A)↑
4]
[(C-C)↓
3]
[(T-A)↓
3]
[(A-G)↓
2]
5
93
[(G-G)↑
19]
[(A-C)↓
16]
[(C-A)↓
12]
[(A-G)↓
11]
[(A-A)↑
7]
6
52
[(A-G)↑
12]
[(C-G)↓
10]
[(G-C)↑
10]
[(T-C)↓
5]
[(G-G)↓
4]
7
25
[(C-C)↓
7]
[(G-C)↓
5]
[(C-G)↑
4]
[(G-A)↑
2]
[(T-C)↑
2]
8
115
[(G-G)↑
30]
[(C-A)↓
15]
[(C-G)↑
13]
[(A-A)↑
11]
[(G-T)↓
10]
9
39
[(C-G)↓
11]
[(G-C)↑
8]
[(T-C)↓
5]
[(C-A)↑
5]
[(A-G)↑
2]
10
42
[(G-A)↑
7]
[(C-G)↓
5]
[(G-G)↓
5]
[(C-G)↑
5]
[(C-T)↑
4]
11
69
[(G-G)↑
25]
[(A-G)↓
10]
[(G-C)↑
7]
[(G-T)↓
6]
[(A-A)↑
5]
12
39
[(C-G)↓
10]
[(C-A)↑
10]
[(T-C)↓
3]
[(A-G)↑
3]
[(A-C)↑
3]
13
43
[(G-C)↑
9]
[(A-G)↓
7]
[(T-G)↑
5]
[(C-G)↑
4]
[(C-C)↓
4]
14
76
[(A-C)↓
12]
[(C-A)↓
10]
[(G-G)↑
10]
[(G-A)↓
10]
[(C-C)↑
9]
15
44
[(C-G)↓
9]
[(A-G)↑
8]
[(G-G)↓
5]
[(G-C)↑
4]
[(C-C)↓
3]
16
19
[(G-C)↓
5]
[(A-C)↑
3]
[(G-G)↓
3]
[(T-G)↑
2]
[(G-T)↑
1]
17
77
[(C-G)↑
13]
[(C-C)↑
12]
[(G-G)↑
10]
[(A-G)↓
9]
[(C-A)↑
9]
Nomenclature as in Table 1.
TABLE 4
χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 0, 1, 2 …17 nucleotide sites,
and their χ21 contribution of the 5 most significant pairs of bases, in the 2º segment of mtDNA (4880º- 9758º site)
Sep
χ 29
1st Pair
Pair
2nd Pair
χ2
1Co
Pair
3rd Pair
χ2
1Co
Pair
4th Pair
χ2
1Co
Pair
5th Pair
χ2
1Co
Pair
χ21Co
0
78
[(C-C)↑
22]
[(G-T)↓
14]
[(A-C)↓
14]
[(C-G)↓
8]
[(G-G)↑
7]
1
21
[(G-C)↓
5]
[(A-A)↓
3]
[(C-T)↓
3]
[(A-C)↑
1]
[(G-G)↓
1]
2
73
[(G-G)↑
30]
[(C-C)↑
13]
[(T-G)↓
8]
[(T-T)↑
5]
[(G-A)↓
5]
3
17
[(T-G)↑
4]
[(C-G)↓
3]
[(G-C)↑
2]
[(A-A)↓
2]
[(G-G)↓
2]
1]
4
12
[(C-G)↑
3]
[(G-A)↑
2]
[(G-C)↓
1]
[(A-G)↓
1]
[(G-G)↓
5
74
[(G-G)↑
32]
[(G-T)↓
8]
[(C-G)↑
6]
[(C-C)↑
6]
[(T-T)↑
6]
6
16
[(C-G)↑
5]
[(C-T)↑
4]
[(C-C)↓
3]
[(T-G)↑
1]
[(T-T)↓
1]
7
11
[(C-T)↓
3]
[(C-A)↑
3]
[(G-C)↓
2]
[(T-A)↓
1]
[(T-G)↑
1]
8
78
[(G-G)↑
34]
[(T-T)↑
7]
[(T-G)↓
7]
[(G-A)↓
6]
[(A-A)↑
5]
9
18
[(T-G)↑
5]
[(G-C)↑
3]
[(C-G)↓
3]
[(G-A)↓
2]
[(T-C)↓
1]
1]
10
14
[(C-G)↑
5]
[(G-C)↓
2]
[(G-T)↓
2]
[(C-C)↓
1]
[(A-C)↑
11
77
[(G-G)↑
27]
[(T-T)↑
8]
[(G-T)↓
7]
[(C-C)↑
7]
[(T-C)↓
7]
12
24
[(G-C)↑
8]
[(C-G)↓
5]
[(G-A)↓
3]
[(T-C)↓
2]
[(C-T)↑
2]
13
22
[(C-G)↑
4]
[(T-C)↑
4]
[(G-G)↓
3]
[(C-C)↓
2]
[(G-T)↑
2]
14
93
[(G-G)↓
18]
[(C-G)↑
13]
[(G-C)↑
10]
[(T-T)↑
9]
[(A-A)↑
8]
15
23
[(C-G)↓
13]
[(G-C)↑
3]
[(C-T)↑
2]
[(G-T)↓
1]
[(A-G)↑
1]
16
15
[(C-G)↑
5]
[(T-C)↑
3]
[(G-C)↓
1]
[(T-G)↓
1]
[(T-A)↓
1]
17
69
[(G-G)↑
21]
[(T-T)↑
9]
[(G-A)↓
6]
[(T-G)↓
6]
[(G-C)↑
6]
Nomenclature as in Table 1.
290
VALENZUELA Biol Res 44, 2011, 283-293
TABLE 5
χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 0, 1, 2 …17 nucleotide sites,
and their χ21 contribution of the 5 most significant pairs of bases, in the 3º segment of mtDNA (site 9,759º- 14,637º)
Sep
χ 29
1st Pair
Pair
0
128
2nd Pair
χ2
[(G-G)↑
1Co
3rd Pair
χ2
Pair
1Co
4th Pair
χ2
Pair
1Co
5th Pair
χ2
Pair
1Co
33]
[(C-C)↑
19]
[(G-T)↓
17]
[(T-T)↑
16]
Pair
χ21Co
[(T-G)↓
8]
1]
1
13
[(A-T)↑
2]
[(C-G)↑
2]
[(A-G)↑
2]
[(G-G)↑
1]
[(T-T)↓
2
46
[(G-G)↑
11]
[(C-C)↑
9]
[(G-T)↓
4]
[(T-C)↓
4]
[(C-G)↑
3]
3
15
[(C-C)↑
5]
[(C-G)↓
3]
[(T-G)↑
1]
[(G-C)↑
1]
[(T-C)↓
1]
1]
4
13
[(G-T)↓
3]
[(G-A)↑
2]
[(T-A)↓
2]
[(T-T)↑
2]
[(G-G)↑
5
63
[(G-G)↑
27]
[(G-C)↑
8]
[(A-G)↓
5]
[(G-T)↓
4]
[(C-C)↑
4]
6
20
[(G-C)↑
7]
[(T-C)↓
4]
[(G-A)↓
2]
[(C-A)↑
1]
[(G-G)↓
1]
7
11
[(C-A)↑
3]
[(C-T)↓
2]
[(G-T)↑
2]
[(G-A)↓
1]
[(A-G)↑
1]
8
40
[(G-G)↑
16]
[(G-A)↓
7]
[(T-G)↓
5]
[(C-C)↑
2]
[(C-A)↓
2]
9
19
[(G-A)↓
4]
[(G-C)↑
2]
[(A-G)↑
2]
[(T-G)↓
2]
[(T-C)↓
2]
10
7
[(C-C)↓
2]
[(T-C)↑
2]
[(C-A)↑
1]
[(G-C)↓
0]
[(C-T)↓
0]
11
60
[(G-G)↑
28]
[(G-A)↓
6]
[(T-G)↓
4]
[(C-C)↑
4]
[(G-C)↓
4]
12
17
[(C-A)↑
4]
[(G-C)↓
4]
[(G-A)↓
3]
[(C-T)↓
2]
[(G-G)↓
1]
13
20
[(C-G)↑
7]
[(G-C)↓
5]
[(G-T)↑
2]
[(T-T)↓
1]
[(T-C)↑
1]
14
20
[(G-G)↑
8]
[(C-G)↑
4]
[(G-A)↓
3]
[(T-G)↓
1]
[(A-G)↓
1]
15
8
[(G-C)↑
2]
[(G-A)↓
2]
[(C-G)↓
1]
[(G-G)↓
1]
[(A-G)↑
1]
16
5
[(A-G)↑
1]
[(C-T)↓
1]
[(C-G)↑
1]
[(T-G)↑
0]
[(T-A)↓
0]
17
27
[(G-G)↑
15]
[(C-C)↑
4]
[(A-G)↓
2]
[(G-G)↑
1]
[(T-G)↓
1]
Nomenclature as in Table 1.
