ORCHIDACEAE - ORCHIDOIDEAE

Transcription

CECÍLIA OLIVEIRA DE AZEVEDO
FILOGENIA E REVISÃO TAXONÔMICA DO GÊNERO PRESCOTTIA LINDL.
(ORCHIDACEAE - ORCHIDOIDEAE)
Feira de Santana, Bahia
2009
UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA
DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS
PROGRAMA DE PÓS-GRADUAÇÃO EM BOTÂNICA
Filogenia e revisão taxonômica do gênero Prescottia Lindl. (Orchidaceae Orchidoideae)
Cecília Oliveira de Azevedo
Julho de 2009
UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA
DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS
PROGRAMA DE PÓS-GRADUAÇÃO EM BOTÂNICA
Filogenia e revisão taxonômica do gênero Prescottia Lindl. (Orchidaceae Orchidoideae)
Cecília Oliveira de Azevedo
Orientador: Prof. Dr. Cássio van den Berg (UEFS)
Co-orientador: Prof. Dr. Fábio de Barros (IBT)
Tese apresentada ao Programa de PósGraduação em Botânica da Universidade
Estadual de Feira de Santana como parte dos
requisitos para a obtenção do título de Doutor
em Botânica.
Julho de 2009
Ficha catalográfica: Biblioteca Central Julieta Carteado
Banca Examinadora
_____________________________________________
Prof. Dr. João Aguiar Nogueira Batista
(Universidade Federal de Minas Gerais)
_____________________________________________
Prof. Dr. Gerardo A. Salazar
(Universidad Nacional Autónoma de México)
_____________________________________________
Prof. Dr. Eric de Camargo Smidt
(Universidade Federal do Paraná)
_____________________________________________
Prof. Dr. Samantha Koehler
(Universidade Federal de São Paulo – Campus de Diadema)
_____________________________________________
Prof. Dr. Cássio van den Berg
(Universidade Estadual de Feira de Santana)
Orientador e Presidente da Banca
Julho de 2009
Este trabalho teve o apoio financeiro do CNPq, CAPES e FAPESB
Agradecimentos
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
pela bolsa concedida. À Coordenação de Aperfeiçoamento de Pessoal de Nível
Superior (CAPES) pela bolsa do Programa de Doutorado no País com Estágio no
Exterior (PDEE), que possibilitou a visita ao New York Botanical Garden (NYBG). À
Fundação de Amparo à Pesquisa da Bahia (FAPESB) pelo auxílio financeiro.
Ao Programa de Pós-Graduação em Botânica da Universidade Estadual de
Feira de Santana (PPGB/UEFS), nas pessoas de Francisco de Assis e Luciano
Paganucci, por viabilizar a realização deste trabalho. E a Adriana Estrela pela
preocupação, ajuda e empenho durante todos esses anos de convivência.
Aos Laboratórios de Sistemática Molecular de Plantas (Lamol), de Taxonomia
Vegetal (Taxon), de Micromorfologia Vegetal (Lamiv) e de Pesquisa em
Microbiologia (Lapem), nas pessoas de Ricardo Villas-Boas, Reinaldo, Claudia e
Kelly, Gisele e Eduardo Gross, respectivamente, por toda a estrutura disponibilizada
e condições adequadas ao desenvolvimento deste trabalho.
Aos curadores dos herbários pelo empréstimo de material e pela atenção
recebida durante as visitas às instituições. A todos do Herbário da Universidade
Estadual de Feira de Santana (HUEFS), especialmente a Téo, Zezé, Elaine e Silvia,
por viabilizarem o funcionamento do herbário, solicitando e recebendo os
empréstimos, processando material coletado, etc., e também pelos muitos
momentos de descontração durante os inúmeros cafés.
Ao Royal Botanic Gardens, Kew, por disponibilizar toda estrutura necessária
assim como ao curador do Herbário K, Prof. Simon Owens pelos empréstimos
disponibilizados. A Daniela Zappi, Simon Mayo e Amelia Baracat pelo apoio durante
minha estadia na Inglaterra. A Brian Stannard pela simpatia. Ao Dr. R. K. Brummitt
pela grande ajuda e comentários com questões nomenclaturais. E ao British
American Tobacco pela bolsa concedida (The Northeastern Brazil Repatriation of
Herbarium Data) e auxílio logístico e financeiro para desenvolver parte do meu
próprio projeto, como visitar os herbários de Viena e Munique. A Martin Powel pelo
ano de companhia e hospitalidade. Agradeço também a Ivanilza, Ana Paula Prata,
Edgley, Alice, Nira, Natália, Marcelo, Fiorella, Fernando, Amélia, Jovita e Lázaro
pelos passeios, viagens e os inúmeros cafés no tea room. A Simon e Lúcia Mayo
pela hospitalidade e pelo “feijão e carinho” que aliviavam a saudade de casa...
Ao New York Botanical Garden (NYBG) por toda estrutura disponibilizada
durante o período de Estágio no Exterior, nas pessoas de Jackie Kallunki, Lisa
Campbell (MEV), Néstor D. Pérez-Moliére (digitalização de imagens) e Ken
Cameron. Aos amigos do NYBG: Alejandra Vasco por me acompanhar no MEV, por
toda ajuda e amizade “que lastima pero adios me despido de ti y me voy”, a Douglas
Daly pela simpatia, ajuda e todos os cafés no NYBG, a Ulyana por ter me recebido
tão bem em sua casa, a Monse pelos filmes e principalmente pelas comidas
Mexicanas, a Thaís Imbassahy pela agradável companhia e amizade, sobretudo
depois do pedido feito por ela (“posso ser sua amiga???”), a Sirli Leython pela ajuda
e pelos passeios em New York “...solo paseas...” e ainda a Vivi e Kevin, tia Ana, tio
Beto, Paulinha, Beto e Nanda, por todo apoio e carinho durante a minha estadia em
NY.
Às instituições e pessoas pelo apoio logístico nas visitas a herbário e coletas:
a Cláudio Fraga, Melissa Bocayuva e Eduardo Saddi (Rio de Janeiro), André Paviotti
(Espírito Santo) pelo carro disponibilizado, companhia e ajuda nas coletas; ao
Jardim Botânico do Rio de Janeiro (Pousada do Pesquisador); ao pessoal do IBt e
do alojamento do IBt (São Paulo). A Téo, Mimi e seu Bené pela companhia na coleta
pelo Sudeste. A Rubens Mota por todo o apoio nas coletas em Minas Gerais. A
Malba e Ian van den Berg pela hospedagem em Lavras e por disponibilizar o carro
para as viagens de coleta em Minas Gerais. A Eric e Vivi pela viagem ao Espírito
Santo. Aos amigos Renata Mazine, Wellington Forster, Fiorella e Fernando pelo
apoio em São Paulo (Campinas e Piracicaba). A Domingos e Nathan pela
companhia na coleta à Guiné (Mucugê).
Ao Dr. James Ackerman por toda a atenção dispensada na Costa Rica, pelas
referências enviadas e pelas inúmeras discussões nomenclaturais. Agradeço
também à San Diego County Orchid Society pelo patrocínio, viabilizando minha ida
ao Congreso Internacional de Orquideología Neotropical, na Costa Rica. A Rodrigo
Singer pela coleta de Prescottia ostenii no Brasil e pelo envio do material em sílica.
A Eduardo Alonso Paz e Eduardo Marchesi pelas informações sobre Prescottia
ostenii no Uruguai. A Lúcio Leoni pelas incansáveis buscas a Prescottia glazioviana.
A Ana Lú pela ajuda na preparação para o TOEFL, e a Paulinho pelo empréstimo
dos livros. A Carla Lima pelas ilustrações e a Ricardo Villas-Boas pela confecção
dos mapas. A Reyjane Patrícia pelas sugestões na primeira versão desta tese. A Sil
por todo suporte nas análises filogenéticas. A Anderson, Dea, Sil e Laura pela ajuda
na seleção da UESB.
Ao pessoal da Universidade Estadual do Sudoeste da Bahia (UESB): Flávia,
Lú, Duda, Marcial, Raquel e Lúcia pela receptividade. Agradeço também a Débora
Leonardo por entender minhas ausências para finalizar a tese e especialmente a
Vinícius Dittrich por todo apoio e ajuda desde a minha chegada à UESB, não só nas
atividades relacionadas à universidade, mas principalmente pela valiosa ajuda na
edição das imagens e nas sugestões e correções nas versões finais desta tese.
Aos colegas de curso: Adilva, Alexa, Aline, Ana Luisa, Carlianne, Chico
Haroldo, Daiane, Dani, Domingos, Élvia, Eric, Fabrício, Hilder, Ivanilza, Janaína,
Jomar, Kelly, Laura, Lázaro, Lia, Maria, Marla, Marlon, Marquinhos, Milene, Paty
Luz, Paty Cris, Paulo Ricardo, Rick, Sabrina, Silvana (Mineira), Uiara Catharina e
Viviane pelos momentos passados juntos. A todos os meus amigos, próximos e
distantes, pela amizade sem hora, por todo apoio e momentos de descontração:
especialmente Cris e Jorge, Peri, Tati, Sil, Dea, Pati e Marquinhos.
Agradeço à minha família e amigos por todo apoio dado durante meu
internamento por ocasião do acidente durante trabalho de campo (Bothrops sp.),
especialmente a Peri, minha mãe e Mimi, Climene e Valdiki, tia Sônia e tio Tatá e
Lucas Leite. Ao Centro de Informações Antiveneno da Bahia (CIAVE) e ao Hospital
Geral Roberto Santos, nas pessoas de Dr. Lenina L. R. S. de Araújo e à Dr. Luana,
que prestaram atendimento com muita eficiência, cuidado e atenção, e ao Dr.
Ricardo Ponder (Hospital da Bahia) pela paciência e tranquilidade no tratamento.
Aos meus orientadores Cássio van den Berg e Fábio de Barros por todo
apoio, dedicação, paciência e ensinamentos.
Agradeço com enorme carinho à minha querida família por todo apoio
sempre... À minha mãe, meu pai (pelos muitos “paitrocínios”), aos meus irmãos Leo
(super coruja), Kito e Mimi, a Nisia e aos meus sobrinhos Chico e Tiago, que por
mais que não entendam exatamente do trabalho sempre estiveram ao meu lado, me
apoiando e incentivando, entendendo os momentos de ausência.
Resumo
O presente trabalho consiste no estudo filogenético e na revisão taxonômica
de Prescottia Lindl. (Orchidaceae: Orchidoideae), gênero de orquídea terrestre de
distribuição neotropical. O gênero apresenta ampla distribuição com espécies
ocorrendo da Flórida (E.U.A) à Argentina, sendo que o Brasil concentra a maior
riqueza de espécies. As espécies são caracterizadas por apresentarem flores
esverdeadas a esbranquiçadas, labelo cuculado, superfície estigmática inteira e
quatro polínias. Este estudo corresponde à primeira revisão taxonômica do gênero e
teve como base a coleta de material em campo, assim como a observação de suas
populações in situ e de indivíduos em cultivo, análise de coleções de herbários e
análises filogenéticas. Os estudos filogenéticos foram realizados através de análises
individuais e combinadas de dados de sequências de quatro regiões - três do
genoma plastidial (trnL intron, trnL-F spacer e rpoB-trnC spacer) e uma do genoma
nuclear (ITS). Foram usados os métodos de máxima parcimônia e análise
Bayesiana. Prescottia foi reconhecido como um gênero monofilético, sendo
Galeoglossum A. Rich. & Galeotti seu grupo-irmão. Dentro de Prescottia dois grupos
são formados: um consiste de espécies com folhas longo-pecioladas e o outro é
formado pelo resto das espécies amostradas, incluindo espécies com pecíolo curto,
pseudopecioladas e sésseis. As espécies com flores esbranquiçadas com interior do
labelo piloso formam um grupo monofilético, enquanto que as espécies com flores
esverdeadas formam um grupo parafilético. A segunda parte deste estudo teve
como principal objetivo revisar taxonomicamente o gênero Prescottia, no intuito de
entender a circunscrição das espécies e sua distribuição geográfica, além de
reconhecer caracteres morfológicos que as distingam, bem como resolver questões
nomenclaturais. Quinze espécies são aceitas neste trabalho para Prescottia, sendo
que dois complexos de espécie são indicados. Duas novas espécies (Prescottia
mucugensis C.O. Azevedo & Van den Berg e P. ecuadorensis C.O. Azevedo & Van
den Berg) são descritas. Duas propostas de conservação de nomes foram
elaboradas. Uma nova ocorrência (Prescottia ostenii Pabst) foi citada para o Brasil, e
Prescottia glazioviana Cogn. foi encontrada em Minas Gerais. São propostas 23
lectotipificações, uma neotipificação e 11 novas sinonimizações. Uma espécie foi
reestabelecida e quatro nomina nuda foram detectados. São fornecidos dados
macro e micro-morfológicos, descrições, chave para identificação, ilustrações,
mapas de distribuição e comentários ecológicos para todas as espécies.
Abstract
The present work is a phylogenetic study and a taxonomic revision of
Prescottia Lindl. (Orchidaceae: Orchidoideae), a terrestrial orchid genus with
neotropical distribution. The genus presents a widespread distribution, whose
species occur from Florida (U.S.A) to Argentina. Brazil is the country with major
species richness. The species are characterized by its greenish to whitish flowers,
cucullate lip, stigmatic surface entire, and four pollinia. This study is the first
taxonomic monograph for the genus and is based on fieldwork collection, as well as
observation of in situ populations and individuals in cultivation, study of herbaria
collections, and phylogenetic analyses. The phylogenetic studies were carried out by
individual and combined analyses based on sequences of four DNA regions, three
plastid (trnL intron and trnL-F spacer and rpoB-trnC spacer) and one nuclear (ITS),
using maximum parsimony and Bayesian analyses. Prescottia was recognized as a
monophyletic genus, and Galeoglossum A. Rich. & Galeotti is its sister-group. Within
Prescottia two groups are recovered, one consisting of long petiolate-leaved species
and the other formed by the remainders sampled species, including short petiolateleaved, pseudopetiolate and sessile-leaved species. The species group with whitish
flower and lip inner surface pilose is monophyletic, whereas the greenish flower
species, without inner surface pilose, are paraphyletic. The main objective of the
second part of this study was to present a taxonomic revision of Prescottia, trying to
understand the species circumscription, their geographic distribution, to recognize
distinctive morphologic characters, and also to solve nomenclatural questions.
Fifteen species are accepted for Prescottia in this study, and two species complexes
are indicated. Two new species, Prescottia mucugensis C.O. Azevedo & Van den
Berg and P. ecuadorensis C.O. Azevedo & Van den Berg are described. Two
proposals of name conservation were elaborated. One new record (Prescottia ostenii
Pabst) was cited to Brazil, and Prescottia glazioviana Cogn. was found in Minas
Gerais State. Twenty three lectotypifications, one neotipification, and 11 new
synonymies are proposed. One species was reestablished and four nomina nuda
were detected. Macro and micro-morphological data are given, descriptions,
identification key, illustrations, distribution maps, nomenclatural analysis and
ecological comments for each species are presented.
Sumário
Agradecimentos
Resumo
Abstract
Índice de tabelas
Índice de figuras
Índice de mapas
Introdução Geral....................................................................................................23
Capítulo 1 Phylogeny of Prescottia Lindl. (Orchidaceae - Orchidoideae) based on
nuclear and chloroplast DNA regions ....................................................................42
Capítulo 2 Novidades taxonômicas em Prescottia Lindl. (Orchidaceae Orchidoideae) ........................................................................................................72
Proposals to conserve the name Prescottia with that spelling and P. plantaginea
against P. plantaginifolia Orchidaceae) .....................................................73
Lectotypifications in Prescottia (Orchidaceae - Orchidoideae) .........................76
Prescottia ostenii (Orchidaceae) a new record for Brazil, with a complete
morphological description. .........................................................................83
Prescottia mucugensis a new species of Prescottia (Orchidaceae Cranichidinae)
from Bahia, Brazil ......................................................................................95
Prescottia glazioviana Cogn. (Orchidaceae) nova ocorrência para Minas Gerais,
Brasil, com descrição morfológica completa da espécie. ........................107
Capítulo 3 Taxonomic revision of the genus Prescottia Lindl. (Orchidaceae Orchidoideae) ......................................................................................................117
Conclusões Gerais ..............................................................................................279
Anexos ................................................................................................................282
Índice de tabelas
Capítulo 1
Table 1. Primers and PCR programs for amplifying the regions of the cpDNA and
nrDNA in the current study. ................................................................................ 63
Table 2. Features of DNA data sets used in this study, in relation to one of the most
parsimonious trees resulting from the combined analysis (percentages
calculated in relation to aligned length). ............................................................. 64
Índice de figuras
Capítulo 1
Figure 1. One of the trees obtained in a maximum parsimony analysis of nuclear data
(ITS), (one of the 144 most parsimonious trees: length = 725 steps, CI = 0.63
and RI = 0.81; characters optimized on the combined tree). The numbers above
branches are branch lengths; nodes with bootstrap values > 50% are indicated
in bold below branch. An arrow indicates where it collapses in the strict
consensus. ......................................................................................................... 65
Figure 2. One of the trees from maximum parsimony analysis of plastid data (trnL-F),
(one of the 1.014 most parsimonious trees: length = 602 steps, CI = 0.70 and RI
= 0.72; characters optimized on the combined tree). The numbers above
consensus. ......................................................................................................... 66
Figure 3. One of the trees from maximum parsimony analysis of plastid data (rpoBtrnC), (one of the six most parsimonious trees: length = 657 steps, CI = 0.72 and
RI = 0.83; characters optimized on the combined tree). The numbers above
consensus. ......................................................................................................... 67
Figure 4. One of the trees resulting from a combined parsimony analysis of nuclear
(ITS) and plastid data (trnL-F and rpoB-trnC) (one of the 12 most parsimonious
trees of the combined analysis: length = 2028 steps, CI = 0.68 and RI = 0.80)
The numbers above branches are branch lengths; nodes with bootstrap values >
50% are indicated in bold below branch. An arrow indicates where it collapses in
the strict consensus............................................................................................ 68
Figure 5. Majority-rule consensus of 1.000 trees obtained in the Bayesian analysis
with the algorithm Markov chain Monte Carlo in a combined analysis of three
DNA regions. Numbers above branches are posterior probabilities for clades
estimated by the proportion of occurrence in the tree set................................... 69
Capítulo 2
Singer, R.B.; Azevedo, C.O.; Van den Berg, C.; Aguiar, D. (in press). Prescottia
ostenii Pabst (Orchidaceae): a new record for Brazil, with a complete morphological
description. Kew Bulletin.
FIGURE 1: Plant and flower features of Prescottia ostenii Pabst. A. Blooming plant.
Notice the basal rosette of sessile leaves. B-C. Inflorescence (details). D. Detail
of the column. Photos by Rodrigo B. Singer....................................................... 93
FIGURE 2. Prescottia ostenii Pabst. A. Detail of inflorescence. B. Details of perianth.
C. Adnation of the lateral sepals (dorsal view). D-F. Flower (not fully opened). D.
lateral view. E. Fronto-lateral view. F. Schematic longitudinal section to show
column position. G-H. Column. G. Frontal view. H. Lateral view. I-J. Pollinarium.
I. Dorsal view. J. Ventral view. Ds: dorsal sepal. Ls: lateral sepals. L: labellum.
Lp: lateral petals. Drawing by Rodrigo B. Singer based in Singer 2006/21 (ICN).
........................................................................................................................... 94
Azevedo, C.O.; Smidt, E.C.; Van den Berg, C. (submited). Prescottia mucugensis: a
new species of Prescottia (Orchidaceae: Cranichidinae) from Bahia, Brazil. Kew
Bulletin.
Figure 1. Prescottia mucugensis. A habit; B inflorescence; C-E flower: C front view;
D side view; E dorsal view; F floral bract; G perianth parts, clockwise from top:
lip, dorsal sepal, petal, lateral sepal; H-K column with pollinarium in place: H
dorsal view; J ventral view; K lateral view; L pollinarium. Drawn from fresh
material (Azevedo 253). ................................................................................... 104
Figure 2. Prescottia mucugensis (Bahia: Azevedo 253). A detail of inflorescence; B
angular rachis; C flower, side view; D flower, front view; E perianth parts,
clockwise from top: lip, lateral sepal, petal, dorsal sepal, petal, lateral sepal,
column; F detail of the column: a: anther. pl: pollinia. stg: stigma. vi: viscidium.
Prescottia leptostachya (Bahia: Azevedo 250). G detail of inflorescence.
Prescottia phleoides (Minas Gerais: Azevedo 344). H detail of inflorescence.. 106
Azevedo, C.O.; Leoni, L.S.; Van den Berg, C. (submetido) Prescottia glazioviana
Cogn. (Orchidaceae): nova ocorrência para Minas Gerais, Brasil, com descrição
morfológica completa da espécie. Acta Botanica Brasilica.
Figura 1: Prescottia glazioviana Cogn.: A. Hábito. B-C. Flor. B. vista frontal. C. vista
lateral. D. Bráctea floral. E. Labelo, vista lateral. F. Diagrama floral, de cima para
baixo, sentido horário: labelo, sépala dorsal, pétala, sépala lateral. G-H. Coluna.
G. vista ventral. H. vista dorsal (Leoni 5280).................................................... 116
Capítulo 3
Figure 1. SEM micrographs of Prescottia cucullate lip. A. P. oligantha (Azevedo 329).
B. P. phleoides (Azevedo 344). C-D. P. glazioviana lip, with prominent and
ondulate margin (Leoni 5280). Nectariferous glands at lip base. E. P. phleoides
(Azevedo 344). F. P. ostenii (Singer 2006/21). Lip inner surface. G. P.
mucugensis (Azevedo 253). H. P. glazioviana (Leoni 5280). ........................... 130
Figure 2. SEM micrographs of Prescottia lip inner surface. A-B. P. stachyodes
(Azevedo 288). C-D. P. densiflora (van den Berg 1417). E-F. P. lancifolia
(Bocayuva 198). G-H. P. oligantha (Azevedo 329). ......................................... 131
Figure 3. SEM micrographs of Prescottia lip inner and outer surface, and column. AB. Lip inner surface of P. ostenii (Singer 2006/21). C-D. Lip outer surface of P.
spiranthophylla (Azevedo 270). Lip outer surface with trichomes at the base. E.
P. plantaginifolia (Azevedo 263). F. P. spiranthophylla (Azevedo 270). Dorsal
surface of the column. G. P. phleoides (Azevedo 344). H. P. ostenii (Singer
2006/21). .......................................................................................................... 132
Figure 4. SEM micrographs of Prescottia column. Dorsal surface of the column,
covered by trichomes. A-B. P. plantaginifolia (Azevedo 263). C-D. P.
spiranthophylla (Azevedo 270). Anther. E. P. leptostachya (Azevedo 250). F. P.
stachyodes (Azevedo 288). Stigma. G. P. densiflora (van den Berg 1417). H. P.
oligantha (Azevedo 329). ................................................................................. 133
Figure 5. SEM micrographs of Prescottia stigma and staminodes. Stigma. A. P.
plantaginifolia (Azevedo 263). B. P. phleoides (Azevedo 344). C. P. montana
(Azevedo 324). D. P. stachyodes (Azevedo 288). Staminodes. E-F. P. oligantha
(Azevedo 329). G. P. montana (Azevedo 324). H. P. phleoides (Azevedo 344).
......................................................................................................................... 134
Figure 6. SEM micrographs of Prescottia pollinaria and pollen. A. Pollinaria of P.
oligantha (Azevedo 329). Viscidium. B. P. oligantha (Azevedo 329). C-D. P.
phleoides (Azevedo 344). Pollen tetrads. E. P. oligantha (Azevedo 329). F. P.
phleoides (Azevedo 344). Elastoviscine. G. P. densiflora (van den Berg 1417).
H. P. phleoides (Azevedo 344). ........................................................................ 135
Figure 7. SEM micrographs of Prescottia pollen. Elastoviscine. A-B. P. phleoides
(Azevedo 344). Pollen exine. C. P. phleoides (Azevedo 344). D. P. stachyodes
(Azevedo 288). Germinated pollen. E-F. P. stachyodes (Azevedo 288). ......... 136
Figure 8. SEM micrographs of Prescottia seed morphology. A-B. P. carnosa
(Steyermark 59772). C-D. P. ecuadorensis (Madsen 86457). E-F. P. lancifolia
(Silva 3758). G-H. P. leptostachya (CFCR 7308). ............................................ 137
Figure 9. SEM micrographs of Prescottia seed morphology. A-B. P. lojana (Holst
3522). C-D. P. montana (Azevedo 287). E-F. P. oligantha (Hatschbach 6475). GH. P. ostenii (Osten 22939). ............................................................................. 138
Figure 10. SEM micrographs of Prescottia seed morphology. A-B. P. phleoides
(Azevedo 344). C-D. P. plantaginifolia (Mori 10702). E-F. P. spiranthophylla
(Mulford 881). G-H. P. stachyodes (Azevedo 318). .......................................... 139
Figure 11. SEM micrographs of Prescottia stachyodes seed morphology. A-B. (Harris
10096). C-D (Kuhlmann 2742). E-F (Oliveira 842). G-H (Raven 19994). ......... 140
Figure 12. Prescottia carnosa. A. Habit. B. Flower, front view. C. Floral bract. D.
Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal sepal. E-F.
Column. E. Ventral view. F. Dorsal view. (Steyermark 59772). ........................ 147
Figure 13. Prescottia densiflora. Drawn from fresh material. A. Habit. B-C. Flower. B.
Dorsal view. C. Front view. D. Floral bract. E. Perianth parts, clockwise from top:
lip, dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F.
Dorsal view. G. Ventral view. H. Pollinarium. (van den Berg 1417). ................. 152
Figure 14. Prescottia ecuadorensis. A. Habit. B. Flower, front view. C. Floral bract. D.
Lip. E. Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal sepal.
F-G. Column. F. Dorsal view. G. Ventral view. (Madsen & Pedersen 86457). 156
Figure 15. Holotype of Prescottia ecuadorensis (Madsen & Pedersen 86457) at the
Missouri Botanical Garden Herbarium (MO). ................................................... 157
Figure 16. SEM micrographs of Prescottia seed morphology. 1 -2 P. carnosa
(Steyermark 59772). 3-4 P. lojana (Holst 3522). 5-6 P. ecuadorensis (Madsen &
Pedersen 86457). 7-8 P. stachyodes (Harris 10096). ...................................... 158
Figure 17. Prescottia glazioviana. A. Habit. B-C. Flower. B. Front view. C. Lateral
view. D. Floral bract. E. Lip. F. Perianth parts, clockwise from top: lip, dorsal
sepal, petal, lateral sepal. G-H. Column. G. Ventral view. H. Dorsal view. (Leoni
5280). ............................................................................................................... 162
Figure 18. Prescottia lancifolia. A. Habit. B-C. Flower. B. Front view. C. Lateral view.
D. Floral bract. E. Perianth parts, clockwise from top: lip, dorsal sepal, petal,
lateral sepal. F-G. Column with pollinarium in place. F. Dorsal view. G. Ventral
view. (Bocayuva 198). ...................................................................................... 169
Figure 19. Prescottia leptostachya. Drawn from fresh material. A. Habit. B-C. Flower.
B. Front view. C. Lateral view. D. Lip. E. Perianth parts, clockwise from top: lip,
dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F.
Dorsal view. G. Ventral view. H. Pollinarium. (Azevedo 164). .......................... 174
Figure 20. Prescottia lojana. A. Habit. B-C. Flower. B. Front view. C. Lateral view. D.
Floral bract. E. Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal
sepal. F-G. Column. F. Ventral view. G. Dorsal view. (Holst 3522). ................. 177
Figure 21. Prescottia montana. Drawn from fresh material. A. Habit. B-C. Flower. B.
Front view. C. Lateral view. D. Floral bract. E. Perianth parts, clockwise from top:
lip, dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F.
Ventral view. G. Dorsal view. H. Pollinarium. (Azevedo 324). .......................... 182
Figure 22. Prescottia mucugensis. Drawn from fresh material. A. Habit. B. Detail of
inflorescence. C-E. Flower. C. Front view. D. Lateral view. E. Dorsal view. F.
Floral bract. G. Perianth parts, clockwise from top: lip, dorsal sepal, petal, lateral
sepal. H-J. Column with pollinarium in place. H. Dorsal view. I. Ventral view. J.
Lateral view. K. Pollinarium. (Azevedo 253). .................................................... 186
Figure 23. Prescottia oligantha. Drawn from fresh material. A. Habit. B-C. Flower. B.
Front view. C. Lateral view. D. Floral bract. E. Lip. F. Perianth parts, clockwise
from top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium in
place. G. Dorsal view. H. Ventral view. I. Frontal view. J. Pollinarium. (Azevedo
333). ................................................................................................................. 205
Figure 24. Prescottia ostenii. Drawn from fresh material. A. Habit. B. Detail of
inflorescence. C. Flower, front view. D. Floral bract. E. Perianth parts, clockwise from
top: lip, lateral sepal, petal, dorsal sepal. F-G. Column with pollinarium in place. F.
Ventral view. G. Dorsal view. H-I. Pollinarium. H. Ventral view. I. Dorsal view. (Singer
2006/21). ........................................................................................................... 210
Figure 25. Prescottia phleoides. Drawn from fresh material. A. Habit. B-C. Flower. B
Front view. C. Lateral view. D. Floral bract. E. Lip. F. Perianth parts, clockwise
from top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium in
place. G. Dorsal view. H. Ventral view. I. Lateral view. J. Pollinarium. (Azevedo
344). ................................................................................................................. 213
Figure 26. Prescottia plantaginifolia. Drawn from fresh material. A. Habit. B-D. Flower. B.
Front view. C. Lateral view. D. Dorsal view. E. Floral bract. F. Perianth parts,
clockwise from top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium
in place. G. Ventral view. H. Dorsal view. I. Lateral view. J. Pollinarium. (Azevedo
263). ................................................................................................................. 224
Figure 27. Prescottia spiranthophylla. Drawn from fresh material. A. Habit. B-C.
Flower. B. Front view. C. Lateral view. D. Floral bract. E. Perianth parts,
clockwise from top: lip, dorsal sepal, petal, lateral sepal. F-G. Column F. Dorsal
view. G. Ventral view. (Azevedo 270)............................................................... 229
Figure 28. Prescottia stachyodes. A. Habit. B-C. Flower. B. Front view. C. Lateral
view. D. Floral bract. E. Perianth parts, clockwise from top: lip, dorsal sepal,
petal, lateral sepal. F-G. Column F. Dorsal view. G. Ventral view. (Azevedo 318).
......................................................................................................................... 260
Índice de mapas
Map 1. Geographical distribution map of Prescottia species. .................................. 142
Map 2. Geographical distribution map of Prescottia carnosa, P. ecuadorensis, and P.
lojana................................................................................................................ 148
Map 3. Geographical distribution map of Prescottia densiflora................................ 153
Map 4. Geographical distribution map of Prescottia glazioviana, P. leptostachya, P.
mucugensis, P. ostenii, P. phleoides, and P. spiranthophylla. ......................... 163
Map 5. Geographical distribution map of Prescottia lancifolia. ................................ 170
Map 6. Geographical distribution map of Prescottia montana. ................................ 183
Map 7. Geographical distribution map of Prescottia oligantha................................. 206
Map 8. Geographical distribution map of Prescottia plantaginifolia. ........................ 225
Map 9. Geographical distribution map of Prescottia stachyodes. ............................ 261
Para efeito do Código Internacional de Nomenclatura Botânica, esta tese não
constitui publicação efetiva para os nomes e tipificações aqui utilizados. Estas
mudanças serão efetivadas somente a partir da publicação dos manuscritos
aqui apresentados.
23
INTRODUÇÃO GERAL
24
Introdução Geral
A família Orchidaceae inclui cerca de 20.000 espécies e 850 gêneros, sendo
uma das maiores famílias de plantas (Atwood 1986; Dressler 1993). Apresenta
ampla distribuição geográfica, com grande diversidade nos trópicos. A família
pertence à Ordem Asparagales e, filogeneticamente, aparece como grupo-irmão das
demais famílias da ordem (Fay et al. 2000; Judd et al. 2007). Orchidaceae está
rapidamente se tornando uma das mais estudadas famílias de angiospermas em
termos de filogenia. Tais estudos têm demonstrado que vários conceitos anteriores
sobre padrões filogenéticos estavam errados, o que tem feito com que muitas das
classificações prévias necessitem de revisão (Chase et al. 2003).
A tribo Cranichideae já esteve enquadrada em diferentes subfamílias de
Orchidaceae como, por exemplo, Neottioideae Lindl. (e.g. Lindley 1840; Bentham
1881; Schlechter 1911, 1926; Garay 1960; Dressler 1974; Rasmussen 1985) e
Spiranthoideae (e.g. Dressler 1979, 1981, 1990, 1993; Szlachetko 1995). Contudo,
recentes estudos filogenéticos, baseados em morfologia e em dados moleculares,
evidenciaram que ela ficaria mais bem posicionada num conceito expandido de
Orchidoideae (Dressler 1986; Dressler & Chase 1995; Kores et al. 1997, 2000, 2001;
Cameron & Chase 1999; Freudenstein & Rasmussen 1999; Freudenstein et al.
2000). A tribo Cranichideae sensu Dressler (1993) abrange cerca de 95 gêneros e
1.140 espécies, sendo predominantemente terrestre e distribuída em todos os
continentes, com exceção da Antártida, mas apresentando maior diversidade nas
regiões tropicais e subtropicais das Américas e Ásia (Dressler 1993). Dentro de
Cranichideae, Dressler (1993) reconheceu seis subtribos, em grande parte de
acordo com o que havia sido previamente proposto por Schlechter (1926), exceto
por apresentar uma nova subtribo, Prescottiinae (Dressler 1990), criada para
acomodar alguns gêneros anteriormente incluídos na subtribo Cranichidinae. Dentre
essas subtribos, Goodyerinae e Spiranthinae são amplamente distribuídas, enquanto
Cranichidinae e Prescottiinae são restritas ao neotrópico e Manniellinae e
Pachyplectroninae são endêmicas da África Tropical e Nova Caledônia,
respectivamente.
A subtribo Prescottiinae sensu Dressler (1993) é composta por 99 espécies,
distribuídas em sete gêneros: Aa Rchb. f., Altensteinia Kunth, Gomphichis Lindl.,
25
Myrosmodes Rchb. f., Porphyrostachys Rchb. f., Prescottia Lindl. e Stenoptera C.
Presl. Com exceção de Prescottia, todos os outros representantes ocorrem,
sobretudo, em altitudes elevadas da Cordilheira dos Andes.
Prescottia apresenta maior diversidade no Brasil, estendendo-se da Flórida
(E.U.A.), através das Índias Ocidentais, até o nordeste da Argentina. O gênero
apresenta caracteres morfológicos bastante variáveis e as espécies são de difícil
delimitação, razão pela qual, aparentemente, muitas espécies novas foram descritas
e caíram, posteriormente, em sinonímia.
Originalmente o gênero foi descrito como “Prescotia”, com um único ‘t’, em
homenagem a “John Prescot” (Lindley in Hooker 1824). Em 1836, Lindley passou a
se referir ao gênero com a grafia Prescottia, com dois “t”, após ter tido conhecimento
de que “John Prescott” se escrevia desta forma. Desde então o gênero vem sendo
tratado por alguns autores da forma original (e.g. Steudel 1841; Vöth 1976; Farr et
al. 1979; Ackerman 1989), enquanto outros adotaram a forma alternativa (e.g.
Cogniaux 1895; Hoehne 1945; Pabst & Dungs 1975; Brummitt & Powell 1992;
Dressler 1993; Greuter et al. 1993; Ackerman 1995, 2003). A espécie tipo do gênero
foi descrita como “Prescotia plantaginifolia”, tendo sido citada desta forma em todo o
protólogo, aparecendo dessa forma, várias vezes no texto e no cabeçalho da
ilustração, sendo que somente na prancha o nome está grafado como “Prescotia
plantaginea”. Após a publicação original, o nome Prescotia plantaginifolia foi adotado
por Loddiges (1824) e Sprengel (1826). Mais tarde o próprio Lindley (1836, 1840)
passou a citar a espécie tipo do gênero como Prescottia plantaginea, embora não
tenha dado nenhuma explicação a respeito da mudança e nem tenha rejeitado o
outro nome. Vöth (1976) propôs o uso de Prescotia plantaginifolia, tendo sido
seguido apenas por Farr et al. (1979), Ackerman (1989, 1995, 2003) e Greuter et al.
(1993), enquanto outros autores (e.g. Cogniaux 1895; Hoehne 1945; Pabst & Dungs
1975) usaram o nome P. plantaginea.
Com o intuito de evitar futuras confusões nomenclaturais a respeito do nome
do gênero e de sua espécie-tipo, Azevedo & Van den Berg (2005) propuseram a
conservação do nome Prescottia (com esta grafia) e do nome Prescottia
plantaginea, rejeitando o epíteto “plantaginifolia”. Ressalte-se que é como P.
plantaginea que a espécie está determinada no material-tipo, no herbário de Lindley.
O Comitê de Nomenclatura para Plantas Vasculares (“Nomenclature Committee for
26
Vascular Plants”), em Brummitt (2007), recomendou a conservação do nome do
gênero como proposto por Azevedo & Van den Berg (2005), embora não tenha
recomendado a conservação de Prescottia plantaginea com a justificativa que,
embora os dois nomes tenham sido publicados simultaneamente (provavelmente por
uma confusão feita por Hooker) e este (P. plantaginea) seja o nome mais usado
hoje, alguns autores usaram P. plantaginifolia. O primeiro a sinonimizar um nome
sob outro foi Steudel (1841), que adotou P. plantaginifolia Lindl. Desta forma,
embora menos conhecido e usado, P. plantaginifolia Lindl. ex Hook. é o nome
correto e, portanto, o que deve ser adotado.
Dificuldades na delimitação e identificação das espécies parecem ser uma
questão histórica no gênero. Não foram poucas as confusões resultantes da
inobservância ou erros relacionados à presença e ausência de tricomas no interior
do labelo. Cogniaux (1895) usou este caráter já nos primeiros passos de sua chave
de identificação, na Flora Brasiliensis. Cogniaux (1895) citou como glabras, por
exemplo, Prescottia densiflora (Brongn.) Lindl., P. micrantha Lindl. e P. microrhiza
Barb. Rodr. que, na verdade, apresentam tricomas no interior do labelo. Hoehne
(1945) comentou sobre este problema, atribuindo a confusão ao fato de que quando
o material de herbário é fervido os tricomas aderem à parede do labelo, dificultando
a sua visualização. Para verificar sua presença deve-se observar o material de
herbário a seco em microscópio estereoscópico.
Outra característica utilizada para a descrição de muitas espécies novas e
hoje relacionadas como sinônimos, foi a variação morfológica das folhas. Suas
formas e dimensões oscilam de acordo com o meio em que a planta cresce e
Hoehne (1945) acreditava, ainda, que a idade da planta também poderia exercer
influência em tais variações.
Apesar de se tratar de um gênero relativamente pequeno, a delimitação das
espécies é muito difícil. Não existem muitos caracteres qualitativos diagnósticos.
Uma grande variabilidade morfológica é observada, especialmente entre populações
de uma mesma espécie. Tal variação entre as populações acarreta dificuldades de
delimitação das espécies a partir de dados macro-morfológicos o que tem sido
responsável também pela identificação incorreta de muitos espécimes em herbário.
O presente trabalho teve como objetivos: (i). revisar taxonomicamente o
gênero Prescottia, com base em dados macro e micromorfológicos, apresentando
27
chave de identificação para as espécies, descrições, ilustrações, comentários e
discussão sobre aspectos morfológicos e taxonômicos, além de dados sobre a
distribuição geográfica das espécies, e (ii). apresentar uma hipótese filogenética
para o mesmo, com base em dados moleculares, para testar o monofiletismo de
Prescottia, e compreender suas relações interespecificas.
28
Histórico taxonômico da subtribo Prescottiinae
Em 1840, Lindley posicionou alguns dos gêneros hoje reconhecidos como
pertencentes à subtribo Prescottiinae (Altensteinia, Gomphichis, Prescottia e
Stenoptera) junto de outros gêneros pouco relacionados a estes, na tribo Neotteae,
divisão Cranichidae. Esta divisão era caracterizada por apresentar flores nãoressupinadas, labelo côncavo, coluna ereta, antera incumbente e rostelo truncado. A
divisão Spiranthidae também foi proposta para acomodar os gêneros com flores
ressupinadas. Bentham (1881) e, subsequentemente, Bentham & Hooker (1883)
modificaram o sistema de tribo e subtribo de Lindley e uniram as orquídeas de flores
ressupinadas e as não-resupinadas em Spirantheae. Esta subtribo foi composta por
Aa, Altensteinia, Gomphichis, Prescottia e Stenoptera junto com outros táxons de
Spiranthinae.
Quase simultaneamente, Reichenbach (1881) descreveu o gênero Manniella,
da África tropical, e hipotetizou sua possível relação com o gênero Stenoptera do
Neotrópico. Com base em caracteres vegetativos, Pfitzer (1887) propôs a subfamília
Neottiinae, que consistia de várias subtribos, dentre as quais a subtribo
Cranichideae, contendo gêneros como Gomphichis, Prescottia, Altensteinia
(incluindo Aa e Myrosmodes) e Stenoptera, e a subtribo Spirantheae consistindo de
nove gêneros.
Schlechter (1915) juntou Aa (incluindo Myrosmodes), Altensteinia,
Porphyrostachys, Prescottia e Stenoptera (incluindo Gomphichis) com Cranichis,
Pterichis Lindl. e Fuertesiella, sob o mesmo grupo, denominado Cranichidinae. Cinco
anos mais tarde, Schlechter (1920) publicou uma síntese das Spiranthinae, na qual a
subtribo Cranichidinae diferia da subtribo Spiranthinae pela posição do labelo, sendo
as flores ressupinadas na última. Schlechter (1926) refinou e expandiu o sistema de
classificação previamente proposto por ele próprio, incluindo uma chave de
identificação para a subtribo. Nesse novo cenário, através de uma chave dicotômica,
Cranichideae foi subdividida em dois grupos principais: ”obtusirostellata” e
“productirostellata”, baseados na forma do rostelo. No primeiro, Aa, Altensteinia,
Gomphichis, Porphyrostachys e Stenoptera foram colocados junto de
Wullschlaegelia Rchb. f. (atualmente considerado como membro da subfamília
Epidendroideae). Um ano mais tarde Schlechter (1927) incluiu em Cranichidinae:
Wullschlaegelia, Pseudocentrum Lindl., Solenocentrum Schltr., Porphyrostachys,
29
Altensteinia, Aa (= Myrosmodes), Prescottia, Stenoptera (= Gomphichis.), Pterichis
(= Acraea Lindl.), Fuerstesiella Schltr., Cranichis Sw. (= Ocampoa A. Rich. & Gal.) e
Ponthieva R. Br. (= Nerissa Raf., = Schoenleinia Kl., = Calorchis Barb. Rodr.).
Em Cranichidinae, Dressler (1981; 1990) reconheceu 15 gêneros em duas
alianças: a aliança Altensteinia, caracterizada por coluna truncada, polínia
granulosa, ausência de caudículo e labelo simples livre da coluna, incluindo Aa,
Altensteinia, Gomphichis, Myrosmodes, Porphyrostachys, Prescottia e Stenoptera; e
a aliança Cranichis, incorporando gêneros com coluna pontiaguda, polínia
cartilaginosa com caudículos e labelo geralmente fundido com a coluna. Essas
alianças seguiram essencialmente a divisão de Schlechter (1926).
Na revisão de Spiranthinae, Garay (1982) reconheceu 390 espécies em 44
gêneros. Nesta revisão o autor propôs o gênero monotípico Pseudocranichis para
acomodar Cranichis thysanochila B.L. Rob. & Greenm. Esta espécie foi inicialmente
descrita em Cranichis principalmente por suas flores não-ressupinadas. BurnsBalogh (1986) atribuiu Pseudocranichis a Cranichidinae em vez de Spiranthinae
baseada nas seguintes características presentes em Pseudocranichis: deiscência
das anteras lateral, polínia circular em corte transversal e flores não-ressupinadas.
Rasmussen (1985), em seu tratamento para as Orchidaceae, posicionou
Prescottia e gêneros aparentados em Spiranthinae. Este grupo foi incluído na tribo
Neottieae, subfamília Neottioideae. As Spiranthinae, para Rasmussen, eram
definidas por apresentarem folhas basais em roseta e por seus órgãos
armazenadores (raízes) espessos e agregados. Este grupo, como definido por
Rasmussen (1985), pode ser comparado com a tribo Cranichideae de Dressler
(1990).
Burns-Balogh & Funk (1986) caracterizaram a subtribo Cranichidinae por
apresentar flores não-ressupinadas, estipe hamular e polínia redonda em corte
transversal. Os autores incorporaram a esta 15 gêneros e cerca de 200 espécies,
incluindo os gêneros de Prescottiinae como membros de uma Cranichidinae
expandida. Estes autores, em acordo com a classificação de Schlechter (1926),
reconheceram também as subtribos monotípicas Manniellinae e Pachyplectroninae
dentro da tribo Cranichideae.
Prescottiinae foi formalmente proposta como uma subtribo de Cranichideae
por Dressler (1990) para acomodar as orquídeas terrestres de flores não-
30
ressupinadas dos Neotrópicos. Essa nova subtribo incluiu Aa, Altensteinia,
Myrosmodes, Porphyrostachys, Prescottia e Stenoptera. A relação de grupo irmão
entre Prescottiinae e Spiranthinae foi sugerida por Dressler (1990). As Prescottiinae
assemelham-se às Spiranthinae em seu tipo de velame, no formato de suas polínias
e nos lobos retrorsos típicos de Spiranthinae que estão presentes em Prescottia
(Dressler 1993). A mesma circunscrição da subtribo foi adotada por Dressler (1993)
em seu sistema de classificação posterior, o qual dividiu a subfamília Spiranthoideae
em três tribos: Diceratosteleae, Tropidieae e Cranichideae. Neste sistema a tribo
Cranichideae foi a maior desta subfamília, com 95 gêneros e cerca de 1.140
espécies, incluindo seis subtribos: Spiranthinae, Prescottiinae, Cranichidinae,
Goodyerinae, Manniellinae e Pachyplectroninae. As orquídeas terrestres da América
tropical que habitam áreas de altitudes elevadas foram incluídas em Prescottinae,
mais rica nos Andes, onde são encontrados mais de dois-terços das espécies. A
subtribo, como definida por Dressler (1990), é unida pelo velame do tipo Spiranthes,
flores não-ressupinadas, rostelo laminar e polínias granulosas, sem hâmulo. As
Prescottiinae incluem aproximadamente 100 espécies em sete gêneros: Aa Rchb. f.,
Altensteinia Kunth, Gomphichis, Myrosmodes Rchb. f., Porphyrostachys Rchb. f.,
Prescottia Lindl. e Stenoptera C. Presl (Dressler 1990, 1993).
Szlachetko (1995) propôs incluir o morfologicamente distinto gênero
Pseudocranichis em Prescottiinae. Nesta classificação, Szlachetko (1995)
reconheceu a tribo Spirantheae como um grupo monofilético contendo seis
subtribos, dentre as quais Prescottiinae, que incluiu Aa, Altensteinia, Myrosmodes,
Porphyrostachys, Prescottia, Pseudocranichis e Stenoptera. O autor supôs uma
relação próxima entre Prescottiinae e Spiranthinae. González-Tamayo (1996)
discutiu o inapropriado posicionamento de muitos táxons não-ressupinados no
gênero Cranichis. Sugerindo a inclusão de Pterichis, Nothostele e Fuertesiella em
Prescottiinae, ao invés de Cranichidinae, com base na adnação das pétalas à sépala
dorsal.
Numa abordagem cladística de Cranichideae e Prescottiinae, usando dados
morfológicos, Vargas (1997) chegou à conclusão de que Prescottiinae era um grupo
monofilético, concordando com a circunscrição dos sistemas de classificação de
Dressler (1990; 1993) e Szlachetko (1995), mas sua relação de grupo-irmão com
Spiranthinae foi fracamente sustentada. Além disso, segundo Vargas (1997), o
31
gênero africano Manniella e Prescottiinae foram considerados grupos-irmãos por
apresentarem labelo livre da coluna, apesar da distinta distribuição geográfica.
O trabalho de Salazar et al. (2003) foi o primeiro estudo de filogenia molecular
para a tribo Cranichideae. Neste, Prescottiinae apareceu como um grupo com dois
clados, um predominantemente de gêneros andinos (Stenoptera, Gomphichis,
Porphyrostachys e Aa) e o outro formado somente pelo gênero Prescottia, com P.
tubulosa como grupo-irmão de P. plantaginifolia-P. aff. oligantha. Desta forma,
Salazar et al. (2003) concluíram que Prescottiinae e Prescottia não são grupos
monofiléticos. No trabalho de Salazar et al. (2003), a amostragem de Prescottiinae
foi incompleta (nem todos os gêneros foram amostrados), e o relacionamento entre
Prescottiinae, Cranichidinae e Spiranthinae não ficou claramente determinado,
especialmente o posicionamento do gênero Prescottia.
Chase (2003) não reconheceram a subtribo Prescottiinae, uma vez que
Prescottiinae como definida por Dressler (1993), foi considerada parafilética por
Salazar et al. (2003). Chase (2003) preferiu juntar as duas subtribos sob o nome
mais antigo, Cranichidinae sensu Dressler (1981). Salazar et al. (2003) sugeriram a
necessidade de trabalhos com maior número de caracteres e espécies para
esclarecer a relação filogenética de Prescottia e Prescottiinae entre si, e entre eles e
as subtribos Cranichidinae e Spiranthinae.
Alvarez (2005), com estudos de filogenia molecular para a subtribo
Prescottiinae, concluiu que (i) Prescottiinae é polifilética; (ii) ambos os clados de
Prescottiinae apresentam maior afinidade com Spiranthinae do que com
Cranichidinae, como sugerido por Dressler (1990; 1993) e Szlachetko (1995); e (iii)
Prescottia apresentou-se parafilética, pois Pseudocranichis, que não tinha sido
incluído na análise de Salazar et al. (2003), apareceu aninhado dentro deste. Estes
resultados indicaram que nenhum dos sistemas de classificação correntes ou
prévios para estes táxons está correto, visto que a delimitação de Dressler (1990;
1993) de Prescottiinae não é monofilética; a delimitação expandida de Prescottiinae
proposta por Szlachetko (1995) é parafilética; e a classificação revisada de Chase
(2003), que inclui Prescottiinae em Cranichidinae, seguindo Dressler (1981), torna a
última polifilética. Além disso, Prescottia só pode ser considerado monofilético se
incluir Pseudocranichis ou excluir Prescottia tubulosa.
32
Figueroa et al. (2008), seguido de Álvarez-Molina & Cameron (2009) e
Salazar et al. (2009), com base em dados moleculares, comfirmaram o parafiletismo
de Prescottia s.s., confirmando a relação de Pseudocranichis thysanochila com
Prescottia tubulosa. Salazar et al. (2003) já haviam resaltado a similaridades entre a
coluna e o labelo de Pseudocranichis thysanochila e Prescottia tubulosa. Com base
em dados moleculares e morfológicos Salazar (2009) transferiu P. tubulosa and P.
thysanochila para o gênero Galeoglossum A. Rich. & Galeotti (Salazar 2009).
Histórico taxonômico do gênero Prescottia
O gênero Prescottia foi descrito por Lindley (in Hooker 1824) com base em
uma única espécie brasileira, Prescottia plantaginifolia. O gênero foi caracterizado
por apresentar flores não-ressupinadas, sépalas e pétalas revolutas, sépalas laterais
conadas na base, labelo ereto, carnoso, cuculado, inteiro, coluna diminuta envolvida
pelo labelo, antera biloculada, persistente, estigma paralelo e polínias 4 (em dois
pares), granulosas. Posteriormente, duas espécies descritas originalmente em
Cranichis [C. stachyodes Sw. e C. oligantha Sw. (Swartz 1788)], foram transferidas
para Prescottia por Lindley (1836; 1840).
Barbosa-Rodrigues (1877, 1881) descreveu dez espécies novas de Prescottia
para o Brasil. Cogniaux (1895), na Flora Brasiliensis, citou 18 espécies de Prescottia
para o Brasil. Nesta obra o autor descreveu as espécies brasileiras e apresentou
uma chave de identificação para as mesmas. Cogniaux (1895) não mencionou as
outras espécies de Prescottia, não brasileiras, descritas anteriormente (P.
ophioglossoides Spreng., P. petiolaris Lindl., P. oligantha (Sw.) Lindl., P. tenuis
Lindl., P. lanceaefolia Link & Otto ex Steud., P. pachyrhiza A. Rich. & Galeotti, P.
orchioides Lindl., P. lindeniana A. Rich. & Galeotti, P. galeottii Rchb. f., P. cordifolia
Rchb. f., P. pellucida Lindl. e P. myosurus Rchb. f. ex Griseb.), embora tenha
sinonimizado as espécies brasileiras Prescottia colorans Lindl. e P. longipetiolata
Barb. Rodr. sob P. stachyodes (Sw.) Lindl., da Jamaica.
Na Flora Brasilica, Hoehne (1945) citou 17 espécies para o Brasil, além de
incluir algumas espécies exóticas que o autor acreditava poderem ocorrer no Brasil
(Prescottia longifolia Schltr., P. smithii Schltr., P. panamensis Schltr., P. filiformis
Schltr. e P. gracilis Schltr.). Também criou um nomen novum para a espécie
equatoriana Prescottia longipetiolata Schltr.: Prescottia schlechteri Hoehne.
33
Entretanto, não mencionou nada sobre as variedades nem sobre Prescottia tubulosa
(Lindl.) L.O. Williams e não fez nenhum comentário sobre as espécies descritas
antes dos trabalhos de Cogniaux, com exceção de Prescottia lanceaefolia Link &
Otto ex Steud., a qual considerou como sinônimo de P. lancifolia Lindl.
Em 1975, Pabst & Dungs citaram 17 espécies para o Brasil e estabeleceram
quatro grupos informais para as espécies brasileiras do gênero, baseados na forma
da folha e na presença ou ausência de tricomas no interior do labelo. Ackerman
(2003), em Genera Orchidacearum, citou 24 espécies para o gênero, apresentando
uma descrição genérica, dados sobre distribuição, palinologia, ecologia e
polinização.
34
Referências Bibliográficas
Ackerman, J.D. 1989. Prescottia and Cranichis of Puerto Rico and the Virgin Islands.
Lindleyana 4: 42-47.
Ackerman, J.D. 1995. An orchid flora of Puerto Rico and the Virgin Islands. Mem.
New York Bot. Gard. 73: 1 203.
Ackerman, J.D. 2003. Prescottia. Pp. 47–50. In Pridgeon, A.M.; Cribb, P.J.; Chase,
M.W.; Rasmussen, F.N. Genera Orchidacearum. vol. 3, Orchidoideae (part 2):
Vanilloideae. Oxford: Oxford University Press.
Alvarez, A. 2005. Phylogenetics of Prescottiinae Dressler and Systematics of
Gomphichis Lindl. (Orchidaceae). Tese de doutorado, New York: The City
University of New York.
Alvarez-Molina, A.; Cameron, K.M. 2009. Molecular phylogenetics of Prescottiinae
s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and
nuclear ribosomal DNA sequences. Am. J. Bot. 96: 1020-1040.
Atwood, J.T. 1986. The size of the Orchidaceae and the systematic distribution of
epiphytic orchids. Selbyana 9: 171-186.
Azevedo, C.O.; van den Berg, C. 2005. (1705-1706) Proposals to conserve the name
Prescottia with that spelling and P. plantaginea against P. plantaginifolia
(Orchidaceae). Taxon 54: 1105-1106.
Barbosa-Rodrigues, J. (1877). Genera et species Orchidearum novarum I. C. & H.
Fleiuss, Rio de Janeiro.
Barbosa-Rodrigues, J. (1881). Genera et species Orchidearum novarum II. C. & H.
Bentham, G. 1881. Notes on Orchideae. J. Linn. Soc., Bot. 18: 281-360.
Bentham, G.; Hooker, J.D. 1883. Orchidee. Gen. Pl. 3: 460-620.
Brummitt, R.K. 2007. Report of the Committee for Vascular Plants. Taxon 56: 12891296.
Brummitt, R.K.; Powell, C.E. (eds.) 1992. Authors of plant names: a list of authors of
scientific names of plants, with recommended forms of their names, including
abbreviations. Kew: Royal Botanic Gardens. 732p.
Burns-Balogh, P. 1986. A synopsis of Mexican Spiranthinae. Orquidea (Mexico City)
19: 47-96.
35
Burns-Balogh, P.; Funk, V.A. 1986. A phylogenetic analysis of the Orchidaceae.
Smithsonian Contr. Bot. 61: 1-79.
Cameron, K.M.; Chase, M.W. 1999. Phylogenetic relationships of Pogoniinae
(Vanilloideae, Orchidaceae): an herbaceous example of the eastern North
America-eastern Asia phytogeographic disjunction. J. Plant Res. 112: 317-329.
Chase, M.W. 2003. Phylogenetics (of Cranichidinae). In Pridgeon, A.M.; Cribb, P.J.;
Chase, M.W. & Rasmussen, F.N. (eds). Genera Orchidacearum, Vol. 3:
Orchidoideae. Part 2. Vanilloideae. Oxford: Oxford University Press.
Chase, M.W.; Cameron, K.M.; Barrett, R.L.; Freudenstein, J.V. 2003. DNA data and
Orchidaceae Systematics: a new phylogenetic classification. Pp. 69-89. In
Dixon, K.W.; Kell, S.P.; Barrett, R.L.; Cribb, P.J. (eds.). Orchid conservation.
Kota Kinabalu: Natural History Publications (Borneo). 418p.
Cogniaux, A. 1895. Orchidaceae: Prescottia. In Martius, C.F.P.; Eichler, A.G.; Urban,
I. (eds.) Flora Brasiliensis. Lipsiae: Frid. Fleischer. vol. 3(4), pp. 256-270, tab.
61-65.
Dahlgren, R.M.T.; Rasmussen, F.N. 1983. Monocotyledon evolution: characters and
phylogenetic estimation. Evol. Biol. 16: 255-395.
Dressler, R.L. 1974. Classification of the orchid family. Pp. 259–279. In Ospina, M.
(ed.) Proceedings of the Seventh World Orchid Conference. Medellín: Editorial
Bedout.
Dressler, R.L. 1979. The subfamilies of the Orchidaceae. Selbyana 5: 197-206.
Dressler, L.R. 1981. The orchids: natural history and classification. Cambridge:
Harvard University Press. 332p.
Dressler, R.L. 1986. Recent advances in orchid phylogeny. Lindleyana 1: 5-20.
Dressler, L.R. 1990. The Spiranthoideae: grade or subfamily? Lindleyana 5: 110-116.
Dressler, L.R. 1993. Phylogeny and classification of the orchid family. Portland:
Dioscorides Press. 314p.
Dressler, R.L.; Chase, M.W. 1995. Whence the orchids? Pp. 217–226. In Rudall, P.
J.; Cribb, P. J.; Cutler, D. F.; Humphries, C. J. (eds.) Monocotyledons:
systematics and evolution. Kew: Royal Botanic Gardens.
Farr, E.R.; Leussink, J.A.; Stafleu, F.A. (eds.) 1979. Index Nominum Genericorum
(Plantarum). Regnum Veg. 100-102: 1-1896.
36
Fay, M.F.; Rudall, P.J.; Sullivan, S.; Stobart, K.L.; Bruijn, A.Y.; Reeves, G.; QamaruzZaman, F.; Hong, W.P.; Joseph, J.; Hahn, W.J.; Conran, J.G.; Chase, M.W.
2000. Phylogenetic studies of Asparagales based on four plastid DNA loci. Pp.
360–371. In Wilson, K.L.; Morrison, D.A. (eds.) Monocots: systematics and
evolution. Collingwood: CSIRO.
Figueroa, C.; Salazar, G.A.; Zavaleta, H.A.; Engleman, E.M. 2008. Root character
evolution and systematics in Cranichidinae, Prescottiinae and Spiranthinae
(Orchidaceae, Cranichideae). Ann. Bot. (Oxford). 101: 509-520.
Freudenstein, J.V.; Rasmussen, F.N. 1999. What does morphology tell us about
orchid relationships? A cladistic analysis. Amer. J. Bot. 86: 225-248.
Freudenstein, J.V.; Senyo, D.M.; Chase, M.W. 2000. Mitochondrial DNA and
relationships in the Orchidaceae. Pp. 421–429. In Wilson, K.L.; Morris, M.W.
(eds.) Monocots: systematics and evolution. Collingwood: CSIRO.
Garay, L.A. 1960. On the origin of the Orchidaceae. Bot. Mus. Leafl. 19: 57-96.
Garay, L.A. 1982. A generic revision of the Spiranthinae. Bot. Mus. Leafl. 28: 278425.
González-Tamayo, R. 1996. Nezahualcoyotlia (Cranichidinae, Orchidaceae), nuevo
género del Occidente mexicano. Bol. Inst. Bot. Univ. Guadalajara 4: 65-71.
Greuter, W.; Brummitt, R.K.; Farr, E.; Kilian, N.; Kirk, P.M.; Silva, P.C. 1993. NCU-3.
Names in current use for extant plant genera. Regnum Veg. 129.
Hoehne, F.C. 1945. Orchidaceae. In Hoehne, F.C. (ed.) Flora Brasilica. vol. 12(2).
São Paulo: Secretaria da Agricultura, Indústria e Comércio de São Paulo. 389p.
Hooker, W.J. 1824. Prescotia plantaginifolia. Exotic Flora. Edinburgh: Printed for W.
Blackwood 2(13): t. 115.
Judd, W.S.; Campbell, C.S.; Kellog, E.A.; Stevens, P.F.; Donoghue, M.J. 2007. Plant
systematics: A phylogenetic approach. 3rd edition. Sunderland: Sinauer
Associates.
Kores, P.J.; Cameron, K.M.; Molvray, M.; Chase, M.W. 1997. The phylogenetic
relationships of Orchidaceae and Spiranthoideae (Orchidaceae) as inferred from
rbcL plastid sequences. Lindleyana 12: 1-11.
Kores, P.J.; Weston, P.; Molvray, M.; Chase, M.W. 2000. Phylogenetic relationships
within the Diurideae (Orchidaceae): inferences from plastid matK DNA
37
sequences. Pp. 449–456. In Wilson, K.L.; Morrison, D.A. (eds.) Monocots:
Systematics and Evolution: CSIRO.
Kores, P.J.; Molvray, M.; Weston, P.H.; Hopper, S.D.; Brown, A.P.; Cameron, K.M.;
Chase, M.W. 2001. A phylogenetic analysis of Diurideae (Orchidaceae) based
on plastid DNA sequence data. Amer. J. Bot. 88: 1903-1914.
Lindley, J. 1836. Prescóttia colórans. Edwards's Bot. Reg. 22 sub t. 1916.
Lindley, J. 1840. The genera and species of orchidaceous plants. London: Ridgways.
553p.
Loddiges, C. 1824. The Botanical Cabinet: Consisting of coloured delineations of
plants from all countries; with a short account of each, directions for
managements / By Conrad Loddiges & Sons. The Plates by George Cooke. vol.
10: t. 990.
Pabst, G.F.J.; Dungs, F. 1975. Orchidaceae Brasilienses. vol. 1. Hildesheim: Kurt
Schmersow. 408p.
Pfitzer, E.H.H. 1887. Entwurf einer natiirlichen Anordnung der Orchideen.
Heidelberg: Carl Winter’s Univertatsbuchhandlung. 108p.
Rasmussen, F.N. 1985. Orchids. Pp. 249–274. In Dahlgren, R.M.T.; Clifford, H.T.;
Yeo, P.F. (eds.). The families of the monocotyledons: structure, evolution and
taxonomy. Berlin: Springer-Verlag.
Reichenbach, H.G. 1881. Manniella gustavii. Otia Bot. Hamburg. 2: 109.
Salazar, G.A. 2009. DNA, morphology, and systematic of Galeoglossum
(Orchidaceae, Cranichidinae). Proc. Second Sci. Conf. Andean Orchids 161172.
Salazar, G.A.; Chase, M.W.; Soto Arenas, M.A.; Ingrouille, M. 2003. Phylogenetics of
Cranichideae with emphasis on Spiranthinae (Orchidaceae, Orchidoideae):
evidence from plastid and nuclear DNA sequences. Am. J. Bot. 90: 777-795.
Salazar, G.A., Cabrera, L.I., Madriñán, S.; Chase, M.W. 2009. Phylogenetic
relationships of Cranichidinae and Prescottiinae (Orchidaceae, Cranichideae)
inferred from plastid and nuclear DNA sequences. Ann. Bot. (Oxford)
http://aob.oxfordjournals.org/cgi/content/full/mcn257v1.
Schlechter, R. 1911. Die Polychondreae (Neottiinae Pfitz.) und ihre systematische
Einteilung. Bot. Jahrb. Syst. 54: 375-410.
38
Schlechter, R. 1915. Die Orchideen, III. Aufzählung und Beschreibung der Gattungen
und hauptsächlichsten Arten. Orchideen. Berlin: Paul Parey. Pp.189–246.
Schlechter, R. 1920. Versuch einer systematischen Neuordnung der Spiranthinae.
Beihefte Bot. Centralblatt 37: 317-454.
Schlechter, R. 1926. Das system der Orchidaceen. Notizbl. Königl. Bot. Gart. Berlin
9: 563-591.
Schlechter, R. 1927. Die Orchideen. ed. 2. Berlin: Paul Parey. 959 p.
Sprengel, K. P. 1826. Systema Vegetabilium. Sumptibus Librariae Dieterichianae.
vol. 3.
Steudel, E.G. 1841. Nomenclator Botanicus. ed. 2, vol. 2. Stuttgard: sumptibus I.G.
Cottae. Pp. 177–432.
Szlachetko, D.L. 1995. Systema orchidalium. Fragm. Florist. Geobot. (Supp. 3): 1152.
Swartz, O. 1788. Nova genera et species plantarum; Prodromus. 120.
Vargas, C.A. 1997. Phylogenetic analysis of Cranichideae and Prescottiinae
(Orchidaceae) with some taxonomic changes in Prescottiinae. MS Thesis, St.
Louis, Missouri: University of Missouri, St. Louis.
Vöth, W. 1976. Prescotia plantaginifolia Lindl. ex Hook. Orchidee 27: 148-153.
39
Apêndice 1. Herbários consultados, siglas segundo Holmgren & Holmgren (1998).
Collection
AAU (Herbarium Jutlandicum, Institute of Biological Sciences, University of Aarhus, Denmark)
ALCB (Universidade Federal da Bahia, Salvador, Bahia, Brazil)
AMES (Orchid Herbarium of Oakes Ames, Botanical Museum, Harvard University, Cambridge,
Massachusetts, U.S.A.)
B (Botanischer Garten und Botanisches Museum Berlin-Dahlem, Zentraleinrichtung der Freien
Universität Berlin, Berlin, Germany)
BAH (Empresa Baiana de Desenvolvimento Agrícola, Salvador, Bahia, Brazil)
BBG (Birmingham Botanical Gardens, Birmingham, Alabama, U.S.A.)
BHCB (Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil.)
BM (Natural History Museum, London, England, UK)
CAY (Institut de Recherche pour le Developpement (IRD), Cayenne, French Guiana (France)
CEN (EMBRAPA Recursos Genéticos e Biotecnologia – CENARGEN, Brasília, Distrito Federal,
Brazil)
CEPEC (CEPEC, CEPLAC, Itabuna, Bahia, Brazil)
CESJ (Universidade Federal de Juiz de Fora, Juiz de Fora, Minas Gerais, Brazil)
CGMS (Universidade Federal do Mato Grosso do Sul, Campo Grande, Mato Grosso do Sul, Brazil)
CM (Carnegie Museum of Natural History, Pittsburgh, Pennsylvania, U.S.A)
COL (Herbario Nacional Colombiano, Instituto de Ciencias Naturales, Universidad Nacional de
Colombia, D.C., Colombia)
COR (Universidade Federal do Mato Grosso do Sul, Corumbá, Mato Grosso do Sul, Brazil)
CR (Museo Nacional de Costa Rica, San José, Costa Rica)
CTES (Instituto de Botánica del Nordeste, Corrientes, Argentina)
CVRD (Reserva Natural da Vale do Rio Doce, Linhares, Espírito Santo, Brazil)
EAC (Universidade Federal do Ceará, Fortaleza, Ceará, Brazil)
ESA (Universidade de São Paulo, Piracicaba, São Paulo, Brazil)
ESAL (Universidade Federal de Lavras, Lavras, Minas Gerais, Brazil)
F (Field Museum of Natural History, Chicago, Illinois, U.S.A.)
G (Conservatoire et Jardin Botaniques de la Ville de Genève, Genève, Switzerland)
GFJP (Herbário Guido F. J. Pabst, Faculdade de Filosofia, Ciências e Letras de Carangola,
Universidade do Estado de Minas Gerais, Carangola, Minas Gerais, Brazil)
GH (Harvard University, Cambridge, Massachusetts, U.S.A.)
GUA (DIVEA, DEP, FEEMA, Rio de Janeiro, Rio de Janeiro, Brazil)
40
HAS (Fundação Zoobotânica do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil)
HASU (Universidade do Vale do Rio dos Sinos – CCS, São Leopoldo, Rio Grande do Sul, Brazil)
HB (Herbarium Bradeanum, Rio de Janeiro, Rio de Janeiro, Brazil)
HEPH (Jardim Botânico de Brasília, Brasília, Distrito Federal, Brazil)
HMS (Embrapa Gado de Corte, Campo Grande, Mato Grosso do Sul, Brazil)
HRB (IBGE, Salvador, Bahia, Brazil)
HRCB (Universidade Estadual Paulista, Rio Claro, São Paulo, Brazil)
HUA (Universidad de Antioquia, Medellín, Antioquia, Colombia)
HUFU (Universidade Federal de Uberlândia, Uberlândia, Minas Gerais, Brazil)
HUEFS (Universidade Estadual de Feira de Santana, Feira de Santana, Bahia, Brazil)
HURG (Universidade do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil)
HXBH (Fundação CETEC, Belo Horizonte, Minas Gerais, Brazil)
IAC (Instituto Agronômico de Campinas, Campinas, São Paulo, Brazil)
IBGE (Reserva Ecológica do IBGE, Brasília, Distrito Federal, Brazil)
ICN (Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil)
INPA (Instituto Nacional de Pesquisas da Amazônia, Manaus, Amazonas, Brazil)
IPA (Empresa Pernambucana de Pesquisa Agropecuária, IPA, Recife, Pernambuco, Brazil)
JPB (Universidade Federal da Paraíba, João Pessoa, Paraíba, Brazil)
K, K–L (Royal Botanic Gardens, Kew, England, U.K.)
