Vol. Especial Núm. 3

Transcription

Rev. Mex. Cienc. Agríc. Pub. Esp. Núm. 3 p. 399-602 1 de noviembre - 31 de diciembre, 2011
REVISTA MEXICANA DE CIENCIAS AGRÍCOLAS
ISSN: 2007-0934
editora en jefa
Dora Ma. Sangerman-Jarquín
editor asociado
Agustín Navarro Bravo
editores correctores
comité editorial internacional
Agustín Giménez Furest. INIA-Uruguay
Alan Anderson. Universite Laval-Quebec. Canadá
Álvaro Rincón-Castillo. Corporación Colombiana de Investigación. Colombia
Arístides de León. Instituto Nacional de Tecnología Agropecuaria. El Salvador C. A.
Bernardo Mora Brenes. Instituto Nacional de Tecnología Agropecuaria. Costa Rica
Carlos J. Bécquer. Ministerio de Agricultura. Cuba
Carmen de Blas Beorlegui. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria. España
César Azurdia. Universidad de San Carlos. Guatemala
Charles Francis. University of Nebraska. EE. UU.
Daniel Debouk. Centro Internacional de Agricultura Tropical. Puerto Rico
David E. Williams. Biodiversity International. Italia
Elizabeth L. Villagra. Universidad Nacional de Tucumán. Argentina
Elvira González de Mejía. University of Illinois. EE. UU.
Hugh Pritchard. The Royal Botanic Gardens, Kew & Wakehurst Place. Reino Unido
Ignacio de los Ríos Carmenado. Universidad Politécnica de Madrid. España
James Beaver. Universidad de Puerto Rico. Puerto Rico
James D. Kelly. University State of Michigan. EE. UU.
Javier Romero Cano. Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria. España
José Sangerman-Jarquín. University of Yale. EE. UU.
Ma. Asunción Martin Lau. Real Sociedad Geográfica-Madrid. España
María Margarita Hernández Espinosa. Instituto Nacional de Ciencias Agrícolas. Cuba
Marina Basualdo. UNCPBA. Argentina
Moisés Blanco Navarro. Universidad Nacional Agraria. Nicaragua
Raymond Jongschaap. Wageningen University & Research. Holanda
Silvia I. Rondon. University of Oregon. EE. UU.
Steve Beebe. Centro Internacional de Agricultura Tropical. Puerto Rico
Valeria Gianelli. Instituto Nacional de Tecnología Agropecuaria. Argentina
Vic Kalnins. University of Toronto. Canadá
Revista Mexicana de Ciencias Agrícolas. Pub. Esp. Núm. 3, 1 de noviembre - 31 de diciembre 2011. Es una publicación bimestral editada por el Instituto Nacional
de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Progreso No. 5. Barrio de Santa Catarina, Delegación Coyoacán, D. F., México. C. P. 04010.
www.inifap.gob.mx. Distribuida por el Campo Experimental Valle de México. Carretera Los Reyes-Texcoco, km 13.5. Coatlinchán, Texcoco, Estado de México.
C. P. 56250. Teléfono y fax: 01 595 9212681. Editora responsable: Dora Ma. Sangerman-Jarquín. Reserva de derecho al uso exclusivo: 04-2010-012512440200-102.
ISSN: 2007-0934. Licitud de título. En trámite. Licitud de contenido. En trámite. Ambos otorgados por la Comisión Calificadora de Publicaciones y Revistas Ilustradas
de la Secretaría de Gobernación. Domicilio de impresión: Imagen Digital. Prolongación 2 de marzo, Núm. 22. Texcoco, Estado de México. C. P. 56190. (juancimagen@
hotmail.com). La presente publicación se terminó de imprimir en diciembre de 2011, su tiraje constó de 1 000 ejemplares.
ISSN: 2007-0934
editora en jefa
editor asociado
comité editorial nacional
Alfonso Larqué Saavedra. Centro de Investigación Científica de Yucatán
Alejandra Covarrubias Robles. Instituto de Biotecnología de la UNAM
Andrés González Huerta. Universidad Autónoma del Estado de México
Antonieta Barrón López. Facultad de Economía de la UNAM
Antonio Turrent Fernández. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias
Bram Govaerts. Centro Internacional de Mejoramiento de Maíz y Trigo
Daniel Claudio Martínez Carrera. Colegio de Postgraduados en Ciencias Agrícolas-Campus Puebla
Delfina de Jesús Pérez López. Universidad Autónoma del Estado de México
Demetrio Fernández Reynoso. Colegio de Postgraduados en Ciencias Agrícolas
Ernesto Moreno Martínez. Unidad de Granos y Semillas de la UNAM
Esperanza Martínez Romero. Centro Nacional de Fijación de Nitrógeno de la UNAM
Eugenio Guzmán Soria. Instituto Tecnológico de Celaya
Froylán Rincón Sánchez. Universidad Autónoma Agraria Antonio Narro
Guadalupe Xoconostle Cázares. Centro de Investigación y Estudios Avanzados del IPN
Higinio López Sánchez. Colegio de Postgraduados en Ciencias Agrícolas-Campus Puebla
Ignacio Islas Flores. Centro de Investigación Científica de Yucatán
Jesús Axayacatl Cuevas Sánchez. Universidad Autónoma Chapingo
Jesús Salvador Ruíz Carvajal. Universidad de Baja California-Campus Ensenada
José F. Cervantes Mayagoitia. Universidad Autónoma Metropolitana-Xochimilco
June Simpson Williamson. Centro de Investigación y Estudios Avanzados del IPN
Leobardo Jiménez Sánchez. Colegio de Postgraduados en Ciencias Agrícolas
Octavio Paredes López. Centro de Investigación y Estudios Avanzados del IPN
Rita Schwentesius de Rindermann. Centro de Investigaciones Económicas, Sociales y
Tecnológicas de la Agroindustria y Agricultura Mundial de la UACH
Silvia D. Peña Betancourt. Universidad Autónoma Metropolitana-Xochimilco
La Revista Mexicana de Ciencias Agrícolas es una publicación del Instituto
Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Tiene
como objetivo difundir los resultados originales derivados de las investigaciones
realizadas por el propio Instituto y por otros centros de investigación y enseñanza
agrícola de la república mexicana y otros países. Se distribuye mediante canje, en
el ámbito nacional e internacional. Los artículos de la revista se pueden reproducir
total o parcialmente, siempre que se otorguen los créditos correspondientes. Los
experimentos realizados puede obligar a los autores(as) a referirse a nombres
comerciales de algunos productos químicos. Este hecho no implica recomendación
de los productos citados; tampoco significa, en modo alguno, respaldo publicitario.
La Revista Mexicana de Ciencias Agrícolas está incluida en el Índice de
Revistas Mexicanas de Investigación Científica y Tecnológica del Consejo
Nacional de Ciencia y Tecnología (CONACYT).
Indizada en: Red de Revistas Científicas de América Latina y el Caribe
(REDALyC), Biblioteca electrónica SciELO-México, The Essential Electronic
Agricultural Library (TEEAL-EE. UU.), Scopus, Dialnet, Agrindex, Bibliography
of Agriculture, Agrinter y Periódica.
Reproducción de resúmenes en: Field Crop Abstracts, Herbage Abstracts,
Horticultural Abstracts, Review of Plant Pathology, Review of Agricultural
Entomology, Soils & Fertilizers, Biological Abstracts, Chemical Abstracts,
Weed Abstracts, Agricultural Biology, Abstracts in Tropical Agriculture, Review
of Applied Entomology, Referativnyi Zhurnal, Clase, Latindex, Hela, Viniti y
CAB International.
Portada: una rosa pintada de azul, (acuarela 21*25 cm, cruzgaali).
ISSN: 2007-0934
editora en jefa
editor asociado
árbitros de este número
Alma Rosa Solís Pérez. Colegio de Postgraduados en Ciencias Agrícolas
Ana Tztzqui Chávez Bárcenas. Universidad Michoacana de San Nicolás de Hidalgo
Ángel Lagarda Murrieta. Universidad Autónoma Agraria Antonio Narro
Antonio Vázquez Alarcón. Universidad Autónoma Chapingo
Edgardo Federico Hernández Valdez. Universidad Michoacana de San Nicolás de Hidalgo
Fernando Carlos Gómez Merino. Colegio de Postgraduados en Ciencias Agrícolas
Iran Alia Tejacal. Universidad Autónoma del Estado de Morelos
J. Cruz García Albarado. Colegio de Postgraduados en Ciencias Agrícolas
José Antonio Rangel Lucio. Instituto Tecnológico de Roque
Juan Diego García Paredes. Universidad Autónoma de Nayarit
Juan de la Fuente Hernández. Universidad Autónoma Chapingo
Libia Iris Trejo-Téllez. Colegio de Postgraduados en Ciencias Agrícolas
Manuel Villareal Romero. Universidad Autónoma de Sinaloa
María Andrade Rodríguez. Universidad Autónoma del Estado de Morelos
Pedro Antonio López. Colegio de Postgraduados en Ciencias Agrícolas
Rubén Bugarín Montoya. Universidad Autónoma de Nayarit
CONTENIDO
ARTÍCULOS
♦ CONTENTS
♦ ARTICLES
Página
Macronutrimentos en petunias crecidas con distintas proporciones de composta en sustrato.
♦ Macronutrients in petunias grow with different compost rations into the substrate.
Fernando Carlos Gómez-Merino, Libia Iris Trejo-Téllez, María de los Ángeles Velásquez-Hernández, J. Cruz
García-Albarado y Alejandrina Ruiz-Bello.
399-413
Micronutrimentos en petunias crecidas con distintas proporciones de composta en sustrato.
♦ Micronutrients in petunias grown with different compost rations into the substrate.
Fernando Carlos Gómez-Merino, Libia Iris Trejo-Téllez, Víctor Hugo Volke-Haller, J. Cruz García-Albarado,
María de los Ángeles Velásquez-Hernández y Alejandrina Ruiz-Bello.
415-430
Identificación de especies de Pythium aisladas de plantas ornamentales. ♦ Identification of Pythium
species isolated from ornamental plants.
Marlene Díaz-Celaya, Gerardo Rodríguez-Alvarado, Hilda Victoria Silva-Rojas, Martha Elena Pedraza-Santos,
Rafael Salgado-Garciglia y Sylvia Patricia Fernández-Pavía.
431-443
Efecto de rayos gamma 60Co en nardo (Polianthes tuberosa L.). ♦ Effect of 60Co gamma rays in
tuberose (Polianthes tuberosa L.).
Jorge Adán Estrada-Basaldua, Martha Elena Pedraza-Santos, Eulogio de la Cruz-Torres, Alejandro MartínezPalacios, Cuauhtémoc Sáenz-Romero y José Luciano Morales-García.
445-458
Percepción de jardines con especies silvestres y cultivadas. ♦ Perception of gardens with wild and
cultivated species.
Sebastiana Guadalupe Ramírez-Hernández, J. Cruz García-Albarado, Arturo Pérez-Vázquez, Andrés Bruno-Rivera,
Mónica de la Cruz Vargas-Mendoza y Libia Iris Trejo-Tellez.
459-471
Caracteres morfológicos y bioquímicos de Rosa x hybrida contra Tetranychus urticae Koch en
invernadero. ♦ Morphological and biochemical characters of Rosa x hybrida against Tetranychus
urticae Koch in greenhouse.
Ricardo Javier Flores Canales, Rosalina Mendoza Villareal, Jerónimo Landeros Flores, Ernesto Cerna Chávez,
Agustín Robles Bermúdez y Néstor Isiordia Aquino.
473-482
Especies ornamentales asociadas a cochinilla rosada del hibisco (Hemiptera: Pseudococcidae) en
Nayarit. ♦ Ornamental species associated with pink hibiscus mealybug (Hemiptera: Pseudococcidae)
in Nayarit.
Néstor Isiordia-Aquino, Agustín Robles-Bermúdez, Héctor González-Hernández, Oswaldo García-Martínez,
Gregorio Luna-Esquivel, José Roberto Gómez-Aguilar, Arturo Alvarez-Bravo y Candelario Santillán-Ortega.
Producción de plántulas de alcatraz amarillo (Zantedeschia elliottiana Engl.) en diferentes sustratos.
♦ Yellow calla lily seedling production (Zantedeschia elliottiana Engl.) in different substrates.
Ma. de Jesús Juárez-Hernández, Juan Martínez-Solís, Arturo Curiel-Rodríguez y Alejandro Gracia-Santos.
483-493
495-507
Adaptación de Laelia autumnalis Lindl. a un bosque de pino-encino. ♦ Laelia autumnalis Lindl.
adaptation into a pine-oak forest.
Lia Stefany Luyando-Moreno, Martha Elena Pedraza-Santos, José López-Medina, José Luciano Morales-García,
Guillermo Martín Carrillo-Castañeda y Roberto Lindig-Cisneros.
509-524
CONTENIDO
♦ CONTENTS
Página
Uso y manejo de plantas ornamentales y medicinales en espacios urbanos, suburbanos y rurales.
♦ Use and management of ornamental and medicinal plants in urban, suburban and rural areas.
Rafaela Mendoza-García, Arturo Pérez-Vázquez, J. Cruz García-Albarado, Eliseo García-Pérez y José López-Collado.
525-538
Propagación in vitro de Laelia halbingeriana. ♦ In vitro propagation of Laelia halbingeriana.
Yurixhi Atenea Raya-Montaño, Guillermo Carrillo-Castañeda, Martha Elena Pedraza-Santos, Tarsicio CoronaTorres, José Alfredo Carrillo-Salazar y Gabriel Alcantar-González.
539-553
Trampas tratadas con Pimpinella anisum, como atrayente de trips (Thysanoptera: Thripidae) en rosal.
♦ Traps treated with Pimpinella anisum, as attractant of thrips (Thysanoptera: Thripidae) in rose.
Agustín Robles-Bermúdez, Candelario Santillán-Ortega, J. Concepción Rodríguez-Maciel, José Roberto GómezAguilar, Néstor Isiordia-Aquino y Rubén Pérez-González.
Germinación in vitro de cactáceas, utilizando zeolita como sustrato alternativo.
germination by using zeolite as alternative substrate.
555-563
♦ Cacti in vitro
Lidia Rosaura Salas-Cruz, Rahim Foroughbackch-Pournabav, María de Lourdes Díaz-Jiménez, María Luisa
Cárdenas-Ávila y Alfredo Flores-Valdes.
565-575
Efecto de la aspersión de ácido giberélico en el crecimiento de cinco cultivares de nochebuena.
♦ Effect of gibberellic acid sprays on growth of five poinsettia cultivars.
Iran Alia-Tejacal, Luis Alonso Valdez-Aguilar, Elio Campos-Bravo, Manuel de Jesús Sainz-Aispuro, Gloria Alicia
Pérez-Arias, María Teresa Colinas-León, María Andrade-Rodríguez, Víctor López-Martínez y Andrés Alvear-García.
Época de corte y manejo poscosecha de ocho cultivares de rosa de corte.
postharvest management of eight cut rose cultivars.
577-589
♦ Time cutting and
Gabriela Mosqueda-Lazcares, Ma. de Lourdes Arévalo-Galarza, Guadalupe Valdovinos-Ponce, Juan Enrique
Rodríguez-Pérez y María Teresa Colinas-León.
591-602
Revista Mexicana de Ciencias Agrícolas Pub. E s p . N ú m . 3 1 de noviembre - 31 de diciembre, 2011 p. 399-413
MACRONUTRIMENTOS EN PETUNIAS CRECIDAS CON DISTINTAS
PROPORCIONES DE COMPOSTA EN SUSTRATO*
MACRONUTRIENTS IN PETUNIAS GROW WITH DIFFERENT
COMPOST RATIONS INTO THE SUBSTRATE
Fernando Carlos Gómez-Merino1§, Libia Iris Trejo-Téllez2, María de los Ángeles Velásquez-Hernández2, J. Cruz García-Albarado1
y Alejandrina Ruiz-Bello2
Campus Córdoba. Colegio de Postgraduados. Carretera Córdoba-Veracruz, km 348. Congr. Manuel León, Amatlán de los Reyes, Veracruz, México. C. P. 94946. (jcruz@
colpos.mx). 2Campus Montecillo. Colegio de Postgraduados. Carretera México-Texcoco, km 36.5. Montecillo, Texcoco, Estado de México, México. C. P. 56230. (tlibia@
colpos.mx), ([email protected]), ([email protected]). §Autor para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
En esta investigación se evaluó el efecto de tres sustratos que
consistieron en: suelo agrícola salino (T1), suelo agrícola
salino con 30% (v/v) de composta (estiércol de bovino y
residuos de cosecha) (T2), y suelo agrícola salino con 80%
(v/v) de la misma composta (T3); sobre la acumulación
de macronutrimentos en petunia (Petunia x hybrida
Hort. Vilm.-Andr.) bajo condiciones de invernadero.
Las acumulaciones nutrimentales de N, P, K, Ca y Mg
fueron determinadas en raíces, tallos y hojas de plantas
de petunia, utilizando los pesos de materia seca y las
concentraciones nutrimentales obtenidas por órgano,
ocho meses después del trasplante. Se utilizó un arreglo de
tratamientos completamente al azar con diez repeticiones
por cada uno. La adición de composta en una proporción
de 80% incrementó significativamente la concentración de
N en hoja, en tallo y en raíces. Asimismo, la inclusión de
composta incrementó significativamente la acumulación
nutrimental de N, P, K, Ca y Mg en los diferentes tejidos
analizados y en consecuencia en la planta completa. El
orden de acumulación nutrimental en planta completa
fue distinto entre T1 (K> Ca> N> Mg> P), T2 y T3 (K>
N> Ca> Mg> P). Estos resultados sirven para sustentar el
uso de materiales orgánicos provenientes de la actividad
In this paper the effect on three substrates consisted of:
saline agricultural soil (T1), saline agricultural soil with
30% (v/v) compost (bovine manure and crop residues)
(T2) and saline agricultural soil with 80% (v/v) of the
same compost (T3) was evaluated; on macronutrient
accumulation in petunia (Petunia x hybrida Hort.
Vilm.-Andr.) under greenhouse conditions. Nutrient
accumulations of N, P, K, Ca and Mg were determined
in roots, stems and leaves of petunia using the weights
of dry matter and nutrient concentrations obtained per
organ, eight months after transplantation. A completely
randomized treatments array was used with ten repetitions
each. The 80% compost addition significantly increased
N concentration in the leaves, stems and roots. Also, the
inclusion of compost significantly increased nutrient
accumulation of N, P, K, Ca and Mg in the different
analyzed tissues and, therefore in the entire plant. The
order of nutrient accumulation in the whole plant was
different among T1 (K> Ca> N> Mg> P), T2 and T3 (K>
N> Ca> Mg> P). These results support the use of organic
materials from agricultural activities, for the production
of ornamental plants such as petunia, especially when
they are processed by composting.
* Recibido: marzo de 2011
Aceptado: octubre de 2011
400 Rev. Mex. Cienc. Agríc. Pub. Esp. Núm. 3 1 de noviembre - 31 de diciembre, 2011
Fernando Carlos Gómez-Merino et al.
agropecuaria, para la producción de plantas ornamentales
como la petunia, en especial cuando son procesados por
composteo.
Key words: Petunia x hybrida, nutrient accumulation,
ornamental horticulture, organic matter.
Palabras clave: Petunia x hybrida, acumulación
nutrimental, horticultura ornamental, materia orgánica.
INTRODUCTION
INTRODUCCIÓN
La petunia (Petunia x hybrida Hort. Vilm.-Andr.) es una
especie ornamental ampliamente cultivada en zonas con
clima cálido y templado que responde bien a la fertilización
mineral y orgánica (Chamani et al., 2008). Para su
producción en invernadero, se emplea la turba (peat moss)
como principal componente de los sustratos; no obstante, su
elevado costo (Hanson, 2003) y la degradación ambiental
que ocasiona su extracción.
Como estrategia para lograr sustentabilidad ambiental
en la producción de ornamentales, es recomendable que
los materiales orgánicos que resultan de los procesos de
producción de actividades agropecuarias, sean reutilizados
a fin de reducir sus impactos negativos en el entorno.
En muchos países se han puesto en marcha programas
de reciclaje de nutrimentos y mejoramiento de las
características del suelo, tanto con propósitos ambientales
como productivos. La búsqueda de sustratos alternativos a
base de materiales orgánicos que sean de fácil acceso y que
resulten baratos, es uno de los principales objetivos de los
productores hortícolas (Dede et al., 2006). Normalmente,
dichos materiales son procesados para formar composta
antes de ser usados como sustratos y tienen efectos benéficos
en las plantas, si se usan en proporciones adecuadas (GarcíaGómez et al., 2002).
Las propiedades físicas y químicas de los sustratos afectan
la aireación, así como el contenido de agua y nutrimentos
disponibles para la planta. Varias fuentes y formas de
residuos de cosechas y estiércol composteados, pueden ser
usados en forma eficiente como sustratos y fertilizantes de
bajo costo a la vez (García-Gómez et al., 2002; Marfa et
al., 2002). Por ejemplo, Dede et al. (2006) probaron el uso
de turba, cáscara de nuez y rastrojo de maíz como medios
de soporte, y la adición de composta de residuos orgánicos
municipales (residuos sólidos de comida) y gallinaza como
materiales fertilizantes en el crecimiento y la nutrición de
Impatiens wallerana; encontraron que la mayor floración
The petunia (Petunia x hybrida Hort. Vilm.-Andr.) is
a widely cultivated ornamental species in areas with
warm and mild climate, which have good response to
mineral and organic fertilization (Chamani et al., 2008).
For greenhouse production, peat moss is used as a major
component of substrates, despite its high costs (Hanson,
2003) and environmental degradation caused by its
extraction.
As a strategy to achieve environmental sustainability
in the ornamental production, it is recommended that,
organic materials resulting from the production processes
of agricultural activities are reused in order to reduce their
negative impacts on the environment. Many countries
have implemented nutrient-recycling programs and
have improves soil characteristics programs with both,
environmental and productive purposes. The search for
alternative substrates based on organic materials that are
easily accessible and cheap, is one of the main objectives of
horticultural producers (Dede et al., 2006). Usually, these
materials are processed to form compost before being used
as substrates and have beneficial effects on the plants if
used in proper proportions (García-Gómez et al., 2002).
The physical and chemical properties of substrates affect
aeration, water and nutrients content available for the plants.
Several sources and forms of composted crop residues and
manure can be efficiently used as substrates and low-cost
fertilizer at a time (García-Gómez et al., 2002; Marfa et al.,
2002). For example, Dede et al. (2006) tested the use of peat,
walnut shells and maize stover as a support mean, and the
addition of compost from municipal organic waste (food
solid waste) and chicken manure as fertilizing materials on
growth and nutrition of Impatiens wallerana; it was found
that, the greatest flowering occurred when combined peat,
maize stover and chicken manure, while the better nutrition
for the plants was obtained when the chicken manure was
added to the substrate.
Theunissen et al. (2010) argued that, organic plant
production is controlled by macro and micronutrients
and other growth-promoting substances present in the
Macronutrimentos en petunias crecidas con distintas proporciones de composta en sustrato
se presentó cuando se combinaron turba, rastrojo de maíz y
gallinaza; en tanto que la mejor nutrición de las plantas se
obtuvo cuando se adicionó gallinaza al sustrato.
Theunissen et al. (2010) sostienen que la producción
orgánica de plantas, es controlada por los macro y los
micronutrimentos y por otras sustancias promotoras del
crecimiento presentes en el medio de cultivo. Con la
creciente tendencia mundial hacia la producción orgánica,
los materiales orgánicos procesados pueden usarse para
producir compostas que contienen nutrimentos y otros
compuestos que estimulan el crecimiento de las plantas
y que mejoran la calidad del suelo. En este sentido, es
importante determinar la proporción ideal de composta
en las mezclas de sustratos, que se preparen como medio
de cultivo para cada especie y variedad.
Diversos sustratos de naturaleza orgánica han sido
empleados con éxito en petunia y en la parte aérea de
árboles completos de pino (Pinus taeda L.) de 10 años de
edad, con diámetro de 15.2 y 20.3 cm medido a 30.5 cm
de la superficie del suelo, fueron pasados a través de una
astilladora, cuyas astillas resultantes fueron procesadas en
un molino de martillo oscilante, hasta obtener partículas de
0.48, 0.64 y 0.95 cm; éstas fueron valoradas como sustrato
alternativo en combinación con 20 ó 50% de turba (v/v),
en comparación al testigo representado por el sustrato
comercial Peat-lite (8:1:1, turba:vermiculita:perlita, v/v/v)
en el crecimiento y desarrollo de esta especie (Fain et al.,
2008). Los sustratos probados no afectaron el contenido
de clorofila y en todos los casos las plantas alcanzaron
estándares de mercado, que demuestra que este tipo de
sustratos orgánicos, puede ser una alternativa para la
producción de petunias y contribuyen a disminuir el uso
de turba al 100% en los sustratos.
Ayala-Sierra y Valdez-Aguilar (2008), evaluaron también en
petunia el uso de polvo de coco (acondicionado mediante pH
de 6.2, con adición de cal dolomítica y KNO3 como carga de
nutrimentos), como sustrato alternativo para la producción
de plantas de esta especie y observaron que los diferentes
sustratos no afectaron la calidad comercial de las plantas.
El uso de compostas a base de estiércol y residuos vegetales
de traspatio en combinación con suelos agrícolas salinos,
mejora significativamente variables de crecimiento, como
diámetro de tallo, producción de biomasa total de petunia
y variables relacionadas con el rendimiento, como son la
401
culture medium. With the growing global trend towards
organic production, organic processed materials can
be used to produce compost containing nutrients and
other compounds that stimulate the plant’s growth and
improve the soil’s quality. In this regard, it is important
to determine the ideal proportion of compost in substrate
mixtures prepared as a culture medium for each species
and variety.
Several substrates of organic nature have been successfully
used in petunia and in the aerial part of whole pine trees
(Pinus taeda L.) of 10 years old, with a diameter of 15.2
and 20.3 cm, measured at 30.5 cm from the ground;
they were passed through a chipper, and resulting chips
were processed in a swing hammer mill until obtaining
particles of 0.48, 0.64 and 0.95 cm; they were valued as
an alternative substrate in combination with 20 or 50%
peat (v/v) compared to the control represented by the
commercial substrate Peat-lite (8:1:1, peat: vermiculite:
perlite, v/v/v) on growth and development of this species
(Fain et al., 2008). The substrates did not affect the
chlorophyll content and in all cases the plants reached
market standards, demonstrating that this type of organic
substrates may be an alternative for the production of
petunias and also, to help to reducing the use of 100%
peat in the substrates.
Ayala-Sierra and Valdez-Aguilar (2008), also evaluated
the use of coconut powder in petunia (conditioned
by 6.2 pH, with addition of dolomitic lime and KNO3
as nutrient load), as an alternative substrate for the
production of plants on this species and, found that
different substrates did not affect the commercial quality
of the plants.
The use of composted manure and backyard plant
residues in combination with saline agricultural soils,
significantly improves growth variables, such as stem
diameter, total petunia biomass production and yieldrelated variables such as leaf production, buds and flowers
(García-Albarado et al., 2010), but it’s necessary to
evaluate the effect of these substrates on the nutritional
status of this species.
This paper evaluated the effect of substrates consisting of
different proportions of soil: compost, on macronutrients
concentration and accumulation (N, P, K, Ca and Mg) in
roots, stems and leaves of petunia.
MATERIALS AND METHODS
producción de hojas, brotes y flores (García-Albarado
et al., 2010); sin embargo, es necesario evaluar el efecto
de estos sustratos sobre el estatus nutrimental de esta
especie.
The research was conducted under greenhouse conditions
of metal structure and milky-white colored plastic (caliber
720), located at 19° 29’ north latitude, 98° 53’ west
longitude and 2 240 m, in Montecillo, Texcoco, Mexico
State.
En esta investigación se evaluó el efecto de sustratos
constituidos por distintas proporciones de suelo:composta,
sobre concentración y acumulación de macronutrimentos
(N, P, K, Ca y Mg) en raíces, tallos y hojas de petunia.
The seeds of petunia (Petunia x hybrida) were germinated
in trays with a mixture of peat with agrolite (70/30;
v/v). Once the plants reached 10 cm height, they were
transplanted to black polyethylene bags of 2 kg capacity
containing mixtures of substrates to assess: 1) control,
saline agricultural soil of the experimental site (T1); 2)
mixture of saline agricultural soil with 30% compost (T2);
and 3) saline agricultural soil with 80% compost mixture
(T3). The compost was prepared from cattle manure and
vegetable waste from backyard-crops, each treatment had
ten replicates. The experimental design had a completely
random distribution; experimental units were black
polyethylene bags of 2 kg capacity containing the mixture
of substrates to evaluate and one plant each. The physical
and chemical properties of soil mixtures and substrates
tested are presented in Tables 1 and 2.
MATERIALES Y MÉTODOS
La investigación se realizó bajo condiciones de invernadero
tipo cenital de estructura metálica y plástico blanco lechoso
(calibre 720), localizado a 19° 29’ latitud norte, 98° 53’
longitud oeste y altitud de 2 240 m, en Montecillo, Texcoco,
Estado de México.
Semillas de petunia (Petunia x hybrida) fueron germinadas
en charolas con una mezcla de turba con agrolita (70/30; v/v).
Una vez que las plantas alcanzaron 10 cm de altura, éstas
fueron trasplantadas en bolsas de polietileno negro de 2 kg de
capacidad conteniendo las mezclas de sustratos a evaluar: 1)
testigo, suelo agrícola salino del sitio experimental (T1); 2)
mezcla de suelo agrícola salino con 30% de composta (T2);
y 3) mezcla de suelo agrícola salino con 80% de composta
(T3). La composta fue preparada con estiércol de bovino y
residuos vegetales de cosechas de huertos de traspatio; cada
tratamiento tuvo diez repeticiones. El diseño experimental
tuvo una distribución completamente al azar, las unidades
experimentales fueron bolsas negras de polietileno de 2 kg
de capacidad conteniendo la mezcla de sustratos a evaluar y
una planta cada una. Las propiedades físicas y químicas de
las mezclas de sustratos y suelo evaluadas son presentadas
en los Cuadros 1 y 2.
Sampling was conducted eight months after the pot
experiment started. Harvested plants were divided by
organs: roots, stems and leaves. Once separated, the
organs were placed in paper bags and then dried in a
forced air oven at 72 °C for 48 h. Once dried, the biomass
weight was taken and samples were ground in a stainless
steel mill Wiley Model 4. The ground samples were
weighed to determine total dry biomass by component
and were processed in order to determine the nutrient
concentrations and subsequent estimation of nutrient
accumulation.
Cuadro 1. Propiedades físicas de tres sustratos utilizados en petunia (García-Albarado et al., 2010).
Table 1. Physical properties of three substrates used in petunia (García-Albarado et al., 2010).
ADD
AR
Suelo
11.24
1.67
Suelo + 30% composta
8.44
11.35
Tratamiento
AFD
(% del volumen)
CA
EPT
3.95
33.15
50
2.04
4.88
40.63
56
1.88
4.41
37.36
55
ADD= agua difícilmente disponible; AR= agua residual; AFD= agua fácilmente disponible; CA= capacidad de aireación, EPT= espacio poroso total.
403
Cuadro 2. Propiedades químicas de tres sustratos utilizados en petunia (García-Albarado et al., 2010).
Table 2. Chemical properties of three substrates used in petunia (García-Albarado et al., 2010).
Parámetro
Suelo
pH
8.91
8.61
8.45
MO
N (mg g-1)
0.46
1 100
2.59
700
7.21
200
P (mg g-1)
1.49
2.3
5.31
HCO3- (mg L-1)
328.84
391.07
508.21
Cls (mg L )
247.86
97.52
142.19
Nas (mg L-1)
184.69
71.76
95.68
Nai (cmolc kg-1)
2.6
0.64
0.1
Ki (cmolc kg-1)
7.69
6.56
8.71
Cai (cmolc kg-1)
2.72
2.08
1.98
Mgi (cmolc kg )
1.91
0.78
1.42
CIC (cmolc kg-1)
16.92
11.74
14.97
-1
-1
MO= materia orgánica; Cls= cloro soluble; Nas= sodio soluble; Nai= sodio intercambiable; Ki= potasio intercambiable; Cai= calcio intercambiable; Mgi= magnesio
intercambiable; CIC= capacidad de intercambio catiónico.
La toma de muestras se realizó a los ocho meses de haber
establecido el experimento en macetas. Las plantas
cosechadas fueron divididas por órganos: raíces, tallos y
hojas. Una vez separados, los órganos fueron depositados
en bolsas de papel y éstas secadas en estufa de aire forzado
a 72 °C por 48 h. Una vez secas, se tomó el peso de biomasa
y se molieron en molino de acero inoxidable marca
Wiley Modelo 4. Las muestras molidas fueron pesadas
para determinar la biomasa seca total por componente
y procesadas, para determinar sus concentraciones
nutrimentales y posterior estimación de acumulaciones
nutrimentales.
Se determinó la concentración de nitrógeno (N)
empleando el método Semimicro-Kjeldahl (Bremner,
1965); las concentraciones de fósforo (P), potasio (K),
calcio (Ca) y magnesio (Mg), fueron determinadas
mediante digestión húmeda del material seco con
una mezcla de ácidos perclórico y nítrico (Alcántar y
Sandoval, 1999). La lectura de los extractos obtenidos
después de la digestión y filtrado, se determinaron
por espectroscopía de emisión atómica e inducción
por plasma acoplado ICP-AES VARIAN™ modelo
Liberty II.
Nitrogen concentration (N) was determined using semimicroKjeldahl method (Bremner, 1965); the concentrations of
phosphorus (P), potassium (K), calcium (Ca) and magnesium
(Mg) were determined by wet digestion of dry material with a
mixture of perchloric and nitric acids (Alcántar and Sandoval,
1999). The extracts obtained after digestion and filtering were
determined by inductively coupled plasma atomic emission
spectroscopy ICP-AES VARIAN™ model Liberty II.
The information analysis was performed using the statistical
analysis system (SAS, 2003), for each of the treatments and
repetitions of the experiment. Means were compared using
the Tukey test at 5% probability of error.
RESULTS
Concentration and accumulation of macronutrients
in roots
Macronutrient concentrations in the roots showed statistical
differences between treatments (p≤ 0.05), except for Mg
(Table 3). P concentration was higher when the plants
El análisis de la información se realizó a través del sistema
de análisis estadístico (SAS, 2003), para cada uno de los
tratamientos y repeticiones del experimento. Las medias
obtenidas se compararon mediante la Prueba de Tukey al
5% de probabilidad de error.
were established on agricultural soil (T1). On the other
hand, although the highest concentrations of K and
Ca were also recorded in T1; no statistical differences
existed between T1 and T3. In the case of N, the highest
concentrations (p≤ 0.05) were observed in T3 (20% of
agricultural soil: 80% compost).
RESULTADOS
The Figure 1 shows the macronutrients contents in roots of
petunias grown in substrates with different levels of compost.
These results show statistical differences between treatments
(p≤ 0.05). The highest content of the tested macronutrients
were recorded in plants’ grown in agricultural soil added
with 80% compost (T3). The nutriment that plants extracted
in greater amounts in roots was K (66.21 mg), followed by
N (64.37 mg), Ca (36.44 mg), Mg (18.42 mg) and P (10.71
mg), all recorded in treatment T3. In general, the lower
nutrimental accumulation in roots was recorded in the
substrate without compost (T1), and contents of N in this
treatment (T1), represent only 19.5% of the accumulation
determined in the T3 treatment. Importantly, the results of
nutrient accumulation in T1 were not statistically different
to those in plants of T2 treatment.
Concentración y acumulación de macronutrimentos
en raíces
Las concentraciones de macronutrimentos en raíz mostraron
diferencias estadísticas entre tratamientos (p≤ 0.05), con
excepción de Mg (Cuadro 3). La concentración de P fue
superior cuando las plantas se establecieron en suelo
agrícola (T1). Po otro lado, si bien las concentraciones de
K y Ca más altas se registraron también en T1; no existieron
diferencias estadísticas entre T1 y T3. Para el caso de N, las
concentraciones más altas (p≤ 0.05) se observaron en T3
(20% de suelo agrícola: 80% de composta).
Cuadro 3. Concentración de macronutrimentos en raíces de petunia, cultivadas en tres sustratos diferentes.
Table 3. Macronutrients concentration in petunia roots cultivated in three different substrates.
Tratamiento
Suelo
DMS
N
P
14.21 bz
14.38 b
22.9 a
1.3
6.51 a
2.57 b
3.75 b
2.41
K
(g kg-1 de materia seca)
27.46 a
15.03 b
23.62 a
6.84
= letras distintas en la misma columna indican diferencias significativas (p≤ 0.05) entre tratamientos.
z
En la Figura 1 se muestran los contenidos de macronutrimentos
en raíces de petunias crecidas en sustratos con diferentes
niveles de composta. Estos resultados muestran diferencias
estadísticas entre tratamientos (p≤ 0.05). Los contenidos más
altos de los macronutrimentos evaluados, se registraron en
plantas crecidas en suelo agrícola adicionado con 80% de
composta (T3). El nutrimento que las plantas extrajeron en
mayor cantidad en raíces fue K (66.21 mg), seguido de N
(64.37 mg), Ca (36.44 mg), Mg (18.42 mg) y P (10.71 mg),
todos registrados en el tratamiento T3. En general, se observa
que la menor acumulación nutrimental en raíces fue registrada
en el sustrato al que no se le adicionó composta (T1), y los
contenidos de N en este tratamiento (T1), representan sólo
19.5% de la acumulación determinada en el tratamiento
Ca
Mg
17.38 a
13.42 b
12.27 ab
12.21
5.93 a
3.96 a
6.43 a
2.53
Macronutrient concentration and accumulation in
stems
Unlike the results obtained in roots (Table 3), only N and Ca
concentrations were statistically different (p≤ 0.05) between
treatments in stem. Regarding the concentration of N, the
result obtained in T3 outperforms T1 (agricultural soil) in
75.77%; while T2 in almost 82% (Table 4). In contrast, the
Ca concentration was lower in plants grown in T3 compared
with T1 and T2.
The Figure 2 shows the macronutrient content in stems
of petunias grown in substrates with different proportions
of agricultural soil and compost. The highest accumulation
80
a
a
T1
T2
T3
60
a
T1
T3
T3
a
150
b
b
b
b
a
N
P
a
ab
b b
0
a
250
200
40
20
of macronutrients were recorded in stems of plants
established in the substrate with 80% compost (T3)
being N the most extracted (217.63 mg), followed by
K (171.64 mg), Ca (28.83 mg), Mg (28.54 mg) and P
(19.81 mg).
Acumulación en raíces por planta (mg)
Acumulación en raíces por planta (mg)
T3. Es importante indicar que los resultados obtenidos en
acumulaciones nutrimentales en T1, no fueron diferentes
estadísticamente a los obtenidos en plantas sometidas al
tratamiento T2.
405
b
K
Ca
b b
Mg
Macronutrimentos
Figura 1. Acumulación de macronutrimentos en raíces de
petunias cultivadas con tres sustratos: T1= testigo
(suelo); T2= 70% suelo y 30% composta (v/v); T3=
20% suelo y 80% composta (v/v). Las barras sobre
los promedios indican desviaciones estándar y las letras
distintas indican diferencias estadísticas significativas
(p≤ 0.05) entre tratamientos.
Figure 1. Macronutrients accumulation in petunias roots
cultivated with three substrates: T1= control (soil);
T2= 70% soil and 30% compost (v/v); T3= 20% soil
and 80% compost (v/v). The bars on the averages
indicate standard deviations and different letters
indicate statistical significant differences (p≤ 0.05)
between treatments.
en tallos
A diferencia de los resultados obtenidos en raíces
(Cuadro 3), sólo las concentraciones de N y Ca fueron
estadísticamente diferentes (p≤ 0.05) entre tratamientos
en tallo. En lo que respecta a concentración de N, se
observa que el resultado obtenido en T3 supera a T1 (suelo
agrícola) en 75.77%; mientras que T2 en casi 82% (Cuadro
4). Por el contrario, la concentración de Ca fue más baja
en plantas crecidas en T3 en comparación con T1 y T2.
La Figura 2 muestra los contenidos de macronutrimentos
en tallos de petunias, crecidas en sustratos con diferentes
proporciones de suelo agrícola y composta. Las
acumulaciones más altas de macronutrimentos, se
registraron en tallos de plantas establecidas en el sustrato con
100
50
0
b
b
b b
b b
N
P
a
a
b b
K
Ca
a
b b
Mg
Macronutrimentos
Figura 2. Acumulación de macronutrimentos en tallos de
petunias cultivadas en tres sustratos: T1= testigo
(suelo); T2= 70% suelo y 30% composta (v/v); T3=
20% suelo y 80% composta (v/v). Las barras sobre
los promedios indican desviaciones estándar y las letras
distintas indican diferencias estadísticas significativas
(p≤ 0.05) entre tratamientos.
Figure 2. Macronutrient accumulation in petunias stems
grown in three substrates: T1= control (soil); T2=
70% soil and 30% compost (v/v); T3= 20% soil and
80% compost (v/v). The bars on the averages indicate
standard deviations and different letters indicate
significant differences (p≤ 0.05) between treatments.
Concentration and accumulation of macronutrients in
leaves
The Table 5 presents the macronutrient concentrations
determined in petunia leaves, established on substrates with
different compost proportions. In this organ, no statistical
differences between treatments in the concentration of
K were found (p> 0.05). The concentrations of P, Ca
and Mg were higher when the plants were grown on
agricultural soil. These values exceeded 152, 95.6 and
56.4%, respectively to those determined in plants grown
in substrate with 80% compost (T3). The concentrations
of P and Mg recorded at T1 were not statistically different
to those obtained in T2. However, the concentration of
N in leaves was higher in plants established in substrate
with 80% compost.
The macronutrients accumulation in petunia leaves of
plants established on substrates with different proportions
of compost are shown in Table 6. Treatments with 80%
80% de composta (T3); siendo el N el más extraído (217.63
mg), seguido de K (171.64 mg), Ca (28.83 mg), Mg (28.54
mg) y P (19.81 mg).
Cuadro 4. Concentración de macronutrimentos en tallos de petunia cultivadas en tres sustratos diferentes.
Table 4. Macronutrient concentration in petunia stems cultured in three different substrates.
N
P
12.88 bz
12.44 b
22.64 a
3.08
3.12 a
2.09 a
2.1 a
1.67
Tratamiento
Suelo
DMS
K
17.81 a
19.76 a
18.27 a
11.12
z
en hojas
En el Cuadro 5 se presentan las concentraciones de
macronutrimentos determinadas en hojas de petunia,
establecidas en sustratos con distintas proporciones de
composta. En este órgano, no se encontraron diferencias
estadísticas entre tratamientos en la concentración de K
(p> 0.05). Las concentraciones de P, Ca y Mg fueron mayores
cuando las plantas crecieron en suelo agrícola. Dichos
valores superaron en 152, 95.6 y 56.4%, respectivamente,
a los determinados en plantas desarrolladas en sustrato con
80% de composta (T3). Las concentraciones de P y Mg
registradas en T1 no fueron diferentes estadísticamente a
las obtenidas en T2. Sin embargo, la concentración de N en
hojas fue más alta en plantas establecidas en sustrato con
80% de composta.
Ca
Mg
3.32 a
3.04 a
3b
1.3
2.91 a
2.66 a
3.03 a
1.46
compost, showed higher values of N and K in this plant
organ. The accumulation values of N ranged between 25.6
and 118.7 mg per plant, and correspond to T1 and T3,
respectively. In the case of K, the accumulation interval
was of 95.1 and 254.9 mg, also for T1 and T3, respectively.
The treatments did not differ significantly in content of P,
Ca and Mg in this organ, although there was a tendency
for greater accumulation of Ca and Mg in plants under
T3 treatment.
Macronutrient accumulation in the whole plant
The Table 7 shows the accumulation of macronutrients in
the whole plant (roots, stems and leaves), which shows
that treatment with 80% compost (T3), presents the
highest contents. Importantly, the order of nutrient
accumulation is different between the treatment without
Cuadro 5. Concentración de macronutrimentos en hojas de petunia cultivadas en tres sustratos diferentes.
Table 5. Macronutrients concentration in petunia leaves cultured in three different substrates.
Tratamiento
Suelo
DMS
N
P
K
Mg
24.63 a
15.62 b
13.1 b
8.34
8.04 a
6.17 ab
5.14 b
2.04
12.77 bz
14.12 b
23.4 a
1.81
5.67 a
2.94 ab
2.25 b
3.34
47.74 a
43.21 a
50.28 a
10.52
z
Ca
La acumulación de macronutrimentos en hojas de plantas de
petunia, establecidas en sustratos con distintas proporciones
de composta puede ser observada en el Cuadro 6. El
compost (T1) and those containing compost (T2 and T3);
in T1 was K> Ca> N> Mg> P, while in T2 and T3 was K>
N> Ca> Mg> P.
407
DISCUSSION
tratamiento con 80% de composta, presentó valores más
elevados de N y K en este órgano de la planta. Los valores de
acumulación de N oscilaron entre 25.6 y 118.7 mg por planta,
y corresponden a los tratamientos T1 y T3, respectivamente.
En el caso de K, el intervalo de acumulación fue de 95.1
y 254.9 mg, también para T1 y T3, respectivamente. Los
tratamientos no presentaron diferencias significativas en
cuanto al contenido de P, Ca y Mg en este órgano, aunque
hubo una tendencia de mayor acumulación de Ca y Mg en
plantas bajo el tratamiento T3.
The materials processed through composting, contain
nutrients that have positive effects on photosynthesis and
chlorophyll content when they are absorbed by the plants.
In compost, the nutrient availability for plants it’s higher,
since this process increases the available forms of elements,
including nitrates, as well as interchangeable forms of P, K,
Ca and Mg (Chamani et al., 2008).
Cuadro 6. Acumulación de macronutrimentos en hojas de petunias, establecidas en tres sustratos diferentes (GarcíaAlbarado et al., 2010).
Table 6. Accumulation of macronutrients in petunias’ leaves established in three different substrates (García-Albarado
et al., 2010).
Tratamiento
N
P
K
Ca
Mg
(mg planta )
-1
Suelo
25.6 bz
11.8 a
95.1 b
50.2 a
16.1 a
Suelo + 30 % composta
39.3 b
7.3 a
124.7 b
41.1 a
17.2 a
118.7 a
11.4 a
254.9 a
66.2 a
25.9 a
33.2
10.3
104.9
44.1
15.3
DMS
z
Acumulación de macronutrimentos en planta completa
En el Cuadro 7 se presenta la acumulación de
macronutrimentos en la planta completa (raíces, tallos y
hojas), en el cual se observa que el tratamiento con 80%
de composta (T3), se presentan los contenidos más altos.
Es importante destacar que el orden de acumulación
nutrimental es diferente entre el tratamiento sin composta
(T1) y los que contienen composta (T2 y T3); en T1 fue
K> Ca> N> Mg> P, en tanto que en T2 y T3 fue K> N>
Ca> Mg> P.
The concentration ratio of macronutrients found in roots,
stems and leaves in this paper (Tables 3, 4 and 5) were
different in each of the tested substrates. Both in root and
stem, when the substrate contained 80% compost (T3) had
the highest concentration of N. In leaves (Table 5), regardless
of used substrate, the higher nutrient concentration was
found in K.
The N concentration values recorded in root, stem and
leaves (Tables 3, 4 and 5, respectively) were similar in
each of the tested substrates, with values ranging from
Cuadro 7. Acumulación de macronutrimentos en plantas completas de petunia, establecidas en tres sustratos diferentes.
Table 7. Macronutrient accumulation in the whole plants of petunia established in three different substrates.
Tratamiento
N
P
K
Ca
Mg
(mg planta-1)
Suelo
70.477
23.952
158.603
72.51
27.93
97.29
17.568
205.92
55.081
30.576
400.715
41.902
492.755
131.47
72.984
DISCUSIÓN
Los materiales procesados a través del compostaje
contienen nutrimentos que al ser absorbidos por las plantas
tienen efectos positivos sobre fotosíntesis y contenido de
clorofila. En compostas, la disponibilidad de nutrimentos
para las plantas es mayor, ya que este proceso aumenta
las formas disponibles de los elementos, incluyendo
nitratos, así como formas intercambiables de P, K, Ca y
Mg (Chamani et al., 2008).
La relación de concentración de macronutrimentos
encontrada en raíces, tallos y hojas en esta investigación
(Cuadros 3, 4 y 5) fue distinta en cada uno de los
sustratos evaluados. Tanto en raíces como en tallo,
cuando el sustrato contenía 80% de composta (T3) se
tuvo la mayor concentración de N. En hojas (Cuadro 5),
independientemente del sustrato empleado, el nutrimento
encontrado en mayor concentración fue el K.
Los valores de concentración de N registrados en raíz,
tallo y hojas (Cuadros 3, 4 y 5, respectivamente) fueron
muy similares en cada uno de los sustratos evaluados, con
valores oscilando entre 12.77 a 14.21 para T1; en T2 de 12.44
a 14.38 y en T3 de 22.64 a 23.4 g kg-1 de materia vegetal
seca; observándose de manera general una relación positiva
entre la concentración de este elemento y la proporción de
composta en el sustrato. Así también, Atiyeh et al. (2001)
reportaron que la concentración de N fue mayor en plantas de
tomate crecidas en sustratos con 5% o más de vermicomposta
de estiércol de cerdo, lo cual coincide con los datos de la
presente investigación.
Por su parte, Atiyeh et al. (2002) reportaron incrementos
significativos en la concentración de N en hojas de Tagetes
erecta, crecidas en una mezcla de vermicomposta, turba
y arena, lo que resultó en mayor crecimiento de raíces
y tallos. De la misma manera, en plantas de Impatiens
wallerana crecidas con mezclas de sustratos con gallinaza
y turba (1:3, v/v) la concentración de N en plantas aumentó
significativamente, en comparación con el sustrato testigo
que incluían únicamente turba (Dede et al., 2006). En
hojas de petunia (Cuadro 5), se observa deficiencia de
N en los tres sustratos (12.77 g kg-1 de materia seca para
T1; 14.12 g kg-1 para T2; y 23.4 g kg-1 para T3), pues el
intervalo de concentración de este nutrimento reportado
como suficiente por Mills y Jones (1996) oscila de 39 a 76
g kg-1 de materia seca.
12.77 to 14.21 for T1; T2 of 12.44 to 14.38 and T3 of 22.64
to 23.4 g kg-1 of dry plant matter, but there was generally
a positive relation between this element concentration
and the compost proportion in the substrate. Atiyeh et al.
(2001) also reported that, the N concentration was higher
in tomato plants grown in substrates with 5% or more of
pig manure vermicompost, which is consistent with the
data obtained from this paper.
Atiyeh et al. (2002), reported significant increases in
the N concentration in Tagetes erecta leaves, grown in
a mixture of vermicompost, peat and sand, resulting in
greater growth of roots and stems. Likewise, in plants
of Impatiens wallerana grown with substrate mixtures
of manure and peat (1:3, v/v), the N concentration in
plants was significantly increased compared to the
control substrate that contained only peat (Dede et
al., 2006). In petunia leaves (Table 5), N deficiency is
observed in the three substrates (12.77 g kg-1 of dry matter
for T1; 14.12 g kg-1 for T2 and 23.4 g kg-1 for T3), the
concentration range of this nutrient reported as sufficient
by Mills and Jones (1996), ranges from 39 to 76 g kg-1 of
dry matter.
This allows suggesting the addition of complementary
N to the substrate from inorganic or organic sources. A
further example of an organic source would be the addition
of a combination of manure and feather meal, which
would provide both rapid and slow release of nitrogen
(Buckwalter and Fake, 2003).
The highest average concentration of P in all organs
tested were recorded on the plants growing in soil
without compost (T1), although this substrate contains
the least amount of P than those containing compost
(García-Albarado et al., 2010). In leaves (Table 5),
only the concentration of P in this treatment is within
the sufficiency range (4.7 to 9.3 g kg -1) and was not
statistically different from the results obtained in T2 (2.94
g kg-1), although it’s classified as poor.
Similar results were reported by Eichler-Löbermann et
al. (2007), who found that the combination of organic
fertilizers (cow manure and compost) and inorganic
fertilizer increased the P content in soils, although
significant yield increases were only observed when
combined with organic fertilizer triple superphosphate,
and indicated that regular application of manure and
compost have the same effects on yield, P uptake and P
Lo anterior permite sugerir la adición de N complementario
al sustrato a partir de fuentes inorgánicas o bien de fuentes
orgánicas. Un ejemplo adicional de una fuente orgánica
sería la adición de una combinación de estiércol y harina
de plumas de ave, que proporcionan nitrógeno tanto rápida
como lenta liberación (Buckwalter y Fake, 2003).
Las medias de concentración más altas de P en todos los
órganos evaluados fueron registradas en plantas creciendo
en suelo sin composta (T1), a pesar de que este sustrato
contiene la menor cantidad de P, que aquellos que contienen
composta (García-Albarado et al., 2010). En hojas (Cuadro
5), sólo la concentración de P de este tratamiento se encuentra
dentro del intervalo de suficiencia (4.7 a 9.3 g kg-1) y no fue
estadísticamente diferente al resultado obtenido en el T2
(2.94 g kg-1), a pesar que éste se clasifica como deficiente.
Resultados similares fueron reportados por EichlerLöbermann et al. (2007), quienes encontraron que la
combinación de abonos orgánicos (estiércol de ganado
bovino y composta) con fertilizantes inorgánicos elevaron el
contenido de P en suelos, aunque incrementos significativos
en rendimiento sólo se observaron cuando los abonos
orgánicos se combinaron con superfosfato triple, e indicaron
que la aplicación periódica de estiércol y de composta
tiene los mismos efectos en rendimiento, absorción de P y
contenido de P en suelo que el P soluble inorgánico aplicado
al suelo, por lo que sugieren que las recomendaciones
sobre fertilización fosfatada, deben tomar en cuenta la baja
correlación entre suministro y absorción de P en los cultivos.
La alta movilidad de K en la planta (Anjos et al., 2009) se
pone de manifiesto en las altas concentraciones de este
elemento obtenidas en hojas, independientemente de los
sustratos evaluados (Cuadro 5), las cuales son superiores
en general en más de dos veces a las registradas en raíces
y tallos (Cuadros 3 y 4). Analizando las concentraciones
de K en hojas, se observa que éstas no se correlacionan de
manera positiva con el contenido de potasio en el sustrato
(García-Albarado et al., 2010); y todas ellas son clasificadas
como óptimas de acuerdo al intervalo de 31.3 a 66.5 g kg-1 de
suficiencia reportado para petunia por Mill y Jones (1996).
El contenido de Ca intercambiable es superior en el sustrato
testigo consistente en suelo agrícola (T1). Este valor
disminuye conforme la proporción de composta decrece
(García-Albarado et al., 2010). Estos datos se correlacionan
de manera positiva, con las concentraciones de este elemento
determinadas en hojas y tallos en este estudio. De acuerdo con
409
content in soil soluble inorganic P applied to the soil, thus
suggesting that P fertilization recommendations must take
into account the low correlation between supply and P
uptake in crops.
The high mobility of K in the plant (Anjos et al., 2009) is
revealed in the high concentrations of this element on leaves
obtained regardless of the tested substrates (Table 5), which
are generally twice higher than those recorded in roots and
stems (Tables 3 and 4). Analyzing the K concentrations in
leaves, it’s clear that they are not positively correlate with
the potassium content in the substrate (García-Albarado et
al., 2010) and, they are all classified as optimal according
to the range of 31.3 to 66.5 g kg-1 sufficiency reported for
petunia by Mill and Jones (1996).
The exchangeable Ca content is higher in the control
substrate consisting of agricultural soil (T1). This value
decreases as the compost proportion decreases (GarcíaAlbarado et al., 2010). These data are positively correlated
with concentrations of this element determined in leaves
and stems in this study. According to Mill and Jones (1996),
the optimal concentrations of calcium in petunia’s leaves
range from 12 to 28 g kg-1 of dry matter and, the values
found in this paper are within this range in the evaluated
treatments.
In the case of Mg, this nutrient concentrations in leaves
of tested substrates (Table 5), are within the range 0.36 to
1.37% (3.6 to 13.7 g kg-1 dry matter), reported as sufficient
for this species according to Mill and Jones (1996). This
result is because the Mg content in the tested substrates
(Table 2), is much higher than the value considered optimal
by Ansorena (1994) for culture substrates (> 0.575 cmolc
of Mg kg-1 equivalent to 0.07 g of Mg kg-1 dry matter). The
highest average foliar concentrations of Mg were found in
plants growing in agricultural soil (T1) and substrate with
30% compost (T2), results that are not positively relate
with the contents of exchangeable Mg in the substrate;
which is contrary to that reported by Chamani et al. (2008)
in Petunia, who pointed out that, the use of vermicompost
did tended to increase the concentration of Mg in the plant’s
tissue. In the same manner as in leaves in the substrates,
the exchangeable Mg contents are not related with their
compost proportion.
Regarding to the nutrient accumulation in roots and stems,
the highest contents of N, P, K and Mg were recorded in
treatment T3 (Figures 1 and 2), a behavior also observed
Mill y Jones (1996), las concentraciones óptimas de calcio
en hoja de petunia oscilan de 12 a 28 g kg-1 de materia seca, y
los valores encontrados en esta investigación se encuentran
dentro de este intervalo en los tratamientos evaluados.
En el caso de Mg, las concentraciones de este nutrimento en
hojas de los sustratos evaluados (Cuadro 5), se encuentran
dentro del intervalo 0.36 a 1.37% (3.6 a 13.7 g kg-1 de materia
seca), reportado como suficientes para esta especie de
acuerdo con Mill y Jones (1996). Este resultado obedece que
el contenido de Mg en los sustratos evaluados (Cuadro 2),
es muy superior al valor considerado óptimo por Ansorena
(1994) para sustratos de cultivos (> 0.575 cmolc de Mg kg-1
equivalente a 0.07 g de Mg kg-1 de materia seca). Las medias
más altas de concentración foliar de Mg se encontraron en
plantas creciendo en suelo agrícola (T1) y en sustrato con
30% de composta (T2), resultados que no se relacionan en
forma positiva con los contenidos de Mg intercambiable en
el sustrato; lo cual es contrario a lo reportado por Chamani
et al. (2008) en petunia, quienes indican que el uso de
vermicomposta tendió a incrementar la concentración de Mg
en tejido vegetal. De la misma manera que en hojas, en los
sustratos los contenidos de Mg intercambiable, no guardan
una relación con la proporción de composta en éstos.
En lo que a acumulación nutrimental respecta, se observó en
raíces y tallos que los mayores contenidos de N, P, K y Mg se
registraron en el tratamiento T3 (Figura 1 y 2), comportamiento
también observado en hojas para los nutrimentos N y K
(Cuadro 6) y reportado por García-Albarado et al. (2010). De la
misma manera, Senthilkumar et al. (2004), reportaron que los
materiales orgánicos composteados y la adición de fertilizantes
de síntesis química (NPK), incrementaron la disponibilidad
de N, P y K en rosales. Por su parte, Hargreaves et al. (2008;
2009) reportaron un incremento en la absorción de P, K, S, Zn,
B y Cu con la aplicación de materiales composteados, lo que
incrementó el crecimiento de las plantas.
Sainz et al. (1998) reportaron que la adición de vermicomposta
al suelo, ocasionó incrementos en los contenidos de N, P, K, Ca
y Mg en éste, así como mayores concentraciones de P, Ca y Mg
en tallos de trébol y calabaza, lo cual es contrario a los hallazgos
reportados en la presente investigación, excepto para el caso
del N (Cuadro 4). No obstante, la adición 80% de composta
al sustrato incrementó la acumulación de N, P, K, Ca y Mg en
tallos de petunia (Figura 2). Por su parte, Sailaja-Kumari y
Ushakumari (2002) reportaron que la composta incrementó
la absorción de N, P, K, Ca y Mg en Vigna unguiculata.
in leaves for nutrients N and K (Table 6) and reported by
García-Albarado et al. (2010). Likewise, Senthilkumar et
al. (2004) reported that composted organic materials and
the addition of chemical fertilizers (NPK) increased the
availability of N, P and K in roses. Meanwhile, Hargreaves
et al. (2008; 2009) reported an absorption increase of P,
K, S, Zn, B and Cu with the application of composted
materials, which increased the plant’s growth.
Sainz et al. (1998), reported that the addition of
vermicompost to the soil resulted in increasing contents
of N, P, K, Ca and Mg and higher concentrations of P,
Ca and Mg in stems of clover and squash, which is contrary
to the findings reported in this paper, except for the case
of N (Table 4). However, adding 80% compost to the
substrate increased the accumulation of N, P, K, Ca and
Mg in the petunia’s stems (Figure 2). Meanwhile, SailajaKumari and Ushakumari (2002) reported that compost
increased the absorption of N, P, K, Ca and Mg in Vigna
unguiculata.
Similar results are also reported by Chamani et al.
(2008), who found that the N concentration in petunia
stems increased significantly with increasing content
of vermicompost up to 60% of the total substrate. This
response was also observed in this paper not only on
concentration but also on the N accumulation in the
stems and roots (Tables 3 and 4; Figures 1 and 2). Also,
Chamani et al. (2008) found no significant differences
in Ca accumulation, which is different from these paper
findings, as in the stems there was greater accumulation
of Ca when using 80% compost in the substrate. These
differences may be due to the compost origin and its
production processes (compost vs vermicompost) and
the levels used in the substrates mixture (80% vs 60% as
maximum levels).
García-Albarado et al. (2010), reported that the
addition of 80% compost, significantly increased the
production of dry biomass in roots, stems and leaves
both compared with the control (saline agricultural
soil) and in the treatment with addition of 30%
compost; although plants grown in T3 (80% compost)
had undesirable commercial characteristics such as
lodging and lack of seed production, so that in future
researches it will be necessary to test intervals of less
than 80% compost in the substrate and to analyze their
effects on both, growth and development indicators
Resultados similares son también reportados por Chamani
et al. (2008), quienes encontraron que la concentración de
N en tallos de petunia se incrementó significativamente al
aumentar el contenido de vermicomposta hasta en un 60%
del volumen total de sustrato. Esta respuesta fue también
observada en la presente investigación no sólo en la
concentración, sino también en la acumulación de N en tallos
y raíces (Cuadros 3 y 4; Figuras 1 y 2). Asimismo, Chamani
et al. (2008) no encontraron diferencias significativas en
la acumulación de Ca, lo cual es distinto a los hallazgos
de la presente investigación, pues en tallos hubo mayor
acumulación de Ca cuando se utilizó 80% de composta en
el sustrato. Estas diferencias quizás se deban al origen de las
compostas y a los procesos de su producción (composta vs
vermicomposta), y a los niveles utilizados en la mezcla de
sustratos (80% vs 60% como niveles máximos).
García-Albarado et al. (2010) reportaron que la adición de 80%
de composta incrementó significativamente la producción de
biomasa seca en raíces, tallos y hojas tanto en comparación con
el testigo (suelo agrícola salino), como con el tratamiento de
adición de 30% de composta, aunque las plantas crecidas en
tratamiento T3 (80% de composta) presentaron características
comerciales no deseables como acame y ausencia de
producción de semillas, por lo que en futuros estudios será
necesario probar intervalos menores a 80% de composta
en el sustrato y analizar sus efectos tanto en indicadores de
crecimiento y desarrollo, como nutrimentales, lo cual permitiré
encontrar niveles óptimos de este tipo de compostas en los
sustratos, que resulten en máximos beneficios nutrimentales
y también en mejor calidad de las plantas.
Dada la diversidad de desechos orgánicos que se producen
en la región, debido a la actividad ganadera, también será
necesario probar diferentes proporciones de estiércol de
origen diferente al bovino, como el equino, caprino y ovino,
por citar algunos ejemplos, y su combinación con desechos
orgánicos provenientes de la actividad agrícola y forestal.
Otro aspecto a considerar como estrategia amigable con
el ambiente es el aprovechamiento de residuos sólidos
municipales, los cuales, al ser procesados a través de
compostajes, pueden ser utilizados en agricultura, horticultura,
paisajismo y control de la erosión. A este respecto, Silva et al.
(2007) reportaron que la calidad de los materiales residuales
composteados y su aplicación en agricultura, depende de
sus propiedades físicas y químicas tales como su capacidad
de retención de agua, densidad, sales solubles totales,
411
and nutrients indicators, which allow to find optimal
levels of this compost type in the substrates that result
in maximum benefits and better nutritional quality of the
plants.
Due to the diversity of organic waste produced in the
region, due to livestock, it will also be necessary to
try different proportions of manure different to bovine
origin, such as horses, goats and sheep, to name a few, and
its combination with organic waste from farming and
forestry.
Another aspect to be considered as an environmentally
friendly strategy is the use of municipal solid waste,
which when processed through composting, can be used in
agriculture, horticulture, landscaping and erosion control.
In this regard, Silva et al. (2007) reported that, the quality
of composted waste materials and their application in
agriculture depends on physical and chemical properties,
such as its water holding capacity, density, total soluble
salts, C:N ratio, content of macro and micronutrients
and levels of toxic elements such as heavy metals, which
will have to be assessed when implementing strategies
to benefit from these types of waste for the ornamentals
production such as petunia, which has shown to be tolerant
to salinity (Formes et al., 2007), but there are not detailed
studies that show its performance against toxic agents
like heavy metals.
CONCLUSIONS
The addition of 80% compost to petunia’s growth
substrate had a positive effect on the nutrient concentration
of N in the roots, stems and leaves. Also, the inclusion
of 80% compost significantly increased nutrient
accumulation of N, P, K, Ca and Mg in the different
analyzed tissues. However, when increasing the compost
proportion on the growth substrate from 30 to 80%, the Ca
concentration in the stem decreased significantly, a trend
with no significant difference but that was also observed
in the K concentration in the stem, and P, Ca and Mg in
the leaves.
End of the English version
relaciones C:N, contenido de macro y micronutrimentos y
niveles de elementos tóxicos como metales pesados, lo cual
tendrá que evaluarse al momento de implementar estrategias
de aprovechamiento de estos tipos de residuos, para la
producción de ornamentales como petunia, la cual ha mostrado
ser tolerante a la salinidad (Formes et al., 2007), pero se carece
de estudios detallados que muestren su comportamiento frente
a agentes tóxicos como metales pesados.
CONCLUSIONES
La adición de 80% de composta al sustrato de crecimiento
de petunias, tuvo un efecto positivo sobre la concentración
nutrimental de N en raíces, tallos y hojas. Asimismo, la
inclusión de 80% de composta incrementó significativamente
la acumulación nutrimental de N, P, K, Ca y Mg en los
diferentes tejidos analizados. Sin embargo, también se
observó que al incrementar la proporción de composta en
el sustrato de crecimiento de 30 a 80%, la concentración de
Ca en tallo disminuyó significativamente, tendencia que sin
mostrar diferencias significativas, también fue observada
en la concentración de K en tallo, y de P, Ca y Mg en hojas.
AGRADECIMIENTOS
Los autores(as) agradecen a la línea prioritaria de
investigación 4. Agronegocios, agroecoturismo y
arquitectura del paisaje del Colegio de Postgraduados
en Ciencias Agrícolas, por los apoyos otorgados para la
realización de esta investigación.
LITERATURA CITADA
Alcántar, G. G. y Sandoval, M. V. 1999. Manual de análisis
químico de tejido vegetal. Publicación especial.
Núm. 10. SMCS. Chapingo, México. 150 p.
Anjos, R. M.; Mosquera, B.; Sánches, N.; Cambui, C. A.
and Mercier, H. 2009. Caesium, potassium and
ammonium distributions in different organs of
tropical plants. Environ. Exp. Bot. 65(1):111-118.
Ansorena, M. J. 1994. Sustratos propiedades y caracterización.
Ediciones Mundiprensa. 172 p.
Atiyeh, R. M.; Edwards, C. A.; Subler, S. and Metzger, J.
D. 2001. Pig manure vermicompost as a component
of a horticultural bedding plant medium: effects
on physicochemical properties and plant growth.
Bioresour. Technol. 78:11-20.
Atiyeh, R. M.; Arancon, N. Q.; Edwards, C. A. and Metzger,
J. D. 2002. The influence of earthworm-processed
pig manure on the growth and productivity of
marigolds. Bioresour. Technol. 81:103-108.
Ayala-Sierra, A. y Valdez-Aguilar, L. A. 2008. El polvo de
coco como sustrato alternativo para la obtención
de plantas ornamentales para trasplante. Revista
Chapingo. Serie Horticultura. 14(2):161-167.
Bremner, J. M. 1965. Total nitrogen. In: Black, C. A. (ed.).
Methods of soil analysis. Part 2. Agronomy 9. Ame.
Society Agron. Madison, Wisconsin, USA.
Buckwalter, C. and Fake, D. 2003. Using organic
amendments. University of California Cooperative
Extension. 31-072C.
Chamani, E.; Joyce, D. C. and Reihanytabar, A. 2008.
Vermicompost effects on the growth and flowering
of Petunia hybrida ‘Dream Neon Rose”. AmericanEurasian J. Agric. Environ. Sci. 3:506-512.
Dede, O. H.; Koseoglu, G.; Ozdemir, S. and Celebi, A.
2006. Effects of organic waste substrates on the
growth of impatiens. Turkish. J. Agric. Forestry.
30:375-381.
Eichler-Löbermann, B; Köhne, S. and Köppen, D. 2007.
Effect of organic, inorganic, and combined
organic and inorganic P fertilization on plant P
uptake and soil P pools. J. Plant Nutr. Soil Sci.
170:623-628.
Fain, G. B.; Gilliam, C. H.; Sibley, J. L. and Boyer, C.
R. 2008. Establishment of greenhouse-grown
Tagetes patula and Petunia x hybrida in ‘wholetree’
substrates. Acta Hortic. 782:387-393.
García-Albarado, J. C.; Trejo-Téllez, L. I.; VelásquezHernández, M. A.; Ruiz-Bello, A. y GómezMerino, F. C. 2010. Crecimiento de petunia en
respuesta a diferentes proporciones de composta
en sustrato. Revista Chapingo. Serie Horticultura
16(2):107-113.
García-Gómez, A; Bernal, M. P. and Roig, A. 2002. Growth
of ornamental plants in two composts prepared
from agroindustrial wastes. Bioresour. Technol.
83:81-87.
Hanson, J. B. 2003. Counting on coir. Greenhouse Product
News. 13(9):48-54.
Hargreaves, J. C.; Adl, M. S. and Warman, P. R. 2008. A
review of the use of composted municipal solid
waste in agriculture. Agric. Ecosyst. Environ.
123:1-14.
Hargreaves, J. C.; Adl, M. S. and Warman, P. R. 2009.
The effect of municipal solid waste compost and
compost tea on mineral element uptake and fruit
quality of strawberries. Compost Sci. Utilization.
17:85-94.
Marfa, O.; Lemaire, F.; Cáceres, R.; Giuffrida, F. and
Guerin, V. 2002. Relationship between growing
media fertility, percolate composition and
fertigation strategy in peat-substitute substrates
used for growing ornamental shrubs. Sci. Hortic.
94:309-321.
Mills, H. A. and Jones, J. B. 1996. Plant analysis handbook
II. MicroMacro Publishing. Athens, Ga.
Sailaja-Kumari, M. S. and Ushakumari, K. 2002. Effect
of vermicompost enriched with rock phosphate on
the yield and uptake of nutrients in cowpea [Vigna
unguiculata (L.) Walp]. J. Trop. Agric. 40:27-30.
413
Sainz, M. J.; Taboada-Castro, M. T. and Vilariño, A.
1998. Growth, mineral nutrition and mycorrhizal
colonization of red clover and cucumber plants
grown in a soil amended with composted urban
wastes. Plant Soil. 205:85-92.
SAS Institute (SAS). 2003. SAS/STAT User’s Guide.
Version 9.1. Inc., Cary, NC. Volumes 1-7.
Senthilkumar, S.; Sriramachandrasekharan, M. V. and
Haripriya, K. 2004. Effect of vermicompost and
fertilizer on the growth, physiological disorders, fruit
yield and quality of strawberry (Fragaria x ananassa
(Duch.) Bioresour. Technol. 99:8502-8511.
Silva, M. T. B.; Menduiña, A.; Seijo, Y. C. and Viqueira,
F. C. 2007. Assessment of municipal solid waste
compost quality using standardized methods before
preparation of plant growth media. Waste Manage.
Res. 25:99-108
Theunissen, J.; Ndakidemi, P. A. and Laubscher, C. P. 2010.
Potential of vermicompost produced from plant
waste on the growth and nutrient status in vegetable
production. Int. J. Phys. Sci. 5:1964-1973.
MICRONUTRIMENTOS EN PETUNIAS CRECIDAS CON DISTINTAS
PROPORCIONES DE COMPOSTA EN SUSTRATO*
MICRONUTRIENTS IN PETUNIAS GROWN WITH DIFFERENT
COMPOST RATIONS INTO THE SUBSTRATE
Fernando Carlos Gómez-Merino1§, Libia Iris Trejo-Téllez2, Víctor Hugo Volke-Haller2, J. Cruz García-Albarado1, María de los
Ángeles Velásquez-Hernández2 y Alejandrina Ruiz-Bello2
Campus Córdoba. Colegio de Postgraduados. Carretera Córdoba-Veracruz, km 348. Congr. Manuel León, Amatlán de los Reyes, Veracruz. C. P. 94946. México. (jcruz@
colpos.mx). 2Campus Montecillo. Colegio de Postgraduados. Carretera México-Texcoco km 36.5. Montecillo, Texcoco, Estado de México, México. C. P. 56230. (wolke@
colpos.mx), ([email protected]), ([email protected]), ([email protected]). §Autor para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
Se estudiaron los efectos de relaciones composta/suelo
en tres mezclas de sustratos. Las relaciones composta/
suelo evaluadas fueron: T1= 0 (100% suelo agrícola
salino); T2= 0.43 (70% suelo agrícola salino + 30% (v/v)
de composta); y T3= 4 (20% suelo agrícola salino + 80%
(v/v) composta); sobre la concentración y extracción de
micronutrimentos y sodio en petunia (Petunia x hybrida)
bajo condiciones de invernadero en 2008. La composta
fue elaborada con estiércol bovino y residuos de cosecha;
ocho meses después del trasplante en estos sustratos, las
concentraciones y acumulaciones de Fe, Cu, Zn, Mn, B y
Na fueron determinadas en raíces, tallos y hojas. Se utilizó
un arreglo de tratamientos completamente al azar con diez
repeticiones por cada uno. La relación composta/suelo se
relacionó en forma positiva con las concentraciones de Fe y
B en raíces, el Fe en tallo y hojas. Asimismo, se observó una
relación negativa entre la cantidad de composta en el sustrato
y las concentraciones de Cu y Na en tallos y Mn, B y Na en
hojas. Por el contrario, a mayor relación composta/suelo en
el sustrato, se observaron incrementos en la acumulación
de Fe, Cu, Zn, Mn, B y Na en raíces; Fe, Zn, Mn, B y Na
en tallos y hojas. Estos resultados permiten concluir que la
The effects of compost/soil relations in three mixtures of
substrates were studied. The compost/soil relations tested
were: T1= 0 (100% saline agricultural soil); T2= 0.43 (70%
saline agricultural soil + 30% (v/v) of compost); and T3= 4
(20% saline agricultural soil + 80% (v/v) compost); about
the concentration and extraction of micronutrients and
sodium in petunia (Petunia x hybdrida) under greenhouse
conditions in 2008. The compost was elaborated with bovine
manure and crop residues; eight months after transplant
of these substrates, the concentrations and accumulations
of Fe, Cu, Zn, Mn, B and Na were determined in roots,
stems and leaves. The used-treatments arrangement was
completely random with ten repetitions for each of them.
The compost/soil relations were related positively with the
Fe and B concentrations in roots and Fe in stem and leaves.
Likewise, a negative relation was observed between the
compost quantity in the substrate and the concentration of
Cu and Na in stems and Mn, B and Na in the leaves. On the
contrary, with higher compost/soil relation in the substrate,
increments were observed in the accumulation of Fe, Cu,
Zn, Mn, B and Na in the roots; Fe, Zn, Mn, B and Na in the
stems and leaves. These results allow us to conclude that,
* Recibido: mayo de 2011
Aceptado: septiembre de 2011
adición de composta al sustrato de crecimiento, reduce la
acumulación de Na en hojas e incrementa la absorción de
micronutrimentos en petunia.
the addition of compost to the growth substrate, reduce the
accumulation of Na in leaves and increments the absorption
of micronutrients in petunia.
Palabras clave: Petunia x hybrida, extracción nutrimental,
horticultura ornamental, materia orgánica.
Key words: Petunia x hybrida, nutrient extraction, organic
matter, ornamental horticulture.
INTRODUCCIÓN
INTRODUCTION
La producción de petunia (Petunia x hybrida Hort. Vilm.Andr.) en invernadero emplea turba (“peat moss”) como
principal componente de los sustratos (García-Albarado
et al., 2010). Por otra parte, existen numerosos reportes
científicos que han demostrado los efectos positivos del uso
de compostas en los cultivos hortícolas (He et al., 2001),
dado que éstas pueden ser empleadas como sustituto de la
turba en los medios de crecimiento.
The production of petunia (Petunia x hybrida Hort. Vilm.Andr) in greenhouse employs peat moss as the main
component in the substrates (García-Albarado et al., 2010).
Moreover, there are numerous scientific reports that have
shown the positive effects of compost use in horticultural
crops (He et al., 2001), since these tests could be used as a
substitute for the peat on the growth medium.
En particular para petunia se ha reportado que la inclusión
de composta en el sustrato, tiene efectos positivos sobre
el crecimiento y la concentración nutrimental (GarcíaAlbarado et al., 2010). Adicionalmente a los beneficios
del uso de composta en petunia per se, la sustitución de la
turba en los sustratos coadyuva a evitar la extracción de este
recurso natural, promueve la reutilización de los residuos y
en consecuencia disminuye los problemas de contaminación
ambiental (Moldes et al., 2007). El uso de compostas ha
sido evaluado para el crecimiento de diversas especies.
Sin embargo, la variabilidad en las compostas, ocasiona
respuestas diferenciales debido a las distintas las materias
primas que la conforman (Vendrame y Maguire, 2005).
Las compostas pueden incrementar la concentración de
nutrimentos disponibles para las plantas en el suelo y
fomentar el crecimiento, pero puede también alterar la
dinámica de los micronutrimentos e incrementar las pérdidas
de éstos por lixiviación. En el pasto Bermuda (Cynodon
dactylon (L.) Pers.), se estudió la influencia de la adición
de composta al suelo en la dinámica estacional de Fe, Cu,
Zn y Mn biodisponibles. Las concentraciones de Mn y Cu
se incrementaron a los 29 meses; mientras que el Fe y Zn
disminuyeron considerablemente en el mismo periodo de
tiempo (Provin et al., 2008).
En brócoli, Pérez-Murcia et al. (2006) evaluaron el uso
de lodos residuales procesados para obtener compostas,
en combinación con turba sobre el desarrollo de la
Particularly for petunia, it’s been reported that the inclusion
of compost in the substrate has positive effects on growth
and nutrient concentration (García-Albarado et al., 2010).
In addition to the benefits of the compost used in petunia per
se, the substitution of peat in the substrates helps to prevent
the extraction of this natural resource, promotes the reuse
of residues and thus reduces the environmental pollution
problems (Moldes et al., 2007). The use of compost has been
tested for growth in diverse species. However, the variability
in the compost results in differential responses due to different
raw materials that comprise them (Vendrame y Maguire, 2005).
Composts may increase the concentration of nutrients
available for the plants in the soil and promote growth, but
can also alter the dynamics of micronutriments and increase
their losses by leaching. In Bermuda grass (Cynodon
dactylon (L.) Pers.), we studied the influence of the addition
of compost to the soil in the seasonal dynamics of Fe, Cu,
Zn and bioavaliable Mn. The concentrations of Mn and Cu
were increased at 29 months, whereas Fe and Zn decreased
significantly over the same period of time (Provin et al., 2008).
In broccoli, Pérez-Murcia et al. (2006) evaluated the use
of sludge to obtain compost, in combination with peat on
the plant’s development, biomass production, content of
macro and micronutrients and, heavy metals in plant tissue.
In particular, the combination of 50% compost with 50%
peat moss produced the highest concentration of macro and
micronutrients, as well as heavy metals in the plant. By contrast,
Ekling et al. (2001) indicated that, the presence of compost
Micronutrimentos en petunias crecidas con distintas proporciones de composta en sustrato
planta, producción de biomasa, contenidos de macro y
micronutrimentos y metales pesados en tejido vegetal. En
particular, la combinación de 50% de composta con 50%
de turba, produjo las mayores concentraciones de macro
y micronutrimentos, así como de metales pesados en la
planta. Por el contrario, Ekling et al. (2001) indican que la
presencia de composta en el medio de crecimiento reduce las
concentraciones de metales pesados en plantas, debido a los
altos valores del pH resultantes en el medio de crecimiento;
es decir, las compostas presentan valores de pH clasificados
de ligeramente alcalinos a alcalinos, que se relacionan de
forma inversa con la disponibilidad de micronutrimentos
(Handreck y Black, 2002).
García-Albarado et al. (2010) reportaron que el uso de
compostas a base de estiércol y residuos vegetales de
traspatio en combinación con suelos agrícolas salinos,
mejora significativamente variables de crecimiento
como diámetro de tallo y producción de biomasa total
de petunia, y variables relacionadas con el rendimiento
como la producción de flores, hojas, brotes, así como la
concentración de N y K en hojas. En esta investigación, se
evaluó la influencia de distintas relaciones composta/suelo
sobre la concentración y extracción de micronutrimentos
(Fe, Cu, Zn, Mn y B) y de sodio (Na) en raíces, tallos y
hojas de petunia, mediante curvas respuesta y modelos de
regresión.
Condiciones experimentales y manejo del experimento
La investigación se realizó bajo condiciones de invernadero
tipo cenital de estructura metálica y plástico blanco lechoso
(calibre 720) localizado a 19° 29’ latitud norte, 98° 53’
longitud oeste y altitud de 2 240 m, en Montecillo, Texcoco,
Estado de México, durante 2008, hasta alcanzar la fase de
floración. Las temperaturas máximas y mínima registradas
dentro del invernadero en este periodo fueron de 47.5 y
2.5 oC, respectivamente. Asimismo, la humedad relativa
promedio del periodo de experimentación fue de 59%,
mientras que la intensidad luminosa promedio fue de 690
mmol m-2 s-1.
Durante la fase experimental no se suministró fertilización
a las unidades experimentales (descritas en el apartado de
tratamientos y diseño experimental) y éstas fueron regadas
417
in the growth medium reduces the concentrations of heavy
metals in the plants, due to high pH values resulting in the
growth medium; that is, composts exhibit pH values classified
from slightly alkaline to alkaline, inversely related with the
micronutrients’ availability (Handreck and Black, 2002).
García-Albarado et al. (2010) reported that, the use of manure
compost and vegetable waste in combination with saline
agricultural soils, significantly improved the growth’s variables
such as stem diameter and total biomass production of petunia,
and variables related to yield on production of flowers, leaves,
buds, as well as the concentration of N and K in the leaves. In
this paper, we evaluated the influence of different compost/
soil relations on concentration and extraction of micronutrients
(Fe, Cu, Zn, Mn and B) and sodium (Na) in the roots, stems and
leaves of petunia, by response curves and regression models.
Experimental conditions and management
The research was conducted under zenithal white plastic
(720 gauge) metallic structured greenhouse conditions
located at 19° 29’ north latitude, 98° 53’ west longitude and
2 240 m in Montecillo, Texcoco, Estado de México, during
2008 up to the flowering phase. The minimum and maximum
temperatures recorded inside the greenhouse during this
period were 47.5 and 2.5 °C respectively. Likewise, the
average relative humidity of the experimental period was
59%, while the average light intensity was 690 mmol m-2 s-1.
During the experimental phase, fertilization was not supplied to
the experimental units (described in the section on treatments
and experimental design) and they were manually irrigated
twice a week at field capacity. The irrigation was made with
tap water (pH of 7.34, electrical conductivity of 0.37 dS m-1,
content of NO3-, NH4+, K, Ca, Mg, S, Na and HCO3- of 0.98,
0.28, 1.5, 23.7, 29.7, 24.5, 39.3 and 240 mg L-1, respectively;
no presence of P, Fe, Cu, Zn, Mn, and CO3-2 was detected).
Vegetal material
Petunia seeds (Petunia x hybrida Hort. Vilm.-Andr.)
were germinated in trays containing a mixture of peat
with perlite (70/30 v/v). Once the plants reached 10cm
height, they were transplanted into 2 kg-bags containing
the substrate mixtures to be evaluated.
en forma manual, dos veces por semana a capacidad de
campo. El riego se hizo con agua corriente (pH de 7.34,
conductividad eléctrica de 0.37 dS m-1, contenido de NO3-,
NH4+, K, Ca, Mg, S, Na y HCO3- de 0.98, 0.28, 1.5, 23.7,
29.7, 24.5, 39.3 y 240 mg L-1, respectivamente; no se detectó
presencia de P, Fe, Cu, Zn, Mn, y CO3-2).
Material vegetal
Semillas de petunia (Petunia x hybrida Hort. Vilm.-Andr.)
fueron germinadas en charolas conteniendo una mezcla
de turba con agrolita (70/30 v/v). Una vez que las plantas
alcanzaron 10 cm de altura, éstas fueron trasplantadas en
bolsas de 2 kg de capacidad conteniendo las mezclas de
sustratos a evaluar.
Tratamientos y diseño experimental
Se probaron los siguientes tratamientos: suelo agrícola salino
del sitio experimental (T1) como testigo; mezcla de suelo
agrícola salino (70%) con 30% de composta (T2) v/v; y
mezcla de suelo agrícola salino (20%) con 80% de composta
(T3) v/v. La composta fue preparada con estiércol de bovino
y residuos vegetales de cosechas de huertos de traspatio. Las
relaciones composta/suelo en los tratamientos resultantes
T1, T2 y T3 fueron 0, 0.43 y 4, respectivamente. Cada
tratamiento con diez repeticiones, el diseño experimental
tuvo una distribución completamente al azar; las unidades
experimentales fueron bolsas negras de polietileno de 2
kg de capacidad, con mezcla de sustratos a evaluar y una
planta. Las propiedades físicas y químicas de las mezclas
de sustratos y suelo evaluadas, son reportadas por GarcíaAlbarado et al. (2010).
Toma y manejo de muestras vegetales
La toma de muestras se realizó a los ocho meses de haber
establecido el experimento en macetas, etapa que coincidió
con la fase de floración de las plantas. Las plantas cosechadas
fueron divididas por órganos: raíces, tallos y hojas. Una vez
separados, los órganos fueron depositados en bolsas de papel
y éstas secadas en estufa de aire forzado a 72 °C por 48 h.
Una vez secas, se tomó el peso de biomasa y se molieron
en molino de acero inoxidable marca Wiley modelo 4. Las
muestras molidas fueron pesadas para determinar la biomasa
seca total por componente y procesadas para determinar sus
concentraciones nutrimentales y posterior estimación de
acumulaciones nutrimentales.
Treatments and experimental design
The following treatments were tested: saline agricultural
soil of the experimental site (T1) as a witness; a mixture
of saline agricultural soil (70%) with 30% compost (T2)
v/v; and mixture of saline agricultural soil (20%) with 80%
compost (T3) v/v. The compost was prepared with bovine
manure and vegetable waste from the backyard garden
crops. The resulting compost/soil relations in treatments
T1, T2 and T3 were 0, 0.43 and 4, respectively. Each
treatment with 10 repetitions, the experimental design
had a completely random distribution; the experimental
units were black polyethylene 2 kg capacity bags, with
a mixture of substrates to be evaluated and a plant. The
physical and chemical properties of the substrate and soil
mixtures evaluated, are reported by García-Albarado et
al. (2010).
Sampling and management of vegetable samples
Sampling was performed eight months after having put
the experiment in pots; stage that coincided with the
flowering phase of the plants. The harvested plants
were divided by organs: roots, stems and leaves. Once
separated, the organs were deposited in paper bags
and then dried in a forced air oven at 72 °C for 48 h.
Once dried, biomass weight was measured and they
were milled in a stainless steel Wiley mill model 4. The
samples were weighted to determine the total dried
biomass per component and processed to determine the
nutrient concentration, following the estimated nutrient
accumulations.
Determinations of nutrient concentrations
The concentrations of iron (Fe), copper (Cu), zinc
(Zn), manganese (Mn), boron (B) and sodium (Na)
were determined by wet digestion of dried material
with a mixture of perchloric and nitric acids (Alcántar
and Sandoval, 1999). The reading of the extracts
obtained after the digestion and filtration were
determined in an inductively coupled plasma atomic
emission spectroscopy equipment ICP-AES VARIAN™
model Liberty II. The determination of sodium in the
plant tissue was done because the soil in the substrates
is saline and therefore presents significant amounts of
soluble and exchangeable sodium (García-Albarado
et al., 2010).
419
Determinaciones de concentraciones nutrimentales
Statistical analysis
Las concentraciones de hierro (Fe), cobre (Cu), zinc (Zn),
manganeso (Mn), boro (B) y sodio (Na), fueron determinadas
mediante digestión húmeda del material seco con una mezcla
de ácidos perclórico y nítrico (Alcántar y Sandoval, 1999).
La lectura de los extractos obtenidos después de la digestión
y filtrado, se determinaron en un equipo de espectroscopía
de emisión atómica de inducción por plasma acoplado ICPAES VARIAN™ modelo Liberty II. La determinación de
sodio en tejido vegetal fue realizada debido que el suelo en
los sustratos es salino y en consecuencia, presenta cantidades
importantes de sodio soluble e intercambiable (GarcíaAlbarado et al., 2010).
Response curves were constructed of concentration and
accumulation of nutrients and sodium in roots, stems and
leaves. Subsequently, the regression models presented in
Table 1 were tested in each of the variables, considering
the relationship compost/soil substrate as an independent
variable under study. For each variable, the best regression
model was selected, considering the best ones as those who
had the lowest mean square error of the regression and, the
higher coefficient of determination (R2).
Análisis estadístico
Se construyeron curvas respuesta de concentraciones y
acumulaciones de nutrimentos y sodio en raíces, tallos
y hojas. Posteriormente, en cada una de las variables
se probaron los modelos de regresión presentados en el
Cuadro 1, considerando como variable independiente en
estudio la relación composta/suelo del sustrato. En cada
variable se seleccionó el mejor modelo de regresión,
considerando como mejor a aquel que tuviera el menor
cuadrado medio del error de la regresión y mayor
coeficiente de determinación (R2).
Cuadro 1. Modelos de regresión ajustados.
Table 1. Adjusted regression models.
Modelo
Y = β0 + β1X
Y = β0 + β 1X + β2X2
Y = β0 + β1X + β2X0.5
Nombre
Lineal
Cuadrático
Raíz cuadrada
RESULTADOS
Concentración y acumulación de micronutrimentos y
sodio en raíz
En la Figura 1 se presentan las curvas de respuesta de la
concentración de micronutrimentos y sodio, en raíces de
petunias establecidas en sustratos con distinta relación
composta/suelo. Se observan diferentes formas de respuesta,
que hace necesario la evaluación de diferentes modelos en
cada caso.
RESULTS
Concentration and accumulation of micronutrients and
sodium in the roots
The Figure 1 shows the response curves of the concentration
of micronutrients and sodium in petunia’s roots set in
substrates with different compost/soil relations. Different
types of responses were observed, which makes necessary
the evaluation of different models in each case.
The response curves of the concentration of micronutrients
and sodium in the roots show in general, an increase
depending on the percentage increase of compost in the
substrate (Figure 2). The most accumulated micronutrient
in this organ was Fe (3.54 mg roots-1 plant-1), followed by
B (1.14 mg roots-1 plant-1), Mn (0.3 mg roots-1 plant-1), Zn
(0.28 mg roots-1 plant-1) and Cu (0.019 mg roots-1 plant-1),
all recorded in roots of plants grown in agricultural soil
with 80% compost (compost/soil relation, 4).
The Table 2 shows the models selected for the variables of
concentration and accumulation of nutrients and sodium in
roots of petunia set in substrates with different compost/soil
relations; of these, those that were obtained for Cu and Zn
concentration are not significant.
sodium in the stem
Response curves of micronutrients and sodium concentration in
the stems (Figure 3) allow us to observe that, the concentration
of Na in the compost/soil relation 4 (80% compost + 20% soil)
was surpassed by 139.8% by the determined concentration
in relation 0 (substrate without compost). A similar response
11
Concentración de Cu en
raíces (mg kg-1)
Concentración de Fe en
raíces (mg kg-1)
1300
1100
900
700
500
Concentración de Mn en
raíces (mg kg-1)
Concentración de Zn en
raíces (mg kg-1)
75
65
0
0.43
4
Relación composta/suelo (v/v) en el sustrato
106
92
78
64
0
0.43
4
410
0
0.43
4
4.55
Concentración de Na en
raíces (mg kg-1)
Concentración de B en
raíces (mg kg-1)
7.25
120
85
380
350
320
290
8.5
6
0
0.43
4
95
55
9.75
0
0.43
4
3.7
2.85
2
0
0.43
4
Figura 1. Respuesta de concentración de micronutrimentos y sodio en raíces de petunia. Relaciones composta/suelo: T1= 0 (0%
composta/100% suelo, v/v); T2= 0.43 (30% composta/70% suelo, v/v); y T3= 4 (80% composta/20% suelo, v/v).
Figure 1. Response of micronutrients and sodium concentration in petunia’s roots. Compost/soil relation: T1= 0 (0% compost/100%
soil, v/v); T2= 0.43 (30% compost/70% soil, v/v); and T3= 4 (80% compost/20% soil, v/v).
Las curvas respuesta de acumulación de micronutrimentos
y sodio en raíces muestran, de manera general un
incremento en función del aumento del porcentaje de
composta en el sustrato (Figura 2). El micronutrimento
más acumulado en este órgano fue el Fe (3.54 mg
raíces -1 planta -1 ), seguido de B (1.14 mg raíces -1
planta -1), Mn (0.3 mg raíces -1 planta -1), Zn (0.28 mg
raíces-1 planta-1) y Cu (0.019 mg raíces-1 planta-1), todos
ellos registrados en raíces de plantas crecidas en suelo
agrícola con 80% de composta (relación composta
/suelo, 4).
to Na was recorded for the element Cu. On the contrary, Fe
concentration tends to increase as the proportion of compost
in the substrate increases.
With the exception of the elements Cu and Na, in response
curves for accumulations in stems, it’s quite evident the
increase in all of them as the compost/soil relation increases
in the substrate. In the stems, the most accumulated element
was Na, followed by B and Fe. On the contrary, the less
accumulated element was Cu with an average value of
0.013016 mg (Figure 4).
0.02
2.8
0.016
2
1.2
0.4
Acumulación de Mn
(mg raíces-1 planta-1)
Acumulación de Zn
0.17
0.11
0
0.43
4
0.26
0.2
0.14
0.08
0
0.43
4
0
0.43
4
8.5
Acumulación de Na
1.2
0.95
0.7
0.45
0.2
0.008
0.32
0.23
0.05
0.012
0.004
0
0.43
4
0.29
Acumulación de B
421
3.6
Acumulación de Cu
Acumulación de Fe
0
0.43
4
6.5
4.5
2.5
0
0.43
4
Figura 2. Respuesta de acumulación de micronutrimentos y sodio en raíces petunia. Relaciones composta/suelo: T1= 0 (0%
Figure 2. Response of micronutrients and sodium concentration in petunia’s roots. Compost/soil relation: T1= 0 (0% compost/100%
En el Cuadro 2 se muestran los modelos seleccionados para
las variables concentración y acumulación de nutrimentos
y sodio en raíces de petunia, establecidas en sustratos
con distintas relaciones composta/suelo; de éstos, no son
significativos los obtenidos para concentración de Cu y Zn.
sodio en tallo
Las curvas respuesta de concentración de micronutrimentos
y sodio en tallos (Figura 3), permiten observar que la
concentración de Na en la relación composta/suelo de 4 (80%
de composta + 20% de suelo), fue superada en 139.8% por
la concentración determinada en la relación 0 (sustrato sin
The best models selected for the variables of concentration
and accumulation of nutrients and sodium in the
stems of petunia set in substrates with different
compost/soil relations, are shown in Table 3. The
models obtained for concentration of Cu, Mn and B,
and the corresponding accumulation of Cu are not
significant.
sodium in the leaves
In the leaves, with the exception of Cu, the compost/soil
effect in the substrate is observed on the concentration
responses. The concentrations of Zn, Mn, B and Na
composta). Una respuesta similar al Na fue registrada para el
elemento Cu. Por el contrario, la concentración de Fe tiende
a incrementar a medida que la proporción de composta en
el sustrato aumenta.
are negatively related with the value of compost/
soil relation in the substrate; on the contrary, the leaf
concentration of Fe increases as the said relation increases
(Figure 5).