TABLE 6
χ29 values for heterogeneity of the distribution of dinucleotide bases separated by 0, 1, 2 …17 nucleotide sites,
and their χ21 contribution of the 5 most significant pairs of bases, in the 2º segment of mtDNA (site 14,638º- 19,516º)
Sep
χ 29
1st Pair
Pair
2nd Pair
χ2
1Co
Pair
3rd Pair
χ2
1Co
Pair
4th Pair
χ2
1Co
Pair
5th Pair
χ2
1Co
Pair
χ21Co
0
100
[(C-C)↑
61]
[(A-G)↓
7]
[(T-G)↑
6]
[(G-T)↓
5]
[(A-C)↓
4]
1
216
[(C-C)↑
119]
[(T-T)↓
18]
[(T-A)↓
14]
[(C-G)↑
13]
[(A-A)↑
13]
2
62
[(C-C)↑
19]
[(T-G)↓
10]
[(A-G)↑
6]
[(C-T)↓
5]
[(A-A)↓
5]
3
85
[(A-A)↑
21]
[(A-T)↓
20]
[(T-A)↓
19]
[(T-T)↑
19]
[(A-C)↓
1]
4
62
[(A-T)↑
13]
[(T-T)↓
13]
[(T-A)↑
13]
[(A-A)↓
13]
[(C-C)↑
5]
5
29
[(C-C)↑
15]
[(A-C)↓
3]
[(G-T)↑
3]
[(G-A)↓
1]
[(T-T)↑
1]
6
118
[(T-A)↑
24]
[(T-T)↓
23]
[(A-T)↓
15]
[(A-A)↓
12]
[(C-A)↓
11]
7
33
[(C-G)↑
13]
[(C-C)↑
9]
[(C-A)↓
4]
[(T-G)↓
2]
[(G-G)↑
1]
8
83
[(A-T)↑
18]
[(T-T)↓
17]
[(T-A)↑
16]
[(C-C)↑
15]
[(A-A)↓
14]
9
11
[(C-G)↑
6]
[(C-T)↓
1]
[(G-C)↓
1]
[(C-A)↑
0]
[(G-A)↑
0]
10
23
[(T-T)↓
4]
[(T-A)↑
4]
[(A-T)↑
4]
[(A-A)↓
4]
[(G-A)↓
2]
11
6
[(G-C)↑
2]
[(G-A)↓
1]
[(G-T)↓
1]
[(T-C)↓
1]
[(C-G)↑
0]
12
17
[(C-G)↓
3]
[(T-T)↓
2]
[(A-T)↑
2]
[(A-A)↓
2]
[(G-T)↓
1]
13
13
[(A-T)↓
2]
[(A-A)↑
2]
[(T-A)↓
2]
[(T-T)↑
2]
[(C-G)↓
1]
14
31
[(T-C)↓
9]
[(G-C)↑
6]
[(A-C)↑
6]
[(G-T)↓
2]
[(G-G)↑
1]
15
21
[(G-C)↑
10]
[(C-T)↑
3]
[(C-A)↓
3]
[(G-G)↓
2]
[(T-G)↑
1]
16
47
[(G-C)↑
19]
[(C-G)↑
9]
[(A-G)↓
8]
[(T-G)↑
4]
[(C-C)↓
2]
17
39
[(A-A)↑
6]
[(A-T)↓
5]
[(T-A)↓
4]
[(T-T)↑
4]
[(G-C)↑
4]
Nomenclature as in Table 1
VALENZUELA Biol Res 44, 2011, 283-293
2000, 2002, 2007, 2009; Valenzuela et al., 2010). Recurrent
forward and backward mutations make neutral fixation
impossible (Wright 1931; Feller 1951; Valenzuela 2000, 2002a;
Valenzuela et al., 2010). Mutations do occur in mtDNA of
eukaryote organisms during their life and are a main factor
in aging and death (Gredilla et al., 2010). As well, hundreds
of human mtDNA mutations are known that produce lethal
or sub-lethal conditions (Tuppen et al., 2010). Thus, mtDNA is
almost always destroyed (depending only on the life span of
the individual) during the life of eukaryote individuals, but it
is much more stable in phylogeny. The individual instability
and phylogenetic stability are only possible if there are strong
selective mechanisms (DNA repair and protection; Gredilla
et al. 2010) acting on mitochondria from one generation to
the next, especially in females among sexually reproductive
species. The HIV-1 virus has a high correlation among its
genome bases, but not periodicity (Valenzuela 2009, 2011).
The HIV-1 virus may need this correlation to fold the RNA
chain into the capsid, which is not needed by the mtDNA.
However, mtDNA needs coiling and hypercoiling to protect
itself and locate functionally in the mitochondrion matrix. It is
fascinating that this structure may be present in prokaryotes, as
we found preliminarily (Valenzuela 2010a, 2011).
The strong non-random association between a nucleotide
(and its complementary one) in a DNA site and the residual
genome, maintained over millions of generations, convinced
us that the main selector (selection factor) for this nucleotide
site is not the environment, but the residual genome. Once
hereditary polymers are acquired in biotic systems, evolution
goes on mainly by polymer interactions and recombination
(Valenzuela, 2002a, 2002b), either in the endogenous or
exogenous plane. Horizontal evolution, sex and symbiogenesis
are positive selective mechanisms of inter-polymer selection
in evolution. However, if other polymers are the best
“friends” for a particular polymer, they may also be its worst
enemies (negative selection) leading to polymer destruction,
competition, diseases and extinction. We see only those
organisms that reached a resilient equilibrium after the intraindividual polymers’ coexistence or fusion.
The different structures of deviations from randomness
according to significances found in the four segments with
equal numbers of nucleotides indicate that the nucleotide
association in dinucleotides is rather flexible and depends on
the base composition of the segment (a relationship among
purines and pyrimidines and base complementariness). The
strong G-G, G-C and C-G associations found in the head, tail
1 and tail 2 periodicities, respectively, in the whole mtDNA
represent the most frequent deviation from randomness,
but, their frequencies vary in the four segments. Perhaps
these statistical attractions and repulsions indicate physical
attractions and repulsions that are necessary to accomplish
important non-protein-synthesis functions that were and
are crucial in evolutionary development. The high degree of
heterogeneity of the base composition of the four segments
maintained for millions of mitochondrion generations
conclusively refutes neutral and nearly neutral evolution and
the neighbor influence hypothesis (and independently of the
internucleotide interactions described above). These theories
and hypothesis predict a homogeneous distribution instead.
This article could finish here; however there are
fundamental misconceptions in the neutralist and nearlyneutralist position that need special treatment (Valenzuela
291
2000, 2002a, 2010a, 2010b, Valenzuela et al., 2010). Perhaps
the reader, habituated to phylogenetic analyses based on
protein-coding features such as coding positions, synonymous
or non-synonymous mutations, thinks our conclusive
refutation of neutral and nearly neutral evolution is rather
unsupported. We have received the critical position from
the Neutral Theory of Evolution (made from neutralist and
non-neutralist colleagues) that neutralism accepts “purifying
selection” in the form of lethal and sub-lethal mutations as
an important part of the theory. However, this proposition is
not true as far as mtDNA is concerned, because the clinical
genetic practice (a method with very low sensitivity to study
selectors) shows that mtDNA mutations (in humans and
animals) are lethal, sub-lethal, and compatible with life with
and without impairment of reproduction (Tuppen et al.,
2010). As mentioned above, neutralists protected the theory
by including “constraints” such as the genetic code, the
restriction to four nucleotide bases, some invariant functional
parts of proteins or DNA, biases of codon usage, etc. However,
neutralists or nearly neutralists (and selectionists or neoDarwinists) never advanced a proportion of evolution that
is due to lethal or sub-lethal nucleotide mutations or to
invariant constraints, so as to put these hypotheses to the
test (epistemologically this proposition is a negative heuristic
protective belt). If the proportion of evolution in every
nucleotide site is mostly (over 50%) due to lethal and sublethal bases, then evolution is, by definition, selective and not
neutral or nearly-neutral. But in this case life is impossible.
The same occurs with constraints. First, studies of protein
constraints were focused on the active site of enzymes. Then
allosteric sites, receptor sites, signal sequences, attachment
to membrane sequences, and several other amino-acid
functional sequences that conferred an invariant function to
almost every amino-acid of a protein were described. Now, it
is difficult to conceive of any amino acid of a protein without
a function that severely constraints it. Constraints proposed
without precision are also negative heuristic protective belts
of neutralism or near neutralism. A simple question shows
that: what is a constraint, in the evolutionary process? Or,
how were constraints acquired and maintained in evolution
during paleontological eras? To propose that the genetic
code, eukaryote, prokaryote, unicellular, multicellular,
vertebrate (and so on) organizations were acquired and are
maintained by mutation and random drift is simply madness.
Evolution is mostly conservation not variation (Valenzuela,
2007, 2009; Valenzuela et al., 2010). That the genetic code or
any organization was acquired and is maintained mostly by
selection implies that evolution is selective. Constraints are
mostly produced by non-random nucleotide sequences; thus,
they were included in the present analysis. The nearly neutral
theory of evolution added selection to mutation and drift with
a positive selection coefficient (Ohta, 1992, 2002) making this
theory almost undistinguishable from the Synthetic Theory of
Evolution.
The present analysis is a trans- supra- or non-proteincoding study. Moreover, these base-to-base interactions
and periodicities occur between bases separated by 0 to
more than 2,000 sites, and mitochondrial genes have less
than 1,750 nucleotides. On the contrary, it is expected that
a gene sequence disturbs or destroys non-protein-coding
periodicities to specify its own coding message, which is
seldom periodical. Furthermore, there are no G-G, G-C or
292
VALENZUELA Biol Res 44, 2011, 283-293
C-G periodical dinucleotide associations in mtDNA, where
the two bases are separated by 0 to more than 2,000 sites
involved in protein-coding processes. Now, if we add to these
widespread non-protein-coding co-adaptive interactions those
due to protein-coding adaptive processes, we will have a more
complete picture of pan-adaptive evolutionary processes. The
reader interested in protein-coding functions will find the total
nucleotide information for this mtDNA through the accession
number in Genbank. The fourth segment includes most of the
control region with several TA tandem repeat regions (see it in
Fig 1). However, the information about the gene organization
is, at present, not necessary for our study.
Note. These ideas were presented in the Annual Meeting
of the Chilean Society of Evolution and the Chilean Society of
Genetics, in Concepción, Chile, October 21 - 23 2009.
ACKNOWLEDGEMENT
I am indebted to my student, now my colleague, Javier
Cisternas for programming figures with the base distribution
and for improving my programs.
LITERATURE CITED
DRAKE JW (1993) Rates of spontaneous mutation among RNA viruses. Proc
Natl Acad Sci USA 90:4171-4175.
DRAKE JW (1999) The distribution of rates of spontaneous mutation over
viruses, prokaryotes, and eukaryotes. Ann N Y Acad Sci 870: 100-107.
DRAKE JW (2009) Avoiding dangerous missense: Thermophiles display
especially low mutation rates. PloS Genetics 5, Issue 6, e1000520.
