abstracts

Transcription

abstracts

BMC Proceedings 2013, Volume 7 Suppl 6
http://www.biomedcentral.com/bmcproc/supplements/7/S6
MEETING ABSTRACTS
Open Access
23rd European Society for Animal Cell
Technology (ESACT) Meeting: Better Cells for
Better Health
Lille, France. 23-26 June 2013
Edited by Hansjörg Hauser
Published: 4 December 2013
These abstracts are available online at http://www.biomedcentral.com/bmcproc/supplements/7/S6
INTRODUCTION
I1
Better Cells for Better Health: Abstracts of the 23rd ESACT Meeting
2013 in Lille
Hansjörg Hauser
Helmholtz-Zentrum für Infektionsforschung GmbH, Department of Gene
Regulation and Differentiation, 38124 Braunschweig, Germany
E-mail: [email protected]
BMC Proceedings 2013, 7(Suppl 6):I1
The European Society of Animal Cell Technology (ESACT) is a society that
brings together scientists, engineers and other specialists working with
animal cells in order to promote communication of experiences between
European and international investigators and progress development of
cell systems in productions derived from them.
Animal cells are being used as substrates in basic research and also for
the production of proteins. Tissue engineering, gene and cell therapies,
organ replacement technologies and cell-based biosensors contribute to
a considerable widening of interest and research activity based on animal
cell technology.
Since its foundation 35 years ago, the ESACT Meeting has developed into
the international reference event in animal cell technology, building on a
tradition of combining both basic science and its application into
industrial biotechnology.
The abstracts of this supplement are from the 23rd ESACT meeting that
was held in Lille, France, June 23 - 26, 2013. The abstracts review the
presentations from this meeting and should be a useful resource for the
state-of-the-art in animal cell technology.
ORAL PRESENTATIONS
O1
A novel genotype of MVA that efficiently replicates in single cell
suspensions
Ingo Jordan*, Volker Sandig
ProBioGen AG, 13086 Berlin, Germany
BMC Proceedings 2013, 7(Suppl 6):O1
Background: Vectored vaccines based on modified vaccinia Ankara
(MVA) may lead to new treatment options against infectious diseases and
certain cancers. MVA is highly attenuated and requires avian cells for
production. We established avian continuous cell lines (including CR and
related CR.pIX) and adapted these cells to proliferation in single-cell
suspension in a chemically defined medium [1,2]. Replication of several
viruses was efficient in CR suspension cultures [3,4] but yields for MVA
were low. We suspected that cell-to-cell spread may be an important
mechanism for MVA replication in agitated suspension cultures and
developed a production medium that is added at the time of infection to
induce cell aggregates [2]. MVA (and other host-restricted poxviruses)
replicate to very high titers with this robust and fully scalable cultivation
protocol but further improvement may facilitate production for large
vaccine programs. We now describe a novel genotype of MVA that
replicates with high efficiency in single-cell suspensions without
aggregate induction.
Materials and methods: Motivated to discover new phenotypes, we
quantified replication of successive MVA passages in aggregated CR
suspension cultures. Because titers increased slightly within 10 passages,
viral genomic DNA of early and late passages was sequenced. Of the
advanced passage, a contiguous sequence of 135 kb was recovered and
revealed a genotype (which we call MVA-CR) where the structural proteins
A3L, A9L and A34R (in vaccinia virus nomenclature) each carry a single
amino acid exchange (Figure 1A). The novel genotype appears to
accumulate in our system but to completely remove traces of wildtype
plaque purification was performed. The pure isolate (called MVA-CR19) was
further characterized and compared to the wildtype.
Results: The aggregate-based process was developed to facilitate cell-to-cell
spread, which appears to be an important mechanism for vaccinia virus
replication. Surprisingly, multiplication of MVA-CR19 appears to be efficient
also in single-cell avian suspension cultures (Figure 1B) with increased
infectious titers in the cell-free supernatant. Because of this qualitative
difference between wildtype and MVA-CR19, we hypothesized that a smaller
fraction of the MVA-CR isolate remains cell associated and that this capacity
allows viruses of the novel genotype to spread also in single cell
suspensions. As one test of our proposed explanation we repeated the
passaging experiments in adherent cultures. No mutations in the three
genes that distinguish MVA-CR were detected, suggesting that the
contribution of host cell properties to the observed changes in the virus
population recovered from the suspension process may be negligible.
However, the MVA-CR phenotype is evident also in adherent cells: compared
to wildtype MVA, plaques formed by MVA-CR19 on CR cell monolayers in
comet assays appear to be larger and to develop earlier [5]. These results
are consistent with mechanisms that allow MVA-CR19 to replicate, infect or
uncoat faster, or be released with greater efficiency from host cells. For
further characterization of this effect, adherent cells were infected with a
high multiplicity of 10 and briefly subjected to a pH shift. This is predicted
© 2013 various authors, licensee BioMed Central Ltd. All articles published in this supplement are distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Page 2 of 151
Figure 1(abstract O1) (A) Schematic of the genomic DNA of MVA-CR. The region covered by next generation sequencing is shown together with the
mutations (in single letter code for amino acids, e.g. H639Y is His639 ® Tyr) in the three genes. ITR (viral telomers) and deletion sites in MVA as light gray boxes
are shown for orientation. (B) CR.pIX single-cell suspension cultures were infected with wildtype (wt) and MVA-CR19. Cells were immunostained for virus
antigens 48 h post infection and quantified by FACS to investigate differences in the dissemination of infectious units in absence of aggregate induction.
(C) Cell fusion is induced by wildtpe MVA but less so by MVA-CR19. Red immunofluorescence against MVA antigens serves as a positive control for infection.
Blue fluorescence of DNA is shown for orientation. MVA-negative cells next to infected cells are shown in the panels where virus was added to a multiplicity
of infection (MOI) of 0.1.
to activate the viral fusion apparatus so that cell-associated viruses in a
confluent cell monolayer can induce formation of syncitia [6]. As shown in
Figure 1C, cell fusion appears to be less pronounced in cultures infected
with MVA-CR suggesting that either fewer virions of this genotype remain
cell associated or that fusion may be less important for entry of such virions.
A molecular basis for the proposed improved MVA-CR19 dissemination is
that all three of the observed mutations each target a different
component of the complex viral particles, the core and the different
membranes of the mature intracellular and extracellular virions. We are in
the process of generating various combinations of recombinant MVAs to
determine whether all three factors need to cooperate to produce the
observed effects or whether a single gain of function mutation in any
one or two factors is sufficient.
Conclusions: Compared to wildtype MVA, plaques formed by MVA-CR19 on
adherent CR cells appear to be larger and to develop earlier. Titers are
slightly higher in complete lysates and significantly elevated in cell-free
supernatants. MVA-CR19 replicates efficiently without aggregate induction
also in single cell suspension cultures. We hypothesize that a greater fraction
of MVA-CR19 escapes the hosts for infection of distant targets. In such a
model the new genotype should not confer a significant advantage
to viruses spreading in cell monolayers, and indeed we could not generate
the MVA-CR genotype by passaging in adherent cultures. Attenuation has
yet to be confirmed for MVA-CR but host cell-restriction appears to have
been fully maintained for Vero and HEK 293 cells.
Supply of an injectable vaccine preparation may be facilitated with this
strain as production in single cell suspension using only a cell proliferation
medium is less complex compared to the current protocol that requires
cell aggregate induction by addition of a virus production medium.
Furthermore, MVA-CR has a tendency to accumulate in the extracellular
volume. Purification of live virus out of a cell-free suspension may allow
enhanced purity compared to a process that initiates with a complete
lysate containing the full burden of unwanted host cell-derived
components.
References
1. Jordan I, Vos A, Beilfuss S, Neubert A, Breul S, Sandig V: An avian cell line
designed for production of highly attenuated viruses. Vaccine 2009,
27:748-756.
2. Jordan I, Northoff S, Thiele M, Hartmann S, Horn D, Höwing K, Bernhardt H,
Oehmke S, von Horsten H, Rebeski D, Hinrichsen L, Zelnik V, Mueller W,
Sandig V: A chemically defined production process for highly attenuated
poxviruses. Biol J Int Assoc Biol Stand 2011, 39:50-58.
3. Lohr V, Rath A, Genzel Y, Jordan I, Sandig V, Reichl U: New avian
suspension cell lines provide production of influenza virus and MVA in
serum-free media: studies on growth, metabolism and virus
propagation. Vaccine 2009, 27:4975-4982.
4. Lohr V, Genzel Y, Jordan I, Katinger D, Mahr S, Sandig V, Reichl U: Live
attenuated influenza viruses produced in a suspension process with
avian AGE1.CR.pIX cells. Bmc Biotechnol 2012, 12:79.
5. Jordan I, Horn D, John K, Sandig V: A Genotype of Modified Vaccinia
Ankara (MVA) that Facilitates Replication in Suspension Cultures in
Chemically Defined Medium. Viruses 2013, 5:321-339.
6. Ward BM: Visualization and characterization of the intracellular
movement of vaccinia virus intracellular mature virions. J Virol 2005,
79:4755-4763.
O2
Electrically modulated attachment and detachment of animal cells
cultured on an ITO patterning electrode surface
Sumihiro Koyama
Institute of Biogeosciences, Japan Agency for Marine-Earth Science and
Technology, 2-15 Natsushima-cho, Yokosuka, 237-0061, Japan
Background: Micropatterning techniques of animal cells have been
reported by numerous groups and fall into 6 major classifications (1).
There are 1) photolithography, 2) soft lithography, 3) ink jet printing, 4)
electron beam writing, 5) electrochemical desorption of self-assembled
monolayers, and 6) dielectrophoresis. These six cell micropatterning
techniques cannot modulate both the attachment and detachment of
animal cells iteratively at the same positions, however. The present work
has demonstrated that a weak electrical potential can modulate the
attachment and detachment of specifically positioned adhesive animal
cells using a patterned indium tin oxide (ITO)/glass electrode culture
system [1], (Figure 1).
Materials and methods: A patterned indium tin oxide (ITO) optically
transparent working electrode was placed on the bottom of a chamber
slide with a counter- (Pt) and reference (Ag/AgCl) electrode. The ITO
patterning was formed by a reticulate ITO region and arrayed square glass
regions of varying size. Constant and rectangular potentials were applied
to the working ITO/glass electrode using the Ag/AgCl reference and the Pt
counterelectrode (Figure 1). The potentials were delivered via a function
generator (AD-8624A, A&D Company, Tokyo, Japan) and a potentiostat
(PS-14, Toho Technical Research, Tokyo, Japan).
Results: Animal cells suspended in serum or sera containing medium
were drawn to and attached on a reticulate ITO electrode region to
which a +0.4-V vs. Ag/AgCl-positive potential was applied. Meanwhile, the
cells were successfully placed on the square glass regions by -0.3-V vs. Ag/
AgCl-negative potential application.
Animal cells detached not only from the ITO electrode but also from the
square glass regions after the application of a ± 10 mV vs. Ag/AgCl, 9-MHz
triangular wave potential in PBS(-) for 30-60 min. The triangular wave
potential-induced cell detachment is almost completely noncytotoxic, and
no statistical differences between trypsinization and the high frequency
wave potential application was observed in HeLa cell growth.
Conclusions: Using the 3-electrode culture system, the author succeeded
in modulation of the attachment and detachment of animal cells on the
working electrode surface. The electrical modulation of specifically
positioned cell attachment and detachment techniques holds potential
for novel optical microscopic cell sorting analysis in lab-on-chip devices.
Page 3 of 151
Reference
1. Koyama S: Electrically modulated attachment and detachment of animal
cells cultured on an optically transparent patterning electrode. J Biosci
Bioeng 2011, 111:574-583, (Erratum in: J Biosci Bioeng 2012, 114: 240-241).
O3
Novel strategy for a high-yielding mAb-producing CHO strain
(overexpression of non-coding RNA enhanced proliferation and
improved mAb yield)
Hisahiro Tabuchi
Chugai Pharmaceutical Co., Ltd., 5-5-1 Ukima, Kitaku, Tokyo, Japan 115-8543
Background: Innovation in mAb production is driven by strategies to
increase yield. A host cell line constructed to overexpress TAUT (taurine
transporter) produced a higher proportion of high-mAb-titer strains [1].
From these we selected a single TAUT/mAb strain that remained viable
for as long as 1 month. Its improved viability is attributed to improved
metabolic properties. It was also more productive (>100 pg/cell/day) and
yielded more mAb (up to 8.1 g/L/31 days) than the parent cell line [2]. These
results suggested that this host cell engineering strategy has great potential
for the improvement of mAb-producing CHO cells.
Results: Our present challenge was to achieve a high yield in a shorter
culture period by modulating events in the nucleus by using non-coding
RNA (ncRNA). We looked for long ncRNA (lncRNA) that was abnormally
expressed in high-titer cells. A Mouse Genome 430 2.0 array (Affymetrix)
identified the lncRNA (Figure 1) as a complementary sequence of the
3’ non-coding region of mouse NFKBIA (NF-kappa-B inhibitor alpha) mRNA.
NFKBIA is an important regulator of the transcription factor NFKB, a
positive regulator of cell growth. Since NFKBIA suppresses NFKB function,
inhibition of NFKBIA by overexpression of the lncRNA might further
enhance cell proliferation. We genetically modified the TAUT/mAb strain to
overexpress part of the lncRNA. The resulting co-overexpression strains
gave increased yield, and one strain increased yield in a shorter culture
period (up to 6.0 g/L/14 days from 3.9 g/L/14 days). Interestingly, however,
this effect might not be due to enhancement of the NFKB-dependent
promoter activity of the mAb expression plasmid because mAb production
under EF-1a promoter without an NFKB binding site was also enhanced by
overexpression of part of the lncRNA. Since overexpression of the partial
sequence still functions as an antibody production enhancing sequence in
mAb-producing cell lines, many unexpected functions from ncRNAcontaining microRNA might exist.
Conclusions: 1. We found a lncRNA that was abnormally expressed in hightiter cells. It was identified as the antisense RNA of NFKBIA. Overexpression
of part of the lncRNA suppressed NFKBIA mRNA.
2. Overexpression of part of the lncRNA improved CHO cell performance.
The transporter/lncRNA co-overexpressing strain gave increased yield in a
shorter culture period.
3. This effect might not be due to enhancement of the NFKB-dependent
promoter of the mAb expression plasmid.
References
1. Tabuchi H, Sugiyama T, Tanaka S, Tainaka S: Overexpression of taurine
transporter in Chinese hamster ovary cells can enhance cell viability and
product yield, while promoting glutamine consumption. Biotechnol
Bioeng 2010, 107:998-1003.
2. Tabuchi H, Sugiyama T: Cooverexpression of alanine aminotransferase
1 in Chinese hamster ovary cells overexpressing taurine transporter
further stimulates metabolism and enhances product yield. Biotechnol
Bioeng 2013, 110:2208-2215.
O4
Improvement in a human IgE-inducing system by in vitro immunization
Shuichi Hashizume1*, Hiroharu Kawahara2
1
Idea-Creating Lab, Yokohama 236-0005, Japan; 2Kitakyushu National College
of Technology, Kitakyushu 802-0985, Japan
Page 4 of 151
Figure 1(abstract O2) Schematic illustration of a patterned ITO/glass electrode culture system.
Introduction: The immune system, which is the self-defense system of the
body, occasionally responds in a manner that is harmful to the body. The
incidence and severity of allergies caused by cedar pollen, house dust, egg
protein, and many others are increasing and have recently become a
serious social problem. We have previously developed an original in vitro
system for inducing human IgE antibody specific to a designated antigen
that can be used to study various allergic reaction [1]. In this study, we
attempted to improve this system to stimulate IgE levels in its medium to
provide a highly sensitive screening method.
Experimental: The original in vitro IgE-inducing system was established
using lymphocytes and plasma from donors which were not naturally
immunized with allergens. The original system contained ERDF supplemented
with fetal bovine serum (final concentration, 5%) and contained human
plasma (10%) as an essential component. Human peripheral blood
lymphocytes and plasma were obtained by density-gradient centrifugation
at 400 × g for 30 min with cell separation medium, Ficoll-Paque™ Plus.
This system also included allergen (100 ng/ml), interleukins (IL-) 2, 4, and
6 (10 ng/ml each) and muramyl dipeptide (MDP, 10 μg/ml), as described
previously [2]. Human lymphocytes were cultured in 96- or 24-well plates
at a final density of 1 × 106 cells/ml in the medium and incubated in a CO2
incubator at 37°C for 10 days. During the 10 days, IgE was specifically
secreted into the medium.
Results and discussion: Effects of human plasma and interleukins on
human IgE induction: The necessity for inclusions of human plasma and
interleukins was shown, when human lymphocytes and plasma from donors
which were not naturally immunized with allergens were used. For the
induction of IgE, human lymphocytes and plasma obtained from the same
donor were required [2]. Addition of IL-2, 4 and 6 induced IgE. Elimination of
each of these three interleukins from the medium resulted in no induction
of IgE (data not shown). From these results, IL-2, 4 and 6 are considered to
be essential factors to initially immunize lymphocytes with allergens, when
lymphocytes and plasma from donors not naturally immunized with
allergens were used. We next attempted to improve this system to stimulate
IgE levels in the medium to provide a highly sensitive screening method.
Page 5 of 151
Figure 1(abstract O3) The lncRNA is an antisense RNA of NFKBIA mRNA.
Effects of elimination of IL-2 from the medium on human IgE
production: In this study, the lymphocytes and plasma of donors naturally
immunized with various allergens were used. Therefore, the IgE level of the
control was high, i.e., more than 300 ng/ml, as shown in Table 1. Elimination
of IL-2 from the medium resulted in the induction of higher IgE levels
compared with medium containing IL-2 (Table 1). These data indicate that
elimination of IL-2 from the medium induced higher IgE levels when human
lymphocytes and plasma obtained from naturally immunized donors were
used. Furthermore, strawberry extract in the media containing Cryj1 and
Derf2 decreased the secreted IgE levels by 38% and 24%, respectively. There
is a possibility that strawberries may alleviate allergies.
In summary, elimination of IL-2 from the IgE-inducing system medium
increased the IgE induction level when human lymphocytes and plasma
obtained from donors naturally immunized with allergens were used. The
level of about 1 μg/ml IgE reported to be secreted in this study may be
the highest compared with those reported elsewhere. The original and
improved systems for human IgE production are considered to be of
profound use for studying allergy mechanisms and surveying allergyalleviating products, respectively.
Table 1(abstract O4) Effects of various additives on IgE
productivity
Medium
Control (ERDF + hPlasma + FBS)
IgE productivity (ng/ml)
319 ± 19
+ IL-2 + IL-4 + IL-6 + MDP + Cryj1
356 ± 85
+ IL-4 + IL-6 + MDP + Cryj1
549 ± 189
+ IL-4 + IL-6 + MDP + Cryj1 +
strawberry extract
341 ± 55
+ IL-4 + IL-6 + MDP + Derf2
660 ± 172
+ IL-4 + IL-6 + MDP + Derf2 +
strawberry extract
499 ± 167
References
1. Kawahara H, Maeda-Yamamoto M, Hakamata K: Effective induction and
acquisition of human IgE antibodies reactive with house-dust mite
extracts. J Immunol Methods 2000, 233:33-40.
2. Hashizume S, Kawahara H: Inducing of human IgE antibodies by in vitro
immunization. Proceedings of the 20th Annual Meeting of the European
Society for Animal Cell Technology (ESACT) Springer Science+Business Media
B.V: Noll T 2010, 833-836, Dresden, Germany, 2007.
O5
First CpG island microarray for genome-wide analyses of DNA
methylation in Chinese hamster ovary cells: new insights into the
epigenetic answer to butyrate treatment
Anna Wippermann1,2*, Sandra Klausing1, Oliver Rupp2, Thomas Noll1,2,
Raimund Hoffrogge1
1
Cell Culture Technology, Bielefeld University, Bielefeld, Germany; 2Center for
Biotechnology, Bielefeld University, Bielefeld, Germany
Background: Optimizing productivity and growth of recombinant Chinese
hamster ovary (CHO) cells requires insight and intervention in regulatory
processes. This is to some extent accomplished by several ‘omics’
approaches. However, many questions remain unanswered and bioprocess
development is therefore still partially empirical. In this regard, the analysis
of DNA methylation as one of the earliest cellular regulatory levels is
increasingly gaining importance. This epigenetic process is known to
influence transcriptional events when it occurs at specific genomic regions
with high CpG frequencies, called CpG islands (CGIs). Being methylated, CGIs
attract proteins with methyl-DNA binding domains (MBD proteins) that in
turn can interact with chromatin modifying complexes, thereby leading to a
transcriptionally inactive state of the associated gene [1]. In CHO cells, DNA
methylation has yet only been investigated in gene-specific approaches, e.g.
regarding the CMV promoter [2]. To analyze differential DNA methylation in
CHO cultures on a genomic scale, we developed a microarray covering
19,598 CGIs in the CHO genome. We applied it to elucidate the effect of
butyrate on CHO DP-12 cultures, as this short chain fatty acid (SCFA) is
known to elicit epigenetic responses by inhibiting histone-deacetylases [3].
Materials and methods: Based on the genomic and transcriptomic
information available for CHO cells [4,5], 21,993 promoter-associated and
intragenic CGIs were identified in the CHO genome using an algorithm
according to Takai and Jones [6]. We developed a customized 60 K
microarray (printed by Agilent Technologies) covering 19,598 (89%) of the
identified CGIs with an average probe spacing of 500 bp. Genomic DNA of
each four replicate experimental and reference CHO DP-12 (clone #1934,
ATCC CRL-12445) batch cultures was phenol-chloroform extracted and
sheared by sonication. Methylated fragments were enriched using the
methyl-CpG binding domain of MBD2 protein fused to the Fc tail of IgG1
(MBD2-Fc protein) coupled to magnetic beads (New England Biolabs).
Experimental samples prior to treatment with 3 mM butyrate (0 h) as well as
24 hours and 48 hours after butyrate addition were directly compared to the
references by two-colour co-hybridizations. Data analysis was carried out
upon LOWESS normalization by Student’s t-tests with p-values ≤ 0.05 using
the open source platform EMMA2 [7]. Confirmatory COBRA (combined
bisulfite restriction analysis) was performed by amplifying a 541 bp fragment
of the myc proto-oncogene protein-like gene (Gene ID: 100758352) following
bisulfite treatment of genomic DNA using the primers myc_for 5’-atttggaagg
atagtaagtatattggaag-3’ and myc_rev 5’- aaataaaactctaactcaccatatctcct-3’ and
the nested primers myc_for_nested 5’- atagtaagtatattggaaggggagtg-3’ and
myc_rev_nested 5’- taaaactctaactcaccatatctcctc-3’ (oligonucleotides obtained
from Metabion). Purified PCR products were digested with BstUI (Fermentas)
and separated in agarose gels.
Page 6 of 151
Results: Butyrate treated CHO DP-12 cultures stopped proliferating and
decreasing viabilities could be detected 24 hours upon addition of the
SCFA (Figure 1A). Simultaneously, cell specific productivities increased by
nearly 100% (17 pg/cell/day 48 hours after butyrate addition compared to
9 pg/cell/day in the reference cultures). Surprisingly, 228 differentially
methylated genes could be detected in a comparison between the
experimental cultures and the references even before addition of butyrate
(Figure 1B), indicating substantial heterogeneity among identically handled
parallel cultivations. 24 hours after butyrate addition we found a strongly
increased number of 1221, solely at this point in time, differentially
methylated genes. Gene ontology classification showed that, amongst
others, the terms ‘stress response’, ‘chromatin modification’ or ‘signalling
cascade’ were significantly overrepresented. Pathways such as the Ca2+,
MAPK and Wnt signalling systems were comprised within the latter group
and showed a large coverage by differentially methylated components.
48 hours upon butyrate addition the number of differential methylations
decreased by about 90%. COBRA analysis of the Wnt responsive myc
proto-oncogene protein-like gene showed clearly detectable cleavage
products (indicating methylation of the BstUI sites in the original DNA)
24 hours upon butyrate addition, that completely vanished another
24 hours later (Figure 1C), confirming the results of the microarray analysis.
Conclusions: Our first genome-wide screening for differential DNA
methylation in CHO cells shows that the epigenetic response upon
butyrate treatment seems to be highly dynamic and reversible. This was
confirmed by applying the bisulfite-based single-gene method COBRA
to analyze a region of the myc proto-oncogene protein-like gene.
Furthermore, detection of differential methylation before butyrate addition
Figure 1(abstract O5) (A) Viable cell densities, viabilities and cell specific productivities for batch CHO DP-12 reference (blue) and
butyrate treated (red) cultivations. The green dashed line marks the point of butyrate addition. Error bars represent standard deviations. (B) Venn
diagram showing the numbers of genes associated with differentially methylated CpG islands before (0 h), 24 hours and 48 hours upon butyrate addition.
Gene Ontology classification was performed using DAVID [9] with an EASE score ≤ 0.01 (C) COBRA analysis of a part of the CGI (blue) of the myc
proto-oncogene protein-like gene (green) differential methylation was detected for (red). Cleavage products indicate methylation of BstUI sites in the
original DNA.
indicates that heterogeneity in DNA methylation occurs even if cells
originated from the same preculture and were treated identically. This
occurrence of differentially methylated genes in parallel cultivations
strongly fosters the hypothesis that the culture history influences final
process outcomes [8]. It underlines the importance of DNA methylation
analyses in CHO cells, especially considering the fact that DNA methylation
patterns can remain stably anchored over several generations.
References
1. Ndlovu MN, Denis H, Fuks F: Exposing the DNA methylome iceberg.
Trends Biochem Sci 2011, 36:381-387.
2. Osterlehner A, Simmeth S, Göpfert U: Promoter methylation and transgene
copy numbers predict unstable protein production in recombinant
Chinese hamster ovary cell lines. Biotechnol Bioeng 2011, 108:2670-2681.
3. Mariani MR, Carpaneto EM, Ulivi M, Allfrey VG, Boffa LC: Correlation
between butyrate-induced histone hyperacetylation turn-over and
c-myc expression. J Steroid Biochem Mol Biol 2003, 86:167-171.
4. Xu X, Nagarajan H, Lewis NE, Pan S, Cai Z, Liu X, Chen W, Xie M, Wang W,
Hammond S, Andersen MR, Neff N, Passarelli B, Koh W, Fan HC, Wang J,
Gui Y, Lee KH, Betenbaugh MJ, Quake SR, Famili I, Palsson BO, Wang J: The
genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line.
Nat Biotechnol 2011, 29:735-741.
5. Becker J, Hackl M, Rupp O, Jakobi T, Schneider J, Szczepanowski R, Bekel T,
Borth N, Goesmann A, Grillari J, Kaltschmidt C, Noll T, Pühler A, Tauch A,
Brinkrolf K: Unraveling the Chinese hamster ovary cell line transcriptome
by next-generation sequencing. J Biotechnol 2011, 156:227-235.
6. Takai D, Jones P: The CpG island searcher: a new WWW resource. In silico
biology 2003, 3:235-40.
7. Dondrup M, Albaum SP, Griebel T, Henckel K, Jünemann S, Kahlke T,
Kleindt CK, Küster H, Linke B, Mertens D, Mittard-Runte V, Neuweger H,
Runte KJ, Tauch A, Tille F, Pühler A, Goesmann A: EMMA 2–a
MAGE-compliant system for the collaborative analysis and integration
of microarray data. BMC Bioinformatics 2009, 10:50.
8. Le H, Kabbur S, Pollastrini L, Sun Z, Mills K, Johnson K, Karypis G, Hu WS:
Multivariate analysis of cell culture bioprocess data–lactate consumption
as process indicator. J Biotechnol 2012, 162:210-23.
9. Huang DW, Sherman BT, Zheng X, Yang J, Imamichi T, Stephens R,
Lempicki RA: Extracting biological meaning from large gene lists with
DAVID. Curr Protoc Bioinformatics 2009, Chapter 13, Unit 13.11.
Page 7 of 151
O6
Aspects of vascularization in Multi-Organ-Chips
Katharina Schimek1, Reyk Horland1*, Sven Brincker1, Benjamin Groth1,
Ulrike Menzel1, Ilka Wagner1, Eva-Maria Materne1, Gerd Lindner1,
Alexandra Lorenz1, Silke Hoffmann1, Mathias Busek2, Frank Sonntag2,
Udo Klotzbach2, Roland Lauster1, Uwe Marx1,3
1
TU Berlin, Institute of Biotechnology, Faculty of Process Science and
Engineering, 13355 Berlin, Germany; 2Fraunhofer IWS Dresden, 01277
Dresden, Germany; 3TissUse GmbH, 15528 Spreenhagen, Germany
Background: Enormous efforts have been made to develop circulation
systems for physiological nutrient supply and waste removal of in vitro
cultured tissues. These developments are aiming for in vitro generation of
organ equivalents such as liver, lymph nodes and lung or even multi-organ
systems for substance testing, research on organ regeneration or transplant
manufacturing. Initially technical perfusion systems based on membranes,
hollow fibers or networks of micro-channels were used for these purposes.
However, none of the currently available systems ensures long-term
homeostasis of the respective tissue over months. This is caused by a lack of
in vivo-like vasculature which leads to continuous accumulation of protein
sediments and cell debris in the systems. Here, we demonstrate a closed
and self-contained circulation system emulating the natural blood perfusion
environment of vertebrates at tissue level.
Material and methods: The Multi-Organ-Chip (MOC) device accommodates
two microvascular circuits (Figure 1a). Each circuit is operated by a separate
peristaltic on-chip micropump, modified from Wu and co-workers [1].
Microfluidic 3D channels were formed in PDMS by replica molding from
master molds and were afterwards closed by bonding to a cover-slip by air
plasma treatment. To retain PDMS hydrophilicity, channels were filled with
culture medium immediately after sealing. To emulate the natural blood
perfusion environment, human dermal microvascular endothelial cells
(HDMEC) were used. The cells were seeded into the PDMS channels and
adhered to all channel walls after subsequent static cultivation on each
channel side. Afterwards cells were cultured up to 14 days in PDMS channels
under pulsatile flow conditions.
Figure 1(abstract O6) HDMEC microvasculature in the MOC device. a) Exploded view of the device comprising a polycarbonate CP (blue),
the PDMS-glass chip accommodating two microvascular circuits (yellow; footprint: 76 mm × 25 mm; height: 3 mm) and a heatable MOC-holder (red).
b) Calcein AM assay (red) showed viable and evenly distributed HDMEC in all areas of the circulation. Scale bar = 2 mm. c) Image stack taken by
two-photon laser scanning microscopy. HDMEC were able to cover all walls of the channels forming a fluid tight layer. Functionality of the established
microvascular vessel system was demonstrated by d) ac-LDL uptake of HDMEC and e) CD31 (red), vWF (green) expression throughout the entire cell
population. Nuclei were counterstained with Hoechst 33342 (blue). Scale bar = 100 μm.
Results: A miniaturized circulation system has been established over a
period of 14 days by fully covering all channels and surfaces of the MOC
with human microvascular endothelial cells. By injecting 2 × 107 cells ml-1
into the channels, a homogeneous distribution of cells throughout all
channels was achieved (Figure 1b). During the following static incubation,
cells adhered well to the air plasma treated channel walls. A peristaltic
micro-pump was used to create culture medium circulation. After adaption
to shear stress, HDMEC showed an elongation and alignment parallel to
the flow direction. Three-dimensional reconstitutions of image stacks
indicate that cells formed confluent monolayers on all walls of the channels
(Figure 1c). During the whole cultivation time they maintained adherence
to the channel walls and were positive for Calcein AM viability staining
(Figure 1b). After 14 days of culture HDMEC forming the microvascular circuit
were positive for ac-LDL uptake (Figure 1d) and expressed the endothelialspecific marker CD31 and von Willebrand Factor (vWF) (Figure 1e).
Conclusion: A robust procedure applying pulsatile shear stress has been
established to cover all fluid contact surfaces of the system with a functional,
tightly closed layer of HDMEC.
Long-term cultivation of elongated and flow-aligned HDMEC inside the chipbased microcirculation was demonstrated over a period of 14 days. For such
endothelialized microfluidic devices to be useful for substance testing, it is
essential to show long-term viability and function in the presence of
physiological flow rates as shown here. These artificial vessels are an
important approach for systemic substance testing in Multi-Organ-Chips.
The miniaturized circulation system creates the conditions for circulation of
nutrients through the organoid culture chamber, allows for in vivo-like
crosstalk between endothelial cells and tissues and prevents clumping
inside the channels. Compared with conventional cell culture techniques, a
microfluidic-based cell culture may mimic more accurate in vivo-like
extracellular conditions, as the culture of cells and organ models in perfused
microfluidic systems can improve their oxygen and nutrient supply. This
makes it suitable for long-term cultivation and more efficient drug studies.
In future, such endothelialized bioreactors might be used for testing
vasoactive substances. Finally, the described system can now be used for
the establishment of organ-specific capillary networks. Here, we will adhere
to our recently published roadmap toward vascularized ‘’human-on-a-chip’’
models to generate systemic data fully replacing the animals or human
beings currently used [2].
Acknowledgements: The work has been funded by the German Federal
Ministry for Education and Research, GO-Bio Grant No. 0315569.
References
1. Wu M-H, Huang S-B, Cui Z, Cui Z, Lee G-B: A high throughput perfusionbased microbioreactor platform integrated with pneumatic micropumps
for three-dimensional cell culture. Biomedical microdevices 2008,
10:309-319.
2. Marx U, Walles H, Hoffmann S, Lindner G, Horland R, Sonntag F,
Klotzbach U, Sakharov D, Tonevitsky A, Lauster R: “Human-on-a-chip”
developments: a translational cutting-edge alternative to systemic
safety assessment and efficiency evaluation of substances in laboratory
animals and man? Alternatives to laboratory animals: ATLA 2012,
40:235-257.
O7
Rapid construction of transgene-amplified CHO cell lines by cell cycle
checkpoint engineering
Kyoungho Lee1, Kohsuke Honda1, Hisao Ohtake1, Takeshi Omasa1,2*
1
Department of Biotechnology, Graduate School of Engineering, Osaka
University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japan; 2Institute of
Technology and Science, The University of Tokushima, 2-1 Minamijosanjimacho, Tokushima 770-8506, Japan
Introduction: Dihydrofolate reductase (DHFR)-mediated gene amplification
has been widely used to establish high-producing mammalian cell lines
[1-3]. However, since gene amplification is an infrequent event, in that many
rounds of methotrexate (MTX) selection to amplify the transgene and
screening of over several hundred individual clones are required to obtain
cells with high gene copy numbers [4]. Consequently, the process for DHFRmediated gene amplification is a time-consuming and laborious step for cell
Page 8 of 151
line construction. Here, we present a novel concept to accelerate gene
amplification through cell cycle checkpoint engineering. In our knowledge,
there is no previous report which focused on controlling cell cycle
checkpoint to enhance the efficiency of DHFR gene amplification system.
Materials and methods: A small interfering RNA (siRNA) expression
vector against Ataxia-Telangiectasia and Rad3-Related (ATR), a cell cycle
checkpoint kinase, was transfected into Chinese hamster ovary (CHO) cells.
The effects of ATR down-regulation on gene amplification and productivity
in CHO cells producing green fluorescent protein (GFP) and monoclonal
antibody (mAb) were investigated.
Results and discussion: Analysis of GFP expression level during gene
amplification process: The ratio of GFP-expressing cells was evaluated
by flow cytometry analysis during the gene amplification process at 100-,
250-, and 500-nM MTX concentrations. In the process of gene amplification
at all MTX concentrations, the pools of ATR-downregulated cells showed a
much higher percentage of GFP-positive cells as compared with the pools
of mock cells. At 100-nM MTX concentration, the percentage of GFPpositive cells in the CHO-siATR cell pool was 18.7% of total cells, which
was approximately twice of the 8.4% in the mock cells. At 250- and
500-nM MTX concentrations, CHO-siATR cell pools had 28.6 and 39.2%
GFP-positive cells, respectively, which were up to six times higher than the
4.6 and 6.8% of the pools of mock cells.
Comparison of IgG productivity: IgG-producing cell lines were generated
to confirm the previous results obtained in GFP-producing cell lines. The
ATR-downregulated cells showed a significant increase in specific production
rate of an average of 0.08 pg cell−1 day−1, which was approximately four
times higher than the average of 0.02 pg cell−1 day−1 in the mock cells.
The volumetric productivity of each cell line was also investigated to
evaluate the influence of ATR downregulation. The volumetric productivity
of ATR knockdown cells was an average of 0.035 mg L−1 day−1, which was
approximately three times higher than the average of 0.013 mg L−1 day−1
of the mock cells, suggesting that ATR knockdown generated the pool of
higher-producing cells during the gene amplification process.
Estimation of amplified transgene copy number: Quantitative real-time
PCR was used to estimate the amplified transgene copy number of GFPproducing cell lines during the gene amplification process. The average
copy number of ATR-downregulated cells was 15.4 ± 0.8, 27.6 ± 0.3,
and 62.0 ± 2.9 at 100-, 250-, and 500-nM MTX concentrations, respectively.
These numbers were up to 24 times higher than 3.98 ± 0.09, 2.20 ± 0.03,
and 2.59 ± 0.07 of the mock cells. Interestingly, the amplified transgene
copy numbers in the pools of ATR-downregulated cells were increased
proportionally with the MTX concentration. The amplified transgene copy
numbers in the IgG-producing cells were also investigated during the gene
amplification process at 100-nM MTX concentration. The amplified light- and
heavy-chain copy numbers of the pool of ATR knockdown cells were 13.2 ±
3.8 and 11.8 ± 1.8, respectively, which were up to seven times higher than
6.95 ± 0.07 and 1.68 ± 0.04 of the mock cells. The results from both the
GFP- and IgG-producing cells showed that the pools of ATR-downregulated
cells had much higher amplified transgene copy numbers as compared with
the pools of mock cells during the gene amplification process.
Conclusions: In conclusion, we have demonstrated that gene amplification
can be accelerated by the downregulation of a cell cycle checkpoint kinase,
ATR, and a pool of high-producing cells can be rapidly derived in a short
time after MTX treatment. This novel method focuses on generating more
high-producing cells in a heterogeneous pool as compared with the
conventional method and would thus contribute to reducing the time and
labor required for cell line establishment by increasing the possibility of
selecting high-producing clones.
Acknowledgements: This work is partially supported by grants from the
Program for the Promotion of Fundamental Studies in Health Sciences of
NIBIO and a Grant-in-Aid for Scientific Research of JSPS. We thank Prof.
Yoshikazu Kurosawa at Fujita Health University for kindly providing heavyand light-chain genes of humanized IgG.
References
1. Gandor C, Leist C, Fiechter A, Asselbergs FA: Amplification and expression
of recombinant genes in serum-independent Chinese hamster ovary
cells. FEBS Lett 1995, 377:290-294.
2. Kim JY, Kim YG, Lee GM: CHO cells in biotechnology for production of
recombinant proteins: current state and further potential. Appl Microbiol
Biotechnol 2012, 93:917-930.
3. Wurm FM: Production of recombinant protein therapeutics in cultivated
mammalian cells. Nat Biotechnol 2004, 22:1393-1398.
4.
Cacciatore JJ, Chasin LA, Leonard EF: Gene amplification and vector
engineering to achieve rapid and high-level therapeutic protein
production using the Dhfr-based CHO cell selection system. Biotechnol
Adv 2010, 28:673-681.
O8
1
H-NMR spectroscopy for human 3D neural stem cell cultures metabolic
profiling
Daniel Simão1,2, Catarina Pinto1,2, Ana P Teixeira1,2, Paula M Alves1,2,
Catarina Brito1,2*
1
iBET, Instituto de Biologia Experimental e Tecnológica, 2780-901 Oeiras,
Portugal; 2Instituto de Tecnologia Química e Biológica, Universidade Nova de
Lisboa, 2780-157 Oeiras, Portugal
Background: The current lack of predictable central nervous system (CNS)
models in pharmaceutical industry early stage development strongly
contributes for the high attrition rates registered for new therapeutics [1].
Thus, there is an increasing need for a paradigm shift towards more human
relevant cell models, which can closely recapitulate the in vivo cell-cell
interactions, presenting higher physiological relevance by bridging the gap
between animal models and human clinical trials. In this context, human 3D
in vitro models are promising tools with great potential for pre-clinical
research, as they can mimic some of the main features of tissues, such as
cell-cell and cell-extracellular matrix (ECM) interactions [2,3]. Moreover these
complex cell models are suitable for high-throughput screening (HTS)
platforms, essential in drug discovery pipelines by reducing both costs and
time in clinical trials [2,4]. However, despite important advances in the
last years and the increasing clinical and biological relevance, the full
establishment of human 3D in vitro models in pre-clinical research requires a
significant increase in the power of the available analytical methodologies
towards more robust and comprehensive readouts [4]. With the emergence
of systems biology field and several “-omics” technologies, such as
metabolomics, it became possible to have a more mechanistic approach in
the understanding of cellular programs. 1H-nuclear magnetic resonance
(1H-NMR) spectroscopy is a powerful and widely accepted high resolution
methodology for a number of applications, including metabolic profiling [5].
Despite the low sensitivity when compared with mass spectrometry (MS),
1
H-NMR profiling presents several advantages, enabling a non-invasive and
non-destructive quantitative analysis requiring only minimal sample
preparation [5].
In this work we present the development of a robust and optimized
workflow for the exometabolome profiling of 3D in vitro cultures of human
midbrain-derived neural progenitor cells (hmNPC).
Materials and methods: Cell culture: hmNPC were isolated and routinely
propagated in static conditions, on poly-L-ornithine-fibronectin (PLOF)
coated plates, in serum-free expansion medium, containing basic fibroblast
growth factor and epidermal growth factor, as previously reported [6].
hmNSC were cultured in stirred systems as neurospheres for 7 days, with a
50% media changes every at day 3 [7]. All experiments were performed
in 500 mL shake flasks (80 mL working volume), with orbital shaking at
100 rpm. Cultures were maintained at 37°C, in 3% O2 and 5% CO2.
Sample Preparation: Neurospheres harvested at day 7 were plated on
PLOF-coated plates. A washing step with PBS was performed before adding
fresh medium (Neurobasal medium (Invitrogen) supplemented with 2% of
B27, 2 mM of Glutamax (Invitrogen), 100 μM dibutyryl c-AMP (SigmaAldrich), and 10 μg/mL gentamycin (Invitrogen)) to the culture. Samples of
supernatant were then collected at 6, 12, 24 and 48 hours after media
exchange and stored at -20°C. Neurospheres were harvested and total
protein was quantified with Micro BCA Protein Assay Kit (Pierce), according
to manufacturer’s instructions. Prior to NMR analysis, samples were thawed
and filtered using Vivaspin 500 columns (Sigma-Aldrich) at 14,000xg, in
order to remove high molecular weight proteins and lipids that induce
baseline distortions and peak broadening due to protein binding.
To minimize variations in pH, 400 μL of filtered samples were mixed with
200 μL of phosphate buffer (50 mM, pH 7.4) with 5 mM DSS-d6 [8].
1
H-NMR spectra acquisition and profiling: For NMR analysis, 500 μL of
the resulting supernatants were placed into 5 mm NMR tubes. All 1H-NMR
spectra were recorded at 25°C on a Bruker Avance II+ 500 MHz NMR
Page 9 of 151
spectrometer. One-dimensional (1D) spectra were recorded using a NOESYbased pulse sequence (4 s acquisition time, 1 s relaxation time and 100 ms
mixing time). Typically, 256 scans were collected for each spectrum.
All spectra were phase and baseline corrected automatically, with fine
adjustments performed manually. Spectra analysis was performed using
Chenomx NMR Suite 7.1, using DSS-d6 as internal standard for quantification
of metabolites.
Results: The approach applied in this study for metabolic profiling of the
hmNPC cultures using 1H-NMR enables an accurate screening of a wide
range of metabolites in the extracellular environment (Figure 1A),
including amino acids, glucose, lactate, among other substrates and
by-products.
Metabolism plasticity has been widely described as closely related with cell
pluri/multipotency and cell fate. Stemness programs and cell identity
determination are driven mainly by genetic and epigenetic switches, which
can modulate cell metabolism, among other cell fate pathways [9]. Thus,
the transition from pluri/multipotency towards somatic cell lineages is
accompanied by significant metabolic shifts, mainly at energy metabolism
levels. In this context, the metabolic study of in vitro cultures of stem cells
may contribute with valuable knowledge for the mechanistic understanding
of stemness and differentiation pathways.
Our results showed that the hmNPC in an undifferentiated state presented
a highly glycolytic metabolism, with high glucose consumption and lactate
production rates (Figure 1B), in agreement with previous reports for
murine NPC [10]. The profiles observed for glucose consumption and
lactate synthesis suggest an almost complete conversion of pyruvate,
generated as the final product of glycolysis, to lactate. One key culture
parameter that can greatly contribute for a low oxidative metabolism is
the fact that neural stem/progenitor cells are typically cultured under
physiological low oxygen tension environments. Hypoxic conditions have
been widely described as critical for maintaining cell viability and selfrenewal, while promoting proliferation and influencing cell fate during
differentiation [11]. Moreover, the consumption and depletion of pyruvate
present in culture media may suggest not only its conversion to lactate,
but may also contribute for the observed alanine synthesis.
Interestingly, even though glutamate could not be detected at significant
levels, an accumulation of pyroglutamate was observed, which can be
found as N-terminal modification in many neuronal peptides, including
pathological accumulating peptides as b-amyloid in Alzheimer’s disease.
As a free metabolite pyroglutamate can derive both from degradation of
proteins containing N-terminal residues or from glutamate/glutamine
cyclization. Although it is still a matter of debate, pyroglutamate
may act as a reservoir of neural glutamate, which is the main excitatory neurotransmitter in CNS and in high levels becomes a major
neurotoxicant [12].
Concerning branched-chain amino acids (BCAA) metabolism it was possible
to observe the extracellular accumulation of 2-oxoisocaproate and
methylsuccinate as main by-products, although in low rates. In brain
metabolism the balance between leucine and 2-oxisocaproate has particular
relevance through the establishment of a nitrogen turnover cycle where
astroglia cells catabolize leucine into 2-oxoisocaproate, which is then taken
up by neurons and converted back into leucine [13,14].
Conclusions: The methodology presented in this work, enables a
straightforward approach for an accurate and reproducible metabolic
profiling of multipotent hmNPC 3D cultures. This methodology provides a
robust alternative to an array of laborious analytical methods, by taking
advantage of the fast and simple sample preparation for NMR spectroscopy
and the ease of user-friendly software for spectra profiling, which is often a
challenging and time-consuming process due to peak overlapping in
complex mixtures such as the mammalian cell culture media. Moreover, this
approach can be applied to other multi/pluripotent cell sources, not only for
metabolic profiling of in vitro cultures but also to study the impact of new
therapeutics or toxicants, contributing to generate invaluable data in drug
development cascades.
Acknowledgements: The authors acknowledge Dr J. Schwarz (Technical
University of Munich, Germany) for the supply of hmNPC, within the
scope of the EU project BrainCAV (FP7-222992); this work was supported
by PTDC/EBB-BIO/112786/2009 and PTDC/EBB-BIO/119243/2010, FCT,
Portugal; BrainCAV (FP7-222992), EU. The NMR spectrometers are part of
The National NMR Facility, supported by Fundação para a Ciência e a
Tecnologia (RECI/BBB-BQB/0230/2012). Daniel Simão acknowledges the PhD
fellowship (SFRH/BD/78308/2011, FCT).
Page 10 of 151
Figure 1(abstract O8) Typical 1H-NMR spectra for hmNPC culture at different time points (A). Concentration profiles of the main metabolites quantified
in the exometabolome of hmNPC cultures that have significantly changed during 48 h of culture (B).
References
1. Miller G: Is pharma running out of brainy ideas? Science 2010,
329:502-504.
2. Pampaloni F, Reynaud EG, Stelzer EHK: The third dimension bridges the
gap between cell culture and live tissue. Nat Rev Mol Cell Biol 2007,
8:839-845.
3. Griffith LG, Swartz M: Capturing complex 3D tissue physiology in vitro.
Nat Rev Mol Cell Biol 2006, 7:211-224.
4. Fennema E, Rivron N, Rouwkema J, van Blitterswijk C, de Boer J: Spheroid
culture as a tool for creating 3D complex tissues. Trends Biotechnol 2013,
31:108-115.
5. Mountford CE, Stanwell P, Lin A, Ramadan S, Ross B: Neurospectroscopy:
the past, present and future. Chem Rev 2010, 110:3060-3086.
6. Storch A, Paul G, Csete M, Boehm BO, Carvey PM, Kupsch A, Schwarz J:
Long-term proliferation and dopaminergic differentiation of human
mesencephalic neural precursor cells. Exp Neurol 2001, 170:317-325.
7.
Brito C, Simão D, Costa I, Malpique R, Pereira CI, Fernandes P, Serra M,
Schwarz SC, Schwarz J, Kremer EJ, Alves PM: 3D cultures of human neural
progenitor cells: dopaminergic differentiation and genetic modification.
Methods 2012, 56:452-460.
8. Duarte T, Carinhas N, Silva AC, Alves PM, Teixeira AP: 1H-NMR protocol for
exometabolome analysis of cultured mammalian cells. Animal Cell
Biotechnology-Methods and Protocols Springer: Pörtner R , 3 2013 in press.
9. Folmes CDL, Nelson TJ, Dzeja PP, Terzic A: Energy metabolism plasticity
enables stemness programs. Ann N Y Acad Sci 2012, 1254:82-89.
10. Candelario KM, Shuttleworth CW, Cunningham LA: Neural stem/progenitor
cells display a low requirement for oxidative metabolism independent
of hypoxia inducible factor-1alpha expression. J Neurochem 2013,
125:420-429.
11. Milosevic J, Schwarz SC, Krohn K, Poppe M, Storch A, Schwarz J: Low
atmospheric oxygen avoids maturation, senescence and cell death of
murine mesencephalic neural precursors. J Neurochem 2005, 92:718-729.
12. Kumar A, Bachhawat AK: Pyroglutamic acid: throwing light on a lightly
studied metabolite. Curr Sci 2012, 102:288-297.
13. Bixel MG, Engelmann J, Willker W, Hamprecht B, Leibfritz D: Metabolism of
[U-(13)C]leucine in cultured astroglial cells. Neurochem Res 2004,
29:2057-2067.
14. Yudkoff M, Daikhin Y, Nelson D, Nissim I, Erecińska M: Neuronal
metabolism of branched-chain amino acids: flux through the
aminotransferase pathway in synaptosomes. J Neurochem 1996,
66:2136-2145.
O9
BEAT® the bispecific challenge: a novel and efficient platform for the
expression of bispecific IgGs
Pierre Moretti1*, Darko Skegro2, Romain Ollier2, Paul Wassmann2,
Christel Aebischer1, Thibault Laurent1, Miriam Schmid-Printz3,
Roberto Giovannini3, Stanislas Blein2, Martin Bertschinger1
1
Cell Line Development and Protein Expression group, Glenmark
Pharmaceuticals SA, La Chaux-de-Fonds, 2300, Switzerland; 2Antibody
Engineering group, Glenmark Pharmaceuticals SA, La Chaux-de-Fonds, 2300,
Switzerland; 3Downstream Processing group, Glenmark Pharmaceuticals SA,
La Chaux-de-Fonds, 2300, Switzerland
Background: The binding of two biological targets with a single IgGbased molecule is thought to be beneficial for clinical efficacy. However
the technological challenges for the development of a bispecific platform
are numerous. While correct pairing of heterologous heavy and light
chains (Hc and Lc) can be achieved by engineering native IgG scaffolds,
crucial properties such as thermostability, effector function and low
immunogenicity should be maintained [1]. The molecule has to be
Page 11 of 151
expressed at industrially relevant levels with a minimum fraction of
contaminants and a scalable purification approach is needed to isolate
the product from potentially complex mixtures. This article introduces a
novel bispecific platform based on the proprietary BEAT® technology
(Bispecific Engagement by Antibodies based on the T cell receptor)
developed by Glenmark.
Materials and methods: Stable cell lines were generated by co-transfection
of three proprietary expression vectors pGLEX41_GA/GB coding for the Hc, Lc
and Fc-scFv under optimized stoichiometric conditions in CHO-S cells. Cell
lines were selected according to expression and heterodimerization during
small scale fed-batch cultures performed in TubeSpin bioreactors (TPP,
Trasadingen, Switzerland). For high throughput (HT) screening, the fraction of
BEAT® molecule was evaluated using the Caliper LabChip GXII Protein Assay
(PerkinElmer, Waltham, Ma, USA). Titers were measured by HPLC-PA after
14 days of culture. The fraction of heterodimer in CHO supernatants was
measured by CE-CGE on Protein A (ProtA) purified supernatants harvested on
day 14. The actual BEAT® titer was obtained by multiplying the concentration
measured by HPLC-PA by the fraction of heterodimer measured by CE-CGE in
ProtA purified supernatants. The BEAT® was produced in 3 L STR bioreactors
(Mobius CellReady Bioreactor, Millipore) in fed-batch. Supernatants were
typically harvested on day 14 by centrifugation and dead-end filtration.
A single Protein A step was performed for purification, where two
isocratic steps allowed the selective elution of the bispecific product. The
thermostability of the BEAT® molecule was measured by differential scanning
calorimetry (DSC) in PBS.
Results: The BEAT® bispecific molecule consists of three chains: a heavy
chain (Hc), a light chain (Lc) and a Fc-scFv (see Figure 1 A). The molecule has
a fully functional Fc and engages two biological targets by a Fab arm on one
side and by a scFv on the other. Heterodimerization is achieved by
a proprietary CH3 interface, mimicking the natural association of the T-cell
surface receptors a and b between the two CH3 domains of IgG. Lc
mispairing is avoided by the replacement of one Fab arm of the bispecific
IgG by a scFv. In addition, the Protein A binding site in the Hc of the
Figure 1(abstract O9) The BEAT®bispecific platform. In A: secretion profile of a BEAT® secreting CHO clone obtained by Caliper analysis of a
non-purified supernatant. B: distribution of the heterodimerization level of stable clones at cell line development level. C: BEAT® expression level of 10
selected stable clones. D: BEAT® purification strategy.
molecule is abrogated to facilitate the isolation of the BEAT®-antibody by
affinity chromatography (discussed in the following). The DSC analysis of the
BEAT® indicated a good thermostability within the range of naturally
occurring antibodies. The BEAT® molecule is expressed in CHO cells. Figure 1
A shows a typical secretion profile obtained by Caliper Protein Analysis of a
non-purified CHO supernatant after 14 days in fed-batch culture. It can be
seen that the asymmetry of the BEAT® format allows an easy characterization
of the secretion profile of generated clones using HT analytics solely based
on molecular weight. The example illustrates that a very low level of
monospecific IgG is secreted and that the main secreted species is the BEAT®
molecule, the main monospecific contaminant being the scFv-Fc homodimer.
Figure 1 B shows the distribution of the heterodimerization level of the CHO
clones screened during cell line development. The median of the distribution
is approx. 80% indicating that half of the generated clones secreted > 80% of
heterodimer. The expression level of the best 10 clones selected in small
scale fed-batches after cell line development can be seen in Figure 1 C.
Clones secreting 1-2 g/L of BEAT® could be obtained under non-optimized
fed-batch conditions. Stability studies demonstrated that selected CHO
clones have a stable level of heterodimerization over long term cultivation
(75 population doubling level (PDL), data not shown).
At 3 L bioreactor scale, titers of 3 g/L with 90% of secreted heterodimer
could be obtained in fed-batch with minimal feeding optimization. After
harvest the molecule is purified by Protein A (ProtA). For purification
purposes the BEAT® was designed with a missing ProtA binding site on the
Hc of the molecule. Consequently, residual monospecific IgG contaminants
(harboring 2 Hc) do not bind to the ProtA column and are thus easily
separated from the products of interest. In addition, the BEAT® molecule and
the homodimeric Fc-scFv contaminant exhibit a different affinity for Protein
A as the molecules harbor one and two binding sites for ProtA, respectively.
Thus, the BEAT® molecule can be separated by ProtA via a two-step isocratic
elution as illustrated in Figure 1 D. Applying this purification strategy for
harvested bioreactor material, a level of purity of 97% could be obtained
post ProtA.
Conclusions: This work introduces a new bispecific IgG format called the
BEAT®. Glenmark’s BEAT® platform allows the generation of stable clones
with volumetric productivity of several g/L and a high heterodimerization
level (> 90% secreted BEAT® in CHO supernatants). Generated clones harbor
stable product quality profiles, e.g. level of heterodimerization, over at least
75 PDL. The developed purification strategy allows a purity reaching 97%
post ProtA. The BEAT® platform combines a unique CH3 interface for
heterodimerization, an efficient cell line selection strategy and an industrial
relevant purification process for the production of pure bispecific antibody
at several g/L.
Acknowledgements: The authors would like to thank Emilie Vaxelaire
and Farid Mosbaoui for their contribution to this work.
Reference
1. Klein C, Sustmann C, Thomas M, Stubenrauch K, Croasdale R, Schanzer J,
Brinkmann U, Kettenberger H, Regula J T, Schaefer W: Progress in
overcoming the chain association issue in bispecific heterodimeric IgG
antibodies. MAbs 2012, 4:653-663.
O10
A quantitative and mechanistic model for monoclonal antibody
glycosylation as a function of nutrient availability during cell culture
Ioscani Jiménez del Val1, Antony Constantinou2,3, Anne Dell2, Stuart Haslam2,
Karen M Polizzi2,3, Cleo Kontoravdi1*
1
Centre for Process Systems Engineering, Department of Chemical
Engineering, Imperial College London, South Kensington Campus, London,
SW7 2AZ, UK; 2Department of Life Sciences, Imperial College London, South
Kensington Campus, London, SW7 2AZ, UK; 3Centre for Synthetic Biology
and Innovation, Imperial College London, South Kensington Campus,
London, SW7 2AZ, UK
Introduction: Monoclonal antibodies (mAbs) are currently the highestselling products of the biopharmaceutical industry, having had global sales
of over $45 billion in 2012 [1]. All commercially-available mAbs contain a
consensus N-linked glycosylation site on each of the Cg2 domains of their
constant fragment (Fc). The monosaccharide composition and distribution of
Page 12 of 151
these N-linked carbohydrates (glycans) has been widely reported to directly
impact the safety and efficacy of mAbs when administered to patients.
Many studies have also shown that manufacturing bioprocess conditions
(e.g. nutrient availability, metabolite accumulation, dissolved oxygen, pH,
temperature and stirring speed) directly influence the composition and
distribution of N-linked glycans bound to mAbs and other recombinant
proteins. Given this tight interconnection between manufacturing process
conditions, product quality and ensuing safety and therapeutic efficacy,
mAbs and their glycosylation present a clear opportunity where process
development can be guided by quality by design (QbD) principles.
QbD is a conceptual framework that aims to build quality into drug products
at every stage of process development. Specifically, implementation of QbD
to pharmaceutical process development requires identifying critical quality
attributes (CQAs) that define the drug’s safety and therapeutic efficacy. QbD
then uses all available information on the mechanisms that quantitatively
relate process inputs with product quality to control the manufacturing
process so that product CQAs are maintained and end-product quality is
ensured. Within the QbD context, composition and distribution of the
glycans present on the Fc of mAbs is defined as a CQA, and thus, the
processes employed in their manufacture must be controlled so that their
glycan distribution ensures the required safety and efficacy profiles.
Under this perspective, we have defined a mathematical model that
mechanistically and quantitatively describes mAb Fc glycosylation as a
function of nutrient availability during cell culture. Such a model aims to be
used for bioprocess design, control and optimisation, thus facilitating the
manufacture of mAbs with built-in glycosylation-associated quality under
the QbD scope.
Materials and methods: The mathematical model consists of three
distinct modular elements which have been connected to achieve a
mechanistic description of mAb glycosylation as a function of nutrient
availability. The first element corresponds to cell culture dynamics and uses
modified Monod kinetics to describe the growth and death of cells as a
function of glucose and glutamine availability. This element also describes
accumulation of metabolites (lactate and ammonia) and mAb synthesis
throughout cell culture.
The second element describes the intracellular dynamics of nucleotide sugar
(NS) metabolism. NSs are the substrates required for protein glycosylation
and are synthesised via the amino sugar and nucleotide sugar metabolic
pathway using glucose and glutamine as primary substrates [2]. The full
metabolic pathway has been heuristically reduced to 8 reactions by
collapsing sequential reactions along each distinct branch of the pathway
into a single one, as shown with the coloured arrows in Figure 1. This
module is linked with the cell culture dynamics one by equations that
define intracellular glucose and glutamine accumulation as a function of
their availability in the extracellular environment.
The pathway shows the synthesis of uridine diphosphate N-acetylglucosamine
(UDP-GlcNAc), uridine diphosphate N-acetylgalactosamine (UDP-GalNAc),
uridine diphosphate glucose (UDP-Glc), uridine diphosphate galactose (UDPGal), guanosine diphosphate mannose (GDP-Man), guanosine diphosphate
fucose (GDP-Fuc), cytosine monophosphate N-acetylneuraminic acid
(CMP-Neu5Ac) and uridine diphosphate glucoronic acid (UDP-GlcA) using
glucose (Glc) and glutamine as substrates. The coloured arrows represent the
reduced scheme where sequential reactions have been collapsed into a single
one (e.g. the blue arrow describes a single reaction that produces UDP-GlcNAc
using glucose and glutamine as substrates). The remaining arrows represent
the synthesis of the other NSs using glucose and glutamine or other NSs
as substrates.
The third element describes mAb Fc glycosylation as a function of mAb
specific productivity and NS availability. This element approximates the
Golgi apparatus to a plug-flow reactor and considers the transport of NSs
from the cytosol, where they are synthesised, into the Golgi, where they are
consumed in glycosylation reactions [3]. As inputs, this element requires
intracellular NS availability and mAb specific productivity, and is thus
coupled to the other two modules. All model simulation was performed
with gPROMS v. 3.4.0 [4].
Experimentally, murine hybridoma cells (CRL-1606, ATCC) were cultured and
typical data was collected (viable cell density, extracellular glucose,
glutamine, lactate, ammonia and mAb titre). In addition, the intracellular
pools of NSs were extracted using perchloric acid and quantified using a
high performance anion exchange chromatographic method that allows for
quantification of 8 NSs and 8 nucleotides in under 30 minutes [5]. Finally,
the mAb glycan profiles were obtained using MALDI mass spectrometry.
Page 13 of 151
Figure 1(abstract O10) Nucleotide sugar metabolic network.
The obtained experimental data was then used to estimate the unknown
parameters of the model. Estimation was performed with the maximum
likelihood formulation available in gPROMS v. 3.4.0, where the values for
uncertain physical parameters are obtained to maximise the probability that
the model will predict values from experimental measurements [4].
Results: Time-courses for all data were produced, including intracellular
profiles for six NSs (GDP-Man, GDP-Fuc, UDP-Glc, UDP-Gal, UDP-GlcNAc and
CMP-Neu5Ac). This, along with data on cell culture dynamics and mAb Fc
glycosylation were used to estimate the unknown parameters of the model
as described previously. With the estimated parameters, the mathematical
model was found to reproduce cell culture dynamics, intracellular NS pools
and terminal mAb Fc glycan distributions accurately.
With the obtained parameters, a case study for glutamine depletion
was simulated. This study showed that under glutamine deprivation,
intracellular availability of UDP-GlcNAc decreases to a point where mAbs
with high-mannose (Man5) glycan structures begin accumulating in the
extracellular environment, a phenomenon that is consistent with previous
observations [6].
Conclusions: We have shown the construction of a mathematical model
which mechanistically and quantitatively describes mAb Fc glycosylation
as a function of nutrient availability during cell culture. In addition,
experimental methods have been developed to generate data which was
used to estimate the unknown parameters of the model. Finally, the
model and obtained parameters were found to be capable of reproducing
previously observed effects of glutamine depletion on protein glycosylation.
With further validation, this quantitative and mechanistic model could prove
useful in aiding process development, control and optimisation for the
manufacture of mAbs with desired glycosylation-associated quality.
References
1. World Preview 2013, Outlook to 2018: Returning to Growth.
EvaluatePharma Report 2013.
2. Kanehisa M, Goto S, Sato Y, Furumichi M, Tanabe M: KEGG for integration
and interpretation of large-scale molecular data sets. Nucl Acids Res 2012,
40(D1):D109-D114.
3.
4.
5.
6.
del Val IJ, Nagy JM, Kontoravdi C: A dynamic mathematical model for
monoclonal antibody N-linked glycosylation and nucleotide sugar donor
transport within a maturing Golgi apparatus. Biotechnol Progr 2011,
27:1730-1743.
Process Systems Enterprise: gPROMS Introductory User Guide. 2009.
Jimenez del Val I, Kyriakopoulos S, Polizzi KM, Kontoravdi C: An optimised
method for extraction and quantification of nucleotides and nucleotide
sugars from mammalian cells. Analytical Biochemistry 2013, under review.
Wong DCF, Wong KTK, Goh LT, Heng CK, Yap MGS: Impact of dynamic online
fed-batch strategies on metabolism, productivity and N-glycosylation
quality in CHO cell cultures. Biotechnol Bioeng 2005, 89:164-177.
POSTER PRESENTATIONS
P1
Generation of genetically engineered CHO cell lines to support the
production of a difficult to express therapeutic protein
Holger Laux1*, Sandrine Romand1, Anett Ritter1, Mevion Oertli1, Mara Fornaro2,
Thomas Jostock1, Burkhard Wilms1
1
Novartis Development Integrated Biologic Profiling, 4002 Basel, Switzerland;
2
Novartis Institutes for Biomedical Research, 4056 Basel, Switzerland
BMC Proceedings 2013, 7(Suppl 6):P1
Introduction: Chinese Hamster Ovary (CHO) cells are widely used for the
large scale production of recombinant biopharmaceuticals. These cells
have been extensively characterised and approved by regulatory
authorities for production of biopharmaceuticals. During the last years
more and more cell-line engineering strategies have been developed to
enhance productivity and quality. CHO cell line engineering work has
made remarkable progress in optimizing products or titers by focusing on
manipulating single genes and selecting clones with desirable traits. In
this work it is shown how cell line engineering approaches enable the
expression of a challenging to express “novel therapeutic protein”. The
expression of the “novel therapeutic protein” in CHO cells resulted in
significant reduced cell growth as well as low productivity.
Results: Transcriptomics analysis: Using customised CHO specific
microarrays the gene expression profile of CHO cells expressing the “novel
therapeutic protein” was analysed. The expression of the “novel therapeutic
protein” resulted in a significant downregulation of all mitochondria encoded
genes. The downregulation was more than 40 fold for some of these genes
(Figure 1A). This massive reduced transcription of mitochondrial encoded
genes was very likely causing the reduced cell growth and reduced
expression of the “novel therapeutic protein”. A decrease in mitochondrial
function reduces overall metabolic efficiency and a change of metabolic
pathways could also be detected on gene expression level. Additionally the
expression of “gene A” was detected in the applied CHO cell line, which
might have the potential to trigger the down regulation of the mitochondrial
encoded genes in the presence of the “novel therapeutic protein”.
Gene knockdown using shRNA (short hairpin RNA) technique: A variety
of cell line engineering approaches were performed to circumvent cell
growth inhibition caused by down regulation of mitochondrial encoded
genes with the aim to improve expression of the “novel therapeutic
protein”. In the first approach the expression of “gene A”, which was
assumed to trigger the down regulation of the mitochondrial encoded
genes, was repressed more than 10 fold using shRNA technique. shRNA is
a sequence of RNA that makes a tight hairpin turn that can be used to
silence target gene expression via RNA interference. Expression of shRNA
was accomplished by delivery of stable integrated plasmids. Cells with
reduced expression of “gene A” showed an improved cell growth and
higher expression of the “novel therapeutic protein” (Figure 1 B). However
cell growth was still repressed, although to a lower extent, and titers were
still lower in comparison to other therapeutic protein formats. Despite the
significant decrease in the expression of “gene A”, the remaining “protein A”
seemed to be sufficient to trigger these effects although to a lower
magnitude.
Gene knockout using zinc finger nucleases (ZFN): To completely
eliminate the cell growth inhibition a knockout of “gene A” was
performed using ZFN technique. ZFNs are artificial restriction enzymes
generated by fusing a zinc finger DNA-binding domain to a DNAcleavage domain. Plasmids encoding ZFNs (specifically designed to detect
and cleave “gene A”) were transiently transfected in the parental CHO cell
line. ZFN cleaves “gene A” which is then repaired by non-homologous
end joining. This is often error prone and resulted in the generation of
mutant alleles. Three clones were identified with mutation in both alleles
of “gene A” resulting in shifts of the reading frame and therefore only
nonfunctional premature termination products are encoded.
Knockout of “gene A” resulted in complete elimination of cell growth
inhibition and the expression of mitochondria encoded genes (Figure 1D)
was restored to levels comparable to parental CHO cells. In addition there
was no change in the expression of genes that are involved in metabolic
pathways. Most striking is the significant improved cell growth and
productivity resulting in a 6-7 fold titer increase using this genetically
engineered knockout cell line (Figure 1B and 1C).
Conclusion: This example illustrates that transcriptomic analysis can
support and facilitate the understanding and solving of specific issues
during the expression of therapeutic proteins. Novel cell line engineering
methods as ZFN technique are powerful tools to solve definite issues in
production of therapeutic proteins in biopharmaceutical industry.
P2
Expansion of mesenchymal adipose-tissue derived stem cells in a
stirred single-use bioreactor under low-serum conditions
Carmen Schirmaier1*, Stephan C Kaiser1, Valentin Jossen1, Silke Brill2,
Frank Jüngerkes2, Christian van den Bos2, Dieter Eibl1, Regine Eibl1
1
Zurich University of Applied Sciences, Institute of Biotechnology,
Biochemical Engineering and Cell Cultivation Technique, 8820 Wädenswil,
Switzerland; 2Lonza Cologne GmbH, 50829 Cologne, Germany
E-mail: *[email protected]
Background: The need for human mesenchymal stem cells (hMSCs) has
increased enormously in recent years due to their important therapeutic
potential. Efficient cell expansion is essential to providing clinically relevant
Page 14 of 151
cell numbers. Such cell quantities can be manufactured by means of
scalable microcarrier (MC)-supported cultivations in stirred single-use
bioreactors.
Materials and methods: Preliminary tests in disposable-spinners (100 mL
culture volume, Corning) were used to determine two suitable media and
MC-types for serum reduced expansions (< 10%) of human adipose tissuederived stem cells (hADSCs; passage 2, Lonza). Using such optimized
media-MC-combinations, hADSCs expanded 30 to 40-fold, which compares
well with expansion rates in planar culture. Based on computational fluid
dynamics simulations and suspension analyses in spinners [1], optimal
operating parameters were determined in a BIOSTAT® UniVessel® SU 2 L
(2 L culture volume, Sartorius Stedim Biotech).
Results: In subsequent batch tests with the BIOSTAT UniVessel® SU 2 L,
expansion rates of between 30 and 40-fold were reached and up to 4.4·108
cells with a cell viability exceeding 98% were harvested. Flow cytometry
tests demonstrated typical marker profiles following cell expansion and
harvest. A 40-fold expansion rate delivered a total of 1·1010 cells in a first
cultivation with the BIOSTAT® CultiBag STR 50 L (35 L culture volume,
Sartorius Stedim Biotech).
Conclusions: In summary, the foundations for successfully expanding
therapeutic stem cells in truly scalable systems have been laid. Strategies
ensuring expansion rates between 60 and 70-fold and, thus, generating
cell amounts over 1010 are now in preparation.
Acknowledgements: This work is part of the project “Development of a
technology platform for a scalable production of therapeutically relevant
stem cells” (No. 12893.1 VOUCH-LS). It is supported by the Commission for
Technology and Innovation (CTI, Switzerland). The authors would like to
thank the CTI for partially financing the investigations presented.
Reference
1. Kaiser S C, Jossen V, Schirmaier C, Eibl D, Brill S, van den Bos C, Eibl R:
Investigations of fluid flow and cell proliferation of mesenchymal
adipose-derived stem cells in small-scale, stirred, single-use bioreactors.
Chem Ing Tech 2013, 85:95-102.
P3
Evaluating the effect of chromosomal context on zinc finger nuclease
efficiency
Scott Bahr*, Laura Cortner, Sara Ladley, Trissa Borgschulte
CHOZN® Platform Development Team, SAFC/Sigma-Aldrich, St Louis, MO
63103, USA
Introduction: Zinc Finger Nuclease (ZFN) technology has provided
researchers with a tool for integrating exogenous sequences into most cell
lines or genomes in a precise manner. Using current methods, the
efficiency of targeted integration (TI) into the host genome is generally low
and is highly dependent on the ZFN activity at the genomic locus of
interest. It is unknown if the ZFN binding and cutting efficiency is more
dependent on the nucleotide recognition sequence or the chromosomal
context in which the sequence is located.
We have taken a highly efficient ZFN pair (hAAVS1) from human studies
and introduced the exogenous DNA sequence into the Chinese Hamster
Ovary (CHO) genome in an attempt to improve the efficiency of targeted
integration. A “Landing Pad” comprised of human AAVS1 sequence has
been integrated into the CHO genome at 3 separate loci to determine if
the ZFN’s will work across species and if the cutting efficiency is affected
by chromosomal context. The results of this study will help us to improve
the overall efficiency of TI by using Landing Pads, particularly for
genomic targets in which suitable ZFN’s may not be available.
Methods: 3 CHO Loci were chosen for this study based on previous gene
expression studies. Rosa26 and Neu3 show consistent but low levels of
expression while Site #1 appears to have no known coding sequence.
Additionally, Rosa26 and Site#1 were chosen as potential safe harbor sites
in CHO. The ZFN cutting efficiency at the endogenous CHO loci Rosa26,
Site #1 and Neu3 are approximately 15%, 30% and 40% respectively. Based
on other studies the cutting efficiency of human AAVS1 ZFN’s was as high
as 50% depending on the human cell line used. A plasmid donor carrying
the hAAVS1 ZFN recognition sequence Landing Pad was introduced into
CHO Rosa26, Site #1, and Neu3 via targeted integration (Figure 1).
Page 15 of 151
Figure 1(abstract P1) A highlights the reduced expression of mitochondria encoded genes in CHO cells expressing the “novel therapeutic protein” in
comparison to parental CHO cells. The y-axis shows the gene expression values in signal intensities. B: Batch culture titers of the “novel therapeutic
protein” in shake flask are shown. Titer for CHO WT cells are labeled in red, titer for CHO cells with reduced expression of gene A (shRNA approach) are
labeled in yellow and titer for CHO cells with non-functional gene A (knockout) are labeled in green. C: Cell growth of CHO WT cells and CHO knockout
(KO) cells with and without “novel therapeutic protein” in shake flasks. Y-axis shows viable cell density and x-axis cultivation time. D: Gene expression of
mitochondrial encoded genes is not reduced in all three generated CHO KO cell lines with the “novel therapeutic protein”. Hierarchical clustering reveals
that the “novel therapeutic protein” does not affect the gene expression profile of the KO cell lines. In contrast the “novel therapeutic protein” has a clear
effect on the WT cell line.
Page 16 of 151
Figure 1(abstract P3) Schematic of ZFN mediated Integration of the hAAVS1 Landing Pad into CHO.
Results: Clones carrying the exogenous hAAVS1 Landing Pads at Rosa26, Site
#1 and Neu3 were transfected with hAAVS1 ZFN’s and the cutting efficiency
was measured. We found that the human AAVS1 ZFN’s were able to
successfully cut at their recognition sequence in the Landing Pad at all 3 CHO
loci to varying degrees (Table 1). ZFN efficiency at each loci was measured by
Cel1 Assay or direct sequencing of Indels in PCR amplicons. We see
successful ZFN activity at all 3 loci but with varying efficiency. **The Landing
Pad integration at Neu3 locus caused phenotypic changes in the cell growth
and viability following transfection which may explain low ZFN activity.
Conclusions: These results indicate that the chromosomal context of the
ZFN recognition sequence has an effect on cutting efficiency. This study
shows that TI can be performed with Landing Pads across species with high
efficiency and provide researchers with additional tools for cell line
engineering. Further development of Landing Pads could create highly
engineered and multi-functional platforms that would facilitate more
efficient and more tailored CHO cell modifications.
P4
Insights into monitoring changes in the viable cell density and cell
physiology using scanning, multi-frequency dielectric spectroscopy
John Carvell1*, Lisa Graham2, Brandon Downey2
1
Aber Instruments Ltd, Abersytwyth, UK; 2Bend Research Inc., Oregon, USA
Table 1(abstract P3) Comparing ZFN activity in CHO
before and after Landing Pad Integration
CHO
Site
ZFN Activity at Endogenous
CHO Locus
ZFN Activity at Integrated
Landing Pad
Rosa
26
16%
18%
Site
#1
31%
51%
Neu3
41%
16%**
Background: Real-time bioprocess monitoring is fundamental for
maximizing yield, improving efficiency and process reproducibility,
minimizing costs, optimizing product quality, and full understanding of how
a system works. The FDA’s Process Analytical Technology initiative (PAT)
encourages bioprocess workflows to operate under systems that provide
timely, in-process results. At the same time the demand for ever increasing
supplies of biological pharmaceuticals, such as antibodies and recombinant
proteins, has fueled interest in streamlined manufacturing solutions.
Bioreactors that are monitored continuously and in real-time offer the
advantage of meeting current and future supply demands with biological
product of the utmost quality and safety, achieved at the lowest overall cost
and with least risk. This paper will focus on how one research groups in has
used scanning multi-frequency dielectric spectroscopy to comparatively
profile multiple bioreactor runs and elucidate fine details concerning cell
viability and mechanism of cell death. The cellular information observed has
not been available through other technologies. The presentation will also
focus on how the technology can also be applied to Single use Bioreactors
in a cGMP environment and on samples down to 1 ml volume.
Introduction: • Dielectric spectroscopy (DS) is now the most common
method for estimating the in situ live cell concentration in animal cell
culture.
• DS and traditional offline methods for cell counting based on
Trypan Blue correlate well during the growth phases but with some
cell lines, deviations are observed during the late growth phase.
• Scanning multi-frequency DS can detect the physiological changes
of the cells during the death phase of the culture including changes
in cell size, membrane capacitance and internal conductivity [1-3].
• The concept of using the Area Ratio Algorithm (ARA) looks to be a
relatively simple and promising method for providing on-line cell
counts that correlate well with traditional methods for the complete
cell growth cycle.
Background of DS and the Futura Biomass Monitor: • DS measures
the passive electrical properties of cells in suspension through the
cells’ interaction with RF excitations.
• Viable cells are composed of a conducting cytoplasm surrounded by a
non-conducting membrane suspended in a conducting medium. When
an alternating current is applied to the suspension, each cell becomes
polarised and behaves electrically as a tiny spherical capacitor.
• The suspensions reaction to the current is expressed as its permittivity
can be measured by its capacitance and conductivity as a function of
frequency. Viable cells possess intact membranes which prevent the
free flow of ions and allow the cells to polarise. Dead, porous cells and
debris lack an enclosing membrane and are unable to build up charge
separation. Hence, DS measures only viable cells.
• The Futura Biomass Monitor (Aber Instruments Ltd, UK) measures the
capacitance created directly from the cells. The capacitance signature
of cells is measured between 50 KHz and 20 MHz with readings every
30 seconds.
• At low excitation frequencies the cells can fully polarise and the
capacitance of the suspension is maximised. As the excitation
increases, the cells lose their ability to fully polarize and the measured
capacitance drops eventually measuring no polarisation at high
frequencies.
Concept of the Area Ratio algorithm: • A novel method for obtaining an
enhanced prediction of viable cell volume fraction (VCV) compared to
currently employed methods has been developed, wherein changes in
cell health are quantified using frequency scanning data. In the novel
method, cell health is measured by using an area ratio (AR) to quantify
the shape of the measured dielectric spectrum using the following
algorithm: AR = ∫ fQfHC(f )df ∫ fLfHC(f )df fH < fQ < fL
Where:
AR = area ratio for a given scan
fH = highest frequency of the scan
fL = lowest frequency of the scan
fQ = semi arbitrary chosen frequency between fH and fL
C(f) = capacitance as a function of frequency
• The AR is used as a correction factor to correct for the death phase
divergence in the following manner: VCV(t) = A × (C(t) - B × AR(t) k2) + k1
Where:
VCV = predicted viable cell volume fraction
A and B = fit constants of proportionality relating dielectric
measurements to offline cell measurements
k1 and k2 = constant offset values
• Changes in cell health are quantified using frequency scanning data.
When the ARA is applied to the uncorrected VCV derived from the
capacitance data, there is a good match with the off-line derived VCV
(Figure 1).
Applying multi-frequency scanning DS to single use bioreactors and
samples off-line: • A single use sensor has been developed by Aber
Instruments and the early versions utilized stainless steel electrodes.
This sensor was suitable for single or dual frequency DS and the
Page 17 of 151
performance has been compared with traditional probes that are used
on reusable bioreactors [4].
• Samples as low as 100 microlitre can be withdrawn from a bioreactor
and scanning DS can be applied using existing DS probes. An example
of this is shown in the full version of the poster with distinctly
different frequency scans for healthy and unhealthy cells. The
unhealthy cells were generated by treatment with 1 uM staurosporine
to induce apoptosis.
Discussions and conclusions: The work presented here shows the utility
of frequency scanning data to obtain enhanced measurement of VCV using
non-invasive capacitance sensors in reusable and single use bioreactors. The
information-rich nature of dielectric frequency scanning allows interrogation
of biophysical properties of cells. The concept can be extended to samples
off-line.
References
1. Asami K: Characterization of heterogeneous systems by dielectric
spectroscopy. Prog Polymer Sci 2002, 27:1617-1659.
2. Cannizzaro C, Gügerli R, Marison I, Von Stockar U: On-line biomass
monitoring of CHO perfusion culture with scanning dielectric
spectroscopy. Biotechnol Bioeng 2003, 84:597-610.
3. Ron A, Singh RR, Fishelson N, Shur I, Socher R, Benayahu D, ShachamDiamand Y: Cell-based screening for membranal and cytoplasmatic
markers using dielectric spectroscopy. Biophys Chem 2008, 135:59-68.
4. Carvell JP, Williams J, Lee M, Logan D: On-Line Monitoring of the Live Cell
Concentration in Disposable Bioreactors (poster). European Society for
Animal Cell Technology biennial conference, Dublin, Ireland 2009.
P5
Multidimension cultivation analysis by standard and omics methods for
optimization of therapeutics production
Julia Gettmann1†, Christina Timmermann1†, Jennifer Becker1, Tobias Thüte1,
Oliver Rupp2, Heino Büntemeyer1, Anica Lohmeier1, Alexander Goesmann2,
Thomas Noll1,3*
1
Institute of Cell Culture Technology, Bielefeld University, 33615 Bielefeld,
Germany; 2Bioinformatics Resource Facility, Center for Biotechnology
(CeBiTec), Bielefeld University, 33615 Bielefeld, Germany; 3Center for
Biotechnology (CeBiTec), Bielefeld University, 33615 Bielefeld, Germany
Background: During the last decades Chinese Hamster Ovary (CHO) cells
have been extensively used for research and biotechnological applications.
About 40% of newly approved glycosylated protein pharmaceuticals are
produced in CHO cells today [1]. Despite the increasing relevance of these
Figure 1(abstract P4) Implementation of the Area Ratio Algorithm (ARA) yields enhanced prediction of viable cell volume fraction compared
with uncorrected methods.
cells for biopharmaceutical production little is known about effects of
intracellular processes on productivity and product quality.
In the last years supplementation of serum-free media with insulin - more
and more replaced by IGF-1 and its analogue LongR3 - was utilized to
enhance product titer and quality. To compare the intracellular effects of
these two supplements an antibody producing CHO cell line was cultivated
in batch mode using insulin, LongR 3 or no growth factor as reference.
Subsequently, different omics-techniques were applied to analyze medium
and cell samples.
Materials and methods: CHO cells producing an antibody were cultured
in chemically defined serum-free medium TC-BN.CHO (Teutocell AG) with
addition of 6 mM glutamine. Three cultivations (37°C, pH 7.1, 40% DO,
120 rpm) were performed in 2l-bioreactor systems with supplementation
of 10 mg/l insulin or 0.1 mg/l LongR3. The third culture was untreated and
served as reference. Samples were taken every 24 h.
Viable cell density and cell viability were measured using Cedex (Roche).
Glucose and lactate were determined via YSI 2300 STAT Plus™ Glucose &
Lactate Analyzer (YSI Life Science). Quantitation of antibody production was
determined using POROS® A columns (Invitrogen). N-Glycan abundance was
analyzed by HPAEC-PAD method [2].
For RNA samples ‘Total RNA NucleoSpin Kit’ (Macherey-Nagel) was used.
Quality and quantity of RNA were determined using Nano Drop 1000
(Peqlab) and Bioanalyzer (Agilent).
An in-house developed customized cDNA microarray with 41,304 probes
was applied for transcriptome analysis. RNA was labeled using Agilent
LIQUA Kit, one-color. Processing of microarray data was performed in
ArrayLims and EMMA2 [3]. Raw data were standardized using Feature
Extractor (Agilent) and LOWESS normalization.
Results: Cultivation data illustrated that maximal cell density was higher in
cultivations with insulin and LongR3 compared to that without growth
factor. Additionally, glucose consumption and lactate production was
slightly higher in cultivations with these supplements but time point of
glutamine depletion was similar in all reactors after similar cultivation time
(Figure 1A). Furthermore, product quantity and product quality was not
influenced by growth factor addition. The most abundant glycoforms after
7 days of cultivation were G0F with about 50% and G1F with about 40% in
all cultivation set-ups (Table 1).
For transcriptome analysis samples on day 5 were compared with those on
day 3. Therefore, the following settings were used in statistical tests: a twosample t-test with a p-value ≤ 0.01, signal intensity ≥ 6 (for A1 or A2) and
intensity ratio ≥ 0.6 or ≤ -0.6 (for M1 or M2). Transcriptome data showed
that LongR3 supplementation resulted in the highest transcription change
(1259 up- and 1689 down-regulated). Insulin supplementation resulted in
second highest transcriptomic change (1026 up- and 1404 downregulated) and reference cultivation led to lowest changes (344 up- and
301down-regulated). Supplemented cultures showed a higher transcription
change in the selected pathways, like pentose phosphate pathway, TCA
and glycolysis, than the reference culture, too. In LongR 3 containing
Page 18 of 151
cultures even more genes from these pathways were higher changed
(Figure 1B).
Conclusions: Data on cell growth and productivity as well as omics results
were brought together to achieve a deeper insight into cellular processes
and their influence on productivity and product quality.
Cultivation data showed faster growth, glucose consumption and lactate
formation for cultivations with insulin and LongR3 compared to reference
culture. However, antibody titer and glycan profiles were almost similar in all
cultures. This indicates that supplementation with insulin or LongR3 does
not have an enhancing effect on product quality and quantity in antibody
production with our CHO-K1 cells.
Additionally, transcriptome data showed that growth factor supplementation resulted in a higher transcription change than in reference cultivation.
Thus, for more understanding of the influence of insulin or LongR 3
supplementation on cultured CHO cells, further analysis of pathway
regulation with full details is required.
Acknowledgements: The project is co-funded by the European Union
(European Regional Development Fund - Investing in your future) and the
German federal state North Rhine-Westphalia (NRW).
References
1. Higgins E: Carbohydrate analysis throughout the development of a
protein therapeutic. Glycoconj J 2010, 2:211-225.
2. Behan JL, Smith KD: The analysis of glycosylation: a continued need for high
pH anion exchange chromatography. Biomed Chromatogr 2011, 25:39-46.
3. Dondrup M, Albaum SP, Griebel T, Henckel K, Junemann S, Kahlke T,
Kleindt CK, Kuster H, Linke B, Mertens D, Mittard-Runte V, Neuweger H,
Runte KJ, Tauch A, Tille F, Puhler A, Goesmann A: EMMA 2–a MAGEcompliant system for the collaborative analysis and integration of
microarray data. BMC Bioinformatics 2009, 10:50.
P6
Toward a serum-free, xeno-free culture system for optimal growth and
expansion of hMSC suited to therapeutic applications
Mira Genser-Nir*, Sharon Daniliuc, Marina Tevrovsky, David Fiorentini
Biological Industries, Kibbutz Beit Haemek, Israel
Background: Human mesenchymal stem cells (hMSC) hold great promise
as a tool in regenerative medicine and cell therapy. Application of hMSC in
cell therapy requires the elaboration of an appropriate serum-free (SF),
xeno-free (XF) culture system in order to minimize the health risk of using
xenogenic compounds, and to limit the immunological reactions in-vivo.
Besides the well-known disadvantages of serum, in comparison to a SF, XF
culture system, serum also exhibits poor performance in the context of
hMSC proliferation. In the present study, a novel SF, XF culture system for
hMSC suitable for therapeutic applications was developed and evaluated.
Figure 1(abstract P5) (A) Time chart of viable cell density (VCD), cell viability (CV) and extracellular metabolites [glucose (Glc), lactate (Lac), glutamine
(Gln)]. (B) Number of significantly up- and down-regulated genes on day 5 in selected pathways (compared to day 3).
Page 19 of 151
Table 1(abstract P5) N-Glycan abundance [%] after
7 days of cultivation
Culture
G0F
G0
G1F
G1
G2F
G2
Reference
51,8
4,1
35,6
0,9
7,4
0,2
Insulin
50,6
3,4
38,6
0,9
6,3
0,2
LongR3
52,5
1,4
38,5
0,5
6,9
0,3
The SF, XF culture system includes specially developed solutions for
attachment, dissociation, and freezing, as well as a culture medium, MSC
NutriStem® XF, that enables long-term growth of multipotent hMSC.
Development of the SF, XF culture system was conducted on hMSC from a
variety of sources: bone marrow (BM), adipose tissue (AT) and Wharton’s
jelly (WJ).
Materials and methods: MSC NutriStem® XF culture medium was
examined in combination with MSC Attachment Solution (BI, 05-752-1) and
either Recombinant Trypsin Solution (BI, 03-078-1) or MSC Dissociation
Solution (BI, 03-075-1). The performance of MSC NutriStem® XF was
evaluated based on the following parameters: proliferation rate, viability,
morphology, stemness (estimated from CFU-F), multilineage differentiation
capability, and phenotypic surface marker profile [1].
Cells: hMSC (passage 1-5) from a variety of sources: BM (Lonza, Promocell),
AT (Promocell, ATCC), and WJ (ATCC, Prof. Mark Weiss - self isolation) were
used in this study.
Culture System: hMSC were cultured in a SF, XF expansion medium (MSC
NutriStem® XF, BI) on pre-coated dishes (MSC Attachment Solution, BI) or
other media; commercial SF media (Invitrogen; SCT, Promocell), in-house
serum-containing formulation (Prof. Mark Weiss). Cells were seeded at
5000-6000 viable cells/cm2, and harvested using either MSC Dissociation
Solution (BI) or recombinant Trypsin Dissociation Solution (BI).
Medium Performance Evaluation: Medium performance was evaluated
