Ginekol Pol. 2011, 82, © P olskie T owarzystwo G inekologiczne 2

Comments

Transcription

Ginekol Pol. 2011, 82, © P olskie T owarzystwo G inekologiczne 2
2
Ginekol Pol. 2011,
82,
LUTY
/2011
PL ISSN 0017-0011 Volume 82
Ginekol Pol 2011 (2) 81-160
Indexed in:
MEDLINE / Index Medicus / Pub Med /
Index Copernicus / Journal Citation Reports /
Science Citation Index Expanded / KBN
www.ginekolpol.com
Aktualna punktacja:
IC – 9,00; MNiSW – 6,00
© Polskie Towarzystwo Ginekologiczne
79
Ginekol Pol. 2011, 82,
NOWE ZAL
Grupy EksECENIA
p
w sprawieertów
suplemen
tacji DHA*
...to co najlepsze z Omega-3
Produkty posiadają rekomendacje:
Polskiego
Towarzystwa
Ginekologicznego
Polskiego
Towarzystwa
Neonatologicznego
Polskiego
Towarzystwa
Pediatrycznego
Produkty Omegamed® posiadają pozytywną opinię Instytutu Matki i Dziecka
*Stanowisko Grupy Ekspertów w sprawie suplementacji kwasu dokozaheksaenowego i innych kwasów tłuszczowych omega-3 w populacji kobiet ciężarnych,
karmiących piersią oraz niemowląt i dzieci do lat 3. Standardy Medyczne, suplement; nr 40, tom 11; 2010.
80
www.omegamed.pl
Nr 2/2011
Dietetyczny środek spożywczy specjalnego przeznaczenia medycznego. Ważna informacja: Produkt przyjmowany pod nadzorem lekarza.
Informacja o produkcie OMEGAMED® PREGNA 500 01/2011
Codzienna podaż zalecanej dawki
czystego DHA 500 mg
dla kobiet w ciąży i matek karmiących
Ginekol Pol. 2011, 82, 81
PL ISSN 0017-0011 Volume 82
Ginekol Pol 2011 (2) 81-160
2
Komitet Naukowy
_Scientific Committee
Leszek Bablok
WΠodzimierz Baranowski
Antoni Basta
WiesΠawa Bednarek
Mariusz Bidziƒski
Andrzej Bieƒkiewicz
Katarzyna Borszewska-Kornacka
Jacek Bràzert
Grzegorz H. Br´borowicz
Bogdan Chazan
Ryszard Czajka
Romuald D´bski
Krzysztof Drews
Mariusz Dubiel
Antoni Duleba (USA)
Soldano Ferrone (USA)
Micha∏ Gaca
Diane Harper (USA)
Grzegorz Jakiel
Artur Jakimiuk
Maciej Jóêwik
Agata Karowicz-Biliƒska
Grzegorz Krasomski
Witold K´dzia
Jan Kornafel
Jan Kotarski
Urszula Kowalska-Koprek
Józef Krzysiek
Marek Kulikowski
RafaΠ Kurzawa
Zbigniew Kwias
Bo˝ena Leszczyƒska-Gorzelak
Andrzej Malarewicz
Andrzej Malinowski
Tomasz Niemiec
Komitet Honorowy
_Honorary Committee
Romuald Biczysko
Adam Cekaƒski
Janusz Emerich
Martin Gillieson (USA)
Jerzy Jakowicki
Stefan Jaworski
MichaΠ Jóêwik
Rudolf Klimek
CzesΠaw KΠyszejko
Jadwiga Kuczyƒska-Siciƒska
ZdzisΠaw Maciejewski
Longin Marianowski
Anita Olejek
Jan Oleszczuk
Tomasz Opala
PrzemysΠaw Oszukowski
Tomasz Paszkowski
Leszek Pawelczyk
Tomasz Pertyƒski
Ryszard Por´ba
Krzysztof Preis
LechosΠaw Putowski
StanisΠaw Radowicki
Jerzy Radwan
Tomasz Rechberger
Izabella Rzepka-Górska
Alfred Reroƒ
Stefan Sajdak
Andrzej Semczuk
Agnieszka Seremak-Mrozikiewicz
Jerzy Sikora
Andrzej Skr´t
Jana Skrzypczak
Violetta Skrzypulec
Krzysztof Sodowski
Jacek Suzin
Krzysztof Szaflik
Krzysztof SzyΠΠo
Andrzej Tykarski Jan Urban
MirosΠaw WielgoÊ
Bogna Wierusz-Wysocka
Jan Wilczyƒski
Andrzej Witek
Theresa Whiteside (USA)
SΠawomir WoΠczyƒski
Henryk Wysocki
Jacek Wysocki
Maciej Zabel
Mariusz Zimmer
Jerzy Mielnik
El˝bieta Ronin-Walknowska
StanisΠaw Ró˝ewicki
Marian Semczuk
Piotr SkaΠba
Zbigniew SΠomko
Marian Szamatowicz
Marian Szpakowski
WiesΠaw Szymaƒski
Henk C.S. Wallenburg (Holandia)
Alina Warenik-Szymankiewicz
Edmund Waszyƒski
Janusz Woytoƒ
Witold Woêniak
© Polskie Towarzystwo Ginekologiczne
LUTY
/2011
Redaktor Naczelny
_Editor in Chief
prof. dr hab. n. med. Marek Spaczyƒski
Zast´pca Redaktora Naczelnego
_Deputy Editor
prof. dr hab. n. med. Ewa Nowak-Markwitz
Sekretarz Redakcji
_Managing Editor
mgr MaΠgorzata Skowroƒska
CzΠonkowie Redakcji
_Editors
dr hab. n. med. Anna Markowska
dr hab. n. med. Robert Spaczyƒski
prof. dr hab. n. med. Ewa Wender-O˝egowska
dr n. med. Magdalena Magnowska
mgr Lucyna Januszek-Michalecka
Adres Redakcji
_Address
Redakcja „Ginekologii Polskiej”,
Klinika Onkologii Ginekologicznej
60-535 Poznaƒ, ul. Polna 33, Polska
tel.: 061 84-19-265
fax: 061 84-19-465
e-mail: [email protected]
[email protected]
www.ginekolpol.com
Wydawca
_Publisher
Na zlecenie Zarzàdu GΠównego PTG
studio k
Krzysztof Molenda
62-090 Rokietnica
Kiekrz, ul. Wiatraczna 5, Polska
tel. kom.: 606 88 75 77
e-mail: [email protected]
Redakcja nie odpowiada za treÊç i jakoÊç reklam oraz ogΠoszeƒ
i komunikatów umieszczonych w Ginekologii Polskiej.
Reklamy leków wydawanych na recept´ skierowane sà tylko
do lekarzy, którzy posiadajà niezb´dne uprawnienia do ich
przepisywania.
NakΠad: 2830 egz.
Indexed in:
MEDLINE / Index Medicus / Pub Med /
Index Copernicus / Journal Citation Reports /
Science Citation Index Expanded / KBN
Aktualna punktacja:
IC – 9,00; MNiSW – 6,00
81
Ginekol
Ginekol
Pol.Pol.
2011,
2011,
82, 82,
82
O D
Poznań, luty 2011
R E D A K C J I
Szanowne Kole˝anki i Koledzy!
Ultrasonografia, którą w Polsce stosuje się od przeszło 30 lat, jest jedną
z najintensywniej rozwijających się gałęzi położnictwa i ginekologii, a zastosowanie
diagnostyki obrazowej ulega stałemu poszerzaniu. Oczywistym zastosowaniem
badania USG jest ocena wieku i masy płodu oraz innych elementów jaja płodowego,
w tym struktury i lokalizacji łożyska, czy ilości płynu owodniowego. Uzyskana
w ten sposób wiedza jest coraz bardziej precyzyjna i pozwala odpowiednio wcześnie
wykryć wiele schorzeń i wad. Stanowi również podstawę do obiektywnego podjęcia
decyzji o wykonaniu cięcia cesarskiego, bądź uzasadnia odstąpienie od tego zabiegu.
Niestety, błędy pomiaru nadal się zdarzają. Dlatego doskonalenie stosowanych metod
jest istotnym celem wielu badaczy. Dwie interesujące prace w tej dziedzinie mamy
przyjemność zaprezentować w niniejszym numerze Ginekologii Polskiej.
Pierwsza z omawianych publikacji dotyczy prognozowania makrosomii płodu. Co
ciekawe, badacze zastosowali model, w którym oprócz oceny biometrycznej płodu
uwzględnia się parametry charakteryzujące kobietę ciężarną. Następnie porównali jego
dokładność w szacowaniu masy prenatalnej z pięcioma innymi obecnie stosowanymi
formułami uzyskując bardzo dobre wyniki, co sugeruje dużą przydatność nowej metody.
Warto rozważyć jej szersze zastosowanie w praktyce klinicznej z uwagi na częstość
występowania makrosomii płodu i związane z nią powikłania okołoporodowe, do
których należą: nieprawidłowy stan pourodzeniowy, wzrost ryzyka dystocji barkowej,
złamania kości ramiennej i obojczyka noworodka, a w odniesieniu do matki –
wydłużenie i traumatyzacja porodu oraz uszkodzenie krocza.
Autorzy drugiej ze wspomnianych prac podjęli się ustalenia wartości normatywnych
wskaźnika sprawności mięśnia serca u płodów pomiędzy 18 a 40 tygodniem ciąży.
Wskaźnik ten umożliwia nieinwazyjną ocenę funkcji serca u dorosłych i dzieci.
Chociaż do kardiologii płodowej wprowadzony został przeszło 12 lat temu, w polskim
piśmiennictwie dotychczas opublikowano normy jedynie dla płodów między 6-10
i 11-13 tygodniem ciąży. Obliczone wartości posłużyć mogą jako punkt odniesienia
w prenatalnej diagnostyce kardiologicznej.
Na łamach bieżącego numeru znajdą Państwo również opis przypadku, gdzie
wobec wystąpienia krwotoku poporodowego, zamiast powszechnie stosowanej
histerektomii, zastosowano embolizację tętnic macicznych. Zdaniem Autorów, taki
sposób postępowania wart jest upowszechnienia, ponieważ pozwala na ocalenie
życia pacjentki oraz zachowanie macicy i płodności, jednocześnie będąc zabiegiem
bezpiecznym, mniej niż histerektomia inwazyjnym i zapewniającym szybszą
rekonwalescencję.
82
Z wyrazami szacunku
Marek Spaczyński
Redaktor Naczelny
Nr 2/2011
Ginekol Pol. 2011, 82, 83
2/
LUTY
2011
S P I S
T R E Ś C I
P R A C E
O R Y G I N A L N E
g i n e k o lo g i a
96
Painful bladder syndrome: management and effect on sexual function
and quality of life
Zespó∏ bolesnego p´cherza moczowego: leczenie i wp∏yw na funkcje seksualne oraz jakoÊç ˝ycia
Schmid Corina, Berger Katrin, Müller Martin, Silke Johann, Mueller Micheal David, Kuhn Annette
102
ACE I/D polymorphism in Polish patients with endometriosis
Polimorfizm I/D genu ACE u polskich pacjentek z endometriozà
Kowalczyńska Liliana J., Ferenc Tomasz, Wojciechowski Michał,
Mordalska Anna, Pogoda Krzysztof, Malinowski Andrzej
P R A C E
O R Y G I N A L N E
po ∏ o ˝ n i ctw o
108
Ilościowa ocena funkcji prawej i lewej komory metodą Dopplera
pulsacyjnego z użyciem wskaźnika sprawności mięśnia serca
u zdrowych płodów między 18 a 40 tygodniem ciąży
Quantitative assessment of the right and the left ventricular function using pulsed Doppler
myocardial performance index in normal fetuses at 18 to 40 weeks of gestation
Hamela-Olkowska Anita, Szymkiewicz-Dangel Joanna
114
Ultrasonograficzne prognozowanie makrosomii płodu
z zastosowaniem oceny masy ciała ciężarnej
Ultrasound macrosomic fetal weight estimation formula using maternal weight measurements
Murlewska Julia, Pietryga Marek, Wender-Ożegowska Ewa
P R A C E
O R Y G I N A L N E
n e o n a to lo g i a
119
Zaburzenia w okresie adaptacyjnym noworodków urodzonych
„blisko terminu porodu”
Late preterm infants – complications during the early period of adaptation
Baumert Małgorzata, Łukomska Agnieszka, Krzych Łukasz J., Magnucki Jacek, Pacula Małgorzata
P R A C E
P O G L Ñ D O W E
po ∏ o ˝ n i ctw o
126
Nieinwazyjne badania prenatalne w diagnostyce aneuploidii chromosmów
13, 18 i 21 – aspekty teoretyczne i praktyczne
Non-invasive prenatal test in the diagnosis of aneuploidy 13, 18 and 21 – theoretical and practical aspects
Stembalska Agnieszka, Łaczmańska Izabela, Dudarewicz Lech
© Polskie Towarzystwo Ginekologiczne
83
Ginekol Pol. 2011, 82, 84
K O M U N I K A T Y
Uprzejmie informuję, że zgodnie z podjętą Uchwałą
Nr 9//09/ZG/2010 na zebraniu
Zarządu Głównego
Polskiego Towarzyst wa Ginekologicznego
w dniu 16 września 2010 r.
wysokość składki członkowskiej PTG
od 1 stycznia 2011 roku wynosi
200 zł rocznie.
P rez es P TG
P ro f. zw. d r h ab. med. Ryszard P o ręba
84
Nr 2/2011
Ginekol Pol. 2011, 82, 85
Spis treści
P R A C E
P O G L Ñ D O W E
po ∏ o ˝ n i ctw o
133
P R A C E
Czy płód może odczuwać ból?
Is fetus able to feel pain?
Kosińska-Kaczyńska Katarzyna, Wielgoś Mirosław
P O G L Ñ D O W E
g i n e k o lo g i a
137
Wady wrodzone układu moczowo-płciowego u kobiet
– diagnostyka i postępowanie
Congenital anomalies of the female reproductive tract – diagnosis and management
Rechberger Tomasz, Kulik-Rechberger Beata
P R A C E
K A Z U I S T Y C Z N E
po ∏ o ˝ n i ctw o
146
Wewnątrznaczyniowa embolizacja tętnic macicznych w leczeniu
wczesnego krwotoku poporodowego – opis przypadku
Intravascular embolization of the uterine arteries in the treatment of early postpartum haemorrhage
– case report
Lisowski Andrzej, Drelichowski Stanisław, Słoka-Sutkowska Alicja, Wiśniewski Dawid, Malinowski Janusz
P R A C E
K A Z U I S T Y C Z N E
g i n e k o lo g i a
150
Olbrzymi guz jajnika – opis przypadku i propozycja
postępowania klinicznego
Giant ovarian tumor – case report and proposal for clinical management
Stukan Maciej, Dudziak Mirosław, Pawłowski Maciej
153
Powtórne założenie wkładki wewnatrzmacicznej po nierozpoznanym
przemieszczeniu poprzedniej do jamy brzusznej
Insertion of IUD after extrauterine mislocation of the previous one
Lewandowski Jan, Cieminski Adam, Emerich Janusz
Na okładce:
Zdjęcia z pracy: Hamela-Olkowska A, et al. Ilościowa ocena funkcji prawej i lewej komory metodą Dopplera pulsacyjnego
z użyciem wskaźnika sprawności mięśnia serca u zdrowych płodów między 18 a 40 tygodniem ciąży. (Str. 108)
Ginekol Pol. 2011, 82, 108-113
© Polskie Towarzystwo Ginekologiczne
85
Ginekol Pol. 2011, 82,
86
Nr 2/2011
87
Ginekol Pol. 2011, 82,
88
Nr 2/2011
Ginekol Pol. 2011, 82,
SUPER OKAZJA!
UZMLPUFSB[XXZKnjULPXFKDFOJF
Szczegóły promocji tel. 81 888 02 72 tel. 65 525 93 08
www.miro-med.pl
© Polskie Towarzystwo Ginekologiczne
89
ALOKA ProSound F75
to więcej niż klasa Premium
dla ginekologa/położnika
Obrazowanie STIC serca płodu:
- nowatorski, opatentowany przez Alokę algorytm rekonstrukcji
- obrazowanie z kolorowym Dopplerem
- prezentacja MPR i objętościowa
Automatyczny pomiar przezierności karkowej AutoNT:
- eliminacja ludzkich pomyłek
- raport z pełną analizą wielokrotnego pomiaru
Pomiary objętości:
- szybki pomiar automatyczny AVM
- precyzyjny pomiar półautomatyczny TVM
- doskonała rekonstrukcja przestrzenna mierzonej bryły
1
Siedziba:
Warszawa (03-707), ul. Floriańska 6 lok. 9, tel. +48 22 518 43 00, fax +48 22 518 43 02
Biura handlowe:
Leszno (64-100), ul. Wolińska 21A, tel. +48 65 525 93 00, fax +48 65 525 93 02
Puławy (24-100), ul. Partyzantów 40, tel./fax +48 81 888 02 72
2
:
2
ćç
3D i elastografia w badaniu piersi:
- nowe dane różnicujące dla sonomammografii
- lekka, przyjazna głowica objętościowa
- duży zakres penetracji i szerokie pole widzenia
- 3D z obrazowaniem przepływu w obrębie zmiany
91
Ginekol Pol. 2011, 82,
Skuteczne zapobieganie i leczenie
nawracających dolegliwości
pochwowych
Zapobiega i leczy bakteryjne zakażenie pochwy (BV)
Przeciwdziała rozwojowi drożdżaków
Przynosi szybką ulgę w dolegliwościach
pochwowych (świąd, podrażnienia, nieprzyjemny
zapach i upławy)
Multi-Gyn ActiGel 50ml. Wskazania: Bakteryjne zakażenie pochwy (Bacterial Vaginosis). Zapobiegawczo w nawracających bakteryjnych zakażeniach pochwy i infekcjach na tle grzybiczym. W dolegliwościach pochwowych takich,
jak: świąd, podrażnienie, upławy, nieprzyjemny zapach, tkliwość, zaczerwienienie, suchość. Sposób stosowania: W leczeniu bakteryjnego zakażenia pochwy z występującymi upławami i/lub nieprzyjemnym zapachem stosować obficie
dopochwowo, co najmniej dwa razy dziennie przez okres min. 5 dni. W celu zapobiegania upławom, nieprzyjemnym zapachom, i podobnym dolegliwościom lub w celu przeciwdziałania rozwojowi drożdżaków stosować dopochwowo
raz na trzy dni. W razie potrzeby można stosować częściej. W przypadku dolegliwości ze strony pochwy takich jak: świąd, podrażnienie, tkliwość, suchość, zaczerwienienie i bolesność należy stosować Multi-Gyn ActiGel obficie
co najmniej raz dziennie lub ilekroć pojawią się dolegliwości. Skład: Galactoarabinan Polyglucoronic Acid Crosspolymer (2QR), Xanthan Gum, Glycerin, Caprylyl Glycol. Uwagi: Po zastosowaniu może być
odczuwalne lekkie szczypanie. Jest to normalne uczucie, które ustępuje w ciągu kilku minut. Można stosować jednocześnie z kuracją antybiotykową lub antygrzybiczą. Ciąża i laktacja: Multi-Gyn Actigel może
być bezpiecznie stosowany w okresie ciąży i karmienia piersią. Klasyfikacja: Wyrób medyczny klasy 2a, CE 0086. Producent: BioClin BV, Delftechpark 55, 2628 XJ Delft, Holandia. Wyłączna dystrybucja
Nr 2/2011
w Polsce:
92Qpharma Sp. z o.o., ul. Wichrowa 7F/10, 04-682 Warszawa, [email protected] www.qpharma.pl.
mga.reklek.v1.05.2010
BIO-AKTYWNY BLOKER BAKTERII
Ginekol Pol. 2011, 82,
© Polskie Towarzystwo Ginekologiczne
93
Ginekol Pol. 2011, 82, 94
K O M U N I K A T Y
SEKCJA ULTRASONOGRAFII
POLSKIEGO TOWARZYSTWA GINEKOLOGICZNEGO
SEKCJA ULTRASONOGRAFII
POLSKIEGO TOWARZYST WA
GINEKOLOGICZNEGO
ORAZ
STOWARZYSZENIE NA RZECZ ZDROWIA KOBIETY
Serdecznie zapraszaj¹ na konferencjê
e
czna ultra
so
kty
ra
i po³o¿nict
wi
gii
lo
fia w gine
gra
ko
no
P
Praktyczna ultrasonografia w ginekologii i po³o¿nictwie
Zakopane, 1-2 kwietnia 2011 r.
Hotel Belvedere, ul. Droga do Bia³ego 3
(31 marca 2011 r. – Warsztaty Praktyczne)
Termin nadsy³ania prac do prezentacji – 1 marca 2011 r.
Zg³oszenia na konferencjê prosimy przesy³aæ na adres:
Sekcja USG PTG - sekretariat, ul. Polna 33, 60-535 Poznañ
tel. 618419334, e-mail: [email protected] oraz [email protected]
Przewodnicz¹cy komitetu naukowego
Dr hab. Marek Pietryga
Honorowy przewodnicz¹cy
Prof. dr hab. Jacek Bràzert
Perinatal Doppler Focus Group
Prof. dr hab. Mariusz Dubiel
94
Nr 2/2011
Ginekol Pol. 2011, 82, 95
© Polskie Towarzystwo Ginekologiczne
K O M U N I K A T Y
95
Ginekol Pol. 2011, 82, 96-101
P R A C E
O R Y G I N A L N E
g i n e k o l o gi a
Painful bladder syndrome: management and
effect on sexual function and quality of life
Zespó∏ bolesnego p´cherza moczowego: leczenie i wp∏yw
na funkcje seksualne oraz jakoÊç ˝ycia
Schmid Corina, Berger Katrin, Müller Martin, Silke Johann,
Mueller Micheal David, Kuhn Annette
Urogynaecology, Department of Gynaecology, University Hospital of Bern and University of Bern, Switzerland
Abstract
Objectives: Primary aim of this study was to evaluate the effect of our therapeutical management in patients with
painful bladder syndrome (PBS) / interstitial cystitis (IC) on sexual function, quality of life and bladder symptoms
using validated tools prospectively.
Material and Methods: A prospective case controlled study. The setting is a tertial referral centre. We included
69 patients with PBS/ IC according to the National Institute of Diabetes and Kidney Disease (NIDDK) into this
study. All patients were managed applying determined therapeutical steps including tetracycline, bladder instillation
consisting of heparine, local anaesthetic and natrium-bicarbonate, prednisolon and antihistaminics or instillation
with DMSO.
Sexual function, quality of life and symptoms were evaluated with validated tools FSFI, King’s Health Questionnaire
and visual analogue scale (VAS).
Results: Pain, nocturia, urinary frequency and urgency were significantly reduced The King’s Health questionnaire
showed a significant improvement of all domains but emotions and sleep, and FSFI improved significantly in all
domains but orgasm.
Conclusion: Patients with PBS/IC undergoing defined therapeutical steps including tetracycline, bladder instillation
and anti-inflammatory agents improved significantly regarding sexual function, quality of life and symptoms.
Long term follow-up has to prove this management as well as profound research on the unknown aetiology have to
been done to determine even more efficient therapeutical regimes.
Key words: painful bladder syndrome / treatment / sexual function / quality of life /
Corresponding author:
Annette Kuhn
Urogynaecology, Department of Gynaecology, University Hospital Bern
Effingerstrasse 102
CH-3000 Bern, Switzerland
phone +41 31 632 10 10, fax: +41 31 632 12 51
email: [email protected]
96
Otrzymano: 20.11.2010
Zaakceptowano do druku: 15.01.2011
Nr 2/2011
Ginekol Pol. 2012, 82, 96-101
P R A C E
O R Y G I N A L N E
ginekologia
Schmid C, et al.
Streszczenie
Cel pracy: Podstawowym celem badania była ocena wpływu leczenia farmakologicznego, u pacjentek z zespołem bolesnego pęcherza moczowego (PBS - painful bladder syndrome) i śródmiąższowym zapaleniem pęcherza
(IC - interstitial cystitis), na funkcje seksualne, jakość życia i objawy bólowe i dyzuryczne pęcherza moczowego
przy użyciu walidowanych kwestionariuszy.
Materiał i metodyka: Prospektywne badanie porównawcze wykonanano w szpitalu o trzecim poziomie referencyjności. Do badania włączono 69 pacjentek z PBS/IC spełniających kryteria NIDDK (National Institute of Diabetes
and Kidney Disease). Wszystkie pacjentki leczono farmakologicznie włączając kolejno, w zależności od odpowiedzi
klinicznej, tetracykliny, dopęcherzowe podawanie heparyny, lignokainy i dwuwęglanu sodu, prednizolon, leki antyhistaminowe lub DMSO (dwumetylosulfotlenek).
Funkcje seksualne, jakość życia i objawy chorobowe oceniono przy pomocy walidowanych kwestionariuszy: FSFI,
Kwestionariusza King’s Heath oraz wizualnej analogowej skali wzrokowej (visual analogue scale - VAS).
Wyniki: Ból, nokturia, częstotliwość oddawania moczu i parcia naglące były znacząco obniżone. Zgodnie z kwestionariuszem King’s Heath wykazano znaczącą poprawę we wszystkich kategoriach za wyjątkiem emocji i snu, a
w FSFI znacząco poprawiły się wszystkie kategorie za wyjątkiem orgazmu.
Wnioski: U pacjentek z zespołem bolesnego pęcherza moczowego, u których zastosowano terapie obejmujące
kolejno: tetracykliny, leczenie dopęcherzowe i środki przeciwzapalne – wykazano znaczącą poprawę w zakresie
funkcji seksualnych, jakości życia oraz ustępowanie objawów bólowych i dyzurycznych.
Długoterminowa obserwacja, tak samo jak rozszerzone badania nad nieznaną etiologią, muszą zostać przeprowadzone, aby określić bardziej efektywne modele terapeutyczne.
Słowa kluczowe: zespół bolesnego pęcherza moczowego / terapia /
/ funkcje seksualne / jakość życia /
Introduction
Painful bladder syndrome (PBS)/ interstitial cystitis (IC)
is a clinical syndrome of pelvic pain and/or urinary urgency/
frequency in the absence of a specific cause such as bacterial
infection or bladder injury [1]. Mechanisms of PBS/IC are as
yet undefined and it is largely this lack of knowledge, which
precludes a systematic therapeutic approach. Painful bladder
syndrome/ interstitial cystitis (PBS/IC) is a symptom complex
of urinary frequency, urgency and /or chronic pelvic pain, in
a patient in whom no other pathology can be established such
as urinary tract infection, carcinoma or cystitis induced by
radiation or medication. Considering the high number of patients
in need of a permanent therapeutic regime (approximately
750 000 individuals in the USA, based on a survey by Curhan),
the clinical problem of interstitial cystitis has a considerable
impact – not only on the individuals’ well being, but also on a
Nation’s health budget [2].
Pathophysiology of PBS/IC remains unknown, and as a
consequence, the treatment of PBS/IC is largely empirical. A
multitude of mechanisms of the disease have been postulated
ranging from neuroinflammatory to autoimmune or possibly
infectious or toxic agents. Recent studies have hinted towards
a genetic course of the disease, but in most hypotheses an
inflammatory component of some kind is considered important
[3].
Several causes have been postulated including infection,
autoimmune response, allergic reaction, neurogenic inflammation,
epithelial dysfunction and inherited susceptibility.
The prevalence of painful bladder syndrome/ interstitial
cystitis (PBS/IC) among gynaecological patients attending with
unclear pelvic pain or chronic cystitis is higher than expected.
The prevalence ranges from 10 to 500 cases/100000 women
depending on the criteria used for diagnosis [4].
© Polskie Towarzystwo Ginekologiczne
PBS has a known negative impact on quality of life and
sexual function because of extreme urinary frequency and pain
[5].
A large number of pharmacologic treatment options
have been used to treat this condition with limited success
including pentosan polysulfate, heparin, antihistamines, tricyclic
antidepressants, intravesical dimethyl sulfoxide and bacilli
Calmette-Guérin [6, 7, 8, 9, 10].
Objectives
The aim of this prospective cohort study was to show how
our treatment algorithm based on current literature [7, 10, 11,12]
affects sexual function, quality of life and symptoms in female
patients with PBS.
Material and Methods
Patients were recruited from the outpatient department
among of the Department of Urogynaecology at the University
Hospital of Bern, Switzerland. All patients with the diagnosis
of PBS/IC who gave informed written and oral consent were
included into this prospective cohort study between July 2004
until October 2009.
The diagnosis of IC/PBS was made according to the criteria of
the National Institute of Diabetes and Kidney Disease (NIDDK).
All patients had a history of unsuccessful therapy with
anticholinergic agents, local estrogen if postmenopausal or even
injections with Botulinum Toxin.
Patients filled in a three-day bladder diary and urinalysis was
performed from midstream or catheter urine before inclusion.
Patients were examined gynaecologically to exclude local
infection and transvaginal ultrasound was performed to exclude
pelvic masses and patients were also asked to fill in a bladder
diary assessing their functional capacity.
97
P R A C E
Ginekol Pol. 2011, 82, 96-101
O R Y G I N A L N E
gineko l o gi a
Painful bladder syndrome: Management and effect on sexual function and quality of life.
Figure 1. Treatment scheme.
Cystoscopy was performed using general anaesthesia and
bladder distension was performed using a pressure of 80cmH20
for 5 minutes, cystoscopic findings were noted. Cold cut biopsies
were taken from suspicious lesions and send for histology.
Treatment scheme was as follows: Figure1
Tetracycline dosage was 100mg/d for two weeks followed
by 100mg/d for additional two weeks including partner therapy.
Condom use was recommended for the treatment period.
Instillation therapy was performed as followed:
Patients were instructed for intermittent clean self
catheterization (ISC). 40000 IE Heparin, 10ml 1% Xylocain
and 2ml Natriumbicarbonate were instilled twice a day for three
weeks followed by once daily for another three weeks. For those
who were unable to perform ISC, the district nurse was instructed
to perform the instillation.
Prednisolon was given orally (1mg/kg) with an anti-ulcerative
protection (aluminium hydroxide emulsion for four weeks after
which the patients were weaned.
Cimetidine was administered orally 400mg bd.
DMSO is a chemical solvent with analgesic, anti-inflammatory
and muscle relaxant effects. A total of 50ml Dimethyl Sulfoxide
solution (DMSO), 500mg Dimethyl Sulfoxide per ml, were
administered in six weekly instillations via ISC.
If these measures were not successful, patients were referred
for neurostimulation.
At any time additional non steroidal antirheumatic agents
(NSAR) or further pain medication were allowed if required. The decision if to proceed to the next therapeutical step was
performed by the patient: She was asked if she is satisfied with
the current situation or if not; in the latter case, the next step was
initiated. Treatment was defined as successful if the patients did
not require further treatment. If relapse occurred after initial
success the last successful step of the treatment scheme was
repeated.
Patients were evaluated prior to the treatment and two weeks
after each therapeutical step using the Female Sexual Function
index FSFI, the King’s Health questionnaire and the Visual
Analogue scale (VAS).
98
Additionally, patients who were without any symptoms were
asked to fill in the questionnaires six months after cessation of
therapy.
To evaluate sexual function the Female Sexual Function
Index (FSFI) questionnaire as determined by Rosen was used
[13].
Six domaines of sexual function (desire, arousal, lubrication,
orgasm, satisfaction and pain) are determined and the questionnaire
is validated in German, French and other European languages.
Each domain is scored with scores ranging from 0-8. The higher
the score the more sexually satisfied is the patient.
To assess quality of life the King’s Health questionnaire
was used [14]. The King’s Health questionnaire is validated in
several European languages and determines various aspects of
quality of life as sleep, symptom bother, physical limitations,
role limitations and emotions. The score ranges from 0-80. The
higher the score the less bothered is the patient by the symptom.
To quantify the severity of the symptoms the visual analogue
scale (VAS) 0-10 was used with 0 points being the least bother
and 10 points being the worst possible bother of bladder symptom.
Patients were asked to name their most bothersome symptom and
to rate it applying the VAS.
For statistical analysis, Prism version 4.0 for Windows was
used. A paired two-tailed t-test was performed to compare scores
before and after treatment and alpha was set 0.05.
Results
72 patients could be included in the study and follow-up was
36 months (range 14-48).
Median age was 48 (range 24-62) years and a parity of 2
(range 0-3). The duration until the diagnosis of PBS/IC was 62
months (range 41-78) and previously performed cystoscopies
were 2 (range 0-4).
21 patients had a history of endometriosis or were still
undergoing investigations for endometriosis.
Functional capacity increased from 178ml (median; range
95-200ml) to 218 (median, range 145-260, p<0.01).
Nr 2/2011
Ginekol Pol. 2012, 82, 96-101
P R A C E
O R Y G I N A L N E
ginekologia
Schmid C, et al.
Table I.
Table II.
Figure 2. FSFI before and after treatment.
Treatment steps (followed the treatment scheme) and their
success:
- 17 patients were satisfied after a treatment with Tetracyclines.
- 29 patients after therapy heparin, Xylocain 2%
and Natriumbicarbonate,
- nine patients after steroids,
- two after antihistamines,
- nine after DMSO-instillation.
© Polskie Towarzystwo Ginekologiczne
Figure 3. Most bothersome symptom as determined by visual analogue scale
(VAS) before and after treatment
- S
ix patients undergoing neurostimulation have not yet been followed up until now.
12 patients required repeat Heparin bladder instillation.
Median symptom free interval was 6 months (range 3-24
months).
One patient required another drug therapy with steroids after
12 months and three repeated DMSO instillation after a median
symptom free interval of 11 months (range 9-14 months).
99
P R A C E
Ginekol Pol. 2011, 82, 96-101
O R Y G I N A L N E
gineko l o gi a
Painful bladder syndrome: Management and effect on sexual function and quality of life.
Discussion
Figure 4. King’s Health Questionnaire before and after treatment.
Patients did not experience serious side effects; one patient
suffered from hot flushes during the use of prednisolone and two
patients were suffering from recurrent bacterial cystitis while
performing ISC for bladder instillations, which were treated with
antibiotics.
Figure 2 shows the results of the FSFI questionnaire. The
domains are marked in different colours with the initial FSFI
score on the left side and the FSFI score three months after
intervention to the right. For FSFI, a full data set of 66 patients
only was analysed as three patients were reluctant to fill in the
FSFI questionnaire.
Table I summarizes the statistical analyses of the FSFI
scores before and after therapy.
Figure 3 shows the development of the most bothersome
symptom as defined by VAS. Pain, nocturia, urinary frequency
and urgency improved significantly (p<0.05). Note that the higher
the FSFI scores for pain are the less discomfort is noted.
48 patients named pain as the most bothersome symptom, 18
urgency, three nocturia and three patients were unable to name
the most bothersome symptom.
Pain improved significantly (p<0.001) as did nocturia
(p<0.01) and frequency (p<0.01).
Urgency improved with a mean VAS score dropping from
40 to 25 but without statistical significance (p=0.09; all student’s
t-tests).
Figure 4 shows the results of the King’s Health questionnaire.
On the left side the initial score of the King’s Health questionnaire
and on the right side the results six months after treatment.
King’s Health Questionnaire scores in general showed
high scores around 40 even after therapy for the domains
role limitations, physical limitations, personal relationship
and emotions; incontinence impact was low with 14 and 15
respectively.
Table II gives an overview about the statistical analyses of
the King’s Health Questionnaire results (all two-tailed t-tests).
General health, role limitations, physical limitations, personal
relationship, and sleep/energy improved significantly. Emotions
deteriorated significantly.
100
The current study shows that with a stepwise therapy
compromising tetracycline, bladder instillation with heparin/
local anaesthetic, oral steroids, antihistamines and DMSO
instillation an improvement of sexual function and quality of life
in some domains but not in all can be achieved. 10% of patients
who have not been evaluated yet have undergone neurostimulator
implantation and did not respond to any of the therapeutical
steps.
According to the King’s Health questionnaire, incontinence
impact in PBS/ IC-patients was low before and after treatment;
this demonstrates that incontinence is not a major issue in PBS/
IC-patients.
Despite the common opinion that PBS/IC is easily confused
with urinary tract infections and that consecutively antibiotics are
of no therapeutic benefit [5]. 25% of our patients responded to oral
tetracycline therapy. Tetracyclines are broad-spectrum antibiotics
that are effective against some of the most common infectious
causes of sexually transmitted diseases, such as C. trachomatis,
N. gonorrhoea, U urealyticum and M. genitalium. The prevalence
of sexually transmitted disease is growing and in chlamydial
infection it is 5-20% [15]. We might assume that in those patients
who responded to tetracyclines an underlying infectious cause
was the reason for the symptoms despite negative urine cultures.
Male partners of all patients were also treated, which is in
accordance with the local guidelines for sexually transmitted
diseases [16].
Particularly the complaint of pain as determined with the
FSFI and the VAS can be effectively treated with the treatment
scheme. 55% of the patients responded to either Heparin/LA or
DMSO local bladder instillation, which corresponds to data from
the literature [5; 7; 10].
In the current study, antihistamines were successful in three
percent of patients only, which is remarkably less compared to data
from Theoharides [11]. In the latter, hydroxyzine was used with
an improvement of 65% and additive beneficial effects caused by
sedative and anxiolytic properties were noted. Cimetidine as we
used in the current study has been evaluated in small open-label
trial [8] and has been shown to provide some relief. This was the
reason why we included this drug in the current study; however, it
has not been studied in randomized, placebo-controlled trials and
the current data do not support a valuable effectiveness [9].
Only 13% of our patients felt cured after an oral therapy with
prednisolone; this is less than in a small study of 14 patients with
IC/PBS by Soucy who reported 69% improvement; however, in
that study prednisolone was used as permanent medication which
may be preferable in patients who respond to prednisolone [17].
Sexual dysfunction in PBS/IC patients is a known problem,
and other studies have suggested the use of antidepressants [18].
Gardella describes that the use of antidepressants could have
contributed to the preponderance of sexual dysfunction in her
study group [19]. We have not used antidepressants in the current
study; controlled clinical trails have not yet been performed but
this may be an issue for future studies.
Sexual function is known to be impaired in women with
interstitial cystitis as also shown in the current study [20]. Many
women had pre-treatment FSFI scores below the cut-off score of
26 for hypoactive sexual disorder suggested by some authors to
determine female sexual dysfunction [21].
Nr 2/2011
Ginekol Pol. 2012, 82, 96-101
P R A C E
O R Y G I N A L N E
ginekologia
Schmid C, et al.
While sexual dysfunction appears to be important in
predicting quality of life, we cannot ascribe causality. Certainly
sexual functioning in a chronic pain disease state as IC/PBS must
be influenced by numerous variables that will include pain and
storage symptoms associated with IC/PBS, but other factors,
probably psychosocial, not yet described can possibly be involved
as well. Further studies will address this association [22].
Five percent of patients were reluctant to answer the FSFI
questionnaire; it is possible that most patients deciding not to
answer that sexual function form may not have been sexually
active or had been experiencing sexual dysfunction or were too
embarrassed or distressed to complete the questionnaire [23].
We did not capture depressive symptomatology or coping
strategies in our cohort of patients with IC/PBS. It has been
reported that patients with IC/PBS suffer from greater depression
than controls [24].
We did not perform multichannel urodynamics in this
study, which is another potential negative aspect of the study.
However, as all bladder interventions are painful for the patients
we believe that the measurement of functional capacity, sexual
function quality of life and symptom bother in PBS/IC patients
using validated tools is more promising and less disturbing for
the patient. Functional bladder capacity increased significantly.
Cochrane database describes an increase of bladder capacity using
intravesical oxybutinin instillation and but concluded that due to a
lack of valuable data randomised controlled trials are still needed
[25]. Regarding the academic aspect, we fully agree, however, it
is difficult to suggest a patient who is suffering with diminished
quality of life and sexual function a placebo controlled study.
The estimated prevalence of PBS/IC ranges widely, the
pathogenesis is unknown, the diagnosis is usually delayed as
demonstrated in our current study with a time interval between
onset of symptoms and treatment of five years. The natural history
is unclear, treatment is empiric, and preventive techniques have
not even been considered [26].
Hanno summarizes: “The lack of universally accepted
clinical diagnostic criteria of IC affects all aspects of making
progress in understanding this disease”. In the current study,
we have used the criteria of the NIDDK because of rather clear
criteria of inclusion and exclusion at the time of the study start
despite not being the most recent classification [27].
We found the NIDDK criteria useful and easy in clinical
practice; additionally, NIDDK criteria have a high specificity
and have proven effective in clinical research studies allowing
comparative analysis of results [12]. For future studies, ESSIC
(European Society for the Study of interstitial Cystitis) criteria
will be followed [28]. However, at the start of this study these
were not available.
We did not experience any serious side effects of our treatment,
and patients’ acceptability of intermittent self catheterization
(ISC) was not a problem despite their initial restraints about ISC.
ISC does not appear to be a burden for the patient and, from a
patient’s perspective, can be recommended [29].
The origin of PBS/IC remains unclear, and the current
study did not aim at investigating the pathogenic cause of PBS/
IC. Consecutive projects for the determination of underlying
molecular pathologies are planned.
© Polskie Towarzystwo Ginekologiczne
Acknowledgements
We thank Pfizer AG for their support of this study with the European
Bladder Grant.
Disclosure of Interests
There is no conflict of interest of any authors except for the European
Bladder Grant by Pfizer. All the authors contributed equally to the planning of
the study (CS; KB, SJ; MDM; AK).
Ethical approval was obtained from the local ethics commitee as
uploaded (KEK Kantonale Ethikkommission Berne, Sitzerland, kek-bern.ch,
President: Prof. Dr. pharm N. Tüller, Postfach 56, CH-3010 Berne, Switzerland).
Studynumber: 146-05.
Re f e r e nce s
1. Gillenwater J, Wein A. Summary of the National Institute of Arthritis, diabetes, Digestive and
Kidney Disease Workshop on Interstitial Cystitis National Institutes of Health, Bethesda,
Maryland August 28-29, 1987. J Urol. 1988, 140, 203-206.
2. Curhan G, Speizer F, Hunter D, [et al.]. Epidemiology of interstitial cystitis: a population based
study. J Urol. 1999,161, 549-552.
3. Pontari M, Ruggieri M. Mechanisms in prostatitis/chronic pelvic pain syndrome. J Urol. 2004,
172, 839-845.
4. Temml C, Wehrberger C, Riedl C, [et al.]. Prevalence and correlates of interstitial cystitis
symptoms in women participating in a health screening project. Eur Urol. 2007, 51, 803-809.
5. Chancellor M, Yoshimura N. Treatment of interstitial cystitis. Urology. 2004, 63, 85-92.
6. Hanno P. Analysis of long-term Elmiron therapy for interstitial cystitis. Urology. 1997, 49, 93-99.
7. Parsons C, Housley T, Schmidt J. Treatment of interstitial cystitis with intravesical heparin. Br J
Urol. 1994, 73, 504-507.