Cuadro 2. Modelos de regresión para concentraciones y acumulaciones de micronutrimentos y sodio en raíces de petunia.
Table 2. Regression models for concentrations and accumulations of micronutrients and sodium in petunia’s roots.
Elemento
Fe
Variable
Concentraciónx
Acumulacióny
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Cu
Zn
Mn
B
Na
Mejor modelo
Fe= 631.313 + 317.487X0.5
Fe= 0.398 + 1.543X0.5
Cu= 6.338 + 11.041X -2.726X2
Cu= 0.0074 + 0.0063X0.5
Zn= 71.154 - 37.458X + 10.832X2
Zn= 0.057 + 0.056X
Mn= 117.514 - 131.155X + 31.993X2
Mn= 0.084 + 0.054X
B= 299.279 + 31.483X - 12.893X2
B= 0.281 + 0.216X
Na= 4485.728 - 6133.19X + 1422.778X2
Na= 3.053 + 1.219X
Pr> F
0.0263
0.0006
0.2076
0.0161
0.205
0.0026
0.0044
0.0003
0.0477
<0.0001
0.047
0.0172
R2
0.3255
0.6162
0.2305
0.3699
0.2321
0.5157
0.5955
0.6497
0.3977
0.7019
0.3993
0.3641
X= representa la relación composta/suelo en el sustrato; x= concentración expresada en mg kg-1 de materia seca; y= acumulación expresada en mg en las raíces por planta.
7.2
120
118
116
114
0
0.43
4
tallo (mg kg-1)
tallo (mg kg-1)
58
51
44
37
30
0
0.43
4
tallo (mg kg-1)
tallo (mg kg-1)
340
327.5
315
302.5
290
tallo (mg kg-1)
tallo (mg kg-1)
122
0
0.43
4
5.2
4.2
2.7
1.2
0
0.43
4
32.5
31.75
31
30.25
29.5
0
0.43
4
4.3
3.65
3
2.35
1.7
0
0.43
4
Figura 3. Respuesta de concentración de micronutrimentos y sodio en tallos de petunia. Relaciones composta/suelo: T1= 0 (0%
Figure 3. Response of micronutrients and sodium concentration in petunia’s stems. Compost/soil relation: T1= 0 (0% compost/100%
Just like the nutrimental concentration in the leaves,
the tendencies of accumulation show relation with the
evaluated treatments, except Cu. The micronutrients Fe,
Zn, Mn and B are accumulated in higher quantity when
the compost/soil relation used was 4. The accumulation
of Na responded inversely to the value of the compost/
soil relation in the substrate. It’s important to note that, the
1.2
0.015
0.9
0.014
Acumulación de Cu
(mg tallos-1 planta-1)
Acumulación de Fe
Con excepción de los elementos Cu y Na, en las curvas
respuesta de acumulaciones en tallos, es evidente el
incremento de éstas a medida que la relación composta/
suelo aumenta en el sustrato. En tallos el elemento más
acumulado fue Na, seguido de B y Fe. Por el contrario, el
elemento menos acumulado fue el Cu con un valor medio
de 0.013016 mg (Figura 4).
0.6
0.3
0
Acumulación de Mn
Acumulación de Zn
0.31
0.20
0
0.43
4
0.24
0.18
0.12
0.06
0
0.43
4
2.81
0
0.43
4
17
Acumulación de Na
2.27
1.73
1.19
0.65
0.012
0.3
0.42
0.09
0.013
0.011
0
0.43
4
0.53
Acumulación de B
423
0
0.43
4
15
13
11
9
0
0.43
4
Figura 4. Respuesta de acumulación de micronutrimentos y sodio en tallos de petunia. Relaciones composta/suelo: T1= 0 (0%
Figure 4. Response of micronutrients and sodium concentration in petunia’s stems. Compost/soil relation: T1= 0 (0% compost/100%
Los mejores modelos seleccionados para las variables
concentración y acumulación de nutrimentos y sodio en
tallos de petunia, establecidas en sustratos con distintas
leaf content of Na was higher than the nutrients evaluated,
independent of the compost/soil relation in the substrate
(Figure 6).
relaciones composta/suelo, se presentan en el Cuadro 3. Los
modelos obtenidos para concentración de Cu, Mn y B; así el
correspondiente a acumulación de Cu no son significativos.
The best models selected for the variables of concentration
and accumulation of nutrients and sodium in petunia’s
leaves set in substrates with different compost/soil
Cuadro 3. Modelos de regresión para las concentraciones y acumulaciones de micronutrimentos y sodio en tallos de petunia.
Table 3. Regression models for concentrations and accumulations of micronutrients and sodium in petunia’s stems.
Elemento
Fe
Cu
Zn
Mn
B
Na
Variable
Mejor modelo
Pr > F
R2
Concentraciónx
Fe= 115.788 + 1.379X
0.8882
0.0016
Acumulacióny
Fe= 0.228 + 0.233X
<0.0001
0.7106
Concentración
Cu= 7.125 - 9.877X + 2.101X2
0.0287
0.4467
Acumulación
Cu= 0.014 - 0.00077X0.5
0.8419
0.0032
Concentración
Zn= 38.354 - 3.861X
0.1623
0.1444
Acumulación
Zn= 0.073 + 0.113X
<0.0001
0.8351
Concentración
Mn= 31.421 - 0.719X0.5
0.8121
0.0045
Acumulación
Mn= 0.072 + 0.055X
<0.0001
0.7397
Concentración
B= 323.088 - 7.799X
0.5074
0.0345
Acumulación
B= 0.77 + 0.505X
<0.0001
0.7554
Concentración
Na= 4114.884 - 1205-559X0.5
0.0117
0.398
0.0479
0.2684
Acumulación
Na= 9.294 + 1.886X
X= representa la relación composta/suelo en el sustrato; = concentración expresada en mg kg de materia seca; = acumulación expresada en mg en tallos por planta.
x
sodio en hoja
En hojas con excepción del Cu, se observa efecto de la
relación composta/suelo en el sustrato sobre las respuestas
de concentración. Las concentraciones de Zn, Mn, B y Na se
relaciona negativamente con el valor de la relación composta/
suelo del sustrato; por el contrario, la concentración foliar de
Fe incrementa a medida que dicha relación aumenta (Figura 5).
Al igual que la concentración nutrimental en hojas,
las tendencias de acumulación muestran relación
con los tratamientos evaluados, excepto el Cu. Los
micronutrimentos Fe, Zn, Mn y B son acumulados en mayor
cantidad cuando la relación composta/suelo fue de 4. La
acumulación de Na respondió de manera inversa al valor
de la relación composta/suelo del sustrato. Es importante
destacar que el contenido foliar de Na fue superior a los
micronutrimentos evaluados, independiente de la relación
composta/suelo del sustrato (Figura 6).
-1
y
relations are shown in Table 4. In the leaves, only the
models obtained in Zn, both for concentration and
accumulation and for sodium accumulation are not
significant.
DISCUSSION
The compost increases the fertility of the substrates that
contain them since they increase the nutrient availability
(Canellas and Facanha, 2004). Sainz et al. (1998) reported
that, addition of vermicompost to the soil would increase
the nutrients content, and micronutrients concentrations
of Cu, Mn and Zn also increased in cucumber and
red clover’s stems. In broccoli, the concentrations
of micronutrients in aerial parts were significantly
increased by the increasing presence of sewage-sludge
compost in the substrate, especially for Zn (Pérez-Murcia
et al., 2006).
9
hojas (mg kg-1)
hojas (mg kg-1)
800
425
675
550
425
300
7
5
3
1
0
0.43
4
0
87
121
77
112
67
57
4
103
94
85
47
0
0.43
4
0
0.43
4
420
8.816
395
hojas (mg kg-1)
hojas (mg kg-1)
0.43
hojas (mg kg-1)
hojas (mg kg-1)
370
345
320
7.216
5.608
4.004
2.4
0
0.43
4
0
0.43
4
Figura 5. Respuesta de concentración de micronutrimentos y sodio en hojas de petunia. Relaciones composta/suelo: T1= 0 (0%
Figure 5. Response of micronutrients and sodium concentration in petunia’s leaves. Compost/soil relation: T1= 0 (0% compost/100%
0.025
3.2
0.02
2.3
1.4
0.5
Acumulación de Zn
(mg hojas-1 planta-1)
Acumulación de Cu
4.1
0.01
0.005
0
0.43
4
0
0.43
4
0.25
0.46
0.23
0.4
0.21
0.19
0.17
0
0.43
0.34
0.28
0.22
4
1.45
Acumulación de Na
Acumulación de B
0
0.43
4
17.5
1.7
1.2
0.95
0.7
0.015
Acumulación de Mn
Acumulación de Fe
0
0.43
4
15.5
13.5
11.5
0
0.43
4
Figura 6. Respuesta de acumulación de micronutrimentos y sodio en hojas de petunia. Relaciones composta/suelo: T1= 0 (0%
Figure 6. Response of micronutrients and sodium concentration in petunia’s leaves. Compost/soil relation: T1= 0 (0% compost/100%
Los mejores modelos seleccionados para las variables
concentración y acumulación de nutrimentos y sodio
en hojas de petunia, establecidas en sustratos con
distintas relaciones composta/suelo, se presentan en
el Cuadro 4. En hojas, sólo los modelos obtenidos en
Zn, tanto para concentración como acumulación y el
correspondiente a acumulación de sodio, no fueron
significativos.
In this paper, the response curves show that the amount of
compost added to the substrate is positively correlated with
the concentrations of Fe and Zn in roots (Figure 1) and with
the Fe in the stems (Figure 3), meanwhile, in the leaves, this
correlation is presented with the concentration of Fe (Figure
5). In petunia, with the addition of 60% of vermicompost
to the substrate, the highest concentrations of Fe, Zn and
Cu in the stems were obtained (Pérez-Murcia et al., 2006).
427
Cuadro 4. Modelos de regresión para las concentraciones y acumulaciones de micronutrimentos y sodio en hojas de petunia.
Table 4. Regression models for concentrations and accumulations of micronutrients and sodium in petunia’s leaves.
Elemento
Fe
Cu
Zn
Mn
B
Na
Variable
Concentraciónx
Acumulacióny
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Concentración
Acumulación
Mejor modelo
Fe= 325.088 + 239.331X0.5
Fe= 0.465 + 1.737X0.5
Cu= 8.376 - 16.053X + 3.771X2
Cu= 0.0177 - 0.031X - 0.0082X2
Zn= 86.575 - 9.807X
Zn= 0.176 + 0.148X - 0.033X2
Mn= 119.704 - 71.129X + 15.727X2
Mn= 0.234 + 0.052X
B= 401.543 - 40.325X0.5
B= 0.788 + 0.428X0.5
Na= 8809.698 - 8624.159X + 1761.214X2
Na= 16.553 - 2.043X0.5
Pr > F
0.0028
<0.0001
0.0055
0.041
0.1048
0.7737
0.0219
0.0121
0.0349
0.0093
0.0027
0.381
R2
0.5107
0.7312
0.5802
0.4129
0.1895
0.0419
0.471
0.3948
0.299
0.4173
0.6265
0.0595
X= representa la relación composta/suelo en el sustrato; x= concentración expresada en mg kg-1 de materia seca; y= acumulación expresada en mg en hojas por planta.
DISCUSIÓN
Las compostas incrementan la fertilidad de los sustratos que
las contienen, debido que éstas aumentan la disponibilidad
nutrimental (Canellas y Facanha, 2004). Sainz et al.
(1998) reportaron que la adición de vermicomposta al
suelo incrementó los contenidos de nutrimentos, y las
concentraciones de los micronutrimentos Cu, Mn y Zn
también aumentaron en vástagos de pepino y trébol rojo.
En brócoli, la concentración de micronutrimentos en parte
aérea se incrementó de manera significativa, con el aumento
de la cantidad de composta derivada de lodos residuales en
el sustrato, en particular de Zn (Pérez-Murcia et al., 2006).
En esta investigación, las curvas respuesta muestran que la
cantidad de composta adicionada al sustrato se correlaciona
en forma positiva con las concentraciones de Fe y Zn en
raíces (Figura 1), y con el Fe en tallo (Figura 3), en tanto que
en hojas esta correlación se presentó con la concentración
de Fe (Figura 5). En petunia, con la adición de 60% de
vermicomposta al sustrato se obtuvieron las mayores
concentraciones de Fe, Zn y Cu en vástago (Pérez-Murcia
et al., 2006).
Las concentraciones de Fe y B obtenidas en hojas (Figura
5), son muy superiores a los intervalos establecidos por
Mills y Jones (1996) para esta especie (84 a 168 y 18 a 43
mg kg-1 de materia seca, respectivamente). Lo anterior, es
independiente a la proporción de composta adicionada al
The concentrations of Fe and B obtained in the leaves
(Figure 5) are well above the ranges established by Mills
and Jones (1996) for this species (84 to 168 and 18 to 43
mg kg-1 of dry matter, respectively). This is independent
of the proportion of compost added to the substrate. On the
contrary, the concentrations of Cu, Zn and Mn in plants
growing in the three substrates tested (Figure 1, 3 and 5),
are within the optimum ranges (3 to 19, 33 to 85 and 44 to
177 mg kg-1 of dry matter, respectively) reported by Mills
and Jones (1996).
With regard to sodium, the concentration in plants
established in the substrate with a compost /soil relation of
4, it’s outside the range of proficiency, which ranges from
3 067 to 10 890 mg kg-1 of dry matter, respectively. The
concentration obtained of Na in the plant tissue deserves
special attention over the organs evaluated, this, decrease
as the concentration of compost in the substrate increases.
Pérez-Murcia et al. (2006) indicated that, the proportion of
compost in the final substrate it’s quite important in order
to minimize potential risks, especially salinity.
Coincident with this statement, Lakhdar et al. (2008)
demonstrated that, the addition of compost to the soil
decreases the negative effects of salinity on growth.
Similarly, the accumulation of Na in petunia’s leaves
(Figure 6) decreases as the proportion of compost in the
substrate increases. However, if we analyze the results of
accumulation of this element between organs, it’s observed
that, the content of Na in the roots and stems is lower than
sustrato. Por el contrario las concentraciones de Cu, Zn y Mn
en plantas creciendo en los tres sustratos evaluados (Figura 1,
3 y 5), se encuentran dentro de los intervalos óptimos (3 a 19,
33 a 85 y 44 a 177 mg kg-1 de materia seca, respectivamente)
reportados por Mills y Jones (1996).
Respecto al sodio, la concentración obtenida en plantas
establecidas en el sustrato con una relación composta/
suelo de 4, se encuentra fuera del intervalo de suficiencia,
el cual oscila del 3 067 a 10 890 mg kg-1 de materia seca,
respectivamente. Las concentraciones de Na obtenidas en
tejido vegetal merecen especial atención en virtud que en
los órganos evaluados, éstas disminuyen a medida que la
concentración de composta incrementa en el sustrato. PérezMurcia et al. (2006) indica que la proporción de composta en
el sustrato final es muy importante para minimizar riesgos
potenciales, especialmente la salinidad.
Coincidente con esta afirmación, Lakhdar et al. (2008)
demuestran que la adición de composta al suelo disminuye el
efecto negativo de la salinidad sobre el crecimiento.Asimismo,
la acumulación de Na en hojas de petunia (Figura 6), decrece a
medida que la proporción de composta en el sustrato aumenta.
No obstante, si se analizan los resultados de acumulación de
este elemento entre órganos, se observa que en raíces y tallos
existen menores contenidos de Na que en hojas. Esto permite
confirmar los hallazgos de Fornes et al. (2007), quienes
reportan que la petunia es una herbácea tolerante a la salinidad
al tener la capacidad de acumular Na en láminas foliares.
En lo que a acumulaciones nutrimentales respecta, se observó
de manera general que en raíces, los mayores valores promedio
fueron registrados en plantas creciendo en el sustrato con más
alta relación composta/suelo (Figura 2). En tallos y hojas, la
tendencia de acumulación antes descrita fue observada en
Fe, Zn, Mn y B (Figuras 4 y 6). Es decir, con excepción de
Cu en tallos y hojas y del Na en hojas, las acumulaciones de
micronutrimentos in planta en petunia mostraron la misma
tendencia, incrementaron con el aumento de la relación
composta/suelo en el sustrato. Estos resultados coinciden con
los reportados por Pérez-Murcia et al. (2006) en brócoli, donde
las acumulaciones de Fe y Zn fueron más altas en plantas
creciendo en mezclas de turba con composta.
De los 18 mejores modelos seleccionados para concentración
de nutrimentos y sodio en los tres órganos evaluados, siete de
ellos no fueron significativos: Cu y Zn en raíces; Fe, Zn, Mn
y B en tallos; y Zn en hojas. Los modelos significativos en
raíces presentaron coeficientes de determinación (R2) entre
in the leaves. This confirms the findings of Fornes et al.
(2007), who reported that, the petunia is a salt-tolerant
herbaceous, having the ability to accumulate Na in the
leaf blades.
Regarding the nutrient accumulation, it was observed
overall that, in the roots the highest average values were
recorded in the plants growing on the substrate with the
highest compost/soil relation (Figure 2). In the stems
and leaves, the above described accumulation tendency
was observed in Fe, Zn, Mn and B (Figures 4 and 6). I. e.,
except for Cu in the stems and leaves and Na in the leaves,
accumulations of micronutrients in planta in petunia
showed the same trend, they increased as the compost/
soil relation did in the substrate. These results agree with
those reported by Pérez-Murcia et al. (2006) in broccoli,
where the accumulations of Fe and Zn were higher in
plants growing in mixtures of peat moss with compost.
Out of the 18th best models selected for the concentration
of nutrients and sodium in the three organs tested, seven
were not significant: Cu and Zn in roots, Fe, Zn, Mn and
B in stems, and Zn in the leaves. The significant models
in the roots showed coefficients of determination (R2)
between 0.3255 and 0.5955, resulting particularly low for
Fe, B and Na (Table 2). In the stems, only models of Cu and
Na were significant with R2 values of 0.4467 and 0.3980,
respectively (Table 3). In the leaves only the concentration
model of Zn was not significant (Table 4).
In assessing the effect of nutrient management and
application of nematicide on the nutrimental state of potato
(variety Tollocan); Estañol-Botello et al. (2005) reported
a significant regression model for nutrients concentration
with R2 values between 0.35 and 0.76. Meanwhile, Bres and
Jerzy (2008) in assessing the influence of solar radiation
on nutrition of chrysanthemum, reported R2 values for
concentrations of Fe, Cu and B of 0.3991, 0.5187 and 0.4816,
respectively.
Three out of the 18th best accumulation models of nutrients
in the three organs tested were not significant: Cu in stems,
Zn and Na in the leaves (Tables 2, 3 and 4). In general, the
coefficients of determination obtained in the accumulation
models were higher than those obtained in the concentration
models, since it reached values up to 0.8351 in the stems.
In this context, R 2 results indicate that variability in
the accumulation of nutrients and sodium in petunia is
explained better by the compost/soil relation than by the
429
0.3255 y 0.5955, resultando particularmente bajos para Fe, B
y Na (Cuadro 2). En tallos, sólo los modelos de concentración
de Cu y Na fueron significativos con valores de R2 de 0.4467 y
0.3980, respectivamente (Cuadro 3). En hojas sólo el modelo
de concentración de Zn no fue significativo (Cuadro 4).
nutrient concentration. This means that there are other
variables that modify the nutrient concentration, in addition
to the compost/substrate relation, which can modify and
explain the variability of such concentration.
Al evaluar el efecto del manejo nutrimental y la aplicación de
nematicida sobre el estado nutrimental de tubérculos de papa
variedad Tollocan, Estañol-Botello et al. (2005), reportan
modelos de regresión significativos para concentraciones
nutrimentales con valores de R2 entre 0.35 y 0.76. Por su
parte, Bres y Jerzy (2008) al evaluar la influencia de la
radiación solar sobre la nutrición de crisantemo, reportaron
valores de R2 para concentración de Fe, Cu y B de 0.3991,
0.5187 y 0.4816, respectivamente.
CONCLUSIONS
Tres de los 18 mejores modelos de acumulación de nutrimentos
en los tres órganos evaluados fueron no significativos: Cu
en tallos, Zn y Na en hojas (Cuadros 2, 3 y 4). De manera
general, los coeficientes de determinación obtenidos en los
modelos de acumulación, fueron superiores a los obtenidos en
los modelos de concentración, pues se alcanzaron valores de
hasta 0.8351 en tallos. En este contexto, los resultados de R2
indican que la variabilidad en la acumulación de nutrimentos
y sodio en petunia, es explicada en mayor medida por la
relación composta/sustrato que la concentración nutrimental.
Esto significa que existen otras variables que modifican la
concentración nutrimental, adicionales a la relación composta/
sustrato, las cuales pueden modificar y explicar la variabilidad
de dicha concentración.
CONCLUSIONES
La composta adicionada al sustrato de crecimiento de
petunias incrementa la acumulación de micronutrimentos
en raíces, tallos y hojas. Por el contrario, disminuye
la acumulación de Na en hojas, elemento que en altas
concentraciones puede resultar tóxico para los cultivos.
AGRADECIMIENTOS
Los autores(as) agradecen a la línea prioritaria de investigación
4. Agronegocios, agroecoturismo y arquitectura del paisaje
del Colegio de Postgraduados en Ciencias Agrícolas el apoyo
para la realización de esta investigación.
Compost added to the substrate growth of petunia increases
the accumulation of micronutrients in the roots, stems and
leaves. On the contrary, Na accumulation in leaves decreases
an element which in high concentrations may be toxic to
the crop itself.
LITERATURA CITADA
Alcántar, G. G. y Sandoval, V. M. 1999. Manual de análisis
químico de tejido vegetal. Publicación especial.
Núm. 10. SMCS. Chapingo, México. 150 p.
Bres, W. and Jerzy, M. 2008. Changes of nutrient
concentration in chrysanthemum leaves under
influence of solar radiation. Agron. Res. 6(2):435444.
Canellas, L. P. and Facanha, A. R. 2004. Chemical nature of
soil humified fractions and their bioactivity. Pesq.
Agropec. Bras. 39(3):233-240.
Ekling, Y.; Ramert, B. and Wivstad, M. 2001. Evaluation
of growing media containing farmyard manure
compost, household waste compost or chicken
manure for the propagation of lettuce (Lactuca
sativa L.) transplants. Biol. Agric. Hort.
19(2):157-181.
Estañol-Botello, E.; Rodríguez-Mendoza, M. N.; VolkeHaller, V. H., Zavaleta-Mejía, E.; Sánchez-García, P.
y Peña-Valdivia, C. 2005. Estudio preliminar sobre
manejo nutrimental y aplicación de nematicida para
el control de la infección por nematodos en papa.
Terra Latinoamericana. 23(4):477-485.
Fornes, F.; Belda, R. M.; Carrión, C.; Noriega, V.; GarcíaAgustín, P. and Abad, M. 2007. Pre-conditioning
ornamental plants to drought by means of saline
water irrigation as related to salinity tolerance. Sci.
Hortic. 113(1):52-59.
García-Albarado, J. C.; Trejo-Téllez, L. I.; VelásquezHernández, M. A.; Ruiz-Bello, A. y Gómez-Merino,
F. C. 2010. Crecimiento de petunia en respuesta a
diferentes proporciones de composta en sustrato.
Revista Chapingo. Serie Horticultura 16(2):107-113.
Handreck, K. and Black, N. 2002. Growing media for
ornamental plants and turf. UNSW Press. Sidney,
Australia. 534 p.
He, Z.; Yang, X.; Kahn, B. A.; Stofella, P. J. and Calvert,
D. V. 2001. Plant nutrition benefits of phosphorus,
potassium, calcium, magnesium and micronutrients
from compost utilization. In: compost utilization in
horticultural cropping systems. Stofella, P. J. and
Kahn, B. A. (eds.). Lewis Publishers, Boca Ratón,
FL. 307-320 pp.
Lakhdar, A.; Hafsi, C.; Rabhi, M.; Debez, A.; Montemurro,
F.; Abdelly, C.; Jedidi, N. and Ouerghi, Z. 2008.
Application of municipal solid waste compost reduces
the negative effects of saline water in Hordeum
maritimum L. Bioresour. Technol. 99(15):7160-7167.
Mills, H. A. and Jones, J. B. 1996. Plant analysis handbook
II. MicroMacro Publishing. Athens, Ga. 422 p.
Moldes, A.; Cendón, Y. and Barral, M. T. 2007. Evaluation
of municipal solid waste compost as a plant growing
media component, by applying mixture design.
Bioresour. Technol. 98(16):3069-3075.
Pérez-Murcia, M. D.; Moral, R.; Moreno-Caselles, J.;
Perez-Espinosa, A. and Paredes, C. 2006. Use of
composted sewage sludge in growth media for
broccoli. Bioresour. Technol. 97(1):123-130.
Provin, T. L.; Wright, A. L.; Hons, F. M.; Zuberer, D.
A. and White, R. H. 2008. Seasonal dynamics
of soil micronutrients in compost-amended
bermudadagrass turf. Bioresour. Technol.
99(7):2672-2679.
Sainz, M. J.; Taboada-Castro, M. T. and Vilariño, A.
1998. Growth, mineral nutrition and mycorrhizal
colonization of red clover and cucumber plants
grown in a soil amended with composted urban
wastes. Plant Soil. 205(1):85-92.
Vendrame, W. A. and Maguire, I. 2005. Growth of
selected bedding plants as affected by different
compost percentages. Proc. Fla. State Hort. Soc.
118:368-371.
IDENTIFICACIÓN DE ESPECIES DE Pythium AISLADAS
DE PLANTAS ORNAMENTALES*
IDENTIFICATION OF Pythium SPECIES ISOLATED
FROM ORNAMENTAL PLANTS
Marlene Díaz-Celaya1, Gerardo Rodríguez-Alvarado1, Hilda Victoria Silva-Rojas2, Martha Elena Pedraza-Santos3, Rafael
Salgado-Garciglia4 y Sylvia Patricia Fernández-Pavía1§
Universidad Michoacana de San Nicolás de Hidalgo. Carretera Morelia-Zinapécuaro, km 9.5. Tarímbaro, Michoacán, México. C. P. 58880. Tel. 01 443 2958323 y
2958324. ([email protected]), ([email protected]). 2Producción de Semillas. Colegio de Postgraduados. Carretera México-Texcoco, km 36.5. Montecillo,
Estado de México. C. P. 56230. Tel. 01 555 8045900. ([email protected]). 3Facultad de Agrobiología. Universidad Michoacana de San Nicolás de Hidalgo. Paseo
Lázaro Cárdenas esq. Berlín. Colonia Viveros, Uruapan, Michoacán, México. C. P. 60090. Tel. 01 452 5236474. ([email protected]). 4Instituto de Investigaciones
Químico-Biológicas. Universidad Michoacana de San Nicolás de Hidalgo. Ciudad Universitaria. Morelia, Michoacán, México. C. P. 58060, Tel. 01 443 3265788. (rafael.
[email protected]). §Autora para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
El uso de plantas ornamentales como elementos decorativos
en jardines e interiores, ha tomado gran importancia en todo
el mundo. Sin embargo, uno de los principales problemas
en la producción de estas plantas en vivero es el inadecuado
manejo fitosanitario, que ocasiona enfermedades causadas
por Pythium spp. que afecten todas las etapas del ciclo
de producción, ya que el patógeno es capaz de sobrevivir
en agua, residuos de plantas y suelo. Debido al auge del
cultivo de plantas ornamentales en vivero y a las pérdidas
económicas producidas por patógenos vegetales, se han
realizado estudios en diferentes viveros a nivel mundial,
para detectar la presencia de estos; no obstante, en México
los trabajos que existen son muy escasos. El objetivo de
este estudio fue detectar e identificar especies de Pythium
en muestras de tejido enfermo y en la rizosfera del suelo,
procedentes de viveros ubicados en Morelia, Tarímbaro
y Uruapan en el estado de Michoacán, mediante la
caracterización morfológica y molecular. El estudio se
realizó durante los años 2008 y 2009. Dieciocho aislamientos
fueron obtenidos a partir de 17 hospederos, de los cuales
The use of ornamental plants as decoration in gardens
and interiors has become worldwide quite important.
However, one of the main problems in the production of
these plants in the nursery is the inadequate phytosanitary
handling, allowing diseases caused by Pythium spp. to
affect all stages of production due that the pathogen can
survive in water, plant residues and soil. With the rise of
ornamental plants culture in nurseries and economic losses
caused by plant pathogens, studies have been conducted
in different nurseries around the world for detecting its
presence; however, in Mexico there are only very few
papers related to this matter. The aim of this study was to
detect and identify Pythium species in samples of diseased
tissues and soil’s rhizosphere from nurseries located in
Morelia, Tarimbaro and Uruapan in Michoacan State, by
morphological and molecular characterization. The study
was conducted in 2008 and 2009. Eighteen isolates were
obtained from 17 hosts and 14 of them were pathogenic
on cucumber. Thirteen isolates were characterized
based on the sequences of the ITS region of rDNA and
* Recibido: junio de 2011
14 fueron patogénicos en pepino. Trece aislamientos se
caracterizaron en base a las secuencias de la región ITS
del ADNr y a las características morfológicas; las especies
de Pythium identificadas fueron: un aislamiento con P.
aphanidermatum, tres de P. cylindrosporum, uno con P.
dissotocum, dos de P. irregulare, tres con P. splendens, dos
de P. ultimum var. ultimum y uno con Pythium sp. nov.
Palabras clave: oomicete, patógeno, vivero.
INTRODUCCIÓN
El género Pythium consta de más de 120 especies (Dick,
1990), que se encuentran ampliamente distribuidas en
todo el mundo. Pythium puede vivir como saprófito
sobre restos de plantas muertas o puede ser patógeno. En
sistemas de producción tales como invernaderos, viveros,
campos agrícolas y bosques ocasiona pudrición de semillas,
ahogamiento de plántulas, pudrición de raíces, frutos y otros
órganos vegetales que se encuentran en contacto con el suelo
(MacDonald et al., 1994; Agrios, 2005). También se asocia
con una reducción en el vigor de plantas adultas, ya que
daña la raíz; pero generalmente no las mata (Martin, 2009).
Este oomicete puede ser introducido en viveros, establecerse
ahí, dispersarse e infectar plantas susceptibles, un número
pequeño de plantas infectadas genera una gran cantidad
de propágulos (MacDonald et al., 1994). Debido a las
pérdidas económicas producidas por patógenos en plantas
ornamentales en vivero, se han realizado estudios a nivel
mundial para detectarlos y se han identificado varias especies
de Pythium causando daños, entre las que se encuentran: P.
aphanidermatum, P. cylindrosporum, P. intermedium, P.
irregulare, P. pachycaule, P. paroecandrum, P. spinosum,
P. splendens, P. sylvaticum, P. ultimum var. ultimum y
P. vexans (Duff, 1993; Tello et al., 1995; Al-Sa’di et al.,
2007), en agua de riego se ha identificado P. dissotocum,
P. porphyrae, P. sulcatum y P. torulosum, (Kong et al.,
2004). Los estudios sobre Pythium son escasos, a diferencia
del taxón Phytophthora (perteneciente también a la familia
Pythiaceae) que destruye una gran cantidad de plantas.
La identificación de especies del género Pythium está basada
en características morfológicas, como forma y tamaño de
los esporangios, tamaño y ornamentación del oogonio, el
número de anteridios y la forma en que están unidos (Van
der Plaats-Niterink, 1981; Martin, 2009). La gran variación
Marlene Díaz-Celaya et al.
morphological characteristics; identified Pythium species
were: one isolation with P. aphanidermatum, three of P.
cylindrosporum, one with P. dissotocum, two of P. irregulare,
three with P. splendens, two of P. ultimum var. ultimum and
one with Pythium sp. nov.
Key words: nursery, oomycete, pathogen.
INTRODUCTION
The Pythium genus comprises more than 120 species
(Dick, 1990), which are widely distributed throughout
the world. Pythium can live as a saprophyte on dead plant
debris and it can be pathogenic. In production systems
such as greenhouses, nurseries, agricultural fields and
forests, it causes seed rot, seedling damping off, root rot,
fruit rot and other plant organs that are in contact with
the soil (MacDonald et al., 1994; Agrios, 2005). It is also
associated with a reduction in the vigor of mature plants,
damaging the roots; but usually it does not kill them
(Martin, 2009).
This oomycete can be introduced into nurseries, settle
there, then spread and infect susceptible plants, a small
number of infected plants generate a large number of
propagules (MacDonald et al., 1994). Due to economic
losses caused by pathogens on ornamental plants in
nurseries, studies have been performed worldwide in
order to detect them and several species of Pythium have
been identified causing damage, among which there are:
P. aphanidermatum, P. cylindrosporum, P. intermedium, P.
irregulare, P. pachycaule, P. paroecandrum, P. spinosum,
P. splendens, P. sylvaticum, P. ultimum var. ultimum and
P. vexans (Duff, 1993; Tello et al., 1995; Al-Sa’di et al.,
2007), in irrigation water P. dissotocum, P. porphyrae, P.
sulcatum and P. torulosum have been identified (Kong
et al., 2004). Studies about Pythium are limited, unlike
Phytophthora taxon (also belonging to the Pythiaceae
family) which destroys a large number of plants.
The identification of species of the Pythium genus is based
on morphological characteristics, such as the shape and
size of sporangia, size and ornamentation of oogonium,
the antheridia number and the manner in which they are
attached (Van der Plaats-Niterink, 1981; Martin, 2009).
The great morphological variation within the genre and the
fact that these features are shared between species, as well
Identificación de especies de Pythium aisladas de plantas ornamentales
de características morfológicas dentro del género y el
hecho de que estas características son compartidas entre
especies, así como la ausencia de estructuras que permitan la
identificación de ciertas especies o aislamientos, dificulta en
gran medida la identificación de este oomicete; por lo tanto,
la caracterización morfológica debe complementarse con la
identificación molecular. El análisis de las secuencias ITS1,
5.8S e ITS2 del ADN ribosomal (ADNr) ayuda a simplificar
la clasificación de los aislamientos a nivel de especie.
Dicha región del ADNr es la más usada en estudios del
género Pythium, ya que presenta gran variabilidad y existe la
disponibilidad de iniciadores desarrollados por White et al.
(1990) para su amplificación mediante la técnica de PCR. El
uso de caracteres moleculares es especialmente importante,
para aislamientos que no forman estructuras como oosporas
y por lo tanto, no pueden ser clasificados morfológicamente
a nivel de especie. Algunos estudios han demostrado que el
tamaño de la región ITS del ADNr varía de 750-1050 pb,
lo cual indica que es mayor que en hongos 300-700 pb, que
provee de un número mayor de caracteres para su análisis
(Lévesque y De Cock, 2004).
Aunque existen estudios acerca de la diversidad de especies
de Pythium en viveros de algunos países del mundo, en
México no hay reportes acerca de la presencia este oomicete
en viveros ornamentales. Por lo que el objetivo de este estudio
fue detectar e identificar especies de Pythium en muestras
de tejido enfermo y la rizosfera del suelo procedentes de
viveros ubicados en Morelia, Tarímbaro y Uruapan en el
estado de Michoacán.
Colecta de muestras
Se obtuvieron muestras de suelo y tejido enfermo de 25
géneros de plantas ornamentales con síntomas de marchitez
de ocho viveros de los municipios de Morelia, Tarímbaro y
Uruapan, del estado de Michoacán.
Obtención de aislamientos a partir de tejido vegetal
Los aislamientos fueron realizados directamente de las
secciones de raíces de las plantas con síntomas. Se hicieron
cortes de tejido de 5 a 10 mm a partir del borde de la lesión,
estos se desinfestaron con una solución de hipoclorito de
433
as the absence of structures that allow the identification of
certain species or strains, seriously hampers this oomycete
identification, so that morphological characterization
must be complemented with molecular identification. The
sequence analysis of ITS1, 5.8S and ITS2 of ribosomal DNA
(rDNA) helps to simplify the classification of isolates to the
species level.
This region of rDNA is the most used in studies of the
Pythium genus, as it shows great variability and there
is the availability of primers developed by White et al.
(1990) for its amplification by the PCR technique. The
use of molecular characteristics is particularly important
for isolates that do not form structures such as oospores
and therefore they cannot be morphologically classified
at species level. Some studies have shown that, the size of
the ITS rDNA region varies from 750-1050 pb, indicating
that it’s higher than in fungus 300-700 pb, which provides
a greater number of characters for analysis (Lévesque and
De Cock, 2004).
Even though there are studies about the diversity of Pythium
species in nurseries of some countries, in Mexico there are no
reports about the oomycete presence in ornamental nurseries.
So, the aim of this study was to detect and identify Pythium
species in samples of diseased tissues and soil’s rhizosphere
from nurseries located in Morelia, Tarímbaro and Uruapan
in Michoacán State.
Sample collection
Soil and diseased tissue samples were obtained from 25
genera of ornamental plants with wilt symptoms from eight
nurseries in the municipalities of Morelia, Tarímbaro and
Uruapan, Michoacán State.
Isolates obtained from plant tissue
Isolates were made directly from root sections of plants with
symptoms. Tissue sections of 5 to 10 mm from the lesion
edge were made; these were disinfected with a sodium
hypochlorite solution (0.6%) for 30 s. Some sections were
only rinsed with tap water. Then, placed in a Petri dish with
cornmeal agar (PARN) containing: pentachloronitrobenzene
(PCNB) (0.1 g L-1), ampicillin (0.27 g L-1), rifampicin (0.01
sodio (0.6%) durante 30 s. Algunos cortes únicamente se
enjuagaron con agua. Después se colocaron en una caja Petri
con medio selectivo de harina de maíz (PARN) conteniendo:
pentacloronitrobenceno (PCNB) (0.1 g litro-1), ampicilina
(0.27 g litro-1), rifampicina (0.01 g litro-1) y natamicina
(0.02g litro-1) y en medio selectivo V8 (PARN) conteniendo:
PCNB (0.1 g litro-1), ampicilina (0.27 g litro-1), rifampicina
(0.01 g litro-1) y natamicina (0.02 g litro-1). Se incubaron a
temperatura ambiente (23 °C ±3 °C) hasta que se observó
el crecimiento de colonias.
Obtención de aislamientos a partir de suelo o sustrato
de siembra
Se tomaron muestras de la rizosfera del suelo directamente
de plantas enfermas. Se colocaron en una caja Petri 10 g de
suelo y 20 ml de agua destilada estéril, se usó como cebo
hojas completas o discos de azalea (Rhododendron indicum).
Las cajas Petri se incubaron durante 24 h a temperatura
ambiente (23 °C ±3 °C). Posteriormente los discos o las hojas
completas se desinfestaron con una solución de hipoclorito de
sodio (0.06%) durante 30 segundos. Se sembraron en medio
selectivo de harina de maíz PARN y se incubaron a temperatura
ambiente (23 °C ±3 °C), hasta que se observó el crecimiento de
colonias. Los aislamientos puros se transfirieron a medio de
cultivo de harina de maíz, a partir de los cuales se obtuvieron
cultivos de punta de hifa y se almacenaron a 15 °C en tubos
de microcentrífuga con agua destilada estéril.
Caracterización morfológica
Se realizó con los aislamientos obtenidos de punta de hifa
que crecieron en los siguientes medios: agar-zanahoria (20
g de agar, 50 g de zanahoria en cubitos, 1 000 ml de agua
destilada), V8-agar (20 g de agar, 3 g CaCo3, 160 ml de jugo
de verduras V8 Campbell’s, 840 ml de agua destilada) o en
papa dextrosa agar, se mantuvieron en obscuridad a 25 °C
hasta que se observaron estructuras. Se determinó el tipo de
esporangios, si el micelio presentaba o no hinchamientos,
presencia o ausencia de oosporas, tipo de oospora y número de
anteridios. Se realizaron mediciones de esporangios, oosporas
e hinchamientos de micelio cuando estuvieron presentes. Se
determinó si crecieron a una temperatura de 35 °C.
Extracción de ADN
Los aislamientos obtenidos que crecieron en medio líquido
de chícharo estéril; el ADN se extrajo a partir de micelio de
cada aislamiento, para lo cual se utilizó el siguiente protocolo:
g L-1) and natamycin (0.02g liter-1) and V8 selective medium
(PARN) containing: PCNB (0.1 g liter-1), ampicillin (0.27 g
liter-1), rifampin (0.01 g liter-1) and natamycin (0.02 g liter-1).
Then, they were incubated at room temperature (23 °C ± 3
°C) until colonies growth was observed.
Isolates obtained from soil or planting substrate
Samples from the soil’s rhizosphere were taken directly from
diseased plants. And then placed in a Petri dish with 10 g of
soil and 20 ml of sterile distilled water, as bait full sheets or
azalea discs were used (Rhododendron indicum). The Petri
dishes were incubated for 24 h at room temperature (23 °C
± 3 °C). Later discs or whole leaves were disinfected with
sodium hypochlorite solution (0.06%) for 30 seconds. Then
they were seeded in PARN cornmeal agar and incubated at
room temperature (23 °C ± 3 °C) until colonies growth was
observed. Pure isolates were transferred to cornmeal culture
medium, from which hyphal tip cultures were obtained
and stored at 15 °C in microcentrifuge tubes with sterile
distilled water.
Morphological characterization
This was performed with the isolates obtained from hyphae
tip that grew in the following mediums: carrot agar (20 g of
agar, 50 g diced carrot, 1 000 ml of distilled water), V8-agar
(20 g of agar, 3 g CaCO3, 160 ml Campbell’s V8 vegetable
juice, 840 ml of distilled water) or on potato dextrose agar,
they were maintained in darkness at 25 °C until structures
were observed. Sporangia type was determined, whether or
not the mycelium showed swelling, presence or absence of
oospores, oospore type and antheridia number. Sporangia,
oospores and mycelial swellings measurements were made
when present. It was also determined if they grew at 35 °C
temperature.
DNA extraction
For obtained isolates that grew in liquid medium of sterile
pea; DNA was extracted from mycelium of each isolate,
using the following protocol: each isolate that grew in pea
liquid medium, which was prepared with 120 g peas in 1
000 ml of distilled water and sterilized for 20 min at 121
°C. And then filtered through cheesecloth and diluted in
1 liter of distilled water and then sterilized once again. It
was poured in Petri dishes and incubated at 25 °C one or
two weeks to get plenty of mycelial growth. The mycelium
was rinsed with sterile distilled water in a funnel with
cada aislamiento que creció en medio líquido de chícharo,
el cual se preparó colocando120 g de chícharos en 1 000 ml
de agua destilada, este se esterilizó durante 20 min a 121 °C.
Posteriormente se filtró con manta de cielo y se aforó a 1
litro con agua destilada, y se esterilizó nuevamente. Se vació
en cajas de Petri y se incubó a 25 ºC, de una a dos semanas
para obtener abundante crecimiento micelial. El micelio se
enjuagó con agua destilada estéril en un embudo, con tela
filtrante (Miracloth). Posteriormente el micelio se envolvió
con papel filtro y papel aluminio estériles y se deshidrató
durante 24 a 48 h a 4 °C.
El micelio deshidratado se molió en un mortero estéril con
nitrógeno líquido hasta obtener un polvo fino y se transfirió a
tubos de microcentrífuga. El micelio se almacenó a -20 ºC hasta
que fue utilizado.Acada tubo con micelio molido se le agregaron
900 µl de búfer de extracción (0.05 M EDTA, 1 M Tris-HCl
pH 8, 0.5 M NaCl, 0.25% SDS, 0.75% Mercaptoetanol),
precalentado a 65 °C. Las muestras se incubaron a 65 °C
durante 1 h. Posteriormente se adicionan 450 µl de una solución
de acetato de amonio 7.5 M, se mezclaron vigorosamente
durante 5 min y se mantuvieron en hielo durante 20 min.
Los tubos se centrifugaron a 13 200 revoluciones por minuto
(rpm) durante 15 min. El sobrenadante se transfirió a un tubo
nuevo que contenía 800 µl de isopropanol, los tubos se agitaron
manualmente y se mantuvieron en hielo por 30 min. Las
muestras se centrifugaron nuevamente a 13 200 rpm durante
15 min. Los tubos se mantuvieron invertidos para drenar el
líquido, y la pastilla se secó a temperatura ambiente. La pastilla
se resuspendió en 450 µl de TE pH 7.5 y luego se agregó 1 µl
de ARNasa A (20 mg ml), se dejó toda la noche a 4 °C.
Posteriormente se agregaron a cada tubo 450 µl de cloroformo:
alcohol isoamil (24:1) y se mezcló vigorosamente durante
5 min, en seguida los tubos se centrifugaron a 13 200 rpm
durante 5 min y la fase acuosa se transfirió a un tubo nuevo.
Se agregaron 45 µl de acetato de sodio 3 M y 1 ml de etanol
100% frío, los tubos se agitaron manualmente y mantuvieron
por 1.5 h a -20 °C. Se centrifugaron los tubos a 13 200 rpm
durante 15 min. Se descartó el sobrenadante y se secó la
pastilla a temperatura ambiente. Esta se resuspendió en 100
µl de TE pH 7.5, y se dejó toda la noche a 4 °C. Las muestras
se analizaron por electroforesis, colocando 5 µl de ADN en
un gel de agarosa 1%/TAE durante 90 min a 50V.
Para amplificar la región de los espacios transcritos internos
(ITS1, 5.8S e ITS2) se utilizaron los oligonucleótidos
ITS5 (GGAAGTAAAAGTCGTAACAAGG) e ITS4
435
filter cloth (Miracloth). Subsequently, the mycelium was
wrapped with sterile filter and foils paper and dehydrated
for 24 to 48 h at 4 °C.
The dried mycelium was ground in a sterile mortar with
liquid nitrogen until a fine powder was obtained and then
transferred to microcentrifuge tubes. The mycelium was
stored at -20 °C until it was used. To each tube with ground
mycelium was added 900 µl of extraction buffer (0.05 M
EDTA, 1 M Tris-HCl pH 8, 0.5 M NaCl, 0.25% SDS, 0.75%
Mercaptoethanol), preheated at 65 °C. The samples were
incubated at 65 °C for 1 h. Subsequently 450 µl of a 7.5 M
ammonium acetate solution were added and vigorously
mixed for 5 min and kept on ice for 20 min.
The tubes were centrifuged at 13 200 revolutions per minute
(rpm) for 15 min. The supernatant was transferred to a
fresh tube containing 800 µl of isopropanol; the tubes were
shaken by hand and kept on ice for 30 min. The samples were
again centrifuged at 13 200 rpm for 15 min. The tubes were
inverted to drain the liquid and, the pellet was dried at room
temperature. The pellet was re-suspended in 450 µl of TE
pH 7.5 and then added 1 µl RNase A (20 mg ml) and it was
left overnight at 4 °C.
Subsequently to each tube 450 µl of chloroform were added:
isoamyl alcohol, (24:1) and vigorously mixed for 5 min, then
the tubes were centrifuged at 13 200 rpm for 5 min and the
aqueous phase was transferred to a fresh tube. 45 µl of 3 M
sodium acetate and 1 ml of 100% cold ethanol were added,
the tubes were manually shaken kept for 1.5 h at -20 °C.
The tubes were centrifuged at 13 200 rpm for 15 min. The
supernatant was discarded and, the pellet was dried at room
temperature. This was re-suspended in 100 µl of TE pH 7.5,
and left overnight at 4 °C. The samples were analyzed by
electrophoresis, placing 5 µl of DNA in a 1% agarose gel/
TAE for 90 min at 50 V.
In order to amplify the region of the internal transcribed
spaces (ITS1, 5.8S and ITS2), ITS5 oligonucleotides were
used (GGAAGTAAAAGTCGTAACAAGG) and ITS4
(TCCTCCGCTTATTGATATGC) (White et al., 1990),
which hybridize within the 18S rDNA and 28S rDNA
genes. The conditions used for carrying out the PCR were
as follows: 4 min at 95 °C, 34 cycles of 1 min at 95 °C, 1
min at 55 °C, 2 min at 72 °C and a final extension step at 72
°C for 10 min. The amplified fragments were analyzed by
electrophoresis on agarose gels (1.5%) in order to determine
the amplification degree.
(TCCTCCGCTTATTGATATGC) (White et al., 1990), los
cuales hibridizan dentro de los genes 18S ADNr y 28S ADNr.
Las condiciones usadas para la realización del PCR fueron las
siguientes: 4 min a 95 °C, 34 ciclos de 1 min a 95 °C, 1 min
a 55 °C, 2 min a 72 °C y un paso final de extensión a 72 °C
durante 10 min. Los fragmentos amplificados se analizaron
por electroforesis en geles de agarosa (1.5%) para determinar
el grado de amplificación.
Then they were purified with a commercial kit (Wizard
SV Gel and PCR Clean-Up System-Promega), and sent to
Macrogen Company (South Korea). The obtained sequences
were assembled and edited using BioEdit version 7.0.5 (Hall,
1999), which created a consensus sequence. This sequence
was compared with the sequences of type strains deposited in
GenBank at the National Center for Biotechnology Information
(NCBI) by using the BLASTN 2.2.19 (Zhang et al., 2000).
Después se purificaron con un kit comercial (Wizard SV
Gel and PCR Clean-Up System–Promega), y se enviaron
a la compañía Macrogen (Corea del Sur). Las secuencias
obtenidas se ensamblaron y editaron usando BioEdit
version 7.0.5 (Hall, 1999), con el cual se creó una secuencia
consenso. Esta secuencia se comparó con las secuencias de
aislamientos tipo, depositadas en el GenBank del National
Center for Biotechnology Information (NCBI) mediante la
opción BLASTN 2.2.19 (Zhang et al., 2000).
Identification of Pythium species using molecular
techniques
Identificación de especies de Pythium mediante técnicas
moleculares
Para establecer las relaciones filogenéticas entre las especies
de Pythium, las secuencias consenso obtenidas de cada
aislamiento, se compilaron en un archivo fasta y se alinearon
con el profile mode de Clustal W 1.8.1 (Thompson et al., 1994),
incluido en el programa Mega 4.0.2 (Tamura et al., 2007).
El árbol filogenético se construyó con el método de máxima
parsimonia, utilizando 836 pares de bases correspondientes
al espacio transcrito interno del ADNr, se usó la opción Close
Neighbour Interchange (CNI) search (level= 1), con un árbol
inicial con adiciones al azar (10 REPS), los gap/missing se
consideraron como delecciones completas.
In order to establish the phylogenetic relationships among
the species of Pythium, the consensus sequences obtained
from each strain were compiled in a fasta file and aligned
with the profile mode Clustal W 1.8.1 (Thompson et al., 1994),
included in the Mega program 4.0.2 (Tamura et al., 2007).
The phylogenetic tree was constructed with the maximum
parsimony method, using 836 base pairs corresponding
to the internal rDNA transcribed space, the option Close
Neighbour Interchange (CNI) search (level= 1) was used,
with an initial tree with random additions (10 REPS), the
gap/missing were considered as complete deletions.
In order to determine the values of confidence in the resulting
tree groupings, a bootstrap analysis with 1 000 random
replications was performed (Felsestein, 1985). The reference
sequences of each of the found species in this paper were
obtained from the GenBank (NCBI). Phytophthora sp.
accession number FJ217679 was assigned outside the group.
Pathogenicity tests on cucumber seedlings
Pruebas de patogenicidad en plántulas de pepino
Inoculum preparation. The grass-leaves were washed
with soap and water, which were cut into pieces about 1 cm
length and placed in test tubes with distilled water. The tubes
were sterilized for 20 min at 121 °C. The tubes with sterile
grass-blades were inoculated with mycelial disks of different
Pythium isolates. They were incubated until the mycelium
was observed, colonizing grass-leaves. This method was
used as the grass is not toxic to the inoculated plant, unlike
other culture medium used in other inoculation protocols.
Preparación del inóculo. Se usaron hojas de pasto lavadas
con agua y jabón, las cuales se cortaron en trozos de
aproximadamente 1 cm de longitud y se colocaron en tubos
de ensayo con agua destilada. Los tubos se esterilizaron
durante 20 min a 121 °C. Los tubos con las hojas de pasto
Germination of seeds. Green cucumber seeds were used
(Cucumis sativus L.) (Víta®). The seeds were washed with
sterile distilled water, then dipped in ethanol (96%) for 5
s, and rinsed again with sterile distilled water and dried
with sterile absorbent paper. The seeds were subsequently
Para determinar los valores de confianza de los agrupamientos
dentro del árbol resultante, se realizó un análisis boostrap con
1 000 repeticiones al azar (Felsestein, 1985). Las secuencias
de referencia de cada una de las especies encontradas en este
trabajo se obtuvieron del GenBank (NCBI). Phytophthora
sp. número de acceso FJ217679 se asignó fuera de grupo.
estériles se inocularon con discos de micelio de los diferentes
aislamientos de Pythium. Se incubaron hasta que se observó
al micelio colonizando las hojas de pasto. Se utilizó este
método ya que el pasto no es tóxico para la planta inoculada,
como lo puede ser el medio de cultivo que se utiliza en otros
protocolos de inoculación.
Germinación de semillas. Se usaron semillas de pepino verde
(Cucumis sativus L.) (Víta®). Las semillas se lavaron con agua
destilada estéril, enseguida se sumergieron en etanol (96%)
durante 5 s, nuevamente se enjuagaron con agua destilada
estéril y se secaron con papel absorbente estéril. Las semillas
se transfirieron posteriormente a cajas Petri estériles en las
que se colocó papel filtro estéril humedecido. Se incubaron
a 25 °C expuestas a la luz durante 6 días.
Trasplante e inoculación de las plántulas. Las plántulas
de pepino se colocaron en macetas de plástico que se
llenaron con suelo (turba/agrolita) estéril, humedecido; se
mantuvieron a 23 °C ±3 °C, expuestas a la luz. Seis días
después del trasplante se realizó la inoculación, la cual se
hizo colocando una de las hojas de pasto colonizadas por
Pythium cerca del tallo de cada plántula y se cubrió con
suelo. Después de la inoculación se regó cada plántula con
el propósito de mantener condiciones de alta humedad. Seis
plántulas por aislamiento fueron inoculadas y tres fueron
usadas como control. Durante el experimento las plántulas
se mantuvieron a temperatura ambiente (23 °C ±3 °C) y en
condiciones de alta humedad.
RESULTADOS
Obtención de aislamientos
Se obtuvieron 18 aislamientos del género Pythium a partir de
17 de las 25 plantas ornamentales muestreadas procedentes
de viveros de Morelia, todas mostrando síntomas de
marchitez (Cuadro 1). No se detectó Pythium en las plantas
de los municipios de Tarímbaro y Uruapan.
Caracterización de los aislamientos
La caracterización morfológica de los aislamientos
permitió la identificación de siete especies de Pythium: P.
aphanidermatum (Edson) Fitzp., P. cylindrosporum B. Paul,
P. dissotocum Drechsler, P. irregulare Buisman, P. ultimum
Trow var. ultimum, P. splendens Hans Braun. y Pythium sp.
437
transferred to sterile Petri dishes with moistened sterile
filter paper. Then, they were incubated at 25 °C exposed to
light for 6 days.
Seedlings transplantation and inoculation. Cucumber
seedlings were placed in plastic pots filled with wetted
sterile soil (peat/perlite) they were maintained at 23 °C ±3
°C and exposed to light. Six days after transplantation, the
inoculation was performed, which was made by placing
one of the grass-leaves colonized by Pythium, near the
stem of each seedling and covered with soil. After the
inoculation, each seedling was irrigated in order to maintain
high humidity conditions. Six seedlings per isolate were
inoculated and three were used as controls. During the
experiment, the seedlings were kept at room temperature
(23 °C ±3 °C) and in high humidity conditions.
RESULTS
Isolates collection
Eighteen isolates of the Pythium genus were obtained
from 17 out of the 25 sampled ornamental plants from
Morelia nurseries, all showing wilting signs (Table 1).
Pythium was not detected in plants of Taríbaro and Uruapan
municipalities.
Cuadro 1. Plantas ornamentales en viveros de Morelia,
donde se obtuvieron aislamientos de Pythium.
Table 1. Ornamental plants in Morelia nurseries, where
Pythium isolates were obtained.
Hospedero
Ruta graveolens
Buxus sempervirens
Cedrus sp.
Primula acaulis
Saintpaulia hybrida
Cyclamen persicum
Rhododendron indicum
Gazania rigens
Impatiens hawkeri x hybrida
Portulaca grandiflora
Santolina chamaecyparissus
Alyssum maritimum
Gerbera sp.
Síntomas Año de colecta
Marchitez
2008
Marchitez
2009
Marchitez
2008
Marchitez
2008
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
Marchitez
2009
nov. Detectándose más de una especie en todos los viveros.
La identificación morfológica se confirmó mediante la
secuenciación de las regiones ITS1, 5.8S e ITS2 delADNr (Van
der Plaats-Niterink, 1981; Lévesque y De Cock, 2004; McLeod
et al., 2009) (Cuadro 2). Las características morfológicas
observadas se muestran en el Cuadro 3 y en la Figura 1. Se
detectaron tanto especies homotálicas como heterotálicas.
Cuadro 2. Especies de Pythium identificadas.
Table 2. Pythium species identified.
Especies
P. irregulare
P. splendens
P. splendens
P. irregulare
Pythium sp. nov.
P. cylindrosporum
P. splendens
P. dissotocum
P. cylindrosporum
P. cylindrosporum
P. ultimum var. ultimum
P. ultimum var. ultimum
P. aphanidermatum
BLAST (%) de similitud
99
99
99
99
99
100
100
100
100
100
100
99
Characterization of isolates
Morphological characterization of the isolates allowed the
identification of seven Pythium species: P. aphanidermatum
(Edson) Fitzp., P. cylindrosporum B. Paul, P. dissotocum
Drechsler, P. irregulare Buisman, P. ultimum Trow var.
ultimum, P. splendens Hans Braun. and Pythium sp. nov.
Detecting more than one species in all the nurseries. The
morphological identification was confirmed by sequencing
the ITS1, 5.8S and ITS2 rDNA regions (Van der PlaatsNiterink, 1981; Lévesque and De Cock, 2004; McLeod et al.,
2009) (Table 2). Observed morphological characteristics are
shown in Table 3 and Figure 1. Heterothallic and homothallic
species were detected.
The phylogenetic position of species within the Pythium
genus is shown in Figure 2, the tree was constructed with
sequences corresponding to the internal transcribed space
(ITS) of rDNA, using the maximum parsimony method.
Pathogenicity tests
Fourteen out of the 18 isolates obtained in this paper were
pathogenic on cucumber, drowning symptoms in seedlings
occurred between two and nine days after inoculation. The
controls had no symptoms.
Cuadro 3. Características morfológicas observadas en los aislamientos de Pythium.
Table 3. Morphological characteristics observed in Pythium isolates.
Especie
Pythium splendens
Pythium
cylindrosporum
Pythium ultimum var.
ultimum
Pythium
aphanidermatum
Pythium dissotocum
Pythium sp. nov.
P. irregulare
Características morfológicas
Heterotálicos. No se observaron esporangios. Hinchamientos en el micelio abundantes y globosos,
con un diámetro de 37.5-40 µm∗37.5-40 µm, generalmente terminales, raramente intercalares.
No crecieron a 35 °C.
Homotálicos. Oogonios globosos, terminales, con un diámetro de 17.5-20 µm∗15-17.5 µm.
Oosporas apleróticas. Un anteridio por oogonio. No crecieron a 35 °C.
Homotálicos. Hinchamientos en el micelio globosos, terminales de 20-25 µm∗20-25 µm de
diámetro. Oogonios terminales e intercalares de 22.5-25 µm∗22.5-25 µm de diámetro. Uno o dos
anteridios por oogonio. Oosporas apleróticas. Solamente un aislamiento creció a 35 °C.
Homotálicos. Esporangios lobulados, formados en medio papa-dextrosa-agar. Oogonios
terminales, globosos con un diámetro de 25-27.5 µm∗25-27.5 µm. Un anteridio por oogonio.
Oosporas apleróticas. Si creció a 35 °C.
Homotálicos. Esporangios lobulados. Apresorios cilíndricos. No creció a 35 °C.
Homotálicos. Hinchamientos en el micelio intercalares, globosos, con un diámetro de 22.5 µm
a 25 µm. Oogonios globosos, algunos irregulares, terminales e intercalares, con un diámetro de
20-25 µm∗20-25 µm. Uno o dos anteridios por oogonio. Oosporas apleróticas. No creció a 35 °C.
Homotálicos. Hinchamientos en el micelio intercalares, globosos, con un diámetro de hasta 25µm.
Oogonios globosos, algunos irregulares, terminales e intercalares, con un diámetro de 22.5-25
µm∗22.5-25 µm. Uno o dos anteridios por oogonio. Oosporas apleróticas. No creció a 35 °C.
A)
B)
C)
439
AY598634. Pythium dissotocum
D)
25
86
99
h
o
a
E)
FJ415905. Pythium myriotylum
FJ415903. Pythium periilum
PV-26. Pythium aphanidermatum
99 FJ415896. Pythium aphanidermatum
50
F)
PV-18. Pythium dissotocum
99
G)
99
PV-21. Pythium ultimum
PV-25. Pythium ultimum
AY598657. Pythium ultimum
98
FJ415953. Pythium splendens
PV-5. Pythium splendens
99
92 PV-4. Pythium splendens
74 PV-17. Pythium splendens
AY598643. Pythium cylindrosporum
Figura 1. Estructuras de especies pertenecientes al género
Pythium. A) P. irregulare, a= anteridio; o= oogonio
40X. B) P. ultimum var. Ultimum, anteridio y oogonio
40X. C) P. splendens, h= hinchamientos de micelio
40X. D) y E) P. aphanidermatum anteridio y oogonio,
e= esporangios 40X. F) P. cylindrosporum anteridio
y oogonio 40X. G) P. dissotocum, esporangios 40X.
Figure 1. Structures of belonging species to Pythium genus. A)
P. irregulare, a= antheridium; o= oogonium 40X. B) P.
ultimum var. Ultimum, antheridium and oogonium 40X.
C) P. splendens, h= 40X mycelial swellings. D); and
E) P. aphanidermatum antheridium and oogonium, e=
sporangia 40X. F) P. cylindrosporum antheridium and
oogonium 40X. G) P. dissotocum, sporangia 40X.
La posición filogenética de las especies dentro del género
Pythium se muestra en la Figura 2, el árbol fue construido
con secuencias correspondientes al espacio transcrito interno
(ITS) del ADNr usando el método de máxima parsimonia.
Pruebas de patogenicidad
Catorce de los 18 aislamientos obtenidos en este estudio
fueron patogénicos en pepino, los síntomas de ahogamiento
en las plántulas se presentaron entre dos y nueve días después
de la inoculación. Los testigos no presentaron síntomas.
DISCUSIÓN
Los problemas fitosanitarios que ocasionan enfermedades
en viveros dedicados a la producción y venta de plantas
ornamentales, no son tratados en la mayoría de las ocasiones
debido a la falta de conocimiento acerca de la identidad de
los patógenos que las ocasionan. Por esto, el presente trabajo
constituye un avance importante debido que se identificaron
89 PV-13. Pythium cylindrosporum
PV-20. Pythium cylindrosporum
97
PV-19. Pythium cylindrosporum
99
AY598702. Pythium irregulare
AY598704. Pythium irregulare
97
PV-8. Pythium sp.*
FJ217679. Phytophthora sp.
20
Figura 2. Árbol filogenético de Pythium detectadas en viveros.
Las secuencias obtenidas se compararon con los
aislamientos del Gen Bank de NCBI (códigos
AY y FJ). Se utilizó la secuencia FJ217679 de
Phytophthora sp.
Figure 2. Phylogenetic tree of Pythium detected in nurseries.
The sequences obtained were compared to the
isolates from NCBI GenBank (AY and LF codes).
The FJ217679 sequence of Phytophthora sp. was
used.
DISCUSSION
Plant health problems that cause diseases in nurseries
dedicated to the production and sale of ornamental plants
are not treated in most cases due to lack of knowledge
about the identity of the pathogens. Therefore, this
paper is an important advance because seven species of
Pythium were identified, causing wilt symptoms in 17
species of ornamental plants in nurseries of Morelia,
Michoacán.
In Mexico there are few reports about diseases caused by
oomycetes in nurseries. There are reports of pathogens
that cause damage to ornamental plants in nurseries
from around the world, among which are those caused
by Pythium oomycetes (Duff, 1993; Tello et al., 1995;
siete especies de Pythium, ocasionando síntomas de
marchitez en 17 especies de plantas ornamentales en viveros
de Morelia, Michoacán.
Kong et al., 2004; Al-Sa’di et al., 2007) and Phytophthora
(Warfield et al., 2008; Moralejo et al., 2009; Yakabe et
al., 2009).
En México son escasos los reportes acerca de enfermedades
causadas por oomicetes en viveros. Existen reportes de
patógenos que causan daños en plantas ornamentales en
viveros de diferentes partes del mundo, entre los que se
encuentran los ocasionados por los oomicetes Pythium
(Duff, 1993; Tello et al., 1995; Kong et al., 2004; Al-Sa’di
et al., 2007) y Phytophthora (Warfield et al., 2008; Moralejo
et al., 2009; Yakabe et al., 2009).
Since Pythium can be found as a saprophyte, pathogenicity
tests have been designed using cucumber seedlings as
bait, in order to evaluate the infectivity of Pythium
isolates (Sánchez et al., 2001; Sánchez and Gallego,
2002). This pathogenicity test in cucumber seedlings was
very effective as it allowed us to select 14 pathogenic
isolates of 18 Pythium isolates obtained from
four nurseries in Morelia, Michoacán. This is indicative
of major phytosanitary problem caused by this pathogen
in the mass production of plants. The broad host
range of this oomycete was also detected, having been
isolated from different ornamental plants. From the
ornamental plants analyzed, only the Rhododendron
genus had been reported worldwide as a Pythium host
(Ho, 1986).
Debido a que Pythium puede encontrarse como saprófito,
se han diseñado pruebas de patogenicidad en las cuales se
utilizan plántulas de pepino como cebos, para la evaluación
del potencial infeccioso de aislamientos de Pythium
(Sánchez et al., 2001; Sánchez y Gallego, 2002). Esta
prueba de patogenicidad en plántulas de pepino resultó
muy efectiva, ya que permitió seleccionar 14 aislamientos
patogénicos de los 18 aislamientos de Pythium, obtenidos
de cuatro viveros de Morelia, Michoacán. Esto es indicativo
del gran problema fitosanitario que ocasiona este patógeno
en la producción masiva de plantas. Asimismo, se detectó
el amplio rango de hospedantes que tiene este oomicete,
al haberse aislado de diferentes plantas ornamentales. De
las plantas ornamentales analizadas únicamente el género
Rhododendron, había sido previamente reportado a nivel
mundial como hospedante de Pythium (Ho, 1986).
La identificación morfológica de los aislamientos se confirmó
con las secuencias de las regiones ITS1, 5.8S e ITS2 del
ADNr, se identificaron siete especies: P. aphanidermatum,
P. cylindrosporum, P. dissotocum, P. ultimum var. ultimum,
P. irregulare, P. splendens y Pythium sp. nov. Es importante
mencionar que las secuencias obtenidas se compararon
con las secuencias de los aislamientos tipo. Se menciona
esto porque existen secuencias en el GenBank (NCBI),
que están incorrectamente clasificadas, y no corresponden
a la especie que reportan. Las secuencias obtenidas del
aislamiento PV8 presentaron 95% de homología con
P. debaryanum, debido a este bajo porcentaje se puede
considerar como una especie no descrita. Con respecto
a las especies identificadas, cuatro de ellas ya han sido
reportadas en viveros ornamentales, P. dissotocum, P.
ultimum var. ultimum, P. aphanidermatum y P. irregulare
et al., 2007).
The morphological identification of isolates was confirmed
with the sequences of the ITS1, 5.8S and ITS2 rDNA
regions, seven species were identified: P. aphanidermatum,
P. cylindrosporum, P. dissotocum, P. ultimum var. ultimum,
P. irregulare, P. splendens and Pythium sp. nov. It is
noteworthy that, the sequences obtained were compared
with sequences of type strains. This is mentioned because
there are sequences in the GenBank (NCBI) that are
incorrectly classified, and do not correspond to the species
reported. The sequences obtained in PV8 isolation, showed
95% homology with P. Debaryanum, due to this low
percentage it can be considered as an un-described species.
Regarding to the identified species, four of them have been
already reported in ornamental nurseries, P. dissotocum, P.
ultimum var. ultimum, P. aphanidermatum and P. irregulare
et al., 2007).
It has been reported that among most pathogenic Pythium
species, there are P. cylindrosporum, P. aphanidermatum,
P. dissotocum and P. splendens (Miller and Sauve, 1975;
cited in Moorman et al., 2002; Kong et al., 2004), all
identified in this paper. Diseases caused by Pythium are a
major limiting factor that affects the production of floral
crops (Kong et al., 2004). Furthermore, Pythium can be
transported from one place to another through infested soil
or irrigation water, as well as by cuttings, seeds or infected
plants. In Michoacán, plants are sold from different States
Se ha reportado que entre las especies de Pythium
más patogénicas se encuentran P. cylindrosporum, P.
aphanidermatum, P. dissotocum y P. splendens (Miller
y Sauve, 1975; citado en Moorman et al., 2002; Kong et
al., 2004), todas ellas identificadas en este estudio. Las
enfermedades causadas por Pythium son un importante factor
limitante que afecta la producción de cultivos florales (Kong
et al., 2004). Además, Pythium puede ser transportado de un
lugar a otro a través de suelo o agua de riego infestados, al
igual que por medio de esquejes, semillas o plantas infectadas.
En Michoacán se comercializan plantas provenientes de
diferentes estados entre los que se encuentran el Estado de
México, Guanajuato, Guerrero y Jalisco, por lo que este
patógeno se está diseminando de un estado a otro en el país.
La identificación de especies de Pythium presentes en un
vivero es de suma importancia, ya que representa el primer
paso para el desarrollo de estrategias de manejo efectivas
(Kong et al., 2004). Entre las cuales se recomienda esterilizar
el sustrato antes de ser usado, en la mayoría de estos se
utiliza suelo de monte, que proviene de bosques de encinos
o coníferas y puede estar infestado por Pythium. Las macetas
deben tener buen drenaje para evitar daños por este patógeno.
Con este trabajo se intenta aportar información sobre los
daños y síntomas de enfermedades causadas por Pythium
spp. en varias especies ornamentales, que se comercializan
ampliamente en viveros de Morelia, Michoacán.
CONCLUSIONES
Se obtuvieron 18 aislamientos de Pythium a partir de muestras
de suelo y tejido enfermo de 17 especies ornamentales de
cuatro viveros de Morelia.
Se identificaron siete especies de Pythium en base a las
características morfológicas y a las secuencias de las
regiones ITS1, 5.8S e ITS2 del ADNr: P. aphanidermatum,
P. irregulare, P. cylindrosporum, P. dissotocum, P. ultimum
var. ultimum, P. splendens, Pythium sp. nov.
Se reportan 13 hospederos para las diferentes especies de
Pythium identificadas en este estudio: ruda (Ruta graveolens),
primavera (Primula acaulis), Buxus sempervirens, pino
(Cedrus sp.), violeta africana (Saintpaulia hybrida), violeta
imperial (Cyclamen persicum), azalea (Rhododendron
indicum), gazania (Gazania rigens), belén (Impatiens
441
among which are the Mexico State, Guanajuato, Guerrero
and Jalisco so, this pathogen is spreading from State to
State within the country.
The identification of Pythium species in a nursery is quite
important because it represents the first step in developing
effective management strategies (Kong et al., 2004).
Among these strategies is recommended to sterilize the
substrate before being used, most of the nurseries uses
forest soil, which comes from oak or pine forests and it can
be infested by Pythium. The pots should be well drained to
prevent damage from this pathogen. This paper attempts to
provide information on damage and symptoms of diseases
caused by Pythium spp. on several ornamental species,
which are widely marketed in nurseries from Morelia,
Michoacán.
CONCLUSIONS
Eighteen Pythium isolates were obtained from soil samples
and diseased tissue from 17 ornamental species of four
nurseries in Morelia.
Seven Pythium species were identified based on
morphology and sequences of the ITS1, 5.8S and ITS2
rDNA regions: P. aphanidermatum, P. irregulare, P.
cylindrosporum, P. dissotocum, P. ultimum var. ultimum,
P. splendens, Pythium sp. nov.
Thirteen hosts are reported for different species of Pythium
found in this study: ruda (Ruta graveolens), primavera
(Primula acaulis), Buxus sempervirens, pine (Cedrus
sp.) african violet (Saintpaulia hybrida), violeta imperial
(Cyclamen persicum), azalea (Rhododendron indicum),
Gazania (Gazania rigens), belen (Impatiens hawkeri
x hybrida), amor de un rato (Portulaca grandiflora),
santolin (Santolina chamaecyparissus), panalillo (Alyssum
maritimum) and gerbera (Gerbera sp.).
From the ornamental plants analyzed, only the
Rhododendron genus had been reported worldwide as a
Pythium host.
hawkeri x hybrida), amor de un rato (Portulaca grandiflora),
santolin (Santolina chamaecyparissus), panalillo (Alyssum
maritimum) y gerbera (Gerbera sp.).
De las plantas ornamentales analizadas únicamente el género
Rhododendron, había sido previamente reportado a nivel
mundial como hospedante de Pythium.
AGRADECIMIENTOS
Agradecemos de manera muy especial a la Dra. Gloria Abad
por su valiosa ayuda en el análisis de las secuencias, para la
determinación de las especies.
LITERATURA CITADA
Agrios, G. N. 2005. Plant Pathology. 5ta edición. Editorial
Academic Press. México. 922 p.
Al-Sa’di, A. M.; Drenth, A.; Deadman, M. L.; Al-Said, F. A.;
Khan, I. and Aitken, E. A. B. 2007. Potential sources
of Pythium inoculum into greenhouse soils with
no previous history of cultivation. J. Phytopathol.
156:502-505.
Dick, W. M. 1990. Keys to Pythium. Ed. Dick, M. W..
Department of Botany. School of Plant Sciences.
University of Reading. Reino Unido. 64 p.
Duff, J. D. 1993. The incidence of Phytophthora and
Pythium species in Northern territory nurseries.
Australasian Plant Pathol. 22:149-151.
Felsestein, J. 1985. Confidence limits on phylogenesis: an
approach using the boostrap. Evolution. 39:783-791.
Hall, T. A. 1999. BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows
95/98/NT. NucleicAcids Symposium Series. 41:95-98.
Ho, H. H. 1986. Pythium dimorphum from Rhodondendron.
Mycopathologia. 93:141-145.
Kong, P.; Richardson, P. A. and Hong, C. 2004. Pythium and
recycled irrigation water. Pest and Dis. 32-35 pp.
Lévesque, C. A. and De Cock, A. W. A. M. 2004. Molecular
phylogeny and taxonomy of the genus Pythium.
Mycol. Res. 108(12):1363-1383.
MacDonald, J. D.; Ali-Shtayed, M. S.; Kabashima, J. and
Stites, J. 1994. Occurrence of Phytophthora species
in recirculated nursery irrigation effluents. Plant
Dis. 78:607-611.
McLeod, A.; Botha, W. J.; Meitz, J. C.; Spies, C. F.;
Tewoldemedhin, Y. T. and Mostert, L. 2009.
Morphological and phylogenetic analyses of
Pythium species in South Africa. Mycol. Research.
113:933-951.V
Martin, F. 2009. Pythium Genetics, In: oomycete genetics
and genomics: diversity, interactions, and research
tools. Lamour, K. and Kamoun, S. (eds.).Wiley
Blackwell. Estados Unidos de América. 213-239 pp.
Moorman, G. W.; Kang, S.; Geiser, D. M. and Kim, S. H.
2002. Identification and characterization of Pythium
species associated with greenhouse floral crops in
Pennsylvania. Plant Dis. 86:1227-1231.
Moralejo, E.; Pérez-Sierra, A. M.; Álvarez, L. A.;
Belbahri, L.; Lefort, F. and Descals, E. 2009.
Multiple alien Phytophthora taxa discovered on
diseased ornamental plants in Spain. Plant Pathol.
58:100-110.
Sánchez, J.; Olivares, J. S. and Gallego, E. 2001. Occurrence
and pathogenicity of Pythium spp. in the dust
deposited on the greenhouse roofs in the Poniente
region of Almeria (South-East Spain). J. Plant
Pathol. 83:13-19.
Sánchez, J. and Gallego, E. 2002. Fitopatogenicidad de
Pythium spp. presentes en el agua de riego del
poniente almeriense (sureste de España). Revista
Iberoamericana de Micología. 19:177-180.
Tamura, K.; Dudley, J.; Nei, M. and Kumar, S. 2007.
MEGA4: Molecular evolutionary genetics analysis
(MEGA) software version 4.0. Molec. Biol. Evol.
24:1596-1599.
Tello, M. M. L.; Alonso, A. y Mateo-Sagasta, Azpeitia, E.
1995: Algunos hongos patógenos detectados en
raíces de diferentes plantas ornamentales en viveros
de la Comunidad de Madrid. Boletín de Sanidad
Vegetal Plagas 21:517-526.
Thompson, J. D.; Higgins, D. G. and Gibson, T. J.
1994. Clustal W: improving the sensitivity of
progressive multiple sequence alignment through
sequence weighting, positions-specific gap
penalties and weight matrix choice. Nucleic Acids
Res. 22:4673-4680.
Van Der Plaats-Niterink, A. J. 1981. Monograph of the genus
Pythium. Vol. 21. Centraalbureau Voor Schimmelcultures, Baarn. The Netherlands. 242 p.
Warfield, C. Y.; Hwang, J. and Benson, D. M. 2008.
Phytophthora blight and dieback in North
Carolina nurseries during a 2003 survey. Plant
Dis. 92:474-481.
White, T. J.; Bruns, T.; Lee, S. and Taylor, J. 1990.
Amplification and direct sequencing of fungal
ribososmal RNA genes for phylogenetics. In: PCR
protocols: a guide to methods and applications.
Innis, M. A.; Gelfand, D. H.; Sninsky, J. J. and
White, T. J. (eds.). Academic Press. Estados Unidos
de América. 315-322 pp.
443
Yakabe, L. E.; Blomquist, C. L. and Thomas, S. L. 2009.
Identification and frequency of Phytophthora
species associated with foliar diseases in California
ornamental nurseries. Plant Dis. 93:883-890.
Zhang, Z.; Schwartz, S.; Wagner, L. and Miller, W. 2000. A
greedy algorithm for aligning DNA sequences. J.
Computational Biol. 7:203-14.
EFECTO DE RAYOS GAMMA 60Co EN NARDO (Polianthes tuberosa L.)*
EFFECT OF 60Co GAMMA RAYS IN TUBEROSE (Polianthes tuberosa L.)
Jorge Adán Estrada-Basaldua1§, Martha Elena Pedraza-Santos1, Eulogio de la Cruz-Torres2, Alejandro Martínez-Palacios3,
Cuauhtémoc Sáenz-Romero3 y José Luciano Morales-García1
Facultad de Agrobiología Presidente Juárez. Universidad Michoacana de San Nicolás de Hidalgo. Paseo Lázaro Cárdenas esq. con Berlín. Uruapan, Michoacán, México.
C. P. 60090. Tel. 01 452 5236474. ([email protected]), ([email protected]). 2Instituto Nacional de Investigaciones Nucleares. Carretera México-Toluca
s/n. La Marquesa, Ocoyoacac, México. C. P. 52750. Tel. 01 55 53297200. ([email protected]). 3Instituto de Investigaciones Agropecuarias y Forestales.
Universidad Michoacana de San Nicolás de Hidalgo. Carretera Morelia-Zinapécuaro, km 9.5. Tarímbaro, Michoacán, México. C. P. 58880. Tel. 01 443 3340475. Ext.
119. ([email protected]), ([email protected]). §Autor para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
Las plantas que se reproducen asexualmente como el nardo
(Polianthes tuberosa L.), presentan poca variabilidad
genética, ésta puede ser inducida por la técnica de la
mutagénesis. Los objetivos del presente trabajo de
investigación son: inducir variabilidad mediante el
uso de radiación gamma 60Co y establecer la curva
de radiosensibilidad en tubérculos y plantas in vitro
de nardo. En el Instituto Nacional de Investigaciones
Nucleares (ININ), se irradiaron tubérculos de nardo con
siete dosis de radiación gamma 60Co (0 a 30 Gy), con
intervalos de 5 Gy entre tratamientos. De los tubérculos
irradiados (con 2 a 21 bulbos laterales), se extrajeron los
bulbos sin daños mecánicos y se establecieron in vitro
en un medio de cultivo Murashige y Skoog (MS), con
1 mg L-1 de benciladenina (BA) y 0.5 mg L-1 de ácido
naftalenacético (ANA), los bulbos restantes se sembraron
en una mezcla de sustrato (suelo, tierra de hojas y tezontle
en una proporción de 1:1:1). Los nardos irradiados con
altas dosis, el desarrollo de las plantas se vio disminuido;
presentando una mayor variación en el largo y ancho de
las hojas; comparadas con las plantas irradiadas, además
se presentaron hojas deformes, brotes arrosetados, y estos
se resecaban repentinamente. Las plantas procedentes de
brotes aclimatados de nardo presentaron una LD50 (9.09
The plants that are asexually reproduced like the tuberose
(Polianthes tuberosa L.), have little genetic variability;
this can be induced by the mutagenesis technique. The
objectives of this paper are: to induce variability by using
60
Co gamma radiation and, to establish the radiosensitivity
curve in tubers and in vitro plants. At the National Institute
for Nuclear Research (ININ by its Spanish acronym),
tuberose’s tubers were irradiated with seven doses of 60Co
gamma radiation (0 to 30 Gy) with 5 Gy intervals between
treatments. Of irradiated tubers (with 2 to 21 side bulbs),
the bulbs were extracted without mechanical damage and
established in vitro in a Murashige and Skoog (MS) culture
medium with 1 mg L-1 of benzyladenine (BA) and 0.5 mg L-1
of naphthaleneacetic acid (NAA), the remaining bulbs were
planted in a substrate mixture (soil, leaf mold and volcanic
rock at a ratio of 1:1:1). In the tuberoses irradiated with
high doses, the plant growth decreased, showing a greater
variation in the length and width of the leaves; compared
to the irradiated plants, deformed leaves also appeared,
rosette-shaped buds, these were suddenly desiccated. The
plants from acclimatized tuberose’s buds had an LD50 (9.09
Gy), lower than tubers established in vivo (LD50 of 25.91
Gy), where the dose of 30 Gy was lethal to all plants after
five months of cultivation.
* Recibido: febrero de 2011
Jorge Adán Estrada-Basaldua et al.
Gy), menor a la de los tubérculos establecidos in vivo (LD50
de 25.91 Gy), en donde la dosis de 30 Gy fue letal para todas
las plantas después de cinco meses de cultivo.
Key words: Polianthes tuberosa, genetic variability, in vitro
cultivation, radiosensitivity.
Palabras clave: Polianthes tuberosa, cultivo in vitro,
radiosensibilidad, variabilidad genética.
INTRODUCTION
INTRODUCCIÓN
La mutagénesis es una herramienta importante en el
mejoramiento genético de los cultivos, ampliamente
utilizada para generar variación genética y nuevas
variedades de las plantas cultivadas, además de que está
libre de las restricciones y regulaciones impuestas a los
organismos genéticamente modificados (Waugh et al.,
2006; Shu y Lagoda, 2007; Parry et al., 2009). Hasta 2007
aproximadamente 2 300 variedades se desarrollaron a
partir de mutagénesis, estas fueron liberadas y registradas
oficialmente en la base de datos de variedades mutantes
de la Organización para la Agricultura y AlimentaciónAgencia Internacional de Energía Atómica (FAO-IAEA)
(Toker et al., 2007).
Las mutaciones pueden ser inducidas por mutágenos físicos
y químicos, que se pueden aplicar a todas las especies de
plantas y animales. Los mutágenos físicos consisten en
radiaciones no-ionizantes (rayos UV) o ionizantes (rayos
X y gamma, alfa, beta y neutrones rápidos y lentos),
mientras que algunos de los mutágenos químicos más
ampliamente utilizados en las plantas, incluyen etilmetano
sulfonato (EMS), metilmetano sulfonato (MMS), floruro
de hidrógeno (HF), azida de sodio, N-metil-N-nitrosourea
(MNU) e hidroxilamina (Parry et al., 2009).
El uso de la radiación ionizante como los rayos X, rayos
gamma y neutrones, así como los mutágenos químicos
para inducir variación está bien establecido (Ahloowalia y
Maluszynski, 2001), debido a la gran cantidad de trabajos
en el área de la mutagénesis convencional y en varios
cultivos como en tomate (Solanum lycopersicum L.)
(Matsukura et al., 2007; Watanabe et al., 2007), oyamel
[Abies religiosa (Kunth) Schltd. et Cham.] (IglesiasAndreu et al., 2010), chícharo de vaca [Vigna unguiculata
(L.) Walp] (Kumar y Verma, 2011), tabaco (Nicotiana
tabacum L.) (Kazama et al., 2008), trigo sarraceno perene
(Fagopyrum dibotrys Hara) (Jia y Li, 2008), maíz (Zea
mays L.) (Carrera y Cervantes, 2007), arroz (Oryza sativa
Mutagenesis is an important tool in genetic improvement
of crops, it’s widely used to generate genetic variation and
new varieties of crops, plus it is free of restrictions and
regulations imposed on genetically modified organisms
(Waugh et al., 2006; Shu and Lagoda, 2007; Parry et al.,
2009). Until 2007, about 2 300 varieties were developed
from mutagenesis, they were released and officially
registered in the database of mutant varieties of the Food
and Agriculture Organization-International Atomic Energy
Agency (FAO-IAEA) (Toker et al., 2007).
Mutations may be induced by physical and chemical
mutagens, which can be applied to all species of plants and
animals. Physical mutagens are non-ionizing radiation (UV)
or ionizing radiation (X rays and gamma, alpha, beta and fast
and slow neutrons), whereas some of the most widely used
chemical mutagens in the plants are: ethylmethane sulfonate
(EMS ) metilmethane sulfonate (MMS), hydrogen fluoride
(HF), sodium azide, N-methyl-N-nitrosourea (MNU) and
hydroxylamine (Parry et al., 2009).
The use of ionizing radiation such as X rays, gamma rays and
neutrons, as well as chemical mutagens to induce variation
is well established (Ahloowalia and Maluszynski, 2001),
due to the large amount of papers about the conventional
mutagenesis in several crops such as tomato (Solanum
lycopersicum L.) (Matsukura et al., 2007; Watanabe et
al., 2007), sacred fir [Abies religiosa (Kunth) Schltd. et
Cham.] (Iglesias-Andreu et al., 2010), cowpeas [Vigna
unguiculata (L.) Walp] (Kumar and Verma, 2011), snuff
(Nicotiana tabacum L.) (Kazama et al., 2008), perennial
buckwheat (Fagopyrum dibotrys Hara) (Jia and Li, 2008),
maize (Zea mays L.) (Carrera and Cervantes, 2007), rice
(Oryza sativa L.) (Fu et al., 2008; Yamaguchi et al., 2009;
Babaei et al., 2010) and black cumin (Nigella sativa L.)
(Kumar and Gupta, 2007).
The mutation effect in ornamentals it’s quite visible so
that, the selection for changes in flower color, shape and
size it’s simple but these changes do not always show
innovations with value (Maluszynski et al., 1995). In
vegetative propagated plants, reproductive organs are
Efecto de rayos gamma 60Co en nardo (Polianthes tuberosa L.)
L.) (Fu et al., 2008; Yamaguchi et al., 2009; Babaei et al.,
2010) y comino negro (Nigella sativa L.) (Kumar y Gupta,
2007).
El efecto de la mutación en plantas ornamentales es muy
visible, por lo que la selección para cambios en el color de
la flor, forma y tamaño es fácil; sin embargo, estos cambios
no siempre presentan novedades con valor (Maluszynski
et al., 1995). En las plantas de propagación vegetativa se
utilizan los órganos de multiplicación como yemas, rizomas,
bulbos, tubérculos, estacas enraizadas y segmentos de
hojas; sin embargo, estos órganos son multicelulares por
lo que el desarrollo de sectores mutados o genotípicamente
diferentes conocidos como quimeras es complejo y pueden
sufrir los efectos tóxicos de los mutágenos químicos, además
la aplicación homogénea de estos es difícil, por lo que las
radiaciones ionizantes con un gran poder de penetración
como los rayos X y gamma, son la opción para el desarrollo de
variedades mejoradas a partir de la inducción de mutaciones
en las plantas de propagación vegetativa (Prina et al., 2010).
La combinación entre las técnicas de inducción de mutantes
y de cultivo in vitro, pueden ofrecer muchas ventajas como
la separación quimeras, la capacidad de producir grandes
poblaciones en poco tiempo y la posibilidad de obtener
clones de un sólo brote (Van Harten, 1998). La dosis de
radiación es un factor clave para lograr mutaciones en
material vegetal. En el caso de las plantas cultivadas in vitro,
sólo unos miligramos de tejido son irradiados por lo que se
requieren dosis bajas (Ahoowalia y Maluszynski, 2001).
Existen varios trabajos en los que se realizó la inducción
de mutaciones in vitro en plantas, como caña de azúcar
(Saccharum officinarum L.) (García et al., 2001; Suprasana
et al., 2008), cacahuate (Arachis hypogaea L.) (Muthusamy
et al., 2007), papa (Solanum tuberosum L.) (Li et al., 2005),
henequén (Agave fourcroydes) (González et al., 2007),
camote (Ipomoea batatas L.) (Luan et al., 2007), crisantemo
(Chrysanthemum morifolium) (Yamaguchi et al., 2008;
Yamaguchi et al., 2009), violeta africana (Saintpaulia sp.)
(González et al., 2005), ciclamen (Cyclamen persicum)
(Kondo et al., 2009; Sugiyama et al., 2008), torenia (Torenia
fournieri Lind) (Sasaki et al., 2008), lirio sapo [Tricyrtis hirta
(Thund.) Hook] (Nakano et al., 2010) y petunia (Petunia
hybrida) (Hase et al., 2010).
El nardo (Polianthes tuberosa L.) presenta poca variabilidad
genética porque sólo se propaga a través de tubérculos
(Shillo, 1992), situación que dificulta su mejoramiento
447
used such as buds, rhizomes, bulbs, tubers, rooted cuttings
and leaf segments; these organs are multicellular and
so the development of mutant sectors or genotypically
different known as chimeras is complex and can suffer
the toxic effects of chemical mutagens, the consistent
application of these it’s difficult, so that ionizing radiation
with great penetrating power as X and gamma rays are the
choice for the development of improved varieties from
mutation induction in vegetative propagated plants (Prina
et al., 2010).
The combination of techniques of mutant induction and
in vitro culture can provide many benefits as chimeras’
separation, the ability to produce large populations in a short
period of time and, the possibility to obtain clones from a
single bud (Van Harten, 1998). The radiation dose is a key
factor in achieving mutations in plant material. In the case
of plants grown in vitro, only a few milligrams of tissue
are irradiated so, low doses are required (Ahoowalia and
Maluszynski, 2001).
There are several papers that performed in vitro mutation
induction in plants, such as sugarcane (Saccharum
officinarum L.) (García et al., 2001; Suprasana et al.,
2008), peanut (Arachis hypogaea L.) (Muthusamy et al.,
2007), potato (Solanum tuberosum L.) (Li et al., 2005), sisal
(Agave fourcroydes) (González et al., 2007), sweet potato
(Ipomoea batatas L.) (Luan et al., 2007), chrysanthemum
(Chrysanthemum morifolium) (Yamaguchi et al., 2008;
Yamaguchi et al., 2009), african violet (Saintpaulia sp.)
(González et al., 2005), cyclamen (Cyclamen persicum)
(Kondo et al., 2009; Sugiyama et al., 2008), Torenia (Torenia
fournieri Lind) (Sasaki et al., 2008), toad lily [Tricyrtis hirta
(Thund.) Hook] (Nakano et al., 2010) and petunia (Petunia
hybrida) (Hase et al., 2010).
The tuberose (Polianthes tuberosa L.) showed little genetic
variation because it is only spread by tubers (Shillo, 1992),
hampering its genetic improvement. There are few papers
about the effect of gamma radiation on the induction of
genetic variation in tuberose and none examines the impact
of growing tissues irradiated in vitro, which justifies the
development of techniques for genetic variability increases
of this species, such as mutagenesis caused by exposure
of living tissues to gamma radiation or a combination
of in vitro culture and gamma radiation, which generate
changes in the flowers such as color, shape and growth
habits (dwarf or trailing) that could be selected in future
breeding programs.
genético. Existen pocos trabajos donde se estudie el efecto
de las radiaciones gamma en la inducción de variación
genética en nardo y en ninguno se estudia el efecto de
cultivar tejidos irradiados in vitro, por lo que se justifica
el desarrollo de técnicas que permitan incrementos en la
variabilidad genética de esta especie, como la mutagénesis
causada por la exposición de tejidos vivos a radiaciones
gamma o la combinación de cultivo in vitro y radiaciones
gamma, que generen alteraciones en las flores como
el color, forma y hábitos de crecimiento (enanos o
rastreros) que podrían ser seleccionados en programas de
mejoramiento genético.
La presente investigación se realizó con los siguientes
objetivos: 1) inducir variabilidad mediante el uso de
radiación gamma 60Co en tubérculos y tejidos cultivados
in vitro; y 2) establecer la curva de radiosensibilidad en
tubérculos y plantas in vitro de nardo.
El material vegetal que se utilizó en esta investigación,
son tubérculos de nardo (primera generación) de San
Andrés, Municipio de Zumpahuacán, Estado de México.
El experimento se realizó de julio de 2009 a julio de 2010,
durante los ciclos otoño-invierno y primavera-verano. Los
tubérculos con 2 a 21 bulbos pequeños (diámetro de 0.7 a 3
cm y longitud de 1 a 3.4 cm), se dejaron secar a la sombra
esparcidos en una superficie plana dentro de una habitación
por 30 días y posteriormente se clasificaron por tamaños
de mayor a menor, se colocaron cinco o seis tubérculos en
sobres de papel tamaño carta y se identificaron según su
tratamiento. El trabajo de investigación se llevó a cabo en el
departamento del irradiador gamma del Instituto Nacional
de Investigaciones Nucleares (ININ), con un irradiador
Gammacell 220. Se establecieron seis dosis de radiación
de 60Co (5, 10, 15, 20, 25 y 30 Gy) que generaron seis
tratamientos y su respectivo testigo sin irradiar.
Cultivo in vitro de bulbos laterales
De los tubérculos irradiados se extrajeron los bulbos laterales
sin daños mecánicos visibles para su cultivo in vitro, éstos se
separaron por tratamientos y posteriormente se lavaron con
agua del grifo y detergente, después se sumergieron durante
tres horas en una solución compuesta por los fungicidas
Tecto 60 ® (Tiabendazol 60% i. a.) (1 g L -1), Switch ®
This research was performed with the following objectives:
1) to induce variability by using 60Co gamma radiation
on tubers and tissue cultured in vitro; and 2) to establish
the radiosensitivity curve of in vitro tubers and plants of
tuberose.
Tuberose tubers were the plant material used in this
paper (first generation) of San Andrées, Zumpahuacán
Municipality, Mexico State. The experiment was conducted
from July 2009 to July 2010, during the autumn-winter and
spring-summer cycles. The tubers with 2 to 21 small bulbs
(diameter of 0.7 to 3 cm and length of 1 to 3.4 cm) were dried
in the shade and spread over a flat surface for 30 days and,
thereafter, they were classified by size from largest to lowest,
five or six tubercles were placed on letter-sized envelopes
and identified according to their treatment. The research
was conducted in the Department of Gamma Irradiator of
the National Institute for Nuclear Research (ININ by its
Spanish acronym) with a Gammacell 220 irradiator. Six
doses of 60Co radiation were established (5, 10, 15, 20, 25
and 30 Gy) that generated six treatments and their respective
non-irradiated control.
In vitro culture of lateral bulbs
From irradiated tubers, lateral bulbs were extracted
without visible mechanical damage for in vitro cultivation;
they were removed by treatments and subsequently
washed with tap water and detergent then, immersed for
three hours in a solution composed of fungicides Tecto
60 ® (Thiabendazole 60% a. i.) (1 g L -1 ), Switch ®
(Cyprodinil Fludioxonil 37.5 and 25% a. i.) (1 g L-1) and
Cercobin M® (70% Methyl Thiophanate a. i.) (2 g L-1).
Disinfection was performed with a solution of commercial
sodium hypochlorite at 70% v/v (6% active chlorine)
for 20 min.
In a laminar flow hood, chlorine solution was removed and
explants were rinsed four to five times with sterile water.
Three bulbs were placed in flasks with a volume of 100
mL, adding 15 mL of liquid culture medium containing the
Murashige and Skoog mineral salts (1962) (MS) at 100%
and supplemented with benzyladenine (BA) (1 mg L-1),
naphthaleneacetic acid (NAA) (0.2 mg L-1) and Switch®
fungicide (1 g L-1). The flasks with the explants were
(Cyprodinil 37.5 y Fludioxonil 25% i. a.) (1 g L-1) y Cercobin
M® (Tiofanato metílico 70% i. a.) (2 g L-1). La desinfección se
efectuó con una solución de hipoclorito de sodio comercial
a 70% v/v (6% de cloro activo) durante 20 min.
En una campana de flujo laminar se retiró la solución con
cloro y se enjuagaron los explantes de cuatro a cinco veces
con agua estéril. Se colocaron tres bulbos en frascos con
un volumen de 100 mL, adicionándole 15 mL de medio
de cultivo líquido que contenía las sales minerales de
Murashige y Skoog (1962) (MS) a 100% y suplementados
con benciladenina (BA) (1 mg L-1), ácido naftalenacético
(ANA) (0.2 mg L-1) y el fungicida Switch ® (1 g L-1).
Los frascos con los explantes se incubaron con un
fotoperiodo de 16:8 (luz:oscuridad) blanca fría fluorescente
de 75 W y una radiación fotosintéticamente activa de 45
µE m-2s-1.
Los bulbos se distribuyeron en un diseño experimental
completamente al azar con 27 repeticiones por tratamiento.
A los siete días y cuando los explantes estaban incubándose
en medio con fungicida, se midieron las siguientes
variables número de explantes con brotes y porcentaje de
contaminación. Después de subcultivarlos a un medio sin
fungicida y se midió la altura de los brotes; los brotes se
aclimataron transfiriéndolos a macetas de 113.4 g con turba
(Peat moss®) como sustrato y se colocaron en contenedores
de plástico herméticos dentro de un invernadero por 30 días,
después se quitó la tapa.
Los brotes de nardo que sobrevivieron a la contaminación
y aclimatación, se distribuyeron en un diseño estadístico
de bloques al azar con 15 bloques y una repetición por
bloque; después se trasplantaron a vasos de poliestireno
expandido (unicel) con 226.8 g de un sustrato conformado
por suelo (extraído de tierras de cultivo) y turba (Peat
moss®) en proporción 1:1. Un mes después se trasplantaron
nuevamente a recipientes con capacidad de un litro y
utilizando suelo como sustrato. Los brotes de nardo
aclimatados recibieron dos riegos por semana con solución
nutritiva Steiner al 75% (Steiner 1984), durante los dos
primeros meses después de ser aclimatados y cuatro
veces se fertilizaron con 2-3 g de fórmula especial
jardín 12-24-12 ® una vez al mes. A los cuatro meses
después de la aclimatación de los brotes de nardo, se
tomaron los datos de las variables largo y ancho de hojas.
Un mes después se contó el número de plantas aclimatadas
supervivientes.
449
incubated with a photoperiod of 16:8 (light:dark) cool white
fluorescent of 75 W and a photosynthetically active radiation
of 45 μE m-2 s-1.
The bulbs were distributed in a completely randomized
design with 27 replicates per treatment. After seven days
and when the explants were incubated in a fungicide
medium, the following variables were measured:
the number of explants with buds and contamination
percentage. After sub-cultivated them in a medium without
fungicide, bud’s height was measured, the shoots were
acclimated by transferring them to pots with peat 113.4
g (Peat moss®) as a substrate and placed in sealed plastic
containers in a greenhouse for 30 days, then the lid was
removed.
The tuberose’s buds that survived the pollution and
acclimatization were distributed in a statistical design of
random blocks with 15 blocks and a repetition per block;
then they were transplanted into expanded polystyrene
cups (Styrofoam) with 226.8 g of a substrate consisting of
soil (extracted from farmlands) and peat (Peat moss®) in a
