Organotypic brain slice co-cultures of the dopaminergic

Transcription

Organotypic brain slice co-cultures
of the dopaminergic system -
A model for the identification of neuroregenerative
substances and cell populations
Der Fakultät für Biowissenschaften, Pharmazie und Psychologie
der Universität Leipzig
genehmigte
DISSERTATION
zur Erlangung des akademischen Grades
doctor rerum naturalium
Dr. rer. nat.
vorgelegt von
Dipl. Biochem. Katja Sygnecka, geb. Kohlmann
geboren am 23.12.1983 in Lutherstadt Wittenberg
Dekan: Prof. Dr. Erich Schröger
Gutachter: Prof. Dr. Andrea Robitzki
Prof. Dr. Bernd Heimrich
Verteidigung: Leipzig, den 23.10.2015
BIBLIOGRAPHY
Katja Sygnecka
Organotypic brain slice co‐cultures of the dopaminergic system – A model for the identification of neuroregenerative substances and cell populations Faculty of Biosciences, Pharmacy and Psychology
Leipzig University
Dissertation
89 pages, 130 references, 29 figures, and 3 tables
The development of new therapeutical approaches, devised to foster the regeneration of neuronal circuits after injury and/or in neurodegenerative diseases, is of great importance. The impairment of dopaminergic projections is especially severe, because these projections are involved in crucial brain functions such as motor control, reward and cognition. In the work presented here, organotypic brain slice co‐cultures of (a) the mesostriatal and (b) the mesocortical dopaminergic projection systems consisting of tissue sections of the ventral tegmental area/substantia nigra (VTA/SN), in combination with the target regions of (a) the striatum (STR) or (b) the prefrontal cortex (PFC), respectively, were used to evaluate different approaches to stimulate neurite outgrowth: (i) inhibition of cAMP/cGMP turnover with 3’,5’ cyclic nucleotide phosphodiesterase inhibitors (PDE‐
Is), (ii) blockade of calcium currents with nimodipine, and (iii) the co‐cultivation with bone marrow‐
derived mesenchymal stromal/stem cells (BM‐MSCs). The neurite growth‐promoting properties of the tested substances and cell populations were analyzed by neurite density quantification in the border region between the two brain slices, using biocytin tracing or tyrosine hydroxylase labeling and automated image processing procedures. In addition, toxicological tests and gene expression analyses were conducted. (i) PDE‐Is were applied to VTA/SN+STR rat co‐cultures. The quantification of neurite density after both biocytin tracing and tyrosine hydroxylase labeling revealed a growth promoting effect of the PDE2A‐Is BAY60‐7550 and ND7001. The application of the PDE10‐I MP‐10 did not alter neurite density in comparison to the vehicle control. (ii) The effects of nimodipine were evaluated in VTA/SN+PFC rat co‐cultures. A neurite growth‐
promoting effect of 0.1 µM and 1 µM nimodipine was demonstrated in a projection system of the CNS. In contrast, the application of 10 µM nimodipine did not alter neurite density, compared to the vehicle control, but induced the activation of the apoptosis marker caspase 3. The expression levels of the investigated genes, including Ca2+ binding proteins (Pvalb, S100b), immediate early genes (Arc, Egr1, Egr2, Egr4, Fos and JunB), glial fibrillary acidic protein, and myelin components (Mal, Mog, Plp1) were not significantly changed (with the exception of Egr4) by the treatment with 0.1 µM and 1 µM nimodipine. (iii) Bulk BM‐MSCs that were classically isolated by plastic adhesion were compared to the subpopulation Sca‐1+Lin‐CD45‐‐derived MSCs (SL45‐MSCs). The neurite growth‐promoting properties of both MSC populations were quantified in VTA/SN+PFC mouse co‐cultures. For this purpose, the MSCs were seeded on glass slides that were placed underneath the co‐cultures. A significantly enhanced neurite density within the co‐cultures was induced by both bulk BM‐MSCs and SL45‐MSCs. SL45‐MSCs increased neurite density to a higher degree. The characterization of both MSC populations revealed that the frequency of fibroblast colony forming units (CFU‐f ) is 105‐fold higher in SL45‐MSCs. SL45‐MSCs were morphologically more homogeneous and expressed higher levels of nestin, BDNF and FGF2 compared to bulk BM‐MSCs. Thus, this work emphasizes the vast potential for molecular targeting with respect to the development of therapeutic strategies in the enhancement of neurite regrowth. i Table of contents Abbreviations ....................................................................................................... 1 1. Introduction ............................................................................................... 2 1.1 The dopaminergic system ..................................................................................................... 2 1.2 Neurite regeneration following mechanical lesions of the CNS ........................................... 7 1.3 Organotypic brain slice co‐cultures ...................................................................................... 8 1.4 Promising substances and cells to enhance neuroregeneration ........................................ 10 1.5 The aim of the thesis .......................................................................................................... 14 2. The original research articles ..................................................................... 16 2.1 Phosphodiesterase 2 inhibitors promote axonal outgrowth in organotypic slice co‐
cultures ..................................................................................................................................... 17 2.2 Nimodipine enhances neurite outgrowth in dopaminergic brain slice co‐cultures ........... 35 2.3 Mesenchymal stem cells support neuronal fiber growth in an organotypic brain slice co‐
culture model ........................................................................................................................... 50 ...................................................................................................................................................... 3. References ................................................................................................ 66 Appendices ................................................................................................... 73 Summary ........................................................................................................................... 73 Zusammenfassung ............................................................................................................ 78 Curriculum Vitae ...................................................................................................................... 84 Track Record ............................................................................................................................ 85 Selbständigkeitserklärung ........................................................................................................ 87 Acknowledgments .................................................................................................................... 88 ii ABBREVIATIONS
Abbreviations BM bone marrow BM‐MSC bone marrow‐derived mesenchymal stromal/stem cell cAMP adenosine 3’,5’ cyclic monophosphate CD cluster of differentiation CFU‐f fibroblast colony forming units cGMP guanosine 3’,5’ cyclic monophosphate CNS central nervous system DA dopamine DHP dihydropyridine Fig. figure GABA ɣ‐aminobutyric acid GFAP glial fibrillary acidic protein LDH lactate dehydrogenase MAP2 microtubule‐associated protein 2 MSC mesenchymal stromal/stem cell NGF nerve growth factor P postnatal day PDE 3’,5’‐cyclic‐nucleotide phosphodiesterase PDE‐I 3’,5’‐cyclic‐nucleotide phosphodiesterase inhibitor PFC prefrontal cortex PI propidium iodide qPCR quantitative real time reverse transcription polymerase chain reaction SL45‐MSC Sca‐1+Lin‐CD45‐‐derived mesenchymal stromal/stem cell SN substantia nigra SNc substantia nigra pars compacta STR striatum TH tyrosine hydroxylase VM ventral mesencephalon VTA ventral tegmental area 1
INTRODUCTION - The dopaminergic system
1. Introduction Axonal projections can get lost as a consequence of (i) brain injury (e.g. traumatic brain injury), (ii) the occurrence of cell death in neurodegenerative diseases, such as Parkinson’s disease, and (iii) the malformation of neuronal processes during development. The loss of these projections results in the impairment of the basic organization of neuronal circuits. To date, there are no adequate therapy strategies available that would lead to the complete regeneration of these neuronal circuits after injury or with the onset of neurodegenerative diseases. Of special interest is the loss or impairment of dopaminergic projections, because they play important roles in the regulation of physiological and psychological functions in the central nervous system (CNS). The dysfunctions that occur within these projections are pathophysiological features of Parkinson’s disease, depression, and schizophrenia. The recent and detailed studies of the anatomy of dopaminergic projections, as well as its specific physiological functions, and the growing knowledge around the pathophysiology of the above mentioned disorders have been of great benefit to the development of effective therapy strategies. However, the current therapeutic options are still insufficient. Taking into account the considerable consequences of disturbances of dopaminergic neuronal projections and regrowth failures after injury and/or in neurodegenerative diseases, there is a strong need for experimental models, in which these projections are reproduced. These experimental models would attempt to accelerate development, as well as the characterization and the selection of effective neurite outgrowth‐promoting substances. Organotypic brain slice co‐cultures that reconstruct dopaminergic projections could be such an experimental model. To fully understand the scale of the problem, there will be an introduction into the anatomy and the (patho)physiological characteristics of the dopaminergic projection system, as well as into general mechanisms of neurite regeneration. Next, the history and principles of dopaminergic organotypic co‐cultures will be looked at. Finally, the particular substances and cells that have been characterized with regard to their (neuroregenerative) effects in organotypic brain slice co‐cultures will be introduced. 1.1 The dopaminergic system The catecholamine dopamine (DA, Fig. 1A) is a neuromodulator that is involved in the regulation of the diverse functions of the CNS. Among these functions are motor control, reward and cognition. The five DA receptors (D1‐D5) that have been described so far belong to the family of seven transmembrane domain G‐protein coupled receptors (Fig. 1B). The DA receptors are divided into two subfamilies: the D1‐like (D1, D5) and the D2‐like (D2, D3, D4) DA receptors (1). While the former 2
interact with a stimulatory Gs‐protein, the stimulation of the latter leads to the activation of inhibitory Gi‐proteins as reviewed in more detail in (2). This means that the DA can be an activating or an inhibitory neurotransmitter, depending on the DA receptor subtype. The main influences on subsequent signaling events are indicated in Fig. 1C. Fig. 1(A) The catecholamine neurotransmitter dopamine (DA). (B) The structure of the DA receptor (D1‐
subtype). Seven transmembrane helices are indicated (1‐7). Potential phosphorylation sites are represented on the intracellular loop and the intracellular COOH‐terminal tail. Potential glycosylation sites are indicated on the extracellular NH2 tail. (C) Intracellular events, following the stimulation of D1‐like and D2‐like DA receptors, respectively. AC ‐ adenylate cyclase. (B,C) are adopted from (3). 1.1.1 The anatomy of dopaminergic projections Using the brain of a rat, groups of dopaminergic and other catecholaminergic neurons were mapped out and grouped together as A1‐17. This was carried out with the formaldehyde histofluorescence method (4,5). Ninety percent of all brain DA neurons are located in the ventral mesencephalon (VM) and belong to the cell groups A8 (retrorubal area), A9 (substantia nigra (SN) pars compacta(c)) and A10 (ventral tegmental area, VTA) (6–9). These cell groups give rise to important projections to the forebrain with a topography organized in three planes: dorso‐ventral, medial‐lateral and anterior‐
posterior (10). Among them, the three main pathways are the mesostriatal (also termed nigrostriatal), mesocortical and mesolimbic dopaminergic pathways (11) (Fig. 2). The mesolimbic DA pathway is involved in reward and emotions and is comprised of dopaminergic projections from the ventral portions of the SNc and the VTA to the limbic forebrain (including e.g. nucleus accumbens, 3
amygdala and piriform cortex). As they are quite relevant for the work presented here, the mesostriatal and the mesocortical projections are described in more detail below. Fig. 2(A) Scheme of dopaminergic projections in a rodent’s brain arising in the ventral tegmental area/substantia nigra‐complex (VTA/SN). It was not attempted to distinguish VTA and SN, because of retrograde labeling studies, which indicated that both the striatum and the cerebral cortex are innervated by dopaminergic projections originating in both VTA and SN (12,13). The mesocortical pathway (innervating e.g. the anterior cingulate cortex, ACg; and the prefrontal cortex, PFC), the mesolimbic pathway (innervating e.g. the amygdala, Amg; the nucleus accumbens, NAc; and the olfactory tubercle, OTb) and the mesostriatal pathway (innervating the striatum, STR) are indicated with arrows. Another target region of mesencephalic dopaminergic projections is the hippocampus, Hip. Regions that are relevant for the here presented work are highlighted with bold letters. (B) Coronal section of the ventral mesencephalon at the midrostral level of VTA/SN indicating the localization of VTA, SN pars compacta (SNc) and SN pars reticulata (SNr). (C‐E) Location of dopaminergic neurons of the VTA/SN projecting to (C) the PFC and ACg, (D) the STR and (E) the NAc. (A) adapted from (14); (B‐E) adapted from (9,15) 4
1.1.1.1 Mesostriatal Projections The mesostriatal pathway arises from the ventral and intermediate sheets of the SNc and the ventrolateral VTA and projects to the dorsal striatum (STR), which contains caudate and putamen (9). This pathway is important for motor planning and the execution of movement (11). Moreover, it seems to be involved in non‐motor functions, such as cognition (16). dopaminergic fibers of this particular projection have been shown to innervate patch structures within the patch‐matrix organization of the STR. The striatal "patch" compartment is identified by substance P‐like or leu‐enkephalin‐like immunoreactivity (17). Cortical and thalamic afferents, as well as the efferent targets (SNc and SN pars reticulata) of the two compartments are distinct, suggesting that patch and matrix are segregated, parallel input‐output systems (12). In the STR, ɣ‐aminobutyric acid (GABA)ergic medium spiny neurons are the most prevalent cell type, representing 95% of all striatal neurons (18). The major targets for the dopaminergic innervation are the dendritic shafts and spines of these medium spiny neurons, on which dopaminergic afferents form symmetric synapses (19). There is ultrastructural evidence that striatal cell types such as large aspiny cholinergic interneurons are targets of a few other TH‐immunoreactive boutons (20). The neuronal processes originating from the ventral tier of the SNc and projecting to the striatal patches have a diameter of 0.2‐0.6 µm and frequent varicosities (0.4‐1.0 µM), giving them a crinkled appearance (12). Additionally, they have been shown to be negative for the 28kDa calcium binding protein (now referred to as calbindin‐
D28k), in contrast to those innervating matrix structures of the STR (21). The STR is the major input structure of the basal ganglia, receiving projections from the cerebral cortex, the brainstem, and the thalamus. Among the projections from the brainstem are the mesostriatal projections that modulate two distinct pathways within the complex basal ganglia circuits: the direct and the indirect pathway. Dopaminergic projections from the SNc activate the direct pathway through the activation of DA receptors of the D1‐type. In contrast, the indirect pathway is inhibited by the activation of inhibitory D2 receptors. The balance between the direct and indirect pathway is believed to be important for normal motor function (22). 1.1.1.2 Mesocortical Projections The mesocortical projections arise in the dorsal tier of SNc and VTA and project to the anterior cingulate cortex, the entorhinal cortex, perirhinal cortex and the PFC (23,24). These pathways play a prominent role in concentration and the executive functions, such as the working memory (16,25,26). 5
Only 33% of all PFC projections originating in the VTA are dopaminergic (27). There is evidence to suggest that most of the other neurons projecting from the VTA to the PFC are GABAergic (28–30). In addition to these two well‐recognized pathways, parallel glutamate‐only and glutamate‐DA pathways from the VTA to the PFC exist, as established by recent findings (31). The neurons in the PFC, which receive the dopaminergic inputs, are mainly pyramidal cells in the deeper layers (V,VI) of the PFC (32,33). They conduct excitatory signals to, for example, the VTA by mainly using the neurotransmitter glutamate. Additionally, DA receptors have been described on inhibitory cortical interneurons, which use GABA as a neurotransmitter (34). In contrast to the pyramidal cells, cortical interneurons do not conduct signals outside the cortical region (33,35,36). 1.1.2 The (patho)physiology of dopaminergic projections The afferents of the dopaminergic cell bodies of the VM innervate the STR, the cortical and limbic regions. These projections are involved in the regulation of crucial brain functions such as the motor function, emotions and cognitive control. Thus, the impairment of the dopaminergic neurocircuits is a common feature of neurological and psychiatric diseases: Parkinson’s disease. The degeneration of dopaminergic neurons in the SNc entails a reduction of dopaminergic projections to the dorsal STR, which leads to the dysregulation of the basal ganglia motor circuit. The cardinal motor symptoms of Parkinson’s disease ‐ tremor, rigidity and akinesia ‐ highlight the importance of DA projections for movement control (22,37,38). Depression. Disturbances in neurotransmission are believed to present the molecular basis of depression. Among them is the deficiency of the mesolimbic DA transmission that results in (i) reduced DA levels in the ventral STR, including the nucleus accumbens, and (ii) the dysfunction of the closely connected reward system. These particular disturbances are expected to cause anhedonia, a frequent symptom of depression (16,39). Moreover, lower extracellular DA in the dorsal STR has been associated with motor retardation in major depression disorder (40). New approaches targeting the dopaminergic system are of high interest, considering the current lack of therapy options that could reverse these effects. Schizophrenia. Much evidence suggests that schizophrenia is a neurodevelopmental disorder with genetic and environmental factors, which can cumulatively lead to different developmental trajectories (41). The reduced elaboration of inhibitory interneuron activity, and the exceeded pruning of the excitatory pathways cause an imbalance in the inhibitory and excitatory pathways in the PFC (42). The impairment of DA transmission in the PFC is associated with deficits in working memory ‐a core dysfunction in schizophrenia (25,26). Additionally, deficient DA function results in the hypostimulation of D1 receptors in the PFC. It has been suggested that this reduced stimulation 6
INTRODUCTION - Neurite regeneration
can play a role in the development of the “negative” symptoms and cognitive impairments of the disease (43). It is of great importance to find therapeutic strategies to overcome the loss of dopaminergic projections or dysregulations of DA transmission in the described diseases. New approaches have to be developed and evaluated with the aim of enhancing the outgrowth of neuronal processes within the projection systems. 1.2 Neurite regeneration following mechanical lesions of the CNS Following brain injury, membrane resealing at the transection site of the severed axons is the first prerequisite for survival of the neuron. Another requirement for regeneration after mechanical lesions is the growth cone formation and extension. It has been demonstrated that high calcium influx leads to membrane resealing (44). In contrast, growth cone formation and axon elongation necessitate optimal calcium levels that are reached by cytoplasmic calcium homeostasis mechanisms, as reviewed by (45). Compared to the peripheral nervous system or to neurite growth during development, regenerative capacities of mammalian adult CNS neurons are limited. The regrowth of injured axons in the mature CNS is inhibited by extrinsic and intrinsic mechanisms. Extracellular growth‐inhibitory mechanisms include (i) repellent guidance cues that are important during development and upregulated following injury, for example ephrins and their receptors (46–48). Additionally, (ii) myelin proteins like Nogo‐A, myelin‐associated glycoprotein (MAG) and oligodendrocyte myelin glycoprotein (OMgp) present growth‐inhibitory factors. Furthermore, (iii) the glial scar impedes the regrowth of severed axons. It consists of activated astrocytes and the secreted extracellular matrix components, e.g. chondroitin sulfate proteoglycan, (as reviewed in more detail by (49,50)). A therapeutic approach to overcome this non‐permissive environment is the neutralization of growth‐inhibitory factors like Nogo‐A with specific antibodies (51–53), and the enzymatic digestion of chondroitin sulfate proteoglycan by chondroitinase ABC (53,54). Despite these extrinsic factors that impede axon regrowth, spontaneous axon regeneration has been observed under certain circumstances (55,56) as reviewed in (57). These observations suggest that there must be intrinsic mechanisms that enable the regenerating axon to overcome the inhibitory environment, which is created by the above mentioned factors. Examples of the intrinsic mechanisms, which lead to growth cone formation and extension, are the activation of gene expression, local protein synthesis and microtubule assembly (57). These processes are regulated by intracellular signaling pathways including the MAPK/ERK pathway and the PI3K/Akt pathway. These pathways interact with each other and with other signaling cascades in a complex manner that 7
INTRODUCTION - Organotypic brain slice co-cultures
additionally differs between distinct neuronal cell types {Cui 2006 #213}{Heine 2015 #123}. Within this complex signaling network, the second messenger adenosine 3’,5’ cyclic monophosphate (cAMP) seems to be a key player, because it appears to interact with the above‐mentioned and other signaling pathways (58). Elevated intracellular cAMP levels have been shown to enable regenerating axons to overcome the growth‐inhibitory action of MAG (59,60). A therapeutic approach to enhance the intrinsic regeneration‐promoting processes could be the application of neurotrophic factors, e.g. NGF and BDNF that activate the respective signal transduction pathways, as well as the elevation of intracellular cAMP concentrations and subsequent activation of gene expression (58). 1.3 Organotypic brain slice co‐cultures Organotypic brain slice co‐cultures present an experimental model that provides some important advantages, in contrast to single‐cell culture or in vivo models. The complex cytoarchitecture of the brain tissue is preserved within these models. For example, Snyder‐Keller et al. demonstrated that the complex striatal matrix‐patch organization can be found in striatal slice cultures after ex vivo‐
cultivation and, to an even greater extent, in mesostriatal co‐cultures (VM+STR) (61). Moreover, within co‐cultures that reconstruct projection systems, the specific innervation of target regions corresponds to the in vivo situation. This has been shown by applying tracing methods, e.g. biocytin tracing (62), immunohistochemical stainings (63–65) and electrophysiological measurements (66,67). Additionally, organotypic (co‐)cultures provide good experimental access to the sample material, as well as precise control over the extracellular environment. The ex vivo cultivation and the characterization of explants of the VM can be traced back to the 1970s (68,69). In the first study of co‐cultures, tissue explants of the midbrain and the STR (caudate nucleus), derived from the brains of newborn dogs, were combined (70). In this study, the outgrowth of catecholamine containing fibers from the midbrain portion into the striatal slice was observed. This target‐oriented fiber growth, with plexiform nerve terminals in the STR, was confirmed in mesostriatal rat co‐cultures (63). The combination of VM slices with slices of (a) STR, (b) hippocampus or (c) cerebellum clearly demonstrated that the ex vivo observed target‐oriented neurite outgrowth correlates with the projections, which are built in vivo during the development. While there was significant ingrowth into STR, which represents a major target of mesencephalic dopaminergic neurons, only a few neurites grew into the hippocampal slice, a minor target region. No ingrowth of dopaminergic fibers was observed in co‐cultures with the cerebellum, a non‐target region for mesencephalic DA neurons (64). These findings were confirmed in a later study working with triple cultures containing (a) cerebral cortex+SN+STR or (b) cerebral cortex+VTA+STR, respectively (71). This study further demonstrated the specific innervation of (a) the STR by 8
INTRODUCTION - Organotypic brain slice co-cultures
dopaminergic neurons from the SN and (b) the ingrowth into the cortex by DA neurons originating in the VTA. It should also be noted that the capacity to innervate the respective target regions is dependent on the age of the donor of the VM tissue explants: The innervation of the striatal tissue by dopaminergic cells of VM explants prepared from newborn rats (P0) is more intensive than those of P7‐derived VM explants (72). Furthermore, the importance of the striatal tissue donor’s age in nigrostriatal co‐
cultures has been demonstrated: dopaminergic fibers originating from the VM are only attracted to the STR at late embryonic (i.e. E19+) and early postnatal stages (i.e. <P4) (64,73). Triple cultures of the VM, the STR and a cortical part, revealed a rather moderate innervation of the cortex, when compared to the STR (66,71). Two principle cultivation techniques have become prevalent in recent decades and both methods consider the major requirements of organotypic cultivation. The necessary conditions are as follows: sufficient oxygenation, stable attachment to a substrate, and an appropriate culture medium (74). (i) The roller tube technique has been proven to allow the organotypic growth of neuronal tissue explants (75,76). However, there is a non‐physiological flattening to quasi‐monolayers, which is preferable when optimal optical conditions are required (74). (ii) If the maintenance of the semi‐
three‐dimensional structure is desired, the membrane interface technique would be the preferred method of choice (77). Modifications of the interface method have been mostly utilized in more recent studies (78). A preparation scheme of mesocortical and mesostriatal co‐cultures, which were used in the work presented here, is shown in Fig. 3 9
INTRODUCTION - Tested compounds and cell populations
Fig. 3 Illustration of the preparation of mesocortical (left) or mesostriatal (right) co‐cultures. (A) Dorsal view on a neonatal rat brain. The regions containing ventral tegmental area/substantia nigra (VTA/SN) and the prefrontal cortex (PFC) are highlighted in dark and bright red, respectively. The region containing the striatum (STR) is highlighted in blue. (B) Coronal sections of the rat brain. Additional cuts are indicated by dashed lines to isolate PFC (*), VTA/SN (#) and the STR (*), respectively. (C) Coronal sections were placed side by side on membrane inserts as co‐cultures. During the ex vivo cultivation, co‐cultures were treated with nimodipine or MSC populations (VTA/SN+PFC) or with different PDE‐Is (VTA/SN+STR), respectively. (A,B) adapted from (79). 1.4 Promising substances and cells to enhance neuroregeneration As discussed above (see section 1.2), the regrowth of neurites after mechanical lesions is a very complex process. Many intrinsic and extrinsic factors influence the regrowth capacities of injured neurites. These factors provide a wide range of molecular targets for therapeutical approaches to enhance intrinsic regrowth mechanisms. In the following, substance candidates and cells with potential neuroregenerative properties that influence intracellular signaling, calcium currents or the extracellular microenvironment by the secretion of e.g. growth factors, will be presented. 1.4.1 Phosphodiesterase inhibitors 3’,5’‐cyclic‐nucleotide phosphodiesterases (PDEs, EC 3.1.4.17) are enzymes that hydrolyze the 3’ cyclic phosphate bond of the second messenger molecules cAMP and/or guanosine 3’, 5’ cyclic monophosphate (cGMP, the chemical structures of both molecules are presented in Fig. 1 of the original article, p. 29). These enzymes, therefore, regulate intracellular cell signaling. The superfamily of PDEs comprises of at least 21 genes/isoforms that are subdivided into 11 families (80,81). These PDE families differ in their substrate specificity, their kinetic and regulatory properties and their distribution in tissues and cells. The activity of PDEs is regulated (i) by their expression level 10
in the cell, (ii) by their posttranslational modifications (e.g. phosphorylation/dephosphorylation) and (iii) by their allosteric regulators, such as cAMP, cGMP and Ca2+/calmodulin. Early after the discovery of PDE activity, the nonselective inhibitors caffeine and theophylline, both methylxanthines, were found (82,83). These early PDE‐inhibitors (PDE‐Is) were used as therapeutic agents, e.g. for the treatment of airway diseases due to their bronchodilating clinical efficacy. However, their therapeutic index is narrow, because of the inhibition of nearly all PDEs in all tissues. More recently developed PDE‐Is target specific PDE isoforms (84). In the study presented here, we focused on two PDE families: PDE2 and PDE10. As there is only one gene/isoform belonging to each of these two families ‐PDE2A and PDE10A, respectively‐ I will refer to them as PDE2 and PDE10 in the following description. Both isoforms are dual substrate enzymes, being capable of the hydrolysis of both cAMP and cGMP. Another common feature is the N‐terminal GAF domain. In the case of PDE2, the binding of the allosteric factor cGMP to this domain activates the enzyme. Thus, PDE2 activity requires elevated cGMP concentrations to be functionally significant (85). PDE2 has been detected in the brain in unique neuronal populations. Its activity has, for example, been shown in striatal cells (86). It regulates cGMP levels in neurons, and is believed to be involved in long‐term memory (81). BAY60‐7550 is one example of potent and highly selective PDE2‐Is. It was shown in an in vivo mouse model that treatment with this PDE‐I enhances memory and learning by enhancing synaptic plasticity (87). PDE10 is highly expressed in the STR of the rodent brain (88). Thus, its involvement in the modulation of striatonigral and striatopallidal pathways has been suggested (89). Within the STR, PDE10 is expressed in medium spiny neurons, where it is supposed to regulate the metabolism of both cAMP and cGMP (89). The selective inhibition of PDE10 is discussed as a possibility to treat psychosis, because studies have demonstrated its efficacy in behavioral models predictive of antipsychotic activity (90). Moreover, with regard to the corticostriatal projections, PDE10‐Is could improve some of the cognitive symptoms of schizophrenia by increasing the activity of the GABAergic striatal medium spiny neurons (91). An effect on neurite outgrowth in the dopaminergic mesostriatal projection system by PDE2‐Is and PDE10‐Is has not been investigated, so far. 1.4.2 Nimodipine Nimodipine (isopropyl‐(2‐methoxyethyl)‐1,4‐dihydro‐2,6‐dimethyl‐4‐(3‐nitrophenyl)‐3,5‐pyridinedi‐
carboxylate, Bay e 9736, Fig. 4) is a dihydropyridine (DHP) derivative that has been found to selectively block the slow calcium currents (92) by specifically binding to L‐type voltage gated calcium channels. Nimodipine and other DHP derivatives block the calcium current by specifically binding to the α1 subunit of the channel protein (93). 11
Fig. 4 The dihydropyridine (DHP) derivate nimodipine. The DHP core is highlighted with bold lines and letters. Nimodipine is a highly lipophilic molecule. Thus, it can pass the blood brain barrier, resulting in a high distribution volume in the brain. However, when using it as a therapeutic agent, low oral bioavailability, short half‐life and high protein binding have to be considered (94). Nimodipine’s low adverse effect profile has been confirmed in numerous clinical trials and is advantageous for the clinical application of the substance (95–97). In the early eighties nimodipine was regarded as a vasodilatory agent with a preferential effect on cerebral vessels (98–100). Therefore, it has since been considered as an agent to counteract pathophysiological situations that are caused by insufficient blood supply to the brain. In addition to nimodipine’s dilatory effects on cerebral microvessels, a protective effect on nervous tissue, exerted by the modulation of metabolic processes, has been assumed (101). Later on in the eighties, direct neuronal effects were discussed and the application of nimodipine in epileptic seizures or withdrawal syndromes has since been pondered (102,103). Additionally, a preventive treatment of migraine was suggested (104,105). However, the clinical application of nimodipine was mainly related to its beneficial effects when applied after subarachnoid hemorrhage. In this clinical situation, nimodipine reduces the deleterious effects of related delayed cerebral vasospasm (106). Nevertheless, later research discovered other fields of application. Experimental studies in animal models demonstrated the neuroregenerative effects of nimodipine after mechanical peripheral nerve injury (107,108). Moreover, clinical studies have demonstrated improved nerve function after vestibular schwannoma surgery, especially when nimodipine was applied intravenously before, during and after the surgery (109). The studies described above investigated the effects of nimodipine treatment on neurite growth in the peripheral nervous system. Thus, a neurite growth‐promoting effect of nimodipine in experimental models of CNS projection systems remains to be elucidated. 1.4.3 MSC‐derived cell populations Mesenchymal stromal/stem cells (MSCs) have been intensively investigated as promising candidates for cell therapies in regenerative medicine. Currently, clinical trials are ongoing, applying bone 12
marrow (BM)‐derived MSCs to treat a variety of disorders: neurodegenerative disorders such as multiple sclerosis and Parkinson’s disease, disorders of the locomotor system, like osteoarthritis and injury of the articular cartilage, and others, e.g. acute respiratory distress symptoms, chronic and ischemic stroke, liver failure and spinal cord injury (http://www.clinicaltrials.gov/ 2015‐03‐03). In addition to the BM, MSCs have been isolated from nearly every adult tissue (as reviewed by (110)), mainly due to their presence in the perivascular region (111,112). However, the main sources of MSCs are adult BM (113,114), adipose tissue (115), and umbilical cord blood (116). MSCs are classically characterized by their ability to adhere to plastic surfaces and to undergo sustained proliferation. Their trilineage differentiation capacity into adipocytes, chondrocytes and osteoblasts in vitro has been first described by Pittenger (117) and became an important criterion for the definition of MSCs (118). Moreover, for human MSCs, cell surface expression of cluster of differentiation (CD)73, CD90 and CD105 as well as the absence of hematopoietic lineage markers such as CD11b, CD14, CD19 or CD34, CD45 or CD79 are required, to refer to the cells as MSCs (118). The characteristics for murine MSCs overlap partly with those described for human MSCs, but are generally less well defined (119). With regard to the development of new strategies for the treatment of neurological and neurodegenerative disorders, (i) it was assumed that MSCs would replace lost cells in the damaged tissue. In addition to their trilineage potential, the transdifferentiation into cells of other lineages, such as neurons, has been described in several studies (e.g. (120,121)). However, the experimental approach to characterize the neuronal phenotype, varies between the different laboratories and the validity of the results is controversial (as discussed by (122)). (ii) Immunomodulatory mechanisms have been described. MSCs limit stress response/inflammation and apoptosis following injury (123–
125). (iii) The capacity of MSCs to produce and secrete neurotrophic factors and, in addition, to induce growth factor secretion in host cells can be another powerful mechanism, creating a microenvironment around a lesion site that fosters the regeneration and repair of the damaged tissue, as it has been shown in preclinical studies (125–127). These paracrine effects are thought to contribute more significantly to the broad therapeutic efficacy of MSCs, as opposed to their plasticity, in achieving tissue repair. However, the composition of the secreted cytokines and growth factors varies significantly between different MSC preparations, because the proportions of the respective subpopulations of the intrinsically heterogeneous MSCs and their biological activity strongly depend on isolation and cultivation protocols (128). As a consequence, the effect of applied MSCs in the context of clinical application is hardly predictable. Some recent advances in experimentation allowed for attempts to isolate defined homogeneous MSC subpopulations. Thus, specific surface markers, in addition to the ones mentioned above, have been identified. Kucia et al. described a multiparameter sorting 13
INTRODUCTION - The aim of the thesis
method, yielding a homogeneous murine BM‐derived cell population that expresses the stem cell antigen‐1 (Sca‐1) and is hematopoietic lineage‐depleted and CD45‐negative (Sca‐1+Lin‐CD45‐). These cells expressed the pluripotency markers SSEA‐1, Oct‐4, Nanog and Rex‐1 (129). Therefore, and because of their small size, the group termed them “very small embryonic‐like (VSEL) cells”. However, the pluripotency has not yet been rigorously proven (130). In another study, the surface markers, platelet‐derived growth factor receptor‐ߙ (PDGFR‐ߙ), and Sca‐1 were described as suitable for the isolation of a homogeneous cell population from murine BM that fulfills MSC criteria (111). The potential to enhance neurite outgrowth of the described subpopulations has not been compared to the growth‐promoting potential of bulk BM‐MSCs, yet. 1.5 The aim of the thesis As pointed out above, there is a need for the development of new therapeutic options to treat the consequences of axon (re)growth failures, especially within dopaminergic projections. Utilizing organotypic brain slice co‐cultures of the mesostriatal and the mesocortical projection systems, it was intended to evaluate different approaches that could help to enhance neuronal fiber growth: (i) Selective PDE‐Is, which interfere with intracellular second messenger turnover In particular, the specific inhibitors of PDE2 (BAY60‐7550, ND7001) and PDE10 (MP‐10) are of interest in the study presented here. (ii) Nimodipine, an inhibitor of transmembrane calcium currents The effects of the treatment with different concentrations of nimodipine (0.1 µM‐10 µM) were compared. (iii) Mesenchymal stromal/stem cells (MSCs), whose therapeutic potential is supposed to be based i.a. on the secretion of growth factors, which act extracellularly on the respective receptors In the work presented here, the neurite outgrowth‐enhancing potential of the prospectively isolated (Sca‐1+Lin‐CD45‐) murine MSC subpopulation that we name “SL45‐MSC” was compared to murine bulk BM‐MSC, classically isolated through plastic adhesion. Being already an established model for the analysis of the neurite growth‐promoting properties of pharmacological compounds, dopaminergic brain slice co‐cultures were applied to characterize substances and cells with regard to their: (a) neurite outgrowth‐promoting effect within DA projection systems, (b) possible toxic properties, (c) potential influence on gene expression. The work program is summarized in Fig. 5. 14
INTRODUCTION - The aim of the thesis
Fig. 5 Work program. (A) The treatment of each study is indicated. (B) The projection systems that have been used for the respective study are represented as schemes. As indicated in the left and middle panel, PDE‐Is and nimodipine have been applied to the medium. The MSCs are plated on glass slides that were placed underneath the membrane inserts (right panel). In (C), the main analyses that have been conducted during or after the cultivation are specified. Neurite outgrowth was quantified in all studies. 15
RESEARCH ARTICLES
2. The original research articles In the following, the original research articles that have been published in peer reviewed journals are presented. Reprints were made by kind permission of the publishers: 
“Phosphodiesterase 2 inhibitors promote axonal outgrowth in organotypic slice co‐cultures.” (published in Neurosignals by S. Karger AG) 
“Nimodipine enhances neurite outgrowth in dopaminergic brain slice co‐cultures.” (published in International journal of developmental neuroscience by Elsevier Ltd.) 