LP (División Plantas Vasculares, Museo de La Plata, La Plata, Buenos Aires, Argentina)
M (Botanische Staatssammlung München, Munich, Germany)
MAC (Instituto do Meio Ambiente, Maceió, Alagoas, Brazil)
MBM (Museu Botânico Municipal, Curitiba, Paraná, Brazil)
MBML (Museu de Biologia Mello Leitão, Santa Teresa, Espírito Santo, Brazil)
MG (Museu Paraense Emílio Goeldi, Belém, Pará, Brazil)
MO (Missouri Botanical Garden, St. Louis, U.S.A)
MVFA (Herbario Bernardo Rosengurtt, Universidad de la República, Montevideo, Uruguay)
MVM (Museo Nacional de Historia Natural, Montevideo, Uruguay)
NY (New York Botanical Garden, New York, U.S.A)
P (Muséum National d'Histoire Naturelle, Paris, France)
PACA (Instituto Anchietano de Pesquisas/Unisinos, São Leopoldo, Rio Grande do Sul, Brazil)
PAMG (Empresa de Pesquisa Agropecuária de Minas Gerais (EPAMIG), Belo Horizonte, Minas
Gerais, Brazil)
PEL (Universidade Federal de Pelotas, Pelotas, Rio Grande do Sul, Brazil)
41
PEUFR (Universidade Federal Rural de Pernambuco, Recife, Pernambuco, Brazil)
PMSP (Prefeitura do Município de São Paulo, São Paulo, São Paulo, Brazil)
QCNE (Herbario Nacional del Ecuador, Museo Ecuatoriano de Ciencias Naturales, Quito, Ecuador)
R (Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil)
RB (Jardim Botânico do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil)
RBR (Universidade Federal Rural do Rio de Janeiro, Seropédica, Rio de Janeiro, Brazil)
RPSC (Herbarium Río Palenque Science Center, Casilla 95, Santo Domingo de los Colorados,
Ecuador)
RUSU (Universidade Santa Úrsula, Rio de Janeiro, Rio de Janeiro, Brazil)
S (Swedish Museum of Natural History, Stockholm, Sweden)
SEL (Marie Selby Botanical Gardens, Sarasota, Florida, U.S.A.)
SJRP (Unesp, Campus São José Rio Prêto, São José do Rio Prêto, São Paulo, Brazil)
SMDB (Universidade Federal de Santa Maria, Santa Maria, Rio Grande do Sul, Brazil)
SP (Instituto de Botânica, São Paulo, São Paulo, Brazil)
SPF (Universidade de São Paulo, São Paulo, São Paulo, Brazil)
TEPB (Universidade Federal do Piauí, Teresina, Piauí, Brazil)
UB (Universidade de Brasília, Brasília, Distrito Federal, Brazil)
UEC (Universidade Estadual de Campinas, Campinas, São Paulo, Brazil)
UFMT (Universidade Federal do Mato Grosso, Cuiabá, Mato Grosso, Brazil)
US (Smithsonian Institution, National Museum of Natural History, Washington, U.S.A)
USJ (Herbario Luis A. Fournier, Universidad de Costa Rica, San José, Costa Rica)
VEN (Herbario Nacional de Venezuela, Fundación Instituto Botánico de Venezuela Dr. Tobías
Lasser, Caracas, Venezuela)
VIC (Universidade Federal de Viçosa, Viçosa, Minas Gerais, Brazil)
W (Naturhistorisches Museum Wien, Wien, Austria)
42
Capítulo 1
Phylogeny of Prescottia Lindl. (Orchidaceae - Orchidoideae) based on nuclear and
chloroplast DNA regions
43
Phylogeny of Prescottia Lindl. (Orchidaceae - Orchidoideae) based on nuclear
and chloroplast DNA regions
Cecília Oliveira de Azevedo1,3,Cássio van den Berg2
1. Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade
Estadual de Feira de Santana, Av. Transnordestina s/n, Novo Horizonte, 44.036-900,
Feira de Santana, BA, Brazil.
2. Departamento de Ciências Biológicas, Laboratório de Sistemática Molecular de
Plantas, Universidade Estadual de Feira de Santana, Av. Transnordestina s/n, Novo
Horizonte, 44.036-900, Feira de Santana, BA, Brazil.
3. Author for correspondence: e-mail [email protected]
44
Abstract
Prescottia is a Neotropical genus with its main diversity center in Brazil. It
comprises approximately 15 species of mostly terrestrial herbs that are easily
recognizable by their non-resupinate tiny flowers with cucullate labellum. The
present study presents phylogenetic analyses among Prescottia speciesusing
sequences of three plastid (trnL intron and trnL-F spacer and rpoB-trnC spacer) and
one nuclear (ITS) regions. Matrices were analyzed individually and in a combined
analysis using maximum parsimony and Bayesian approaches. All analyses were
congruent in supporting the monophyly of Prescottia and Galeoglossum as sistergroup. Within Prescottia the species relationships are well resolved in two well
supported main clades, one including the long petiolate-leaved species and the
other grouping the remainder sampled species. The species with whitish flowers
and lip with pilose inner surface form a monophyletic group nested within a
paraphyletic group of the species with greenish flowers and lip with glabrous inner
surface. Two species complexes are indicated. The infrageneric classification
previously proposed for Prescottia is not supported by this study.
Keywords – Bayesian inference, molecular systematics, parsimony, plastid DNA,
nuclear DNA.
45
Introduction
Orchidaceae are rapidly becoming one of the best-studied angiosperm
families in terms of infra-familial phylogenetic relationships. These studies
demonstrate that several previous concepts about phylogenetic patterns were
incorrect, which make all previous classifications in need of review (Chase et al.
2003).
Prescottiinae s.s. was formally proposed as a subtribe within Cranichideae by
Dressler (1990) to accommodate the non-resupinate, terrestrial species of the
Neotropics, included at that subtribe before. The subtribe comprises about 100
species included in seven genera: Aa Rchb.f., Altensteinia Kunth, Gomphichis Lindl.,
Myrosmodes Rchb.f., Porphyrostachys Rchb.f., Prescottia Lindl., and Stenoptera
C.Presl. (Dressler 1990, 1993). The subtribe, as defined by Dressler (1990), is united
by the Spiranthes-type of velamen, non-resupinate flowers, a laminar rostellum, and
soft-pollinia lacking a hamulus. The subtribe is most abundant in Andean South
America, where over two-thirds of the species are found.
A sister relationship between Prescottiinae and Spiranthinae was suggested
by Dressler (1990, 1993) based on the velamen and pollinia types, and retrorse
lobules, typical of the Spiranthinae and also present in Prescottia (Dressler 1993).
Szlachetko (1995) proposed including the morphologically distinctive genus
Pseudocranichis Garay in Prescottiinae. In his classification of Orchidales, he
recognized tribe Spirantheae as a monophyletic group containing six subtribes. One
of them was Prescottiinae, which included Aa, Altensteinia, Myrosmodes,
Porphyrostachys, Prescottia, Pseudocranichis, and Stenoptera. Similarly to Dressler
(1990, 1993) Szlachetko (1995) hypothesized a close relationship between
Prescottiinae and Spiranthinae.
Using cladistic methods in a morphology-based analysis of Cranichideae and
Prescottiinae, Vargas (1997) recovered a monophyletic Prescottiinae, supporting
Dressler’s (1990; 1993) and Szlachetko’s (1995) circumscription of the subtribe, but
its sister relationship to the Spiranthinae was only weakly supported by the data. In
addition, the African genus Manniella Rchb.f. and the Neotropical Prescottiinae were
found to be sister to each other on the basis of possessing the lip free from the
column, despite their distinctive distributions.
46
Vargas (1997), based on the morphological resemblance between Prescottia
tubulosa (Lindl.) L.O. Williams and species of Porphyrostachys, suggested the former
should be transferred to the latter. Recent molecular studies (Salazar et al. 2003,
2009; Álvarez 2005; Álvarez-Molina & Cameron 2009) showed that the
morphological similarities found in Prescottia tubulosa and Porphyrostachys are
probably the result of convergence.
In contrast, molecular studies based on nuclear and chloroplast DNA regions
for Cranichideae (Salazar et al. 2003) have recovered a paraphyletic Prescottiinae,
divided into two lineages, the first being Prescottia and a monophyletic group
comprising the remaining sampled genera of the subtribe (Aa, Gomphichis,
Porphyrostachys, and Stenoptera).
Salazar et al. (2003) pointed out the similarities between the column and
labellum of Pseudocranichis thysanochila (B.L.Rob. & Greenm.) Garay and the
Mexican Prescottia tubulosa. Molecular studies (Figueroa et al. 2008, Álvarez-Molina
& Cameron 2009, Salazar et al. 2009) found the former is sister to Prescottia
tubulosa, confirming in part Szlachetko’s (1995) hypothesis of their affinities, and
Salazar et al. (2003) suggestion.
Most recently, Chase et al. (2003) proposed a new classification of the
Orchidaceae based on phylogenetic patterns. In this system, subtribe Prescottiinae
was not recognized, being included in an expanded concept of Cranichideae (sensu
Dressler 1981). This decision was mainly based on molecular studies in
Cranichideae (Salazar et al. 2003), in which the Prescottiinae were shown to be
paraphyletic. This classification has been adopted in the series Genera
Orchidacearum (Pridgeon et al. 2003).
Alvarez (2005) concluded that Prescottiinae are polyphyletic, and that both
clades of Prescottiinae showed an affinity to Spiranthinae, rather than Cranichidinae
as suggested by Dressler (1990; 1993) and Szlachetko (1995). The relationships
among Prescottiinae, Cranichidinae and Spiranthinae were not clearly resolved (e.g.
Salazar et al. 2003; Álvarez-Molina & Cameron 2009), especially the placement of
Prescottia.
Prescottia s.s. was found to be paraphyletic (Figueroa et al. 2008, ÁlvarezMolina & Cameron 2009; Salazar et al. 2009) because Pseudocranichis is nested
within it. Prescottia is monophyletic only if Pseudocranichis is classified within it or
47
Prescottia tubulosa is removed from it. To make Prescottia monophyletic, Salazar et
al. (2009) argued for the removal of P. tubulosa from Prescottia, and transferred it
and Pseudocranichis thysanochila to Galeoglossum A.Rich. & Galeotti (Salazar
2009). Morphologically, the main difference between Galeoglossum and Prescottia
are the distal part of the lip, that is open, with a distinct apical lobule in the former,
and not cucullate as in Prescottia. The stigma saddle-shaped, separated by a nonreceptive central portion, that is present in Galeoglossum, whereas in Prescottia s.s.
there is a single receptive area located on the ventral surface of the column. The
other difference is the pollinarium, which has two ribbon-like pollinia in Galeoglossum
(Salazar 2009), while in Prescottia there are four obovate pollinia.
Pabst & Dungs (1975) established four informal groups within Prescottia.
Prescottia colorans “alliance” including: P. glazioviana Cogn., P. leptostachya Lindl.,
P. stachyodes Lindl., and P. stricta Schltr., characterized by the lip internally
glabrous, and elliptic leaves, clearly petiolate. Prescottia plantaginea “alliance”
including: P. montana Barb.Rodr., P. nivalis Barb.Rodr., P. phleoides Lindl., and P.
plantaginifolia Lindl. ex Hook., distinguished by the lip internally glabrous, and
lanceolate leaves indistinctly petiolate. Prescottia oligantha “alliance” was
represented by P. densiflora Lindl., P. microrhiza Barb.Rodr. P. oligantha (Sw.)
Lindl., and P. pubescens Barb.Rodr., differentiated by the lip internally densely
pilose, and elliptic or oval leaves.The last, Prescottia lancifolia “alliance” comprised
by P. epiphyta Barb.Rodr., P. lancifolia Lindl., P. octopollinica Barb.Rodr., and P.
polyphylla Porsch., separated from the others by the lip internally densely pilose, and
lanceolate leaves.
The study presented here attempts to evaluate the monophyly of the genus
Prescottia in its current circumscription, to check the monophyly of the proposed
infrageneric alliances, to investigate phylogenetic relationships within and among
species of Prescottia, and to explore evolutionary patterns within the genus using
sequence data from the plastid (trnL intron and trnL-F spacer and rpoB-trnC spacer)
and nuclear (ITS) genome.
48
Materials and Methods
Taxon sampling - In order to reconstruct a phylogeny for the genus we
included 11 of 15 species of Prescottia accepted in a recent taxonomic revision
(Chapter 3). Besides the accessions of Prescottia, one species of each genera of
Cranichidinae s.s. and Prescottiinae s.s. (Galeoglossum, Stenoptera, Altensteinia,
Porphyrostachys, Gomphichis, Aa, Pterichis Lindl., Cranichis Sw., Ponthieva R.Br.),
and a couple of Spiranthinae were included in the ingroup (Appendix 1). Galeottiella
sarcoglossa (A.Rich. & Galeotti) Schltr. (Galeottiellinae) was taken as outgroup,
based on previously molecular studies in Cranichideae (Salazar et al. 2003, 2009;
Álvarez-Molina & Cameron 2009). Twenty five percent of the sequences were
obtained from Genbank, and the remaining 75% were sequenced in this study.
Prescottia carnosa C.Schweinf., P. glazioviana, P. lojana Dodson and P.
ecuadorensis C.O. Azevedo & Van den Berg were not included due to lack of
suitable material for molecular work. Besides, we included different morphs or
several samples from different locations of Prescottia leptostachya, P. montana, P.
oligantha, P. plantaginifolia, P. spiranthophylla Barb. Rodr., and P. stachyodes, in
order to assess the existence of sequence polymorphism below the species level.
Several protocols for herbarium material were tried without sucess. Appendix 1 lists
all species sampled in this study with voucher information and Genbank accession
numbers.
DNA extraction, amplification, and sequencing - Total DNA was extracted
mostly from fresh or silica-gel-dried leaves using a modified version of the 2× CTAB
protocol (Doyle & Doyle 1987). For amplification and sequencing of nuclear Internal
Transcribed Spacers (ITS) we used the primers 75 and 92 (Desfeaux et al. 1996),
and a PCR program consisting of 40 cycles of 94ºC denaturation for 1 min, 50ºC
annealing for 1 min, and 72ºC extension for 3 min, with 72ºC for 7 min of final
extension. To reduce problems related to secondary structure during amplification
and sequencing, 2% dimethyl sulfoxide (DMSO) and 1.0 M of betaine were added to
the PCR. For the trnL intron and trnL-F spacer (hereafter trnL-F) we used the four
universal primers (c, d, e, and f) of Taberlet et al. (1991) and a PCR program
consisting of 35 cycles of 94ºC denaturation for 45 s, 50-55ºC annealing for 1 min,
49
and 72ºC extention for 1:30 min, with 72ºC for 10 min of final extension. The plastid
spacer rpoB-trnC (Shaw et al. 2005) was amplified consisting of 30 cycles of 94ºC
denaturation for 30 s, 50ºC annealing for 30 s, and 72ºC extention for 1 min, with
72ºC for 7 min of final extension (See table 1 to the PCR programs used for each
DNA regions).
Amplification of all DNA regions was carried out in 50 µL polymerase chain
reactions (PCR) including 1.25 units of Taq polymerase (Phoneutria LTDA, Belo
Horizonte, Brazil), 1 × Mg-free DNA polymerase buffer (Phoneutria), 2.5 mM MgCl2,
10 mM dNTP, 0.05% bovine serum albumin (BSA), 0.5 µM each primer.
All the PCR reactions were performed in a GeneAmp PCR System 9700
termocycler (Applied Biosystems). PCR products were quantified and then purified
with Exonuclease I and Shrimp alkaline phosphatase – SAP (kit ExoSapIT, GE
Healthcare). Which were sequenced in both directions, using the Big Dye Terminator
kit version 3.1 (Applied Biosystems) on a SpectruMedix SCE9624 automated
capillary sequencer following the manufacturers’ protocols. The primers used for
sequencing were the same as those used for PCR.
Sequence alignment and indel coding - Electropherograms were edited and
assembled using STADEN PACKAGE (Staden et al. 1998). Sequence fragments
were subjected to BLAST searches to verify their identity. The sequences were
aligned using Clustal X, version 1.8 (Thompson et al. 1997) and subsequently
visually adjusted as necessary, following the guidelines in Kelchner (2000).
The indels were coded and included as a separate binary (presence/absence
of the gap, assuming that state 0 denotes absence of a gap) for each DNA regions
using GapCoder software (Young & Healy 2003). All autopomorphic sites were
manually removed. The trnL-F coded indels were removed because its RI was lower
than the trnL-F without coded indels. The aligned matrix is available on request from
COA and CVDB, and all sequences have been submitted to GenBank
(http://www.ncbi.nlm.nih.gov) (see Appendix 1).
Phylogenetic analyses – The incongruence length difference (ILD) test
(Farris et al. 1995) was performed to assess the congruence between data partitions,
to verify the possibility to combine different phylogenies of the same taxa from
different genes (Dolphin 2000). The data partitions were combined in the following
50
way: trnL-trnF × rpoB-trnC and then plastid regions × ITS. The ILD test was
performed with PAUP* (Phylogenetic analysis using parsimony, version 4.0b 10
(Swofford 2002), as the partition homogeneity test (PHT). For each partition, we used
500 replicates for ILD, and in each replicate heuristic searches with 50 replicates of
random taxon addition, tree bisection-reconnection (TBR) branch swapping
algorithm, saving 15 trees per replicate.
Maximum parsimony (MP) - Analyses were conducted in PAUP* with Fitch
parsimony (equal weights, unordered characters; Fitch 1971) as the optimality
criterion. Each data set was analyzed separately, and then we preformed an analysis
with all plastid regions (cpDNA), after that a combined analysis with all data sets
(cpDNA e nrDNA) were. Each search consisted of 2,000 random taxon-addition
replicates, with tree bisection-reconnection (TBR) branch swapping and the
MULTREES option on, saving all most parsimonious trees. All characters were
unordered and equally weighted (Fitch parsimony; Fitch 1971). Internal support of
clades was evaluated by the bootstrap (Felsenstein 1985), with 5,000 replicates with
tree bisection-reconnection (TBR) branch swapping, saving 20 trees per replicate.
Bayesian analyses (BA) - The models of sequence evolution were chosen
using the hierarchical likelihood ratio test conducted in MRMODELTEST version 2.2
(Nylander 2004). The analysis was run at MRBAYES version 3.1 (Ronquist et al.
2005). Two completely independent analyses starting from different randomly chosen
trees, of four Markov chains were run simultaneously for 2,000,000 generations,
sampling from the trees every 100th generation. The average standard deviation of
split frequencies was reached at around 1,000,000 generation. Therefore, the trees
produced in the first 1,000,000 generations (10,000 trees) were discarded as an
extended ‘‘burn-in,’’ and inference about relationships was based only on the
remaining 1,000,000 generations (10,000 trees).
Results
Details on the sizes of the aligned matrices, number of characters considered
in the analysis, number of variable sites, number of potentially informative sites for
the parsimony, number of changes per site, length (number of steps) of the trees
obtained, consistency index (CI), retention index (RI), transition / transversion rates,
51
trees generated in the heuristic search, and number of taxa used in each region
analyzed are provided in Table 2. In all parsimony analyses, we selected the first tree
obtained as a random sample for displaying the results, plotting the support values
on it. Clades that were not present in all shortest trees are marked with an
arrowhead; clades without values have less than 50% bootstrap.
Parsimony analyses – The most variable data set was ITS (32% variable
characters), which also had the lowest consistency index (CI = 0.63 and RI = 0.81;
characters optimized on the combined tree). The rpoB-trnC variation was around
15%, with a CI = 0.73, and RI = 0.83. The least variable data set was trnL-F region
with only 12% potentially informative sites, with a CI = 0.69, and the lowest retention
indice, RI = 0.72.
The analysis of ITS included 684 characters, from which 32% were variable
and 16% were parsimony informative (Table 2). Maximum parsimony analysis of this
data generated 144 equally parsimonious trees, with 725 steps, one of which is
shown in Fig. 1. In this data set, Prescottia oligantha (Azevedo 333) and P.
stachyodes (Azevedo 325, and Pangui) were removed because we were unable to
obtain good quality sequences of them. The ITS analysis strongly support the
monophyly of Prescottia (BP 99). The relationship of the group with Galeoglossum
tubulosum (Lindl.) Salazar & Soto Arenas and G. thysanochilum (B.L.Rob &
Greenm.) Salazar as sister-group to Prescottia is not confirmed in this analysis.
Instead, Spiranthinae are sister to a group with low support (BP 68), unresolved,
comprising the Altensteinia clade, Prescottia, Galeoglossum, and Cranichidinae s.s.
Within Prescottia two main clades were recovered; one including the long petiolateleaved species (clade A, with BP 100), and the other clade presenting the remainder
species. In the former, Prescottia stachyodes samples are sister to P. montana
samples. Within the other clade, two other subclades are present. One, clade B,
includes P. leptostachya samples sister to P. mucugensis C.O. Azevedo & Van den
Berg. and P. phleoides (BP 100). The other clade presents two subclades: one with
the species with sessile to pseudopetiolate leaves (clade C) and the other with all
species with whitish flowers, and lip inner surface pilose (clade D). Clade C is a well
supported group (BP 99), and includes P. plantaginifolia samples sister to P.
spiranthophylla samples. Clade D is also well supported (BP 98), including P.
52
lancifolia sister to P. ostenii Pabst (BP 82), which in turn is sister to P. densiflora and
P. oligantha samples (BP 87).
The trnL-F analysis included 1.388 characters, from which 12% were variable
and parsimony informative (Table 2). Here, sequences of P. lancifolia (Bocayuva
198), P. leptostachya (Azevedo 201, and 250) and P. stachyodes (Azevedo 200,
277, 277.1, s.n., 318, 325, van den Berg s.n., Salazar 7312, EC, Pan) were removed
because we could not obtain sequences of good quality. The heuristic search based
on the trnL-F data set generated 1.014 equally parsimonious trees of 602 steps, one
of which is shown in Fig. 2. The intergeneric relationships are similar to those
recovered by ITS. The Spiranthinae are sister to a polytomy comprising the
Altensteinia clade, Prescottia, Galeoglossum, and Cranichidinae s.s. However, the
monophyly of Prescottia was not corroborated in this analysis. Galeoglossum
tubulosum and G. thysanochilum are embedded in Prescottia with low support (BP
52). Besides that, this analysis presents the same groups defined in the ITS tree as
clade A (BP 100) and B (BP 99). The clades C and D found in the ITS tree are not
formed with trnL-F, although the topology recovered in this part of the tree has low
support (BP 55 - 69).
The heuristic search based on the rpoB-trnC matrix generated six equally
parsimonious trees of 657 steps, one of which is shown in Fig. 3. This analysis
included 1.416 characters, from which 15% were variable and 14% were parsimony
informative (Table 2). Sequences of P. stachyodes (Azevedo s.n., 318) were
unavailable because we were unable to amplify the DNA for these samples. The tree
obtained was similar to the ITS tree. However there is a lack of support along the
spine of the tree. Nevertheless, we still obtained the same two main clades of the ITS
analysis, clade A (with BP 100) and the other clade presenting the remainder species
(BP 100), including clade B (BP 100) and clade D (BP 81). No clade equivalent to
clade C of the ITS analysis is recovered. Instead, P. plantaginifolia is sister to clade
D (with BP 90), which in turn is sister to P. spiranthophylla (BP 92). Within Clade D,
P. oligantha samples are sister to a subclade where P. densiflora is sister to P.
lancifolia and P. ostenii (BP 96).
The Incongruence length difference test (ILD) did not detect significant
incongruence between the plastid regions (trnL-F × rpoB-trnC: p value = 0.49).
However, in the other data partition cpDNA × ITS the hypothesis of congruence was
53
rejected (p < 0.01). After careful inspection of individual analyses searching for
possible well-supported incongruences we found no strongly supported incongruent
patterns of relationship, and we decided to carry out a combined analysis of all data,
despite the ILD results.
The combined analysis produced 12 trees, one of which (randomly selected) is
shown in Fig. 4. This trees had L = 2028 steps, CI = 0.68, and RI = 80 (Table 2). The
strict consensus tree is nearly fully resolved. The combined analyses strongly
support the monophyly of Prescottia (BP 95), in agreement with the ITS tree, having
as sister-group the clade formed by Galeoglossum tubulosum and G. thysanochilum
with low support (BP 52). This pattern was not recovered in the individual analyses,
where there is a lack of resolution among most of the ingroup. Here, Spiranthinae are
sister to a well supported group (BP 92) comprising the Altensteinia clade sister to
Cranichidinae s.s., and Galeoglossum sister to Prescottia. Within Prescottia, as in the
ITS and rpoB-trnC analyses, two main clades are recovered, previously defined as
clade A (BP 100), and the other presenting the remainder species. Within the latter,
two subclades are present: clade B as defined in the ITS tree (BP 100), and the other
clade presenting two subclades: the clade C as defined in ITS (BP 87), and the clade
D (BP 97), as recovered in the rpoB-trnC analysis.
Bayesian analysis – The sequence models selected were: (i) the general
time-reversible model and gamma distribution (GTR + gamma) for ITS (ii) the general
time-reversible model with a proportion of invariant characters and gamma
distribution (GTR + Inv + gamma) for trnL-trnF, (iii) GTR + gamma for and rpoB-trnC,
and (iv) lset coding=variable for the ITS and (iv) rpoB-trnC coded indels. The
Bayesian analysis based on all DNA regions and coded indels of ITS and rpoB-trnC
(Fig. 5) produced a well-supported tree as assessed by posterior probabilities (PP).
Essentially, the same topology observed in the analysis of combined parsimony was
maintained. Spiranthinae being sister to a moderately supported group (PP 92)
comprising the Altensteinia clade as sister of a well-supported group (PP 100); that
includes a monophyletic Prescottia (PP 100) sister to Galeoglossum, which in turn is
sister to Cranichidinae s.s (PP 97). The infrageneric relationships recovered the
same topology as obtained in the combined analysis. The tree is fully resolved and
54
the majority of the clades recovered is highly supported, including clades A (PP 100),
B (PP 100), C (PP 100), and D (PP 100).
Discussion
Molecular evolution – Despite the ILD results, most phylogenetic patterns in
Prescottia based on different plastid and nuclear fragments were congruent.
Especially in terms of the establishment of the genus monophyly, the sister position
of Galeoglossum tubulosum and G. thysanochilum, and the subdivision into two main
groups: the clade A and the other formed by groups B, C and D. Incongruence
between DNA data sets in orchids has been found predominantly within genera at
species level (e.g. Goldman et al. 2004, Koehler et al. 2008). Some studies
demonstrated that although the tests indicated the presence of incongruence, the
combined analyses demonstrated data congruence (Yoder et al. 2001).
The combined DNA matrix with coded indels of ITS and rpoB-trnC includes
information from all regions. Since the parsimony and Bayesian analyses of the
combined data provided a similar topology and detailed information on the
phylogenetic relationship within the genus, we favor the results of these analyses
over all others, suggesting that the differences observed in the individual analyses
were caused by the character sampling error in single data sets and not by true
incongruence among DNA regions. Furthermore, the Bayesian analysis resulted in a
fully resolved and well-supported tree. For this reason, this tree is taken as the best
hypothesis of relationship for our study and, unless otherwise stated, the discussion
refers to it.
As expected, the two ITS spacer regions, ITS 1 and ITS 2, have the greatest
number of variable sites with the faster rate of change. ITS also presents the lowest
consistency index (Table 2). Undoubtedly, the data set with greatest contribution in
resolving clades was ITS, which can be explained by its greater number of variable
sites and their higher rate of substitution. ITS was more informative than trnL-F, the
same result was found by Soliva et al. (2001), Higgins et al. (2003) and van den Berg
et al. (2005). Our plastid data sets displayed lower variation in comparison with the
ITS, similar results have been observed in Salazar et al. (2003) and Álvarez-Molina &
55
Cameron (2009). The rpoB-trnC displays the greatest evolutionary rate between the
two plastid fragments used, confirming Shaw et al. (2005) results.
Intergeneric relationships – Chase (2003) resurrected Cranichidinae (sensu
Dressler 1981), putting back the genera transfered to Prescottiinae by Dressler
(1990, 1993). The Bayesian analysis of Salazar et al. (2009) support this approach.
The analyses presented here, except for the rpoB-trnC analysis, corroborate this
result, since Cranichidinae s.l. is recovered as monophyletic. Our analyses indicate
that Spiranthinae are sister to Cranichidinae s.l. Within Cranichidinae s.l. the
Altensteinia clade is sister of a group that includes Prescottia as sister to
Galeoglossum, which in turn is sister to Cranichidinae s.s.
The analyses sugest that Galeoglossum is the genus most closely related to
Prescottia. This result corroborated the results of Álvarez (2005), Figueroa et al.
(2008), Álvarez-Molina & Cameron (2009), and Salazar et al. (2009). Galeoglossum
has a restrict distribution in Mexico and Guatemala. Some morphological characters,
such as a cucullate lip and stigma with a single receptive area located on the ventral
surface of the column constitute synapomorphies of Prescottia.
Infrageneric relationships – The topologies obtained here indicate that the
informal groups proposed by Pabst & Dungs (1975) are not monophyletic. The
Prescottia colorans “alliance” is not monophyletic because P. leptostachya is not
included in the clade that contains the other species of that section. Besides that, P.
montana is part of this clade and not part of the P. plantaginea “alliance” as proposed
by Pabst & Dungs (1975); recovering the latter as polyphyletic, because besides that,
P. phleoides is not included in this clade. The Prescottia oligantha “alliance” and
Prescottia lancifolia “alliance” are also paraphyletic, once the whitish flower with lip
internally pilose appears here as a monophyletic clade, where P.densiflora is more
close related to P. lancifolia and not to P. oligantha as proposed by Pabst & Dungs
(1975). Due to the inconsistency of the morphological characters used to define the
four groups (Pabst & Dungs 1975), we suggest their rejection altogether. Given the
small number of species currently accepted (Chapter 3) we prefer not to establish
intrageneric divisions within Prescottia.
56
Species’ delimitation - Six of the 11 sampled species of Prescottia were
represented by more than one sample in each data set. None of the analyses
rejected the current species circumscription, since all accessions of each species
cluster together (PP 100). Two species complexes (around Prescottia oligantha and
P. stachyodes), composed of species with extremely variable morphology, also
emerged as monophyletic groups from these analyses, with high support (PP 100).
Species’ boundaries among these taxa have been questioned, and there are many
names available for species within each complex. In view of the fact that is very
difficult to distinguish its morphs, since they are defined by continuously variable
morphological characters, as leaf shape and size, and floral size, P. oligantha and P.
stachyodes have been considered in a broadened circumscription (Chapter 3). The
sequence data presented here are not sufficient to elucidate the relationship within
these clades, because they do not include an adequate sampling for that purpose.
Evolution of selected characters in Prescottia - In terms of vegetative and
floral morphological characters, little can be inferred based on the relationships
among different species of Prescottia. When grouping based on vegetative
characters, species groups delimited by sessile to petiolate leaves are not fully
congruent with the major groupings recovered in phylogenetic reconstruction. Those
species with long petiolate leaves are monophyletic and highly supported as an
synapomorphy of the clade A, and those with sessile, pseudopetiolate or short
petiolate leaves are paraphyletic.
In terms of the floral characters, when grouping based on flower color and
presence or absence of tricomas, we observe that those species of whitish flowers
with the inner surface of the lip pilose form a monophyletic and highly supported
group, whereas those species with greenish flowers and lip inner surface glabrous do
not form a monophyletic group, because the whitish flower group is within it.Change
from greenish to withish flowers is indicated as a synapomorphy for clade D. This
character evolved together with the presence of trichomes in the inner surface of the
lip, also synapomorphic. The greenish flowers with lip inner surface glabrous appears
to be the plesiomorphic character state. The arrangement of the flower into loose and
dense inflorescence has also evolved more than once within the genus. The species
within clade C share some morphological characters such as lip with outer surface
57
with trichomes at the base, and column with dorsal surface covered by trichomes,
which are synapomorphies of this clade.
Terrestrial habit is considered plesiomorphic in the Orchidaceae and in
Asparagales as a whole (Neyland and Urbatsch, 1995). Nearly all Orchidoideae are
terrestrials.The positioning of Prescottia lancifolia (an epiphyte or facultative epiphyte
species) suggests that it evolved from a terrestrial habit ancestor.
Distribution of Prescottia – Within the clade containing species of Prescottia
with long petiolate leaves (clade A), P. stachyodes has a widespread distribution; it
occurs in the extreme points of the genus distribution and displays one of the largest
ecological plasticity within Prescottia. It prefers humid and shaded forests, and
elevation from sea level to 3.600 m. The other species of this clade, P. montana, has
a more restrict distribution, occurring from Southeast of Brazil (plus Goiás, and
Bahia) to Argentina, where it grows in open areas, at elevations between 730 and
2,660 m.
The species within clade B are restricted to Brazil, with a more restricted
distribution. Prescottia leptostachya and P. mucugensis are restricted to Bahia and P.
phleoides occurs in southeastern Brazil (plus Goiás). The members of this clade
have a preference for open areas, at elevations between sea level and 2,000 m.
Species in Clade C are also restricted to Brazil and from open areas. P.
spiranthophylla is endemic to Rio de Janeiro, whereas P. plantaginifolia occurs
throughout the northeastern to southeastern Brazil. The whitish flower species (clade
D), with the exception of P. oligantha, present a restricted distribution. Prescottia
oligantha and P. lancifolia inhabit shady sites in moist and wet forest, whereas P.
densiflora and P. ostenii have a marked preference for open vegetation.
The results indicate that the widespread (reaching Central America, West
Indies and Florida), and vegetatively highly polymorphic species, included in this
genus belong to two distinct clades (Prescottia stachyodes clade A, and P. oligantha
clade D).
58
Conclusions
The resulting phylogeny improves our understanding about the relationship
within Prescottia species. It had been useful in helping to clarify the circumscription of
Prescottia species, and was also used as the base for discussion in the taxonomic
monograph presented in chapter 3.
Although the present analyses included most of the species currently
recognized in Prescottia (Chapter 3), covering most of the morphological diversity
found in the genus, the rare Brazilian species P. glazioviana, and the extra Brazilian
long petiolate-leaved species (Prescottia carnosa, P. lojana and P. ecuadorensis)
were not included in this study. The inclusion of them would permit a clear
understanding about their relationship.
Further studies utilizing more infraspecific samples, including samples from
different sites of the wide range of the species distribution, and different molecular
markers at population level and phylogeography are recommended to clarify
questions about the relationship within each complex. Population samples are
already being collected for that purpose.
Acknowledgements
The authors would like to acknowledge the Conselho Nacional de Desenvolvimento
Científico e Tecnológico - CNPq for fellowships to C.O.Azevedo (GD) and C. van den
Berg (PQ-2D).
59
Literature Cited
Alvarez, A. (2005). Phylogenetics of Prescottiinae Dressler and Systematics of
Gomphichis Lindl. (Orchidaceae). Doctoral Thesis. New York: The City
University of New York.
Alvarez-Molina, A. & Cameron, K.M. (2009). Molecular phylogenetics of Prescottiinae
s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and
nuclear ribosomal DNA sequences. Am. J. Bot. 96: 1020-1040.
Chase, M.W. (2003). Phylogenetics (of Cranichidinae). In: Pridgeon, A.M.; Cribb,
P.J.; Chase, M.W. & Rasmussen, F.N. (eds). Genera Orchidacearum, Vol. 3:
Orchidoideae. Part 2. Vanilloideae. Oxford: Oxford University Press.
Chase, M.W.; Cameron, K.M.; Barrett, R.L. & Freudenstein, J.V. (2003). DNA data
and Orchidaceae Systematics: a new phylogenetic classification. In: Dixon,
K.W.; Kell, S.P.; Barrett, R.L. & Cribb, P.J. (eds). Orchid conservation. Kota
Kinabalu: Natural History Publications. 418p.
Desfeaux, C.; Maurice, S.; Henry, J.P.; Lejeune, B. & Gouyon, P.H. (1996). The
evolution of reproductive system in the genus Silene. Proceedings: Biological
Sciences. 263: 409-414.
Dolphin, K.; Belshaw, R.; Orme, C.D.L. & Quicke, D.L.J. 2000. Noise and
incongruence: interpreting results of the incongruence length difference test.
Molec. Phylogenet. Evol. 17: 401-406.
Doyle, J.J. & Doyle, J.L. (1987). A rapid DNA isolation method for small quantities of
fresh tissues. Phytochemical Bulletin of the Botanical Society of America. 19: 1115.
Dressler, R.L. (1981). The orchids: natural history and classification. Cambridge:
Harvard University Press. 332 p.
Dressler, R.L. (1990). The Spiranthoideae: grade or subfamily? Lindleyana 5: 110116.
Dressler, R.L. (1993). Phylogeny and Classification of the Orchid Family. Portland:
Dioscorides Press. 314p.
Farris, J.S.; Källersjö, M.; Kluge, A.G. & Bult, C. (1995). Constructing a significance
test for incongruence. Syst. Biol. 44: 570-572.
60
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39: 783-791.
Figueroa, C.; Salazar, G.A.; Zavaleta, H.A. & Engleman, E.M. (2008). Root character
evolution and systematics in Cranichidinae, Prescottiinae and Spiranthinae
(Orchidaceae, Cranichideae). Ann. Bot. (Oxford). 101: 509-520.
Fitch, W.M. (1971). Towards defining the course of evolution: minimum change for a
specific tree topology. Syst. Zool. 20: 406–416.
Higgins, W. E.; van den Berg, C.; Whitten, W. M. 2003. A combined molecular
phylogeny of Encyclia (Orchidaceae) and relationships within Laeliinae. Selbyana
24: 165-179.
Kelchner, S.A. (2000). The evolution of non-coding chloroplast DNA and its
application in plant systematic. Ann. Missouri Bot. Gard. 87: 482–498.
Koehler, S.; Cabral, J.S.; Whitten, W.M.; Williams, N.H.; Singer, R.B.; Neubig, K.M.;
Guerra, M.; Souza, A.P. & Amaral, M.C.E. (2008). Molecular Phylogeny of the
Neotropical Genus Christensonella (Orchidaceae, Maxillariinae): Species
Delimitation and Insights into Chromosome Evolution. Ann. Bot. (Oxford). 102:
491-507.
Neyland, R. & Urbatsch, L.E. (1995). A terrestrial origin for the Orchidaceae
suggested by a phylogeny inferred from ndhF chloroplast gene sequences.
Lindleyana 10: 4244–251.
Nylander, J.A.A. (2004). MrModeltest v2. Program distributed by the author.
Evolutionary Biology Centre, Uppsala University.
Pabst, G.F.J. & Dungs, F. (1975). Orchidaceae Brasilienses. Hildesheim: Kurt
Schmersow. 408p.
Pridgeon, A.M.; Cribb, P.J.; Chase, M.W. & Rasmussen, F.N. (eds) (2003). Genera
Orchidacearum, Vol. 3: Orchidoideae (part 2). Vanilloideae. Oxford: Oxford
University Press. 360 pp.
Ronquist, F.; Huelsenbeck, J.P. & Mark, P. (2005). MRBAYES 3.1: Manual. 69p.
Salazar, G. A. (2009). DNA, morphology, and systematic of Galeoglossum
(Orchidaceae, Cranichidinae). Proc. Second Sci. Conf. Andean Orchids 161172.
Salazar, G.A.; Chase, M.W.; Soto Arenas, M.A. & Ingrouille, M. (2003).
Phylogenetics of Cranichideae with emphasis on Spiranthinae (Orchidaceae,
61
Orchidoideae): evidence from plastid and nuclear DNA sequences. Am. J. Bot. 90:
777-795.
Salazar, G.A., Cabrera, L.I., Madriñán, S. & Chase, M.W. (2009). Phylogenetic
Shaw, J.; Lickey, E.B.; Beck, J.T.; Farmer, S.B.; Liu, W.; Miller, J.; Siripun, K.; Winder,
C.T.; Schilling, E.E. & Small, R.L. (2005). The tortoise and the hare ii: relative utility
of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot.
92: 142–166.
Soliva, M.; Kocyan, A. & Widmer, A. (2001). Molecular Phylogenetics of the Sexually
Deceptive Orchid Genus Ophrys (Orchidaceae) Based on Nuclear and Chloroplast
DNA Sequences. Molec. Phylogenet. Evol. 20: 78-88.
Staden, R.; Beal, K.F. & Bonfield, J.K. (1998). The Staden package. Methods in
Molecular Biology. 132: 115-130.
Szlachetko, D.L. (1995). Systema orchidalium. Fragm. Florist. Geobot. (Supp. 3): 1152.
Swofford, D.L. (2002). PAUP: Phylogenetic Analysis using Parsimony. Version 4.0.
Champaign: Illinois Natural Survey.
Taberlet, P.; Gielly, L.; Pautou, G. & Bouvet, J. (1991). Universal primers for
amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17:
1105-1109.
Thompson, J. D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F. & Higgins, D.G. (1997).
The CLUSTALX windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882.
Van den Berg, C.; Goldman, D.H.; Freudenstein, J.V.; Pridgeon, A.M., Cameron, K.
M. & Chase, M.W. (2005). An overview of the phylogenetic relationships within
Epidendroideae inferred from multiple DNA regions and recircumscription of
Epidendreae and Arethuseae (Orchidaceae). Am. J. Bot. 92: 613-624.
Vargas, C.A. (1997). Phylogenetic analysis of Cranichideae and Prescottiinae
(Orchidaceae), with some taxonomic changes in Prescottiinae. MSc thesis,
University of Missouri, St. Louis.
62
Yoder, A.D.; Irwin, J.A. & Payseur, B.A. (2001). Failure of the ILD to determine
combinability for slow loris phylogeny. Syst. Biol. 50: 408-424.
Young, N.D. & Healy, J. (2003). GapCoder automates the use of indel characters in
phylogenetic analysis. BMC Bioinformatics 4: 1-6.
63
Table 1. Primers and PCR programs for amplifying the regions of the cpDNA and nrDNA in the current study.
Primers
ITS
ITS 92 (AAGGTTTCCGTAGGTGAA)
ITS 75 (TATGCTTAAACTCAGCGGG)
trnL-F
c (forward) (CGAAATCGGTAGACGCTA)
f (reverse) (ATTTGAACTGGTGACACGAG)
e (forward) (GGTTCAAGTCCCTCTATCCC)
d (reverse) (GGGGATAGAGGGACTTGAAC)
rpoB (CKACAAAAYCCYTCRAATTG)
trnC (CACCCRGATTYGAACTGGGG)
Pre-melt
Amplification
Nº cycles in the
amplification
Final extention
94ºC (1 min)
94ºC (45 sec) + 50ºC (1 min) + 72ºC
(3 min)
94ºC (45 s) + 50-55ºC (1 min) + 72ºC
40
72ºC (7 min)
35
72ºC (10 min)
30
72ºC (5 min)
94ºC (3 min)
(1:30 min)
94ºC (1 min)
94ºC (30 sec) + 50ºC (30 sec) + 72ºC
(1 min)
64
Table 2. Features of DNA data sets used in this study, in relation to one of the most parsimonious trees resulting from the combined
analysis (percentages calculated in relation to aligned length).
ITS region
ITS 1
5.8S
ITS 2
ITS indels
trnL-F region
trnL-F intron
trnL-F exon
trnL-F intergenic spacer
trnL-F indels
rpoB-trnC
rpoB-trnC indels
cpDNA
cpDNA and nrDNA
Aligned
matrix
(pb)
684
252
165
267
29
1388
822
51
515
106
1416
73
2804
3517
No. of variable
characters
216 (32%)
104 (41%)
09 (5.50%)
103 (39%)
21 (72%)
172 (12%)
92 (11%)
01 (2%)
79 (15%)
45 (42%)
210 (15%)
36 (49%)
382 (14%)
619 (18%)
No. of parsimony
informative
characters
110 (16%)
60 (24%)
04 (2%)
46 (17%)
08 (28%)
165 (12%)
84 (10%)
01 (2%)
80 (16%)
60 (57%)
201 (14%)
35 (48%)
366 (13%)
484 (14%)
No. changes
/ variable site
Tree
length
CI
RI
Ts:tv
3.4
3.6
2.6
3.2
2.1
3.5
3.5
07
3.4
3.6
3.1
2.7
3.3
3.3
725
374
23
328
44
602
323
07
272
160
657
98
1259
2028
0.6262
0.6203
0.6087
0.6341
0.6591
0.6910
0.6718
0.2857
0.7243
0.6562
0.7260
0.7245
0.7093
0.6785
0.8056
0.7858
0.8831
0.8165
0.8333
0.7207
0.7080
0.4444
0.7449
0.5217
0.8307
0.8373
0.7883
0.7971
0.82
0.94
0.97
0.92
0.72
0.75
0.99
0.86
0.72
0.63
0.58
Note: CI, consistency index; RI, retention index; Ts:tv, transition/transversion ratio. cp DNA (trnL-F + rpoB-trnC), and cpDNA
and nrDNA (trnL-F + rpoB-trnC + ITS).
65
FIGURES
30
8
16
35
53
3
87
39
100
11
21
3
30
10
100
13
11
10
43
83
17
68
5
68
7
7
98
0
64
1
100
9
82
0
7
0
85
0
6
1
100
0
9
17
7
100
63
96
0
0
14
75
100
6
99
3
2
0
100
2
30
1
100
11
2
24
5
100
58
6
53
2
1
99
2
100
10
7
0
100
19
13
25
92
29
52
Pre oligantha RJ
D
Pre lancifolia
Pre ostenii
Pre plantaginea
plan tagin ifoli a
Pre plan
plantaginea
tagin ifoliSP
a SP
plan tagin ifoliRJ
a RJ
Pre plantaginea
C
Pre spiranthophylla R
Pre spiranthophylla K
mucugensis
Pre guineensis
Pre phleoides
Pre leptostachya M
B
Pre leptostachya L
Pre montana MG Type
Pre montana ES
Pre stachyodes BA
Pre stachyodes EC
Pre stachyodes ES PQ
A
Pre stachyodes ES GR
Pre stachyodes SP GR
0
6
100
Pre oligantha GO
Pre stachyodes CR
6
100
37
Pon racemosa
Pre stachyodes RJ
2
6
11
Cra engelii
Pre spiranthophylla S
5
2
17
Gal tubulosum
tagin ifoliES
a ES
Pre plan
plantaginea
1
1
99
Gal thysanochilum
Pre oligantha BA
6
4
21
Ste ecuadorana
Pre densiflora
2
1
87
Alt fimbriata
Pte habenarioides
7
0
Por pilifera
Gom caucana
14
19
Aa colombiana
Pre stachyodes MEX
Pre stachyodes MEX2
Cyc epiphyticum
Sar acaulis
Dic cinnabarinus
Gal sarcoglossa
Figure 1. One of the trees obtained in a maximum parsimony analysis of nuclear data
(ITS), (one of the 144 most parsimonious trees: length = 725 steps, CI = 0.63 and RI
= 0.81; characters optimized on the combined tree). The numbers above branches
are branch lengths; nodes with bootstrap values > 50% are indicated in bold below
branch. An arrow indicates where it collapses in the strict consensus.
66
25
Gal sarcoglossa
31
19
Dic cinnabarinus
30
100
14
9
100
23
7
75
30
93
7
11
79
11
31
2
15
10
11
32
78
18
11
23
15
1
100
9
10
18
52
9
100
10
16
6
17
99
56
4
11
8
99
100
0
0
0
5
9
55
0
0
1
6
69
Pon racemosa
Pre montana MG Type
A
Pre montana ES
Gal thysanochilum
Gal tubulosum
mucugensis
Pre guineensis
Pre phleoides
B
Pre oligantha GO
Pre oligantha BA
Pre ostenii
2
8
100
Cra engelii
Pre densiflora
7
4
Gom caucana
Pre oligantha RJ
0
4
4
Alt fimbriata
Pre oligantha MG
0
100
Por pilifera
Pre stachyodes MEX
3
100
Aa colombiana
Pte habenarioides
25
97
Sar acaulis
Ste ecuadorana
34
7
Cyc epiphyticum
tagin ifoliaSP
SP
Pre plan
plantaginea
0
0
tagin ifoliaES
ES
Pre plan
plantaginea
7
Pre
tagin ifoli a
Pre plan
plantaginea
0
plan tagin ifoliaRJ
RJ
Pre plantaginea
0
Figure 2. One of the trees from maximum parsimony analysis of plastid data (trnL-F),
(one of the 1.014 most parsimonious trees: length = 602 steps, CI = 0.70 and RI =
0.72; characters optimized on the combined tree). The numbers above branches are
branch lengths; nodes with bootstrap values > 50% are indicated in bold below
67
29
12
20
3
13
5
95
15
14
20
18
10
14
18
100
30
99
4
4
2
14
1
96
4
67
2
0
81
0
0
95
90
0
0
4
3
0
0
10
0
8
4
0
100
92
0
0
14
5
100
99
0
0
2
3
75
5
98
6
5
100
3
95
4
97
2
0
100
0
0
100
9
2
0
0
27
3
5
92
7
1
100
8
5
98
100
0
1
0
2
0
0
0
0
5
14
95
21
100
35
27
28
22
12
15
Aa colombiana
Gom caucana
Alt fimbriata
Ste ecuadorana
Por pilifera
Cyc epiphyticum
Sar acaulis
Dic cinnabarinus
Pre densiflora
Pre lancifolia
Pre ostenii
Pre oligantha GO
Pre oligantha BA
Pre oligantha MG
Pre oligantha RJ
Pre
tagin ifolia
Pre plan
plantaginea
tagin ifoliaSP
SP
Pre plan
plantaginea
tagin ifoliaES
ES
Pre plan
plantaginea
tagin ifoliaRJ
RJ
Pre plan
plantaginea
mucugensis
Pre guineensis
Pre phleoides
Pre leptostachya M
Pre leptostachya L
Pre montana MG Type
Pre montana ES
Pre stachyodes BA
Pre stachyodes MG
Pre stachyodes EC
Pre stachyodes Pan
Pre stachyodes
Pre stachyodes
Pre stachyodes
Pre stachyodes
Pre stachyodes
Cra engelii
Pon racemosa
D
B
A
ES PQ
ES GR
MEX
MEX2
SP GR
Gal thysanochilum
Gal tubulosum
Gal sarcoglossa
Pte habenarioides
Figure 3. One of the trees from maximum parsimony analysis of plastid data (rpoBtrnC), (one of the six most parsimonious trees: length = 657 steps, CI = 0.72 and RI =
0.83; characters optimized on the combined tree). The numbers above branches are
branch lengths; nodes with bootstrap values > 50% are indicated in bold below
68
117
95
71
69
39
100
100
53
60
47
23
69
100
32
93
89
13
100
50
100
35
103
15
75
99
92
27
19
56
100
17
60
92
100
31
4
76
5
100
45
62
9
100
75
2
1
0
93
2
76
52
0
17
8
39
3
0
0
83
100
12
100
8
4
2
15
99
34
95
4
100
66
8
9
6
24
22
3
4
37
89
100
13
3
100
18
7
44
13
100
22
12
16
83
86
9
97
14
4
9
91
98
18
87
96
2
1
0
5
25
16
87
0
1
100
2
0
24
100
2
1
69
0
7
1
Gal sarcoglossa
Dic cinnabarinus
Cyc epiphyticum
Sar acaulis
Pte habenarioides
Cra engelii
Pon racemosa
Ste ecuadorana
Alt fimbriata
Gom caucana
Aa colombiana
Por pilifera
Gal thysanochilum
Gal tubulosum
Pre montana MG Type
Pre montana ES
Pre stachyodes RJ
Pre stachyodes BA
Pre stachyodes MG
Pre stachyodes EC
Pre stachyodes Pan
Pre stachyodes MEX
Pre stachyodes MEX2
Pre stachyodes CR
mucugensis
Pre guineensis
Pre phleoides
Pre leptostachya M
Pre leptostachya L
Pre densiflora
Pre lancifolia
Pre ostenii
Pre oligantha MG
Pre oligantha BA
Pre oligantha GO
Pre oligantha RJ
tagin ifoli aES
ES
Pre plan
plantaginea
plan
tagin
ifoli
a
SP
Pre plantaginea SP
Pre
tagin ifoli a
Pre plan
plantaginea
plan tagin ifoli RJ
a RJ
Pre plantaginea
A
B
D
C
Figure 4. One of the trees resulting from a combined parsimony analysis of nuclear
(ITS) and plastid data (trnL-F and rpoB-trnC) (one of the 12 most parsimonious trees
of the combined analysis: length = 2028 steps, CI = 0.68 and RI = 0.80) The numbers
above branches are branch lengths; nodes with bootstrap values > 50% are indicated
in bold below branch. An arrow indicates where it collapses in the strict consensus.
69
Majority rule
100
100
Aa colombiana
Por pilifera
96
Gom caucana
100
Alt fimbriata
100
100
Ste ecuadorana
Cra engelii
Pon racemosa
Pte habenarioides
92
Gal thysanochilum
100
Gal tubulosum
Pre densiflora
100
100
97
Pre lancifolia
Pre ostenii
100
90
100
100
Pre oligantha GO
Pre oligantha RJ
D
Pre oligantha BA
Pre oligantha MG
Pre plantaginea
plan tagin ifoli a
100
100
93
100
plan tagin ifoliSP
a SP
Pre plantaginea
tagin ifoliRJ
a RJ
Pre plan
plantaginea
plan tagin ifoliES
a ES
Pre plantaginea
100
100
C
100
52
69
Pre guineensis
mucugensis
Pre phleoides
100
100
100
Pre leptostachya M
B
Pre leptostachya L
Pre montana MG Type
100
Pre montana ES
100
Pre stachyodes BA
Pre stachyodes MG
100
Pre stachyodes EC
80
100
98
Pre stachyodes Pan
Pre stachyodes RJ
100
100
78
A
91
Pre stachyodes CR
100
Pre stachyodes MEX
Pre stachyodes MEX2
100
100
100
Cyc epiphyticum
Sar acaulis
Dic cinnabarinus
Gal sarcoglossa
Figure 5. Majority-rule consensus of 1.000 trees obtained in the Bayesian analysis
with the algorithm Markov chain Monte Carlo in a combined analysis of three DNA
regions. Numbers above branches are posterior probabilities for clades estimated by
the proportion of occurrence in the tree set.
70
APPENDIX 1. Taxa studied, voucher information and GenBank accession numbers.
Taxon
Cranichidinae s.s.
Cranichis engelii Rchb. f.
Ponthieva racemosa (Walter) C. Mohr
Pterichis habenarioides (F. Lehm. & Kraenzl.) Schltr.
Galeottiellinae
Galeottiella sarcoglossa (A. Rich. & Galeotti) Schltr.
Prescottiinae s.s.
Aa colombiana Schltr.
Altensteinia fimbriata Kunth
Galeoglossum tubulosum
Galeoglossum thysanochilum
Gomphichis caucana Schltr.
Porphyrostachys pilifera (Kunth) Rchb. f.
Prescottia densiflora (Brongn.) Lindl.
Prescottia lancifolia Lindl.
Prescottia leptostachya Lindl.
Prescottia montana Barb. Rodr.
Prescottia mucugensis C.O. Azevedo & Van den Berg
Prescottia oligantha (Sw.) Lindl.
Prescottia ostenii Pabst
Prescottia phleoides Lindl.
Prescottia plantaginifolia Lindl. ex Hook.
Prescottia spiranthophylla Barb. Rodr.
GenBank accessions
trnL-F
rpoB
Voucher
ITS
Ecuador, Schott s.n. (K spirit)
Mexico, Salazar 6049 (MEXU)
Colombia, Aldana 12 (COL)
AM419779
AJ539508
AJ539509
AM412721
AJ544490
AJ544491
submited
submited
submited
Mexico, Jimenez 2334 (AMO)
AJ539518
AJ544500
submited
Colombia, Aldana 2 (MEXU spirit)
Ecuador, Salazar 6789 (MEXU photo)
Mexico: Oaxaca, Salazar 6054 (MEXU)
Mexico: Oaxaca, Tenorio 17900 (MEXU)
Colombia, Diaz 159 (COL)
Peru, Whalley s.n. (K-photo)
Brazil: Goiás, C. van den Berg 1417 (HUEFS)
Brazil: Rio de Janeiro, Bocayuva 198 (HUEFS)
Brazil: Bahia, Mucugê, Azevedo 201 (HUEFS)
Brazil: Bahia, Lençóis, Azevedo 250 (HUEFS)
Brazil: Espírito Santo, Azevedo 287 (HUEFS)
Brazil: Minas Gerais, Azevedo 324 (HUEFS)
Brazil: Bahia, Azevedo 253 (HUEFS)
Brazil: Goias, Azevedo 202 (HUEFS)
Brazil: Rio de Janeiro, Azevedo 268 (HUEFS)
Brazil: Rio Grande do Sul, Singer 2006/21 (ICN)
Brazil: Bahia, van den Berg 1018 (HUEFS)
Brazil: São Paulo, Azevedo 263 (HUEFS)
Brazil: Rio de Janeiro, Saddii s.n. (RB)
Brazil: Espírito Santo, Azevedo 289 (HUEFS)
Brazil, van den Berg (HUEFS)
AM419766
AM419765
AJ539510
AM419775
AM419770
AJ539514
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
AM412731
AM412737
AJ544492
AM412725
AM412736
AM544496
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
71
APPENDIX 1: Continued
Taxon
Prescottia stachyodes (Sw.) Lindl.
Stenoptera ecuadorana Dodson & C. Vargas
Spiranthinae
Cyclopogon epiphyticum (Dodson) Dodson
Dichromanthus cinnabarinus (La Llave & Lex.) Garay
Sarcoglottis acaulis (J.E.Sm.) Schltr.
Voucher
ITS
Brazil, Salazar 6350 (K spirit)
Brazil: Espírito Santo (GR), Azevedo 277 (HUEFS)
Brazil: Espírito Santo (PQ), Azevedo 277.1 (HUEFS)
Brazil: São Paulo (GR) van den Berg s.n. (HUEFS)
Costa Rica, Azevedo s.n. (HUEFS)
Mexico: Guerrero (MEX2), Salazar 7312 (MEXU)
Mexico: Veracruz (MEX), Salazar 6092 (MEXU)
Ecuador: Ecuagenera (EC)
Ecuador: Pangui (Pan), Salazar s.n.
Ecuador, Salazar 6357 (K-spirit)
GenBank accessions
trnL-F
rpoB
AJ539511
AJ544493
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
submited
AM419774
submited
AM419773 AM412735
submited
submited
submited
submited
AJ539512
AJ544494
submited
Ecuador, Salazar 6355 (K)
Mexico, Linares 4469 (MEXU)
Trinidad, Salazar 6356 (K-spirit)
AJ539499
AJ539486
AJ539500
AJ544482
AJ544469
AJ544483
submited
submited
submited
72
Capítulo 2
Novidades taxonômicas em Prescottia Lindl. (Orchidaceae - Orchidoideae)
73
Azevedo, C.O.; Van den Berg, C. 2005. (1705-1706) Proposals to conserve the
name Prescottia with that spelling and P. plantaginea against P. plantaginifolia
(Orchidaceae). Taxon 54(4): 1105-1106.
54 (4) • November 2005: 1105–1106
Azevedo & van den Berg • (1705-1706) Conserve Prescottia
74
(1705-1706) Proposals to conserve the name Prescottia with that spelling and
P. plantaginea against P. plantaginifolia (Orchidaceae)
Cecília Azevedo1 & Cássio van den Berg2
1 Pós-Graduação
em Botânica, Departamento de Ciências Biológicas, Universidade Estadual de Feira de
Santana, Rodovia BR 116, km 03, Feira de Santana, BA, 44031-460, Brazil. [email protected]
2 Departamento de Ciências Biológicas, Laboratório de Sistemática Molecular de Plantas, Universidade
Estadual de Feira de Santana, Rodovia BR 116, km 03, Feira de Santana, BA, 44031-460, Brazil.
(1705) Prescottia Lindl. in Hooker, Exot. Fl. 2: ad t. 115.
Aug 1824 (‘Prescotia’) [Orchid.], nom. & orth.
cons. prop.
Typus: P. plantaginea Hook.
When Hooker first published this generic name and
description by Lindley in 1824, it was spelled Prescotia and
said to be named after “John Prescot”. Later (in Bot. Reg.
22: t. 1916. 1836 & Gen. Sp. Orchid. Pl.: 453. 1840),
Lindley changed it to Prescottia, with the knowledge that
“John Prescott” (Lindley, l.c., 1836) spelled his name
accordingly. Since then, some authors have used the original spelling, e.g., Steudel (Nomencl. Bot. ed. 2, 2: 393.
1841), Vöth (in Orchidee (Hamburg) 27: 148–153. 1976),
Farr & al. (in Regnum Veg. 102: 1409. 1979), and
Ackerman (in Lindleyana 4(1): 42–47. 1989), while others
have adopted the corrected spelling, e.g., Cogniaux (in
Martius, Fl. Bras. 3(4): 256. 1895), Hoehne (Fl. Bras. 12(2):
95. 1945), Pabst & Dungs (Orchidaceae Brasil. 1: 123.
1975), Brummitt (Vasc. Pl. Fam. Gen.: 349. 1992), Dressler
(Phylog. Classif. Orch. Fam.: 120, 268. 1993), Greuter & al.
(in Regnum Veg. 129: 919. 1993), and Ackerman (in Mem.
New York Bot Gard. 73: 142. 1995 & in Pridgeon & al.,
Gen. Orchid. 3: 47. 2003). Current usage, as reflected in the
results (729 hits to 127) of a Google search, favors the
spelling Prescottia. The genus includes 24 species extending from Florida (U.S.A.) through the West Indies to northeastern Argentina with the greatest diversity in Brazil. To
avoid any further disagreement over the spelling of the
generic name, it seems desirable to conserve it as proposed
above.
(1706) Prescottia plantaginea Hook., Exot. Fl. 2: ad t.
115. Aug 1824 [Monocot.: Orchid.], nom. cons.
prop.
Lectotypus (hic designatus): cultivated 1824 in
Glasgow, Scotland; origin from Brazil, Rio de
Janeiro, autumn of 1822, Forbes s.n. (K!).
(≡)
Prescottia plantaginifolia Lindl. ex Hook.,
Exot. Fl. 2: ad t. 115. Aug 1824, nom. rej. prop.
Prescottia plantaginea is an herbaceous plant commonly found in shady sites in wet forests throughout the
Brazilian Atlantic Forest. For the epithet of the only original species of this genus Hooker used the spelling “plantaginifolia”, which he ascribed to Lindley, in the heading, in
the text, and at the head of the caption for the illustration,
but on the plate itself (and on Hooker’s type) the name
appeared as “plantaginea”, without ascription. These two
spellings at first glance may appear to be orthographic variants (Art. 61.2; Greuter & al. in Regnum Veg. 138. 2000) of
one name, but they are more properly viewed as two etymologically different names of equivalent priority based on
the same type, i.e., alternative names (Art. 34.2). In this situation, Art. 11.5 determines the name that has priority is
that which the first subsequent author adopted while simultaneously rejecting the other (see Art. 11, Note 2). After
Hooker’s 1824 publication, the name P. plantaginifolia was
adopted in Loddiges (Bot. Cab. 10: t. 990. 1825) and
Sprengel (Syst. Veg. 3:706. 1826) but without mention of
the alternative name. Lindley later (l.c., 1836, 1840) used P.
plantaginea, but again without explicitly rejecting the alternative name. Steudel (l.c.) appears to have been the first to
make an effective choice under Art. 11.5, by adopting P.
plantaginifolia while listing P. plantaginea as a synonym,
thereby establishing that P. plantaginifolia has priority.
Some authors, e.g., Vöth (l.c.), Farr & al. (l.c.), Ackerman
(l.c., 1995, 2003), and Greuter & al. (l.c.) have adopted this
name, while others, e.g., Cogniaux (l.c.), Hoehne (l.c.), and
Pabst & Dungs (l.c.), have used the name P. plantaginea
later preferred by Lindley. Current usage favors P. plantaginea, as the results (39 hits to 2) of a Google search on
both names indicate, but to preserve this name requires conservation.
In the protologue, Hooker clearly indicated which portions were provided by Lindley. The Latin generic diagnosis ascribed to Lindley would be sufficient, under Art. 42, to
validate both his generic and specific names, since the
genus was originally monotypic. However, Hooker provided a separate validating description in English following his
citation of “Prescotia plantaginifolia, Lindl. Hist. Orchid.
ined.”, so Art. 46.4 would imply that he is the author of this
name as well as the competing P. plantaginea, which cannot
be associated with Lindley. Hooker’s description was based
on a plant cultivated in the Glasgow Botanic Garden,
received from the Horticultural Society of London (where
Lindley was then employed as a garden clerk), whose material had in turn originated with an 1822 collection by John
Forbes from “Rio Janeiro”. The original collection is represented by a (cultivated?) specimen of this taxon citing
Forbes (but dated 1824) in the Lindley Herbarium at K, and
another cultivated specimen (also dated 1824) from the
Herbarium Hookerianum now exists in the general herbarium at K. Both of these elements, having been mentioned by
Hooker, can be taken as syntypes, since they are probably
1105
Dressler & Folsom • (1707) Reject Cymbidium muricatum
54 (4) • November 2005: 1106–1107
75
not parts of the same gathering. The latter, more directly
associated with Hooker, labelled “Prescotia plantaginea” in
his handwriting, and more closely resembling the published
plate is here designated as lectotype.
Acknowledgements
We thank Dr. R. K. Brummitt and Dr. W. Greuter for help
with nomenclatural issues and advice in the preparation of these
proposals. This work was carried out as part of the work for a PhD
in Botany of C.O.Azevedo at Programa de Pós-Graduação em
Botânica, Universidade Estadual de Feira de Santana - UEFS
(1707) Proposal to reject the name Cymbidium muricatum (Orchidaceae)
Robert L. Dressler1 & James P. Folsom2
1 Jardín Botánico Lankester, Universidad de Costa Rica, P.O.Box 1031-7050, Cartago, Costa
2 Huntington Botanical Gardens, 1151 Oxford Road, San Marino, California 92208, U.S.A.
(1707) Cymbidium muricatum Sw. in Nova Acta Regiae
Soc. Sci. Upsal. 6: 71. 1799 [Monocot.: Orchid.],
nom. utique rej. prop.
Lectotypus (hic designatus): Swartz s.n. (W [RchbOrch] No. 25291).
When Swartz first published Cymbidium muricatum
from Jamaica, the description (in Nova Acta Regiae Soc.
Sci. Upsal. 6: 76. 1799) was brief, though “suberect” with
“muricate capsule” point to the species later described as
Dichaea morrisii Fawc. & Rendle (in J. Bot. 48: 107. 1910);
he also cited his then-unpublished treatment for Flora
Indiae occidentalis. In 1806 he again described the plant
(Fl. Ind. Occid. 3: 1454. 1806) in more detail as with leaves
1.5 inches long, and stressed that the plant was more erect,
much wider and had larger flowers and fruits with shorter
pedicels (“sessile”) than Epidendrum echinocarpon Sw.
(Prodr.: 124. 1788) [= D. pendula (Aubl.) Cogn.]. This
expanded description fits only the later D. morrisii Fawc. &
Rendle., but there has been much confusion as to the application of Swartz’s name.
Dichaea muricata (Sw.) Lindl. was interpreted as the
correct name for D. latifolia Lindl. by Cogniaux (in Martius,
Fl. Bras. 3(6): 487, 488. 1906 and in Urban, Symb. Antill. 6:
671. 1910) and Garay & Sweet (in Howard, Fl. Lesser
Antill., Orchidaceae: 219. 1974). Indeed, this name has been
used rather consistently in this sense in the West Indies, until
Ackerman (in Mem. New York Bot. Gard. 73: 41. 1995)
treated D. latifolia as distinct from D. muricata. Then Nir
(Orch. Antill.: 88. 2000) argued that the descriptions could
apply only to the species later named D. morrisii.
On the mainland, in contrast, floristic workers have
used the name for any medium-sized member of Dichaea
subgen. Dichaea with wide, thin leaves, including D.
costaricensis Schltr., D. cryptarrhena Rchb. f. ex Kraenzl.,
D. laxa (Ruiz & Pav.) Poepp. & Endl., D. histrio Rchb. f.,
D. poicillantha Schltr., and D. splitgerberi Rchb. f., among
others (Allen in Ann. Missouri Bot. Gard. (Fl. Panama) 36:
239. 1949; Ames in Publ. Field Mus. Nat. Hist., Bot. Ser.
(Fl. Costa Rica) 18: 212. 1937; Ames & Correll in
Fieldiana, Bot. 26(2): 702, 703. 1953; Foldats, Fl. Venez.
1106
Rica.
25(5): 460. 1970; Schweinfurth in Fieldiana, Bot. 30(4):
968. 1961; Williams in Ceiba 5: 249. 1956, among others).
This misuse has been so persistent that when Hamer and
Garay (Orq. Salvador 1: 143. 1974) recognized that
Dichaea tuerckheimii Kraenzl., 1923 (non Schltr., 1916)
was a distinct species, they renamed it as D. muricatoides,
an allusion to a supposed resemblance to the chimaeric D.
muricata (note that the leaves of D. muricatoides were characterized as being “much bigger than those of D. muricata”). Even a species as distinct as D. neglecta Schltr. is one
of several that have been treated as varieties of D. muricata, and herbarium identifications as D. muricata may be
found on almost any species of Dichaea subgen. Dichaea.
The name Dichaea muricata clearly has been “persistently used for a taxon or taxa not including its type” (ICBN
Art. 57.1; Greuter & al. in Regnum. Veg. 138. 2000). Garay
& Sweet (l.c.) cited “Type: Jamaica, without proper locality. Coll. Swartz s.n.! (S)”, an effective typification under
Art. 7.11 of the ICBN. Since Garay & Sweet interpreted D.
muricata as the earliest name for D. latifolia Lindl., the
specimen must have represented that species, though such a
Swartz specimen has not been found in recent years.
Dichaea latifolia, like D. pendula, is laxly pendent, rather
than suberect, and has narrower stems, smaller leaves and
smaller, long-pedicellate flowers and fruits, and is thus in
conflict with the protologue. As already mentioned,
Swartz’s characterization of Cymbidium muricatum fits the
species later described as Dichaea morrisii and discussed
by Schweinfurth (in Bot. Mus. Leafl. 6: 8–9. 1938). The
specimen at S cannot therefore have been part of Swartz’s
original material for Cymbidium muricatum; thus this specimen, if it exists, could only be regarded as a neotype.