1:1 ratio. One month later they were transplanted back into
containers with one liter capacity, using ground as substrate.
The acclimated tuberose’s buds received two irrigations per
week with Steiner 75% nutrient solution (Steiner 1984),
during the first two months after being acclimated, they were
fertilized four times with 2-3 g of garden®12-24-12 special
formula once a month. Four months after the acclimatization
of tuberose’s buds, variable data of leaves length and width
were recorded. A month later, the number of acclimated
survivors’ plants was counted.
Tubers culture in greenhouses
The tubers that remained after the explants removal for in
vitro culture were sown in expanded polystyrene containers
(Styrofoam) of 2 L capacity, with substrate composed of
soil, leaf mold and volcanic rock in a 1:1:1 ratio, and were
distributed in a randomized block design with five blocks and
one replicate per block. Later information about beginning
and end of tuber sprouting and bulbs percentage of sprouted
tubers per radiation dose was recorded. Two months later,
when budding finished, variables of number of shoots per
pot, number of leaves per shoot, length and width of leaves
were measured. Four months after planting the data of length
and width of the leaves was taken again, a month later the
number of surviving plants was counted.
Cultivo de tubérculos en invernadero
Los tubérculos que quedaron después de la extracción de
explantes para cultivar in vitro, se sembraron en recipientes
de poliestireno expandido (unicel) de 2 L de capacidad con
sustrato conformado por suelo, tierra de hojas y tezontle en
una proporción de 1:1:1, y se distribuyeron en un diseño
bloques al azar con cinco bloques y una repetición por
bloque. Posteriormente se tomaron los datos de inicio y
final de la brotación de tubérculos y porcentaje de bulbos
que brotaron por tubérculos por dosis de radiación. A los
dos meses, cuando terminó la brotación, se midieron las
variables número de brotes por maceta, número de hojas
por brote, largo y ancho de hojas. A los cuatro meses de la
siembra se tomaron nuevamente los datos de las variables
largo y ancho de hojas, un mes después se contó el número
de plantas supervivientes.
Los tubérculos se fertilizaron con 2 a 3 g del mismo
fertilizante, que se utilizó en los brotes de nardo aclimatados;
al quinto mes se adicionó de 4 a 5 g de sulfato de magnesio®
al fertilizante. Todos los nardos recibieron un ataque severo
por araña roja (Tetranychus urticae Koch), que se controló
con aplicaciones de Supresor® (Naleb 58%) (1.25 ml L-1),
Talstar 100 CE® (Bifentrina 12.15%) (0.4 ml L-1) y Avalanch®
(Abamectina 1.8%) (0.25 ml L-1), por lo menos una vez cada
15 días, sin repetir el mismo insecticida acaricida dos veces
seguidas para evitar aparición de resistencia.
Todas las variables registradas se sometieron a análisis
de varianza (ANOVA) con el procedimiento PROC
GLM y prueba de comparación de medias de Tukey con
el procedimiento Tukey lines utilizando el programa
SAS versión 9 (SAS, 2004). Con el número de plantas
de nardo sobrevivientes se obtuvieron los porcentajes de
supervivencia y se realizaron pruebas de regresión lineal.
Además se calculó el error estándar y coeficientes de
variación con el comando Distribution del menú Analyze
del programa JMP versión 8 (SAS, 2008).
RESULTADOS Y DISCUSIÓN
Todas las variables evaluadas en las plántulas in vitro
derivadas de tubérculos irradiados, presentaron diferencias
estadísticas significativas (porcentaje de explantes con
brotes p= 0.00001, porcentaje de explantes contaminados
p= 0.0001 y altura de brotes p= 0.0001), por lo que se puede
The tubers were fertilized with 2 to 3 g of the same fertilizer
that was used in acclimated tuberose shoots; in the fifth
month 4 to 5 g of magnesium sulphate® were added to
fertilize them. All tuberoses showed a severe attack by
spider mites (Tetranychus urticae Koch), which was
controlled with applications of Suppressor ® (Naleb 58%)
(1.25 ml L-1), Talstar 100 CE® (Bifenthrin 12.15%) (0.4 ml
L-1) and Avalanch® (Abamectin 1.8%) (0.25 ml L-1) at least
once every 15 days, without repeating the same miticide
insecticide twice, in order to avoid resistance.
All the recorded variables were subjected to variance
analysis (ANOVA) with PROC GLM procedure and
comparison test of Tukey with Tukey’s lines procedure
by using SAS version 9 (SAS, 2004). With the number of
tuberose survivor plants, survival rates were obtained and
linear regression tests were made. Besides, the standard
error was calculated and variation coefficients with the
Distribution command of Analyze menu of the JMP
program version 8 (SAS, 2008).
RESULTS AND DISCUSSION
All variables evaluated of in vitro plantlets derived from
irradiated tubers, showed statistically significant differences
(percentage of explants with shoots p= 0.00001, percentage
of contaminated explants p= 0.0001 and shoot height p=
0.0001), so it can be stated that different radiation doses used
influenced the budding and seedlings growth. The shoot
development began on the third day after in vitro seeding
and ended on the seventh day. Plants treated with gamma
radiation of 5 Gy showed a shoots’ growth equal than the
control’s treatment (100%) and this variable decreased when
radiation doses increased (Table 1).
Similar results were reported for in vitro regeneration of
adventitious shoots, from internodal sections of carnation
(Dianthus gratianopolitanus Vill.), where the shoot’s
development was reduced from 1.1 to 0.1 shoots per explant,
with increasing doses of gamma radiation from 5 to 30 Gy,
with intervals of 5 Gy (Jerzy and Zalewska, 2000) and the
regeneration of toad lily seedlings [Tricyrtis hirta (Thunb.)
Hook] from irradiated callus, where the treatments exposed
to 5 and 10 Gy were similar to the un-irradiated treatment
and decreased with increasing radiation doses (Nakano et
al., 2010). In this paper, explants contamination was higher
in the treatment exposed to doses of 5 Gy (85.3%).
451
afirmar que las diferentes dosis de radiación empleadas
influyeron en la brotación de yemas y desarrollo de las
plántulas. El desarrollo de brotes inició a los tres días después
de la siembra in vitro y terminó a los siete días. Las plantas
tratadas con la radiación gamma de 5 Gy, presentaron un
desarrollo de brotes igual al tratamiento testigo (100%) y
esta variable disminuyó conforme se aumentó la dosis de
radiación (Cuadro 1).
The seedlings exposed to 5 and 10 Gy showed a higher level
(2.63 and 2.66 cm respectively) to the control treatment
(1.87 cm), probably due to the stimulating effect of low
radiation doses, similar to that observed in plants of Lactuca
sativa L. (González et al., 2004), this result is similar to that
obtained in in vitro potato plantlets of the Atlantic variety
that developed with a 4 Gy dose at 23.2% more micro tubers
than the control’s treatment (Li et al., 2005), although it is
Cuadro 1. Desarrollo de plántulas in vitro derivadas de tubérculos de nardo (Polianthes tuberosa L.) irradiados con 60Co.
Table 1. Development of in vitro plantlets derived from tuberose’s tubers (Polianthes tuberosa L.) irradiated with 60Co.
Dosis (Gy)
0
5
10
15
20
25
30
Explantes con brotes (%)
Explantes contaminados (%)
Altura de brotes (cm) Media ±ES
100 a
100 a
96.3 a
92.7 a
66.7 b
85.3 ab
77.7 ab
62 abc
85.3 a
70.3 ab
33.3 bc
26 c
37 bc
44.3 bc
1.87 ±0.33 ab
2.63 ±0.29 a
2.66 ±0.23 a
1.07 ±0.21 b
1.07 ±0.23 b
1.77 ±0.28 ab
1.39 ±0.24 b
Valores con diferentes letras en una columna presentan diferencias estadísticas significativas (p≤ 0.05); ES= error estándar; n= 189.
Resultados similares fueron reportados para la regeneración
in vitro de brotes adventicios, a partir de secciones
internodales de clavel (Dianthus gratianopolitanus Vill.),
donde el desarrollo de brotes se redujo de 1.1 a 0.1 brotes
por explante, al aumentar las dosis de radiación gamma de
5 a 30 Gy, en intervalos de 5 Gy (Jerzy y Zalewska, 2000)
y a la regeneración de plántulas de lirio sapo [Tricyrtis
hirta (Thunb.) Hook] a partir de callos irradiados, donde
los tratamientos expuestos a 5 y 10 Gy, fue similar al
tratamiento no irradiado y disminuyo al aumentar las dosis
de radiación (Nakano et al., 2010). En el presente estudio
la contaminación de explantes fue mayor en el tratamiento
expuesto a la dosis de 5 Gy (85.3%).
Las plántulas expuestas a 5 y 10 Gy presentaron una altura
superior (2.63 y 2.66 cm respectivamente) al tratamiento
testigo (1.87 cm), probablemente por el efecto estimulante de
bajas dosis de radiación, similar a lo observado en plantas de
(Lactuca sativa L.) (González et al., 2004), resultado que es
similar al obtenido en plántulas in vitro de papa de la variedad
Atlantic, que desarrollaron con la dosis de 4 Gy 23.2% más de
micro tubérculos que el tratamiento testigo (Li et al., 2005),
aunque también es opuesto al obtenido en ápices de henequén
(Agave fourcroides Lem.), expuestos a dosis de radiación
gamma 60Co de 0 a 50 Gy con intervalos de 10 Gy, ninguno de
los tratamientos expuestos a radiación pudo superar al testigo
(3.5 brotes por explante) (González et al., 2007).
opposite to that obtained in sisal apices (Agave fourcroides
Lem.), exposed to 60Co gamma radiation doses from 0 to 50
Gy with intervals of 10 Gy, none of the treatments exposed to
radiation could exceed the control’s (3.5 shoots per explant)
(González et al., 2007).
However, it is similar to that obtained at in vitro shoots
of grape varieties (Vitis vinifera L.) 3309, Helwani and
Cabernet Franc exposed to gamma radiation dose of 7 Gy,
they produced a bud length (BL) (5.33, 4.11 and 7.46 cm)
and number of leaves (NL) (14.66, 10 and 8.66 respectively)
that exceeded the control’s treatment (shoots of 5.03, 1.4
and 2.9 cm length and 8.33, 5 and 2.66 leaves, respectively)
(Charbaji and Nabulsi, 1999).
In the case of irradiated tubers established in vivo, there
were only statistically significant differences in the length
and width of the obtained shoots’ leaves (p= 0.0001 and p=
0.0001, respectively). As with the seedlings in vitro, in vivo
plants exposed to a gamma radiation dose of 5 Gy, showed
a very similar development than the control’s treatment and
plants development appeared to decrease when increasing
the radiation dose (Table 2).
Similar results were observed in black cumin plants (Nigella
sativa L), where the height of seed-derived plants decreased
from 54.86 ±0.45 to 36.84 ±0.29 cm, with the increase
Sin embargo, es similar al obtenido en brotes in vitro de
las variedades de uva (Vitis vinifera L.) 3309, Helwani y
Cabernet Franc expuestos a una dosis de radiación gamma
de 7 Gy produjeron una longitud de brote (LB) (5.33,
4.11 y 7.46 cm) y número de hojas (NH) (14.66, 10 y 8.66
respectivamente) que superaron a los tratamientos testigo
(brotes de 5.03, 1.4 y 2.9 cm de longitud y 8.33, 5 y 2.66
hojas, respectivamente) (Charbaji y Nabulsi, 1999).
En el caso de los tubérculos irradiados que se establecieron
in vivo, sólo se presentaron diferencias estadísticas
significativas en el largo y ancho de las hojas de los brotes
obtenidos (p= 0.0001 y p= 0.0001, respectivamente). Al
igual que en las plántulas in vitro, las plantas in vivo expuestas
a una dosis de radiación gamma de 5 Gy, presentaron un
desarrollo muy similar al tratamiento testigo y el desarrollo
de las plantas pareció disminuir al aumentar las dosis de
radiación (Cuadro 2).
of gamma radiation from 0 to 300 Gy at intervals of 50
Gy (Kumar and Gupta, 2007) and in fir seedlings [Abies
religiosa (Kunth) Schltd. et Cham.], generated from seeds
exposed to gamma radiation dose of 0 to 20 Gy at intervals
of 5 Gy between treatments, where the seedling height and
number of primary leaves, decreased with increasing doses
of radiation (Iglesias-Andreu et al., 2010). The development
of tuberose’s buds began five days after planting and ended
after two months.
Statistical differences found in the tubers established in vivo
after emergence were retained after four months of culture
(Table 3). Moreover, the acclimated shoots also showed
statistically significant differences (p≤ 0.01), after a culture
period equal to the tubers’ established in vivo. In acclimated
outbreaks, the dose that showed the highest variation in the
length and width of the leaves’ variables (51.37 and 26.8
CV, respectively) was of 25 Gy (Table 3), similar than in
Cuadro 2. Desarrollo vegetativo de plantas derivadas de tubérculos de nardo (Polianthes tuberosa L.) irradiados con 60Co.
Table 2. Vegetative growth of plants derived from tuberose’s tubers (Polianthes tuberosa L.) irradiated with 60Co.
Dosis (Gy)
0
5
10
15
20
25
30
Brotación (%)
60 a
100 a
100 a
100 a
60 a
100 a
80 a
Largo de hojas (cm) Media ±ES
17.76 ±1.32 a
19.07 ±1.11 a
11.56 ±0.91 b
13.92 ±0.9 ab
11.56 ±0.87 b
9.11 ±1.08 b
3.38 ±0.77 c
Ancho de hojas (cm) Media ±ES
1.27 ±0.02 a
1.27 ±0.02 a
1.34 ±0.04 a
1.22 ±0.04 a
1.19 ±0.04 a
1.13 ±0.05 a
0.86 ±0.07 b
Valores con diferentes letras en una columna, presentan diferencias estadísticas significativas (p≤ 0.05); ES= error estándar; n= 35 para brotación; y n= 312 para hojas.
Resultados similares fueron observados en plantas de comino
negro (Nigella sativa L), donde la altura de las plantas
derivadas de semillas disminuyó de 54.86 ±0.45 a 36.84 ±0.29
cm, con el incremento de la radiación gamma de 0 a 300 Gy en
intervalos de 50 Gy (Kumar y Gupta, 2007) y en plántulas de
oyamel [Abies religiosa (Kunth) Schltd. et Cham.], generadas
a partir de semillas expuestas a dosis de radiación gamma de 0
a 20 Gy con intervalos de 5 Gy entre tratamientos, en donde la
altura de las plántulas y número de hojas primarias, disminuyó
conforme aumentaban las dosis de radiación (Iglesias-Andreu
et al., 2010). El desarrollo de brotes de nardo inició a los cinco
días de la siembra y terminó a los dos meses.
Las diferencias estadísticas que se encontraron en los
tubérculos establecidos in vivo después de la brotación, se
conservaron después de cuatro meses de cultivo (Cuadro 3).
Por otra parte, los brotes que fueron aclimatados también
tubers’ established in vivo, the highest variation in leaves
length (51.14 CV) was shown at the 25 Gy dose, although,
the greatest variation in leaves width (25.56 CV) was shown
at the 5 Gy dose.
Similar to this paper results, in vitro shoots of pear (Pyrus
communis L.) irradiated with gamma rays (3.5 Gy) showed
variation frequencies of 0.81 and 3.64% in fruit traits for
Doyenné d’Hiver and Passe Crassane varieties, compared
with non-irradiated plants (Predieri and Zimmerman, 2001).
By comparing the variation in the aforementioned variables
between the control treatments, it’s shown that acclimated
shoots (31.76 and 26.04 CV) show a greatest variation than in
vivo tubers’ (27.12 and 18.93 CV); maybe because not every
shoot developed roots before being acclimated, therefore
they did not have a uniform development in the substrate.
In an opposite case to the results obtained in this paper, in
453
presentaron diferencias estadísticas significativas (p≤ 0.01),
después de un periodo de cultivo igual al de los tubérculos
establecidos in vivo. En los brotes aclimatados, la dosis que
presentó una variación más elevada en las variables largo y
ancho de hojas (51.37 y 26.80 CV, respectivamente) fue de 25
Gy (Cuadro 3), similarmente en los tubérculos establecidos
in vivo, la mayor variación en el largo de hojas (51.14 CV) se
presentó en la dosis de 25 Gy, aunque la mayor variación en
el ancho de hojas (25.56 CV) se presentó en la dosis de 5 Gy.
vitro culture reduced the variation in the development of
wild plants of Yucca valida Brandegee, from 39.46 to 9.11
CV (Arce-Montoya et al., 2006).
In the acclimated shoots, the average values of the
studied variables decreased when increasing radiation
doses, however; shoots exposed to 30 Gy had leaves
with a length and width (12.16 ± 0.63 and 1.12 ±0.04 cm)
comparable with those obtained with doses of 5 and 10 Gy
Cuadro 3. Desarrollo vegetativo de plantas derivadas de brotes in vitro y tubérculos de nardo (Polianthes tuberosa L.)
irradiados con 60Co después de cuatro meses.
Table 3. Vegetative growth of plants derived from in vitro shoots and tuberose’s tubers (Polianthes tuberosa L.) irradiated
with 60Co after four months.
Dosis (Gy)
Largo de hoja (cm)
Media ±ES
0
5
10
15
20
25
30
15.83 ±0.89 a
12.44 ±0.69 ab
10.22 ±0.78 bcd
9.13 ±0.67 bcd
8.7 ±0.55 cd
7.77 ±1.15 d
12.16 ±0.63 abc
0
5
10
15
20
25
30
28.85 ±0.94 a
26.63 ±0.92 a
27.38 ±1.04 a
23.54 ±0.62 ab
16.84 ±0.86 bc
12.53 ±0.90 cd
3.75 ±1.25 d
Ancho de hoja (cm)
CV
Media ±ES
Brotes aclimatados de nardo
31.76
1.39 ±0.06 a
42.82
1.27 ±0.04 ab
38.06
1.04 ±0.03 bc
29.36
1.07 ±0.04 bc
39.34
0.93 ±0.04 c
51.37
0.9 ±0.07 c
33.07
1.12 ±0.04 bc
Tubérculos de nardo establecidos in vivo
27.12
1.43 ±0.03 abc
32.24
1.48 ±0.04 ab
31
1.56 ±0.03 a
28.13
1.49 ±0.03 ab
38.06
1.32 ±0.04 abc
51.14
1.08 ±0.03 c
47.14
1.15 ±0.05 bc
CV
26.04
25.6
17.72
15.17
24.91
26.8
21.86
18.93
25.56
16.7
24.54
22.09
21.76
6.14
Valores con diferentes letras en una columna presentan diferencias estadísticas significativas (p≤ 0.05); ES= error estándar; CV= coeficiente de variación; n= 224 para
hojas de brotes aclimatados; n= 446 para hojas de tubérculo.
En forma similar a los resultados del presente estudio brotes
in vitro de pera (Pyrus communis L.), irradiados con rayos
gama (3.5 Gy), presentaron frecuencias de variación de 0.81
y 3.64% en rasgos de la fruta para las variedades Doyenné
d’Hiver y Passe Crassane, en comparación con las plantas
no irradiadas (Predieri y Zimmerman, 2001). Al comparar
la variación en las variables ya mencionadas entre los
tratamientos testigo, muestran que los brotes aclimatados
(31.76 y 26.04 CV), presentan mayor variación que los
tubérculos establecidos in vivo (27.12 y 18.93 CV); sin
embargo, tal vez se debe que no todos los brotes desarrollaron
raíces antes de ser aclimatados, por lo que no presentaron
(12.44 ±0.69 and 1.27 ±0.04 and 10.22 ±0.78 and 1.04
±0.03 cm respectively); while in the tubers established in
vivo, doses of 5, 10 and 15 Gy showed wider leaves (1.48
±0.04, 1.56 ±0.03 and 1.49 ±0.03 cm) than the control’s
(1.43 ±0.03 cm), this result is similar to that obtained in
peanut plants Arachis hypogaea L., germinated from
somatic embryos developed in irradiated embryogenic
callus of Co. 5 y Co. 7 varieties, which showed in doses
of 10, 20 and 30 Gy a height in field conditions (37.2, 38.5
and 45.2 cm for Co. 5 and 37.4, 39.4 and 40.4 cm for Co. 7)
higher than the control’s (35.8 and 36.4 cm) (Muthusamy
et al., 2007).
En los brotes aclimatados los valores promedio de las
variables estudiadas, disminuyeron conforme aumentaban
las dosis de radiación; sin embargo, los brotes expuestos a
30 Gy, presentaron hojas con un largo y ancho (12.16 ±0.63
y 1.12 ±0.04 cm), comparable con los obtenidos con las dosis
de 5 y 10 Gy (12.44 ±0.69 y 1.27 ±0.04, y 10.22 ±0.78 y 1.04
±0.03 cm respectivamente); mientras que, en los tubérculos
establecidos in vivo las dosis de 5, 10 y 15 Gy, presentaron
hojas más anchas (1.48 ±0.04, 1.56 ±0.03 y 1.49 ±0.03 cm)
que el testigo (1.43 ±0.03 cm), este resultado es similar al
obtenido en plantas de cacahuate Arachis hypogaea L.,
germinadas a partir de embriones somáticos desarrollados en
callos embriogénicos irradiados de las variedades Co. 5 y Co.
7, que presentaron en las dosis de 10, 20 y 30 Gy una altura
en condiciones de campo (37.2, 38.5 y 45.2 cm para Co. 5 y
37.4, 39.4 y 40.4 cm para Co. 7), superiores a los tratamientos
testigo (35.8 y 36.4 cm) (Muthusamy et al., 2007).
Aunque los brotes aclimatados generaron algunas plantas
muy vigorosas con la dosis de 30 Gy, éstos presentaron
una LD50 de 9.09 Gy, obtenida con la fórmula de regresión
y= 101.41 - 7.3529x + 0.1869x2 (Figura 1), un resultado
similar se presentó en callos irradiados de papa (Solanum
tuberosum L.) de la variedad Desirée, donde se obtuvo una
LD50 de 12.51 Gy (Veitía et al., 2007). Es necesario tomar
en cuenta que otros factores ajenos al efecto de la radiación,
como la contaminación in vitro y daños mecánicos
ocurridos durante la etapa de aclimatación, pueden influir
negativamente en la supervivencia de las plántulas y causar
una LD50 menor a la que se obtendría solo con la radiación.
Por otra parte, la presencia de plantas vigorosas con la dosis
de 30 Gy observadas en esta investigación, es opuesta a los
resultados obtenidos en brotes in vitro de crisantemo, donde
la dosis de 16 Gy fue letal (Yamaguchi et al., 2009).
En el caso de los tubérculos establecidos in vivo se obtuvo
una LD50 de 25.91 Gy, con la fórmula de regresión y= 93.81
+ 3x - 0.181x2 (Figura 2), resultado cercano a la dosis que
alcanzó la mayor variación en el largo y ancho de las hojas
(25 Gy) y es menor a otras plantas como el henequén (Agave
fourcroides Lem.), donde se presentó una DL50 de 30 Gy
(González et al. 2007), o las DL50 de 28 y 27 Gy calculadas
para las variedades de aguacate (Persea americana Mill.)
Even though, acclimated shoots generated some very
vigorous plants with a dose of 30 Gy, they also showed an
LD50 of 9.09 Gy obtained with the regression formula y=
101.41 - 7.3529x + 0.1869x2 (Figure 1), a similar result was
observed in irradiated potato calluses (Solanum tuberosum
L.) of Desirée variety, which yielded an LD50 of 12.51 Gy
(Veitía et al., 2007). It is necessary to consider other factors
beyond the effect of radiation, such as in vitro contamination
and mechanical damage occurring during the acclimatization
stage may adversely affect the survival of seedlings and may
cause an LD50 lower than that obtained only with radiation.
Moreover, the presence of vigorous plants with 30 Gy dose
observed in this paper is opposite to the results obtained
from in vitro shoots of chrysanthemum, where the 16 Gy
dose was lethal (Yamaguchi et al., 2009).
120
y= 101.41 - 7.3529x + 0.1869x2
R2= 0.7856
100
Supervivencia (%)
un desarrollo uniforme en el sustrato. En un caso opuesto
a los resultados obtenidos en la presente investigación el
cultivo in vitro, redujo la variación en el desarrollo de plantas
silvestres de (Yucca valida Brandegee) de 39.46 a 9.11 CV
(Arce-Montoya et al., 2006).
80
60
40
20
0
0
10
20
30
40
Dosis de radiación gamma (Gy)
Figura 1. Efecto de rayos gamma 60Co en la supervivencia de
brotes después de cinco meses de ser aclimatados.
Figure 1. Effect of 60Co gamma rays on the survival of shoots
after five months of being acclimated.
In the case of tubers established in vivo, an LD50 of 25.91
Gy was obtained, with the regression formula y= 93.81 +
3x - 0.181x2 (Figure 2), a result close to the dose that reached
the highest variation in the leaves’ length and width (25 Gy)
and is lower than other plants such as sisal (Agave fourcroides
Lem.), where there was a LD50 of 30 Gy (González et al.
2007) or the LD50 of 28 and 27 Gy calculated for the avocado
varieties (Persea americana Mill) Duke and Hass (Fuentes
et al., 2004), in tubers established in vivo, 30 Gy dose was
lethal after five months of culture.
From the materials established in vivo, the plants exposed
at 30 Gy died because their tubers did not develop roots,
so these plants survived until its reserves ran out; while
acclimated plants exposed to 30 Gy survived because they
455
Duke y Hass (Fuentes et al., 2004); en los tubérculos
establecidos in vivo la dosis de 30 Gy fue letal después de
cinco meses de cultivo.
120
Supervivencia (%)
100
80
60
40
20
0
y= 93.81 + 3x - 0.181x2
R2= 0.6645
0
10
20
30
40
Dosis de radiación gamma (Gy)
Figura 2. Efecto de rayos gamma 60Co en la supervivencia
de tubérculos establecidos in vivo después de cinco
meses de cultivo.
Figure 2. Effect of 60Co gamma rays on the survival of tubers
set in vivo after five months of culture.
developed viable roots as a possible effect of the exposure
of irradiated tissue to plant growth regulators (ANA BA)
present in the culture medium during the stage of in vitro
development. Moreover, there were also deformed leaves
(twisted or very thin leaves), very rosette-shaped shoots and
emerging shoots that suddenly dried up; 11 months after
planting the tubers established in vivo, a plant exposed to
a dose of 10 Gy began to develop an inflorescence, three
weeks after this another plant exposed at 15 Gy also initiated
an inflorescence development.
The Figure 3 shows the effect of gamma radiation on
tuberose plants: A= decreased vigor of tuberose plants with
increasing radiation dose; B= acclimated bud exposed to 30
Gy; C= necrosed tuberose tuber of a plant exposed to 30 Gy;
D= plant exposed to 30 Gy before dying; E and F= acclimated
shoot, in vivo plants with deformed leaves; G= rosette-plants;
H, I= inflorescences developed in plants exposed to 15 and
10 Gy respectively; J= plant with a suddenly dead shoot; ht
= twisted leave; hd= thin leave; bm= dead shoot.
En los materiales establecidos in vivo, las plantas
expuestas a 30 Gy murieron porque sus tubérculos no
desarrollaron raíces; así que estas plantas sobrevivieron
hasta que agotaron sus reservas, mientras que las plantas
aclimatadas expuestas a 30 Gy sobrevivieron, por que
desarrollaron raíces viables como un posible efecto de
la exposición de tejidos irradiados a reguladores del
crecimiento vegetal (ANA BA), presentes en el medio
de cultivo durante la etapa de desarrollo in vitro. Por otra
parte, también se presentaron deformaciones en las hojas
(hojas torcidas o muy delgadas), brotes que surgían muy
rosetados y brotes que se secaban repentinamente, a 11
meses de la siembra de los tubérculos establecidos in
vivo, una planta expuesta a una dosis de 10 Gy empezó
a desarrollar una inflorescencia, a tres semanas de este
hecho otra planta expuesta a 15 Gy también inició el
desarrollo de una inflorescencia.
En la Figura 3 se muestra el efecto de la radiación gamma
sobre las plantas de nardo: A= disminución del vigor de
plantas de nardo al aumentar la dosis de radiación; B=
brote aclimatado expuesto a 30 Gy; C= tubérculo de nardo
necrosado de una planta expuesta a 30 Gy; D= planta
expuesta a 30 Gy antes de morir, E y F= brote aclimatado
plantas in vivo con deformaciones en hojas; G= plantas
rosetadas, H e I= inflorescencias que se desarrollaron
Figura 3. Efecto de la radiación gamma en plantas de nardo.
Figure 3. Effect of gamma radiation on tuberose plants.
en una plantas expuestas a 15 y 10 Gy respectivamente;
J= planta con un brote muerto repentinamente; ht= hoja
torcida; hd= hoja delgada; bm= brote muerto.
De forma similar a las observaciones realizadas en este
estudio otras plantas expuestas a radiación gamma, también
presentan deformaciones como hojas pálidas, hojas y frutos
de color verde amarillento similares a las plantas silvestres,
también con frutos de color rosa en plantas de tomate
(Solanum lycopersicum L.) miniatura var. Micro-Tom
expuestas a radiación gamma (300 Gy) (Matsukura et al.,
2007), flores con un pétalo extra en comino negro (Nigella
sativa L.) (Kumar y Gupta, 2007), o alteraciones en la forma
y color de los pétalos de ciclamen (Cyclamen persicum)
(Sugiyama et al., 2008; Kondo et al., 2009), petunia (Petunia
hybrida) (Hase et al., 2010) y torenia (Torenia fournieri
Lind.) (Sasaki et al., 2008).
En el presente estudio, las deformaciones observadas en
las plantas que se desarrollaron a partir de los tubérculos
irradiados, sugieren el desarrollo de quimeras que junto
con el aumento en los coeficientes de variación de estas
plantas con respecto a las plantas del tratamiento testigo no
irradiado, indican que la radiación gamma posiblemente si
afectó variación genética en los nardos.
CONCLUSIONES
Al aumentar la dosis de radiación disminuye el desarrollo de
las plantas de nardo, tanto en plantas desarrolladas a partir
de brotes aclimatados, como en las desarrolladas a partir
de tubérculos establecidos in vivo. Las plantas irradiadas
presentan mayor variación en el largo y ancho de hojas que
las plantas no irradiadas. La LD50 de las plantas desarrolladas
a partir de brotes aclimatados (9.09 Gy), fue menor a la LD50
de plantas desarrolladas a partir de tubérculos establecidos
in vivo (25.91 Gy). La dosis de radiación de 30 Gy fue
letal para las plantas desarrolladas a partir de tubérculos
establecidos in vivo.
LITERATURA CITADA
Ahloowalia, B. S. and Maluszynski, M. 2001. Induced
mutations-a new paradigm in plant breeding.
Euphytica. 118:167-173.
Similar to the observations of this paper, other plants exposed
to gamma radiation showed deformations such as pale
leaves, yellowish-green leaves and fruits similar to wild
plants also, pink fruits in tomato (Solanum lycopersicum L.)
thumbnail var. Micro-Tom exposed to gamma radiation (300
Gy) (Matsukura et al., 2007), flowers with extra petals in
black cumin (Nigella sativa L.) (Kumar and Gupta, 2007) or
alterations in shape and color of cyclamen petals (Cyclamen
persicum) (Sugiyama et al., 2008; Kondo et al., 2009),
petunia (Petunia hybrida) (Hase et al., 2010) and Torenia
(Torenia fournieri Lind.) (Sasaki et al., 2008).
In this paper, deformations observed in plants that developed
from irradiated tubers suggest the development of chimeras
that along with the increase of the variation coefficients of
these plants with respect to the control treatment with nonirradiated plants indicated that, the gamma radiation may
affect genetic variation of tuberose.
CONCLUSIONS
Increased radiation doses reduce the development of
tuberose plants, both in plants developed from acclimated
buds, as in those developed from tubers established in vivo.
Irradiated plants show a greater variation in the length and
width of leaves than non-irradiated plants. The LD50 of the
plants grown from acclimated shoots (9.09 Gy) was lower
than the LD50 of plants grown from tubers established in
vivo (25.91 Gy). The radiation dose of 30 Gy was lethal for
the plants grown from tubers established in vivo.
Arce-Montoya, M.; Rodríguez-Áglvarez, M.; HernándezGonzález, J. A. and Robert, M. L. 2006.
Micropropagation and field performance of Yucca
valida. Plant Cell Reports. 25:777-783.
Babaei, A.; Nematzadeh, G. A.; Avagyan, V. and HashemiPetrodi, S. H. 2010. Radio sensitivity studies of
morpho-physiological characteristics in some
Iranian rice varieties (Oryza sativa L.) in M1
generation. African J. Res. 5(16):2124-2130.
Carrera, V. J. A. y Cervantes, S. T. 2007. Comportamiento de
cruzas de maíz obtenidas por irradiación y selección.
Rev. Fitotec. Mex. 30(2):173-180.
Charbaji, T. and Nabulsi, I. 1999. Effect of low doses
of gamma irradiation on in vitro growth of
grapevine. Plant Cell, Tissue and Organ Culture.
57:129-132.
Fu, H. W.; Li, Y. F. and Shu, Q. Y. 2008. A revisit of mutation
induction by gamma rays in rice (Oryza sativa L.):
implications of microsatellite markers for quality
control. Mol. Breed. 22:281-288.
Fuentes, J. L.; Santiago, L.; Valdés, Y.; Guerra, M.; Ramírez,
I. M.; Prieto, E. F.; Rodríguez, N. N. and Velázquez,
B. 2004. Mutation induction in zygotic embryos of
avocado (Persea americana Mill). Biotecnología
Aplicada. 21(2):82-84.
García, R. L.; Orellana, P. P; García, R. L.; Pérez, P. J. N.;
Veitía, R. N.; Bermúdez, C. I.; Clavero, G. J. and
Romero, Q. C. 2001. Empleo de la mutagénesis
en la mejora al grosor del tallo del somaclón IBP
89-169 de caña de azúcar. Biotecnología Vegetal.
1(2):71-75.
González, L. M.; Ramírez, R.; Licea, L.; Porra, E. and García,
B. 2004. Acción estimulante de las dosis bajas de
rayos X en plantas Lactuca sativa. Universidad y
Ciencia. 20(39):1-6.
González, M. C.; Fuentes, J. L.; Cortes, S. y Sam, O.
2005. “Delia”, nueva variedad de violeta africana
(Saintpaulia sp.) obtenida a partir del empleo de
técnicas biotecnológicas y nucleares. Cultivos
Tropicales. 26:67-68.
González, O. G.; Alemán, G. S.; Garriga, M.; Ortiz, R. and
De La Fe, C. 2007. Radiosensitivity to gamma rays
(60Co) in shoot tips of henequen. Biotecnología
Vegetal. 7(2):115-117.
Hase, Y.; Okamura, M.; Takeshita, D.; Narumi, I. and
Tanaka, A. 2010. Efficient induction of flowercolor mutants by ion beam irradiation in petunia
seedlings treated with high sucrose concentration.
Plant Biotechnol. 27:99-103.
Iglesias-Andreu, L. G.; Sánchez-Velásquez, L. R.; TivoFernández, Y.; Luna-Rodríguez, M.; FloresEstévez, N.; Noa-Carranzana, J. C.; Ruiz-Bello,
C. and Moreno-Martínez, J. L. 2010.Efecto de
radiaciones gamma en Abies religiosa (Kunth)
Schltd. et. Cham. Revista Chapingo. Serie Ciencias
Forestales y del Ambiente. 16(1):5-12.
Jerzy, M. and Zalewska, M. 2000. Effect of X and gamma
rays on in vitro adventitious bud production of
pot carnation (Dianthus gratianopolitanus Vill.).
Revista Chapingo. Serie Horticultura. 6(1):49-52.
457
Jia, C. F. and Li, A. L. 2008. Effect of gamma radiation on
mutant induction of Fogopyrum dibotrys Hara.
Photosynthetica. 46(3):363-369.
Kazama, Y.; Saito, H.; Miyagai, M.; Takehisa, H.; Ichida, H.;
Miyazawa, Y.; Mishiba, K.; Kanaya, T.; Suzuki, K.;
Bae, C. H.; Miyoshi, K.; Mii, M. and Abe, T. 2008.
Effect of heavy ion-beam irradiation on plant growth
and mutation induction in Nicotiana tabacum. Plant
Biotechnol. 25:105- 111.
Kondo, E.; Nakayama, M.; Kameari, N.; Tanikawa, N.;
Morita, Y.; Akita, Y.; Hase, Y.; Tanaka, A. and
Ishizaka, H. 2009. Red-purple flower due to
delphinidin 3,5-diglucoside, a novel pigment for
Cyclamen spp., generated by ion-beam irradiation.
Plant Biotechnol. 26:565-569.
Kumar, G. and Gupta, P. 2007. Mutagenic efficiency of
lower doses of gamma rays in black cumin (Nigella
sativa L.). Cytologia. 72(4):435-440.
Kumar, G. and Verma, S. 2011. Comparative effect of
individual and sequential treatment of gamma
rays and sodium azide in Vigna unguiculata.
Chromosome Botany. 6:33-36.
Li, H. Z.; Zhou, W. J.; Zhang, Z. J.; Gu, H. H.; Takeuchi, Y.
and Yoneyama, K. 2005. Effect of γ-radiation on
development, yield and quality of microtubers in vitro
in Solanum tuberosum L. Biol. Plant. 49(4):625-628.
Luan, Y.; Zhang, J.; Gao, X. and An, L. 2007. Mutation
induced by ethylmethanesulphonate (EMS), in vitro
screening for salt tolerance and plant regeneration
of sweet potato (Ipomoea batatas L.). Plant Cell
Tissue Organ Cult. 88:77-81.
Maluszynski, M.; Ahloowalia, B. S. and Sigurbjörnsson, B.
1995. Application of in vivo and in vitro mutation
techniques for crop improvement. Euphytica.
85:303-315.
Matsukura, C.; Yamaguchi, I.; Inamura, M.; Ban, Y.;
Kobayashi, Y.; Yin, Y.; Saito, T.; Kuwata, C.;
Imanishi, S. and Nishimura, S. 2007. Generation
of gamma irradiation-induced mutant lines of
the miniature tomato (Solanum lycopersicum L.)
cultivar ‘Micro-Tom’. Plant Biotechnol. 24:39-44.
Murashige, T. and Skoog, F. 1962. A revised medium for
rapid growth and bioassay with tobacco tissue
culture. Physiol. Plant. 15:473-497.
Muthusamy, A.; Vasanth, K.; Sivasankari, D.; Chandrasekar,
B. R. and Jayabalan, N. 2007. Effects of mutagens
on somatic embryogenesis and plant regeneration
in groundnut. Biol. Plant. 51(3):430-435.
Nakano, M.; Amano, J.; Watanabe, Y.; Nomizu, T.; Suzuki,
M.; Mizunashi, K.; Mori, S.; Kuwayama, S.; Han,
D-C.; Saito, H.; Ryuto, H.; Fukunishi, N. and Abe,
T. 2010. Morphological variation in Tricyrtis hirta
plants regenerated from heavy ion beam-irradiated
embryogenic calluses. Plant Biotechnol. 27:155-160.
Parry, M. A. J.; Madgwick, P. J.; Bayon, C.; Tearall, K.;
Hernández-López, A.; Baudo, M.; Rakszegi, M.;
Hamada, W.; Al-Yassin, A.; Ouabbou, H.; Labhilili,
M. and Phillips, A. L. 2009. Mutation discovery for
crop improvement. J. Expe. Bot. 60(10):2817-2825.
Predieri, S. and Zimmerman, R. H. 2001. Pear mutagenesis:
In vitro treatment with gamma-rays and field
selection for productivity and fruit traits. Euphytica.
117:217-227.
Prina, A.; Landau, A.; Pacheco, M. G. y Hopp, E. H.
2010. Mutagénesis, TILLING y EcoTILLING.
In: Levitus, G.; Echenique, V.; Rubinstein, C.;
Hopp, E. y Mroginski, L. (Eds.) Biotecnología y
mejoramiento vegetal II. Editorial INTA. Segunda
edicion. Argentina. 217-228 pp.
Sasaki, K.; Aida, R.; Niki, T.; Yamaguchi, H.; Narumi, T.;
Nishijima, T.; Hayashi, Y.; Ryuto, H.; Fukunishi,
N.; Abe, T. and Ohtsubo, N. 2008. High-efficiency
improvement of transgenic torenia flowers by ion
beam irradiation. Plant Biotechnol. 25:81-89.
Statistical Analysis System (SAS Institute). 2004. SAS/STAT
User’s Guide. Release 9 Edition. Cary, NC. USA.
Statistical Analysis System (SAS Institute). 2008. JMP
User’s Guide. Release 8 Edition. Cary, NC. USA.
Shillo, R. 1992. The cuber community holds the answer to
flowering problems in polianthes tuberose. Acta
Hortic. 325:139-364.
Shu, Q. Y. and Lagoda, P. J. L. 2007. Mutation techniques
for gene discovery and crop improvement. Mol.
Plant Breed. 5:193-195.
Steiner, A. A. 1984. The universal nutrient solution.
ISOSC. In: Proceedings 6th International Congress
on Soilless Culture. Lunteren. The Netherlands
633-649 pp.
Sugiyama, M.; Saito, H.; Ichida, H.; Hayashi, Y.; Ryuto,
H.; Fukunishi, N.; Terakawa, T. and Abe, T. 2008.
Biological effects of heavy-ion beam irradiation on
cyclamen. Plant Biotechnol. 25:101-104.
Suprasanna, P.; Rupali, C.; Desai, N. S. and Bapat, V. A. 2008.
Partial desiccation augments plant regeneration
from irradiated embryogenic cultures of sugarcane.
Plant Cell Tissue Organ Cult. 92:101-105.
Toker, C.; Yadav, S. S. and Solanki, I. S. 2007. Mutation
breeding. In: Yadav, S. S. (eds.) Lentil: An ancient
crop for modern times. Springer. 209-224 pp.
Van Harten, A. M. 1998. Mutation breeding: theory and
practical applications. Cambridge University Press,
Cambridge, UK. 353 pp.
Veitía, N.; García, L. R.; Bermúdez-Caraballoso, I.;
Orellana, P.; Padrón, Y. and Torres, D. 2007. Efecto
de las radiaciones gamma sobre callos de papa var.
‘Desirée’. Biotecnología Vegetal. 7(1):57-61.
Watanabe, S.; Mizoguchi, T.; Aoki, K.; Kubo, Y.; Mori,
H.; Imanishi, S.; Yamazaki, Y.; Shibata, D. and
Ezura, H. 2007. Ethylmethanesulfonate (EMS)
mutagenesis of Solanum lycopersicum cv.
Micro-Tom for large-scale mutant screens. Plant
Biotechnol. 24:33-38.
Waugh, R.; Leader, D. J.; McCallum, N. and Caldwell, D.
2006. Harvesting the potential of induced biological
diversity. Trends Plant Sci. 11(2):71-79.
Yamaguchi, H.; Shimizu, A.; Degi, K. and Morishita, T.
2008. Effects of dose and dose rate of gamma ray
irradiation on mutation induction and nuclear DNA
content in chrysanthemum. Breed. Sci. 58:331-335.
Yamaguchi, H.; Hase, Y.; Tanaka, A.; Shikazono, N.; Degi,
K.; Shimizu, A. and Morishita, T. 2009. Mutagenic
effects of ion beam irradiation on rice. Breed Sci.
59:169-177.
Yamaguchi, H.; Shimizu, A.; Hase, Y.; Degi, K.; Tanaka, A.
and Morishita, T. 2009. Mutation induction with ion
beam irradiation of lateral buds of chrysanthemum
and analysis of chimeric structure of induced
mutants. Euphytica. 165:97-103.
PERCEPCIÓN DE JARDINES CON ESPECIES SILVESTRES Y CULTIVADAS*
PERCEPTION OF GARDENS WITH WILD AND CULTIVATED SPECIES
Sebastiana Guadalupe Ramírez-Hernández1, J. Cruz García-Albarado1§, Arturo Pérez-Vázquez2, Andrés Bruno-Rivera1, Mónica
de la Cruz Vargas-Mendoza2 y Libia Iris Trejo-Tellez3
Campus Córdoba. Colegio de Postgraduados. Carretera Córdoba-Veracruz, km 385. Congregación Manuel León, Amatlán de los Reyes, Veracruz, México. C. P. 94946.
Tel. 01 271 7166504. ([email protected]), ([email protected]). 2Campus Veracruz. Colegio de Postgraduados. Carretera Xalapa-Veracruz, km 88.5.
Tepetates, Veracruz. México. C. P. 91700. Tel. 01 229 2010770. Ext. 64332. ([email protected]), ([email protected]). 3Campus Montecillo. Colegio de Postgraduados.
Carretera México-Texcoco, km 36.5, Montecillo, Texcoco, Estado de México, México. C. P. 56230. Tel. 01 595 9520200. Ext. 1262. ([email protected]). §Autor para
correspondencia: [email protected].
1
RESUMEN
ABSTRACT
La flora de Veracruz, México, es conocida por su gran
biodiversidad y riqueza de especies con potencial ornamental
alto. Sin embargo, escasos estudios han incorporado
plantas silvestres ornamentales en el diseño del paisaje o
áreas verdes. El objeto fue identificar la percepción de la
población local hacia el uso de plantas silvestres y especies
utilizadas tradicionalmente en jardines públicos. Para ello
tres plantaciones experimentales fueron establecidas en el
jardín del Colegio de Postgraduados Campus Córdoba, en
2008. Ubicado en Amatlán de los Reyes, México; empleando
especies herbáceas. En la primera plantación se utilizaron
especies cultivadas con un diseño formal (convencional); en
la segunda, especies silvestres con un diseño semiformal; y la
tercera plantación contenía especies silvestres en un diseño
informal (distribución aleatoria). En total se utilizaron 13
especies, ocho de ellas silvestres y cinco exóticas. Se evaluó
la percepción de usuarios (n= 112) de estas plantaciones in
situ, por medio de un cuestionario. Los resultados mostraron
que las características más aceptadas de las plantaciones,
fueron la asociación de plantas silvestres y cultivadas con
variaciones de color y atrayentes de insectos. La gente
mostró una respuesta favorable hacia la incorporación
de herbáceas silvestres en el diseño de las áreas verdes;
The flora of Veracruz, Mexico, is known for its high
biodiversity and richness of species with high ornamental
potential. However, only a few papers have incorporated
ornamental wild plants in the landscape design or green
areas. The aim was to identify the perception of the
local people towards the use of wild plants and species
traditionally used in public gardens. For this, three
experimental plantations were established in the gardens
of the College de Postgraduates, Cordoba Campus in
2008. Located in Amatlan de los Reyes, Mexico; using
herbaceous species. In the first plantation, species with
a formal design were used (conventional); in the second
one, wild species with a semiformal design and the third
planting contained wild species in an informal design
(randomized). In total, 13 species were used, eight of
them were wild and five were exotic. The user perception
of the plantations in situ was evaluated (n= 112), using a
questionnaire. The results showed that, the most popular
features for the plantations were the association of wild
and cultivated plants with color variations and insect
attractants. People showed a favorable response to the
addition of wild grasses in the design of green areas,
although it requires the implementation of advice and
* Recibido: mayo de 2011
aunque se requiere la implementación de asesoría y
conocimiento de aquellas especies con el potencial, para
su uso en paisajismo y además de diseñadores o arquitectos
que permita un arreglo espacial atractivo de las especies.
Esta investigación proporciona elementos que soportan el
diseño y planificación de plantaciones herbáceas estética y
ecológicamente deseables.
Palabras clave: diseño de paisaje, ornamentales,
plantaciones sustentable, preferencia de paisaje.
INTRODUCCIÓN
La sociedad obtiene múltiples beneficios de las plantas en
áreas verdes urbanas, que van desde el atractivo de las flores
hasta la transformación ecológica del paisaje (Kaplan y
Herbert, 1987). Actualmente se considera la planificación
del paisaje como un tema clave en la investigación científica
(Beunen y Opdam, 2011). Entre algunos beneficios que el
público puede identificar con la conservación y expansión
de bosques, se encuentran la generación de actividades
económicas, la conservación de la biodiversidad a través
del uso sustentable; así como la creación o mejoramiento
de paisajes estéticos (Nijnik y Mather, 2008).
En las áreas verdes urbanas el arbolado contribuye en
gran parte al contacto con la naturaleza, atrayendo la
satisfacción estética y de libertad asociada con actividades
al aire libre (Hunter, 2011). No obstante, existe un enorme
potencial paisajístico con el empleo de especies herbáceas,
el cual ha sido explorado en Europa y en menor grado en
Latinoamérica, muy a pesar del gran potencial que se tiene
de especies como en praderas silvestres o asociaciones de
plantas a orillas de carreteras, además de otras en bosques y
selvas, márgenes de ríos, entre otros. Se estima que México
cuenta con aproximadamente 30 000 especies de plantas
(Alanís et al., 2004), de las cuales, de acuerdo a MunguíaLino et al. (2010) se tiene un potencial aproximado de 4 220
especies para uso ornamental.
Por su parte, se considera que la flora del Estado de Veracruz
es cerca de 7 855 especies registradas, prevaleciendo las
herbáceas en más de 50%, (Castillo-Campos et al., 2011),
lo cual significa un potencial del uso en paisaje ya sea en
poblaciones rurales y urbanas. Sin embargo, el dominio
en zonas urbanas de construcciones, establecimiento
generalizado de plantas exóticas y considerables extensiones
Sebastiana Guadalupe Ramírez-Hernández et al.
knowledge of those species with potential for use in
landscaping and also designers and architects that allow
an attractive spatial arrangement of the species. This paper
provides elements that support the design and planning
of herbaceous plantings, aesthetic and environmentally
desirable.
Key words: landscape design, landscape preference,
ornamental, sustainable plantings.
INTRODUCTION
The society obtains many benefits from plants in the green
urban areas, ranging from the flowers’ attractiveness
to the greening of the landscape (Kaplan and Herbert,
1987). Currently, landscaping is considered as a key
issue in scientific research (Beunen and Opdam, 2011).
Among some benefits that the public can identify with
the conservation and expansion of forests there are,
the generation of economic activities, conservation
of biodiversity through sustainable use, as well as the
creation or enhancement of aesthetic landscapes (Nijnik
and Mather, 2008).
In urban green areas, the trees contribute largely to
the contact with nature, providing the aesthetic and
freedom satisfaction associated with outdoor activities
(Hunter, 2011). However, there is an enormous landscape
potential with the use of herbaceous species, which has
been explored in Europe and to a lesser extent in Latin
America, in spite of the great potential of grassland species
or associations of plants in roadsides, besides others in
the forests, river banks, among others. It is estimated that
Mexico has approximately 30 000 plant species (Alanís
et al., 2004), out of which, according to Munguia-Lino et
al. (2010), there is a potential of about 4 220 species for
ornamental use.
It’s considered that, the flora of Veracruz State has about
7 855 species registered, prevailing herbaceous in more
than 50% (Castillo-Campos et al., 2011), which means a
potential use in landscape in rural and urban populations
alike. However, the domain of constructions in urban areas,
the widespread establishment of exotic plants and large
areas of grass, and impervious materials such as pavement,
adversely affects the implementation of native plants and
wildlife in those areas (Hostetler et al., 2011).
Percepción de jardines con especies silvestres y cultivadas
de césped, y en general materiales impermeables como
pavimentos afecta negativamente la implementación de
plantas y fauna nativa en esos espacios (Hostetler et al., 2011).
Un sistema de plantación informal o alternativo al
convencional, se conoce como diseño ecológico o sustentable
de paisaje. Este tipo de plantación se caracteriza generalmente
por tener un estilo “naturalista” y utilizar vegetación silvestre,
principalmente nativa. Si se planifica bien, este tipo de paisajes
o áreas verdes tienden a la autorregulación a largo plazo, lo que
se reflejaría en una reducción de costos en el establecimiento
y mantenimiento (Kingsbury, 2001), alta diversidad de flora
y fauna (Diekelmann y Schuster, 2002) y dinamismo en la
imagen percibida a lo largo de las estaciones del año. En
contraste, una plantación formal o convencional, se identifica
por incluir generalmente especies cultivadas (exóticas) que se
distribuyen de manera controlada, precisa y uniforme; además
de ser manejada intensivamente para evitar la competencia
de plantas no deseadas y se considerara menos sustentable.
Actualmente el estilo naturalista es cada vez más practicado
por profesionales en paisaje.
Si se parte de la existencia de estos dos enfoques en el
diseño de plantaciones y/o jardines, es importante también
considerar la respuesta de los usuarios de estos espacios
públicos. Existe evidencia que la preferencia de los usuarios
por diseños formales es mayor, debido que son considerados
espacios más limpios y cuidados que los naturalistas
(Özgüner y Kendle, 2006). Esto ha provocado que en las
áreas verdes urbanas se utilicen especies ornamentales
exóticas, traídas de otras latitudes y que en algunas ocasiones
se han propagado tanto, que han llegado a ser perjudiciales
por su amplia adaptabilidad y propagación agresiva sobre
la flora local. De acuerdo con Aguirre-Muñoz y MedozaAlfaro (2009), en México existen al menos 15 de 32 especies
de plantas terrestres más perjudiciales.
A mediados de los años 90 surgen dos ideales para la
planeación y diseño de las ciudades, el urbanismo paisajístico
y la ecología urbana. El primero evolucionó como parte de
la arquitectura y la arquitectura del paisaje; mientras que
la ecología urbana ha tenido un mayor desarrollo en la
investigación y las ciencias, además de ser considera menos
estética (Steiner, 2011). Cabe mencionar que de acuerdo a De
la Fuente et al. (2006), la belleza escénica representa un papel
importante en el modo como se ha protegido el paisaje y su
conservación, considerados como belleza singular. Desde
la perspectiva de la ecología del paisaje, existe un gran interés
en la interpretación del paisaje en términos de los valores
461
An informal planting system or alternative to the
conventional is known as ecological design or sustainable
landscape. This type of planting is generally characterized
by a “naturalist” style and using wild plants, mostly native.
If well planned, this type of landscape or green areas tend
to long-term self-regulation, which would be reflected
in reduced costs of establishment and maintenance
(Kingsbury, 2001), high diversity of flora and fauna
(Diekelmann and Schuster, 2002) and dynamism in the
perceived image throughout the seasons. In contrast, a
formal or conventional planting is identified for including
cultivated species (exotic) that are distributed in a
controlled, accurate and uniform way; as well as being
intensively managed in order to prevent competition from
unwanted plants and is considered as less sustainable.
Currently, the naturalistic style is increasingly practiced
by landscape professionals.
Considering the existence of these two approaches in the
design of plantations and/or gardens, it is also important to
consider the response of the users of these public spaces.
There is evidence that users prefer formal designs, because
they are considered to be cleaner and care spaces than
naturalists (Özgüner and Kendle, 2006). This has resulted in
urban green areas using exotic ornamental species brought
from other places and in some cases they have been extended
until almost become harmful due to its wide adaptability and
aggressively spread on the local flora. According to AguirreMuñoz and Medoza-Alfaro (2009), in Mexico there are at
least 15 of the 32 more damaging terrestrial plants.
In the mid 90’s, two ideas for planning and designing of
cities arise, urban landscape and urban ecology. The first
one developed as part of the architecture and landscape
architecture; while the urban ecology has had a major
development in research and science, besides being
considered as less aesthetic (Steiner, 2011). It is worth
mentioning that, according to De la Fuente et al. (2006),
scenic beauty plays an important role in the way that the
landscape has been protected and its conservation, considered
as unique beauty. From the perspective of landscape ecology,
there is great interest in interpreting the landscape in terms
of human values. This perception can lead to develop new
criteria for ensuring the ecological functions of the landscape
in a manner consistent with the values and public demands.
Green-design has been implemented mainly in northern
hemisphere countries like the United Kingdom, Germany,
Netherlands and the United States of America (Hitchmough,
humanos. Tal percepción puede conducir a formular nuevos
criterios, que permitan garantizar las funciones ecológicas
del paisaje de forma compatible con los valores y demandas
del público.
El diseño ecológico se ha implementado principalmente en
países del hemisferio norte, como el Reino Unido, Alemania,
Holanda y Estados Unidos de América (Hitchmough, 2004);
sin embargo, Australia es un ejemplo adicional donde sus
especies silvestres y nativas se han utilizado en plantaciones
de jardines públicos (Hitchmough, 1996; Kendal et al., 2008).
El interés por la conservación y el uso de vegetación herbácea
silvestre con potencial ornamental se ha extendido también a
países latinoamericanos (Chile, Brasil, Argentina), los cuales
se observan en monocultivos y plantaciones mixtas que
incluyen especies nativas y exóticas, como una alternativa
para la reforestación (Piotto et al., 2002). Mientras el uso de
herbáceas nativas es incuestionablemente bueno, el uso de
plantas exóticas se consideran cada vez más como plantaciones
no sustentables; sin embargo esta afirmación puede ser más
cultural que lógica, pues problemas como la invasión y altos
costos de mantenimiento no son características exclusivas de
la vegetación exótica (Hitchmough, 2011).
A la fecha, se han realizado numerosos estudios sobre la
percepción del paisaje en espacios públicos; estos estudios
han permitido identificar las necesidades de los usuarios para
mejorar su entorno. La mayoría han evaluado el atractivo visual
y recursos estéticos del paisaje (De Groot y Van Den Brorn,
2003). Helfand et al. (2006) indican que los paisajes ecológicos
“saludables” no siempre son considerados “atractivos”,
además, sugieren que mucha gente no estaría dispuesta a
establecerlos y mantenerlos. García-Albarado y Dunnett
(2009) menciona que un paisaje o plantación demasiado natural
o “silvestre”, puede llegar a ser bien aceptado en un ámbito
urbano bajo ciertas normas, para su mayor aceptación que
permitan introducir vegetación nativa regional.
Por su parte, Nassauer (1993) ha propuesto que un diseño
informal o “naturalista”, que puede ser más aceptable bajo un
contexto de cuidado, particularmente si no parecen fuera de
control o abandonados. Ella sugiere que debe haber ciertas
“señales” de cuidado, tal como un anuncio discreto que
indique que ese jardín o plantación están bajo el cuidado de
alguien, o bien a través de una porción de césped podado al
frente o alrededor del conjunto de especies distribuidas en
estilo naturalista como (una pradera ornamental con flores
silvestres).
2004), but Australia is a further example where its wild and
native species have been used in planting public gardens
(Hitchmough, 1996; Kendal et al., 2008).
The interest in conservation and use of wild herbaceous
vegetation with ornamental potential has also spread to Latin
American countries (Chile, Brazil, Argentina), which are
observed in monocultures and mixed plantations including
native and exotic species, as an alternative to reforestation
(Piotto et al., 2002). While the use of native herbaceous is
unquestionably good, exotic plants are increasingly seen as
unsustainable plantations; however, this statement may be
more cultural than logic, as the problems such as invasion
and high maintenance costs are not unique features of the
exotic vegetation (Hitchmough, 2011).
Currently, there have been numerous studies on the
perception of the landscape in public spaces; these studies
have identified the user’s needs in order to improve their
environment. Most studies have assessed the visual appeal
and aesthetic resources of the landscape (De Groot and
Van Den Brorn, 2003). Helfand et al. (2006) indicated that
“healthy” ecological landscapes are not always considered
as “attractive”; they also suggest that many people would not
be willing to establish and sustain them. García-Albarado
and Dunnett (2009), mention that a too natural or “wild”
landscape or planting can be well accepted in an urban setting
with certain standards for a greater acceptance that enables
the introduction of regional native vegetation.
Nassauer (1993) has proposed that an informal or “naturalist”
design, which may be more acceptable in a context of care,
particularly if they do not seem out of control or abandoned.
She suggests that there must be some “signs” of care, such
as a discreet announcement indicating that the garden
or plantation is under the someone’s care, or through a
portion of mowed grass in front or around the set of species
distributed in a naturalistic style (such as an ornamental
meadow with wildflowers).
Moreover, there is a cultural influence for the appreciation
of the landscape. According to García-Albarado and Dunnett
(2009) there is evidence that a difference in perception
may vary according to demographics. In their study about
the influence of age and gender of the public towards
the preference of plantations with wild vegetation and
cultivated, they found that older people (over 60 years) and
youth (under 18) tend to have a greater preference for formal
plantings and less to the naturalists.
Por otra parte, existe una influencia cultural para la
apreciación del paisaje. Según García-Albarado y
Dunnett (2009) existe evidencia que una diferencia
de percepción puede variar de acuerdo a aspectos
demográficos. En su estudio sobre la influencia de la edad
y género del público hacia la preferencia de plantaciones
con vegetación silvestre y cultivada, encontraron que las
personas de la tercera edad (mayores a 60 años) así como
los jóvenes (menores a 18 años) tienden a tener mayor
predilección por plantaciones formales y menor hacia las
naturalistas.
Esta misma tendencia se encontró para los hombres a
diferencia de las mujeres. Otros estudios como el de Zheng
et al. (2011) sugieren una relación de percepción entre
la preferencia hacia áreas verdes formales o silvestres y
el lugar de residencia. Actualmente existen teorías que
explican la preferencia por el paisaje con plantas nativas,
y los estudios en torno a dicha temática se han realizado
utilizando metodologías de valoración económica o
modelos econométricos (Helfand et al., 2006).
A pesar de ser poco estudiada la percepción de paisaje
en México, recientemente ha surgido el interés por
identificar las relaciones de una nueva propuesta de paisaje
(usando plantas silvestres) y su grado de aceptación por
el público como usuario de las áreas verdes urbanas. Se
ha pretendido introducir especies silvestres y nativas con
alto potencial ornamental y asociadas a un aumento en
poblaciones de fauna asociada. Con esto se promovería
su eventual establecimiento en jardines públicos, y por
lo tanto, para promover una mayor sustetabilidad en el
diseño, establecimiento y manejo de paisaje urbano.
Es por ello que el objetivo del presente estudio, fue
evaluar la percepción que tienen los usuarios de áreas
verdes hacia el uso de especies silvestres ornamentales
silvestres y cultivadas, así como en combinación con
el diseño de jardines para la parte central del estado de
Veracruz.
Establecimiento de plantaciones
Se establecieron tres plantaciones de 4 m2 (2∗2 m) cada una,
en un jardín de fácil acceso (frente a un estacionamiento)
del Colegio de Postgraduados, Campus Córdoba. El
463
The same trend was found for men unlike women. Other
papers such as Zheng et al. (2011), suggested a perception
relationship between the preference towards formal or wild
green areas and the place of residence. Currently, there are
theories that explain the preference for the landscape with
native plants and studies about this subject have been made
using economic valuation methodologies or econometric
models (Helfand et al., 2006).
Despite the poorly studied perception of landscape in
Mexico, there has recently become an interest to identify
the relationships of a new landscape proposal (using wild
plants) and their acceptance by the public as users of urban
green areas. It has been tried to introduce wild and native
species with high ornamental potential and associated with
an increase in associated wildlife populations. This will
promote their eventual establishment in public gardens,
and therefore, to promote a greater sustainability in design,
establishment and management of urban landscape. That is
why the objective of this paper was to evaluate the users’
perception of green areas towards the use of ornamental
wild and cultivated species and, in combination with the
landscaping for the central part of Veracruz State.
Plantation establishment
Three plantations of 4 m2 (2∗2 m) each were established, in
an accessible garden (across the parking lot) of the Colegio
de Postgraduados, Campus Cordoba. The Campus is located
at 18º 51’ north latitude and 96º 51’ west longitude, at 645
masl, in the municipality of Amatlan de los Reyes, Veracruz,
Mexico. The average annual temperature is 19.9 °C and an
average annual rainfall of 1 800 mm (Anonymous, 2011).
The three plantations were established in 2008. The
establishment procedure consisted in transplants; all the
species had a maximum height up to 30 cm. The arrays were
formal, semiformal and informal (Figure 1). In the first only,
only cultivated plants were used, which represent familiarity
for the users and participants of the study: Duranta sp.,
Ixora coccinea, Chlorophytum comosum, Begonia sp. and
Alternathera bettzickiana. It had a geometrical arrangement,
using Duranta sp. as contrast of yellow and light green.
In the second planting, wild plants were included with a
geometric arrangement: Salvia coccinea (red, pink and
Campus está situado a los 18º 51’ latitud norte y 96º 51’
longitud oeste, a 645 msnm; en el municipio de Amatlán de
los Reyes, Veracruz, México. La temperatura media anual
es de 19.9 °C y una precipitación media anual de 1 800 mm
(Anónimo, 2011).
Las tres plantaciones se establecieron en 2008. El
procedimiento de establecimiento fue por trasplante,
todas las especies utilizadas tuvieron una altura
máxima hasta de 30 cm. Los arreglos fueron formal,
semiformal e informal (Figura 1). En la primera se
utilizaron sólo plantas cultivadas, las cuales representan
familiaridad para los usuarios y participantes del estudio:
Duranta sp., Ixora coccínea, Chlorophytum comosum,
Begonia sp. y Alternathera bettzickiana. Su arreglo
fue geométrico utilizando como especie de contraste
amarillo y verde claro a Duranta sp. En la segunda
plantación se incluyeron plantas silvestres con un arreglo
geométrico: Salvia coccinea (roja, rosa y blanca), Crucea
calosephala, Leonorus sibiricus, Ruellia coerulea,
Centratherum punctatum y Oenothera rosea. En la tercer
plantación se utilizaron plantas silvestres en su mayoría,
excepto por Zinnia spp. con distribución que simulara
una pradera. Estas fueron: Salvia coccinea (roja, rosa
y blanca), Ruellia coerulea, Rusellia sarmentosa y
Oenothera rosea.
white), Crucea calosephala, Leonorus sibiricus, Ruellia
coerulea, Centratherum punctatum and Oenothera rosea.
In the third one, almost only wild plants were used, except
for Zinnia spp. with a meadow-like distribution. These were:
Salvia coccinea (red, pink and white), Ruellia coerulea,
Rusellia sarmentosa and Oenothera rosea.
The basis for establishing three planting designs responds to
the need to finding relationships between user’s preference
and the characteristics of each design. I. e., to identify if
there is any direct relationship between the arrangement
of the plants and relevant aspects, such as the flowers’
color and foliage that can be identified by the participants
and that may influence the perception of the used species.
Also, combinations of wild or only cultivated can give
an acceptance difference. The three plantations were
established at five meters distance between them in a linear
array (Figure 1). The three arrangements were in one place
to facilitate the participants’ assessment.
Arreglo
Especies cultivadas
Especies silvestres
Duranta sp.
Ixora coccinea
Chlorophytum comosum
Begonia sp.
Alternanthera bettzickiana
Formal
Salvia coccinea (blanca)
Salvia coccinea (roja)
Crucea calocephala
Salvia coccinea (rosa)
Leonorus sibiricus
Ruellia coerulea
Centratherum punctatum
Oenothera rosea
La base de establecer tres diseños de plantaciones
responde a encontrar relaciones entre la preferencia
de los usuarios y las características de cada diseño. Es
decir, identificar si existe alguna relación directa entre
el arreglo de las plantas y aspectos relevantes, como el
color de flores y follajes que puedan ser identificados por
los participantes y que puedan influir en la percepción
de las especies utilizadas. Además combinaciones de
plantas silvestres o sólo cultivadas pueden dar una
diferencia de aceptación. Las tres plantaciones se
establecieron a cinco metros de distancia entre ellas en
un arreglo lineal (Figura 1). Se partió de tener los tres
arreglos en un mismo lugar para facilitar la evaluación
de los participantes.
Figura1. Diseño de las tres plantaciones y sus especies de
plantas.
Figure 1. Design of the three plantations and plant species.
Una vez establecidas las plantaciones a través del
sistema de transplante, se esperó por un período de
cuatro semanas para permitir a las plantas su adaptación
y comienzo de la floración (Figura 2). Después se inició
con la aplicación del instrumento de evaluación, para
determinar la percepción de los usuarios hacia estas
plantaciones.
Once the plantations were established through the
transplant system, for a period of four weeks the plants
were allowed to adapt and beginning to flowering (Figure
2). Then, the assessment tool implementation began, in
order to determine the perception of the users towards
these plantations.
Semiformal
Zinnia sp.
Salvia coccinea
Ruellia coerulea
Ruellia sarmentosa
Oenothera rosea
Informal
Formal
Semiformal
465
Informal
Figura 2. Vista de tres tipos de plantaciones con especies herbáceas (silvestres y cultivadas) establecidas en el Campus Córdoba.
Figure 2. View of three types of plantations with herbaceous species (wild and cultivated) established in Córdoba Campus.
Evaluación de percepción
Perception assessment
Se tuvo la participación de personas voluntarias (n= 112),
que visitaron el Colegio de Postgradudos en Ciencias
Agrícolas Campus Córdoba, en el periodo comprendido
entre 9 al 13 de septiembre de 2008, en horario de las 9
a las 13 h. Este horario permitió a los participantes tener
una mejor apreciación de las plantas, como su color,
composición y contemplar la presencia de fauna asociada,
ya que existen especies como Salvia coccinea que apertura
sus flores por la mañana solamente, después de las once de
la mañana cierra éstas y ya no se aprecia su mismo colorido
en el transcurso del día.
We had the participation of volunteers (n= 112), who visited
the College de Postgraduados, Campus Córdoba, in the
period from September 9th to 13th, 2008, in the hours from 9 to
13 h. This schedule allowed the participants to have a better
appreciation of the plants, such as the color, composition and,
to contemplate the presence of the associated fauna, as there
are species such as Salvia coccinea that open the flowers just
in the morning, closing after eleven oʼclock and no longer
showing the same color during the day.
Cada plantación estuvo identificada con una letra
impresa en un letrero al frente de la misma (A, B y C
para formal, semiformal e informal, respectivamente).
A cada participante se le proporcionó un cuestionario
como instrumento de evaluación. Una vez indicadas
las instrucciones, justo frente a las plantaciones, los
cuestionarios permitieron contestar de manera concreta
las preguntas para cada plantación.
El cuestionario consistió en cuatro secciones de preguntas:
1) información básica de los participantes, como el género,
la edad, el domicilio y la frecuencia de visitas a parques
y jardines públicos; 2) la percepción por cada plantación
y las razones; 3) la percepción de aspectos relevantes de
cada plantación (diseño, color, altura, diversidad de flores
y presencia de insectos); y 4) una pregunta abierta para
determinar si les gustaría ver más alguna plantación en un
espacio abierto. Para el caso de las secciones 2 y 3 se utilizó
una escala de Likert, donde se midió el gradiente 1= disgusta
mucho a 5= gusta mucho.
Each plantation was identified with a letter printed on a sign
in front of it (A, B and C to formal, semiformal and informal,
respectively). Each participant was given a questionnaire
as an assessment tool. Once given the instructions, right in
front of the plantations, the questionnaires allow answering
the questions for each plantation.
The questionnaire consisted of four sections of questions:
1) basic information of the participants, such as gender,
age, address, and the frequency of visits to parks and public
gardens, 2) the perception for each plantation and the
reasons, 3) the perception of relevant aspects of each planting
(design, color, height, variety of flowers and the presence
of insects) and, 4) an open question to determine if they
would like to see some planting in open space. In the case
of sections 2 and 3 a Likert scale was used, which measured
the gradient 1= dislike a lot to 5= very much.
Descriptive statistics in the program Statistica 6.0
(Statsoft ®, Tulsa, Oklahoma, USA), for the general
variables of the participants (age, gender, place of origin,
level of education). However, the relevant variables for
Se realizó estadística descriptiva en el programa Statistica
6.0 (Statsoft®, Tulsa, Oklahoma, EE.UU.) para las variables
generales de los participantes (edad, género, localidad
de origen, grado de estudios). Sin embargo, las variables
relevantes de cada plantación como diseño, color, altura,
diversidad de f lores y presencia de insectos, fueron
evaluadas mediante la comparación de medias y análisis de
varianza por el mismo programa.
each planting such as design, color, height, flower and
diversity of insects were evaluated by comparing the mean
and variance analysis in the same program.
Due to the location of the Campus Córdoba where the research
was conducted, the interviewed participants came from
several nearby locations. 42% and 12% of the municipalities
of Córdoba and Cuitláhuac, respectively. The remaining 46%
came from other communities also in the central region where
the study results would have a direct impact. Regarding the
gender, we identified a balance between men and women
(51% men and 49% women). The average age was 29 years,
ranging between 13 and 69. Regarding the education, 33%
were students, 32% professionals mostly related to biology
and agricultural sciences, 11% practitioners and 24% reported
other occupation.
Los participantes
Debido a la ubicación del Colegio de Postgraduados Campus
Córdoba, en el centro del Estado de Veracruz, lugar donde
se realizó la investigación, los participantes entrevistados
provinieron de distintas localidades cercanas. El 42% y 12%
de los municipios de Córdoba y Cuitláhuac, respectivamente.
El 46% restante provino de distintas comunidades también
de la región central, donde los resultados del estudio tendrían
un impacto directo. En cuanto a género, se identificó un
balance entre hombres y mujeres (51% hombres y 49%
mujeres). La edad promedio fue de 29 años, con un rango
entre 13 y 69 años. En cuanto a formación profesional,
33% eran estudiantes, 32% profesionales en su mayoría
relacionados con la biología y ciencias agrícolas, 11%
trabajadores de campo y 24% reportaron otra ocupación.
En relación a la frecuencia de visitar áreas verdes, se
encontró que 26% de los participantes las visita a menudo;
65% ocasionalmente, 6% rara vez y 3% nunca visita este
tipo de lugares. Estos resultados indican que no hay una
cultura importante por visitar áreas verdes en esta región
de Veracruz y es quizá debido que el entorno natural
provisto de abundante vegetación, provee esa necesidad,
situación que de acuerdo a Márquez y Márquez (2009)
esta zona está provista principalmente de bosque tropical
perennifolio, bosque tropical caducifolio y bosque tropical
subcaducifolio, la convierte en una región con basta riqueza
natural y donde las personas satisfacen un contacto directo
con la naturaleza; tal vez pueda influir la necesidad de asistir
a un parque público.
Percepción de las plantaciones
Existió tendencia positiva de los participantes hacia los
diseños formal e informal sobre el semiformal (Cuadro 1).
Participants
In relation to the frequency of visiting the green-areas, it
was found that 26% of the participants often visit them, 65%
occasionally; rarely 6% and 3% never visit these places.
These results indicate that there is an important culture for
visiting green-areas in this region of Veracruz and is perhaps
due to the natural environment provided by the vegetation,
provides this need, a situation that according to Márquez and
Márquez (2009) this area is provided mainly with tropical
evergreen forest, tropical deciduous forest and tropical
semi-deciduous forest, making it a region with vast natural
richness, where the people meet direct contact with nature
influencing the need to attend a public park.
Perception of plantations
There was a positive tendency of participants to formal and
informal designs over the semiformal (Table 1).
Cuadro 1. Tendencias de preferencia otorgadas por tipo
de plantación.
Table 1. Trends of preference granted by type of planting.
Plantación
Formal
Semiformal
Informal
Calificación
8.6 a
6b
8.3 a
Máxima
10
10
10
Mínima
4
1
4
Tratamientos con la misma letra son estadísticamente similares (p< 0.05).
467
Plantación formal
Formal plantation
El 77% de los participantes consideraron que la plantación
formal presentaba buen color, diseño, distribución y
vistosidad; sólo una proporción mínima (3%) señalaron que
presentaba una distribución desagradable y llamaba poco la
atención (Figura 3). Respecto a los comentarios adicionales
sobre este diseño, se destacó que las plantas que conformaban
la plantación le proporcionaba mucha vistosidad que hacía
que llamara la atención, aún cuando la presencia de flores
fuera mínima. Esta preferencia fue notoria en el diseño
formal, y se observó de forma menor en los otros dos diseños
(semiformal e informal) donde solo había flores y el follaje
era predominantemente verde. Estudios previos indican que la
gente tiende a preferir plantas con flores de colores brillantes
en contraste con colores tenues, ya que estos proporcionan
alegría, dinamismo, confianza y significado de amistad
(Todorova et al., 2004). Esto fue notorio en la plantación
formal y menor en las otras dos plantaciones.
The 77% of participants felt that formal planting had
good color, design, distribution and striking, only a small
proportion (3%) said that they had a bad distribution and
drew little attention (Figure 3). Regarding the additional
comments on this design, it was noted that plants
that made up the plantation gave him much that was
striking to attract attention, even when the presence of
flowers was minimal. This preference was evident in the
formal design and smaller form was observed in the
other two designs (semi-formal and informal) where
there were only flowers and foliage was predominantly
green. Previous studies indicated that people tend to
prefer plants with brightly colored flowers contrasting
with light colors as these bring joy, vitality, confidence
and meaning of friendship (Todorova et al., 2004). This
was evident in formal planting and lower in the other two
plantations.
100
Número de entrevistados
90
80
70
60
50
40
30
20
10
0
Buen color, buena
distribución,
mucha vistosidad
Arreglo artificial
o convencional
Muy saturado
No atrae insectos
Mala distribución
poca vistosidad
Figura 3. Opiniones sobre algunos aspectos relevantes de la evaluación de la plantación formal.
Figure 3. Views on some important aspects of the evaluation of formal planting.
Plantación informal
Informal planting
Para la plantación informal, 82% de los participantes
consideró que era agradable el colorido de sus flores, así
como observar la diversidad de especies (plantas e insectos)
que la conformaban, ya que tenía un aspecto muy natural.
El resto de los participantes (18%) no estuvo de acuerdo
con este arreglo, considerando que la plantación carecía
de diseño y presentaba flores poco atractivas (Figura 4).
Esto demuestra que a pesar que existe un reconocimiento y
valoración de biodiversidad en un pequeño espacio, ejemplo
un jardín, aún hay quienes perciben estas plantaciones como
desordenadas (Nassauer, 2009).
For informal planting, 82% of the participants felt that
it was nice, the colorful f lowers and got to see the
diversity of species (plants and insects) that formed, as it
looked quite natural. The remaining participants (18%)
disagreed with this arrangement, considering that
the plantation had lacked design and unattractive
f lowers (Figure 4). This shows that, although there
is a recognition and appreciation of biodiversity in
a small space, such as a garden, there are still those
who see these plantations as disordered (Nassauer,
2009).
100
90
80
70
60
50
40
30
20
10
0
Mucho colorido Diversidad de Muy natural, no
por sus flores especies (plantas es común, muy
e insectos)
atractivo
Jardín
descuidado,
flores no
agradable
Falta diseño
Figura 4. Aspectos relevantes de la evaluación de la plantación informal.
Figure 4. Relevant aspects of the evaluation on the informal planting.
De hecho, existe gran interés en la incorporación de
plantas nativas silvestres en áreas verdes y actividades de
vivero (Wrigley, 1996). Nassauer (1993) reporta que la
incorporación de plantas silvestres en áreas verdes puede
convertir éstas más atractivas para la gente que aquellas
áreas que no las incluyen.
Plantación semiformal
Para la plantación semiformal, sólo 14% la consideró como
agradable debido a la presencia de insectos, tales como
mariposas y abejas. El 40% de los participantes consideró que
carecía de diseño, colorido y poca presencia de flores (Figura 5).
In fact, there is a great interest in incorporating native
wild plants in landscaping and nursery activities (Wrigley,
1996). Nassauer (1993) reported that, the incorporation
of wild plants in landscaping can make them more
attractive.
Semiformal planting
For semiformal planting, only 14% considered it as
enjoyable because of the presence of insects such as
butterflies and bees. 40% of participants found that
it lacked design, color and little presence of flowers
(Figure 5).
100
90
80
70
60
50
40
30
20
10
0
Poca vistosidad
Falta color y
diseño
Pocas flores e Atrae muchos insectos
insectos
y es agradable
Maleza
Figura 5. Aspectos relevantes de la evaluación de la plantación semiformal.
Figure 5. Relevant aspects of the evaluation on the semiformal planting.
Otros aspectos relevantes de las plantaciones
Other relevant aspects of plantations
De las características más relevantes por los participantes,
se destaca la diversidad de color en las flores y de insectos
como mariposas y abejas.
From the most important characteristics made by the
participants, the diversity of color in the flowers and insects
such as butterflies and bees are noteworthy.
469
Color y fauna asociada
Color and fauna associated
El color fue una característica importante en el diseño de
las plantaciones porque determinaron en gran medida la
preferencia hacia algún diseño (Cuadro 2). Para las tres
plantaciones la diversidad de colores fue estadísticamente
significativa (p< 0.05).
Color was an important feature in the design of the
plantations, because it largely determined the preference for
the design (Table 2). For the three plantations, the diversity
of colors was statistically significant (p< 0.05).
Cuadro 2. Análisis de varianza para el criterio diversidad
de colores e insectos.
Table 2. Analysis of variance for the standard range of
colors and insects.
Plantación
Semiformal
Formal
Informal
Diversidad de
colores
5.6 a
8.3 b
8.8 c
Diversidad de
insectos
5.3 a
6.9 b
8.7 c
Tratamientos con la misma letra son estadísticamente similares (p< 0.05).
Los resultados para el diseño semiformal, mostraron que
los visitantes percibieron al color con poco atractivo y
pudo deberse a la menor diversidad de colores y texturas
en flores y follajes, con respecto a la plantación informal
y formal. Hitchmough (2004) indica que el color es un
factor importante en el diseño de jardines urbanos. Incluso,
cuando variados colores están presentes en la plantación,
se enriquece de texturas y colorido. Esto está relacionado
con el número de especies con flores, a mayor número de
especies habrá mayor riqueza de color y por tanto mayor
aceptación, de acuerdo a los resultados del estudio y otros
(García-Albarado y Dunnett, 2009).
Otra característica que puede estar asociada al color es
la cantidad de insectos. Las tres plantaciones fueron
significativamente diferentes (p< 0.05) a este respecto. En la
plantación informal, los participantes señalaron una mayor
diversidad (mariposas y abejas), los cuales proporcionaron
mayor agrado y comodidad para los visitantes. Por el
contrario, los participantes identificaron en la plantación
formal baja concentración de fauna (Cuadro 2).
Plantaciones alternativas
¿Qué tipo de plantación desearían ver en las áreas verdes
públicas?, se encontró que a pesar de la utilización de
especies cultivadas en los jardines, los encuestados se
inclinaron por nuevas opciones para estas áreas. Esta
situación indica preferencia por el uso de especies
The results for the semi-formal design showed that, the
visitors perceived the unattractive color and could be due to
less diversity of colors and textures of flowers and foliage,
with respect to the informal and formal planting. Hitchmough
(2004) indicated that, the color is an important factor in the
design of urban gardens. Even when different colors are present
in the plantation, rich textures and colors. This is related to the
number of species with flowers, more species will be richer in
color and therefore greater acceptance, according to the study
results and others (García-Albarado and Dunnett, 2009).
Another feature that can be associated to color is the number
of insects. The three plantations were significantly different
(p< 0.05) in this regard. In informal planting, participants
noted a greater diversity (butterflies and bees), which
provided more pleasure and comfort for the visitors. In
contrast, the participants identified in the formal planting,
low concentration of fauna (Table 2).
Alternative crops
What kind of planting would you like to see in the greenpublic areas? we found that, despite the use of species grown
in the gardens, the respondents were in favor of new options
for these areas. This indicates a preference for the use of
wildlife in public green areas, particularly students (33%) and
professionals (33%) who showed a preference for wild plants.
Therefore, throughout this study is started to implement option
alternative crops where wild flora has a greater acceptance.
The ecological role these plants play in attracting associated
wildlife (butterflies, hummingbirds, etc.) helps to provide a
greater degree of user´s acceptance. Finally, this project adds
to the research work in Mexico, in order to take advantage of
the local flora as an ornamental potential.
CONCLUSIONS
Whatever type of design (formal, semiformal or formal),
people tend to perceive positively the use of wild grasses for
its diversity of species, colors and the attraction of associated
silvestres en las áreas verdes públicas, en particular por
los estudiantes (33%) y profesionales (33%), quienes
mostraron una mayor preferencia por las plantas silvestres.
Por lo tanto, a través de este estudio se inicia la opción
de implementar plantaciones alternativas donde la flora
silvestre tenga mayor aceptación. El papel ecológico que
estas plantas juegan en la atracción de la fauna silvestre
asociada (mariposas, colibríes, etc.) ayuda a proveer de un
mayor grado de aceptación de los usuarios. Por último, este
proyecto se suma al trabajo de investigación en México,
con la finalidad de aprovechar la flora local como potencial
ornamental.
CONCLUSIONES
Independientemente del tipo de diseño (formal, semiformal
o formal), las personas tienden a percibir positivamente
el uso de plantas herbáceas silvestres por su diversidad
de especies, colorido y la atracción de la fauna asociada
(mariposas y abejas principalmente). Las plantas
cultivadas, tradicionalmente utilizadas en jardinería,
demuestran ser útiles en la aceptación de las especies
silvestres, ya que proporcionan mayor familiaridad hacia
los usuarios, así como reforzaron el color y aportaron
estructura a la plantación.
AGRADECIMIENTOS
Los autores(as) agradecen el apoyo brindado para la
realización de esta investigación al Proyecto FOMIXVeracruz 37622, así como a la línea prioritaria de investigación
4. Agronegocios, agroecoturismo y arquitectura del paisaje
y al Campus Córdoba del Colegio de Postgraduados en
Ciencias Agrícolas.
LITERATURA CITADA
Aguirre-Muñoz, A. y Mendoza-Alfaro, R. 2009. Especies
exóticas invasoras; impactos sobre las poblaciones
de f lora y fauna, los procesos ecológicos y la
economía, In: capital natural de México, Vol. II:
estado de conservación y tendencias de cambio.
Conabio. México. 277-318 pp.
fauna (butterf lies and bees in particular). Cultivated
plants, traditionally used in gardening, prove to be useful
in the acceptance of wildlife because they provide greater
familiarity to the users and, enhanced the color and structure
contributed to the plantation.
Alanís, G. J.; Velazco, C. G.; Foroughbakhch, R.; Valdés,
V. y Alvarado, M. A. 2004. Diversidad florística de
Nuevo León: especies en categoría de riesgo. Ciencia
UANL. Universidad Autónoma de Nuevo León.
7(2):209-218.
Anónimo. 2011. Sistemas de información municipal.
Cuadernillos municipales. Amatlán de los Reyes.
Gobierno del Estado de Veracruz. Sefiplan. 12 p.
Beunen, R. and Opdam, P. 2011. When landscape planning
becomes landscape governance, what happens
to the science? Landscape and Urban Planning.
100:324-326.
Castillo-Campos, G.; Avedaño-Reyes, S. y Medina-Abreo,
M. A. 2011. Flora y vegetación. In: la biodiversidad
en Veracruz, Vol. I: estudio de estado. CruzAngón A. (Coord). Comisión Nacional para el
Conocimiento y Uso de la Biodiversidad, Gobierno
del Estado de Veracruz, Universidad Veracruzana,
Instituto de Ecología A. C. México. 161-180 pp.
De Groot, W. T. and Van Den Born, R. J. G. 2003. Visions
of nature and landscape type preferences: an
exploration in the Netherlands. Landscape and
Urban Planning. 63:127-138.
De la Fuente, G. J.; Atauri, J. A. and De Lucio, J. V. 2006.
Relationship between landscape scenic quality and
its visual and spatial structure in mediterranean
regions. Landscape Ecology. 77(4):393-407.
Diekelmann, J. and Schuster, R. M. 2002. Natural
landscaping: designing with native plant
communities (2 nd edition). The University of
Wisconsin Press. Madison, USA. 302 p.
García-Albarado, J. C. y Dunnett, N. 2009. Percepción
del público hacia plantaciones de herbáceas
ornamentales. Revista Chapingo. Serie Horticultura.
15(2):49-55.
Helfand, G. E.; Park, J. S.; Nassauer, J. I. and Kosek, S.
2006. The economics of native plants in residential
landscape designs. Landscape and Urban Planning.
78:229-240.
Hitchmough, J. 2011. Exotic plants and plantings in the
sustainable, designed urban landscape. Landscape
and Urban Planning. 100:380-382.
Hitchmough, J. D. 2004. Naturalistic herbaceous vegetation for
urban landscapes. In: the dynamic landscape. Design,
ecology and management of naturalistic urban.
Dunnett, N. and James, H. (ed.). London. 130-181 pp.
Hitchmough, J. D. 1996. A native revolution. Landscape
Design. 255:14-16.
Hostetler, M.; Allen, W. and Meurk, C. 2011. Conserving
urban biodiversity? Creating green infrastructure is
only the first step. Landscape and Urban Planning.
100:369-371.
Hunter, M. R. 2011. Impact of ecological disturbance on
awareness of urban nature and sense of environmental
stewardship in residential neighborhoods. Landscape
and Urban Planning. 101: 131-138.
Kaplan, R. and Herbert, E. 1987. Cultural and sub-cultural
comparisons in preferences for natural settings.
Landscape and Urban Planning. 14:281-293.
Kendal, D.; Williams, K. and Armstrong, L. 2008. Preference
for and performance of same Australian native
plants grown as hedges. Urban Forestry & Urban
Greening. 7:93-106.
Kingsbury, N. 2001. New approaches in perennial use/ Neue
Wege in der Staudenverwendung. Topos. 37:75-83.
Márquez, W. y Márquez, J. 2009. Municipios con mayor
biodiversidad en Veracruz. Foresta veracruzana.
11(2):43-50.
Munguía-Lino, G.; Vázquez-García, L. M. y LópezSandoval, J. A. 2010. Plantas silvestres ornamentales
comercializadas en los mercados de la f lor de
Tenancingo y Jamaica, México. Polibotánica.
29:281-308.
471
Nassauer, J. I. 1993. Ecological function and the perception
of suburban residential landscapes, In: managing
urban and high-use recreation settings, general
technical report. Gobster, P. H. (ed.). USDA. St.
Paul, USA. 55-60 pp.
Nassauer, J. I. 2009. What will the neighbors think? Cultural
norms and ecological design. Landscape and Urban
Planning. 92:282-292.
Nijnik, M. and Mather, A. 2008. Analyzing public
preferences concerning woodland development in
rural landscapes in Scotland. Landscape and Urban
Planning. 86:267-275
Özgüner, H. and Kendle, A. D. 2006. Public attitudes towards
naturalistic versus designed landscapes in the city
of Sheffield (UK). Landscape and urban planning.
74:139-157.
Piotto, D.; Montagnini, F.; Kanninen, M.; Ugalde, L. y
Viquez, E. 2002. Comportamiento de las especies
y preferencias de los productores. Plantaciones
forestales en Costa Rica y Nicaragua. Revista
Forestal Centroamericana. 38:59-66.
Steiner, F. 2011. Landscape ecological urbanism: origins
and trajectories. Landscape and urban planning.
100:333-337.
Todorova, A.; Asakawa, S. and Aikoh, T. 2004. Preferences
for and attitudes towards street flowers and trees in
Sapporo, Japan. Landscape and Urban Planning.
69:403-416.
Wrigley, J. W. 1996. Australian native plants: propagation,
cultivation and use in landscaping. Reed Books.
(4th edition). Sydney, Australia. 696 p.
Zheng, B.; Zhang, P. and Chen, J. 2011. Preference to home
landscape: wildness or neatness?. Landscape and
Urban Planning. 99:1-8.
CARACTERES MORFOLÓGICOS Y BIOQUÍMICOS DE Rosa x hybrida CONTRA
Tetranychus urticae Koch EN INVERNADERO*
MORPHOLOGICAL AND BIOCHEMICAL CHARACTERS OF Rosa x hybrida
AGAINST Tetranychus urticae Koch IN GREENHOUSE
Ricardo Javier Flores Canales1§, Rosalina Mendoza Villareal2, Jerónimo Landeros Flores2, Ernesto Cerna Chávez2, Agustín
Robles Bermúdez1 y Néstor Isiordia Aquino1
Unidad Académica de Agricultura, Universidad Autónoma de Nayarit. Carretera Tepic-Compostela, km 9. Xalisco, Nayarit, México. C. P. 63770. Tel. 01 311 1453474,
2301411 y 1367377. ([email protected]), ([email protected]). 2Departamento de Parasitología Agrícola. Universidad Autonoma Agraria Antonio Narro.
Carretera a Zacatecas, Buenavista, Saltillo, Coahuila, México. C. P. 25315. Tel. 01 844 4361736, 10002647. ([email protected]), ([email protected]),
([email protected]). §Autor para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
Este estudio tuvo como objetivo, conocer el comportamiento
poblacional del ácaro de dos manchas (Tetranychus urticae
Koch.) en 13 cultivares de rosal y determinar la correlación
que existe entre los caracteres bioquímicos (terpenos, taninos
y aceites esenciales) y morfológicos (tricomas, glándulas
y grosor de hoja), aunado a poblaciones del ácaro de dos
manchas. En 13 cultivares de rosal para corte se liberó
una población de 100 hembras adultas por planta; una vez
establecida la población del ácaro se tomaron muestras de
2 a 7 g de masa foliar con una frecuencia semanal durante
57 días. Se hizo un análisis bioquímico de las muestras y la
información resultante se sometió a análisis de varianza y
comparación de medias por el método Tukey (p= 0.05). De
las poblaciones de ácaros en 13 cultivares (expresados en
ácaros-día-hoja) en ocho fechas de muestreo; adicionalmente
se hizo un análisis de correlación y regresión múltiple de la
población con las variables. El cultivar Luna® presentó mayor
desarrollo poblacional con un promedio de 2 784.1 ácaros
por día, seguido de Gran Gala®, Verdi®, y Vendela®, con 1
472.5, 1 307 y 1 076 ácaros por día, respectivamente. Por
otro lado en los cultivares Movie Star®, Emma® y Virginia®
This study aimed to knowing the population behavior
of the red spider mite (Tetranychus urticae Koch.) in 13
rose cultivars and, to determine the correlation between
biochemical (terpenes, tannins and essential oils) and
morphological characters (trichomes, glands and sheet
thickness), coupled with populations of the red spider
mite. In 13 cultivars of cutting-roses a population of 100
female adults per plant got released; once the red spider
mite population was established, samples from 2 to 7 g of
litter mass on a weekly basis were taken for 57 days. There
was a biochemical analysis of the samples and the resulting
information was submitted to an analysis of variance
and means comparison by Tukey’s method (p= 0.05).
Populations of mites in 13 cultivars (expressed in miteday-sheet) in eight sampling dates, was further correlation
analysis and multiple regression of population variables.
The Luna® cultivar had a higher population development
with an average of 2 784.1 mites per day, followed by Gran
Gala®, Verdi® and Vendela®, with a 1 472.5, 1 307 and 1 076
mites per day, respectively. On the other hand, in the Movie
Star®, Emma® and Virginia® cultivars, a fewer quantity of
Aceptado: agosto de 2011
Ricardo Javier Flores Canales et al.
se encontró menor cantidad de ácaros con 3 77.5, 444.7 y
486.4, respectivamente. Del análisis de regresión se observó
correlación negativa con los aceites esenciales y positivos
en terpenos, grosor de hoja, y contenido de nitrógeno.
mites was found, 3 77.5, 444.7 and 486.4, respectively. In the
regression analysis, a negative correlation with the essential
oils was observed and a positive one in the terpenes, leaf
thickness and nitrogen content.
Palabras clave: antibiosis, antixenosis, aceites esenciales,
resistencia vegetal, trofobiosis.
Key words: antibiosis, antixenosis, essential oils, plant
resistance, trophobiosis.
INTRODUCCIÓN
INTRODUCTION
El ácaro de dos manchas (Tetranychus urticae Koch.), es
una plaga polífaga, considerada como la principal plaga del
rosal en invernadero. Cuando no se lleva a cabo un manejo
adecuado de esta plaga baja la calidad y producción de la
flor (Bolland et al., 1998). Los miembros de la familia
Tetranychidae son una plaga que se presenta en una gran
diversidad de plantas que le ocasionan daños severos como
la disminución del vigor del árbol y el manchado, así como
la caída de las hojas provocado por la alimentación del ácaro
(Kheradpir et al., 2007).
The red spider mite (Tetranychus urticae Koch) is a
polyphagous pest, considered the main pest of roses in
greenhouses. When proper management is not performed,
the quality of the flower production diminishes (Bolland
et al., 1998). The members Tetranychidae family members
are a pest that occurs in a wide variety of plants that cause
several damage such as low tree vigor, staining, as well as leaf
dropping caused by the mite’s feeding (Kheradpir et al., 2007).