DRAKE JW, CHARLESWORTH B, CHARLESWORTH D, CROW JF (1998)
Rates of spontaneous mutation. Genetics 148: 1667-1686.
FELLER W (1951) Diffusion processes in genetics. Proc Second Berkeley
Symp Math Stat Prob. Pp 227-246.
GATLIN LL (1976) Counter-examples to a neutralist hipótesis. J Mol Evol
7:185-195.
GOULD SJ (2002) The structure of evolutionary theory. The Belknap Press of
Harvard University Press, Cambridge, MA, USA. pp: 518-524.
GREDILLA R, BOHR VA, STEVNSNER T Mitochondrial DNA repair and
association with aging – An update. Exp Gerontol (2010) doi:10.1016/j.
exger.2010.01.017
JUKES TH (1976) Comments on Counter-Examples to a Neutralist
Hypothesis. J Mol Evol 8:295-297.
KIMURA M (1962) On the probability of fixation of mutant genes in a
population. Genetics 47: 713-719.
KIMURA M, OHTA T (1977) Further Comments on “Counter-Examples to a
Neutralist Hipotesis”. J Mol Evol 9:367-368.
KOCH RE (1971) The influence of neighboring base pairs upon base-pair
substitution mutation rates. PNAS (USA) 68: 773-776.
LI WH (1997) Molecular Evolution. Sunderland: Sinauer Associates.
MACKWAN RR, CARVER GT, KISSLING GE, DRAKE JW, GROGAN DW
(2008) The rate and character of spontaneous mutation in Thermus
thermophilus. Genetics 180: 17-25.
NEI M (2005) Selectionism and neutralism in molecular evolution. Mol Biol
Evol 22:2318-2342.
NEI M, SUZUKI Y, NOZAWA M (2010) The neutral theory of molecular
evolution in the genomic era. Annu Rev Genomics Hum Genet. Jun 21
(on line) PMID:20565254.
OHTA T (1992) The Nearly Neutral Theory of molecular evolution. Annu
Rev Ecol Syst 23:263-86
OHTA T (2002) Near-neutrality in evolution of genes and gene regulation.
Proc Nat Acad Sci 99:16134-16137.
PREVOSTI A (2000) La selección natural 30 años después. Memorias de la
Real Academia de Ciencias y Artes de Barcelona. Tercera Época Nº 964;
58(9): 349-397.
TUPPEN HAL, BLAKELY EL, TURNBULL DM, TAYLOR RW (2010)
Mitochondrial DNA mutations and human diseases. Biochim Biophys
Acta 1797:113-128.
VALENZUELA CY (1997) Non random DNA evolution. Biol Res 30:117-123.
VALENZUELA CY (2000) Misconceptions and false expectations in neutral
evolution. Biol Res 33:187-195.
VALENZUELA CY (2002a) A biotic Big Bang. In: Palyi G, Zucchi C &
Caglioti L (eds) Fundamentals of Life. Paris: Elsevier. pp: 197-202.
VALENZUELA CY (2002b) Does biotic life exist?. In: Palyi G, Zucchi C &
Caglioti L (eds) Fundamentals of Life. Paris: Elsevier. pp: 331-334.
VALENZUELA CY (2007) Within selection. Rev. Chil. Hist. Nat. 80:109-116.
VALENZUELA CY (2009) Non-random pre-transcriptional evolution in
HIV-1. A refutation of the foundational conditions for neutral evolution.
Genet Mol Biol 32: 159-169.
VALENZUELA CY (2010a) Internucleotide correlation and nucleotide
periodicity in Drosophila mtDNA: New evidence for panselective
evolution. Biol Res 43:497-502.
VALENZUELA CY (2010b) Periodicidades e interacciones del DNA. El fin
del neutralismo y del casi neutralismo (Textbook, in press)
VALENZUELA CY (2011) Nucleotide Correlation and Periodicity. End of
Neutral and Nearly-Neutral Evolution (to be sent).
VALENZUELA CY, SANTOS JL (1996) A model of complete random
molecular evolution by recurrent mutation. Biol. Res. 29:203-212.
VALENZUELA CY, FLORES SV, CISTERNAS J (2010) Fixations of the HIV-1
env gene refute neutralism: new evidence for pan-selective evolution.
Biol Res 43:149-163.
WRIGHT S (1931) Evolution in Mendelian populations. Genetics 16:97-159.
293
VALENZUELA Biol Res 44, 2011, 283-293
APPENDIX 1
METHOD TO STUDY THE ASSOCIATION BETWEEN TWO NUCLEOTIDES
SEPARATED (SEP) BY 0, 1, 2 … K NUCLEOTIDE SITES (VALENZUELA, 2010b)
SITE
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Base
A
A
T
G
G
C
T
T
A
C
G
G
C
T
C
A
Sep
PAIR OF BASES
0
1-2,
A-A
2-3,
A-T
3-4,
T-G
4-5,
G-G
5-6,
G-C
6-7,
C-T
7-8,
T-T
8-9,
T-A
9-10,
A-C
10-11,
C-G
1
1-3,
A-T
2-4,
A-G
3-5,
T-G
4-6,
G-C
5-7,
G-T
6-8,
C-T
7-9,
T-A
8-10,
T-C
9-11,
A-G
etc.
2
1-4,
A-G
2-5,
A-G
3-6,
T-C
4-7,
G-T
5-8,
G-T
6-9,
C-A
7-10,
T-C
8-11,
T-G
9-12,
A-G
etc.
3
1-5,
A-G
2-6,
A-C
3-7,
T-T
4-8,
G-T
5-9,
G-A
6-10,
C-C
7-11,
T-G
8-12,
T-G
9-13,
A-C
etc.
etc.
And so on, until K Sep. The distribution of pairs is compared to a random distribution by a χ29 test (4 rows for the first and 4 columns for the second base yield 9
degrees of freedom). The expected and observed values are compared for each of the 16 pairs and the χ21 contribution is obtained. The addition of these contributions
increases the χ29 value.
These associations have no relation to the expected protein-coding functions. With 0Sep, in a protein-coding segment a significant distribution will imply non-random
associations between the 1º and 2º codon positions, between the 2º and 3º positions, between the 3º position of a codon and the 1º position of the next codon, and
so on. The 1Sep implies association between the 1º and 3 º codon positions, between the 2º and the first position of the next codon, between the 3º and the 2º codon
position of the next codon, and so on.
APPENDIX 2
Deviations from randomness for the 16 dinucleotides
whose bases are separated by 17 nucleotide sites, ordered by the χ21 value (significance) contribution to the total χ29 value.
Pair
D Sign
Obs-Exp
χ21 cont
213
↑
101.1
91.4
234
↑
82.4
44.8
296
↑
90.5
39.8
Expected
Observed
G-G
111.9
C-G
151.6
C-C
205.5
G-C
151.7
210
↑
58.3
22.4
A-A
3401.0
3677
↑
276.0
22.4
A-G
616.4
516
↓
-100.4
16.4
G-A
617.3
518
↓
- 99.3
16.0
T-T
3181.7
3399
↑
217.3
14.8
C-A
836.6
732
↓
-104.6
13.1
T-G
596.1
513
↓
- 83.1
11.6
A-C
835.7
749
↓
- 86.7
9.0
G-T
597.1
537
↓
- 60.1
6.1
C-T
809.3
741
↓
- 68.3
5.8
T-C
808.1
746
↓
- 62.1
4.8
A-T
3289.9
3201
↓
- 88.9
2.4
T-A
3289.1
3217
↓
- 72.1
1.6
χ2
= 322.2
Total
19499.0
19499
9
D Sign = the sign of the Observed-Expected difference; ↑ = more dinucleotides observed than expected; ↓ = fewer dinucliotides observed than expected.
Biol Res 44: 295-299, 2011
Habituation of the eyeblink response in humans with stimuli
presented in a sequence of incremental intensity
Fernando P Ponce, Gonzalo R Quintana, Andrew S. Philominraj, Edgar H Vogel1
1
Universidad de Talca, Talca, Chile.
ABSTRACT
In an experiment we examined whether the repeated presentation of tones of gradually increasing intensities produces greater decrement
in the eyeblink reflex response in humans than the repetition of tones of constant intensities. Two groups of participants matched for their
initial level of response were exposed to 110 tones of 100-ms duration. For the participants in the incremental group, the tones increased
from 60- to 90- dB in 3-dB steps, whereas participants in the constant group received the tones at a fixed 90-dB intensity. The results
indicated that the level of response in the last block of 10 trials, in which both groups received 90-dB tones, was significantly lower in the
incremental group than in the constant group.
These findings support the data presented by Davis and Wagner (7) with the acoustic response in rats, but differ from several reports with
autonomic responses in humans, where the advantage of the incremental condition has not been observed unambiguously.
The discussion analyzes theoretical approaches to this phenomenon and the possible involvement of separate neural circuits.
Key words: habituation, incremental stimulus intensity effect, sensitization.
INTRODUCTION
When a stimulus is systematically repeated, the predominant
result is a progressive diminution in the frequency or amplitude
of the response. When it is proved that this decrement is
prolonged over time and that it is not caused by either muscular
fatigue or sensorial adaptation, it is inferred that a learning
phenomenon known as habituation has occurred (14, 27).
The universality of this simple form of learning has been
demonstrated in a broad range of organisms such as protozoa
(33), birds (8), fish (22), mollusks (11), rats (3), rabbits (32), cats
(13, 27), dogs (23) and humans (9), just to name a few. A good
deal of research has focused on determining the conditions
or parameters that lead to habituation (26, 27). Although
it seems to be a well-established fact that the effectiveness
of habituation depends on the number and spacing of the
repetitions, the experimental evidence is less clear regarding
other factors, such as the intensity of the stimulus.
In this last category, there is a phenomenon known as
“incremental stimulus intensity effect” (ISIE), which refers to
the observation that habituation is more effective when the
repetition of the stimulus involves progressive increments in its
intensity than when the intensity is constant (13). The existence
of this effect has been taken as evidence favoring the so-called
Dual-Process Theories of Habituation (e.g., 13), which argues
that in addition to the decremental tendencies that are specific
to the stimulus in question (habituation), the repetition of the
stimulus also produces generalized decrements in the form of
loss of arousal or desensitization, the latter explaining ISIE.