8. Seshadri P, Emerson L, Morales A. Cimetidine in the treatment of interstitial cystitis. Urology.
1994, 44, 614-616.
9. Theoharides T, Sant G. New agents for the medical treatment of interstitial cystitis. Exper Opin
Investig Drugs. 2001, 10, 521-546.
10. Peeker R, Haghsheno M, Holmäng S, [et al.]. Intravesical bacillus Calmette-Guerin and dimethyl
sulfoxide for treatment of classic and nonulcer interstitial cystitis: a prospective randomized
double-blind study. J Urol. 2000, 164, 1912-1916.
11. Theoharides T, Sant G. Hydroxyzine therapy for interstitial cystitis. Urology. 1997, 49, 108-110.
12. Sant G. Etiology, pathogenesis, and diagnosis of interstitial cystitis. Rev Urol. 2002, 4, 9-15.
13. Rosen R, Brown C, Heiman J, [et al.]. The Female Sexual function Index (FSFI): a multidimensional
self-report instrument for the assessment of female sexual function. J Sex Martial Ther. 2000,
26, 191-208.
14. Kelleher C, Cardozo L, Khullar V, Salvatore S. A new questionnaire to assess the quality of life
of urinary incontinent women. Br J Obstet Gynaecol. 1997, 104, 1374-1379.
15. Centres for Disease Control and Prevention. Sexually Transmitted Disease Surveillance (2005).
Atlanta, GA: US Department of Health and Human Services, November 2006.
16. Workowski K, Berman S. CDC sexually transmitted disease treatment guidelines. Clin Infect Dis.
2002, 35, suppl. S135-137.
17. Soucy F, Gregoire M. Efficacy of prednisolone for severe refractory ulcerative interstitial cystitis.
J Urol. 2005, 173, 841-843.
18. van Ophoven A, Pokupic S, Heinecke A, Hertle L. A prospective, randomized, placebo controlled,
double-blind study of amitriptyline for the treatment of interstitial cystitis. J Urol. 2004, 172, 533536.
19. Gardella B, Porru D, Ferdeghini F, [et al.]. Insight into urogyneclogic features of Women with
interstitial cystitis/painful bladder syndrome. Eur Urol. 2008, 54, 1145-1151.
20. Nickel J, Tripp D, Teal V, [et al.]. Sexual function is a determinant of poor quality of life for women
with treatment refractory interstitial cystitis. J Urol. 2007, 177, 1832-1836.
21. Rosen R, Brown C, Heimah J, [et al.]. The female sexual function index (FSFI): a multidimensional
self-report instrument for the assessment of female sexual function. J Sex Marital Ther. 2000,
26, 191-208.
22. Azevedo K, Nguyen A, Rowhani-Rahbar A, [et al.]. Pain impacts sexual functioning among
interstitial cystitis patients. Sex Disabil. 2005, 23, 189-208.
23. Basson R. Recent advances in women’s sexual function and dysfunction. 2004, 11, 714-725.
24. Rothrock N, Lutgendorf S, Hoffman A, Kreder K. Depressive symptoms and quality of life in
patients with interstitial cystitis. J Urol. 2002, 167, 1763=1767.
25. Dawson T, Jamison J. Intravesical treatments for painful bladder syndrome/interstitial cystitis
(Review). The Cochrane Library, Issue 4, 2008. CD 006113.
26. Warren J, Brown J, Tracy J, [et al.]. Evidence-based criteria for pain of interstitial cystitis/ painful
bladder syndrome in women. Urology. 2008, 71, 444-448.
27. Hanno P, Landis R, Metthews-Cook Y, [et al.]. The diagnosis of interstitial cystitis revisited:
Lessons learned from the National Institutes of Health Interstitial Cystitis Data Base Study. J
Urol. 1999, 161, 553-557.
28. van de Merwe J, Nordling J, Bouchelouche P, [et al.]. Diagnostic criteria, classification, and
nomenclature for painful bladder syndrome/interstitial cystitis: An ESSIC proposal. Eur Urol.
2008, 53, 60-67.
29. Kessler T, Ryu G, Burkhard F. Clean intermittent self-catheterization: a burden for the patient?
Neurourol Urodyn. 2009, 28, 18
101
P R A C E
O R Y G I N A L N E
gineko l o gi a
Ginekol Pol. 2011, 82, 102-107
ACE I/D polymorphism in Polish patients
with endometriosis
Polimorfizm I/D genu ACE u polskich pacjentek z endometriozà
Kowalczyńska Liliana J.1, Ferenc Tomasz1, Wojciechowski Michał2,
Mordalska Anna1, Pogoda Krzysztof2, Malinowski Andrzej2
1
2
Department of Biology and Medical Genetics, Medial University of Łódź, Poland
Clinic of Surgical and Endoscopic Gynecology, Medical University, Polish Mother’s Memorial Hospital, Łódź, Poland
Abstract
Objectives: To analyse I/D polymorphism of ACE gene in women with diagnosed endometriosis and to determine
the correlation of the identified genotypes with the stage of the disease and its clinical picture.
Material and methods: The analysis of ACE I/D gene polymorphism was performed in a group of 121 women
with endometriosis and in the control group of 122 women. In the study group the stage of the disease, number of
pathological foci, occurrence of chronic pain in pelvis minor and infertility were taken into consideration.
Results: In the study group the following distribution was found of ACE gene genotypes: II – 25.62%, ID – 47.93%,
DD – 26.45%, whereas in the control group: II – 35.25%, ID – 41.80%, DD – 22.95%. The comparison of the
frequency of analysed genotypes and alleles between the study and control groups did not demonstrate statistically
significant differences (p>0.05). Similarly no correlation was found for these parameters when the four stages of the
disease acc. to rAFS (p>0.05) were compared. In the study group the frequency was compared of the analysed
ACE gene genotypes and alleles in women with infertility (n=59) and in fertile women (n=62). The comparison of
these parameters did not demonstrate statistically significant differences between the analysed groups (p>0.05).
The frequency of genotype II was 17.07%, ID – 46.34% and DD – 36.59% in women with endometriosis complaining
of pain (n=41). In the group of women with endometriosis without pain the frequency of the investigated genotypes
(II, ID, DD) was respectively: 26.53%, 59.18%, 14.29%. DD genotype and D allele were more frequent in patients
with pain complaints (p<0.05).
Conclusion: In analysed population no association was found of ACE I/D polymorphism and the prevalence of
endometriosis, its stages or the number of disease foci. However, the association of DD genotype and D allele with
the occurrence of pain within pelvis minor in women with endometriosis was found.
Key words: endometriosis / angiotensin I converting enzyme / genetic polymorphism /
/ pelvic pain /
Corresponding author:
Liliana Kowalczyńska
Department of Biology and Medical Genetics, Medical University of Lodz
Pl. Hallera 1, 90-647 Lodz, Poland,
phone/fax: +48 42 6330594
email: [email protected]
102
Otrzymano: 15.11.2010
Zaakceptowano do druku: 20.01.2011
Nr 2/2011
Ginekol Pol. 2012, 82, 102-107
P R A C E
O R Y G I N A L N E
ginekologia
Kowalczyńska L, et al.
Streszczenie
Cel pracy: Analiza polimorfizmu I/D genu ACE u kobiet ze zdiagnozowaną endometriozą oraz określenie korelacji
zidentyfikowanych genotypów ze stopniem zaawansowania choroby i jej obrazem klinicznym.
Materiał i metody: Przeprowadzono analizę polimorfizmu I/D genu ACE w grupie 121 kobiet z endometriozą
i 122 kobiet z grupy kontrolnej. W grupie badanej wzięto pod uwagę stopień zaawansowania i liczbę ognisk choroby,
występowanie przewlekłego bólu miednicy mniejszej i bezpłodności.
Wyniki: W grupie badanej stwierdzono następujący rozkład genotypów genu ACE: II – 25,62%, ID – 47,93%, DD
– 26,45%, a w grupie kontrolnej: II – 35,25%, ID – 41,80%, DD – 22,95%. Porównanie częstości występowania
badanych genotypów i alleli pomiędzy grupą badaną i kontrolną nie wykazało różnic istotnych statystycznie
(p>0,05). Podobnie brak korelacji dla tych parametrów zaobserwowano w przepadku porównania czterech stopni
zaawansowania choroby wg. rAFS (p>0,05).
W grupie badanej porównano częstość występowania analizowanych genotypów i alleli genu ACE u kobiet
z niepłodnością (n=59) i płodnych kobiet (n=62). Analiza tych parametrów nie wykazała różnic statystycznie
istotnych pomiędzy badanymi grupami (p>0,05). U kobiet z endometriozą, które uskarżały się na ból (n=41) genotyp
II występował z częstością 17,07%, ID – 46,34%, DD – 36,59%. W grupie kobiet z endometriozą, u których ból
nie występował, badane genotypy (II, ID, DD) występowały odpowiednio z częstością: 26,53%, 59,18%, 14,29%.
Genotyp DD i allel D występował częściej u kobiet z dolegliwościami bólowymi (p<0,05).
Wnioski: W badanej populacji kobiet nie wykazano istnienia związku między polimorfizmem genotypu I/D genu
ACE, a występowaniem endometriozy, stopniem jej zaawansowania oraz liczbą ognisk choroby. Natomiast
wykazano związek genotypu DD i allelu D z występowaniem u kobiet z endometriozą objawów bólowych w obrębie
miednicy mniejszej.
Słowa kluczowe: endometrioza / enzym konwertujący angiotensynę /
/ genetyczny polimorfizm / ból miednicy mniejszej /
Introduction
Endometriosis is a benign estrogen-dependent disease
of women, mainly during their reproductive years, when
endometrial cells grow outside of the uterus which evokes chronic
inflammatory reaction. Pelvis minor organs and peritoneal surface
are the locations most frequently affected [1]. Endometriosis is
most often divided into three categories: peritoneal endometriosis,
ovarian endometrial cysts and rectouterine pouch endometriosis
[2]. Occasionally endometriosis can also develop in other parts
of the body e.g. in lungs, appendix. It has been estimated that it
occurs in about 10% of women in their reproductive years but it
increases even to 35-50% of women complaining of pelvic pain
or infertility [3, 4].
Aetiology of endometriosis has not been explained although
there exist several theories competing with each other. Retrograde
menstruation is thought to be one of the causes of the disease.
During a woman’s menstrual flow some of the menstrual effluent
goes in reverse into the peritoneal cavity (implantation theory).
There comes to ectopic implantation of endometrial cells in the
peritoneum and to establishment of the disease foci [5]. Other
frequently mentioned and already classical theories explaining the
development of endometriosis are the theory of metaplasia and
the theory of induction [1]. Furthermore, short menstrual cycle,
prolonged menstrual bleeding and small number of labours are
factors increasing the risk of endometriosis development [1, 4, 5].
In recent years, the share of the angiogenesis in the development
and persistence of endometriosis foci in peritoneal cavity has
been indicated [4-6].
Angiopoetins, increasing the exposure of endothelial cells
to the activity of angiogenic factors, matrix metalloproteinases
(MMP) degrading the components of extracellular matrix and
© Polskie Towarzystwo Ginekologiczne
facilitating penetration of newly formed blood vessels, vascularendothelial growth factor (VEGF) and interleukins (IL-8 and
IL-6) are the factors playing an important role in the process of
neovascularisation in endometriosis [4-7].
Genetic factors also play a role in the development of
endometriosis [3, 8-10]. In the case of severe endometriosis the
occurrence of hereditary predispositions of multigene inheritance
is observed [11]. The contribution of a genetic factor in the
development of endometriosis was also confirmed by studies on
monozygotic twins [9]. Up till now, multiple candidate genes
have been analysed as their involvement in the pathogenesis
of endometriosis seems to be of major importance, among
others: genes encoding cytokines and pro-inflammatory factors,
adhesive proteins and extracellular matrix enzymes, growth
factors, cell cycle and apoptosis regulatory proteins, receptors for
hormones [reviewed 9, 10]. Renin-angiotensin system (RAS) was
suggested to be another factor contributing to the development of
endometriosis. It acts as hormonal system [12].
The RAS gene system comprises the renin, angiotensinogen
(AGT), angiotensin I converting enzyme (ACE) and angiotensin II
receptor types 1 and 2 (AT1, AT2) genes. [13]. Renin is synthesized
in kidneys and released from granular juxtaglomerular cells.
This enzyme demonstrates aspargine protease activity and takes
part in angiotensinogen (synthesized in liver) to angiotensin
I conversion. Then, angiotensin I is converted to angiotensin
II – a key compound of RAS system which transmits the signal
into the cells through membrane receptors of type 1 and 2 [13].
Besides angiotensin systemic activity its local (tissue) potential
is emphasized. Deletion of 287-base pair fragment in intron 16 of
ACE gene results in increased level of angiotensin I convertase
in plasma [14].
103
P R A C E
Ginekol Pol. 2011, 82, 102-107
O R Y G I N A L N E
gineko l o gi a
ACE I/D polymorphism in Polish patients with endometriosis.
Objectives
The aim of the study was the analysis of insertion/deletion
polymorphism in the angiotensin I converting enzyme gene
(ACE) in women with diagnosed endometriosis and to determine
the correlation of the identified genotypes with the stage of the
disease and its clinical picture.
Material and methods
Subjects
A cohort of 121 women diagnosed upon laparoscopic
examination with different stages (I – minimal, II – mild, III
– moderate, IV - severe) of endometriosis using the revised
American Fertility Society (rAFS) classification system [15]
were recruited at the Department of Surgical and Endoscopic
Gyneacology, Polish Mother’s Memorial Hospital, Lodz, Poland.
Twenty-nine patients were classified as stage I of the disease
(mean age 32.1±4.7, range 23-42), 22 as stage II (mean age
33.8±5.8, range 25-51), 35 as stage III (mean age 33.2±6.8, range
21-49) and 35 patients were stage IV (mean age 31.2±5.6, range
20-56).
A population of 122 women without endometriosis from
the Department of Surgical and Endoscopic Gyneacology were
studied as a control group (mean age 40.8±10.4, range 22-67).
The protocol had been previously approved by the Bioethical
Committee of the Medical University of Lodz (RNN/47/09/KB).
Molecular analysis
Genomic DNA was isolated from the peripheral blood
with the Blood Mini kit (DNA-Gdańsk, Poland) according to
the manufacturers procedure. Analysis of ACE genotypes was
performed using polymerase chain reaction (PCR).
The primer sequences were as follows: sense primer 5’CTGGAGACCACTCCCATCCTTTCT3’ and antisense primer:
5’GATGTGGCCATCACATTCGTCAGAT3’, as described by
Hsieh and coworkers [16].
PCR reaction was performed in a final volume of 50μl
containing 150ng/sample of primers, 0.1 mM/sample of dNTPs,
DNA buffer 1X/sample, 1.5 U/sample of Taq polymerase and
50ng of genomic DNA. The DNA was amplified for initial
denaturation at 94°C for 5 min. followed by 35 cycles of 94°C
for 30 sec, 62°C for 30 sec and 72°C for 45 sec following a final
extension of 72°C for 10 min. (Genius, Techne).
The amplification products were analyzed by electrophoresis
of 5 μl samples on 2% agarose gels and visualizing with ethidium
bromide staining. The products were of the size about 190 bp and
490 bp for I and D allele respectively. (Figure 1).
Statistical analysis
Statistical analysis was performed using the Statistica 8.0 pl.
Allele and genotype frequencies were compared between groups
using the c2 test (or Fisher’s exact test when necessary). Nonparametric variables were analyzed with the U-Mann-Whitney
test. P <0.05 was considered statistically significant.
Results
In the study group (n=121) the following distribution was
found of ACE gene genotypes: II – 25.62% ID – 47.93%, DD –
26.45%, whereas in the control group (n=122): II – 35.25%, ID
– 41.80%, DD – 22.95%. (Table I).
I and D allele frequencies were: I – 49.59%, 56.15%; D –
50.41%, 49.85% respectively for the study and control groups.
(Table II).
The comparison of the frequency of II, ID and DD genotypes
and I and D alleles between the study and control groups did not
demonstrate statistically significant differences (respectively:
p=0.265; p=0.147). No correlation was found as regards the
frequency of the investigated genotypes (Table I) and alleles
(Table II) when the four stages of the disease acc. to rAFS were
compared (respectively: p=0.266; p=0.624).
Figure 1. Gel electrophoresis of the ACE I/D polymorphism. 1: DNA size marker (Low Range); II: 2, 3, 6, 8-10, 13; ID: 4, 12; DD: 5, 7, 11, 14.
104
Nr 2/2011
Ginekol Pol. 2012, 82, 102-107
P R A C E
O R Y G I N A L N E
ginekologia
Kowalczyńska L, et al.
Table I. Genotype frequencies for ACE I/D gene polymorphism in individuals with and without endometriosis.
Table II. Alleles frequencies for ACE I/D gene polymorphism in individuals with
and without endometriosis.
Among patients with endometriosis (n=121) in 55 of
them a single disease focus was observed, in 41-two and in 19
endometrial lesions comprised three localizations, in 4 patients –
four, in 2 – five localizations. Table III demonstrates the frequency
of individual genotypes of I/D polymorphism in ACE gene. The
comparison of the investigated genotypes and alleles between
these groups with the use of nonparametric Mann-Whitney test
did not show statistically significant differences (respectively:
p=0.594; p=0.947).
The frequency of the analysed ACE gene genotypes and
alleles was compared in the study group in women suffering from
infertility (n=59) and in fertile women (n=62). The following
distribution of genotypes was observed in individual investigated
groups: patients with infertility: II – 22.03%, ID – 52.54%, DD
– 25.42%; patients without fertility disorders: II – 29.03, ID –
43.55%, DD – 27.42%. The frequency of I and D alleles was:
I – 48.31%, 50.81%; D – 51.69%, 49.19% respectively for the
patients with infertility and in those with normal fertility. (Table
IV). The comparison of the frequency of genotypes and alleles of
ACE gene did not demonstrate statistically significant differences
between both analysed groups (respectively: p=0.567; p=0.697).
Information was obtained from 90 patients with diagnosed
endometriosis concerning the occurrence of chronic pelvic pain.
In patients who complained of pain (n=41) the frequency of II
genotype was 17.07%, of ID genotype – 46.34% and of DD
genotype – 36.59%. The frequency of these genotypes in the
group of patients with no pain was respectively: 26.53%, 59.18%,
14.29%. (Table V).
DD genotype was more frequent in patients with pelvic pain
and the difference was statistically significant (χ2=6.13, p=0.046).
Similarly, the frequency of D allele in this group was significantly
higher compared to the group of patients with no pain (χ2=4.5,
p=0.034). Discussion
Endometriosis affects even 10% of all reproductive-aged
women. Its aetiology still remains unrecognized. Endometrium
is one of few mature tissues which is distinguished by regular
periods of rapid growth and abruption. Thus, angiogenesis is an
important element of this tissue functioning. That is why recently
it has been suggested that the mechanism of the development
and persistence of this disease foci may be engaged in the
angiogenesis [4-7]. The fact that endometriotic implants are
© Polskie Towarzystwo Ginekologiczne
often surrounded by a network of blood vessels can be a proof.
Neovascularization around and inside endometriotic lesions was
also confirmed by microscopic analysis [6]. Inan et al. observed
increased expression of von Willebrand factor and CD34 (antigens
specific for vascular endothelium) in endometrial cysts in relation
to the tissue of normal ovary [17]. In the authors’ opinion this
proves the significant role of neoangiogenesis in the development
of endometriosis. Ria et al., who compared the structure of
blood vessels in normal endometrium and in endometrial cysts
came to the same conclusion [18]. Immaturity of newly formed
vessels and high proliferative activity of endothelial cells in
active inflammatory lesions were also observed in peritoneal
endometriosis [5, 19, 20].
Owing to reports proving coexistence of endometriosis
and neovascularization, there was undertaken the analysis
of polymorphism of genes engaged in the development and
functioning of blood vessels including also the genes of reninangiotensin system [10].
RAS system regulates, among others, blood pressure by
influencing vessel tension, renal haemodynamics and water and
electrolyte balance [21]. The studies revealed that angiotensin
I convertase is present on the surface of vessel epithelial cells
within the whole circulatory system. Also renin released from
kidneys can be captured by epithelial cells. This enables local
production of angiotensin II which demonstrates autocrine/
paracrine activity [13]. Furthermore, angiotensin II produced
in tissues stimulates smooth muscle vessel proliferation. The
contribution of RAS is also suggested as one of the factors in the
initiation of the menstrual cycle [22].
105
P R A C E
Ginekol Pol. 2011, 82, 102-107
O R Y G I N A L N E
gineko l o gi a
ACE I/D polymorphism in Polish patients with endometriosis.
Table III. Genotype and allele frequencies for ACE I/D gene polymorphism in individuals with different number of endometriosis foci.
Table IV. Genotype and allele frequencies for ACE I/D gene polymorphism in individuals with endometriosis with and without infertility.
Table V. Genotype and allele frequencies for ACE I/D gene polymorphism in individuals with endometriosis with and without pain.
To date, in the available medical literature one study can be
found concerning the analysis of insertion/deletion angiotensin
I-converting enzyme gene polymorphism in women with
endometriosis. The authors determined ACE gene genotype
in 125 women with endometriosis and in 128 from the control
group. According to the authors genotypes with insertion allele
of ACE gene (II, ID) seem to predispose to the development of
endometriosis in Taiwan population [16].
In this study 121 women with endometriosis and 120
from the control group were analysed. The obtained results
did not demonstrate any association between ACE I/D gene
polymorphism and the prevalence of endometriosis in women
nor the stage of the disease. On the other hand, Hsieh et al., estimated polymorphism only in women with advanced stage of
the disease, whereas in this study the study group included all
four stages of the disease acc. to rAFS [15, 16].
Owing to very differentiated as regards localization and
number of endometrial foci in the investigated women, the
authors divided the study group into subgroups dependently
on the number of endometrial foci. In nearly half (n=55) of the
investigated women endometriosis was related to one organ (most
frequently it was peritoneum or ovary), in 44 women the disease
occurred in two localizations and in 25 patients endometriosis
affected three or more sites. (Table III).
106
Statistical analysis did not demonstrate any association
between the number of the foci and ACE I/D gene
polymorphism.
Infertility is one of the main symptoms accompanying
endometriosis. It has been estimated that it affects even 50% of
women with this disease [3, 4]. Despite the visible association
between endometriosis and infertility the mechanism of this
dependence has not been recognized [23]. Ovulatory disorders,
disturbed transport of gametes through uterine tubes, hormonal
disorders (including LH), toxic effect of factors associated
with inflammatory reaction on fetus and also on sperm and
embryo implantation in endometrium are among the suggested
mechanisms leading to fertility disturbances in women with
endometriosis [23, 24].
To date, the association has been successfully demonstrated
of several polymorphisms found in human genome with infertility
of women suffering from endometriosis. The studies carried
out by Lamp et al., revealed increased susceptibility to fertility
disorders in patients with endometriosis when two types were
found of polymorphisms of encoding gene 17β-hydroxysteroid
dehydrogenase: HSD17B1 A/G SNP A allele and ESR1 longer
(TA)n repeats [25]. Also Marfa et al. suggest that LHbeta G1502A
polymorphism may be involved in the predisposition to minimal/
mild endometriosis-associated infertility, although it is not clear
if endometriosis is not only a coincidental finding along with
infertility [26].
Nr 2/2011
Ginekol Pol. 2012, 82, 102-107
P R A C E
O R Y G I N A L N E
ginekologia
Kowalczyńska L, et al.
In our studies infertility was found in 59 patients. No fertility
disorders were observed in the remaining 62 patients with
endometriosis. The frequency of genotypes: II, ID and DD and
alleles I and D of I/D ACE polymorphism was similar in both
groups. (Table IV). Insignificant differences which were noted
were not statistically significant.
The major symptoms of endometriosis and reasons for its
treatment, besides infertility, include pain complaints such as:
strong pain with menstrual and perimenstrual periods, dyspareunia
and chronic pelvic pain [3]. The precise mechanism responsible
for pain in the course of endometriosis has not been known. It
seems that this pain results from both direct and indirect effect of
endometrial alterations. The direct effect includes implantation of
endometrial foci into normal tissues and their periodical bleeding
and stimulation of fibrosis. Indirect effect includes synthesis of
cytokines and other proinflammatory factors which can irritate
neighbouring nerve roots and silent nociceptors [27].
In this study information about pelvic pain was obtained
from 90 patients with endometriosis. In 41 (45.56%) of them the
pain occurred, whereas the remaining 49 (54.44%) of women did
not complain of pain. The statistical analysis showed that both
DD genotype and D allele of ACE I/D gene polymorphism were
more frequent in women with pain symptoms (p<0.05).
As it has been already mentioned, endometriosis is estrogendependent and thus its development is strictly dependent on
estrogen metabolism. The level of oestriol (E2) in menstrual
blood of women with endometriosis is higher compared to
healthy women which suggests that this hormone is synthesized
in them locally in endothelium [28]. In ectopic endometrium
there is observed a disturbed level of expression of enzymes
engaged in estrogen metabolism in relation to normally localized
tissue, among others increased expression of aromatase,
17β-hydroxysteroid dehydrogenase (17β-HSD) type 1, 7, 12,
or decreased expression of 17β-HSD type 2, which leads to
excessive synthesis of oestriol [29].
The studies performed by Chakrabarty et al., on animal
model with the use of rat nerve cells demonstrated that oestriol
on signal pathway in which type 2 angiotensin receptor (AT2)
is engaged, stimulates growth of nociceptors. Furthermore, E2
promotes neuritogenesis only in the presence of active ACE [30].
It has been known that DD genotype of ACE gene increases
this enzyme activity. The results of studies of these authors can
be the base for discussion why increased level of angiotensin
I convertase in blood of women is more frequently associated
with pain complaints than in the patients with insertion allele.
Re f e r e nc e s
1. Gazvani R, Templeton A. New considerations for the pathogenesis of endometriosis. Int J
Gynecol Obstet. 2002, 76, 117-126.
2. Jackson B, Telner D. Managing the misplaced: approach to endometriosis. Can Fam Physician.
2006, 52, 1420-1424.
3. Hompes P, Mijatovic V. Endometriosis: the way forward. Gynecol Endocrinol. 2007, 23, 5-12.
4. Vigano P, Parazzini F, Somigliana E, [et al.]. Endometriosis: epidemiology and aetiological
factors. Best Pract Res Clin Obstet Gynaecol. 2004, 18, 177-200.
5. Nap A, Groothuis P, Demir A, [et al.]. Pathogenesis of endometriosis. Best Pract Res Clin Obstet
Gynaecol. 2004, 18, 233-244.
6. Taylor R, Jie Y, Torres P, [et al.]. Mechanistic and therapeutic implications of angiogenesis in
endometriosis. Reprod Sci. 2009, 16, 140-146.
7. Barcz E, Kamiński P, Marianowski L. VEGF concentration in peritoneal fluid of patients with
endometriosis. Ginekol Pol. 2001, 72, 442-448.
8. Bischotf F, Simpson J. Genetics of endometriosis: heritability and candidate genes. Best Pract
Res Clin Obstet Gynaecol. 2004, 18, 219-232.
9. Montgomery G, Nyholt D, Zhao Z, [et al.]. The search for the genes contributing to endometriosis
risk. Hum Reprod Update. 2008, 14, 447-457.
10. Tempfer C, Simoni M, Destenaves B, [et al.]. Functional genetic polymorphisms and female
reproductive disorders: Part II – endometriosis. Hum Reprod Update. 2009, 15, 97-118.
11. Buyalos R, Agarwal S. Ensometriosis-associated infertility. Curr Opin Obstet Gynecol. 2000, 12,
377-381.
12. Griendling K, Murphy T, Alexander R. Molecular biology of the rennin-angiotensin system.
Circulation. 1993, 87, 1816-1828.
13. Crisan D, Carr J. Angiotensin I. Converting enzyme: genotype and disease associations. J Mol
Diagn. 2000, 2, 105-115.
14. Rigat B, Hubert C, Alhenc-Gelas F, [et al.]. An insertion/deletion polymorphism in the angiotensin-I
converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest.
1990, 86, 1343-1346.
15. American Fertility Society. Classification of endometriosis. Fertil Steril. 1979, 32, 633-645.
16. Hsieh Y, Lee C, Chang C, [et al.]. Angiotensin I-converting enzyme insertion-related genotypes
and allele are associated with higher susceptibility of endometriosis and leiomyomas. Mol
Reprod Dev. 2007, 7, 808-814.
17. Inan S, Kuscu N, Vatansever S, [et al.]. Increased vascular surface density in ovarian
endometriosis. Gynecol Endocrinol. 2003, 2, 143-150.
18. Ria R, Loverro G, Vacca A, [et al.]. Angiogenesis extent and expression of matrix
metalloproteinase-2 and –9 agree with progression of ovarian endometriomas. Eur J Clin Invest.
2002, 3, 199-206.
19. Matsuzaki S, Canis M, Murakami T, [et al.]. Immunohistochemical analysis of the role of
angiogenic status in the vasculature of peritoneal endometriosis. Fertil Steril. 1999, 4, 712716.
20. Fujishita A, Hasuo A, Khan K, [et al.]. Immunohistochemical study of angiogenic factor in
endometrium and endometriosis. Gynecol Obstet Invest. 1999, 48, Suppl 1, 36-44.
21. Fornage M, Amos C, Kardia S, [et al.]. Variation in the region of the angiotensinogen-converting
enzyme gene influences interindividual differences in blood pressure levels in young white
males. Circualtion. 1998, 97, 1773-1779.
22. Li X-F, Ahmed A. Compartmentalization and cyclic variation of immunoreactivity of renin and
angiotensin converting enzyme in human endometrium throughout the menstrual cycle. Hum
Reprod. 1997, 12, 2804-2809.
23. Holoch K, Lessey B. Endometriosis and infertility. Clin Obstet Gynecol. 2010, 53, 429-438.
24. Bulletti C, Coccia M, Battistoni S, [et al.]. Endometriosis and infertility. J Assist Reprod Genet.
2010, 27, 441-447.
25. Lamp M, Peters M, Reinmaa E, [et al.]. Polymorphism in ESR1, ESR2 and HSD17B1 genes are
associated with fertility status in endometriosis. Gynecol Endocrinol. 2010, 29. [Epub ahead of
print].
26. Mafra F, Bianco B, Christofolini D, [et al.]. Luteinizing hormone beta-subunit gene (LHbeta)
polymorphism infertility and endometriosis-associated infertility. Eur J Obstet Gynecol Reprod
Biol. 2010, 151, 66-69.
27. Hansen K, Chalpe A, Eyster K. Management of endometriosis – associated pain. Clin Obstet
Gynecol. 2010, 53, 439-448.
28. Takahashi K, Nagata H, Kitao M. Clinical usefulness of determination of estradiol levels in the
menstrual blood for patients with endometriosis. Nippon Sanka Fujinka Gakkai Zasshi. 1989,
41, 1849-1850.
29. Rižner T. Estrogen metabolism and action in endometriosis. Mol Cell Endocrinol. 2009, 307,
8-18.
30. Chakrabarty A, Blacklock A, Svojanovsky S, [et al.]. Estrogen elicits dorsal root ganglion axon
sprouting via a renin-angiotensin system. Endocrynology. 2008, 149, 3452-3460.
Acknowledgements
This study was supported by the Medical University of Lodz,
Poland (project no. 502-17-827).
© Polskie Towarzystwo Ginekologiczne
107
Ginekol Pol. 2011, 82, 108-113
P R A C E
O R Y G I N A L N E
po∏o ˝ n i ctwo
Ilościowa ocena funkcji prawej i lewej komory
metodą Dopplera pulsacyjnego z użyciem
wskaźnika sprawności mięśnia serca
u zdrowych płodów między 18 a 40 tygodniem
ciąży
Quantitative assessment of the right and the left ventricular function
using pulsed Doppler myocardial performance index in normal fetuses
at 18 to 40 weeks of gestation
Hamela-Olkowska Anita, Szymkiewicz-Dangel Joanna
Poradnia Perinatologii i Kardiologii Perinatalnej, II Katedra i Klinika Położnictwa i Ginekologii
Warszawski Uniwersytet Medyczny, Warszawa, Polska
Streszczenie
Cel pracy: Ocena wartości wskaźnika sprawności mięśnia serca (MPI, Tei index) mierzonego metodą Dopplera
pulsacyjnego dla lewej (Tei index LV) oraz prawej (Tei index RV) komory u zdrowych płodów między 18 a 40 tygodniem ciąży.
Materiał i metody: Badania echokardiograficzne przeprowadzono w referencyjnym ośrodku kardiologii płodowej
u 140 zdrowych płodów. Tei index liczono ze wzoru (a-b)/b. Czas a mierzono od końca do początku kolejnego
napływu przez zastawkę mitralną i trójdzielną. Czas b mierzono od otwarcia do zamknięcia zastawki aortalnej i pnia
płucnego.
Wyniki: Wartość Tei index LV wynosiła śr. 0,47±0,07, a Tei index RV śr. 0,48±0,1. Stwierdzono dodatnią korelację
Tei index RV z Tei index LV (p=0,008; r=0,22). Wartości Tei index dla obu komór nie różniły się znamiennie między
sobą (p=0,41). Dla lewej i prawej komory wskaźnik sprawności mięśnia serca był niezależny od rytmu serca płodu
i tygodnia ciąży.
Wnioski: Obliczone wartości normatywne wskaźnika sprawności mięśnia serca mogą posłużyć do porównania
stopnia nasilenia zmian funkcji miokardium w różnych stanach patologicznych u płodów.
Słowa kluczowe: Tei index / wskaźnik sprawności mięśnia serca /
/ badania dopplerowskie płodu / funkcja mięśnia sercowego płodu /
/ echokardiografia płodowa /
Adres do korespondencji:
Anita Hamela-Olkowska
Poradnia Perinatologii i Kardiologii Perinatalnej, II Katedra i Klinika Położnictwa i Ginekologii WUM
ul. Karowa 2, 00-315 Warszawa, Polska
tel/fax: (+48 22 596 61 67
e-mail: [email protected]
108
Otrzymano: 10.10.2010
Zaakceptowano do druku: 20.01.2011
Nr 2/2011
Ginekol Pol. 2011, 82, 108-113
P R A C E
O R Y G I N A L N E
po∏o˝nictwo
Hamela-Olkowska A, et al.
Abstract
Objective: To establish the values of the pulsed Doppler myocardial performance index (MPI, Tei index) for the left
and the right ventricle in normal fetuses at 18 to 40 weeks gestation.
Material and methods: Echocardiography exams were performed in 140 normal fetuses at 18 to 40 weeks
gestation at the tertiary centre for fetal cardiology. MPI was calculated in pulsed Doppler using formula: (a-b)/b. The
time a was measured from a closure click to the subsequent opening click of the mitral/tricuspid valve and time b
from opening to the closure clicks of the aortic/pulmonary valve.
Results: The mean MPI for the LV was 0.47±0.07 and for RV 0.48±0.1. There was no difference between the Tei
index LV and the Tei index RV (p=0.41). We observed a linear correlation between the Tei index LV and the Tei index
RV (p=0.008; r=0.22). Fetal heart rate and gestational age had no effect on the MPI for both ventricles.
Conclusions: The assessed normal values of Tei index for the left and the right ventricles in fetuses may be used
in comparison of myocardial performance in various clinical settings.
Key words: Tei index / myocardial performance index / fetal Doppler /
/ fetal cardiac function / fetal echocardiography /
Wstęp
Wskaźnik sprawności mięśnia serca (Tei index, MPI –
myocardial performance index) jest nieinwazyjną, ilościową
metodą dopplerowską oceny funkcji mięśnia sercowego
w różnych jednostkach chorobowych, zarówno u dorosłych, jak
i u dzieci [1, 2, 3, 4].
Został po raz pierwszy wykorzystany w 1995 roku przez Tei
i wsp. do oceny stanu miokardium u osób z kardiomiopatią rozstrzeniową [5]. Jego wartość nie zależy od rytmu serca, budowy
komór ani ciśnienia tętniczego [6]. W przypadku dysfunkcji komór czas wyrzutu ulega skróceniu, a czas skurczu i rozkurczu
izowolumetrycznego wydłużeniu, co prowadzi do podwyższenia
wartości Tei index [7].
W kardiologii płodowej wskaźnik sprawności mięśnia serca
został zastosowany po raz pierwszy w 1999 roku [8].
W populacji polskiej dokonano oceny Tei index u płodów
między 6 a 10 tygodniem ciąży oraz między 11 a 13,6 tygodniem
ciąży [9, 10]. Dotychczas w polskim piśmiennictwie nie opublikowano norm dla Tei index u płodów w II i III trymestrze ciąży.
Cel pracy
Celem pracy była ocena wartości wskaźnika sprawności
mięśnia serca mierzonego metodą Dopplera pulsacyjnego dla
lewej (Tei index LV) oraz prawej (Tei index RV) komory u zdrowych płodów między 18 a 40 tygodniem ciąży.
Materiał i metody
Grupę badaną stanowiło 140 płodów z ciąż pojedynczych,
u których w trakcie badania echokardiograficznego stwierdzono
rytm zatokowy, prawidłową anatomię i funkcję układu krążenia
oraz prawidłową anatomię innych narządów. Wiek płodów według biometrii wynosił od 18 do 40 tygodni.
Rycina 1. Pomiar Tei index LV w 28 tygodniu ciąży. Pomiar 1 – czas a między zamknięciem a otwarciem zastawki mitralnej w kolejnym cyklu pracy serca.
Pomiar 2 – czas b wyrzutu do aorty wstępującej.
© Polskie Towarzystwo Ginekologiczne
109
P R A C E
Ginekol Pol. 2011, 82, 108-113
O R Y G I N A L N E
po∏o˝n i c t w o
Ilościowa ocena funkcji prawej i lewej komory metodą Dopplera pulsacyjnego z użyciem wskaźnika sprawności mięśnia serca...
Rycina 2A. Pomiar Tei index RV w 28 tygodniu ciąży. Pomiar czasu a między zamknięciem a otwarciem zastawki trójdzielnej cyklu pracy serca.
Ciężarne były w wieku od 17 do 47 lat (średnio 29±4,7 lat).
58 (41%) z nich stanowiły pierwiastki. Żadna z kobiet nie przyjmowała leków mogących wpływać na stan płodowego układu
krążenia.
Celem oceny zależności wartości Tei index LV oraz Tei
index RV od wieku ciąży w sposobie doboru płodów do grupy
badanej zastosowano losowanie warstwowe w ramach następujących podgrup tygodni ciąży: 18-22, 23-28, 29-34 oraz 35-40. Ze
względów statystycznych grupę dobrano tak, aby w poszczególnych przedziałach tygodni była zbliżona liczba płodów.
Tei index oceniano stosując metodę opisaną po raz pierwszy w 1995 roku przez Tei i wsp. oraz jej modyfikację dla lewej
komory u płodów przedstawioną przez Friedman i wsp. w 2003
roku [5, 11].
Tei index liczono ze wzoru (a-b)/b, gdzie a jest sumą czasu
skurczu izowolumetrycznego, czasu wyrzutu oraz czasu rozkurczu izowolumetrycznego, a b jest czasem wyrzutu. Celem oceny
Tei index dla lewej komory uzyskiwano jednoczasowy przepływ
przez zastawkę mitralną i napływ do aorty w obrazie 5-jamowym
serca. (Rycina 1).
Dla prawej komory wykonywano osobno przepływ przez
zastawkę trójdzielną oraz napływ do pnia płucnego jeden po
drugim tak, aby różnica w rytmie serca między przepływami nie
była większa niż 5u/min. (Rycina 2).
Czas a mierzono od końca do początku kolejnego napływu
przez zastawkę mitralną i trójdzielną. Czas b mierzono od
otwarcia do zamknięcia zastawki aortalnej i pnia płucnego. Czas
a i b dla prawej komory mierzono na przepływach najbardziej
zbliżonych do siebie czasowo, tj. między dwoma ostatnimi
przepływami przez zastawkę trójdzielną i pierwszym przepływie
przez zastawkę pnia płucnego.
Badania dopplerowskie przeprowadzano, gdy płód pozostawał w bezruchu i nie wykonywał ruchów oddechowych. Stosowano aparat Acuson Sequoia 512 (Siemens Medical Solutions)
110
oraz sondę przezbrzuszną convex o częstotliwościach od 3,5 do
6 MHz.
Pacjentki podpisały świadomą zgodę na badanie echokardiograficzne płodu. Na przeprowadzenie badań uzyskano zgodę Komisji Bioetycznej Warszawskiego Uniwersytetu Medycznego.
Analizę statystyczną wykonano przy użyciu programu SPSS
15.0. (Chicago, IL, USA). Do badania korelacji liniowej posłużono się współczynnikiem korelacji Pearsona (r). Do oceny wpływu FHR (fetal heart rate) i tygodnia ciąży na wartość Tei index
LV oraz Tei index RV przeprowadzono analizę regresji liniowej.
Obliczono 5. i 95. percentyl wartości Tei index dla lewej i prawej
komory. Za poziom istotności statystycznej przyjęto p<0,05.
Zmienność pomiarów Tei index LV oraz Tei index RV wykonanych między dwoma badaczami (interobserver variability)
obliczono przy użyciu współczynnika korelacji wewnątrzgrupowej (ICC – intraclass correlation coefficient), z wyznaczeniem
95% przedziału ufności (CI – confidence interval).
Wyniki
Wszystkie płody miały rytm zatokowy od 120 do 167/min.
Wartość Tei index LV wynosiła od 0,29 do 0,68 (śr. 0,47±0,07).
Była niezależna od FHR i tygodnia ciąży. (Rycina 3).
5. i 95. percentyl wartości Tei index LV dla całej grupy badanej wynosił odpowiednio 0,35 i 0,60.
Tei index dla prawej komory wynosił od 0,31 do 0,85
(śr. 0,48±0,1). Wartość Tei index RV była niezależna od FHR
i tygodnia ciąży. (Rycina 4).
5. i 95. percentyl wartości Tei index RV dla całej grupy
badanej wynosił odpowiednio 0,32 i 0,68. Stwierdzono dodatnią
korelację Tei index RV z Tei index LV (p=0,008; r=0,22). Wartości
Tei index dla obu komór nie różniły się znamiennie statystycznie
między sobą (p=0,41).
Uzyskano wysoką zgodność wartości pomiarów wykonanych przez dwóch badających.
Nr 2/2011
Ginekol Pol. 2011, 82, 108-113
P R A C E
O R Y G I N A L N E
po∏o˝nictwo
Hamela-Olkowska A, et al.
Rycina 2B. Pomiar Tei index RV w 28 tygodniu ciąży. Pomiar czasu b wyrzutu do pnia płucnego.