Nir (l.c.) later stated, after referencing Folsom’s unpublished 1987 thesis on Dichaea in his introductory comments
to the genus: “As pointed out by Folsom, the only extant
Swartzian type specimen of D. muricata (C)”. But he then
proceeded (l.c.: 91), under his treatment of D. muricata, to
only list two supposed unseen Swartz syntypes at S and BM
under the heading of “Type”. There is indeed a very small,
sterile specimen at C labelled “missit Swartz, Herbarium
Vahlianum” and “Cymbidium muricatum”, but Nir’s action
76
Azevedo, C.O.; Van den Berg, C. 2007. Lectotypifications in Prescottia (Orchidaceae Orchidoideae). Kew Bulletin. 62: 651-655.
77
651
KEW BULLETIN 62: 651– 655 (2007)
Lectotypifications in Prescottia (Orchidaceae -Orchidoideae)
Cecília Azevedo1,3 & Cássio van den Berg2
Summary. Typifications of 11 species names are presented as a result of work on a taxonomic revision of the
genus Prescottia Lindl.
Key words. Orchidaceae, Prescottia, lectotypification.
Introduction
Prescottia Lindl. includes 24 species (Ackerman 2003),
of which 17 occur in Brazil (Pabst & Dungs 1975).
These species generally occur between 500 to 1,500
m altitude and are distributed from Florida to
northwestern Argentina. They are usually found in
very small populations mainly in humid forests. The
genus has rather variable morphology and several
species are difficult to delimit, which has resulted in
many synonyms. Consequently, from the 70 species
originally described, only 24 are currently accepted.
In ongoing studies for a monograph of Prescottia, type
materials of most names published in the genus have
been studied. Lectotypes are designated here for 11
of these names.
by the author of the species, e.g., notes in their own
handwriting, as well as those deposited in herbaria at
which the species’ authors worked.
In each species lectotypification, we give as
‘protologue’ the exact text provided by the author at
the original description and, after the designed
lectotype, the information obtained from the
specimen label.
Lectotypifications
1. Cranichis oligantha Sw. (1788: 120). Protologue:
‘Jamaica’, without collector or date. Lectotype
(chosen here): Jamaica (mont. Caerul.), Swartz s.n.
(BM!).
= Prescottia oligantha (Sw.) Lindl. (1840a: 454).
Material and methods
The protologues of all published names were
examined, and original material was sought and
studied in the following herbaria: ALCB*, B, BAH,
BHCB, BM*, CAY, CEN, CEPEC*, CESJ, CGMS, CM,
COR, CR*, CTES, CVRD, EAC, ESA, ESAL, G, GH,
GUA, HAS, HASU, HB*, HEPH, HMS, HRB*, HRCB,
HUA, HUFU, HUEFS*, HURG, HXBH, IAC, ICN,
INPA, IPA, JPB, K*, K–L*, M*, MAC, MBM*, MBML*,
MG, MVFA, MVM, NY, P*, PACA, PAMG, PEL, PEUFR,
PMSP, R*, RB*, RBR, RUSU, S, SJRP, SMDB, SP, SPF,
TEPB, UB, UEC, UFMT, USJ*, VIC and W* (acronyms
according to Holmgren et al. 1990). Specimens were
studied by visiting some of the herbaria (indicated with
*) or otherwise as loans to HUEFS and K.
For the designation of the lectotypes, we considered
specimens bearing clear indications of first-hand study
Cranichis oligantha was described by Swartz without
information about the specimen examined. As
Swartz’s West Indian collections at S are not complete
and as Swartz was very liberal with his specimens,
Swartz types can be found, for instance, at BM
(Stafleu & Cowan 1986).
Fawcett & Rendle (1910), Garay & Sweet (1979)
and McLeish et al. (1995) determined that the type of
Cranichis oligantha is at BM. However, Garay (1978)
indicated that the type is at S, demonstrating the
current confusion about the type. Although Garay
(1978) cited the specimen at S as type, he wrote:
“Type: Jamaica, Blue Mountains, Swartz s.n.! (S)”, the
specimen at S does not bear this information. We
found only one specimen at S that is very similar to
the unpublished drawings of West Indian Plants by
Accepted for publication July 2007.
1
Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade Estadual de Feira de Santana, Rodovia BR 116, km 03, Feira de Santana,
BA, 44031-460, Brazil.
2
Departamento de Ciências Biológicas, Laboratório de Sistemática Molecular de Plantas, Universidade Estadual de Feira de Santana, Rodovia BR 116, km
03, Feira de Santana, BA, 44031-460, Brazil.
3
Author for correspondence: e-mail [email protected]
© The Board of Trustees of the Royal Botanic Gardens, Kew, 2007
78
652
Olof Swartz in the library of the Royal Swedish
Academy of Sciences, Stockholm, but without
collector’s name or location. Despite the similarities,
there is no clear link between this material and the
protologue information. On the other hand, there is
a specimen at BM annotated, on the back of the
sheet, in handwriting: “Jamaica (mont. Caerul.) Sz.”.
This agrees in part with the protologue and especially
with the later citation of Swartz (1806): “C. oligantha –
in montibus summis Jamaicae (cum duabus
sequentibus hanc legi in adscensu montium
caeruleorum)”. Stearn (1980) explains that the
herbarium specimens from West India were in Sir
Joseph Banks’ herbarium, now in the British Museum
(BM). For these reasons, we choose the BM specimen
as the lectotype of C. oligantha.
2. Cranichis stachyodes Sw. (1788: 120). Protologue:
“Jamaica” without collector or date. Lectotype
(chosen here): Jamaica (Blue Mountains), Swartz s.n.
(BM!).
= Prescottia stachyodes (Sw.) Lindl. (1836: 1916).
Cranichis stachyodes was described without information
on the specimen examined. There is a specimen at S
without collector’s name or location, and without any
clear links to the protologue information. At BM,
however, there is a specimen annotated on the back
in handwriting: “Jamaica (Blue Mount.) Swartz”.
Fawcett & Rendle (1910), Garay & Sweet (1979),
Garay (1978) and McLeish et al. (1995) cited that the
type of Cranichis stachyodes is at BM, although, Serna
& Ferrari (1998) cited that it is at S and Nir (2000)
cited that it at S and BM. To avoid more confusion
about the type, the BM specimen is selected here as
the lectotype of C. stachyodes, as this is the only
specimen that can be undoubtedly attributed to
Swartz and to the type location.
3. Decaisnea densiflora Brongn. (1829: 39). Protologue:
“L’ile Sainte-Catherine au Brésil”, without collector
or date. Lectotype (chosen here): Brazil: Santa
Catarina, A. Brongniart s.n. (K-L!; isolectotype P!).
= Prescottia densiflora (Brongn.) Lindl. (1840b: 52).
In the protologue there is no information about the
provenance of the type. We found two specimens of
Decaisnea densiflora, one at P, where most of
Brongniart’s specimens are deposited, and another at
K-L. They are both annotated with the same
information as that given in the protologue. The
specimen at K-L is the specimen drawn for the
original publication and has a copy of the drawing
added to it. When Lindley (1840b) transferred D.
densiflora to Prescottia densiflora, he said: “I possess an
KEW BULLETIN VOL. 62(4)
excellent specimen of D. densiflora, through the
liberality of M. Ad. Brongniart”. It seems clear not
only that Brongniart gave this specimen to Lindley,
probably after describing D. densiflora but that this
material was clearly the one used to describe the
species. Because the specimen given to Lindley is the
specimen illustrated, the K-L specimen is here
designated as the lectotype of D. densiflora, whereas
the other material is considered an isolectotype.
4. Prescottia glazioviana Cogn. (1895: 261). Protologue:
“Habitat ad cacumen mont. Itatiaia in Campo de
Silverio prov. Rio de Janeiro: Glaziou n. 6729 in herb.
Berol. non alior; ad Serra dos Órgãos: Gardner 5884 in
herb. Berol. et Kew.” Lectotype (chosen here): Brazil:
Rio de Janeiro, Summit of Órgãos Mountains, Gardner
5884, March 1841 (K-L!; isolectotype K! (Herb.
Benthamianum); K! (Herb. Hookerianum); BM!; R!).
Prescottia glazioviana was described on the basis of two
syntypes, Glaziou 6729 and Gardner 5884. The first,
Glaziou 6729, cited by Cogniaux as being only at B, was
not found, and was probably destroyed during the
World War II. The second was cited to be at Berlin
and Kew. Actually, we found six specimens of Gardner
5884, three of them at K, of which was one stamped
“Herbarium Hookerianum 1867” (1867 being the
year that Kew bought Hooker’s herbarium) and the
other “Herbarium Benthamianum 1854” (1854 being
the year that George Bentham donated his herbarium
to Kew). This means that these two collections had
been kept at Kew for about 30 years before Cogniaux’s
description. The third Kew specimen is in Lindley’s
herbarium. There is one specimen at BM and one at
R, both bearing similar handwritten labels. The final
specimen is at G, and has a different date (July 1842).
This specimen has phototype at NY. Because the
information about the date does not agree with the
other specimens, we prefer not to consider the G
specimen as an isolectotype. Cogniaux cited that the
specimens were at Berlin and Kew, but the Gardner
material at Berlin (B) was also destroyed during the
war. Cogniaux could have examined any of the three
specimens at Kew, but none of them was determined
by him or has his handwritten notes. Because all the
materials deposited at Kew are equivalent in
annotations, we chose the well-preserved material at
K-L as lectotype of P. glazioviana, leaving the
remaining duplicates at K, BM and R as isolectotypes.
5. Prescottia lancifolia Lindl. (1840a: 453). Protologue:
“in Brazilia, Gardner 681; prope Ilha Grande inter
humum, Descourtilz (hab. s. sp.).” Lectotype (chosen
here): Brazil: Gardner 681 (K-L!; isolectotype BM!; G!;
K!; NY!; P!; W!).
79
LECTOTYPIFICATIONS IN PRESCOTTIA (ORCHIDACEAE-ORCHIDOIDEAE)
Lindley cited two syntypes in the protologue of
Prescottia lancifolia, Gardner 681 and Descourtilz s.n. We
found seven specimens annotated as Gardner 681,
which have different labels and different dates. The
most curious among them is the material at Kew, in
which Gardner says that it was a new species: “681.
Prescotia parviflora Gard. Mss. This I believe to be an
undescribed species of Prescotia. It grew upon the
moss covered stump of an old tree in a shady place —
Flowers white — May 1837 G. Gardner” (handwriting).
It is stamped “Herbarium Hookerianum 1867”. The
BM material bears the same year, but a different
month, and is annotated as follows: “681. On the
stems of old trees, Órgão Mountains, April 1837
Prescottia lancifolia Lindl.” (handwriting). The material
at Lindley herbarium has no date, and is annotated as:
“Rio de Janeiro — Gardner” (typewritten) “no. 681,
Prescottia lancifolia” (handwriting). This material
includes a drawing of the lip made by Lindley. The G,
NY and W specimens have a different years from the
BM and K material. The G material is annotated:
“Bresil — Organ mountains. (Serra dos Órgãos) M.
Gardner. (Recu en 1838)” (typewritten) “no. 681”
(handwriting), and was latter determined as Prescottia
lancifolia by A. Cogniaux. The NY material is
annotated: “In Brasilia ad montes “Serra dos Órgãos”
legit Gardner! no. 681, 1838” (handwriting). The W
material is annotated as: “Orchidea, Brasilia, Gardner
no. 681, III/1838” (all handwritten). There are
phototypes at NY of the BM and G specimens.
Descourtilz’s syntype was not found, and so the
syntype Gardner 681 housed in Lindley’s herbarium
(K-L) is chosen here as lectotype.
6. Prescottia ostenii Pabst (1979: 19). Protologue:
“Uruguay, Dep. Canelones, La Floresta, in uliginosis
dunarum, greg. Cop., C. Osten 22939, 23 Oct. 1933”.
Holotypus HB 1233 omitted at original description.
Lectotype (chosen here): Uruguai: Canelones, La
Floresta, C. Osten 22939 (S!; isolectotype MVFA!,
MVM!).
Prescottia ostenii was first described in Pabst (1979),
but a holotype was not explicitly designated as such
by the author. In a latter note, Pabst (1980) cited:
“holotypus HB 1233, omitted at original description”,
which corresponds to: Uruguay, Dep. Canelones, La
Floresta, C. Osten 16918, 30 Sep. 1923. This is a
different specimen from that cited in 1979. Article
37.3. of the International Code of Botanical
Nomenclature (Greuter et al. 2000) states that for the
name of a new species, mention of a single specimen
or gathering or illustration, even if that element is
not explicitly designated as type, is acceptable as
indication of the type. Only on or after 1 January
1990, as Article 37.5. says, must indication of the type
653
include one of the words ‘typus’ or ‘holotypus’. Thus,
in this case, the name was validly published in 1979,
and Osten 22939 must be accepted as the type, not
Osten 16918 (HB 1233). We found three specimens of
Osten 22939, one at S and two at GH. The materials at
GH are marked ‘Osten 22939 b’ and have no
identification label by Pabst, hence we are not
accepting them as isolectotypes. There is no
specimen of Osten 22939 in Pabst’s herbarium (HB),
but the specimen at S has Pabst’s determination label
and is here chosen as the lectotype of P. ostenii. There
are also two specimens of Osten 22939 at MVM and
another one at MVFA without Pabst’s identification,
considered here as isolectotype.
7. Prescottia smithii Schltr. (1920a: 52). Protologue:
“Magdalena: Santa Marta, 4000 ft., H. H. Smith 2277.
March.” Lectotype (chosen here): Colombia:
Magdalena: Santa Marta, above las Partidas. H. H.
Smith 2277 (NY!; isolectotypes K!, GH!; CM!)
In the protologue, there is no information about
where the type was deposited. Four specimens of
Smith 2277 were found at NY, K, GH, CM. The
material at GH is annotated by Smith as an isotype
collection on 15 June 1928, after the original
description. There is also a copy of drawings and
analyses from Schlechter’s material at GH, made
under supervision of Rudolf Schlechter. The original
material of Prescottia smithii was probably at B, but it
could not be found and was probably destroyed
during World War II, together with Schlechter’s
original specimens. The original materials of Smith
were distributed by NY, where the material is
annotated as isotype. Among the isotype, the original
material belonging to Smith and deposited at NY, is
selected as the lectotype of P. smithii.
8. Prescottia truncicola Schltr. (1920b: 319). Protologue:
“Paraná: Serra do Mar, Carvaelho, in silva primaevis,
ad truncos putridos — no. 18154, flor. Sept. 1911;
Serra do Mar, Monte Alegre, in terra silvosa, no.
10290, flor. Sept. 1910.” Lectotype (chosen here):
Brazil: Paraná, Serra do Mar, Carvalho in silv. prim.
ad trunc., 12 Sept. 1911, P. Dusen 18154 (AMES!;
isolectotype GH!).
= Prescottia lancifolia Lindl. (1840a: 453).
Schlechter cited two syntypes in the original
description of Prescottia truncicola, Dusén 18154 and
Dusén 10290. There is one specimen at Dusén’s
herbarium, which is now incorporated to MBM, with
a handwritten label bearing the information 10290
and year 1910, which agrees with the protologue.
80
654
There are two specimens of Dusén 18154 at Harvard
University Herbaria, annotated in Schlechter’s
handwriting with the same information given in the
protologue and determined by him as P. truncicola.
One is from GH without date (barcode 103629) and
has three separated plants glued to the same sheet,
and the other is from AMES, more complete, with
date (barcode 103628), and bearing a single plant.
The original material of P. truncicola was probably at B
and destroyed during World War II. There is no
evidence that Schlechter had examined the syntype at
MBM. Thus, we chose the AMES syntype as the
lectotype of P. truncicola.
Schlechter’s Prescottia
Schlechter’s original materials were at B, and most
were destroyed during World War II. Therefore, we
chose to lectotypify the names for which it was
impossible to locate syntypes or isotypes with
drawings and analyses from Schlechter’s Herbaria,
made under the supervision of Rudolf Schlechter.
9. Prescottia gracilis Schltr. (1920a: 51). Protologue:
“Antioquia: c. 2000 m., M. Madero”, without collector
number and date. Lectotype (chosen here):
Colombia: Antioquia: c. 2000 m., M. Madero 62
(drawing of type AMES!).
10. Prescottia filiformis Schltr. (1920a: 50). Protologue:
“Cauca: 1800 m., M. Madero”, without collector
Colombia, Cauca: 1800 m., M. Madero 73 (drawing of
type AMES!).
11. Prescottia longifolia Schltr. (1920a: 51). Protologue:
“Antioquia, c. 2000 m. M. Madero.” without collector
Colombia: Antioquia, c. 2000 m. M. Madero 120
(drawing of type AMES!).
Acknowledgments
The authors are grateful to the curators of the cited
herbaria and to the Trustees of the Royal Botanic
Gardens, Kew. The authors also thanks to the
Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq, Brazil, GD and PQ-ID) for the
fellowships received. Two anonymous reviewers
provided helpful comments on an earlier version of
this manuscript. This work was carried out as part of
KEW BULLETIN VOL. 62(4)
the work for a PhD in Botany by C. O. Azevedo at
Programa de Pós-Graduação em Botânica,
Universidade Estadual de Feira de Santana — UEFS.
References
Ackerman, J. D. (2003). Prescottia. In: A. M.
Pridgeon, P. J. Cribb, M. W. Chase & F. N.
Rasmussen, Genera Orchidacearum. vol. 3,
Orchidoideae (part 2): Vanilloideae, pp. 47 – 50.
Oxford University Press, Oxford.
Brongniart, A. (1829). Decaisnea densiflora Brongn.
Voy. Coq. Bot. 192 (1): 39.
Cogniaux, A. (1895). Orchidaceae. Flora Brasiliensis
3(4): 261.
Fawcett, W. & Rendel, A. B. (1910). Flora of Jamaica,
containing descriptions of the flowering plants
known from the island. Printed by order of the
Trustees of the British Museum, London.
Garay, L. A. (1978). Orchidaceae (Cypripedioideae,
Orchidoideae, Neottioideae). Flora of Ecuador. 225(1),
9: 1 – 305.
—— & Sweet, H. R. (1979). Orchidaceae. In: R. A.
Howard, F. W. Gould, T. Koyama, P. J. M. Maas, R.
W. Read. Flora of the Lesser Antilles: Leeward and
Windward Islands. Arnold Arboretum, Harvard
University, Jamaica Plain, Massachusetts.
Greuter, W., McNeill, J., Barrie, F. R., Burdet, H. M.,
Demoulin, V., Filgueiras, T. S., Nicolson, D. H., Silva,
P. C., Skog, J., Trehane, P., Turland, N. J. &
Hawksworth, D. L. (eds.). (2000). International
Code of Nomenclature (Saint Louis Code). Adopted
by the Sixteenth International Botanical Congress,
St. Louis, Missouri, July – August 1999. Koeltz
Scientific Books, Königstein [Regnum Veg. 138].
Holmgren, P. K., Holmgren, N. H. & Barnett, L. C.
(eds.) (1990). Index Herbariorum Part I: The
Herbaria of the World (Regnum Veg. 120). New
York Botanical Garden, New York.
Lindley, J. (1836). Prescóttia colórans. Bot. Reg. 22
sub t. 1916.
—— (1840a). The genera and species of orchidaceous
plants. pp. 451 – 454. Ridgways, London.
—— (1840b). A note upon the Genus Decaisnia, Ad
Brong. Ann. Mag. Nat. Hist. 1, 6 (34): 52.
McLeish, I., Pearce, N. R., Adams, B. R. with
contributions by Briggs, J. S. (1995). Native
orchids of Belize. A. A. Balkema, Rotterdam.
Nir, M. A. (2000). Orchidaceae Antillanae. DAG Media,
New York.
Pabst, G. F. J. (1979). Orchidaceae extra Brasilianae
novae vel criticae. Bradea 3(3): 19.
—— (1980). Notícias orquidológicas – XX. Bradea
3(7): 50.
—— & Dungs, F. (1975). Orchidaceae Brasilienses. vol.
1. Kurt Schmersow, Hildesheim.
81
LECTOTYPIFICATIONS IN PRESCOTTIA (ORCHIDACEAE-ORCHIDOIDEAE)
655
Schlechter, R. (1920a). Die orchideenfloren der
sudamerikanischen
kordillerenstaaten
II.
Colombia. Repert. Spec. Nov. Regni Veg. 7:50 – 52.
—— (1920b). Orchidaceenflora von Parana. Repert.
Spec. Nov. Regni Veg. 16: 319.
Serna, A. E. & Ferrari, A. R. L. (1998). Las
monocotiledoneas Mexicanas: una sinopsis
floristica: 1. lista de referencia Parte VIII:
Orchidaceae (2). Consejo Nacional de la Flora de
Mexico, Mexico City.
Stafleu, F. A. & Cowan, R. S. (1986). Taxonomic
Literature, vol. 6: Sti-Vuy. Bohn, Scheltema &
Holkema Publishers, Boston.
Stearn, W. T (1980). Swartz’s contributions to West
Indian botany. Taxon, 29 (1): 1 – 13.
Swartz, O. (1788). Nova genera e specie plantarum;
prodromus. 120.
—— (1806). Flora Indiae occidentalis. Tomus III. J.
Palmii, Erlangae.
Williams, L. O. (1939) Orchid studies, X. Bot. Mus.
Leafl. 7: 137.
82
Singer, R.B.; Azevedo, C.O.; Van den Berg, C.; Aguiar, D. (in press). Prescottia
ostenii Pabst (Orchidaceae): a new record for Brazil, with a complete morphological
description. Kew Bulletin.
83
Prescottia ostenii Pabst (Orchidaceae): a new record for Brazil, with a complete
morphological description
Rodrigo B. Singer 1 , 5, Cecília O. de Azevedo 2, Cássio van den Berg
3
and
Daniela Aguiar4
Summary. Previously known from only two specimens collected in Uruguay,
Prescottia ostenii Pabst, is herein reported for the first time in Rio Grande do Sul,
Southern Brazil. Several morphological features lacking in the original description
are described and illustrated for the first time. The taxonomic affinities of this
species are discussed, based on vegetative and floral morphology.
Key Words. Brazil, new record, Orchidaceae, Prescottia.
Introduction
Prescottia Lindl. is a Neotropical orchid genus of ca. 24 species distributed from
Florida to north-western Argentina; although particularly species-rich in Brazil
(Ackerman 2003). This genus involves both widely distributed and quite localized
taxa. The vast majority of the species are terrestrial herbs (geophytes), with a basal
rosette of leaves and a terminal, many-flowered inflorescence (spike). The flowers
are characteristically sessile, helmet-like and non-resupinate. The fruit is a capsule
1
Depto Botânica, Instituto de Biociências, Universidade Federal do Rio Grande do Sul. Av. Bento Gonçalves
9500. Bloco IV, Prédio 43432, Sala 207. Bairro Agronomia. CEP 9150-970. Porto Alegre, RS, Brazil.
2
Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade Estadual de Feira de
Santana, Rodovia BR 116, km 03, Feira de Santana, BA, 44031-460, Brazil.
3
Departamento de Ciências Biológicas, Laboratório de Sistemática Molecular de Plantas, Universidade Estadual
de Feira de Santana, Rodovia BR 116, km 03, Feira de Santana, BA, 44031-460, Brazil.
4
Graduated student at the Instituto de Biociências, Universidade Federal do Rio Grande do Sul. Av. Bento
Gonçalves 9500. Bloco IV, Prédio 43432, Sala 207. Bairro Agronomia. CEP 9150-970. Porto Alegre, RS, Brazil.
5
Author for correspondence: e-mail [email protected]
84
and the seeds are minute and dust-like (Ackerman 2003; Dressler 1993). The roots
are fasciculate, fleshy, subterranean and villous (Ackerman 2003).
Prescottia ostenii was first described by Pabst (1979), from specimens collected at
Canelones, Uruguay. It is a very rare, poorly known species, and it is recorded here
for the first time from Brazil. So far, it was only known from two specimens: C.Osten
16918 (HB), and C.Osten 22939 (GH, MFVA, MVM, S), which were collected in
September 1923 and October 1933, at the same place in Uruguay. Notably, this
species was recently collected by us in Rio Grande do Sul, a southern Brazilian
state. The original description of P. ostenii (Pabst 1979) is quite poor regarding floral
details (especially flower shape, column and pollinarium details) and the original
illustrations consisted of a drawing of the habit plus a crude diagram of the perianth.
Both the drawing of the habit and perianth parts suggest that Pabst (1979) based his
description on specimens in bud. The discovery of this species in Brazil compelled us
to the elaboration of more detailed illustrations, including several features omitted in
the original description. The aim of the following contribution is thus twofold: 1) to
record P. ostenii for the first time for the Brazilian orchid flora; and 2) to provide a
more complete description of this plant’s morphological features, with emphasis in
characters that may be useful to elucidate taxonomic affinities.
Material and Methods
The protologue of the species (Pabst 1979) has been examined. Looking for
additional, possibly overlooked collections of P. ostenii, specimens of the following
herbaria have been studied: ALCB*, B, BAH, BHCB*, BM*, CAY, CEN, CEPEC*,
CESJ, CGMS, CM, COR, CR*, CTES, CVRD, EAC, ESA, ESAL, F, G, GH, GUA,
HAS*, HASU, HB*, HEPH, HMS, HRB*, HRCB, HUA, HUFU, HUEFS*, HURG,
85
HXBH, IAC, ICN*, INPA, IPA, JPB, K*, K–L*, M*, MAC, MBM*, MBML*, MG, MVFA,
MVM, NY, P*, PACA*, PAMG, PEL, PEUFR, PMSP, R*, RB*, RBR, RUSU, S, SJRP,
SMDB, SP, SPF, TEPB, UB, UEC*, UFMT, USJ*, VIC, W* (acronyms according to
Holmgren & Holmgren 1998). Specimens were studied by visiting some of the
herbaria (indicated with *) or otherwise as loans to HUEFS and K. Original materials
at HB, GH and S were examined.
The Brazilian specimens (see Distribution) were pressed and deposited at ICN. One
inflorescence was preserved in 70 % ethanol and its flowers were used to draw floral
features. Emphasis was put on characters absent or poorly illustrated in the
protologue. Floral features were drawn using a binocular stereomicroscope with a
camera lucida attachment. Living specimens were photographed with a digital (Sony
Cyber-shot DSC-H7) camera. In addition, floral details of a living specimens were
photographed with the help of a digital camera (Nikon Coolpix) attached to a
stereomicroscope.
Description
Prescottia ostenii Pabst (1979). Protologue: “Uruguay, Dep. Canelones, La
Floresta, in uliginosis dunarum, greg. Cop., C.Osten 22939, 23 Oct.1933”. Type:
Uruguay: Canelones, La Floresta, C.Osten 22939 (lectotype S!, isolectotype MVFA!,
MVM! selected by Azevedo & Van den Berg 2007).
Terrestrial herb, 5-8.4 cm high (in bloom). Leaves 2 - 5; rosulate; sessile; blade 0.8 2.0 cm long; 1.0 - 2.0 cm wide (Figure 1A), membranaceous, elliptic to ovate; apex
acute, base rounded, light green, concolorous, margin entire (Figure 1A).
Inflorescence terminal spike, 9 - 40-fl (Figure 1A-C, Figure 2A); peduncle (1,5) - 4.0 -
86
4.5 cm long; rachis 1.0 - 2.0 cm long; peduncle bracts 1 - 4; 3.0 - 6.0 mm long, 1.0 1.5 mm wide, apex acute, flower bract 0.7 - 1.0 mm long, ovate. Flowers nonresupinate (Figure 1A-C, Figure 2A, D-F), sessile, perianth white and ovary green
(Figure 1A-C), dorsal sepal 1.0 - 1.3 mm long, 1.0 - 1.3 mm wide, ovate, apex obtuse
(Figure 2B); lateral sepals 1.3 - 1.5 mm long, 1.3 - 1.5 mm wide, ovate, apex obtuse
(Figure 2B); lateral petals 1.0 - 1.3 mm long, 0.3 - 0.5 mm wide, asymmetric, oblong,
apex obtuse(Figure 2B). Labellum 1.5 - 1.7 mm long, 1.0 - 1.5 mm wide, concave,
with two prominent retrorse lobes (nectaries), inner surface pilose, outer surface
densely minute-papillose (Figure 2B). Column stout, short and erect, ca. 1.5 mm
long, provided with two lateral, staminode-like appendages (Figure 1D, Figure 2 GH). Stigmatic surface flat and entire (Figure 1D, Figure 2G-H). Anther-cap umbonate,
brown (Figure 1D). Anther erect, holding a pollinarium made up by four yellow,
clavate, friable, slightly compressed pollinia and a terminal disc-like viscidium (Figure
2I-J). Caudicles lacking. Fruit and seeds not seen.
DISTRIBUTION. Brazil and Uruguay
BRAZIL: Rio Grande do Sul, Jardim do Éden, Mun. Tramandaí, em área brejosa
19/Aug./2006, Singer 2006/21 (ICN); Rio Grande do Sul, Jardim do Éden, Mun.
Tramandaí, em área brejosa 18/Aug/2007, Singer 2006/50 (ICN). URUGUAY: Dep.
Canelones, La Floresta, in uliginosis dunarum 30/Sept./1923, Osten 16918 (HB);
Dep. Canelones, La Floresta, in uliginosis dunarum 23/Oct./1933, Osten 22939 (GH,
MVFA, MVM, S).
HABITAT: Either in Uruguay or Brasil, P. ostenii has been found among marshy,
paludicolous, open vegetation very near of the Atlantic coast (the Brazilian
populations were found less than 200 m from the sea).
87
CONSERVATION STATUS. Prescottia ostenii was hitherto known only from the type
locality, and only from two collections (see above). Apparently, it has not been
collected again in Uruguay and the type locality has been considerably modified as a
consequence of urban development (Eduardo Marchesi, pers. comm.). Only now,
after more than 70 years, it has been recollected. For the time being, the Brazilian
population is the only surviving population we are aware of. Indeed, P. ostenii is quite
inconspicuous and may have been overlooked by preceding researchers or may
have been confused with the widespread Prescottia densiflora (Brogn.) Lindl. We
have to say, however, that no misidentified specimens have been located by us so
far. More fieldwork in coastal Rio Grande do Sul is necessary to confidently assess
the status of this species in Brazil. In this context, P. ostenii should be provisionally
considered as DD (data deficient, according to IUCN criteria) regarding its
conservation status.
ETYMOLOGY: In honor of Dr. Cornelius Osten, its first collector.
NOTES. Prescottia ostenii is one of the most distinctive species in the genus, and is
easily differentiated by its short robust habit, only 5-8 cm tall (Fig 1A) when in flower,
and a dense and thick inflorescence (Fig 1A-C, Figure 2A). Some confusion was
caused by Pabst (1979) when citing the type. Therefore, a lectotype had to be
designated (Azevedo & Van den Berg 2007).
Overall, the plant resembles very much P. densiflora in vegetative and, to a lesser
degree, floral features. This resemblance was already highlighted by Pabst (1979).
By checking the type specimen (Osten 22939, S), we noticed that in 1955
(22/02/1955); according to an identification label Pabst had previously identified this
taxon as “Prescottia densiflora Lindl. forma nana”. This name, however, was never
88
validly published and therefore constitutes a nomen nudum. Indeed, Pabst (1979) did
not mention his preceding identification in the protologue of P. ostenii (Pabst 1979).
Both P. ostenii and P. densiflora display sessile, rosulate leaves (Figure 1A), as well
as multiflorous and congested inflorescences (Figure 2A-C, Figure 2A). However,
inflorescences are much taller (up to 30 cm) in P. densiflora. In both species the
labellum is deeply concave and pilose in its inner surface (Figure 2B). Another
shared feature is the basal adnation of the lateral sepals, delineating a hood-like
structure that partially conceals the labellum (Figure 2C). Whereas the lateral sepals
have strongly revolute apices in P. densiflora (Singer & Sazima 2001); the sepals in
P. ostenii are erect and straight. As in P. densiflora, the column of P. ostenii is short
and stout and provided with two lateral column appendages (Figure 1D, Figure 2 GH) (Singer & Sazima 2001; Singer & Cocucci 1999). Pollinarium features are also
quite similar in both species. However, the pollinarium of P. ostenii can only be
removed from very young, just opening flowers. Two or three days after blooming,
the pollinarium displays a wet, pasty consistence and it is not possible to remove it
from the clinandrium anymore. These preliminary observations made in living flowers
suggest that P. ostenii is autogamous; self-pollination being achieved by the passive
contact of the edges of the pollinia and the stigmatic secretion. By observing the
column, it is easy to notice that there is no physical separation between the edges of
the pollinia and the edge of the broad stigmatic surface (Figure 1D, Figure 2 G-H).
This mechanism of self-pollination may be widespread among orchidoid terrestrial
Orchidaceae and has already been suggested to occur in a few other Prescottia
species in Central America (Ackerman 2003). In contrast, P. densiflora is selfcompatible, but pollinator-dependent (Singer & Sazima 2001; Singer & Cocucci
1999).
89
After checking 10 fresh flowers and 13 alcohol-preserved flowers of P. ostenii, we
found no evidence of protandry in this taxon. Protandry was already reported for
some Prescottia species with long columns, such as P. stachyodes (Sw.) Lindl. and
P. montana Barb. Rodr.; but it is likely absent in taxa with short, stout columns
(Singer & Sazima 2001).
It is important to stress that P. ostenii and P. densiflora dwell in very different
conditions. Prescottia densiflora always occurs in humid, tough, well-drained soils.
Prescottia ostenii dwells in full-sun, with its roots underwater or in very moist
conditions. To our knowledge, P. ostenii is the only species in the genus able to
thrive in such conditions. The protologue of P. ostenii mentions that the plant was
found among several other water-tolerant plants, such as Drosera brevifolia Pursh
(Droseraceae), Eriocaulon modestum Kunth (Eriocaulaceae), Utricularia sp.
(Lentibulariaceae) and Laurembergia tetrandra Kanitz (Haloragaceae). The Brazilian
specimens were found among almost identical vegetation, very close to a population
of the rare Gunnera herteri Osten (Gunneraceae).
Ongoing molecular analyses (Azevedo & Van den Berg, in prep.) suggest that P.
ostenii belongs in a clade composed of the species with small, white-coloured flowers
and similar floral features (stout column, pilose inner labellum surface, etc). It is
important to stress that even if Pabst (1979) proposed a morphological affinity
between P. ostenii and P. densiflora, other species such as P. lancifolia Lindl. and
also P. oligantha Lindl. also share a significant number of floral features with P.
ostenii. Indeed, overall flower shape in P. ostenii more closely resembles P.
lancifolia, especially regarding the shape and position of the lateral sepals, which are
straight in both species (vs. folded in P. densiflora). The forthcoming phylogeny of the
90
genus Prescottia (Azevedo & Van den Berg, in prep.) will provide a solid framework
to critically assess the affinities between all these aforementioned taxa.
Prescottia ostenii can easily be separated from P. lancifolia and P. oligantha on the
basis of foliar shape: leaves in P. ostenii are sessile, these of P. lancifolia are
petiolate and lanceolate and these of P. oligantha are shortly petiolate. Because P.
ostenii and P. densiflora share sessile rosulate leaves and superficially similar
flowers, both taxa could be confused either in the form of pressed vouchers or in the
field. However, as shown above, both species can be easily separated through a
consistent set of ecological and morphological features. The following artificial key
summarizes the most useful characters to set apart the species:
1. Plants growing in marshy conditions. Inflorescences up to 8 cm high. Lateral
sepals straight, covering the labellum almost completely .................. P. ostenii
1. Plants not growing in marshy conditions. Inflorescences much taller, up to 30
cm high. Lateral sepals folded, with revolute apices ............... P. densiflora
Acknowledgments
The authors are grateful to the curators of the cited herbaria. The authors also thanks
to the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq,
Brazil, GD and PQ-ID) for the fellowships received. RBS thanks Rosana FariasSinger, Paulo Brack, Angelo Schneider, Ilsi Iob Boldrini and Cristiano R. Buzatto
(Depto Botânica, UFRGS) for helping in many ways.
91
References
Ackerman, J. D. (2003). Prescottia. In: A. M. Pridgeon, P. J. Cribb, M. W. Chase & F.
N. Rasmussen, Genera Orchidacearum. vol. 3, Orchidoideae (part 2):
Vanilloideae, pp. 47 – 50. Oxford University Press, Oxford.
Azevedo, C.O. & Van den Berg, C. (2007). Lectotypifications in Prescottia
(Orchidaceae - Orchidoideae). Kew Bull. 62(4): 651-655.
Dressler, L.R. 1993. Phylogeny and classification of the orchid Family. Dioscorides
Press, Portland.
Pabst, G. F. J. (1979). Orchidaceae extra Brasilianae novae vel criticae.Bradea. 3(3):
19 - 20.
Singer, R. B. & Cocucci, A. A. (1999). Pollination mechanism in southern Brazilian
orchids which are exclusively or mainly pollinated by halictid bees. Pl. Syst. Evol.
217(1 - 2): 101 - 117.
Singer, R. B. & Sazima, M. (2001). The pollination mechanism of three sympatric
Prescottia (Orchidaceae: Prescottinae) species in southeastern Brazil. Ann. Bot.
(Oxford) 88(6): 999 – 1005.
92
FIGURE 1: Plant and flower features of Prescottia ostenii Pabst. A. Blooming plant.
Notice the basal rosette of sessile leaves. B-C. Inflorescence (details). D. Detail of
the column. Photos by Rodrigo B. Singer.
93
FIGURE 2. Prescottia ostenii Pabst. A. Detail of inflorescence. B. Details of perianth.
C. Adnation of the lateral sepals (dorsal view). D-F. Flower (not fully opened). D.
lateral view. E. Fronto-lateral view. F. Schematic longitudinal section to show column
position. G-H. Column. G. Frontal view. H. Lateral view. I-J. Pollinarium. I. Dorsal
view. J. Ventral view. Ds: dorsal sepal. Ls: lateral sepals. L: labellum. Lp: lateral
petals. Drawing by Rodrigo B. Singer based in Singer 2006/21 (ICN).
94
Azevedo, C.O.; Smidt, E.C.; Van den Berg, C. (submited). Prescottia mucugensis: a
new species of Prescottia (Orchidaceae: Cranichidinae) from Bahia, Brazil. Kew
Bulletin.
95
Prescottia mucugensis: a new species of Prescottia (Orchidaceae:
Cranichidinae) from Bahia, Brazil
Cecília O. de Azevedo2,3, Eric de Camargo Smidt4, Cássio van den Berg5
Summary. Prescottia mucugensis C.O. Azevedo & Van den Berg, a new orchid species
from the district of Guiné, municipality of Mucugê, Bahia, Brazil, is described and illustrated
and a key for the related species is presented.
Resumo. Prescottia mucugensis C.O. Azevedo & Van den Berg, espécie nova do distrito de
Guiné, município de Mucugê, Bahia, Brasil, é descrita e ilustrada, e uma chave de
identificação para as espécies afins é apresentada.
Key Words: Mucugê, Orchidaceae, Prescottia.
Prescottia Lindl. is a genus of primarily terrestrial orchids. The flowers are nonresupinate, with lateral sepals basally connate forming a short cup. The lip is cucullate,
basally auriculate, with the inner surface glabrous to pilose, enclosing the column. The genus
has a broad distribution in the Neotropics, from Florida to Northwestern Argentina, although
most species occur in Brazil (Ackerman 2003).
2
Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade Estadual de Feira de
Santana, Av. Transnordestina s/n, Novo Horizonte, 44.036-900, Feira de Santana , BA, Brazil
3
Autor para correspondência: e-mail [email protected]
4
Universidade Federal do Paraná, Centro Politécnico, Setor de Ciências Biológicas, Departamento de Botânica,
Caixa Postal 19031, 81531-990, Curitiba, PR, Brazil
5
Departamento de Ciências Biológicas, Universidade Estadual de Feira de Santana, Av. Transnordestina s/n,
Novo Horizonte, 44.036-900, Feira de Santana , BA, Brazil
96
The Chapada Diamantina is located in the interior of Bahia state, Northeast Brazil. It is
a mountain range of outcrops of quartzite, sandstone and gneiss, ranging from 700 to over
2,000 m and is an important centre of diversity of the Brazilian mountain flora, where many
genera show a remarkable degree of diversification and large numbers of endemic species
occur (Harley & Simmons 1986; Giulietti et al. 1987, 1997; Giulietti & Pirani 1988; Alves &
Kolbek 1994; Harley 1995; Conceição & Pirani 2005, 2007). The vegetation in this area is
dominated by campo rupestre, an herbaceous-shrub vegetation that develops on open rocky
ground at elevations above 900 m, and is related to the Caatinga (Harley 1995). The district
of Guiné presents a very rich flora (Conceição et al. 2007), being located on the western
border of the Serra do Sincorá and the Chapada Diamantina National Park in the municipality
of Mucugê (12°45' S and 41°30' W).
Four Prescottia species have been recently recorded for the Chapada Diamantina: P.
densiflora (Brongn.) Lindl. (material not seen), P. leptostachya Lindl., P. montana Barb.
Rodr. and P. stachyodes (Sw.) Lindl. (Toscano de Brito 1995; Toscano de Brito & Smidt
2005; van den Berg & Azevedo 2005; Azevedo & van den Berg 2007). A fifth species has
been discovered for the same area and is here described and illustrated.
Prescottia mucugensis C.O.Azevedo & Van den Berg sp. nov. P. phleoide Lindl. et P.
leptostachya floribus viridescens et labello intus glabro similis, illa sepalis lateralibus
labellum adpressis aemulans. Ab ambabus rachidi angulari (in P. phleoide et P. leptostachya
rachidi cylindrica) et floribus minoribus differt. Florum dispositio in inflorescentia intermedia
inter ambas species (flores congesti in P.phleoide et laxi in P.leptostachya). Ab
P.leptostachya sepalis lateralibus labellum adpressis differt (in illa sepalis lateralibus reflexis
cum parte dorsali ovarium adpressa). Typus: Brazil, Bahia, Mucugê, Guiné, Smidt 796
(holotypus HUEFS). Fig. 1.
97
Terrestrial herb, to 19 – 22 cm tall (in bloom). Roots fasciculate, fleshy. Leaves not seen
(without leaves when in bloom). Inflorescences terminal, erect, 10 – 20-flowered; peduncle
14 – 16 cm long; peduncle bracts 3 – 5, 8 – 15 × 2 – 4 mm, apex acute; rachis 3 – 5.5 cm
long, angular; floral bracts greenish to purplish brown, ovate, apex acuminate, 2.4 – 2.7 × 1 –
1.2 mm. Flowers non-resupinate; ovary green, 2.2 – 2.4 × 1.3 – 1.5 mm; sepals greenish to
purplish brown, dorsal sepal reflexed, oblong-lanceolate, apex obtuse, 1.2 – 1.4 × 0.8 – 1 mm,
lateral sepals basally connate, forming a sepaline cup, adpressed to the lip, ovate-lanceolate,
apex obtuse, 1.5 – 1.7 × 1 – 1.2 mm; petals greenish to purplish brown, reflexed, linear, 1 –
1.2 × 0.2 – 0.3 mm, apex obtuse; labellum connate to sepaline tube, whitish to yellowish, 1.2
– 1.5 × 1.2 – 1.5 mm, deeply concave, cucullate over the column, outer surface densely
minute-papillose, inner surface glabrous, provided at the base with two fleshy, parallel,
fusiform-cylindrical nectarines, which are 0.4 – 0.6 mm long; column erect, 0.9 – 1 × 0.4 –
0.5 mm; provided with two lateral, staminode-like appendages, anther erect, brown, pollinia
4, yellow, soft, slightly compressed, viscidium terminal, disc-like; stigmatic surface flat and
entire.
DISTRIBUTION. BRAZIL: Bahia.
SPECIMENS EXAMINED. BRAZIL. State of Bahia, Chapada Diamantina, Municipality of
Mucugê, District of Guiné, Serra do Esbarrancado, Nov. 2004, Smidt 796 (holotype HUEFS);
Nov. 2005, Azevedo 253 (paratype HUEFS).
HABITAT. Rocky places in campo rupestre vegetation, between 1,000 - 1,400 m altitude,
summit of Serra do Esbarrancado, among rocks and Velloziaceae.
98
CONSERVATION SATATUS. Vulnerable (VU – D). Besides Prescottia mucugensis is
inside of a National Park, it is currently known to exist at only a single location, in a small
and restricted population.
ETYMOLOGY. In reference to the type locality, the municipality of Mucugê.
NOTES. Ongoing molecular analyses (Azevedo et al. in prep.) based on nuclear and
chloroplast DNA sequences show that Prescottia mucugensis forms a group with P. phleoides
(Fig. 2H) and P. leptostachya (Fig. 2G), being sister to the former.
Prescottia leptostachya, like P. mucugensis, occurs in the campos rupestres of the
Chapada Diamantina, whereas P. phleoides grows on sandy soils in campos de altitude (high
altitude grasslands) in Southeastern Brazil, in elevations between 1,800 – 2,000 m.
Prescottia mucugensis can be distinguished from these taxa by the shape of its
inflorescence, floral bracts and flowers. Prescottia phleoides has multiflorous and congested
inflorescence, with the rachis 2.5 – 5.5 (7) cm long (Fig. 2H), while in P. leptostachya and P.
mucugensis the inflorescences are sparsely flowered. In Prescottia leptostachya the
inflorescence is really laxly flowered and the rachis is 8 - 20 (25) cm long (Fig. 2G).
Prescottia mucugensis can be distinguished from both these species by its angular rachis
shape (Fig. 1-2B), while in the other two it is cylindrical.
Prescottia phleoides differs by possessing long floral bracts, longer than the ovary and
flower combined, whereas in P. mucugensis the bracts are about the same length as the ovary
and flower together. Prescottia leptostachya bears shorter flower bracts, about the same
length as the ovary (Fig. 2G).
In addition to these differences, the lateral sepals are reflexed (with the distal part
adpressed to the ovary) in P. leptostachya, whereas in P. mucugensis (Fig. 2C-D) and P.
phleoides (Fig. 2H) the lateral sepals are adpressed to the lip. Prescottia mucugensis has small
flowers with the lip from 1.2 – 1.5 mm long, while P. leptostachya and P. phleoides present
99
bigger flowers with the lip between 2.5 – 3.5 mm long, and 2.5 – 4 mm long, respectively.
Prescottia leptostachya and P. phleoides have pale green sepals and petals with a green lip.
Prescottia mucugensis on the other hand has greenish to purplish brown sepals and petals and
a whitish to yellowish lip.
The following artificial key summarizes the most useful characters to separate the three
species:
1. Inflorescence congested, rachis 2.5 – 5.5 (7) cm long; floral bract longer than flower
....................................................................................................... Prescottia phleoides
1’. Inflorescence lax, rachis 3 – 20 (25) cm long; floral bract not longer than flower
..................................................................................................................................... 2
2. Rachis angular, 3 – 5.5 cm long; floral bract about the same length as flower ;
lateral sepals adpressed to the lip; sepals and petals greenish to purplish brown, and a
whitish to yellowish lip; lip 1.2 – 1.5 mm long ................. Prescottia mucugensis
2’. Rachis cylindrical, 8 - 20 (25) cm long; floral bract shorter then flower, about the
same length as the ovary; lateral sepals reflexed (with distal part adpressed to ovary);
sepals and petals pale green with green lip; lip 2.5 – 3.5 mm long ..........................
.......................................................................................... Prescottia leptostachya
Acknowledgments
The authors thank the CNPq - Conselho Nacional de Desenvolvimento Científico e
Tecnológico, Brazil, for fellowships received (GD and PQ-2D to CvdB), and Carla Teixeira
de Lima for the line drawing.
Literature Cited
100
Ackerman, J. D. (2003). Prescottia. In: A. M. Pridgeon; P. J. Cribb; M. W. Chase & F. N.
Rasmussen, Genera Orchidacearum. vol. 3, Orchidoideae (part 2): Vanilloideae, pp. 47 –
50. Oxford University Press, Oxford.
Alves, R. J. V. & Kolbek, J. (1994). Plant species endemism in savanna vegetation on table
mountains (campo rupestre) in Brazil. Vegetatio 113: 125 – 139.
Azevedo, C. O. & van den Berg, C. (2007). A Família Orchidaceae no Parque Municipal de
Mucugê, Bahia, Brasil. Hoehnea. 34: 1 – 47.
Conceição, A. A.; Pirani, J. R. & Meirelles, S. T. (2007). Floristics, structure and soil of
insular vegetation in four quartzite-sandstone outcrops of "Chapada Diamantina",
Northeast Brazil. Rev. Bras. Bot. 30: 641 – 656.
Conceição, A. A. & Pirani, J. R. (2005). Delimitação de habitats em campos rupestres na
Chapada Diamantina: substratos, composição florística e aspectos estruturais. Bol. Bot.
Univ. São Paulo. 23: 85 – 111.
Conceição, A. A. & Pirani, J. R. (2007). Diversidade em quatro áreas de campos rupestres na
Chapada Diamantina, Bahia, Brasil: espécies distintas, mas riquezas similares. Rodriguésia
58: 193 – 206.
Giulietti, A. M. & Pirani, J. R. (1988). Patterns of geographic distribution of some plant
species from the Espinhaço Range, Minas Gerais and Bahia, Brazil. In: P. E. Vanzolini &
W. R. Heyer (eds.), Proceedings of a workshop on neotropical distribution patterns, pp. 39
– 69. Academia Brasileira de Ciências, Rio de Janeiro.
Giulietti, A. M.; Menezes, N. L.; Pirani, J. R.; Meguro, M. & Wanderley, M. G. L. (1987).
Flora da Serra do Cipó, Minas Gerais: caracterização e lista das espécies. Bol. Bot. Univ.
São Paulo 9: 1151.
Giulietti, A. M.; Pirani, J. R. & Harley, R. M. (1997). Espinhaço Range Region, Eastern
Brazil. In: S. D. Davis; V. H. Heywood; O. Herrera-Macbryde; J. Villa-Lobos & A. C.
101
Hamilton (eds.), Centres of plant diversity. A guide and strategy for their conservation, pp.
397 – 404. The Americas. IUCN Publication Unity, Cambridge.
Harley, R. M. (1995). Introduction. In: B. L. Stannard (ed.) Flora of the Pico das Almas,
Chapada Diamantina, Brazil, pp. 1 – 42. Royal Botanic Gardens, Kew.
Harley, R. M. & Simmons, N. A. (1986). Florula of Mucugê, Chapada Diamantina, Bahia,
Brazil. Royal Botanic Gardens, Kew.
Toscano de Brito, A. L. V. 1995. Orchidaceae. In: B. L. Stannard (ed.) Flora of the Pico das
Almas: Chapada Diamantina, Bahia, Brazil, pp. 725 – 767. Royal Botanic Gardens,
Kew.
Toscano de Brito, A. L. V. & Smidt, E. C. (2005). Checklist da Orquídeas da Chapada
Diamantina. In: A. L. V. Toscano de Brito & P. Cribb, Orquídeas da Chapada
Diamantina, pp. 278 – 285. Nova Fronteira, Rio de Janeiro.
Van den Berg, C. & Azevedo, C. O. (2005). Orquídeas. In: F. A. Juncá; L. S. Funch; W.
Rocha (Org.), Biodiversidade e Conservação da Chapada Diamantina, pp. 195 – 208.
Ministério do Meio Ambiente, Brasília.
102
A
1 cm
1 mm
L
F
1 mm
0.2 mm
G
E
D
C
1 mm
0.2 mm
K
1 cm
0.2 mm
H
B
J
103
Figure 1. Prescottia mucugensis. A habit; B inflorescence; C-E flower: C front view; D side
view; E dorsal view; F floral bract; G perianth parts, clockwise from top: lip, dorsal sepal,
petal, lateral sepal; H-K column with pollinarium in place: H dorsal view; J ventral view; K
lateral view; L pollinarium. Drawn from fresh material (Azevedo 253).
104
A
B
C
D
stg
vi
E
F
G
H
G
H
pl
a
105
Figure 2. Prescottia mucugensis (Bahia: Azevedo 253). A detail of inflorescence; B angular
rachis; C flower, side view; D flower, front view; E perianth parts, clockwise from top: lip,
lateral sepal, petal, dorsal sepal, petal, lateral sepal, column; F detail of the column: a: anther.
pl: pollinia. stg: stigma. vi: viscidium. Prescottia leptostachya (Bahia: Azevedo 250). G detail
of inflorescence. Prescottia phleoides (Minas Gerais: Azevedo 344). H detail of inflorescence.
106
Azevedo, C.O.; Leoni, L.S.; Van den Berg, C. (submetido) Prescottia glazioviana
Cogn. (Orchidaceae): nova ocorrência para Minas Gerais, Brasil, com descrição
morfológica completa da espécie. Acta Botanica Brasilica.
107
1
Prescottia glazioviana Cogn. (Orchidaceae): nova ocorrência para Minas Gerais, Brasil, com
2
descrição morfológica completa da espécie.
3
4
Cecília O. de Azevedo6,4, Lúcio de Souza Leoni2, Cássio van den Berg 3
5
6
Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade Estadual de Feira
de Santana, Av. Transnordestina s/n, Novo Horizonte, 44.036-900, Feira de Santana , BA, Brasil.
2
Faculdade de Filosofia, Ciências e Letras de Carangola, Universidade do Estado de Minas Gerais,
Caixa Postal 90, 36800-000, Carangola, MG, Brasil.
3
Departamento de Ciências Biológicas, Universidade Estadual de Feira de Santana, Av.
Transnordestina s/n, Novo Horizonte, 44.036-900, Feira de Santana , BA, Brasil.
4
Autor para correspondência: e-mail [email protected]
108
1
RESUMO – (Prescottia glazioviana Cogn. (Orchidaceae): nova ocorrência para Minas
2
Gerais, Brasil). Previamente conhecida de apenas dois espécimes coletados no Rio de Janeiro,
3
Prescottia glazioviana é aqui registrada pela primeira vez para o estado de Minas Gerais,
4
Brasil. Características morfológicas ausentes na descrição original são descritas e ilustradas.
5
6
Palavras-chave: Minas Gerais, nova ocorrência, Orchidaceae, Prescottia.
7
8
ABSTRACT – (Prescottia glazioviana Cogn. (Orchidaceae): a new record for Minas Gerais,
9
Brazil). Previously known from only two specimens collected in Rio de Janeiro, Prescottia
10
glazioviana is reported for the first time for Minas Gerais State, Brazil. Morphological
11
features lacking in the original description are described and illustrated.
12
13
14
Key Words: Minas Gerais, new record, Orchidaceae, Prescottia.
109
1
Introdução
2
3
Prescottia Lindl. é um gênero Neotropical de Orchidaceae que ocorre da Flórida ao
4
nordeste da Argentina, com grande riqueza de espécies no Brasil (Ackerman 2003). São ervas
5
terrestres, raramente epífitas, com folhas em roseta basal e inflorescência terminal. As flores
6
são pequenas, brancas ou branco-rosadas a esverdeadas, não ressupinadas, com labelo
7
cuculado.
8
Cogniaux (1895) descreveu Prescottia glazioviana com base em dois síntipos
9
coletados no estado do Rio de Janeiro: Glaziou 6729 (Protólogo: “Habitat ad cacumen mont.
10
Itatiaia in Campo de Silvério prov. Rio de Janeiro: Glaziou n. 6729 in herb. Berol. non alior”)
11
e Gardner 5884 (Protólogo: “Serra dos Órgãos: Gardner 5884 in herb. Berol. et Kew”). Nem
12
um dos dois espécimes citados para o herbário de Berlin (B) foi encontrado, o que significa
13
que provavelmente foram destruídos durante a Segunda Guerra Mundial. Do segundo foram
14
encontrados seis espécimes e, embora citado apenas para B e K, há exemplares também em
15
BM e R. Em K foram encontrados três espécimes. Desta forma, um dos espécimes de
16
Gardner 5884 foi recentemente selecionado como lectótipo (Azevedo & Van den Berg 2007).
17
Existe ainda um espécime em G: este apresenta data diferente de todos os outros e por isso
18
não foi considerado como isolectótipo.
19
Auguste François Marie Glaziou, botânico francês, coletou no Brasil entre 1861 e
20
1895 (Stafleu & Cowan 1976), sendo a região do Planalto do Itatiaia alvo de inúmeras
21
expedições botânicas desde 1872 (Brade, 1956). Em julho deste ano, Glaziou, acompanhado
22
da princesa Isabel, foi o primeiro a alcançar a parte mais alta do maciço. Nessa expedição,
23
várias espécies novas foram coletadas e descritas por especialistas da época. Ainda no século
24
XIX, a região recebeu os botânicos Wawra e Ule, e, no início do século XX, foi explorada
25
pelos botânicos Brade, Dusén, Tamandaré de Toledo Jr., Sampaio e Campos Porto, gerando
26
importantes contribuições ao conhecimento da flora regional. Alexandre Curt Brade,
27
pesquisador do Jardim Botânico do Rio de Janeiro, coletou continuamente no planalto por
28
mais de 30 anos (Brade, 1956).
29
Prescottia glazioviana é uma espécie rara e pouco conhecida. É aqui registrada pela
30
primeira vez para o estado de Minas Gerais. O ápice do labelo é proeminente, de margem
31
ondulada e constrição na região apical, característica encontrada apenas nesta espécie. Apesar
32
disso, essa informação não foi mencionada na descrição original (Cogniaux 1895), e a única
33
ilustração publicada da espécie (Hoehne 1945) também omite esta característica. Desta forma,
110
1
pretende-se aqui, além de registrar a ocorrência desta espécie para o estado de Minas Gerais,
2
apresentar uma descrição morfológica mais completa, com o intuito de elucidar questões
3
taxonômicas, e ilustrar estes caracteres.
4
5
Material e Métodos
6
O protólogo e material-tipo da espécie (Cogniaux 1895) foram examinados, além do
7
material dos seguintes herbários: AAU, ALCB*, B, BAH, BHCB*, BM*, CAY, CEN,
8
CEPEC*, CESJ, CGMS, CM, COL, COR, CR*, CTES, CVRD, EAC, ESA*, ESAL, F, G,
9
GFJP, GH, GUA, HAS, HASU, HB*, HEPH, HMS, HRB*, HRCB, HUA, HUFU, HUEFS*,
10
HURG, HXBH, IAC, IBGE, ICN, INPA, IPA, JPB, K*, K–L*, LP, M*, MAC, MBM*,
11
MBML*, MG, MO, MVFA, NY*, P*, PACA, PAMG, PEL, PEUFR, PMSP, QCNE, R*,
12
RB*, RBR, RUSU, S, SEL, SJRP, SMDB, SP*, SPF*, TEPB, UB, UEC*, UFMT, US, USJ*,
13
VIC, W* (acrônimos segundo Holmgren & Holmgren 1998). Os herbários visitados estão
14
indicados com asteriscos, sendo os materiais dos restantes obtidos através de empréstimos
15
para os herbários HUEFS, K e NY.
16
Expedições às áreas de ocorrência da espécie foram feitas no intuito de recoletar o
17
material. Destas, três foram realizadas para o estado do Rio de Janeiro, nas localidades tipo,
18
sendo duas para o Itatiaia (julho/2006 e abril/2007) e uma para a região da Serra dos Órgãos
19
(junho/2006). Para o Caparaó, no estado de Minas Gerais, foram realizadas sete expedições
20
(dezembro de 2007, janeiro, fevereiro, março e abril de 2008, fevereiro e abril de 2009), mas
21
não foi encontrado material além dos presentes nos herbários.
22
23
Resultados e discussão
24
25
Prescottia glazioviana Cogn., Fl. Bras. 3 (4): 261. 1895. Lectótipo: Brasil: Rio de Janeiro,
26
Summit of Órgãos Mountains, Gardner 5884, March 1841 (K-L!; isolectótipo K! (Herb.
27
Benthamianum); K! (Herb. Hookerianum); BM!; R! selecionado por Azevedo & Van den
28
Berg (2007).
29
Fig. 1.
30
111
1
Erva terrestre. Raiz fasciculada, cilíndrica. Folha 1 (raro 2), basal; pecíolo 2-5,5 cm compr.;
2
lâmina 7-14 x 3-6,8 cm, verde, membranácea, elíptica a oblonga, ápice agudo, margem
3
inteira. Inflorescência espiga terminal, ereta, 10-20-fl; pedúnculo 10-17(28) cm compr.,
4
brácteas do pedúnculo 2-3, 17-40 × 6-10 mm, ovadas a lanceoladas, ápice agudo; raque (5)7-
5
9(12) cm compr., brácteas florais 5-10 × 1-3,5 mm, ovadas, ápice agudo a acuminado. Flores
6
não ressupinadas, verdes, glabras; sépala dorsal 3-4 × 2-2,5 mm, reflexa, oblonga, ápice
7
obtuso; sépalas laterais 5-5,5 × 2-2,5 mm, adpressas ao labelo, oblongas a ovadas, ápice
8
obtuso a agudo, conatas na base formando um mento; pétalas 4-5 × 0,7-1,5 mm, adpressas ao
9
labelo, linear-espatuladas, ápice truncado; labelo 3,5-5 × 2,7-4 mm, carnoso, cuculado, na
10
base adnato ao mento, constrito na região apical, ápice proeminente com margem ondulada,
11
superfície externa papilosa e interna glabra, base auriculada (nectário). Coluna ereta, ca. 1,5-2
12
mm compr.; estaminódio ausente, antera ereta, polínias 4, viscídio terminal; superfície
13
estigmática inteira.
14
15
Distribuição - Restrita ao Brasil, ocorre nos estados do Rio de Janeiro e Minas Gerais.
16
BRASIL. Rio de Janeiro: Summit of Órgãos Mountains, III/1841, Gardner 5884 (BM, K, K-
17
L, NY, R, SEL(foto); Órgãos, VII/1842, Gardner 5884 (G, MO (foto); Castelos, Serra dos
18
Órgãos, 19/III/1932, Brade 11799 (R); Minas Gerais: Alto Caparaó, Parque Nacional do
19
Caparaó. Trilha para o pico da Bandeira, 12/II/1998, Souza et al. 2137 (ESA); Alto Caparaó,
20
Parque Nacional do Caparaó, 02/IV/2003, Leoni 5280 (GFJP, HUEFS).
21
Habitat - Tanto no Rio de Janeiro como em Minas Gerais, Prescottia glazioviana habita
22
campos de altitude entre 1.790 – 2.400 m. No Parque Nacional do Caparaó, ela cresce sobre
23
afloramentos rochosos de gnaise que se apresentam revestidos por uma fina camada de solo
24
pétreo arenoso em meio a briófitas.
25
Status de Conservação - VU D2 (vulnerável) - Prescottia glazioviana é uma espécie rara, até
26
o momento conhecida por cinco coletas de apenas três ou quatro localidades (Itatiaia, Serra
27
dos Órgãos, Castelos (Serra dos Órgãos) e Alto Caparaó).
28
A primeira coleta de Prescottia glazioviana foi em 1841, na Serra dos Órgãos
29
(Gardner 5884). Supõe-se que a segunda coleta, do outro síntipo (Glaziou 6729), ocorreu em
30
1872. Embora o material tenha sido destruído, sabe-se que este foi o período em que Glaziou
31
realizou excursão à parte alta do maciço de Itatiaia (Brade 1956). Apesar das coletas de longo
32
prazo realizadas por Brade na região, não existe registro de que a espécie tenha sido coletada
33
novamente nesta área. Este último espécime (Glaziou 6729) coletado há 137 anos atrás é,
112
1
desta maneira, a primeira e única coleta realizada na região de Itatiaia. Entretanto, é preciso
2
cautela ao afirmar que a espécie de fato existe - ou existiu - no planalto do Itatiaia. Wurdack
3
(1970) chama atenção para a alteração dos locais de coleta e para a apropriação indevida de
4
materiais coletados por outros coletores por parte de Glaziou, sendo que a falta de coleta por
5
parte de Brade aumenta a desconfiança com relação à presença da espécie na região. A
6
terceira coleta, realizada na Serra dos Órgãos (Brade 11799 em 1932), 91 anos após a
7
primeira coleta nesta região (Gardner 5884 em 1841), foi também a última vez que a planta
8
foi encontrada no estado do Rio de Janeiro. A quarta coleta foi feita 66 anos depois, em Minas
9
Gerais (Souza et al. 2137 em 1998) e a quinta, alguns anos depois (Leoni 5280 em 2003), no
10
mesmo local da anterior.
11
Etimologia - O nome é em homenagem a Auguste François Marie Glaziou (1828-1906),
12
coletor de um dos síntipos da espécie.
13
Notas - Prescottia glazioviana é uma espécie pouco conhecida, embora seja facilmente
14
reconhecida por apresentar geralmente uma única folha com pecíolo curto, lâmina elíptica a
15
oblonga, o ápice das pétalas truncado e, principalmente, por apresentar o ápice do labelo
16
proeminente com margem ondulada e constrito na região apical, duas características
17
exclusivas desta espécie no gênero.
18
Prescottia glazioviana provavelmente ocorre no estado do Espírito Santo, uma vez que
19
o Parque Nacional do Caparaó situa-se na divisa dos estados de Minas Gerais e Espírito
20
Santo, sendo que 75% de sua área pertence ao Espírito Santo, mas aparentemente nenhuma
21
coleta foi feita neste estado. Embora tenha sido citada por Pabst & Dungs (1975) para São
22
Paulo, nenhum material coletado no estado foi encontrado, nem mesmo no Herbário
23
Bradeanum (HB) onde Pabst trabalhou e foi diretor.
24
Os espécimes coletados em Minas Gerais (Souza et al. 2137 e Leoni 5280) foram
25
encontrados entre o material indeterminado da família Orchidaceae. Após sua identificação
26
diversas excursões foram feitas à área no intuito de recoletar o material, que não foi
27
encontrado. A espécie em questão parece ser realmente muito rara. Trabalhos de campo mais
28
extensos serão necessários para afirmar com segurança o estado de conservação da espécie no
29
estado do Rio de Janeiro e sua real distribuição geográfica no território brasileiro.
30
31
32
33
Agradecimentos
Os autores agradecem aos curadores dos herbários citados pela atenção e empréstimo
de material, a Vinícius A. de O. Dittrich pela leitura crítica do manuscrito, ao Conselho
113
1
Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pela bolsa concedida à
2
primeira autora (GD) e ao último autor (Pq-1D), e à Fundação de Amparo à Pesquisa da
3
Bahia (FAPESB) pelo auxílio financeiro.
4
5
Referências bibliográficas
6
Ackerman, J.D. 2003. Prescottia. Pp. 47–50. In: A.M. Pridgeon, P.J. Cribb, M.W. Chase &
7
F.N. Rasmussen, Genera Orchidacearum Vol. 2. Orchidoideae (part 2): Vanilloideae.
8
Oxford, Oxford University Press.
9
10
11
12
13
14
15
16
17
Azevedo, C.O. & Van den Berg, C. 2007. Lectotypifications in Prescottia (Orchidaceae Orchidoideae). Kew Bulletin 62(4): 651-655.
Brade, A.C. 1956. A Flora do Parque Nacional do Itatiaia. Boletim do Parque Nacional do
Itatiaia 5: 1-85.
Cogniaux, A. 1895. Orchidaceae. In: C.F.P. Martius & A.G. Eichler (eds.) Flora Brasiliensis.
vol. 3(4). Lipsiae, Frid. Fleischer.
Hoehne, F.C. 1945. Orchidaceae. Pp 1-389. In: F.C. Hoehne (ed.) Flora Brasilica. São Paulo,
Secretaria da Agricultura, Indústria e Comércio de São Paulo.
Holmgren, P.K. & Holmgren, N.H. 1998. Index Herbariorum: A global directory of public
18
herbaria and associated staff. New York Botanical Garden's Virtual Herbarium.
19
http://sweetgum.nybg.org/ih/
20
Pabst, G.F.J. & Dungs, F. 1975. Orchidaceae Brasilienses. Hildesheim, Kurt Schmersow.
21
Singer, R.B. & Cocucci, A.A. 1999. Pollination mechanism in southern Brazilian orchids
22
which are exclusively or mainly pollinated by halictid bees. Plant Systematics and
23
Evolution 217(1-2): 101-117.
24
Singer, R.B. & Sazima, M. 2001. The pollination mechanism of three sympatric Prescottia
25
(Orchidaceae: Prescottiinae) species in Southeastern Brazil. Annals of Botany 88(6):
26
999-1005.
27
28
29
30
31
Stafleu, F.A. & Cowan, R.S. 1976. Taxonomic literature. vol. I: A-G. Utrecht, Bohn
Scheltema & Holkema.
Wurdack, J.J. 1970. Erroneous data in Glaziou collections of Melastomataceae. Taxon 19(6):
911-913.
114
1
Legenda da figura
2
3
Figura 1: Prescottia glazioviana Cogn.: A. Hábito. B-C. Flor. B. vista frontal. C. vista lateral.
4
D. Bráctea floral. E. Labelo, vista lateral. F. Diagrama floral, de cima para baixo, sentido
5
horário: labelo, sépala dorsal, pétala, sépala lateral. G-H. Coluna. G. vista ventral. H. vista
6
dorsal (Leoni 5280).
7
115
1 mm
B
1 mm
2 cm
F
E
2 mm
2 mm
C
D
A
1 mm
G
H
1
2
Figura 1: Prescottia glazioviana Cogn.: A. Hábito. B-C. Flor. B. vista frontal. C. vista lateral.
3
D. Bráctea floral. E. Labelo, vista lateral. F. Diagrama floral, de cima para baixo, sentido
4
horário: labelo, sépala dorsal, pétala, sépala lateral. G-H. Coluna. G. vista ventral. H. vista
5
dorsal (Leoni 5280).
116
Capítulo 3
Taxonomic revision of the genus Prescottia Lindl. (Orchidaceae - Orchidoideae)
117
Taxonomic revision of the genus Prescottia Lindl. (Orchidaceae Orchidoideae)
Cecília Oliveira de Azevedo1,4, Cássio van den Berg2, Fábio de Barros3
1. Pós-Graduação em Botânica, Departamento de Ciências Biológicas, Universidade
Estadual de Feira de Santana, Transnordestina s/n, Novo Horizonte, 44.036-900,
Feira de Santana, BA, Brazil.
2. Departamento de Ciências Biológicas, Laboratório de Sistemática Molecular de
Plantas, Universidade Estadual de Feira de Santana, Transnordestina s/n, Novo
Horizonte, 44.036-900, Feira de Santana, BA, Brazil.
3. Instituto de Botânica, Seção de Orquidário do Estado. Av. Miguel Estefano, 3687.
Água Funda. 04301-012 - São Paulo, SP, Brazil.
4. Author for correspondence: e-mail [email protected]
118
Abstract
A taxonomic revision of Prescottia Lindl. (Orchidaceae: Orchidoideae), a
neotropical genus of mainly terrestrial orchids, is presented. This study is based on
fieldwork collection, in situ population observation, and herbaria collections
examination. Nomenclatural questions are analyzed, and ecological comments are
presented. Fifteen species are recognised for Prescottia in this study, incuding two
new described species (Prescottia mucugensis C.O. Azevedo & Van den Berg and
P. ecuadorensis C.O. Azevedo & Van den Berg). Two species complexes are
indicated. Eleven lectotypifications, one neotipification, and 11 new synonymies are
proposed. One sepecies is reestablished and four nomina nuda are detected. Macro
and micro-morphological data are given, besides species descriptions and