The first systematic observations of ISIE were made in
experiments on instrumental conditioning, in which animals
were trained to produce an operant response rewarded with
food, which was presented simultaneously with an electric
shock (1, 16, 18). The results indicated that even though the
punishment provoked a suppressing effect over the rewarded
behavior, this effect progressively disappeared over the trials,
and that this decrement was stronger when the punishment
was delivered with shocks of incremental rather than constant
intensities. Despite the suggestive character of these findings,
it is not clear whether the decrement in “aversiveness” to the
electric shock was due to habituation, since this might also be
interpreted as the development of antagonistic behavior that
aided the animals to avoid the shocks, or as the formation of an
association between the shock and the reward (7).
These diffi culties led to studies in which the stimulus
in question was repeated under conditions in which there
were neither rewards nor obvious possibilities to avoid the
aversive stimulus by expressing certain behaviors. The first of
these studies was conducted by Church, LoLordo, Overmier,
Solomon and Turner (2), who demonstrated that habituation to
a cardiac acceleration response provoked by electric shock was
greater in a group of dogs that received shocks of increasing
intensities (from 0.5- to 6- mA) than another group that
received the stimuli at a fixed intensity. Davis and Wagner (7,
Experiment 2) studied the same effect in rats by comparing
the acoustic startle response to 120-dB tones in groups of rats
that had been exposed to 750 stimuli at either a constant 120dB, a constant 100-dB, a random order of intensities between
85 and 120-dB, or a gradually increasing order of intensities
between 85 and 120-dB. The findings indicated that there was
substantially less response in the test with a 120-dB tone in the
group that had experienced gradually increasing intensities
than in any of the other three groups. Groves and Thompson
(13, Experiment 3) essentially replicated these findings with the
limb flexion reflex in the spinal cat.
In contrast to studies with dogs, rats and cats, the
evidence in humans is not very clear. For example, O’Gorman
and Jamieson (20, 21) demonstrated that the progressive
presentation of an acoustic stimulus (between 80- and 100dB, Experiment 1, 20; between 64- and 100-dB, 21) caused
a higher decrement in electrodermal response than did
constant presentations (100-dB). However, such an effect was
* Corresponding author: Edgar H. Vogel, Universidad de Talca, Casilla N° 747, Talca/Chile. Tel: (5671) 201566 - Fax: (5671) 201510. E-mail: [email protected]
Received: November 29, 2010. In revised form: January 11, 2011. Accepted: January 13, 2011.
296
VOGEL ET AL. Biol Res 44, 2011, 295-299
not replicated when they measured the finger blood volume
response (20, Experiment 1) and the cardiac response (20,
Experiment 2). Similar difficulties to find this effect have
been reported in procedures that employed galvanic skin and
cardiac responses to phobic images (12) and electrodermal
response to acoustic stimuli (17).
The absence of robust evidence of ISIE in humans casts
doubts on its generality. Facing this ambiguity of results, it
is necessary to take a look at the differences and similarities
between studies that have found the effect and those that
have not. On the one hand, most of the positive results have
been obtained by examining skeletal responses in animals,
such as the startle response in rats (7) and the limb flexion
reflex in the spinal cat (13), which are typically of slow
habituation. On the other hand, studies that have tested ISIE
in autonomic responses, such as electrodermal and cardiac
responses, which are both of more rapid habituation, have
only demonstrated ISIE when the constant group has not
shown detectable habituation (2, 20, 21). In contrast, when
the habituation has been achieved in the constant group, the
effect tends to disappear (17), possibly due to a floor effect
that could complicate the detection of differences between the
constant and incremental procedures. Thus, it could be argued
that the ISIE can only be detected when the response is of slow
habituation (skeletal) or when it is tested in the early stages
in the development of habituation of autonomic responses. Of
course, given the limited number of studies in this area, this is
only speculation.
Taking into consideration the theoretical and empirical
importance of this phenomenon, the methodological
difficulties to observe pre-asymptotic habituation of autonomic
responses and the absence of studies with human skeletal
responses, this investigation examined the ISIE with a skeletal
response typically used in studies of human habituation,
eyeblink response. The habituation of this response has been
relatively well studied in humans and has the advantage of
requiring a considerable number of trials to reach asymptotic
levels of habituation (9).
METHOD
Participants
A total of 72 male and female undergraduate students of the
University of Talca, with a mean age of 18.2 years (SD = 0.23),
participated in the experiment for course credit. They were
tested individually and had no previous experience in similar
research.
Apparatus
The experiment was carried out in a dimly illuminated (18
w bulb) and acoustically isolated room (2.5 m x 2.7 m x 2.4
m). The presentation of the stimulus and the recording of
responses were controlled by the Eyeblink Conditioning
System (San Diego Instruments, San Diego, CA), which
administered the acoustic stimulus and registered eyeblink
responses. The acoustic stimulus was a 100-ms tone, presented
through MAICO earphones.
The eyeblink response was measured by a low power
infrared photoelectric emitter/receiver that measures the
amount of light reflected as the eyelid closes. The changes in
reflected light as blinks occurred were converted to changes in
electrical signals that were analyzed by a computer program.
The photoelectric cell was located in front of the participant’s
right eye and was supported by a headband to keep it in a
fixed position throughout the experiment.
Procedure
The experiment consisted of 4 phases: adaptation, pretest,
habituation and post-test. In the adaptation phase, the
researcher placed the headband with the stimulation and
registration devices on the participant’s head and calibrated
its position to obtain a detectable eyeblink response. The
experimenter then left the room and allowed the participants
to adapt to the situation for 3 minutes without stimulation.
In the pretest phase the participants received 5 tones of 90dB at 40 sec intervals. The objective of the pretest was to
determine the average level of response to the 90-dB tone
before habituation. In the habituation phase, the participants
were exposed to 100 presentations of a tone at 40-sec intervals.
The constant group received these habituation sequences in
a constant intensity of 90-dB, whereas the incremental group
began with 10 tones of 60-dB rising gradually by 3-dB to the
successive blocks of 10 sequences, until reaching a maximum
of 87-dB. Finally, during the post-test phase, the participants in
both groups received 10 trials of 90-dB tones.
Scoring
Movements of the participant’s eyelid were recorded with a
frequency of one sample every 1-ms, which were expressed
as changes in the voltage transmitted by the transducer.
A standardization trial was conducted with one naive
volunteer to obtain a measure of the amplitude of a typical
eyelid response to the tone. The maximal voltage obtained
during the 200-ms following the onset of the stimulus was
regarded as a response amplitude of l00. The responses
of all participants were expressed as a percentage of this
standardization value.
The measure of the evoked responses was based on the
maximal amplitude occurring within the 200-ms following the
onset of the stimulus. An eyelid response was scored only if the
record indicated an amplitude of 5% or more within the 100-ms
of stimulus duration. A valid trial was defined as one in which
the amplitude of response was lower than 5% within the 200ms window that preceded the onset of the stimulus.
Results
Figure 1 shows the mean amplitude of response of the two
groups during the pretest with the 90-dB tones, over blocks of
10 trials when the groups received different intensities of the
tones, and on the post-test in which each group was exposed
again to the 90-dB tones. First, it is observed that both groups
experienced a considerable decrement in responding to the
90-dB tone from pretest to post-test, indicating that the 100
habituation trials were effective in producing habituation in
both conditions. Second, it can be seen that although the two
groups exhibited similar amplitudes of responses during the
pretest, there was considerably more response in the constant
than in the incremental group in the post-test. This greater
decrease in response in the incremental group supports
VOGEL ET AL. Biol Res 44, 2011, 295-299
the idea that the incremental sequence is more efficient in
producing habituation than the constant sequence.
The reliability of these observations was confirmed by a 2
(test: pretest, posttest) x 2 (group: constant, incremental) mixed
design ANOVA. In order to avoid a loss of statistical power if
the amplitude of response in the post-test were more uniform
than in the pretest, a blocking factor of 2 levels based on the
participants’ initial amplitude of response was introduced (19).
The blocking factor was obtained by dividing the participants
into two groups using the median amplitude of response in the
pretest as a cut-off point.
The ANOVA showed a significant main effect of test
(F(1, 38) =186.363; p <0.001; η2 partial =0.831) and blocking
(F(1, 38) =69.332; p <0.001; η2 partial =0.646), and no reliable
main effect of the group (F(1, 38) =0.664; p =0.420; η2 partial
=0.017). There were also reliable interactions between test and
group (F(1, 38) =6.376; p =0.016; η2 partial =0.144) and between
test and blocking (F(1, 38) =56.641; p <0.001; η2 partial =0.598).
The interactions between group and blocking and between
group, blocking and test were non-reliable (ps >0.901).
All the effects related to the blocking factor confirm the
utility of this procedure, especially the interaction between
blocking and test, since it reflects the fact that the differences
between the high and low responders tend to disappear in
the post-test. The most interesting effects are the main effect
of test and the interaction between group and test. On the one
hand, the effect of the test reveals the existence of a decrement
in both groups from pretest to post-test, which confirms the
effectiveness of both procedures in producing habituation. On
the other hand, the interaction between group and test was
assessed by evaluating the simple effects of group in each
test. This analysis indicated that the two groups showed no
differences between them in the pretest (p =0.339), but did
differ in the post-test, where the incremental group responded
significantly less than the constant group (p =0.037).
297
An interesting aspect of the data shown in Figure 1 is
the demonstration of the incremental intensity effect, even
though substantial evidence of habituation in both groups
was obtained. This is contrary to the observations in which
the incremental effect appears only when habituation had not
yet occurred in the constant group (2, 20). In addition, Figure
1 shows extra evidence of habituation in both groups in that
the data indicated a progressive decrement in the amplitude
of the response within the 10 blocks of the habituation phase.
Naturally, this drop is less marked in the incremental group
since the decremental tendencies compete with the progressive
increase in the stimulus intensity, although in the end, the
decrease tends to predominate.