En estado de adulto presenta dos manchas bien definidas,
su coloración es más pálida y las manchas son casi
perfectas (Marcic, 2007). Sadrás et al. (1998) indican
que T. urticae se alimenta principalmente del mesófilo, lo
cual reduce significativamente la resistencia estomática y
la tasa respiratoria, además trae por consecuencia severas
afectaciones en la tasa de absorción energética de la planta,
con los consecuentes daños a la planta por la alimentación
directa, ya que reduce el área de actividad fotosintética y
causa abscisión en la hoja (Gorman et al., 2001). Landeros
et al. (2004) mencionan que cinco ácaros por hoja son
suficientes para reducir el rendimiento y calidad de las rosas
del siguiente corte. Con el paso del tiempo, el uso irracional de
agroquímicos presenta desventajas, tales como la destrucción
de la fauna silvestre y la inducción de resistencia a la mayoría
de los productos utilizados (Cerna et al., 2005).
El control de T. urticae en ornamentales y en la mayoría de
los cultivos, se realiza casi exclusivamente con agroquímicos;
sin embargo, el mayor problema que se enfrenta con el control
químico de este ácaro, es su rápida habilidad para desarrollar
resistencia después de pocas generaciones (Stumpf et al.,
2001; Stumpf y Nauen, 2002; Aguilar et al., 2011). Se han
utilizado exitosamente diversos ácaros depredadores para
su combate, como lo son: Phytoseilus persimilis y Neoseilus
californicus (Zhang, 2003; Pedigo y Rice, 2006).
In adult state it has two well-defined spots, its color is paler
and the spots are almost perfect (Marcic, 2007). Sadrás et al.
(1998) indicated that, T. urticae feeds mainly on the mesophyll,
which significantly reduces the stomatal resistance and
respiratory rate, it also has as a consequence, severe effects
on the rate of energy absorption of the plant, with consequent
damage to the plant itself by direct feeding, reducing the area
of photosynthetic activity and causing abscission in the leaf
(Gorman et al., 2001). Landeros et al. (2004) mentioned
that five mites per leaf are quite enough to reduce the yield
and quality of the roses in the next cutting. Over time, the
irrational use of agrochemicals has disadvantages, such as the
destruction of wildlife and the induction of resistance to most
of the products used (Cerna et al., 2005).
T. urticae control for the ornamental and most of the crops
is done almost exclusively with chemicals, but the biggest
problem facing the chemical control of this mite is its ability
to develop resistance rapidly after just a few generations
(Stumpf et al., 2001; Stumpf and Nauen, 2002; Aguilar et al.,
2011). Several predatory mites have been successfully used,
such as: Phytoseilus persimilis and Neoseilus californicus
(Zhang, 2003; Pedigo and Rice, 2006).
Botanical pesticides provide mite control at low costs, and
with a reduced risk to human health and the environment as
well, its recommendation as a tetranychid control strategy
has increased (Gencsoylu, 2007). An important aspect
Caracteres morfológicos y bioquímicos de Rosa x hybrida contra Tetranychus urticae Koch en invernadero
Los plaguicidas botánicos proporcionan un control del ácaro a
un bajo costo, y con un reducido riesgo para la salud humana y
el medio ambiente, su recomendación como una estrategia de
control de tetraníquidos se ha incrementado (Gencsoylu, 2007).
Un aspecto importante en el manejo del ácaro es la búsqueda
de plantas con características morfológicas, fisiológicas y
bioquímicas que reduzcan el grado de daño al cultivo. En
el caso del tomate se conocen inhibidores bioquímicos de
proteínas y enzimas oxidativas (Duffey et al., 1996).
Los mecanismos de defensa químicos que las plantas han
desarrollado, tienen un gran potencial en utilizar métodos más
racionales para el control de plagas y dentro de los mecanismos
morfológicos están los tricomas glandulares implicados en la
defensa contra ácaros (Murray et al., 1999). Van Schie and
Haring (2007), mencionan que las planta de tomate Solanum
lycopersicum, producen y emiten una gran variedad de
compuestos orgánicos volátiles, presentes en sus tricomas, los
cuales consisten principalmente de terpenos. El objetivo de este
trabajo fue identificar cultivares de rosal tolerantes al ácaro de
dos manchas, como una posible fuente genética de resistencia
y determinar el comportamiento poblacional de T. urticae.
La presente investigación se desarrolló en 2007 bajo
condiciones de invernadero, con infraestructura ubicada
en el Departamento de Parasitología Agrícola (DPA) de la
Universidad Autónoma Agraria Antonio Narro (UAAAN),
en Saltillo, Coahuila, México. El material vegetativo
consistió de 13 cultivares de rosal que se plantaron en bolsas
de plástico de 5 L, mezclada a relación de 2:1 con tierra y
perlita y una formula de fertilización (nitrato de calcio 0.08
g L-1 de agua, nitrato de potasio 0.4 g L-1, nitrato de amonio
0.35 g L-1, quelato de fierro 0.03 g L-1 , ácido fosfórico 0.06
ml L-1 y ácido nítrico 0.08 ml L-1), al material fertilizado se
le añadió el fungicida PCNB®, 45% 600 g de ingrediente
activo (IA) L-1, (Agroquímicos Versa S. A de C. V, México)
posteriormente con el fin de homogenizar los tratamientos
se realizaron análisis de micro y macronutrientes,
conductividad eléctrica y pH a los sustrato utilizados. La
frecuencia de la aplicación de nutrimentos fue cada cuatro
días por la técnica de incorporación fue manual localizada.
Con la finalidad de contar con poblaciones suficientes de T.
urticae, se recolectaron ácaros provenientes de diferentes
cultivos de la región y se establecieron sobre plantas de
475
in the management of mite is the search for plants with
morphological, physiological and biochemical features that
would help to reduce the level of damage in the crop. For
tomato, biochemical inhibitors of proteins and enzymes are
well-known (Duffey et al., 1996).
The chemical defense mechanisms that the plants have
developed have a great potential to use more rational
methods for controlling pests and there are within the
morphological mechanisms, glandular trichomes involved
in the defense against mites (Murray et al., 1999). Van Schie
and Haring (2007) mentioned that, tomato plant Solanum
lycopersicum, produce and broadcast a variety of volatile
organic compounds present in their trichomes, consisting
mainly of terpenes. The aim of this study was to identify
rose cultivars tolerant to the red spider mite, as a possible
genetic source of resistance and, to determine the behavior
of T. urticae population.
This research was conducted in 2007 under greenhouse
conditions, with facilities located in the Department of
Agricultural Parasitology (DAP) of the Universidad
Autonoma Agraria Antonio Narro (UAAAN) in Saltillo,
Coahuila, Mexico. The plant material consisted of 13 rose
cultivars that were planted in 5 L plastic bags, mixed at 2:1
ratio with soil and perlite and a fertilizer formula (calcium
nitrate 0.08 g L-1 of water, nitrate potassium 0.4 g L-1, 0.35
g L-1 ammonium nitrate, 0.03 g L-1 iron chelate, 0.06 ml
L-1phosphoric acid and 0.08 ml L-1 nitric acid), to the fertilized
material fungicide PCNB® 45% was added, 600 g of active
ingredient (AI) L-1 (Agroquímicos Versa, S. A. de C.V.,
Mexico) later and in order to standardize all the treatments,
micro and macronutrients analysis were performed, electrical
conductivity and pH to the used substrate. The frequency of
application of nutrients was made very days.
In order to have a sufficient population of T. urticae, mites
from different crops were collected in the region and settled
on bean plants Phaseolus lunata of the cultivar Lima in a
growth chamber at 25 ±2 °C, Biotronnete®, 60-70% relative
humidity (RH) and photoperiod of 12:12 h.
When the rose plants reached a height of 50 to 60 cm and
enough foliage, the fertilization was suspended; a week later,
at a rate of 100 females T. urticae per plant was infested
frijol Phaseolus lunata del cultivar Lima en una cámara
bioclimática Biotronnete® a 25 ±2 ºC, 60-70% humedad
realtiva (HR) y fotoperiodo de 12:12 h.
Cuando las plantas de rosal alcanzaron una altura de 50 a
60 cm y follaje suficiente se suspendió la fertilización, una
semana posterior se infestó de manera uniforme a razón de
100 hembras de T. urticae por planta en cada uno de los 13
cultivares de rosal. A partir de la infestación se realizaron
muestreos semanales. Cada muestreo fue al azar con
tres observaciones por planta, que consistió del recuento
de los ácaros en una hoja pentafoliada. Los muestreos
poblacionales de ácaros se realizaron durante un periodo
de 57 días en los estratos (superior, medio e inferior), con
tres repeticiones, que reflejó un total de 117 observaciones
por fecha. Los resultados de los muestreos se realizaron
mediante un diseño completamente al azar.
Cuantificación de terpenos
La cuantificación de terpenos se hizo con la técnica de
extracción soxhlet con hexano (Cruz et al., 1973; Brown,
1994; Muñoz et al., 2001). Se colocaron 2 g de muestra
del estrato medio de la planta (hojas de rosal frescas en
fracciones muy pequeñas), del estrato medio de la planta.
En un dedal de extracción del procesador soxhlet, al cual se
le añadió previamente 250 mL de hexano por muestra y con
un tiempo de exposición de 5 h. Los terpenos se extrajeron
del hexano mediante el secado en estufa y por diferencia
de peso se obtuvo la cantidad de terpenos expresada en
porcentaje.
Aceites esenciales
La obtención de aceites esenciales se desarrolló por
hidrodestilación, para ello se colocaron 7 g de muestra
tomadas del estrato medio de la planta de rosal de cada una de
las variedades, hidrodestilando por 60 min de donde se midió
el volumen de aceite obtenido conforme a la metodología de
World Health Organization (1998), el resultado se expresó
en mL de aceite obtenido por 100 g.
Extracción de taninos
Se utilizó el método de extracción acuosa para la
cuantificación de taninos (Lastra et al., 2000), se pesaron
250 mg de muestra seca de hojas de rosal, y en un tubo tapón
de 20 mL, se añadieron 10 mL de la mezcla de solvente
acetona-agua (70:30). Se mantuvieron las muestras a 4 °C
uniformly in each of the 13 cultivars of rose. Since the
infestation, samplings were performed weekly. Each sample
was randomized with three observations per plant, which
consisted of counting mites on a leaf. The mite population
samplings were conducted over a period of 57 days in the
strata (upper, middle and bottom), with three replicates,
which reflected a total of 117 observations per day. The
results of the samplings were conducted in a completely
randomized design.
Quantification of terpenes
The quantification of terpenes was done with the Soxhlet
with hexane extraction technique (Cruz et al., 1973; Brown,
1994; Muñoz et al., 2001). Two grams of the sample from
the middle of the plant were placed (fresh rose leaves in
very small fractions) from the middle stratum of the plant.
In a small proportion of the soxhlet extraction processor,
at which 250 mL of hexane per sample was previously
added and with an exposure time of 5 h. The terpenes were
extracted from the hexane through an oven-drying process
and, by weight-difference the amount of terpenes expressed
in percentage was obtained.
Essential oils
The essential oils were obtained by hydrodistillation,
for this purpose 7 g of the sample taken from the
middle layer of the rose plant of each of the varieties,
hydrodistillating for 60 min, measuring the volume of
oil obtained according to the World Health Organization
methodology (1998), the result was expressed as mL of
oil obtained per 100 g.
Extraction of tannins
The aqueous extraction method of for the quantification of
tannins was used (Lastra et al., 2000), weighed 250 mg of
dry sample of rose’s leaves, and in a tube plug of 20 mL, was
added 10 mL of the mixture of solvent acetone-water (70:30).
The samples were kept at 4 °C for 24 h and centrifuged. For
the quantification a standard curve of tannic acid at 50 mg
L-1 was prepared and dilutions were performed 2, 4, 6 and
8 mg L-1 and diluted at 10 mL with distilled water. Finally,
the volume of the biological material was dissolved in 1 mL
of Folin and 1 mL of NaOH, mixing it and taking readings
expressed in the spectrophotometer at 670 nm of wavelength.
We obtained the concentration of tannins in mg per 100 mg
of sample.
por 24 h y se centrifugó. Para su cuantificación se preparó
una curva estándar a partir de ácido tánico a 50 mg L-1 y se
realizaron diluciones de 2, 4, 6 y 8 mg L-1 y se aforó a 10
mL con agua destilada. Por último, el volumen del material
biológico se disolvió en 1 mL del reactivo de Folin y 1 mL
de NaOH, se mezcló y se tomaron las lecturas expresadas
en el espectrofotómetro a 670 nm de longitud de onda. Se
obtuvo la concentración de taninos en mg por 100 mg de
muestra.
El contenido de nitrógeno se determinó por el método
macro Kjeldahl, colocando 1 g de muestra seca de rosal
con 30 mL de ácido sulfúrico concentrado y 5 g de muestra
selénica en el matraz de 250 mL de capacidad; se colocó
en la parrilla de digestión a temperatura no menor de 100
°C y la muestra se retiró hasta que el líquido se tornó
al color verde claro. Se dejaron reposar las muestras a
temperatura ambiente para posteriormente añadir 300 mL
de agua destilada, y después se agregaron 110 mL de NaOH
al 45% y gránulos de zinc. A continuación se procedió a
destilar, se agregó al matraz la mezcla que contiene 50 mL
de ácido bórico al 2% y 5 mL de un indicador, terminada
la destilación se procedió a titular las muestras con ácido
sulfúrico al 0.01, para finalmente ajustar el porcentaje de
nitrógeno.
Análisis morfológicos
Los parámetros morfológicos se realizaron en hojas
tomadas del estrato medio, utilizando para ello un
microscopio estereoscopio, donde se realizaron conteos
de tricomas y glándulas por cm2 de hoja y el grosor de hoja
se obtuvo en milímetros.
Análisis de datos
Los resultados obtenidos de las variables utilizadas
(ácaros día hoja, terpenos, taninos, aceites esenciales
nitrógeno, tricomas, número de glándulas y grosor de
hoja), se analizaron mediante un análisis de varianza
completamente al azar, así como una comparación de
medias por el método Tukey (p≤ 0.05), en los 13 cultivares,
finalmente se compararon todas las variables mediante una
correlación múltiple, también de manera individual para
ver el efecto de las variables sobre la población del ácaro.
Para todos los análisis se utilizó el paquete estadístico
SAS versión 11.0
477
The nitrogen content was determined by the macro Kjeldahl
method, placing 1 g of dry sample of the rose with 30 mL of
concentrated sulfuric acid and 5 g of selenic sample in the 250
mL flask; placing it on the grid for digestion at a temperature
not lower than 100 °C and, the sample was not removed
until the liquid became light-green color. The samples were
allowed to stand at room temperature and subsequently
adding 300 mL of distilled water and then added 110 mL
of NaOH 45% and zinc granules. After this we preceded to
distillate, adding to the flask the mixture containing 50 mL at
2% boric acid and 5 mL of an indicator, after the distillation
we preceded to label the samples with sulfuric acid at 0.01,
to finally adjust the percentage of nitrogen.
Morphological analysis
The morphological parameters were performed on
leaves taken from the middle level, using a stereoscopic
microscope, counting the number of trichomes and glands
per cm2 of the leaf and, the thickness was obtained in
millimeters.
Data analysis
The results of the variables used (mites days leaf, terpenes,
tannins, essential oils, nitrogen, trichomes, number of glands
and leaf thickness) were completely randomly analyzed
by an analysis of variance, and a comparison of means by
Tukey’s method (p≤ 0.05) in all the 13 cultivars, finally all
the variables were compared using a multiple correlation,
also individually in order to see the effect of the variables
on the mite population. The SAS statistical package version
11.0 was used for all the analysis.
The Luna cultivar had the highest mite population
development with an average of 2784.1 mites day-1, followed
by Gran Gala® with 1471.5, Verdi® 1307 and, Vendela® 1076.
The cultivars Movie star®, Virginia® and Emma® developed
fewer mites with 377.5, 444.7 and 486.4 mites, respectively.
These data show a difference in the population of the cultivar
Movie Star® compared to cultivars Verdi®, Gran Gala® and
Luna® (Table 1), corresponding to 71.14, 74.39 and 86.46
percentage respectively.
El cultivar Luna fue el que presentó el mayor desarrollo
poblacional de ácaros con un promedio de 2784.1 ácaros
día-1, seguido por Gran Gala® con 1471.5, Verdi ® 1307,
y Vendela® 1076. Los cultivares Movie Star®, Emma® y
Virginia® fue donde se desarrollaron un menor número de
ácaros con 377.5, 444.7 y 486.4 ácaros, respectivamente.
Estos datos muestran una diferencia en la población del
cultivar Movie Star® en comparación a los cultivares Verdi®,
Gran Gala® y Luna®, (Cuadro 1), que corresponde al 71.14,
74.39 y 86.46 de porcentaje respectivamente.
The analysis of variance showed statistical differences in the
variables terpenes, essential oils, leaf thickness and nitrogen
content (Table 2).
The multiple regression analysis allowed to defining
a prediction model for the variables under study.
The expression was as follows: y= 5.7802 + 0.4010b
- 0.24c + 0.15d + 0.14e; where b= terpenes, essential
oils c= d= nitrogen, e = thickness of sheet; to determine
the degree of correlation of the variables, resulting in a
significantly negative correlation with essential oils and
a positive one for terpenes, leaf thickness and nitrogen
content.
Cuadro 1. Medias de ácaros día hoja, terpenos, taninos, aceites esenciales, nitrógeno, tricomas, glándulas y grosor de hojas
en 13 variedades de rosal.
Table 1. Mites day leaf means, terpenes, tannins, essential oils, nitrogen, trichomes, glands and thickness of leaves in 13
varieties of rose.
Cultivares
Véndela
Gran Gala
Virginia
Verdi
Embassador
Golden Star
Marco Polo
Movie Star
Pekuobo
Luna
Emma
Verano
Bella Perla
Aceites
esenciales
(mL) Media
±DE
0.0008 ±0.0004 0.216 ±0.025
6.2 ±1.51
0.549 ±0.378
4.07 ±0.916
0.183 ±0.041
2.81 ±2.43
0.213 ±0.011
4.27 ±3.02
0.153 ±0.028
4.04 ±3.5
0.296 ±0.271
5.77 ±2.37
0.22 ±0.153
2.74 ±2.64
0.17 ±0.0145
5.77 ±2.73
0.173 ±0.045
6.56 ±6.45
0.126 ±0.02
6.08 ±0.68
0.15 ±0.017
5.06 ±4.33
0.16 ±0.005
4.01 ±3.47
0.166 ±0.023
Ácaros/día/ Terpenos hoja Taninos (mg/
hoja Media
(%)
mL) Media
±DE
Media ±DE
±DE
1076 ±702.6
1472.5 ±722
486.4 ±483.6
1307 ±1807.3
1052.6 ±515.8
509.8 ±353.5
696.3 ±141.4
377.5 ±86.3
547.8 ±411.5
2784.1 ±1051
444.7 ±161.2
881.6 ±858.4
592.1 ±110.4
0.916 ±0.1167
0.773 ±0.138
1.053 ±0.227
0.866 ±0.161
1.216 ±0.095
1.153 ±0.249
1.393 ±0.619
0.95 ±0.593
1.25 ±0.332
1.39 ±0.461
1.53 ±0.554
1.46 ±0.896
1.3 ±0.259
El análisis de varianza mostró diferencias estadísticas en
las variables terpenos, aceites esenciales, grosor de hoja y
contenido de nitrógeno (Cuadro 2).
La regresión múltiple permitió definir un modelo de
predicción para las variables en estudio. La expresión fue
la siguiente: y= 5.7802 + 0.4010b - 0.24c + 0.15d + 0.14e;
donde: b= terpenos; c= aceites esenciales; d= nitrógeno; e=
grosor de hoja; para conocer el grado de correlación de las
variables en estudio arrojó como resultado una correlación
negativa con los aceites esenciales y positivos en terpenos,
grosor de hoja, y contenido de nitrógeno.
Nitrógeno Tricomas Glándulas Grosor de hoja
(mg g-1)
(cm2)
(cm2)
(cm)
Media ±DE Media ±DE Media ±DE Media ±DE
0.61 ±0.073
0.795 ±0.327
0.797 ±0.096
0.824 ±0.056
0.887 ±0.218
0.886 ±0.169
0.541 ±0.062
0.593 ±0.087
0.642 ±0.266
0.569 ±0.165
0.704 ±0.205
0.909 ±0.204
0.522 ±0.022
1.66 ±1.15
5.33 ±0.57
4.66 ±2.88
1.66 ±0.57
3 ±1
3.3 ±0.57
2 ±1.73
4.66 ±3.51
3 ±2
1.66 ±1.15
4.66 ±0.57
1.66 ±1.15
1.66 ±2.15
3.33 ±2.08
3.0 ±1.73
6.33 ±2.08
5.66 ±4.04
1.33 ±0.57
4.66 ±2.51
2.33 ±1.52
8.66 ±0.57
3.33 ±1.52
1.33 ±0.57
4.66 ±2.3
1.33 ±0.57
1.33 ±0.57
0.017 ±0.001
0.019 ±0.001
0.017 ±0.005
0.019 ±0.005
0.018 ±0.001
0.017 ±0.001
0.018 ±0.005
0.113 ±0.092
0.018 ±0.001
0.143 ±0.04
0.223 ±0.005
0.176 ±0.005
0.018 ±0.003
Cuadro 2. Análisis de varianza de la regresión de las
variables con ADH.
Table 2. Analysis of variance of the variables regression
with ADH.
Variable
Glándulas
Tricomas
Grosor de hoja
Nitrógeno
Aceites esenciales
Taninos
Terpenos
NS
R2
0.046
0.049
0.042
0.137
0.284
0.004
0.247
= no significativo; ∗= significativo (p≤ 0.05).
F
0.39NS
0.42NS
1.398∗
1.277∗
4.574
0.039NS
5.39∗
(p≤ 0.05)
0.549
0.535
0.27
0.291
0.0649
0.8481
0.0487
El desarrollo poblacional respondió de diferente forma
entre los cultivares en estudio. Lo anterior confirma y
coinciden los resultado con lo expuesto por Van Lenteren
y Noldus (1990), quienes aseveran que un reducido
desarrollo y alta tasa de reproducción total de la plaga
en plantas hospederas, indican el grado de estabilidad de
metabolitos secundarios en las plantas. Así dentro de los
efectos que presentan algunos tipos de metabolitos está
la anti-alimentación, actividad que es ejercida por los
compuestos que al ser ingeridos por el insecto, provoca
que se deje de alimentar y, finalmente mueren de hambre
(Isman, 2006). Además otros compuestos que regulan el
crecimiento e inhiben la metamorfosis o provocan la muda
precoz, también alteran la regulación de las hormonas
de crecimiento y malformaciones, que causa esterilidad
o la muerte de los insectos (Celis et al., 2008). Entre los
metabolitos con actividad biológica contra insectos están
los flavonoides, terpenoides, alcaloides, esteroides y
fenoles (Orozco et al., 2006).
Estos resultados colocan a los cultivares Movie Star®,
Emma® y Virginia® como inadecuados para el desarrollo
poblacional del ácaro. Los factores químicos y morfológicos
presentes en los cultivares Luna®, Gran Gala® y Verdi®
permiten el desarrollo de ácaros y se presentan como
cultivares susceptibles a la plaga. A mayor concentración
de nitrógeno se incrementa la tasa de desarrollo de la
población de ácaros y coincide con lo documentado por
diversos autores como Wermelinger et al. (1985), quienes
indican que la reducción de nitrógeno del 50%, afectó de
manera negativa 10 veces la fecundidad de T. urticae en
hojas de manzana, por su parte Wilson (1994), menciona
un mayor desarrollo poblacional de arañitas con altos
contenidos de nitrógeno en plantas fertilizadas con una
alta proporción de nitrógeno.
Con respecto a la variable terpenos, investigaciones sobre los
mecanismos de defensa de las plantas sobre los herbívoros
tienen acción atrayente para artrópodos (Berenbaun, 1995;
Gorsky, 2004), entre otras substancias se encuentran formas
volátiles conocidas como terpenos y taninos. Los resultados
en esta investigación coinciden con los autores antes
mencionados, porque se encontró una alta tasa de desarrollo
When performing a simple linear regression between the
concentration of essential oils and the mite days leaf data,
the model records y= 8.7768 - 0.31x, with R2 of 0.6143,
finding that only essential oils have a negative effect on the
mite populations (Figure 1).
3000
2600
2200
Y= 8.7768 - 0.31X
R2= 0.6143
1800
ADH
Al realizar una regresión lineal simple entre la concentración
de aceites esenciales y los datos de ácaros día hoja registra el
modelo y= 8.7768 - 0.31x, con R2 de 0.6143, encontrando que
solamente los aceites esenciales tienen un efecto negativo
en las poblaciones de ácaros (Figura 1).
479
1400
1000
600
200
-200
0.0
0.2
0.4
Aceites
0.6
0.8
1.0
Figura 1. Relación entre ácaro/día/hoja y mL de aceites
esenciales por gramo de hoja de Rosa x hybrida.
Figure 1. Relationship between mite/day/leaf and essential oil
mL per gram of leaf of Rosa x hybrida.
The population development responded differently between
the cultivars under study. This confirms the result and agrees
with the statement of Van Lenteren and Noldus (1990), who
asserted that a small development and high reproductive rate
of the pest in all host-plants indicate the degree of stability
of secondary metabolites in the plants. So within the effects,
presented by some metabolites lays the anti-feeding activity,
exerted by the compounds ingested by the insect, causing
them to stop feeding and eventually starve to death (Isman,
2006). In addition, other compounds that regulate growth
and inhibit metamorphosis or cause premature molting, also
alter the regulation of growth hormones and malformations
that cause sterility or death of the insects (Celis et al., 2008).
Among the metabolites with biological activity against
insects are the flavonoids, terpenoids, alkaloids, steroids
and phenols (Orozco et al., 2006).
These results place the cultivars Movie star®, Virginia® and
Emma® as unsuitable for mite population development. The
chemical and morphological factors in the cultivar Luna®,
Gran Gala® and Verdi® allow the development of mites and
are presented as cultivars susceptible to the pest. At higher
nitrogen concentration, the rate of development of mite
population increases, coinciding with that documented
by several authors such as Wermelinger et al. (1985), who
indicated that, the nitrogen reduction of 50%, negatively
affected 10 times the fecundity of T. urticae in apple leaves,
poblacional, como resultado del modelo matemático de la
regresión múltiple, que muestra una correlación positiva e
indica que a mayor concentración de terpenos hay mayor
desarrollo poblacional.
Las poblaciones del ácaro se vieron afectadas de manera
negativa con la presencia de aceites esenciales y los
resultados coinciden con Isman et al. (2007); Choi et al.
(2004), quienes estudiaron el efecto tóxico de diversos
aceites esenciales de plantas con T. urticae y demostraron
el efecto tóxico de contacto con el aceite de romero y otras
plantas. Por otro lado Miresmailli et al. (2006), demostró
que el aceite esencial de romero (Rosmarinus officinalis L.)
fue efectivo en el control de T. urticae en cultivos de frijol
y tomate. Además de tener los aceites esenciales actividad
fumigante y de contacto, poseen también acción ovicida,
antialimentaria y repelente (Sanna et al., 2004).
CONCLUSIONES
De los 13 cultivares en estudio Luna®, Gran Gala® y Verdi®
fueron los que presentaron un mayor incremento poblacional
del ácaro de dos manchas, T. urticae, siendo los cultivos
mas suceptibles. Sin embargo los cultivares Movie Star®,
Emma® y Virginia® fueron los cultivares más resistentes
al desarrollo poblacional del ácaro de dos manchas; por
otro lado los aceites esenciales fue la única variable que
mostró un impacto negativo, por lo que actuaron como
mecanismos de defensa. La fluctuación poblacional en
ocho semanas de muestreo sistemático de T. urticae en los
cultivares susceptibles (Luna®, Gran Gala® y Verdi®) que en
promedio oscilo entre los 1 307 a 2 784.1 ácaros, siempre
fue en aumento mientras que los cultivares más estables,
que no presentaron picos poblacionales fueron las que
mostraron cierto grado de resistencia como Movie star®,
Emma® y Virginia®.
LITERATURA CITADA
Aguilar, M. S.; Díaz, G. O.; Rodríguez, M. C.; González, C.
J. E.; García, V. R.; Martínez, C. J .L. y Reséndiz,
G. B. 2011. Resistencia de Tetranychus urticae
Koch a acaricidas usados en la producción del
rosal en invernadero en México. Southwestern
Entomologist. 36(3):363-371.
meanwhile Wilson (1994), mentioned a higher development
of spider population with high contents of nitrogen in plants
fertilized with a high proportion of nitrogen.
With respect to the variable terpenes, research on defense
mechanisms of plants on herbivores have an attractive action
for arthropods (Berenbaun, 1995; Gorsky, 2004), among
other substances, there are volatile forms better known as
terpenes and tannins. The results in this study agree with
the authors just mentioned, because we found a high rate
of population development, as a result of the mathematical
model of multiple regressions, which shows a positive
correlation, indicating that the higher the concentration of
terpenes the greater population development.
The mite populations were negatively affected by the
presence of essential oils and these results concord with that
established by Isman et al. (2007); Choi et al. (2004), who
studied the toxic effect of various essential oils of plants
with T. urticae and demonstrated the toxic effect of contact
with the oil of rosemary and other plants. Furthermore,
Miresmailli et al. (2006) showed that, rosemary’s essential
oil (Rosmarinus officinalis L) was effective in controlling
T. urticae on bean and tomato crops. The essential oils
besides presenting fumigant and contact activity also possess
ovicidal, antifeedant and repelling action (Sanna et al., 2004).
CONCLUSIONS
Out of the 13 studied cultivars, Luna®, Gran Gala® and
Verdi® were those with the highest red spider mite population
increase, T. urticae, being the most susceptible crops.
However, the cultivars Movie Star®, Emma® and Virginia®
were those more resistant to the red spider mite population
development; on the other hand, the essential oils variable
was the only one that showed a negative impact so it acted as
a mechanism of defense. The population dynamics of eight
weeks of systematic sampling of T. urticae on the susceptible
cultivars (Luna®, Gran Gala® and Verdi®) which on average
ranged between 1 307 to 2 784.1 mites, always increased,
while the most stable cultivars, which did not showed
population peaks were those that showed some degree of
resistance such as Movie star®, Emma® and Virginia®.
Berenbaum, M. R. 1995. The chemistry of defense: theory
and practice. Proc. Natl. Acad. Sci. USA. 92:2-8.
Bolland, H. R.; Gutierrez, J. and Fletchmann, C. H. W.1998.
World Catalogue of the Spider Mite Family (Acari:
Tetranychidae). Koninklijke Brill NV, Leiden. The
Netherlands. 165-170 pp.
Brown, G. D. 1994. Drimediol a sequiterpene from Drymis
winteri. Phytochemistry. 35:975-977.
Celis, A.; Mendoza, C.; Pachón, M.; Cardona, J.; Delgado, W.
y Cuca, L. 2008. Extractos vegetales utilizados como
biocontroladores con énfasis en la familia Piperácea.
Una Revisión. Agronomía Colombiana. 26:97-106.
Cerna, E.; Landeros, J.; Ochoa, Y.; Luna R.; Vásquez, M. y
Ventura, O. 2005. Detección de resistencia enzimática
por productos sinergistas en una línea de campo de
Tetranychus urticae Koch (Acari: Tetranychidae).
Folia Entomológica Mexicana. 44(3):287-295.
Cruz, A.; Silva, M. y Sammes, P. G. 1973. Further terpenoides
and phenolics of drymis winteri. Phytochemistry.
12:2549-2550.
Choi, W. I.; Lee, S. G.; Park, H. M. and Ahn, J. 2004. Toxicity
of plant essential oils to Tetranychus urticae (Acari:
Tetranychidae), and Phytoseilus persimilis (Acari:
Phytoseidae). J. Econ. Entomol. 97:553-558.
Duffey, S. S.; Stout, M. J. and Workman, K. V. 1996. Identity,
spatial distribution, and variability of induced
chemical responses in tomato plants. Entomología
Experimentalis et Applicata. 79:255-271.
Gencsoylu, I. 2007. Effects of the Asphedolus aestivus
Brot. as a botanical acaricide against Tetranychus
cinnabarinus Boisd. (Acari: Tetranychidae). Int J.
Agric. Res. 2:189-192.
Gorman, K. F.; Hewitt, Denholm, I. and Devine, G. J. 2001.
New developments in insecticide resistance in the
glasshouse whitefly (Trialeurodes vaporariorum)
and the two-spotted spider mite (Tetranychus
urticae) in the UK. Pest Mang Sci. 58:123-130.
Gorski, R. 2004. Effectiveness of natural essential
oils in the monitoring of greenhouse whitefly
(Trialeroudes vaporarorium Westwood. Folia
Hortic. Ann. 183-187 pp.
Isman, M. B.; Machial, C. M.; Miresmailli, S. and Bainard,
L. D. 2007. Essential oil-based pesticides: new
insights from old chemistry. In: Ohka-wa, H. and
Miyagawa, H. Lee, P. (eds.). Pesticide Chemistry.
Wiley, Weinheim. 201-209 pp.
Isman, M. B. 2006. Botanical insecticides, deterrents, and
repellents in modern agriculture and an increasingly
regulated world. Annual Review Entomol. 51:45-66.
481
Kheradpir, N.; Khalghani, J.; Ostovan, H. and Rezapanah,
M. R. 2007. The comparasion of demographic traits
in Tetranychus urticae Koch (Acari: Tetranychidae)
on five different greenhouse cucumber hybrids
(Cucumis sativus). Acta Hotic. 747:425-429.
Landeros, F. J.; Guevara, L. P.; Badii, M. H.; Flores, F. y
Pámanes, A. 2004. Effect of different densities of the
twospotted spider mite Tetranychus urticae on CO2
assimilation. transpiration and stomatal behaviour
in rose leaves. Expl. Appl. Acarol. 32:187-198.
Lastra, V. H.; Rodríguez, L. E.; Leyes, P. L. y Rego, G. S.
M. 2000. Método analítico para la cuantificación de
taninos en el extracto acuoso de romerillo. Revista
Cubana Médica. 5(1):17-22.
Marcic, D. 2007. Sublethal effects of spirodiclofen o life
history and life-table parameters of two-spotted
spider mite (Tetranychus urticae). Exp. Aplied
Acarology. 42:121-129.
Miresmailli, S.; Bradbury, R. and Isman, M. B. 2006.
Comparative toxicity of Rosmarinus officinalis L.
Essential oil and blends of its major constituents
against Tetranychus urticae Koch (Acari: Tetranychidae) on two different host plants. Pest Manage.
Sci. 62(4):366-371.
Muñoz, O.; Montes, M. y Wilkomirsky, T. 2001. Plantas
medicinales de uso en Chile. Editorial Universitaria.
Santiago, Chile. 330 pp.
Murray, K. D.; Hasegawa, S. and Arx, A. R. 1999.
Antifeedant activity of citrus limonoids against
Colorado potato beetle: comparison of aglycones
and glucosides. Entomol. Exp. Appl. 92:331-334.
Orozco, J.; Soto, A. e Hipolito, A. 2006. Efecto de
repelencia de Crotalaria juncea, Galactia striata y
Cymbopogon nardus para el manejo de Cyrtomenus
bergi (Hemiptera: Cydnidae). Revista de Biología
e Ciencias Da Tierra. 6:179-185.
Pedigo, L. y Rice, M. 2006. Entomology and pest management.
Pearson Prentice Hall. Nueva York, USA. 749 p.
Sadras, V. O.; Wilson, L. J. and Rally, D. A. 1998. Water
deficit enhanced cotton resistance to spider mite
herbivory. London. Ann. Bot. 81:273-286.
Sanna, G.; Bazzoni, E. and Moretti, M. 2004. Microencapsulated
essential oils active against Indian meal moth. Bol.
San. Veg. Plagas. 30:125-132.
Stumpf, N.; Zebitz, C. P. W.; Kraus, W.; Moores, G. D. and
Nauen, R. 2001. Resistance to organophosphates and
biochemical genotyping of acetylcholinesterases in
Tetranychus urticae (Acari: Tetranychidae). Pestic.
Biochem. Physiol. 69:131-142.
Stumpf, N. and Nauen, R. 2002. Biochemical markers linked
to abamectin resistance in Tetranychus urticae
(Acari: Tetranychidae). Pestic. Biochem. Physiol.
72:111-121.
Van Lenteren, J. C. and Noldus, L. P. 1990.Whitefly- plant
relationship: behavioral, and biological aspects
In: Gerling, D. (ed.). Whitefly: their bionomics,
pest status and management. Intercept Andover.
47-89 pp.
Van Schie, C. C. and Haring, M. A. 2007. Tomato linalool
synthase is induced in trichomes by jasmonic acid.
Plant Mol. Biol. 64:251-263.
Wermelinger, B.; Oertli, J. J. and Delucchi, V. 1985. Effect
of host plant nitrogen fertilization on the biology
of the spotted spider mites, Tetranychus urticae.
Entomol. Exp Appl. 38:23-28.
Wilson, L. J. 1994. Plant-quality effect on life-history parameters
of the twospotted spider mite (Acari:Tetranychidae)
on cotton. J. Economic Entomol. 87:1665-1673.
World Health Organization. 1998. Quality control methods
for medicinal plant materials. World Health
Organization. Geneva, Switzerland. 115 p.
Zhang, Z. 2003. Mites of greenhouse of identification
biology and control. Cabi Publishing. 256 p.
ESPECIES ORNAMENTALES ASOCIADAS A COCHINILLA ROSADA DEL
HIBISCO (HEMIPTERA: PSEUDOCOCCIDAE) EN NAYARIT*
ORNAMENTAL SPECIES ASSOCIATED WITH PINK HIBISCUS MEALYBUG
(HEMIPTERA: PSEUDOCOCCIDAE) IN NAYARIT
Néstor Isiordia-Aquino1§, Agustín Robles-Bermúdez2, Héctor González-Hernández3, Oswaldo García-Martínez4, Gregorio
Luna-Esquivel2, José Roberto Gómez-Aguilar2, Arturo Alvarez-Bravo2 y Candelario Santillán-Ortega2
Ciencias Biológico Agropecuarias y Pesqueras. Universidad Autónoma de Nayarit. Tepic, Nayarit, México. C. P. 63190. Tel. 01 311 1367377. 2Unidad Académica de
Agricultura. Universidad Autónoma de Nayarit. Carretera Tepic-Compostela, km 9. Xalisco, Nayarit. México. C. P. 63780. Tel. 01 311 2301411. (nitsugarobles@hotmail.
com), ([email protected]), ([email protected]), ([email protected]), ([email protected]). 3Entomología y Acarología. Colegio de Postgraduados.
Carretera México-Texcoco, km 36.5. Montecillo, Estado de México. C. P. 56230. Tel. 01 595 9517145. ([email protected]). 4Departamento de Parasitología, Universidad
Autónoma Agraria Antonio Narro. Calzada Antonio Narro 1923, Buenavista, Saltillo, Coahuila. C. P. 25315. Tel. 01 844 8698015. ([email protected]). §Autor para
1
RESUMEN
ABSTRACT
El estudio se realizó en 2009 con el objetivo de conocer
la diversidad de especies ornamentales susceptibles al
ataque de cochinilla rosada del hibisco, Maconellicoccus
hirsutus (Green), así como determinar la incidencia y nivel
de infestación del insecto. Los muestreos semanales en 28
especies de plantas, se cuantificaron individuos de cochinilla
presentes en 9 101 sitios de muestreo de siete municipios,
dentro de áreas marginales, urbano, agrícola y viveros. Esta
plaga se detectó en 2 435 sitios (26.7%), con infestación
de 25.7, 0.9 y 0.1% para los niveles bajo, medio y alto,
respectivamente. Las especies vegetales identificadas con
mayor incidencia de la plaga, fueron Hibiscus rosa-sinensis
L., (37.4%), H. tiliaceaus Arruda (29%) y H. mutabilis L.,
(14.4%); para H. rosa-sinensis, los municipios que fueron
identificados con mayor asociación plaga-hospedante,
fueron Acaponeta (59.3%), Santiago Ixcuintla (44.2%) y
Rosamorada (37.5%). Montanoa grandiflora Alamán ex DC
y Solandra sp., se determinaron como nuevos hospedantes de
cochinilla rosada del hibisco, ambos en nivel de infestación 1.
The study was conducted in 2009 in order to understand the
diversity of ornamental species susceptible to the hibiscus
mealybug attack, Maconellicoccus hirsutus (Green) and,
to determine the incidence and severity of this insect
infestation. The weekly samplings in 28 plant species
were quantified mealybug individuals, present in 9 101
sampling sites in seven municipalities, in marginal, urban,
agricultural and nursery areas. This pest was detected
in 2 435 sites (26.7%), with infestation of 25.7, 0.9 and
0.1% for low, medium and high levels, respectively. Plant
species identified with the highest incidence of the pest,
were Hibiscus rosa-sinensis L., (37.4%), H. tiliaceaus
Arruda (29%) and H. mutabilis, (14.4%); for H. rosasinensis, municipalities that were identified with the
highest pest-host association were Acaponeta (59.3%),
Santiago Ixcuintla (44.2%) and Rosamorada (37.5%).
Montanoa grandiflora Alamán ex DC and Solandra sp.,
were identified as new hosts of hibiscus mealybug, both
in level 1 of infestation.
Palabras clave: Maconellicoccus hirsutus, plagas de
hibiscus, plagas cuarentenarias, plagas de ornamentales.
Key words: Maconellicoccus hirsutus, hibiscus pests,
ornamental pests, quarantine pests.
Néstor Isiordia-Aquino et al.
INTRODUCCIÓN
INTRODUCTION
El cultivo y propagación de plantas son importantes para el
hombre como fuente de alimento y por brindarle protección,
además de ser una fuente de entretenimiento y satisfacción
estética (Martínez et al., 2008); la ubicación en áreas
urbanas como plazas, paseos, jardines e interiores de las
plantas ornamentales nativas y exóticas, propicia gran valor
comercial por su embellecimiento estético y el colorido de
sus flores y follaje (Granara y Claps, 2003).
Plant cultivation and propagation are important to humans
as a food source and to provide protection, as well as being
a source of entertainment and esthetic satisfaction (Martínez
et al., 2008), the location in urban areas such as plazas,
promenades, gardens and interiors of native and exotic
ornamental plants, promotes high commercial value for its
esthetic embellishment and colorful flowers and foliage
(Granara and Claps, 2003).
Pertenecientes a la familia Pseudococcidae, los insectos
comúnmente conocidos como cochinillas o chinches
harinosas, se encuentran ampliamente distribuidos en todo el
mundo, presentes especialmente en las regiones tropicales y
subtropicales, donde se han convertido en plagas de plantas
cultivadas y silvestres (Niebla et al., 2010).
Belonging to the family Pseudococcidae, insects commonly
known as mealybugs are widely distributed throughout the
world, present especially in tropical and subtropical regions,
where they have become pests of cultivated and wild plants
(Niebla et al., 2010).
La producción de especies ornamentales, frutales y nativas
se ve amenazada por la presencia de plagas, como la
cochinilla rosada del hibisco, Maconellicoccus hirsutus
(Green), como en el caso de Granada; Isla dentro del cual
la falta de atención a la plaga por más de un año, ocasionó
devastaciones con repercusiones sociales y turísticas en
campos recreativos y jardines de hoteles (CABI, 2005). De
importancia extremadamente polífaga (Sagarra y Peterkin,
1999; Reed, 2009), la especie M. hirsutus fue descrita
inicialmente en India, de donde se ha extendido a otras
regiones tropicales y subtropicales del mundo, entre las
que se incluye África, sureste de Asia y Australia (Cermeli
et al., 2002; Hoy et al., 2011).
Por lo tanto, se considera una especie de importancia mundial
y cuarentenaria que se alimenta de savia sobre las plantas
atacadas, y con altas preferencias en especies como Hibiscus
rosa-sinensis L. (Mani, 1989; Kairo et al., 2000; Vázquez et
al., 2002; OEPP-EPPO, 2005; Tanwar et al., 2007; Niebla
et al., 2010; Mohammad et al., 2010), existe confirmación
de daños en 15 especies más dentro de este género (Stibick,
1997); asimismo, se ha reportado que afecta de 200 a 300
especies vegetales entre hortalizas, ornamentales, forestales
y plantas silvestres, comprendidas en 74 familias botánicas
(Mani, 1989; USDA, 2001; Bogran y Ludwig, 2007); en
algunas especies hospedantes no cultivadas donde el insecto
logra establecerse, éste puede establecerse y conformar
reservorios fuera del área de control y cuarentena, que
complica su manejo (Chong, 2009).
The ornamental, fruit and native species production
is threatened by the presence of pests like the hibiscus
mealybug, Maconellicoccus hirsutus (Green), as in the
case of Grenada, Island within which the lack of attention
to this pest for over a year, caused devastation with social
and touristic repercussions in fields and gardens of hotels
(CABI, 2005). With an extremely important polyphagous
(Sagarra and Peterkin, 1999; Reed, 2009), the species M.
hirsutus was first described in India, where it has been spread
to other tropical and subtropical regions of the world, which
includes Africa, Southeast Asia and Australia (Cermeli et
al., 2002; Hoy et al., 2011).
Therefore, it is considered a quarantined species of global
importance that feeds on sap and, with high preferences
for species such as Hibiscus rosa-sinensis L. (Mani, 1989;
Kairo, 1998; Vázquez et al., 2002; OEPP-EPPO, 2005;
Tanwar et al., 2007; Niebla et al., 2010; Mohammad et
al., 2010), there is confirmation of damage in 15 species
in this genus (Stibick, 1997); it has also been reported to
affect from 200 to 300 plant species including vegetables,
ornamentals, forestry and wild plants, in 74 botanic families
(Mani, 1989; USDA, 2001; Bogran and Ludwig, 2007); in
some uncultivated host species, where the insect is able to
inhabit, it may settle and form reservoirs outside the control
and quarantine, which complicates its use (Chong, 2009).
Regarding the degree of impairment of host species grouped
at family level, the most affected by the pest has been
observed in the most affected families are Leguminosae
Especies ornamentales asociadas a cochinilla rosada del hibisco (Hemiptera: Pseudococcidae) en Nayarit
En cuanto al grado de afectación de especies hospedantes
agrupadas a nivel de familia, las mayores afectaciones por
la plaga han sido observadas en las familias más afectadas
son Leguminosae (Fabaceae), Malvaceae, Solanaceae y
Moraceae (Mani, 1989; Sagarra y Peterkin, 1999; OEPPEPPO, 2005; Tanwar et al., 2007; SAGARPA, 2008). De
acuerdo con Berg (1996), las especies ornamentales con
mayor incidencia de la plaga son Hibiscus spp., Ficus spp.,
Cosmos spp., Chrysanthemum spp., Dahlia spp., Gerbera
spp., Rosa spp., Dieffenbachia spp., Philodendron spp.,
Syngonium spp., Aralia spp., Schefflera spp., Asparagus spp.,
Begonia spp., Chenopodium spp., Kalanchoe spp., Dracaena
spp., Bougainvillea spp. y Jasminum spp.
Las causas por las cuales, tanto la familia Malvaceae como
algunas especies pertenecientes a ésta, como en los casos
de H. rosa sinensis, y otras especies del mismo género son
consideradas como hospedantes preferentes de M. hirsutus,
quizás debido a la presencia de algunos mucilagos como
fibras solubles en agua que facilitan su alimentación, además
de los contenidos de aminoácidos (Shrewsbury et al., 2006),
hierro, calcio y potasio, que favorecen incrementos en las
poblaciones de estas plagas, independientemente de otros
factores como la temperatura y humedad favorables en las
regiones tropicales o subtropicales, donde se desarrollan
mejor este tipo de plantas, lo mismo que de la abundancia o
densidad poblacional de las mismas.
De acuerdo con CABI (2011); SAGARPA (2007), la
presencia de cochinilla se reporta actualmente en 67 países
incluyendo a México, donde tiene un estatus de distribución
restringida. En este país se presentan condiciones
ambientales favorables para el establecimiento del insecto
en una superficie estimada en 57 millones de hectáreas, que
corresponden a las selvas cálido secas y cálido húmedas, que
propicia una extensión altamente vulnerable a la expansión
del insecto, sobre todo en la temporada de huracanes, toda
vez que el viento puede ser un medio de transporte de la
cochinilla, ya sea de países cercanos a México, o de los sitios
del interior del país (SINAVEF, 2011a).
Entre los años 1999 a 2009, se introdujeron a México al
menos 26 plagas de importancia económica y cuarentenaria,
entre ellas la cochinilla rosada, las cuales fueron notificadas
oportunamente, muchas de las cuales fueron introducidas
mediante la movilización de mercancías en el comercio
internacional, o bien, por su capacidad inherente de
dispersión o por eventos meteorológicos como ciclones
(SINAVEF, 2011b).
485
(Fabaceae), Malvaceae, Solanaceae and Moraceae (Mani,
1989; Garland, 1998; Sagarra and Peterkin, 1999; OEPPEPPO, 2005; Tanwar et al., 2007; SAGARPA, 2008).
According to Berg (1996), ornamental species with the
highest incidence of the pest are Hibiscus spp., Ficus spp.,
Cosmos spp., Chrysanthemum spp., Dahlia spp., Gerbera
spp., Rosa spp., Dieffenbachia spp. Philodendron spp.,
Syngonium spp., Aralia spp., Schefflera spp., Asparagus
spp., Begonia spp., Chenopodium spp., Kalanchoe spp.,
Dracaena spp., Bougainvillea spp. and Jasminum spp.
The reasons why the family Malvaceae as well as some
species belonging to this, as in the case of H. rosa sinensis
and other species of this genus are considered preferred
hosts of M. hirsutus, perhaps due to the presence of some
mucilage as water-soluble fibers that provide nutrition,
and amino acid content (Shrewsbury et al., 2006), iron,
calcium and potassium, which favor the increase in
populations of these pests, regardless of other factors
such as temperature and favorable humidity in tropical or
subtropical regions, where these kind of plants develop
better plants, as well as the abundance or population
density.
According to CABI (2011); SAGARPA (2007), the presence
of mealybugs is reported now in 67 countries including
Mexico, where it has a status of restricted distribution. In this
country, there are favorable environmental conditions for the
establishment of the insect in an area estimated at 57 million
hectares, corresponding to the warm-dry and warm-humid
jungles, which encourages an area highly vulnerable to the
spread of the insect, especially in the hurricane season, since
the wind can be a conveyance of the mealybugs, whether
from nearby countries to Mexico, or sites within the country
itself (SINAVEF, 2011a).
From 1999 to 2009, at least 26 quarantine and economically
important pests were introduced in Mexico, including the
hibiscus mealybug, which were reported on time, many
of which were introduced through the transportation of
goods in international trade, or by their inherent ability to
spread or by weather events such as cyclones (SINAVEF,
2011b).
The further spread of the insect pest has been in urban areas,
especially by backyard agriculture and due to the presence
of hosts used as ornamental plants, such as obelisk,
majahua, parota or soursop, where, the transportation of
infested plant material without surveillance or illegally, is
La mayor propagación del insecto plaga se ha dado dentro de
las áreas urbanas, sobre todo por la agricultura de traspatio y
por la presencia de hospedantes utilizados como plantas de
ornato, tales como obelisco, majahua, parota o guanábano,
donde, la transportación de material vegetal infestado, sin
regularización o de manera clandestina, es posiblemente el
principal mecanismo de dispersión, en virtud de la cantidad
de productos que se pueden movilizar, por lo que las acciones
cuarentenarias y la vigilancia en puertos y carreteras
constituyen una de las principales barreras para evitar la
propagación de este insecto (Martínez, 2007).
El problema de cochinilla rosada del hibisco es de vital
importancia para los productores de especies ornamentales
en el estado de Nayarit. Por ser de reciente introducción
existen pocos estudios que les permitan controlar o manejar
eficientemente este problema fitosanitario; por lo cual, la
investigación tuvo como objetivo conocer la diversidad de
especies vegetales ornamentales susceptibles al ataque de
cochinilla rosada y determinar su nivel de infestación en
siete municipios del estado de Nayarit.
Los muestreos realizados para la detección y determinar
el nivel de infestación de cochinilla rosada en especies
ornamentales, fueron obtenidos en intervalos semanales
durante 49 semanas comprendidas entre los meses de
enero a diciembre de 2009. El análisis consistió en estudiar
las especies ornamentales cultivadas y silvestres de los
municipios Acaponeta, Rosamorada, Santiago Ixcuintla,
San Blas, Tepic, Compostela y Bahía de Banderas.
Identificación de especies ornamentales
De las especies ornamentales muestreadas para evaluar
la presencia de cochinilla rosada dentro de cada uno de
los municipios, se colectaron las hojas, tallos, flores
y frutos para facilitar su identificación, las cuales se
prensaron y deshidrataron mediante técnicas estándar de
herborización (Lot y Chiang, 1986). La identificación se
realizó por personal especializado de la Unidad Académica
de Agricultura, de la Universidad Autónoma de Nayarit
(UAN), con confirmación de nombres científicos por
cotejo de muestras con las del Herbario Nacional MEXU de
la Universidad Nacional Autónoma de México (UNAM).
probably the main mechanism of dispersion, considering the
number of products that can be mobilized, so that quarantine
and surveillance measurements at the ports and roads are
one of the main barriers to prevent the spread of this insect
(Martínez, 2007).
The trouble with the hibiscus mealybug is quite important
for the ornamental species producers in the State of Nayarit.
Considering that, it has been recently introduced, only a
few studies allow them to efficiently manage or control
this problem, for which, the research aimed to understand
the diversity of ornamental plant species susceptible to
mealybug attack and, to determine the level of infestation
in seven municipalities of Nayarit.
The samples taken to detect and determine the level of
mealybug infestation in ornamental species were obtained
at weekly intervals for 49 weeks from January to December,
2009. The analysis consisted of studying the cultivated
and wild ornamental species from the municipalities of
Acaponeta, Rosamorada, Santiago Ixcuintla, San Blas,
Tepic, Compostela and Bahía de Banderas.
Ornamental species identification
From the ornamental species sampled to assess the presence
of the hibiscus mealybug within each of the municipalities,
the leaves, stems, flowers and fruits were collected in order
to easily identify them, which were pressed and dehydrated
by standard techniques of plant collection (Lot and Chiang,
1986). The identification was made by specialists of the
Academic Unit of Agriculture of the Autonomous University
of Nayarit (UAN), with confirmation of the scientific
names for comparison of samples with those of the National
Herbarium of MEXU, National Autonomous University of
Mexico (UNAM).
Determination of incidence and level of infestation
In order to determine the presence, incidence and level of
infestation of the pest in each of the established ornamental
species in the marginal, urban, agricultural and nursery
areas, a georeferencing permanent sampling sites located
in 500 to 1 000 m was performed; 10 plants per site and four
Determinación de incidencia y nivel de infestación
Para determinar la presencia, incidencia y nivel de
infestación de la plaga en cada una de las especies
ornamentales establecidas dentro del área marginal, urbana,
agrícola y vivero, se realizó una georeferenciación de sitios
de muestreo permanentes ubicados cada 500 a 1 000 m; se
seleccionaron 10 plantas por sitio y cuatro brotes terminales
de 5 a 10 cm (uno por cada punto cardinal). Se contabilizaron
los estadios ninfales (primero, segundo y tercero) y adultos
de cochinilla presentes en cada brote.
Para determinar el grado de afectación se utilizó la escala
propuesta por la DGSV-DPF (2008); SAGARPA (2010);
Suresh y Chandra (2008), quienes especifican que el nivel
nulo corresponde a 0 cochinillas por brote; el nivel 1 (bajo),
de 1 a 10 cochinillas por brote; nivel 2 (medio), 11 a 20
cochinillas por brote; nivel 3 (alto), con más de 20 cochinillas
por brote. Basado en las características morfológicas del
insecto, la determinación taxonómica se realizó por personal
técnico especializado en piojos harinosos, perteneciente
tanto al Comité Estatal de Sanidad Vegetal en Nayarit
(CESAVENAY), como de la Universidad Autónoma de
Nayarit; para lo cual, en los casos en que surgió alguna
duda, se contó con el apoyo para verificación del material
biológico, por parte de personal oficial adscrito al Centro
Nacional de Referencia Fitosanitaria.
Identificación de especies ornamentales
De las 33 colectas realizadas de material vegetal, se
identificaron 28 especies distribuidas en 20 familias
botánicas, las cuales fueron: Malvaceae, obelisco (Hibiscus
rosa sinensis L.), majagua (Hibiscus tiliaceaus Arruda);
me verás y no me conocerás (Hibiscus mutabilis L.);
Combretaceae, almendro (Terminalia cattapa L.);
Araliaceae, aralia (Fatsia sp.); Ericaceae, azalia (Azalea sp.);
Moraceae, benjamina (Ficus benjamina); Nyctaginaceae,
bugambilia (Bougainvillea spp.); Apocynaceae, carisa
(Carissa macrocarpa= grandiflora), campanita (Cascabela
thevetia L. (Lippold), copa de vino (Allamanda cathartica
L.), laurel (Nerium oleander L.) y mandevila (Mandevila
sp.); Solanaceae, copa de oro (Solandra sp.); Asteraceae,
manto de la virgen (Montanoa grandiflora Alamán ex DC.);
Euphorbiaceae, croto (Codiaeum variegatum) y nochebuena
487
terminal shoots 5 to 10 cm (one for each cardinal direction)
were selected. The nymphal stages (first, second and
third) and mealybug adults present in each outbreak were
counted.
In order to determine the degree of impact, the scale proposed
by the DGSV-DPF (2008); SAGARPA (2010); Suresh
and Chandra (2008) was used, who specified that, the zero
level corresponds to 0 mealybugs per shoot, level 1 (low),
from 1 to 10 mealybugs per shoot, level 2 (medium), 11 to
20 mealybugs per shoot, level 3 (high), with more than 20
mealybugs per shoot. Based on the insectʼs morphological
characteristics, a taxonomic identification was performed by
trained personnel in mealybugs, both belonging to the State
Committee for Plant Protection in Nayarit (CESAVENAY),
and the Autonomous University of Nayarit; for which, in the
cases where questions arose, it was supported for verification
of biological material by official personnel assigned in the
Fitosanitary National Reference Center.
Ornamental species identification
Out of the 33 plant material collections, 28 species
were identified in 20 botanical families: Malvaceae,
obelisk (Hibiscus rosa-sinensis L.), majahua (Hibiscus
tiliaceaus Arruda); me verás y no me conocerás (Hibiscus
mutabilis L.); Combretaceae, almond (Terminalia cattapa
L.); Araliaceae, aralia (Fatsia sp.); Ericaceae, azalia
(Azalea sp.); Moraceae, benjamina (Ficus benjamina);
Nyctaginaceae, bougainvillea (Bougainvillea spp.);
Apocynaceae, Carisa (Carissa grandiflora=macrocarpa),
campanita (Cascabela thevetia L. (Lippold), glass of wine
(Allamanda cathartica L.), laurel (Nerium oleander L.)
and mandevila (Mandevila sp.); Solanaceae, cup of gold
(Solandra sp.); Asteraceae, the garment of the Virgin
(Montanoa grandiflora Alamán ex DC.); Euphorbiaceae,
croto (Codiaeum variegatum) and poinsettia (Euphorbia
pulcherrima Will ex. Klotzsch); Heliconiaceae, heliconia
(Heliconia spp.) Convulvulaceae, poison ivy (Ipomoea
carnea var. fistulosa); Rubiaceae, ixora (Ixora spp.);
Leguminosae, golden shower (Cassia fistula L.) and leg of
beef (Bahuinia variegata L.); Verbenaceae, melina (Gmelina
arborea Roxb.); Amaryllidaceae, daffodil (Narcissus sp.);
Polygonaceae, rose angel (Antigonon leptopus Hok. &
Arn); Rosaceae, Rose (Rosa spp.), Palmae, coconut palm
(Euphorbia pulcherrima Will ex. Klotzsch); Heliconaceae,
heliconia (Heliconia spp.); Convulvulaceae, hiedra
(Ipomoea carnea var. fistulosa); Rubiaceae, ixora (Ixora
spp.); Leguminosae, lluvia de oro (Cassia fistula L.) y pata de
res (Bahuinia variegata L.); Verbenaceae, melina (Gmelina
arborea Roxb.); Amaryllidaceae, narciso (Narcissus sp.);
Polygonaceae, rosa de ángel (Antigonon leptopus Hok. &
Arn); Rosaceae, rosal (Rosa spp.), Palmae, palma de coco
(Cocos nucifera L.) y Oleaceae, trueno (Ligustrum sp.),
con una dominancia relativa de las familias Apocynaceae,
Malvaceae, Euphorbiaceae y Leguminosae, con 5, 3, 2 y 2
especies, respectivamente, que concuerda con los resultados
de Mani (1989); Sagarra y Peterkin (1999); Kairo et al.
(2000) en cuanto a la familia Malvaceae.
Determinación de incidencia y nivel de infestación
Se muestrearon 9 101 sitios, de los cuales; 91.6%
correspondió a sitios de muestreo ubicados en áreas urbanas;
asimismo, en 8 174 sitios (89.8%) se encontraron plantas que
mostraron algún nivel de infestación por cochinilla rosada
(Cuadro 1). De los 8 174 sitios con presencia de cochinilla,
los muestreos se realizaron en su mayoría en áreas urbanas
(91.5%), lo que concuerda con Martínez (2007), seguido
por las áreas de viveros (4.4%), marginal (3.8%) y agrícola
(0.3%), respectivamente.
(Cocos nucifera L.) and Oleaceae, thunder (Ligustrum sp.),
with a relative dominance of the families Apocynaceae,
Malvaceae, Euphorbiaceae and Leguminosae, with 5, 3, 2
and 2 species, respectively, consistent with the results of
Mani (1989); Kairo (1998); Sagarra and Peterkin (1999)
in the family Malvaceae.
Incidence and infestation level determination
9 101 sites were sampled, out of which; 91.6% were sampling
sites located in urban areas; also, in 8 174 sites (89.8%)
plants that showed some level of mealybug infestation were
found (Table 1). Out of the 8 174 sites with the presence
of mealybugs, the samples were taken mostly in urban
areas (91.5%), consistent with Martínez (2007), followed
by nursery (4.4%), marginal (3.8%) and agriculture areas
(0.3%), respectively.
Considering the number of sites sampled at municipal
level, the distribution was as follows: Santiago Ixcuintla 2
571 (31.5%), Bahia de Banderas 1 640 (20.1%), San Blas
1 198 (14.7%), Compostela 1 012 (12.4%), Rosamorada 885
(10.8%), Acaponeta 620 (7.6%) and Tepic 235 (2.9%); on the
other hand, by taking into account only the points with the
insect pest, with an overall average of 29.8% infestation, the
most affected plant species were H. rosa-sinensis (77.5%),
Cuadro 1. Especies ornamentales con presencia de cochinilla rosada del hibisco en Nayarit.
Table 1. Ornamental species with hibiscus mealybug in Nayarit.
Especie ornamental
Hibiscus rosa-sinensis
Hibiscus tiliaceaus
Hibiscus mutabilis
Bougainvillea sp.
Codiaeum variegatum
Montanoa grandiflora
Solandra spp.
Carissa macrocarpa
Total
Sitios (Núm.)
5 046
1 782
111
272
456
29
429
49
8 174
m= marginal; u= urbano; a= agrícola; v= viveros.
Área de muestreo
m
u
70
4 802
219
1 532
0
110
3
250
1
369
13
16
2
368
1
34
309
7 481
Por el número de sitios muestreados a nivel de municipio, la
distribución quedó de la siguiente manera: Santiago Ixcuintla
2 571 (31.5%), Bahía de Banderas 1 640 (20.1%), San Blas
1 198 (14.7%), Compostela 1 012 (12.4%), Rosamorada 885
(10.8%), Acaponeta 620 (7.6%) y Tepic 235 (2.9%); por otro
a
9
10
1
1
1
0
2
1
25
v
165
21
0
18
85
0
57
13
359
Nivel de infestación
0
1
3 158
1 835
1 265
477
95
14
269
3
454
2
25
4
426
3
47
2
5 739
2 340
2
45
35
2
0
0
0
0
0
82
3
8
5
0
0
0
0
0
0
13
H. tiliaceaus (21.3%) and H. mutabilis (0.7%); finally, the
level of infestation obtained in the sites studied was found
that: 70.1% were classified at level zero for not presenting
the plague at all, 28.8%, 1 (low); 1% in level 2 (medium)
and remaining 0.1% in level 3 (high).
lado, al tomar en cuenta únicamente los puntos con presencia
del insecto plaga, con un promedio general de infestación
de 29.8%, las especies vegetales más afectadas fueron H.
rosa-sinensis (77.5%), H. tiliaceaus (21.3%) e H. mutabilis
(0.7%); finalmente, el nivel de infestación obtenido en los
sitios estudiados se encontró que 70.1% fue clasificado en
nivel nulo por no presentar la plaga; 28.8% de 1 (bajo); 1%
en nivel 2 (medio) y 0.1% restante en nivel 3 (alto).
Estos resultados coinciden con González-Hernández (2011),
quien considera que un factor importante para la presencia
de cochinilla rosada del hibisco (CRH) en bajas densidades
y su restricción a zonas urbanas o marginales, en las nuevas
áreas de infestación, es la introducción temprana, cuando
las densidades del insecto se encuentran en niveles bajos y
poco extendidas en una localidad, de enemigos naturales
como A. kamali, toda vez que en estas zonas se tiene cero o
bajo uso de plaguicidas y de otras prácticas agronómicas,
que pueden afectar la efectividad y el establecimiento a
largo plazo de los enemigos naturales; sobre la presencia
y severidad del insecto en diversas especies hospedantes,
existen evidencias relacionadas al tiempo de desarrollo,
supervivencia y capacidad de reproducción, que varían de
acuerdo a la especie hospedante (Serrano y Lapointe, 2002).
Del total de especies identificadas como hospedantes de
cochinilla rosada en el estudio, los casos de Montanoa
grandiflora y Solandra sp., corresponden a nuevos reportes
como hospedantes de la plaga a nivel mundial, ambos con
nivel de afectación 1 y considerados como secundarios o
no preferenciales.
Para el caso particular de la especie H. rosa-sinensis, al hacer un
análisis sobre la distribución mensual de puntos con presencia
de cochinilla rosada dentro de los diversos municipios (Cuadro
2), se observa que a excepción de San Blas y Tepic, donde se
obtuvo el menor número de puntos con presencia de la plaga,
con distribución no uniforme durante todos los meses, para el
resto de municipios la distribución de puntos infestados fue
muy significativa (muchos puntos) y uniforme durante todo
el año, gracias a lo cual, por ser la única especie presente en las
cuatro áreas de muestreo y en todos sus niveles de afectación,
se confirma como la especie hospedante principal de la plaga,
acorde a la generalidad de registros con presencia de la plaga en
el mundo (Mani, 1989; Berg, 1996; USDA, 2001; Vázquez et
al., 2002; CABI, 2005; Bogran y Ludwig, 2007; Niebla et al.,
2010), lo que obliga a mantener una estricta vigilancia sobre
esta especie para la detección oportuna del insecto plaga
(Vázquez et al., 2002).
489
These results agree with González-Hernández (2011), who
believes that an important factor for the presence of the
hibiscus mealybug (HM) at low density and its restriction to
urban areas or marginalized in the new areas of infestation,
is the early introduction when the insect densities are found
at low levels and little widespread in a locality, of natural
enemies such as A. kamali, since in these areas, there in zero
or low use of pesticides and other agricultural practices that
may affect the effectiveness and long-term establishment
of natural enemies on the presence and severity of the
insect in different host species, there is evidence related
to the time of development, survival and reproductive
capacity, which vary according to host species (Serrano
and Lapointe, 2002).
From all the species identified as hosts of the hibiscus
mealybug in the study, the cases of Montanoa grandiflora
and Solandra sp., correspond to new records as hosts of
this pest worldwide, both with involvement level 1 and
considered secondary or non-preferential.
For the particular case of the species H. rosa-sinensis, to
make an analysis of the monthly distribution of points
with hibiscus mealybug presence within the various
municipalities (Table 2) shows that, with the exception of
San Blas and Tepic, where the fewest points in the presence
of the pest was found, whose distribution was not uniform
during each month, for the rest of the municipalities the
points distribution was highly significant (several points)
and uniform throughout the whole year, thanks to which,
being the only species present in the four sampling areas
and at all levels of involvement, is confirmed as the main
host species of the pest, according to the majority of records
in the presence of the pest in the world (Mani, 1989; Berg,
1996; Garland, 1998; USDA, 2001; Vázquez et al., 2002;
CABI, 2005; Bogran and Ludwig, 2007; Niebla et al., 2010),
making it necessary to keep a close watch on this species for
the early detection of insect pests (Vázquez et al., 2002).
However, during the months when the coldest temperatures
are recorded annually in the State (November to March), in
which the least number of points with the insect was found,
the population is not entirety diminished, with documentary
evidence that in countries with a cold winter, the species
can survive these conditions as both an egg (OEPP-EPPO,
2005) and adult, thanks to its ability to protect themselves
by occupying different habitats such as soil, cracks and
hollow vegetable barks or even inside host-fruit slices
(Matthew, 2009).
Cuadro 2. Distribución mensual de puntos con presencia de cochinilla rosada en Hibiscus rosa- sinensis L.
Table 2. Monthly distribution of points with the presence of hibiscus mealybug in Hibiscus rosa-sinensis L.
Municipio
Acaponeta
Rosamorada
Santiago Ixc.
San Blas
Tepic
Compostela
B. Banderas
Total
Ene
3
6
62
2
1
11
28
113
Feb
37
16
23
8
5
12
29
130
Mar
18
23
17
Abr
50
41
96
18
6
12
76
30
235
May
27
21
90
8
2
14
10
172
No obstante, durante los meses en que se registran
anualmente las temperaturas más frías en la entidad
(noviembre a marzo), y en los que se encontró el menor
número de puntos con presencia del insecto, su población
no se ve disminuida en su totalidad, con evidencias
documentales de que en países con un invierno frío, la
especie puede sobrevivir a dichas condiciones tanto en
estado de huevo (OEPP-EPPO, 2005), como de adulto,
gracias a su capacidad de protegerse al ocupar diversos
hábitats como suelo, grietas y huecos de corteza vegetal ó
interior de gajos de frutos hospedantes (Matthew, 2009).
Caso contrario, como se observa en el mismo cuadro, las
altas poblaciones encontradas durante el periodo de lluvias
(julio-octubre), tienen relación con lo encontrado por
Samuthiravelu et al. (2010), quienes al evaluar en India la
influencia de factores abióticos sobre dinámica poblacional
del insecto en el cultivo de morera, encontraron que con
lluvias y humedad relativa altas, no se observó alguna
correlación negativa sobre la plaga, con incrementos de
50.6% de la población y durante el invierno (0-3.1%).
Con relación a los muestreos realizados en obelisco (Cuadro
3); 95.2% se desarrolló en áreas urbanas. Los resultados
obtenidos muestran que de los 5 046 sitios muestreados, en
3 158 (62.6%) no se encontró algún nivel de infestación,
mientras que en 1 888 (37.4%), si se ubicaron entre los
niveles de infestación 1, 2 y 3 con 1 835 (36.4%), 45
(0.9%) y 8 (0.2%) respectivamente; en cuanto al grado de
infestación por zona, toda vez que a nivel estatal las mayores
afectaciones se observaron en los municipios de Santiago
Ixcuintla (13.7%), Acaponeta (7.1%) y Rosamorada (5.9%),
en el norte del estado se tuvo 45.5% de sitios con presencia de
la plaga, seguido por las zonas sur (33.4%) y centro (18.9%).
Jun
31
25
54
6
5
9
26
156
Meses
Jul
50
39
83
12
1
29
19
233
Ago
34
37
75
10
5
22
19
202
Sep
38
33
47
14
1
29
21
183
Oct
36
19
67
9
1
23
23
178
Nov
17
21
52
6
4
13
10
123
Dic
18
15
24
3
10
17
87
Total
359
296
690
96
25
208
214
1 888
Otherwise, as shown in the same figure, the high
populations found during the rainy season (July-October)
are related to the findings of Samuthiravelu et al. (2010),
who evaluated in India the influence of abiotic factors on
population dynamics of insects in mulberry cultivation,
found that with rain and high humidity, there wasn’t any
negative correlation on the pest at all, with increases of
50.6% population and during the winter (0-3.1%).
Regarding the samplings made in obelisk (Table 3), 95.2%
took place in urban areas. The results show that, out of
the 5 046 sites sampled, in 3158 (62.6%) there wasn’t
any level of infestation at all, while in 1888 (37.4%), did
ranked among the infestation levels 1, 2 and 3 with 1835
(36.4%), 45 (0.9%) and 8 (0.2%) respectively; regarding
the degree of infestation per area, since at State level
the greatest damage was observed in the municipalities
of Santiago Ixcuintla (13.7%) Acaponeta (7.1%) and
Rosamorada (5.9%), in the north of the State, 45.5% of the
sites presented the pest, followed by the southern (33.4%)
and central areas (18.9%).
CONCLUSIONS
The ornamental species of the Malvaceae family: Hibiscus
rosa-sinensis, H. tiliaceaus and H. mutabilis are shown to
have great susceptibility to Maconellicoccus hirsutus attack.
In the pest-host association, H. rosa-sinensis was the only
species found in the seven municipalities throughout the
sampling period and within the four sampling areas, as well
as in all the levels of infestation, with a greater frequency of
positive cases in the municipalities of Acaponeta (59.3%),
491
Cuadro 3. Monitoreo y nivel infestación de Hibicus rosa-sinensis L. en siete municipios de Nayarit.
Table 3. Monitoring and infestation level of Hibicus rosa-sinensis L. in seven municipalities of Nayarit.
Municipio
Acaponeta
Rosamorada
Santiago Ixc.
San Blas
Tepic
Compostela
B. Banderas
Total
Sitios (Núm.)
605
788
1 558
619
209
555
712
5 046
m= marginal; u= urbano; a= agrícola; v= viveros.
Área de muestreo
m
u
19
579
10
778
15
1 528
2
607
7
179
12
532
5
599
70
4 802
CONCLUSIONES
Las especies ornamentales de la familia Malvaceae
Hibiscus rosa-sinensis, H. tiliaceaus e H. mutabilis,
son las que mostraron tener la mayor susceptibilidad al
ataque de Maconellicoccus hirsutus. En la asociación
plaga-hospedante, la única especie encontrada en los
siete municipios, durante todo el periodo de muestreo
y dentro de las cuatro áreas de muestreo, así como en
todos los niveles de infestación fue H. rosa-sinensis, con
mayor frecuencia de casos positivos en los municipios
de Acaponeta (59.3%), Santiago Ixcuintla (44.2 %)
y Rosamorada (37.5%). Las especies Montanoa
grandif lora Alamán ex DC (familia Asteraceae) y
Solandra sp. (Solanaceae), corresponden a nuevos
reportes como hospedantes de cochinilla rosada a
nivel mundial, ambos con nivel de afectación 1,
considerados como hospedantes secundarios o no
preferenciales por el insecto.
AGRADECIMIENTOS
Al Consejo Nacional de Ciencia y Tecnología (CONACYT),
por el apoyo económico para la realización del proyecto
integral de donde deriva este estudio, mediante proyecto
Nayarit 2007/C04/81795, así como al Comité Estatal de
Sanidad Vegetal de Nayarit, por las facilidades y apoyos
de información brindados para la realización de la
investigación.
a
0
0
3
5
0
0
1
9
v
7
0
12
5
23
11
107
165
Nivel de infestación
0
1
246
349
492
282
868
683
523
96
184
25
347
194
498
206
3 158
1 835
2
10
12
5
0
0
13
5
45
3
0
2
2
0
0
1
3
8
Santiago Ixcuintla (44.2%) and Rosamorada (37.5%). The
species Montanoa grandiflora Alamán ex DC (Asteraceae)
and Solandra sp. (Solanaceae) correspond to new worldwide
records as mealybug hosts, both with involvement level 1,
considered as secondary or non-preferred hosts for the insect.
LITERATURA CITADA
Berg, G. H. 1996. Análisis de riesgo por una vía respecto
a Maconellicoccus hirsutus (Green) (cochinilla
rosada). Informe técnico. Organismo Internacional
Regional de Sanidad Agropecuaria (OIRSA). San
Salvador, El Salvador. 32 p.
Bogran, C. E. and Ludwig, S. 2007. Pink hibiscus mealybug,
a new pest in Texas. Texas Cooperative Extension.
The Texas A&M University System E-454. 2 p.
CAB International (CABI). 2005. Crop Protection Compendium.
Global Module. United Kingdom. CD-ROOM.
CABI, 2011. Crop Protection Compendium. Maconellicoccus
hirsutus. URL: http://www.cabi.org/cpc/?compid=
1&dsid=40171&loadmodule=datasheet&page=86
8&site=161.
Cermeli, M.; Morales, V. P.; Godoy, F.; Romero, R. y
Cárdenas, O. 2002. Presencia de la cochinilla rosada
de la cayena Maconellicocus hirsutus (Green)
(Hemíptera: Pseudococcidae) en Venezuela.
Entomotrópica. 17(1):103-105.
Chong, H. H. 2009. First report of the pink Hibiscus
Mealybug, Maconellicoccus hirsutus (Green)
(Hemiptera: Pseudocóccidae), in South Carolina.
J. Agric. Urban Entomol. 26(2):87-94.
DGSV-DPF. 2008. Apéndice técnico-operativo de la
campaña contra cochinilla rosada del hibisco
(Maconellicoccus hirsutus Green). DGSV-DPFSENASICA-SAGARPA. D. F., México. 36 p.
G o n z á l e z - H e r n á n d e z , H . 2 0 11 . F i c h a t é c n i c a
Maconellicoccus hirsutus (Green) cochinilla
r o s a d a d e l h i b i s c o ( C R H ) . S A G A R PA SENASICA-SINAVEF. D. F., México. 32 p.
URL: http://www.cesaveson.com/fckeditor/
editor/filemanager/conectors/oispx/UserFiles/
file/FT-CRH_2011.pdf.
Granara, W. M. C. y Claps, L. E. 2003. Cochinillas
(Hemiptera: Coccoidea) presentes en plantas
ornamentales en la Argentina. Neotropical
Entomology. 32(4):625-637.
Hoy, M. A.; Hamon, A. and Nguyen, R. 2011. Pink hibiscus
mealybug, Maconellicoccus hirsutus (Green).
University of Florida, Institute of Food and
Agricultural Sciences. EENY-029. 6 p.
Kairo, M. T. K.; Pollard, G. V.; Peterkin, D. D. y López, V. F.
2000. Biological control of the hibiscus mealybug
maconellicoccus hirsutus green (Hemíptera:
Pseudococcidae) in the Caribean. Integrated Pest
Management Reviews. 5:214-254.
Lot, A. y Chiang, F. 1986. Manual de herbario. Consejo
Nacional de la Flora de México A. C. México.
142 p.
Mani, M. 1989. A rewiew of the pink mealybug
Maconellicoccus hirsutus (Green). Insect Science
Appl. (10):157-167.
Martínez, M. A. 2007. La cochinilla rosada del hibisco,
Maconellicoccus hirsutus (Green), un peligro
potencial para la agricultura cubana. Protección
Vegetal. 22(3):166-182.
Martínez, M. A.; Blanco, E. y Suris, M. 2008. Fauna de
chinches harinosas (Hemíptera: Pseudococcidae)
asociadas a plantas de interés: plantas
ornamentales. Revista Protección Vegetal.
(23):48-53.
Matthew, V. J. 2009. Ecological and behavioral factors
associated with monitoring and managing pink
hibiscus mealybug (Hemíptera: Pseudocóccidae) in
the southern US. Thesis Philosophy Doctor (PhD).
Virginia Polytechnic Institute and Virginia State
University. 146 p.
Mohammad, A. H.; Moussa, S. F.; Abo-Ghalia, A. H.
and Ahmed, S. A. 2010. Efficiency of certain
insecticides on the population(s) of the pink hibiscus
mealybug Maconellicoccus hirsutus (Green) and
their natural enemies under the field condition in
Ismailia governorate. Egypt. Acad. J. Biolog. Sci.
2(2):11-17.
Niebla, R. S.; Jiménez, C. R.; Castellanos, G. L. y Suárez, P. E.
2010. Pseudocóccidos en la Provincia de Cienfuegos
y sus Hospedantes. Fitosanidad. 14(1):1-10.
Organisation Européenne et Mediterranéenne pour
la Protection des Plantes, European and
Mediterranean Plant Protection Organization.
(OEPP-EPPO). 2005. Maconellicoccus hirsutus,
data sheets on quarantine pests, OEPP, EPPO.
Bulletin. 35:413-415.
Reed, C. 2009. Import risk analysis: table grapes (Vitis
vinifera) from China. ISBN 978-0-478-35725-7.
81-90 pp.
Secretaría de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación (SAGARPA). 2007.
Acuerdo por el que se instrumenta el dispositivo
nacional de emergencia en los términos del
Artículo 46 de la Ley Federal de Sanidad Vegetal,
con el objeto de controlar y mitigar el riesgo de
dispersión de la cochinilla rosada del hibisco
(Maconellicoccus hirsutus) en México. Diario
Oficial de la Federación (DOF). Primera sección.
72-80 pp.
Secretaría de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación (SAGARPA). 2010.
Protocolo operativo de la campaña contra la
cochinilla rosada del hibisco Maconellicoccus
hirsutus (Green). Versión 1. 34 p.
Sagarra, L. A. and Peterkin, D. D. 1999. Invasions
of the Caribbean by the hibiscus mealybug,
Maconellicoccus hirsutus Green (Homóptera:
Pseudococcidae). Phytoprotection. 80(2):103-113.
Samuthiravelu, P.; Ravikumar, J.; Qadri, M. S. H.;
Hemanthkumar, L. and Jayarac, S. 2010. Influence
of abiotic factors on population dynamics of
leaf webber Diaphania pulverulentalis and its
natural enemies in mulberry. J. Biopesticides.
3(1):37-42.
Serrano, M. S. and Lapointe, S. L. 2002. Evaluation of host
plants and a meridic diet for rearing Maconellicoccus
hirsutus (Hemiptera: Pseudócoccidae) and its
parasitoid Anagyrus kamali (Hymenóptera:
Encyrtidae). Fla. Entomol. 85:417-425.
Shrewsbury, P. M.; Bejleri, K. and Lea-Cox, J. D. 2006.
Integrating cultural management practices and
biological control to suppress citrus mealybug. Int.
Soc. Hortic. Sci. 60 p.
SINAVEF. 2011a. Reporte epidemiológico cochinilla rosada
del hibisco. SINAVEF-UASLP-SENASICASAGARPA. 1-15 pp.
SINAVEF. 2011b. El cambio climático y su influencia
en las plagas agrícolas. SINAVEF-SENASICASAGARPA. 22-38 pp.
Stibick, J. N. L. 1997. New pest response guidelines, pink
hibiscus mealybug Maconellicoccus hirsutus.
USDA. Marketing and regulatory programs, animal
and plant health inspection service, plant protection
and quarantine (USDA-APHIS-PPQ). 104 pp.
493
Suresh, S. and Chandra, K. P. 2008. Seasonal incidence
of economically important coccid pests in
Tamil Nadu. Proceedings of the XI International
Symposium on Scale Insect Studies. Tamil Nadu,
India. 285-291 pp.
Tanwar, R.; Jeyakumar, P. and Monga, D. 2007. Mealybug
and their management. Technical bulletin 19. New
Delhi. 20 p.
United States Department Agriculture (USDA) 2001.
Biological control of pink Hibiscus Mealybug
Project Manual. 194 p.
Vázquez, L. L.; Navarro, A. y Blanco, E. R. 2002.
Riesgos de la cochinilla rosada (Maconellicoccus
hirsutus) para Cuba. La Habana. INISAV.
41 p.
PRODUCCIÓN DE PLÁNTULAS DE ALCATRAZ AMARILLO (Zantedeschia
elliottiana Engl.) EN DIFERENTES SUSTRATOS*
YELLOW CALLA LILY SEEDLING PRODUCTION (Zantedeschia
elliottiana Engl.) IN DIFFERENT SUBSTRATES
Ma. de Jesús Juárez-Hernández1§, Juan Martínez-Solís1, Arturo Curiel-Rodríguez1 y Alejandro Gracia-Santos2
Departamento de Fitotecnia. Universidad Autónoma Chapingo. Carretera México-Texcoco, km 38.5. Chapingo, Estado de México. C. P. 56230. Tel. 01 595 95216542.
([email protected]), ([email protected]). 2Ingeniero agrónomo especialista en fitotecnia. ([email protected]). §Autora para
1
RESUMEN
ABSTRACT
Zantedeschia elliotiana Engl. es una planta herbácea decidua
nativa de África con potencial ornamental para jardín, flor de
corte y planta de maceta. Estudios en especies ornamentales
han confirmado que el ácido giberélico (AG3), mejora el
porcentaje de emergencia y la velocidad de emergencia de
las plántulas. La presente investigación experimental se
estableció en mayo de 2008 en un invernadero localizado
en Chapingo, Estado de México con el objetivo de evaluar
el efecto del AG3 en concentraciones de 0, 100 y 200 mg L-1
en seis sustratos (tierra lama, tezontle, tierra de hoja y las
mezclas de éstos en pares por partes iguales). El experimento
se realizó bajo un diseño completamente al azar con tres
repeticiones, empleando siete semillas para cada tratamiento.
El AG3 fue principalmente favorable cuando se aplicó a una
concentración de 100 mg L-1 utilizando como sustrato la
tierra lama; sin embargo, los mayores valores de porcentaje
de germinación e índice de velocidad de emergencia, se
obtuvieron cuando no se aplicó AG3 y utilizando como
sustratos la tierra lama más la tierra de hoja o sólo tierra de
hoja. Se concluyó que la germinación de Z. elliotiana no
estuvo regulada totalmente por procesos fisiológicos de las
giberelinas, debido que no mejoró considerablemente los
valores de las variables evaluadas, y el tipo de sustrato es
muy importante para la germinación de semillas.
Zantedeschia elliotiana Engl. is a deciduous herbaceous
plant native from Africa with ornamental potential
for garden, cutting f lower and pot plant. Studies in
ornamental species have confirmed that gibberellic acid
(GA3), improves the emergence percentage and the rate
of seedling emergence. This experimental research was
established in May, 2008, in a greenhouse located in
Chapingo, State of Mexico in order to evaluate the effect
of GA3 at concentrations of 0, 100 and 200 mg L-1 in
six substrates (organic matter, volcanic rock, leaf mold
and mixtures of these in pairs equally distributed). The
experiment was conducted under a completely randomized
design with three replications, using seven seeds for each
treatment. The GA3, was mainly favorable when applied
at a concentration of 100 mg L-1 using as substrate organic
matter; however, the highest values of germination
percentage and rate of emergence speed is obtained when
GA3 was not applied and using as substrates organic matter
with leaf mold or just the last one. It was concluded that,
the germination of Z. elliotiana was not fully regulated
by physiological processes of gibberellins, because it
did not improve significantly the values of the variables
evaluated and, the type of substrate it’s quite important
for seed germination.
Palabras clave: ácido giberélico, reguladores de
crecimiento, sustratos.
INTRODUCCIÓN
El alcatraz amarillo (Zantedeschia elliotiana Engl.) es una
planta herbácea nativa del sur de África la cual es producida
y comercializada como flor de corte, planta de jardín al
aire libre y más recientemente como plantas para floración
en maceta, esto debido a su atractiva espata, referida
comúnmente como la flor (Corr y Widmer, 1991)
Las hormonas han sido reconocidas desde el principio como
agentes que desencadenan procesos que llevan la semilla
a la germinación. Las principales clases de hormonas
asociadas con la fisiología de la semilla son giberelinas
(AG), ácido abscísico (ABA) y citocininas (Purohitt, 1985).
Los principales efectos de las giberelinas en las semillas son
el aumento en el porcentaje y velocidad de la germinación
(Weaber, 1980), beneficios que se buscan cuando se propaga
a nivel comercial a partir de semillas.
La germinación de semillas de alcatraz por lo común no presenta
problemas, ya que se obtiene un porcentaje de germinación
aceptable cuando se propaga de esta manera; sin embargo, la
velocidad de germinación es lenta, empezando a germinar las
semillas a 30 días de sembradas. El tipo de sustrato es también
esencial para la producción de plantas de alta calidad, debido
que el volumen de una maceta es limitado, el sustrato y sus
componentes deben de poseer características físicas y químicas
que combinadas con un programa integral de manejo permitan
un crecimiento óptimo de las plantas (Cabrera, 1995).
Por lo anterior, los objetivos del presente trabajo fueron
determinar el sustrato o la combinación de sustratos que
proporcionen las mejores condiciones para la germinación
y crecimiento de plántulas de alcatraz amarillo y evaluar
el porcentaje y velocidad de germinación de las semillas,
bajo diferentes concentraciones de ácido giberélico (AG3).
La investigación se llevó a cabo en los invernaderos de
Postgrado de Horticultura del Departamento de Fitotecnia
en mayo de 2008, ubicados en la Universidad Autónoma
Ma. de Jesús Juárez-Hernández et al.
Key words: gibberellic acid, growth regulators, substrates.
INTRODUCTION
The yellow calla lily (Zantedeschia elliotiana Engl.) is an
herbaceous plant native of southern Africa which is produced
and marketed as a cutting flower, outdoors garden plant
and most recently as potted flowering plants, this due to its
attractive spathe, commonly referred as the flower (Corr
and Widmer, 1991).
The hormones have been recognized from the beginning as
agents that trigger processes leading to seed germination. The
major classes of hormones associated with seed physiology
are gibberellin (GA), abscisic acid (ABA) and cytokinins
(Purohitt, 1985). The main effects of gibberellins in the
seeds are the increase in the percentage and germination
rate (Weaber, 1980), benefits sought when propagated
commercially from the seeds.
The yellow calla lily’s seeds germination usually do not present
any problem at all, since it is obtained an acceptable percentage
of germination when propagated in this manner; however, the
speed of germination is slow, starting to germinate the seeds
30 days after sowing. The type of substrate is also essential
for plant production of high quality, because the volume of a
container is limited, the substrate and its components should
possess chemical and physical characteristics combined
with an integrated management program permit an optimum
growth of the plants (Cabrera, 1995).
Therefore, the objectives of this study were to determine the
substrate or the combination of substrates that would provide the
best conditions for germination and seedling growth of yellow
calla lily and, assessing the degree and speed of seed germination
under different acid concentrations gibberellic (GA 3).
The research was performed in greenhouses from the
Horticulture Graduate, Department of Plant Science in May
2008, located in the Chapingo (UACH), located at 19° 29’
north latitude and 98° 53’ west longitude, at an elevation of
2 245 m, with total annual rainfall of 644.8 mm and average
annual temperature of 15 °C.
Producción de plántulas de alcatraz amarillo (Zantedeschia elliottiana Engl.) en diferentes sustratos
Chapingo (UACH), que se localiza a 19° 29’ de latitud norte
y 98° 53’ de longitud oeste, a una altitud de 2 245 msnm, con
precipitación total anual de 644.8 mm y temperatura media
anual de 15 °C.
Se emplearon semillas de alcatraz amarillo (Zantedeschia
elliotiana Engl.), compradas en la región de Texcoco, con
una edad de aproximadamente ocho meses. Los sustratos
usados en este estudio fueron: tierra de hoja proveniente
de los bosques de encino del municipio de Texcoco, Estado
de México; tierra lama extraída de una laguna en el periodo
de sequia en el estado de Jalisco, tezontle rojo, el cual es
un sustrato de origen volcánico extraído de minas cercanas
al municipio de Texcoco, Estado de México. Se utilizaron
individualmente tierra de hoja, tierra lama y tezontle, así
como sus respectivas combinaciones en pares de sustratos
con una proporción 1:1. Se realizó un análisis físicoquímico de los sustratos y de las mezclas utilizadas en este
experimento, en el laboratorio de nutrición de frutales del
Departamento de Fitotecnia. Los resultados se muestran
en el Cuadro 1.
497
Yellow calla lily’s seeds were used (Zantedeschia elliotiana
Engl.), purchased in the region of Texcoco, eight months
old. The substrates used in this study were: leaf mold from
the oak forests of the municipality of Texcoco, Mexico;
organic matter taken from a pond in the drought period in
the State of Jalisco; volcanic rock, extracted from mines
near the Texcoco, Mexico State. Individually, the leaf
mold, organic matter and volcanic rock were used ass well
as their respective combinations of pairs of substrates with
a 1:1 ratio. An analysis of physicochemical substrates and
mixtures used in this experiment was made, at the nutrition
laboratory of the Department of Plant Science. The results
are shown in Table 1.
The factors and levels of study were three concentrations
of GA3 in powder soluble, with 0, 100 and 200 ppm and six
substrates, which generated the treatments listed in Table 2.
The application of GA3 was made by soaking the seeds for
each treatment for 24 h with their respective concentration
in the solution at a temperature of 25 °C. In order to ensure
Cuadro 1. Análisis físico-químico de los sustratos utilizados en los tratamientos de germinación de semillas de alcatraz
amarillo (Zantedeschia elliotiana Engl.).
Table 1. Physicochemical analysis of the substrates used in the treatment of seed germination of yellow calla lily (Zantedeschia
elliotiana Engl.).
Propiedades
Sustrato
TL100
Tz100
TH100
TL50+Tz50
TL50+TH50
Tz50+TH50
Textura
Franco
Arenoso
Arenoso
Franco-arenoso
Franco-arenoso
Arenoso
ρb (g cm-3)
0.46 mb
1.15 m
0.33 mb
0.96 b
0.39 mb
0.89 b
6.2 la
6.2 la
5.8 ma
6.1 mac
5.7 ma
5.5 fa
CE (mmhos cm-1)
1.29 ns
2.85 ps
1.58 ns
1.28 ns
1.5 ns
2 ns
N (%)
0.776 er
0.006 ep
0.366 er
0.188 r
0.685 er
0.17 1a
P (ppm)
2.05 p
1.97 p
2p
1.97 p
2p
2p
MO (%)
15.88 er
0.7 p
18.61 er
2.24 m
20.7 er
6.09 r
pH
TL= tierra lama; Tz= tezontle; TH= tierra de hoja; ρb= densidad aparente; la= ligeramente acido; mac= moderadamente ácido; fc= fuertemente ácido; ns= no salino; ps=
poco salino; er= extremadamente rico; ep= extremadamente pobre; r= rico; p= pobre; mb= muy bajo; b= bajo m= medio; fr= franco; ar= arenoso; fr-ar= franco-arenoso.
Los factores y niveles de estudio fueron: tres concentraciones
de AG3 en presentación de polvo soluble, con 0, 100 y 200
ppm y seis sustratos, los cuales generaron los tratamientos
que se indican en el Cuadro 2.
the inhibition of the solution, the seeds were rolled into a
fabric and immersed in the solution. The size of the seeds was
visually standardized by size and health, gathering those with
no symptoms of damage caused by fungi or environmental
Cuadro 2. Tratamientos estudiados de sustratos y concentraciones de AG3 en la germinación de semillas de Zantedeschia
elliotiana Engl.
Table 2. Studied treatments of substrates and GA3 concentrations in the germination of seeds of Zantedeschia elliotiana Engl.
Tratamiento
Sustrato (%)
AG3 (ppm)
Tratamiento
Sustrato
AG3 (ppm)
1
2
3
4
5
6
7
8
9
TL100
TL100
TL100
Tz100
Tz100
Tz100
TH100
TH100
TH100
0
100
200
0
100
200
0
100
200
10
11
12
13
14
15
16
17
18
TL50+ Tz50
TL50+ Tz50
TL50+ Tz50
TL50+ TH50
TL50+ TH50
TL50+ TH50
Tz50+ TH50
Tz50+ TH50
Tz50+ TH50
0
100
200
0
100
200
0
100
200
TL= tierra lama; Tz= tezontle; TH= tierra de hoja.
La aplicación de AG3 se hizo remojando las semillas de cada
tratamiento durante 24 h con su respectiva concentración
en la solución, a una temperatura de 25 °C. Para asegurar la
inbibición de la solución, las semillas se enrollaron dentro
de una tela y se sumergieron en la solución. Se uniformizó
visualmente el tamaño de las semillas por tamaño y sanidad,
obteniendo aquellas sin síntomas de daño causado por
hongos o factores ambientales. Las semillas se sembraron en
los respectivos sustratos a una profundidad de un centímetro,
en recipientes de polipropileno con dimensiones de 15 cm
de largo 15 cm de ancho ∗ 5 cm de profundidad, con una
capacidad de 250 ml aproximadamente.
factors. The seeds were sown in the respective substrate
to a depth of one inch in polypropylene containers with
dimensions of 15 cm length ∗ 15 cm wide ∗ 5 cm deep with
a capacity of 250 ml.
Se utilizó un diseño experimental completamente al azar
con tres repeticiones, donde las unidades experimentales
estuvieron constituidas por un recipiente con siete semillas.
Durante el transcurso del experimento se verificó que se
mantuvieran constantes los niveles de humedad y se regó
cada tres días con agua potable. Se aplicó Captan una vez a
dosis de 2 g L-1 para evitar enfermedades fungosas.
We recorded the percentage of germination from the first
seedling emerged until four months after planting. At the
end of the experiment, data from the rest of the variables
were taken, for which the seedlings were harvested
and transplanted immediately, these variables were:
emergence velocity index (EVI), fresh weight of plant
(FWP), emergence (E), normal seedlings (NS), abnormal
seedlings (AS), un-germinated seeds (UGS), number
of leaves (NL), leaf width (LW), root length (RL), root
number (RW).
Se registró el porcentaje de germinación desde que emergió
la primera plántula hasta cuatro meses después de la siembra.
Al final del experimento se tomaron los datos del resto de
las variables, para lo cual se cosecharon las plántulas y se
trasplantaron inmediatamente, dichas variables fueron las
siguientes: índice de velocidad de emergencia (IVE), peso
fresco de plántula (PFP), emergencia (E), plántulas normales
(PN), plántulas anormales (PA), semillas sin germinar
(SSG), número de hojas (NH), ancho de hojas (AH), longitud
de raíces (LR), número de raíces (NR).
We used a completely randomized design with three
replications, where the experimental units were composed
of a container with seven seeds. During the course of the
experiment, the humidity levels were verified to remain
constant and watered every three days with drinking water.
Captan was applied once at a dose of 2 g L-1 to prevent fungal
diseases.
Due to the wide variability in response to the treatments
applied to the yellow calla lily’s seeds, we performed
the Kruskal Wallis nonparametric test for more than two
independent samples, which does not assume normality
in the data and replace them by category (Conover,
1980), which made an analysis of variance (ANOVA) and
comparison of means through the ‘t’ student test (p≤ 0.05).
499
Por razones de la amplia variabilidad en la respuesta a los
tratamientos aplicado a las semillas de alcatraz amarillo, se
realizó la prueba no paramétrica de Kruskal Wallis para más
de dos muestras independientes, la cual no asume normalidad
en los datos y los remplaza por categorías (Conover, 1980),
con la cual se realizó una análisis de varianza (ANOVA)
y la comparación de medias a través de la prueba de ‘t’ de
student (p≤ 0.05).
The treatments with the highest value of emergence were
at concentrations of 0 ppm of GA3 on the substrate with
TL50+TH50 with 100 ppm of GA 3; and the substrate
TH100, because in both (E) 100% emergence was obtained,
these values differed significantly from other treatments,
except TH100 at 0 and 200 ppm of GA3 and TL50+TH50
at 100 and 200 ppm of GA3 (Table 3). Bowman and Paul
(1983) reported that a substrate should have a porosity of at
least 70% based on the volume and at least 40% proportion
of organic components, characteristics presented in the
TH100 substrate.
Con el fin de disminuir la variabilidad de las variables
respuesta, se manejo de la mejor manera el riego en los
sustratos. Aún así se presentaron problemas en los sustratos
tezontle y tierra lama, debido a la menor y excesiva retención
de agua en estos sustratos.
Emergencia
Los tratamientos con el mayor valor de emergencia fueron