identification key. Each species is illustrated, relevant literature reviewed, and their
distribution mapped.
119
Introduction
Orchidaceae is one of the largest families of flowering plants, comprising
around 20.000 species and 850 genera (Atwood 1986; Dressler 1993), being widely
distributed but with the greatest diversity in the tropics. The family is monophyletic
and positioned as sister to the other members of the order Asparagales (Fay et al.
2000; Judd et al. 2007).
Tribe Cranichideae has been placed under different names in the subfamilies
Neottioideae (Lindley 1840a; Bentham 1881; Schlechter 1926; Garay 1960; Dressler
1974) and Spiranthoideae (Dressler 1979, 1981, 1990, 1993; Szlachetko 1995).
However, recent morphological and molecular phylogenetic studies have provided
evidence for their inclusion into an expanded concept of Orchidoideae (Dressler
1986; Dressler & Chase 1995; Kores et al. 1997, 2000, 2001; Cameron & Chase
1999; Freudenstein & Rasmussen 1999; Freudenstein et al. 2000).
Cranichideae sensu Dressler (1993) includes about 95 genera and 1.140
species of mainly terrestrial orchids, distributed in all continents, but are especially
diverse in the tropical and subtropical regions of America and Asia (Dressler 1993).
Dressler (1993) recognized six subtribes in Cranichideae, which agreed with subtribal
limits set previously by Schlechter (1926) except for the recognition of a new
subtribe, Prescottiinae (Dressler 1990), to accommodate several genera formerly
included in Cranichidinae. Subtribes Goodyerinae and Spiranthinae are both
widespread, whereas Cranichidinae and Prescottiinae are restricted to the
Neotropics, and Manniellinae and Pachyplectroninae are endemic to tropical Africa
and New Caledonia, respectively. Subtribe Prescottiinae sensu Dressler (1993)
contain 99 species, belonging to seven genera: Aa Rchb. f., Altensteinia Kunth,
Gomphichis Lindl., Myrosmodes Rchb. f., Porphyrostachys Rchb. f., Prescottia Lindl.,
and Stenoptera C. Presl. Except for Prescottia all others genera occur at higher
elevations in the Andes.
In 1824 Lindley described Prescottia, based on Prescottia plantaginifolia
(Lindley in Hooker 1824). Latter two species, originally described as Cranichis, C.
stachyodes Sw. and C. oligantha Sw. (Swartz 1788), were transferred to this genus
by Lindley (1836; 1840a). Cogniaux (1895), at Flora Brasiliensis, cited 19 species of
Prescottia to Brazil, however he did not comment anything about the non Brazilian
120
species previously described (P. ophioglossoides Spreng., P. petiolaris Lindl., P.
oligantha (Sw.) Lindl., P. tenuis Lindl., P. lanceaefolia Link & Otto ex Steud., P.
pachyrhiza A. Rich. & Galeotti, P. orchioides Lindl., P. lindeniana A. Rich. & Galeotti,
P. galeottii Rchb. f., P. cordifolia Rchb. f., P. pellucida Lindl., and P. myosurus Rchb.
f. ex Griseb.). Although he synonymized the Brazilian species Prescottia colorans
Lindl. and P. longipetiolata Barb. Rodr., under P. stachyodes (Sw.) Lindl., from
Jamaica.
At Flora Brasilica, Hoehne (1945), cited 17 species occurring in Brazil,
together with some non-Brazilian species, that he believed could be found in Brazil
as well (Prescottia longifolia Schltr., P. smithii Schltr., P. panamensis Schltr., P.
filiformis Schltr., and P. gracilis Schltr.). In addition, he created a new name (nomen
novum): Prescottia schlechteri Hoehne, for the Ecuadorian species Prescottia
longipetiolata Schltr (non P. longipetiolata Barb. Rodr.). Hoehne (1945) did not
mention anything about the varieties, nor about Prescottia tubulosa (Lindl.) L.O.
Williams. Once again, the author did not make any comments about the species
described before Cogniaux’s work, except for Prescottia lanceaefolia Link & Otto ex
Steud., which he considered a synonym of P. lancifolia Lindl.
In 1975, Pabst & Dungs listed 17 species of Prescottia native to Brazil, and
established four informal groups for the Brazilian species of the genera: Prescottia
colorans alliance: lip internally glabrous, leaves elliptic, clearly petiolate; Prescottia
plantaginea alliance: lip internally glabrous, leaves lanceolate and indistinctly
petiolate; Prescottia oligantha alliance: lip internally densely pilose, leaves elliptic or
oval; and Prescottia lancifolia alliance: lip internally densely pilose, leaves lanceolate.
In recent years, Prescottia has been treated in the context of regional floras,
without any attempt to evaluate previous taxonomic views. Available treatments of
Prescottia within country boundaries are the following: Barbosa-Rodrigues (1882 Brazil), Cogniaux (1895 - Brazil), Cogniaux (1907 - Brazil), Fawcett & Rendle (1910 Jamaica), Gale & Baldomero (1938 - Cuba), Hoehne (1945 - Brazil), Williams (1946 Panama), Williams (1951 - Mexico), Hodge (1953 - Dominica, British West Indies),
Schweinfurth (1958 - Peru), Dunsterville & Garay (1959 - Venezuela), Britton &
Millspaugh (1962 - Bahama), Correll (1965 - Guatemala and British Honduras),
Dunsterville & Garay (1965), Dunsterville & Garay (1966 - Venezuela), Schweinfurth
(1967 - Guayana), Adams (1972 - Jamaica), Garay & Sweet (1974 - Lesser Antilles),
121
Hamer (1974 – El Salvador), Pabst & Dungs (1975 - Brazil), Garay (1978 - Ecuador),
Hamer (1984 - Nicaragua), Hamer (1985 - Nicaragua), McVaugh (1985), Werkhoven
(1986 - Suriname), Ackerman (1989 - Puerto Rico and the Virgin Islands), Cremers &
Hoff (1992 - French Guiana), Ackerman (1995 - Puerto Rico and the Virgin Islands),
Gloudon & Tobisch (1995 - Jamaica), McLeish et al. (1995 Belize), Bennett &
Christenson (1998 - Peru), Serna & Ferrari (1998), Jørgensen & León-Yánez (1999 Ecuador), Balick et al. (2000 - Belize), Carnevali & Romero (2000 - Venezuela), Dix
& Dix (2000 - Guatemala), Carnevali et al. (2001 - Yucatan Peninsula, Mexico),
Feldmann & Barré (2001 - Guadeloupe), Stevens et al. (2001 - Nicaragua), Carnevali
et al. (2003), Hammel et al. (2003 – Costa Rica), and Ackerman (In press - Greater
Antilles).
The original publication of the genus spelled it as “Prescotia”. Since then and
until recently, the name was spelled double “t”, including subsequent writings of
Lindley himself. Azevedo & van den Berg (2005) proposed the conservation of the
two "t" spelling due to its common usage; the proposal has been approved (Brummitt
2007).
Prescottia Lindl., as here circumscribed, is a Neotropical genus comprising at
least 15 species of delicate to robust herbaceous, terrestrial or epiphytic plants,
extending from Florida (U.S.A.) through the West Indies to northeastern Argentina,
with the greatest diversity in Brazil. They inhabit mainly humid forests, usually in very
small populations. The genus presents rather variable morphological characters, and
species of difficult delimitation, for that reason many new species were described and
later became synonyms.
This study aim to provide a taxonomic revision of Prescottia, based on macroand micro-morphological data, presenting an identification key, descriptions,
illustrations, coments and discussion about morphological and taxonomic aspects,
besides providing geographic distribution data and maps for each species.
Materials and Methods
A bibliographic revision was carried out by surveying the general and classic
literature, mainly in the Library of the Royal Botanic Gardens - Kew and the New
York Botanical Garden, but also at the Botanische Staatssammlung München -
122
Munich, Muséum National d'Histoire Naturelle - Paris, The Natural History Museum London, and Naturhistorisches Museum Wien - Vienna.
Field studies. Many individuals of Prescottia were observed in Brazil (States of
Bahia, Minas Gerais, Espírito Santo, Rio de Janeiro, and São Paulo) and Costa Rica
in their natural habitats. Specimens were fixed in 70% ethanol. Ecological conditions
were registered during field work. These observations were important for expanding
information on character variation within and among populations of the genus.
Herbarium studies. Around 2.000 herbarium specimens from 82 herbaria were
examined. These included specimens from the following herbaria: AAU, ALCB*,
AMES, B, BAH, BBG, BHCB*, BM*, CAY, CEN, CEPEC*, CESJ, CGMS, CM, COL,
COR, CR*, CTES, CVRD, EAC, ESA*, ESAL, F, G, GFJP, GH, GUA, HAS, HASU,
HB*, HEPH, HMS, HRB*, HRCB, HUA, HUFU, HUEFS*, HURG, HXBH, IAC, IBGE,
ICN, INPA, IPA, JPB, K*, K–L*, LP, M*, MAC, MBM*, MBML*, MG, MO, MVFA, MVM,
NY*, P*, PACA, PAMG, PEL, PEUFR, PMSP, QCNE, R*, RB*, RBR, RPSC, RUSU,
S, SEL, SJRP, SMDB, SP*, SPF*, TEPB, UB, UEC*, UFMT, US, USJ*, VEN, VIC,
W* (acronyms according to Holmgren & Holmgren 1998). Specimens were studied
by visiting some of the herbaria (herbarium acronyms indicated with asterisk were
visited) or as loans to the Herbaria HUEFS, K and NY.
Databases. Voucher specimen informations were inserted in an Access database.
Taxonomic descriptions were created using the DELTA software package
(Description Language for Taxonomy).
Maps. Latitude and longitude attributes were gathered from the labels of herbarium
vouchers examined. Missing coordinate data from voucher specimens were assigned
after consulting geographic sites available on-line or maps (e.g. Google Earth).
Distribution maps for each taxon were prepared with ArcGis (Environmental Systems
Research Institute (ESRI) 2003). Maps were based on herbarium specimens
examined.
123
Descriptions. The dichotomous key proposed is artificial and therefore does not
intend to reflect evolutionary relationships. Species are listed alphabetically by
specific epithet. All specimens studied are cited in the list of specimens. Numeric
values are given in their normal ranges, with extreme values enclosed in
parentheses. Description of habit, color and information on distribution and ecology
were gathered from herbarium specimen labels and field observations. Illustrations
were made under stereoscopic microscope with a drawing tube, from fresh or
herbarium material.
Typification. Lectotypes were designated from the extant isotype(s) or syntype(s)
whenever appropiate. For a number of species no types were located, but line
drawings, published or not, based on type specimen were consulted, and selected as
lectotypes. For each case, the International Code of Botanical Nomenclature (McNeill
et al. 2006) was considered to make the appropriated decision.
Laboratory studies. A combination of stereoscopic microscope and scanning
electron microscopy (SEM) studies were conducted to investigate and document
both vegetative and reproductive features of Prescottia.
Micromorphology. For SEM study the flowers were dissected under a stereoscopic
microscope, and the isolated parts processed for SEM. Different floral segments from
dried and preserved specimens were dehydrated in an ethanol series, and critical
point dehydration. Small pieces of different floral parts (e.g. gynostemia and lip) were
mounted on stubs and gold sputter coated for SEM study, and examined under a
LEO 1430 VP - Carl Zeiss scanning electron microscope. SEM studies on pollen and
pollinaria were made using a non-acetolytic method to avoid destruction. Seeds from
naturally dehiscing capsules taken from dried specimens were examined under SEM
microscope. Images of the structures obtained under the SEM and light microscopes
were recorded digitally. Measurements were taken directly from the digital images.
MORPHOLOGY
Habit. Plants of Prescottia are primarily terrestrial, occasionally epiphytic, perennial
herbs. They are quite diverse in height. Some are not taller than 2.5 – 6.5 cm,
124
whereas others are nearly 1 m tall (including the inflorescence). The smallest species
is P. ostenii. In contrast, the tallest representatives are P. spiranthophylla and P.
stachyodes.
Habitat. Most Prescottia species are adapted to the warm, rainy, and humid
conditions of tropical rainforests. Some also occur in secondary zones including
landsides and roadsides, and rocky places near mountain summits. Reaching
elevations between sea level and 3.700 m.
Roots. The roots of Prescottia are fasciculate, elongate, cylindrical to fusiform,
extremely thick and fleshy, and pale-brown in color, and possess an indument of
persistent root hairs, usually described as pubescent, pilose, or villose.
Stem. The stem is very short or inconspicuous and located below or on the substrate
surface. The roots and terminal inflorescences develop from it.
Leaves. The leaves are green, ranging from light to dark-green, darker and glossier
on the adaxial surface, sometimes white on the margin or with longitudinal stripes,
(variegate).They are basal, and usually form a rosette, and are soft, herbaceous to
coriaceous, sometimes fleshy, and glabrous. The leaves are exceedingly variable in
shape and length. The species have lanceolate, elliptic, oblong, or linear to obovate
leaves, blades up to 45 cm long, which are sessile or short to long petiolate. The
blades have entire or serrulate margin. The leaves may attain lengths of over 45 cm
and widths of 15 cm. There is a great variation in the length and width of leaves
throughout the genus and species.
Inflorescence. The inflorescence is terminal, long- or short-pedunculate and
glabrous. The inflorescence is densely many-flowered or loosely few-flowered, short
or long spike, and ranges from erect to pendulous. Prescottia spiranthophylla and P.
stachyodes exhibits the longest inflorescences in the genus, whereas P. ostenii
produces the shortest ones.
125
Flowers. The flowers of Prescottia are hermaphroditic, small, non-resupinate, spirally
arranged, each one subtended by a bract. Flower opening starts from the base to the
apex (acropetal). Their predominant colours are green, white, and yellow. The floral
bracts are ovate or lanceolate, with acute to acuminate apex. They are clasping to
the base of the ovary, and are shorter or longer than the flowers. Sepals are basally
connate and form a short cup. They are erect to reflexed or revolute. Petals are
variable in shape, but usually ovate or linear and free, erect to reflexed or revolute.
The lip is simple with entire margins, hood-shaped or cucullate [e.g. P. oligantha
(Azevedo 329) and P. phleoides (Azevedo 344) Fig. 1 A-B], rare with a prominent
and ondulate margin [P. glazioviana (Leoni 5280) Fig. 1 C-D]. It has nectariferous
glands at its base [e.g. P. phleoides (Azevedo 344) and P. ostenii (Singer 2006/21)
Fig. 1.E-F]. The lip inner surface is glabrous [e.g. P. mucugensis (Azevedo 253) Fig.
1 G; P. glazioviana (Leoni 5280) Fig. 1 H; P. stachyodes (Azevedo 288) Fig. 2 A-B]
or pilose [e.g. P. densiflora (van den Berg 1417) Fig. 2 C-D; P. lancifolia (Bocayuva
198) Fig. 2E-F; P. oligantha (Azevedo 329) Fig 2 G-H; P. ostenii (Singer 2006/21)
Fig. 3 A-B]. The outer surface is smooth or densely minute-papillose [e.g. P.
spiranthophylla (Azevedo 270) Fig. 3 C-D], glabrous or with trichomes at the base
[e.g. P. plantaginifolia (Azevedo 263) Fig. 3 E; P. spiranthophylla (Azevedo 270) Fig.
3 F].
Gynostemium. The column or gynostemium is erect, blunt, and short. The dorsal
surface of the column is glabrous [e.g. P. phleoides (Azevedo 344) and P. ostenii
(Singer 2006/21) Fig. 3 G-H] or covered by trichomes [e.g. P. plantaginifolia
(Azevedo 263) Fig. 4 A-B; P. spiranthophylla (Azevedo 270) Fig. 4 C-D]. Column foot
is absent. The anther is erect, motile, ovate to oblong, opening laterally to the center
of the flower, and two-locular. The anther is parallel to the axis of the column, firmly
attached to a short, thick filament [e.g. P. leptostachya (Azevedo 250) and P.
stachyodes (Azevedo 288) Fig. 4 E-F]. The rostellum is laminar and thin. The stigma
is horizontal, relatively small, ovate, and flat to convex [e.g. P. densiflora (van den
Berg 1417) Fig. 4 G; P. oligantha (Azevedo 329) Fig. 4 H; P. plantaginifolia (Azevedo
263) Fig. 5 A; P. phleoides (Azevedo 344) Fig. 5 B; P. montana (Azevedo 324) Fig. 5
C; P. stachyodes (Azevedo 288) Fig. 5 D]. The hamulus is absent. There are two
appendages on the column apex [e.g. P. oligantha (Azevedo 329) Fig. 5 E-F; P.
126
montana (Azevedo 324) Fig. 5 G; P. phleoides (Azevedo 344) Fig. 5 H], which can
be wide or reduced, and could be interpreted as staminodes (Kurzweil 1988).
Pollinaria and Pollen
The pollinia are four (two-bipartite), oblong-ovoid, powdery or soft, without
caudicles, and yellow in color [e.g. P. oligantha (Azevedo 329) Fig. 6 A]. They are
adnate to a single terminal brown viscidium [e.g. P. oligantha (Azevedo 329) Fig. 6 B;
P. phleoides (Azevedo 344) Fig. 6 C-D], which is small, detachable, oval, and very
sticky.
The pollen grains are arranged in tetrads [e.g. P. oligantha (Azevedo 329) Fig.
6 E; P. phleoides (Azevedo 344) Fig. 6 F], elastoviscine was observed between
tetrads [e.g. P. densiflora (van den Berg 1417) Fig. 6 G; P. phleoides (Azevedo 344)
Fig. 6 H, 7 A-B], as showed by Schill & Wolter (1986) and by Burns-Balogh (1987) to
Prescottia stachyodes. The pollen has reticulate exine, with smooth walls [e.g. P.
phleoides (Azevedo 344) and P. stachyodes (Azevedo 288) Fig. 7 C-D], similarly
documented by Schill & Pfeiffer (1977) to Prescottia plantaginifolia. Germinated
pollen was observed in the anther cavity [e.g. P. stachyodes (Azevedo 288) Fig. 7 EF].
Ovary. The ovary is unilocular, usually ovoid, with three longitudinal ridges
externally. The single locule contains numerous small ovules and the placentation is
parietal. The pedicel is absent.
Fruits. The fruits are capsules, bearing the persistent remnants of the floral
segments. Young fruits are light green, whereas mature fruits are medium to dark
brown.
Seeds. Seeds of this genus are diverse and lack distinctive generic characters. They
are very small, and dust-like in appearance. They are usually fusiform, golden brown,
ranging from 270 – 950 µm, with about three to nine cells in wide, and are covered by
a smooth seed coat that surrounds a minute embryo.
The species studied here are represented by oblong to linear seeds, some
have no intercellular spaces, in others triangular intercellular spaces are found at the
127
angles of the testa cells, or circular intercellular spaces around the testa cells are
present. That can be observed in Prescottia carnosa [Fig. 8 A-B (Steyermark
59772)], P. ecuadorensis [Fig. 8 C-D (Madsen 86457)], P. lancifolia [Fig. 8 E-F (Silva
3758)], P. leptostachya [Fig. 8 G-H (CFCR 7308)], P. lojana [Fig. 9 A-B (Holst 3522)],
P. montana [Fig. 9 C-D (Azevedo 287)], P. oligantha [Fig. 9 E-F (Hatschbach 6475)],
P. ostenii [Fig. 9 G-H (Osten 22939)], P. phleoides [Fig. 10 A-B (Azevedo 344)], P.
plantaginifolia [Fig. 10 C-D (Mori 10702)], and P. spiranthophylla [Fig. 10 E-F
(Mulford 881)].
In Prescottia stachyodes its anticlinal walls of the testa cells are more or less
partly splitted forming a series of small fusiform intercellular spaces with beaded
appearance (Fig. 10 G-H, 11 A-H). The length of the seeds varies between
specimens, but in width there is no marked difference. It differs from all species of the
genus. Different morphs from different locations were examined. From Brazil, three
different size samples were scanned, an intermediate size from Rio de Janeiro [Fig.
10 G-H (Azevedo 318)], a taller one from São Paulo [Fig. 11 C-D (Kuhlmann 2742)],
and a smaller from Espírito Santo [Fig. 11 E-F (Oliveira 842)]. Samples of different
size from Jamaica were observed, a morph as “P. pellucida Lindl.” [Fig. 11 A-B
(Harris 10096)], and another as “P. cordifolia Rchb. f.” [data not shown (Maxon 943)].
A small specimen from Mexico was seen [Fig. 11 G-H (Raven 19994)]. A type of “P.
petiolaris” (Callejas 9672) from Colombia, a sample from Venezuela (Steyermark
103947) and another from Ecuador (Alvarez 2862) were also observed (data not
shown).
Cytogenetics
The chromosomes in Prescottia are small, variable in number (n = 48 or 2n =
48) and homogeneous or not in size. Some species (P. leptostachya and P.
stachyodes) has a bimodal karyotype, with one pair of chromosomes significantly
larger than the rest (Felix & Guerra 2005). Felix & Guerra (2005) suggested a strong
affinity between the subtribes Prescottiinae, Spiranthinae, and Cranichidinae,
because the three share the bimodal chromosome size associated with the basic
numbers x = 23, 24.
Ecology
128
Species of the genus are remarkable for their broad ecological tolerance and
phenotypic plasticity (Ackerman 2000). The genus has been noted as growing in the
understory of moist and wet montane forests at low to high elevations, from sea level
to 3.700 meters. Most plants occur in the shade of shrubs. Flowering and fruiting
specimens have been collected the whole year.
Reproductive biology
Ackerman (2003) suggested that some Central American species of Prescottia
were autogamous. Singer & Cocucci (1999) reported that Prescottia densiflora
(Brongn.) Lindl. is pollinated by halictid bees (Halictidae). The pollinaria are
deposited on the bees proboscis while probing the flowers for nectar, and are
removed when the insect leaves the flower, visiting another flower it will brush the
stigmatic surface and leave clumps of pollen. Flies of the family Syrphidae are
secondary pollinators. Posteriorly, Singer & Sazima (2001) verified that P. densiflora,
P. stachyodes (Sw.) Lindl. and P. plantaginifolia Lindl. ex Hook. are self-compatible
but pollinator-dependent. Pollination by halictid bees was confirmed for P. densiflora
and moth-pollination was registered for P. stachyodes and P. plantaginifolia. Besides
that, protandry was reported for P. stachyodes and P. montana Barb. Rodr. (Singer &
Sazima 2001).
129
A
B
C
D
E
F
G
H
Figure 1. SEM micrographs of Prescottia cucullate lip. A. P. oligantha (Azevedo 329).
B. P. phleoides (Azevedo 344). C-D. P. glazioviana lip, with prominent and ondulate
margin (Leoni 5280). Nectariferous glands at lip base. E. P. phleoides (Azevedo
344). F. P. ostenii (Singer 2006/21). Lip inner surface. G. P. mucugensis (Azevedo
253). H. P. glazioviana (Leoni 5280).
130
A
B
C
D
E
F
G
H
Figure 2. SEM micrographs of Prescottia lip inner surface. A-B. P. stachyodes
(Azevedo 288). C-D. P. densiflora (van den Berg 1417). E-F. P. lancifolia (Bocayuva
198). G-H. P. oligantha (Azevedo 329).
131
A
B
C
D
E
F
G
H
Figure 3. SEM micrographs of Prescottia lip inner and outer surface, and column. AB. Lip inner surface of P. ostenii (Singer 2006/21). C-D. Lip outer surface of P.
spiranthophylla (Azevedo 270). Lip outer surface with trichomes at the base. E. P.
plantaginifolia (Azevedo 263). F. P. spiranthophylla (Azevedo 270). Dorsal surface of
the column. G. P. phleoides (Azevedo 344). H. P. ostenii (Singer 2006/21).
132
A
B
C
D
E
F
G
H
Figure 4. SEM micrographs of Prescottia column. Dorsal surface of the column,
covered by trichomes. A-B. P. plantaginifolia (Azevedo 263). C-D. P. spiranthophylla
(Azevedo 270). Anther. E. P. leptostachya (Azevedo 250). F. P. stachyodes
(Azevedo 288). Stigma. G. P. densiflora (van den Berg 1417). H. P. oligantha
(Azevedo 329).
133
A
B
C
D
E
F
G
H
Figure 5. SEM micrographs of Prescottia stigma and staminodes. Stigma. A. P.
plantaginifolia (Azevedo 263). B. P. phleoides (Azevedo 344). C. P. montana
(Azevedo 324). D. P. stachyodes (Azevedo 288). Staminodes. E-F. P. oligantha
(Azevedo 329). G. P. montana (Azevedo 324). H. P. phleoides (Azevedo 344).
134
A
B
C
D
E
F
G
H
Figure 6. SEM micrographs of Prescottia pollinaria and pollen. A. Pollinaria of P.
oligantha (Azevedo 329). Viscidium. B. P. oligantha (Azevedo 329). C-D. P.
phleoides (Azevedo 344). Pollen tetrads. E. P. oligantha (Azevedo 329). F. P.
phleoides (Azevedo 344). Elastoviscine. G. P. densiflora (van den Berg 1417). H. P.
phleoides (Azevedo 344).
135
A
B
C
D
E
F
Figure 7. SEM micrographs of Prescottia pollen. Elastoviscine. A-B. P. phleoides
(Azevedo 344). Pollen exine. C. P. phleoides (Azevedo 344). D. P. stachyodes
(Azevedo 288). Germinated pollen. E-F. P. stachyodes (Azevedo 288).
136
A
B
C
D
E
F
100 µm
G
H
10 µm
Figure 8. SEM micrographs of Prescottia seed morphology. A-B. P. carnosa
(Steyermark 59772). C-D. P. ecuadorensis (Madsen 86457). E-F. P. lancifolia (Silva
3758). G-H. P. leptostachya (CFCR 7308).
137
A
B
100 µm
C
D
100 µm
20 µm
E
F
G
H
20 µm
Figure 9. SEM micrographs of Prescottia seed morphology. A-B. P. lojana (Holst
3522). C-D. P. montana (Azevedo 287). E-F. P. oligantha (Hatschbach 6475). G-H.
P. ostenii (Osten 22939).
138
100 µm
100 µm
A
B
C
D
E
F
G
100 µm
H
20 µm
Figure 10. SEM micrographs of Prescottia seed morphology. A-B. P. phleoides
(Azevedo 344). C-D. P. plantaginifolia (Mori 10702). E-F. P. spiranthophylla (Mulford
881). G-H. P. stachyodes (Azevedo 318).
139
A
B
C
D
100 µm
E
F
G
H
20 µm
Figure 11. SEM micrographs of Prescottia stachyodes seed morphology. A-B. (Harris
10096). C-D (Kuhlmann 2742). E-F (Oliveira 842). G-H (Raven 19994).
140
Systematic treatment
Prescottia Lindl., Exot. fl. 2(13): t. 115. 1824. nom. cons. (‘Prescotia’). Type: P.
plantaginifolia Lindl. ex Hook.
= Decaisnea Brongn., Voy. monde 1: 192. 1829.
Herbs terrestrial or epiphytic, erect. Roots fasciculate, fleshy, cylindric, villous. Stems
short, erect, largely concealed by roots. Leaves non-articulate, basal, petiolate or
sessile, petioles sheathing at base, membranaceous to coriaceous, blades entire,
lanceolate, elliptic, oblong, or linear to obovate with an entire or serrate margin.
Inflorescences terminal, erect to nodding, peduncles partially covered by sheathing
bracts, spike many-flowered. floral bracts ovate to lanceolate, acuminate or acute,
clasping the base of the ovary. Flowers sessile, non-resupinate; sepals thin, lateral
sepals basally connate forming a sepaline cup, erect, erect to reflexed; petals thin,
narrow, erect to reflexed; labellum uppermost in flower, entire, fleshy, adnate to the
sepaline cup, with nectary at the base, deeply concave, cucullate, inner surface
glabrous to pilose, enclosing the column; column minute, blunt, erect, short, glabrous
to puberulent, bearing two lateral, staminode-like appendages, stigmatic surface
entire, anther dorsal, erect, oblong-ovate, pollinia 4, yellow, soft, mealy, slightly
flattened, with a terminal disc-like viscidium, pollen in tetrads, exine reticulate,
caudicles absent. Fruit capsule, ovoid to ellipsoidal.
DISTRIBUTION. From Florida (U.S.A.) through the West Indies to northeastern
Argentina. Map 1.
ETYMOLOGY. The generic name honours the British botanist John D. Prescott (?1837), who resided in St. Petersburg during the 1800’s (Schultes & Pease 1963) and
sent plants to England (Ackerman 2003).
141
Map 1. Geographical distribution map of Prescottia species.
142
Key to the species of Prescottia
1. Lip with inner surface glabrous
2. Lateral sepals erect to adpressed to the lip
3. Petal apex truncate; lip apex prominent with ondulate margin ........................
......................................................................................... Prescottia glazioviana
3’. Petal apex not truncate; lip apex non prominent without undulate margin
4. Inflorescence loose; sepals and petals greenish, with some brown; lip
whitish to yellowish, 1.2 – 1.5 mm long ...................... Prescottia mucugensis
4’. Inflorescence congest; sepals and petals pale green; lip green, at least 2.5
mm long
5. Leaves 2-3, sessile or pseudopetiolate; lip 2.5 – 4 mm long ...................
.................................................................................... Prescottia phleoides
5’. Leaves 1(2), clearly petiolate; lip 4 – 4.8 (-6.6) mm long ........................
..................................................................................... Prescottia montana
2’. Lateral sepals reflexed to revolute
6. Leaf sessile or pseudopetiolate
7. Inflorescence congest; sepals and petals whitish, lip green .........................
................................................................................ Prescottia spiranthophylla
7’. Inflorescence loose; sepals, petals and lip greenish ...................................
................................................................................. Prescottia plantaginifolia
6’. Leaf clearly petiolate
8. Petiole 1.5 – 2 cm long; lateral sepals reflexed (with distal part adpressed
to ovary) ..................................................................... Prescottia leptostachya
8’. Petiole more than 2 cm long; lateral sepals revolute
9. Flowers almost patent; lip with a keel or septum ...... Prescottia carnosa
9’. Flowers erect; lip without a keel or septum
10. Leaf deltoid ............................................... Prescottia ecuadorensis
10’. Leaf elliptic to ovate
11. Leaf ovate; lip with prominent midvein .......... Prescottia lojana
11’. Leaf elliptic to ovate; lip without prominent midvein ..................
..................................................................... Prescottia stachyodes
1’. Lip with inner surface pilose
143
12. Inflorescence nodding ......................................................... Prescottia lancifolia
12’. Inflorescence erect
13. Leaf sessile to pseudopetiolate; inflorescence congest
14. Rachis 1.0-2.0 cm long; lip 1.5-1.7 mm long; leaf sessile ........................
.......................................................................................... Prescottia ostenii
14’. Rachis 5.0-14.0 cm long; lip 1.7-2.4 mm long; leaf sessile to
pseudopetiolate ........................................................... Prescottia densiflora
13’. Leaf petiolate; inflorescence loose .............................. Prescottia oligantha
144
1. Prescottia carnosa C. Schweinf., Fieldiana, Bot. 28(1): 173, fig. 28, 1951.
[Schweinfurth 1967]. Protologue: “Type in Chi. Nat. Hist. Mus., no. 1203753,
Ptaritepui, state of Bolivar, alt. 2200 m, November 2, 1944, Julian A. Steyermark
59772.” Type: Venezuela: Bolivar, Ptari-tepui, Steyermark 59772 (holotype F!). Fig.
12.
Terrestrial herb. Leaves 3, basal to rosulate, long-petiolate; petiole 5.0-9.2 cm long,
rose-red; blade 4.7-5.3 cm long, 2.3-3.0 cm wide, coriaceous, elliptic to ovate, deep
green, apex acute, base truncate to rounded, margin entire. Inflorescence loose, 3035-flowered; peduncle ca. 41.5 cm long, cylindric, rose-red; peduncle bracts 8-13,
10.0-30.0 mm long, 5.0 mm wide, ovate, apex acute; rachis 8.5-11.0 cm long, 1.31.5 cm wide, rose-red. Flower bracts ca. 0.5 mm long, 0.4 mm wide, ovate, apex
acuminate; flower almost patent, tawny-yellow and salmon; dorsal sepal strongly
revolute, 2.5-3.0 mm long, 1.0-1.2 mm wide, submembranaceous, lanceolate-oblong
to oblong, tawny-yellow and salmon, apex obtuse; lateral sepals strongly revolute,
3.2-3.5 mm long, 1.5-1.8 mm wide, submembranaceous, triangular-oblong, tawnyyellow and salmon, apex rounded; petals strongly revolute, 2.4-2.6 mm long, 0.70.9 mm wide, submembranaceous, linear, tawny-yellow and salmon, apex obtuse; lip
3.5 mm long, 3.0-3.2 mm wide, fleshy, tawny-yellow and salmon, divided in the
middle by a prominent but short longitudinal keel, inner surface glabrous, outer
surface densely minute-papillose. Column 0.8-1.0 mm long, glabrous.
DISTRIBUTION. Venezuela and Guyana. Map 2.
GUYANA, Potaro-Siparuni Region. Mt. Ayanganna, camp on summit plateau
23/07/2001, Clarke, H.D. 9458 (US); VENEZUELA, Bolívar, Ptari-tepui 02/11/1944,
Steyermark, J.A. 59772, Holotype, Prescottia carnosa C. Schweinf. (F); Bolívar,
Expedición Auyan-tepui. At base of moist zanjon below (north of) El Libertador
15/05/1964, Steyermark, J.A. 93962 (GH); Territorio Federal Amazonas*, Cerro
Sipapo (Paráque), Territorio Amazonas 01/01/1949, Maguire, B. 28092 (NY).
HABITAT. Occur in grasslands on summit plateaus, at elevations between 1.400 and
2.300 m.
145
CONSERVATION STATUS. Vulnerable (VU – D2). This taxon is known to exist at no
more than five locations, represented only from four herbarium collections (see
above).
ETYMOLOGY. From the Latin carnosus (= fleshy), probablly a reference to the very
fleshy lip.
NOTES. Prescottia carnosa is poorly known and rarely collected. No sample of this
species was included for the molecular studies (Chapter 2), but this taxa might be
expected to form a sister relationship with P. stachyodes (Sw.) Lindl., because it also
have long petiolate leaves, flowers with the inner surface of the lip glabrous.
Prescottia carnosa is distinguished from all other species of the genus by the
longitudinal keel or septum in the center of the fleshy lip. Another remarkable
character of this taxon is the flower position, which is almost patent.
146
C
6 mm
4 mm
A
2 cm
B
4 mm
3 mm
D
1 mm
E
F
Figure 12. Prescottia carnosa. A. Habit. B. Flower, front view. C. Floral bract. D.
Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal sepal. E-F. Column.
E. Ventral view. F. Dorsal view. (Steyermark 59772).
147
Map 2. Geographical distribution map of Prescottia carnosa, P. ecuadorensis, and P.
lojana.
148
2. Prescottia densiflora (Brongn.) Lindl., Ann. Mag. Nat. Hist. 1, 6 (34): 52. 1840.
[Cogniaux 1895; Brade & Pabst 1952; Pabst & Dungs 1975]. ≡ Decaisnea densiflora
Brongn., Voy. Coq. Bot. 192 (1): 39. 1829. [Lindley 1840b; Cogniaux 1895; Hoehne
1945; Govaerts 2004] Protologue: “L'ile Sainte-Catherine au Brésil”, without collector
or date. Type: Brazil: Santa Catarina, A. Brongniart s.n. (lectotype K-L!; isolectotype
P! (selected by Azevedo & van den Berg 2007a). Fig. 13.
Terrestrial herb. Leaf (3-)5-8; basal to rosulate; sessile to pseudopetiolate; petiole
1.0-2.0 cm long, green, blade 3.0-6.0(-8.0) cm long, 1.8-3.0(-4.8) cm wide,
coriaceous, elliptic to lanceolate, apex acute, base attenuate to obtuse, green,
margin entire. Inflorescence dense, 50-150-flowered; peduncle 12.0-23.0(-30.0) cm
long, 0.2-0.4 cm wide, cylindric, green; peduncle bracts 4-6, 10.0-35.0 mm long; 3.05.0 mm wide, ovate, apex acute to acuminate, green; rachis 5.0-14.0 cm long, 0.71.0 cm wide, green. Flower bracts 3.7-4.4 mm long, 1.2-1.6 mm wide, lanceolate to
ovate, apex acuminate to acute, green; flower erect, white, dorsal sepal revolute, 1.72.2 mm long, 1.0-1.1 mm wide, submembranaceous, ovate to triangular, white with
purplish-brown spot at the apex, apex acute; lateral sepals patent, 2.6-3.3 mm long,
1.2-1.4 mm wide, submembranaceous, ovate, white with purplish brown spot at the
apex, apex acute; petals revolute, 1.6-2.0 mm long, 0.5-0.6 mm wide,
submembranaceous, linear, white, apex obtuse to acute; lip 1.7-2.4 mm long, 2.02.3 mm wide, membranaceous, white, inner surface pilose. Column 1.0-1.1 mm long,
glabrous.
DISTRIBUTION. Restricted to Brazil. Occurs at Rio de Janeiro, São Paulo, Paraná,
Santa Catarina and Rio Grande do Sul. Map 3.
BRAZIL, Monte Negro s.d., s.n. (PACA43873); s.l., s.d., Bicalho, H.D. 05 (SP); By
the aquaduct near Rio, 08/1836, Gardner s.n. (K); s.l., s.d., M.P. 4235 (MBM);
Paraná, Guaratuba, Praia do Mendanha 24/09/1967, Hatschbach, G. 17205 (MBM);
Guaratuba, Brejatuba, 13/08/1950, Hatschbach, G. 210 (MBM); Paranaguá, Bela
Mar de Dentro, Ilha do Mel, 04/10/1986, Silva, S.M. 25651 (MBM); Rio de Janeiro,
Cabo Frio, Praia Grande, 21/12/1982, Miranda, F.E. 100 (GUA); Cabo Frio, Road
between Araruama Lagoon and the main road Cabo Frio-Arraial do Cabo,
149
16/08/1953, Restinga I 865 (K, R); Rio Grande do Sul, 45 km ao S de Porto Alegre,
Morro do Coco, 26/09/1973, Lindeman, J.C. s.n. (ICN24372); Itacolomi, 14/08/1976,
Waechter, J.L. s.n. (ICN32452); Cachoeira, 20/11/1953, Pivetta 490 (B); Guaíba,
Cerro do Poeta, Fazenda Maximiano, Passo do Petim (BR 116), propriedade do Sr.
Nelson Ivo Matzenbacher, 12/11/1993, Nunes, V.F. 1370 (ICN); Monte Negro,
Campo limpo C-CAU 7, 29/09/1977, Bueno, O. 925 (HAS); Pelotas, 10º Distrito
Colônia Oliveira, 09/11/1973, Sacco, J.C. 8745 (PEL); Porto Alegre, Jardim Botânico
de Porto Alegre, 11/11/1988, Haussen, M. s.n. (HASU836); Porto Alegre, Monte
Serrado, 15/10/1942, Irmão Augusto 3785 (ICN); Porto Alegre, Vila Manresa/M. da
Gloria, 07/07/1931, Orth, L. s.n. (PACA1712); Porto Alegre, 28/10/1931, Orth, P.
Canisio s.n. (ICN132855); São Leopoldo, Morro das Pedras, 20/10/1927, Dutra, J.
945 (HUEFS, ICN); São Leopoldo, 12/10/1929, Dutra, J. 970 (ICN); São Leopoldo,
10/1941, Leite, J.E. 205 (SP); Torres, Morro Azul, 21/10/1977, Waechter, J.L. 641
(ICN); Santa Catarina, s.d., Brongniart, A. s.n., isolectotype, Decaisnea densiflora
Brongn. (P00366650); s.l., s.d., Brongniart, A. s.n., lectotype, Decaisnea densiflora
Brongn. (P00366650); Guará-Mirim, 29/09/1947, Hans, D. 189 (R); Ubatuba, beira
da praia, 14/11/1949, Hans, D. 242 (R); Florianópolis, Praia dos Ingleses,
11/10/1993, Bueno, O. 6275 (HAS); Florianópolis, Ponta Sul, Ilha do Campeche,
16/10/1982, Silva, F.A. 30 (MBM); Florianópolis, Ilha de Santa Catarina, 20/10/1979,
Yano, O. 2292 (SP); Timbé do Sul, na subida da Serra da Rocinha, 12/11/1987,
Silveira, N. 5002 (HAS); São Paulo, São Paulo, Parque do Estado, 26/10/61, Brolio,
P. 18 (SP); Ubatuba, Parque Estadual da Ilha Anchieta, 08/1999, Smidt, E.C. 63
(SJRP).
HABITAT. Prescottia densiflora is light-tolerant and occurs in humid, though welldrained soils in open areas.
CONSERVATION STATUS. Not endangered.
ETYMOLOGY. Probablly a reference to the dense inflorescence, with many flower
and very congest. From the Latin densus = congest, and flora or flos = flower.
NOTES. Prescottia densiflora is characterized by elliptic leaves, sessile to
pseudopetiolate, and lip internally pilose. Morphologically, Prescottia densiflora is
very similar to P. oligantha. Otherwise Wiggins & Porter (1971) considered it as
synonym of P. oligantha. The morphological extremes are well delimited, but
intermediate specimens make the delimitation among them very hard. The type of
150
Prescottia densiflora is a morphological extreme, and can be easily distinguished by
its sessile leaves and congest inflorescence. Phylogenetically it is close related to the
others species of whitish flowers and lip internally pilose (P. lancifolia, P. oligantha,
and P. ostenii), being more closely related with P. lancifolia and P. ostenii (Chapter
1).
The IPNI cites that the new combination of Decaisnea densiflora was made at
1841, but the number 34 of the “Annals and Magazine of Natural History” was
published in 1840 (Lindley 1840b). The latter and “The genera and species of
orchidaceous plants” (Lindley 1840a) were published in September 1840, but the
second one, already cites Prescottia densiflora (Brongn.) Lindl., as published at
Annals and Magazine of Natural History (Lindley 1840b), for this reason, we believe
that the combination was published on it.
There are two type specimens of Decaisnea densiflora, one at P and another
at K-L, both annotated with the same information given in the protologue. When
Lindley (1840b) transferred D. densiflora to Prescottia, he said that Brongniart gave a
specimen to him. The specimen given to Lindley has the original illustration, and was
designated as the lectotype of D. densiflora by Azevedo & van den Berg (2007a).
151
1 mm
C
B
1 mm
1 mm
D
E
0.2 mm
A
H
0.2 mm
F
G
Figure 13. Prescottia densiflora. Drawn from fresh material. A. Habit. B-C. Flower. B.
Dorsal view. C. Front view. D. Floral bract. E. Perianth parts, clockwise from top: lip,
dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F. Dorsal
view. G. Ventral view. H. Pollinarium. (van den Berg 1417).
152
Map 3. Geographical distribution map of Prescottia densiflora.
153
3. Prescottia ecuadorensis C.O. Azevedo & Van den Berg. sp. nov. Typus:
Ecuador, Province Loja, Parque Nacional Podocarpus. Vicinity of Lagunas de
Compadre, ca. 6 hours walking from centro de Información. 21.nov.1989. J.E.
Madsen & A.B. Pedersen 86457 (Holotype MO4645295). Fig. 14-15.
Terrestrial herb. Leaf at least 2, basal, petiolate; petiole 3.2-3.5 cm long; blade 3.74.0 cm long, 2.7-3.3 cm wide, fleshy to coriaceous, deltoid, apex acute, base
truncate, margin serrulate to entire. Inflorescence dense, at least 55-flowered;
peduncle at least 19.0 cm long, 0.4-0.5 cm wide; peduncle bracts at least 6, 20.040.0 mm long, 8.0-10.0 mm wide, ovate, apex acute; rachis at least 8.0 cm long; at
least 1.2 cm wide. Flower bracts 5.9-6.1 mm long, 2.2-2.5 mm wide, ovate, apex
acute; flower erect; dorsal sepal strongly revolute, 2.9-3.2 mm long, at least 1.0 mm
wide, lanceolate to oblong, apex obtuse; lateral sepals strongly revolute, 3.7-4.0 mm
long, 1.0-1.2 mm wide, lanceolate to ovate, apex obtuse; petals strongly revolute,
2.9-3.0 mm long, at least 0.8 mm wide, linear, apex obtuse; lip 3.0-3.5 mm long, 1.82.3 mm wide, fleshy, midvein prominent, inner surface glabrous. Column at least
2.0 mm long, glabrous.
DISTRIBUTION. Occurs in Loja, Ecuador. Map 2 (p. 148).
ECUADOR, Loja, Lagunas de Compadre, Parque Nacional Podocarpus, ca. 6 hours
walking from centro de Information. 21/11/1989, Madsen, J.E. 86457, holotype,
Prescottia ecuadorensis C.O. Azevedo & Van den Berg. (MO).
HABITAT. Ridge top vegetation of elfin forest and paramos, between elevations of
3.000 - 3.400 m.
CONSERVATION STATUS. Vulnerable (VU – D2). It is known to exist at only a
single location, represented by only a single specimen.
ETYMOLOGY. In reference to the country where the type specimen was collected.
NOTES. There are two specimen of Madsen & Pedersen 86457, one at MO (Fig. 4),
and the other at AAU, which are different, the one in AAU is a specimen of Prescottia
lojana, and it was cited at the P. lojana’s original description (Dodson 1996) as other
specimen seen, however only the AAU material was cited in the protologue. Although
154
the MO material is determinate by Dodson, we believe he did not saw it. First
because he did not cite it at the P. lojana’s protologue, and second, because it has
not his handwriting determination, as at AAU. It means that the MO material could be
identified as P. lojana only because it is a duplicate of the AAU material, cited at the
P. lojana’s protologue.
This species was not available for the molecular studies, although, it appears
to be related to Prescottia carnosa, P. lojana and P. stachyodes. Morphologically
Prescottia ecuadorensis is most closely related with P. lojana Dodson, P. carnosa
and P. stachyodes (Sw.) Lindl. Prescottia ecuadorensis can be distinguished from
these taxa by its leaves, inflorescence, and flowers. Prescottia ecuadorensis can be
also distinguished from these by its seeds. Prescottia carnosa presents oblong seeds
with triangular intercellular spaces at the angles of the testa cells [Fig. 16. 1-2
(Steyermark 59772)], while in P. lojana its intercellular spaces are circular, and
around the testa cells [Fig. 16. 3-4 (Holst 3522)]. Prescottia ecuadorensis seeds are
fusiform, without intercellular spaces [Fig. 16. 5-6 (Madsen & Pedersen 86457)],
whether P. stachyodes has linear seeds, its anticlinal walls of the testa cells are more
or less partly splitted forming a series of small fusiform intercellular spaces with
beaded appearance [Fig. 16. 7-8 (Harris 10096)].
155
1 mm
2 mm
D
C
B
2 cm
1 mm
A
E
2 mm
F
G
Figure 14. Prescottia ecuadorensis. A. Habit. B. Flower, front view. C. Floral bract. D.
Lip. E. Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal sepal. F-G.
Column. F. Dorsal view. G. Ventral view. (Madsen & Pedersen 86457).
156
Figure 15. Holotype of Prescottia ecuadorensis (Madsen & Pedersen 86457) at the
Missouri Botanical Garden Herbarium (MO).
157
1
2
3
4
5
6
7
8
Figure 16. SEM micrographs of Prescottia seed morphology. 1 -2 P. carnosa
(Steyermark 59772). 3-4 P. lojana (Holst 3522). 5-6 P. ecuadorensis (Madsen &
Pedersen 86457). 7-8 P. stachyodes (Harris 10096).
158
4. Prescottia glazioviana Cogn. in Mart., Fl. Bras. 3(4): 261. 1895. [Cogniaux 1907;
Rizzini 1954; Pabst & Dungs 1975]. Protologue: “Habitat ad cacumen mont. Itatiaia in
Campo de Silverio prov. Rio de Janeiro: Glaziou n. 6729 in herb. Berol. non alior; ad
Serra dos Órgãos: Gardner 5884 in herb. Berol. et Kew.” Type: Brazil: Rio de
Janeiro, Summit of Órgão Mountains, Gardner 5884, March 1841 (Lectotype K-L!;
isolectotype K! (Benthamianum); K! (Hookerianum); BM!; R! (selected by Azevedo &
van den Berg 2007a). Fig. 17.
Terrestrial herb. Leaves 1(-2), basal, petiolate; petiole 2.0-5.5 cm long, green; blade
7.0-14.0 cm long, 3.0-6.8 cm wide, membranaceous, elliptic to oblong, deep green,
apex acute, base rounded, margin entire. Inflorescence loose, 10-20-flowered;
peduncle 10.0-17.0(-28.0) cm long, 0.2-0.5 cm wide, cylindric, green; peduncle
bracts 2-3, 17.0-40.0 mm long, 6.0-10.0 mm wide, ovate to lanceolate, apex acute;
rachis (5.0-)7.0-9.0(-15.0) cm long, 0.8-1.2 cm wide, green. Flower bracts 5.010.0 mm long, 1.0-3.5 mm wide, ovate, green, apex acuminate to acute; flower erect,
green; dorsal sepal reflexed, 3.0-4.0 mm long, 2.0-2.5 mm wide, membranaceous,
oblong, green, apex obtuse; lateral sepals adpressed to the lip, 5.0-5.5 mm long, 2.02.5 mm wide, membranaceous, ovate to oblong, green, apex obtuse to acute; petals
adpressed to the lip, 4.0-4.5 mm long, 0.7-1.5 mm wide, membranaceous, trullate,
green, apex truncate; lip 3.5-5.0 mm long, 2.7-4.0 mm wide, membranaceous, green,
inner surface glabrous, outer surface densely minute-papillose. Column 1.5-2.0 mm
long, glabrous.
DISTRIBUTION. Restricted to Brazil, occurs in Rio de Janeiro and was recently
found in Minas Gerais (Azevedo et al. submitted a, Chapter 2). Map 4.
BRAZIL, s.d., 24919 (F1026720); Minas Gerais, Alto Caparaó, Parque Nacional,
02/04/2003, Leoni, L.S. 5280 (GFJP, HUEFS); Alto Caparaó, Parque Nacional do
Caparaó. Trilha para o pico da Bandeira, 12/02/1998, Souza, J.P. 2137 (ESA); Rio
de Janeiro, Castelos, Serra dos Órgãos, 19/03/1932, Brade, A.C. 11799 (R); Serra
dos Órgãos, s.d, Gardner, G. 5884, isolectotype, Prescottia glazioviana Cogn. (R);
Serra dos Órgãos, s.d., Gardner, G. 5884, phototype, Prescottia glazioviana Cogn.
159
(NY); Serra dos Órgãos, 03/1841, Gardner, G. 5884, lectotype, Prescottia
glazioviana Cogn. (K-L); Serra dos Órgãos, 03/1841, Gardner, G. 5884, isolectotype,
Prescottia glazioviana Cogn. (K); Serra dos Órgãos, 03/1841, Gardner, G. 5884,
isolectotype, Prescottia glazioviana Cogn. (K); Rio de Janeiro*, Órgãos, 07/1842,
Gardner, G. 5884 (photo SEL); Órgãos, 07/1842, Gardner, G. 5884 (G); Serra dos
Órgãos, 07/1841, Gardner, G. 5884, phototype, Prescottia glazioviana Cogn. (photo
MO); Serra dos Órgãos, 06/1841, Gardner, G. 5884, phototype, Prescottia
glazioviana Cogn. (photo F); Summit of Organ Mountans, 03/1941, Gardner, G.
5884, isolectotype, Prescottia glazioviana Cogn. (BM).
HABITAT. In Rio de Janeiro and in Minas Gerais, Prescottia glazioviana grows on
sandy soils, in campos de altitude (high altitude grasslands), in elevations between
1.700 - 2.400 m.
CONSERVATION STATUS. Vulnerable (VU – D2) This taxon is known to exist at no
more than five locations. Prescottia glazioviana is known only from five herbarium
collections: the two sintypes, and three other collections (see above), from three or
four sites [Itatiaia, Serra dos Órgãos, Castelos (Serra dos Órgãos) and Alto
Caparaó]. It was first collected in 1841, at Serra dos Órgãos (Gardner 5884). The
second collection was probably that of 1872 (Glaziou 6729), when Glaziou made a
fieldtrip to Itatiaia (Brade 1956). Even though, Alexandre C. Brade collected
systematically, for more than 30 years, in Itatiaia (Brade 1956), P. glazioviana has
never been collected again at Itatiaia. This latter specimen (Glaziou 6729), collected
137 years ago, is therefore the first and only collection in the region. The third
collection at Serra dos Órgãos (Brade 11799 in 1932), 91 years after the first
collection in the region (Gardner 5884 in 1841), is also the least collection of the
species at the state of Rio de Janeiro. The fourth collection was made after 66 years,
in the state of Minas Gerais (Souza et al. 2137 in 1998) and the fifth, some years
after (Leoni 5280 in 2003), in the same place. During this study three fieldtrips were
undertaken to the two places at Rio de Janeiro, and seven to Minas Gerais, but the
species was not recollected.
ETYMOLOGY. The name honours Auguste François Marie Glaziou (1828-1906), a
French botanical traveller who collected in Brazil between 1861 and 1895, and was
director of the “Passeio Público”, Rio de Janeiro (Stafleu & Cowan 1976).
160
NOTES. Prescottia glazioviana is a rare and poorly known taxon, and was not
available for the molecular studies. Azevedo et al. (submitted a, Chapter 2) present a
complete morphological description and illustration, showing for the first time, several
diagnostic features lacking in the original description: e.g. the lip apex constricted
and with a prominent and ondulate margin. The species is also recognized by its
unusual truncate petal apex.
Pabst & Dungs (1975) cited it to São Paulo, although no specimen from this
state was found, even in the Herbarium Bradeanum (HB) where Pabst worked and
was director. Azevedo et al. (submitted a, Chapter 2) sugested that Prescottia
glazioviana may occur at Espírito Santo state, once it was found at Parque Nacional
do Caparaó, which comprises both states Minas Gerais and Espírito Santo, and 75%
of the park area is at the Espírito Santo. However no collection was made in this
state so far.
It is not easy to suppose the relationship among Prescottia glazioviana and
the others Prescottia species, because P. glazioviana presents a very distinctive lip,
which is unique in the genus. We would expected that it has a sister relationship with
the clade B (Chapter 1). Its leaves are more similar to the Prescottia leptostachya
(short petiole), although its flowers are more reminiscent of P. mucugensis and P.
phleoides.
Cogniaux (1895) described Prescottia glazioviana based on two syntypes,
both collected at Rio de Janeiro state: Glaziou 6729 and Gardner 5884. None of
them, assumed to be housed at B, was found there, probably destroyed during World
War II. From the second (Gardner 5884), six specimens were found, one of which
was selected as the lectotype of P. glazioviana by Azevedo & van den Berg (2007a).
There is a specimen at G with a different date (July 1842). Because the date is
different from the other specimens, it was not considered as an isolectotype
(Azevedo & Van den Berg 2007a).
161
B
1 mm
1 mm
2 cm
F
E
2 mm
2 mm
C
D
A
1 mm
G
H
Figure 17. Prescottia glazioviana. A. Habit. B-C. Flower. B. Front view. C. Lateral
view. D. Floral bract. E. Lip. F. Perianth parts, clockwise from top: lip, dorsal sepal,
petal, lateral sepal. G-H. Column. G. Ventral view. H. Dorsal view. (Leoni 5280).
162
Map 4. Geographical distribution map of Prescottia glazioviana, P. leptostachya, P.
mucugensis, P. ostenii, P. phleoides, and P. spiranthophylla.
163
5. Prescottia lancifolia Lindl., Gen. sp. orchid. pl.: 453. 1840. [Cogniaux 1895;
Cogniaux 1907; Kränzlin 1911; Brade & Pabst 1952; Rizzini 1954; Pabst 1966; Pabst
& Dungs 1975]. Protologue: “in Brazilia, Gardner 681; prope Ilha Grande inter
humum, Descourtilz (hab. s. sp.)”. Type: Brazil: Gardner 681 (lectotype K-L!;
isolectotype BM!; G!; K!; NY!; P!; SP!; W! (selected by Azevedo & van den Berg
2007a). Fig. 18.
= Prescottia epiphyta Barb. Rodr., Gen. spec. Orchid. 1: 179, t. 462. 1877.
Protologue: “Serra da Pedra Branca et dos Poços. Fleurit au mois de Mars.”
synon. nov. Lectotype (here designated): Barbosa Rodrigues’ original drawing
(plate t. 462) in the library of the Jardim Botânico do Rio de Janeiro [reproduction
printed in “Iconographie des Orchidées du Brésil”, Sprunger et al. (1996), 2: t.
86].
= Prescottia octopollinica Barb. Rodr., Gen. spec. Orchid. 2: 277, t. 652. 1881.
Protologue: “Croissant sur les arbres des forets de la Serra de Sant'Anna, à Rio
de Janeiro. Fleurit en Mai.” synon. nov. Lectotype (here designated): Barbosa
Rodrigues’ original drawing in the library of the Jardim Botânico do Rio de
Janeiro [reproduction printed in “Iconographie des Orchidées du Brésil”,
Sprunger et al. (1996), 2: t. 85].
= Prescottia truncicola Schltr., Repert. Spec. Nov. Regni Veg. 16: 319. 1920.
[Hoehne 1945; Brade & Pabst 1952; Pabst & Dungs 1975]. Protologue: “Paraná:
Serra do Mar, Carvaelho, in silva primaevis, ad truncos putridos - no. 18154, flor.
Sept. 1911; Serra do Mar, Monte Alegre, in terra silvosa, no. 10290, flor. Sept.
1910.” Type: Brazil: Paraná: Serra do Mar, Carvalho in silv. prim. ad trunc.,
12.Sept.1911, P. Dusén 18154 (lectotype AMES!; isolectotype GH! (selected by
Azevedo & van den Berg 2007a).
Epiphytic herb. Leaves 2-5, rosulate, petiolate; petiole (1.0-)3.0-6.0 cm long, green;
blade (2.0-)4.0-9.0 cm long, (0.8-)1.5-2.0 cm wide, membranaceous, lanceolate,
green, apex acute, base attenuate, margin entire. Inflorescence loose, 11-40flowered; peduncle (5.0-)10.0-13.0 cm long, 0.04-0.1 cm wide, cylindric, green;
peduncle bracts 2-3, 1.0-2.5 mm long, 0.5 mm wide, ovate to triangular, green, apex
acute to acuminate; rachis (2.0-)4.0-6.0(-12.0) cm long, 0.6-1.0 cm wide, green.
164
Flower bracts 3.0-6.0 mm long, 1.2-2.6 mm wide, ovate to triangular, green, apex
acuminate to acute; flower erect, white; dorsal sepal revolute, 2.0-2.6 mm long, 1.01.5 mm wide, submembranaceous, lanceolate to ovate, apex acute; lateral sepals
patent to revolute, 2.5-3.6 mm long, 1.5-2.0 mm wide, submembranaceous, oblong to
ovate, apex rounded to acute; petals revolute, 1.5-2.6 mm long, 0.5-0.8 mm wide,
submembranaceous, linear, apex rounded to acute; lip 2.0-3.5 mm long, 2.5-3.0 mm
wide, membranaceous, inner surface pilose. Column 0.8-1.2 mm long, glabrous.
DISTRIBUTION. Restricted to Brazil, it occurs at Minas Gerais, Espírito Santo, Rio
de Janeiro, São Paulo, Paraná, and Santa Catarina. Map 5.
BRAZIL, Santo Antonio de Imbé, Pedra da República, 04/1932, Brade, A.C. 11812
(R); s.l., 16/08/1976, Carpenter, M.O. s.n. (SEL16413); s.l., s.d., Glaziou, A.F.M.
2714 (W); Baependy, 06/1898, Rabello, C. 2824 (R); s.l., 21-31/03/1847, Regnell,
A.F. III 1146 (P); Lagoa Santa, s.d., Warming, E. 2714 (P); Espírito Santo, Castelo,
Forno Grande, 16/05/1949, Brade, A.C. 19847 (RB); Itaguaçu, Jatiboca, 05/1946,
Brade, A.C. 18545 (RB); Santa Teresa, Nova Lombardia, Reserva Biológica Augusto
Ruschi, córrego próximo ao marco 112, 03/10/2002, Vervloet, R.R. 1147 (MBML);
Minas Gerais, Caldas, 08/03/1969, Regnell, A.F. III 1146 (US); Passa-Quatro,
23/03/1921, Zikan, F.J. s.n. (SP); s.l., 01/1898, Rabello, C. 2793 (R); Paraná, Serra
do Mar, Monte Alegre, 1910, Dusén, P. 10290, syntype, Prescottia truncicola Schltr.
(MBM); Serra do Mar, Carvaelho, 12/09/1911, Dusén, P. 18154, lectotype, Prescottia
truncicola Schltr. (GH); Serra do Mar, Carvaelho, s.d., Dusén, P. 18154, isolectotype,
Prescottia truncicola Schltr. (GH); Marumbi-Serra do Mar, 11/1971, Kuniyoshi, Y.S.
3144 (MBM); Antonina, Rod. BR 116, São Sebastião, 11/09/1970, Hatschbach, G.
24697 (MBM); Guaratuba, Estr. para Joinvile-Alto da Serra, 18/10/1953, Hatschbach,
G. 3290 (MBM); Guaratuba, Alto da Serra, 13/10/1957, Hatschbach, G. 4116 (MBM);
Guaratuba, Itararé, 14/09/1982, Kummrow, R. 2003 (MBM); Guaratuba, Rio Itararé,
06/11/2003, Silva, J.M. 3877 (MBM); Morretes, Morro 7, 17/05/1964, Hatschbach, G.
11286 (MBM); Estr. Itupava, Rio São João, 13/09/1966, Hatschbach, G. 14703
(MBM, US); Morretes, Serra do Leão, 10/10/1969, Hatschbach, G. 22407 (MBM);
Morretes, Pilão de Pedra, 03/09/1961, Hatschbach, G. 8320 (MBM); Morretes,
Marumbi, 01/09/1991, Ribas, O.S. 374 (MBM); Paranaguá, Torre da Prata,
165
01/07/2003, Silva, J.M. 3758 (MBM); Rio de Janeiro, Serra da Carioca, 07/1929,
Brade, A.C. 11091 (R); Pedra Bonita, Distrito Federal, 08/1932, Brade, A.C. 11985
(R); Frade de Macaé, 17-21/06/1937, Brade, A.C. 15874 (RB); Sumaré, D. Fed.,
27/07/1951, Brade, A.C. s.n. (RB84184); Organ mountains, s.d., Gardner 681,
lectotype, Prescottia lancifolia Lindl. (K-L, photo F, photo MO, isolectotype BM, K,
NY, photo MO, photo NY, P, photo SEL, SP, W, line drawing W); s.l., 1895, Ule, E.
s.n. (R); Itatiaia, Faz. Fonseca, 25/03/1942, Brade, A.C. 17285 (RB); Nova Friburgo,
Distrito do Rio Bonito, Sertão do Rio Bonito, 21/05/1986, Ribeiro, R. 850 (GUA);
Petrópolis, 08/09/1937, Spannagel, C. 438 (SP); Santa Catarina, Ilhota, Morro do
Baú, 17/09/1970, Reitz, R. 7415 (B, MBM, NY, PACA, US); Itajaí, Braço Joaquim,
Luis Alves, 24/05/1956, Klein, R. 2051 (US); São Paulo, Serra da Bocaina,
04/05/1951, Brade, A.C. 20845 (RB); Alto da Serra, Mata da Estação Biológica,
30/09/1920, Gehrt, A. 4470 (NY, R); Alto da Serra, Estação Biológica, 30/09/1920,
Gehrt, A. s.n. (SP4470); Alto da Serra, Estação Biológica, 19/05/1926, Hoehne, F.C.
s.n. (SP29236); Parque Est. da Serra do Mar, Núcleo Curucutu, Mata a esquerda
antes da estrada e do reflorestamento de Pinus, 16/07/2001, Izumisawa, C.M. 313
(PMSP); Bocaina, 27/03/1894, Loefgren, A. 2317 (SP); Reserva Florestal da
Bocaina, Posses, 07/05/1968, Sucre, D. 3014 (RB); Bananal, sertão do Rio
Vermelho, 15/05/1936, Brade, A.C. 15250 (RB); Campo Grande, 05/1899, Edwall, G.
6010 (SP); Campos do Jordão, 03/1945, Leite, J.E. 3340 (GH, SP); Campos do
Jordão, à beira da estrada nova atrás do Grande Hotel, 05-3/1946-1947, Pabst,
G.F.J. 324 (GH, K, SP); Campos do Jordão, 5-20/02/1937, Campos-Porto, P. 3190
(RB); Campos do Jordão, 29/04/1940, Hashimoto, G. 225 (SP); Paranapiacaba, linha
São Paulo-Santos, Estação Biológica, 26/05/1955, Handro, O. 483 (SP, SPF, US).
HABITAT. Epiphytic in rainforest, between elevations from 400 to 1.700 m.
ETYMOLOGY. Probably a reference to the lanceolate leaves.
NOTES. Prescottia lancifolia can be distinguished by its lanceolate leaves, nodding
inflorescence and lip internally pilose. Based on DNA sequence data, it is within the
whitish flowers and lip internally pilose clade. Prescottia lancifolia is sister to P.
ostenii (Chapter 1).
The relation between the length of the leaves and the inflorescences has been
the main reason, up to now, for the separation among Prescottia lancifolia, P.
166
epiphyta, and P. truncicola. The inflorescences can be shorter than the leaves, but
they are generally longer. These characters, therefore, appear to represent normal
variations within this species, even among specimens of the same collection and
population. This variation has been the reason for some confusion among these taxa.
For example: one of the syntypes of Prescottia truncicola (Dusén 10290) was cited
before its publications as Prescottia lancifolia by Kränzlin (1911).
Prescottia lancifolia was described based on two syntypes, Gardner 681 and
Descourtilz s.n. Seven specimens annotated as Gardner 681 were found. However,
the Descourtilz’s syntype was not found. Azevedo & van den Berg (2007a) selected
the syntype Gardner 681 housed in Lindley’s herbarium (K-L) as the lectotype of P.
lancifolia. When Schlechter described Prescottia truncicola he cited two syntypes,
Dusén 18154 and Dusén 10290. The original material of P. truncicola was probably
at B and destroyed during World War II. As there is no evidence that Schlechter had
examined the syntype at MBM, Azevedo & van den Berg (2007a) chose the AMES
syntype as the lectotype of this species, which is annotated in Schlechter’s
handwriting with the same information given in the protologue and determined by him
as P. truncicola.
When Barbosa-Rodrigues (1881) described Prescottia octopollinica, he stated
that this taxon was very similar to his P. epiphyta, differing only in the number of
pollinia. Prescottia octopollinica was characterized by the presence of eight pollinia.
Probably it is due to a confusion, because he justified the number of pollinia saying
that Lindley cited “pollinia 4 geminata”, and he observed that the species in question
had four very detached pollinia pairs that made it eight. Actually, when Lindley
described the genus he cited: “pollinia 2, didyma” (in Hooker 1824), confirming the
same information a few years later (Lindley 1840a): “pollinia 2, biloba”. Before in
1836 (Lindley 1836) he described the genus and stated: “pollinia 4, geminata” giving
rise to the confusion. Apparently, Barbosa-Rodrigues’ illustration shows four sulcate
pollinia. Eight pollinia were never found again indicating that it was only a
misinterpretation.
Barbosa Rodrigues’ herbarium specimens were lost after his death (Cribb &
Toscano-de-Brito 1996). After verifying the materials at the Herbarium of the Jardim
Botânico do Rio de Janeiro (Rio de Janeiro Botanical Garden), we chose to
167
lectotypify Prescottia epiphyta and P. octopollinica upon the plates mentioned by the
author in the original description, recently reproduced in Sprunger et al. (1996).
168
1 mm
C
B
1 mm
1 cm
D
A
5 mm
H
E
0.5 mm
G
0.5 mm
F
Figure 18. Prescottia lancifolia. A. Habit. B-C. Flower. B. Front view. C. Lateral view.
D. Floral bract. E. Perianth parts, clockwise from top: lip, dorsal sepal, petal, lateral
sepal. F-G. Column with pollinarium in place. F. Dorsal view. G. Ventral view.
(Bocayuva 198).
169
Map 5. Geographical distribution map of Prescottia lancifolia.
170
6. Prescottia leptostachya Lindl., Bot. Reg. 22: t. 1916. 1836. [Cogniaux 1895;
Cogniaux 1907]. Protologue: “Bahia, in fruticetis sabulosis, Salzmann”, without
collector number or date. Type: Brazil: Bahia, in fruticetis sabulosis, Salzmann s.n.
(holotype K-L!; isotypes K!; P!; W!). Fig. 19.
Terrestrial herb. Leaves 2-3, rosulate, petiolate; petiole 1.5-2.0 cm long, green; blade
4.0-5.5 cm long, 2.0-2.5 cm wide, membranaceous, lanceolate, silver-green, apex
acute, base obtuse, margin entire. Inflorescence loose, 35-40-flowered; peduncle
22.0-28.0(-38.0) cm long, 0.1-0.4 cm wide, cylindric, green; peduncle bracts 3-4, 5.015.0 mm long, 2.0-6.0 mm wide, ovate to lanceolate, green, apex acute; rachis 8.020.0(-25.0) cm long, 0.5-0.8 cm wide, green. Flower bracts 3.0-4.0 mm long, 1.41.7 mm wide, ovate, green, apex acute to acuminate; flower erect, green; dorsal
sepal revolute, 2.0-2.5 mm long, 0.5-1.0 mm wide, membranaceous, oblong to ovate,
green, apex obtuse; lateral sepals reflexed with distal part adpressed to ovary, 3.03.5 mm long, 0.5-1.0 mm wide, membranaceous, oblong to ovate, green, apex
obtuse; petals revolute, 2.0-2.5 mm long, 0.3-0.5 mm wide, membranaceous, linear,
obtuse, green; lip 2.5-3.5 mm long, 1.5-2.0 mm wide, membranaceous, green, inner
surface glabrous. Column 0.8-1.0 mm long, glabrous.
DISTRIBUTION. Restricted to Brazil. Originally described from the state of Bahia
(Lindley 1836). It is also cited to Rio de Janeiro (Hoehne 1945; Pabst & Dungs 1975),
but we could not find any specimen from the later. In Bahia it is encountered at
Chapada Diamantina, where it was cited for Rio de Contas (Toscano de Brito 1995),
Lençóis (Toscano de Brito 1998), Catolés (Toscano de Brito & Queiroz 2003), and
Mucugê (Azevedo & van den Berg 2007b) and at “restinga” on the east coast. Map 4
(p. 163).
BRAZIL, Bahia, 1831, Salzmann 536 (photo F, G, photo MO, photo NY, photo SEL);
s.l., s.d., Salzmann s.n., holotype, Prescottia leptostachya Lindl. (K000293872,
fragment F, isotype K000293363, K000293364, photo MO, P00366657, W646);
Abaíra, Campo de Ouro Fino (baixo), 24/01/1992, Pirani, J.R. H 50794 (SPF);
Lençóis, Rio Mucugezinho, próximo à BR - 242, em direção à Serra Brejão, próximo
171
ao Morro do Pai Inácio, 20/12/1984, Stannard, B. CFCR 7308 (HUEFS, K, SPF);
Morro do Chapéu, Trilha entre o Rio Ferro Doido e a Estrada do Feijão (BA 052),
29/01/2003, França, F. 4056 (HUEFS); Mucugê, Parque Municipal de Mucugê,
confluência com Morro do Capa Bode, 26/11/2002, Azevedo, C. 164 (HUEFS); Piatã,
Serra de Santana, trilha para a capela do Senhor do Bonfim, imediatamente a leste
da cidade, 27/12/2004, Mello-Silva, R. 2777 (SPF); Rio de Contas, Vertente leste,
próximo do Campo de Queiroz, 25/12/1988, Harley, R.M. 27370 (CEPEC, K, SPF);
Santa Cruz de Cabrália, 20/10/1969, Jesus, J.A. 514 (CEPEC); Santa Cruz de
Cabrália, 24/02/1970, Jesus, J.A. 614 (CEPEC); Serrinha, Barra do Vento, próximo a
torre da Embratel, 20/10/2006, Azevedo, C. 310 (HUEFS).
HABITAT. It grows in sandy soils on dunes, or in the organic matter gathered
between the rocks, in campo rupestre vegetation, between elevations from sea level
to 1.700 m.
CONSERVATION STATUS. Not threatened.
NOTES. Prescottia leptostachya is characterized by the silver-green leaves with
entire margins, long inflorescence, rachis with 8-20 cm length, and small flowers.
Based on DNA sequence data, P. leptostachya is grouped in a clade with P.
mucugensis and P. phleoides (Chapter 2). However, morphologically P. leptostachya
flowers look like that of P. plantaginifolia, from which the former may be distinguished
by its leaves. Furthermore, P. plantaginifolia has the dorsal surface covered by
trichomes and P. leptostachya has it glabrous.
We have found six Salzmann’s specimens annotated as Prescottia
leptostachya in different herbaria: one at K-L, one at P, another at W, and two at K,
one stamped with “Herbarium Hookerianum 1867” and the other with “Herbarium
Benthamianum 1854”. The materials at K, K-L and W have the same handwriting
label informations, and corresponding exactly to the protologue of the species. The P
material is typewritten as “Bahia, Salzmann”. There is also a specimen at G,
annotated in Salzmann’s handwriting with almost the same information given in the
protologue: “Bahia, in fruticetis sabulosis aridis” and additional information indicating
the year (1831) and the collection number (536). However, as the latter has
informations about year and collection number, which are different from the other
specimens, we did not consider this specimen as an isotype. The holotype is the
172
specimen housed in Lindley’s herbarium, as Lindley is the author of the species; this
specimen has also a line drawing made by Lindley on it.
173
1 mm
1 mm