“Mesenchymal Stem Cells Support Neuronal Fiber Growth in an Organotypic Brain Slice Co‐
culture Model.” (published in Stem cells and development by Mary Ann Liebert Inc. Publishers)
16
RESEARCH ARTICLES - Phosphodiesterase Inhibitors (PDE-Is)
Original Paper
Received: November 3, 2011
Accepted after revision: February 29, 2012
Published online: August 31, 2012
Neurosignals
DOI: 10.1159/000338020
Phosphodiesterase 2 Inhibitors Promote
Axonal Outgrowth in Organotypic Slice
Co-Cultures
C. Heine a, b K. Sygnecka a, b N. Scherf c, d A. Berndt e U. Egerland e T. Hage e
H. Franke b
a
Translational Centre for Regenerative Medicine (TRM), b Rudolf Boehm Institute of Pharmacology and Toxicology,
and c Interdisciplinary Centre for Bioinformatics, University of Leipzig, Leipzig, d Institute for Medical Informatics
and Biometry, Dresden University of Technology, Dresden, and e biocrea, Radebeul, Germany
Key Words
Axonal outgrowth ⴢ Biocytin ⴢ Development ⴢ
Dopaminergic system ⴢ Organotypic slice co-culture ⴢ
Phosphodiesterase ⴢ Regeneration ⴢ Repair ⴢ Tracing ⴢ
Tyrosine hydroxylase
Abstract
The development of appropriate models assessing the potential of substances for regeneration of neuronal circuits is
of great importance. Here, we present procedures to analyze
effects of substances on fiber outgrowth based on organotypic slice co-cultures of the nigrostriatal dopaminergic system in combination with biocytin tracing and tyrosine hydroxylase labeling and subsequent automated image quantification. Selected phosphodiesterase inhibitors (PDE-Is)
were studied to identify their potential growth-promoting
capacities. Immunohistochemical methods were used to visualize developing fibers in the border region between ventral tegmental area/substantia nigra co-cultivated with the
striatum as well as the cellular expression of PDE2A and
PDE10. The quantification shows a significant increase of fiber density in the border region induced by PDE2-Is (BAY607550; ND7001), comparable with the potential of the nerve
growth factor and in contrast to PDE10-I (MP-10). Analysis of
© 2012 S. Karger AG, Basel
1424–862X/12/0000–0000$38.00/0
Fax +41 61 306 12 34
E-Mail [email protected]
www.karger.com
Accessible online at:
www.karger.com/nsg
tyrosine hydroxylase-positive fibers indicated a significant
increase after treatment with BAY60-7550 and nerve growth
factor in relation to dimethyl sulfoxide. Additionally, a dosedependent increase of intracellular cGMP levels in response
to the applied PDE2-Is in PDE2-transfected HEK293 cells was
found. In summary, our findings show that PDE2-Is are able
to significantly promote axonal outgrowth in organotypic
slice co-cultures, which are a suitable model to assess
growth-related effects in neuro(re)generation.
Copyright © 2012 S. Karger AG, Basel
Introduction
Axonal projections and the basic organization of midbrain dopaminergic (DAergic) neurons are the subject of
interest when studying human neurological disorders, e.g.
Parkinson’s disease [1], schizophrenia [2], and drug abuse
or addiction [3, 4]. The mesencephalon as a region of complex anatomical organization, and projection patterns of
the DAergic neurons are divided into the retrorubral area
C.H. and K.S. contributed equally to the study.
PD Dr. Heike Franke
Rudolf Boehm Institute of Pharmacology and Toxicology
University of Leipzig, Härtelstrasse 16–18
DE–04107 Leipzig (Germany)
Tel. +49 341 972 4602, E-Mail Heike.Franke @ medizin.uni-leipzig.de
17
(A8 cell group), substantia nigra (SN; A9 cell group), and
the ventral tegmental area (VTA; A10 cell group) [5–7].
Tract-tracing techniques have revealed three projections
to forebrain targets, namely the mesolimbic, the mesocortical, and the nigrostriatal pathways (for references, see
[8]). The trajectories from the SN and VTA target all intrinsic nuclei of the basal ganglia while exhibiting preferential concentrations of terminals in the dorsal and ventral striatum (STR) [1, 8]. The balance between these projections is thought to be regulated by afferent DAergic
signals from the VTA and SN pars compacta, acting on
differentially distributed D1 and D2 dopamine (DA) receptors, e.g. on striatal medium spiny neurons. The activation of D1 receptors leads to an intracellular accumulation
of cyclic adenosine 3ⴕ,5ⴕ-monophosphate (cAMP) via the
adenylyl cyclase and following activation of cAMP-dependent protein kinase. Otherwise, DA inhibits the adenylyl
cyclase via D2 receptors (for references, see [9]).
It is well known that disruption of DAergic cell activity and the loss of ascending projections to the basal ganglia results in the emergence of fundamental pathological
features. Due to the necessity for therapeutic strategies
promoting neuro(re)generation, there is a clear need to
develop appropriate test systems to assess the potential of
different substances regarding regeneration and repair of
neuronal circuits. Over the last years, we established ex
vivo models of organotypic slice co-cultures of the DAergic system [10–12]. Parts of this system were reconstructed using tissue slices from the VTA/SN and STR or
the prefrontal cortex, respectively, to analyze the cytoarchitectural organization of the VTA/SN and the innervations of the target regions by DAergic fibers. Our results
demonstrated that tyrosine hydroxylase (TH)-immunopositive neurons are also able to develop their characteristic innervation patterns in organotypic slice co-cultures [10]. A number of intracellular and extracellular
molecules are involved in the regulation of neuronal differentiation. Using our model system, we were able to
identify a trophic support in axonal outgrowth after purinergic stimulation [11, 12]. Moreover, second messengers cAMP and cyclic guanosine 3ⴕ,5ⴕ-monophosphate
(cGMP), formed from the triphosphates ATP and GTP,
appear to play prominent roles in regulating neuronal
differentiation and neuroplasticity [13, 14]. Elevated intracellular levels of the cyclic nucleotides are important
for axon regeneration, even beyond the required increase
in cAMP levels needed to respond to most factors that
support cell survival [15]. Cyclic nucleotide phosphodiesterases (PDEs) comprise a superfamily of metallophosphohydrolases that specifically cleave the 3ⴕ,5ⴕ-cyclic
2
Neurosignals
phosphate moiety of cAMP and/or cGMP and terminate
the action of cyclic nucleotide signaling [16]. Eleven individual PDE subfamilies (PDE1–PDE11) with varying selectivity for cAMP or cGMP have been identified in
mammalian tissues based on sequence similarities, inhibitor sensitivity, and biochemical properties. They are
involved in mediating a range of different functions, including cytoskeletal rearrangement, gene transcription,
and regulation of ion channel function [17, 18]. Recent
data have shown that PDE2 and PDE10 are localized in
the nigrostriatal system and hydrolyze both cAMP and
cGMP. The inhibition of PDE2 selectively increases cyclic
nucleotide levels, influencing synaptic plasticity and
memory formation [19, 20]. Inhibition of PDE10 modulates neuronal activity within the striatopallidal and nigrostriatal pathway and leads to efficacy in behavioral
models predicting an antipsychotic effect [21–24].
The aim of the present study was to characterize possible trophic/regenerative properties of selected PDE2 inhibitors (PDE2-Is; BAY60-7550 and ND7001) and PDE10I (MP-10), as compared to the effect of the neurotrophin
nerve growth factor (NGF) by using an organotypic slice
co-culture model (VTA/SN+STR). To quantify the potential of stimulating fiber growth, density of neuronal
fibers in the border region of slice co-cultures was determined using both biocytin-tracing technique and
TH immunolabeling, and subsequent automated image
quantification.
Materials and Methods
Materials/Substances
Selected PDE-Is with different subclass specificities were used
(details, see table 1; structural formula, see fig. 1): BAY60-7550
(2-(3,4-dimethoxybenzyl)-7-{(1R)-1-[(1R)-1-hydroxyethyl]-4phenyl-butyl}-5-methyl imidazo[5,1-f][1,2,4]triazin-4(3H)-one;
Alexis Biochemicals, San Diego, Calif., USA), ND7001 (3-(8-methoxy-1-methyl-2-oxo-7-phenyl-2,3-dihydro-1H-benzo[e][1,4]diazepin-5-yl)-benzamide), and MP-10 (2-[4-(1-methyl-4-pyridin4-yl-1H-pyrazol-3-yl)-phenoxymethyl]-quinoline 3) were synthesized at biocrea (Radebeul, Germany).
Furthermore, the following substances/factors were applied:
NGF (Sigma-Aldrich, Taufkirchen, Germany), dimethyl sulfoxide (DMSO; AppliChem GmbH, Darmstadt, Germany), artificial
cerebrospinal fluid (ACSF) of the composition (mM): 126 NaCl;
2.5 KCl; 1.2 NaH2PO4; 1.3 MgCl2, and 2.4 CaCl2 (pH 7.4; Hospital
Pharmacy, University of Leipzig, Germany).
In vitro PDE Assay
PDE activity was measured by the conversion of [3H]-cAMP
and [3H]-cGMP into [3H]-AMP and [3H]-GMP, respectively, as
described previously [25]. PDEs 1B, 2A, 3A, 4A, 5A, 7B, 8A, 9A,
10A, and 11A were generated from full-length human recombi-
Heine /Sygnecka /Scherf /Berndt /
Egerland /Hage /Franke
18
Fig. 1. Chemical structures of the PDE
substrates cGMP and cAMP and of the
PDE-Is BAY60-7550, ND7001, and MP-10.
nant clones. PDE6 was isolated from bovine retina as described
previously [26]. PDE activity was measured with the preferred
substrates, in detail, for PDE1B, 2A, 3A, 4A, 7B, 8A, 10A, and 11A
cAMP was used and for PDE5A, 6, and 9A cGMP, at or below the
K m value (Michaelis-Menten constant). PDE1B and PDE2A were
activated by Ca2+/calmodulin and by cGMP, respectively. The
other PDEs did not need any additional activation procedure. Inhibition of PDE activity was measured using a scintillation proximity assay at varied compound concentrations and optimized
fixed enzyme concentrations for each enzymatic assay. IC50 (half
maximal inhibitory concentration) values were calculated with
the Hill2 parameter model from at least four independent experiments, done in duplicates.
Intracellular cGMP Assay
The selected PDE-Is BAY60-7550 and ND7001 were tested in
a cellular test system to analyze the effects on intracellular cGMP
levels. Human embryonic kidney (HEK) 293 cells, stably transfected with the full-length sequence of human PDE2A
(NM002599), were cultured in collagen I-coated 96-well plates
(70,000 cells/well) over night. On the next day, the test compounds were administered at a final DMSO concentration of 0.5%
and incubated for 30 min at 37 ° C and 5% CO2. This was followed
by incubation with the guanylyl cyclase (GC)-activating agent sodium nitroferricyanide(III) dihydrate (sodium nitroprusside,
SNP, 100 ␮ M; Sigma-Aldrich) for 10 min. Wells incubated without
test compound in the presence and absence of SNP were used as
controls for statistical analysis. The level of intracellular cGMP
was determined with the enzyme-linked immunosorbent assay
system (cGMP EIA System; GE Healthcare UK Ltd., Little Chalfont, England).
Table 1. IC50 values (nM) of the PDE2-Is BAY60-7550 and
ND7001, and the PDE10-I MP-10 against individual phosphodiesterases
PDE
hPDE2A
hPDE1B
hPDE3A
hPDE4A
hPDE5A
bPDE6
hPDE7B
hPDE8A
hPDE9A
hPDE10A
hPDE11A
BAY60-7550
0.18
426
>5,000
2,130
516
2,200
1,740
>5,000
>5,000
1,640
>5,000
ND7001
57
>5,000
>10,000
>10,000
>10,000
>10,000
>10,000
>10,000
>10,000
1,460
>10,000
MP-10
2,630
>5,000
>5,000
2,230
>5,000
>5,000
>5,000
>5,000
>5,000
1.14
>5,000
Overview of the IC50 values (nM) of the PDE2-Is BAY60-7550
and ND7001, and the PDE10-I MP-10 against individual human
(h) PDEs as well as the bovine (b) PDE6.
Axonal Outgrowth
Animals
Neonatal rat pups (WISTAR RjHan, own breed; animal house
of the Rudolf Boehm Institute of Pharmacology and Toxicology,
University of Leipzig) of postnatal day 1–5 (P1–5) were used for
preparation of the organotypic slice co-cultures. The animals
were housed under standard laboratory conditions, under a 12-
Neurosignals
3
19
hour light/12-hour dark cycle and allowed access to lab food and
water ad libitum.
All of the animal use procedures were approved by the Committee of Animal Care and Use of the relevant local governmental
body in accordance with the law of experimental animal protection.
Preparation of Slice Cultures
Slice co-cultures were prepared from P1–5 old rats and cultivated according to the ‘static’ culture protocol described by Franke et al. [10] (for details, see also fig. 2). Briefly, rat pups were decapitated and the brains were removed from the skull under sterile conditions. The brains were apposed to an agar block and fixed
onto the specimen stage of a slicer (Leica VT 1000S; Nussloch,
Germany) with cyanoacrylate glue (Histoacryl쏐; B. Braun, Tuttlingen, Germany). Coronal sections (thickness 300 ␮m) were cut
at mesencephalic (fig. 2: A) and forebrain levels (fig. 2: B). During
the preparation of organotypic slice cultures of the ventral mesencephalon we did not attempt to separate the VTA and the SN.
For further discussion, this area will be named VTA/SN. After
preparation of the VTA/SN (fig. 2: A’, asterisk) and the STR (fig. 2:
B’, asterisk), respectively, the slices were transferred into petri
dishes filled with cold (4 ° C) preparation solution (MEM, Minimum Essential Medium, 2 mM glutamine; Invitrogen GmbH,
Darmstadt, Germany) supplemented with the antibiotic gentamicin (50 ␮g/ml; Invitrogen GmbH). Selected sections were placed
next to each other on moistened translucent membrane inserts
(0.4 ␮m; Millicell-CM, Millipore, Bedford, Mass., USA) as cocultures (VTA/SN+STR) and were put in 6-well plates each filled
with 1 ml incubation medium (50% MEM, 25% Hank’s Balanced
Salt Solution, 25% heat inactivated horse serum; glutamine to a
final concentration of 2 mM; all from Invitrogen GmbH and with
0.044% sodium hydrogen carbonate, NaHCO3; Sigma-Aldrich).
The pH was adjusted to 7.2. The cultures were stored at 37 ° C in
5% CO2 and the medium was changed 3 times a week.
Immunohistochemistry
(a) Qualitative Characterization of PDEs. Following pre-incubation in 1% H2O2 solution for 25 min as well as in blocking solution containing 10% normal horse serum in 0.1 M PB for 1 h, respectively, the slices were incubated with goat anti-PDE2A (1:100;
Santa Cruz Biotechnology, Inc., Santa Cruz, Calif., USA) or rabbit
anti-PDE10 (1:500; FabGennix Inc., Frisco, Tex., USA) for 48 h at
4 ° C.
(b) Quantitative Characterization of TH-Positive Fibers. After
pre-treatment with H2O2 and incubation with blocking solution,
the slices were incubated with mouse anti-TH (1: 1,000; Chemicon, Temecula, Calif., USA) for 48 h at 4 ° C.
(a, b) After washing with PB, the slices were incubated with
biotinylated anti-goat, biotinylated anti-rabbit or biotinylated anti-mouse immunoglobulin IgG (H+L) (1:65; Vector Laboratories,
Inc., Burlingame, Calif., USA), respectively, for 2 h at room tem-
B‘
*
*
VTA/SN
+
STR
STR
VTA/
SN
Fig. 2. Schematic illustration of the preparation procedure to ob-
tain organotypic slice co-cultures of the DAergic system as described previously by Franke et al. [10]. Intact brains were removed from 1- to 5-day-old rats. Afterwards, transverse cuts were
made at the level of A to isolate the mesencephalon and the striatal region (B). Additional horizontal cuts were made indicated by
the dashed lines to separate the VTA/SN (A’ *) and the STR (B’ *).
In the last step, selected coronal sections (thickness 300 ␮m) were
placed next to each other on moistened membranes as co-cultures
as shown in the pictures.
4
A‘
Fixation of the Tissues
After 10 days in vitro (DIV), the cultures were fixed in a solution consisting of 4% paraformaldehyde, 0.1% glutaraldehyde,
15% picric acid in phosphate buffer (PB, 0.1 M; pH 7.4) for 2 h and
subsequently washed with PB intensively. Following fixation, the
co-cultures were cut into 50-␮m thick slices by means of the vibratome.
B
A
Neurosignals
perature. Afterwards, the avidin-biotin-horseradish peroxidase
complex (1:50; ABC-Elite Kit, Vector Laboratories, Inc.) was applied and visualized by 3,3ⴕ-diaminobenzidine hydrochloride
(DAB; Sigma-Aldrich) as the chromogen. For the TH immunolabeling, nickel/cobalt-intensified DAB was used. After mounting
on glass slides, the stained slices were dehydrated in a series of
graded ethanol, processed through n-butylacetate and coverslipped with Entellan (Merck, Darmstadt, Germany).
20
DIV 0
Cy5- (1:100) conjugated IgGs were diluted in TBS supplemented
with 5% FCS and 0.3% Triton X-100 and the mixture was applied
for 2 h at room temperature.
TH-double immunofluorescence was performed using antibodies against mouse anti-TH (1:1,000; Chemicon) and goat antiPDE2A (1: 100; Santa Cruz Biotechnology, Inc.) or rabbit antiPDE10 (1: 500; FabGennix Inc.), respectively, in TBS-containing
5% FCS and 0.3% Triton X-100 for 48 h at 4 ° C. The visualization
was performed with a mixture of DyLightTM 649-conjugated donkey anti-mouse IgG (1:100, color coded in green) and Cy3-conjugated donkey anti-rabbit or anti-goat (1: 1,000; Jackson ImmunoResearch, each). Subsequently, all slices were stained with the
nucleic acid probe Hoechst as described above.
After intensive washing and mounting on glass slides, all
stained sections were dehydrated in a series of graded ethanol,
processed through n-butylacetate and covered with Entellan.
Preparation of slice co-cultures
(P1–5 old rats)
DIV 1
ST1
ST2
ST3
DIV 8
2h
3×
Biocytin tracing
ST4
48 h
Fixation
DIV 10
Acute exposure
to biocytin
Medium change
ST
Fig. 3. A detailed chronological scheme of the experimental pro-
cedure is illustrated. During the incubation period of the cultures,
the treatment was executed 4 times (ST), starting on DIV 1 using
the respective substances. At DIV 8, the biocytin tracing was performed as described and, finally, at DIV 10, the co-cultures were
fixed and analyzed. ST = Substance treatment.
Immunofluorescence
Single Labeling. After washing with Tris-buffered saline (TBS,
0.05 M; pH 7.6) and blocking with TBS containing fetal calf serum
(FCS, 5%) and Triton X-100 (0.3%), the slices were incubated with
mouse anti-TH (1: 1,000; Chemicon); mouse anti-␤III-tubulin
(1: 400; Promega GmbH, Mannheim, Germany) or mouse antiglial fibrillary acidic protein (GFAP, 1:1,000; Sigma-Aldrich), respectively, for 48 h at 4 ° C. The visualization of the respective primary antibodies was performed with carbocyanine (Cy)2-conjugated goat anti-mouse IgG (1: 400; Jackson ImmunoResearch,
West Grove, Pa., USA). In addition, slices were stained with the
nucleic acid probe Hoechst 33342 (Hoe, final concentration 40 μg/
ml; Molecular Probes, Leiden, The Netherlands) to identify the
cell nuclei.
Multiple Fluorescence Labeling. After the blocking step, performed as described above, the slices were incubated with an antibody mixture of rabbit anti-microtubule-associated protein-2
(MAP2, 1: 500; Millipore, Temecula, Calif., USA), mouse antiGFAP (1:1,000; Sigma-Aldrich) and goat anti-PDE2A (1:100; Santa Cruz Biotechnology, Inc.) or mouse anti-MAP2 (1:1,000; Millipore), goat anti-GFAP (1: 300; Santa Cruz Biotechnology, Inc.)
and rabbit anti-PDE10 (1: 500; FabGennix Inc.), respectively, in
TBS-containing 5% FCS and 0.3% Triton X-100 for 48 h at 4 ° C.
The simultaneous visualization of the different primary antisera
was performed with a mixture of secondary antibodies specific
for the appropriate species IgG (rabbit, mouse, goat; all from Jackson ImmunoResearch). In detail, Cy2- (1:400), Cy3- (1:1000), and
Axonal Outgrowth
Confocal Microscopy
Imaging of the fluorescence-labeled specimen was done using
a confocal laser scanning microscope (LSM 510 Meta; Zeiss,
Oberkochen, Germany). Excitation wave lengths were 633 nm
(helium/neon2), 543 nm (helium/neon1), and 488 nm (argon). An
ultraviolet laser (351/364 nm, Enterprise) was used to evoke the
Hoechst fluorescence.
Treatment Procedure
According to the treatment procedure described in Heine et
al. [12] (for a detailed time schedule, see fig. 3), the slice co-cultures were divided into different experimental groups and were
treated with the following substances (final concentration):
BAY60-7550 (10 ␮ M), ND7001 (10 ␮ M), MP-10 (10 ␮ M), and NGF
(50 ng/ml). The experiments were performed in a blinded fashion,
i.e. the compound identity was only provided after final data analysis.
The substances (except NGF) were dissolved in DMSO, sterilized by filters (0.2 ␮m; Sarstedt, Nümbrecht, Germany) and finally added to 1 ml incubation medium. To exclude influences
resulting from the solvent DMSO (final concentration 0.1%), an
additional control group was used, treated only with ACSF (1%).
The substances were applied at each medium change (4 times
within the incubation period).
Tracing Procedure
At DIV 8, small biocytin crystals (Sigma-Aldrich) of similar
size were placed on the VTA/SN part of the co-cultures (according to [10]) under binocular control (for detailed time schedule,
see fig. 3). Cultures were left in contact with the crystals for 2 h to
allow the uptake of biocytin, followed by careful rinsing with
fresh incubation medium. Then, the cultures were reincubated
with medium containing the substances to allow for anterograde
transport of the tracer. After DIV 10, the cultures were fixed as
described above and cut into 50-␮m thick slices by means of the
vibratome.
The visualization of the traced axons was performed using a
previously described protocol [10]. Briefly, the anterogradely
transported tracer biocytin was labeled using the ABC-Elite Kit
(1:50; Vector Laboratories, Inc.), in combination with nickel/cobalt-intensified DAB. After mounting on glass slides, all stained
sections were handled as described above.
Neurosignals
5
21
d
f
c
a
b
e
␤
g
h
Fig. 4. a Overview of a DAergic nigrostriatal co-culture (VTA/
SN+STR) using the biocytin-tracing technique in combination
with DAB labeling. The small biocytin crystals had been placed
onto the VTA/SN part of the co-culture; afterwards, the anterograde tracer was transported from the cell bodies to the outgrowing fibers. The cell bodies (labeled black) of the VTA/SN and the
respective outgrowing fibers, linking the border region and growing into the STR, are shown. b–f Examples of TH immunofluorescence labeling to characterize the expression of the DAergic
marker in the co-cultures: TH-IR was observed on cell bodies and
outgrowing fibers within the VTA/SN (b, e) as well as on fiber
6
Neurosignals
i
processes in the border region (c, d) and the STR (d, f). In the border region, strong TH-IR was observed (e.g. arrowhead in c, d) on
fibers, but also an increased number of ‘dot-like’ structures (e.g.
arrows in c, d) was found. Finally, within the STR, a fine network
of TH-positive fibers and ‘dot-like’ structures is characteristic (f).
g–i The expression of ␤III-tubulin- (g), GFAP- (astroglial marker)
(h), as well as MAP2- (neuronal marker) (i) positive fibers in the
border region is demonstrated, together with the nuclear stain
Hoechst (Hoe) 33342. Scale bars: a 10 ␮m; b–d, f 20 ␮m; e 50 ␮m;
g–i 10 ␮m.
22
Automated Image Quantification
The quantification of outgrowing biocytin-traced fibers as
well as of the TH-labeled fibers was performed within the border
region of the co-cultures, i.e. the part where the two initially separated brain slices were grown together (fig. 4a). The following
criteria were used for the selection of the biocytin-traced slices:
(a) the tracer was correctly placed on the VTA/SN; (b) the major
part of the VTA/SN was characterized by a dense network of biocytin-traced structures, and (c) no traced cell bodies had been
observed in the target region STR (described in detail in [12]).
The raw images were obtained at 20! magnification from the
whole border region by a usual transmitted light bright field microscope (Axioskop 50; Zeiss, Oberkochen, Germany) equipped
with a CCD camera. Due to the usual problems with sensor noise
and the large amount of light absorption and scattering inside the
complex tissue structure of the stained co-culture slices, the axonal structures are typically blurred and image quality further suffers from inhomogeneous illumination. The border region is
composed of both vesicular and fibrous structures (in the following only termed fibers) due to the dynamic transport properties
of the tracer biocytin. Thus, a tailored image analysis pipeline had
to be designed to quantify the fiber density in an automated manner. This procedure can be roughly split into two parts: image
pre-processing and fiber detection.
Pre-Processing of the Images
At first, a deconvolution of the images was computed to reduce
the blur and highlight the expected ‘true’ structures of the fibers.
Since the real point-spread function of the microscope setup was
lacking, the convolution kernel was estimated by a general Gaussian function (the width of the Gaussian is empirically set to 2 pixels), which is a reasonable guess in the general case of isotropic
blur. The actual deconvolution was done with a damped least
squares method (see [27]).
The deconvolution step inevitably leads to an increase in noise.
Since noisy image structures would lead to a high number of false
positive hits for subsequent detection of vesicular structures, a
total variation-based smoothing step was applied to suppress single pixel noise in the images while preserving structures of interest [28].
Large-scale blurry structures in the background (due to structures from out-of-focus structures in the tissue) were subsequently removed by applying a top-hat transform, image structures
larger than a given threshold were removed (a cutoff of 40 pixels
was used here, see [29] for details).
Quantification of the Fiber Density
After pre-processing, the fiber structures appeared as well-defined bright regions that clearly stood out against the background.
These regions were then extracted by Otsu thresholding [30].
Subsequently, the image area occupied by the fibers was measured to obtain a reasonable estimate of the underlying axonal
density of the analyzed specimen. Precisely, the ratio of the number of foreground pixels (fibers) against the total number of pixels
in the images was taken, giving the percentage of area occupied
by fibers in the focal plane.
Statistics
Statistical analysis of the intracellular cGMP assay was performed using Student’s t test. Statistically significant differences
Axonal Outgrowth
were considered at a p level !0.05 (* p ! 0.05, ** p ! 0.01, *** p !
0.001; the error bars indicate the SEM).
Statistical analysis of the quantitative data, comparing the different treatment groups, was performed using a Wilcoxon Rank
Sum test. Each individual group was compared to the control
group DMSO. To correct for multiple pairwise testing between
groups, a conservative Bonferroni p value correction was applied.
Statistically significant differences were considered at a p level
!0.05 (* p ! 0.05, ** p ! 0.01, *** p ! 0.001). For each group, the
treatment experiments were repeated for at least three individual
preparations.
Results
IC50 Values of Selected PDE-Is
The potency and selectivity of BAY60-7550, ND7001,
and MP-10 were confirmed against individual human
purified proteins of each PDE family (except for PDE6,
which was isolated from bovine retina), and the results
are shown in table 1.
The data of the IC50 values against PDE2A indicated
the following ranking: BAY60-7550 1 ND7001 1 MP-10.
The PDE2-I BAY60-7550 inhibited the target enzyme
with high potency with an IC50 value of 0.18 nM, and
ND7001 was characterized as a PDE2-I with moderate
affinity (IC50 = 57 nM). Both compounds are highly selective against all other PDE isoforms. MP-10 inhibited the
activity of PDE10 with high potency (IC50 = 1.14 nM) as
well as high selectivity towards each individual isoform
of the PDE family. In general, PDE proteins show a high
degree of sequence homology across different species, especially within their catalytic domains (for review, see
[17, 18]). Thus, it is very unlikely that PDE-Is show species-specific effects with regard to their inhibitory activity. We have tested, for example, the PDE2-I ND7001 in a
reference experiment using rat and human PDE2 proteins and could not detect any significant differences in
their inhibitory activity across species (data not shown).
Effects of PDE2-Is on Intracellular cGMP Level
The PDE2-Is BAY60-7550 and ND7001 had been selected for the cellular cGMP assay. Measurement of
cGMP levels in HEK293 cells, stably transfected with the
full-length sequence of human PDE2A, confirmed that
PDE2-I BAY60-7550 (fig. 5a) and ND7001 (fig. 5b) increased cGMP levels in a dose-dependent manner. In the
presence of SNP (100 ␮M), these compounds significantly increased cGMP levels as compared to the control
group. These findings suggest that PDE2 may play a major role in the degradation of cGMP under conditions of
Neurosignals
7
23
350
BAY60-7550 (μM)
**
300
250
200
***
150
*
100
**
*
50
*
*
50
40
30
20
10
0
0
a
ND7001 (μM)
60
cGMP (fmol/well)
cGMP (fmol/well)
70
**
Medium SNP
0.005
0.01
0.05
0.1
0.5
1
5
10
b
Medium SNP
0.005
0.01
0.05
0.1
0.5
1
5
10
Fig. 5. Dose-dependent effects of PDE2-Is BAY60-7550 (a) and
ND7001 (b) on intracellular cGMP levels in a PDE2-HEK293 cell
line. BAY60-7550 and ND7001 (in the presence of the GC stimulator SNP) increased the intracellular cGMP level in a dose-dependent fashion. Values are shown in fmol cGMP per well. The
error bars indicate SEM. The numbers of independent experiments per compound were: BAY60-7550 (n = 8) and ND7001 (n =
4), performed in duplicates. Differences to SNP were considered
to be statistically significant according to a p level !0.05 (* p !