Współczynnik korelacji wewnątrzgrupowej (ICC) dla Tei
index LV wynosił 0,93 (z 95% przedziałem ufności (CI) od 0,750,98), a dla Tei index RV: 0,92 (z 95% przedziałem ufności (CI)
od 0,70-0,97).
Dyskusja
Tsutsumi i wsp. jako pierwsi opisali zastosowanie Tei index
u zdrowych płodów [8]. Obliczona przez nich na 50 przypadkach
wartość Tei index LV między 18 a 26 tygodniem ciąży wynosiła
0,62±0,07, a Tei index RV 0,62±0,06. Po 34 tygodniu ciąży Tei
index LV miał wartość 0,43±0,03, a Tei index RV 0,49±0,05 i dla
obu komór obniżał się znamiennie wraz z czasem trwania ciąży.
Zjawisko to autorzy tłumaczą poprawą funkcji mięśnia sercowego wraz z zaawansowaniem ciąży.
W badanej grupie nie wykazano zależności między Tei
index dla lewej i prawej komory a czasem trwania ciąży. Podobne obserwacje mieli również inni badacze. W doniesieniu Mori
i wsp. Tei index LV wynosił 0,34±0,03, a Tei index RV 0,35±0,07
i nie zmieniał się między 20 a 39 tygodniem ciąży [12]. Stałe
wartości Tei index w drugim i trzecim trymestrze opisali także
Falkensammer i wsp. (Tei index RV - 0,38±0,04 i Tei index LV
- 0,41±0,05), Eidem i wsp. (Tei index LV - 0,36±0,06 i Tei index
RV – 0,35±0,05), Friedman i wsp. (Tei index LV - 0,53±0,13),
Raboisson i wsp. (Tei index LV – 0,37±0,08) oraz Van Mieghem
i wsp. (Tei index LV - 0,34±0,05) [11, 13, 14, 15, 16] .
Najliczniejszą grupę zdrowych płodów, u których zmierzono Tei index LV opisali Hernandez-Andrade i wsp. [17]. Na 557
przypadkach wykazali, że Tei index LV wzrasta nieznamiennie
statystycznie z 0,35±0,027 w 19 tygodniu do 0,37±0,029 w 39
tygodniu ciąży.
W badanej grupie wartość średnia Tei index LV wynosiła
0,47±0,07, a Tei index RV 0,48±0,1, co odbiega od niektórych
danych z piśmiennictwa. Różnice te wynikają zarówno ze sposobu pomiaru czasów przewodzenia niezbędnych do obliczenia
© Polskie Towarzystwo Ginekologiczne
wartości Tei index, jak i aparatu ultrasonograficznego oraz używanego oprogramowania. W naszym ośrodku stosujemy technikę przedstawioną w 2003 roku przez Friedman i wsp., uwzględniającą początek i koniec napływu przez zastawki jako miejsca
umieszczenia markerów [11].
W 2005 roku Hernandez-Andrade i wsp. opisali nowy sposób pomiaru (tzw. zmodyfikowany Tei index), polegający na
wykorzystaniu klików zastawek przedsionkowo-komorowych
i naczyniowych jako znaczników do oceny czasów [18]. Pomiary
przeprowadza się między klikami, co prowadzi do zmniejszenia
wartości czasu a we wzorze do obliczenia wskaźnika sprawności
mięśnia serca. W konsekwencji otrzymane wartości są niższe.
Wydaje się więc, że technika badania i wartości normatywne powinny być ustalane osobno dla każdego ośrodka, a osoby wykonujące pomiary powinny je przeprowadzać w ten sam sposób.
Przedstawiona w niniejszej pracy niezależność wartości Tei
index od rytmu serca zdrowych płodów pokrywa się z doniesieniami innych autorów [11, 15]. Jest to ponadto druga co do liczebności populacja płodów (po Hernandez-Andrade i wsp.), dla
której ustalono wartości normatywne Tei index LV dla drugiego
i trzeciego trymestru ciąży, a pierwsza co do wielkości grupa,
w której oceniono Tei index RV [17].
Istnieją doniesienia o podwyższeniu Tei index, czyli o pogorszeniu globalnej funkcji komór, u płodów matek z cukrzycą przedciążową, hipotrofią wewnątrzmaciczną, uogólnionym
obrzękiem nieimmunologicznym, restrykcyjnym przewodem
tętniczym, zespołem Ebsteina, dużego stopnia niedomykalnością
zastawki trójdzielnej, biorców w przebiegu zespołu przetoczenia
między płodami, w gruczolakotorbielowatości płuc oraz zespole
uogólnionej reakcji zapalnej u płodu [12, 13, 19, 20, 21, 22, 23,
24] .
Z kolei Api i wsp. nie zauważyli pogorszenia funkcji
miokardium mierzonej wartością wskaźnika sprawności mięśnia
serca u płodów matek w stanie przedrzucawkowym [25].
111
P R A C E
Ginekol Pol. 2011, 82, 108-113
O R Y G I N A L N E
po∏o˝n i c t w o
Ilościowa ocena funkcji prawej i lewej komory metodą Dopplera pulsacyjnego z użyciem wskaźnika sprawności mięśnia serca...
Rycina 3. Wartość Tei index dla lewej komory od: A – FHR (p=0,63; r=0,04); B – tygodnia ciąży (p=0,4; r=0,07).
Rycina 4. Wartość Tei index dla prawej komory w zależności od: A – FHR (p=0,419; r=0,07); B – tygodnia ciąży (p=0,149; r=0,123).
Friedman i wsp. proponują, by pomiar wskaźnika Tei index
był rutynowo stosowany w analizie dobrostanu płodu [11]. Choć
jest on stosunkowo łatwy do oceny przez przeszkolone osoby,
w warunkach polskich jest wykorzystywany głównie w ośrodkach kardiologii prenatalnej.
W naszej poradni posługujemy się nim na co dzień i uważamy go za najlepszy parametr w ocenie funkcji komór serca
u płodów już od pierwszego trymestru ciąży.
112
Wnioski
1. Wskaźnik sprawności mięśnia serca dla obu komór u płodów między 18 a 40 tygodniem nie zależy od częstości rytmu serca płodu ani wieku ciąży.
2. Wartości Tei index dla lewej i prawej komory nie różnią się
między sobą.
3. Obliczone wartości normatywne wskaźnika sprawności
mięśnia serca mogą posłużyć do porównania stopnia nasilenia zmian w funkcji miokardium w różnych stanach patologicznych u płodów.
Nr 2/2011
Ginekol Pol. 2011, 82, 108-113
P R A C E
O R Y G I N A L N E
po∏o˝nictwo
Hamela-Olkowska A, et al.
Piśm i e n n i c t w o
1. Takasaki K, Gillinov A, Yamano T, [et al.]. Detection of left ventricular dysfunction with Tei index
in normal ejection fraction patients with mitral regurgitation before mitral valve surgery. Am J
Cardiol. 2009, 103, 1011-1014.
2. Mishra R, Kizer J, Palmieri V, [et al.]. Utility of the myocardial performance index in a
population with high prevalences of obesity, diabetes and hypertension: the strong heart study.
Echocardiography. 2007, 24, 340-347.
3. Patel D, Cui W, Gambetta K, [et al.]. A comparison of Tei index versus systolic to diastolic ratio
to detect left ventricular dysfunction in pediatric patients. J Am Soc Echocardiogr. 2009, 22,
152-158.
4. Zacharska-Kokot E. The myocardial performance index in children after surgical correction of
congenital malformations with intracardiac shunt. Kardiol Pol. 2007, 65, 143-150.
5. Tei C, Ling L, Hodge D, [et al.]. New index of combined systolic and diastolic myocardial
performance: a simple and reproducible measure of cardiac function - a study in normals and
dilated cardiomyopathy. J Cardiol. 1995, 26, 357-366.
6. Tei C, Dujardin K, Hodge D, [et al.]. Doppler index combining systolic and diastolic myocardial
performance: clinical value in cardiac amyloidosis. J Am Coll Cardiol. 1996, 28, 658-664.
K O M U N I K A T
Pierwszy Międzynarodowy
Kongres Medyczny
Kobieta i Mężczyzna
Zdrowie reprodukcyjne
i seksualne
3-4 czer wca 2011
Hotel Hilton, Warszawa
7. Williams R, Ritter S, Tani L, [et al.]. Quantitative assessment of ventricular function in children
with single ventricles using the Doppler myocardial performance index. Am J Cardiol. 2000, 86,
1106-1110.
8. Tsutsumi T, Ishii M, Eto G, [et al.]. Serial evaluation for myocardial performance in fetuses and
neonates using a new Doppler index. Pediatr Int. 1999, 41, 722-727.
9. Włoch A, Rozmus-Warcholinska W, Czuba B, [et al.]. Doppler study of the embryonic heart in
normal pregnant women. J Matern Fetal Neonatal Med. 2007, 20, 533-539.
10. Szymkiewicz-Dangel J, Hamela-Olkowska A, Własienko P, [et al.] The possibility of evaluation
of the myocardial performance index in fetuses at 11,0 to 13,6 week of gestation. Ginekol Pol.
2007, 78, 218-222.
11. Friedman D, Buyon J, Kim M, [et al.]. Fetal cardiac function assessed by Doppler myocardial
performance index (Tei Index). Ultrasound Obstet Gynecol. 2003, 21, 33-36.
12. Mori Y, Rice M, McDonald R, [et al.]. Evaluation of systolic and diastolic ventricular performance
of the right ventricle in fetuses with ductal constriction using the Doppler Tei index. Am J Cardiol.
2001, 88, 1173-1178.
13. Falkensammer C, Paul J, Huhta J. Fetal congestive heart failure: correlation of Tei-index and
cardiovascular-score. J Perinat Med. 2001, 29, 390-398.
14. Eidem B, Edwards J, Cetta F. Quantitative assessment of fetal ventricular function: establishing
normal values of the myocardial performance index in the fetus. Echocardiography. 2001, 18,
9-13.
15. Raboisson M, Bourdages M, Fouron J. Measuring left ventricular myocardial performance index
in fetuses. Am J Cardiol. 2003, 91, 919-921.
16. Van Mieghem T, Gucciardo L, Lewi P, [et al.]. Validation of the fetal myocardial performance
index in the second and third trimesters of gestation. Ultrasound Obstet Gynecol. 2009, 33,
58-63.
17. Hernandez-Andrade E, Figueroa-Diesel H, Kottman C, [et al.] Gestational-age-adjusted
reference values for the modified myocardial performance index for evaluation of fetal left
cardiac function. Ultrasound Obstet Gynecol. 2007, 29, 321-325.
18. Hernandez-Andrade E, Lopez-Tenorio J, Figueroa-Diesel H, [et al.]. A modified myocardial
performance (Tei) index based on the use of valve clicks improves reproducibility of fetal left
cardiac function assessment. Ultrasound Obstet Gynecol. 2005, 26, 227-232.
19. Ichizuka K, Matsuoka R, Hasegawa J, [et al.]. The Tei index for evaluation of fetal myocardial
performance in sick fetuses. Early Hum Dev. 2005, 81, 273-279.
20. Niewiadomska-Jarosik K, Lipecka-Kidawska E, Kowalska-Koprek U, [i wsp.]. Assessment of
cardiac function in fetuses with intrauterine growth retardation using the Tei Index. Med Wieku
Rozwoj. 2005, 9, 153-160. Polish.
21. Chen Y, Lv G, Li B, Wang Z. Cerebral vascular resistance and left ventricular myocardial
performance in fetuses with Ebstein’s anomaly. Am J Perinatol. 2009, 26, 253-258.
22. Inamura N, Taketazu M, Smallhorn J, [et al.]. Left ventricular myocardial performance in the fetus
with severe tricuspid valve disease and tricuspid insufficiency. Am J Perinatol. 2005, 22 91-97.
23. Szwast A, Tian Z, McCann M, [et al.]. Impact of altered loading conditions on ventricular
performance in fetuses with congenital cystic adenomatoid malformation and twin-twin
transfusion syndrome. Ultrasound Obstet Gynecol. 2007, 30, 40-46.
24. Letti Müller A, Barrios Pde M, Kliemann L, [et al.] Tei index to assess fetal cardiac performance
in fetuses at risk for fetal inflammatory response syndrome. Ultrasound Obstet Gynecol. 2010,
36, 26-31.
25. Api O, Emeksiz M, Api M, [et al.]. Modified myocardial performance index for evaluation of fetal
cardiac function in pre-eclampsia. Ultrasound Obstet Gynecol. 2009, 33, 51-57.
Serdecznie zapraszamy!
Prof. Włodzimierz Baranowski
Prof. Zbigniew Lew-Starowicz
Doc. Piotr Radziszewski
Szczegółowe informacje i rejestracja
www.kobietaimezczyzna.info
© Polskie Towarzystwo Ginekologiczne
113
P R A C E
O R Y G I N A L N E
po∏o˝n i c t w o
Ginekol Pol. 2011, 82, 114-118
Ultrasonograficzne prognozowanie makrosomii
płodu z zastosowaniem oceny masy ciała
ciężarnej
Ultrasound macrosomic fetal weight estimation formula using maternal
weight measurements
Murlewska Julia1,2, Pietryga Marek1,2, Wender-Ożegowska Ewa1
1
2
Klinika Położnictwa i Chorób Kobiecych UM w Poznaniu, Polska
Pracownia Ultrasonografii Ginekologiczno-Położniczego Szpitala Klinicznego w Poznaniu, Polska
Streszczenie
Wstęp: Ultrasonograficzne metody oceny masy płodu są związane ze statystycznie znaczącymi błędami pomiaru
dla przypadków z makrosomią. Masa płodu powyżej 4000g może być dokładniej oszacowana przy użyciu formuły
łączącej w sobie ocenę biometryczną płodu i parametry charakteryzujące kobietę ciężarną.
Materiał i metodyka: Ultrasonograficzna ocena masy płodu została wykonana w czasie siedmiu dni poprzedzających
poród u 113 pacjentek ciężarnych, które urodziły noworodki z masą urodzeniową ≥4000g. Nową logarytmiczną
formułę opracowaną przez Harta: (loge SMP=7,6377445039+0,0002951035xmasa ciała+0,0003949464xobwód
głowy+0,0005241529xobwód brzucha+0,0048698624xdługość kości udowej), służącą do prognozowania
masy urodzeniowej płodu porównywano z popularnie stosowanymi formułami Sheparda, Campbella, Hadlocka
I, Hadlocka II, Hadlocka III. Z badania wyeliminowano ciąże mnogie, przypadki z występującymi obumarciami
wewnątrzmacicznymi oraz wadami płodu. Formuła Harta analizuje parametry pomiarowe biometrii płodu: SMP
– szacowana masa płodu, Masa ciała – masa ciężarnej w okresie ≤7 dni przed porodem, obwód głowy, brzucha
i długość kości udowej płodu.
Wyniki: Formuła Harta pozwala uzyskać najniższy możliwy średni błąd procentowy: (MPE – mean percentage
error) = -0,74% oraz średni absolutny błąd procentowy: (MAPE – mean absolute percentage error) =3,38%,
w odniesieniu do rutynowo stosowanych formuł, które cechują się statystycznie znacząco wyższymi średnimi błędami
procentowymi i średnimi absolutnymi błędami procentowymi. Zastosowanie formuły Harta pozwoliło na porównanie
masy szacowanej z masą rzeczywistą pourodzeniową u 84 pacjentek na poziomie rozbieżności wynoszącym: ±5%,
u 111 pacjentek na poziomie: ±10% oraz u 112 pacjentek w zakresie ±15% i ±20%.
Wnioski: Prezentowana ultrasonograficzna formuła wykorzystująca masę ciała ciężarnej cechuje się wysoką
dokładnością oceny prenatalnej masy płodu w porównaniu z pozostałymi metodami dla przypadków podejrzewania
makrosomii płodu.
Słowa kluczowe: makrosomia płodu / szacowana masa płodu / ultrasonografia /
/ ciężarna /
Adres do korespondencji:
Julia Murlewska
Klinika Położnictwa i Chorób Kobiecych
Katedra Ginekologii, Położnictwa i Onkologii Ginekologicznej Uniwersytetu Medycznego im. K. Marcinkowskiego w Poznaniu
60- 535 Poznań, ul. Polna 33, Polska
Tel./ fax. + 48 61 8419 334;
e-mail: [email protected]; [email protected]
114
Otrzymano: 10.09.2010
Zaakceptowano do druku: 21.01.2011
Nr 2/2011
Ginekol Pol. 2011, 82, 114-118
P R A C E
O R Y G I N A L N E
po∏o˝nictwo
Murlewska J, et al.
Summary
Introduction: Methods of macrosomic fetal weight estimation are associated with large deviations and statistically
significant errors. Fetal macrosomia might be better predicted by using fetal ultrasound measurements and maternal characteristics.
Material and methods: Ultrasound evaluation of fetal weight was performed in 113 singleton fetuses one week
(max. 7 days) before delivery. Retrospectively all newborns with birth weight of ≥4000g were taken into the study.
A new logarithmic estimation formula proposed by Hart and co. was compared with commonly used formulas of
Shepard, Campbell, Hadlock I, Hadlock II, Hadlock III. Exclusion criteria were: multiple pregnancies, intrauterine deaths, structural or chromosomal abnormalities. The new formula established by Hart (loge EFW = 7.6377445039 +
0.0002951035 x maternal weight + 0.0003949464 x HC + 0.0005241529 x AC + 0,0048698624 x FL) uses fetal
biometric measurements and maternal weight as two different parameters: EFW- estimated fetal weight, maternal
weight- weight measured at one week (max. 7 days) before delivery, HC - fetal head circumference, AC - abdominal
circumference, FL - femur length.
Results: The new Hart formula gives the lowest mean percentage error (MPE) : -0.74% and mean absolute
percentage error (MAPE) : 3.38%, as compared to other routinely used formulas which presented statistically significantly higher MPE and AMPE. With the new formula 84 of estimated fetal weights fell within ±5% of the actual
weight at birth, 111 within ± 10% and 112 within ± 15% and ± 20%.
Conclusions: The presented ultrasound formula demonstrated a more precise macrosomic fetuses weight estimation with
the lowest MPE and MAPE as compared to the others and might be introduced when fetal macrosomia is suspected.
Key words: fetal macrosomia / fetal weight / ultrasonography / pregnancy /
Wstęp
Problem makrosomii rozumianej jako masy płodu ≥4000g
dotyczy od 1 do 10% całej populacji kobiet ciężarnych i grupa ta
obecnie ulega dynamicznemu powiększeniu [1].Wraz ze wzrostem masy urodzeniowej noworodka wzrasta częstość przypadków wystąpienia dystocji barkowej z towarzyszącym uszkodzeniem splotu barkowego i/lub złamaniem obojczyka [2].
Średnie ryzyko dystocji barkowej wynoszące 1,4% przypisywane jest wszystkim porodom samoistnym, natomiast dla masy
płodu powyżej 4500g wynosi ono od 9,2 do 24% [3]. Pośród możliwych powikłań dotyczących noworodka, powiązanych z obecnością makrosomii płodowej wyróżniamy również zwiększoną
częstość wystąpienia nieprawidłowego stanu pourodzeniowego,
określanego według punktacji w skali Apgar: Apgar <4, złamań
kości ramiennej oraz przyjęć na oddziały noworodkowe [1]. Zagrożenia dla matki, jakie niesie ze sobą makrosomia to zwiększone ryzyko przedłużania się drugiego okresu porodu, uszkodzeń
krocza po porodach samoistnych, zabiegowych, traumatyzacji
podczas cięć cesarskich i krwawień poporodowych [2].
Stanowisko ekspertów Polskiego Towarzystwa Ginekologicznego dotyczące postępowania u kobiet z cukrzycą nakazuje
rozważenie ukończenia ciąży drogą cięcia cesarskiego przy podejrzewanej masie płodu powyżej 4200g a także stwierdzanej
różnicy obwodu brzucha płodu (AC) i obwodu główki płodu
(HC) przekraczającej 4cm, jak również różnicy powyżej 2,6cm
pomiędzy wymiarem poprzecznym brzucha (AD) a wymiarem
poprzecznym główki (BPD) [4, 5].
Natomiast, ACOG (American Congress of Obstetricians and
Gynecologists) rekomenduje wykonanie planowego cięcia cesarskiego w sytuacji, gdy szacowana ultrasonograficznie masa płodu wynosi powyżej 5000g w odniesieniu do całej populacji oraz
powyżej 4500g dla kobiet ciężarnych z cukrzycą [6].
W związku z brakiem dokładnego programu pozwalającego
na wczesne wykrywanie i prowadzenie ciąży powikłanej
makrosomią płodu ostateczna diagnoza jest stawiana często po
porodzie.
© Polskie Towarzystwo Ginekologiczne
Obecność 16-20% błędu pomiaru masy płodów z makrosomią skłania do prowadzenia dalszych badań nad poprawą dokładności metod biometrycznych [1]. Szybki i dynamiczny rozwój
metod ultrasonograficznych pozwala nam na pozytywne spojrzenie w przyszłość i uzyskiwanie coraz doskonalszych i dokładniejszych wyników.
Cel pracy
Celem badań było poszukiwanie metody ultrasonograficznej, która cechowałaby się wyższą dokładnością w diagnostyce
płodów powyżej 90 percentyla. Głównym zamierzeniem autorów
pracy była analiza retrospektywna pomiarów masy płodu na siedem dni przed porodem, wykonana zgodnie z opracowanymi formułami według Sheparda, Campbella, Hadlocka I, Hadlocka II,
Hadlocka III oraz porównanie jej z formułą według Harta w celu
sprawdzenia jej przydatności dla wszystkich noworodków z ciąż
pojedynczych z masą urodzeniową powyżej 4000g.
Materiały i metody
Badanie polegało na analizie retrospektywnej 113 ultrasonograficznych badań biometrycznych płodów z ciąż pojedynczych,
wykonanych w Ginekologiczno-Położniczym Szpitalu Klinicznym w Poznaniu według formuł mających powszechnie zastosowanie, opracowanych przez Sheparda, Campbella, Hadlocka
I, Hadlocka II, Hadlocka III, które porównano z nową formułą
logarytmiczną Harta dla przypadków, gdzie masa urodzeniowa
noworodków wynosiła powyżej 4000g.
Metoda ultrasonograficznej oceny masy płodu Harta: (loge
EFW = 7,6377445039 + 0,0002951035 x maternal weight +
0,0003949464 x head circumference + 0,0005241529 x abdominal circumference + 0,0048698624 x femur length) różni się od
pozostałych tym, że oprócz parametrów płodowych do obliczeń
należy także uwzględnić masę ciała kobiety ciężarnej, liczonej
w tym samym czasie, kiedy wykonywane badanie ultrasonograficzne, czyli do siedmiu dni przed porodem [6].
115
P R A C E
Ginekol Pol. 2011, 82, 114-118
O R Y G I N A L N E
po∏o˝n i c t w o
Ultrasonograficzne prognozowanie makrosomii płodu...
Formuła według Sheparda przedstawia się następująco:
Log10 EFW = -1,7492 + 0,166 (BPD) + 0,046 (AC) – (2,646 [(
AC) x (BPD)] / 100) i odpowiednio pozostałe: według Campbella: Log 10 EFW = - 4,564 + 0,282 AC – 0,00331 AC 2, według
Hadlocka1 : Log10 EFW = 1,3596 – 0,00386 AC x FL + 0,0064
HC + 0,00061 BPD X AC + 0,0424 AC + 0,174 FL, według Hadlocka2: Log 10 EFW = 1,304 + 0,05281 AC + 0,1938 FL – 0,004
AC X FL, natomiast według Hadlocka3 : Log10 EFW = 1,335 –
0,0034 AC X FL + 0,0316 BPD + 0,0457 AC + 0,1623 FL.
EFW – estimated fetal weight – szacowana masa płodu
AC – abdominal circumference – obwód brzucha
FL – femur length – długość kości udowej
HC – head circumference – obwód głowy płodu
BPD – biparietal diameter – wymiar dwuciemieniowy głowy płodu
maternal weight – masa ciała ciężarnej
Analiza statystyczna polegała na wyznaczeniu średniego błędu procentowego PE (percentage error) dla każdej metody, gdzie
PE = (EFW – BW) / BW x 100) oraz średniego błędu absolutnego
APE (absolute percentage error), gdzie APE = ( [EFW – BW]) /
BW x 100) i BW - masa urodzeniowa płodu (birth weigth). Błędy procentowe zostały wyliczone poprzez porównanie wielkości
masy płodu szacowanej ultrasonograficznie i masy urodzeniowej
noworodka.
Różnice pomiędzy wyliczonymi średnimi błędami absolutnymi (APE) dla poszczególnych metod i dla nowej metody Harta
zostały porównywane przy użyciu testu Wilcoxona, natomiast
pomiędzy wyliczonymi średnimi błędami procentowymi (PE)
przy pomocy testu t Studenta, w przedziale ufności wynoszącym
5%, na poziomie istotności p ≤0,007
Dla każdej metody służącej do szacowania masy płodu określono także ilość przypadków, w których masa płodu szacowana
różniła się od masy rzeczywistej pourodzeniowej na poziomie
rozbieżności wynoszącym: 5, 10, 15 oraz 20% (przy użyciu testu
McNemara, dla p≤0,01 o istotności statystycznej).
Opracowanie statystyczne zostało wykonane dzięki
współpracy z Katedrą Informatyki i Statystyki Uniwersytetu
Medycznego im. K. Marcinkowskiego w Poznaniu.
Wyniki
Wyniki badań przedstawione zostały w tabelach I i II oraz
rycinach 1-4.
Tabela I. Wartości średnich błędów procentowych PE i APE dla każdej z metod
ultrasonograficznych zastosowanych w populacji pacjentek ciężarnych z ciąż
powikłanych makrosomią płodu.
Tabela II. Ilość przypadków (n), spośród całej populacji 113 pacjentek objętych badaniem, u których szacowana masa płodu różniła się w stosunku do masy urodzeniowej
noworodka na poziomie rozbieżności wynoszącym: ±5, 10, 15, 20% dla każdej rutynowo stosowanej formuły ultrasonograficznej oraz dla nowej formuły Harta, dla p<0,001
o znaczeniu statystycznie istotnym.
116
Nr 2/2011
Ginekol Pol. 2011, 82, 114-118
P R A C E
O R Y G I N A L N E
po∏o˝nictwo
Murlewska J, et al.
Rycina 1. Różnice pomiędzy rzeczywistą masą pourodzeniową a szacowanymi
masami płodu dla każdej z metod: Sheparda, Campbella, Hadlocka I, II, III, Harta.
Rycina 2. Wartości średnie mas szacowanych płodu według Sheparda,
Campbella, Hadlocka I, II, III w odniesieniu do masy szacowanej według Harta.
Rycina 3. Wartości średnie błędów procentowych PE dla każdej z metod.
Rycina 4. Wartości średnie błędów procentowych APE dla każdej z metod.
Dyskusja
Najczęściej spotykanym błędem związanym z określaniem
ultrasonograficznie masy płodu z makrosomią jest jej niedoszacowanie, dlatego tak istotne jest poszukiwanie nowej metody, która
pozwalałaby na dokładną diagnostykę w sytuacji masy przekraczającej 90 percentyl dla danego wieku ciążowego [8-11].
Hoopmann M. i wsp. opublikowali w 2010 roku analogiczną
pracę retrospektywną oceniającą dokładność trzydziestu sześciu
formuł biometrycznych, służących do szacowania masy płodu
z makrosomią [12]. Analiza dotyczyła ciąż pojedynczych w czasie ≤7 dni przed porodem, gdzie masa urodzeniowa noworodków wynosiła ≥4000g. Obliczenia statystyczne wskazywały na
obecność średniego błędu procentowego w zakresie od – 62,2
do 9,6%, natomiast błąd najniższy i najbliższy wartości zerowej
uzyskano dla formuły Harta.
© Polskie Towarzystwo Ginekologiczne
Wyniki powyższych autorów są zgodne z wynikami naszej
publikacji i potwierdzają dokładność metody Harta; średni błąd
procentowy wyniósł w obliczeniach Hoopmanna M. i wsp. dla
szacowanej masy płodu powyżej 90 percentyla: 0,3%, w naszych
badaniach: - 0,74%, średni absolutny błąd procentowy wyniósł:
3,9% według Hoopmanna i 3,38% w naszej analizie.
Oryginalna praca Harta z 2010 roku przedstawia średni błąd
procentowy metody jako wynoszący: - 0,03%, natomiast średni absolutny błąd procentowy: 3,69%, a więc zarówno analiza
Harta, jak i nasza ocena statystyczna wskazuje na wystąpienie
nieznacznego niedoszacowania masy płodu z makrosomią [6].
Wyniki oceniające poziom rozbieżności pomiędzy masą szacowaną płodu powyżej 90 percentyla a rzeczywistą masą pourodzeniową są podobne dla badań Harta i naszej analizy [7].
117
P R A C E
Ginekol Pol. 2011, 82, 114-118
O R Y G I N A L N E
po∏o˝n i c t w o
Ultrasonograficzne prognozowanie makrosomii płodu...
Według Harta u 77,9% pacjentek masa szacowana płodu
i masa rzeczywista są na poziomie rozbieżności wynoszącym:
±5%, u nas jest to grupa 111 pacjentek, u 97,1% na poziomie
±10% (w naszej analizie jest to grupa 112 pacjentek), natomiast
u 100% i odpowiednio u 112 pacjentek w naszej publikacji rozbieżność ta jest zachowana w zakresie ±15 i ±20%.
Częstość wykrywania masy urodzeniowej ≥4000g, ≥4300g,
≥4500g obliczona dla wszystkich formuł w pracy Markusa Hoopmanna wynosiła odpowiednio 29, 24, 22%, natomiast fałszywie pozytywna wartość predykcyjna została obliczona na 12%
dla masy ≥4300g i 7% dla masy ≥4500g [12].Wobec powyższych
wyników autorzy doszli do wniosku, iż żadna z metod nie posiada
zadowalającej częstości wykrywania makrosomii, jak i fałszywie
pozytywnej predykcji dla oceny masy ≥4500g, które pozwalałyby na rekomendowanie ich do celów klinicznych [12].
Krytycy formuły Harta: Nahum i Stanislaw pomimo,
iż osiągnęli wyższą czułość swojej metody ultrasonograficznej
prognozowania makrosomii w porównaniu z metodą Harta, wynoszącą: 75%, oraz specyficzność: 98%, pozytywną i negatywną
wartość predykcyjną odpowiednio: 67% i 95%, to wyeliminowali ze swoich badań przypadki ze współistniejącą cukrzycą
w ciąży, gdzie makrosomia płodu jest szczególnie często obecna
przy niewyrównanej metabolicznie cukrzycy [13, 14]. Formuła
opracowana przez Nahuma i Stanislawa została wykonywana
w okresie jedenastu tygodni poprzedzających poród i dotyczyła
oceny płodów z masą od 2285 do 4850g.
Balsyte i wsp. w analizie zastosowania klinicznego dwóch
metod szacowania masy płodu z makrosomią opracowanych
przez Mazouniego i Nahuma, Stanislawa, które zawierają dodatkowe parametry zmienne charakterystyki kobiety ciężarnej,
oprócz wartości biometrycznych płodu, nie wykazali ich wyższości nad powszechnie stosowanymi metodami, przy czym badanie wykonywano w czasie poprzedzającym siedem dni przed
porodem [15].
Na podstawie naszych badań i publikacji innych autorów
[12, 13, 14], zajmujących się ultrasonograficznym prognozowaniem makrosomii płodu należy stwierdzić, że włączenie do analizy masy ciężarnej cechuje się większą dokładnością oceny masy
płodu niż standardowe ultrasonograficzne metody biometryczne.
6. ACOG Practice Bulletin No. 58. Ultrasonography in pregnancy. Obstet Gynecol. 2004, 104,
1449-1458.
7. Hart N, Hilbert, Meurer B, [et al.]. Macrosomia: a new formula for optimized fetal weight
estimation. Ultrasound Obstet Gynecol. 2010, 35, 42-47.
8. Benacerraf B, Gelman R, Frigoletto F Jr. Sonographically estimated fetal weights: accuracy and
limitation. Am J Obstet Gynecol. 1988, 159, 1118-1121.
9. Deter R, Hadlock F. Use of ultrasound in the detection of macrosomia: a review. J Clin
Ultrasound. 1985, 13, 519-524.
10. Miller J Jr, Kissling G, Brown H, [et al.]. Estimated fetal weight: applicability to small - and large –
for- gestational – age fetus. J Clin Ultrasound. 1988, 16, 95-97.
11. Weinberger E, Cyr D, Hirsch J, [et al.]. Estimating fetal weights less than 2000g: an accurate and
simple method. AJR Am J Roentgenol. 1984, 142, 973-977.
12. Hoopmann M, Abele H, Wagner N, [et al.]. Performance of 36 different weight estimation formulae
in fetuses with macrosomia. Fetal Diagn Ther. 2010, 27, 204-213.
13. Nahum G, Stanislaw H. Derivation of combination birth- weight prediction equations to identify
fetal macrosomia. Correspondence. Ultrasound Obstet Gynecol. 2010, 35, 503- 5074
14. Nahum G, Stanislaw H. A computerized method for accurately predicting fetal macrosomia up to
11 weeks before delivery. Eur J Obstet Gynecol Reprod Biol. 2007, 133, 148-156.
15. Balsyte D, Schaffer L, Burkhardt T, [et al.]. Sonographic prediction of macrosomia cannot be
improved by combination with pregnancy- specific characteristics. Ultrasound Obstet Gynecol.
2009, 33, 453-458.
Wnioski:
Prezentowana ultrasonograficzna formuła wykorzystująca
masę ciała ciężarnej cechuje się wyższą dokładnością oceny
prenatalnej masy płodu w porównaniu z pozostałymi metodami
dla ciąż powikłanych makrosomią.
Piśmi en n i c t w o
1. Pundir J, Sinha P. Non- diabetic macrosomia : an obstetric dilemma. J Obstet Gynaecol. 2009,
29, 200- 205.
2. Orskou J, Kesmodel U, Henriksen T, [et al.]. An increased proportion of infants weigh more than
4000 grams at birth. Acta Obstet Gynecol Scand. 2001, 80, 931-936.
3. Ben- Haroush A, Yogev Y, Hod M. Fetal weight estimation in diabetic pregnancies and suspected
fetal macrosomia. J Perinat Med. 2004, 32, 113-121.
4. Zespół Ekspertów Polskiego Towarzystwa Diabetologicznego : Zalecenia kliniczne dotyczące
postępowania u chorych na cukrzycę 2009. Diabetologia Praktyczna. 2009, 10, suplement A.
5. Standardy Polskiego Towarzystwa Ginekologicznego postępowania u kobiet z cukrzycą. Ginek
Pol. 2005, 76, 68-76.
118
Nr 2/2011
Ginekol Pol. 2011, 82, 119-125
P R A C E
O R Y G I N A L N E
n e o n ato l og ia
Zaburzenia w okresie adaptacyjnym
noworodków urodzonych „blisko terminu
porodu”
Late preterm infants – complications during the early period
of adaptation
Baumert Małgorzata¹, Łukomska Agnieszka¹, Krzych Łukasz J.²,
Magnucki Jacek³, Pacula Małgorzata¹
¹ Klinika Neonatologii Katedry Położnictwa i Ginekologii SUM, Katowice, Polska
² I Oddział Kardiochirurgii, Górnośląskie Centrum Medyczne, Katowice, Polska
³ Klinika Położnictwa i Ginekologii SUM, Katowice, Polska
Streszczenie
W ostatnich latach przedmiotem zwiększonego zainteresowania stała się podgrupa noworodków urodzonych
pomiędzy 34 a 37 tygodniem ciąży, którą nazwano „późnymi wcześniakami”.
Celem pracy jest przeanalizowanie, czy u tych noworodków częściej występują zaburzenia w okresie adaptacyjnym
w porównaniu z noworodkami urodzonymi w terminie porodu.
Materiał i metoda: dokonano przeglądu retrospektywnego 1271 historii rozwoju noworodków urodzonych od
01.01.2008 do 31.12.2008 w Klinice Ginekologii SUM w Katowicach.
Do badania zakwalifikowano 312 noworodków urodzonych „blisko terminu porodu” - ”późne wcześniaki” - (pomiędzy
34 tyg. 0/7 dni a 36 tyg. 6/7 dni) oraz 812 dzieci urodzonych w terminie porodu.
Wyniki: „późne wcześniaki” częściej wykazywały zaburzenia oddychania w porównaniu z noworodkami
donoszonymi (p<0,001), istotnie częściej u nich leczono infekcję wewnątrzmaciczną (p=0,0012) i hiperbilirubinemię
(p<0,001), zaburzenia termoregulacji (p<0,001) oraz wylewy I i II° do komór mózgu (p<0,001).
Obserwowano również przedłużenie czasu hospitalizacji z powodu udokumentowanych zaburzeń klinicznych
(p<0,001).
Wnioski: nawet niewielkie skrócenie czasu trwania ciąży wpływa istotnie na przebieg adaptacji noworodków.
U „późnych wcześniaków” obserwuje się istotnie częściej zaburzenia oddychania, hiperbilirubinemię, infekcje,
zaburzenia termoregulacji i wylewy do/okołokomorowe w porównaniu z noworodkami urodzonymi o czasie.
Słowa kluczowe: noworodek urodzony o czasie / „późny wcześniak” / powikłania /
Adres do korespondencji:
Małgorzata Baumert
Klinika Neonatologii SUM
ul. Medyków 14, 40-752 Katowice, Polska
tel/fax: +48 32-789 44 61
e-mail: [email protected]
© Polskie Towarzystwo Ginekologiczne
Otrzymano: 19.11.2010
Zaakceptowano do druku: 21.01.2011
119
P R A C E
Ginekol Pol. 2011, 82, 119-125
O R Y G I N A L N E
neona to l o g i a
Baumert M, et al.
Abstract
A subgroup of more mature preterm infants, so-called „near term” („late preterm”) infants, 34 weeks 0/7 days to 36
weeks 6/7 days, have become the interest of countless research recently.
Objectives: the aim of the study is the observation of more frequent occurrence of clinical problems in near-term
infants in comparison with term infants.
Methods: A retrospective review, conducted from January 1, 2008 to December 31, 2008, included 1271 neonatal
records and subset analyses of 312 near-term infants and 812 full term infants.
Results: Late preterm newborns were at higher risk of respiratory distress syndrome (p<0,01), infections, (p=0,0012)
hyperbilirubinemia (p<0,001), temperature instability (p<0,001) and intraventricular hemorrhage (p<0,001) than
term infants. A prolonged infant stay at hospital (beyond 72 hours after vaginal delivery and 96 hours after a cesarean delivery) resulting from specific clinical problems was observed.
Conclusions: Even a little shortened period of pregnancy influences the adaptation period of the infants and
increases the occurrence of clinical problems like respiratory distress syndrome, hyperbilirubinemia, infections,
temperature instability and intraventricular hemorrhage, when comparing to term infants.
Key words: term infant / late preterm infant / clinical complications /
Wstęp
Statystyki światowe informują, że częstość wcześniactwa
stale wzrasta pomimo postępu w opiece medycznej [1].
Raporty badaczy amerykańskich zwróciły uwagę iż odsetek noworodków urodzonych przed 32 tygodniem ciąży w ciągu ostatnich lat nie zwiększa się natomiast dzieci urodzonych
pomiędzy 34 0/7 tygodniem ciąży a 36 6/7 tygodniem ciąży jest
co roku więcej. Noworodki urodzone w tej grupie stanowią ponad 70% wszystkich urodzonych przedwcześnie [2]. Dlatego też
w ostatnich latach przedmiotem zwiększonego zainteresowania
stała się powyżej zdefiniowana podgrupa noworodków.
Dwa towarzystwa amerykańskie zrzeszające pediatrów
i położników ustaliły nowy termin – „noworodek blisko terminu
porodu” lub „późny wcześniak” („near term, „marginally
preterm”) [3]. Autorzy tej definicji uważają, że wiek płodowy
powinien być wyznaczony przez zakończony tydzień ciąży. Na
przykład noworodek, który urodził się w 5 dniu 36 tygodnia
ciąży ma skończone 35 tygodni, a nie 36 (35 tygodni i 5/7 dni).
Autorzy zasugerowali, iż noworodki urodzone blisko terminu
porodu rodzą się pomiędzy 239-259 dniem ciąży, czyli pomiędzy
34 tyg. 0/7 dni a 36 tyg. 6/7 dni [4].
Doświadczenia kliniczne ostatnich lat wskazują, że nawet
niewielkie skrócenie czasu trwania ciąży istotnie wpływa na
przebieg adaptacji pourodzeniowej choć przez długi czas uważano, że noworodki te są czynnościowo w pełni dojrzałe. Konsekwencją niedojrzałości u dzieci urodzonych „blisko terminu
porodu” są różnego rodzaju i stopnia nieprawidłowości, takie
jak zaburzenia oddychania, hipotermia, hipoglikemia, zakażenia,
przedłużająca się żółtaczka bezdechy i nagła śmierć łóżeczkowa
[5, 6].
Dlatego też celem pracy było przeanalizowanie czy u noworodków urodzonych blisko terminu porodu – „późnych wcześniaków” częściej występują zaburzenia w okresie adaptacyjnym
w porównaniu z noworodkami urodzonymi w terminie porodu.
Materiał i metoda
Dokonano przeglądu retrospektywnego 1271 historii rozwoju noworodków urodzonych od 01.01.2008 do 31.12.2008 w Klinice Ginekologii SUM w Katowicach, która jest jednym z dwóch
ośrodków III stopnia referencyjności na Śląsku.
120
Do badania zakwalifikowano 312 noworodków urodzonych
blisko terminu porodu – „późnych wcześniaków” – (pomiędzy
34 tyg. 0/7 dni a 36 tyg. 6/7 dni) oraz 812 dzieci urodzonych
w terminie porodu. Dla porównania analizowano także grupę
147 noworodków urodzonych poniżej 34 tygodnia ciąży.
Z badań wykluczono noworodki z dużymi wadami wrodzonymi i te, których historie rozwoju noworodka nie zawierały
kompletnych danych. Porównywano stan noworodka po urodzeniu oceniany wg skali Apgar, długość pobytu w oddziale, częstość zaburzeń okresu adaptacyjnego (zaburzenia termoregulacji, zaburzenia oddychania, hiperbilirubinemia, infekcja).
Zaburzenia termoregulacji rozpoznano u tych noworodków,
u których temperatura mierzona pod pachą wynosiła mniej niż
36,3ºC i wymagały umieszczenia w inkubatorze. Zaburzenia
oddychania rozpoznawano, gdy u noworodka obserwowano
stękanie wydechowe, poruszanie skrzydełkami nosa, wciąganie międzyżebrzy trwające dłużej niż 2 godziny oraz do grupy
tej kwalifikowano noworodki wymagające tlenoterapii biernej
i wspomagania oddechu w systemie nCPAP (nasal continuous
positive airway pressure) i /lub sztucznej wentylacji.