B
D
1 mm
1 mm
C
2 cm
E
A
H
0,2 mm
1 mm
F
G
Figure 19. Prescottia leptostachya. Drawn from fresh material. A. Habit. B-C. Flower.
B. Front view. C. Lateral view. D. Lip. E. Perianth parts, clockwise from top: lip,
dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F. Dorsal
view. G. Ventral view. H. Pollinarium. (Azevedo 164).
174
7. Prescottia lojana Dodson, Orquideologia 20(1): 108. 1996. [Jørgensen & LeónYánez 1999]. Protologue: “Ecuador: Zamora-Chinchipe: Yangana to Valladolid, east
side of pass, 2800 m, 23 March 1985, A.Hirtz, C. & J. Luer & W. Flores 2298
(holotype RPSC).” Type: Ecuador: Zamora-Chinchipe, Yangana to Valladolid. Hirtz,
Luer & Flores 2298 (holotype MO (RPSC)!). Fig. 20.
Terrestrial herb. Leaves 2-3, rosulate, petiolate; petiole (4.0-)8.5-10.0 cm long; blade
(4.5-)7.5-10.0 cm long, (2.5-)4.3-5.2 cm wide, fleshy to coriaceous, ovate, green with
a hyaline-white margin, apex acute, base rounded, margin serrulate. Inflorescence
dense, 25-60-flowered; peduncle 19.0-31.0 cm long, at least 0.5 cm wide, red;
peduncle bracts 5-7, 17.0-45.0 mm long, 6.0-10.0 mm wide, ovate, apex acute;
rachis 10.0-15.0 cm long; 1.0-1.5 cm wide. Flower bracts 5.8-10.0 mm long, 2.03.0 mm wide, ovate, apex acuminate; flower erect, deep green; dorsal sepal strongly
revolute, 2.0-2.5 mm long, 1.5-2.0 mm wide, ovate to triangular, apex obtuse; lateral
sepals strongly revolute, 3.0-3.5 mm long, 1.5-2.0 mm wide, oblong, apex obtuse;
petals strongly revolute, 2.5-3.0 mm long, 0.5-0.7 mm wide, oblong, apex obtuse; lip
(3.7-)5.0-6.6 mm long, 1.8-2.2 mm wide, midvein prominent, inner surface glabrous.
Column 1.8-3.0 mm long.
DISTRIBUTION. Ecuador and Venezuela. Map 2 (p. 148).
ECUADOR, along path (Camino de herradura) at pass on km 13.5 Loja-Zamora,
29/12/1980, Dodson, C.H. 10570 (SEL); Km 12 Loja to Zamora, 18/11/1961, Dodson,
C.H. 1327 (RPSC); Condorazo, 11/1985, Hirtz, A. 2626 (RPSC); Loja, Parque
Nacional Podocarpus, Cerro Toledo, 01/12/1988, Madsen, J.E. 75723 (AAU); Loja,
Lagunas de Compadre, Parque Nacional Podocarpus, ca. 6 hours walking from
centro de Informacion, ridge top vegetation 21/11/1989, Madsen, J.E. 86457 (AAU,
MO); Zamora-Chinchipe, Eastern side of pass on road from Yangana to Valladolid
s.d., Hirtz, A. 2298, holotype, Prescottia lojana Dodson (RPSC).
VENEZUELA, Bolivar, Kekenan Tepui, summit, 11/04/1988, Liesner, R. 23114 (MO);
Bolivar, Cumbre del Macizo de Chimanta; sector septentrional: Murey (Eruoda)-tepui,
175
24/02/1978, Steyermark, J.A 115781 (MO); Bolivar, Piar, Murisipantepui, summit.
Second of 4 tepuis W to E in Aparaman range, 22/03/1987, Holst, B.K. 3522 (MO).
HABITAT. Prescottia lojana grows on eroded sandstone mesa with deep crevices
and large rock formation, mostly in shrub island or open forest, in elevations between
3.000 and 3.700 m.
CONSERVATION STATUS. Not Evaluated.
ETYMOLOGY: Named for the region of Loja (Dodson 1996).
NOTES: Prescottia lojana can be diagnosed by its fleshy to coriaceous leaves and lip
with prominent midvein. It was not available for the molecular studies, however, it
appears to be related to Prescottia carnosa, P. ecuadorensis, and P. stachyodes. All
of them have petiolate leaves, greenish flowers and the inner surface of the lip
glabrous.
The Orchidaceae of the Ecuadorian Herbarium Río Palenque Science Center
(RPSC) were transferred to MO, though the holotype is now at the Missouri Botanical
Garden herbarium (MO).
176
3 mm
3 mm
B
D
C
2 mm
E
2 cm
2.5 mm
F
A
G
Figure 20. Prescottia lojana. A. Habit. B-C. Flower. B. Front view. C. Lateral view. D.
Floral bract. E. Perianth parts, clockwise from top: lip, lateral sepal, petal, dorsal
sepal. F-G. Column. F. Ventral view. G. Dorsal view. (Holst 3522).
177
8. Prescottia montana Barb. Rodr., Gen. spec. Orchid. 1: 178, t. 485. 1877.
[Cogniaux 1895; Cogniaux 1907; Pabst 1966; Pabst & Dungs 1975; Sprunger 1996].
Protologue: “Sur le sommet de la Pedra Branca, à Caldas. Fleurit au mois d'Avril.”
Lectotype: Barbosa Rodrigues’ original drawing (plate t.485) in the library of the
Jardim Botânico do Rio de Janeiro (selected by Azevedo & van den Berg 2007b).
Fig. 21.
Rupicolous to terrestrial herb. Leaves 1(-2), basal, petiolate; petiole 8.0-9.0 cm long,
green; blade 10.0-11.0 cm long, 1.5-2.0 cm wide, coriaceous, elliptic to lanceolate,
green, apex acute, base attenuate, margin entire. Inflorescence dense, 30-60flowered; peduncle 24.0-50.0 cm long, 0.2-0.9 cm wide, cylindric, green; peduncle
bracts 2-4, 15.0-40.0 mm long, 5.0-6.0 mm wide, ovate, green, apex caudate; rachis
6.0-21.0 cm long, 0.7-1.5 cm wide, green. Flower bracts 7.0-9.0(-12.0) mm long,
(2.0-)3.0-4.5(-5.6) mm wide, lanceolate to ovate, green, apex acuminate to caudate;
flower erect, yellow to green; dorsal sepal revolute, 3.0-3.8(-5.1) mm long, 1.4-1.5(1.8) mm wide, membranaceous, oblong to triangular, green to yellow, apex acute to
obtuse; lateral sepals adpressed to the lip, 4.0-4.5(-6.1) mm long, 1.4-1.6(-2.0) mm
wide, membranaceous, lanceolate to oblong, yellow to green, apex acute; petals
revolute, 3.0-3.5(-4.5) mm long, 0.6-1.0 mm wide, membranaceous, linear, yellow to
green, apex obtuse to acute; lip 4.0-4.8(-6.6) mm long, 3.0-3.7(-4.0) mm wide,
membranaceous, green, inner surface glabrous. Column 1.0-1.2(-2.0) mm long,
glabrous.
DISTRIBUTION. Brazil and Argentina. This species was described from material
collected at Pedra Branca, Caldas, state of Minas Gerais (Barbosa-Rodrigues 1877),
it also occurs at Rio de Janeiro, São Paulo (Hoehne 1945; Pabst & Dungs 1975;
Sprunger et al. 1996), Espírito Santo, Paraná, Santa Catarina (Pabst & Dungs 1975;
Sprunger et al. 1996), Bahia (Azevedo & van den Berg 2007b), Goiás, and Rio
Grande do Sul. In Minas Gerais, it was cited to Serra do Cipó (Barros 1987) and
Grão-Mogol (Barros & Pinheiro 2004). Map 6.
178
ARGENTINA, Depto. Capital, sierra de Zapla, subida al co. Zapla, 13/04/1974,
Cabrera 24954, “holotype”, Prescottia serrana M.N. Correa (LP). BRAZIL, Planalto Parque Nacional do Itatiaya, 19/02/1956, Fidalgo, O. 25 (W); P.E. do Ibitipoca,
25/06/1987, Souza, H.C. s.n. (BHCB16122); Bahia, Morro do Chapéu, Morrão,
11/11/2001, Borba, E.L. 2070 (HUEFS); Mucugê, Guiné, 25/11/2000, Conceiçao,
A.A. 894 (SPF); Espírito Santo, Castelo, Forno Grande, 15/08/2006, Azevedo, C.
287 (HUEFS); Castelo, Forno Grande, 16/05/1949, Brade, A.C. 19875 (RB); Castelo,
Parque Estadual do Forno Grande, 11/06/2004, Kollmann, L. 6729 (MBML); Castelo,
Parque Estadual do Forno Grande, 31/05/2006, Kollmann, L. 9139 (MBML);
Domingos Martins, Reserva Florestal da Pedra Azul, 26/05/1991, Valpassos, E. s.n.
(MBML6247); Santa Maria de Jetibá, Pedra do Garrafão, Distrito do Garrafão, Trilha
do topo, nascente do córrego garrafão, 10/05/2003, Berger, M.V.S. 91 (MBML); São
Roque do Canaã, Alto Misterioso, Pedra 2, 17/07/2005, Fontana, A.P. 1579 (MBML);
Goiás, Alto Paraíso de Goiás, Chapada dos Veadeiros, GO 118, sentido Teresina de
Goiás, 11/02/2002, Simões, A.O. 1235 (UEC); Minas Gerais, Serra do Cipó, km 123,
23/05/2007, Azevedo, C. 332 (HUEFS); s.l., 1836, Regnell, A.F. III 1194 (US); Serra
da Itatiaia, Pr. Chapada (Ouro Branco), s.d., Schwacke, C.A.W. 11495 (RB); Serra
de Ibitipoca, Pico do Pião, 14/05/1970, Sucre, D. 6860 (RB); s.l., s.d., Williams, L.O.
7297 (GH, RB); Araponga, Serra das Cabeças (PESB), 05/05/2000, Beirigo, R.M. 07
(HUEFS, VIC); Araponga, PESB, Serra das Cabeças, 3ªcabeça, 06/2001, Caiafa,
A.N. 175 (HUEFS, VIC); Araponga, Parque Estadual da Serra do Brigadeiro, área de
campo em frente ao Laboratório do CECO, 27/05/2000, Salino, A. 5522 (BHCB);
Brumadinho, Retiro das Pedras, 03/07/2001, Viana, P.L. 102 (BHCB); Brumadinho,
Retiro das Pedras - Serra da Calçada, 10/05/2002, Viana, P.L. 638 (BHCB); Caldas,
Serra da Pedra Branca, cume da serra, 04/04/2007, Azevedo, C. 324 (HUEFS);
Catas Altas, Serra do Caraça, 11/06/2000, Mota, R.C. 849 (BHCB); Catas Altas,
Serra do Caraça, Pico do Inficionado, 25/05/2004, Mota, R.C. 2447 (BHCB);
Conceição do Mato Dentro, Parque Natural Municipal do Ribeirao do Campo,
07/07/2002, Mota, R.C. 2549 (BHCB); Conceição do Mato Dentro, Parque Natural
Municipal do Ribeirão do Campo, 30/05/2003, Mota, R.C. 2551 (BHCB); Itabirito,
Pico do Itabirito, 23/06/1994, Teixeira, W.A. s.n. (BHCB 26120); Itabirito, Pico do
Itabirito, 19/05/1994, Teixeira, W.A. s.n. (BHCB 26119); Itabirito, Pico do Itabirito,
Serra dos Inconfidentes, 28/06/1993, Teixeira, W.A. s.n. (BHCB 26121, F2189526);
179
Jaboticatubas, Serra do Cipó, km 139 ao longo da rodovia Lagoa Santa - Conceição
do Mato Dentro - Diamantina, 08/06/1970, Joly, A.B. 323 (SP); Jaboticatubas, Serra
do Cipó, km 142 ao longo da rodovia Lagoa Santa - Conceiçao do Mato Dentro Diamantina, 27/05/1972, Joly, A.B. s.n. (SP146162); Jaboticatubas, Serra do Cipó,
km 132 ao longo da rodovia Lagoa Santa - Conceiçao do Mato Dentro - Diamantina,
08/07/1974, Onishi, E. 5077 (SP); Jaboticatubas, Serra do Cipó, km 132 ao longo da
rodovia Lagoa Santa - Conceiçao do Mato Dentro - Diamantina, 08/07/1974, Onishi,
E. 5078 (SP); Jaboticatubas, Km 132 da Rod. Lagoa Santa a Conceição do Mato
Dentro, 16/07/1072, Sazima, M. 13408 (UEC); Ouro Preto, Parque Estadual do
Itacolomí, final da trilha nova do Baú, 02/06/1999, Nakajima, R.T. 13 (VIC); Ouro
Preto, Estação Ecológica do Tripuí, 03/10/1991, Oliveira s.n. (CETEC10340); Ouro
Preto, Pico do Itacolomí, 15/05/1983, RMS 19496 (CESJ); Ouro Preto, Parque
Estadual do Itacolomí, 12/05/1998, Stehmann, J.R. 2353 (BHCB); Rio Preto, Gruta
do Funil, 06/1989, Grandi, T.S.M. 322 (BHCB); Rio Vermelho, Pedra da Menina,
Serra do Ambrósio, Espigão do Meio, 01/08/1985, Mello-Silva, R. CFCR 7868 (SPF);
Santana do Riacho, Caminho das Vellozias gigantes, 26/04/2006, Marino, F. 97
(BHCB); Paraná, Palmeira, Col. Quero-Quero, 04/05/1952, Hatschbach, G. 2772
(MBM); Palmeira, Col. Quero-Quero, 06/05/1973, Hatschbach, G. 31847 (MBM); Rio
de Janeiro, Itatiaia, Caminho Rebouças-Prateleiras, 13/03/1960, Atala, F. 275
(GUA); Itatiaia, Caminho entre abrigo Rebouças e Prateleiras, 13/03/1960, Atala, F.
354 (GUA); Itatiaia, em direção a parte alta, trilha para o Rebouças, 02/04/2007,
Azevedo, C. 317 (HUEFS); Itatiaia, Planalto, 26/02/1936, Brade, A.C. 15159 (RB);
Itatiaia, Prateleiras. Lajão, 01/03/1950, Brade, A.C. 20233 (RB); Itatiaia, Alto Itatiaia,
01/03/1921, Campos-Porto, P. 1007 (RB); Itatiaia, Itatiaia planalto, 06/03/1962,
Pereira, E. 7925 (B, K); Itatiaia, Resende Co., Serra do Itatiaia, 1953, SERRA I 263
(R); Itatiaia, Planalto de Itatiaia, subida das Agulhas Negras, 06/02/1969, Sucre, D.
4648 (RB); Itatiaia, Serra de Itatiaia, 02/1894, Ule, E. 288 (R); Nova Friburgo,
Cônego, Pedra do Imperador, Alto da Pedra, em trilha calçada que leva a torre,
16/06/2004, Mello-Silva, R. 2626 (SPF); Resende, Parque Nacional do Itatiaia, Morro
do Conto, 19/02/1984, Ribeiro, R. 440 (GUA); Rio Grande do Sul, Guaíba, Morro
Maximiano, 16/05/1993, Nunes, V.F. 343 (ICN); Porto Alegre, Morro da Polícia,
03/06/1980, Bueno, O. 2553 (HAS); Porto Alegre, Gloria, 05/1933, Canisis 1153
(ICN); Porto Alegre, Vila Manresa/M. da Gloria, 03/09/1954, Orth, L. s.n.
180
(PACA1705); Santa Catarina, Campo Alegre, Subida para a Serra Quiriri,
27/04/2001, Ribas, O.S. 3507 (HUEFS, MBM, SP); São José, Serra da Boa Vista,
02/02/1953, Reitz, R. 5433 (PACA); São Paulo, Serra da Bocaina, alto da Boa Vista,
26/04/1951, Brade, A.C. 20728 (HUEFS, ICN, M, RB); Atibaia, Parque Municipal da
Grota Funda, s.d., Bernacci, L.C. 28443 (UEC); Atibaia, Parque Municipal da Grota
Funda, Pedra Grande, 24/05/1997, Helayne, F. 35522 (UEC); Atibaia, Pedra Grande,
12/05/1936, Hoehne, F.C. s.n. (SP35311, SPF72209); Atibaia, Pedra Grande,
07/06/2003, Singer, R.B. 2003/26 (UEC); Atibaia, Pedra Grande, 08/08/1997, Singer,
R.B. 97/209 (UEC); Atibaia, Parque Estadual Grota Funda, 07/05/1997, Singer, R.B.
97/24 (UEC); Atibaia, Pedra Grande, 08/08/1997, Singer, R.B. 98/209 (UEC);
Queluz, encosta próxima a Pedra da Mina, 18/02/1997, Shephered, G.J. 97 34
(UEC); Province de Saint-Paul, 1816-1821, Saint-Hilaire, A. de C 1791 (P).
HABITAT. It grows on granitic substrates or on sandy soils, in campos de altitude
(high altitude grasslands) and campo rupestre vegetation, in elevations between 730
and 2.660 m.
ETYMOLOGY. Probably named for the place where the species was collected at the
summit of a mountain.
NOTES. Prescottia montana is easily recognized by the dense and conical
inflorescence, by the presence of a single lanceolate leaf and yellow-greenish
flowers, with the lateral sepal adpressed to the lip.
Based on DNA sequence data, Prescottia montana is sister to P. stachyodes,
with which it shares some morphological similarities, as petiolate leaves. However, it
is more similar to P. phleoides, which has sessile to pseudopetiolate leaves. Both
share multiflowered, dense inflorescences and flowers with lateral sepals adpressed
to the lip.
181
1 mm
5 mm
D
E
5 mm
B
C
4 cm
1 mm
1 mm
A
H
F
G
Figure 21. Prescottia montana. Drawn from fresh material. A. Habit. B-C. Flower. B.
Front view. C. Lateral view. D. Floral bract. E. Perianth parts, clockwise from top: lip,
dorsal sepal, petal, lateral sepal. F-G. Column with pollinarium in place. F. Ventral
view. G. Dorsal view. H. Pollinarium. (Azevedo 324).
182
Map 6. Geographical distribution map of Prescottia montana.
183
9. Prescottia mucugensis C.O. Azevedo & Van den Berg. Type: Brazil, Bahia,
Mucugê, Guiné, Serra do Esbarrancado, Smidt 796 (holotype HUEFS). Fig. 22.
Terrestrial herb. Leaves no seen. Inflorescence loose, 10-20-flowered; peduncle
14.0-16.0 cm long, 0.12-0.14 cm wide , cylindrical, green; peduncle bracts 3-5, 8.015.0 mm long, 2.0-4.0 mm wide, ovate, green, apex acute; rachis 3.0-5.5 cm long, at
least 4.0 cm wide, green. Flower bracts 2.2-2.4 mm long, 1.3-1.5 mm wide, ovate,
greenish to purplish brown, apex acuminate; flower erect; dorsal sepal reflexed, 1.21.4 mm long, 0.8-1.0 mm wide, oblong to lanceolate, greenish to purplish brown,
apex obtuse; lateral sepals adpressed to the lip, 1.5-1.7 mm long, 1.0-1.2 mm wide,
ovate to lanceolate, greenish to purplish brown, apex obtuse; petals reflexed, 1.01.2 mm long, 0.2-0.3 mm wide, linear, greenish to purplish brown, apex obtuse; lip
1.2-1.5 mm long, 1.2-1.5 mm wide, yellow to whitish, inner surface glabrous, outer
surface densely minute-papillose. Column 0.9-1.0 mm long, glabrous.
DISTRIBUTION. Occurs in Brazil, currently known only from the type collections. It is
aparently endemic to the Chapada Diamantina (Azevedo et al. submitted b (Chapter
2). Map 4 (p. 163).
BRAZIL, Bahia, Mucugê, Chapada Diamantina, Guiné, Serra do Esbarrancado,
11/2005, Azevedo, C. 253, paratype, Prescottia mucugensis (HUEFS); Mucugê,
Chapada Diamantina, Guiné, Serra do Esbarrancado, 11/2004, Smidt, E. 796,
holotype, Prescottia mucugensis (HUEFS).
HABITAT. It grows on rocky places at campo rupestre vegetation, between 1.000 1.400 m altitude, among Velloziaceae.
CONSERVATION STATUS. Vulnerable (VU – D2). Besides Prescottia mucugensis
is inside of a National Park, it is currently known to exist at only a single location, in a
small and restricted population.
ETYMOLOGY. A reference to the type locality, the municipality of Mucugê.
NOTES. Molecular analyses based on nuclear and chloroplast DNA sequences
(Chapter 1) suggest that Prescottia mucugensis is most closely related to P.
phleoides Lindl. and P. leptostachya, respectively.
184
Prescottia mucugensis can be distinguished morphologically from these two
taxa by its inflorescence and flowers. Prescottia phleoides has multiflorous and
congested inflorescences, while P. leptostachya and P. mucugensis have it more
loose. Prescottia mucugensis can be distinguished from these also by its angular
rachis shape, while in the other two it is cylindrical. Additionally, the lateral sepals are
reflexed (with distal part adpressed to the ovary) in P. leptostachya, whereas the
lateral sepals in P. mucugensis and P. phleoides are adpressed to the lip. Prescottia
leptostachya and P. phleoides have pale green sepals and petals with green lip.
Prescottia mucugensis has the sepals and petals greenish, with some brown, and a
whitish to yellowish lip.
185
A
1 cm
1 mm
C
D
E
1 mm
0.2 mm
G
F
K
1 mm
0.2 mm
J
0.2 mm
H
I
B
Figure 22. Prescottia mucugensis. Drawn from fresh material. A. Habit. B. Detail of
inflorescence. C-E. Flower. C. Front view. D. Lateral view. E. Dorsal view. F. Floral
bract. G. Perianth parts, clockwise from top: lip, dorsal sepal, petal, lateral sepal. H-J.
Column with pollinarium in place. H. Dorsal view. I. Ventral view. J. Lateral view. K.
Pollinarium. (Azevedo 253).
186
10. Prescottia oligantha (Sw.) Lindl., Gen. sp. orchid. pl.: 454. 1840. [Cogniaux
1909; Fawcett & Rendle 1910; Small 1913; Gale & Baldomero 1938; Williams 1946;
Williams 1951; Hodge 1953; Williams 1956; Britton & Millspaugh 1962; Dunsterville &
Garay 1966; Schweinfurth 1967; Wiggins & Porter 1971; Adams 1972; Garay &
Sweet 1974; Pabst & Dungs 1975; Garay 1978; Hamer 1985; Ackerman 1989;
Correa 1992; Ackerman 1995; Gloudon & Tobisch 1995; McLeish et al. 1995;
Sprunger 1996; Bennett & Christenson 1998; Espejo-Serna & López-Ferrari 1998;
Jørgensen & León-Yánez 1999; Balick et al. 2000; Dix & Dix 2000; Nir 2000;
Feldmann & Barré 2001; Stevens et al. 2001; Hammel et al. 2003; Rocha &
Waechter 2006]. ≡ Cranichis oligantha Sw. Prodr. Ind. Occ. 120. 1788. [Lindley
1840a; Cogniaux 1909; Fawcett & Rendle 1910; Gale & Baldomero 1938; Williams
1946; Williams 1951; Hodge 1953; Williams 1956; Britton & Millspaugh 1962;
Dunsterville & Garay 1966; Schweinfurth 1967; Wiggins & Porter 1971; Garay &
Sweet 1974; Garay 1978; Hamer 1985; Ackerman 1989; Sprunger 1991; Correa
1992; Ackerman 1995; McLeish et al. 1995; Sprunger 1996; Bennett & Christenson
1998; Espejo-Serna & López-Ferrari 1998; Nir 2000; Johnson 2001; Stevens et al.
2001; Hammel et al. 2003; Govaerts 2004; Rocha & Waechter 2006]. Protologue:
“Jamaica”, without collector or date. Type: Jamaica: (mont. Caerul.) Swartz s.n.
(lectotype BM! (selected by Azevedo & van den Berg 2007a). Fig. 23.
= Cranichis micrantha Spreng., Syst. Veg. 3: 700. 1826. [Cogniaux 1909; Dunsterville
& Garay 1966; Wiggins & Porter 1971; Garay 1978; Hamer 1985; Sprunger
1991; Sprunger 1996; Bennett & Christenson 1998; Nir 2000; Stevens et al.
2001; Govaerts 2004]. isonym (see discussion below).
= Prescottia micrantha Lindl., Bot. Reg. 22: t. 1916. 1836. [Wiggins & Porter 1971;
Pabst & Dungs 1975; Sprunger 1991; Sprunger 1996; Rocha & Waechter 2006].
Protologue: “Brazil, Sierra d’Estrella, Dr. Griesebach.” without collector number
or date. Type: Brazil: Sierra d’Estrella, Griesebach s.n. (holotype K-L!).
= Prescottia tenuis Lindl., Gen. sp. orchid. pl.: 454. 1840. [Dunsterville & Garay 1966;
Schweinfurth 1967; Wiggins & Porter 1971; Garay 1978; Hamer 1985; Sprunger
1991; McLeish et al. 1995; Sprunger 1996; Bennett & Christenson 1998; Stevens
et al. 2001; Govaerts 2004; Rocha & Waechter 2006]. Protologue: “Hab. In
187
Peruvia, Mathews 1862 (exam. s. sp. in hb. Hooker).” Type: Peru: Mathews 1862
(holotype K!; line drawing K-L!).
= Prescottia myosurus Rchb. f. ex Griseb., Fl. Brit. W. I.: 640. 1864. [Cogniaux 1909;
Fawcett & Rendle 1910; Gale & Baldomero 1938; Hodge 1953; Dunsterville &
Garay 1966; Wiggins & Porter 1971; Garay 1978; Garay & Sweet 1974; Hamer
1985; McLeish et al. 1995; Bennett & Christenson 1998; Nir 2000; Stevens et al.
2001; Govaerts 2004]. Protologue: “Jamaica!, Pd., Wullschl., on rocks and in
mountain pastures, Manchester, Hanover; Dominica!, Imr.; [Cuba!].” Lectotype:
Dominica, Imray 228 (lectotype K!)
= Prescottia microrhiza Barb. Rodr., Gen. spec. Orchid. 1: 179, t. 492. 1877.
Protologue: “Sur le bord des chemins pres de la riviere Sapucahy. Fleurit au
mois de Mai.” synon. nov. Lectotype (here designated): Barbosa Rodrigues’
original drawing (plate t. 492) in the library of the Jardim Botânico do Rio de
Sprunger et al. (1996), 2: t. 90.]
= Prescottia pubescens Barb. Rodr., Gen. spec. Orchid. 1: 178, t. 469. 1877.
Protologue: “Dans la foret de la serra da Pedra Branca à Caldas. Fleurit au mois
de Mai.” synon. nov. Lectotype (here designated): Barbosa Rodrigues’ original
drawing in the library of the Jardim Botânico do Rio de Janeiro [reproduction
printed in “Iconographie des Orchidées du Brésil”, Sprunger et al. (1996), 2: t.87].
= Prescottia nivalis Barb. Rodr., Gen. spec. Orchid. 2: 278, t. 818. 1881. Protologue:
“Croissant parmi les fougeres des bords des chemins pres Palmeiras, à Rio de
Janeiro. Fleurit en Juillet.” synon. nov. Lectotype (here designated): Barbosa
Sprunger et al. (1996), 2: t. 88B.]
= Prescottia viacola Barb. Rodr. Gen. spec. Orchid. 2: 279. 1881. [Dunsterville &
Garay 1966; Wiggins & Porter 1971; Pabst & Dungs 1975; Garay 1978; Hamer
1985; Sprunger 1991; Correa 1992; McLeish et al. 1995; Sprunger 1996; Bennett
& Christenson 1998; Johnson 2001; Stevens et al. 2001; Govaerts 2004].
Protologue: “pres Água Comprida à S. Gonçalo da Campanha, Minas Gerais.
Florasion Aout.” Lectotype (here designated): Barbosa Rodrigues’ original
drawing in the library of the Jardim Botânico do Rio de Janeiro [reproduction
188
printed in “Iconographie des Orchidées du Brésil”, Sprunger et al. (1996), 1: t.
65A.].
= Prescottia viacola var. polyphylla Cogn. in Mart., Fl. Bras. 3(6): 549. 1906.
[Dunsterville & Garay 1966; Wiggins & Porter 1971; Sprunger 1991; Sprunger
1996]. Protologue: “Habitat prope Ponte de Xavier ad Ouro Preto prov. Minas
Gerais: L. Damazio n. 1106.” Type: Brazil: Minas Gerais, Ponte de Xavier ad
Ouro Preto, Damazio 1106 (not in BR).
= Prescottia filiformis Schltr., Repert. Spec. Nov. Regni Veg. Beih. 7: 50. 1920.
[Dunsterville & Garay 1966; Wiggins & Porter 1971; Garay 1978; Hamer 1985;
Sprunger 1991; Sprunger 1996; Bennett & Christenson 1998; Stevens et al.
2001; Govaerts 2004]. Protologue: “Cauca: 1800 m., M. Madero”, without
collector number or date. Type: Colombia, Cauca: 1800 m., Madero 73
(lectotype: drawing of type AMES! (selected by Azevedo & van den Berg 2007a).
= Prescottia gracilis Schltr., Repert. Spec. Nov. Regni Veg. Beih. 7: 51. 1920.
[Dunsterville & Garay 1966; Wiggins & Porter 1971; Garay 1978; Hamer 1985;
Sprunger 1991; McLeish et al. 1995; Sprunger 1996; Bennett & Christenson
1998; Stevens et al. 2001; Govaerts 2004; Rocha & Waechter 2006]. Protologue:
“Antioquia: c. 2000 m., M. Madero”, without collector number or date. Type:
Colombia: Antioquia, c. 2000 m, Madero 62 (lectotype: drawing of type AMES!
(selected by Azevedo & van den Berg 2007a).
= Prescottia panamensis Schltr., Repert. Spec. Nov. Regni Veg. 16: 357. 1920.
[Williams 1946; Williams 1956; Dunsterville & Garay 1966; Wiggins & Porter
1971; Garay 1978; Hamer 1985; Sprunger 1991; McLeish et al. 1995; Sprunger
1996; Bennett & Christenson 1998; Stevens et al. 2001; Govaerts 2004].
Protologue: “Panama: In savannas, Cerro Vaca, Chiriqui, 900-1000 m - H. Pittier
no. 5358, dez.1911.” Lectotype (here designated): Panama: eastern Chiriqui,
Cerro Vaca, 900-1136 m, Pittier 5358 (lectotype US!; isolectotype AMES! With
drawing).
Terrestrial herb. Leaves 2(-4), basal, petiolate; petiole 1.0-6.0 cm long, green; blade
(1.0-)3.0-6.0(-11.0) cm long, (0.7-)1.5-2.7(-4.0) cm wide, membranaceous, elliptic to
lanceolate, green, apex acute, base attenuate to obtuse, margin entire. Inflorescence
189
loose, (10-)30-100-flowered; peduncle (4.0-)28.0(-43.0) cm long, 0.1-0.2 cm wide,
green; peduncle bracts 3-6, 10.0-20.0 mm long, 1.3-3.0 mm wide, ovate, rose-red to
green, apex acute; rachis (2.0-)3.0-8.0(-19.0) cm long, 0.4-0.6 cm wide, green to
rose-red. Flower bracts 2.5-3.4(-5.0) mm long, 1.3-1.5(-1.8) mm wide, ovate, green to
rose-red, apex acuminate to acute; flower erect, white; dorsal sepals revolute, 1.31.9 mm long, 0.8-1.2 mm wide, triangular to ovate, white with purplish spot at the
apex, apex acute; lateral sepal patent to revolute, 1.9-3.2 mm long, 1.1-1.5 mm wide,
ovate to oblong, white with purplish spot at the apex, apex acute; petals revolute, 1.22.0 mm long, 0.5-0.7 mm wide, linear, white, apex acute to obtuse; lip 1.5-2.2 mm
long, 2.0-2.2 mm wide, white, inner surface pilose. Column 0.8-0.9 mm long,
glabrous.
DISTRIBUTION. Prescottia oligantha occurs throughout the West Indies, Florida,
Mexico, Central America, tropical South America: Ecuador, including the Galapagos
Islands, Colombia, Venezuela, British Guiana, Paraguay, Uruguay, Bolivia, Peru, and
Argentina. In Brazil it occurs at Roraima, Alagoas, Bahia, Espírito Santo, Rio de
Janeiro, São Paulo, Distrito Federal, Goiás, Mato Grosso do Sul, Minas Gerais,
Paraná, Santa Catarina, and Rio Grande do Sul. Map 7.
s.l., s.d., s.n. (R35564); s.l., s.d., Brade, A.C. 15159 (W); New Providence, E.G. Britta
1905 # 3206, 03/04/07, Nash, G.V. 22072 (NY); s.l., 07/40, Scheacho, F. s.n.
(GH59708); s.l., 15/10/1907, Usteri, P.A. 02 (K); s.l., 27/08/1864, Warming, E. 126
(W); Antilles, 11/05/1921, Husnot, T. s.n. (P00366669); West Indies, Ridge above
Baker's Hill Village, Parish of St. Peter, Montserrat, 28/02/1976, Adams, B.R. M 01
(GH); San Jan, Makombo, 30/03/1906, Raunkiaer, C. s.n. (US1959324); San Jan,
Makombo, 30/03/1906, Raunkiaer, C. s.n. (P00366679). ARGENTINA, Misiones,
Iguazú Dpt., Iguazú Nat. Park, Area Cataratas, Area influencia sendero Macuco,
04/08/1992, Johnson, A. 298 (CTES); BAHAMAS, New Providence, Maiden head
Coppice, 1905, Britton, E.G. 3206 (NY); New Providence, 28/02/1905, Britton, E.G.
3437 (GH, NY). BELIZE, Below summit of Baldy Sibuia, Mountain Pine Ridge, Cayo
District, 09/03/1981, Adams, B.R. 281 (K). BOLIVIA, s.d., Bang, M. 2439 (NY);
Yungas, Chulumani, 07/1933, Cardenas, M. 1370 (GH); Santa Cruz, Nuflo de
Chavez, Rancho Jinca, 90 km SE of Concepcion, 18/07/19885, Killeen, T. 1032 (F);
190
Chape Yungas, s.d., d’Orbigny, A.D. 437 (P); s.l., 09/07/1902, Williams, R.S. 1626
(NY). BRAZIL, 1872, Burchell, W.J. 313 (P); Sierra d’Estrella s.d., Griesebach s.n.,
holotype, Prescottia micrantha Lindl. (K-L, photo MO); Campus de Butantã,
01/09/1977, Joly, A.B. 461 (SPF); Jardim Botânico, 20/09/1921, Occhioni, P. s.n.
(ICN46309); s.l., 08/05/1868, Regnell, A.F. III 1201 (P); s.l., s.d., Schwacke, C.A.W.
11497 (RB); s.l., 30/07/1895, Schwacke, C.A.W. 11549 (P); Serra da Mantiqueira,
08/1894, Silveira, A. 315 (R); In sylva, s.d., Spruce, A. s.n. (W13997); Lagoa Santa,
s.d., Warming, E. 2714 (P); Alagoas, 28/10/1980, Andrade-Lima, D. 80 9724
(HUEFS, IPA); Bahia, Coração de Maria, Estrada para Retiro, ca. 10 km SE de Feira
de Santana, 22/09/1995, França, F. 1361 (HUEFS); Maraú, Peninsula de Maraú.
Area de Preservação Ambiental (APA), Faz. Virgem Del Mar, 14/08/1999, Jardim,
J.G. 2180 (CEPEC); Rui Barbosa, Serra do Orobó, Riacho da Prata, 05/09/2004,
Queiroz, L.P. de 9534 (HUEFS); Distrito Federal, Córrego Vicente Pires, perto da
estrada velha de Setor Industrial a Taguatinga, 10/08/1983, Kirkbride, J.H. 5357
(UB); Brasília, Parque Nacional de Brasília, próximo ao portão de entrada (ca. 1km),
03/07/1992, Barros, M. 2354 (UB); Brasília, Setor de Mansões, Lago Norte, 07/1989,
Batista, J.A.N. 03 (HEPH); Brasília, Região Administrativa X, Guará, Reserva
Ecológica do Guará, trecho da Reserva a direita da estrada Parque Taguatinga, no
sentido plano piloto-Guará, 11/08/2001, Batista, J.A.N. 1241 (CEN); Brasília,
Reserva Biológica de Águas Emendadas, 10/02/1991, Batista, J.A.N. 184 (CEN);
Brasília, Córrego Carirú cortado dela DF - 130, 16/06/1991, Batista, J.A.N. 200
(CEN); Brasília, Cachoeira do Tororó, Córrego Pau de Cacheta, aprox. 3 km da DF –
1, Estrada de terra próxima a entrada da reserva Ecológica do IBGE, 14/06/1990,
Batista, J.A.N. 30 (CEN); Brasília, Reserva Biológica de Águas Emendadas,
19/07/1992, Batista, J.A.N. 311 (CEN); Brasília, Rio Maranhão, DF - 130, em direção
a Planaltina de Goiás, limite do Distrito Federal com Goiás, um pouco abaixo da
ponte sobre o rio, 30/04/1999, Batista, J.A.N. 929 (CEN); Brasília, Mata próxima da
DF - 100, entre o Ribeirão Jacaré e o Ribeirão Extrema, 16/06/1991, Bianchetti, L.
1165 (CEN); Brasília, Reserva IBAMA-SEMATEC, CIPLAN (cimentos planalto), DF –
205, 58 km CENARGEM e 43 km da CIPLAN, 25/06/1992, Dias, T.A.B. 231 (CEN);
Brasília, Reserva Ecológica do IBGE. Coletada entre as chácaras 3 e 4, 17/08/1978,
Heringer, E.P. 599 (IBGE); Brasília, Chapada da Contagem, ca. 15 km E of Brasília,
18/08/1964, Irwin, H.S. 5291 (NY, SEL, UB); Brasília, Reserva Biológica de Águas
191
Emendadas, ca. 40 km a NE de Brasília, 29/08/1983, Maury, C.M. 451 (HEPH,
INPA); Brasília, Reserva Biológica de Águas Emendadas, ca. 40 km a NE de
Brasília, 13/07/1982, Ramos, A.E. 54 (HEPH); Brasília, Reserva Biológica de Águas
Emendadas, ca. 40 km a NE de Brasília, 19/07/1982, Ramos, A.E. 72 (HEPH);
Espírito Santo, Itapemirim, Itaoca, APA de Guanandy, 09/02/1995, Fraga, C.N. 470
(MBML); Goiás, Caldas Novas, margem direita do Rio Corumbá, 2 km da barragem,
a montante, próximo ao canteiro de obras, 11/06/1996, Cavalcanti, T.B. 1977 (CEN);
Valparaíso de Goiás, Bairro Valparaíso II, próximo ao lixão, ao lado da pista de chão
que segue para o pedregal, 30/06/2001, Miranda, Z.J.G. 82 (CEN); Mato Grosso do
Sul, Corumbá*, Rio Corumbá, 02/03/1979, Salles, A.E.H. 95 (IBGE); Minas Gerais,
Serra de Cural del Rey, 09/1845, s.l, s.n. (BM61730); Serra de Cural del Rey, 09/40,
s.l., s.n. (K-L); Serra de Cural del Rey, 09/1845, Gardner, G. 5195 (K); Near Ouro
Preto, 10/1840, Gardner, G.* 5197 (BM); Grão Mogol, rod. para Cristalia,
13/02/1990, Hatschbach, G. 54241 (MBM); estrada entre Pomba e Piraúba,
13/07/1947, Heringer, E.P. 2532 (SP); Fazenda do Engenho, 3 km de Paraopeba,
11/07/1955, Heringer, E.P. 3937 (UB); Sítio, 16/06/1945, Krieger, L. 1032 (CESJ);
Serra da Moeda, 04/10/1989, Pequeno, P.H.A. 116 (BHCB); Serra da Itabira,
11/09/1887, Schwacke, C.A.W. 5870 (RB); Serra da Caparão, 09/02/1890,
Schwacke, C.A.W. 6791 (RB); Alagoa, morro com campo com vista do sitio
Quaresmeira, em frente à pousada, 04/03/2003, Pansarin, E.R. 1008 (UEC);
Araponga, Parque Estadual da Serra do Brigadeiro, Serra da Araponga, Faz.
Neblina, próximo ao laboratório de campo, trilha subindo morro, 30/09/1995,
Lombardi, J.A. 988 (BHCB); Baipendi, São Thomé das Letras, 13/07/1950, Brade,
A.C. 20415 (RB); Barbacena, s.d., Schwacke, C.A.W. 11549 (RB); Brumadinho,
Retiro das Pedras, 11/08/2001, Viana, P.L. 126 (BHCB); Caldas, 08/05/1968,
Henschen, S.E. III 1201 (US); Catas Altas, Serra do Caraça, 15/09/2004, Mota, R.C.
2393 (BHCB); Catas Altas, Serra do Caraça, 07/08/2002, Mota, R.C. 2438 (BHCB);
Conceição do Mato Dentro, Parque Natural Municipal do Ribeirão do Campo,
05/05/2003, Mota, R.C. 2521 (BHCB); Itabirito, Pico do Itabirito, Serra dos
Inconfidentes, 09/06/1994, Teixeira, W.A. s.n. (BHCB 26110); Jaboticatubas, Serra
do Cipó, 05/08/1972, Hatschbach, G. 29935 (MBM); Juramento, Plantar MG 15 Fazenda Tamandua, 10/04/2005, Tameirão Neto, E. 4186 (BHCB); Lavras, Reserva
Poço Bonito, 14/09/1987, Gavilanes, M.C. 3490 (ESAL); Moeda, Serra da Moeda,
192
30/07/1987, Andrade, I.R. 199 (BHCB); Ouro Preto, 08/1903, Damasio, L. 1026 (RB);
Ouro Preto, Morro da Queimada, 10/08/1937, Mello-Barreto, H.L. 8316 (SP); Rio
Vermelho, Serra do Ambrósio, 10/01/2006, Viana, P.L. 2454 (BHCB); Santa Rita de
Jacutinga, 27/07/1970, Urbano 8887 (CESJ, RB); Santo Antônio do Itambé, Pico
Itambé, 09/08/1972, Hatschbach, G. 30128 (MBM); Santos Dumont, no barranco
antigo, a beira da estrada de ferro, 14/07/1983, RMS s.n. (CESJ20005); São João
del Rei, Bengo, 02/06/1986, Krieger, L. s.n. (HUEFS99511); Viçosa, Railroad cut
near km 377, 31/07/1930, Mexia, Y. 4934 (GH); Minas Gerais*, São João D'el Rei,
06/1896, Silveira, A. 1416 (R); Andrelândia, Fazenda da Parahyba, 23/08/1936,
Mello Barreto, H.L. 5284 (BHCB); Paraná, entre Rio das Pombas e Rio dos
Papagaios, Palmeira, 12/10/1970, Dombrowski, L.Th. 3001 (MBM); Jacarehy,
06/07/1914, Dusén, P. 15341 (S); Serrinha, 08/10/1914, Dusén, P. 15559 (F, GH,
MO, NY, line drawing S, S); Jacarehy, 07/1915, Dusén, P. 17265 (GH, S); Jacarehy,
07/1915, Dusén, P. 17265 (GH, S); Serrinha, 28/10/1908, Dusén, P. 6952 (GH);
Serrinha, 14/05/1909, Dusén, P. 8541 (S); Ilha do Mel, Baia de Paranaguá, 07/1949,
Hertel, R. s.n. (SP69704); Porto de Cima, 19/10/1908, Lange, R. 6642 (MBM);
Tibagi, 10/08/1934, Reiss, R. 80 (F, NY); Fazenda Padre Ignácio, estrada Curitiba
Palmeira, 16/10/1947, Tessmann, G. 2515 (MBM); Caiobá (na costa do atlântico), 35
km ao sul de Paranaguá, 05/11/12947, Tessmann, G. s.n. (MBM2149540); Balsa
Nova, Serra São Luiz do Purunã, 07/10/1996, Cordeiro, J. 1313 (MBM); Balsa Nova,
Rod. BR-277, Serra São Luiz do Purunã, 28/10/1996, Ribas, O.S. 1535 (MBM);
Bocaiúva do Sul, Mandassaia, 11/10/1977, Dombrowski, L.Th. 7583 (MBM);
Bocaiúva do Sul, Capivari, 16/10/1949, Hatschbach, G. 1542 (MBM, SP); Bocaiúva
do Sul, Salto, 12/11/1959, Hatschbach, G. 6475 (MBM); Castro, Fundão, 02/10/1964,
Hatschbach, G. 11648 (MBM); Curitiba, Jardim das Américas, 05/11/1992, Cordeiro,
J. 893 (MBM); Curitiba, 20/09/1915, Dusén, P. 17167 (S); Curitiba, 07/11/1948,
Hatschbach, G. 1074 (MBM, SP); Curitiba, Tarumã, 18/10/1971, Hatschbach, G.
27659 (MBM); Curitiba, 19/10/1928, Hoehne, F.C. s.n. (SP23075); Curitiba*, Beira da
estrada em serra 8 km S de Tunas, 03/08/1966, Lindeman, J.C. 1961 (MBM);
Guarapuava, Canta Galo, 26/09/1968, Hatschbach, G. 19869 (MBM); Guaratuba,
Brejatuba, 08/06/1993, Guimarães, O. 21039 (CTES, NY, SJRP); Guaratuba,
Brejatuba, 13/08/1950, Hatschbach, G. 2118 (SP); Guaratuba, Brejatuba,
19/05/1991, Silva, J.M. 1016 (BHCB, MBM); Guaratuba, Guaratuba, 21/09/1963,
193
Hatschbach, G. 10244 (MBM); Guaratuba, Serra de Araçatuba, Morro dos Perdidos,
05/03/1999, Santos, E.P. 761 (MBM); Guaratuba, Balneário Nereidas, 11/06/1993,
Silva, J.M. 1258 (MBM); Jaguariaíva, 30/10/1910, Dusén, P. 10771 (S); Jaguariaíva
27/09/1911, Dusén, P. 13048 (F, GH, NY, S); Lapa, Eng. Bley, 26/09/1948,
Hatschbach, G. 1018 (MBM, SP); Lapa, Gruta do Monge, 03/10/1966, Hatschbach,
G. 14783 (MBM); Lapa, Rio Passa Dois, 30/09/1969, Hatschbach, G. 22252 (MBM);
Lapa, Rio Passa Dois, 05/10/1958, Hatschbach, G. 5052 (MBM); Lapa, Rio Iguaçu,
próximo da ponte na Rod. PR-427, 04/09/2001, Silva, J.M. 3434 (MBM); Laranjeiras
do Sul, Rincão Grande, 12/10/1974, Hatschbach, G. 35208 (MBM); Matinhos*
[Paranaguá], Caiobá, 02/06/1961, Hatschbach, G. 8150 (MBM); Morretes, arredores
da cidade, margem da Estrada Graciosa, 22/09/1946, Hatschbach, G. 377 (MBM,
RB); Morretes, 13/10/1976, Kuniyoshi, Y.S. 4022 (MBM); Morretes*, Serra do Mar,
Porto de Cima, 1914, Dusén, P. s.n. (GH71598); Palmeira, Córrego da Anta,
30/09/1982, Hatschbach, G. 45498 (MBM); Paranaguá, Morro do Meio, Ilha do Mel,
29/05/1987, Britez, R.M. 1535 (MBM); Paranaguá, Morro do Joaquim, Ilha do Mel,
12/09/1987, Britez, R.M. 1786 (MBM); Paranaguá, Morro do Joaquim, Ilha do Mel,
12/09/1987, Britez, R.M. 25339 (MBM); Paranaguá, Ilha do Mel, 16/08/1987, Britez,
R.M. 25726 (MBM); Paranaguá, Ilha do Mel, perto do cemitério e da usina elétrica,
05/06/1996, Cocucci, A A s.n. (MBM226971); Paranaguá, Ilha da Gamela,
19/06/1992, Dunaiski Jr., A. 238 (BHCB); Paranaguá, Alexandra, 11/10/1975,
Dziewa, A 76 (MBM); Paranaguá, Rio Perequê, 30/10/1966, Hatschbach, G. 15201
(MBM); Paranaguá, Pontal do Sul, 25/09/1967, Hatschbach, G. 17228 (MBM);
Paranaguá, Ipanema, 27/08/96, Hatschbach, G. 22114 (MBM, MO, NY); Paranaguá,
Rio Perequê, 31/05/1962, Hatschbach, G. 9140 (MBM); Paranaguá, arredores,
12/10/2003, Ribas, O.S. 5190 (MBM); Paranaguá, Ilha das Cobras, 15/06/1986,
Silva, S.M. 25024 (UEC); Ponta Grossa, Vila Velha, 07/10/1969, Hatschbach, G.
22345 (MBM); Quatro Barras, Rio Taquari, 08/10/1968, Hatschbach, G. 19943
(MBM); Rio Branco do Sul, Serra do Votuvoru, 09/10/1975, Hatschbach, G. 37314
(MBM, UEC); Sengés, Fda. Morungava, Rio do Funil, 09/09/1959, Hatschbach, G.
6283 (MBM); Tibagi, Alto do Amparo, 06/09/1966, Hatschbach, G. 14671 (MBM,
US); Ventania, Rod. PR-153, Rio Laranjinha, 03/09/1998, Hatschbach, G. 68305
(MBM); Rio de Janeiro, Mauá, s.d., s.n. (R35568); Niterói, estrada para "Piratonim",
07/08/1882, "Bello" 6226 (R); Mauá, 05/08/1875, Glaziou, A. 8036 (K, P, W);
194
08/1921, Kuhlmann, J.G. s.n. (RB16337); Mauá, 1875, Schwacke, C.A.W. 1360
(RB); Pedra da Gávea, 05/10/1967, Sucre, D. 1651 (RB); s.l., 1843, Weddell, H.A.
290 (P); Araruama, Zacara, à margem da lagoa do Espinho, 19/08/1982, Araujo, D.
5132 (GUA); Itatiaia, na serra entre Campo Belo e Monteserrat, 22/07/1901,
Hemmendorff 524 (R); Itatiaia, Parque Nacional de Itatiaia, na margem do Lago Azul,
na trilha, 12/07/2006, Azevedo, C. 268 (HUEFS); Itatiaia, pr. Lago Azul, 02/07/66,
Pabst, G.F.J. 8909 (M); Itatiaia, Parque Nac. Itatiaia, Lago Azul, 11/07/1953, Pereira,
E. 58 (RB); Penedo, Estrada de Visconde de Mauá km 9, 16/07/1988, B 525
(SP254764); Petrópolis, 10/11/1936, Spannagel, C. 427 (RB); Rio de Janeiro,
Marapendi, Parque Municipal Natural de Marapendi, Recreio dos Bandeirantes,
17/07/2006, Azevedo, C. 271 (HUEFS); Rio de Janeiro, Gávea, 03/1915, Hoehne,
F.C. 234 (SP); Rio de Janeiro, Gávea 14/09/1895, Ule, E. s.n. (R35570); Rio de
Janeiro*, Praia da Gávea, 07/1916, Frazão, A. s.n. (RB7579); Rio de Janeiro*,
Jardim Botânico, 20/09/1921, Occhioni, P. s.n. (RB480); Rio de Janeiro*, Province
de Rio de Janeiro, 1816-1821, Saint-Hilaire, A. de A' 427 (P); Guanabara, pr. Lagoa
da Tijuca, 13/08/1961, Pabst, G.F.J. 5670 (K, M, PEL); Rio de Janeiro/Minas Gerais,
s.d., Griesebach s.n. (photo NY533742); Rio de Janeiro*, Sebastianopolis, 1847,
Shenck com. Cl. Martius s.n. (M); Rio Grande do Sul, In summo Monte Sapucaia
para S.L., 26/10/1955, Rambo, B. s.n. (PACA57063); Arroio dos Ratos, Fazenda
Faxinal, 04/11/1979, Hagelund, K. 13179 (CTES, ICN, MBM); Bagé, 02/04/1985,
Mattos, J. 28899 (HAS); Caçapava do Sul, ca. de 5 km da cidade, na rodovia
Caçapava-Bagé, 22/10/1986, Mattos, J. 30175 (HAS); Esteio, Esteio p. Porto Alegre,
25/10/1950, Rambo, B. s.n. (PACA49058); Esteio, S. Leopoldo, 25/10/1950, Rambo,
B. s.n. (B1000027810); Guaíba, Fazenda São Maxiliano, 16/09/1977, Citadini, V. 243
(ICN); Porto Alegre, 10/1932, Canisio, P. 1140 (ICN); Porto Alegre, Jardim Botânico
de Porto Alegre, 22/10/1985, Haussen, M. s.n. (HASU789); Porto Alegre, Morro da
Glória, 05/10/1932, Orth, C. 103 (SP); Porto Alegre, Vila Manresa/M. da Glória,
22/10/1932, Orth, L. s.n. (PACA103); Porto Alegre, Vila Manresa, perto de Porto
Alegre, 29/09/1948, Rambo, B. 37802 (ICN); Porto Alegre, Morro da Polícia, 1944,
Rambo, B. s.n. (PACA27055); Porto Alegre, Vila Manresa, 29/09/1948, Rambo, B.
s.n. (PACA37802); Porto Alegre, Vila Manresa/M. da Glória, 21/09/1931, Rambo, B.
s.n. (PACA1710); Porto Alegre, 08/1932, Wiesen s.n. (GH39307); São Francisco de
Paula, RS 235 em beira do caminho, 04/11/2001, Wasum, R. 1232 (US); São
195
Leopoldo, Quinta São Manoel, 27/10/1925, Dutra, J. 964 (ICN); São Leopoldo,
10/1941, Leite, J.E. 429 (NY); São Leopoldo, 09/1940, Rohr, J.A. s.n. (RB43481);
São Leopoldo, 07/1931, Wiesen s.n. (GH39296); Sapiranga, Recanto da CascataPicada Verão, 12/10/1991, Nunes, V.F. 1302 (PACA); Terra de Areia, Serraria, prox.
BR 101, 01/2000, Gonçalves, C.N. 192 (ICN); Terra de Areia, Arroio Bonito, 01/2000,
Gonçalves, C.N. 31 (ICN); Torres, Butiazal, 25/09/1969, Favalli, J. s.n. (ICN7057);
Triunfo, no Polo Petroquímico, COPESUL, 06/11/1992, Silveira, N. 11625 (HAS);
Viamão, Itapoã, 25/10/1975, Waechter, J.L. 199 (ICN); Viamão*, Viamão, Parque
Estadual Itapoã, 21/09/1990, Haussen, M. s.n. (HASU2029); Roraima, 06/64, Appan,
C. 1389 (K); Serra dos Surucucus, NE of Mission station, 17/02/1969, Prance, G.T.
10012 (INPA); Santa Catarina, Araranguá, no barranco do caminho, Turvo,
11/11/1943, Reitz, R. C 155 (GH, RB); Azambuja, Brusque, 04/10/1961, Klein, R.
2650 (US); Itajaí, Morro da Cruz, 17/09/1961, Klein, R. 2509 (NY, US); Palhoça,
campo do Massiambu, 24/09/1953, Reitz, R. 1002 (PACA); Palhoça, campo do
Massiambu, 24/09/1953, Reitz, R. 1008 (PACA); Parati, 26/10/1928, Hoehne, F.C.
s.n. (SP23187); Santa Catarina*, Azambuja, Brusque, 26/09/1952, Reitz, R. 4775
(PACA); São Paulo, 1953, s.n. (P00366660); Santa Ana, 18/10/1907, Barbosa, J. 02
(SP); S. Anua, 20/10/1912, Brade, A.C. 6215 (S); s.l., s.d., Everett, H.L. s.n.
(GH83182); Ca. 50 km S de Itapetininga, estrada a Registro. Reserva Florestal de
Carlos Botelho, 26/10/1976, Gibbs, P.E. 3261 (F, MBM, NY, UEC); Iguape,
21/09/1929, Hoehne, F.C. 24283 (NY); Butantan, 07/09/1917, Hoehne, F.C. 434
(BM, M, R); Estação Biológica Alto da Serra, 04/11/1924, Hoehne, F.C. s.n.
(SP17799); Santo Amaro, 19/08/1943, Roth, L. 391 (SP); Guarujá, 25/07/1907,
Usteri, P.A. 03 (K); Cananéia, Ilha Comprida, estrada entre a balsa e a Praia da Ilha
Comprida, 08/09/1994, Basso, M.E. MEB 16 (ESA, HUEFS, UEC); Cananéia,
Parque Estadual da Ilha do Cardoso, 30/08/1998, Pansarin, E.R. 304 (UEC);
Caraguatatuba, próximo Caraguatatuba, Martim de Sá, 17/07/1953, Hoehne, W.
5028 (SPF); Ibiúna, ca. 2 km da estrada que sai a esquerda (sentido São PauloIbiúna) da Rodovia SP-250, km 63, 11/08/1998, Cordeiro, I. 1764 (HUEFS, SP);
Iguape, Iguape and Caiacanga, 10/1910, Brade, A.C. 5015 (S); Iguape, Estação
Ecológica Juréia-Itatins, Serra da Juréia, trilha para o alto do morro, 13/06/1991,
Carvalhaes, M.A. 42 (SP); Iguape, Reserva Ecológica Juréia-Itatins, Serra da Juréia,
Caminho do Imperador, 19/06/1990, Cordeiro, I. 648 (SP); Iguape, Estação
196
Ecológica Juréia-Itatins, Caminho do Imperador, 14/08/1992, Ferreira, S. 567
(HUEFS, SP); Iguape, 21/09/1929, Hoehne, F.C. s.n. (SPF72241); Iguape,
21/09/1929, Hoehne, F.C. s.n. (SP24283); Iguape, 21/09/1894, Loefgren, A. 2629
(SP); Iguape, Barra do Ribeira, 16/07/1989, Yano, O. s.n. (SP235134); Ilha do
Cardoso, 09/10/1894, Loefgren, A. 2728 (SP); Itanhaem, Praia Grande, 28/07/1954,
Kuhlmann, M. 2979 (SP); Itirapina, 29/08/1985, Cesar, O. 607 (HRCB); Jabaquara,
29/10/1939, Hashimoto, G. 237 (SP); Jaraguá, 11/08/1912, Brade, A.C. 6214 (S);
Peruíbe, 13/10/1990, Furlan, A. 1243 (HRCB); Peruíbe, Estação Ecológica da Juréia,
Praia do Guarauzinho, 22/07/1988, Souza, V.C. 28 (ESA, HUEFS); Samaritá,
Estrada de ferro Mayrink a Santos, entroncamento da E.F. Santos-Juquiá,
01/09/1938, Hoehne, F.C. s.n. (SP39684); Santo Amaro, Sitio do Sr. Pedro Roschel,
19/11/1893, Edwall, G. 2236 (SP); Santo Amaro, 19/08/1943, Krieger, L. 391 (CESJ);
São Paulo, São Paulo, Parque Estadual das Fontes do Ipiranga, 07/09/1990, Barros,
F. 1866 (SP); São Paulo, nativa no Jardim Botânico, 20/10/1940, Handro, O s.n.
(HUEFS115459); São Paulo, Jardim Botânico, 20/10/1940, Handro, O. s.n.
(SP44444); São Paulo, Butantan, 07/09/1917, Hoehne, F.C. s.n. (SP434); São
Paulo, Vila Cerqueira Cezar, 12/10/1917, Hoehne, F.C. s.n. (SP25138); São Paulo,
Cidade Jardim, 15/08/1934, Kuhlmann, M. s.n. (SP31957); São Paulo, 1904,
Puttemans, A. 2096 (RBR); São Paulo, Iguape, 25/07/1907, Usteri, A. s.n.
(SP27055); São Paulo, Ipiranga, 13/08/1895, Usteri, A. s.n. (SP27056); São Paulo,
Vila Mariana, 20/08/1906, Usteri, A. s.n. (SP27053); São Paulo, Avenida Paulista,
05/11/1906, Usteri, A. s.n. (SP29225); São Paulo*, Ipiranga, 18/08/1912, Brade, A.C.
6213 (S); Ubatuba, city of Ubatuba, 24/09/1961, Eiten, G. 3317 (US); Ubatuba,
Picinguaba, BR 101, sentido Pincinguaba-Ubatuba próximo ao Rio Promirim,
08/07/1998, Pansarin, E.R. 207 (UEC); Ubatuba, Praia do Costa, 13/10/1986,
Sazima, M. 18672 (UEC); Ubatuba, Parque Estadual da Serra do Mar, núcleo
Picinguaba, 25/11/1999, Singer, R.B. 99/20 (UEC); Ubatuba, Parque Estadual da
Ilha Anchieta 21/07/1998, Smidt, E.C. 39 (SJRP); Ubatuba, Parque Estadual da Ilha
Anchieta 10/10/1999, Smidt, E.C. 66 (SJRP). BRITISH GUIANA, Kanuku Mountains,
23/07/1958, Harrison 1349 (K). COLOMBIA, 04/09/1882, Lehmann, F.C. 1856 (BM,
W); Antioquia, s.d., Madero, M. 62, lectotype, Prescottia gracilis Schltr. (AMES);
Cauca, s.d., Madero, M. 73, lectotype, Prescottia filiformis Schltr. (AMES); Dep.
Boyaca Ende, 11/1937, Renz, O. 4098 (BBG); Intendencia Meta Anfang, 12/1939,
197
Renz, O. 4148 (BBG); Cauca, ad pag. El Tombo, 02/01/1935, Sneidern, K. 92 (S);
Cundinamarca, Quetame, Monte Redondo, 15/12/1950, Schneider, M. 414 (S);
Cundinamarca, 15/12/1950, Schneider, M. 414/1 (BBG). COSTA RICA, San Pedro
de San Ramón, 08/01/1927, Brenes, A. (100) 1581 (GH); San Pedro de San Ramón,
07/12/1925, Brenes, A.M. 299 (F); San Pedro de San Ramon, 07/01/1924, Brenes,
A.M. 3021 (NY); San Pedro de San Ramon (Province of Alajela), 07/01/1924,
Brenes, A.M. 803 (CR). CUBA, Province do Oriente, Vicinity of El Cuero, 189/03/1912, Britton, N.L. 12770 (NY); Prov. Pinar del Rio, Sierra de las Animas,
15/03/1920, Ekman, E.L. 10521 (S); Prov. Oriente, in a hill called Uijial at Rio Aro,
mont "Bueno-malo", 28/03/1915, Ekman, E.L. 5108 (S); Prov. Oriente, Sierra de
Cristal, in manacales at the headwaters of Rio La brisa, 04/03/1916, Ekman, E.L.
6771 (S); Ote., Gran Piedra, near French ruins, 31/03/1959, Hawkes, A.D. 08 (GH,
US); Prov. Oriente, Arroyo Grande, 08/03/1955, Hawkes, A.D. 08 (GH, US); Base of
El Yunque Mt., Baracoa, 03/1903, Underwood, L.M. 539 (NY); Monte Verde, 016/1859, Wright, C. 1477 (GH, K-L). DOMINICA, 08/03/1940, Hodge, W.H. 1779 (GH,
NY); s.l., 21/04/1946, Stehlé, H. 6396 (US); West Indies, Between Laudat and
Freshwater Lake, 08-09/03/1940, Hodge, W.H. 1779 (GH, NY); West Indies,
Cultivated areas, Hatton Garden Estate, 19/04/1940, Hodge, W.H. 3027 (GH); West
Indies, s.d., Imray, D. 228, lectotype, Prescottia myosurus Rchb. f. ex Griseb. (K).
DOMINICAN REPUBLIC, La Cidra, 07/04/1955, Jiménez, J.J. 2905 (US); South
shore of Samana Bay, Boca de Infierno, 03/03/1928, Miller, G.S. 1036 (US); Santo
Domingo, Finca Mendez Capellan, al norte aereopuerto, 06/03/1978, Dod, D. 657
(SEL); Flora von Santo Domingo, prov. Barahona, 11/02/1910, Fuertes, Pater 840
(GH). ECUADOR, Isabella S-mine inside Sierra Negra, 29/07/1977, Adsersen, A.
2332 (QCNE); Galapagos, Santa Cruz Isl., 03/01/1966, Weber, D. 162 (GH);
Ecuador *, Prov. Napo-pastaza, Mera, grassy ground near Mangayacu, 27/11/1955,
Asplund, E. 18667 (S); Prov. Napo-pastaza, Mera, grassy roadside, 09/12/1955,
Asplund, E. 18757 (S); Prov. Napo-pastaza, Mera, sand-bank in Rio Pastaza,
15/12/1955, Asplund, E. 18853 (S); GRENADA, West Indies, Morre Delice Road, St.
George's, 16/03/1905, Broadway, W.E. s.n. (GH7891); West Indies, St. George's,
16/03/1905, Broadway, W.E. s.n. (GH10633); West Indies, Swamp around the Grand
Etang, 24-06/02-03/1950, Howard, R.A. 10572 (GH). GUADELOUPE, Le long du
canal Dupuy, Houellemonh, 17/03/1896, Duss, Pere = A.Duss 3849 (MO, NY, US);
198
Pointe noire, 04/1843, L'Herminier, F.L. 25 (P); Ste Rose, 25/3/1939, Questel, A.
4001 (US); Ste Rose, 25/3/1939, Questel, A. 4004 (US); Kleine Antillen, 27/01/1970,
Renz, O. 10471 (BBG); Bois de la montagne du Houelmont, 24/03/1934, Rodriguez,
L. 3239 (P); Pigeon, Habitation Marsolle, 02/03/1936, Rodriguez, L. 3973 (P); Forêt
de Sophaïa, 21/03/1936, Rodriguez, L. 4244 (P); Mornes fasaltiques secs. Endroits
humides du Honelment, 25/02/1936, Stehlé, H. 378 (NY, P). JAMAICA, 1855, s.n.
(P00366677); s.l., 1845, s.n. (P00371999); Locality below Newcastel, nr. Morning
road, Parish, St. Andrew, s.d., Adams, C.D. 6347 (M); Parish, St. Catherine. 2 m SW
of Ewarton, nr Rivergead, 12/02/1961, Adams, C.D. 8919 (GH, MO); Dolphin Head
and vicinity, 18-20/03/1908, Britton, N.L. 2310 (NY); Parish of St. Thomas, Balt to
Curea Gap, 1-13/03/1909, Britton, N.L. 4064 (NY); Morse's Gap, 05/02/1908, Harris,
W. 10094 (NY); s.l., 06/03/1900, Harris, W. 7844 (BM); County of Middlesex, St. Ann
parish, 06/03/1936, Hunnewell, F.W 14291 (GH); Morces Gap and vicinity,
14/03/1920, Maxon, W.R. 1085 (GH, US); Upper slopes of Mount Diabolo, 2528/02/1920, Maxon, W.R. 512 (F, GH, P, US); s.l., s.d., Morris J.P. 471 (NY); Holly
Mt. Hill, 12/03/1967, Read, R.W. 1836 (US); Parish of St. Andrew, 27/01/1961, Renz,
O. 9883 (BBG); Parish of St. Catherine, 31/01/1961, Renz, O. 9884 (BBG); Parish of
St. Andrew, 04/02/1961, Renz, O. 9894 (BBG); (Mont. Caerul.), s.d., Swartz, O. s.n.,
lectotype, Cranichis oligantha Sw. (BM53892, drawing BM91704, photo of drawing
NY232317); Mt. Moses, s.d., Syme, G. JP 2156 (NY). MARTINIQUE, Savanes
Balata, 03/1903, Mouret, M. 377 (P). MEXICO, Vera Cruz, near Martinez de la Torre,
30/03/1935, Juan, G. 4659 (GH); MONTSERRAT, 13/02/1907, Shafer, J.A. 530
(NY). PANAMA, Provincia of Panama, Cerro Campana, savanas of radio tower,
10/11/1978, Hammel, B. 5557 (MO); Cerro Vaca, eastern Chiriqui, 25-28/12/1911,
Pittier, H. 5358, holotype, Prescottia panamensis Schltr. (US, isotype AMES).
PARAGUAY, Cerro Torica, 08/1922, Rojas, T. s.n. (GH53306); Altos, Barranca
humeda de arroyo, s.d., Rojas, T. 1753 (GH, SP); Barranca de arroyo, Cerro Torise,
sierra de Amambay, 08/1921, Rojas, T. 3915 (GH, SP). PERU, Dep. Huánuco, Prov.
Huánuco, Chinchao, 16/08/1940, Asplund, E. 13147 (S); Dept. Ayacucho, Ccarrapa,
between Huanta and Rio Apurimac, 05/05/1929, Killip, E.P. 22428 (US); s.l., s.d.,
Mathews 1862, holotype, Prescottia tenuis Lindl. (GH, K, line drawing K-L, photo
MO); Huayna Picchu - Dep. Cuzco, 20/07/1948, Scolnik, R 842 (GH); Departamento
Cuzco, Provincia Paucartambo, Pillawata, Paso del Aguila, 04/11/1965, Vargas, C.
199
16808 (photo F, GH, NY); Cusco, Paucartambo, k. 136-137, carretera Kosnipata,
26/09/1966, Vargas, C. 17680 (photo F, photo NY); Cusco, Huasbamba,
28/06?or07/1943, Vargas, C. 3460 (photo F, photo NY); Amazonas, Mendoza,
03/08/1963, Woytkowski, F. 8100 (MO); Cajamarca, along the Rio Chinchipe,
between Tamborapa and San Ignacio, 23/09/1980, Luer, C.A. 5411 (SEL); Cusco,
Urubamba, a 115 km de Cusco, camino al Proyecto Arqueologico Mandor-Puturusi,
en Machu Picchu, 14/05/1988, Núñez, P. 9110 (MO). PUERTO RICO, Maricao,
Monte del Estado Forest Reserve, 11/01/1995, Acevedo-Rodríguez, P. 7185 (US);
Guayama, Carite Forest Reserve, along dirt and trail from Rt 792 to edge of lake,
06/03/1988, Axelrod, F. 1006 (NY); Naguabo: Bo. Rio Blanco, Caribbean National
Forest, along 1.5 km stretch up Rio Sabana S of closed portion of Rt 191,
29/02/1991, Axelrod, F. 4124 (NY, US); Ciales: Los Tres Picachos, Rt 149, km 35.5,
dirt road through old coffee plantation, 14/03/1992, Axelrod, F. 4222 (NY);
Ceiba/Naguabo, Caribbean National Forest, along road between Pico del Este &
Pico del Oeste, 11/03/1994, Axelrod, F. 7559 (NY); Mount Mandios, near Jayuya,
upper slopes, 17/03/1906, Britton, E.G. 921 (NY); Alto de la Bandera, near Adjuntas,
14/03/1913, Britton, N.L. 2132 (NY); Laguna Tortuguero, 05/02/1915, Britton, N.L.
3841 (NY); La Juanita, near Las Marias, 07/02/1915, Britton, N.L. 3904 (NY); Indiera
Fria, near Maricao, 19-22/02/1915, Britton, N.L. 4462 (NY); Vicinity of Barranquitas,
18/03/1922, Britton, N.L. 6624 (NY); Indiera Baja, North of Yauco, 4-11/02/1923,
Britton, N.L. 7226 (GH, NY); Catalina-Yunque Trail, Luquillo Mountains, 2326/02/1923, Britton, N.L. 7569 (GH, NY); "Loguna Tortugueiro", 02/02/1924, Britton,
N.L. 7950 (NY); Yauco, 1880, Garber, A.P. s.n. (GH71579); N slope Luquillo mts,
08/03/1899, Heller, A.A. 725 (NY); Eastern slope of the Luquillo Mountains,
18/02/1900, Heller, A.A. s.n. (GH6528); km 22.8, south side of El Yunque, 2230/01/1963, Howard, R.A. 15482 (GH); Near Bayamon, 14/03/1964, Liogier, Bro.
Alain H. 10721 (NY); Route 486, km 8.4. South of Camuy, 26/02/1986, Liogier, P.
35956 (NY); Maricao Reserva Forestal, Carr. 120, km 15.3 on path in front of power
station, 27/04/1996, Nir, M. 53 (NY); s.l., 07/01/1961, Renz, O. 9944 (BBG); Maricao
Forest, 20/12/1981, Ricart, J.L.R. 6771 (SEL); s.l., 12/1960, s.coll., s.n. (BBG9945);
Prope Adjuntas, La Lkucia in Monte Cienega, 11/04/1886, Sintenis, P. 4152 (BM,
GH, US, W); 0.2 km on Rte 366, east of junction with Rte 120, Reserva Florestal
Maricao, 28/12/1980, Solomon, J.C. 5711 (MO); Espinosa, 02/03/1915, Stevenson,
200
J.G. 2622 (NY); Guayama, Sierra de Cayey, at the San Lorenzo/Patillas boundary
across hwy 7740, 08/01/2003, Worthington 31886 (SEL). UNITED STATES OF
AMERICA, Florida, Burden's Hammack, Gossmans, 24/02/1905, Eaton, A.A. 1240
(NY). VENEZUELA, Anzoátegui, Cerro Peonía (Cerro Los Pajaritos), above Santa
Cruz, headwaters of Rio Manantiales, east of Bergantín, 20/03/1945, Steyermark,
J.A 61601 (F, GH); Aragua, 12/12/1953, Renz, O. 8140 (BBG); Barinas, 11/09/1951,
Renz, O. 7357 (BBG); Bolivar, Piar, Guayaraca, between escarpment and River
Guayaraca, southern base of Auyan-tepui, 25/11/1982, Davidse, G. 22812 (MO);
Bolívar, Sororopan-tepui, 13/11/1944, Steyermark, J.A 60052 (F); Bolívar*, Mount
Auyan-Tepui, 12-01/1937-38, Tate, G.H.H. 1239 (NY); Lara, 20/10/1952, Renz, O.
7847 (BBG); Lara, Moran, Quebrada Jarillo, sector Paramo La Pena, 2.6 km arriba
de la poblacion de El Jabon, 08/12/2002, Alvarez, A. 2989 (NY); Mérida, 04/06/1949,
Renz, O. 5444 (BBG); Mérida, 13/11/1949, Renz, O. 6121 (BBG); Mérida,
15/11/1949, Renz, O. 6133 (BBG); Trujillo, 16/09/1947, Renz, O. 4335 (BBG);
Trujillo, 19/10/1947, Renz, O. 4340 (BBG); Trujillo Ende, 01/1948, Renz, O. 4564
(BBG); Trujillo, 15/02/1948, Renz, O. 4582 (BBG); Trujillo, 09/12/1948, Renz, O.
4946 (BBG); Trujillo, 23/02/1950, Renz, O. 6257 (BBG). VIRGIN ISLANDS, Tortola,
Soge Montain, 08/02/1919, Fishlock, W.C. 377 (NY); St. Thomas, 11-22/02/1913,
Britton, E.G. 1487 (NY); St. Thomas, near Bouru Resulutulu, 5-7/02/1913, Britton,
E.G. 425 (NY); St. John, 10-2/02/1913, Britton, N.L. 535 (NY).
HABITAT. Terrestrial in limestone rocks or soils under shady sites in moist and wet
forests, elevation from sea level to 2.900 m.
CONSERVATION STATUS. Not endangered. Although Prescottia oligantha was
cited at the list of endangered (EN) species of Florida (Ward et al. 2003) and at the
CITES Appendix II (2007), it is a well represented and widespread species, reason
why we are considering it as a not threatened species.
ETYMOLOGY. From the Greek oligo (few) and anthos (flower), but since this plant is
not few-flowered this epithet is confusing (McLeish et al. 1995).
NOTES. Prescottia oligantha has elliptic to lanceolate leaves, inflorescences loose,
with white flowers, and lip internally densely pilose. The size and form of these plants
are extremely variable, changing without any evident pattern. These characters are,
then, variable within this species. Prescottia oligantha is delimitated here in a more
extensive circumscription, as a result of the difficulty to establish the limits or
201
boundaries of the taxon. We are indicating here that it is probably a species complex,
and population studies would help to clarify and elucidate the real circumscription of
the species. Based on DNA sequence data, it is within the whitish flowers and lip
internally pilose clade (Chapter 1).
Cranichis oligantha was described by Swartz without information about type
specimen. Some authors cited the type for BM (Fawcett & Rendle 1910, Garay &
Sweet 1979, McLeish et al. 1995), while Garay (1978) indicated that it was at S. For
this reason, Azevedo & van den Berg (2007a) chosen the BM specimen as the
lectotype of C. oligantha. The specimen at BM bears an annotation on the back of
the sheet, which agrees in part with the protologue and especially with the later
citation of Swartz (1806). Sprengel renamed Cranichis oligantha as C. micrantha
because he felt that Swartz’s name was inappropriate (oligantha = few-flowers) for a
plant that has many flowers “(Cr. oligantha Sw. hallucinatione dicta).” Although
Sprengel’s name may have been more descriptive of the plant, nonetheless it is
illegitimate (Ackerman, in press).
Nir (2000) and Govaerts (2008) cited Cranichis tenuiflora Griseb. as synonym
of Prescottia oligantha, but a careful examination of the original material [Protologue:
“Cuba occ. (Wr. 3292) E.” Type: Cuba: Wright 3292 (AMES!, P!)] reveals it is not a
Prescottia at all. It looks like that Nir (2000) made a confusion, as the author also
cited Cranichis tenuiflora Griseb. as a species in Cranichis, and informed that he saw
the type (Cuba: Wright 3292) at AMES.
At the same herbarium sheet of the holotype of Prescottia micrantha there is
another collection, from Serra de Curral del Rey, Minas Gerais, which is not part of
the type collection. When Lindley described Prescottia tenuis (Lindley 1840), he
cited: “Hab. In Peruvia, Mathews 1862 (exam. s. sp. in hb. Hooker)”. Kew bought
Hooker’s herbarium in 1867.This implies that the holotype of Prescottia tenuis is the
specimen stamped “Herbarium Hookerianum 1867” now at K. At K-L there is an
illustration made by Lindley from the type specimen.
Prescottia myosurus was described based on more than one syntype. Besides
the specimen from Dominica cited on the protologue has no number, Garay & Sweet
(1979) cited Dominica, Imray 228 (K) as the type of P. myosurus. This sheet at K has
different collections, one of it is the Imray 228, and it is determined by Ackerman as
the lectotype of P. myosurus.
202
Cogniaux (1895), Hoehne (1945), Brade & Pabst (1952), Pabst & Dungs
(1975) and Sprunger (1996) accept Prescottia pubescens as a good species.
Hoehne (1945) said that if was not the 3-toothed lip apex he would say it was
Prescottia plantaginifolia. However, it has white flowers, with lip inner surface pilose,
what is completely different from P. plantaginifolia. We are suggesting here that it is a
synonym of P. oligantha.
At the Prescottia nivalis original description, Barbosa-Rodrigues (1881)
asserted that this taxon has small and white flowers. Therefore, after analyzing the
diagnose and illustration we saw that it easily fits within our circumscription of P.
oligantha.
We could not find the type of Prescottia viacola var. polyphylla, however there
is a specimen from the same collector and place at RB (L. Damazio n. 1026, Brazil:
Minas Gerais, Ouro Preto, collected in Aug 1903), the type is not there nor at BR.
As explained before, we are choosing here a lectotype to Barbosa Rodrigues’
names, Prescottia microrhiza, P. pubescens, P. nivalis, and P. viacola, since his
herbarium specimens were lost. Schlechter’s original materials were at B, and most
were destroyed during World War II. Therefore, Azevedo & van den Berg (2007a)
choose a lectotype for Prescottia filiformis and P. gracilis, since it was impossible to
locate any isotype.
Christenson (1995) stated that Henri Pittier collected plants for the US in the
Canal Zone of Panama in 1911. His collections were sent to specialists for
identification and description of new taxa. Christenson (1995) also affirmed that
Orchidaceae were described by Rudolf Schlechter at B herbarium, and published in a
series of papers in 1913. Schlechter did not indicate a herbarium of deposition in his
protologues and, for this reason, his holotypes are assumed to have been at B.
Christenson (1995) verify that the Pittier Panama collections at US are holotypes,
annotated by Schlechter and marked “typ. auct.” in his handwriting, that were sent to
B and returned to US. However, a few duplicates were sent to B as a Schlechter
request. It is clear that it was one of it. Prescottia panamensis was published later
(Schlechter 1920), and the material at US do not have any Schlechter annotation like
“typ. auct.”. Actually, Schlechter determined it as P. oligantha. Probably, Schlechter
changed his mind later and described the new species based on the sent duplicate.
For this reason, we are designating here the US material as the lectotype of P.
203
panamensis. There is also a duplicate of it at AMES, with an original line drawing
made under supervision of Schlechter, and a plant specimen inside a small
envelope. It was probably sent to AMES after describing the new species.
204
1 mm
5 mm
1 mm
B
E
1 mm
D
F
0.5 mm
C
1 mm
J
2 cm
0.5 mm
I
A
0.5 mm
G
H
Figure 23. Prescottia oligantha. Drawn from fresh material. A. Habit. B-C. Flower. B.
Front view. C. Lateral view. D. Floral bract. E. Lip. F. Perianth parts, clockwise from
top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium in place. G.
Dorsal view. H. Ventral view. I. Frontal view. J. Pollinarium. (Azevedo 333).
205
Map 7. Geographical distribution map of Prescottia oligantha.
206
11. Prescottia ostenii Pabst, Bradea 3(3): 19. 1979. Protologue: “Uruguay, Dep.
Canelones, La Floresta, in uliginosis dunarum, greg. Cop., C. Osten 22939, 23
Oct.1933”. Type: Uruguay: Canelones, La Floresta, Osten 22939 (lectotype S!,
isolectotypes MVFA!, MVM! (selected by Azevedo & Van den Berg 2007a). Fig. 24.
Terrestrial herb. Leaves (1-)2-5, rosulate, sessile; blade (0.8-)2.0-4.0(-5.0) cm long,
1.0-1.5 cm wide, membranaceous, elliptic to ovate, green, apex acute, base rounded,
margin entire. Inflorescence dense, 9-20-flowered; peduncle (1.5-)4.0-4.5 cm long,
0.2-0.3 cm wide, cylindric, green; peduncle bracts 1-4, 3.0-8.0(-11.5) mm long, (1.0)3.0-4.0(-6.0) mm wide, ovate, green, apex acute; rachis 1.0-2.0 cm long, 0.5-0.7 cm
wide, green. Flower bracts 2.0-5.0 mm long, 1.5-2.5 mm wide, ovate, green, apex
acuminate; flower erect, white, dorsal sepal revolute, 1.0-1.3 mm long, 1.0-1.3 mm
wide, submembranaceous, ovate, white, apex acute; lateral sepals adpressed to the
lip to patent, 1.3-1.5 mm long, 1.3-1.5 mm wide, submembranaceous, ovate, white,
apex obtuse; petals revolute, 1.0-1.3 mm long, 0.3-0.5 mm wide,
submembranaceous, oblong, white, apex obtuse; lip 1.5-1.7 mm long, 1.0-1.5 mm
wide, membranaceous, white, inner surface pilose, outer surface densely minutepapillose. Column at least 0.5 mm long, glabrous.
DISTRIBUTION. Brazil and Uruguay. Map 4 (p. 163).
BRAZIL, Rio Grande do Sul, Tramandaí, Jardim do Éden, 19/08/2006, Singer, R.B.
2006 21 (ICN); Rio Grande do Sul, Tramandaí, Jardim do Éden, 18/08/2007, Singer,
R.B. 2006 50 (ICN). URUGUAI, Dep. Canelones, La Floresta, in uliginosis dunarum,
30/09/1923, Osten, C. 16918 (HB); Dep. Canelones, La Floresta, in uliginosis
dunarum, 23/10/1933, Osten, C. 22939, lectotype, Prescottia ostenii Pabst (S,
isolectotype MVM, MVFA); Dep. Canelones, La Floresta, in uliginosis dunarum,
23/10/1933, Osten, C. 22939 b (AMES, GH).
HABITAT. Either in Uruguay or Brazil, this species has a marked preference for
moist and very humid places, with its roots underwater. It has been found among
marshy, paludicolous, open vegetation in full-sun very near to the Atlantic coast.
207
CONSERVATION STATUS. Critically endangered (CR – A1a). Prescottia ostenii was
known only from the type locality, and from two additional collections (see above).
Apparently, it has not been collected again in Uruguay and the type locality has been
considerably modified as a consequence of urban development (Eduardo Alonso Paz
and Eduardo Marchesi, pers.com.). Only now, past more than 70 years, it was
recollected (Singer et al. in press, Chapter 2), and for the first time in Brazil, being the
Brazilian population the only remnant population we are aware of.
ETYMOLOGY. In honor to Dr. Cornelius Osten, German botanist and business man
in Uruguay, its first collector.
NOTES. Prescottia ostenii is one of the most distinctive species in the genus.
Besides it is a very rare and poorly known species, it is easily recognized by its short
and robust habit, with only 5-8 cm in height when in flower, and its dense and thick
inflorescence.
Charles Schweinfurth recognized it as a new species of Prescottia back in
1934. He wrote a note in the GH material, but never described it. Prescottia ostenii
was first described by Pabst (1979), from specimens collected at Canelones,
Uruguay. It was recently recorded for the first time to Brazil (Singer et al. in press,
Chapter 2). So far, it was only known from two collections: C. Osten 16918 (HB), and
C. Osten 22939 (GH, MFVA, MVM, S), which were collected at the same place in
Uruguay.
When Pabst (1979) described this species a holotype was not explicitly
designated as such by the author, however he cited a single specimen on it: Osten
22939. Even though, one year later Pabst (1980) published a note saying: “Prescottia
ostenii Pabst, Bradea 3(3): 18. 1979. holotypus HB 1233, omitted at original
description”, which corresponds to another collection: Osten 16918. Following the
Article 37.3 of the International Code of Botanical Nomenclature (McNeill et al. 2006)
the name was validly published in 1979, and Osten 22939 must be kept as the type,
not Osten 16918 (HB 1233). Six specimens of Osten 22939 were found, at AMES,
GH, MVFA, MVM (2 specimens), and S. The material at S, which bears a Pabst’s
determination label, was recently selected by Azevedo & Van den Berg (2007a) as
the lectotype of P. ostenii. The materials at AMES and GH are marked “Osten 22939
b” and were not accepted as isolectotypes.
208
In the molecular-based phylogeny, Prescottia ostenii is placed in the clade that
unites P. densiflora, P. lancifolia and P. oligantha. Being more closely related to P.
lancifolia. Prescottia ostenii can easily be separated from P. lancifolia and P.
oligantha on the basis of the foliar shape: leaves in P. ostenii are sessile, whereas
are petiolate and lanceolate in P. lancifolia, and shortly petiolate in P. oligantha.
Morphologically, this species most closely resembles P. densiflora, since both share
sessile rosulate leaves, but differs conspicuously in plant size.
No evidence of protandry was found in this taxon (Singer et al. in press,
Chapter 2). Protandry was already reported for some Prescottia species with long
columns, such as P. stachyodes (Sw.) Lindl. and P. montana Barb. Rodr., but it is
likely absent in taxa with short columns (Singer & Sazima 2001).
209
10 mm
2 mm
1 mm
D
A
2 mm
C
B
0.5 mm
1 mm
G
F
0.5 mm
E
H
I
Figure 24. Prescottia ostenii. Drawn from fresh material. A. Habit. B. Detail of