DISCUSSION
The results of this investigation provide positive evidence
of the existence of the incremental stimulus intensity effect
in the habituation of the eyeblink response in humans. This
information represents the first demonstration of this effect
with skeletal responses in humans and is in agreement with
the studies reported by Davis and Wagner (7) and Groves and
Thompson (13) on the startle response in rats and the limb
flexion reflex in the spinal cat, respectively.
As mentioned above, even though there is some evidence
of the ISIE in the habituation of the autonomic responses,
such as the cardiac response in dogs (2) and the electrodermal
response in humans (20, 21), there is also evidence of null
effects (with the electrodermal response, 17, and with the blood
volume response, 20). Remarkably, the positive effects seen
in the literature tend to match with poor habituation in the
constant group.
It could be inferred that what produces controversial
results is the quickness of the habituation of autonomic
responses. If this were the case, the absence of the effect
Figure 1. Mean amplitude of eyeblink response of the constant group (black dots, n=36) and incremental group (white dots; n=36) during
the pretest, training and post-test phases. The error bars represent the standard error of the mean.
298
VOGEL ET AL. Biol Res 44, 2011, 295-299
would be a detection problem. According to this reasoning, it
is important to distinguish between asymptotic habituation
and non-detectable habituation, since it has been proven that
habituation often continues beyond the detection margin,
which has been called “below-zero habituation” (27). Thus, to
detect the possible differences between the incremental and
constant conditions when below-zero habituation is produced,
further investigations should employ more sensitive measures,
such as the comparison of differential levels of spontaneous
recovery.
Another interesting aspect of the ISIE is the type of
habituation theory required to explain it. Several researchers
(e.g., 13, 26), have pointed out that this phenomenon poses
serious difficulties for certain habituation theories, such as
the so-called comparator theory of Sokolov (24, 25). Sokolov
suggested that stimulus repetition leads to the formation of
a neuronal model in the cerebral cortex and that each new
presentation of the stimulus is compared to the model. The
greater the difference between the stimulus and the model,
the greater is the expected response to the stimulus. Therefore,
as these representations develop, the stimulus becomes more
similar to the model, and progressively losses its capacity to
produce the response. This theory fails to explain the ISIE
because it assumes that the repetition of a stimulus with
incremental intensities is equivalent to the repetition of
different stimuli, which would always produce a difference
between the model and the actual stimulus.
Groves and Thompson (13) have pointed out that their
dual theory of habituation is better prepared to explain the
ISIE. According to these authors, the presentation of a stimulus
produces two opposite and interacting tendencies, a specific
decremental tendency (or habituation, which is subordinated
to the stimulus-response system) and a global incremental
tendency (or sensitization, which is subordinated to the
activation state or arousal of the organism), which combine to
produce the observed behavior. When a stimulus is repeated,
both tendencies change their magnitude depending on various
factors, such as the intensity of the stimulus and the number
of repetitions. The sensitization process dominates over the
habituation process with more intense stimulus but decreases
with the number of repetitions, while the habituation process
develops more easily with lower intensities and increases
with stimulus repetition. Following this logic, Groves and
Thompson explain the ISIE by suggesting that the constant
group suffers a higher sensitization and lower habituation than
the incremental group, because the latter group receives less
intense stimuli in each block.
Wagner and Vogel (31) used the associative machinery
of the SOP (29) and AESOP (30) models to describe how
incremental and decremental processes may interact in
habituation procedures. According to the SOP model, when a
stimulus is repeatedly presented in a context, the context acts
as a conditioned stimulus that develops an association with
the habituating stimulus, which in turns plays the role of the
unconditioned stimulus. As this association develops, the
stimulus becomes progressively more expected in the context.
SOP further assumes that an expected or pre-processed
stimulus is not as effectively processed, as it otherwise would
be, which would explain the decremental tendencies that
resulted from the repetition of the stimulus. On the other
hand, according to the additional principles contained in
the AESOP model, certain emotional responses provoked
by the stimulus, like fear, can also be conditioned to the
context, which would acquire the property of potentiating
the response to the habituating stimulus. The AESOP model
assumes that decremental and incremental tendencies develop
simultaneously and obey to different associative parameters.
A shared aspect between the dual theory of Groves and
Thompson (13) and the Wagner ’s approach (29-31) is the
assumption that the decremental process is assumed to
be specific to the stimulus-response system, whereas the
incremental process is global, affecting multiple response
systems simultaneously. According to this, it would be
possible to evaluate whether the advantage of the incremental
group over the constant group is due to differential
habituation or differential sensitization, if it were possible
to employ two different stimuli, perhaps one acoustic and
the other tactile, that have been demonstrated to have at
least partially separable startle-producing features. Then it
would be possible to determine whether the exposure to one
of the stimuli in the incremental versus constant conditions
produced less responding in the incremental condition specific
to the exposed stimulus (due to differences in habituation to
the repeated stimulus) or less responding to the two stimuli
(due to differences in sensitization). This sort of experiments
needs preparations that show robust stimulus specific
habituation, which has not been demonstrated systematically
yet in the procedures in which the ISIE effect has been
observed (9, 28).
Another methodological strategy to uncover the real
nature of the ISIE might be to examine the neural pathways of
incremental and decremental processes involved in habituation
procedures. This could be based in the fact that neural circuit
of the startle response is clearly drawn to the level of the
sensory-motor connections with the reticular system (5). It has
also been demonstrated that the habituation of this response
is seriously affected by lesions in this pathway (15). On the
other hand, there is substantial evidence that the acquisition of
different levels of sensitization occur in different neural circuit,
which has been proven by studies that demonstrated that
the startle response could be enhanced by the experimental
activation of the amygdala (4, 6, 10). By means of the structural
or chemical deactivation of one of these circuits it could be
clarified if the differences between the two experimental
conditions are due to differences in the habituation or
sensitization circuits.
The habituation theories and the understanding of this
phenomenon will be able to move beyond the current state,
to the extent that some procedures are developed to allow
separating the different influences that underlie this apparently
simple type of learning.
ACKNOWLEDGEMENTS
This work was supported by grants from Fondecyt Nº 1090640
to Edgar Vogel and from the University of Talca to the Program
of Research on the Quality of Life (Res. 387/2007).
REFERENCES
1. BROWN JS, WAGNER AR (1964) Resistance to punishment and extinction
following training with shock or non-reinforcement. J Exp Psychol 62:
169-179
2. CHURCH RM, LOLORDO V, OVERMIER JB, SOLOMON RL, TURNER
LH (1966) Cardiac responses to shock in curarized dogs: Effects of shock
VOGEL ET AL. Biol Res 44, 2011, 295-299
intensity and duration, warning signal, and prior experience with shock.
J Comp Physiol Psychol 62: 1-8
3. DAVIS M (1970) Effect of interstimulus interval length and variability on
startle response habituation in the rat. J Comp Physiol Psychol 87: 571-581
4. DAVIS M (1992) The role of the amygdala in fear and anxiety. Annu Rev
Neurosci 15:353–375
5. DAVIS M, GENDELMAN DS, TISCHLER M, GENDELMAN PM (1982)
A primary acoustic startle circuit: lesion and stimulation studies. J
Neurosci 2: 791– 805
6. DAVIS M, FALLS WA, CAMPEAU S, KIM M (1993) Fear-potentiated
startle: A neural and pharmacological analysis. Behav Brain Res 58:175–
198
7. DAVIS M, WAGNER AR (1969) Habituation of startle response under
incremental sequence of stimulus intensities. J Comp Physiol Psychol
67: 486-492
8. DONG S, CLAYTON DF (2009) Habituation in songbirds. Neurobiol Learn
Mem 92: 183-188
9. DYCUS WA, POWERS AS (1997) Eyeblink cross-habituation between
tactile and acoustic system in humans. Psychobiology 28: 507-514
10. FRANKLAND PW, JOSSELYN SA, BRADWEJN J, VACCARINO FJ,
YEOMANS JS (1997) Activation of Amygdala CholecystokininB
Receptors Potentiates the Acoustic Startle Response in the Rat. J.
Neurosci.17: 1838 -1847
11. FROST WN, BRANDON CL, VAN ZYL C (2006) Long-term habituation
in the marine marine mollusc and Tritonia Diomedea. Biol Bull 210:
230-237
12. GRAYSON JB (1982) The elicitation and habituation of orienting and
defensive responses to phobic imagery and the incremental intensity
effect. Psychophysiology 19: 104-111
13. GROVES PM, THOMPSON RF (1970) Habituation: A dual-process theory.
Psychol Rev 77: 419-450
14. HUMPHREY G (1933) The nature of learning. New York: Harcourt Brace.
15. JORDAN WP, LEATON RN (1982). The effects of mesencephalic reticular
formation lesions on habituation of the startle and lick suppression
responses in the rat. J Comp Physiol Psychol 96: 170-183
16. KARSH EB (1963) Changes in intensity of punishment: Effect on running
behaviour of rats. Science 140: 1084-1085
17. KYRIACOU C, SIDDLE DAT, SPINKS JA, STEPHENSON D, TURPIN
G (1977). The incremental stimulus intensity effect and habituation of
evoked electrodermic response. Physiol Psychol 5: 16-20
18. MILLER NE (1960) Learning resistance to pain and fear: Effects of
overlearning, exposure, and rewarded exposure in context. J Exp
Psychol 60: 137-145
299
19. MYERS JL, WELL AD (1995). Research Design and Statistical. Hillsdale,
NJ, Lawrence Erlbaum
20. 1O’GORMAN JG, JAMIESON RD (1975) The incremental stimulus
intensity effect and habituation of autonomic responses in man. Physiol
Psychol 3: 385-389
21. O’GORMAN JG, JAMIESON RD (1978) Further observations on the
incremental stimulus intensity effect and habituation of electrodérmica
response. J Gen Psychol 98: 145-154
22. PEEKE HVS, VENO A (1973) Stimulus specificity of habituated
aggression in the stickleback Gasterosteus aculeatus. Behav Biol 8: 427432
23. SEAL JB, ZBROZYNA AW (1978) Renal vasoconstriction and its
habituation in course of repeated auditory-stimulation and naturally
elicited defense reactions in dogs. J Physiol 280: 56-57
24. SOKOLOV EN (1960) Neuronal models and the orienting influence. In:
BRAZIER MA (Ed) The central nervous system and behavior III, New
York: Macy Foundation
25. SOKOLOV EN (1963) Higher nervous functions: The orienting reflex.
Annu Rev Physiol 25: 545-580
26. THOMPSON RF (2009) Habituation: A history. Neurobiol Learn Mem 92:
127-134
27. THOMPSON RF, SPENCER WA (1966) Habituation: A model
phenomenon for the study of neuronal substrates of behaviour. Psychol
Rev 73: 16-43
28. VOGEL EH, WAGNER AR (2005) Stimulus specificity in the habituation
of startle response on rat. Physiol Behav 86: 516-525
29. WAGNER AR (1981) SOP: A model of automatic memory processing
in animal behavior. In: SPEAR NE, MILLER RR (Eds) Information
processing in animals: Memory mechanisms. New York: Lawrence
Erlbaum Associates
30. WAGNER AR, BRANDON, SE (1989) Evolution of a structured
connectionist model of Pavlovian conditioning (AESOP). In: KLEIN
SB, MOWRER RR (Eds) Contemporary learning theories: Pavlovian
conditioning and the status of traditional learning theory. New York:
Erlbaum
31. WAGNER AR, VOGEL EH (2010) Associative modulation of US
processing: Implications for understanding of habituation. In:
SCHMAJUCK N (Ed) Computational models of classical conditioning.
Cambridge University Press
32. WHITLOW JW (1975) Short-term memory in habituation and
dishabituation. J Exp Psychol 104: 189-206
33. WOOD DC (1973) Stimulus specific habituation in a protozoan.
Physiology and Behavior 11: 349-354
Biol Res 44: 301-305, 2011
Insulin is secreted upon glucose stimulation by both gastrointestinal
enteroendocrine K-cells and L-cells engineered with the
preproinsulin gene
1,3Gonzalo
Encina,
2
Fernando Ezquer,
2
Paulette Conget,
1,3,4
Yedy Israel
1
Laboratory of Gene Therapy, Department of Pharmacological and Toxicological Chemistry, Universidad de Chile, Santiago, Chile.
Instituto de Ciencias, Facultad de Medicina Clínica Alemana Universidad del Desarrollo, Santiago, Chile.
3 Millennium Institute for Cell Dynamics and Biotechnology, Santiago, Chile, and
4 Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia PA.
2
ABSTRACT
Transgenic mice carrying the human insulin gene driven by the K-cell glucose-dependent insulinotropic peptide (GIP) promoter secrete
insulin and display normal glucose tolerance tests after their pancreatic β-cells have been destroyed. Establishing the existence of other
types of cells that can process and secrete transgenic insulin would help the development of new gene therapy strategies to treat patients
with diabetes mellitus. It is noted that in addition to GIP secreting K-cells, the glucagon-like peptide 1 (GLP-1) generating L-cells share/
many similarities to pancreatic β-cells, including the peptidases required for proinsulin processing, hormone storage and a glucosestimulated hormone secretion mechanism.
In the present study, we demonstrate that not only K-cells, but also L-cells engineered with the human preproinsulin gene are able to
synthesize, store and, upon glucose stimulation, release mature insulin. When the mouse enteroendocrine STC-1 cell line was transfected
with the human preproinsulin gene, driven either by the K-cell specific GIP promoter or by the constitutive cytomegalovirus (CMV)
promoter, human insulin co-localizes in vesicles that contain GIP (GIP or CMV promoter) or GLP-1 (CMV promoter). Exposure to glucose of
engineered STC-1 cells led to a marked insulin secretion, which was 7-fold greater when the insulin gene was driven by the CMV promoter
(expressed both in K-cells and L-cells) than when it was driven by the GIP promoter (expressed only in K-cells).
Thus, besides pancreatic β-cells, both gastrointestinal enteroendocrine K-cells and L-cells can be selected as the target cell in a gene therapy
strategy to treat patients with type 1 diabetes mellitus.
Key terms: Type 1 diabetes mellitus, preproinsulin gene, gastrointestinal enteroendocrine cells, K-cells, L-cells.
INTRODUCTION
While in early studies the regulation of blood glucose was
considered to be controlled mainly by the endocrine pancreas,
it is now clear that cells in the gastrointestinal tract can sense
carbohydrates and other food components, releasing hormones
that potentiate the glucose-dependent liberation of insulin by
pancreatic β-cells (McIntyre et al., 1964, Perley & Kipnis, 1970,
Dupré et al., 1973). Gastrointestinal enteroendocrine K-cells and
L-cells release the glucose-dependent insulinotropic peptide
(GIP) and glucagon-like peptide 1 (GLP-1), respectively.
Due to their common developmental origin, pancreatic
β-cells, K-cells and L-cells show marked similarities, which
include: (i) the expression of the PC1/3 and PC2 peptidases
needed for the conversion of proinsulin to insulin, (ii) the
presence of GLUT-2 glucose transporter, (iii) a glucosedependent mechanism for hormone secretion, with granules
that can store and readily secrete their respective hormones
(Spooner et al., 1970, Baggio & Drucker 2007). Nonetheless,
gastrointestinal enteroendocrine cells are not susceptible to
the autoimmune-mediated destruction of pancreatic β-cells
observed in patients with type 1 diabetes mellitus (Vilsbøll et
al., 2003).
Interestingly, in healthy individuals, plasma GIP and GLP-1
levels kinetically match the changes in plasma insulin levels
following meals (Fujita et al., 2004). Thus, it is expected that if
gastrointestinal enteroendocrine cells of patients with type 1
diabetes mellitus were endowed with the ability to express the
preproinsulin gene, they could contribute to the normalization
of postprandrial blood glucose. A proof-of-principle of
this hypothesis was the data generated in transgenic mice
carrying the human insulin gene under the K-cell specifi c
GIP promoter (Cheung et al., 2000). When rendered diabetic
by streptozotozin-mediated destruction of their pancreatic
β-cells, these animals showed normal glucose tolerance tests
results and expressed human insulin in cells in the stomach
and duodenum. While this study shows that K-cells might be a
good target for therapeutic strategies, embryonic transgenesis
cannot be applied to treat patients. It is also noted that these
authors did not address the possibility that cells other than
K-cells might also have the ability to secrete transgenic insulin
upon glucose stimulation.
Several studies have reported gene-based strategies
targeting different organs and tissues designed for the
treatment of individuals with type 1 diabetes mellitus
(Kolodka et al., 1995, Lipes et al., 1996, Goldfine et al.,
1997, Bartlett et al., 1997, Bochan et al., 1999, Falqui et al.,
1999, Olson et al., 2003). However, to date a timed glucosedependent release of preformed insulin is an unachieved goal.
Gatrointestinal enteroendocrine cells might constitute ideal
gene therapy cell targets to manage postprandial glycemia
levels.
* Reprint requests to: Gonzalo Encina, Ph.D., Laboratory of Gene Therapy, University of Chile, Sergio Livingstone (Ex Olivos) 1007, Independencia, Santiago, RM 11111, Chile.
Email: [email protected] - Telephone: (56 2) 978 2943 - Fax: (56 2) 737 7291
Received: February 28, 2011. In revised form: May 22, 2011. Accepted: June 29, 2011.
302
ENCINA ET AL. Biol Res 44, 2011, 301-305
The aim of our work was to assess in vitro if the
transfection into K-cells and L-cells of the human
preproinsulin gene, driven either by the GIP promoter or by
cytomegalovirus (CMV) promoter, results in mature insulin
(i) synthesis, (ii) storage in granules, and (iii) secretion
upon glucose stimulation. We also compared the relative
contribution of a K-cell specific promoter versus a constitutive
promoter.
or pAAV-CMV/eGFP plasmids using Lipofectamine 2000
(Invitrogen, Carlsbad, CA, USA) in serum free DMEM. After
six hours, FBS was restored. Two days later, the cells were
trypsinized (Invitrogen) and centrifuged at 500 x g for 10
minutes at room temperature. The pellet was resuspended
and cells were fixed with 2% p-formaldehyde (Sigma-Aldrich
St. Louis, MO, USA) in PBS. Finally, eGFP fluorescence was
measured in cells using a BD FACSCanto™ flow cytometer,
and data obtained were analyzed with the Weasel 2.5 Software.
MATERIALS AND METHODS
Co-localization of human insulin with mouse GIP or mouse GLP-1
Cell line and culture conditions
The murine plurihormonal mixed intestinal STC-1 cell
line (Rindi et al., 1990) was obtained from the ATCC with
permission of Dr. D. Hanahan (University of California,
San Francisco). Cells were cultured in DMEM (Invitrogen,
Auckland, New Zealand) containing 10% fetal bovine serum
(FBS; Hyclone, Logan, UT, USA) supplemented with 100
IU/mL penicillin (Invitrogen) and 50 μmol/L streptomycin
(Invitrogen), in an atmosphere of 5% CO2 and 100%
humidity.
Plasmids
pAAV-CMV/eGFP was obtained from Stratagene (Cedar
Creek, TX, USA). To construct pAAV-GIP/eGFP, the 1,227
bp rat GIP promoter (nucleotides -1153 to +7) was amplified
from genomic DNA by PCR, cloned into pGEM-T Easy
(Promega, Madison, WI, USA) and sequenced to confirm that
no errors were introduced into the product. The upstream
and downstream primers used were (5’)- ATC TCT CCA
GTC CCT TCC TC -(3’) and (5’)- GGA TCC AGC TCT TCC
AGG AGG GCA GGA TG - (3’), respectively. The fragment
containing the GIP promoter was excised from pGEM-T Easy
with the use of Not I (Promega) restriction enzyme and ligated
into Not I site of the pAAV-MCS (Stratagene) using T4 DNA
ligase (Promega). To construct pAAV-CMV/INS, the complete
human preproinsulin gene (nucleotides +9 to +1831) was
amplified from genomic DNA by PCR, cloned into pGEM-T
Easy (Promega) and sequenced to confirm that no errors were
introduced into the product. The upstream and downstream
primers used were (5’)- GGA TCC AGG ACA GGC TGC
ATC -(3’) and (5’)- CCT CCA CAG GGA CTC CAT CAG -(3’),
respectively. The fragment containing the human preproinsulin
gene was excised from pGEM-T Easy using EcoR I restriction
enzyme (Promega) and subsequently cloned into the EcoR I
restriction site of the pAAV-MCS.