0.05, ** p ! 0.01, *** p ! 0.001).
GC stimulations. The numbers of independent experiments per compound were: BAY60-7550, n = 8, and
ND7001, n = 4, performed in duplicates.
typical routes during the development of the central nervous system and that selected guidance molecules support this innervation [32–34].
Characterization of the Organotypic Co-Cultures
(VTA/SN+STR)
In the present study, the VTA/SN and the STR, main
parts of the DAergic nigrostriatal projection system, were
prepared from P1–5 old rats, a period during which the
rat exhibits an adult localization of the neurons, although
the axonal network is still immature [31]. Following fixation of the cultures at DIV 10, the slices were characterized using different labeling techniques.
Immunohistochemistry/Immunofluorescence
The expression of TH, a marker for DAergic neurons,
was shown using immunofluorescence labeling in combination with confocal laser scanning microscopy. The results indicate the presence of TH-positive cell bodies and
fibers in the VTA/SN (fig. 4b, e), whereas the expression
of the marker was restricted to fibers within the border
region (fig. 4c, d) and the STR (fig. 4d, f). Fluorescence
images illustrating the differences in the expression of TH
immunoreactivity (IR) in the respective anatomical parts
of the DAergic system are shown in figure 4b–d. The pictures especially exemplify the expression of the ‘dot-like’
structures in the border region and the target area (also
observed after biocytin tracing, see fig. 6). Furthermore,
antibodies against neuronal markers, i.e. ␤III-tubulin and
MAP2 and the astroglial marker GFAP, were used to
prove the existence of neuronal processes and glial cells,
especially within the border region of the co-cultures. A
positive IR for all investigated markers was observed in
VTA/SN and STR. Examples are shown in figure 4g–i,
where the existence of ␤III-tubulin- (fig. 4g), MAP2(fig. 4i), and GFAP- (fig. 4h) labeled fibers spanning the
border region and, thus, linking the two slices could be
verified. These results are consistent with the results
Biocytin Tracing
The morphology of the biocytin-traced cell bodies as
well as the outgrowth of the fibers were analyzed in treated as well as untreated control co-cultures. An example
of an untreated biocytin-traced co-culture is shown in
figure 4a. In general, numerous biocytin-marked fibers
(labeled in black) originating from the VTA/SN, ramified
and crossed the border region between the two brain slices. Moreover, their fiber processes were observed to grow
into the striatal part of the culture. The fiber pathways of
the VTA/SN+STR co-cultures developed an innervation
pattern similar to that found in vivo [10]. These findings
are in accordance with other studies, showing that the
projections of axons to their targets follow special stereo8
Neurosignals
24
a
b
c
d
e
f
Fig. 6. Results of the biocytin tracing after substance treatments
are demonstrated within the border region of the co-cultures.
Compared to control conditions applying ACSF (a) and DMSO
(b) an increase in biocytin-positive fibers in PDE2-Is-treated cocultures using BAY60-7550 (d) and ND7001 (e) was observed.
These effects were comparable with the effect evoked by the
growth factor NGF (c). Co-cultures treated with MP-10 (f) were
characterized by few biocytin-traced innervations within the border region. Scale bar: a–f 20 ␮m.
found in our previous studies, demonstrating the expression of neuronal and glial fiber connections within VTA/
SN + prefrontal cortex co-cultures [12].
Further light microscopic and triple immunofluorescence labeling studies with specific antibodies directed
against PDE2A and PDE10 were performed to demonstrate the expression of these isoforms. Examples are
shown in figure 7.
The light microscopic data indicated the expression of
PDE2A on cell bodies and fibrous structures in the STR
and VTA/SN (data not shown) and correlate with the immunofluorescence data. The immunofluorescence labeling was predominately found at the plasma membrane as
well as in the cytoplasm (an example for the STR is given
in fig. 7a–c, arrows). Moreover the co-localization of the
PDE2A-IR on MAP2-immunopositive cells could be observed (example for VTA/SN; fig. 7f–h, arrows). We did
not find PDE2-positive fibers in the border region (an example is shown in fig. 7d, e). Double immunofluorescence experiments using TH and PDE2A indicated no
co-expression on cell bodies or fibers in all parts of the
studied co-cultures, as shown in figure 7i–m.
Light microscopic images also confirmed the evidence
of PDE10-marked cell bodies and fibers in the STR and
the VTA/SN. Additional investigations using double immunofluorescence labeling with antibodies against TH
and the PDE10 isoform indicated the expression of PDE10
on cell bodies and single fibers. On the other hand, no
co-expression with TH-positive fibers (STR, VTA/SN) or
the localization on TH-positive neurons (VTA/SN) could
be found (fig. 7n–q).
The obtained results thus clearly underline the expression of the investigated isoforms in the VTA/SN+STR cocultures during development.
Axonal Outgrowth
Neurosignals
Treatment of Organotypic Co-Cultures with PDE2and PDE10-Is
Qualitative Results of the Fiber Growth (Biocytin
Tracing)
Further co-cultures (VTA/SN+STR) had been used to
study the influence of selected PDE-Is, with different
subclass specificities, on fiber growth and sprouting. All
experiments were performed in a blinded fashion, i.e. the
compound identity was provided after final data analysis.
9
25
a
b
f
g
i
j
n
o
Fig. 7. Confocal images of multiple immunofluorescence labeling
using antibodies against PDE2A (a–m) and PDE10 (n–q) in com-
bination with MAP2 (neuronal marker), TH (DAergic marker),
and Hoechst (Hoe) are shown. a–h PDE2A is expressed in the STR
and VTA/SN especially on cell bodies (plasma membrane, cytoplasm; co-expression with MAP2 is indicated by arrows). No labeling was found on fibers in the border region (example given in
10
Neurosignals
c
e
d
h
k
m
l
q
p
d, e). The double-labeling experiments with antibodies against
TH indicated neither co-localization of PDEA2 and TH in the
STR, VTA/SN, nor in the border region (i–m). PDE10 was found
to be expressed on cell bodies and also on fibers (indicated by arrows in n–q), but no co-localization was found with TH-positive
structures in the studied regions. Scale bars: a–c 5 ␮m; d–h 10
␮m; i 20 ␮m; j, k 20 ␮m; l–o 10 ␮m; p, q 20 ␮m.
26
b
Fig. 8. a–d TH-positive fibers after substance treatment (a ACSF;
b NGF, c DMSO, d BAY60-7550 solved in DMSO) within the border region of the co-cultures are shown (scale bar: a–d 20 ␮m).
e Results of automated image quantification to measure the den-
sity of the TH-positive fibers in the border region of differently
treated co-cultures in comparison to control conditions. After
TH labeling, the fiber density was quantified, taking the ratio of
the number of foreground pixels (fibers) over the total number of
pixels in the images to reveal the size of the area occupied by fibers. The box-whisker plots represent the empirical distribution
of the fiber densities in the different groups (the vertical axis corresponds to the percentage of image pixels belonging to labeled
fibers). Compared with ACSF and DMSO, the growth factor NGF
induced a significant increase in TH-positive fibers in the studied
co-cultures. In contrast, the PDE2-I BAY60-7550 evoked only a
small but significant increase of the number of TH-positive fibers,
in comparison with the solvent DMSO. The numbers of analyzed
images per group are: ACSF (n = 8), DMSO (n = 20), NGF (n = 33)
and BAY60-7550 (n = 94). Differences were considered statistically significant at a p level !0.05 (* p ! 0.05, *** p ! 0.001).
c
d
Percentage of image pixels belonging
to TH-positive fibers
a
***
0.10
*
0.08
0.06
0.04
0.02
0
e
ACSF
NGF
DSMO
BAY60-7550
As described in the Methods section, the co-cultures
were treated 4 times with the respective substances, over
an incubation time of 10 days and, afterwards, the outgrowth of the biocytin-traced fibers in the border region
was analyzed.
Differences in fiber outgrowth within the border region could be observed for the different treatments, and
examples of these results are illustrated in figure 6. An
increase in biocytin-positive fibers was apparent in
PDE2-I- (e.g. BAY60-7750, fig. 6d) treated co-cultures in
comparison to control conditions (ACSF, fig. 6a; DMSO,
fig. 6b). The growth factor NGF evoked an effect comparable to the PDE2-Is under study (fig. 6c). Co-cultures
treated with MP-10, an inhibitor of the PDE10, were characterized by fewer biocytin-traced innervations within
the border region compared to the effects induced by the
PDE2-Is (fig. 6f). Furthermore, the ‘dot-like’ structures
are of particular interest. They could be observed in the
border region and the target region (STR) after substance
treatment. This expression was also found after TH labeling of outgrowing fibers (see also fig. 4, 8). A significant
increase in the number of puncta was noticeable after
treatment with BAY60-7550.
Axonal Outgrowth
Neurosignals
Quantification of Fiber Density (Biocytin Tracing)
Starting from light microscopic images, the density of
the biocytin-positive fibers was measured for all treatment groups in the border region of the co-cultures using
the automated image quantification described above. The
respective results of the tested substances are shown as
box-whisker plots in figure 9. A significant increase in
neuronal fiber outgrowth after application of the PDE2Is BAY60-7550 and ND7001 was observed, with BAY607550 exhibiting the strongest effect. These results were of
11
27
Fiber density
(percentage of pixels belonging to fibers)
expression of TH-positive fibers in the border region (examples are shown in fig. 8a–d). Especially the effect of
NGF as trophic factor was clearly visible.
***
0.14
***
0.12
0.10
***
0.08
0.06
0.04
0.02
0
ACSF
DMSO
NGF
BAY60- ND7001
7550
MP-10
Fig. 9. Automated image quantification to measure the fiber den-
sity in the border region of different treated co-cultures in comparison to control conditions. After biocytin tracing, the fiber
density was quantified, taking the ratio of the number of foreground pixels (fibers) over the total number of pixels in the images to reveal the size of the area occupied by fibers. The boxwhisker plots represent the empirical distribution of the fiber
densities in the different groups (the vertical axis corresponds to
the percentage of image pixels belonging to traced fibers). The
analysis revealed a significant increase in neuronal fiber outgrowth after application of PDE2-Is BAY60-7550 and ND7001,
with effects comparable to the stimulation capacity of NGF. The
inhibitor of PDE10, MP-10, caused a significantly lower fiber density in the border region, similar to the results of ACSF and DMSO.
The numbers of analyzed images per group were: ACSF (n = 22),
DMSO (n = 62), NGF (n = 41), BAY60-7550 (n = 101), ND7001
(n = 103), and MP-10 (n = 76). Statistically significant differences
were considered at a p level !0.05 (*** p ! 0.001).
Quantification of the Fiber Density
(TH Immunolabeling)
Moreover, the density of the TH-positive fibers was
analyzed and quantified for all treatment groups as described above. The results are shown in figure 8e. The
growth factor NGF induced a significant increase in THpositive fibers in the studied co-cultures as compared to
ACSF and DMSO. In contrast, the PDE2-I BAY60-7550
evoked a smaller (in comparison to the biocytin tracing)
but statistically significant increase in the density of THpositive fibers under these conditions (as compared with
the DMSO group). The observed difference in effect size
of BAY60-7550 treatment between biocytin tracing and
TH labeling suggests an involvement of additional neurotransmitter populations, other than the TH-positive
(DAergic) subgroup. Although small differences between
DMSO and ACSF exist, they were not found to be statistically significant.
The numbers of analyzed images per group are: ACSF
(n = 8), DMSO (n = 20), NGF (n = 33), and BAY60-7550
(n = 94). Differences were considered statistically significant at a p level !0.05 (* p ! 0.05, ** p ! 0.01, *** p !
0.001).
Discussion
comparable effect size as for the neurotrophic factor NGF.
MP-10 (PDE10-I) caused a clearly lower fiber density in
the border region, akin to the effects observed in the control groups. Moreover, no significant differences in fiber
density could be observed between the ACSF and the
DMSO control group, thus excluding adverse effects resulting from the solvent DMSO. The numbers of analyzed images per group are: ACSF (n = 22), DMSO (n =
62), NGF (n = 41), BAY60-7550 (n = 101), ND 7001 (n =
103), and MP-10 (n = 76).
Treatment of Organotypic Co-Cultures with PDE2-I
and NGF – Characterization of DAergic Fibers
Qualitative Results of the Fiber Growth (TH
Immunolabeling)
Treatment of the co-cultures with ACSF, NGF, DMSO,
and BAY60-7550 (solved in DMSO) and immunolabeling
with antibodies against TH indicated differences in the
12
Neurosignals
The characterization of determinants of innervation
patterns and the activities of growth promoting factors
are of special interest for the development of clinical
strategies to promote fiber development and, thereby, the
regeneration of neuronal circuits. Using the ex vivo model of organotypic slice co-cultures, consisting of the VTA/
SN and the STR, in combination with biocytin tracing,
TH immunolabeling, and subsequent automated image
quantification, it was shown that substances with the potential to inhibit PDE2 (BAY60-7550, ND7001) were able
to increase neuronal fiber outgrowth, in contrast to the
studied PDE10-I (MP-10) and the control substances
ACSF and DMSO.
The data suggest a role for PDE2-Is, possibly mediated via cGMP, in the induction of fiber outgrowth in the
nigrostriatal projection system. In PDE2-transfected
HEK293 cells, a dose-dependent increase of intracellular
cGMP levels in response to PDE2-Is, the previously described reference compounds BAY60-7550 and ND7001,
28
could further be shown. These data indicate that inhibition of PDE2 results in a dose-dependent augmentation
of intracellular cGMP levels.
In vivo studies on rats have shown that DAergic neurons emerged around embryonic day 10, with the first
nerve fibers appearing in the STR around embryonic
days 14–15. The innervations are completed at about P15
[35]. Thus, the situation in the established ex vivo model
strongly correlates with the developmental processes of
physiological neuronal circuits. The observed neurite
outgrowth pattern is consistent with our own previous
data obtained under in vivo conditions [10].
PDEs are involved in distinct tasks in the brain, both
in the mature rat brain and at embryonic as well as postnatal stages when significant developmental and maturational events are in progress [19, 20, 36]. An increase
in PDE activity was reported during development of
the brain from fetus to adulthood [37, 38]. Our data indicate an expression of PDE2A and PDE10 on cells in the
DAergic co-culture preparations, consequently underlining a role of these isoenzymes in early development.
Hydrolyzing PDE families have distinct expression
patterns within the central nervous system. For instance,
striatal medium spiny neurons express mRNA for the
PDE1B, 2A, 4B, 7B, 9A, and 10A isoforms (for references,
see [39, 40]). A prominent PDE2A-IR was found besides
the STR in the isocortex, hippocampus, and basal ganglia. Moreover, a high expression was observed in the SN
and VTA on cell bodies and terminals [20, 36], which is
supported by the findings presented in this work. PDE10
mRNA and protein are highly enriched in medium spiny
neurons in the STR, within the cell bodies and dendrites
as well as on SN axons [22, 41, 42]. PDE10A is associated
with post-synaptic membranes of these medium spiny
neurons and their dendrites and spines [43].
Under physiological conditions, the dual substrate enzyme PDE2(A) plays a critical role in the feedback control
of cellular cAMP and cGMP levels, resulting in acute and
long-term changes of neuronal functions. The basal PDE2
activity in neurons is low, but it is stimulated by an acute
increase in cGMP following GC activation during signal
transduction. In detail, a characteristic feature of PDE2 is
the positive cooperativity with the substrate cGMP due to
an allosteric cGMP binding site at N-terminal domains
[40, 44]. This cyclic nucleotide stimulates cAMP degradation such that higher concentrations of cGMP inhibit
cAMP hydrolysis and low levels of cGMP enhance the rate
of cAMP hydrolysis [39, 44]. Besides the described features of PDE2, also special GAF domains of PDEs 5, 6, 10,
and 11 bind cGMP and may regulate the catalytic activity
or protein-protein interactions (for references, see [45]).
As a consequence, inhibition of PDE2 selectively increases cGMP and cAMP in brain active synapses [19, 44]. Incubation of cultured neurons and hippocampal slices
with the selective PDE2-I BAY60-7550 resulted in increased cGMP levels [44]. This is in accordance with our
present data, indicating a dose-dependent increase of intracellular cGMP levels in response to the investigated
PDE2-Is obtained in the HEK cell line. Inhibition of the
PDE10A causes also increased levels of cAMP and cGMP
[40], with the difference that the regulation of the two cyclic nucleotides by PDE10A is independent [22].
The involvement of cAMP/cGMP during neuronal development in synaptic plasticity and memory formation
has been described [19, 36, 44]. Recent data suggest a role
of cAMP (via cAMP-dependent protein kinase) in neuritogenesis and synaptogenesis during neuronal differentiation in NG108-15 cells [14]. The particular role of exchange proteins directly activated by cAMP (Epac) will
be of specific interest for further studies as they are
known to be involved in mediating cAMP responses.
These are implicated in various cellular processes such as
integrin-mediated cell adhesion and cell-cell junction
formation or influencing, for example, cortical actin cytoskeleton (for review, see [46]).
cGMP can regulate directional guidance of growth
cones [13, 47] and is involved in the outgrowth of cortical
neurons during maturation [32]. The observed trophic
effects clearly show that inhibitors of PDE2 are able to
modulate neuronal fiber outgrowth in VTA/SN+STR cocultures in contrast to the studied PDE10-I (MP-10), suggesting an involvement of PDE2, via cGMP signaling, in
synaptic plasticity. Data from Boess et al. [44] confirm
that inhibition of PDE2, e.g. by the selective PDE2-I
BAY60-7550, increases cGMP/cAMP in cultured neurons
and hippocampal slices, resulting in enhanced long-term
potentiation of synaptic transmission, which is thought
to be a key factor implicated in pro-cognitive activity
without affecting basal synaptic transmission. A role of
PDE2A activity in memory processes is further supported by the results of Song et al. [47] and Rutten et al. [19]
showing that BAY60-7550 reportedly improves performance of rodents in recognition memory tasks.
Inhibition of PDE10 promotes effects modulating basal
ganglia function in ways that suggest a particular therapeutic utility in the treatment of psychosis in schizophrenia [22, 23, 48]. It has also been shown that PDE10-I
increases phosphorylation of key cAMP-dependent
substrates, such as cAMP response element-binding protein, extracellular receptor kinase, or, more recently, the
Axonal Outgrowth
Neurosignals
13
29
AMPA-receptor GluR1 subunit [48–51]. Sotty et al. [51]
further suggest a modulatory role of PDE10A on mesolimbic DAergic neurotransmission, via the D1-regulated feedback loop controlling midbrain DAergic neuronal activity.
Therefore, investigating its modulatory role to affect the
confluence of the corticostriatal glutamatergic and the
midbrain DAergic pathways will be of particular interest.
The regulation of cAMP synthesis by DA and other
neurotransmitter receptors has been extensively studied.
But the importance of cAMP degradation by PDEs and
the precise roles of each PDE isoform in DAergic signaling are not yet completely understood, owing to the diversity of PDE isoforms expressed in the STR and the
complexity of their potential regulation (for review, see
[24]). The authors conclude that the inhibition of PDEs
upregulates cAMP/PKA signaling in three neuronal subtypes, resulting in (a) the stimulation of DA synthesis at
DAergic terminals, (b) the inhibition of D2 receptor signaling in striatopallidal neurons, and (c) the stimulation
of D1 receptor signaling in striatonigral neurons. However, it should be noted that the striatopallidal system as
well as the corticostriatal glutamatergic projection are
not constituents of the organotypic slice co-culture system used in the present study – possibly causing the different inhibitory effects of the investigated PDE-Is (especially for PDE10-I). However, the mechanism of inhibition responsible for the observed effects of the two kinds
of PDE-Is needs further experimental investigations, especially the role of PDE10 to affect the corticostriatal glutamatergic and the midbrain DAergic pathways.
Finally, in the present study, the growth-promoting effect of the PDE-Is was compared with the stimulating capacity of NGF, which elicited a significant increase in fiber outgrowth intensity. Neurotrophins, like NGFs and
their receptors, are the major regulators of neuronal survival during development, after injury or nervous system
diseases [52]. NGF promotes neurite extension through a
cAMP-independent signaling pathway involving Ras,
PKC, and extracellular signal-regulated protein kinase
[53]. It has been shown that cAMP also induces neuronal
differentiation in PC12 cells and that the co-treatment of
NGF and dibutyryl cAMP exhibits synergistic effects on
neurite outgrowth [54]. Moreover, NGF increases cGMP
level and activates PDEs in PC12 cells [55]. Also other
trophic molecules have been shown to enhance survival
and neurite outgrowth of mesencephalic DAergic neurons in single cell cultures or slice cultures [56–58]. Treatment of organotypic slice co-cultures with BDNF resulted in enhanced survival of TH-positive neurons and an
increased growth of TH-positive fibers into the striatal
14
Neurosignals
tissue [58]. GDNF has been shown to act as a powerful
chemoattractant for outgrowing DAergic axons in organotypic co-cultures [33, 59] as well as under in vivo conditions [60]. Finally, Thompson et al. [60] showed that axonal regrowth in the nigrostriatal trajectory can be further
enhanced by the addition of trophic support by overexpression of GDNF in the striatal target.
In summary, cAMP/cGMP are involved in survival,
repair, and remodeling in the nervous system both during development and after injury, and PDE2 appears to
act as an important regulator in these processes. In the
present study, we were able to analyze the specific potential of PDE-Is in mediating the growth of defined fiber
connections under controlled conditions, using the ex
vivo model of organotypic slice co-cultures of the nigrostriatal system in combination with an automated image
quantification. Hence, our results strongly support a trophic role of PDE2-Is in shaping interneuronal connections during the early phase of neuronal development.
The characterization of the molecular and functional basis underlying the observed effects of PDE2-Is in regeneration and repair of disrupted neuronal circuits will be
an important next step to foster the development of improved ways for the treatment of neurological disorders.
Acknowledgements
The authors thank Katrin Becker and Katrin Krause (Rudolf
Boehm Institute of Pharmacology and Toxicology) for technical
assistance.
The work presented in this paper was made possible by funding from the German Federal Ministry of Education and Research
(BMBF, PtJ-Bio, 0313909) and was supported by the European
Fund for Regional Development (EFRE) and by the Free State of
Saxony (grant No. SAB12525).
References
1 Redgrave P, Rodriguez M, Smith Y, Rodriguez-Oroz MC, Lehericy S, Bergman H, et al:
Goal-directed and habitual control in the
basal ganglia: implications for Parkinson’s
disease. Nat Rev Neurosci 2010;11:760–772.
2 Sesack SR, Carr DB: Selective prefrontal cortex inputs to dopamine cells: implications for
schizophrenia. Physiol Behav 2002; 77: 513–
517.
3 Dailly E, Chenu F, Renard CE, Bourin M:
Dopamine, depression and antidepressants.
Fundam Clin Pharmacol 2004;18:601–607.
4 Wise RA: Roles for nigrostriatal – not just
mesocorticolimbic – dopamine in reward
and addiction. Trends Neurosci 2009; 32:
517–524.
30
5 Hökfelt T, Johansson O, Fuxe K, Goldstein
M, Park D: Immunohistochemical studies
on the localization and distribution of
monoamine neuron systems in the rat brain.
I. Tyrosine hydroxylase in the mes- and diencephalon. Med Biol 1976; 54:427–453.
6 Fallon JH, Loughlin SE: Substantia nigra; in
Paxinos G (ed): The Rat Nervous System. San
Diego, Academic Press, 1995, pp 215–237.
7 Lindvall O, Björklund A: Cell therapy in Parkinson’s disease. Neurotherapeutics 2004; 1:
382–393.
8 Björklund A, Dunnett SB: Dopamine neuron
systems in the brain: an update. Trends Neurosci 2007;30:194–202.
9 Sasaki T, Kotera J, Omori K: Transcriptional
activation of phosphodiesterase 7B1 by dopamine D1 receptor stimulation through the
cyclic AMP/cyclic AMP-dependent protein
kinase/cyclic AMP-response element binding protein pathway in primary striatal neurons. J Neurochem 2004;89:474–483.
10 Franke H, Schelhorn N, Illes P: Dopaminergic neurons develop axonal projections to
their target areas in organotypic co-cultures
of the ventral mesencephalon and the striatum/prefrontal cortex. Neurochem Int 2003;
42:431–439.
11 Franke H, Illes P: Involvement of P2 receptors in the growth and survival of neurons in
the CNS. Pharmacol Ther 2006; 109: 297–
324.
12 Heine C, Wegner A, Grosche J, Allgaier C,
Illes P, Franke H: P2 receptor expression in
the dopaminergic system of the rat brain
during development. Neuroscience 2007;
149:165–181.
13 Song HJ, Poo MM: Signal transduction underlying growth cone guidance by diffusible
factors. Curr Opin Neurobiol 1999; 9: 355–
363.
14 Tojima T, Kobayashi S, Ito E: Dual role of cyclic AMP-dependent protein kinase in neuritogenesis and synaptogenesis during neuronal differentiation. J Neurosci Res 2003;74:
829–837.
15 Cai D, Shen Y, De Bellard M, Tang S, Filbin
MT: Prior exposure to neurotrophins blocks
inhibition of axonal regeneration by MAG
and myelin via a cAMP-dependent mechanism. Neuron 1999;22:89–101.
16 Francis SH, Turko IV, Corbin JD: Cyclic nucleotide phosphodiesterases: relating structure and function. Prog Nucleic Acid Res
Mol Biol 2001; 65:1–52.
17 Bender AT, Beavo JA: Cyclic nucleotide
phosphodiesterases: molecular regulation to
clinical use. Pharmacol Rev 2006; 58: 488–
520.
18 Conti M, Beavo J: Biochemistry and physiology of cyclic nucleotide phosphodiesterases:
essential components in cyclic nucleotide
signaling. Annu Rev Biochem 2007; 76: 481–
511.
Axonal Outgrowth
19 Rutten K, Prickaerts J, Hendrix M, van der
Staay FJ, Sik A, Blokland A: Time-dependent
involvement of cAMP and cGMP in consolidation of object memory: studies using selective phosphodiesterase type 2, 4 and 5 inhibitors. Eur J Pharmacol 2007;558:107–112.
20 Stephenson DT, Coskran TM, Wilhelms
MB, Adamowicz WO, O’Donnell MM, Muravnick KB, et al: Immunohistochemical localization of phosphodiesterase 2A in multiple mammalian species. J Histochem Cytochem 2009;57:933–949.
21 Siuciak JA, Chapin DS, Harms JF, Lebel LA,
McCarthy SA, Chambers L, et al: Inhibition
of the striatum-enriched phosphodiesterase
PDE10A: a novel approach to the treatment
of psychosis. Neuropharmacology 2006; 51:
386–396.
22 Chappie T, Humphrey J, Menniti F, Schmidt
C: PDE10A inhibitors: an assessment of the
current CNS drug discovery landscape. Curr
Opin Drug Discov Devel 2009;12:458–467.
23 Grauer SM, Pulito VL, Navarra RL, Kelly
MP, Kelley C, Graf R, et al: Phosphodiesterase 10A inhibitor activity in preclinical models of the positive, cognitive, and negative
symptoms of schizophrenia. J Pharmacol
Exp Ther 2009;331:574–590.
24 Nishi A, Snyder GL: Advanced research on
dopamine signaling to develop drugs for the
treatment of mental disorders: biochemical
and behavioral profiles of phosphodiesterase
inhibition in dopaminergic neurotransmission. J Pharmacol Sci 2010;114:6–16.
25 Höfgen N, Stange H, Schindler R, Lankau
HJ, Grunwald C, Langen B, et al: Discovery
of imidazo[1,5-a]pyrido[3,2-e]pyrazines as a
new class of phosphodiesterase 10A inhibitors. J Med Chem 2010;53:4399–4411.
26 Paglia MJ, Mou H, Cote RH: Regulation of
photoreceptor phosphodiesterase (PDE6) by
phosphorylation of its inhibitory gamma
subunit re-evaluated. J Biol Chem 2002; 277:
5017–5023.
27 Vivas FA, Pestana RC, Ursin B: A new stabilized least-squares imaging condition. J Geophys Eng 2009;6:264–268.
28 Rudin LI, Osher S, Fatemi E: Nonlinear total
variation based noise removal algorithms.
Physica D: Nonlinear Phenomena 1992; 60:
259–268.
29 Gonzalez RC, Woods RE: Digital Image Processing, ed 2. Prentice Hall International,
2001.
30 Otsu N: A threshold selection method from
gray-level histograms. IEEE Trans Syst Man
Cybern 1979;9:62–66.
31 Gomez-Urquijo SM, Hökfelt T, Ubink R, Lubec G, Herrera-Marschitz M: Neurocircuitries of the basal ganglia studied in organotypic cultures: focus on tyrosine hydroxylase, nitric oxide synthase and neuropeptide
immunocytochemistry. Neuroscience 1999;
94:1133–1151.
Neurosignals
32 Polleux F, Morrow T, Ghosh A: Semaphorin
3A is a chemoattractant for cortical apical
dendrites. Nature 2000;404:567–573.
33 Jaumotte JD, Zigmond MJ: Dopaminergic
innervation of forebrain by ventral mesencephalon in organotypic slice co-cultures:
effects of GDNF. Brain Res Mol Brain Res
2005;134:139–146.
34 Tamariz E, Díaz-Martínez NE, Díaz NF,
García-Peña CM, Velasco I, Varela-Echavarría A: Axon responses of embryonic stem
cell-derived dopaminergic neurons to semaphorins 3A and 3C. J Neurosci Res 2010; 88:
971–980.
35 Voorn P, Kalsbeek A, Jorritsma-Byham B,
Groenewegen HJ: The pre- and postnatal development of the dopaminergic cell groups
in the ventral mesencephalon and the dopaminergic innervation of the striatum of the
rat. Neuroscience 1988;25:857–887.
36 Van Staveren WCG, Steinbusch HWM,
Markerink-Van Ittersum M, Repaske DR,
Goy MF, Kotera J, et al: mRNA expression
patterns of the cGMP-hydrolyzing phosphodiesterases types 2, 5, and 9 during development of the rat brain. J Comp Neurol 2003;
467:566–580.
37 Smoake JA, Song SY, Cheung WY: Cyclic
3ⴕ,5ⴕ-nucleotide phosphodiesterase. Distribution and developmental changes of the enzyme and its protein activator in mammalian tissues and cells. Biochim Biophys Acta
1974;341:402–411.
38 Davis CW, Kuo JF: Ontogenetic changes in
levels of phosphodiesterase for adenosine
3ⴕ:5ⴕ-monophosphate and glucosine 3ⴕ:5ⴕmonophosphate in the lung, brain and heart
from guinea pigs. Biochim Biophys Acta
1976;444:554–562.
39 Juilfs DM, Soderling S, Burns F, Beavo JA:
Cyclic GMP as substrate and regulator of cyclic nucleotide phosphodiesterases (PDEs).
Rev Physiol Biochem Pharmacol 1999; 135:
67–104.
40 Mehats C, Andersen CB, Filopanti M, Jin
SLC, Conti M: Cyclic nucleotide phosphodiesterases and their role in endocrine cell signaling. Trends Endocrinol Metab 2002; 13:
29–35.
41 Fujishige K, Kotera J, Michibata H, Yuasa K,
Takebayashi S, Okumura K, et al: Cloning
and characterization of a novel human phosphodiesterase that hydrolyzes both cAMP
and cGMP (PDE10A). J Biol Chem 1999;274:
18438–18445.
42 Seeger TF, Bartlett B, Coskran TM, Culp JS,
James LC, Krull DL, et al: Immunohistochemical localization of PDE10A in the rat
brain. Brain Res 2003;985:113–126.
43 Xie Z, Adamowicz WO, Eldred WD, Jakowski AB, Kleiman RJ, Morton DG, et al: Cellular and subcellular localization of PDE10A, a
striatum-enriched phosphodiesterase. Neuroscience 2006;139:597–607.
15
31
44 Boess FG, Hendrix M, van der Staay F-J, Erb
C, Schreiber R, van Staveren W, et al: Inhibition of phosphodiesterase 2 increases neuronal cGMP, synaptic plasticity and memory
performance. Neuropharmacology 2004; 47:
1081–1092.
45 Deng C, Wang D, Bugaj-Gaweda B, De Vivo
M: Assays for cyclic nucleotide-specific
phosphodiesterases (PDEs) in the central
nervous system (PDE1, PDE2, PDE4, and
PDE10). Curr Protoc Neurosci 2007;Chapter
7:Unit 7.21.
46 Bos LB: Epac proteins: multi-purpose cAMP
targets. Trends Biochem Sci 2006; 12: 680–
686.
47 Song H, Ming G, He Z, Lehmann M, McKerracher L, Tessier-Lavigne M, et al: Conversion of neuronal growth cone responses
from repulsion to attraction by cyclic nucleotides. Science 1998;281:1515–1518.