inflorescence. C. Flower, front view. D. Floral bract. E. Perianth parts, clockwise from top:
lip, lateral sepal, petal, dorsal sepal. F-G. Column with pollinarium in place. F. Ventral
view. G. Dorsal view. H-I. Pollinarium. H. Ventral view. I. Dorsal view. (Singer 2006/21).
210
12. Prescottia phleoides Lindl., Gen. sp. orchid. pl.: 453. 1840. [Cogniaux 1895;
Pabst & Dungs 1975]. Protologue: “Hab. In Brasilia; in campis ad Contentas, prov.
Min. Ger., Martius (exam. s. sp. in hb. Mart.).” without collector number or date. Type:
Brazil: Minas Gerais, in campis ad Contentas, Martius s.n. (holotype M!; fragment of
type W!). Fig. 25.
Rupicolous to terrestrial herb. Leaves 2-3, rosulate, sessile to pseudopetiolate;
petiole (0.5-)2.0-2.5(-5.0) cm long, green; blade (2.0-)3.5-5.5(-9.0) cm long, (0.5-)0.81.5(-2.0) cm wide, coriaceous, oblong to lanceolate, green to deep green, apex
acute, base attenuate, margin entire. Inflorescence dense, 30-80(-100)-flowered;
peduncle 9.5-18.0(-36.0) cm long, 0.1-0.3 cm wide, cylindric, green; peduncle bracts
3-5, 10.0-45.0 mm long, 4.0-8.0 mm wide, ovate, green, apex acuminate to acute;
rachis 2.5-5.5(-7.0) cm long, 0.7-1.3 cm wide, green. Flower bracts 4.5-5.9 mm long,
1.3-1.7 mm wide, ovate, green, apex acuminate; flower erect; dorsal sepal reflexed to
revolut, at least 3.0 mm long, at least 1.5 mm wide, membranaceous, oblong to
ovate, whitish to green, apex obtuse to acute; lateral sepals patent to adpressed to
the lip, 2.5-3.7 mm long, at least 1.7 mm wide, membranaceous, oblong, green to
whitish, apex obtuse to acute; petals reflexed to revolute, at least 3.0 mm long, at
least 0.5 mm wide, membranaceous, linear, whitish to green, apex obtuse; lip 2.54.0 mm long, 1.8-3.0 mm wide, fleshy, yellow to green, inner surface glabrous, outer
surface densely minute-papillose. Column up to 2.0 mm long, glabrous.
DISTRIBUTION. Restricted to Brazil, at Goiás, Espírito Santo, Rio de Janeiro, São
Paulo and Minas Gerais (Pabst & Dungs 1975). Map 4 (p. 163).
BRAZIL, Conceição, Fazenda Dourado, 31/08/1933, Mello-Barreto, H.L. 4859
(BHCB, SP); Goiás*, Serra dos Pyreneos, 27/08/1895, Glaziou, A. 22164
(P00366693, P00366694, P00372002); Espírito Santo, Castelo, Reserva Florestal de
Forno Grande, 07/11/1991, Valpassos, E. 32 (MBML); Minas Gerais, 09/1892,
Glaziou, A. 19897 (K, P); Habitat in campis ad Contentas, s.d., Martius, C.F.P. s.n.,
lectotype, Prescottia phleoides Lindl. (M, line drawing K-L, fragment of type W); Serra
do Cipó, s.d., Schwacke, C.A.W. 8408 (RB); Catas Altas, Serra do Caraça, perto da
211
gruta do Padre Caio, 25/05/2004, Mota, R.C. 3085 (BHCB); Itabirito, Pico do Itabirito,
24/03/1994, Teixeira, W.A. s.n. (BHCB 26118); Itabirito, Pico do Itabirito, 18/05/1994,
Teixeira, W.A. s.n. (BHCB 26117); Santa Luzia, Serra do Cipó, km 135, 15/04/1935,
Mello-Barreto, H.L. 1276 (BHCB, RB, SP); São Gonçalo do Rio Preto, Parque
Estadual de Rio Preto, 26/05/2007, Azevedo, C. 344 (HUEFS); São Gonçalo do Rio
Preto, Parque Estadual de Rio Preto, 10/05/2004, Viana, P.L. 1768 (BHCB); Rio de
Janeiro, Est. Rio, Itatiaia, estr. de Registro para Agulhas Negras, km 8, 26/04/1971,
Sastre, C. 1213 (P); São Paulo, Serra da Bocaina, 24/04/1951, Brade, A.C. 20716
(RB).
HABITAT. Grows on sandy soils, in campos de altitude (high altitude grasslands) of
Southeastern Brazil, in elevations between 1.400 and 2.000 m.
NOTES. Prescottia phleoides is characterized by its sessile to pseudopetiolate,
oblong to lanceolate leaves, congest inflorescence, and long floral bracts. This
species has affinities with Prescottia mucugensis and P. leptostachya. It is more
closely related to P. mucugensis and their relationships are discussed under the
description of that species (Azevedo et al. submitted b, Chapter 2).
The holotype of Prescottia phleoides is located at M. It is annotated in
Martius’s handwriting with the same information given in the protologue. There is a
fragment of what appears to be the same material at W, with an illustration probably
made by Martius. There is also an illustration of the type material at K-L made by
Lindley.
212
1 mm
1 mm
E
B
1 mm
1 mm
D
1 mm
F
J
C
1 mm
2 cm
1 mm
G
A
H
0.2 mm
I
Figure 25. Prescottia phleoides. Drawn from fresh material. A. Habit. B-C. Flower. B
Front view. C. Lateral view. D. Floral bract. E. Lip. F. Perianth parts, clockwise from
top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium in place. G.
Dorsal view. H. Ventral view. I. Lateral view. J. Pollinarium. (Azevedo 344).
213
13. Prescottia plantaginifolia Lindl. ex Hook., Exot. Fl. 2: t. 115. Aug 1824. [Steudel
1841; Vöth 1976; Ackerman 1995]. (nom. rej. prop. made by Azevedo & van den
Berg 2005 (not recomended). Protologue: Horticultural Society of London, from Rio
de Janeiro, in the autumn of 1822, by Mr. John Forbes. Type: cultivated 1824 in
Glasgow, Scotland; origin from Brazil, Rio de Janeiro, Autumn of 1822, Forbes s.n.
(lectotype K!) (selected by Azevedo & van den Berg 2005). ≡ Prescottia plantaginea
Hook., Exot. Fl. 2: t. 115. Aug 1824. [Steudel 1841]. Fig. 26.
= Prescottia rodeiensis Barb. Rodr., Gen. spec. Orchid. 2: 278, t. 813. 1882.
Protologue: “Croissant a l'ombre des forets des montagnes du Rodeio à Rio de
Janeiro. Fleurit en Juin.” synon. nov. Lectotype (here designated): Barbosa
Sprunger et al. (1996), 2: t. 91].
= Prescottia stricta Schltr., Repert. Spec. Nov. Regni Veg. 17: 269. 1921. [Hoehne
1945 (inferring from the diagnose); Brade & Pabst 1952; Pabst 1966; Pabst &
Dungs 1975; Sprunger 1996]. Protologue: “Brasilien: Estado Minas Gerais, bei
Bello Horizonte. - F.Christian, im Jahre 1912.” without collector number. Type:
Brazil: Minas Gerais, Belo Horizonte, Christian s.n. (not found B, probably
destroyed).
= Prescottia plantaginea var. macrostachya Hoehne, Fl. Bras. 8 (12; 2): 105. 1945.
Protologue: “Mat. Exam.: Inst. Bot. (ex Depart. Bot. Est.): no. 24953 - F.C.
Hoehne, no. 236, Jacarepagua, Rio de Janeiro, 09.1910; - no. 42772 - A. Gehrt,
S. Vicente, S. Paulo, 28.06.1940. Mus. Nac., Rio de Janeiro: no. 18432 - A.C.
Brade, Gavea, Rio de Janeiro, 08.1928; - no. 35567 - E. Ule, Tijuca, 08.1894.
Jard. Bot., Rio de Janeiro: no. 7578 - A. Frazão, Gávea, Rio de Janeiro, 07.1916.
Herb. Alex. Curt Brade: no. 6852 - Guarujá, Ilha de St. Amaro, S. Paulo, em
rochedos, 07.1913” synon. nov.
Rupicolous to terrestrial herb. Leaves 2-5, rosulate, sessile to pseudopetiolate; blade
(4.5-)10.0-25.0(-40.0) cm long, (1.5-)2.5-3.0(-5.0) cm wide, membranaceous to
coriaceous, oblong to lanceolate or elliptic, green, apex acute to acuminate, base
attenuate to truncate; margin entire. Inflorescence loose, (25-)35-90(-160)-flowered;
214
peduncle 20.0-38.0(-44.0) cm long, 0.2-0.5(-0.8) cm wide, green; peduncle bracts up
to 5; 20.0-85.0 mm long, 0.4-1.6(-2.0) mm wide, obovate to ovate, green, apex acute;
rachis (8.0-)9.0-29.0(-40.0) cm long, 0.6-0.9(-1.3) cm wide, green. Flower bracts 4.46.0(-8.7) mm long, 2.0-3.0(-4.0) mm wide, ovate, green, apex acute to caudate;
flower erect, green; dorsal sepal revolute, 2.2-3.5 mm long, 0.8-1.4 mm wide,
membranaceous, lanceolate to oblong, apex acute; lateral sepals revolute, 2.23.8 mm long, 1.2-2.0 mm wide, membranaceous, oblong to lanceolate, apex acute;
petals revolute, 2.2-3.5 mm long, 0.4-0.7 mm wide, membranaceous, linear, acute;
lip 2.3-3.0 mm long, 1.6-2.3 mm wide, inner surface glabrous, outer surface with
trichomes at the base. Column 1.3-1.8 mm long, dorsal surface covered by
trichomes.
DISTRIBUTION. Occurs in Brazil, where it is found at the states of Pernambuco, Rio
de Janeiro, São Paulo, Paraná, Santa Catarina, Minas Gerais, and Goiás (Pabst &
Dungs 1975; Sprunger 1996). Also known from Paraíba, Bahia, and Espírito Santo.
At Pernambuco it was cited to Bezerros (Thomas et al. 1998). Map 8.
BRAZIL, 26/09/1976, Andrade-Lima, D. 76 8290 (IPA); Rio Comprido, 04/08/1881,
Galvão, R. 5611 (R); Lagoão de Freitos, 25/07/1880, Glaziou, A. 12207 (P00366690,
P00366691); Quinta, 10/07/1891, Glaziou, A. 18540 (P); s.l., 23/06/1871, Regnell,
A.F. III 1194 (P00366667, P00366668); Parque Nacional, abrigo 2, 10-20/0910/1952, Rizzini 1101-1123 (RB); s.l., s.d., Schwacke, C.A.W. s.n. (RB37026); Bahia,
s.d., s.n. (P00366689); Vale do Rio Paraguaçu, 09/1980, Queiroz, L.P. 43 (ALCB);
Belmonte, Faz. Ondina, 3 km de Belmonte, 04/09/2006, Queiroz, L.P. 1830 (HRB);
Cachoeira, 24/10/1984, Queiroz, L.P. 881 (HUEFS); Cachoeira, Vale do Rio
Paraguaçu, 30/09/1986, Queiroz, L.P. 956 (HUEFS); Camamu, Estrada Travessão Camamu km 25, na estrada Acarai-Camamu, 23/07/1981, Carvalho, A.M. 762
(CEPEC, MBM, SP); Caravelas, ca. 16 km na estrada Caravelas - Alcobaça,
05/09/1989, Carvalho, A.M. 2481 (CEPEC, K); Feira de Santana, Ipuaçú, inselberg
em caatinga, 02/12/2003, Carvalho-Sobrinho, J.G. 155 (HUEFS); Feira de Santana,
20/09/1980, Noblick, L.R. 2000 (HUEFS); Feira de Santana, Serra de São José,
08/12/2003, van den Berg, C. 1056 (HUEFS); Ilhéus, Rodovia Itabuna - Aurelino Leal
km 33, 20/09/1992, Coradin, L. 8685 (BHCB, CEN, K, SP); Itamaraju, 10/07/2004,
215
Carneiro, J. 1538 (MBM299804); Itamaraju, Fazenda Pau Brasil, ca. 5 km NW de
Itamaraju, 19/09/1978, Mori, S. 10702 (CEPEC, NY, RB); Ituberá, Litoral Sul, Mata
da sede, 15/09/2006, Guedes, M.L. 12673 (ALCB); Macarani, Rod. para Vila das
Graças 27,2 km E, ca. 4,4 km de Vila das Graças, 17/08/2001, Carvalho, A.M. 7011
(CEPEC); Maracás, Fazenda Cana Brava, 31/08/1996, Harley, R.M. 28219 (K,
HUEFS); Maracás, 09/07/1984, Queiroz, L.P. 828 (HUEFS); Maraú, 6 km ao lado N,
28/08/1969, Jesus, J.A. 414 (CEPEC, P, SP); Santa Teresinha, Serra da Jibóia,
Morro da Pioneira, 16/08/1998, Azevedo, C. 108 (HRB); Santa Teresinha, Serra da
Jibóia, Morro do Cruzeiro, 05/09/1998, Azevedo, C. 117 (HRB); Santa Teresinha,
Morro do Cruzeiro, entre Serra da Jibóia, 02/09/1995, França, F. 1326 (HUEFS, RB);
Santa Teresinha, Morro do Cruzeiro 3 km W de Santa Teresinha na estrada para
Elísio Medrado, 29/10/1995, Melo, E. 1360 (HUEFS, RB); Santa Teresinha, Morro do
Cruzeiro, 13/09/1997, Miranda, E.B. 5 (ESA, HUEFS); Serrinha, Morro da Torre,
2004, van den Berg, C. 1416 (HUEFS); Espírito Santo, 01/07/2003, San MartinGajardo, I. s.n. (UEC140343); Margem da rodovia Colatina-Vitoria, 45 km leste de
Colatina, Zona calcárea, 09/07/1968, Belém, R.P. 3829 (CEPEC, NY, QCNE, SEL);
Alfredo Chaves, Estrada São Bento de Urânia a Castelinho, 07/07/1996,
Hatschbach, G. 65227 (MBM); Anchieta, Enseada do Balanço, 29/06/1999, Fraga,
C.N. 457 (MBML); Cachoeiro de Itapemirim, Vargem Alta, Morro de Sal, 21/08/1948,
Brade, A.C. 19322 (RB); Cachoeiro de Itapemirim, Vargem Alta, morro do Sal,
20/02/1988, Fernandes, H.Q.B. 2376 (MBML); Cariacica, Condomínio Cantinho do
Céu, proximidades de Duas Bocas, 18/06/1997, Fraga, C.N. 367 (MBML); Castelo,
Forno Grande, 15/08/2006, Azevedo, C. 286 (HUEFS); Castelo, Parque Estadual do
Forno Grande, subida para o Fornão, 01/11/2004, Fontana, A.P. 1001 (MBML);
Conceição da Barra, Guriri, APA de Conceição da Barra, 01/10/1995, Fraga, C.N.
248 (MBML); Domingos Martins, próximo do Rio Jucu, 10/07/2004, Carneiro, J. 1539
(MBM299806); Domingos Martins, Pedra Azul, 15/06/1985, Hatschbach, G. 49417
(MBM); Domingos Martins, arredores, 16/06/1985, Hatschbach, G. 49426 (MBM);
Guarapari, Setiba, Parque Estadual Paulo César Vinha, 29/12/1994, Fraga, C.N. 100
(MBML); Guarapari, Setiba, Parque Estadual Paulo César Vinha, 09/02/1995, Fraga,
C.N. 106 (MBML); Guarapari, Setiba, Parque Estadual Paulo César Vinha,
06/12/1994, Fraga, C.N. 83 (MBML); Guarapari, perto da praia, 30/08/1980, Krieger,
L. s.n. (HUEFS99512); Guarapari, Três Praias, 20/07/1983, Pena, F.G. 116 (BHCB);
216
Ibiraçu, Estação Ecológica Mosteiro Zem, Morro da Vargem, 21/08/1999, Fraga,
C.N. 482 (MBML); Itapemirim, Itaoca, APA de Guanandy, 29/06/1999, Fraga, C.N.
462 (MBML); Itapemirim, Itaoca, APA de Guanandy, 01/12/1999, Fraga, C.N. 557
(MBML); Linhares, Barra Seca, Praia de nudismo de Barra Seca, 21/06/2000, Fraga,
C.N. 567 (MBML); Nova Venécia, a 3 km de Todos os Santos, lado esquerdo, indo
para Paulista, 08/09/1989, Fernandes, H.Q.B. 2810 (MBML); Santa Leopoldina, Rio
do Norte, Ribeirão Timbuí, Cachoeira do Cravo, 18/08/1998, Kollmann, L. 382
(MBML); Santa Maria de Jetibá, Pedra do Garrafão, Distrito do Garrafão, trilha
principal, 08/03/2003, Berger, M.V.S. 101 (MBML); Santa Teresa, Escola
Agrotécnica Federal de Santa Teresa, Vale do São Brás, 12/08/2006, Azevedo, C.
272 (HUEFS); Santa Teresa, Bela Vista, propriedade de José Luís Redigheri,
12/08/2006, Azevedo, C. 273 (HUEFS); Santa Teresa, Valsugana Velha,
propriedade de Dr. Pedro, 15/08/2006, Azevedo, C. 289 (HUEFS); Santa Teresa,
Propriedade do Sr. Fracalossi, 25/07/1990, Boone, W. 1377 (MBML); Santa Teresa,
Estação Biológica de Santa Lúcia, leito do rio Timbuí, abaixo da cachoeira,
20/08/1985, Boone, W. 686 (MBML); Santa Teresa, Estação Biológica Santa Lúcia,
trilha abaixo da cachoeira, 11/05/2000, Demuner, V. 1048 (MBML); Santa Teresa,
MBML, orquidário, procedência desconhecida, 31/05/1988, Fernandes, H.Q.B. 2513
(MBML); Santa Teresa, Vale do Canaã, próximo do terreno do Coqueto e Belumat,
08/07/2005, Fontana, A.P. 1535 (MBML); Santa Teresa, São João de Petrópolis,
EAFST, Valão de São Bráz, 02/09/2000, Fontana, A.P. 26 (MBML); Santa Teresa,
Valsugana Velha, estrada acesso ao terreno de Walter Schaffer, 03/07/2002,
Fontana, A.P. 374 (MBML); Santa Teresa, São João de Petrópolis, Barracão, Escola
Agrotécnica Federal de Santa Teresa, 15/07/2000, Fraga, C.N. 643 (MBML); Santa
Teresa, Valsugana Velha, Estação Biológica de Santa Lúcia, trilha do Indaiaçu e
Sagui, 16/07/2000, Fraga, C.N. 661 (MBML); Santa Teresa, Comunidade Pedra
Alegre, Pedra do Cruzeiro, 20/06/2000, Kollmann, L. 3014 (MBML); Santa Teresa,
Valsugana Velha, Estação Biológica de Santa Lúcia, esquerda da cachoeira,
23/08/2000, Kollmann, L. 3070 (MBML); Santa Teresa, Rio Saltinho, terreno de J.P.
Mass, 27/06/2001, Kollmann, L. 4052 (MBML); Santa Teresa, Rio Saltinho, Boerão,
sitio de Paulo Mass, 11/07/2001, Kollmann, L. 4131 (MBML); Santa Teresa, Toma
Vento, 14/08/2001, Kollmann, L. 4326 (MBML, SP); Santa Teresa, Estação Biológica
de Santa Lúcia, trilha do túmulo, 29/06/2004, Kollmann, L. 6780 (MBML); Santa
217
Teresa, Alto da Pedra Alegre, Pedra do Cruzeiro, 20/06/2000, Vervloet, R.R. 07
(MBML); Santa Teresa, Nova Lombardia, Reserva Biológica Augusto Ruschi, trilha
lado direito da casa pedra, 27/06/2002, Vervloet, R.R. 415 (MBML); São Roque do
Canaã, Alto Misterioso, Pedra 5b, 16/07/2005, Fontana, A.P. 1562 (MBML); Vitória,
Arredores da UFES Vitória, 07/1985, Sobral, M. 4116 (ICN); Goiás, ca. 15 km W of
Veadeiros, 14/02/1966, Irwin, H.S. 12833 (NY, UB); Pico dos Pirineus, ca. 20 km NW
of Corumbá de Goiás, near road to Niquelandia, 27/01/1968, Irwin, H.S. 19261 (UB);
Pirenópolis, Serra dos Pirineus, ca. 21 km E of Pirenópolis, 19/01/1972, Irwin, H.S.
34578 (UB); Minas Gerais, margem da rodovia Nanuque - Teófilo Otoni, 14/08/1965,
Belém, R.P. 1614 (UB); Pedreira Santo Cristo - Linhares - Juiz de Fora, 25/05/1998,
Caiafa, A.N. s.n. (SPF133419); Estrada entre Diamantina e Curvelo, 15/06/2006,
Salles, A.H. 4198 (HEPH); Alagoa, 07/07/2004, Faria, A.D. s.n. (UEC140329);
Araponga, Complexo da Serra do Brigadeiro, 28/07/2004, Salles, A.H. 3091 (HEPH);
Araponga, Serra do Brigadeiro, 2004, Salles, A.H. 3756 (HEPH); Belo Horizonte,
Pico da Piedade, 10/07/1940, Mulford 560 (GH); Caeté, Serra da Piedade, Alto da
Serra, 20/07/1987, Mello-Silva, R. CFCR 11159 (SPF); Caeté, Serra da Piedade,
29/06/1985, Paula, J.A. 1870 (BHCB, MBML); Caeté, Serra da Piedade, 29/06/1985,
Paula, J.A. 1875 (MBML); Caeté, Serra da Piedade, 15/07/1987, Paula, J.A. s.n.
(BHCB18540); Caeté, Serra da Piedade, 29/06/1985, Siqueira, J.C. 1856 (BHCB,
MBML); Catas Altas, Serra do Caraça, 15/09/2004, Mota, R.C. 2384 (BHCB); Catas
Altas, Serra do Caraça, 15/09/2004, Mota, R.C. 2385 (BHCB); Catas Altas, Serra do
Caraça, Pico do Inficionado, 30/08/2000, Mota, R.C. 246 (BHCB); Conceição do
Mato Dentro, Parque Natural Municipal do Ribeirão do Campo, 08/08/2002, Mota,
R.C. 2514 (BHCB); Conceição do Mato Dentro, Parque Natural Municipal do
Ribeirão do Campo, 01/08/2003, Mota, R.C. 2525 (BHCB); Conceição do Mato
Dentro, Parque Natural Municipal do Ribeirão do Campo, 19/03/2003, Mota, R.C.
2550 (BHCB); Fervedouro, PESB, Serra da Pirraça, 19/07/1996, Paula, C.C. 1144
(VIC); Itabirito, Pico do Itabirito, 23/07/1966, Emygdio, L. 2196 (R); Itabirito, Pico do
Itabirito, Serra dos Inconfidentes, 03/09/1993, Teixeira, W.A. s.n. (BHCB 26125);
Itabirito, Pico do Itabirito, Serra dos Inconfidentes, 03/09/1993, Teixeira, W.A. s.n.
(F2189527); Itabirito, Pico do Itabirito, Serra dos Inconfidentes, 21/06/1994, Teixeira,
W.A. s.n. (BHCB 26116); Itamarandiba, Parque Estadual da Serra Negra,
13/09/2006, Mota, R.C. 3103 (BHCB); Juiz de Fora, Linhares, Pedreira Santo Cristo,
218
02/08/1998, Caiafa, A.N. s.n. (CESJ30335); Marliéria, Zona da Mata de Minas
Gerais, 25/07/2004, Salles, A.H. 3051 (HEPH); Marliéria, Zona da Mata de Minas
Gerais, 26/07/2004, Salles, A.H. 3051.1 (HEPH); Marliéria, Morro do Machado, Zona
da Mata de Minas Gerais, 26/07/2004, Salles, A.H. 3067 (HEPH); Marliéria, Morro do
Machado, Zona da Mata de Minas Gerais, 26/07/2004, Salles, A.H. 3077 (HEPH);
Moeda, Serra da Moeda, estrada para BR-040, 15/08/1998, Rapini, A. 649 (SPF);
Muriaé, Rod. BR 116, 03/08/1983, Hatschbach, G. 46666 (MBM); Ouro Preto, Pico
do Itacolomí, 23/07/1977, Martinelli, G. 2771 (RB); Ouro Preto, Cachoeira das
Andorinhas, 15/07/1978, Martinelli, G. 4721 (RB); Ouro Preto, Morro da Queimada,
10/08/1937, Mello-Barreto, H.L. 9170 (BHCB, SP); Raul Soares, PCH Granada,
19/06/2002, Mota, R.C. 2599 (BHCB); Rio Preto, 07/06/2004, Schuchter 20 (CESJ);
Rio Vermelho, Estrada para a Vila de Pedra Menina, ramificação a esquerda, ca. 4
km após a vila, topo da Serra da Pedra Menina, 01/08/2000, Fiaschi, P. 415 (SPF);
Santa Rita de Jacutinga, Perto da cachoeira, 27/07/1970, Urbano 8931 (CESJ);
Santo Antônio do Itambé, Pico Itambé, 09/08/1972, Hatschbach, G. 30110 (MBM);
São Gonçalo do Rio Abaixo, EPDA-Peti, 22/05/1993, Borba, E.L. 09 (BHCB); São
Gonçalo do Rio Abaixo, EPDA-Peti, 12/06/1993, Borba, E.L. 19 (BHCB); São
Gonçalo do Rio Preto, Parque Estadual de Rio Preto, 15/09/2006, Mota, R.C. 3132
(BHCB); São Gonçalo do Rio Preto, Parque Estadual de Rio Preto, base do Pico
Dois Irmãos, 10/08/2004, Viana, P.L. 1828 (BHCB); Paraíba, Remígio, próximo a
Lagedos; regiões secas do Estado da Paraíba, 20/09/59, Moraes, J.C. 2240 (MO,
NY, P, US); Paraná, S. Antonio do Itambé, Caminho ao Pico Itambé, 09/09/1971,
Hatschbach, G. 27501 (MBM); Pernambuco, Cupira to Penélas, W facing granite
outcrop, in Bromeliad clumps local, 25/09/1976, Davis, P.H. D 61116 (UEC); Bom
Jardim, Margem da estrada para Surubim, 22/08/1970, Andrade-Lima, D. 70 5926
(HUEFS, IPA); Brejo da Madre de Deus, Propriedade Bituri, 15/09/1973, AndradeLima, D. 73 7471 (HUEFS, IPA); Rio de Janeiro, Fortaleza do Pico, 14/07/1887, s.n.
(RB146263); Tijuca, 21-23/07/1882, Ball., J. s.n. (K); Estrada Rio-PetrópolisContôrno, 08/1975, Banio, J. 795 (R); Pedra do Roncador, Serra dos Órgãos,
11/07/1940, Brade, A.C. 16357 (RB); s.l., s.d., Gardner, G. 121 (BM, GH, K Herb.
Benthamianum 1854K-L, photo MO, W); s.l., 1837, Gardner, G. 121 (K Herbarium
Benthamianum 1854); Rio de Janeiro, 1836, Gardner, G. 121 (K Herb. Hookerianum
1867, G, NY, P, US); Morro do Flamengo, 1836, Gardner, G. 121 (BM, NY); s.l.,
219
1829, Gay, C. s.n. (P00371959); s.l., 08/1828, Gay, C. s.n. (P00371958); s.l.,
01/1881, Glaziou, A. 12207 (K); s.l., 1891, Glaziou, A. 18540 (K); Mauá, 26/06/01,
Hemmendorff, E. 461 (S); divisa de Petrópolis com Patí de Alferes, Reserva sob
regime de preservação permanente, próximo a Fazenda Inglesa, 08/06/1978, Lima,
H.C. 574 (RB); Junyuba Bay, 07/1878, Miers, J. 3689 (K); Guanabara, Guaratiba,
11/08/1963, Pereira, E. 7644 (B, PEL, NY); Paineiras, 29/06/1882, Schwacke,
C.A.W. 5632 (RB); s.l., 9-11/1836, Shuttleworth 1838 (NY); Matas da Lagoinha,
23/08/1968, Sucre, D. 3242 (RB, US); Itapuca, 01/08/1968, Sucre, D. 3405 (RB);
Estado de Guanabara, encosta do Morro Mundo Novo, Botafogo, 04/08/1968, Sucre,
D. 3414 (RB); Ilha Furtada, Bahia de Sepetiba, 25/08/1968, Sucre, D. 3602 (RB);
Pedra de Itauna, Restinga da Tijúca – Guanabara, 13/07/1966, Sucre, D. 954 (RB);
s.l., 1839, Tweedie, J. 1311 (K); s.l., 1844, Widgren s.n. (S); Araruama, Restinga de
Massambaba, 07/03/1993, Fagnani, M.P.K. s.n. (RUSU3382); Guapimirim, Estrada
Rio-Terezópolis, 14/07/1993, Fagnani, M.P.K. 20 (RUSU); Itaguaí, Estrada do
Caçador, ca. de 300 m, 03/09/1990, Carauta, J.P.P. 6161 (GUA); Itatiaia, Rio Bonito,
09/1934, Brade, A.C. 14045 (RB); Itatiaia, Maromba, 22/06/1935, Brade, A.C. 14631
(RB); Itatiaia, Serra do Itatiaia, Ponte Maromba, 12/07/1952, Brade, A.C. 21226
(RB); Itatiaia, Parque Nacional, 24/07/1966, Hunt, D.R. 6424 (K); Mendes, Fazenda
São José das Paineiras, km 32 da RJ-127, 10/09/1993, Braga, J.M.A. 612 (RUSU);
Nova Iguaçu, Reserva Biológica de Tinguá, Pico do Tinguá, 14/08/2002, Moraes, M.
503 (RB); Parati, São Gonçalo, 01/08/1975, Araujo, D. 737 (RB); Petrópolis, s.d.,
Spannagel, C. 312 (SP); Petrópolis, 07/1938, Spannagel, C. 487 (SP); Petrópolis,
Estrada de contorno Rio-Petrópolis, 26/05/1968, Sucre, D. 3129 (RB); Rio de
Janeiro, Gávea, 08/1933, Brade, A.C. 12733 (RB); Rio de Janeiro, Gávea, 08/1928,
Brade, A.C. s.n. (R18432); Rio de Janeiro, Gávea, 07/1916, Frazão, A. s.n.
(RB7578); Rio de Janeiro, Jacarepaguá, 09/1910, Hoehne, F.C. 236 (SP); Rio de
Janeiro, Gávea, Distrito Federal, 07/1914, Hoehne, F.C. s.n. (R44791); Rio de
Janeiro, Mouth of Rio Tijuca, beyond Copacabana, 31/06/1940, Mulford 516
(GH59216, GH59217, GH59218, GH59219); Rio de Janeiro, Morro do Queimado,
face Norte, 18/07/1990, Ormindo, P. s.n. (GUA37203); Rio de Janeiro, Ilha Grande,
Distrito Federal, 22-24/07/1915, Rose, J.N. 20338 (US, photo MO); Rio de Janeiro,
Morro do Pavão, posto 6, Copacabana, 21/08/1967, Sucre, D. 1560 (RB); Rio de
Janeiro, Tijuca, 08/1894, Ule, E. s.n., syntypo, Prescottia plantaginea var.
220
macrostachya Hoehne (R35567); Rio de Janeiro, Tijuca, 27/06/1906, Usteri, A. s.n.
(SP 29240); Rio de Janeiro*, Flora da Serra dos Órgãos, Pedra do Frade,
20/08/1940, Brade, A.C. 16602 (RB); Pedra Chapadão, Serra dos Órgãos,
19/09/1929, Brade, A.C. 9308 (R); Guanabara, Jardim Botânico, vertente leste do
morro do Sumaré, 26/10/1970, Braga, U.C. 01 (RB); s.l., 1824, Forbes, lectotype,
Prescottia plantaginifolia Lindl. ex Hook. (K); On the ? of the Corcovado, 1836,
Gardner, G.* 121 (BM); Santa Maria Madalena, Parque Estadual do Desengano,
Pedra do Desengano, vertente NW, 04/10/1988, Leitman, M. 296 (RB); Santa Maria
Madalena, Parque Estadual do Desengano, Pedra do Desengano, vertente NW e
SW, 29/06/1989, Martinelli, G. 13373 (RB); Teresópolis, Pedra do Frade,
26/09/1929, Brade, A.C. s.n. (R24797); Teresópolis, Parque Nacional Serra dos
Órgaos, trilha para Pedra do Sino, 13/07/2006, Paula-Souza, J. 5934 (ESA); Tijuca,
Guanabara, floresta da Tijuca, 08/08/1963, Martins, H.F. 328 (GUA); Urca, Morro do
Pãozinho, 22/07/1982, Miranda, F.E. 22 (GUA); Province de Rio de Janeiro, 18161821, Saint-Hilaire, A. 139 (P); Province de Rio de Janeiro, 1816-1821, Saint-Hilaire,
A. 343 (P00371951, P00371954); Environ de Rio de Janeiro, 1843, Weddell, H.A.
517 (P); Environ de Rio de Janeiro, 1843, Weddell, H.A. 518 (P00371955,
P00371956, P00371960); P. da Tijuca, 22/07/1944, s.n. (RB75824); Copacabana
(morro), 07/1880, Galvão, R. 520 (P); Gávea, Sitio das Pedras, 26/08/1951, Pabst,
G.F.J. 1174 (GH); São Paulo, s.d., Commissão Geographica e Geologica de São
Paulo 3104 (SP); Parque Estadual da Serra do Mar, núcleo Cubatão, 15/08/1998,
Singer, R.B. 98/78 (UEC); Parque Estadual da Serra do Mar, núcleo Cubatão,
01/07/2003, Singer, R.B. s.n. (UEC140345); Bananal, Serra da Bocaina, Alto Vale do
Rio Paca (Bracuí), 29/09/1994, Shirasuna, R.T. 79 (SP); Caraguatatuba, próximo ao
município de Caraguatatuba, 17/07/53, Hoehne, W. s.n. (K); Caraguatatuba, próximo
ao município de Caraguatatuba, 17/07/53, Hoehne, W. s.n. (MBM91617);
Caraguatatuba, próximo ao município de Caraguatatuba, 17/07/953, Hoehne, W. s.n.
(SPF15027); Caraguatatuba, próximo Caraguatatuba, 17/07/1953, Hoehne, W. s.n.
(HUEFS115460); Cubatão, 25/07/1907, Usteri, A. s.n. (SP29228); São Paulo, São
Vicente, 28/06/1940, Gehrt, A. s.n. (HUEFS115458); São Paulo, São Vicente,
28/06/1940, Gehrt, A. s.n. (SP42772); São Paulo, São Vicente, 28/06/1940, Gehrt, A.
s.n. (SPF72218); Ubatuba, Pincinguaba, BR 101, sentido Pincinguaba-Ubatuba,
próximo ao Rio Promirim, Beira do Rio, 06/06/2006, Azevedo, C. 263 (HUEFS);
221
Ubatuba, Picinguaba, BR 101, sentido Pinciguaba-Ubatuba km 13, 10/07/1998,
Pansarin, E.R. 209 (UEC); Ubatuba, Picinguaba, trilha atrás do alojamento,
05/08/1988, Ribeiro, J.E.L.S. 391 (HRCB); Ubatuba, Parque Estadual da Serra do
Mar, núcleo Picinguaba, 15/09/1999, Singer, R.B. 99/09 (UEC); Ubatuba, Parque
Estadual da Serra do Mar, núcleo Picinguaba, 10/2000, Singer, R.B. s.n.
(UEC140200); Ubatuba, Ilha Anchieta, 08/2000, Smidt, E.C. 159 (SJRP).
HABITAT. Prescottia plantaginifolia occurs in open areas in soil or rocky places at
elevations from sea level to 2.000 m, and also in disturbed habitats such as road
banks.
CONSERVATION STATUS. Not threatened.
ETYMOLOGY. The epithet plantaginea was in reference of the inflorescence aspect,
which looks like an inflorescence of Plantago.
NOTES. Prescottia plantaginifolia is very variable. It is characterized by the oblong to
lanceolate, sessile to pseudopetiolate leaves, with green flowers and lip internally
glabrous. According to phylogenetic studies this species is sister to Prescottia
spiranthophylla. They share some morphological similarities as lip with outer surface
with trichomes at the base, and column with dorsal surface covered by trichomes,
characters exclusive of these two taxa. Prescottia plantaginifolia differs from P.
spiranthophylla by the plant size, the loose inflorescence and the flowers with lateral
sepal revolute, whereas in P. spiranthophylla the inflorescence is congest and the
flowers have the lateral sepals reflexed with the distal part adpressed to ovary or
reflexed.
When Hoehne (1945) described Prescottia plantaginea var. macrostachya he
stated that probably the variety constitutes a transition to Prescottia spiranthophylla,
differing from it by its flowers, which are less dark and less congest than those of P.
spiranthophylla, but more congest than those of P. plantaginifolia. However, all
specimens that we have seen comprise our circumscription of P. plantaginifolia.
Cogniaux (1895), Hoehne (1945), Pabst (1966), and Pabst & Dungs (1975)
considered Prescottia rodeiensis as a good species, although Hoehne (1945) and
Pabst (1966) expressed that it is very similar to P. plantaginifolia, differing only by the
emarginate petal apex. Pabst (1966) commented that it seems to be a rare species,
because he had never seen it. Hoehne (1945) also remarked that no specimen was
recollected after the type, and questioned the possibility of an anomaly at the original
222
material. As we also could not find any other collection like the type, and as it is really
similar to P. plantaginifolia, we are here considering it as a synonym of the latter.
223
1 mm
E
C
D
B
0.2 mm
1 mm
J
4 cm
F
0.5 mm
I
A
0.5 mm
G
H
Figure 26. Prescottia plantaginifolia. Drawn from fresh material. A. Habit. B-D. Flower. B.
Front view. C. Lateral view. D. Dorsal view. E. Floral bract. F. Perianth parts, clockwise
from top: lip, dorsal sepal, petal, lateral sepal. G-I. Column with pollinarium in place. G.
Ventral view. H. Dorsal view. I. Lateral view. J. Pollinarium. (Azevedo 263).
224
Map 8. Geographical distribution map of Prescottia plantaginifolia.
225
14. Prescottia spiranthophylla Barb. Rodr., Gen. spec. Orchid. 1: 177. 1877.
[Cogniaux 1895; Hoehne 1945]. Protologue: “Dans les environs de Rio Comprido à
Rio de Janeiro. Fleurit au mois de Juillet”. Neotype (here designated): Brazil: Distrito
Federal, Retiro dos Bandeirantes, 04. Aug. 1931, Brade & Lutz 15 (R!). Fig. 27.
Rupicolous herb. Leaves 3-6, rosulate, sessile; blade (10.0-)20.0-44.0(-47.0) cm
long, (1.0-)2.0-3.0(-5.0) cm wide, fleshy to coriaceous, lanceolate to linear, green,
apex acute, base truncate, margin entire. Inflorescence dense, 140-260-flowered;
peduncle (17.0-)29.0-67.0 cm long, (0.7-)1.0-1.2 cm wide, green; peduncle bracts 45, 20.0-90.0(-190.0) mm long, 10.0-24.0 mm wide, ovate to oblong, green, apex
acute; rachis (9.0-)12.0-27.0 cm long, (0.8-)1.0-1.2 cm wide, green. Flower bracts
3.0-5.4(-7.5) mm long, 2.0-3.2 mm wide, ovate, green, apex caudate; flower erect,
green; dorsal sepal revolute, 2.7-3.8 mm long, 1.6-1.9 mm wide, membranaceous,
lanceolate, whitish, apex acute; lateral sepals reflexed with distal part adpressed to
ovary to reflexed, 3.7-3.8 mm long, 1.8-2.2 mm wide, membranaceous, ovate,
whitish, apex acute; petals revolute, 3.7-3.8 mm long, 0.8-1.0 mm wide,
membranaceous, linear, whitish, apex acute to obtuse; lip 2.7-3.0(-4.2) mm long, 2.03.5 mm wide, fleshy, yellow to green, inner surface glabrous, outer surface densely
minute-papillose, with trichomes at the base. Column 1.7-2.0 mm long, dorsal
surface covered by trichomes.
DISTRIBUTION. Restricted to Brazil, apparently endemic to Rio de Janeiro
municipality. Map 4 (p. 163).
BRAZIL, 02/08/1940, Mulford 881 (GH); D. Federal, Ilha de Paquetá, 09/08/1958,
Emmerich, M. s.n. (R206634); Est. da Guanabara, estrada para Guaratiba,
10/08/1966, Ichaso, C.L.F. 42 (NY, RB, UB); H. Florestal grotão, subindo na encosta
em direção ao pico do morro, Projeto vegetação das áreas do entrono do Jardim
Botânico do RJ, p. Lage e H. Florestal, 14/10/1992, Marquete, R. 680 (RB); Pedra da
Urca, Praia Vermelha D.F., 25/09/1949, Pabst, G.F.J. 400 (RB, SP); s.l., 1832,
Riedel 16 (W); Estado de Guanabara, reduto de formação secundária do Morro
Macedo Sobrinho, 14/07/1968, Sucre, D. 3224 (F, GUA, ICN, NY, RB, US); s.l.,
226
1839, Tweedie, J. 1343 (K); Rio de Janeiro, Restinga de Jacarepaguá, Itauna,
18/08/1975, Araujo, D. 754 (RB); Rio de Janeiro, Recreio dos Bandeirantes, Parque
Natural Municipal da Prainha, Pedra dos Cabritos (Boa Vista), 15/07/2006, Azevedo,
C. 270 (HUEFS); Rio de Janeiro, Parque Natural Mun. da Prainha, Morro da Boa
Vista, 22/07/2003, Bocayuva, M. 34 (RB, SP); Rio de Janeiro, Parque Natural Mun.
da Prainha, Morro da Boa Vista, vertente leste, 30/07/2003, Bocayuva, M. 40 (RB);
Rio de Janeiro, Parque Natural Mun. da Prainha, trilha (ponto de partida na ponte),
pelo meio do parque chegando em um paredão, 22/08/2003, Bocayuva, M. 44 (RB,
SP); Rio de Janeiro, Recreio dos Bandeirantes, Distrito Federal, 04/08/1931, Brade,
A.C. 15 (R); Rio de Janeiro, Leblon, 2 Irmãos, 06/06/1950, Brade, A.C. s.n.
(RB71464); Rio de Janeiro, Bairro do Recreio dos Bandeirantes, Prainha, Morro da
Boa Vista (Área de Proteção Ambiental), 09/10/1996, Braga, J.M.A. 3562 (RUSU);
Rio de Janeiro, Bairro do Recreio dos Bandeirantes, Prainha, topo do Morro Boa
Vista (Área de Proteção Ambiental), 08/07/1997, Braga, J.M.A. 4172 (HUEFS,
RUSU); Rio de Janeiro, Distrito Federal, Pão de Açúcar, Cepi, 20/07/1987, Carauta,
J.P.P. 40 (R); Rio de Janeiro, Corcovado, 07/1938, Carris, B. s.n. (RB37662); Rio de
Janeiro, Barra da Tijuca, Estrada para Jacarepaguá, encosta pedregosa do morro,
15/07/1964, Hoehne, W. 5803 (SP, SPF); Rio de Janeiro, at the mouth of the Rio
Tijuca, beyond Copacabana, 31/06/1940, Mulford 515 (GH59220, GH59221); Rio de
Janeiro, Recreio dos Bandeirantes, 28/07/1958, Pereira, E. 4072 (RB); Rio de
Janeiro, Est. da Guanabara, Recreio dos Bandeirantes, Restinga de Itapeba, Pedra
de Itauna, BR-6, 02/08/1964, Santos, N. 5176 (R); Rio de Janeiro, Morro do Pavão,
posto 6, Copacabana, 16/08/1967, Sucre, D. 1540 (RB).
HABITAT. Prescottia spiranthophylla is found growing together with species of
Bromeliaceae and Cactaceae on granitic substrates, at elevations from 100 to 460 m
ETYMOLOGY. The name is due to the spiralled leaves.
NOTES. The main distinguishing characteristics of Prescottia spiranthophylla is its
robust and vigorous habit, with big sessile leaves and congest inflorescence.
Phylogenetically and also morphologically it is closely related to Prescottia
plantaginifolia. They both share two characters that are, apparently, exclusive of
them in the genus: the lip outer surface with trichomes at the base, and the dorsal
surface of the column covered by trichomes.
227
Cogniaux (1895) transcribed the Barbosa Rodrigues’ original description,
saying that he did not saw the original material. Hoehne (1945), commented that the
original diagnose is not sufficient to recognize the species. Besides the comment, he
decided to make a new diagnose and presented an illustration to establish the
species. Pabst (1966) considered it a synonym of Prescottia plantaginifolia, followed
by Pabst & Dungs (1975) and Sprunger (1996). Here we are reestablishing the
species, based on morphological characters and also on DNA sequence data.
Barbosa Rodrigues made very good illustrations of his collections, which are
mentioned by him in the original description. Those illustrations were recently
reproduced in Sprunger et al. (1996). Many of these have been chosen as the
lectotypes of his names. When Barbosa Rodrigues described Prescottia
spiranthophylla he cited a plate (t. 501), although the original drawing was never
found; probably it was lost. It was not printed in “Iconographie des Orchidées du
Brésil” (Sprunger et al. 1996), nor it is at the library of the Rio de Janeiro Botanical
Garden, where are the other original plates of Barbosa Rodrigues. We have chosen
here one of the two specimens cited by Hoehne (1945), Brade & Lutz 15, as the
neotype of Prescottia spiranthophylla. Besides, it has as site of collection “Distrito
Federal”. It was certainly collected at Rio de Janeiro, which was the Federal District
of Brazil until the foundation of Brasília, around 1960.
228
5 mm
C
B
5 mm
E
D
1 cm
1 mm
F
G
A
Figure 27. Prescottia spiranthophylla. Drawn from fresh material. A. Habit. B-C.
Flower. B. Front view. C. Lateral view. D. Floral bract. E. Perianth parts, clockwise
from top: lip, dorsal sepal, petal, lateral sepal. F-G. Column F. Dorsal view. G.
Ventral view. (Azevedo 270).
229
15. Prescottia stachyodes (Sw.) Lindl., Bot. Reg. 22: sub t. 1916: 1. 1836.
[Cogniaux 1895; Cogniaux 1907; Cogniaux 1909; Fawcett & Rendle 1910; Kränzlin
1911; Gale & Baldomero 1938; Williams 1946; Renz 1948; Williams 1951; Hodge
1953; Williams 1956; Schweinfurth 1958; Dunsterville & Garay 1959; Correll 1965;
Vargas 1965; Pabst 1966; Schweinfurth 1967; Adams 1972; Garay & Sweet 1974;
Hamer 1974; Pabst & Dungs 1975; Garay 1978; Hamer 1984; Werkhoven 1986;
Ackerman 1989; Correa 1992; Cremers & Hoff 1992; Ackerman 1995; Gloudon &
Tobisch 1995; McLeish et al. 1995; Sprunger 1996; Espejo-Serna & López-Ferrari
1998; Thomas et al. 1998; Jørgensen & León-Yánez 1999; Ackerman 2000; Balick et
al. 2000; Dix & Dix 2000; Nir 2000; Carnevali et al. 2001; Feldmann & Barré 2001;
Stevens et al. 2001; Hammel et al. 2003; Rocha & Waechter 2006]. ≡ Cranichis
stachyodes Sw., Prodr.: 120. 1788. [Lindley 1836; Lindley 1840a; Cogniaux 1895;
Cogniaux 1909; Fawcett & Rendle 1910; Gale & Baldomero 1938; Williams 1946;
Williams 1951; Hodge 1953; Williams 1956; Schweinfurth 1958; Dunsterville & Garay
1959; Pabst 1966; Schweinfurth 1967; Garay & Sweet 1974; Hamer 1974; Garay
1978; Hamer 1984; Ackerman 1989; Sprunger 1991; Correa 1992; Cremers & Hoff
1992; Ackerman 1995; McLeish et al. 1995; Sprunger 1996; Espejo-Serna & LópezFerrari 1998; Jørgensen & León-Yánez 1999; Ackerman 2000; Nir 2000; Carnevali et
al. 2001; Johnson 2001; Stevens et al. 2001; Hammel et al. 2003; Govaerts 2004;
Rocha & Waechter 2006]. Protologue: “Jamaica” without collector or date. Type:
Jamaica (Blue Mountains), Swartz s.n. (lectotype BM! (selected by Azevedo & van
den Berg 2007a). Fig. 28.
= Prescottia colorans Lindl., Bot. Reg. 22: t. 1916. 1836. [Cogniaux 1895; Cogniaux
1909; Gale & Baldomero 1938; Williams 1956; Schweinfurth 1958; Dunsterville &
Garay 1959; Pabst 1966; Hamer 1974; Pabst & Dungs 1975; Sprunger 1991;
Cremers & Hoff 1992; McLeish et al. 1995; Sprunger 1996; Nir 2000; Govaerts
2004]. Protologue: “A native of Brazil, whence it was imported by Messrs.
Loddiges. The drawing was made in January 1834.” without collector number or
date. Type: Brazil: Loddiges s.n. (holotype K-L!).
= Prescottia petiolaris Lindl., Bot. Reg. 22: t. 1916: 2. 1836. [Schweinfurth 1958;
Sprunger 1991; Cremers & Hoff 1992; Sprunger 1996]. Protologue: “Peru
230
Mathews (no. 1875).” Type: Peru: Yambras (Bamba), Mathews 1875, Herb.
Hookerianum (holotype K!, line drawing K-L!).
= Prescottia pellucida Lindl., Ann. Mag. Nat. Hist., 3, 1: 335. 1858. [Cogniaux 1909;
Gale & Baldomero 1938; Ackerman 2000; Govaerts 2004]. Protologue: “Loma
del Gato, (no number.)”. Lectotype (here designated): Cuba Orientali, 1856 - 7,
Wright s.n. (K-L!, the left collection).
= Prescottia longipetiolata Barb. Rodr., Gen. spec. Orchid. 1:177. 1877. [Cogniaux
1895; Schweinfurth 1958; Pabst 1966; Pabst & Dungs 1975; Sprunger 1991;
Cremers & Hoff 1992; Sprunger 1996; Johnson 2001; Govaerts 2004].
Protologue: “Pedra Branca, à Caldas. Floraison au mois d' Avril.” Lectotype
(here designated): Barbosa Rodrigues’ original drawing (plate t. 475) in the
library of the Jardim Botânico do Rio de Janeiro [reproduction printed in
“Iconographie des Orchidées du Brésil”, Sprunger et al. (1996), 2: t. 84].
= Prescottia paulensis Cogn. in Mart., Fl. Bras. 3(6): 548. 1906. [Pabst 1966; Pabst &
Dungs 1975; Sprunger 1991; Sprunger 1996; Johnson 2001]. Protologue: “Serra
da Cantareira prov. S. Paulo: Comm. Geogr. e Geol. S. Paulo n. 3052, comm. cl.
Löfgren.” Type: Brasil: São Paulo, Serra da Cantareira, Comm. Geogr. e Geol. S.
Paulo 3052, comm. cl. Löfgren (holotype BR; isotype SP!).
= Prescottia smithii Schltr., Repert. Spec. Nov. Regni Veg. Beih. 7: 52. 1920. [Garay
1978; Govaerts 2004]. Protologue: “Magdalena: Santa Marta, 4000 ft., H.H.
Smith 2277. March.” Type: Colombia: Magdalena: Santa Marta, above las
Partidas. Smith 2277 (lectotype NY!; isolectotypes CM!; F!; GH!; K!; US!
(selected by Azevedo & van den Berg 2007a).
= Prescottia longifolia Schltr., Repert. Spec. Nov. Regni Veg. Beih. 7: 51. 1920.
Protologue: “Antioquia, c. 2000 m. M. Madero.” without collector number or date.
Type: Colombia: Antioquia, c. 2000 m. Madero 120 (lectotype drawing of type
AMES! (selected by Azevedo & van den Berg 2007a).
= Prescottia longipetiolata Schltr., Repert. Spec. Nov. Regni Veg. Beih. 8: 39. 1921.
Protologue: “Pichincha: in monte Corazon - A. Sodiro s. no.”, without collector
number or date. synon. nov. Lectotype (here designated): Schlechter’s
drawing [printed in Mansfeld 1929. Figuren Atlas zu den Orchideenfloren der
sudamerikanischen Kordillerenstaaten von R. Schlechter. Repert. Spec. Nov.
231
Regni Veg. Beih 57: 75, t. 291]. ≡ Prescottia schlechteri Hoehne, Fl. Bras. 8 (12;
2): 113. 1945 (non Prescottia longipetiolata Barb. Rodr. 1877).
= Prescottia colorans var. macrophylla Hoehne, Revista Soc. Brasil. Agron. 8 (2):
222. 1945. Protologue: Coletada em Coronel Pacheco, Minas. Inst. Bot. S. Paulo
SC-461-27-IX-1944 F.C.H. synon. nov. Type: (not in SP).
= Prescottia tepuyensis Carnevali & C.A. Vargas, Lindleyana 11(4): 236-238. 1996.
Protologue: “Venezuela: Amazonas, Rio Negro, R. Liesner & G. Carnevali 22460
(holótipo VEN; isótipo MO)”. synon. nov. Type: Venezuela. Territorio Federal
Amazonas: Rio Negro: Cerro Aracamuni, summit, Proa Camp, savanna with
small to large patches of forest, especially along streams, in ravines and near
edge of tepui, 01 o 32' N, 65 o 49' W, 1,400 m, 25 Oct 1987, "epiphyte on base of
tree trunk. Flowers green. Unicate," Liesner & Carnevali 22460 (holotype: VEN,
photo!; isotype MO!).
= Prescottia villenaorum Christenson, Orchids 71(7): 618. 2002. Protologue: Type:
Peru. San Martin, mountains near Moyobamba, flowered in cutivation at Hort.
Villena (Agroriente), February 2002, Christenson 2034 (holotype: CUZ). synon.
nov. Type: Peru: San Martin, mountains near Moyobamba, Christenson 2034
(holotype CUZ).
Terrestrial herb. Leaves 1-4(-5), rosulate, petiolate; petiole (2.0-)6.0-35.0(-41.0) cm
long, green to rose-red; blade (3.5-)6.5-28.0(-30.5) cm long, (2.0-)3.0-11.5(-15.8) cm
wide, membranaceous to coriaceous, elliptic to ovate, dark green to variegated, apex
acute, base attenuate to obtuse, margin entire to serrulate, sometimes hyaline-white.
Inflorescence dense to loose; (4-)30-75(-160)-flowered; peduncle (7.0-)20.0-60.0(95.0) cm long, 0.2-0.6(-1.3) cm wide, red to green; peduncle bracts (2-)3-6(-8), (8.0)20.0-50.0(-120.0) mm long, (8.0-)10.0-15.0(-22.0) mm wide, oblong, green to rosered, apex acute; rachis (6.0-)15.0-25.0(-44.0) cm long, 0.4-1.5(-2.2) cm wide, green
to rose-red. Flower bracts (3.0-)7.0-10.0(-17.0) mm long, 2.0-3.0(-5.0) mm wide,
lanceolate, rose-red to green, apex acuminate to caudate; flower erect, green; dorsal
sepal strongly revolute, (1.0-)3.3-4.6(-6.0) mm long, (0.5-)1.0-1.2(-1.5) mm wide,
membranaceous, triangular to ovate, whitish to green, apex acute; lateral sepals
strongly revolute, (2.0-)4.6-5.7(-6.6) mm long, (0.6-)1.2-1.6 mm wide,
232
membranaceous, triangular to ovate, green to whitish, apex acute; petals strongly
revolute, (1.0-)3.5-5.0(-5.4) mm long, 0.4-0.5 mm wide, membranaceous, linear,
green to whitish, apex acute; lip (2.0-)2.8-4.0(-6.0) mm long, 2.5-3.0(-4.0) mm wide,
membranaceous, green, inner surface glabrous. Column (0.8-)1.6-2.7 mm long,
glabrous.
DISTRIBUTION. This species occurs from Mexico to Panama, and West Indies,
French Guiana, Surinam, Guyana, Venezuela, Colombia, Ecuador, Peru, Bolivia,
Paraguay, Brazil, and Argentina. In Brazil, it is cited for the states of Amazonas,
Pará, Ceará, Pernambuco, Alagoas, Bahia, Espírito Santo, Rio de Janeiro, São
Paulo, Paraná, Santa Catarina, Rio Grande do Sul, Minas Gerais, and Distrito
Federal. Map 9.
ARGENTINA, Misiones, Iguazú Dpt., Iguazú Nat. Park, Area Cataratas, Sendero
Macuco, 11/07/1991, Johnson, A. 220 (CTES); Buenos Aires, Trindade Hills,
17/03/1932, Jack., J.G. 8628 (GH). BELIZE, Beside the hummingbird highway at 31
1/2 miles from Dangriga, Stam Creck District, 26/01/1980, Adams, B.R. 224 (K);
Toledo, Vicinity of Doyle's Delight, Southen Maya Mountains, 11/12/1993, Allen, B.
15406 (MO); Toledo District, Maya Mountains, near Union Camp, 23/03/1977, Boutin
5124 (MO); Toledo District, lower slopes of Richardson Peak, Maya Mountains,
directly N of the junction of Richardson Creek and Bladen Branch, 03/1987, Davidse,
G. 31982 (MO). BOLIVIA, 10/07/1992, Williams, R.S. 1624 (NY); La Paz, Munecas,
Consata, 08/04/1981, Luer, C.A. s.n. (SEL81666); BRAZIL, s.d., Loddiges, C. s.n.,
holotype, Prescottia colorans Lindl. (K-L); s.l., s.d., Plée, A. s.n. (P00371961); s.l.,
25/04/1877, Regnell, A.F. III 1193 * (P); s.l., 04/1859, Schwacke, C.A.W. s.n.
(P00372001); Alagoas, Quebrangulo, Parque Estadual da Pedra Talhada, Pedra
D'agua, 24/07/1987, Rodrigues, M.N. 1189 (MAC); Amazonas, Caatinga do Porto
Camanaus, 19/10/1978, Madison, P.F.E. 480 (INPA); Camanaus, 31/10/1971,
Prance, G.T. 15882 (INPA, NY); Bahia, Jequié, Fazenda Brejo Novo, a 10,5 km da
Av. Otávio Mangabeira pela Exupério Miranda no Bairro do Mandacarú, 12/09/2003,
Macedo, G.E.L. 217 (HUEFS, PEUFS); Mucugê, Parque Municipal de Mucugê, mata
do Zé Leandro, 16/08/2002, Azevedo, C. 148 (HUEFS); Poções, acesso a Faz. Boa
Esperança com entrada ao S de Morinhos, 6,1 km E de Poções na rodovia a Ilhéus,
233
fragmento no limite Sul da área, 08/10/2004, Amorim, A.M. 4293 (CEPEC, HUEFS);
Santa Teresinha, Serra da Jibóia, Morro da Pioneira, 16/08/1998, Azevedo, C. 106
(HRB); Santa Teresinha, Serra da Jibóia, Morro da Pioneira, 16/08/1998, Azevedo,
C. 109 (HRB); Santa Teresinha, Serra da Jibóia, Morro da Pioneira, 05/09/1998,
Azevedo, C. 116 (HRB); Santa Teresinha, Serra do Jibóia, Monte Cruzeiro,
19/08/1993, Pignal, M.H H 434 (P); Una, Estrada São José, km 8, ramal a direita a
partir de São José, 14/08/1995, Amorim, A.M. 1699 (CEPEC, G, NY); Uruçuca,
Distrito de Serra Grande, 7.3 km na estrada Serra Grande/Itacaré, Fazenda Lagoa
do Conjunto Fazenda Santa Cruz, 01-12/07/1991, Carvalho, A.M. 3454 (CEPEC,
NY); Ceará, Guaramiranga, Sitio São Salvador, 13/09/1998, Castro, A.S.F. 601
(EAC); Guaramiranga, Serra de Baturité, 21/08/2003, Fernandes, A. s.n.
(EAC32878); Guaramiranga, 31/08/1986, Lima-Verde, L.W. s.n. (EAC15340); Pacoti,
08/07/1989, Lima-Verde, L.W. s.n. (EAC16631); Pacoti, Sitio Olhos d'água dos
Tangarás, 27/05/1995, Lima-Verde, L.W. s.n. (HUEFS80339); Distrito Federal,
Riacho Fundo, ca. 15 km SW of Brasília on road to Goiânia, 24/09/1965, Irwin, H.S.
8609 (F, MO, NY); Brasília, do lado oposto ao conjunto 3 da quadra 24, das
Mansões, Setor Park Way, 04/02/1996, Batista, J.A.N. 605 (CEN); Brasília, Estação
Ecológica do Jardim Botânico de Brasília, 19/07/2005, Figueiredo, S. 162 (HEPH);
Brasília, Reserva Ecológica do IBGE, coletada na picada R 8, Córrego Roncador,
28/07/1978, Heringer, E.P. 631 (IBGE); Brasília, Reserva Ecológica do IBGE,
Coletada na picada R 8, Córrego Roncador, 28/07/1978, Heringer, E.P. 632 (IBGE);
Brasília, Jardim Botânico de Brasília, 20 km de Brasília, em Mata ciliar do Córrego
Cabeça do Veado, 16/09/89, Lima, I.V. 1512 (HEPH); Brasília, Estação Ecológica do
JBB, 14/08/1998, Nobrega, M.G. 952 (HEPH); Brasília, APA Cabeça de Veado,
córrego Mata Gado, área do estuário, 30/08/1999, Ramos, A.E. 1431 (HEPH, MBM);
Brasília, 11/09/1996, Reis, G.C. 223 (HEPH); Brasília, 2000, Rodrigues Jr., C.E. s.n.
(HEPH20401-3); Santa Maria, Córrego Caxeta, 17/07/2004, Salles, A.H. 3033
(HEPH); Espírito Santo, Castelo, Forno Grande, 15/08/2006, Azevedo, C. 288
(HUEFS); Castelo, Parque Estadual do Forno Grande, 10/07/2004, Kollmann, L.
6867 (MBML); Guarapari, Setiba, Parque Estadual Paulo César Vinha, 22/06/1995,
Fraga, C.N. 220 (MBML); Linhares, Urussuquara, Vale do Suruaca, 27/03/2000,
Fraga, C.N. 614 (MBML); Santa Maria de Jetibá, Rio das Pedras, terreno de Paulo
Kuzanki, 29/05/2003, Kollmann, L. 6208 (MBML); Santa Teresa, Estação Biológica
234
da Caixa D'água, 17/04/1985, Boone, W. 385 (MBML); Santa Teresa, Estação
Biológica Santa Lúcia, Trilha do Palmiteiro, 04/05/2000, Demuner, V. 984 (MBML);
Santa Teresa, São Lourenço, Estação Biológica da Caixa D'água, 05/05/2000,
Demuner, V. 986 (MBML); Santa Teresa, Nova Lombardia, 04/06/1985, Fernandes,
H.Q.B. 1227 (MBML); Santa Teresa, Reserva Biológica de Nova Lombardia,
caminho para João Neiva, divisa, 06/08/1985, Fernandes, H.Q.B. 1363 (MBML);
Santa Teresa, Penha, propriedade do Tabajara, trilha da cachoeira, 22/03/2005,
Fontana, A.P. 1197 (MBML); Santa Teresa, Alto Santo Antônio, Pedra do Cruzeiro,
20/05/2005, Fontana, A.P. 1448 (MBML); Santa Teresa, Terreno Mazinho Carretta
(em frente ao Clube Tangarás), início da trilha, lado esquerdo, beira do córrego,
06/07/2001, Fontana, A.P. 148 (MBML); Santa Teresa, Terreno BANESTES, estrada
Iracema, lado direito, 29/09/2001, Fontana, A.P. 183 (MBML); Santa Teresa, São
Lourenço, APP (EBSL), trilha principal, 30/03/2002, Fontana, A.P. 314 (MBML);
Santa Teresa, São Lourenço, Estação Biológica da Caixa D'água, 14/04/1999,
Kollmann, L. 2477 (MBML); Santa Teresa, Valsugana Velha, Estação Biológica de
Santa Lúcia, trilha do túmulo, 30/03/2000, Kollmann, L. 2768 (MBML); Santa Teresa,
Valsugana Velha, Estação Biológica de Santa Lúcia, trilha do indaiá-açu,
06/04/2000, Kollmann, L. 2821 (MBML); Santa Teresa, São Antonio, sitio do Boza,
12/07/2001, Kollmann, L. 4187 (MBML); Santa Teresa, Valsugana Velha, Estação
Biológica de Santa Lúcia, trilha do sagui, 02/08/2001, Kollmann, L. 4248 (MBML);
Santa Teresa, Nova Lombardia, Reserva Biológica Augusto Ruschi, 05/2002,
Kollmann, L. 5668 (MBML); Santa Teresa, Penha, Sítio do R.Pizziolo, 16/09/2005,
Kollmann, L. 8330 (MBML); Santa Teresa, Estrada para Alto Santo Antonio, próximo
ao Vale do Canaã, 26/04/1983, Lima, H.C. 1976 (RB); Santa Teresa, Reserva
Biológica de Nova Lombardia, Picada de Cachoeira, 10/05/1985, Martinelli, G. 10942
(RB); Santa Teresa, Reserva Biológica Santa Lúcia, na trilha Indaiassu, 11/04/2003,
Oliveira, R.P. 842 (HUEFS, MBML); Santa Teresa, Estrada para Alto Santo Antonio,
próximo ao Vale do Canaã, 23/04/1983, Peixoto, A.L. 1859 (RB); Santa Teresa,
Nova Lombardia, Reserva Biológica Augusto Ruschi, Goipabo-Açu, Boeirão, linha de
divisa, marco 53 a 52, picada, 29/04/2003, Vervloet, R.R. 2304 (MBML); Santa
Teresa, APP, São Lourenço, proximidades do marco P70, 16/08/2003, Vervloet,
R.R. 2555 (MBML); Santa Teresa, Nova Lombardia, Reserva Biológica Augusto
Ruschi, Dra. Marlene, antiga estrada, 23/07/2002, Vervloet, R.R. 524 (MBML); Santa
235
Tereza, /07/1939, Ruschi, A. 57 (SP); Venda Nova do Imigrante, Alto Bananal,
10/08/1996, Hatschbach, G. 65294 (MBM, SPF); Minas Gerais, Chapadão das
Perdizes, cruzamento a vau do Rio Capivari, 06/04/2007, Azevedo, C. 325 (HUEFS);
Estação Experimental Coronel Pacheco, 08/01/1946, Heringer, E.P. 1586 (IAC);
Serra de Água Limpa, St. Bárbara do Mato Dentro, 11/01/1921, Hoehne, F.C. s.n.
(SP4870); Aiuruoca, Parque Estadual da Serra do Papagaio, 18/05/2005,
Echternacht, L. 1000 (BHCB); Aiuruoca, Matutu, 10/10/2004, Mota, R.C. 2481
(BHCB); Cabeceira Grande, Mata a direita da ponte de madeira (acesso para
Palmital), margem esquerda do Rio Preto, 17/05/2002, Santos, A.A. 1234 (CEN);
Caldas, Pedra Branca, 05-6/1854, Regnell, A.F. III 1193 (S); Camanducaia, divisa
com município de Gonçalves, Mata do Altair, 20/06/2000, Kamino, L.H.Y. 36
(BHCB); Carrancas, Estrada Itutinga-Carrancas, mata a cerca de 13 km da cidade,
29/07/1999, Simões, A.O. 835 (UEC, UEFS); Carrancas, Cachoeira da Zilda,
20/05/1997, Singer, R.B. 97/30 (UEC); Carrancas, Serra de Bicas, 22/06/1998,
Singer, R.B. 98/48 (UEC); Catas Altas, Serra do Caraça, região próximo a Gruta do
Padre Caio, 22/05/2007, Azevedo, C. 328 (HUEFS); Catas Altas, Serra do Caraça,
20/08/2005, Mota, R.C. 2942 (BHCB); Descoberto, Reserva Biológica da Represa do
Grama, 30/09/2000, Salimena, F.R.G. s.n. (SP348415); Itabirito, Pico do Itabirito,
29/06/1994, Teixeira, W.A. s.n. (BHCB 26123); Itabirito, Pico do Itabirito, 26/05/1994,
Teixeira, W.A. s.n. (BHCB 26122); Itabirito, Pico do Itabirito, Serra dos Inconfidentes,
03/09/1993, Teixeira, W.A. s.n. (BHCB 26124, F2189540); Itabirito, Pico do Itabirito,
Serra dos Inconfidentes, 03/09/1993, Teixeira, W.A. s.n. (BHCB 26124); Moeda,
Serra da Moeda, próximo ao Grotão do Lopes, 22/04/2006, Kamino, L.H.Y. 337
(BHCB); Nova Lima, Retiro das Pedras, 27/09/2001, Mota, R.C. 1311 (BHCB); Ouro
Branco, Serra do Ouro Branco, 29/07/1988, Braga, M.M.N. s.n. (BHCB13674); Ouro
Preto, Estação Ecológica do Tripui, 03/10/1991, Pedralli, G. s.n. (CEN16045); Passa
Quatro, Campo do "ceifeiro", 05/05/1948, Brade, A.C. 18966 (RB); Santa Bárbara,
Serra do Caraça, 30/08/1997, Stehmann, J.R. 2671 (BHCB); Santa Maria do Salto,
Fazenda Duas Barras, 24/08/2003, Lombardi, J.A. 5509 (BHCB); Santa Maria do
Salto, Fazenda Duas Barras, 24/08/2003, Lombardi, J.A. 5513 (BHCB); Santana do
Riacho, Serra do Cipó, km 107-108, 17/07/1977, Martinelli, G. 2654 (RB); São
Gonçalo do Rio Preto, Parque Estadual de Rio Preto, 15/09/2006, Mota, R.C. 3129
(BHCB); São Roque de Minas, Parque Nacional da Serra da Canastra, 18/08/1999,
236
Mota, R.C. 67 (BHCB); Pará, São Félix do Xingu*, São Felix do Xingu, a 20 km sul
da Vila Central, 15/08/2001, Salles, A.H. 2256 (HEPH); Paraná, Alexandra,
07/09/1910, Dusén, P. 10193 (F, S); Bocaiúva do Sul, Rio Capivari, 14/07/1986,
Silva, J.M. 131 (MBM); Campina Grande do Sul, Serra Ibitiraquire, trilha para o Pico
Caratuva, 16/05/2004, Silva, J.M. 4065 (MBM); Guaraqueçaba, Caminho ao
Paruquara, 28/10/1971, Hatschbach, G. 27696 (MBM); Ipiranga, Roca Nova,
Ypiranga, 17/06/1909, Dusén, P. 8537 (GH, NY, S); Jundiaí do Sul, Mata do
Cruzeiro, 07/09/2003, Carneiro, J. 1500 (MBM); Morretes, Serra do Leão,
10/10/1969, Hatschbach, G. 22406 (MBM); Morretes, Serra Marumbi, pico Olimpo,
18/05/1982, Hatschbach, G. 44941 (MBM, SP); Morretes, Serra da Prata, trilha para
o cume, 29/09/1999, Silva, J.M. 3070 (MBM, SPF); Paranaguá, Ilha do Mel, Morro
Bento Alves, 21/05/1999, Kozera, C. 1047 (UEC); Paranaguá, Ilha do Mel, Morro
Bento Alves, 09/10/1999, Kozera, C. 1262 (UEC); Paranaguá, Ilha das Cobras,
04/05/1986, Silva, S.M. 25016 (UEC); Piraquara, Rio Taquary, 01/09/1952,
Hatschbach, G. 2825 (MBM); Piraquara, Estrada Piraquara-Banhado, Serra da Boa
Vista, 08/06/1989, Silva, J.M. 621 (MBM); Quatro-Barras, Borda do Campo,
27/06/1975, Hatschbach, G. 37018 (MBM, US); São José dos Pinhais, Rio Pequeno,
03/06/1970, Hatschbach, G. 24378 (MBM); São José dos Pinhais, Vossoroca,
16/05/1953, Hatschbach, G. 3098 (MBM); São José dos Pinhais, Rincão, 06/1953,
Hatschbach, G. 3146 (MBM); Tijucas do Sul, Lagoinha, 29/06/02, Liebsch, D. 454
(MBM); Pernambuco, Iguarassu, 07/10/1887, Ridley, H.N. s.n. (BM61739); Brejo da
Madre de Deus, Propriedade Bituri, 05/02/1965, Andrade-Lima, D. 65 4299 (IPA);
Brejo da Madre de Deus, Propriedade Bituri, 15/09/1973, Andrade-Lima, D. 73 7470
(IPA); Brejo da Madre de Deus, Propriedade Bituri, 15/09/1973, Andrade-Lima, D. 73
7509 (HUEFS, IPA); Brejo da Madre de Deus, Propriedade Bituri, mata do Caçange,
19/08/1980, Andrade-Lima, D. s.n. (HUEFS99523); Brejo da Madre de Deus,
Propriedade Bituri, na mata do Caçange, 19/08/1980, Perruci, A. 11 (HUEFS, IPA);
Caruaru, Brejo dos Cavalos, 29/08/1980, Andrade-Lima, D. 13 (HUEFS, IPA);
Caruaru, Brejo dos Cavalos, 03/12/1970, Andrade-Lima, D. 70 6226 (IPA); Caruaru,
Brejo dos Cavalos, Fazenda Caruaru, 10/09/1971, Andrade-Lima, D. 71 6499 (IPA);
Caruaru, Faz. Caruaru, 10/09/1971, Andrade-Lima, D. 71 6728 (IPA); Caruaru, Brejo
dos Cavalos, 10/10/1972, Andrade-Lima, D. 72 7092 (HUEFS, IPA); Caruaru, Murici,
Brejo dos Cavalos, Parque Ecológico Municipal, 08/10/1994, Mayo, S. 1008 (MO,
237
NY, US); Gravatá, Faz. Harmonia, 06/09/1970, Andrade-Lima, D. 70 6001 (IPA);
Recife, Dois Irmãos, Jardim Zoo-Botânico, ao lado esquerdo da jaula do leão,
subindo a serra, 15/09/1966, Tenório, E.C. 66 170 (HUEFS, IPA); Rio de Janeiro,
Mesa do Imperador, 04/1937, Brade, A.C. 15729 (RB); Frade de Macaé, 17/06/1937,
Brade, A.C. 15875 (RB); Sumaré, 12/04/1931, Brade, A.C. 10713 (R); Serra da
Carioca, 31/03/1931, Brade, A.C. 59 (GH); Tijuca, Morro do Inferno, 14/09/30,
Braungelb 24029 (M); Mundo Novo, 22/07/1921, Kuhlmann, J.G. s.n. (RB16327);
Vertente do Sumaré, 09/1969, Sucre, D. 5749 (RB); Estado de Guanabara, Morro
Queimado, 22/05/1072, Sucre, D. 9146 (RB); Araruama, Próximo a Praia Seca,
comoros de La Pitanguinha, 20/12/1982, Araujo, D. 5301 (GUA); Itatiaia, Parque
Nacional de Itatiaia, em direção a parte alta, trilha para o Rebouças, 02/04/2007,
Azevedo, C. 318 (HUEFS); Itatiaia, Serra de Itatiaia, primeira Macieira a margem da
estrada, 21/05/1902, Dusén, P. 536 (R); Itatiaia, Serra de Itatiaia, 29/05/1902,
Dusén, P. 672 (R); Itatiaia, Serra de Itatiaia, 07/1902, Moreira, C. s.n. (R2702); Nova
Friburgo, Macaé de Cima, fazenda Ouro Verde, trilha para a bacia, 20/03/1994,
Vieira, C.M. 567 (RB); Nova Iguaçu, Reserva Biológica de Tinguá, Pico do Tinguá,
14/08/2002, Moraes, M. 489 (RB); Nova Iguaçu, Reserva Biológica de Tinguá,
caminho para o Pico do Tinguá, 18/08/2002, Moraes, M. 510 (RB); Parati, Morro da
Pedra Rolada, Apa-Cairuçu, 23/08/1995, Bovini, M.G. 873 (RB); Parati, Próximo a
divisa dos mun. de Parati e Cunha (SP), estrada Parati-Cunha, 19/06/1978,
Martinelli, G. 4656 (RB); Rio de Janeiro, Tijuca, 21/07/1929, Brade, A.C. 11090 (R);
Rio de Janeiro, Pico da Tijuca, 09/08/1942, Brade, A.C. 17363 (RB); Rio de Janeiro,
Tijuca, 19/08/1928, Brade, A.C. s.n. (R18433); Rio de Janeiro, Morro do Sumaré,
atrás do Jardim Botânico, 22/09/1988, Costa, A 208 (RB); Rio de Janeiro, Gávea,
03/1915, Hoehne, F.C. 235 (SP); Rio de Janeiro, Mundo Novo, Botafogo,
22/07/1921, Kuhlmann, J.G. s.n. (RB16327); Rio de Janeiro*, Serra dos Órgãos,
27/02/1933, Brade, A.C. 12491 (RB); Rio de Janeiro*, near the summit of Órgão
Mountans, 03/1941, Gardner, G. 5882 (BM, K); Rio de Janeiro*, Serra dos Órgãos,
10/03/1956, Pereira, E. 1939 (RB); Santa Maria Madalena, bifurcação para terras
frias, trilha para o sítio do Sr. Zé e Dona Madalena, s.d., s.n. (RB375042);
Teresópolis, Pedra do Sino, Serra dos Órgãos, 02/1952, Vidal, J. II 666 (R); Rio de
Janeiro*, Near the summit of Organ Mountains, 03/1941, Gardner, G. 5882 (BM, K);
Prov. Rio de Janeiro, 06/1887, Moura, J.T. 38 (P); Morro Queimado, 13/06/1945,
238
Occhioni, P. 88 (RB); Morro Queimado, S. da Carioca, 13/06/1945, Occhioni, P. 89
(RB); Matas da vista Chinesa, 25/04/1945, Occhioni, P. 96 (RB); Province de Rio de
Janeiro, 1816-1821, Saint-Hilaire, A. 330 (P); Rio Grande do Sul, Porto Alegre, Morro
Santana, 22/10/1988, Tissot, M.L. s.n. (ICN87080); Porto Alegre, in Walde, 10/1932,
Erde s.n. (GH39308); Porto Alegre, M. da Glória, 21/11/1932, Orth, L. s.n.
(PACA398); Porto Alegre, Vila Manresa, 21/11/1932, Orth, L. s.n. (B100002782);
São Leopoldo, Morro das Pedras, 20/10/1927, Dutra, J. 945 (HUEFS, ICN); São
Leopoldo, 09/1940, Rohr, J.A. s.n. (RB43484); Sapiranga, Recanto da CascataPicada Verão, 20/09/1991, Nunes, V.F. 1291 (PACA); Torres, Faxinal, 18/08/1979,
Waechter, J.L. 1311 (ICN); Torres, Lagedinho, 18/10/1980, Zanette, V.C. 389 (ICN);
Santa Catarina, Azambuja*, Brusque, 06/10/1949, Reitz, R. 3054 (SP, US);
Blumenau, 1884, Schwacke, C.A.W. 59 (R); Palhoça, Pilões, 28/09/1956, Reitz, R.
3800 (GH); São Paulo, 27/05/1815, s.n. (BM61741); Serra do Mar, Rio Grande,
1913, Brade, A.C. 6851 (K); Serra da Bocaina, Morro do Matão, 16/05/1951, Brade,
A.C. s.n. (RB74168); Pirajussara, 03/11/1930, Gehrt, A. 26678 (NY); Pirajussara,
03/11/1930, Gehrt, A. s.n. (SP26678); Alto da Serra, Estação Biológica, 14/10/1921,
Hoehne, F.C. 5787 (SP); Cabreúva, 18/07/1935, Hoehne, F.C. s.n. (SP40308); Serra
da Cantareira, 15/06/1895, Loefgren, A. 3052, holotype, Prescottia paulensis Cogn.
(BR, isotype SP); City limits of São Paulo, 06/10/1940, Mulford 1151 (GH); Alto da
Serra, 07/1998, Edwall, G. 6011 (SP); Amparo, Monte Alegre, margem do rio
Camanducaia, 26/08/1943, Kuhlmann, M. 1050 (SP); Amparo, s.d., Recch, P. 79
(SP); Atibaia, Parque Municipal da Grota Funda, s.d., Bernacci, L.C. 28441 (UEC);
Atibaia, Parque Municipal da Grota Funda, s.d., Bernacci, L.C. 28442 (UEC);
Bocaina, 05/05/1951, Brade, A.C. 20858 (RB); Campinas, Reserva Santa Genebra,
19/08/1993, Bernacci, L.C. 110 (IAC); Campinas, Sousas, 05/07/1997, Singer, R.B.
97/60 (UEC); Campinas, Barão Geraldo, Fazenda Sta. Genebra, 13/11/1995, Spina,
A.P. 444 (HUEFS, UEC); Campos do Jordão, 1916, Campos-Porto, P. 6954 (GH);
Campos do Jordão, 05/1945, Leite, J.E. 3493 (GH65831, GH71591, SP); Campos do
Jordão, 13/07/1916, Campos-Porto, P. 300 (RB); Campos do Jordão, Estrada para
São José dos Alpes, 28/03/1994, Cordeiro, I. 1293 (SP); Campos do Jordão,
22/10/1938, Hashimoto, G. 48 (SP); Cananéia, Parque Estadual Ilha do Cardoso,
morro Três Irmãos, 30/06/2002, Breier, T.B. 303 (UEC); Embu-Guaçu, Estrada Mina
de Ouro, Splash Club, 01/11/1996, Rapini, A. 233 (SP); Igaratá, 12/12/1951,
239
Kuhlmann, M. 2742 (SP, SPF, US); Itatiba, Serra Azul, 07/08/1998, Singer, R.B.
98/152 (UEC); Jaraguá, 12/07/1921, Gehrt, A. s.n. (NY533768); Jaraguá,
12/07/1921, Gehrt, A. s.n. (SP5712); Jundiaí, Serra do Japi, sentido bairro Eloy
Chaves, próximo a represa do DAE, 09/09/2003, Pansarin, E.R. 1084 (UEC);
Jundiaí, Serra do Japi, sentido bairro Eloy Chaves, próximo a represa do DAE,
03/10/2004, Pansarin, E.R. 1161 (UEC); Jundiaí, Serra do Japi, sentido bairro Eloy
Chaves, próximo a represa do DAE, 01/2001, Pansarin, E.R. 835 (UEC); Jundiaí,
Serra do Japi, 07/08/1998, Singer, R.B. 98/153 (UEC); Jundiaí, Serra do Japi,
07/08/1998, Singer, R.B. s.n. (UEC140055); Jundiaí, Serra do Japí, Bairro Eloy
Chaves, próximo a represa do DAE, 10/09/1997, Pansarin, E.R. 97/69 (UEC);
Paranapiacaba, via férrea São Paulo-Santos, Estação Biológica, 12/07/1966,
Handro, O. 1143 (SPF); Piassaguera, 23/10/1923, Hoehne, F.C. s.n. (SP29237); São
Paulo, Parque do Estado, 08/08/1979, Custodio Filho, A. 128 (SP); São Paulo,
Parque do Estado (on old maps "Parque de Agua Funda") grounds of the Instituto de
Botânica, 10.1 km south an 2.0 km east of center of São Paulo (Praça da Sé),
13/06/1960, Eiten, G. 2060 (MO, US); São Paulo, nativa no Jardim Botânico,
15/07/1970, Handro, O. 2143 (SPF); São Paulo, nativa no Jardim Botânico,
29/06/1938, Handro, O. s.n. (SP48277); São Paulo, nativa no Jardim Botânico,
29/06/1938, Handro, O. s.n. (HUEFS115461, SPF72208); São Paulo, Bosque da
Saúde, 10/05/1923, Hoehne, F.C. s.n. (SP8377); São Paulo, Butantan, 28/10/1924,
Hoehne, F.C. s.n. (SP29229); São Paulo, 13/06/1929, Hoehne, F.C. s.n. (SP24105);
São Paulo, Reserva do Morumbi, 23/05/1985, Honda, S. 615 (SPF); São Paulo,
Reserva do Morumbi, 23/05/1985, Honda, S. s.n. (PMSP); São Paulo, Reserva
Biológica do Parque Estadual das Fontes do Ipiranga, 09/05/1978, Jung, S.L. 256
(SP); São Paulo, Reserva Biológica do Parque Estadual das Fontes do Ipiranga,
19/09/1980, Jung, S.L. 328 (SP); São Paulo, Reserva Biológica do Parque Estadual
das Fontes do Ipiranga, 12/03/1980, Kirizawa 544 (SP); São Paulo, 30/10/1926,
Kuhlmann, M. s.n. (SP29233); São Paulo, Represa do Guarapiranga - Ilha dos
eucaliptos, 17/08/1995, Meireles, D.S. CIE 101 (PMSP); São Sebastião, Parque
Estadual da Serra do Mar, estrada da Limeira, 19/04/2000, Souza, J.P. 3269 (ESA);
Ubatuba, Picinguaba, Parque Estadual da Serra do Mar, trilha para Parati,
11/11/1990, Furlan, A. 1312 (HRCB, HUEFS); Ubatuba, Parque Estadual da Serra
do Mar, núcleo Picinguaba, 15/08/1999, Singer, R.B. 99/08 (UEC). BRITISH
240
HONDURAS, Plans of Yucatan Peninsula, Stann Creek District, 14 miles, Stann
Creek Railway, 21/12/1937, Gentle, P.H. 2159 (GH); Stann Creek Valley, Big Eddy
Ridge, 17/01/1941, Gentle, P.H. 3492 (GH, NY); Toledo, 29/01/1907, Peck, M.E. 638
(GH, K). COLOMBIA, Departamento del Valle, Cordillera Ocidental, vertiente
occidental, monte La Guarida, filo de la cordillera sobre La Carbonera (entre Las
Brisas y Albán), 18/10/1946, Cuatrecasas, J. 22259 (F1361086, F1361087, GH, US);
Comisaria del Caquetá, Cordillera Ocidental, vertiente oridental, Sucre, 04/04/1940,
Cuatrecasas, J. 9070 (COL, US); Antioquia, Municipios Medellín y Guarne, Parque
Ecológico Piedras Blancas, sector Lajas, 19/11/1994, Fonnegra, R. 5288 (HUA);
Municipios Medellín y Guarne, Parque Ecológico Piedras Blancas, sector Lajas,
10/12/1994, Fonnegra, R. 5319 (HUA); Caldas, Vereda La Corrala, Finca La Zarza,
23/03/1984, Escobar, L.A. 3976 (MO); Medellín, Road from San Pedro to Don
Matius, 15/09/1984, Dodson, C.H. 15302 (MO); Mpio de Guarne, Piedras Blancas,
05/08/1971, Soejarto, D.D. 3063 (HUA); Cordillera Ocidental, dep. Magdalena, Sierra
de Parija, 6 km east-ne of Manaure, 42 km east of Valledupar, 7 hm from
Venezuelan border, 02/02/1945, Grant, M.L. 10759 (US); Cordillera La Macarena
(extremo nordeste), macizo Renjifo, cumbre y alrededores, 06/01/1951, Idrobo, J.M.
1047 (COL); Cordillera occidental, 11/09/1922, Killip, E.P. 11357 (GH); Límites entre
las Departamentos de Santander y Bojacá: Corregimiento de Virolín. Finca "La
Sierra", 12/05/1976, Lozano, G.C. 2360 (COL); Antioquia, s.d., Madero, M. 120,
lectotype, Prescottia longifolia Schltr. (AMES); Cordillera occidental, 14/05/1922,
Pennell, F.W. 5791 (GH); Sierra de La Macarena, Central Mountains, South Ridge,
06/01/1950, Philipson, W.R. 2038 (BM); Dep. Antioquia, bosque humedo bajo la
cumbre de Santa Elena, caminho entre Medellin y Rionegro, 02/04/1949, Skolnik, R.
19an 374 (US); Magdalena, Santa Marta, 1898-1901, Smith, H.H. 2277, lectotype,
Prescottia smithii Schltr. (NY, isolectotype CM, F, GH, line drawing GH, K, US);
Santa Marta, "Horqueta" Mountain, 28/12/1898-9, Smith, H.H. 2847 (NY); Jamesia,
Vicinity of Medellin, 01/02/1928, Toro, R.A. 945 (NY); El Tambo, Cauca, 13 km de El
Tambo a Munchique, Cordillera Occidental,13/05/1991, Betancur, J. 2518 (NY);
Envigado, Vereda Pantanillo en límites con Mpio de Rionegro y Retiro en Vereda
Yarumales (Mpio Rionegro), 35 km SE de Medellín, 12/12/1990, Callejas, R. 9672
(NY); Cauca, ad pag. El Tombo, Munchique, 27/08/1935, Sneidern, K. 376 (S);
Cundinamarca, road to east from Guasca, 31/05/1947, Haught, O. 5796 (US);
241
Zipaquirá-Cogua, "La Juratena", 08/05/1942, Huertas, G. 1129 (COL); 11/06/1939,
Renz, O. 4054 (BBG4054.1, BBG4054.2); Salto de El Tequendama, 04/1946,
Schneider, M. 348/1 (COL); Bojacá, 03/1949, Schneider, M. 348/2 (COL); Bogotá,
Localidade Usaquén, Ver. Torca, Calle 200, Frente a estación de policía, 07/2002,
González, C.A.B. 1249 (COL486762); Bojacá, vereda de san Antonio, "La Merced",
próximo a la carretera Mosquera-Tena, 12/07/1964, Lozano, G.C. 141 (COL);
Bojacá, Vereda de San Antonio, "La Merced", en faja de robledales proximo a la
carretera que conduce de Mosquera a La Mesa, 19/03/1964, Torres, J.H. 77 (COL);
Magdalena, Santa Marta, Base de Cerro Quemado y Cerro San Lorenzo,
22/04/1959, Romero-Castañeda 7842 (COL); Meta, Acacías, Cordillera Oriental,
Colonia Penal y Agrícola de Oriente, cerca del Campamento de La Neseta,
07/08/1981, Jaramillo, R. 7354 (COL); Nariño, Finca La Planada, near Chucunes,
13/01/1981, Gentry, A. 30602 (MO); Pasto Cabeceras de Chachagui, 01/06/1972,
Mora, L.E. 6006 (COL); Risaralda, Pereira, Orilla del camino entre Ceylan y el