To construct pAAV-GIP/INS, a BamH I site was included
at the 5’ end of the downstream primer for the GIP promoter
and the upstream primer for the preproinsulin gene. Fragments
containing the GIP promoter and the human preproinsulin
were excised from pGEM-T Easy using Not I (Promega)
and BamH I (Invitrogen, Carlsbad, CA, USA) restriction
enzymes. A three-fragment ligation was performed using T4
DNA ligase (Promega) to insert the rat GIP promoter and the
human preproinsulin gene into Not I site of the pAAV-MCS
(Stratagene).
Assessment of transfection efficiency and promoter strength:
STC-1 cells seeded in 6-well plates and grown to 60%
confluence were transfected with 2 μg of pAAV-GIP/eGFP
STC-1 cells seeded on sterile 18x18 mm cover slips and grown
to 60% confluence were transfected with 2 μg of pAAV-GIP/
INS or pAAV-CMV/INS using Lipofectamine 2000 (Invitrogen)
in serum free DMEM. After six hours, FBS was restored.
Two days later, cover slips were gently washed twice with
PBS. Subsequently, cells were fixed with 4% p-formaldehyde
(Sigma-Aldrich) in 100 mM PIPES buffer, pH 6.8, containing
0.04 M KOH, 2 mM EGTA, and 2 mM MgCl2 for 20 minutes
and washed three times with 50 mM Tris-HCl buffer, pH 7.6,
containing 0.15 N NaCl and 0.1% sodium azide (universal
buffer). Cells were permeabilized with 0.1% Triton X-100
(Sigma-Aldrich) in universal buffer for 10 minutes, washed
twice with universal buffer, and then blocked with 2% bovine
serum albumin in the same buffer for 30 minutes. Cells were
then incubated simultaneously with mouse monoclonal IgG
anti-human mature insulin (2D11-5, 1:100), and goat polyclonal
IgG anti-mouse GIP (Y-20, 1:100) or goat polyclonal IgG antimouse GLP-1 (C-17, 1:100) (all from Santa Cruz Biotechnology,
Santa Cruz, CA, USA), at room temperature for one hour. After
washing, cells were incubated simultaneously with FITCconjugated anti-mouse IgG (1:200) and TR-conjugated anti-goat
IgG (1:200) (all from Santa Cruz Biotechnology). Samples were
then mounted onto slides with UltraCruz™ Mounting Medium
(Santa Cruz Biotechnology) and optical sections were obtained
following excitation at 488 or 543 nm with a Carl Zeiss LSM
410-Axiovert 100 confocal microscope.
Human mature insulin secretion assay in standard culture condition with
glucose stimulation
STC-1 cells plated at 10 5 cells/well on 12-well plates and
grown to 60% confluence were transfected with 2 μg of pAAVGIP/INS or pAAV-CMV/INS using Lipofectamine 2000
(Invitrogen) in serum free DMEM. After six hours, FBS was
restored. When cells were 80% confl uent, culture medium
was replaced either by DMEM or Krebs-Ringer bicarbonate
buffer containing HEPES plus 0.1% BSA (secretion buffer).
In the former case, conditioned medium were collected three
and 24 hours later. In the later case, after one hour at 37ºC,
the buffer was replaced by a secretion buffer containing
either no glucose or 50 mM glucose (the latter, in line with
glucose concentrations achieved in the GI tract). Three hours
later, media were collected, centrifuged at 1,500 x g and
assayed for human insulin using the human-specific insulin
ELISA kit (Linco Research, St. Charles, MO, USA), according
to manufacturer ’s instructions. The monoclonal antibody
included in the kit recognizes neither preproinsulin nor
proinsulin. To standardize the data, total protein were assessed
by Bradford method.
303
ENCINA ET AL. Biol Res 44, 2011, 301-305
Statistical analysis
The results were expressed as mean ± standard error. The
student’s t-test was used to compare experimental group data.
P < 0.05 was considered statistically significant.
RESULTS
The STC-1 cell line is a duodenal tumor-derived cell line (Rindi
et al., 1999) containing a heterogeneous and plurihormonal
population of cells, including enteroendocrine K-cells and
L-cells (Brubacker et al., 2003). To assess gene transfection
efficiency and promoter strength in these cells we evaluated
the expression of the reporter eGFP gene driven by either
the K-cell specific 1.2 kb GIP promoter (pAAV-GIP/eGFP) or
the constitutive CMV promoter (pAAV-CMV/eGFP). Cells
transfected with pAAV-CMV/eGFP showed a greater number
of eGFP positive cells (8.7% vs. 13.6%; p<0.05) and a 4-fold
higher eGFP fluorescent intensity (9.1 ± 0.1 vs. 35.6 ± 3.7;
p<0.02) than cells transfected with pAAV-GIP/eGFP. Thus, as
expected, the CMV promoter targets a broader number/type of
enteroendocrine cells and results in a stronger expression than
when the gene is driven by the GIP promoter.
To determine whether engineered enteroendocrine cells
express 1 the preproinsulin gene and process it into mature
insulin, STC-1 cells were transfected with plasmids coding
for the complete human preproinsulin gene driven either by
the K-cell specific GIP promoter (pAAV-GIP/INS) or the CMV
promoter (pAAV-CMV/INS). Confocal microscopy analyses
of STC-1 cells transfected with pAAV-GIP/INS showed
mature human insulin in GIP producing cells (K-cells) (Fig.
1A), but not in GLP-1 producing ones (data not shown). Cells
transfected with the pAAV-CMV/INS plasmid showed human
mature insulin in both GIP (K-cells) and GLP-1 (L-cells)
producing cells (Figs. 1B and 1C, respectively). Irrespective
A
B
pAAV-GIP/INS
of the promoter used, mature human insulin co-localized in a
granular pattern with the endogenous hormones, known to be
produced and stored in secretory vesicles by enteroendocrine
cells (reviewed in Baggio & Drucker, 2007, Cho and Kieffer,
2010). Consistent with data obtained with the eGFP reporter
gene, the frequency of positive cells and the fl uorescence
intensity for insulin were higher in cells transfected with
pAAV-CMV/INS than in cells transfected with pAAV-GIP/
INS (Figs. 1A and 1B).
To determine whether engineered enteroendocrine cells
secrete transgenic insulin, STC-1 cells were transfected with
plasmids coding for the complete human preproinsulin gene
driven either by the K-cell specific GIP promoter (pAAVGIP/INS) or the CMV promoter (pAAV-CMV/INS) and the
secretion of human mature insulin levels into the media was
assessed. Irrespective of the promoter used, at 25 mM glucose
(culture medium concentration) engineered STC-1 cells were
able to secrete human insulin (Figs. 2A and B). Further, cells
transfected with pAAV-CMV/INS secreted more human
insulin than cells transfected with pAAV-GIP/INS (at 24 hours:
5.70 ± 0.30 μU/μg protein vs. 0.57 ± 0.03 μU/μg protein; P <
0.05) (Fig. 2B).
To determine the glucose dependence of mature human
insulin secretion in engineered enteroendocrine cells, STC-1
cells transfected with pAAV-GIP/INS or pAAV-CMV/INS
were incubated for 3 hours in Krebs-Ringer buffer containing
either no glucose or 50 mM glucose. STC-1 cells transfected
with pAAV-GIP/INS showed no significant differences in
secreted insulin in the presence or absence of glucose (Fig. 3A).
Cells transfected with pAAV-CMV/INS and incubated with
50 mM glucose showed a 3-fold increase (p< 0.02) in secreted
insulin into the medium versus cells incubated without glucose
(Fig. 3B). Neither detached cells nor morphological changes
were observed upon incubation in glucose-free buffer at the
different time points.
C
pAAV-CMV/INS
Figure 1. Mature human insulin expression in K-cells and L-cells: STC-1 cells were transfected with (A) pAAV-GIP/INS or (B and C)
pAAV-CMV/INS. Immunocytofluorescence with anti-human mature insulin and anti-mouse GIP or anti-mouse GLP-1 was performed.
Confocal microphotographs show co-localization of human mature insulin along with endogenous mouse GIP in K-cells (A and B) or with
endogenous mouse GLP-1 in L-cells (C). In all cases the granular distribution is characteristic of secretory vesicles.
304
ENCINA ET AL. Biol Res 44, 2011, 301-305
DISCUSSION
Figure 2. Human mature insulin secretion by gastrointestinal
enteroendocrine cells: STC-1 cells were transfected with 2 µg of
either pAAV-GIP/INS (open bars) or pAAV-CMV/INS (black bars)
plasmids and incubated in DMEM. Following 48 hours, cells were
washed twice in PBS and incubated in fresh DMEM containing 25
mM glucose. Conditioned media were taken at 3 hours (A) and
24 hours (B) and insulin was detected by ELISA by a monoclonal
antibody specific for mature human insulin. Under the same
experimental conditions, pAAV-CMV/INS transfected cells secreted
5 to 10 times more insulin than cells transfected with pAAV-GIP/
INS. (n = 4).
0
50
Figure 3. Glucose-dependent mature human insulin secretion
by gastrointestinal enteroendocrine cells: STC-1 cells were
transfected with 2 µg of either pAAV-GIP/INS (A) or pAAV-CMV/
INS (B) plasmids and incubated in DMEM. After 48 hours, cells
were washed twice in PBS and incubated for 3 hours in KrebsRinger buffer without glucose or buffer supplemented with 50 mM
glucose. Samples were taken from the supernatant and human
insulin was detected by specific human insulin ELISA. pAAV-CMV/
INS transfected cells incubated with glucose showed a 3-fold
increase in secreted insulin versus cells incubated without glucose.
pAAV-GIP/INS transfected cells incubated with glucose showed
only a 1.7-fold increase in secreted insulin versus cells incubated
without glucose. (n = 3).