by conducting a comparison of proliferation rate, cell morphology,
multilinage differentiation potential into adipocytes, osteocytes, and
chondrocytes, self-renewal potential and cell immunophenotype.
Cell Expansion: Cell proliferation was assessed by cell count using a
trypan blue exclusion assay at each time point.
Differentiation: hMSC expanded for 3-5 passages in MSC NutriStem® XF
were tested for maintenance of multilineage differentiation potential (into
adipocytes, osteocytes, and chondrocytes) using in-house differentiation
formulations. Undifferentiated control cells were cultured in MSC
NutriStem® XF. Cells were fixed and stained with Oil Red O, Alizarin Red/
von Kossa, and Alcian blue/Masson’s trichrome, respectively.
CFU-F Assay: hMSC were seeded at low densities (10, 50, and 100 cells/
cm2) in MSC NutriStem® XF, cultured for 14 days, and stained with 0.5%
crystal violet.
Flow Cytometry: WJ-derived hMSC were cultured for five passages in
MSC NutriStem® XF, followed by immunophenotype evaluation by flow
cytometry expression of CD73, CD90, CD105, HLA-ABC (positive), HLA-DR,
and CD45 (negative).
Results: An optimized SF, XF culture system for hMSC was developed,
composed of growth medium, MSC NutriStem® XF, and all the required
auxiliary solutions for the attachment, dissociation, and freezing of the cells.
This SF, XF culture system for hMSC, supported optimal expansion of hMSC
from a variety of sources, and exhibited superior proliferation compared
with serum-containing media and commercially available SF media. hMSC
expanded in the SF, XF culture system maintain their typical fibroblast-like
cell morphology and phenotypic surface marker profile of CD73, CD90,
CD105, HLA-ABC (all positive), or CD34, CD45, HLA-DR (all negative). hMSC
differentiated efficiently after expansion in the developed SF, XF culture
system into osteocytes, chondrocytes, and adipocytes. The self-renewal
potential was maintained as well, demonstrated by a colony-forming unit
fibroblast (CFU-F) assay (Figure 1).
Conclusions: The use of serum is not an option from a regulatory point of
view. A SF, XF culture system for hMSC was developed and enables longterm growth of multipotent hMSC suitable for therapeutic applications.
The performance of MSC NutriStem® XF medium was proved to be
superior to serum-containing medium and commercially available SF
media. MSC NutriStem® XF medium supports long-term culture of hMSC
from a variety of sources, while retaining the essential hMSC characteristics
(fibroblast-like morphology, surface markers phenotype, multilineage
differentiation, and self-renewal potential).The developed SF, XF culture
system (MSC NutriStem® XF medium, MSC Attachment Solution, either
MSC Dissociation Solution or Recombinant Trypsin solution, and MSC
Freezing Solution) supports the expansion of hMSC suitable for clinical
applications.
Acknowledgements: We would like to thank Professor Mark L. Weiss,
Kansas State University, Department of Anatomy and Physiology,
Manhattan, KS, for his invaluable contribution to this study.
Reference
1. Poster: ISCT 2012 Seattle, USA. Identification of optimal conditions for
generating MSCs for preclinical testing: Comparison of three commercial
serum-free media and low-serum growth medium. Weiss, Kansas State
University, Department of Anatomy and Physiology, Manhattan, KS: Yelica
López, Elizabeth Trevino, Mark L .
P7
Highly efficient inoculum propagation in perfusion culture using WAVE
Bioreactor™ systems
Christian Kaisermayer1*, Jianjun Yang2
1
GE Healthcare Life Sciences, Björkgatan 30, 751 84 Uppsala, Sweden; 2GE
China Research and Development Center Co. Ltd. Shanghai, China
Introduction: A perfusion-based process was developed to increase the
split ratio during the scale-up of CHO-S™ cell cultures. Fedbatch cultures
were inoculated with cells propagated in either batch or perfusion
cultures. All cultures were grown in disposable Cellbag™ bioreactors using
the WAVE Bioreactor system. Cell concentrations of 4.8 × 107 cells/mL were
achieved in the perfusion culture, whereas the final cell concentration in
the batch culture was 5.1 × 106 cells/mL. The higher cell concentration of
the perfusion culture allowed for a more than six-fold increase of the split
ratio to about 1:30. The method described here, can reduce the number of
required expansion steps and eliminate the need for one or two
bioreactors in the seed train. Single-use bioreactors at benchtop scale can
be used for direct inoculation of production bioreactors. Alternatively, high
biomass concentrations accumulated in perfusion culture can be used to
seed production vessels at increased cell concentrations. Thus, the process
time in these bioreactors, which often is the bottleneck in plant
throughput, can be shortened.
Materials and methods: • CHO-S cells (Life Technlologies)
• Cultivation medium and feed concentrate: T13 and T13-F (Shanghai
Hankang Biotech Co.)
• WAVE Biorereactor 20/50 system (GE Healthcare)
• Cellbag bioreactors (GE Healthcare)
Batch and fed-batch cultivations were run in Cellbag 10 L bioreactors,
perfusion cultures in Cellbag 2 L bioreactors. Cultivation conditions: T 37°C,
pH 7.10, DO > 40%, agitation for all cultures 25 rpm/6°.
Analytics: Cell concentration and viability, glucose and lactate concentration.
Perfusion and feed rates were adjusted to maintain the residual glucose
concentration above 0.5 g/L.
Results and discussion: CHO cells are the production system of choice for
complex recombinant proteins. The prevalent mode of production is
fedbatch cultivation because of the generated titers achieved with limited
process complexity [1]. Perfusion processes have been reported as an
alternative strategy that substantially increases volumetric productivity but
because of the higher process complexity, they are less frequently used in
manufacturing [2,3]. An alternative strategy is to use perfusion technology in
the seed train to improve process flexibility and maximize equipment
utilization [3]. In this comparative study, CHO-S cells were grown in either
batch or perfusion (Figure 1) culture to generate inocula for subsequent fedbatch cultivations. During the initial phase, cell growth in both cultures was
similar (Figure 1). However, despite high cell viability, the growth rate in the
batch culture decreased from 0.8 d-1 during the first two days to about 0.3 d-1
between day 2 and 6 (data not shown). In contrast, the nutrient supply in
the perfusion culture supported an average growth rate of 0.8 d-1 and an
exponential growth until day 5 (Figure 1). Inoculum was removed from each
seed culture while the cells were still growing at their maximum rate and
while viability was above 95%. The higher cell concentration achieved in the
perfusion culture was used to seed a subsequent fedbatch culture at an
Page 20 of 151
Figure 1(abstract P6) hMSC Features after culturing in MSC NutriStem® XF. Characterization of hMSC-WJ expanded for 5 passages in MSC
NutriStem® XF and in-house serum-containing formulation. Immunophenotype using FACS analysis (A), multilineage differentiation into adipocytes (Oil
Red O), osteocytes (von Kossa), and chondrocytes (Masson’s trichrome) (B), CFU-F assay (C). hMSC cultured in MSC NutriStem® XF maintains the essential
MSC characteristics; classical profile of MSC markers, multilineage differentiation, and self-renewal potential [1].
increased split ratio of 1:30, compared with 1:5 used for the inoculum from
the batch culture. Cell growth in the two subsequent fed-batch cultures is
shown in Figure 1. The cultures inoculated from either batch or perfusion
culture showed comparable growth and no lag phase was observed after
inoculation. A comparison of the individual culture parameters is presented in
Table 1. The higher split ratio in the perfusion culture saves at least one step
in the inoculum propagation as compared with cultivation in batch mode, for
which two subsequent cultures with a split ratio of 1:5 would be required to
obtain a similar ratio. Even higher split ratios could be achieved in perfusion
cultures. On day 6, the cell concentration was 4.06 × 107 cells/mL with a
viability of 96%. (Figure 1). Although the cells were already at the end of the
exponential growth phase, a split ratio of 1:100 could be achieved at this
timepoint. The fed-batch culture inoculated from the perfusion culture was
started at a substantially higher cell concentration than the one inoculated
from the batch culture and, thus, reached its maximum cell concentration
about two days earlier (Figure 1). Additionally the viable cell integral was
increased by about 20% (data not shown). Assuming constant product
formation during cell growth, this would allow to reach the same amount of
product two days earlier and, thus, shorten process time in the main
bioreactor. The use of perfusion cultures for seeding the production
bioreactor at high cell concentrations has also been reported for an industry
process at 13,500 L working volume where it resulted in a 20% decrease in
the occupation of the production vessel [3].
Conclusions: • Perfusion culture maintained cells in exponential growth
phase for an extended period of time compared with batch culture.
• The high cell concentrations obtained in perfusion culture can
substantially increase the split ratio, thus, minimizing the number of
vessels needed in the seed train.
• Alternatively, the production bioreactor can be inoculated at high cell
concentration, which can help shortening process time in the
production vessel and improving facility utilization.
• One WAVE Bioreactor 20/50 system, run in perfusion mode at the
maximum operating volume of 25 L, could provide inoculum for a
2000 L bioreactor.
References
1. Shukla A, Thömmes J: Recent advances in large-scale production of
monoclonal antibodies and related proteins. Trends Biotechnol 2010,
28:253-261.
2. Wang L, Hu H, Yang J, Wang F, Kaisermayer C, Zhou P: High yield of
human monoclonal antibody produced by stably transfected drosophila
schneider 2 cells in perfusion culture using wave bioreactor. Mol
Biotechnol 2012, 52:170-179.
3. Pohlscheidt M, Jacobs M, Wolf S, Thiele J, Jockwer A, Gabelsberger J,
Jenzsch M, Tebbe H, Burg J: Optimizing capacity utilization by large scale
3000 L perfusion in seed train bioreactors. Biotechnol Prog 2013,
29:222-229.
Page 21 of 151
Figure 1(abstract P7) CHO-S cells grown in batch and perfusion. Arrow indicates seed removal for subsequent fedbatch cultures (upper panel).
Comparison of CHO-S fed-batch cultures inoculated from either batch or perfusion (lower panel).
University, Institute for Medical Technology, Mannheim, Baden-Württemberg,
68163, Germany
P8
Intact cell MALDI mass spectrometry biotyping for “at-line” monitoring
of apoptosis progression in CHO cell cultures
Sebastian Schwamb1*, Bogdan Munteanu1, Björn Meyer1, Carsten Hopf1,2,
Mathias Hafner1,2,3, Philipp Wiedemann1,2
1
Center for Applied Biomedical Mass Spectrometry (ABIMAS), Mannheim,
Baden-Württemberg, 68163, Germany; 2Mannheim University of Applied
Sciences, Mannheim, Baden-Württemberg, 68163, Germany; 3Heidelberg
Background: Mammalian cell cultures, especially Chinese Hamster Ovary
(CHO), are the predominant host for the production of biologics. Despite
considerable progress in industry and academia alike (also enforced e.g.
by the Process Analytical Technology Initiative of the FDA), particularly in
Table 1(abstract P7) Comparison of fed-batch cultures
FB seeded from batch
FB seeded from perfusion
Cell conc. at cell removal [c/mL]
2.2 × 106
2.3 × 107
Split ratio
1:5
1:30
Inoculum conc. [c/mL]
4.1 × 105
7.4 × 105
Process time [d]
14
14
7
Peak cell conc. [c/mL]
Av. μ during growth phase [d ]
-1
Inoculum propagated either in batch or perfusion culture
1.4 × 10
1.7 × 107
0.44
0.52
the field of process monitoring there is still a need for innovative
methods enabling improvement of process monitoring. For optimized
process control it would be imperative to know as early as possible
“when a cell needs what”, when it is stressed, running into substrate
limitations etc., at best in an online or robust at line format.
Intact cell MALDI mass spectrometry (ICM-MS) biotyping, a method used
successfully in the field of clinical and environmental microbiology, is
getting more attention in the context of mammalian cell cultivation. Here
we report preliminary results of an assessment of a fast and high
throughput at line capable ICM MS method for cell culture monitoring. As
a first example, we choose apoptosis monitoring.
The identification of specific mass spectrometric signatures related to
early stages of apoptosis using ICM-MS biotyping as reported here could
be a promising tool for CHO culture.
Material and methods: An exponentially growing CHO suspension cell
line was inoculated at a seeding density of 2 × 105 cells/ml and an initial
volume of 30 ml in 125 ml Erlenmeyer flasks. Samples for assessing viabilityand apoptosis-progression and for ICM MS biotyping were taken at 48, 72,
96, 120, 144, 192 and 240 h. Experiments were carried out as biological
triplicates.
Page 22 of 151
Viability was determined by trypan blue dye exclusion using a ViCell
(Beckman Coulter, Krefeld, Germany) for automated processing. Apoptosis
was measured in triplicate for each biological sample by means of caspase-9
activity (Caspase-Glo®9 assay kit; Promega, Mannheim, Germany) using a
microplate format (plate reader POLARstar Omega, BMG Labtech, Ortenberg,
Germany).
ICM MS biotyping (using a Bruker Autoflex III MALDI-TOF/TOF MS) analysis
samples were prepared from as little as 2500 cells. The method is
described in detail by Munteanu et al. (2012) [1].
Results: To evaluate the power of ICM MS as an at-line analytical method
for apoptosis monitoring, batch cultivations of CHO suspension cells were
analyzed by standard analytical methods and ICM MS in comparison.
Cell viabilities as assessed by trypan blue remained constant over 120 h of
batch cultures. A first drop in cell viability was noticed between 120 and
144 h (Figure 1 a).
In ICM MS analysis, a total of approx. 160 m/z values was monitored in a
mass to charge (m/z) range of 4,000 to 30,000. Principle component analysis
(PCA; Figure 1 c) of ICM MS results showed no clear group discrimination
during the first 96 h of cultivation. Interestingly, cell samples obtained from
120 h of cultivation onwards appear as distinct groups in PCA analysis.
Figure 1(abstract P8) Viability (a), caspase-9 activity (b) and ICM MS biotyping (c) during batch cultivation. FC RLU: Fold change of relative
luminescence units; PC: Principal component of the respective analysis. (a) and (b): given are means of measurements of three experiments (i.e. n = 3) ± SD;
(3): each dot represents one ICM MS measurement. Dashed lines illustrate at which point culture alteration is detectable with the respective method.
Page 23 of 151
Table 1(abstract P8) Details of classifying “unknown”
samples using the CPT model
“unknown”
sample [h]
Drop of
viability [Y/N]
Apoptosis
detection [Y/N]
Class
PPV [%]
48
N
N
Viable
(no
apoptosis
signal)
72
N
N
96
N
N
120
83
N
Y
Early
apoptotic
144
Y
Y
Late
apoptotic
192
Y
Y
240
Y
Y
94
100
The concentration of the monitored apoptosis marker (caspase-9 activity;
Figure 1 b) began to increase between 96 and 120 h, i.e. concomitantly
with PCA analysis (Figure 1).
As a result, ICM MS as reported here allowed for rapid detection of cell
viability changes approx. 24 h earlier than standard culture monitoring
and concomitant with the detection of an early, not “at-line” applicable
apoptosis marker.
Closer data analysis allowed the identification of an apoptosis related
subset of m/z values. Using the software ClinProTools (CPT; Bruker
Daltonik) it was possible to develop a classification model which points
toward classification of unknown samples regarding their viability/
apoptosis state (Table 1). The classification power was illustrated as
positive predictive value (PPV) which is the number of correctly classified
samples over the total number of classified samples. All biological samples
were analyzed as 6-8 technical replicates, meaning in theory a PPV > 50%
is sufficient for classification.
Conclusion: We introduced a fast and robust ICM MS method for
predictive cell culture monitoring. Viability changes can be detected up to
24 h earlier compared to standard methods (e.g. trypan blue).
We identified a specific MS signature (condensed subset of original
spectra) of m/z values related to cell stress and apoptosis.
A model built on the basis of this signature allows classification of unknown
samples regarding their viability/apoptosis level.
These results will be substantiated by assessment of further cell lines as well
as monitoring attributes other than cell stress/apoptosis (e.g. product titer or
metabolite progression).
Reference
1. Munteanu B, von Reitzenstein C, Hänsch GM, Meyer B, Hopf C: Sensitive,
robust and automated protein analysis of cell differentiation and of
primary human blood cells by Intact cell MALDI mass spectrometry
biotyping. Anal Bioanal Chem 2012, 408:2277-2286.
This is time- and cost-intensive: From volumes used for cell thawing or cell
line maintenance the cell number has to be increased. The cells are usually
run through many cultivation systems which become larger with each
passage (e.g. T-flasks, roller bottles or shake flasks, small scale bioreactor
systems and subsequently larger bioreactors. Single-use systems may be
applied and systems which are inoculated at a partly filled state and
culture volume is increased afterwards by medium addition). The
production bioreactor is inoculated out of the largest seed train scale.
Motivation: A seed train offers space for optimization, e.g. choice of
optimal points in time for cell passaging from one scale into the larger
one. Furthermore choice of inoculation cell density as well as culture
volume at inoculation in bioreactor scales (when inoculation volume is
below maximum working volume). When designing a new seed train, the
volumes of the cultivation scales may also be open for optimal choice.
Results: Tool strucbture: A seed train structure has been programmed in
Matlab®. The implemented model calculates cell growth, cell death, uptake
of substrates and production of metabolites. The tool is suitable for
different cell lines via entering corresponding model parameters, medium
and seed train information. Seed train optimization is possible regarding
cell passaging at optimal Space-Time-Yield (STY) or other optimization
criteria [1].
Application example for CHO cell line: Based on three cultivations, cell
line model parameters have been determined using the simplex algorithm
by Nelder and Mead. The whole seed train is modeled for cell passaging at
fixed time intervals (current method, reference) and cell passaging at
optimal points in time (optimized method). For this, the tool calculates
Space-Time-Yield-(STY)-courses for every scale and selects the optima.
As examples, Figure 1 shows an input mask of the seed train starting
conditions as well as the courses of STY and viability over time during
growth for flask scale 2:
Figure 1 indicates that the reference method passages the cells in T-flasks
and roller bottles when Space-Time-Yield (STY) is already decreasing and
viability dropping which is too late (beginning of stationary phase, not
presented).
The whole optimized seed train is calculated including optimal points in
time for cell passaging and optimal inoculation volumes and -densities in
reactor scales. Table 1 gives an example of an output screen.
In this example, time saving until inoculation of a 5,000 L production
bioreactor is 108 hours. When the averages of point in time of optimal
Space-Time-Yield (STY) and point in time of growth rate decreased to 90%
are taken, time saving is 114 hours. This method also offers a ‘safety’ time
span between cell passaging and beginning of stationary phase.
Conclusions: The tool improves seed train understanding and allows seed
train design and optimization. Time savings as well as increased viabilities
for passaging are possible. The tool has also been tested using a known
and manually optimized seed train. Without such time consuming lab
work, the tool has delivered the same optimized seed train only based on
data of two batches [2].
References
1. Frahm B: Seed train optimization for cell culture. Animal Cell
Biotechnology-Methods and Protocols Springer/Humana Press, in print:
Pörtner R, 3.
2. Kern S: Model-based design of the first steps of a seed train for cell
culture processes. BMC Proceedings 2013, 7(6):P11.
P9
Seed train optimization for suspension cell culture
Tanja Hernández Rodríguez1, Ralf Pörtner2, Björn Frahm3*
1
Department of Mathematics, Bielefeld University, Bielefeld, D-33615,
Germany; 2Institute of Bioprocess and Biosystems Engineering, Hamburg
University of Technology, Hamburg, D-21073, Germany; 3Biotechnology &
Bioprocess Engineering, Ostwestfalen-Lippe University of Applied Sciences,
Lemgo, D-32657, Germany
P10
In vitro safety assessment of nanosilver with improved cell culture
systems
Alina Martirosyan*, Madeleine Polet, Yves-Jacques Schneider
Laboratory of Cellular, Nutritional and Toxicological Biochemistry, Institute of
Life Sciences & UCLouvain, Croix du Sud, L7.07.03, Louvain-la-Neuve, B1348,
Belgium
Fields of application: Fields of application are the production of
biopharmaceuticals (antibodies, proteins for diagnostic and therapeutic
purposes) based on suspension cell culture and cultivation scales and
-systems of any kind.
Introduction: The purpose of a seed train is the generation of an
adequate number of cells for the inoculation of a production bioreactor.
Background: Silver nanoparticles (Ag-NPs) become increasingly
prevailing in consumer products as antibacterial agents [1] and their
potential threat on human health makes the risk assessment of utmost
importance. In order to elucidate the complex interactions of Ag-NPs
upon digestion in the gastrointestinal tract, an improved in vitro cell
culture system was used. The model contained, beside the enterocytes,
Page 24 of 151
Figure 1(abstract P9) One input mask of the seed train starting conditions as an example for the tool’s user interface and courses of SpaceTime-Yield (STY) and viability over time during growth for flask scale 2.
specialized microfold (M) cells, able to increase the absorption of micro- and
nanoparticles [2,3].
In the current study, different aspects of the toxicity of Ag-NPs on the cell of
intestinal epithelium were studied, i.e. cytotoxicity, inflammatory response
and barrier integrity of the epithelial monolayer.
Materials and methods: The cytotoxic effect of AgNPs < 20 nm (10-90
μg/ml, Mercator GmbH, DE) was assessed by MTT assay on Caco-2 cells
(clone 1, from Dr. M. Rescigno, University of Milano-Bicocca, IT). The
co-culture model was received by co-culturing Caco-2 cells with RajiB cells
(ATCC, Manassas, VA) in Transwell permeable supports (Corning Inc., NY)
[1,2]. The inflammatory mediators chemokine IL-8 and nitric oxide (NO)
levels were analysed in both apical (AP) and basolateral (BL) compartments
by ELISA (BD Biosciences Pharmingen, San Diego, CA) and by Nitrate/Nitrite
Colorimetric Assay Kit (Cayman Chemical Company, Ann Arbor, MI),
respectively, according to the manufacturer’s instructions.
The expression levels of the IL-8 and iNOS (inducible Nitric Oxide Synthase)
genes were evaluated by quantitative real-time PCR (qRT-PCR), where the
primers used were: for IL-8 CTGGCCGTGGCTCTCTTG (sense) and GGGT
GGAAAGGTTTGGAGTATG (antisense) and for iNOS - TGTGCCACCTC
CAGTCCAGT (sense) CTTATGGTGAAGTGTGTCTTGGAA (antisense). Levels of
individual transcripts were normalized to those of glyceraldehyde-3phosphate dehydrogenase (GAPDH). Relative quantification (RQ) values fold change of the target gene expression compared to the untreated
sample, were calculated by 2-ΔΔCt method [4].
The barrier integrity of the cell monolayers of mono- and co-cultures under
the influence of AgNPs was evaluated on 21 days fully differentiated
Page 25 of 151
Table 1(abstract P9) Output screen example displaying the whole seed train including inoculation of production bioreactor (reactor scale 4,
5,000 L).
cultures in bicameral inserts by measuring the transepithelial electrical
resistance and the passage of Lucifer Yellow.
The immunofluorescence staining of two tight junctions (TJs) proteins, i.e.
occludin and ZO-1 was realized by mouse anti-occludin/anti-ZO-1 as
primary and Alexa Fluor 488 goat anti-mouse as secondary antibodies
(Invitrogen). Images were collected by Zeiss LSM 710 confocal microscope.
Results: Ag-NPs displayed a dose-dependent cytotoxic effect on Caco-2 cells
starting from 30 μg/ml. The pro-inflammatory chemokine IL-8 levels were
reduced under the influence of Ag-NPs (Figure 1a) in AP compartments in
both mono- and co-cultures. In contrast, practically no changes in IL-8 levels
were observed in the BL compartments. The ELISA analysis data were
confirmed by qRT-PCR analysis, where the expression levels of the IL-8 gene
showed a tendency to decrease in both mono- (fold change ≈ 0.86) and
co-cultures (fold change ≈ 0.7) under the influence of Ag-NPs.
NO content was increased in both AP and BL compartments in both monoand co-cultures (Figure 1b), although more marked in the latter case. In BL
compartments, the NO levels increase was dependent on the Ag-NPs
concentration. In contrast to IL-8, there were practically no changes
observed in the iNOS gene expression levels in Caco-2 cells, indicating that
Ag-NP-induced NO generation increase is likely independent of the iNOS
gene expression.
Immunostaining with confocal microscopy analysis of two TJs proteins, i.e.
occludin and ZO-1, revealed that, in Ag-NP-treated cells, the continuity of
both occludin and ZO-1 was disrupted as compared to control and the
aggregation of both proteins was observed. The Ag-NP-induced dashed
and degraded distributions of occludin and ZO-1 suggest the opening of
TJs (not illustrated). The opening of junctions was further confirmed by
decreased TEER values and increased LY passage rates in Ag-NP-treated
samples. These effects were less obvious in co-cultures, a more accurate
model to reflect in vivo conditions, suggesting that the presence of
M-cells seemingly decreases the toxicity of AgNPs.
Conclusions: These results suggest that Ag-NPs: (i) are cytotoxic
for intestinal epithelial cells; (ii) possess anti-inflammatory properties; and
(iii) mediate the intestinal barrier function disruption. Differences in response
to Ag-NPs were observed in mono- and co-cultures, where the NPs affected
less obviously the IL-8 levels and barrier function in co-cultures, while, in
contrast, led to more marked increase of NO concentration in comparison
with mono-cultures. These differences demonstrate the advisability of
application of more complex in vitro models and further need of
improvement of the model by addition of e.g. mucus producing cells and/or
dendritic cells that would provide a tool to achieve even more reliable and
predictive correlations between in vitro studies and in vivo outcomes.
Acknowledgements: This work was supported by a mobility grant of the
Belgian Federal Science Policy Office (BELSPO) co-funded by the Marie
Curie Actions from the European Commission.
References
1. Des Rieux A, Ragnarsson EG, Gullberg E, Preat V, Schneider Y-J, Artursson P:
Transport of nanoparticles across an in vitro model of the human
intestinal follicle associated epithelium. Eur J of Pharm Sci 2005, 25:455-465.
2. Des Rieux A, Fievez V, Theate I, Mast J, Preat V, Schneider Y-J: An improved in
vitro model of human intestinal follicle-associated epithelium to study
nanoparticle transport by M cells. Eur J of Pharm Sci 2007, 30:380-391.
Figure 1(abstract P10) IL-8 (a) and NO (b) levels in mono- and co-cultures in AP and BL compartments upon exposure to Ag-NPs (45 μg/ml).
*samples significantly different from the corresponding control. Means of 3 independent experiments ± SD are given, P < 0.001.
3.
4.
Page 26 of 151
The Project on Emerging Nanotechnologies. [http://www.nanotechproject.
org].
Livak KJ, Schmittgen TD: Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
2001, 25:402-408.
P11
Model-based design of the first steps of a seed train for cell culture
processes
Simon Kern1,2, Oscar B Platas1, Martin Schaletzky1, Volker Sandig3,
Björn Frahm2, Ralf Pörtner1*
1
Institute of Bioprocess and Biosystems Engineering, Hamburg University of
Technology, Hamburg, D-21073, Germany; 2Biotechnology & Bioprocess
Engineering, Ostwestfalen-Lippe University of Applied Sciences, Lemgo, D-32657,
Germany; 3ProBioGen AG, Berlin, D-13086, Germany
Concept: Production of biopharmaceuticals for diagnostic and therapeutic
applications with suspension cells in bioreactors requires a seed train up to
production scale [1]. For the final process steps in pilot and production
scale the scale-up steps are usually defined (e.g. a factor of 5 - 10). More
difficult in this respect are the first steps, the transitions between T-flasks,
spinner tubes, roller bottles, shake flasks, stirred bioreactors or single-use
reactors, because here often scale-up steps are different. The experimental
effort to lay these steps out is correspondingly high. At the same time it is
known that the first cultivation steps have a significant impact on the
success or failure on production scale. The concept for a model based
design of the seed train consists of the following steps:
➢ A simple unstructured kinetic model, where kinetic parameters
can be obtained from a few experiments only.
➢ A Nelder-Mead-algorithm to determine model parameters.
➢ A MATLAB simulation based on this model to determine optimal
points in time or viable cell concentrations respectively for harvest of
seed train scales from spinner tubes over shake flasks up to a stirred
bioreactor based on an optimization criterion.
Verification: The concept was verified for a suspendable cell line (AGE1.
HN, ProBioGen AG) grown in serum-free 42-Max-UB medium (Teutocell
AG, Germany) containing 5 mM-Glutamine.
Two batch experiments were performed in shake flasks for determination
of kinetic parameters.
The average value of time for minimal and maximal Space-Time-Yield for
cells was used as optimization criterion for cell transfer.
The concept was tested successfully up to a 5 L scale for 6 scale-up steps
(Figure 1).
Conclusions: The concept offers a simple and inexpensive strategy for
design of the first scale-up steps. The results show that the tool was able
to perform a seed train optimization only on the basis of two batches, the
underlying model and its parameter identification. This quick optimization
led to the same results as the extensive manual optimization carried out in
the past.
Acknowledgements: The bioreactor (Labfors 5 Cell) was kindly provided
by the company Infors AG, the cell line AGE1.HN by ProBioGen AG.
Reference
1. Eibl R, Eibl D, Pörtner R, Catapano G, Czermak P: Cell and Tissue Reaction
Engineering. Springer 2008, ISBN 978-3-540-68175-5.
P12
Novel approaches to render stable producer cell lines viable for the
commercial manufacturing of rAAV-based gene therapy vectors
Verena V Emmerling1*, Karlheinz Holzmann3, Karin Lanz3, Stefan Kochanek2,
Markus Hörer1
1
Rentschler Biotechnologie GmbH, Erwin-Rentschler-Straße 21, 88471
Laupheim, Germany; 2Division of Gene Therapy, University of Ulm, Helmholtz
Str. 8/1, 89081 Ulm, Germany; 3Department of Internal Medicine III, University
Hospital of Ulm, Albert-Einstein-Allee 23, 89081 Ulm, Germany
Figure 1(abstract P11) Time course of simulated and experimentally
determined viable cell density and cell number during model based
seed from culture tube to lab-scale-bioreactor. 1: culture tube (0.01 L);
2: shake flask (0.035 L); 3: shake flask (0.13 L), 4: Vario 1000 (medorex, 0.35 L),
5: VSF 2000 (Bioengineering, 1 L); 6: Labfors 5 Cell (Infors, 2.5 L).
Background: Recombinant Adeno-associated virus (rAAV) based vectors
recently emerged as very promising candidates for viral gene therapy due
to a large toolbox available including twelve different AAV serotypes,
natural isolates, designer capsids and library technologies [2]. Furthermore,
rAAV vectors have favourable properties such as non-pathogenicity of
AAV, low B-/T-cell immunogenicity against transgenes delivered and longterm transgene expression from a non-integrating vector [5,9]. Promising
data from clinical trials using rAAV-based vectors for the treatment of e.g.
haemophilia or retinal diseases as well as the recent approval of the first
gene therapy drug in the European Union, Glybera® to treat lipoprotein
lipase deficiency, emphasise the potential of rAAV vectors for gene therapy
approaches in a wide variety of indications [8,7,15]. Thereby, the demand
for robust and cost-effective manufacturing of those vectors for market
supply rose steadily. Standard production systems comprise transient
transfection- and/or infection-based approaches using mammalian cells [3],
or insect cells [16]. However, high production costs combined with
considerable regulatory effort and safety concerns gave rise to the
development of producer cell lines enabling stable rAAV production [3].
AAVs are parvoviruses whose productive infection is depending on the
presence of helper viruses like e.g. adenovirus (AdV). Their singlestranded DNA genome carries two genes. The rep gene encodes proteins
responsible for site-specific integration, viral genome replication as well
as packging. The cap gene is translated into three structural proteins
building the capsid shelf. Furthermore, cap encodes a protein required
for capsid assembly (AAP or assembly-activating protein) that has been
described recently [13]. The AAV genes are flanked by inverted terminal
repeat (ITR) sequences constituting the replication, integration and
packaging signal. In a stable producer cell line with integral helper
functions, all required genetic elements are stably integrated into the
genome of the host cell as independent expression constructs: the
recombinant vector implying a transgene flanked by AAV ITRs, the AAV
genes rep and cap required for replication and encapsidation, as well as
adenoviral helper function delivered by sequences encoding genes E1a,
E1b, E2a, E4orf6 and viral associated (VA) I/II RNA [9]. In a timely regulated
fashion, viral proteins are expressed and the AAV genome is replicated
and encapsidated. As some of the gene products arising during rAAV
production are toxic, an inducible expression of the gene products is
indispensable for generation of stable production cells.
The aim of the underlying study is to provide all tools necessary to generate
a stable and versatile producer cell line In order to circumvent the problems
triggered by toxic proteins inevitably arising during rAAV formation, one
objective of the project is to establish stable producer cells where rAAV
production can be induced by temperature shift at the final production
scale. To begin with, we first performed some general feasability studies to
Page 27 of 151
Figure 1(abstract P12) (A) Transfection- and infection-based generation of rAAV in HeLa cells at different temperatures. Cells were transfected
by calcium phosphate using three plasmids encoding the rAAV vector, rep and cap, followed by AdV5 infection and subsequent incubation of the cells
at three different temperatures. Genomic rAAV titers were determined 96 h post infection as previously described [4]. (B) Investigation of rAAV production
in a “transfection only approach” applying plasmids encoding rep, cap, vector as well as adenoviral E1 and remaining AdV helper functions. Different
variants of rep and cap were compared regarding rAAV productivity. 1: Approach implying functionally separated rep and cap genes on different
plasmids, which are devoid of rep78 expression and lack an artificial Rep Binding Site (RBS) in the pUC19 plasmid backbones [6] (standard plasmids used
in all preceding experiments). 2: Same rep and cap plasmids but modified to avoid the expression of non-functional and truncated viral gene products by
deletion of various promoter and potential transcription start sites. Genome titre was analyzed 120 h post infection as previously described [4].
investigate whether the generation of stable and inducible producer cell
lines using proprietary constructs is a viable approach. For this purpose,
experiments for rAAV manufacturing based on a transient packaging
approach were conducted. Infection of rep, cap and rAAV vector
plasmid transfected cells with wildtype Adenovirus was compared with
co-tranfection of the cells with additional plasmids carrying the Adenoviral
helper genes. The influence of different cultivation temperatures on
Adenovirus replication kinetics and rAAV productivity in the transient
packaging approaches were analyzed. Furthermore, we investigated
differential gene expression in response to temperature downshifts.
Results: In the first experiments, a transfection-/infection-based approach
was chosen to produce rAAV. For this, HeLa cells were co-transfected with
three plasmids encoding the AAV vector on one side and the rep and cap
genes delivered on two separate constructs on the other side (trans-split
packaging system, [6]). Subsequently, cells were infected with a helper virus.
Cultivation of cells at 32 °C post infection resulted in significantly increased
rAAV titres compared to 37 °C (Figure 1A). This could arise from an arrest of
cells in G2/M phase, causing enhanced growth but decreased proliferation.
Hence, cells exhibit enlarged size and elevated protein production, possibly
supported by avoided degradation of rDNA as previously described for CHO
cells [14]. Repressed adenoviral replication kinetics may trigger prolonged
cellular viability and, thereby, further increase rAAV titres. In fact these
results also suggest that high copy numbers of helper genes are not
essential for efficient rAAV packaging being an important prerequisite for
the generation of efficient producer cells by stable integration of only few
copies of the Adenoviral helper genes. Importantly, rAAV production was
also possible replacing the adenovirus infection step by co-transfection of
rep-, cap- and rAAV vector transfected HeLa cells with two more plasmids
coding for all known adenoviral helper genes. Considering that in such an
approach cells have to be co-transfected by five different plasmids at the
same time in order to produce rAAV, the yiels obtained in this “transfection
only approach” were quite promising. Overall rAAV yields generated with
the rep/cap trans-split packaging system [6] could be further increased by
modifications of the rep and cap coding sequences in terms of avoidance of
production of non-functional byproducts (Figure 1B).
Differential gene expression analysis of HeLa cells cultivated at different
temperatures gave rise to the identification of three genes up-regulated
up to 7-fold and 16 miRNAs likely regulated more than 2-fold at lowered
temperature (Table 1). Underlying genetic switches are subject to further
investigations. Appropriate temperature-inducible switches will be used to
control expression of the adenoviral helper gene E1a, the key inducer of
the whole cascade required for rAAV production. Applied in stable
producer cells, such a system would allow for timely-regulated induction
of rAAV production. Making use of a temperature shift as primary switch
for rAAV production, we would combine the inevitable induction event
with conditions presumably enhancing rAAV production.
Conclusions: Taken together, these first data provide the basis for a
successful generation of temperature inducible stable producer cells
Table 1(abstract P12) Analysis of differential gene expression in HeLa triggered by different cultivation temperatures
Name
Differential expression at
Mode of regulation
Microarray analysis
RT qPCR
Gene A
Gene B
30°C
30°C
Up
Up
3.2-fold
2.2-fold
6.9-fold
2.6-fold
Gene C
30°C
Up
3.3-fold
2.3-fold
miRNA A
32°C
Up
3.1-fold
-
miRNA B
32°C
Down
3.3-fold
-
miRNA C
32°C
Up
3.0-fold
-
Cells were seeded at two different densities and cultivated at 37°C for two days. Subsequently, cells were incubated for another 6 hours at 30, 32, and 37°C,
respectively, before mRNA was isolated from the cells. Microarray analysis (GeneChip® Human Exon 1.0 ST Array, Affymetrics) was performed to identify mRNAs
differentially expressed more than 2-fold. Validation was done by RT qPCR analysis (EvaGreen® Mastermix, Biorad) and included controls of regulated and nonregulated mRNAs [12,11,1]. Differentially expressed miRNAs (>2-fold) were also identified by microarray analysis (GeneChip® miRNA 2.0 Array, Affymetrics). As
validation is not yet completed, only an excerpt of the most promising miRNA candidates is shown.
carrying all genetic elements required for rAAV production. A versatile
and high-titre rAAV production platform based on such cells will be
applicable for industrial-scale manufacturing and thus has the potential to
open AAV-based gene therapy to a high number of patients.
References
1. Ars E, Serra E, de la Luna S, Estivill X, Lázaro C: Cold shock induces the
insertion of a cryptic exon in the neurofibromatosis type 1 (NF1) mRNA.
Nucl Acids Res 2000, 28(6):1307-1312.
2. Asokan A, Schaffer D, Samulski JR: The AAV Vector Toolkit: Poised at the
Clinical Crossroads. Mol Ther 2012, 20(4):699-708.
3. Aucoin MG, Perrier M, Kamen AA: Critical assessment of current adenoassociated viral vector production and quantification methods.
Biotechnol Adv 2008, 26(1):73-88.
4. Aurnhammer C, Haase M, Muether N, Hausl M, Rauschhuber C, Huber I,
Nitschko H, Busch U, Sing A, Ehrhardt A, Baiker A: Universal real-time PCR
for the detection and quantification of adeno-associated virus serotype
2-derived inverted terminal repeats. Hum Gene Ther Methods 2012,
23(1):18-28.
5. Ayuso E, Mingozzi F, Bosch F: Production, purification and
characterization of adeno-associated vectors. Curr Gene Ther 2012,
10(6):423-436.
6. Bertran J, Moebius U, Hörer M, Rehberger B: Host cells for packaging a
recombinant adeno-associated virus (RAAV), method for the production
and use thereof. World Intellectual Property Organization 2002, WO 02/
20748 A2.
7. Hauswirth WW, Aleman TS, Kaushal S, Cideciyan AV, Schwartz SB, Wang L,
Conlon TJ, Boye SL, Flotte TR, Byrne BJ, Jacobson SG: Treatment of leber
congenital amaurosis due to RPE65 mutations by ocular subretinal
injection of adeno-associated virus gene vector: short-term results of a
phase I trial. Hum Gene Ther 2008, 19:979-990.
8. Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR, Tai SJ,
Ragni MV, Thompson A, Ozelo M, Couto LB, Leonard DG, Johnson FA,
McClelland A, Scallan C, Skarsgard E, Flake AW, Kay MA, High KA, Glader B:
AAV-mediated factor IX gene transfer to skeletal muscle in patients with
severe hemophilia B. Blood 2003, 101(8):2963-2972.
9. Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The
adenovirus E1A and E1B19K genes provide a helper function for
transfection-based adeno-associated virus vector production. J Gen Virol
2004, 85(8):2209-2214.
10. Mingozzi F, High KA: Therapeutic in vivo gene transfer for genetic
disease using AAV: progress and challenges. Nat Rev Genet 2011,
12(5):341-355.
11. Nishiyama H, Higashitsuji H, Yokoi H, Itoh K, Danno S, Matsuda T, Fujita J:
Cloning and characterization of human CIRP (cold-inducible RNAbinding
protein) cDNA and chromosomal assignment of the gene. Gene 1997,
204:115-120.
12. Sonna LA, Fujita J, Gaffin SL, Lilly CM: Molecular biology of
thermoregulation invited review: Effects of heat and cold stress on
mammalian gene expression. J Appl Physiol 2002, 92:1725-1742.
13. Sonntag F, Schmidt K, Kleinschmidt JA: A viral assembly factor promotes
AAV2 capsid formation in the nucleolus. Proc Natl Acad Sci USA 2010,
107(22):10220-10225.
14. Tait AS, Brown CJ, Galbraith DJ, Hines MJ, Hoare M, Birch JR, James DC:
Transient production of recombinant proteins by chinese hamster ovary
cells using polyethyleneimine/DNA complexes in combination with
microtubule disrupting anti-mitotic agents. Biotechnol Bioeng 2004,
88(6):707-721.
15. UniQure BV:[http://www.uniqure.com/news/167/189/uniQure-s-Glybera-FirstGene-Therapy-Approved-by-European-Commission.html].
16. Urabe M, Ding C, Kotin RM: Insect cells as a factory to produce adenoassociated virus type 2 vectors. Hum Gen Ther 2002, 13:1935-1943.
P13
Benchmarking of commercially available CHO cell culture media for
antibody production
David Reinhart1*, Christian Kaisermayer2, Lukas Damjanovic1, Renate Kunert1
1
Dept. of Biotechnology, University of Natural Resources and Life Sciences,
Muthgasse 11, 1190 Vienna, Austria; 2GE Healthcare Life Sciences AB,
Björkgatan 30, 75184 Uppsala, Sweden
Page 28 of 151
Introduction: Chinese hamster ovary (CHO) cells have become the
preferred expression system for the production of complex recombinant
proteins. Several suppliers offer CHO specific cell cultivation media and
sometimes also media systems, which combine feeds and basal medium.
We compared eight commercially available CHO cell culture media and feed
supplements from three different vendors to evaluate their influence on cell
growth and antibody production of a CHO cell line. In conclusion, ActiCHO™
Media System, with a matching base media and feeds, resulted in the
highest cell growth and the highest productivity. Further nutrient additions
did not have a profound effect on the process performance.
Materials and methods: Cultivation media:
ActiCHO P (GE Healthcare)
CD CHO (Life Technologies)
CD OptiCHO™ (Life Technologies)
CD FortiCHO™ (Life Technologies)
Ex-Cell™ CD CHO (Sigma Aldrich)
ProCHO 5 (Lonza)
BalanCD™ CHO Growth A (Irvine Scientific)
Cellvento™ CHO-100 (EMD Millipore)
• Anti-Clumping Agent (Life Technologies)
• CHO DG44 cells expressing an IgG antibody
• Cultivation conditions: 37°C, 7% CO2, 140 rpm
• Batch and fed-batch cultivations were run in Erlenmeyer shake flasks
(Corning, NY). The cultures were grown in a CO 2 incubator shaker
(Kühner, Switzerland)
• Batch cultures were run as single experiments, the method
variability was determined by a triplicate reference experiment in
ActiCHO P.
• During fed-batch processes the cultures were fed with the
corresponding feeds ActiCHO Feed A and Feed B (GE Healthcare),
BalanCD™ CHO Feed 1 (Irvine Scientific) or EfficientFeed™ A and/or
FunctionMAX™ (both Life Technologies) according to the manufacturers
inctructions [1]. The respective feeding regimens are shown in Table 1.
• Fed-batch cultures were run in triplicates. The residual glucose
concentration was maintained above 3 g/L by addition of glucose
concentrate
• Analytics: cell concentration, viability, selected metabolites, product
concentration, amino acid concentrations
Results and discussion: In batch cultures the highest cell concentrations
were obtained in ActiCHO P and BalanCD as shown in Figure 1. In ActiCHO P
the cells initially grew with a slightly higher specific growth rate (data not
shown) and therefore the maximum cell concentration was reached 3 days
earlier than in BalanCD. In ProCHO 5, Cellvento CHO-100 and CD OptiCHO,
cell concentrations of 4 × 106 to 5 × 106 cells/mL were reached. Although
initially the growth was similar in all three media, the culture in ProCHO
5 was terminated on day 7 due to a viability below 60%. In the other two
media the batch lasted for four days longer. In Ex-Cell CD CHO cells grew to
2.6 × 106 cells/mL which was about 30% of the cell concentration reached in
ActiCHO P. Finally in CD CHO and CD FortiCHO cells formed small
aggregates and rather low concentrations of 2.5 × 106 and 6.0 × 105 cells/
mL were obtained, respectively. Cell adaptation in CD FortiCHO during seven
passages and addition of Anti-Clumping Agent (1:250) did not resolve the
aggregation problem or improve cell growth (data not shown). The antibody
production in the different cultures followed the same ranking as the cell
growth (Figure 1). The highest titers were achieved in ActiCHO P and
BalanCD CHO. In CD OptiCHO, Ex-Cell CD CHO and Cellvento CHO-100
product concentrations of about 500 mg/L were reached. The lowest titers
were generated in ProCHO 5 and CD CHO with 380 mg/L and 330 mg/L,
respectively. Fed-batch cultivations were then run in selected basal media
with the respective feeds according to table 1. Again there was a strong
correlation between cell concentration and antibody production. The highest
cell and product concentrations were obtained in ActiCHO P (Table 1).
Compared with the previous batch cultures, the cell concentrations were
more than doubled and due to the extended process duration the titer
was increased more than 6 fold, as shown in table 1. Feeding cultures in
ActiCHO P with Feed A and B alone or additionally with FunctionMAX,
altered the process only marginally. Supplementing the fed-batch only
with ActiCHO Feeds A&B resulted in slightly higher cell concentrations and
the process duration was reduced by 2 days (data not shown). A fed-batch
culture in BalanCD medium and Feed 1 reached only 80% of the cell
concentration achieved during the previous batch culture, however,
Page 29 of 151
Table 1(abstract P13) Feeding regimens in fed-batch cultures
Basal medium
ActiCHO Feed A
ActiCHO Feed B
EfficientFeed A
FunctionMAX Feed 1
Peak cell conc.
[106 c/ml]
Harvest Titer
[g/L]
ActiCHO P
daily; 3%
daily; 0.3%
-
-
23.9
5.48
ActiCHO P
daily; 3%
daily; 0.3%
-
3, 5, 7; 3.3%
21.3
5.82
CD OptiCHO
-
-
3, 5, 7, 9; 10%
-
5.8
0.72
CD OptiCHO
-
-
3, 5, 7; 10%
-
5.2
0.80
CD OptiCHO
-
-
3, 5, 7; 10%
3, 5, 7; 3.3%
6.3
1.74
CD OptiCHO
daily; 3%
daily; 0.3%
-
-
9.0
1.46
BalanCD CHO
-
-
-
-
7.1
1.30
1, 3, 5; 10%
The time [d] for feed addition and the feed volume in % of the culture volume are indicated. Feed start for the culture in BalanCD CHO was day 1, all other
cultures were fed from day 3 on. Values for peak cell concentration and harvest titer are mean values of triplicate experiments.
feeding extended the process by five days and increased the antibody
concentration by 60% compared with the previous batch culture to a final
titer of 1.3 g/L (Table 1). Fed-batch cultures in CD OptiCHO achieved about
40% of the cell concentrations in ActiCHO P. Similar cell concentrations
were reached when feeding cultures in CD OptiCHO with ActiCHO feeds
A and B or EfficientFeed A, independent if the feed was added during 7 or
9 days or if additional feeding with FunctionMAX was performed (Table 1).
However, the feeding had an impact on the product concentration.
The lowest one was obtained when feeding cultures in CD OptiCHO with
EfficientFeed A only. Further supplementation with FunctionMAX or
feeding with ActiCHO Feed A&B substantially increased the product
concentration (Table 1).
Conclusions: • Batch cultivation in the different media resulted in peak
cell concentrations from 2.5 × 10 6 to 9.0 × 10 6 cells/mL and a
corresponding antibody titer from 220 to 860 mg/L. ActiCHO P and
BalanCD CHO performed best in these cultures.
Figure 1(abstract P13) Cell concentrations (upper panel) and product concentrations (lower panel) obtained in batch experiments with
different commercially available CHO cell culture media. Titers in CD FortiCHO were not determined due to low cell concentrations. Error bars are
one standard deviation.
Page 30 of 151
• Fed-batch cultivations substantially improved cell and product
concentration. Feeding cultures in CD OptiCHO with EfficientFeed A
and FunctionMAX or with Feed A and Feed B resulted in similar
antibody concentrations and roughly doubled the antibody
production compared to feeding with EfficientFeed A only.
• The highest titer was achieved in ActiCHO P in combination with Feed
A and Feed B. In this medium a 6.3-fold improvement, compared with
the previous batch cultivation, was observed. Further addition of
FunctionMAX to these cultures did not significantly improve the
antibody production.
Reference
1. Barrett S, Boniface R, Dhulipala P, Slade P, Tennico Y, Stramaglia M, Lio P,
Gorfien S: Attaining Next-Level Titers in CHO Fed-Batch Cultures.
BioProcess International 2012, 10:56-62.
P14
Advanced off-gas measurement using proton transfer reaction mass
spectrometry to predict cell culture parameters
Timo Schmidberger1,2*, Robert Huber2
1
Department of biotechnology, University of Natural Resources and Life
Sciences, 1180 Vienna, Austria; 2Sandoz GmbH BU Biopharmaceuticals, 6336
Langkampfen, Austria
Background: Mass spectrometry is a well-known technology to detect O2
and CO2 in the off-gas of cell culture fermentations. In contrast to classical
mass spectrometers, the proton transfer reaction mass spectrometer (PTR
MS) enables the noninvasive analysis of a broad spectrum of volatile
organic compounds (VOCs) in real time. The thereby applied soft
ionization technology generates spectra of less fragmentation and
facilitates their interpretation. This gave us the possibility to identify
process relevant compounds in the bioreactor off-gas stream in addition to
O2 and CO2. In our study the PTR-MS technology was applied for the first
time to monitor volatile organic compounds (VOC) and to predict cell
culture parameters in an industrial mammalian cell culture process.
Materials and methods: The aptitude of PTR MS for advanced bioprocess
monitoring was assessed by Chinese hamster ovary (CHO) cell culture
processes producing a recombinant protein conducted in a modified 7L
glass bioreactor (Applikon, Shiedam, Netherlands). The PTR MS-hs (Ionicon,
Innsbruck, Austria) was equipped with a QMS422 quadrupole for mass
separation and with a secondary electron multiplier detector to measure
masses ranging from 18 to 200 m/z. The equipment set-up is illustrated in
Figure 1. On a daily basis the glutamine concentration was determined
with the BioProfile 100 plus (Nova Biomedical, Waltham, MA) and the
viable cell density (VCD) was measured with the Vi-Cell XR cell counter
(Beckham Coulter, Fullerton, CA). Samples for the product quantification
were pulled daily and analyzed once at the end of a fermentation using
affinity liquid chromatography. The PTR-MS data was first filtered with an
adaptive online repeated median filter [1] and then correlated to the cell
culture parameters with partial least square regression (PLS-R) using the
software SIMCA P12+ (Umetrics, Umea, Sweden).
Results: The applicability of the PTR-MS technique was studied using eight
different fermentations conducted during process optimization to determine
key cell culture parameters such as viable cell density, product titer and
glutamine by partial least square regression models. Probably the most
important parameter in industrial cell culture processes is the viable cell
density. The R² of the PLS-R model for the VCD was 0.86 and hence, lower
compared to other methods found in literature (such as 2D fluorescence
[2]). Especially low values, which were observed only in the first few days of
the fermentation, showed a high prediction error. At the beginning of the
fermentation the VOC composition in the off-gas is characterized by VOCs
from the media preparation (probably impurities of the raw materials used)
and only a few VOC can be assigned to the cells. The media was prepared
up to one week before the fermentations started and, depending on the
storage time, the initial VOC content varied. Within the first days the media
assigned VOCs were washed out and the cells started to produce VOCs.
Accordingly the effect of the initial condition was weaker and prediction got
better. In a second PLS-R model the product concentration was estimated
based on the PTR-MS data. The model was better compared to the
estimation of the VCD what is reflected in a R² of 0.94. The effect of the early
Figure 1(abstract P14) Experimental set-up to monitor VOCs in
mammalian cell culture.
process phase on the prediction quality is not very distinct since almost no
product was produced in the first days. The good model for the titer is a hint
that producing the product is correlated with metabolic pathways involving
VOCs. However distinct metabolic pathways could not be revealed within
this study, since only a few VOC could be assigned to specific compounds
yet. The third parameter assessed in this study was the glutamine
concentration. The PLS-R model for glutamine concentration showed the
lowest R² and Q² of this evaluation. Glutamine was added on demand and
probably feeding corrupted the correlation. To overcome this problem, the
glutamine related physiological parameter specific glutamine uptake (qGln)
was used. The descriptive as well as the predictive power was higher when
the specific consumption instead of the glutamine concentration was used
(0.91 and 0.82). An explanation for this result is that the consumption of
glutamine might be correlated to other metabolic pathways which can
produce VOCs. In combination with an accurate online VCD measurement,
the qGln can be used to estimate the overall glutamine demand of the
culture in real-time. A summary of all PLS-R models is given in Table 1.
Conclusions: In our study we showed that the VOC profile obtained with
the PTR-MS can be used to predict important cell culture parameters, but
compared to other on-line techniques such as near infrared spectroscopy
the PLS-R models are currently less robust (expressed by a lower R²).
Moreover the most important VOCs in the PLS-R model could be used to
get deeper insights into the cellular metabolism. At the moment however,
this is limited by the lack of identified VOCs and the small literature basis
reporting of pathways including volatile metabolites. Finally, further
experiments will be necessary to assess the most influential factors on the
VOC production and to fully exploit the potential of the PTR-MS.
Table 1(abstract P14) Summary PLS-R models
Compound
R²
Q²
VCD
0.86
0.76
Product titer
0.94
0.88
Glutamine
0.83
0.62
Specific glutamine uptake
0.91
0.82
Acknowledgements: We want to thank Rene Gutmann from Ionicon for
the installation and support for the PTR-MS and Karl Bayer for the fruitful
discussions.
References
1. Schettlinger K, Fried R, Gather U: Real-time signal processing by adaptive
repeated median filters. Int J Adapt Control 2009, 24:346-362.
2. Teixeira AP, Portugal CA, Carinhas N, Dias JM, Crespo JP, Alves PM,
Carrondo MJ, Oliveira R: In situ 2D fluorometry and chemometric
monitoring of mammalian cell cultures. Biotechnol Bioeng 2009,
102:1098-1106.
P15
New peptide-based and animal-free coatings for animal cell culture in
bioreactors
Youlia Serikova1*, Aurélie Joly1, Géraldine Nollevaux1, Martin Bousmanne2,
Wafa Moussa2, Jonathan Goffinet3, Jean-Christophe Drugmand3,
Laurent Jeannin2, Yves-Jacques Schneider1
1
Laboratory of Cellular, Nutritional and Toxicological Biochemistry, Institute of
Life Sciences, UCLouvain, 1348 Louvain-la-Neuve, Belgium; 2Peptisyntha sa,
1120 Brussels, Belgium; 3ATMI, 1120 Brussels, Belgium
Background: Anchorage dependent cells require an appropriate
extracellular matrix for their survival, migration, proliferation, phenotyping
and/or differentiation [1-3]. These cells interact with extracellular matrix
proteins, primarily through integrins, which induces focal adhesion
contacts assembly and activation of signalling pathways that regulate
diverse cellular processes [4].
Culture supports usually include biochemical components allowing such
cells to adhere and to reconstitute an extracellular environment close to
that found in vivo. Currently, this artificial environment is achieved by
extracellular matrix constituents deposition, adsorption or grafting; among
them collagens, fibronectin, laminin, artificial lamina propria... [5]. However,
such animal proteins used in cell culture may induce pro-inflammatory
stress, be unstable against proteolysis or loose activity after adsorption
[6,7]. Synthetic microenvironments should be more suitable for clinical
purposes: (i) improved control of physicochemical and mechanical
properties, (ii) limited risks of immunogenicity, (iii) increased biosafety
(animal free) and (iv) facilitated scale-up [1].
In this framework, research has recently focused on synthetic peptides or
peptidomimetics that can mimic the extracellular matrix. Such molecules
can be immobilized as recognition motifs on the surface of culture
supports with a greater stability and easier surfaces characterization [5].
Self-assembling peptide hydrogels could mimic the chemical and
mechanical aspects of the natural extracellular matrix [8,9] by undergoing
large deformations, as in mammalian tissues. They have an inherent
biocompatibility and should be able to direct cell behaviour [10]. They also
can be functionalized with various biologically active ligands constituting
good candidates to a new range of smart biomaterials, able to ensure
adhesion of different cell types [11-13].
The range of biomimetic peptides that direct cell adhesion and are
recognized by integrins is large. Recognition sequences derived from
different extracellular matrix proteins include RGD [1], which are specific to
different cell lines [1,5,6].
In this context, this work aims at designing animal-free, chemically defined
and industrially scalable coatings for animal cell culture, as an alternative
to collagen, fibronectin or Matrigel® for laboratory and industrial large
scale applications. These are based on self-assembling short peptides
bearing adhesion bioactive sequences like RGD-derived or other adhesion
sequences developed to coat polystyrene or polyethylene terephthalate
surfaces. Adhesion sequences should be recognized by cells, which should
favour their anchorage and spreading.
Experimental: Bioactive self-assembling peptide sequences were
synthesized in liquid phase, purified, analytically characterised and
manufactured by Peptisyntha (Brussels, Be) in GMP conditions, as sterile
coating solutions. They were used to coat polystyrene flasks (Corning Inc.,
NY) in comparison with animal-derived coatings i.e. collagen and fibronectin.
Human Adipose Derived Stem Cells (hADSC) were purchased from Lonza
(Verviers, Be); Caco-2, MRC-5 and CHO cells, obtained from ATCC.
Cells were seeded at 8 000 cells/cm2 and cultured until 7 days. After 60 h
Page 31 of 151
or 7 days of culture, cells were harvested and counted on Bürker cell in
Trypan blue or fixed. Nuclei were then stained with DAPI and actin
filaments with Rhodamin-Phalloidin. Fluorescence microscopy was used
to observe cell morphology and NIS software allowed cell-spreading
determination.
Results and discussion: The absence of cytotoxicity was assayed with
necrosis (LDH) and cell metabolic activity (MTT) tests on different cell
lines (Caco-2, MRC-5, CHO, hADSC). No cytotoxicity was detected.
Two variants of bioactive self-assembling peptides, both containing RGDderived sequences, were compared with animal-derived coatings (collagen
and fibronectin) in serum-poor of free medium. Cytocompatibility and
dose dependent response studies revealed that peptides promote cell
adhesion and growth.
As for hADSC culture, these cells were first incubated in a serum-free
medium during 6 to 24 h and the proportion of adherent cells and their
spreading was evaluated. hADSC cells needed more than 6 h to fully
adhere to the culture surface and the adhesion effectiveness appeared
better for collagen and the first variant of peptide than for the other
substrate coatings. Initial spreading was more marked on fibronectin, but
then increased from 6 to 24 hours on all coatings.
A second experiment consisted in a first cell incubation in DMEM
supplemented with 1% Fetal Bovine Serum (FBS) and, after 24 h, the
medium was replaced by DMEM supplemented with 10% FBS. After 7 days,
the best cell growth was observed for substrates coated with collagen and
peptide 1, fibronectin and peptide 2 being slightly less efficient. In parallel,
cell spreading decreased or remained constant upon cell proliferation
(Figure 1).
As for Caco-2 cells culture, these cells were incubated in a serum-free,
hormono-defined medium (BDM) during 6 to 24 h and the proportion of
adherent cells and their spreading were evaluated. These cells required a
shorter duration than hADSC to adhere on the surface and the adhesion
effectiveness appeared a little bit better for collagen and fibronectin.
Initial spreading was more marked on collagen and its importance varies
between 6 and 24 h on different coatings.
The second experiment consisted in a first cell incubation in a serum-free
medium and, after 24 h, the nutritive medium was replaced by a medium
supplemented with 1% FBS. After 60 h, there was almost no difference
between the different coatings. Nevertheless, after 7 days, cells cultured
on peptides reached the same effectiveness as on fibronectin, but slightly
lower than collagen. As for hADSC, cell spreading decreased upon cells
proliferation.
Conclusion: Designed self-assembling bioactive peptides are not cytotoxic
and are cytocompatible. Cell adhesion and growth on peptide coatings
appear as effective as on animal-derived coatings and the peptide
coatings allow easy cell harvesting after culture.
Globally, the results indicate that self-assembling bioactive peptides
constitute chemically defined, entirely synthetic and effective promoters of
cell adhesion, spreading and proliferation.
Acknowledgements: This work is supported by Innoviris (Brussels
Region) in the scope of a Doctiris PhD grant.
References
1. Petrie TA, Garcia AJ: Extracellular Matrix-derived Ligand for Selective
Integrin Binding to Control Cell Function. Biol Interact Mater Surf 2009,
1:133-156.
2. Hynes RO: The Extracellular Matrix: Not Just Pretty Fibrils. Sci 2009,
326:1216-1219.
3. Rahmany MB, Van Dyke M: Biomimetic approaches to modulate cellular
adhesion in biomaterials: A review. Acta Biomater 2013, 9:5431-5437.
4. Badami AS, Kreke MR, Thompson MS, Riffle JS, Goldstein AS: Effect of fiber
diameter on spreading, proliferation, and differentiation of osteoblastic
cells on electrospun poly(lactic acid) substrates. Biomater 2006,
27:596-606.
5. Shin H, Jo S, Mikos AG: Biomimetic materials for tissue engineering.
Biomater 2003, 24:4353-4364.
6. Hersel U, Dahmen C, Kessler H: RGD modified polymers: biomaterials for
stimulated cell adhesion and beyond. Biomater 2003, 24:4385-4415.
7. Lin CC, Metters AT: Hydrogels in controlled release formulations: Network
design and mathematical modeling. Adv Drug Deliv Rev 2006, 58:1379-1408.
8. Wu EC, Zhang S, Hauser CAE: Self-Assembling Peptides as Cell-Interactive
Scaffolds. Adv Funct Mater 2012, 22:456-468.
9. Hamilton SK, Lu H, Temenoff JS: Micropatterned Hydrogels for Stem Cell
Culture. Stud Mechanobiol Tissue Eng Biomater 2010, 2:119-152.
Page 32 of 151
Figure 1(abstract P15) Fluorescence micrographies of hADSC cultivated for 7 days on polystyrene substrates. After incubation and cell fixation,
nuclei were stained with DAPI and actin filaments with rhodamin-phalloidin. Pictures were taken at the centre of each flask. Upper left: collagen coating;
upper right: fibronectin. Lower left: peptide 1; lower right: peptide 2.
10. Jayawarna V, Ali M, Jowitt TA, Miller AF, Saiani A, Gough JE, Ulijn RV:
Nanostructured Hydrogels for Three-Dimensional Cell Culture Through
Self-Assembly of Fluorenylmethoxycarbonyl-Dipeptides. Adv Mater 2006,
8:611-614.
11. Bhat NV, Upadhyay DJ: Plasma-induced surface modification and
adhesion enhancement of polypropylene surface. J Appl Polym Sci 2002,
86:925-936.
12. Varghese S, Elisseeff JH: Hydrogels for Musculoskeletal Tissue Engineering.
Adv Polym Sci 2006, 203:95-144.
13. Tessmar JK, Göpferich AM: Customized PEG-Derived Copolymers for
Tissue-Engineering Applications. Macromol Biosci 2007, 7:23-39.
P16
An integrated synchronization approach for studying cell-cycle
dependent processes of mammalian cells under physiological
conditions
Oscar B Platas1, Uwe Jandt1, Volker Sandig2, Ralf Pörtner1, An-Ping Zeng1*
1
Technology, Hamburg, D-21073, Germany; 2ProBioGen AG, Berlin, D-13086,
Germany
Introduction: The study of central metabolism and the interactions of its
dynamics with growth, product formation and cell division is a key issue
for decoding the complex metabolic network of eukaryotic cells. For this
purpose, not only the quantitative determination of key cellular molecules
is necessary, but also the variation of their expression rates in time, e.g.
during cell cycle. The enrichment of cells within a specific cell cycle phase,
referred to as cell synchronization, and their further cultivation allow for
the generation of a cell population with characteristics required for cell
cycle related dynamic studies. Unfortunately, most of the synchronization
methods used are not suitable for study under unperturbed physiological
conditions.
Physical selective methods appear to be a better choice. Among them, the
method of countercurrent centrifugal elutriation allows for an efficient
separation of different cell subpopulations from an asynchronous cell
population according to the cell size. Within an elutriated cell subpopulation
high similarity in the size and DNA content of the cells can be achieved.
Given the reproducibility of this method, high cell numbers can be obtained
for inoculation of controlled bench-top bioreactors with synchronous cells.
By integration of this method for synchronous cell generation and a culture
method for further unperturbed growth, sampling of synchronous cells can
be performed over many synchronous population doublings.
Materials and methods: Using the combined approach mentioned
above, centrifugal elutriation was employed for synchronization in
different cell cycle phases of the industrial human cell line AGE1.HN®
(ProBioGen AG, Berlin, Germany) and a CHO-K1 cell line (CeBiTec, Bielefeld,
Germany). Cells were cultivated in bench-top bioreactors with culture
volumes ranging between 200 mL and 1 L. A dialysis bioreactor
(Bioengineering AG, Switzerland) with a total volume of 3.8 L was used for
the cultivation of one cell line in order to allow for a higher number of
synchronous cell divisions. In this bioreactor cells are separated from the
conditioning chamber, where pH and DO control takes place. In this way
cells can’t be damaged neither by increase in stirring rate nor by bubble
sparging. Furthermore, continuous nutrient exchange takes place through
the dialysis membrane. Cell density values of 4.2 × 10 7 cells mL-1 have
been reached in this system with AGE1.HN® cells without noticeable
change in the cell specific growth rate.
Results: Our first results had already demonstrated the successful
separation of a heterogeneous AGE1.HN® cell population into synchronous
subpopulations [1]. Independently of the targeted cell cycle phase, the
countercurrent centrifugal elutriation allowed for a reproducible and
scalable cell synchronization of AGE1.HN and CHO-K1 cells with high
synchrony degrees, up to 95% in G1, 53% in S and 75% in the G2/M phases.
After assessing the reproducibility of elutriation results, the process was
scaled up successfully for inoculation of a dialysis bioreactor, where
synchronous unperturbed growth was observed at least for 4 cell
divisions (Figure 1). A very clear damped oscillation of the cell cycle
Page 33 of 151
phases could be observed during synchronous growth (Figure 1b and 1c).
Moreover, a sawtooth-like oscillation of the cell diameters confirmed the
successful synchronous growth of the cells. Bioreactor culture showed no
noticeable perturbation in the doubling time of the population.
Conclusions: With these results, one of the most important requirements
for population-based research of mammalian cells was fulfilled. The
dynamic behaviour of the synchronous growing cells was systematically
studied not only based on cell growth, but also on the distribution of the
cell size and the DNA content of the cells. Furthermore, dialysis culture
allowed for a higher number of synchronous cell divisions without
noticeable perturbations. With this contribution, we present an integrated
approach for cell synchronization and further unperturbed cultivation
which is useful for studying cell-cycle dependent processes under
physiological conditions.
Acknowledgements: This work is a part of SysLogics (FKZ 0315275A):
Systems biology of cell culture for biologics, a project founded by the
German Ministry for Education and Research (BMBF).
Reference
1. Platas Barradas O, Jandt U, Hass R, Kasper C, Sandig V, Pörtner R, Zeng AP:
Physical methods for synchronization of a human production cell line.
22nd European Society for Animal Cell Technology (ESACT) Meeting on
Cell Based Technologies, Vienna, Austria.5(Supplement 8), Online:
http://www.biomedcentral.com/1753-6561/5/S8/P49.
Figure 1(abstract P16) Synchronous growth of AGE1.HN cells in a dialysis bioreactor. The cultured cells were elutriated with high synchrony in the
G2/M phase. (a): viable cell density and viability, (b): percentage values of the cell cycle phase distribution, (c): distribution of the S phase, exhibiting a
damped oscillation.
P17
Evaluation of process parameters in shake flasks for mammalian cell
culture
Oscar B Platas1, Volker Sandig2, Ralf Pörtner1, An-Ping Zeng1*
1
Technology, Hamburg, D-21073, Germany; 2ProBioGen AG, Berlin, D-13086,
Germany
Introduction: Shake flask cultivation is nowadays a routine technique
during process development for mammalian cell lines. During shaken
culture, changes in agitation velocity, shaking diameter or shake flask size
affect the hydrodynamics in the shake flask. This might be reflected in the
growth of the cultured cells.
Process parameters such as power input, mixing time, fluid velocity etc.
have been determined and described mathematically for shake flasks
used for microbial cultivation, but only to some extend for mammalian
cell culture. Especially the relationship between these parameters and
growth characteristics of mammalian cells is still a relatively uncovered
issue.
In this work, process parameters like specific power input, mixing time,
maximum fluid velocity and Reynolds number were determined for four
different shake flasks (baffled and unbaffled) in a range of shaking velocities
on a shaking machine. The specific growth rate (μ max ) of the human
industrial cell line AGE1.HN® (ProBioGen AG, Berlin, Germany) was compared
to the respective process parameters.
Determination of process parameters: (1) Power input (P/V) was
calculated according to experimental data, that have been published in
correlations with the form of Np = f(Re), where Np is the power number
and Re the Reynolds number of the culture. The first correlation is
based on the work by Büchs et al. [1,2], who used a modified Np
analog to bioreactors, and fited the experimental Np’ data to Re. The
second correlation used is based on the work of Kato et al. [3]. Here,
the calculation of the Reynolds number considers the diameter of the
shaker (do) instead of the inner flask diameter (di).
(2) Mixing time (Θ95) was determined by means of the decolourization
method (I/KI titrated with Na2S2O3). Decolourization time course was
video recorded and visually analyzed.
(3) Maximum fluid velocity (u i ) was calculated at the maximum
flask’s inner diameter.
(4) Reynolds number (Re) was calculated as Re = rNd2/h, with d = di,
and d = do, for the methods published by Büchs et al., and Kato el al.
respectively.
A modified di (di, mod) was used for calculations of parameters in baffled
flasks. This number considers the flask’s depth into the flask circumference.
The average specific growth rate μmax was employed as indicator for
growth performance.
Relationship between cell growth and process transfer criteria:
Figure 1 shows the dependency of the average specific growth rate μmax
of AGE1.HN® cells on the process parameters of the cultures performed in
shake flasks. A shaking velocity of 200-250 min-1 seems to be optimal for
the cell growth rate. A maximal specific growth rate was observed in a
close range of power input at 200-400 W m-3 according to the method of
Büchs et al. and at 400-1000 W m-3 for the method of Kato et al. used for
Re calculation. As has been shown for the culture of AGE1.HN® cells in
bench-top bioreactors [4], a range of mixing time values between 8 and
13 seconds can be identified here as common for all shake flasks too. The
process operational windows identified in this work can lead to a
significant reduction in the growth differences of mammalian cells in the
context of standardization and reproducibility of shake flask cultures.
Conclusions: Our results point to regions of the studied parameters, where
common operation windows can be identified for μmax. In these process
windows the cells show a similar μmax in different shake flask, making cell
growth comparable. These process windows are common for the flasks,
independently of their size and the number of baffles.
The data obtained in this work can be used for process standardization and
comparability of results obtained in shaken systems i.e. to guarantee
consistency of results generated during laboratory studies with mammalian
cells.
Page 34 of 151
Acknowledgements: This work is a part of SysLogics (FKZ 0315275A):
Systems biology of cell culture for biologics, a project founded by the
German Ministry for Education and Research (BMBF).
References
1. Büchs J, Maier U, Milbradt C, Zoels B: Power consumption in shaking flasks
on rotary shaking machines: I. Power consumption measurement in
unbaffled flasks at low liquid viscosity. Biotechnol Bioeng 2000, 68:589-593.
2. Büchs J, Maier U, Milbradt C, Zoels B: Power consumption in shaking
flasks on rotary shaking machines: II. Nondimensional description of
specific power consumption and flow regimes in unbaffled flasks at
elevated liquid viscosity. Biotechnol Bioeng 2000, 68:594-601.
3. Kato Y, Hiraoka S, Tada Y, Shirai S, Koh ST, Yamaguchi T: Powerconsumption of horizontally shaking vessel with circulating motion.
Kagaku Kogaku Ronbunshu 1995, 21:365-371.
4. Platas O, Jandt U, Phan LDM, Villanueva ME, Schaletzky M, Rath A, Freund S,
Reichl U, Skerhutt E, Scholz S, Noll T, Sandig V, Pörtner R, Zeng AP:
Evaluation of criteria for bioreactor comparison and operation
standardization for mammalian cell culture. Eng Life Sci 2012,
12:518-528.
P18
Online glucose-lactate monitoring and control in cell culture and
microbial fermentation bioprocesses
Henry Weichert*, Mario Becker
Sartorius Stedim Biotech GmbH, August-Spindler-Strasse 11, 37079
Goettingen, Germany
Introduction: Conventional biopharmaceutical manufacturing is
characterized by validated process steps and extensive lab testing
procedures. The FDA PAT-Guidance recommends the use of potential for
improving development, manufacturing, and quality assurance through
innovation in product and process development, process analysis and
process control.
Measurement of glucose, as a major nutrient during cell cultivation and
microbial fermentation, has a key role for controlling the status of the
cultivation process. Together with the amount of lactate and additional
process parameters, like pH and DO, it gives the possibility to calculate
specific consumption rates of nutrients. The user gets information about the
status of the culture and of the cells.
BioPAT®Trace: Online Glc/Lac Analyser: BioPAT®Trace (Figure 1) is a
dual-channel analyser for the simultaneously measurement of glucose and
lactate which is based on an enzymatic detection of the two analytics.
Special attention has been paid to the ease of use and hygienic issues
related to cGMP environments. The system follows the plug & plays
principle, can be fully integrated into all facility environment scenarios and
is compliant with all relevant regulatory guidelines.
Wide measuring range: The linear measuring range of the BioPAT
®Trace extends from 0.01 to 40 g/l glucose and from 0.05 to 5 g/l lactate.
The deviation from the average measurement value is less than 3% for a
measurement of 5 g/l glucose and 2.5 g/l lactate.
Fast measurement frequency: The measurement frequency is up to 60
analyses per hour depending on the conditions. The service life of the
sensor system ensures 30 days or 5000 analyses depending on the
application. The ambient temperature of the BioPAT ®Trace can lie
between 5 and 35°C due to internal temperature correction. The ambient
humidity should not exceed 90%.
Flexible system integration: The BioPAT ®Trace has a number of outputs
making integration into data recording systems very flexible. Along with a
standard analog output for signal ranges from 0 to 20 mA, 0 to 10 V or 4
to 20 mA, the BioPAT ®Trace also has a USB interface, an Ethernet
connection as well as a serial output for data recording.
Connection to different fermenter scales by filtration or dialysis
probes: The on-line analysing system BioPAT®Trace covers the different
demands of long-term cell culture cultivations and fast microbial processes
in different scales such as small volume cultivations and FDA-validated large
scale productions. The sterile sampling systems based on filtration, dialysis
or ContiTRACE disposable probes provide the perfect solution for reliable
on-line sampling in bioreactors and bio disposables applied in industrial and
laboratory facilities.
Page 35 of 151
Figure 1(abstract P17) Relationship between maximum specific growth rate μ max and the process parameters in shake flask culture.
A) Shaking velocity, B) Power input calculated with the method by Büchs et al., C) Power input calculated by the method by Kato el al., D) Mixing time,
E) Maximum fluid velocity, F) Reynolds number with d = do.
The simplest method is to directly measure a filtered sample of medium.
However, because reactor medium is used, the range of applications is
limited to processes for which there’s a sufficient reactor volume or which
allow continuous-feed. Dialysis sampling is an option when processes are
involved for which reactor volume does not allow enough sample material.
This method only removes low molecular substances from the reactor
medium, without reducing the volume of fluid.
Automated control loop for glucose feed: Integrated in an automation
platform enabled with a 2 point glucose controller, e.g. as part of an S88
recipe module of the BioPAT®MFCS SCADA system, it is possible to realize
a fully automated control loop for any kind of cultivation process.
Conclusions: • Real Online system
Fast & automated measurement
SU tube sets and sensors
• Direct culture control (24/7)
Process knowhow
Replace offline methods
Real-time process monitoring
Automated sampling
• Setup of control loops and event based actions
defined by using the S88 module
• Different connections to automation systems possible
• Automated feed control
• Real-time Glucose and Lactate values
P19
Study of the improved Sf9 transient gene expression process
Xiao Shen, David L Hacker, Lucia Baldi, Florian M Wurm*
Laboratory of Cellular Biotechnology, Faculty of Life Sciences, Ecole
Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland
Figure 1(abstract P18) BioPAT®Trace equipped with the single use
Tube set.
Introduction: Insect cells have been widely used for the production of
recombinant proteins using recombinant baculovirus for gene delivery [1].
To simplify protein production in insect cells, we have previously described
a method, based on transient gene expression (TGE) with cultures of
suspension-adapted Sf9 cells using polyethylenimine (PEI) for DNA delivery
[2]. Expression of GFP has been realized at high efficiency and a tumor
necrosis factor receptor-Fc fusion protein (TNFR-Fc) was produced at a
level of 40 mg/L. However, the efficiency of the insect cells TGE system has
not been studied and further optimization may improve protein titers.
Here, we studied the efficiency of PEI for plasmid delivery in Sf9 cells.
Methods: Cell culture: Sf-9 cells were maintained in suspension in
TubeSpin® bioreactor 600 at 28°C [3].
Sf-9 cells Transfection: Sf9 cells were transfected as described before [2]
using 25 kDa polyethylenimine PEI (Polysciences, Warrington, PA) and an
expression vector for GFP or TNFR-Fc. GFP-specific fluorescence was
measured 48 h post-transfection using the GUAVA EasyCyteTM flow
cytometer (Millipore, Billerica MA, USA). TNFR-Fc was measured by
sandwich ELISA [4].
Estimation of plasmid copy number: Total DNA was isolated using
DNeasy Blood & Tissue Kit (Qiagen AG, Hombrechtikon, Switzerland)
according to the manufacturer’s protocol. PCR was executed using the
Absolute qPCR SYBR Green ROX reaction mix (Axon Lab AG, Baden-Dättwil,
Switzerland) with total cellular DNA as template. The PCR was performed
using LightCycler® 480 real-time PCR system (Roche Applied Science, Basel,
Switzerland). The plasmid copy number was estimated from the standard
curve according to the threshold cycle (Ct) of each sample [4].
Cell cycle analysis: Cells at different times post-transfection were
centrifuged and washed with PBS before fixation in 70% ethanol. Fixed cells
were washed with PBS and then stained with Guava Cell Cycle Reagent and
analyzed by the GUAVA EasyCyteTM flow cytometer. Cells treated with
nocodazole (50 ng/mL, 16 h) and mimosine (1 mM, 24 h) were used as
references for determining the positions of the G1 and G2/M phases [5].
Results: Plasmid delivery efficiency in Sf9 cells: To measure the time
course of plasmid DNA delivery, cells were transfected with a GFP
expression vector. At different times post-transfection, a complete medium
exchange was performed. The percentage of GFP-positive cells was
determined for all cultures including a control for which a medium
exchange was not performed. All cultures exhibited similar levels of GFPpositive cells meaning that DNA uptake into cells occurred within 10 min of
DNA addition (Figure 1A).
To measure the amount of DNA uptake, Sf9 cells were transfected in two
different ways with a TNFR-Fc expression vector and the amount of
intracellular plasmid was measured by quantitative PCR. On the day of
transfection more than 80% of the plasmid DNA was present within cells
with the control transfection while 40% of the DNA was present within
cells following a high-density transfection (Figure 1B). It has been reported
that improved plasmid delivery can result in an increase in specific and
volumetric productivity for HEK 293 cells transfected at high-density [6].
However, in our high-density protocol, plasmid delivery was diminished in
comparison to the control (Figure 1B).
Page 36 of 151
Plasmid delivery was not improved, but cell growth was inhibited in
an optimized TGE process: Improvement in TGE yields from Chinese
hamster ovary cells was achieved by reducing the cell growth rate [5,7].
When the cell growth curve of the optimal TGE process with Sf9 cells was
compared with that of the control protocol, we observed a significant
decrease of viable cell number, within 24 h post-transfection (Figure 1C).
This suggested a deregulation in the cell cycle in the initial phase of
transfection. The cell cycle distribution was analyzed and an increase of the
percentage of cells in the G2/M phase was observed for the high-density
protocol early after transfection (Figure 1D). However, the growth inhibition
was attenuated by 24 h post-transfection (Figure 1D). Nevertheless, the
temporary cell growth inhibition contributed to yield improvement in our
optimal protocol.
Conclusion: A previously described method for the transient transfection
of Sf9 cells was improved. The increase in recombinant protein yield was
not due to an increased plasmid delivery after transfection. However,
high-density transfection resulted in a significant percentage of cells
being blocked in the G2/M phase of the cell cycle for the first 24 h posttransfection.
References
1. Kost TA, Condreay JP, Jarvis DL: Baculovirus as versatile vectors for
protein expression in insect and mammalian cells. Nat Biotechnol 2005,
23:567-575.
2. Shen X, Michel PO, Xie Q, Baldi L, Wurm FM: Transient transfection of
insect Sf-9 cells in TubeSpin® bioreactor 50 tubes. BMC Proc 2011, Suppl
8: P37.
3. Xie Q, Michel PO, Baldi L, Hacker DL, Zhang X, Wurm FM: TubeSpin
bioreactor 50 for the high-density cultivation of Sf-9 insect cells in
suspension. Biotechnol Lett 2011, 33:897-902.
4. Matasci M, Baldi L, Hacker DL, Wurm FM: The PiggyBac transposon
enhances the frequency of CHO stable cell line generation and yields
recombinant lines with superior productivity and stability. Biotechnol
Bioeng 2011, 108:2141-2150.
5. Wulhfard S, Tissot S, Bouchet S, Cevey J, De Jesus M, Hacker DL, Wurm FM:
Mild hypothermia improves transient gene expression yields several fold
in Chinese hamster ovary cells. Biotechnol prog 2008, 24:458-465.
6. Backliwal G, Hildinger M, Hasija V, Wurm FM: High-density transfection
with HEK-293 cells allows doubling of transient titers and removes need
for a priori DNA complex formation with PEI. Biotechnol Bioeng 2008,
99:721-727.
7. Gorman CM, Howard BH, Reeves R: Expression of recombinant plasmids
in mammalian cells is enhanced by sodium butyrate. Nucleic acids res
1983, 11:7631-7648.
P20
Development of a Drosophila S2 insect-cell based placental malaria
vaccine production process
Wian A de Jongh1, Mafalda dos SM Resende2, Carsten Leisted1,
Anette Strøbæk1, Besim Berisha2, Morten A Nielsen2, Ali Salanti2,
Kathryn Hjerrild3, Simon Draper3, Charlotte Dyring1*
1
ExpreS2ion Biotechnologies, Horsholm, Denmark, 2970; 2Centre for Medical
Parasitology, Copenhagen University, Copenhagen, Denmark, 1356; 3The
Jenner Institute, University of Oxford, Oxford, UK, OX3 7DQ
Background: Malaria during pregnancy is the cause of 1500 neonatal
deaths a day. Moreover, 40% of all low weight births are caused by
pregnancy associated malaria. Researchers at Copenhagen University have
identified the VAR2CSA protein as a potential protective recombinant
placental malaria vaccine. ExpreS 2 ion Biotechnologies is responsible
establishment of cell lines expressing VAR2CSA variants and for developing
the protein production process based on VAR2CSA.
The ExpreS2 System is a one-for-all protein expression system based on
Drosophila S2 cells that is excellent in all phases of Drug Discovery, R&D and
manufacturing due to high-level transient transfections, easy establishment
of stable polyclonal pools that provides continuous high protein expression
levels without selection pressure, and simple cloning procedure. It is a novel,
non-viral, insect-cell based expression technology applied to the
development of a critically needed vaccine. The VAR2CSA protein, which the
vaccine is based on, is hard to express and comparison studies between
Page 37 of 151
Figure 1(abstract P19) Study of the Sf9 TGE process. (A) Sf9 cells were transfected with EGFP-coding plasmid DNA and PEI at a starting cell density of
4 × 106 cells per ml. Media of the transfected culture were exchanged at 10, 30, 60, 90, 120, 180 minutes post-transfection. EGFP-positive cells were
measured on day 2. (B) Average intracellular plasmid copy number on day of transfection and day 3 post-transfection of cultures transfected using control
protocol and high-density TGE protocol were analyzed by quantitative PCR. (C) Cell growth of Sf9 cells transfected using the two different protocols were
compared. Cell cycle distribution during the first 24 hours post-transfection of those two TGE culture were analyzed (D). C: control transfection at
4 × 106 cells/mL; H: high-density Sf9 transfection; h: hours.
insect, bacteria and yeast have shown that an insect cell system is the only
one leading to a clinically useful immune response. Process optimization is
also critically important, as the cost of manufacture must be as low as
possible to allow the vaccine to be used in the countries where it is most
needed.
Aim: The choice and cost of a manufacturing platform is one of the most
important strategic decisions in recombinant subunit vaccine development.
Furthermore, the geographic distribution of malaria and the philanthropic
funding sources involved requires production to be as cost-effective as
possible. Single-use provides manufacturing flexibility and economic
advantages, both highly desirable in this type of process. We therefore aim
to develop cost-effective Drosophila S2 based Placental and Blood-stage
malaria vaccine production processes combining the ExpreS2 constitutive
insect cell expression system with single-use bioreactor technology.
Materials and methods: Thirty-four truncation variants of the VAR2CSA
placental malaria vaccine antigen and full-length PfRh5 were cloned into
pExpreS2 vectors and transfected into Drosophila S2 insect cells. Stable cell
lines were established in three weeks in T-flask culture, which were then
inoculated at 8E6 cells/ml in shake flasks, or batch or fed-batch production
in DasGip Bioreactors and harvested after 3 and 7 days respectively. The
cultures were harvested by centrifugation and filtration, where after the
proteins were purified using Ni ++ affinity columns and gel filtration.
Bioreactor optimisation were performed in 1L DasGip mini-bioreactors, 2L
Braun glass bioreactor, and the single-use CellReady3L bioreactor.
Alternating Tangential Flow (ATF) technology from Refine was also
employed for perfusion production tests. The bioreactor conditions were
25°C, pH6.5, Dissolved Oxygen 20%, 110 rpm stirrer speed using a Marine
impeller. The perfusion rate was set to 0.5 to 3 Reactor Volumes (RV) per
Page 38 of 151
Table 1(abstract P21) Key compounds supplemented at
0.01% (w/v) to CD media
Key compound
Specific IgG production (%)*
Ferulic acid
154
Syringic acid
194
Galactarate
Adenine
153
185
Trigonelline
141
SE50MAF-UF
204
CD media
100
All values are set relative to CD media (100%).
Figure 1(abstract P20) Expression yields obtained for Rh5 in batch,
fed-batch and ATF-perfusion modes. Using perfusion could
significantly increase yields.
day, but was increased significantly faster for the CellReady 3L perfusion
run compared to the Braun runs, with 3 RV per day reached by day 6 vs.
day 9 for the Braun runs.
Results: Thirty-four protein variants of VAR2CSA were screened for
expression level. Further process optimization was performed on the lead
candidate in glass bioreactors, and >30% yield increase was achieved
using a fed-batch approach (results not shown). The expression of Rh5 was
compared in batch, fed-batch and perfusion using both CellReady3L and
glass bioreactors. There was no significant difference between growth in
the DasGip bioreactor and the disposable CellReady bioreactor.
Comparable yields were obtained in both systems whether running in batch,
fed-batch, or perfusion mode (e.g. Perfusion day 6: 190 vs. 210 mg/L, results
not shown). Furthermore, 350E6 cells/ml were achieved in concentrated
perfusion mode using the ATF and CellReady3L. Concentrated perfusion
lead to final Rh5 yields of 210 mg/L and 500 mg/L after 6 or 9 days
production runs (see Figure 1).
Conclusions: The ExpreS 2 platform has demonstrated its robustness of
expression ability, by expression of two complex malaria antigens; and in
breadth of hardware adaptability, as it was shown to perform comparably
in the single use CellReady3L and glass bioreactors. Furthermore,
extremely high cell counts and yields of Rh5 were achieved in Fed-batch
and perfusion modes. The results demonstrate how the ExpreS2 expression
system in conjunction with single-use technology can be used to produce
cost-effective malaria vaccines.
P21
Understanding the complexity of hydrolysates
Abhishek J Gupta1,2, Kathleen Harrison2, Dominick Maes3*
1
Laboratory of Food Chemistry, Wageningen University, Wageningen, The
Netherlands; 2FrieslandCampina Domo, Delhi, NY 13753, USA;
3
FrieslandCampina Domo, Wageningen, The Netherlands
Background: Hydrolysates are complex media supplements composed of
many as well as different types of compounds. Within Frieslandcampina
Domo’s Quality by Design project, detailed information of these compounds
(annotation and quantification) has been generated. This was achieved for
soy protein hydrolysates (Proyield Soy SE50MAF-UF) using metabolomics
biochemical profiling. Biochemical profiling, together with peptide
profiling and analysis of the inorganic compounds, resulted in complete
characterization of this hydrolysate product. Additionally, these lots of
Proyield Soy SE50MAF-UF were tested for cell culture performance.
Results and Discussion: The composition data was natural log transformed and functionality data was corrected for experiment-to-experiment
variation. Consequently, the dataset was analyzed using statistical tools like
two-mode cluster analysis, bootstrapped stepwise regression and 2D
correlation analysis. These statistical tools were composed in-house using
Matlab® R 2009b version 7.9.0.529.
This resulted in identification of a series of key compounds in the
hydrolysates that correlated with cell growth or IgG production in a CHO cell
line. To validate these findings, pure preparations of these key compounds
were supplemented to the chemically defined medium. Addition of these
individual key compounds to chemically defined medium, in some cases,
slightly improved cell growth or IgG production, but the effect was still
much smaller than the enhancing effect of the complete hydrolysate. The
specific IgG production of key compounds supplemented to CD media, CD
media alone, and soy protein hydrolysate supplemented to CD media is
shown in Table 1.
This suggests that the effect of a hydrolysate cannot by mimicked by
adding certain key compounds. Alternatively, this suggests that these key
compounds are biomarkers, which are interconnected with several other
compounds, and that presence of all of these compounds is relevant/
important for the enhancement in the functionality.
The 2D correlation analysis reveals this complex network of compounds,