con concentraciones de 0 ppm de AG3 en el sustrato con
TL50+TH50 y también con 100 ppm de AG3 y el sustrato
TH100, ya que en ambos se obtuvo una emergencia (E) de
100%, estos valores tuvieron diferencias significativas con
el resto de los tratamientos, con excepción de TH100 a 0 y
200 ppm de AG3 y TL50+TH50 a 100 y 200 ppm de AG3
(Cuadro 3). Al respecto, Bowman y Paul (1983), mencionan
que un sustrato debe tener una porosidad de por lo menos
70% con base en volumen y una proporción de componentes
orgánicos 40% como mínimo, características que presentó
el sustrato TH100.
In order to reduce the variability of the response variables, the
irrigation in the substrates was carefully managed. Even so,
there were problems in the volcanic rock and organic matter
substrates, due to the lower and excessive retention of water.
Emergence
The TH100 positive effect on germination is consistent
with that reported by Martínez (2008), who evaluated
substrates on the germination of Hippeastrum sp., found
that, TH100 allowed a germination percentage above 90%.
The combination of substrates TL50+TH50 gave a favorable
result due to interaction effects, enhancing organic matter,
water holding capacity and air porosity (Bowman and Paul,
1983; Bunt, 1988; Ansorena, 1994; Handreck and Black,
2002). With the volcanic rock, having a low porosity level,
presented a lower moisture retention capacity and achieved
48% of germinated seeds.
Cuadro 3. Efectos de los sustratos y del AG3 sobre la germinación y vigor de semillas de alcatraz amarillo, mediante la
prueba no paramétrica de Kruskal-Wallis.
Table 3. Effects of the substrates and GA3 on germination and vigor of yellow calla lily’s seeds through the Kruskal-Wallis
nonparametric test.
Sustrato (%)
TL100
TL100
TL100
Tz100
Tz100
Tz100
TH100
TH100
AG3 (ppm)
0
100
200
0
100
200
0
100
E (%)
28.57
57.14
57.14
47.61
33.33
9.52
85.71
100
Ef
b-e
b-e
b-e
ef
f
ab
a
z
PN (%)
23.8
57.14
57.14
42.85
9.52
9.52
80.95
100
fg
b-e
b-e
c-f
g
g
ab
a
PA (%)
4.76
0
0
4.76
23.8
0
4.76
0
ab
a
a
ab
b
a
ab
a
SSG (%)
71.42
42.85
42.85
52.38
66.66
90.47
14.28
0
fg
b-f
b-f
c-f
fg
g
a-c
a
IVE (%)
0.012
0.014
0.012
0.01
0.013
0.008
0.019
0.014
c-e
a-d
c-e
de
a-d
c-e
a
a-d
TL= tierra lama; Tz= tezontle; TH= tierra de hoja; E= emergencia; PN= plántulas normales; PA= plántulas anormales; SSG= semillas sin germinar; IVE= índice de
velocidad de emergencia; z= medias con la misma letra dentro de cada columna indican diferencias no significativas con p≤ 0.05.
prueba no paramétrica de Kruskal-Wallis (Continuación).
prueba no paramétrica de Kruskal-Wallis (Continuation).
Sustrato (%)
AG3 (ppm)
E (%)
TH100
TL50+Tz50
TL50+Tz50
TL50+Tz50
TL50+TH50
TL50+TH
TL50+TH50
Tz50+TH50
Tz50+TH50
Tz50+TH50
DMS
200
0
100
200
0
100
200
0
100
200
85.71
57.14
33.33
33.33
100
76.19
71.42
47.61
38.09
9.52
16.04
PN (%)
ab
b-e
ef
ef
a
a-c
a-d
c-e
d-f
f
85.71
57.14
28.57
33.33
100
61.9
66.66
38.09
23.8
9.52
14.52
PA (%)
ab
b-e
e-g
d-g
a
b-d
a-c
c-f
fg
g
0
0
4.76
0
0
14.28
4.76
9.52
14.28
0
19.85
SSG (%)
a
a
ab
a
a
b
ab
ab
ab
a
14.28
42.85
66.66
66.66
0
23.8
28.57
52.38
61.9
90.47
16.04
IVE (%)
ab
b-f
fg
fg
a
a-d
a-e
d-f
e-g
g
0.013
0.012
0.01
0.011
0.018
0.013
0.015
0.012
0.01
0.007
20.2
b-e
b-e
e
c-e
ab
a-d
a-c
c-e
e
e
TL= tierra lama; Tz= tezontle; TH= tierra de hoja; E= emergencia; PN= plántulas normales; PA= plántulas anormales; SSG= semillas sin germinar; IVE= índice de
velocidad de emergencia; z= medias con la misma letra dentro de cada columna indican diferencias no significativas con p≤ 0.05.
El efecto positivo de la TH100 en la germinación coincide
con lo reportado por Martínez (2008), quien al evaluar
sustratos en la germinación de Hippeastrum sp., encontró
que la TH100 produjo un porcentaje de germinación superior
al 90%. La combinación de sustratos TL50+TH50 dio un
resultado favorable, debido que hubo efectos de interacción,
mejorando la materia orgánica la capacidad de retención
de agua y la porosidad de aire (Bowman y Paul, 1983;
Bunt, 1988; Ansorena, 1994; Handreck y Black, 2002).
Con el tezontle, al tener una porosidad baja mostró menor
capacidad de retención de humedad y logró 48% de semillas
germinadas.
El AG3 no tuvo efectos significativos (p≤ 0.05) sobre le
emergencia de plántulas, es posible que las dosis altas de
ácido giberélico hayan actuado en forma negativa, debido
a que su efecto se añade al de las hormonas endógenas de la
semilla, que se encuentran en concentraciones variables en
los individuos (Rojas y Ramírez, 1993), las cuales pueden
variar no sólo entre especies y edad (Alizaga, 1992; Rojas,
1995), de modo que la respuesta puede no ser uniforme.
Plántulas normales
Los tratamientos con los que se obtuvo el mayor porcentaje de
plántulas normales (PN) fueron: TH100 con sus respectivas
concentraciones de AG3 y TL50+TH50, donde la aplicación
de AG3 a 200 ppm tuvo el mismo efecto que la aplicación a
GA3 had no significant effect (p≤ 0.05) on the seedling
emergence, it’s possible that, the high doses of gibberellic
acid acted negatively, because its effect is added to that of
endogenous hormones in the seed, which is found in varying
concentrations (Rojas and Ramírez, 1993), which may vary
not only between species and age (Alizaga, 1992; Rojas,
1995), so the answer may not be uniform.
Normal seedlings
The treatments which had the highest percentage of
normal seedlings (PN) were: TH100 with the respective
concentrations of GA 3 and TH50+TL50, where the
application of GA3 at 200 ppm had the same effect as the
application at 0 ppm. Applications of GA3 at 100 ppm in
TH100 and 0 ppm GA3 in the TL50+TH50, provided the
highest values (100%) of PN with significant differences
(p≤ 0.05) compared to the other treatments, except TH100
at concentrations of 0 and 200 ppm of GA3 together with
LT50+TH50 at 200 ppm of GA3 (Table 3). It’s inferred that,
since the organic matter came from a pond, it could´ve been
contaminated by toxic substances from the industrial or
agriculture in the riversʼ flow (Bastida, 1999), which could
explain the low percentage of PN.
Applications with concentrations of 100 ppm of GA3 over
concentrations of 0 ppm, generated only positive effects on
the percentage of PN in the TL100, where the value increased
0 ppm. Aplicaciones de 100 ppm de AG3 en TH100 y 0 ppm
de AG3 en la TL50+TH50, proporcionaron los más altos
valores (100%) de PN con diferencias significativas (p<
0.05) respecto al resto de los tratamientos, con excepción
de TH100 a concentraciones de 0 y 200 ppm de AG3 aunado
a TL50+TH50 a 200 ppm de AG3 (Cuadro 3). Se infiere
que la tierra lama por provenir de una laguna pudo estar
contaminada por sustancias tóxicas, de origen industrial o
agrícola que los ríos llevan en su caudal (Bastida, 1999), lo
que podría explicar el bajo porcentaje de PN.
Aplicaciones con concentraciones de 100 ppm de AG3
respecto a concentraciones de 0 ppm, sólo generaron efectos
positivos en el porcentaje de PN en la TL100, donde el
valor aumentó 140% (Cuadro 3). En la TL100 el efecto
positivo del AG3 a 100 ppm posiblemente se debió al efecto
de interacción sustrato∗AG3, para la cual las condiciones
brindadas por este sustrato, tales como una alta humedad y
temperaturas bajas, afectaron la acción del AG3.
Plántulas anormales
En los siguientes tratamientos TL100 y TH100, ambos con
100 y 200 ppm de AG3, TL50+Tz50 con concentraciones de 0
y 200 ppm de AG3, también en los tratamientos Tz50+TH50 y
Tz100 con concentraciones de 200 ppm de AG3 y por ultimo
en TL50+TH50 con concentraciones de 0 ppm de AG3, se
obtuvieron los valores más bajos de plantas anormales (PA)
siendo 0% y fueron diferentes a los tratamientos Tz50 y TL50
y al tratamiento TH100 a concentraciones de 100 ppm de
AG3 cada uno (Cuadro 3).
El más alto porcentaje de PA en los sustratos Tz50+TH50,
Tz100 y TL100 posiblemente se debió que en los dos
últimos tratamientos de sustratos, pudieron existir altos
contenidos de sales o iones tóxicos (Bowman y Paul, 1983;
Cabrera, 1995) o bien a sus propiedades físicas, las cuales
no brindaron las condiciones óptimas para la germinación.
Aplicaciones de AG3 a 100 ppm respecto a la concentración
de 0 ppm, generaron efectos significativos (p< 0.05) en la
mezcla de sustrato TL50+TH50, donde el porcentaje de
PA aumentó en 14% (Cuadro 3). Aplicaciones a dosis de
200 ppm de AG3 respecto a concentraciones de 100 ppm
generaron decrementos en el porcentaje de PA en el Tz100;
sin embargo, no hubo efectos respecto a 0 ppm de AG3.
El uso de giberelinas en altas concentraciones, en muchas
ocasiones, puede inducir la aparición de una serie grande
de anormalidades en las plántulas debido a efectos tóxicos.
501
by 140% (Table 3). In the TL100, the positive effect of
GA3 at 100 ppm was probably due to the effect of GA3 ∗
substrate interaction, for which the conditions provided by
this substrate, such as high humidity and low temperatures
affected the action of GA3.
Abnormal seedlings
In the next treatments TL100 and TH100, both with 100
and 200 ppm of GA3, TL50+Tz50 with concentrations of 0
and 200 ppm of GA3, also in the treatment Tz50+TH50 and
Tz100 with concentrations of 200 ppm of GA3 and finally
in LT50+TH50 with concentrations of 0 ppm of GA3, the
lowest values of abnormal plant (PA) were obtained, at
0% and the treatments differed from Tz50 and TL50 and
the TH100 treatment at concentrations of 100 ppm of GA3
each (Table 3).
The highest percentage of PA in the substrates Tz50+TH50,
Tz100 and TL100 was probably due that in the last two
treatments, could’ve been high concentrations of salts and
toxic ions (Bowman and Paul, 1983; Cabrera, 1995) or due to
their physical properties, which did not provide the optimal
conditions for germination. Applications of GA3 at 100 ppm
relative to the concentration of 0 ppm, generated significant
effects (p≤ 0.05) in the substrate mixture TL50+TH50, where
the percentage of PA rose 14% (Table 3). Applications at a
dosage of 200 ppm of GA3 with respect to the concentrations
of 100 ppm generated decreases in the percentage of PA in
the Tz100; however, there were no effects at 0 ppm GA3.
The use of gibberellins in high concentrations in many cases
can induce the appearance of a large number of abnormal
seedlings due to the toxic effects. Even though, GA3 at
concentrations of 200 ppm did not show a high percentage
of PA, it’s also true that at this concentration was found the
least number of plants emerged in the substrates.
Ungerminated seeds
In the TL50+TH50 treatments with 0 ppm of GA3 and
TH100 with 100 ppm of GA 3 the lowest percentages
of ungerminated seeds (SSG) were obtained and were
different to the rest of the treatments, except for TL50+TH50
at 100 and 200 ppm of GA3 and TH50 at 0 and 200 ppm
of GA3 (Table 3). GA3 had negative effects on the seeds
germination, possibly due to the applied concentrations
affected the seed’s embryo, leaving it in a state of rest,
causing not to germinate in time of the emergence test.
Si bien el AG3 a concentraciones de 200 ppm no presentó
un alto porcentaje de PA, también es cierto que en esta
concentración se encontró el menor número de plantas
emergidas en los sustratos.
Semillas sin germinar
En los tratamientos TL50+TH50 con 0 ppm de AG3 y
TH100 con 100 ppm de AG3, se obtuvieron los más bajos
porcentajes de semillas sin germinar (SSG) y fueron
diferentes con el resto de los tratamientos, con excepción
de TL50+TH50 a 100 y 200 ppm de AG3 y TH50 a 0 y
200 ppm de AG 3 (Cuadro 3). El AG 3 tuvo efectos
negativos sobre la germinación de semillas, debido
posiblemente que las concentraciones aplicadas afectaron
el embrión de la semilla, dejándolo en un estado de reposo
provocando que no germinaran en el tiempo de la prueba
de emergencia.
Índice de velocidad de emergencia
Los tratamientos con los que se obtuvo el mayor valor
de índice de velocidad de emergencia (IVE), fueron
TH100 con concentraciones de 0 y 100 ppm de AG3,
TL50+TH50 con sus respectivas concentraciones de
AG3, Tz100 y TL100 con concentraciones de 100 ppm
de AG3; pero únicamente con el tratamiento TH100 con
concentraciones de 0 ppm de AG3, se obtuvo el mayor valor
de IVE y fue diferente con todos los demás tratamientos,
excepto con los que se comparó anteriormente. El AG 3 no
tuvo efectos significativos (p≤ 0.05). Uno de los factores
que afectan la aplicación del AG3 es la concentración del
mismo, con un tiempo prolongado de exposición o bien
altas concentraciones en la solución provocan efectos
inhibitorios (Alizaga et al., 1992), lo cual podría explicar
el escaso efecto del AG3.
Número de hojas
Fueron varios los tratamientos con los cuales se obtuvo
el mayor número de hojas (NH), siendo principalmente
el tratamiento TH100 con 0 ppm de AG 3 con el cual
se obtuvo el valor más alto de NH, este fue diferente
estadísticamente (p≤ 0.05) a los tratamientos TL50+Tz50
y Tz100, con concentraciones de 0 y 100 ppm de AG3 con
TL100 y Tz50+TH50 con concentraciones de 200 ppm
de AG3 (Cuadro 4). El AG3 no tuvo efectos significativos
(p≤ 0.05).
Emergence speed index
The treatments which had the highest value of emergence
speed index (EVI) were TH100 with concentrations
of 0 and 100 ppm of GA 3 , TL50+TH50 with their
respective concentrations of GA3, Tz100 and TL100 with
concentrations of 100 ppm GA3, but only with the TH100
treatment with concentrations of 0 ppm of GA3, the highest
value of IVE were obtained and was different to all the other
treatments, except with those compared before. GA3 had no
significant effect (p≤ 0.05). One of the factors that affected
the application of GA3 is the concentration, with prolonged
exposure or high concentrations in the solution causing
inhibitory effects (Alizaga et al., 1992), which could explain
the small effect of GA3.
Number of leaves
There were various treatments which had the highest number
of leaves (NL), mainly the treatment TH100 with 0 ppm
of GA3 which was obtained with the highest value of NH,
this was statistically different (p≤ 0.05), the treatments
TL50+Tz50 and Tz100 with concentrations of 0 and 100 ppm
of GA3 with TL100 and Tz50+TH50 with concentrations
of 200 ppm of GA3 (Table 4). GA3 had no significant effect
(p≤ 0.05).
The positive effect of TH100 in this variable was due to
the adequate soil’s physical structure and its high nutrient
content. The use of the TH100 as a suitable substrate in the
expression of NH, agrees with that reported by Martínez
(2008), who evaluated substrates in the development of
Hippeastrum sp., and found that, with TH100 there was a
higher NH.
Leaf’s width
For this variable in the treatment TH100 with 0 and 100
ppm concentrations of GA3, the highest value of AH was
obtained and was statistically different (p≤ 0.05) with all
the other treatments except for the treatments TH50 + TL50,
TL100 with 0 and 100 ppm of GA3, Tz50+TH50 and Tz100
at concentrations of 100 ppm and TH at 200 ppm (Table 4).
GA3 had no significant effect.
The good effect of the TH100 and the mixture TL50+TH50
in this variable, was due that these had physicochemical
characteristics such as porosity, organic matter and
503
Cuadro 4. Efectos de los sustratos y del AG3 sobre el vigor de semillas de alcatraz amarillo, mediante la prueba no paramétrica
de Kruskal-Wallis.
Table 4. Effects of substrates and GA3 on the yellow calla lily’s seeds vigor by the Kruskal-Wallis nonparametric test.
Sustrato (%)
AG3 (ppm) NH
AH (cm)
LH (cm)
LR (cm)
NR
PFP (g)
TL100
TL100
TL100
Tz100
Tz100
Tz100
TH100
TH100
TH100
TL50+Tz50
0
100
200
0
100
200
0
100
200
0
2
2
1.94
1.88
1.33
2
2.87
2.28
2.02
1.88
a-ez
a-e
b-e
c-e
de
a-d
a
a-d
a-e
c-e
2.11
2.51
2.03
1.81
1.55
1.26
2.5
2.36
2.08
1.9
a-e
a-c
b-e
de
a-e
e
a
a
a-e
c-e
11.63
11.96
10.2
7.02
5.43
5.23
13.97
12.15
9.63
7.41
a-e
a-d
a-f
gh
f-h
gh
a
ab
b-g
e-h
8.22
7.44
8.08
2.7
2.16
2.56
9.25
5.33
6.22
5.79
a-d
a-d
ab
f
f
f
a
c-f
a-e
b-e
5.66
8.61
6.11
6.44
4
5
8.68
6.14
5.91
5.51
a-d
a-d
cd
a-d
cd
ad
a
b-d
b-d
cd
0.86
1.29
0.76
0.73
0.56
0.59
2
1.11
1.13
0.98
b-e
a-d
c-e
c-e
c-e
c-e
a
a-c
a-c
b-d
TL50+Tz50
100
1.27
e
1.97
b-e
8.12
d-h
4.13
ef
5.33
cd
0.6
de
TL50+Tz50
TL50+TH50
TL50+TH50
TL50+TH50
200
0
100
200
2
2.71
2.42
2.76
a-e
a-c
a-d
ab
1.84
2.35
2.24
1.85
c-e
ab
a-d
de
8.39
11.14
11.04
8.74
c-h
a-c
a-c
c-h
4.12
6.33
7.16
7.28
ef
a-e
a-d
a-c
5.66
7.71
7.75
5.96
cd
cd
a-c
b-d
0.78
1.37
1.34
1.14
c-e
ab
ab
a-c
Tz50+TH50
Tz50+TH50
Tz+TH
DMS
0
100
200
2.2
2.33
1.33
23.19
a-d
a-e
de
1.99
2.14
1.18
22.37
b-e
a-e
e
9.68
9.06
4.26
19.82
b-g
b-h
h
4.83
3.91
4.5
18.34
d-f
ef
c-f
8.66
6.33
4
24.05
ab
a-d
d
1.078
0.96
0.36
21.06
b-d
b-d
e
TL= tierra lama; Tz= tezontle; TH= tierra de hoja; NH= número de hojas; AH= ancho de hoja; LR= longitud de raíz; NR= número de raíces; PFP= peso fresco de plántula;
IVE= índice de emergencia; Z= medias con la misma letra dentro de cada columna indican diferencias no significativas con p≤ 0.05; -= guión entre dos letras incluye a las
letras intermedias, por ejemplo a-c= abc; DMS= diferencia mínima significativa con una prueba de ‘t’ de student.
El efecto positivo de la TH100 en esta variable se debió a
la adecuada estructura física del suelo y a su alto contenido
nutrimental. El uso de la TH100 como un sustrato adecuado
en la expresión de NH, coincide con lo reportado por
Martínez (2008), quien al evaluar sustratos en el desarrollo
de Hippeastrum sp. encontró que con TH100 se produjo
el mayor NH.
Ancho de hoja
Para esta variable en el tratamiento TH100 con
concentraciones 0 y 100 ppm de AG3, se obtuvo el mayor
valor de AH y fue diferente estadísticamente (p≤ 0.05) con
todos los demás tratamientos, excepto con los tratamientos
TL50+TH50, TL100 con 0 y 100 ppm de AG3, Tz50+TH50
y Tz100 con concentraciones de 100 ppm y TH a 200 ppm
(Cuadro 4). El AG3 no tuvo efectos significativos.
nutrients (Table 1), which favored the seeds to germinate
faster, which allowed them to have more time to develop
and thus express a more favorable response, contrary to
what happened in the rest of the substrates, which have
a lower speed to emergence response, showed a less
favorable feature.
Leaf’s length
The treatments with the highest leaf´s length value
(LH) were TH100 and TL50 + TH50 at concentrations
of 0 and 100 ppm each and TL100 with the respective
concentrations of GA3, but only the TH100 treatment with
concentrations of 0 ppm GA3 obtained the highest value of
LH and was statistically different (p≤ 0.05) with the other
treatments, except for TH100 with 100 ppm, TL50+TH50
at concentrations of 100 and 200 ppm of GA3 and TL100
El buen efecto de la TH100 y de la mezcla TL50+TH50 en
esta variable, se debió que estos presentaron características
físico-químicas, tales como porosidad, contenido de materia
orgánica y nutrimental (Cuadro 1), que favorecieron a las
semillas germinar más rápidamente, que permitió que
tuvieran mayor tiempo para desarrollarse y por lo tanto,
expresar una respuesta más favorable, contrariamente a lo
que sucedió en el resto de los sustratos, los cuales al tener
una baja velocidad de emergencia mostraron una respuesta
menos favorable.
with their respective concentrations of GA3 (Table 3). Since
TH100 has good organic matter content, together with the
physicochemical characteristics favored the expression of
leaf size. The Tz100 presented the lowest values of LH, due
to low nutrient content and low moisture holding capacity,
since according to Bastida (1999) the volcanic rock has a
high porosity within its particles, so that moisture retention
is low, adding that, it depends on the particle size.
Longitud de hoja
With the TH100 treatment with concentrations of 0 ppm of
GA3 the highest value of root length (RL) was obtained and
was statistically different (p≤ 0.05) with respect to the other
treatments, except for TL50+TH50 and the TL100 treatment
with the respective concentrations of GA3 each, and TH100
with 200 ppm of GA3 (Table 4) GA3 had no significant effect
statistically (p≤ 0.05).
Los tratamientos con mayor valor de longitud de hoja
(LH), fueron TH100 y TL50+TH50 a concentraciones de
0 y 100 ppm de AG3 cada uno y TL100 con sus respectivas
concentraciones de AG3, pero sólo el tratamiento TH100
con concentraciones de 0 ppm de AG3, se obtuvo el mayor
valor de LH y fue diferente estadísticamente (p≤ 0.05) con
el resto de los tratamientos, excepto con TH100 con 100
ppm, TL50+TH50 a concentraciones de 100 y 200 ppm
de AG3 y TL100 con sus respectivas concentraciones de
AG3 (Cuadro 3). La TH100 al tener un buen contenido
de materia orgánica, aunado a sus características físicoquímicas favoreció la expresión del tamaño de hoja. El
Tz100 presentó los menores valores de LH, debido al bajo
contenido nutrimental y la baja capacidad de retención de
humedad, ya que de acuerdo a Bastida (1999) el tezontle
presenta una porosidad grande dentro de sus partículas, por
lo que se supone la retención de humedad baja, agregando
que ésta depende del tamaño de partícula.
Longitud de raíz
Con el tratamiento TH100 con concentraciones de 0 ppm
de AG3, se obtuvo el mayor valor de longitud de raíz
(LR) y fue diferente estadísticamente (p< 0.05) con todos
los demás tratamientos, excepto con TL50+TH50 y el
tratamiento TL100 con sus respectivas concentraciones
de AG3 cada uno, y TH100 con 200 ppm de AG3 (Cuadro
4); el AG3 no tuvo efectos significativos estadísticamente
(p< 0.05).
La TH100 y la TL100 al ser sustratos orgánicos y muy
porosos (Cuadro 2), favorecieron la exploración del
sistema radicular, generando los mayores valores de LR.
El tratamiento Tz100 presentó los valores más bajos de LR,
debido a la mayor resistencia mecánica impuesta por sus
partículas, lo que dificultó el desarrollo de las raíces.
Root length
The TH100 and TL100 been both very porous organic
substrates (Table 2), favored the exploration of the root
system, generating the highest values of LR. The Tz100
treatment showed the lowest values of RA because of the
greater mechanical resistance imposed by the particles,
hampering the development of the roots.
Number of roots
The treatments with the highest values of number of roots
(NR) were TL100, Tz50+TH50, with concentrations of 0
and 100 ppm of GA3, Tz100 with 0 and 200 ppm of GA3,
TH100 with 0 ppm of GA3 and TL50+TH50 with 100 ppm
GA3, but only in the treatment TH100 with concentrations of
0 ppm of GA3, the highest value of LR was obtained and was
statistically different (p≤ 0.05) with all the other treatments,
except for those previously compared with (Table 4). GA3
had no significant effect.
Since the TH100 substrate has high organic matter and
proper humidity levels, favored the expression of this
variable, unlike the other substrates, such as the Tz100, that
presented a low nutrient content and low moisture holding
capacity, showing unfavorable results.
Seedling fresh weight
The treatments with the highest value of seedling fresh
weight (PFP) were TH100 and TL50+TH50 with their
respective concentrations of GA3 and TL100 with 100 ppm
Número de raíces
Los tratamientos con mayor valor de número de raíces (NR)
fueron TL100, Tz50+TH50, con concentraciones de 0 y 100
ppm de AG3, Tz100 con 0 y 200 ppm de AG3, TH100 con 0
ppm de AG3 y TL50+TH50 con 100 ppm de AG3, pero sólo
en el tratamiento TH100 con concentraciones de 0 ppm
de AG3, se obtuvo el mayor valor de LR y fue diferente
estadísticamente (p≤ 0.05) con todos los demás tratamientos,
excepto con los comparados anteriormente (Cuadro 4). El
AG3 no tuvo efectos significativos.
El sustrato TH100 al tener altos contenidos de materia
orgánica y niveles de humedad adecuados favorecieron
la expresión de esta variable, contrariamente a los otros
sustratos, tales como el Tz100, que al tener un bajo contenido
nutrimental y una baja capacidad de retención de humedad,
mostró resultados poco favorables.
Peso fresco de plántula
Los tratamientos con los que se obtuvo el mayor valor de
peso fresco de plántula (PFP), fueron TH100 y TL50+TH50
con sus respectivas concentraciones de AG3 y TL100 con
100 ppm de AG3, pero sólo en el tratamiento TH100 con 0
ppm de AG3, se obtuvo el mayor valor de PFP con 2 g y fue
estadísticamente diferente (p≤ 0.05) con todos los demás
tratamientos, excepto con los comparados anteriormente
(Cuadro 4). El AG3 no tuvo efectos signif icativos
estadísticamente (p< 0.05).
El mejor desarrollo de las plántulas, se debió al contenido
nutrimental aportado por la materia orgánica a los sustratos
TH100 y TL50+TH50 (Gil, 1995) y a la velocidad de
emergencia de las plántulas, ya que ello permitió que
hubieran un mejor desarrollo y mayor acumulación de
biomasa. Este resultado coincide con Martínez (2008),
quien al evaluar sustratos en la producción de Hippeastrum
sp. encontró que la TH100 produjo el mayor valor de PFP.
DISCUSIÓN
El sustrato tierra de hoja (TH100) con concentraciones de
ácido giberélico (AG3) a 0 ppm, fue el más adecuado para
la propagación de semillas de alcatraz amarillo, ya que la
mayoría de las variables evaluadas mostraron los mejores
valores cuando se utilizó éste como sustrato. Según Bastida
505
of GA3, but only in the treatment TH100 with 0 ppm of GA3,
the highest value of PFP with 2 g was obtained and was
statistically different (p≤ 0.05) with respect to all the other
treatments, except those previously compared with (Table
4). GA3 had no significant effect statistically (p≤ 0.05).
The best seedling growth was due to the nutrient content
contributed of the organic matter to the substrates
TH100 and TL50+TH50 (Gil, 1995) and the speed of
seedling emergence, as this would have allowed a better
development and higher biomass accumulation. This result
agrees with Martínez (2008), who evaluated substrates
in the production of Hippeastrum sp. found that TH100
produced the highest value of PFP.
DISCUSSION
The leaf mold substrate (TH100) with concentrations of
gibberellic acid (GA3) at 0 ppm was the best suitable for
the propagation of yellow calla lily’s seeds, since most
of the variables evaluated showed the best values when
it was used as substrate. According to Bastida (1999), the
oak’s leaf (used in this study) contains particles of all sizes
in various stages of decomposition, it has good drainage,
good aeration and proper moisture retention, pH is low, it’s
a substrate contributor for nutrients with good buffering
capacity, qualities that provided the best conditions for the
seed germination and development.
When TH was mixed with the TL also showed favorable
results, since this substrate was statistically similar (p≤
0.05) for most of the variables. This effect was due that,
TH help TL to improve their physical and chemical
characteristics just mentioned and to reduce undesirable
effects such as high amount of toxic substances to prevent
a gap.
The application of gibberellic acid (GA3) had poor response
in the evaluated variables, in the cases with significant
effects; these were mostly negative since they did decrease
the value of the variables. It’s possible that, the dose of
gibberellic acid had been high, as it often happens, despite
the known initial amount of the hormone to be applied in the
treatment, the effect of this is added to endogenous hormones
of the seed, which are found in varying concentrations in
different individuals, so that the response is not quite uniform
(Rojas and Ramírez, 1993).
(1999) la hoja de encino (usada en esta investigación)
contiene partículas de todos los tamaños en diferentes etapas
de descomposición, presenta buen drenaje, buena aireación
y retención de humedad apropiada, su pH es bajo, es un
sustrato aportador de nutrimentos, con una buena capacidad
amortiguadora, cualidades que brindaron a las semillas
mejores condiciones para su germinación y desarrollo.
CONCLUSIONS
Cuando la TH se mezcló con la TL mostró también resultados
favorables, ya que este sustrato fue estadísticamente
similar (p≤ 0.05) en la mayoría de las variables evaluadas.
Este efecto se debió que la TH le ayudo a la TL a mejorar
sus características físicas y químicas ya mencionadas
y a reducir sus efectos indeseables, tales como elevada
cantidad de sustancias tóxicas presentes en ella por prevenir
de una laguna.
The organic matter-leaf mold combination (TL50 + TH50)
with or without GA3 applications, is another acceptable
option that can be used in the propagation of yellow calla
lily’s seeds.
La aplicación de ácido giberélico (AG 3) tuvo escasa
respuesta en las variables evaluadas, en los casos en los que
tuvo efectos significativos, fueron en su mayoría negativos
al disminuir el valor de las variables evaluadas. Es posible
que las dosis de ácido giberélico hayan sido altas, como
ocurre muchas veces, donde a pesar de conocer la cantidad
inicial de la hormona a aplicar en el tratamiento, el efecto
de ésta se añade al de las hormonas endógenas de la semilla,
las cuales se encuentran en concentraciones variables en
los diversos individuos, de tal modo que la respuesta no es
uniforme (Rojas y Ramírez, 1993).
CONCLUSIONES
El sustrato tierra de hoja (TH) con y sin AG3, fue el sustrato
más favorable para la propagación por semilla de alcatraz
amarillo (Zantedeschia elliottiana Engl.), al generar los
mayores valores en la mayoría de las variables evaluadas.
La combinación tierra lama con tierra de hoja (TL50 +
TH50) con o sin aplicaciones de AG 3, es otra opción
aceptable que se puede utilizar en la propagación de alcatraz
amarillo por semilla.
El porcentaje y la velocidad de emergencia no fueron
regulados por las giberelinas en las concentraciones usadas.
Las aplicaciones de AG3 en concentraciones de 100 y 200 ppm
en combinación con los sustratos, en ningún caso superaron
los valores que se obtuvieron cuando no se aplicó AG3.
The leaf mold substrate (TH) with and without GA3 was
the most favorable substrate for the propagation by seed
of the yellow calla lily (Zantedeschia elliottiana Engl.),
Generating the highest values in most of the variables.
The percentage and the emergence speed were not covered
by the gibberellins in the used concentrations.
GA3 applications in concentrations of 100 and 200 ppm
blended with the substrates, in no case exceeded the values
obtained when GA3 was not even applied.
LITERATURA CITADA
Alizaga, R.; Guevara, E. y Herrera, J. 1992. Efecto de
algunos tratamientos químicos sobre el periodo
de reposo de maní (Arachis hypogea). Agronomía
Costarricense. 16(1):29-39.
Ansorena, M. J. 1994. Sustratos. Propiedades y
caracterización. Ediciones Mundi-Prensa. España.
172 p.
Bastida, T. A. 1999. El medio de cultivo de las plantas.
Sustratos para hidroponía y producción de planta
ornamental. Serie de Publicaciones Agribot No.
4. Universidad Autónoma Chapingo, Chapingo,
Estado de México. 27 p.
Bowman, D. C. and Paul, J. L. 1983. Understanding of
container media vital knowledge for growing
successful plants. Pacific Coast Nurseryman and
Garden Supply Dealer. 48-50 pp.
Bunt, A. C. 1988. Media and mixes for container-grown
plants. Second edition. Publisher by the Academic
of Unwin Hyman Ltd. London. 309 p.
Cabrera, R. I. 1995. Fundamentals of container media
management. Part 1, Physical properties. Rutgers
Cooperative Extension Factsheet. Num. 950. 4 p.
Cabrera, R. I. 1999. Propiedades, uso y manejo de
sustratos de cultivo para la producción de plantas
en maceta. Revista Chapingo. Serie Horticultura.
5(1):5-11.
Conover, W. J. 1980. Practical Nonparametric Statistics.
John Wiley & Sons. 2 nd editiond. Texas Tech
University. 493 p.
Corr, B. E. and Widmer, R. E. 1991. Paclobutrazol, giberellic
acid, and rhizome size affect growth and flowering
of zantedeschia. University of Minnesota, St. Paul.
HortScience. 26(2):133-135.
Gil, M. F. 1995. Elementos de fisiología vegetal. Ediciones.
Mundi-Prensa S. A. de C. V. D. F., México. 225260 pp.
Handreck, K. and Black, N. 2002. Growing media for
ornamental plants and turf. 3th edition. UNSW Press.
Australia. 542 p.
507
Martínez, J. A. J. 2008. Evaluación de sustratos en la germinación
y desarrollo de plántulas de amarillis (Hippeastrum
sp.). Tesis de Licenciatura. Departamento de
Fitotécnia. Universidad Autónoma Chapingo.
Chapingo, Texcoco, Estado de México. 47 p.
Purohitt, S. S. 1985. Hormonal regulation of plant growth
and development (advances in agricultural
biotechnology) Martinus Nilhoff. Netherlands.
95-144 pp.
Rojas, G. M. y Ramírez, H. 1993. Control hormonal del
desarrollo de las plantas. Fisiología-TecnologíaExperimentación. 2da edición. Editorial Limusa.
México. 236 p.
Rojas, G. M. 1995. Manual de herbicidas y fitorregula dores.
3ra edición. Noriega Editores. D. F., México. 157 p.
Weaber, R. J. 1980. Reguladores del crecimiento de plantas
en la agricultura. Editorial Trillas. México. 622 p.
ADAPTACIÓN DE Laelia autumnalis Lindl. A UN BOSQUE DE PINO-ENCINO*
Laelia autumnalis Lindl. ADAPTATION INTO A PINE-OAK FOREST
Lia Stefany Luyando-Moreno1§, Martha Elena Pedraza-Santos1, José López-Medina1, José Luciano Morales-García1, Guillermo
Martín Carrillo-Castañeda2 y Roberto Lindig-Cisneros3
Facultad de Agrobiología “Presidente Juárez” UMSNH. Paseo Lázaro Cárdenas esquina con Berlín, Uruapan, Michoacán, México. C. P. 60080. Tel. 01 452 1312425,
1126710, 5251073 y 5252079. ([email protected]), ([email protected]), ([email protected]). 2Programa de Genética. Campus Montecillo.
Colegio de Posgraduados. Carretera Los Reyes-Texcoco, km 36.5. Montecillo, Texcoco, Estado México. C. P. 56230. ([email protected]). 3Centro de investigaciones en
Ecosistemas. Antigua Carretera a Pátzcuaro. Colonia Exhacienda de San José de la Huerta. Morelia, Michoacán, México. C. P. 58190. ([email protected]. §Autora
para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
El estudio de metodologías para la propagación y manejo de
poblaciones de Laelia autumnalis, son estrategias básicas
para lograr la conservación de esta especie que se encuentra
amenazada, debido a la perturbación de los hábitats y la
extracción masiva de individuos reproductivos. El objetivo
de este estudio fue establecer metodologías para propagar
a la orquídea L. autumnalis en forofitos de un bosque
de pino-encino con diferentes sustratos. Plantas adultas
fueron rescatadas de zonas de riesgo para la orquídea y se
elaboraron propuestas de manejo, para la conservación de
estos ejemplares y se establecieron experimentos en un
bosque en medios artificiales y naturales. Se encontró que el
desarrollo de nuevos pseudobulbos y raíces, es influenciado
por el medio en el que se desarrolla, así también que la especie
Arbutus xalapensis es buen medio de sostén para la orquídea
epífita L. autumnalis. Los sustratos formulados a base de
aserrín, composta, viruta y musgo, ejercen una influencia
positiva en el crecimiento de pseudobulbos.
The study of methodologies for the spread and population
management of Laelia autumnalis are basic strategies
in order to achieve the conservation of this threatened
species due to habitat disturbance and massive extraction
of reproductive individuals. The aim of this paper was
to establish methods to propagate the orchid L. autumnalis
in phorophytes of a pine-oak forest with different
substrates. Adult plants were rescued from areas at
risk for the orchid and management proposals for the
conservation of these animals were developed, also
experiments were settled in artificial and natural forest.
It was found that, the development of new pseudobulbs
and roots is influenced by the environment in which it
develops, so that the species Arbutus xalapensis is a good
mean of support for the epiphytic orchid L. autumnalis.
The substrates prepared with sawdust, compost, wood
chips and moss, exerted a positive influence on the
pseudobulbs’ growth.
Palabras clave: Arbutus xalapensis, conservación, epífitas,
Orchidaceae, sustratos.
Key words: Arbutus xalapensis, conservation, epiphytic,
Orchidaceae, substrates.
* Recibido: julio de 2011
Lia Stefany Luyando-Moreno et al.
INTRODUCCIÓN
INTRODUCTION
En la región de la Meseta Purépecha en el estado de
Michoacán, los encinares han sido tradicionalmente
explotados por las comunidades para la obtención de leña
y carbón; en la actualidad, además son utilizados para la
extracción de celulosa para la fabricación de papel. Esto
hace que los pobladores de las comunidades aledañas a los
bosques de encino talen los árboles, e impacte negativamente
en la ecología de los bosques de la región. Otro aspecto
importante que participa en la destrucción de bosques de
encino, es la tendencia local a establecer huertas de aguacate.
In the Meseta Purépecha region in the State of Michoacán,
the oaks have been traditionally exploited by communities
for fuelwood and charcoal, currently they are also used for
the extraction of cellulose for paper making. This makes the
residents of the surrounding communities of the oak forests
to cut down the trees, negatively affecting the ecology of
the forests in this region. Another important part in the
destruction of oak forests is the local trend to establish
orchards of avocado.
En estos árboles existe gran diversidad de orquídeas
epífitas endémicas, que son plantas muy apreciadas por los
habitantes locales; por ejemplo; en la comunidad indígena
de Nuevo San Juan Parangaricutiro, en donde se llevó a
cabo un estudio florístico detallado (Medina et al., 2000), se
identificaron 20 especies de esta familia, entre ellas Laelia
autumnalis. Esta especie es de gran significancia cultural
en esta parte de México, conocida como flor de muerto, ya
que tiene un uso tradicional en las festividades del día de los
difuntos, porque su floración coincide con esta celebración;
además de adornar altares religiosos es utilizada de diversas
formas desde la época precolombina como materia prima,
para la elaboración de productos adhesivos, curativos,
aglutinantes y ha sido importante en la actividad culinaria,
como condimento e incorporada en la actualidad en diversas
ceremonias religiosas (Salazar-Rojas et al., 2007).
Las orquídeas representan un elemento importante en
la diversificación del aprovechamiento de las especies
ornamentales de México (Ceja et al., 2008); sin embargo,
la alteración y destrucción de hábitats (Rivera-Cotto y
Corrales-Moreira, 2007), así como la extracción ilegal
de epífitas silvestres para su comercio, pone en riesgo a
algunas en la categoría de peligro de extinción (FloresEscobar et al., 2008).
La reintegración de orquídeas a bosques de pino-encino,
principalmente aquellas que se ven amenazadas, incrementa
su potencial de supervivencia (Swarts, 2007); sobre todo
si se basa en programas que estimule la conservación de
áreas boscosas (Lauri, 2007) y proporcionen un recurso
económico para los pobladores regionales, lo que implica
la conservación al mismo tiempo de varias especies, las
forestales y las plantas epífitas (Mateos, 2006).
In these trees, there is a great diversity of endemic epiphytic
orchids, plants highly prized by the locals; for example, in the
indigenous community of Nuevo San Juan Parangaricutiro,
a detailed floristic study was conducted (Medina et al.,
2000), identifying 20 species of this family, including Laelia
autumnalis. In this part of Mexico, this species is of great
cultural significance, known as the flower of death, as it
has a traditional use in the festivities of the day of the dead,
because its flowering coincides with the celebration; besides
adorning religious shrines, it´s been used in many forms
since pre-Columbian times as raw material for adhesives,
healing and, binders production, it has also been important
in cooking as a condiment, incorporating it into various
religious ceremonies, even now (Salazar-Rojas et al., 2007).
Orchids are an important element in diversification of the
use of ornamental species of Mexico (Brow et al., 2008);
however, alteration and destruction of habitats (Rivera-Cotto
and Corrales-Moreira, 2007) and also the illegal extraction
of wild epiphytes for trading, is threatening some of these
species (Flores-Escobar et al., 2008).
The reintegration of orchids into pine-oak forests, especially
those that are threatened, increase their survival potential
(Swarts, 2007); especially if it is based on programs that
encourage the conservation of wood areas (Lauri, 2007)
and provide an economic resource for regional residents,
which implies the conservation of several species, forest
and epiphytic plants (Mateos, 2006).
There are working examples of reintroduction of orchids
and morphophysiological adaptations study, where the
functional ecosystem is rehabilitated (Rangel-Villafranco
and Ortega-Larrocea, 2007), as the natural microflora
and then, reintroducing the orchids (Smith et al. 2007,
Adaptación de Laelia autumnalis Lindl. a un bosque de pino-encino
Existen ejemplos funcionales de reintroducción de orquídeas
y de estudio de sus adaptaciones morfofisiológicas, en
donde se rehabilita el ecosistema funcional (RangelVillafranco y Ortega-Larrocea, 2007), como la microflora
natural y luego se reintroducen las orquídeas (Smith et
al., 2007; Wake, 2007). También es posible utilizar áreas
verdes desaprovechadas y deterioradas para su uso en la
conservación in situ (Garduño et al., 2007). Sin embargo,
para realizar una restauración dirigida en lugares como la
“Meseta Purépecha” se requieren técnicas y estrategias
apropiadas (Lindig et al., 2007).
En la actualidad se conoce poco sobre las especies de
árboles que proporcionen las condiciones adecuadas, para
el crecimiento y desarrollo de estas epífitas, incluso algunas
especies pueden ocasionar daños al liberar sustancias
tóxicas. Es importante considerar las características del
forofito, ya que las adaptaciones morfofisiológicas de las
orquídeas dependen de la especie sobre la que viven (GarcíaGonzález y Pérez, 2011).
La propagación de orquídeas epífitas en macetas presenta
diferencias sustanciales, con respecto al cultivo de
manera tradicional, es decir en ramas cortadas o árboles
vivos. Al cultivar en contenedor las plantas son inducidas
eficientemente al crecimiento, ya que se proporcionan
las cantidades de nutrientes y agua que son demandados
(Rodríguez et al., 2010), de tal manera que con el uso de
sustratos, se pueden desarrollar métodos de manejo eficaces
para el cultivo de especies ornamentales, aunque también
pueden ser más susceptibles al ataque de patógenos, si las
condiciones no son las adecuadas en el manejo (SalazarCasasa et al., 2007).
En la selección del sustrato, se deben tomar en cuenta
aspectos sociales y económicos, tales como la ubicación
del centro de extracción natural del mismo y que su uso sea
ambientalmente correcto. Es importante que la extracción
del sustrato se haga a una corta distancia de donde se utilizará,
así como optar por materiales reciclables o subproductos
industriales (Sánchez-Córdova et al., 2008), como cascarilla
de arroz, polvo de coco, corteza de pino o composta, en
combinación con materiales inorgánicos como piedra pómez
y tezontle (Ayala-Sierra y Valdez-Aguilar, 2008).
Tomando en consideración lo anterior, se desarrollaron
dos experimentos con el objetivo general de establecer
metodologías para propagar a la orquídea L. autumnalis en
forofitos de un bosque de pino-encino con diferentes sustratos.
511
Wake, 2007). It’s also possible to use missed and damaged
green areas for in situ conservation (Garduño et al.,
2007). However, for restoring places such as the “Meseta
Purépecha”, appropriated techniques and strategies are
necessary (Lindig et al., 2007).
Currently, little is known about the species of trees that would
provide the right conditions for growth and development
of these epiphytes, even some species may cause damage
by releasing toxic substances. It is important to consider
the characteristics of phorophyte as morphophysiological
adaptations of orchids depend on the species on which they
live on (García-González and Pérez, 2011).
The spread of epiphytic orchids in pots is substantially
different with respect to growing in a traditional way, i. e.,
cutting branches or live trees. By growing plants in containers
they are efficiently induced to growing, since they provide
the amounts of nutrients and water which are demanded
(Rodríguez et al., 2010), so that with the use of substrates
can develop methods of handling effective for growing
ornamental species, but they may be more susceptible to
pathogenic attack, if the conditions are not appropriated in
the management (Salazar-Casasa et al., 2007).
When selecting the substrate, the social and economic
aspects should be taken into consideration, such as the
location of natural extraction center and that their use is
environmentally correct. It is important that, the extraction of
the substrate is made at a short distance from where it’s used,
and to prefer recyclable materials or industrial by-products
(Sánchez-Córdova et al., 2008), such as rice husks, coconut
powder, pine bark or compost, in combination with inorganic
materials such as pumice and volcanic rock (Ayala-Sierra
and Valdez-Aguilar, 2008).
Considering the above, two experiments were developed
with the overall objective to establishing methodologies
to propagate the orchid L. autumnalis in pine-oak forest
phorophytes with different substrates.
This research was conducted from January 2009 to January
2011, in a pine-oak forest, located in the community of
Charapan, Michoacán, 19° 34’ north latitude, 102° 17’ west
longitude which is at an elevation of 2 500 m.
La presente investigación se desarrolló de enero de 2009 a
enero de 2011, en un bosque de pino-encino, ubicado en la
comunidad de Charapan, Michoacán, a 19° 34’ de latitud
norte, 102° 17’ de longitud oeste que se encuentra a una
altitud de 2 500 m.
Plantas adultas de L. autumnalis de aproximadamente dos
años de edad, en etapa vegetativa fueron colectadas en las
comunidades de Zacán y Charapan, ambas localidades con
clima templado subhúmedo con lluvias en verano (C(w2)
W(b’)ig); las plantas se encontraban en zonas de riesgo por
cambio de uso de suelo forestal a agrícola, generalmente
mostraban daños por estrés hídrico, enfermedades o
quemaduras de sol. Las plantas se dividieron en una sección
de rizoma con cuatro o más pseudobulbos de 12 cm de altura
y 2 cm de grosor aproximadamente, se lavaron con cepillo y
jabón y se les aplicó el fungicida thiabendazole (0.6 g L-1).
Influencia del tipo de sostén sobre el desarrollo de L.
autumnalis
Se establecieron nueve tratamientos, seis estuvieron
conformados por la colocación de orquídeas con cuatro
pseudobulbos, sobre seis diferentes especies de árboles
vivos: Quercus crassipes, Q. crassifolia, Crataegus
mexicana, Arbutus xalapensis, Prunus capuli y Q. rugosa;
en el séptimo tratamiento orquídeas con cuatro pseudobulbos
se colocaron sobre trozos de Quercus sp., para los dos
tratamientos restantes se utilizaron orquídeas con más de
cuatro pseudobulbos montados sobre Quercus rugosa,
uno con la aplicación de pesticidas y otro sin aplicaciones.
Cada tratamiento constó de seis repeticiones, distribuidas
conforme a un diseño experimental totalmente al azar, la
unidad experimental fue una planta (Cuadro 1).
Adult plants of L. autumnalis about two years old, in a
vegetative stage were collected from Charapan and Zacán
communities, both areas with mild subhumid climate
with summer rains (C(w2)W(b’)ig); the plants were in
areas of risk due to the change of use of the forest-land
into agriculture-land, generally showed damage from
water stress, disease or sunburn. The plants were divided
into a section of rhizome with four or more pseudobulbs
12 cm high and approximately 2 cm thick, washing them
with soap using a toothbrush, applying the fungicide
thiabendazole (0.6 g L-1).
Influence of the type of support on the development of
L. autumnalis
Nine treatments were established, six of them were
formed by placing four-pseudobulbs of orchids, in six
different species of living trees: Quercus crassipes, Q.
crassifolia, Crataegus mexicana, Arbutus xalapensis,
Prunus capuli and Q. rugosa; in the seventh treatment
four-pseudobulbs orchids were placed in the pieces of
Quercus sp., for the two remaining treatments orchids
with more than four-pseudobulbs were used mounted on
Quercus rugosa, one with the application of pesticides
and the other one free of applications. Each treatment
consisted of six repetitions, distributed under a completely
randomized experimental design; the experimental unit
was a plant (Table 1).
The evaluated variables were: days to emergence of shoots
and roots, number of shoots per plant, shoot and root length,
days to formation of new pseudobulbs and pseudobulb
length and diameter. Using that data, an analysis of variance
and means of comparison test were done (Tukey, p≤ 0.05)
with SAS (Statistical Analysis System) version 6.03 (SAS,
1997). Also, the moisture content and dry matter of the bark’s
phorophytes were evaluated.
Cuadro 1. Medios de sostén utilizados para el desarrollo de plantas adultas de Laelia autumnalis.
Table 1. Means of support used for the development of adult plants of Laelia autumnalis.
Tratamiento
Especie o tipo de sostén
Tratamiento
1
2
3
4
5
6
Quercus crassipes
Quercus crassifolia
Crataegus mexicana
Arbutus xalapensis
Prunus capulí
Trozos de Quercus sp.
7
8
9
Especie o tipo de sostén
Quercus rugosa (sin pesticidas)
Quercus rugosa (4 pseudobulbos)
Quercus rugosa (más de cuatro
pseudobulbos)
513
Las variables evaluadas fueron: días a emergencia de brotes
y raíces, número de brotes por planta, longitud de brotes y
raíces, días a formación de nuevos pseudobulbos y longitud
y diámetro de pseudobulbo. Con los datos obtenidos se
hizo un análisis de varianza y prueba de comparación de
medias (Tukey, p≤ 0.05) con el paquete estadístico SAS
(Statistical Analysis System) versión 6.03 (SAS, 1997).
Además se evaluó el contenido de humedad y materia seca
de las cortezas de los forofitos.
Effect of the substrate type on the growth of L. Autumnalis
Efecto del tipo de sustrato sobre el desarrollo de L.
autumnalis
The main sources used for the formulation of the substrates
were charcoal, volcanic rock, crushed dried oak bark, peat
moss (Canadian peat moss: Sphagnum sp. moss, with
nutrients and pH adjusted at 6.2), vermiculite, pine-oak
sawdust, bark compost, oak shavings, moss, bagasse (sugar
harvest) and dried crushed oats.
Se prepararon muestras de cuatro pseudobulbos y se
colocaron en macetas de plástico de 6 pulgadas, en donde
se estudió el efecto de cinco tratamientos conformados por
diferentes sustratos (Cuadro 2); cada uno con 10 repeticiones;
los tratamientos se distribuyeron conforme a un diseño
experimental completamente al azar, la unidad experimental
fue una maceta con una planta de cuatro pseudobulbos.
Samples from four pseudobulbs were prepared and
placed in plastic pots of 6 inches, where we studied the
effect of five treatments comprised of different substrates
(Table 2); each with 10 replicates; both treatments were
distributed according to an experimental design completely
randomized, the experimental unit was a potted fourpseudobulbs plant.
For this experiment, the recorded variables were: days to
emergence of shoots, shoot number and length and diameter
of pseudobulbs. Using that data, an analysis of variance and
Cuadro 2. Proporción de los sustratos formulados para el cultivo de Laelia autumnalis en macetas.
Table 2. Formulated proportion of the substrates for the cultivation of potted Laelia autumnalis.
Sustrato
Catecopeat
Astecoca
Ascovimu
Temucoba
Tecocapa
Fuentes y número de partes
Carbón 1 + tezontle 1 + corteza de encino 2 + peat moss ½ + vermiculita ½
Aserrín de pino-encino 2 + tezontle 2 + corteza de encino 1 + carbón 1
Aserrín de pino-encino 1 + Composta 1 + Viruta 1 + Musgo 1
Tezontle 1 + musgo 1 + composta 2 + bagazo de caña 2
Tezontle 1 + composta 2 + carbón 1 + paja de avena 2
Como fuentes principales para la formulación de los
sustratos se utilizaron carbón vegetal, tezontle rojo, corteza
de encino seca triturada, peat moss (turba canadiense: musgo
Sphagnum sp., con carga de nutrientes y pH ajustado a 6.2),
vermiculita, aserrín de pino-encino, composta de corteza,
viruta de encino, musgo, bagazo de caña (zafra azucarera)
y paja de avena seca molida.
Para este experimento se registraron las variables: días
a emergencia de brotes, número de brotes y longitud y
diámetro de pseudobulbos. Con los datos obtenidos se hizo
un análisis de varianza y prueba de comparación de medias
(Tukey, p≤ 0.05) con el paquete estadístico SAS versión
6.03 (SAS, 1997). Además se realizaron las determinaciones
en los sustratos de las características físicas de porcentaje
de aireación, retención de humedad y porosidad, con las
técnicas descritas por Muratalla-Lua et al. (2006).
means comparison test were done (Tukey, p≤ 0.05) with SAS
version 6.03 (SAS, 1997). Also, the determinations were
performed on the substrates of the physical characteristics
of aeration rate, moisture retention and porosity, with the
techniques described by Muratalla-Lua et al. (2006).
Influence of the type of support on L. Autumnalis
The phorophyte type influenced the growth of L. autumnalis,
the statistical analysis showed significant differences
and highly significant differences for the variables root
emergence, shoot emergence, root length, diameter and
length of pseudobulb (Table 3).
Influencia del tipo de sostén sobre L. autumnalis
El tipo de forofito influyó sobre el desarrollo de las
plantas de L. autumnalis, el análisis estadístico mostró
diferencias significativas y altamente significativas para
las variables emergencia de raíz, emergencia de brotes,
longitud de raíz, diámetro y longitud de pseudobulbo
(Cuadro 3).
When assessing the rooting of L. autumnalis, depending on
the species support, it was observed that in A. xalapensis,
the time of growth of roots was reduced 70% compared
with the other species tested (Figure 1A). This proves the
high affinity of the orchid with the architectural features,
foliage and bark of A. xalapensis, phorophyte properties
that influence the adaptation of epiphytic plants (GarcíaGonzález and Pérez, 2011). The affinity between the
species Tillandsia recurvata and the Prosopis laevigata
phorophyte may induce anatomical changes such as
cork formation and reaction of phenolic substances such
Cuadro 3. Prueba de especies sostén y datos estadísticos básicos registrados de Laelia autumnalis.
Table 3. Supporting species test and basic statistical data registered of Laelia autumnalis.
Variables
Media
R2
CM
CM Error
CV (%)
Emergencia de raíz (d)
44.04
0.72
1281.54∗∗
92.99
21.9
Emergencia de brotes (d)
55.31
0.47
1299.73∗∗
300.58
31.34
Longitud de raíz 30 días (cm)
3.43
0.42
12.07∗
3.05
51
6
0.41
26.19∗
6.67
43.03
7.26
0.79
101.77∗∗
5
30.79
8.75
0.87
152.01
∗∗
4.13
23.21
9.54
0.9
210.99∗∗
4.12
21.29
11.89
0.94
665.88∗∗
7.16
22.51
Número brotes 60 días
1.55
0.31
0.93
0.42
41.68
Número de brotes 180 días
1.92
0.29
1.35
0.67
42.71
Diámetro del pseudobulbo
1.67
0.46
0.78∗
0.18
25.92
Longitud del pseudobulbo
11.42
0.42
23.37∗
6.58
22.47
= diferencia significativa; ∗∗= diferencias altamente significativa; R2= coeficiente de determinación; CM= cuadrados medios; CV= coeficiente de variación.
∗
Al evaluar la rizogénesis de L. autumnalis, en función de la
especie sostén, se observó que en A. xalapensis, el tiempo de
crecimiento de raíces se redujo 70% en comparación con las
otras especies estudiadas (Figura 1A). Esto demuestra la gran
afinidad de la orquídea con las características de arquitectura,
follaje y corteza de A. xalapensis, propiedades del forofito
que influyen en la adaptación de las plantas epífitas (GarcíaGonzález y Pérez, 2011). La afinidad entre las especies
Tillandsia recurvata y el forofito Prosopis laevigata, puede
inducir cambios anatómicos como formación de súber de
reacción y de sustancias fenólicas, como barrera química al
establecimiento de enfermedades y promotor de crecimiento
de las raíces de las epífitas (Aguilar-Rodríguez et al., 2007).
as chemical barrier to the establishment of disease and
promoting growth of the roots of epiphytes (AguilarRodríguez et al., 2007).
The shoots’ time of emergence was 50% higher than the
cultures of L. autumnalis set over Q. crassipes that in C.
mexicana, A. xalapensis, P. capuli and pieces of Quercus
sp., wherein the time of new shoots is reduced on average
40 days (Figure 1B). Q. crassipes is a species with a wider
open canopy, which allows an easier entry of light and
generates a balance between the requirements of light
and water provided by the epiphytic (Rubio-Licona et
al., 2011).
100
515
A
Emergencia de raíz (d)
90
DMS= 18.79
80
70
a
60
a
a
a
a
QP
QR
QM
ab
50
40
bc
30
bc
c
20
10
0
100
90
80
70
60
50
40
30
20
10
0
QC
QCR
CM
AX
PC
QT
Especies sostén
B
DMS= 35.31
a
ab
ab
QC
QCR
b
b
CM
AX
b
ab
b
b
PC
QT
Especies sostén
QP
QR
QM
Figura 1. Velocidad de crecimiento de raíces. A) QC= Quercus crassipes; QCR= Quercus crassifolia; CM= Crataegus mexicana;
AX= Arbutus xalapensis; PC= Prunus capuli; QT= trozos de Quercus sp.; QP= Quercus sin aplicaciones; QR= Quercus
rugosa; QM= plantas con más de 4 pseudobulbos sobre Quercus rugosa; y B) brotes de Laelia autumnalis cultivadas.
Barras con la misma letra son estadísticamente iguales (Tukey, p≤ 0.05); DMS= diferencia mínima significativa.
Figure 1. Root growth rate. A) QC= Quercus crassipes, QCR= Quercus crassifolia; CM= Crataegus mexicana; AX= Arbutus
xalapensis; PC= Prunus capuli; QT= pieces of Quercus sp., QP= Quercus with no applications, QR= Quercus rugosa;
QM= plants with more than 4 pseudobulbs on Quercus rugosa, and B) Laelia autumnalis grown sprouts. Bars with the
same letter are not significantly different (Tukey, p≤ 0.05); DMS= minimum significant difference.
El tiempo de emergencia de brotes fue 50% mayor a los
cultivos de L. autumnalis establecidos sobre Q. crassipes
que en C. mexicana, A. xalapensis, P. capuli y Trozos de
Quercus sp., en los que el tiempo de la aparición de nuevos
brotes se reduce a 40 días en promedio (Figura 1B). Q.
crassipes es una especie de dosel más abierto, que permite
que la luz ingrese fácilmente y genera un balance entre los
requerimientos de luz y suministro de agua que proporciona
a la epífita (Rubio-Licona et al., 2011).
La longitud de la raíz de las orquídeas sobre C. mexicana y
en A. xalapensis era de 5 cm en promedio a los 30 días, en
comparación con las plantas sobre otros forofitos que incluso
no presentaban crecimiento de raíz (Figura 2A); sin embargo,
esta tendencia se mantuvo para A. xalapensis pero no para C.
mexicana (Figura 2B), lo cual pudiera deberse a la presencia
The length of the roots of orchids on C. mexicana and A.
xalapensis was 5 cm on average at 30 days, compared
with plants on other phorophytes with no root growth
at all (Figure 2A), however, this trend continued for A.
xalapensis but not for C. mexicana (Figure 2B), which
could be due to the presence of fungi and bacteria on
the rind of the latter species, the bacterium Erwinia is
common in orchids and is considered a major threat for
the development of these species (Rivera- Corrales-Coto
and Moreira, 2007).
At 60 days, the supporting species did not affect the
development of new shoots (Figure 3A), but at 180 days,
differences were easily observed (Figure 3B). When
the orchids with four pseudobulbs were held in Q. rugosa
those presented on average 1.5 fewer shoots, but in the
plants established with more than four pseudobulbs in
the same kind of support, which favored the development
of new shoots (3 or more). The epiphytic habit of the
orchid species predisposes to maintain an aggregated
de hongos y bacterias sobre la corteza de esta última especie,
la bacteria Erwinia es común en orquídeas y se considera
como una de las principales amenazas para el desarrollo
de estas especies (Rivera-Coto y Corrales-Moreira, 2007).
QC
Longitud de raíz (cm)
18
16
A
DMS= 3.27
CM
AX
PC
QT
DMS= 4.77
QP
QR
QM
DMS= 4.26
a
14
12
8
a
6
4
a
abc
ab
ab
ab ab
0
40
b
ab a
10
2
ab a
bcd
abc abc abc
bc
bcd
cd
cb
bc
cd
c
b
d
c
30 días
60 días
90 días
B
a
DMS= 3.82
DMS= 3.87
35
QCR
DMS= 5.03
30
25
5
0
b
b
b
15
10
a
a
20
bc
c
c c
c
c cd
c
c
c
c
c
d
120 días
cd cd
cd
cde
d
150 días
Evaluación (d)
cde
de
e
180 días
Figura 2. Desarrollo de raíces de Laelia autumnalis cultivadas en diferentes medios de sostén. A) 30, 60 y 90 días. QC= Quercus
crassipes; QCR= Quercus crassifolia; CM= Crataegus mexicana; AX= Arbutus xalapensis; PC= Prunus capuli; QT=
trozos de Quercus sp.; QP= Quercus sin aplicaciones; QR= Quercus rugosa; QM= plantas con más de 4 pseudobulbos
sobre Quercus rugosa; y B. 120, 150 y 180 días. Barras con la misma letra son estadísticamente iguales (Tukey, p≤ 0.05);
DMS= diferencia mínima significativa.
Figure 2. Development of Laelia autumnalis roots grown in different means of support. A) 30, 60 and 90 days. QC= Quercus
crassipes; QCR= Quercus crassifolia; CM= Crataegus mexicana; AX= Arbutus xalapensis; PC= Prunus capuli; QT= pieces
of Quercus sp.; QP= Quercus with no applications; QR= Quercus rugosa; QM= plants with more than 4 pseudobulbs
on Quercus rugosa; and B. 120, 150 y 180 days. Bars with the same letter are not significantly different (Tukey, p≤ 0.05);
DMS= minimum significant difference.
A los 60 días, la especie sostén no afectó el desarrollo de
nuevos brotes (Figura 3A); sin embargo, a los 180 días, se
observaron diferencias (Figura 3B). Cuando las orquídeas
con cuatro pseudobulbos se sostuvieron en Q. rugosa
aquéllas presentaron en promedio menos de 1.5 brotes
nuevos, pero en las plantas establecidas con más de cuatro
pseudobulbos en esa misma especie sostén, se favoreció el
desarrollo de nuevos brotes (3 o más). El hábito epífito ó
litofítico de las especies de orquídeas predispone a mantener
distribution (Zozt and Schmidt, 2006), this explains the
tendency of orchids to grow better when they are cut into
pieces.
The larger diameter of pseudobulb (2.4 cm) was
obtained from L. autumnalis plants with more than
four pseudobulbs on Q. rugosa, unlike the plants that
were split and maintained in Q. crassifolia, reaching
only 1.5 cm (Figure 4A); the largest pseudobulbs
517
(14.3 cm) were obtained when grown on A. xalapensis
(Figure 4B), which contrasted with the results on the
species Q. crassipes and Q. crassifolia, which were
una distribución en partes o agregada (Zozt y Schmidt, 2006),
esto explica la tendencia de las orquídeas a desarrollarse
mejor cuando no se seccionan en partes.
3.5
A
DMS= 1.30
Número de brotes
3
2.5
a
2
a
a
1.5
a
a
a
QC
QCR
CM
a
a
a
1
0.5
0
AX
PC
QT
QP
QR
QM
Especies sostén
3.5
B
DMS= 1.64
a
Número de brotes
3
2.5
2
ab
ab
1.5
ab
ab
ab
ab
ab
b
1
0.5
0
QC
QCR
CM
AX
PC
Especies sostén
QT
QP
QR
QM
Figura 3. Desarrollo de brotes en plantas de Laelia autumnalis cultivadas en los medios de sostén indicados. A) 60 días. QC= Quercus
crassipes; QCR= Quercus crassifolia; CM= Crataegus mexicana; AX= Arbutus xalapensis; PC= Prunus capulí; QT= trozos
de Quercus sp.; QP= Quercus sin aplicaciones; QR= Quercus rugosa; QM= plantas con más de 4 pseudobulbos sobre
Quercus rugosa; y B) 180 días. Barras con la misma letra son estadísticamente iguales (Tukey, p≤ 0.05); DMS= diferencia
mínima significativa.
Figure 3. Shoot development in plants grown in Laelia autumnalis cultivated in the means indicated. A) 60 days. QC= Quercus
crassipes, Quercus crassifolia QCR=; CM= Crataegus mexicana, AX= Arbutus xalapensis, PC= Prunus capuli, QT= pieces
f
of Quercus
sp., QP= Quercus with no applications, QR= Quercus rugosa, QM= plants with more than 4 pseudobulbs on
Quercus rugosa, and B) 180 days. Bars with the same letter are not significantly different (Tukey, p≤ 0.05); DMS= minimum
signi icant difference.
El mayor diámetro del pseudobulbo (2.4 cm) se obtuvo en
plantas de L. autumnalis con más de cuatro pseudobulbos
sobre Q. rugosa, al contrario de lo que sucedió cuando las
plantas se dividieron y se sostuvieron en Q. crassifolia, en
donde sólo alcanzaron 1.5 cm (Figura 4A); los pseudobulbos
más largos (14.3 cm), se obtuvieron cuando se cultivaron
sobre A. xalapensis (Figura 4B), que contrastó con los
only pseudobulbs no larger than 10 cm. The increased size
of these plant’s parts means a greater accumulation of
water in their tissues, according to Trapnell and Hamrick
(2006), moisture availability favors the colonization
of phorophytes by epiphytic species and infers that Q.
rugosa and A. xalapensis provide the micro-climatic
requirements that L. autumnalis requires.
resultados sobre las especies de Q. crassipes y Q. crassifolia,
en que sólo se registraron pseudobulbos no mayores a 10 cm
de longitud. El aumento de tamaño de estas partes vegetales
implica mayor acumulación de agua en sus tejidos; de acuerdo
con Trapnell y Hamrick (2006), la disponibilidad de humedad,
propicia la colonización de forofitos por especies epífitas
e infiere que Q. rugosa y A. xalapensis, proporciona los
requerimientos microclimáticos que L. autumnalis requiere.
There were differences in the moisture content of the bark
of the phorophytes, Q. rugosa remained almost 100%
moisture content at five days, unlike C. mexicana that in
the same period lost more than 35%, on the other hand,
Q. rugosa and Q. crassipes maintained over 80% of the
quantity of water accumulated in the crust at 40 days
(Figure 5). Due that the orchids are adapted to sites with
periods of low water availability (Andrade et al., 2007),
DMS= 0.88
Diámetro del pseudobulbo (cm)
3
A
ab
ab
ab
abc
bc
bc
bc
c
2.5
2
1.5
a
1
0.5
0
QC
QCR
CM
AX
PC
Especies sostén
QT
QP
QR
QM
DMS= 15.23
Longitud del pseudobulbo (cm)
16
14
12
10
B
a
ab
ab
ab
b
b
ab ab
QC
QR
ab
8
6
4
2
0
QCR
CM
AX
PC
Especies sostén
QT
QP
QM
Figura 4. Desarrollo del pseudobulbo de Laelia autumnalis cultivadas en los medios de sostén indicados. A) Diámetro. QC= Quercus
crassipes; QCR= Quercus crassifolia; CM= Crataegus mexicana; AX= Arbutus xalapensis; PC= Prunus capuli; QT=
trozos de Quercus sp.; QP= Quercus sin aplicaciones; QR= Quercus rugosa; QM= plantas con más de 4 pseudobulbos
sobre Quercus rugosa; y B) Longitud. Barras con la misma letra son estadísticamente iguales (Tukey, p≤ 0.05); DMS=
diferencia mínima significativa.
Figure 4. Pseudobulb development of Laelia autumnalis grown in the means of support indicated. A) Diameter. QC= Quercus
crassipes, QCR= Quercus crassifolia; CM= Crataegus mexicana, AX= Arbutus xalapensis, PC= Prunus capuli, QT= pieces
of Quercus sp., QP= Quercus with no applications, QR= Quercus rugosa, QM= plants with more than 4 pseudobulbs on
Quercus rugosa, and B) Length. Bars with the same letter are not significantly different (Tukey, p≤ 0.05); DMS= minimum
significant difference.
519
Se registraron diferencias en el contenido de humedad
de las cortezas de los forofitos, Q. rugosa mantuvo
el contenido de humedad casi 100% a los cinco días,
a diferencia de C. mexicana que en el mismo periodo
perdió más de 35% de humedad; por otro lado, Q.
rugosa y Q. crassipes mantuvieron más de 80% de la
cantidad de agua acumulada en la corteza hasta los 40 días
(Figura 5). Debido a que las orquídeas están adaptadas
a sitios con periodos de escasa disponibilidad de agua
(Andrade et al., 2007), se deduce que L. autumnalis
necesite tiempos parciales de humedad y se adapte a
especies como A. xalapensis que no retienen cantidades
excesivas de agua, la dinámica de las cortezas de las
especies de forofitos ejerce una influencia en la dinámica
de las poblaciones de epífitas en la naturaleza (Zozt y
Schmidt, 2006).
140
it’s considered that L. autumnalis needs partial moisture
times and to adapt to species such as A. xalapensis that
do not retain excessive amounts of water, the dynamics
of the bark of species of phorophytes exerts an influence
on the population dynamics of epiphytes in nature (Zozt
and Schmidt, 2006).
Influence of the type of substrate on the growth of L.
autumnalis
The statistical analysis showed highly significant
differences between the treatments and, for the
pseudobulb’s length and diameter variables (Table 4)
but not in the development of new shoots in L. autumnalis
in the different substrates (Figure 6B), an effect
attributed due to this species has a bud per plant annually,
A
Materia seca (g)
120
100
80
60
40
20
0
Quercus rugosa
Quercus crassipes Quercus crassifolia Crataegus mexicana Arbutus xalapensis
Prunus capuli
Especies sostén
Contenido de humedad (%)
100
90
B
5 días
10 días
40 días
80
70
60
50
40
30
20
10
0
Quercus rugosa
Quercus crassifolia
Quercus crassipes Crataegus mexicana Arbutus xalapensis
Prunus capuli
Especies sostén
Figura 5. Comparación de la materia seca de cortezas (A) y contenido de humedad (B) de las especies sostén indicadas para el
desarrollo de Laelia autumnalis.
Figure 5. Comparison of the bark’s dry matter (A) and moisture content (B) of the supporting species indicated for the development
of Laelia autumnalis.
Influencia del tipo de sustrato sobre el desarrollo de L.
autumnalis
El análisis estadístico mostró diferencias altamente
significativas y significativas entre tratamientos, para las
variables longitud y diámetro del pseudobulbo (Cuadro 4), pero
no en el desarrollo de nuevos brotes en L. autumnalis en los
diferentes sustratos (Figura 6B), efecto que se atribuye a que esta
especie desarrolla un brote por planta anualmente, a partir de una
yema localizada en la base del pseudobulbo más joven, aunque
es posible que otros pseudobulbos formen brotes nuevos.
from a bud located at the base of the younger pseudobulb,
although, it’s possible that other pseudobulbs form new
buds.
The plants grown in Ascovimu (sawdust, compost, wood
chips, moss, 1:1:1:1), presented on average shoots at 43
days compared to the other substrates such as Catecopeat
(coal, volcanic rock, bark, peat moss, vermiculite , 1:1:2:
½: ½), which began sprouting up to 64 days (Figure 6A). In
this same substrate, the pseudobulbs were even larger (15.8
cm) in the other substrates tested; the pseudobulbs did not
Cuadro 4. Prueba sustratos y datos estadísticos básicos registrados de Laelia autumnalis.
Table 4. Test of substrates and basic statistical data recorded for Laelia autumnalis.
Variables
Número de brotes
Longitud de pseudobulbo (cm)
Diámetro de pseudobulbo (cm)
X
54.02
1.67
10.36
2.08
R2
0.16
0.05
0.60
0.29
CM
612.99
0.27
97.56**
3.07*
CM Error
322.58
0.47
6.44
0.75
CV (%)
33.25
41.28
24.51
41.67
= diferencia significativa; ∗∗= diferencias altamente significativa; R2= coeficiente de determinación; CM= cuadrados medios; CV= coeficiente de variación.
Número de brote
Emergencia de brote (d)
∗
70
60
50
40
30
20
10
A
0
2
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
a
a
a a
CATECOPEAT
B
ASTECOCA
ASCOVIMU
Sustratos
a
a
TEMUCOBA
DMS= 24.3
a
TECOCAPA
DMS= 0.93
a
a
a
CATECOPEAT
ASTECOCA
ASCOVIMU
Sustratos
TEMUCOBA
TECOCAPA
Figura 6. Desarrollo de nuevos brotes de Laelia autumnalis cultivada en los tipos de sustratos indicados. A) emergencia de brotes.
CATECOPEAT= carbón, tezontle, corteza, peat moss, vemiculita, 1:1:2:½:½; ASTECOCA= aserrín, tezontle, corteza,
carbón, 2:2:1:1; ASCOVIMU= aserrín, composta, viruta, musgo, 1:1:1:1; TEMUCOBA= tezontle, musgo, composta,
bagazo de caña, 1:1:2:2; TECOCAPA= tezontle, composta, carbón, paja de avena, 1:2:1:2; y B) número de brotes. Barras
con la misma letra son estadísticamente iguales (Tukey, p≤ 0.05); DMS= diferencia mínima significativa.
Figure 6. Development of new shoots of Laelia autumnalis grown in the indicated media type. A) emergence of shoots.
CATECOPEAT= coal, volcanic rock, bark, peat moss, vemiculite, 1:1:2:½:½ ASTECOCA= sawdust, volcanic rock,
bark, coal, 2:2:1:1; ASCOVIMU= sawdust, compost, wood chips, moss , 1:1:1:1; TEMUCOBA= volcanic rock, moss,
compost, bagasse, 1:1:2:2; TECOCAPA= volcanic rock, compost, coal, oats straw, 1:2:1:2, and B) shoots number. Bars
with the same letter are not significantly different (Tukey, p≤ 0.05); DMS= minimum significant difference.
521
Las plantas cultivadas enAscovimu (aserrín, composta, viruta,
musgo, 1:1:1:1), presentaron brotes a los 43 días en promedio,
en comparación con otros sustratos como Catecopeat (carbón,
tezontle, corteza, peat moss, vermiculita, 1:1:2: ½:½), en el
que la brotación se inició hasta los 64 días (Figura 6A). En
este mismo sustrato los pseudobulbos fueron más grandes
(15.8 cm), en los demás sustratos evaluados los pseudobulbos
no rebasaron los 10 cm de altura. Esta mezcla compuesta por
aserrín y la corteza, subproductos de la industria forestal, es una
opción económica para el desarrollo de plantas de la familia
Orchidaceae, que puede sustituir sustratos importados como
la vermiculita, el peat moss (Sánchez-Córdova et al., 2008).
Diámetro del pseudobulbo (cm)
Longitud del pseudobulbo (cm)
Al igual que lo observado en la longitud del pseudobulbo,
las plantas cultivadas en Ascovimu, presentaron el mayor
diámetro (2.9 cm) en tanto que Catecopeat y Astecoca
(aserrín, tezontle, corteza, carbón, 2:2:1:1), fueron los
sustratos que ejercieron menor efecto en el crecimiento del
pseudobulbo (Figura 7B).
18
16
14
12
10
8
6
4
2
0
even exceed 10 cm. This mixture composed of sawdust and
bark, by-products forest industry, is an economical choice
for the development of plants of the family Orchidaceae,
which can replace imported substrates such as vermiculite
and peat moss (Sánchez-Córdova et al., 2008.)
As noted in the length of the pseudobulb, plants grown
in Ascovimu had the highest diameter (2.9 cm) while
Catecopeat and Astecoca (saw dust, volcanic rock, bark,
coal, 2:2:1:1) were the substrates that exerted less effects
on the pseudobulb’s growth (Figure 7B).
These are preliminary results, so further research it’s
necessary to better define the properties of the substrates,
in order to explain their influence that generate differences
in the development of the orchid’s pseudobulbs. The
analysis of the physical characteristics of the substrates
used in this investigation denoted that, these substrates
were homogeneous (Figure 8). It’s possible that the feature
A
b
CATECOPEAT
a
b ASTECOCA
ASCOVIMU
Sustratos
DMS= 3.43
b
TEMUCOBA
2.5
2
1.5
TECOCAPA
DMS= 1.17
B
3.5
3
b
a
b b b
b
1
0.5
0
CATECOPEAT
ASTECOCA
ASCOVIMU
Sustratos
TEMUCOBA
TECOCAPA
Figura 7. Desarrollo del pseudobulbo en Laelia autumnalis cultivada en los sustratos indicados. A) Longitud. CATECOPEAT=
carbón, tezontle, corteza, peat moss, vemiculita, 1:1:2:½:½; ASTECOCA= aserrín, tezontle, corteza, carbón, 2:2:1:1;
ASCOVIMU= aserrín, composta, viruta, musgo, 1:1:1:1; TEMUCOBA= tezontle, musgo, composta, bagazo de caña,
1:1:2:2; TECOCAPA= tezontle, composta, carbón, paja de avena, 1:2:1:2; y B) Diámetro. Barras con la misma letra son
estadísticamente iguales (Tukey, p≤ 0.05); DMS= diferencia mínima significativa.
Figure 7. Pseudobulb development in Laelia autumnalis grown in the indicated substrates. A) Length. CATECOPEAT= coal,
volcanic rock, bark, peat moss, vemiculite, 1:1:2: ½: ½ ASTECOCA= sawdust, volcanic rock, bark, coal, 2:2:1:1;
ASCOVIMU= sawdust, compost, wood chips, moss , 1:1:1:1; TEMUCOBA= volcanic rock, moss, compost, bagasse,
1:1:2:2; TECOCAPA= volcanic rock, compost, coal, oat straw, 1:2:1:2, and B) Diameter. Bars with the same letter are
not significantly different (Tukey, p≤ 0.05); DMS= minimum significant difference.
CONCLUSIONES
involved in the development of L. autumnalis is the ability
to transfer between substrate-plant nutrients as mentioned
by Rodríguez et al. (2010).
100
90
Características físicas
Estos resultados son preliminares por lo que habrá de llevarse
a cabo más investigaciones, para definir con mayor precisión
las propiedades de los sustratos, que expliquen su influencia
para generar diferencias en el desarrollo de pseudobulbos de
la orquídea en estudio. El análisis de las características físicas
de los sustratos utilizados en la presente investigación, denotó
que estos sustratos fueron muy homogéneos (Figura 8). Es
posible que la propiedad que interviene en el desarrollo de L.
autumnalis sea la capacidad de transferencia nutrimental entre
sustrato-planta tal como lo menciona Rodríguez et al. (2010).
80
70
60
50
40
30
20
10
0
Basados en los resultados generados en esta investigación,
se puede anticipar que es posible la reintegración de plantas
de orquídea de L. autumnalis a hábitats naturales, si se
determinan las especies arbóreas que la orquídea tiene
mayor afinidad y permiten el desarrollo de estas plantas
epífitas. Tal es el caso de A. xalapensis. L. autumnalis tuvo
mayor crecimiento y sobrevivencia en una mezcla a base
de aserrín, composta, viruta y musgo, debido posiblemente
que este sustrato tiene un menor porcentaje de retención de
humedad; por lo tanto, cuando se cultiven plantas epífitas
en este tipo de sustratos deben seleccionarse los que tengan
baja capacidad de retención de humedad.
Porosidad (%)
Aireación (%)
Retención de humedad (%)
CAT
ASC
ASV
Sustratos
TEM
TEC
Figura 8. Características físicas de los sustratos. CAT= carbón,
tezontle, corteza, peat moss, vemiculita, 1:1:2:½:½;
ASC= aserrín, tezontle, corteza, carbón, 2:2:1:1;
ASV= aserrín, composta, viruta, musgo, 1:1:1:1;
TEM= tezontle, musgo, composta, bagazo de caña,
1:1:2:2; TEC= tezontle, composta, carbón, paja de
avena, 1:2:1:2.
Figure 8. Physical characteristics of the substrates. CAT=
coal, volcanic rock, bark, peat moss, vemiculite,
1:1:2: ½: ½, ASC= sawdust, volcanic rock, bark,
coal, 2:2:1:1, ASV= sawdust, compost, wood chips,
moss , 1:1:1:1, TEM= volcanic rock, moss, compost,
bagasse, 1:1:2:2, TEC= volcanic rock, compost,
coal, oat straw, 1:2:1:2.
AGRADECIMIENTOS
Los autores(as) agradecen al Consejo Nacional de Ciencia
y Tecnología (CONACyT) por los apoyos otorgados, al
Sistema Nacional de Recursos Fitogenéticos de México
(SINAREFI); así como a las personas que proporcionaron
las plantas de L. autumnalis en las comunidades de Charapan
y Zacán, Michoacán, y a los propietarios del bosque de pinoencino donde se llevó a cabo la investigación.
LITERATURA CITADA
Aguilar-Rodríguez, S.; Terrazas, T.; Aguirre-León, E. y
Huidrobo-Salas, M. E. 2007.Modificaciones en la
corteza de Prosopis laevigata por el establecimiento
de Tillandsia recurvata. México. Bol. Soc. Bot.
Méx. 81(1):27-35.
CONCLUSIONS
Based on the results generated in this research, it’s
anticipated that it is possible to reintegrate L. autumnalis
orchid plants into natural habitats, if the tree species in
which the orchids have higher affinity and enable the
development of these epiphytes are determined. Such
is the case of A. xalapensis. L. autumnalis had a higher
growth and survival in a mixture of sawdust, compost,
wood chips and moss, possibly because this substrate has a
lower percentage of moisture retention; so, when growing
epiphytes in such substrates, those with low moisture
retention capacity should be selected.
Andrade, J. L.; De la Barrera, E.; Reyes, G. C.; Ricalde,
M. F.; Vargas, S. G. y Cervera, J. C. 2007. El
metabolismo ácido de las crasuláceas: diversidad,
fisiología ambiental y productividad. México.
Boletín de la Sociedad Botánica de México.
81(1):37-50.
Ayala-Sierra, A. y Valdez-Aguilar, L. A. 2008. El polvo de
coco como sustrato alternativo para la obtención
de plantas ornamentales para trasplante. Revista
Chapingo. Serie horticultura. 14(2):161-167.
Ceja, R. J.; Espejo, S. A.; López, F. A. R.; García, C. J.;
Mendoza, R. A. y Pérez, G. B. 2008. Las plantas
epífitas, su diversidad e importancia. Ciencias.
91(1):34-41.
Flores-Escobar, G.; Legaria-Solano, J. P.; Gil-Vásquez, I.
y Colinas-León, M. T. 2008. Propagación in vitro
de Oncidium stramineum Lindl. Una orquídea
amenazada y endémica de México. Revista
Chapingo. 14(3):347-353.
García-González, A. y Pérez, M. R. 2011. Aspectos
fisiológicos de la comunidad orquideológica de un
hábitat conservado y uno antropizado en la reserva
de la biósfera Sierra del Rosario, Cuba. México.
Mesoamericana. 15(1):33-39.
Garduño, C.; García, S. Y.; Ramos, M. y Téllez, M. A.
2007. Area recovery and characteristic orchids
conservation “in situ” at San Angel stony terrain,
Mexico, D. F. Reservoir area and ecological pathway
at south sciences and humanities educational
center (SSHEC) within the National Autonomous
University of Mexico. Costa Rica. Lankesteriana.
7(1-2):281-286.
Lauri, R. K. 2007. Conservation of the group Piperia
(Orchidaceae) and associated plant comunities.
Costa Rica. Lankesteriana. 7(1-2):287-293.
Lindig, C. R.; Blanco, G. A.; Sáenz, R. C.; Alvarado, S. P. y
Alejandre, M. N. 2007. Restauración adaptable en
la Meseta Purépecha, Michoacán, México: hacia
un modelo de estados y transiciones. México. Bol.
Soc. Bot. Mex. 80(suplemento):25-31.
Mateos, M. J. A. 2006. Proyecto Orquídea. México. Boletín
de contacto otoño-invierno. 2(4):4:2-9.
Medina, C.; Guevara-Fefer, F.; Martínez, M. A.; SilvaSaénz, P.; Chávez-Carvajal, M. A. y García, I.
2000. Estudio florístico de la comunidad indígena
de Nuevo San Juan Parangaricutiro, Michoacán,
México. Acta Botánica Mexicana. 52:5-42.
523
Muratalla-Lúa, S.; Rodríguez-Mendoza, M. N.; SánchezGarcía, P.; Tijerina-Chávez, L.; Santizo-Rincón, J.
A. y López-Jiménez, A. 2006. Paja de maíz como
sustrato en el crecimiento de plántulas de jitomate.
México. Terra Latinoamericana. 24(3):319-325.
Rangel-Villafranco, M. and Ortega-Larrocea, M. P. 2007.
Efforts to conserve endangered terrestrial orchids
in situ and ex situ at two natural reserves within
central Mexico. Costa Rica. 7 Lankesteriana. (12):326-333.
Rivera-Cotto, G. y Corrales-Moreira, G. 2007. Problemas
fitosanitarios que amenazan la conservación de las
orquídeas en Costa Rica. Costa Rica. Lankesteriana.
7(1-2):347-352.
Rodríguez, M. R.; Alcántar, G. E. G.; Iñiguez, C. G.; Zamora,
N. F.; García, L. P. M.; Ruíz, L. M. A. y Salcedo, P. E.
2010. Caracterización física y química de sustratos
agrícolas a partir de bagazo de agave tequilero.
Venezuela. Interciencia. 35(7):515-520.
Rubio-Licona, L.; Romero-Rangel, S. y Rojas-Zenteno,
E. C. 2011. Estructura y composición florística
de dos comunidades con presencia de Quercus
(Fagaceae) en el estado de México. México.
Revista Chapingo. Serie Ciencias Forestales y del
Ambiente. 17(1):77-90.
Salazar-Casasa, W.; Rivera-Cotto, G. y Corrales-Moreira, G.
2007. Comparación de los problemas fotosanitarios
en orquídeas de poblaciones silvestres y de cultivo,
como evaluación de riesgos de plagas o epidemias.
México. Lankesteriana. 7(1-2):362-367.
Salazar-Rojas, V. M.; Herrera-Cabrera, B. E.; FloresPalacios, A. y Ocampo-Fletes, I. 2007. Uso
tradicional y conservación de la “calaverita” Laelia
aceps subsp. Dawson ii F. Chilapensis Soto- Arenas
en la region de Chilapa, Guerrero. Costa Rica.
Lankesteriana. 7(1-2):368-370.
Sánchez-Córdova, T.; Aldrete, A.; Cetina-Alcalá, V. M.; y
López-Upton, J. 2008. Caracterización de medios
de crecimiento compuestos por corteza de pino y
aserrín. México. Madera y Bosques 14(2):41-49.
Statistical Analysis System (SAS Institute). 1997. Paquete
estadístico.Versión 6.03 Fiveth edition., volumen
1 and 2. SAS Institute Inc. Cary, N.C.
Smith, Z. F.; James, E. A. and McLean, C. B. 2007.
Experimental reintroduction of the threatened
terrestrial orchid Diuris fragrantissima. Costa Rica.
Swarts, N. D.; Batty,A. L.; Hopper, S. D. and Bixon, K. W. 2007.
Does integrated conservation of terrestrial orchids
work? Costa Rica. Lankesteriana. 7(1-2):219-222.
Trapnell, D. W. and Hamrick, J. L. 2006. Variety of
phorophyte species colonized by the Neotropical
Epiphyte, Laelia rubescens (Orchidaceae). EUA.
Selbyana 27(1):60-64.
Wake, C. M. F. 2007. Micro-environment conditions,
mycorrhizal simbiosis, and seed germination in
Cypripedium candidum: strategies for conservation.
Costa Rica. Lankesteriana. 7(1-2):423-426.
Zotz, G. and Schmidt, G. 2006. Population decline in the
epiphytic orchid Aspasia principissa. EUA. Biol.
Conserv. 129(1):82-90.
USO Y MANEJO DE PLANTAS ORNAMENTALES Y MEDICINALES
EN ESPACIOS URBANOS, SUBURBANOS Y RURALES*
USE AND MANAGEMENT OF ORNAMENTAL AND MEDICINAL
PLANTS IN URBAN SUBURBAN AND RURAL AREAS
Rafaela Mendoza-García1, Arturo Pérez-Vázquez2§, J. Cruz García-Albarado3, Eliseo García-Pérez2 y José López-Collado2
¹Programa en Agroecosistemas Tropicales. Colegio de Postgraduados. Campus Veracruz. Carretera Xalapa-Veracruz, km 88.5. Predio Tepetates, Manlio Fabio Altamirano,
Veracruz, México. A. P. 421. C. P. 91700. ([email protected]). ²Colegio de Postgraduados. Campus Veracruz. Tel. 01 229 2010770. Ext. 64332. (geliseo@
colpos.mx), ([email protected]). 3Colegio de Postgraduados. Campus Córdoba. Carretera Córdoba-Veracruz, km 385. Congregación Manuel León, Amatlán de los Reyes,
Veracruz. C. P. 94946. Tel. 01 272 7166504. ([email protected]). §Autor para correspondencia: [email protected].
RESUMEN
ABSTRACT
En México los jardines pueden ser considerados como
agroecosistemas por la intervención humana, su biodiversidad
y usos antropocéntricos. El acelerado desarrollo urbano ha
restado gradualmente superficie de áreas verdes y espacios
para esparcimiento y embellecimiento del paisaje. Por tanto,
el objetivo de esta investigación fue comparar el uso y manejo
de plantas ornamentales y medicinales y las percepciones
del público, respecto a jardines en zonas rural, suburbanas y
urbanas de la zona centro del estado de Veracruz. Se aplicó
en 2009 una encuesta utilizando la técnica de cuestionario y
seleccionando a los entrevistados que tuviesen jardín por el
método bola de nieve. El cuestionario cubrió tres aspectos;
socioeconómicos, manejo y uso de las plantas (medicinales y
ornamentales) y la percepción respecto a su jardín utilizando
la escala de Likert. Se encontró que los sitios rurales utilizan
regularmente 19 plantas medicinales, los suburbanos 20 y en
el urbano 5. El manejo de los jardines es incipiente en sitios
suburbanos. El análisis de percepción indicó una respuesta
altamente positiva en el sitio rural (4.3) y menor en el
suburbano (3.8) y urbano (3.7). Concluyendo que el aprecio
por las plantas y los espacios verdes es mayor en zonas
rurales; que el conocimiento y uso de plantas medicinales
fue mayor, en función de menor grado de urbanización; en el
In Mexico, gardens may be considered agroecosystems,
because of human intervention, biodiversity and
anthropocentric uses. The urban development has
gradually reduced the surface of green areas and spaces
for recreation and landscaping. Therefore, the objective of
this research was to compare the use and management of
ornamental and medicinal plants and the public perception
regarding to gardens in rural, suburban and urban areas, in
central Veracruz State. In 2009, a survey was implemented
using the questionnaire technique and selecting the
interviewers with gardens using the so called snowballmethod. The questionnaire covered three main aspects,
socio-economic, management and use of plants (medicinal
and ornamental) and, the perception of their gardens
using the Likert’s scale. It was found that, 19 rural sites
regularly used medicinal plants, suburban 20 and urban
5. The management of gardens is emerging in suburban
areas. The perception analysis indicated a highly positive
response at the rural site (4.3) and lower in suburban
(3.8) and urban (3.7). Concluding that, the appreciation
of plants and green-spaces is greater in rural areas; that
the knowledge and use of medicinal plants was higher due
to the lower degree of urbanization; in the management of
* Recibido: enero de 2011
Rafaela Mendoza-García et al.
manejo de los jardines no hubo diferencias en las tres zonas;
el análisis de percepción mostró que la zona rural tuvo un
mayor aprecio para los espacios verdes.
the gardens there were no differences in the three areas; the
perception analysis showed that, the rural areas presented a
greater appreciation for green-spaces.
Palabras clave: contaminación, conocimiento local,
huertos, jardines, percepción.
Key words: local knowledge, gardens, orchards, perception,
pollution.
INTRODUCCIÓN
INTRODUCTION
La crisis ecológica que enfrenta hoy día la humanidad es
de escala planetaria. Una de las mayores preocupaciones
y ocupaciones es el cambio climático y la pérdida de
biodiversidad, debido a un acelerado desarrollo urbano no
planificado el cual ha restado gradualmente superficie a
los ecosistemas y pérdida de la biodiversidad (Rodríguez,
2002; Benítez et al., 2004; Alcalá et al., 2007). Hoy día cerca
de 72% de la población mexicana vive en urbes (INEGI,
2010), las grandes metrópolis, carecen de suficientes áreas
de amortiguamiento ecológico o presentan un déficit en la
relación área verde por habitante (Rodríguez, 2002). Esta
problemática trata de corregirse a través de programas de
reforestación urbana con árboles y arbustos de los cuáles
pocos logran sobrevivir, debido a la falta de cuidados, la mala
planeación en la selección de especies y de las condiciones
ambientales adecuadas en un ambiente urbano con altos
niveles de contaminación (Benítez et al., 2004; Alanís, 2005;
Goddard et al., 2009).
Currently, the humanity is facing a worldwide scale
ecological crisis. One of the major concerns and
occupations is the climate change and the biodiversity
loss due to the rapid and unplanned urban development,
which has gradually subtracted surface ecosystems
and biodiversity loss (Rodríguez, 2002; Benítez et
al., 2004; Alcalá et al., 2007). Now a day, 72% of
Mexico’s population lives in cities (INEGI, 2010), the
big metropolis, lack of sufficient ecological buffering
areas or have a deficit in the green area per habitant
ratio (Rodríguez, 2002). This trouble is corrected through
urban reforestation programs with trees and shrubs of
which only a few survive due to neglect, poor planning
in the selection of species and suitable environmental
conditions in an urban environment with high levels
of contamination (Benítez et al., 2004; Alanís, 2005;
Los jardines se construyen para el deleite de la gente.
En ellos se configuran consciente o inconscientemente
un sistema de significados, que deben ser entendidos
por el visitante. Además, hay muchos tipos de jardines;
por ejemplo, jardines de plantas medicinales que sirven
como reservorio de especies con propiedades curativas
(Eyssartier et al., 2009), jardines con plantas de ornato y
jardines mixtos (medicinales y ornamentales) (Quesada,
2008); donde el objetivo principal de un jardín en cualquier
sitio es de esparcimiento, relajación, armonía con la
vivienda y de contacto con la naturaleza (Domínguez y
Domínguez, 1998).
Al respeto, existen escasos estudios en donde se examine
el papel de los jardines domésticos en ámbitos rurales,
suburbanos y urbanos en México (Salas, 2010); además se
desconoce el manejo, uso y su valor social en términos de
los beneficios derivados. Las investigaciones realizadas
en este sentido se enfocan a los huertos y jardines de las
The gardens are built for the delight of the people. They
consciously or unconsciously set up a system of meanings,
which must be understood by the visitor. In addition, there
are many types of gardens, such as medicinal plant gardens
that serve as reservoirs of species with healing properties
(Eyssartier et al., 2009), gardens with ornamental
plants and mixed gardens (medicinal and ornamental)
(Quesada, 2008), where the main purpose of a garden
at any site is recreation, relaxation, harmony with
the housing and contact with nature (Domínguez and
Domínguez, 1998).
Considering this regard, there are few studies that examine
the role of home gardens in rural, suburban and urban
in Mexico (Salas, 2010), also, unknown handling, use
and social value in terms of benefits. Researching in this
direction is focused on the orchards and gardens in rural
areas and the diversity found among these, taken from
ethnobotanical work (Rebolledo et al., 2008; Goddard
et al., 2009).
Uso y manejo de plantas ornamentales y medicinales en espacios urbanos, suburbanos y rurales
regiones rurales y sobre la diversidad que en ellos existen,
extraídos en trabajos etnobotánicos (Rebolledo et al., 2008,
En México los jardines y huertos, pueden ser clasificados
como agroecosistemas por la intervención humana
en su manejo, el alto grado de biodiversidad y los usos
antropocéntricos que tienen (Domínguez y Domínguez,
1998; Chávez-García, 2009). Cabe resaltar, que en el México
antiguo, existía gran preferencia por las flores y un gran uso de
plantas medicinales, esto se reflejaba en los arreglos florales,
los adornos del vestuario, los símbolos y las metáforas y las
ceremonias y fiestas (Heyden, 1995). De hecho, cuando los
españoles llegaron por primera vez a México, se sorprendieron
de la belleza, el diseño, y la biodiversidad presente en jardines
de los emperadores aztecas, como el de Chapultepec y el de
Itztapalapa (Moreno y Torres, 2002).
En la época prehispánica muchas plantas de los jardines tenían
usos diversos. Esta el caso de la Dahlia spp. que se usaba como
ornamental, alimenticia, medicinal, ceremonial y ahora se
sabe que también tiene propiedades forrajeras (Mera y Bye,
2006; Planchuelo et al., 2003; Tlahuextl et al., 2005). El
uso más sobresaliente de muchas plantas de jardines es el
medicinal. En México el uso de plantas medicinales constituye
una tradición (Terrones et al., 2004; Didier, 2009).
Según estimaciones, entre 70% y 80% de las poblaciones
humanas rurales recurren a plantas medicinales (Díaz, 2003).
Sin embargo, el auge y demanda de la “medicina naturista”
está ocasionando una mayor depredación de bosques y selvas
(Mendoza, 2002; Didier, 2009).
Los habitantes de las grandes ciudades, muchas veces no
valoran los beneficios ecológicos provistos por las áreas
verdes, traducidos éstos en servicios ambientales como
la purificación del aire, reservorio de aves e insectos
(Todorova et al., 2004). Esto motiva a que estos espacios sean
eliminados o desplazados (Benz et al., 2000), aunado a la
presión sobre el uso del suelo. En ocasiones, muchas de estas
áreas verdes son consideradas un reservorio de animales
no deseables, como cucarachas y mosquitos (Alanís, 2005;
Alcalá et al., 2007; Terrones et al., 2009).
Otra problemática en las zonas urbanas es la relación
superficie de áreas verdes por habitante. Según Rodríguez
(2002), debe de haber como mínimo nueve metros cuadrados
per cápita. Sin embargo, sólo se reporta que existen 3.5
m2 por habitante en México, cifra muy por debajo de lo
527
In Mexico, the gardens and orchards can be classified
as agroecosystems by human intervention in their
management, the high degree of biodiversity and the
anthropocentric uses (Domínguez and Domínguez, 1998;
Chávez-García, 2009). It’s noteworthy that in ancient
Mexico, there was a strong preference for flowers and
a great use of medicinal plants, this was reflected in
the floral arrangements, clothing motifs, symbols and
metaphors and ceremonies and parties (Heyden, 1995).
In fact, when the Spanish first arrived in Mexico, they
were amazed at the beauty, design, and biodiversity in the
gardens of the Aztec emperors, such as Chapultepec and
Itztapalapa (Moreno and Torres, 2002).
At the prehispanic age, many garden plants had several
uses. Such is the case for Dahlia spp. which was used as
an ornate, food, medicine, ceremonial and now, is also
known to present forage properties (Mera and Bye, 2006;
Tlahuextl et al., 2005; Planchuelo et al., 2003). The most
prominent usage for many garden plants is medicinal. In
Mexico, the use of medicinal plants is a tradition (Didier,
2009; Terrones et al., 2004).
According to estimates, between 70% and 80% of rural
human populations rely on medicinal plants (Díaz, 2003).
However, the rise and demand for “natural medicine” is
causing greater devastation of forests and jungles (Mendoza,
2002; Didier, 2009).
People from large cities, do not often value the ecological
benefits provided by green areas, environmental services
translated as purification of the air, reservoir of birds
and insects (Todorova et al., 2004). This motivates
that these spaces are removed or displaced (Benz et al.,
