LA BIOTECNOLOGIA e INGENIERIA GENETICA : DEFINICIONES

Comments

Transcription

LA BIOTECNOLOGIA e INGENIERIA GENETICA : DEFINICIONES
LA BIOTECNOLOGIA e INGENIERIA GENETICA :
DEFINICIONES BASICAS , DESARROLLO y
APLICACIONES PARA LA MEJORA DE BIENES Y
SERVICIOS AGROPECUARIOS
W. Roca
Seminario Arequipa , Agosto 20,2012
Síntesis
Vacunas
EN LA AGRICULTURA . . .
Se perfilan
numerosos
desafios
para el futuro
desarrollo de
la agricultura
• Reduccion en la superficie de tierra cultivable per capita
• Erosión y degradación de suelos : desertificacion,
salinidad
• Limitaciones en la disponibilidad de agua
para irrigación (*)
.Cambio climatico: variabilidad - eventos extremos
• Excesiva presión de agroquímicos sobre el medio
ambiente
• Agotamiento paulatino del potencial de mejoramiento
genético actual
(*) Se anticipa una
crisis en la
disponibilidad de
recursos acuíferos
en los próximos 20
años.
Se proyecta
un deficit
grande para
satisfacer la
demanda
de cereales en Datos en Millones de TM
paises
industrializados y en
Se requiere un aumento de la
paises en
producción del 45% en 30 años
desarrollo
Tomado de: James, C. ISAAA Briefs Nº 17, 2000.
Posibles escenarios de la influencia de factores criticos sobre la
volatilidad de los precios de productos agrícolas (*)
II . Porcentaje de aumento o disminución del precio de productos agrícolas
cuando el rendimiento anual de los cereales aumenta o disminuye 5%
Productos
Trigo
Arroz
Granos (Maíz)
Oleaginosas-Harina
Carne-pollo
Oleaginosas-semilla
Rendimiento anual
de cereales: + 5%
- 18%
- 18%
- 17%
- 13%
- 9%
- 5%
(*) OECD-FAO Agricultural Outlook 2011-2020
Rendimiento anual
de cereales: - 5
+ 25%
+ 25%
+ 24%
+ 18%
+ 13%
+ 7%
Principales alimentos importados por el Perú en el 2010 (*)
Producto
Maíz duro amarillo
Trigos
Soya: tortas, harinas, otros
Aceite de soya
Azúcar de caña o remolacha
Arroz blanqueado
Cebada
Malta sin tostar
Manzanas frescas
Lentejas
Leche: polvo, con/sin azúcar
Preparaciones alimenticias
(*) SUNAT, 2011
Ton. M.
1’904,298
1’687,195
1´173,133
343,140
196,204
94,663
90,088
58,672
47,750
32,164
24,974
17,969
PERU: Área de cultivo perdida debido a eventos climáticos
extremos entre 1995 y 2007(*)
Papa
Maíz amiláceo
Plátano
Maíz amarillo duro
Arroz
Cebada-grano
Frijol
Haba-grano
(*) MINAG, Dic. 2010
80,000 Has
59,000
41,000
38,000
30,000
24,000
13,000
12,000
Trigo
Yuca
Arena-forraje
Papaya
Frijol Castilla
Caña de azúcar
Quinua
11,000 Has
11,000
10,000
5,000
4,000
4,000
4,000
Manejo de las papas nativas de Tayacaja,
Huancavelica, hace 30 años y actualmente (*)
(*) S. De Haan & H. Juarez, CIP (2008)
Polilla Guatemalteca
Amenazas al cultivo de
papa , exacerbadas por
el cambio climático.
Heladas
Gorgojo de los Andes
Polilla de los Andes
Reproducción sexual
(Variabilidad y virulencia)
Altiplano (barrera)
Verruga
Por
M.Gutierrez
(UNALM,2012)
Rancha cepa A1
Rancha cepa A2
Producción mundial de alimentos (109 Tm/año)
El incremento
de la producción
agrícola no puede
sustentarse
indefinidamente
en las tecnologías
actuales
Tomado de: Tilman, Proc. Natl. Acad. Sci. USA, 1999.