Enteroendocrine cells in the small intestine, especially in the
duodenum and jejunum, appear as attractive targets for an
insulin gene transfer strategy to treat patients with type 1
diabetes mellitus. K-cells and L-cells are innately specialized
to respond to nutrients in the lumen, especially glucose,
secreting GIP and GLP-1 into the blood, potentiating the
glucose-induced insulin response. In normal individuals, the
kinetics and plasma concentrations attained for GIP, GLP-1
and insulin following a meal are remarkably similar (Orskov et
al., 1996, Fujita et al., 2004) and so are those of GIP and GLP-1
in patients with type 1 diabetes mellitus (Vilsbøll et al., 2003).
Furthermore, K-cells and L-cells synthesize the PC1/3 and
PC2 peptidases that allow proinsulin processing into mature
insulin. Finally, K-cells and L-cells are not destroyed by the
immune system of patients with type 1 diabetes mellitus
(Vilsbøll et al., 2003).
Previously it has been shown that STC-1 derived K-cells
genetically modified with the insulin gene under the control
of the GIP promoter secrete insulin in a glucose-dependent
manner (Palizban et al., 2007, Han et al., 2007, Li et al., 2008,
Zhang et al., 2008). Unfortunately, when transplanted into
the peritoneal cavity, diabetic mice developed hypoglycemia
(Han et al., 2007, Unniappan et al., 2009). Hypoglycemic
states can be potentially fatal and are therefore an
unacceptable risk for diabetic patients. This result is most
likely explained by an uncontrolled proliferation of these
tumor transplanted cells.
Thus far, despite the similarities of pancreatic β-cells and
K-cells and L-cells, the latter have been ignored as a possible
target for transgenic insulin expression and secretion. Since
an uncontrolled proliferation of tumor cells may compromise
the safety of an ex vivo insulin gene transfer strategy to treat
a diabetic patient, an in vivo approach to incorporate the
insulin gene to normal endogenous intestinal K-cells and
L-cells would present mayor advantages. Viral-derived
vectors arise as potentially effective transduction methods for
insulin gene therapy in the small intestine (Fujita et al., 2004).
Here we show that simultaneous transfection of K-cells and
L-cells with the human preproinsulin gene driven by CMV
promoter results in (i) the synthesis of human mature insulin
in both type of cells, (ii) the storage of human mature insulin
in GIP-containing vesicles (K-cells) or GLP-1-containing
vesicles (L-cells), (iii) the secretion of human mature insulin
in a glucose-dependent manner. While the constitutive CMV
promoter drives insulin gene expression in both K-cells and
L-cells, the GIP promoter excludes L-cells. Moreover, the CMV
promoter induces a higher gene expression than the 1.2 kb
GIP promoter. Overall, we have demonstrated that a strong
constitutive promoter allows increased insulin synthesis,
which is stored in vesicles and secreted after stimulation with
glucose in a broader number of target cells, namely L-cells,
in addition to K-cells. It is noted that the promoter itself is
not responsible for the glucose-regulated hormone secretion,
but rather is the chain of cellular events that are normal in
enteroendocrine cells.
This proof-of-principle study supports the idea that
preproinsulin gene transduction of either L-or K-cells may
constitute an adjunct therapy to help manage postprandial
hyperglycemia in patients with type 1 diabetes mellitus.
ENCINA ET AL. Biol Res 44, 2011, 301-305
ACKNOWLEDGEMENTS
This study was supported the Millennium Scientific Initiative
(ICM P05-001F).
REFERENCES
BAGGIO LL, DRUCKER DJ (2007) Biology of incretins: GLP-1 and GIP.
Gastroenterology 132:2131-2157.
BARTLETT RJ, SECORE SL, DENIS M, FERNÁNDEZ L, TZAKIS A,
ALEJANDRO R, RICORDI C (1997) Toward the biologic release of
human insulin from skeletal muscle. Transplant Proc 29:2199-2200.
BOCHAN MR, SHAH R, SIDNER RA, JINDAL RM (1999) Reversal of
diabetes in the rat by injection of hematopoietic stem cells infected with
recombinant adeno-associated virus containing the preproinsulin II
gene. Transplant Proc 31:690-691.
BRUBAKER PL, IZZO A, ROCCA AS (2003) Synthesis and secretion of
intestinal proglucagon-derived peptides by the STC-1 enteroendocrine
cell line. Canadian J of Diabetes 27:141-148.
CHEUNG AT, DAYANANDAN B, LEWIS JT, KORBUTT GS, RAJOTTE
RV, BRYER-ASH M, BOYLAN MO, WOLFE MM, KIEFFER TJ (2000)
Glucose-dependent insulin release from genetically engineered K cells.
Science 290:1959-1962.
CHO YM, KIEFFER TJ (2010) K-cells and glucose-dependent insulinotropic
polypeptide in health and disease. Vitam Horm. 84:111-150.
DUPRÉ J, ROSS SA, WATSON D, BROWN JC (1973) Stimulation of insulin
secretion by gastric inhibitory polypeptide in man. J Clin Endocrinol
Metab 37:826-828.
FALQUI L, MARTINENGHI S, SEVERINI GM, CORBELLA P, TAGLIETTI
MV, ARCELLONI C, SARUGERI E, MONTI LD, PARONI R, DOZIO
N, POZZA G, BORDIGNON C (1999) Reversal of diabetes in mice by
implantation of human fibroblasts genetically engineered to release
human mature insulin. Hum Gene Ther 10:1753-1762.
FUJITA Y, CHEUNG AT, KIEFFER TJ (2004) Harnessing the gut to treat
diabetes. Pediatric Diabetes 5 Suppl 2:57-69.
GOLDFINE ID, GERMAN MS, TSENG HC, WANG J, BOLAFFI JL, CHEN
JW, OLSON DC, ROTHMAN SS (1997) The endocrine secretion
of human insulin and growth hormone by exocrine glands of the
gastrointestinal tract. Nat Biotechnol 15:1378-1382.
HAN J, LEE HH, KWON H, SHIN S, YOON JW, JUN HS (2007) Engineered
enteroendocrine cells secrete insulin in response to glucose and reverse
hyperglycemia in diabetic mice. Mol Ther 15:1195-1202.
KOLODKA TM, FINEGOLD M, MOSS L, WOO SL (1995) Gene therapy for
diabetes mellitus in rats by hepatic expression of insulin. Proc Natl Acad
Sci USA 92:3293-3297.
305
LI N, YAN-CHENG X, ZHE D, HUI-QIN D (2008) Gene therapy for type 1
diabetes mellitus in rats by gastrointestinal administration of chitosan
nanoparticles containing human insulin gene. World J Gastroenterol
14:4209-4215.
LIPES MA, COOPER EM, SKELLY R, RHODES CJ, BOSCHETTI E, WEIR
GC, DAVALLI AM (1996) Insulin-secreting non-islet cells are resistant to
autoimmune destruction. Proc Natl Acad Sci USA 93:8595-600.
MCINTYRE N, HOLDSWORTH CD, TURNER DS (1964) New interpretation
of oral glucose tolerance. Lancet II:20-21.
ORSKOV C, WETTERGREN A, HOLST JJ (1996) Secretion of the incretin
hormones glucagon-like peptide-1 and gastric inhibitory polypeptide
correlates with insulin secretion in normal man throughout the day.
Scand J Gastroenterol 31:665-670.
MORTENSEN K, CHRISTENSEN LL, HOLST JJ, ORSKOV C (2003) GLP1 and GIP are colocalized in a subset of endocrine cells in the small
intestine. Reg. Pept. 114:189-196.
OLSON DE, PAVEGLIO SA, HUEY PU, PORTER MH, THULE PM (2003)
Glucose-responsive hepatic insulin gene therapy of spontaneously
diabetic BB/Wor rats. Hum Gene Ther 14:1401-1413.
PALIZBAN AA, SALEHI R, NORI N, GALEHDARI H (2007) In vivo
transfection of rat small intestine K-cell with pGIP/Ins plasmid by
DOTAP liposomes. J Drug Target 15:351-357.
PERLEY M, KIPNIS DM (1970) Plasma insulin responses to oral and
intravenous glucose: studies in normal and diabetic subjects. J Clin
Invest. 46:1954-1962.
RINDI G, GRANT SG, YIANGOU Y, GHATEI MA, BLOOM SR, BAUTCH
VL, SOLCIA E, POLAK JM (1990) Development of neuroendocrine
tumors in the gastrointestinal tract of transgenic mice. Heterogeneity of
hormone expression. Am J Pathol 136:1349-1363.
SPOONER B S, WALTHER BT, RUTTER WJ (1970) The development of the
dorsal and ventral mammalian pancreas in vivo and in vitro. J Cell Biol
47:235-246.
UNNIAPPAN S, WIDEMAN RD, DONALD C, GUNN V, WALL JL, ZHANG
Q, WEBBER TD, CHEUNG AT, KIEFFER TJ (2009) Treatment of diabetes
by transplantation of drug-inducible insulin-producing gut cells. J Mol
Med 87:703-712.
VILSBØLL T, KRARUP T, SONNE J, MADSBAD S, VØLUND A, JUUL AG,
HOLST JJ (2003) Incretin secretion in relation to meal size and body
weight in healthy subjects and people with type 1 and type 2 diabetes
mellitus. J Clin Endocrinol Metab 88:2706-2713.
ZHANG Y, YAO L, SHEN K, XU M, ZHOU P, YANG W, LIU X, QIN X (2008)
Genetically engineered K cells provide suffi cient insulin to correct
hyperglycemia in a nude murine model. Acta Biochim Biophys Sin
(Shanghai) 40:149-157.

Similar documents