in which these compounds are positively or negatively correlated with
each other and with cell growth or IgG production (Figure 1).
In hydrolysates, these compounds interact with several other compounds in
a complex biochemical network. This network of compounds is a unique
and native feature of hydrolysates and non-existent in chemically defined
media.
Working in close collaboration with our customers, we gain understanding
about the relation between the complex composition of hydrolysates and
their effect on cell growth and titer in the application.
P22
Developing a production process for influenza VLPs: a comparison
between HEK 293SF and Sf9 production platforms
Christine M Thompson1,2, Emma Petiot1, Marc G Aucoin3, Olivier Henry2,
Amine A Kamen1,2*
1
Human Health Therapeutics, Vaccine Program, NRC, Montréal, Québec, H4P
2R2, Canada; 2Department of Chemical Engineering, École Polytechnique de
Montréal, Montréal, Québec, H3C 3A7, Canada; 3Department of Chemical
Engineering, University of Waterloo, Waterloo, Ontario, N2L 3G1, Canada
Background: Influenza virus-like particle (VLP) vaccines are one of the most
promising approaches to respond to the constant threat of the emergence
of pandemic strains, as they possess the potential for higher production
capabilities compared to traditional vaccines made in egg-based technology.
VLPs are particles produced in cell culture utilizing recombinant protein
technology composed of viral antigens that are able to elicit an immune
response but lack viral genetic material. Thus far, influenza VLPs have been
produced in mammalian, insect and plant based platforms [1], with
production in insect cells being the most explored. Baculovirus with
mammalian promoters (Bacmam) have been shown to efficiently transduce
mammalian cells and further express genes but are unable to replicate,
efficiently repressing baculovirus (BV) production that leads to contamination
downstream [2]. Influenza VLP production was performed in HEK 293SF cells
using the Bacmam gene delivery system. The proposed system was assessed
Page 39 of 151
Figure 1(abstract P21) 2D correlation map of compounds present in ProYield SE50MAF-UF that significantly influences IgG production by CHO
cells. These key compounds are interconnected to other compounds of the hydrolysate, forming a complex biochemical network.
for its ability to produce influenza VLPs composed of Hemagglutinin (HA),
Neuraminidase (NA) and Matrix Protein (M1) and compared to VLPs
produced in Sf9 cells through the lens of bioprocessing.
Materials and methods: VLPs from both systems were characterized using
currently available influenza quantification techniques such as Single Radial
Immunodiffusion (SRID) assay, Hemagglutination (HA) assay, Negative
Staining Electron Microscopy (NSEM) and western blot.
Results: It was found that VLPs from the HEK 293SF system were present
in the culture supernatant in a heterogeneous mixture in terms of particle
shape and size. Particles were spherical and also pleomorphic in shape and
ranged from sizes of 100-400 nm. Sucrose cushion concentrated samples
contained broken particles and a lot of debris. Additionally, it was found
that VLPs were associated with the cell pellet after harvest in relatively the
same amount as released into the supernatant in the form of unreleased
VLPs from NSEM and HA assay analysis. This is possibly due to the sticky
nature of the HA protein or from cell clumping during production that
worked to trap the VLPs, preventing release into the supernatant. Sf9 cells
produced more uniformly shaped VLPs that were spherical in shape,
around 100 nm in size and were found to be mainly in the supernatant,
not associated with the cell pellet. Sucrose cushion concentrated VLPs
contained noticeably less debris than VLPs produced from HEK 293SF cells.
It was found that VLP production in Sf9 cells produced 1.5 logs more VLPs
than in HEK 293SF cells and had 30× higher HA activity. However, Sf9
VLP samples contained 20× more baculovirus than VLPs, which can
contribute to HA activity in both the HA and SRID assays which has to be
acknowledged during process development stages. This is the first time to
our knowledge that specific production values for influenza VLPs in terms
of total particles/ml have been reported.
Conclusions: From this study, the insect-cell baculovirus system produced a
more homogeneous population of VLPs compared to its counterpart in HEK
293SF cells. However, this study also highlights the major problem of
baculovirus contamination in the Sf9 system, which requires removal for
final vaccine formulations and to help ease the optimization of process
production conditions.
Acknowledgements: The authors would like to thank Dr. Ted M Ross of
the University of Pittsburgh for kindly donating the Bacmam construct and
NSERC for providing the Discovery Grant that supported this study. In
addition, we’d like to thank Johnny Montes for his help with viral stock
productions and the rest of the ACT group and graduate students at NRC in
Montréal for their daily support.
References
1. Kang SM, Song JM, Quan FS, Compans RW: Influenza vaccines based on
virus-like particles. Virus research 2009, 143:140-146.
2. Tang XC, Lu HR, Ross TM: Baculovirus-produced influenza virus-like
particles in mammalian cells protect mice from lethal influenza
challenge. Viral immunology 2011, 24:311-319.
P23
Dynamic cyclin profiles as a tool to segregate the cell cycle
David Garcia Munzer1, Margaritis Kostoglou2, Michalis C Georgiadis3,
Efstratios N Pistikopoulos1, Athanasios Mantalaris1*
1
Biological Systems Engineering Laboratory, Centre for Process Systems
Engineering, Department of Chemical Engineering, Imperial College London,
London, SW7 2AZ, UK; 2Department of Chemistry, Aristotle University of
Thessaloniki, Thessaloniki, 54124 Greece; 3Department of Chemical
Engineering, Aristotle University of Thessaloniki, Thessaloniki, 54124 Greece
Background and novelty: Mammalian cells growth, productivity and cell
death are highly regulated and coordinated processes. The cell cycle is at
the centre of cellular control and should play a key role in determining
optimization strategies towards improving productivity [1]. Specifically, cell
productivity is cell cycle, cell-line and promoter dependant [2]. The cyclins
are key regulators that activate their partner cyclin-dependent kinases
(CDKs) and target specific proteins driving the cell cycle. To our knowledge,
there is no information on cyclin phase-dependent expression profiles of
industrial relevant mammalian cell lines. We use the cyclin profiles as a tool
to identify and quantify the landmarks of the cell cycle and implement a
modelling approach to describe the bioprocess. Hereby, we introduce two
possible experimental approaches to obtain such dynamic cyclin profiles.
Experimental approach: Cyclin expression (cyclin E - G1 class and cyclin B
- G2 class) was studied in GS-NS0 batch cultures by flow cytometry. Two set
of experiments were performed: a) culture of cells under perturbed (cell
arrest) and unperturbed growth (control run) and b) culture of cells for
DNA labelling to perform a proliferation assay as well as a non-exposed
cells (control run). The static profiles were obtained by direct cyclin
staining and the dynamic profiles were reconstructed by either a) tracking
a partially synchronized population or b) combining the timings from
proliferation assays with the static profiles.
Result discussion: Both cyclins showed a clear cell cycle phase-specific
pattern (cyclin E was 10% higher at G1 and cyclin B was 40% higher at G2).
These results were consistent among all the different culture conditions
and were inferred from the static cyclin profiles. After the arrest release the
dynamic cyclin profiles can be directly reconstructed by plotting the
relevant cyclin content from the partially synchronized moving population
traversing the cycle. An advantage of this approach is a clear view of the
cyclin accumulation and transition threshold levels. However, this
approach requires testing using different arrest agents, exposure levels
and timings, which could have an effect on the cell behaviour.
A second approach included an indirect dynamic cyclin profile
reconstruction by combining the acquired proliferation times for different
cell cycle phases (e.g. G1/G0, G2/M) with the static cyclin profiles. If the static
cyclin profiles are considered as the most representative cyclin values (and
near to the transition threshold level), it is possible to reconstruct the
dynamic profile by linking the threshold values with the cycling times (from
the proliferation assay). The advantage of such approach is the ability to
formulate different dynamic cyclin profiles such as constant functions, piecewise linear functions or more elaborated profiles. However, implementation
of such an approach requires the tuning of the proliferation assay and the
frequency of sampling since it will affect the quality of the assay.
The two approaches showed comparable results both for the static cyclin
profiles (also when compared to the control runs) and the dynamic cyclin
profiles.
Conclusions: The different approaches for deriving the dynamic
cyclin profiles provide a versatile experimental toolbox for cell cycle
characterization. Cyclins can be used as cell cycle distributed variables and be
experimentally validated (quantitatively), avoiding the use of weakly
supported variables (e.g. age or volume). The observed patterns and timings
provide a blueprint of the cell line’s cell cycle, which can be used for cell cycle
modelling. The development of these models will aid the systematic study of
the cell culture system, the improvement of productivity and product quality.
Acknowledgements: The authors are thankful for the financial support from
the MULTIMOD Training Network, European Commission, FP7/2007-2013,
Page 40 of 151
under the grant agreement No 238013 and to Lonza for generously
supplying the GS-NS0 cell line.
References
1. Dutton RL, Scharer JM, Moo-Young M: Descriptive parameter evaluation
in mammalian cell culture. Cytotechnol 1998, 26:139-152.
2. Alrubeai M, Emery AN: Mechanisms and Kinetics of Monoclonal-Antibody
Synthesis and Secretion in Synchronous and Asynchronous Hybridoma
Cell-Cultures. J Biotechnol 1990, 16:67-86.
P24
Development and implementation of a global Roche cell culture
platform for production of monoclonal antibodies
Thomas Tröbs1*, Sven Markert1, Ulrike Caudill1, Oliver Popp2, Martin Gawlitzek3
, Masaru Shiratori3, Chris Caffalette3, Robert Shawley3, Steve Meier3,
Abby Pynn3, Wendy Hsu3, Andy Lin3
1
Pharmaceutical Biotech Production & Development PTDE, Roche, 82377
Penzberg, Germany; 2Pharma Research and Early Development pRED, Roche,
82377 Penzberg, Germany; 3Early and Late Stage Cell Culture PTDU,
Genentech, South San Francisco, CA 94061, USA
Introduction: Roche and Genentech both developed their first platform
cell culture process using chemically-defined media independently.
This resulted in significantly different processes with regards to operations
and media formulations. The decision was made to evaluate both and
decide for one existing platform. Drivers and benefits of a single upstream
cell culture platform were the maximization of flexibility with regard to
process development, clinical and commercial manufacturing by execution
of any process at any network facility with standard transfer effort and by
minimization of component lists and raw material inventories across sites.
Furthermore capturing benefits of improvements made by all sites funneled
into a common knowledge base benefits the whole organization. And
process characterization and validation data could be leveraged across the
entire organization what means less resource expenditure for PC/PV.
The existing independent platforms were evaluated if there is a clear benefit
in going forward with a given platform or certain aspects of a platform. The
comparison consisted in a technical (cell culture performance, product
quality, manufacturability) and a business case evaluation (product titer,
timelines to launch, costs, IP. In result both platforms are capable of
achieving sufficient titers for platform process (2-4 g/L) with acceptable
product quality. There existed no major business driver to select one process
over the other.
Development: For development of new basal and feed media knowledge
from two legacy efforts was leveraged and so potential synergies and
performance benefits could be achieved (Figure 1). Based on platform
Figure 1(abstract P24) Schematic diagram of major elements of the two legacy platforms and the optimization of medium and feed respective
the leveraging of knowledge from two existing legacy platforms.
evaluation results, decision was made to harmonize existent CHO host cell
line, seed train medium and feeding strategy (chosen from the two
existing platforms).
Results: The cell culture media and feed optimization strategy started with
a paper exercise to compare existing in-house chemically defined media
formulations and identify components/component groups for further
evaluation. Subsequently identified conditions were screened in highthroughput cell culture systems (HTS-CC) to identify beneficial components
and remove components that are not required. Optimized best cases were
confirmed in 2L bioreactors with 6 model cell lines and the final process
was up-scaled to pilot scale.
Promising results from HTS-CC media screening were confirmed in a
2L-bioreactor experiment. The new platform medium and feed were
finalized after a series of 2L optimization experiments. The process was
successful up-scaled to 250L single-use bioreactor (SUB) and 400L stainless
steel bioreactor with two model cell lines. Growth and titer were
comparable to 2L satellites.
In the course of the platform implementation four new GMP raw materials
(dry powders and stock solution) were developed and tested. Raw material
shelf life stability retesting and extension were initiated. Global specifications
were established for equipment and site independent platform application
and the applicability for global production units is given.
High temperature/short time treatment (HTST) compatibility was tested.
The sterile hold for liquid media was initiated.
Summary: New chemically defined platform media (basal and feed) were
developed by leveraging data and knowledge from the two Genentech
and Roche legacy platform processes, and through a series of experiments
including high-throughput systems for cell culture, shake flasks,
2L bioreactors and pilot-scale bioreactors. An average increase in final titer
of 30% was achieved compared to the two legacy platforms.
The final process resulted in product quality attributes (glycans, charge
variants, size) that were comparable to historical data. No new variants
were detected. The final and fully harmonized platform process is specified
and implemented.
Acknowledgements: Thomas Tröbs on behalf of Technical Team for
Global Cell Culture Platform development and Christine Jung, Josef
Gabelsberger, Uli Kohnert, Josef Burg, Ralf Schumacher, Robert Kiss, John
Joly, Brian Kelley, Alexander Jockwer, Nicola Beaucamp, Christian Walser,
Carolin Lucia, Peter Harms, Pilot Plant Operations, Analytical Operations.
P25
Powerful expression in Chinese Hamster Ovary cells using bacterial
artificial chromosomes: Parameters influencing productivity
Wolfgang Sommeregger1, Andreas Gili2, Thomas Sterovsky2, Emilio Casanova3,
Renate Kunert1*
1
Vienna Institute of BioTechnology (VIBT), Department of Biotechnology,
University of Natural Resources and Life Sciences, Vienna, 1190, Austria;
2
Polymun Scientific Immunbiologische Forschung GmbH, Klosterneuburg, 3400,
Austria; 3Ludwig Boltzmann Institute for Cancer Research (LBI-CR), Vienna, 1090,
Austria
Background: CHO (Chinese Hamster Ovary) cells are the cell line of choice
for therapeutic protein production. Although the achieved volumetric titers
have increased significantly over the past two decades, the establishment of
well-producing CHO cell lines is still difficult and not always successful [1].
Factors influencing productivity are the chosen host cell line, the genetic
vectors, applied media, the cultivation strategy as well as the product itself.
Several CHO host strains are available for recombinant protein production,
however, they are often quite diverse in terms of growth rate, maximal
achieved cell concentrations and specific productivities. Specific productivity
is also related to the locus of integration of the transgenes due to positional
effects caused by the chromatin environment. Previously it was described
that Bacterial Artificial Chromosomes (BACs) carrying the Rosa26 locus are
advantageous for the recombinant protein production in CHO cells,
enhancing the specific productivity compared to plasmid derived
recombinant CHO cells [2-4]. In this project we aim to identify factors
influencing volumetric productivity using different CHO hosts, Rosa 26 BACs
as genetic constructs and suitable cell culture media. First, different
commonly used CHO host cell lines were analyzed in various cell culture
Page 41 of 151
media to identify which host strain performs best. Secondly, we generated a
recombinant cell line, producing the highly glycosylated HIV envelope
protein gp140 as an example for a difficult to express model protein. Gp140
expression was compared to an already existing gp140 cell line generated
by a plasmid vector as expression system.
Methods: Cell culture: CHO-DUKX-B11 (ATCC-CRL-9096) and CHO-DG44
(life technologies) were serum-free cultivated in spinner flasks. CHO-K1
(ATCC-CCL-61) and CHO-S (life technologies) were serum-free cultivated
in in shaker flasks.
BAC Recombineering: E.coli carrying the Rosa 26 BAC (~220 kbp) were
transformed with a plasmid coding for a recombinase. Consecutively, a
plasmid carrying the gp140 (CN54) gene flanked by homologous regions
to the BAC was used for the transformation of the recombinase positive
E.coli cells. BAC positive colonies were selected and the BAC DNA was
purified (NucleoBond Xtra BAC, Macherey Nagel).
Transfection and selection: CHO-S host cells were transfected with linearized,
lipid complexed (Lipofectin) CN54 Rosa26 BAC DNA. Recombinant clone
selection was performed in 96-well plates using 0.5 mg/mL G418. BAC
transfected CHO cells are able to express the transgene as well as a
Neomycin resistance gene within the Rosa26 locus.
Results: Host cell line comparison: CHO-DUKX-B11, CHO-DG44, CHO-K1
and CHO-S were analyzed in batch culture in CD-CHO (life technologies),
ActiCHO (GE-PAA), DMEM/Ham’s F12 (Biochrom) + supplements (Polymun
Scientific), and CD-DG44 (life technologies) media in spinner and shaker
flasks. CHO-DUKX-B11 and CHO-DG44 grew best in spinner flasks with
CD-DG44 media, whereas CHO-K1 and CHO-S grew best in shaker flasks
with ActiCHO media. The dhfr negative cell lines were growing to much
lower viable cell densities than K1 and S. CHO-S reached the highest viable
cell density (1.17 × 107 cells/mL) followed by CHO-K1 (8.39 × 106 cells/mL)
(Table 1).
Gp140 (CN54) recombinant cell lines: CHO-S was chosen for testtransfections and recombinant gp140 (CN54) producers were established
using a Rosa 26 BAC construct carrying the gp140 (CN54) gene. The best
clone was analyzed in a batch experiment and yielded 77 μg/mL which is
~10 times the titer achieved with a recombinant plasmid derived CHODUKX-B11 (Figure 1). This 10-fold increase was related to the higher
specific productivity (~18-fold) and the higher accumulated cell density
(3.5-fold) in shorter batch duration.
Conclusion: CHO-S and CHO-K1 have the potential to grow to high cell
densities. The used dhfr deficient hosts (DUKX-B11 and DG44) are at least
without a co-transfection of the dhfr gene not growing to high cell concentrations. Rosa 26 BAC derived clones need no amplification as they provide
their own open chromatin region. Thus, higher specific productivity can be
achieved by elevated transcript levels compared to conventional plasmid
clones. The combination of cells growing to high cell densities and the
transcriptional efficiency of the Rosa26 BAC system leads to accumulation of
significantly increased volumetric titers for a difficult to express glyco-protein.
Acknowledgements: This study was partly financed by Polymun Scientific
Immunbiologische Forschung GmbH, Klosterneuburg, 3400, Austria; BioToP
PhD Programme, University of Natural Resources and Life Sciences, Vienna,
1190, Austria and the FWF Austrian Science Fund.
References
1. Kim JY, Kim YG, Lee GM: CHO cells in biotechnology for production of
recombinant proteins current state and further potential. Appl Microbiol
Biotechnol 2012, 93:917-930.
2. Mader A, Prewein B, Zboray K, Casanova E, Kunert R: Exploration of BAC
versus plasmid expression vectors in recombinant CHO cells. Appl
Microbiol Biotechnol 2013, 97:4049-4054.
3. Blaas L, Musteanu M, Grabner B, Eferl R, Bauer A, Casanova E: The use of
bacterial artificial chromosomes for recombinant protein production in
mammalian cell lines. Methods Mol Biol 2012, 824:581-593.
4. Blaas L, Musteanu M, Eferl R, Bauer A, Casanova E: Bacterial artificial
chromosomes improve recombinant protein production in mammalian
cells. BMC Biotechnol 2009, 9:3.
Table 1 Maximum achieved viable cell densities in batch
experiments
CHO cell line
DUKX-B11
DG44
CHO-S
CHO-K1
Max. VCD (cells/mL)
2.00E+06
2.28E+06
1.17E+07
8.39E+06
Page 42 of 151
Figure 1(abstract P25) Titer and specific productivity comparison of a BAC derived recombinant CHO-S cell line producing gp140 (CN54) and
an already existing recombinant plasmid derived CHO-DUKX-B11 cell line.
P26
INVect - a novel polycationic reagent for transient transfection of
mammalian cells
Sebastian Püngel1, Miklos Veiczi2, Tim Welsink1, Daniel Faust1, Vanessa Vater1,
Derek Levison2, Uwe Möller2, Wolfgang Weglöhner1*
1
InVivo BioTech Services GmbH, 16761 Hennigsdorf, Germany; 2emp Biotech
GmbH, 13125 Berlin, Germany
Background: For rapid recombinant protein production in small to medium
size volumes, transient transfection of mammalian cells is still the method of
choice in biotechnology [1]. However, due to the high costs of commercially
available lipofectamines or polycationic transfection reagents such as
polyethylenimine (PEI), the most widely used transfection reagents available
present a substantial economic bottleneck. While these reagents produce
seemingly high transient transfection rates [2], there is still a strong desire for
transfection reagents providing both secure and easy handling and higher
recombinant protein production. As part of our commitment to excellence,
InVivo BioTech Services initiated a joint venture with emp Biotech and
developed a novel polycationic reagent, named INVect, for transient
transfection and recombinant protein production in mammalian cells.
Materials and methods: Mammalian cells were cultured in CD-ACF media
using shake flasks and standard culture conditions. Cells were transfected
with 10 μg per mL of a GOI harboring plasmid at a cell density of 5 × 106
cells per mL in FreeStyle™ Medium (Life Technologies) with INVect to DNA
ratio of 6:1 (w/w) and PEI to DNA ration of 2:1 (w/w). Cultures were
supplemented with same volume Protein Expression Medium (Life
Technologies) 2 hours post transfection. GFP and SEAP expression took
place in 8 mL culture volume in 50 mL bioreactor tubes. Expression of other
reporter proteins were performed in 150 mL culture volume in 500 mL
shake flasks. Transfection efficiency was determined 24 hours post
transfection by counting green fluorescent positive cells using a FACSCalibur
(Becton, Dickinson and Company). SEAP expression was determined in cell
culture supernatant on day 6 post transfection by a photometric pNPP turnover assay. Quantification of IgG was performed by protein G affinity
chromatography on day 6 post transfection. Thrombomodulin concentration
was calculated from cell culture supernatant on day 6 post transfection by
IMUBIND® Thrombomodulin ELISA Kit (american diagnostica). His-tagged
recombinant protein was purified on day 6 post transfection by TALON®
immobilized metal affinity chromatography system.
Results: Cytotoxicity was tested over a broad range of concentrations.
Results demonstrate several novel synthetic polymers exhibiting transfection
efficiencies even higher than common PEIs after optimized ratios of DNA-topolymer were applied. Transfection efficiency of INVect was compared to
PEI, currently the standard transfection reagent for transient gene
expression. INVect was found to generally give better transfection
efficiencies of greater 80% in a GFP assay (Figure 1A). Batch-to-batch
reproducibility was shown on five independent INVect batches. Transfection
results were highly consistent and in the range of 80-90% (Figure 1B).
INVect successfully delivers genes to HEK293-F, CHO-S and CAP-T cells as
shown in a SEAP expression system (Figure 1C). Post-transfection cell
productivity was determined under TGE manufacturing conditions.
Thrombomodulin (60 kDa) (Figure 1D), an IgG (144 kDa) (Figure 1E) and a
HIS-tagged Protein of Interest (~40 kDa) (Figure 1F) were transiently
expressed using INVect as transfection reagent and conventional 25 kDa PEI
as control. Cells were transfected with a gene of interest harboring plasmid,
with product concentration being measured on day 6 post transfection. The
use of INVect provided a minimum 2-fold increase in protein production
over PEI (25 kDa) based transfection.
Conclusions: INVect is a novel polycationic transfection reagent which
demonstrates low cell toxicity for transient transfection of mammalian cells
and delivers extremely high transfection efficiencies of up to 90%, 24 h post
transfection. The use of INVect for transfection under TGE conditions leads
to exceptionally high levels of protein expression and outperforms 25 kDa
linear PEI by 2-fold. INVect can be used effectively with all common cell lines
and is especially suited for HEK293-F and CAP-T cells.
References
1. Geisse S: Reflections on more than 10 years of TGE approaches. Protein
Expr Purif 2009, 64:99-107.
2. Fischer S, Charara N, Gerber A, Wölfel J, Schiedner G, Voedisch B,
Geisse S: Transient recombinant protein expression in a human
amniocyte cell line: the CAP-T® cell system. Biotechnol Bioeng 2012,
109:2250-2261.
P27
Development of a chemically defined cultivation and transfection
medium for HEK cell lines
Sebastian Püngel1, T Tim Welsink1, Penélope Villegas Soto1,
Wolfgang Weglöhner1, Tim F Beckmann2, Ina Eickmeier2, Stefan Northoff2,
Christoph Heinrich2*
1
InVivo BioTech Services GmbH, 16761 Hennigsdorf, Germany; 2TeutoCell AG,
33615 Bielefeld, Germany
Page 43 of 151
Figure 1(abstract P26) Transfection efficiency and 6 day post-transfection cell productivity of INVect. (A) Transfection efficiency of INVect
compared to PEI. (B) transfection efficiency of 5 independent batches. Transfection efficiency was determined 24 hours post transfection by counting
green fluorescent positive CAP-T cells using a FACSCalibur (Becton, Dickinson and Company). (C) CHO-S, HEK293-F and CAP-T cells were transfected with
a SEAP harboring plasmid. Relative SEAP expression was determined in cell culture supernatant by a photometric pNPP turn-over assay. (D) CAP-T cells
were transfected with a Thrombomodulin harboring plasmid. Thrombomodulin concentration was calculated from cell culture supernatant by IMUBIND®
Thrombomodulin ELISA Kit (american diagnostica). (E) CAP-T cells were transfected with an IgG harboring plasmid. Antibody concentration was
determined by protein G affinity chromatography. (F) CAP-T cells were transfected with a His-tagged protein harboring plasmid. Protein of interest was
purified by TALON® immobilized metal affinity chromatography system.
Background: In the process of generating a production cell, introduction
of the gene of interest into the host cell can be performed by various
physical, chemical or biological methods. Because of the greater scalability
compared to physical methods and no safety concerns or restrictions that
are associated with the use of viral systems, a transfection using chemical
methods is of great interest. However, up to now up-scaling is limited by
the challenge to transfect cells in conditioned media with the widely used
reagent polyethylenimine (PEI). Considering the upscaling to gram yields, a
culture medium that allows both, transfection and production is required.
In this work, the current status in the development of such media
supporting cell growth, transfection and protein production in HEK cells is
presented. By this, processes will no longer be limited by media exchange
prior transient transfection.
Materials and methods: Transfection was performed according to
standard protocols described in the literature. Briefly, 5 × 10 6 cells/mL
were transfected with 2 pg DNA/cell and 25 kDa PEI in 4 mL transfection
volume. Transfection efficiency was determined 24 hours post transfection
by counting green fluorescent positive cells using a FACSCalibur (BD
Biosciences). All cultivations were carried out using shake flasks with
standard conditions well known in the art. Automated viable cell counting
was performed by a Cedex (Innovatis). Furthermore, the quantities of
components like glucose, lactate, amino acids, salts and vitamins in the
supernatant were measured. Based on this information, single ingredients
or groups of components from the basal formulation were screened for
their influence on transfection efficiency. To evaluate the effect of cellular
proteins in conditioned medium, they were separated by chromatography
and analyzed via MALDI-TOF/TOF mass spectrometry (MS) (ultrafleXtreme,
Bruker). SEC was performed using the high resolution gel filtration medium
Superdex™ 200 16/60 with the ÄKTAprime system (GE Healthcare).
Results: Batch growth for an exemplary HEK host cell line in the latest basic
growth medium formulation reached a maximum viable cell density of
nearly 1 × 107 cells/mL. Direct adaption of three different adherent serumdepending host cell lines was also successfully implemented in this medium.
The screening of basal medium components exhibited no significant
influence on transient transfection efficiency of HEK cells (overall efficiency
of 80% +/- 15%), as shown in Figure 1(A). In contrast, depending on the
level of conditioning, the presence of proteins in the supernatant of these
media reduced transfection efficiency up to 100% (Figure 1B).
Separation and analysis of conditioned medium revealed that especially
high molecular weight components have a negative impact on the
transfection efficiency. Identification by MALDI-TOF/TOF-MS showed not
only proteins of the basal lamina but also histones to be present in the
analyzed high molecular weight fractions 1 and 2 (Table 1).
Conclusions: The latest medium formulation supports cell growth and easy
adaption to suspension of the three major HEK host cell lines and several
producer cell lines originated from those. High transfection efficiencies of up
to 80% 24 hours post transfection where reached in a basic medium
formulation. In this context, the major challenge for combining a
transfection- and growth medium in one formulation is to retain single cell
growth, while avoiding commonly used anti-aggregation components,
which are known to impair transfection efficiency. Beyond that, in this study
basal medium components exhibited no influence on transient transfection,
Page 44 of 151
whereas high molecular weight fractions of conditioned media reduced
transfection efficiency. Noticeably, these fractions contained histones which
might be one factor with negative impact.
Acknowledgements: This work was partly supported by ZIM (Zentrales
Innovationsprogramm Mittelstand) and the German Federal Ministry of
Economics and Technology.
P28
Automated substance testing for lab-on-chip devices
Lutz Kloke1*, Katharina Schimek1, Sven Brincker1, Alexandra Lorenz1,
Annika Jänicke1, Christopher Drewell1, Silke Hoffmann1, Mathias Busek2,
Frank Sonntag2, Norbert Danz2, Christoph Polk2, Florian Schmieder2,
Alexey Borchanikov4, Viacheslav Artyushenko4, Frank Baudisch3, Mario Bürger3,
Reyk Horland1, Roland Lauster1, Uwe Marx1
1
Technische Universität Berlin/Germany; 2Fraunhofer IWS, Dresden/Germany;
3
GeSiM mbh, Großerkmannsdorf/Germany; 4ART Photonics GmbH, Berlin/
Germany
Background: A smartphone-sized multi-organ-chip has been developed
by TissUse. This platform consists of a microcirculation system which
contains several fully endothelial-cell-coated micro- channels in which
organ equivalents are embedded. Briefly, Human 3D organ equivalents
such as liver and skin could be maintained functional over 28 days and
treated with chemical entities in this microcirculation system.
In order to automate the Multi-Organ-Chip (MOC) handling we developed
with partners a robotic platform. The prototype is capable to maintain 10
MOCs. Operations can be programmed individually by its user. For example
OECD guidelines for acute toxicity testing could be performed. The robotic
platform features also functions such as automatic media supply, sampling
and storage, temperature control, fluorescence and microscopic monitoring,
PIV, O2-measurement, etc. To display the functionality we performed a
toxicity test with RPTEC cells treated with DMSO in different concentrations.
Proof of concept study: RPTEC cells were used as cellular model system.
The cells were cultivated in two Generation-4-MOCs as well as in 96-wellplates working as reference system. The systems were stained with
CellTracker™ Red and cultivated at 37°C and 5% CO2 saturation. After some
hours of resting MOCs and MWPs were treated with 10% respectively 20%
DMSO. Afterwards the fluorescence activity was measured in 20 minute
intervals in order to detect potential cell death. The cells can be detected
by the monitoring unit of the robot. A 20 μmol/L CellTracker™ Red staining
provides a sufficient signal which can be monitored over time. The
treatment with 10% DMSO shows a fluorescence signal decline of more
than 50% and the following recovery of them.
Summary: This project shows the successful development of a robotic
platform to handle multi-organ-chips. Maintenance as well as user specific
protocols, for example toxicity testing, can be accomplished with a
minimum amount of labor time. The MOCs in combination with the robotic
platform offer the plug-and-play solution to generate substance interaction
data on a Lab-on-Chip system.
Figure 1(abstract P27) A: Screening of media components and different concentrations thereof with regard to transfection efficiency.
B: Transfection efficiency in conditioned media as well as in fractions from SEC.
Page 45 of 151
Table 1(abstract P27) Proteins identified with at least 2 peptides and a false discovery rate of 0% in up to
5 biological replicates by MALDI-TOF/TOF-MS in the high molecular weight fractions 1 and 2
High molecular weight fraction 1
High molecular weight fraction 2
Group
Protein name
# Peptides
Group
Protein name
Histones
Histone H2A
3
Histones
Histone H2A
4
Histone H2B
Histone H4
2
2
Histone H2B
Histone H4
3
4
Histone H3
3
Tubulin alpha
2
Cytoskeleton
Tubulin beta
2
Actin
3
Galectin-3-binding protein
6
Heat shock 70 kDa protein 1A/1B
5
Other
Cytoskeleton
Extracellular (matrix)
Introduction: The Quality by Design (QbD) approach shows significant
benefit in classical pharmaceutical industry and is now on the cusp to a
stronger influence on biopharmaceutical applications. Monitoring the
critical process parameters (CPP) applying process analytical technologies
(PAT) during biotechnological cell cultivations is of high importance in
order to maintain a high efficiency and quality of a bioprocess. For
parameters like glucose concentration, total cell count (TCC) or viability a
robust online prediction is in many applications not yet possible. This gap
can be closed with the help of NIR spectroscopy (NIRS), which provides
quantitative prediction of single analytes in real-time.
For accurate process control based on NIR spectroscopy, special care has to
be taken while building the calibration model [1,2]. In cell cultivation almost
all analytes are confounded and show large correlation coefficients.
Therefore, partial least square (PLS) models are not able to discriminate
between the signals of the different analytes. Especially, analytes like
glucose or glutamine which are strongly confounded with cell growth need
to be evaluated carefully as cell growth is the analyte causing the largest
changes in NIR spectra throughout a cultivation run. Spiking experiments
Tubulin alpha
2
Tubulin beta
3
Actin
6
Fibrillin-2
Fibronectin
2
5
Clusterin
3
Cochlin
2
Galectin-3-binding protein
10
Heat shock 70 kDa protein 1A/1B
13
Golgi membrane protein 1
6
Alpha-enolase
2
Other
P29
NIR-spectroscopy for bioprocess monitoring & control
Marko Sandor1, Ferdinand Rüdinger1, Dörte Solle1, Roland Bienert2,
Christian Grimm2, Sven Groß2*, Thomas Scheper1
1
Institut für Technische Chemie, Leibniz Universität Hannover, Callinstraße 5,
D-30167 Hannover, Germany; 2Sartorius Stedim Biotech GmbH, AugustSpindler-Straße 11, D-37079 Göttingen, Germany
# Peptides
are the most efficient way in order to break correlations between critical
analytes like glucose and other nutrients or TCC. This strategy should be
followed in order to build robust calibration models without correlations
[3,4]. Another very critical issue occurring in cell cultivation are batch-tobatch variations. As it is recommended in good modeling practice [5], for
robust models it is crucial to use several complete batches for validation
which are not part of the calibration set rather than cross validation [6].
Materials and methods: CHO-K01 cells (Cell Culture Technology,
University of Bielefeld), were cultivated in a BIOSTAT® C plus bioreactor
(Sartorius Stedim Biotech) with a 7.5 L working volume. In total, eight
cultivation runs were performed, each lasting six days on average. Sampling
was performed every three to six hours, and reference analytics of the
critical process parameters, such as TCC, viability (TC10 automated cell
counter, Bio-Rad), glucose, lactate, glutamine, etc. (YSI 2700, YSI Inc.) were
determined in the laboratory.
Results: Table 1 gives an overview of the models and the accuracy of
predictions for several analytes investigated. An excellent model could be
obtained for total cell count (TCC). Viability can be predicted and glucose
can be predicted as well. Correlations from glucose with other analytes have
been reduced by spiking of glucose in one cultivation. Predictions for low
concentration analytes like glutamine seem to be also predictable at the first
glance, but are strongly related to correlations with other parameters, such
as TCC. Models based on correlations are not recommended for process
control since they show a lack of sensitivity to the analyte of interest and
robustness. Whether a model is based on correlations can be easily
demonstrated by spiking experiments. Glutamine, for example, was spiked
in one cultivation at the end of the batch-phase up to 1 g/L. The glutamine
model was not able to predict the spiking, which proves the strong
correlation to other analytes. Glutamine cannot be measured directly in this
Table 1(abstract P29) NIR results for calibration models and validation by external data sets
Analyte
Range
Reg. maths
Factors
SEC
SEP
TCC (·106 cell/mL)
0-16
No. Cal. No. Val. Batches (Samples)
5 (185)
3 (118)
None
2
1.07
0.48
Viability (%)
10-100
5 (193)
3 (110)
None
4
4.2
4.2
Glucose (g/L)
0-9
5 (198)
3 (105)
None
4
1.2
0.48
Glutamine (g/L)
0-1.1
5 (189)
3 (114)
SNV
2
0.16
correlation
(TCC: total cell count; No.Cal.: Number of batches (samples) of the calibration set. No.Val.: Number of batches (samples) of the validation set; SNV: standard
normal variate; SEC: standard error of calibration; SEP: standard error of prediction)
concentration range using NIRS. However, qualitative models on overall
nutrient consumption or metabolite accumulation yield promising results
(data not shown).
Additional benefit is generated via MSPC of NIR data. Batch trajectories have
been generated from major variances of the NIR spectra. The Score values
have been used and plotted over time using SIMCA 13. Figure 1 (top) shows
the BEM build for the first principal component of the NIR spectra. Three
batches contribute to this model, which showed optimal cell growth.
All batches show almost an identical profile which indicates a high
batch-to-batch reproducibility, both in terms of process operation and spectra
acquisition. The mean trajectory (green dashed line) is called golden batch
and represent the profile of optimal performance. Moreover, process limits
(red dashed lines) can be defined, which are calculated by three times the
standard deviation of the batches involved in the model. Other batches can
be compared to the model. As long as the trajectory of a new batch stays
within the limits, it can be assigned as statistically identical to the golden
batch. A relevant process deviation will be notified if the trajectory is outside
of the limits. Significant process deviations are shown in Figure 1 (middle).
The trajectory of batch 3 (blue line) surpasses the process limits after 30 h.
The reason for this was a bacterial contamination during the process. In batch
2 (black line) a different aeration strategy was applied which resulted in a
lower cell growth rate. In Figure 1 (bottom) a BEM based on the third
principal component is shown. The model (dashed lines) is again generated
from high performance batches as seen in the model above.
Summary: The Ingold port adaption of a free beam NIR spectrometer is
tailored for optimal bioprocess monitoring and control. The device shows
an excellent signal to noise ratio dedicated to a large free aperture and
therefore a large sample volume. This can be seen particularly in the
batch trajectories which show a high reproducibility. The robust and
compact design withstands rough process environments as well as SIP/
CIP cycles.
Robust free beam NIR process analyzers are indispensable tools within
the PAT/QbD framework for real-time process monitoring and control.
They enable multiparametric, non-invasive measurements of analyte
concentrations and process trajectories. Free beam NIR spectrometers are
an ideal tool to define golden batches and process borders in the sense
of QbD. Moreover, sophisticated data analysis both quantitative and
MSPC yields directly to a far better process understanding. Information
can be provided online in easy to interpret graphs which allow the
operator to make fast and knowledge-based decisions. This finally leads
to higher stability in process operation, better performance and less
failed batches.
References
1. Cervera A, Petersen N: Application of near- infrared spectroscopy for
monitoring and control of cell culture and fermentation. Biotechnology
Progress 2009, 25:1561-1581.
2. Rodrigues L, Vieira L, Cardoso J P, Menezes JC: The use of NIR as a multiparametric in situ monitoring technique in filamentous fermentation
systems. Talanta 2008, 75:1356-1361.
3. Arnold SA, Crowley J, Woods N, Harvey LM, McNeil B: In-situ near infrared
spectroscopy to monitor key analytes in mammalian cell cultivation.
Biotechnology and bioengineering 2003, 84:13-19.
4. Vaidyanathan S, Macaloney G, Harvey LM, McNeil B: Assessment of the
Structure and Predictive Ability of Models Developed for Monitoring Key
Analytes in a Submerged Fungal Bioprocess Using Near-Infrared
Spectroscopy. Applied Spectroscopy 2001, 55:444-453.
5. Henriques JG, Buziol S, Stocker E, Voogd A, Menezes JC: Monitoring
Mammalian Cell Cultivations for Monoclonal Antibody Production Using
Near-Infrared Spectroscopy. Optical Sensor Systems in Biotechnology Place:
Springer, Berlin, Heidelberg: Rao G 2010, 2010:29-72.
6. Hakemeyer C, Strauss U, Werz S, Jose GE, Folque F, Menezes JC: At-line NIR
spectroscopy as effective PAT monitoring technique in Mab cultivations
during process development and manufacturing. Talanta 2012, 90:12-21.
P30
Case study: biosimilar anti TNFalpha (Adalimumab) analysis of Fc
effector functions
Carsten Lindemann*, Silke Mayer, Miriam Engel, Petra Schroeder
EUFETS GmbH, 55743 Idar-Oberstein, Germany
Page 46 of 151
Background: For the development of biosimilar monoclonal antibodies
or related substances containing the IgG Fc part it is mandatory to fully
compare immunological properties between originator and biosimilar in a
“comparability exercise” [1]. The important Fc associated functions
to mediate antibody dependent cellular cytotoxicity (ADCC) and
complement dependent cytotoxicity (CDC) need to be characterized
using both the active substance of the biosimilar and the comparator
[2,3]. For testing anti TNFalpha antibodies target cells with stable
expression of membrane TNFalpha (mTNFalpha) is required. Further
prerequisites are test systems facilitating analysis with high precision and
accuracy.
Materials and methods: We generated a human transgenic NK-cell line
(YTE756.V#26, effector cell line) with stable expression of Fc gammareceptor IIIA (CD16, high affinity variant, valine at position 159) and stable
functional characteristics to replace primary effector cells in ADCC assays.
Target cells for ADCC and CDC assays were genetically modified for
stable expression of mTNFalpha without the capability to release soluble
TNFalpha. Both target and effector cells were generated using retroviral
vectors to facilitate high and stable transgene expression. Vector particles
were generated by transient transfection of 293T cells with plasmids
encoding gag, pol/env and an expression plasmid containing the
packaging region and the sequences of promotor and the transgenes, i.e.
selection marker and gene of interest. Multiple gene expression was
achieved either by using a bicistronic design enabling transcription from
two promotor sequences, or by using an internal ribosomal entry site.
Transduction of cells in log phase was followed by a selection of
transduced cells and clonal selection by limiting dilution. Cell clones were
expanded for primary and secondary cell banks and further characterised
with regard to transgene expression and functional characteristics.
The more complex ADCC assays were developed employing design of
experiments (DoE). To show assay suitability goodness of fit, ratio of
upper to lower asymptote, slope and parallelism was determined for each
dose-response curve compared to a standard. Hypo- and hyperpotent
samples (50%, 100%, 150% and 200% potency) of Adalimumab and
Infliximab were analysed in both ADCC and CDC assays to determine
accuracy and linearity of each method.
For ADCC assays HT1080 mTNFalpha+ cells were seeded into 96-well plates
18 - 20 h before start of the assay. Anti TNFalpha dilution series were
performed in separate plates and transferred into the assay plate together
with YTE756.V#26 effector cells at an E:T ratio of 10:1 using the effectors
cell medium as assay medium. After an incubation time of 17 ± 1 h
effector cells were washed from the adherent target cells. Quantification of
residual target cells was performed by staining with XTT and photometric
measurement. Each assay consists of standard (the biosimilar) and sample
(originator) concentrations ranging from 1000 to 4.69 ng/ml in duplicates.
Comparison of dose-response curves in a 4 PL model and determination of
potency was performed using PLA software (Stegmann Systems).
For CDC assays CHO mTNFalpha+ cells were seeded into 96 well plates
20 - 25 h before start of the assay. Antibody dilution series were transferred
into the assay plate using cell culture medium containing 20% native
human serum pool. After an incubation time of 2 ± 0.5 h medium nonadherent cells were removed by washing the MTP. Quantification of residual
cells was performed as described for ADCC assays. Each assay consists of
standard and sample (originator or accuracy item) concentrations ranging
from 5000 to 130 ng/ml in duplicates. Comparison of dose-response curves
in a 4 PL model and determination of the relative potency was performed
using PLA software.
Originator batches and the biosimilar were analysed by monosaccharide
and sialic acid analysis, N-glycan profiling by MALDI-MS (permethylated
glycans) and by HILIC-HPLC. N-Glycosylation site determination was done
by MALDI and/or LC-ESI-MS and MS/MS (1 digestion).
Results: Both ADCC and CDC assays show good accuracy (relative accuracy
< 15%) and linearity (r squared < 0.97). Precision of CDC assays (CV < 8%)
was better than that of the more complex ADCC assays (< 15%). Due to the
distinctly lower actitivity of Adalimumab compared to that of Infliximab we
evaluated the most influential factor for gaining a high asymptote ratio by
DoE. The incubation time was shown to be most important compared to
other factors as effector to target cell ratio and fetal bovine serum content.
We analysed different batches of originators and a biosimilar candidate
molecule for functional variability in ADCC and CDC assays (Table 1). In CDC
assays (n = 3) the three originator batches of Adalimumab showed
comparable potency in between batches and compared to the biosimilar.
Page 47 of 151
Figure 1(abstract P29) Batch evolution models (BEM) based on NIR spectra. (Top): Batch trajectories from three batches based on the first principal
component of NIR spectra. The golden batch trajectory is shown in green (mean value of all contributing batches) and the process limits are shown in
red (three times the standard deviation of the three contributing batches). (Middle): Compared to the BEM other batches show deviations which can be
assigned to contaminations (blue line) or low cell growth rate (black line). (Bottom): Batch trajectories from three batches based on the third principal
component of NIR spectra. Compared to the BEM other batches show deviations like contaminations (blue and violet line) or early glucose limitation
which led to an early drop of viability (black, yellow and violet line).
Table 1(abstract P30) Relative potency (compared to
biosimilar) of originators in ADCC and CDC assays
Assay
Originator
Relative potency
ADCC
2
140%
9.9%
3
141%
11.1%
4
135%
16.8%
2
92%
15.1%
3
89%
10.2%
4
89%
16.7%
CDC
CV
A higher variability of the originators was found in ADCC assays (n = 6)
besides the potency was higher than that of the Adalimumab biosimilar.
Major differences between originators with regard to glycosylation were not
found. The biosimilar showed a high galactose content and consequently a
higher percentage of galactosylated glycan structures than the originators.
Conclusions: In summary we show the suitability of an ADCC potency
assay for investigation of functional comparability of Adalimumab and
biosimilar candidate substances. Differences between biosimilar and
originators in glycosylation might contribute to differences found in the
ADCC potency assay but not with the CDC potency assay.
References
1. Guideline in similar biological medicinal products containing
monoclonal antibodies. , EMA/HCMP/BMWP/403543/2010.
2. Guideline on development, production, characterisation and
specifications for mnoclonal antibodies and related products. , EMEA/
CHMP/BWP/157653/2007.
3. ICHQ6B Test procedures and acceptance criteria for biotechnological/
biological products. , CMP/ICH/365/96.
P31
Cellular tools for biosimilar mAb analysis
Carsten Lindemann*, Silke Mayer, Miriam Engel, Petra Schroeder
EUFETS GmbH, 55743 Idar-Oberstein, Germany
Background: For the development of biosimilar monoclonal antibodies
(mAb) or related substances containing the IgG Fc part it is mandatory to
fully compare immunological properties between originator and biosimilar
in a “comparability exercise” [1]. The most complex Fc associated function
to mediate antibody dependent cellular cytotoxicity (ADCC) needs to be
characterized using the active substance of the biosimilar and the
comparator. From a regulatory point of view potency assays should reflect
the proposed mode of action but in vitro ADCC assays are considered
difficult to validate due to the variability of the primary effector cells [2,3].
The requirement to test for ADCC with high precision and accuracy is
challenging. Design of cell lines to replace primary cells for effector or
target cells is a solution to provide tools for standardized and extensive
biosimilar testing.
Materials and methods: Retroviral vectors were used to generate cell
lines with stable genetic modification. Vector particles were generated by
transient transfection of 293T cells with plasmids encoding gag, pol/env
and an expression plasmid containing the packaging region and the
sequences of promotor and the transgenes, i.e. selection marker and gene
of interest. Multiple gene expression was achieved either by using a
Page 48 of 151
bicistronic design enabling transcription from two promotor sequences, or
by using an internal ribosomal entry site. Transduction of cells in log phase
was followed by a selection of transduced cells and clonal selection by
limiting dilution. Cell clones were expanded for primary and secondary cell
banks and further characterised with regard to transgene expression and
functional characteristics. We developed a human transgenic NK-cell line
(YTE756.V#26, effector cell line) with stable expression of Fc gammareceptor IIIA (CD16, high affinity variant, valine at position 159) and stable
functional characteristics. Target cell lines were generated similarly using
different expression plasmid constructs.
ADCC assays were developed by using design of experiments (DoE) to
determine experimental factors of importance for assay suitability. To show
assay suitability goodness of fit, the amplitude of sigmoid curve, slope and
parallelism was determined for each sample compared to a standard. Hypoand hyperpotent samples (50%, 100%, 150% and 200% potency) of
Rituximab, Trastuzumab, Adalimumab and Infliximab were analysed to
determine accuracy and linearity of each method. Optimisation of each
assay requires determining the relative importance of factors including E:T
ratio, incubation time, target cell density and pre-assay schedules for target
and effector cells. Analysis of critical factor interaction was performed using
Minitab software. A list of established ADCC assays is shown in Table 1.
CD16 expression was analyzed and quantified by flow cytometry. Cells
were stained using anti-CD16 PE-conjugated antibodies. PE-fluorescence
was correlated to number of PE-molecules per cell using BD Quantibrite
beads. Primary NK-cells were isolated using Dynal beads (purity > 95%)
from 3 healthy donors and used immediately after isolation.
Results: In order to prove genetic stability of the transgenic NK cell line
CD16 expression was analysed by flow cytometry for up to 22 passages.
More than 95% of cells were CD16 positive, viability of cells was >90%.
CD16 expression level was stable (19.000 - 28.000 CD16 molecules/cell).
Functional stability of the effector cell line was shown for more than 30
passages. This was shown by a stable EC50 value obtained for a reference
antibody in the Trastuzumab ADCC assay.
The effector cell line was compared with primary NK-cells (purity > 95%)
from 3 donors in a Trastuzumab ADCC assay. The data show high donor
variability, mostly incomplete dose-response curves and a killing activity
with a low dynamic range (baseline to top ratio: 3). For primary NK-cells
the amplitude of the dose-response curve is dependent on both donor
variability and the type of target cell. Using the effector cell line this is
dependent on the target cell only. Assay variability was strongly reduced
and sample throughput could strongly be increased by using the effector
cell line in comparison to primary NK-cells. Optimization of each assay by
DoE required determining the relative importance of various factors
including effector to target cell ratio, incubation time, target cell density
and pre-assay culture schedules for target and effector cells. Accuracy of
these ADCC assays could be shown in between a range of 50% to 200%
potency. Linearity was shown by a high coefficient of determination
(>0.97) and other statistical methods. Inter-assay precision of all ADCC
assays was <20%.
ADCC assays for Infliximab and Adalimumab require a membraneTNFalpha
expressing target cell line (Table 1). In this fully designed ADCC test system
both the transgenic NK-effector cell line and the target cell line were
generated by genetic modification. In the presented case, the test system
consists of HT1080 target cells modified to express membraneTNFalpha
and the transgenic NK-cell line.
Accuracy and linearity of the Infliximab ADCC assay was analysed by
measuring items containing varying theoretical antibody concentrations to
simulate hypo-potent and hyper-potent samples. Linearity was shown by a
high coefficient of determination or by testing if the 2nd order polynomial
model is non-significant (0 is included in the 95% confidential interval of B2).
Table 1(abstract P31) ADCC assay systems
Antibody
Target cell line
Read-out
Selection of cell line
Trastuzumab
HER-2+ SK-OV-3 cells
metabolic activity of residual target cells
selected from various breast cancer cell lines
Rituximab
CD20+ Granta-519 cells
Calcein release by target cells
selected from various hematopoietic tumor cell lines
Cetuximab
EGFR+ SK-OV-3 cells
selected from various breast cancer cell lines
Infliximab
membraneTNFalpha+ 293T cells
Calcein release by target cells
generated by genetic modification
Adalimumab
membraneTNFalpha+ HT1080 cells
Page 49 of 151
Figure 1(abstract P31) Analysis of accuracy and linearity of the Infliximab ADCC assay. Data shown are sample dose response curves (left)
determined by 4PL analysis and mean rel. potency +/- SD (dot, n = 3) compared to the standard (right).
For precision analysis the relative potency of a sample was repeatedly
analyzed on 4 days with 3 assays per day.
Conclusions: Altogether these data show the feasibility of providing
suitable tools for validation and routine testing of various mAbs in ADCC
potency assays scalable to the analytical needs of biosimilar testing.
References
1. Guideline in similar biological medicinal products containing
monoclonal antibodies. EMA/HCMP/BMWP/403543/2010.
2. Guideline on development, production, characterisation and
specifications for mnoclonal antibodies and related products.
EMEA/CHMP/BWP/157653/2007.
3. ICHQ6B Test procedures and acceptance criteria for biotechnological/
biological products. CMP/ICH/365/96.
P32
The successful transfer of a modern CHO fed-batch process to different
single-use bioreactors
Sebastian Ruhl*, Ute Husemann, Elke Jurkiewicz, Thomas Dreher,
Gerhard Greller
Sartorius Stedim Biotech GmbH, D-37079 Göttingen, Germany
Introduction: Nowadays, single-use bioreactors are widely accepted in
pharmaceutical industry. This is based on shorter batch to batch times,
reduced cleaning effort and a significantly lower risk of cross contaminations
[1,2]. One large field of the application of single-use bioreactors is the seed
train cultivation of mammalian cells [1]. The focus is further extended to
perform state of the art fed-batch production processes in such bioreactors.
In this study an industrial proven CHO fed-batch process is established in
different single-use and reusable bioreactors.
Materials and methods: Cell line, medium and process strategy: For
the fed-batch process the cell line CHO DG44 (Cellca, Germany) secreting
human IgG1 was used. SMD5 medium (Cellca, Germany) was prepared for
the seed train and PM5 medium (Cellca, Germany) as a basal medium for
the fed-batch culture. The feeding procedure comprised the addition of
three different feeds (feed medium A, feed medium B and concentrated
glucose solution). After a 3 day batch phase, the 14 day fed-batch phase
started. The automated discontinuous bolus feed of feed media A and B was
supplemented by the glucose feed solution to keep the glucose
concentration above 3 g/L.
Bioreactors: The process was initially developed in a 5 L stirred glass
bioreactor therefore the BIOSTAT® B with a UniVessel® 5 L was considered as
a reference. Single-use bioreactors involved in this study were the stirred
tank reactor BIOSTAT® STR 50 L with a CultiBag STR 50 L and the rocking
motion bioreactor BIOSTAT® RM 50 optical with CultiBag RM 50 L.
Process transfer: The used bioreactors were characterized in terms of
process engineering [3]. Due to different agitation and gassing principles
present in the BIOSTAT® STR and RM the k L a and mixing times were
chosen as a scale-up criteria. The process conditions were specified to
meet a kLa-value of > 7 h-1 [4] and a mixing time of < 60 s [5].
Sampling procedure: A daily sampling procedure was performed before
the bolus feed. Metabolites like glucose and lactate were analyzed by the
Radiometer ABL800 basic (Radiometer, Germany). Viable cell density (VCD)
and viability were determined by the Cedex HiRes (Roche Diagnostics,
Germany).
Results: The process transfer is considered successful, if comparable
cellular proliferation activities and product titers are obtained.
The initial viable cell density in all systems was 0.3 - 0.4 × 106 cells/mL. At the
start of the fed-batch phase a viable cell density of 4 - 5 × 106 cells/mL could
be achieved. As seen in Figure 1A the viable cell density peak of 27 - 28 ×
106 cells/mL was reached in all systems after 8 - 9 days. At the point of
harvest after 17 days viable cell densities between 12 - 17 × 106 cells/mL
and viabilities of 57 - 82% were reached. The cell broth was harvested for
further downstream operations.
A well-controlled pH value is essential for a reproducible cell proliferation. As
seen in Figure 1B exemplarily shown for the BIOSTAT® STR 50 L small peaks
occurred due to the daily addition of feed medium B (pH 11). The offline
measured pCO2 trend shows a constant decrease during the batch phase
followed by an increase during the fed-batch phase with a maximum value
of 135 mmHg.
Page 50 of 151
Figure 1(abstract P32) Process trends.
Shown in Figure 1D glucose concentration could be kept above 3 g/L in
the fed-batch phase. Lactate had a peak accumulation of 0.9 g/L at the
end of the batch phase and remained at low value afterwards.
The product yield in all cultivations was comparable to the reference
systems and exceeded 8 g/L IgG (Figure 1C).
Conclusion: The high cell density CHO fed-batch process with industry
relevant titers was successfully transfer from a reference bioreactor to a
variety of single-use bioreactor systems.
The kL a and mixing time were suitable as a scale-up criteria for systems
with different agitation principles.
Acknowledgements: My thanks go to the complete Upstream
Technology-team at Sartorius Stedim Biotech Göttingen.
References
1. Brecht R: Disposable Bioreactors: Maturation into Pharmaceutical
Glycoprotein Manufacturing. Adv Biochem Engin/Biotechnol 2009, 115:1-31.
2. Eibl D, Peuker T, Eibl R: Single-use equipment in biopharmaceutical
manufacture: a brief introduction. Wiley, Hoboken: Eibl R., Eibl D 2010,
Single-use technology in biopharmaceutical manufacture.
3. Löffelholz C, Husemann U, Greller G, Meusel W, Kauling J, Ay P, Kraume M,
Eibl R, Eibl D: Bioengineering Parameters for Single-Use Bioreactors:
Table 1(abstract P32) Bioreactor Setup and Process Parameters
BIOSTAT®
RM 50 L
STR 50 L
B5L
Gassing principle
Overlay
Ring Sparger
Sensors
Single-use optical patches
Working volume [L]
25
50
5
Initial volume [L]
13
26
2.6
pH set point
7.15
Reusable probes
pH control
CO2 gassing
pO2 set point
60% sat.
pO2 control
Multi stage cascade comprising N2, Air, O2 - gassing
Agitation [rpm]
30 @ 10° rocking angle
150
400
4.
5.
Overview and Evaluation of Suitable Methods. Chem Ing Tech 2013,
85:40-56.
Ruhl S, Dreher T, Husemann U, Greller G: Design space definition for a
stirred single-use bioreactor family from 50 to 2000 L scale. Poster ESACT
Lílle 2013.
Lara AR, Galindo E, Ramírez OT, Palomares LA: Living with Heterogeneities
in Bioreactors. Mol Biotechnol 2006, 34:355-381.
P33
Differences in the production of hyperglycosylated IFN alpha in CHO
and HEK 293 cells
Agustina Gugliotta, Marcos Oggero Eberhardt, Marina Etcheverrigaray,
Ricardo Kratje, Natalia Ceaglio*
Cell Culture Laboratory, School of Biochemistry and Biological Sciences,
Universidad Nacional del Litoral. Ciudad Universitaria - C.C. 242 - (S3000ZAA)
Santa Fe, Provincia de Santa Fe, Argentina
Background: IFN alpha is an important cytokine of the immune system. It
has the ability to interfere with virus replication exerting antiviral activity.
Moreover, it displays antiproliferative activity and can profoundly modulate
the immune response. IFN4N (or hyperglycosylated IFN alpha) is an IFNalpha2b mutein developed in our laboratory using glycoengineering
strategies. This molecule contains 4 potential N-glycosylation sites together
with the natural O-glycosylation site in Thr106 [1]. The resulting N- and
O-glycosylated protein shows higher apparent molecular mass and longer
plasmatic half-life compared to the non-glycosylated IFN-alpha produced in
bacterial systems and used for clinical applications. As a consequence, the
correct glycosylation of our modified cytokine is very important for its
in vivo activity. For this reason, it is of great relevance the evaluation of
different mammalian host cells for its production. While hamster-derived
CHO cells are widely used for large scale production of recombinant
therapeutic glycoproteins, human HEK cells are a promising system because
they are easy to grow and transfect [2]. In this work, we performed a
comparison between both production systems in terms of cell growth,
culture parameters and specific productivity of hyperglycosylated IFN alpha.
Results: Lentiviral vectors containing the sequence of IFN4N were
assembled and employed for the transduction of CHO-K1 and HEK 293T
cells. The recombinant cell lines were subjected to a process of selective
pressure using increasing concentrations of puromycin. The CHO-IFN4N
and HEK-IFN4N producing cell lines resistant to the highest concentration
of puromycin showed the highest productivity of IFN4N. In particular, the
CHO-IFN4N cell line was resistant to 350 μg/ml of puromycin and it
showed a specific productivity of 817 ± 134 ng.10 6 cell-1 .day -1 , which
represents an 8-fold increment compared to the parental line. The
Page 51 of 151
HEK-IFN4N cell line was resistant to 200 ug/ml of puromycin and
showed a 15-fold increment in the specific productivity compared to the
parental line, reaching a value of 1,490 ± 332 ng.106cell-1.day-1. In both
cases, complete culture death was achieved at higher puromycin
concentrations. The specific productivity of IFN4N of HEK 293T cell line
duplicated the value obtained for the CHO-K1 cell line, and it was
achieved at a lower concentration of puromycin, making the selection
process shorter (Figure 1).
Both cell lines were cloned using the limiting dilution method, and after
15 days of culture more than 100 clones were screened. To achieve the
characterization and study both cell lines as recombinant protein expression
hosts, the 6 best producer clones were isolated and amplified. The adherent
clones were grown for 7 days in order to construct their growth curves. Cell
density and viability were determined every 24 h by trypan-blue exclusion
method and the culture supernatant was collected to determine IFN4N and
metabolites concentration. The IFN4N production was assessed employing a
sandwich ELISA assay developed in our laboratory. Glucose consumption
and lactate production were evaluated using specific Reflectoquant® test
strips (Merck Millipore) in a RQflex® Reflectometer (Merck Millipore). Levels
of amonium in the culture supernatant were determined by the Berthelot
reaction.
As shown in Table 1, the average specific growth rates of CHO and HEK
clones were similar. However, CHO clones reached higher maximum cell
densities (between 7.105-1.5.106 cell.ml-1) than HEK clones (between 6.1059.105 cell.ml-1), probably because of space limitation and higher glucose
consumption, since average qgluc of HEK clones was higher (see Table 1). No
differences were observed between lactate and ammonium production of
both groups of clones. In contrast, specific production rate of IFN4N was
higher for the clones derived from the human cell line. Moreover, higher
average IFN4N cumulative production for HEK clones was achieved after
7 days of culture (3,494 versus 5,961 ng.ml-1).
Conclusion: CHO and HEK cells were genetically modified to produce
IFN4N by using lentiviruses as a tool for the IFN4N gene transfer. Since both
cell lines expressed high levels of IFN4N, 6 clones were amplified for an
intensive characterization. Culture and production properties of both groups
of clones were very different. On the one hand, CHO clones were easy to
maintain in culture for a long period of time, reaching higher cell densities
than HEK clones. On the other hand, the best specific productivity of IFN4N
was achieved employing HEK cells. The behavior of CHO and HEK cells at
large scale production should be analyzed in order to select the proper
system for the cytokine’s production.
Wide differences have been observed between the glycosylation profile
of the same recombinant therapeutic protein produced in CHO and HEK
systems [2]. Considering that glycosylation affects protein bioactivity,
stability, pharmacokinetics and immunogenicity, it would be very
important to evaluate the characteristics of the IFN4N produced in both
hosts to determine their efficacy as therapeutic agents.
Figure 1(abstract P33) Comparison between the specific productivity of the CHO-IFN4N (a) and HEK-IFN4N (b) producing cell lines as a function of
puromycin concentration.
Page 52 of 151
Table 1(abstract P33) Determination of the specific cell growth rate, specific production rate of lactate, ammonium
and IFN4N, and specific consumption rate of glucose of CHO-K1 (a) and HEK 293T (b) clones
a)
Clones
μ(h-1)
P4D3
0,0182
±
0,002
79
±
8
36
±
5
40
±
5
0,027
±
0,007
P1E9
0,0196
±
0,002
35
±
4
24
±
4
45
±
5
0,027
±
0,003
P2A9
P1B6
0,0249
0,0240
±
±
0,001
0,002
41
19
±
±
4
3
30
26
±
±
2
5
31
49
±
±
1
5
0,014
0,013
±
±
0,004
0,005
P1B7
0,0191
±
0,002
41
±
3
32
±
4
35
±
2
0,017
±
0,006
P1B8
0,0277
±
0,002
42
±
3
21
±
3
34
±
2
0,015
±
0,004
qgluc
(μg.10-6cell.h-1)
qIFN
(ng.10-6cell.h-1)
qlac
(μg.10-6cell.h-1)
qamon
(nmol.10-6cell.h-1)
b)
Clones
μ(h-1)
P2A5
0,020
±
0,001
129
±
10
56
±
6
37
±
4
0,014
±
P2C7
0,015
±
0,002
122
±
13
62
±
11
38
±
3
0,009
±
0,003
P2G11
0,017
±
0,002
82
±
6
47
±
9
31
±
3
0,008
±
0,002
P3B7
P3H8
0,016
0,027
±
±
0,002
0,001
99
82
±
±
8
11
55
46
±
±
8
6
31
34
±
±
3
3
0,008
0,008
±
±
0,003
0,001
P4B4
0,017
±
0,002
63
±
5
61
±
15
32
±
3
0,009
±
0,001
qgluc
(μg.10-6cell.h-1)
qIFN
(ng.10-6cell.h-1)
References
1. Ceaglio N, Etcheverrigaray M, Conradt HS, Grammel N, Kratje R, Oggero M:
Highly glycosylated human alpha interferon: An insight into a new
therapeutic candidate. J Biotechnol 2010, 146:74-83.
2. Croset A, Delafosse L, Gaudry JP, Arod C, Gleza L, Losbergera C, Beguea C,
Krstanovicb A, Robertb F, Vilboisa F, Chevaleta L, Antonssona B: Differences
in the glycosylation of recombinant proteins expressed in HEK and CHO
cells. J Biotechnol 2012, 161:336-348.
P34
Developing an upstream process for a monoclonal antibody including
medium optimization
Sevim Duvar*, Volker Hecht, Juliane Finger, Matthias Gullans, Holger Ziehr
Pharmaceutical Biotechnology, Fraunhofer Institute for Toxicology and
Experimental Medicine (ITEM), Braunschweig, Germany
Background: Monoclonal antibodies have been established as important
therapeutics in cancer and autoimmune diseases. Hence, there is a
growing interest in the production of monoclonal antibodies in
pharmaceutical industry. In order to reduce timelines and costs of
production the process and medium development is of central importance.
Perfusion processes are well known to achieve higher productivities
compared with batch or fed batch. Major advantages of perfusion culture
are that you can keep optimal culture medium conditions for the cells and
realize higher performance. However, obtaining high performance requires
the combination of process optimization as well as a well-balanced
concentrated culture medium. Selecting the best system also depends on
the shear sensitivity of the cell line, the robustness of the process and the
scale used.
In upstream processing batch, fed batch and perfusion mode were applied.
Design of Experiments (DoE) was used to develop a feed protocol for fed
batch cultivations. In shake flask experiments the influence of temperature,
osmolality, and pH to improve antibody yield was examined.
In a further study we compared different cell retention systems with regard
to achieve high viable cell densities in a short time like required for a seed
train application. The best results were achieved with the ATF system with
cell densities up to 1.3 × 10 8 cells/ml and 4 fold improved product
concentration compared to batch culture.
Materials and methods: A CHO cell line producing the antibody G8.8
against Epithelial Cell Adhesion Molecule (Ep-CAM) was employed for the
qlac
(μg.10-6cell.h-1)
qamon
(nmol.10-6cell.h-1)
0,003
experiments performed in this study. The fermenters were Sartorius BBI
Twin-System (2- and 5 L culture volume). We compared five different
retention systems: SpinFilter (Sartorius BBI Systems), Cell Settler
(Biotechnology Solutions), Centritech Lab III (Pneumatic Scale), Biosep
(Applikon) and ATF (Alternate Tangential Flow; Refine Technology). The cell
count was performed with CEDEX cell counter (Roche Diagnostics). The
monoclonal antibody was quantified with HPLC-method using Protein Acolumn. Design of Experiments (DoE) was used to develop a feed protocol
for Perfusion cultivations. In shake flask experiments we examined the
influence of temperature, osmolality, and pH to improve antibody yield.
Results: Fed batch development in shake flasks with DoE: For the
development of fed batch in shake flasks we used D-optimal Design with
18 runs. The examined factors were: Feed volume, time of feed start, time of
temperature shift (33°C) and time of Osmolality shift (450 mOsmol/kg). The
response was maximum antibody titer. The results show that the optimal
feed volume is 15 ml/d. The time point for feeding start has almost no
influence. The temperature shift and osmolality shift have negative influence
(data not shown).
Comparison of cultivations with different retention systems: We
compared five different cell retention systems under same cultivation
conditions. The best results could be achieved with the ATF system with cell
densities up to 1.3 × 108 cells/ml. The next best retention systems were
the Centrifuge and the Cell Settler with cell densities reached up to 3 ×
107 cells/ml. Using BioSep and Spinfilter, cell densities up to 2 × 107 cells/ml
were obtained (data not shown). The Spin filter and BioSep showed break
through of cells at cell densities > 2 × 107 cells/ml. In contrast, the Cell
Settler had the advantage of simplicity and robustness and no moving parts.
The advantage of the centrifuge was the high flexibility concerning the
reactor-volume to be perfused. The Spinfilter and BioSep showed the lowest
performance.
Comparison of cultivations with ATF: In a study we compared ATF
cultivations with 0.2 μm membrane and with 50 kDa membrane. In
cultivations with the 0.2 μm membrane a maximum cell density with 6.4 ×
107 cells/ml could be achieved compared to a maximum cell density of 1.3 ×
108 cells/ml with the 50 kDa membrane as shown in Figure 1. The increased
cell densities resulted in a higher productivity compared to the other cell
retention systems. Furthermore, the ATF with 50 kDa retended not only the
cells but also the antibody within the reactor. Therefore, a higher volumetric
productivity could be achieved with the 50 kDa membrane. The maximum
titer in the reactor with the 50 kDa membrane was 4 fold higher compared
with the 0.2 μm membrane.
Viable cell densities (VCD) and product concentrations of the monoclonal
antibody (MAB) are shown.
Page 53 of 151
Figure 1(abstract P34) Comparison of cultivations with ATF 0.2 μm and 50 kDa membrane.
Conclusions: We have demonstrated that perfusion processes have a
higher productivity compared to batch or fed batch processes. In our
study the best retention system for perfusion culture was the ATF system
compared with SpinFilter, Cell Settler, Centritech Lab III and Biosep. With
the ATF system we realized cell densities up to 1.3 × 10 8 cells/ml and
4 fold improved product concentration compared to batch culture. Also,
the ATF with a 50 kDa membrane retended not only the cells but also the
antibody within the reactor. Therefore, a higher volumetric productivity
could be achieved with the 50 kDa membrane. In perfusion culture the
cells show constant specific productivity over the whole perfusion phase
which shows that the cells are well fed.
P35
Development and evaluation of a new, specially tailored CHO media
platform
Tim F Beckmann*, Christoph Heinrich, Heino Büntemeyer, Stefan Northoff
TeutoCell AG, Bielefeld, 33613, Germany
Background: Today’s biopharmaceutical industry is under increasing
pressure considering cost efficient development. Short timeframes rule
the progress starting from the generation of producer cell lines to the
establishment of a final production process. Hence, the timescale for
optimization of cell culture media is small, but on the other hand it
contains high potential for global process improvement. In this scope, our
specially tailored media development platform, which allows a fast and
reliable introduction of high-performance basis media and feeds,
establishes new perspectives for an efficient process development.
Materials and methods: For the design and development of TeutoCell’s
new media platform various cell lines and expression systems were
comprehensively analyzed and incorporated. The results gained from
cultivations and extensive analysis of culture supernatant and e.g. product
glycosylation were integrated in a cyclic development strategy, utilizing
theoretical and empirical formulation optimizations. Special applications
like single clone selection were integrated into our platform as well.
The cell lines used for the development of our media platform include CHODG44, CHO-GS and CHO-K1 clones. Cultivations were carried out in shaking
flasks as well as closed-loop controlled 0.5 - 2.0 L bioreactor systems in batch
und fed-batch mode using standard conditions. An industrially relevant,
protein-free and chemically defined medium was used as a reference.
Media development for single clone selection by limited dilution was
performed with different CHO suspension cells in microtiter plates (from
96- to 6-wells) up to shaking flaks. Analysis of single clone colonies was
done with a Cellscreen System.
Samples of a model antibody produced in commercially available CHO
reference medium and TeutoCell’s platform medium using two different
producer clones were desalted, denaturated and treated with PNGaseF.
Glycans were concentrated via solid-phase extraction and analyzed by
MALDI-TOF mass spectrometry. Signal-to-noise ratios of specific masses
were used for calculations of relative amounts.
Results: The performance of the platform medium was evaluated using a
set of eleven different CHO cell lines in comparison to an industrially
relevant, protein-free and chemically defined medium. For all tested cell
lines, the maximum viable cell density (vcd) as well as the integrated viable
cell density (ivcd) and the product titer were higher compared to the
reference. In numbers, the improvement in vcd ranged between a factor of
1.7 and 2.5, in ivcd between a factor of 1.2 and 4.2 and in product titer
between a factor of 1.4 and 2.7 in batch cultures. By this improvement viable
cell densities of up to 17.53·106 cells/mL and product titer of 1015 mg/L
were reached. An overview of these results is illustrated in Figure 1.
Furthermore, the potential influence of the utilized medium on product
glycosylation was examined. For this, antibody harvest from two different
clones cultivated in reference and platform medium was analyzed. The
results of relative quantification of glycan structures by mass spectrometry
showed highly comparable profiles for the reference and platform
medium. An overview of the glycoanalysis is given in Table 1.
As an additional application, the platform medium was successfully
utilized as a basis for a chemically defined cloning medium in limited
dilution experiments. For different cell lines single cell growth was
achieved and cells were effectively expanded from 96-well plate format
up to shaking flask cultures.
Conclusions: Within this work a chemically defined and animal-component
free media platform was successfully implemented, which supports high
performance growth and productivity without supplementation of proteins
or growth hormones. In addition, its streamlined formulation of less than
Page 54 of 151
50 components increases the design space for the efficient development of
custom formulations. The suitability as a platform medium was verified by
the successful cultivation of a wide range of cell lines including CHO-DG44,
CHO-GS and CHO-K1 clones and the feature of easy adaption from serum
containing and commercially available formulations. For all tested cell lines
stable high performance cultivations with high product yields were
achieved, with consistent glycosylation profiles. As a further field of
application, the platform medium provides the basis for single cell growth
following limited dilution.
Acknowledgements: Parts of this work were financially supported by the
German Federal Ministry of Education and Research - BMBF (#031A106).
Responsibility for the content lies with the author.
P36
Streamlined process development using the Micro24 Bioreactor system
Steve RC Warr*, John PJ Betts, Shahina Ahmad, Katy V Newell, Gary B Finka
Upstream Process Research, GlaxoSmithKline, Stevenage, SG1 2NY, UK
Introduction: The Pall Micro24 Bioreactor system is one of several
microbioreactor systems that have been commercialised in recent years
in response to the demand to reduce costs and shorten process
development time lines.
We have previously demonstrated that the Micro24 Bioreactor system can
be integrated successfully into the later stages of cell line screening
programmes and that the results correlate well with those from more
conventional methods [1]. Further process development for these
selected cell lines traditionally utilises bench top bioreactors to define
appropriate process conditions giving the desired process outcomes
Figure 1(abstract P35) Comparison of growth performance (A) and product titer (B) using the reference and platform medium. To illustrate the
improvement in relation to the reference medium, the mean of 5 producer- and the corresponding parental cell line were normalized to the results
obtained in the reference medium (C and D). The error bars show the deviation between the different cell lines. The development progress of the
platform medium is represented by one major interstage.
Page 55 of 151
Table 1(abstract P35) Comparison of the glycosylation pattern of a model antibody produced in two different cell
lines using the reference medium and the platform medium
Structure
Relative Amount of Glycan Structure [%]
High Producer 1
High Producer 2
Reference
Shaker
Platform
Shaker
Platform
Bioreactor
Reference
Shaker
Platform
Shaker
Platform
Bioreactor
Man3
-
Man5
G0F-GlcNAc
7±2
2±2
-
-
4±2
1±2
-
3±2
2±1
5±2
4±2
12 ± 3
10 ± 4
9±2
5±0
4±1
2±2
G0F
G1
46 ± 2
50 ± 5
47 ± 5
47 ± 5
47 ± 2
47 ± 5
6±3
6±2
8±2
3±1
9±1
5±1
G1F
30 ± 3
32 ± 5
29 ± 7
19 ± 2
23 ± 3
35 ± 2
G2F
9±2
7±2
7±2
5±1
6±1
7±2
The relative amounts of detected structures are given in % with the standard deviation of four independent analyses.
although this approach can be time consuming and resource intensive.
However the Micro24 Bioreactor system allows up to 24 different process
conditions to be run concurrently thereby facilitating efficient process
development.
This work describes the use of the Micro24 Bioreactor system to identify
improved process conditions for different cell lines and their subsequent
validation in bioreactors.
Micro-24 bioreactor system (Pall): This system comprises 24 bioreactors
(7 ml working volume) each capable of independent temperature,
dissolved oxygen and pH control. The main limitation of the system is the
lack of automation meaning that any feed additions or sample removal
must be made manually and similarly, for mammalian cultures, upwards
pH control is achieved by the manual addition of NaHCO3.
Engineering characterisation studies carried out at UCL (data not shown)
have shown how conditions within the individual Micro24 chambers
compare with those in bioreactors and recent results also indicate that
the selection of the Micro24 plate type is critical in ensuring good
correlation with performance in traditional bioreactors.
Within the Micro24 Bioreactor system cell cultures are carried out in
presterilised polycarbonate mammalian cell culture cassettes which are
inoculated manually in a laminar flow cabinet before sealing with Type A
single use closures and incubation under experimental conditions.
Methods: Chemically defined medium and feeds were used throughout
this work. Unless otherwise stated standard experimental conditions were
used. (35°C, pH 6.95, 30% Dissolved Oxygen (DO)). Viable cell numbers
and viability were determined using a ViCell Cell Viability Analyser
(Beckman Coulter) and antibody titres were determined using an Immage
Immunochemistry System (Beckman Coulter).
Process optimisation: Typical process relevant factors that can be tested
in the Micro24 include feed regime, pH, DO and temperature. The effects
of these types of factors are best tested using a Design of Experiments
(DoE) approach to assess the effects not only of different factors but also
of the interactions between them. Such data can then be used to build
predictive models of process performance to specify the appropriate
operating conditions in larger scale bioreactors. We have already
developed and are using a similar approach for microbial dAb processes.
The data below shows examples of how we have used this system to
identify improvements to platform processes for specific cell lines.
Case Study 1 - process conditions: In this experiment the effects of
changes to the platform process pH and DO set points on the performance
of a mAb producing cell line were assessed in the Micro24 using a DoE
approach with different operating conditions in each well.
This data demonstrated that although the dissolved oxygen level had
little effect on viable cell numbers, titres and specific productivity,
operating at a higher pH than the standard platform set point resulted in
an increase in titre and in specific productivity. There was no significant
interaction between the factors.
Bioreactor validation (1) - 2 litre scale: The high pH process identified
from the Micro24 was run in 2 litre bioreactors and compared to the
standard platform process.
At the high pH set point cell numbers during the later stages of the process
were slightly reduced compared to the control and as in the Micro24 higher
titres were produced under higher pH conditions. However, as in the
Micro24 the greatest effect of increased pH was on specific productivity
which in the bioreactors was increased by approximately 35% compared to
the control.
Bioreactor validation (2) - 50 litre scale: Similar results were achieved at
the 50 litre scale for a different cell line running in the same platform
process but producing a different molecule (Figure 1). There was little effect
on the cell numbers but the higher pH condition resulted in increased titre,
culture duration, volumetric productivity and specific productivity.
Case study 2 - feeding regime: The Micro24 can be used to investigate
the effect of different feeding regimes on culture performance. We have
already demonstrated that the effect of feed addition on culture
performance in the Micro24 is similar to that in shake flasks [1]; the data
below (Table 1) shows that for a chemically defined process multiple feed
additions have a similar effect in 2 litre bioreactors to the Micro24. In both
systems the addition of the feed results in significant increases in cell
numbers and titre. Culture duration is increased and the overall specific
activity is increased by 63% in the Micro24 and 79% in the bioreactors.
Discussion: Our previous work has demonstrated how the Micro24 system
can be used for mammalian cell line selection [1] and the data presented
here extends the application of the Micro24 into mammalian process
development. The parallel nature of the Micro24 enables process relevant
factors to be tested in DoE experiments and these data show that
improved process conditions such as increased pH and feed additions
identified in the Micro24 can be used to achieve process improvements in
bioreactors.
The validation of the Micro24 results in bioreactors suggests that the
integration of this technology into mammalian process development could
reduce significantly the numbers of bioreactors required to achieve process
improvements which could result in reduced resource requirements and
improved timelines.
Reference
1. Warr S, Patel J, Ho R, Newell K: Use of Micro Bioreactor systems to
streamline cell line evaluation and upstream process development for
monoclonal antibody production. BMC Proceedings 2011, 5(Suppl 8):P14.
P37
Temperature dependency of immunoglobulin production in novel
human partner cell line
Galina Kaseko*, Marjorie Liu, Edwin Hoe, Qiong Li, Mercedes Ballesteros,
Tohsak Mahaworasilpa
The Stephen Sanig Research Institute, Sydney, NSW, 2015 Australia
Introduction: A number of immunoglobulin (Ig) secreting human hybrid
cell lines were created using one-on-one somatic cell hybridization of a
rare human tumor infiltrating B lymphocyte and a cell of a novel human
cell line (WTM), developed in house and described earlier [1]. These hybrid
cell lines secret various amounts of tumor-derived immunoglobulins (Igs)
of different specificities. Current investigative efforts are directed towards
Page 56 of 151
Figure 1(abstract P36) Effect of pH on cell line performance in 50 litre bioreactors.
determining the optimal culture conditions to ensure consistent cell
growth and long-term stabilities of Ig productions by the hybrids. Based
on previous literature reports [2,3], we investigated an effect of short- and
long-term mild hypothermic conditions on Ig production, cell growth and
cell size.
Results: Three different hybrid cell lines each representing the highest,
medium and lowest ranges of Ig productions, were subject to culture
temperature drops from 37°C to 36°C, 35°C or 34°C for up to 168 hours with
24-hour data point intervals. In case of prolonged mild hypothermia, the cell
line with Ig production most susceptible to temperature drops was
maintained at various temperatures below 37°C (e.g. 36°C, 35°C and 34°C)
for at least 5 passages with each passage lasting 120 hours and the data
taken at a 24-hour interval. At each data point for each of the hybrid cell
lines at a given temperature interval, the sample was collected to determine
cell concentration, cell size and Ig production.
Whilst there was no observable effect of any of the short-term temperature
drops on the cell growth or the cell size in any of the three hybrid cell lines,
the level of Ig concentration consistently increased in all of them, with gains
ranging from 67% and 320% and with Ig productivity peaking between 48
and 72 hours after the exposure to lower temperatures (Figure 1).
In contrast to short-temperature drop conditions, a prolonged exposure
to mild hypothermic conditions (longer than 1 passage) led to a
progressive decrease in cell size over 5 passages. This decrease in the cell
size was accompanied by gradual 10-30% gains of Ig production with
each passage after the initial 100 to 150% increase in Ig concentration
immediately upon transfer to lower temperature (Table 1). When cultured
at 36°C, it seems to generate the highest increase in Ig production. This
temperature effect was not noticeable at log phase of cell growth.
Conclusions: In conclusion, whilst lowering temperature in the culture
resulted in overall increase in Ig concentration, our results suggest that
Table 1(abstract P36) Comparison of the effect of feed on cell line key performance parameters in Micro24 and 2 litre
bioreactors
Effect of Feed on Key Performance Parameters in Micro 24 and 2 L Bioreactors
Micro 24
2 L Bioreactors
Normalised VCC
Normalised Culture Duration
Normalised Peak Titre
Normalised SPR
Unfed
100
100
100
100
Fed
147
113
206
163
Unfed
100
100
100
100
Fed
171
133
379
179
Page 57 of 151
Figure 1(abstract P37) Effects of short-term temperature drops
from 37°C to 36°C and 37°C to 35°C on Ig production by hybrid
cell line 2.
Table 1(abstract P37) Effects of prolonged mild
hypothermia on Ig production by hybrid cell line 2 at
day 5 of each passage over 5 passages
Passage
P0
(ng/ml)
P1
(ng/ml)
P2
(ng/ml)
P3
(ng/ml)
P4
(ng/ml)
P5
(ng/ml)
37°C
342
322
388
36°C
35°C
0
0
712
605
758
452
356
301
348
929
514
1559
586
928
716
34°C
0
751
667
535
490
465
there might be different mechanisms responsible for the increase in Ig
productivity in response to short temperature drop and prolonged
hypothermia.
Acknowledgements: The project was financially supported in part by
Anthrocell Pty Limited, an Australian biotechnology company located in
Sydney, Australia.
References
1. Kaseko G, Liu M, Li Q, Mahaworasilpa T: Novel partner cell line for
immortalisation of rare antigen-specific B cells in mAb development.
BMC Proceedings 2011, 5(Suppl 8):P130.
2. Chong SL, Mou DG, Ali AM, Lim SH, Tey BT: Cell growth, cell-cycle
progress, and antibody production in hybridoma cells cultivated under
mild hypothermic conditions. Hybridoma 2008, 27:107-111.
3. Lloyd DR, Holmes P, Jackson LP, Emery N, Al-Rubeai M: Relationship
between cell size, cell cycle and specific protein productivity.
Cytotechnology 2000, 34:59-70.
P38
Strategies for clone detection, selection and isolation in Per.C6 cells case for Rebmab100
Fernanda P Yeda1,2, Mariana L dos Santos1,2, Lilian R Tsuruta1,2,
Bruno B Horta1,2, André L Inocencio1, Oswaldo K Okamoto2,3, Maria C Tuma2,
Ana M Moro1*
1
Lab. Biofármacos em Células Animais, Instituto Butantan, SP, 05503-900, Brazil;
2
Recepta-biopharma, SP, 04533-014, Brazil; 3Depto. Genética e Biologia Evolutiva,
Instituto de Biociências, Universidade de São Paulo, SP, 05508-900, Brazil
Background: A successful monoclonal antibody (mAb) cell line development
requires efficient clone detection and screening. Cloning by limiting dilution
(LDC) is the traditional method to isolate mAbs expressing clones [1].
Although effective, LDC is time-consuming, with limited workflow and
therefore a critical step of cell line development. To compare to LDC in terms
of timelines and productivities for Rebmab100 mAb cell line development we
have implemented ClonePix FL (CP-FL), an automated system for high
throughput clone detection. The robotic colony picker has the advantages of
reducing the process time and increasing the probability to isolate highproducing clones. Moreover, we have combined these two approaches with
high throughput screening assays for early detection of high productive
clones.
Rebmab100 mAb targets Lewis-Y, a blood group-related antigen expressed
in over 70% of epithelial cancers, including breast, colon, ovary and lung
carcinomas. The murine monoclonal 3S193 was generated in BALB/c mice
by immunization with Ley-expressing cells from the MCF-7 breast carcinoma
cell line [2]. The humanized version of anti- Ley 3S193 mAb was obtained by
CDR-grafting method [3]. The hu3S193 (Rebmab 100) mAb has potent
immune effector function (ADCC and CDC), is rapidly internalized into Ley
expressing cancer cells, and has been shown to cause significant regressions
in xenograft models in preclinical studies, alone or in conjunction with
isotope and toxins [3,4]. Safety and desirable pharmacokinetic profiles of
Rebmab100 were demonstrated in a Phase I clinical trial in patients with
epithelial carcinomas [5] and promising results have been obtained in a
Phase II clinical trial conducted in Brazil [6]. Very importantly, Rebmab100
was granted orphan-drug status by the FDA for ovary cancer. Aiming the
next step of Rebmab100 mAb development we generated a new
Rebmab100 cell line that shows stability and high productivity allowing its
scale-up to later clinical trials.
Materials and methods: Suspension Per.C6® cells (Crucell, Netherlands)
were transfected with a vector containing the genes coding for heavy and
light chains of Rebmab100 mAb. After selection by G418 the cells from the
stable pool were cloned by limiting dilution or plated in semi-solid
medium (Molecular Devices, USA) for ClonePix FL screening.
Cellular growth was assessed in plates, 96, 24 or 6-well plates, either by
CloneSelect Imager (Molecular Devices) or Guava EasyCyte cytometer
(Merck-Millipore). Antibody titers were measured by Biacore T100 (GE
Healthcare, Sweden). The selected clones were transferred to T-flasks and
subsequently to shaker flasks (SF). Clones were analyzed in 50 mL and 200
mL SF fed-batch processes. The stability study was performed for at least
50 generations in continuous culture and also starting batch runs with
cells taken at different generations.
Results: Generation of Rebmab100 stable pool: The transfection of
Per.C6® cells with a vector containing the genes coding for heavy and light