48 Schmidt CJ, Chapin DS, Cianfrogna J, Corman ML, Hajos M, Harms JF, et al: Preclinical characterization of selective phosphodiesterase 10A inhibitors: a new therapeutic
approach to the treatment of schizophrenia.
J Pharmacol Exp Ther 2008;325:681–690.
49 Siuciak JA, McCarthy SA, Chapin DS, Fujiwara RA, James LC, Williams RD, et al: Genetic deletion of the striatum-enriched phosphodiesterase PDE10A: evidence for altered
striatal function. Neuropharmacology 2006;
51:374–385.
16
Neurosignals
50 Nishi A, Kuroiwa M, Miller DB, O’Callaghan
JP, Bateup HS, Shuto T, et al: Distinct roles of
PDE4 and PDE10A in the regulation of
cAMP/PKA signaling in the striatum. J Neurosci 2008;28:10460–10471.
51 Sotty F, Montezinho LP, Steiniger-Brach B,
Nielsen J: Phosphodiesterase 10A inhibition
modulates the sensitivity of the mesolimbic
dopaminergic system to D-amphetamine:
involvement of the D1-regulated feedback
control of midbrain dopamine neurons. J
Neurochem 2009;109:766–775.
52 Chao MV: Neurotrophins and their receptors: a convergence point for many signalling
pathways. Nat Rev Neurosci 2003;4:299–309.
53 Vaudry D, Stork PJS, Lazarovici P, Eiden LE:
Signaling pathways for PC12 cell differentiation: making the right connections. Science
2002;296:1648–1649.
54 Ng YP, Wu Z, Wise H, Tsim KWK, Wong
YH, Ip NY: Differential and synergistic
effect of nerve growth factor and cAMP on
the regulation of early response genes during neuronal differentiation. Neurosignals
2009;17:111–120.
55 Laasberg T, Pihlak A, Neuman T, Paves H,
Saarma M: Nerve growth factor increases the
cyclic GMP level and activates the cyclic
GMP phosphodiesterase in PC12 cells. FEBS
Lett 1988;239:367–370.
56 Engele J, Bohn MC: The neurotrophic effects
of fibroblast growth factors on dopaminergic neurons in vitro are mediated by mesencephalic glia. J Neurosci 1991;11:3070–3078.
57 Nikkhah G, Odin P, Smits A, Tingström A,
Othberg A, Brundin P, et al: Platelet-derived
growth factor promotes survival of rat and
human mesencephalic dopaminergic neurons in culture. Exp Brain Res 1993; 92:516–
523.
58 Østergaard K, Jones SA, Hyman C, Zimmer
J: Effects of donor age and brain-derived
neurotrophic factor on the survival of dopaminergic neurons and axonal growth in
postnatal rat nigrostriatal cocultures. Exp
Neurol 1996;142:340–350.
59 Schatz DS, Kaufmann WA, Saria A, Humpel
C: Dopamine neurons in a simple GDNFtreated meso-striatal organotypic co-culture
model. Exp Brain Res 1999;127:270–278.
60 Thompson LH, Grealish S, Kirik D, Björklund A: Reconstruction of the nigrostriatal
dopamine pathway in the adult mouse brain.
Eur J Neurosci 2009;30:625–638.
32
Nachweis über Anteile der Co-Autoren, Dipl. Biochem. Katja Sygnecka
Organotypische Gewebe-Co-Kulturen des dopaminergen Systems –Ein Modell
zur Identifikation neuroregenerativer Substanzen und Zellen
Nachweis über Anteile der Co-Autoren:
Titel:
Phosphodiesterase 2 inhibitors promote axonal outgrowth in organotypic
slice co-cultures
Journal:
Neurosignals
Autoren:
C. Heine, K. Sygnecka, N. Scherf, A. Berndt, U Egerland, T. Hage, H. Franke
(geteilte Erstautorinnenschaft: CH und KS)
Anteil Sygnecka (Erstautorin):
- Gewebekulturen (Präparation, Behandlung, Aufarbeitung)
- Immunhistochemie
- Faserquantifizierung
- Analyse und Verarbeitung der Daten
- Revision und Fertigstellung des Manuskripts
Anteil Heine (Erstautorin):
- Projektidee
- Konzeption
- Immunhistochemie
- Analyse und Verarbeitung der Daten
- Erstellen der Abbildungen
- Schreiben der Publikation
Anteil Scherf:
- Bioinformatische Bildauswertung
Anteil Bernd, Egerland, Hage:
- Synthese von applizierten Substanzen
- In vitro PDE Assay
- Intrazellulärer cGMP Assay
Anteil Franke (Letztautorin):
- Projektidee
- Konzeption
- Gewebekulturen (Präparation, Tracing)
33
34
Int. J. Devl Neuroscience 40 (2015) 1–11
RESEARCH ARTICLES - Nimodipine
Contents lists available at ScienceDirect
International Journal of Developmental Neuroscience
journal homepage: www.elsevier.com/locate/ijdevneu
Nimodipine enhances neurite outgrowth in dopaminergic brain slice
co-cultures
Katja Sygnecka a,b,∗,1 , Claudia Heine a,b,1 , Nico Scherf c , Mario Fasold d , Hans Binder d ,
Christian Scheller a,e , Heike Franke b
a
Translational Centre for Regenerative Medicine (TRM), University of Leipzig, Philipp-Rosenthal-Straße 55, 04103 Leipzig, Germany
Rudolf Boehm Institute of Pharmacology and Toxicology, University of Leipzig, Härtelstr. 16-18, 04107 Leipzig, Germany
c
Institute for Medical Informatics and Biometry, Dresden University of Technology, Fetscherstraße 74, 01307 Dresden, Germany
d
Interdisciplinary Centre for Bioinformatics, University of Leipzig, Härtelstr. 16-18, 04107 Leipzig, Germany
e
Department of Neurosurgery, University of Halle-Wittenberg, Ernst-Grube-Str. 40, 06120 Halle/Saale, Germany
b
a r t i c l e
i n f o
Article history:
Received 19 September 2014
Received in revised form 24 October 2014
Accepted 26 October 2014
Available online 4 November 2014
Keywords:
Calcium channel blockade
Development
Neurite growth
Nimodipine
Organotypic slice co-culture
Regeneration
a b s t r a c t
Calcium ions (Ca2+ ) play important roles in neuroplasticity and the regeneration of nerves. Intracellular
Ca2+ concentrations are regulated by Ca2+ channels, among them L-type voltage-gated Ca2+ channels,
which are inhibited by dihydropyridines like nimodipine. The purpose of this study was to investigate the
effect of nimodipine on neurite growth during development and regeneration. As an appropriate model
to study neurite growth, we chose organotypic brain slice co-cultures of the mesocortical dopaminergic
projection system, consisting of the ventral tegmental area/substantia nigra and the prefrontal cortex
from neonatal rat brains. Quantification of the density of the newly built neurites in the border region
(region between the two cultivated slices) of the co-cultures revealed a growth promoting effect of
nimodipine at concentrations of 0.1 ␮M and 1 ␮M that was even more pronounced than the effect of the
growth factor NGF.
This beneficial effect was absent when 10 ␮M nimodipine were applied. Toxicological tests revealed
that the application of nimodipine at this higher concentration slightly induced caspase 3 activation in
the cortical part of the co-cultures, but did neither affect the amount of lactate dehydrogenase release or
propidium iodide uptake nor the ratio of bax/bcl-2. Furthermore, the expression levels of different genes
were quantified after nimodipine treatment. The expression of Ca2+ binding proteins, immediate early
genes, glial fibrillary acidic protein, and myelin components did not change significantly after treatment,
indicating that the regulation of their expression is not primarily involved in the observed nimodipine
mediated neurite growth. In summary, this study revealed for the first time a neurite growth promoting
effect of nimodipine in the mesocortical dopaminergic projection system that is highly dependent on the
applied concentrations.
© 2014 ISDN. Published by Elsevier Ltd. All rights reserved.
Abbreviations: ANOVA, analysis of variance; Arc, activity-regulated cytoskeleton-associated protein; CBPs, Ca2+ binding proteins; DAB, 3,3 -diaminobenzidine hydrochloride; DIV, days in vitro; Egr, early growth response protein; FCS, fetal calf serum; Fos, proto-oncogene c-Fos; GFAP, glial fibrillary acidic protein; HS, horse serum; IEGs,
immediate early genes; Junb, transcription factor jun-B; LDH, lactate dehydrogenase; LSM, laser scanning microscope; LVCC, L-type voltage-gated Ca2+ channels; Mal,
myelin and lymphocyte protein; MAP2, microtubule associated protein-2; Mog, myelin oligodendrocyte glycoprotein; MrpL32, mitochondrial ribosomal protein L32; NB-A,
Neurobasal-A; NGF, nerve growth factor; P, postnatal day; PFC, prefrontal cortex; PI, propidium iodide; Plp1, myelin proteolipid protein 1; Pvalb, parvalbumin; qPCR, quantitative reverse transcription polymerase chain reaction; SOM, self-organizing maps; TBS, tris buffered saline; Ubc, ubiquitin; VTA/SN, ventral tegmental area/substantia
nigra.
∗ Corresponding author at: Rudolf Boehm Institute of Pharmacology and Toxicology, University of Leipzig, Härtelstr. 16-18, 04107 Leipzig, Germany.
Tel.: +49 0341 97 24606; fax: +49 0341 97 24609.
E-mail addresses: [email protected] (K. Sygnecka), [email protected] (C. Heine), [email protected] (N. Scherf),
[email protected] (M. Fasold), [email protected] (H. Binder), [email protected] (C. Scheller), [email protected]
(H. Franke).
1
Both authors contributed equally to the study.
http://dx.doi.org/10.1016/j.ijdevneu.2014.10.005
0736-5748/© 2014 ISDN. Published by Elsevier Ltd. All rights reserved.
35
2
K. Sygnecka et al. / Int. J. Devl Neuroscience 40 (2015) 1–11
1. Introduction
Nimodipine is a blocker of the L-type voltage-gated Ca2+ channels (LVCC), which regulate the intracellular Ca2+ concentration.
Calcium ions (Ca2+ ) play an important role in neuronal plasticity
(Gispen et al., 1988). Their intracellular concentration is crucial
for the regulation of axonal and dendritic growth, guidance during
neuronal development and for resprouting of axons after injury
(for review see Gomez and Zheng, 2006). It has been shown that
proper neuronal development proceeds when the intracellular Ca2+
is within an optimal range (Fields et al., 1993; Kater and Mills,
1991; Kater et al., 1988). Therefore, the modulation of Ca2+ channels such as the LVCC is of special interest, when neurite (re)growth
is desired.
Being one of the examined LVCC blockers, the dihydropyridine
derivate nimodipine has been intensively studied. Its beneficial
effects have been confirmed in clinical studies (Liu et al., 2011,
Scheller and Scheller, 2012) and in diverse experimental studies,
where it has been applied to models of various disorders. These
experimental studies, analyzing the effect of nimodipine (and other
dihydropyridine LVCC blockers), focused on (i) the neuroprotective
properties after different kinds of neuronal injury (Harkany et al.,
2000; Krieglstein et al., 1996; Lecht et al., 2012; Li et al., 2009; Rami
and Krieglstein, 1994; Weiss et al., 1994), for example by reducing
the consequent intracellular free Ca2+ overload after e.g. ischemic
injury and excitotoxic lesion (Kobayashi and Mori, 1998) and (ii) the
neurite growth promoting characteristics, mainly investigated in
the peripheral nervous system (Angelov et al., 1996; Lindsay et al.,
2010; Mattsson et al., 2001).
LVCC are expressed in a couple of brain regions of the central
nervous system, among them the mesencephalon (Mercuri et al.,
1994; Nedergaard et al., 1993; Takada et al., 2001), the cortex, and
the hippocampus (Dolmetsch et al., 2001; Quirion et al., 1985; Tang
et al., 2003). In the cortex, LVCC are located on the entire postnatal
neuron including dendrites and axonal processes (Tang et al., 2003).
Although the beneficial outcomes of LVCC modulation by
nimodipine are well established, the exact cellular and molecular mechanisms by which this modulation occurs are still unclear.
Nevertheless, results of some previously published studies may
in part explain how neurite growth after nimodipine treatment
is accomplished. An upregulation of Ca2+ binding proteins (CBPs,
parvalbumin (Pvalb), S100b, calbindin) has been observed in cortical neurons after nimodipine administration (Buwalda et al.,
1994; Luiten et al., 1994). Furthermore, the expression of the
glial fibrillary acidic protein (GFAP) was enhanced following longterm nimodipine treatment (Guntinas-Lichius et al., 1997). An
increase in myelination was found surrounding the recovering
neurons after unilateral facial crush injury and interestingly also
around neurons located in the contralateral nonlesioned site in
nimodipine treated animals (Mattsson et al., 2001). Moreover,
microglial-mediated oxidative stress and inflammatory response
was attenuated by nimodipine (but not by other LVCC blockers) in dopaminergic neurons/microglial co-cultures (Li et al.,
2009).
In this study, we wanted to investigate whether nimodipine
directly influences neurite growth. We further aimed to elucidate
which genes are potentially involved in the nimodipine mediated
growth effects. To address these questions, we determined the neurite density in the border region of organotypic co-cultures of the
mesocortical dopaminergic system, which culture together brain
slices of the ventral tegmental area/substantia nigra (VTA/SN) and
prefrontal cortex (PFC) (Heine et al., 2007; Heine and Franke, 2014),
and analyzed gene expression patterns of nimodipine treated samples and control samples.
Our findings indicate that nimodipine, at appropriate dosages,
is a promising substance to enhance neurite outgrowth as shown in
the applied co-culture model of the dopaminergic (CNS)-projection
system.
2. Experimental procedures
2.1. Materials
The solvent ethanol was purchased from AppliChem GmbH (Darmstadt,
Germany) and VWR International (Dresden, Germany), respectively. Glutamate,
nerve growth factor (NGF), and staurosporine were purchased from Sigma–Aldrich
Co. (St. Louis, MO, USA). Nimodipine (pure substance) was a gift from Bayer Vital
GmbH (Leverkusen, Germany). 1000-fold stock solutions of nimodipine were prepared in absolute ethanol and finally added to 1 ml of incubation medium (resulting
ethanol concentration 0.1%, details see Section 2.3). Untreated cultures (“untreated”)
or cultures treated with the vehicle ethanol (“ethanol”, resulting end concentration
0.1%) were used as control groups.
2.2. Animals
Neonatal rat pups (WISTAR RjHan, own breed; animal house of the Rudolf Boehm
Institute of Pharmacology and Toxicology, University of Leipzig) of postnatal day
1–4 (P1-4) were used for the preparation of the organotypic slice co-cultures. The
animals were housed under standard laboratory conditions of 12 h light–12 h dark
cycle and allowed free access to lab food and water ad libitum.
All of the animal use procedures were approved by the Committee of Animal
Care and Use of the relevant local governmental body in accordance with the law of
experimental animal protection. All efforts were made to minimize animal suffering
and to reduce the number of animals used.
2.3. Preparation, culture and treatment of slice co-cultures
Dopaminergic brain slice co-cultures were prepared from P1-4 rats and cultured according to the “static” culture protocol described previously (Heine et al.,
2007; Heine and Franke, 2014). In brief, coronal sections (300 ␮m) were cut at mesencephalic and forebrain levels using a vibratome (Leica, Typ VT 1200S, Nussloch,
Germany). For details see also supplementary Fig. S1. After separation of VTA/SN
and PFC, respectively, the slices were transferred into petri dishes, filled with cold
(4 ◦ C) preparation solution (Minimum Essential Medium (MEM) supplemented with
glutamine (final concentration 2 mM) and the antibiotic gentamicin (50 ␮g/ml);
all from Invitrogen GmbH, Darmstadt, Germany). Thereafter, the selected sections
were placed as co-cultures (VTA/SN + PFC, 4 co-cultures per well) on moistened
membrane inserts (0.4 ␮m, Millicell-CM, Millipore, Bedford, MA, USA) in 6-well
plates (Fig. S1.A3), each filled with 1 ml incubation medium (50% Minimal Essential Medium, 25% Hank’s Balanced Salt Solution, 25% heat inactivated horse serum
(HS), 2 mM glutamine and 50 ␮g/ml gentamicin; all from Invitrogen GmbH supplemented with 0.044% sodium bicarbonate, Sigma-Aldrich; pH was adjusted to 7.2),
referred to as “25% HS incubation medium”.
Supplementary Fig. S1 can be found, in the online version, at http://dx.doi.org/
10.1016/j.ijdevneu.2014.10.005.
The preliminary gene expression studies (microarray analysis, quantitative
reverse transcription polymerase chain reaction, qPCR) have been conducted after
culture under serum-free culture conditions. Therefore, after 4 days in vitro (DIV)
the 25% HS incubation medium was replaced by serum-free medium (Neurobasal-A
(NB-A) medium, 1 mM glutamine supplemented with 2% B27 and 50 ␮g/ml gentamicin; all from Invitrogen GmbH), referred to as “NB-A incubation medium”.
Nimodipine (final concentration 10 ␮M) or the vehicle ethanol (0.1%), respectively
were added to the incubation medium at DIV4, 6, 8 and 11.
To determine the concentration of nimodipine that would be appropriate,
we first analyzed previous published studies and the therein used concentrations
(10 ␮M: Blanc et al., 1998; Krieglstein et al., 1996; Lecht et al., 2012; Tang et al.,
2003; 20 ␮M: Martínez-Sánchez et al., 2004; Pisani et al., 1998; Pozzo-Miller et al.,
1999; 50 ␮M: Bartrup and Stone, 1990, toxic at higher concentrations: Turner et al.,
2007). Second, we quantified nimodipine uptake into the co-cultures with applied
nimodipine concentrations ranging from 10 ␮M to 40 ␮M in a preliminary experiment. We found the lowest dose applied (10 ␮M nimodipine in the culture medium)
yielded a sufficiently high concentration in the tissue (unpublished results). Therefore, the following studies were at first conducted with 10 ␮M nimodipine.
The analysis of neurite growth in the organotypic brain slice co-cultures is
a well-established technique in our lab (Heine et al., 2013; Heine et al., 2007).
Therefore, the neurite growth analysis has been performed after culture in 25% HS
incubation medium. For the neurite growth quantification, slice co-cultures were
divided into different experimental groups and were treated with nimodipine at
different concentrations (first 10 ␮M, later 0.1 ␮M and 1 ␮M) or the vehicle control
ethanol. A second control group was left untreated. Nimodipine and ethanol were
added directly after the preparation and at each medium change at DIV1,4,6 and
8 (Fig. 1). In a second study the effect of 1 ␮M nimodipine alone or in combination
with 50 ng/ml NGF (final concentration) was compared to 50 ng/ml NGF alone. These
culture conditions (25% HS incubation medium, substance application five times
as indicated in Fig. 1) were also applied for toxicity tests and later gene expression
studies. In addition, tissue slices of the nimodipine treated groups were dissected
36
3
gene expression was performed by the CP method with MrpL32 and Ubc serving
as reference housekeeping genes.
2.5. Neurite quantification
Fig. 1. Culture and treatment schedule. For neurite growth, toxicity and later gene
expression analysis, nimodipine or ethanol were applied at day in vitro (DIV)0, 1, 4,
6 and 8. Neurite growth was quantified after biocytin tracing at DIV8 and fixation
at DIV11, as indicated. For the analysis of toxicity and gene expression, co-cultures
were harvested at DIV11.
in nimodipine containing preparation medium. This is in accordance to in vivo
data of a human study, where prophylactic treatment had the strongest beneficial
effect (Scheller et al., 2012). For this reason, 36 nM nimodipine were added to the
preparation solution on the basis of findings in the literature (Lindsay et al., 2010).
2.4. Analysis of gene expression
2.4.1. RNA extraction and quality control
RNA extraction was performed for microarray analysis and quantitative reverse
transcription polymerase chain reaction (qPCR). At the end of culture, both regions
of the co-cultures (PFC and VTA/SN) were separated with a scalpel and all PFCand VTA/SN-slices from one well, containing four co-cultures, were pooled to one
sample, respectively. Afterwards total RNA was isolated using TRIzol reagent (Life
Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instructions.
The total RNA was alcohol precipitated for a second time with addition of ammonium acetate and GlycoBlue (Life Technologies) for optimal recovery of the nucleic
acids. RNA integrity and concentration for each sample that was later on applied to
the microarray, was examined on an Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA, USA) using the RNA 6.000 LabChip Kit (Agilent Technologies)
according to the manufacturer’s instructions. RNA integrity and concentration of
samples, that were investigated by qPCR, were examined on a 1.5% agarose gel and
with NanoDrop1000 (NanoDrop Technologies, Wilmington, DE, USA), respectively.
2.4.2. Microarray analysis
Microarray measurements were conducted at the microarray core facility of
the Interdisziplinäres Zentrum für klinische Forschung (IZKF) Leipzig (Faculty of
Medicine, University of Leipzig). Biotin labeled probes were prepared from 250 ng
of total RNA using the TargetAmpTM -Nano Labeling Kit for Illumina® Expression
BeadChip (Biozym, Hessisch Oldendorf, Germany) according to the manufacturer’s
instructions. Hybridization of labeled probes to an Illumina Rat Ref12 BeadChip
(Illumina Inc., San Diego, CA, USA) using the respective BeadChip kit (Illumina)
was done according to the protocol of the manufacturer. Bead level data was
preprocessed using standard Illumina software resulting in background-corrected,
quantile-normalized expression estimates which were used for further analysis.
Ranked lists of differentially expressed genes were obtained in treatment-vs.-control
comparisons and judged using the Welch’s t-test and subsequent False Discovery Rate
adjustment (Opgen-Rhein and Strimmer, 2007). Gene Set Z-scoring (Törönen et al.,
2009) was used to perform gene set analysis using gene-ontology terms (Wirth et al.,
2012).
2.4.3. qPCR
Reverse transcription was performed using the RevertAidTM H Minus First Strand
cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany) with 1 ␮g total RNA and
oligo(dT)18 primer. qPCR was conducted using a LightCycler (Roche Diagnostics,
Mannheim, Germany) in a total volume of 10 ␮l per capillary containing 5 ␮l QuantiTect SYBR Green 2× Master Mix (Roche), 0.4 ␮l cDNA, 1 ␮l primer (5 ␮M, each)
specific for the different target genes or the reference genes (mitochondrial ribosomal protein L32, MrpL32 and ubiquitin, Ubc) and 3.6 ␮l water. The oligonucleotide
primer sequences are listed in Table A.1. The Hot Start Polymerase was activated by
a 15 min pre-incubation at 95 ◦ C, followed by 55 amplification cycles at 95 ◦ C for
10 s, 60 ◦ C for 10 s and 72 ◦ C for 10 s. The obtained crossing point (CP) values were
between 15 and 28 for the different target genes. A melting curve analysis was performed to verify correct qPCR products. The following appropriate controls have
been used: no template control (water) and “reverse transcription-minus control”,
in order to exclude the presence of genomic DNA in the samples. Quantification of
2.5.1. Tracing and neurite visualization
To quantify neurite outgrowth between the two slices of the co-cultures,
biocytin-tracing (detailed time schedule in Fig. 1) was performed according to a
previously described protocol (Franke et al., 2003; Heine et al., 2007). At DIV8,
small biocytin-crystals of similar size were placed onto the VTA/SN slice of the
co-cultures. Co-cultures were left in contact with the crystals for 2 h to allow the
uptake of biocytin. Afterwards they were reincubated with medium containing
the respective nimodipine concentrations for 48 h. At DIV11, the cultures were
fixed and cut into 50 ␮m vibrosections. Afterwards, the anterograde tracer biocytin
was labeled using the avidin–biotin-complex (1:50, ABC-Elite Kit, Vector Laboratories, Inc., Burlingame, CA, USA), in combination with nickel/cobalt-intensified
3.3 -diaminobenzidine hydrochloride (DAB; Sigma–Aldrich) as a chromogen. After
mounting on glass slides, all stained sections were dehydrated in a series of graded
ethanol, processed through n-butylacetate and covered with Entellan (Merck, Darmstadt, Germany).
2.5.2. Automated image quantification
The quantification of outgrowing biocytin-traced neurites was performed as
previously described (Heine et al., 2013; Heine and Franke, 2014). Briefly, microscopic images were taken at 40-fold magnification in the border region (where the
two initially separated brain slices were grown together, for details see also Fig.
S1.B1) using an usual transmitted light bright field microscope (Axioskop 50; Zeiss
Oberkochen, Germany) equipped with a CCD camera (DCX-950P, SONY Corporation,
Tokyo, Japan). The following criteria were used for the selection of the biocytintraced slices: (a) the tracer was correctly placed on the VTA/SN, (b) the major part of
the VTA/SN was characterized by a dense network of biocytin-traced structures and
(c) no traced cell bodies had been observed in the target region PFC (in more detail
described in Heine et al., 2007). During image acquisition, preceding treatments of
the observed tissue slices were hidden from the experimenter.
After pre-processing of the images (for details see Heine et al., 2013), neurite
structures appeared as well-defined bright regions. Subsequently, the image area
occupied by the neurites was measured to obtain a reasonable estimate of the underlying neurite density of the analyzed specimens. Precisely, the ratio of the number
of foreground pixels (neurites) against the total number of pixels in the images was
taken, giving the percentage of area occupied by neurites in the focal plane. Neurite
density was subsequently normalized to the median values of the untreated controls
of each individual experiment.
2.6. Analysis of cell death
2.6.1. Lactate dehydrogenase (LDH) activity in conditioned culture medium
LDH release into the 25% HS incubation medium was quantified after treatment
with 0.1 ␮M, 1 ␮M and 10 ␮M (time schedule according to Fig. 1). Medium samples
were collected at every medium exchange (DIV1, 4, 6, 8) and before fixation (DIV11),
and stored at −20 ◦ C until further analysis.
When the samples reached room temperature after thawing, LDH activity was
measured by the method of Koh and Choi (1987) applied to 96-well plate format
using filter-based plate reader device (Polarstar Omega von BMG Labtech, Offenburg,
Germany) measuring the absorption at 340 nm. Briefly, the LDH substrate pyruvate and the coenzyme NADH (both Sigma–Aldrich) were added to the conditioned
medium samples and the decrease of NADH due to LDH activity was measured over
the time (every 10 s for 3 min).
To exclude variations due to temperature changes between individual sets of
measurements, LDH activity of all samples has been normalized to the control sample (untreated) at DIV1 of the respective preparation.
2.6.2. Active caspase 3 immunolabeling and propidium iodide (PI) uptake
For the active caspase 3 immunolabeling and PI (Invitrogen GmbH) uptake quantification, nimodipine was applied at 0.1 ␮M, 1 ␮M and 10 ␮M as described above
for the neurite quantification study. As positive controls for caspase 3 activation
and the induction of necrosis, 5 ␮M staurosporine (for 4 h) and 10 mM glutamate
(for 48 h), respectively, have been added to the incubation medium prior to fixation
of the co-cultures at DIV11. PI (7.5 ␮M) was added 3 h before the fixation to every
culture well.
After fixation, co-cultures were cut into 50 ␮m slices as described above and
stained. In detail, slices were blocked with Tris buffered saline (TBS, 0.05 M; pH
7.6) containing fetal calf serum (FCS, 5%) and Triton X-100 (0.3%) for 30 min. Then,
the slices were incubated with a primary antibody directed against active caspase
3 (produced in rabbit, 1:50, MBL International, Inc., Woburn, MA, USA) for 48 h at
4 ◦ C. After washing with TBS, the secondary antibody (donkey anti rabbit Alexa488
conjugated IgG, 1:400, Jackson ImmunoResearch, West Grove, PA, USA), diluted
in TBS supplemented with 5% FCS and 0.3% Triton X-100, was applied for 2 h at
room temperature. For further characterization of active caspase 3 positive cells,
multiple fluorescence labeling was performed. The slices were incubated with a
mixture of primary antibodies (rabbit anti-active caspase 3, 1:50, MBL International,
37
4
in combination with mouse anti-microtubule associated protein-2 (MAP2), 1:1000,
Millipore, Temecula, CA, USA and goat anti-GFAP, 1:1000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) for 48 h at 4 ◦ C. After washing with TBS, the secondary
antibodies (donkey anti rabbit Cy3 conjugated IgG, 1:1000 and donkey anti mouse
Alexa488 conjugated IgG, 1:400 and donkey anti goat Dyelight 647 conjugated IgG,
all Jackson ImmunoResearch, West Grove, PA, USA), diluted in TBS supplemented
with 5% FCS and 0.3% Triton X-100, was applied for 2 h at room temperature. In
addition, slices were stained with the nucleic acid probe Hoechst 33342 (40 ␮g/ml,
Molecular Probes, Leiden, Netherlands), to identify the cell nuclei. After mounting
on glass slides, all stained sections were dehydrated and covered as described above.
2.6.3. Image analysis
Fluorescence labeled specimens were imaged with a confocal laser scanning
microscope (LSM 510 Meta; Zeiss, Oberkochen, Germany). Excitation wavelengths
were 633 nm, 543 nm, 488 nm and 351 nm/364 nm to evoke the Dyelight 647, PI,
Alexa488 and Hoechst fluorescence, respectively. Microscopic images were taken
at 20-fold magnification. For each group, 6 slices were analyzed within the PFC and
VTA/SN, (3 pictures per slice and region, resulting in 18 pictures per group and
region). During image acquisition and manual cell counting preceding treatments
of the observed tissue slices were hidden from the experimenter. Cells positive for
active caspase 3 were counted manually with the help of ImageJ cell counter plugin
(http://rsb.info.nih.gov/ij/; http://rsbweb.nih.gov/ij/plugins/cell-counter.html). PI
uptake quantification was conducted with an algorithm implemented in Wolfram
Mathematica 9.0.1. To assess the number of PI positive cell nuclei, a global threshold
for binarization was chosen to divide the image in PI positive nuclei and background.
Furthermore, a maximal particle size was defined to estimate the number of cell
nuclei in regions where the segmentation could not separate single nuclei. In those
cases, the area of the region was divided by the mean cell size (which was determined from a visually verified image), to obtain a rough estimate of the number of
cells which are connected in this region.
2.7. Statistics
All quantitative data (except microarray analysis) has been analyzed with
SigmaPlot 12 statistical analysis program. Details referring to the applied tests are
specified in the respective result section and in the figure legends.
3. Results
3.1. Upregulation of immediate early genes (IEGs) in the PFC after
treatment with 10 M nimodipine
To elucidate the mode of action of nimodipine, we conducted
a microarray study to preliminarily identify the genes whose
expression is modulated by nimodipine application. After substance application (4 times 10 ␮M, for details regarding the chosen
concentration see Section 2.3), co-cultures were separated into
PFC and VTA/SN. The two regions were analyzed individually.
Gene expression patterns of untreated, vehicle control ethanol, or
nimodipine treated samples were compared. There were no differentially expressed genes in the VTA/SN, but we found upregulated
genes in the nimodipine treated PFC samples. Therefore, we focused
on the PFC samples for further gene expression analyses.
Self-organizing map (SOM) analysis of the microarray data was
used to visualize the expression patterns of each sample that
has been applied to the microarray. The comparison of the SOMs
revealed that the expression patterns of both controls (untreated
and ethanol) were very similar to each other. Therefore, the samples of the two groups were combined to a single control group
for further analysis of the microarray study. Differential expression
analysis of nimodipine versus control group within the PFC yielded
seven genes with log fold changes > 2 (log2 FC, p-value Welch’s ttest): Arc (activity-regulated cytoskeleton-associated protein, log2
FC 3.487, p = 0.018), Egr1 (early growth response protein 1, log2
FC 2.466, p = 0.06), Egr2 (log2 FC 3.568, p = 0.095), Egr4 (log2 FC
2.844, p = 0.177), Fos (proto-oncogene c-Fos, log2 FC 2.05, p = 0.219),
JunB (transcription factor jun-B, log2 FC 2.069, p = 0.280), and Pmch
(pro-MCH precursor, log2 FC 2.853, p = 0.499). The transcripts of the
IEGs (Arc, Egr1,2,4, Fos and JunB) were quantified by qPCR of five
independent preparations. With the exception of JunB, significantly
higher gene expressions were confirmed after nimodipine treatment, with median values ranging from 5-fold to 36-fold compared
Fig. 2. Results of qPCR validation experiments. (A–F) Expression levels of the IEGs,
which were found to be upregulated in the PFC in the microarray study: Arc, activityregulated cytoskeleton-associated protein; Egr1,2 and 4, early growth response
protein 1, 2 and 4; Fos, proto-oncogene c-Fos; Junb, transcription factor jun-B are
expressed as CP, normalized to untreated control (y-axis), while x-axis represents the different treatments (application of 0.1% ethanol (in the figure: eth) or
10 ␮M nimodipine (in the figure: Nim), respectively at DIV4, 6, 8 and 11). Statistical
analysis was done in comparison to vehicle control ethanol. (A–E) Treatment with
10 ␮M nimodipine increased expression of the investigated genes of interest significantly. Data are shown as box plots, n(independent samples) = 5, *p < 0.05, **p < 0.01,
Mann–Whitney rank sum test.
to vehicle control ethanol, Mann–Whitney rank sum test, p < 0.05,
p < 0.01 (Fig. 2). All of these validated upregulated genes belong to
the group of IEGs. The transcriptional activation of these genes after
nimodipine treatment, which are involved in neurite growth and
plasticity (reviewed in Pérez-Cadahía et al., 2011; Shepherd and
Bear, 2011) strongly suggested a nimodipine induced enhancement
in neurite growth in our test system under the applied conditions.