Hiperbilirubinemię rozpoznawano gdy stężenie bilirubiny
u noworodka było ≥15mg/dl i wymagał stosowania fototerapii.
Infekcję rozpoznawano na podstawie badania klinicznego (między innymi niechęć do ssania, żółtaczka, osłabiona żywotność)
i badań dodatkowych: morfologii krwi z rozmazem, trzykrotnego, w odstępach 12 godzinnych, badania białka CRP, posiewów
krwi oraz leczenia antybiotykami. Za przedłużenie czasu hospitalizacji uznawano pobyt powyżej 72 godzin w przypadku porodu siłami natury i powyżej 96 godzin w przypadku porodu przez
cięcie cesarskie.
Wyniki
W tabeli I przedstawiono charakterystykę ogólną badanych
pacjentów.
W 2008 roku urodziło się łącznie 1271 dzieci. Noworodków
płci żeńskiej było 620 (48,8%), płci męskiej 651 (51,2%). Do 33
tygodnia ciąży urodziło się 147 noworodków (11,6%), pomiędzy
34 tyg. 0/7 dni i 36 tyg. 6/7 dni ciąży – 312 (24,4%) dzieci, a donoszonych noworodków było 812 (65,9%). „Późne wcześniaki”
stanowiły 68% wszystkich urodzonych przedwcześnie.
Nr 2/2011
Ginekol Pol. 2011, 82, 119-125
P R A C E
O R Y G I N A L N E
n e onat ologia
Zaburzenia w okresie adaptacyjnym noworodków urodzonych „blisko terminu porodu”.
Tabela I. Charakterystyka ogólna badanych pacjentów.
Tabela II. Najczęstsze wskazania do cięcia cesarskiego w grupie noworodków urodzonych do 34 tyg ciąży (grupa I), w grupie „późnych wcześniaków” (grupa II)
i w grupie noworodków donoszonych (grupa III) oraz istotności statystyczne.
© Polskie Towarzystwo Ginekologiczne
121
P R A C E
Ginekol Pol. 2011, 82, 119-125
O R Y G I N A L N E
neona to l o g i a
Baumert M, et al.
Tabela III. Częstości występowania poszczególnych zaburzeń okresu adaptacyjnego oraz iloraz szans porównywany pomiędzy „późnymi wcześniakami”
i noworodkami donoszonymi.
ZZO – Zespół zaburzeń oddychania
IVH – Wylew do/okołokomorowy
Rycina 1. Odsetek cięć cesarskich oraz istotności statystyczne
w poszczególnych grupach badanych noworodków.
Rycina 2. Stan noworodków oceniany wg skali Apgar w 1 min. życia oraz
istotności statystyczne w poszczególnych grupach badanych noworodków.
122
Rycina 3. Zaburzenia okresu adaptacyjnego oraz istotności statystyczne
pomiędzy grupą „późnych wcześniaków” i noworodków donoszonych.
Przez cięcie cesarskie urodziło się łącznie 705 (55,5%) noworodków. W grupie „późnych wcześniaków” cięciem cesarskim urodziło się 77,2%. Była to różnica istotna statystycznie
w porównaniu, zarówno z noworodkami urodzonymi do 33 tyg.
ciąży (p=0,0069), jak i urodzonych w terminie porodu – p<0,001.
(Rycina 1).
W tabeli II przedstawiono najczęstsze wskazania do cięcia
cesarskiego. Wszystkie wskazania do cięcia cesarskiego występowały istotnie częściej w grupie „późnych wcześniaków” w porównaniu z grupą dzieci urodzonych w terminie (p<0,001).
Średnia urodzeniowa masa ciała (±odchylenie standardowe)
„późnych wcześniaków” i noworodków donoszonych wynosiła
odpowiednio 2649 ± 584g i 3449 ± 446g.
„Późne wcześniaki” istotnie częściej rodziły się w gorszym
stanie, ocenianym w 1 minucie życia w/g skali Apgar, w porównaniu z noworodkami urodzonymi o czasie (p<0,001). (Ryc. 2).
Oceniając zaburzenia okresu adaptacyjnego stwierdzono,
że częstość wszystkich analizowanych powikłań klinicznych
różniła się między noworodkami urodzonymi blisko terminu
porodu a donoszonymi.
Nr 2/2011
Ginekol Pol. 2011, 82, 119-125
P R A C E
O R Y G I N A L N E
n e onat ologia
Zaburzenia w okresie adaptacyjnym noworodków urodzonych „blisko terminu porodu”.
„Późne wcześniaki” częściej wykazywały zaburzenia oddychania w porównaniu z noworodkami donoszonymi (p<0,001).
Istotnie częściej u nich leczono infekcję wewnątrzmaciczną
(p=0,0012) i hiperbilirubinemię (p<0,001). Również w grupie tej
obserwowano zaburzenia termoregulacji istotnie częściej w porównaniu z noworodkami urodzonymi o czasie (p<0,001).
U „późnych wcześniaków” istotnie częściej niż u noworodków donoszonych obserwowano wylewy I i IIº do komór mózgu
(p<0,001). (Rycina 3, tabela III) .
Obserwowano również przedłużenie czasu hospitalizacji
z powodu udokumentowanych zaburzeń klinicznych u „późnych
wcześniaków” w porównaniu z noworodkami urodzonymi
o czasie (p<0,001).
Oceniając występowanie poszczególnych zaburzeń w okresie wczesnonoworodkowym, biorąc pod uwagę jedynie grupę
„późnych wcześniaków” wykazano różnice znamienne statystycznie w częstości ZZO w poszczególnych tygodniach ciąży.
Podobne różnice stwierdzono w zakresie częstości infekcji oraz
zaburzeń termoregulacji. (Rycina 4).
Dyskusja
W naszym materiale „późne wcześniaki” stanowiły 68%
wszystkich urodzonych przedwcześnie. Taka tendencja utrzymuje się również na świecie. W 2002 roku w USA noworodki
urodzone jako „późne wcześniaki” stanowiły aż 74% wszystkich
wcześniaków [2]. Stan zdrowia matki podczas ciąży, włączając
nadciśnienie tętnicze, astmę i cukrzycę zwiększa ryzyko spontanicznego porodu. Opieka nad kobietą w ciąży, szczególnie przedwczesnej przedstawia wiele wyzwań dla położników. Muszą oni
dokonać wielu analiz by ustalić najbardziej optymalny czas rozwiązania biorąc pod uwagę zarówno ryzyko ze strony matki jak
i płodu. Przedwczesne rozwiązanie korzystne dla płodu jest wtedy, gdy zagrożenia ciąży są na tyle poważne, że stwarzają gorsze
warunki dla rozwoju dziecka.
W materiale przez nas analizowanym rozwiązanie ciąży
przez cięcie cesarskie w grupie „późnych wcześniaków” stanowiło aż 77,2%. Dzieci z tej grupy istotnie częściej rodziły się
przez cięcie cesarskie w porównaniu z noworodkami urodzonymi o czasie, jak i wcześniakami urodzonymi do 33 tygodnia
ciąży.
ZZO – Zespół zaburzeń oddychania
Rycina 4. Występowanie zaburzeń w okresie adaptacyjnym w grupie „późnych wcześniaków” z uwzględnieniem poszczególnych tygodni ciąży
oraz istotności statystyczne.
© Polskie Towarzystwo Ginekologiczne
123
P R A C E
Ginekol Pol. 2011, 82, 119-125
O R Y G I N A L N E
neona to l o g i a
Baumert M, et al.
Najczęstszymi wskazaniami były: przedwczesne odpłynięcie płynu owodniowego (PROM), nadciśnienie tętnicze u matki,
nieprawidłowe zapisy KTG. Wszystkie te wskazania były istotnie częściej spotykane u matek noworodków urodzonych blisko
terminu porodu niż u matek noworodków rodzących w terminie
porodu. Podobny trend obserwuje się również w innych ośrodkach. W 2007 roku opublikowano badanie randomizowane
(PROMEXITIL- trial), w którym autorzy wykazali iż wcześniejsze rozwiązanie ciąży powikłanej PROM, redukuje wystąpienie
zakażenia u noworodków z 7,5% do 2,5%. Obniżenie częstości
zakażenia jest na tyle istotne, że przewyższa nawet ryzyko wystąpienia RDS u tych dzieci [7].
Pomimo iż powszechnie panuje pogląd, że noworodki urodzone blisko terminu porodu są „prawie dojrzałe” to jednak
w istocie tak nie jest. Badania nasze i innych autorów wykazują,
że obarczone są one szeregiem zaburzeń wynikających głównie
z ich niedojrzałości [8, 9, 10].
Jednym z najpoważniejszych jest zespół zaburzeń oddychania. 14,8% „późnych wcześniaków” w naszym badaniu wykazywało zaburzenia oddychania. Wymagały one wsparcia oddechowego i/lub tlenoterapii biernej. Zaobserwowano również , że
ZZO istotnie częściej dotyczył noworodków urodzonych w 34
tygodniu ciąży, niż w późniejszych tygodniach ciąży, co jedynie
potwierdza iż przyczyną tych zaburzeń, oprócz rozpoznanego
przejściowego zespołu zaburzeń oddychania i zapalenia płuc
wrodzonego, była niedojrzałość układu oddechowego. Istotną
przyczyną ZZO jest również proces wchłaniania płynu płucnego,
szczególnie u dzieci pochodzących z cięcia cesarskiego. W badanej grupie dzieci aż 77,2% z nich rodziło się tym sposobem.
Proces wchłaniania płynu płucnego zostaje zainicjowany dopiero po 37 tygodniu ciąży w następstwie endogennego uwalniania
sterydów i amin katecholowych i uruchomienia pomp jonowych
nabłonka oddechowego płuc [11].
Powszechnie wiadomo, że istotną rolę w układzie oddechowym odgrywa surfaktant, produkowany przez pneumocyty II
rzędu dopiero od 22-23 tygodnia ciąży. W 25-26 tygodniu życia płodowego wytwarzają się w pneumocytach II rzędu wtręty
laminarne, które stanowią formę zapasów surfaktantu wewnątrz
pneumocytu. Surfaktant jest tam odkładany i stamtąd wydalany
na zewnątrz. Dostateczną ilość surfaktantu stwierdza się dopiero
po 36 tygodniu ciąży [12].
Równie częstym problemem u „późnych wcześniaków”
była hiperbilirubinemia-14,1%
w porównaniu z 6,7% u noworodków donoszonych. Wyższe
stężenie bilirubiny obserwuje się w wyniku opóźnionego dojrzewania i niższego stężenia transferazy glukuronowej [13]. Ponadto noworodki urodzone blisko terminu porodu mają niedojrzały
przewód pokarmowy oraz trudności w odżywianiu, które powodują zwiększenie krążenia wątrobowo-jelitowego, zmniejszają
częstość oddawania stolca, mogą prowadzić do odwodnienia,
a tym samym do hiperbilirubinemii.
Niestabilność ciepłoty ciała obserwowano aż w 33% „późnych wcześniaków”.
U noworodków wytwarzanie ciepła odbywa się w wyniku
termogenezy bezdrżeniowej, z wykorzystaniem tkanki tłuszczowej brunatnej [14]. Odpowiedź noworodka po urodzeniu na
zimno, w głównej mierze zależy od dojrzałości brunatnej i białej
tkanki tłuszczowej. 124
Gromadzenie i dojrzewanie brunatnej tkanki tłuszczowej
oraz stężenie hormonów mających na nią wpływ (prolaktyna,
leptyna, norepinefryna, trójjodotyronina, kortyzol) mają najwyższą wartość w terminie porodu [15, 16, 17].
Pokłady tkanki tłuszczowej białej służące termoizolacji również są niższe u noworodków urodzonych przedwcześnie. Poza
tym dzieci urodzone przedwcześnie tracą więcej ciepła gdyż
stosunek powierzchni do ich masy ciała przewyższa trzykrotnie
wartości występujące u dorosłych [18]. Dodatkowo obniżone
napięcie mięśniowe u noworodków urodzonych przedwcześnie
jest przyczyną zwiększenia powierzchni ciała, w wyniku czego następuje nasilona utrata ciepła drogą parowania, konwekcji
i promieniowania.
Innym powikłaniem, istotnie częściej występującym w grupie „późnych wcześniaków”, w porównaniu z noworodkami urodzonymi w terminie porodu były wylewy do/ okołokomorowe
(IVH). Głównie były to wylewy I i II stopnia wg skali Papille’a.
Zależności takiej nie uwidoczniono porównując tę grupę z noworodkami urodzonymi do 33 tygodnia ciąży. Brak istotnej różnicy w częstości wylewów pomiędzy tymi grupami noworodków
sugeruje, iż dzieci urodzone blisko terminu porodu przynależą
bardziej do grupy wcześniaków niż donoszonych.
Podstawowe znaczenie w patomechanizmie krwawień odgrywa niedojrzałość i zaburzenia krążenia mózgowego związane
z czynnikami wewnątrznaczyniowymi, naczyniowymi i pozanaczyniowymi. Czynniki naczyniowe przyczyniają się do występowania wylewów, a związane jest to z niedojrzałością naczyń
macierzy przykomorowej. Łożysko macierzy przykomorowej
składa się z dużej liczby nieregularnych naczyń, które mają charakter śródbłonkowy i pozbawione są wszelkich tkanek podporowych, a także kolagenu i włókien mięśniowych. Ich budowa nie
odpowiada ani tętnicom, ani żyłom, ani naczyniom włosowatym.
W błonach podstawnych naczyń macierzy istnieje niedobór białek i połączenia ich są bardzo niespójne. Dopiero w pierwszych
dniach po porodzie zachodzi przebudowa sieci naczyń macierzy
przykomorowej, której towarzyszy wzrost przepływu krwi. Ma
to prawdopodobnie związek z czasem powstawania krwawień
[19].
W konsekwencji powikłań okresu noworodkowego „późne
wcześniaki” istotnie dłużej przebywały w oddziale neonatologii
w porównaniu z noworodkami urodzonymi o czasie.
Powyższe badania i badania innych autorów pokazują, że
noworodki urodzone blisko terminu porodu są trochę bardziej
dojrzałymi wcześniakami niż trochę mniej dojrzałymi noworodkami donoszonymi [20, 21]. Wniosek
Nawet niewielkie skrócenie czasu trwania ciąży wpływa
istotnie na przebieg okresu adaptacyjnego noworodków.
W okresie adaptacyjnym „późnych wcześniaków” obserwuje się istotnie częściej zaburzenia oddychania, hiperbilirubinemię, infekcje, zaburzenia termoregulacji i wylewy do/okołokomorowe w porównaniu z noworodkami urodzonymi o czasie.
Nr 2/2011
Ginekol Pol. 2011, 82, 119-125
P R A C E
O R Y G I N A L N E
n e onat ologia
Zaburzenia w okresie adaptacyjnym noworodków urodzonych „blisko terminu porodu”.
Piśm i e n n i c t w o
1. Martin J, Hamilton B, Sutton P, [at al.]. Births: final data for 2005. Natl Vital stat Rep. 2007, 56,
1-103.
2. Davidoff M, Dias T, Damus K, [et al.]. Changes in the gestational age distribution among U.S.
Singelton birth: impact on rates of late preterm birth, 1992 to 2002. Semin Perinatol. 2006, 30,
8-15.
3. American Academy of Pediatrics and American College of Obsterticians and Gynecologists
2005. Guidelines of Perinatal Care. 5 th Ed. American Academy of Pediatrics. Elk Grove Village.
2005, 211-220.
4. Raju K. The problem of late-preterm ( near-term) birth: a workshop summary. Pediatr Res. 2006,
60, 775-776.
K O M U N I K AT
UROGINEKOLOGIA OPERACYJNA
W A R S Z TAT Y P R A K T Y C Z N E
( I p ó ł r o c z e 2 0 1 1 r. )
kierownik kursu
prof. zw. dr hab. n. med. Tomasz Rechberger
5. Hunt C. Ontogeny of autonomic regulation in late preterm infants born at 34-37 week
postmenstrual age. Semin Perinatol. 2006, 30, 73-76.
6. Engle W, Tomashek K, Wallman C, [et al.]. Late-preterm infants: a population at risk Pediatrics.
2007, 120, 1390-1401.
7. van der Ham D, Nijhuis J, Mol B, [at al.]. Induction of labour versus expectant management
in women with preterm prelabour rupture of membranes between 34 and 37 weeks ( the
PPROMEXIL- trial). BMC Pregnancy Childbirth. 2007, 7, 11-16.
8. Garg M, Devaskar S. Glucose metabolism in the late-preterm infant. Clin Perinatol. 2006, 33,
853-870.
9. Kalia J, Visintainer P, Brumberg H, [et al.]. Comparison of enrollmentin interventional therapies
betwee late- pretem and very preterm infants at 12 month’ corrected age. Pediatrics. 2009, 123,
804-809.
10. Vachharajani A, Dawson J.. Short term outcome of late preterms: an institutional experience.
Clin Pediatr. 2009, 48, 383-388.
11. Jain L, Eaton D. Physiology of fetal lung fluid clearance and the effect of labour. Semin Perinatol.
2006, 30, 34-43.
12. Szczapa J. Choroby układu oddechowego. W: Podstawy neonatologii. Red. Szczapa J.
Warszawa: PZWL. 2008, 136-168.
13. Sarici S, Serdar M, KorkmazA, [et al.]. Incidence, course and prediction of hyperbilirubinemia in
near-term and term newborns. Pediatrics. 2004, 113, 775-780.
14. Himms-Hagen J. Brown adipose tissue thermogenesis: interdisciplinary studies. FASEB J.
1990, 4, 2890-2898.
15. Stephenson T, Budge H, Mostyn A, [et al.]. Fetal and neonatal adipose maturition: a primary site
of cytokine and cytokine-receptor action. Biochem Soc Trans. 2001, 29, 80-85.
16. Symonds M, Mostyn A, Pearce S, [et al.]. Endocrine and nutritional regulation of fetal adipose
tissue development. J Endocrinol. 2003, 179, 293-299.
17. Pearce S, Mostyn P, Alves-Guerra M, [et al]. Prolactin, prolactin receptor and uncoupling proteins
during fetal and neonatal development. Proc Nutrr Soc. 2003, 62, 421-427.
18. Rutter N. Clinical consequences of immature barrier. Semin Neonatol. 2000, 5, 281-287.
19. Berardi A, Guidi B, Cattani S, [et al.]. Intraventricular hemorrhage in full term newborns. A case
report with a review of the literature. Ital Pediatr. 2001;27:929-932.
20. TołłoczkoJ, Kornacka M. K, Sonczyk A, Zapała Ł. Late preterm neonates-a significant neonatal
problem? Ginekol Pol. 2010, 81,693-698.
21. Lindstrom K, Winbladh B, Haglund B, [et al]. Preterm infants as a young adults: a Swedish
National Cohort Study. Pediatrics. 2007
II Katedra i Klinika Ginekologii UM w Lublinie
oraz
Stowarzyszenie na Rzecz Promocji
i Rozwoju Nauk Podstawowych oraz Klinicznych
w Ginekologii Pro Femina
organizuje warsztaty praktyczne
w zakresie operacji uroginekologicznych.
W progr ami e war s ztatów:
• zabiegi rekonstrukcyjne dna miednicy z wykorzystaniem
nowoczesnych systemów protezujących – (Prosima),
• leczenie operacyjne wysiłkowego nietrzymania moczu
– nowe zestawy operacyjne – TVT Abbrevo, TVT Exact;
• Botox w leczeniu OAB.
Zapewniamy czynny udział w przeprowadzanych w czasie kursu
zabiegach operacyjnych – planowana liczba zabiegów podczas
warsztatów 8-10.
Czas trwania warsztatów 9.00-18.00. Ilość uczestników ograniczona.
Te r m i n y w a r s z t a t ó w :
25. 02. 2011 r.,
18. 03. 2011 r.,
15. 04. 2011 r.,
13. 05. 2011 r.,
10. 06. 2011 r.
Koszt uczestnictwa 800 PLN (zapewniamy lunch podczas trwania kursu).
Uczestnicy otrzymują certyfikat oraz 8 punktów edukacyjnych.
Zgłoszenia z przedpłatą w wysokości 300 PLN przyjmuje sekretariat
Stowarzyszenia Pro Femina
tel. 81-7244688 fax. 81-7244849
Dokładne dane do faktury proszę przesyłać na
e-mail: [email protected] lub na nr faxu 81-7244849
Stowarzyszenie na Rzecz Promocji i Rozwoju Nauk Podstawowych
oraz Klinicznych w Ginekologii Pro Femina,
nr konta bankowego: 13 1930 1709 2001 0021 2894 0001
Szczegółowych informacji udziela dr n. med. Paweł Miotła
604 79 39 02
© Polskie Towarzystwo Ginekologiczne
125
Ginekol Pol. 2011, 82, 126-132
P R A C E
P O G L Ñ D O W E
po∏o ˝ n i ctwo
Nieinwazyjne badania prenatalne
w diagnostyce aneuploidii chromosmów
13, 18 i 21 – aspekty teoretyczne i praktyczne
Non-invasive prenatal test in the diagnosis of aneuploidy
13, 18 and 21 – theoretical and practical aspects
Stembalska Agnieszka1, Łaczmańska Izabela1, Dudarewicz Lech2
1
2
Katedra i Zakład Genetyki, Akademia Medyczna we Wrocławiu. Polska
Zakład Genetyki Instytutu Centrum Zdrowia Matki Polki w Łodzi, Polska
Streszczenie
Częstość występowania liczbowych aberracji chromosomowych wynosi w trakcie trwania całej ciąży ok. 5%,
a u żywo urodzonych noworodków około 0,2%. Najczęściej stwierdzane aberracje liczbowe u żywo urodzonych to
trisomie chromosomów 13, 18, 21, X i Y oraz monosomia chromosomu X.
Szacuje się, że około 70-80% noworodków z aneuploidiami rodzonych jest przez kobiety, które nie mają wyraźnych
czynników ryzyka, dlatego według najnowszych rekomendacji PTG, diagnostyka prenatalna, zwiększająca
wykrywalność aneuploidii u płodu, powinna być proponowana całej populacji kobiet. Ze względu na ryzyko powikłań
towarzyszące badaniom inwazyjnym i dużą liczbę niepotrzebnie wykonywanych badań tego typu postuluje się, żeby
diagnostyka inwazyjna stosowana była w ściśle określonych przypadkach, natomiast diagnostyka nieinwazyjna
miała charakter przesiewowy.
Do diagnostyki nieinwazyjnej zalicza się: 1) szczegółowe badania USG wykonywane w 11-13(+6 dni) t.c. oraz
w 18-24 t.c.; 2) testy biochemiczne: test PAPP-A (test I trymestru) i test potrójny (test II trymestru) a także rzadziej
wykonywane: test podwójny, poczwórny i zintegrowany.
Wysoki wskaźnik wykrywalności aberracji chromosomowych w badaniach nieinwazyjnych (co najmniej 75%, przy
nie wyższym niż 5% ryzyku uzyskania wyników fałszywie dodatnich) i brak powikłań po ich wykonaniu stanowią
o dużej wartości nieinwazyjnej diagnostyki prenatalnej.
Słowa Kluczowe: aneuploidie / PAPP-A / testy biochemiczne /
/ prenatalna diagnostyka nieinwazyjna /
Adres korespondencyjny:
Agnieszka Stembalska
Katedra i Zakład Genetyki, Akademia Medyczna
Marcinkowskiego 1, 50-368 Wrocław, Polska
tel.: +48 71 784 12 56, fax: +48 71 784 00 63
e-mail: [email protected]
126
Otrzymano: 10.07.2010
Zaakceptowano do druku: 20.01.2011
Nr 2/2011
Ginekol Pol. 2011, 82, 126-132
P R A C E
P O G L Ñ D O W E
po∏o˝nictwo
Stembalska A, et al.
Abstract
The incidence of numerical chromosome aberrations is about 5% during the entire pregnancy, and about 0.2% in
live-born infants. Most commonly observed numerical aberrations in live births are trisomies of chromosomes 13,
18, 21, X and Y and monosomy of the X chromosome.
It is estimated that approximately 70-80% of newborns with aneuploidies are born by women who did not present
obvious risk factors, therefore, according to a recent recommendation by PTG, prenatal diagnosis increasing the
detection of fetal aneuploidy should be offered to the entire population of women. Due to the risk of complications
associated with invasive tests and a large number of unnecessarily performed tests of this type, it is postulated that
invasive diagnostics should be used in very specific cases, and a non-invasive diagnostics should have a screening
character.
Non-invasive diagnostics include: 1) detailed ultrasonography performed in 11-13(+6 days) hbd and in 18-24 hbd;
2) biochemical tests: PAPP-A (first-trimester test) and the triple test (second-trimester test) and less frequently performed: double, quadruple, and integrated tests.
High detection rate of chromosomal aberrations in non-invasive tests (at least 75%, with no more than 5% risk of
obtaining false positive results) and lack of procedure-related pregnancy losses constitute the advantage of noninvasive prenatal diagnosis.
Key words: aneuploidy / PAPP-A / maternal serum screening /
/ biochemical screening / prenatal diagnosis / non-invasive /
Wstęp
Częstość występowania liczbowych aberracji chromosomowych (w większości aneuploidii1) u żywo urodzonych noworodków wynosi około 0,2% [1]. W trakcie trwania całej ciąży
częstość ta sięga nawet 5% [2]. Aneuploidie mogą dotyczyć
wszystkich chromosomów, jednak u żywo urodzonych dzieci
stwierdzane są prawie wyłącznie trisomie chromosomów 13, 18,
21, X, Y oraz monosomia chromosomu X. Średnie ryzyko populacyjne urodzenia dziecka z trisomią 21 wynosi 1:800, trisomią
18 - 1:6000, trisomią 13 - 1:10000, trisomią chromosomów płci
1:500, monosomią chromosomu X 1:2500 dziewczynek [3, 4,
5].
Ryzyko urodzenia dziecka z aneuploidiami chromosomów
autosomalnych (13, 18, 21) wzrasta wraz z wiekiem matki (Tabela I) [5, 6]. Wiek ≥35 r.ż. stanowi w chwili obecnej w Polsce
główne wskazanie do objęcia kobiet w ciąży Programem Badań
Prenatalnych i wykonania diagnostyki prenatalnej [7]. Z roku
na rok rośnie liczba kobiet decydujących się na późne macierzyństwo, tym samym rośnie liczba kobiet kwalifikujących się
do badań prenatalnych [8]. Według danych Głównego Urzędu Statystycznego średni wiek kobiet rodzących w Polsce już
w 2010 roku będzie wynosił 29,13 lat dla miast, 28,49 dla wsi2
i wartości te wykazują dalszą tendencję wzrostową [8]. Z jednej
strony związane jest to ze świadomymi decyzjami (np. priorytet: kariera), a z drugiej strony ze zwiększonym odsetkiem par
z niepowodzeniami rozrodu (około 10-15% par w wieku rozrodczym). W tym ostatnim przypadku pojawienie się dziecka jest
często związane z długotrwałym leczeniem jednego lub obojga
partnerów [9].
Obniżenie ryzyka urodzenia dziecka z aneuploidią obserwuje się wraz z zaawansowaniem ciąży. Wiąże się to z wysokim
1
Aneuplodia – nieprawidłowa liczba chromosomów, niebędąca
krotnością podstawowej liczby n=23.
2
Wg GUS na 2009 [http://www.stat.gov.pl/cps/rde/xbcr/gus/PUBL_
prognoza_ludnosci_Pl_2008-2035.pdf
© Polskie Towarzystwo Ginekologiczne
prawdopodobieństwem samoistnych poronień ciąż z aberracją
liczbową chromosomów (ok. 70% wszystkich poronionych zarodków/płodów) [1, 5, 10]. Szacuje się, że ryzyko poronienia lub
wewnątrzmacicznego obumarcia płodu z trisomią 21 pomiędzy
12 a 40 tygodniem ciąży wynosi około 30%, z trisomią 13 lub
18 oraz z monosomią chromosomu X – ponad 80% [5]. Wraz
z wysokością ciąży nie zmienia się natomiast ryzyko wystąpienia
trisomii chromosomów płciowych, dla których ryzyko samoistnego zakończenia ciąży nie jest wyższe niż populacyjne [5].
Pełna diagnostyka aberracji chromosomowych w okresie
przedurodzeniowym opiera się na badaniach prenatalnych inwazyjnych takich, jak biopsja trofoblastu (11-14 t.c.), amniopunkcja (15-19 t.c., niekiedy później) lub kordocenteza (po 19 t.c.)
z następującym po pobraniu materiału płodowego klasycznym
badaniem cytogenetycznym (ocena kariotypu) [11]. W zależności od wskazań, diagnostyka poszerzana jest o techniki molekularne, których atutem jest krótki czas oczekiwania na wynik.
W przypadku stosowania mikromacierzy można uzyskać również wyższą rozdzielczość i możliwość wykrywania zespołów
uwarunkowanych mikroaberracjami i innymi zmianami niewidocznymi w klasycznych badaniach [12]. Dotychczas stosowane wskazania do inwazyjnych badań prentalanych, związane ze
zwiększonym ryzykiem wystąpienia aneuploidii u płodu przedstawiono w tabeli II.
Diagnostyka inwazyjna, zważywszy na fakt analizowania
bezpośrednio materiału genetycznego (chromosomów) płodu,
pozwala niemal3 w 100% potwierdzić lub wykluczyć liczbową
aberrację chromosomową. Ze względu jednak na ryzyko powikłań (m.in. poronienie) towarzyszące badaniom inwazyjnym
i dużą liczbę niepotrzebnie wykonywanych tego typu badań postuluje się, żeby diagnostyka inwazyjna stosowana była w ściśle
określonych przypadkach [7].
3
Wyjątkiem mogą być postacie mozaikowe danego zespołu
(co najmniej 2 linie komórkowe: prawidłowa i nieprawidłowa),
w których liczba komórek nieprawidłowych jest niewielka.
127
P R A C E
Ginekol Pol. 2011, 82, 126-132
P O G L Ñ D O W E
po∏o˝n i c t w o
Nieinwazyjne badania prenatalne w diagnostyce aneuploidii chromosmów 13, 18 i 21...
Zgodnie z danymi Polskiego Towarzystwa Ginekologicznego (PTG) np. sam wiek kobiety (>35 r.ż.) wydaje się być słabym czynnikiem prognostycznym dla oceny ryzyka wystąpienia aneuploidii chromosomów 13, 18 i 21, tym samym nie jest
wystarczającym wskazaniem do wykonania inwazyjnych badań
prenatalnych [7, 13]. Skoro, jak się szacuje, około 70-80% noworodków z aneuploidiami rodzonych jest przez kobiety, które
nie mają wyraźnych czynników ryzyka, diagnostyka prenatalna
zwiększająca wykrywalność aneuploidii u płodu powinna być
proponowana całej populacji kobiet [14, 15].
Według najnowszych rekomendacji Polskiego Towarzystwa
Ginekologicznego opublikowanych w Ginekologii Polskiej 2009
(PTG 2009) wskazane jest wykonywanie u wszystkich ciężarnych pacjentek nieinwazyjnych badań prenatalnych i dążenie do
nadania im charakteru badań przesiewowych [7, 16].
Przesiewowa diagnostyka prenatalna (badania prenatalne
nieinwazyjne), stosowana dla oceny ryzyka wystąpienia aneuploidii chromosomów 13, 18 i 21, polega na analizie określonych parametrów płodu przy użyciu badania USG oraz na
oznaczeniu określonych markerów biochemicznych w surowicy
kobiety ciężarnej. Jest to diagnostyka, która nie niesie ze sobą
żadnego ryzyka powikłań ani dla matki, ani dla płodu. Zgodnie
z rekomendacjami PTG 2009, które odpowiadają standardom
światowym, badania nieinwazyjne powinny charakteryzować
się wysoką wykrywalnością aberracji chromosomowych – co
najmniej 75%, przy nie wyższym niż 5% ryzyku uzyskania wyników fałszywie dodatnich [7, 13]. Wykonując badania nieinwazyjne należy zapewnić zarówno wysoką jakość udzielanych
porad medycznych, jak i jakość badań (certyfikowane metody
oznaczeń biochemicznych, programy komputerowe). Powinno
być to osiągnięte dzięki odpowiednim szkoleniom, certyfikatom
i corocznym audytom [7]. Komputerowa ocena ryzyka aberracji chromosomowych wiąże się z otrzymaniem statystycznego
wyniku badania, np. 1:100, tj. istnieje prawdopodobieństwo, że
jedna na 100 kobiet z takimi samymi wynikami urodzi dziecko
z aberracją, 99 kobiet urodzi dzieci bez aberracji będącej celem
skriningu. Badania przesiewowe nie pozwalają na 100% wykluczenie aneuploidii u płodu, ale też w 100% jej nie potwierdzają.
Wynika to zarówno z określonego współczynnika wykrywalności, jak i możliwości uzyskania wyników fałszywie dodatnich
i ujemnych. Zgodnie z rekomendacjami PTG 2009 przyjęto, że
nieprawidłowe wyniki badań (wynik dodatni - ryzyko równe lub
wyższe niż 1:300) mówią o podwyższonym prawdopodobieństwie wystąpienia aneuploidii u płodu i stanowią wskazanie do
wykonania inwazyjnej diagnostyki prenatalnej [7]. Wyniki ujemne (ryzko niższe niż 1:300) mówią o niższym, niż ryzyko powikłań po badaniach inwazyjnych, ryzyku wystąpienia aneuploidii
u płodu. Otrzymanie ujemnego wyniku badań przesiewowych,
przy braku innych wskazań, pozwala na rezygację z inwazyjnej
diagnostyki prenatalnej [7].
Badanie ultrasonograficzne
Zgodnie z rekomendacjami PTG 2009 pierwsze, szczegółowe badanie ultrasonograficzne powinno być wykonywane rutynowo w 11-13(+6 dni) t.c. Badanie to umożliwia ocenę ryzyka
wystąpienia aberracji chromosomowych u płodu poprzez analizę
takich parametrów, jak:
1) przezierność karkowa (NT – nuchal translucency)
mierzona w odniesieniu do długości ciemieniowo-
128
Tabela I. Związek między wiekiem matki a ryzykiem wystąpienia aneuploidii
u płodu wg [30, 31].
siedzeniowej płodu (CRL – crown-rump length),
2) obecność lub brak prawidłowego skostnienia kości
nosowych (NB – nasal bone), czy
3) charakterystyka widma przepływu w przewodzie żylnym
i na zastawce trójdzielnej,
4) pomiar kąta czołowo-szczękowego [5, 16,17].
Nowoczesne aparaty USG na tym etapie zaawansowania
ciąży umożliwiają w rękach eksperta również ocenę anatomii
płodu i wykrycie np. znacznej części poważnych wad rozwojowych, jak niektóre wady serca. Oprócz wymienionych powyżej
markerów ultrasonograficznych, większość strukturalnych anomalii płodu stwierdzanych w obrazie USG wiąże się ze znacznym wzrostem ryzyka anueploidii, stanowi więc wskazanie do
badania kariotypu płodu, nawet jeżeli wady obserwowane są
jako izolowane, przy prawidłowym NT i innych markerach aneuploidii. Badanie ultrasonograficzne w 11-13(+6 dni) t.c. musi
być połączone z komputerową oceną ryzyka wystąpienia aberracji chromosomowych, uwzględniającą oprócz obrazu USG, również wiek pacjentki oraz ewentualne obciążenia wywiadu położniczego. Rekomendowane przez PTG i zalecane przez Fundację
Medycyny Płodowej (FMF – Fetal Medicine Foundation) metody oznaczeń biochemicznych oparte powinny być o technologię
Delfia lub Kryptor [18, 19].
Zgodnie z rekomendacjami PTG i zasadami FMF, USG
powinno być przeprowadzone przez lekarzy posiadających certyfikat PTG i FMF, a wykonywane przez nich badania należy
poddawać okresowej kontroli jakości [7, 19].
Kolejne prenatalne badanie USG (szczegółowe, genetyczne), zgodnie z rekomendacjami PTG 2009 zalecane jest w 1824 tygodniu ciąży [7, 17]. Umożliwia ono dalszą ocenę rozwoju
płodu i rozpoznanie/wykluczenie wrodzonych wad, jak wady
serca, układu kostnego, o.u.n, przewodu pokarmowego, twarzoczaszki i in. [5, 17].
Niektóre z w/w. wad mogą być składową aberracji chromosomowych. W związku z tym wynik badania USG w 18-24 t.c.
może modyfikować ryzyko wystąpienia aneuplodii u płodu obliczone na podstawie wyników badania USG w 11-13(+6 dni)
t.c. i badań przesiewowych. Podobnie jak przy badaniu w pierwszym trymetrze ciąży, w przypadku podejrzenia wad u płodu należy rozważyć diagnonstykę inwazyjną.
Nieliczne wady rozwojowe nie stanowią wskazania do badania kariotypu płodu, m.in.: wytrzewienie, izomeryzm, izolowana nerka torbielowata dysplastyczna.
Nr 2/2011
Ginekol Pol. 2011, 82, 126-132
P R A C E
P O G L Ñ D O W E
po∏o˝nictwo
Stembalska A, et al.
Testy biochemiczne
Testy biochemiczne pozwalają na określenie ryzyka wystąpienia u płodu m.in. trisomii 21, 13 i 18, monosomii X a także
triploidii i otwartych wad cewy nerwowej, poprzez pomiar w surowicy kobiety ciężarnej stężenia określonych markerów biochemicznych [13]. Otrzymane wyniki przeliczane są na wartości
MoM, czyli wielokrotność mediany (MoM – Multiples of the
Median), która jest wartością względną, umożliwiającą porównywanie otrzymanych stężeń badanych parametrów określanych
za pomocą różnych metod analitycznych, w różnych tygodniach
ciąży. MoM uzyskuje się dzieląc wartość stężenia badanego parametru przez medianę (wartość środkową) dla danego tygodnia
ciąży. Ze względu na różnice populacyjne aby określić mediany
dla poszczególnych tygodni ciąży należy przebadać w danym
laboratorium, przy użyciu jednej metody oznaczeń biochemicznych, określoną grupę (co najmniej 100) kobiet w danym tygodniu ciąży, z danej populacji. Na stężenia badanych parametrów
mogą mieć wpływ np.: stosowana metoda analityczna, masa
ciała ciężarnej, palenie papierosów, cukrzyca typu 1, zapłodnienie in vitro. Niedokonanie korekcji wyników pod kątem wpływu w/w czynników może powodować wzrost liczby wyników
fałszywie dodatnich lub ujemnych [14]. W związku z tym do
kalkulacji ryzyka wystąpienia aberracji chromosomów wykorzystywane powinny być wspomniane już specjalistyczne programy
komputerowe (standardy FMF i rekomendacje PTG). Błędem
w sztuce jest analizowanie osobno każdej ze składowych testów
biochemicznych i na tej podstwie określanie ryzyka wystąpienia
aneuploidii u płodu.
Należy również pamiętać, że niektóre leki z grupy antybiotyków, leków antywirusowych, antydepresantów, immunosupresantów, leków na astmę, leków hormonalnych też mogą wpływać
na wyniki testów biochemicznych zwiększając liczbę wyników
fałszywie dodatnich [20].
Do najczęściej zalecanych i wykonywanych testów biochemicznych należą test PAPP-A (test I trymestru) i test potrójny
(test II trymestru).
Test PAPP-A polega na ocenie w 11-13(+6 dni) t.c. w surowicy kobiety ciężarnej stężenia ciążowego białka A (pregnancy
-associated plasma protein A) oraz wolnej podjednostki β-hCG
(human chronic gonadotropin) wraz z pomiarem NT w badaniu
USG przy CRL pomiędzy 45 a 84mm [16].
Test ten polecany jest wszystkim kobietom w ciąży ze
względu na wczesny czas wykonywania oraz wysoką wykrywalność aberracji liczbowych chromosomów 21, 13 i 18. Wykrywalność aberracji chromosomowych w teście PAPP-A określana
jest na 90% dla trisomii 21 przy 5% odsetku wyników fałszywie
dodatnich [13, 16]. Dla trisomii 18 i 13 wykrywalność wynosi
ponad 91% przy 2 do 5% wyników fałszywie dodatnich [21, 22].
Wykrywalność 90% oznacza, że badanie wykrywa 9 na 10 przypadków trisomii. Zastosowanie dodatkowych, wymienionych
powyżej ultrasonograficznych markerów aneuploidii dodatkowo
zwiększa czułość i swoistość diagnostyki.
• Białko PAPP-A (pregnancy associated plasma protein
A) ulega ekspresji m.in. w pęcherzyku jajnikowym, płynie pęcherzykowym, komórkach ciałka żołtego. Poziom
stężenia białka PAPPA w surowicy kobiety ciężarnej
wzrasta eksponencjalnie podczas trwania ciąży. Charakterystyczna zmiana w stężeniu widoczna jest między 10
a 14 tygodniem ciąży i ten czas uznawany jest za naj-
© Polskie Towarzystwo Ginekologiczne
lepszy do przeprowadzenia badań. Niski poziom białka
PAPPA w surowicy ciężarnej w pierwszym trymestrze
ciąży (średnio około 0,5 MoM w przypadku trisomii 21
u płodu) jest związany z występowaniem aberracji chromosomowych u płodu (OMIM 176385) [23]. Pomiar stężenia PAPP-A nie jest stosowany jako samodzielny test
przesiewowy w kierunku aneuploidii płodu.
• Wolna podjednostka β-hCG –gonadotropiny kosmówkowej (free beta chronic gonadotropin, beta chain; CGB).
Gonadotropina kosmówkowa jest glikoproteiną, hormonem produkowanym przez komórki trofoblastu począwszy od 10-12 dnia po zapłodnieniu. Hormon ten przyłącza
się do ciałka żółtego jajnika i stymuluje je do produkcji
progesteronu (OMIM 118860) [23]. Stężenie wolnej podjednostki β-hCG po początkowym wzroście, obniża się
między 10 a 20 tygodniem ciąży. Podwyższony, lub obniżony poziom wolnej podjednostki β-hCG w surowicy
ciężarnej w pierwszym trymestrze ciąży (średnio w trisomii 21 około 2 MoM) jest związany z występowaniem
aberracji chromosomowych u płodu [16].
Wysoka czułość testu PAPP-A i wczesny czas wykonywania
badania przemawiają za tym, by właśnie to badanie było polecane jako przesiewowe, niezależnie od wieku kobiet w ciąży.