chains of Rebmab100 generated a stable pool through G418 selection.
Cloning using two different approaches: The stable pool was cloned by
LDC in liquid medium at 0.5 cell/well in 50 96-well plates, resulting in 261
colonies transferred to 24-well plates in 3-4 weeks after screening with the
CloneSelect Imager. Concomitantly the same pool was seeded at different
concentrations (300 to 2000 cells/mL) in semi-solid medium. The plates
were screened by light and fluorescence images about ten days after
seeding. A total of 845 colonies were picked, from which 225 were
transferred to 24-well plates. At the transference step to 24-well plates, 261
out of 4800 wells seeded in LDC were transferred while 225 colonies out of
845 colonies picked by CP-FL, representing 5.4% and 26.6% efficiency,
respectively. Both approaches followed sequential steps as transfer of the
clones to 6-well plates, T-flasks and SF, selecting them at each step for cell
growth and productivity related to cell number.
Fed-batch experiments and stability study: Thirty-one clones adapted
to suspension cultures were assessed for productivity in fed-batch
processes, being 15 originated from LDC and 16 from CP-FL. From the fedbatch in 50 mL SF 12 clones presented titers ranging from 1.3 to 3.0 g/L
(Figure 1A). Out of 31 clones, 10 were selected for long-term stability study
to determine growth and productivity along the time required for mAb
production during a manufacturing process. The stability study performed
with 6 LDC and 4 CP-FL originated clones ruled out 3 of them, two from
LDC and one from CP-FL. Seven clones showed genetic and cellular
stability (data not shown), 4 from LDC and 3 from CP-FL and were further
analyzed in fed-batch in 200 mL SF. In this study we compared titers
obtained after 2 weeks run for all clones, with results ranging from 0.9 to
1.8 g/L to the maximum productivity attained by each clone, obtained at
different lengths of culture (Figure 1B). Taken together the data for cell
growth, productivity, kinetic and functional assays of the purified
antibodies (data not shown), mainly the immune-effector activity
characteristically displayed by Rebmab100, we identified 4 lead clones, the
first and second originated by CP-FL screening. Final ranking will be
evaluated after bioreactor runs.
Conclusions: The CP-FL automated picking has the advantage of being
less labor-intensive and time-consuming, while allowing the chance of
Page 58 of 151
Figure 1(abstract P38) Antibody titer measured by Biacore in SF fed-batch process (g/L). (A) 31 selected Rebmab100 clones measured on the last
day of a 50 mL SF fed-batch culture. (B) Maximum (grey bars) and 2 weeks (black bars) mAb productivity obtained in a 200 mL SF fed-batch culture for
the 7 stable Rebmab100 clones. The number above the grey bars indicates the day when maximum mAb productivity occurred.
picking clones that would not grow isolated in LDC. Both CP-FL and LDC
procedures proved efficient for generating high productive and stable
cell clones. Overall productivity for individual clones depends on specific
productivity, cell density and viability along time, allowing accumulation
of the antibody. CP-FL clones reached maximum productivity at an earlier
stage (2 weeks) of the 200 mL SF fed-batch experiment, which represents
an advantage during the manufacturing process.
The 4 lead clones will be submitted to bioreactor runs to evaluate the
most suitable clone for the Rebmab100 mAb to be used in clinical trials
and eventually to go under production.
Acknowledgements: We acknowledge the excellent technical support of
Denis N Aranha and José M Oliveira. We are grateful to Dr. Maria T A
Rodrigues for logistics support. This work was supported by FAPESP, FINEP,
CNPq, Fundação Butantan, and Recepta-biopharma.
References
1. Browne SM, Al-Rubeai M: Selection methods for high-producing
mammalian cell lines. Trends Biotechnol 2007, 25:425-432.
2. Kitamura K, Stockert E, Garin-Chesa P, Welt S, Lloyd KO, Armour KL,
Wallace TP, Harris WJ, Carr FJ, Old LJ: Specificity analysis of blood group
Lewis-y (Le(y)) antibodies generated against synthetic and natural Le(y)
determinants. Proc Natl Acad Sci USA 1994, 91:12957-12961.
3. Scott AM, Geleick D, Rubira M, Clarke K, Nice EC, Smyth FE, Richards EC,
Carr FJ, Harris WJ, Armour KL, Rood J. Kypridis A, Kronina V, Murphy R,
Lee FT, Liu Z, Kitamura K, Ritter G, Laughton K, Hoffman E, Burgess AW,
Old LJ: Construction, production, and characterization of humanized
anti-Lewis Y monoclonal antibody 3S193 for targeted immunotherapy of
solid tumors. Cancer Res 2000, 60:3254-3261.
4. Kelly MP, Lee FT, Smyth FE, Brechbiel MW, Scott AM: Enhanced efficacy of
90Y-radiolabeled anti-Lewis Y humanized monoclonal antibody hu3S193
and paclitaxel combined-modality radioimmunotherapy in a breast
cancer model. J Nucl Med 2006, 47:716-725.
5. Scott AM, Tebbutt N, Lee FT, Cavicchiolo T, Liu Z, Gill S, Poon AM, Hopkins W,
Smyth FE, Murone G, MacGregor D, Papenfuss AT, Chappell B, Saunder TH,
Brechbiel MW, Davis ID, Murphy R, Chong G, Hoffman EW, Old LJ: A phase I
biodistribution and pharmacokinetic trial of humanized monoclonal
antibody Hu3s193 in patients with advanced epithelial cancers that
express the Lewis-Y antigen. Clin Cancer Res 2007, 13:3286-3292.
6. Smaletz O, Diz MPD, Carmo CC, Sabbaga J, Cunha GF, Azevedo SJ,
Maluf FC, Barrios CH, Costa RL, Fontana AG, Alves VA, Moro AM, Scott EW,
Hoffman EW, Old LJ: Anti-LeY monoclonal antibody (mAb) hu3S193
(Rebmab100) in patients with advanced platinum resistant/refractory
(PRR) ovarian cancer (OC), primary peritoneal cancer (PPC), or fallopian
tube cancer (FTC). ASCO Annual Meeting, 2011, Chicago. J Clin Oncol 2011,
29:5078.
P39
Impact of single-use technology on continuous bioprocessing
William G Whitford*, Brandon L Pence
Thermo Fisher Scientific, 925 West 1800 South, Logan, Utah 84321, USA
Background: Single-use (SU) technologies supply a number of values to
any mode of bioprocessing, but can provide some specific and enabling
features in continuous bioprocessing (CB) implementations [1-3]. Most
every operation in a CB process train is now supported by a commercially
available single-use, or at least hybrid, solution (Figure 1). First of all,
many of the SU equipment and solutions being developed for batch
bioproduction have the same or related application in CB systems.
Examples here include simple equipment such as tubings and connectors,
to more complex applications such as the cryopreservation of large
working stock aliquots in flexible bioprocess containers (BPCs). The list of
CB-supporting SU technologies being developed is large and growing.
Results: A SU advantage in process development is its supports of an
open architecture approach and a number of hybrid designs. Such designs
include combining reusable and single-use systems, or between divergent
suppliers of particular equipment. Especially in bioproduction, the many
flexibilities of SU support a manufacturing platform of exceptional
efficiency, adaptability, and operational ease. Advances designs in SU
transfer tubing, manifold design and container porting also supports
creativity in process design. This is of particular value in designing a
process with such demands as entirely new flow paths or lot designations,
such for CB.
SU systems upstream provide a reduced footprint and eliminate of the need
for cleaning and sterilization service. This complements perfusion culture’s
inherently smaller size and independence from cleaning for extended
periods of time.
Page 59 of 151
Figure 1(abstract P39) Hybrid intensified perfusion-based continuous bioproduction in a Thermo Scientific HyPerforma S.U.B. TK 250L supported
by yhe Refine Technology ATF System.
Several newer approaches to formulating process fluids support the concept
of CB. Single-use mixing systems are typically constructed of a rigid
containment system with a motor and controls driving radiation-sterilized
single-use bags equipped with disposable impeller assemblies. From a
variety of manufacturers there are a number of distinct approaches to
motor/disposable impeller assembly linkages, tubing lines and connections.
Also appearing are a number of exciting SU sampling, sensing, and
monitoring solutions. Single-use powder containers permit seamless transfer
between powder and liquid formulation steps, and the ridged mixing
containers are available in jacketed stainless steel for heating and cooling
requirements. Surprisingly, the “topping-up” of large-scale single-use fluid
containers with newly prepared buffer to provide a virtually unlimited and
constant supply of each buffer/media type can be validated for GMP
manufacturing procedures.
Process flexibility is a key feature in both SU and CB. CB contributes to
overall process flexibility in that equipment tends to be easy to clean,
inspect and maintain − and generally promotes simple and rapid product
changeover. SU systems can provide similar flexibility and ease product
changeover because they tend to be more modular and transportable
than much of the older batch equipment. In fact the size, configuration
and reduced service requirements of SU systems actually encourage
diversity of physical location within a suite or plant, as well as re-location
to other manufacturing sites.
Due to its inherent demand for immediate process data and control
capabilities, CB supports initiatives in continuous quality verification (CQV),
continuous process verification (CPV), and real-time release (RTR). Although
CB will not be feasible for all products and processes, many implementations well-support a “platform” approach, in which a single process
supports more than one product. CB most always shortens the process
stream, reduces downtime, and greatly reduces handling of intermediates.
These features complement the operational efficiencies of SU systems,
contributing to a greatly reduced cumulative processing time for the API.
Furthermore, they greatly simplify production trains and inherently facilitate
application of closed processing approaches to individual operations and
even processes. Especially in bioproduction, the modularity and integral
gamma irradiation sterility of SU combined with the sustained operation of
CB promise the appearance of platforms of unparalleled operational
simplicity and convenience.
The heart of a CB approach is the bioreactor. Perfusion bioreactors have
been successfully employed in bioproduction, even biopharmaceutical
production, for decades. And, rather remarkably, disposable bioreactors
have been available for nearly 20 years. At the research scale there have
even been single-use hollow fiber perfusion bioreactors available from a
variety of vendors for over 40 years. However, only recently have
commercially available SU and hybrid production-scale perfusion-capable
equipment become available.
The production-scale CB enabling SU bioreactor technologies now
becoming commercial available include single-use and hybrid perfusioncapable reactors (Figure 1); a growing variety of SU and hybrid monitoring
probes and sensors; SU pumps and fluid delivery automation of various
design; and automated SU online sampling, interface, valving and feeding
technologies. Their coordinated implementation in actual production
settings with appropriate control is now beginning.
Justified or not, concerns in the implementation of CB include performance
reliability (incidence of failure), validation complexity, process control and
economic justification. But for many processes, such previous limitations –
or their perception – are being alleviated by advances in CB processing
technology and OpEx driven advances bioprocess understanding, reactor
monitoring and feedback control. However, while some CB attributes
inherently provide immediate advantages (such as reduces reactor
residency time) others do present challenges (such as cell-line stability
concerns).
Due to the limited contribution of API manufacturing to small-molecule
pharmaceutical cost, the limited bottom-line financial savings of CB has
been a concern. However, biopharma is a different animal in general, and
as such trends as globalization and biosimilars alter the picture even
further, the financial benefits of CB are becoming even stronger.
The fact that many SU systems are constructed of standards compliant and
animal product-free materials supports CB applications in a wide variety of
product types and classification. In fact, SU systems are available to most
any process format (eg, microcarriers and suspension), platform (eg, cell
line, vectors, culture media), mode (eg, dialysis or enhanced perfusion) or
scale (eg, through rapid, inexpensive scale-out). “Futureproofing”, or
supporting the sustainability of a new CB process in the face of product
lifecycle or emerging technology imperative, is supported by many SU
features. Examples here include SUs low initial facility, service and
equipment cost and especially SU’s undedicated manufacturing suits and
ease of process train reconfiguration.
Conclusion: As advanced single-use solutions are applied to single-use
perfusion mode-capable reactors, the design of integrated closed,
disposable and continuous upstream bioproduction systems are finally
being realized.
References
1. Whitford WG: Supporting continuous processing with advanced singleuse technologies. BioProcess International 2013, 11:46-52.
2. Whitford WG: Continued progress in continuous processing for
bioproduction. Life Science Leader 2012, June:62-64.
3. Whitford WG: Single-use systems support continuous processing in
bioproduction. PharmaBioWorld 2012, 10:22-27.
P40
Comparison of BHK-21 cell growth on microcarriers vs in suspension at
2L scale both in conventional bioreactor and single-use bioreactor
(Univessel® SU)
Lídia Garcia*, Elisenda Viaplana, Alicia Urniza
Zoetis Manufacturung & Research Spain, S.L Pfizer Olot S.L.U., Ctra.
Camprodon s/n, La Riba, 17813 Vall de Bianya (Girona), Spain
Background: BHK-21 cells are the most commonly used cells for vaccine
production. Not all cell lines can be adapted to suspension growth. In
general, anchorage-dependent cells (must be attached to a substrate to
grow) will grow in suspension only with the use of microcarrier beads.
However, some cell lines such as the BHK-21 can be adapted to grow in
suspension.
In recent years, the use of disposables in the pharmaceutical industry has
increased extensively. The aim of this study is to evaluate the influence of
a single use bioreactor on the final cell production of BHK-21 cells when
they are growing with microcarriers or in suspension which can do an
impact on the final product quality.
Cultivations on conventional 2L-bioreactors were compared with results
obtained from 2L single use bioreactor (UniVessel® SU).
Materials and methods: Cell line: Two BHK-21 cell lines were used, BHK21 clone C3 as an anchorage-dependent cell line and SBHK cells adapted
to grow in suspension.
Both cell lines were cultivated in MEM Glasgow medium supplemented
with fetal bovine.
BHK-21 cells were grown in microcarriers Cytodex-3.
Cultivation system: The growth using two different bioreactors was
analyzed: Conventional reusable bioreactor (Autoclaving glass vessel of 2L)
and the UniVessel® SU as a single use bioreactor
To control both bioreactors the BIOSTAT® B plus unit was used.
Parameters as pH, temperature, stirring speed, aeration rate and viable
cell number were analyzed.
Cell growth was conducted at the optimal conditions determined previously
on spinner flasks. Cells were seeded into the bioreactor at the following
concentration:
BHK-21: 5 × 105 cells/ml with a viability of ≥ 98%
SBHK: 3 × 105 cells/ml with a viability of ≥ 97%
Page 60 of 151
Cell count: BHK-21 were counted using the crystal violet dye nucleus
staining method.
SBHK cells were counted using the NucleoCounter (ChemoMetec A/S).
Results: Optimization, characterization of BHK cells culture processes and
evaluation of microcarriers vs non-microcarrier processes at 2L scale were
done.
Process performance was compared in conventional glass vessels to
single use bioreactors.
In Table 1 values of viability and final cell density are shown in single-use
and conventional bioreactors (3 batches per bioreactor). The results
obtained demonstrated that at 3 days of culture no significant differences
were found using both bioreactors.
BHK-21 attached and grew efficiently on microcarriers. Fully confluency
and a maximum viable cell density (between 1.2 to 2.9 × 106 cells/ml)
was obtained after 3 days of culture (Table 1, Figure 1). In all the cases,
the viability was higher than 96.5%.
SBHK cells reached higher yields comparing with the BHK-21. The
maximum viable cell density (> 90% of viability) was obtained at 3 days
of culture reaching a cell concentration between 1.95 to 3.5 × 106 cells/ml
(Table 1, Figure 1).
The variability on final cell density obtained between the different
batches was similar in both types of bioreactors (Table 1).
Conclusions: ✓ Comparable results between conventional glass vessels
and single use bioreactors: cell density and viability.
✓ Given the good results obtained with SBHK cells, elimination of
microcarriers can decrease the cost of a large-scale operation.
✓ The feasibility of transferring the BHK cells growth from a
conventional bioreactor to single-use bioreactor has been
demonstrated.
✓ Benefits of single-use technology integration:
• SU Bioreactors can replace conventional bioreactors without
loss of process efficiency
• The scale-up for both suspension and attached cell lines in SU
bioreactors is guarantee. The flexibility and easy of use of this
SU bioreactors enable rapid scale-up without any loss in
product quality
• SU Bioreactors increase easy of handling and offer advantages
in the areas of cleaning, sterilization, validation, set-up, and
turn-around time between runs.
• SU Bioreactors are the best solution when containment is
required (BL-3 and BL-4 laboratories).
P41
Size-dependent antioxidative activity of platinum nanoparticles
Hidekazu Nakanishi1*, Takeki Hamasaki2, Tomoya Kinjo1, Kiichiro Teruya1,2,
Shigeru Kabayama3, Sanetaka Shirahata1,2
1
Division of Life Engineering, Graduate School of Systems Life Sciences,
Kyushu University, Fukuoka 812-0053, Japan; 2Department of Bioscience and
Biotechnology, Faculty of Agriculture, Kyushu University, Fukuoka 812-0053,
Japan; 3Nihon Trim Co. Ltd, Osaka 531-0076, Japan
Background: So far, most of studies on nanometer-sized metal particles
have focused on biological safety and potential hazards. However, antioxidative activity of noble metal nanoparticles (NPs) attracts much
attention, recently. Platinum nanoparticles (Pt NPs) are one of the most
important noble metals in nanotechnology because Pt NPs have negative
surface potential from negative charges and are stably suspended from
an electric repulsion between the same charged particles [1]. We
previously reported that Pt NPs of 2-3 nm sizes scavenged reactive
oxygen species (ROS) such as superoxide anion radical, hydrogen
peroxide and hydroxyl radical in vitro [2]. Here, we report the cytotoxicity
and size-dependent antioxidative activity of Pt NPs on rat skeletal muscle
cell line, L6.
Materials and methods: Pt NPs were synthesized by a modified citrate
reduction method of Hydrogen hexachloroplatinate (IV). Particle size and
concentrations of Pt NPs were determined by a transmittance electron
microscope (TEM) and ICP-MS, respectively. To find the toxic effect of Pt
NPs rat myoblast L6 cells were pre-cultured for 24 hours in culture medium
with a 10-3 to 10 mg/l of Pt NPs and cell viability was determined by WST-1
Page 61 of 151
Table 1(abstract P40) Cell growth and viability at 3 days culture in a 2L conventional bioreactor and in a single use
bioreactor
Univessel SU (2L)
BHK-21
Conventional Bioreactor (2L)
SBHK
BHK-21
SBHK
Batch
Viable Cells
(cells/ml)
Viability (%)
Viable Cells
(cells/ml)
Viability (%)
Viable Cells
(cells/ml)
Viability (%) Viable Cells
(cells/ml)
Viability (%)
1
2.90 × 106
97
2.70 × 106
99.1
2.46 × 106
99
1.96 × 106
92.1
2
3
1.20 × 106
2.10 × 106
96.5
98
1.95 × 106
3.0 × 106
90.5
97
1.80 × 106
1.90 × 106
98.9
98.1
2.36 × 106
3.50 × 106
98
99.4
Mean valors
2.08 × 106
97.5
2.55 × 106
97
2.05 × 106
99
2.61 × 106
99.4
assay. To investigate the anti-oxidative effect of Pt NPs on L6 cells, the
relative amount of intracellular H 2O2 was measured with a Bes-H2O2-AC
florescent probe, which is designed to detect intracellular H2O2 specifically
[3]. The intracellular ROS levels when treated with 1 mg/l of Pt NPs for
2 hours were measured using IN Cell Analyzer 1000.
Results and conclusions: The particle sizes we synthesized were
determined to 1-2 nm, 2-3 nm and 4 nm respectively (data not shown).
Cytotoxicity of Pt NPs of these sizes was not observed at a concentration
below 10 mg/l (data not shown). Intracellular ROS levels are thought to
result from a primary response to internalized NPs leading to decreased cell
viability [4]. Thus, the suppression of excess ROS is of prime importance for
cell survival. The intracellular ROS levels were decreased significantly by the
whole sizes of Pt NPs treatment and 2-3 nm of Pt NPs scavenged the ROS
most efficiently (Figure 1). The relative fluorescence level treated with 2-3
nm of Pt NPs decreased significantly to about 60% (*** P < 0.001) compared
with that of non-treated cells. Smaller NPs should be more taken up by the
cells efficiently and might more scavenge ROS effectively [5]. However, the
Pt NPs of 1-2 nm less scavenged the intracellular ROS than that of 2-3 nm.
The one reason might be that 1-2 nm of Pt NPs is rather too small to
activate intracellular anti-oxidant defense pathways than 2-3 nm of Pt NPs
because of their less cytotoxicity. However, we have no data to show.
Therefore, we have to make more effort to investigate the relationship
between the sizes of Pt NPs and ROS scavenging activity.
Our results suggest Pt NPs of 2-3 nm sizes have no cytotoxity below 10 mg/l
and are useful materials to scavenge ROS. In this regard Pt NPs are
expected as redox regulation factors for suppression of various ROSrelated diseases.
References
1. Aiuchi T, Nakajo S, Nakaya K: Reducing activity of colloidal platinum
nanoparticles for hydrogen peroxide, 2,2-diphenyl-1-picrylhydrazyl
radical and 2,6-dichlorophenol indophenol. Biol Pharm Bull 2004,
27:736-738.
2. Hamasaki T, Kashiwagi T, Imada T, Nakamichi N, Aramaki S, Toh K,
Morisawa S, Shimakoshi H, Hisaeda Y, Shirahata S: Kinetic analysis of
superoxide anion radical-scavenging and hydroxyl radical-scavenging
activities of platinum nanoparticles. Langmuir 2008, 24:7354-7364.
3. Maeda H, Fukuyasu Y, Yoshida S, Fukuda K, Saeki K, Matsuno H, Yamauchi Y,
Yoshida K, Hirata K, Miyamoto K: Fluorescent probes for hydrogen
peroxide based on a non-oxidative mechanism. Angew Chem Int Ed Engl
2004, 43:2389-2391.
4.
5.
Long TC, Tajuba J, Sama P, Saleh N, Swartz C, Parker J, Hester S, Lowry GV,
Veronesi B: Nanosize titanium dioxide stimulates reactive oxygen species
in brain microglia and damages neurons in vitro. Environ Health Perspect
2007, 115:1631-1637.
Hirn S, Semmler-Behnke M, Schleh C, Wenk A, Lipka J, Schäffler M,
Takenaka S, Möller W, Schmid G, Simon U, Kreyling WG: Particle sizedependent and surface charge-dependent biodistribution of gold
nanoparticles after intravenous administration. Eur J Pharm Biopharm
2011, 77:407-416.
P42
Sampling and quenching of CHO suspension cells for the analysis of
intracellular metabolites
Judith Wahrheit*, Elmar Heinzle
Biochemical Engineering Institute, Saarland University, D-66123 Saarbrücken,
Germany
Background: Metabolic studies are of fundamental importance in
metabolic engineering approaches to understand cell physiology and to
pinpoint metabolic targets for process optimization. Knowledge on
intracellular metabolites, in particular in combination with powerful dynamic
metabolic flux analysis methods will substantially expand our basic
understanding on metabolism, e.g. about metabolic compartmentation [1].
Few protocols for quantitative analysis of intracellular metabolites in
mammalian suspension cells have been proposed in the literature. However,
due to limited validation of sampling and quenching procedures provided
in previous publications, we thoroughly investigated the associated critical
issues, such as (a) cellular integrity, (b) quenching efficiency, (c) cell
separation at different centrifugation conditions and its influence on cell
fitness, and (d) different washing procedures to prevent carryover of
extracellular metabolites. Many metabolites of interest are also contained in
the medium in large amounts, e.g. amino acids, making their intracellular
quantification critical.
Materials and methods: Cell cultivation: Two CHO cell lines were used,
T-CHO ATIII cells (GBF, Braunschweig, Germany) cultivated in serum-free
CHO-S-SFM II medium (GIBCO, Invitrogen, Karlsruhe, Germany) and CHO
Figure 1(abstract P40) Comparison of cell growth and viability at 3 days culture in a 2L conventional bioreactor and in a single use bioreactor.
Page 62 of 151
Figure 1(abstract P41) The scavenging effect of several sized Pt NPs on intracellular hydrogen peroxide in L6 cells. Asterisks donate significant
difference from the untreated control cells. (***P < 0.001).
K1 cells (University of Bielefeld, Germany) cultivated in amino acid rich
TC-42 medium (TeutoCell, Bielefeld, Germany) in baffled shake flasks in a
shaking incubator. Cell counting and determination of cell diameters
were performed using an automated cell counter (Invitrogen, Darmstadt,
Germany). Cell viability was verified using the trypan blue exclusion
method. Cell recovery was defined as (total viable cell number after
quenching)×100/(total viable cell number in initial sample).
Determination of the energy charge: ATP, ADP, and AMP were analyzed
in a luminometer (Promega, Mannheim, Germany) using the CellTiter-Glo,
the ADP-Glo Kinase, and the AMP-Glo assays (Promega, Mannheim,
Germany), respectively. For the ADP- and AMP-Glo assays, cells were lysed
using the CelLytic M reagent (Sigma-Aldrich, Germany) before adding the
assay reagents. The energy charge value was calculated as ([ATP] + ½ ×
[ADP])/([ATP] + [ADP] + [AMP]).
Evaluation of different washing procedures and carryover of media
components: Carryover of extracellular metabolites from the culture
medium was investigated without washing and after applying different
washing procedures. Cell pellets were either resuspended in 50 ml
quenching solution or rinsed once or twice with 50 ml quenching solution
without re-suspension. After another centrifugation step and re-suspension
in a small volume PBS, cell numbers were determined and extracellular
metabolite amounts analyzed via HPLC as described previously [2] and
related to the initial sample.
Final protocol: (1) Precooling of 45 ml and 50 ml 0.9% saline quenching
solution in an ice-water bath to 0°C for at least 1 hour. (2) Adding of 5 ml
cell suspension to 45 ml 0.9% quenching solution and immediate mixing
by inverting the tube. (3) Centrifugation at 2000 × g in a precooled
centrifuge at 0°C for 1 min. (4) Careful decanting of the supernatant
followed immediately by suction of residual liquid using a vacuum pump
without touching the cell pellet. (5) Washing once by careful pouring of
50 ml precooled QS 50 ml on top of the cell pellet without resuspending
the cells followed by repetition of steps (3) and (4). (6a) Immediate
freezing by placing the tube in liquid nitrogen or (6b) determination of
cell recovery.
Results: Ice-cold 0.9% saline is a suitable quenching solution maintaining
cellular integrity as reported previously [3]. However, longer incubation
times at 0°C reduce cellular viability and should be avoided. The time from
taking the sample (final protocol, step 2) to freezing the cell pellet in liquid
nitrogen (final protocol, step 6a) is critical and should be kept to a minimum.
A rapid temperature shift and in addition a significant dilution of extracellular metabolites was achieved using a nine-fold excess of quenching
solution. Efficient inactivation of metabolism was proven by a high and
representative energy charge value of 0.82 (± 0.01, n = 3).
Separation of cells via centrifugation was incomplete due to required short
centrifugal times. Thus, it is necessary to determine the cell recovery after
quenching. However, from the average cell size estimation we conclude that
centrifugation at short times provides a representative sample, although
sampling was incomplete. Centrifugation time and speed, total volume and
even the initial cell density in the cell suspension have an impact on the cell
recovery after quenching. Centrifugation at 1000 × g and 2000 × g did not
affect cell integrity. Higher centrifugal accelerations (3000 × g, 4000 × g)
reduce cell viability. Above 2000 × g no further improvement in the cell
recovery was obtained. Thus, centrifugation should be limited to 2000 × g to
prevent unnecessary stress to the cells. Due to highly reproducible
centrifugation, the cell recovery can be determined from a biological replicate
(final protocol, step 6b).
Washing steps further reduce cell recovery. Rinsing the cell pellet affects cell
recovery only little and much less than resuspending the cell pellet. Cell
integrity was not impaired by different washing procedures. Reducing the
carryover of metabolites contained in the medium is a prerequisite for their
intracellular analysis. Using a nine-fold excess of quenching solution,
contamination with medium components was very low (less than 0.3% of
the initial metabolite amount was found for glucose, lactate, pyruvate, citrate,
and all proteinogenic amino acids). Rinsing the cell pellet without resuspending the cells further reduces the carryover of medium components
efficiently. However, washing cannot completely prevent medium carryover.
Washing by resuspending does not remove more metabolites than rinsing
and should be avoided due to substantially reduced cell recovery.
Conclusions: Ice-cold 0.9% saline was shown to be a suitable quenching
solution maintaining cellular integrity. A rapid temperature shift was
achieved using a nine-fold excess of quenching solution resulting in
efficient inactivation of metabolism. The applied conditions result in a very
low level of medium contamination. Rinsing the cell pellet without
re-suspending the cells reduced medium carryover effectively. Separation
of cells via centrifugation was incomplete due to required short centrifugal
times. Thus, it is necessary to determine the cell recovery after quenching.
References
1. Wahrheit J, Nicolae A, Heinzle E: Eukaryotic metabolism: measuring
compartment fluxes. Biotechnol J 2011, 6:1071-1085.
2. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling
using HPLC allows classification of drugs according to their mechanisms
of action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011,
252:183-191.
3. Dietmair S, Timmins NE, Gray PP, Nielsen LK, Krömer JO: Towards
quantitative metabolomics of mammalian cells: Development of a
metabolite extraction protocol. Anal Biochem 2010, 404:155-164.
P43
13
C labeling dynamics of intra- and extracellular metabolites in CHO
suspension cells
Judith Wahrheit*, Averina Nicolae, Elmar Heinzle
Germany
Background: Isotope labeling techniques have become a most valuable
tool in metabolomics and fluxomics [1]. In particular the dynamics of label
incorporation provide rich information about metabolism. A thorough
understanding of CHO metabolism is crucial for metabolic engineering and
process optimization.
Materials and methods: Experimental set-up: CHO-K1 cells were
cultivated in protein free TC-42 medium (TeutoCell, Bielefeld, Germany) in
250 ml baffled shake flasks. For the non-stationary experiment the cultures
were inoculated at a start cell density of 2 × 106 cells/ml in a start volume
of 120 ml. Four parallel cultivations were performed, two with 100%
[U- 13 C 6 ]glucose and two with 100% [U- 13 C 5 ]glutamine, respectively.
Extracellular samples were taken from all four cultivations every 6 h for cell
counting and determination of extracellular metabolite concentrations and
extracellular labeling dynamics. Intracellular samples were taken alternately
from the two replicates. After 2 min, 10 min, 20 min, 30 min, 60 min, 2 h,
4 h, 6 h, 12 h, 18 h, 24 h, 30 h, 36 h, and 48 h, a sample of 5 ml cell
suspension was quenched in 45 ml ice-cold 0.9% sodium chloride solution,
centrifuged for 1 min at 2000 × g, washed once by rinsing the cell pellet
with 50 ml ice-cold 0.9% sodium chloride solution, and frozen in liquid
nitrogen. Intracellular metabolites were extracted in methanol and water
by repeated freeze-thaw cycles, as described previously [2]. Extracts were
dried in a centrifugal evaporator.
Analytics: Cell counting and viability determination was carried out using
an automated cell counter (Invitrogen, Darmstadt, Germany). Quantification
of extracellular glucose, organic acids and amino acids via HPLC was carried
out as described recently [3]. For determination of extracellular labeling
dynamics, lyophilized supernatants were resolved in dimethylformamid
(0.1% pyridine) and derivatized with MBDSTFA (Macherey-Nagel, Düren,
Deutschland). Dried cell extracts were resolved in pyridine (20 mg/ml
methoxylamine) and derivatized with MSTFA (Macherey-Nagel, Düren,
Deutschland). Samples were analyzed by GC-MS. Unique fragments
containing the whole carbon backbone were chosen for excreted
extracellular metabolites and selected intracellular metabolites of the central
metabolism.
Results: We observed a monotonic cultivation profile during short-term
cultivation for 48 h. Metabolic steady state was confirmed by exponential
growth and constant metabolite yields. The two tracers, glucose and
glutamine, were the major carbon sources. Lactate, alanine, glycine, and
glutamate were excreted, all other metabolites were consumed. Although
serine, aspartate, and glutamine were only consumed, we found significant
extracellular labeling of these metabolites indicating simultaneous
consumption and excretion.
Page 63 of 151
Label incorporation into intracellular pyruvate and lactate was very fast on
[U-13C6]glucose (mainly m3). Isotopic steady state in extracellular lactate
was reached after 12 h. Labeling in pyruvate and lactate was also found
using [U-13C5]glutamine as tracer (mainly m1) indicating a significant reflux
from TCA cycle via anaplerotic reactions. Label incorporation into alanine
was slower than for pyruvate and lactate and had a different labeling
pattern. A significantly higher m2 fraction on labeled glucose indicates
synthesis after pyruvate has entered the mitochondria. Significant labeling
of serine and glycine was found on labeled glucose but not on labeled
glutamine indicating the absence of gluconeogenesis.
Label incorporation into TCA cycle metabolites was fast on both tracers
approaching steady state in citrate within 6 h of cultivation. Nearly
identical labeling patterns were found for fumarate, malate and aspartate
indicating a tight connection between these metabolite pools. After 24 h a
metabolic shift takes place. Glutamine was synthesized in significant
amounts. Labeling in TCA cycle metabolites decreased and labeling in
pyruvate, lactate, and alanine further increased.
Conclusions: We present the very first study of 13C labeling dynamics in
CHO suspension cells. We were able to capture labeling dynamics in
excreted extracellular metabolites as well as in intracellular organic acids
and amino acids providing a representative overview of the central
metabolism in CHO cells. Furthermore, we could draw some first
qualitative conclusions. These transient labeling data is currently used in a
non-stationary 13C metabolic flux analysis in order to obtain an in-depth
understanding of CHO central metabolism, e.g. about reversibilities and
the connection between glycolysis and TCA cycle.
References
1. Klein S, Heinzle E: Isotope labeling experiments in metabolomics and
fluxomics. Wiley Interdiscip Rev Syst Biol Med 2012, 4:261-272.
2. Sellick CA, Hansen R, Stephens GM, Goodacre R, Dickson AJ: Metabolite
extraction from suspension-cultured mammalian cells for global
metabolite profiling. Nat Protocols 2011, 6:1241-1249.
3. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling
using HPLC allows classification of drugs according to their mechanisms
of action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011,
252:183-191.
P44
Investigation of glutamine metabolism in CHO cells by dynamic
metabolic flux analysis
Judith Wahrheit*, Averina Nicolae, Elmar Heinzle
Germany
Background: Glutamine metabolism represents one of the major targets in
metabolic engineering and process optimization due to its importance as
cellular energy, carbon and nitrogen source. Metabolic flux analysis
represents a powerful method to investigate the physiology and
metabolism of cells [1]. Classical metabolic flux analysis methods require
steady state conditions. However, industrially relevant cultivation conditions,
i.e. batch and fed-batch cultivations, are characterized by changing
environmental conditions and metabolic shifts [2]. We used dynamic
metabolic flux analysis to study the impact of glutamine availability or
limitation on the physiology of CHO K1 cells capturing metabolic dynamics
during batch- and fed-batch cultivations.
Materials and methods: Cell cultivation: CHO-K1 cells were cultivated in
protein free TC-42 medium (TeutoCell, Bielefeld, Germany) in 50 ml filtertube bioreactors (TPP, Trasadingen, Switzerland) at a start cell density of 2 ×
10 5 cells/ml and a start volume of 20 ml. Cell counting and viability
determination was carried out using an automated cell counter (Invitrogen,
Darmstadt, Germany). Quantification of glucose, organic acids and amino
acids via HPLC was carried out as described recently [3]. Ammonia was
quantified using an ammonia assay kit (Sigma-Aldrich, Steinheim, Germany)
in 96-well plates. Six different batch cultivations with 0 mM, 1 mM, 2 mM,
4 mM, 6 mM or 8 mM glutamine start concentration and two different fedbatch cultivations starting at 1 mM glutamine and feeding 1 mM every 24 h
or starting at 2 mM and feeding 2 mM every 48 h were performed.
Metabolic flux analysis: Splines were fitted to the cell density and the
extracellular metabolite profile using the SLM curve fitting tool in Matlab
2012b (The Mathworks, Natick, MA, USA). Using a stoichiometric model of
the CHO metabolism the intracellular fluxes were calculated by flux
balancing.
Results: Glutamine has an initial growth stimulating effect. With increasing
glutamine concentration, the specific growth rate was initially higher but
dropped earlier. However, increased accumulation of waste products at high
glutamine levels, e.g. ammonia, inhibited growth later on and decreased
culture longevity. The highest viable cell densities were reached in the
1 mM glutamine batch and 8 × 1 mM glutamine fed-batch cultivations.
Substantial dose-dependent flux rearrangements were observed for
different glutamine availabilities. Initially, no significant impact on the
glycolytic fluxes and lactate excretion was found. In later phases, glycolytic
and lactate excretion rates were higher in the glutamine free cultivation.
Waste product excretion of ammonia, alanine and glutamate increased
with increasing glutamine concentration. The highest glutamate excretion
was, however, found in the glutamine free cultivation. Uptake of pyruvate
and serine as well as their importance as substrates increased with
decreasing glutamine concentration and were highest under glutamine
free conditions. This was accompanied by increasing excretion rates
for glycine. At high glutamine concentrations, glutamate is converted to
a-ketoglutarate feeding TCA cycle fluxes from a-ketoglutarate to
oxaloacetate. However, due to an increased flux from oxaloacetate to
phosphoenol pyruvate, fluxes from oxaloacetate to a-ketoglutarate were
only significantly increased at 8 mM glutamine, but not at lower glutamine
levels. The flux from oxaloacetate to phosphoenol pyruvate was reversed
(phosphoenol pyruvate to oxaloacetate) at glutamine free conditions,
resulting in anaplerotic feeding of carbon into the TCA cycle. The
glutamate dehydrogenase flux was reversed (a-ketoglutarate to glutamate)
at glutamine free conditions to produce glutamate for glutamine synthesis.
Waste product excretion was reduced in the fed-batch cultivations
compared to respective batch cultivations with 1, 2, or 8 mM glutamine.
TCA cycle fluxes decreased over time in cultivations with high glutamine
start concentrations and increased for cultivations with low initial
glutamine levels and the glutamine free cultivation. With glutamine
feeding, less variation of TCA cycle fluxes was observed.
Conclusions: Dynamic metabolic flux analysis is a suitable method to
describe the dynamics of growth and metabolism during batch and fedbatch cultivations with changing environmental conditions. For the batch
cultivations, we observed dose-dependent effects of 1 to 8 mM glutamine
start concentration. The fed-batch cultivations showed an intermediate
response. The glutamine free cultivation had a very different physiology.
Feeding of glutamine resulted in a reduced waste product excretion
compared to respective batch cultivations and TCA cycle fluxes showed
less variation during the cultivation process.
References
1. Niklas J, Heinzle E: Metabolic Flux Analysis in Systems Biology of
Mammalian Cells. Adv Biochem Eng Biotechnol 2011, 127:109-132.
2. Niklas J, Schräder E, Sandig V, Noll T, Heinzle E: Quantitative
characterization of metabolism and metabolic shifts during growth of
the new human cell line AGE1.HN using time resolved metabolic flux
analysis. Bioprocess Biosyst Eng 2011, 34:533-545.
3. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling using
HPLC allows classification of drugs according to their mechanisms of
action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011, 252:183-191.
P45
The optimization of a rapid low-cost alternative of large-scale medium
sterilization
Dominique T Monteil1, Cédric A Bürki2, Lucia Baldi1,2, David L Hacker1,
Maria de Jesus2, Florian M Wurm1,2*
1
Laboratory of Cellular Biotechnology, Faculty of Life Sciences, Ecole
Polytechnique Fédérale de Lausanne, 1015 Lausanne, Switzerland;
2
ExcellGene SA, 1870 Monthey, Switzerland
Background: One of the most important unit operations in upstream
animal cell bioprocesses at scales over 100 L is the preparation and
sterilization of the medium. This complex, sensitive, and expensive process
requires a considerable investment in both material and time [1].
Traditionally, large-scale medium sterilization is performed with costly
Page 64 of 151
single-use dead-end filters. To optimize and reduce the cost of this unit
operation, we investigated the sterilization of mammalian cell culture
medium at volumes larger than 100 L.
Materials and methods: In this study, an optimization of the cost and
time for the sterilization of cell culture medium at volumes larger than 100 L
was investigated. Pressure-volume diagrams were completed for both a
positive displacement pump (Watson-Marlow 620, Cornwall, England) and a
bearingless centrifugal pump (Levitronix PuraLev 600 MU, Zurich,
Switzerland) to determined optimal pumping speeds and pressures. The
study was completed using 0.25” ID tubing with a gate valve downstream of
the pump. The pressure (SciLog SciPres, Madison, WI, USA) and flow
rate (Equflow flowsensor, Ravenstein, Netherlands) were measured at
diffeFinarent closures of the valve. Independently, a range of different size
glass microfiber (GF) pre-filters were tested in combination with and without
the dead-end filters by measuring the turbidity (TN100, Eutech Instruments,
Singapore). A range of different 0.2 μm dead-end membrane filter materials
including polyethersulfone (PES), polyvinylidene fluoride (PVDF), and mixed
cellulose ester (ME) were tested using a positive displacement pump. In
addition, tangential flow filtration (TFF) was examined with both PES and ME
0.2 μm membranes in comparison to the dead-end filters. A mammalian cell
culture medium was filter sterilized at a starting pressure of 500 mbar. The
pressure and flow rate were recorded during the filtration until the
transmembrane pressure increased to 1200 mbar. The filtration was then
stopped at the pressure limit of the tubing connections. Specific filtered
medium volume, filter liquid flux rate, and filtrate turbidity were determined
for each membrane type.
Results: The pressure-volume diagram displayed a higher flow rate for the
bearingless centrifugal pump (6 to 7 Lpm) in comparison to the peristaltic
pump (2.5 Lpm) at the desired pressure of 1000 mbar (data not shown). The
turbidity for unfiltered, pre-filtered, and filtered medium was 2.5, 0.75, and
0.2 NTU, respectively, demonstrating the possible benefits of using a prefilter (data not shown). The filter liquid flux rates ranged from 3 to
25 L/min/m2 for the range of different filters. The PES hollow fiber TFF
filters (Spectrum Labs, Breda, Netherlands) displayed a flux rate of 10 L/min/m2
(Figure 1B). The specific filtered volume for the dead-end filters was up
to 300 L per m2 of filter surface, while the TFF filter was able to achieve over
1000 L of sterilely filtered medium per m2 of filter surface (Figure 1A).
Conclusions: The optimization of pumps for the sterile filtration of
mammalian cell culture was completed. Our results indicate that a
bearingless centrifugal pump could provide twice the flow rate at the
desired filtration pressure in comparison to a peristaltic pump. In addition,
the bearingless centrifugal pump was able to provide a constant flow in
comparison to the peristaltic pump. Pre-filters were found to clarify the
medium and thus could further reduce the cost of the filtration. The PES
hollow fiber TFF filter was able to filter over three times the sterile medium
volume in comparison to the dead-end filters. The TFF filters displayed a
similar range of filter liquid flux rates in comparison to the different filters
types. This study showed that a hollow fiber TFF coupled with the use of a
bearingless centrifugal pump provides a low-cost technology for the rapid
large-scale 0.2 μm sterilization of mammalian cell culture medium.
Acknowledgements: We gratefully acknowledge Stéphane ItartLongueville from Spectrum labs and Juerg Burkart from Levitronic GmbH
for their considerable support of equipment and material. This work has
been supported by the KTI-Program of the Swiss Economic Ministry and by
the Swiss National Science Foundation (SNSF).
Reference
1. Zhang X, Stettler M, De Sanctis D, Perrone M, Parolini N, Discacciati M, De
Jesus M, Hacker D, Quarteroni A, Wurm F: Use of orbital shaken
disposable bioreactors for Mammalian cell cultures from the milliliterscale to the 1,000-liter scale. Adv Biochem Eng Biotechnol 2010, 115:33-53.
P46
Improved fed-batch bioprocesses using chemically modified amino
acids in concentrated feeds
Ronja Mueller1, Isabell Joy-Hillesheim1, Karima El Bagdadi1, Maria Wehsling1,
Christian Jasper2, Joerg von Hagen1, Aline Zimmer1*
1
Merck Millipore, Pharm-Chemical Solutions - Research & Development
Upstream, Darmstadt, Germany; 2Merck KGaA, Performance Materials Advanced Technologies Synthesis, Darmstadt, Germany
Page 65 of 151
Figure 1(abstract P45) The calculated specific filtered volume displayed over the changing transmembrane pressure for a range of different
filter types (A). The calculated filter liquid flux rate for different filter types (B). The filter pore sizes were as followed: A - PVDF 0.45/0.22 μm, B - PES
0.2 μm, C - PES/PVDF 0.2/0.1 μm, D - GF/PVDF 0.5/0.2 μm, E - PES 0.8/0.2 μm, and F - PES 0.2 μm.
Background: Fed-batch culture bioprocesses are essential for the
production of therapeutic proteins [1]. In these cultures, concentrated
feeds are added during cultivation to prevent nutrient depletion and to
extend the growth phase, thus increasing product concentration [2]. One
limitation arises from the low solubility of some amino acids at high
concentrations, in particular tyrosine [3]. This amino acid is commonly
solubilized in separate feeds at basic pH [4] inducing pH spikes and
precipitation when added in the bioreactor. This work describes the
evaluation of several chemically modified tyrosines as alternative to
simplify fed-batch bioprocesses by using single feeding strategies at
neutral pH.
Materials and methods: For solubility experiments, increasing concentrations of modified tyrosines were solubilized in Merck Millipore proprietary
feed at pH 7,0 until reaching the maximum solubility. Stability was assessed
during 6 months in Merck Millipore proprietary medium and amino acids
(including modified tyrosine) were quantified by ultra performance liquid
chromatography using ACQ·Tag Ultra reagent (Waters).
For batch cultures, modified tyrosines were solubilized at a concentration of
4,5 mM in Merck Millipore proprietary medium depleted in unmodified
tyrosine. The control medium contained 1 mM tyrosine di-sodium salt. CHOS cells were seeded at 1.105 cells/ml in 50 ml spin tubes and incubated at
37°C, 5% CO2, 80% humidity and a rotation speed of 320 rpm. Growth and
viability were monitored during 11 days using Beckman Coulter ViCell®.
For fed-batch cultures, CHO-S cells expressing a human monoclonal
antibody were seeded at 2.105 cells/ml in medium containing tyrosine
di-sodium salt. Feeds were added every other day starting at day 3. In the
control, tyrosine di-sodium salt was added in a separate feed at pH 11
whereas modified tyrosines were solubilized in the main feed at pH 7,0.
Glucose was maintained at 4 g/L using a separate feed. Growth and viability
were monitored during 14 days using Beckman Coulter ViCell®.
For antibody analysis, IgG concentrations were determined by a
turbidometric method using Roche Cedex bio HT®. Intact mass analysis,
peptide mapping and glycan analyses were performed on samples from
day 14 using mass spectrometry and 2-aminobenzamide labeling followed
by ultra performance liquid chromatography.
Results: Solubility and stability experiments: Chemically modified
tyrosines demonstrated an increased solubility in concentrated feed at
neutral pH in comparison with tyrosine or tyrosine di-sodium salt (Table 1).
The highest solubility was achieved for the modified tyrosine 4 with a value
of 75 g/L. The stability was assessed by quantification of the modified amino
acid through ultra performance liquid chromatography. Moreover, no
precipitation was detected over a 6 months period indicating that the
chemical modification was stable in the tested conditions.
Batch and fed-batch cultures: The performance in batch culture was
determined using tyrosine depleted media and supplementation with the
different derivates. The growth of CHO-S cells with medium supplemented
with modified tyrosine 2 reached only 50% of the growth of the control
indicating that this molecule may not be able to be taken up by the cells
or to promote growth through alternative mechanisms. This derivate was
not evaluated further. Both modified tyrosines 3 and 4 induced a growth
comparable to the control culture until day 6 and were then able to
extend the growth during 2 additional days indicating that both derivates
can be used successfully in batch cultures.
In fed-batch mode, modified tyrosines 3 and 4 were solubilized in a
single concentrated feed at pH 7,0 and added to the culture every other
day starting at day 3. The growth of recombinant CHO-S cells obtained
with the derivates was similar to the control (where tyrosine di-sodium
salt was added through a separate feed at pH 11) reaching a maximum
viable cell density of 14.106 at day 7 (Figure 1A). The titer obtained after
14 days was equivalent in the two feeds and the new single feed process
with final titers around 1,5 g/l (Figure 1B) indicating no negative effect of
the chemical modification on productivity.
Impact of modified tyrosines on the monoclonal antibody quality
attributes: Intact mass, peptide mapping and glycosylation analyses were
performed on the monoclonal antibody to study the impact of modified
tyrosines on the final molecule. No significant difference could be established
in either the intact mass of the antibody or the detailed analysis of the
tryptic peptides by mass spectrometry. Glycosylation analysis indicated the
same overall glycosylation pattern with 8,2% GlcNac3Man3Fuc, 72,3% G0F,
7,4% Man5 and 8,5% G1F glycans. Altogether these data indicated that the
Table 1(abstract P46) Maximum solubility and stability of tyrosine derivates in Merck Millipore proprietary feed or
medium at pH 7,0
Molecule
Tyrosine
Tyrosine di-sodium salt
Modified Tyrosine 2
Modified Tyrosine 3
Modified Tyrosine 4
Solubility in concentrated
feed at pH 7,0
Not soluble
< 1 g/l
10 g/l
70 g/l
75 g/l
> 6 months
> 6 months
> 6 months
> 6 months
Stability in medium at pH 7,0 -
Page 66 of 151
Figure 1(abstract P46) Performance of the modified tyrosines in fed-batch culture. A: Viable cell density and viability during the fed-batch process.
B. IgG production during the fed-batch culture.
use of chemically modified tyrosines in concentrated feeds did not induce
any detectable modification of the monoclonal antibody.
Conclusions: The chemical modification of tyrosine can improve the
solubility of the amino acid by up to 70 fold.
Modified tyrosines are stable in chemically defined media and feeds and can
be used in batch and fed-batch mode. The use of these modified amino
acids in fed-batch bioprocesses has no detectable impact on the
monoclonal antibody or the recombinant protein produced. Altogether, this
study demonstrates that modified amino acids can be used successfully in
highly concentrated neutral feeds to improve and simplify next generation
fed-batch processes.
References
1. Butler M, Meneses-Acosta A: Recent advances in technology supporting
biopharmaceutical production from mammalian cells. Appl Microbiol
Biotechnol 2012, 96:885-894.
2. Wlaschin KF, Hu WS: Fedbatch culture and dynamic nutrient feeding. Adv
Biochem Eng Biotechnol 2006, 101:43-74.
3. Hitchcock DI: The Solubility of Tyrosine in Acid and in Alkali. J Gen Physiol
1924, 6(6):747-757.
4. Yu M, Hu Z, Pacis E, Vijayasankaran N, Shen A, Li F: Understanding the
intracellular effect of enhanced nutrient feeding toward high titer
antibody production process. Biotechnol Bioeng 2011, 108:1078-1088.
P47
Approaches for automized expansion and differentiation of human
MSC in specialized bioreactors
Anne Neumann1,2*, Antonina Lavrentieva2, Dominik Egger2, Tim Hatlapatka1,
Cornelia Kasper1
1
Department for Biotechnology, University of Natural Resources and Life
Sciences, 1190 Vienna, Austria; 2Institute for Technical Chemistry, Leibniz
University of Hannover, 30167 Hanover, Germany
Background and experimental approach: A main challenge in cell
therapies and other tissue regeneration approaches is to produce a
therapeutically significant cell number. For expansion of mesenchymal stem
cells (MSC) the cultivation on 2D plastic surfaces is still the conventional
procedure, even though the culture conditions differ significantly from the
3D environment in vivo. Additionally, static amplification of MSC is a labourintensive procedure. We therefore used a specialized rotating bed bioreactor
in order to maximize ex vivo expansion of MSC. MSC were isolated from
umbilical cord (UC) by explant method approach under xeno-free
conditions. UC-MSC were thereafter expanded under dynamic conditions in
a novel rotating bed bioreactor. The bioreactor system was designed to
enable integration of sensors for online monitoring of various parameters (e.
g. pH, pO 2 , pCO 2 ) and hence, allow ensured cultivation under well
controlled and reproducible conditions. Beside cell expansion, directed
differentiation of MSC was also achieved in bioreactors. MSC lack the ability
to grow in 3D direction and build functional tissue in vitro. Thus, it is
necessary to seed and culture MSC on 3D matrices to obtain functional
implants. For guided differentiation towards the osteogenic lineage, MSC
were cultivated on ceramic porous matrices under dynamic conditions.
Custom-made miniaturized perfusion bioreactors for parallel testing were
designed and optimized for that purpose.
Methods: MSC isolation was achieved as described previously [1]. Briefly,
umbilical cord tissue is cut into pieces (approx. 0.5 cm2) and cultivated for
10 days in aMEM containing 15% human serum in cell culture flasks. Cells
grow out of the tissue pieces and adhere to the cell culture plastic.
Subsequently, cells are harvested and subcultivated in aMEM containing
10% human serum.
UC-MSC were expanded in a rotating bed bioreactor (Figure 1A). The
bioreactor chamber is a cylindrical bioreactor shell, comprising an inlet
(bed) fixed to a magnet whereas the bioreactor chamber is hold by that
magnet to an engine. The inlay is rotating, while the shell is fixed. The inlay
comprises cell culture plastic slides with an all over surface of 2000 cm2,
requiring approximately 130 ml cell culture medium to be completely
covered. The bioreactor is equipped with a feed circulation for fresh medium
and removal of waste. An additional circulation to pH and pO 2 sensor
electrodes enables online monitoring. Sampling is performed through a
septum in the bioreactor shell. Gas mixture of air and CO2 is supplied by an
overlay stream. The whole bioreactor set up is situated in a GMP conform
breeder, enabling sterile handling as well as an environmental temperature
of 38°C. The system is connected to a control unit, which comprises gas
regulation, pumps and software for parameter set up and monitoring.
UC-MSC were seeded (1,500 cells/cm2) in the bioreactor for 24 h hours
and expanded for 5 days under dynamic conditions. Medium feed was
adjusted depending on glucose consumption. After 5 days of cultivations
UC-MSC were harvested by flushing the bioreactor with accutase for 20 min.
MSC were counted, examined regarding their senescence (b-galactosidase),
proliferation capacity (glucose/lactate) and differentiation potential
(Oil Red O, Alizarin Red, Von Kossa, Alcian Blue), as well as surface markers.
Perfusion bioreactors consist of a stainless steel tube in which the material is
inserted and a piston, which closes the reactors (Figure 1B). As the piston
can be adjusted in height a bioreactor can host materials with a diameter of
10 mm and a high of max. 10 mm. MSC-seeded ceramic materials (10 mm ×
3 mm) were inserted into the bioreactor. The bioreactors are connected to
Page 67 of 151
Figure 1(abstract P47) A) Rotation bed bioreactor for expansion of MSC and B) Perfusion bioreactors.
a medium reservoir, equipped with a sterile filter for gas exchange. The
volume of the bioreactor containing the ceramic material is 1,5 ml, the
overall volume of medium used for the cultivation is 10 ml. Dynamic
cultivation was achieved using flow rates of 0.3 and 1.5 ml/min. Viability was
examined using MTT Assay. Cell distribution throughout the scaffold was
investigated using DAPI staining. The status of differentiation was examined
using different histological stainings (e.g. Von Kossa, Calcein, Alizarin Red).
Results and discussion: UC-MSC isolated using explant method approach
fulfils MSC criteria, such as adherence to plastic surfaces, specific surface
marker pattern and differentiation potential towards at least the
adipogenic, chondrogenic and osteogenic lineage [1].
MSC expanded under dynamic conditions in a rotating bed bioreactor
also fulfil these MSC criteria. Furthermore it could be shown, that MSC
consume glucose and produce lactate during dynamic cultivation in the
rotating bed bioreactor and consequently proliferate. After 5 days of
cultivation MSC were investigated regarding their specific surface marker.
They express CD44, CD73, CD90 and CD 105 and lack CD 31, CD34 and
CD45.
MSC on ceramic materials could be shown to differentiate towards the
osteogenic lineage under static conditions. Also after dynamic cultivation
with a medium perfusion of 0.3 ml/min and even 1.5 ml/min cells adhere
on the macro porous ceramic material, were viable and equally distributed
throughout the scaffold. Seeding efficiency was found to be approximately
20%. Osteogenic differentiation could be achieved by cultivation in
perfusion bioreactors.
Conclusion: MSC could be successfully isolated from human umbilical
cord tissue. MSC expansion in the rotation bed bioreactor provides a high
number of cells, maintaining their stem cell properties such as specific
surface markers, proliferation capacity and differentiation potential.
Cultivation of MSC in perfusion bioreactors have been shown to support
and improve osteogenic differentiation as mechanical plays an important
role in directing MSC fate. Our results support the argument that the
application of tailor-made bioreactors are an essential step toward the
production of stem cell based therapeutics and tissue engineering
products.
Reference
1. Moretti P, Hatlapatka T, Marten D, Lavrentieva A, Majore I, Hass R, Kasper C:
Mesenchymal Stromal Cells Derived from Human Umbilical Cord Tissues:
Primitive Cells with Potentisl for Clinical and Tissue Engineering
Applications. Adv Biomedical Engin/Biotechol 2010, 123:29-45.
P48
Cell cycle and apoptosis in PER.C6® cultures
Sarah M Mercier1*, Bas Diepenbroek1, Dirk E Martens2, Rene H Wijffels2,
Mathieu Streefland2
1
Crucell, Leiden, The Netherlands; 2Bioprocess Engineering, Wageningen
University, Wageningen, The Netherlands
Background: PER.C6® is a human cell line designed for virus production,
which was immortalized by transformation with adenoviral E1A and E1B
genes. Expression of E1A is known to inhibit negative regulators of cell
cycle and E1B protein function analogously to an apoptosis inhibitor. As
changes in cell cycle and apoptosis are likely to affect cell’s ability for
viral infection and propagation, the study of these parameters in PER.C6®
cultures is essential to develop optimum virus production processes.
Materials and methods: Cell cycle distribution and apoptosis were
measured in batch and perfusion PER.C6® cultures using flow cytometry.
Propidium iodide was used to measure cell cycle distribution. Three
methods were used to measure apoptosis: staining of externalized
phosphatidylserine (PS) using annexinV, staining of activated caspases
using a fluorochrome-conjugated inhibitor of caspases, and staining of
fragmented DNA using BrdU incorporation and specific fluorescent
labeling. 7-ADD was used to stain dead cells with a permeable membrane.
Results: Significant cell death occurred in 14-days batches, when the main
carbon sources were depleted. Apoptosis was initially not detected by the
annexinV staining. However, activated caspases were detected after 6 days,
suggesting that apoptosis occurred in batch. In perfusion, where the
required nutrients were constantly supplied, no significant cell death or
induction of apoptosis occurred, showing that the cultures were maintained
in healthy conditions. At the end of batches, the portion of cells in S phase
increased drastically and the one in G0/G1 decreased. In perfusion, cell cycle
distribution was stable until 10 days, when a similar trend as the end of
batch was observed.
This is the first research describing apoptosis and cell cycle distribution in
PER.C6® batch and perfusion cultures. Our data are in accordance with the
theoretical effect of immortalization by the E1A/B system, which inhibits
apoptosis when nutrients are in excess and promotes the entry into the cell
division cycle.
P49
Scale-up considerations for monoclonal antibody production process:
an oxygen transfer flux approach
Laura Gimenez*, Claire Simonet, Laetitia Malphettes
BioTech Sciences, UCB Pharma SA, Braine l’Alleud, Belgium
Background: When scaling up a monoclonal antibody (mAb) production
process in stirred tank bioreactor, oxygen transfer is probably one of the
most challenging parameters to consider. Approaches such as keeping
constant specific power input or tip speed across the scales are widely
described in the literature and are often based on the assumption that
mammalian cells are sensitive to shear stress.
However, with the high cell densities reached in modern processes, such
scale-up strategies can lead to relatively high gas flow rate to compensate
low agitation speed which could be detrimental to cells in its own right.
As an alternative, we explored a scale-up strategy based on the overall
oxygen transfer flux (OTF) required by the cell culture process. OTF was
defined as directly proportional to oxygen transfer coefficient (kLa) and
oxygen enrichment in the gas mix. This way the overall gas flow can be
kept at relatively low values, while satisfying the oxygen requirements of a
high cell density culture.
Materials and methods: Process scale-up between 3 different stirred tank
bioreactors was studied: a 2 L glass bioreactor (Sartorius Stedim Biotech)
equipped with one 3-segment blade impeller, a 10 L glass bioreactor
(Sartorius Stedim Biotech) equipped with two 3-segment blade impellers
and a 80 L stainless steel bioreactor (Zeta Biopharma) equipped with two
elephant ear impellers.
Oxygen transfer coefficients (k L a) were determined for the chemically
defined production medium, using the dynamic technique of oxygen
adsorption. The statistical analysis software JMP (SAS) was then used in
order to express kLa’s according to the following equation: kLa = A * (P/V) a
* Vsb, P/V being volumetric power input [W.m-3] and Vs being superficial air
velocity [m.s-1], and to analyze our results.
Oxygen transfer flux was defined as followed: OTF = kLa * (%O2 in the
gas mix/% O2 in air).
For cell culture experiments, bioreactors were inoculated with a CHO cell line
producing a mAb. Cells were cultivated in chemically defined media for a
14-day fed-batch process. The culture was controlled to maintain the desired
process parameters (temperature, pH, dO2 and glucose concentration). dO2
level was maintained using a cascade aeration. Viable cell density (VCD) and
viability were monitored by Trypan blue dye exclusion using a Vicell XR
(Beckman Coulter). Glucose and lactate concentrations were determined
using a Nova Bioprofile 400 analyzer (Nova Biomedical). Offline dissolved CO2
and osmolality were measured with a Nova Bioprofile pHox (Nova
Biomedical) and Osmo 2020 (Advanced Instrument) analyzers respectively.
mAb concentrations were determined by Protein A HPLC.
Results: kLa mapping of 2 L, 10 L and 80 L bioreactors: The 2 L and
10 L bioreactors were characterized for a range of superficial gas velocity
going from 5.0 × 10-5 to 4.0 × 10-4 m.s-1 and the 80 L for a range going from
2.0 × 10-4 to 1.2 × 10-3 m.s-1. Specific power input was ranged from 10 to
90 W.m-3 for the 2 L bioreactor, 20 to 130 W.m-3 for the 10 L bioreactor and
5 to 80 W.m-3 for the 80 L bioreactor. Models were generated with JMP and
gave the following equations for kLa [s-1]:
2 L bioreactor: kLa = 6.37 × 10-2 * (P/V)0.28 * Vs0.59 (R2 = 0.98, Prob>F:
<0.0001)
10 L bioreactor: k L a = 4.07 × 10 -2 * (P/V) 0.55 * Vs 0.67 (R 2 = 0.91,
Prob>F: <0.0001)
80 L bioreactor: k L a = 5.53 × 10 -2 * (P/V) 0.72 * Vs 0.77 (R 2 = 0.92,
Prob>F: <0.0001)
Scale-up of aeration and agitation strategy of a monoclonal
antibody production process using a constant OTF approach: The
cell culture process was initially developed at 2 L and 10 L scale. Maximum
Oxygen Transfer Flux was determined at maximum cell density for these
two scales. This maximum OTF was kept constant for scaling up to 80 L
(Table 1). From kLa mapping of the 80 L bioreactor, appropriate P/V, Vs and
O2% values were chosen in order to reach the target OTF.
Page 68 of 151
Table 1(abstract P49) Determination of aeration and
agitation strategy in the 80 L bioreactor, based on the
maximum OTF required by the cells at 2 L and 10 L scales
2L
-3
10 L
80 L
P/V [W.m ]
30
69
80
Vs [×10-4 m.s-1]
0.94
3.53
4.03
kLa [×10-3 s-1]
0.70
1.43
3.85
%O2 in gas mix
74
90
OTF max [×10-3 s-1]
2.44
6.11
30
Target OTF for 80 L
= 10 L OTF
®
5.55
To confirm that high specific power input are well tolerated by CHO cells,
the fed-batch process was first run in two 2 L bioreactors (Figure 1a).
Agitation speed was set at 250 rpm (20 W.m-3) in the first bioreactor and at
400 rpm (90 W.m-3) in the second bioreactor. In the high agitation condition,
the maximum VCD was 1.8-fold higher, viability remained above 80% (versus
60% in the low agitation condition) and mAb titer was 2.2-fold higher.
Our model fed-batch process was then run in our 80 L bioreactor, using
the aeration strategy defined in Table 1. Figure 1b, c and 1d show that the
process was successfully scaled-up from 2 L and 10 L to 80 L bioreactor.
Conclusions: Thanks to extensive characterization of aeration conditions
in 2 L, 10 L and 80 L bioreactors, the oxygen transfer flux approach
enabled to have a sufficient aeration and comparable process performance
across the scales, including dCO 2 profile. The same strategy will be used
for further scale-up of the process to 2000 L. However, the results also
revealed that our 2 L scale model should be re-assessed to become more
predictive of 10 L and 80 L scales.
Acknowledgements: This work was carried out within the Cell Culture
Process Sciences laboratories of UCB Pharma SA, Braine l’Alleud, Belgium.
P50
Improvement of production rate on recombinant CHO cells in twostage culture
Hiroshi Matsuoka*, Chie Shimizu, Mihoko Tazawa
Dept. Lifesciences, Teikyo University of Science, Tokyo, 120-0045, Japan
Background: Cultivation temperature is a key environmental parameter
that influences cell growth and recombinant protein production.
Recombinant CHO (rCHO) cells are usually cultivated at 37 °C. Although
lowering culture temperature below 37 °C decrease specific growth rate, in
many cases, the specific production rate, q, of CHO cells was not enhanced
by lowering the culture temperature. Unlike the specific growth rate,
effects of low temperature cultivation on specific productivity rate are not
so clear [1]. In the present study, we investigated the effect of low
temperature cultivation on rCHO cell growth and production rate. We
proposed a two-stage culture that the cultivation was carried out at 37 °C
and then a culture temperature become lower. We report that the final
production concentration by the two-stage culture is higher than that in
case of a flat temperature at 37 °C.
Materials and methods: CRL-10052 was used as the cell line of rCHO,
which is the CR1 plasmid was transfected to CHO cells. Target product is the
soluble CR1, sCR1, which is a soluble form of a human complement receptor
type1, could be expressed and secreted by rCHO [2]. Although an original
rCHO was an adherent cell, we changed it to be a floating one and used in
this experiment. Batch cultivations were carried out in a 1 L-fermentor with
a 400 mL working volume at various temperatures. pH and DO were
maintained at 7.2 and 40% of air saturation by CO2 and O2, respectively.
Agitation speed was 100 rpm. A serum-free medium on the basis of IMDM
with 1% penicillin-streptomycin-neomycin antibiotics mixture was used. An
initial cell concentration was 3 × 105 ml-1 and cultivation was ceased when
cell concentration below 1 × 10 5 cells mL -1 . sCR1 concentration was
determined by using HPLC gel filtration column chromatography (TSK gel
Page 69 of 151
Figure 1(abstract P49) Cell culture process performance at 2 L, 10 L and 80 L scale. a) Impact of agitation speed on VCD and mAb titer at 2 L scale.
b) Comparison of VCD, viability and mAb titer obtained in 2 L, 10 L and 80 L bioreactors. c) Comparison of osmolality, glucose and lactate profiles
obtained in 2 L, 10 L and 80 L bioreactor. d) Online pH and dCO2 levels obtained in 2 L, 10 L and 80 L bioreactors.
G3000SWXL, TOSOH), in which the Tris buffer (pH = 7.4) containing 0.05%
CHAPS was used as elution buffer.
Results: All batch cultivations were carried out until viable cells become
equal to zero. Cells grew well at more than 33 °C, however cells didn’t grow
at 30 °C. Compared to 37 °C-cultivation, lower specific growth rates were
observed in the lower temperature cultivations. The specific production rate
of sCR1, qsCR1, was obtained by the slope of relationship between sCR1
concentration and time integrated cell concentration within a linear range.
The qsCR1 at each temperature were the almost same except at 30 °C.
The final sCR1 concentrations at 33 °C was rather higher than those at 37
and 35 °C. The cell concentration in stationary phase, XS, at 33 °C was lower
than those at 37 and 35 °C. Thus the ratio of the final sCR1 concentration to
X S at 33 °C was the highest in case of more than 33 °C. The final sCR1
concentration to XS at 30 °C is rather higher than that at 33 °C, however it
makes no sense because of the extremely low specific growth rate at 30 °C.
In order to increase the final sCR1 concentration, we proposed a two-stage
culture that at first cultivation temperature was set to 37 °C and then a
culture temperature became lower at late logarithm phase. Thus the final
sCR1 concentration by using a two-stage culture, in which the temperature
was 37 °C initially and changed to 33 °C after 120 h-cultivation, increased
by 1.75 and 1.99, compared as a flat temperature culture at 33 °C and
37 °C, respectively (Figure 1, Table 1).
Conclusions: The conclusions are as follows:
1. It was shown that the ratio of the final sCR1 concentration to the cell
concentration in stationary phase was rather higher at lower temperature
than that in 37 °C-cultivation.
2. A two-stage cultivation with temperature change from 37 °C to lower
temperature was proposed and it was shown that the final product
concentration was considerably improved.
References
1. Yoon SK, Song Ji Y, Lee GM: Effect of low temperature on specific
productivity, transcription level, and heterogeneity of erythropoietin in
Chinese hamster ovary cells. Biotechnol Bioeng 2003, 82:289-298.
2. Kato H, Inoue T, Ishii N, Murakami Y, Matsumura M, Seya T, Wang PC:
A novel simple method to purify recombinant soluble human
complement receptor type 1 (sCR1) from CHO cell culture. Biotechnol
Bioprocess Eng 2002, 7:67-75.
P51
HEK293 cell culture media study: increasing cell density for different
bioprocess applications
Leticia Liste-Calleja*, Martí Lecina, Jordi Joan Cairó
Chemical Engineering Department, Universitat Autònoma de Barcelona,
Cerdanyola del Vallès, 08193, Spain
Background: The increasing demand for biopharmaceuticals produced in
mammalian cells has lead industries to enhance bioprocess volumetric
productivity through different strategies. Among them, media development
is of major interest [1]. According to the increasing constraints regarding the
use of animal derived components on industrial bioprocesses but also the
drawbacks of its depletion from cell culture [2], the main goal of the present
work was to provide different cell culture platforms which are suitable for a
wide range of applications depending on the type and the final use of the
product obtained.
Page 70 of 151
Figure 1(abstract P50) Time courses of cell-cultivation: (a) 37 °C, (b) two-stage cultivation (37 °C to 33 °C after 120 h).
Table 1(abstract P50) Comparison of culture parameters at various temperatures
30 °C
-1
33 °C
35 °C
37 °C
37 °C®33 °C
specific growth rate [h ]
>0.0002
0.0072
0.0107
0.0136
-
qsCR1 [109 g cells-1 h-1]
0.0304
0.0416
0.0407
0.0446
-
final sCR1 [mg/mL] (a)
3.04
8.68
8.11
7.67
15.2
XS [10 cells/mL] (b)
0.223
0.788
1.09
1.15
1.20
(a)/(b)
13.6
11.0
7.43
6.68
12.7
6
Materials and methods: The cell line HEK293SF-3F6 employed in this
study was kindly provided by Dr. A.Kamen, NRC-BRI. The basal media
tested were CDM4HEK293, SFM4HEK293 and SFMTransFx-293 (Hyclone,
Thermo Scientific) supplemented -when indicated- with FBS (Invitrogen)
and/or Cell Boost 5 (80 g/L) (Hyclone, Thermo Scientific). Viable cell
density and viability were determined by trypan blue exclusion method
and manual counting using an haemocytometer. The adenovirus strain
HAdV-5(ΔE1/E3) encoding pCMV-GFP was used for infection experiments.
All infections were carried out at MOI≈1 TOI≈0.5 × 106cell/mL in 6-wellplate. Harvesting was performed 48 hpi.
Viral titration was performed by Flow cytometry on a FACS Canto
(Becton and Dickinson, Bioscience) by adaption of a protocol previously
described [3].
Results: The first part of this work was focused on screening different
serum-free cell culture media specifically recommended for HEK293
cell line. As shown in Figure 1A top panel, cultures performed in HyQ
SFM4HEK293 and HyQ SFMTransFx-293 showed better cell growth than
HyQ CDM4HEK293, reaching maximum cell densities of about 3.5 × 106
cell/mL, 2 × 106 cell/mL and less than 1 × 106 cell/mL respectively. In order
to evaluate whether the substitution of critical serum components have
satisfactorily been performed in the media tested without affecting cell
growth, the addition of fetal bovine serum (FBS) was assessed. FBS
depletion was acceptable only in HyQ SFM4HEK293 as the other cell media
reached higher cell densities when FBS was added (up to 7-fold increment
of Xv max ). Regarding the screening of Animal derived component free
supplements, three chemically defined supplements were tested but only
one (Cell Boost 5, onwards CB5) significantly enhanced cell growth. This
supplement enabled to reach higher cell densities in all media tested:
2-fold up in HyQ SFM4HEK293 and CDM4HEK293 and 5-fold increment in
HyQ SFMTransFx-293 (Figure 1A, bottom panel).
The results obtained so far showed that supplementation of all cell media
tested is recommended in order to achieve higher cell density cultures.
Among all the conditions, HyQSFMTransFx-293 was the media which
supported the highest Xv max with both supplements (FBS and CB5).
Therefore, this medium was selected for tuning the final concentration
of each supplement. Among the studied concentration range for FBS
(2.5-10% v/v) and for CB5 (2.5-20%) it was determined that the best
conditions were 5% for FBS and 10% for CB5 solution. At these
concentrations, Xvmax achieved were (7.14 ± 0.56*106 cell/mL) and (12.63 ±
1.76*10 6 cell/mL) respectively (Figure 1B). Interestingly, CB5 enabled to
extend μmax phase while FBS increased μmax value, as previously detected in
the initial media screening (Table 1). The combination of supplements (5%
FBS and 10%CB5) resulted in an Xvmax as high as 16.77 ± 0.70 × 106cell/mL
in batch culture, with an increment in specific growth rate of 15% in
comparison to those cultures in which FBS was deprived. Specific growth
rate was maintained for 144 h of cell culture.
From the range of applications in which HEK293 can be used, the work
carried out in this work was directed to recombinant adenovirus production.
Hence, the evaluation of the effect of supplementation in the cell media
selected on adenovirus infection efficiency and final titer obtained was
evaluated (Figure 1C). Efficiency of infection was around 63% as expected
for an effective infection [4] in all conditions. In regards to adenovirus
production, FBS increased it up to fivefold, whereas CB5 supplementation
did not affect significantly, and the addition of both supplements almost
doubled the viral production in comparison to basal medium. It is proposed
that an increment of osmolarity due to the addition of both supplements
might explain the slight reduction on productivity in comparison to the
addition of FBS solely [5].
Conclusions: Two culture platforms are proposed for two possible
scenarios in basis of the Xv max reached: (1) HyQSFMTransFx-293 CB5
Page 71 of 151
Figure 1(abstract P51) (A) Comparison of cell growth profiles of HEK293 cell cultures in serum-free cell media (top panel) and in the same cell media
FBS supplemented (middle panel) or CB5 supplemented (bottom panel). (B) HyQ SFMTransFx-293 cell cultures with the best concentrations encountered
for FBS and CB5 and combination of supplements. (C) Evaluation of the effect of supplement addition on efficiency of infection and Viral Titer obtained.
Table 1(abstract 51) Kinetic parameters for HEK293 cell cultures corresponding to the profiles depicted in Figure 1
No adition
5% FBS
5%CB5
HyQ CDM4HEK293
HyQ SFM4HEK293
HyQ SFMTransFx-293
Xvmax (×106 cell·mL-1)
0.85 ± 0.0
3.53 ± 0.21
2.1 ± 0.12
μmax (×10-2 h-1)
1.06 ± 0.01
2.46 ± 0.14
2.43 ± 0.03
tμ (h)
96
74
74
Xvmax (×106 cell·mL-1)
μmax (h-1)
6 ± 0.0
2.61 ± 0.04
4.67 ± 0.48
2.8 ± 0.05
7.02 ± 0.06
2.67 ± 0.01
tμ (h)
95
71
72
Xvmax (×10 cell·mL )
4.11 ± 0.33
7.29 ± 0.18
9.75 ± 0.25
μmax (h-1)
2.1 ± 0.06
2.06 ± 0.03
2.17 ± 0.03
tμ (h)
92
69
116
6
-1
supplemented -10% v/v- for animal derived component Free required
bioprocesses (Xvmax= 12.6 × 106 cell/mL) and (2) HyQSFMTransFx-293 FBS
and CB5 supplemented -5% and 10% v/v respectively- for animal derived
component containing bioprocesses (Xvmax= 16.7 × 106 cell/mL). In both
cases, μmax and tμ values were preserved or even improved with respect to
basal media and any of the supplements negatively affected the adenovirus
production when compared to non-supplemented infections.
Acknowledgements: We would like to thank Dr. Amine Kamen (BRI-NRC,
Canada) for kindly providing the HEK 293 cell line.
References
1. Burgener A, Butler M: Medium Development. Cell Culture Technology For
Pharmaceutical And Cell-Based Therapies Boca Ratón, FL: CRC Press: Ozturk S,
Hu WS, 1 2006, 41-80.
2. Keenan J, Pearson D, Clypes M: The role of recombinant proteins in the
development of serum-free media. Cytotechnology 2006, 50:49-56.
3. Gálvez J, Lecina M, Solà C, Cairó JJ, Gòdia F: Optimization of HEK-293S cell
cultures for the production of adenoviral vectors in bioreactors using
on-line OUR measurements. J Biotech 2012, 157:214-222.
4.
5.
Condit RC: Principles of Virology. Fields Virology Lippencott: Williams and
Wilkins: Knipe DM, Howley PM , 5 2007, 25-58.
Dormond E, Perrier M, Kamen A: From the first to the third generation
adenoviral vector: what parameters are governing the production yield?
Biotechnology advances 2009, 27:133-144.
P52
Preliminary studies of cell culture strategies for bioprocess
development based on HEK293 cells
Leticia Liste-Calleja*, Jonatan López-Repullo, Martí Lecina, Jordi Joan Cairó
Chemical Engineering Department, Universitat Autònoma de Barcelona,
Cerdanyola del Vallès, 08193, Spain
Background: The use of human embryonic kidney cells (HEK293) for
recombinant protein or virus production has gained relevance along the
last years. They are specially recommended for transient gene expression
and adenovirus or adeno-associated virus generation [1,2]. To achieve
high volumetric productivities towards bioprocess optimization, the
concentration of biocatalizer (i.e. animal cells) must be enhanced. The
limits for cell growth are mainly related to the accumulation of metabolic
by-products, or the depletion of nutrients [3]; therefore, cell cultures
strategies must be developed. In this work, we have explored Punctual
Feeding and Media Replacement cell culture strategies to over perform
the limit on Xvmax encountered on batch culture mode. Finally, we scaled
up cell culture in order to control other parameters (i.e. pO2) that could
be limiting cell growth.
Materials and methods: The cell line used in this study was HEK293SF-3F6
(kindly provided by Dr. A.Kamen, NRC-BRI). The basal medium for all cell
cultures was SFMTransFx-293 (Hyclone, Thermo Scientific) supplemented
with 5% (v/v) of FBS and 4 mM GlutaMAX (Gibco, Invitrogen). For Punctual
Page 72 of 151
Feeding and FedBatch Fementation Cell Boost 5 (Hyclone, Thermo Scientific)
was used. Batch, media replacement and punctual feeding experiments
were performed in 125-ml plastic shake flasks (Corning Inc.) shaken at
110 rpm in an orbital shaker at 37°C, 95% humidity, 5% CO2 incubator.
FedBatch Fermentation was carried out in Bioreactor Braun-MCD (2 L) with
mechanical agitation at 80 rpm, pH set point 7.1 and pO2 set point 50%.
Viable cell density and viability were determined by trypan blue exclusion
method and manual counting using a haemocytometer. Glucose and lactate
were analysed in an automatic analyser, YSI (Yellow Springs Instrument,
2700 Select).
Results: Characterization of HEK293 cell culture in batch operation was
initially performed. It was encountered that cell growth was extended for
168 h reaching approximately 7·106 cell/mL of cell density (Figure 1.1).
Nevertheless, maximal cell growth rate (μ max ) was only maintained for
96 h. As glucose and lactate were not at limiting concentrations [4],
Figure 1(abstract P52) Comparison of HEK293 cell growth, viability, glucose and lactate profiles in different cell culture strategies.
nutrient limitation different from glucose arose as the first hypothesis for
this decrease on cell growth rate. Therefore, punctual additions of
nutritional supplement for HEK293 were carried out. Xv max was
significantly increased in comparison to basal media, reaching cell
densities as high as 17·106 cell/mL (Figure 1.2). Nevertheless, we could not
overcome this limit on Xvmax regardless the number of punctual feedings
performed. Moreover, nutrient addition did not elongate μmax period (tμ).
These results suggested that by-product accumulation different from
lactate could be limiting cell growth. In order to validate the hypothesis,
complete media replacement (up to three replacements) was studied
(Figure 1.3). Although this strategy enabled to extend tμ up to 168 h of cell
culture, the maximal cell density reached was similar to nutrient addition
strategy (1MR: 12·106 cell/mL; 2MR: 16·106 cell/mL; 3MR: 18·106 cell/mL).
This limit on Xv max encountered on shake flask might be related to a
limitation on pO2. Thus, the cell culture system was changed towards a
bioreactor with controlled pO 2 (maintained between 20-60% of air
saturation). In addition, a continuous feeding using a pre-fixed profile
addition was implemented. As it can be noticed in Figure 1.4, FedBatch
operation in bioreactor enabled to beat the limit encountered in shake
flask system, reaching cell densities of 27·106 cell/mL.
Conclusions: Punctual feeding and media replacement overcame the limit
of 7·10 6 cell/mL encountered in batch mode operation indicating that
nutrient depletion was one of the causes of that limit. Nevertheless, the
elongation of tμ found out performing MR suggests that the accumulation
of by-products might not be ruled out.
The new limit on Xvmax (≈17-18·106 cell/mL) encountered regardless the
cell culture strategy, was outperformed by transferring O 2 more
efficiently in bioreactor system, reaching cell densities as high as Xvmax =
27·106 cell/mL. The monitoring and control of cell culture parameters (i.e.
pO 2 , pH) will enable to develop more accurate feeding strategies in
order to achieve higher cell densities than those presented here (on
going work).
Acknowledgements: We would like to thank Dr. Amine Kamen (BRI-NRC,
Canada) for kindly providing the HEK 293 cell line.
References
1. Nadeau I, Kamen A: Production of adenovirus vector for gene therapy.
Biotechnology advances 2003, 20:475-489.
2. Geisse S, Fux C: Recombinant protein production by transient gene
transfer into Mammalian cells. Methods in Enzymology 2009,
463:223-238.
3. Butler M: Animal cell cultures:recent achievements and perspectives in
the production of biopharmaceuticals. Appl Microbiol Biotechnol 2005,
68:283-291.
4. Petiot E, Jacob D, Lanthier S, Lohr V, Ansorge S, Kamen A: Metabolic and
Kinetic analyses of influenza production in perfusion HEK293 cell
culture. BMC Biotechnol 2011, 11:84-96.
P53
Adhesion and colonization of mesenchymal stem cells on polylactide or
PLCL fibers dedicated for tissue engineering
Frédérique Balandras1, Caroline Ferrari1, Eric Olmos1, Mukesh Gupta2,
Cécile Nouvel2, Jérôme Babin2, Jean-Luc Six2, Nguyen Tran3,
Isabelle Chevalot1, Emmanuel Guedon1*, Annie Marc1
1
CNRS, Laboratoire Réactions et Génie des Procédés, UMR 7274, Université
de Lorraine-ENSAIA, 2 avenue de la forêt de Haye, TSA 40602, F-54518
Vandoeuvre-lès-Nancy Cedex, France; 2CNRS, Laboratoire de Chimie Physique
Macromoléculaire, FRE 3564, Université de Lorraine-ENSIC, 1 rue Grandville,
54000 Nancy Cedex, France; 3École de Chirurgie, Faculté de Médecine,
Université de Lorraine, F-54500 -Vandœuvre-lès-Nancy, France
Background: Tissue engineering covers a broad range of applications
dedicated to the repair or the replacement of part or whole tissue such as
blood vessels, bones, cartilages, ligaments, etc [1]. Practically, a bio
substitute, made with cells cultivated on scaffold, is needed. Mesenchymal
stem cells (MSC) are generally the most suitable cells for such application
since they are self-renewable with a great potential for differentiation and
immuno suppression [2]. However, materials used for bio functional
scaffold synthesis have to meet several criteria, such as biocompatibility
and biodegradability. Thus, the aim of the study was to screen several
Page 73 of 151
Table 1(abstract 53) Composition of co-polymers used in
this study
Commercial PLCL
70% L-LA
30% CL
MKG58
70% D, L-LA
30% CL
MKG64
-
100% CL
MKG70
MKG71
50%L-LA
100%D, L-LA
50% CL
-
MKG74
100%L-LA
-
LA: lactic acid; CL: ε-caprolactone
biopolymers differing in their composition for their capability to promote
adhesion and growth of MSC.
Materials and methods: Porcine MSC were cultivated in a-MEM
supplemented with 10% serum and FGF2. For cell adhesion experiments,
6(co)polymers (Table 1) were synthesized and tested.
Fibres of polymers were electrospun on 4 cm2 cover glasses. Briefly, the
polymer solutions are introduced into a syringe with various flow rates and
an electrical field is applied, resulting in the formation of a polymer jet on
cover glasses or on any surfaces. Then, cover glasses were put onto 6 wells
plate before to be seeded with MSC. Then, cell adhesion and colonization
of polymer fibres were monitored by microscopy and counted using
Guava Viacount assay after trypsine treatment as already described [3].
Results: With the aim of studying and identifying new materials dedicated
to scaffold manufacturing for tissue ingineering, MSC were cultivated on
various (co) polymers. These polymers, made with lactic acid (L and/or D)
and/or caprolactone (blue bars; MKG 58, 64, 70, 71 and 74) in comparison
with a commercial PLCL (red bars), were electrospun on cover glasses in
order to functionalize them. Then MSC were cultivated on theses
functionalized cover glasses at two initial cell seeding (10 000 and 60 000
cells) during 200 hours (Figure 1).
Whatever the polymer used and the initial cell seeding, cells were able to
adhere and to colonize fibres. A cell multiplication factor ranging from 6.5 to
22 was measured after 200 hours of culture depending on the polymer
composition and the initial seeding. However, compared to the commercial
PLCL, the total cell number was strongly increased with MKG 71 (21 and
50%), MKG 74 (34 and 34%) and MKG 58 (15 and 40%) whereas a moderate
growth was observed with MKG 64 (9 and 30%) at an initial seeding of
10 000 and 60 000 cells respectively. MKG 70 did not improve the cell
growth compared to the commercial polymer (> 5% for both seeding).
Conclusion: In this study, porcine MSC were cultivated on various (co)
polymers made with lactic acid (L and/or D) and/or caprolactone. Our results
demonstrated that composition of these (co)polymers strongly influences
MSC growth and colonization. Indeed, polymers such as MKG 58, 71 and 74
appeared to promote MSC growth contrary to other polymers tested, i;e
MKG 64 and MKG 70, compared to the commercial one. Therefore, MKG 58,
71 and 74 could be favoured for further scaffold synthesis.
References
1. Caplan AI: Adult mesenchymal stem cells for tissue engineering versus
regenerative medicine. J Cell Physio 2007, 213:341-347.
2. Chamberlain G, Fox J, Ashton B, Middleton J: Concise review:
Mesenchymal stem cells: Their phenotype, differentiation capacity,
immunological features, and potential for homing. Stem Cells 2007,
25:2739-2749.
3. Ferrari C, Balandras F, Guedon E, Olmos E, Chevalot I, Marc A: Limiting cell
aggregation during mesenchymal stem cell expansion on microcarriers.
Biotechnol Prog 2012, 28:780-787.
P54
Cell cycle and apoptosis: a map for the GS-NS0 cell line at the genetic
level and the link to environmental stress
Chonlatep Usaku, David Garcia Munzer, Efstratios N Pistikopoulos,
Athanasios Mantalaris*
Biological Systems Engineering Laboratory, Centre for Process Systems
Engineering, Department of Chemical Engineering, Imperial College London,
London, SW7 2AZ, UK
Page 74 of 151
Figure 1(abstract P53) Quantitative evaluation of MSC growth on poly lactide/caprolactone polymers. Two initial MSC seeding, 10 000 and 60 000
cells, were carried out. The red stars indicate a significant increase in final cell number compared to the control (commercial PLCL).
Background: Large scale mammalian cell culture systems, especially fedbatch systems, are currently utilised to manufacture monoclonal
antibodies (MAbs) in order to meet the continuously growing global
demand [1]. Nutrient deprivation and toxic metabolite accumulation
commonly encountered in such systems influence the cell cycle and
trigger apoptosis, resulting in shorter culture times and a lower final MAb
titre. Control of the cell cycle has been previously studied in order to
achieve higher titre through apoptosis inhibition by bcl-2 overexpression
and cell cycle arrest in G 1 /G0 by p21 transfection. However, the above
mentioned strategies have not always been successful; no improvement in
titre was often observed though bcl-2 over-expression helped prolong the
culture viability whereby the majority of cells were arrested at G1/G0 to
avoid apoptosis [2-4]. Thus, a systematic insight of the dynamic relation
between metabolic stress, cell cycle and apoptosis is still required. To this
end, we aim to establish a novel map of the dynamic interplay between
cell cycle and apoptosis at the genetic level, and provide a link with the
culture conditions at the metabolic level.
Materials and methods: Batch culture of GS-NS0 producing a cB72.3
MAb was performed. Cell density and viability was quantified using the
dye exclusion method. Extracellular glucose, glutamate, lactate and
ammonium were quantified using Bioprofile 400 (Nova Biomedical,
Waltham, USA). The extracellular antibody was measured using ELISA. DNA
staining and Annexin V/PI assay was used to quantify the fraction of cells
in each cell cycle phase as well as the degree of apoptosis. The
measurement of both apoptosis and cell cycle related gene expression was
conducted using real-time PCR.
Results and discussion: Our results showed a clear link between the
environmental factors and gene expression. The batch cultures started
with a high fraction of cells in the G1/G0 phase, which rapidly left this state
in order to join the proliferating population. Soon after, glutamate
deprivation occurred at around 50 h of culture, whereby atf5 upregulation
peaked (50% higher) suggesting that glutamate deprivation is among the
first factors that introduce metabolic stress, in agreement with previous
results [5]. The upregulation of atf5 triggered the upregulation of bcl-2
(which followed at around 90 h). After the batch cultures reached their
maximum cell density (which occurred roughly the same time as the
glutamate exhaustion), the onset of an increasing early apoptotic cell
population was observed - around 10%. Together with the high cell
density, casp8 was upregulated (100% increase). Consequently, the
expression of casp3 followed a similar trend with a lag of few hours as its
protein, caspase-3, is one of downstream targets of caspase-8 and a final
executor of the apoptosis pathways [6]. In addition, trp53bp2 showed a
similar trend to casp3. These results suggest that apoptosis could initially
occur via the death receptor pathway as marked by the casp8 upregulation,
which might be induced by the glutamate exhaustion and/or the cell
density peak. However, given that the trp53bp2 upregulation happened later
than that of casp8 suggests that apoptosis in the later stages of culture
might also occur through the mitochondrial pathway and it could also be
triggered by other lethal signals (e.g. high level of lactate accumulation).
As soon as the onset of apoptosis occurred, the upregulation of p21 was
also observed (300% increase) and this happened simultaneously with the
bcl-2 upregulation. Since it was reported that Bcl-2 protein helps facilitate
cell cycle arrest at G1/G0 phase and an increase in G1/G0 cell fraction was
observed later in the death phase of culture, this could suggest that
the bcl-2 upregulation may underlie the p21 upregulation and the cell
cycle arrest at G 1 /G 0 phase and this could be a mechanism to avoid
apoptosis [7].
Conclusions: These findings set a map of the cell cycle and apoptotic
timing and magnitudes of the events from the genetic level and their links
to the environmental conditions, which can be used to gain insight of the
GS-NS0 cultures. By looking at the map, we can systematically analyse
cellular responses to the environmental conditions which may have
detrimental effect on the culture and utilise the result of the analysis to
tackle the culture issues way before the final executors, but at the genetic
level. Ultimately, the goal is to utilize mathematical models that will help
to establish new strategies in order to achieve a longer cultivation period,
high viability and increased MAb titre.
Acknowledgements: We would like to thank Lonza Biologics (Slough,
UK) for kindly providing the cell line and members of Biological