3.2. No enhanced neurite growth after treatment with 10 M
nimodipine
In parallel to preliminary gene expression analysis, we investigated whether nimodipine may enhance neurite growth in the
dopaminergic system. Therefore a treatment study with 10 ␮M
nimodipine in comparison to untreated and vehicle ethanol treated
control co-cultures was performed, following a well-established
treatment schedule for neurite growth analysis (Fig. 1 and Heine
et al., 2007, 2013). Surprisingly, treatment with nimodipine at this
concentration did not enhance neurite growth in the border region
38
(for details see Fig. S1) of the co-cultures. Automated image quantification of at least 60 analyzed pictures per group revealed that
the median value for neurite density in 10 ␮M nimodipine treated
co-cultures was even lower than neurite density in the vehicle
control (10 ␮M nimodipine was 85% of ethanol group, p = 0.283;
Mann–Whitney rank sum test, data not shown).
3.3. 10 M nimodipine induces an increase in active caspase 3
positive cells, but has no influence on PI uptake, LDH release and
bax/bcl-2 ratio
We wanted to clarify whether the application of 10 ␮M
nimodipine to the co-cultures induces (neuro-)toxic effects. Different toxicological methods have been used after application of
0.1 ␮M, 1 ␮M, and 10 ␮M nimodipine (according to the treatment
schedule shown in Fig. 1) to quantify apoptotic and necrotic cell
death: (i) measurement of LDH release into the incubation medium,
(ii) PI uptake quantification, (iii) analysis of caspase 3 activation
in immunostained co-culture slices, and (iv) calculation of the
bax/bcl-2 ratio.
The highest LDH activity was detected at DIV1 (Fig. 3A ). It
decreased during the culture period without a significant difference
between the differently treated groups. These findings are substantiated by the analysis of PI uptake into the PFC and the VTA/SN,
where no significant changes were observed after the different
treatments, except in the positive control treated with glutamate
(10 mM, 48 h). Data are shown in Fig. 3B.
Moreover, the number of the active caspase 3 positive cells was
quantified after immunofluorescence labeling (exemplary microscopic images are shown in Fig. 3D–F). We found a slightly but
significantly increased number of cells being positive for active caspase 3 staining after treatment with nimodipine (10 ␮M) in the
cortical part of the cell culture compared to the vehicle ethanol
treated control (p < 0.05). In comparison, the positive control staurosporine, which is known to induce apoptosis, was characterized
by an obviously much higher number of active caspase 3 positive cells (p < 0.01); n(analyzed images) = 18, ANOVA on ranks
followed by all pairwise multiple comparison procedures (Dunn’s
test) (Fig. 3C). To assess apoptosis with a second method, expression
levels of bax and bcl-2 were quantified and bax/bcl-2 ratio was calculated for all different treatments (untreated, ethanol, nimodipine
(0.1–10 ␮M)) in PFC and VTA/SN samples. In contrast to active caspase 3 immunoreactivity, no significant changes were detected
between the different groups (data not shown).
With multiple fluorescence labeling, we further aimed to characterize the identity of the cells being apoptotic after application of
10 ␮M nimodipine. Active caspase 3 positive cells are often surrounded by GFAP positive structures (Fig. 3G). Additionally, we
found active caspase 3 immunoreactivity and apoptotic fragmentation of cell nuclei (Fig. 3G, insert) located in areas where MAP2
staining is less defined (Fig. 3H,I), indicating a locally restricted loss
of MAP2 immunoreactivity during apoptosis.
3.4. Significant enhancement of neurite growth after treatment
with 0.1 M and 1 M nimodipine
After having shown that 10 ␮M nimodipine induces caspase
3 activation in the organotypic brain slice co-cultures whereas
0.1 ␮M and 1 ␮M do not, the neurite growth promoting potential
of nimodipine was investigated again by applying these lower concentrations to the co-cultures (according to the time schedule of
treatment in Fig. 1). After application of nimodipine at both concentrations (0.1 ␮M, 1 ␮M), a visible increase in biocytin-traced
outgrowing neurites in the border region of the co-cultures was
observed in comparison to control conditions (untreated control,
ethanol; Fig. 4A). In contrast, neurite density after the application of
5
10 ␮M nimodipine is as low as in the images of the controls (Fig. 4A).
These qualitative observations have been confirmed by automated
image quantification, revealing a significant augmentation of the
neurite density in co-cultures which had been treated with 0.1 ␮M
and 1 ␮M nimodipine (116% and 127% of vehicle control ethanol,
respectively), n(analyzed images) > 225, p < 0.01, ANOVA on ranks
followed by all pairwise multiple comparison procedures (Dunn’s
test) (Fig. 4B).
For a better estimation of the neurite growth promoting impact
of nimodipine in our co-culture system, the effect of 1 ␮M nimodipine was compared to the well-known growth factor NGF. To check
additionally for potential synergistic action, both compounds were
also applied together. The strongest effect was observed for the
combination of both compounds (138% of vehicle control ethanol),
followed by 1 ␮M nimodipine (127% of vehicle control ethanol) and
NGF alone (119% of vehicle control ethanol), (see supplementary
Fig. S2). All of these treatments were significantly higher than the
vehicle control ethanol (p < 0.01). The combination of nimodipine
(1 ␮M) and NGF was significantly higher than NGF alone (p < 0.05)
but not significantly higher than 1 ␮M nimodipine, n(analyzed
images) > 173, ANOVA on ranks followed by all pairwise multiple
comparison procedures (Dunn’s test).
Supplementary Fig. 2 can be found, in the online version, at
http://dx.doi.org/10.1016/j.ijdevneu.2014.10.005.
3.5. Expression levels of CBPs, IEGs and myelin constituents are
not altered by 0.1 M and 1 M nimodipine
With neurite density quantification, we did show a neurite
growth promoting effect of nimodipine (0.1 ␮M, 1 ␮M) in the
dopaminergic projection system. Nevertheless, the mode of action
remained unclear and we wanted to address this issue. After culture under the conditions, where enhanced neurite outgrowth was
found, we quantified the changes in expression levels of several
genes in PFC and VTA/SN separately (Fig. 5 exemplarily shows the
results for the PFC, treatment according to Fig. 1): (i) The CBPs Pvalb
and S100b have been reported to be upregulated after nimodipine
treatment (Buwalda et al., 1994; Luiten et al., 1994). Our results
revealed no significant changes in gene expression in our model in
response to nimodipine application. (ii) It was shown that nimodipine treatment causes an increase in the thickness of the myelin
sheath (Mattsson et al., 2001). Therefore, we quantified expression
levels of the myelin constituents myelin and lymphocyte protein
(Mal), myelin oligodendrocyte glycoprotein (Mog) and myelin proteolipid protein 1 (Plp1). Again, no significant changes in gene
expression were found. (iii) Guntinas-Lichius et al. (1997) described
a nimodipine induced increase in transcripts of GFAP. We quantified GFAP in our experimental model, detecting no significant
change in expression levels. (iv) Furthermore, we tested if the IEGs
that were found to be up-regulated in the microarray will also be
up-regulated under the conditions that lead to enhanced neurite
growth. The findings from the microarray and subsequent qPCR
validation (with 10 ␮M nimodipine) were not confirmed after culture under neurite growth conditions. We found that the expression
of Arc, Egr1, Egr2, Fos and Junb was not significantly changed after
treatment with nimodipine (0.1 ␮M, 1 ␮M). Nevertheless, there is
a tendency of a concentration dependent reduction of expression
levels of the above mentioned genes, which was significant for Egr4
after application of 1 ␮M nimodipine, n(independent samples) = 6
for all analyzed transcripts (Fig. 5).
4. Discussion
We investigated the effects of nimodipine in an organotypic
co-culture model of the dopaminergic system and we found
39
6
Fig. 3. Toxicity testing. (A) LDH release into 25% HS incubation medium. Data have been normalized to the control value at DIV1 of the respective preparation. Being maximal
at DIV1, LDH activity decreased during the culture period without significant differences between the differently treated groups. (B) Propidium iodide uptake quantification
in the co-cultures, shown as percentage of maximal damage after treatment with 10 mM glutamate. No significant changes were found after nimodipine (in the figure:
Nim) application in comparison to the vehicle control ethanol (in the figure: eth). Data are shown as means, error bars indicate standard error, n(analyzed pictures) = 18,
except glutamate: n = 9, **p < 0.01, ANOVA followed by all pairwise multiple comparison procedures (Holm–Sidak test). (C) Quantification of active caspase 3 positive cells
40
7
Fig. 4. Neurite outgrowth quantification. (A) Representative microscopic images of biocytin positive neurites in the border region, as they were used for neurite density
quantification. For comparison and reference, an image of neurites treated with 10 ␮M nimodipine is included, (scale bar: 50 ␮m). (B) Neurite growth is significantly increased
after treatment with 0.1 ␮M and 1 ␮M nimodipine (in the figure: Nim) in comparison to the vehicle control (0.1% ethanol). Neurite density data have been normalized to the
median value of the untreated control group of each individual preparation. Data are shown as box plots, n(analyzed pictures) > 225, **p < 0.01, ANOVA on ranks followed by
all pairwise multiple comparison procedures (Dunn’s test).
increased density of neurites in the border region of the co-cultures
after application of nimodipine at certain concentrations (0.1 ␮M,
1 ␮M). The application of 10 ␮M nimodipine did not enhance
neurite density. In contrast, we observed a moderate caspase
3 activation following application of 10 ␮M nimodipine. Moreover, we quantified the expression of several genes (CBPs, IEGs,
GFAP and myelin constituents) in the co-cultures after incubation under the conditions, where enhanced neurite growth has
been found. The expression of the investigated genes did not
change significantly after treatment, indicating that other mechanisms are involved in the observed nimodipine mediated neurite
growth.
(in the graph: active caspase 3+ cells) in the cortical parts of the co-cultures detected by immunofluorescence staining. There are significantly more active caspase 3 positive
cells found after application of 10 ␮M nimodipine, but not as pronounced as after application of 5 ␮M staurosporine (in the figure: sts), which served as a positive control
for the induction of apoptosis. Data are shown as box plots, n(analyzed pictures) = 18, *p < 0.05, **p < 0.01, ANOVA on ranks followed by Dunn’s multiple comparison against
ethanol. (D–F) Confocal fluorescence microscopic images of the cortical part of the co-cultures after application of (E) 1 ␮M and (F) 10 ␮M nimodipine in comparison to (D)
vehicle control ethanol. The number of active caspase 3 positive cells after treatment with 10 ␮M nimodipine is markedly increased. (G–I) Higher magnification of an active
caspase 3 positive cell after treatment with 10 ␮M nimodipine; the active caspase 3 positive cell body (red, arrow) is surrounded by GFAP positive structures (green, G).
Hoechst staining exhibits the fragmentation of the nucleus, typical for apoptotic cells, highlighted in the insert in (G). No clear co-localization with MAP2 (green, H and I)
has been found, probably due to reduced immunoreactivity in apoptotic neurons (I). Active caspase 3 negative neurons with well-defined cell bodies are indicated by empty
arrowheads. (Scale bars: D–F = 50 ␮m; G–I = 20 ␮m)
41
8
Fig. 5. Gene expression analysis in the PFC after treatment under “neurite growth promoting conditions”. (A–E, G) Expression levels of immediate early genes decrease
after application of 0.1 ␮M and 1 ␮M nimodipine. (F, H–L) Expression levels of GFAP, myelin constituents (Mal, Mog, Plp1) and Ca2+ binding proteins (Pvalb, S100b) are not
significantly altered by nimodipine treatment under the applied conditions. Results are expressed as CP, normalized to the untreated control (y-axis), while the x-axis
represents the different treatments according to Fig. 1. n(independent samples) = 6, *p < 0.05. (A–H, K) Data are shown as means, error bars indicate standard error, ANOVA
followed by multiple comparisons vs. vehicle control ethanol (in the figure: eth), (Holm–Sidak test). (I, J, L) Data are shown as box plots, ANOVA on ranks; differences of
expression levels were not significant.
4.1. Calcium and neurite growth
Axon outgrowth occurs within optimal levels of intracellular
Ca2+ . If levels rise above or fall below a narrow optimal level
growth is decelerated or inhibited (Kater et al., 1988). This suggests that nimodipine at concentrations of 0.1 ␮M and 1 ␮M – the
concentrations that enhanced neurite density in our study – influences intracellular Ca2+ concentrations in a way that is optimal
for neurite outgrowth in the used model. Even though it is not
proven by our experiments, based on the published literature it
seems very likely that Ca2+ is the causative agent in our model:
LVCC play an active and specific role in mediating the effects of
Ca2+ on growth cone motility and morphology, and different studies reported that Ca2+ influx through these channels affect axonal
growth (Nishiyama et al., 2003; Schmitz et al., 2009; Tang et al.,
2003). In addition, process extension is not only regulated by prolonged shifts in Ca2+ influx or intracellular baseline changes, but
also by temporal intracellular Ca2+ fluctuations (Gomez and Zheng,
2006). Transient elevations of intracellular Ca2+ levels, either spontaneous or electrically stimulated, are known to affect neurite
extension. It was shown that the incidence, frequencies, and amplitudes of Ca2+ transients are inversely related to the rate of axon
outgrowth (Gomez et al., 1995; Gomez and Spitzer, 1999; Gu and
Spitzer, 1995). This is consistent with our observations and the
results of other studies, which have shown that partial blocking
or silencing of Ca2+ influx by LVCC blockade accelerated axonal
sprouting and outgrowth (Angelov et al., 1996; Lindsay et al., 2010;
Mattsson et al., 2001).
As already mentioned above, the concentration of the applied
LVCC blockers seems to be crucial. Daschil and Humpel (2014) have
shown a dose-dependent effect of LVCC blockers on the survival
of SN pars compacta neurons in dopaminergic brain slices. Among
the tested concentrations (0.1 ␮M, 1 ␮M and 10 ␮M), only 1 ␮M
and 10 ␮M nifedipine and 1 ␮M nimodipine markedly enhanced
the survival of SN neurons. In addition, after blockade of LVCC
with nifedipine at increasing concentrations (5–30 ␮M), Tang et al.
(2003) observed increased axon lengths of cortical neurons in
cell culture experiments. They also applied nimodipine (10 ␮M)
and found neurite growth enhancement. In contrast, we did not
find growth promotion, but rather toxic effects with nimodipine
used at this concentration. This discrepancy likely relates to differences between the two model systems and application schemes
(single versus repeated long-term application). The latter is especially likely to be a relevant difference as Koh and Cotman (1992)
reported that prolonged LVCC blockade has detrimental effects on
neurons.
42
4.2. Neuroprotection and neurotoxicity
In this study, we focused on the regenerative and growth
promoting potential of nimodipine in the dopaminergic system.
However, parameters of neuroprotection have also been analyzed.
The absence of a reduction of LDH release in the nimodipine
(0.1 ␮M, 1 ␮M, 10 ␮M) treated samples after the preparation of the
brain slices (representing a mechanical insult with deterioration
of neuronal connections) does not suggest a neuroprotective effect
of nimodipine in the used experimental model. In contrast, quantification of active caspase 3 after nimodipine (10 ␮M) application
revealed the induction of apoptosis.
Recently, it was reported that 10 ␮M nimodipine is toxic to cultured hippocampal neurons (Sendrowski et al., 2013). Additionally,
high concentrations and prolonged administration of LVCC blockers like nimodipine have been reported to be toxic in primary cell
cultures (Koh and Cotman, 1992) and in vivo (Turner et al., 2007).
There is an increased vulnerability to Ca2+ deprivation especially
within a tight time window during postnatal neuronal development (around P7) (Turner et al., 2007).
Moreover, Puopolo et al. (2007) have found that nimodipine
(3 ␮M) completely blocks spontaneous firing in acutely dissociated SN pars compacta neurons, and Mercuri et al. (1994) did show
in mesencephalic brain slice cultures that spontaneous electrical
activity of dopaminergic neurons is blocked by the application of
10 ␮M nimodipine. It is widely accepted that electrical activity is a
prerequisite for neuronal survival and its blockade leads to programmed cell death (as reviewed by Mennerick and Zorumski,
2000). Therefore, we suggest that the observed caspase 3 activation
and the absence of enhanced neurite growth in the co-cultures after
application of 10 ␮M nimodipine could be a result of the reduced
electrical activity (due to the LVCC blockade).
With multiple fluorescence labeling after application of 10 ␮M
nimodipine, we found active caspase 3 immunoreactivity located
in areas where MAP2 staining is less defined compared to the
surroundings where MAP2 staining is distinctly demarcated.
Therefore, our interpretation of the multiple immunofluorescence
labeling is that presumably neurons undergoing apoptosis following LVCC blockade by 10 ␮M nimodipine. This is in line with other
reports, indicating that disappearance of MAP2 can be used as a
marker for neurotoxic events (Koczyk, 1994). Moreover, earlier
studies demonstrated that only neurons – not glial cells – are vulnerable to higher concentrations of nimodipine (Koh and Cotman,
1992). We suggest that the GFAP positive structures surrounding
active caspase 3 positive cell bodies most likely belong to reactive
astrocytes, which envelop apoptotic neurons and thereby isolate
the dying cells from the environment.
4.3. Nimodipine’s mode of action and target cells
To elucidate the mechanism leading to the reported beneficial
effects of nimodipine, gene expression has been analyzed using
expression microarrays. We found a group of genes belonging to
IEGs to be upregulated in the nimodipine treated PFC samples.
Given that (i) the PFC is the target region of the dopaminergic neurite processes and therefore the region where new connections are
established; (ii) the PFC is supposed to produce guiding signals
that trigger neurite ingrowth (Gomez-Urquijo et al., 1999; Plenz
and Kitai, 1996) and (iii) changes in gene expression in the VTA/SN
following nimodipine application were not found in the applied
model, we focused on the PFC samples for further gene expression
analyses.
Applying qPCR after culture under the conditions promoting enhanced neurite growth, we pursued the leads from other
published investigations and interpreted our own preliminary
microarray analysis as discussed below:
9
Transient upregulation of Pvalb and S100b until P10 was
observed in the neocortex and the hippocampus after maternal perinatal nimodipine administration in rats (Buwalda et al.,
1994). This upregulation of CBPs was supposed to be one of the
mechanisms that lead to the observed neuroprotective effect of
nimodipine after perinatally occurring ischemic insults. We did
not find such an increase in transcripts encoding for the chosen CBPs (Pvalb, S100b) in response to nimodipine treatment
in the cortical part of the co-cultures at the end of the culture
period.
LVCC are also present on glia (D’Ascenzo et al., 2004; Latour
et al., 2003; Westenbroek et al., 1998). It was shown that long-term
treatment with nimodipine (in vivo, >42 days) led to enhanced and
prolonged astroglial ensheathment of axotomized, target deprived
neurons in an in vivo model of facial and hypoglossal nerve
resection, (Guntinas-Lichius et al., 1997). It was further shown that
nimodipine reduced cell loss and increased GFAP immunoreactivity in a model of traumatic brain injury (Thomas et al., 2008).
However, quantification of GFAP encoding mRNA transcripts did
not reveal changes of gene expression levels in our model at
DIV11.
In addition, application of nimodipine increased not only the
number and size of myelinated axons of the facial nerve but also
increased the degree of myelination, both in lesioned and nonlesioned facial nerves (Mattsson et al., 2001). In order to explore
whether nimodipine application affects myelination and thereby
stabilizes axonal growth in our model, we quantified the transcripts
of the myelin components Mal, Mog and Plp1. No significant gene
expression changes have been found, suggesting that this aspect is
not relevant for the enhanced neurite growth observed in dopaminergic brain slice co-cultures.
In the microarray and qPCR analysis, we found IEGs to be upregulated after 10 ␮M nimodipine application. We wanted to confirm
this upregulation under the conditions that enhanced neurite outgrowth. IEGs are closely related to neuronal growth and plasticity
and therefore are interesting candidates for the regulation of neurite growth (reviewed in Pérez-Cadahía et al., 2011; Shepherd
and Bear, 2011). However, the findings from the microarray analysis were not reproduced after application of 0.1 ␮M or 1 ␮M
nimodipine. In contrast, we found a decrease in expression levels
after nimodipine (0.1 ␮M, 1 ␮M) treatment. The down-regulating
effect of a dihydropyridine LVCC blocker on the expression of IEGs
(e.g. c-Fos, JunB, Egr1 and others) is in line with the results of
Murphy et al. in cultured cortical neurons (Murphy et al., 1991)
and with the findings reviewed by Sheng and Greenberg, which
demonstrated an upregulation of these genes not only after stimulation with growth factors (NGF and Epidermal Growth Factor,
EGF) but also after Ca2+ influx and depolarization (Sheng and
Greenberg, 1990). This study further corroborates the notion that
blockade of Ca2+ influx inhibits IEG expression rather than induces
it.
In summary, the results of the gene expression analysis
indicate that the regulation of the expression of the investigated genes cannot clearly explain the observed nimodipine
mediated neurite growth in the applied model of the dopaminergic projection system. Therefore, referring to the investigated
genes, nimodipine-induced neurite outgrowth does not seem to
depend on mRNA synthesis. In contrast, mechanisms including
non-coding RNA or nimodipine-induced protein modifications
should be considered and examined in further investigations.
4.4. Conclusion and translational outlook
Nimodipine – at certain concentrations (0.1 ␮M, 1 ␮M) –
seems to influence the intracellular Ca2+ concentration in a way
43
10
Table A.1
Sequences of primers for quantitative polymerase chain reaction (qPCR).
Target
Accession ID
Forward primer
Reverse primer
Genes of interest
Arc
Bax
Bcl-2
Egr1
Egr2
Egr4
Fos
Junb
Gfap
Mal
Mog
Plp1
Pvalb
S100b(eta)
NM
NM
NM
NM
NM
NM
NM
NM
NM
NM
NM
NM
NM
NM
019361.1
017059.2
016993.1
012551.2
053633.1
019137.1
022197.2
021836.2
017009.2
012798.1
022668.2
030990.2
022499
013191.1
GCCAGTCTTGGGCAGCATAG
ACCCGGCGAGAGGCAG
GACTGAGTACCTGAACCGGC
ACCTGACCACAGAGTCCTTTTC
CTACCCGGTGGAAGACCTCG
TATCCTGGAGGCGACTTCTTG
TACTACCATTCCCCAGCCGA
AGGCAGCTACTTTTCGGGTC
AGCTTACTACCAACAGTGCCC
CTGCAGTGGTGTTCGCCTAT
TGTGTGGAGCCTTTCTCTGC
CTGCAAAACAGCCGAGTTCC
AAGAGTGCGGATGATGTGAAGA
AGAGGGTGACAAGCACAAGC
CACTGGTATGAATCACTGCTGG
CTCGATCCTGGATGAAACCCT
AGTTCCACAAAGGCATCCCAG
GCAACCGGGTAGTTTGGCT
GATCATGCCATCTCCAGCCAC
TCCAGGAAGCAGGAGTCTGTT
CTGCGCAAAAGTCCTGTGTG
TTGCTGTTGGGGACGATCAA
TCATCTTGGAGCTTCTGCCTC
GCTCCCAATCTGCTGTCCTA
TGAACTGTCCTGCGTAGCTG
AGGGAAACTAGTGTGGCTGC
CAGAATGGACCCCAGCTCATC
TTCCTGCTCTTTGATTTCCTCCA
Housekeeping genes
MrpL32
Ubc
NM 001106116.1
NM 017314.1
TTCCGGACCGCTACATAGGTG
ACACCAAGAAGGTCAAACAGGA
CTAGTGCTGGTGCCCACTGAG
CACCTCCCCATCAAACCCAA
that is advantageous for neurite outgrowth. Thereby nimodipine
enhances neurite density in organotypic co-cultures of the dopaminergic projection system, as demonstrated for the first time in
this study.
In addition, we did show that a set of genes whose expression
levels were quantified are not changed by nimodipine application,
suggesting that other mechanisms are involved in the observed
nimodipine mediated effects.
The here presented data support previous clinical observations
of the beneficial effect of nimodipine e.g. on the preservation of
cranial nerve functions following vestibular schwannoma surgery
(Scheller et al., 2007). Regarding the use of nimodipine against
diseases affecting especially the dopaminergic system, primarily
further in vivo data and eventually clinical studies will have to be
conducted. In general, nimodipine is a usually well-tolerated drug
(Castanares-Zapatero and Hantson, 2011). Therefore no barriers in
the use of nimodipine for neurite outgrowth in clinical situations
are expected. The elucidation of the detailed mode of action of
nimodipine as a neuroprotective and neuroregeneration promoting
substance – especially within the dopaminergic projection system
– will help to foster its application and the identification of new targets and therapy options also within the dopaminergic projection
system.
Acknowledgements
The authors thank Katrin Becker and Anne-Kathrin Krause
(Rudolf Boehm Institute of Pharmacology and Toxicology) for
technical assistance. We thank Dr. Martin Reinsch at the Analytisches Zentrum Biopharm GmbH (Berlin, Germany) for quantifying
the nimodipine concentrations in the co-culture tissues. The
authors are grateful to Dr. Knut Krohn and the members of the
microarray core facility of the Interdisziplinäres Zentrum für klinische Forschung (IZKF) Leipzig (Faculty of Medicine, University of
Leipzig) for performing the microarray measurements. We also
thank Christin Zöller for her secretarial contribution and Jennifer
Ding for providing language help. The work presented in this paper
was made possible by funding from the German Federal Ministry of
Education and Research (BMBF 1315883). Furthermore, the study
was supported by Bayer Vital GmbH (Leverkusen, Germany). The
funding sources have not been involved in the study design, in
the collection, analysis and interpretation of data; in the writing
of the report; or in the decision to submit the article for publication.
Appendix A.
Table A.1
References
Angelov, D.N., Neiss, W.F., Streppel, M., Andermahr, J., Mader, K., Stennert, E., 1996.
Nimodipine accelerates axonal sprouting after surgical repair of rat facial nerve.
J. Neurosci. 16, 1041–1048.
Bartrup, J.T., Stone, T.W., 1990. Dihydropyridines alter adenosine sensitivity in the
rat hippocampal slice. Br. J. Pharmacol. 101, 97–102.
Blanc, E.M., Bruce-Keller, A.J., Mattson, M.P., 1998. Astrocytic gap junctional communication decreases neuronal vulnerability to oxidative stress-induced disruption
of Ca2+ homeostasis and cell death. J. Neurochem. 70, 958–970.
Buwalda, B., Naber, R., Nyakas, C., Luiten, P.G., 1994. Nimodipine accelerates the
postnatal development of parvalbumin and S-100 beta immunoreactivity in the
rat brain. Brain Res. Dev. Brain Res. 78, 210–216.
Castanares-Zapatero, D., Hantson, P., 2011. Pharmacological treatment of delayed
cerebral ischemia and vasospasm in subarachnoid hemorrhage. Ann. Intens.
Care 1, 12.
D’Ascenzo, M., Vairano, M., Andreassi, C., Navarra, P., Azzena, G.B., Grassi, C., 2004.
Electrophysiological and molecular evidence of L-(Cav1), N-(Cav2.2), and R(Cav2.3) type Ca2+ channels in rat cortical astrocytes. Glia 45, 354–363.
Daschil, N., Humpel, C., 2014. Nifedipine and nimodipine protect dopaminergic substantia nigra neurons against axotomy-induced cell death in rat vibrosections via
modulating inflammatory responses. Brain Res. 1581, 1–11.
Dolmetsch, R.E., Pajvani, U., Fife, K., Spotts, J.M., Greenberg, M.E., 2001. Signaling
to the nucleus by an L-type calcium channel-calmodulin complex through the
MAP kinase pathway. Science 294, 333–339.
Fields, R.D., Guthrie, P.B., Russell, J.T., Kater, S.B., Malhotra, B.S., Nelson, P.G., 1993.
Accommodation of mouse DRG growth cones to electrically induced collapse:
kinetic analysis of calcium transients and set-point theory. J. Neurobiol. 24,
1080–1098.
Franke, H., Schelhorn, N., Illes, P., 2003. Dopaminergic neurons develop axonal
projections to their target areas in organotypic co-cultures of the ventral mesencephalon and the striatum/prefrontal cortex. Neurochem. Int. 42, 431–439.
Gispen, W.H., Schuurman, T., Traber, J., 1988. Nimodipine and neural plasticity in
the peripheral nervous system of adult and aged rats. In: Morad, M., Nayler, W.,
Kazda, S., Schramm, M. (Eds.), The Calcium Channel: Structure, Function and
Implications. Springer, New York, pp. 491–502.
Gomez, T.M., Snow, D.M., Letourneau, P.C., 1995. Characterization of spontaneous
calcium transients in nerve growth cones and their effect on growth cone migration. Neuron 14, 1233–1246.
Gomez, T.M., Spitzer, N.C., 1999. In vivo regulation of axon extension and pathfinding
by growth-cone calcium transients. Nature 397, 350–355.
Gomez, T.M., Zheng, J.Q., 2006. The molecular basis for calcium-dependent axon
pathfinding. Nat. Rev. Neurosci. 7, 115–125.
Gomez-Urquijo, S.M., Hökfelt, T., Ubink, R., Lubec, G., Herrera-Marschitz, M., 1999.
Neurocircuitries of the basal ganglia studied in organotypic cultures: focus on
tyrosine hydroxylase, nitric oxide synthase and neuropeptide immunocytochemistry. Neuroscience 94, 1133–1151.
Gu, X., Spitzer, N.C., 1995. Distinct aspects of neuronal differentiation encoded by
frequency of spontaneous Ca2+ transients. Nature 375, 784–787.
Guntinas-Lichius, O., Martinez-Portillo, F., Lebek, J., Angelov, D.N., Stennert, E., Neiss,
W.F., 1997. Nimodipine maintains in vivo the increase in GFAP and enhances the
44
astroglial ensheathment of surviving motoneurons in the rat following permanent target deprivation. J. Neurocytol. 26, 241–248.
Harkany, T., Dijkstra, I.M., Oosterink, B.J., Horvath, K.M., Abrahám, I., Keijser, J., van
der Zee, E.A., Luiten, P.G., 2000. Increased amyloid precursor protein expression
and serotonergic sprouting following excitotoxic lesion of the rat magnocellular
nucleus basalis: neuroprotection by Ca(2+) antagonist nimodipine. Neuroscience 101, 101–114.
Heine, C., Wegner, A., Grosche, J., Allgaier, C., Illes, P., Franke, H., 2007. P2 receptor
expression in the dopaminergic system of the rat brain during development.
Neuroscience 149, 165–181.
Heine, C., Sygnecka, K., Scherf, N., Berndt, A., Egerland, U., Hage, T., Franke, H., 2013.
Phosphodiesterase 2 inhibitors promote axonal outgrowth in organotypic slice
co-cultures. Neurosignals 21, 197–212.
Heine, C., Franke, H., 2014. An ex vivo organotypic culture system to study axon
regeneration in the dopaminergic system. In: Axon Growth and Regeneration:
Methods and Protocols. Humana Press, Springer, Clifton, N.J.
Kater, S.B., Mattson, M.P., Cohan, C., Connor, J., 1988. Calcium regulation of the
neuronal growth cone. Trends Neurosci. 11, 315–321.
Kater, S.B., Mills, L.R., 1991. Regulation of growth cone behavior by calcium. J. Neurosci. 11, 891–899.
Kobayashi, T., Mori, Y., 1998. Ca2+ channel antagonists and neuroprotection from
cerebral ischemia. Eur. J. Pharmacol. 363, 1–15.
Koczyk, D., 1994. Differential response of microtubule-associated protein 2 (MAP-2)
in rat hippocampus after exposure to trimethyltin (TMT): an immunocytochemical study. Acta Neurobiol. Exp. (Wars) 54, 55–58.
Koh, J.Y., Choi, D.W., 1987. Quantitative determination of glutamate mediated cortical neuronal injury in cell culture by lactate dehydrogenase efflux assay. J.
Neurosci. Methods 20, 83–90.
Koh, J.Y., Cotman, C.W., 1992. Programmed cell death: its possible contribution
to neurotoxicity mediated by calcium channel antagonists. Brain Res. 587,
233–240.
Krieglstein, J., Lippert, K., Pöch, G., 1996. Apparent independent action of nimodipine
and glutamate antagonists to protect cultured neurons against glutamateinduced damage. Neuropharmacology 35, 1737–1742.
Latour, I., Hamid, J., Beedle, A.M., Zamponi, G.W., Macvicar, B.A., 2003. Expression of voltage-gated Ca2+ channel subtypes in cultured astrocytes. Glia 41,
347–353.