Niemniej należy pamiętać, że nieprawidłowe wyniki testu PAPP
-A można otrzymać w innych przypadkach niż aneuploidie chromosomów 13, 18 i 21. Na przykład pogrubienie przezierności
karkowej może występować w przypadku wielu wad rozwojowych i zespołów uwarunkowanych genetycznie, również spowodowanych innymi przyczynami, niż aberracje chromosomowe.
Należą do nich np. zespół Noonan, SMA (rdzeniowy zanik mięśni), inne wrodzone miopatie i inne przyczyny sekwencji akinezji
płodu, dysplazje kostne, zwłaszcza letalne, anemia płodu m.in.
na tle genetycznym, infekcyjnym, zespół Beckwith-Wiedemanna, zespół Smitha-Lemlego-Opitza, wady układu krążenia i klatki piersiowej oraz przepony.
Dodatni wynik testu biochemicznego można uzyskać także
w przypadku zaburzeń funkcji łożyska, np. w ciążach powikłanych w późniejszym czasie stanem przedrzucawkowym, cukrzycą ciężarnych czy nadciśnieniem tętnicznym [24]. W związku
z tym wykluczeniu aberracji liczbowych w badaniach inwazyjnych powinna towarzyszyć bezwzględnie dalsza szczegółowa
diagnostyka ultrasonograficzna i położnicza [7].
Testy biochemiczne drugiego trymestru
Test potrójny polega na ocenie stężenia wolnej podjednostki beta gonadotropiny kosmówkowej (chociaż stosowane są również inne izoformy hCG, np. całkowita hCG), α-fetoproteiny oraz
wolnego estriolu uE3 w surowicy kobiety ciężarnej optymalnie
w 15-17 t.c. Na podstawie powyższych danych, uzupełnionych
o wiek kobiety ciężarnej i inne parametry modyfikujące (masa
ciała, palenie tytoniu itp.) obliczane jest ryzyko trisomii 18, 21
oraz otwartej wady cewy nerwowej płodu. Nieprawidłowe wyniki testu potrójnego stwierdza się oprócz wyżej wymienionych
także w przypadkach monosomii chromosomu X, triploidii, wad
powłok brzusznych płodu.
Czułość testu potrójnego szacuje się na 60-70 % dla trisomii
21 oraz ok. 80% dla wad cewy nerwowej i wad powłok brzusznych. Otrzymanie dodatniego wyniku badania (zwiększone ryzyko wystąpienia aneuploidii lub w/w wad u płodu) jest wskazaniem
129
P R A C E
Ginekol Pol. 2011, 82, 126-132
P O G L Ñ D O W E
po∏o˝n i c t w o
Nieinwazyjne badania prenatalne w diagnostyce aneuploidii chromosmów 13, 18 i 21...
do wykonania inwazyjnych badań prenatalnych lub/i szczegółowych badań ultrasonograficznych, na podstawie których można
dokonać dalszej modyfikacji ryzyka choroby płodu.
Test nie jest polecany dla pacjentek z zaawansowanym wiekiem metrykalnym, tj. po 42 r.ż. (wysokie prawdopodobieństwo
wyniku fałszywie dodatniego ze względu na wysokie ryzyko
a piori) [17]:
• α-fetoproteina (AFP) – jest białkiem osocza, wytwarzanym przez płód we wczesnym okresie ciąży. Produkowana jest przez wątrobę i pęcherzyk żółtkowy
(OMIM 104150) [24]. Stężenie AFP wzrasta w surowicy
kobiety w sposób ciągły w czasie ciąży (w płynie owodniowym rośnie między 10. a 14. tygodniem, a następnie maleje). Obniżone stężenie AFP w surowicy (<0,5
MoM) stwierdzane jest w przypadkach aneuploidii
chromosomów. Podwyższone stężenie AFP bez zmiany pozostałych parametrów testu może występować
w przypadku: wad cewy nerwowej płodu, wad powłok
brzusznych płodu, śmierci płodu, ciąży bliźniaczej.
U ok. 2% zdrowych kobiet ocena poziomu AFP w surowicy wykazuje wartości podwyższone. Podwyższony
poziom AFP w surowicy ciężarnej jest wskazaniem do
oznaczenia w płynie owodniowym acetylocholinesterazy (AchE), AFP oraz wykonania szczegółowego badania
USG w kolejnych tygodniach ciąży [17, 25].
• β-hCG – opis jak wyżej.
• wolny estriol E3 (uE3) - jest to hormon wytwarzany
w procesach metabolicznych płodu w wątrobie i nadnerczach a także łożysku. W surowicy kobiety ciężarnej
poziom uE3 wzrasta w czasie ciąży [23]. Znamienne
obniżenie wolnego estriolu stwierdza się w przypadku
jednej z częstszych chorób uwarunkowanych genetycznie w polskiej populacji jaką jest zespół Smitha-Lemlego
-Opitza - SLOS (OMIM 270400). Przyczyną tej choroby są mutacje genu DHCR7 (MIM 602858) kodującego
reduktazę 7-dehydrocholesterolu, prowadzące do braku
lub znaczącego obniżenia aktywności tego enzymu [23].
Brak enzymu powoduje zablokowanie szlaku metabolicznego, obniżenie stężenia cholesterolu, który bierze
udział w procesie embriogenezy przez udział w szlaku
sygnałowym Sonic hedgehog, co w rezultacie prowadzi
do wad rozwojowych i zaburzeń rozwoju psychoruchowego. W teście potrójnym stwierdza się znacznie obniżone stężenie niezwiązanego estriolu w surowicy krwi
matki (<0,15 MoM), gdyż estriol, jako hormon steroidowy jest produktem przemian cholesterolu i ulega znaczącemu obniżeniu w przypadku zespołu SLO u płodu.
Obniżenie wolnego estriolu w surowicy krwi matki
występuje również w przypadku niedoboru sulfatazy
steroidowej u płodu, powodującej objawy rybiej łuski
u dziecka po urodzeniu. W odróżnieniu od zespołu SLO,
nie ma jednak zgodności co do znaczenia prenatalnego
stwierdzenia tej choroby u płodu [26].
Opisano kilka innych niedoborów enzymatycznych na
drodze przemiany cholesterolu, które mogą prowadzić do
wad rozwojowych u płodu i obniżonego stężenia wolnego estriolu w teście potrójnym, ale są to choroby wielokrotnie rzadsze od zespołu SLO i niedoboru sulfatazy
steroidowej.
130
Tabela II. Wskazania do wykonania diagnostyki prenatalnej inwazyjnej –
podejrzenie wystąpienia aneuploidii u płodu wg zasad realizacji Programu Badań
Prenatalnych 2009 [32] .
Rzadziej wykonywane są testy: podwójny, poczwórny
i zintegrowany.
Test podwójny polega na ocenie w surowicy krwi ciężarnej
stężenia jednej z izoform hCG oraz α-fetoproteiny bez wolnego
estriolu. Test wykonywany jest w II trymetrze ciąży, ma nieco
niższą czułość niż test potrójny [27].
Test poczwórny polega na ocenie w surowicy ciężarnej
stężenia jednej z izoform hCG, α-fetoproteiny, wolnego estriolu
E3 oraz inhibiny A. Test wykonywany jest jako test II trymestru
ciąży. Jego współczynnik wykrywalności jest o ok. 3-6% wyższy niż testu potrójnego, dodatkowo liczba wyników fałszywie
dodatnich jest niższa o ok. 0,9-2% w porównaniu do testu potrójnego.
• hCG, AFP i uE3 – jak wyżej.
• inhibina A – glikoproteina, hormon wytwarzany w łożysku i gonadach, składa się z dwóch podjednostek (OMIM
147380) [23]. Jej stężenie zwiększa się w przypadkach
wystąpienia trisomii 21 u płodu.
Testem łączącym zalety testu I i II trymestru jest test zintegrowany oraz jego modyfikacje.
Test zintegrowany [11-13(+6 dni) t.c.i 15-19 t.c.] polega
on na różnoczasowym wykonaniu zarówno pomiaru przezierności karkowej płodu, testu PAPP-A, jak i testu poczwórnego lub
potrójnego oraz łącznym opracowaniu obu testów przez odpowiedni program komputerowy. Zwiększa to czułość i swoistość
testu, niemniej odwleka w czasie podjęcie ewentualnej decyzji
o diagnostyce inwazyjnej, ze względu na dokonywanie kalkulacji ryzyka dopiero w II trymestrze, po pobraniu krwi na test potrójny lub poczwórny [28]. W przypadku pacjentek ze znacznie
podwyższonym ryzykiem aneuploidii płodu w oparciu o parametry z pierwszego trymestru (np. pogrubienie NT) wątpliwości
etyczne budzi odwlekanie diagnostyki do momentu otrzymania
wyników testu biochemicznego drugiego trymestru. Z tego powodu test zintegrowany nie jest już wykonywany. Jego aktualnie
stosowaną modyfikacją jest skrining kontyngentowy. Polega ona
na wykonaniu testu PAPP-A z pomiarem NT (w zależności od
kompetencji ultrasonografisty uzupełnionego ewentualnie o inne
markery aneuploidii płodu w I trymestrze ciąży) i określeniu
dwóch wartości odcięcia, określających trzy rodzaje wyników:
– niskiego ryzyka, przy którym dalszy skrining nie jest
zalecany (typowo ryzyko trisomii 21 poniżej 1:1500),
– wysokiego ryzyka, przy którym zalecana jest diagnostyka
Nr 2/2011
Ginekol Pol. 2011, 82, 126-132
P R A C E
P O G L Ñ D O W E
po∏o˝nictwo
Stembalska A, et al.
inwazyjna (typowo ryzyko trisomii 21 powyżej 1:50),
– pośredniego ryzyka, przy którym zalecane jest wykonanie
testu poczwórnego lub potrójnego i kalkulacja ryzyka
w oparciu łącznie o parametry pierwszego i drugiego
trymestru (typowo ryzyko trisomii 21 pomiędzy 1:50
a 1:1500).
Zaletą skriningu kontyngentowego jest możliwość wcześniejszego wykonania badania inwazyjnego w przypadku stwierdzenia wysokiego ryzyka aneuploidii płodu w oparciu o wynik
badania w pierwszym trymestrze oraz niższy koszt, związany
z brakiem diagnostyki u większości pacjentek w drugim trymestrze ciąży [29].
Alternatywę dla badań biochemicznych w drugim trymestrze
ciąży jako metody modyfikacji ryzyka obliczonego w trymestrze
pierwszym stanowi badanie USG genetyczne II trymestru ciąży
z badaniem echokardiograficznym płodu.
Ograniczenia w wykonywaniu badań
nieinwazyjnych
Nieinwazyjne badania prenatalne powinny być proponowane wszystkim kobietom w ciąży i mieć charakter badań przesiewowych. Zgodnie z rekomendacjami PTG 2009 diagnostykę
taką można pominąć u kobiet po 40 r.ż., jak i kobiet świadomie
rezygnujących z badań nieinwazyjnych oraz kobiet w ciąży mnogiej. W tym ostatnim przypadku wyniki testów biochemicznych
mogą być trudne do interpretacji.
W przypadku ciąży bliźniaczej wynik uzyskiwany jest dla
obu płodów jednocześnie. Prawidłowe parametry zdrowego
płodu mogą maskować odchylenia markerów u płodu chorego.
Dla ciąż bliźniaczych czułość testów spada – np. testy
pierwszego trymestru wraz z pomiarem NT pozwalają na wykrycie około 80% przypadków zespołu Downa, a testy biochemiczne II trymestru około 50% przypadków płodów z tą aberracją
[4]. Również pomiar NT u bliźniąt monozygotycznych może
być obarczony ryzykiem błędu, ponieważ w przypadku zespołu
TTS - transfuzji pomiędzy bliźniętami (twin to twin transfusion
syndrome) rośnie wartość NT u bliźnięcia biorcy, co łączy się ze
zwiększonym odsetkiem wyników fałszywie dodatnich [16].
Nie zaleca się stosowania testów biochemicznych dla ciąż
trojaczych i liczniejszych [16].
Podsumowanie
Prenatalna diagnostyka nieinwazyjna powinna być wykonywana jako przesiewowa w przypadku każdej ciąży. Istotą proponowanych badań jest statystyczna ocena ryzyka wystąpienia
określonych nieprawidłowości u płodu, jak najczęstsze w populacji aneuploidie chromosomów 13, 18, 21.
Wysoki wskaźnik wykrywalności aberracji chromosomowych w badaniach nieinwazyjnych i brak powikłań po ich wykonaniu stanowią o dużej wartości nieinwazyjnej diagnostyki prenatalnej. Pozwala ona uniknąć niepotrzebnie wykonywanej diagnostyki inwazyjnej, np. w przypadkach związanych wyłącznie
z wiekiem kobiet. Istotnym aspektem badań prenatalnych, w tym
nieinwazyjnej diagnostyki, jest poradnictwo. Powinno mieć ono
charakter porady niedyrektywnej. Lekarz powinien skupiać się
na prawidłowej interpretacji otrzymanych wyników, możliwościach i ograniczeniach stosowanych metod.
Warunkiem prawidłowej interpretacji badań nieinwazyjnych
jest ich prawidłowe wykonanie. Dotyczy to zarówno sprzętu,
jak i odpowiednio przygotowanego, przeszkolonego personelu
(ginekolog, genetyk kliniczny, diagnosta laboratoryjny). Po wykonaniu badań nieinwazyjnych w każdym przypadku indywidualnie należy rozważyć wskazania do dalszej diagnostyki, przede
wszystkim do inwazyjnej diagnostyki prenatalnej.
Wskazania do inwazyjnego badania prenatalnego powinny
mieć charakter medyczny. Zważywszy na możliwość powikłań
po badaniu inwazyjnym wskazania do ich wykonania powinny
być związane z większym w tym przypadku ryzykiem wystąpienia aneuploidii u płodu, niż ryzyko powikłań po badaniu.
W rzadkich przypadkach diagnostykę inwazyjną rozważa się
z powodu wysokiego niepokoju kobiety w ciąży (np. świadoma
rezygnacja z etapu badań przesiewowych). W każdej z powyższych sytuacji kobieta powinna być poinformowana o możliwościach diagnostycznych i ograniczeniach badania prenatalnego.
Ośrodki zajmujące się diagnostyką prenatalną muszą dodatkowo zapewnić pacjentkom kompleksową opiekę medyczną,
w tym specjalistyczne poradnictwo, uwzględniającą świadomą
wolę pacjentki na każdym z etapów.
P i ś mi e nni c two
1. Wang JC. Autosomal aneuploidy. in: The principles of clinical cytogenetics. second ed., Eds.
Gersen S, Keagle M. New Jersey: Humana Press, Totowa. 2005, 133-164.
2. Hassold T, Hall H, Hunt P. The origin of human aneuploidy: where we have been, where we are
going. Hum Mol Genet. 2007,16, 203-208.
3. Sutton E, McInerney-Leo A, Bondy C, [et al.]. Turner syndrome: four challenges across the
lifespan. Am J Med Genet A. 2005, 139A, 57-66.
4. Driscoll D, Gross S. Clinical practice. Prenatal screening for aneuploidy. N Engl J Med. 2009,
360, 2556-2562.
5. Nicolaides K, Węgrzyn P. Badanie ultrasonograficzne między 11-13(+6 dni) tygodniem ciąży.
2004. http://www.fetalmedicine.com/fmf/FMF-polish.pdf
6. Morton N, Jacobs P, Hassold T, [et al.]. Maternal age in trisomy. Ann Hum Genet. 1988, 52,
227-235.
7. Rekomendacje Polskiego Towarzystwa Ginekologicznego dotyczące postępowania w zakresie
diagnostyki prenatalnej. Ginekol Pol. 2009, 80, 390-393.
8. www.stat.gov.pl (GUS)
9. Milewski R, Jamiołkowski J, Milewska, [i wsp.]. Prognozowanie skuteczności procedury IVF ICSI/
ET – wśród pacjentek Kliniki Rozrodczości i Endokrynologii Ginekologicznej – z wykorzystaniem
sieci neuronowych. Ginekol Pol. 2009, 80, 900-906.
10. Fritz B, Hallermann C, Olert J, [et al.]. Cytogenetic analyses of culture failures by comparative
genomic hybridisation (CGH)-Re-evaluation of chromosome aberration rates in early
spontaneous abortions. Eur J Hum Genet. 2001, 9, 539-547.
11. Bocian E. Prenatalna diagnostyka cytogenetyczna chorób genetycznych. Klasyczne Metody i
zasady oceny kariotypu. Medical Science Review Genetyka. 2004, 27-33.
12. Constantinou M, Kałużewski B. Kliniczne aplikacje technik cytogenetyki molekularnej w procesie
diagnostyki prenatalnej wybranych przypadków aberracji chromosomowych. Medical Science
Review Genetyka. 2004, 34-43.
13. Eiben B, Glaubitz R. First-trimester screening: an overview. J Histochem Cytochem. 2005, 53,
281-283.
14. Perenc M, Kałużewski B. Test potrójny jako badanie przesiewowe w drugim trymestrze ciąży.
Medical Science Review Genetyka. 2004, 88-94.
15. Mazurczak T. Poradnictwo genetyczne – czym jest i jakim być powinno. Medical Science
Review Genetyka. 2004, 11-17.
16. Nicolaides K. First-trimester screening for chromosomal abnormalities. Semin Perinatol. 2005,
29, 190-194.
17. Stembalska A, Slezak R, Pesz K, [et al.]. Prenatal diagnosis-principles of diagnostic procedures
and genetic counseling. Folia Histochem Cytobiol. 2007, 45, Suppl 1, 11-16.
© Polskie Towarzystwo Ginekologiczne
131
P R A C E
Ginekol Pol. 2011, 82, 126-132
P O G L Ñ D O W E
po∏o˝n i c t w o
Nieinwazyjne badania prenatalne w diagnostyce aneuploidii chromosmów 13, 18 i 21...
K O M U N I K AT
18. Qin Q, Christiansen M, Pettersson K. Point-of-care time-resolved immunofluorometric assay
for human pregnancy-associated plasma protein A: use in first-trimester screening for Down
syndrome. Clin Chem. 2002, 48, 473-483.
19. http://www.fetalmedicine.com/fmf/ (FMF)
20. Pekarek D, Chapman V, Neely C, [et al.]. Medication effects on midtrimester maternal serum
screening. Am J Obstet Gynecol. 2009, 201, 622 e1-e5.
21. Spencer K, Spencer C, Power M, [et al.]. Screening for chromosomal abnormalities in the first
trimester using ultrasound and maternal serum biochemistry in a one-stop clinic: a review of
three years prospective experience. BJOG. 2003, 110, 281-286.
Klinika Perinatologii i Chorób Kobiecych,
UM Poznań
serdecznie zaprasza na
Konferencję:
22. Wapner R, Thom E, Simpson J, [et al.]. First Trimester Maternal Serum Biochemistry and Fetal
Nuchal Translucency Screening (BUN) Study Group. First-trimester screening for trisomies 21
and 18. N Engl J Med. 2003, 349, 1405-1413.
23. http://www.ncbi.nlm.nih.gov/omim (OMIM)
24. Spencer K, Yu K, Savvidou M, [et al.]. Prediction of pre-eclampsia by uterine artery Doppler
ultrasonography and maternal serum pregnancy-associated plasma protein-A, free beta-human
chorionic gonadotropin, activin A and inhibin A at 22 + 0 to 24 + 6 weeks’ gestation. Ultrasound
Obstet Gynecol. 2006, 27, 658-663.
25. Schell D, Drugan A, Brindley B, [et al.]. Combined ultrasonography and amniocentesis for
pregnant women with elevated serum alpha-fetoprotein. Revising the risk estimate. J Reprod
Med. 1990, 35, 543-546.
26. Schoen E, Norem C, O’Keefe J, [et al.]. Maternal serum unconjugated estriol as a predictor for
Smith-Lemli-Opitz syndrome and other fetal conditions. Obstet Gynecol. 2003, 102, 167-172.
27. Hwa H, Yen M, Lin C, [et al.]. Cost-effectiveness analysis of triple test in second-trimester
maternal serum screening for Down’s syndrome: an experience from Taiwan with decreasing
birth rate but increasing population of old pregnant women. J Eval Clin Pract. 2008, 14, 191197.
Badania molekularne
w położnictwie i ginekologii
– możliwy element strategii
klinicznej
0 8 . 0 4 . 2 0 1 1 , Po znań
28. Wald N, Watt H, Hackshaw A. Integrated screening for Down’s syndrome on the basis of tests
performed during the first and second trimesters. N Engl J Med. 1999, 1341, 461-467.
29. Malone F, Canick J, Ball R, [et al.]. First-trimester or second-trimester screening, or both,
for Down’s syndrome. First- and Second-Trimester Evaluation of Risk (FASTER) Research
Consortium. N Engl J Med. 2005, 353, 2001-2011.
–––––––––––––––––––––––––––––––––––––––––
30. Hook E. Rates of chromosomal abnormalities at different maternal ages. Obstetrics &
Gynecology. 1981, 58, 282-285.
Organizatorzy:
31. Hook E, Cross P, Schreinemachers D. Chromosomal abnormality rates at amniocentesis and in
live-born infants. JAMA. 1983, 249, 2034-2038.
Klinika Perinatologii i Chorób Kobiecych UM w Poznaniu
32. Zasady realizacji Programu Badań Prenatalnych. Załącznik nr 5 do Zarządzenia Nr 57/2009/
DSOZ Prezesa Funduszu Zdrowia z dnia 29.10.2009 - www.nfz.gov.pl
Polskie Towarzystwo Ginekologiczne
Katedra i Zakład Farmacji Klinicznej i Biofarmacji UM w Poznaniu
Fundacja na Rzecz Rozwoju Biotechnologii i Genetyki
POLBIOGEN
Polskie Towarzystwo Farmakologii Klinicznej i Terapii
Towarzystwo na Rzecz Rozwoju Badań w Perinatologii
i Ginekologii
–––––––––––––––––––––––––––––––––––––––––
Miejsce konferencji:
Budynek PAN, ul. Wieniawskiego, Poznań
08.04.2011, godz. 09:00
–––––––––––––––––––––––––––––––––––––––––
Zgłoszenia uczestnictwa oraz dalsze informacje:
Klinika Perinatologii i Chorób Kobiecych, UM Poznań
ul. Polna 33, 60-535 Poznań
tel. 61-8419-223, 61-8419-613
www.farmakologia-kliniczna.pl
Zgłoszenia prosimy nadsyłać do 15.03.2011
132
Nr 2/2011
Ginekol Pol. 2011, 82, 133-136
P R A C E
P O G L Ñ D O W E
po∏o˝nictwo
Czy płód może odczuwać ból?
Is fetus able to feel pain?
Kosińska-Kaczyńska Katarzyna, Wielgoś Mirosław
I Katedra i Klinika Położnictwa i Ginekologii Warszawskiego Uniwersytetu Medycznego,
Warszawa, Polska
Streszczenie
Na podstawie hormonalnych i hemodynamicznych reakcji płodu na bodźce bólowe, podstaw neuroanatomicznych
oraz obserwacji dzieci urodzonych przedwcześnie stwierdzono, iż płód ludzki jest zdolny do odczuwania bólu po
24. tygodniu ciąży.
Niewykluczone jednak, iż nawet we wcześniejszym okresie rozwoju płód może odczuwać ból. W obliczu
rozwijających się wewnątrzmacicznych technik diagnostycznych i terapeutycznych, nowym wyzwaniem staje się
nie tylko anestezja, lecz również odpowiednia analgezja płodu.
Artykuł prezentuje historię badań nad nocycepcją płodu oraz implikacje, jakie niosą one dla współczesnej
medycyny.
Słowa Kluczowe: ból / nocycepcja / płód / świadomość /
Abstract
On the basis of fetal hormonal and hemodynamic responses to pain related stimuli, neuroanatomy and observations
of preterm babies, it was concluded that human fetus is able to feel pain after 24 weeks gestation.
However, it is possible that the fetus may feel pain even before that time. With the development of intrauterine
diagnostic and therapeutic procedures, it is crucial to provide fetuses undergoing painful procedures not only with
anesthesia but also analgesia.
The article presents fetal pain research history and its implications for medicine.
Key words: pain / nociception / fetus / awareness /
Adres korespondencyjny:
Katarzyna Kosińska-Kaczyńska
I Katedra i Klinika Położnictwa i Ginekologii Warszawskiego Uniwersytetu Medycznego
Pl. Starynkiewicza 1/3
02-015 Warszawa, Polska
tel. 22 502 14 30, 608087721
fax 22 502 21 57
e-mail: [email protected]
© Polskie Towarzystwo Ginekologiczne
Otrzymano: 10.10.2010
Zaakceptowano do druku: 20.01.2011
133
P R A C E
Ginekol Pol. 2011, 82, 133-136
P O G L Ñ D O W E
po∏o˝n i c t w o
Kosińska-Kaczyńska K, et al.
Fizjologiczne rekcje płodu na ból
Od kilkunastu lat w piśmiennictwie światowym toczy się
dyskusja dotycząca możliwości odczuwania bólu przez płód
ludzki.
Jako pierwsi problem ten poruszyli Giannakoulopoulos
i jego współpracownicy, który w latach 1992-93 przeprowadził
doświadczenie z udziałem płodów ludzkich w wieku od 20 do 34
tygodni ciąży, u których przeprowadzano kordocentezę lub transfuzję wewnatrzmaciczną ze wskazań medycznych. W zależności
od warunków technicznych dostęp do krążenia płodowego uzyskiwano poprzez nakłucie żyły pępowinowej w miejscu przyczepu łożyskowego pępowiny (zabiegi przezłożyskowe) bądź żyły
wewnątrz wątroby płodu (zabiegi przezowodniowe). Ponieważ
pętle pępowiny nie są unerwione czuciowo, założono iż ich punkcja jest dla płodu bodźcem obojętnym. Zabiegi przeprowadzane
drugą techniką wiązały się z nakłuciem powłok jamy brzusznej
płodu. Zaobserwowano istotnie statystyczny wzrost stężenia kortyzolu oraz β-endorfin we krwi płodów poddawanych zabiegom
przezwodniowym już od 23 tygodnia ciąży [1]. Praca ta rozpoczęła dyskusję na temat odczuwania bólu przez płód.
Przedstawiane w późniejszych latach reakcje płodu na ostre
bodźce bólowe można podzielić na hormonalne i hemodynamiczne. Porównywano stężenia kortykoliberyny (CRH) i hormonu adrenokortykotropowego (ACTH) oraz noradrenaliny
w zależności od techniki przeprowadzanej transfuzji wewnątrzmacicznej. Stężenia CRH nie różniły się między analogicznymi
grupami badanych płodów w wieku od 20 do 38 tygodni ciąży
oraz nie zmieniały się w trakcie zabiegu [2]. W grupie zabiegów
przezowodniowych zaobserwowano znaczący wzrost stężenia
noradrenaliny (od 25 tygodnia ciąży, badane płody w wieku 18
– 37 tygodni) i wyższe stężenia ACTH we krwi płodów [2, 3].
W odpowiedzi na ból noradrenalina wydzielana była wcześniej
niż kortyzol.
Poza badaniami statusu hormonalnego, opublikowano również doniesienia o hemodynamicznych reakcjach płodów na
bodźce bólowe. Centralizację krążenia zaobserwowano u płodów
poddanych nakłuciom w trakcie różnych zabiegów diagnostycznych i terapeutycznych (między innymi punkcji torbieli jajnika,
założenia drenażu pęcherzowo-owodniowego, przezowodniowych transfuzji wewnątrzmacicznych). Jako oceny oporu naczyń
mózgowych użyto wskaźnika pulsacji tętnicy środkowej mózgu
(middle cerebral artery pulsatility index – MCA PI). W przypadku płodów poddanych zabiegom przezowodniowym zaobserwowano istotne obniżenie MCA PI w porównaniu z płodami poddanymi jedynie punkcji pępowiny. Reakcja ta miała miejsce w czasie 4 minut od rozpoczęcia zabiegu i występowała już u 18‑tygodniowego płodu (badane płody miały od 18 do 36 tygodni
ciaży) [4]. Podczas transfuzji mierzono także wskaźnik pulsacji
tętnicy udowej płodu i zaobserwowano jego istotne zwiększenie
w grupie zabiegów przezowodniowych [5]. Oba doświadczenia
świadczą o redystrybucji przepływu krwi – opór w naczyniach
mózgowych spada, zwiększając przepływ w krążeniu mózgowym, natomiast opór w tętnicach kończyn wzrasta, zmniejszając
przepływ krwi w krążeniu obwodowym.
Neuroanatomia
Rozwój układu nerwowego i narządów zmysłów pozwala domniemywać, kiedy płód może nabywać zdolności do odczuwania bólu. Pierwszym piętrem układu nocyceptywnego są
134
receptory zlokalizowane w powłokach i mięśniach oraz włókna
przewodzące bodźce bólowe do rdzenia kręgowego, czyli włókna
C i A-δ neuronów zlokalizowanych zwojach rdzeniowych. Tworzą one synapsy z komórkami rogów tylnych istoty szarej rdzenia
kręgowego od 10 tygodnia ciąży. Biorą także udział w tworzeniu
łuku odruchowego na poziomie rdzenia. Pierwsze nocyreceptory
pojawiają się w skórze w okolicy ust już w 7. tygodniu życia [6].
Łączą się one z nagimi zakończeniami nerwowymi włókien C.
Unerwienie czuciowe skóry kończyn rozwija się od 11 tygodnia,
tułowia od 15, a do 20 tygodnia nocyreceptory są już zlokalizowane w całej skórze i mięśniach, ale dojrzałość osiągają dopiero około 24-28 tygodnia [7, 8]. Reakcje na dotyk pojawiają
się około 7-8 tygodnia życia, gdy dotykanie okolicy ust skutkuje
odwróceniem głowy [9]. W pełni wykształcony łuk odruchowy
rdzeniowy funkcjonuje od 19 tygodnia życia wewnątrzmacicznego [10].
Około 22 tygodnia wykształcają się drogi rdzeniowo-wzgórzowe, będące kolejnym piętrem układu odczuwania bólu. Ich
mielinizacja trwa do 29 tygodnia [11]. Pierwsze synapsy wzgórzowo-korowe powstają w 24 tygodniu życia. Drogi wzgórzowo-korowe są kluczowe dla układu nocyceptywnego. Neurony
korowe rozpoczynają migrację od strefy okołojądrowej od 8 tygodnia, jednak różnicowanie się kory czuciowej jako jednostki
strukturalnej rozpoczyna się w 17 tygodniu [12].
Połączenia wzgórzowo-korowe początkowo tworzą się pomiędzy wzgórzem a specyficznymi neuronami, które intensywnie
różnicują się pomiędzy 17 a 25 tygodniem, lecz zanikają po 30.
tygodniu w procesie apoptozy [13]. Ta strefa przejściowa neuronów (tak zwana subplate) pojawia się wcześniej w okolicy somatosensorycznej niż we wzrokowej i osiąga ponad czterokrotnie
większą grubość od kory czuciowej w mózgu płodu. Ostateczne
połączenia wzgórzowo-korowe (kora czołowa) powstają od 2930 tygodnia życia wewnątrzmacicznego, a ich mielinizacja trwa
do 37 tygodnia [11].
Od 20‑24 tygodnia pojawia się aktywność elektroencefaliczna mózgu [14]. Jest ona pierwszym dowodem integralności kory
mózgowej. Staje się ona zsynchronizowana od 26 tygodnia, a od
30 wykazuje już rytm sen-czuwanie [6].
Układ nocyceptywny płodu nie jest tylko niedojrzałą wersją odpowiadającego układu osoby dorosłej. Obszar skóry unerwiony przez jeden neuron rdzenia jest proporcjonalnie większy
u płodu niż u osoby dorosłej. Zanim dojrzeją włókna C, część
bodźców bólowych może być również transmitowana włóknami
A‑β [15]. Można wnioskować z tego, iż płód nie potrafi dokładnie lokalizować bodźca bólowego oraz wiele różnych bodźców
może wywoływać wrażenie bólu.
Układ nerwowy osób dorosłych dysponuje mechanizmami ograniczającymi przewodzenie bodźców bólowych do kory
mózgowej. Drogi zstępujące hamowania bólu (noradrenergiczne
i serotoninergiczne) rozwijają się znacznie później niż pozostałe elementy układu nocyceptywnego, prawdopodobnie już po
urodzeniu. Strukturalnie są one związane z okołowodociągową
substancją szarą w śródmózgowiu oraz jądrem szwu w rdzeniu
przedłużonym. Ich funkcjonowanie przypomina bramkę hamującą dla bodźców, osiągających wyższe piętra układu nerwowego [16]. Można wnioskować więc, iż szersze spektrum bodźców
o mniejszym nasileniu może wywoływać natężone reakcje bólowe u płodu ludzkiego [17].
Nr 2/2011
Ginekol Pol. 2011, 82, 133-136
P R A C E
P O G L Ñ D O W E
po∏o˝nictwo
Czy płód może odczuwać ból?
Reakcje na ból u dzieci urodzonych
przedwcześnie
U dzieci urodzonych w 26 tygodniu po nakłuciu skóry zaobserwowano odruch cofania [18]. Reakcja ta jest jednak jedynie
łukiem odruchowym na poziomie rdzenia kręgowego [14].
U noworodków urodzonych po 28 tygodniu zaobserwowano mimikę odpowiadającą mimice dzieci odczuwających ostry
ból oraz wzrost ciśnienia tętniczego krwi podczas intubacji bez
znieczulenia [19]. Mimika bólowa oraz zmiany fizjologiczne
w postaci wzrostu częstości rytmu serca zaobserwowano nawet
u dzieci urodzonych w 27 tygodniu ciąży [20]. Na tej podstawie
można wnioskować, iż do takich samych reakcji zdolny jest płód
w 27-28 tygodniu życia wewnątrzmacicznego. Pierwsze badania
reakcji noworodków na stres polegały na mierzeniu stężenia kortyzolu w krwi pępowinowej podczas porodów fizjologicznych
i zabiegowych [21].
Reakcje na ból w postaci wzrostu stężenia katecholamin
i kortyzolu we krwi odnotowano również u dzieci urodzonych
przedwcześnie, poddawanych operacjom kardiochirurgicznym
(ligacjom przetrwałego przewodu tętniczego) bez analgezji [22].
Mózgową reakcję na ból mierzono, analizując poziom utlenowania krwi w korze czuciowej po zastosowaniu bodźca bólowego
za pomocą spektroskopii bliskiej podczerwieni w czasie rzeczywistym u dzieci urodzonych przedwcześnie. Reakcje w postaci
zwiększenia stężenia hemoglobiny utlenowanej nad korą czuciową stwierdzono już u noworodków urodzonych w 25 tygodniu
ciąży [23].
Od którego tygodnia płód odczuwa ból?
Problem nocycepcji płodu ma ogromne znaczenie w obliczu szybkiego rozwoju technik diagnostyki i terapii wewnątrzmacicznej. Jak zauważył Mellor, zapobieganie i leczenie bólu to
jedno z podstawowych praw każdego człowieka, niezależnie od
jego wieku [24].
Początkowo noworodki i niemowlęta uznawane były za niezdolne do odczuwania bólu i poddawano je inwazyjnym zabiegom i operacjom bez analgezji. Radykalne zmiany w tym stanowisku wprowadził Kanwaljeet Anand. Jako pierwszy zastosował
pełne znieczulenie operowanych noworodków zamiast dotychczasowej sedacji.
Obecnie w piśmiennictwie światowym toczy się burzliwa
debata dotycząca granicy czasowej odczuwania bólu przez ludzkie płody. Naukowcy prezentują często radykalnie różne poglądy
na temat nocycepcji. Glover i Fisk, autorzy prac dotyczących reakcji stresowych w życiu wewnątrzmacicznym, stoją na stanowisku, iż płód ludzki może odczuwać ból już po 20 tygodniu [25].
Van de Velde twierdzi, iż płód na pewno jest zdolny do reakcji
na bodziec bólowy po 24 tygodniu, natomiast możliwe jest, iż
częściowo nabywa tej zdolności już od 16 tygodnia ciąży [26].
Nie wiadomo, czy płód ma świadomość niezbędną do pełnego
odczuwania bólu. Można jednak uznać, iż od momentu rozwoju
wszystkich potrzebnych do tego struktur, świadomość u płodu
jest możliwa po 30 bądź po 35 tygodniu [27, 28]. W związku
z tym część autorów stoi na stanowisku, iż płód może odczuwać ból dopiero po 30 tygodniu [27, 29]. Przeciwnicy tych teorii
twierdzą, iż płód nie jest świadomy w życiu wewnątrzmacicznym
i w związku z tym nie może odczuwać bólu [30, 31].
W 2007 roku Lowery zaproponował odróżnienie w przypadku
płodu świadomego odczuwania bólu od nieświadomej rejestracji
© Polskie Towarzystwo Ginekologiczne
bodźców bólowych, czyli nocycepcji [13]. Nocycepcja jest
aktywacją dróg bólowych na poziomie podkorowym bez udziału
świadomości, natomiast odczuwanie bólu wymaga świadomej
percepcji bodźca jako nieprzyjemnego.
Analgezja i anestezja płodu
Royal College of Obstetricians and Gynaecologists w 1996
roku w wytycznych, dotyczących terminacji ciąży z powodu wad
płodu, stwierdziło, iż należy uznać zdolność do odczuwania bólu
przez płód po 26 tygodniu [32]. Rok później w raporcie na temat świadomości płodu przesunięto tę granicę na 24 tygodnie,
a w 1998 roku w kolejnych wytycznych odnośnie terminacji
ciąży zalecono unikanie możliwości zadawania bólu płodom
niezależnie od wieku ciąży [33, 34]. W 2005 roku część Stanów
Zjednoczonych Ameryki, między innymi Kalifornia, Kentucky,
Nowy Jork czy Oregon, wprowadziły obowiązek informowania
kobiet, iż płód może odczuwać ból po 20 tygodniu i podczas procedur późnych terminacji ciąży należy poddać go znieczuleniu
[14]. W 2006 roku Izba Reprezentantów USA debatowała nad
Unborn Child Pain Awareness Act (Akt Dotyczący Odczuwania
Bólu przez Dzieci Nienarodzone), wystarczające poparcie uzyskał on w 2010 roku [35].
Wraz z rozwojem technik diagnostycznych i terapeutycznych rośnie liczba patologii płodu możliwych do korekcji lub
leczenia przed urodzeniem. Pierwszy płodowy zabieg chirurgiczny przeprowadzili w 1884 roku Cohnstein i Zuntz na częściowo
wyłonionych z macicy płodach owiec [36].
Obecnie wiele patologii rozpoznanych prenatalnie można
poddać terapii wewnątrzmacicznej [37, 38]. Bez względu na to,
czy płód odczuwa ból, analgezja i anestezja płodu służą również
innym ważnym celom: zapewniają zwiotczenie płodu podczas
procedur inwazyjnych, znoszą hormonalną reakcję stresową, która może pogarszać przebieg rekonwalescencji po zabiegu, a także prawdopodobnie zmniejszają negatywny wpływ interwencji
medycznych na dalszy rozwój neurobehawioralny płodu. Dla
każdej z tych procedur dyskutowane są obecnie techniki stosowania znieczulenia u płodu. Już od 20 tygodnia ciąży w mózgu
i rdzeniu kręgowym płodu znajdują się receptory μ, wydaje się
więc, iż opioidy będą skutecznymi środkami znieczulającymi dla
płodów [20].
Zabiegi diagnostyczne i terapeutyczne na płodzie mają także
wpływ na kobietę ciężarną. Znieczulenie ciężarnej i płodu podczas poszczególnych zabiegów wewnątrzmacicznych stanowi
złożony problem. Oboje pacjenci wymagać mogą różnych poziomów znieczulenia, ale jednocześnie anestezja i analgezja, której
poddana jest ciężarna, ma ogromny wpływ na płód.
W otwartej chirurgii płodu i procedurze EXIT ciężarna poddawana jest znieczuleniu ogólnemu. Gazy anestezjologiczne
przez transport łożyskowy zapewniają również anestezję płodu
[39]. Leki te mają jednak działanie nasenne, nie przeciwbólowe.
W otwartych operacjach można rozważyć podawanie płodom
opioidów domięśniowo lub dożylnie. Nie poznano jednak dotychczas farmakokinetyki wchłaniania leków stosowanych domięśniowo u płodu. W zabiegach mało inwazyjnych, jak punkcje
i zakładanie drenaży, ciągła dożylna infuzja pochodnych fentanylu u ciężarnej, oprócz miejscowego znieczulenia jej powłok
brzusznych, zapewnia odpowiedni poziom znieczulenia płodu.
Remifentanyl przechodzi przez łożysko i jest szybko metabolizowany także u płodu, co znosi ryzyko wystąpienia depresji
135
P R A C E
Ginekol Pol. 2011, 82, 133-136
P O G L Ñ D O W E
po∏o˝n i c t w o
Kosińska-Kaczyńska K, et al.
oddechowej u noworodka w przypadku konieczności wykonania
natychmiastowego cięcia cesarskiego. W przypadku wewnątrzmacicznych zabiegów chirurgii endoskopowej znieczulenie
ogólne ciężarnej nie jest konieczne, a jest obarczone zbyt dużym
ryzykiem powikłań, by stosować je jedynie dla uzyskania znieczulenia płodu . Leki analgetyczne można w części przypadków
podawać bezpośrednio do naczyń płodu [40].
Podsumowanie
Współczesna medycyna traktuje płód ludzki jako odrębnego
pacjenta. Wraz z rozwojem technik diagnostycznych i terapeutycznych oraz wzrostem liczby patologii płodu, które stają się
możliwe do leczenia wewnątrzmacicznego, problem odczuwania
przez płód bólu będzie poruszany coraz częściej.
Zagadnienie nocycepcji, bądź świadomego odczuwania
bólu przez płód ludzki, pozostaje nadal w sferze dyskusji i teorii.
Nieliczne doniesienia naukowe, pozwalające pośrednio wnioskować na ten temat, nie pozwalają jak dotychczas na jednoznaczne
określenie, czy i kiedy płód nabywa zdolności do odbioru bodźców bólowych. Dlatego też każde badanie naukowe i każdy głos,
podejmujący tą trudną dyskusję, mogą wnieść ogromny wkład
w rozwój medycyny perinatalnej w przyszłości.
15. Fitzgerald M, Butcher T, Shortland P. Developmental changes in the laminar termination of A
fibre cutaneous sensory afferents in the rat spinal cord dorsal horn. J Comp Neurol. 1994, 348,
225–233.
16. Hiller S, Zegarska Z. Rdzeń przedłużony. Most. Anatomia człowieka. Red. Bochenek A, Reicher
M. Warszawa: PZWL. 1997, 127-180.
17. Derbyshire S. Foetal pain? Best Pract Res Clin Obstet Gynaecol. 2010, 24, 647-655.
18. Andrews K, Fitzgerald M. The cutaneous withdrawal reflex in human neonates: sensitization,
receptive fields, and the effects of contralateral stimulation. Pain. 1994, 56, 95–101.