2000), besides the pressure on land-use. Sometimes,
many of these green areas are considered a reservoir
of undesirable animals such as cockroaches and
mosquitoes (Alanís, 2005; Alcalá et al., 2007; Terrones
et al., 2009).
Another problem in urban areas is the green area per
inhabitant ratio. According to Rodríguez (2002), we must
have at least nine square meters per capita. However, reports
show that there are only 3.5 m2 per capita in Mexico, a figure
way below that required by the WHO (Rent et al., 1997;
Rodríguez and Alarcón, 2003; Chávez and Toledo, 2006).
Moreover, the reduction of dwelling areas is even smaller,
which makes it to reject the idea of having a green area at
all, although, there are indeed cases where there is a green
estipulado por la OMS (Rente et al., 1997; Rodríguez y
Alarcón, 2003; Chávez y Toledo, 2006). Por otra parte, la
reducción del área para casas habitación es más pequeña lo
cual hace desechar la idea de tener un área verde; aunque
existen casos en donde existe área verde, pero no se le da los
manejos y cuidados adecuados y termina siendo un depósito
de basura (Domínguez y Domínguez, 1998; Alanís, 2005;
Alcalá et al., 2007).
En las zonas rurales, en donde los espacios verdes
disponibles son abundantes y los jardines son más de
carácter familiar (Buendía y Morán, 1996), se caracterizan
por ser espacios con fines y beneficios diversos, que
contribuyen a satisfacer las necesidades básicas para la
alimentación de la familia y fuente de remedios curativos
para las enfermedades más típicas y cuyo uso está basado
en conocimientos locales (Benz et al., 2000; ChávezServía et al., 2004; Cárdenas y Ramírez, 2004; Bermúdez
et al., 2005; Lozada et al., 2006). Sin embargo, debido al
desarrollo acelerado, la transmisión de dicho conocimiento
está en riesgo de desaparecer a consecuencia de la invasión
tecnológica y la urbanización (Raja et al., 1997; Tabuti et
al., 2003; Eyssartier et al., 2009).
De tal modo que la pregunta de investigación planteada
fue ¿Cuál es el conocimiento local e importancia sobre
uso, manejo y diversidad de las plantas ornamentales,
medicinales en jardines del ámbito urbano, suburbano y
rural en la zona centro del estado de Veracruz? Por ello, esta
investigación tuvo como objetivo analizar el uso, manejo de
plantas ornamentales y medicinales, así como la diversidad
y conocer la percepción respecto a la importancia de los
jardines en las zonas urbana, suburbana y rural de la zona
centro del Estado de Veracruz. Bajo la hipótesis de que
existe un mayor conocimiento local sobre uso y manejo de
las plantas ornamentales y medicinales, y mayor diversidad
vegetal y diferente percepción de la importancia social de
los jardines en las zonas rurales respecto a los urbanos y
suburbanos.
Área de estudio. Se ubicaron tres ámbitos urbano,
suburbano y rural. Como sitio rural se tomaron dos
comunidades, Angostillo y El Faisán del municipio de Paso
de Ovejas. Angostillo tiene una actividad agropecuaria de
producción de maíz y fríjol con tendencia principal a la
area, but without proper care and handling, it ends up being
a deposit of garbage (Domínguez and Domínguez, 1998;
Alanís, 2005; Alcalá et al., 2007).
In rural areas, where green spaces are plenty available and
the grounds are of a more familiar character (Buendía and
Morán, 1996), they are characterized by areas with different
purposes and benefits that help meeting the basic needs for
food for the family and they’re also a source of healing
remedies for the most typical diseases, whose use is based
on local knowledge (Benz et al., 2000; Chávez-Servía et
al., 2004; Cárdenas and Ramírez, 2004; Bermúdez et al.,
2005; Lozada et al., 2006). However, due to an accelerated
development, the transmission of such knowledge is at risk
of disappearing as a result of the technological invasion
and urbanization (Raja et al., 1997; Tabuti et al., 2003;
Eyssartier et al., 2009).
So that, the researching question proposed was: what is the
local knowledge and importance of use and management
and diversity of ornamental, medicinal plants in gardens of
urban, suburban and rural areas in central Veracruz State?
Therefore, this study aimed to analyze the use, management
of ornamental and medicinal plants, as well as the diversity
and understanding of the perception of importance of gardens
in urban, suburban and rural areas of central Veracruz State.
Under the hypothesis that there is more local knowledge on
use and management of ornamental and medicinal plants,
and increased plant diversity and different perception of the
social importance of the gardens in rural areas compared to
urban and suburban.
Study area. Three urban, suburban and rural areas were
located. As the rural site, two communities were taken,
Angostillo and El Faisán in the Paseo de Ovejas municipality.
Angostillo has a farming production of corn and beans,
strongly focused on livestock, located at 19° 13’ 01” north
latitude 96° 32’ 35” longitude west at an elevation of 300
meters. El Faisán’s main activity is the production of sugar
cane and is located 19° 19’ 66” north latitude 96° 32’ 35”
west longitude at an elevation of 300 m.
Colonia Amapolas was selected as the suburban site,
municipality of Veracruz, located at 19° 09’30” north latitude
96° 11’ 54” W and an elevation of 90 m and the colony Luis
529
ganadería, se ubica a los 19° 13’ 01” latitud norte 96° 32’
35” longitud oeste a una altitud de 300 msnm. El Faisán tiene
como actividad principal la producción de caña de azúcar
y se ubica los 19° 19’ 66” latitud norte 96° 32’ 35” longitud
oeste a una altitud de 300 m.
Gómez Zepeda 19° 11’ 52” north latitude 96° 09’ 45” west
longitude at an elevation of 60 m. These two colonies are
located on the edge of the urban area of the city of Veracruz
and in the metropolitan area designated as suburban by the
CONAPO (2000); INEGI (2010).
Como sitio suburbano se seleccionó a la Colonia Amapolas,
municipio de Veracruz, ubicada a los 19° 09’ 30” latitud
norte 96° 11’ 54” longitud oeste y una altitud de 90 m y la
colonia Luis Gómez Zepeda 19° 11’ 52” latitud norte 96° 09’
45” longitud oeste a una altitud de 60 m. Estas dos colonias
están ubicadas en la orilla de la zona urbana de la ciudad
de Veracruz y dentro del área conurbada señalada como
suburbana por la CONAPO (2000); INEGI (2010).
As the urban areas, Miguel Hidalgo y Costilla colony was
taken, located at 19° 11’ 43” north latitude and 96° 11’ 54”
longitude west at an elevation of 60 m and is classified as
urban by CONAPO (2000); INEGI (2010). It has good
roads, all public services and the main economic activity is
the industry and commerce.
Como zona urbana se tomó a la colonia Miguel Hidalgo y
Costilla, municipio de Veracruz, ubicada a los 19° 11’ 43”
latitud norte y 96° 11’ 54” longitud oeste a una altitud de 60
msnm y está catalogada como urbana por CONAPO (2000);
INEGI (2010). Dispone de buenas vías de comunicación,
todos los servicios públicos y su actividad económica es la
industria y el comercio.
Al respecto, el criterio para considerar a una población
urbana es una localidad de más de 2 500 habitantes, dispone
con servicios públicos como alumbrado, agua potable,
drenaje, comunicaciones, y servicios médicos, sanitarios
y de higiene suficientes (Rodríguez y Alarcón, 2003). El
suburbano es un espacio genérico que rodea a cualquier
ciudad (Cruz, 2002), en donde la coexistencia e interacción
de elementos urbanos y rurales están en un mismo territorio.
La zona rural se caracteriza porque se ubica lejos de un
polo de desarrollo (cuidad), su principal función es cultivar
la tierra, su población es menor de 2 500 habitantes, y no
dispone con los requisitos mínimos de servicios públicos
(Rodríguez y Alarcón, 2003).
La encuesta. Durante los meses de abril a junio de 2009,
se aplicó una encuesta a propietarios de los jardines en
los tres ámbitos: rural, suburbano y urbano. Para ello se
estructuró un cuestionario con base en operacionalización
de la hipótesis. Este cuestionario estuvo conformado
por preguntas estructuradas en tres secciones: la primera
concerniente a información socioeconómica como sexo,
edad, tipo de vivienda, servicio de seguro social (IMSS,
ISSSTE, particular, curandero o seguro popular), tipo de
propiedad (propia o rentada), escolaridad, estado civil,
ocupación y servicios de la vivienda.
In this regard, the criterion for considering as an urban
population, is a town with more than 2 500 inhabitants,
provides public services such as energy, water, drainage,
communications, and medical services, adequate
sanitation and hygiene (Rodríguez and Alarcón, 2003.)
The Suburban is a generic space that surrounds any city
(Cruz, 2002), where the coexistence and interaction of
urban and rural elements are in the same territory. The rural
area is characterized because it lies far from a development
center (city), its main function is to cultivate the land,
its population is less than 2 500 inhabitants, and has no
minimum requirements for public services (Rodríguez
and Alarcón, 2003).
Survey. During the months from April to June 2009, a
survey was applied to the owners of gardens in three areas:
rural, suburban and urban areas. In order to do this, a
structured questionnaire based on the operationalization
of the hypothesis was made. This questionnaire consisted
of structured questions in three sections: the first one
concerning socio-economic information such as gender,
age, type of housing, social security services (IMSS,
ISSSTE, particular, healer or popular insurance), property
type (own or rented ), education, marital status, occupation
and housing services.
The second section included aspects of primary use
(ornamental or medicinal) and management of the
plants such as irrigation, fertilization, plant acquisition
(purchased, gifted, exchange or if brought from the
field), time for establishing the green-area. Finally, the
third section included aspects on criteria for the selection
of plants and social perception (space for recreation,
relaxation, socialization, social or regional custom
hierarchy) and environmental (if it serves as a reservoir of
La segunda sección incluyó aspectos sobre uso principal
(ornamental o medicinal) y manejo de las plantas como
tipo de riego, fertilización, forma de adquisición de
plantas (compradas, regaladas, intercambio o si las traía
del campo), tiempo del establecimiento del área verde.
Finalmente, la tercera sección incluyó aspectos sobre
criterios para la selección de las plantas y la percepción
social (espacio para recreo, relajación, socialización,
jerarquía social o costumbre regional) y ambiental (si
sirve como reservorio de especies vegetales, de fauna
silvestre, reductor de contaminación e interés de las
nuevas generaciones); estas últimas preguntas fueron
elaboradas mediante la técnica de escala tipo Likert para
obtener una calificación.
Tamaño de muestra. Se utilizó el método bola de nieve,
el cual consistió en localizar informantes que tuvieran
casas con áreas verdes (jardines), en buenas condiciones y
donde unos conducen a otros participantes y así hasta
lograr tener una muestra representativa (Martín-Crespo y
Salamanca, 2007). El tamaño de la muestra se estandarizó
para todos los sitios, la cual fue de 20 personas a entrevistar
por sitio.
Análisis estadística de la información. La información
se capturó en Excel y se analizó utilizando el programa
estadístico SA versión 6.1 (López et al., 2008). Se
hizo una separación de variables, primeramente se
diagnosticó el perfil de los entrevistados (género,
edad, escolaridad, estado civil, integrantes de
familia y ocupación), mediante cálculo de frecuencias
y porcentajes. Para el análisis de estatus
socioeconómico se obtuvieron medias con máximos y
mínimos que permitieron clasificar por tipo de vivienda
en acomodada, modesta y humilde. Por cada atributo de
la vivienda, se le asignó una calificación en una escala
de 1 a 3.
Se analizó el uso y manejo de las plantas medicinales y
ornamentales en función de variables, como prácticas
agrícolas y diversidad de usos. Finalmente se analizó la
percepción de los entrevistados, en una escala Likert, de
1= totalmente en desacuerdo; 2= en desacuerdo; 3= no
sabe; 4= de acuerdo; 5= totalmente de acuerdo, en donde
una respuesta positiva se ubica en el intervalo de 5 a 3 y
una respuesta negativa de 2 a 1 (Cañadas y Sánchez, 1998;
Ospina et al., 2005).
plant species, wildlife, reducing contamination and interest
of future generations), the latter questions were constructed
using the technique of Likert scale for rating.
Sample size. The so called snowball-method was used,
in order to locate the informants who had houses with
green areas (gardens), in good condition and where
they lead to each other to achieve a representative
sample (Martín-Crespo and Salamanca, 2007.) The sample
size was standardized for all the sites, 20 interviewees
per site.
Statistical analysis of information. The information is
captured in Excel and analyzed using the statistical software
STATISTICA version 6.1 (López et al., 2008). There was
a separation of variables, initially diagnosed the profile
of the respondents (gender, age, education, marital status,
occupation and family members), by calculating frequencies
and percentages. For the analysis of socioeconomic status,
the maximum and minimum means were obtained that
permitted the classification by type of housing in affluent,
modest and humble. For each attribute of the house, was
assigned a score on a scale of 1 to 3.
We analyzed the use and management of medicinal and
ornamental plants based on variables such as agricultural
practices and diversity of uses. Finally, we analyzed the
perception of respondents in a Likert scale with 1= strongly
disagree, 2= disagree, 3= do not know, 4= agree, 5= strongly
agree, where a positive response is at the range of 5 to 3 and a
negative response from 2 to 1 (Cañadas and Sánchez, 1998;
Ospina et al., 2005).
Profile of respondents. In the profile of the respondent
(Table 1), we found that, the respondents of the locations of
El Faisán and Angostillo, 90% are women and 10% male,
from the colonies Amapolas and Gómez, 70% women and
the others are males, Hidalgo colony, 80% female and 20%
males, with an age range greater than 49 years on average
in El Faisán and Angostillo localities, colonies Amapolas
48, Gomez 51, Hidalgo 48, with elementary school (3
years Faisán, Angostillo 2 years, 5 years Amapolas, Gómez
4 years, Hidalgo 5 years). In this regard, this variable
Perfil de los entrevistados. En el perfil del entrevistado
(Cuadro 1), se encontró que las personas encuestadas de
las localidades del Faisán y Angostillo, 90% son mujeres y
10% hombres, de las colonias de Amapolas y Gómez 70%
mujeres y el resto hombres, colonia Hidalgo 80% mujeres
y 20% a hombres; con un rango de edad mayor de 49 años
en promedio en las localidades el Faisán y Angostillo,
colonias Amapolas 48 años, Gómez 51 años, Hidalgo 48
años, con escolaridad básica (3 años Faisán, Angostillo 2
años, Amapolas 5 años, Gómez 4 años, Hidalgo 5 años). Al
respecto, esta variable corrobora que en las zonas rurales la
mujer tiene un papel tradicional, que consiste en ocuparse de
las labores domésticas, en los sitios suburbanos su papel se
diversifica, ya que la mujer es pilar de la economía o ambas
partes trabajan, en los sitios urbanos el papel de la mujer
puede ser similar al de las zonas suburbanas.
531
confirms that rural women have a traditional role, to dealing
with housework, suburban sites diversifies its role as the
woman is a pillar of the economy or both parties work, in
urban settings the role of women may be similar to that of
the suburban areas.
On the economic level, El Faisán scored 1.8 (low), Angostillo
1.4 (low), Gómez 1.9 (low), Amapolas 1.5 (low) and Hidalgo
2.1 (medium), classifying it as modest , the highest level
found in the study sites.
Mendoza’s studies (2002) mentioned the close link
between women and conservation, they are the ones
that have selected and preserved species since ancient
times, for the domestication process and even more those
women from rural areas, because the link with the nature is
tighter; so, women are in charge of green-spaces, gardens
or orchards, being from rural or poor areas the ones with
the highest affinity.
Cuadro 1. Perfil de los entrevistados en la zona rural, suburbana y urbana.
Table 1. Respondents’ profile in rural, suburban and urban areas.
Rural
Entrevistados
Características
Género
Femenino
Masculino
X
X
Ama de casa
Empleado
X
Edad (años)
Escolaridad (años)
Ocupación
Núm. de familiares
Faisán
(%) (n)
90 (18)
10 (2)
49
3
85 (17)
10 (2)
4
En el nivel económico, se obtuvo calificaciones del
Faisán 1.8 (bajo), Angostillo 1.4 (bajo), Gómez 1.9 (bajo),
Amapolas 1.5 (bajo) e Hidalgo 2.1 (medio), tipificándola
como modesto el cual fue el de mayor nivel encontrado en
los sitios de estudio.
Estudios de Mendoza (2002) hacen mención del
estrecho enlace que existe entre la mujer y el instinto
de conservación, ya que ellas son las que desde épocas
antiguas han conservado y seleccionado especies, para el
proceso de domesticación y más aun las mujeres de zonas
rurales, ya que el vínculo con la naturaleza es más cercano;
por tanto, constata lo expuesto en la investigación, al decir
Suburbano
Angostillo
(%) (n)
90 (18)
10 (2)
49
2
85 (17)
10 (2)
5
Amapolas
(%) (n)
70 (14)
30 (6)
48
5
45 (9)
25 (5)
4
Gómez
(%) (n)
70 (14)
30 (6)
51
4
65 (13)
25 (5)
4
Urbano
Hidalgo
(%) (n)
80 (16)
20 (4)
48
9
85 (17)
10 (2)
4
Management and use of the gardens. For the
management, it was found that, the main activities are
the irrigation and fertilization. In El Faisán 50% watered
daily, in Angostillo 75% water the garden at least twice
a week. In Amapolas, 80% watered daily and the rest
three times a week; in Gómez 30% watered daily, another
30% three times a week; in Hidalgo 60% of the surveyed
population waters daily. In rural areas the water resource
is scarce and therefore prevents watering daily. As for
the fertilization, at El Faisán 80% do this activity and
responds to the availability of this as 100% are dedicated to
sugar cane. Regarding the urban and suburban area is less
frequent chemical fertilization, preferring to use compost
que las mujeres son las que se hacen cargo de los espacios
verdes denominados jardines o huertos y que el arraigo es
mayor en las zonas rurales o de bajos recursos.
instead. In the suburban and urban areas fertilization is not
even performed because it´s not considered an important
task (Table 2).
Manejo y uso de los jardines. En el manejo se encontró
que las actividades básicas son el riego y fertilización. En
el Faisán 50% riega diariamente, en Angostillo 75% riega
el jardín al menos dos veces por semana. En Amapolas 80%
riega diario y el resto tres veces por semana; en Gómez 30%
riega diariamente, otro 30% tres veces por semana y en
Hidalgo 60% de la población encuestada riega todos días. En
la zona rural el recurso hídrico es escaso y por tanto se evita
regar diariamente. En cuanto a la fertilización, en el Faisán
80% realiza esta actividad y responde a la disponibilidad
de este dado que 100% se dedica a la caña de azúcar.
Respecto a la zona suburbana y urbana es menos frecuente
la fertilización química y mucho mayor el uso de composta.
En las zonas suburbanas y urbanas no se fertiliza ya que no
les parece una actividad primordial (Cuadro 2).
Regarding the use, there is a larger knowledge and
appreciation of medicinal plants in the rural areas with
low income and, the appreciation for plants with multiple
functions are occupying a place in their orchards and
gardens. As for the form of management, there was no
difference for the areas and the handling is reduced with
low impact (Table 2). Studies made by García et al. (2000)
reported that, within the tasks for managing the garden there
is a gender-gap, where the heaviest tasks are performed by
the men and though, lighter work by women.
Estomba et al. (2006) asserted that, the rural areas
are more attached to these practices; the closer to an
urbanization, the lower the use and knowledge of these
species. Consequently, the transmission of such knowledge
Cuadro 2. Manejo agronómico realizado en los jardines de las zonas de estudio.
Table 2. Agricultural practices conducted in the gardens of the study areas.
Actividad
Característica
Rural
Faisán
Angostillo
(%) (n)
(%) (n)
Frecuencia de riego
Diario
Temporal
Si
No
Composta
Comercial
55 (11)
30 (6)
80 (16)
20 (4)
5 (1)
75 (15)
Fertilización
Tipo de fertilización
Respecto al uso existe un mayor conocimiento local y aprecio
de las plantas medicinales en las zonas rurales y con bajos
recursos el aprecio por plantas con múltiples funciones, son
las que ocupan un lugar en sus huertos y jardines. En cuanto
a la forma de manejo no se encontró diferencia para las zonas
ya que el manejo es reducido y de poco impacto (Cuadro 2).
Estudios de García et al. (2000) registró, que las tareas de
manejo del jardín, hay una separación por género, donde las
labores más pesadas son realizadas por el hombre y labores
más ligeras por las mujeres.
Estudios de Estomba et al. (2006) aseveran que las zonas
rurales son más apegadas a este tipo de prácticas, ya que en
cuanto más se acercan a la urbanización el uso y conocimiento
de estas especies es menor. En consecuencia, la transmisión
5 (1)
5 (1)
30 (6)
70 (14)
20 (4)
10 (2)
Suburbano
Amapolas
Gómez
(%) (n)
(%) (n)
80 (16)
40 (8)
60 (12)
20 (4)
10 (1)
30 (6)
40 (8)
60 (12)
25 (5)
15 (3)
Urbano
Hidalgo
(%) (n)
60 (12)
30 (6)
70 (14)
20 (4)
10 (1)
is at risk of disappearing due to technological invasion
and urbanization (Raja et al., 1997; Tabuti et al., 2003;
Eyssartier et al., 2009). This may be justified because
the respondents believe that new generations have less
attachment or interest in this knowledge, as it scored 2.8
(negative) in El Faisán, 4.2 (positive) Angostillo, 3.4
(positive) in Amapolas. 3.1 (positive) in Gómez and 2.9
(negative) in Hidalgo and, it’s noteworthy that Angostillo
(rural) got the highest score (Likert scale).
Plant diversity
In the case of plant diversity, it was more abundant in the rural
areas, decreasing with the level of urbanization (Figure 1).
Besides, the dendrogram analysis to observe the similarity
Diversidad vegetal
70
65
61
60
50
0
Ornamental
Medicinal
24
Ornamental
Ornamental
Medicinal
12
28
Medicinal
10
Ornamental
30
100%
80%
Más de 10 m2
10%
Más de 10 m2
55%
60%
40%
20%
65%
35%
5 m2
5 m2
80%
2
5m
70%
45%
20%
0%
10%
Más de 10 m2
5 m2
35%
Angostillo
Amapolas
10%
2 m2
65%
Gómez
Hidalgo
2 m2
2 m2
2 m2
Faisán
Suburbana
Urbana
Zonas de estudio
36
Medicinal
Ornamental
32
The largest diversity in the rural areas is due that the available
spaces are quite larger than in the suburban and urban
areas (Figure 2). This can be attributed to the pressure of
land-use that is higher in urban areas. Studies of Campillo
(2005), Domínguez and Domínguez (1998), argued that, the
abundance of species in urban green areas is lower, due to
the space dedicated for them and the goal of the garden, as
they can be very artificial.
Rural
45
40
20
57
53
Medicinal
Número de plantas medicinales y ornamentales
En el caso de la diversidad vegetal, fue más abundante en las
zonas rurales y disminuyó a medida conforme el grado de
urbanización (Figura 1). Además, el análisis de dendograma
para observar la similitud de especies entre los lugares de
estudios, mostró la existencia de dos grupos: el grupo 1 lo
conforman Amapolas y Angostillo, con una similitud de
especies marcada a pesar de ser tipos diferentes, el grupo 2 lo
conforman el Faisán, Gómez e Hidalgo en donde comparten
especies entre sí.
of species between the study sites showed the existence of
two groups: group 1 is made up of Amapolas and Angostillo,
with a marked similarity of species despite being different
types, Group 2 conformed by El Faisán, Gómez and Hidalgo
sharing species between them.
Porcentajes del espacio dedicado al jardín
de dicho conocimiento se encuentra en riesgo de desaparecer
debido a la invasión tecnológica y la urbanización (Raja et
al., 1997; Tabuti et al., 2003; Eyssartier et al., 2009). Esto se
puede sustentar ya que las personas encuestadas creen que
las nuevas generaciones tienen menor apego o interés hacia
este conocimiento, ya que se obtuvieron calificaciones a
este supuesto de 2.8 (negativa) en el Faisán, 4.2 (positiva) en
Angostillo, 3.4 (positiva) enAmapolas. 3.1 (positiva) en Gómez
y 2.9 (negativa) en Hidalgo y se deja notar que Angostillo
(rural) obtiene la mayor calificación (escala tipo Likert).
533
Figura 2. Espacio dedicado al jardín dentro del lote de la
vivienda (en m2).
Figure 2. Space dedicated to the garden in the lot of the
dwelling (m2).
Figura 1. Total de plantas medicinales y ornamentales
registradas en los jardines por zona (rural,
suburbana y urbana).
Figure 1. Total registered medicinal and ornamental plants in
gardens by area (rural, suburban and urban).
The type of vegetation in areas where the economy is more
abundant it’s more commercial, finding introduced or
exotic species that require more care (Table 3). Chávez et
al., 2006 argued that, the environmental problems in cities
are caused by several factors, including insufficient green
areas that may be multifactorial, because of the lack of an
urban growth scheme.
La mayor diversidad vegetal en zonas rurales se debe a que los
espacios disponibles son más grandes y en las suburbanas y
urbanas más reducidos (Figura 2). Esto puede ser atribuido a
la presión de uso del suelo que es mayor en zonas urbanizadas.
Estudios de Campillo (2005); Domínguez y Domínguez
(1998), plantean que la abundancia de especies en áreas
verdes urbanas es menor, debido al espacio dedicado a ellas
y el objetivo del jardín, ya que pueden ser muy artificiales.
As advised by Campillo (2005), companies involved
in construction of houses in series, provide tight and
monotonous green areas with introduced species that may
be sometimes quite expensive. This can be attributed as
proposed by Rionda (2008), who argues that, the urban
expansion is increasing as people in rural areas are forced
to migrate to urban areas to try to increase their economy,
moving the green areas swarming them into an urban area.
El faisán
Angostillo
Col. Amapolas
Col. Gómez
Col. Hidalgo
Zonas de estudio
El tipo de vegetación en las zonas en donde la economía
es más abúndate el estilo es más comercial, encontrando
especies introducidas o exóticas que requieren mayores
cuidados (Cuadro 3). Chávez et al., 2006 plantean que los
problemas ambientales en ciudades son ocasionados por
varios factores, entre ellos la insuficiencia de áreas verdes
que puede ser multifactorial, por una carente planeación del
crecimiento urbano.
The investigation of Domínguez and Domínguez (1998),
mentions that for the planning of green spaces in urban areas,
there are no defined criteria, as is sometimes omitted these
areas or are purely cosmetic and does not matter the type of
species used, not the techniques used for the maintenance and
aftercare. This makes that green spaces in most neighborhoods
are reduced or inexistent, due to a lack of urban planning and
speculation that is done with the urban land.
Cuadro 3. Preferencia de los usuarios de las plantas que están presentes en los jardines.
Table 3. User preference of the plants present in the gardens.
10 (2)
0
90 (18)
0
Percepción social
En cuanto a la percepción social si existe diferencia según
la zona, lo cual también está influenciada por el nivel
socioeconómico y el nivel de estudios de cada individuo.
El mayor puntaje se tuvo en Angostillo con 4.3 (calificación
positiva), mientras que en el Faisán, Amapolas e Hidalgo se
tuvo una calificación similar de alrededor de 3.8 y por último
la colonia Gómez tuvo una calificación de 3.7 (Figura 3). Lo
50 (10)
10 (2)
40 (8)
0
35 (7)
0
65 (13)
0
Social perception
As for the social perception there are indeed differences
depending on the area, which is also inf luenced by
socioeconomic status and educational level of each individual.
The highest score was taken into Angostillo to 4.3 (positive
rating), while in El Faisán,Amapolas and Hidalgo had a similar
rating, about 3.8 and finally the colony Gómez had a score
of 3.7 (Figure 3). This indicates that rural areas have a more
grounded appreciation to the green areas, the many benefits
they can bring to the family and its economic importance.
4.7
4.6
4.5
4.4
4.3
4.2
4.1
4.0
3.9
3.8
3.7
3.6
3.5
3.4
Calificación: F(4;95)= 3,4705; p= 0,0108
Mean
Mean ± SE
Mean±1.645*SE
Gómez
La investigación de Domínguez y Domínguez (1998),
menciona que para la planeación de espacios verdes en las
áreas urbanas, no existen criterios definidos, ya que a veces
se omite estas áreas o son puramente estética y no interesa el
tipo de especies a utilizar, tampoco las técnicas empleadas
para el mantenimiento y cuidados posteriores. Esto hace que
los espacios verdes en la mayoría de los barrios conurbados
sean reducidos o nulos, debido a una falta de planeación
urbana y a la especulación que se hace con el suelo urbano.
Urbano
Hidalgo (%) (n)
Hidalgo
Tal como lo plantea Campillo (2005), las empresas dedicadas
a la construcción de casas habitación en serie, contemplan
áreas verdes muy rígidos, monótonos y con especies
introducidas y a veces caras. Esto puede atribuirse a lo
propuesto por Rionda (2008), quien afirma que la expansión
urbana cada vez es mayor, ya que las personas de las áreas
rurales se ven obligadas a emigrar a las zonas urbanas, para
tratar de incrementar su economía desplazando las áreas
verdes y aglomerándose en una zona urbana.
35 (7)
0
60 (12)
5 (1)
Faisán
70 (14)
0
25 (5)
5 (1)
Amapolas
Ornamentales
Medicinales
Medicinales y ornamentales
Otras (frutales)
Rural
Suburbano
Faisán (%) (n) Angostillo (%) (n) Amapolas (%) (n) Gómez (%) (n)
Angostillo
Preferencia
Zonas de estudio
Figura 3. Calificación sobre la percepción de los jardines entre
las zonas de estudio.
Figure 3. Rating on the perception of the gardens between the
study areas.
anterior indica que las zonas rurales tienen un aprecio más
arraigado a las áreas verdes, por los múltiples beneficios que
estos pueden aportar a la familia y su importancia económica.
Aparentemente este fenómeno tiende a disminuir a medida
que la urbanización avanza, ya que en las zonas urbanas se
tiene el conocimiento de la importancia de los espacios verdes
pero el aprecio es menor. El interés de las nuevas generaciones
se va menguando por la influencia de la urbanización; en el
caso de las zonas rurales que tiene un nivel socioeconómico
bajo, no se tiene un conocimiento conceptual del ambiente,
pero se tiene el conocimiento empírico o heredado, el cual
se sigue pasando a las nuevas generaciones.
Los estudios realizados por Alcalá et al., (2007), hacen
referencia a las zonas urbanas que carecen de interés hacia el
medio ambiente y que es necesario satisfacer a la población
de mayor información sobre el ambiente, incluyendo la
percepción del individuo acerca de su entorno en general y
del local. Lo que esta investigación reitera con la de Alcalá,
ya que se debe partir del conocimiento del individuo y de su
opinión e incitarlo a la conservación del uso y conocimiento
local encontrado en los jardines y huertos de las zonas.
CONCLUSIONES
Se puede concluir que el uso de plantas medicinales es
diferente para las zonas en estudio. En el caso de Angostillo
y Amapolas se encontró un mayor número de plantas
útiles que en los otros sitios. Esto puede ser por la relación
que tienen ambos sitios, el nivel socioeconómico, las
costumbres, el tipo de educación, la edad y la preferencia
por el tipo de plantas, pueden ser en respuesta a la cultura
y conocimiento local existente sobre plantas con potencial
medicinal. En contraste, con las zonas urbanas, suburbanas y
rurales tuvieron más especies medicinales, lo que implica un
mayor conocimiento local sobre uso y manejo de las plantas
medicinales y ornamentales.
La diferencia encontrada en el manejo de los jardines en
las tres zonas fue similar, ya que el único manejo que se
da al jardín es el riego y en algunos casos la fertilización.
La diversidad de plantas en las zonas de estudio varía
según el estatus económico de los entrevistados de cada
zona. Además, los jardines de las zonas urbanas tuvieron
una menor diversidad vegetal (medicinal y ornamental),
535
Apparently this phenomenon tends to decrease as the
urbanization proceeds, as in the urban areas they have
the knowledge of the importance of green space but the
appreciation is lower. The interest of new generations is
waning under the influence of urbanization; in the case of
the rural areas having a low socioeconomic status, there is
no conceptual knowledge of the environment, but there is
empirical or inherited knowledge, which is still passing on
for the new generations.
Alcalá et al. (2007), refers to urban areas that are not
relevant to the environment and the need to satisfy the
people for more information on the environment, including
the individual’s perception about their environment in
general and local terms. This is exactly what this research
proposes; to start with the knowledge of each person and
their opinion to encourage them to use and conserve the
local knowledge found in the gardens and orchards of
these areas.
CONCLUSIONS
It’s concluded that, the use of medicinal plants is quite
different for each of the areas under study. In the case
of Amapolas and Angostillo, a higher number of useful
plants were found. This may be because of the relationship
they both have, socioeconomic status, habits, type of
education, age and preference for the type of plants; it
may be in response to cultural and local knowledge on
the plants with medicinal potential. In contrast with the
urban, suburban and rural areas, these areas presented
even more medicinal species, which means a greater local
knowledge on the use and management of medicinal and
ornamental plants.
The difference found in the management of the gardens in
the three areas was quite similar, since the only operation
performed to the garden is the irrigation and fertilization,
in some cases. The diversity of plants in the study area
varies by the economic status of the respondents in
each area. Besides this, gardens in urban areas had a
lower diversity of plants (medicinal and ornamental),
compared with those in suburban and rural, accepting a
greater degree of urbanization and pressure of land-use,
which affects reducing the dedicated areas and species
diversity.
en comparación con los de la zona suburbana y rural,
aceptándose un mayor grado de urbanización y presión
del recurso suelo, que impacta en la reducción de las áreas
dedicadas y de la diversidad de especies.
El papel que juega el jardín en las zonas rurales o de
bajos recursos como algunas zonas suburbanas, es de ser
espacios de esparcimiento, socialización e intercambio de
ejemplares tanto ornamentales como medicinales así como
de intercambio de experiencias, por tanto son de importancia
para la sociedad que se desenvuelve en ellos.
Existe una percepción social diferente sobre la importancia
de los jardines en función del gradiente urbano, suburbano
y rural, siendo mayor calificación en la zona rural. En
los aspectos de percepción se encontró que las nuevas
generaciones de las zonas urbanas no muestran gran interés
en los jardines, esto puede ser por la falta de conocimiento.
Es por ello que los estudios de percepción pueden ayudar
a esclarecer las necesidades y saber el nivel de conciencia
que el sujeto tiene de su entorno y que tanto lo valora. Estos
estudios pueden ayudar a introducir espacios verdes en las
urbes de acuerdo a las necesidades del usuario.
AGRADECIMIENTOS
Se agradece al CONACYT por el apoyo de la beca
de Postgrado de la primera autora. Además, a la LPI4
(agronegocios, agroecoturismo y arquitectura del paisaje) por
el financiamiento de la presente investigación y al fideicomiso
del Colegio de Postgraduados en Ciencias Agrícolas.
LITERATURA CITADA
Alanís, F. J. G. 2005. El arbolado urbano en el área
metropolitana de Monterrey. UANL. Revista
Ciencia. 8(1):20-32.
Alcalá, J.; Soto, R.; Lebgue, T. y Sosa, M. 2007. Percepción
comunitaria de la flora y fauna urbana en el ciudad
de Chihuahua, México. Revista Latinoamericana
de Recursos Naturales. 3(1):58-64.
Benítez, G.; Pulido-Salas, M. T. y Equihua, M. 2004. Árboles
multiusos nativos de Veracruz para reforestación
restauración y plantaciones. CONAFOR-SIGOLFOINECOL. Xalapa, Veracruz, México. 420 p.
The role of the garden in the rural areas or low-income areas
like in some suburban areas is to become places of recreation,
socialization and exchange of ornamental and medicinal
samples as well as exchange of experiences, therefore its
importance for the society.
There is a different social perception on the importance of
gardens as a function of gradient on the urban, suburban and
rural areas, being the rural area with the highest grade. In the
aspects of perception is found that, new generations of urban
areas are not that interested in gardens, this may be due to
lack of knowledge. That is why perception studies may help
to clarify the needs and to know the level of consciousness
that the subject has on the environment and how much they
value it. These studies may help to bringing green spaces in
urban areas according to the users’ needs.
Benz, B. F.; Cevallos, J.; Santana, F.; Rosales, J. and Graff,
M. 2000. Losing knowledge about plant use in the
Sierra at the Manantlan Biosphere Reserve, Mexico.
J. Econ. Bot. 54:183-191.
Bermúdez, A.; Oliveira-Miranda, M. A. y Velázquez, D.
2005. Investigación etnobotánica sobre plantas
medicinales: Una revisión de sus objetivos y
enfoques actuales. Caracas. Revista de la Facultad
de Farmacia. 30(8):19.
Buendía, N. y Morán, M. 1996. Seguridad alimentaria y
participación de la mujer campesina en huertos
caseros. Estudio de caso en las comunidades de
Novara, Estado de Veracruz y San Miguel Tlaixpan,
Estado de México. Tesis Profesional. Universidad
Autónoma de Chapingo. Chapingo, Estado de
México. 86 p.
Campillo, F. 2005. Plantas autóctonas en jardinería. Revista
Agrícola Jardinería y Paisajismo. 15:18-21.
Cañadas, O. I. y Sánchez, B. A. 1998. Categorías de respuesta
en escalas tipo Likert. Revista Psicothema.
10(3):623-631.
Cárdenas, L. D. y Ramírez, A. J. G. 2004. Plantas útiles y
su incorporación a los sistemas productivos del
departamento de Guaviare. Revista Colombia
Amazónica. 26(1):95-110.
Chávez-García, E. 2009. Mujer y agroecosistemas: el papel
del género en el manejo del huerto familiar en una
comunidad del plan Chontalpa, Tabasco, México.
Revista Brasileira de Agroecología. 4(2):4038-4041.
Chávez, A. J. M. y Toledo, G. S. L. 2006. Estimación
de áreas verdes públicas en el municipio de
Guadalajara Pinar del Río Cuba. 4to Simposio
internacional sobre manejo sostenible de los
recursos forestales. 10 p.
Chávez-Servia, J. L.; Tuxil, J. y Jarvis, D. I. 2004. Manejo de
la diversidad de los cultivos en los agroecosistemas
tradicionales. Instituto Internacional de Recursos
Fitogenéticos. Cali, Colombia. 264 p.
Consejo Nacional de Población (CONAPO). 2000.
Tendencias recientes de la movilidad territorial
en algunas zonas metropolitanas de México. La
situación demográfica de México. 1:145-159.
Díaz, J. L. 2003. Las plantas mágicas y la conciencia
visionaria. Revista de Arqueología Mexicana.
10(59):18-25.
Didier, H. B. 2009. Las colecciones de las plantas
medicinales más importantes de América Latina.
Revista Ciencia. 6:26-47.
Domínguez, G. P. y Domínguez, G. A. 1998. Jardinería
ecológica: necesidades y criterios básicos. Ponencia
pública en actas del III congreso de la sociedad
española de agricultores ecológica. Editorial SEAEUV. Valencia. 1:121-128.
Estomba, D.; Ladio, A. H. and Lozada, M. 2006. Medicinal
wild plant knowledge and gathering patterns in a
Mapuche community of North-western Patagonia.
J. Ethnopharmacol. 103:109-119.
Eyssartier, C.; Ladio, A. H. y Lozada, M. 2009. Uso
de las plantas medicinales cultivadas en una
comunidad semirural de la estepa patagónica.
Boletín latinoamericano y del Caribe de plantas
medicinales y aromáticas. 8(2):77-85.
García, M. J. 2000. Etnobotánica maya. Origen y
evolución de los huertos familiares de la península
de Yucatán. Tesis Doctorado. Universidad de
Córdoba. 210 p.
Goddard, M. A.; Dougill, A. J. and Benton, T. G. 2009.
Scaling up from gardens: biodiversity conservation
in urban environments. J. Trends Ecol. Evol.
30(10):1-9.
Heyden, D. 1995. Jardines botánicos prehispánicos.
Coloquio cantos de mesoamérica. UNAM. México
7:18-23.
Instituto Nacional de Estadística y Geografía Informática
(INEGI). 2010. Perspectiva estadística Veracruz
de Ignacio de la Llave. 96 p. URL: http://www.
inegi.org.mx.
537
López, A.; Molina, P. y Rojas L. 2008. Influencia del género y
la percepción de la imagen corporal en las conductas
alimentarias de riesgo en adolescentes de Mérida.
Anales Venezolanos de Nutrición. 21(2):85-90.
Lozada, M.; Ladio, H. A. and Weigandt, M. 2006. Cultural
transmission of ethnobotanical knowledge in a rural
community of northwestern Patagonia. J. Econ. Bot.
60(4):374-385.
Martín-Crespo, B. C. y Salamanca, C. A. B. 2007. El
muestreo en la investigación cualitativa. Revista
Nure Investigación. 27:4 p.
Mendoza, C. G. 2002. Las farmacias vivientes. Difusión
Cultural UACH. México. 50 p.
Mera, O. L. M. y Bye, R. B. 2006. La dahlia una belleza
originaria de México. Revista Digital Universitaria
7(1):2-11. URL: http://www.revista.unam.mx/
vol.7/num11/art90/int90.htm.
Moreno, M. y Torres, M. 2002. El origen del jardín Mexica
de Chapultepec. Serie Historia de la Arqueología en
México VI. D. F., México. 10(57):41-48.
Ospina, B. E.; Sandoval, J. J.; Aristizábal, C. A. y
Ramírez, M. C. 2005. La escala de Likert en la
valoración de los conocimientos y las actitudes
de los profesionales de enfermería en el cuidado
de la salud. Antioquia. Revista Investigación y
Educación en Enfermería. 23(1):14-29.
Planchuelo, A. M.; Carreras, M. E. y Fuentes, E. 2003.
Las plantas nativas como recursos ornamentales:
Conceptos y generalidades. In: Mascarini, L.;
Vilella, F. y Wright, E. (eds.). Floricultura en
la Argentina. Investigación y tecnología de
producción. Editorial Facultad de Agronomía.
496 p.
Quesada, H. A. 2008. Las plantas medicinales. Revista
Biocenosis. 21(1-2):20-24.
Raja, D.; Blanche, C. and Vallés, J. 1997. Contribution to the
knowledge of the pharmaceutical ethnobotany of the
La Segarra region (Catalonia, Iberian Peninsula). J.
Ethnopharmacol. 57:149-160.
Rebolledo, D. S.; Santos, J. V. J.; Tapia, T. N. A. y Pérez,
O. C. P. 2008. Huertos familiares, una experiencia
en Chacah Ver. Quintana Roo. Revista Polibótica.
25:135-154.
Rente, N. J., Krishnamurthy, L. y Juhani, K. K. 1997.
Áreas verdes urbanas en América Latina:
una introducción. Áreas verdes urbanas en
Latinoamérica y el Caribe. Banco Interamericano
de Desarrollo. D. F., México, 6:1-13.
Rionda, R. J. 2008. Pensar la cuidad desde la óptica del
territorio. Revista Urbano. 11(17):76-82.
Rodríguez, S. M. C. 2002. Manejo de áreas verdes en
concepción: mejor calidad de vida urbana. Revista
Urbano. 5(6):41-42.
Rodríguez, N. L. y Alarcón, M. 2003. Para llamarse cuidad
áreas verdes y espacios de paz en las ciudades
presentes. Revista Austral de Ciencias Sociales.
7:129-138.
Salas, S. A. 2010. De la ciudad al campo: proceso de cambio
y apropiación del territorio rural en municipio de
México. Revista de Planteamiento Territorial y
Urbanismos Iberoamericana. 14:10-27.
Tabuti, J. R.; Lye, K. A. y Dhillion, S. 2003. Traditional
herbal drugs of Bulamogi, Uganda. Plants,
use and administration. J. Ethnopharmacol.
88:19-44.
Terrones, R.; Rosario, T. L.; González, S. C.; Ríos, R. S.
A. 2004. Arbustivas nativas de uso múltiple de
Guanajuato. INIFAP. Campo Experimental Bajío.
Celaya, Guanajuato, México. 216 p.
Terrones, R.; Rosario L. T., Hernández, M. M. A. y Ríos,
R. S. A. 2009. Educación ambiental en traspatios
agroforestales con arbustivas nativas: espacios para
amortiguar la desertificación. INIFAP-CIRCE.
Campo Experimental Bajío.10 p.
Tlahuextl, T. C.; Ávila, S. J. M. y Leszczyñska, B. H. 2005.
Flores de corte y follaje en florerías y mercados de
puebla México. Revista Chapingo. Serie Ciencias
Forestales y del Medio Ambiente. 11(2):323-237.
Todorova, A.; Asakawa, S. and Aikoh, T. 2004. Preferences
for and attitudes towards street flowers and trees
in Sapporo, Japan. J. Landscape Urban Planning.
69:403-416.
PROPAGACIÓN in vitro DE Laelia halbingeriana*
In vitro PROPAGATION OF Laelia halbingeriana
Yurixhi Atenea Raya-Montaño1§, Guillermo Carrillo-Castañeda1, Martha Elena Pedraza-Santos2, Tarsicio Corona-Torres1, José
Alfredo Carrillo-Salazar1 y Gabriel Alcantar-González3
Genética. Colegio de Posgraduados. Carretera México-Texcoco, km 36.5. Montecillo, Texcoco, Estado de México. C. P. 56230. Tel. 01 452 5233858 y 01 595 9520200.
Ext. 1541, 1569 y 1593. ([email protected]), ([email protected]), ([email protected]). 2Facultad de Agrobiología “Presidente Juárez”. UMSNH. Paseo Lázaro
Cárdenas esquina con Berlín, Uruapan, Michoacán. C. P. 60080. Tel. 01 452 5236474. ([email protected]). 3Edafologia. Colegio de Posgraduados. Carretera
México-Texcoco, km 36.5. Montecillo, Texcoco, Estado de México. C. P. 56230. Tel. 01 595 9520200. Ext. 1188. §Autora para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
Laelia halbingeriana (Orchidaceae) es una planta epífita
endémica de la cañada de Oaxaca, amenazada por la
reducción de su hábitat debido a deforestación, cambios de
uso de suelo, extracción ilegal de plantas. Se desarrolló una
metodología en el Colegio de Postgraduados en Ciencias
Agrícolas en 2010, para su propagación in vitro como
estrategia de conservación usando el medio Murashige
Skoog (MS) suplementado con 6-benciladenina (BA)
(0, 2.22 y 4.43 µM L-1) y 3-ácido naftalenacético (ANA)
(0, 2.6, 5.2 y 10.4 µM L-1). Con estos medios fueron
cultivadas plántulas de 2.5 cm con tres concentraciones de
sacarosa (58.43, 87.64 y 116.85 mM L-1) y cinco de sales
minerales del medio MS (50, 75, 100, 125 y 150%). Para
el enraizamiento, las plántulas fueron cultivadas en medio
MS suplementado con cinco concentraciones de ANA (0,
2.6, 7.8, 10.4 y 13 µM L-1) y cinco de ácido 3-indolbutirico
(AIB) (0, 4.92, 7.38, 9.84 y 12.3 µM L-1). Se utilizó el diseño
experimental completamente al azar con arreglo factorial
y diez repeticiones. En la multiplicación, el BA (2.22 µM
L-1) incrementó el número promedio de hojas por planta
(3.93), mientras que la mayor longitud (1.11 cm) se logró
al adicionar ANA (5.2 µM L-1). La concentración de azúcar
y las sales minerales no influyeron en la organogénesis in
vitro de L. halbingeriana. El enraizamiento presento mayor
Laelia halbingeriana (Orchidaceae) is an epiphytic plant,
endemic from Oaxaca’s glen, threatened by its habitat
shrinking due to deforestation, land-use changes and,
illegal plant extraction. A methodology was developed in
the Graduated College in Agricultural Sciences in 2010,
for its in vitro propagation as a conservation strategy
using Murashige and Skoog medium (MS) supplemented
with 6-benzyladenine (BA) (0, 2.22 and 4.43 µM L-1)
and 3-naphthaleneacetic acid (NAA) (0, 2.6, 5.2 and
10.4 µM L -1). With these media, seedlings of 2.5 cm
with three concentrations of sucrose were grown (58.43,
87.64 and 116.85 µM L-1) and five mineral salts of MS
medium (50, 75, 100, 125 and 150%). For rooting, the
seedlings were grown on MS medium supplemented with
five concentrations of NAA (0, 2.6, 7.8, 10.4 and 13 µM
L-1) and five 3-indole butyric acid (IBA) (0, 4.92, 7.38,
9.84 and 12.3 µM L-1). A completely randomized design
with factorial arrangement and ten repetitions was used.
In the multiplication, BA (2.22 µM L -1) increased the
average number of leaves per plant (3.93), while the
longest (1.11 cm) was achieved by adding NAA (5.2
µM L-1). The sugar and mineral salts concentration did
not influenced the in vitro organogenesis of L.
halbingeriana. Rooting showed higher number of roots
* Recibido: abril de 2011
Yarixhi Atenea Raya-Montaño et al.
número de raíces por planta (2.62), se obtuvo reduciendo
las sales minerales a 75%, la adición de 7.8 µM L-1 de ANA
incrementó el número de raíces (2.86).
per plant (2.62), obtained by reducing 75% of mineral
salts, the addition of 7.8 µM L-1 of NAA increased the
number of roots (2.86).
Palabras clave: Orchidaceae, fitoreguladores, sales
minerales.
Key words: Orchidaceae, mineral salts, phytoregulators.
INTRODUCCIÓN
Laelia halbingeriana es una planta epifita endémica de la
cañada de Oaxaca, en la reserva de la biosfera TehuacánCuicatlán, amenazada por la reducción de su hábitat debido
a factores como la deforestación, cambios de uso del suelo
y extracción ilegal de plantas (Hángsater et al., 2005) que
aumenta el riesgo de la desaparición. Existen muy pocos
estudios acerca de su reproducción. En este tipo de plantas,
la reproducción sexual de forma natural es limitada, debido
a la naturaleza de la semilla (tamaño pequeño con poca
o nula materia de reserva), por lo que la germinación así
como los estados de desarrollo subsecuentes dependen de la
relación simbiótica con un hongo micorrízico (Rhizoctonia
solani) (Suárez et al., 2006; Otero et al., 2007; Mosquera
et al., 2010). Porras-Alfaro y Bayman et al. (2007) señalan
que cada especie tiene una especificidad por el hongo
micorrizico.
La germinación de semillas in vitro es una alternativa de
reproducción viable, pues es posible sustituir la acción de
los hongos micorrízicos con el medio de cultivo (Gil et al.,
2007; Otero y Bayman, 2009). Mediante este método se
logra incrementar la variabilidad genética de la especie.
Para la propagación de orquídeas, se han estudiado los
medios de cultivo mínimos, la constitución de reguladores
de crecimiento así como la acción benéfica de la peptona
y el carbón activo entre otros aditivos (Ouyang et al.,
2006); sin embargo, la respuesta morfogénica de los tejidos
dependen del tipo y concentración de los reguladores de
crecimiento.
Para la propagación de orquídeas se han empleado
citocininas naturales 2-isopenteniladenina (2iP), zeatina,
citocininas sintéticas N6-benciladenina (BA) y la cinetina
(6-furfuril-aminopurina), en concentraciones de 0.01 a 10
mg L-1; donde esta última es la menos eficiente de las cuatro.
También se ha postulado que la concentración de sales
minerales y de sacarosa, son factores determinantes en el
proceso de organogénesis in vitro de estas plantas (Sorace
INTRODUCTION
Laelia halbingeriana (Orchidaceae) is an epiphytic plant,
endemic from Oaxaca’s glen, in the Tehuacán-Cuicatlán
Biosphere Reserve threatened by its habitat shrinking due
to factors such as deforestation, land-use changes and illegal
extraction of plants (Hángsater et al., 2005) that increases
the risk of extinction. There are very few studies on its
reproduction. In this type of plant, sexual reproduction is
naturally limited due to the seed’s nature (small size with
little or no reserve material), so that, the germination and
subsequent development stages depend on a symbiotic ratio
with a mycorrhizal fungi (Rhizoctonia solani) (Suárez et al.,
2006; Otero et al., 2007; Mosquera et al., 2010). PorrasAlfaro and Bayman et al. (2007) noted that each species has
a mycorrhizal fungus specificity.
In vitro seed germination is a viable alternative for
reproduction, since it’s possible to replace the action of the
mycorrhizal fungi in a culture medium (Gil et al., 2007;
Otero and Bayman, 2009). By using this method, an increase
in the genetic variability of the species is achieved. For the
propagation of orchids, the minimal growth media have been
studied, the formation of growth regulators as well as the
beneficial action of the peptone and, the activated carbon
among other additives (Ouyang et al., 2006); however,
the tissues’ morphogenic response depend on the type and
concentration of the growth regulators.
For the propagation of orchids, natural cytokinins have
been used, 2-isopenteniadenine (2iP), zeatin, synthetic
cytokinins, N6-benzyladenine (BA) and kinetin (6-furfurylaminopurine) in concentrations of 0.01 to 10 mg L-1; where
the latter is the least efficient of them all. It has also been
postulated that, the concentration of mineral salts and
sucrose are determining factors in the in vitro process of
organogenesis of these plants (Sorace et al., 2008). The
largest number of seedlings in vitro of L. speciosa was
accomplished by Sarabia et al. (2010), by adding to the
culture medium NAA (0.5 mg L-1) and gibberellic acid (GA3)
(0.1 mg L-1) obtaining 70% survival.
Propagación in vitro de Laelia halbingeriana
et al., 2008). La mayor formación de plántulas in vitro de L.
speciosa fue lograda por Sarabia et al. (2010), al adicionar al
medio de cultivo ANA (0.5 mg L-1) y ácido giberélico (AG3)
(0.1 mg L-1) quienes obtuvieron 70% de supervivencia al
ser aclimatadas.
Aunque ya se han establecido metodologías para la
propagación in vitro de orquídea de diferentes géneros,
existen pocos estudios en L. halbingeriana, por lo que es
factible modificar las condiciones conocidas, para mejorar
los resultados de la micropropagación como una estrategia
inicial, para asegurar posteriormente la conservación en
su ambiente natural. Basados en lo expuesto previamente,
el objetivo de la presente investigación fue establecer un
método práctico y competitivo para propagar in vitro L.
halbingeriana.
Multiplicación de plántulas
Plántulas de L. halbingeriana cultivadas in vitro fueron
proporcionadas por el Dr. Raymundo Enríquez del Valle,
provenientes del laboratorio de cultivo de tejidos del Instituto
Tecnológico Agropecuario de Oaxaca (ITAO).
Medios de cultivo
El medio de cultivo de Murashige y Skoog (1962) fue
utilizado como base de los medios preparados; todos los
medios de cultivo contenían 2.96 μM de tiamina, 5.55
μM de mio-inositol, 6 g L-1 de agar (Merck®) y el pH fue
ajustado a 5.7 ±0.1 antes de agregar el agar. El medio se
esterilizó a 121 ºC (1.05 kg cm-2) durante 17 min. Todas
las cantidades expresadas en la composición de los medios
están dadas por litro de medio, a menos que otra cosa sea
indicada.
Las plántulas fueron originalmente cultivadas en una serie
de 12 medios (Cuadro 1), para determinar la condición más
favorable en la multiplicación del número de plantas. Todos
los cultivos fueron conservados durante 60 días en un cuarto
de incubación a 25 ±2 ºC, 16 h de fotoperiodo con intensidad
lumínica de 76 μmol m-2 s-1 producida por lámparas de luz
blanca fría fluorescente. Se determinó el desarrollo de las
plántulas durante un periodo de 60 días.
541
Even though, methodologies for in vitro propagation of
orchids on different genera have been established, there are
only a few studies on L. halbingeriana, making it feasible to
modify the known conditions in order to improve the results
of micropropagation as an initial strategy to ensure further
conservation in the wild. Based on these, the objective of
this research was to establish a practical and competitive in
vitro propagation of L. halbingeriana.
Seedlings propagation
The L. halbingeriana seedlings cultured in vitro were
provided by Dr. Raymundo Enríquez del Valle, from the
tissue culture laboratory of the Agricultural Technological
Institute of Oaxaca (ITAO).
Culture media
The culture medium of Murashige and Skoog (1962) was
used as the groudnwork for the prepared media; all the
culture media contained 2.96 µM of thiamine, 5.55 µM of
myo-inositol, 6 g L-1 agar (Merck®), and pH was adjusted at
5.7 ±0.1 before adding the agar. The medium was sterilized
at 121°C (1.05 kg cm-2) for 17 min. All quantities expressed
in the media composition are given per liter of medium,
unless otherwise noted.
The seedlings were first grown in a series of 12 media
(Table 1), in order to determine the most favorable
condition in the multiplication on the number of plants.
All cultures were maintained for 60 days in an incubation
room at 25 ±2 °C, 16 h photoperiod with light intensity of
76 µmol m-2 s-1 produced by fluorescent cold white lighted
lamps. The seedlings’ development over a period of 60
days was determined.
In order to evaluate the effect on the concentration of mineral
salts and sucrose in the in vitro seedlings’ development of L.
halbingeriana, new explants were selected bout 2.5 cm in
length and subjected to 15 treatments conformed by three
concentrations of sucrose (58.43, 87.64 and 116.85 mM),
combined with five concentrations of the total mineral salts
of MS medium (50, 75, 100, 125 and 150%) as indicated
in Table 2.
Cuadro 1. Composición química de los medios de cultivo, estos contenían concentración de sales minerales del medio
Murashige y Skoog (MS) al 100% y 87.64 mM de sacarosa.
Table 1. Chemical composition of the culture media, containing concentrations of mineral salts from Murashige and Skoog
medium (MS) at 100% and 87.64 mM sucrose.
Medio MS
1
2
3
4
5
6
BA (µM)
0
0
0
0
2.22
2.22
ANA (µM)
0
2.6
5.2
10.4
0
2.6
Para evaluar el efecto de la concentración de sales minerales
y sacarosa en el desarrollo de las plántulas in vitro de L.
halbingeriana, fueron seleccionados nuevos explantes de
aproximadamente 2.5 cm de longitud y se sometieron a
15 tratamientos conformados por tres concentraciones de
sacarosa (58.43, 87.64 y 116.85 mM), combinadas con cinco
concentraciones de las sales minerales totales del medio MS
(50, 75, 100, 125 y 150%) como se indica en el Cuadro 2.
Medio MS
7
8
9
10
11
12
BA (µM)
2.22
2.22
4.43
4.43
4.43
4.43
ANA (µM)
5.2
10.4
0
2.6
5.2
10.4
In the third trial, vigorous shoots approximately 3 cm
length were selected for cultivation in a series of 25 media,
containing 87.64 mM of sucrose. In this case, the combination
of NAA was evaluated (0, 5.2, 7.8, 10.4 and 12.3 µM) with
IBA (0, 4.94, 7.38, 9.84 and 12.3 µM) to induce the in
vitro rooting of the seedlings (Table 3). For each bottle of
100 ml capacity, 25 mL of culture medium was added, 10
explants were planted to produce a total of 30 explants per
Cuadro 2. Composición química de los medios de cultivo, estos contenían 2.22 µM de BA y 5.2 µM de ANA, más 100% del
medio Murashige y Skoog (MS) y las cantidades de sacarosa indicadas.
Table 2. Chemical composition of the culture media, containing 2.22 µM of BA and 5.2 µM of NAA, plus 100% of Murashige
and Skoog medium (MS) and the indicated amounts of sucrose.
Medio MS Concentración de sales (%) Sacarosa (mM) Medio MS
13
50
58.43
21
14
75
58.43
22
15
100
58.43
23
16
125
58.43
23
17
150
58.43
25
18
50
87.64
26
19
75
87.64
27
20
100
87.64
En el tercer ensayo, brotes vigorosos de aproximadamente 3
cm de longitud, se seleccionaron para cultivarlos en una serie
de 25 medios que contenían 87.64 mM de sacarosa. En este
caso fue evaluada la combinación de ANA (0, 5.2, 7.8, 10.4
y 12.3 µM) con AIB (0, 4.94, 7.38, 9.84 y 12.3 µM), para
inducir el enraizamiento in vitro de las plántulas (Cuadro
3). A cada frasco de 100 ml de capacidad sé adicionaron 25
mL de medio de cultivo, fueron sembrados 10 explantes
para generar un total de 30 explantes por tratamiento.
Los explantes se mantuvieron por 60 días en el cuarto de
incubación a 25 ±2 ºC, 16 h de fotoperiodo con intensidad
lumínica de 76 μmol m-2 s-1, producida por lámparas de luz
Concentración de sales (%)
125
150
50
75
100
125
150
Sacarosa (mM)
87.64
87.64
116.85
116.85
116.85
116.85
116.85
treatment. The explants were maintained for 60 days in the
incubation room at 25 ±2 °C, 16 h photoperiod with light
intensity of 76 µmol m-2 s-1, produced by fluorescent cold
white lighted lamps. The experimental design was completely
randomized with a factorial arrangement of 3∗4, 5∗3 and 5∗5
in the first, second and third experiment, respectively.
Evaluated variables and statistical analysis
The evaluated variables for all the cases were: number
and length of leaves, seedling height, root number, root
length. Using these information, an analysis of variance
543
blanca fría fluorescente. El diseño experimental utilizado fue
completamente al azar con arreglo factorial 3∗4, 5∗3 y 55 en
el primero segundo y tercer experimento, respectivamente.
and a comparison of means test, Tukey p≤ 0.05 using the
statistical package SAS version 9.1 (SAS, 2003) were
conducted.
Cuadro 3. Composición de medios que contenían 100% de sales minerales (Murashige y Skoog) MS y 87.64 mM de sacarosa.
Los medios contenían las cantidades de ANA y AIB indicadas.
Table 3. Media composition containing 100% of mineral salts (Murashige and Skoog) MS and 87.64 µM sucrose. The media
contained the indicated amounts of NAA and IBA.
Medio MS
28
29
30
31
32
33
34
35
36
37
38
39
40
ANA (µM)
0
0
0
0
0
5.2
5.2
5.2
5.2
5.2
7.8
7.8
7.8
AIB (µM)
0
4.94
7.38
9.84
12.3
0
4.94
7.38
9.84
12.3
0
4.94
7.38
Variables evaluadas y análisis estadístico
Las variables evaluadas en todos los casos fueron: número
y longitud de hojas, altura de plántula, número de raíces,
longitud de raíces. Con los datos obtenidos se hizo un análisis
de varianza y se llevó a cabo una prueba de comparación de
medias Tukey a una p≤ 0.05 con el paquete estadístico SAS
versión 9.1 (SAS, 2003).
Efecto del tipo y concentración de fitohormonas en
la etapa de multiplicación in vitro de plántulas de L.
halbingeriana
Se observaron diferencias estadísticas significativas en la
respuesta de las plantas, respecto a los tratamientos. Con la
adición de 2.22 µM de BA se obtuvieron hasta 3.93 hojas en
promedio, mientras que al duplicar dicha concentración, la
formación de hojas se redujo 13% (Figura 1A). El número
de hojas no se vio afectado por la presencia de ANA en
el medio de cultivo (Figura 1B). En cuanto a la longitud
Medio MS
41
42
43
44
45
46
47
48
49
50
51
52
ANA (µM)
7.8
7.8
10.4
10.4
10.4
10.4
10.4
13
13
13
13
13
AIB (µM)
9.84
12.3
0
4.94
7.38
9.84
12.3
0
4.94
7.38
9.84
12.3
Type and concentration of phytohormones effect at
the in vitro multiplication stage of L. Halbingeriana’s
seedlings.
There were statistically significant differences in the
response of the plants with respect to the treatments. With
the addition of 2.22 µM of IBA, 3.93 leaves were obtained
on average, while doubling the concentration, the leaves
formation was reduced at 13% (Figure 1A). The number
of leaves was not affected by the presence of NAA in the
culture medium (Figure 1B). As for the length of the leaves,
it was found that, with the addition of IBA there were no
differences between treatments for this variable (Figure 1C).
In the hybrid Brassocattleya ‘Pastoral’ x Laeliocattleya’
Amber Glow’ Araujo et al. (2006), found in this species
that the addition of low concentrations of IBA increased
the number of shoots.
These results agree with those reported by Sarabia et al.
(2010), who, with the addition of IBA obtained the greatest
callus formation, and the best quality of it in L. speciosa;
de las hojas se encontró, que con la adición de BA no se
observaron diferencias entre los tratamientos para esta
variable (Figura 1C). En el hibrido de Brassocattleya
‘Pastoral’ x Laeliocattleya ‘Amber Glow’ Araujo et al.
(2006), encontraron en esta especie que la adición de bajas
concentraciones de BA incrementaron el número de brotes.
A
3.9
Número de hojas
a
BA
3.8
3.7
ab
3.6
3.5
b
3.4
3.3
Longitud de hojas (cm)
1.6
1.4
1.2
0
C
2.22
µM L-1
BA
a
a
4.43
DMS= 0.34
1
0.6
0.4
0.2
0
2.22
µM L-1
4.43
DMS= 0.11
B
1.6
a
0.8
0
3.85
3.8
3.75
3.7
3.65
3.6
3.55
3.5
3.45
3.4
3.35
1.4
3.2
Número de hojas
4
however, it was possible to stimulate the length of the leaves
by using NAA in the culture medium, considering that
with 5.2 µM L-1 of NAA, the leaves length was increased
to 1.45 cm and, by reducing its concentration to 2.6 µM
L-1, the length was reduced at 31% (Figure 1D). These data
contrasted with those reported by Coello et al. (2010), who
1.2
1
0.8
ANA
a
a
a
a
0
2.6
D
µM L-1
5.2
10.4
DMS= 0.43
a
ANA
b
b
c
0.6
0.4
0.2
0
0
2.6
µM L-1
5.2
10.4
DMS= 0.14
Figura 1. Efecto de la concentración de BA (A y C) y concentración de ANA (B y D), en el número y longitud de las hojas formadas
in vitro de L. halbingeriana en un periodo de 60 días.
Figure 1. BA (A and C) and NAA (B and D) concentration effect on the number and length of the leaves formed in vitro of L.
halbingeriana over a period of 60 days.
Estos resultados coinciden con los encontrados por Sarabia
et al. (2010), quienes con la adición de BA obtuvieron la
mayor formación de callo, así como la mejor calidad del
mismo en L. speciosa; sin embargo, se logró estimular la
longitud de hojas al utilizar ANA en el medio de cultivo,
pues con 5.2 µM L-1 de ANA se incrementó la longitud de
las hojas hasta 1.45 cm y al reducir su concentración a 2.6
µM L-1 la longitud se redujo 31% (Figura 1D). Estos datos
contrastan con los registrados por Coello et al. (2010),
quienes en Guarianthe skinneri (Bateman) Dressier & W.
E. Higgins, obtuvieron el mayor número de brotes (10.6) al
utilizar concentraciones de 16.1 y 0,0023 μM de BA. En el
estudio realizado por Suárez et al. (2007), encontraron que
la adición de BA tiene mayor influencia que el ANA en la
propagación in vitro de Euchile mariae.
in Guarianthe skinneri (Bateman) Dressler & W. E. Higgins,
obtained the highest number of shoots (10.6) when using
concentrations of 16.1 and 0.0023 µM of IBA. In the study
by Suárez et al. (2007), it was found that, the addition of IBA
had more influence than NAA for the in vitro propagation
of Euchile mariae.
The absence of IBA in the culture medium negatively
influenced the growth of the seedlings grown in vitro,
growing only 1.96 cm (Figure 2A); however, by adding 4.43
µM L-1 of IBA, the plant height got increased (2.19 cm). A
similar response was found when adding NAA to the culture
medium, since with 5.2 µM L-1, the highest explant height
(2.24 cm) was obtained, and when reduced at 2.6 µM L-1,
the height of the seedlings decreased on average (1.97 cm),
545
La ausencia de BA en el medio de cultivo influyó
negativamente en el crecimiento de las plántulas desarrolladas
in vitro, ya que sólo alcanzaron 1.96 cm de altura (Figura 2 A);
sin embargo, al adicionar 4.43 µM L-1 de BA, se incrementó
la altura de planta (2.19 cm). Se encontró una respuesta
similar al adicionar ANA al medio de cultivo, ya que a 5.2
µM L-1 se obtuvo la mayor altura por explante (2.24 cm), y
cuando se redujo hasta 2.6 µM L-1, la altura de las plántulas
disminuyó en promedio (1.97 cm), además se observó que
tanto la ausencia de ANA en el medio como la concentración
de 10.4 µM L-1, presentaron el mismo efecto inhibitorio en
la altura promedio de las plántulas.
Altura de planta (cm)
2.2
2.15
2.1
A
BA
2.3
a
a
2.05
2
1.95
Rhizogenesis process was also affected by the two types
of phytohormones used (Figure 3). The presence of IBA
influenced the number of roots, and by adding 2.22 and
4.43 µM L-1 was obtained on average, 1.82 roots not
statistically different from controls without IBA, in which
only 1.55 roots on average were obtained per seedling.
Regarding the average length of the seedlings, the addition
2.25
2.25
it was also observed that, for both, the absence of NAA in
the medium as well as the concentration of 10.4 µM L-1,
showed the same inhibitory effect on the average height of
the seedlings.
b
2.1
5
1.9
4.43
DMS= 0.14
1.85
ab
2.05
1.95
2.22
µM L-1
a
2.2
1.9
0
ANA
2.15
1.85
1.8
B
ab
b
0
2.6
5.2
µM L-1
10.4
DMS= 0.18
Figura 2. Efecto de la concentración de BA (A) y ANA (B) en la altura de plantas formadas in vitro de L. halbingeriana en un
periodo de 60 días.
Figure 2. IBA (A) and NAA (B) concentration effect on L. halbingerianaʼs height of in vitro formed plants over a period of 60 days.
El proceso de rizogénesis también fue afectado por los dos
tipos de fitohormonas utilizadas (Figura 3). La presencia
de BA influyó en el número de raíces ya que al adicionar
2.22 y 4.43 µM L-1 se obtuvieron 1.82 raíces en promedio
sin ser estadísticamente diferente al testigo sin BA en el
cual únicamente se obtuvieron 1.55 raíces en promedio por
plántula. En cuanto a la longitud promedio de las plántulas,
la adición de 4.43 µM L-1 de BA numéricamente fue mejor
al obtener una longitud de 1.14 cm sin ser estadísticamente
diferentes a las plantas de los otros tratamientos utilizados.
Con el regulador de crecimiento ANA la respuesta de
las plántulas fue negativa, ya que al no adicionar esta
fitohormona el número de raíces fue mayor (1.89) y al
adicionar 10.4 µM L-1 se inhibe la formación en 20%; la
longitud de raíces tuvo un efecto similar al encontrarse que
numéricamente es mejor en ausencia de ANA en el medio
(1.12 cm), mientras que la adición de 10.4 µM L-1 sólo se
obtuvo un incremento promedio de 1.02 cm.
of 4.43 µM L-1 BA was numerically better to get a length
of 1.14 cm, not being statistically different from the plants
from the other treatments.
With NAA, the seedling’s response was negative, because
when this phytohormone was not added, the number of roots
was higher (1.89) and by adding 10.4 µM L-1, the formation is
inhibited by 20% on the roots length, an effect quite similar
to that found numerically better in the absence of NAA in
the middle (1.12 cm), while the addition of 10.4 µM L-1 only
produced an average increase of 1.02 cm.
Sucrose and mineral salts concentration on L.
halbingeriana propagation
Sucrose concentration did not affect the in vitro
organogenesis of L. halbingeriana (Table 4). However,
the concentration of 87.64 µM L-1 did favored its growth,
due to the osmotic potential generated by this quantity of
1.85
A
2
1.8
1.6
a
1.75
Número de raíces
Número de raíces
1.8
a
BA
1.7
1.65
1.6
a
1.55
1.5
1.45
C
2.22
µM L-1
1
BA
ANA
a
0.8
0.6
0.4
1.14
a
0
a
a
2.6
µM L-1
5.2
10.4
DMS= 0.43
D
a
1.12
ANA
1.1
1.08
1.06
1.02
a
a
1.04
a
1
0.95
0.9
a
1.4
1.2
1
0
4.43
DMS= 0.33
0
1.1
1.05
a
a 0.2
1.4
1.15
B
0.98
0
2.22
µM L-1
4.43
DMS= 0.20
0.96
0
2.6
µM L-1
5.2
10.4
DMS= 0.27
Figura 3. Efecto de la concentración de BA (A y C) y de ANA (B y D) sobre el número y longitud de las raíces formadas in vitro
de L. halbingeriana a 60 días de incubación.
Figure 3. IBA (A) and NAA (B) concentration effect on in vitro L. Halbingeriana’s roots number and length at 60 days of incubation.
Efecto de la concentración de sacarosa y sales
minerales en la propagación de plántulas de L.
halbingeriana
La concentración de sacarosa no afectó la organogénesis
in vitro de L. halbingeriana (Cuadro 4). Sin embargo, la
concentración de 87.64 mM L-1 favoreció su crecimiento,
debido que el potencial osmótico que generó esta
cantidad de sacarosa permitió a la plántula absorber
agua y nutrientes. En cambio, el adicionar 116.85
mM L -1 de sacarosa al medio de cultivo, disminuyó
considerablemente el potencial osmótico, lo que dificulta
la absorción de agua y nutrientes hacia el interior de
las plántulas, por lo que el crecimiento de las hojas fue
limitado.
sucrose enabled the seedling to absorb water and nutrients.
In contrast, the addition of 116.85 µM L-1 on sucrose medium
significantly decreased the osmotic potential, hindering the
absorption of water and nutrients into the seedlings, so the
leaf growth was too limited.
The concentration of mineral salts in the medium did not
affect the number and length of the leaves, which contrasts
with that obtained by Romero et al. (2007), who pointed
out that, using mineral salts at 50 and 100% concentration,
a greater number of seedlings grown in vitro of L. anceps
would be obtained. Rhizogenesis process was affected
by the concentration of mineral salts, as both the high
concentrations as low concentrations of inorganic salts (150
and 50%) decreased the formation of roots (1.65) on average;
547
Cuadro 4. Efecto de la concentración de sacarosa sobre la organogénesis in vitro de Laelia halbingeriana a 60 días de
incubación.
Table 4. Sucrose concentration effect on in vitro organogenesis of Laelia halbingeriana at 60 days of incubation.
Sacarosa
(mM L-1)
Número de hojas
Longitud de
hojas (cm)
Número de
raíces
Longitud de
raíces (cm)
Longitud del
explante (cm)
58.43
87.64
116.85
DMS
3.59 az
3.77 a
3.69 a
0.24
0.98 b
1.07 a
1.00 ab
0.07
1.95 a
1.91 a
2.11 a
0.57
0.78 a
0.82 a
0.80 a
0.23
0.82 a
0.88 a
0.87 a
0.07
= medias con la misma letra en cada columna son iguales estadísticamente a p≤ 0.05 prueba de tukey.
Z
La concentración de sales minerales en el medio no afectó el
número y la longitud de hojas, resultados que contrastan con
los obtenidos por Romero et al. (2007), quienes señalan que
al utilizar sales minerales a 50 y 100% de su concentración,
se obtiene una mayor cantidad de plántulas desarrolladas in
vitro de L. anceps. El proceso de rizogénesis fue afectado por
la concentración de las sales minerales, ya que tanto las altas
concentraciones como las bajas concentraciones de sales
minerales (150 y 50%), disminuyen la formación de raíces
(1.65) en promedio; mientras que una concentración de 75%
promueve su formación (2.62) raíces por planta en promedio.
Sin embargo, la concentración de sales minerales no afectó el
crecimiento de las raíces (Cuadro 5). Estos datos contrastan con
los obtenidos por Romero et al. (2007), quienes determinaron
que en los medios MS al 50% y al 100% no existen diferencias
en el enraizamiento de L. anceps subsp. Anceps.
while a 75% concentration did promote its growth, (2.62)
on average per plant roots. However, the concentration of
mineral salts did not affect the growth of the roots (Table
5). These data contrast with those obtained by Romero et
al. (2007), who found that in MS media at 50% and 100%
there is no difference in the rooting of L. anceps subsp.
Anceps.
Differences were observed in the average leafʼs formation,
due to the interaction between sucrose concentrations
and mineral salts contained in the culture medium. The
Figure 4A shows that the medium with 150% mineral
salts, and 116.85 µM L-1 sucrose, favored the formation
of leaves per plant (4.03), while decreasing the percentage
of mineral salts at 50% concentration, with the same
amount of sucrose was observed a decrease in the average
Cuadro 5. Efecto de la concentración de sales minerales MS sobre la organogénesis in vitro de L. halbingeriana a 60 días
de incubación.
Table 5. MS mineral salts concentration effect on the organogenesis in vitro of L. halbingeriana at 60 days of incubation.
Sales minerales
(%)
150
125
100
75
50
DMS
Número de
hojas
3.82 a
3.7 a
3.85 a
3.52 a
3.56 a
0.36
Longitud de
hojas (cm)
1.03 a
0.98 a
1.06 a
0.99 a
1.04 a
0.1
Número de
raíces
1.68 b
1.78 ab
2.15 ab
2.62 a
1.65 b
0.85
= medias con la misma literal en cada columna son iguales estadísticamente a p≤ 0.05 prueba de tukey.
Z
Se observaron diferencias en el promedio de formación de
hojas, por efecto de la interacción entre concentraciones
de sacarosa y sales minerales contenidas en el medio de
cultivo. En la Figura 4A se muestra que el medio con 150%
de sales minerales y 116.85 mM L-1 de sacarosa, favoreció
Longitud de
raíces (cm)
0.85 a
0.83 a
0.87 a
0.74 a
0.66 a
0.34
Longitud del
explante (cm)
0.88 a
0.89 a
0.9 a
0.83 a
0.79 a
0.1
yield of leaves per seedling to 3.13. These data contrasts
with the results by Sorace et al. (2008), who pointed out that
adding 116.85 µM L-1 sucrose and 50% of the concentration
of mineral salts in MS medium, the further development of
Oncidium baueri’s seedlings would be obtained.
la formación de hojas por planta (4.03); mientras que
al disminuir el porcentaje de sales minerales a 50% de
concentración, con la misma cantidad de sacarosa, se
observó una disminución del promedio de producción
de hojas por plántula a 3.13. Estos datos contrastan con
los resultados obtenidos por Sorace et al. (2008), quienes
señalan que al adicionar 116.85 mM L-1 de sacarosa y 50%
de la concentración de sales minerales en el medio MS,
se obtiene mayor desarrollo de plántulas de Oncidium
baueri.
4.5
The rhizogenesis process in L.halbingeriana was
unaffected by the combination of mineral salts and sucrose
in the culture medium; Moreno and Menchaca (2007)
A
a
ab ab
ab ab ab
ab
ab
ab
ab
ab
b
4
3.5
Número de hojas
The treatment containing 50% mineral salts and 87.64 µM L-1
sucrose did favored the length of the leaves (1.12 cm); while 58.43
µM L-1 sucrose and 75% mineral salts decreased the length of the
leaves (0.84 cm) (Figure 4B). These results agreed with those
of Tirado et al. (2005), who by adding 58.43 µM L-1 of sucrose
led to increasing the leaf’s growth in Phalaenopsis hybrids.
3
ab
ab
b
Sacarosa
58.43 mM L-1
87.64 mM L-1
116.85 mM L-1
2.5
2
1.5
1
0.5
0
1.2
150
B
ab ab ab
1
ab ab ab
ab
0.8
a
ab ab
ab
50
DMS= 0.77
ab a
ab
b
Sacarosa
58.43 mM L-1
87.64 mM L-1
116.85 mM L-1
0.6
0.4
0.2
0
Longitud de explante (cm)
125
100
75
Concentración de sales minerales (%)
1
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
150
C
ab ab a
125
100
75
a
a a
a
ab
ab
ab
150
ab a
125
100
75
50
DMS= 0.78
ab ab
Sacarosa
b
58.43 mM L-1
87.64 mM L-1
116.85 mM L-1
50
DMS= 0.22
Figura 4. Número de hojas (A), longitud de hojas (B), altura de planta (C) desarrollados in vitro de Laelia halbingeriana en
un periodo de 60 días.
Figure 4. Number of leaves (A), length of leaves (B), plant height (C) developed in vitro of Laelia halbingeriana over a period of
60 days.
El tratamiento que contenía 50% de sales minerales y
87.64 mM L-1 de sacarosa favoreció la longitud de las
hojas (1.12 cm de longitud); mientras que 58.43 mM
L-1 de sacarosa y 75% de sales minerales disminuyeron
la longitud de las hojas (0.84 cm) (Figura 4 B).
Estos resultados coinciden con los de Tirado et al.
(2005), quienes al adicionar 58.43 mM L-1 de sacarosa
propiciaron un mayor crecimiento foliar en híbridos de
Phalaenopsis.
El proceso de rizogénesis en L.halbingeriana no fue
afectado por la combinación de sales minerales y sacarosa
en el medio de cultivo; Moreno y Menchaca (2007)
observaron que al adicionar pulpa de plátano al medio de
cultivo, se aumenta el número de raíces formadas in vitro,
así como la formación de pseudobulbos en Stanhopea
tigrina Bateman.
La concentración de sales minerales de 150, 125, 100, 75%
en interacción con 116.85 mM L-1 de sacarosa, indujeron
mayor altura de planta (0.95 cm de altura) (Figura 4 C),
este mismo resultado se observó en la interacción de 100%
de sales minerales y 87.64 mM L-1. Por el contrario, la
reducción de las sales minerales a 50% con 116.85 mM
L-1de sacarosa afectó negativamente el crecimiento de las
plántulas de L. halbingeriana, ya que sólo se obtuvo 0.65
cm de altura de planta. Estos resultados contrastan con los
de Sorace et al. (2008), quienes utilizaron la concentración
de sales minerales al 100% del medio Knudson C, para
crecer in vitro el híbrido de Dendrobium nobile; esta
concentración favoreció el crecimiento de la parte aérea
del híbrido.
Efecto de la fuente y concentración de auxina en la
rizogénesis in vitro de L. halbingeriana
En la Figura 5A se observa que en ausencia de ANA,
disminuye el número de raíces y su aplicación lo incrementa,
aunque no se encontraron diferencias significativas con dosis
entre 5.2 y 13 µM L -1 de ANA.
Se observó que tanto la ausencia como la concentración
alta de ANA (13.00 µM L-1), produjeron plántulas con
raíces de menor longitud, 0.67 y 0.75 cm respectivamente
(Figura 5C); en contraste, Pardo et al. (2008) encontraron
que el número de raíces de brotes en Billbergia rosea,
se incrementan (8.95) con una concentración de ANA
1 mg L-1.
549
observed that, by adding banana pulp into the culture
medium, it did increased the number of roots formed in
vitro as well as the formation of pseudobulbs in Stanhopea
tigrina Bateman.
The concentration of mineral salts 150, 125, 100, 75% in
interaction with 116.85 µML-1 sucrose induced a higher
plant height (0.95 cm) (Figure 4 C), this very result was
observed in the interaction 100% minerals and 87.64
µM L-1. On the other hand, the reduction at 50% mineral
salts with 116.85 µM L-1 of sucrose adversely affected
the seedling’s growth of L. halbingeriana, as only 0.65
cm was obtained from the plant height. These results
contrasted with those of Sorace et al. (2008), who used
the concentration of mineral salts 100% of Knudson C
medium to grow in vitro the hybrid Dendrobium nobile;
this concentration favored the aerial-growth part of the
hybrid.
Auxin’s source and concentration effect on the in vitro
rhizogenesis of L. halbingeriana
The Figure 5A shows that in the absence of NAA, the
number of roots decreases and its application will increase
it, although, there were no significant differences at doses
between 5.2 and 13 µM L-1 NAA.
It was observed that both the absence and the high
concentration of NAA (13 µM L-1), produced seedlings
with shorter roots, 0.67 and 0.75 cm respectively (Figure
5C); in contrast, Brown et al. (2008) found that, the number
of root’s sprouts in Billbergia rosea increased (8.95) with a
concentration of 1 mg L-1 NAA.
IBA marginally affected the rooting, as both its absence and
the addition of 7.38 µM L-1 promoted the formation of roots
at concentrations of 2.98 and 2.86 µM L-1 respectively.
However, with 9.84 µM L-1 of IBA, it decreased 22% of
root formation (Figure 5B). The Figure 5D shows the
effect of the concentration of IBA in the length of the roots.
These results showed that for a greater length of roots,
the addition of 7.38 and 12.3 µM L-1 IBA, and the lack
of it, promoted the size of the roots (0.9 cm), this may be
due to endogenous content of auxins from the explants;
however, by adding 3.12 µM L-1 of IBA, the length of the
roots decreases 41%. By adding 13 µM L-1 of NAA to the
medium, the maximum number of leaves (3.8 leaves per
plant) was obtained, but 5.2 µM L-1 NAA had the highest
3.5
A
ANA
a
a
a 2.5
a
2
1.5
1
0.5
0.8
0
5.2
7.8
10.4
µM L-1
C
ab
b
2
1.5
1
ANA
a
DMS= 0.4
1.2
c
c
0
0.4
0.2
4.94
7.38
9.84
µM L
D
AIB
a
12.3
DMS= 0.4
-1
1
ab
bc
0.6
0
a
ab
0
13
Longitud de raíces (cm)
Longitud de raíces (cm)
1
2.5
AIB
a
0.5
0
1.2
B
3
a
Número de raíces
Número de raíces
3
3.5
a a
0.8
0.6
b
b
0.4
0.2
0
5.2
7.8
µM L-1
10.4
13
DMS= 0.14
0
0
4.94
7.38
µM L-1
9.84
12.3
DMS= 0.14
Figura 5. Influencia de la concentración de ANA (A y C) y concentración de AIB (B y D), sobre el número y longitud de las raíces
formadas in vitro de L. halbingeriana a 60 días de incubación.
Figure 5. NAA (A and C) and IBA (B and D) concentration influence on the number and length of roots formed in vitro of L.
halbingeriana at 60 days of incubation.
El AIB afectó marginalmente la rizogénesis, ya que tanto
su ausencia como la adición de 7.38 µM L-1 promovieron la
formación de raíces, en concentraciones de 2.98 y 2.86 µM
L-1 respectivamente. Sin embargo, con 9.84 µM L-1 de AIB
disminuyó 22% la formación de raíces (Figura 5 B). En la
Figura 5D se observa el efecto de la concentración de AIB en la
longitud de las raíces. Los resultados mostraron, que para una
mayor longitud de raíces la adición de 7.38 y 12.3 µM L-1 de
AIB, así como la ausencia de ella, promovieron el tamaño de las
raíces (0.9 cm), esto se puede deber al contenido endógeno de
auxinas de los explantes; sin embargo, al adicionar 12.3 µM L-1
deAIB la longitud de las raíces disminuye 41%.Al adicionar 13
µM L-1 deANAal medio, se obtuvo el máximo número de hojas
(3.8 hojas por planta); sin embargo, con 5.2 µM L-1 de ANA se
obtuvo la mayor longitud de 1.25 cm. En la Figura 6A y 6C se
observa que la ausencia de la hormona produjo menor número
de hojas por planta (3.1) y longitud (1.07 cm) de hojas.
length 1.25 cm. The Figure 6A and 6C shows that, the
absence of the hormone produced a lower number of leaves
per plant (3.1) and leaf’s length (1.07 cm).
Furthermore, the concentration of 7.38 µM L-1 of IBA
was more favorable, as it was on average 3.67 leaves per
plant, and by increasing the concentration to 9.84 µM
L-1, the number of leaves decreased by 10%. With respect
to the length of the leaves, 0 and 7.38 µM L-1 produced
longer leaves at 1.25 and 1.31 cm respectively. However,
it was adversely affected at 20% of the length of the leaves
when the concentration of IBA was 12.3 µM L-1 (Figures
6B and 6D).
Regarding the plant’s height, the high concentration of 13
µM NAA L-1 produced the tallest plants, 1.13 cm on average,
but in the absence thereof, achieved only 86% of its growth
4.5
A
ANA
ab
bc
cd
d
4
3.5
3
3.7
a
2.5
2
1.5
1
5.2
7.8
µM L-1
1.1
10.4
ab
ab
b
3.3
ANA
1.4
a
ab ab 0
a
b
4.94
7.38
9.84
µM L-1
C
1.05
1.2
1
D
a
AIB
a
c bc
12.3
DMS= 0.31
b
0.8
0.6
0.4
0.2
1
0.95
3.4
13
DMS= 0.31
Longitud de las hojas (cm)
Longitud de las hojas (cm)
0
1.2
1.15
a
ab
3.5
3.1
0
1.25
AIB
3.2
0.5
1.3
B
3.6
Número de hojas
Número de hojas
551
0
5.2
7.8
µM L-1
10.4
13
DMS= 0.1
0
0
4.94
7.38
µM L-1
9.84
12.3
DMS= 0.1
Figura 6. Influencia de la concentración de ANA (A y C) y concentración de AIB (B y D) en el número y longitud de hojas formadas
in vitro de L. halbingeriana a los 60 días de incubación.
Figure 6. NAA (A and C) and IBA (B and D) concentration influence on the number and length of leaves formed in vitro of L.
halbingeriana at 60 days of incubation.
Por otro lado, la concentración de 7.38 µM L-1de AIB fue más
favorable, ya que se obtuvieron en promedio 3.67 hojas por
planta, y al incrementar la concentración hasta 9.84 µM L-1,
disminuyó el número de hojas 10%. Con respecto a la longitud
de las hojas, 0 y 7.38 µM L-1 produjeron hojas más largas
en 1.25 y 1.31 cm respectivamente. Sin embargo, se afectó
negativamente hasta 20% la longitud de las hojas cuando la
concentración de AIB fue de 12.3 µM L-1 (Figuras 6B y 6D).
(Figure 7A). IBA produced a maximum value of the
plant’s height at the concentration of 7.38 µM L-1, higher
or lower values to reduce this variable’s response in 20%
(Figure 7B).
Con respecto a la altura de planta, la concentración alta de
ANA de 13 µM L-1 produjo las plantas más altas, de 1.13
cm en promedio; sin embargo, en ausencia del mismo, sólo
alcanzaron 86% de este crecimiento (Figura 7A). El AIB
produce un valor máximo de altura de planta a la concentración
de 7.38 µM L-1, valores superiores o inferiores disminuyen
esta variable respuesta hasta en 20% (Figura 7B).
Based on the results, for the in vitro propagation of
Laelia halbingeriana a practical method was able to be
established.
CONCLUSIONS
For the leaves’ formation, the best promoter was IBA in
a concentration of 2.22 µM L-1 in Murashige and Skoog
medium.
1.1
1.05
1
A
ANA
ab
1.2
abc
bc
c
0.95
0.9
0.85
1.4
ac
1.15
1
B
AIB
a
ab
c
c bc
0.8
0.6
0.4
0.2
0
5.2
7.8
µM L-1
10.4
13
DMS= 0.14
0
0
4.94
7.38
9.84
µM L-1
12.3
DMS= 0.14
Figura 7. Efecto de la concentración de ANA (A) y de AIB (B) en la altura de plantas formadas de L. halbingeriana in vitro a 60
días de incubación.
Figure 7. NAA (A) and IBA (B) concentration effect on the plant’s height consisting of L. halbingeriana in vitro at 60 days of
incubation.
CONCLUSIONES
Con base en los resultados de este trabajo, para la propagación
in vitro de Laelia halbingeriana se logró establecer un método
práctico.
Para la formación de hojas el mejor promotor fue BA en
una concentración de 2.22 µM L-1 en el medio de cultivo
Murashige y Skoog.
De manera general la concentración de sales minerales en
el medio y la concentración de azúcar, no influyeron en la
formación de hojas y raíces generadas in vitro de Laelia
halbingeriana.
En la fase de enraizamiento in vitro la adición de ANA al
medio de cultivo promovió el enraizamiento.
LITERATURA CITADA
Araujo, A. G.; Pasqual, M. Pereira, A. R. y Souza, R. H.
2006. Crescimento in vitro de Laelia tenebrosa
(Orquidaceae) em diferentes concentrações de sais
de Knudson C e carvão ativado. Plant Cell Culture
& Micropropagation. 2(2):53-106.
Generally, the concentration of mineral salts in the medium
and the concentration of sugar did not inf luence the
formation of the leaves and roots generated in vitro of Laelia
halbingeriana.
For the in vitro rooting phase, the addition of NAA into the
culture medium, promoted the rooting.
Coello, C. Y.; Miceli1, C. L.; Orantes, C.; Dendooven, L.
and Gutiérrez, F. A. 2010. Plant growth regulators
optimization for in vitro cultivation of the orchid
Guarianthe skinneri (Bateman) Dressier and
Higgins, W. E. Gayana Bot. 67(1):19-26.
Gil, I. V.; Bastida, A. T.; Flores, G. E. y Navarro, E. L. 2007.
Reproducción y manejo de orquídeas Mexicanas.
Universidad Autónoma Chapingo. Chapingo,
México. 31-42 pp.
Hágsater, E.; Soto, A. M. A.; Salazar, C. G. A; Jiménez,
M. M. A.; López, R. Y. y Dressler, R. L. 2005. Las
orquídeas de México. Instituto Chinoín. México.
304 p.
Knudson, L. 1946. A new nutrient solution for the
germination of orchid seed. Am Orchid Soc Bull.
15:214-217.
Moreno, M. D. y Menchaca, G. R. (2007). Efecto de los
compuestos orgánicos en la propagación in vitro de
Stanhopea tigrina Bateman (Orchidaceae). Foresta
Veracruzana. 9(2):27-32.
Mosquera, E. A; Bayman, P. y Túoac, O. J. 2010.
Ceratobasidium como hongo micorrízico de
orquídeas en Colombia. Acta Agronómica.
59(3):316-326.
Murashige, T. and Skoog, F. 1962. A revised medium for
rapid growth and bioassays with tobacco tissue
cultures. Physiol. Plant. 15:473-497.
Otero, J.; Flanagan, N.; Herre,A.;Ackerman, J. and Bayman, P.
2007. Widespread mycorrhizal specificity correlates
to mycorrhizal function in the neotropical, epiphytic
orchidIonopsis utricularioides (orchidaceae) Am. J.
Bot. 94(12):1944-1950.
Otero, J. T. y Bayman, P. 2009. Germinación simbiótica y
asimbiótica en semillas de orquídeas epífitas. Acta
Agronómica. 58(4):270-276.
Ouyang, T. Chen, S. and Wang, F. S. 2006. Key technology
study on Oncidium industrial propagation by tissue
culture. Forest Res. 19(5):606-611.
Pardo, A.; Michel, C. A.; Magallón, N. y Alvarado, G. 2008.
Regeneración in vitro de Billbergia rosea hortus ex
beer a partir de ápices caulinares Bol. Centro Invest.
Biol. 42(4):491-505.
Porras-Alfaro, A. y Bayman, P. 2007. Mycorrhizal fungi
of vanilla: diversity, specificity and effects on
seed germination and plant growth. Mycology.
99(4):510-525.
553
Romero, T. R.; Rosales, S. B. A. L. y Álvarez, A. B.
2007. Uso de complejos comerciales como
sustitutos de componentes del medio de cultivo
en la propagación in vitro de Laelia anceps.
Sarabia, O. M. E.; Ávila, D. I.; Gómez, A. C. and Salgado,
G. R. 2010. Call us growth and plant regeneration
in Laelia speciosa (Orchidaceae ). Lankesteriana.
10(1):13-18.
Statistical Analysis System (SAS Institute). 2003. SAS/
STAT User’s Guide Release 9.1 ed, Cary, NC, USA.
Sorace, M.; Tadeu, F. R.; Damsceno, J. C. V.; Gómes, G. P.;
Muniz, B. C.; Nesello, F. G.; Lopez, S. G.; Assari,
T. L. S. y Schnitzer, A. J. 2008. Crescimento in vitro
de Oncidium baueri (Orchidaceae) em diferentes
concentrações de macronutrientes e sacarose Semina:
Ciências Agrárias, Londrina, 29(4):775-782.
Suárez, Q. I.; Hernández, A. M.; Chávez, A. V.; Sandoval,
Z. y Martínez, P. 2007. Propagación in vitro y
aclimatización de Euchile mariae (Ames) Withner
(Orchidaceae). Lankesteriana 7(1-2):388-393.
Suárez, J. P.; Michael, W.; Abele, A.; Garnica, S.;
Oberwinklerb, F. and Kottke, I. 2006. Diverse
tulasnelloid ungi form mycorrhizas with epiphytic
orchids in an Andean cloud forest. Mycol. Res.
110:1257-1270.
Tirado, M. J.; Naranjo, E. J. y Atehorutúa, L. 2005.
Propagación in vitro de Phalenopsis (Orchidaceae)
a partir de protocormos, mediante el sistema de
inmersión temporal. “Rita”. 7(1):25:31.
TRAMPAS TRATADAS CON Pimpinella anisum, COMO ATRAYENTE
DE TRIPS (Thysanoptera: Thripidae) EN ROSAL*
TRAPS TREATED WITH Pimpinella anisum, AS ATTRACTANT
OF THRIPS (Thysanoptera: Thripidae) IN ROSE
Agustín Robles-Bermúdez1§, Candelario Santillán-Ortega1, J. Concepción Rodríguez-Maciel2, José Roberto Gómez-Aguilar1,
Néstor Isiordia-Aquino1 y Rubén Pérez-González1
Universidad Autónoma de Nayarit. Unidad Académica de Agricultura. Carretera federal Tepic-Compostela, km 9. Xalisco, Nayarit, México. Tel. 01 311 2110128.
([email protected]), ([email protected]), ([email protected]), ([email protected]). 2 Programa de Entomología y Acarología. Campus Montecillo. Colegio
de Postgraduados Carretera México-Texcoco, km 36.5 Montecillo, Texcoco, Estado de México. C. P. 56230. Tel. 01 595 9510105. ([email protected]). §Autor para
1
RESUMEN
ABSTRACT
El cultivo de rosal representa una de las principales actividades
de la zona florícola de la región de Villa Guerrero, Estado
de México. Los trips son un complejo de especies insectiles
plaga, que afectan la calidad del botón de la rosa de corte,
ocasionando daños de distorsión del pétalo y succión del
contenido celular y por su efecto un deterioro de la calidad
estética del botón floral. Derivado del ciclo biológico corto,
el mal uso de moléculas químicas y por consecuencia la
capacidad de desarrollar resistencia, los trips representan
la segunda plaga más importante del rosal después de araña
roja. Por lo anterior existe la necesidad de buscar alternativas
ecológicas y sustentables en el proceso de producción y en
específico el muestreo de los insectos descritos. El objetivo
fue evaluar el efecto de la impregnación de trampas azules con
diferentes concentraciones de anís, Pimpinella anisum L. en
la captura de trips, durante seis semanas en la época de mayor
presencia de la plaga en el cultivo de rosal de corte cv. Polo®, en
El Islote, Villa Guerrero, Estado de México. Se establecieron
11 tratamientos con cuatro repeticiones cada uno, incluyendo
un testigo sin impregnación. El extracto del fruto de anís a
50 g L-1 de agua capturó en promedio, 76 trips trampa-1 y el
testigo 40 trips trampa-1, que representa 90% de incremento
en la captura respecto a la trampa azul sin impregnar.
The cultivation of roses is one of the main activities of the
flower-area from the region of Villa Guerrero, Mexico State.
The thrips are a complex pest insect species that affect the
quality of the cut-rose’s buds, making damage of distortion
on the petals and sucking the cell’s contents, causing a
deterioration of the esthetic quality of the bud. Derived from
their short biological cycle, the misuse of chemical molecules
during their control and therefore the ability to develop
resistance, the trips are the second most important pest of roses
after the red spider. Therefore, ecological and sustainable
alternatives to control this plague during the rose’s production
process are needed; also it is necessary to get specific sampling
techniques for the study this kind of insects. The objective was
to evaluate the effect of blue traps impregnated with different
concentrations of anise, Pimpinella anisum L. for capturing
trips, during six weeks involved in the occurrence greatest
period of this pest in the cultivation of cut-roses cv. Polo®,
in El Islote, Villa Guerrero, Mexico State. Eleven treatments
were established with four replicates each, including a control
without impregnation. The anise fruit extract at 50 g L-1 of
water, showed an average of 76 thrips captured by trap and
the control 40 thrips by trap, which represents 90% increase
in contrast with the blue trap without impregnation.
Agustín Robles-Bermúdez et al.
Palabras clave: aceites esenciales, plagas de invernadero,
sustentabilidad, trampas adhesivas.
Key words: essential oils, greenhouse pests, sustainability,
sticky traps.
INTRODUCCIÓN
INTRODUCTION
En México se cultivan 14 463 ha de ornamentales y destacan
por su importancia y superficie cultivada, crisantemo
(Dendranthema grandiflorum Ramat), gladiolo (Gladiolus
x hortulanus L.), palma camedor (Chamaedorea spp.) y rosa
de corte (Rosa x hybrida) (SIAP, 2008). El cultivo de rosa
de corte ocupa 1 301 ha, de las cuales 698 ha se cultivan en
condiciones de invernadero y 603 a cielo abierto (SIAP, 2008).
Esta flor no compite en los mercados internacionales, debido a
la baja calidad ocasionada por factores pre y poscosecha. En el