Lecht, S., Rotfeld, E., Arien-Zakay, H., Tabakman, R., Matzner, H., Yaka, R., Lelkes, P.I.,
Lazarovici, P., 2012. Neuroprotective effects of nimodipine and nifedipine in the
NGF-differentiated PC12 cells exposed to oxygen-glucose deprivation or trophic
withdrawal. Int. J. Dev. Neurosci. 30, 465–469.
Li, Y., Hu, X., Liu, Y., Bao, Y., An, L., 2009. Nimodipine protects dopaminergic neurons
against inflammation-mediated degeneration through inhibition of microglial
activation. Neuropharmacology 56, 580–589.
Lindsay, R.W., Heaton, J.T., Edwards, C., Smitson, C., Hadlock, T.A., 2010. Nimodipine
and acceleration of functional recovery of the facial nerve after crush injury.
Arch. Facial Plast. Surg. 12, 49–52.
Liu, G.J., Luo, J., Zhang, L.P., Wang, Z.J., Xu, L.L., He, G.H., Zeng, Y.J., Wang, Y.F., 2011.
Meta-analysis of the effectiveness and safety of prophylactic use of nimodipine
in patients with an aneurysmal subarachnoid haemorrhage. CNS Neurol. Disord.
Drug Targets 10, 834–844.
Luiten, P.G., Buwalda, B., Traber, J., Nyakas, C., 1994. Induction of enhanced postnatal
expression of immunoreactive calbindin-D28k in rat forebrain by the calcium
antagonist nimodipine. Brain Res. Dev. Brain Res. 79, 10–18.
Martínez-Sánchez, M., Striggow, F., Schröder, U.H., Kahlert, S., Reymann, K.G., Reiser,
G., 2004. Na+ and Ca2+ homeostasis pathways, cell death and protection after
oxygen–glucose-deprivation in organotypic hippocampal slice cultures. Neuroscience 128, 729–740.
Mattsson, P., Janson, A.M., Aldskogius, H., Svensson, M., 2001. Nimodipine promotes
regeneration and functional recovery after intracranial facial nerve crush. J.
Comp. Neurol. 437, 106–117.
Mennerick, S., Zorumski, C.F., 2000. Neural activity and survival in the developing
nervous system. Mol. Neurobiol. 22, 41–54.
Mercuri, N.B., Bonci, A., Calabresi, P., Stratta, F., Stefani, A., Bernardi, G., 1994. Effects
of dihydropyridine calcium antagonists on rat midbrain dopaminergic neurones.
Br. J. Pharmacol. 113, 831–838.
Murphy, T.H., Worley, P.F., Baraban, J.M., 1991. L-type voltage-sensitive calcium
channels mediate synaptic activation of immediate early genes. Neuron 7,
625–635.
Nedergaard, S., Flatman, J.A., Engberg, I., 1993. Nifedipine- and omega-conotoxinsensitive Ca2+ conductances in guinea-pig Substantia nigra pars compacta
neurones. J. Physiol. (Lond.) 466, 727–747.
11
Nishiyama, M., Hoshino, A., Tsai, L., Henley, J.R., Goshima, Y., Tessier-Lavigne, M., Poo,
M., Hong, K., 2003. Cyclic AMP/GMP-dependent modulation of Ca2+ channels sets
the polarity of nerve growth-cone turning. Nature 423, 990–995.
Opgen-Rhein, R., Strimmer, K., 2007. Accurate ranking of differentially expressed
genes by a distribution-free shrinkage approach. Stat. Appl. Genet. Mol. Biol. 6,
Article9.
Pérez-Cadahía, B., Drobic, B., Davie, J.R., 2011. Activation and function of immediateearly genes in the nervous system. Biochem. Cell Biol. 89, 61–73.
Pisani, A., Calabresi, P., Tozzi, A., D’Angelo, V., Bernardi, G., 1998. L-type Ca2+ channel
blockers attenuate electrical changes and Ca2+ rise induced by oxygen/glucose
deprivation in cortical neurons. Stroke 29, 196–202.
Plenz, D., Kitai, S.T., 1996. Organotypic cortex-striatum-mesencephalon cultures:
the nigrostriatal pathway. Neurosci. Lett. 209, 177–180.
Pozzo-Miller, L.D., Inoue, T., Murphy, D.D., 1999. Estradiol increases spine density
and NMDA-dependent Ca2+ transients in spines of CA1 pyramidal neurons from
hippocampal slices. J. Neurophysiol. 81, 1404–1411.
Puopolo, M., Raviola, E., Bean, B.P., 2007. Roles of subthreshold calcium current and
sodium current in spontaneous firing of mouse midbrain dopamine neurons. J.
Neurosci. 27, 645–656.
Quirion, R., Lal, S., Nair, N.P., Stratford, J.G., Ford, R.M., Olivier, A., 1985. Comparative
autoradiographic distribution of calcium channel antagonist binding sites for
1,4-dihydropyridine and phenylalkylamine in rat, guinea pig and human brain.
Prog. Neuropsychopharmacol. Biol. Psychiatry 9, 643–649.
Rami, A., Krieglstein, J., 1994. Neuronal protective effects of calcium antagonists in
cerebral ischemia. Life Sci. 55, 2105–2113.
Scheller, C., Richter, H., Engelhardt, M., Köenig, R., Antoniadis, G., 2007. The influence
of prophylactic vasoactive treatment on cochlear and facial nerve functions after
vestibular schwannoma surgery: a prospective and open-label randomized pilot
study. Neurosurgery 61, 92–98.
Scheller, K., Scheller, C., 2012. Nimodipine promotes regeneration of peripheral facial
nerve function after traumatic injury following maxillofacial surgery: an off label
pilot-study. J. Craniomaxillofac. Surg. 40, 427–434.
Scheller, C., Vogel, A., Simmermacher, S., Rachinger, J.C., Prell, J., Strauss, C., Reinsch,
M., Kunter, U., Wienke, A., Neumann, Scheller, K., 2012. Prophylactic intravenous
nimodipine treatment in skull base surgery: pharmacokinetic aspects. J. Neurol.
Surg. A: Cent. Eur. Neurosurg. 73, 153–159.
Schmitz, Y., Luccarelli, J., Kim, M., Wang, M., Sulzer, D., 2009. Glutamate controls growth rate and branching of dopaminergic axons. J. Neurosci. 29,
11973–11981.
˛
Sendrowski, K., Rusak, M., Sobaniec, P., Iłendo, E., Dabrowska,
M., Boćkowski, L.,
Koput, A., Sobaniec, W., 2013. Study of the protective effect of calcium channel
blockers against neuronal damage induced by glutamate in cultured hippocampal neurons. Pharmacol. Rep. 65, 730–736.
Sheng, M., Greenberg, M.E., 1990. The regulation and function of c-fos and other
immediate early genes in the nervous system. Neuron 4, 477–485.
Shepherd, J.D., Bear, M.F., 2011. New views of Arc, a master regulator of synaptic
plasticity. Nat. Neurosci. 14, 279–284.
Takada, M., Kang, Y., Imanishi, M., 2001. Immunohistochemical localization of
voltage-gated calcium channels in substantia nigra dopamine neurons. Eur. J.
Neurosci. 13, 757–762.
Tang, F., Dent, E.W., Kalil, K., 2003. Spontaneous calcium transients in developing
cortical neurons regulate axon outgrowth. J. Neurosci. 23, 927–936.
Thomas, S., Herrmann, B., Samii, M., Brinker, T., 2008. Experimental subarachnoid
hemorrhage in the rat: influences of nimodipine. Acta Neurochir. Suppl. 102,
377–379.
Törönen, P., Ojala, P.J., Marttinen, P., Holm, L., 2009. Robust extraction of functional
signals from gene set analysis using a generalized threshold free scoring function. BMC Bioinform. 10, 307.
Turner, C.P., Miller, R., Smith, C., Brown, L., Blackstone, K., Dunham, S.R., Strehlow,
R., Manfredi, M., Slocum, P., Iverson, K., West, M., Ringler, S.L., 2007. Widespread
neonatal brain damage following calcium channel blockade. Dev. Neurosci. 29,
213–231.
Weiss, J.H., Pike, C.J., Cotman, C.W., 1994. Ca2+ channel blockers attenuate betaamyloid peptide toxicity to cortical neurons in culture. J. Neurochem. 62,
372–375.
Westenbroek, R.E., Bausch, S.B., Lin, R.C., Franck, J.E., Noebels, J.L., Catterall,
W.A., 1998. Upregulation of L-type Ca2+ channels in reactive astrocytes after brain injury, hypomyelination, and ischemia. J. Neurosci. 18,
2321–2334.
Wirth, H., von Bergen, M., Binder, H., Mining, S.O.M., 2012. expression portraits:
feature selection and integrating concepts of molecular function. Biodata Mining
5, 18.
45
RESEARCH ARTICLES - Nimodipine (Suppl.)
Supplementary Fig.S.1: Experimental set‐up. (A) Preparation of brain slice co‐cultures of the mesocortical dopaminergic projection system. (A1) Photograph of a neonatal rat brain. The regions containing ventral tegmental area/substantia nigra (VTA/SN) and prefrontal cortex (PFC) are highlighted in dark and bright red. (A2) Coronal sections of the rat brain; additional cuts are made as indicated by dashed lines to isolate VTA/SN (#) and PFC (*), respectively. (A3) Coronal sections of 300µm thickness were placed side by side on membrane inserts as co‐cultures. (B1) Schema of a co‐culture consisting of PFC and VTA/SN; the transparent box indicates the border region, where the two initially separated slices were grown together and where neurite density was quantified after biocytin‐tracing and histochemical processing (described in detail in section 2.5.1). (B2) Microscopic image of a biocytin‐traced co‐culture slice after treatment with 1µM nimodipine. Biocytin‐traced cell bodies are located in the VTA/SN. Outgrowing neurites cross the border region between VTA/SN and PFC and grow into the PFC. (Scale bar: 500µm) 46
RESEARCH ARTICLES - Nimodipine (Suppl.)
Supplementary Fig.S.2: Neurite outgrowth quantification after application of 1µM nimodipine (in the figure: Nim) and 50ng/ml nerve growth factor (NGF) alone or in combination. (A) Representative microscopic images of biocytin positive neurites in the border region as they were used for neurite density quantification, (scale bar: 50µm). (B) Neurite density data has been normalized to the median value of the untreated control group of each individual preparation. Neurite growth is significantly increased after treatment with 1µM nimodipine, 50ng/ml NGF and the combination of both in comparison to the vehicle control (0.1% ethanol). No significant increase in neurite density has been observed among the Nim‐, NGF‐ and Nim+NGF‐treated groups. Neurite density data have been normalized to the median value of the untreated control group of each individual preparation. Data are shown as box plots, n(analyzed pictures)>173, **p<0.01, ANOVA on Ranks followed by All Pairwise Multiple Comparison Procedures (Dunn's Method). 47
Titel:
Nimodipine enhances neurite outgrowth in dopaminergic brain slice cocultures
Journal:
International Journal of Developmental Neuroscience
Autoren:
K. Sygnecka, C. Heine, N. Scherf, M. Fasold, H. Binder, C. Scheller, H.
Franke
(geteilte Erstautorinnenschaft: KS und CH)
- Konzeption
- Immunhistochemie
- Genexpressionsstudien
Anteil Heine (Erstautorin):
- Projektidee
- Konzeption
- Gewebekulturen (Präparation)
Anteil Scherf:
- Bioinformatische Bildauswertung
Anteil Fasold, Binder:
- Unterstützung bei der Analyse der Microarray-Ergebnisse
Anteil Scheller:
- Projektidee
- Konzeption
48
49
RESEARCH ARTICLES - MSCs
STEM CELLS AND DEVELOPMENT
Volume 00, Number 00, 2014
Mary Ann Liebert, Inc.
DOI: 10.1089/scd.2014.0262
ORIGINAL RESEARCH REPORT
Mesenchymal Stem Cells Support Neuronal Fiber Growth
in an Organotypic Brain Slice Co-culture Model
Katja Sygnecka,1,2 Andreas Heider,1 Nico Scherf,3 Rüdiger Alt,1,4
Heike Franke,2,* and Claudia Heine1,2,*
Mesenchymal stem cells (MSCs) have been identified as promising candidates for neuroregenerative cell
therapies. However, the impact of different isolation procedures on the functional and regenerative characteristics of MSC populations has not been studied thoroughly. To quantify these differences, we directly
compared classically isolated bulk bone marrow-derived MSCs (bulk BM-MSCs) to the subpopulation Sca1 + Lin - CD45 - -derived MSCs - (SL45-MSCs), isolated by fluorescence-activated cell sorting from bulk BMcell suspensions. Both populations were analyzed with respect to functional readouts, that are, frequency of
fibroblast colony forming units (CFU-f), general morphology, and expression of stem cell markers. The SL45MSC population is characterized by greater morphological homogeneity, higher CFU-f frequency, and significantly increased nestin expression compared with bulk BM-MSCs. We further quantified the potential of
both cell populations to enhance neuronal fiber growth, using an ex vivo model of organotypic brain slice cocultures of the mesocortical dopaminergic projection system. The MSC populations were cultivated underneath the slice co-cultures without direct contact using a transwell system. After cultivation, the fiber density
in the border region between the two brain slices was quantified. While both populations significantly enhanced fiber outgrowth as compared with controls, purified SL45-MSCs stimulated fiber growth to a larger
degree. Subsequently, we analyzed the expression of different growth factors in both cell populations. The
results show a significantly higher expression of brain-derived neurotrophic factor (BDNF) and basic fibroblast
growth factor in the SL45-MSCs population. Altogether, we conclude that MSC preparations enriched for
primary MSCs promote neuronal regeneration and axonal regrowth, more effectively than bulk BM-MSCs, an
effect that may be mediated by a higher BDNF secretion.
Recent reports and reviews suggest a beneficial role of
MSCs in recovery after neuronal injury and in neurodegenerative diseases like Parkinson’s disease [4–8]. For
example, positive effects of MSCs on fiber regeneration
have been shown under various experimental conditions, such as cell cultures [9,10], organotypic slice culture
models [11–13] and also in vivo [14,15]. Besides the
synthesis of extracellular matrix molecules, stabilization
of the microenvironment, and immune modulatory properties, the production of humoral factors appears to be one
of the relevant processes for the observed regenerative
effects of MSCs [16,17]. In this context, the expression
and secretion of growth factors such as brain-derived
neurotrophic factor (BDNF), nerve growth factor (NGF),
glial cell-derived neurotrophic factor (GDNF), or basic
Introduction
S
tudying neuronal regeneration and regrowth is
important in potentially treating neurological diseases associated with the loss of neurons and their corresponding fiber
projections. In this context, stem cells that positively influence
neuronal regeneration and axonal regrowth are of great interest
for the development of cell therapeutic strategies.
Mesenchymal stem cells (MSCs) are multipotent precursors, which are capable of differentiation into bone, cartilage,
and adipose tissues. They can be obtained easily from, for
example, adult bone marrow (BM), adipose tissue, or umbilical cord blood. Conventionally, MSCs are isolated from
human or animal tissue through plastic adhesion and culture
procedures [1–3].
1
Translational Centre for Regenerative Medicine (TRM), University of Leipzig, Leipzig, Germany.
Rudolf Boehm Institute of Pharmacology and Toxicology, University of Leipzig, Leipzig, Germany.
3
Faculty of Medicine Carl Gustav Carus, Institute for Medical Informatics and Biometry (IMB), Dresden University of Technology,
Dresden, Germany.
4
Vita 34 AG, Leipzig, Germany.
*These two authors contributed equally to the work.
2
1
50
2
fibroblast growth factor (bFGF, also known as FGF2) have
been elucidated [9,13,14,18–20].
MSCs are intrinsically heterogeneous and are comprised
of a diverse repertoire of distinct subpopulations (for review
see Phinney [21]). It is accepted that methods used to isolate, expand, and cultivate MSCs significantly affect their
overall composition and therefore their therapeutic potential
[22–25]. Current limitations in the use of MSCs underline
the need to identify specific surface markers that can be used
to investigate the physiological functions and biological
properties of MSCs [26]. Morikawa et al. have recently
shown that MSCs need not necessarily be isolated by culture
expansion, but can be prospectively isolated from primary
tissue, yielding a highly enriched homogeneous subpopulation [3]. These PaS cells are a subpopulation of the very
small embryonic-like stem cell population described earlier
by Kucia et al. that have shown a broad differentiation potential beyond the mesenchymal lineage in vitro [27,28].
The prospective isolation of MSCs will certainly have to be
considered for safer and more effective clinical treatments
in the future [26]. Therefore, gaining knowledge about the
different MSC populations and the use of standardized
protocols for the preparation of homogenous cell populations and their expansion is integral.
We set out to investigate the impact of the isolation procedure on the functional and regenerative characteristics of
MSC populations. In this study, bulk BM-derived MSCs (bulk
BM-MSCs), directly expanded from cell suspensions of isolated BM of 8-week-old mice, were compared to Sca-1 +
Lin - CD45 - -derived MSCs (SL45-MSCs), which were sorted
from lineage depleted BM suspensions via fluorescenceactivated cell sorting (FACS) from mice of the same age. The
properties of both populations were analyzed in regards to their
(i) ability to form fibroblast colony-forming units (CFU-f), (ii)
general appearance and morphology, (iii) expression of stem
cell markers and growth factors, and (iv) neuronal fiber growth
promoting potential. To examine fiber growth, an organotypic
brain slice co-culture model of the mesocortical dopaminergic
projection system consisting of brain slices of the ventral
tegmental area/substantia nigra (VTA/SN) and the prefrontal
cortex (PFC) of newborn mice was employed. Fiber density in
the border region between the two slices was quantified after cocultivation with either BM-MSCs or sorted SL45-MSCs
underneath the slice co-cultures using biocytin tracing and
subsequent automated image analysis. The growth factor BDNF
was applied to the co-culture medium as a positive control for
fiber growth enhancement. The co-cultures serve as a model of
both development and regeneration, as the growth of fiber
connections under ex vivo conditions strongly correlates with
the development of neuronal circuits in vivo, and the dopaminergic projections in the neonatal mouse brains are cut during
preparation. Therefore, this model is suitable to analyze growth
promoting effects of substances and cells in a context that is
close to the in vivo situation, as demonstrated in a number of
previous studies [29–31].
Animals
For the preparation of the organotypic brain slice co-cultures,
neonatal mouse pups of postnatal day 2 (P2) were used (C57BL/
6, own breed; animal house of the Rudolf Boehm Institute of
SYGNECKA ET AL.
Pharmacology and Toxicology, University of Leipzig, Leipzig,
Germany). For the isolation of the MSC populations, 8-weekold C57BL/6 mice were used (Medizinisch-Experimentelles
Zentrum, University of Leipzig, Leipzig, Germany). Both
genders were used for the preparation of the organotypic brain
slice co-cultures and the isolation of both MSC populations. No
gender-specific differences between male or female mice were
observed. The animals were housed under standard laboratory
conditions, under a 12 h light–12 h dark cycle and allowed access to lab food and water ad libitum.
All of the animal use procedures were approved by the
Committee of Animal Care and Use of the relevant local
governmental body in accordance with the law of experimental animal protection.
Isolation and expansion of investigated cells
Isolation of murine BM. BM was isolated following a
method modified from Morikawa et al. [3]. Tibiae and femura
were dissected out of 8 – 1-week-old C57BL/6 mice. After
cleaning, the bones were crushed with a pestle, and marrow
was flushed out with 5 mL of wash buffer [phosphate buffered
saline (PBS) with 0.3% citrate phosphate dextrose buffer
(both Sigma-Aldrich, Taufkirchen, Germany) and 1% bovine
serum albumin (BSA; SERVA, Heidelberg, Germany)]. The
resulting solution was passed through a 0.45 mm cell strainer
(Greiner Bio-One GmbH, Frickenhausen, Germany) before
proceeding. The remaining bone chips were further minced
using scissors and digested at 37C using an enzyme solution: Accutase containing penicillin/streptomycin (Pen/Strep
100 U/mL and 100 mg/mL, respectively; both PAA Laboratories GmbH, Cölbe, Germany), 2 mM calcium chloride
(Sigma-Aldrich), and 1 mg/mL collagenase IV (SERVA).
Afterward, the pooled cell fractions were then washed once
with wash buffer and manually counted using a Neubauer
counting chamber (Carl Roth GmbH andCo. KG, Karlsruhe,
Germany).
Derivation of MSCs from murine BM. About 107 bulk BM
cells were seeded in 75 cm2 culture flasks (Greiner Bio-One
GmbH) and cultivated in bulk BM-MSCs maintenance medium
[alpha-modification of Eagle’s minimal essential medium with
10% fetal bovine serum (FBS), supplemented with Pen/Strep
(100 U/mL and 100 mg/mL, respectively; all from PAA Laboratories)] to derive MSCs. After 2 days, an initial washing
step with PBS was performed to remove nonadherent cells.
Afterward, fresh bulk BM-MSCs maintenance medium was
applied. For further expansion the medium was changed every
2–3 days. Cells were passaged via trypsinization (using trypsin;
PAA Laboratories) when reaching 80% confluency. Passages
3–5 have been used for all experiments in this study except for
the colony forming unit-fibroblast (CFU-f) assay (see below).
Isolation of SL45-MSCs. The isolation procedure was
adapted from Kucia et al. and Morikawa et al. [3,28]. Mature blood cells were removed from BM preparations via the
magnetic activated cell sorting lineage depletion kit (biotinylated antibody cocktail; Miltenyi Biotech, Bergisch
Gladbach, Germany). Lineage negative (Lin - ) cells were
stained with anti-Sca-1-phycoerythrin(-PE) and anti-CD45PE-carbocyanine(-Cy)7 in addition to Streptavidin-AlexaFluor-488 to label and exclude any remaining Lin + cells (all
from eBiosciences, Frankfurt a.M., Germany), for 30 min at
4C using saturation concentrations recommended by the
51
MESENCHYMAL STEM CELLS SUPPORT NEURONAL FIBER GROWTH
manufacturer. To discriminate living cells from dead
cells and debris, Hoechst (5 mg/mL) and propidium iodide
(PI; 2 mg/mL) stains (all Sigma-Aldrich) were employed.
Sca-1 + CD45 - Lin - Hoe + PI - (SL45)-MSCs were sorted by
FACS in FACS sort buffer (PBS with 1% FBS, 1 mM ethylenediaminetetraaceticacid, and 25 mM HEPES; all SigmaAldrich; 0.2 mm sterile filtered) using a BD FACS Vantage
SE cell sorter (BD Biosciences, Heidelberg, Germany).
Cultivation of SL45-MSCs. Sorted SL45-MSCs were cultivated in 25 cm2 culture flasks (Greiner Bio-One GmbH) in
bulk BM-MSCs maintenance medium until passage 2.
Afterward, cells were cultivated in SL45-MSCs maintenance
medium [alpha MEM with 30% FBS, Pen/Strep (100 U/mL
and 100 mg/mL, respectively); PAA Laboratories] and 50 ng/
mL recombinant human FGF2 (Peprotech, Hamburg, Germany). The administration of FGF2 and additional serum to
the medium was needed for the prolonged in vitro growth of
SL45-MSCs, as the cells would stop growing after 3 passages without additional FGF2. For further expansion, the
medium was changed every 2–3 days. Upon reaching 80%
confluence the cells were passaged using Accutase (PAA
Laboratories). Passages 3–5 have been used for all experiments in this study except for the CFU-f assay (see below).
CFU-f assay
To empirically determine the frequency of CFU-f in cell
suspensions, freshly isolated cells, either sorted SL45-MSCs
(starting with 1,000 cells) or bulk BM-MSCs (starting with
107 cells), were cultivated for 14 days in Ø 3 cm culture
dishes or in 75 cm2 culture flasks, respectively (both Greiner
Bio-One GmbH). The cell numbers are a consequence of
intrinsic differences in availability of the cells and their
respective colony frequencies. The frequency of colony
forming cells in bulk BM-MSCs is far lower than in the
SL45 population. Plating the same number of cells would
therefore generate either too many SL45-derived colonies or
too few BM-MSC-derived colonies for reliable quantification. For this reason, we adjusted the input cell number to
yield quantifiable numbers of colonies.
The CFU-f assays were performed for both MSC populations in bulk BM-MSC maintenance medium. The cells
were fixed using methanol (AppliChem GmbH, Darmstadt,
Germany) and stained using Giemsa stain (Sigma-Aldrich).
The resulting primary colonies were counted using a binocular microscope.
Immunofluorescence staining
The two MSC preparations from either bulk BM or SL45
cells were characterized by applying immunofluorescence
staining after cultivation under maintenance conditions. When
the cultures reached 80% confluency, cells were fixed for
10 min with 4% paraformaldehyde (PFA; Merck, Darmstadt,
Germany) in PBS at room temperature (RT). After the fixation
step, cells were washed with PBS with 0.5% Tween 20 (PBST; both Sigma-Aldrich). Reactive PFA endings were saturated
in a 30 min incubation step with 20 mM glycine (Carl Roth
GmbH and Co. KG) in PBS. After permeabilization with
0.1% Triton-X 100 (Applichem GmbH) for 5 min, cells were
washed and incubated over night at 4C in blocking solution
[PBS-T with addition of 3% FBS (PAA Laboratories), 1%
3
BSA (SERVA)] and primary antibodies: mouse anti-bIII tubulin (1:500; Promega, Mannheim, Germany) and rabbit antinestin (1:400; Chemicon, Temecula, CA). Cells were washed
again and stained for 1.5 h at RT in blocking solution containing secondary antibodies: donkey anti-mouse and donkey
anti-rabbit conjugated with Cy2 or Cy3 (1:400/1:800, respectively; both Jackson Immunoresearch, West Grove, PA)
followed by washes with Tris-buffered saline with 0.5%
Tween 20 (Sigma-Aldrich). Finally, staining of the cell nuclei
was performed using Hoechst 33342 (Sigma-Aldrich) at
concentration of 5 mg/mL for 10 min. Then cells were washed
again, embedded in fluorescence mounting medium (Dako
Deutschland GmbH, Hamburg, Germany), and immunofluorescence labeling was analyzed using an inverted microscope
(Nikon Eclipse Ti) equipped for the detection of Cy2, Cy3 and
Hoechst.
RNA extraction and quantitative real-time
polymerase chain reaction
Quantitative real-time polymerase chain reaction (qPCR)
was conducted to quantify the expression of (i) stem cell
markers nestin and bIII tubulin under maintenance conditions and (ii) growth factors: BDNF, ciliary neurotrophic
factor (CNTF), FGF2, GDNF, hepatocyte growth factor
(HGF), insulin-like growth factor 1 (IGF1), NGF, and
neuregulin 1 (NRG1) after cultivation in maintenance medium or in brain slice culture medium (for composition see
section ‘‘Preparation and cultivation of slice co-cultures’’)
in both bulk BM-MSCs and SL45-MSCs.
For gene expression analysis under co-culture cultivation
conditions (meaning in brain slice culture medium, rather than
in co-culture with brain slices), 1 day after seeding of the bulk
BM-MSCs or SL45-MSCs, respectively, into 25 cm2 culture
flasks, maintenance medium was changed to brain slice culture
medium. Corresponding to the duration of cultivation of cells
underneath the co-cultures, after 3.5 days cells were harvested
for RNA-extraction. Total RNA was isolated using TRIzol
reagent (Life Technologies, Gaithersburg, MD) according to
the manufacturer’s instructions. RNA concentration was measured with NanoDrop1000 (NanoDrop Technologies, Wilmington, DE).
Reverse transcription was performed using the RevertAidTM
H Minus First Strand cDNA Synthesis Kit (Fermentas, St. LeonRot, Germany) with 0.1 mg total RNA and oligo(dT)18 primer
in 20 mL total reaction volume. qPCR was conducted using a
LightCycler (Roche Diagnostics, Mannheim, Germany) in a
total volume of 10 mL per capillary [LightCycler Capillaries
(20 mL); Roche Applied Science, Mannheim, Germany] containing 5 mL QuantiTect SYBR Green 2 · Master Mix (Roche
Applied Science), 0.4 mL cDNA, 1 mL primer (5 mM each)
specific for the different target genes or the reference genes
[mitochondrial ribosomal protein L32 (MrpL32) and ubiquitin
(Ubc)], and 3.6 mL water. Sequences of all used primers are
listed in the Supplementary Table S1 (Supplementary Data
are available online at www.liebertpub.com/scd). The Hot
Start Polymerase (contained in the QuantiTect SYBR Green 2·
Master Mix) was activated by a 15 min preincubation at
95C, followed by 55 amplification cycles at 95C for 10 s, 60C
for 10 s, and 72C for 10 s. A melting curve analysis was performed to verify correct qPCR products. The following appropriate controls have been used: no template control (water) and
52
4
SYGNECKA ET AL.
‘‘reverse transcription-minus control,’’ to exclude the presence
of genomic DNA in the samples. Quantification of gene expression was performed by the DCP method with MrpL32 and
Ubc serving as reference housekeeping genes.
Determination of the BDNF concentration
in the conditioned media
To further investigate growth factor production and secretion on the protein level, the concentration of BDNF has
been quantified in conditioned brain slice culture medium.
Conditioned medium of cells that were used for RNA extraction (see above) was collected and kept at - 80C until
analysis. BDNF levels were measured using a multiplexed
particle-based flow cytometric cytokine assay [32]. Assay
kits were purchased from Millipore (Zug, Switzerland). The
procedures closely followed the manufacturer’s instructions.
The analysis was conducted using a conventional flow
cytometer (Guava EasyCyte Plus; Millipore).
Preparation and cultivation of slice co-cultures
Slice co-cultures consisting of a prefrontal and a mesencephalic slice were prepared from P2 mice and cultivated according to the ‘‘static’’ culture protocol using a
transwell system as described previously for rats [29,33].
After decapitation of the pups, the brains were removed
from the skull and immersed into low melting agar. Forebrain- and mesencephalon-containing brain parts were
separated with coronal cuts and the resulting tissue blocks
were fixed onto the specimen stage of a vibratome (Leica,
Typ VT 1200S, Nussloch, Germany). Coronal sections
(thickness 300 mm) were cut at mesencephalic and forebrain levels to obtain slices of the VTA/SN and the PFC,
respectively. A scheme to illustrate the preparation procedure is shown in Fig. 1. Four co-cultures were placed on
one membrane insert (0.4 mm, Millicell-CM; Millipore) in
a six-well plate (NuncTM Multidish; Thermo Scientific via
VWR International GmbH, Dresden, Germany), filled with
1 mL of the brain slice culture medium [25% MEM, 25%
Basal Medium Eagle without glutamine, 25% horse serum,
glutamine to a final concentration of 2 mM, gentamicin
50 mg/mL (all from Invitrogen GmbH, Darmstadt, Germany), and 0.6% glucose (Hospital Pharmacy, University
of Leipzig, Leipzig, Germany), pH adjusted to 7.2].
Twenty-four hours before the preparation of the organotypic co-cultures, 105 bulk BM-MSCs or SL45-MSCs,
respectively were seeded on poly-l-lysine (Sigma-Aldrich)coated glass slides (Carl Roth GmbH and Co. KG) and were
cultivated in the respective maintenance medium (see
above). After the completion of the preparation these glass
slides were transferred underneath the membrane inserts
with the organotypic co-cultures. Co-cultures were kept at
37C and 5% CO2. Culture medium was changed every 2–3
days and glass slides were changed at days in vitro (DIV)4
and DIV7. The cells used for the exchange were derived
from continuing cultures of the original input cells, ensuring
that cells of the same batch and age were used throughout
each experiment. Control cultures were cultivated without
any additional cells or substances. As a reference for the
growth promoting potential, BDNF (75 ng/mL; Peprotech)
was added to the brain slice culture medium with every
FIG. 1. Preparation of brain slice co-cultures of the mesocortical dopaminergic projection system [(A), black arrow]. After decapitation of the mouse pups, the brain was
removed from the skull under sterile conditions. Coronal
cuts were made at the level of forebrain and mesencephalon
[(A), dashed lines]. The brain parts were fixed on the
specimen stage of a slicer and cut as indicated [(B), dashed
lines] to isolate PFC (*) and VTA/SN (#), respectively.
Coronal sections of 300 mm thickness were cut and resulting
sections were placed as co-cultures on the moistened
membranes (C) and inserted in six-well plates filled with
brain slice culture medium. After DIV10 the slices were
fixed and the biocytin tracing was visualized. (D) Schematic
co-culture slice to illustrate the localization of the PFC, the
border region and the VTA/SN in greater magnification.
PFC, prefrontal cortex; VTA/SN, ventral tegmental area/
substantia nigra; DIV, days in vitro.
medium exchange in an additional experimental group
(BDNF group). For detailed information see also Fig. 2.