19. Craig K, Whitfield M, Grunau R, [et al.]. Pain in the preterm neonate: behavioural and physiological
indices. Pain. 1993, 53, 287-299.
20. Gibbins S, Stevens B, McGrath P, [et al.]. Comparison of pain responses in infents of different
gestational ages. Neonatology. 2007, 93, 10-18.
21. Chełmicki Z, Baumert M, Chełmicka A. Stężenie kortyzolu w surowicy krwi matki i krwi
pępowinowej w różnych sposobach zakończenia ciąży. Ginekol Pol. 1996, 67, 283-286.
22. Anand K, Sippell W, Aynsley-Green A. Randomised trial of fentanyl anaesthesia in preterm
babies undergoing surgery: effects on the stress response. Lancet. 1987, 1, 62-66.
23. Slater R, Cantarella A, Gallella S, [et al.]. Cortical Pain Responses in Human Infants. J Neurosci.
2006, 26, 3662–3666.
24. Mellor D, Diesch T, Gunn A, [et al.]. The importance of “awareness” for understanding fetal pain.
Brain Res Rev. 2005, 49, 455–471.
25. Glover V, Fisk N. Fetal pain: implications for research and practice. Br J Obstet Gynaecol. 1999,
106, 881-886.
26. Van de Velde M, Jani J, De Buck F, [et al.]. Fetal pain perception and pain management. Semin
Fetal Neonatal Med. 2006, 11, 232-236.
27. Brusseau R. Developmental perspectives: is the fetus conscious? Int Anesthesiol Clin. 2008,
46, 11-23.
28. Smith R. Fetal awareness. Obstet Gynecol Reprod Biol. 2009, 19, 115-116.
29. Benatar D, Benatar M. A pain in the fetus: toward ending confusion about fetal pain. Bioethics.
2001, 15, 57–76.
30. McCullagh P. Do fetuses feel pain? Can fetal suffering be excluded beyond reasonable doubt?
BMJ. 1997, 314, 302–303.
31. Leuning R. Fetus: discussion of pain perception. Presence of consciousness is required.
Kinderkrankenschwester. 2006, 25, 408.
32. Termination of Pregnancy for Fetal Abnormality in England, Wales and Scotland. London: RCOG
Press, 1996.
33. Fetal Awareness: Report of a Working Party. London: RCOG Press, 1997.
34. A Consideration of the Law and Ethics in relation to Late Termination of Pregnancy for Fetal
Abnormality (Report of the RCOG Ethics Committee). London: RCOG Press, 1998, 16.
35. The Unborn Child Pain Awareness Act of 2010. S. 51. Available online: http://frwebgate.access.
gpo.gov/cgi-bin/getdoc.cgi?dbnameĽ109_cong_bills&docidĽf:s51is.txt.pdf.
36. Adamson K. Current concepts: fetal surgery. N Engl J Med. 1966, 275, 204-206.
37. Mitkowska-Woźniak H, Wender-Ożegowska E, Błaszczyński M, [i wsp.]. Przepuklina przeponowa
u płodu - możliwości diagnostyczne i terapeutyczne. Ginekol Pol. 2003, 74, 227-233.
38. Parlakgumus H, Tarim E, Ezer S. Diagnostyka prenatalna potworniaka regionu krzyżowoguzicznego – dwa przypadki o różnym przebiegu. Ginekol Pol. 2009, 80, 445-448.
Piśmi en n i c t w o
1. Giannakoulopoulos X, Sepulveda W, Kourtis P, [et al.]. Fetal plasma cortisol and β-endorphin
response to intrauterine needling. Lancet. 1994, 344, 77-81.
39. Gaiser R, Kurth C. Anesthetic considerations for fetal surgery. Semin Perinatol. 1999, 23, 50714.
40. Tran K. Anesthesia for fetal surgery. Semin Fetal Neonatal Med. 2010, 15, 40-45.
2. Gitau R, Fisk N, Glover V. Human fetal and maternal corticotrophin releasing hormone responses
to acute stress. Arch Dis Child Fetal Neonatal Ed. 2004, 89, F29–F32.
3. Giannakoulopoulos X, Tiexeira J, Fisk N, [et al.]. Human fetal and maternal noradrenaline
responses to invasive procedures. Ped Res. 1999, 45, 494-499.
4. Teixeira J, Fogliani R, Giannakoulopoulos X, [et al.]. Fetal haemodynamic stress response to
invasive procedures. Lancet. 1996, 347, 624.
5. Smith R, Glover V, Fisk N. Acute increase in femoral artery resistance in response to direct
physical stimuli in the human fetus. BJOG. 2003, 110, 916–921.
6. Vanhatalo S, van Nieuwenhuizen O. Fetal pain? Brain Dev. 2000, 22, 145-150.
7. Wolf A. Development and evaluation of pain and the stress response. In: Paediatric Anaesthesia,
Principles and Practice. Eds. Bissonnette B, Dalens B. New York: McGraw-Hill. 2002, 187–
200.
8. Ismail K, Wilson M, Kilby D. Fetal pain and analgesia. Curr Obstet Gynaecol. 2000, 10, 214
-217.
9. Derbyshire S. Fetal pain: do we know enough to do the right thing? Reprod Health Matters.
2008, 16, 117-126.
10. Simons S, Tibboel D. Pain perception development and maturation. Semin Fetal Neonatal Med.
2006, 11, 227-231.
11. Fitzgerald M, Beggs S. The neurobiology of pain: developmental aspects. Neuroscientist. 2001,
7, 246–257.
12. Smith R, Gitau R, Glover V, [ et al.]. Pain and stress in human fetus. Eur J Obstet Gynecol
Reprod Biol. 2000, 92, 161-165.
13. Lowery C, Hardman M, Manning N, [et al.]. Neurodevelopmental changes of fetal pain. Semin
Perinatol. 2007, 31, 275-282.
14. Lee S, Ralston H, Drey E, [et al.]. Fetal Pain: A Systematic Multidisciplinary Review of the
Evidence. JAMA. 2005, 294, 947-954.
136
Nr 2/2011
Ginekol Pol. 2011, 82, 137-145
P R A C E
P O G L Ñ D O W E
gi n e k o l o gia
Wady wrodzone układu moczowo-płciowego
u kobiet – diagnostyka i postępowanie
Congenital anomalies of the female reproductive tract
– diagnosis and management
Rechberger Tomasz1, Kulik-Rechberger Beata2
1
2
II Katedra i Klinika Ginekologii UM w Lublinie
Zakład Propedeutyki Pediatrii UM w Lublinie
Streszczenie
W artykule podano aktualny stan wiedzy dotyczący etiologii, diagnostyki i postępowania u pacjentek z wrodzonymi
wadami układu moczowo-płciowego, będącymi wynikiem nieprawidłowego rozwoju przewodów Müllera w trakcie
rozwoju embriologicznego.
Objawy kliniczne zazwyczaj pojawiają się w czasie pokwitania i w okresie reprodukcyjnym i mogą wpływać na
potencjalną płodność kobiety. W diagnostyce pierwszoplanową rolę odgrywają techniki obrazowe takie jak
histerosalpingografia, ultrasonografia i rezonans magnetyczny. Klasyfikacja tych nieprawidłowości rozwojowych
umożliwia podjęcie odpowiednich działań terapeutycznych pozwalających na uzyskanie optymalnych wyników.
Zawsze jednak podejście powinno być zależne od indywidualnej sytuacji klinicznej.
Słowa Kluczowe: zaburzenia Müllerowskie / uklad moczowo-płciowy /
/ diagnostyka / leczenie /
Abstract
The aim of this review was to discuss the putative etiology of Müllerian duct anomalies and to present the current
diagnostic strategy and therapy.
Congenital defects of the female reproductive tract result from failure in the proper embryological development
and fusion of the Müllerian ducts. Their causative factors are not fully understood yet. Clinical symptoms, if any,
appear usually during adolescence or early adulthood, and in some cases might affect the reproductive outcome.
Imaging techniques such as hysterosalpingography, ultrasonography and magnetic resonance are mainstay for
the diagnosis. The classification system of these anomalies facilitates the decision about therapy and prognosis,
however individual approach in every case is strongly recommended.
Key words: Müllerian abnormalities / diagnosis / disease management / therapy /
Adres korespondencyjny:
Tomasz Rechberger
II Katedra i Klinika Ginekologii UM
20-054 Lublin, ul. Jaczewskiego 8, Polska
tel. +48 81 7244268; fax. +48 81 7244849
e-mail: [email protected]
© Polskie Towarzystwo Ginekologiczne
Otrzymano: 15.11.2010
Zaakceptowano do druku: 21.01.2011
137
P R A C E
Ginekol Pol. 2011, 82, 137-145
P O G L Ñ D O W E
gineko l o gi a
Rechberger T, et al.
Nieprawidłowości müllerowskie spowodowane są niewłaściwym tworzeniem, brakiem zupełnej fuzji lub też zatrzymanym
rozwojem przewodów śródnerczowych, z których to struktur,
w czasie embriogenezy, powstają żeńskie wewnętrzne narządy
płciowe. Zdecydowana większość nieprawidłowości rozwojowych przewodów Műllera to zaburzenia sporadyczne bez tendencji do dziedziczenia rodzinnego, jakkolwiek w badaniach brano
pod uwagę cały szereg potencjalnych czynników sprawczych:
niedostateczna produkcja hormonu antymillerowskiego w obrębie płodowych gonad, brak ekspresji receptorów estrogenowych
w obrębie przewodów Müllera, czy też zaburzony proces apoptozy spowodowany mutacją genu Bcl2 [1].
Rozwój embriologiczny
W rozwoju embriologicznym przewody Müllera powstają bocznie do przewodów Wolffa. W przypadku braku supresji
ich rozwoju spowodowanej aktywnością genu SRY sprzężonego
z płcią męską, przewody Műllera rozwijają się i kanalizują, co
powoduje powstanie bocznych części jajowodów. Z kolei ich zespolenie w części środkowej daje w rezultacie pojedynczą jamę
macicy oraz szyjkę [2, 3, 4]. Nie do końca natomiast poznane
jest embriologiczne pochodzenie pochwy. Najprawdopodobniej
narząd ten powstaje również z przewodów Müllera w miejscu
ich połączenia z zatoką moczowo-płciową. Występowanie złożonych zaburzeń rozwojowych wykazuje jednak, że pochwa nie
jest najprawdopodobniej wynikiem połączenie jedynie przewodów Müllera. Badania eksperymentalne na zwierzętach wskazują, że niekompletna regresja przewodów Wolffa może również
odpowiadać za częściowe formowanie tkanek pochwy.
Pierwszą kliniczną klasyfikację zaburzeń rozwojowych
przewodów Müllera, sporządzoną w oparciu o stwierdzane wady,
opublikowano w roku 1979 [5].
Klasyfikacja ta została w latach późniejszych zmodyfikowana przez Amerykańskie Towarzystwo Płodności, które podzieliło nieprawidłowości na 7 podtypów klinicznych [6]: Typ I – Dysgenezje i hipoplazje przewodów Müllera:
A. Pochwa.
B. Szyjka macicy.
C. Trzon macicy.
D. Jajowody.
E. Zaburzenia mieszane.
Typ II – Nieprawidłowości jednostronne:
A. Róg szczątkowy połączony z macicą.
B. Róg szczątkowy niepołączony z macicą.
C. Róg szczątkowy bez funkcjonalnego
endometrium.
D. Macica jednorożna.
Typ III – Macica podwójna.
Typ IV – Macica dwurożna:
A. Całkowita przegroda sięgająca do ujścia
wewnętrznego.
B. Przegroda częściowa.
Typ V – Macica pojedyncza przedzielona przegrodą:
A. Całkowita przegroda sięgająca do ujścia
wewnętrznego.
B. Przegroda częściowa.
Typ VI – Macica łukowata.
Typ VII – Nieprawidłowości rozwojowe związane
ze stosowaniem diethylostilbestrolu.
138
Z klinicznego punktu widzenia należy jednak podkreślić,
że przedstawiona powyżej klasyfikacja stanowi jedynie ramę
umożliwiającą właściwe porozumienie pomiędzy klinicystami,
a ponadto, co jest szczególnie istotne, umożliwia porównanie poszczególnych sposobów postępowania w określonych zaburzeniach rozwojowych [7, 8].
Należy również pamiętać, że nie wszystkie, a zwłaszcza złożone nieprawidłowości można jednoznacznie zakwalifikować do
poszczególnych grup wyodrębnianych przez wspomnianą wyżej
klasyfikację.
Epidemiologia
Częstość występowania wad wrodzonych wewnętrznych
narządów płciowych u kobiet jest trudna do oceny, jakkolwiek
szacuje się ją na ok. 7%-10% populacji [9]. Spowodowane jest
to faktem, że część zaburzeń rozwojowych nie daje żadnych objawów klinicznych i nie powoduje jakichkolwiek konsekwencji
zdrowotnych. Tak więc częstość ta zależy od specyfiki analizowanej grupy kobiet, a stwierdzany zakres to wartości od 0,16% do
10% [10, 11, 12, 13]. I tak dla przykładu, u kobiet poddawanych
badaniom ultrasonograficznym z różnych wskazań medycznych
częstość występowania szacowano na ok. 0,4% [10], podczas
gdy w grupie pacjentek z nawykowymi utratami ciąż wartość ta
wynosiła ponad 10% [13, 14].
W wielu badaniach podkreślano, że niepowodzenia położnicze u pacjentek z różnymi formami zaburzeń rozwojowych przewodów Műllera stwierdza się aż w 25%, podczas gdy w zdrowej populacji odsetek ten jest ponad 2 razy niższy i wynosi ok.
10% [15, 16]. Z danych tych wynika, że największy odsetek tych
nieprawidłowości występuje u kobiet, u których w wywiadzie
stwierdzono się powtarzające się utraty ciąż. Dodatkowo u pacjentek tych charakterystyczne jest występowanie wrodzonych
nieprawidłowości dotyczących układu moczowego, co oczywiście spowodowane jest wspólnym embriologicznym pochodzeniem obu układów [2].
Diagnostyka
W okresie dzieciństwa i wczesnej młodości, przy podejrzeniu istnienia wady rozwojowej, pierwszym krokiem diagnostycznym jest badanie kliniczne w celu ewentualnego stwierdzenia
nieprawidłowości dotyczących pochwy i szyjki macicy.
Diagnostycznym standardem u dzieci jest waginoskopia, jakkolwiek nie zawsze jest ona rutynowo wykonywana. Najczęściej
stosowaną procedurą diagnostyczną jest rezonans magnetyczny
(MRI), pozwalający na uwidocznienie potencjalnych nieprawidłowości dotyczących pochwy oraz macicy, z jednoczasowym
obrazowaniem układu moczowego [17].
Laparoskopia, uważana za złoty standard diagnostyczny
dotyczący kształtu i wielkości macicy, w chwili obecnej została
niemal zupełnie zastąpiona przez rezonans magnetyczny.
Diagnostyka zespołu wrodzonego braku pochwy i macicy
(zespół Mayer-Rokitansky-Küstner-Hauser – MRKH) wykonana
przy pomocy MRI dała 100% zgodność z danymi uzyskanymi
z laparoskopii [18]. Wykazano również dużą zgodność rozpoznań
nieprawidłowości rozwojowych układu moczowo-płciowego
przy pomocy trójwymiarowej ultrasonografii i rezonansu
magnetycznego. Stwierdzane różnice najczęściej dotyczyły
macicy dwurożnej w obrazie ultrasonograficznym oraz macicy
z przegrodą w badaniu rezonansem magnetycznym.
Nr 2/2011
Ginekol Pol. 2011, 82, 137-145
P R A C E
P O G L Ñ D O W E
ginekologia
Wady wrodzone układu moczowo-płciowego u kobiet – diagnostyka i postępowanie.
Tabela I. Nieprawidłowości rozwojowe wraz z korespondującymi badaniami obrazowymi.
© Polskie Towarzystwo Ginekologiczne
139
P R A C E
Ginekol Pol. 2011, 82, 137-145
P O G L Ñ D O W E
gineko l o gi a
Rechberger T, et al.
Dlatego też aktualnie zaleca się wykonywanie badań ultrasonograficznych w lutealnej fazie cyklu, kiedy pogrubiałe
endometrium wyraźnie modeluje jamę macicy, co minimalizuje
prawdopodobieństwo pomyłki. Jest to również powód, dla którego badania ultrasonograficzne u dziewcząt w okresie przedpokwitaniowym mogą nie być zbyt dokładne. Schematy nieprawidłowości rozwojowych wraz z korespondującymi obrazami MRI
przedstawiono w tabeli I.
Postępowanie kliniczne w zależności
od rodzaju stwierdzanych wadach
rozwojowych
1. Wrodzona agenezja pochwy i macicy
– zespół Mayer-Rokitansky-Küstner-Hauser (MRKH).
Wrodzona agenezja pochwy i macicy nazywana również
zespołem MRKH dotyczy 0,2% populacji żeńskiej. Klasyczny
pogląd, że zespół ten spowodowany jest negatywnym wpływem na płód teratogenów, leków, czy chorób dotykających matki we
wczesnym okresie embriogenezy jest w chwili obecnej weryfikowany pod kątem nieprawidłowości genetycznych. Zauważono
bowiem występowanie tego typu zaburzeń rozwojowych u sióstr
matek pacjentek z zespołem MRKH. Zespół wydaje się być dziedziczony jako cecha autosomalna, dominująca, z niecałkowitą
penetracją i różną ekspresją genów. Postawiono hipotezę, że geny
o szerokim zakresie aktywności w procesie embriogenezy (WT1,
PAX2, HOXA7, HOXA13 i PBX1) mogą mieć udział w powstawaniu zespołu, chociaż ich rola nie została do końca udowodniona. Innym branym pod uwagę genem jest WNT4 należący do rodziny genów regulujących wzrost i różnicowanie komórek i tkanek w czasie rozwoju. Brak aktywności tego genu u homozygot
prowadzi do uszkodzenia przewodów Müllera i wielu letalnych
wad u zwierząt [19]. Tak więc etiologia pozostaje nadal dość niejasna aczkolwiek spektrum występujących zaburzeń sugeruje powstawanie defektów organów blisko związanych (powstających
z mezodermy) w czasie embriogenezy. Najczęściej mamy do
czynienia z obecnością normalnych prawidłowo funkcjonujących
jajników, co powoduje normalny rozwój fenotypowy dziewcząt.
Dotknięte tą nieprawidłowością dziewczęta mają prawidłowo
rozwiniętą błonę dziewiczą oraz 1-2 centymetrowy ślepo zakończony zachyłek pochwy. Diagnoza zazwyczaj stawiana jest
w okresie późno pokwitaniowym, a przyczyną zgłaszania się do
lekarza pierwszego kontaktu lub lekarza ginekologa jest pierwotny brak miesiączki, przy prawidłowym rozwoju drugorzędowych
cech płciowych. Leczenie, poza wsparciem psychologicznym,
ma na celu wytworzenie funkcjonalnej pochwy umożliwiającej
odbywanie normalnych stosunków płciowych. Należy wyjaśnić
pacjentce i rodzinie istotę schorzenia oraz cel podjętych działań
terapeutycznych. Wytworzenie funkcjonalnej pochwy powinno
proponować się dziewczętom odpowiednio przygotowanym psychicznie i fizycznie do ewentualnego podjęcia aktywności płciowej, po zakończeniu fazy wstępnej leczenia. Początkowo zaleca
się pasywne metody wytwarzania kanału pochwy poprzez używanie odpowiednich dilatatorów [20]. U dziewcząt, które nie są
w stanie wykonać poprawnie i efektywnie sukcesywnego poszerzania i pogłębiania kanału pochwy, zalecanym sposobem postępowania jest laparoskopowa rekonstrukcja kanału pochwy metodą Vecchiettiego [21, 22], od wielu lat z powodzeniem stosowana
w II Katedrze i Klinice Ginekologii UM w Lublinie [23].
140
Należy podkreślić, że pacjentki, u których wytworzono neopochwę osiągają taki sam stopień satysfakcji seksualnej jak prawidłowo rozwinięte kobiety [24, 25].
Inne metody chirurgiczne polegają na stosowaniu mobilizacji
i przeszczepów płatów (fałdów): skóry z pośladków – McIndoe,
Klingele [26, 27], otrzewnej z zagłębienia Douglasa – Davydov,
Davydov i Zhvitiascvili [28, 29], błon płodowych – Nisolle
i Donnez [30], sztucznej skóry – Noguchi [31], przeszczepów
tkanek jelita – krętego, kątnicy, czy okrężnicy esowatej – Bürger,
Novak [32, 33].
2. Częściowa atrezja pochwy.
Około 15% pacjentek z agenezją pochwy w rzeczywistości
ma tzw. segmentalną (częściową) atrezję [34]. Schorzenie ujawnia się zazwyczaj u nastolatek z prawidłowo rozwiniętymi drugorzędowymi cechami płciowymi. U dziewcząt tych występują
cykliczne progresywnie nasilające się bóle brzucha.
W badaniach obrazowych (przezkroczowe USG, MRI) można uwidocznić krwiak pochwy o różnej objętości, w zależności
od czasu występowania objawów. Według aktualnie przyjętej arbitralnej definicji, o atrezji segmentalnej mówimy wówczas, gdy
dolna i górna część pochwy oddzielona jest od siebie przegrodą
o grubości 1cm lub większej. Leczenie polega na operacyjnym
odtworzeniu ciągłości pochwy poprzez wycięcie brakującego
segmentu i połączeniu dolnej i górnej części pochwy [35, 36].
3. Poprzeczna przegroda pochwy.
Pacjentki z tym schorzeniem mają dokładnie takie same objawy jak nastolatki z atrezją segmentalną. Leczenie jest również
podobne i z reguły łatwiejsze technicznie [35]. Niektórzy autorzy
zalecają używanie po zabiegu dilatatorów pochwowych w celu
zapobieżenia wystąpieniu pooperacyjnej stenozy w miejscu
zespolenia [37].
4. Wady kombinowane.
Podłużna przegroda pochwy w ponad 90% przypadków
skojarzona jest z występowaniem nieprawidłowości w obrębie
macicy (macica z przegrodą lub macica dwurożna) [38]. Obecność
dwóch szyjek jednoznacznie wskazuje na występowanie macicy
podwójnej bądź też kompletnej przegrody macicy.
5. Kompletna przegroda macicy.
Pacjentki z tym schorzeniem zazwyczaj są diagnozowane
z powodu wczesnych utrat ciąży, przedwczesnych porodów,
dyspareunii i/lub bolesnych krwawień miesięcznych. Złotym
standardem diagnostycznym jest rezonans magnetyczny, który
powinien również obejmować ocenę układu moczowego,
ponieważ do 20% pacjentek ma anomalie w zakresie tego układu.
Leczenie chirurgiczne polega na skojarzonym zastosowaniu
laparoskopii i histeroskopii. Przegroda macicy usuwana jest przy
użyciu diatermii.
Należy zwrócić uwagę aby nie naruszyć przyśrodkowej części szyjek macicy. W wyjątkowych przypadkach, gdy histeroskopowa resekcja jest z technicznego punktu widzenia niemożliwa,
pacjentce można zaproponować metroplastykę brzuszną [38].
Histeroskopowa resekcja przegrody macicy jest niezwykle efektywna w redukowaniu wczesnej utraty ciąży. Obserwowana efektywność tego zabiegu w przypadku występowania nawrotowych
poronień szacowana jest na ok. 80% [39].
Nr 2/2011
Ginekol Pol. 2011, 82, 137-145
P R A C E
P O G L Ñ D O W E
ginekologia
Wady wrodzone układu moczowo-płciowego u kobiet – diagnostyka i postępowanie.
Rycina 1. Kryteria różnicujące macicę dwurożną od macicy z przegrodą.
Macicę dwurożną rozpoznaje się kiedy:
A – dno macicy (3) znajduje się poniżej linii łączącej maciczne ujścia jajowodów (1, 2) lub B – dno macicy (3) znajduje się 5mm (patrz strzałka) powyżej tej linii.
Macica z przegrodą C – jest wtedy, kiedy dno macicy znajduje się więcej niż 5mm (patrz strzałka) powyżej linii łączącej maciczne ujścia jajowodów.
Jest rzeczą oczywistą, że histeroskopowa resekcja przegrody jest możliwa tylko w przypadku C, podczas gdy w przypadkach A i B wykonujemy klasyczną
metroplastykę brzuszną (jeżeli są wskazania, modyfikacja wg. Troiano i wsp.) [43].
A
B
Rycina 2. Obrazy histerosalpingograficzne macicy z przegrodą i macicy dwurożnej.
A – Kąt zawarty pomiędzy rogami macicy mniejszy niż 75° sugeruje macicę z przegrodą – w tym przypadku kąt wynosi 85°
– dlatego ostateczna diagnoza możliwa po badaniu MRI.
B – Kąt pomiędzy rogami macicy większy niż 105° sugeruje macicę dwurożną.
Należy jednak podkreślić, że histeroskopowa resekcja
przegrody nie poprawia odsetka zajść w ciążę u pacjentek
z pierwotną niepłodnością [40]. Dlatego też rola ewentualnej
histeroskopowej metroplastyki u pacjentek asymptomatycznych
jest kontrowersyjna i w każdym przypadku decyzja o takim
zabiegu wymaga indywidualnego podejścia [38, 41].
6. Różnicowanie macicy dwurożnej od macicy z przegrodą
i kwalifikacja do leczenia operacyjnego.
Prawidłowa diagnostyka macicy dwurożnej (typ IV AFS)
jest możliwa poprzez ocenę zewnętrznego konturu macicy [42].
(Rycina 1).
© Polskie Towarzystwo Ginekologiczne
Przegrody maciczne (typ V AFS) zazwyczaj leczymy za pomocą resekcji histeroskopowej przegrody, podczas gdy w przypadku macicy dwurożnej lub podwójnej właściwe zespolenie
dwóch jam macicy umożliwia klasyczna metroplastyka [44].
Należy podkreślić, że specyficzność diagnostyczna
histerosalpingografii (wykorzystanie wartości kąta pomiędzy
rogami macicy wynosi jedynie 55% [45]. Wartość kąta mniejsza
niż 75% sugeruje macicę z przegrodą, podczas gdy kąt większy
niż 105° jest charakterystyczny dla macicy dwurożnej [45, 46].
(Rycina 2).
141
P R A C E
Ginekol Pol. 2011, 82, 137-145
P O G L Ñ D O W E
gineko l o gi a
Rechberger T, et al.
Należy podkreślić, że skojarzone zastosowanie ultrasonografii i histerosalpingografii pozwala na postawienie prawidłowej diagnozy u 90% pacjentek [47]. Jedynym badaniem dającym
100% specyficzność jest MRI i powinno być ono zawsze zastosowane w przypadkach wątpliwych, szczególnie jeżeli planowane
jest postępowanie chirurgiczne [48, 49]. (Rycina 3).
Rycina 3. Obrazowanie MRI macicy dwurożnej – (typ IV wg klasyfikacji AFS).
Strzałka pokazuje częściowe zespolenie rogów macicy w jej dolnej części.
Kąt zawarty pomiędzy oboma rogami macicy jest zbliżony do 180°.
7. Macica podwójna z niedrożną jedną pochwą
U ok. 6% pacjentek z przegrodą pochwy i podwójną macicą
występuje niedrożność jednej pochwy [50]. Pacjentki te zazwyczaj mają prawidłowy rozwój drugorzędowych cech płciowych,
prawidłowo miesiączkują, natomiast w miarę upływu czasu narastają u nich dolegliwości związane z występowaniem krwawień
miesięcznych, co spowodowane jest niemożnością odpływu krwi
z niedrożnej pochwy. Nieprawidłowość ta jest często skojarzona z występowaniem agenezji lub dysplazji nerki. W większości
przypadków regularne krwawienia miesięczne powodują nieprawidłową diagnozę i zwiększają ryzyko niewłaściwego postępowania operacyjnego, polegającego na otwarciu jamy brzusznej
w poszukiwaniu torbieli, która w rzeczywistości jest niedrożną
pochwą wypełnioną przez krew [51, 52, 53].
Złotym standardem diagnostycznym pozwalającym na uniknięcie tego typu pomyłek, jest rezonans magnetyczny. Leczenie
polega na usunięciu chirurgicznym przegrody pochwy, co umożliwia odpływ krwi z drugiej macicy.
8. Macica jednorożna
Macica jednorożna powstaje na skutek prawidłowego rozwoju tylko jednego przewodu Müllera. Nieprawidłowość ta występuje u ok. 5% pacjentek z anomaliami rozwojowymi układu
rozrodczego [54, 55]. Wada ta występuje w 4 odmianach anatomicznych, przy czym zdecydowana większość pacjentek ma
142
dodatkowy róg szczątkowy niekomunikujący, bez czynnego
hormonalnie endometrium [54]. Najczęstsze powikłania spowodowane tą wadą dotyczą rozrodczości. Pacjentki mają z reguły
obniżoną płodność i zwiększone ryzyko wczesnej i późnej utraty
ciąży. W przypadku występowania rogu szczątkowego niekomunikującego z czynnym endometrium należy wykonać jego laparoskopową resekcję.
9. Atrezja szyjkowa
Występowanie prawidłowego trzonu macicy i nieprawidłowej szyjki jest rzadką wadą rozwojową [56]. Należy też podkreślić, że ponad połowa pacjentek z tym schorzeniem ma również
dodatkowo agenezję pochwy [57], a 1/3 dodatkowe nieprawidłowości w obrębie trzonu macicy. Rzadkość występowania tego
schorzenia powoduje, że ponad 80% pacjentek przechodzi leczenie operacyjne nieadekwatne do zaistniałej sytuacji klinicznej
[58]. U pacjentek z kompletną agenezją szyki rekomendowanym
postępowaniem jest wykonanie pierwotnej histerektomii, chociaż
podjęcie takiej decyzji jest niezwykle trudne z psychologicznego
punktu widzenia [56]. Ewentualne wykonanie anastomozy pomiędzy funkcjonalną jamą macicy a pochwą zależy od stopnia
agenezji szyjki oraz umiejętności zespołu leczącego. Należy jednak pamiętać, że brak prawidłowego nabłonka szyjki może skutkować zakażeniami wstępującymi, doprowadzającymi w konsekwencji do konieczności wykonania zabiegu radykalnego.
W największej ostatnio opublikowanej pracy, obejmującej
30 pacjentek z agenezją szyjki, powodzenie wykonania ewentualnej anastomozy było związane ze średnicą szyjki 2cm lub więcej. Konieczność wykonywania dodatkowej vaginoplastyki obniżała prawdopodobieństwo powodzenia do 43% w porównaniu
do 68% u dziewcząt nie wymagających dodatkowej rekonstrukcji
pochwy [57]. Należy też pamiętać, że pacjentki, u których wykonano pomyślne wytworzenie anastomozy maciczno-pochwowej
mają obniżoną zdolność do zachodzenia w ciążę o mniej więcej
60% [58].
Jak widać w wielu przypadkach wady mają charakter złożony i nie mogą być jednoznacznie zaszeregowane do do jednej
z VII grup klasyfikacji AFS, nie mówiąc już o tym, że zarośnięcie
błony dziewiczej, będące dość częstą wadą nie mieści się w tej
klasyfikacji ponieważ błona dziewicza nie powstaje, w rozwoju
embriologicznym, z przewodów Müllera.
Dlatego też Acien zaproponowała nową klasyfikację nieprawidłowości rozwojowych uwzględniającą pochodzenie embriologiczne i umożliwiającą kwalifikowanie wad złożonych [59].
Kliniczna i embriologiczna klasyfikacja wad
rozwojowych narządu rodnego [wg 59]
1. Agenezja lub hipoplazja całego grzebienia moczowopłciowego:
macica jednorożna z agenezją macicy, jajowodu, jajnika lub
nerki po stronie kontralateralnej.
2. Anomalie przewodu śródnerczowego z brakiem przewodu
Wolffa otwierającego się do zatoki moczowo – płciowej
oraz brakiem zawiązków moczowodów (czego efektem
jest agenezja nerek). Zaburzony zostaje stymulujący wpływ
przewodu Wolffa na przewód Müllera, co zwykle prowadzi
do zdwojenia macicy i pochwy oraz niedrożności pochwy po
tej samej stronie co agenezja nerki.
Nr 2/2011
Ginekol Pol. 2011, 82, 137-145
P R A C E
P O G L Ñ D O W E
ginekologia
Wady wrodzone układu moczowo-płciowego u kobiet – diagnostyka i postępowanie.
Objawy kliniczne i wady stwierdzane u pacjentek z tej grupy
to:
A) duży krwiak niedrożnej pochwy,
B) pseudotorbiele Gärtnera na przednio-bocznej
ścianie pochwy,
C) częściowa reabsorpcja przegrody między
pochwowej widoczna jako otwór na przednio
bocznej ścianie pochwy, który umożliwia
dostęp do narządów rodnych od strony
agenetycznej nerki.
D) jednostronna agenezja pochwy lub pochwy
i szyjki macicy występująca po stronie
agenetycznej nerki, przy braku komunikacji,
lub z zachowaną komunikacją pomiędzy trzonami.
3. Izolowane anomalie „müllerowskie” dotyczące:
A) przewodów Müllera: należą do nich często występujące wady
rozwojowe macicy, takie jak:
macica jednorożna (zwykle z rogiem
szczątkowym), dwurożna, przegrodzona lub
podwójna,
B) guzka Müllera: atrezja szyjkowo-pochwowa oraz anomalie
odcinkowe, takie jak: poprzeczna przegroda
pochwy,
C) zarówno przewodów jak i guzka Müllera
(jedno- lub obustronne)
Zespół Mayer-Rokitansky-Küstner-Hauser
4. Wady rozwojowe zatoki moczowo-płciowej:
anomalie kloaczne i inne.
5. Kombinacje wad rozwojowych przewodów Wolffa, Müllera
oraz anomalii kloaki.
Zaburzenia rozwojowe przewodów Müllera
– aspekty psychologiczne
Z praktycznego punktu widzenia niezwykle istotne jest właściwe poinformowanie pacjentki o ewentualnych konsekwencjach
zdrowotnych i prokreacyjnych wynikających z konkretnej wady
rozwojowej. Nieumiejętnie przekazana, zła informacja u młodszych dziewcząt przede wszystkim budzi strach o życie i zdrowie, u starszych dodatkowo pomniejsza satysfakcję z własnego
ciała, niesie za sobą trudności psychologiczne głównie związane
z zaspokojeniem potrzeb psychospołecznych takich jak atrakcyjność czy kobiecość.
U dziewcząt w okresie dojrzewania wzrasta zainteresowanie własnym wyglądem i funkcjonowaniem ciała stąd też informacja o nieprawidłowościach powoduje negatywny stosunek do
własnej osoby, obniża samoocenę, powoduje negatywne stany
emocjonalne i negatywnie wpływa na stosunki interpersonalne.
Pacjentki, które w niedalekiej przyszłości zamierzają założyć
rodzinę, początkowo są zszokowane. Pojawia się lęk, poczucie
mniejszej wartości. Kobiety te często rezygnują z aktywności
życia społecznego, popadają w depresję, obniża się ich satysfakcja z życia i jakość życia.
Tymczasem obecnie, dzięki lepszym możliwościom diagnostycznym i terapeutycznym wiele wad może być skorygowanych. Kompetentne poinformowanie pacjentki o możliwościach
leczenia prowadzącego do ustąpienia dolegliwości bólowych,
prawidłowego miesiączkowania, dającego satysfakcję współżycia seksualnego oraz zajścia w ciążę i jej donoszenia zdecydowanie poprawia jej samopoczucie, daje nadzieję i pozytywnie
motywuje do leczenia. Pacjentki z perspektywą długotrwałego,
kilkuetapowego leczenia, których szanse na satysfakcjonujące
współżycie seksualne, zajście w ciążę czy jej donoszenie są niewielkie potrzebują wsparcia rodziny, partnera życiowego i psychologa [8, 60].
Zaburzenia rozwojowe przewodów Müllera
a niepowodzenia prokreacyjne
Pierwotne szacowane ryzyko niepowodzeń położniczych
w poszczególnych typach wad (bez zastosowania jakiejkolwiek
interwencji chirurgicznej) przedstawiono w sposób zbiorczy
w tabeli II.
Z przedstawionych w tabeli II danych jednoznacznie wynika
że w żadnym typie wady ryzyko niepowodzeń położniczych nie
wynosi 100% i taką informację należy przekazywać pacjentkom.
Typ VII wad rozwojowych (wady spowodowane wewnątrzmaciczną ekspozycją na diethylostilbestrol) ma już jedynie znaczenie historyczne ponieważ specyfik ten od wielu lat nie jest stosowany w terapii poronień zagrażających.
Leczenie – uwagi ogólne
Z praktycznego punktu widzenia, wszystkie zabiegi przeprowadzane u pacjentek z zaburzeniami rozwojowymi przewodów
Müllera dzieli się na 3 typy [7]:
• Typ I – Zabiegi chirurgiczne wykonywane w celu
zlikwidowania nasilonych dolegliwości bólowych,
uniemożliwiających normalne funkcjonowanie
(poprzeczna przegroda pochwy, agenezja szyjki
Tabela II. Średnie szacowane ryzyko pierwotnych niepowodzeń położniczych w poszczególnych typach wad, wg klasyfikacji AFS [43].
© Polskie Towarzystwo Ginekologiczne
143
P R A C E
Ginekol Pol. 2011, 82, 137-145
P O G L Ñ D O W E
gineko l o gi a
Rechberger T, et al.
macicy, róg szczątkowy niekomunikujący
z czynnym funkcjonalnym endometrium, pochwa
szczątkowa niekomunikująca połączona z macicą
podwójną, zarośnięta błona dziewicza przy czym
ostatnia patologia nie mieści się w klasyfikacji
AFS, ponieważ błona dziewicza nie powstaje
z przewodów Müllera).
• Typ II – Zabiegi chirurgiczne przeprowadzane w celu
poprawienia jakości życia kobiety – wytwarzanie
neopochwy u pacjentek z zespołem RMKH.
• Typ III – Zabiegi chirurgiczne wykonywane w przypadku niepowodzeń położniczych – histeroskopowe
usuwanie przegrody u pacjentek z grupy V wg
klasyfikacji AFS oraz klasyczna brzuszna metroplastyka u pacjentek z grupy IV i/lub III.
Wnioski
Zaburzenia rozwojowe struktur powstających z przewodów
Műllera stanowią istotny problem kliniczny. Pomimo wprowadzenia systemu kwalifikującego poszczególne wady oraz większych możliwości diagnostycznych ciągle część pacjentek nie
jest leczona w sposób optymalny. Przed podjęciem decyzji terapeutycznych o ewentualnym leczeniu chirurgicznym należy,
oprócz badania klinicznego, przeprowadzić szczegółową diagnostykę obrazową (MRI, USG). Tym sposobem można uniknąć
wykonywania zabiegów nie przynoszących pacjentkom potencjalnych korzyści.
Najbardziej kontrowersyjną kwestią jest sposób postępowania u pacjentek z agenezją szyjki, ponieważ brak jest w chwili
obecnej konsensusu, co do sposobu postępowania u kobiet z taką
wadą.
Wydaje się, że istotnym kryterium pozwalającym na podjęcie
decyzji o próbie wytworzenia anastomozy maciczno-pochwowej
jest średnica szyjki macicy wynosząca 2cm lub więcej.
Uwagi praktyczne
1. Myśl zawsze o zaburzeniach rozwojowych jeżeli
u dziewczynki w okresie pokwitania występują cykliczne
dolegliwości bólowe towarzyszące krwawieniom
miesięcznym, lub gdy krwawienie nie występuje
pomimo prawidłowo rozwiniętych drugorzędowych cech
płciowych (gruczoły piersiowe, owłosienie pachowe
i łonowe).
2. Prawidłowa diagnostyka oparta jest o badanie kliniczne
oraz badania obrazowe (USG i MRI) – szczególnie przed
podejmowaniem decyzji o leczeniu operacyjnym.
3. Rozpoznanie określonej wady nie jest jednoznaczne
z prawdopodobieństwem niepowodzeń prokreacyjnych.
4. Rzeczowe wyjaśnienie istoty schorzenia oraz jego
potencjalnych skutków zdrowotnych i prokreacyjnych
a także właściwe wsparcie psychologiczne mają kluczowe
znaczenie dla dobrostanu psychicznego i samooceny
pacjentki dotkniętej schorzeniem.
P i ś mi e nni c two
1. Sarto G, Simpson J. Abnormalities of the mullerian and wolffian duct systems. Birth Defects Orig
Artic Ser. 1978, 14, 37-54.
2. Acien P. Embryological observations on the female genital tract. Hum Reprod. 1992, 7, 43745.
3. Breech L, Laufer M. Műllerian anomalies. Obstet Gynecol Clin North Am. 2009, 36, 47-68.
4. Acién P, Acién M, Fernández F, [et al.]. The cavitated accessory uterine mass: a Müllerian
anomaly in women with an otherwise normal uterus. Obstet Gynecol. 2010, 116, 1101-1109.
5. Buttram V, Gibbons W. Mullerian anomalies: a proposed classification (an analysis of 144
cases). Fertil Steril. 1979, 32, 40-46.
6. The American Fertility Society classifications of adnexal adhesions, distal tubal obstruction, tubal
occlusion secondary to tubal ligation, tubal pregnancies, mullerian anomalies and intrauterine
adhesions. Fertil Steril. 1988, 49, 944-955.
7. Rechberger T, Wróbel A. Klasyfikacja oraz leczenie operacyjne anomalii rozwojowych narządu
rodnego. Ginekol Pol. 2005, 76, 921-925.
8. Quint E, McCarthy J, Smith Y. Vaginal surgery for congenital anomalies. Clin Obstet Gynecol.
2010, 53,115-124.
9. Grimbizis G, Campo M. Congenital malformations of the female genital tract: the Need for a New
classification system. Fertil Steril. 2010, 94, 401-407.
10. Byrne J, Nussbaum-Blask A, Taylor W, [et al.]. Prevalence of Mullerian duct anomalies detected
at ultrasound. Am J Med Genet. 2000, 94, 9-12.
11. Maneschi F, Zupi E, Marconi D, [et al.]. Hysteroscopically detected asymptomatic mullerian
anomalies. Prevalence and reproductive implications. J Reprod Med. 1995, 40, 684-688.
12. Simon C, Martinez L, Pardo F, [et al.]. Müllerian defects in women with normal reproductive
outcome. Fertil Steril. 1991, 56, 1192-1193.
13. Stampe Sorensen S. Estimated prevalence of mullerian duct anomalies. Acta Obstet Gynecol
Scand. 1988, 67, 441-445.
14. Stray-Pedersen B, Stray-Pedersen S. Etiologic factors and subsequent reproductive
performance in 195 couples with a prior history of habitual abortion. Am J Obstet Gynecol.