proceso de precosecha las plantas ornamentales son afectadas
por problemas ambientales, nutricionales y fitosanitarios.
En el cultivo de rosa de corte la calidad y producción es
limitada por plagas como trips, áfidos (Macrosiphum rosae
L.), araña roja (Tetranychus urticae Koch) y enfermedades
como peronospora (Peronospora sparsa Berkeley) y cenicilla
(Sphaeroteca pannosa Cooke).
In Mexico, 14 463 ha are cultivated with ornamental plants,
among which stand out for their importance and acreage:
chrysanthemum (Dendranthema grandiflorum Ramat),
gladiolus (Gladiolus x hortulanus L.), parlour palm
(Chamaedorea spp.) and cut-rose (Rosa x hybrida) (SIAP,
2008). The cut rose cultivation occupies 1 301 ha, of which
698 ha are cultivated in greenhouse conditions and 603 in
open conditions (SIAP, 2008). This flower does not compete
in international markets due to poor quality caused by preand postharvest factors. During the pre-harvest process,
the ornamental plants are affected by environmental,
nutritional and phytosanitary problems. In the cut-rose
cultivation the production and also the quality is limited by
pests such as thrips, aphids (Macrosiphum rosae L.), red
spider mite (Tetranychus urticae Koch) and diseases such
as Peronospora (Peronospora sparsa Berkeley) and mildew
(Sphaeroteca pannosa Cooke).
Los trips como plaga, hasta los ochentas eran considerados
como plagas secundarias, sólo Frankliniella occidentalis
Pergande se documentó como plaga en el cultivo de
crisantemo. En la actualidad, a consecuencia probablemente
del uso inapropiado de plaguicidas y cambios ambientales,
existen alrededor de 15 especies de trips que afectan a los
cultivos ornamentales (Huerta y Chavarín, 2002). Los trips
como plaga representan un reto para el floricultor, por los
daños que ocasionan, que son directos al alimentarse y
dañar la epidermis de los pétalos, el tejido se distorsiona
al succionar el contenido celular, mismo que produce un
defecto antiestético (Morse y Hoddle, 2006), y su daño
indirecto que es más grave porque transmiten virosis
(Morales-Díaz et al., 2008).
Las especies ornamentales no toleran altas poblaciones de
trips, el mínimo daño estético representa disminución de la
calidad del botón floral y problemas en la comercialización
(Carrizo et al., 2008). Daños fitosanitarios en botones florales
de rosal constituyen deterioro en la estética y simetría floral,
conceptos fuertemente castigados en la exportación y/o
comercialización de la flor de corte (Shipp et al., 2000;
Castresana et al., 2008). La situación se complica por el hábito
de refugiarse en estructuras de los vegetales que suelen ser
difíciles para acceder y combatirlos (Corredor, 1999).
Until the eighties thrips were regarded as secondary pests,
only Frankliniella occidentalis Pergande, was documented
as pest in chrysanthemum cultivation. Today, probably
resulting from the inappropriate use of pesticides and
environmental changes, there are about 15 species of thrips
that affect ornamental crops (Huerta and Chavarín, 2002).
As pests, thrips represent a challenge to the grower, for
the damage they cause, they are direct when feeding and
damaging the epidermis of the petals, the tissue is distorted
by sucking the cell’s contents, causing a dislike appearance
(Morse and Hoddle, 2006), and an indirect damage which
is worst because they transmit viruses (Morales-Díaz et
al., 2008).
Ornamental species cannot tolerate high populations
of trips; the minimum damage represents a decrease in
flower bud quality and marketing problems (Reed et al.,
2008). Phytosanitary damages in roses flower buds lead to
deterioration of aesthetics and floral, both aspects heavily
punished in the export and marketing of the cut flower
(Shipp et al., 2000; Castresana et al., 2008). The situation
is complicated by the thrip’s habits of taking refuge in plant
structures that are often difficult to access and fight them
(Corredor, 1999).
Trampas tratadas con Pimpinella anisum, como atrayente de trips (Thysanoptera: Thripidae) en rosal
557
La alternativa sustentable para el manejo de este problema
fitosanitario, debe sustentarse en una serie de medidas
ecológicas de bajo riesgo a la salud y al ambiente, estas
estrategias deben incluir compuestos que muestran efectos
antialimentarios, repelencia, atracción y distracción (Di
Totto et al., 2010). Los aceites esenciales son compuestos
aplicados en forma de aspersiones (Cloyd y Chiasson,
2007; Zamar et al., 2007); además para integrar programas
de monitoreo y muestreo de trips es necesario conocer el
patrón de distribución en campo, en la planta y la distribución
estacional de la plaga (Reitz, 2002). Las trampas para
insectos se utilizan con fines de muestreo, o con propósitos
de control directo, la colocación de trampas en los cultivos
agrícolas, además de la detección generan información
propia para determinar la fluctuación y distribución espacial
de las especies plaga, la ubicación de la trampa y la altura son
factores importantes para su eficiencia (Vernon y Gillespie,
1990; Harman et al., 2007).
The sustainable alternative for handling this
phytosanitary problem, must be based on a series
of ecological measures of low risk to health and the
environment, these strategies must include compounds
that show anti-feedants effects, repellency, attraction
and distraction (Di Totto et al., 2010). Essential oils
are compounds applied as sprays (Cloyd and Chiasson,
2007; Zamar et al., 2007), in addition to integrated
monitoring programs and sampling trips is necessary to
know the field distribution pattern on the plant and also
the seasonal distribution of the pest (Reitz, 2002). Insect
traps are used for sampling purposes, or for purposes of
direct control, the location of traps on agricultural crops,
beside the detection of the insects, generate information to
determine fluctuation and spatial distribution of the pest
species, the location of the trap and height are important
factors for their efficiency (Vernon and Gillespie, 1990;
Harman et al., 2007).
El color de la trampa también es determinante como factor
de atracción, ciertos colores resultan atrayentes para
algunas especies de insectos; entre ellos el color amarillo
intenso atrae cicadélidos, áfidos, minadores y moscas
blancas, el blanco atrae a varias especies de trips y el rojo a
coleópteros, y se reporta el color azul como el preferencial
para trips (Larraín et al., 2006; Stavenga y Arikawa, 2006;
Arismendi et al., 2009). Actualmente se utilizan trampas
pegajosas de color amarillo en rosal (Pizzol et al., 2010) y
trampas de color azul (Natwick et al., 2007), mismas que
se consideran efectivas.
The color of the trap is also crucial as an attraction
factor, certain colors are attractive to some species of
insects, among them bright yellow attracts leafhoppers,
aphids, leaf miners and whiteflies, white attracts several
species of thrips and red to beetles. Nevertheless, some
researchers had reported blue as the color preferred by the
thrips (Stavenga and Arikawa, 2006, Larraín et al., 2006,
Arizmendi et al., 2009). Yellow sticky traps are currently
used to control this pest in the cultivation of roses (Pizzol
et al., 2010) and blue traps (Natwick et al., 2007), which
are being considered effective.
Las trampas azules se encuentran en la longitud de onda
entre los 350 y 550 nm, rango de visión de los insectos
(Briscoe y Chittka, 2001). Estas trampas se pueden tratar
con atrayentes vegetales para incrementar la atracción
de trips y por tanto su eficacia biológica, como lo
sugieren Tunc et al. (2000); Tuní y Ahinkaya, (1998).
Por ejemplo, plantas como Pimpinella anisum, Carum
carvi L. y Cuminum cyminum poseen atrayentes naturales
para plagas y otras atribuciones en el manejo de estas
(Kosalec et al., 2005; Salvadores et al., 2007). Ali et al.
(2009) encontraron 9 ordenes, 18 familias, 21 géneros y
23 especies de insectos que son atraídos a estas plantas.
Los meses de abril y mayo en México, son más secos que
favorecen el desarrollo de la plaga (González et al., 1999).
El objetivo del trabajo fue evaluar el efecto de diferentes
presentaciones de anís como atrayente aplicado a trampas
azules para la captura de trips.
Blue traps are in the wavelength between 350 and 550
nm, viewing range of insects (Briscoe and Chittka, 2001).
These traps can be treated with vegetable attractive to
increase the attraction of thrips and thus its biological
efficacy, as suggested by Tunc et al. (2000); Tuní and
Ahinkaya, (1998). For example, plants such as Pimpinella
anisum, Carum carvi L. and Cuminum cyminum have
natural attractants for pests and other attributes for the
management of them (Kosalec et al., 2005; Salvadores et
al., 2007). Ali et al. (2009) found 9 orders, 18 families,
21 genera and 23 species of insects that are attracted to
these plants. The months of April and May in Mexico
are drier than the other ones, and this situation favor
the development of the pest (González et al., 1999).
The objective of this work was to evaluate the effect on
different presentations of anise as an attractant applied to
blue traps for catching thrips.
Sitio de estudio
Study site
El presente trabajo se realizó en la comunidad de El Islote,
Villa Guerrero, Estado de México. Este lugar se ubica en
latitud de 18° 58’ 12’’ latitud norte, 99° 39’ 45’’ longitud
oeste y altitud de 2 204 m, en las Instalaciones del Instituto de
Capacitación e Investigación Agrícola, Pecuaria y Forestal
del Estado de México (ICAMEX).
This work was performed in the community of El Islote, Villa
Guerrero, Mexico State. This place is situated in latitude
18° 58’12” N, 99° 39’ 45” west longitude and elevation of
2 204 masl, in the Mexico State’s Agriculture, Livestock
and Forestry Training and Research Institute Facilities
(ICAMEX).
Cultivo y variedad
Crop and variety
El cultivo fue rosal de corte del cultivar Polo® en estado
fenológico de producción de flores y de cuatro años de edad.
The crop was cut rose Pole ® cultivar, in f lowering
phenological stage and four years of age.
Descripción de las trampas
Description of the traps
Se diseñaron trampas de 15 cm de ancho por 22.5 cm de
largo, 2 mm de espesor y 675 cm2 de área de captura (ambos
lados). El material de fabricación consistió en rectángulos
hechos del material FOMIX® de color azul intenso y con
una cubierta de plástico transparente.
Were designed traps 15 cm wide by 22.5 cm long, 2 mm thick
and 675 cm2 capture area (both sides). The manufacturing
material consisted of rectangles made with FOMIX® bright
blue and a clear plastic cover.
Preparación de las trampas
Las trampas azules fabricadas se colocaron dentro de una bolsa
plástica transparente de 15∗25 cm, misma que se impregnó con
pegamento para insectos (STICK-BUG 50® 50%, concentrado
emulsionable, 500 g de ingrediente activo (IA) L-1, Alterna
Agro S. A. de C. V, México). Posterior a la aplicación del
pegamento, la cubierta plástica recibió el tratamiento a base
de anís previamente seleccionado aleatoriamente.
La aplicación de los tratamientos
La aplicación consistió en la microaspersión con un
atomizador manual. Dicha aspersión se realizó sobre la bolsa
de plástico que contenía el pegamento y cubría la trampa. El
tamaño de gota fue, en promedio de 20 µm, por un tiempo
aproximado de 4 s. La cantidad de la solución aplicada a
cada trampa fue de 2 ml.
Colocación y distribución espacial de las trampas
Las trampas se distribuyeron de manera aleatoria en
un invernadero de 2 400 m2 (80 m de largo por 30 m de
ancho), que disponía de 53 camas de 1.5 m de ancho y 30
Preparation of the traps
The manufactured blue traps were placed in a transparent
plastic bag of 15∗25 cm, it was impregnated with insect
glue (STICK-BUG 50® 50% emulsifiable concentrate,
500 g of active ingredient (AI) L-1, Alterna Agro S. A. de
C. V, Mexico). After application of the glue, the plastic was
impregnated with an anise solution randomly selected from
several treatments with anise.
The application of the treatments
The application consisted of micro sprinkler with a
manual sprayer. This spraying was done on the plastic
bag containing glue and covered the trap. The droplet
size was 20 µm in average, for a period of approximately
4 s. The amount of solution applied to each trap was
2 ml.
Placement and spatial distribution of traps
The traps were distributed randomly in a greenhouse of 2
400 m2 (80 m long and 30 m wide), which provided 53 beds
of 1.5 m wide and 30 m long. One trap per planting bed
was placed leaving a range of 10 m between traps to avoid
m de largo. Se colocó una trampa por cama de plantación
procurando un radio de acción entre trampas de 10 m para
evitar interferencia con los atrayentes. Cada trampa se
colocó en posición vertical a la superficie del suelo, a 1.2
m de altura, misma que coincidía con el mayor número de
botones florales.
Frecuencia de revisión
Se hicieron conteos semanales por un periodo de seis
semanas. Para esto se sustrajo la cubierta plástica
transparente de la trampa y se contabilizaron, con la
ayuda de un microscopio estereoscópico, los especímenes
adheridos a ésta.
Tratamientos
A= testigo; B= aceite de anís, 5%; C= aceite de anís, 2.5%;
D= aceite de anís, 1%; E= aceite de anís, 0.5%; F= esencia
de anís, 5%; G= esencia de anís, 2.5%; H= esencia de anís,
1%; I= esencia de anís, 0.5%; J= fruto de anís infusión 10 g
L-1 de agua; K= semilla de anís 50 g L-1 de agua.
El aceite de anís (Eladiet fitociencias®, aceite comestibles,
Farmacia Internacional, México), esencia de anís (esencia
de anís Deiman®, esencia, Deiman de México) y semillas de
anís de uso en la industria alimentaria como saborizantes,
adquirido en expendios de productos para la medicina
tradicional. El fruto de anís utilizado en la medicina
tradicional, se adquirió en expendios del mercado municipal
de Tenancingo, Estado de México.
559
interference with attractants. Each trap was placed upright
at the soil surface, to 1.2 m high, coinciding with the highest
number of flower buds.
Frequency of review
Weekly counts were made for a period of six weeks. To
this was subtracted the clear plastic cover of the trap and
counted with the aid of a stereomicroscope, the specimens
attached to it.
Treatments
A= control, B= anise oil, 5%, C= anise oil, 2.5%, D= anise
oil, 1%, E= anise oil, 0.5%, F= anise, 5%, G= anise essence,
2.5%, H= anise essence, 1%, I= anise essence, 0.5%, J= anise
fruit infusion 10 g L-1 of water, K= anise seed 50 g L-1 of water.
Anise oil (Eladiet fitociencias®, edible oil, International
Pharmacy, Mexico), anise essence (anis essence Deiman®,
essence, Deiman of Mexico) and anise seeds used in the
food industry as flavorings, bought in outlets of traditional
medicine products. The anise fruit used in traditional
medicine was purchased in the municipal market outlets in
Tenancingo, Mexico State.
Preparation of anise fruit extract
50 g of medicinal anise plant fruits was weighed, and placed
in 250 ml of distilled water, and subsequently liquefied
during 5 min and gauged to 1 000 ml of water.
Preparación del extracto del fruto de anís
Environmental conditions
Se pesaron 50 g de frutos de la planta medicinal anís, y se
colocaron en 250 ml de agua destilada, posteriormente se
licuaron por 5 min y se aforaron a 1 000 ml de agua.
To measure the environmental conditions inside and outside
the greenhouse, two HOBO® Data Logger brand were used
one inside the greenhouse and another outside it.
Condiciones ambientales
Experimental design
Para medir las condiciones ambientales dentro y fuera del
invernadero se dispuso de dos Data Logger de la marca
HOBO®, uno dentro del invernadero y otro fuera de éste.
The experimental design was completely randomized, using
11 treatments with four replications.
Diseño experimental
El diseño experimental utilizado fue completamente al
azar, donde se establecieron 11 tratamientos con cuatro
repeticiones.
By using the SAS software, the data obtained were
subjected to analysis of variance and multiple comparison
test (Tukey, p= 0.05) to order the biological effectiveness
of treatments.
Los datos obtenidos se sometieron a un análisis de varianza y
a una prueba de comparación múltiple de medias (Tukey, p=
0.05) para ordenar la eficacia biológica de los tratamientos.
Se efectuó sobre la base del programa de cómputo SAS.
Las trampas para insectos proporcionan una estimación
relativa de la cantidad de especímenes por unidad de
superficie. Además, generan información del inicio de la
incidencia y la fluctuación poblacional; sin embargo, el
uso de atrayentes pueden coadyuvar en la captura de trips
(Hoddle et al., 2001). Existe una gran diversidad en el uso de
trampas para la captura de insectos, destacan las trampas de
luz para la captura de trips, trampas de color blanco, amarilla
y azul. Se ha documentado que las trampas azules llegan a
capturar mayor número de trips que las trampas amarillas
(González et al., 1999; Chen et al., 2004).
En función a los resultados el color azul por sí solo tiene un
efecto natural sobre la atracción de trips, datos que coinciden
con González et al. (1999), autores que describen que las
trampas azules por si solas atraen a estos fitófagos; los
mismos autores señalan que el insecto puede ser atraído por
trampas amarillas, blancas y verdes. Los datos obtenidos
muestran que el color azul de las trampas sin atrayente
capturan en promedio 40 trips por trampa (Cuadro 1);
información que coincide con lo reportado por Brodsgaard
(1989), que evaluó 20 colores de trampas pegajosas en
condiciones de invernadero, encontró que el color azul es
atractivo para trips y propone que las trampas azules, pueden
utilizarse como una herramienta ficiente para detectar
poblaciones iníciales del artrópodo y Larraín et al. (2006)
asevera que el color azul de la trampa atrae más trips que el
amarillo y el blanco.
Diversos investigadores han realizado estudios utilizando
aceites esenciales, para incrementar la captura de plagas en
trampas de diferentes colores (Frey et al., 1994). Teulon et al.
(1993) aseveraron que con la adición de volátiles químicos,
como nicotinato de etilo se incrementa hasta 27 veces la
captura de trips respecto al testigo y otros compuestos como
p-anisaldehido, se logra un incremento en la captura de 1.8
a seis veces más. En el presente estudio se muestra que los
extractos de anís en cualquiera de sus presentaciones tienen
Insect traps provide a relative estimation of the number
of specimens per area unit. In addition, they generate
information about the start of the incidence and
population fluctuation dynamics, however, the use of
attractants may assist in the capture of thrips (Hoddle
et al., 2001). There is great diversity in the use of traps
for catching insects, highlighting the light traps for
catching thrips, white, yellow and blue traps. It has been
documented that the blue ones catch a higher number of
trips than the yellow ones (González et al., 1999; Chen
et al., 2004).
According to the results the blue color by itself has a
natural effect on the attraction of thrips, information that
agree with González et al. (1999), authors that reported that
blue traps by themselves attract these kind of phytofagous,
the same authors note that the insect may be attracted by
yellow, white and green traps. The data obtained show
that the blue color of the traps without attractant capture
in average 40 thrips per trap (Table 1); information
that matches with the indicated by Brodsgaard (1989),
who evaluated 20 colors of sticky traps in greenhouse
conditions, found that the blue color is attractive to thrips
and suggests that blue traps can be used as a tool to detect
initial populations of this arthropod, and Larraín et al.
(2006) assert that the blue color of the trap attracts more
thrips than yellow and white.
Cuadro 1. Atracción de trips a trampas azules pegajosas e
impregnadas de anís, El Islote, Villa Guerrero,
Estado de México.
Table 1. Attraction of thrips to blue sticky traps impregnated
with anise, El Islote,Villa Guerrero, Mexico State.
Tratamiento
X (trips/trampa ±ES) PIRT (%)
Testigo
40.2 b ±7.99
Aceite de anís 5%
41.3 ab ±4.25
3
Aceite de anís 2.5%
50.5 ab ±4.83
25
Esencia de anís 2.5%
54.8 ab ±4.79
36
Esencia de anís 1%
57.7 ab ±9.07
43
Semilla de anís
59.7 ab ±7.03
48
Esencia de anís 5%
60.3 ab ±7.54
50
Esencia de anís 0.5%
61.5 ab ±4.32
53
Aceite de anís 0.5%
63.5 ab ±11.68
58
Aceite de anís 1%
65.8 ab ±7.54
64
Fruto de anís 50 g L-1 de
76.3 a ±7.93
90
agua
Medias con la misma letra no son estadísticamente diferentes (Tukey p= 0.05); ES=
error estándar de la media PIRP= porcentaje de incremento en relación al testigo.
actividad atrayente que incrementa de 25 a 90%, en función a
la presentación del anís. Sin embargo, es el extracto de fruto
de anís el que muestra capturas más altas.
El tratamiento que capturó mayor número de trips por trampa
en el periodo de seis semanas, fue el fruto de anís que promedió
76 trips por trampa y fue estadísticamente superior a los
anteriormente mencionados, representa 90% más en relación
al testigo (Cuadro 1). Las esencias volátiles (monoterpenos)
tienen efecto atrayente alimenticio en insectos principalmente
chupadores. Choi et al. (2003); Koul et al. (2008) describen
que la eficiencia de los aceites esenciales como anís es variable
y depende de la presentación, aplicación y concentración del
metabolito utilizado.
Por tanto, el uso de trampas impregnadas con fruto de anís (50
g L-1), tiene elevada capacidad para la detección temprana de
trips y mejora su desempeño como factor de mortalidad. Los
resultados son similares con los encontrados por Gorski (2004),
quien destaca el incremento de 487.6% de insectos atrapados
con el uso de aceites esenciales naturales y 81.2% en té de
árbol y los encontrados por Demirel (2007), quien encontró un
incremento en la captura de 463 y 479% con aceite de canola y
aceite de mostaza respectivamente en trampas azules para trips.
Las condiciones meteorológicas prevalecientes durante
el desarrollo del experimento, promediaron dentro del
invernadero 30.4 °C, a la intemperie 28.9 °C con temperatura
mínima promedio interior de 7.4 °C y de 7 °C fuera del
mismo. La humedad relativa promedio fuera del invernadero
fue de 65% y dentro se mantuvo entre 69% por la mañana y
43 a 50% entre las 12:00 y 15:00 h.
CONCLUSIÓN
Las trampas azules impregnadas de extracto de fruto de anís
a una concentración de 50 g L-1 incrementa la capacidad de
captura de trips.
AGRADECIMIENTOS
El presente estudio se llevó a cabo con fondos del proyecto
15-2006-5354 “Manejo integrado de plagas y enfermedades
en ornamentales de corte” financiado por la Fundación
Produce del Estado de México.
561
Several researchers have conducted studies using essential oils
to increase the capture of pest by different color traps (Frey et
al., 1994). Teulon et al. (1993) asserted that with the addition
of volatile chemicals, such as ethyl nicotinate the capture of
thrips increases to 27 times than the control and by using other
compounds such as p-anisaldehyde, is possible achieve an
increase in the catch from 1.8 to six times longer. The present
study shows that extracts of anise in any presentations have
attract activity that increases from 25 to 90% according to the
presentation of anise. However, it is the anise fruit extract the
treatment that showing the highest catches.
The treatment caught more thrips per trap in the six weeks
period, was the anise fruit, with an average of 76 thrips per
trap and was statistically superior to those mentioned above,
representing 90% more than the control (Table 1). The
volatile essences (monoterpenes) have nutrimental attractive
effect mainly for sucking insects. Choi et al. (2003); Koul et
al. (2008) report that the efficiency of essential oils such as
anise is variable and depends on the presentation, application
and concentration of the metabolite used.
Therefore, the use of traps impregnated with anise fruit (50 g L-1),
has high capacity for early detection of thrips and improves its
performance as mortality factor. The results are similar to those
found by Gorski (2004), who noted an increase of 487.6% in
insects caught with the use of natural essential oils, and 81.2% by
using tea tree, and those reported by Demirel (2007), who found
an increase of 463 and 479% by using canola oil and mustard
oil respectively in blue traps for thrips.
Prevailing weather conditions during the course of the
experiment, were in average: Temperature inside the greenhouse,
30.4°C, meanwhile outside it was 28.9°C, with an inside
average minimum temperature of 7.4 °C and 7 °C outside the
greenhouse. The outside average relative humidity was 65%
and inside it was maintained between 69% in the morning and
from 43 to 50% between 12:00 and 15:00 h.
CONCLUSION
Blue traps impregnated with anise fruit extract at a
concentration of 50 g L-1 increases their capture capacity
of thrips.
LITERATURA CITADA
Ali, A. G.; Embarak, M. Z. and Ahmed, E. A. 2009. Specific
composition and seasonal fluctuation of destructive
and beneficial insect species inhabiting three
medicinal plants in assiut governorate. Egypt. Ass.
Univ. Environ. Res. 12(2):77-87.
Arismendi, N.; Carrillo, R.; Andrade, N.; Riegel, R. y Rojas,
E. 2009. Evaluación del color y la posición de la
trampa en la captura de cicadélidos en Gaultheria
phyllyreifolia (Ericaceae), afectadas por fitoplasmas.
Brasil. Neotropical Entomology. 38(6):754-761.
Briscoe, A. D. and Chittka, L. 2001. The evolution of color
vision in insects. USA. Annual Review Entomology.
46:471-510.
Brodsgaard, H. F. 1989. Coloured sticky traps for Frankliniella
occidentalis (Pergande) (Thysanoptera: Thripidae) in
glasshouses. USA. J. Appl. Entomol. 107:136-140.
Carrizo, P.; Gatelú, C.; Langoni, P. y Klasman, R. 2008.
Especies de trips (Insecta: Thysanoptera: Thripidae)
en las flores ornamentales. Chile. Idesia. 26(1):83-86.
Castresana, J.; Gagliano, E.; Puhl, L.; Bado, S.; Vianna, L. y
Castresana, M. 2008. Atracción de trips Frankliniella
occidentalis (Pergande) (Thysanoptera:Tripidae)
con trampas de luz en el cultivo de Gerbera
jamesonni G. Chile. Idesia. 26(3):51-56.
Chen, T. Y.; Chiu, C. C.; Fitzgerald, G.; Natwick, E. T. and
Henneberry, T. J. 2004. Trap evaluations for thrips
(Thysanoptera: Thripidae) and hoverflies (Diptera:
Syrfidae). USA. Environ. Entomol. 33(5):1416-1420.
Choi, W. I.; Lee, E. H.; Choi, B. R.; Park, H. M. and Aha, Y. J.
2003. Toxicity of plant essential oil to Trialeurodes
vaporariorum (Homoptera: Aleyroridae). USA. J.
Econ. Entomol. 96(5):1479-1484.
Cloyd, R. A. and Chiasson, H. 2007. Activity on essential
oil derived from Chenopodium ambrosioides
on greenhouse insect pest. J. Econ. Entomol.
100(2):459-466.
Corredor, D. 1999. Integrated pest management in cut flower
crops grown in plastic houses at the Bogota Plateau.
Belgium. Acta Hortic. 482:241-246.
Demirel, N. 2007. Attraction of color cups and plant
compounds to thrips species on organic napa
cabbage. USA. J. Entomol. 4(3):263-266.
Di Totto, B. L.; Alvarez, C. O.; Popich, S.; Neske, A. and
Bardon, A. 2010. Antifeedant and toxic efects of
acetogenins from Annona montana on Spodoptera
frugiperda. Austria. J. Pest Sci. 3(83):307-310.
Frey, J. E.; Cortada, R. V. and Helbling, H. 1994. The
potential of flower odours for use in population
monitoring of western flower thrips Frankliniella
occidentalis Perg. (Thysanoptera: Thripidae). UK.
Biocontrol Sci. Technol. 4:177-186.
González, H. H.; Méndez, R. A.; Valle de la Paz, A. R.
y González, R. M. 1999. Selección de trampas
de color y fluctuación poblacional de trips en
Michoacán, México. Revista Chapingo. Serie
Horticultura. 5:287-290.
Gorski, R. 2004. Effectiveness of natural essential oils in the
monitoring of greenhouse whitefly (Trialeurodes
vaporariorum Westwood). Polonia. Folia Hortic.
16(1):183-187.
Harman, J. A.; Mao, C. X. and Morse, J. G. 2007.
Selection of colour of sticky trap for monitoring
adult bean thrips, Caliothrips fasciatus
(Thysanoptera: Thripidae). UK. Pest Manage.
Sci. 63(2):210-216.
Hoddle, M. S.; Robinson, L. and Morgan, D. 2001.
Attraction of thrips (Thysanoptera: Thripidae
and Aelothripidae) to colored sticky cards in a
California avocado orchard. Netherlands. Crop
Prot. 21(5):383-388.
Huerta, P. R. A. y Chavarín, P. J. C. 2002. Trips y minadores:
identificación, biología y control. In: manejo
fitosanitario de ornamentales. Bautista M. N.;
Alvarado L. J.; Chavarín P. J. C. y Sánchez, A.
H. (eds.). Instituto de Fitosanidad. Colegio de
Postgraduados. Texcoco, México. 67-70 pp.
Kosalec, I.; Pepeljnjak, S. and Kustrak, D. 2005. Antifungal
activity of fluid extract and essential oil from anise
fruits (Pimpinella anisum L., Apiaceae). USA. Acta
Pharm. 55:377-385.
Koul, O.; Walia, S. and Dhaliwal, G. S. 2008. Essential
oils as green pesticides: potential and constraints.
Japan. Biopesticides International. 4(1):63-84.
Larraín, P. S.; Varela, U. F.; Quiroz, E. C. y Graña, S. F.
2006. Efecto del color de trampa en la captura
de Frankliniella occidentalis (Thysanoptera:
Thripidae) en pimiento Capsicum annum L. Chile.
Agric. Téc. Méx. 66(3):306-311.
Morales-Díaz, M. V.; Alcacio-Rangel, S. y De la TorreAlmaráz, R. 2008. Tomato spotted wilt virus:
agente causal de la marchitez del miguelito (Zinnia
elegans Jacquin) en el estado de Morelos, México.
Agrociencia. 42(3):335-347.
Morse, G. and Hoddle, M. S. 2006. Invasión biology of
thrips. USA. Annu. Rev. Entomol. 51:67-89.
Natwick, E. T.; Byers, J. A.; Chu, C.; Lopez, M. and
Hanneberry, T. J. 2007. Early detection and mass
trapping of Frankliniella occidentalis and Thrips
tabaci in vegetable crops. USA. Southwestern
Entomology. 32(4):229-238.
Pizzol, J.; Nammour, D.; Hervouet, P.; Bout, A.; Desneux, N.
and Mailleret, L. 2010. Comparison of two methods
of monitoring thrips populations in a greenhouse
rose crop. Austria. J. Pest Sci. 2(83):191-196.
Reitz, S. R. 2002. Seasonal and within plant distribution of
Frankliniella thrips (Thysanopetera: Thripidae)
in North Florida Tomatoes. USA. Florida
Entomologist. 83:431-439.
Salvadores, Y. U.; Silva, B. A.; Tapia, M. V. y Hepp, R.
G. 2007. Polvos de especias aromáticas para el
control del gorgojo del maíz (Sitophilus zeamais)
Moutschulsky, en trigo almacenado. Chile. Agric.
Téc. 67(2):147-154.
Shipp, J. L.; Wang, K. and Binns, M. R. 2000. Economic injury
levels for western flower thrips (Thysanoptera:
Thripidae) on greenhouse cucumbers. USA. J. Econ.
Entomol. 93(6):1732-1740.
Sistema de Información Agropecuaria y Pesquera (SIAP).
2008. Sistema de Información Agropecuaria y
Pesquera. URL: http://www.siap.sagarpa.gob.
mx.
563
Stavenga, D. G. and Arikawa, K. 2006. Evolution of color
and visión of butterflies. USA. Arthropods structure
and development. 35(4):307-318.
Teulon, D. A. J.; Penman, D. R. and Ramakers, P. M. J.
1993. Volatile chemicals for thrips (Thysanoptera:
Thripidae) host-finding and applications for
thrips pest management. USA. J. Econ. Entomol.
86(5):1405-1415.
Tunc, I.; Berger, B. M.; Erler, F. and Dag, F. 2000. Ovicidal
activity of essencial oils from five plants against
two stored-products insects. Netherlands. J. Stored
Products Res. 36(2):161-168.
Tuní, I. and Anhinkaya, S. 1998. Sencitivity of two
greenhouses pests to vapours of essential oils.
Scotland. Entomologia Experimentals Applicata.
86(2):183-187.
Vernon, R. S. and Gillespie, D. R. 1990. Spectral responsiveness
of Frankliniella occidentalis (Thysanoptera:
Thripidae) determined by trap catches in greenhouses.
USA. Environ. Entomol. 19(5):1229-1241.
Zamar, M. I.; Arce de Hamity, M. G.; Andrade, A.; Amendola
de Olsen, A. y Hamity, V. 2007. Efecto de productos
no convencionales para el control de Thrips tabaci
(Thysanoptera: Tripidae) en el cultivo del ajo
(Allium sativum) en la Quebrada de Humahuaca
(Jujuy-Argentina). Chile. Idesia. 25(3):41-46.
GERMINACIÓN IN VITRO DE CACTÁCEAS, UTILIZANDO
ZEOLITA COMO SUSTRATO ALTERNATIVO*
CACTI IN VITRO GERMINATION BY USING ZEOLITE
AS ALTERNATIVE SUBSTRATE
Lidia Rosaura Salas-Cruz1§, Rahim Foroughbackch-Pournabav1, María de Lourdes Díaz-Jiménez3, María Luisa CárdenasÁvila2 y Alfredo Flores-Valdes3
Departamento de Botánica. Universidad Autónoma de Nuevo León. Av. Universidad s/n. San Nicolás de los Garza, Nuevo León, México. C. P. 66451. Tel. 01 818
3159880, 3598158 y 3598158. ([email protected]). 2Departamento de Biología Celular y Genética. Universidad Autónoma de Nuevo León. (cardenasavila@
yahoo.com). 3Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional. Unidad Saltillo. Carretera Saltillo-Monterrey, km 13.5. Ramos Arizpe,
Coahuila, México. C. P. 25900. Tel. 01 844 4389600. Ext. 8520. ([email protected]), ([email protected]). §Autora para correspondencia:
[email protected].
1
RESUMEN
ABSTRACT
Se evaluó la germinación in vitro de seis especies de
cactáceas usando zeolita como alternativa de sustrato. Se
realizó la siembra in vitro de: Astrophytum capricorne A.
Dietr. Britton & Rose, A. myriostigma Lem., Echinocereus
reichenbachii Terscheck ex Walp. Haage, Escobaria
dasyacantha Engelm Britton & Rose, Mammillaria prolifera
Mill. Haw. y Sclerocactus scheeri Salm-Dyck N. P. Taylor.
Para ello se aplicaron tres granulometrías de zeolita: fina (de
0.71 a 1 mm), mediana (de 1.1 a 2 mm) y gruesa (de 2.1 a 3.36
mm de calibración). En total se aplicaron nueve tratamientos
a las estructuras de granulometrías de zeolitas: fina, mediana
y gruesa + agua destilada (tratamientos 1, 2 y 3), tres tipos de
zeolitas + medio Murashige y Skoog (MS) (tratamiento 4, 5
y 6); tratamiento 7 agar + MS + sacarosa, tratamiento 8 agar
+ MS; y tratamiento 9 agar. Se analizaron estadísticamente
los resultados sobre la tasa de germinación y se determinaron
diferencias altamente significativas para las variables
porcentaje (F= 7.036, p< 0.01), velocidad (7.767, p< 0.01)
e índice de germinación (4.298, p< 0.01). Los valores de
germinación más altos se obtuvieron con el tratamiento
agar + MS con un valor promedio de 63.3%; seguido del
By using zeolite as an alternative substrate, in vitro
germination of six cacti species was evaluated. In vitro
seeding was performed for: Astrophytum capricorne A.
Dietr. Britton & Rose, A. myriostigma Lem., Echinocereus
reichenbachii Terscheck ex Walp. Haage, Escobaria
dasyacantha Engelm Britton & Rose, Mammillaria
prolifera Mill Haw. and Sclerocactus scheeri SalmDyck N. P. Taylor. In order to do this, three particle
sizes of zeolite were applied: thin (from 0.71 to 1 mm),
medium (from 1.1 to 2 mm) and coarse (2.1 to 3.36 mm
of calibration). A total of nine treatments were applied to
zeolite’s structures of the following granulometric sizes:
fine, medium and coarse + distilled water (treatments 1,
2 and 3), three types of zeolites + Murashige and Skoog
(MS) (treatment 4, 5 and 6) treatment 7 agar + MS +
sucrose, treatment 8, agar + MS; and treatment 9 agar. The
germination index evaluation results were statistically
analyzed identifying highly significant differences for the
variables percentage (F= 7.036, p< 0.01), speed (7.767,
p< 0.01) and germination index (4.298, p< 0.01). The
highest germination values were obtained with agar +
* Recibido: enero de 2011
Aceptado: julio de 2011
Lidia Rosaura Salas-Cruz et al.
tratamiento zeolita mediana + MS (58%). La especie con
mejor respuesta germinativa fue E. dasyacantha (92.6%),
seguida de A. myriostigma (54.07%). Este protocolo indica
la conveniencia de usar como sustrato zeolitas sustituyendo
al agar, favoreciendo así acciones de conservación in vitro
de cactáceas, aprovechando lo redituable del sustrato debido
a su abundancia y fácil obtención.
MS treatment. The species with the highest germination
response was E. dasyacantha (92.6%), followed by
A. myriostigma (54.07%). This protocol calls for the
convenience of using zeolites as a replacement for agar
substrate, thus promoting the cacti in vitro conservation,
taking advantage of such profitable substrate because of
its abundance and easy acquisition.
Palabras clave: agar, cactáceas, germinación in vitro,
zeolita natural.
Key words: Agar, cacti, in vitro germination, natural
zeolite.
INTRODUCCIÓN
INTRODUCTION
La familia Cactaceae contiene entre 1 500 y 2 000 especies
(Hunt, 1999; Guzmán et al., 2007; Velazco, 2009). Para
México esta familia es considerada de gran importancia
en cuanto a su diversidad biológica. Se estima que las
cactáceas en la flora de México alcanzan alrededor de 700
especies, que corresponde al 40% de la familia, siendo el
país más diverso para este grupo de plantas, con más 84% de
endemismo a nivel de especie (Arias, 1993). Sin embargo,
sus poblaciones naturales han sido diezmadas por el cambio
de uso de suelo y la extracción ilegal de especies de alto
valor ornamental. El empleo de cactáceas como plantas
de colección u ornamentales es quizá el más demandado a
nivel internacional, por su rareza y belleza y sobre todo por
su lento crecimiento y hermosa floración (Carmona et al.,
2008). Alrededor de 300 especies de cactos están disponibles
como ornamentales.
The Cactaceae family contains between 1 500 and 2 000
species (Guzmán et al., 2007; Hunt, 1999; Velazco, 2009).
For Mexico, this family is considered quite important in
terms of its biodiversity. It is estimated that in the Mexican
flora, Cactaceae reach about 700 species, corresponding
40% of the whole family, being the most diverse country in
this group of plants, with over 84% of endemism at species
level (Arias, 1993). However, its natural populations have
been decimated by the change in land-use and the illegal
extraction of high valued ornamental species. Due to their
beauty, scarcity and slow growing, cacti are one of the
plant groups more requested internationally (Carmona
et al., 2008). Around 300 species of cacti are available as
ornamentals.
Usualmente los cactus son propagados por semilla y esquejes;
sin embargo, estos métodos convencionales, aunados a la
falta de metodologías más eficientes de propagación, no
siempre resultan satisfactorios, especialmente en aquellas
especies en peligro de extinción, de lento crecimiento y
que producen pocas semillas. Otros métodos usuales para
la propagación de cactáceas son: hijuelos, yemas e injertos
(Reyes et al., 2001). Por lo tanto, es inminente la necesidad
de establecer técnicas de producción de cactáceas eficientes
y de bajo costo, para satisfacer la alta demanda que ha vuelto
vulnerables a las poblaciones naturales de este llamativo
grupo de plantas.
Al respecto, Bunt (1988) señala que la calidad de las
plántulas depende del tipo de sustrato donde se desarrollan,
en particular de sus características físico-químicas, ya
que el desarrollo y el funcionamiento de las raíces están
Cacti usually are propagated by seed and cuttings, but
these conventional methods, combined with the lack of
more efficient methods of propagation, not always are
satisfactory, especially in endangered species, with slow
growing and produce few seeds. Other conventional
methods for the propagation of cacti are shoots, buds and
grafts (Reyes et al., 2001). Therefore, it is important to
define new, efficient and economical cacti production
techniques, to meet the high demand that has become
vulnerable the natural populations of this remarkable
group of plants.
About plant propagation, Bunt (1988) indicates that the
quality of seedlings depends on the substrate where they
develop, in particular its physic-chemical characteristics,
because the development and functioning of roots are
directly linked to the conditions of aeration, water content,
as well as having direct influence on the availability of
nutrients. Meanwhile, Andrade et al. (2008), consider
Germinación in vitro de cactáceas, utilizando zeolita como sustrato alternativo
567
directamente ligados a las condiciones de aireación,
contenido de agua, además de tener influencia directa sobre
la disponibilidad de los nutrientes. Por su parte, Andrade et
al. (2008), consideran necesario usar en los sustratos algún
componente que aporte nutrimentos para el crecimiento de
las plantas, además del soporte adecuado.
necessary to use on substrates some kind of component
that provides nutrients for plant growth, in addition to
suitable support.
Una opción para cubrir dichas necesidades específicas lo
constituyen las zeolitas naturales que son minerales del
grupo de los aluminosilicatos hidratados con estructura
porosa, que presentan alta capacidad de retención de
humedad y de intercambio catiónico. Estas características
físicas y químicas las hacen un sustrato atractivo en la
agricultura (Allen y Ming, 1995; Urbina et al., 2006) y para
el cultivo de cactáceas entre otras plantas; sin embargo, en
México, la información sobre las zeolitas como sustrato
natural, abundante y económico es mínimo para las especies
en general, y nulo para el caso de la producción y propagación
de las cactáceas.
Las técnicas de cultivo in vitro permiten la propagación
masiva y comercial de especies de interés hortícola (Thorpe,
1981); por lo tanto, la germinación in vitro de cactáceas
con alta demanda ornamental puede llegar a tener un gran
impacto a nivel industrial y en la conservación in situ (Molina
et al., 2005), abasteciendo la alta demanda en el mercado
(Manzo, 2010), lo cual reduciría el saqueo ilegal en las
poblaciones silvestres. El propósito del presente estudio
es desarrollar una nueva estrategia, mediante la aplicación
de metodologías para acelerar el proceso de germinación
in vitro de cactáceas, aprovechando las propiedades
físicas y químicas de zeolitas naturales, como una buena
alternativa de sustrato que ayudaran a incrementar la tasa
de germinación de las especies de cactáceas.
En base a este objetivo se planteo la siguiente hipótesis: los
tratamientos aplicados a zeolitas naturales incrementan en
forma significativa la tasa de germinación de las especies
de cactáceas en el estudio.
Material vegetal
Las especies de cactáceas evaluadas fueron: Astrophytum
capricorne (A. Dietr.) Britton & Rose, Astrophytum
myriostigma Lem. (ambas endémicas y bajo estatus
An option to meet those specific needs is natural zeolites
which are minerals of the hydrated aluminosilicates group
with pore structure, with high moisture holding capacity and
cationic exchange. These physical and chemical properties
make them an attractive substrate in agriculture (Allen and
Ming, 1995; Urbina et al., 2006) and for the cultivation of
cacti and other plants, but in Mexico, information about
zeolites as abundant and cheap natural substrate is minimal
for the species in general, and zero for the case of the
production and propagation of cacti.
The in vitro culture techniques allow mass and commercial
propagation of several horticultural interest species (Thorpe,
1981), therefore, in vitro germination of ornamental cacti with
high market demand can have a high impact in terms of their
industrial use and also in their in situ conservation (Molina et al.,
2005), supplying the high demand in the market (Manzo, 2010),
which would reduce looting on their wild populations. The
purpose of this study is to develop a new strategy by applying
methodologies to accelerate the process of in vitro germination
of cacti, taking advantage of physical and chemical properties of
natural zeolites as a good alternative substrate to help increase
the rate of germination of species of cacti.
Based on this objective, the following hypothesis was
proposed: the treatments applied to natural zeolites
significantly increased the germination rate of the species
of cacti in involved in the present study.
Vegetal materials
Cacti species evaluated were: Astrophytum capricorne (A.
Dietr.) Britton & Rose, Astrophytum myriostigma Lem. (both
endemic and in threatened status according to NOM-ECOL059-2001-SEMARNAT), Echinocereus reichenbachii
(Terscheck ex Walp.) Haage, Escobaria dasyacantha
(Engelm) Britton & Rose, Mammillaria prolifera (Mill.)
Haw. and Sclerocactus scheeri (Salm-Dyck) N. P. Taylor.
Seeds were provided by Dr. Alfredo Flores Valdés (Senior
Researcher at CINVESTAV, Saltillo Unit), from his collection
registered under Num. MX/VIV-CO-132/COAH.
amenazada de acuerdo a la NOM-ECOL-059-2001SEMARNAT), Echinocereus reichenbachii (Terscheck
ex Walp.) Haage, Escobaria dasyacantha (Engelm)
Britton & Rose, Mammillaria prolifera (Mill.) Haw.
y Sclerocactus scheeri (Salm-Dyck) N. P. Taylor. Las
semillas fueron proporcionadas por el Dr. Alfredo Flores
Valdés (Profesor investigador del CINVESTAV, Unidad
Saltillo), procedentes de su colección registrada bajo el
Núm. MX/VIV-CO-132/COAH.
Criterio de la selección de especies
La selección de especies para el estudio fue efectuado en
base su adaptabilidad, su potencial e importancia ecológica
y ornamental. Además las especies mencionadas se
encuentran presentes dentro de las áreas naturales protegidas
de zonas desérticas del noreste de México consideradas
de gran riqueza y diversidad de cactáceas, de acuerdo a lo
reportado por Carmona et al. (2008), tomando en cuenta
las siguientes características: a) mínimo nodricismo; b)
asociación a sustrato rocoso; c) alta tasa de crecimiento; d)
valor ornamental; e) endemismo; f) especies en peligro de
extinción; y g) valor ecológico.
Sustratos y tratamientos
Se evaluó el tamaño de las partículas de sustrato para
establecer una relación con la eficiencia en la toma de
nutrientes por la planta, expresado en el porcentaje, velocidad
e índice de germinación. Para esto se tamizó la zeolita a tres
granulometrías de sustratos: fina (de 0.71 a 1 mm), mediana
(de 1.01 a 2 mm) y gruesa (de 2.01 a 3.36 mm de calibración).
Se realizó la siembra en cada granulometría.
En total se aplicaron nueve tratamientos. Los tratamientos 1 a
3 consistieron en 10 g de zeolita de cada una de las respectivas
granulometrías, más 10 mL de agua destilada. En el caso de
los tratamientos 4 al 6, se usaron 10 g de zeolita de cada una
de las respectivas granulometrías y fue humedecida con 10
mL de sales básicas del medio Murashige y Skoog (MS),
señalado como MS al 50% de su concentración original. Se
ajustó el pH del medio a pH 5.7. Para los tratamientos 7 y 8,
se usaron las sales básicas del medio MS al 50% y agar (4 g
L-1) con y sin sacarosa (10 g L-1) respectivamente (10 mL por
frasco). Finalmente, para el tratamiento 9 se usó agar-agua
(4 g L-1) a razón de 10 mL por frasco (Cuadro 1). Todos los
tratamientos fueron esterilizados a 121 °C y 15 libras de
presión por 15 min.
Species selection criteria
The selection of species for this study was conducted based
on their adaptability, ecological importance and their
potential as ornamentals. Besides the above, the indicated
species are present within the protected areas of desert areas
of northeastern Mexico considered of great richness and
diversity of cacti, according to that reported by Carmona et
al. (2008), taking into account the following characteristics:
a) minimum nodricism; b) association to rocky substrate;
c) high growth rate; d) ornamental value; e) endemism; f)
endangered species, and g) ecologic value.
Substrates and treatments
It was evaluated the particle size of substrate to establish
a connection with the efficiency of nutrient uptake by
the plant, expressed in percentage, speed and rate of
germination. For this zeolite was sieved to three particle
sizes of substrates: fine (from 0.71 to 1 mm), medium (from
1.01 to 2 mm) and coarse (2.01 to 3.36 mm of calibration).
The sowing was carried out in each indicated zeolite size.
A total of nine treatments were applied. The treatments 1
to 3 consisted of 10 g of zeolite for each of the respective
particle sizes, plus 10 mL of distilled water. In the case
of treatment 4 to 6 were used 10 g of zeolite for each of
the respective particle sizes and was moistened with 10
mL of basic salts of Murashige and Skoog (MS) medium,
designated as MS 50% of their original concentration. The
pH of the medium was adjusted at pH 5.7. For treatments 7
and 8, were used basic salts of MS medium at 50% and agar
(4 g L-1) with and without sucrose (10 g L-1) respectively
(10 mL per bottle). Finally, for the treatment 9 was used
agar-water (4 g L-1) at 10 mL per bottle (Table 1). All
treatments were sterilized at 121 °C and 15 pounds of
pressure for 15 min.
Before sowing, seeds were submerged in sterile distilled
water for 10 min, followed by absolute ethyl alcohol for 30
s. They were then disinfected with a solution of commercial
sodium hypochlorite (Cloralex®) diluted to 20% (v/v)
containing 0.1% Tween 20 for 15 min. Subsequently,
and under aseptic conditions, the seeds were rinsed again
with 500 mL of sterile distilled water and were placed for
germination in glass bottles (35 mL). The culture conditions
were: photoperiod 12 h light and 26 ±1 °C in a growth
chamber (SEV model INLC 297).
569
Antes de la siembra, las semillas fueron sumergidas en
agua destilada estéril por 10 min, seguido de alcohol etílico
absoluto por 30 s. A continuación fueron desinfectadas con
una solución de hipoclorito de sodio comercial (Cloralex®)
diluido al 20% (v/v), conteniendo 0.1% de Tween 20 por
15 min. Posteriormente y bajo condiciones asépticas, las
semillas se enjuagaron nuevamente con 500 mL de agua
destilada estéril y fueron colocadas para su germinación en
frascos de vidrio (35 mL). Las condiciones de cultivo fueron:
fotoperiodo de 12 h luz y 26 ±1 °C en cámara de crecimiento
(SEV modelo INLC 297).
Cuadro 1. Composición de tratamientos para el cultivo in
vitro de seis especies de cactáceas.
Table 1. Composition of treatments for in vitro culture of
six species of cacti.
Para llevar a cabo el proceso de germinación, cada
tratamiento consistió de cinco repeticiones cada uno con
5 semillas. El 2 de marzo de 2009 se realizó la siembra
y diariamente se registró la germinación durante 20 días,
posteriormente se determinó el porcentaje final, índice
y velocidad de germinación, de acuerdo con González y
Orozco (1996).
Diseño experimental y análisis estadístico
El mecanismo de germinación se efectuó bajo la aplicación
de un diseño factorial en bloques completamente al azar,
donde el factor A esta conformado por 6 especies y el factor
B por 9 combinaciones de sustratos como tratamientos.
Para poder realizar el análisis de varianza (ANOVA) bajo
un modelo factorial, los resultados sobre el porcentaje
de germinación fueron transformados en arcoseno de la
raíz cuadrada, de acuerdo con Zar, (2010). Los efectos
principales de los factores fueron determinados, así mismo
que los valores promedios fueron comparados.
Las variables de respuesta evaluadas fueron: porcentaje
final de germinación, velocidad de germinación (M) e índice
de germinación (IG); la velocidad e índice de germinación
se calcularon de acuerdo con González y Orozco (1996),
mediante las siguientes ecuaciones:
a) IG = Σ (niti)/N y b) M= Σ (ni)/t
Donde: IG= índice de germinación, definido como la medida
del tiempo de germinación en relación con la capacidad
germinativa; ni= número de semillas germinadas en el día i;
ti= número de días después de la siembra; N= total de semillas
sembradas; M= velocidad de germinación, definida como la
relación del número de semillas germinadas con el tiempo
de germinación; t= tiempo de germinación desde la siembra
Tratamiento
Sustrato
Humedecido con 10 mL de:
1
zeolita fina Agua destilada
2
zeolita mediana Agua destilada
3
zeolita gruesa Agua destilada
4
zeolita fina Medio MS 50%
5
zeolita mediana Medio MS 50%
6
zeolita gruesa Medio MS 50%
7
Agar
Medio MS 50% + 10 g sacarosa
8
Agar
Medio MS 50%
9
Agar
Agua destilada
Zeolita fina= partículas de 0.71 a 1 mm; zeolita mediana= 1.1 a 2 mm; zeolita
gruesa= 2.1 a 3.36 mm de calibración.
In order to experimentally evaluate the germination process,
all the treatments consisted of five replicates, each one
integrated with 5 seeds. On March 2th, 2009, the sowing was
made and the germination was recorded daily for 20 days,
later, the final percentage, index and speed germination
were determined, according to González and Orozco (1996).
Experimental design and statistical analysis
The germination process was experimentally evaluated
through randomized complete block design with factorial
arrangement, where the factor A consisted of 6 species and
the factor B for 9 combinations of substrates and treatments.
To perform the analysis of variance (ANOVA) under a
factorial model, the results related with the percentage of
germination were transformed into arc-sine square root,
according to Zar (2010). The main effects of the factors were
determined by the statistical procedure known as means test.
The response variables evaluated were: final germination
percentage, germination rate (M) and germination index
(GI); the speed and germination index were calculated
according to González and Orozco (1996), by the following
equations:
a) GI = Σ (niti)/N y b) M= Σ (ni)/t
Where: GI= germination index, defined as the timing of
germination in relation to germination capacity; ni= number
of seeds germinated on day I; ti= number of days after
hasta la germinación de la última semilla. De acuerdo con
este índice, entre mayor es el valor calculado, mayor es la
velocidad a la que ocurre la germinación de las semillas.
Los resultados sobre porcentaje, velocidad e índice de
germinación se sometieron a un análisis de varianza (en un
diseño de bloques completamente al azar) y comparación
múltiple de medias por el método de Tukey (Zar, 2010),
mediante el paquete estadístico SPSS, (2006), vers. 15.0. El
nivel de significancia para los análisis fue de 5%.
RESULTADOS
Los resultados obtenidos sobre el proceso de germinación,
indican que la especie E. dasyacantha fue la de mayor
porcentaje de germinación (92.59%) en comparación con M.
prolifera con 22.96%. Esta última especie fue considerada
de muy baja tasa de germinación. El análisis de varianza
mostró diferencias altamente significativas (F= 7.036, p<
0.01) para porcentaje, velocidad (F= 7.767, p< 0.01) e índice
de germinación (F= 4.298, p< 0.01).
De acuerdo al ANOVA y comparación múltiple de medias de
Tukey, las semillas del tratamiento con agar + MS, obtuvieron
altos valores en porcentaje (63.33 ±3.95%), velocidad (0.48)
e índice de germinación (5.46) para las seis especies, seguido
del tratamiento con zeolita granulometría media + MS, donde
se obtuvo 57.78% de germinación; asimismo, los tratamientos
de zeolitas + MS y los 3 tratamientos con agar conformaron
un grupo estadísticamente similares (p≤ 0.05). Por otro lado,
los 3 tratamientos de zeolitas + agua destilada establecieron
un grupo estadísticamente diferente; el tratamiento con zeolita
gruesa + agua destilada arrojó el porcentaje de germinación
más bajo con 25.56% (Cuadro 2 y Figura 1).
sowing; N= total number of seeds sown; M= germination
rate, defined as the ratio of the number of germinated seeds
with germination time; t= germination time from sowing
until the last seed germination. According to this index, the
greater is the calculated value, the greater the speed at which
occur the seed germination.
The results on percentage, germination speed and rate were
subjected to analysis of variance (in a completely random
block design) and multiple comparison of means by Tukey
method (Zar, 2010), using the statistical package SPSS (2006),
ver. 15.0. The level of significance for the analyzes was 5%.
RESULTS
The results obtained on the germination process, indicate
that the species E. dasyacantha had the highest germination
percentage (92.59%) compared to M. prolifera with 22.96%.
The latter species was considered very low germination rate.
Analysis of variance showed highly significant differences
(F= 7.036, p< 0.01) for percentage, rate (F= 7.767, p< 0.01)
and germination index (F= 4.298, p< 0.01).
According toANOVAand multiple Tukey means comparison,
seed treatment + MS agar, showed high values in percentage
(63.33 ±3.95%), speed (0.48) and germination index (5.46)
for the six species, followed by the zeolite treatment with
mean particle size + MS, which yielded 57.78% germination;
also treatments of zeolites + MS and the 3 treatments with
agar, formed a group statistically similar (p≤ 0.05). On the
other hand, the 3 treatments of zeolites + distilled water
established a statistically different group, the treatment
with zeolite thick + water distilled, showed the lowest
germination percentage with 25.56% (Table 2 and Figure 1).
Cuadro 2. Porcentaje, velocidad e índice de germinación para nueve tratamientos del cultivo in vitro.
Table 2. Percentage, speed and germination index for nine treatments from in vitro culture.
Tratamiento
1. Zeolita fina + agua
2. Zeolita media + agua
3. Zeolita gruesa + agua
4. Zeolita fina + MS[½]
5. Zeolita media + MS[½]
6. Zeolita gruesa + MS[½]
7. Agar + MS[½]+sacarosa
8. Agar + MS[½]
9. Agar
Germinación (%)
27.38 ±6.02 cd
36.67 ±7.45 bcd
25.56 ±6.12 d
50 ±4.48 abc
57.78 ±4.95 ab
44.44 ±5.27 abcd
51.11 ±5.47 abc
63.33 ±3.95 a
54.44 ±5.56 ab
Velocidad de germinación
0.23 ±0.06 cd
0.3 ±0.07 bcd
0.2 ±0.06 d
0.36 ±0.07 abc
0.41 ±0.07 ab
0.33 ±0.06 bcd
0.42 ±0.08 ab
0.48 ±0.07 a
0.37 ±0.07 abc
Letras diferentes en columna indican diferencias significativas (p≤ 0.05) entre los valores promedio.
Índice de germinación
2.83 ±0.68 bc
2.93 ±0.59 abc
2.19 ±0.48 c
4.59 ±0.36 abc
5.23 ±0.33 ab
3.97 ±0.41 abc
3.98 ±0.38 abc
5.46 ±0.41 a
5.3 ±0.47 ab
En cuanto a la comparación múltiple de medias por
especie, se formaron cuatro grupos diferentes para la
variable porcentaje, el primero conformado sólo por
E. dasyacantha; la cual obtuvo la mejor respuesta
germinativa (92.59%) y velocidad de germinación (1.09);
el segundo lo integraron A. myriostigma con 54.07%
y 0.34 para las respectivas variables, y A. capricorne
(47.41 y 0.24 respectivos porcentaje y velocidad de
germinación); sin embargo, el índice de germinación
mostró valores estadísticamente iguales para 5 especies
(A. capricorne, A. myriostigma, S. scheeri, E. dasyacantha
y E. reichenbachii) (Cuadro 3).
DISCUSIÓN
Los resultados evidencian la conveniencia del uso de zeolita
natural en sustitución del agar, lo anterior debido que se
obtuvieron resultados estadísticamente similares en la
571
A)
B)
C)
Figura 1. Germinación in vitro de Sclerocactus scheeri bajo
diferentes tratamientos. A) zeolita media + MS; B)
Agar + MS; y C) zeolita gruesa + agua destilada.
Figure 1. In vitro Germination under different treatments: A)
Medium Zeolite + MS, B) Agar + MS; and C) thick
Zeolite + distilled water.
In relation with the multiple means comparison by species, It
was formed four different groups for the percentage variable,
the first conformed only by E. dasyacantha, which reached
the best germination answer (92.59%) and germination
Cuadro 3. Comparación del porcentaje, velocidad e índice de germinación en cactáceas cultivada in vitro.
Table 3. Comparison of percentage, speed and germination index in cacti in vitro cultivated.
Especie
A. capricorne
A. myriostigma
S. scheeri
E. dasyacantha
E. reichenbachii
M. prolifera
Germinación (%)
47.41 ±3.71 bc
54.07 ±3.12 b
27.41 ±3.62 d
92.59 ±2.8 a
31.85 ±3.99 cd
22.96 ±3.57 d
Velocidad de germinación
0.24 ±0.02 bc
0.34 ±0.02 b
0.12 ±0.02 cd
1.09 ±0.03 a
0.17 ±0.02 cd
0.1 ±0.02 d
Índice de germinación
5.16 ± 0.38 a
5.27 ±0.43 a
3.26 ±0.43 ab
4.45 ±0.18 ab
3.36 ±0.44 ab
2.85 ±0.42 b
Letras diferentes en columna indican diferencias significativas (p≤ 0.05) entre los valores promedio.
germinación de las seis especies de cactáceas con 63.33%
y 57.78% con agar y zeolita, respectivamente; al respecto
Martínez et al. (2006), mencionan la existencia de alternativas
viables para la sustitución del agar en el cultivo in vitro, mediante
el uso de sustratos inertes como agrolita, vermiculita, y tezontle
en la obtención de patrones de cítricos, los autores mencionan
además, que la incorporación de dichos sustratos incrementa
la sobrevivencia 50% y en algunos casos hasta 100% al pasar
las plantas a macetas, ya que sus raíces no se dañan. Resultados
similares fueron reportados por Izquierdo et al. (2002),
quienes evaluaron diferentes sustratos en la aclimatación de
vitroplantas y microbulbillos de ajo; resultando la utilización
de la zeolita mezclada con materia orgánica un sustrato óptimo
que favoreció la supervivencia de las plantas, al parecer,
ligado con las propiedades químicas y físicas de este mineral.
rate (1.09), the second was composed by A. myriostigma
with 54.07% and 0.34 for the respective variables, and A.
capricorne (with 47.41 and 0.24 percentage and germination
rate respectively), but the germination index showed values
statistically equal to 5 species (A. capricorne, A. myriostigma,
S. scheeri, E. dasyacantha and E. reichenbachii) (Table 3).
DISCUSSION
The results show the suitability of natural zeolite as agar
substitute, because the above results were obtained statistically
similar in the germination of six species of cacti with 63.33%
and 57.78% with agar and zeolite, respectively, Martínez et
Las especies M. prolifera y E. reichenbachii mostraron
los valores más bajos para las variables evaluadas; al
respecto, factores internos de las semillas, como su
viabilidad (Enríquez et al., 2004) o tamaño (Sánchez et
al., 2006), pueden influir en su respuesta germinativa
(Venable y Pake, 1999); aún y cuando la semilla obtenida
para la realización del presente experimento fue colectada
poco antes de la siembra, para algunas semillas de
cactáceas la viabilidad es limitada en semillas frescas o
recién colectadas y aumenta a los dos o tres años, así lo
mencionaron Trejo y Garza (1993), quienes reportaron que
las semillas de Mammillaria heyderi de cero años de edad
tiene un porcentaje de germinación menor, a diferencia de
las de dos y tres años, por lo que es posible que las semillas
de E. reicheinbachii y M. prolifera, tuvieran embriones
inmaduros durante la prueba, ya que se colectaron 3 meses
antes.
El tamaño de partícula del sustrato o granulometría con
los mejores resultados fue la de textura media (1- 2 mm),
lo que coincide con lo reportado por Ansorena (1994),
quien menciona que el tamaño óptimo de partículas
para sustratos hortícolas está entre 0.25 y 2.5 mm y con
Gislerød (1997), quien menciona que el desarrollo de las
raíces primarias y secundarias se ve favorecido al mejorar
el suministro de oxígeno con sustratos de partículas de
tamaño uniforme, tal como se observó en la presente
investigación, en relación con mezclas de partículas de
diferentes tamaños.
La zeolita en textura gruesa (2.01-3.36 mm) fue el
tratamiento con el menor porcentaje de germinación. Al
respecto, Santos et al. (2004), mencionan que la textura
fina es importante para permitir buen contacto entre las
semillas (especialmente si son pequeñas) y la humedad
de la mezcla, fomentando la germinación. No obstante,
la zeolita en textura fina (0.71-1 mm) retuvo en exceso
el agua aplicada, por lo que se observó un decremento en
la germinación de las semillas de cactáceas debido a la
saturación del sustrato, puesto que se necesita una mezcla o
sustrato que sea permeable, que absorba el agua pero que no
retenga los excesos como su característica más importante
(Santos et al., 2004).
Estos estudios han sido considerados por algunos autores
como importantes contribuciones en la conservación de
especies vegetales en peligro de extinción, así lo refieren
Molina et al. (2005), al realizar la conservación in vitro
de cinco especies de cactáceas de Guatemala en peligro
al. (2006), informed the existence of viable alternatives for
replacing the agar in the in vitro culture, using inert substrates
such as perlite, vermiculite and volcanic rock in obtaining
patterns of citrus, the authors refer also that the incorporation of
these substrates increases survival 50% and in some cases up to
100%, from potted plants because their roots are not damaged.
Similar results were reported by Izquierdo et al. (2002), who
evaluated different substrates in the acclimatization of
vitro-plantlets and micro bulbs of garlic, resulting in the use
of a mixture of zeolite and organic matter like an optimal
substrate that favored the survival of plants, apparently due
to the chemical and physical properties of this mineral.
M. prolifera and E. reichenbachii showed the lowest values
for the variables assessed and in this regard, internal factors
of the seeds, as their viability (Enríquez et al., 2004) or size
(Sánchez et al., 2006), may influence their germination
response (Venable and Pake, 1999), even if the seed obtained
to conduct this experiment was collected just before sowing.
For some cactus seeds viability is limited when they are
extracted from fresh fruits, increasing their germination
capacity after two or three years, as indicated Trejo and Garza
(1993), who reported that the seeds of Mammillaria heyderi
of zero years of age have a lower germination percentage,
in contrast with seed of the same species of two and three
years old in which the germination index was higher, so it is
possible that the seeds of E. reicheinbachii and M. prolifera,
involved in this work had immature embryos, due that they
were collected 3 months before.
The substrate particle size or granulometric texture with the best
results was the medium textured (1-2 mm), which is consistent
with that reported by Ansorena (1994), who mentions that the
optimum particle size for horticultural substrates is between
0.25 and 2.5 mm and agree with Gislerød (1997), who states
that the development of primary and secondary roots is
enhanced to improve the oxygen supply with substrate particles
of uniform size, as observed in this investigation, in relation to
mixtures of particles of different sizes.
The zeolite of coarse texture (2.01-3.36 mm) was the
treatment with the lowest percentage of germination.
Thereon, Santos et al. (2004), report that the fine texture
is important to allow good contact between the seeds
(especially if they are small) and the humidity of the
mixture, promoting germination. However, the zeolite
with fine texture (0.71 to 1 mm) retained water applied in
excess, so that there was a decrease in seed germination
cactus due to saturation of the substrate, since it requires
573
de extinción. Además, se genera información valiosa para
aquellas personas que quieran dedicarse a su cultivo y
exportación, evitando con ello la extinción de las especies.
a mixture or substrate enough permeable to absorb water,
but that does not retain the excess as its most important
characteristic (Santos et al., 2004).
CONCLUSIONES
Los tratamientos conformados por Agar + medio Murashige
Skoog (MS) y zeolita en granulometría media + medio MS,
fueron los que obtuvieron mejores resultados en cuanto a
porcentaje, velocidad e índice de germinación para las seis
especies de cactáceas; asimismo, de las granulometrías
evaluadas, la zeolita con granulometría media (de 1 a 2 mm)
proporcionó los mejores resultados para la germinación
de las cactáceas.
Con estos resultados se muestra la conveniencia de usar zeolitas
naturales como alternativa de sustrato en la germinación de
cactáceas, al lograr resultados estadísticamente similares
en ambos medios de cultivo, ya sea zeolita o agar (medio
convencional de cultivo in vitro), destacando además, que se
trata de un recurso natural de bajo costo, poco aprovechado
a la fecha, abundante y relativamente fácil de extraer y con
las características ideales de un sustrato, para el óptimo
establecimiento y desarrollo de las plántulas. Además se
facilita la implementación de acciones de conservación in vitro
de cactáceas y de otras especies vulnerables o en peligro de
extinción, aprovechando lo redituable de las zeolitas debido
a su abundancia y fácil obtención.
Finalmente, los resultados obtenidos demuestran que la
incorporación de sustratos alternativos al agar, para el cultivo
in vitro es una buena opción para la germinación de especies
de cactáceas, por lo que se sugiere realizar futuros estudios del
uso de zeolita en otras especies de importancia ornamental,
ecológica e industrial. Así mismo, es necesario desarrollar
estudios puntuales acerca de las propiedades físicas y químicas
de las zeolitas naturales, con la finalidad de comprender los
efectos sobre la germinación y desarrollo de dichas especies.
AGRADECIMIENTOS
Al Consejo Nacional de Ciencia y Tecnología (CONACYT),
a través del proyecto 51739 y al proyecto de PAICYT
Proyecto CN-427-10, por el apoyo económico para la
realización de esta investigación.
According to Molina et al (2005), studies like this, have been
considered by several researchers as important contributions
to the conservation of plant species in danger of extinction.
Performing in vitro conservation of five species of cacti from
Guatemala in danger of extinction, they provided valuable
information for those who want to engage in its cultivation
and export, thereby preventing the extinction of plant species.
CONCLUSIONS
The treatments comprised of Agar + Murashige Skoog (MS)
and zeolite with mean particle size + MS medium, were the
best performing in terms of percentage, speed and germination
index for the six species of cacti, also among those evaluated
grain size , the zeolite with medium particle size (1 to 2 mm)
provided the best results for germination of cacti.
These results show the convenience of using natural zeolite as
an alternative substrate in the germination of cacti, achieving
results statistically similar in both culture media, either
agar or zeolite (as components of conventional mixtures
for in vitro culture), noting also that the last one is a natural
resource of low cost, little used to date, abundant, relatively
easy to extract and with ideal characteristics as substrate for
optimal establishment and development of seedlings. It also
facilitates the implementation of conservation actions in vitro
of cacti and other vulnerable or endangered species, taking
advantage of zeolite profitability because of its abundance
and readily available.
Finally, the results of the present work show that the
incorporation of alternative substrates as agar substitutes
for in vitro cultivation is a good choice for germination
of some species of cacti, so future studies about the use of
zeolite involving other species with ornamental, ecological
and industrial importance are suggested. It is also necessary
to develop specific studies about the physical and chemical
properties of natural zeolites, in order to understand the
effects on germination and development of such species.
LITERATURA CITADA
Allen, E. R. and Ming, D. W. 1995. Recent progress
in the use of natural zeolites in agronomy and
horticulture. In: Ming, D. W. and Mumpton, F. A.
(ed.), Natural zeolites ‘93: occurrence, properties,
use. International Committee on Natural Zeolites,
Brockport, New York. 477-490 pp.
Andrade, R. M.; Ayala, H. J. J.; Alia, T. I.; Rodríguez, M.
H.; Acosta, D. C. M. y López, M. V. 2008. Efecto
de promotores de la germinación y sustratos en el
desarrollo de plántulas de papayo. Rev. Fac. Agron.
(25):617-635.
Ansorena, M. J. 1994. Sustratos: propiedades y caracterización.
Mundi Prensa. Madrid, España. 172 p.
Arias, S. 1993. Cactáceas: conservación y diversidad
en México. In: Gío, A. R. y López, O. E. (eds.)
Diversidad Biológica en México. Revista de la
Sociedad Mexicana de Historia Natural. Vol. Esp.
(XLIV):109-115.
Bunt, A. C. 1988. Media and mixes for container-grown
plants. In: a manual on the preparation and use of
growing media for pot plants. Hyman, U. (ed.).
London. 309 p.
Carmona, M. P.; Foroughbakhch, P. R.; Flores, V. A.;
Alvarado, V. M. A. y Guzmán, L. M. A. 2008. Flora
cactológica y especies asociadas en el área natural
protegida Sierra corral de los bandidos, Nuevo
León, México. Revista Mexicana de Biodiversidad.
(79):307-323.
Enríquez, P. E.; Suzán, A. H. y Malda, B. G. 2004.
Viabilidad y germinación de semillas de Taxodium
mucronatum (Ten.) en el estado de Querétaro,
México. Agrociencia. 38:375-381.
Gislerød, H. R. 1997. Efect of aereation on rooting and
growth of roses. Acta Hortic. (450):113-122.
González, Z. L. y Orozco, S. A. 1996. Métodos de análisis
de datos en la germinación de semillas, un ejemplo:
Manfreda Brachystachya, Boletín de la Sociedad
Botánica de México. (58):15-30.
Guzmán, U.; Arias, S. y Dávila, P. 2007. Catálogo de
cactáceas mexicanas, Universidad Nacional
Autónoma de México (UNAM) y Comisión
Nacional para el Conocimiento y Uso de la
Biodiversidad (CONABIO), 1ra reimpresión. D.
F., México. 315 p.
Hunt, D. 1999. CITES Cactaceae cheacklist. 2nd edition.
Kew: Royal Botanic Gardens. Kew. 315p.
Izquierdo, H.; Quiñones, Y.; Disotuar, R. y Pedroso, D.
2002. Evaluación de diferentes sustratos en la
aclimatización de vitroplantas y microbulbillos
de ajo (Allium sativum L.). Cultivos Tropicales.
23(3):63-69.
Manzo, R. S. 2010. Propagación in vitro de Mammillaria
Coahuilensis var. coahuilensis Boedeker (Moran)
y Echinocereus plathyacanthus Link y Otto, a
partir de semilla para su conservación. Colegio de
Postgraduados en Ciencias Agrícolas. 62 pp.
Martínez, H. M. J.; Alonso, L. A.; Osorio, A. F.; Gallardo,
L. F.; López, M. H. y Mata, R. M. 2006. Cultivo in
vitro de patrones de cítricos tolerantes al virus de la
tristeza, empleando sustratos inertes alternativos al
agar. Interciencia. 31(8):616-619.
Molina, M. L. G.; Sagastume, M. H. A. y Suchini, F. A. E.
2005. Conservación in vitro de cinco especies de
cactáceas en peligro de extinción de Guatemala,
distribuidas en los Departamentos de el Progreso y
Zacapa. ICTA. 60 pp.
Murashige, T. y Skoog, F. 1962. A revised medium for rapid
growth and bioassay with tobacco tissue cultures.
Physiologia Plantarum. (15):473-479.
Norma Oficial Mexicana. (NOM-059-SEMARNAT-2001).
2003. Protección ambiental-especies nativas de
México de f lora y fauna silvestres-categorías
de riesgo y especificaciones para su inclusión,
exclusión o cambio-lista de especies en riesgo.
Diario Oficial de la Federación. D. F., México.
Reyes, S. J.; Gutiérrez, de la R. A. y Sevilla, B. J. 2001.
Producción de cactáceas y suculentas mexicanas.
Cuadernos de comunicación sindical. Núm. 63. 23 pp.
Sánchez, S. J.; Flores, J. y Martínez, G. E. 2006. Efecto
del tamaño de semilla en la germinación de
Astrophytum myriostigma Lemaire. (Cactaceae),
especies amenazada de extinción. Interciencia.
31(5):371-375.
Santos, A. H.; Velasco, C. M. y Alanís, F. G. 2004.
Propagación de cactáceas y suculentas. In:
Foroughbakhch, R.; Torres, C. T. y Alvarado, V.
M. 2004. Tópicos selectos de Botánica, 1ra Jornada
de Actividades Botánicas Dra. María Ana Garza
Barrientos. Universidad Autónoma de Nuevo León.
México. 119-160 pp.
SPSS Inc. 2006. SPSS for Windows, version 15.0 Inc.,
Chicago, USA.
Thorpe, T. A. 1981. Plant tissue culture: methods and
applications in agriculture. Academic Press. New
York, USA. 379 p.
575
Trejo, L. y Garza, M. 1993. Efecto del tiempo de
almacenamiento en la germinación de semillas
de Mammillaria heyderi Muchl. en 4 sustratos.
BIOTAM. 5(3):19-24.
Urbina, S. E.; Baca, C. G.; Núñez, E. R.; Colinas,
L. M.; Tijerina, C. L. y Tirado, T. J. 2006.
Cultivo hidropónico de plántulas de jitomate en
zeolita cargada con K+, Ca2+ o Mg2+ y diferente
granulometría. Agrociencia. (40):419-429.
Velázco, M. C. G. 2009. Flora del estado de Nuevo León,
México: diversidad y análisis espacio-temporal.
UANL. 299 pp.
Venable, D. L. y Pake, C. E. 1999. Population ecology
of desert plants. In: ecology of desert plants.
Robichaux R. H. (ed.). The University of Arizona
Press. USA. 115-142 pp.
Zar, J. H. 2010. Biostatistical analysis. 5ta ediction. Pearson
Prentice-Hall. Upper Saddle River, N. J. 944 pp.
EFECTO DE LA ASPERSIÓN DE ÁCIDO GIBERÉLICO EN EL CRECIMIENTO
DE CINCO CULTIVARES DE NOCHEBUENA*
EFFECT OF GIBBERELLIC ACID SPRAYS ON GROWTH
OF FIVE POINSETTIA CULTIVARS
Iran Alia-Tejacal1§, Luis Alonso Valdez-Aguilar2, Elio Campos-Bravo1, Manuel de Jesús Sainz-Aispuro1, Gloria Alicia PérezArias1, María Teresa Colinas-León3, María Andrade-Rodríguez1, Víctor López-Martínez1 y Andrés Alvear-García1
Posgrado en Ciencias Agropecuarias y Desarrollo Rural. Facultad de Ciencias Agropecuarias. Universidad Autónoma del Estado de Morelos. Avenida Universidad
Núm. 1001. Cuernavaca, Morelos. C. P. 62209. Tel. 01 777 1345402. ([email protected]), ([email protected]), ([email protected]), (andradem65@
hotmail.com), ([email protected]), ([email protected]). 2Departamento de Horticultura. Universidad Autónoma Agraria Antonio Narro. Calzada Antonio
Narro 1923. Saltillo, Coahuila, C. P. 25315. Tel. 01 844 2223675. ([email protected]). 3Departamento de Fitotecnia. Universidad Autónoma Chapingo. Carretera
México-Texcoco, km 38.5. Chapingo, Estado de México. C. P. 56230. Tel. 01 595 9517682. ([email protected]). §Autor para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
En 2010 se realizaron aplicaciones de Ácido Gibérelico
(AG), con dosis de 0 y 10 mg L-1 a siete y 14 días después
del trasplante, fueron asperjados en cinco variedades de
nochebuena (Euphorbia pulcherrima Willd. ex Klotz),
‘Sonora’, ‘Da Vinci’, ‘Freedom White’, ‘Freedom Red’ y
‘Festival Red’; se evaluó el efecto en la altura de planta,
número de brotes, altura de brote, diámetro de inflorescencia y
planta, color de brácteas (luminosidad, cromaticidad y matiz)
y concentración de clorofilas (unidades SPAD). Analizando
los factores individuales, los resultados indicaron que la altura
de las plantas se incrementó de 15 a 20%, cuando se aplicó en
una ocasión y de 21 a 30% cuando se realizó en dos ocasiones.
La altura de la planta se incrementó significativamente a partir
de dosis de 2 mg L-1 (p≤ 0.05). La altura del brote fue mayor
cuando se realizaron dos aplicaciones y dosis mayores de 2 mg
L-1; mientras que el diámetro de inflorescencia disminuyó sólo
en la variedad ‘Freedom White’después de aplicar 2 mg L-1 en
dos ocasiones, lo que sugirió un efecto negativo en la calidad
comercial de la planta. El color de las brácteas y concentración
de clorofila, no fueron afectados por la aplicación de AG. Se
concluye que las dosis de aplicación incrementó la altura de
plantas de nochebuena, sin afectar la calidad de la planta
In 2010 gibberellic acid (GA) was foliar sprayed at
concentrations from 0 to 10 mg L-1 in single applications
(seven days after transplant) or double applications
(seven and 14 days after transplant) in five poinsettia
cultivars (Euphorbia pulcherrima Willd. ex Klotz):
‘Sonora’, ‘Da Vinci’, ‘Freedom White’, ‘Freedom Red’
and ‘Festival Red’. The effects on plant height, number
of branches, branch length, plant and inf lorescence
diameter, bract color (lightness, chrome, and hue) and
chlorophyll concentration (SPAD units) were studied.
Analyzing the factors separately, the results indicated
that plant height increased 15% to 20% when plants were
sprayed once and 21% to 30% when plants were sprayed
twice. Plant height increased significantly when GA
concentration was 2 mg L-1 or higher (p≤ 0.05). Branch
length was larger when plants were sprayed twice and
GA concentration was higher than 2 mg L -1, whereas
inf lorescence diameter decreased only in ‘Freedom
White’, which suggested a deleterious effect in plant
quality. Bract color and chlorophyll concentration were
unaffected by GA sprays. In conclusion, GA increased
plant height without affecting plant quality in the cultivars
* Recibido: junio de 2011
Iran Alia-Tejacal et al.
en los cultivares evaluados cuando la concentración estuvo
entre 2 y 4 mg L-1 y se realizaron dos aplicaciones (siete y
14 días después del trasplante); sin embargo, es es necesario
realizar estudios sobre la firmeza de los brotes a fin de definir
si el AG no afecta otros parámetros de calidad.
studied when concentration was between 2 and 4 mg L-1
and when solutions were sprayed twice (seven and 14 days
after transplant), nonetheless, it is necessary to elucidate if
GA does not affect other quality parameters such as stem
firmness in follow up experiments.
Palabras clave: Euphorbia pulcherrima, altura, matiz,
reguladores del crecimiento.
Key words: Euphorbia pulcherrima, growth regulators,
height, hue.
INTRODUCCIÓN
INTRODUCTION
La altura de planta de nochebuena (Euphorbia pulcherrima
Willd.), es un factor decisivo y variante en la venta de la
misma. La elongación del tallo y la altura de planta es
afectada por la temperatura, la luminosidad, la humedad
relativa, el nivel de riego, la fertilización, el espaciamiento,
la densidad de plantación y el vigor del cultivar (Ecke
et al., 2004). Cada año es un reto para los productores
de nochebuena establecer el balance de estos factores
para obtener la altura deseada. Desafortunadamente,
en ocasiones no se alcanza la altura óptima o se rebasa,
afectando la calidad de la planta debida que la planta es muy
pequeña o excede el tamaño apropiado, lo que dificulta su
manejo y transporte.
Plant height in poinsettia (Euphorbia pulcherrima
Willd.) is a quality critical issue that determines visual
attractiveness and marketing of plants. Shoot elongation
is affected by temperature, radiation, relative humidity,
watering practices, nutrition, plant density, and the vigor
of each cultivar (Ecke et al., 2004). Every year, poinsettia
growers face a challenging task to balance all these
horticultural and environmental factors in order to attain
optimum plant height. Unfortunately, optimum plant
height is frequently not attained or exceeded, affecting
plant quality if they are too small or making shipping and
handling of plants more difficult if they are excessively
large.
La atracción de los consumidores para comprar nochebuena
depende no solo de la altura de la planta, sino también del
tamaño, color de brácteas y hojas, además del precio del
producto (Catanzaro y Bhatti, 2006). Wilfret y Bell (1998),
indican que la altura ideal para plantas de nochebuena
desarrolladas en contenedores de 15 cm es entre 28 y 30.5
cm; sin embargo, Martínez (1995) sugiere que la planta debe
ser 2.5 a 3 veces mayor que el tamaño de la planta.
Enticing consumers for buying poinsettia plants depends
greatly not only on plant height but also on size and color
of bracts and leaves as well as on product price (Catanzaro
and Bhatti, 2006). Wilfret and Bell (1998) indicated that
ideal plant height in poinsettias grown in 15 cm pots is
from 28 to 30.5 cm; however, Martínez (1995) suggested
that plant height must be 2.5 to 3 times the pot height.
Para evitar que la planta de nochebuena crezca en exceso,
se han realizado trabajos para regular la altura de la
planta mediante el uso de estrés hídrico, pero se afecta
negativamente la calidad de la planta (Gilbertz et al.,
1984; Hartley, 1992). El manejo de la fertilización es otra
opción para manejar la altura de la planta; sin embargo, se
afecta negativamente el color de la planta (Ku y Hersey,
1996). Las opciones más viables hasta el momento ha sido
el uso de reguladores del crecimiento, así para controlar
que la planta no rebase el tamaño deseado se utilizan
compuestos comerciales como: cloromequat ((2-chlorotil)
trimetilamonio)), ancymidol (ciclopropil-4-(metoxifenil)
pirimidin-5-il-metanol), paclobutrazol ((2S, 3S)-1-(4-
To control excessive height research has been performed
to regulate plant growth through water stress, but quality
is severely impaired (Gilbertz et al., 1984; Hartley,
1992). Good fertilization practices are another option
to control plant height in poinsettia but bract color is
affected negatively (Ku and Hershey, 1996). Currently,
the most used technique for controlling excessive height
in poinsettia is through applications of growth retardants
such as cloromequat ((2-chlorothyl) trimethylammonium)),
ancymidol (cyclopropyl-4-(methoxyphenyl) pyrimidin-5yl-methanol), paclobutrazol ((2S, 3S)-1-(4-chlorophenyl)4,4-dimethyl-2-(1,2,4 (tryazol-1-yl)-3-pentanol), and
recently, ethephon (2.chloroethylphosphonic acid) (PérezLópez et al., 2005).
Efecto de la aspersión de ácido giberélico en el crecimiento de cinco cultivares de nochebuena
clorofenil)-4, 4-dimetil-2-(1, 2, 4, (triazol-1-il)-3-pentanol)
y recientemente el etefón (ácido 2-cloroetilfosfonico)
(Pérez-López et al., 2005).
Por otra parte, cuando los productores no tienen facilidades
para controlar el ambiente o cuando baja la temperatura base,
disminuye el consumo de energía de la planta que puede
resultar en una altura por debajo de los estándares de calidad,
que se requieren para su comercialización (Wilfret y Bell,
1998), por lo que se requiere la utilización de otros reguladores
de crecimiento para incrementar el tamaño. El ácido gibérelico
se ha utilizado para inducir la elongación de tallos, en el
desarrollo de nochebuena en forma de pequeños arboles; el
resultado es que los tallos son débiles, por lo cual son forrados
con alambre para que puedan soportar el peso del dosel (Dole
y Hawkins, 2005). Shanks (1980) indica la evidencia que la
aplicación de ácido gibérelico a dosis de 20 ó 40 mg L-1, puede
revertir el efecto negativo de bajas temperaturas y ayudar a
incrementar la altura de la planta, similar efecto se tiene en
cultivares de porte bajo, además ayuda a retrasar la abscisión
de brácteas, hojas e inflorescencia. Sin embargo, a la fecha
poca información se tiene al respecto de este regulador de
crecimiento (Ecke et al., 2004).
En Morelos la producción de plantas ornamentales en
contenedor o maceta, aporta 50% del producto interno
bruto del sector agropecuario, generando cerca de 24 000
empleos directos al año, ocho jornales por hectárea, sin
contar los empleos indirectos y temporales (García et al.,
2009). La nochebuena es la planta ornamental de maceta
con mayor número de plantas producidas en la entidad y
valor de producción (Cabrera y Orozco, 2003); en 2008 se
produjeron 4 743 500 plantas, en una superficie cultivada
de 74.6 ha, con un valor total de la producción de 83 516 400
pesos (OEIDRUS, 2010).
Cabrera et al. (2006), reportan 22 variedades comerciales
de nochebuena en el estado de Morelos. Actualmente
variedades como ‘Prestige’, ‘Orion Red’ y ‘Freedom’, en
sus diferentes colores, tienen una demanda igual o superior
a la ‘Supjibi’; hoy en día hay nuevas variedades tales como
‘Sonora White Glitter’, ‘Da Vinci’, ‘Monet’, entre muchas
más y que representan una opción diferente al color rojo
que siempre ha predominado en la demanda (García, 2008).
En Morelos, se requiere conocer sobre reguladores que
promuevan la elongación de los brotes cuando haya años
con temperaturas bajas, dado que la producción en la región
es principalmente bajo cubiertas plásticas o malla sobra
579
However, when poinsettia growers had no facilities for
temperature environmental control or when temperature
set point is decreased in order to reduce fuel consumption,
a cold fall season may result in plant height below the
accepted standards (Wilfret y Bell, 1998); in this case,
other growth regulators are required to promote plant
growth. Gibberellic acid (GA) has been used to promote
stem elongation when poinsettia is grown as mini trees,
however, the stems resulted to be weak and they have to
be wired so that canopy weight can be supported (Dole
and Wilkins, 2005). Shanks (1980) provided evidence
in which indicated that GA at 20 to 40 mg L-1 restore
the negative effect of low temperatures and increased
plant height, delaying bract, leaf, and cyathia abscission;
similar effects were observed in short-type cultivars.
Nonetheless, little information is available regarding the
potential use of GA as a growth regulator in poinsettia
(Ecke et al., 2004).
Morelos is a state in central Mexico in which potted plant
production accounts for 50% of total farming activities
and generates 24 000 direct jobs annually (eight jobs per
hectare), apart from indirect and temporary jobs (García et
al., 2009). Poinsettia is the largest potted plant cultivated
in Morelos and the most profitable (Cabrera y Orozco,
2003); in 2008, 4 743 500 potted poinsettias were grown
in 74.6 ha with an estimated value of 6 576 094 US dollars
(OEIDRUS, 2010).
Cabrera et al. (2006) reported that 22 poinsettia
cultivars are grown in Morelos. Currently, cultivars such
as ‘Prestige’, ‘Orion Red’ and ‘Freedom’ have higher
demand compared to ‘Supjibi’, the most demanded
cultivar in Mexico since the 80’s, however, recently
introduced cultivars such as ‘Sonora’, ‘Da Vinci’,
‘Monet’, and others, are receiving more attention by
growers and consumers because they are an alternative to
the traditional red colored bracts that have predominated
in the market (García, 2008).
In Morelos, a growth regulator to promote shoot elongation
may be required in years with cold fall seasons since
poinsettia is predominantly grown in greenhouses or
shade houses with no temperature control; however, there
are not reports regarding the efficacy of GA applications
or unwanted secondary effects. The present study was
conducted to elucidate the impact of GA on growth and
some quality parameters on five of the currently most
demanded poinsettia cultivars in México.
sin control de la temperatura; actualmente no se tienen
reportes de la aplicación y efecto del ácido gibérelico (AG)
en el cultivo de nochebuena; por lo cual el objetivo del
presente trabajo fue evaluar el efecto de la aplicación en una
o dos ocasiones de AG en cinco de los cultivares de mayor
producción en el estado de Morelos.
Se obtuvieron esquejes enraizados de cinco cultivares
de nochebuena: dos de brácteas rojas (‘Freedom Red’ y
‘Festival Red’), uno marmoleado (‘Sonora’), rosa (‘Da
Vinci’) y blanco (‘Freedom White’), fueron establecidos
bajo cubierta plástica en el Campo Experimental de la
Facultad de Ciencias Agropecuarias en la Universidad
Autónoma del Estado de Morelos, durante la temporada
otoño-invierno de 2010. Los esquejes enraizados con
cuatro hojas totalmente desarrolladas y 10 cm de alto,
fueron trasplantadas en macetas de 15.2 cm de diámetro,
conteniendo como sustrato una mezcla de suelo de hoja/
agrolita/peat moss/tezontle rojo/Arena (60:15:15:5:5 v/v),
bajo condiciones de invernadero cubierto con plástico
transparente que deja pasar 70% transmisión de la intensidad
luminosa; la temperatura y humedad relativa mensual
durante el periodo de experimentación fueron registradas
(Cuadro 1).
Rooted cuttings of five cultivars: ‘Freedom Red’,
‘Festival Red’, ‘Sonora’ (marble), ‘Da Vinci’ (pink)
and ‘Freedom White’, were planted in a greenhouse
located in the Experimental Station at the Facultad
de Ciencias Agropecuarias (Universidad Autónoma
del Estado de Morelos) during 2010. Uniform cuttings
with four fully developed leaves and 10 cm tall were
planted in black standard pots of 15.2 cm diameter
containing a growing medium prepared with leaf
mould, perlite, peat moss, volcanic rock, and sand
(60:15:15:5:5 v/v). Plants were maintained in a plastic
house with 30% shading; temperature and relative
humidity for experiment duration are presented in Table
1 as monthly average.
Plants were soft-pinched one day after transplant by
removing the shoot apex, leaving six to seven lateral buds
on the main stem (Ecke et al., 2004). Plants were maintained
at constant spacing (20 cm) to render a plant density of 25
plants per m2. Fertirrigation was applied every 48 h with 100
to 300 ml per plant of a nutrient solution containing 300 mg
L-1 N, 90 mg L-1 de P, 300 mg L-1 K, 300 mg L-1 Ca, 60 mg
L-1 Mg, and 5 mg L-1 Fe. To control electrical conductivity of
the growing medium plants were irrigated with plain water
once a week.
Cuadro 1. Temperatura y humedad relativa promedio predominante durante el experimento.
Table 1. Temperature and relative humidity predominant during the experiment.
Mes
Agosto
Septiembre
Octubre
Noviembre
Temperatura (ºC)
Humedad relativa (%)
21.5
20
20
17.2
70.9
81.9
79.9
73.5
Un día después del transplante se realizó la poda suave del
ápice de las plantas, dejando entre 6 y 7 yemas en el tallo
principal (Ecke et al., 2004). Las plantas fueron desarrolladas
en camas con separación de 20 cm, que da una densidad de
25 macetas por m2. La fertilización de las plantas se realizaba
mediante fertirrigación, aplicando de 100 a 300 mL de
solución a cada planta cada tercer día, la solución nutritiva
se compuso de 300 mg L-1 de N, 90 mg L-1 de P, 300 mg L-1
de K, 300 mg L-1 de Ca, 60 mg L-1 de Mg y 5 mg L-1 de Fe. Se
Temperatura mensual
máxima absoluta (ºC)
36.3
35.4
35.1
31.7
Temperatura mensual
mínima absoluta (ºC)
11.2
11.1
8.4
6.3
Gibberellic acid (GA 3 ) was dissolved in distilled
water at concentrations of 0, 2, 4, 6, 8 y 10 mg L -1
and sprayed to the foliage once (seven days after
transplant) or twice (seven and 14 days after transplant)
at 11:00 with a manual sprayer to dispense 10 ml of
the solution per plant. Experimental unit was one pot
with one plant and there were eight replicates. The
experimental units were distributed in a completely
randomized factorial design (5 cultivars per 6 GA
581
realizaban dos riegos con solución nutritiva y uno con agua
durante todo el ciclo del cultivo, con la finalidad de controlar
la conductividad eléctrica del sustrato.
concentrations per 2 spraying frequencies). The
experiment was terminated when bracts were fully colored
(105 days after transplant).
Se asperjó ácido giberélico (AG) disuelto en agua
destilada, en dosis de 0, 2, 4, 6, 8 y 10 mg L-1 a los 7 y 14
días después del trasplante dependiendo si fue una o dos
aplicaciones. Las aplicaciones se realizaron antes de las
11:00 am con un aspersor manual. En las plantas testigo (0
mg L-1 de ácido giberélico) sólo se aplicó agua destilada.
La unidad experimental fue una maceta con una planta
y se tuvieron ocho repeticiones. El diseño experimental
fue completamente al azar con diseño de tratamientos
factorial, donde la combinación de los factores: cultivar de
nochebuena (cinco), número de aplicaciones (una o dos) y
dosis de A3 (0, 2, 4, 6, 8 y 10 mg L-1). Se determinó como
finalizado el experimento cuando las brácteas estuvieron
totalmente pigmentadas (105 días después del transplante).
Growth measurements included plant height (from the
medium line to the top of the plant), number of branches,
length of branches (measured on the two top branches of
each plant), inflorescence diameter, and total plant diameter.
The color of bracts of each plant was measured with a
spectrophotometer (X-rite SP64) that report luminosity
(L), chrome (C), and hue (H) according to McGuire (1992).
Chlorophyll concentration was measured in leaves located
close to the bracts with an SPAD meter (Minolta, Japan,
SPAD 502). Statistical analysis of data was performed with
an ANOVA and multiple mean comparison according to
Tukey’s procedure (p≤ 0.05).
Se midió la altura de la planta, (desde la base del tallo
a nivel del sustrato hasta la parte más alta de la planta),
número de brotes, longitud de brotes (evaluados en la parte
alta de la planta), diámetro de la inflorescencia y diámetro
total de la planta. El color de las brácteas de cada planta
fue medida con un espectrofotómetro (X-rite SP64) que
reporta la luminosidad (L), cromaticidad (C) y ángulo matiz
(McGuire, 1992). El contenido de clorofilas fue evaluada
en las hojas debajo de las brácteas con un SPAD (Minolta,
Japan, SPAD 502). Los datos fueron procesados con un
análisis de varianza y se hicieron comparaciones de medias
por el método de Tukey con una probabilidad de (p≤ 0.05).
La temperatura promedio vario entre 20 y 21.5 ºC desde
agosto a octubre; sin embargo, en la parte final del cultivo
las temperaturas disminuyeron a 17.2 ºC (Cuadro 1). La
temperatura máxima absoluta fue mayor a 31 ºC, mientras
que la temperatura mínima varió entre 6 y 11.2 ºC. La
temperatura base para nochebuena es 10 ºC (Ecke et al.,
2004) y esta temperatura fue registrada durante octubre y
noviembre, periodo en que se presenta la diferenciación y
pigmentación de brácteas. La presencia de temperatura baja