Systems Engineering Laboratory (BSEL) for help with the analytical
techniques.
References
1. Elvin JG, Couston RG, van der Walle CF: Therapeutic antibodies: Market
considerations, disease targets and bioprocessing. International Journal of
Pharmaceutics 2013, 440:83-98.
2. Simpson NH, Singh RP, Emery AN, Al-Rubeai M: Bcl-2 over-expression
reduces growth rate and prolongs G1 phase in continuous chemostat
cultures of hybridoma cells. Biotechnology and Bioengineering 1999,
64:174-186.
3. Tey BT, Singh RP, Piredda L, Piacentini M, Al-Rubeai M: Bcl-2 mediated
suppression of apoptosis in myeloma NS0 cultures. Journal of
Biotechnology 2000, 79:147-159.
4.
5.
6.
7.
Watanabe S, Shuttleworth J, Al-Rubeai M: Regulation of cell cycle and
productivity in NS0 cells by the over-expression of p21CIP1.
Biotechnology and Bioengineering 2002, 77:1-7.
Browne SM, Al-Rubeai M: Analysis of an artificially selected GS-NS0
variant with increased resistance to apoptosis. Biotechnology and
Bioengineering 2011, 108:880-892.
Hengartner MO: The biochemistry of apoptosis. Nature 2000, 407:770-776.
Janumyan YM, Sansam CG, Chattopadhyay A, Cheng N, Soucie EL, Penn LZ,
Andrews D, Knudson CM, Yang E: Bcl-xL/Bcl-2 coordinately regulates
apoptosis, cell cycle arrest and cell cycle entry. EMBO J 2003,
22:5459-5470.
P55
Design space definition for a stirred single-use bioreactor family from
50 to 2000 L scale
Thomas Dreher*, Ute Husemann, Sebastian Ruhl, Gerhard Greller
Sartorius Stedim Biotech GmbH, Göttingen, Germany, D-37079
Background: Single-use bioreactors continue to gain large interest in the
biopharmaceutical industry. They are excessively used for mammalian cell
cultivations, e.g. production of monoclonal antibodies and vaccines [1]. This
is motivated by several advantages of these bioreactors like reduced risk of
cross contaminations or shortening lead times [2]. Single-use bioreactors
differ in terms of shape, agitation principle and gassing strategy [3]. Hence, a
direct process transfer or scale-up between different systems can be a
challenge. Reusable bioreactors are still regarded as gold standard due to
their well-known and defined geometrical properties. Based on this
knowledge a stirred single-use bioreactor family from 50 to 2000 L scale was
developed with similar geometrical ratios like commonly used reusable
systems. To follow a Quality by Design approach the key process parameters
for a modern mammalian cell cultivation were specified. Therefore, the kLavalue, mixing time and the power input per volume were evaluated by
using process engineering methods for all scales.
Stirred single-use bioreactor family: The used stirred single-use
bioreactor family (BIOSTAT® STR, Sartorius Stedim Biotech, Germany) has
design criteria similar to conventional reusable systems. The bioreactors
have a cylindrical cultivation chamber, two impellers mounted on a rigid
shaft and a submerged sparger. The H/D ratio of 2:1 and the impeller to bag
ratio of 0.38 was kept constant for all scales [4]. There is the possibility to
select between the impeller configuration 2 × 3-blade segment impeller
(downward mixing) and 6-blade disk (bottom) + 3-blade segment (top)
impeller. For the process engineering characterization 2 × 3-blade segment
impellers were used. The aeration was performed by a combi sparger, which
consists a ring sparger part (hole diameter 0.8 mm) and a micro sparger part
(hole diameter 0.15 mm).
Process engineering characterisation: Design space approach: The
field of application of the stirred single-use bioreactor family is the
cultivation of mammalian cells. To verify the single-use bioreactors a
modern CHO process was considered with a peak cell density of 27 - 28 ×
106 cells/mL. This process defines the key process parameters relevant for
the design space definition [3,5], which are a moderate shear rates (tip
speeds < 2.0 m/s), a sufficient oxygen transfer rate (kLa > 7 h-1, supply pure
oxygen assumed), a suitable homogeneity (mixing times < 60 s) and a
power input per volume (P/VL ) between 10 and 250 W/m3 (from lab to
production scale).
Power input per volume: Energy has to be transferred to a bioreactor to
ensure cell suspension, homogenization and gas dispersion [6]. For the
quantification the dimensionless Newton number (Ne) was determined by
torque measurements [3]. From the results the power input per volume
was calculated for tip speeds between 0.6 and 1.8 m/s. Ne for the selected
configuration was 1.3. Figure 1a shows the P/VL characteristics, which
increased for all scales with the tip speed. With increasing size of the
CultiBag STR the power input per volume decreases at a defined tip speed.
Mixing time: Appropriate mixing is important to avoid concentration or
temperature gradients inside the cultivation chamber. The mixing time of
the stirred single-use bioreactor was determined by the decolourization
method [7]. The mixing times as a function of the tip speed are illustrated
in Figure 1b. As the tip speed increases, expectedly the mixing times
decrease. For all scales mixing times below 30 s are achieved.
Page 75 of 151
Oxygen transfer capabilities: The oxygen transfer efficiency of a
bioreactor can be described by the kLa-value, which was determined by
the gassing-out method (1xPBS, room temperature) [8]. The aeration was
carried out through the holes with 0.8 mm (ring sparger part) (Figure 1c)
and in another trial through the holes with 0.15 mm diameter (micro
sparger part) (Figure 1d). The volumetric mass transfer coefficients were
determined as a function of the tip speed for a constant gas flow rate of
0.1 vvm. With increasing tip speed the kLa-value characteristics increased
for all scales. For larger scales higher kLa-values were achieved presumably
due to longer residence times of the gas bubbles. By using aeration
through the holes with the smaller diameter the k L a-value can be
significantly increased.
Conclusions: The main application of the presented single-use bioreactor
family is the cultivation of mammalian and insect cells. These cells have
special demands on the cultivation system for their optimal growth. To
verify the suitability of the bioreactor family different process engineering
parameters were determined. Based on the results the process
engineering parameters are in the desired ranges of the defined design
space regarding the power input per volume, mixing efficiency and the
kLa-value. This indicates that the stirred single-use bioreactor family is
suitable for cell culture applications. The design criteria of the CultiBag
STR family directly relates to those from reusable systems. Therefore,
existing challenges for a scale-up or process transfer are removed due to
the improved design. Consequently, this technology represents an
important step towards further maturity of single-use bioreactors and
their acceptance.
References
1. Brecht R: Disposable Bioreactors: Maturation into Pharmaceutical
Glycoprotein Manufacturing. Adv Biochem Engin/Biotechnol 2009, 115:1-31.
2. Eibl D, Peuker T, Eibl R: Single-use equipment in biopharmaceutical
manufacture: a brief introduction. Single-use technology in
biopharmaceutical manufacture Wiley, Hoboken: Eibl R, Eibl D 2010, 3-11.
3. Löffelholz C, Husemann U, Greller G, Meusel W, Kauling J, Ay P, Kraume M,
Eibl R, Eibl D: Bioengineering Parameters for Single-Use Bioreactors:
Overview and Evaluation of Suitable Methods. Chem Ing Tech 2013,
85:40-56.
4. Noack U, Verhoeye F, Kahlert W, Wilde D de, Greller G: Disposable stirred
tank reactor BIOSTAT® CultiBag STR. Single-use technology in
biopharmaceutical manufacture Wiley, Hoboken: Eibl R, Eibl D 2010, 225-240.
5. Ruhl S, Dreher T, Husemann U, Jurkiewicz E, Greller G: The successful
transfer of a modern CHO fed-batch process to different single-use
bioreactors. Poster ESACT Lillé 2013.
6. Storhas W: Aufgaben eines Bioreaktors. Bioreaktoren und periphere
Einrichtungen Vieweg & Sohn Verlagsgesellschaft, Braunschweig/Wiesbaden
1994, 15-86.
7. Zlokarnik M: Bestimmung des Mischgrades und der Mischzeit.
Rührtechnik, Theorie und Praxis, Springer-Verlag Berlin Heidelberg New York
2002, 97-99.
8. Wise W S: The measurement of the aeration of culture media. J Gen
Microbiol 1951, 5:167-177.
P56
Full transcriptome analysis of Chinese Hamster Ovary cell lines
producing a dynamic range of Coagulation Factor VIII
Christian S Kaas1,2*, Claus Kristensen1, Jens J Hansen1, Gert Bolt1,
Mikael R Andersen2
1
Department of Mammalian cell technology, Novo Nordisk A/S, Maaloev,
2760, Denmark; 2Center for Microbial Biotechnology, Technical University of
Denmark, Kgs Lyngby, 2800, Denmark
Background and novelty: Coagulation Factor VIII (FVIII) is an essential
cofactor in the blood coagulation cascade. Inability to produce functional
FVIII results in haemophilia A which can be treated with recombinant
FVIII [1]. Chinese Hamster Ovary (CHO) cells are the most used cell line for
producing complex biopharmaceuticals due to its ability to perform
complex post-translational modifications. When mammalian cells
overexpress a protein like FVIII they will adapt by regulating various proteins
and pathways to support synthesis/production of this protein. Yields of FVIII
produced in CHO are low and for this reason a greater understanding of
Page 76 of 151
Figure 1(abstract P55) Process engineering parameters of the CultiBag STR family. (a) Characteristics of the power input per volume, (b) mixing
time characteristics, (c) kLa-values for the aeration with the ring sparger part, (d) kLa-values for the aeration with the micro sparger part.
what constitute a high producing cell line is desired. In this study a full
transcriptome analysis was undertaken in order to analyze the differences
between high and low producers of FVIII
Experimental approach: The FVIII gene was introduced into CHO-DUKXB11 cells and a stable pool was generated by selection with MTX.
A number of subclones were analysed and 3 high producing clones,
3 medium producers and 3 low (~0) producer clones were isolated. These
9 clones were grown in shake flasks in batch culture. During the
cultivation essential metabolites were monitored as well as cell number
and viability. RNA was extracted after 48 hours of cultivation and
sequenced using the Illumina HiSeq system. Reads were processed and
aligned to the CHO-K1 genome [2] using Tophat2 and expression levels
were deduced using htseq
Results and discussion: Experiments showed that 48 hours into the
cultivation cells were seen to grow in the exponential phase in media still
containing sufficiently high amounts of glutamine and low amounts of
lactate. Furthermore, a significant difference in FVIII levels was detected
at this time in the media of cells from the different groups and for this
reason this time point was chosen for extraction of RNA. 1677 genes
were found to be differentially expressed in high vs non-producing
clones. Among these, genes involved in oxidative stress were seen to be
enriched (p = 1.74 × 10-6). This finding is strengthened by the work by
Malhotra et al [3] showing that CHO cell lines activate the oxidative stress
response when producing FVIII, which might induce apoptosis. The nonFVIII-producing clones were seen to express predominantly truncated
FVIII-DHFR mRNAs (Figure 1) explaining the phenotype for growth in
media containing MTX selection but no functional FVIII expressed. Further
analyses are ongoing.
References
1. Thim L, Vandahl B, Karlsson J, Klausen NK, Pedersen J, Krogh TN, Kjalke M,
Petersen JM, Johnsen LB, Bolt G, Nørby PL, Steenstrup TD: Purification
and characterization of a new recombinant factor VIII (N8).
Haemophilia. The official journal of the World Federation of Hemophilia
2010, 16:349-359.
2. Xu X, Nagarajan H, Lewis NE, Pan S, Cai Z, Liu X, Chen W, Xie M, Wang W,
Hammond S, Andersen MR, Neff N, Passarelli B, Koh W, Fan HC, Wang J,
Gui Y, Lee KH, Betenbaugh MJ, Quake SR, Famili I, Palsson BO, Wang J: The
genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line.
Nature biotechnol 2011, 29:735-741.
3. Malhotra JD, Miao H, Zhang K, Wolfson A, Pennathur S, Pipe SW,
Kaufman RJ: Antioxidants reduce endoplasmic reticulum stress and
improve protein secretion. PNAS 2008, 105:18525-18530.
Page 77 of 151
Figure 1(abstract P56) Depth of sequenced reads at every position of the FVIII gene. It is seen that the 3 non-producing clones transcribe
5’-truncated RNA species. This would explain the phenotype of no FVIII protein production but growth under MTX selection as the IRES element
containing DHFR is still transcribed.
P57
Production of monoclonal antibody, Anti-CD3 by hybridoma cells
cultivated in Basket Spinner under free and immobilized conditions
Elsayed A Elsayed1,2*, Hoda Omar3, Hasnaa R Shahin4, Hamida Abou-Shleib3,
Maha El-Demellawy4, Mohammad Wadaan1, Hesham A El-Enshasy4,5
1
Bioproducts Research Chair, Zoology Department, Faculty of Science, King
Saud University, 11451 Riyadh, Kingdom of Saudi Arabia; 2Natural & Microbial
Products Department, National Research Centre, Dokki, Cairo, Egypt;
3
Microbiology Department, Faculty of Pharmacy, Alexandria University, Egypt;
4
City for Scientific Research and Technology Applications, New Burg Al Arab,
Alexandria, Egypt; 5Institute of Bioproducts Development, Universiti
Teknologi Malaysia, Skudai, Johor, Malaysia
Background: Monoclonal antibodies (Mabs) have been recently used for
the treatment of virtually every debilitating disease. Packed-bed
bioreactors have been used for the cultivation and production of a wide
range of cell lines and biologics including MAbs. The principle behind a
Packed-bed bioreactor is that the cells are being immobilized within a
suitable stationary matrix which is represented by the bed. Packed-bed
bioreactors also have the advantage of being capable of generating high
cell densities with a low concentration of free cells in suspension; hence,
simplifying downstream processing. The present work was designed to
compare between the cultivation of hybridoma cells as well as the
production of OKT3 MAb in free and immobilized culture conditions.
Materials and methods: Hybridoma cell line (OKT3), producing IgG2a
monoclonal antibodies against CD3 antigen of human T lymphocyte cells
were adapted to grow in serum free medium. The specificity of the produced
MAbs was determined through the use of indirect immunofluorescence
staining of T lymphocytes from peripheral blood followed by flowcytometeric
analysis using cell quest software and FACSCalibur. The MAb was
continuously produced by the cultivation of hybridoma cells in Basket
Spinner. The cells were immobilized within the Fibra-Cel® disks. For
comparison, two Basket Spinners were used in parallel, one of them was
packed with 5 gm of Fibra-Cel® disks, and the other was used as a control for
the cultivation of free cells. Samples were daily collected throughout the
cultivation for the determination of cell viability using Trypan blue exclusion
method. Glucose/lactate concentrations were determined using automatic
glucose/lactate analyzer. The concentration of MAb was determined by direct
ELISA assay.
Results: Determination of MAb specificity: Secondary fluorescence
antibodies bounded to the produced antibody which in turn is bound to
CD3 positive lymphocytes (T-cells) showed a percentage of CD3 positive
lymphocytes of 76.68%. This was proved using indirect immunofluorescence
staining of healthy volunteer T lymphocytes from peripheral blood. Forward
scatter (FSC) versus side scatter (SSC) can allow for the differentiation of
blood cells in a heterogeneous cell population.
When the “gated” cells were analyzed for their emitted fluorescence upon
stimulation by the laser beam, high fluorescence is produced from the
cells that react with FITC- anti-mouse specific antibody which reflects CD3
antibody content in the added culture supernatant. Histogram statistics
showed that there were 2513 events inside the gated lymphocytes; the
percentage of lymphocytes that were CD3 positive was 76.68%.
Continuous production of MAb by the cultivation of hybridoma
cells in Basket spinner: In this work two Basket Spinners were used in
parallel, one of them was packed with 5 gm of Fibra-Cel disks (Figure 1), and
the other was used as control without packing (free living cells). For the free
Basket Spinner, the growth and viability of the hybridoma cells as well as their
Page 78 of 151
metabolic activities and mAb productivity were determined after 120 h. Viable
cell concentration increased only during the first 72 h of cultivation reaching
9.2 × 10 5 Cells mL -1 . On the other hand, mAb production reached its
maximum concentration of 206.5 mg L-1 also at 72 h. For the immobilized
Basket Spinner, the growth and viability of the hybridoma cells as well as their
metabolic activities and mAb productivity were determined for 288 h. The
Culture medium was perfused through the bed to supply cells with nutrients.
This allowed the spinner to run as repeated batch, enabling long term
cultivation of cells. The number of viable, and dead cells determined over the
12 days of the cultivation corresponded to the cells detached from Fibra-CelR
disks and does not reflect the actual cell number. On the other hand, the
mAb titer increased in each batch reaching its maximum concentration of
298.5 mg L-1 at batch number VI (after 216 h of cell inoculation).
It was found that the rates of glucose consumption and lactate
production increased for each batch where the medium was changed
once after the first 72 h and then the batch time was further reduced to
only 48 h in the subsequent batches, then once each 24 h over the
remaining 12 days of the cultivation period. The maximum production of
lactate was 2.74 g L-1 occurred at batch number VII (after 240 h).
Upon comparing at 72 h of cultivation, it was found that the produced
mAb in case of the immobilized Basket Spinner was higher than that
produced in case of the free Basket Spinner, however, the rate of glucose
consumption and lactate production at the same time interval for the
former was lower than the later (2.2, 1.825 g L-1 for glucose and 1.27,
2.075 g L-1 for lactate, respectively).
Conclusion: The results obtained revealed that upon using flow cytometry
and the fluorochrome-conjugated secondary antibody attached specifically
to MAb present in the supernatant from the cells adapted to serum free
medium succeeded in sorting 76.8% of the gated cells (lymphocytes). This
confirmed the binding of MAb of the adapted cells to CD3 positive
lymphocytes. Which means that, stable hybridoma cells adapted to grow in
serum free medium (SMIF-6) were successfully obtained. It was also
observed upon using the backed spinner basket, the MAb titer increased in
each successive batch to reach to 298.5 mg L-1 after 216 h. This might be
due to the protection of the cells against shear stress and air/O2 sparging by
their immobilization on the microcarriers, promoting the use of serum- or
protein-free medium. Moreover, the microcarrier is designed to ensure
sufficient nutrient supply and also to remove toxic metabolites. On the other
hand, the rate of glucose consumption and lactate production increased for
each repeated batch. This explains why the decrease in the batch period.
This indicated the good physiological state of the cells.
P58
Using Rice Bran Extract (RBE) as Supplement for Mescenchymal Stem
Cells (MSCs) in Serum-free Culture
Rinaka Yamauchi1, Ken Fukumoto1, Satoko Moriyama1, Masayuki Taniguchi2,
Shigeru Moriyama3, Takuo Tsuno3, Satoshi Terada1*
1
University of Fukui, Fukui, 910-8507, Japan; 2Niigata University, Niigata, 9502102, Japan; 3Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 6497122, Japan
Figure 1(abstract P57) Kinetics of cell growth, metabolism, and
MAb production during cultivation of hybridoma cells in packed
Basket Spinner.
Introduction: Currently, therapies using multipotent mescenchymal stem
cells (MSCs) are tested clinically for various disorders, including cardiac
disease [1]. However, conventional culture media contain fetal bovine
serum (FBS) and so the concern about amphixenosis remains. Therefore,
developing animal derived factor-free media are desired [2].
We previously reported that rice bran extract (RBE) significantly improved
the proliferation of various cell lines and the cellular functions. In this
study, we tested the effect of RBE on MSCs in serum-free culture.
Materials and methods: Effect of RBE on osteogenic differentiation:
MSCs obtained from the bone marrow of Wistar rats were cultured under
conventional a-MEM with 15% FBS medium, supplemented with or without
RBE for three days at passage 1 - 3. After treatment with RBE for three days,
the media were replaced by RBE-free osteogenic medium composed of
a-MEM containing 10% FBS, 10 mM b-glycerol phosphate (Merck, USA),
0.05 mM L-ascorbic acid 2 phosphate (Sigma, USA), 10 nM dexamethasone
(Sigma), 1% penicillin-streptomycin solution and the cells were cultured in
the medium for 24 days. To evaluate the differentiation ability, the cells
were stained with Alizarin Red S and analyzed by using Image J.
Figure 1(abstract P58) Effect of RBE on osteogenic differentiation.
Effect of RBE on cell proliferation: After MSCs were cultured in the
presence of RBE for three days, viable cell number was measured by the
trypan blue dyeing assay on a hemocytometer.
Effect of RBE on gene expression after expansion: After treatment
with RBE for three days, cells were lysed to be analyzed the maintaining
MSC markers with real-time PCR. Total RNA from the cells was isolated by
Acid Guanidinium Phenol Chloroform method and cDNA was synthesized
with supersucriptTM (Invitologen, USA). These cDNAs were analyzed by
LightCycler R480 (Roche, Germany) using primers: MSC markers, CD44,
CD105 and CD166, and osteogenic genes, BMP2, ALPL, OCN. The results
were normalized with respect to GAPDH or HPRT. Relative mRNA quantify
was calculated using the comparative ΔΔCT.
Results and discussion: As shown in Figure 1, threshold area (%) was
significantly increased in MSCs expanded in the presence of RBE in
comparison with in absence (*P < 0.03), suggesting that the cells expanded
in RBE-containing medium differentiated into bone superior to the negative
control cells.
The viable cell densities in the culture with and without RBE were quite
similar, suggesting that increase in osteogenisis with RBE is not due to the
population of the cells. Expression levels of MSC markers such as CD44,
CD105 and CD166, were not up- nor down-regulated in the presence of RBE
during expansion, whereas that of osteogenic gene BMP2 was remarkably
reduced. These results suggest that RBE does not induce osteogenesis
during expansion and imply that RBE could keep MSCs undifferentiatiated.
Treatment with RBE during expansion up-regulated the expression levels of
osteogenic genes including ALPL and OCN in MSCs during osteogenic
differentiation.
Conclusion: Decreased osteogenic differentiation ability of MSCs after
expansion could be maintained by addition of RBE into expansion
medium. RBE is a candidate for the novel supplement for maintaining
differentiation ability of MSCs in expansion culture.
References
1. Amado CLuciano, Saliaris PAnastasios, Schuleri HKarl, St John Marcus ,
Xie Jin-Sheng, Cattaneo Stephen, Durand JDaniel, Fitton Torin, Kuang Jin
Qiang, Stewart Garrick, Lehrke Stephanie, Baumgartner WWilliam,
Martin JBradley, Heldman WAlan, Hare MJoshua: Cardiac repair with
intramyocardial injection of allogeneic mesenchymal stem cells after
myocardial infarction. PNAS 2005, 102:11474-11479.
2. Leopold G, Thomas RK, Sonia N, Manfred R: Emerging trends in plasmafree manufacturing of recombinant protein therapeutics expressed in
mammalian cells. Biotechnol J 2009, 4:186-201.
P59
Viral vector production in the integrity® iCELLis® single-use fixed-bed
bioreactor, from bench-scale to industrial scale
Alexandre Lennaertz*, Shane Knowles, Jean-Christophe Drugmand, Jose Castillo
ATMI LifeSciences, Brussels, 1120, Belgium
Page 79 of 151
Introduction: Wild-type or recombinant viruses used as vaccines and
human gene therapy vectors are an important development tool in
modern medicine. Some have demonstrated high potential such as
lentivirus, paramyxovirus and adeno-associated-virus (AAV). These vectors
are produced in adherent and suspension cell cultures (e.g. HEK293T,
A549, VERO, PER.C6, Sf9) using either transient transfection (e.g PEI, calcium
phosphate precipitation) or infection (e.g. modified or recombinant viruses)
strategies. Most of these processes are currently achieved in static mode
on 2-D systems (Roller Bottles, Cell Factories, etc.) or on suspended microcarriers (porous or non-porous). However, these two systems are timeconsuming (large numbers of manipulation, preparation of equipment, etc.)
and hardly scalable. In regards to process simplification and traceability,
Integrity® iCELLis® bioreactors offer a new solution for scalability and
monitoring of adherent cell cultures.
The Integrity iCELLis Bioreactor: Integrity® iCELLis® bioreactors from
ATMI LifeSciences were designed for adherent cell culture applications
such as recombinant protein, viral vaccine and gene therapy vector
production. Using PET carriers trapped into a fixed-bed, cells grow in a 3-D
environment with temperature, pH and dissolved oxygen controls. The
iCELLis technology can be used at small-scale (the iCELLis nano from 0.5 to
4 m2) and manufacturing scale (iCELLis 500 from from 66 to 500 m2) which
eases process scale-up and its overall utilization.
Materials and methods: All the experiments described here have been
performed in the bench-scale and pilot scale iCELLis bioreactors
containing iPack carriers made of 100% pure non-woven PET fibers.
Crystal violet was used for cell nuclei counts from carriers.
Recombinant viral vectors production: Some recombinant entities are
produced in the iCELLis bioreactors using hybrid vectors. For example,
A549-stable packaging cell line, maintained in Optipro medium + 1% FBS,
can deliver recombinant AAV vectors frequently used in gene transfer
applications (Inserm UMR 649, Institut de Recherche Thérapeutique).
Alternatively, other rAAV vectors are obtained by transient transfection. In
this case, HEK293-T cells are regularly found to be sensitive to the viral
DNA and transfection reagent complex (generally polyethylenimine - PEI
or phosphate calcium precipitate). The transfer of the transfection process
from static or dynamic systems to the iCELLis bioreactors requires some
adaptation in order to fully benefit of both technologies. Using a
fluorescent protein marker, the transfected cells can be observed during
the culture and the viral vectors can be quantified after the harvest.
Transfection method using the PEI/DNA complexes is frequently found in
cell suspension processes due to its high efficiency and adaptability to
high-throughput systems. The circulation pattern of the medium through
the fixed-bed of the iCELLis system allows a good contact between cells
and transfection complexes.
The transfection by phosphate precipitation is a static method where the
DNA precipitates settle on the cells. For this reason, it is difficult to apply
this technic in dynamic conditions. To be able to implement it in the
iCELLis bioreactor, the agitation speed has to be minimal to get a
medium circulation through the fixed-bed. This maintains the precipitate
in suspension while giving the longest contact time between these
precipitates and the cells. The iCELLis system with its pH regulation and
low-shear circulation is well adapted for this method sensitive to small
pH changes and reagent mix.
Results: Recombinant adeno-associated virus vector production:
Recombinant AAV vectors were produced in an A549 based stable
packaging cell line containing the AAV2 rep and cap genes from various
AAV serotypes. Using a dual adenovirus infection (wild-type Ad5 followed
by hybrid Ad/AAV) in the iCELLis nano bioreactor under perfusion mode,
recombinant particles were harvested up to 96 hours post-infection. The
expression levels of the AAV2 rep and cap genes from various AAV
serotypes were assessed by western-blot and qPCR. This 8-days process
demonstrated higher vector particles production in the iCELLis bioreactor
compared to CS-5 control (4.5 × 108 vs 3.1 × 108 vg/cm2, 72 h after the
first infection) (Inserm UMR649, Institut de Recherche Thérapeutique).
Triple transient transfection using PEI was performed in the iCELLis nano
system (0.53 m2, 40 mL fixed-bed) for the production of serotype 5 AAV
in HEK 293T cells. Cells were seeded at 80,000 cells/cm2 in the CS10 and
the iCELLis bioreactor. Twenty-four hours post-inoculation, the DNA-PEI
mix containing the GFP gene was added to fresh medium inside the
bioreactor. Cells were still growing on the carriers after the transfection.
The expression of GFP by cells demonstrated that the transfection had a
high efficiency rate in both vessels (FACS analysis on sampled carriers for
Page 80 of 151
• Paramyxovirus production in Vero cells
• Undisclosed lytic virus in Vero cells
Transfer and scale-up of a HEK293 cell culture process for
production of adenovirus: Small Scale Development
An existing process using HEK293 cells for the production of adenovirus
was first transferred from multi-tray systems to an iCELLis nano bioreactor
(0.53 m 2 , 40 ml of fixed-bed) by keeping equivalent cell culture
parameters:
•
•
•
•
•
Figure 1(abstract P59) Comparison of Green Fluorescent Units and
Viral Genome/cm2 and VG/GFYU ratio in the CS10 and iCELLis
nano 0.53 m2.
the iCELLis bioreactor). Green Fluorescent Units (GFU) and Viral Genome
(VG) were measured for the CS10 control and the iCELLis nano bioreactor.
Viral particles were harvested using a freeze/thaw method, suboptimal in
the case of the iCELLis system. The GFU and VG titers/cm2 in the iCELLis
bioreactor were about 53% of the control (Figure 1) (Dept of Biochemical
Eng. - UCL).
Conclusions: We demonstrated that the iCELLis system could be very
useful for production of viral vaccine and gene therapy vectors. The
iCELLis platform facilitates handling and scale-up, high biomass
amplification and sterile containment within a closed system. Moreover,
in many cases, the specific culture environment enhances virus
production yields.
Specifically, after some optimization of the culture parameters, it was
demonstrated that rAAV vectors were produced by modified A549 cells in
high viral level in the 0.53 m2 iCELLis bioreactor. The maximum viral yield
achieved in the bioreactor was 4.5 × 108 vg/cm2, which was higher than
the yield per cm2 obtained in a CellSTACK vessel (3.1 × 108 vg/cm2).
Finally, the preliminary results of transfection demonstrated that the
method using PEI is applicable in the iCELLis bioreactors, with
optimization of the viral recovery at harvest yet to be performed. This
also demonstrated that the iCELLis can be considered as a solution for
transient transfection processes at large scales.
P60
Linear scalability of virus production in the integrity® iCELLis®
single-use fixed-bed bioreactors from bench to industrial scale
Shane Knowles*, Jean-Christophe Drugmand, Nicolas Vertommen,
Jose Castillo
ATMI LifeSciences, Rue de Ransbeek 310, Brussels, 1120, Belgium
Introduction: In order to maximize cell growth within a compact space
and retain cells for easy medium exchange, the iCELLis bioreactors from
ATMI LifeSciences contain macro-carriers trapped in a fixed-bed, creating
a 3-D matrix within which cells adhere and replicate. These bioreactors
also enable precise temperature, pH and dissolved oxygen control which
cannot be done in 2-D cultures.
The iCELLis technology can be used at small and large scales with
straightforward process scale-up, easy single-use operations and minimal
space requirement.
Here we present a summary of adherent cell process development in
iCELLis bioreactors, including:
•
•
•
•
•
•
HEK 293 cell expansion for production of adenovirus
MVA virus production in CEF cells
Bovine Herpes Virus production in MDBK cells
Recombinant Adeno-Associated Virus in A549 cells
Adenovirus production in A549 cells
Influenza virus production in Vero cells
Temperature, pH, DO (% saturation with air)
Multiplicity of infection (pfu/cell)
Time of infection
Cell seeding density (cells/cm2 and cells/mL)
Culture duration
Additional experiments were performed with lower cell densities at
inoculation in order to reduce the number of pre-culture steps at large
scale. The following parameters were also optimized for cell growth and
virus productivity:
• Compaction of carriers inside the fixed-bed (96 g/L or 144 g/L)
• Linear velocity of medium through the fixed-bed (cm/s).
• Fixed-bed height (2,4 or 10 cm)
Industrial scale-up: The scale-up of iCELLis technology is similar to that
of chromatography columns. The difference in fixed bed geometry from
small to large scale is that the cross-sectional area increases, while the
fixed-bed (FB) height remains constant. Therefore, cell seeding, nutrient
and oxygen delivery throughout the fixed bed are comparable at small
and large scale.
After determining optimal parameters at small scale, HEK293 cell culture
batches were performed in duplicate with small and large scale
bioreactors. Inoculation density, medium volume ratios, culture duration,
pH, DO and temperature set points were kept identical. Consistent cell
densities of 2.7 to 3.8 cells/cm2 were achieved in multiple experiments at
both small and large scale. Analysis of glucose and lactate (Figure 1) at
both scales in comparison to a 5-tray Cell Factory control indicated that
cell metabolism was comparable between small and large scale iCELLis
bioreactors and the standard 2D process.
Additional Virus Production Process Development: Results of
experiments performed for production of several viruses in various cell
lines at various bioreactor scales are shown in Table 1. Bench scale
bioreactors were used for each process to determine what conditions and
feeding strategies sustained the highest growth rates and cell densities.
Bench scale bioreactors were used for each process to determine what
conditions and feeding strategies sustained the highest growth rates and
cell densities.
For chicken embryonic fibroblasts (CEF) and production of Modified
Vaccinia Ankara (MVA), a prototype “Artefix” bioreactor (the predecessor
of iCELLis) with a 0.07 m2 fixed-bed surface area was tested.
Intermediate “pilot” scale prototype iCELLis bioreactors with surface areas
of 20 or 40 m2 were used to test Vero and MDBK cell processes.
The Vero cell process was scaled up to a 660 m2 bioreactor. In this case,
cells were inoculated at only 3200 cells/cm 2 using two 40-tray Cell
Factories (2.5 m 2 each), equivalent to fifteen roller bottles (1700 cm 2
each). With such a low seeding density the seed train required for
inoculation is simplified extensively compared to standard 2D cell culture
processes. The Vero cell density reached 2.3 × 105 cells/cm2 for a total
biomass of 1.5 × 1012 cells in 11 days. A complete medium exchange was
then performed, followed by virus infection. Continuous perfusion of
medium was used during the production phase. While the virus type and
productivity data is confidential, the results indicated that virus output
was equivalent or better than expected based on the standard 2D
process.
Conclusions: This summary of experiments demonstrates that the fixedbed design of the iCELLis bioreactor enables high cell densities to be
achieved and maintained in both small and large bioreactor volumes.
Different processes have been easily scaled up by keeping cell culture
conditions and process parameters identical to the standard 2-D cell
culture process.
The iCELLis bioreactor can be inoculated at a very low cell density,
leading to a dramatic simplification of seed train operations and a
significant reduction of development timelines.
Page 81 of 151
Figure 1(abstract P60) Comparability of Glucose (Top Panel) and Lactate (Bottom Panel) Profiles of HEK293 culture in iCELLis 133 m2 (Blue),
iCELLis nano 1.06 m2 (Green) and 5-tray Cell Factory (Red).
➢ The process must be closed
➢ The growth rate and population-doubling level (i.e. the number of
times the cells in the population has doubled) must be at least
equivalent to the current process in multilayer trays
➢ The process must comply to the cGMP rules
➢ The cells must succeed the quality control (QC) test specifications
at the end of cultivation, i.e. cells must remain undifferentiated and
show the presence of HHAPLCs markers, while exhibiting the
capacity to differentiate toward functional hepatocytes.
In conclusion, large biomass amplification and excellent virus productivities,
combined with the advantages of a fully closed disposable system with low
shear stress, make the iCELLis fixed-bed bioreactor a simple and
straightforward solution for industrial production of viruses.
P61
Scale-up of hepatic progenitor cells from multitray stack to 2-D
bioreactors
Matthieu Egloff1*, Florence Collignon1, Jean-François Michiels1,
Jonathan Goffinet1, Sarah Snykers2, Philippe Willemsen2, Christophe Gumy2,
Claude Dedry2, Jose Castillo2, Jean-Christophe Drugmand1
1
ATMI LifeSciences, Brussels, Belgium, 1120; 2Promethera Biosciences, MontSaint-Guibert, 1435, Belgium
Introduction: Promethera Biosciences (Mont-St-Guibert, BE) is developing
cell therapies to treat several liver genetic metabolic diseases, such as the
Crigler-Najjar syndrome. Human heterologous adult liver progenitors cells
(HHALPCs) were initially cultivated in 2D standard cultivation devices. The
present study is investigating the feasibility to cultivate HHALPCs in
Xpansion bioreactors, with the following objectives:
Integrity® Xpansion™ multiplate bioreactors have been specifically
designed to enable an easy transfer from existing multiple-tray-stack
processes by offering the same cell growth environment on 2-D
hydrophylized Polystyrene (PS) plates in a fully closed system. To make
the bioreactors compact, the headspace between each plate has been
reduced to a minimum (1.3 mm). Gas transfer is made through a semipermeable silicone tubing mounted in the central column. Additionally,
critical cell culture parameters such as pH and DO are controlled and the
cell density is automatically monitored via a specific holographic
microscope developed by Ovizio
Materials and methods: Cell culture parameters: ✓ pH set-point: 7.5
✓ DO regulated > 50%
✓ No agitation during the first 8 hours after plating
Table 1(abstract 60) Summary of results of virus production processes tested in various cell lines in iCELLis
bioreactors (or predecessors)
Cells
Virus
Bioreactor
Surface
Area (m2)
Average Cell Density
at TOI (cells/cm2)
Specific Virus
Productivity
CEF
Modified Vaccina Ankara
Artefix
0.07
3.9E+05
3.0E+06
pfu/cm2
2.1E+09
pfu
MDBK
Bovine Herpes Virus
iCELLis nano
4
1.2E+05
2.2E+07
pfu/cm2
8.7E+11
pfu
iCELLis pilot
20
1.4E+05
1.7E+07
pfu/cm2
3.4E+12
pfu
iCELLis 500
66
3.3E+05
3.3E+07
pfu/cm2
2.2E+13
pfu
A549
Vero
Vero
Total Virus
2
rAAV
iCeLLis nano
0.53
6.0E+04
5.3E+08
vg/cm
2.8E+12
vg
Adenovirus
iCELLis nano
2.67
2.3E+05
1.1E+10
TCID50/cm2
3.0E+14
TCID50
Influenza
iCELLis nano
4
1.0E+05
3.8E+06
TCID50/cm2
1.5E+11
TCID50
iCELLis pilot
20
7.5E+04
2.5E+06
TCID50/cm2
5.0E+11
TCID50
Paramyxovirus
iCELLis nano
2.67
2.7E+05
6.4E+05
TCID50/cm2
1.7E+10
pfu
Undisclosed Lytic Virus
iCELLis pilot
40
1.5E+05
Confidential
iCELLis 500
133
1.5E+05
iCELLis 1000
660
2.3E+05
Confidential
Page 82 of 151
Table 1(abstract 61) Scale-up feasibility of stem cells growth in Xpansion bioreactor
QUALITY CONTROL TEST
Xpanion10
(Five runs)
Xpansion 50
(Two runs)
Xpansion 180
(Three runs)
In-Line Centrifugation
Three runs
CELL CULTURE SURFACE (CM2)
6.120
30.600
110.160
/
AVERAGE CELL QUANTITY AT HARVEST
VIABILITY
1.8 × 108
≥90%
9 × 108
≥90%
3.3 × 109
≥90%
/
≥90%
GROWTH PROFILE
Normal
Normal
Normal
Normal
CONFLUENCY
√
√
√
√
HOMOGENEOUS CELL DISTRIBUTION &
MORPHOLOGY
√
√
√
√
IDENTITY
CYP3A4 Activity
Conform
> 10-8pmol/cell/4 h
Conform
> 10-8pmol/cell/4 h
Conform
> 10-8pmol/cell/4 h
Conform
> 10-8pmol/cell/4 h
IDENTITY
Phenotype
Conform
CD73, CD90>60%
ALB+, vim+, ASMA+
Conform
CD73, CD90>60%
ALB+, vim+, ASMA+
Conform
CD73, CD90>60%
ALB+, vim+, ASMA+
Conform
CD73, CD90>60%
ALB+, vim+, ASMA+
PURITY
Conform
CD31+CD133+
CD45+CK19 < 15%
ConforM
4/5*
Conform
4/5*
Conform
CD31+CD133+
CD45+CK19 < 15%
ConforM
1/2*
Conform
2/2
Conform
CD31+CD133+CD45+
CK19 < 15%
Conform
3/3
Conform
(pending)
Conform
CD31+CD133+CD45+
CK19 < 15%
Conform
3/3
Conform
(pending)
POTENCY
(Urea secretion)
POTENCY
(Bilirubin Conjugation)
Cell properties are checked throughout the scale-up process and results are expressed in terms of cell viability, confluence, morphology, growth and cell
characterization (identity/purity/potency). * 1 QC failed in the Xpansion 10 & Xpansion 50 bioreactors but QC were similar to their respective CS control (not
related to the bioreactor).
Stem cells expansion and harvesting: ✓ Inoculation: 5,000 cells/cm2
✓ Harvest: 20,000-40,000 cells/cm2
✓ 10% serum-containing medium
Results: Xpansion 10 was used to prove feasibility of stem cell growth in
Xpansion multiplate bioreactor and to optimize cell culture parameters. The
goal was to perform a simple process transfer from multitray stack (e.g.
Corning CellStack (CS)) to the Xpansion by mimicking cell culture conditions.
All Xpansion runs achieved similar results to their control in terms of cell
density, homogenous distribution, viability and morphology. Additional
quality control (QC) analysis revealed that cell characteristics were
maintained (identity/purity/potency) (table 1)
Scale-up from the Xpansion 10 to the Xpansion 180: Cultures were
directly transferred from the Xpansion 10 bioreactor to the larger scales
Xpansion 50 and Xpansion 180 bioreactors, where cells reached similar
levels of growth and confluence (Table 1). Further analysis of the cultures
at all scales showed compliancy with the QC specifications. In order to
keep the process within a closed system, cells harvested from Xpansion
180 were directly centrifuges. The in-line continuous centrifugation step
achieved 80% yields while maintaining cells characteristics (Table 1).
Xpansion bioreactor regulation: Figure 1 shows the pH and DO
regulation profiles of cultures in Xpansion 10 and Xpansion 180. The
trends of both bioreactors are highly similar, except that the duration of
a regulation cycle is longer in the Xpansion 180 compared to the
Figure 1(abstract P61) Regulation parameters in XP-10 (A) or XP-180 (B) in the course of time, pH (green), D.O. (blue) and T° (red) evolution.
Set points (dashed lines) were fixed at 7.5 for pH and D.O. >50%. T° peaks are due to Xpansion disconnection for microscopic observation or samplings.
Xpansion10. This is due to the longer homogenization time. The gas
diffusion system through the silicone tubing is efficient.
Cell observation using the holographic microscope - iLine: The iLine
holographic microscope and the Xpansion bioreactors are designed to
allow cell observation on the first ten plates of each bioreactor. The
microscope software enables an automatic cell counting of the cell
confluency. Cell confluence assessment through DDHM microscope is a
key element for defining cell harvest time given that cell confluence
levels are critical to guarantee cell characteristics.
Conclusions: The Integrity Xansion multiplate bioreactors demonstrated
their efficiency for the growth of progenitor of hepatocyte cells at large
scale while keeping the cell therapeutic potency.
The use of a robust process control system and the iLine microscope
enabled to record the evolution of the culture:
➢ Sampling port that can be used for dosing of nutrients, growth
factors, etc.
➢ On-line pH and D.O. tracking
➢ Off-line microscopic observations
The Xpansion 10 bioreactor proved to be a useful tool for determining
optimal cell culture parameters. Actually, several runs could be performed
using this scaled-down, while sparing time and money and extrapolating
the cell behavior, the pH and DO trends in the Xpansion 50 and
Xpansion 180. The new Xpansion bioreactor offers a valuable technology
for large-scale production while meeting GMP compliancy. Moreover, the
in-line centrifugation step guarantees a closed manufacturing process,
from seeding to freezing.
P62
Characterization and quantitation of fluorescent Gag virus-like particles
Sonia Gutiérrez-Granados, Laura Cervera, Francesc Gòdia,
María Mercedes Segura*
Departament d’Enginyeria Química, Universitat Autònoma de Barcelona,
Bellaterra, Barcelona, 08193, Spain
Background: Upon expression, the Gag polyprotein of HIV-1
spontaneously assembles giving rise to enveloped virus-like particles
(VLPs). These particulate immunogens offer great promise as HIV-1
vaccines. In order to develop robust VLP manufacturing processes, the
availability of simple, fast and reliable quantitation tools is crucial.
Traditionally, commercial p24 ELISA kits are used to estimate Gag VLP
concentrations. However, this quantitation technique is time-consuming,
laborious, costly and prone to methodological variability. Reporter
proteins are frequently used during process development to allow a
straightforward monitoring and quantitation of labeled products. This
alternative was evaluated in the present work by using a Gag-GFP fusion
construct.
Materials and methods: Generation of fluorescent VLPs was carried out
by transient transfection of HEK 293 suspension cells with a plasmid
coding for Gag fused to GFP (NIH AIDS Reagent Program). VLP budding
from producer cells was visualized by electron microscopy (JEM-1400, Jeol)
and confocal fluorescence microscopy (Fluoview® FV1000, Olympus,
Japan). A purified standard of Gag-GFP VLP material was obtained by
ultracentrifugation through a sucrose cushion and fully characterized. SDSPAGE, Western blot, size-exclusion chromatography (SEC), nanoparticle
tracking analysis (NTA, NanoSight®, UK) and transmission electron
microscopy (TEM) were used for VLP characterization. The standard VLP
material was used for the development and validation of a Gag-GFP VLP
quantitation technique based on fluorescence. Viral particle titers
estimated using this method were compared with those obtained by p24
ELISA (Innotest®, Innogenetics, Belgium), densitometry, TEM and NTA.
Results: Upon transfection, Gag-GFP was expressed in the cytoplasm of
the producer cells and accumulated in the vicinity of the plasma
membrane where the budding process takes place. Upon staining with
Cell Mask™, co-localization of green (Gag-GFP molecules) and red (lipid
membrane) fluorescence was observed in yellow (Figure 1A). VLP
budding was also visualized in TEM images of ultrathin sections of HEK
293 producer cells (Figure 1B).
Page 83 of 151
A purified Gag-GFP VLP standard material was obtained by harvesting
VLPs from cell culture supernatants of transfected HEK 293 cells by low
speed centrifugation followed by VLP pelleting through a 30% sucrose
cushion. The purity of the standard material was analyzed by SEC. The
SEC chromatogram showed a single peak eluting in the column void
volume (V0 = 44 mL) as determined by UV and fluorescence analyses of
collected fractions (Figure 1D). The A260/A280 ratio was 1.24 which is
consistent with reported ratios for purified retroviral particles [1]. The
standard VLP material was further characterized using different
techniques. Particle morphology was analyzed by TEM. Roughly spherical
viral particles surrounded by a lipid envelope and containing an electrodense core could be observed (Figure 1C). The mean VLP diameter
according to TEM analysis was determined to be 141 ± 22 nm (n = 100),
which is the expected size of Gag-GFP VLPs as they resemble immature
HIV particles that are larger than wild-type HIV-1 virions [2]. NTA analyses
of the standard material showed that the most frequent particle size
value (statistical mode) was 149 ± 5 nm, which is consistent with our
TEM results. SDS-PAGE analysis of the standard VLP material (Figure 1E)
was performed. Approximately, 65% of the total protein loaded in the gel
corresponded to Gag-GFP (Figure 1E, full arrow), the major HIV-1 VLP
structural protein. The other minor bands should correspond to cellular
proteins derived from host cells as retroviral particles are known to
promiscuously incorporate a significant amount of host proteins [3,4]. A
Gag-GFP band of the expected molecular weight (~81 kDa) was
specifically detected using an anti-p24 mAb by Western blot analysis
(Figure 1E, full arrow). The presence of a Gag-GFP fragment (Figure 1E,
empty arrow), representing only 5% of the total Gag-GFP loaded, was
also observed in the gel.
A fluorescence-based quantitation method for Gag-GFP VLPs was
developed [5]. Validation of the quantitation assay was carried out
according to International Conference Harmonization (ICH) guidelines [6].
The validation parameters evaluated included specificity, linearity,
quantitation range, limit of detection, precision, and accuracy [5]. All
validation parameters met the criteria for analytical method validation.
Some parameters were also studied in parallel for p24 ELISA for
comparison purposes (Table 1). Both techniques specifically detected
Gag-GFP. Even though the p24 ELISA assay showed to be more sensitive
for Gag-GFP detection, the fluorescence-based method was more precise
and showed to be linear in a wider range. In addition, the developed
quantitation method required less time and was considerably less
expensive than the traditional p24 ELISA method used for Gag VLP
quantitation. Finally, the standard VLP material was quantified using
several methods. In order to compare the concentration of Gag-GFP in
μg/mL as determined by the fluorescence-based method, ELISA and
densitometry with the titers obtained by TEM and NTA analyses which
are given in particles/mL, it was assumed that a Gag VLP contains 2500
Gag molecules as previously reported [7]. All concentration values,
regardless of the quantitation technique used, were in close agreement
within an expected range. These results support the reliability of the
fluorescence-based method developed [5].
Conclusions: Due to the flexibility of the retrovirus particle assembly
process, fluorescently tagged Gag VLPs can be easily generated by
expressing Gag as a fusion construct with GFP. Although fluorescently
labeled Gag has mainly been used to study retrovirus replication in
living cells, this attractive feature is exploited in our laboratory to
facilitate the monitoring and quantitation of Gag VLPs. A purified
standard VLP material was obtained and fully characterized. VLPs in the
standard material showed to be of the expected size, morphology and
with a composition consistent with immature HIV-1 particles. A fast,
reliable and cost-effective quantitation method based on fluorescence
was developed and validated using the standard VLP material. The
fluorescence-based quantification method should facilitate the
development and optimization of bioprocessing strategies for Gagbased VLPs.
Acknowledgements: We would like to thank Dr. Amine Kamen
(National Research Council of Canada) for helpful discussions about this
project and for kindly providing the cGMP compliant HEK 293SF-3F6
cell line. The pGag-GFP plasmid was obtained through the NIH AIDS
reagent program (Cat #11468). The contribution of Dr. Julià Blanco and
Dr. Jorge Carrillo (IrsiCaixa, Spain) to this work is greatly appreciated.
This project was financially supported by MINECO-SEIDI, reference
BIO2012-31251.
Page 84 of 151
Figure 1(abstract P62) Characterization of the purified standard Gag-GFP VLP material. (A) Confocal fluorescence microscopy image of a HEK 293
producer cell expressing green fluorescent Gag-GFP molecules. The lipid membrane is stained with Cell Mask™ (red) and the cell nucleus with Hoechst
(blue). (B) TEM image of an ultrathin section showing VLP budding from HEK 293 producer cells. (C) Negatively stained Gag-GFP VLPs in the purified
standard material. (D) Size exclusion chromatogram of the standard Gag-GFP VLP material. (E) SDS-PAGE and Western-blot analyses of the standard VLP
material. Full and empty arrows represent Gag-GFP protein and Gag-GFP fragment, respectively. Abbreviations: MW, molecular weight standard.
References
1. McGrath M, Witte O, Pincus T, Weissman IL: Retrovirus purification:
method that conserves envelope glycoprotein and maximizes infectivity.
J Virol 1978, 25:923-927.
2. Valley-Omar Z, Meyers AE, Shephard EG, Williamson AL, Rybicki EP:
Abrogation of contaminating RNA activity in HIV-1 Gag VLPs. Virol J
2011, 8:462.
3. Ott DE: Cellular proteins in HIV virions. Rev Med Virol 1997, 7:167-180.
4. Segura MM, Garnier A, Di Falco MR, Whissell G, Meneses-Acosta A,
Arcand N, Kamen A: Identification of host proteins associated with
Table 1(abstract 62) Comparison between the
fluorescence-based quantitation method and the p24
ELISA assay
Specificity
Linear range
Fluorescence-based
method
p24 ELISA assay
Gag-GFP fusion protein
Gag-GFP fusion protein
7 to 1000 RFU
(10 to 3600 ng of p24/mL)
10 to 300 pg of
p24/mL
Precision
~2% CV
~10% CV
Limit of detection
10 ng/mL of p24
10 pg/mL of p24
Time (96 samples)
~1.5 h
~4 h
Price (96 samples)
~10 €
~400 €
RFU: Relative fluorescence units
CV: Coefficient of variation
5.
6.
7.
retroviral vector particles by proteomic analysis of highly purified vector
preparations. J Virol 2008, 82(3):1107-1117.
Gutierrez-Granados S, Cervera L, Godia F, Carrillo J, Segura MM:
Development and validation of a quantitation assay for fluorescently
tagged HIV-1 virus-like particles. J Virol Methods 2013, 193:85-95.
ICH: Validation of Analytical Procedures:Text and Methodology Q2(R1).
2005.
Chen Y, Wu B, Musier-Forsyth K, Mansky LM, Mueller JD: Fluorescence
fluctuation spectroscopy on viral-like particles reveals variable gag
stoichiometry. Biophys J 2009, 96:1961-1969.
P63
BI-HEX®-GlymaxX® cells enable efficient production of next generation
biomolecules with enhanced ADCC activity
Anja Puklowski, Till Wenger, Simone Schatz, Jennifer Koenitzer,
Jochen Schaub, Barbara Enenkel, Anurag Khetan, Hitto Kaufmann,
Anne B Tolstrup*
Boehringer-Ingelheim, Biberach an der Riss, Germany, 88397
Background: Despite the succes story of therapeutic monoclonal
antibodies (mAbs), a medical need remains to improve their efficacy. One
possibility to achieve this is to modulate important effector functions
such as the antibody dependent cellular cytotoxicity (ADCC).
The advantage of highly active biotherapeutic molecules is - apart from
the enhanced efficacy - the reduction of side effects due to lower
administered doses. Furthermore, these therapeutic antibodies may
enable treatment of current non-responders, e.g. patients with low
antigen bearing tumors. Enhancement of the effector functions of
antibodies can be achieved either by directly mutating the antibody’s
amino acid sequence or by modifying its glycosylation pattern, e.g. by
using a novel host cell line able to attach a desired glycostructure to the
product. The latter approach has the advantage of not impacting the
antibody structure itself, thereby avoiding negative effects on the PK/PD
of the molecule. During the last decade it has been shown that
antibodies with a reduced level of glycan fucosylation are much more
potent in mediating ADCC, a mode of action particularly relevant for
cancer therapeutics. Therefore, defucosylated antibodies are of major
interest for biotherapeutics developers. To produce such antibodies,
Boehringer Ingelheim has inlicensed the GlymaxX® system from
ProBioGen, Germany. This technology utilises the bacterial protein RMD
(GDP-6-deoxy-D-lyxo-4-hexulose reductase) which, when stably integrated
into host cell lines, inhibits fucose de-novo biosynthesis. The enzyme
deflects the fucosylation pathway by turning an intermediate (GDP-4Keto-6-Deoxymannose) into GDP-Rhamnose, a sugar that cannot be
metabolised by CHO cells. As a consequence, recombinant antibodies
generated by such host cells exhibit reduced glycan fucosylation and
20-100 fold higher ADCC activity. Here, we show the establishment of a
new host cell line, termed BI-HEX®-GlymaxX® which is capable of
producing highly active therapeutic antibodies. We furthermore present
data on the cell line properties concerning cell culture performance (e.g.
titer, growth, transfection efficiency), process robustness and product
quality reproducibility.
Methods: The BI-HEX® host cell line was transfected with the bacterial
RMD enzyme and stably expressing clones were selected. The presence
of RMD was confirmed by Western blotting. The clones were analysed for
stability of RMD expression over time in continous culture (>100 days),
glycoprofile structure, CD16 binding and ADCC activity of mAbs produced
by these clones before selection of the final new BI-HEX®-GlymaxX® host
cell. Furthermore, we examined the growth and cultivation properties of
the modified BI-HEX®GlymaxX® cells to ensure that the engineered host
cell maintained the favourable manufacturability properties of BI-HEX®
and we tested the reproducibility of key product quality attributes of the
generated antibodies.
Results: Up to date seven different antibodies were produced in our new
BI-HEX®-GlymaxX®host cell line. All molecules showed a very significant
reduction of fucosylation down to 1-3% compared to the control.
Correlating with the low fucose levels, antibodies produced in BI-HEX®GlymaxX® exhibited a 20-100× increased ADCC activity (Figure 1A). This
enhancement also correlated well with an increase in CD16 binding. For
the routine cell line and process development we investigated the
robustness of the defucosylation and its resulting activity enhancement.
The results indicated a high reproducibility between independent
production runs. The ADCC level as well as the CD16 binding was robust
for all analysed mAbs (Figure 1B). Investigating the cell culture behaviour
of the BI-HEX®-GlymaxX®and its parental BI-HEX® cell line, we saw
comparable results for their transfection efficiencies, doubling times, titer
Page 85 of 151
and production run performance. Depletion studies of RMD showed that
this enzyme can be efficiently depleted during downstream purification
of the mAb.
Conclusions: Our new BI-HEX®-GlymaxX®cell line is capable of producing
>90% defucosylated antibodies which exhibit a 20-100 fold higher ADCC
activity compared to a normal CHO production cell line like BI-HEX®. This
increase in ADCC activity correlated with a stronger CD16 binding in
those molecules. Furthermore, the BI-HEX®-GlymaxX® cells show the same
manufacturing properties (transfection efficiency, doubling times, titer,
peak cell density) to its originator cell line. For the depletion of RMD
we’ve established a sensitive depletion assay and measured a complete
reduction of RMD after the first purification step (protein A capture).
P64
Effects of perfusion processes under limiting conditions on different
Chinese Hamster Ovary cells
Anica Lohmeier1*, Tobias Thüte1, Stefan Northoff2, Jeff Hou3, Trent Munro3,
Thomas Noll1,4
1
Institute of Cell Culture Technology, Bielefeld University, Germany;
2
TeutoCell AG, Bielefeld, Germany; 3The Australian Institute for
Bioengineering and Nanotechnology (AIBN), University of Queensland,
Brisbane, Australia; 4Center for Biotechnology (CeBiTec), Bielefeld University,
Germany
Background: The use of perfusion culture to generate biopharmaceuticals
is an attractive alternative to fed-batch bioreactor operation. The process
allows for generation of high cell densities, stable culture conditions and a
short residence time of active ingredients to facilitate the production of
sensitive therapeutic proteins.
However, challenges remain for efficient perfusion based production at
industrial scale, primarily complexity of required equipment and
strategies adopted for downstream processing. For perfusion systems to
be industrially viable there is a need to increase product yields from a
perfusion-based platform.
We have shown previously that one effective way to enhance the cell
specific productivity is via glucose limitation [1,2]. The mechanisms leading
to an increased productivity under these glucose limiting conditions are
still under investigation. Preliminary studies using proteomic analysis have
indicated changes in histone acetylation [2].
In this work, we investigated the influence of glucose limited conditions on
the production of two different recombinant proteins in perfusion processes.
Materials and methods: CHO-MUC2 and CHO-XL99 cell lines were
cultivated perfusion based in a 2 L pO 2- and pH-controlled bioreactor
using an internal spin filter (20 μm) for cell retention. In addition these
cell lines were cultivated both under limiting and non-limiting glucose
conditions in fed-batch mode in a four vessel parallel single-use system
(Bayshake, Bayer Technology Services GmbH).
Figure 1(abstract P63) A) Comparison of ADCC activity of Rituximab produced in either BI-HEX® or BI-HEX®-GlymaxX®. B) ADCC activity of 3
different mAbs produced in BI-HEX®-GlymaxX®. Three independent production runs were performed for each mAb. The mAbs were individually purified
by protein A capture before ADCC activity determination.
Perfusion mode was started three days after inoculation; flow rate was
adjusted between 0.3 d -1 and 0.6 d -1 . For fed-batch cultivation the
limiting range for glucose concentration was chosen between 0.2 and
0.5 g/L. Reference cultivation was performed between 1.5 and 3.0 g/L.
Both cultures were fed with similar volumes.
All cultivations were performed in chemically-defined, animal-component
free CHO growth media (TeutoCell AG).
Viable cell density and viability were determined using the automated cell
counting system CEDEX (Roche Diagnostics), glucose and lactate
concentrations were detected via YSI (YSI life sciences). Amounts of IgG1
were quantified via Protein A HPLC, anti IL-8 mAb purified from a CHO
DP-12 cell clone was used as a standard. Mucin-2 quantity was measured
via photometric quantification of eGFP coupled to the Mucin 2.
Results: Using perfusion mode with a 20 μm spin filter as cell retention device
we have reached viable cell densities of 1.4·107 cells/mL in a 24 day perfusion
run of CHO-MUC2 (Figure 1A). During perfusion the average viability remained
higher than 85% was attained. After 6 days of cultivation glucose reached a
limiting concentration below 1 mM (Figure 1B). Meanwhile a relative eGFP
concentration of 5 mg/L was achieved (Figure 1C) and cell specific productivity
increased by 90% during glucose limitation (data not shown).
A further 34 day perfusion cultivation using a CHO-XL99 clone reached a
viable cell density of 2.6·10 7 cells/mL with an average viability of 90%
(Figure 1A). Glucose and Lactate concentrations of CHO-XL99 were below
Page 86 of 151
detectable limits on day 8 and 17 post-inoculation respectively (Figure 1B).
Simultaneously, cells were able to reach an IgG1 titer of 326 mg/L, with
significant increases in product titer observed after 24 days of culture
(Figure 1C). Simultaneously, cell specific productivity showed a slight
increase after 25 days (data not shown).
Neither the CHO-MUC2, nor the CHO-XL99 cells showed any limitations
concerning other substrates, e.g. amino acids (data not shown).
In two parallel fed-batch cultivations of the CHO-XL99 clone the glucose
limited culture showed similar growth characteristics as the unlimited
reference culture. Viable cell densities of 1.9·107 cells/mL (reference) and
2.9·10 7 cells/mL (-Glc), respectively, were observed (Figure 1D). The
limited culture reached an IgG1 concentration of 610 mg/L, in contrast to
292 mg/L produced by the reference culture (Figure 1D). Under glucose
limitation the cells consumed lactate while under non-limiting conditions
lactate accumulated (Figure 1E).
Conclusions: During perfusion processes under glucose limitation three
characteristic phases appear: At first glucose concentration is high and
lactate is below detection limit. Afterwards glucose is metabolized into
lactate with an increasing lactate formation rate. In the end both
metabolites are consumed and an increase in product concentration and
cell specific productivity occurs.
Reduced lactate formation was observed during the perfusion run as
CHO-MUC2 cells shift towards a more efficient glucose metabolism.
Figure 1(abstract P64) A Viable cell counts and cell viabilities for the time course of CHO-MUC2 and CHOXL99 cells during perfusion process; B: glucose
and lactate concentrations during CHO-XL99 and CHO-MUC2 perfusion cultivation; C: Concentration of IgG1 mAb and eGFP during CHO perfusion
cultivations; D: Viable cell counts and mAb concentration for the time course of CHO-XL99 fed-batch cultivations; E: Glucose and lactate concentrations
for the time course of CHO-XL99 under limiting (-Glc) and non-limiting conditions.
Thereby cell specific productivity of CHO-MUC2 cells increased by 90%
during glucose limitation.
CHO-XL99 cells showed a similar metabolic shift during perfusion along
with increased mAb production as well as in fed-batch cultivation.
Resulting from this fed-batch cultivations allow predictions concerning
cell behavior under glucose limitation in perfusion.
To analyse the impact of limiting conditions on transcriptome level of
CHO cells, a microarray will be used. This proprietary CHO microarray
contains 41.304 different probes to elucidate reasons for the increase in
cell specific productivity.
Acknowledgements: We gratefully acknowledge to the Australian
Institute for Bioengineering and Nanotechnology, University of
Queensland-Brisbane, Australia (AIBN) for providing the CHO-XL99 clone.
We would also thank Bayer Technology Services for providing the
Bayshake system.
References
1. Link T, Bäckström M, Graham R, Essers R, Zörner K, Gätgens J: Bioprocess
development for the production of a recombinant MUC1 fusion protein
expressed by CHO-K1 cells in protein-free medium. J Biotechnol 2004,
110:51-62.
2. Wingens M, Gätgens J, Hoffrogge R, Noll T: Proteomic characterization
of a glucose-limited CHO-perfusion process-analysis of metabolic
changes and increase in productivity. ESACT proceedings Springer: Noll T
4:265-269.
P65
Development of 3D human intestinal equivalents for substance testing
in microliter-scale on a multi-organ-chip
Annika Jaenicke1*, Dominique Tordy3, Florian Groeber3, Jan Hansmann3,
Sarah Nietzer4, Carolin Tripp4, Heike Walles3,4, Roland Lauster1, Uwe Marx1,2
1
TU Berlin, Institute for Biotechnology, Faculty of Process Science and
Engineering, 13355 Berlin, Germany; 2TissUse GmbH, 15528 Spreenhagen,
Germany; 3Fraunhofer Institute for Interfacial Engineering and Biotechnology
IGB, 70569 Stuttgart, Germany; 4Chair of Tissue Engineering and
Regenerative Medicine, Julius-Maximilians-Universität Würzburg, 97070
Würzburg, Germany
Page 87 of 151
Background: Robust and reliable dynamic bioreactors for long term
maintenance of various tissues at milliliter-scale on the basis of a
biological, vascularized matrix (BioVaSc®) have been developed at the
Fraunhofer IGB in Stuttgart, Germany. As an intestinal in vitro equivalent,
seeding of the matrix with CaCo-2 cells yielded in the self-assembly of a
microenvironment with the typical histological appearance of villus-like
structure and morphology [1]. We modified this matrix (BioVaSc®) - cell
(CaCo-2) system to some extent with the aim to develop 3D intestinal
equivalents for systemic preclinical testing of orally applied drug
candidates in microliter-scale on a human Multi-Organ-Chip (MOC), which
consists of different organ equivalents important for ADMET (adsorption,
distribution, metabolism, excretion, toxicity) testing.
Materials and methods: For the generation of biological, vascularized
matrices (rBioVaSc®), jejunal segments of the small intestine of Wistar rats
including the corresponding capillary bed were explanted and decellularized
by perfusion with 1% sodium deoxycholate. Characterization of the matrix
was done by histological analysis as well as 2-photon microscopy (2 PM)
and immunofluorescent stainings. After sterilization by g-irradiation, the
rBioVaSc® could be used to built up a 3D intestinal equivalent. Punch
biopsies of the matrix were fixed on the frame of a 96-well transwell insert
and seeded with CaCo-2 cells (2*10^6 cells) on the former luminal side of
the matrix following static cultivation for 48 hours and integration in a
perfused MOC device. Our MOC device consists of an integrated micropump, a microfluidic channel system and inserts for the cultivation of
different organ equivalents (Figure 1e). For the generation of the intestinal
equivalent, the generated matrix-cell construct was placed in the MOC
device and perfused for up to one week with cell culture medium
(supplemented MEM), following histological as well as immunofluorescence
(IF) analysis of the growth behavior of the cells. As a control, matrix-cell
constructs were cultivated statically. Daily medium samples have been
analyzed to monitor metabolic activity and the absorption properties of the
intestinal equivalent. Immunohistostaining of cryo-preserved tissue slices
have been analyzed to compare self-assembled organoid tissue structures
with their corresponding in vivo counterparts.
Results: Decellularization of jejunal segments of rats together with the
corresponding capillary bed yielded in a biological, vascularized matrix
which was free of non-human cells but with the preserved 3D structure
of the former intestinal extracellular matrix (ECM) (Figure 1a-d). Those
ECM components were used for the resettlement of human intestinal
Figure 1(abstract P65) a-d) Characterization of the decellularization procedure. a) Explanted jejunal segment with the preserved capillary bed after
decellularization. b) H/E staining of the decellularized matrix. c) Feulgen staining of the decellularized matrix. d) immunofluorescent stainings for collagen
I on rBioVaSc. e) The multi-organ-chip (MOC) device consisting of an integrated micro-pump, a microfluidic .channel system and inserts for the cultivation
of different organ equivalents. f+g) Characterization of the intestinal in vitro equivalent. f) H/E staining of the recellularized matrix after one week of
dynamic culture in the MOC device. g) Second Harmonic Generation by 2 PM, nuceli were stained with Hoechst 33342.
cells (CaCo-2) which resulted in the formation of characteristical villus-like
structures on the matrix after one week of perfused cultivation (Figure 1f+g).
Cells expressed typical intestinal epithelial markers, e.g. CK8/18, EpCAM and
Na/K-ATPase. Process parameters, such as nutrient perfusion rate and
culture time, have been optimized to qualify the system for repeated dose
testing of orally administered drug candidates.
Conclusions: As shown by histological as well as immunofluorescent
stainings, we succeeded in the development of self-assembled 3D organ
equivalents which have a characteristical intestinal architecture. Those
organ equivalents can be used as an in vitro system for the evaluation of
adsorption properties of orally administered drugs in microliter-scale on a
multi-organ-chip (MOC). Further improvements of the MOC device are
necessary, e.g. the integration of a second circulation, representing the
intestinal lumen. In addition, reseeding the matrix with primary intestinal
cells as well as co-cultures of epithelial and endothelial cells are planned.
Ministry for Education and Research, GO-Bio Grand No. 0315569.
Reference
1. Pusch J, Votteler M, Göhler S, Engl J, Hampel M, Walles H, SchenkeLayland K: The physiological performance of a three-dimensional model
that mimics the microenvironment of the small intestine. Biomaterials
2011, 32:7469-7478.
P66
A robust RMCE system based on a CHO-DG44 platform enables
efficient evaluation of complex biological drug candidates
Thomas Rose1,2*, Annette Knabe1, Rita Berthold1, Kristin Höwing1,
Anne Furthmann1, Karsten Winkler1, Volker Sandig1
1
ProBioGen AG, 10439 Berlin, Germany; 2Freie Universität Berlin, 14195 Berlin,
Germany
Background: In early development stages of biologicals there is often
more than one molecule against a specific target. A careful candidate
evaluation is crucial to choose an optimal lead variant for further
development. Complex biologicals are typically produced in CHO cells
and host cells as well as the process are known to influence important
molecule features such as glycan patterns or activity. To streamline the
generation of stable producer cell lines we have established an Flp-based
RMCE system in our CHO-DG44 platform. RMCE application allows for
multi-parallel production of candidate material in the host cell and
process background used for the pharmaceutical cell lines. Therefore, the
molecular features of this material are expected to match with material
that will be derived from a future producer cell line.
Generation of the RMCE host cell line: A replaceable gfp gene cassette
was established at random chromosomal integration sites in CHO-DG44
cells. This clone pool was subjected to a primary RMCE with a secreted
and complex glycosylated alpha1-antitrypsine (A1AT) reporter. Resulting
cells were screened for A1AT producers that have undergone a successful
cassette exchange. This strategy allows for selection of a RMCE host cell
line that combines transgene expression from highly active genomic loci
with superior processing and secretion capabilities.
Strategy for routine RMCE application: The selected RMCE host cell
line is susceptible for cassette exchange with any desired target gene
and candidate protein. Successful cassette exchange is enforced by
promoter trap and a well defined selection system (Figure 1A). For RMCE
application the promoterless target gene encoding for the candidate
protein is cloned into a target vector where it is linked to a selection
marker via an IRES element. Upon successful cassette exchange, the
target and marker gene will be activated by a promoter residing at the
targeting locus. In addition, a second inactive marker gene (lacking an
ATG) that resides also at the host genome, but downstream of the
replaceable gene cassette will be activated. The target vector is
introduced together with a vector encoding the flp recombinase into the
RMCE host cell line. The use of heterospecific FRT sites prevents from
simple re-excision of the gene cassette.
A robust protocol provides for efficient RMCE: RMCE application
results in cell populations showing comparable expression levels of the
newly introduced genes as exemplified for individual RMCEs with a gfp
reporter and different selection formats (Figure 1B). Also, a homogenous
Page 88 of 151
expression was observed within the individual RMCE derived populations
after drug selection. Efficient RMCE application is supported by a fine
tuned and robust protocol that can be applied in T-flasks or multiwell
formats.
Evaluation studies: RMCE application with monoclonal antibody and
fusion proteins: RMCE was applied to a monoclonal antibody and single
cell clones have been generated from the RMCE derived population. Those
clones were analyzed together with the original population in fed batch
culture using ProBioGen’s chemical defined platform medium and process
(Figure 1C). The RMCE derived population yielded in harvest titers of 0.5 g/L
matching the titers obtained for individual clones. Consequently, after drug
selection the cells can be directly used for material production. Single cell
cloning is not required!
In a second study two variants of a soluble receptor-Fc fusion protein
were analyzed for manufacturability. Over a number of individual RMCEs
variant #1 was expressed at a ~2-fold higher rate. In a fed batch process
the difference was maintained yielding in final titers of 1.2 g/L for variant
#1 (Figure 1D). The 2-3-fold outperformance of variant #1 was confirmed
in classic cell line development.
RMCE facilitates streamlined generation of stable cell lines and POC
material production: At minimal effort RMCE application allows for
streamlined generation of stable cell lines and production of POC
material (Figure 1E). Applying a single RMCE within only 2 weeks a
suspension culture is available for scale-up and production. Compared to
transient protocols production runs can easily be repeated at any time
and scale.
Conclusions: A robust protocol provides for efficient and reproducible
RMCE application for antibodies and single chain proteins.
At minimal effort RMCE application enables fast and multi-parallel
evaluation of complex biological drug candidates.
RMCE application allows for streamlined production of candidate material
in the background of ProBioGen’s CHO-DG44 platform.
P67
Systems biology of unfolded protein response in recombinant CHO
cells
Kamal Prashad Segar, Vikas Chandrawanshi, Sarika Mehra*
Department of Chemical Engineering, Indian Institute of Technology
Bombay, Mumbai - 400076, India
Background: Productivity of recombinant therapeutics is a coordinated
effort of multiple pathways in the cell [1]. The protein processing
pathway in endoplasmic reticulum has been the target of many cell
engineering studies but with mixed results [2]. We have observed the
induction of UPR genes in recombinant CHO cells (data not shown). In
this work, we attempt to increase their productivity further by inducing
ER stress using a known UPR inducer.
Materials and methods: Cell culture: Suspension CHO cells secreting
anti rhesus IgG were grown in a media containing 50% PF-CHO
(Hyclone) and 50% CDCHO (Invitrogen) supplemented with 4 mM LGlutamine (Invitrogen), 0.10% Pluronic (Invitrogen), 600 μg/ml G418
(Sigma) and 250 nM Methotrexate (Sigma) in a total culture volume of
20 ml. All cultures were run in replicates in 125 ml Erlenmeyer flasks
(Corning). Cells were treated with tunicamycin (Sigma) for 12 hours and
were harvested for RNA isolation. Cell densities and viabilities were
determined by a hemocytometer using the tryphan blue exclusion
method.
Quantitative real time PCR: Primers were designed based on consensus
sequences from human, mouse and rat and checked against the CHO
genome database wherever available. Total RNA was isolated using Tri
reagent (Sigma) and converted to cDNA using the Reverse Transcription
kit (Thermo). 100 ng of cDNA was used for qPCR to quantify the mRNA
levels of different UPR genes with Actin as the house keeping genes
following the ΔΔCT method.
Antibody quantification: Antibody titres were quantified using the
protocol as described earlier by Chusainow et.al.,[3] and their specific
productivities (qP) were also calculated.
Results: Induction of different ER stress genes was observed at peak
productivities in these recombinant CHO cell lines (data not shown).
Page 89 of 151
Figure 1(abstract P66) A: RMCE Strategy for routine RMCE application in the selected CHO-DG44 RMCE host cell line. M = selection marker, haat =
A1AT gene. B: GFP expression of cell populations derived from multiple RMCEs and selection formats. C: RMCE with a monoclonal antibody. Fed batch of
the direct RCME derived population and three individual RMCE clones derived from original RMCE population. D: RMCE with two variants of a soluble
receptor-Fc fusion protein. Exemplary fed batch process for the both RMCE derived Fc fusion protein variants. E: Timescale of routine RMCE Application.
Therefore, we hypothesized that increasing the ER stress to higher levels
may have an additive effect on IgG productivity in these cell lines.
Tunicamycin a known ER stress inducer was used to induce ER stress in
these cells. CHO cells were treated with tunicamycin (2.5 mM) for 12
hours and harvested for RNA isolation. qPCR was performed to quantitate
the expression levels of different ER stress genes. IgG HC and LC mRNA
were also quantified and their fold changes were also calculated. IgG
titers in the supernatant were quantified using ELISA.
The IgG titers and cumulative productivities in the tunicamycin treated and
control cells are presented in Figures 1a and 1b. 12 hours post-treatment
with tunicamycin, the IgG titers increased to 460 μg/ml. Productivity in
treated cells was found to be 25 pg/cell/day, corresponding to a 1.7 fold
increase compared to control cells. Interestingly, both the IgG HC and LC
mRNA were not induced in treated cells (Figure 1c, d). To elucidate the
role of UPR pathway in the observed increase in productivity, expression of
many chaperones and UPR genes was measured. In response to
tunicamycin, chaperones including GRP78 and GRP94 were induced to a
maximum of 17-fold (Figures 1e, f). Co-chaperone ERDJ4, involved in
the translocation of nascent proteins inside ER and activation of ERAD
pathway [4], was also induced in response to tunicamycin treatment
indicating increase in ER load. Figure 1g and 1h show the mRNA profiles
of ERDJ4 and EDEM in control and treated cells. No significant difference
in expression of UGGT1 mRNA was observed, suggesting that there may
be negligible mis-folded proteins (Figure 1i) which can be recycled for
refolding while most of them are continuously degraded by the ERAD
machinery. Highly active transcription factors of the UPR pathway viz.,
GADD34, CHOP and XBP1s were also induced in response to tunicamycin
treatment. Figures 1j-1l show the mRNA profiles of different UPR genes.
GADD34 was induced to 38-folds on treatment while CHOP mRNA
induced to about 30-folds. Spliced XBP1 mRNA was also induced to a
maximum of 5.5-folds in treated cells leading to increased expression of
GRP78 mRNA.
Conclusion: Engineering cells towards high productivity by exploiting
their cellular pathways has been gaining importance recently in
biopharmaceutical industries. The unfolded protein response (UPR)
pathway has also been targeted to develop a high producing clone.
However, the results from previous engineering studies on this pathway
are either cell line or product dependent.
Page 90 of 151
Figure 1(abstract P67) Effect of Tunicamycin on the IgG titres, productivities and mRNA levels of different UPR genes.
In this study, with prior knowledge on the induction of different UPR genes
at peak productivities, we attempted to increase productivity by increasing
ER stress using a known UPR inducer, tunicamycin. Tunicamycin induced
the expression of chaperones and key UPR transcription factors including
GADD34 and XBP1s mRNA.
Increase in the levels of GRP78 and GRP94 mRNA with no change in the
levels of the UGGT1 mRNA suggests that the treated cells may possess a
highly active folding pathway. Increase in the productivities with no
change in the levels of IgG HC and LC mRNA support our hypothesis of
an increased folding capacity in treated cells. Hence, we suggest that the
UPR pathway can be modulated to increase the productivity.
Acknowledgements: This work was partially supported by a grant from
Department of Biotechnology, Government of India. We would like to
thank Dr. Miranda Yap and Dr. Niki Wong, Bioprocessing Technology
Institute, Singapore for providing the CHO cell lines.
References
1. Seth G, Charaniya S, Wlaschin KF, Hu WS: In pursuit of a super produceralternative paths to high producing recombinant mammalian cells. Curr
Opin Biotechnol 2007, 18:557-564.
2. Seth G, Hossler P, Yee JC, Hu WS: Engineering cells for cell culture
bioprocessing–physiological fundamentals. Adv Biochem Eng Biotechnol
2006, 101:119-164.
3. Chusainow J, Yang YS, Yeo JHM, Toh PC, Asvadi P, Wong NSC, Yap MGS: A
Study of Monoclonal Antibody-Producing CHO Cell Lines: What Makes a
Stable High Producer? Biotechnology 2009, 102:1182-1196.
4. Lai CW, Otero JH, Hendershot LM, Snapp E: ERdj4 protein is a soluble
endoplasmic reticulum (ER) DnaJ family protein that interacts with ERassociated degradation machinery. The Journal of biological chemistry
2012, 287:7969-7978.
P68
Chemical chaperone suppresses the antibody aggregation in CHO cell
culture
Masayoshi Onitsuka1, Miki Tatsuzawa2, Masahiro Noda2, Takeshi Omasa1*
1
Institute of Technology and Science, The University of Tokushima,
Tokushima, 770-8506, Japan; 2Graduate School of Advanced Technology and
Science, The University of Tokushima, Tokushima, 770-8506, Japan
Background: Aggregation of therapeutic antibodies could be generated
at different steps of the manufacturing process, posing the problem for
quality control of produced antibodies. It has been well known that
secreted antibodies from recombinant mammalian cells into culture
medium can aggregate due to the physicochemical stresses such as
media pH and osmolality, cultivation temperature [1,2]. The antibody
aggregation during the cell culture process is difficult to suppress
because the cell culture conditions for antibody production are generally
optimized for cell culture and growth and not for suppressing the
aggregate formation. Here we show the novel strategy to suppress the
antibody aggregation; application of chemical chaperone to the cell
culture process. It is well established that an addition of some cosolutes
serves as chemical chaperone to suppress the protein aggregation.
Trehalose, non-reducing sugar formed from two glucose units with a-1,1
linkage, is known as an effective chemical chaperone. In this study, we
investigated the anti-aggregation effect of trehalose in the culture process
of recombinant Chinese hamster ovary cell (CHO) line producing Ex3humanized IgG-like bispecific single-chained diabody with Fc (Ex3-scDb-Fc).
Page 91 of 151
Table 1(abstract 68) Kinetic parameters of cell culture in
Erlenmeyer flasks
Specific growth rate
(μ; ×10-2 1/h)
Without trehalose
150mM trehalose
a
Specific
antibody production rate
(rAb; pg/cell/day)
3.07 ± 0.18
a
0.39 ± 0.02
a
1.51 ± 0.04
a
1.55 ± 0.03
a
Mean ± S.D. (n = 3).
Ex3-scDb-Fc shows the remarkable anti-tumor activity based on anti-EGFR
and anti-CD3 bispecificity [3]. However, our in-house results showed that
Ex3-scDb-Fc shows aggregation tendency, demonstrating the necessity of
developing a bioprocess for suppressing the aggregation of the bispecific
diabody.
Materials and methods: CHO Top-H cell line producing the Ex3-scDb-Fc [4]
was cultivated in 500mL Erlenmeyer flask and 2L-glass bioreactor with serumfree medium containing 150mM trehalose. Viable cell densities and antibody
concentrations were determined with Vi-Cell XR™ cell viability analyzer
(Beckman Coulter) and by ELISA, respectively. Ex3-scDb-Fc was purified with
Hi-Trap protein A column (GE Healthcare). 1M Arg-HCl (pH4.2) was used as
eluting solution, which make it possible to prevent the aggregation of the
antibody in the affinity purification process. Antibody aggregation was
analyzed by sephacryl S-300 column (GE healthcare). Solution structure of
Ex3-scDb-Fc was assessed by circular dichroism spectroscopy.
Results and discussion: Cell culture performance in trehalose
containing medium: We cultivated CHO Top-H cell line in 150mM
trehalose containing medium. The media osmolalities with and without
trehalose (150 mM) were 480 mOsm/kg and 319 mOsm/kg, respectively.
Estimated kinetic parameters of cell culture are listed in Table 1. Cell
culture in Erlenmeyer flasks demonstrated that cell growth was strongly
affected by trehalose; the specific cell growth rate and the maximum cell
density were decreased compared to those in the absence of trehalose.
On the other hand, both the specific antibody production rate and
volumetric production were largely enhanced by trehalose addition. The
results in Erlenmeyer flask mentioned above were reproduced in 2L-glass
bioreactor culture. Observed properties of the cell culture in the presence
of trehaose, suppressed cell growth and enhanced antibody production,
were similar to those reported for mammalian cell cultures under
hyperosmotic condition [5], although the underlying mechanisms
responsible for the enhanced antibody production are largely unknown.
Anti-aggregation effects by trehalose during the cell culture process:
The scDb-Fc was purified from the culture supernatant by protein A
affinity chromatography, and the aggregation states were analyzed by
size exclusion chromatography. We observed the 3 states of scDb-Fc,
monomer, dimer, and large aggregates, which were included in the
culture supernatant when harvested (Figure 1). The peak area of the large
Figure 1(abstract P68) Size-exclusion chromatography showing the
aggregation status of Ex3-scDb-Fc.
aggregates in the presence of trehalose was one-third that in the
absence of trehalose, indicating that trehalose suppressed the formation
of large aggregates in the CHO cell culture. Circular dichroism (CD)
spectroscopy showed that the large aggregates were misfolded state
with non-native b-strand. Trehalose is expected to suppress the
accumulation of misfolded state and the intermolecular interactions
leading to the aggregate formation in cell culture.
Conclusions: We demonstrated the potential application of chemical
chaperon in the culture of antibody-producing mammalian cells. Trehalose
can be incorporated in the culture media for CHO cells, and can suppress
the antibody aggregation, especially high-order aggregates. In addition,
trehalose may be involved in the enhancement of antibody production.
Acknowledgements: This study was supported by the Advanced
research for medical products Mining Programme of the National Institute
of Biomedical Innovation (NIBIO). Trehalose was kindly supplied by
HAYASHIBARA Biochemical Laboratories, Inc. (Okayama, Japan). This work was
collaboration with Assoc. Prof. Ryutaro Asano and Prof. Izumi Kumagai
(Tohoku University, Japan).
References
1. Cromwell ME, Hilario E, Jacobson F: Protein aggregation and
bioprocessing. AAPS J 2006, 8:E572-579.
2. Vázquez-Rey M, Lang DA: Aggregates in monoclonal antibody
manufacturing processes. Biotechnol Bioeng 2011, 108:1494-1508.
3. Asano R, Kawaguchi H, Watanabe Y, Nakanishi T, Umetsu M, Hayashi H,
Katayose Y, Unno M, Kudo T, Kumagai I: Diabody-based recombinant
formats of humanized IgG-like bispecific antibody with effective
retargeting of lymphocytes to tumor cells. J Immunother 2008,
31:752-761.
4. Onitsuka M, Kim WD, Ozaki H, Kawaguchi A, Honda K, Kajiura H, Fujiyama K,
Asano R, Kumagai I, Ohtake H, Omasa T: Enhancement of sialylation on
humanized IgG-like bispecific antibody by overexpression of a2,6sialyltransferase derived from Chinese hamster ovary cells. Appl Microbiol
Biotechnol 2012, 94:69-80.
5. Rodriguez J, Spearman M, Huzel N, Butler M: Enhanced production of
monomeric interferon-beta by CHO cells through the control of culture
conditions. Biotechnol Prog 2005, 21:22-30.
P69
Dynamical analysis of antibody aggregation in the CHO cell culture
with Thermo Responsive Protein A (TRPA) column
Masahiro Noda1, Masayoshi Onitsuka2, Miki Tatsuzawa1, Ichiro Koguma3,
Takeshi Omasa2*
1
Graduate School of Advanced Technology and Science, The University of
Tokushima, Tokushima, 770-8506, Japan; 2Institute of Technology and
Science, The University of Tokushima, Tokushima, 770-8506, Japan; 3New
Products Development Department, Asahikasei Medical Co., LTD., Bioprocess
Division, Fuji, 416-8501, Japan
Background: Aggregation of therapeutic antibody is generally occurred
in its manufacturing process, and should be suppressed and removed
because its potential risk for unexpected immune response [1,2]. Protein
A affinity chromatography is the first purification step in the monoclonal
antibody manufacturing. Although the affinity purification is a powerful
technique, high affinity between protein A and antibody requires acidic
condition (below pH 3.0) to elute the captured antibody molecules.
Exposure to acidic condition can induce the denaturation and aggregation
of antibody molecules, demonstrating the necessity of novel strategy to
reduce the antibody aggregation in the affinity purification process. Here we
introduced a novel affinity purification strategy, thermo responsive protein A
(TRPA) resin. TRPA is an engineered protein A ligand which adopts folded
structure under 10°C and unfolds at moderate temperature, above 25°C.
TRPA resin can control capture and elution of antibody by changing column
temperature, making it possible to elute antibody molecules without low pH
condition. In this study, we applied the TRPA column to the purification of
Ex3 humanized IgG-like single-chained bispecific diabody-Fc (Ex3-scDb-Fc)
[3]. The bispecific diabody is the promising candidate for next-generation
therapeutic antibody, whereas it shows aggregation tendency. Furthermore,
we observed the time-dependent formation of antibody aggregation in the
culture process of the recombinant Chinese hamster ovary (CHO) cell line
with TRPA column.
Materials and methods: CHO Top-H cell line producing the Ex3-scDb-Fc
[4] was cultivated in a 1L-glass bioreactor with working volume of 750 mL
serum-free medium. Viable cell densities and antibody concentrations in
the medium was determined with Vi-Cell XR™ cell viability analyzer
(Beckman Coulter) and by ELISA, respectively. The bispecific diabody was
purified with conventional protein A (PA) column or thermo responsive
protein A (TRPA) column, which were connected with AKTA prime plus (GE
Healthcare). Elution of antibody was performed by acidic pH solution
(pH2.7) for PA column and by raising column temperature to 45°C for TRPA
column. Aggregate formation was analyzed with Superdex 200 10/30 GL
column (GE Healthcare).
Results and discussion: Performance of TRPA column in the affinity
purification of bispecific diabody-Fc: We purified the Ex3-scDb-Fc from
the culture supernatant of CHO Top-H cell line with PA and TRPA column.
Compared to the conventional protein A column (PA), purification with
TRPA column showed no precipitation of the aggregated scDb-Fc after the
elution. Figure 1A is the size exclusion chromatography (SEC) profiles,
showing that TRPA purification substantially reduced the formation of
soluble large aggregates as compared to the PA purification including the
exposure to acidic pH condition. Collectively, the above results demonstrate
that TRPA column is highly effective in preventing the formation of
precipitated and soluble aggregates in the affinity purification of the
bispecific diabody-Fc.
Dynamical aggregation analysis in the cell culture process: SEC profile
of TRPA-purified Ex3-scDb-Fc would correctly reflect the status of antibody
aggregation in CHO cell culture, because no further aggregation was
induced in the affinity purification process with TRPA column as compared
with that with conventional PA. Although secreted antibody is known to
aggregate during cell culture process [1,2], the underlying mechanism is
still poorly understood due to the lack of observation of the aggregation
process. We applied the TRPA column to dynamical aggregation analysis of
Ex3-scDb-Fc in CHO cell culture. Culture supernatants from exponential to
stationary growth phase in a bioreactor operation were sampled, and the
bispecific diabody was purified with TRPA column and analyzed by Size
exclusion chromatography. The procedure makes it possible to observe the
time-dependent formation of antibody aggregates in CHO cell culture. In
Figure 1B, the peak areas of large aggregates were plotted as a function of
cultivation time, showing that after 250 hours the amounts of aggregated
Ex3-scDb-Fc were abruptly increased in time dependent manner. The
results suggest a nucleation-dependent aggregation model for antibody
aggregation, where the accumulation of aggregation nucleus is the rate
limiting step and then the nucleus induces the formation of large
aggregates in CHO cell culture. The bispecific diabody in this study has a
tendency to aggregate during the CHO cell culture process, demonstrating
Page 92 of 151
the necessity of the novel cell culture strategy to suppress the aggregates
formation.
Conclusions: We propose the Thermo Responsive Protein A (TRPA)
column as a novel strategy to reduce the antibody aggregation in an
affinity purification process and to analysis the aggregation during the
cell culture process.
Acknowledgements: This study was supported by the Advanced
research for medical products Mining Programme of the National Institute
of Biomedical Innovation (NIBIO). This work was collaboration with Assoc.
Prof. Ryutaro Asano and Prof. Izumi Kumagai (Tohoku University, Japan).
References
1. Cromwell ME, Hilario E, Jacobson F: Protein aggregation and
bioprocessing. AAPS J 2006, 8:E572-579.
2. Vázquez-Rey M, Lang DA: Aggregates in monoclonal antibody
manufacturing processes. Biotechnol Bioeng 2011, 108:1494-1508.
3. Asano R, Kawaguchi H, Watanabe Y, Nakanishi T, Umetsu M, Hayashi H,
Katayose Y, Unno M, Kudo T, Kumagai I: Diabody-based recombinant
formats of humanized IgG-like bispecific antibody with effective
retargeting of lymphocytes to tumor cells. J Immunother 2008,
31:752-761.
4. Onitsuka M, Kim WD, Ozaki H, Kawaguchi A, Honda K, Kajiura H, Fujiyama K,
Asano R, Kumagai I, Ohtake H, Omasa T: Enhancement of sialylation on
humanized IgG-like bispecific antibody by overexpression of a2,6sialyltransferase derived from Chinese hamster ovary cells. Appl Microbiol
Biotechnol 2012, 94:69-80.
P70
Fucoidan extract enhances the anti-cancer activity of chemotherapeutic
agents in breast cancer cells
Sanetaka Shirahata1,2*, Zhonguan Zhang1, Toshihiro Yoshida1, Hiroshi Eto3,
Kiichiro Teruya1
1
Department of Bioscience and Biotechnology, Faculty of Agriculture, Kyushu
University, Fukuoka 812-8581, Japan; 2Yosida Clinic, Osaka 532-0002, Japan;
3
Daiichi Sangyo Co. Ltd., Osaka 530-0037, Japan
Background: Fucoidan, a fucose-rich polysaccharide isolated from brown
alga, is currently under investigation as a new anti-cancer compound
[1-4]. In the present study, fucoidan extract (FE) from Cladosiphon navaecaledoniae Kylin was prepared by enzymatic digestion. We investigated
whether a combination of FE with chemotherapeutic agents had the
potential to improve the therapeutic efficacy of cancer treatment.