Cedral, 06/89, Franco, P. 2935 (COL); Valle, Bosque de San Antonio, W of Cali, near
television tower, lower montane forest, 15/07/1984, Gentry, A. 48166 (MO); Valle del
Cauca, Cali, Finca Zingara km 18 de la carretera Cali-Buenaventura, km 4 via a
Dapa, corregimiento de la Elvira, cordillera Occidental, 29/03/1997, Gensini, J.G. 801
(MO). COSTA RICA, Hills above Palmar Norte, 21/02/1953, Allen, P.H. 6732 (SEL);
Alajuela, Reserva Biológica Monte Verde Rio Penas Blancas, Laguna Poco Sol,
08/08/1989, Bello, E. 1088 (CR); La Palma de San Ramón, 28/11/1924, Brenes,
A.M. 409 (CR); San Ramon region, 1924-5, Brenes, A.M. 1142 (NY); Volcan
Miravalles, west of Bijagua, near the Rio Zapote, 11-2/02/1982, Burger, W. 11703
(BM, CR, F); Puntarenas, Cantón de Osa, Uvita, San Josecito, Faldas de la fila
Alivio, Lado Pacífico de la fila Costena, Finca Oro Verde, 11/01/2000, Blanco, M.
1193 (CR, K); about 8 km southwest of Puerto Viejo along the road to San Jose,
07/01/1967, Burger, W. 4295 (F); Osa, Bahia Ballena, Bosque cerca del poblado de
San Josecito, subiendo Fila El Alivio, 16/11/2006, Chacón, E. 740 (USJ); Sendero
entre el campamento Canta Rana y Rio Peje, Magsasay, Heredia, 14/01/83, Chacón,
I.A. 67 (CR); Refugio Nacional Golfito Southern end of Fila Gamba, in vicinity of pass
crossed by road from Golfito to Villa Briceno, 10/12/1988, Grayum, M. 9183 (CR,
MO); Cantón de Buenos Aires Ujarras, cabeceras de Rio Kuiye, seguiendo las Filas
que dan a Olan, 20/09/1989, Herrera, G. 3500 (CR, MO, SEL); Cantón de Golfito
242
Jiménez, Dos Brazos de Rio Tigre, Siguiendo el sendero que desciende hasta la
unión de la Quebrada Patemazo com Quebrada Porsillego, 22/11/1990, Herrera, G.
4630 (CR); Guanacaste, Estación Cacao, Parque Nacional Guanacaste, 23/11/1990,
Espinosa, R. 51 (K, MO); Parque Rincón de la Vieja, Liberia Del Mirador siguiendo la
fila al volcán Santa Maria, 22/11/1987, Herrera, G. 1355 (CR, MO, SEL); San Jose:
Pérez Zeledón, Savegre abajo de Rio Nuevo, Finca de Neftalí Cordero, 10/11/1998,
Estrada, A 1889 (CR); Dota. Copey, Tres de Junio, Carret. Inter. Sur, 28/08/1999,
Laurito, J.G. 13230 (USJ); Dota, Estribaciones Sureste del Cerro Lira, 11/12/1994,
Martén 735 (CR); Limon, Almirante, Cerro Chiqui, subiendo desde la base por el
flanco norte, 18/08/1995, Herrera, G. 8605 (CR); Cataratas de El Zapote, Turrialba,
17/02/1977, Laurito, J.G. GL 2400 (USJ); Alajuela: SE slope of Vulcan Arenal
between Fortuna and Palma, 25/07/1990, Luther, H. 2812 (SEL); San Carlos, San
Juana de Venecia, 24/11/1990, Mora, D.E. s.n. (USJ50565); Corcovado Nat. Park,
near Estation Sirena, 15/12/1989, Merz 529 (SEL); Tapantí, Cartago, 06/06/1990,
Mora, D.E. s.n. (USJ38238); Cartago, south of Cartago near San Cristobal,
22/09/1979, Luer, C.A. 4269 (SEL); Cartago, Canton de Turrialba, CATIE, Sendero
Los Espaveles, 16/02/1991, Hammel, B. 18134 (MO); Cartago, Lourdes, Navarro del
Socorro, 09/11/1999, Pupulin, F. 1751 (USJ); Cartago: 1,3 km down (west) road to
San Cristobal norte from Pan Am highway, uphill slope, 21/09/1979, Walter, K.S.
79496 (CR); Shirores, Calamanca, 02/1895, Pittier 9178 (US); Tapantí, Cartago,
06/06/1990, Schmidt, B. s.n. (USJ38243); Prov. Guanacaste, Hillside of a low ridge
about 3 km north of Rio Naranjo, 05/01/1975, Taylor, J. 18101 (F, MO, US);
Aguabuena, 3.5 km W of Rincón, 1 km N of Boscosa station, 04/12/92, Thomsen, K.
211 (CR, K); Osa Peninsula, Aguabuena, 3,5 km W of Rincón, four-hectare
permanent sample plot 1 km N of Boscosa station in well-drained undulating terrain
with slopes of 15-35o, 04/12/92, Thomsen, K. 211 (CR, K); Cauca, Paramo de
Barbillas, southeast of Popayan, 27/07/1978, Luer, C.A. 3022 (SEL); Cauca, Paramo
de Barbillas, 27/07/1978, Luer, C.A. 3033 (SEL); Guanacaste, Parque Nacional
Rincon de la Vieja, the SE slopes of Volcan Santa Maria, above Estacion Hacienda
Santa Maria, 27/01/1983, Davidse, G. 23458 (MO); Guanacaste, Ridge SSE of
Quebrada Zopilote, lower SE slope of Vulcan Santa Maria, 24/01/1986, Grayum,
M.H. 6209 (MO); Guanacaste, Parque Nacional Guanacaste, Estacion Pitilla,
Sendero Nacho, 03/01/1991, Ríos, P. 284 (MO); Heredia, Parque Nacional Braulio
243
Carrillo, forest between Rio Peje and Rio Sardinalito, Atlantic slope of Volcan Barva,
14/11/1986, Grayum, M. 7903 (MO); Heredia, North end of Cerro Las Marias, N
slope of Volcan Barva, 19/04/1986, Grayum, M.H. 7294 (MO); Puntarenas, Reserva
Florestal Golfo Dulce Aguabuena, Sector norte 21/11/1991, Aguilar, R. 686 (MO);
Puntarenas, Canton de Osa, R.F. Golfo Dulce, Peninsula de Osa, Estacion Cerro de
Oro, sobre el Rio que localmente se le conoce como el Nino, Faldas de Cerro Ricon,
01/12/1995, Angulo, L. 496 (MO); Puntarenas, Canton de Golfito, P.N. Corcovado,
Peninsula de Osa, Bonanza, 05/03/1997, Azofeifa, A. 265 (MO); Puntarenas, about 5
km west of Rincon de Osa, Osa Peninsula, 09-12/01/1970, Burger, W.C. 7260 (F);
Puntarenas, Canton de Buenos Aires Olan, camino entre Sipar y Olan, 23/09/1989,
Chacón, A. 398 (SEL); Puntarenas, Upper Rio Buru, 19/08/1983, Gómez, L.D. 21413
(MO); Puntarenas, Osa Peninsula, trail from Rincon de Osa to Rancho Quemada,
13/11/1972, Kennedy, H. 1947 (MO); Puntarenas, Ridge north of Airport; Rincon de
Osa, 10/02/1974, Liesner, R. 1983 (MO). CUBA, Loma del Gato, Sierra del Cobre,
Provincia Oriente, 25-05/09-10/1935, Acuna, J. 9767 (GH); Province of Pinar del Rio,
Cayajabos, 20-10/01-02/1903, Ames, O. 05 (GH2819, GH2820); Cayajabos,
02/1903, Ames, O. 06 (GH2817, GH2818); Cayajabos, Pinar del Rio, 02/1903,
Ames, O. 12 (GH2815, GH2816); Cayajabos, 27/01/1903, Ames, O. s.n. (GH2826);
Cayajabos, 27/01/1903, Ames, O. s.n. (GH2829); Cayajabos, Pinar del Rio, 2010/01-02/1903, Ames, O. s.n. (GH2814); Province of Pinar del Rio, 20-10/0102/1903, Ames, O. s.n. (GH2825); Province of Pinar del Rio, Cayajabos, 20-10/0102/1903, Ames, O. s.n. (GH2821); Province of Pinar del Rio, Cayajabos, 27/01/1903,
Ames, O. s.n. (GH2823); Province of Pinar del Rio, Cayajabos, 27/01/1903, Ames,
O. s.n. (US426682); Province of Pinar del Rio, Cayajabos, 27/01/1903, Ames, O. s.n.
(GH2824); Province of Pinar del Rio, Cayajabos, 27/01/1903, Ames, O. s.n.
(GH2828); Trindad Mountains, Santa Clara, El Porvenir, 09/03/1910, Britton, N.L.
5316 (NY); Prov. Pinar del Rio, Pan de Guajaibón, highest mountain of the Sierra de
los Organos, northern slope, 09/01/1921, Ekman, E.L. 12751 (S); Prov. Santa Clara,
Lomas del Banao, El Purial, on Rio Banao, on the ridge between El Purial and Los
Guineos, 27/01/1923, Ekman, E.L. 16234 (S); Prov. Oriente, Sierra Azul (inter
Quibijan et Toa), 23/01/1915, Ekman, E.L. 4370 (S); Prov. Oriente, in juga maestrali
(Sierra Maestra), prope P. de Palmamocena, 19/04/1915, Ekman, E.L. 5581 (S);
Prov. Oriente, Sierra de Cristal, in manacales at the headwaters of Rio La brisa,
244
04/03/1916, Ekman, E.L. 6775 (S); Prov. Oriente, Sierra Maestra (La Bayamesa) Rio
Oro, near the mining camp, 05/05/1916, Ekman, E.L. 7249 (S); Prov. Oriente, Sierra
Maestra (La Bayamesa), Rio Oro, near the mining camp, 05/05/1916, Ekman, E.L.
7258 (NY, S); Prov. Oriente, Sierra de Nipe, in manacales at Rio Piloto, 17/02/1917,
Ekman, E.L. 9034 (S); Prov. de Oriente, Zona boscosa de la sierra Maestra, entre los
Arroyos Peladero e Indio, Costa sur de Oriente, 27/11/1959, Figueiras, L. 379 (US);
Lomas de Banao (Santa Clara), 01/1920, Luna, A. 149 (NY); Oriente, Crest of Serra
Maestra between Pico Turquino and La Bayamesa, 27-28/10/1941, Morton, C.V.
3668 (US); Oriente, Crest of Serra Maestra between Pico Turquino and La
Bayamesa, 27-28/10/1941, Morton, C.V. 3705 (US); Slopes of La Bayamesa, crest of
the Serra Maestra near Aserradero San Antonio de los Cumbres, 21-24/01/1956,
Morton, C.V. 9228 (US); Rio Guayabo, above the falls, Oriente, 21-30/01/1910,
Shafer, J.A. 3721 (NY); Near base of Loma Mensura, Oriente, 1-3/02/1910, Shafer,
J.A. 3849 (NY); Prope villam Monte Verde dictam, Cuba Orientali, 01-7/1859, Wright,
C. 1473 (G, GH, K, photo MO, MO, P); In Cuba Orientali, 1860, Wright, C. 626 (BM,
K, K-L, P); Cuba Orientali, 1856-7, Wright, C. s.n., holotype, Prescottia pellucida (KL); s.l., s.d., Wright, C. s.n. (P00371966); s.l., s.d., Wright, C. s.n. (P00371967);
Vedado – Habana,. Pinar del Rio, 04/1942, Liogier, B.A.H. 103 (GH). DOMINICA,
Laudart, 04/04/1888, Imray, D. 107 (K); s.l., s.d., Imray, D. 256 (K); on Island of
Dominica, 10/01/1977, Rabinowitz, L. s.n. (SEL16835); s.l., 07/1888, Ramage, G.A.
s.n. (K); St. Peter, Syndicate Estate, 25/03/1987, Whitefoord, C. 5607 (BM); St.
Peter, Syndicate Estate, 26/03/1987, Whitefoord, C. 5619 (BM); North-west slops of
Morne Diablotin, Syndicate Estate, 27/03/1988, Whitefoord, C. 5881 (BM); Ti Branch,
St. Andrew - Path along the ridge, 03-4/1996, Whitefoord, C. 7369 (BM); Badineau,
Wooded slopes west of Morne Gay hause, 24/03/1940, Hodge, W.H. 2227 (GH);
West Indies, Layou River Valley, stream northeast of Clarke Hall, Brookhil Estate
(Manette Gutter), 23/04/1964, Ernst, W.R. 1155 (BM, GH, US); West Indies, one mile
east of Laudat, 11/03/1940, Hodge, W.H. 1988 (GH); West Indies, Rainforest
bordering Imperial Road, Red Gulley, 05/04/1940, Hodge, W.H. 2508 (GH).
DOMINICAN REPUBLIC, Old Heart River (Jato Viejo), Samaná Peninsula, 1623/04/1921, Abbott, W.L. 1406 (US); Polo, Provincia de Barahona, 26-12/02-3/1922,
Abbott, W.L. 1871 (US); Vicinity of Piedra Blanca, Province of La Vega, deep moist
woods near Goodrich Rubber Grove, 19/01/1947, Allard, H.A. 18950 (US); Alredores
245
del Pico del Gallo, 28/12/1952, Jiménez, J. 2523 (US); Puerto Plata, Prov. El Choco,
26/03/1961, Jiménez, J. 4387 (US); La Mina, Sect. El Jovero, Miches, El Seibo
Province, 25/03/1970, Jiménez, J.J. 5803 (NY); Loma de la Sal, Jarabacoa,
24/05/1968, Liogier, B.A.H. 11401 (NY); E of Loma de la Sal, Jarabacoa, 710/08/1968, Liogier, B.A.H. 12011 (GH, NY); Above Los Arroyos along the
International Higway, Pedernales, 18-20/02/1969, Liogier, B.A.H. 13986 (NY); About
10 miles W from Aceitillar, Bahoruco Mts., Pedernales, 24/02/1969, Liogier, B.A.H.
14184 (NY); About 10 miles W from Aceitillar, Sierra del Bahoruco, Pedernales,
24/02/1969, Liogier, B.A.H. 14332 (NY); Valle de Lagrimas, N from Los Cacaos,
Samana Peninsula, 15/03/1969, Liogier, B.A.H. 14431 (NY); Valle de Lagrimas,
about 5 miles N of Los Cacaos, Samaná Peninsula, 15/03/1969, Liogier, B.A.H.
14434 (NY); Los Haitises, cockpit cointry, limestone hills, near the mouth of
Barracote river, Samana Bay, 19/03/1969, Liogier, B.A.H. 14480 (GH, NY, P);
Zapotén, 57.2 km N of Pedernales, 26/03/1985, Maas, P.J.M. 6434 (K, NY);
Departamento de Olancho, Refugio de Vida Silvestre de La Muralla, 14 km N de La
Unión, Quebrada de Monte Escondido, 1-2/04/1993, Nelson, C. 15557 (GH); Near
Loma de Toro, 15-14/01-2/1982, Phillips, B.R. 90 (K); Independencia, 5-6 km NNW
of Angel Feliz, near crest of Serra de Neiba, 22/07/1992, Thompson, S.A. 10578
(CM); Prov. Pedernales, 5 km NE of Los Arroyos, 01/10/1991, Thompson, S.A. 9328
(CM); Sierra de Baoruco, Prov. Pedernales, 46 km al Norte del Puerto de Cabo Rojo
(de Alcoa Exploration Company) en el camino minero a Las Mercedes, Aceitillar,
Conate, y Las Abejas (minas), 17/02/1982, Zanoni, T. 19106 (NY); Sierra de Neiba,
prov. Independencia, ente Cerros de Plan Ciquen y Loma El Hoyazo, 34 km de La
Descubierta en la carretera de la frontera a Aniseto Martinez y Hondo Valle,
15/12/1982, Zanoni, T. 24949 (NY); Cordillera Central, Prov. Las Vega, Parque
Nacional J.A. Bermúdez: en la Loma "La Cotorra", aprox. 45-60 mins. lejos de Los
Tablones en el sendero al Pico Duarte, 16/01/1987, Zanoni, T. 37759 (NY); Sierra de
Neiba, prov. Estrelleta, cerca del monumento de "km 204" (al "Sur" de Aniseto
Martínez) en la Carretera Internacional, 15/07/1988, Zanoni, T. 39957 (NY);
Cordillera Central, Prov. Santiago Rodríguez, Parque Nacional J.C. Ramírez, entre
Monte Llano & Los Descansaderos, 10/07/1988, Zanoni, T. 41879 (NY). ECUADOR,
Carchi, Huaca, Parroquia Mariscal Sucre, Estacion Biologica Guandera, ca. al
Sendero Autogioado Clusia, 13/01/2001, Alvarez, A. 2862 (NY, QCNE); Zamora-
246
Chinchipe, Nambija. 24/09/2001, Alvarez, A. 2926 (NY); Morona-Santiago, Macas,
ca. Cordillera de Cutuc'u, 24/09/2001, Alvarez, A. 2927 (NY); Cordillera Oriental,
below Camp Equator, due east of Volcano de Cayambe, 18/07/1944, Drew, W.B.E.
335 (GH); Parque Nacional Sumaco Napo-Galeras, Cumbre de la Cordillera de
Galeras, 05/03/2003, Farfán, W. 472 (QCNE); Zamora-Chinchipe, Nudo de
Sabanilla, just E of the pass on road to Valladolid, 04/02/1985, Harling, G. 21577
(QCNE); Carchi, Espejo, El Gualtal, Faldas de Cerro Golondrina, 21/08/1994,
Palacios, W. 12661 (QCNE); Prov. Azuay, between Huagrarancha and Loma de
Galapagos, 09/07/1943, Steyermark, J.A. 53468 (F); Prov. El Oro, along Quebrada,
on south, southwest, and west-facing slopes in Montana Sichicay, near Cachicaran,
tributary to Rio Minas Nuevas, above Huertas, east and northeast of Paccha,
24/08/1943, Steyermark, J.A. 54110 (F); Morona-Santiago, Morona Canton,
Cordillera del Cutucu, Asociacion Shuar Sevilla, Junto al camino Angel
Ruby/Transcutucu, Cerro Nashipe, 14/03/2002, Suin, L. 1851 (MO, QCNE); Carchi,
El Pailon, ca. 45 km below Maldonado along a foot path to Tobar Donoso,
01/12/1979, Madison, M.T. 7217 (SEL31064, SEL31065); Imbabura, Selva Alegre,
08/1982, Hirtz, A. 343 (SEL); Loja, Parque Nacional Podocarpus, E of Nudo
Cajanuma, wet montane forest above Centro de Informacion, 16/06/1988, Øllgaard,
B. 74885 (AAU); Morona-Santiago, Cordillera de Cutucu, western slopes, along a
trail from Logrono to Yapi, 11/1976, Madison, M.T. 5501 (SEL); Napo, Guayacamayo
range, Baeza–Tena, 15/07/1983, Hirtz, A. 1144 (SEL); Napo, Baeza to Tena,
11/1982, Hirtz, A. 390 (SEL); Napo, Cerro Sumaco, SE slope, 02/05/1979, Madison,
M.T. 6909 (SEL); Pichincha, at km 70 old road Quito-Sto. Domingo west of
Chiriboga, 15/12/1981, Dodson, C.H. 13512 (SEL); Pichincha, Rio Toachi on road
from Quito-Santo Domingo, 15/07/1983, Hirtz, A. 1084 (SEL); Pichincha, Mindo, s.d.,
Hirtz, A. 323 (SEL); Tungurahua, Mt. Tungurahua, 11/11/1985, Hirtz, A. 2096 (GH);
Zamora-Chinchipe, Parque Nacional Podocarpus, Road Yangana-Valladolid, just S
of pass (Nudo de Sabanilla), 14/02/1989, Øllgaard, B. 90554 (AAU); Ecuador*, Prov.
Tungurahua, Cordilheira de Llanganates, near junction of Rio Golpe and Rio
Sangarinas (Desaguadero), 26/11/1939, Asplund, E. 9981 (S). EL SALVADOR,
Cerro Montecristo - Los Planes, 17/12/1974, Hamer, F. 436 (GH, SEL); Boqueron del
volcan San Salvador, 17/12/1974, Hamer, F. 445 (SEL). GRENADA, Mt. Gilbert, NE
of Mt. Maitland, 4-10/03/1979, Howard, R.A. 18793 (BM, GH, NY, US); West Indies,
247
Annandale, St. George's, 03/1906, Broadway, W.E. s.n. (GH10636); West Indies,
Annandale, St. George's, 03/1906, Broadway, W.E. s.n. (NY167929); West Indies,
30/03/1898, Broadway, W.E. s.n. (GH7614). GUADELOUPE, s.d., 377 (P00371974);
Houellemant, 04/1894, Duss, Pere = A. Duss 3394 (NY, US); Bois de Deshaies,
16/04/1903, Duss, Pere = A. Duss 4217 (NY); Morne de Huelmont, 15/07/1893,
Duss, Pere = A. Duss 632 (P); Crête du Morne de la Poite Noire, 04/1843,
L'Herminier, F.L. 12 (P); Cascade Vauchelet, s.d., Quentin, R.P. 646 (P); Banio
Jaunes, 15/3/1938, Questel, A. 2272 (US); Ste Rose, 15/3/1939, Questel, A. 4005
(P, US); Sofaia, 05/05/1987, Questel, A. s.n. (P00371979); Sainte Rose, trace
Sofaia-Baille Argent, en forêt, 03/04/1979, Raynal-Roques, A. 21076 (GH, P); Forêt
de Tunet, 22/02/1936, Rodriguez, L. 3890 (P); Forêt de Sofaïa, 21/03/1939,
Rodriguez, L. 4247 (P); s.l., 03/1937, Serres du Muséum Paris, s.n. (P00371983); S
of Aya, Chemin des Bains, 21/03/1936, Stehlé, H. 2886 (GH, NY, P); Endroits
arbrites, Honelmant, Vieux Fost, 25/02/1936, Stehlé, H. 377 (NY, P). GUATEMALA,
s.d., s.n. (W12923); Finca "San Vicente" Eberhard Hartleben, Sierra de las Minas,
04/06/1972, Hamer, F.A. 146 (SEL); Zinca Mocá, Depto. Suchi – Tepequez,
25/10/1934, Skutch, A.F. 1540 (GH, K); Nebaj, Depto. Quiché, 16/11/1934, Skutch,
A.F. 1684 (GH); Volcán Zunil, 04/08/1934, Skutch, A.F. 932 (GH); Dept. Zacapa,
bordering Quebrada Alejandria, summit of Sierra de Las Minas, vicinity of Finca
Alejandria, 13/10/1939, Steyermark, J.A. 29848 (F); Dept. Izabal, along Rio Frio.
Cerro San Gil, 19/12/1941, Steyermark, J.A. 41604 (F, GH); Dept. Izabal, Cerro San
Gil, 25/12/1941, Steyermark, J.A. 41872 (F, GH); Dept. Zacapa, slopes of Monte
Virgem, Sierra de Las Minas, 12/01/1942, Steyermark, J.A. 42643 (F, GH); Dept. El
Progreso, hills N of Finca Piamonte, between Finca Piamonte and summit of Volcán
Santa Luisa, 05/02/1942, Steyermark, J.A. 43603 (F, GH); Dept. Sololá, Volcán
Atitlán, south-facing slopes, 11/06/1942, Steyermark, J.A. 47396 (F); Cubilquitz,
Depart. Alta Verapaz, 06/01/1906, Tuerckheim, H. 8589 (GH6366, GH71571, K, NY,
US); Jutiapa, Volcan Suchitan, northwest of Asuncion Mita, 18/11/1939, Steyermark,
J.A. 31939 (F); Quezaltenango, lower south-facing slopes of Volcan Santa Maria,
between Finca Pirineos and Los Positos, between Santa Maria de Jesus and
248
Calahuache, 08/01/1940, Steyermark, J.A. 33790 (F); San Marcos, slopes of
barrancos tributary to and bordering Rio Vega, between San Rafael at northeast
portion of Volcan Tacana and Guatemala-Mexico line, 21/02/1940, Steyermark, J.A.
36364 (F); San Marcos, Near Fraternidad, between San Rafael Pie de la Cuesta and
Palo Gordo, west facing slope of the Sierra Madre Mountains, 10-8/12/1963,
Williams, L.O. 26302 (F); Baja Verapaz, km 162, 2 km south of Puruhla, 18/02/1980,
Dodson, C.H. 9518 (SEL). GUIANA FRANCESA, Mont Saint-Marcel, zone du
sommet Sud, 20/07/2002, Granville, J.J. 15362 (CAY); Mont Saint-Marcel, zone du
sommet central, 24/07/2002, Granville, J.J. 15452 (CAY). GUYANA, Potaro-Siparuni
Region. Mt. Ayanganna, east face, fourth of four escarpments, 21/06/2001, Clarke,
H.D. 9431 (US); U. Takutu-U. Essequibo, Rupununi River, betw. Kwattamang
Landing & Rewa Village, 29/09/1997, Clarke, D. 6793 (NY, US); U. Takutu-U.
Essequibo, Wassarai Mts., upper slopes of northern outlier, 0-0,5 km S of summit,
01/09/1999, Clarke, H.D. 8111 (US). HAITI, Rivere Glace, 05/05/1944, Curtis, J.T. 17
(GH); Ins. Hispaniola, civ. Haiti, Dep. Du Sud, solme de la Hotte in mont. Accid. Ma
Blanche, 07/08/1917, Ekman, E.L. H 534 (S); Guimbi Gatata, Morres des
Commissaires, 21/06/1942, Holdridge, L.R. 1283 (GH, NY); Vicinity of St. Louis du
Nord, 07/04/1929, Leonard, E.C. 14587 (US); Vicinity of Mission, Fonds Varettes, 1704/04-05/1920, Leonard, E.C. 3871 (NY, US); Vicinity of Marmelade, Departament
du Nord, 20/12/1925, Leonard, E.C. 8381 (NY, US). HONDURAS, Dept.
Tegucigalpa, Vicinity of San Juancito Colonial Trail, 30/11/1931, Edwards, J.B. 111
(GH); Cerro de Uyuca, dept. Francisco Morazan, 10-20/03/1951, Morton, C.V. 6916
(US); Lancetilla Valley, near Tela, Department of Atlantida, 06-20/12-03/1927-28,
Standley, P.C. 53997 (F, GH, US); Lancetilla Valley, near Tela, Department of
Atlantida, 06-20/12-03/1927-28, Standley, P.C. 54213 (GH); Lancetilla Valley, near
Tela, Department of Atlantida, 06-20/12-03/1927-28, Standley, P.C. 56568 (GH);
Dept. Morazan, Slopes of Cerro de Uyuca, 25-05/11-2/1946, Standley, P.C. 737 (F);
Dept. Morazan, entre El Piliguin y Prado de Fatima, la represa La Tigra, 30/12/1962,
Williams, L.O. 11238 (F); Dept. Cortes, NE shore of Lake Yojoa, 30/12/1952,
Williams, L.O. 18755 (F, US); Rio Esperanza, Pto Sierra, 02/02/1903, Wilson, P. 280
(NY); Morazan, Summit of Cerro Uyuca, 05/12/1946, Allen, P.H. 4005 (SEL).
JAMAICA, 1855, 10 (P00371963); Arntully, St. Thomas, 03/02/1963, Adams, C.D.
12211 (M, MO); Parish, Portland, Proctor's Pool, 01/03/1961, Adams, C.D. 9147
249
(GH); St Andrew, Grand Ridge of the Blue Mountains between Morce's Gap and
John Crow Peak, 24/04/1991, Bellingham, W. 1432 (BM); Union hill, near Moneague
(Parish of St. Ann's), 6-7/04/1908, Britton, N.L. 2808 (NY); Parish of St. Thomas, ?,
Curea Curea Gap, 1-13/03/1909, Britton, N.L. 4041 (NY); Leeward side of Morcé's
Gap, toward St. Helen's, 12/06/1940, Chrysler, M.A. 4563 (GH); Cinchona, Blue
Mountains, windward slopes, 24/02/1915, Harris, A. C 15256 (US); Cinchona, Blue
Mountains, windward slopes, 13/03/1915, Harris, A. C 15474 (NY); Ridge below
Vinegar Hill, 05/02/1908, Harris, W. 10096 (GH, K, NY); Survery of vegetation on
bauxite and related areas–Parish, Portland, The John Crow Mts., 1,5-2,5 mi. SW of
Ecclesdown, 24/01/1956, Howard, R.A. 14774 (GH); Survery of vegetation on
bauxite and related areas–Parish, St. Ann. Schwallenburgh property, northeast
slopes of Mt. Diablo, 21/01/1958, Howard, R.A. 15137 (GH); Morces Gap,
27/02/1916, Killip, E.P. 288 (GH, US); Upper slopes of Mount Diabolo, 2528/02/1920, Maxon, W.R. 539 (US); Below New Haven Gap, 10/03/1920, Maxon,
W.R. 943 (BM, F, GH, NY, US); Vicinity of St. Helens Gap, St. Andrew, 12/03/1920,
Maxon, W.R. 980 (GH, P, US); Blue Mts, s.d., Morris J.P. 234 (K, NY); Morce's Gap,
12/07/1903, Nichols, G.E. 18 (NY); Portland Sap, 27/04/1928, Orcutt, C.R. 5269
(US); St. Andrew, Mt. Horeb, Fairy Glades, 01/02/1977, Podzorski, A.C. JA 08 (K);
Portland, John Crow Mts., McRoberts Patent, Hog House Hill, 17/03/1977,
Podzorski, A.C. JA 113 (K); St. Andrew, along ridge between Morces Gap and John
Crow Peak, Blue Mts., 24/11/1954, Proctor, G.R. 9515 (NY); St. Ann, Holly Mt. Hill,
25/01/1967, Read, R.W. 1770 (US); St. Ann, Mt. Diablo, s.d., Read, R.W. 1995 (US);
Jamaika, Parish of Portland, 26/01/1961, Renz, O. 9870 (BBG); (Blue Mount.), s.d.,
Swartz, O. s.n., lectotype, Cranichis stachyodes Sw. (BM53891); Morce's Gap,
02/02/1903, Underwood, L.M. 507 (NY); St. Andrew, 23/11/1957, Yuncker, T.G.
17533 (F, NY). MARTINIQUE, Windward Islands, Martinique Island, Morne Bois la
Roche NE of Case-Pilote, 27/02/1993, Croat, T.B. 74377 (MO); s.l., 1879, Duss,
Pere = A. Duss 372 (F, GH, MO, NY59256, NY59260, US); s.l., 1870, Hahn, L. 1361
(BM, G, P, S); s.l., 1871, Hahn, L. 1369 (P). MEXICO, San Luis Potosí, "Espinazo del
Diablo", 27/01/1937, Dino, E. 5178 (GH); Puebla, East of Teziutlan, 31/05/1933,
Juan, G. 2429 (F, US); Vera Cruz, east of Rodriguez Clara, 25/11/1934, Juan, G.
4202 (BM, GH); Vera Cruz, Volcano San Martins, 24/12/1936, Juan, G. 5778 (GH);
Vera Cruz, Volcano San Martins, 24/12/1936, Juan, G. 5796 (F, GH); "Esquipula,
250
Cero de Laguna mapastepes, clus", 01/1938, Matuda, E. 2035 (GH48865, GH58825,
K, NY); Motzorongo Cordova, 15-25/02/1891, Maury, P. 5576 (GH); Veracruz, near
Cordoba, 28/11/1931, Nagel, O. 2594 (GH); Veracruz, San Andis Tuxtla, volcan San
Martin, 23/03/1967, Sousa, M.P. 67 (GH); Chiapas, Ocosingo, near Laguna Ocotal
Grande, ca. 25-30 km Southeast of Monte (Cerro) Líbano (wich is ca. 45 km E of
Ocosingo), 12/08/1954, Dressler, R.L. 1656 (GH); Chiapas, Pueblo Nuevo
Solistahuacán, N of Clinica Yerba Buena near Pueblo Nuevo Solistahuacán,
25/01/1965, Raven, P.H. 19994 (GH); Chipas, Ocosingo, en estacion Chajul,
14/12/1992, Martínez, E. 25877 (MO); Oaxaca, along Highway 175 through Sierra
Juarez between Tuxtepec and Oaxaca, 18.4 miles S of bridge at Valle Nacional at ca
km 140, 19/02/1979, Croat, T.B. 48065 (MO); Oaxaca, Juquila Mixes, 15/12/1969,
Miller, W.S. s.n. (SEL10767); Oaxaca, San Miguel Chimalapa, Cerro El Reten, ca. 34
km en linea recta al N de San Pedro Tapanatepec, 24/10/1986, Maya, S. 4111 (MO);
Oaxaca, Sta. Maria Chimalapa, Region del Rio Verde en area de explotacion
florestal, 29/01/1986, Hernández, H. 2036 (MO); Oaxaca, Sta. Maria Chimalapa,
Arroyo Sardina, parte superior, 7-7.5 kmal S de Sta. Maria, 08/02/1986, Hernández,
H. 2057 (MO); Oaxaca, Sta. Maria Chimalapa, El Horno, al N del camino a El Horno
en canada ca. 1 km al NE de Sta. Maria Chimalapa, 31/01/1985, Hernández, H. 811
(MO); Veracruz, Dos Rios, 14/03/1930, Mell, C.D. 613 (NY); Veracruz, Alpatlahua,
Puente San Bernardo, 7 km NW of Coscomatepec on road to Escola, 12/01/1981,
Nee, M. 19820 (F); Veracruz, Catemaco, Cerro al E de Coyame, lado NE de Lago
Catemaco, 13/12/1971, Beaman, J.H. 5295 (F); Veracruz, San Andres Tuxtla, Ejido
Emiliano Zapata, terceira del Ejido Ruiz Cortinez hacia el Diamante, 27/07/2005,
Kromer, T. 2377 (SEL); Veracruz, Soteapan, Volcan de Santa Martha, 20/12/1978,
Ortiz, R.O. 1079 (F). NICARAGUA, Departamento de Zelaya, Mt. Liveca, Madregara,
Rain forest near Siuna, 06/01/1970, Atwood, J.T. 3045 (MO); Bocaycito, 28/12/1973,
Atwood, J.T. 6914 (MO); Departamento de Chontales, Cerro Oluma, remnant wet
premontane forest near top of Cordillera Amerisque, 03/01/1984, Gentry, A. 43903
(MO, SEL); s.l., s.d., Heller, A.H. 3019 (SEL); s.l., s.d., Heller, A.H. 3972 (SEL); s.l.,
s.d., Heller, A.H. 8903 (SEL); s.l., s.d., Heller, A.H. 9101 (SEL); Departamento de
Zelaya, Bluefields, Cerro El Panteón, 02/02/1982, Moreno, P.P. 14592 (MO);
Departamento de Chontales, 1,5 km al E de San Pedro Lóvago, 06/04/1982,
Moreno, P.P. 16051 (MO, SEL); Departamento de Zelaya, La Posolera, 5 km al W de
251
Waslala, carretera El Tuma a Waslala, 22/12/1982, Moreno, P.P. 19144 (MO);
Departamento de Madriz, Cerro Volcán de Somoto, 03/02/1983, Moreno, P.P. 20061
(MO); Departamento de Zelaya, Río Labú, 15 km W de Wani, carretera a Waaslala,
28/02/1983, Moreno, P.P. 20920 (MO); Departamento de Jinotega, km 146-147, a 3
km de la estrada a Aranjuez, 08/12/1980, Moreno, P.P. 4993 (MO); Departamento de
Zelaya, ca. 13 km above Kururia, on road to San Jeronimo, 02/03/1979, Pipoly, J.J.
3800 (MO); Departamento de Zelaya, Cerro La Pimienta, northern slope facing La
Garrapata, 16/03/1980, Pipoly, J.J. 6068 (MO); Departamento Bluefields, Base
Camp 3,6 km SE Cerro San Isidro, Rio Kama, Rio Escondido, 1.4 km N of base
camp, 05/03/1966, Proctor, G.R. 26955 (NY); Departamento de Jinotega, Macizos de
Peñas Blancas, along trail between finca of Socorro Mejia and Finca of Luis
Manzanares, 14/01/1979, Stevens, W.D. 11345 (MO); Departamento de Zelaya,
along new road from Rio Blanco to Rio Copalar, ca. 31 km E of Rio Blanco,
13/02/1979, Stevens, W.D. 12098 (MO, SEL); Departamento de Zelaya, along new
road from Rio Blanco to Rio Copalar, ca. 26 km E of Rio Blanco, 14/02/1979,
Stevens, W.D. 12228 (MO, SEL); Departamento de Jinotega, Salto Kayaska, Rio
Bocay, 07/03/1980, Stevens, W.D. 16463 (MO); Departamento de Zelaya, Bonanza,
ca. 1 km NE of Plantel, 14/01/1981, Stevens, W.D. 18922 (MO); Departamento de
Chontales, Cerro Oluma, 28/01/1985, Stevens, W.D. 23542 (MO); Chontales,
01/06/1868, Tate, R. 242 (K); Castillo, Río San Juan, Reserva Indio-Maiz, a 8 km de
la cabecera del Rio Bartola, en dereccion hacia el Cerro el Diablo, 03/01/1997,
Rueda, R. 5278 (MO); Castillo, Río San Juan, Reserva Indio-Maiz, a lo largo del
Caño Chontaleño, 19/02/1997, Rueda, R. 6063 (MO); Chontales, Cerro Pistacho,
s.d., Heller, A.H. 6901 (SEL3716, SEL803713); Granada, Volcán Mombacho,
15/02/1977, Atwood, J.T. 77155 (SEL); Jinotega, Bocay, Reserva Natural Kilambe,
Comunidade San Miguel de Kilambé, 06/01/2001, Rueda, R. 15297 (MO);
Matagalpa, road to La Fundadora, north of Sta. Maria de Ostuma, Cordilheira Central
de Nicaragua, 02/1963, Williams, L.O. 24971 (F); Zelaya, ca. 6.3 km S of bridge at
Colonia Yolaina and ca. 0.8 km S of ridge of Serranías de Yolaina on road to Colonia
Manantiales, 13/02/1978, Stevens, W.D. 6408 (MO); Zelaya, Along trail from Cerro El
Inocente toward Cerro Saslaya, reaching saddle between the peaks and at this point
near the source of Caño Majagua, 08/03/1978, Stevens, W.D. 6711 (MO); Zelaya,
Bonanza, Reserva Bosawas, entre la desenbocadura del cano Sulum y la base del
252
cerro la Francia, 19/01/1996, Rueda, R. 3943 (MO). PANAMA, Provincia de Coclé,
Vicinity of El Valle, 08/12/1938, Allen, P.H. 1183 (GH, MO); Provincia de Coclé,
Vicinity of El Valle de Anton, 10/12/1939, Allen, P.H. 2064 (GH); Hills N of El Valle de
Anton, Prov. Coclé, Vicinity of La Mesa, 21/01/1941, Allen, P.H. 2326 (GH); s.l., s.d.,
Braga, P.S.I. 2591 (RB); Provincia de Coclé, El Cope sawmill cold forest on peak to
right of road just before (S of) sawmill, 28/07/1978, Hammel, B. 4149 (MO); Canal
Zone, Summit Garden, 20/12/1970, Croat, T.B. 12856 (MO); Chiriqui, Fortuna Dam
area, N of reservoir, between Quebrada Bonito and Quebrada Franh, to E of road,
01/08/1984, Churchill, H.W. 5888 (MO); Chiriqui, S slope of Cerro Pate Macho along
Rio Palo Alto, 11/11/1981, Knapp, S. 2058 (MO); Chiriqui, on Cerro Hornito,
15/12/1976, Luer, C.A. 1323 (SEL); Chiriqui, 25 km W of El Hato del Volcan, forest
on farm of Mr. R.Hartman, 19/10/1980, Maas, P.J.M. 4908 (SEL); Chiriqui, ca 5 km E
of Fortuna Dam, along trail crossing Rio Hornito, 26/04/1988, Thompson, S.A. 4998
(CM); Chiriqui, Bugaba, Cerro Punta, 26/01/1985, Werff, H. van der 6425 (MO);
Chiriqui, Fortuna, Dam, along trail across Rio Hornito, 04/12/1987, McPherson, G.
11779 (MO); Cocle, Purchased at the Sunday Market, El Vale, 04/12/1983, Luer, C.
9239 (SEL); Cocle, Cerro Gaital above El Valle, Ridge trail to summit, 24/07/1983,
Miller, J.S. 810 (MO); Cocle, Above El Potroso sawmill at Continental Divide,
24/10/1980, Sytsma, K.J. 1829 (MO); Darien, Parque Nacional de Darien, Cerro Mali,
head waters of S branch of Rio Pucuro, ca. 22 km E of Pucuro, 20/10/1987, Nevers,
G. 8491 (MO); Panama, Altos de Campana, unos 110 metros del Motel Sulin,
17/12/1977, Méndez, R. 148 (MO); Panama, Parque Nacional Cerro Campana, 2 km
N of Hwy 707, 01/01/1983, Stein, B.A. 1153 (MO, SEL); Panama, Capira, Cerro
Campana, 15/12/1994, Galdames, C. 1821 (COL); Panama, Capira, Cerro
Campana, 21/01/1985, Werff, H. van der 6208 (MO, SEL). PARAGUAY, Paraguai,
Parque Nacional Ybycu'i, Road to Cesar Barrientos, 15/09/1988, Zardini, E. 7207
(MO). PERU, Dept. Cajamarca, Prov. Hualgayoc, Hacienda Taulis, 10/1964,
Bismark, K. von s.n. (GH104438); Amazonas, Quebrada kayamas lugar Cenepa,
Monte al lado kayamas, 06/04/1973, Ancuash, E. 165 (MO); Amazonas, trail E of
Huampami to Shaim, 01/08/1974, Berlin, B. 1952 (MO); Amazonas, Bagua Province,
Distrito Imaza, Comunidad Aguaruna de Putuim (Campou) (anexo Yamayakat),
Monte Alto de Putuim, 25/08/1994, Díaz, C. 7012 (MO); Amazonas, Condorcanqui
Province, Rio Cenepa, vicinity of Huampami, ca. 5 km east of Chavez Valdivia, al
253
lado de Chigkan entsa, Quebrada Aintami, 17/08/1978, Kujikat, A. 435 (MO); La
Merced, Hacienda Schunke, 27-01/08-9/1923, Macbride, J.F. 5640 (F); Yambras
(Bamba), s.d., Mathews 1875, holotype, Prescottia petiolaris Lindl. (photo GH, K, line
drawing K-L, photo MO); Cusco, Urubamba, Machu Picchu, on a hillside above the
Rio Mandor, 3 km from km 114 of the Urubamba railroad, plot #196, 21/09/1982,
Peyton, B. 1296 (MO, SEL); Dept. Junin, Chanchamayo Valley, 08/1930, Schwacke
1120 (F); Departamento Cuzco, Provincia Umbamba, on trail Puyupata to
Sayacmaca, 05/08/1942, Vargas, C. 2892 (GH); Loreto, Maynas Province, Iquitos,
Allpahuayo, Estacion Experimental del Instituto de Investigaciones de la Amazonia
Peruana (IIAP) 10/10/1990, Vásquez, R. 14460 (MO); Pasco, Oxapampa, Pachis
Valley, San Matias Ridge, 10-12 km SW of Puerto Bermudez, above Santa Rosa de
Chivis, trail to Loma Linda, 29/09/1982, Foster, R.B. 8968 (MO). PUERTO RICO,
Patillas, Carite Forest Reserve, Rt 184, km 18.9, along trail S from road, 08/03/1993,
Axelrod, F. 5875 (US); Alto de la Bandera, near Adjuntas, 14/03/1913, Britton, N.L.
2131 (NY); Monte Alegrillo, 03/04/1913, Britton, N.L. 2606 (NY); Luquillo National
Forest, Odum's El Verde Plot, 23/03/1964, Duke, J.A. 7321 (MO); N. ride Luquillo
Mts., 13/04/1899, Heller, A.A. 1097 (F, NY); El Verde, Luquillo Mts., 18/04/1964,
Liogier, B.A.H. 10856 (NY); Maricao Forest, 05/03/1983, Ricart, J.L.R. 7528 (SEL);
Prope Adjunctas in syl. prim. ad La Lucia in Norte Cierrega, 25/04/1886, Sintenis, P.
4260 (K); Prope Penuelas, 19/05/1886, Sintenis, P. 4389 (BM, GH); montis Cerrate,
27/05/1886, Sintenis, P. 4438 (US); Adjuntas, Cordillera Central, Barrio Saltillo.
Mountain slopes c. 1.4-2 km due SSW of Alto de la Bandera, 31/01/1987, Proctor,
G.R. 42977 (US). ST. VINCENTS, 03/1890, Smith, H.H. 949 (NY). SURINAM,
Inselberg Talouakem - Massif des Tumuc-Humac, 08/08/1993, Granville, J.J. 12141
(US). TRINIDAD, West Indies, Blanchissene Road near 10 1/2 mile post near a
Ridge, 01/05/1925, Broadway, W.E. 5668 (K). VENEZUELA, Territorio Federal
Amazonas, Departamento Río Negro, Cerro Aracamuni, summit, Proa Camp.,
25/10/1987, Liesner, R. 22460, holotype, Prescottia tepuyensis Carnevali & C.A.
Vargas (VEM, isotype MO); Venezuela-Brasil fronteira, Plantas of Cerro de la
Neblina, Headwaters of Canon Grande, southeastern portion, 16-7/10/1970,
Steyermark, J.A 103947 (NY); Anzoátegui, forested slopes of Montana de las
Palomas, tributary of Rio Neveri, between "Carmelita" and "Natalia", northeast of
Bergantin, 09/03/1945, Steyermark, J.A 61451 (F); Aragua, Henri Pittier National
254
Park. Pico Guacamaya, ridge extending E from peak, 15/02/1990, Edwards, K.S. 224
(K); Aragua, Henri Pittier National Park, Pico Guacamaya, N facing slope of peak,
24/01/1990, Edwards, K.S. 51 (K); Aragua, Henri Pittier National Park, Pico
Guacamaya, N facing slope of peak, 24/01/1990, Edwards, K.S. 51 (K); Aragua,
07/11/1949, Renz, O. 6080 (BBG); Aragua, Parque Nacional Henry Pittier, cloud
forest on summit of knife-edge ridge above Rancho Grande Biological Station,
towards Pico Guacamayo, 20/10/1961, Steyermark, J.A. 89766 (GH); Aragua*,
Poper coloniam Tovar, 07/1856, Fendler, A. 1401 (K, K-L); Barinas, 19/09/1951,
Renz, O. 7387 (BBG); Bolívar, Southwest slope forest and savannas, ptari-tepui,
17/12/1952, Maguire, B. 33878 (NY); Bolívar, summit of Mount Roraima, on southern
half of the summit between Summit Camp, Great Central Rift, Central Swamp,
28/09/1944, Steyermark, J.A. 58903 (F); Distr. Federal = Dist. Capital Mitte, 11/1956,
Renz, O. 8785 (BBG); Distrito Federal, Topo infiernito em selva nublada, Parque
Nacional "El Avila", 01/1993, Meier, W. 3320 (M); Lara, 20/10/1952, Renz, O. 7850
(BBG); Lara, 29/10/1952, Renz, O. 7869 (BBG); Merida, Sierra del Norte, 0608/11/1952, Humbert, H. 26699 (P); Mérida, 27/03/1949, Renz, O. 5186 (BBG);
Mérida, 26/03/1949, Renz, O. 5222 (BBG5222.1, BBG5222.2, BBG5222.3); Mérida,
04/03/1949, Renz, O. 5294 (BBG); Mérida, 29/07/1949, Renz, O. 5784 (BBG5784.1,
BBG5784.2); Mérida, 19/11/1949, Renz, O. 6149 (BBG); Mérida, 20/11/1949, Renz,
O. 6165 (BBG); Mérida, 19/07/1951, Renz, O. 7261 (BBG); Mérida, 07/09/1951,
Renz, O. 7348 (BBG); Mérida, 18/11/1951, Renz, O. 7550 (BBG); Mérida, Woods
above Las Cuadras, along Quebrada Molino, north of Torondoy, 27/03/1944,
Steyermark, J.A. 55815 (F, GH); Mérida, Woods above Las Cuadras, along
Quebrada Molino, north of Torondoy, 27/03/1944, Steyermark, J.A. 55815 (F, GH);
Miranda, Cerro del Bachiller, near east end, virgin evergreen forest, between base
and summit, above Quebrada Corozal, south of Santa Cruz, 10 km (by air) west of
Cupira, 20-26/03/1979, Steyermark, J.A. 116524 (MO, NY); Monagas, Montana de
Aguacate, along Quebrada de Pajarral, tributary to Rio Caripe and Caripito,
19/04/1945, Steyermark, J.A. 62227 (F, GH); Tachira, 16/05/1951, Renz, O. 7032
(BBG); Tachira Anfang, 01/1954, Renz, O. 8121 (BBG); Tachira, 28/11/1953, Renz,
O. 8131 (BBG); Tachira, 28/11/1953, Renz, O. 8132 (BBG8132.1, BBG8132.2);
Trujillo, 25/09/1947, Renz, O. 4321 (BBG4321.1, BBG4321.2); Trujillo Ende,
09/1947, Renz, O. 4369 (BBG); Trujillo, 08/05/1948, Renz, O. 4703 (BBG4703.1,
255
BBG4703.2); Trujillo, 12/05/1948, Renz, O. 4705 (BBG4705.1, BBG4705.2); Trujillo
Mitte, 02/1949, Renz, O. 5295 (BBG5295.1, BBG5295.2, BBG5295.3, BBG5295.4);
Trujillo, 26/02/1949, Renz, O. 5296 (BBG); Trujillo Mitte, 06/1949, Renz, O. 5567
(BBG). VIRGIN ISLANDS (U.S.), St. John, Bordeaux Mountain near Bordeaux Peak,
09/02/1988, Acevedo-Rodríguez, P. 2604 (NY); St. John, Coral Bay Quarter, gut
from Bordeaux to Reef Bay, 22/02/1993, Acevedo-Rodríguez, P. 5278 (NY, US); St.
John, 10-2/02/1913, Britton, N.L. 559 (NY).
HABITAT. Terrestrial in thick leaf litter in shade of broadleaf forests of moist and wet,
lowland to montane regions. Elevation from sea level to 3.600 m.
ETYMOLOGY. From the Greek stachy (relating to a spike) and odes (resembling) in
reference to the shape of the inflorescence (McLeish et al. 1995).
NOTES. Prescottia stachyodes is a widespread species, very variable in shape and
size. It has lanceolate to elliptic leaves, clearly petiolate, with green flowers and lip
internally glabrous. The leaves are whole green or with the center whitish, with or
without white margin, entire to lightly serrated. The leaves of Prescottia stachyodes
are very variable in its format and dimensions, apparently related to the places where
the plants grow. Plants that grow on rocks differ a lot from those that inhabit the soil.
This variation was probably the reason for the large number of synonyms for this
species.
As currently circumscribed it encloses a large range of variation in size, color,
and shape. The delimitation here proposed to Prescottia stachyodes is a broadened
circumscription, and includes some morphs. We could not find any geographic or
ecologic pattern and significant variations were not found. There is a continuous
morphological variation, even in specimens of the same collection and population.
The seed morphology of this taxon is very characteristic and distinct from all other
species of the genus (with fusiform intercellular spaces with beaded appearance). All
the different morphs studied, coming from different regions, have the same kind of
seed. We suggest that a population study should be carried out to clarify the species
within this complex.
These plants appear to be self-pollinating, since virtually all flowers set fruit.
Singer & Sazima (2001) verified that P. stachyodes is self-compatible but pollinatordependent. However, germinated pollen was observed in the anther cavity, near the
256
clinandrium, as reported for Epipactis microphylla (Ehrh.) Sw. (Bonatti et al. 2006).
The clinandrium, somehow turn back and the pollen come into contact to the
stigmatic surface. This is an efficient way to ensure seed set, independently of the
presence of pollinators. These conditions would explain somewhat distinct variants
growing sympatrically.
As Cranichis oligantha, C. stachyodes was described without type information.
Fawcett & Rendle (1910), Garay & Sweet (1979), Garay (1978) and McLeish et al.
(1995) cited that it is at BM, although, Serna & Ferrari (1998) cited that it is at S and
Nir (2000) cited that it is at S and BM. To avoid more confusion Azevedo & van den
Berg (2007a), selected the BM specimen as the lectotype of C. stachyodes, as this is
the only specimen that can be undoubtedly attributed to Swartz and to the type
location.
Prescottia colorans was described as a Prescottia of one leaf and with
purplish scape, probably the reason of the name. The holotype of Prescottia colorans
is annotated in Lindley’s handwriting with the information “Brasil Loddiges”, in
agreement with the information given in the protologue. This herbarium sheet has
two collections, one being the type, a single inflorescence, without leaves and an
illustration, and the other “Wright 626, in Cuba Orientali”, which is not part of the type.
It was collected in July 1856, in other words, after P. colorans publication (Lindley
1836), but it was also determined and cited by Lindley (1858) as a P. colorans, what
evidences that Lindley’s circumscription of P. colorans included big specimens not
only from Brazil, but also from Cuba.
When Lindley described Prescottia petiolaris (Lindley 1836), he did not say
where the type come from. Latter, Lindley (1840a) cited it as: Hab. in Peruvia,
Mathews, 1875 (exam. s. sp. in hb. Hooker). The specimen at K is stamped
“Herbarium Hookerianum 1867” (1867 being the year that Kew bought Hooker’s
herbarium) it implies that it is the holotype of Prescottia petiolaris. There is also a
herbarium sheet at Lindley’s herbarium that is a line drawing of the type made by
himself at Hooker’s herbarium.
The type of Prescottia pellucida is characterized by specimens with large
flowers (lip 4.5-5.0 mm long) and short petioles (1.5-3.0 cm long). In Flowering Plants
of Jamaica, Adams (1972) recognized Prescottia pellucida as a good species (as
well as Ackerman 1989; 1995) but expressed some doubts and suggested that it may
257
simply be an ecological variant of P. stachyodes. Prescottia pellucida was regarded
as synonym of P. stachyodes based on morphometric data taken from herbarium
specimens collected throughout the Greater Antilles (Ackerman 2000). Nir (2000)
recognized Prescottia pellucida as a good species, and cited: Cuba, Loma del Gato,
Wright 626 (K – L) as its type, but without seen the specimen. However, this number
was cited by Lindley (1858) at the same time he published Prescottia pellucida,
exactly the line before it, as Prescottia colorans. This specimen (Wright 626) is quite
different of P. pellucida’s type.
At the protologue of Prescottia pellucida, where Lindley (1858) presented a list
of orchidaceous plants collected in the east of Cuba by Mr. C. Wright, he explicitly
says: Loma del Gato (no number). Ackerman (1989, 2000) cited: Cuba, Loma del
Gato, Wright s.n. (holotype K-L!, photograph of specimen at UPRRP!) as the type of
the species. The problem is that the material at K-L has three collections in the same
sheet. One was collected in Monte Verde and has a number (1473), and was
collected after the description, in 1859, what excludes it as a possible type material.
The other has no year, and has handwritten: “Prescottia pellucida?”, but it has only
one leaf, instead of two leaves as described at the protologue. The other one (the left
one) has two leaves, no number, and was collected in 1856-7 in “Cuba Orientali”. It
has Lindley’s line drawing under it, and we are here selecting it as the lectotype of P.
pellucida.
When Schlechter described Prescottia smithii he did not cite where the type
was deposited. Four specimens of Smith 2277 were found at CM, GH, K, and NY.
The original material of P. smithii was probably at B, but it could not be found and
was probably destroyed during World War II. The original materials of Smith were
distributed by NY, and for this reason it was selected as the lectotype of P. smithii
(Azevedo & van den Berg 2007a).
When Schlechter (1921) described Prescottia longipetiolata the author
characterized the new species as similar to P. stachyodes, but with smaller flowers in
a dense inflorescence, remarking that the type has only a notably long petiolate leaf,
which was also emphasized by Lindley (1836) as a characteristic of P. colorans. As
Barbosa-Rodrigues had already used the epithet longipetiolata before in 1877,
Hoehne (1945) choose Prescottia schlechteri as a nomen novum to Prescottia
longipetiolata Schltr. Prescottia longipetiolata was considered as synonym of
258
Prescottia cordifolia Rchb. f. by Hoehne (1945), Garay (1978), Hamer (1984),
Govaerts (2004), and here we consider it as a synonym of P. stachyodes.
Schlechter’s original materials were at B, and were mostly destroyed during
World War II. As Azevedo & van den Berg (2007a) could not find any isotype of
Prescottia longifolia they selected a lectotype for it. The same situation happened
with Prescottia longipetiolata, therefore we choose to lectotypify this name under the
line illustration printed in Mansfeld (1929) Figuren Atlas zu den Orchideenfloren der
sudamerikanischen Kordillerenstaaten von R. Schlechter t. 291.
When Carnevali & Vargas (1996) described Prescottia tepuyensis, they said
that this taxon is very closely related to P. stachyodes, but the plants and flowers are
consistently smaller, and the floral bracts are proportionally shorter. However in size
it is very similar to the type of P. stachyodes. Carnevali & Vargas (1996) stated that
small specimens of P. stachyodes have leaves of at least 10 cm long but are usually
longer than 15 cm, and in P. tepuyensis the leaves do not exceed 8 cm long (differing
from the information given at the description: 8 - 11 cm long). The type of P.
stachyodes has leaves 7 - 9 cm long. Prescottia stachyodes is extremely variable in
shape and size and the type of P. tepuyensis easily falls within our circumscription of
P. stachyodes.
259
5 mm
C
B
E
5 mm
5 mm
D
1 mm
G
1 cm
F
A
Figure 28. Prescottia stachyodes. A. Habit. B-C. Flower. B. Front view. C. Lateral
view. D. Floral bract. E. Perianth parts, clockwise from top: lip, dorsal sepal, petal,
lateral sepal. F-G. Column F. Dorsal view. G. Ventral view. (Azevedo 318).
260
Map 9. Geographical distribution map of Prescottia stachyodes.
261
Doubtful Names
1. Prescottia auyantepuiensis Carnevali & G.A. Romero, Orchids Venezuela, ed. 2:
1145. 2000. Protologue: “Venezuela: Bolivar, Auyantepui, 2000--2100 m, G.C.K.
Dunsterville 866 (holotype: AMES drawing)”.
Prescottia auyantepuiensis was described as similar to Prescottia tubulosa
differing of it by its linear leaves(Carnevali & Romero, 2000). Its etymology is in
reference to the type locality, Auyantepui, a table-top mountain in southern
Venezuela (Carnevali & Romero, 2000). However as the holotype of Prescottia
auyantepuiensis is a drawing, we are here considering it as a doubtful name, once
we could not confirm the real circumscription of the species.
2. Prescottia corcovadensis Rchb. f., Linnaea 22: 814. 1849. Protologue: “Zwischen
Gestrauch der inneren Berge des Corcovado Brasiliens. Octob. 1822. Beyrich.”
Type: Brazil: Rio de Janeiro, Corcovado, Beyrich s.n. (not in W).
Cogniaux (1895) and Schlechter (1926) recognized it as a good species. Brade
& Pabst (1952) cited it as synonym of Prescottia plantaginifolia. Wiggins & Porter
(1971) cited it as synonym of Prescottia oligantha. Since we could not locate any
type material, we are here placing this taxon as a doubtful name.
3. Prescottia cordifolia Rchb. f., Bonplandia 3: 66. 1855. Protologue: “Aspasica.”
without collector and date. Type: Colombia: Norte de Santander, Aspasica,
Wagener s.n. (not in W).
Prescottia cordifolia was described from a material from Colombia, but its type
was not found. The protologue says mainly that the species is similar to Prescottia
colorans, and present leaf 15 cm long, with cordate base.
Garay (1978), Hamer (1984), Jørgensen & León-Yánez (1999) and Stevens et
al. (2001) recognized it as a good species. Dod (1986) also recognized Prescottia
cordifolia as a good species, but stated that its flower shows few differences from
262
those of P. stachyodes. Hamer (1984) observed that Prescottia cordifolia is a much
larger plant with larger flowers than P. stachyodes, according to the author, a close
ally, that may be distinguished by the larger, cordate leaf, generally only one leaf and
by the green and not purplish flowers. We believe that it may be larger than the P.
stachyodes type, but is very similar to P. colorans type which has also only one large
leaf. Ackerman (in press.) stated that P. cordifolia may not be distinguished from P.
stachyodes. We recognize that it must be related to our circumscription of P.
stachyodes, but because we could not found the type, and there is no illustration, we
are here considering it as a doubtful name, once it is not possible to confirm this
information and the real circumscription of the species.
4. Prescottia polyphylla Porsch., Oesterr. Bot. Z. 55: 153. 1905. Protologue: “in
Waldern bei Barra Mansa im Gebiet der Stadt Itapecirica 100 m.s.m. VI.1901
(leg. Wettstein et Schiffner)” without collector number.
The type material of Prescottia polyphylla Porsch was not found, and there is no
type illustation. Additionaly, the original description is not very informative, a couple
of species could fit in its description. The protologue does not have a good
description or any measurement. The only known figure of P. polyphylla is a line
drawing of a flower (front and side view) in Wettstein (1908), together with a
description of the species, which did not clarify its circumscription. This species was
accepted by Hoehne (1945), who considereded it near to Prescottia lancifolia, P.
microrhiza, P. epiphyta and P. octopollinica. Hoehne (1945) commented that he was
reluctant to distinguish Prescottia polyphylla from P. lancifolia, justifying that it would
be the transition of the latter and P. microrhiza. However, those four species present
the inner surface of the lip pilose, and one of the few informative character on
Porsch’s (1905) description was that the lip was glabrous on both sides (utrimque
glaberrimo). Nevertheless, Hoehne (1945) considered that P. polyphylla has the
inner surface of the lip base pilose and the rest glabrous. As we can not really
confirm how P. polyphylla looks like, it is hard to recognize the real circumscription of
this species.
263
5. Prescottia polysphaera Schltr., Repert. Spec. Nov. Regni Veg. 16: 357. 1920.
Protologue: “Brasilien: Rio Grande do Sul - H. Wendt anno 1907.” without
collector number.
Schlechter’s original materials were at B, most of them were destroyed during
World War II. For some names it was impossible to locate syntypes, isotypes, or
drawings. Prescottia polysphaera was first cited as synonym of Prescottia densiflora
by Hoehne (1945) and Brade & Pabst (1952) and subsequently cited as synonym of
Prescottia oligantha by Dunsterville & Garay (1966), Wiggins & Porter (1971),
Sprunger (1991), Sprunger (1996), Govaerts (2004) and Rocha & Waechter (2006).
However, Schlechter said that its habit reminds the kind of P. epiphyta. From its
description we could see that it is a plant with intermediate size (12 – 22 cm high),
with petiolate leaves (petiole 1.5 – 4 cm long), and blade 4 – 9 cm long. As we could
not find any type material it is hard to confirm what is the real circunscription of this
taxon.
Nomen nudum
1. Prescottia gigantea Lodd. ex W. Baxter, J.C. Loudon, Suppl. Hort. Brit.: 618, 185.
1850. nom. nud.
Besides Cogniaux (1895) have cited it as synonym of Prescottia stachyodes, it
is impossible to know anything about this name, no specimen, collector, collector
number, nor location were cited. It is only a name on a catalogue, without description
or diagnosis.
2. Prescottia lanceaefolia Link & Otto ex Steud., Nom. ed. 2. 2: 393. 1841. nom.
nud.
Hoehne (1945) have cited this species as synonym of Prescottia lancifolia, but
it was also published without a description or diagnosis.
264
3. Prescottia serrana M.N. Correa, Parodiana 7 (1-2): 6, fig. 2. 1992. Protologue:
“Exsiccatum. Jujuy. Depto. Capital, mina 9 de Octubre, sierra de Zapla, subida al co.
Zapla, 13-4-1974, A.L. Cabrera et R. Kiesling 24954 (LP)”. nom. nud.
When Correa (1992) described Prescottia serrana he provided a Latin and a
Spanish description, an illustration, and cited the material: A.L. Cabrera et R. Kiesling
24954 (LP). The author did not mention the words "typus" or "holotypus", or its
equivalent in a modern language, what makes the publication invalid following the
Article 37.6. of the International Code of Botanical Nomenclature (McNeill et al.
2006). Furthermore, a careful examination of the original publication (Correa 1992)
reveals that Correa (1992) was not sure about the new species. Correa (1992) said:
“Prescottia serrana, a juzgar por la descripción y la ilustración de Hoehne (1945),
sería afín a P. montana, especie de Minas Gerais (Brasil) pero hasta el momento no
he logrado ver suficiente material”. After seeing the “type” of P. serrana we confirmed
that it is really a specimen of P. montana.
Excluded Taxa
1. Prescottia barbifrons Kraenzl., Bot. Jahrb. Syst. 54 (117): 19. 1916. Type: Peru:
Piura: E of Huancabamba, Weberbauer s.n. (not in B).
= Pterichis barbifrons (Kraenzl.) Schltr., Repert. Spec. Nov. Regni Veg. Beih. 9:
127. 1921.
2. Prescottia crassicaulis F. Lehm. & Kraenzl., Bot. Jahrb. Syst. 26: 501. 1899. Type:
Ecuador: Chimborazo (Lectotype designated by de Vogel in Blumea 17 (2): 313-350,
1969.), F. Lehmann 8164 (isótipo AMES).
= Altensteinia virescens Lindl., Ann. Mag. Nat. Hist. 15: 385. 1845.
3. Prescottia lindeniana A. Rich. & Galeotti, Ann. Sci. Nat., Bot., 3 3: 31. 1845.
Protologue: without collector or date. Type: México: Cidade Real, Linden 1222 (W!
(selected by Salazar 2009).
= Galeoglossum tubulosum (Lindl.) Salazar & Soto Arenas, Proc. Second Sci.
Conf. Andean Orchids: 169. 2009.
265
4. Prescottia ophioglossoides Spreng., Syst. Veg. 3: 706. 1826. Amer. Bor. (Malaxis *
Microstylis ophioglossoides Nutt. Orchis f. Monorchis pumila floridana Plukn. T. 434.
f.4).
= Malaxis unifolia Michx., Fl. Bor. Amer. 2: 157. 1803.
5. Prescottia orchioides Lindl., Ann. Mag. Nat. Hist. 15: 386. 1845. Type: Mexico:
Hartweg s.n. (holótipo K-L!).
= Galeottiella orchioides (Lindl.) R. González ex Rutk., Mytnik & Szlach. Ann. Bot.
Fenn. 41(6): 477. 2004.
6. Prescottia pachyrhiza A. Rich. & Galeotti, Ann. Sci. Nat., Bot. 3, 3: 31. 1845.
Protologue: without collector or date. Type: México: Galeotti 5180 (lectotipo W!);
Galeotti 5189 (lectotype W! (selected by Salazar 2009).
According to Ruthowski et al. (2004), a careful examination of the type
specimen of Prescottia orchioides showed that the species must be transfered to
Galeottiella.
7. Prescottia pteristyloides Kraenzl., Bot. Jahrb. Syst. 37: 393. 1906. Type: Peru:
Cajatambos, Ancachs, Weberbauer 2869 (AMES photo of type).
= Altensteinia marginata Rchb. f., Xenia Orchid. 3: 20. 1878.
8. Prescottia tubulosa (Lindl.) L.O. Williams, Bot. Mus. Leafl. 7: 137. 1939. ≡
Cranichis tubulosa Lindl., Gen. sp. orchid. pl. 451. 1840. Protologue: “Hab. in Mexico,
Karwinski (hab. s. sp. comm. cel. Bateman).” without collector number or date. Type:
Mexico, Karwinski s.n. (holotype K-L!).
266
Molecular studies place Pseudocranichis thysanochila as sister to Prescottia
tubulosa, making Prescottia paraphyletic (Figueroa et al. 2008, Álvarez-Molina &
Cameron 2009, Salazar et al. 2009). To accomplish monophyly to Prescottia, Salazar
(2009) transferred Prescottia tubulosa and Pseudocranichis thysanochila to
Galeoglossum A. Rich. & Galeotti.
267
Literature Cited
Ackerman, J. D. (1989). Prescottia and Cranichis of Puerto Rico and the Virgin
Islands. Lindleyana 4: 42 − 47.
Ackerman, J. D. (1995). An orchid flora of Puerto Rico and the Virgin Islands. Mem.
New York Bot. Gard. 73.
Ackerman J. D. (2000). Notes on the Caribbean Orchid Flora. II. Lindleyana 15: 89 −
95.
Ackerman, J. D. (2003). Prescottia. In: A. M. Pridgeon, P. J. Cribb, M. W. Chase & F.
N. Rasmussen (eds). Genera Orchidacearum. Volume 3, Orchidoideae (part 2):
Vanilloideae, pp. 47 − 50. Oxford University Press, Oxford.
Ackerman, J. D. (In press). Flora of the Greater Antilles: Orchidaceae. Mem. New
York Bot. Gard.
Adams, C. D. (1972). Flowering plants of Jamaica. University of the West Indies,
Mona.
Alvarez-Molina, A. & Cameron, K. M. (2009). Molecular phylogenetics of
Prescottiinae s.l. and their close allies (Orchidaceae, Cranichideae) inferred
from plastid and nuclear ribosomal DNA sequences. Am. J. Bot. 96: 1020 −
1040.
Atwood, J. T. (1986). The size of the Orchidaceae and the systematic distribution of
epiphytic orchids. Selbyana 9: 171 − 186.
Azevedo, C. O., Leoni, L. S. & Van den Berg, C. (submited a). Prescottia glazioviana
Cogn. (Orchidaceae): nova ocorrência para Minas Gerais, Brasil. Acta Botanica
Brasilica.
Azevedo, C. O.; Smidt, E. C. & Van den Berg, C. (submitted b). Prescottia
mucugensis: a new species of Prescottia (Orchidaceae: Cranichidinae) from
Bahia, Brazil. Kew Bull.
Azevedo, C. O. & Van den Berg, C. (2005). (1705-1706) Proposals to conserve the
name Prescottia with that spelling and P. plantaginea against P. plantaginifolia
(Orchidaceae). Taxon 54: 1105 − 1106.
Azevedo, C. O. & Van den Berg, C. (2007a). Lectotypifications in Prescottia
(Orchidaceae - Orchidoideae). Kew Bull. 62: 651 − 655.
268
Azevedo, C. O. & Van den Berg, C. (2007b). A Família Orchidaceae no Parque
Municipal de Mucugê, Bahia, Brasil. Hoehnea 34: 1 − 47.
Balick, M. J., Nee, M. H. & Atha, D. E. (2000). Checklist of the Vascular Plants of
Belize. New York Botanical Garden Press, New York.
Barbosa-Rodrigues, J. (1877). Genera et species Orchidearum novarum I. C. & H.
Barbosa-Rodrigues, J. (1881). Genera et species Orchidearum novarum II. C. & H.
Barros, F. 1987. Orchidaceae. In: A.M. Giulietti; N.L. Menezes; J.R. Pirani; M.
Meguro & M.G.L. Wanderley. Flora da Serra do Cipó, Minas Gerais:
caracterização e lista de espécies. Bol. Bot. Univ. São Paulo. 9: 1-151.
Barros, F. & Pinheiro, F. (2004). Flora de Grão-Mogol, Minas Gerais: Orchidaceae.
Bol. Bot. Univ. São Paulo. 22: 361 − 383.
Bennett Jr., D. E. & Christenson, E. A. (1998). Icon. Orchid. Peruviarum: Plates 401600. A. Pastorelli de Bennett, Lima.
Bentham, G. (1881). Notes on Orchideae. J. Linn. Soc., Bot. 18: 281 − 360.
Bonatti, P. M., Sgarbi, E. & Del Prete, C. (2006). Gynostemium micromorphology and
pollination in Epipactis microphylla (Orchidaceae). J. Plant Res. 119: 431 − 437.
Brade, A. C. (1956). A Flora do Parque Nacional do Itatiaia. Boletim do Parque
Nacional do Itatiaia 5: 1 − 85.
Brade, A. C. & Pabst, G. F. J. (1952). Index Generum et specierum Orchidacearum
Brasiliensium inter MCMXXXII et MCML descripta sunt. Orquídea 13-14: 1 − 52.
Britton, N. L. & Millspaugh, C. F. (1962). The Bahama flora. The New York Botanical
Garden, New York.
Brummitt, R. K. (2007). Report of the Committee for Vascular Plants. Taxon 56: 1289
− 1296.
Burns-Balogh P. (1987). Scanning electron micrographs of orchid pollen/pollinaria.
IDC Microform Publishers: Switzerland.
Cameron, K. M. & Chase, M. W. (1999). Phylogenetic relationships of Pogoniinae
(Vanilloideae, Orchidaceae): an herbaceous example of the eastern North
America-eastern Asia phytogeographic disjunction. J. Plant Res. 112: 317 −
329.
269
Carnevali, G. & Romero, G. A. (2000). Orchids of Venezuela: an illustrated field
guide / Orquideas de Venezuela: una guia de campo ilustrada. Armitano
Editores, Caracas.
Carnevali, G. & Vargas, C. A. (1996). A new Prescottia from Venezuelan Guayana.
Lindleyana 11: 236 − 238.
Carnevali, G., Tapia-Muñoz, J. L., Jiménez-Machorro, R., Sánchez-Saldaña, L.,
Ibarra-González, L., Ramírez, I. M. & Gómez, M. P. (2001). Notes on the flora
of the Yucatan Peninsula II: a synopsis of the orchid flora of the Mexican
Yucatan Peninsula and a tentative checklist of the Orchidaceae of the Yucatan
Peninsula biotic province. Harvard Pap. Bot. 5: 383 − 466.
Christenson, E. (1995). Pittier’s Panama collections at US. Orchid Res. Newslett. 25:
7 − 8.
Cogniaux, A. (1895). Orchidaceae: Prescottia. In: C. F. P. Martius; A. G. Eichler; I.
Urban (eds) Fl. Bras. (Martius). vol. 3(4). pp. 256-270. Frid. Fleischer, Lipsiae.
Cogniaux, A. (1907). Orchidées du Brésil et des régions voisins. Bull. Soc. Bot. Belg.
43: 266 − 350.
Cogniaux, A. (1909). Orchidaceae. In: I. Urban (ed) Symb. Antill. (Urban). pp. 293432. Fratres Borntraeger, Lipsiae.
Correa, M. N. (1992). Notas orquidológicas V. Novedades en los géneros Prescottia
y Pterichis. Parodiana 7: 3 − 13.
Correll, D. S. (1965). Supplement to Orchids of Guatemala, and British Honduras.
Fieldiana, Bot. 31: 177 − 221.
Cremers, G. & Hoff, M. (1992). Inventaire taxonomique des plantes de la Guyane
Française: II - les orchidacees. Museum National D'Histoire Naturelle, Paris.
Cribb, P. & Toscano-de-Brito, A.L.V. (1996). Histórico. In: S. Sprunger; P. Cribb &
A.L.V. Toscano-de-Brito (eds.) Iconographie des Orchidées du Brèsil. pp. 4247. Reinhardt, Basle.
Dix, M. A. & Dix, M. W. (2000). Orchids of Guatemala: a revised annotated checklist.
Missouri Botanical Garden Press, St. Louis.
Dod, D. D. (1986). Orquídeas (Orchidaceae) nuevas para la Española y otras notas.
Moscosoa 4: 188 − 199.
270
Dodson, C. H. (1996). New orchid species and combinations from Ecuador: 4.
Orquideologia 20: 90 – 110.
Dressler, R. L. (1974). Classification of the orchid family. In: M. Ospina (ed.),
Proceedings of the Seventh World Orchid Conference, pp. 259 – 279. Editorial
Bedout, Medellín.
Dressler, R. L. (1979). The subfamilies of the Orchidaceae. Selbyana 5: 197 − 206.
Dressler, L. R. (1981). The orchids: natural history and classification. Harvard
University Press, Cambridge.
Dressler, R. L. (1986). Recent advances in orchid phylogeny. Lindleyana 1: 5 − 20.
Dressler, R. L. (1990). The Spiranthoideae: grade or subfamily? Lindleyana 5: 110116.
Dressler, R. L. (1993). Phylogeny and classification of the orchid family. Dioscorides
Press, Portland.
Dressler, R. L. & Chase, M. W. (1995). Whence the orchids? In: P. J. Rudall; P. J.
Cribb; D. F. Cutler; C. J. Humphries (eds), Monocotyledons: systematics and
evolution, pp. 217–226. Royal Botanic Gardens, Kew.
Dunsterville, G. C. K. & Garay, L. A. (1959). Venezuelan orchids illustrated. Andre
Deutsch, London.
Dunsterville, G. C. K. & Garay, L. A. (1966). Venezuelan orchids illustrated. Andre
Deutsch, London.
Espejo-Serna, A. & López-Ferrari, A. R. (1998). Las monocotiledoneas Mexicanas:
una sinopsis florística: 1. lista de referencia Parte VIII: Orchidaceae (2).
Consejo Nacional de la Flora de Mexico, Ciudad de Mexico.
Fay, M. F., Rudall, P. J., Sullivan, S., Stobart, K. L., Bruijn, A. Y., Reeves, G.,
Qamaruz-Zaman, F., Hong, W. P., Joseph, J., Hahn, W. J., Conran, J. G. &
Chase, M. W. (2000). Phylogenetic studies of Asparagales based on four plastid
DNA loci. In: K. L. Wilson & D. A. Morrison (eds), Monocots: systematics and
evolution, pp. 360 – 371. CSIRO, Collingwood.
Fawcett, W. & Rendle, A. B. (1910). Flora of Jamaica, containing descriptions of the
flowering plants known from the island. Printed by order of the Trustees of the
British Museum, London.
Feldmann, P. & Barré, N. (2001). Atlas des orchidées sauvages de la Guadeloupe.
CIRAD/MNHN, Paris.
271
Felix, L. P. & Guerra, M. (2005). Basic chromosome numbers of terrestrial orchids.
Pl. Syst. Evol. 254: 131 – 148.
Figueroa, C.; Salazar, G. A.; Zavaleta, H. A. & Engleman, E. M. (2008). Root
character evolution and systematics in Cranichidinae, Prescottiinae and
Spiranthinae (Orchidaceae, Cranichideae). Ann. Bot. (Oxford). 101: 509 − 520.
Freudenstein, J. V. & Rasmussen, F. N. (1999). What does morphology tell us about
orchid relationships? A cladistic analysis. Amer. J. Bot. 86: 225 − 248.
Freudenstein, J. V., Senyo, D. M. & Chase, M. W. (2000). Mitochondrial DNA and
relationships in the Orchidaceae. In: K. L. Wilson & M. W. Morris (eds),
Monocots: systematics and evolution. pp. 421 – 429. CSIRO, Collingwood.
Gale, A. & Baldomero, J. (1938). Catálogo descriptivo de las orquideas cubanas. Bol.
Estac. Exp. Agron. Santiago. 60: 1 - 221.
Garay, L. A. (1960). On the origin of the Orchidaceae. Bot. Mus. Leafl. 19: 57 − 96.
Garay, L. A. (1978). Orchidaceae (Cypripedioideae, Orchidoideae, Neottioideae). In:
G. Harling & B. Sparre (eds). Flora of Ecuador, pp. 1 − 305. Riksmuseum,
Stockholm.
Garay, L. A. & Sweet, H. R. (1974). Orchidaceae. In: R. A. Howard; F. W. Gould; T.
Koyama; P. J. M. Maas & R. W. Read. Flora of the Lesser Antilles: Leeward
and Windward islands. Monocotyledoneae. pp. 1 − 235. Arnold Arboretum,
Jamaica Plain.
Gloudon, A. & Tobisch, C. (1995). Orchids of Jamaica. The Press University of the
West Indies, Kingston.
Govaerts, R. (2004). The Board of Trustees of the Royal Botanic Gardens, Kew.
Published on the Internet; http://www.kew.org/monocotChecklist/ [accessed 08
November 2004; 09:15 GMT].
Greuter, W.; McNeill, J.; Barrie, F. R.; Burdet, H. M.; Demoulin, V.; Filgueiras, T. S.;
Nicolson, D. H.; Silva, P. C.; Skog, J.; Trehane, P.; Turland, N. J. &
Hawksworth, D. L. (eds). (2000). International Code of Nomenclature (Saint
Louis Code). Adopted by the Sixteenth International Botanical Congress, St.
Louis, Missouri, July – August 1999. Koeltz Scientific Books, Königstein
[Regnum Veg. 138].
272
Hamer, F. (1974). Las orquídeas de El Salvador / The orchids of El Salvador / Die
Orchideen El Salvadors. Ministerio de Educación, Dirección de Publicaciones,
San Salvador.
Hamer, F. (1984). Orchids of Nicaragua. Icon. Pl. Trop. 12: 1101 − 1200.
Hamer, F. (1985). Orchids of Nicaragua. Icon. Pl. Trop. 13: 1201 − 1300.
Hammel, B. E., Grayum, M. H., Herrera, C. & Zamora, N. (eds) (2003). Manual de
Plantas de Costa Rica. Monocotiledoneas (Orchidaceae - Zingiberaceae).
Missouri Botanical Garden Press, St Louis.
Hodge, W. H. (1953). The Orchids of Dominica, British West Indies. Amer. Orchid.
Soc. Bull. 22: 891 − 904.
Hoehne, F. C. (1945). Orchidaceas. In: F.C. Hoehne (ed). Fl. Bras. (Hoehne) 12.
Instituto de Botânica, São Paulo.
Holmgren, P. K., & Holmgren, N. H. (1998). Index Herbariorum: A global directory of
public herbaria and associated staff. New York Botanical Garden's Virtual
Herbarium. http://sweetgum.nybg.org/ih/
Hooker, W. J. (1824). Prescotia plantaginifolia. Exot. Fl. Printed for W. Blackwood,
Edinburgh.
Johnson, A. E. (2001). Las orquideas del Parque Nacional Iguazú. Literature of Latin
America, Buenos Aires.
Jørgensen, P. M. & León-Yánez, S. (eds). (1999). Catalogue of the vascular plants of
Ecuador. Monogr. Syst. Bot. Missouri Bot. Gard. 75: 1-1182.
Judd, W. S., Campbell, C. S., Kellog, E. A., Stevens, P. F. & Donoghue, M. J. (2007).
Plant Systematics: A Phylogenetic Approach. Sinauer Associates, Sunderland.
Kores, P. J., Cameron, K. M., Molvray, M. & Chase, M. W. (1997). The phylogenetic
relationships of Orchidaceae and Spiranthoideae (Orchidaceae) as inferred from
rbcL plastid sequences. Lindleyana 12: 1 − 11.
Kores, P. J., Weston, P., Molvray, M. & Chase, M. W. (2000). Phylogenetic
relationships within the Diurideae (Orchidaceae): inferences from plastid matK
DNA sequences. In: Wilson, K. L. & Morrison, D. A. (eds), Monocots:
systematics and evolution, pp. 449 – 456. CSIRO, Collingwood.