La utilización incremental de insumos agronómicos
al ritmo de la demanda de alimentos podría conducir
a tensiones insostenibles para los agroecosistemas
% Aumento del precio (2010-2050)
Cambios en el Precio de los Alimentos (2010-2050) (%)
Fuente: Nelson et al. (2010)
Efecto del clima
Efecto económico
El
mejoramiento
convencional
tiene un
límite
teórico
El Banco Mundial reporta que los
rendimientos en granos a nivel mundial
aumentaron a una tasa anual de:
2.1% durante los años 80’s
Menos de 1.0% en los años 90’s
(McCalla, 1999)
que depende Algunas evidencias indican
de la amplitud que los rendimientos agrícolas están
entrando a una meseta, e incluso
de la base
declinando, como es el caso de algunos
genética
sistemas de arroz y trigo .
(James, 1999)
Es necesario
usar todas las
tecnologias
actuales y
futuras,
. Contribuir a aumentar la producción de alimentos y
compensar el descenso de productividad y la reducción de
tierra cultivable
incluyendo la
biotecnologia
moderna .
• Contribuir a aumentar la calidad nutricional
Los OGMs
deben tenerse
en cuenta como
parte de la
solución.
• Contribuir a aumentar el valor agregado
• Contribuir a disminuir la degradación del medioambiente
La Biotecnologia
La biotecnologia comprende un conjunto de tecnologias
que utilizan organismos vivos ( plantas, animales,
microorganismos ) , o partes de ellos, para desarrollar
productos , procesos o servicios .
Los avances logrados ultimamente en la ingenieria
genetica,, la clonacion de genes y organismos , y la
genetica
genomica,, entre otros , han dado origen a lo que hoy
genomica
conocemos como biotecnologia moderna
moderna..
La Ingenieria Genetica
Manipulacion del ADN y los genes , y su uso en la
modificacion genetica de organismos vivos
•
•
mediante las tecnicas de recombinacion y
clonacion molecular . Se basa en el conocimiento de
la estructura y funcion de los genes .
•.
La Molecula de ADN : denominador comun y base física
de la biotecnologia moderna
Alfabeto = 4 letras (A-T,C-G) ( universal )
Codigo genetico =palabra de 3 letras (universal)
Vocabulario = 64 palabras (universal)
GEN
DNA
James Watson ,Francis Crick (1953 )
Estructura y funciones basicas de los genes
Replicación
Transcripció
Transcripci
ón Reversa
Transcripción
Translación
(traduccion
traduccion))
La tecnologia del ADN recombinante
1- Cortar los ADNs de dos especies diferentes
usando la misma “enzima de restricción “ ( EcoRI)
Paul Berg
1972
5’ GTGCCGGTTGAATT
3’ CACGGCCAAC
CCGCGATCGTAAAC 3’ ADN de
TTAAGGCGCTAGCATTTG 5’ plásmido
5’ GTGCCGGTTGAATT
3’ CACGGCCAAC
CCGCGATCGTAAAC 3’ ADN del
TTAAGGCGCTAGCATTTG 5’ virus SV40
2- Acoplar los ADNs cortados usando una “enzima
de ligación” 
5’ GTGCCGGTTGAATTCCGCGATCGTAAAC 3’
3’ CACGGCCAACTTAAGGCGCTAGCATTTG 5’
ADN
recombinante
Clonacion de genes
El ADN del gen se aisla del donante y se inserta en plamidos de
bacterias que contienen factores de resistencia a un antibiotico
antibiotico..
Clonar el gen implica hacer copias identicas de los genes en
medio de cultivo bacterial
bacterial.. El medio permite solo el crecimiento
5
de bacterias conteniendo
el plasmido con el gen de interes
interes.. En
este caso, el gen puede o no ser GM.