Materials and methods: Estrogen receptor (ER)-positive MCF-7 and
ER-negative MDA-MB-231 breast cancer cells were cultured in DME
Figure 1(abstract P69) (A) Size-exclusion chromatography showing the elution profiles of Ex3-scDb-Fc purified with TRPA (red) and PA (blue).
(B) Time-dependent formation of aggregates in CHO cell culture.
medium supplemented with 10% fetal bovine serum in a humidified
atmosphere of 5% CO 2 at 37 °C. The abalone glycosidase-digested
fucoidan extract (FE) was obtained from Daiichi Sangyo Corporation (Osaka,
Japan). The cells were treated with FE and chemotherapeutic agents like
cisplatin, tamoxifen or paclitaxel. The cell growth was determined by MTT
assay. Apoptosis was evaluated using annexin V binding assay and flow
cytometry analysis. Signaling proteins were analyzed by western blot.
Intracellular reactive oxygen species (ROS) were determined using DCFH-DA
and determined using IN Cell Analyzer 1000. The reduced glutathione (GSH)
concentration was measured by the GSH assay kit.
Results: The co-treatments significantly induced cell growth inhibition,
apoptosis, as well as cell cycle modifications in MDA-MB-231 and MCF-7
cells. FE enhanced apoptosis in cancer cells that responded to treatment
with cisplatin, tamoxifen, or paclitaxel after 48 h of treatment (Figure 1).
FE enhanced the downregulation of the anti-apoptotic proteins Bcl-xL
and Mcl-1 by these chemotherapeutic drugs. The combination treatments
led to an obvious decrease in the phosphorylation of ERK and Akt in
MDA-MB-231 cells, but increased the phosphorylation of ERK in MCF-7
cells. In addition, we observed that combination treatments enhanced
intracellular ROS levels and reduced glutathione (GSH) levels in breast
cancer cells, suggesting that induction of oxidative stress was an
important event in the cell death induced by the combination treatments.
FE protected normal human fibroblast TIG-1 cells from apoptosis by
cisplatin and tamoxifen, suggesting its favorable characteristic for
application to cancer therapy.
Conclusions: • Combination of FE and three chemotherapeutic agents
exhibit highly synergistic inhibitory effects on the growth of breast
cancer cells.
• Combination treatments induced modifications in cell cycle
distribution.
Figure 1(abstract P70) Synergistic induction of apoptosis by cotreatmentAnalysis of apoptotic cells by annexin/PI double-staining
using theIN Cell Analyzer 1000. MDA-MB-231 and MCF-7 cells were
treatedfor different times with 200 μg/mL FE alone or 200 μg/mL FEin
combination with 5 μM CDDP, 10 μM TAM or 2.5 nM TAXOL after 48 h
of treatment. All results were obtained from three independent
experiments. A significant difference from control is indicated by p <
0.05 (#) or p < 0.01 (##); a significant difference from single treatments is
indicated by p < 0.05 (*) or p < 0.01 (**).
Page 93 of 151
• Combination treatments modified the Bcl-2 expression, and ERK
and Akt phosphorylation induced by FE, demonstrating different
effects on apoptotic pathways in MDA-MB-231 cells and MCF-7 cells.
• Generation of intracellular ROS and depletion of GSH are related to
the cell death in combination treated -breast cancer cells.
References
1. Ye J, Li Y, Teruya K, Katakura Y, Ichikawa A, Eto H, Hosoi M, Hosoi M,
Nishimoto S, Shirahata S: Enzyme-digested fucoidan extracts derived from
seaweed Mozuku of Cladosiphon novae-caledoniae kylin inhibit invasion
and angiogenesis of tumor cells. Cytotechnology 2005, 47:117-126.
2. Zhang Z, Teruya K, Eto H, Shirahata S: Fucoidan extract induces apoptosis in
MCF-7 Cells via a mechanism involving the ROS-dependent JNK activation
and mitochondria-mediated pathways. PLoS ONE 2012, 6:e27441.
3. Zhang Z, Teruya K, Eto H, Shirahata S: Induction of apoptosis by lowmolecular weight fucoidan through calcium- and caspase-dependent
mitochondrial pathways in MDA-MB-231 breast cancer cells. Biosci
Biotechnol Biochem 2012, 77:235-242.
4. Zhang Z, Teruya K, Yoshida T, Eto H, Shirahata S: Fucoidan extract
enhances the anti-cancer activity of chemotherapeutic agents in MDAMB-231 and MCF-7 breast cancer cells. Marine Drugs 2013, 11:81-98.
P71
Assessment of troglitazone induced liver toxicity in a dynamically
perfused two-organ Micro-Bioreactor system
Eva-Maria Materne1, Caroline Frädrich1, Reyk Horland1, Silke Hoffmann1,
Sven Brincker1, Alexandra Lorenz1, Mathias Busek2, Frank Sonntag2,
Udo Klotzbach2, Roland Lauster1, Uwe Marx1, Ilka Wagner1*
1
Engineering, Gustav-Meyer-Allee 25, 13355 Berlin, Germany; 2Fraunhofer IWS
Dresden, Winterbergstraße 28, 01277 Dresden, Germany
Background: The ever-growing amount of new substances released to the
market and the limited predictability of current in vitro test systems has led
to an ample need for new substance testing solutions. Many drugs like
troglitazone, that had to be removed from the market due to drug
induced liver injury, show their toxic potential only after chronic long term
exposure. But for long-term multiple dosing experiments, a controlled
microenvironment is pivotal, as even minor alterations in extracellular
conditions may greatly influence the cell physiology. Within our research
program, we focused on the generation of a micro-engineered bioreactor,
which can be dynamically perfused by an on-chip pump and combines at
least two culture spaces for multi-organ applications. This circulatory
systems better mimics the in vivo conditions of primary cell cultures and
assures steadier, more quantifiable extracellular signaling to the cells.
Materials and methods: Liver microtissues (aggregates of HepaRG+human
hepatic stellate cells) and skin biopsies were cultured in separate inserts of
a 96-well Transwell® unit (Corning), which were hung inside the chip with
the membrane fitting directly over the circuit. The tissues were cultivated
either air/liquid interfaced (skin) or submerged in media (liver equivalent) for
a culture period of 28 days. Exposing the tissues to troglitazone, the cultures
were cultured for one day in normal medium and were, subsequently,
exposed to 0 μM, 5 μM and 50 μM troglitazone, respectively for further
6 days. Application of troglitazone was repeated at 12 h intervals
simultaneously with the medium change. In a further experiment co-cultures
of liver and skin equivalents were cultured in a fully vascularized chip.
Therefore, HDMECs isolated from human foreskin were seeded into the
microfluidic channel system using a syringe. After even cell infusion inside
the circuit the device was incubated in 5% CO 2 at 37°C under static
conditions for 3 h to allow the cells to attach to the channel walls.
A frequency of 0.476 Hz was applied for continuous dynamic operation, after
10 days of monoculture, skin and liver tissue were added for co-cultivation
for another 15 days.
Results: Co-cultures of human artificial liver microtissues and skin biopsies
have successfully proven the long-term performance of the novel
microfluidic multi-organ-chip device. The metabolic activity of the co-culture
analysed in media supernatants reached a steady state at day 7 of
co-culture and stayed constant for the rest of the culture period (Figure 1A).
Furthermore, the co-cultures revealed a dose-dependent response to a
6-day exposure to the toxic substance troglitazone. Liver microtissues
Page 94 of 151
Figure 1(abstract P71) Multi-tissue culture in the MOC device. (A) Liver and skin tissue performance over 28-day MOC co-culture. Metabolic activity of the
co-culture analysed in media supernatants. (B) LDH values (C) Real-time qPCR of the cytochrome P450 3A4. Statistical analysis was performed by one-way
analysis of variance (ANOVA), followed by post-hoc Dunnett’s pairwise multiple comparison test. * P < 0.05 versus control. Data are means ± SEM (n = 4).
showed sensitivity at different molecular levels. LDH levels measured in the
media supernatants increased significantly with increasing troglitazone
concentration (Figure 1B). Furthermore, an induction of Cyp450 3A4 levels
on RNA level were observed (Figure 1C). In addition, a robust procedure
applying pulsatile shear stress has been established to cover all fluid contact
surfaces of the system with a functional, tightly closed layer of HDMECs and
co-cultivation of liver, skin and endothelial cells for 15 days was successful.
Conclusion: A unique chip-based tissue culture platform has been
developed enabling the testing of drugs or chemicals on a set of miniaturized
human organs. This “human-on-a-chip” platform is designed to generate high
quality in vitro data predictive of substance safety in humans. Tissue
co-cultures can be exposed to pharmaceutical substances at regimens
relevant to respective guidelines, currently used for subsystemic substance
testing in animals.
P72
Dynamic culture of human liver equivalents inside a micro-bioreactor
for long-term substance testing
Eva-Maria Materne1*, Ilka Wagner1, Caroline Frädrich1, Ute Süßbier1,
Reyk Horland1, Silke Hoffmann1, Sven Brincker1, Alexandra Lorenz1,
Matthias Gruchow2, Frank Sonntag2, Udo Klotzbach2, Roland Lauster1,
Uwe Marx1,3
1
Engineering, Gustav-Meyer-Allee 25, 13355 Berlin, Germany; 2Fraunhofer IWS
Dresden, Winterbergstraße 28, 01277 Dresden, Germany; 3TissUse GmbH,
Markgrafenstraße 18, 15528 Spreenhagen, Germany
Background: Current in vitro and animal tests for drug development are
failing to emulate the organ complexity of the human body and, therefore, to
accurately predict drug toxicity. In this study, we present a self-contained,
bioreactor based human in vitro tissue culture test system aiming to support
predictive substance testing at relevant throughput. We designed a
microcirculation system interconnecting several tissue culture spaces within a
PDMS-embedded microfluidic channel circuit. The bioreactor is reproducibly
perfused by a peristaltic on-chip micro-pump, providing a near physiologic
fluid flow and volume to liquid ratio.
Materials and methods: Liver microtissue aggregates containing 4.8 × 104
HepaRG cells and 0.2 × 104 human hepatic stellate cells (HHSteC) were
formed in Perfecta3D® 384-Well Hanging Drop Plates (3D Biomatrix, USA).
After two days of hanging drop culture, 20 aggregates were loaded into a
single tissue culture compartment of the micro-bioreactor. Each circuit of
the micro-bioreactor device contained 700 μl medium in total. During the
first 7 days, a 40% media exchange rate was applied at 12 h intervals. From
day 8 onwards, a 40% exchange rate was applied at 24 h intervals. Daily
samples were collected for respective analyses. Experiments were stopped
at day 14 and 28 and tissues were subjected to immunohistochemical
stainings and qRT-PCR analyses. Experiments were conducted with four
replicates. To expose the chip-cultures to troglitazone, liver microtissues
were cultured for one day in normal medium and were, subsequently,
Page 95 of 151
Figure 1(abstract P72) 14-day tissue performance of the micro-bioreactor culture compared to static control Cell functionality shown by
immunostaining of (A) phase I enzyme CYP450 3A4 (red) and CYP450 7A1 (green), (B) collagen I (red) and vimentin (green), (C) MRP2, an ABC
transporter located at the apical membrane, (green) and (D) tight junction protein ZO-1 (red). Cell viability shown by TUNEL KI67 staining of
(E) liver equivalents cultivated for 28 days in the micro-bioreactor and (F) liver equivalents cultivated for 28 days under static conditions. Nuclei are
stained with hoechst 33342. Scale bar: 100 μm.
treated with 0 μM, 5 μM and 50 μM substance, respectively. Application of
troglitazone was repeated at 12 h or 24 h intervals simultaneously with the
medium change.
Results: Cultures of human artificial liver microtissues have successfully
been cultivated over 28 days in the novel microfluidic bioreactor. Glucose
consumption and lactate production indicated an aerobic metabolism which
reached a steady state after 7 days. Immunohistochemical staining revealed
the expression of phase I metabolic enzymes CYP450 3A4 and CYP450 7A1,
extracellular matrix component collagen I, apical transporter MRP2 and tight
junction protein ZO-1 (Figure 1A-D). Cell viability over 28 days was increased
in the bioreactor culture compared to static control (Figure 1E, F).
Furthermore, the cultures revealed a dose-dependent response to a 7-day
exposure to the toxic substance troglitazone. Liver microtissues showed
sensitivity at different molecular levels. Concentration of LDH released to the
medium increased with troglitazone concentration and gene expression of
selected marker genes varied. An induction of CYP450 3A4 by troglitazone
treatment was also recorded on protein level by immunhistochemistry.
Conclusion: A promising tool for long term culture of human liver
equivalents has been developed. The simple MOC design presented,
assisted the culture of human liver equivalents over a period of up to
28 days. The cultures, operated at a total on-chip volume of 700 μl medium
at recirculation rates of 40 μl/min assisted by an on-chip micropump,
stabilize approximately within a week at a metabolic steady state. The
prediction of toxicology profiles of compounds metabolised by the liver was
demonstrated possible by exposing the cells to different concentrations of
troglitazone. This platform is designed to generate high-quality in vitro data
predictive of substance safety in humans. Tissue cultures can be exposed to
pharmaceutical substances at regimens relevant to respective guidelines,
currently used for subsystemic substance testing in animals.
P73
Evaluation of the advanced micro-scale bioreactor (ambr™) as a
highthroughput tool for cell culture process development
Frédéric Delouvroy*, Guillaume Le Reverend, Boris Fessler, Gregory Mathy,
Mareike Harmsen, Nadine Kochanowski, Laetitia Malphettes
Cell Culture Process Sciences, Biotech Sciences, UCB Pharma S.A., Chemin du
Foriest, Braine l’Alleud, Belgium
Introduction: Bio-pharmaceutical industries face an increasing demand to
accelerate process development and reduce costs. This challenge requires
high throughput tools to replace the traditional combination of shake
flasks and small-scale stirred tank bioreactors. A conventional and widely
used process development tool is the stirred tank reactor (STR) ranging
from approximately 1L to 10L in working volume. Physical culture
parameters such as pH, temperature and pO2 can be easily controlled in
such systems.
However preparation and operation of these systems are time and resource
consuming. The ambr™ system from TAP Biosystems has the capabilities for
automated sampling, feed addition, and control for pH, dissolved oxygen,
gassing, agitation, and temperature.
Here, through the evaluation of parameters including cell growth,
viability, metabolite concentration and production titer during a fed-batch
process using CHO cells producing a recombinant mAb, we assessed the
reproducibility of the ambr™ system for standard conditions compared to
2L stirred tank bioreactors and the effects of parameter ranging between
both culture systems, namely feed rate and pH ranging.
Material and methods: A CHO cell line expressing a recombinant
monoclonal antibody was used. Cells were carried out for 14 days in a fedbatch mode in a chemically defined medium and fed according to process
description.
Culture systems: ambr™48 is an automated system with 48 disposable
microbioreactor vessels. Results of ambr™ 48 workstation (TAP Biosystems)
were compared to the results obtained with 2L stirred tank bioreactors
with Biostat B-DCUII control systems (Sartorius Stedim).
Commercially available production media and feeds were used as per
manufacturer’s recommendations. pH (7.0 +/- 0.2 for standard conditions).
All fed-batch cultures lasted 14 days.
For the scale down model, parameters were divided in two groups. 1. The
scale dependent factors: culture start volume, feed volumes that are
linearly dependent and agitation speed and gazing that are theoretically
or by experiences determined. 2. The scale independent factors: Media,
temperature, seeding densities, pH, dissolved O2, culture duration.
Product quality of the monoclonal antibody produced was analyzed as
follows: Cell culture fluid samples were centrifuged and filtered to remove
cell debris. The monoclonal antibody was purified by ÄKTA-express (GE
Healthcare) Protein-A purification. The neutralized eluate was used for
product quality analysis.
Sample analysis: Viable Cell Concentration (VCC) and cell viability were
measured using a ViCell XR cell counter (Beckman Coulter). Metabolite
concentrations were measured by enzymatic assay using a UV-method
Page 96 of 151
Table 1(abstract P73) Design of the experiment
pH set point
Feed rate
Number of replicates in ambr™ run
Number of replicates in 2L bioreactor run
7.0
-30%
2
0
7.0
-20%
2
1
7.0
-10%
2
1
7.0
Control feed rate
6
1
7.0
+10%
2
1
7.0
+20%
2
1
7
+30%
2
0
6.9
Control feed rate
2
1
7.1
Control feed rate
2
1
(R-Biopharm) for the ambr™ vessels and by a BioProfile Analyzer 400
(Nova Biomedical) for stirred tank bioreactors. For both systems, pH
measurement was obtained with a BioProfile pHOx pH/Gas Analyzer (Nova
Biomedical), Osmolality was obtained using a Omometer (Advanced
Instruments). Production titers were measured throughout the culture
using an Octet QK (ForteBio) and after 14 days with protein A HPLC
(Agilent) after purification.
Design of experiment: A 3x7-factorial design was implemented using JMP
software (SAS). Parameter ranging included pH (6.9, 7.0, and 7.1) and feed
rate addition (±30%, ±20% and ±10% compared to standard conditions)
see Table 1.
Results and discussion: The ambr™ run was performed in parallel to a 2L
bioreactor run. Both experiments were inoculated with the same pool of
cells, same batches of media and feeds were used in both systems.
Different pH setpoints and feed rates were assessed to determine the
impact on cell growth (see Table 1), viability and mAb titers. Each
condition was tested in duplicates in the ambr ™ minibioreactors and
singlet in 2L bioreactors. The design of experiment is described in Table 1.
The aim of this experiment was to test the reproducibility within ambr™
and the comparability between the minibioreactors and the 2L.
Cell growth and cell viability were monitored daily throughout the cultures
in 2L (control runs, n = 4). In the ambr™ system, cell density and viability
were measured every two days to avoid excessive sampling on control runs
(n = 6). Cell viabilities were maintained at acceptable values (>80%)
throughout the cultures in the established culture conditions.(Figure 1). Cell
growth and viability performances observed in the ambr™ minibioreactors
and 2L bioreactors were comparable (Figure 1). Final mAb titer obtained
using ambr™ showed slightly (15%) lower concentration than the 2L
bioreactors. Osmolality profiles showed the same trend in 15 mL and 2L
bioreactors (between and 300 mOsm/kg at the beginning and 420 mOsm/kg
at the end of the run). Online pH profiles were also comparable in both
ambr™ minibioreactors and in 2L bioreactors.
The impact of different feed rates were assessed and compared between
2L bioreactors stirred tank bioreactors and ambr™ minibioreactors.
Obtained results show similar profiles of viable cell density, cell viability,
pre-harvest Mab titer at day 14 and osmolality profiles with different feed
rates.
High feed rates and low feed rates impact cell growth profiles and
osmolality profiles. The different feed rates applied do not show any
significant impact on the final mAb titer. Profiles observed in 2L
bioreactors and ambr™ are comparable in both systems, except viability
at the end of the ambr™ run due to a lack of glucose.
The impact of different pH setpoints on cell growth, viability, final mAb
titer and osmolality didn’t showed significant impact on those parameters
in both systems. mAb titer at day 14 was comparable in 2L stirred
bioreactors than in the ambr™ system.
Conclusions: Our evaluation of the ambr™ system showed there is good
reproducibility within the 6 ambr™ controls. There is good comparability
Figure 1(abstract P73) Viable cell concentration (VCC) and viability average comparison between ambr ™ and 2L bioreactors (control runs)
Page 97 of 151
in terms of cell growth, product titer, pH, pO2 and osmolality profiles as
well as PQA obtained between ambr™ and bioreactors despite the fact
ambr™ used a bolus feeding regimen and the stirred tank bioreactors
used a continuous feeding strategy. The impact of feed rate on cell
growth and osmolality upon feed rate ranging was observed in both
culturing systems, but has no impact on PQA. pH set point ranging did
not have an impact on the measured output parameters in either scale.
ambr™ provides a predictive and resource-efficient tool to do process
development especially media testing, feeding strategy screening and cell
culture production conditions.
Experiment (DoE)[2]. Compared to the original basal medium an
improvement in cell growth, viability and antibody titer was achieved. These
optimized inoculum conditions were used for subsequent bioreactor
fermentations. Furthermore, these conditions were used in order to test
feeding strategies. For this purpose a fed-batch process with a double bolus
feed was simulated in shake flasks with two different glucose feeding
strategies - with and without Hyclone Cell Boost 6 (CB6). Finally, the result
from shake flasks could be verified and improved antibody yield was
achieved in a controlled 2L fed-batch process.
Material and methods: DoE approach: DoE (Modde, Umetrics) was
used to optimize the cultivation medium by varying the three factors,
FBS (1-10%), IGF (10 - 100 μg/L) and Pluronic (0.2 - 1 g/L). The central
composite face-centered design was applied to test 24 different medium
compositions. Cells were cultivated with a seeding density of 2 × 105
cells/mL for five days in these media in 40 mL working volume in 125 mL
shaker flask. Cell concentration and viability was quantified every day
using an image-based cell counter (Cedex XS, Roche) and were defined
as response factors for DoE analysis (table 1). Cultures grown with
optimized conditions were used as inoculum for subsequent bioreactor
fermentations.
Feeding strategy: Cells were seeded with 3 × 10 5 cells/mL in 35 mL
working volume in 125 mL shake flasks in optimized medium (DMEM, 4.5 g/L
glucose, 2 mM stable glutamine, 6% FBS, 100 μg/L IGF and 0.2 g/L Pluronic).
The 1st triplicate was cultivated without feeding as batch control. The 2nd
triplicate was fed with 20 mM glutamine and 20 g/L glucose. The 3 rd
triplicate was fed with 14 g/L glucose in CB6 (Hyclone, Thermo Scientific)
instead of usual glucose feeding in medium. Substrates and metabolites, cell
concentration and antibody titer were measured with a chemical analyzer
(Konelab, Thermo Scientific), an image-based cell counter (Cedex XS, Roche)
and Protein A HPLC (Agilent), respectively.
Fed-batch with and without Cell Boost 6: Both feeding strategies with
and without CB6 were performed again in a 2L bioreactor. The incolumn
density was 3 × 105 cells/mL. The main parameters were kept constant at
1 mM glutamine and at 2 g/L glucose.
P74
Optimized fermentation conditions for improved antibody yield in
hybridoma cells
Martina Stützle1,2*, Alina Moll1, René Handrick1, Katharina Schindowski1
1
Institute of Applied Biotechnology, University of Applied Sciences Biberach,
Biberach, 88400, Germany; 2Medical Faculty, Ulm University, Ulm, 89081,
Germany
Background: Traditionally antibody producing cells like hybridoma cells
sank into oblivion since other suspension cell lines have captured the
biopharmaceutical production market. However, they are still of particular
interest in academic and industrial diagnostic research. Hence, fast and
sufficient antibody production is needed as proof of concept, for toxicology
and in vivo studies. Although, hybridoma cultivation in fetal bovine serum
(FBS) containing animal derived ingredients, like contaminating IgG, is
undesirable and leads to difficulties in purification. When reducing the
serum to a minimum other key components of the FBS have to be replaced.
Therefore, human insulin-like growth factor (IGF) [1] and the surfactant
Pluronic F68 were supplemented to improve overall cell performance and to
reduce shear stress during shaking respectively employing Design of
Table 1(abstract P74) Central composite face-centered result
Exp No
FBS [%]
Pluronic [g/L]
IGF [ug/L)
Viability [%]
Viable cell concentration [cells/mL]
1
-1 (1)
-1 (0.2)
-1 (10)
75.8
736000
2
1 (10)
-1 (0.2)
-1 (10)
79.1
1.468e+006
3
4
-1 (1)
1 (10)
1 (1)
1 (1)
-1 (10)
-1 (10)
66.6
82
575000
1.401e+006
5
-1 (1)
-1 (0.2)
1 (100)
71.6
696000
6
1 (10)
-1 (0.2)
1 (100)
77.9
1.545e+006
7
-1 (1)
1 (1)
1 (100)
59.3
554000
8
1 (10)
1 (1)
1 (100)
78.7
1.319e+006
9
-1 (1)
0 (0.6)
0 (55)
69.1
632000
10
1 (10)
0 (0.6)
0 (55)
79.8
1.455e+006
11
12
0 (5.5)
0 (5.5)
-1 (0.2)
1 (1)
0 (55)
0 (55)
82.5
78.9
1.461e+006
1.442e+006
13
0 (5.5)
0 (0.6)
-1 (10)
79.1
1.326e+006
14
0 (5.5)
0 (0.6)
1 (100)
81.6
1.336e+006
15
0 (5.5)
0 (0.6)
0 (55)
81.8
1.27e+006
16
0 (5.5)
0 (0.6)
0 (55)
80.2
1.194e+006
17
0 (5.5)
0 (0.6)
0 (55)
81.3
1.188e+006
18
19
0
5.5
0.6
0
55
55
28.5
78.4
13300
1.255e+006
20
5.5
0.6
0
81.25
1.2685e+006
21
5.5
0.2
100
83.7
1.533e+006
22
10
0
0
83.6
1.28e+006
23
6
0
0
81.9
1.305e+006
24
1
0
0
57.2
464000
Results and discussion: DoE approach: A simple DoE approach with the
three factors FBS, IGF and Pluronic led to improved hybridoma cultivation
conditions. In Table 1 viability and viable cell concentration are depicted
from exponential phase for all 24 media on day 3. Additional controls were
run to improve the model like zero values for each factor and various FBS
concentrations. FBS could be reduced from 10% to 6% by adding 100 μg/L
human insulin-like growth factor and 0.2 g/L Pluronic. Compared to the
original base medium an improvement in cell growth and viability was
achieved.
Three concentration levels for each variable including a maximum (1) a
minimum (-1) and a center point (0) were used. Values shown in parenthesis
are concentrations. Exp no 15-17 shows the central points for the medium,
which were repeated three times. Exp no 18-20 shows the zero controls for
each factor. Exp no 21-24 are additional controls for FBS at different
concentrations. The concentrations in the yellow and red box are not in
brackets. Viability and viable cell concentration were determined as
response factors and used for fitting and evaluating the model.
Based on the DoE results, the optimized medium was compared to the
original culture conditions with FBS (10%, 6% and 1%) subsequently in
125 mL shake flasks in triplicates. Reduction of FBS without supplementation
results in decreased viability and cell concentration. The optimized medium,
compared to 10% FBS supplementation, showed a significant impact in
viable cell concentration and antibody titer by 1.2 fold.
Feeding strategy: After optimizing the inoculum conditions, a fed-batch
process was simulated in 125 mL shake flask due to a daily bolus feed with
glutamine and glucose. The batch control ended in the death phase at day 3,
whereas the fed-batch feed led to 6 day cultivation time. The feeding
strategy with CB6 revealed a slightly improved cell growth. This result could
be tremendously improved in a controlled 2L bioreactor leading to
elongated process time (6 to 12 days), an increased viable cell concentration
(from 1.6 × 106 cells/mL to 6.4 × 106 cells/mL) and higher antibody titer
(450 mg/L compared to initial 110 mg/L) (Figure 1).
Fed-batch was started with optimized medium (DMEM supplemented with
6% FBS, 100 μg/L IGF and 0.2 g/L Pluronic). Glutamine was hold constant at
1 mM and glucose at 2 g/L. Substrates and metabolites, cell concentration
and antibody titer were measured with a chemical analyzer (Konelab,
Thermo Scientific), an image-based cell counter (Cedex XS, Roche) and
Protein A HPLC (Agilent) respectively each day.
Conclusion: This data presents DoE as a powerful and efficient time
saving tool in process optimization as well as a novel feeding strategy for
fed-batch hybridoma process for increased IgG production. By employing
DoE, FBS could be decreased from 10% to 6% by 100 μg/L human IGF and
0.2 g/L Pluronic F68. For entirely serum-free hybridoma culture further
critical ingredients like transferrin and albumin have to be replaced.
However, serum-free media leads to higher production costs and can
Page 98 of 151
result in antibody yield reduction. Optimized medium was successfully
used for subsequent bioreactor processes starting with a better cell
performance. Fed-batch feeding with Hyclone Cell Boost 6 was beneficial
for cell growth and antibody production compared to the conventional
feed with glucose in medium. Both the optimized medium as well as the
Cell Boost 6 feeding strategy led to a prolonged process time and
increased antibody titer in the fermentation process.
References
1. Morris A, Schmid J: Effects of Insulin and LongR3 on Serum-Free Chinese
Hamster Ovary Cell Cultures Expressing Two Recombinant Proteins.
Biotechnology progress 2000.
2. Eriksson L, Johansson E, Kettaneh-Wold N, Wikström C, Wold S: Design of
Experiments: Principles and Applications Umea: UMETRICS ACADAEMY, 3
2008, 425.
P75
High performance CHO cell line development platform for
enhanced production of recombinant proteins including
difficult-to-express proteins
Pierre-Alain Girod1*, Valérie Le Fourn1, David Calabrese1, Alexandre Regamey1,
Deborah Ley2, Nicolas Mermod2
1
Selexis SA, Plan-Les-Ouates, Switzerland; 2University of Lausanne,
Switzerland
Background: In an effort to improve product yield of mammalian cell
lines, we have previously demonstrated that our proprietary DNA
elements, Selexis Genetic Elements (SGEs), increase the transcription of a
given transgene, thus boosting the overall expression of a therapeutic
protein drug in mammalian cells [1]. However, there are additional cellular
bottlenecks, notably in the molecular machineries of the secretory
pathways. Most importantly, mammalian cells have some limitations in
their intrinsic capacity to manage high level of protein synthesis as well as
folding recombinant proteins. These bottlenecks often lead to increased
cellular stress and, therefore, low production rates.
Material and Methods: Our specific approach involves CHO cell line
engineering. We constructed CHO-M libraries based upon the CHO-M
genome and transcriptome and using unique proprietary transposon
vectors harboring SGE DNA elements to compensate for rate-limiting
factors [2]. Each CHO-Mplus library displays a diversity of auxiliary
proteins involved in secretory pathway machineries and cellular
metabolism. Collectively, the libraries address a broad range of expression
issues.
Figure 1(abstract P74) Fed-batch process with double feed - glutamine in medium and glucose (F1: with CB6; F2: without CB6).
Page 99 of 151
Figure 1(abstract P75) The iterative application of the CHO-Mplus libraries enabled >10 fold increase in productivity of ScFv:Fc without
changes in gene copy number or transcription level of gene of interest.
Results: Figure 1 shows that our CHO-Mplus libraries enabled the
selection of a clonal cell line expressing 12 fold more product by
comparison to the unmodified host cell [3].
Conclusions: Our results demonstrate that components of the secretory
and processing pathways can be limiting, and that engineering of the
metabolic pathway (’omic’ profiling) improves the secretion efficiency of
therapeutic proteins from CHO cells.
References
1. Girod PA, Nguyen DQ, Calabrese D, Puttini S, Grandjean M, Martinet D,
Regamey A, Saugy D, Beckmann JS, Bucher P, Mermod N: Genome-wide
prediction of matrix attachment regions that increase gene expression
in mammalian cells. Nature Methods 2007, 4:747-753, Epub 2007 Aug 5.
2. Ley D, Harraghy N, Le Fourn V, Bire S, Girod PA, Regamey A, RouleuxBonnin F, Bigot Y, Mermod N: MAR Elements and Transposons for
Improved Transgene Integration and Expression. PLoS One 2013, 8:
e62784.
3. Le Fourn V, Girod PA, Buceta M, Regamey A, Mermod N: CHO cell
engineering to prevent polypeptide aggregation and improve
therapeutic protein secretion. Metab Eng 2013 [http://www.ncbi.nlm.nih.
gov/pubmed/23380542], Feb 1. pii: S1096-7176(13)00002-5. doi: 10.1016/j.
ymben.2012.12.003. [Epub ahead of print].
P76
Enhancement mechanism of antioxidant enzyme gene expression by
hydrogen molecules
Tomoya Kinjo1, Takeki Hamasaki2, Hanxu Yan1, Hidekazu Nakanishi1,
Tomohiro Yamakawa1, Kiichiro Teruya1,2, Shigeru Kabayama3,
Sanetaka Shirahata1,2*
1
Graduate School of Systems Life Sciences, Kyushu University, Fukuoka 8128581, Japan; 2Department of Bioscience and Biotechnology, Faculty of
Agriculture, Kyushu University, Fukuoka 812-8581, Japan; 3Nihon Trim Co.
Ltd., Osaka 531-0076, Japan
Background: Redox regulation system protects our body from oxidative
stress-injury and keeps redox homeostasis. The hydrogen molecules (H2)
exist as stable gas in the ordinal temperature and atmosphere. Recent study
reports H 2 improve ischemia-reperfusion injury, glaucoma, Parkinson’s
disease and atherosclerosis of animal models. It is supposed from these
improvement results that H2 participate in reduction of the oxidation stress,
however, the reaction mechanism has not been clarified thoroughly. We
surmised that intracellular redox regulation system is activated by H 2
thereupon antioxidative activity is generated. Thus, we tried to find the
effect of H2 on the Nrf2 pathway, one of the redox regulation systems.
Materials and methods: HT1080 cells, a human fibrosarcoma cell line,
were incubated in a gas incubator at an atmosphere of 75%N2/20%O2/5%
CO2 or 75%H2/20%O2/5%CO2 for 24 h. Then, after the cells were treated
with H2O2 or fixative solution for 30 min or 15 min, the intracellular H2O2
and Nrf2 were determined by In cell analyzer and Confocal laser microscop
using a BES-H2O2 or anti-Nrf2 antibody, respectively. Furthermore, after
extraction of mRNA from the treated HT1080 cells, the gene expressions
were examined by using Real-time PCR.
Results: The quantity of intracellular H 2 O 2 increased by hydrogen
peroxide treatment was significantly decreased by pretreatment of H2. H2
enhanced the expression of catalase, glultathione peroxidase, Cu/Znsuperoxide dismutase, Nrf2 genes and Nrf2 protein.
Conclusions: It was suggested that H2 induced the expression level of
antioxidant enzyme genes like catalase and glutathione peroxidase by
increasing the expression level of the Nrf2 protein and decreased the
amount of intracellular H2O2 induced by the H2O2 treatment in HT1080 cells.
P77
Evaluation of the impact of matrix stiffness on encapsulated HepaRG
spheroids
Sofia P Rebelo1,2, Marta Estrada1,2, Rita Costa1,2, Christophe Chesné3,
Catarina Brito1,2, Paula M Alves1,2*
1
iBET, Instituto de Biologia Experimental e Tecnológica, 2780-901 Oeiras,
Portugal; 2Instituto de Tecnologia Química e Biológica, Universidade Nova de
Lisboa, 2780-157 Oeiras, Portugal; 3Biopredic International, Rennes, France (C.C.,
R.L., S.C.)
Background: The drug development process is widely hampered by the
lack of human models that recapitulate liver functionality and efficiently
predict toxicity of new chemical compounds. Moreover, liver failure is a
global medical problem, with transplantation being the only effective
treatment currently available. The bipotent liver progenitor cell line HepaRG
can be differentiated into cholangiocyte and hepatocyte-like cells that
express major functions of mature hepatocytes, representing a valuable tool
to model hepatic function [1]. Current two-dimensional (2D) protocols for
the differentiation into mature hepatocyte-like cells fail to recapitulate the
complex cell-cell interactions, which are crucial for maintaining polarity and
inherent mature hepatic functionality. Herein, we present a threedimensional (3D) strategy for the culture of HepaRG cells based on the
encapsulation of aggregates. The effect of matrix stiffness on expansion and
differentiation was evaluated through encapsulation with different
concentrations of alginate (1.1% and 2%). Further characterization of the
hepatic features will reveal the extent of the hepatic functionality of the
generated spheroids.
Materials and methods: HepaRG cells were routinely propagated in static
conditions as previously described [2]. Briefly, culture medium Williams E
was supplemented with 1% (v/v) Glutamax, 1% (v/v) pen/strep, 5 μ g/ml
insulin and 50 μ M hydrocortisone hemissuccinate and 10% (v/v) FBS and
cultures were maintained at 37 ° C, 5% CO2. Spinner vessels with ball impeller
(Wheaton) were inoculated with inoculums ranging from 5 to 8 × 105 cell/mL
and an agitation ranging from 35 to 45 rpm to attain the desired aggregation
conditions. Aggregate size was determined by measuring Ferret’s diameter
using the Image J software (NIH). After 3 days of aggregation, spheroids were
encapsulated in 1.1% and 2% (w/v) of Ultra Pure MVG alginate (UP MVG
NovaMatrix, Pronova Biomedical) in NaCl 0.9% (w/v) solution. Encapsulation
was performed in an electrostatically driven microencapsulation unit VarV1
(Nisco) and cultures were maintained for 14 days in stirred culture conditions.
Viability was determined by the double stain viability test - alginate beads
were collected from stirred cultures, incubated with fluorescein diacetate
(10 μg/mL) and TO-PRO3 ® (1 μM) and observed on a fluorescence
microscope (Leica DMI6000) - and by the Trypan blue exclusion method alginate beads were dissociated with a solution of Sodium citrate 50 mM,
Sodium chloride 104 mM and spheroids were dissociated by incubation with
Trypsin 0.05%-EDTA (Gibco) and counted trypan blue exclusion dye. For
characterization of the cultures, encapsulated spheroids were fixed as
previously described [3] and incubated with phalloidin and prolong gold with
DAPI and images were acquired in a confocal microscope (Andor spinning
disk).
Results: In 2D cultures, HepaRG cells proliferate until confluence is reached
and the cell-cell interactions established associated with the spatial
constriction are postulated to trigger the differentiation program and
maintain the differentiated state [1,4]. Moreover, the mechanochemical
environment has been previously shown to strongly influence the liverspecific functions [5]. Thus, it was hypothesized that the microenvironment
created by encapsulation of spheroids with an inert biomaterial with
different stiffness levels, would promote differential behavior of the
spheroids, towards differentiation or proliferation. Alginate concentrations
of 1.1 and 2% (w/v) were used, given the 10 fold difference in stiffness,
measured by the elastic modulus [6]. Both viability and the growth profile
were monitored throughout culture time.
In both culture conditions, the viability was maintained above 85%,
showing that the alginate concentration does not affect diffusion of
nutrients or oxygen to supply effectively the cell spheroids (Figure 1 A).
Moreover, it was observed that the growth profile was comparable for the
two cultures, with growth arrest after aggregation and no proliferation
occurring either in both alginate concentrations (Figure 1 B). This suggests
that the differentiation program is triggered either in softer and stiffer
microenvironments, being 1.1% alginate concentration sufficient to initiate
the process.
The structural organization of the cell spheroids in both stiffness environments was characterized by the arrangement of actin filaments, which is
associated to the tight junctions in highly polarized epithelial cells. As
shown in Figure 1 C, the cells are disposed in a highly polarized manner,
without necrotic centres.
Conclusions: In the current work, the encapsulation of liver spheroids
with different stiffness conditions was evaluated as a strategy to culture
HepaRG cells. It was observed that the encapsulation with different
alginate concentrations is compatible with maintenance of highly viable
Page 100 of 151
cultures of liver spheroids, with growth arrest and cell polarization
promoted by spatial constriction and the enhanced cell-cell interactions
in 3D.
Acknowledgements: This work was supported by PTDC/EBB-BIO/112786/
2009 and SFRH/BD/70264/2010 FCT, Portugal.
References
1. Guillouzo A, Corlu A, Aninat C, Glaise D, Morel F, Guguen-Guillouzo C: The
human hepatoma HepaRG cells: a highly differentiated model for
studies of liver metabolism and toxicity of xenobiotics. Chem Biol Interact
2007, 168:66-73.
2. Gripon P, Rumin S, Urban S, Le Seyec J, Glaise D, Cannie I, Guyomard C,
Lucas J, Trepo C, Guguen-Guillouzo C: Infection of a human hepatoma
cell line by hepatitis B virus. Proc Natl Acad Sci USA 2002, 99:15655-15660.
3. Tostoes RM, Leite SB, Serra M, Jensen J, Bjorquist P, Carrondo MJ, Brito C,
Alves PM: Human liver cell spheroids in extended perfusion bioreactor
culture for repeated-dose drug testing. Hepatology 2012, 55:1227-1236.
4. Cerec V, Glaise D, Garnier D, Morosan S, Turlin B, Drenou B, Gripon P,
Kremsdorf D, Guguen-Guillouzo C, Corlu A: Transdifferentiation of
hepatocyte-like cells from the human hepatoma HepaRG cell line
through bipotent progenitor. Hepatology 2007, 45:957-967.
5. Semler EJ, Ranucci CS, Moghe PV: Mechanochemical manipulation of
hepatocyte aggregation can selectively induce or repress liver-specific
function. Biotechnol Bioeng 2000, 69:359-369.
6. Martinsen A, Skjak-Braek G, Smidsrod O: Alginate as immobilization
material: I. Correlation between chemical and physical properties of
alginate gel beads. Biotechnol Bioeng 1989, 33:79-89.
P78
Feeding strategy optimization in interaction with target seeding
density of a fed-batch process for monoclonal antibody production
Marie-Françoise Clincke1*, Grégory Mathy1, Laura Gimenez1,
Guillaume Le Révérend1, Boris Fessler1, Jimmy Stofferis1, Bassem Ben Yahia1,
Nicola Bonsu-Dartnall2, Laetitia Malphettes1
1
Cell Culture Process Sciences Group, BioTech Sciences, UCB Pharma S.A.,
Braine L’Alleud, Belgium; 2In-Process Analytics Group, BioTech Sciences, UCB
Celltech, Slough, UK
Background: Current trend towards Quality by Design (QbD) leads the
process development exercise towards systematic experimentation,
rational development, process understanding, characterization and control.
In this study, an example of the application of QbD approach is given.
Optimization of the feeding strategy and the target seeding density was
performed and interactions of the two parameters were assessed in order
to enhance cell growth and MAb productivity. The feeding strategy was
optimized to take into account daily process performance attributes and
Figure 1(abstract P77) Characterization of encapsulated cultures of HepaRG spheroids (A) Viability assessed by staining the encapsulated spheroids
with fluorescein diacetate (live, green) and TO-PRO3 ® (dead, red). Spheroids in 1.1 and 2% (w/v) of alginate after 14 days of culture are represented.
Scale bar: 100 μm (B) Growth profile of encapsulated cultures of 1.1 and 2% (w/v) of alginate. (C) Immunofluorescence characterization of hepatic
spheroids (1.1% alginate) after 14 days of culture. Actin filaments - green; Nuclei - blue. Scale bar: 10 μm.
associated nutrient needs of the culture to maintain a balance between
metabolism and MAb productivity. For scale up the feed strategy was
simplified to become independent of daily process performance attributes.
Feed ranging studies were performed to assess the robustness of the
process.
Materials and methods: 2L stirred tank bioreactors were run for 14 days
in a fed-batch mode in a chemically defined medium. Feed was added
daily from day 3 onwards. If required, antifoam C was added to the
bioreactor by manual injections. DO, pH, and temperature were controlled
at setpoint. DO was controlled using a multi-stage aeration cascade via a
ring sparger. Viable cell concentration, cell viability, and average cell
diameter were measured using a ViCell cell counter. The glucose, lactate,
glutamine and ammonia concentrations were measured with a BioProfile
Analyzer 400. On the day of harvest, the clarification was performed by
centrifugation plus depth filtration. Monoclonal Antibody (MAb)
concentration of the supernatant samples was quantified using Octet QK
and Protein A high performance liquid chromatography.
Results: Interaction study between feeding strategy and Target
Seeding Density (TSD): Previous experiments performed with different
daily fixed volume feed additions showed a correlation between feeding
strategy and specific MAb productivity. It was observed that a significant
decrease in the specific MAb productivity occurred if the feed ratio per the
projection of a subset of process performance attributes was below a
specific threshold (data not shown). A feed addition strategy based on the
projected subset of process performance attributes was then developed.
Based on previous screening study, feed ratio from 0.004 to 0.006 arbitrary
units and and TSD from 0.30 to 0.40 arbitrary units were assessed. Custom
DoE was performed with JMP SAS to study the interactions between both
parameters. Number of interactions between the factors and the power of
each factor were both fixed at 2. In total, 12 bioreactors were run. This
Design of Experiment (DoE) was applied to the process development of a
cell line 1 producing a monoclonal antibody and led to a 36% increase in
the monoclonal antibody titer compared to control condition (Figure 1).
The final feed ratio was based on (i) the improvement of MAb titer
compared to the control condition, (ii) the scalability of the process
(Culture start volume high enough to cover the impellers and low enough
in order for Culture final volume to not exceed the maximum volume of
the production bioreactor at large scale). TSD was fixed at 0.35 arbitrary
units, so that a minimum dilution factor of 1:5 between the N-1 passage
and the production bioreactor is achievable.
Page 101 of 151
Feeding strategy simplification, mode of feed addition, feeding
ranging study: The design of the feeding strategy was simplified in order
to facilitate the process transfer to large scale manufacture. Hence, based
on the final feed ratio, the feed rates were fixed with a feed volume
independent of the projected subset of process performance attributes.
The pH of the feed is highly basic. In our 2L experiments, feed was added
within less than 5 min, which generates pH excursions above 7.40.
A strategy of slow bolus addition with a fixed minimum addition
timeframe and with a fixed maximum flow rate was implemented, leading
to minor pH-excursions during feeding with only minor CO 2 flows
necessary to keep the pH within the pH deadband (data not shown). The
robustness of the process was assessed by performing an experiment with
over- and underfeeding cultures. Underfeeding at 20% below target had
no impact on process performance (MAb titer) while feeding 20% above
target led to a lower MAb titer (Table 1). No impact of underfeeding or
overfeeding at ± 20% of the feed target was observed on the Acidic Peak
Group (APG) and aggregate levels. Feeding 20% above target led to an
increase in Mannose 5 species.
Conclusions: DoE enabled us to study the impact of the feed addition
strategy and the impact of the TSD on the Mab titer and PQAs at harvest
in a time efficient manner. The feeding strategy was simplified to become
independent of the projected subset of process performance attributes
and to be scalable to large scale manufacture. The mode of feed addition
was optimized to minimize pH-excursions during feeding. Feed ranging
studies showed that underfeeding at 20% below target had no impact on
MAb titer and PQAs while feeding 20% above target led to a lower MAb
titer and an increase in Mannose 5 species (glycan). Finally, a 36% increase
in the MAb titer was achieved in the feed optimized conditions compared
to control condition at harvest with a feed strategy designed to be robust
and scalable.
P79
Process development and optimization of fed-batch production
processes for therapeutic proteins by CHO cells
Marie-Françoise Clincke*, Mareike Harmsen, Laetitia Malphettes
Cell Culture Process Sciences Group, BioTech Sciences, UCB Pharma S.A.,
Braine L’Alleud, Belgium
Figure 1(abstract P78) Impact of feed ratio and TSD on MAb titer at harvest day as well as one-way Anova study comparing the MAb titer at
harvest (optimized process vs. baseline process in all runs)
Table 1(abstract P78) MAb titers and Product Quality Attributes observed during the feed ranging study
MAb titer (Normalized)
APG (Normalized)
Aggregate (Normalized)
Mannose 5 (Normalized)
Center point (n = 2)
1.00
1.00
1.00
1.00
+20% Feed (n = 2)
0.54
0.97
0.95
1.78
-20°% Feed (n = 2)
1.10
1.01
1.04
0.94
Page 102 of 151
Figure 1(abstract P79) Viable cell concentration and off-line pH, pCO2, osmolality, lactate and ammonia profiles during fed-batch culture (solid
black line: cell line 2, process 1 strategy, short dash line: cell line 1, process 1, long dash line: cell line 2, process 2)
Table 1(abstract P79) Comparison of MAb titers
(normalized) obtained for both cell lines at 2L scale and
80L scale
Cell line 1, Process 1
Cell line 2, Process 2
2L scale
1.00
1.00
80L scale
0.99
1.09
Background: In the biopharmaceutical industry, process development and
optimization is key to produce high quality recombinant proteins at high
yields. As technologies mature, pressure on cost and timelines becomes
greater for delivering scalable and robust processes. Overall, process
development should be viewed as a continuum from the early stages up to
process validation. Here we outline a lean approach on upstream development
during the initial phases to optimize yields while maintaining the desired
product quality profiles. Early-stage process development was designed to
lead to the establishment of a baseline process and to systematically include
experiments with input parameters that have a high impact on performance
and quality. At this stage, potential for pre-harvest titer and yield increases as
well as product quality challenges were identified. Feed adjustments and
systematic experiments with top, high, and medium impact parameters have
then been performed to develop a robust and scalable process. This approach
was applied to two early stage upstream processes.
Materials and methods: 2L and 80L stirred tank bioreactors were run for
14 days in a fed-batch mode in a chemically defined medium. Feed was
added daily from day 3 onwards. If required, antifoam C was added to
the bioreactor by manual injections. DO, pH, and temperature were
controlled at setpoint. DO was controlled using a multi-stage aeration
cascade via a ring sparger. Viable cell concentration, cell viability, and
average cell diameter were measured using a ViCell cell counter. The
glucose, lactate, glutamine and ammonia concentrations were measured
with a BioProfile Analyzer 400. On the day of harvest, the clarification was
performed by centrifugation plus depth filtration. Monoclonal Antibody
(MAb) concentration of the supernatant samples was quantified using
Protein A high performance liquid chromatography.
Results: A lean and Quality by Design (QbD) approach on process
development during the initial phases to optimize yields while maintaining
the desired product quality profiles was adopted. In this approach, a
workpackage including the expected high impact parameters (feeding
strategy, seeding density, pH, temperature and the interaction studies) was
defined. This workpackage was applied to the process development of a
cell line 1 producing a monoclonal antibody and led to a 36% increase in
the monoclonal antibody titer compared to control condition (data not
shown). Then, the operational process parameters and feeding strategy
developed for cell line 1 (process 1) were applied to a cell line 2 producing
a monoclonal antibody fragment. The application of the process 1 strategy
to a cell line 2 was not the best for cell line 2 and led to high pCO2 level,
high ammonia concentration, high osmolalities and low monoclonal
antibody fragment titers (Figure 1). A feeding strategy was optimized for
cell line 2 and pH set-point and deadband were also adjusted in order to
decrease the pCO2 level. This optimized process for cell line 2 led to higher
performances (pCO2, ammonia concentration, and osmolalities values were
maintained at a low level) with a 43% increase in the monoclonal antibody
fragment titer (data not shown). Then both processes were scaled up to
80L stirred tank bioreactors and comparable monoclonal antibody titers
were obtained at 2L scale and 80L scale (Table 1). For the cell line 1,
Product Quality Attributes such as Acidic Peak Group, aggregate and
Mannose 5 were assessed and were maintained within the expected
ranges with scale-up (data not shown).
Conclusions: A similar process development approach was applied to
both projects where identical high impact parameters were identified.
Although process optimized for cell line 1 was not the best for cell line 2,
we were able to use it as a starting point and were able to optimize within
the tight timelines. For both projects, high titers were achieved following
our lean approach on process development. The final process 1 optimized
for a cell line 1 led to a 36% increase in monoclonal antibody titer. The
final process 2 optimized for a cell line 2 led to a 43% increase in
monoclonal antibody fragment titer. Comparable titers and product quality
attributes were observed at 2L scale and 80L scale. Hence the adopted
feeding strategy proved to be robust and scalable.
P80
Characterization of mAb aggregates in a mammalian cell culture
production process
Albert Paul*, Friedemann Hesse
Institute of Applied Biotechnology, University of Applied Sciences Biberach,
Biberach, 88400, Germany
Introduction: Protein aggregation is a major concern during monoclonal
antibody (mAb) production [1,2]. The presence of aggregates can reduce the
therapeutic efficacy of mAbs and trigger immunogenic responses upon
administration [3]. Higher molecular weight (HMW) aggregates can be
removed during downstream processing (DSP), but prevention of aggregate
formation upstream could increase process yield [4,5]. Unfortunately,
detection of aggregates upstream is challenging, since the size of aggregates
Page 103 of 151
ranges from small oligomers to visible particles and there is no single
technique capable of measuring the broad range of aggregation phenomena
[6,7]. For upstream detection of aggregates, all HMW species potentially
present in the culture broth must be known. Therefore, we established
methods to generate different types of aggregates and characterized the
different HMW species using size exclusion high pressure liquid
chromatography (SE-HPLC), dynamic light scattering (DLS) and UV
spectroscopy. Furthermore, stability and traceability of the aggregates in cell
culture medium and Chinese hamster ovary (CHO) DG44 supernatant were
demonstrated. Finally, the established methods were used to monitor
aggregate formation in a mAb producing CHO DG44 cell culture.
Material and methods: Two mAbs produced in CHO DG44 cells and
stored in 20 mM acetate at pH 3.5 were used for aggregation studies.
Aggregation was induced using heat stress, pH-shift, high salt concentration
and freeze-thawing. Heat stress was induced at 65 °C for different time
periods. For the pH-shift, the antibody was diluted in citrate-phosphate
buffer containing pH 3-8. NaCl concentrations for salt-induced aggregation
varied from 50-1500 mM. A freeze-thawing cycle included incubation at
-80 °C for 15 min followed by thawing at 25 °C for 15 min. The freeze-thaw
cycle was repeated three times. The presence of small aggregates was
evaluated using SE-HPLC equipped with a Yarra SEC4000 (Phenomenex)
column. To identify the different HMW species the molecular weight was
determined using SEC-MALS (multi-angle light scattering). Moreover, large
aggregates were characterized using DLS (Zetasizer 3000HS, Malvern
instruments) and UV spectroscopy (SpectraMax M5 e microplate reader,
Molecular Devices). The size of large aggregates was displayed by
the average diameter. The aggregation index (AI) was calculated from UV
absorbance using the following equation: A 340 × 100/(A 280 -A 340 ).
Furthermore, stability of induced aggregates in cell culture medium
(SFM4CHO, Thermo Scientific) and CHO DG44 host cell supernatant was
investigated. Therefore, freeze-thawed mAb2 was spiked into the culture
medium as well as CHO DG44 host cell supernatant and analyzed via SEHPLC. Finally, the supernatant of CHO DG44 mAb2 producer cells was
analyzed directly after inoculation and at the end of cultivation. Based on
results obtained from spiking aggregated mAb2 into CHO DG44 host cell
supernatant, aggregate formation in a culture of a mAb producing CHO
DG44 cell line was monitored.
Results: All stress methods provoked aggregate formation. The mAbs
showed formation of different aggregates using the different stress
methods (Table 1). Heating the antibody only led to formation of large
aggregates. Despite the loss of mAb2 monomer, no small aggregates were
detected via SE-HPLC. However, heat induction provoked formation of
large aggregates, whereby the average size (diameter > 1 μm) and AI
increased over time at 65 °C. Hence, heat induction can only be used to
generate large aggregates of the mAbs used in this study. The pH change
provoked formation of small aggregates (dimer and oligomer) as well as
large aggregates (diameter > 75 nm). With increasing pH dimer and
oligomer levels also increased, whereas an increased diameter was only
observed for pH 5 and 6. Thus, a shift to pH 6 can be used for induction of
dimers, oligomers and large aggregates. The addition of NaCl provoked
concentration-dependent formation of dimers and large aggregates
(diameter > 50 nm) at higher NaCl concentrations (above 500 mM). In
contrast to pH-induction, no oligomers larger than dimer were visible via
SE-HPLC. Therefore, NaCl can be used for the fast generation of dimers and
above a concentration of 500 mM for the induction of large aggregates.
With increasing freeze thaw cycles formation of small aggregates occurred.
Surprisingly, more aggregates were formed than with all other methods.
Hence, freeze-thawing was used to study the stability of aggregates under
culture conditions.
Table 1(abstract P80) Formation of different HMW
species using different induction methods
Induction Method
Small aggregates
Dimer
Heat
pH
NaCl
Freeze-thawing
Large aggregates
Oligomer
-
-
Up to 1 μm
Increase with pH
+
At pH 5 and 6
Increase with NaCl
-
Above 500 mM
+
+
-
Page 104 of 151
Figure 1(abstract P80) Freeze-thawed mAb2 spiked into cell culture medium (A) and supernatant of CHO DG44 mAb producer cells (B).
For this purpose, freeze-thawed mAb2 was spiked into culture medium
and analyzed using SE-HPLC (Figure 1, A). Since the retention time of cell
culture medium components differed from the freeze-thawed antibody,
monomer and the aggregates were still detectable. Accordingly, freezethawing was preferred for the use in cell culture supernatant spiking
experiments. The investigation of freeze-thawed (3x) mAb2 spiked into CHO
DG44 host cell supernatant revealed that mAb2 monomers as well as the
aggregates (22% dimer and 72% oligomer) were still detectable and
quantifiable via SE-HPLC. Knowing the retention time of different aggregate
species, the analysis of the supernatant of a CHO DG44 mAb producing cell
line was performed at the beginning and after 144 h cultivation (Figure 1, B).
Aggregates and monomer could successfully be detected after 144 h via
SE-HPLC, whereas after inoculation neither monomer nor aggregates were
visible. Therefore, the methods established in this work can be used to
generate different types of aggregates as positive control to evaluate
aggregate formation in cell culture supernatant.
Summary: The stress methods used in this work induced different types of
aggregates. Heating the antibody led to a loss of monomer and only
formation of large aggregates. Dimers and oligomers were formed with
increasing pH and large aggregates were formed at pH 5 and 6. A NaCl
concentration dependent aggregate formation was observed, whereby
only dimers were visible via SE-HPLC and large aggregates were only
present at a NaCl concentration above 500 mM. Freeze-thawing induced
more aggregates as with all other methods and was therefore used for the
application under cell culture conditions. Spiking experiments of freezethawed mAb2 in culture medium and CHO DG44 host cell supernatant
revealed that aggregates were still detectable and quantifiable under cell
culture conditions. Finally, this work showed that aggregate formation
directly in the supernatant of a CHO DG44 mAb producing cell line is
possible.
References
1. Ishikawa T, Ito T, Endo R, Nakagawa K, Sawa E, Wakamatsu K: Influence of
pH on heat-induced aggregation and degradation of therapeutic
monoclonal antibodies. Biological & pharmaceutical bulletin 2010,
33:1413-1417.
2. Pease LF, Elliott JT, Tsai D-H, Zachariah MR, Tarlov MJ: Determination of
protein aggregation with differential mobility analysis: application to IgG
antibody. Biotechnology and bioengineering 2008, 101:1214-1222.
3. Filipe V, Poole R, Oladunjoye O, Braeckmans K, Jiskoot W: Detection and
characterization of subvisible aggregates of monoclonal IgG in serum.
Pharmaceutical research 2012, 29:2202-12.
4. Gomez N, Subramanian J, Ouyang J, Nguyen MDH, Hutchinson M,
Sharma VK, Lin Aa, Yuk IH: Culture temperature modulates aggregation of
recombinant antibody in cho cells. Biotechnology and bioengineering 2012,
109:125-136.
5. Jing Y, Borys M, Nayak S, Egan S, Qian Y, Pan S-H, Li ZJ: Identification of
cell culture conditions to control protein aggregation of IgG fusion
proteins expressed in Chinese hamster ovary cells. Process Biochemistry
2012, 47:69-75.
6.
7.
Philo JS: Is any measurement method optimal for all aggregate sizes and
types? The AAPS journal 2006, 8:E564-E571.
Arakawa T, Philo JS, Ejima D, Tsumoto K, Arisaka F: Aggregation Analysis of
Therapeutic Proteins, Part 1: General Aspects and Techniques for
Assessment. 2006, 4:42-43.
P81
Identification of process relevant miRNA in CHO cell lines - Process
profiling reveals interesting targets for cell line engineering
Fabian Stiefel1*, Matthias Hackl2, Johannes Grilliari2, Friedemann Hesse1
1
Institute of Applied Biotechnology Biberach, Germany; 2University of Natural
Resources and Life Sciences, Institute for Applied Microbiology, Vienna,
Austria
Introduction: MicroRNAs (miRNAs) are small RNAs which function as
regulators of posttranscriptional gene expression by binding to their mRNA
targets [1]. MiRNAs are involved in crucial regulations of many signaling and
metabolic pathways. In difference to other interfering RNAs (RNAi), miRNAs
can target many mRNA, thus having an increased impact on regulation of
gene expression. These properties of miRNAs makes them interesting and
promising targets for biomarkers and cell line engineering [2,3]. Therefore,
we studied miRNA profiles during different culture phases and process
conditions and investigated the potential of differentially expressed miRNAs
as targets for process optimization. This may help to pave the way to
introduce a new layer of control for cell line engineering.
Results: For miRNA target selection a strain from Chinese hamster ovary
cells (CHO-DG44) was cultivated in a 2L bioreactor (Biostat B plus, Sartorius
Stedim, Germany) in Batch mode and two different process conditions,
control runs and temperature shift. For the control runs temperature was
maintained at 37°C all time, while for the temperature shift the temperature
was reduced to 30°C. Isolated RNA was analyzed using microarray
technology (PowerScanner and HS 400 Pro Hybridisation station, Tecan,
Germany and a cross-species chip containing miRNAs from human, mouse
and rat, University of Graz) and the best differential expressed miRNA were
cross-validated with qRT-PCR.
The optimized bioreactor protocol, shown in Figure 1 A, each process
condition included two independent biological replicates. The control
runs show good growth behavior to a maximal viable cell concentration
of 2.9 × 106 cells/ml. Reducing temperature from 37°C to 30 °C resulted
in a clear inhibition of cell growth by sustained viability. From each time
point of the different culture phases a sample was taken and total RNA
was purified.
Purified samples were labeled and then analyzed on a cross species
miRNA microarray chip. Differential expression was always calculated
between the time points for the respective culture stage compared to
day zero (shown in Table 1). The temperature shift from 37°C to 30°C
Page 105 of 151
Figure 1(abstract P81) A) Sample creation with final protocol of CHO-DG44 cells in 2L bioreactors. B) Summary of miRNA targets of microarray
analysis for validation with qRT-PCR
after 46 hours had a high impact on the miRNA profile with 22
differentially expressed miRNAs for the early response from day three
(D3-D0). In the late response (D5-D0) only three miRNAs and 18 miRNAs
in the very late response (D7-D0) were differentially expressed. Two
miRNAs were constantly expressed after shifting the temperature. In the
control run at 37°C the number of differentially expressed miRNA was
increasing during the course of the cell culture ranging from two miRNAs
for the early to medium exponential phase, 12 miRNAs for the late
exponential phase to 28 miRNA in the declining phase.
To validate microarray normalization and results, differentially expressed
miRNAs from the microarray analysis were cross-validated with qRT-PCR.
This validation was conducted for respective miRNA of the time points
before and after the temperature shift. Fold changes of mmu-miR-207
(Log 2 FC of microarray was 2.0 and 2.9 for qRT-PCR) and mmu-471-5p
207 (Log2 FC of microarray was 4.4 and 5.0 for qRT-PCR) obtained from
microarray and qRT-PCR technology were very comparable and showed
same trends. This indicates that the microarray results can be used for a
deeper analysis of the differentially expressed miRNAs.
During a batch run, culture parameters are changing. In order to investigate
the impact of these changes to miRNA profiles, time course of differential
expression of miRNA during the different cell culture phases were analyzed.
For the time courses of ten miRNAs in the temperature shift most of the
miRNAs showed their highest differential expression shortly after the
reduction of the temperature. Some miRNAs keep their level of differential
expression, some return to normal levels three days after the temperature
shift. One miRNA is differential expressed at the end of the observed culture
phase. In the control run the number of differential expressed miRNAs and
the fold change of the differential expression is increasing during
progressing culture phase.
Figure 1 B shows the differential expression of ten miRNA directly after the
temperature shift and four miRNAs for the control runs between day zero
and the declining phase at day seven. For the temperature shift differential
expression ranges from log2 FC 1.7 to 5.4 and 2.0 to 4.4 for the control
Table 1(abstract P81) Summary of differentially
expressed miRNAs in the control run and the
temperature shift
Amount of differentially expressed miRNA
Control
Temperature shift
D2-D0
0
0
D3-D0
2
22
D5-D0
12
3
D7-D0
28
18
runs. This selection of miRNAs presented here may be interesting
candidates for further investigation using miRNA overexpression/inhibition
and phenotype studying.
Conclusion: As a conclusion, with optimized bioreactor protocols it was
possible to establish miRNA profiles of CHO-DG44 cells for different culture
phases on cross species microarray chips. The number of differential
expressed miRNAs was increasing by progressing of the culture phase.
Additionally, the impact of a temperature shift on the profiles revealed
several highly differentially expressed miRNA. Some of these miRNAs were
already cross-validated with qRT-PCR which confirmed the results from the
microarray experiment. MiRNA targets of these two experimental
approaches will help to increase the knowledge of the role of miRNAs
during a bioreactor process and might pave the way for their use in cell line
engineering.
References
1. Chen K, Rajewsky N: The evolution of gene regulation by transcription
factors and microRNAs. Nature reviews Genetics 2007, 8:93-103.
2. Barron N, Sanchez N, Kelly P, Clynes M: MicroRNAs: tiny targets for
engineering CHO cell phenotypes? Biotechnology letters 2011, 33:11-21.
3. Hackl M, Jadhav V, Jakobi T, Rupp O, Brinkrolf K, Goesmann A, Pühler A,
Noll T, Borth N, Grillari J: Computational identification of microRNA gene
loci and precursor microRNA sequences in CHO cell lines. J biotechnol
2012, 158:151-155.
P82
Introducing a new chemically defined medium and feed for hybridoma
cell lines
Christoph Heinrich1*, Tim F Beckmann1, Sandra Klausing1, Stefanie Maimann2,
Bernd Schröder2, Stefan Northoff1
1
TeutoCell AG, Bielefeld, 33613, Germany; 2Miltenyi Biotec GmbH, Teterow,
17166, Germany
Background: Hybridoma technology was established in the 2nd half of the
20th century and in the view of current protein production it might seem
old-fashioned. Despite, it is commonly used to produce monoclonal
antibodies (mAbs) for R & D, clinical diagnostics or medical applications and
the demand for mAbs produced by hybridomas is still high. However,
compared to CHO, only a few serum-free hybridoma media are available
and even less suppliers for chemically defined products are on the market.
In this work, a new chemically defined medium and feed were developed to
bring hybridoma processes to the next level and to target the existing gap
in the market.
Materials and methods: HybriMACS CD medium was developed using
various research and production hybridoma cell lines from Bielefeld
University (e.g. MF20, 187.1, HB8209) and industrial partners. HybriMACS
CD medium was supplemented with 8 mM L-Glutamine for routine
cultivation, batch and perfusion processes. For optimal performance of
MF20 hybridoma cells (DSHB at the University of Iowa) the HybriMACS
CD medium was supplemented with insulin (4 mg/L) or IGF (0.04 mg/L).
All cultivations were carried out using standard conditions. Briefly,
precultures and batch cultivations were performed in 125 mL and 250 mL
Erlenmeyer flasks. Incubator conditions were set to 37 °C, 5% CO2 and a
relative humidity of 80%. For bioreactor cultivations closed-loop controlled
2 L benchtop systems were used with parameters set to 37 °C, 40% DO and
pH 7.1 +/- 0.05. Automated viable cell counting was performed using a
Cedex (Innovatis). Monoclonal antibody (mAb) concentrations were
determined with Protein A HPLC or ELISA (MF20 cell line).
Results: Hybridoma cell growth in HybriMACS CD medium was compared
to 12 competitor products in the time course of several passages and a
final batch cultivation. For a mouse-mouse hybridoma cell line, maximum
viable cell density (vcd) in HybriMACS CD was highest and for a ratmouse hybridoma cell line second-highest compared to growth in the 12
competitor media, as shown in Figure 1 (A).
Easy adaption from serum-containing medium was verified by direct
thawing of five different hybridoma cell lines in HybriMACS CD (Figure 1 B).
Furthermore, long-term stable growth of a hybridoma cell line in HybriMACS
CD was also confirmed in cultivations for more than 80 days.
The majority of tested cell lines reached a maximum cell density above
2.5 to 5.0 × 106 cells/mL in uncontrolled and controlled batch processes
using HybriMACS CD. For uncontrolled fed batch cultivations 1.0 × 107
cells/mL were observed as maximum viable cell density, while controlled
fed batch processes reached values above 1.5 × 107 cells/mL. The final
antibody titer was increased at least by a factor of 5 in uncontrolled fed
batches and up to 10 times in controlled fed batch cultivations using
HybriMACS Feed Supplement. Exemplary results of controlled as well as
uncontrolled batch and fed batch cultivations are shown in Table 1.
Conclusions: HybriMACS CD is a chemically-defined, protein-free medium
composition with no need for growth hormone supplementation. The
specially designed formulation supports direct adaption of serumdependent hybridoma cells, even when starting from a serum-containing
Page 106 of 151
cell bank. In addition, the developed medium formulation enables stable
long-term growth of hybridoma cell lines, supporting an unrestricted
utilization in diverse processes. HybriMACS CD is suitable for bioreactor
batch and perfusion processes reaching high cell densities and commonly
accepted amounts of antibody. A specially tailored HybriMACS Feed
Supplement increased final antibody titer at least by a factor of 5 to 10 for
all tested hybridoma cell lines. This improvement can be further increased
by customization of the generic feed regime, while maintaining suitable
glucose and glutamine concentrations.
P83
Comparative study of bluetongue virus serotype 8 production on
BHK-21 cells in a 50L Biostat® STR single-use bioreactors vs
roller bottles
Lídia Garcia*, Mercedes Mouriño, Alicia Urniza
Zoetis Manufacturing & Research Spain, S.L Pfizer Olot S.L.U., Ctra.
Camprodon s/n, La Riba, 17813 Vall de Bianya (Girona), Spain
Background: Bluetongue is a major disease of ruminant livestock that can
have a substantial impact on income and animal welfare. Bluetongue virus
serotype 8 (BTV-8) first emerged in the European Union in 2006, peaking at
45,000 cases in 2008. Zoetis (formerly Pfizer Animal Health) licensed
bluetongue vaccines (Zulvac 4 Ovis, Zulvac 1 Ovis, Zulvac 1 Bovis, Zulvac 8
Ovis and Zulvac 8 Bovis and combinations) able to prevent viremia,
stressing the role of the vaccine as an aid for the epidemiological control
of the disease.
One important issue to be taken into account in the development of
vaccines is their cost, especially in veterinary use. Vaccine production
requires high-yield, stable bioproduction systems and implementation of
new technologies.
Mammalian cells are the substrate for production of most of the veterinary
vaccines. BHK-21 cells are commonly used to produce bluetongue
vaccines.
Figure 1(abstract P82) (A) Comparison of two different hybridoma cell lines in HybriMACS CD and 12 competitor media. (B) Growth behaviour
of five serum-dependent hybridoma cell lines in HybriMACS CD directly after thawing.
Table 1(abstract P82) Exemplary data of batch and fed batch cultivations under controlled (bioreactor) as well as
uncontrolled (shaker) conditions
Shaker
Bioreactor
Process
Maximum vcd
[106 cells/mL]
IVCD
[106 (cells*d)/mL]
Final mAb titer
[mg/L]
Batch
3.7
7.3
56.2
Fed batch
10.5
39.5
447.5
Batch
3.7
9.52
61.0
Fed batch
17.3
107.6
1035.4
Values represent mean from two biological replicates.
As an example, the use of the BTV-8 vaccine is routinely produced in roller
bottles (RB). The aim of this study is to investigate Single-Use Bioreactor
technology as an alternative to RB. This technology combines the basic
concept of allowing the cells to attach to a surface (microcarriers) with the
advantages of suspension, which allows a better control of culture
conditions and systematic and automatic culture process.
Single use technology can also be an alternative to conventional production
methods reducing facility complexity, possibility of the rapid expansion of
the capacity of the production and to avoid the cleaning process and
reduction of the risk of cross-contamination. Lower culture handling and
more homogeneity can be achieved.
Selection of appropriate culture conditions can be important to achieve
consistent cell culture and virus production across sites and scales.
Because characteristics like tank geometry and hardware (impellers,
sparger) are not subject to change during scale-up, the scalability from
50 L to 1000 L in the BIOSTAT® STR bioreactor can be an easy strategy for
our production process.
Materials and methods: Cell line: BHK-21. These cells were used
because they are permissible to BTV replication. All cells were cultured at
37°C in MEM-G medium supplemented with serum.
Virus strain: BTV-8, strain BEL2006/02, supplied by “Veterinary and
Agrochemical Research Centre” (VAR-CODA-CERVA), Ukkel, Belgium.
Cultivation system: The growth of the BHK-21 cells and production of
virus was performed in roller bottles and 50 L single-use bioreactor
BIOSTAT® STR (Sartorius Stedim Biotech).
BHK-21 cells were grown in microcarriers Cytodex-3 at 3g/L into the STR
bioreactor and the cell production was optimized with respect to pH,
temperature, stirring speed and aeration rate.
Viable cell number was evaluated using the crystal violet dye nucleus
staining method.
Virus infection and titration
The virus chosen to compare and prove the suitability of Single use
technology for the production of viral vaccines was BTV-8.
Confluent cells were infected at a constant MOI and harvesting was done
at 100% CPE.
Virus production was calculated according to the Spearman-Kärber method,
expressing the result in tissue culture infectious doses (50%) (TCID50).
Cell growth and BTV-8 antigen production in the BIOSTAT® STR bioreactor
was conducted at the optimal conditions determined previously on
conventional bioreactors.
Microcarriers elimination: Taking into account that for vaccine
formulation microcarriers must be eliminated from the viral suspension,
filtration through Sartopure PP2 cartridges (from Sartorius Stedim
Biotech) was performed.
Results: The final goal is to maximize productivity preserving its quality.
How? By increasing cell concentration and cell productivity.
To demonstrate the feasibility of bioreactors for microcarriers cell cultures,
the growth of BHK-21 cells in roller bottles, and in the BIOSTAT® STR
bioreactor was evaluated and compared.
Results prove that when using the 50L BIOSTAT® STR bioreactor, BHK-21
cells are attached and grow efficiently on microcarriers. Cell concentration
yield in terms of average was higher than in roller bottles (Figure 1).
Page 107 of 151
The virus titers reached in the BIOSTAT® STR bioreactor were equal o
higher than the levels obtained in roller bottles (Figure1).
Conclusions: ▪ Comparable results between Roller bottles and 50 L
BIOSTAT® STR bioreactor
✓ cell density
✓ productivity
✓ product quality
▪ BHK-21 cells grow efficiently on microcarriers. Conditions for cell
attachment in terms of mixing conditions were optimized.
▪ BTV-8 antigen with satisfactory yields can be obtained by culturing
BHK-21 in a 50L BIOSTAT® STR bioreactor.
▪ As expected, high density of BHK-21 cultures showed increased
productivity
▪ Microcarrier filtration causes no significant drop in virus titer.
▪ With the conditions established with the 50 L BIOSTAT® STR
bioreactor the reproducibility and the scale-up from 50 L to 1000 L
can be easily performed.
▪ Single-Use Bioreactor technology is a good alternative to Roller
Bottles and is a suitable system for propagation of BTV-8 virus using
adherent BHK cells on microcarriers. Involving reduction of costs,
cleaning, sterilization etc.
P84
Golgi engineering of CHO cells by targeted integration of
glycosyltransferases leads to the expression of novel Asn-linked
oligosaccharide structures at secretory glycoproteins
Tobias Reinl1*, Nicolas Grammel2, Sebastian Kandzia3, Eckart Grabenhorst1,2,3,
Harald S Conradt1,2,3
1
Dept. Cell Engineering, Feodor-Lynen-Str. 35, 30625 Hannover, Germany;
2
Dept. Mass Spectrometry, Feodor-Lynen-Str. 35, 30625 Hannover, Germany;
3
Dept. Glycosylation Analysis GlycoThera GmbH, Feodor-Lynen-Str. 35, 30625
Hannover, Germany
Background and novelty: N-glycans constitute an important information
carrier in protein-driven signaling networks. Amongst others, N-glycans
contribute to protein folding quality, adjust protein turnover and operate as
address label for targeting proteins to specific cells and tissues [1]. Hence,
the composition of N-glycans attached to recombinant glycoprotein
therapeutics is vital for in-vivo therapeutic efficacy and strongly depends on
the choice of the expression host [2,3]. Due to absence or silencing of
glycosyltransferase genes homologue to human enzymes, biotechnologically
used cell lines are limited by their intrinsic glycosylation machinery and
produce host specific glycoforms.
Cetuximab, a therapeutic chimeric mouse/human monoclonal antibody
(IgG1), is N-glycosylated both at the CH2-domain (Asn299) and at the
VH-domain (Asn88) (Figure 1A). Sold under the trade name Erbitux®,
Cetuximab is expressed from a murine myeloma cell line and targets the
human EGF receptor [4], which is overexpressed in about 1/3 of all
human cancers. The antibody is highly decorated with the aGal-epitope
Figure 1(abstract P83) Comparison of cell growth and virus titer in roller bottles and in 50 liter BIOSTAT®CultiBagSTR single-use bioreactor
Page 108 of 151
Figure 1(abstract P84) (A) Non-reducing terminal oligosaccharide motifs attached to N-glycans of specific human glycoproteins (left side). Scheme of
model glycoprotein Cetuximab with CH2- and VH-domain N-glycans (right side). (B) NP-HPLC-FLD elution profiles of 2-AB labeled oligosaccharides from
VH-domain of Cetuximab after co-expression of the indicated glycosyltransferases.
(Gala1-3Galb1-4GlcNAc) which has been shown to result in fatal allergic/
hypersensitivity response in several patients [5].
The design of new quality-optimized and functionally improved biopharmaceuticals with properties conferred by host cell unrelated N-glycans
requires a rational Golgi engineering strategy. Here, we apply GET, a system
that enables the positioning of a desired catalytic glycosyltransferase
activity into a favorable localization within the intracellular glycosylation
machinery, to suspension CHO cells developed to secrete suitable amounts
(200 μg/ml) of Cetuximab as a model glycoprotein. The presented Golgi
engineering project aims in the extension of the intrinsic glycosylation
repertoire enabling CHO cells to produce new human-type glycosylation
motifs as indicated in Figure 1A: (i) GalNAcb1,4GlcNAc-R (LacdiNAc, LDN),(ii)
GlcNAc in b1,4 linkage to central mannose residue (bisecting GlcNAc, bGN),
(iii) Galb1,4(Fuca1,3)GlcNAc-R (Lewis X , Le X ) and (iv) NeuAca2,3Galb1,4
(Fuca1,3)GlcNAc-R (Sialyl-LewisX, sLe X ). To assemble (ii) and (iv), we
co-express GnT3 and FT7. As shown earlier, the latter enzyme catalyzes
fucosylation exclusively of (iv). Therefore, we included in our study a variant
of FT6 that is targeted to the early Golgi compartment with the aim to
additionally generate structure (iii) [6,7]. The uncommon LDN motif (i)
which is e.g. detected on lutropin is assembled by human B4GalNT3 [8,9].
We analyze oligosaccharides released from the products of genetically
engineered CHO cells based on the resolution of single glycosylation sites
of VH- and CH2- glycopeptides by quantitative NP-HPLC-FLD and use our
comprehensive oligosaccharide standard library to identify novel
oligosaccharide motifs.
Experimental approach: Cloning of human glycosyltransferases and
engineering of VAR FT6 [7] as well as construction of pGET expression
plasmids encoding either the heavy and light chain of Cetuximab or the
glycosyltransferase cDNAs was done acc. to standard DNA technologies.
A stable clone with Cetuximab titers of 200 μg/ml and doubling times of
25 hours was selected after transfection of pGET-Cetuximab in CHO cells.
This clone was either mock- or co-transfected with pGET plasmids
encoding the indicated glycosyltransferases. After shake flask
subcultivation for 72 h Cetuximab was purified from supernatants,
digested and applied to RP-HPLC peptide mapping. CH2- and VH-domain
glycopeptides were separated and oligosaccharides were enzymatically
released. After 2-AB labeling, the isolated oligosaccharides were subjected
to quantitative NP-HPLC-FLD and ESI-TOF-MS and MS/MS analysis.
Oligosaccharide structures were unambiguously identified in comparison
to GlycoThera’s reference standard oligosaccharide library.
Results and discussion: In combination with our site specific and
quantitative micro glycan structure analysis we provide a modular system
(GET) for the customized assembly of novel CHO unrelated oligosaccharide
motifs. As exemplified for VH-domain, the NP-HPLC-FLD elution profiles of
2-AB labeled oligosaccharides after heterologous co-expression of
Cetuximab and the indicated glycosyltransferases are shown in Figure 1B.
Quantitative results of all oligosaccharide structures are given in Figure 2.
The Mock-transfected control approach reveals the intrinsic glycosylation
repertoire of our stable CHO cell clone. Cetuximab is decorated with
Page 109 of 151
agalactosylated (35,5%), mono- (50,0%) and di-galactosylated (10,1%)
diantennary complex-type N-glycans containing proximal a1,6-linked fucose
at the CH2-domain. VH-domain N-glycans consist of neutral (13,8%), mono(50,3%) and di-sialylated (35,8%) oligosaccharide structures. Whereas
N-glycans from the market product Erbitux® produced in SP2/0 cells are
extensively decorated with Gala1,3Gal and NeuGc (data not shown), those
allergenic structures are not detected in Cetuximab N-glycans from our CHO
cell clone.
The heterologous co-expression of wildtype B4GalNT3, GnT3 and FT7 and
genetically modified FT6 results in the formation of the uncommon
LacdiNAc motif (ca. 40%), the LewisX and di-LewisX structures (ca. 50%)
and Sialyl-LewisX (ca. 15%) almost exclusively on oligosaccharides from the
VH-domain. Relevant modification of both VH-domain (ca. 40%) and CH2domain glycans (ca. 30%) is only achieved by GnT3 catalyzed attachment
of bisecting GlcNAc. In addition, glycosyltransferase co-expression leads to
charge state reduction of oligosaccharides by depletion of suitable
acceptors for endogenous sialyltransferases. The strongest reduction in the
content of neuraminic acid at VH-domain was observed by co-expression
of VARFT6 (ca. 55% reduction) and WTB4GalNT3 (ca. 50% reduction).
Figure 2(abstract P84) Amount of oligosaccharide structures detected on CH2- and VH-domain of Cetuximab after heterologous glycosyltransferase
co-expression (given in% peak area values after integration of NP-HPLC-FLD chromatograms)
As a conclusion, Golgi engineering endows CHO cells to assemble
significant amounts of LacdiNAc, bisecting GlcNAc, Lewis X and SialylLewisX to Cetuximab N-glycans (Figure 1B and Figure 2). Therefore, our
glycosylation engineering strategy provides a tool to produce tailored
N-glycosylation variants with defined structural motifs. As demonstrated,
the tailored addition of bisecting GlcNAc to CH2-domain N-glycans
increases ADCC of an aCD20 therapeutic mAB [10]. We therefore assume
that the presented structural motifs exhibit novel therapeutic properties
(ADCC, CDC, tissue specificity, serum half-life). Our strategy represents a
relevant basis for the development of biotherapeutics and biobetters with
potentially improved pharmacokinetics, pharmacodynamics, safety
properties and in vivo therapeutic efficacy.
References
1. Varki A, Lowe JB: Biological Roles of Glycans. Essentials of Glycobiology
Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press: Varki A,
Cummings RD, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler
ME, 2 2009, Chapter 6.
2. Sinclair AM, Elliott S: Glycoengineering: the effect of glycosylation on the
properties of therapeutic proteins. J Pharm Sci 2005, 94:1626-1635.
3. Grabenhorst E, Schlenke P, Pohl S, Nimtz M, Conradt HS: Genetic
engineering of recombinant glycoproteins and the glycosylation
pathway in mammalian host cells. Glycoconj J 1999, 16:81-97.
4. Erbitux® (Cetuximab): Prescribing Information. Bristol-Myers Squibb
(1236886B3, Rev. March 2013).
5. Commins SP, Platts-Mills TAE: Allergenicity of Carbohydrates and Their
Role in Anaphylactic Events. Curr Allergy Asthma Rep 2010, 10:29-33.
6. Grabenhorst E, Nimtz M, Costa J, Conradt HS: In Vivo Specificity of Human
a1,3/4-Fucosyltransferases III-VII in the Biosynthesis of LewisX and Sialyl
LewisX Motifs on Complex-type N-Glycans. J Biol Chem 1998,
273:30985-30994.
7. Grabenhorst E, Conradt HS: The cytoplasmic, transmembrane, and stem
regions of glycosyltransferases specify their in vivo functional
sublocalization and stability in the Golgi. J Biol Chem 1999,
274:36107-36116.
8. Sato T, Gotoh M, Kiyohara K, Kameyama A, Kubota T, Kikuchi N, Ishizuka Y,
Iwasaki H, Togayachi A, Kudo T, Ohkura T, Nakanishi H, Narimatsu H:
Molecular cloning and characterization of a novel human beta 1,4-Nacetylgalactosaminyltransferase, beta 4GalNAc-T3, responsible for the
synthesis of N, N’-diacetyllactosediamine, galNAc beta 1-4GlcNAc. J Biol
Chem 2003, 278:47534-47544.
9. Fiete D, Srivastava V, Hindsgaul O, Baenziger JU: A hepatic
reticuloendothelial cell receptor specific for SO4-4GalNAc beta
1,4GlcNAc beta 1,2Man alpha that mediates rapid clearance of lutropin.
Cell 1991, 67:1103-1110.
10. Davies J, Jiang L, Pan LZ, LaBarre MJ, Anderson D, Reff M: Expression of
GnTIII in a recombinant anti-CD20 CHO production cell line: Expression
of antibodies with altered glycoforms leads to an increase in ADCC
through higher affinity for FC gamma RIII. Biotechnol Bioeng 2001,
74:288-294.
P85
Characterization of the influence of cultivation parameters on
extracellular modifications of antibodies during fermentation
Christian Hakemeyer*, Martin Pech, Gero Lipok, Alexander Herrmann
Pharma Technical Development, Roche Diagnostics GmbH, Penzberg
Germany
Introduction: The production of protein-based medical agents, like
monoclonal antibodies (Mabs), by biotechnological processes requires a
comprehensive quality control. The pharmaceutical industry and national
health authorities support the complete characterization of therapeutic
proteins to increase the quality and safety. During numerous and
different production steps like fermentation, purification and storage,
various protein modifications on therapeutic products can occur, like
deamidation of asparagine and glutamine, oxidation of methionine
tryptophan residues, clipping of terminal amino acids, glycation and
others.
During the development of fermentation processes, good growth
conditions for the cell culture are of primary importance to obtain
Page 110 of 151
maximal productivity [1]. Until now only few efforts have been made to
investigate the development of extracellular antibody modifications and
their sources during fermentation as the first phase of the productions
process. Already known is the fact that pH-value and temperature can
induce modifications on monoclonal antibodies [2].
Aim of this work is to increase the knowledge about the development of
extracellular modifications of monoclonal antibodies during the fermentation
process. Therefore, parameters of fermentation were identified which
influence modifications during cell-free incubation under common fermentation conditions (in shake flask and small scale bioreactor-systems).
Results: The results from the shake flask experiments showed a different
degree of changes of the charge isoform pattern (measured by IE-HPLC)
for five analyzed antibodies during the approx. nine days of cell-free
incubation. The respective increase of the amount of acidic regionwas
strongly dependent on the specific protein. At the end of the incubation,
the amount of the acidic region range from approx. 20 area-% to
approx.75 area-% depending on the characteristics of the Mab. The
increase in the acidic region correlated with a decrease of the main peak
while the basic regionremained unchanged.
The specific influence of the parameters pH, temperature and dissolved
oxygen (DO) on the modification of antibodies was further characterized in
full factorial DoE designed experiments for three Mabs. For this purpose,
cell broth was taken at an early stage from standard 1.000 L fermentations
with Chinese Hamster Ovary (CHO) cells and cells were removed by
centrifugation. The cell-free supernatant was then transferred to small
scale bioreactors and incubated for approx. ten days under the conditions
listed in table 1.
In these experiments, elevated temperature conditions and higher pH
values led to a faster modification (degradation) for all three investigated
antibodies during the incubation compared to lower pH and temperature
conditions, while dissolved oxygen level had no relevant impact on the
kinetic of antibody degradation.
The results of the cell-free incubation studies were used to develop a
mathematical model was to predict the isoform pattern of the Mab during
standard fermentations with CHO cells from inoculation to harvest. The
amount of the acidic peak can be predicted, depending on the specific
antibody characteristics as determined in the previous experiments, the
concentration of the antibody during the cultivation, and the fermentation
time and process conditions (pH, DO, temperature). Figure 1 shows an
actual-by-predicted plot, comparing model predictions against measured
values for several fermentations of one Mab. The model is well capable of
predicting the amount of acidic isoform for this molecule.
Conclusion: In this work, the influence of fermentation parameters (pH,
DO, temperature) on the extracellular modification of Mabs (in the
supernatant of cell broth) was examined. Higher temperature and higher
pH values lead to a significant increase in the formation of the acid region
species of Mabs compared to lower temperature and pH conditions. The
impact of these process parameters on the modification kinetics of Mabs
Table 1(abstract P85) Setup for the small scale
fermentation experiments
Experiment
pH
Temp. [°C]
DO [%]
1
6.7
33.0
45
2
6.7
40.0
5
3
7.0
36.5
25
4
7.0
36.5
25
5
7.3
33.0
5
6
7.3
40.0
45
7
6.7
40.0
45
8
6.7
33.0
5
9
7.0
36.5
25
10
7.0
36.5
25
11
7.3
33.0
45
12
7.3
40.0
5
Page 111 of 151
Figure 1(abstract P85) Correlation of measured versus calculated amount of acidic isoforms
during cell-free incubation was characterized. Furthermore, additional
modifications were detected, as oxidation, deamidation, generation of
pyro glutamic acid, separation of lysin (data not shown).
The results of the incubation experiments in the small scale fermenter
system lead to a mathematical prediction model for the increase of the
acidic peak during a standard fermentation for the production of Mabs with
CHO cells. This prediction model helps to develop robust fermentation
processes.
References
1. Müthing J, Kemminer SE, Conradt HS, Sagi D, Nimtz M, Kärst U, PeterKatalinic J: Effects of buffering conditions and culture pH on production
ratesand glycosylation of clinical phase I anti-melanoma mouse IgG3
monoclonal antibody r24. Biotechnol Bioeng 2003, 83:321-334.
2. Usami A, Ohtsu A, Takahama S, Fujii T: The effect of pH,
hydrogenperoxide and temperature on the stability of a human
monoclonal antibody. J PharmBiomed Anal 1996, 14:1133-1140.
P86
Technology transfer and scale down model development strategy for
biotherapeutics produced in mammalian cells
Nadine Kochanowski*, Laetitia Malphettes
Cell Culture Process Sciences Group, Biotech Sciences, UCB Pharma S.A.,
Braine L’Alleud, 1420, Belgium
Background: The goal of manufacturing process development for drug
substance and drug product is to establish a commercial process capable of
consistently producing drug substance/drug product of the intended
quality. Based on regulatory requirements, the manufacturing process has to
be characterized prior to process validation. Since performing the
characterization study at the manufacturing scale is not practically feasible,
development of a scale down model that represents the performance of the
commercial process is essential to achieve reliable process characterization.
The developed scale down model could also be applied for cell line
selection, process and medium development, raw material evaluation, limit
of cell age studies, process parameter excursions, etc... Process development
and commercial production should not be on the critical path to market
despite the compressed time-to-market expectations. That is why
Technology Transfer (TT) is a vulnerable time for companies. According to
World Health Organization, Transfer of technology is defined as “a logical
procedure that controls the transfer of any process together with its
documentation and professional expertise between development and
manufacture or between manufacture sites”. In the pharmaceutical industry,
Technology Transfer refers to the processes that are needed for successful
progress from drug discovery to product development to clinical trials to
full-scale commercialization or it is the process by which a developer of
technology makes its technology available to commercial partner that will
exploit the technology. This article describes the strategies and activities
required to develop a scale down model. It also sketches a Technology
Transfer approach for bioprocesses by focusing on the upstream part of a
cell culture based process.
Results: Scale down model development strategy: “Small-scale models
can be developed and used to support process development studies. The
development of a model should account for scale effects and be
representative of the proposed commercial process. A scientifically justified
model can enable a prediction of quality, and can be used to support the
extrapolation of operating conditions across multiple scales and equipment
[2]. The key elements for designing a scale down model are inputs (raw
materials and components, cell source, environmental conditions) and
outputs (performance and product quality metrics, sample handling/
storage, analytical methods). A scale down model can be equivalent for
some outputs but not for all and still be a representative model. It should
reproduce at small scale the effect/impact seen at large scale. The