1984, 148,140-146.
15. Golan A, Langer R, Bukovsky I, [et al.]. Congenital anomalies of the mullerian system. Fertil
Steril. 1989, 51, 747-755.
16. Harger J, Archer D, Marchese S, [et al.]. Etiology of recurrent pregnancy losses and outcome of
subsequent pregnancies. Obstet Gynecol. 1983, 62,574-581.
17. Chuch D, Vancil J, Vasanawala S. Magnetic resonance imaging for uterine and vaginal
anomalies. Curr Opin Obstet Gynecol. 2009, 21, 379-389.
18. Pompili G, Munari A, Franceschelli G, [et al.]. Magnetic resonance imaging in the preoperative
assesment of Mayer-Rokitansky-Kűster-Hauser Syndrome. Radiol Med. 2009, 114, 811-826.
19. Guerrier D, Mouchel T, Pasquier L, [et al.]. The Mayer-Rokitansky-Kűster-Hauser syndrome
(congenital absence of uterus and vagina) – phenotypic manifestation and genetic approaches.
J Negat Results Biomed. 2006, 5, 1.
20. ACOG Committee on Adolescent Healthcare. ACOG Committee Opinion No. 355: vaginal
agenesis – diagnosis, management, and routine care. Obstet Gynecol. 2006, 108, 1605-1609.
21. Fedele L, Bianchi S, Berlanga N, [et al.]. Laparoscopic creation of a neovagina with the
laparoscopic Vecchietti operation: comparison of two instrument sets. Fertil Steril. 2006; 86,
429-432.
22. Borruto F, Chasen S, Chervenak F, [et al.]. The Vecchietti procedure for surgical treatment of
vaginal agenesis: comparison of laparoscopy and laparotomy. Int J Gynaecol Obstet. 1999, 64,
153-158.
23. Adamiak A, Monist M, Bartuzi A, [et al.]. Efekt anatomiczny i czynnościowy laparoskopowej
operacji sposobem Vecchiettiego. Ginekol Pol. 2009, 80, 107-110.
24. Nadarajah S, Quek J, Rose G, [et al.]. Sexual function in women treated with dilators for vaginal
agenesis. J Pediatr Adolesc Gynecol. 2005, 18, 39-42.
25. Fedele L, Bianchi S, Frontino G, [et al.]. The laparoscopic Vecchietti’s modified technique in
Rokitansky syndrome: anatomic, functional, and sexual long-term results. Am J Obstet Gynecol.
2008, 198, 377. e1-6.
26. McIndoe A. Surgical management for vaginal agenesis. In: The Treatment of vaginal atresia.
Eds. Skoog T, Ivy R. Baltimore: Williams and Wilkins Eds, 1995, 414-426.
27. Klingele C, Gebhart J, Croak A, [et al.]. McIndoe procedure for vaginal agenesis: long-term
outcome and effect on quality of life. Am J Obstet Gynecol. 2003, 189, 1569-1572.
28. Davydov S. Colpopoeisis from the peritoneum of the uterorectal space. Obstet Gynecol. 1969,
45, 55-57.
29. Davydov S, Zhvitiashvili O. Formation of vagina (colpopoeisis) from perineum of Douglas pouch.
Acta Chir Plast. 1974, 16,35-41.
30. Nisolle M, Donnez J. Vaginoplasty using amniotic membrans in cases of vaginal agenesis or
after vaginectomy. J Gynecol Surg. 1992, 8, 25-30.
31. Noguchi S, Nakatsuka M, Sugiyama Y, [et al.]. Use of artificial dermis and recombinant basic
fibroblast growth factor for creating a neovagina in a patient with Mayer-Rokitansky-KusterHauser syndrome. Hum Reprod. 2004, 19: 1629-1632.
32. Bűrger R, Riedmiller H, Knapstein P, [et al.]. Ileocecal vaginal construction. Am J Obstet Gynecol.
1989, 161, 162-167.
33. Novak F, Kos L, Plesko F. The advantages of the artificial vagina derived from sigmoid colon.
Acta Obstet Gynecol Scand. 1978, 57, 95-96.
34. Robson S, Oliver G. Management of vaginal Genesis: review of 10 years practice At a tertiary
referral centre. Aust N Z J Obstet Gynaecol. 2000, 40,430-433.
144
Nr 2/2011
Ginekol Pol. 2011, 82, 137-145
P R A C E
P O G L Ñ D O W E
ginekologia
Wady wrodzone układu moczowo-płciowego u kobiet – diagnostyka i postępowanie.
35. Van Bijsterveldt C, Willemsen W. Treatment of patients with congenital transversal vaginal
septum or a partial aplasia ot the vagina. The vagina pull-through versus the push-through
technique. J Pediatr Adolesc Gynecol. 2009, 22, 157-161.
36. Miller R, Breech L. Surgical correction of vaginal anomalies. Clin Obstet Gynecol. 2008, 51,
223-236.
37. Lacy J, Correll G, Walmer D, [et al.]. Simple vaginal mold for use in the postoperative care of
patients with a transverse vaginalis septum. Fertil Steril. 2007, 87, 1225-1226.
38. Patton P, Novy M, Lee D, [et al.]. The diagnosis and reproductive outcome after surgical
treatment of the complete septate uterus, duplicated cervix and vaginal septum. Am J Obstet
Gynecol. 2004, 190, 1669-1675.
39. Wang J, Xu K, Lin J, [et al.]. Hysteroscopic septum resection of complete septate uterus with
cervical duplication, sparing the double cervix In patients with recurrent spontaneous abortion
or infertility. Fertil Steril. 2009, 91, 2643-2649.
40. Grimbizis G, Camus M, Tarlatzis B, [et al.]. Clinical implications of uterine malformations and
hysteroscopic treatment results. Hum Reprod Update. 2001, 7, 161-174.
41. Lin K, Zhu X, Xu H, [et al.]. Reproductive outcomes following resectoscope metroplasty in
women having a complete uterine septum with double cervix and vagina. Int J Gynaecol Obstet.
2009, 105, 25-28.
42. Fedele L, Dorta M, Brioschi D, [et al.]. Re-examination of the anatomic indications for
hysteroscopic metroplasty. Eur J Obstet Gynecol Reprod Biol. 1991, 39, 127–131.
43. Troiano R, McCarthy S. Mullerian duct anomalies: imaging and clinical issues. Radiology. 2004,
233, 19-34.
44. Strassmann E. Fertility and unification of double uterus. Fertil Steril. 1966, 17, 165-176.
45. Reuter K, Daly D, Cohen S. Septate versus bicornuate uteri: errors in imaging diagnosis.
Radiology. 1989, 172,749-752.
46. Ott D, Fayez J, Zagoria R, eds. “Congenital anomalies” in hysterosalpingography: a text and
atlas. 2nd ed. Baltimore, Md: Williams & Wilkins, 1998; 59-69.
47. Fedele L, Ferrazzi E, Dorta M, [et al.]. Ultrasonography in the differential diagnosis of “double”
uteri. Fertil Steril. 1988, 50, 361-364.
48. Pellerito J, McCarthy S, Doyle M, [et al.]. Diagnosis of uterine anomalies: relative accuracy of
MR imaging, endovaginal sonography, and hysterosalpingography. Radiology. 1992, 183, 795800.
49. Fedele L, Dorta M, Brioschi D, [et. al.]. Magnetic resonance evaluation of double uteri. Obstet
Gynecol. 1989, 74, 844-847.
50. Heinonen P. Complete septate uterus with longitudinal vaginal septum. Fertil Steril. 2006, 85,
700-705.
51. Żurawin R, Dietrich J, Herard M, [et al.]. Didelphic uterus and obstructed hemivagina with renal
genesis: case report and review of the literature. J Pediatr Adolesc Gynecol. 2004, 17, 137141.
52. Cameron M, Moore Paddy, Grover S. Uterus didelphys with obstructed hemivagina: a case
series. J Pediatr Adolesc Gynecol. 2007, 20, 137.
53. Smith N, Laufer R. Obstructed hemivagina and ipsilateral renal anomaly (OHVIRA) syndrome:
management and follow-up. Fertil Steril. 2007, 87, 918-922.
54. Jayasighe Y, Rane A, Stalewski H, [et al.]. The presentation and early diagnosis of the
rudimentary uterine horn. Obstet Gynecol. 2005, 105, 1456-1467.
55. Reichmann D, Laufer M, Robinson B. Pregnancy outcomes in unicornuate uterus: a review.
Fertil Steril. 2009, 91, 1886-1894.
56. Rock J, Roberts C, Jones H. Congenital anomalies of the uterine cervix: lessons from 30 cases
managed clinically by a common protocol. Fertil Steril. 2010, 94, 1858-1863.
57. Fujimoto V, Miller H, Klein N, [et al.]. Congenital cervical atresia: report of 7 cases and review of
literature. Am J Obstet Gynecol. 1997, 177, 1419-1425.
58. Deffarges J, Haddad B, Musset R, [et al.]. Utero-vaginal anastomosis in women with uterine
cervix atresia: long-term follow-up and reproductive performance. A study of 18 cases. Hum
Reprod. 2001, 16, 1722-1725.
59. Acien P, Acien M, Sanchez-Ferrer M. Complex malformations of the female genital tract. New
types and revision of classification. Hum Reprod. 2004, 19, 2377-2384.
60. Jarząbek G, Friebe Z, Szafińska A. Problemy psychoseksualne u pacjentek z wrodzonymi
wadami rozwojowymi narządów płciowych. Seksuol Pol. 2004, 2, 5-10.
K O M U N I K AT
Konferencje Ogólnopolskie 2011
IV AKTUALNOŚCI W GINEKOLOGII
I POŁOŻNICTWIE
13-14 maja 2011r.
Cie chocine k
Patronat: Polskie Towarzystwo Ginekologiczne
Tematy wiodące:
• ból jako problem ginekologii • położnictwo •
• standardy opieki perinatalnej • współczesna antykoncepcja •
• Hormonalna Terapia Zastępcza • niepłodność •
• endokrynologia ginekologiczna • uroginekologia •
Warsztaty:
• podwiązywanie tętnic biodrowych wewnętrznych w krwotoku
poporodowym •
• zamykanie tętnic macicznych drogą pochwową •
• algorytm postępowania w krwotoku poporodowym •
• zakładanie szwów Be Lyncha w atonii poporodowej macicy •
II NOWE TRENDY W GINEKOLOGII
ONKOLOGICZNEJ
23-24 września 2011r.
K oł obr z e g
Patronat:
Polskie Towarzystwo Ginekologiczne
Polskie Towarzystwo Ginekologii Onkologicznej
Komitet Naukowy:
Przewodniczący: Prof. dr hab. med. Janusz Emerich
Członkowie:
Prof. dr hab. med. Antoni Basta
Prof. dr hab. med. Mariusz Bidziński,
Prof. dr hab. med. Wojciech Biernat,
Prof. dr hab. med. Piotr Knapp
Prof. dr hab. med. Zbigniew Kojs
Prof. dr hab. med. Janusz Limon
Prof. dr hab. med. Janina Markowska,
Prof. dr hab. med. Anita Olejek
Prof. dr hab. med. Ryszard Poręba
Prof. dr hab. med. Jerzy Stelmachów
Prof. dr hab. med. Stefan Sajdak,
Prof. dr hab. med. Marek Sikorski
Prof. dr hab. med. Jacek Suzin
Prof. dr hab. med. Beata Śpiewankiewicz,
Prof. dr hab. med. Krzysztof Urbański
Dr hab. n. med. Anna Markowska
Tematyka sesji dotyczyć będzie:
• raka szyjki macicy • nowotworów jajnika • nowotworów piersi
• nowotworów sromu i pochwy • nowotworów trzonu macicy •
W sprawach organizacyjnych prosimy o kontakt:
AGORA
ul. Żurawia 10-12/31
60-860 Poznań
e-mail:
tel./fax 61/842 74 65
[email protected]
Szczegółowe informacje oraz rejestracja na stronie www.
www.agora-konferencje.pl
© Polskie Towarzystwo Ginekologiczne
145
Ginekol Pol. 2011, 82, 146-149
P R A C E
K A Z U I S T Y C Z N E
po∏o ˝ n i ctwo
Wewnątrznaczyniowa embolizacja tętnic
macicznych w leczeniu wczesnego krwotoku
poporodowego – opis przypadku
Intravascular embolization of the uterine arteries in the treatment
of early postpartum haemorrhage – case report
Lisowski Andrzej, Drelichowski Stanisław, Słoka-Sutkowska Alicja,
Wiśniewski Dawid, Malinowski Janusz
Wojewódzki Szpital Specjalistyczny we Wrocławiu Ośrodek Badawczo-Rozwojowy, Wrocław, Polska
Oddział Ginekologiczno-Położniczy i Oddział Radiologii Zabiegowej
Streszczenie
W pracy opisano przypadek pacjentki z krwotokiem poporodowym w przebiegu atonii macicy, powikłanym wstrząsem
hipowolemicznym, leczonym embolizacją tętnic macicznych. Po raz pierwszy w ginekologii i położnictwie zabieg ten
został opisany przez Browna i wsp. w 1979 roku.
Embolizacja jest szybką, bezpieczną, efektywną i małoinwazyjną metodą, alternatywną do leczenia chirurgicznego,
gdy leczenie farmakologiczne krwotoku poporodowego zawodzi.
Słowa kluczowe: atonia macicy / krwotok poporodowy /
/ embolizacja tętnic macicznych /
Summary
The article presents a case report of a patient with postpartum haemorrhage in the course of uterine atony with
hypovolemic shock as a complication treated by uterine arteries embolization. In obstetrics and gynecology this
procedure was first described in 1979 by Brown et al.
Embolization is a rapid, secure, efficient and low-invasive alternative to surgical intervention when pharmacological
treatment of postpartum haemorrhage fails.
Key words: uterine atony / postpartum hemorrhage /
/ uterine arteries embolization /
Adres do korespondencji:
Janusz Malinowski
Wojewódzki Szpital Specjalistyczny we Wrocławiu
Oddział Ginekologiczno-Położniczy
ul. Kamieńskiego 73a, 51-124 Wrocław, Polska
tel./fax: +48 71 32 70 245
e-mail: [email protected]
146
Otrzymano: 20.06.2010
Zaakceptowano do druku: 15.01.2011
Nr 2/2011
Ginekol Pol. 2011, 82, 146-149
P R A C E
K A Z U I S T Y C Z N E
po∏o˝nictwo
Lisowski A, et al.
Krwotoki w położnictwie oraz ginekologii mogą potencjalnie stać się stanami nagłymi, zagrażającymi życiu, niereagującymi na konwencjonalne metody leczenia. Najczęściej spotykany
jest krwotok poporodowy, który jest wciąż jedną z głównych
przyczyn zachorowalności oraz umieralności matek na świecie.
Przezcewnikowa embolizacja tętnic stała się realną alternatywą
dla konwencjonalnego chirurgicznego leczenia. Może być zastosowana do różnych typów krwawienia.
W tej pracy przedstawiamy opis przypadku pacjentki leczonej metodą wybiórczej, przezcewnikowej embolizacji tętnic macicznych z powodu wczesnego krwotoku poporodowego, po raz
pierwszy wykonanej w Wojewódzkim Szpitalu Specjalistycznym
we Wrocławiu.
Opis przypadku
Pacjentka lat 36, CIII PIII, została przyjęta w lutym 2010
roku do szpitala, w 40 tygodniu ciąży z powodu nieregularnej
czynności skurczowej macicy. W wywiadzie stan po dwóch porodach siłami natury w latach 2006 i 2008. Pierwszy poród bez
powikłań. Drugi poród odbyty w domu, powikłany krwotokiem
z dróg rodnych, oraz wstrząsem hipowolemicznym, leczonym
w szpitalu płynami infuzyjnymi i koncentratem krwinek czerwonych.
Ciężarna przyjęta na Blok Porodowy w stanie ogólnym dobrym: RR 120/80mmHg, tętno 80/min., temperatura 36,6°C. Akcja serca płodu 140/min. W USG położniczym położenie płodu
podłużne główkowe, ilość płynu owodniowego w normie, łożysko na ścianie przedniej, bez cech niepokojących, masa płodu ok.
3800g. W badaniach laboratoryjnych Hgb 12,2 g/dl, Ht 36,6%,
RBC 4,36 M/µL, WBC 7,4 K/µL PLT 260 K/µL.
W pierwszym okresie porodu trwającym 6 godzin i 15 minut
zaproponowano pacjentce, ze względu na słabą czynność skurczową macicy, kroplówkę naskurczową z 5j. Oxytocyny w 500ml
0,9% NaCl, na którą rodząca nie wyraziła zgody.
Drugi okres porodu trwający 5 minut bez powikłań. Wśród
skurczów partych urodziła siłami natury córkę żywą donoszoną o masie ciała 3740g, w stanie ogólnym dobrym (10 punktów
w skali Apgar). Trzeci okres porodu prowadzono w sposób czynny, podano 5j. Oxytocyny i.v. oraz 5j. Oxytocyny w 500ml 0,9%
NaCl. Po 10 minutach urodziło się całe łożysko mechanizmem
Schultzego. Kontrola kanału rodnego – szyjka macicy oraz sklepienia pochwy bez obrażeń. Stwierdzono pęknięcie śluzówki
przedsionka pochwy, które zaopatrzono w sposób typowy. Stan
pacjentki po porodzie dobry. Utrata krwi ok. 400ml. Zalecono
kroplówkę 500ml PWE oraz 0,4mg Mizoprostolu (2 tabletki Cytotecu) doodbytniczo.
Dwie godziny po porodzie pacjentka zgłosiła zawroty głowy, oraz ogólne słabe samopoczucie. W badaniu fizykalnym
skóra blada, wilgotna. Macica wiotka, obecne krwawienie z dróg
rodnych w ilości około 500 ml krwi ze skrzepami. Położnica zasłabła, bez kontaktu, RR 70/40mmHg, tętno niewyczuwalne na
obwodzie. W czasie transportu na salę zabiegową nastąpiło ponowne krwawienie z dróg rodnych w ilości około 500ml.
Pobrano krew do badań laboratoryjnych i uzyskano wyniki:
WBC 23,70K/µL, HGB 9,9g/dl RBC 3,65M/µL , PLT 329K/µL,
APTT 29,2sek., INR 1,06, Fibrynogen 4,8g/l, D-dimery 9420µg/l,
elektrolity: Na 137mmol/l, K 3,6mmol/l, Cl 105 mmol/l.
Rozpoczęto intensywne przetaczanie płynów krwiozastępczych,
zamówiono 6 jednostek koncentratu krwinek czerwonych, oraz
© Polskie Towarzystwo Ginekologiczne
4 jednostki osocza świeżo mrożonego.W znieczuleniu ogólnym
dożylnym wyłyżeczkowano jamę macicy, która obkurczyła
się prawidłowo. Podczas ponownej kontroli kanału rodnego
nie stwierdzono krwawiących obrażeń. Podano równocześnie
10 j. Oxytocyny i.v, 0,6mg Mizoprostolu (3 tabletki Cytotecu)
doodbytniczo oraz 0,4mg Terlipresyny (2 amp. Remestypu) i.v.
Po 10 minutach nastąpił kolejny krwotok z dróg rodnych z utratą
około 800ml krwi. Uciśnięto macicę przez powłoki brzuszne,
co tylko częściowo wstrzymało krwawienie. W tej sytuacji,
celem ratowania życia pacjentki, zakwalifikowano położnicę do
embolizacji tętnic macicznych. Pacjentka przekazana z Bloku
Porodowego na Oddział Diagnostyki Obrazowej mieszczący się
na tym samym piętrze w odległości około 70 metrów. W czasie
transportu położnicy uciskano mechanicznie macicę, co pozwoliło
powstrzymać dalsze krwawienie. Łączna utrata krwi oceniono na
2400ml.
W aortografii uzupełnionej wybiórczo angiografią tętnic
biodrowych wewnętrznych wykazano obecność wynaczynienia
środka cieniującego z gałęzi obu tętnic macicznych. (Rycina 1,
2).
Po selektywnym zacewnikowaniu tętnic macicznych wprowadzono do ich światła spirale metalowe firmy Cook o wymiarach 3mm x 4cm. W kontrolnej angiografii nie wykazano wynaczynienia środka cieniującego. (Rycina 3, 4).
W trakcie zabiegu rozpoczęto przetaczanie 2 jednostek
KKCz bez próby krzyżowej.
Po zabiegu embolizacji naczyń macicznych położnicę
w stanie stabilnym przewieziono na Odział Anestezjologii
i Intensywnej Terapii, gdzie przetoczono dalsze 4 jednostki KKCz
i 4 jednostki FFP. Gazometria z krwi żylnej: pH 7,478, pCO2 29
mmHg, pO2 78mmHg , Na + 135mmol/l K+ 3,3 mmol/l Ca++
0,89mmol/l HCO3 21,2mmol/l, BE -1,6, O2 sat 97,1% oraz
układ krzepnięcia APTT 41,5sek, Antytrombina III 61%, INR
1,14, Fibrynogen 2,9g/l, D-dimery 5178. Kontrolna morfologia
krwi: WBC 10,44 RBC 2,47, Hgb 6,6g/dl, PLT 166 K/l, HCT
18%, Na 136mmol/l, K 3,5mmol/l, Cl 107mmol/l.
Dalszy pobyt w Oddziale Ginekologiczno-Położniczym
bez powikłań, pacjentce przetoczono kolejne 2 jednostki KKCz.
Kontrolna morfologia krwi WBC 9,75K/ul RBC 4,36M/ul Hgb
12,3g/dl Ht- 34% PLT 248K/ul APTT 32,4 s INR 1.01 Fibrynogen 5,1g/l D-dimery 1270ug/l .W czwartej dobie po porodzie
w stanie ogólnym dobrym, bez dolegliwości, pacjentka została
wypisana z Oddziału na własne żądanie.
Dyskusja
Krwotok poporodowy (PPH) rozpoznajemy przy utracie
krwi ponad 500ml przy porodzie siłami natury, oraz ponad 1000
ml podczas cięcia cesarskiego. Utratę krwi w pierwszych 24 godzinach po porodzie nazywamy wczesnym krwotokiem poporodowym, a w okresie od 24 godzin do 6 tygodni po porodzie, późnym krwotokiem poporodowym. Ciężki krwotok stwierdzamy,
gdy utrata krwi wynosi ponad 150ml/min. (w ciągu 20 minut powoduje utratę ponad 50% objętości krwi) lub przy nagłej utracie
ponad 1500-2000ml (utrata 25-35% objętości krwi) [1, 2].
PPH jest zazwyczaj możliwy do opanowania przez masaż
macicy, oraz leczenie farmakologiczne przy użyciu oxytocyny i analogów prostoglandyn E2, a także kontrolę jamy macicy
ręczną i instrumentalną w znieczuleniu ogólnym, kontrolę dróg
rodnych, oraz tamponowanie jamy macicy [3].
147
P R A C E
K A Z U I S T Y C Z N E
po∏o˝n i c t w o
Ginekol Pol. 2011, 82, 146-149
Wewnątrznaczyniowa embolizacja tętnic macicznych w leczeniu wczesnego krwotoku poporodowego...
Rycina 1. Wybiórcza angiografia prawej tętnicy macicznej.
Widoczne wynaczynienia miąższowe z gałązek tętnicy.
Rycina 2. Wybiórcza angiografia lewej tętnicy macicznej.
Widoczne wynaczynienia miąższowe z gałązek tętnicy.
Rycina 3. Efekt po embolizacji prawej tętnicy macicznej.
Rycina 4. Efekt po embolizacji lewej tętnicy macicznej.
Jeżeli takie postępowanie zawiedzie, powinny być wdrożone
metody zabiegowe.
Do konwencjonalnego leczenia chirurgicznego zaliczamy
szew uciskowo – hemostatyczny zakładany na macicę wg techniki B-Lynch, obustronne podwiązanie tętnic macicznych lub
tętnic biodrowych wewnętrznych oraz wycięcie macicy [4, 5].
Alternatywą do takiego leczenia jest selektywna embolizacja tętnic macicznych.
Przezcewnikowa embolizacja tętnic w ginekologii i położnictwie została opisana po raz pierwszy w 1979 przez Browna
i wsp. w leczeniu krwotoku poporodowego u pacjentki z utrzymującym się krwawieniem po obustronnym podwiązaniu tętnic
podbrzusznych [6]. Od tego czasu zabieg ten został zastosowany
w różnych przypadkach krwawień macicy z powodzeniem w 7190% przypadków [7, 8, 9].
W trakcie 34 dorocznej konferencji naukowej Amerykańskiego Towarzystwa Radiologii Interwencyjnej (12.03.2009 San
Diego, California) poddano ostrej krytyce dotychczasowe postępowanie ginekologów i położników. Dr Michael S. Stecker, radiolog zabiegowy z Brigham and Women’s Hospital w Bostonie
w komentarzu do swojej pracy dotyczącej krwawienia po cięciu
cesarskim powiedział, że „wykonuje się o wiele za dużo histerektomii – żadna kobieta nie powinna być operowana z powodu
nadmiernego krwawienia po cięciu cesarskim”.
148
Nr 2/2011
Ginekol Pol. 2011, 82, 146-149
P R A C E
K A Z U I S T Y C Z N E
po∏o˝nictwo
Lisowski A, et al.
Embolizacja ocala macicę, pozwala na rodzenie w przyszłości i zapewnia szybką rekonwalescencję” [10]. Znając tą opinię
i posiadając możliwość wykonania embolizacji postanowiliśmy
wykorzystać ją w dogodnej okazji.
Embolizacja jest zamierzonym zamknięciem światła naczynia w celu leczniczym. Zabieg ten zawsze poprzedza badanie
angiograficzne, które potwierdza rozpoznanie i jest podstawą
doboru ilości i rodzaju materiału embolizacyjnego. Embolizacje
przeprowadza się zwykle w znieczuleniu miejscowym, a ciężki
stan chorego nie jest przeciwwskazaniem do jej wykonania. Materiały embolizacyjne mogą być pochodzenia biologicznego, np.
autogenne skrzepy krwi, kawałki mięśni czy opony twardej lub
niebiologicznego, np. gąbka żelatynowa, alkohol poliwinylowy,
metalowe spirale, kleje cyjanoakrylowe lub balony odczepialne.
Materiał embolizacyjny musi być jałowy, nietoksyczny, nieuczulający, odpowiednio twardy, cieniujący w obrazie rentgenowskim, a także łatwy do wprowadzenia przez cewnik angiograficzny. Najczęstszym wskazaniem w położnictwie do zastosowania
embolizacji tętnic macicznych jest atonia macicy [11].
K O M U N I K AT
Sekcja Ultrasonografii
Polskiego Towarzystwa Ginekologicznego
serdecznie zaprasza na kursy organizowane
w rok u 2011
Podsumowanie
Embolizacja tętnic macicznych w przypadkach krwawienia
poporodowego jest zabiegiem szybkim, efektywnym, pozwalającym na ocalenie życia i macicy, oraz szybką rekonwalescencję pacjentki. Rozpowszechnienie tego sposobu postępowania pozwoli
na obniżenie częstości wycięcia macicy po porodzie i ocalenie
płodności kobiet. Polska posiada obecnie 120 pracowni radiologii zabiegowej, jest więc nadzieja na częstsze wykorzystywanie
embolizacji tętnic macicznych w przypadkach krwotoków, przy
odpowiednim zainteresowaniu położników i NFZ.
-------------------------------------------------------–––----24.02.2011
warsztaty Poznań
25.02.2011
kurs
Poznań
-------------------------------------------------------–––----31.03.2011
warsztaty Nowy Targ
01-02.04.2011 kurs
Zakopane
-------------------------------------------------------–––----10.06.2011
kurs
Poznań
-------------------------------------------------------–––----02.09.2011
kurs
Poznań
-------------------------------------------------------–––----02.12.2011 kurs
Poznań
-------------------------------------------------------–––-----
Piśm i e n n i c t w o
1. Sobieszczyk S, Bęborowicz GH. Rekomendacje postępowania w krwotokach poporodowych.
Część I. Protokół postępowania. Kliniczna Perinatologia i Ginekologia. 2004, 40, 2, 60-63.
2. Combs C, Murphy E, Laros R. Factors associated with hemorrhage in cesarean deliveries.
Obstet Gynecol. 1991, 77, 77-82.
3. Delotte J, Novellas S, Koh C, [et al.]. Obstetrical prognosis and pregnancy outcome following
pelvic arterial embolisation for post-partum hemorrhage. Eur J Obstet Gynecol Reprod Biol.
2009, 145, 129-132.
Szczegółowe informacje na stronie internetowej Sekcji USG PTG:
www.usgptg.pl
4. B-Lynch C, Coker A, Lawal A, [et al.]. The B-Lynch surgical technique for the control of massive
postpartum haemorrhage: an alternative to hysterectomy? Five cases reported. Br J Obstet
Gynaecol. 1997, 104, 372-375.
5. Raba G, Baran P. Parametry hemodynamiczne po obustronnym podwiązaniu tętnic biodrowych
wewnętrznych, w leczeniu krwotoku porodowego. Ginekol Pol. 2009, 80, 179-183. English.
6. Brown B, Heaston D, Poulson A, [et al.]. Uncontrollable postpartum bleeding: a new approach to
hemostatsis through angiographic arterial embolisation. Obstet Gynecol. 1979, 54, 361-365.
7. Stefanowicz M, Stefanowicz E. Przezcewnikowa embolizacja tętnic biodrowych wewnętrznych
jako alternatywa dla chirurgicznego ich podwiązania. Ginekol Pol. 1993, 64, 461-464.
8. Pelage J, Le Dref M, Mateo J, [et al.]. Life-threatening primary postpartum hemorrhage: Tretment
with emergency selective arterial embolization. Radiology. 1998, 208, 359-362.
9. Pelage J, Soyer P, Repiquent D, [et al.]. Secondary postpartum hemorrhage: treatment with
selective arterial embolization. Radiology. 1999, 212, 385-389.
10. Rebelo Kristina SIR 2009. Embolization Technique effectively treats hemorrhaging after
cesarean delivery. 2009, Medscape Medical News.
11. Salazar G, Petrozza J, Walker T. Transcatheter Endovascular Techniques for Management of
Obstetrical and Gynecologic Emergencies. Tech Vasc Interv Radiol. 2009, 12, 139-147.
Zgł os z e nia lis t ownie , faxe m lu b e -maile m :
Sekcja Ultrasonografii PTG,
60-535 Poznań, ul. Polna 33
fax. 061 8419-647 ,
tel. 061 8419-334, 560
e-mail: [email protected]
Proszę przy zgłoszeniu podać nr NIP oraz dane do faktury
© Polskie Towarzystwo Ginekologiczne
149
Ginekol Pol. 2011, 82, 150-152
P R A C E
K A Z U I S T Y C Z N E
g i n e k o l o gi a
Olbrzymi guz jajnika – opis przypadku
i propozycja postępowania klinicznego
Giant ovarian tumor – case report
and proposal for clinical management
Stukan Maciej, Dudziak Mirosław, Pawłowski Maciej
Szpital Morski im PCK w Gdyni,
Gdyńskie Centrum Onkologii, Oddział Ginekologii Onkologicznej, Polska
Streszczenie
Przedstawiono postępowanie kliniczne u chorej z guzem jajnika o masie 90 kg. Przed zabiegiem wykonywano
nakłucia guza z ewakuacją płynowej zawartości oraz prowadzono żywienie pozajelitowe, w czasie operacji, po
wycięciu guza w całości, zastosowano czasowy ucisk z serwet w loży po guzie, a po zabiegu kontynuowano
leczenie żywieniowe oraz objawowe. Zastosowanie opisanego postępowania klinicznego pozwoliło wypisać chorą
w 10 dobie po operacji, bez powikłań, w dobrym stanie ogólnym.
Słowa kluczowe: guz jajnika / postępowanie kliniczne /
Abstract
A case report of a woman with 90kg ovarian tumor is presented. Paracentesis and intravenous alimentation was
performed before operation. During the surgery, the ovarian tumor was excised and abdominal cavity packing,
followed by slow pressure decreasing, was done. Intravenous together with oral alimentation was continued after
the operation. The patient was discharged on the 10th postoperative day, without any complications, in a good
overall condition.
Key words: ovarian tumor / clinical management / abdominal packing /
Adres do korespondencji:
Maciej Stukan
Szpital Morski im PCK w Gdyni,
Gdyńskie Centrum Onkologii, Oddział Ginekologii Onkologicznej.
Gdynia 81-519, ul. Powstania Styczniowego 1, Polska
tel. +48 58 6998920, fax. +48 58 6998935,
e-mail: [email protected]
150
Otrzymano: 20.06.2010
Zaakceptowano do druku: 15.01.2011
Nr 2/2011
Ginekol Pol. 2011, 82, 150-152
P R A C E
K A Z U I S T Y C Z N E
ginekologia
Stukan M, et al.
Wstęp
Olbrzymi guz jajnika stanowi problem kliniczny, a postępowanie z chorą powinno być zaplanowane i prowadzone we
współpracy klinicystów różnych specjalności. Największy opisany w literaturze guz jajnika ważył 149 kg [1].
Cel pracy
Celem pracy było przedstawienie postępowania klinicznego
u chorej z olbrzymim guzem jajnika.
Opis przypadku
Chora lat 49, z olbrzymim guzem w jamie brzusznej, bez
obciążeń internistycznych, leżąca, wydolna krążeniowo-oddechowo, z obrzękami kończyn dolnych, płynem w lewej jamie
opłucnej, ważąca 140 kg, została przyjęta do naszego oddziału
dnia 04.11.2009, po wcześniejszej hospitalizacji w szpitalu rejonowym, gdzie zmniejszono objętość guza jamy brzusznej
ewakuując 32 litry płynu w celu umożliwienia przeprowadzenia
badania obrazowego (zbyt mała bramka tomografu w stosunku
do obwodu brzucha chorej). W badaniu tomografii komputerowej stwierdzono, że jamę brzuszną wypełniał torbielowaty guz
o wymiarach 450x250x250mm, przemieszczający pozostałe narządy ku tyłowi, oraz policykliczną masę patologiczną, wypełniającą miednicę mniejszą, wielkości 250x180x150mm, wolny
płyn w jamie opłucnowej lewej oraz w jamie otrzewnej w miernej ilości.
W badaniach laboratoryjnych z odchyleń od normy
stwierdzono hipoproteinemię 5,6g/dl, hipoalbuminemię
– 2,6g/dl, niedokrwistość – Hb 10,6g/dl; podwyższone stężenia
CRP – 68,9mg/l, D-dimerów – 11510ug/l, CA 125 – 140,4U/ml,
oraz obniżone stężenie cholesterolu – 107mg/dl, limfocytopenię
– 650ul.
Nie oceniano stężenia innych markerów nowotworowych.
W okresie przedoperacyjnym, w ciągu 8 dni, wykonano kilkakrotne przezskórne nakłucia guza, ewakuując 26 litrów płynu
o gęstej, nieśluzowej konsystencji, koloru brunatnego (dodatkowo wcześniej upuszczono 32 litry). Wobec stanu klinicznego
chorej, płynu nie wysyłano do badania histologicznego przed
radykalnym leczeniem operacyjnym. Prowadzono również kompletne żywienie pozajelitowe, uzyskując poprawę stanu ogólnego
chorej i parametrów stanu odżywienia. Przetoczono 3j. masy erytrocytarnej i 2j. osocza.
Operację przeprowadzono dnia 16.11.2009. Bezpośrednio
przed rozpoczęciem zabiegu przetoczono 2000ml koloidalnych
płynów infuzyjnych, zastosowano profilaktycznie antybiotykoterapię i heparyny drobnocząsteczkowe 12 godzin wcześniej.
Jamę brzuszną otwarto z cięcia prostego, stwierdzono olbrzymi,
torbielowaty guz jajnika lewego, zrośnięty na całej powierzchni
z otrzewną, pętlami jelit i okolicą wnęki wątroby, oraz mięśniakowato zmienioną macicę. Guz jajnika, po wypreparowaniu ze
zrostów, wytoczono z jamy brzusznej w całości, jednoczasowo
układając złożone serwety do loży po guzie. (Rycina1).
Następnie co 5 minut zmniejszano stopniowo ucisk w jamie
brzusznej, poprzez usuwanie kolejnych serwet. Wypreparowano
oba moczowody, wycięto zmienioną macicę z prawymi przydatkami. W doraźnym badaniu histopatologicznym guz opisano jako
gruczolak śluzowy. Zabieg operacyjny zakończono, zakładając
do jamy otrzewnej 2 dreny. W czasie trwania operacji nie doszło
do istotnych zmian ciśnienia tętniczego krwi.
© Polskie Towarzystwo Ginekologiczne
Rycina 1. Wypełnienie jamy brzusznej serwetami, po wycięciu olbrzymiego guza
jajnika.
Chorą po zabiegu przekazano na Oddział Intensywnej Terapii
celem kontynuacji sztucznej wentylacji, którą prowadzono przez
okres 24 godzin po operacji, wyrównania ewentualnych zaburzeń
gospodarki wodno-elektrolitowej i kwasowo-zasadowej. W 3
dobie po zabiegu chorą przekazano ponownie do Oddziału
Ginekologii Onkologicznej.
W przebiegu pooperacyjnym zastosowano antybiotykoterapię, heparyny drobnocząsteczkowe w dawkach profilaktycznych,
kompletne żywienie pozajelitowe, prowadzone do 4 doby po
operacji włącznie, oraz leczenie objawowe. W drenach z jamy
otrzewnowej ewakuowano 600ml/dobę surowiczego płynu do 4
doby po operacji, później objętość zmniejszała się aż do wartości
śladowych w 9 i 10 dobie, gdy kolejno usunięto dreny. Od 3 doby
po operacji zastosowano pas podtrzymujący powłoki brzuszne.
Po operacji chora przez cały czas pozostawała wydolna krążeniowo-oddechowo, zachowując prawidłowe, stabilne wartości
ciśnienia tętniczego. Do domu została wypisana w 10 dobie po
zabiegu, w dobrym stanie ogólnym, chodząca, w pełni samodzielna.
Wynik ostatecznego badania histopatologicznego to śluzowy
guz jajnika o granicznej złośliwości. Łączna masa guza wynosiła
90kg (preparat z operacji razem z masą ewakuowanego wcześniej
płynu).
W czasie 6 miesięcy obserwacji pacjentka nie zgłaszała
dolegliwości, pozostawała w dobrym stanie ogólnym, podejmowała pracę.
Dyskusja
W pracy Einenkela i wsp. przedstawiono 19 chorych z guzami nabłonkowymi jajnika o masie powyżej 40kg, w 7 przypadkach rozpoznano raka jajnika lub guz o granicznej złośliwości
[2]. Największy opisany nabłonkowy złośliwy guz jajnika ważył
100kg [3], natomiast jedyny olbrzymi (>40kg) guz nienabłonkowy (włókniak) o masie 54kg został opisany przez Stukana i wsp.
[4].
151
P R A C E
Ginekol Pol. 2011, 82, 150-152
K A Z U I S T Y C Z N E
gineko l o gi a
Olbrzymi guz jajnika – opis przypadku i propozycja postępowania klinicznego.
Średnia wielkość guzów śluzowych jajnika o granicznej złośliwości to około 20cm [5]. Opisywany guz w chwili operacji
miał wymiary 50x45x26 cm.
Duża masa patologiczna, wypełniająca jamę brzuszną, powoduje uciśnięcie łożyska naczyniowego oraz narządów znajdujących się w jamie otrzewnej, przesunięcie przepony ku górze,
doprowadzając do zmniejszenia objętości płuc i rozciągnięcia
powłok brzusznych. Masa ciała chorej przed operacją zwykle
przekracza normę, jednak najczęściej pacjentka jest niedożywiona. Po wycięciu guza, w bezpośrednim czasie po operacji
następuje przesunięcie krwi do wcześniej uciśniętych naczyń
jamy otrzewnowej i powłok brzusznych, co może objawiać się
hipotonią, doprowadzić do wstrząsu hipowolemicznego, krwawienia z powłok brzusznych [2, 3, 6]. Obserwuje się przesunięcia płynów do trzeciej przestrzeni – wodobrzusze, płyn w jamie
opłucnowej w okresie pooperacyjnym [4]. Wycięcie guza wraz
z krwią zalegającą w jego naczyniach stanowi dodatkowy czynnik ryzyka załamania się wydolności krążeniowej w trakcie zabiegu operacyjnego. W późniejszym czasie istnieje ryzyko skrętu
jelita, powstania przepukliny brzusznej [2].
Naszym zdaniem, w opisanym przypadku, najważniejsze
były trzy czynności kliniczne zastosowane w okresie okołoi śródoperacyjnym: po pierwsze stopniowe zmniejszanie objętości guza i ucisku przez niego powodowanego poprzez przedoperacyjne nakłucia i ewakuację płynu; po drugie, po wycięciu guza,
zastosowany śródoperacyjnie ucisk na łożysko naczyniowe, który był powoli zmniejszany; oraz po trzecie prowadzenie żywienia
pozajelitowego.
W literaturze opisuje się śródoperacyjne lub przedoperacyjne nakłuwanie torbielowatego guza i powolne zmniejszanie jego
objętości. Doniesienia na temat zapobiegania w ten sposób powikłaniom krążeniowo-oddechowym są niejednoznaczne. Jedni
autorzy zalecają takie postępowanie [3, 7, 8, 9], inni podają, że
nie ma ono wpływu na zmniejszenie powikłań [10], jeszcze inne
prace nie zalecają takiej metody [11, 12].
Główne wątpliwości związane z procedurą nakłucia dotyczą
ryzyka wszczepów nowotworowych do powłok w przypadku guzów złośliwych. W wyniku łącznej analizy 19 przypadków chorych z guzami o masie powyżej 40 kg, nie stwierdzono istotnych
korzyści z rutynowego nakłuwania i drenowania światła torbieli
dla przebiegu okołooperacyjnego, jeżeli nie było takiej potrzeby
[2].
Innym zalecanym postępowaniem śródoperacyjnym jest
rozpoczęcie zabiegu od wrzecionowatego nacięcia skóry, a następnie usunięcie nadmiaru rozciągniętych wcześniej na guzie
powłok brzusznych wraz z rozbudowanym łożyskiem naczyniowym [3, 6]. Rozważa się również odstąpienie od rozdzielania
zrostów torbieli z powłokami i pozostawienie części torebki guza
przyrośniętej do otrzewnej ściennej. Celem takiego postępowania jest zapobieganie wystąpieniu masywnego krwawienia z dużej powierzchni otrzewnej [3].
W literaturze nie opisywano do tej pory ani śródoperacyjnego ucisku łożyska naczyniowego po wycięciu olbrzymiego
guza ze stopniowym zmniejszaniem ciśnienia, ani przygotowania
przedoperacyjnego w postaci żywienia pozajelitowego u takich
chorych, chociaż większość z nich prezentowała objawy niedożywienia.