al final del verano e inicio de otoño origino una disminución
en el crecimiento de la nochebuena, como se observó en las
plantas donde no se aplicó AG (0 mg L-1) (Cuadro 2).
Average temperature from August to October ranged
from 20 to 21.5 ºC; however, during the last month of the
growing season, temperature decreased to 17.2 ºC (Table
1). Absolute maximum temperature was higher than 31
ºC whereas absolute minimum temperature ranged from
6 to 11.2 ºC. Base temperature for poinsettia, estimated
in 10 ºC (Ecke et al., 2004), and was observed during
October and November, period in which flower induction
and bract pigmentation of poinsettias generally occurs.
The occurrence of lower temperature during the end of
the summer season and the beginning of the fall led to
decreased growth of poinsettia as demonstrated by the
final plant height when GA was not sprayed (doses= 0 mg
L-1) (Table 2).
Heights of control plants at experiment termination were
19.1, 20.5, 19.5, 21.5, and 20.7 cm for ‘Sonora’, ‘Da
Vinci’, ‘Freedom White’, ‘Freedom Red’ and ‘Festival
Red’, respectively (Figure 1A and 1B), which indicated
that the prevailing temperatures were not conductive for
optimum growth since standards proposed for poinsettia
(a 1.5:1 plant height: pot height ratio) were not met by any
cultivar (Martínez, 1995; Wilfret y Bell, 1998; Hayashi
et al., 2001). However, plant height was increased from
15% to 20% when GA was sprayed once or from 21% to
30% when GA was sprayed twice (Figure 1A and 1B). A
concentration of GA higher than 2 mg L-1 was associated
La altura final al terminar el experimento fueron de 19.1,
20.5, 19.5, 21.5 y 20.7 cm para ‘Sonora’, ‘Da Vinci’, Freedom
White’, ‘Freedom Red’ y ‘Festival Red’, respectivamente
(Figura 1A y 1B), que indica que las temperaturas durante
el experimento no fueron adecuadas para un crecimiento
óptimo, de acuerdo a los estándares propuestos para
nochebuena (una proporción 1.5:1 altura de planta: altura
de contenedor), y no fueron alcanzados por ningún cultivar
evaluado (Martínez, 1995; Wilfret y Bell, 1998; Hayashi et
al., 2001). La altura de la planta se incremento de 15 a 20%
cuando se asperjó AG en una ocasión, y cuando se aplicó
en dos ocasiones la altura se incrementó entre 21 y 30%
(Figura 1A y 1B). Aplicaciones de AG mayores de 2 mg
L-1 se asoció con un incremento de la planta y brote (Figura
1A-D; Cuadro 2). Similares resultados se han reportado en
experimentos con Fascination®, el cual incluye a AG como
uno de sus ingredientes activos (Ecke et al., 2004).
to increased plant height and branch length (Figure 1A-D,
Table 2). Similar results have been reported in experiments
with Fascination™, which includes GA as one of its active
ingredients (Ecke et al., 2004).
The significant interaction in cultivar∗doses and
cultivar∗frequency of applications indicated that the
response was not parallel among cultivars (Table 2). In
fact, ‘Sonora’ had a plant height higher than the minimum
recommended standard size when GA was 2 mg L-1 an
it was applied once (Figure 1A), whereas optimum GA
concentration was 2 to 10 mg L-1 when applied twice (Figure
1B). Cultivar ‘Da Vinci’ and ‘Freedom Red’ exhibited a
plant height higher than the minimum standard when GA
was from 2 to 10 mg L-1 when applied once or from 2 to 10
mg L-1 (‘Freedom Red’) or 4 to 10 mg L-1 (‘Da Vinci’) when
applied twice.
Cuadro 2. Crecimiento de plantas de nochebuena in respuesta a la aplicación de acido giberélico en diferentes concentraciones
y frecuencia de aplicación.
Table 2. Growth of poinsettia plants in response to Gibberellic acid sprays at varying concentrations and frequency of
applications.
Factor
Cultivar (CV)
‘Sonora’
‘Da vinci’
‘Freedom white’
‘Freedom red’
‘Festival red’
DMS
Frecuencia (F)
Una aplicación
Dos aplicaciones
MSD
Dosis (D)
0 mg L-1
2 mg L-1
4 mg L-1
6 mg L-1
8 mg L-1
10 mg L-1
DMS
CV
CV∗F
F∗D
CV∗D
CV∗F∗D
Número de brotes
Longitud de
brote (cm)
Diámetro de
inflorescencia (cm)
Diámetro de
planta (cm)
Altura de
planta (cm)
7.8 a
7b
7.2 b
6.8 b
6.7 b
0.5
16.4 b
14.4 c
16.4 b
18.6 a
18.3 a
0.7
17.7 c
23.5 a
21.9 b
22.7 ab
22.2 b
0.8
28.8 c
30 ab
29.2 b
33.6 a
24.2 a
0.9
23.5 b
24.1 ab
22.5 c
24.8 a
23.5 b
0.8
6.9 b
7.2 a
0.2
16 b
17.7 a
0.3
22 a
21.2 b
0.3
31.3 a
30.7 b
0.4
23 b
24.4 a
0.3
7.1 a
7.3 a
6.8 a
6.9 a
7.1 a
7.3 a
0.5
17.9
NS
NS
NS
NS
14 c
16.9 b
17.5 ab
17.8 a
18.1 a
16.7 b
0.8
11.3
22.3 a
21.9 ab
21.9 ab
21.1 b
21.2 b
21.2 b
0.9
10.0
NS
30 bc
32 a
31.5 ab
30.9 bc
30.7 bc
30.3 c
1
7.3
20.3 c
23.2 b
24.3 a
25.1 a
24.9 a
24.3 a
0.6
8.7
∗∗∗
∗∗
∗
∗∗
NS
NS
NS
∗∗
∗∗
NS
∗∗
∗
Letras diferentes en cada factor indica significancia estadística de acuerdo a la prueba de Tukey (p< 0.05); NS, , ,
0.001 respectivamente; DMS= diferencia mínima significativa; CV= coeficiente de variación.
∗ ∗∗ ∗∗∗
∗∗
∗∗∗
NS
= no significativo y significativo a p< 0.05, 0.01 y
A
28
B
28
26
26
24
24
22
22
20
20
18
Altura de brote (cm)
Diámetro de planta (cm)
2
4
6
8
10
12
C
22
20
20
18
18
16
16
14
14
12
12
0
36
34
32
30
28
26
24
22
2
4
6
8
10
36
34
32
30
28
26
24
22
2
4
6
8
10
12
H
28
26
24
24
22
22
20
20
18
18
16
16
2
4
6
8
10
12
2
4
6
8
10
12
0
2
4
6
8
10
12
0
2
4
6
8
10
12
0
2
4
6
8
10
12
F
G
28
26
0
0
D
12
E
0
Diámetro de inflorescencia (cm)
‘Sonora White Glitter’
‘Da Vinci’
‘Freedom White’
‘Freedom Red’
‘Festival Red’
18
0
22
583
Concentración de ácido giberélico (mg L-1)
Figura 1. Aplicación de ácido giberélico en una ocasión (A, C, E, G) y dos (B, D, F, H) en la altura, diámetro, inflorescencia y
longitud de brote en cinco cultivares de nochebuena. Las barras representan el error estándar de la media, la línea punteada
en A y B es el mínimo estándar de la altura.
Figure 1. Gibberellic acid sprayed once (A, C, E, G) or twice (B, D, F, H) on plant height and diameter, and branch length and
inflorescence in five poinsettia cultivars. The bars represent the standard error of the mean, dotted lines in A and B indicates
minimum standard plant height.
La interacción cultivar∗dosis y cultivar∗número de
aplicaciones fue significativa e indica que la respuesta no fue
paralela entre los cultivares (Cuadro 2). El cultivar ‘Sonora’
tuvo una altura mayor que la mínima recomendada cuando
se aplicó AG en dosis de 2 mg L-1 en una ocasión (Figura
1A); sin embargo, la dosis óptima fue cuando se aplicó AG
Cultivars ‘Freedom White’ and ‘Festival Red’ needed higher
GA concentrations to produce higher plants. ‘Freedom
White’ presented plant height higher than the minimum
standard when GA was spayed twice at concentrations
higher than 4 mg L-1 and exhibited no response when GA
was applied once, thus two applications were required for
en dosis de 2 mg L-1 aplicado dos veces (Figura 1 B). El
cultivar ‘Da Vinci’ y ‘Freedom Red’ mostraron una altura
mayor que el estándar, cuando el AG fue aplicado una vez
en dosis de 2 a 10 mg L-1 (‘Freedom Red’) y 4 a 10 mg L-1
(‘Da Vinci’) cuando se aplicó en dos ocasiones.
this cultivar (Figure 1B). ‘Festival Red’ responded to
both, one or two applications; however, it was the cultivar
that required the highest GA concentrations (4 or 6 mg
L-1) in order to produce plants with height higher than the
minimum standard.
Los cultivares ‘Freedom White’ y ‘Festival Red’ necesitaron
concentraciones mayores de AG para producir plantas
de altura mayor. ‘Freedom White’ tuvo la altura mayor
comparada con el mínimo reportado en la literatura, cuando
el AG se asperjó dos veces en concentraciones mayores a 4
mg L-1 y no mostró respuesta cuando el AG se aplicó en dos
ocasiones; entonces dos aplicaciones son necesarias en este
cultivar (Figura 1B). ‘Festival Red’ mostró respuesta tanto
a una o dos aplicaciones, pero fue el cultivar que necesito
mayor concentración (4 a 6 mg L-1) para generar plantas con
el tamaño mínimo que requiere el mercado.
The increased plant height in response to GA concentration
was associated to an increase in length of lateral branches
(Figure 1C and 1D). Increasing the concentration and
frequency of GA sprays had significant effects on branch
length (Table 2), and as for plant height, there was a significant
cultivar∗doses and cultivar∗frequency interaction. The
increase in both branch and plant height associated to GA
sprays was probably due to the effect of the growth regulator
in cell elongation, since in other species it has been proved
to increase elongation of axial organs such as stem, petiole,
and flower peduncle (Srivastava, 2002). According to Little
and MacDonald (2003), GA promotes stem elongation by
initiating cell division in apical and subapical meristems, and it
is also implicated in leaf expansion (Bhattacharya et al., 2010).
El incremento en la altura de la planta en respuesta a la
concentración deAG, se asocio a un incremento en la longitud de
las ramas laterales (Figura 1C y 1D). Al aumentar la frecuencia
de aspersiones de AG, existió mayor efecto en la longitud del
brote (Cuadro 2) y en la altura de la planta, así lo confirma la
interacción cultivar∗dosis y cultivar∗frecuencia de aplicación.
El incremento en el brote y altura de la planta asociado a las
aspersiones de AG, se deben probablemente al efecto del
regulador de crecimiento en la elongación celular, ya que en
otras especies se ha probado que incrementa la elongación de
órganos axiales, tales como el tallo, peciolo y pedúnculo de la
flor (Srivastava, 2002). Little y MacDonald (2003), indican
que elAG promueve la elongación del tallo al iniciar la división
celular en meristemos apicales y subapicales, esto también está
implicada la expansión celular (Bhattacharya et al., 2010).
La producción de nochebuena en contenedores de 15 cm,
requiere de plantas cubiertas con follaje e inflorescencias
que tengan seis a ocho brotes por planta después de la poda
(Martínez et al. 1995). El cultivar ‘Sonora’ desarrollo ocho
brotes por planta, mientras que los demás cultivares tuvieron
entre 6.7 y 7.2 brotes en promedio (Cuadro 2). Un mayor
número de brotes por planta se obtuvo cuando el AG fue
asperjado dos veces independientemente de la concentración
(Cuadro 2); esto puede estar asociado con cambios en el
balance hormonal de las yemas axilares, que inician el
desarrollo justo después de la poda.
Se ha reportado que el tratamiento de yemas axilares
decapitadas en plantas mutantes de tomate con AG y
kinetina, resulta en la promoción de yemas laterales
Production of poinsettia in 15 cm standard pots with plants
fully covered with foliage and inflorescences requires that
six to eight shoots are allowed to develop after pinching
(Martínez et al., 1995). Cultivar ‘Sonora’ developed eight
shoots per plant, whereas the reminder cultivars grew 6.7 to
7.2 shoots on average (Table 2). A significant higher number
of shoots per plant was obtained when GA was sprayed
twice regardless of the concentration (Table 2); this may
be associated with changes in the hormonal balance of the
axillary buds that started to develop right after pinching.
It has been reported that treatment of axillary buds of
decapitated tomato plants with GA and kinetin resulted in
promotion of bud outgrowth (Catalano and Hill, 1969); in
contrast, other reports in tomato mutants that suppress lateral
growth contain higher concentrations of GA, suggesting that
GA may also inhibit branching (Tucker, 1976). According to
the results of the present study, GA sprays in poinsettia may
induce lateral branching, as reported for chrysanthemum in
response to GA and indole acetic acid (Jiang et al., 2010).
In spite of the increase in plant and branch length, the number
of applications and concentration of GA, it significantly
affected diameter of plants and inflorescences (Table 2).
McDaniel and Wang (2004) reported comparable results
since poinsettia plants sprayed with GA at 10 and 40 mg
L-1, after treatment with a growth retardant ((2S, 3S)-1(4-chlorophenyl)-4,4-dimethyl-2-(1,2,4,(tryazol-1-yl)-3-
585
(Catalano y Hill, 1969); en contraste, otros reportes en
mutantes de tomate que suprimen el crecimiento lateral
muestran altas concentraciones de AG, sugiriendo que el
AG puede inhibir la brotación (Tucker, 1976). Considerando
los resultados del presente trabajo, las aspersiones de AG
en nochebuena, pueden inducir la brotación lateral, como
se ha reportado en crisantemo cuando se aplica AG y acido
indol acético (Jiang et al., 2010).
pentanol)), induced decreased leaf and bract size in addition
to the enlargement of internodes and stem elongation. In
the present study, two applications resulted in decreased
plant diameter (Table 2, Figure 1A-H) the increasing
the concentration of GA significantly decreased plant
diameter, especially when GA concentration was 4 mg
L-1, which agrees with reports regarding optimum levels
of Fascination® (Table 2).
Además del incremento en altura de la planta, longitud
del brote, número de aplicaciones y concentración de AG,
afecto el diámetro de las inflorescencias y planta (Cuadro 2).
MacDaniel y Wang (2004) reportaron resultados similares
cuando aplicaron AG en dosis de 10 a 40 mg L-1, después
de aplicar un retardante de crecimiento (Paclobutrazol),
induciendo menor tamaño de hoja y bráctea, además de
mayor longitud de los entrenudos y elongación del tallo. En
el presente estudio, dos aplicaciones de AG disminuyeron el
diámetro de la planta (Cuadro 2; Figura 1A-H), el incremento
en la concentración de AG disminuye significativamente el
diámetro de la planta, especialmente cuando la concentración
fue de 4 mg L-1, lo cual concuerda con reportes de niveles
mínimos de Fascination® (Cuadro 2).
In the present study it was used a much lower GA
concentrations than McDaniel and Wang (2004) did, which
suggests that other factors may affect the horizontal growth
of plants. The resulting decreased in the diameter of plants
and inflorescences may have been due to the restricted
space maintained in the experimental conditions so that
plants had no enough area to develop branches at more
open angles since pots were separated 20 cm throughout the
experiment. This statement implies that when promoting
growth by applications of GA, plant density must be
decreased to promote the lateral expansion of branches
and inflorescences.
En el presente trabajo se utilizaron dosis menores que
McDaniel y Wang (2004), lo cual sugiere que otros factores
pueden afectar el crecimiento horizontal de las plantas. El
menor diámetro de la planta e inflorescencias, se debió al
espacio restringido entre las plantas durante el desarrollo del
experimento, por lo que las plantas no desarrollaron ramas en
ángulos más abiertos, ya que las plantas estuvieron separadas
20 cm durante todo el experimento. Esta aseveración
implica que cuando se promovió el crecimiento por el AG,
la densidad de plantas disminuyó la expansión lateral de
ramas e inflorescencias.
A significant interaction among the three factors under study
was detected on inflorescence and plant diameter (Table 2).
Inflorescence diameter decreased in ‘Freedom White’ when
2 ml L-1 of GA was sprayed twice, whereas the decrease in
‘Sonora’ was noticeable at concentrations of 10 mg L-1 with
two sprays (Figure 1G and 1H). The reminding cultivars did
not exhibit significant effects of GA on inflorescence and
plant diameter (Figure 1E-H).
Se detectó interacción significativa entre los tres factores
estudiados en las variables diámetro de inflorescencia y
planta (Cuadro 2). El diámetro de la inflorescencia disminuyó
en ‘Freedom White’ cuando se asperjaron 2 mg L-1 de AG
en dos ocasiones, mientras que en ‘Sonora’ se observó una
disminución en concentraciones de 10 mg L-1, cuando se
hicieron dos aspersiones (Figura 1G y 1H). Los cultivares
restantes no mostraron efecto significativo en la inflorescencia
y diámetro de planta por la aplicación de AG (Figura 1E-H).
Bract’s color was significantly affected (Table 3; Figure
2A-F). Frequency and concentration of GA did not affect
significantly luminosity and chrome. However, significant
effects on hue suggested that color tended to the yellow
when GA was sprayed twice (Table 3). There was a
significant effect on hue due to GA concentration. However,
no consistent trend was detected (Table 3; Figure 2E and
2F). The interaction of cultivar ∗frequency of applications
was significant for luminosity and chrome, whereas
the interactions frequency∗concentration and cultivar∗
frequency∗concentration were significant on chrome and
hue (Table 3). In ‘Freedom White’, there was a decrease
in chrome as concentration and frequency of GA sprays
were increased.
El color de las brácteas fue afectada significativamente
(Cuadro 3; Figura 2A-F). La frecuencia y concentración
de AG no afectaron la luminosidad y cromaticidad. Sin
Chlorophyll concentration was unaffected by GA
concentrations or frequency of applications (Table 3).
Similarly to the reports by Fletcher and McCullagh (1971)
embargo, se detectaron efectos significativos en el ángulo
matiz, sugiriendo que el color tiende más al amarillo
cuando el AG se asperja en dos ocasiones (Cuadro 3). Se
detectaron diferencias significativas en el matiz debido a
la concentración de AG. Sin embargo, no se encontraron
tendencias consistentes (Cuadro 3; Figura 2E y 2F).
La interacción de cultivar∗frecuencia de aplicación
fue significativa para la luminosidad y cromaticidad,
mientras que la interacción frecuencia∗concentración y
cultivar∗frecuencia∗concentración, fueron significativas
en la cromaticidad y ángulo matiz (Cuadro 3). En
‘Freedom White’, se detectó disminución en la
cromaticidad cuando se incrementó la frecuencia y dosis
de aplicación.
which indicated that chlorophyll concentration in cucumber
is unaffected by neither GA nor auxins. Nonetheless,
chlorophyll concentration was affected by the significant
cultivar∗frequency of applications interaction (Table 3;
Figure 2 G-H).
CONCLUSIONS
We conclude that GA promoted plant elongation and
plants grown under moderately cold fall, were able to meet
minimum height standards when GA concentrations were
lower than 10 mg L-1. However, to produce plants with
Cuadro 3. Efecto de aspersiones de ácido giberélico en el color de bráctea y clorofilas en hojas de cinco cultivares de
nochebuena aplicada en diferentes concentraciones y frecuencia.
Table 3. Effect of gibberellic acid sprays on bract color and leaf chlorophyll of five poinsettia cultivars as affected by
concentration and frequency of applications.
Factor
Cultivar (CV)
‘Sonora’
‘Da Vinci’
‘Freedom White’
‘Freedom Red’
‘Festival Red’
DMS
Frecuencia (F)
Una aplicación
Dos aplicaciones
DMS
Dosis (D)
0 mg L-1
2 mg L-1
4 mg L-1
6 mg L-1
8 mg L-1
10 mg L-1
DMS
CV
V∗F
F∗D
V∗D
V∗F∗D
Luminosidad
Cromaticidad
Ángulo matiz
Concentración de clorofilas (unidades SPAD)
40.5 c
59.7 b
69.9 a
29.3 d
30.3 d
2.7
44.3 b
36.2 c
30.7 d
48.8 a
51 a
3.6
29.1 c
45.2 b
86.8 a
24.5 d
25 d
2.3
60.3 a
60.3 a
58.9 b
58.9 b
56.7 c
1.3
46.3 a
45.5 a
1.2
42.5 a
42 a
1.6
41.2 b
42.8 a
1
58.9 a
59.1 a
0.6
46.7 a
45.8 a
46 a
45.9 a
44.2 a
46.7 a
3.1
14.8
44 a
42.6 a
42.6 a
41.4 a
41.5 a
41.3 a
4.1
21.3
40.1 b
42.3 ab
44.4 a
43.1 a
42 ab
40.2 b
1.8
13.8
58.7 a
58.5 a
59 a
59.9 a
59.7 a
59.2 a
1.5
5.5
∗
∗
NS
∗∗
NS
NS
∗∗
NS
NS
NS
NS
NS
NS
∗
∗
Letras diferentes en cada factor indica significancia estadística de acuerdo a la prueba de Tukey (p< 0.05).
respectivamente; DMS= diferencia mínima significativa; CV= coeficiente de variación.
NS
, ,
NS ∗ ∗∗
= no significativo y significativo a p< 0.05 y 0.01
Luminosidad (L*)
80
A
70
70
60
60
50
50
40
40
30
30
80
0
2
Ángulo de matiz (H*)
6
8
10 12
80
‘Sonora White Glitter’
‘Da Vinci’
‘Freedom White’
‘Freedom Red’
‘Festival Red’
60
50
40
30
30
4
6
8
10
100
80
80
60
60
40
40
20
20
64
2
4
6
4
6
8
10
12
0
2
4
6
8
10
12
0
2
4
6
8
10
12
0
2
4
D
12
E
0
2
60
40
2
0
70
50
0
Clorofilas (Unidades SPAD)
4
C
70
100
B
20
20
Cromaticidad (C*)
80
587
8
10
F
12
G
H
64
62
62
60
60
58
58
56
56
54
54
52
52
0
2
4
6
8
10
12
6
8
10
12
Concentración de ácido giberélico (mg L-1)
Figura 2. Aspersión de ácido giberélico en una ocasión (A, C, E, G) y en dos ocasiones (B, D, F, H) en el color de la bráctea en
cinco cultivares de nochebuena. Cada observación es la media de ocho repeticiones, las barras representan el error estándar
de la media.
Figure 2. Effect of Gibberellic acid sprayed once (A, C, E, G) or twice (B, D, F, H) on bract color and leaf chlorophyll concentration
in five poinsettia cultivars. Each observation is the mean of eight replicates; bars represent the standard error of the mean.
La concentración de clorofila no fue afectada por las dosis
de aplicación de AG, así como por las dosis (Cuadro 3).
Respuestas similares reportaron Fletcher y McCullagh
(1971), lo cual indica que la concentración de clorofila
en pepino no fue afectada por AG o auxinas. No obstante,
se encontró significancia en la concentración de clorofila
en la interacción cultivarfrecuencia (Cuadro 3; Figura
2 F-H).
CONCLUSIONES
Se concluye que el AG promueve la elongación de plantas
desarrolladas bajo condiciones moderadas de frio en otoño,
donde fueron capaces de alcanzar la altura mínima estándar,
cuando las concentraciones de AG fueron menores a 10 mg
L-1. Sin embargo, para producir plantas con el mínimo de
tamaño requerido, dos aplicaciones de AG en dosis de 2 a
10 g L-1 son requeridas en ‘Sonora’; una aplicación entre 2 y
10 mg L-1 es suficiente para ‘Da Vinci’, dos aplicaciones en
dosis de 4 a 10 mg L-1 en ‘Freedom White’, una aplicación
entre 2 y 10 mg L-1 en ‘Freedom Red’ y una aplicación de 6
y 10 mg L-1 en ‘Festival Red’. Se recomienda disminuir la
densidad de plantas para evitar el alargamiento de la planta
y así se incrementa el diámetro de la planta e inflorescencia.
Las aplicaciones AG no afectó el color de bráctea y hojas en
los cultivares estudiados.
AGRADECIMIENTOS
Los autores(as) agradecen el apoyo de SEP-PROMEP
(PROMEP/103.5/07/2674) para la realización del presente
trabajo.
LITERATURA CITADA
Bhattacharya, A.; Kourmpetli, S. and Davey, M. R. 2010.
Practical applications of manipulating plant
architecture by regulating gibberellin metabolism.
J. Plant Growth Regul. 29:249-256.
Cabrera, R. J. y Orozco, R. M. 2003. Diagnóstico sobre las
plántulas ornamentales en el estado de Morelos.
Publicación Especial 38. Zacatepec, Morelos.
26 p.
minimum height standards, two applications of GA at 2 to
10 mg L-1 are required in ‘Sonora’, whereas one application
at 2 to 10 mg L-1 was enough in ‘Da Vinci’, two applications
at 4 to 10 mg L-1 in ‘Freedom White’, one application at
2 to 10 mg L-1 in ‘Freedom Red’, and one application at
6 to 10 mg L-1 in ‘Festival Red’. To prevent stretching of
plants due to growth promotion a lower planting density
is be recommended to increase plant and cyathia width.
Gibberellic acid applications did not affect bract or leaf color
in the cultivars under study.
Cabrera, R. J.; Morán, M. F.; Torres, Q. R.; Pellón, B. A. y
Granada, C. L. 2006. Producción de nochebuena
Euphorbia pulcherrima Willd. ex Klotzsch. en
Morelos. SAGARPA-INIFAP. Zacatepec, Morelos.
Folleto técnico. Núm. 23. 20 p.
Catalano, M. and Hill, T. A. 1969. Interaction between
gibberellic acid and kinetin in overcoming apical
dominance, natural and induced by IAA, in tomato
(Lycopersicum esculentum Mill. cultivar potentate).
Nature. 222:985-986.
Catanzaro, C. and Bhatti, S. 2006. Consumers survey
reveals poinsettia cultivar preferences for 2005.
HortScience. 41:1061.
Dole, J. M. and Wilkins, F. H. 2005. Floriculture. Principles
and species. Pearson Prentice Hall. New Jersey,
USA. 1 023 p.
Ecke, P.; Faust, E. J.; Williams, J. and Higgins, A. 2004. The
ecke poinsettia manual. Ball Publishing. Illinois,
USA. 287 p.
Fletcher, R. A. and Mccullagh, D. 1971. Cytokinin-induced
chlorophyll formation in cucumber cotyledons.
Planta. 101:88-90.
García, A. 2008. Producción de nochebuena planta
terminada. In: Memoria del 7° Simposium
Internacional de Viverismo. Osuna, C. F.; García,
P. F.; Ramírez, R. S.; Granada, C. L.; Galíndo, G.
D. (eds.). 79-102 pp.
García, P. F.; Ramírez, R. S.; Osuna, C. F. de J. y Ocampo,
O. T. 2009. Enfermedades de las principales
ornamentales de Morelos. SAGARPA-INIFAP. D.
F., México. Folleto técnico. Núm. 39. 30 p.
Gilbertz, A. D.; Barret, E. J. and Nell, A. T. 1984.
Development of drought stressed poinsettias. J. Am.
Soc. Hortic. Sci. 109:854-857.
Hartley, D. E. 1992. Poinsettia nutrition. In: the Poinsettia.
The Journal for Poinsettia Professional Vol. 1.
Malone. T. M. (ed.). Encinitas, Cal., USA. 5-10 pp.
Hayashi, T.; Heins, R.; Cameron, A. and Carlson, A. W.
2001. Ethepon influences height and branching
of several herbaceous perennials. Sci. Hortic.
91:305-323.
Jiang, B.; Miao, H.; Chen, S.; Zhang, S.; Chen, F. and Fang,
W. 2010. The lateral suppressor-like gene, DGLSL,
alternated the axillary branching in transgenic
chrysanthemum (Chrysanthemum x morifolium) by
modulating iAA and GA content. Plant Mol. Biol.
Rep. 28:144-151.
Ku, M. C. and Hershey, R. D. 1996. Fertigation rate, leaching
fraction and growth of potted poinsettia. J. Plant
Nutrit. 19:1639-1652.
Little, C. H. A. and MacDonald, J. E. 2003. Effects of
exogenous gibberellins and auxin on shoot
elongation and vegetative bud development in
seedlings of Pinus sylvestris and Picea glauca. Tree
Physiol. 23:73-83.
Martínez, M. 1995. Manual práctico de producción de
nochebuena. Consultoría OASIS, Morelos,
México. 87 p.
589
McDaniel,A. D. and Wang,Y. T. 2004. Effects in poinsettia overretarded with paclobutrazol. HortScience. 39:822.
McGuire, R. G. 1992. Reporting of objective color
measurements. HortScience. 27:1254-1255.
Oficina Estatal de Información para el desarrollo rural
sustentable (OEIDRUS). 2010. Oficina Estatal
de Información para el Desarrollo Sustentable.
URL: http://www.oeidrus-morelos.gob.mx.
Pérez-López, A.; Carrillo-Salazar, J. A.; Colinas-León,
M. T. y Sandoval-Villa, N. 2005. Regulación
del crecimiento de nochebuena (Euphorbia
pulcherrima Willd. Ex. Klotzch) con etefón.
Agrociencia. 39:639-646.
Shanks, J. B. 1980. Poinsettias. In: introduction to
floriculture. Larson, R. A. (ed.). Academic Press,
New York, USA. 303-326 pp.
Srivastava, L. M. 2002. Plant growht and development.
Academic Press. Florida, USA. 772 p.
Tucker, D. J. 1976. Endogenous growth regulators in relation
to side shoot development in the tomato. New
Phytol. 77:561-568.
Wilfret, G. J. and Bell, M. L. 1998. Effect of paclobutrazol
drenches on height of nine poinsettia cultivars. Proc.
Fla. State hort. Sci. 111:17-19.
ÉPOCA DE CORTE Y MANEJO POSCOSECHA DE OCHO
CULTIVARES DE ROSA DE CORTE*
TIME CUTTING AND POSTHARVEST MANAGEMENT
OF EIGHT CUT ROSE CULTIVARS
Gabriela Mosqueda-Lazcares1, Ma. de Lourdes Arévalo-Galarza1§, Guadalupe Valdovinos-Ponce1, Juan Enrique RodríguezPérez2 y María Teresa Colinas-León2
Recursos Genéticos y Productividad-Fisiología Vegetal. Campus Montecillo. Colegio de Posgraduados. Carretera México-Texcoco, km 36.5. Montecillo, Texcoco,
México. C. P. 56230. 2Departamento de Fitotecnia. Universidad Autónoma Chapingo. Carretera México-Texcoco, km 38.5. Chapingo, Texcoco, México. C. P. 56230.
§
Autora para correspondencia: [email protected].
1
RESUMEN
ABSTRACT
El manejo poscosecha tradicional de flores de corte, implica
la hidratación intermitente de los tallos posterior a la cosecha;
sin embargo, en los últimos años se ha cuestionado esta
práctica y se ha sugerido el sistema de manejo en seco, que
consiste en empacar los tallos sin que hayan sido previamente
hidratados, resultados previos muestran que esta práctica
mantiene la calidad de los tallos florales igual o mejor que
los hidratados. Considerando lo anterior, en este trabajo
se abordaron dos objetivos: 1) evaluar la calidad de ocho
cultivares de rosa de corte (Freedom, Royalty, Red Alfa,
Red Vicer, Grand Gala, Sena, Vendela y Pecubo), hidratados
inmediatamente después de la cosecha con Hydraflor®
por 24 h, en comparación con tallos manejados en seco;
ambos tratamientos fueron almacenados a 4 ºC y 90%
de humedad relativa por 11 días, simulando el manejo
comercial; 2) evaluar el comportamiento poscosecha de
ocho cultivares de rosas cosechados en dos épocas del año
(mayo y septiembre) manejados en seco y almacenados a 4
ºC y 90% de humedad relativa por 11 días. Los resultados
del primer experimento mostraron que los tallos pretratados
con Hydraflor®, tuvieron menor absorción de solución de
florero, vida de florero y mayor incidencia de Botrytis que
Traditional postharvest management of cut-flowers involves
intermittent hydration of the post-harvest stems, but in
recent years the practice has been questioned and, it has been
suggested the dry handling system, which involves packing
the stems without previous hydration; previous results show
that this practice maintains the quality of the flowers stems
same just as hydrated or even better. Considering this, the
study dealt with two main objectives: 1) to evaluate the
quality of eight cultivars of cut-rose (Freedom, Royalty, Red
Alfa, Red Vicer, Grand Gala, Sena, Vendela and Pecubo),
immediately hydrated after the harvest with Hydraflor®
for 24 h, compared with dried stems, both treatments were
stored at 4 °C and 90% relative humidity for 11 days,
simulating commercial handling, 2) to evaluate the postharvest behavior of eight cultivars of roses harvested in
both seasons (May-September) handled and stored dry at 4
°C and 90% relative humidity for 11 days. The results from
the first experiment showed that, the stems pretreated with
Hydraflor®, presented a lower uptake of in-vase solution,
vase life and increased incidence of Botrytis than the stems
completely handled in dry after storage. The results from
the second experiment showed that, the stems harvested in
* Recibido: abril de 2011
los tallos manejados completamente en seco, posterior al
almacenamiento. Los resultados del segundo experimento,
mostraron que los tallos cosechados en septiembre tiene
hasta 20% mayor vida de florero, que los cosechados en
mayo. El uso de Crystal clear® como solución de florero tiene
un efecto positivo en incrementar el peso fresco y vida de
florero en todos los cultivares. Los tallos del cultivar Vendela
fueron los de mayor vida de florero, en contraste con Pecubo.
Palabras clave: Botrytis, Hydraflor®, solución hidratante,
periodo seco, vida de florero.
INTRODUCCIÓN
Uno de los factores que afectan la calidad de las flores
de corte, es el manejo de los tallos después de la cosecha.
Existen dos métodos, uno es la hidratación intermitente y
el otro el manejo en seco. El primero y más ampliamente
utilizado por los productores y distribuidores de flores de
corte, se lleva a cabo colocando los tallos en contenedores
con agua, solución hidratante o solución preservativa por
lo menos en tres ocasiones: después del corte, después del
empaque y en el centro de distribución (Reid, 2002).
La constante interrupción del flujo de agua, agudiza el
restablecimiento hídrico de los tallos florales durante la
comercialización, sobre todo si no se mantiene la cadena de
frío, resultando fallas en la apertura floral, marchitamiento
y senescencia prematuros. El manejo en seco consiste en no
utilizar soluciones hidratantes y preservativas, para ello los
tallos son cortados, clasificados y empacados en cajas de
cartón para finalmente ser estibadas dentro de una cámara
frigorífica a temperaturas entre 0 y 4 ºC, sin que los tallos
hayan sido colocados en solución hidratante y preservativa,
hasta que llegan al centro de distribución y comercialización.
El manejo tradicional (hidratación intermitente) ha sido
cuestionado en los últimos años, pues hay reportes que
muestran que si los tallos se manejan completamente en seco
tienen mayor vida de florero y apertura floral (Macnish et al.,
2009), reduciendo los costos por manejo y uso de soluciones
florales (Cevallos y Reid, 2001). Sin embargo, aunque los tallos
almacenados en seco, muestran pérdidas de peso mayores, la
conductividad hídrica puede restablecerse más rápidamente,
debido al menor crecimiento bacteriano consecuencia de la
baja humedad presente en la base de los tallos florales (De
Capdeville et al., 2005; Macnish et al., 2009).
Gabriela Mosqueda-Lazcares et al.
September presented up to 20% longer vase life than those
harvested in May. The use of Crystal Clear® as a vase solution
has a positive effect on increasing the fresh weight and
vase life in all cultivars. The stems of the Vendela cultivar
presented the longest vase life, in contrast with Pecubo.
Key words: Botrytis, dry period, Hydraflor®, hydrating
solution, vase life.
INTRODUCTION
One of the factors affecting the quality of cut-flowers is the
handling of the stems after harvest. There are two methods;
one is hydration and the other one intermittent dry handling.
The first and most widely used by the producers and cutflowers’ distributors is carried out by placing the stems in
containers with water, moisturizer or preservative solution
at least three times: after cutting, after packing and at the
distribution center (Reid, 2002).
The constant interruption of water flow, water sharpens the
restoration of the flowering stems during marketing, especially
if the cold chain is not kept, resulting failures in anthesis, wilting
and premature senescence. The dry handling consists to not use
hydrating solutions and preservatives, for that the stems are
cut, graded and packed in cardboard boxes to finally be stowed
inside a chamber at temperatures between 0 and 4 °C, without
placing the stems in hydrating and preservative solutions, until
they reach the center of distribution and marketing.
The traditional managment (intermittent hydration) has been
questioned in the recent years, there are reports showing
that if the stems are handled completely dry they present a
longer vase life and flower opening (Macnish et al., 2009),
reducing costs of management and use of floral solutions
(Cevallos and Reid, 2001). However, while the stems stored
dry, show higher weight losses, water conductivity can be
restored more quickly, due to reduced bacterial growth due
to low moisture presented in the base of the flower stems
(De Capdeville et al., 2005; Macnish et al., 2009).
Another benefit of dry handling is that it maintains a low
relative humidity on the inside of the package, reducing the
incidence of Botrytis. The infection in the flower’s buds of
this fungal pathogen is a cause for rejection in the centers
of distribution and marketing, whose infection begins with
the deposition of conidia on the petals of the flowers during
Época de corte y manejo poscosecha de ocho cultivares de rosa de corte
Otro beneficio del manejo en seco es que mantiene una
baja humead relativa al interior del empaque, reduciendo
la incidencia de Botrytis. La infección en los botones
florales de este hongo patógeno es una de las causas de
rechazo en los centros de distribución y comercialización,
cuya infección inicia con la deposición de conidios
en los pétalos de las flores durante su desarrollo en el
invernadero, pero después de la cosecha si los botones
florales son expuestos a humedades relativas superiores
al 90% durante el empaque, almacenamiento y transporte,
las pequeñas lesiones se convierten en necróticas y la
infección puede distribuirse a todo el empaque, llegando
los tallos florales al centro de distribución completamente
dañados (Williamson et al., 1995).
Otro factor que afecta significativamente la calidad y
el comportamiento de algunas especies florales es la
época de cosecha; por ejemplo, en rosas ‘First Red’ y
‘Akito’ cultivados en verano bajo invernadero de vidrio,
tuvieron entre 37-42% mayor vida de florero que los
tallos producidos en invierno (Pompodakis et al., 2005).
Por el contrario, Ávila y Pereyra (2007) reportan que la
vida de florero de clavel (Dianthus sp.), resultó menor en
verano que en invierno; éstas variaciones se encuentran
no sólo entre especies sino también entre cultivares, y se
deben entre otros factores a las reservas de carbohidratos
generadas durante los periodos con mayor luminosidad y a
la cantidad de tejido fotosintético presente en el tallo floral
(Halevy y Mayak, 1979; Hernández et al., 2009).
593
their development in the greenhouse, but after the harvest
when the flower’s buds are exposed to a relative humidity
above 90% during packing, storage and transportation, small
lesions become necrotic and infection can spread to the whole
package, reaching the flowering stems to the distribution
center completely damaged (Williamson et al., 1995).
Another factor that significantly affects the quality and
behavior of some plant species is the harvest season, for
example, rose ‘First Red’and ‘Akito’grown in summer under
glass greenhouse, had between 37-42% higher vase life than
the stems produced in the winter (Pompodakis et al., 2005).
In contrast, Ávila and Pereyra (2007) reported that, the vase
life of carnation (Dianthus sp.) was lower in summer than
in winter, these variations are not only between species but
also between cultivars, and should include factors generated
carbohydrate reserves during periods with higher luminosity
and the amount of photosynthetic tissue present in the floral
stem (Halevy and Mayak, 1979; Hernández et al., 2009).
The objectives of this research were: 1) to evaluate the
effectiveness of post-harvest moisture compared to dry
handling, and 2) to evaluate the effectiveness of dry storage
at two different times cutting on post-harvest quality of eight
rose cultivars.
Los objetivos de la presente investigación fueron: 1) evaluar
la efectividad de la hidratación posterior a la cosecha
en comparación con el manejo en seco; y 2) evaluar la
efectividad del almacenamiento en seco en dos épocas
diferentes de corte sobre la calidad poscosecha de ocho
cultivares de rosa.
The cultivars evaluated in this study were Freedom, Royalty,
Red Alfa, Red Vicer, Grand Gala, Sena, Vendela and Pecubo.
These were grown in the greenhouses of the company Flores
de Analco S. C. of P. R. L. of C.V., in Coatepec de Harinas,
Mexico during May and September, 2008. The stems of each
cultivar were harvested before 10:00 am and were selected
to ensure a size (70 cm length) and an even cutting-point.
Experiment 1
Los cultivares evaluados en esta investigación fueron Freedom,
Royalty, Red Alfa, Red Vicer, Grand Gala, Sena, Vendela y
Pecubo. Estos fueron cultivados en los invernaderos de la
empresa Flores de Analco S. C. de P. de R. L. de C. V., en
Coatepec de Harinas, México durante mayo y septiembre
de 2008. Los tallos de cada cultivar se cosecharon antes de las
10:00 am y fueron seleccionados para garantizar un tamaño
(70 cm longitud) y punto de corte homogéneo.
After harvesting and selection, 6 stems were taken per
cultivar and divided into two lots of eight stems each, the first
batch was treated with a pretreatment solution Hydraflor® (2
g L-1) for 24 h (traditional management ), under refrigeration
(4 °C) and relative humidity (RH) of 90%. The stems of the
second batch were packaged in black polyethylene and kraft
paper and immediately placed in boxes and kept at 4 °C and
90% RH. The stems of both treatments were stored under the
same cooling conditions and relative humidity for 11 days.
Experimento 1
Después de la cosecha y selección se tomaron 16 tallos por
cultivar y se dividieron en dos lotes de ocho tallos cada uno,
al primer lote se le aplicó un pretratamiento con solución
de Hydraflor® (2 g L-1) por 24 h (manejo tradicional), bajo
condiciones de refrigeración (4 ºC) y humedad relativa (HR)
del 90%. Los tallos del segundo lote fueron empacados en
papel kraft y polietileno negro e inmediatamente colocados
en cajas y mantenidos a 4 ºC y 90% HR. Los tallos de ambos
tratamientos, se almacenaron en las mismas condiciones de
refrigeración y humedad relativa por 11 días.
A la salida del almacenamiento refrigerado a todos los tallos
se les eliminaron los foliolos de 20 de la parte basal y se
recortaron 2 cm, y nuevamente se dividieron en dos para
colocarse en floreros individuales, en donde las soluciones
fueron: agua de la llave y solución de florero comercial
Crystal clear® (Floralife) en dosis de 10 g L-1. Se evaluó la
presencia de Botrytis que se manifiesta inicialmente como
lesiones delimitadas que después se convierten en manchas
acuosas y finalmente necróticas en los sépalos y pétalos
(Elad et al., 1988).
Experimento 2
Se realizaron dos cosechas (16 tallos por cultivar por cosecha),
la primera en mayo (cosecha de invierno) y la segunda en
septiembre (cosecha de verano). Después de la selección, sin
tratamiento adicional, los tallos de cada cultivar se agruparon
en paquetes que se envolvieron en papel kraft con polietileno
negro y se colocaron en cajas de cartón, para almacenarse en
una cámara frigorífica (4 ºC y 90% HR) por 11 días.
Al concluir el almacenamiento, los tallos se retiraron de la
cámara, se eliminaron los foliolos de 20 cm de la parte basal
y se recortaron 2 cm y se dividieron en dos tratamientos,
ocho tallos de cada cultivar se colocaron en floreros que
contenían una solución de Crystal clear® (Floralife) (10 g L-1)
y otros ocho en agua de la llave, ésta última se cambió cada
tercer día con la finalidad de evitar el excesivo crecimiento
bacteriano. Los floreros se colocaron en un cuarto a 20 ±1
°C, 50 ±5% HR y luminosidad de 14 µmol m-2 s-1 (12 h d-1)
para evaluar las siguientes variables:
Peso fresco (PF). Diariamente se tomaron lecturas del
peso fresco del tallo floral con una balanza digital Setra,
modelo S1-2000S, con capacidad para 1 500 g y 0.1 g de
precisión, hasta el fin de la vida de florero. El cálculo
At the outlet of refrigerated storage at all stems leaflets were
removed from 20 cm at the heel and 2 cm were cut, and
again split into two to be placed in individual vases, where
the solutions were tap water and commercial vase solution
Crystal clear® (Floralife) at doses of 10 g L-1. We evaluated
the presence of Botrytis expressed initially defined as lesions
that later become necrotic and finally watery spots on sepals
and petals (Elad et al., 1988).
Experiment 2
Two harvests were accomplished (16 stems per cultivar
per harvest), the first in May (winter crop) and the second
in September (summer crop). After the selection, without
further treatment, the stems of each cultivar were grouped
into packages that were wrapped in kraft paper with black
polyethylene and placed in cardboard boxes for storage in
a refrigerated (4 °C and 90% RH) for 11 days.
Concluded the storage, the stems were removed from the
chamber, the leaflets were removed from 20 cm at the heel
and 2 cm were cut and divided into two treatments, eight
stems of each cultivar were placed in vases containing a
solution of Crystal clear® (Floralife) (10 g L-1) and eight in
tap water, the latter was changed every third day in order to
avoid excessive bacterial growth. The vases were placed
in a room at 20 ±1 °C, 50 ±5% RH and light of 14 mol m-2
s-1 (12 h day-1) to assess the following variables.
Fresh weight (FW). Daily readings were taken from the
fresh weight of flowering stems with a Setra digital balance,
S1-2000S model with a capacity of 1 500 g and 0.1 g of
precision, until the end of vase life. The calculation of the
percentage of weight was made using the following formula:
Pp= Pf * 100 , where: Pp = weight (%); Pi = initial
Pi
weight (g); Pf = final weight (g).
Vase life (VF). It was measured from the transfer of the flowers
to the vase, until it had at least one of the following symptoms:
loss of turgor, bending the neck, petal fall and rot the stem.
The experimental design was completely randomized with
a factorial arrangement of treatments in the first experiment
was 8∗2∗2 (eight varieties∗two pretreatment∗two solutions
of vase) with four replicates per treatment, and the second was
8∗2∗2 (eight varieties∗two harvest seasons∗two solutions of
vase) with eight replicates per treatment. In both experiments
del porcentaje de peso se hizo mediante la siguiente
fórmula: Pp= Pf * 100 ; donde: Pp= peso (%); Pi= peso
Pi
inicial (g); Pf= peso final (g).
Vida de florero (VF). Se midió desde la transferencia de
las flores al florero, hasta que se presentó al menos uno de
los siguientes síntomas; pérdida de turgencia, doblamiento
del cuello, caída de pétalos y pudrición de la base del tallo.
El diseño experimental fue completamente al azar con un
arreglo de tratamientos factorial, en el primer experimento
fue de 8∗2∗2 (ocho variedades ∗ dos pretratamiento ∗ dos
soluciones de florero), con cuatro repeticiones por tratamiento;
y en el segundo fue de 8∗2∗2 (ocho variedades ∗ dos épocas de
cosecha ∗ dos soluciones de florero) con ocho repeticiones por
tratamiento. En ambos experimentos se consideró a un tallo
como unidad experimental. Los datos obtenidos se analizaron
mediante análisis de varianza (ANOVA), comparaciones
de medias de Tukey (p≤ 0.05) y correlación entre pares de
variables. La variable peso fresco (expresada en porcentaje)
se le aplicó una transformación mediante el arco seno.
Experimento 1
Los datos muestran una respuesta diferencial entre
cultivares en la variable peso fresco; los tallos que mayor
peso ganaron fueron Red Vicer, Royalty y Pecubo, que no
fueron necesariamente los de mayor vida de florero. Con
respecto a esta variable el cultivar Vendela fue sobresaliente
(Cuadro 1), si lo comparamos con la vida de florero de otros
cultivares reportados como High & Mighty con 8.2 días (sin
almacenamiento refrigerado) (Ahmad et al., 2011) y First
Red y Akito con 7.9 días (almacenadas a 5 ±0.5 ºC por 10
días) (Pompodakis et al., 2005).
Los tallos sometidos al pretratamiento con Hydraflor®,
tuvieron valores significativamente menores en peso fresco
y vida de florero que los tallos manejados en seco (Cuadro 1).
Macnish et al. (2009) observaron que los tallos hidratados de
los cultivares de rosa ‘Black Magic’ y ‘Osiana’, tuvieron una
vida de florero significativamente menor que los mantenidos
en seco. Una posible causa es que los tallos manejados en
seco presentan menor proliferación bacteriana, ya que los
595
a stem was considered as an experimental unit. The data were
analyzed using analysis of variance (ANOVA), Tukey’s
means comparisons (p≤ 0.05) and correlation between pairs
of variables. The variable fresh weight (in percent) was
applied by an arc sine transformation.
Experiment 1
The data show a differential response between cultivars in the
fresh weight variable; the stems that gained more weight were
Red Vicer, Royalty and Pecubo, which were not necessarily
those with the longest vase life. With respect to this variable,
Vendela was quite an outstanding cultivar (Table 1), when
compared with the vase life of the other cultivars reported as
High & Mighty with 8.2 days (with no cold storage) (Ahmad
et al., 2011) and First Red and Akito with 7.9 days (stored at
5 ±0.5 °C for 10 days) (Pompodakis et al., 2005).
Cuadro 1. Efecto del cultivar en ∆PF y VF de tallos de rosa,
posterior al almacenamiento en seco (11 días, 4
°C y 90% HR).
Table 1. Effects of cultivars in ΔPF and VF of rose’s stems,
after dry storage (11 days, 4 °C and 90% RH).
Factor
Cultivar
Freedom
Royalty
Red alfa
Red Vicer
Grand Gala
Sena
Vendela
Pecubo
Pretratamiento
Sin pretratamiento
Hydraflor®
Solución de florero
Agua
Crystal clear®
CV (%)
∆PF (%)
VF (días)
2.64
3.29
2.73
3.36
2.42
2.39
2.95
3.25
9.15
10.46
12.12
10.81
9.34
8.06
13.21
9.56
c
a
c
a
d
d
b
a
de
bc
a
b
cd
e
a
cd
3.30 a
2.43 b
10.92 a
9.76 b
2.81 b
3.04 a
22.5
10.01 b
10.67 a
14.5
∆PF= incremento de peso fresco; VF: vida de florero; CV= coeficiente de
variación; HR= humedad relativa. Medias con la misma letra dentro de columnas y
de cada factor son iguales Tukey (p≤ 0.05).
tallos hidratados tienen mayor humedad alrededor del tejido,
que permite a las bacterias multiplicarse y generar sustancias
mucilaginosas, que entran en los vasos del xilema e impiden
la libre entrada de las soluciones preservativas posterior al
almacenamiento.
La oclusión del tallo provocada por bacterias puede inhibir la
apertura y longevidad de las flores de corte, debido a la baja
absorción de agua (Van Doorn y De Witte, 1997). También
se ha observado en algunas especies florales (claveles,
narcisos, iris, rosa y tulipanes) los beneficios del manejo
en seco, se reporta mayor vida de florero, que los tallos
hidratados, siempre y cuando sean mantenidos debajo de
10 ºC (Cevallos y Reid, 2001).
Otra razón por la que el manejo sin hidratar el tallo floral
tenga mejor respuesta, es que el tratamiento en seco
predispone al tallo a una condición de estrés, retrasando
el desarrollo floral, lo que repercute en mayor vida de
florero después del almacenamiento refrigerado (Nowak y
Rudnicki, 1990; Suzuki et al., 2001). Los resultados de este
estudio muestran que la hidratación de los tallos florales,
posterior a la cosecha no resulta en mejores características
de la flor, lo que contrasta con los procedimientos realizados
por décadas por los productores y empacadores de rosa.
Con respecto a la solución de florero, el uso de Crystal clear®,
tiene un efecto benéfico al incrementar el peso fresco y la vida
de florero de los tallos de rosa de todos los cultivares (Cuadro 1).
Esta respuesta se basa en las características de la solución: bajo
pH, acidez y contenido de azucares que son demandados por
los tallos florales, principalmente en la etapa de apertura floral.
Finalmente con respecto a la incidencia de Botrytis el uso
de Hydraflor®, incrementó 28% su incidencia con respecto
a los tallos manejados en seco (Figura 1). Pecubo resultó el
cultivar más susceptible al ataque del patógeno, los cultivares
Freedom y Sena sólo presentaron signos de la enfermedad
en los tallos pretratados con Hydraflor®, mientras que las
flores de Royalty no se afectaron por el tratamiento toda vez
que 62.5% de sus flores, tanto en las hidratadas como en
las manejadas en seco, presentaron incidencia de Botrytis.
Se ha reportado la susceptibilidad diferencial entre cultivares
de rosa al ataque de Botrytis, atribuida en parte al grosor
de la cutícula del pétalo que dificulta la penetración, entre
otros mecanismos todavía en estudio (Hammer y Evensen,
1994). De forma general se observó que los pétalos de los
tallos manejados en seco, tuvieron menor daño físico que
The stems subjected to the pretreatment with Hydraflor®
were significantly lower in fresh weight and vase life than the
stems handled in dry (Table 1). Macnish et al. (2009) observed
that, the hydrated stems of rose cultivars ‘Black Magic’ and
‘Osiana’, had a vase life significantly lower than those kept
dry. One possible cause is that handled dry stems have lower
bacterial growth, as the hydrated stems have more moisture
around the tissue, which allows bacteria to multiply and produce
mucilaginous substances, which enter the xylem vessels and
prevent the free entry preservative solutions after storage.
Stem occlusion caused by bacteria can inhibit the opening and
longevity of cut-flowers, due to low water absorption (Van
Doorn and De Witte, 1997). It has also been observed in some
flower species (carnations, daffodils, iris, rose and tulip) the
benefits on dry handling, reported greater vase life, as long as
they are kept below 10 °C (Cevallos and Reid, 2001).
Another reason why the un-hydrated handling presents a better
response is that the dry treatment predisposes to the stem to a
stress condition, delaying floral development, which results
in increased vase life after cold storage (Nowak and Rudnicki,
1990; Suzuki et al., 2001). The results of this study show that
hydration of the flowering stems after the harvest is not in best
features of the flower, which contrasts with the procedures
performed for decades by rose growers and packers.
About the vase solution, the use of Crystal Clear® has a
beneficial effect by increasing the fresh weight and vase life
of rose’s stems of all cultivars (Table 1). This response is
based on the characteristics of the solution: low pH, acidity
and sugar content that are demanded by the flowering stems,
mainly at the stage of anthesis.
Finally, with respect to the incidence of Botrytis using
Hydraflor®, 28% increased incidence with respect to the
stems handled in dry (Figure 1). The Pecubo cultivar was more
susceptible to a pathogen attack, Freedom and Sena cultivars
showed only signs of the disease in stems pretreated with
Hydraflor®, while the flowers of Royalty were not affected
by the treatment given that, 62.5% of its flowers in both the
hydrated and in dry handling, showed incidence of Botrytis.
It has been reported differential susceptibility between
cultivars of roses to Botrytis attack, attributed in part to the
thickness of the cuticle of the petal that makes the penetration
quite difficult, among other mechanisms still under study
(Hammer and Evensen, 1994). It is generally observed
that, the petals from the stems dry-handled, presented less
los tallos hidratados con Hydraflor®, que posiblemente
influyó en la menor incidencia de Botrytis, además los
botones florales mostraron un retraso en la apertura y menor
turgencia de pétalos, que representa una ventaja significativa
en la comercialización de rosas (Reid, 2002).
597
physical damage than the stems hydrated with Hydraflor®,
which possibly influenced the lower incidence of Botrytis,
also, the buds showed a delay in opening and lower turgor
pressure of the petals, representing a significant advantage
in the marketing of roses (Reid, 2002).
60
Los caracteres evaluados mostraron comportamiento
diferencial entre cultivares, época de corte, soluciones de
florero y sus interacciones. Los cultivares Pecubo, Red
Vicer y Royalty tuvieron mayor incremento de peso fresco
durante su vida de florero, siendo los cultivares Vendela
y Red Vicer los de mayor vida de florero, superando en
3.5 y 2.6 días al cultivar Pecubo, que fue el cultivar con
menor vida de florero (Cuadro 2). Aunque la longevidad
de las flores de corte está programada genéticamente, es
severamente influenciada por condiciones pre y poscosecha
como la temperatura y el tipo de manejo. En este sentido se
ha observado que las plantas cultivadas en verano tienen
mayor vida poscosecha, que las cultivadas en invierno,
debido a la mayor reserva de carbohidratos producto de una
mayor luminosidad y tasa fotosintética (Halevy y Mayak,
1979; Shvarts et al., 1997; Slootweg et al., 2001).
50
Cuadro 2. Efecto del cultivar en ∆ PF y VF de tallos de rosa,
posterior al almacenamiento en seco (11 días, 4
°C y 90% HR).
Table 2. Effect of the cultivar in ΔPF and VF of rose’s stems,
after dry storage (11 days, 4 °C and 90% RH).
Factor
Cultivar
Freedom
Royalty
Red alfa
Red vicer
Grand gala
Sena
Vendela
Pecubo
Época de corte
Mayo
Septiembre
Solución de florero
Agua
Crystal clear®
CV (%)
∆ PF (%)
VF (días)
4.4 b
7.8 a
1.9 b
7.9 a
-0.63 c
0.65 b
2.5 b
10.9 a
10.5 c
11.9 b
11.5 b
12.3 ab
10.2 c
10.2 c
13.1 a
9.6 c
3.7 b
4.5 a
10.4 b
11.9 a
3.6 b
5.2 a
18.7
10.7 b
11.7 a
10.7
∆PF= incremento de peso fresco; VF= vida de florero; CV= coeficiente de
variación; HR= humedad relativa. Medias con la misma letra dentro de columnas
y de cada factor son iguales Tukey (p≤ 0.05).
% de tallos infectados
Experimento 2
40
30
20
10
0
Hydraflor®
Seco
Figura 1. Porcentaje de tallos con presencia de Botrytis
posterior al almacenamiento refrigerado (11 días, 4
°C y 90% HR) en tallos manejados con a) Hydraflor®
(hidratados); y b) seco (manejo en seco); (n= 8 ± DE).
Figure 1. Percentage of stems with Botrytis after cold storage
(11 days, 4 °C and 90% RH) in stems handled with
a) Hydraflor® (hydrated) and b) dry (dry handling);
(n=8 ±SD).
Experiment 2
The traits evaluated showed differential behavior between
the cultivars, harvest season, vase solutions and their
interactions. Pecubo, Red Vicer and Royalty cultivars had
a greater increase in fresh weight during vase life; Vendela
and Red Vicer were the cultivars with the longest vase
life, surpassing the 3.5 and 2.6 days in cultivating Pecubo,
which was the cultivar with the shortest vase life (Table 2).
Even though, the longevity of cut-flowers is genetically
programmed, is severely influenced by pre-and post-harvest
conditions such as temperature and the type of management.
In this regard it has been observed that, the plants grown in
summer have a greater shelf life than those grown in the
winter, due to a greater carbohydrate reserves resulting from
greater light and photosynthetic rate (Halevy and Mayak,
1979; Shvarts et al. 1997; Slootweg et al., 2001).
By studying the variations in the vase life of roses for
a year, Ruting (1991) reported that, the stems of rose
‘Gerdo’ harvested in May, time of increased demand,
Al estudiar las variaciones en la vida de florero de rosas
durante un año, Ruting (1991) reporta que los tallos
de rosa ‘Gerdo’ cosechados en mayo, época de mayor
demanda, tuvieron menos longevidad. Slootweg et al.
(2001) reportaron que conforme la cosecha de tallos de rosa
cultivares Orange Unique y Diva se efectuaba de agosto
a diciembre, se reducía la vida de florero 70% en ambos
cultivares y se incrementaba la transpiración, atribuyendo
el fenómeno a una menor resistencia estomatal, producto
de las condiciones ambientales del invernadero (menor
luminosidad y mayor humedad relativa).
Pompodakis et al. (2005) determinaron que existe una
correlación lineal, entre la duración de la vida de florero
y la temperatura de crecimiento, debido al efecto de ésta
sobre la actividad fotosintética y por consiguiente el nivel
de carbohidratos, estos autores mostraron que los cultivares
de rosa First Red y Akito que crecieron durante el verano
tuvieron 40% más vida de florero, que las rosas desarrolladas
durante el invierno. En el Estado de México, también se
observa cierta variación en las condiciones ambientales a lo
largo del año, por lo que es muy probable que los tallos que
crecieron durante el verano y se cosecharon en septiembre,
tuvieran mayor contenido de reservas que se reflejó en mayor
vida de florero (Cuadro 2).
El uso de Crystal clear®, mejoró la hidratación de los tallos
después del almacenamiento en seco, lo cual reflejó 69%
de incremento de peso fresco en comparación con los
tallos colocados en agua de la llave, con mayor impacto
en septiembre (Cuadro 2). Diversos estudios muestran el
efecto benéfico de los preservantes florales incrementando
la vida de florero en rosas (Ruting, 1991), clavel (López
et al., 2008), gerbera (Javad, 2011), entre otros. El pH de
la solución de Crystal clear® fue 5, inferior al pH del agua
de la llave (6.5- 7), lo cual contribuyó a romper la tensión
superficial del agua facilitando su absorción. Además, se ha
mostrado que el uso de soluciones con bajo pH reducen el
crecimiento bacteriano con el consecuente incremento en
la vida de florero (Regan y Dole, 2010).
Con respecto a los cambios en peso fresco, se observa
en la Figura 2, que los tallos de los cultivares Royalty,
Red Alfa, Grand Gala, Vendela y Pecubo cosechados en
septiembre y puestas en solución de florero Crystal clear®,
tuvieron mayor ganancia de peso fresco, en comparación
con los tallos cosechados en mayo y colocadas en agua
como solución de florero, repercutiendo en menor vida
de florero (Cuadro 3).
had less longevity. Slootweg et al. (2001) reported that,
since Orange Unique and Diva cultivars were grown from
August to December, it reduced the vase life up to 70% in
both cultivars and increased perspiration, attributing the
phenomenon to a lower stomatal resistance, product of the
greenhouse environmental conditions (low light and higher
relative humidity).
Pompodakis et al. (2005) determined that there is a linear
correlation between the duration of vase life and growth
temperature, due to the effect of this on the photosynthetic
activity and, therefore the level of carbohydrates; these
authors showed that, the rose cultivars First Red and Akito
who grew up during the summer had 40% more vase life
than the roses developed during the winter. In the State
of Mexico, there is also some variation in environmental
conditions throughout the whole year, so it is very likely
that the stems that grew during the summer and harvested
in September, had a higher content of stocks, reflected in
an increased vase life (Table 2).
The use of Crystal clear®, improved hydration of the stems
after storage in dry, reflecting 69% increase in fresh weight,
compared with the stems placed in tap water, with the
greatest impact on September (Table 2). Several studies
show the beneficial effect of increasing floral preservatives
on vase life of the roses (Ruting, 1991), carnation (López
et al., 2008), gerbera (Javad, 2011), among others. The pH
of the solution was Crystal clear® 5, below pH of tap water
(6.5-7), which contributed to break the surface tension of
water to facilitate the absorption. Furthermore, it has been
shown that the use of low pH solutions reduce bacterial
growth with a consequent increase in the vase life (Regan
and Dole, 2010).
Concerning to changes in fresh weight, Figure 2 shows
the stems of the cultivars Royalty, Red Alfa, Grand Gala,
Vendela and Pecubo harvested in September and placed
in a vase solution Crystal clear®, had a higher gained fresh
weight, compared with the stems harvested in May and
placed in water as vase solution, affecting with shorter vase
life (Table 3).
Vase life of all cultivars, subjected to different treatments
was superior to 9 days, so they can be considered as
acceptable. The Figure 3 shows that, the stems harvested
in September (summer crop) generally show higher vase
life in the cultivars Royalty, Red Alfa, Sena, Vendela and
Pecubo. The cutting of the stems every third day helped to
140
Peso fresco relativo (%)
Freedom
120
100
80
60
120
100
80
60
140
Grand gala
120
100
80
60
Sena
120
100
80
60
140
Red alfa
120
100
80
60
140
140
140
Royalty
140
599
Vendela
120
100
80
60
140
Red vicer
120
Pecubo
120
100
100
80
60
0
2
4
6
8
10
Días
12
14
16
80
60
0
2
4
6
8
10
Días
12
14
16
Figura 2. Cambios de peso fresco relativo de ocho cultivares de rosa, cosechadas en dos épocas de corte, posterior al almacenamiento
en seco (11 días, 4 ºC y 90% HR) y sometidos a diferentes tratamientos: cosecha en mayo y colocadas en solución de
Crystal clear® (○); cosecha en mayo y colocadas en agua (●); cosecha en septiembre y colocadas en solución de Crystal
clear® (□); cosecha en septiembre y colocadas en agua (■) (n= 8 ± DE).
Figure 2. Changes of fresh weight on eight cultivars of rose, harvested at two cutting times, after dry storage (11 days, 4 °C and
90% RH) and subjected to different treatments: harvesting in May and placed in solution Crystal clear® (○); harvested in
May and placed in water (●); harvested in September and placed in Crystal clear® solution (□); harvested in September
and placed in water (■) (n=8 ±SD).
La vida de florero de todos los cultivares, sometidos a los
diferentes tratamientos fue superior a 9 días, por lo que
se puede considerar como aceptable. En la Figura 3 se
muestra que los tallos cosechados en septiembre (cosecha
maintain a constant absorption of the solution and extend
vase life (Figure 4). Damunupola et al. (2010) indicated
that this practice significantly improves the absorption of
the solution in different species of cut-flower. The cut also
de verano) muestran en general mayor vida de florero en
los cultivares Royalty, Red Alfa, Sena, Vendela y Pecubo.
El recorte de los tallos cada tercer día ayudó a mantener
constante la absorción de la solución y prolongar la vida
de florero (Figura 4). Damunupola et al. (2010) señalan
que esta práctica mejora significativamente la absorción
de la solución en diferentes especies de flor de corte. El
recorte también prolonga la vida de florero al eliminar la
oclusión de la parte basal del tallo producida por bacterias
y sus subproductos y embolismo (presencia de aire), de
tal forma que se facilita la absorción de la solución de
florero (Van Meeteren y Arévalo, 2009).
16
Vida de florero (días)
14
12
Cuadro 3. Efecto de la solución de florero en ∆PF y VF
de ocho cultivares de rosas cosechadas en dos
épocas de corte.
Table 3. Effect of vase solution in ΔPF and VF in eight
cultivars of roses harvested in two harvesting
seasons.
Época de corte
Mayo
Mayo
Septiembre
Septiembre
Solución
∆PF (%)
VF (días)
Agua
Crystal clear®
Agua
Crystal clear®
3.29 c
4.02 b
2.71 c
6.29 a
9.73 c
11.05 b
11.59 b
12.23 a
∆PF= incremento de peso fresco; VF= vida de florero. Medias con la misma letra
dentro de columnas son iguales Tukey (p≤ 0.05).
Mayo
Septiembre **
**
ns
ns
**
**
**
10
8
extends the vase life by eliminating the occlusion of the
basal part of stalk produced by bacteria and their products
and embolism (presence of air), so that the absorption of
the vase solution it’s easier (Van Meeteren and Arévalo,
2009).
6
cv Vendela
4
cv Pecubo
Pecubo
Vendela
Sena
Grand gala
Red vicer
Red alfa
Royalty
0
Freedom
2
Figura 3. Vida de florero de ocho cultivares de rosa
provenientes de dos épocas de corte manejados
en seco (4 ºC y 90% HR) durante 11 días. Después
del almacenamiento los tallos de rosa se colocaron
en solución preservativa Crystal clear® (n= 8
±DE). ns= no significativo; **= significativamente
diferente (p= 0.05).
Figure 3. Vase life of eight cultivars of rose from two cutting
times handled in dry (4 °C and 90% RH) for 11
days. After storage the stems of roses were placed
in preservative solution Crystal clear® (n= 8 ±SD).
ns= not significant; **= significantly different (p=
0.05).
Los resultados de este trabajo, muestran que el manejo
en seco mantiene e incluso mejora las características
poscosecha de los cultivares de rosa evaluados, permite
cuestionar el punto de vista tradicional de considerar a
la hidratación un paso indispensable en el proceso de
empaque de rosas.
Agua Crystal Agua Crystal
clear®
clear®
Agua Crystal Agua Crystal
clear®
clear
Figura 4. Efecto de la solución de florero en la apertura floral de
dos cultivares de rosa (Vendela y Pecubo), sometidos
a almacenamiento en seco (11 d, 4 °C y 90% HR).
Después del almacenamiento los tallos se colocaron en
agua de la llave o solución preservativa Crystal clear®.
Figure 4. Effect of the vase solution on the flower opening
of two rose cultivars (Vendela and Pecubo), under
dry storage (11 d, 4 °C and 90% RH). After storage,
the stems were placed in tap water or preservative
solution Crystal clear®.
The results of this study show that, the dry handling
maintains and even improves the postharvest characteristics
of the evaluated rose cultivars, allows questioning the
traditional view of considering hydration is an essential step
in the process of packing roses.
601
CONCLUSIONES
CONCLUSIONS
El uso de Hydraf lor ® previo al almacenamiento en
seco redujo la ganancia de peso fresco y favoreció el
desarrollo de Botrytis, por lo que los tallos manejados
completamente en seco tuvieron mejores características
de calidad (peso fresco y vida de florero). Asimismo,
después del almacenamiento refrigerado, se recomienda
la aplicación de una solución preservativa, para asegurar
el restablecimiento de las relaciones hídricas de los tallos
y proveer los sustratos para mejorar las características de
calidad. Las flores cosechadas en septiembre en la mayoría
de los cultivares evaluados, tienen mayor vida de florero
que las cosechadas en mayo, que se ve incrementado con
el uso de una solución de florero como Crystal clear®.
Las cultivares de rosa con mejor comportamiento fueron
‘Vendela’ y ‘Red Vicer’ mientras las de menor vida fue
‘Pecubo’, ‘Grand Gala’ y ‘Sena’.
The use of Hydraflor® prior to the dry storage, reduced
the fresh weight gained and favored the development of
Botrytis, so the stems handled completely dry had better
quality characteristics (fresh weight and vase life). Also,
after the cold storage, the application of a preservative
solution it’s recommended, in order to ensure the
restoration of the water relations of stems and provide
the substrates to improve the quality characteristics. The
flowers harvested in September in most of the cultivars
evaluated present a longer vase life than those harvested
in May, which is increased with the use of a solution such
as Crystal clear®. The best performing rose cultivars were
‘Vendela’ and ‘Red Vicer’ while ‘Pecubo’, ‘Grand Gala’
and ‘Sena’ presented the lowest performance.
AGRADECIMIENTOS
Al Consejo Nacional de Ciencia y Tecnología (CONACYT)
a través del proyecto SAGARPA-CONACYT 11875, por el
apoyo económico para la realización de este proyecto. Al
ingeniero Hugo Domínguez Sepúlveda de Flores de Analco
S. C. de P. de R. L. de C. V., por su incondicional apoyo para
la realización de este trabajo.
LITERATURA CITADA
Ahmad, I.; Joyce, D. and Faragher, J. D. 2011. Physical
stem-end treatment effects on cut rose and acacia
vase life and water relations. Postharvest Biol.
Technol. 59:258-264.
Ávila, A. y Pereyra, S. M. 2007. Cosecha temprana,
apertura forzada y vida en el vaso de flores
de cuatro cultivares de clavel (Dianthus
cariophyllus L.) en invierno y en verano.
Agriscientia. 2:71-77.
Cevallos, J. C. and Reid, M. S. 2001. Effect of dry and wet
storage at different temperatures on the vase life of
cut flowers. HortTechnology. 11:199-202.
Damunupola, J. W.; Qian, T.; Muusers, R.; Joyce, D. C.;
Irving, E. D. and Van Meeteren, U. 2010. Effect
of S-carvone on vase life parameters of selected
cut flower and foliage species. Postharvest Biol.
Technol. 55:66-69.
De Capdeville, G.; Maffia, L. A.; Finger, F. L. and Batista,
U. G. 2005. Pre-harvest calcium sulfate applications
affect base life and severity of gray mold in cut roses.
Sci. Hort. 103:329-338.
Elad, Y.; Kirshner, B. and Gotlib, Y. 1993. Attempts to control
Botrytis cinerea on roses by pre- and postharvest
treatments with biological and chemical agents.
Crop Prot. 12:69-73.
Hammer, P. and Evensen, K. 1994. Differences between rose
cultivars in susceptibility to infection by Botrytis
cinerea. Phytopathology. 84:1305-1312.
Halevy, A. H. and Mayak, S. 1979. Senescence and
postharvest physiology of cut flowers. Part I. Hort.
Rev. 1:204-223.
Hernández, H. F.; Arévalo-Galarza, L.; Colinas-León,
M. T.; Zavaleta-Mancera, H. A. y ValdésCarrasco, J. 2009. Diferencias anatómicas y uso
de soluciones de pulso en dos cultivares de rosa
(Rosa sp.). Revista Chapingo. Serie Horticultura.
15(2):11-16.
Javad, N. M.; Ahmad, K.; Mostafa, A. and Roya, K. 2011.
Postharvest evaluation of vase life, stem bending
and screening of cultivars of cut gerbera (Gerbera
jamesonii Bolus ex. Hook f.) flowers. African J.
Biotechnol. 10(4):560-566.
López, P.; Neisa, D. P.; Bacca, C. and Flórez, V. J.
2008. Evaluación de preservantes florales en la
poscosecha de tres variedades de clavel estándar.
Agronomía Colombiana. 26(1):116-126.
Macnish, A. J.; De Theije, D.; Reid, M. S. and Jian, C. Z.
2009. An alternative postharvest handling strategy
for cut flowers- dry handling after harvest. Acta
Hortic. 847:215-222.
Nowak, J. and Rudnicki, R. M. 1990. Postharvest handling and
storage of cut flowers, florist greens, and potted plants.
Timber Press Inc., Portland, Oregon, USA. 210 p.
Pompodakis, N. E.; Terry, L. A.; Joyce, D. C.; Lydakis,
D. E. and Papadimitriou, M. D. 2005. Effect of
seasonal variation and storage temperature on leaf
chlorophyll fluorescence and vase life of cut roses.
Postharvest Biol. Technol. 36:1-8.
Reid, M. S. 2002. Postharvest handling systems: ornamental
crops. In: Kader, A. A. (ed.). Postharvest technology
of horticulture crops. 3rd edition. University of
California. Oakland, California, USA. 315-326 pp.
Regan, E. M. and Dole, J. M. 2010. Determining optimum
pH and EC levels for extended vase life of cut rose
‘Freedom’, ‘Charlotte’, and ‘Classy’. Acta Hortic.
870:263-271.
Ruting, A. 1991. Effects of wetting agents and cut flower
food on the vase life of cut roses. Acta Hortic.
298:69-74.
Shvarts, M.; Weiss, D. and Borochov, A. 1997.
Temperature effects on growth, pigmentation
and postharvest longevity of petunia flowers.
Sci. Hortic. 69:217-227.
Slootweg, G.; Ten Hoope, M. A. and De Gelder, A. 2001.
Seasonal changes in vase life, transpiration
and leaf drying of cut roses. Acta Hortic.
543:337-342.
Suzuki, A.; Leonard, R. T.; Nell, T. A.; Barret, J. E. and
Clark, D. G. 2001. Effects of retail hydration on
water uptake and quality of ‘Madame Delbard’
roses after long term transport. Acta Hortic.
543: 251-256.
Van Doorn, W. G. and Witte, Y. 1997. Sources of the bacteria
involved in vascular occlusion of cut rose flowers.
J. Amer. Soc. Hort. Sci. 122(2):263-266.
Van Meeteren, U. and Arévalo-Galarza, L. 2009. Obstruction
of water uptake in cut chrysanthemum stems after
dry storage: role of wound-Induced Increase in
enzyme activities and air emboli. Acta Hortic.
847:199-206.
Williamson, B.; Duncan, G. H.; Harrison, J. G.; Harding,
L. L.; Elad, Y. and Zimand, G. 1995. Effect
of humidity on infection of rose petals by dry
inoculated conidia of Botrytis cinerea. Mycol.
Res. 99:1303-1310.
INSTRUCCIONES PARA AUTORES(AS)
La Revista Mexicana en Ciencias Agrícolas (REMEXCA),
ofrece a los investigadores(as) en ciencias agrícolas y
áreas afines, un medio para publicar los resultados de las
investigaciones. Se aceptarán escritos de investigación
teórica o experimental, en los formatos de artículo científico,
nota de investigación, ensayo y descripción de cultivares.
Cada documento será arbitrado y editado por un grupo de
expertos(as) designados por el Comité Editorial; sólo se
aceptan escritos originales e inéditos en español o inglés y
que no estén propuestos en otras revistas.
Las contribuciones a publicarse en la REMEXCA, deberán
estar escritas a doble espacio (incluidos cuadros y figuras)
y usando times new roman paso 11 en todo el manuscrito,
con márgenes de 2.5 cm en los cuatro lados. Las cuartillas
estarán numeradas en la esquina inferior derecha y numerar
los renglones iniciando con 1 en cada página. Los apartados:
resumen, introducción, materiales y métodos, resultados,
discusión, conclusiones, agradecimientos y literatura citada,
deberán escribirse en mayúsculas y negritas alineadas a la
izquierda.
Artículo científico. Escrito original e inédito que se
fundamenta en resultados de investigaciones, en los que se ha
estudiado la interacción de dos o más tratamientos en varios
experimentos, localidades y años para obtener conclusiones
válidas. Los artículos deberán tener una extensión máxima
de 20 cuartillas (incluidos cuadros y figuras) y contener los
siguientes apartados: 1) título; 2) autores(as); 3) institución
de trabajo de autores(as); 4) dirección de los autores(as) para
correspondencia y correo electrónico; 5) resumen; 6) palabras
clave; 7) introducción; 8) materiales y métodos; 9) resultados
y discusión; 10) conclusiones y 11) literatura citada.
Descripción de cultivares. Escrito hecho con la finalidad
de proporcionar a la comunidad científica, el origen y las
características de la nueva variedad, clon, híbrido, etc; con
extensión máxima de ocho cuartillas (incluidos cuadros
y figuras), contiene los apartados 1 al 6 y 11 del artículo
científico. Las descripciones de cultivares es en texto
consecutivo, con información relevante sobre la importancia
del cultivar, origen, genealogía, método de obtención,
características fenotípicas y agronómicas (condiciones
climáticas, tipo de suelo, resistencia a plagas, enfermedades
y rendimiento), características de calidad (comercial,
industrial, nutrimental, etc) y disponibilidad de la semilla.
Formato del escrito
Título. Debe aportar una idea clara y precisa del escrito,
utilizando 13 palabras como máximo; debe ir en mayúsculas
y negritas, centrado en la parte superior.
Autores(as). Incluir un máximo de seis autores, los nombres
deberán presentarse completos (nombres y dos apellidos).
Justificados inmediatamente debajo del título, sin grados
académicos y sin cargos laborales; al final de cada nombre
se colocará índices numéricos y se hará referencia a estos,
inmediatamente debajo de los autores(as); en donde, llevará
el nombre de la institución al que pertenece y domicilio
oficial de cada autor(a); incluyendo código postal, número
telefónico y correos electrónicos; e indicar el autor(a) para
correspondencia.
Resumen y abstract. Presentar una síntesis de 250 palabras
como máximo, que contenga lo siguiente: justificación,
objetivos, lugar y año en que se realizó la investigación, breve
descripción de los materiales y métodos utilizados, resultados,
y conclusiones; el texto se escribe en forma consecutiva.
Nota de investigación. Escrito que contiene resultados
preliminares y transcendentes que el autor(a) desea publicar
antes de concluir su investigación; su extensión es de ocho
cuartillas (incluidos cuadros y figuras); contiene los mismos
apartados que un artículo científico, pero los incisos 7 al 9 se
escribe en texto consecutivo; es decir, sin el título del apartado.
Palabras clave y key words. Se escriben después del
resumen y sirven para incluir al artículo científico en índices
y sistemas de información. Seleccionar tres o cuatro palabras
y no incluir palabras utilizadas en el título. Los nombres
científicos de las especies mencionadas en el resumen,
deberán colocarse como palabras clave y key words.
Ensayo. Escrito recapitulativo generado del análisis de temas
importantes y de actualidad para la comunidad científica,
en donde el autor(a) expresa su opinión y establece sus
conclusiones sobre el tema tratado; deberá tener una extensión
máxima de 20 cuartillas (incluidos cuadros y figuras). Contiene
los apartados 1 al 6, 10 y 11 del artículo científico. El desarrollo
del contenido del ensayo se trata en apartados de acuerdo al
tema, de cuya discusión se generan conclusiones.
Introducción. Su contenido debe estar relacionado con el
tema específico y el propósito de la investigación; señala el
problema e importancia de la investigación, los antecedentes
bibliográficos que fundamenten la hipótesis y los objetivos.
Materiales y métodos. Incluye la descripción del sitio
experimental, materiales, equipos, métodos, técnicas y
diseños experimentales utilizados en la investigación.
Resultados y discusión. Presentar los resultados obtenidos
en la investigación y señalar similitudes o divergencias con
aquellos reportados en otras investigaciones publicadas. En la
discusión resaltar la relación causa-efecto derivada del análisis.
Conclusiones. Redactar conclusiones derivadas de los
resultados relevantes, relacionados con los objetivos e
hipótesis del trabajo.
Literatura citada. Incluir preferentemente citas bibliográficas
recientes de artículos científicos de revistas reconocidas, no
incluir resúmenes de congresos, tesis, informes internos,
página web, etc. Todas las citas mencionadas en el texto
deberán aparecer en la literatura citada.
Observaciones generales
En el documento original, las figuras y los cuadros deberán
utilizar unidades del Sistema Internacional (SI). Además,
incluir los archivos de las figuras por separado en el programa
original donde fue creado, de tal manera que permita, de ser
necesario hacer modificaciones; en caso de incluir fotografías,
estas deben ser originales, escaneadas en alta resulución y
enviar por separado el archivo electrónico. El título de las
figuras, se escribe con mayúsculas y minúsculas, en negritas;
en gráfica de barras y pastel usar texturas de relleno claramente
contrastantes; para gráficas de líneas, usar símbolos diferentes.
El título de los cuadros, se escribe con mayúsculas y
minúsculas, en negritas; los cuadros no deben exceder de una
cuartilla, ni cerrarse con líneas verticales; sólo se aceptan tres
líneas horizontales, las cabezas de columnas van entre las
dos primeras líneas y la tercera sirve para terminar el cuadro;
además, deben numerarse en forma progresiva conforme se
citan en el texto y contener la información necesaria para que
sean fáciles de interpretar. La información contenida en los
cuadros no debe duplicarse en las figuras y viceversa, y en
ambos casos incluir comparaciones estadísticas.
Las referencias de literatura al inicio o en medio del texto, se
utiliza el apellido(s) y el año de publicación entre paréntesis;
por ejemplo, Winter (2002) o Lindsay y Cox (2001) si son
dos autores(as). Si la cita es al final del texto, colocar entre
paréntesis el apellido(s) coma y el año; ejemplo: (Winter,
2002) o (Lindsay y Cox, 2001). Si la publicación que se cita
tiene más de dos autores(as), se escribe el primer apellido del
autor(a) principal, seguido la abreviatura et al. y el año de la
publicación; la forma de presentación en el texto es: Tovar
et al. (2002) o al final del texto (Tovar et al., 2002). En el
caso de organizaciones, colocar las abreviaturas o iniciales;
ejemplo, FAO (2002) o (FAO, 2002).
Formas de citar la literatura
Artículos en publicaciones periódicas. Las citas se deben
colocar en orden alfabético, si un autor(a) principal aparece
en varios artículos de un mismo año, se diferencia con letras
a, b, c, etc. 1) escribir completo el primer apellido con coma
y la inicial(es) de los nombres de pila con punto. Para separar
dos autores(as) se utiliza la conjunción <y> o su equivalente
en el idioma en que está escrita la obra. Cuando son más
de dos autores(as), se separan con punto y coma, entre el
penúltimo y el último autor(a) se usa la conjunción <y> o
su equivalente. Si es una organización, colocar el nombre
completo y entre paréntesis su sigla; 2) año de publicación
punto; 3) título del artículo punto; 4) país donde se edita punto,
nombre de la revista punto y 5) número de revista y volumen
entre paréntesis dos puntos, número de la página inicial y final
del artículo, separados por un guión (i. e. 8(43):763-775).
Publicaciones seriales y libros. 1) autor(es), igual que para
artículos; 2) año de publicación punto; 3) título de la obra
punto. 4) si es traducción (indicar número de edición e idioma,
nombre del traductor(a) punto; 5) nombre de la editorial punto;
6) número de la edición punto; 7) lugar donde se publicó
la obra (ciudad, estado, país) punto; 8) para folleto, serie o
colección colocar el nombre y número punto y 9) número total
de páginas (i. e. 150 p.) o páginas consultadas (i. e. 30-45 pp.).
Artículos, capítulos o resúmenes en obras colectivas
(libros, compendios, memorias, etc). 1) autor(es), igual
que para artículos; 2) año de publicación punto; 3) título
del artículo, capítulo o memoria punto; 4) expresión
latina In: 5) titulo de la obra colectiva punto; 6) editor(es),
compilador(es) o coordinador(es) de la obra colectiva
[se anotan igual que el autor(es) del artículo] punto, se
coloca entre paréntesis la abreviatura (ed. o eds.), (comp.
o comps.) o (coord. o coords.), según sea el caso punto;
7) si es traducción (igual que para publicaciones seriadas
y libros); 8) número de la edición punto; 9) nombre de la
editorial punto; 10) lugar donde se publicó (ciudad, estado,
país) punto y 11) páginas que comprende el artículo, ligadas
por un guión y colocar pp minúscula (i. e. 15-35 pp.).
Envío de los artículos a:
Revista Mexicana de Ciencias Agrícolas. Campo
Experimental Valle de México. INIFAP. Carretera Los
Reyes-Texcoco, km 13.5. Coatlinchán, Texcoco, Estado
de México. C. P. 56250. Tel. 01 595 9212681. Correo
electrónico: revista - [email protected]. Costo de
suscripción anual $ 750.00 (6 publicaciones). Precio de
venta por publicación $ 100.00 (más costo de envío).
INSTRUCTIONS FOR AUTHORS
The Mexican Journal in Agricultural Sciences (REMEXCA),
offers to the investigators in agricultural sciences and
compatible areas, means to publish the results of the
investigations. Writings of theoretical and experimental
investigation will be accepted, in the formats of scientific
article, notice of investigation, essay and cultivar description.
Each document shall be arbitrated and edited by a group of
experts designated by the Publishing Committee; accepting
only original and unpublished writings in Spanish or English
and that are not offered in other journals.
The contributions to publish themselves in the REMEXCA,
must be written in double-space (including tables and
figures) and using “times new roman” size 11 in all the
manuscript, with margins in the four flanks of 2.5 cm. All
the pages must be numbered in the right inferior corner
and numbering the lines initiating with 1 in each page. The
sections: abstract, introduction, materials and methods,
results, discussion, conclusions, acknowledgments and
mentioned literature, must be in upper case and bold left
aligned.
Scientific article. Original and unpublished writing which
is based on researching results, in which the interaction of
two or more treatments in several experiments, locations
through many years to draw valid conclusions have been
studied. Articles should not exceed a maximum of 20 pages
(including tables and figures) and contain the following
sections: 1) title, 2) author(s), 3) working institution of the
author(s), 4) address of the author(s) for correspondence
and e-mail; 5) abstract; 6) key words; 7) introduction;
8) materials and methods; 9) results and discussion; 10)
conclusions and 11) cited literature.
Notice of investigation. Writing that contains
transcendental preliminary results that the author wishes to
publish before concluding its investigation; its extension of
eight pages (including tables and figures); it contains the
same sections that a scientific article, but interjections 7
to 9 are written in consecutive text; that is to say, without
the title of the section.
Essay. Generated summarized writing of the analysis of
important subjects and the present time for the scientific
community, where the author expresses its opinion and
settles down its conclusions on the treated subject; pages
must have a maximum extension of 20 (including tables and
figures). It contains sections 1 to 6, 10 and 11 of the scientific
article. The development of the content of the essay is
questioned in sections according to the topic, through this
discussion conclusions or concluding remarks should be
generated.
Cultivar description. Writing made in order to provide
the scientific community, the origin and the characteristics
of the new variety, clone, hybrid, etc; with a maximum
extensions of eight pages (including tables and figures),
contains sections 1 to 6 and 11 of the scientific article.
The descriptions of cultivars is in consecutive text, with
relevant information about the importance of cultivar, origin,
genealogy, obtaining method, agronomic and phonotypical
characteristics (climatic conditions, soil type, resistance
to pests, diseases and yield), quality characteristics
(commercial, industrial, nutritional, etc) and availability
of seed.
Writing format
Title. It should provide a clear and precise idea of the
writing, using 13 words or less, must be in capital bold
letters, centered on the top.
Authors. To include six authors or less, full names must
be submitted (name, surname and last name). Justified,
immediately underneath the title, without academic degrees
and labor positions; at the end of each name it must be
placed numerical indices and correspondence to these shall
appear, immediately below the authors; bearing, the name
of the institution to which it belongs and official address
of each author; including zip code, telephone number and
e-mails; and indicate the author for correspondence.
Abstract and resumen. Submit a summary of 250 words
or less, containing the following: justification, objectives,
location and year that the research was conducted, a brief
description of the materials and methods, results and
conclusions, the text must be written in consecutive form.
Key words and palabras clave. It was written after the
abstract which serve to include the scientific article in
indexes and information systems. Choose three or four
words and not include words used in the title. Scientific
names of species mentioned in the abstract must be register
as key words and palabras clave.
Introduction. Its content must be related to the specific
subject and the purpose of the investigation; it indicates
the issues and importance of the investigation, the
bibliographical antecedents that substantiate the
hypothesis and its objectives.
Materials and methods. It includes the description of
the experimental site, materials, equipment, methods,
techniques and experimental designs used in research.
Results and discussion. To present/display the results
obtained in the investigation and indicate similarities
or divergences with those reported in other published
investigations. In the discussion it must be emphasize the
relation cause-effect derived from the analysis.
Conclusions. Drawing conclusions from the relevant results
relating to the objectives and working hypotheses.
Cited literature. Preferably include recent citations of
scientific papers in recognized journals, do not include
conference proceedings, theses, internal reports, website,
etc. All citations mentioned in the text should appear in
the literature cited.
General observations
In the original document, the figures and the pictures must
use the units of the International System (SI). Also, include
the files of the figures separately in the original program
which was created or made in such a way that allows, if
necessary to make changes, in case of including photographs,
these should be originals, scanner in resolution high and
send the electronic file separately. The title of the figures
is capitalized and lower case, bold; in bar and pie graphs,
filling using clearly contrasting textures; for line graphs
use different symbols.
The title of the tables, must be capitalized and lower case,
bold; tables should not exceed one page, or closed with
vertical lines; only three horizontal lines are accepted,
the head of columns are between the first two lines and
the third serves to complete the table; moreover, must be
numbered progressively according to the cited text and
contain the information needed to be easy to understand.
The information contained in tables may not be duplicated
in the figures and vice versa, and in both cases include
statistical comparisons.
Literature references at the beginning or middle of the text
use the surname(s) and year of publication in brackets, for
example, Winter (2002) or Lindsay and Cox (2001) if there
are two authors(as). If the reference is at the end of the text,
put in brackets the name(s) coma and the year, eg (Winter,
2002) or (Lindsay and Cox, 2001). If the cited publication
has more than two authors, write the surname of the leading
author, followed by “et al.” and year of publication.
Literature citation
Articles in journals. Citations should be placed in
alphabetical order, if a leading author appears in several
articles of the same year, it differs with letters a, b, c, etc.1)
Write the surname complete with a comma and initial(s)
of the names with a dot. To separate two authors the “and”
conjunction is used or its equivalent in the language the work
it is written on. When more than two authors, are separated
by a dot and coma, between the penultimate and the last
author a “and” conjunction it is used or it’s equivalent. If
it is an organization, put the full name and the acronym in
brackets; 2) Year of publication dot; 3) title of the article
dot; 4) country where it was edited dot, journal name dot
and 5) journal number and volume number in parentheses
two dots, number of the first and last page of the article,
separated by a hyphen (ie 8 (43) :763-775).
Serial publications and books. 1) author(s), just as for
articles; 2) year of publication dot; 3) title of the work
dot. 4) if it is translation ( indicate number of edition and
language of which it was translated and the name of the
translator dot; 5) publisher name dot; 6) number of edition
dot; 7) place where the work was published (city, state,
country) dot; 8) for pamphlet, series or collection to place
the name and number dot and 9) total number of pages (i.
e. 150 p.) or various pages (i. e. 30-45 pp.).
Articles, chapters or abstracts in collective works (books,
abstracts, reports, etc). 1) author(s), just as for articles;
2) year of publication dot; 3) title of the article, chapter
or memory dot; 4) Latin expression In two dots; 5) title
of the collective work dot; 6) publisher(s), compiler(s) or
coordinating(s) of the collective work [written just like the
author(s) of the article] dot, at the end of this, the abbreviation
is placed between parenthesis (ed. or eds.), (comp. or
comps.) or (cord. or cords.), according to is the case dot;
7) if it is a translation (just as for serial publications and
books); 8) number of the edition dot; 9) publisher name
dot; 10) place where it was published (city, state, country)
and 11) pages that includes the article, placed by a hyphen
and lowercase pp (i. e. 15-35 pp.).
Submitting articles to:
Revista Mexicana de Ciencias Agrícolas. Campo
Experimental Valle de México. INIFAP. Carretera Los ReyesTexcoco, km 13.5. Coatlinchán, Texcoco, Estado de México.
C. P. 56250. Tel. 01 595 9212681. E-mail: revista-atm@
yahoo.com.mx. Cost of annual subscription $ 60.00 dollars
(6 issues). Price per issue $ 9.00 dollars (plus shipping).
Revista Mexicana de Ciencias Agrícolas
Mandato:
A través de la generación de conocimientos científicos y de innovación tecnológica agropecuaria y forestal
como respuesta a las demandas y necesidades de las cadenas agroindustriales y de los diferentes tipo de
productores, contribuir al desarrollo rural sustentable mejorando la competitividad y manteniendo la base de
recursos naturales, mediante un trabajo participativo y corresponsable con otras instituciones y organizaciones
públicas y privadas asociadas al campo mexicano.
Misión:
Generar conocimientos científicos e innovaciones tecnológicas y promover su trasferencia, considerando
un enfoque que integre desde el productor primario hasta el consumidor final, para contribuir al desarrollo
productivo, competitivo y sustentable del sector forestal, agrícola y pecuario en beneficio de la sociedad.
Visión:
El instituto se visualiza a mediano plazo como una institución de excelencia científica y tecnológica, dotada de
personal altamente capacitado y motivado; con infraestructura, herramientas de vanguardia y administración
moderna y autónoma; con liderazgo y reconocimiento nacional e internacional por su alta capacidad de
respuesta a las demandas de conocimientos, innovaciones tecnológicas, servicios y formación de recursos
humanos en beneficio del sector forestal, agrícola y pecuario, así como de la sociedad en general.
Retos:
Aportar tecnologías al campo para:
● Mejorar la productividad y rentabilidad
● Dar valor agregado a la producción
● Contribuir al desarrollo sostenible
Atiende a todo el país a través de:
8 Centros de Investigación Regional (CIR’S)
5 Centros Nacionales de Investigación Disciplinaria (CENID’S)
38 Campos Experimentales (CE)
Dirección física:
Progreso 5, Barrio de Santa Catarina, Delegación Coyoacán, Distrito Federal, México. C. P. 04010
Para más información visite: http://www.inifap.gob.mx/otros-sitios/revistas-cientificas.htm.
PRODUCCIÓN
Dora M. Sangerman-Jarquín
DISEÑO Y COMPOSICIÓN
María Otilia Lozada González
y
ASISTENTE EDITORIAL
María Doralice Pineda Gutiérrez

Vol. Especial Núm. 3

Transcription

Similar documents

Nivel 2 - Aspectos Culturales

Nivel 3

St. Peter Chanel Catholic Church

Rivercenter Mall restores history

Agosto 2015 - Recinto de Arecibo - Universidad Interamericana de

Bitter sweet mural blessing for San Anto

Agosto 2014 - Recinto de Arecibo - Universidad Interamericana de

mission streets/ Fotos deL barrio

Descargar PDF - Newton College

p11 p11 - Manhattan Times News

Impacto de especies no-nativas sobre las comunidades mediado

Estudio de los componentes del carácter picante en pimiento