Tracing procedure, fixation, and visualization
of fibers
Biocytin tracing, fixation, and subsequent processing of
the co-cultures were performed as previously described
[29,31,33]. At DIV8, small biocytin crystals (SigmaAldrich) were placed on the VTA/SN part of the co-cultures
53
5
FIG. 2. Time schedule indicating
preparation at DIV0 and subsequent medium changes, exchange
of glass slides with bulk BM-MSCs
and SL45-MSCs, tracing at DIV8
and fixation at DIV10. BDNF was
applied after every medium exchange to the ‘‘BDNF group.’’
BM-MSCs, bone marrow-derived
mesenchymal stem cells; BDNF,
brain-derived neurotrophic factor;
SL45-MSCs, Sca-1 + Lin - CD45 - derived MSCs.
under binocular control. After 2 h, the co-cultures were
rinsed carefully with brain slice culture medium. To allow
the anterograde transport of the tracer, the co-cultures were
reincubated for 48 h.
At DIV10, the co-cultures were fixed in a solution consisting of 4% PFA, 0.1% glutaraldehyde (SERVA), and 15%
picric acid (Sigma-Aldrich) in phosphate buffer (PB, 0.1 M,
pH 7.4) for 2 h and were subsequently washed with PB.
Afterward, co-cultures were cut into 50 mm thick slices with
the vibratome and collected in PB.
Biocytin was visualized with the avidin-biotin-horseradish peroxidise complex (1:50, ABC-Elite Kit; Vector Laboratories, Inc., Burlingame, CA) and ammonium nickel (II)
sulfate hexahydrate/Cobalt (II) chloride hexahydrate (Ni/
Co; both Sigma-Aldrich) intensified 3,3¢-diaminobenzidine
hydrochloride (Sigma-Aldrich). Stained slices were mounted on glass slides and embedded with Entellan (Merck)
when completely dried.
Quantification of fiber density
for multiple comparisons against the control group and
against the BDNF group. Statistical significance of the expression of various growth factors (mRNA-level; BDNF additional protein-level) was determined by Student’s t-test or
Mann–Whitney Rank Sum Test, as indicated. All quantitative
data have been analyzed with SigmaPlot 12 statistical analysis
program, all significant differences were considered at a Plevel below 0.05 (*P < 0.05, **P < 0.01, ***P < 0.001).
Results
Characterization of bulk BM-MSCs and sorted
SL45-MSCs under maintenance conditions
Primary CFU-f are 10,000-fold enriched in SL45-MSCs versus
bulk BM-MSCs. While bulk BM-MSCs were directly ex-
panded from cell suspensions of freshly isolated BM of
8-week-old mice, SL45-MSCs were sorted from lineage
depleted BM suspensions via FACS-sorting from mice of
the same age (for details see Fig. 4A1–A4).
Microscopic images from the whole border region were
obtained with a transmitted light bright field microscope
(Axioskop 50; Zeiss, Oberkochen, Germany) equipped with a
CCD camera at 40 · magnification. The border region of the
co-culture is the part where the two initially separated brain
slices were grown together (for illustrations see also Figs. 1D
and 3A, B2). Slices were used for analysis only if they fulfilled the following criteria: (i) the tracer was correctly placed
on the VTA/SN, (ii) the major part of the VTA/SN was
characterized by a dense network of biocytin-traced structures
and (iii) no traced cell bodies had been observed in the target
region PFC (previously described in more detail in [30]).
A tailored image analysis procedure had been designed to
quantify the fiber density in an automated manner, described
previously in detail [31]. After preprocessing and image
binarization, the ratio of the number of foreground pixels
(fibers) to the total number of pixels in the images was
taken, yielding an estimate of the percentage of area occupied by fibers (fiber density) in the focal plane.
Statistics
Statistical significance of the frequency of CFU-f and of
the expression level of nestin and bIII tubulin between the
different cell populations was assayed by Student’s t-test.
Statistical analysis of the fiber growth promoting effect of the
different MSC populations was performed using Kruskal–
Wallis analysis of variance on Ranks followed by Dunn’s test
FIG. 3. Biocytin labeling. (A) Overview of a biocytintraced co-culture slice (after cultivation with bulk BMMSCs). (B1–B3) Microscopic images of traced cell bodies
in the VTA/SN (B3), traced fibers in the border region of the
co-culture (B2) and in the PFC (B1) at higher magnification.
Scale bars: (A) 500 mm, (B1–B3) 100 mm. PFC, prefrontal
cortex; VTA/SN, ventral tegmental area/substantia nigra.
54
6
SYGNECKA ET AL.
FIG. 4. Primary CFU-f and representative illustration of the isolation of SL45 cells. (A1–A4) SL45-MSCs were sorted from
suspensions of murine bone marrow of 8-week-old mice. For this purpose, cells were stained with Hoechst, PI, lineage markers
(Lin), and a combination of Sca-1 and CD45. (A1) All events plotted with regard to forward scatter (FSC) and Hoechst signal
intensity. (A2) Histogram showing PI staining of Hoechst + cells from (A1). (A3) Hoechst + , PI - cells were stained for Lin
expression. (A4) The dot plot shows Hoechst + , PI - , and Lin - cells that were analyzed for expression of CD45 and Sca-1. Sca-1 + ,
Hoechst + , PI - , Lin - , and CD45 - cells (SL45-MSCs) were found at a frequency of 3.75%. (B) After 2 weeks of cultivation, CFUf contained in both bulk BM-MSCs and SL45-MSCs and both cell populations gave rise to newly formed colonies comprised of
spindle-shaped, fibroblast-like cells. The CFU-f frequency was far higher in SL45-MSCs than in bulk BM-MSCs. Data are shown
as box-whisker plots; SL45-MSCs: n = 5, bulk BM-MSCs: n = 8; Student’s t-test, ***P < 0.001. (C1, C2) Sorted SL45-MSCs are
shown in the micrographs at day 0 (d0) and 14 (d14) after sorting. Scale bars: (C1) 100 mm, (C2) 250 mm. CFU-f, fibroblast colony
forming units; PI, propidium iodide. Color images available online at www.liebertpub.com/scd
Primary sorted SL45-MSCs (1,000 cells) and bulk BMMSCs (107 cells) were subjected to a CFU-f assay. These
cell numbers are a consequence of intrinsic differences in
availability of the cells and their respective colony frequencies (for details see section ‘‘CFU-f assay’’ in ‘‘Materials and Methods’’). Two weeks after inoculation, both
unsorted and sorted cells gave rise to newly formed colonies
comprising spindle-shaped, fibroblast-like cells. As an example, sorted SL45-MSCs are shown in Fig. 4C1 at day 0
and in Fig. 4C2 at day 14 after sorting, respectively. The
frequency of CFU-f was 5.3 · 10 - 6 – 4.1 · 10 - 6 (n = 8) in
bulk BM-MSCs and 5.3 · 10 - 2 – 3.3 · 10 - 2 (n = 5) in SL45MSCs (Fig. 4B). Primary CFU-f were 10,000-fold enriched
in prospectively isolated SL45-MSCs compared to bulk
BM-MSCs. This suggests that SL45-MSCs are a more homogeneous cell population not only with respect to surface
marker expression but also in terms of functional properties.
Higher expression of nestin in SL45-MSCs versus bulk BMMSC. Nestin and bIII tubulin are markers for immature
neuronal cells. Nestin on its own, however, has been shown to
mark precursor cells of both neuronal and mesenchymal lines
[34–36]. bIII Tubulin on the other hand is co-expressed in
some mesenchymal cells together with nestin before any
neuronal differentiation takes place [37]. A characterization of
the nestin and bIII tubulin protein expression in both unsorted
bulk BM-MSCs and sorted SL45-MSCs was performed using
immunofluorescence staining with antibodies against these
markers. We observed a difference in nestin and bIII tubulin
expression between classically isolated MSCs and those derived from sorted SL45 cells (Fig. 5A, B). While almost all
SL45-MSCs expressed nestin, the population of bulk BMMSCs was heterogeneous and also contained many cells that
did not express nestin. This observation was compatible with
our general impression that bulk BM-MSCs are generally
more heterogeneous, with some cells showing a classical
spindle-shaped MSC morphology, others appearing broader
and less well defined in shape. In contrast, in SL45-MSCs the
predominant cell type shows a smaller spindle-shaped or oligopolar morphology with rather small or condensed nuclei, a
clearly defined cell body, and a prominent expression of
nestin. bIII Tubulin-positive cells occurred with similar frequency in both cell populations.
Furthermore, the expression of nestin and bIII tubulin in
both populations was determined on a mRNA level. The
55
7
tated fiber outgrowth of cell bodies originating from the
VTA/SN could be observed. Neuronal processes sprouting
from the black labeled cell bodies of the VTA/SN surmounted the border region between the initially separated
slices and grew into the target region PFC. An example of a
VTA/SN + PFC co-culture after cultivation with bulk BMMSCs is shown in Fig. 3.
We compared the fiber growth promoting potential of
MSCs derived from sorted SL45 cells and bulk BM-MSCs
to BDNF-treated and untreated controls, respectively. Examples of biocytin traced fibers within the border region are
shown for all groups in Fig. 6A. The quantification of the
fiber density in the border region revealed a significant
growth promoting effect for both MSC preparations. The
corresponding box-whisker plots are shown in Fig. 6B. Both
SL45-MSCs and bulk BM-MSCs exhibit a significantly
stronger growth promoting effect compared with control. As
expected, BDNF also enhanced fiber growth in comparison
to untreated control conditions. However, the effect was
significantly less pronounced than that of the co-cultures
with SL45-MSCs, suggesting a greater neurosupportive
stimulus of these mesenchymal cells.
FIG. 5. Nestin and bIII tubulin expression. (A, B) Immunofluorescence staining against nestin (red), bIII tubulin
(green), and Hoechst (blue) of (A) unsorted bulk BM-MSCs
and (B) sorted SL45-MSCs expanded nondifferentiated
cells growing in maintenance medium: (A) Only some bulk
BM-MSCs show immunoreactivity for nestin, whereas
(B) almost all SL45-MSCs were positive for nestin. bIII
Tubulin-positive cells occurred with similar frequency in both
cell populations. (C, D) mRNA expression levels of nestin and
bIII tubulin (Tubb3) in the two cell populations after cultivation under maintenance conditions are expressed as DCP
(relative expression normalized to the housekeeper genes Ubc
and MRPL32, y-axis). (C) Nestin expression was significantly
higher in SL45-MSC samples (mean > 400-fold compared to
bulk BM-MSCs, P < 0.05). (D) No significant difference in
the expression of bIII tubulin was detected by quantification
of the mRNA transcripts (P = 0.63). Data are shown as
mean – standard error of the mean, n > 4 independent cell
preparations, *P < 0.05, Student’s t-test. Scale bars: (A, B)
100 mm. MrpL32, mitochondrial ribosomal protein L32; n.s.,
not significant; Ubc, ubiquitin. Color images available online
at www.liebertpub.com/scd
qPCR-results confirmed our qualitative observations from
the immunostaining experiments. Nestin was detectable in
both MSC populations with a significant higher expression
in the sorted SL45-MSCs (mean DCP = 13.793) compared
with the bulk BM-MSCs (mean DCP = 0.0318) (Fig. 5C).
The mRNA expression of bIII tubulin was comparable in
both MSC populations. There was no significant difference
in the number of bIII tubulin-transcripts between the two
analyzed cell populations (Fig. 5D).
MSCs derived from enriched SL45-MSCs
were more potent in stimulating fiber
growth than classically isolated bulk BM-MSCs
After fixation of the dopaminergic co-cultures at DIV10
and visualization of the biocytin tracing, the target orien-
Sorted SL45-MSCs expressed significantly higher
levels of the growth factors BDNF and FGF2
We assessed the expression of growth factors that could be
responsible for the observed fiber growth promoting effect of
bulk BM-MSCs and sorted SL45-MSCs. The mRNA of the
growth factors BDNF, CNTF, FGF2, GDNF, HGF, IGF1,
NGF, and NRG1 was detected by qPCR in cell samples both
after cultivation in maintenance medium and in brain slice
culture medium, respectively. Under maintenance conditions,
the mRNA of BDNF, FGF2, and NGF was significantly
higher expressed in SL45-MSCs than in bulk BM-MSCs
(Student’s t-test, P < 0.05, data not shown). Consistent with
this observation, BDNF and FGF2 were expressed to a significantly greater extent in the SL45-MSC population (Fig.
7A, B) after cultivation in brain slice culture medium. Under
this condition, the median DCP for NGF transcripts was also
higher in SL45-MSCs, but the difference between the two
groups was not significant (Fig. 7C).
Additionally, secreted BDNF protein has been quantified in
the conditioned brain slice culture medium of both cell populations. The BDNF concentration in SL45-supernatants was
significantly higher (median value: 0.487 fg/mL/cell) than in
bulk BM-MSC supernatants (median value: 0.026 fg/mL/cell),
P < 0.01, n = 6. However, the resulting BDNF concentrations in
the incubation media with SL45 or bulk BM-MSCs (mean
values: 288 and 17 pg/mL, respectively) were lower than in the
BDNF-positive control, where 75 ng/mL BDNF was added.
Taken together, these measurements show a production of
important growth factors by both cells types. This might be one
of the major reasons for the observed effect on fiber growth in
those cultures, which could explain the additional cell-specific
benefit of the MSCs over the BDNF-treated control.
Discussion
The present study confirms the previously reported neurosupportive and regenerative features of MSCs, and additionally highlights the importance of isolation and expansion
56
8
SYGNECKA ET AL.
FIG. 6. Quantification of fiber density in the border region of organotypic brain slice co-cultures after application of
different BM-derived stem cell populations. (A) Microscopic images of traced fibers in the border regions of the co-cultures
after cultivation with (A2) classically isolated bulk BM-MSCs, (A3) SL45-MSCs in comparison to (A4) BDNF-treatment
and to (A1) control conditions. (B) Fiber quantification revealed that SL45-MSCs showed the highest benefit for fiber
growth, followed by bulk BM-MSCs. The effect of BDNF was less pronounced than after co-cultivation with any of the
MSC preparations. Data are shown as box-whisker plots and represent the empirical distribution of fiber densities of the
investigated groups, control: n = 50 images, bulk BM-MSCs: n = 111 images, SL45-MSCs: n = 186 images, BDNF: n = 93
images; **P < 0.01 in comparison to control, #P < 0.01 in comparison to BDNF, Kruskal–Wallis analysis of variance on
Ranks followed by Dunn’s test for multiple comparisons. Scale bar: (A1–A4) 50 mm.
conditions. We provided evidence that sorted SL45-MSCs
differ from bulk BM-MSCs in certain aspects: SL45-MSCs
were enriched for primary CFU-f, were more homogeneous,
expressed higher protein- and mRNA-levels of nestin, and
expressed higher amounts of the growth factors BDNF and
FGF2 compared with the more heterogeneous bulk BMderived cell population. Moreover, utilizing organotypic
dopaminergic slice co-cultures, we have shown that both
BM-MSC populations significantly enhanced neuronal fiber
growth in comparison with control conditions. The growth
promoting effect of the cells was more pronounced than the
effect of the growth factor BDNF. Interestingly, sorted
SL45-MSCs were more potent in stimulating fiber growth in
our co-culture system, indicating that this cell population is
enriched for cells that are responsible for the observed regenerative and trophic effects.
FIG. 7. The expression of BDNF, FGF2, and NGF in bulk BM-MSCs and sorted SL45-MSCs, quantified by quantitative
real-time polymerase chain reaction. (A–C) Expression levels of BDNF, FGF2, and NGF in the two cell populations are
expressed as DCP (relative expression normalized to the housekeeper genes Ubc and Mrpl32, y-axis). Significantly higher
expression levels of (A) BDNF and (B) FGF2 were revealed in the SL45-MSC population. No significant difference in the
expression of (C) NGF between the two cell populations was detected, but there is a tendency to higher expression in the
SL45-MSC samples. Data are shown as box-whisker plots, n > 4 independent cell preparations, *P < 0.05, **P < 0.01,
Mann–Whitney Rank Sum Test. FGF2, basic fibroblast growth factor; NGF, nerve growth factor; n.s., not significant.
57
Conventionally cultured MSCs yield heterogeneous populations that often contain contaminating cells due to the
significant variability in the isolation method, the tissue
origin, and the lack of specific MSC markers [21,23,26].
Moreover, experimental artifacts introduced by inconsistent
cell culture protocols or following extensive culture manipulation may result in changes of the MSCs’ properties or
in the aging processes of the cells, both causing complications in the utilization of MSCs as therapeutic tools (for
review see Wang et al. [25]). As an example, the number of
passages was shown to greatly influence the survival rate,
migration, and neuroprotective capacities of MSCs [38].
With regard to the use of MSCs in clinical medicine, it is
anticipated that more homogeneous cell preparations will
yield more consistent clinical outcomes that exhibit both
dose responsiveness and more reproducible outcomes [21].
Collectively, these studies underline the importance of preparing adequate homogenous cell populations of MSCs.
In our study, we found a higher frequency of nestinpositive cells and significantly more mRNA transcripts of
nestin in SL45-MSCs compared with classically isolated
bulk BM-MSCs. This is in accordance with results of other
studies, where the heterogeneity of primary MSC cultures
and an increase in the percentage of nestin-positive MSCs as
a function of the number of passages were observed [39].
This further implicated the superior proliferative capacity of
nestin-positive MSCs.
The expression of nestin and bIII tubulin in undifferentiated cells has been reported previously and has been taken as
evidence for proliferative and progenitor potential [35,40–
42]. Furthermore, nestin has been described as a marker for
MSCs in the recent literature [34,37,43]. In this context, it
was shown that nestin-positive MSCs contain all the CFU-f
activity of the BM, can self-renew in serial transplantation,
and are able to differentiate toward mesenchymal lineages
[34,37]. Indeed, we could confirm multilineage differentiation capacity into adipogenic, chondrogenic, and osteogenic
lineages in both bulk BM-MSCs and SL45-MSCs (Supplementary Fig. S1).
Several findings point to an active role of MSCs in experimental in vitro and in vivo models of different diseases of
the CNS, including Parkinson’s disease, stroke, multiple
sclerosis, traumatic brain or spinal cord injury [8,44–48]. As
an example, animal studies in traumatic brain injury have
shown improved functional outcome when MSCs were injected intracerebrally or intravenously [49,50]. Human MSCs
were beneficial after spinal cord injury due to the increase in
axonal sprouting and in the number of surviving rat cortical
neurons in vivo [51]. Further underlining the importance of
MSCs, there are 77 clinical trials registered using MSCs in
neuropathological conditions (www.clinicaltrials.gov, website
of the National Institutes of Health, Bethesda, MD, search for
‘‘mesenchymal stem cells and CNS,’’ October 2014, eg, regarding Parkinson’s disease: NCT01446614).
The regeneration of injured neuronal cells and the corresponding fiber projections are of great interest with respect
to the described neurological diseases. Organotypic brain
slices that can be maintained in culture for several weeks
facilitate the study of cellular interactions and mechanisms
in this context. Furthermore, this technique represents a
powerful tool for the development of ex vivo models of
neurological disorders and to investigate approaches for
9
potential stem cell therapies (for review see Daviaud et al.
[52]). For example, MSCs revealed a significant neuroprotective effect in ischemia models of organotypic hippocampal slices [19,53]. In organotypic spinal cord slices,
topically applied MSCs survived, migrated into the slice,
and promoted host neurite extension [11,12] and axonal
outgrowth from the cortex to the spinal cord [13]. Here, we
describe a beneficial effect of BM-MSC preparations with a
particular focus on the clinically relevant parameter of axonal outgrowth in the dopaminergic system. Our data indicate that SL45-MSCs are more potent than bulk BM-MSCs.
Therefore, SL45-MSCs appear to be particularly well suited
to promote neuro(re)generation ex vivo.
Our findings show that MSC preparations derived from a
defined cell population enriched for primary MSCs are advantageous in different aspects. (i) SL45-MSCs have a
higher fiber growth promoting potential compared to conventional bulk BM-MSCs. (ii) A more homogenous MSC
population can be obtained much faster starting from preenriched CFU-f, allowing for a shorter expansion phase in
vitro, and hence a lower risk of culture prone alterations or
mutation accumulations on the MSC population. (iii) Due to
the more homogeneous population derived from enriched
primary MSCs, the risk of contamination with alloreactive
immune cells might potentially be lower. Summarizing, we
suggest the use of cell material that is more homogeneous
and highly enriched in CFU-f activity as a starting point for
cell therapeutic development. This is in line with previously
published studies and their conclusions [1,3,26,28,54].
Earlier studies were based on the assumption that the neuroregenerative effects of MSCs are caused by the replacement of
damaged cells by differentiation into neurons or glia [55,56].
However, the current opinion favors a model of regeneration
induced by the release of soluble factors, such as trophic factors.
Thus, the capacity of MSCs to actively alter the microenvironment via these factors may contribute more significantly to
tissue repair than their plasticity [16,24,47]. Our findings also
suggest a stimulating effect mediated via soluble secreted factors as the main reason for the observed impact on fiber growth,
as the cells where plated underneath the co-cultures without
direct contact to the brain slices in our study. This hypothesis is
in line with findings by other groups, demonstrating the secretion of trophic factors by MSCs, including BDNF, NGF, GDNF,
FGF2, and the vascular endothelial growth factor [9,18,57–59].
We detected the mRNA of the growth factors BDNF,
CNTF, FGF2, GDNF, HGF, IGF1, NGF, and NRG1 by qPCR
in all assessed cell samples. The significantly higher expression of BDNF and FGF2 in the SL45-MSC population,
which has exemplarily been confirmed on the protein level
for BDNF, could be a reason for the more pronounced effect
evoked by the sorted SL45-MSC population as compared to
the classically isolated bulk BM-MSCs. This might result
from the homogeneity of the populations with SL45-MSCs
where the cells express similar levels of growth factors, while
the more heterogeneous bulk BM-MSCs consist of a mixture
of both secreting and non-secreting cells.
The observed growth promoting effect of the growth
factor producing MSC populations in the dopaminergic
projection system is not surprising, taking into account that
previous studies have shown the beneficial effects of BDNF,
GDNF, and FGF2 on mesencephalic dopaminergic neurons
[60–62]. These growth factors are considered to mediate
58
10
dopaminergic neuronal survival and neuroprotection. Thus,
they had become potential candidates for the therapy of
Parkinson’s disease [63–66]. For example, BDNF provides
support for both developing and adult dopaminergic neurons
[67–70]. So BDNF resulted in enhanced survival of tyrosine
hydroxylase-positive neurons and increased growth of tyrosine hydroxylase-positive fibers into striatal tissue [71].
GDNF, which is especially important for the development of
embryonic dopaminergic neurons [72], induced neuronal
survival and promoted the innervation of target areas [73–
76]. FGF2 stimulated the proliferation of dopaminergic
progenitor cells, promoted survival and neurite outgrowth of
dopaminergic neurons, and participated in nigrostriatal
pathway formation and target innervation [66,77,78].
The impact of the BDNF application to the brain slice
culture medium was less pronounced than the growth facilitating properties of both MSC populations under study.
This is in agreement with previous studies showing that the
combined application of neurotrophins (eg, BDNF and
NGF) elicited greater axon growth than treatment with each
neurotrophin alone [79]. Moreover, Crigler et al. revealed
that MSCs express potent neuroregulatory molecules in a
restricted manner in addition to growth factors like BDNF
and NGF. These growth factors may further contribute to
MSC-induced effects on neuronal survival and nerve regeneration [9].
Conclusion
In conclusion, both MSC preparations exerted highly
beneficial effects on fiber outgrowth in organotypic brain
slices of the dopaminergic system well above the level of
untreated controls, and had also a stronger effect than the
positive control BDNF. Thus, MSCs appear to be very well
suited to promote neuro(re)generation. The outcome was
dependent on the isolation and expansion conditions and we
could show that the more homogeneous sorted SL45-MSCs
were more potent in stimulating fiber growth, indicating an
enrichment of cells that are responsible for the observed regenerative and trophic effects. The higher expression levels
of nestin, BDNF, and FGF2 in SL45-MSCs compared to
classically isolated BM-MSCs may serve as an explanation
for the higher potential in stimulating fiber growth as demonstrated in this study.
Acknowledgments
The authors thank Katrin Becker and Katrin Krause
(Rudolf Boehm Institute of Pharmacology and Toxicology)
as well as Gabrielle Öhme and Sabine Hecht (TRM Leipzig)
for excellent technical assistance. The authors are grateful to
Adrian Urwyler (Cytolab, Regensdorf, Switzerland) for
performing the BDNF measurements in the conditioned
media. The authors thank Jennifer Ding for providing language help. The work presented in this article was made
possible by funding from the German Federal Ministry of
Education and Research (BMBF 1315883).
Author Disclosure Statement
None of the authors has any disclosure to declare. No
competing financial interests exist.
SYGNECKA ET AL.
References
1. Tondreau T, L Lagneaux, M Dejeneffe, A Delforge, M
Massy, C Mortier and D Bron. (2004). Isolation of BM
mesenchymal stem cells by plastic adhesion or negative
selection: phenotype, proliferation kinetics and differentiation potential. Cytotherapy 6:372–379.
2. Zhang Z, X Wang and S Wang. (2008). Isolation and
characterization of mesenchymal stem cells derived from
bone marrow of patients with Parkinson’s disease. In Vitro
Cell Dev Biol Anim 44:169–177.
3. Morikawa S, Y Mabuchi, Y Kubota, Y Nagai, K Niibe, E
Hiratsu, S Suzuki, C Miyauchi-Hara, N Nagoshi, et al.
(2009). Prospective identification, isolation, and systemic
transplantation of multipotent mesenchymal stem cells in
murine bone marrow. J Exp Med 206:2483–2496.
4. Torrente Y and E Polli. (2008). Mesenchymal stem cell
transplantation for neurodegenerative diseases. Cell Transplant 17:1103–1113.
5. Castillo-Melendez M, T Yawno, G Jenkin and SL Miller.
(2013). Stem cell therapy to protect and repair the developing brain: a review of mechanisms of action of cord blood
and amnion epithelial derived cells. Front Neurosci 7:194.
6. Uccelli A, A Laroni and MS Freedman. (2011). Mesenchymal stem cells for the treatment of multiple sclerosis and
other neurological diseases. Lancet Neurol 10:649–656.
7. Lee PH and HJ Park. (2009). Bone marrow-derived mesenchymal stem cell therapy as a candidate disease-modifying
strategy in Parkinson’s disease and multiple system atrophy. J
Clin Neurol 5:1–10.
8. Azari MF, L Mathias, E Ozturk, DS Cram, RL Boyd and S
Petratos. (2010). Mesenchymal stem cells for treatment of
CNS injury. Curr Neuropharmacol 8:316–323.
9. Crigler L, RC Robey, A Asawachaicharn, D Gaupp and DG
Phinney. (2006). Human mesenchymal stem cell subpopulations express a variety of neuro-regulatory molecules
and promote neuronal cell survival and neuritogenesis. Exp
Neurol 198:54–64.
10. Wright KT, W El Masri, A Osman, S Roberts, G Chamberlain, BA Ashton and WEB Johnson. (2007). Bone marrow stromal cells stimulate neurite outgrowth over neural
proteoglycans (CSPG), myelin associated glycoprotein and
Nogo-A. Biochem Biophys Res Commun 354:559–566.
11. Cho JS, HW Park, SK Park, S Roh, SK Kang, KS Paik and MS
Chang. (2009). Transplantation of mesenchymal stem cells
enhances axonal outgrowth and cell survival in an organotypic
spinal cord slice culture. Neurosci Lett 454:43–48.
12. Shichinohe H, S Kuroda, S Tsuji, S Yamaguchi, S Yano, JB
Lee, H Kobayashi, S Kikuchi, K Hida and Y Iwasaki.
(2008). Bone marrow stromal cells promote neurite extension in organotypic spinal cord slice: significance for
cell transplantation therapy. Neurorehabil Neural Repair
22:447–457.
13. Kamei N, N Tanaka, Y Oishi, M Ishikawa, T Hamasaki, K
Nishida, K Nakanishi, N Sakai and M Ochi. (2007). Bone
marrow stromal cells promoting corticospinal axon growth
through the release of humoral factors in organotypic cocultures in neonatal rats. J Neurosurg Spine 6:412–419.
14. Chen CJ, YC Ou, SL Liao, WY Chen, SY Chen, CW Wu,
CC Wang, WY Wang, YS Huang and SH Hsu. (2007).
Transplantation of bone marrow stromal cells for peripheral
nerve repair. Exp Neurol 204:443–453.
15. Cuevas P, F Carceller, I Garcia-Gómez, M Yan and M
Dujovny. (2004). Bone marrow stromal cell implantation
for peripheral nerve repair. Neurol Res 26:230–232.
59
16. Marconi S, G Castiglione, E Turano, G Bissolotti, S Angiari, A Farinazzo, G Constantin, G Bedogni, A Bedogni
and B Bonetti. (2012). Human adipose-derived mesenchymal stem cells systemically injected promote peripheral
nerve regeneration in the mouse model of sciatic crush.
Tissue Eng Part A 18:1264–1272.
17. Horwitz E and M Dominici. (2008). How do mesenchymal
stromal cells exert their therapeutic benefit? Cytotherapy
10:771–774.
18. Whone AL, K Kemp, M Sun, A Wilkins and NJ Scolding.
(2012). Human bone marrow mesenchymal stem cells
protect catecholaminergic and serotonergic neuronal perikarya and transporter function from oxidative stress by the
secretion of glial-derived neurotrophic factor. Brain Res
1431:86–96.
19. Sarnowska A, H Braun, S Sauerzweig and KG Reymann.
(2009). The neuroprotective effect of bone marrow stem
cells is not dependent on direct cell contact with hypoxic
injured tissue. Exp Neurol 215:317–327.
20. Zacharek A, A Shehadah, J Chen, X Cui, C Roberts, M Lu
and M Chopp. (2010). Comparison of bone marrow stromal
cells derived from stroke and normal rats for stroke treatment. Stroke 41:524–530.
21. Phinney DG. (2012). Functional heterogeneity of mesenchymal stem cells: implications for cell therapy. J Cell
Biochem 113:2806–2812.
22. Bieback K, S Kinzebach and M Karagianni. (2011).
Translating research into clinical scale manufacturing of
mesenchymal stromal cells. Stem Cells Int 2010:193519.
23. Ho AD, W Wagner and W Franke. (2008). Heterogeneity
of mesenchymal stromal cell preparations. Cytotherapy 10:
320–330.
24. Phinney DG. (2007). Biochemical heterogeneity of mesenchymal stem cell populations: clues to their therapeutic
efficacy. Cell Cycle 6:2884–2889.
25. Wang Y, Z Han, Y Song and ZC Han. (2012). Safety of
mesenchymal stem cells for clinical application. Stem Cells
Int 2012:652034.
26. Mabuchi Y, DD Houlihan, C Akazawa, H Okano and Y
Matsuzaki. (2013). Prospective isolation of murine and
human bone marrow mesenchymal stem cells based on
surface markers. Stem Cells Int 2013:507301.
27. Heider A, R Danova-Alt, D Egger, M Cross and R Alt.
(2013). Murine and human very small embryonic-like cells:
a perspective. Cytometry A 83:72–75.
28. Kucia M, R Reca, FR Campbell, E Zuba-Surma, M Majka,
J Ratajczak and MZ Ratajczak. (2006). A population of
very small embryonic-like (VSEL) CXCR4( + )SSEA1( + )Oct-4 + stem cells identified in adult bone marrow.
Leukemia 20:857–869.
29. Franke H, N Schelhorn and P Illes. (2003). Dopaminergic
neurons develop axonal projections to their target areas in
organotypic co-cultures of the ventral mesencephalon and
the striatum/prefrontal cortex. Neurochem Int 42:431–439.
30. Heine C, A Wegner, J Grosche, C Allgaier, P Illes and H
Franke. (2007). P2 receptor expression in the dopaminergic
system of the rat brain during development. Neuroscience
149:165–181.
31. Heine C, K Sygnecka, N Scherf, A Berndt, U Egerland, T
Hage and H Franke. (2013). Phosphodiesterase 2 inhibitors
promote axonal outgrowth in organotypic slice co-cultures.
Neurosignals 21:197–212.
32. Vignali DA. (2000). Multiplexed particle-based flow cytometric assays. J Immunol Methods 243:243–255.
11
33. Heine C and H Franke. (2014). Organotypic slice co-culture
systems to study axon regeneration in the dopaminergic
system ex vivo. Methods Mol Biol 1162:97–111.
34. Méndez-Ferrer S, TV Michurina, F Ferraro, AR Mazloom,
BD Macarthur, SA Lira, DT Scadden, A Ma’ayan, GN
Enikolopov and PS Frenette. (2010). Mesenchymal and
haematopoietic stem cells form a unique bone marrow
niche. Nature 466:829–834.
35. Wiese C, A Rolletschek, G Kania, P Blyszczuk, KV Tarasov, Y Tarasova, RP Wersto, KR Boheler and AM Wobus.
(2004). Nestin expression—a property of multi-lineage
progenitor cells? Cell Mol Life Sci 61:2510–2522.