152
W podsumowaniu przedstawionego opisu przypadku można
podejrzewać, że kilkukrotne nakłucia i ewakuacja płynu z torbielowatego, olbrzymiego guza jajnika przed operacją, zastosowanie wypełnienia jamy brzusznej serwetami po wycięciu torbieli
w całości, z następowym powolnym zmniejszaniem ucisku, oraz
prowadzenie żywienia pozajelitowego było optymalnym postępowaniem, które pozwoliło na wyleczenie chorej bez wystąpienia istotnych powikłań śród- i pooperacyjnych.
P i ś mi e nni c two
1. Spohn A. Multicystic ovarian tumour weighing 328 lb. Tex Med. 1905, 1, 273.
2. Einenkel J, Alexander H, Schotte D, [et al.]. Giant ovarian cysts: is a pre- and intraoperative
drainage an advisable procedure? Int J Gynecol Cancer. 2006, 16, 2039-2043.
3. Yanazume Y, Yoshinaga M, Yanazume S, [et al.]. Giant ovarian cancer weighing 100 kg with
poor prognosis. J Obstet Gynaecol Res. 2007, 33, 91-94.
4. Stukan M, Wojtylak S, Pietrzak-Stukan M, [et al.]. A giant ovarian fibroma. Acta Obstet Gynecol
Scand. 2009, 88, 860-861.
5. Makarewicz H, Emerich J, Olszewski J. Comparision of two groups of patients with serous and
mucinous type of borderline ovarian tumors. Ginekol Pol. 2003, 74, 24-29.
6. Pretorius R, Matory W, LaFontaine D. Management of massive ovarian tumors. Surg Gynecol
Obstet. 1989, 169, 532-536.
7. Suntharasaj T, Sriwongpanich S, Sorapipat C. The largest ovarian cyst in Songklanagarind
Hospital: A case report. J Med Assoc Thai. 1994, 77, 445-448.
8. Kim Y, Kim J, Choe B. A case of huge ovarian cyst of 21-year-old young woman. J Obstet
Gynaecol Res. 1999, 25, 275-279.
9. Koshiba H, Kitawaki J, Fujita H, [et al.]. Giant ovarian tumor removed after preoperative drainage,
with abdominoplasty. J Reprod Med. 2003, 48, 652-654.
10. Morrison P, Morgan G. Removal of a giant ovarian cyst. Anaesthetic and intensive care
management. Anaesthesia. 1987, 42, 965-974.
11. Vipond M, Michie H, Hershman M, [et al.]. Management of giant ovarian cyst. Br J Hosp Med.
1991, 45, 313-314.
12. Hunter D. Management of a massive ovarian cyst. J Obstet Gynaecol Res. 1999, 25, 275279.
Nr 2/2011
Ginekol Pol. 2011, 82, 153-155
P R A C E
K A Z U I S T Y C Z N E
ginekologia
Powtórne założenie wkładki
wewnatrzmacicznej po nierozpoznanym
przemieszczeniu poprzedniej
do jamy brzusznej
Insertion of IUD after extrauterine mislocation
of the previous one
Lewandowski Jan, Cieminski Adam, Emerich Janusz
Oddział Ginekologiczno-Położniczy w Ustce
Wojewodzkiego Szpitala Specjalistycznego w Słupsku, Polska
Streszczenie
Przedstawiono przypadek 37-letniej pacjentki z obecnością dwóch IUD – jednej prawidłowo usadowionej i drugiej
w obrębie miednicy mniejszej, 5 lat po ich założeniu. Zwrócono uwagę na konieczność wnikliwej diagnostyki
pacjentek, u których nie uwidoczniono nitek IUD w kontrolnym badaniu ginekologicznym.
Słowa kluczowe: wkładka wewnątrzmaciczna / przemieszczenie / diagnostyka /
Abstract
We present a case report of a 37-year-old woman with accidental finding of two IUDs – one inserted correctly, and
the other one located in the abdomen.
Key words: intrauterine device / translocation / diagnostics /
Adres do korespondencji:
Jan Lewandowski
Oddział Ginekologiczno-Położniczy w Ustce
Wojewódzkiego Szpitala Specjalistycznego w Słupsku
76-270 Ustka, ul. Mickiewicza 12, Polska
tel. +48 59 8154220, fax. +48 59 8154239
e-mail: [email protected]
© Polskie Towarzystwo Ginekologiczne
Otrzymano: 15.11.2010
Zaakceptowano do druku: 20.01.2011
153
P R A C E
Ginekol Pol. 2011, 82, 153-155
K A Z U I S T Y C Z N E
gineko l o gi a
Lewandowski J, et al.
Wstęp
Wkładka wewnątrzmaciczna jest powszechnie stosowaną
i akceptowaną metodą antykoncepcji. Skuteczność antykoncepcyjna tej metody ze wskaźnikiem Pearl’a rzędu 0,1-0,2 dla
wkładki typu Mirena jest bardzo wysoka [1].
Nie jest to jednak metoda pozbawiona powikłań. Do najpoważniejszych należy perforacja macicy podczas introdukcji
wkładki (1,6-2,2 na 1000 przypadków) [3]. Możliwe jest także
późniejsze przemieszczenie się nieprawidłowo założonej wkładki do jamy otrzewnowej, jak też jej samoistne wydalenie z jamy
macicy [2].
Opis przypadku
Pacjentka lat 37 po urazie lokomocyjnym, trafiła do Oddziału Ratunkowego w październiku 2005 roku z podejrzeniem
złamania kości miednicy. Badaniem RTG miednicy mniejszej
stwierdzono złamaną kość guziczną. Równocześnie zauważono
za macicą, w zatoce Douglasa obecność ciała obcego w postaci
wkładki domacicznej. Dodatkowo stwierdzono drugą wkładkę
antykoncepcyjną umiejscowioną prawidłowo w jamie macicy.
(Fot. 1).
W wywiadzie jeden poród drogami i siłami natury w 2001
roku, poprzedzony dwoma poronieniami samoistnymi. Pacjentka
była zdrowa nie przyjmowała żadnych leków. 5 lat przed hospitalizacją, a 4 lata po porodzie założono IUD typu Mirena.
Jak podaje pacjentka w czasie zakładania wkładki w gabinecie ginekologicznym wystąpiły raptowne, silne bóle podbrzusza,
które spowodowały dwukrotną utratę przytomności. Bóle brzucha utrzymywały się przez cały dzień. Wystąpiło też obfite krwawienie z dróg rodnych, które nasiliło się w godzinach nocnych.
W kolejnych dniach przy przyjmowaniu leków przeciwbólowych
i rozkurczowych bóle jak też krwawienie zmniejszyły się. Po 3
tygodniach od założenia wkładki w czasie kontrolnego badania
ginekologicznego nie stwierdzono nitek IUD w ujściu zewnętrznym szyjki macicy.
W badaniu USG sondą dopochwową nie stwierdzono obecności wkładki wewnątrzmacicznej w jamie macicy. Nie stwierdzono również innych nieprawidłowości w obrębie narządu
rodnego jak i miednicy mniejszej. Na tej podstawie uznano, że
wkładka wypadła. Założono więc drugą wkładkę w znieczuleniu
ogólnym. Zabieg przebiegł bez powikłań. Niemniej pacjentka ciągu kolejnych miesięcy uskarżała się na uczucie osłabienia,
bóle głowy, nadpobudliwość, nudności, wzdęcia, biegunki oraz
alergie skórną i pokarmową. Według relacji pacjentki wyżej wymienione objawy wcześniej nie występowały.
Po stwierdzeniu w Oddziale Ratunkowym drugiej wkładki
w obrębie jamy brzusznej wykonano badanie tomografii komputerowej, które potwierdziło obecność dwóch wkładek antykoncepcyjnych – jednej prawidłowo usadowionej w macicy, drugiej
w jamie brzusznej. Po przyjęciu do Oddziału GinekologicznoPołożniczego w Ustce pacjentka została zakwalifikowana do
laparoskopii diagnostycznej. Po wprowadzeniu układu optycznego laparoskopu, po odsunięciu jelit i sieci większej dogłowowo, nie uwidoczniono wkładki antykoncepcyjnej w obrębie
miednicy mniejszej. Przeprowadzona szczegółowa inspekcja
laparoskopowa nie wykazała obecności ciała obcego w jamie
brzusznej. Z tego powodu zdecydowano o konwersji do laparotomii. Cięciem poprzecznym nad spojeniem łonowym otwarto
jamę brzuszną. Podczas badania palpacyjnego narządów jamy
154
Fot. 1. RTG miednicy mniejszej – widoczne dwie IUD.
Fot. 2. IUD wrośnięta w sieć większą.
brzusznej stwierdzono, że wkładka domaciczna znajduje się na
tylnej powierzchni sieci większej 3-4cm od jej brzegu. Nie sposób było jej usunąć z powodu głębokiej penetracji do sieci, dlatego też przeprowadzono częściową resekcję sieci większej wraz
z wkładką. (Fot. 2).
Przebieg pooperacyjny niepowikłany. Pacjentkę wypisano
do domu w 3 dobie po zabiegu.
Dyskusja
Pomimo, iż perforacja macicy jako powikłanie założenia
IUD należy do rzadkości to mnogość opisywanych przypadków
w ostatnich latach w Polsce i na świecie pokazuje, że problem
pojawia się codziennej praktyce lekarskiej. Dostępne są
publikacje opisujące odnalezione wkładki wewnątrzmaciczne
w obrębie jelita grubego, pęcherza moczowego, przymacicz,
zatoki Douglasa, wyrostka robaczkowego, sieci większej czy
guzów zapalnych miednicy mniejszej [2, 3, 5, 6, 7, 8, 9].
Nr 2/2011
Ginekol Pol. 2011, 82, 153-155
P R A C E
K A Z U I S T Y C Z N E
ginekologia
Powtórne założenie wkładki wewnatrzmacicznej...
Większość przypadków nie jest rozpoznawanych podczas
zabiegu założenia IUD. Jak pokazują doświadczenia niektórych
autorów, nawet wieloletnie, bezobjawowe przebywanie wkładki
w organizmie kobiety poza macicą może dać poważne późne
powikłania [4, 9].
W dostępnym piśmiennictwie krajowym i zagranicznym
nie znaleźliśmy przypadku, w którym pacjentka przez kilka lat
miałaby umieszczone dwie wkładki – jedną prawidłowo, a drugą
przemieszczoną w obręb jamy brzusznej. Pragniemy również
zauważyć, iż rozpoznanie samoistnego wydalenia wkładki przez
kanał szyjki macicy (występujące w 4-5% przypadków), które
może być niezauważone przez pacjentkę, wymaga szczegółowej
kontroli [1]. Poza rutynowym USG przezpochwowym
zobowiązuje w wątpliwych przypadkach do wykonania także
badania RTG lub TK jamy brzusznej i miednicy mniejszej. K O M U N I K AT
Wnioski
1. Brak nitek IUD w kontrolnym badaniu ginekologicznym
nie upoważnia do stwierdzenia samoistnego wydalenia
wkładki domacicznej.
2. W badaniu USG przezpochwowym nie zawsze można
stwierdzić nieprawidłowo umieszczoną wkładkę
wewnątrzmaciczną w obrębie jamy brzusznej.
Piśm i e n n i c t w o
1.
Meisenbacher K. Antykoncepcja. 2008, 61-64.
2. Gardyszewska A, Niewiadomska-Kowalczyk M, Szymańska B, [i wsp.]. Przemieszczenia
wkładek wewnątrzmacicznych poza jamę macicy. Ginekol Pol. 2009, 80, 942-945.
3. Kowalczyk D, Mączka M, Guzikowski W, [i wsp.]. Problemy kliniczne związane z obecnością
wkładek wewnątrzmacicznych poza jamą macicy – laparoskopowa ewakuacja z jamy
otrzewnowej – opis przypadków. Gin Prakt. 2005, 86, 14-16.
4. Sikora-Szczęśniak D, Sikora W, Rojewski R, Szczęśniak G. Leczenie operacyjne kobiet z
powodu powikłań po stosowaniu wewnątrzmacicznych wkładek antykoncepcyjnych. Gin Prakt.
2004, 12, 6-11.
5. Balci O, Mahmoud A, Cpar M. Diagnosis and management of intra-abdominal, mislocated
intrauterine devices. Arch Gynecol Obstet. 2010, 281, 1019-1022.
6. Chell K, Lipscomb G. Abdominal wall abscess presenting 35 years after insertion of an
intrauterine contraceptive device. Obstet Gynecol. 2010, 115, 458-459.
7. Brunner S, Comman A, Gaetzschmann P, [et al.]. Laparoscopic removal of a perforating
intrauterine device mimicking chronic appendicitis. J Laparoendosc Adv Surg Tech A. 2008, 18,
609-610.
8. Sentilhes L, Lefebvre-Lacoeuille C, Poilblanc M. Incidental finding of an intrauterine device in
sigmoid colon. Eur J Contracept Reprod Health Care. 2008, 13, 212-214.
9. Istanbulluoglu M, Ozcimen E, Ozturk B, [et al.]. Bladder perforation related to intrauterine device.
J Chin Med Assoc. 2008, 71, 207-209.
© Polskie Towarzystwo Ginekologiczne
155
K O M U N I K A T Y
156
Ginekol Pol. 2011, 82, 156
Nr 2/2011
Ginekol Pol. 2011, 82, 157
K O M U N I K A T Y
Sekcja Ginekologii Operacyjnej PTG
Klinika Ginekologii Operacyjnej i Endoskopowej
Instytutu Centrum Zdrowia Matki Polki w Łodzi
Se r de c zn i e zapras za j ą n a
Kursy Doskonalące – Warsztaty Operacyjne
dla Ginekologów w roku 2011
Te r m i n y :
–––––––––––––––––
24-25 STYCZEŃ
–––––––––––––––––
21-22 LUTY
–––––––––––––––––
14-15 MARZEC
–––––––––––––––––
22 MARZEC
–––––––––––––––––
25-26 MARZEC
–––––––––––––––––
11-12 KWIECIEŃ
–––––––––––––––––
16-17 MAJ –––––––––––––––––
14 CZERWIEC
–––––––––––––––––
19-20 WRZESIEŃ –––––––––––––––––
3-4 PAŹDZIERNIK
–––––––––––––––––
24-25 PAŹDZIERNIK
–––––––––––––––––
15 LISTOPAD –––––––––––––––––
18-19 LISTOPAD –––––––––––––––––
21-22 LISTOPAD –––––––––––––––––
12-13 GRUDZIEŃ –––––––––––––––––
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Laparoskopowa i Pochwowa Hysterectomia
–––––––––––––––––––––––––––
• Intensywny Kurs Szycia w Laparoskopii
–––––––––––––––––––––––––––
• Operacje Laparoskopowe w Ginekologii
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Laparoskopowa i Pochwowa Hysterectomia
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Operacje Laparoskopowe w Ginekologii
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Laparoskopowa i Pochwowa Hysterectomia
–––––––––––––––––––––––––––
• Intensywny Kurs Szycia w Laparoskopii
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Zaburzenia Statyki Narządów Płciowych
–––––––––––––––––––––––––––
• Operacje Pochwowe - Zaburzenia Statyki Narządów Płciowych:
24-25/01; 21-22/02; 14-15/03; 16-17/05; 19-20/09; 24-25/10;
21-22/11; 12-13/12
• Operacje Laparoskopowe w Ginekologii:
11-12 /04; 3-4/10
• Laparoskopowa i Pochwowa Hysterektomia:
22/03; 14/06; 15/11
• Intensywny Kurs Szycia w Laparoskopii:
25-26/03; 18-19/11
szczegóły, cena , wa r unk i na s t r o ni e i nt er neto w e j :
www.laparoskopia.org.pl
© Polskie Towarzystwo Ginekologiczne
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
––––––––
Przewodniczący Sekcji Ginekologii Operacyjnej PTG
Kierownik Kliniki Ginekologii Operacyjnej i Endoskopowej ICZMP
prof. dr hab. n med. Andrzej Malinowski
157
Ginekol Pol. 2011, 82, 158
K O M U N I K A T Y
K O M U N I K AT
M AZURSKA S ZKOŁA U SG
I G INEKOLOGII
Planowane kursy w Mazurskiej Szkole USG
i Ginekologii w 2011 roku
Warunki prenumeraty
Uprzejmie informujemy, i˝ cz∏onkowie Polskiego Towarzystwa Ginekologicznego
b´dà otrzymywali Ginekologie Polskà po wczeÊniejszym op∏aceniu sk∏adki
cz∏onkowskiej w odpowiednim Oddziale PTG.
•••••••••••••••••••••••••••••••••••••••••••••••••••••
14-16.01.2011
Zimowy kurs USG w ginekologii i położnictwie
dla zaawansowanych.
•••••••••••••••••••••••••••••••••••••••••••••••••••••
24-26.02.2011
Doppler w ginekologii i położnictwie.
Kierownik naukowy: prof. dr hab. Mariusz Dubiel
•••••••••••••••••••••••••••••••••••••••••••••••••••••
9-12.03.2011
USG w ginekologii i położnictwie dla zaawansowanych.
Kierownik naukowy: prof. dr hab. Romuald Dębski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
20-25.03.2011
USG w ginekologii i położnictwie dla początkujących.
Teoria i praktyka.
Kierownik naukowy: prof. dr hab. Romuald Dębski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
7-9.04.2011
Diagnostyka prenatalna z elementami echokardiografii płodu.
Kierownik naukowy: dr hab. Dariusz Borowski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
14-16.04.2011
Warsztaty ginekologiczne. Diagnostyka i leczenie zmian
szyjki macicy i sromu.
Kierownik naukowy: prof. dr hab. Andrzej Malarewicz
•••••••••••••••••••••••••••••••••••••••••••••••••••••
8-13.05.2011
USG w ginekologii i położnictwie dla początkujących. Teoria
i praktyka.
Kierownik naukowy: prof. dr hab. Romuald Dębski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
26-28.05.2011
Kolposkopia dla początkujących.
Kierownik naukowy: prof. dr hab. Andrzej Malarewicz
•••••••••••••••••••••••••••••••••••••••••••••••••••••
2-4.06.2011
Choroby sutka z elementami diagnostyki USG.
Kierownik naukowy: prof. dr hab. Romuald Dębski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
9-11.06.2011
Patologia ciąży.
Kierownik naukowy: prof. dr hab. Romuald Dębski
•••••••••••••••••••••••••••••••••••••••••••••••••••••
Wysy∏ka Ginekologii Polskiej do cz∏onków PTG jest dokonywana na podstawie list
dostarczonych z poszczególnych oddzia∏ów PTG do Redakcji „Ginekologii
Polskiej”.
Uprzejmie prosimy wszystkich zainteresowanych o zaktualizowanie danych
adresowych w swoich Oddzia∏ach PTG.
Koszt rocznej prenumeraty (krajowa i zagraniczna) dla osób nie b´dàcych
cz∏onkami PTG i instytucji na 2008 rok wynosi 180,00 PLN.
Zamówienie wraz z kserokopià dowodu wp∏aty prosimy przesy∏aç na adres:
Redakcja „Ginekologii Polskiej”
Ma∏gorzata Skowroƒska
60-535 Poznaƒ, ul. Polna 33
tel. 061 84-19-265; fax.: 061 84-19-465
e-mail: [email protected]; [email protected]
www.ginekolpol.com
Wp∏at nale˝y dokonywaç na konto:
ING Bank Âlàski – nr konta: 14 1050 1953 1000 0023 1354 3718
Instrukcja dla autorów w j´zyku polskim i angielskim znajduje si´
na stronie: www.ginekolpol.com
Redakcja
––––––––––––––––––––––––––––––––––––––––––––––
W s z e l k i e i nfor macje or az z apisy na kur sy:
www.usg.pisz.pl, [email protected]
tel.: 0 504 075 804 (8:00-15:00)
MAZURSKA SZKOŁA USG I GINEKOLOGII,
GEMELLI S.C.
UL. LEŚNA 18, 12-200 PISZ
158
Nr 2/2011
Ginekol Pol. 2011, 82, 159
K O M U N I K A T Y
II. Zasady szczegó∏owe
1. Prace oryginalne
Powinny byç napisane w j´zyku polskim lub angielskim wed∏ug ni˝ej zamieszczonych wymogów.
Nie mogà przekraczaç 2500-3000 s∏ów (16000-18000 znaków ze spacjami).
2. Prace poglàdowe
Nie muszà zawieraç n/w struktury i nie mogà przekraczaç 2000 s∏ów (10000-12000 znaków ze
spacjami).
Regulamin dla Autorów
I. Zasady ogólne
1. „Ginekologia Polska” jest miesi´cznikiem wydawanym w j´zyku polskim i angielskim.
2. W „Ginekologii Polskiej” zamieszczane sà prace oryginalne, poglàdowe, kazuistyczne, listy do redakcji oraz zamawiane artyku∏y redakcyjne i poglàdowe z zakresu ginekologii i po∏o˝nictwa oraz
dziedzin bezpoÊrednio z nimi zwiàzanych.
3. Prace opublikowane w „Ginekologii Polskiej” stajà si´ w∏asnoÊcià Polskiego Towarzystwa Ginekologicznego i Redakcji. Przedruk w ca∏oÊci lub fragmentach, czy te˝ t∏umaczenie na inny j´zyk
mogà byç dokonane wy∏àcznie po uzyskaniu pisemnej zgody Redakcji.
Redakcja nabywa na zasadzie wy∏àcznoÊci ogó∏ praw autorskich do opublikowanych prac, w tym
prawo do wydawania drukiem, na noÊnikach elektronicznych i innych oraz w Internecie.
Dopuszcza si´ drukowanie streszczeƒ bez zgody Redakcji.
4. Prace opisujàce doÊwiadczenia na ludziach musi byç zgodna z wymogami Deklaracji Helsiƒskiej
oraz standardami etycznymi (dotyczy: etyki lekarskiej, która zabrania podawania imienia i nazwiska pacjenta, inicja∏ów lub numeru ewidencji szpitalnej) odpowiedniej komisji etycznej, a takie
oÊwiadczenie nale˝y do∏àczyç do pracy. Informacja o zgodzie danej komisji etycznej na przeprowadzenie badaƒ i Êwiadomej zgodzie pacjentów na udzia∏ w badaniu powinna byç zawarta
w rozdziale Materia∏ w ka˝dej pracy, w której post´powanie diagnostyczne lub lecznicze nie by∏o post´powaniem standardowym. Autorzy poszczególnych opisów przypadków sà zobowiàzani
do niepodawania danych personalnych pacjentów.
5. Autorzy prac, którzy przedstawiajà wyniki badaƒ klinicznych dotyczàcych leków i poszczególnych
procedur medycznych powinni zamieÊciç w pracy dok∏adny opis sposobu finansowania badania
oraz roli sponsora w planowaniu, realizacji i analizie wykonanych wyników, a tak˝e jaki jednostka finansujàca mia∏a wp∏yw na treÊç artyku∏u. W pracy nale˝y u˝ywaç mi´dzynarodowych nazw
leków.
6. Prace publikowane na ∏amach „Ginekologii Polskiej” sà recenzowane (przez 2 recenzentów).
Ka˝da praca zostanie zrecenzowana w ciàgu 30-45 dni od daty jej zarejestrowania przez redakcj´,
a Autorzy b´dà poinformowani o wynikach recenzji i dalszym post´powaniu wydawniczym.
7. Redakcja „Ginekologii Polskiej” nie ponosi odpowiedzialnoÊci za stwierdzenia, opinie czy te˝ dane umieszczone w pracach lub materia∏ach reklamowych.
8. Redakcja „Ginekologii Polskiej” zastrzega sobie prawo wyboru prac do kolejnych numerów
9. Redakcja „Ginekologii Polskiej” zastrzega sobie mo˝liwoÊç skracania tekstów oraz dokonywania
koniecznych poprawek stylistycznych i mianownictwa bez porozumienia z Autorami.
10. Za opublikowanie pracy w „Ginekologii Polskiej” autorzy nie otrzymujà wynagrodzenia.
11. Prac´ nale˝y zarejestrowaç i przes∏aç tylko i wy∏àcznie za pomocà programu zamieszczonego na
stronie: www.ginekolpol.com
12. Plik z pracà przesy∏anà do Redakcji za pomocà programu rejestracyjnego musi byç zapisana w
formacie Worda z rozszerzeniem .doc oraz zawieraç n/w elementy:
• tytu∏ pracy w j´zyku polskim i angielskim,
• nazwiska i imiona autorów oraz ich afilacj´,
• adres do korespondencji, który musi zawieraç: imi´ i nazwisko autora, nazw´ jednostki,
dok∏adny adres, numer telefonu i faxu oraz adres e-mail,
• streszczenie pracy w j´z. polskim i angielskim,
• s∏owa kluczowe w j´z. polskim i angielskim,
• treÊç pracy.
13. Do Redakcji nale˝y przes∏aç:
• zgod´ na publikacj´ wyników badaƒ wszystkich autorów
• zgod´ kierownika kliniki (zak∏adu, ordynatora),
• oÊwiadczenie, ˝e praca nie by∏a w ca∏oÊci lub cz´Êci publikowana w innych czasopismach
oraz i˝ nie skierowano jej do publikacji w innym czasopiÊmie.
14. Powy˝sze dokumenty prosimy przesy∏aç na adres:
Redakcja „Ginekologii Polskiej”
60-535 Poznaƒ, ul. Polna 33
tel. 061 84-19-265; fax.: 061 84-19465;
adres e-mail: [email protected]
15. Stosowanie si´ Autorów do zasad ogólnych i szczegó∏owych jest koniecznym warunkiem
przyj´cia oraz ewentualnego opublikowania pracy w „Ginekologii Polskiej”.
16. Prace w j´zyku angielskim, które zostanà zaakceptowane do druku MUSZÑ byç przes∏ane przez
Autorów do t∏umacza, który pracuje pod nadzorem merytorycznym redakcji „Ginekologii
Polskiej”. Koszty t∏umaczenia ponoszà Autorzy. Kontakt do t∏umacza b´dzie podawany Autorom,
w momencie decyzji o druku pracy.
© Polskie Towarzystwo Ginekologiczne
3. Prace kazuistyczne
Prace powinny byç skonstruowane wg n/w wzoru i nie mogà przekraczaç 2000 s∏ów (1000012000 znaków ze spacjami).
4. Ogólna konstrukcja pracy:
a) Tytu∏ – w j´zyku polskim i angielskim; powinien byç zwi´z∏y i oddawaç w miar´ szczegó∏owo
tematyk´ pracy.
b) Imiona i nazwiska autorów – muszà byç podane pe∏ne imiona i nazwiska wszystkich autorów
c) Nazwa i adresy instytucji w których wykonano prac´ – powinny byç podane pe∏ne nazwy oraz
kompletne adresy wszystkich instytucji.
d) Adres, telefon, e-mail g∏ównego autora – do tego autora b´dzie kierowana ca∏a korespondencja zwiàzana z post´powaniem redakcyjnym; autor ten ma obowiàzek przekazywania innym
wspó∏autorom wszystkich informacji dotyczàcych pracy.
e) Streszczenie pracy – musi byç napisane w j´zyku polskim i angielskim oraz posiadaç budow´
strukturalnà: Cel pracy, Materia∏ i metody, Wyniki, Wnioski (ang: Objectives, Material and methods, Results, Conclusions). Streszczenie maksymalnie mo˝e zawieraç 250 s∏ów (1500-2000
znaków ze spacjami). W pracach poglàdowych i kazuistycznych streszczenie nie musi mieç budowy strukturalnej, lecz tak˝e nie mo˝e przekroczyç 250 s∏ów.
f) S∏owa kluczowe – trzy do szeÊciu s∏ów kluczowych w j´zyku polskim i angielskim nale˝y umieÊciç pod streszczeniem. Nomenklatura s∏ów kluczowych musi byç zgodna z Medical Subject
Headings (Index Medicus) – www.nlm.nih.gov/mesh/MBrowser.html
g) TreÊç pracy – musi byç czytelnie podzielona wed∏ug ni˝ej podanej budowy strukturalnej:
• Wst´p – powinien zawieraç ogólny stan wiedzy na dany temat.
• Cel pracy – nale˝y sformu∏owaç i w miar´ mo˝liwoÊci okreÊliç na ile jest on oryginalny.
• Materia∏ i metody – opis badanej grupy oraz u˝ytych metod badawczych i analizy
statystycznej.
• Wyniki – nale˝y ujàç je bardzo czytelnie, przejrzyÊcie (sugestia Redakcji: ró˝nego rodzaju wykresy – np. krzywe czy s∏upkowe – sà bardziej czytelne ni˝ przedstawienie wyników tylko
w tekÊcie lub tabelach).
• Dyskusja – nale˝y ujàç w jakim zakresie zosta∏y osiàgni´te za∏o˝one cele pracy, na ile wyniki sà oryginalne, na ile tylko potwierdzajà dane z piÊmiennictwa polskiego lub Êwiatowego, jakie napotkano ograniczenia w metodach pracy, jakie znaczenie kliniczne mo˝e mieç praca.
Uzyskane wyniki nale˝y przedstawiç w kontekÊcie danych z piÊmiennictwa.
• Wnioski – powinny nawiàzywaç do za∏o˝onych celów pracy i byç przedstawione w sposób
precyzyjny i jasny.
• Podzi´kowania – dla osób, instytucji które pomog∏y w realizacji pracy (np. KBN).
• PiÊmiennictwo – musi zawieraç wykaz wszystkich wymienionych w tekÊcie êróde∏ bibliograficznych w kolejnoÊci cytowaƒ oraz byç pisane jedno pod drugim. Kolejne numery piÊmiennictwa w tekÊcie pracy nale˝y podawaç w nawiasach kwadratowych na koƒcu zdaƒ.
Nie nale˝y powo∏ywaç si´ na prace niepublikowane czy informacje ustne. Pozycje piÊmiennictwa powinny zawieraç nazwiska i inicja∏y autorów (bez stawiania kropek po inicjale imienia);
nale˝y przedstawiç 3 pierwsze nazwiska oraz dalej [i wsp.] lub [et al.]; tytu∏ pracy, skrót nazwy
pisma (wg Index Medicus), rok wydania, tom oraz strony: pierwszà i ostatnià. Rozdzia∏y
w ksià˝kach lub monografiach powinny byç cytowane nast´pujàco: nazwisko i inicja∏y autorów, tytu∏ rozdzia∏u, tytu∏ ksià˝ki, nazwisko i inicja∏ redaktora ksià˝ki, nazwa wydawcy, miejsce wydania, rok, strony.
Przyk∏ady prawid∏owego zapisu bibliografii znajdujà si´ na stronie:
www.ginekolpol.com
• Tekst pracy powinien byç napisany :
- czcionkà 12 punktów Arial lub Times New Roman; Prosimy tekstu nie formatowaç!
- z odst´pem wiersza 1,5
- wyrównaniem tekstu do lewego marginesu
- marginesy: z ka˝dej strony powinny wynosiç 2,5 cm; tylko na 1 stronie pracy prosimy
o margines górny 7 cm; do akapitów, które majà si´ zaczynaç od „wci´cia” prosimy
u˝ywaç klawisza TAB (a nie spacji).
• Tabele mogà byç umieszczone w tym samym pliku co tekst pracy; powinny one zawieraç
tytu∏ w j´zyku polskim oraz byç ponumerowane cyframi rzymskimi.
• Ryciny i fotografie – mogà byç wykonane technikà kolorowà lub czarno-bia∏à; muszà byç
one umieszczone w oddzielnych plikach i zapisane w jednym z nast´pujàcych formatów: JPG,
CDR, TIFF, PPT, AI, EPS o mo˝liwie najwi´kszej rozdzielczoÊci; (elektronicznie zapisane fotografie powinny posiadaç rozdzielczoÊç 300 dpi, zapis *.jpg, *.tif, *.ai, *.eps).
Ryciny i fotografie nale˝y ponumerowaç wed∏ug kolejnoÊci pojawiania si´ w tekÊcie cyframi
arabskimi, a opisy rycin powinny byç w j´zyku polskim; odwo∏ania do ilustracji muszà byç zaznaczone w tekÊcie.
• Skróty trzeba objaÊniaç przy pierwszym wystàpieniu terminu skracanego w tekÊcie (dotyczy
tak˝e streszczenia); w tytule pracy (poza szczególnymi przypadkami) nale˝y unikaç u˝ywania
skrótów.
• Wyniki badaƒ laboratoryjnych, odpowiednie normy i odchylenia standardowe muszà byç
wyra˝one w jednostkach przyj´tych przez Mi´dzynarodowy Uk∏ad Jednostek Miar SI.
Redakcja
159
K O M U N I K A T Y
Ginekol Pol. 2009, 80, 479
Instructions for Authors
I. General guidelines
1. “Ginekologia Polska” is a monthly medical journal published in Polish and English language.
2. “Ginekologia Polska” will accept submissions relating to any aspect of gynaecology, obstetrics and
areas directly related. “Ginekologia Polska” publishes original contributions, comparative works,
case studies, letters to the editor and many other categories of articles.
3. Published manuscripts become the permanent property of Polskie Towarzystwo Ginekologiczne and
“Ginekologia Polska” and may not be published elsewhere without written consent of the publisher, with the exception of the abstract. The articles published in this journal are protected by copyright, which covers translation rights and the exclusive right to reproduce and distribute all of the
articles printed in the journal. Unauthorized use of Polskie Towarzystwo Ginekologiczne and
“Ginekologia Polska” name, logo, or any content for commercial purposes or to promote commercial goods and services (in any format, including print, video, audio, and digital) is forbidden.
4. For all manuscripts reporting data from studies involving human participants, formal review and
approval, or formal review and waiver, by an appropriate institutional review board or ethics committee is required and should be described in the Methods section. For those investigators who do
not have formal ethics review committees, the principles outlined in the Declaration of Helsinki
should be followed. For investigations of humans, state in the Material and methods section the
manner in which informed consent was obtained from the study participants (i.e., oral or written).
Editors may request that authors provide documentation of the formal review and recommendation
from the institutional review board or ethics committee responsible for oversight of the study. No
first name, surname, patient initials or patient chart number can be revealed. In the event of the risk
of patient identification, a signed statement of informed consent to publish (in print and online)
patient descriptions, photographs, and pedigrees should be obtained from all persons (parents or
legal guardians for minors) who can be identified (including by the patients themselves) in such written descriptions, photographs, or pedigrees and should be submitted with the manuscript and indicated in the Acknowledgment section of the manuscript. Such persons should be shown the manuscript before its submission. Omitting data or making data less specific to deidentify patients is
acceptable, but changing any such data is not acceptable.
5. Authors who include results of research on drugs and medical procedures should include detailed
description of means of financing the research, the role of the sponsor in the planning, realisation
and analysis of the results, as well as information how the sponsor had influenced the contents of
the article. International names of drugs must be used.
6. All submitted manuscripts are sent to two expert consultants for peer review. Manuscripts are evaluated according to the following criteria: material is original and timely, writing is clear, study methods are appropriate, data are valid, conclusions are reasonable and supported by the data, information is important. Each manuscript shall be reviewed within the course of 30-45 days since the
registration date and the authors will be notified promptly about the review outcome and whether
the manuscript has been approved for publication.
7. Authors are responsible for all statements included in their work. Polskie Towarzystwo
Ginekologiczne and “Ginekologia Polska” bear no responsibility for the contents of the articles.
8. “Ginekologia Polska” reserves the right to choose the manuscripts for the consecutive issues.
9. “Ginekologia Polska” reserves the right to shorten the manuscript and/or and make stylistic corrections without consulting the authors.
10. Authors are nor financially rewarded for the publication in “Ginekologia Polska”.
11. The manuscript should be registered and sent solely with the use of the programme available on
the website: www.ginekolpol.com
12. The file with the manuscript - Word version (*.doc) - should include the following:
• title in Polish and English
• surnames and first names of the authors and their affiliations
• correspondence details: name and surname of the author, department, address,
phone number, fax number, e-mail address
• abstract in Polish and English
• key words in Polish and English
• the manuscript
13. AThe Editor should be sent:
• written consent for publication from all authors
• written consent for publication from the head of the clinic/ward/department
• statement that the manuscript (or its parts) has not been and is not to be published
elsewhere.
14. The abovementioned documents should be sent to:
Redakcja ”Ginekologii Polskiej”
60-535 Poznaƒ, ul. Polna 33
tel. 061 84-19-265; fax.: 061 84-19465;
e-mail: [email protected]
15. In order to have their manuscript published in ”Ginekologia Polska”, authors are kindly asked to
follow the rules and guidelines included in the Instruction for Authors.
II. Specific guidelines
1. Original contribution
Articles should be written either in Polish or in English, following the order presented in point 4
below. Recommended length: 2500-3000 words (16000-18000 characters including spaces).
2. Comparative work
Articles need not follow the undermentioned order. Recommended length: 2000 words (1000012000 characters including spaces).
© 2009
160
Polskie Towarzystwo Ginekologiczne
Ginekol Pol. 2011, 82, 160
K O M U N I K A T Y
3. Case study
Articles ought to follow the undermentioned order. Recommended length: 2000 words (1000012000 characters including spaces).
4. Order
a) Article title – written in both, Polish and in English – should be concise but clearly state the contents of the article.
b) Authors’ full names and institutional affiliations.
c) The complete name(s) and address(es) of the department(s) and institution(s) to which the work
should be attributed.
d) Contact information for corresponding author: the name, mailing address, telephone, e-mail
address of the author responsible for correspondence about the manuscript (the “corresponding
author”). The corresponding author is responsible for forwarding the whole correspondence
about the manuscript to the co-authors.
e) Abstract: the abstract should be written in Polish and English, and observe the following order:
Objectives, Material and methods, Results, Conclusions. Recommended length: 250 words
(1500-2000 characters including spaces). In case of comparative work and/or case study, the
abstract need not follow the abovementioned order but it should not exceed the length of 250
words (1500-2000 characters including spaces). The abstract should provide the context or background for the study and state the study’s purpose, basic procedures (selection of study subjects
or laboratory animals, observational and analytical methods), main findings (giving specific effect
sizes and their statistical significance, if possible), and principal conclusions. It should emphasize
new and important aspects of the study or observations.
f) Key words: three to six key words, both in Polish and in English, ought to be included below the
abstract; following the Medical Subject Headings (Index Medicus) –
www.nlm.nih.gov/mesh/MBrowser.html
g) Manuscript: when preparing the manuscript for submission to “Ginekologia Polska”, the following order should be applied:
• Introduction – include the general overview of current knowledge on a given topic.
• Objectives – state the aim of the work.
• Material and methods – describe the examined groups/cases and methods,
as well as statistical tools, that have been used.
• Results – clearly and concisely present the outcome (note from the publisher: consider using
graphs or diagrams to accompany the text as they are infinitely more clear and comprehensible).
• Discussion – state to what extent the aims of the work have been met and are original and
new (as opposed to: confirming the data already obtained in Poland and in the world); what
obstacles and limitations have been encountered; what might the clinical significance and implications of the work be.
• Conclusions – should refer to the objectives of the work and be presented clearly and
accurately.
• Acknowledgements – the list of contributions, credits, and other information included at the
end of the text of a manuscript but before the references. The Acknowledgment section includes
authors’ contributions; information on author access to data; sources of funding and support; an
explanation of the role of sponsor(s); names, degrees, and affiliations of participants in a large
study or other group; any important disclaimers; and the contributions, names, degrees, affiliations, and indication if compensation has been received for all persons who have made substantial contributions to the work but who are not authors.
• References – references should be numbered consecutively in the order in which they are first
mentioned in the text. References to papers not yet published should not be included. Each reference entry should consist of: surname(s), first name(s) initial(s) (not to be followed by a full
stop); first three surnames of the authors, followed by [et al.]; title; journal abbreviated title
(please follow the Index Medicus tips); year of publication; volume; first and last page. In case of
book or monograph chapters, please follow the order: surname and first name initial of the
author; chapter title; book title; surname and first name initial of the editor; name of the publishing house; place of publication; year; pages. Examples of reference entries may be found at
www.ginekolpol.com
• Text style and format:
- 12- point font size (Arial or Times New Roman). Please do not format the text!
- 1,5 space
- leave right margins unjustified (ragged)
- margins: the margins should be 2,5 cm, with the exception of the first page where the
authors are kindly asked to leave a 7-cm top margin. If you wish to use indentation at the beginning of a line to signal the start of a new paragraph, please use the TAB key.
- Tables – tables may be included in the same file as the manuscript; number all tables in the
order of their citation in the text, using Roman numerals. Include a title in Polish for each table
(a brief phrase, preferably no longer than 10 words).
- Figures and photos – figures and photos may be black-and-white or colour; the following figure file formats are acceptable: JPG, CDR, TIFF, PPT, AI, EPS. Include all figures and photos in a
single file following the manuscript in one of the abovementioned formats (photos should have
300 dpi resolution and extension: *.jpg, *.tif, *.ai, *.eps); authors should review the images of
such files on a computer screen before submitting them to be sure they meet their own quality
standards.
• Figures and photos should be numbered consecutively according to the order in which they
have been cited in the text, using Arabic numerals; figures description should be in Polish and
their references should be indicated in the manuscript.
• Abbreviations and symbols – only standard abbreviations should be used as the use of nonstandard abbreviations can be confusing to readers. Authors should avoid abbreviations in the
title of the manuscript or abstract. The spelled-out abbreviation followed by the abbreviation in
parenthesis should be used on first mention in the text unless the abbreviation is a standard unit
of measurement.
• Units of measurement – authors should report laboratory information in International System
of Units (SI).
Editor
Nr 2/2011
479
Ginekol Pol. 2011, 82,
żelazo nowej generacji
BEZPIECZNIE UZUPEŁNIA
NIEDOBORY ŻELAZA
Najlepiej przyswajalna i najbezpieczniejsza w dawkowaniu
forma żelaza w postaci chelatu aminokwasowego - Ferrochel®:
skuteczność i bezpieczeństwo działania potwierdzone
badaniami naukowymi
w odróżnieniu od zwykłych form żelaza dobrze się wchłania
nie podrażnia przewodu pokarmowego
nie powoduje interakcji z witaminami i minerałami
wygodne w stosowaniu
tylko jedna kapsułka dziennie
zalecane w stanach niedoboru żelaza
dla kobiet w ciąży lub planujących ciążę, w okresach około
menstruacyjnych
POCZUJ RÓŻNICĘ...
Produkty rekomendowane przez Zespół Ekspertów
Polskiego Towarzystwa Ginekologicznego
www.olimp-labs.com
G i n e k o l o g i c zwww.chela-ferr.com
ne
infolinia: 0801194242*
© Polskie Towarzystwo
161
Ginekol Pol. 2011, 82,
162
Nr 2/2011