Kores, P. J., Molvray, M., Weston, P. H., Hopper, S. D., Brown, A. P., Cameron, K.
M. & Chase, M. W. (2001). A phylogenetic analysis of Diurideae (Orchidaceae)
based on plastid DNA sequence data. Amer. J. Bot. 88: 1903 − 1914.
273
Kränzlin, F. (1911). Beiträge zur Orchideenflora Sudamerikas. Kungl. Svenska
Vetenskapsakademiens Handlingar. 46: 1 − 105.
Kurzweil, H. (1988). Developmental studies in orchid flowers III: Neottioid species.
Nord. J. Bot. 8: 271 – 282.
Lindley, J. (1836). Prescóttia colórans. Edwards's Bot. Reg. 22: sub t. 1916.
Lindley, J. (1840a). The genera and species of orchidaceous plants. Ridgways,
London.
Lindley, J. (1840b). A note upon the Genus Decaisnia, Ad Brong. Ann. Mag. Nat.
Hist. 6: 52 − 53.
Lindley, J. (1858). A list of orchidaceous plants collected in the east of Cuba by Mr.
C. Wright; with characters of the new species. Ann. Mag. Nat. Hist. 3: 325 −
336.
Mansfeld, R. (1929). FigurenAtlas zu den Orchideenfloren der Sudamerikanischen
Kordillerenstaaten von R. Schlechter. Repert. Spec. Nov. Regni Veg. Beih. 57:
75, t.291.
McLeish, I., Pearce, N. R., Adams, B. R.; with contributions by J. S. Briggs (1995).
Native orchids of Belize. A. A. Balkema, Rotterdam.
McNeill; Barrie, F. R.; Burdet, H. M.; Demoulin, V.; Hawksworth, D. L.; Marhold, K.;
Nicolson, D. H.; Prado, J.; Silva, P. C.; Skog, J. E.; Wiersema, J. H. & Turland,
N. J. (eds) (2006). International Code of Nomenclature (Saint Louis Code).
Adopted by the Seventeenth International Botanical Congress, Vienna, Austria,
July 2005. Koeltz Scientific Books, Königstein [Regnum Veg. 146].
Nir, M. A. (2000). Orchidaceae Antillanae. DAG Media, New York.
Pabst, G. F. J. (1966). As Orquídeas do Estado da Guanabara. Orquídea 28: 100 −
349.
Pabst, G. F. J. (1979). Orchidaceae extra Brasilianae novae vel criticae. Bradea 3:
19-20.
Pabst, G. F. J. & Dungs, F. (1975). Orchidaceae Brasilienses. vol. 1. Kurt
Schmersow, Hildesheim.
Porsch, O. (1905). Neue orchideen aus südbrasilien. Österr. Bot. Zeitschr. 55: 150 −
222.
Renz, J. (1948). Beiträge zur Kenntnis der süd- und zentralamerikanischen
Orchideen. Teil 1: Orchidaceae-Cranichidinae. Candollea 11: 243 − 276.
274
Rizzini, C. T. (1954). Flora Organensis. Arquivo do Jardim Botânico do Rio de
Janeiro. 13: 215 − 222.
Rocha, F. S. & Waechter, J. L. (2006). Sinopse das Orchidaceae terrestres
ocorrentes no litoral norte do Rio Grande do Sul, Brasil. Acta Bot. Bras. 20: 71 −
86.
Ruthowski, P., Mytnik, J. & Szachetko, D. L. (2004). New taxa and new combinations
in Mesoamerican Spiranthinae (Orchidaceae, Spirantheae). Ann. Bot. Fennici
41: 471 − 477.
Salazar, G. A. (2009). DNA, morphology, and systematic of Galeoglossum
(Orchidaceae, Cranichidinae). Proc. Second Sci. Conf. Andean Orchids 161 −
172.
Salazar, G. A., Chase, M. W., Soto Arenas, M. A. & Ingrouille, M. (2003).
Phylogenetics of Cranichideae with emphasis on Spiranthinae (Orchidaceae,
Orchidoideae): evidence from plastid and nuclear DNA sequences. Am. J. Bot.
90: 777 − 795.
Salazar, G. A., Cabrera, L. I., Madriñán, S. & Chase, M. W. (2009). Phylogenetic
Schill, R & Pfeiffer, W. (1977). Untersuchungen an Orchideenpollinien unter
besonderer Berücksichtigung ihrer Feinskulpturen. Pollen et Spores 19: 5 −
118.
Schill, R & Wolter, M. (1986). On the presence of elastoviscin in all subfamilies of the
Orchidaceae and the homology to pollenkitt. Nord. J. Bot. 6: 321 – 324.
Schlechter, R. (1921). Die Orchideenflora der Suedamerikanischen
Kordillerenstaaten. III Ecuador. Feddes Repert. Beih. 8: 1 − 172.
Schlechter, R. (1926). Das system der Orchidaceen. Notizbl. Bot. Gart. BerlinDahlem 9: 563 − 591.
Schlechter, R. & Hoehne, F. C. (1926). Contribuições ao conhecimento das
Orchidáceas do Brasil III. Archivos de Botanica do Estado de S. Paulo 1: 185 −
186.
275
Schultes, R. E. & Pease, A. S. (1963) Generic names of orchids, their origin and
meaning. Academic Press, New York.
Schweinfurth, C. (1958). Orchids of Peru. Fieldiana, Bot. 30.
Schweinfurth, C. (1967). Orchidaceae of the Guayana Highland. Mem. New York
Bot. Gard. 14: 69 − 214.
Singer, R. B., Azevedo, C. O., Van den Berg, C. & Aguiar, D. (in press) Prescottia
ostenii (Orchidaceae): a new record for Brazil, with a complete morphological
description. Kew Bull.
Singer, R. B. & Cocucci, A. A. (1999). Pollination mechanism in southern Brazilian
orchids which are exclusively or mainly pollinated by halictid bees. Pl. Syst.
Evol. 217: 101 − 117.
Singer, R. B. & Sazima, M. (2001). The pollination mechanism of three sympatric
Prescottia (Orchidaceae: Prescottinae) species in southeastern Brazil. Ann. Bot.
(London) 88: 999 − 1005.
Small, J. K. (1913). Flora of Miami. Published by the author, New York.
Sprunger, S. (1991). Catalogue. In: S. Sprunger; P. Cribb & W. T. Stearn (eds),
Orchids from the Botanical Register 1815-1847. The illustrations. Birkhäuser
Verlag, Basel.
Sprunger, S. (1996). Catalogue. In: S. Sprunger, P. Cribb & A. L. V. Toscano de Brito
(eds), Iconographie des Orchidées du Brèsil. Vol. 1. Reinhardt, Basle.
Sprunger, S., Cribb, P., Toscano-de-Brito, A. L. V. (eds) (1996). Iconographie des
Orchidées du Brèsil. Vol. 1. Reinhardt, Basle.
Stafleu, F. A. & Cowan, R. S. (1976). Taxonomic literature. Vol. I: A-G. Bohn,
Scheltema & Holkema, Utrecht.
Steudel, E. G. (1841). Nomenclator botanicus, seu, Synonymia plantarum
universalis: enumerans ordine alphabetico nomina atque synonyma, tum
generica tum specifica, et a Linnaeo et a recentioribus de re botanica
scriptoribus plantis phanerogamis imposita. ed. 2, vol. 2. pp. 177 – 432.
Sumptibus I.G. Cottae, Stuttgardiae et Tubingae.
Stevens, W. D., Ulloa, C. U., Pool, A. & Montiel, O. M. (2001). Flora de Nicaragua.
Monogr. Syst. Bot. Missouri Bot. Gard. 85.
Swartz, O. (1788). Nova genera & species plantarum; seu, Prodromus descriptionum
vegetabilium, maximam partem incognitorum quæ sub itinere in Indiam
276
Occidentalem annis 1783-87. In bibliopoliis Acad. M. Swederi, Holmiae, Upsaliæ
& Aboæ.
Szlachetko, D. L. (1995). Systema orchidalium. Fragm. Florist. Geobot. (Supp. 3): 1 −
152.
Thomas, S., Félix, L. P. & Toscano-de-Brito, A. (1998). Orchidaceae. In: M. F. Sales,
S. J. Mayo & M. J. N. Rodal (eds). Plantas vasculares das florestas serranas de
Pernambuco: um checklist da flora ameaçada dos brejos de altitude,
Pernambuco, Brasil. Imprensa Universitária, Recife.
Toscano-de-Brito, A. L. V. 1995. Orchidaceae. In: B. L. Stannard (ed), Flora of the
Pico das Almas: Chapada Diamantina, Bahia, Brazil, pp. 725-767. Royal Botanic
Gardens, Kew.
Toscano-de-Brito, A. L. V. 1998. Orchidaceae. In: M. L. S. Guedes & M. D. Orge
(eds), Checklist das espécies vasculares do Morro do Pai Inácio (Palmeiras) e
Serra da Chapadinha (Lençóis), Chapada Diamantina, Bahia, Brasil, pp. 53 − 54.
Universidade Federal da Bahia, Salvador.
Toscano-de-Brito, A. L. V. & Queiroz, L. P. 2003. Orchidaceae. In: D. C. Zappi, E.
Lucas, B. L. Stannard, E. N. Lughadha, J. R. Pirani, L. P. Queiroz, S. Atkins, D.
J. N. Hind, A. M. Giulietti, R. M. Harley & A. M. Carvalho. Lista das plantas
vasculares de Catolés, Chapada Diamantina, Bahia, Brasil. Bol. Bot. Univ. São
Paulo 21: 396 − 397.
Vargas, C. (1965). Orchids of Machupicchu (Peru). Amer. Orchid Soc. Bull. 34: 960 −
966.
Vargas, C. A. (1997). Phylogenetic analysis of Cranichideae and Prescottiinae
(Orchidaceae), with some taxonomic changes in Prescottiinae. MSc thesis,
University of Missouri, St. Louis.
Vöth, W. (1976). Prescotia plantaginifolia Lindl. ex Hook. Orchidee 27: 148 − 153.
Ward, D. B., Austin, D. F. & Coile, N. C. (2003). Endangered and threatened plants
of Florida, ranked in order of rarity. Castanea 68: 160 − 174.
Werkhoven, M. C. M. (1986). Orchideeën van Suriname / Orchids of Suriname.
Vaco, Paramaribo.
Wettstein, R. (1908). Ergebnisse der Botanischen Expedition der kaiserlichen
Akademie der Wissenschaften nach Südbrasilien 1901. Band I. Pteridophyta
und Anthophyta. Alfred Hölder, Wien.
277
Wiggins, I. L. & Porter, D. M. (1971). Flora of the Galápagos Islands. Stanford
University Press, Stanford.
Williams, L. O. (1946). Flora of Panama. Part III. Fascicle II. Ann. Missouri Bot. Gard.
33: 1 − 140.
Williams, L. O. (1951). The Orchidaceae of Mexico. Ceiba 2: 5 − 194.
Williams, L. O. (1956). An enumeration of the Orchidaceae of Central America,
British Honduras and Panama. Ceiba 5.
278
CONCLUSÕES GERAIS
279
Conclusões Gerais
Neste trabalho foi apresentada a primeira compilação de informações para o
gênero Prescottia como um todo. Quinze espécies de Prescottia são aceitas, dentre
as quais duas são novas: Prescottia mucugensis e P. ecuadorensis. Além disso,
duas propostas de conservação de nomes foram submetidas. A ocorrência de
Prescottia ostenii foi registrada para o Brasil e a de Prescottia glazioviana para
Minas Gerais. Foram propostas 23 lectotipificações, uma neotipificação e 11 novas
sinonimizações. Prescottia spiranthophylla foi restabelecida como espécie e quatro
nomina nuda foram detectados.
Existem poucos caracteres qualitativos macro-morfológicos que podem ser
utilizados para delimitar as espécies de Prescottia. Dentre os caracteres utilizados, o
desenvolvimento dos pecíolos, a coloração das flores, a posição das sépalas e
pétalas e a presença de tricomas no interior do labelo foram os mais úteis. Do ponto
de vista micro-morfológico, os caracteres também são pouco informativos e muito
variáveis, destacando-se a morfologia da superfície das sementes analisadas em
microscópio eletrônico de varredura.
A análise de grande número de espécimes em herbário, juntamente com o
trabalho de campo, permitiu observações detalhadas das populações, tanto do ponto
de vista morfológico quanto ecológico. Além disso, a manutenção de plantas em
cultivo possibilitou o conhecimento mais aprofundado da variação dos caracteres
morfológicos nos táxons.
Grande parte das espécies de Prescottia é pouco coletada. Em parte devido à
dificuldade de encontrar as plantas em campo, uma vez que, além de pequenas,
após o ciclo reprodutivo, elas perdem toda a porção vegetativa, e em parte pela
raridade de algumas espécies. Prescottia oliganta (25%), P. plantaginifolia (14%) e
P. stachyodes (44%) somam, juntas, 83% do material coletado.
O estudo filogenético aqui apresentado demonstrou o monofiletismo do
gênero e a sua relação de grupo-irmão com Galeoglossum. O gênero aparece
dividido em dois grupos maiores, um agrupando as espécies longo-pecioladas e o
outro o restante das espécies amostradas, representado por espécies com pecíolos
curtos, pseudopecioladas e sésseis. As espécies que apresentam flores
280
esbranquiçadas e tricomas no interior do labelo formam um grupo monofilético, mas
as espécies de flores esverdeadas e labelo glabro formam um grupo parafilético.
Foi diagnosticada a presença de complexos específicos envolvendo
Prescottia oligantha e P. stachyodes, que apresentam grande variação morfológica.
A grande variabilidade morfológica observada entre populações de uma mesma
espécie gera dificuldade na delimitação e, consequentemente, identificação das
espécies. Embora não exista dúvida em relação ao monofiletismo do gênero como
aqui aceito, trabalhos adicionais são necessários para confirmar a existência desses
complexos. Deste modo, análises com uma abordagem populacional, inserindo
amostras que englobem populações de várias regiões, incluido seus extremos de
distribuição geográfica, seriam adequadas para confirmar e esclarecer as relações
entre os morfotipos existentes.
A filogenia baseada em dados moleculares foi útil para esclarecer a
circunscrição do gênero e a relação entre suas espécies. Este resultado foi usado
também na discussão das espécies no capítulo 3 e auxiliou no esclarecimento de
questões nomenclaturais no gênero e na descrição da espécie nova apresentada no
capítulo 2.
281
ANEXOS
282
Anexo 01
Taxa
1. Prescottia carnosa C. Schweinf.
2. Prescottia densiflora (Brongn.) Lindl.
Basyonym and/or synonyms
Decaisnea densiflora Brongn.
3. Prescottia ecuadorensis C.O. Azevedo
& Van den Berg
4. Prescottia glazioviana Cogn.
Prescottia epiphyta Barb. Rodr. synon. nov.
5. Prescottia lancifolia Lindl.
Prescottia octopollinica Barb. Rodr. synon. nov.
Prescottia truncicola Schltr.
6. Prescottia leptostachya Lindl.
7. Prescottia lojana Dodson
8. Prescottia montana Barb. Rodr.
9. Prescottia mucugensis C.O. Azevedo
& Van den Berg.
Cranichis oligantha Sw.
10. Prescottia oligantha (Sw.) Lindl.
Cranichis micrantha Spreng. isonym
Prescottia micrantha Lindl.
Prescottia tenuis Lindl.
Prescottia myosurus Rchb. f. ex Griseb.
Prescottia microrhiza Barb. Rodr. synon. nov.
Prescottia pubescens Barb. Rodr. synon. nov.
Prescottia nivalis Barb. Rodr. synon. nov.
Prescottia viacola Barb. Rodr.
Prescottia viacola var. polyphylla Cogn.
Prescottia filiformis Schltr.
Prescottia gracilis Schltr.
Prescottia panamensis Schltr.
11. Prescottia ostenii Pabst
12. Prescottia phleoides Lindl.
Prescottia plantaginea Hook.
13. Prescottia plantaginifolia Lindl. ex
Prescottia rodeiensis Barb. Rodr. synon. nov.
Hook.
Prescottia stricta Schltr.
Prescottia plantaginea var. macrostachya Hoehne
synon. nov.
14. Prescottia spiranthophylla Barb.
Rodr.
Cranichis stachyodes Sw.
15. Prescottia stachyodes (Sw.) Lindl.
Prescottia colorans Lindl.
Prescottia petiolaris Lindl.
Prescottia pellucida Lindl.
Prescottia longipetiolata Barb. Rodr.
Prescottia paulensis Cogn.
Prescottia smithii Schltr.
Prescottia longifolia Schltr.
Prescottia longipetiolata Schltr. synon. nov.
Prescottia schlechteri Hoehne
Prescottia colorans var. macrophylla Hoehne synon.
nov.
Prescottia tepuyensis Carnevali & C.A. Vargas synon.
nov.
Prescottia villenaora Christenson synon. nov.
Doubtful Names
1. Prescottia auyantepuiensis Carnevali &
G.A.Romero
283
Taxa
2. Prescottia corcovadensis Rchb.f.
3. Prescottia cordifolia Rchb.f.
4. Prescottia polyphylla Porsch.
5. Prescottia polysphaera Schltr.
Nomina nuda
1. Prescottia gigantea Lodd. ex W.Baxter
nom. nud.
2. Prescottia lanceaefolia Link & Otto ex
Steud. nom. nud.
3. Prescottia serrana M.N. Correa
Excluded taxa
1. Prescottia barbifrons Kraenzl.
2. Prescottia crassicaulis F. Lehm. &
Kraenzl.
3. Prescottia lindeniana A. Rich. & Galeotti
4. Prescottia ophioglossoides Spreng.
5. Prescottia orchioides Lindl.
6. Prescottia pachyrhiza A. Rich. & Galeotti
7. Prescottia pteristyloides Kraenzl.
8. Prescottia tubulosa (Lindl.) L.O. Williams
Basyonym and/or synonyms
= Pterichis barbifrons (Kraenzl.) Schltr.
= Altensteinia virescens Lindl.
= Galeoglossum tubulosum (Lindl.) Salazar & Soto
Arenas
= Malaxis unifolia Michx.
= Galeottiella orchioides (Lindl.) R. González ex Rutk.
Arenas
= Altensteinia marginata Rchb. f.
Arenas
284
Anexo 02
Lista de nomes aceitos e sinônimos
Cranichis micrantha Spreng. = Prescottia oligantha (Sw.) Lindl.
Cranichis oligantha Sw. = Prescottia oligantha (Sw.) Lindl.
Cranichis stachyodes Sw. = Prescottia stachyodes (Sw.) Lindl.
Cranichis tubulosa Lindl. = Galeoglossum tubulosum (Lindl.) Salazar & Soto
Arenas
Decaisnea densiflora Brongn. = Prescottia densiflora (Brongn.) Lindl.
Galeoglossum prescottioides A. Rich. & Galeotti = Galeoglossum tubulosum
(Lindl.) Salazar & Soto Arenas
Galeoglossum tubulosum (Lindl.) Salazar & Soto Arenas
Prescottia auyantepuiensis Carnevali & G.A. Romero = doubtful name
Prescottia barbifrons Kraenzl. = Pterichis barbifrons (Kraenzl.) Schltr.
Prescottia carnosa C. Schweinf.
Prescottia colorans Lindl. = Prescottia stachyodes (Sw.) Lindl.
Prescottia colorans var. macrophylla Hoehne = Prescottia stachyodes (Sw.) Lindl.
Prescottia corcovadensis Rchb. f. = doubtful name
Prescottia cordifolia Rchb. f. = doubtful name
Prescottia crassicaulis F. Lehm. & Kraenzl. = Altensteinia virescens Lindl.
Prescottia densiflora (Brongn.) Lindl.
Prescottia ecuadorensis C.O. Azevedo & Van den Berg
Prescottia epiphyta Barb. Rodr. = Prescottia lancifolia Lindl.
Prescottia filiformis Schltr. = Prescottia oligantha (Sw.) Lindl.
Prescottia glazioviana Cogn.
Prescottia gigantea Lodd. ex W.Baxter = nom. nud.
Prescottia gracilis Schltr. = Prescottia oligantha (Sw.) Lindl.
Prescottia lanceaefolia Link & Otto ex Steud. = nom. nud.
Prescottia lancifolia Lindl.
Prescottia lindeniana A. Rich. & Galeotti = Galeoglossum tubulosum (Lindl.)
Salazar & Soto Arenas
285
Prescottia lojana Dodson
Prescottia longifolia Schltr. = Prescottia stachyodes (Sw.) Lindl.
Prescottia longipetiolata Barb. Rodr. = Prescottia stachyodes (Sw.) Lindl.
Prescottia longipetiolata Schltr. = Prescottia stachyodes (Sw.) Lindl.
Prescottia micrantha Lindl. = Prescottia oligantha (Sw.) Lindl.
Prescottia microrhiza Barb. Rodr. = Prescottia oligantha (Sw.) Lindl.
Prescottia mucugensis C.O. Azevedo & Van den Berg.
Prescottia myosurus Rchb. f. ex Griseb. = Prescottia oligantha (Sw.) Lindl.
Prescottia nivalis Barb. Rodr. = Prescottia oligantha (Sw.) Lindl.
Prescottia octopollinica Barb. Rodr. = Prescottia lancifolia Lindl.
Prescottia ophioglossoides Spreng. = Malaxis unifolia Michx.
Prescottia orchioides Lindl. = Galeottiella sarcoglossa (A. Rich. & Galeotti) Schltr.
Prescottia ostenii Pabst
Prescottia pachyrhiza A. Rich. & Galeotti = Galeoglossum tubulosum (Lindl.)
Prescottia panamensis Schltr. = Prescottia oligantha (Sw.) Lindl.
Prescottia paulensis Cogn. = Prescottia stachyodes (Sw.) Lindl.
Prescottia phleoides Lindl.
Prescottia pellucida Lindl. = Prescottia stachyodes (Sw.) Lindl.
Prescottia petiolaris Lindl. = Prescottia stachyodes (Sw.) Lindl.
Prescottia plantaginea Hook. = Prescottia plantaginifolia Lindl. ex Hook.
Prescottia plantaginea var. macrostachya Hoehne = Prescottia plantaginifolia
Lindl. ex Hook.
Prescottia polyphylla Porsch = Doubtful name
Prescottia polysphaera Schltr. = = Doubtful name
Prescottia pteristyloides Kraenzl. = Altensteinia marginata Rchb. f.
Prescottia pubescens Barb. Rodr. = Prescottia oligantha (Sw.) Lindl.
Prescottia rodeiensis Barb. Rodr. = Prescottia plantaginifolia Lindl. ex Hook.
Prescottia schlechteri Hoehne = Prescottia stachyodes (Sw.) Lindl.
Prescottia serrana M.N. Correa = nom. nud.
286
Prescottia smithii Schltr. = Prescottia stachyodes (Sw.) Lindl.
Prescottia stricta Schltr. = Prescottia plantaginifolia Lindl. ex Hook.
Prescottia tenuis Lindl. = Prescottia oligantha (Sw.) Lindl.
Prescottia tepuyensis Carnevali & C.A. Vargas = Prescottia stachyodes (Sw.) Lindl.
Prescottia truncicola Schltr. = Prescottia lancifolia Lindl.
Prescottia tubulosa (Lindl.) L.O. Williams = Galeoglossum tubulosum (Lindl.)
Prescottia viacola Barb. Rodr. = Prescottia oligantha (Sw.) Lindl.
Prescottia viacola var. polyphylla Cogn. = Prescottia oligantha (Sw.) Lindl.
Prescottia villenaora Christenson = Prescottia stachyodes (Sw.) Lindl.
287
KEW BULLETIN INSTRUCTIONS FOR AUTHORS
Manuscript submission
Editorial Office
Legal requirements
Manuscript preparation
General text instructions
Format & layout
Tables & figures
Electronic supplementary material
Proofreading
Springer Open Choice
MANUSCRIPT SUBMISSION
• Authors must submit their articles to Kew Bulletin online to facilitate efficient processing. Electronic
submission substantially reduces the editorial processing and reviewing time and shortens overall
publication time. Manuscripts sent to the authors for revision should be returned by the date
specified in the covering email, otherwise they will be treated as new submissions.
• A wide range of submission file formats is supported, including: Word, WordPerfect, RTF, TXT,
TIFF, GIF, JPEG, EPS, LaTeX2E, TeX, Postscript, PICT, Excel, Tar, Zip and Powerpoint. PDF is
not an acceptable file format.
• Please log directly onto the link below and upload your manuscript following the instructions given
on screen. SUBMIT ONLINE at http://www.edmgr.com/kewb
EDITORIAL OFFICE
Dr David A. Simpson
Editor-in-chief
Royal Botanic Gardens, Kew
Richmond
Surrey TW9 3AB
UK
e-mail: [email protected]
Mrs Ruth Linklater
Managing Editor
Kew Publishing
Royal Botanic Gardens, Kew
Richmond
Surrey TW9 3AB
UK
Tel.: +44 208 332 5217
e-mail: [email protected]
LEGAL REQUIREMENTS
• Submission of a manuscript implies: that the work described has not been published before
(except in the form of an abstract or as part of a published lecture, or thesis); that it is not under
consideration for publication elsewhere; that its publication has been approved by all co-authors, if
any, as well as by the responsible authorities — tacitly or explicitly — at the institute where the
work has been carried out. The publisher will not be held legally responsible should there be any
claims for compensation.
• The "Copyright Transfer Statement" has to be signed and faxed to the publisher together with the
corrected proofs (see below), which will be provided by the publisher shortly after the manuscript
has been accepted for publication.
MANUSCRIPT PREPARATION
• All manuscripts are subject to peer review and copy editing.
• To speed up the processing of your manuscript, please follow this checklist precisely.
Failure to do so will result in a delay to publication. Please refer to a recent part of KB for
examples of the typographic and layout characteristics of KB.
288
• Manuscripts are written in English and are typed to fit A4 (208 x 298 mm) paper. Text is
double-spaced and in a single column, aligned left with margins of at least 25 mm on each
side. All pages are numbered.
GENERAL
Fonts and typography
• Footers are in 10 pt Times New Roman.
• All other text is in 12 pt Times New Roman.
• Italics are used for the following:
o
plant names at genus level and below (e.g. Cyperus; sect. Rotundi; Cyperus
rotundus);
o
authority names after the Accepted Name when in bold (e.g. L., Boeck., Schott,
Salunkhe & Potdar);
o
collector names in specimen citations (e.g. Kerr 12345);
o
genes and gene regions (e.g. rbcL, matK, trnL–F);
o
the following abbreviations: et al., loc. cit., tom. cit., op. cit.;
o
book or journal titles in the list of references.
• Do not italicise any other words, phrases or abbreviations.
• Numbers one to nine are written unless a measurement or in taxonomic descriptions (e.g. four
samples, 2 cm, 35 sites, 6 km). Use 0.12 instead of .12; 1 instead of 1.0; % instead of percent.
• Months are formatted as follows: Jan., Feb., March, April, May, June, July, Aug., Sept., Oct., Nov.,
Dec. Give the year in full, for example 1991 not /91.
• Distinguish between hyphens, typed without spaces (e.g. brown-tomentose; 3-flowered), and enrules, typed with spaces (e.g. leaves 24 – 30 x 10 – 15 cm; inflorescences 2 – 3-flowered).
• Essential footnotes to the text should be numbered consecutively and placed at the bottom of the
page to which they refer.
Units and symbols
• Temperatures should be expressed in degrees Celsius, time in seconds (s), minutes (min), hours
(h), days, etc. Otherwise, the International System of Units (Sl, Systéme International d’Unités)
should be used wherever possible. (Consult, e.g. National Institute of Standards and Technology,
Special Publication 330, International System of Units (SI), latest edition;
http://physics.nist.gov/cuu/Units; or "How many? A Dictionary of Units of Measurements" © Russ
Rowlett and the University of North Carolina at Chapel Hill; http://www.unc.edu/~rowlett/units)
Abbreviations
• For correct usage of abbreviations authors should consult the list of Planta units, symbols and
abbreviations. (Planta units, symbols, abbreviations;
http://www.springerlink.com/content/uuv8vawgvm11j01m/fulltext.pdf)
• Herbarium codes follow Index Herbariorum
(http://sciweb.nybg.org/science2/IndexHerbariorum.asp).
• No full stops after common contractions (e.g. Mt, Mts), nor after points of the compass (N, S, NE
etc.), nor after abbreviations for units of measurement (e.g. mm, cm, km). Include after other
abbreviations (e.g. R., fl., fr.).
289
• Use sect., subsp., var. and f. for section, subspecies, variety and form respectively, except at the
start of sentences where the full word is written.
• Use s.l. and s.s. for sensu lato and sensu stricto respectively.
Plant names
• Authors of plant names are cited on first mention of the name in the body of the manuscript at
genus level and below.
• Citations of plant name authors follow Brummitt, R. K. & Powell, E. (eds.) (1992). Authors of Plant
Names. Royal Botanic Gardens, Kew (www.ipni.org).
• The first mention of a genus name in a sentence should be spelt out in full; subsequently, genus
names should be abbreviated to their initial letter, unless this would cause confusion.
Spelling
• Use the ending ‘ise’ in words such as recognise or analyse. Check for consistency of use
throughout the manuscript.
FORMAT & LAYOUT
Title
• The wording should be concise but informative and where appropriate should include the family or
higher taxon and a geographical area.
• If only one taxon forms the subject of the manuscript (e.g. a single new species) the name of the
taxon is included in the title.
• Taxonomic ranks indicated in the title are separated by colons (e.g. Leguminosae: Papilionoideae:
Millettieae).
• Plant name authors are omitted from the title.
Authors
• Author names are placed below the title, in bold.
• Address(es)/affiliation(s) of the author(s) and the e-mail address, telephone and fax numbers of
the corresponding author are placed in a footer on page 1.
• Authors' names and addresses are linked by a superscript number, e.g. J. M. Lock1.
Summary
• The heading ‘Summary’ is in bold on the same line as the text.
• The Summary indicates what the research set out to achieve, how it was carried out and the
degree to which the objectives were reached. It includes any authors of plant names omitted from
the title, the names of all new taxa described and new combinations unless the number is very
large. The methods and main conclusions are also summarised.
• References are not cited in the Summary.
Key words
• The heading ‘Key Words’ is in bold on the same line as the text.
290
• Up to seven key words are provided, in alphabetical order.
• Words already used in the title are not included.
Headings
• Main headings (Introduction, Materials and methods, etc.) are placed on separate lines..
• Headings are in bold, subheadings are not.
• The hierarchy is sensible and consistent.
Keys
• Keys are either bracketed (preferable) or indented, but couplets should always be numbered.
• Taxon names are in bold.
• Plant name authors are not cited in keys.
• A recent issue of KB should be consulted to follow the key layouts used.
Accounts of taxa
Synonyms
• Homotypic synonyms are grouped in chronological order after the accepted name, followed by
heterotypic synonyms, also with their respective homotypic synonyms in chronological order.
• New synonyms are indicated in bold as synon. nov. at the end of the citation for the synonym.
• Illegitimate and invalid names are indicated in bold as nom. illegit. and nom. invalid. respectively
at the end of the citation for the name.
Types
• The herbarium in which the holotype is deposited is cited, as required by the International Code of
Botanical Nomenclature (ICBN).
• Herbaria that are definitely known to hold isotypes are listed.
• If applicable, when lectotypes, neotypes or epitypes are being designated for the first time,
'selected here' is indicated: e.g. Papua, Boridi, Carr 12345 (lectotype K!, selected here;
isolectotypes BRI, L!).
• When lectotypes, neotypes or epitypes have been selected elsewhere, a reference is given:
'Sarawak, Kuching, Smith 34567 (lectotype K!, selected by Bloggs (1977); isolectotypes BRI, L!).'
• When a lectotype has been selected any remaining syntypes are re-designated as lectoparatypes.
They are cited in the list of specimens examined and indicated as such.
• If applicable, the reasons why lectotypes, neotypes and epitypes have been selected and the
reasons for selecting a particular specimen are explained.
• If applicable, type specimens have been seen and are cited for new combinations.
Citation of specimens
• For new taxa, all the material seen is cited.
• Only those label data that add significantly to localising the collection or to field knowledge are
cited.
291
• Label data are normally translated into English, but data for types can be left in the original
language.
• It may be unwise to give precise localities for rare and horticulturally interesting taxa. This factor
should be considered when citing label data.
• If appropriate the number of collections examined is stated, and at least one specimen from each
country in the range of the taxon is cited. In cases of long-standing confusion, there may be a case
for citing all specimens, but reduce detail to a minimum.
• Either use an exclamation mark (!) to show that a specimen has been seen or state in the
introduction that, "All cited specimens have been seen by the author".
• Spellings of place names follow the Times Atlas (12th edition [2007] if possible) and/or Hollis, S. &
Brummitt, R. K. (1992). World Geographical Scheme for Recording Plant Distributions. Hunt
Institute for Botanical Documentation, Pittsburgh.
• Normally accepted English usage place names are cited e.g. Ghana (not Gold Coast), Zimbabwe
(not Rhodesia), Thailand (not Muang Thai), Brazil (not Brasil), Congo (Brazzaville), Congo
(Kinshasa), Burma (not Myanmar), Madagascar (not Malagasy Republic), Sicily (not Sicilia), New
Guinea (for the whole island - the eastern part is Papua New Guinea and the western part, West
Papua).
• Old names of localities, as used on old labels, may be given with the modern equivalent in square
brackets e.g. Stanleyville [Kisangani]; Salisbury [Harare].
• Distances should be cited in metres or kilometres not feet, yards or miles. The original non-metric
label data may be given in square brackets.
• Altitudes are cited in metres to the nearest 50 m. Altitudes in feet on labels are converted to the
nearest 50 m. The original label altitude may be given in square brackets.
• Latitude and longitude (in this order) are cited for obscure localities.
Accounts of new taxa
• New taxa accounts are laid out strictly in the format shown below. Note the positions of indents
and use of spaces, Arial/Times fonts, bold and italics.
• Latin diagnoses compare the new taxon with one or more related taxa, with or without brief Latin
descriptions.
• In large genera, the diagnosis mentions the infrageneric group to which the new taxon belongs, if
such groupings exist. No more than three authority names should be should be cited after the plant
name.
• The full description is in English.
• Types of new species are cited in abbreviated form after the diagnoses and repeated in full
amongst the cited specimens.
• Conservation ratings must be given using the criteria set out in IUCN (2001). IUCN Red List
Categories and Criteria: Version 3.1. IUCN Species Survival Commission. IUCN, Gland,
Switzerland and Cambridge, UK (http://www.iucnredlist.org/static/categories_criteria_3_1). If a
rating cannot be applied then Data Deficient (DD) should be indicated.
Taxa in revisions
• Taxon accounts in revisions are laid out strictly in the format shown below. Note the positions of
indents and use of spaces, Arial/Times fonts, bold and italics.
292
• Name, authority, year and place of publication are cited as, e.g. ‘Mapania meditensis D.A.
Simpson (1992: 42)’ for an accepted name or ‘Hypolytrum soyauxii Boeck. (1882: 25)’ for a
synonym. The full publication is then cited once in the ‘References’ section.
• Conservation ratings must given wherever possible. If a rating cannot be applied then Data
Deficient (DD) should be cited.
• When making new combinations or new names, the name, authority, abbreviated literature
reference, page number and date are cited for the basionym or replaced synonym as, e.g.
Mapaniopsis micrococca T. Koyama, Jap. J. Bot. 20: 130 (1969). The full publication is cited in the
'References' section.
Data
• All DNA sequences are deposited in one of the international nucleotide sequence databases,
either EMBL (www.ebi.ac.uk/embl/) or GenBank (www.ncbi.nlm.nih.gov/).
• For phylogenetic analyses, character state distributions, consistency index, retention index (where
appropriate) and a recognised measure of support for clades (e.g. bootstrap values, decay indices
["Bremer support"], jackknife, etc.) are provided.
• Voucher specimens documenting sources of morphological and molecular data are listed.
Literature citation and references
• Book and journal titles are italicised in the reference list.
• Part numbers of journals are not cited in references.
• Literature citations in the text should be by author and year. If there are more than two authors,
only the first should be named, followed by ‘‘et al.’’ All authors are cited in the 'References' section.
Examples: Manning (1994) showed that... Field studies in Cameroon (Smith & Jones 1994) have
shown that ... Muasya & Simpson (2002) have shown that … Liu et al. (1994) have shown that ...
• The following are used within reason: loc. cit. [same work, same volume, same page]; tom. cit.
[same work, same volume, different page - give page number]; op. cit. [same work; different
volume; different page — give volume and page numbers].
• Abbreviated literature references cited in the text have the following formats depending on the
context: Bloggs (1962), Bloggs (1962: 234), (Bloggs 1962), (Bloggs 1962: 234), (Bloggs 1962;
Another 1976).
• References at the end of the paper should be listed in alphabetical order by the first author's
name. If there is more than one work by the same author or team of authors in the same year, a, b,
etc. is added to the year both in the text and in the list of references.
• For indents use tab stops or other commands, not the space bar.
• Book abbreviations follow Stafleu, F.A. & Cowan, R.S. (1976 – 1988). Taxonomic Literature. (2nd
ed.) Bohn, Scheltema & Holkema, Utrecht. Later Supplements are also available. Note that KB
capitalises most words. If in doubt, do not abbreviate.
• Journal abbreviations follow Bridson, G. D. R., Townsend, S. A., Polen, E. A. & Smith, E. R.
(2004). BPH-2. Periodicals with botanical content. Constituting a second edition of BotanicoPeriodicum-Huntianum. Vols 1 & 2. Hunt Institute for Botanical Documentation, Carnegie Mellon
University, Pittsburgh. The principles therein should allow the correct abbreviations to be made for
journals not included. If in doubt, do not abbreviate.
• Kew Bulletin up to and including 1941 is cited as (for example): Bull. Misc. Inform., Kew 1929: 16 –
28. From Vol.1 (1946) it is cited as (for example): Kew Bull. 44: 601 – 680. Note that this is not as
in BPH.
293
• A useful website for searching both book and journal abbreviations is
http://asaweb.huh.harvard.edu:8080/databases/publication_index.html.
• Page numbers are separated by an en-rule plus spaces (i.e., 1 – 2 not 1-2).
• Part numbers of volumes are not included unless the parts are separately paginated.
• Plant names at genus level and below are italicised in references, whether or not they were in
italics in the original reference.
• The total numbers of pages in single works are not included.
Examples of literature citations:
Dransfield, J. (1989). Voanioala (Arecoideae: Cocoeae: Butiinae), a new palm genus from
Madagascar. Kew Bull. 44: 191 – 198.
Li, H. (1979). Arisaema. In: C. Y. Wu & H. Li (eds), Flora Reipublicae Popularis Sinicae 13: 116 – 194
(in Chinese).
Gentry, A. H. (1986). Endemism in tropical versus temperate plant communities. In: M. E. Soulé (ed.),
Conservation biology — the science of scarcity and diversity, pp. 153 – 181. Sinauer Associates,
Sunderland, Massachusetts, USA.
Prance, G. T. (1989). Chrysobalanaceae. Flora Neotrop. Monogr. 98.
Uhl, N. W. & Dransfield, J. (1987). Genera Palmarum: a classification of palms based on the work of
H. E. Moore Jr. The L. H. Bailey Hortorium and the International Palm Society, Lawrence, Kansas,
USA.
Acknowledgements
• These are kept brief. Do not give the full title of any institute that has an accepted Index
Herbariorum Code.
TABLES & FIGURES
Tables
• Tables are numbered consecutively with arabic numerals and submitted separately from the text.
They have a title and a footnote explaining any abbreviation used in that table. Footnotes to tables
should be indicated by superscript lower-case letters. Double documentation of the same points in
figures and tables is not acceptable.
Figures
• All figures (photographs, illustrations or graphs) should be cited in the text, and numbered
consecutively throughout (Fig. 1, etc); maps are numbered separately (Map 1, etc.) and must be
referred to in the text. Figure parts should be identified by upper-case roman letters (A, B, etc.), "I"
or "O" are not used. Scale bars are included on illustrations and the scale bar measurement is
written in the legend (e.g. scale bar = 1 mm).
• Figure legends must be brief, self-sufficient explanations of the illustrations. The legends should be
placed at the end of the text.
• Full- or part-page figures are acceptable. The figures, including legends, should match either the
column width (78 mm) or the print area of 230 x 165 mm. The publisher reserves the right to
reduce or enlarge illustrations, hence scale bars are used and not magnification factors.
• Submit all figures as separate files and do not integrate them within the text. The preferred figure
formats are EPS for vector graphics exported from a drawing program and TIFF for halftones and
line drawings. EPS files must always contain a preview in TIFF of the figure. The file name should
include the figure number.
294
• All taxa newly described in the manuscript should be accompanied by a good quality line drawing.
All lines and symbols should be of uniform thickness, and of professional quality and proper
dimensions (approx. 2 mm high after reproduction). All line drawings are scanned and submitted
as 1200 dpi TIFF files.
• Photographs ('Plates') for continuous tone reproduction are of the highest quality. They show good
tonal range and are absolutely sharp. They are provided as TIFF files at 300 dpi, either at the final
size or slightly larger.
• Colour figures will always be published in colour in the online version. Illustrations are printed in
black and white unless colour is scientifically necessary. Authors have the option to pay for
additional colour printing. Save colour illustrations as RGB (8 bits per channel) in TIFF format.
ELECTRONIC SUPPLEMENTARY MATERIAL
• Electronic Supplementary Material (ESM) for a paper is published in the electronic edition of this
journal provided the material is submitted in electronic form together with the manuscript.
Reference will be given in the printed version.
•
ESM may consist of information that cannot be printed: animations, video clips, sound recordings
(use QuickTime, .avi, .mpeg, animated GIFs, or any other common file format) information that is
more convenient in electronic form: sequences, check lists, etc.; or large quantities of original data
that relate to the paper, e.g. additional tables, large numbers of illustrations (colour and black &
white) etc.
•
Legends must be brief, self-sufficient explanations of the ESM. The file size should not exceed 2
MB. ESM is to be numbered and referred to as S1, S2, etc.
PROOFS
First-named authors are informed by e-mail that a temporary URL has been created from which they
can obtain their proofs. Proof-reading is the responsibility of the authors. Authors should make their
proof corrections (formal corrections only) on a printout of the .pdf file supplied, checking that the text
is complete and that all figures and tables are included. Please return proofs promptly. Ensure the
marking is clearly comprehensible; practices vary widely in different countries. Authors should advise
us of corrections by e-mail or fax if possible. Nominate someone else to deal with proofs if you expect
to be away at the time of their arrival. Please advise us if you are in doubt as to the quality of
illustration proofs. Substantial changes in content, e.g. new results, corrected values, title and
authorship are not allowed without the approval of the responsible editor. In such a case please
contact the Editorial Office before returning the proofs to the publisher. After online publication,
corrections can only be made in exceptional cases and in the form of an Erratum, which will be
hyperlinked to the article.
SPRINGER OPEN CHOICE
In addition to the traditional publication process, Springer now provides an alternative publishing
option: Springer Open Choice (Springer's open access model). A Springer Open Choice article
receives all the benefits of a regular article, but in addition is made freely available through Springer's
online platform SpringerLink. To publish via Springer Open Choice upon acceptance of your
manuscript, please click on the link below to complete the relevant order form and provide the
required payment information. Payment must be received in full before free access to the publication.
295
KEW BULLETIN — FORMAT AND LAYOUT OF TAXA ACCOUNTS
New taxa
Cyperus kituiensis Muasya sp. nov. C. kwaleense Lye affinis sed spiculis disarticulatis (nec
persistentibus), glumis 3.3 – 3.7 mm longis (nec 3 – 3.5 mm longis), nuculis manifeste
porcatis differt. Typus: Kenya, Kitui Distr., Kirika, Mbii & Wambugu NMK326 (holotypus
EA!; isotypus K!).
Description in the order: general habit; underground parts; stem; leaves; inflorescences;
flowers (calyx, corolla, androecium, gynoecium); fruits; seeds. [Major headings are in
italics]. Fig. 1.
DISTRIBUTION. Africa: Kenya.
SPECIMENS EXAMINED. KENYA. Kitui Distr.: Endau, 1o19’S, 38o28’, 15 Feb. 2002,
Kirika, Mbii & Wambugu NMK326 (holotype EA; isotype K); Endau, 3 km on Endau –
Zombe road, 9 Jan. 2004, Muasya, Kirika, Obunyali & Musili 2508 (EA, K); Endau, 3.5 km
on Endau – Zombe road, 9 Jan. 2004, Muasya, Kirika, Obunyali & Musili 2509 (EA, K);
HABITAT. Seasonal wetland; 435 m. [Note that the use of vernacular terms for vegetation
types is discouraged].
CONSERVATION STATUS. [Use IUCN conservation ratings with some discussion to
justify the rating applied].
PHENOLOGY. [Optional, but provide if information is available].
ETYMOLOGY. [Optional, but provide if information is available].
VERNACULAR NAME. [Optional, but provide if information is available. Give name and
language].
USES. [Optional, but provide if information is available].
NOTES. [Include discussion of taxon here].
New combinations
Mapania micrococca (T. Koyama) D. A. Simpson, comb. nov. Type: Venezuela, Bolivar,
Steyermark & Dunsterville 92317 (holotype NY!; isotype VEN!).
Mapaniopsis micrococca T. Koyama, Jap. J. Bot. 20: 130 (1969). [All other reference
citations are formatted as shown in the examples below]
296
Taxa in revisions
6. Sclerochiton boivinii (Baill.) C. B. Clarke (1899: 110); [list further works in which the
taxon has been treated; use the same format]. Type: Kenya, Mombasa, Boivin s.n. (holotype
P; isotype K).
Pseudoblepharis boivinii Baill. (1890: 837); [further works in which this homotypic synonym
has been used; use the same format].
Pseudoblepharis heinsenii Lindau (1897: 320); [further works in which this heterotypic
synonym has been used; use the same format], synon. nov. Type: Tanzania, E Usambara
Mts, Nderema, Heinsen 4 (holotype B†; isotypes BR!, K).
Description in the order: general habit; underground parts; stem; leaves; inflorescences;
flowers (calyx, corolla, androecium, gynoecium); fruits; seeds. [Major headings are in
italics]. Fig. 4.
DISTRIBUTION. Kenya, Tanzania. Map 5.
[specimen listings either by country — if listing is complete — e.g.:]
SPECIMENS EXAMINED. KENYA. Kilifi Distr.: N of Giriama, Adu, Jan. 1937, Dale
3664 (FT, K); Kwale Distr.: Mwele Mdogo Forest, 6 Feb. 1953, Drummond & Hemsley 1143
(BR, FT, K) & Shimba Hills, Makadara Forest, 17 Sept. 1982, Polhill & Robertson 4795 (C,
K, P). TANZANIA. Lushoto Distr.: E Usambara Mts, Maramba, 18 Nov. 1936, Greenway
4748 (BR, FHO, K, S) & E Usambara Mts, Ndola, 17 Feb. 1954, Faulkner 1350 (BR, K, S).
HABITAT. Shrub layer in lowland and medium-altitude evergreen and semi-evergreen
forest, riverine forest; 0 – 1400 ( – 1500) m. [Note that the use of vernacular terms for
vegetation types is discouraged].
CONSERVATION STATUS [Use IUCN conservation ratings with some discussion to
justify the rating applied].
PHENOLOGY. [Optional, but provide if information is available].
ETYMOLOGY. [Optional, but provide if information is available].
VERNACULAR NAME. [Optional, but provide if information is available. Give name and
language].
USES. [Optional, but provide if information is available].
NOTES. [Include discussion of taxon here].
297
http://www.springer.com/journal/12225
298
http://www.botanica.org.br/acta/ojs
DIRETRIZES PARA AUTORES
A Acta Botanica Brasilica (Acta bot. bras.) publica
artigos originais, comunicações curtas e artigos de revisão,
estes últimos apenas a convite do Corpo Editorial. Os
artigos são publicados em Português, Espanhol e Inglês e
devem ser motivados por uma pergunta central que mostre
a originalidade e o potencial interesse dos mesmos aos
leitores nacionais e internacionais da Revista. A Revista
possui um espectro amplo, abrangendo todas as áreas da
Botânica. Os artigos submetidos à Acta bot.bras. devem
ser inéditos, sendo vedada a apresentação simultânea em
outro periódico.
Sumário do Processo de Submissão. Manuscritos deverão
ser submetidos por um dos autores, em português, inglês
ou espanhol. Para facilitar a rápida publicação e minimizar
os custos administrativos, a Acta Botanica Brasilica aceita
somente Submissões On-line. Não envie documentos
impressos pelo correio. O processo de submissão on-line
é compatível com os navegadores Internet Explorer versão
3.0 ou superior, Netscape Navigator e Mozilla Firefox.
Outros navegadores não foram testados.
O autor da submissão será o responsável pelo
manuscrito no envio eletrônico e por todo o acompanhamento do processo de avaliação.
Figuras e tabelas deverão ser organizadas em arquivos
que serão submetidos separadamente, como documentos
suplementares. Documentos suplementares de qualquer
outro tipo, como filmes, animações, ou arquivos de
dados originais, poderão ser submetidos como parte da
publicação.
Se você estiver usando o sistema de submissão on-line
pela primeira vez, vá para a página de ‘Cadastro’ e registrese, criando um ‘login’ e ‘senha’. Se você está realmente
registrado, mas esqueceu seus dados e não tem como
acessar o sistema, clique em ‘Esqueceu sua senha’.
O processo de submissão on-line é fácil e autoexplicativo. São apenas 5 (cinco) passos. Tutorial do
processo de submissão pode ser obtido em http://www.
botanica.org.br/ojs/public/tutorialautores.pdf. Se você
tiver problemas de acesso ao sistema, cadastro ou envio
de manuscrito (documentos principal e suplementares), por
favor, entre em contato com o nosso Suporte Técnico.
Custos de publicação. O artigo terá publicacão gratuita,
se pelo menos um dos autores do manuscrito for associado
da SBB, quite com o exercício correspondente ao ano de
publicação, e desde que o número de páginas impressas
(editadas em programa de editoração eletrônica) não
ultrapasse o limite máximo de 14 páginas (incluindo figuras
e tabelas). Para cada página excedente assim impressa, será
cobrado o valor de R$ 35,00. A critério do Corpo Editorial,
mediante entendimentos prévios, artigos mais extensos que
o limite poderão ser aceitos, sendo o excedente de páginas
impressas custeado pelo(s) autor(es). Aos autores nãoassociados ou associados em atraso com as anuidades, serão
cobrados os custos da publicação por página impressa (R$
35,00 por página), a serem pagos quando da solicitação
de leitura de prova editorada, para correção dos autores.
No caso de submissão de figuras coloridas, as despesas
de impressão a cores serão repassadas aos autores
(associados ou não-associados). Consulte o Editor-Chefe
para maiores detalhes.
Seguindo a política do Open Access do Public Knowledge
Project, assim que publicados, os autores receberão a URL
que dará acesso ao arquivo em formato Adobe® PDF
(Portable Document Format). Os autores não mais receberão
cópias impressas do seu manuscrito publicado.
Publicação e processo de avaliação. Durante o processo de
submissão, os autores deverão enviar uma carta de submissão
(como um documento suplementar), explicando o motivo
de publicar na Revista, a importância do seu trabalho para
o contexto de sua área e a relevância científica do mesmo.
Os manuscritos submetidos serão enviados para assessores,
a menos que não se enquadrem no escopo da Revista. Os
manuscritos serão sempre avaliados por dois especialistas
que terão a tarefa de fornecer um parecer, tão logo quanto
possível. Um terceiro assessor será consultado caso seja
necessário. Os assessores não serão obrigados a assinar os
seus relatórios de avaliação, mas serão convidados a fazê-lo.
O autor responsável pela submissão poderá acompanhar o
progresso de avaliação do seu manuscrito, a qualquer tempo,
desde que esteja logado no sistema da Revista.
Preparando os arquivos. Os textos do manuscrito deverão
ser formatados usando a fonte Times New Roman, tamanho
12, com espaçamento entre linhas 1,5 e numeração
contínua de linhas, desde a primeira página. Todas as
margens deverão ser ajustadas para 1,5 cm, com tamanho de
página de papel A4. Todas as páginas deverão ser numeradas
seqüencialmente.
O manuscrito deverá estar em formato Microsoft® Word
DOC. O documento deverá ser compatível com a versão
2002. Arquivos em formato RTF também serão aceitos.
Arquivos em formato Adobe® PDF não serão aceitos. O
documento principal não deverá incluir qualquer tipo
de figura ou tabela. Estas deverão ser submetidas como
documentos suplementares, separadamente.
O manuscrito submetido (documento principal,
acrescido de documentos suplementares, como figuras e
2
299
Acta Botanica Brasilica
tabelas), poderá conter até 25 páginas (equivalentes a 14
páginas impressas, editadas em programa de editoração
eletrônica). Assim, antes de submeter um manuscrito com
mais de 25 páginas, entre em contato com o Editor-Chefe.
Todos os manuscritos submetidos deverão ser subdivididos
nas seguintes seções:
1. DOCUMENTO PRINCIPAL
1.1. Primeira página. Deverá conter as seguintes
informações:
a) Título do manuscrito, conciso e informativo, com a
primeira letra em maiúsculo, sem abreviações. Nomes
próprios em maiúsculo. Citar nome científico completo.
b) Nome(s) do(s) autor(es) com iniciais em maiúsculo, com
números sobrescritos que indicarão, em rodapé, a afiliação
Institucional. Créditos de financiamentos deverão vir em
Agradecimentos, assim como vinculações do manuscrito
a programas de pesquisa mais amplos (não no rodapé).
Autores deverão fornecer os endereços completos, evitando
abreviações.
c) Autor para contato e respectivo e-mail. O autor
para contato será sempre aquele que submeteu o
manuscrito.
1.2. Segunda página. Deverá conter as seguintes
informações:
a) RESUMO: em maiúsculas e negrito. O texto deverá
ser corrido, sem referências bibliográficas, em um único
parágrafo. Deverá ser precedido pelo título do manuscrito
em Português, entre parênteses. Ao final do resumo, citar
até 5 (cinco) palavras-chave à escolha do(s) autor(es), em
ordem alfabética, não repetindo palavras do título.
b) ABSTRACT: em maiúsculas e negrito. O texto deverá
ser corrido, sem referências bibliográficas, em um único
parágrafo. Deverá ser precedido pelo título do manuscrito
em Inglês, entre parênteses. Ao final do abstract, citar até
5 (cinco) palavras-chave à escolha do(s) autor(es), em
ordem de alfabética.
Resumo e abstract deverão conter cerca de 200 (duzentas)
palavras, contendo a abordagem e o contexto da proposta
do estudo, resultados e conclusões.
1.3. Terceira página e subseqüentes. Os manuscritos
deverão estar estruturados em Introdução, Material e
métodos, Resultados e discussão, Agradecimentos e
Referências bibliográficas, seguidos de uma lista completa
das legendas das figuras e tabelas (se houver), lista das
figuras e tabelas (se houver) e descrição dos documentos
suplementares (se houver).
1.3.1. Introdução. Título com a primeira letra em maiúsculo,
em negrito, alinhado à esquerda. O texto deverá conter:
a) abordagem e contextualização do problema;
b) problemas científicos que levou(aram) o(s) autor(es) a
desenvolver o trabalho;
c) conhecimentos atuais no campo específico do assunto
tratado;
d) objetivos.
1.3.2. Material e métodos. Título com a primeira letra
em maiúsculo, em negrito, alinhado à esquerda. O texto
deverá conter descrições breves, suficientes à repetição do
trabalho. Técnicas já publicadas deverão ser apenas citadas
e não descritas. Indicar o nome da(s) espécie(s) completo,
inclusive com o autor. Mapas poderão ser incluídos (como
figuras na forma de documentos suplementares) se forem de
extrema relevância e deverão apresentar qualidade adequada
para impressão (ver recomendações para figuras). Todo e
qualquer comentário de um procedimento utilizado para a
análise de dados em Resultados deverá, obrigatoriamente,
estar descrito no ítem Material e métodos.
1.3.3. Resultados e discussão. Título com a primeira
letra em maiúsculo, em negrito, alinhado à esquerda.
Tabelas e figuras (gráficos, fotografias, desenhos, mapas e
pranchas), se citados, deverão ser estritamente necessários
à compreensão do texto. Não insira figuras ou tabelas
no texto. Os mesmos deverão ser enviados como
documentos suplementares. Dependendo da estrutura do
trabalho, Resultados e discussão poderão ser apresentados
em um mesmo item ou em itens separados.
1.3.4. Agradecimentos. Título com a primeira letra em
maiúsculo, em negrito, alinhado à esquerda. O texto
deverá ser sucinto. Nomes de pessoas e Instituições
deverão ser escritos por extenso, explicitando o motivo dos
agradecimentos.
1.3.5. Referências bibliográficas. Título com primeira
letra em maiúsculo, em negrito, alinhado à esquerda. Se a
referência bibliográfica for citada ao longo do texto, seguir
o esquema autor, ano (entre parênteses). Por exemplo: Silva
(1997), Silva & Santos (1997), Silva et al. (1997) ou Silva
(1993; 1995), Santos (1995; 1997) ou (Silva 1975; Santos
1996; Oliveira 1997). Na seção Referências bibliográficas,
seguir a ordem alfabética e cronológica de autor(es). Nomes
dos periódicos e títulos de livros deverão ser grafados
por extenso e em negrito.
Exemplos:
Santos, J.; Silva, A. & Oliveira, B. 1995. Notas palinológicas.
Amaranthaceae. Hoehnea 33(2): 38-45.
Santos, J. 1995. Estudos anatômicos em Juncaceae. Pp. 5-22.
In: Anais do XXVIII Congresso Nacional de Botânica.
Aracaju 1992. São Paulo, HUCITEC Ed. v.I.
Silva, A. & Santos, J. 1997. Rubiaceae. Pp. 27-55. In: F.C.
Hoehne (ed.). Flora Brasilica. São Paulo, Secretaria da
Agricultura do Estado de São Paulo.
Endress, P.K. 1994. Diversity and evolutionary biology
of tropical flowers. Oxford. Pergamon Press.
Furness, C.A.; Rudall, P.J. & Sampson, F.B. 2002.
Evolution of microsporogenesis in Angiosperms.
http://www.journals.uchicago.edu/IJPS/journal/issues/
v163n2/020022/020022.html (acesso em 03/01/2006).
Não serão aceitas referências bibliográficas de
monografias de conclusão de curso de graduação, de
citações de resumos de Congressos, Simpósios, Workshops
e assemelhados. Citações de Dissertações e Teses deverão
ser evitadas ao máximo e serão aceitas com justificativas
consistentes.
1.3.6. Legendas das figuras e tabelas. As legendas
deverão estar incluídas no fim do documento principal,
imediatamente após as Referências bibliográficas. Para cada
Diretrizes para autores
figura, deverão ser fornecidas as seguintes informações,
em ordem numérica crescente: número da figura, usando
algarismos arábicos (Figura 1, por exemplo; não abrevie);
legenda detalhada, com até 300 caracteres (incluindo
espaços). Legendas das figuras necessitam conter nomes
dos táxons com respectivos autores, informações da área
de estudo ou do grupo taxonômico.
Itens da tabela, que estejam abreviados, deverão ser
escritos por extenso na legenda. Todos os nomes dos gêneros
precisam estar por extenso nas legendas das tabelas.
Normas gerais para todo o texto. Palavras em latim no
título ou no texto, como por exemplo: in vivo, in vitro, in
loco, et al. deverão estar grafadas em itálico. Os nomes
científicos, incluindo os gêneros e categorias infragenéricas,
deverão estar em itálico. Citar nomes das espécies por
extenso, na primeira menção do parágrafo, acompanhados
de autor, na primeira menção no texto. Se houver uma
tabela geral das espécies citadas, o nome dos autores deverá
aparecer somente na tabela. Evitar notas de rodapé.
As siglas e abreviaturas, quando utilizadas pela
primeira vez, deverão ser precedidas do seu significado
por extenso. Ex.: Universidade Federal de Pernambuco
(UFPE); Microscopia Eletrônica de Varredura (MEV).
Usar abreviaturas das unidades de medida de acordo com o
Sistema Internacional de Medidas (por exemplo 11 cm, 2,4
μm). O número deverá ser separado da unidade, com exceção
de percentagem, graus, minutos e segundos de coordenadas
geográficas (90%, 17°46’17” S, por exemplo).
Para unidades compostas, usar o símbolo de cada unidade
individualmente, separado por um espaço apenas. Ex.: mg
kg-1, μmol m-2 s-1, mg L-1. Litro e suas subunidades
deverão ser grafados em maiúsculo. Ex.: L , mL, μL.
Quando vários números forem citados em seqüência, grafar
a unidade da medida apenas no último (Ex.: 20, 25, 30 e 35
°C). Escrever por extenso os números de zero a nove (não
os maiores), a menos que sejam acompanhados de unidade
de medida. Exemplo: quatro árvores; 10 árvores; 6,0 mm;
1,0-4,0 mm; 125 exsicatas.
Para normatização do uso de notações matemáticas,
obtenha o arquivo contendo as instruções específicas em
http://www.botanica.org.br/ojs/public/matematica.pdf.
O Equation, um acessório do Word, está programado
para obedecer as demais convenções matemáticas, como
espaçamentos entre sinais e elementos das expressões,
alinhamento das frações e outros. Assim, o uso desse
acessório é recomendado.
Em trabalhos taxonômicos, o material botânico
examinado deverá ser selecionado de maneira a citarem-se
apenas aqueles representativos do táxon em questão, na
seguinte ordem e obedecendo o tipo de fonte das letras:
PAÍS. Estado: Município, data, fenologia, coletor(es)
número do(s) coletor(es) (sigla do Herbário).
Exemplo:
BRASIL. São Paulo: Santo André, 3/XI/1997, fl. fr.,
Milanez 435 (SP).
No caso de mais de três coletores, citar o primeiro seguido
de et al. Ex.: Silva et al.
Chaves de identificação deverão ser, preferencialmente,
300
3
indentadas. Nomes de autores de táxons não deverão
aparecer. Os táxons da chave, se tratados no texto, deverão
ser numerados seguindo a ordem alfabética.
Exemplo:
1. Plantas terrestres
2. Folhas orbiculares, mais de 10 cm diâm. .....................
............................................................. 2. S. orbicularis
2. Folhas sagitadas, menos de 8 cm compr. .....................
................................................................ 4. S. sagittalis
1. Plantas aquáticas
3. Flores brancas ..................................... 1. S. albicans
3. Flores vermelhas ............................... 3. S. purpurea
O tratamento taxonômico no texto deverá reservar
o itálico e o negrito simultâneos apenas para os nomes
de táxons válidos. Basiônimo e sinonímia aparecerão
apenas em itálico. Autores de nomes científicos deverão
ser citados de forma abreviada, de acordo com o índice
taxonômico do grupo em pauta (Brummit & Powell 1992
para Fanerógamas).
Exemplo:
1. Sepulveda albicans L., Sp. pl. 2: 25. 1753.
Pertencia albicans Sw., Fl. bras. 4: 37, t. 23, f. 5. 1870.
Fig. 1-12
Subdivisões dentro de Material e métodos ou de
Resultados e/ou Discussão deverão ser grafadas com a
primeira letra em maísculo, seguida de um traço (-) e do
texto na mesma linha.
Exemplo: Área de estudo - localiza-se ...
2. DOCUMENTOS SUPLEMENTARES
2.1. Carta de submissão. Deverá ser enviada como um
arquivo separado. Use a carta de submissão para explicitar o
motivo da escolha da Acta Botanica Brasilica, a importância
do seu trabalho para o contexto de sua área e a relevância
científica do mesmo.
2.2. Figuras. Todas as figuras apresentadas deverão,
obrigatoriamente, ter chamada no texto. Todas as imagens
(ilustrações, fotografias, eletromicrografias e gráficos) são
consideradas como ‘figuras’. Figuras coloridas poderão
ser aceitas, a critério do Corpo Editorial, que deverá
ser previamente consultado. O(s) autor(es) deverão se
responsabilizar pelos custos de impressão.
Não envie figuras com legendas na base das mesmas. As
legendas deverão ser enviadas no final do documento
principal.
As figuras deverão ser referidas no texto com a primeira
letra em maiúsculo, de forma abreviada e sem plural (Fig.1,
por exemplo).
As figuras deverão ser numeradas seqüencialmente, com
algarismos arábicos, colocados no canto inferior direito. Na
editoração final, a largura máxima das figuras será de: 175
mm, para duas colunas, e de 82 mm, para uma coluna.
Cada figura deverá ser editada para minimizar as áreas
com espaços em branco, optimizando o tamanho final da
ilustração.
Escalas das figuras deverão ser fornecidas com os valores
4
301
Acta Botanica Brasilica
apropriados e deverão fazer parte da própria figura (inseridas
com o uso de um editor de imagens, como o Adobe®
Photoshop, por exemplo), sendo posicionadas no canto
inferior esquerdo, sempre que possível.
Ilustrações em preto e branco deverão ser fornecidas com
aproximadamente 300 dpi de resolução, em formato TIF.
Ilustrações mais detalhadas, como ilustrações botânicas
ou zoológicas, deverão ser fornecidas com resoluções de,
pelo menos, 600 dpi, em formato TIF. Para fotografias (em
preto e branco ou coloridas) e eletromicrografias, forneça
imagens em formato TIF, com pelo menos, 300 dpi (ou
600 dpi se as imagens forem uma mistura de fotografias e
ilustrações em preto e branco). Contudo, atenção! Como
na editoração final dos trabalhos, o tamanho útil destinado
a uma figura de largura de página (duas colunas) é de
170 mm, para uma resolução de 300 dpi, a largura das
figuras não deverá exceder os 2000 pixels. Para figuras de
uma coluna (82 mm de largura), a largura máxima das
figuras (para 300 dpi), não deverá exceder 970 pixels.
Não fornecer imagens em arquivos Microsoft®
PowerPoint, geralmente geradas com baixa resolução, nem
inseridas em arquivos DOC. Arquivos contendo imagens em
formato Adobe® PDF não serão aceitos. Figuras deverão
ser fornecidas como arquivos separados (documentos
suplementares), não incluídas no texto do trabalho.
As imagens que não contiverem cor deverão ser salvas
como ‘grayscale’, sem qualquer tipo de camada (‘layer’),
como as geradas no Adobe® Photoshop, por exemplo. Estes
arquivos ocupam até 10 vezes mais espaço que os arquivos
TIF e JPG. A Acta Botanica Brasilica não aceitará figuras
submetidas no formato GIF ou comprimidas em arquivos
do tipo RAR ou ZIP. Se as figuras no formato TIF forem um
obstáculo para os autores, por seu tamanho muito elevado,
estas poderão ser convertidas para o formato JPG, antes da
sua submissão, resultando em uma significativa redução
no tamanho. Entretanto, não se esqueça que a compressão
no formato JPG poderá causar prejuízos na qualidade das
imagens. Assim, é recomendado que os arquivos JPG sejam
salvos nas qualidades ‘Máxima’ (Maximum).
O tipo de fonte nos textos das figuras deverá ser o Times
New Roman. Textos deverão ser legíveis. Abreviaturas
nas figuras (sempre em minúsculas) deverão ser citadas
nas legendas e fazer parte da própria figura, inseridas com
o uso de um editor de imagens (Adobe® Photoshop, por
exemplo). Não use abreviaturas, escalas ou sinais (setas,
asteriscos), sobre as figuras, como “caixas de texto” do
Microsoft® Word.
Recomenda-se a criação de uma única estampa,
contendo várias figuras reunidas, numa largura máxima de
175 milímetros (duas colunas) e altura máxima de 235 mm
(página inteira). No caso de estampa, a letra indicadora
de cada figura deverá estar posicionada no canto inferior
direito. Inclua “A” e “B” para distingui-las, colocando na
legenda, Fig. 1A, Fig. 1B e assim por diante. Não use bordas
de qualquer tipo ao redor das figuras.
É responsabilidade dos autores obter permissão para
reproduzir figuras ou tabelas que tenham sido previamente
publicadas.
2.3. Tabelas. As tabelas deverão ser referidas no texto com
a primeira letra em maiúsculo, de forma abreviada e sem
plural (Tab. 1, por exemplo). Todas as tabelas apresentadas
deverão, obrigatoriamente, ter chamada no texto.
As tabelas deverão ser seqüencialmente numeradas, em
arábico (Tabela 1, 2, 3, etc; não abrevie), com numeração
independente das figuras. O título das tabelas deverá
estar acima das mesmas. Tabelas deverão ser formatadas
usando as ferramentas de criação de tabelas (‘Tabela’)
do Microsoft® Word. Colunas e linhas da tabela deverão
ser visíveis, optando-se por usar linhas pretas que serão
removidas no processo de edição final. Não utilize padrões,
tons de cinza, nem qualquer tipo de cor nas tabelas. Dados
mais extensos poderão ser enviados como documentos
suplementares, os quais estarão disponíveis como links para
consulta pelo público.
Mais detalhes poderão ser consultados nos últimos
números da Revista.

ORCHIDACEAE - ORCHIDOIDEAE

Transcription

Similar documents

Reserva Ecológica de Guapiaçú

Cirurgia Robótica

Perspectivas muito otimistas para 2014 >> Leia

(Aves, Cardinalidae) in the state of Pernambuco, Brazil

Brasil: Nova referência global em internet?

UNIT 1

professor de língua estrangeira moderna inglês

Manual do Aluno - Advocacia

O nome deles é trabalho

apogeo