acceptability of an observed offset has to be statistically evaluated and
scientifically understood.
Technology Transfer strategy: “The goal of Technology Transfer
activities is to transfer product and process knowledge from development
to market, and within or between manufacturing sites to support product
commercialization. This knowledge forms the basis for the manufacturing
process, control strategy, process validation approach and ongoing
continual improvement [1]. A dedicated Technology Transfer team has to
be set up to facilitate and execute the process including experts in
Page 112 of 151
Figure 1(abstract P86) Technology Transfer (TT) process flow chart.
Table 1(abstract P86) Technology transfer documentation
Document
Content
Bill of materials
List of all components and their step of use (Supplier, grade)
Research and Development reports
Historical data of pharmaceutical development of new drug substances and drug products at stage from
early development to final application of approval - Quality profiles of manufacturing batches (including
stability data) - Specifications and test methods of drug substances, intermediates, drug products, raw
materials and components, and their rationale - Change histories of important processes and control
parameters
Risk assessment
Process flow charts - Scale up - Equipment changes - Media and feed preparation
Process descriptions
Product information - Process step flow diagram - Cell culture steps description (cell line/inoculum/
expansion/production bioreactor - Media and feed preparation - Harvest description - Raw materials/
equipment)
Technology transfer file
Introduction - Manufacturing process description, process parameters - Equipment - Raw materials Analyses - Safety, environment - Stability (conditions, results) - Packaging (cold chain requirements, etc...) Cleaning - Shipment characteristics and proper validation if needed - Historical data available
Technology transfer protocol
Technology transfer description - Scope - Objective - Responsibilities - Process Description - Equipment list
(receiving unit) - Raw material list - Reference of Master batch record/number of repetitions and status of
batches/acceptance criteria/relevant specifications/description of coaching
Page 113 of 151
Table 1(abstract P86): Technology transfer documentation (Continued)
Manufacturing and testing description
of the process
Product information - Process step flow diagram - Cell culture steps description (cell line/inoculum/cell
expansion/production bioreactor) - Media and feed preparation - Harvest description (holding time/storage
conditions) - Raw materials - Equipments
Routine and non-sampling plans
List of all the samplings that should be taken and kept in addition to the in-process control samples listed
in the manufacturing description
Data recording list
Online and offline data to be monitored and recorded during the process
Deviation inventory
Description in details of the deviations and reporting of the impact on the product titer and quality
Technology transfer report
Technology transfer description - Objective - Scope - List of deviations and discussion - Process results and
comparison to acceptance criteria -, Conclusions
different fields (production, QA, QC, RA, MSAT, etc...). The whole
Technology Transfer has to be coordinated by the technology transfer/
project leader. Organization for Technology Transfer should be established
and composed of both party members from both sites, roles and scope of
responsibilities of each party should be clarified, and adequate
communication and feedback of information should be ensured. Figure 1
describes the main steps of the Technology Transfer. Technology Transfer
can be considered successful if the Receiving Unit can routinely reproduce
the transferred product, process, or method against a predefined set of
specifications as agreed with the Sending Unit. The success of a Technology
Transfer project will be largely dependent on the skill and performance of
individuals assigned to the project from the Sending Unit and the Receiving
Unit. The roles and responsibilities of the sending unit and the receiving unit
have to be clearly defined. The documentation is a key element of
Technology Transfer: it ensures consistent and controlled procedures for
Technology Transfer and to run the process. Clear documentation should
provide assurance of process and product knowledge (Table 1).
Conclusions: A scale down models is a tool for developing and
characterizing the process and should be designed and demonstrated as
appropriate representations of the manufacturing process. The transfer of
technology from R&D to the commercial production site is a critical
process in the development and launch of a biotherapeutical product. The
three primary considerations to be addressed during an effective
technology transfer are the project plan, the people involved and the
process.
References
1. ICHQ10 guideline: Pharmaceutical Quality System.
2. ICHQ11 guideline: Development and manufacture of drug substances
(chemical entities and biotechnological/biological entities).
P87
A modular flow-chamber bioreactor concept as a tool for continuous
2D- and 3D-cell culture
Christiane Goepfert1, Grit Blume1, Rebecca Faschian1, Stefanie Meyer1,
Cedric Schirmer1, Wiebke Müller-Wichards2, Jörg Müller2, Janine Fischer3,
Frank Feyerabend3, Ralf Pörtner1*
1
Technology Hamburg, D-21073, Germany; 2Institute of Micro System
Technology, Hamburg University of Technology, Hamburg, D-21073,
Germany; 3Department of Structural Research on Macromolecules, Institute
of Materials Research, Helmholtz-Zentrum Geesthacht, Geesthacht, D-21502,
Germany
Background: Advanced cell culture models, especially long-term 3D
systems, require bioreactors allowing for cultivation under continuous flow
conditions. Such culture models are for example tissue engineered implants,
3D cultures for drug testing, in vitro models of cell growth and migration for
wound healing studies, cell cultures for biomaterial testing. New challenges
in drug testing and biomaterial development arise from regulatory
requirements. Animal trials have to be replaced by cell culture assays,
preferably by test systems with human material. Standard 2D monolayer
cultures are often unsatisfactory and therefore tissue-like 3D cultures are
suggested as an alternative. Here the design of a multi-well flow-chamber
bioreactor as a tool for manufacturing advanced cell culture models is
presented. Advantages of this reactor concept can be seen in constant flow
conditions, removal of toxic reaction products, high cell densities, and
improved metabolism [1]. The general design of the flow chamber
bioreactor (FCBR) can easily be modified for different applications and
analytical requirements.
Concept: The concept of the flow-chamber bioreactor (FCBR) comprises
the following features (Figure 1A): Simultaneous cultivation of multiple
tissue constructs in special inserts; oxygen supply via surface aeration
directly in the chamber; a uniform and thin medium layer which is created
by a small barrier at the end of the flow channel to minimize the diffusion
distance from the gas phase to the tissue constructs; medium supply from
a reservoir bottle in a circulation loop via peristaltic pumps.
Two designs are available: A closed system (single flow channel) with
counter current flow of gas and medium for tissue-engineered constructs
(Figure 1B), and a 24 well plate-based modular bioreactor (medorex, NörtenHardenberg, Germany) for miniaturized tissue constructs that permits the
use of pipetting robots and standard plate readers (Figure 1C).
For the latter one, the design of the 4 channels can be customized for
various applications (Table 1). The lid of the plate is connected to tubings
for medium recirculation. Medium is supplied via the first well and
removed from the last well of each row (Figure 1C). Therefore 4 wells per
row are available for construct cultivation.
The closed system is aerated with humidified pre-mixed gas with optional
composition. Therefore it can be handled independently from cell culture
incubator. The 24 well-based system has to be placed in a humidified
incubator for air supply from the incubator atmosphere.
Fields of Application: For the above mentioned bioreactor designs, four
applications are presented in the following.
Example I: The single flow-channel bioreactor (Figure 1 (B)) was designed for
the generation of three-dimensional cartilage-carrier constructs [2].
The carriers consisting of a bone replacement material were covered with a
1-2 mm cartilage layer. This reactor was used for long-term cultivation of
cartilage-carrier-constructs with improved biochemical parameters (e.g.
content of glycosaminoclycan, collagen type II) under constant conditions.
Example II: The 24-well design was successfully applied to several cell culture
models. Hepatocytes on porous 3D carriers were cultivated for 1-3 weeks and
can be used as a model for drug testing [3]. After prolonged cultivation under
continuous medium flow, the constructs are separated from each other for
measurements in static operation mode to conduct viability and activity
assays similar to procedures done in a standard multi well plate. Viability
testing using Resazurin was performed repeatedly during cultivation.
Furthermore, the EROD-assay for liver-specific cytochrome P450 activity was
carried out at varying time points. Application for the resorption studies
on magnesium implants is currently investigated by Prof. Willumeit,
Dr. Feyerabend, HZ Geesthacht.
Example III: A third layout of the MWFB was realized with four parallel
flow channels instead of the separate wells. There is also the possibility to
carry out material tests for cell expansion on specific materials (e.g.
polymer films, collagen membranes, different coatings etc.).
Example IV: Proliferation and migration of fibroblasts on collagen coated
polymer foils integrated into the bioreactor was carried out using design IV
(Figure 1 C). Electrical stimulation of NIH-3T3 fibroblasts resulted in the
orientation of the cell cleavage plane perpendicular to the electric field
vector. The electrodes were inserted into the chamber on a polymer foil
clamped between the base plate and the 24 well plate equivalent top
frame. The polymer foil can be removed and processed after the assays for
staining and microscopic evaluation of the stimulated cells. The bottom
Page 114 of 151
Figure 1(abstract P87) Flow-chamber bioreactor (FCBR, medorex, Germany)(A) Concept (B) Closed system (single channel) with aeration for
tissue-engineered constructs (C) 24 well plate-based modular bioreactor (medorex) for miniaturized constructs that permits the use of
pipetting robots and standard plate readers (D) Flow chamber equipped with electrodes for stimulation.
Table 1(abstract P87) Bioreactor configuration and applications
Bioreactor design
Potential applications
Example
I.
Single channel, 6 variable culture inserts for 3D
scaffolds transparent cover plate
active aeration
Long term cultivation of 3D tissue constructs under flow
conditions,
tissue cultivation on implantable biomaterials
Cultivation of
cartilage-carrier
constructs [2]
II.
4 flow channels for perfusion 24 well plate layout
Simultaneous cultivation of four 3D constructs per channel, 4
inserts for 3D scaffolds surface aeration gas supply from channels available, separate functional tests can be carried out
humidified incubator
on single constructs
3D cultures of liver
cells [3], biomaterial
testing
III. As (II), transparent bottom plate for microscopy flow
channels instead of separate wells
Cultivation of shear-responsive cells, integration of biomaterials Cultivation of sweatpossible (e.g. a collagen membrane)
gland associated cells
(current)
IV. As (II) plus integrated of electrodes for electrical
stimulation and impedance measurement
Electrical stimulation of cell growth and orientation, impedance Orientation of mitotic
measurement of cell viability
axis [5]
plate was realized in a transparent material for microscopy. The frequency
of unipolar pulses can be varied between 16 Hz and 2 kHz, the voltage
between 0 up to 600 mV and stimulation pulse to pause ratios between
1:1, 1:10 and 1:100
Conclusions: The flow chamber concept and its different modifications
can be applied as an easily applicable and versatile tool for advanced cell
culture models. The 24 well design is suitable for application in a
standard cell culture lab without special bioreactor equipment: For
medium supply, standard peristaltic pumps with 4 channels can be used.
The bottom plate can be handled in a similar way as 24 well plates
allowing for adaptation of standard assays to long-term 3D cultures,
electrically stimulated cells, or primary cells cultivated on membranes
consisting of various biomaterials.
References
1. Pörtner R, Goepfert C, Wiegandt K, Janssen R, Ilinich E, Paetzhold H,
Eisenbarth E, Morlock M: Technical Strategies to Improve Tissue
Engineering of Cartilage Carrier Constructs - A Case Study. Adv Biochem
Eng/Biotechnol 2009, 112:145-182.
2. Nagel-Heyer S, Goepfert Ch, Adamietz P, Meenen NM, Petersen JP,
Pörtner R: Flow-chamber bioreactor culture for generation of threedimensional cartilage-carrier-constructs. Bioproc Biosyst Eng 2005,
27:273-280.
3. Goepfert C, Scheurer W, Rohn S, Rathjen B, Meyer S, Dittmann A,
Wiegandt K, Janßen R, Pörtner R: 3D-Bioreactor culture of human
hepatoma cell line HepG2 as a promising tool for in vitro substance
testing. BMC Proceedings 2011, 5:P61.
4.
5.
Starbird R, Krautschneider W, Blume G, Bauhofer W: In Vitro
Biocompatibility Study and Electrical Properties of the PEDOT, PEDOT
Collagen-Coat, PEDOT Nanotubes and PEDOT Aerogels for Neural
Electrodes. Biomedical Engineering (BioMed 2013) Proceedings Innsbruck,
Austria 2013.
Saß W, Blume G, Faschian R, Goepfert C, Müller J: Wachstumsstimulation
von Fibroblasten mit Platin/PEDOT Elektroden auf hochflexiblen Folien.
Mikrosystemtechnik Kongress VDE VERLAG BerlinBMBF; VDE; GMM; VDI/VDE-IT
2012, ISBN 978-3-8007-3367-5.
P88
Platform process will give platform product - Can we afford it?
Rohit Diwakar*, Sunaina Prabhu, Lavanya C Rao, Janani Kanakaraj, Kriti Shukla,
Saravanan Desan, Dinesh Baskar, Ankur Bhatnagar, Anuj Goel
Cell Culture Lab, Biocon Research Limited, Bangalore, India
Introduction: Manufacturing processes for therapeutic monoclonal
antibodies (mAbs) have evolved immensely in the past two decades
around two major thrust areas.
1) Advancements in a) Cell line development-breakthrough and
incremental knowledge gain in technology b) Media and feed formulation
strategies c) Advent of Disposables and Instrumentation technologies thus
offering significant improvements to Process Development (PD).
2) Establishment of platform processes to leverage faster PD [1,2].
A platform process generally consists of a standard i) Cell line development
technique, ii) Basal medium and feeds, iii) Process parameters and scale-up
Page 115 of 151
approach. The biggest advantage of using the platform process for the PD
group is in expediting the project timelines. The platform approach also
benefits from well-established and validated work flows in Manufacturing,
QA, QC and Supply-chain groups.
Certain disadvantages have also been cited for the platform approach. For
example, modifications in the platform process are generally discouraged
due to time, cost and efforts required in accommodating such changes.
Also, as process conditions can substantially impact the product quality
(PQ) attributes, a platform approach does not allow any significant
changes in the PQ attributes, if desired.
Materials and methods: In this study, CHO cell lines were cultured in
chemically defined medium. Experiments were carried out in 2L stirred
tank bioreactors and 125mL shake flasks running at 140 rpm in 5% CO2
controlled incubator shaker. Cell count and viability were determined
using haemocytometer. Lactate, glucose, osmolality and IgG concentration
was also estimated along with glycosylation profiling.
Results and discussion: Case 1: Multiple cell lines developed using
same technology expressing different mAbs: Using the same cloning
technology, cell lines expressing mAbs 1-4 were developed. These cell
lines when run with the platform process showed very similar growth, titer
and glycosylation profiles. Glycan profile thus produced is represented as
three species; type I, II and III.
The advantage of platform process was evident from the similarity of glycan
profiles achieved in all the mAbs run with this process. However, for mAbs 3
and 4, the target glycan profile was significantly different. The platform
process gave 20-30% higher glycan type 1 than the respective targets. In
order to match the targeted glycan profile, a few changes were made:
i) mAb 3: New feed introduced to reduce glycan type 1; feeding
strategy was optimized during PD.
Figure 1(abstract P88) (Clockwise direction) a) Viability comparison between control (mAb1-4) and mAb5 and 6. b) Viability comparison between
platform and modified process for mAb5 and 6. c) Cell count comparison and d) Lactate comparison between cell line technology 1 and 2. As expected,
PQ profiles between these two clones were very different.
ii) mAb 4: In addition to feeding strategy used for mAb3, changes in
process parameter (pH and DO) set-points were done to achieve
desired glycosylation profiles.
Case 2: Difference in lead clone selection criteria - growth vs.
specific productivity: Clone selection is done by ranking the clones
based on parameters such as cell growth, titer, specific productivity (PCD)
and PQ. In this study, the lead clones were shortlisted based on different
strategies. For mAbs 1-4, the lead clone was shortlisted based on cell
growth and titer as dominant selection criteria. For mAbs 5 and 6, PCD was
the dominant selection criterion. The other aspects of the cloning
technique were same in all cell lines.
When lead clones for mAb 5 and 6 were run in platform process they
showed poor growth characteristics (Figure 1a). The early drop in viability
made these clones unfit for a manufacturing process. Changes in the
platform process were attempted to overcome this manufacturing concern:
i) mAb 5: Culture longevity was increased by restricting cell growth. This
was achieved by reducing nutrient levels in the production medium.
ii) mAb 6: Lactate and ammonia accumulation was reduced by
optimizing medium/feed composition and pH, DO control ranges.
The modified processes significantly improved the culture longevity and
viability profiles, making them suitable for manufacturing (Figure 1b).
Case 3: Cell lines expressing the same mAb developed using
different technology: Two cloning technologies, 1 and 2 were used to
develop clones expressing the same mAb. The major differences in the
technologies were i) host cell lines ii) design of vector and its mechanism
in the genome. Both cell lines were run with the same platform process
and a two-fold difference in cell count was observed between them
(Figure 1c). The lactate levels were also markedly different (Figure 1d),
possibly indicating differences in nutrient metabolism. The lactate
differences also reflected in the pH profiles.
Summary: Case 1: The use of platform process enabled accelerated PD
from cell culture perspective. However, accommodating the specific PQ
requirements resulted in extended process development, affecting timelines.
Case 2: Change in clone selection criteria was observed to significantly
impact culture performance while applying platform process. This almost
resulted in rejection of these clones, thus extending PD timelines. This
was prevented by modifying the platform process.
Case 3: Clones developed using different cloning technologies when run
with the platform process resulted in different cell culture and PQ
profiles. Therefore, the type of cloning technique forms an integral part
of the platform process.
Though platform process was not suitable in most of the cases discussed
here, it still offers advantages like expedited project timelines and
established work flows. These benefits were achieved by establishing four
versions of the platform process to meet the varied cell culture and PQ
requirements. Based on the cell line characteristics and target PQ profiles,
the appropriate version is chosen to initiate PD. These versions retained the
major advantages of the platform process such as having common media
and feeds with only changes in their concentrations and set point of main
process parameters to achieve desired PQ.
Acknowledgements: Cell Culture Lab - Ruchika Srivastava, Vana Raja S,
Chandrashekhar K.N
Characterization Lab - Varshini Priya, Laxmi Adhikari
Purification Lab - Shashank Sharma
References
1. Kelley B: Industrialization of mAb production technology. Landes
Biosciences 2009, 5:443-452, mAbs 1.
2. Li F, Vijayasankaran N, Shen A, Kiss R, Amanullah A: Cell culture processes for
monoclonal antibody production. Landes Biosciences 2010, 5:466-477, mAbs 2.
P89
Applications of biomass probe in PAT
Chandrashekhar K Nanjegowda, Nirmala K Ramappa, Pradeep V Ravichandran,
Deepak Vengovan, Saravanan Desan, Dinesh Baskar*, Ankur Bhatnagar, Anuj Goel
Cell Culture Lab, Biocon Research Limited, Bangalore, India
Page 116 of 151
Introduction: In biologics manufacturing, process consistency is essential to
produce the desired product quality over the product life cycle. Process
monitoring is an important tool to achieve consistency and robustness.
Typical process parameters monitored at upstream are viable cell
concentration (VCC), viability, titer, nutrient levels, waste metabolites,
osmolality, pH, DO and pCO2. Traditionally pH, DO and pCO2 are monitored
using online sensors while others are measured by offline sampling
methods. With recent advances in sensor technology, probes are now
available to reliably estimate some of these parameters online. One such
tool is biomass probe which estimates VCC by measuring capacitance in the
bioreactor. In this work two cases are presented where biomass probe has
advantages over traditional offline sampling and can be used as an effective
PAT tool to monitor and improve process consistency and robustness.
Experimental Approach: CHO and NS0 cell lines were used to run fed
batch (70L) and perfusion (1KL) runs. The perfusion bioreactor used two
Spin filters (SF) as cell retention device that could be switched when
required. Biomass probe readings were compared to the VCC estimated
by offline sampling.
Results and discussions: In Fed Batch runs, offline and online VCC values
were very comparable during the initial days of the run and deviated with
increased process duration and drop in cell viability. In the Perfusion Batch,
the offline and online VCC values were comparable throughout the run.
The current work focusses on the phases where online biomass probe
can be reliably used to improve efficiencies of both Fed Batch and
Perfusion processes.
Case 1: Improving process efficiency in Fed batch: Inoculum
propagation and transfer: Inoculum plays a critical role in the process
performance; therefore inoculum consistency is very important. Inoculum
development step requires cells to be transferred to the next stage while
they are in the exponential phase. This is normally done by sampling the
seed bioreactors, measuring the cell counts and transferring cells to the
next stage.
As this requires sampling for cell counting, due to rapid cell growth in this
phase, generally a wide range of acceptable cell concentration is given for
practical reasons. Although during this broad range of acceptable cell
concentration, cells are in their exponential phase, the volume of inoculum
added into the bioreactor changes the spent media ratio inside the
production bioreactor considerably.
By measuring VCC online using a biomass probe, it was possible to transfer
the inoculum at much precise cell concentration thus achieving consistent
volumetric inoculum ratios in production bioreactor (Figure 1a).This resulted
in an improved consistency in the cell culture profiles of the production run.
Feeding based on online VCC measurements: A Fed Batch process
requires frequent additions of nutrient feeds to the bioreactor. These feeds
are generally added either by sampling and measuring concentrations of
residual nutrients or based on predefined culture time intervals. By feeding
based on fixed culture duration, nutrients are added at same age but at
different cell concentration. Feeding based on biomass probe readings
helped in maintaining the nutrients as per VCC, thus preventing
accumulation or depletion of nutrients in the process and eliminating batchto-batch variations (Figure 1b).
Case 2: Improving process efficiency in Perfusion: In our process, loss
in cell-retention in the perfusion device led to decrease in cell conc. and
productivity. By monitoring retention continuously, corrective actions
could be taken to reduce these losses. Introducing a biomass probe in the
perfusate line overcame operational constraints of frequent sampling to
monitor retention efficiency.
Effective switching of the retention filters: As the SF clogs, there is a
drop in perfusate volume being drawn from the filter, which results in
pressure drop in the harvest line. Whenever the line pressure drops
significantly, the perfusion is switched to the other filter. Calculations show
reduction in retention efficiency of the filters from about 90% to 50%
(Figure 1c). This reduction indicates cell loss through the filter resulting in
significant drop in bioreactor VCC (Figure 1d).
To prevent a significant loss of cells from the bioreactor, it was decided to
switch the filter by monitoring the retention by biomass probe in the
perfusate line. Two biomass probes were inserted in the bioreactor and
the perfusion outlet to measure the bioreactor cell concentration and the
cells lost through the filter during perfusion. The filter was switched when
the retention efficiency drop below 70%. This helped in preventing
significant loss of viable cells from the bioreactor due to cell leakage
through filters.
Page 117 of 151
Figure 1(abstract P89) (In clockwise direction) a) Inoculum transfer range using offline (±15%) and online (±5%) VCC measurements. b) Feeding
strategy comparison based on time and online probe readings c) Profiles of batches comparing N. VCC (Normalized VCC) and N. VVD. d) Drop in cell
retention leading to increased cell leakage through the filter.
Effective control of perfusion rates: The perfusion rate in a perfusion
run is generally reported as VVD (volume of medium perfused per
bioreactor volume per day). As the VCC in the bioreactor increases, VVD is
increased to provide additional nutrients for the cells. Although increase in
VVD favours higher cell concentration, a drop in bioreactor VCC is also
seen occasionally at higher VVD (Figure 1d, batch 1). Upon investigation it
was evident that in these cases when VVD was increased, cell
concentration in the bioreactor decreased due to increased cell leakage
through the filters. Hence it was decided to control the VVD based on cell
retention values. The VVD in the batch 2 was gradually increased
considering the retention efficiency of the filter. A higher VCC was
obtained in this batch compared to batch 1 even at lower VVD, due to
lower cell loss through the filters.
Summary: In the current study, effective use of biomass probe was
demonstrated in applications ranging from direct measurement of VCC to
indirect applications during perfusion. The probe can be used for these and
similar applications as an effective PAT tool to improve process consistency
and robustness.
Acknowledgements: Manufacturing team: Jiju Kumar, Raghu S,
Kathiravan N, Santoshkumar Guddad
Cell culture lab: Rohit Diwakar, Kriti Shukla, Vana Raja S, Abdul Waheed,
Janani Kanakaraj.
P90
Understanding cell behavior in cultivation processes - A metabolic
approach
Jonas Aretz1, Tobias Thüte1, Sebastian Scholz1, Klaudia Kersting1,
Thomas Noll1,2, Heino Büntemeyer1*
1
Institute of Cell Culture Technology, Bielefeld University, Bielefeld, Germany;
2
Center for Biotechnology (CeBiTec), Bielefeld University, Bielefeld, Germany
Background: During cultivation cells undergo a tremendous change in
their metabolism when shifting from one state to another or when
parameters are changed. To understand the changes in intracellular
metabolite concentrations and their impact on cell performance we used a
systematic approach. By employing the chemostat mode at different
steady state conditions we investigated the alterations of the
concentrations of key metabolites during cultivations of a human
production cell line.
Methods: Chemostat cultivations were performed with the AGE1.hn AAT
cell line (Probiogen AG, Berlin, Germany) and TC-42 medium (Teutocell AG,
Bielefeld, Germany) in a fully controlled 2 litre benchtop bioreactor
(Sartorius, Göttingen, Germany). Different dilution rates of 0.24 d-1, 0.33 d-1,
and 0.40 d-1 and pH values of pH 6.9, pH 7.15, and pH 7.3 were performed
using the same bioreactor setup. For stopping the cell metabolism an
established fast filtration method [1] was used for rapid quenching.
Metabolites were extracted from cells using liquid/liquid extraction. Extracts
were analyzed by using hydrophilic interaction chromatography (HILIC) and
ESI-MS/MS mass spectometry. Extracellular amino acids and pyruvate were
analyzed by pre-column derivatization and RP-HPLC [2], glucose and lactate
using a YSI 2700 bioanalyser.
Results: The comparative analysis of the three steady state dilution rates
shows the great impact of changing extracellular conditions on the
intracellular metabolite pools which may also lead to an altered
productivity. For example, as been shown in Figure 1A the specific
pyruvate consumption rate, qPyr, as well as the intracellular pyruvate pools
decrease with increasing dilution rates, while qGlc and qGln increase at
the same time. While some metabolite pools show great differences
between different dilution rates others remain more or less constant.
A malonate inhibition of the TCA cycle (Figure 1B) appears mainly at low
dilution rates, which might be an effect of glucose and/or glutamine
limitation at those steady states.
Although qGlc, qPyr as well as qGln decrease with increasing pH values
(data not shown), the intracellular TCA pools remain constant due to a
catabolism of further amino acids (Table 1). This may have led to a lower
waste of ammonia, lactate and glycine at higher pH values.
The analysis of the intracellular nucleotide pools show that while the
concentrations of almost all nucleotides dropped with increasing dilution
rates, they were more or less stable at changing pH values (data not
shown).
Page 118 of 151
Figure 1(abstract P90) Metabolite pool sizes in Glycolysis (A) and TCA (B) at different dilution rates. The metabolism at the three different
dilution rates 0,24 d-1 (left), 0,33 d-1 (middle), 0,4 d-1 (right) is shown. Specific rates are illustrated with filled bars and given in nmol cell-1 d-1.
Stripped bars illustrate pool sizes which are given in mM (extracellular) and μM (intracellular), respectively.
Conclusions: Although more data have to be raised to get a comprehensive
insight into cell metabolism it could be shown that chemostat cultures
performed at steady state conditions are a valuable tool for investigating cell
behaviour on an intracellular basis. A much better data stability can be
obtained than in batch or fed-batch cultures.
Acknowledgements: Funding by the BMBF, Germany, Grand Nr.
0315275A is gratefully acknowledged.
References
1. Volmer M, Northoff S, Scholz S, Thüte T, Büntemeyer H, Noll T: Fast
filtration for metabolome sampling of suspended animal cells. Appl
Microbiol Biotechnol 2011, 94:659-671.
2. Büntemeyer H: Methods for off-line analysis in animal cell culture.
Encyclopedia of Industrial Biotechnology. Bioprocess, Bioseparation, and Cell
Technology New York: Wiley: Flickinger M 2010.
Table 1(abstract P90) Correlation of specific rates qxxx
with the adjusted pH values during steady state
qNH3
pH 6,9
pH 7,15
pH 7,3
430 ± 27
243 ± 9
207 ± 19
qLac
4751 ± 298
3766 ± 143
3548 ± 325
qGlc
qPyr
- 3660 ± 230
- 155 ± 10
- 3302 ± 126
- 121 ± 5
- 3301 ± 302
-84 ± 8
qGln
- 527 ± 33
- 488 ± 19
- 484 ± 44
qAsp
- 63 ± 4
- 123 ± 5
-153 ± 14
qGlu
66 ± 4
29 ± 1
- 16 ±2
qAsn
- 17 ±1
- 42 ± 2
-45 ± 4
qSer
-91 ± 6
-198 ± 8
- 191 ± 17
qHis
- 13 ± 1
- 23 ± 1
-5 ± 1
qGly
qThr
32 ± 2
- 26 ± 2
9±0
61 ± 2
7±1
67 ± 6
qArg
- 39 ±2
- 97 ± 4
- 109 ± 10
qAla
101 ± 6
48 ± 2
99 ± 9
qTyr
- 10 ± 1
-29 ± 1
29 ± 2
qMet
-20 ± 1
-39 ± 2
- 40 ± 4
qVal
-37 ± 2
-79 ± 3
- 88 ± 8
qTrp
-5±0
-8±0
-9±1
qPhe
qIle
- 10 ± 1
- 35 ± 2
-36 ± 1
- 68 ± 3
-36 ± 3
- 72 ± 7
qLeu
- 63 ± 4
-111 ± 4
-122 ± 11
qLys
- 21 ± 1
- 89 ± 3
- 100 ± 9
The specific rates are given in pmol cell-1 d-1. (Negative values indicate
consumed metabolites.)
P91
Engineering characterisation of single-use bioreactor technology for
mammalian cell culture applications
Akinlolu Odeleye*, Gary J Lye, Martina Micheletti
Department of Biochemical Engineering, University College London, London,
WC1E 7JE, UK
Background: The commercial success of mammalian cell-derived
recombinant proteins has fostered an increase in demand for novel
single-use bioreactor (SUB) systems, that facilitate greater productivity,
increased flexibility and reduced costs. Whilst maintaining auspicious
mixing parameters, these systems exhibit fluid flow regimes unlike those
encountered in traditional glass/stainless steel bioreactors. With such
disparate mixing environments between SUBs currently on the market,
the traditional scale-up procedures applied to stirred tank reactors (STRs)
are not adequate. The aim of this work is to conduct a fundamental
investigation into the hydrodynamics of single-use bioreactors at
laboratory scale to understand its impact upon the growth, metabolic
activity and protein productivity of an antibody-producing mammalian
cell culture.
Materials and methods: This work presents a study characterising the
macro-mixing, fluid flow pattern, turbulent kinetic energy (TKE), energy
dissipation rates (EDRs), and shear stresses within these bioreactor
systems carried out using 2-dimensional Particle Image Velocimetry (PIV).
PIV enables acquisition of whole-field flow characteristics through
instantaneous velocity measurements. The SUBs employed in the PIV
measurements include the 3L CellReady (Merck Millipore), PBS Biotech’s
PBS 3 bioreactor and the Sartorius 2L BIOSTAT Cultibag RM.
The CellReady is a stirred tank bioreactor (3 litre volume), housing a 3-bladed
upward-pumping marine scoping impeller. The PIV study was conducted
Page 119 of 151
using the actual vessel which has an internal diameter (DT) of 137 mm and
height (HT ) of 249 mm. The marine scoping impeller (DI) is 76.2 mm in
diameter and is located near the bottom with a clearance of 30mm from the
base. Measurements were obtained at varying impeller rates from 80 to
350rpm (corresponding to Re = 8699 to 38057). The PBS 3 is a pneumatically
driven bioreactor (3 litre volume) whose mixing is induced through the
buoyancy of bubbles. PIV measurements were again obtained utilising the
actual PBS 3 vessel in the central vertical plane of the bioreactor at wheel
speeds of 20, 27, 33 and 38rpm. The Sartorius Cultibag RM is a rocked bag
bioreactor with a 2 litre total volume. A custom-made Sartorius Cultibag
mimic and rocking platform was manufactured to enable the required
optical access for PIV investigations. Measurements were taken at a rocking
speed of 25 rpm, in the vertical plane 8.5cm from the outer edge of the
bioreactor. Fluid working volume (wv) was varied at 30, 40, 50 and 60% wv.
A biological study into the impact of these fluid dynamic characteristics
on mammalian cell culture performance and behaviour is presented.
CellReady and Cultibag cell cultures were conducted using the GS-CHO
cell-line (Lonza) producing an IgG4 (B72.3) antibody. The impeller speed
and working volume are used to vary the hydrodynamic environment
within the CellReady, whilst the rocker speed is the varied parameter in
the Cultibag RM.
Results and discussion: The upward-pumping 3-bladed impeller within
the CellReady engenders compartmentalisation of the fluid flow. This in
turn contributes to the wide range of turbulence levels conveyed between
the lower quarter and upper three quarters of the fluid. The maximum
fluid velocity of 0.25Utip is achieved in the impeller discharge stream (at
approximately r/R = 0.65 and z/H = 0.15) as shown in Figure 1, whilst the
peak axial and radial turbulent velocities (ũ) are 0.15U tip and 0.11U tip
respectively.
Disparity in cellular growth and viability throughout a range of CellReady
operating conditions (80 rpm-2.4L, 200rpm-2.4L and 350 rpm-1L) was not
substantial, although a significant reduction in cell specific productivity
was found at 350 rpm and 1L working volume. This is considered to be the
most stressful hydrodynamic environment tested. Cells grown at these
conditions displayed a metabolic shift from lactate production to net
lactate consumption, without a reduction in glucose uptake. A possible
reason for these observations is increased oxidative stress resulting from
the higher agitation rate and gas entrainment [1,2].
The PBS exhibits a greater degree of fluid dynamic homogeneity when
compared to the CellReady. Although, TKE is more than 10 times lower
than values observed in the CellReady’s impeller zone (which ranges from
0.0026 to 0.0455 m2/s2 at the varying impeller rates tested). Whilst TKE in
the PBS peaks at approximately 0.0022 m 2 /m 2 with a wheel speed of
38 rpm, the fluid attains velocities of up to 50% of the PBS wheel speed.
This corresponds to velocities of up to 15 cm/s, which is within a similar
range to the values observed in the CellReady.
The Sartorius RM induces fluid velocities of up to 37 cm/s at 25 rpm,
although fluid velocity and turbulence is dominated by the radial
component. EDR and TKE remain relatively low at 25 rpm, with mean wholefield ensemble-averaged values of up to 0.0044 m2/s3 and 0.0020 m2/s2
respectively. These measurements are significantly lower than the mean EDR
values of 0.0052 to 0.14 m2/s3 (over the RPM range of N = 80 to 350 rpm)
determined in the upper three quarters of the CellReady alone. Cellular
response to an increase in turbulence within the rocked bag bioreactor
(25 to 42rpm), results in an increase in stationary phase viable cell
concentration (VCC) of 20%. In addition, cell metabolic activity and cell
specific protein productivity remains relatively unchanged. The augmented
homogeneity and consistency in reference to turbulence and shear stresses
within the Sartorius RM may enable the cells to adapt to the more rigorous
mixing, thus maintaining cell specific productivity as well as enhancing VCC.
Also, cells grown in the Sartorius RM exhibit more than 60% greater cell
specific productivity levels and up to 37% greater IgG4 titres compared to
those grown in the CellReady. Even though IgG 4 productivity increases
within the Cultibag, investigations into product quality are necessary.
Given the shifts seen in metabolic behaviour and cell specific productivity, it
can be concluded that the fluid dynamic environment will impact upon
cellular performance. Clearly, the range of EDRs and TKEs experienced by
the culture is just as pertinent as the peak turbulence levels. Therefore,
determining the critical hydrodynamic parameters applicable to the
different flow regimes found in SUBs, will enable greater cross-compatibility
and scalability across the range of SUBs.
Page 120 of 151
Figure 1(abstract P91) a) Time-resolved mean normalized velocity contour plot obtained at N = 200rpm, Re = 21747, VL = 2.4 L. b) Time-resolved
turbulent velocity ( ũij) contour plot obtained at N = 200rpm, Re = 21747, VL = 2.4 L. Resolution of 0.815mm.
References
1. Mckenna T: Oxidative stress on mammalian cell cultures during
recombinant protein expression. Linkoping University Institute of
Technology 2009, 10.
2. Sengupta N, Rose ST, Morgan J: Metabolic flux analysis of CHO cell
metabolism in the late non-growth phase. Biotechnol Bioeng 2011,
108:82-92.
P92
Enhancing cell growth and antibody production in CHO cells by siRNA
knockdown of novel target genes
Sandra Klausing1*, Oliver Krämer1, Thomas Noll1,2
1
Institute of Cell Culture Technology, Bielefeld University, Bielefeld, Germany;
2
Center for Biotechnology (CeBiTec), Bielefeld, Germany
Background: Seven out of the ten top-selling biopharmaceuticals in 2011
are produced in Chinese Hamster Ovary (CHO) cells [1]. This tremendous
commercial interest makes the development and application of strategies
for cell line optimization, like gene overexpression or knockdown to
enhance cell specific productivity and cellular growth, highly interesting. In
this work, we investigated the knockdown effect of novel target genes by
siRNA as a powerful tool for CHO cell line engineering.
Materials and methods: CHO DP-12 cells (clone #1934, ATCC CRL-12445)
were used as a model cell line, producing an anti IL-8 antibody. Cultivations
were performed in 125 mL shaking flasks at 37 °C, 5% CO2, 185 rpm and
5 cm shaker orbit. For fed-batch processes, TCx2D feed supplement
(TeutoCell AG) and a predefined feeding regime were applied identically for
all cultures. Viable cell densities (vcd) and cell viability were measured by a
Cedex Sytem (Innovatis). Monoclonal antibody (mAb) concentrations were
determined via HPLC and a protein A column (Life Technologies).
Target genes were chosen based on well-known signaling pathways (e.g.
apoptosis, cell cycle or histone modification) as well as from previous results
of a CHO cDNA microarray [2]. Mediators of apoptosis Bad and JNK were
chosen as target genes for evaluation after knockdown, as well as Set, a
protein involved in histone modification. Mcm5 is involved in DNA
replication but its regulative role is not completely understood. Finally,
knockdown of target gene P (patent pending) was investigated. Short
hairpin RNA (shRNA) sequences were designed and cloned into a shRNA
expression vector which was stably introduced into CHO DP-12 cells via
lentiviral gene delivery. After selection with 5 μg/mL puromycin, successful
siRNA-mediated mRNA knockdown (kd) of the target gene was verified by
quantitative real-time PCR (qPCR). Transduced cell pools were evaluated in
batch and fed-batch shaker cultivations with regard to growth performance
and antibody productivity.
Results: Through siRNA-mediated RNA interference, a high stable gene
knockdown in the cell pools was achieved for target gene Set, JNK, Bad and
P. Transcript levels were reduced by 57% (knockdown of JNK) up to 93%
(knockdown of P), as shown in Figure 1A. Due to the procedure of lentiviral
infection and puromycin selection, a slight variation in transcript levels of
some target genes was observed even for an empty vector control cell pool
in comparison to untreated CHO DP-12 cells. Unexpectedly, despite
genomic integration of Mcm5-targeting shRNA, Mcm5 transcription was
found to be up-regulated in two separate measurements of the respective
cell pool.
In batch shaker cultivations, all cells with a stable vector integration
exhibited higher maximum vcds, compared to the untreated CHO DP-12
culture. Cells with a stable knockdown of apoptosis mediator Bad reached
the highest vcd with 121·105 cells/mL. However, final antibody titers did
not exceed the titer of the empty vector control cell pool (data not shown).
Fed-batch shaker cultivation increased maximum cell densities as well as
process duration and revealed a strong influence of siRNA mediated gene
knockdown (Figure 1B and C). The maximum vcd was increased for cells
with stable expression of a shRNA targeting JNK (by 23%), Bad (by 44%),
Mcm5 (by 45%) and P (by 74%) compared to empty vector control cells. In
comparison to this control cell pool, maximum mAb titer was higher for cell
pools JNK-kd, Mcm5-kd and P-kd. Mean cell specific productivity between
day 4 and day 8 of the cultivation was increased in cell pools Set-kd as well
as P-kd. The highest mAb titer of 456 mg/L was detected for cells with a
stable knockdown of gene P.
Conclusions: siRNA knockdown of target genes is an effective tool for
CHO cell engineering in order to achieve higher viable cell densities and
mAb titers. The stable transduction of shRNA targeting Mcm5 resulted in a
slight increase of the transcript level, nevertheless, vcd and product titer
were enhanced. This effect will be further analyzed. Knockdown of target
gene P led to increased vcd in fed-batch cultivation (by 123%), higher
Page 121 of 151
Figure 1(abstract P92) (A) Relative mRNA ratio of target genes in cell pools with stable shRNA expression and the empty vector control cell pool
compared to untreated CHO DP-12 cells. (B) Viable cell density and viability during fed-batch shaker cultivation of cell pools and untreated cells. (C)
Maximum mAb titer and mean cell specific productivity (csp) between day 4 and 8 for all cultures in fed-batch cultivation.
maximum mAb titer (by 159%) and higher csp between day 4 and 8 (by
70%), compared to untreated CHO DP-12 cells, which makes this target
gene a highly interesting candidate for cell line engineering. Stable
transduction with an empty vector also influenced cellular behavior of the
control cell pool compared to untreated CHO DP-12 cells. This is likely due
to the random integration of the transfer vector and a selection for more
robust and faster growing cells during the procedure of lentiviral infection
and puromycin selection. Further reasons are under investigation. Single
cell clone isolation for the presented cell pools will most likely result in
further improvements of viable cell density and product titer.
References
1. Huggett B, Lähteenmaki R: Public biotech 2011 - the numbers. Nature
Biotechnology 2012, 30:751-757.
2. Klausing S, Krämer O, Noll T: Bioreactor cultivation of CHO DP-12 cells
under sodium butyrate treatment - comparative transcriptome analysis
with CHO cDNA microarrays. BMC Proceedings 2011, 5(Suppl 8):P98.
P93
Skin and hair-on-a-chip: Hair and skin assembly versus native skin
maintenance in a chip-based perfusion system
Ilka Wagner1*, Beren Atac1, Gerd Lindner1, Reyk Horland1, Matthias Busek1,
Frank Sonntag2, Udo Klotzbach2, Alexander Thomas1, Roland Lauster1,
Uwe Marx1
1
Technische Universität Berlin - Berlin, Germany; 2Fraunhofer IWS - Dresden,
Germany
Background and novelty: In recent decades, substantial progress to
mimic structures and complex functions of human skin in the form of skin
equivalents has been achieved. Different approaches to generate functional
skin models were made possible by the use of improved bioreactor
technologies and advanced tissue engineering. Although various forms of
skin models are successfully being used in clinical applications, in basic
research, current systems still lack essential physiological properties for
toxicity testing and compound screening (such as for the REACH program)
and are not suitable for high-throughput processes.
Experimental approach: In particular, further bioengineering is necessary
for the implementation of adipose tissue, hair follicles and a functional
vascular network into these models. In addition, miniaturization, nutrient
and oxygen supply, and online monitoring systems have to be implemented
in sophisticated culture systems. To become one step closer to the in vivo
situation, we produced microfollicles as in vitro hair equivalents and
integrated them into skin models. These microfollicles containing skin
tissues were cultured under static and dynamically perfused conditions and
were compared to ex vivo scalp and foreskin skin organ cultures. Dynamic
cultivation was performed in our Multi-Organ-Chip system (Figure 1 A).
Results and discussion: The formation of functional neopapillae needs
more than 48 hours. After the addition of keratinocytes and melanocytes,
the self-organizing microorganoids follow a stringent pattern of follicularlike formation by generating polarized segments, sheath formations and
the production of a hair shaft-like fiber. We show that the de novo
formation of human microfollicles in vitro is accompanied by basic hair
follicle like characteristics. The microfollicles can be used to study
mesenchymal-epithelial-neuroectodermal interactions and for the in vitro
testing of hair growth-modulating substances and pigmentary effects. As
the hair follicle is highly vascularized, it supports penetration of substances
into the skin and further into the bloodstream. Testing of topically applied
substances might therefore be performed with significantly enhanced
validity by the incorporation of a microfollicle into a dynamic chip-based
bioreactor containing a skin equivalent which mimics a physiological
penetration route. Commercially available skin equivalent EpiDermFT were
cultured in the Multi-Organ-Chip for 7 days with subcuteaneous tissue and
showed better viability and comparable histological results to native skin
(Figure 1 C-J). Cellular and nutritional effect of the subcueaneous tissue is
visible even under static conditions. Presence of subcuteaneous tissue
decreased the expression of Tenascin C in dermis which is a marker for
inflamation and fibrosis. Integritiy of the epidermis and proliferating cells
in epidermis kept prominently in combined tissues. Figure 1 B showes the
staining of a skin equivalent with an successfully inserted microfollicle.
Conclusion: Perfusion of the combined tissue provides better integration
and associated to viability of the subcuteaneous tissue. In general, presence
of subcutaneous tissue increased the longevity of the in vitro skin equivalent
in both static and especially in Multi-Organ-Chip cultures with improved
tissue architecture. A skin equivalent with integrated microfollicles and
Page 122 of 151
Figure 1(abstract P93) Microfluidic device for perfused skin equivalent culture and integrated Microfollicle (A) Dynamic chip-based bioreactor
for continuous perfusion culture of skin equivalents with integrated microfollicles. (B) PanCytokeratin immunoflourescent staining of a skin
equivalent with an inserted microfollicle. (C-J) In vitro skin equivalents (MatTek) cultured for 7 days in MOC or static conditions with and without
subcutaneous tissue (SCT) and compared to ex vivo foreskin. (C-F) H&E staining and (G-J) immunofluorescence staining for epidermal markers Cytokeratin
10 and 15. Dashed lines mark the border between the skin equivalent and the subecuteaneous tissue. Scale bars indicate 100 μm.
subcutaneous tissue under dynamic perfusion will be the most suitable
model for long-term cultivation and more efficient drug studies and one
step closer to mimic in vivo skin.
P94
2D fluorescence spectroscopy for real-time aggregation monitoring in
upstream processing
Karen Schwab*, Friedemann Hesse
Institute of Applied Biotechnology, University of Applied Science Biberach,
88400 Germany
Introduction: Product aggregation is one side effect of rising yields due to
process improvement and therefore accompanied with massive product
loss during downstream processing (DSP). But it is already in literature
described, that product aggregation also occurs during the fermentation
process and is caused by various process operations [1]. Real-time
bioprocess monitoring and thus on-line product quality control during
upstream processing (USP) enables to address this issue during process
development. For bioprocess control, 2D fluorescence spectroscopy in
combination with chemometric modeling based on fluorescence signals
derived from cells and medium components is a promising tool and
described in literature [2]. Furthermore extrinsic fluorescence dyes are
widely used to detect and quantify aggregated protein [3]. In this study,
2D fluorescence spectroscopy in combination with three different extrinsic
fluorescence dyes were evaluated, in order to establish a process control
tool which enables real-time product control during USP.
Materials and methods: A CHO DG44 cell line producing a monoclonal
antibody (mAb) was cultivated in a 2 liter bioreactor (Sartorius AG) in
fed-batch mode. Metabolites and substrate concentrations were determined using Konelab 20XT (Thermo Scientific) and cell concentration and
viability via CEDEX XS system (Innovartis-Roche AG). The product titer was
determined with protein-A HPLC. Furthermore, culture supernatant samples
were applied to the size exclusion column Yarra S4000 (Phenomenex) after
filtration. The intrinsic fluorescence signal at 355nm was recorded with a
fluorescence detector (Gynkotek), in order to determine the monomer to
aggregate ratio in the sample. Samples were taken twice a day and
incubated with ANS, bis-ANS and Thioflavin T at 3 different concentrations
respectively. Full 2D scans from 270nm to 590nm of these samples were
taken with the DELTA BioView® sensor. These scans were used as data
input for chemometric modeling, where the target data was the mAb
aggregate concentration.
Results: A common approach to analyze aggregated mAb in cell culture
comprises the isolation of the mAb by protein A HPLC subsequently
followed by size exclusion chromatography [1,4]. However, the capture step
itself may have an influence on product aggregation. Therefore, in this study
we tried to avoid the capture step by directly applying cell culture
supernatant onto the size exclusion column after a filtration step. The signal
derived from the cell culture medium and host cell proteins could be
separated from mAb monomer and aggregate signal (Figure 1D). This
allowed direct quantification of mAb aggregates in culture broth via size
exclusion chromatography (SEC). Fluorescent dyes such as ANS, and its
dimeric analogon 4,4’-bis-1-anilinonaphthalene-8-sulfonate (Bis-ANS) as well
as thioflavin T interact noncovalently with hydrophobic regions of the
aggregated protein [3]. To our knowledge, up to now these dyes were not
used as additives in mammalian cell cultures. Therefore, a major concern
was their toxicity towards the CHO production cell line. Toxicity screens in
microtiter plates (data not shown) revealed that already 4μM bis-ANS as well
as 4μM thioflavin T reduced the specific growth rate strongly. The in
literature reported concentrations for these dyes in DSP approaches [3] were
considerably higher hence their sensitivity limits in cell culture had to be
evaluated. In order to enable a direct comparison of fluorescence intensity
Page 123 of 151
Figure 1(abstract P94) PCA score plots for all Bis-ANS (A), thiovlavin T (B) and ANS (C) concentrations, where PC2 is displayed over PC1. T = 0
indicates data of 2D scans taken directly after inoculation. (D) SEC chromatogram of the intrinsic fluorescence emission signal at 355nm. Monomer, dimer
and oligomer fractions of mAb were detectable; furthermore a separation from the medium and host cell protein signal was possible.
Table 1(abstract P94) PLS results for selected dye concentrations used in the fed-batch fermentation experiment
Dye
PC’s
w/o dye
3
R-Square
RMSE
Offset
Slope
calibration data set
0.96
1.27
0.43
0.96
validation data set
0.72
3.62
2.75
0.70
2μM Bis-ANS
4
0.98
10.9
2.28
0.98
80μM ANS
4
validation data set
0.93
0.98
19.36
0.82
-4.20
0.18
0.97
0.98
validation data set
0.85
2.08
1.44
0.85
25μM Th T
2
0.99
5.18
0.52
0.99
validation data set
0.96
14.54
6.23
0.93
2D fluorescence scans were taken as x-data and the mAb aggregate concentration was used as target data for chemometric modeling. Validation data sets were
generated with cross validation.
increase generated by dye aggregate interaction, the DELTA BioView® sensor
was used at-line during the fed-batch fermentation. For chemometric
modeling, fluorescence maps were preprocessed by principal component
analysis (PCA), in order to capture the data input with the highest variance
over the cultivation time. PCA results indicated that the sensitivity of Bis-ANS
and ANS was very high towards aggregated mAb. Furthermore, increasing
Bis-ANS concentrations increased the score values of PC1 in general (Figure
1A), contrary to ANS where score values of PC2 increased (Figure 1C). For
thioflavin T score values differed greatly when low and high dye
concentrations were compared, starting at one point (Figure 1B).
Furthermore, the mAb aggregate titer was used as target for partial least
square regression (PLS) (Table 1) and resulting calibration and validation
models showed low root square mean error (RMSE) values as well as good
slopes and R-squares for ANS and Bis-ANS. Besides that, the chemometric
model computed with 2D scans taken from cell culture without additional
dye showed a slope of 0.7 and R-square value of 0.72 for the validation data
set. This indicated that the quality of the chemometic models seemed to be
improved when an additional fluorescence signal based on dye mAb
aggregate interaction was generated in the 2D scans. Moreover, only 25μM
thioflavin T enabled a solid calibration model (Table 1). This raised the
suspicion, that there might be only weak interactions of dye and aggregated
mAb. In consequence these preliminary results indicated, that thioflavin T
which is normally used for detection of fibrils seemed to be less favorable
for the detection of mAb aggregates.
Conclusions: Suitable fluorescence dye candidates were selected and
based on sensitivity and toxicity, ANS and Bis-ANS proved to be
promising candidates for further work. Direct quantification of mAb
aggregates in cell culture broth was possible with SE-HPLC based on the
intrinsic fluorescence of mAb. The fed-batch fermentation experiment,
where the DELTA BioView® sensor was used at-line, enabled a direct
comparison of different dye concentrations. Therefore, this experiment
demonstrated that for bis-ANS even lower concentrations than already
used might be applicable due to its high sensitivity towards mAb
aggregates. Moreover, the results indicated that product aggregation is
not only a side effect of rising titers, because mAb aggregates were also
present at early fermentations time points.
References
1. Gomez N, Subramanian J, Ouyang J, Nguyen M, Hutchinson M, Sharma V,
Lin A, Yu I: Culture temperature modulates aggregation of recombinant
antibody in CHO cells. Process Biochem 2012, 47:69-75.
2. Teixeira A, Portugal C, Carinhas N, Dias J, Crespo J, Alves P, Carrondo M,
Oliveira R: In situ 2D fluorometry and chemometric monitoring of
mammalian cell cultures. Biotechnol Bioeng 2009, 102:1098-1106.
3. Hawe A, Sutter M, Jiskoot W: Extrinsic fluorescent dyes as tools for
protein characterization. Pharm Res 2008, 25:1487-1499.
4. Jing Y, Borysa M, Nayakb S, Egana S, Qiana Y, Pana S, Li Z: Identification of
cell culture conditions to control protein aggregation of IgG fusion
proteins expressed in Chinese hamster ovary cells. Biotechnol Bioeng
2012, 109:125-136.
P95
Use of microcarriers in Mobius® CellReady bioreactors to support
growth of adherent cells
Michael McGlothlen*, Donghui Jing, Christopher Martin, Michael Phillips,
Robert Shaw
EMD Millipore Corporation, 80 Ashby Rd, Bedford MA 01730, USA
Mixing: Manufacturer specifications show Cytodex 3 ® and Solohill®
microcarriers to be similar in density and size. Working with this assumption,
mixing studies where performed using the Cytodex3® microcarriers in 3L
Mobius® CellReady and Solohill® Collagen coated in 50L single use
bioreactor to determine the slowest agitation speed or the just suspended
mixing power inputs (P/V)js, required to fully suspend the microcarriers so
that the beads are equally distributed in the bioreactor.
Microcarrier distribution was assessed by sampling the bioreactor at varying
depths. Then the dry weight of the microcarrier was used to determine the
% relative sample weight to the target weight.
Mixing Results: Data show the (P/V)js to be ~0.6W/m3 in both the 3L and
50L single use bioreactors
Page 124 of 151
100% distribution corresponds to the theoretical concentration of
microcarriers, which is 3g/L Cytodex3® in 3L bioreactor and 15g/L Solohill®
Collagen microcarriers in 50L bioreactor
Cell Growth: Initial cell culture runs were performed with MDCK and
Human Mesenchymal Stem Cells (hMSCs) to evaluate the bioreactor
agitation to support cell growth in the 3L Mobius® CellReady single use
bioreactor. The conditions that showed the best performance could then
scaled to the 50L Mobius® bioreactor.
1. Cultured MDCK cells on Cytodex3® microcarriers grew to a peak cell
density of ~1e6cells/mL using a power input of 0.6W/m 3 with a 2L
working volume after 3 days.
2. Cultured hMSCs on Solohill® microcarriers grew to a maximum
total cell number of 6e6 cells using power input of 0.6-0.8W/m3 with
a 2.4L working volume after 12 days.
Conclusions: 1. Data from the mixing experiments demonstrate the just
suspended mixing power input was determined to be ~0.6W/m3.
2. Cell growth experiments with hMSCs demonstrate comparable cell
growth in the 3L and 50L Mobius® CellReady bioreactor with total
number of hMSCs reaching 4e8 and 9e9 cells after 12 days at a
agitation power input of 0.6-0.8W/m3
3. Initial cell growth experiments with adherent MDCK cells
demonstrate an agitation power/volume input of 0.6W/m 3 may
provide the best performance for cell growth with peak cell densities
~1.0e6 cells/mL after 3 days
4. Comparable MDCK cell growth is observed:
Mobius® CellReady Bioreactor 3L
Mobius® CellReady Bioreactor 50L
Rocking Bioreactor 20L
P96
CHO starter cell lines for manufacturing of proteins with pre-defined
glycoprofiles
Karsten Winkler1*, Michael Thiele1,2*, Rita Berthold1, Nicole Kirschenbaum1,
Marco Sczepanski1, Henning von Horsten1,3, Susanne Seitz1, Norbert Arnold2,
Axel J Scheidig2, Volker Sandig1
1
ProBioGen AG, D-13086 Berlin, Germany; 2Christian-Albrechts-Universität zu
Kiel, D-24118 Kiel, Germany; 3Hochschule für Technik und Wirtschaft Berlin,
D-10138 Berlin, Germany
Backround: Glycosylation of protein therapeutics is influenced by a
multifaceted mix of product intrinsic properties, host cell genetics and
upstream process parameters. Industrial CHO cell lines may have several
deficits in their glycosylation pattern for some applications, like high fucose
content (corresponding to a low ADCC profile) and low galactosylation and
sialylation levels (proposed to decrease activity and/or pharmacokinetics).
We have successfully applied the GlymaxX® technology [1] abolishing fucose
synthesis in well-established CHO DG44 and K1 platforms and pre-existing
producer cell lines (glycan modulator GM1). Here we extend this strategy by
other engineering approaches to enable production of protein therapeutics
with desired glycosylation features. Through stable integration of other
Table 1(abstract P95)
Physical Characteristics of Microcarriers
Microcarrier
Cytodex
Density (g/ml)
1.04
3 ®
Solohill® Collagen Coated
1.03
Hydrated Size (μm)
141-211
125-212
Concentration (g/ml)
3
15
Page 125 of 151
Table 2(abstract P95)
MDCK/Cytodex
3 ®
Microcarriers Process Table
Variable
Value
Cells
MDCK
hMSCs
Inoculation
Density
4e5 cells/mL
5e3 cells/mL
Substrate
Cytodex
Growth Media
DMEM w/4.5g/L Glucose, 2% FBS, 1% NEAA and 2mM L-Glutamine
DMEM low glucose, 10% FBS, 8ng/ml bFGF, 2mM
Glutamine, 1X Pen/Strep
pH
7
NA
DO (%
Saturation)
45
NA
Feed 1
Day 1: 100% Growth Media
Day 6: 1000ml low glucose fresh medium
Feed 2
Day 3: Drain 50% of the working volume and reefed with equal volume Day 9: 400ml high glucose fresh medium
of Growth Media
3 ®
Batch Duration 7 days
Solohill®
12 days
Figure 1(abstract P95) Illustrates the attachment of MDCK and hMSCs to Cytodex3® and Solohill® microcarriers
Figure 2(abstract P95) compares the viable cell density of MDCK cells at increasing power/volume impeller inputs and different bioreactors
genes for glycosylation enzymes we are able to tune galactosylation (glycan
modulator GM2) and sialylation (glycan modulator GM3). These glycan
modulators can specifically be combined to address certain desired
oligosaccharide patterns.
We postulate that modulating effects of GM2 and GM3 require a specific
expression level. In this case the combination of high level target protein
expression and defined levels of glycan modulators becomes extremely rare.
Therefore, the characterization of clones with individual stable levels of
glycanmodulator expression is a prerequisite for industrial application.
Materials and methods: Two vectors expressing either GM2 alone or GM2
and GM3 in combination were constructed to evaluate modulator effects.
This technology was applied to both, CHO-DG44 and K1 cells to generate
modified host cell pools. Modulator host cell clones were generated out of
appropriate DG44 pools and characterized for growth and modulator gene
expression using a 7-day shaker batch culture and RT-qPCR respectively.
A human IgG and a Fc-Fusion protein carrying a single N-glycosylation side
in the CH2 domain were chosen as model proteins. After stable transfection
of human IgG into GM2 and Fc-fusion protein into GM2/3 clones, the
Page 126 of 151
Figure 3(abstract P95) shows the viable cell density of hMSCs in the 3L and 50L Mobius® CellReady Bioreactor
resulting test modulator clone pools were analyzed in fed batch shaker
assays. Harvested culture supernatants were purified and subjected to NGlycan profile analysis performed by Hydrophilic-Interaction-Chromatography
(HILIC).
Results: Characterization of modulator host cell clones for proliferation
and modulator mRNA expression indicated that growth behavior is not
influenced by modulator expression level. Therefore only GMx-mRNA
level were used to select five to six clones expressing a broad range of
either GM2 alone or GM2 and GM3 in combination. Each selected
modulator host cell clone was transfected with the corresponding model
protein in duplicates (indicated by A or B).
Final fed batch assays gave typical clone pool results with growth profiles
showing high comparability between clone pools expressing the same
model protein (Table 1). Peak viable cell densities (VCD) of about 3E7 vc/mL
were reached with maximum titers of 1.2 g/L hum IgG and 2.4 g/L Fc-Fusion
protein within 12 days, while final viabilities were in most cases above 80%.
Up to 3 fold different titers between pools A and B of the same starter clone
were observed depending on selection schemes and process management.
As it is given by the conveyer like nature of the glycosylation machinery the
content of a certain glycan structure cannot be increased without
decreasing the output of the preliminary structures. Therefore the
hypergalactosylation effect of GM2 should result in a shift towards more
G2F structures and for the combination of GM2 and GM3 a shift towards
more G2FS1 structures is anticipated, while even the G2F content could be
decreased. As shown in Figure 1 the expected shifts were observed,
demonstrating that the glycan modulators are working in the intended way.
Additionally, we found a positive correlation between the level of modulator
gene expression and the degree of glycan modifying effect. Clone pools
with highest modulator expression levels displayed the highest content of
the desired structures e.g. G2F for GM2 clones and G2FS1 for GM2/3 clones.
This reflects a 15 - 20-fold increase of these target structures compared to
clone pools with low or moderate modulator expression (Table 1).
Despite substantial differences in productivity and process between A and
B clone pool duplicates (2 - 3 fold difference in titers) in most cases only
slight shifts of certain oligosaccharide structures were observed (e.g. clone
pool 3 - 5 and 8, 9). This indicates that the glycan pattern is more
Table 1(abstract P96) Data of selected clone pools shown in Figure 1
Model protein: human IgG
Clone pool no.
Index
1
A
Model protein: Fc-Fusion protein
2
B
A
4
B
A
6
B
7
10
A
B
A
B
A
B
1.5
1.5
3.7
3.7
0.6
0.6
3.2
3.2
1.4
1.4
0.3
0.3
25
relative modulator mRNA expression
GM2
5.8
5.8
2.5
2.5
0.4
0.4
GM3
Key process parameter
Peak VCD
(cell/mL)
20
20
31
24
28
24
31
24
29
25
27
Final-vitality
(%)
73
82
82
88
87
91
87
87
86
84
89
93
Titer
(g/L)
0.6
0.4
0.9
0.7
1.0
0.6
2.1
1.0
1.8
1.0
2.3
1.1
G0F
(%)
2
1
62
55
71
68
37
24
19
19
46
41
G1F
G2
(%)
(%)
19
3
13
4
23
1
29
1
18
1
21
1
27
1
32
1
35
1
34
1
33
1
38
1
12
N-Glycan analysis
G2F
(%)
61
67
4
6
2
3
3
7
11
10
9
G1FS1
(%)
2
3
<1
<1
<1
<1
9
9
5
7
0
0
G2FS1
(%)
2
2
<1
<1
<1
<1
19
21
22
11
1
9
GM2 and human IgG expressing clone pools no. 1, 2, 4. Fc-Fusion protein and GM2/3 expressing clone pools no. 6, 7, 10. Duplicates are indicated by A and B.
Key process parameter and corresponding results of N-Glycan analysis are shown in the under part of the table.
Page 127 of 151
Figure 1(abstract P96) HILIC chromatograms of clone pools with distinct modulator expression levels. A: GM2 clone pools, B: GM2/3 clone pools.
With increasing GM2 activity a clear shift towards G2F structures can be observed. While the increasing activities of GM2 and GM3 correlates positively
with the G2FS1 content.
depended on clone specific modulator gene expression than on
glycoprotein expression level.
Conclusions: Expression of GM2 and GM3 in CHO cell lines can effectively
change the glycosylation pattern of target proteins in a dose dependent
manner. Growth and productivity characteristics are similar to unmodified
host cells and maintain their suitability for clinical and commercial
production.
The degree of glycomodulation is reproducible and relatively independent
of target glycoprotein expression level. This allows a prediction of
glycosylation patterns of glyco-proteins produced in certain host cell
clones in relation to modulator expression level.
Finally, a comprehensive set of engineered, biopharmaceutical CHO
production cell lines were generated and characterized, individually
optimized for enhanced ADCC activity, adjusted galactosylation or sialylation
levels of the target proteins. This elaborate cellular toolbox allows the rapid
and targeted creation of antibody and glycoprotein molecules with specific
pre-defined glycan profiles.
Reference
1. von Horsten HH, Ogorek C, Blanchard V, Demmler C, Giese C, Winkler K,
Kaup M, Berger M, Jordan I, Sandig V: Production of non-fucosylated
antibodies by co-expression of heterologous GDP-6-deoxy-D-lyxo-4hexulose reductase. Glycob 2010, 20:1607-1618.
P97
Dynamic profiling of amino acid transport and metabolism in Chinese
hamster ovary cell culture
Sarantos Kyriakopoulos1, Karen M Polizzi2,3, Cleo Kontoravdi1*
1
Centre for Process Systems Engineering, Department of Chemical
Engineering and Chemical Technology, Imperial College London, UK;
2
Division of Molecular Biosciences, Imperial College London, UK; 3Centre for
Synthetic Biology and Innovation, Imperial College London, UK
Introduction: Chinese Hamster Ovary (CHO) cells are the most widely used
industrial hosts for the production of recombinant DNA technology drugs
[1]. In such processes amino acids (a.a.) are vital nutrients for growth, but
also building blocks of the recombinant protein (rprotein). Our research aims
to establish a better understanding of a.a. transport in and out of cells, since
this could have significant impact on increasing productivity and designing
feeding strategies during bioprocessing.
There are about 46 a.a. transporter proteins in mammalian cells, the genes of
which are presented in Table 1 along with their substrates and all are
members of the Solute Carriers (SLC) database [2]. A.a. transporters are
Page 128 of 151
Table 1(abstract P97) Amino acid transporter genes based on the SLC database [2]
System GENES
Substrates
A
SLC38a1
Ala, Asn, Cys, Gln, His, Ser below detection
limits
SLC38a2
Ala, Asn, Cys, Gln, Gly,
His, Met, Pro, Ser
SLC38a4
ASC
Expresion/Type of
regulation
System
GENES
Substrates
Expresion/Type
of regulation
PAT
SLC36a1
Gly, Ala, Pro, b- Ala,
Tau
remains stable
between cell linesb
SLC36a2
Gly, Ala, Pro
lowa
Ala, Asn, Cys, Gly, Ser, Thr within cell culturec
SLC36a3
putative
lowa
c
SLC1a4
Ala, Ser, Cys, Thr
within cell culture
SLC36a4
Ala, Pro, Trp
remains stable
SLC1a5
Ala, Ser, Cys, Thr, Gln,
Asn
bothd
T
SLC16a10
Phe, Tyr, Trp
lowa
asc
SLC7a10/
SLC3a2
Ala, Cys, Gly, Ser, Thr
lowa
X-AG
SLC1a1
Asp, Glu
lowa
B0
SLC6a19
Pro, Leu, Val, Ile, Met
lowa
SLC1a2
Asp, Glu
bothd
SLC6a15
Pro, Leu, Val, Ile, Met
remains stable
SLC1a3
Asp, Glu
between cell linesb
0,+
B
SLC6a14
basic & neutral a.a.
not checked
SLC1a6
Asp, Glu
below detection
limits
b0,+
SLC7a9/
SLC3a1
Arg, Lys, Cystine
lowa
SLC1a7
Asp, Glu
below detection
limits
b
SLC6a6
Tau, b-Ala
bothd
x-c
SLC7a11/
SLC3a2
Glu, Cystine
within cell culturec
Gly
SLC6a9
Gly
within cell culturec
y+
SLC7a1
Arg, Lys, His
bothd
SLC6a5
Gly
low
SLC7a2
Arg, Lys, His
lowa
SLC6a18
Gly
below detection
limits
SLC7a3
Arg, Lys, His
lowa
IMINO
SLC6a20
Pro
lowa
SLC7a7/
SLC3a2
Lys, Arg, Gln, His, Leu, bothd
Met
L
SLC7a5/
SLC3a2
Cys, Leu, Phe, Trp, Val,
Tyr, Ile, His, Met
bothd
SLC7a6/
SLC3a2
Lys, Arg, Gln, His, Leu, remains stable
Met, Ala, Cys
SLC7a8/
SLC3a2
neutral a.a., except Pro
lowa
SLC15a3
His
between cell linesb
SLC43a1
Leu, Ile, Met, Phe
lowa
SLC15a4
His
between cell linesb
SLC3a1
various based on
“partner”
lowa
SLC3a2
various based on
“partner”
bothd
N
a
y+L
His & small
peptides
b
SLC43a2
Leu, Ile, Met, Phe
between cell lines
SLC43a3
putative
between cell linesb
SLC38a3
Ala, Asn, Gln, His
not checked
SLC38a5
Gln, Asn, His, Ser
bothd
Heavy subunits of
hetero-meric
Not in a system
SLC6a7
Pro
not checked
SLC6a17
neutral a.a.
not checked
SLC7a13
Asp, Glu
not checked
SLC12A8
putative
not checked
The “Expression/Type of regulation” column refers to our results for the CHO cell lines described in the materials & methods section: alow levels-refers to
fractional copies per cell; bregulation between cell lines-refers to regulation significantly higher than two fold at least at a time point between the different cell
lines presented; cregulation within cell culture-refers to differential expression (significantly higher than two fold) at least at a time point within cell culture of a
given cell line; dboth types of regulation-refers to a gene presenting both b and c as discussed previously.
subject to different expression profiles among mammalian cells and are
grouped into more than 18 systems, based on sequence homology and
function.
To our knowledge, there is no comprehensive study of a.a. transporters in
industrially relevant CHO cells in the literature. To that direction, a.a.
transporter genes were profiled during batch culture of three CHO cell lines
with varying levels of productivity. In parallel, the intra- and extracellular
levels of a.a. were quantified.
Materials and methods: Three cell lines were kindly donated by Lonza
Biologics. GSn8 cell line was transfected with an empty glutamine synthetase
(GS) vector. GS35 and GS46 cell lines were both transfected with a GS vector
that also carries the heavy and light chains of a chimeric IgG4 antibody. The
specific productivity of cell line GS46, quantified by a commercial ELISA kit
(Bethyl laboratories, US), is approximately double that of GS35 one.
Batch cultures were performed in triplicate in 1L Erlenmeyer flasks with a
working volume of 300mL in CD-CHO medium (Invitrogen, UK) supplemented with 25 μM MSX (Sigma, UK). Viable cell concentration was
determined daily using the trypan blue dye exclusion method.
40 a.a. transporters were studied in all cell lines using real time
quantitative reverse transcription polymerase chain reaction on samples
from different phases of batch culture. Samples were collected at day 4
(exponential phase) and day 6 & day 7 (stationary phase) of the growth
curve for all cell lines (samples were also taken at day 3 for IgG4 producers
only and day 9 for the null cell line only). Results are reported against the
housekeeping gene “actb”. Housekeeping genes “vezt” and “hirip3” were
also well correlated.
The extracellular and intracellular a.a. profiles were monitored daily using
high performance liquid chromatography (PicoTag, Waters, UK). Intracellular
samples were quenched with 0.9% w/v NaCl and extracted with a 50%
aqueous acetonitrile solution, as described in [3].
Results: The results (Table 1) reveal that ~30% of transporters are lowly
expressed (fractional copies per cell), 9% are below levels of detection,
whereas 40% are significantly differentially expressed either during batch
cell culture, or between cell lines, or both. The remaining transporters
appear to remain stable.
Regulation within culture: The majority of the transporters are found to
be upregulated at stationary phase for all cell lines, as also presented in
Figure 1, where a mapping of a.a. metabolism and transport has been
illustrated for the null cell line. Specifically, five genes encoding for
transporters of a.a. relating to the glutathione (GSH) pathway were found
to be upregulated significantly higher than 2 fold at stationary phase,
when compared to exponential phase for all cell lines. These genes were:
slc1a4 (Ala and Cys), slc6a9 (Gly), slc1a2 (Glu and Asp), slc7a11 (Cystine and
Glu), and heteromeric transporter slc3a2 which partners with slc7a11. GSH
is a well-known marker of oxidative stress [4], high levels of which have
been associated with high productivity [5].
Page 129 of 151
Regulation between cell lines: In their majority, genes were found to be
upregulated for protein producing cell lines at all time points. Genes whose
expression is upregulated significantly (two-fold or higher) in the proteinproducers at all time points analyzed were: slc43a2 (system L, leucine and
branched-chain a.a.) and slc1a2 (system X-AG, glutamate and aspartate).
However, no genes, apart from slc6a6 (taurine and b-Ala), were found to be
differentially expressed between high (GS46) and low producer (GS35). We
find slc6a6 gene differentially expressed early in cell culture (day 3), which
makes us hypothesize that the gene could be a candidate for selection
purposes. The overexpression of this gene in CHO cells has been found to
significantly enhance growth and productivity [6].
Feeding strategy based on order of feeding: The a.a. transporters gene
expression findings correlate well with the extracellular and intracellular
concentration profiles of their respective substrates (Figure 1). By analysing
the differentially expressed genes for a specific cell line a feeding strategy
can be designed. For example, we find transporter slc7a5, of system L,
highly upregulated at stationary phase for the null cell line (Figure 1). This
transporter exchanges an intracellular neutral a.a. with an extracellular
Figure 1(abstract P97) A map associating the differentially expressed amino acid transporters for the null cell line, their amino acid substrates,
and the intracellular concentrations (femtomol/cell, in the area designated by the “IN” tag) and extracellular concentrations (mM, in the area
designated by the “OUT” tag) of the latter. A.a. transport is highlighted by the black box. The expression of the mRNA levels of the differentially
expressed a.a. transporters (in mRNA copies per cell) at different phases of cell culture, exponential (day 4), stationary (days 6 & 7), and decline (day 9) is
displayed at the bottom, where stationary phase samples are averaged, since not statistically different (for ease of statistical analysis visualization). The
relevant energy utilisation mechanisms of each system are also depicted (top). Genes: slc6a9 (glycine), slc1a2 (acidic a.a.), slc7a7 (basic and branched chain
a.a.) and its heteromeric transporter slc3a2 were also found to be differentially expressed, but are not presented in this figure. Our chosen a.a. analysis
method was not able to quantify cysteine (L-Cys) levels.
branched chain one (isoleucine, leucine, valine). Branched chain amino acids
are associated with the mTor signalling pathway, essential regulator for
many physiological roles in mammalian cells [7]. Hence, a feeding strategy
can be proposed, where neutral amino acids are fed first and followed by
branched chain amino acids, in order for them to be more effectively
uptaken. A similar type of pre-conditioning was found to significantly
enhance cellular protein production in another type of mammalian cells [7].
Conclusions: Glutathione pathway associated a.a. transporters (slc1a2,
slc1a4, slc6a9, slc7a11/slc3a2) can be targeted as genetic engineering
targets, since are all found highly upregulated at stationary phase of cell
culture. Additionally, transporters slc1a2, slc43a2 are associated with rprotein
productivity, since all of them are found to be upregulated for producing
cell lines vs the null. Gene slc6a6, carrying taurine and b-alanine, can be
associated with high productivity (as also suggested in [6]), as was also
found to be differentially expressed in the high vs the low producer early in
cell culture. A feeding strategy can be proposed, based on our results that
remains to be tested experimentally. Finally, extending this integrative
approach to the proteome level would help link regulation at the
transcriptomic level to actual differences in transport capability.
Acknowledgements: S.K. would like to thank EPSRC & iChemE for
financial support. K.P. would like to thank RCUK and C.K. thanks RCUK &
Lonza Biologics for their Fellowships.
References
1. Kyriakopoulos S, Kontoravdi C: Analysis of the landscape of biologicallyderived pharmaceuticals in Europe: Dominant production systems,
molecule types on the rise and approval trends. European journal of
pharmaceutical sciences: official journal of the European Federation for
Pharmaceutical Sciences 2012, 48:428-441.
2. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, Bruford EA: The
ABCs of solute carriers: physiological, pathological and therapeutic
implications of human membrane transport proteins - Introduction. Pflug
Arch Eur J Phy 2004, 447:465-468.
3. Dietmair S, Timmins NE, Gray PP, Nielsen LK, Kromer JO: Towards
quantitative metabolomics of mammalian cells: Development of a
metabolite extraction protocol. Anal Biochem 2010, 404:155-164.
4. Selvarasu S, Ho YS, Chong WPK, Wong NSC, Yusufi FNK, Lee YY, Yap MGS,
Lee DY: Combined in silico modeling and metabolomics analysis to
characterize fed-batch CHO cell culture. Biotechnol Bioeng 2012,
109:1415-1429.
5. Chong WP, Thng SH, Hiu AP, Lee DY, Chan EC, Ho YS: LC-MS-based
metabolic characterization of high monoclonal antibody-producing
6. Tabuchi H, Sugiyama T, Tanaka S, Tainaka S: Overexpression of Taurine
Transporter in Chinese Hamster Ovary Cells Can Enhance Cell Viability
and Product Yield, While Promoting Glutamine Consumption. Biotechnol
Bioeng 2010, 107:998-1003.
7. Nicklin P, Bergman P, Zhang BL, Triantafellow E, Wang H, Nyfeler B,
Yang HD, Hild M, Kung C, Wilson C, et al: Bidirectional Transport of Amino
Acids Regulates mTOR and Autophagy. Cell 2009, 136:521-534.
P98
Optimized platform medium and feed for rCHO cell lines using the
CHEF1® expression system
William Paul1*, Raymond Davis2, Andrew Campbell1, Sarah Terkildsen2,
Vann Brasher2, James Powell2, Blake Engelbert2, Howard Clarke2
1
Life Technologies Corporation (PD-Direct® Bioprocess Services), 3175 Staley
Road, Grand Island, NY, 14072 USA; 2CMC Biologics, 22021 20th Avenue SE,
Bothell, WA, 98021 USA
Chinese Hamster Ovary (CHO) cells are widely used in biomanufacturing and
biomedical research to produce proteins of clinical significance. The
environment the cells grow in to produce these proteins is complex and
varies across the industry. One key variable in production processes is the
cell culture medium used. Media can include chemically-defined components
such as amino acids, vitamins, lipids, metal salts, and buffers. In addition,
undefined components such as proteins, serum, or hydrolysates may be
added. To reduce complexity, increase consistency, and comply with
increasing demands from regulatory entities, chemically-defined formulations
are preferred and can be developed and optimized for a given cell line.
Page 130 of 151
While a medium and feed can be optimized for every cell line/clone,
developing a platform system provides a cost-effective option while ensuring
a high level of growth and productivity.
In this collaboration, between Life Technologies PD-Direct® and CMC
Biologics, a single animal origin-free, hydrolysate-free base platform medium
and three synergistic feed media were developed for use with recombinant
CHO cell lines engineered using the CHEF1® expression system to produce
monoclonal antibodies. The CHEF1 expression system utilizes regulatory
domains from the Chinese hamster elongation factor 1 (EF1a) gene to drive
production of heterologous proteins [1]. Serum-free, suspension adapted
CHO DG44 cells were transfected with CHEF1 plasmids harboring 2 different
IgG1 MAb genes and used as test cell lines to develop a platform feed
system. A cell culture production platform system (CHEF1, base medium,
feed media) was developed and optimized using two cell lines that were
previously grown in an undefined culture system. The new platform growth
system developed here, showed an average 1.6 fold improvement in titer
for the two cell lines compared to the performance using the undefined
culture system.
Using Design of Experiment (DOE) methods, we performed a Feed
Mixtures experiment and a 2-Level Categoric experiment in shake flasks
(culture parameters are shown in Table 1). Cell counts and viabilities were
determined using a Cedex AS20 automated cell counter (Innovatis Inc.).
Product titer was measured by Protein A HPLC. Performance data from
the Feed Mixtures experiment were analyzed using Design Expert® (StatEase®). Select spent media samples from the best performing Feed
Mixtures conditions were analyzed for glucose, amino acids and select
water-soluble vitamins using immobilized enzyme (YSI Life Sciences),
UPLC (Waters AccQ-Tag™ - reverse phase with UV detection) and HPLC
(ion-pair reverse phase using a UV detection), respectively. The Feed
mixtures data were used to calculate nutrient consumption rates, which
in turn were used to develop 3 balanced feeds (at neutral pH). A separate
Feed Supplement (at high pH) was designed to facilitate delivery of
components that were needed at levels above solubility limits in a
neutral solution. These feeds and the Feed Supplement were then tested
in a 2-Level Categoric experiment, evaluating feed volume, feed schedule,
and the feed supplement. Performance data from this experiment were
analyzed using Design Expert. Select spent media samples from the best
performing conditions were analyzed for glucose, amino acids and select
water-soluble vitamins. These data demonstrated that the three feeds
were balanced and, when the feed supplement was included, provided
nutrients at levels sufficient for continued growth/productivity. The best
performing feed system (balanced feed [BF1] and feed supplement [FS])
was used in a bioreactor confirmatory experiment (culture parameters
shown in Table 1). In addition, a day 0 feed was designed (BF5 - included
recombinant growth factors) and tested in the bioreactor.
Supplementing BF5 at 3% (v/v) prior to inoculation and feeding 4%BF1 on
day 4, 5% on day 6, 3% on day 8, 2% on day 10, and 1% (v/v) on days 12
and 14 and FS at 0.2% (v/v) on alternate days starting on day 3 provided
an environment for both cell lines that resulted in productivity superior to
the control condition; cell line #1 reached 1.1 gm/L (control = 0.5 gm/L)
and cell line #2 reached 2.0 gm/L (control = 1.6 gm/L).
Since the cost of dry format media is more economical than liquid media at
GMP scale, the feeds were converted from liquid format to dry formats; BF1
was converted to Advanced Granulated Technology™ (AGT™) format and the
Feed Supplement was converted to a dry powder media (DPM). Once
hydrated, these feeds were tested to confirm equivalency, achieving similar
growth and productivity patterns as their liquid counterparts. Additionally,
these feeds have been concentrated to reduce the dilution effect that many
commercial feeds produce, resulting in an approximate 76% reduction in
feed volume added over the life of the culture (Figure 1). This is a significant
reduction in the volume of fluid requiring in-process handling and
downstream processing; saving time, equipment, and money. This feed
system development collaboration yielded a 112% improvement (over the
control condition) in product titer for cell line #1 and a 25% improvement in
product titer for cell line #2 (Figure 1). The base medium and the newly
developed final feed system provide an animal origin-free, hydrolysate-free
growth environment. For the purposes of many commercial cGMP
processes, this culture system provides an economical solution. Addition of
a proprietary undefined feed (CMC Biologics), prior to inoculation, on top of
this balanced feed system has been shown to boost productivity by about
15% over using just the balanced feed system. Next steps include evaluating
protein quality and validating at production scale.
Page 131 of 151
Table 1(abstract P98) Culture Parameter Conditions and Set-Points
Parameters
Shake Flask/Culture Volume
125 mL vented Erlenmeyer
30 mL working volume
Bioreactor/Culture Volume
3 L single-use CellReady bioreactor
2 L working volume
5
Seeding Density
5x10 viable cells/mL
Temperature
37°C ± 0.5°C (days 0 - 4)
34°C ± 0.5°C (day 5 - end)
CO2 Level (Shake Flask)
6% ± 1% (days 0 - 4)
2% ± 1% (day 5 - end)
pH (Bioreactor)
7.0 ± 0.2
RPM (Shake Flask)
120 ± 5
RPM (Bioreactor)
200 ± 10
Dissolved Oxygen (Bioreactor)
60% ± 5%
Reference
1. Running Deer J, Allison DS: High-Level Expression of Proteins in
Mammalian Cells Using Transcription Regulatory Sequences from the
Chinese Hamster EF-1a Gene. Biotechnol 2004, 20:880-889, Prog.
P99
Profiling of glycosylation gene expression in CHO fed-batch cultures in
response to glycosylation-enhancing medium components
Ryan Boniface1*, Jeoffrey Schageman2, Brian Sanderson2, Michael Gillmeister1,
Angel Varela-Rohena1, John Yan3, Yolanda Tennico3, Shawn Barrett1,
Robert Setterquist2, Stephen Gorfien1
1
Life Technologies Corporation, 3175 Staley Road, Grand Island, New York,
USA, 14072; 2Life Technologies Corporation, 2130 Woodward, Austin, Texas,
USA, 78744; 3Life Technologies Corporation, 29851 Willow Creek, Eugene,
Oregon, USA, 97402
Introduction: Characterization of the glycosylation profile of a recombinant
protein product is an important part of defining product quality in the
bioproduction industry. Development of a protein with desired characteristics
would require the capacity to modify and target specific glycosylation
patterns as well as an understanding of the implications of changes to these
glycosylation profiles. Previous cell culture studies have demonstrated the
ability to modulate glycan profiles without negative impact to culture growth
and product titer through the addition of glycosylation-enhancing medium
components. With new methods, including increased measurement
sensitivity and new capabilities in RNA-Seq technology, it is possible to
develop a glycosylation gene expression profile for CHO cells. Specific
glycosylation genes can then be tracked to ensure that the addition of these
compounds will not negatively impact gene expression. Analyses comparing
growth and titer, glycan distribution, and transcriptome differences can
present us with potential insight into what changes are taking place on a
genetic level in the cell in response to changes in medium and culture
conditions.
Materials and methods: (All Materials were from Life Technologies unless
otherwise indicated)
Cell culture: CHO-S® and DG44 derived recombinant cells expressing the
same IgG molecule were grown in CD FortiCHO™ medium supplemented
with 4mM L-glutamine and 1:100 Anti-Clumping Agent.
Fed-batch bioreactor: DASGIP bioreactor with 500mL initial working
volume seeded at 0.3x105 viable cells/ml in CD FortiCHO™ medium. 10% CD
EfficientFeed™ C (EFC) feeding on days 3, 5 and 7 for CHO-S® cultures, and
feeding on days 4, 6 and 8 for DG44 cultures. Glucose concentration was
maintained above 3g/L. Component A and/or component B were added on
the first day of feeding (day 3 for CHO-S® and day 4 for DG44 cultures).
Culture conditions were maintained as follows; pH 7.0 +/- 0.05, 50% DO, 37°C,
110 rpm. Cell densities and viabilities were measured using a Vi-CELL®
counter (Beckman Coulter). Metabolites (glucose, ammonia, lactate) and IgG
were measured using a Cedex® Bio HT Instrument (Roche).
Glycan analysis: Protein supernatant samples were collected and purified
using POROS® MabCapture® A resin. Samples glycan profiles were analyzed
on an Applied Biosystems® 3500 Series Genetic Analyzer.
Transcriptome analysis: RNA was extracted at several time points during
the culture. A total of 174 potential glycosylation specific gene targets were
Figure 1(abstract P98) Summary of Optimization Collaboration - Improved titer by 112% (cell line #1), by 25% (cell line #2), and reduced volume
fed by 76%.
identified and primers designed to these using reference sequences from
Chinese hamster ovary, mouse, rat and human. A total of 34 samples were
multiplexed on a Proton™ PI chip on the Ion Torrent™ PGM™.
Results and discussion: The use of components A and B with CHO-S® cells
in CD FortiCHO™ medium causes a considerable increase in the level of
galactosylation of the recombinant IgG (Figure 1) as shown by the shift in
the glycosylation profile from G0F to G1F and G2F. The use of targeted
transcriptome analysis revealed that the changes observed in the
glycosylation profile do not translate to noticeable differences in the
expression levels of the glycosylation genes. There are changes in gene
expression levels with culture age but they are not altered by the additions
of components A and/or B. It was originally theorized that components A
and B could act as cofactors or substrates within the glycosylation enzymatic
pathways but this could not be confirmed without an understanding of the
Page 132 of 151
glycosylation gene profile. The changes in the glycosylation patterns
combined with the absence of changes in the gene expression data lend
support to this theory. With this information it is apparent that the additions
of the glycosylation-enhancing components A and B can increase
galactosylation of recombinant proteins with no negative effect on growth,
titer or glycosylation gene expression.
The comparison between CHO-S® and DG44 cultures without supplementation with components A or B revealed the DG44 culture had better
galactosylation with increased proportions of G1F and G2F. Both cell lines
express high levels of DDOST, RPN1, DAD1 and SST3A which are all part of
the oligosaccharyltransferase complex which catalyzes the transfer of high
mannose oligosaccharides from lipid-linked oligosaccharide donors to the
asparagines on the Asn-X-Ser/Thr of the polypeptide chain. The DG44 cells
differ from the CHO-S® cells with increases in: ALG2, ALG3, ALG9 and ALG12
Figure 1(abstract P99) Glycan analysis data measured as the percentage of total glycans. (A) The glycan profile for the CHO-S® culture with no
addition of components A and/or B. (B) These data indicate that the addition of component A to the culture results in very little change to the glycan
profile, only slight increase in the percent of G1F on days 5 and 7. (C) The addition of component B to the culture shifts the glycan profile from primarily
non-galactosylated G0F to increased G1F (single galactose) and G2F (two galactose) glycoforms. (D) The addition of both components A and B results in
a change in galactosylation indicated by the increase in both G1F and G2F and an overall reduction of G0F. In every condition, G0F increases with time
but this is minimized with the addition of both components A and B. The majority of protein glycoforms within this experiment are fucosylated and the
addition of components A and/or B does not appear to alter this.
(mannosyltransferases), ALG8 and ALG10 (glucosyltransferases), ALG14
(acetylglucosaminyltransferase), and B4GALT5 (galactosyltransferase). These
increases in gene expression in DG44 cells seem to coincide with the higher
galactosylation profiles observed in the glycan analysis.
Conclusions: Differences in growth, titer and glycoform distribution were
observed between CHO-S® and CHO DG44 cells. DG44 cells had higher
expression of glycosylation transferase genes compared to CHO-S® cells.
Components A and B had synergistic effects on terminal galactosylation
(Figure 1), showed no changes in gene expression and could be acting as
cofactors/substrates with glycosylation enzymes.
Acknowledgements: The Austin team (Natalie Hernandez, Laura
Chapman, Angie Cheng, Lea Kristi and Daniel Williams) for library
preparation and transcriptome analysis.
Page 133 of 151
Table 1(abstract P100) Doubling time of each cell line in
each medium after adaptation
mAb I
mAb II
Cellvento™ CHO-200 medium
20 h
32 h
mAb III
17 h
Supplier A medium 1
23 h
35 h
23 h
Supplier A medium 2
20 h
63 h
22 h
Supplier A medium 3
20 h
24 h
18 h
Supplier B medium 1
21 h
20 h
18 h
Supplier B medium 2
24 h
66 h
24 h
Supplier C medium 1
26 h
18 h
20 h
Supplier C medium 2
22 h
18 h
18 h
P100
How to assess chemically defined media and feeds from 9 suppliers on
CHO cells producing mAb
Aurore Polès-Lahille*, Margaux Paillet, Aurélie Da Silva, Nora Kadi, Eric Basque,
Flavien Thuet, David Balbuena, Sébastien Ribault
Merck Biodevelopment, Martillac, France, 33650
Supplier D medium 1
21 h
19 h
18 h
Supplier E medium 1
26 h
35 h
28 h
Supplier E medium 2
23 h
20 h
19 h
Supplier F medium 1
21 h
26 h
17 h
Supplier G medium 1
21 h
20 h
18 h
Supplier G medium 2
19 h
Introduction: Mammalian cell culture medium development has widely
evolved in recent years. The use of hydrolysates as serum replacement
has led to process variability due to lot-to-lot variations. The undefined