R
ADN
Genes utiles de la biodiversidad
biodiversidad,, aislados y clonados
Genes
Fuente
Uso
R
Ry
Rpi--blbl
Rpi
Grol
Rx
S. demissum
S. stoloniferum
S. bulbocastanum
S. spegazzinii
S. andigena
Resistencia a tizón tardío
Resistencia a PVY
Resistencia a tizón tardío
Resistencia a nemátodo
Resistencia a PVX
Defensina
GLS
Bt-- Cry 1
Bt
Osmotina,, Lizosima
Osmotina
Meg 1
RNA i ( antisentido
antisentido))
Maca
Mashua
B. thuringensis
Arabidopsis
Maiz
Papa cultivada
Resistencia a tizón tardío
Resistencia a tizón tardío
Resistencia a insectos
Resistencia a tizón tardíö
Rendimiento ( semilla )
Almidon--amilopectina
Almidon
La Transformacion Genetica
Consiste en la insercion e integracion
estable de genes caracterizados y
especificos en el ADN del organismo
receptor , usando las tecnicas de ingenieria
genetica y clonacion de genes y de celulas
.
Se trata de un “mejoramiento
“mejoramiento genetico de
precision”.
LA TRANSFORMACION GENETICA
EN LA NATURALEZA
EL TRANSGEN : Construccion genetica para usar en la
transferencia de genes por ing.genetica
Construccion del transgen
Gen de
selección
PROMOTOR
- Iniciación de la lectura
- Expresión (duracion
duracion))
- Expresión en tejidos/organos
tejidos/organos
Gen de interés
MENSAJE
EXPRESION
PROTEINA
Gen marcador
TERMINADOR
Terminación de la
lectura
Procedimiento para la transformacion
genetica de cultivos
Plantas
Aislamiento de explantes
(hojas)
Regeneración de
plántas
Co-cultivo de
los explantes
(hojas) con A.
tumefaciens por
16-24 horas a
22°C,
en oscuridad
2 - 6 semanas
Heridas
A. tumefaciens
+ gen foráneo
Regeneracion de plantas transformadas
mediante el cultivo in vitro de células
células y tejidos
Embrio
Embri
ogénesis som
somáática
Organogéénesis
Organog
Evaluacion de las plantas transformadas
1. Comportamiento del transgen:
Localización, número de copias y
expresión primaria (RNAm, proteína,
interacciones)
2. Toxicidad del producto (proteina)
3. Alergenicidad del producto ( proteina)
4. Comportamiento agronómico
5. Impacto en organismos no-blanco
6. Flujo de genes
7. Impacto socio-economico
Evaluacion molecular de las
plantas GMs,
Selección de plántulas
Transgen en
transgénicas
el ADN genómico
de la planta
1.Presencia del
1.Presencia
gen insertado
(Southern Blot)
2.Expresión del
2.Expresió
gen insertado
(Western Blot)
Uso del gen GUS: Marca la presencia del
transgen en las células
Evaluacion de resistencia transgenica usando genes de especies
silvestres (S.bulbocastanum
(S.bulbocastanum)) para vars
vars.. comerciales de papa
El gen Rblb confiere resistencia a “todas la razas conocidas” de P.
infestans.( Rancha de la papa)
La variedad Kathadin transformada es resistente a tizón tardío.
ABC: 3 genes candidatos
(B es el Rblb ),
D: no transformado,
E: no transformado, no
inoculado
Song et al., 2003. PNAS 100(16):9128–9133
Pruebas de campo confinadas de papa ( Kathadin)
transgénica (gen Rblb) resistente a la Rancha
Control Convencional
Transgénico
Maíz resistente a sequía
1 - 2 años
3 - 4 años
3 - 4 años
Transferencia convencional y
biotecnologica de genes
DONANTE DE GENES
Mejoramiento por
Hibridación
(convencional)
RECEPTOR DE GENES
X
RESULTADO
Selección
Mejoramiento de
Precision
(Ing. genética )
33
Manejo del flujo de genes
Separación por
tiempo de
siembra (varía
con el cultivo)
Separación por
distancias (varía
con el cultivo)
Genes de
mitigación
Separación
geográfica
ORGANISMO TRANSGENICO ( OVM , OGM)
Son organismos vivos( planta, animal o micro-organismo) que han sido modificados
mediante las tecnicas de transformacion
genetica , y expresan rasgos nuevos , o
rasgos existentes modulados .