composition of these media could also increase the process optimization
timelines, sometimes with limited impact on process performances. With
the reduction of process development activities for preclinical and Phase I
studies, medium and feed platforms raised. The objective of the media
was to ensure cell growth only in order to go as fast as possible to
production bioreactors while the feeds were responsible for productivity
and production length. Either companies spent several months if not
years to develop their own generic medium and feed platforms or they
used commercial ones, sometimes under licenses. The medium and feed
platform assessment also started earlier in the product development
process. Clone screening was performed more and more in fed-batch
conditions rather than batch ones. Thus screening tools, scale-down
models of bioreactors, with lower and lower working volumes were
designed. Another cell culture process evolution was the development of
new expression systems without any selection agents. In order to assess
our screening scale-down model, between 20 to 35 chemically defined
platforms from 9 suppliers were screened with 3 CHO host cell lines/
expression systems.
Methods: The following protocol was followed for 3 different CHO cell
lines producing mAb:
Supplier G medium 3
21 h
Supplier G medium 4
19 h
Supplier H medium 1
21 h
Supplier H medium 2
21 h
- CHO host cell 1 - expression system n°1 : mAb I
- CHO host cell 1 - expression system n°2 : mAb II
- CHO host cell 2 - expression system n°3 : mAb III
Each medium was prepared, supplemented according to cell requirements,
0.2 μm PVDF filtrated and stored into at least 2 separated bottles. A sterility
test was performed on each bottle before use. Each cell line was thawed
and amplified during at least one week in its usual medium. Then the cells
were adapted to each medium for at least 8 passages in either 125 mL
shake flasks or 50 mL spin tubes in duplicate. Each media was preheated at
37°C before use and one bottle was used per duplicate in order to reduce
contamination risk. After cell adaptation, fed-batch platform assessment was
performed in 50 mL spin tubes at 37°C with a seeding density around 0.25 *
106 viable cells/mL. Every 2 to 3 days, samples were taken to measure pH,
pO 2 , pCO 2 , viable cell density, viability, glucose and lactate levels. The
feeding strategy applied was the same for each cell line and agreed with
each supplier. The cultures were stopped when the viability was below 60%
or after 16-17 days.
Results: The objective of cell culture media is to sustain cell growth in order
to quickly seed the production bioreactor. Here are the doubling times
measured on the 3 cell lines (Table 1).
Despite having the same host cell, cell growth was different between
mAb I and mAb II. The expression system could have a significant impact
on cell growth behavior. In order to separate the different platform
results, a color was assigned to each supplier and platform assessed
(Figure 1).
Depending on the CHO host cell and the expression system, each platform
had different performances. Some platforms seemed to be more robust
than others in terms of final titer. The lactate metabolism was also
compared between the different platforms. Most of the platforms had a
maximum lactate concentration measured around 1 - 1.5 g/L. Some
platforms went above 2 g/L of lactate, which could be difficult to scale-up
in bioreactors. The practical aspect was also studied as it can facilitate the
implementation and the tech transfer. Some platforms assessed had 2
feeds added everyday while others only had 1 feed added 3 times.
Molecule quality was also compared between platforms in terms of High
Molecule Weight and cIEF.
Conclusions: We have implemented a strong protocol for medium and
feed screening with up to 70 spin tubes manipulated in parallel. More than
3000 sterile manipulations were performed under a laminar flow without
any contaminations. These experiments allow us to define robust platforms
in terms of cell growth, productivity and metabolism on different CHO host
cell lines and expression systems.
P101
Evaluation of single-use bioreactors for perfusion processes
Aurore Polès-Lahille*, Flavien Thuet, David Balbuena, Sébastien Ribault
Merck Biodevelopment, Martillac, France, 33650
Introduction: Single-Use Bioreactors are now commonly used for Process
Development activities, as seeding bioreactors or to produce Drug
Substances. The advantages of this equipment have been well demonstrated over the last years on batch/fed-batch processes. Continuous
processes were widely applied in the past to increase the overall
productivity of small bioreactors or for sensitive molecule production. The
process control, contamination risk and complexity were the main concerns
of this operation mode. However, the bioprocessing trends and technology
evolution led to reconsidering the perfusion processes. The aim of this study
Page 134 of 151
Figure 1(abstract P100) Colors assigned to each supplier. Final mAb I (top right side), mAb II (bottom left side) and mab III (bottom right side) titers
for all platforms compared to Cellvento ™ CHO-200 medium.
was to combine standard single-use bioreactors with different perfusion
technologies and to compare productivity and molecule quality.
Methods: A CHO cell line producing a mAb was thawed and amplified in
shake flasks using Cellvento™ CHO-100 medium. When a sufficient
amount of cells was reached, 2 Mobius® CellReady 3L bioreactors were
launched in parallel: one in batch mode and one in perfusion mode
using Cellvento™ CHO-100 medium. Two perfusion technologies were
assessed: the Fibra-Cel® Disks (Eppendorf) and the Alternative Tangential
Flow (Refine) ones. The Mobius® CellReady 3L bioreactor was not
modified to perform perfusion processes aseptically transferred into a
Mobius® CellReady 3L bioreactor through the probe port. Regarding the
ATF™ technology, an ATF-2 system was first washed with water then
autoclaved and welded to the harvest line of a Mobius® CellReady 3L
bioreactor. The bioreactor conditions were 37°C with pH maintained
between 6.80- and 7.10. The Dissolved Oxygen set point was 50% and
stirrer speed 104 rpm. The viable cell density, viability, metabolism and
titers were measured at least daily. The perfusion was initiated at 0.5 vvm
when the lactate was above 0.5 g/L and increased daily based on glucose
and lactate levels up to 1 vvm for the Fibra-Cel ® technology and up to
2 vvm for the ATF™ one. In order to increase the oxygen transfer at high
cell density, a decision tree was applied. For the Fibra-Cel® technology,
the mAb was collected in harvest bags welded to a side port while for
the ATF™, the molecule remained inside the Mobius® CellReady 3L
bioreactor with the use of a 50 kDa hollow fiber. In order to measure the
quality of the mAb produced, samples were collected on day 7, day
10 and the last bioreactor day. Titers and HCP levels were directly
measured on harvest while SE-HPLC and cIEF were performed on ProSep®
Ultra Plus eluates.
Results: As expected, the cells grew on Fibra-Cel® Disks after 2 days. Thus
only a few cells were in suspension from day 3 to day 14 (end of the
bioreactor). Regarding the ATF™ technology, a maximum cell density of
33 millions cells/mL was reached (Figure 1).
The glucose concentration was well maintained between 5 and 6,5 g/L
while the lactate was not above 1.5 g/L in perfusion bioreactors. A steady
state was maintained over several days. The global productivity of each
process mode was calculated and compared to the batch one. The
perfusion technologies increased the mAb quantity obtained compared to
a batch mode. The ATF™ technology increased the final mAb titer by 2.9
fold and the Fibra-Cel® technology increased the mAb quantity by 1.2 fold
(Table 1).
The quality attributes of the mAb obtained in batch and perfusion modes
were also compared. The molecule produced during the perfusion processes
was more acid than the ones produced in batch and fed-batch modes.
Therefore the mAb produced with Fibra-Cel® and ATF™ technologies in
Mobius® CellReady 3L bioreactor could have a higher half-life than the
molecule produced in batch and fed-batch modes. Regarding the Host Cell
Proteins, Low Molecular Weight and High Molecular Weight overall contents,
the ATF™ technology generates more contaminants while the Fibra-Cel®
reduces them compared to a batch process (Table 1). Finally, the upstream
cost to reach the ATF™ quantity was compared between batch and
perfusion processes at different scales. The ATF™ technology can reduce
process cost in disposable bioreactors whatever the scale compared to the
batch mode while the Fibra-Cel® process cost is higher due to higher
medium quantity necessary (Table 1).
Conclusions: Without any modification of the Mobius® CellReady 3L
bioreactor, we were able to demonstrate the compatibility of this single use
bioreactor to a mAb perfusion process. Using two different technologies, the
overall performances, molecule quality, contaminant level and cost were
compared. This study demonstrates the flexibility of existing disposable
bioreactors to new bioprocessing technologies.
Page 135 of 151
Figure 1(abstract P101) Viable cell density in suspension in batch and perfusion processes measured in Mobius® CellReady 3L.
P102
Profiling and engineering of microRNAs for enhancing recombinant
protein productivity in Chinese hamster ovary cells
Wan Ping Loh1*, Bernard Loo1, Lihan Zhou2, Peiqing Zhang1, Dong Yup Lee1,2
, Yuan Sheng Yang1, Kong Peng Lam1
1
Bioprocessing Technology Institute, 20 Biopolis Way, #06-01 Centros,
Singapore 138668; 2Department of Biochemistry, National University of
Singapore, 8 Medical Drive 4, Blk MD7 #05-04, Singapore 117597
Background: Chinese hamster ovary (CHO) cells have become dominant
host cells in the biopharmaceutical industry due to their capacity for
proper protein folding, assembly and post-translational modifications.
However, low specific productivity (qp) places limitations on yields
obtained from mammalian host cells. MicroRNAs (miRNAs), a novel class of
short, non-coding RNAs which negatively regulate target gene expression
at post-transcriptional levels, have emerged as promising targets for
engineering of CHO cell factories to enhance recombinant protein
production. While engineering of miRNAs for enhanced cell growth and
delayed cell death have been reported, miRNA targets which can enhance
qp have not been identified to date.
Materials and methods: To understand the role of miRNAs in conferring
high qp phenotype in CHO cells, we carried out high throughput
sequencing of 4 in-house generated IgG-expressing CHO sub-clones of
varying qps. Reads were mapped to miRBase and 22 miRNAs were found to
be differentially expressed between the high and low producers. These
miRNAs were stably transfected into an IgG-expressing sub-clone to assess
their effects on growth, titer, qp and product quality attributes.
Results: Over-expression of miRs-17, 19b, 20a and 92a individually and in
combination resulted in 13-27% increases in titer and 14-24% increases in
qp in stably transfected pools. No significant alterations in proliferation rates
were observed. 20-45 single cell clones were randomly selected from each
of the 5 transfected pools for characterization. Statistical analyses showed
significant differences in titer/qp between the high- and low-miRNA
expressing single cell clones. The highest producing single cell clones
exhibited ~100% increases in titer and qp compared to non-transfected
cells. A correlation was found between increased miR-19b levels (>1.3-fold)
and enhanced qp and titer. Over-expression of miR-19b does not appear to
impact IgG aggregation significantly.
Table 1(abstract P101) Global productivity, Host cell Proteins, High Molecular Weight and Low Molecular Weight contents
in perfusion processes compared to batch ones reached in Mobius® CellReady 3L bioreactor in addition to upstream cost
to reach ATF™ mAb quantity, in perfusion processes compared to batch one in Mobius® CellReady Family
Batch mode
Fibra-Cel® technology
ATF™ technology
100%
121%
290%
Host Cell Proteins
100%
28%
144%
High Molecular Weight
100%
87%
198%
Low Molecular Weight
100%
68%
107%
Upstream cost at 3L GLP Scale
100%
108%
47%
Upstream cost at 50L GLP Scale
100%
175%
84%
Upstream cost at 200L GMP Scale
100%
134%
47%
Final Titer
Conclusions: To our knowledge, this is the first report of enhancement
of recombinant protein productivity by stable miRNA over-expression.
The genes and cellular pathways targeted by these miRNAs specific to
enhancing protein productivity are under investigation and will be
reported.
Acknowledgements: This work was supported by the Biomedical
Research Council/Science and Engineering Research Council of A*STAR
(Agency for Science, Technology and Research), Singapore. The authors
would like to thank Faraaz Noor Khan Yusufi, Ju Xin Chin for their
assistance in processing of next-generation sequencing data, and Corrine
Wan, Gavin Teo, Daniel Chew, Lyn Chiin Sim, Ce Huang Poo and Kong
Meng Hoi for their technical assistance in IgG purification, aggregation
and glycosylation analyses.
P103
Designing clinical-grade integrated strategies for the downstream
processing of human mesenchymal stem cells
Bárbara Cunha1,2, Margarida Serra1,2, Cristina Peixoto1,2, Marta Silva1,2,
Manuel Carrondo2,3, Paula Alves1,2*
1
Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa,
Av. da República, 2780-157 Oeiras, Portugal; 2iBET, Instituto de Biologia
Experimental e Tecnológica, Apartado 12, 2780-901 Oeiras, Portugal;
3
Departamento de Química, Faculdade de Ciências e Tecnologia,
Universidade Nova de Lisboa, 2829-516 Monte da Caparica, Portugal
Background: During the past decade, human stem cells have been the
focus of an increased interest due to their potential in clinical applications,
as a therapeutic alternative for several diseases. Within this context, human
mesenchymal stem cells (hMSCs) have gained special attention due to
their immune-modulatory characteristics, as well as in secreting bioactive
molecules with anti-inflammatory and regenerative features [1].
In order to face the high demands of hMSCs (from 10 5 to 10 9 cells
per patient) [2] to be used in therapies, the establishment of robust
manufacturing platforms that can ensure the efficient production,
purification and formulation of stem cell-based products is still a challenge.
Although substantial efforts have been performed on the development of
clinical-grade bioprocesses for the expansion of hMSCs in microcarrier-based
stirred culture systems, the incorporation of downstream strategies that
assure efficient cell-bead separation and consequent hMSC concentration
(i.e. volume reduction) and washing is required to deliver safe hMSCs to the
clinic [3,4].
Therefore, the main aim of this work was the design of integrated
methodologies (filtration and membrane technology approaches) [5] for the
robust and clinical-grade downstream processing of hMSC.
Materials and methods: Cell culture: hMSCs (STEMCELL Technologies™)
were cultivated in IMDM supplemented with 10% of fetal bovine serum
(FBS) or in MesenCult®-XF Medium (STEMCELL Technologies™) supplemented with 2 mM L-glutamine (Life Sciences) at 37°C in a humidified
atmosphere of 5% CO2, according to manufacture recommendations. These
cells were routinely propagated in static conditions (T-flasks) or on
microcarriers (SoloHill Engineering, Inc) using stirred culture systems
(spinner vessels and bioreactors). Cell concentration and viability were
determined by counting the cells in a hemacytometer using the standard
trypan blue exclusion method.
Cell characterization and quality control tests: Standard procedures for the
analysis of cell surface markers (CD90, CD73, CD45, CD34) using flow
cytometry tools, as well as cell-based assays for the evaluation of cell
proliferation capacity (CFU assay - colony-forming unit) and differentiation
potential (differentiation into osteoblasts and adipocytes) were performed,
following the manufacturer’s recommendations.
Downstream processing: After harvesting, the microcarriers were removed
from the cell suspension using nylon filters (Millipore) with different pore
sizes (100, 80 and 30 μm). The clarified cell-based materials were
concentrated by tangential flow filtration (TFF) using polysulfone hollowfiber cartridges with 0.45 μm pore size.
Results: Over the past years, as scale-up platforms for the biomanufacturing
of hMSCs become robust enough to yield high cell quantities to support
cell-based therapies, culture media supplemented with FBS are becoming
less used. This requirement is in line with what is advised by regulatory
Page 136 of 151
agencies, due to the main drawbacks associated to the use of FBS, such as
the variability between different lots and suppliers and the risk of
contamination with animal pathogens, which may trigger an immune
response upon MSC therapy [5]. Within this context, large efforts have been
made towards the development of serum- and xeno- free culture medium
formulations for the expansion of hMSC. Thus, on a first approach, we
evaluated the feasibility of propagating hMSCs in a serum- and xeno-free
culture medium, the MesenCult®-XF medium, and further compared cell
growth profile with standard medium formulation (e.g. IMDM + 10% FBS).
Our results showed that, hMSC can be successfully expanded in MesenCult®XF medium, presenting a constant population doubling length (PDL) of
approximately 2 in each cell passage and a cumulative PDL of 12.5 in a total
of 42 days (Figure 1A). Moreover, hMSCs showed an accelerated cell growth
and increased lifespan when compared to the hMSC cultivated in standard
culture medium supplemented with FBS where hMSCs presented limited
proliferation capacity (Figure 1A). This was an expected outcome since
MesenCult®-XF medium was design to enhance hMSC expansion from
primary human bone marrow and cultured-expanded cells, leading to longterm cultures. It is important to mention that hMSCs maintained
their characteristics after expansion in MesenCult®-XF medium, namely
immunophenotype, proliferation capacity and multipotency (results not
shown).
After the expansion of hMSCs in microcarrier-based stirred culture systems,
different downstream strategies were evaluated for the purification of
hMSCs. First, the clarification step was carried out to remove the
microcarriers from the cell suspension. For this purpose, nylon filters were
used and the effect of the mesh pore size on cell recovery yields and
viability was evaluated. Our results showed that nylon is a suitable material
for the clarification step since it ensured efficient removal of microcarriers
(no beads were detected after filtration processing) without compromising
cell viability (Figure 1B). Moreover, we demonstrated that higher mesh
pore sizes yielded higher cell recoveries (Figure 1B).
For the cell concentration and volume reduction step, preliminary
experiments were performed with human foreskin fibroblasts (Figure 1C).
With this cellular system, a concentration factor (in volume) of 10 times was
successfully achieved using TFF processes, yielding 70-80% of recovered
cells with high viabilities (Figure 1C). Process validation with hMSCs is
ongoing but first results were encouraging since we were able to
concentrate 2 times hMSCs while ensuring high cell recovery yields (96%)
and viabilities (98%) (Figure 1C). In addition, hMSCs maintained their
immunophenotype, as well as their proliferation capacity and multilineage
differentiation potential at the end of all steps of the downstream process
(results not shown).
Conclusions: While upstream technologies mature to meet the increasing
demand of hMSCs, biomanufacturing bottlenecks are now shifting towards
the downstream processing of stem cells. This work shows our first
approach to tackle such bottlenecks. More specifically, we demonstrate that
standard filtration techniques and TFF systems are suitable and robust
approaches for the downstream processing of hMSCs. Using these strategies
we were able to ensure efficient removal of the major impurities of the
cellular suspension (microcarriers) and further concentrate cell-based
products up to 10 times without compromising their viability and quality.
However, further improvements in cell concentration and polishing steps
are still required. Nonetheless, this work provides important insights towards
the establishment of robust and clinical-grade bioprocesses for the
purification of hMSCs to be integrated and applied in the biomanufacturing
of cell-based therapies.
Acknowledgements: The authors acknowledge the NanoGene project
(EuroNanoMed ERA-Net initiative) and the project EXPL/BBB-EBI/1003/2012 “Development of a scalable strategy for stem cells purification” funded by
Fundação para a Ciência e Tecnologia (FCT) for financial support, as well as
MIT-Portugal program and FCT for the grant SFRH/BD/51940/2012.
References
1. Patel A, Genovese J: Potential clinical applications of adult human
mesenchymal stem cell (Prochymal®) therapy. Stem Cells and Cloning:
Advances and Applications 2011, 4:61-72.
2. Chen A, Reuveny S, Oh S: Application of human mesenchymal and
pluripotent stem cell microcarrier cultures in cellular therapy:
Achievements and future direction. Biotechnology Advances 2013 in press.
3. Serra M, Brito C, Correia C, Alves PM: Process engineering of human
pluripotent stem cells for clinical application. Trends in Biotechnol 2012,
30:350-359.
Page 137 of 151
Figure 1(abstract P103) Up- and downstream processing of hMSCs. A) Growth profile of hMSC culture; profile of cumulative PDLs of hMSC cultured
in MesenCult®-XF (blue line) or in IMDM + 10% FBS (purple line) medium along culture time. B) Microcarriers’ removal using nylon filters with different
pore sizes (100, 80 and 30 μm). The (blue) bars represent the cell recovery yields, while the (green) line represents cell viability. C) Major outcomes
achieved after TFF processing of human foreskin fibroblasts and hMSCs.
4.
5.
6.
Pattasseril J, Varadaraju H, Lock L, Rowley J: Downstream Technology
Landscape for Large-Scale Therapeutic Cell Processing. BioProcess
International 2013, 11:46-52.
Peixoto C, Ferreira T, Sousa M, Carrondo MJT, Alves PM: Towards
purification of adenoviral vectors based on membrane technology.
Biotechnol Prog 2008, 24:1290-1296.
Spees J, Gregory C, Singh H, Tucker H, Peister A, Lynch P, Hsu S, Smith J,
Prockop D: Internalized antigens must be removed to prepare
hypoimmunogenic mesenchymal stem cells for cell and gene therapy.
Mol Ther 2004, 9:747-756.
P104
Culture supplement extracted from rice bran for better serum-free
culture
Satoshi Terada1*, Satoko Moriyama1, Ken Fukumoto1, Yui Okada1,
Rinaka Yamauchi1, Yoko Suzuki1, Masayuki Taniguchi2, Shigeru Moriyama3,
Takuo Tsuno3
1
Department of Applied Chemistry and Biotechnology, University of Fukui,
Fukui, 910-8507, Japan; 2Niigata University, Niigata, 950-2102, Japan; 3Tsuno
Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 649-7122, Japan
Introduction: In mammalian cell culture, fetal bovine serum (FBS) and
proteins including albumin (BSA) have been extensively added to culture
media as growth factor. But mammal-derived factors are potent source of
various infections such as abnormal prion and viruses, and so alternative
supplement is eagerly required. The alternative must be chemically defined
or obtained from plant, as well as should be produced in commercial
quantities and stably supplied.
As an alternative supplement, we focused on rice bran extract (RBE), byproduct of milling in the production of refined white rice, because rice bran
contains abundant nutrients and proteins [1] as well as antioxidants [2] and
because rice is cultivated plant, indicative of huge and stable supply.
Materials and methods: Preparation of RBE: RBE was extracted in
alkaline solution and then precipitated with acid. The precipitate was freezedried.
Effect of RBE on the culture of various cell lines: Mitogenic activity of
RBE was evaluated using cell lines. Cells were cultured in ASF104 medium
with or without RBE for several days. Then viable cell densities were counted
by trypan-blue method and concentration of MoAb was measured by ELISA.
Effect of RBE on the culture of MSC: Mesenchymal stem cells (MSCs)
were isolated from male Wistar rats and expanded in purchased serum-free
medium or conventional medium containing FBS. The expanded cells were
transferred to differentiation medium into bone. The differentiated cells to
bone were readily stained. Triplicated culture.
Effect of RBE on the culture of pancreatic islets: Pancreatic islets were
obtained from male Lewis rats and cultured in RPMI medium supplemented
with RBE or FBS for eight days.
Results and discussion: Effect of RBE on the culture of various cell
lines: On growth and MoAb production of hybridoma in serum-free
medium, desired effects of RBE were observed and the effect was superior
to BSA.
Similarly, serum-free culture of CHO-DP12 added with RBE exhibited
increased cell growth and production.
Growth of HepG2 and HeLa cells in the serum-free medium was also
improved.
Page 138 of 151
Introduction: Cryopreservation of the cells allows great flexible application
for cell therapy, as well as industrial production of biologics such as
antibody therapeutics. Conventionally, cryopreservative solution contains
both of fetal bovine serum (FBS) and dimethyl sulfoxide (DMSO) as a
cryoprotectant [1]. However, both of them have problems. FBS frequently
induces differentiation of stem cells and so it should not be used for cell
therapy. Additionally, FBS has serious concern about zoonotic infections
such as abnormal prions, pathogen of bovine spongiform encephalopathy
(BSE) [2,3], indicating necessity of FBS-free cryopreservative solution. DMSO
has cytotoxicity and often induces stem cells to differentiate [3]. Therefore, it
is necessary to reduce the concentration of DMSO in cryoprotectant
solution. In this study, we report that rakkyo fructan, plant-derived
polysaccharide, significantly improved the viability of the cells frozen in
DMSO-free solution.
Materials and methods: Cell line and culture condition: A mouse
hybridoma 2E3-O [4] was used for this study. 2E3-O was cultured in ASF104
(Ajinomoto, Tokyo, Japan) with 1 g/L bovine serum albumin (BSA, Wako
pure chemical industries, Osaka, Japan).
Polysaccharides and cryopreservative solution: Rakkyo fructan was
purified by the method in previous study [5]. Low molecular weight inulin
and high one were produced by Fuji Nihon Seito Co. (Tokyo, Japan). Levan
was purchased from Wako pure chemical industries. Each polysaccharide
was solved in phosphate buffer saline (PBS). FBS containing 10% DMSO was
used as positive control.
Cryopreservative procedure: 2E3-O cells were pre-cultured until 60-70%
confluent before cryopreservation. They were collected by centrifugation,
removed the culture supernatant and then suspended in the cryopreservative solution. They were transferred to freezing tubes, placed in a BIOCELL
container (Nihon freezer, Tokyo, Japan), frozen and stored at -80°C for several
days.
Thawing procedure and re-culture: Stored cells were defrosted at 37°C
rapidly then transferred to the culture medium. The defrosted cells were
centrifuged in order to the cryopreservative solution. Collected cells were
suspended by the culture medium again. A part of them was stained with
trypan blue exclusion method and counted with hemocytometer. The other
one was re-cultured in a multi well plate for several days. After that, grown
cells were stained with trypan blue exclusion method and counted with
hemocytometer.
Results and discussion: 2E3-O cells stored in 3 w/v%, 10 w/v% or 30 w/v%
rakkyo fructan solution. After frozen and thawed in 10 w/v% or 30 w/v%
rakkyo fructan solution, 2E3-O cells successfully survived and proliferated
(Figure 1). On the other hand, all 2E3-O cells stored in 3 w/v% rakkyo fructan
solution were dead (data not shown). This result shows that using rakkyo
fructan will be effective for serum-free cryopreservation without DMSO.
To compare the effect of rakkyo fructan on cellular protection, other fructans
such as inulin and levan were also used for cryopreservation. Four fructans
Figure 1(abstract P104) Effect of RBE on Serum-free Culture of
Islets. Islets were cultured in RPMI 1640 medium in the presence of RBE
or FBS as positive control.
Figure 1(abstract P105) The time curse of viable cell number after
thawing of frozen cells. 2E3-O cells were stored for three days in
10 w/v% rakkyo fructan (triangles) or 30 w/v% rakkyo fructan (circles).
The experiment was four trials.
Together all, RBE had mitogenic activity on various cell lines.
Effect of RBE on the culture of MSC: As primary cells, MSCs from Wistar
rat were expanded in serum-free medium with RBE or without and then the
medium was changed into osteoblast-inducing medium. While MSCs
expanded in the serum-free medium lost it, the cells expanded in the
presence of RBE retained the potency, suggesting that RBE contains
physiologically active substances maintaining potency of differentiation
during ex vivo serum-free culture.
Effect of RBE on the culture of pancreatic islets: Pancreatic islets, isolated
from Lewis rats, were also tested in the presence of RBE. While islets died
out by one week in basal medium, islets successfully survived in the
presence of RB. This result supports that RBE could alternate FBS in islets
culture.
Conclusion: RBE successfully improved the serum-free culture of four cell
lines including hybridoma, CHO, HepG2 and HeLa, as well as primary
culture of MSCs and pancreatic islets. These results indicate that RBE
would be useful as culture supplement in serum-free media.
References
1. Adebiyi AP, Adebiyi AO, Hasegawa Y, Ogawa T, Muramoto K: Isolation and
characterization of protein fractions from deoiled rice bran. European
Food Research and Technology 2008, 10.
2. Adebiyi AP, Adebiyi AO, Yamashita J, Ogawa T, Muramoto K: Purification and
characterization of antioxidative peptides derived from rice bran protein
hydrolysates. European Food Research and Technology 2008, 10.
P105
Cryopreservative solution using rakkyo fructan as cryoprotectant
Satoshi Terada1, Shinya Mizui1, Yasuhito Chida1, Masafumi Shimizu1,
Akiko Ogawa2*, Takeshi Ohura3, Kyo-ichi Kobayashi3, Saori Yasukawa4,
Nobuyuki Moriyama4
1
Department of Applied Chemistry and Biotechnology, University of Fukui,
3-9-1 Bunkyo, Fukui, 910-8507, Japan; 2Department of Chemistry and
Biochemistry, Suzuka National College of Technology, Shiroko-cho, Suzuka,
510-0294, Japan; 3Fukui Prefectural Food Process, 1-1-1 Maruoka-chotubonouchi, Sakai, 910-0343, Japan; 4ELLE ROSE CO., Ltd., 4-200
Saburoumaru, Fukui, 910-0033, Japan
Page 139 of 151
Table 1(abstract P105) Viable cell number of 2E3-O cells after frozen-thawing process
Cryopreservative solution
Mean degree of polymerization
Viable cell number (×106)
30 w/v% rakkyo fructan
390
99.5
30 w/v% inulin (low molecular weight)
16
64.5
10 w/v% inulin (high molecular weight)
19
5.0
1 w/v% levan
1000
0.2
Positive control
-
111
2E3-O cells were stored for three days. 1.18 × 106 cells were frozen.
were different in molecular weight and solubility. Rakkyo fructan and low
molecular weight inulin solved in water very much but high molecular
weight inulin solved in water up to 10 w/v% and levan dissolved in water.
Rakkyo fructan was the highest viable cell number among fructans (Table 1).
This result indicates that rakkyo fructan can protect animal cells more
effectively than other fructans. Using rakkyo fructan has some advantages:
1) using rakkyo fructan can avoid pathogenic contamination, 2) using rakkyo
fructan will not be occurred osmotic change of stored cells because
molecular weight of rakkyo fructan is over 10,000 (i.e. 30 w/v% rakkyo
fructan is about 0.03 M), and 3) rakkyo fructan is high water soluble, which is
easy to use.
Conclusion: In conclusion, the freezing media using rakkyo fructan will be
extensively used to protect animal cells against freezing stress without
DMSO.
References
1. Seth G: Freezing mammalian cells for production of biopharmaceuticals.
Methods 2012, 56:424-431.
2. Tonti GA, Mannello F: From bone marrow to therapeutic applications:
different behavior and genetic/epigenetic stability during mesenchymal
stem cell expansion in autologous and foetal bovine sera? Int J Dev Biol
2008, 52:1023-1032.
3. Santos NC, Figueira-Coelho J, Martines-Silva J, Saldanha C: Multidisciplinary
utilization of dimethyl sulfoxide: pharmacological, cellular, and
molecular aspects. Biochem Pharmacol 2003, 65:1035-1041.
4. Makishima F, Terada S, Mikami T, Suzuki E: Interleukin-6 is antiproliferative
to a mouse hybridoma cell line and promotive for its antibody
productivity. Cytotechnology 1992, 10:15-23.
5. Kobayashi K, Futigami S, Nishikawa K, Inaki Y, Tsuji Y: Japanese patent
application H10-158306 1998.
P106
Rice bran extract (RBE) as supplement for cell culture
Satoko Moriyama1, Ken Fukumoto1, Masayuki Taniguchi2, Shigeru Moriyama3,
Takuo Tsuno3, Satoshi Terada1*
1
University of Fukui, Fukui, 910-8507, Japan; 2Niigata University, Niigata,
950-2102, Japan; 3Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama,
649-7122, Japan
Introduction: In mammalian cell culture, fetal bovine serum (FBS) or
proteins obtained from mammals are usually supplemented to culture
media. Since the use of animal-derived components may cause an infection
of virus and other pathogens, alternative supplement derived from nonmammals is eagerly required in cell culture for producing biotherapeutics
and for cell therapy [1]. As an alternative supplement, we focused on rice
bran extract (RBE), because several studies have been done and reported
that RBE has some biological effects such as enhancement of NK cell activity
and anti-inflammatory effect on mice [2] and antioxidant effect [3].
Rice bran, by-product of milling in the production of refined white rice,
contains abundant nutrients and proteins. In this study, the effect of RBE
was examined in the serum-free culture.
Materials and methods: Effect of RBE on several cell lines: RBE was
extracted from rice bran in an alkaline solution, precipitated with acid, and
subsequently freeze-dried. The proceeding was performed by Tsuno Food
Infdustrial Co., Ltd. To test the effect, RBE was supplemented to the culture
of hybridoma cells, Chinese hamster ovary cells (CHO-DP12), hepatoma
HepG2 and HeLa. The cells were cultured in 24 well plate (Sumitomo
Bakelite, Japan) with 1 ml ASF104 medium (Ajinomoto, Japan) containing
RBE or BSA (Wako, Japan) as positive control. The cell density was estimated
using a hemacytometer. Viable cells were distinguished from dead cells by
trypan blue dye exclusion method. The production of antibodies from
hybridoma and CHO-DP12 cell was measured by ELISA method.
Fractionation of RBE with UF membrane: In order to identify the
growth factor(s) in RBE, fractionations were performed using UF
membranes. RBE was fractionated into the permeable and residual fraction
with ultrafiltration membrane Amicon Ultra-15 (Merck Millipore, Germany)
at 4,000 rpm, 40 min and 4°C. The fractions and whole RBE were added to
the culture of hybridoma and CHO-DP12 cells.
Results and discussion: Enhanced cell growth and productivity
using RBE: Figure 1 shows an enhanced proliferation by RBE. On growth
and monoclonal antibody production of hybridoma cells, RBE had desired
effect and the effect of RBE was superior to that of BSA. Similarly, to CHODP12 cells, addition of RBE exhibited increased cell growth and improved
the productivity of humanized antibody. Growth of HepG2 and HeLa cells
were also enhanced in the presence of RBE.
Improvement of fractionated RBE by UF membrane: Fractionated
RBEs by UF membranes were also tested. The fraction of RBE more than
60 kDa improved the proliferation of hybridoma cells and the level was
superior to that of whole RBE, while the fraction less than 60 kDa inhibited
the proliferation. This results suggest that in RBE, some lower molecular
inhibitor(s) and higher molecular growth factor(s) would be contained.
Conclusion: We provide the first evidence that RBE is an attractive culture
supplement to improve the proliferation and the production of mammalian
cells.
References
1. Leopold G, Thomas RK, Sonia N, Manfred R: Emerging trends in plasmafree manufacturing of recombinant protein therapeutics expressed in
mammalian cells. Biotechnology journal 2009, 4:186-201.
2. Kim HY, Kim JH, Yang SB, Hong SG, Lee SA, Hwang SJ, Shin KS, Suh HJ,
Park MH: A polysaccharide extracted from rice bran fermented with
Lentinus edodes enhances natural killer cell activity and exhibits
anticancer effects. Journal of medicinal food 2007, 10:25-31.
3. Elisa R, Consuelo SM, Miramontes E, Juan B, Ana GM, Olga C, Rosa C,
Juan P: Nutraceutical composition, antioxidant activity and
hypocholesterolemic effect of water-soluble enzymatic extract from rice
bran. Food Research International 2009, 42:387-393.
P107
Identification of mitogenic factor in rice bran for better mammalian cell
culture
Yoko Suzuki1, Satoko Moriyama1, Masayuki Taniguchi2, Shigeru Moriyama3,
Takuo Tsuno3, Satoshi Terada1*
1
University of Fukui, Fukui, 910-8507, Japan; 2Niigata University, Niigata,
950-2102, Japan; 3Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama,
649-7122, Japan
Introduction: In cell culture for biopharmaceutical production, serum-free
culture is required in order to avoid the risks associated with components of
mammal origin such as BSE. Although many serum-free medium have been
developed, there is yet room for improvement and protein hydrolysates
from crops are widely used as additives to improve the culture.
Page 140 of 151
Figure 1(abstract P106) Cell growth in serum-free medium containing RBE. a mouse hybridoma cell, b HeLa.
We found that rice bran extract (RBE), not hydrolysate, successfully
improved the proliferation of various cells as well as recombinant protein
production of CHO cells when RBE was added into serum-free culture.
Several studies have been done and reported that rice bran has antioxidant
potential [1,2] and a rice bran 57-kDa protein showed cell adhesion activity
for murine Lewis lung carcinoma cells [3].
RBE contains various components such as proteins and the factors activating
mammalian cells are not identified yet. In this study, we aim to identify the
effective factor in RBE.
Our colleague reports that heavier molecular weight fraction of RBE
improves the proliferation of various cells. Additionally, protein is the most
abundant component in RBE. Together with them, some of the proteins in
RBE would be the effective factor or the mitogen. We first determined
whether some of the proteins in RBE are the bio-active factor or not, and
then tried to identify which protein in RBE is the bio-active factor.
Materials and methods: Effect of heat treatment on RBE: RBE was
autoclaved at 121°C for 20 minutes. The heated RBE was supplemented
into the culture of murine hybridoma cell line 2E3-O. Hybridoma cells
were cultured in 24-well plate (Sumitomo Bakelite, Japan) with 1 ml
ASF104 medium (Ajinomoto, Japan) in the presence of heated RBE. On
day 3, viable cell number was determined by trypan blue dye exclusion
with hemocytometer.
Effect of trypsin treatment on RBE: RBE was digested with trypsin at 37°C
for 24 hours. The treated RBE was SDS electrophoresed to confirm RBE was
digested and to decide the condition. The trypsinized RBE was supplemented
to the culture of hybridoma cells. On day three, viable cell number was
determined.
Proteins in Rice Bran: Two kinds of oryzacystatins are known in rice bran;
oryzacystatin I and II. Antiserum against both oryzacystatin I and II was
prepared, and mobilized in HiTrap Protein A column (GE Healthcare, USA).
Using affinity chromatography, oryzacystatin I and II were eluted with 100
mM Glycine-HCL (pH 2.9) containing 2 M Urea. All purification steps were
done at 4°C.
The purified oryzacystatin was supplemented to the culture of hybridoma
cells. On day three, viable cell number was determined.
Results and discussion: Autoclaved RBE lost mitogenic activity: While
un-heated RBE successfully improved the proliferation, autoclaved RBE
failed, suggesting that mitogenic factors in RBE would be heat-sensitive.
Trypsinized RBE lost mitogenic activity: Most of proteins including 31
kDa protein of RBE were successfully digested with trypsin. Although the
proliferation of the cells treated with undigested RBE was stimulated, that
of the cells treated with trypsinized RBE was not, suggesting that
effective factors in RBE would be some proteins. Effect of trypsinized RBE
on hybridoma cell growth is shown in Figure 1.
Purified Oryzacistatin from RBE did not improve the cellular
proliferation: Oryzacystatin obtained from RBE did not improve the
culture of hybridoma, suggesting that oryzacystatin would not be mitogen.
Other proteins in RBE would have mitogenic effects on mammalian cells.
Conclusions: RBE improves the culture of various cells. Both of autoclaved
and trypsinized RBE had lost the mitogenic effect, suggesting that bioactive factors in RBE would be heat-sensitive ingredients, probably
proteins.
Among abundant proteins in rice bran, oryzacystatin was purified from
RBE and supplemented into the culture, but it failed to improve the
culture. Other proteins in RBE will be tested to identify bio-active factor
in RBE.
References
1. Adebiyi AP, Adebiyi AO, Hasegawa Y, Ogawa T, Muramoto K: Isolation and
characterization of protein fractions from deoiled rice bran. European
Food Research and Technology 2008, 10.
2. Adebiyi AP, Adebiyi AO, Yamashita J, Ogawa T, Muramoto K: Purification
and characterization of antioxidative peptides derived from rice bran
protein hydrolysates. European Food Research and Technology 2008, 10.
3. Shoji Y, Mita T, Isemura M, Mega T, Hase S, Isemura S, Aoyagi Y: A
Fibronectin-binding Protein from Rice Bran with Cell Adhesion Activity
for Animal Tumor Cells. Biosci Biotechnol Biochem 2001, 65:1181-1186.
Figure 1(abstract P107) Effect of trypsinized RBE on hybridoma cell
growth. RBE was digested with trypsin at 37°C for 24 hours.
P108
Protein folding and glycosylation process are influenced by mild
hypothermia in batch culture and by specific growth rate in continuous
cultures of CHO cells producing rht-PA
Mauricio Vergara1, Silvana Becerra2, Julio Berrios1, Juan Reyes3,
Cristian Acevedo4, Ramon Gonzalez5, Nelson Osses3, Claudia Altamirano1,2*
1
Escuela Ingeniería Bioquímica, Pontificia Universidad Católica de Valparaíso,
Valparaíso, 2362806, Chile; 2Centro Regional En Alimentos Saludables
(CREAS), Valparaíso, 2340025, Chile; 3Instituto Química, Pontificia Universidad
Católica de Valparaíso, Valparaíso, 2340025, Chile; 4Centro de Biotecnología,
Universidad Técnica Federico Santa María, Valparaíso, 2390123, Chile;
5
Department of Chemical and Biomolecular engineering, RICE University,
Houston, 77055, USA
Background: CHO cells are the primary host for the production of
different biopharmaceuticals, including recombinant proteins, monoclonal
antibodies, vaccines, etc. Primarily due to their ability to perform properly
folding and glycosylation processes required for these proteins acquire
adequate biological functionality.
However, culturing of these cells in the bioreactor still presents a number of
disadvantages, among which can be mention: nutrient depletion, toxic
byproducts accumulation, limited oxygen transfer, etc. These issues limit the
cell growth and early onset of programmed cell death, which restricts the
longevity of cultures and jointly specific productivity of recombinant protein.
To overcome these limitations, different approaches have been made to
maximize the productivity of these cultures. One of these approaches, that
has gained importance during the last 20 years is the use of mild
hypothermic temperatures, within a range of 33°C to 30°C. This strategy has
been demonstrated to reduce the rate of growth and metabolism of cells
but in turn increases the longevity of cultures and increase in specific
productivity of a wide range of recombinant proteins in batch cultures [1,2].
One possible cause involved in the increase of specific productivity of
recombinant proteins, is the increase in folding capacity and expression of
chaperones from endoplasmic reticulum [3,4]. However, the intracellular
mechanisms underlying the effect of temperature on the stages of posttranslational protein synthesis are still poorly understood.
In this regard, the study of endoplasmic reticulum processes (folding,
assembly and glycosylation of proteins, and degradation of misfolded
proteins through ERAD pathway) has reached a high interest in recent
years [4,5]. Reports show that the expression of several proteins associated
with the various processes that take place in the ER, are affected under
conditions of mild hypothermia. However, this phenomenon has not been
analyzed from a process perspective.
Page 141 of 151
Thus, this study investigated the effect of mild hypothermic temperatures
(33°C) on the process of protein folding of rht-PA expressed in CHO cells.
For this, inhibitors of protein translation, glycosylation and endoplasmic
reticulum associated degradation pathways (ERAD I: via the ubiquitin/
proteasome and ERAD II: autophagosome/Lysosome) were used. Two
experimental approaches were evaluated: batch culture and continuous
culture.
Materials and methods: Batch Culture: CHO cells were cultured in
HyClone SFM4CHO medium with out glucose, supplemented with 20 mM
glucose, at 95% relative humidity in an atmosphere of 5% CO2, at
temperatures of 37°C or 33°C. The inhibitors used to block processes in
the endoplasmic reticulum were: cycloheximide (Sigma, C4859)-protein
translation; tunicamycin (Sigma, T7765)-N-glycosylation of proteins,
MG132 (Merck, 474790)-ERAD I pathway; Pepstatin A (Merck, 516485),
Leupeptin (Merck, 108976) and E64d (Sigma, E8640)-ERAD II pathway.
Continuous culture: The bioreactor was inoculated and operated in
batch-mode during 48 h and it was then supplied with sterile feed
throughout the period of operation. A series of four experiments was
performed, in duplicate, at 37°C or 33°C, keeping D, at 0.014 and 0.012 h-1.
Cultures were considered to reach steady-state (SS) when, after at least
four residence times, both, the number of viable cells and lactate
concentration, were constant in two consecutive samples.
Cell growth was measured by counting cells by trypan blue method;
consumption and production of metabolites were measured by biochemical
analyzer (YSI 2700); protein rht-PA was measured by ELISA (Trinilize tPA
antigen) and enzymatic activity of the protein was measured by amidolytic
assay (S-2288 peptide, Chromogenix Italy). The results were analyzed by the
mathematical technique of PCA (Principal Component Analysis).
Results: The results of the batch cultures may indicate that the process of
protein folding is sensitive to mild hypothermia. Inhibition of glycosylation
process and ERAD pathways (ERAD I or II), under conditions of low
temperature, promotes the accumulation of intracellular deglycosylated rht-PA
as shown in Table 1. This response may indicate that the protein folding
process is attenuated under conditions of mild hypothermia, promoting
unfolded protein degradation by both ERAD pathways in CHO cells.
Recent reports [6,7] show that the effect of mild hypothermia condition in
batch culture is associated predominant with a decrease on specific cell
growth rate rather a decrease on culture temperature. To evaluate this fact,
we carried out continuous cultures at different dilution rates.
These results show that the degradation of the protein would be more
related to the decrease in specific growth rate than the temperature
decrease. Also show that the temperature decrease would promote an
increase in protein folding capacity of the endoplasmic reticulum. This fact is
clearly observed at low specific growth rate (Table 1).
The cell behavior was evaluated using the technique of principal component
analysis (PCA) in both, batch and continuous culture Figure 1.
Table 1(abstract P108) Intracellular rht-PA content (% of control) on CHO cells by inhibition of translation and
glycosylation prosesses and ERAD I and II pathways at 37°C and 33°C
Dilution rate (h-1)
0.014
Temperature
0.012
Temperature
Temperature
Batch Cultures
37°C
33°C
Continuous Cultures
37°C
33°C
37°C
33°C
CC
1001
1002
SS
1003
1004
1005
1006
TM*
TM/ERAD I*
107
87
140
201
CHX/ERAD I**
CHX/ERAD II**
120
107
117
115
185
242
139
150
TM/ERAD II*
79
176
CC: Control Culture; TM: Culture inhibited glycosylation; TM/ERAD I or II: Culture inhibited glycosylation and ERAD I or II; SS: Steady State; CHX/ERAD I or II:
Culture inhibited translation and ERAD I or II; *Values at 24 hours after perturbation with inhibitors respect to CC value at 0 h. **At 48 hours after perturbation
with inhibitors respect to value at SS.
1
Concentration (8,8 ng/106 cells).
2
3
4
5
6
Page 142 of 151
Figure 1(abstract P108) First principal plane and Loads of first and second principal component of Batch and Continuous cultures.
A: First principal plane of Batch culture B: First principal plane of continuous culture; C: Loads of first and second principal component of Batch cultures.
D: Loads of first and second principal component of Continuous cultures.
The first principal plane (PC1 axis and PC2 axis) of batch cultures (Figure
1A) shows that there are only two values whose behavior is significantly
away from the origin (P < 0,05). These correspond to the behavior of the
tested batch cultures at 24 h at 37°C and 33°C, respectively. This indicates
the great influence of culture temperature on cell behavior. The first
principal plane of continuous culture (Figure 1B) shows the behavior of
cells organized into two major groups, which are correlated with both
dilution rates tested.
PC1 loads of batch cultures (Figure 1C) suggest that low temperature
reduces the ability of the protein folding; this would explain the
accumulation of intracellular deglycosylated rht-PA. However, loads of PC1
from continuous cultures (Figure 1D) shows that increasing of intracellular
rht-PA content is associated with the reduction in the rate of dilution and is
not associated with a lower temperature.
Conclusions: Experimental approach of continuous culture revealed that
reduction on specific growth rate is associated to an increase ERAD
activity on rht-PA while the temperature reduction may have a positive
effect on protein folding. Moreover, PCA analysis indicated that specific
growth rate is also responsible for general behavior exposed by CHO
cells.
References
1. Yoon SK, Song JY, Lee GM: Effect of low culture temperature on specific
productivity, transcription level, and heterogeneity of erythropoietin in
2. Bollati-Fogolín M, Forno G, Nimtz M, Conradt HS, Etcheverrigaray M,
Kratje R: Temperature reduction in cultures of hGM-CSF-expressing CHO
cells: effect on productivity and product quality. Biotechnology Progress
2005, 21:17-21.
3.
4.
5.
6.
7.
Baik JY, Lee MS, An SR, Yoon SK, Joo EJ, Kim YH, Park HW, Lee GM: Initial
Transcriptome and Proteome Analyses of Low Culture TemperatureInduced Expression in CHO Cells Producing Erythropoietin. Biotechnol
Bioeng 2006, 93:361-371.
Masterton RJ, Roobol A, Al-Fageeh M, Carden M, Smales CM: PostTranslational Events of a Model Reporter Protein Proceed With Higher
Fidelity and Accuracy Upon Mild Hypothermic Culturing of Chinese
Hamster Ovary Cells. Biotechnol Bioeng 2010, 105:215-220.
Gomez N, Subramanian J, Ouyang J, Nguyen M, Hutchinson M, Sharma VK,
Lin AA, Yuk IH: Culture Temperature Modulates Aggregation of
Recombinant Antibody in CHO Cells. Biotechnol Bioeng 2012, 109:125-136.
Becerra S, Berrios J, Osses N, Altamirano C: Exploring the effect of mild
hypothermia on CHO cell productivity. Biochem Eng J 2012, 60:1-8.
Vergara M, Becerra S, Berrios J, Osses N, Reyes J, Rodríguez-Moyá M,
Gonzalez R, Altamirano C: Differential effect of culture temperature and
specific growth rate on CHO cell behavior in continuous culture. Bioch
Eng J 2013, submitted.
P109
The combined use of platinum nanoparticles and hydrogen molecules
induces caspase-dependent apoptosis
Takeki Hamasaki1, Tomoya Kinjyo2, Hidekazu Nakanishi2, Kiichiro Teruya1,2,
Sigeru Kabayama3, Sanetaka Shirahata1,2*
1
Department of Bioscience and Bioengineering, Faculty of Agriculture,
Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan;
2
Graduate School of Systems Life Sciences, Kyushu University, 6-10-1
Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan; 3Nihon Trim Co. LTD., 34-8-1
Ooyodonaka, Kita-ku, Osaka 531-0076, Japan
We previously reported electrochemically reduced water (ERW), produced
near the cathode by electrolysis, exhibits reductive activity. We also revealed
that ERW contains Pt nanoparticles (Pt nps) derived from Pt-coated titanium
electrodes in addition to high concentration of dissolved molecular
hydrogen (H2) by in vitro assay, and Pt nps exhibit powerful ROS scavenger
activity and catalysis activity converting H2 to active hydrogen. Our study
investigates apoptosis inducibility of H2 and synthesized Pt nps on human
promyelocytic leukaemia HL60 cells. Human promyelocytic leukaemia cells
(HL60) were cultured in RPMI 1640 medium supplemented with 10% FBS,
2.0 mM l-glutamine, 100 U/ml penicillin and 100 U/ml streptomycin. Cultures
were incubated in an atmosphere of 75%(v/v) H2/20%(v/v) O2/5%(v/v) CO2,
75%(v/v) He/20%(v/v) O2/5%(v/v) CO2 atmosphere or 75%(v/v) N2/20%(v/v)
O2/5%(v/v) CO2 atmosphere for 12-48 hr after incubated with Pt nps for 2 h.
Untreated cultures were included as controls. Cytotoxicity was determined
by cell-counter. Apoptosis pathway of HL60 cells was investigated by Sub
G-1 assay.
Growth suppression was not observed when cells were treated with Pt nps
or H2 only. Analysis of cell cycle and activity of caspase-3 suggested that
combination use of both Pt nps and H2 induced apoptosis in HL60 cells. Our
caspase activity experimentation suggests that apoptosis was caused via
caspase-8 activation. These results suggested that atomic hydrogen from H2
induces caspase-8 dependent apoptosis. The cytotoxicity was not detected
in Pt nps or H2 separately treated cells. Apoptosis was determined only
when cells were treated with both Pt nps and H 2 , suggesaspase-8
dependent apoptosis was caused by atomic hydrogen produced from H2 by
catalyst activity of Pt nps.
P110
Rec. ST6Gal-I variants to control enzymatic activity in processes of
in vitro glycoengineering
Alfred M Engel1*, Harald Sobek1, Michael Greif1, Sebastian Malik2,
Marco Thomann2, Christine Jung2, Dietmar Reusch2, Doris Ribitsch4,
Sabine Zitzenbacher4, Christiane Luley4, Katharina Schmoelzer4,
Tibor Czabany5, Bernd Nidetzky4,5, Helmut Schwab4,6, Rainer Mueller3
1
Professional Diagnostics, Roche Diagnostics GmbH, 82372 Penzberg,
Germany; 2Pharma Biotech Development, Roche Diagnostics GmbH, 82372
Penzberg, Germany; 3Applied Science, Roche Diagnostics GmbH, 82372
Page 143 of 151
Penzberg, Germany; 4ACIB GmbH, 8010 Graz, Austria; 5Institute of
Biotechnology and Biochemical Engineering, Graz University of Technology,
8010 Graz, Austria; 6Institute of Molecular Biotechnology, Graz University of
Technology, 8010 Graz, Austria
Background: Glycosylation is an important posttranslational modification
of proteins influencing protein folding, stability and regulation of the
biological activity. The sialyl mojety (sialic acid, 5-N-acetylneuramic acid) is
usually exposed at the terminal position of N-glycosylation and therefore, a
major contributor to biological recognition and ligand function, e.g. IgG
featuring terminal sialic acids were shown to induce less inflammatory
response and increased serum half-life.
The biosynthesis of sialyl conjugates is controlled by a set of sugar-active
enzymes including sialyltransferases which are classified as ST3, ST6 and
ST8 based on the hydroxyl position of the glycosyl acceptor the Neu5Ac is
transferred to [1]. The ST6 family consists of 2 subfamilies, ST6Gal and
ST6GalNAc. ST6Gal catalyzes the transfer of Neu5Ac residues to the
hydroxyl group in C6 of a terminal galactose residue of type 2 disaccharide
(Galb1-4GlcNAc).
To our knowledge, the access to recombinant ST6Gal-I for therapeutic
applications is still limited due to low expression and/or poor activity in
various hosts (Pichia pastoris, Spodoptera frugiperda and E. coli).
The present study describes the high-yield expression of two variants of
human beta-galactoside alpha-2,6 sialyltransferase 1 (ST6Gal-I, EC 2.4.99.1;
data base entry P15907) by transient gene expression in HEK293 cells with
yields >100 mg/L featuring distinct mono- (G2+1SA) as well as bi- (G2+2SA)
sialylation activity.
Materials and methods: Two N-terminally truncated fragments of human
ST6Gal-I (delta89, residues 89-406, and delta108, residues 109-406) were
designed for transient gene expression (TGE): Instead of the natural leader
sequence and N-terminal residues, both ST6Gal-I coding regions harbor
the Erythropoietin (EPO) signal sequence in order to ensure correct
processing of the polypeptides by the secretion machinery. Following
cloning into pM1MT, expression of the ST6Gal-I coding sequences is under
control of a hCMV promoter followed by an intron A.
Sialyltransferase assays: 1. Asialofetuin was used as acceptor and CMP-9FNANA as donor substrate. Enzymatic activity was determined by measuring
the transfer of 9F-NANA to asialofetuin. 2. Recombinant humanized IgG1
and IgG4 monoclonal antibodies (mabs), characterized as G2+0SA, as well as
desialylated EPO were used as targets in sialylation experiments (30 μg
enzyme/300 μg target protein). Both enzyme variants of ST6Gal-I (delta89
and delta108) were used under identical reaction conditions and the
sialylation status was analyzed by mass spectrometry.
Results: In using the suspension-adapted human embryonic kidney (HEK)
293-F cell line, a modified serum-free FreeStyle™ medium platform plus
transfection by the 293-Free™ reagent, we were able to install a TGE shaker
fermentation process with product yields of up to 200 mg/L culture
supernatant. Both variants delta89 and delta108 could be isolated to >98%
purity by a simple 2-step purification protocol.
To our surprise, both variants show a distinct and different sialylation
activity as shown by sialylation kinetics of a IgG4 molecule (Figure 1).
Recently, the crystal structure of the delta89 variant could be determined
as first human ST6Gal-I by SIRAS phasing using an iodide soak as
derivative I [2]: An elongated glycan from a crystallographic neighbour
binds to the active site, mimicking a substrate complex. An analysis of
substrate interactions and comparison to other sialyltransferases allows
modelling of a Michaelis complex and conclusions on the catalytic
mechanism.
Due to their high expression rates and easy purification, both recombinant
variants (delta89 and delta108) of human ST6Gal-I are available in large
quantities and high purity. Both variants are active with high molecular
weight substrates like monoclonal antibodies. To our surprise, they show
different performance in sialylation experiments using with bi-antennary
glycans such as mabs as well as tetra-antennary glycans (data not shown)
as substrate. Under identical reaction conditions, bi-sialylated glycans are
obtained in using variant delta89, whereas delta108 yields mono-sialylated
glycans.
Our findings on variant delta108 are in contradiction to previous studies [3]
claiming that the conserved QVWxKDS sequence, residues 94-100 of
human ST6Gal-I, being essential for its catalytic activity.
Page 144 of 151
Figure 1(abstract P110) Left panel: Variant delta89 yields 88% G2+2SA sialylation. However, after prolonged incubation (24 hrs), the bi-sialylation is
reduced to a stable mono-sialylation product, presumably by a sialydase activity. Right panel: Variant delta108 yields 70% G2+1SA and 7% G2+2SA
sialylation.
To our knowledge, these human ST6Gal-I variants are the first enzymes
available in large quantities and currently, recombinant alpha-2,3
sialyltransferase 1 (ST3Gal-I) and beta-1,4 galactosyltransferase 2 (B4Gal-T2)
are developed in order to strengthen this enzyme portfolio. Together with
the already available donor substrates (activated sugars), a complete set of
reagents will be soon available for the commercial glycoengineering of
proteins.
References
1. Weijers CA, Franssen MC, Visser GM: Glycosyltransferase-catalyzed
synthesis of bioactive oligosaccharides. Biotechnol Adv 2008, 26:436-456.
2. Kuhn B, Benz J, Greif M, Engel AM, Sobek H, Rudolph MG: Crystal structure
of human 2,6 sialyltransferase reveals mode of binding of complex
glycans. Acta Crystallographica 2013, D69:1826-1838.
3. Donadio S, Dubois C, Fichant G, Roybon L, Guillemot JC, Breton C, Ronin C:
Recognition of cell surface acceptors by two human alpha-2,6sialyltransferases produced in CHO cells. Biochimie 2003, 85:311-321.
P111
Accelerating stable recombinant cell line development by targeted
integration
Bernd Rehberger*, Claas Wodarczyk, Britta Reichenbächer, Janet Köhler,
Renée Weber, Dethardt Müller
Rentschler Biotechnologie GmbH, 88471 Laupheim, Germany
Introduction: Targeted integration (TI) allows fast and reproducible genetic
modification of well characterized previously tagged host cells thus
generating producer cells with predictable qualities. Concurrently, timelines
are cut by 50% compared to random integration (RI) based cell line
development. In contrast to commonly low productivities of cell lines
generated by TI, we developed a system for CHO cells leading to
productivities of more than 1 g/L within weeks using the TurboCell™ platform.
The system is based on CHO K1 cells that have been tagged with a GFP
expression cassette flanked by recombinase recognition sites. Following
GFP based FACS enrichment and cloning of the tagged cells, over 4000
clones were screened for growth, productivity, GFP expression stability
and integration status of the GFP expression cassette. The best clones
were selected to be used as “Master TurboCell” (MTC) host cell lines for
recombinant cell line development.
Generation of producer TurboCell™ lines: A selected MTC host cell line
is co-transfected using a TurboCell™ expression plasmid containing the gene
of interest (GOI) expression cassette flanked by matching recombinase
recognition sites together with a plasmid encoding the recombinase enzyme
required for RMCE. Upon transfection both plasmids enter the MTC’s nucleus
initiating transient expression of the recombinase which further mediates the
stable exchange of the GFP expression cassette against the GOI expression
cassette. Thus, the GOI is stably introduced into the tagged genomic spot
shortly after the transfection. Cells are cultivated for a few days to recover
from the transfection procedure and to allow GFP to fade out of RMCE
positive cells. The transfected pools are thereupon sorted by FACS in order to
remove the majority of GFP positive cells. The remaining producer
TurboCell™(PTC) pools in general comprise of 90-99% GFP negative, GOI
expressing cells that are genetically identical due to the conserved locus of
GOI integration. This allows the production of recombinant protein from PTC
enriched pools at a very early stage of 3 weeks upon transfection. Due to
their genetic homogeneity the physiological diversity of the clones within
the pool is limited thus leading to only small variations in the recombinant
protein produced. Therefore, material drug candidate screening prepared on
the parental PTC pool level should only differ slightly from material produced
from clones thereof. Following FACS sorting, the PTC pools can be cloned, if
required. Due to the high degree of similarity of all clones, the screening
effort to find the best clone can be limited to about 10 clones. Recombinant
protein material from clones can be produced 9 weeks upon transfection.
Molecular biological analysis of producer TurboCell™ lines: In order
to prove successful RMCE reproducibly taking place without additional
random integration of the remaining plasmid, genomic DNA was prepared
from clonal PTC for Southern Blot analysis. The genomic DNA was digested
with a restriction enzyme cutting the correctly integrated targeting vector
into two pieces, one fragment only comprising internal vector sequences, as
well as a second fragment also comprising CHO derived sequences of the
specific integration locus. As both fragments carry sequences of the CMV
promotor, both can be visualized using one single CMV promoter-specific
probe. As only two bands occur in case of successful RMCE, cell lines
showing more than two bands indicate clones with randomly integrated
targeting vector molecules in addition to RMCE. Statistics of several cell line
generation projects show that in about 90% of all analyzed clones a correct
RMCE without additional random integration events takes place. This allows
for a significant reduction in clone screening efforts to a level of 10 clones
per project.
Process characteristics: To show the feasibility of the TurboCell™ system
for recombinant protein production in fed batch cultivations, a PTC clone
producing IgG1 was cultivated in a stirred tank bioreactor. The data of this
bioreactor were compared to two shake flask fed batch runs performed with
the same PTC and the same media system (Rentschler’s proprietary media +
GE Healthcare’s ActiCHO feed) in parallel. Figure 1a shows a comparison of
viable cell density and product concentration. The better performance in the
bioreactor indicates that the PTC can be easily transferred from shake flask
to bioreactor settings. The maximum cell density of 13*106 cells/mL, as well
as the integral of viable cells over the cultivation time, and the maximum
product titer of more than 1 g/L IgG1 proved the feasibility of the
TurboCell™ system for the production of recombinant proteins even in
larger amounts at a very early stage of a biopharmaceutical development
project.
Analysis of Protein Quality: Both amount of glycosylation and glycosylation pattern in different Turbo Cell subsets were analyzed
Figure 1b shows that clones derived from the same parental pool differ
only slightly regarding their glyco pattern and they are very similar to their
parental pool. Even if different antibodies are expressed from pools
derived from the same MTC the variation between the pools is within the
range of clones compared to each other. Significant variations in the glyco
Page 145 of 151
Figure 1a(abstract P111) Comparison of cell growth and recombinant protein production in a bioreactor versus shake flask. Figure 1b:
Comparison of glycopatterns. The first row compares three clones derived from one parental pool of one defined MTC with each other and with the
relevant parental pool. The second row compares mAb material derived from two PTC pools derived from different, not related MTCs. The third row
compares two types of IgG1 antibodies expressed from PTC pools derived from the same MTC.
pattern can only be detected, if antibody material derived from pools
descendent from different, unrelated MTCs is compared (indicated by
yellow arrows).
Conclusions: Within 3 weeks upon transfection and targeted integration,
producer cell pools were FACS sorted to purities of >95%. These cells were
suited for high quality recombinant protein material production in fed batch
runs exceeding 1 g/L IgG1. Clones generated thereof behaved similar to the
pools in terms of productivity and product quality, cell growth and
metabolism. From those clones analyzed a mean of about 90% showed
successful RMCE without unintended random integration. Cellular properties
and productivities of the clones were as expected and variations between
different clones were marginal. Thus, the TurboCell™ system reduces clone
screening efforts to a minimum allowing the simultaneous production of
multiple recombinant proteins in stable CHO cells with optimal use of
resources. This makes the TurboCell™ system an interesting tool for
candidate screening and early phases material production even in large
scale setups.
P112
Differential affects of low glucose on the macroheterogeneity and
microheterogeneity of glycosylation in CHO-EG2 camelid monoclonal
antibodies
Bo Liu1*, Carina Villacres-Barragan1, Erika Lattova2, Maureen Spearman1,
Michael Butler1
1
Dept of Microbiology, University of Manitoba, Winnipeg, Manitoba, R3T 2N2,
CA, USA; 2Dept of Chemistry, University of Manitoba, Winnipeg, Manitoba,
R3T 2N2, CA, USA
Background: The demand for high yield recombinant protein production
systems has focused industry on culture media and feed strategies that
optimize productivity, yet maintain product quality attributes such as
glycosylation. Minimizing media components such as glucose, reduces the
production of lactate, but may also affect glycosylation. The first steps in the
glycosylation pathway involve the synthesis of lipid-linked oligosaccharides
(LLOs). Glycan macroheterogeneity is introduced by variation in site-specific
glycosylation with the transfer of the oligo-saccharide to the protein. Further
modification of the oligosaccharide can occur through processing reactions,
where some sugars are removed and additional sugars added. This
produces microheterogeneity of the glycan pool. Both macroheterogeneity
and microheterogeneity may be affected by fermentation conditions. The
objective of this study has been to investigate the effect of variable
concentrations of glucose on the glycosylation patterns of a camelid
monoclonal antibody produced in Chinese hamster ovary (CHO) cells and to
further evaluate their effect on components of the N-glycosylation pathway.
Materials and methods: A CHO cell line recombinantly expressing
chimeric antibodies EG2 with a camelid single domain fused to human Fc
regions was used in this study. Cells were inoculated at 2.6 x 106 cells/ml
into 7 shake flasks (250 ml) each containing 80 ml of media with a different
initial glucose concentration varying from 0 to 25 mM. The cultures were
maintained and monitored under standard shaking conditions in an
incubator over a 24 hr period.
Cells were harvested and quenched to stop any subsequent metabolic
activities [1]. LLOs were extracted from the cells using a previously
established method [2]. Mild acid cleaved glycans were labeled with 2aminobenzamide and analyzed by high performance liquid chromatography
(HPLC) using the technique of hydrophilic interaction liquid chromatography
(HILIC). The structures were assigned using standard GU values from the
GlycoBase database (NIBRT.ie) [3] and confirmed by Mass spectrometric
analysis.
Antibodies were purified from culture supernatants with a Protein A affinity
column and run under denaturing conditions on 8-16% SDS-PAGE gels and
stained with Coomassie Brilliant Blue (CBB). The density ratio between
upper and lower bands was determined by densitometry. The protein
bands were removed by scalpel, washed, and treated with Peptide-NGlycosidase F for 18 h to remove the attached glycans. MS analysis was
carried out on the MALDI-TOF/TOF mass spectrometer to confirm
aglycosylated Mabs in the lower band, and glycosylated proteins present
in the upper band. The isolated N-linked glycans were labeled with 2-AB
[4]. Glycan structures were assigned using standard GU values from HILIC
analysis in GlycoBase. Structures were confirmed by exoglycosidase
enzymatic digestion arrays according to method of Royle et al (2010).
Results: Peaks corresponding to the LLOs from each of the previously
described cultures with varying glucose concentration cultures were
compared (Figure 1.A.). Samples from cultures containing 25mM glucose
displayed a prominent large peak with a GU value of 11.7 representing
63% of the total LLOs and designated as the Glc3Man9GlcNAc2a structure
(Figure 1.A.). Small peaks were designated as Glc2Man9GlcNAc2,
Glc1Man9GlcNAc2, Man9GlcNAc2, Man5GlcNAc2 and Man2GlcNAc2
structures. For cells grown at an initial glucose concentration of less than
15 mM the predominant peak was Man2GlcNAc2 with a significant level of
the Man5GlcNAc2 structure but the percentage of the Glc3Man9GlcNAc2
structure was reduced significantly to 2.9% of the overall LLOs. It is
important to note that these cultures (≤15mM glucose) were under
conditions of glucose depletion for at least 4 h prior to harvest.
LLO with a completed glycan structure Glc3Man9GlcNAc2 is an essential
precursor for N-glycosylation. Thus, the effect of glucose concentration on
the macroheterogeneity and microheterogeneity of the fully formed
glycoprotein were examined next. Protein A purified antibodies from cultures
after 24 h were analyzed on reduced SDS-PAGE gels 1. B. The antibodies
produced by cells grown in 17.5-25 mM glucose displayed one single strong
band corresponding to the glycosylated heavy chain. Proteins isolated from
cell culture with 15 mM initial glucose concentration (Lane 5) showed a faint
band underneath the predominant gel band. The proportional density of the
lower band in the 12.5 mM glucose sample was 26% which increased
gradually to 52% for samples taken from cultures with no added glucose
(Table 1). The lower protein bands were suspected to be deglycosylated
proteins due to an estimated 2% weight loss, which corresponds to the
typical mass of glycan found on IgGs [5]. Samples of antibody showing two
gel bands were analyzed by MALDI-MS. This showed m/z values of 82,670
and 79,350 which are the expected masses of the glycosylated and nonglycosylated forms, respectively of the complete antibodies.
To compare the difference in glycosylation profiles of EG2 antibodies
induced by various glucose concentrations, the glycans were released from
the Protein A-purified Mabs with PNGase F, and analyzed by HILIC HPLC.
Page 146 of 151
The glycan pool was separated into six major peaks which eluted between
33 and 43 minutes with corresponding GU values between 5 and 9
(Figure 1. C.). Structures were provisionally assigned from GU values with
reference to the Glycobase and confirmed by a series of exoglycosidase
enzyme array digestions. This allowed the identification of biantennary
glycan structures with variable galactosylation, fucosylation and sialylation.
The predominant glycan structure of antibodies isolated from the 25 mM
glucose culture was the fully galactosylated biantennary and fucosylated
structure, Fuc(6)GlcNAc2Gal2 , which comprised 60% of the overall glycans.
Fuc(6)GlcNAc2Gal0 and Fuc(6)GlcNAc2Gal2 structures were determined at
6% and 34%, respectively. The structures were found in samples from all
cultures analyzed but there was a significant shift to lower galactosylation
and sialylation in samples derived from cultures with lower glucose.
a
Glc, glucose; Man, mannose; GlcNAc, N-acetylglucosamine.
b
Fuc, fucose; Gal, galactose.
Each glycan pool was assigned a galactosylation index (GI) and a sialylation
index (SI) based upon the relative peak areas on the HPLC profile. In this
experiment the GI value changed from 0.35 to 0.72 as the availability of
glucose increased for the cells. Sialylation is dependent upon prior
galactosylation of a glycan and consequently shows lower values with
corresponding SI values from 0.019 to 0.058. There was a strong positive
correlation between the GI and SI value determined for each sample and
the time spent by the corresponding cells in glucose deprived media over
the 24 h experimental period (R2 = 0.965 and 0.936 for the GI and SI
values respectively; Figure 1.D.).
Conclusion: N-glycosylation is an important post-translation modification in
mammalian cells, which is known to impact the quality and efficacy of
therapeutic recombinant proteins. In this study, we focused on the effect of
glucose concentration on several aspects in N-glycosylation pathways in
CHO-EG2 cells. The depletion of glucose as the main carbohydrate source
during cell culture, can reduce the capacity for N-glycosylation. Reduced
availability of the full-length LLO precursor occurred by glucose deprivation
and resulted in the accumulation of truncated dolichol linked glycans. This
led to reduced glycosylation in the EG2 antibodies. Glucose deprivation also
led to changes in microheterogeneity with a decrease in galactosylation and
sialylation. It is concluded that low glucose concentrations in culture altered
LLO synthesis and N-glycan profiles of the antibody.
Acknowledgements: This work is supported by the Natural Sciences and
Engineering Research Council of Canada (NSERC) and MabNet. Author
would like to thank Dr. Michael Butler at University of Manitoba for
instructing and all members in Butler’s lab.
References
1. Sellick CA, Hansen R, Maqsood AR, Dunn WB, Stephens GM, Goodacre R,
Dickson AJ: Effective quenching processes for physiologically valid
metabolite profiling of suspension cultured Mammalian cells. Anal Chem
2009, 81:174-183.
2. Gao N, Lehrman MA: Non-radioactive analysis of lipid-linked
oligosaccharide compositions by fluorophore-assisted carbohydrate
electrophoresis. Meth Enzymol 2006, 415:3-20.
3. Royle LL, Campbell MPM, Radcliffe CMC, Rudd PMP, Dwek RAR: GlycoBase
and autoGU: tools for HPLC-based glycan analysis. Bioinformatics 2008,
24:1214-1216.
4. Detailed Structural Analysis of N-Glycans Released From Glycoproteins
in SDS-PAGE Gel Bands Using HPLC Combined With Exoglycosidase
Array Digestions. Methods in Molecular Biology 2010, 347:125-143.
5. Deisenhofer J: Crystallographic refinement and atomic models of a human
Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-A resolution. Biochemistry 1981,
20:2361-2370.
P113
Development and application of an automated, multiwell plate based
screening system for suspension cell culture
Sven Markert*, Carsten Musmann, Klaus Joeris
Roche Diagnostics GmbH, Pharma Biotech Production and Development,
Penzberg, Germany
Introduction: The already presented automated, multiwell plate (MWP)
based screening system for suspension cell culture is now routinely used in
Page 147 of 151
Figure 1(abstract P112) The availability of glucose to CHO cells affects the intracellular lipid-linked oligosaccharide distribution, site occupancy
and the N-glycosylation profile of a monoclonal antibody. A. Lipid-linked oligosaccharide (LLO) profiles. The glycans from each sample were acid
hydrolyzed from the lipid carriers, 2-AB labeled and detected by HILIC. (Glc Δ Man Ο and GlcNAc ?). B. Separation of EG2 antibodies on reduced 8-16%
SDS-PAGE gel. The purified antibody in lane 8 was isolated from the culture prior to the 24 h incubation. Upper bands in lanes 1 to 4 correspond to
glycosylated antibodies, and the lower bands were determined to be non-glycosylated antibodies. C. HPLC profiles of N-glycans isolated from EG2
antibodies produced by CHO cells with various initial glucose concentrations during a 24 h incubation. D. The effect of exposure time of cells to media
depleted of glucose on the galactosylation (GI; |) and the sialylation (SI; ?) indices of EG2 antibodies produced by CHO cells.
process development. It is characterized by a fully automated workflow with
integrated analytical instrumentation and uses shaken 6-24 well plates as
bioreactors which can be run in batch and fed-batch mode with a capacity
of up to 384 reactors in parallel [1].
A wide ranging analytical portfolio is available to monitor cell culture
processes and to characterize product quality. Assays running on the
screening system comprise the determination of cell concentration and
viability, quantification of nutrients and metabolites as well as detection of
apoptosis level and staining of organelles. Additionally a RT-qPCR method
has been setup to measure gene expression level in a high throughput
manner. Having a large network in-house to high throughput groups of
the analytical department a lot of advanced methods can easily be
Table 1(abstract P112) Quantitative densitometry of Protein A purified EG2 antibodies stained with coomassie blue (n = 5)
Initial glucose concentration (mM)
% Glycosylated protein
% Non-glycosylation protein
0
48 ± 1
52 ± 1
5
10
60 ± 4
69 ± 2
40 ± 4
31 ± 2
12.5
74 ± 2
26 ± 2
15
100
0
17.5
100
0
25
100
0
Control
100
0
performed like chromatographic and mass spectrometry to characterize
product quality.
Current work focuses on expanding the analytical portfolio to develop
control strategies for automated cell culture processes. Besides setting up
a robust method for pH measurement we evaluate different spectroscopic
techniques like Raman, infrared or 2D fluorescence as fast and powerful
analytical tools.
Results: Scale-up prediction: The comparability of results obtained with
multiwell plates and bioreactors had to be verified to develop a screening
system for the predictive scale-up.
Using several late stage project cell lines growing in suspension the
comparability of results obtained with automated, shaken multiwell plates
and bioreactors with a volume of up to 1.000 L could be verified. The
effects of process optimization steps on cell culture performance and
product quality were shown in multiwell plates and bioreactors. Thus, the
automated cell culture screening system can be used for scale up
prediction.
Application of pH measurement and pH control: A fully automated,
multiwell plate based pH measurement assay and a pH control strategy
was developed for the screening system. The established assay is based
on the use of pH sensitive absorption and fluorescent dyes which are
added to a cell culture sample. The advantages of this method comprise
a short analytical time and the low sample volume per sample. The assay
is characterized by a high precision and robustness without any probe
drift during a cultivation time of up to two weeks.
The successful application of the developed pH measurement and pH
control could be confirmed by getting comparable pH profiles from MWP
and bioreactor under the same conditions and can be kept equal by
controlling the pH (Figure 1A).
In a second experiment a pH shift of 0.4 pH values after 72 hours was
performed (Figure 1B). The target pH was reached exactly and it could be
controlled at a stable level using the developed pH measurement assay.
Feasibility of Raman spectroscopy as high throughput analytical
tool: Raman spectroscopy is a powerful tool for the detection and
quantification of several components in cell culture processes at once. Using
this fast and non-invasive analytical technique there will be no reagent costs
and no sample consumption what this technique makes ideal for small scale
high throughput systems.
The feasibility of Raman spectroscopy was shown for the quantification of
different metabolites and nutrients, i.e. glucose, lactate and glutamine.
For the quantification of glucose (0 g/L to 20g/L), lactate (0 g/L to 10 g/L)
and glutamine (0 g/L to 20 g/L) a good correlation with a high prediction
accuracy could be shown.
Conclusions and outlook: The developed robotic screening system is
capable of performing a fully automated workflow consisting of incubation,
sampling, feeding and near real-time analytics. In the performed experiments
the scalability from mL scale up to 1000 L scale could be shown.
Page 148 of 151
Expanding the analytical portfolio a robust and fast pH measurement assay
was developed to enable pH control in multiwell plates. This assay as well
as pH control was tested during the cultivation of two late stage project
cell lines resulting in comparable pH profiles and cell culture performance.
These results enable the routinely use of the developed pH measurement
and control strategy. Additionally the proof of concept for Raman
spectroscopy as a powerful tool for the quantification of metabolites and
nutrients for the automated screening system could be shown. Further
spectroscopic techniques using infrared or fluorescence will be evaluated.
Acknowledgements: The authors would like to thank all internship and
diploma students (R. Wetzel, K. Moeser, P. Linke, S. Spielmann, K. Müller,
B. Frommeyer, J. Wisbauer), the Roche Penzberg pilot plant and GMP facility
team, all Roche Penzberg portfolio project teams and the University of
Hannover (Prof. Dr. Thomas Scheper, Dr. D. Solle).
Reference
1. Markert S, Joeris K: Development of an automated, multiwell plate based
screening system for suspension cell culture. BMC Proc 2011, 5(Suppl 8):
O9, Nov 22.
P114
Characterization of recombinant IgA producing CHO cell lines by qPCR
David Reinhart1, Wolfgang Sommeregger1, Monika Debreczeny2,
Elisabeth Gludovacz1, Renate Kunert1*
1
Vienna Institute of BioTechnology, Department of Biotechnology, University
of Natural Resources and Life Sciences, Muthgasse 11, 1190 Vienna, Austria;
2
Vienna Institute of BioTechnology, Imaging Center, University of Natural
Resources and Life Sciences, Muthgasse 11, 1190 Vienna, Austria
Materials and methods: CHO host (ATCC CRL-9096) and recombinant cell
lines [1] were cultivated in spinner vessels (Techne, UK) with 50 mL medium
(ProCHO5, Switzerland), at 37°C and 50 rpm.
Genomic DNA (gDNA) was isolated from 2 × 106 cells using the DNA Blood
Mini Kit (Qiagen, Netherlands) according to the manufacturers’ instructions.
Quantification was performed spectrophotometrically at an absorbance of
260 nm and the purity was determined by measuring the ratio at 260 nm
and 280 nm. gDNA samples were stored at 4°C. Cellular RNA was isolated
from 5 × 106 cells using the Ambion Tri Reagent Solution (Life Technologies,
CA) according to the manufacturers’ instructions. To remove DNA
contaminations from extracted RNA the preparation was digested with 3 U
DNase I (Qiagen, Netherlands) for 30 min at RT together with 160 U RNase
inhibitor (Life Technologies, CA) and then inactivated for 10 min at 75°C
before another RNA precipitation step. Purified total RNA was dissolved in
25 μl RNase free water containing 60 U RNase inhibitor. cDNA was obtained
Figure 1(abstract P113) (A) Comparability of the pH profile between the MWP reference process and the 2L bioreactor reference process.
Additionally further pH profile and product concentration under different media compositions. (B) pH sensitive process with pH shift. The target pH,
before and after the shift, was achieved by pH control.
Page 149 of 151
by reverse transcription. 1.5 μg RNA, 1 μg random primers (Promega, WI)
and 12.5 nmol dNTPs (New England Biolabs, MA) were incubated in a
reaction volume of 14 μl for 5 min at 70°C and 2 min at room temperature.
Then, 40 U RNase inhibitor, 200 U M-MLV reverse transcriptase and buffer
(both Promega, WI) were added to a reaction volume of 20 μl and
incubated for 30 min at 37°C before denaturation for 5 min at 95°C.
Real-time PCR (qPCR) analysis was performed on a MiniOpticon qPCR
device (Biorad, CA). Primers and the fluorogenic hydrolysis probes were
synthesized by Sigma (MO). Same primers and probes were used for the
analysis of gDNA and cDNA. The reaction mix included iQ Supermix
(Biorad, CA), 6 pmol primer and 4 pmol hydrolysis probe for HC, JC and
ß-actin quantification or 12 pmol primer and 8 pmol hydrolysis probe for
LC determination in 20 μl reaction volume. 3 ng pre-denatured (99°C, 10
min) gDNA or 3 μL cDNA from a 1:50 dilution of the reverse transcription
reaction was used directly for qPCR. Negative controls (NC), no template
controls (NTC) and no reverse transcriptase controls (NRT) for transcript
analysis were included in each run. The quantification cycle (Cq) was
determined by linear regression and baseline subtraction using the CFX
Manager (Biorad, CA). The mean qPCR efficiencies for HC, LC, JC and
ß-actin were calculated from raw fluorescence data using the LinRegPCR
software application, V12.17 [2]. Quantification was done by relative
quantification with efficiency correction [3] using ß-actin as internal
reference and expressed as ratios.
Results and discussion: qPCR was performed in six technical replicates.
The Cq values and calculated efficiencies were well reproducible
(Table 1). gDNA analysis revealed an overall higher exogenic GCN for the
low producer 4B3-IgA than for 3D6-IgA (Figure 1). On the genomic level
clone 4B3-IgA contained two times more HC, three times more JC and
four times more LC than 3D6-IgA. Both clones incorporated more HC
genes than JC than LC. This could be due to the presence of the dhfr
amplification gene on the HC plasmid, whereas the neomycin resistance
gene was located on the JC plasmid. No selection marker was included
on the LC plasmid.
mRNA levels were additionally quantified by qPCR to exclude any
misinterpretation of our analysis due to incompletely transfected
expression cassettes, chromosomal position effects or transgene silencing.
Despite higher gene copy numbers 4B3-IgA contained only half of HC and
JC transcripts as compared to 3D6-IgA. LC was transcribed with the same
range of efficiency and resulted in three times more LC mRNA copies. In
contrast to gDNA results, LC mRNA content greatly exceeded that of HC
and JC in both clones (Figure 1). Hence, LC content, which has been
proposed to be critical for high antibody productivities [4], should not
have been limited by mRNA. Summarized, the respective mRNA levels
differed slightly between the two recombinant cell lines, but were
presumably not sufficient for the low specific productivity of clone 4B3-IgA.
Conclusions: An overall higher exogenic GCN was determined for the
low producer 4B3-IgA as compared to 3D6-IgA. Both clones incorporated
more HC genes than JC than LC. Despite higher GCNs 4B3-IgA contained
only half of HC and JC mRNA transcripts as compared to 3D6-IgA. LC was
transcribed with similar efficiencies whereas LC mRNA content greatly
exceeded that of HC and JC in both clones. All in all, differences in
specific productivity, intracellular antibody chain content and volumetric
titers of the cell lines could not sufficiently be explained by qPCR data of
GCN and mRNA levels. Therefore, bottlenecks are believed to occur
further upstream in the translational and/or protein processing machinery.
Acknowledgements: This study was funded by the European Community’s
Seventh Framework Programme (FP7/2002-2013) under grant agreement N°
201038, EuroNeut-41 and sponsored by Polymun Scientific Immunbiologische Forschung GmbH, Donaustraße 99, 3400 Klosterneuburg, Austria.
References
1. Reinhart D, Weik R, Kunert R: Recombinant IgA production: single step
affinity purification using camelid ligands and product characterization.
J Immunol Methods 2012, 378:95-101.
2. Ramakers C, Ruijter JM, Deprez RH, Moorman AF: Assumption-free analysis
of quantitative real-time polymerase chain reaction (PCR) data. Neurosci
Lett 2003, 339:62-66.
3. Pfaffl MW: A new mathematical model for relative quantification in realtime RT-PCR. Nucl Acids Res 2001, 29:e45.
4. Borth N, Strutzenberger K, Kunert R, Steinfellner W, Katinger H: Analysis of
changes during subclone development and ageing of human antibodyproducing heterohybridoma cells by northern blot and flow cytometry.
J Biotechnol 1999, 67:57-66.
P115
Data integration methodology that couples novel bioreactor
monitoring tools, automated sampling, and applied mathematics to
redefine bioproduction processes
Lisa J Graham*, Jeffrey F Breit, Lynn A Davis, Corey C Dow-Hygeland,
Brandon J Downey
Bend Research Inc, Bend, OR, USA
Cell physiology dynamically affects the nutrient requirements of a culture.
It is critical to obtain data over appropriate time intervals to assess the
Table 1(abstract P114) Calculated efficiencies (E), Cq and ΔCq values and copies relative to ß-actin for gDNA and
cDNA derived from clones 3D6-IgA and 4B3-IgA
GOI
Target
Clone
Cq
max. SD [%]
E
SD (%)
ΔCq ß-actin
ß-actin
gDNA
3D6-IgA
24.60
0.20
2.07
2.22
n/a
n/a
4B3-IgA
24.21
0.14
2.07
2.22
n/a
n/a
3D6-IgA
18.52
0.13
2.03
0.43
n/a
n/a
4B3-IgA
16.25
0.63
2.04
1.33
n/a
n/a
gDNA
3D6-IgA
23.56
0.16
1.95
3.32
-1.03
8.28
cDNA
4B3-IgA
3D6-IgA
22.11
21.78
0.14
0.17
1.95
1.91
3.32
1.35
-2.11
3.26
16.44
0.38
4B3-IgA
19.50
0.68
1.97
1.53
3.25
0.20
cDNA
HC
JC
gDNA
3D6-IgA
24.81
0.03
1.95
0.94
0.22
3.80
4B3-IgA
22.77
0.10
1.95
0.94
-1.44
11.20
3D6-IgA
24.52
0.23
1.82
0.87
5.97
0.22
4B3-IgA
20.81
1.54
1.96
0.27
4.56
0.10
gDNA
3D6-IgA
24.90
0.14
2.05
0.59
0.31
0.98
cDNA
4B3-IgA
3D6-IgA
21.50
20.26
0.21
0.20
2.11
1.88
1.21
0.75
-2.71
1.73
4.40
1.30
4B3-IgA
15.02
2.36
1.98
1.30
-1.22
3.93
cDNA
LC
Copies relative to ß-actin
Page 150 of 151
Figure 1(abstract P114) Gene copy number and transcript level of recombinant clones expressing 3D6-IgA or 4B3-IgA. The abundance of LC
( ), JC ( ) and HC ( ) genes was calculated relative to ß-actin.
impact of process conditions on the cell population. By optimizing
bioreactor operation, feed strategies and media composition, we can limit
the number of experiments to obtain the empirical data sets.
For this poster, we present an emerging process-development methodology
that is based on applying novel and existing bioreactor monitoring
technologies, coupled with applied mathematics, to bioreactor processes. This
approach employs tools like dielectric spectroscopy, aseptic autosamplers,
and cell-based bioreactor models. We will illustrate how information gained
from these tools can be coupled through utilization of the proper data
integration and applied mathematics techniques.
The knowledge gained using this improved process development
methodology also supports a less-invasive monitoring and feedback
system, and can be implemented using a customized bioreactor control
code.
P116
Multicellular tumor spheroids in microcapsules as a novel 3D in vitro
model in tumor biology
Elena Markvicheva1*, Daria Zaytseva-Zotova1, Roman Akasov1, Sergey Burov2,
Isabelle Chevalot3, Annie Marc3
1
Shemyakin-Ovchinnikov Inst Bioorg Chem Rus Acad Sci, 117997 Moscow,
Russia; 2Institute of Macromolecular Compounds Rus Acad Sci, 199004 StPetersburg, Russia; 3CNRS, Laboratoire Réactions et Génie des Procédés, UMR
7274, Université de Lorraine, Vandoeuvre-lès-Nancy Cedex, 54505, France
Background: Advantages of microencapsulation as a 3D growth system
are chemically and spatially defined 3D network of extracellular matrix
components, cell-to-cell and cell-to-matrix interactions governing
differentiation, proliferation and cell function in vivo. The study is aimed at
i) optimization of techniques for preparing microcapsules; ii) generation of
multicellular tumor spheroids (MTS) by culturing tumor cells in the
microcapsules; iii) study of anticancer treatment effects for both
photodynamic therapy (PDT) and anti-cancer drug screening. The model
allows to estimate drug doses or parameters for PDT in vitro before
carrying out preclinical tests, and thereby to reduce a number and costs of
experiments with animals commonly used.
Materials and methods: To form MTS, tumor cell lines (mouse melanoma
cells M3, human breast adenocarcinoma cells MCF-7, mouse myeloma Sp2/
0 cells, human CCRF-CEM and CEM/Cl cell lines, HeLa) were encapsulated
in polyelectrolyte microcapsules (200-600 μm), and cultivated for 3-4
weeks [1]. Microcapsules were fabricated from alginate (polyanion) and
various polycations, namely natural polymers (modified chitosan, DEAEdextran etc) and novel smart co-polymers (e.g. chitosan-graft-polyvinyl
alcohol copolymers) synthesized by a Solid-State Reactive Blending
technique [2]. The copolymers were characterized by FTIR, GPC and
elemental analysis.
Results: MTS based MCF-7 cells were prepared and used to study
effects of PDT. To study the effect of irradiation parameters on cell
viability, 2 photosensitizers (PS), namely photosense and chlorine e6
were used. Phototoxicity of PS depended on PS concentration and light
energy density in both monolayer culture (MLC) and MTS. Study of cell
morphology in MLC and MTS before and after PDT revealed that light
energy density increase within the range of 30-70 J/cm2 resulted in cell
apoptosis. However, cell survival in MTS was much higher than this in
the MLC. MTS were also used to test some antitumor therapeutics
(methotrexate, doxorubicin and their derivatives). An enhanced cell
resistance in MTS compared to MLC both for normal and Dox-resistant
cells (MCF-7, MCF-7/DXR, respectively) were observed. MTS were also
proposed to evaluate cytotoxicity not only of novel therapeutics but
also nanosized drug delivery systems (liposomes, micelles, nanoparticles
and nanoemulsions).
Acknowledgements: The authors are greatful to Dr. T. Akopova
(Moscow) for synthesis of chitosan-graft-polyvinyl alcohol copolymers
used in this study. The authors also thank CNRS and Russian foundation
for basic research for support of the research (PICS-Russia project N°
5598 - 2010-2012).
Page 151 of 151
References
1. Zaytseva-Zotova D, Marc A, Chevalot I, Markvicheva E: Biocompatible
Smart Microcapsules Based on Chitosan-Poly(Vinyl Alcohol) Copolymers
for Cultivation of Animal Cells. Adv Eng Mater 2011, 13:B493-B503.
2. Akopova TA, Moguilevskaia EL, Ozerin AN, Zelenetskii AN, Vladimirov LV,
Zhorin VA: Proc Int Conf Mechanochemical Synthesis and Sintering Novosibirsk
2004, 199.
Cite abstracts in this supplement using the relevant abstract number,
e.g.: Markvicheva et al.: Multicellular tumor spheroids in microcapsules
as a novel 3D in vitro model in tumor biology. BMC Proceedings 2013, 7
(Suppl 6):P116

abstracts

Transcription

Similar documents

February 2012 BMC Gasline newsletter

SELENA-SLEDAI* A TOOL TO ASSESS DISEASE ACTIVITY IN

Technews BMC (pdf - 1.2 MB)

GROWTH CORPS - Tlicho Investments

view showcase - Singapore Memory Project

The Violation of Grice`s Maxims in Jokes Author(s): Salvatore Attardo

transgenders flex their sex - Mumbai Messenger

Newsletter - 5th May 2016.pub

Press Kit Les animaux ENGL

9-10 May 2013 Melbourne with Dr David Yonggi Cho