Los primeros OGMs fueron microorganismos
(mediados - finales de los 1970,s ); luego
siguieron las plantas y los animales (
comienzos de los 1980,s )
Lo que permite el mejoramiento de precision
de los cultivos usando ingeniería genética
Permite agregar una nueva característica a una variedad
conocida , adaptada y acepada por agricultores y
consumidores , con el objetivo de reparar un problema de la
var. , como es falta de resistencia a una plaga o
enfermedad, o la falta de tolerancia a heladas o la sequia .
Debido a esto, la siembra de esta variedad ya no resulta
rentable porque ya no rinde suficiente ,o la cosecha tiene
mala calidad por lo que su demanda ha caido, o que
requiere la aplicación excesiva de pesticidas , lo que es muy
costoso y ademas contaminante para suelos , aguas , y para
la gente.
Permite tambien corregir las características existentes en los
cultivos, ej. reducir las sustancias toxicas, alérgenicas,
retardar la maduración de los frutos, y otros…..
Clases de los cultivos transgenicos
actuales
• Rasgos que brindan ventajas a los agricultores en la fase de
producción , en el campo, sin cambiar el producto final.
Contribuyen a reducir los costos de produccion.
– tolerancia a herbicidas
– resistencia a plagas o patógenos
– animales con índice de crecimiento mas alto y eficiente; mayor producción de
leche o lana;
• Rasgos que aumentan el valor del producto agrícola final,
o la cosecha
–
–
–
–
frutos con maduración retardada
Semillas conperfiles de aceites mejorados ( Omegas)
Flores de colores novedosos
Semillas / tuberosas biofortificados o con mejoras en su nivel nutricional
• Rasgos de valor agregado:
Productos como proteínas
farmacéuticas o industriales en plantas o animales usados como
“biofábricas”.
– Producción iducstrial de farmacos o de vacunas
– Producción industrial de aceites o plásticos biodegradables, otros
Comentarios sobre los cultivos GM
• En el 2011 se cultivaron 160 M has (+10% de la superficie
cultivada a nivel global); en 29 paises ( el 50% fueron paises
en desarrollo)
. Mayoritariamente los cultivos GM actuales a nivel comercial
son los llamados “commodities” . Todavia son muy pocos los
cultivos GM criticos para la seguridad alimentaria de
sectores de escasos recursos en paises en desarrollo .
> Promover cultivos y rasgos de importancia local/regional :
seguridad alimentaria , nutricion y desarrollo industrial
> Aumentar de la inversión en CTI .
> Asistencia técnica a agricultores
> Reforzar los programas nacionales de innovación agraria
Impacto ambiental y economico de los cultivos
transgenicos ( 1995 – 2011 )
1.Uso de pesticidas : reduccion de 443 millones Tons de pesticida y
> 18 % del impacto ambiental asociado(*)
2.Emisiones de C02 : reduccion de 19 millones de Kgs de C02
liberados al ambiente : Equivale a retirar 9 millones de automoviles
de las carreteras por un anho (*).
3. Ingreso global agricola: Aumento en US$ 78,000 millones (*)
4.Por adopcion de algodon Bt en la India (**):
24 % de aumento del rendimiento
50% de rentabilidad para pequenhos agricultores
18% de aumento del estandard de vida de pequenhos agricult.
________________________________________________________
(*) Brooks, et al , 2011 ; (**) J.Kathaga & M.Quaim , 2012.
Acceso a las herramientas de la biotecnología
moderna
• Las tecnologías para producir OGM y muchos de los genes
útiles han sido desarrolladas y patentadas en países
industrializados.
• Existe una preocupación de que estas tecnologías y genes no
estarán al alcance de los agricultores en el mundo en
desarrollo.
• Debemos tener en cuenta que las patentes iniciales en
biotecnologías fueron registradas hace cerca a 20 años , por
lo tanto, estaran expirando pronto, y de libre disposicion
• Paises en desarrollo ya estan iniciando su propia industria
para el desarrollo local de transgenicos : China, India , Brasil.

Similar documents