36. Wislet-Gendebien S, F Bruyère, G Hans, P Leprince, G
Moonen and B Rogister. (2004). Nestin-positive mesenchymal stem cells favour the astroglial lineage in neural
progenitors and stem cells by releasing active BMP4. BMC
Neurosci 5:33.
37. Tondreau T, L Lagneaux, M Dejeneffe, M Massy, C
Mortier, A Delforge and D Bron. (2004). Bone marrowderived mesenchymal stem cells already express specific
neural proteins before any differentiation. Differentiation
72:319–326.
38. Charrière K, PY Risold and D Fellmann. (2010). In vitro
interactions between bone marrow stromal cells and hippocampal slice cultures. C R Biol 333:582–590.
39. Wislet-Gendebien S, F Wautier, P Leprince and B Rogister.
(2005). Astrocytic and neuronal fate of mesenchymal stem
cells expressing nestin. Brain Res Bull 68:95–102.
40. Lendahl U, LB Zimmerman and RD McKay. (1990). CNS
stem cells express a new class of intermediate filament
protein. Cell 60:585–595.
41. Menezes JR and MB Luskin. (1994). Expression of neuronspecific tubulin defines a novel population in the proliferative layers of the developing telencephalon. J Neurosci
14:5399–5416.
42. Lee MK, LI Rebhun and A Frankfurter. (1990). Posttranslational modification of class III beta-tubulin. Proc
Natl Acad Sci U S A 87:7195–7199.
43. Wislet-Gendebien S, P Leprince, G Moonen and B Rogister. (2003). Regulation of neural markers nestin and
GFAP expression by cultivated bone marrow stromal cells.
J Cell Sci 116:3295–3302.
44. Li Y and M Chopp. (2009). Marrow stromal cell transplantation in stroke and traumatic brain injury. Neurosci
Lett 456:120–123.
45. Kan I, E Melamed and D Offen. (2007). Autotransplantation
of bone marrow-derived stem cells as a therapy for neurodegenerative diseases. Handb Exp Pharmacol 219–242.
46. Park HJ, PH Lee, OY Bang, G Lee and YH Ahn. (2008).
Mesenchymal stem cells therapy exerts neuroprotection in
a progressive animal model of Parkinson’s disease. J
Neurochem 107:141–151.
47. Rivera FJ and L Aigner. (2012). Adult mesenchymal stem
cell therapy for myelin repair in multiple sclerosis. Biol Res
45:257–268.
48. Joyce N, G Annett, L Wirthlin, S Olson, G Bauer and JA
Nolta. (2010). Mesenchymal stem cells for the treatment of
neurodegenerative disease. Regen Med 5:933–946.
49. Mahmood A, D Lu and M Chopp. (2004). Marrow stromal cell
transplantation after traumatic brain injury promotes cellular
proliferation within the brain. Neurosurgery 55:1185–1193.
50. Qu C, A Mahmood, D Lu, A Goussev, Y Xiong and M
Chopp. (2008). Treatment of traumatic brain injury in mice
with marrow stromal cells. Brain Res 1208:234–239.
60
12
51. Sasaki M, C Radtke, AM Tan, P Zhao, H Hamada, K
Houkin, O Honmou and JD Kocsis. (2009). BDNFhypersecreting human mesenchymal stem cells promote
functional recovery, axonal sprouting, and protection of
corticospinal neurons after spinal cord injury. J Neurosci
29:14932–14941.
52. Daviaud N, E Garbayo, PC Schiller, M Perez-Pinzon and
CN Montero-Menei. (2013). Organotypic cultures as tools
for optimizing central nervous system cell therapies. Exp
Neurol 248:429–440.
53. Zhong C, Z Qin, CJ Zhong, Y Wang and XY Shen. (2003).
Neuroprotective effects of bone marrow stromal cells on rat
organotypic hippocampal slice culture model of cerebral
ischemia. Neurosci Lett 342:93–96.
54. Sivasubramaniyan K, D Lehnen, R Ghazanfari, M Sobiesiak, A Harichandan, E Mortha, N Petkova, S Grimm, F
Cerabona, et al. (2012). Phenotypic and functional heterogeneity of human bone marrow- and amnion-derived MSC
subsets. Ann N Y Acad Sci 1266:94–106.
55. Kopen GC, DJ Prockop and DG Phinney. (1999). Marrow
stromal cells migrate throughout forebrain and cerebellum,
and they differentiate into astrocytes after injection into
neonatal mouse brains. Proc Natl Acad Sci U S A 96:
10711–10716.
56. Woodbury D, EJ Schwarz, DJ Prockop and IB Black.
(2000). Adult rat and human bone marrow stromal cells
differentiate into neurons. J Neurosci Res 61:364–370.
57. Chen X, M Katakowski, Y Li, D Lu, L Wang, L Zhang, J
Chen, Y Xu, S Gautam, A Mahmood and M Chopp. (2002).
Human bone marrow stromal cell cultures conditioned by
traumatic brain tissue extracts: growth factor production. J
Neurosci Res 69:687–691.
58. Mahmood A, D Lu and M Chopp. (2004). Intravenous
administration of marrow stromal cells (MSCs) increases
the expression of growth factors in rat brain after traumatic
brain injury. J Neurotrauma 21:33–39.
59. Wilkins A, K Kemp, M Ginty, K Hares, E Mallam and N
Scolding. (2009). Human bone marrow-derived mesenchymal stem cells secrete brain-derived neurotrophic factor
which promotes neuronal survival in vitro. Stem Cell Res
3:63–70.
60. Krieglstein K. (2004). Factors promoting survival of
mesencephalic dopaminergic neurons. Cell Tissue Res 318:
73–80.
61. Von Bohlen und Halbach O and K Unsicker. (2009).
Neurotrophic support of midbrain dopaminergic neurons.
Adv Exp Med Biol 651:73–80.
62. Rangasamy SB, K Soderstrom, RAE Bakay and JH Kordower. (2010). Neurotrophic factor therapy for Parkinson’s
disease. Prog Brain Res 184:237–264.
63. Sullivan AM and A Toulouse. (2011). Neurotrophic factors
for the treatment of Parkinson’s disease. Cytokine Growth
Factor Rev 22:157–165.
64. Peterson AL and JG Nutt. (2008). Treatment of Parkinson’s
disease with trophic factors. Neurotherapeutics 5:270–280.
65. Fumagalli F, G Racagni and MA Riva. (2006). Shedding
light into the role of BDNF in the pharmacotherapy of
Parkinson’s disease. Pharmacogenomics J 6:95–104.
66. Grothe C and M Timmer. (2007). The physiological and
pharmacological role of basic fibroblast growth factor in
the dopaminergic nigrostriatal system. Brain Res Rev 54:
80–91.
67. Hyman C, M Hofer, YA Barde, M Juhasz, GD Yancopoulos, SP Squinto and RM Lindsay. (1991). BDNF is a
SYGNECKA ET AL.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350:230–232.
Hyman C, M Juhasz, C Jackson, P Wright, NY Ip and RM
Lindsay. (1994). Overlapping and distinct actions of the
neurotrophins BDNF, NT-3, and NT-4/5 on cultured dopaminergic and GABAergic neurons of the ventral mesencephalon. J Neurosci 14:335–347.
Knüsel B, JW Winslow, A Rosenthal, LE Burton, DP Seid,
K Nikolics and F Hefti. (1991). Promotion of central cholinergic and dopaminergic neuron differentiation by brainderived neurotrophic factor but not neurotrophin 3. Proc
Natl Acad Sci U S A 88:961–965.
Hagg T. (1998). Neurotrophins prevent death and differentially affect tyrosine hydroxylase of adult rat nigrostriatal
neurons in vivo. Exp Neurol 149:183–192.
Østergaard K, SA Jones, C Hyman and J Zimmer. (1996). Effects of donor age and brain-derived neurotrophic factor on the
survival of dopaminergic neurons and axonal growth in postnatal rat nigrostriatal co-cultures. Exp Neurol 142:340–350.
Lin LF, DH Doherty, JD Lile, S Bektesh and F Collins. (1993).
GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260:1130–1132.
Granholm AC, M Reyland, D Albeck, L Sanders, G Gerhardt, G Hoernig, L Shen, H Westphal and B Hoffer.
(2000). Glial cell line-derived neurotrophic factor is essential for postnatal survival of midbrain dopamine neurons. J Neurosci 20:3182–3190.
Jaumotte JD and MJ Zigmond. (2005). Dopaminergic innervation of forebrain by ventral mesencephalon in organotypic slice co-cultures: effects of GDNF. Brain Res Mol
Brain Res 134:139–146.
Schatz DS, WA Kaufmann, A Saria and C Humpel. (1999).
Dopamine neurons in a simple GDNF-treated meso-striatal
organotypic co-culture model. Exp Brain Res 127:270–278.
Thompson LH, S Grealish, D Kirik and A Björklund.
(2009). Reconstruction of the nigrostriatal dopamine pathway in the adult mouse brain. Eur J Neurosci 30:625–638.
Engele J. (1998). Changing responsiveness of developing
midbrain dopaminergic neurons for extracellular growth
factors. J Neurosci Res 51:508–516.
Baron O, A Ratzka and C Grothe. (2012). Fibroblast
growth factor 2 regulates adequate nigrostriatal pathway
formation in mice. J Comp Neurol 520:3949–3961.
Oishi Y, J Baratta, RT Robertson and O Steward. (2004).
Assessment of factors regulating axon growth between the
cortex and spinal cord in organotypic co-cultures: effects of
age and neurotrophic factors. J Neurotrauma 21:339–356.
Address correspondence to:
Katja Sygnecka
Translational Centre for Regenerative Medicine (TRM)
c/o Rudolph Boehm Institute of Pharmacology
and Toxicology
University of Leipzig
Härtelstr. 16-18
Leipzig 04107
Germany
E-mail: [email protected]
Received for publication May 27, 2014
Accepted after revision November 10, 2014
Prepublished on Liebert Instant Online XXXX XX, XXXX
61
RESEARCH ARTICLES - MSCs (Suppl.)
Supplementary Data
changed every 2–3 days. After 21 days, osteogenesis was
analyzed.
Differentiation protocols
Five thousand cells/cm2 were seeded in
maintenance medium and expanded. At a confluency of
80%, medium was replaced by adipogeneic differentiation
medium [Dulbecco’s modified Eagle’s medium (DMEM)/
F12 (1:1; PAA Laboratories, GmbH, Cölbe, Germany), 5%
rabbit serum, 3.925 mg/L dexamethasone, 10 mg/L insulin,
111.1 mg/L 3-isobutyl-1-methylxanthin, 35.76 mg/L indomethacine, and 10 mM HEPES (all from Sigma-Aldrich)
supplemented with Pen/Strep (100 U/mL and 100 mg/mL,
respectively; all from PAA Laboratories)]. This medium
was partly (50%) changed every 2–3 days. After 7 days,
cells were fixed and adipogenesis was analyzed.
Chondrogenesis. About 250,000–500,000 cells were
centrifuged in 1 mL maintenance medium in a 15 mL-falcon
tube at 270 g for 3 min. After 24 h incubation at 37C, medium was replaced by chondrogeneic differentiation medium
[DMEM/F12 (1:1; PAA Laboratories), 10% fetal calf serum
(FCS; PAA Laboratories), 39.25 mg/L dexamethasone, 1%
ITS-Premix, 37.84 mg/mL l-ascorbic acid 2-phosphate (all
from Sigma-Aldrich, Taufkirchen, Germany), 46.24 mg/mL
proline, and 10 ng/mL transforming growth factor beta 1
(Peprotech) supplemented with Pen/Strep (100 U/mL and
100 mg/mL, respectively; all from PAA Laboratories)]. This
medium was partly (50%) changed every 2–3 days. After 21
days, chondrogenesis was analyzed.
Osteogenesis. Five thousand cells/cm2 were seeded in
maintenance medium and expanded. At a confluency of
80%, medium was replaced by osteogenic differentiation medium [DMEM/F12 (1:1; PAA Laboratories), 10%
FCS (PAA Laboratories), 39.25 mg/L dexamethasone,
2.16 mg/mL b-glycerophosphate, and 25.61 mg/mL lascorbic acid (all from Sigma-Aldrich) supplemented with
Pen/Strep (100 U/mL and 100 mg/mL, respectively; all from
PAA Laboratories)]. This medium was partly (50%)
Adipogenesis.
Analysis of differentiation
Adipogenesis. Cells were fixed with 3.7% paraformaldehyde (PFA) for 30 min, washed with propylene glycol
(Sigma-Aldrich), and incubated in Oil Red O solution
(0.5%; Sigma-Aldrich in propylene glycol) for 10 min at
room temperature. Afterward, cells were washed with propylene glycol until washing reagent remained colorless.
Cells were analyzed with a usual light microscope (Nikon).
Chondrogenesis. Processing of the cell aggregates: Cells
were fixed with 3.7% PFA for 120 min and washed twice
with phosphate-buffered saline (PBS) followed by histological processing: dehydration in graded series of ethanol,
xylole, and melted paraffin (Vogel GmbH and Co. KG,
Giessen, Germany), embedding in paraffin, hematoxyline/
erythrosine staining [10–15 s in Mayer’s hematoxylin solution (Merck, Darmstadt, Germany), 10–15 s in 0.6% erythrosine solution (Merck) in 35% ethanol, four drops of acetic
acid/200 mL added directly before use], sectioning with a
microtome (Leica RM 2165, 4 mm), mounting on glass
slides, rehydration in series of xylole and graded ethanol,
washing in water, and staining.
Masson’s Trichrome staining: After postfixation at 60C for
60 min with Bouin’s fluid (Sigma-Aldrich), slices were washed under running tap water for 10 min at room temperature
(RT). All followed steps were conducted at RT. Slices were
incubated for 10 min in Weigert’s iron hematoxylin solution
(Sigma-Aldrich) followed by washing with water for 10 min.
Then, slices were stained with ponceau fuchsine solution
[0.75 g/L ponceau de xylidin, 0.25 g/L acid fuchsine (both
Sigma-Aldrich) 1% acetic acid] for 30 min, followed by a
rinsing step with 1% acetic acid. Incubation in phosphotungstic acid (2%; Sigma-Aldrich) for 2 min was conducted
followed by a rinsing step with 1% acetic acid. Finally, slices
were incubated in Fast Green solution (0.2% Fast Green FCF;
Supplementary Table S1. Sequences of Primers for Quantitative Polymerase Chain Reaction
Target
Accession ID
Forward primer
Reverse primer
Bdnf
Cntf
Fgf2
Gdnf
Hgf
Igf1
Mrpl32
Nes
Ngf
Nrg1
Tubb3
Ubc
NM_007540.4
NM_170786.2
NM_008006.2
NM_010275.2
NM_010427.4
NM_010512.4
NM_029271.2
NM_016701.3
NM_013609.3
NM_178591.2
NM_023279.2
NM_019639.4
GGCTGACACTTTTGAGCACG
ACCTCTGTAGCCGCTCTATCT
CGACCCACACGTCAAACTAC
CTGAAGACCACTCCCTCGG
TCAGGACCATGTGAGGGAGAT
GGACCGAGGGGCTTTTACTT
CAGAGCTGGAGTCGCTTTGT
AGAGGACCCAAGGCATTTCG
GGGGGAGTTCTCAGTGTGTG
ACTGGCATCTGTATCGCCCT
TTCGTCTCTAGCCGCGTGAA
CCCACACAAAGCCCCTCAAT
CAAGTCCGCGTCCTTATGGT
AGGCCTTGATGTTTTACATAAGATT
GTTGGCACACACTCCCTTGA
TCTTCAGGCATATTGGAGTCAC
ACATCCACGACCAGGAACAA
TCCGGAAGCAACACTCATCC
TGAGGATGGATGGTCTCTGGA
TGCCTTCACACTTTCCTCCC
CACCTCCTTGCCCTTGATGT
CTGCCGCTGTTTCTTGGTTTT
CTCCCAGAACTTGGCCCCTATC
AAGATCTGCATCGTCTCTCTCAC
Bdnf, brain-derived neurotrophic factor; Cntf, ciliary neurotrophic factor; Fgf2, basic fibroblast growth factor; Gdnf, glial cell-derived
neurotrophic factor; Hgf, hepatocyte growth factor; Igf-1, insulin-like growth factor 1; Mrpl32, mitochondrial ribosomal protein L32; Ngf,
nerve growth factor; Nrg1, neuregulin 1; Ubc, ubiquitin.
62
RESEARCH ARTICLES - MSCs (Suppl.)
SUPPLEMENTARY FIG. S1. In vitro differentiation assays showing tri-lineage potential of bulk bone marrow-derived
mesenchymal stem cell (BM-MSC) (A–C) and Sca-1 + Lin - CD45 - -derived MSC (SL45-MSC) (D–F) populations starting
from fibroblast colony forming units. (A, D) Adipogenesis was demonstrated by Oil red O staining of lipid globules. (B, E)
Chondrogenesis was confirmed by (B1, E1) Masson’s Trichrom staining (collagene appears green; nuclei are blue-black;
cytoplasm is stained red); (B2, E2) Safranin O staining (proteoglycans appear orange-red; nuclei are blue-black; cytoplasm
is stained gray-green). (C, F) Osteogenesis of bulk BM-MSCs (C1, C2) and SL-45-MSCs (F1, F2) was indicated by
Alizarin Red staining of depositions of calcium mineralized matrix. Micrographs of representative experiments are shown.
Scale bars: (A–E) 100 mm, (F) 200 mm.
Sigma-Aldrich in 1% acetic acid) for 5 min, followed by a
last rinsing step with 1% acetic acid.
Safranin O staining: Slices were incubated with Safranin
O solution (0.2%; Sigma-Aldrich in 1% acetic acid) for
10 min, followed by a washing step with aqua dest.
Thereafter, slices were stained with Fast Green solution [0.04% Fast Green (Chroma, Stuttgart, Germany) in
0.2% acetic acid] for 15 s. Slices were then washed with
aqua dest. and embedded when dried. All steps were
conducted at RT.
Embedding of stained slices: After the staining, slices
were washed with 96% ethanol for 3 min and rinsed with
xylole. After having dried, slices were embedded with Roti
Histokit (Carl Roth GmbH and Co. KG, Karlsruhe, Germany).
Osteogenesis. Cells were fixed with 3.7% PFA for
30 min, washed with PBS and incubated in 1% Alzarin Red
solution (Sigma-Aldrich) for 5 min at room temperature.
Afterwards, cells were washed with PBS until washing reagent remained colorless. Cells were analyzed, after having
dried with a usual light microscope.
63
Titel:
Mesenchymal stem cells support neuronal fiber growth in an organotypic
brain slice co-culture model
Journal:
Stem cells and Development
Autoren:
K. Sygnecka, A. Heider, N. Scherf, R. Alt, H. Franke, C. Heine
- Konzeption
- Immunhistochemie (Zellen)
- Faserquantifizierung (Co-Kulturen)
- Genexpressionsstudien (Zellen)
- Quantifizierung sezernierter Wachstumsfaktoren: Generierung der Proben,
Auswertung
Anteil Heider:
- Präparation und Kultivierung der Zellen
- CFU-f-Analyse
- Differenzierung der Zellen
Anteil Scherf:
- Bioinformatische Bildauswertung (Faserquantifizierung)
Anteil Alt:
- Projektidee
- Konzeption
- Projektidee
Anteil Heine (Letztautorin):
- Projektidee
- Konzeption
- Gewebekulturen (Präparation)
64
65
REFERENCES
3. References (1) Kebabian JW and Calne DB. 1979. Multiple receptors for dopamine. Nature 277(5692):93–96. (2) Gingrich JA and Caron MG. 1993. Recent advances in the molecular biology of dopamine receptors. Annu. Rev. Neurosci. 16:299–321. (3) Missale C, Nash SR, Robinson SW, Jaber M and Caron MG. 1998. Dopamine receptors: from structure to function. Physiol. Rev. 78(1):189–225. (4) Falck B, Hillarp NA, Thieme G and Torp A. 1982. Fluorescence of catechol amines and related compounds condensed with formaldehyde. Brain Res. Bull. 9(1‐6):xi–xv. (5) Francis SH, Turko IV and Corbin JD. 2001. Cyclic nucleotide phosphodiesterases: relating structure and function. Prog. Nucleic Acid Res. Mol. Biol. 65:1–52. (6) Dahlstroem A and Fuxe K. 1964. Evidence for the existence of monoamine‐containing neurons in the central nervous system. I. Demonstrations of monoamines in the cell bodies of brain stem neurons. Acta Physiol. Scand. Suppl:232:1‐55. (7) German DC and Manaye KF. 1993. Midbrain dopaminergic neurons (nuclei A8, A9, and A10): three‐dimensional reconstruction in the rat. J. Comp. Neurol. 331(3):297–309. (8) Björklund A and Lindvall O. 1984. Dopamine‐containing systems in the CNS. In: Björklund A and Hökfelt T, editors. Handbook of Chemical Neuroanatomy. (Classical Transmitters in the CNS, Part I), Vol. 2. Elsevier, Amsterdam. 55–122. (9) Fallon JH and Loughlin SE. 1995. Substantia Nigra. In: Paxinos G, editor. The Rat Nervous System. Academic Press, San Diego, CA. 215–237. (10) Fallon JH and Moore RY. 1978. Catecholamine innervation of the basal forebrain. IV. Topography of the dopamine projection to the basal forebrain and neostriatum. J. Comp. Neurol. 180(3):545–580. (11) Rutten K, Prickaerts J, Hendrix M, van der Staay, F Josef, Sik A and Blokland A. 2007. Time‐
dependent involvement of cAMP and cGMP in consolidation of object memory: studies using selective phosphodiesterase type 2, 4 and 5 inhibitors. Eur. J. Pharmacol. 558(1‐3):107–112. (12) Gerfen CR, Herkenham M and Thibault J. 1987. The neostriatal mosaic: II. Patch‐ and matrix‐
directed mesostriatal dopaminergic and non‐dopaminergic systems. J. Neurosci. 7(12):3915–
3934. (13) Fallon JH. 1988. Topographic organization of ascending dopaminergic projections. Ann. N. Y. Acad. Sci. 537:1–9. (14) Björklund A and Dunnett SB. 2007. Dopamine neuron systems in the brain: an update. Trends Neurosci. 30(5):194–202. (15) Swanson LW. 1992. Brain Maps: Structure of the Rat Brain. Elsevier, Amsterdam. Level 38. (16) Dunlop BW and Nemeroff CB. 2007. The role of dopamine in the pathophysiology of depression. Arch. Gen. Psychiatry 64(3):327–337. (17) Gerfen CR. 1985. The neostriatal mosaic. I. Compartmental organization of projections from the striatum to the substantia nigra in the rat. J. Comp. Neurol. 236(4):454–476. (18) Kemp JM and Powell TP. 1971. The structure of the caudate nucleus of the cat: light and electron microscopy. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 262(845):383–401. (19) Pickel VM, Beckley SC, Joh TH and Reis DJ. 1981. Ultrastructural immunocytochemical localization of tyrosine hydroxylase in the neostriatum. Brain Research 225(2):373–385. 66
REFERENCES
(20) Freund TF, Powell JF and Smith AD. 1984. Tyrosine hydroxylase‐immunoreactive boutons in synaptic contact with identified striatonigral neurons, with particular reference to dendritic spines. Neuroscience 13(4):1189–1215. (21) Gerfen CR, Baimbridge KG and Thibault J. 1987. The neostriatal mosaic: III. Biochemical and developmental dissociation of patch‐matrix mesostriatal systems. J. Neurosci. 7(12):3935–
3944. (22) DeLong MR and Wichmann T. 2007. Circuits and circuit disorders of the basal ganglia. Arch. Neurol. 64(1):20–24. (23) Fallon JH and Loughlin SE. 1995. The Substantia Nigra. In: Paxinos G, editor. The Rat Nervous System. Academic Press, San Diego, CA. 353–374. (24) Fallon JH and Loughlin SE. 1987. Monoamine innervation of cerebral cortex and a theory of the role of monoamines in cerebral cortex and basal ganglia. In: Jones EG, Peters A, editor. Cerebral Cortex. Plenum, New York. 41–127. (25) Tanaka S. 2006. Dopaminergic control of working memory and its relevance to schizophrenia: a circuit dynamics perspective. Neuroscience 139(1):153–171. (26) Goldman‐Rakic PS, Castner SA, Svensson TH, Siever LJ and Williams GV. 2004. Targeting the dopamine D1 receptor in schizophrenia: insights for cognitive dysfunction. Psychopharmacology 174(1):3–16. (27) Swanson L. 1982. The projections of the ventral tegmental area and adjacent regions: A combined fluorescent retrograde tracer and immunofluorescence study in the rat. Brain Res. Bull. 9(1‐6):321–353. (28) Steffensen SC, Svingos AL, Pickel VM and Henriksen SJ. 1998. Electrophysiological characterization of GABAergic neurons in the ventral tegmental area. J. Neurosci. 18(19):8003–
8015. (29) Thierry AM, Deniau JM, Herve D and Chevalier G. 1980. Electrophysiological evidence for non‐
dopaminergic mesocortical and mesolimbic neurons in the rat. Brain Res. 201(1):210–214. (30) Carr DB and Sesack SR. 2000. GABA‐containing neurons in the rat ventral tegmental area project to the prefrontal cortex. Synapse 38(2):114–123. (31) Yamaguchi T, Wang H, Li X, Ng TH and Morales M. 2011. Mesocorticolimbic glutamatergic pathway. J. Neurosci. 31(23):8476–8490. (32) Emson P and Koob G. 1978. The origin and distribution of dopamine‐containing afferents to the rat frontal cortex. Brain Res. 142(2):249–267. (33) Sesack SR and Pickel VM. 1992. Prefrontal cortical efferents in the rat synapse on unlabeled neuronal targets of catecholamine terminals in the nucleus accumbens septi and on dopamine neurons in the ventral tegmental area. J. Comp. Neurol. 320(2):145–160. (34) Vincent SL, Khan Y and Benes FM. 1993. Cellular distribution of dopamine D1 and D2 receptors in rat medial prefrontal cortex. J. Neurosci. 13(6):2551–2564. (35) Yang CR, Seamans JK and Gorelova N. 1999. Developing a neuronal model for the pathophysiology of schizophrenia based on the nature of electrophysiological actions of dopamine in the prefrontal cortex. Neuropsychopharmacology 21(2):161–194. (36) Tzschentke TM. 2001. Pharmacology and behavioral pharmacology of the mesocortical dopamine system. Prog. Neurobiol. 63(3):241–320. (37) Sulzer D. 2007. Multiple hit hypotheses for dopamine neuron loss in Parkinson's disease. Trends Neurosci. 30(5):244–250. 67
REFERENCES
(38) Vallone D, Picetti R and Borrelli E. 2000. Structure and function of dopamine receptors. Neurosci. Biobehav. Rev. 24(1):125–132. (39) Dailly E, Chenu F, Renard CE and Bourin M. 2004. Dopamine, depression and antidepressants. Fundam. Clin. Pharmacol. 18(6):601–607. (40) Meyer JH. 2013. Neurochemical imaging and depressive behaviours. Curr. Top. Behav. Neurosci. 14:101–134. (41) Lewis DA and Levitt P. 2002. Schizophrenia as a disorder of neurodevelopment. Annu. Rev. Neurosci. 25:409–432. (42) Insel TR. 2010. Rethinking schizophrenia. Nature 468(7321):187–193. (43) Faludi G, Dome P and Lazary J. 2011. Origins and perspectives of schizophrenia research. Neuropsychopharmacol. Hung. 13(4):185–192. (44) Rehder V, Jensen JR and Kater SB. 1992. The initial stages of neural regeneration are dependent upon intracellular calcium levels. Neuroscience 51(3):565–574. (45) Zheng JQ and Poo M. 2007. Calcium signaling in neuronal motility. Annu. Rev. Cell Dev. Biol. 23:375–404. (46) Goldshmit Y, McLenachan S and Turnley A. 2006. Roles of Eph receptors and ephrins in the normal and damaged adult CNS. Brain Res. Rev. 52(2):327–345. (47) Hou ST, Jiang SX and Smith RA. 2008. Permissive and repulsive cues and signalling pathways of axonal outgrowth and regeneration. Int. Rev. Cell Mol. Biol. 267:125–181. (48) Bolsover S, Fabes J and Anderson PN. 2008. Axonal guidance molecules and the failure of axonal regeneration in the adult mammalian spinal cord. Restor. Neurol. Neurosci. 26(2‐
3):117–130. (49) Liu BP, Cafferty, William B J, Budel SO and Strittmatter SM. 2006. Extracellular regulators of axonal growth in the adult central nervous system. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 361(1473):1593–1610. (50) Murray AJ. 2014. Axon regeneration: what needs to be overcome? Methods Mol. Biol. 1162:3–
14. (51) Caroni P and Schwab ME. 1988. Antibody against myelin associated inhibitor of neurite growth neutralizes nonpermissive substrate properties of CNS white matter. Neuron 1(1):85–96. (52) Schnell L and Schwab ME. 1990. Axonal regeneration in the rat spinal cord produced by an antibody against myelin‐associated neurite growth inhibitors. Nature 343(6255):269–272. (53) Zhao R, Andrews MR, Wang D, Warren P, Gullo M, Schnell L, Schwab ME and Fawcett JW. 2013. Combination treatment with anti‐Nogo‐A and chondroitinase ABC is more effective than single treatments at enhancing functional recovery after spinal cord injury. Eur. J. Neurosci. 38(6):2946–2961. (54) Bradbury EJ, Moon LDF, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW and McMahon SB. 2002. Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416(6881):636–640. (55) Harel NY and Strittmatter SM. 2006. Can regenerating axons recapitulate developmental guidance during recovery from spinal cord injury? Nat. Rev. Neurosci. 7(8):603–616. (56) Steward O, Zheng B, Tessier‐Lavigne M, Hofstadter M, Sharp K and Yee KM. 2008. Regenerative growth of corticospinal tract axons via the ventral column after spinal cord injury in mice. J. Neurosci. 28(27):6836–6847. 68
REFERENCES
(57) Muramatsu R, Ueno M and Yamashita T. 2009. Intrinsic regenerative mechanisms of central nervous system neurons. Biosci. Trends 3(5):179–183. (58) Cui Q. 2006. Actions of neurotrophic factors and their signaling pathways in neuronal survival and axonal regeneration. Mol. Neurobiol. 33(2):155–179. (59) Gao Y, Nikulina E, Mellado W and Filbin MT. 2003. Neurotrophins elevate cAMP to reach a threshold required to overcome inhibition by MAG through extracellular signal‐regulated kinase‐dependent inhibition of phosphodiesterase. J. Neurosci. 23(37):11770–11777. (60) Cai D, Shen Y, Bellard M de, Tang S and Filbin MT. 1999. Prior exposure to neurotrophins blocks inhibition of axonal regeneration by MAG and myelin via a cAMP‐dependent mechanism. Neuron 22(1):89–101. (61) Snyder‐Keller A, Costantini LC and Graber DJ. 2001. Development of striatal patch/matrix organization in organotypic co‐cultures of perinatal striatum, cortex and substantia nigra. Neuroscience 103(1):97–109. (62) Heimrich B and Frotscher M. 1993. Slice cultures as a model to study entorhinal‐hippocampal interaction. Hippocampus 3 Spec No:11–17. (63) Gähwiler BH. 1988. Organotypic cultures of neural tissue. Trends Neurosci. 11(11):484–489. (64) Ostergaard K, Schou JP and Zimmer J. 1990. Rat ventral mesencephalon grown as organotypic slice cultures and co‐cultured with striatum, hippocampus, and cerebellum. Exp. Brain Res. 82(3):547–565. (65) Franke H, Schelhorn N and Illes P. 2003. Dopaminergic neurons develop axonal projections to their target areas in organotypic co‐cultures of the ventral mesencephalon and the striatum/prefrontal cortex. Neurochem. Int. 42(5):431–439. (66) Plenz D and Kitai ST. 1996. Organotypic cortex‐striatum‐mesencephalon cultures: the nigrostriatal pathway. Neurosci. Lett 209(3):177–180. (67) Dossi E, Heine C, Servettini I, Gullo F, Sygnecka K, Franke H, Illes P and Wanke E. 2013. Functional regeneration of the ex‐vivo reconstructed mesocorticolimbic dopaminergic system. Cereb. Cortex 23(12):2905–2922. (68) Coyle JT, Jacobowitz D, Klein D and Axelrod J. 1973. Dopaminergic neurons in explants of substantia nigra in culture. J. Neurobiol. 4(5):461–470. (69) Schlumpf M, Shoemaker WJ and Bloom FE. 1977. Explant cultures of catecholamine‐containing neurons from rat brain: biochemical, histofluorescence, and electron microscopic studies. Proc. Natl. Acad. Sci. U.S.A. 74(10):4471–4475. (70) Whetsell WO, Mytilineou C, Shen J and Yahr MD. 1981. The development of the dog nigrostriatal system in organotypic culture. J. Neural Transm. 52(3):149–161. (71) Jaumotte JD and Zigmond MJ. 2005. Dopaminergic innervation of forebrain by ventral mesencephalon in organotypic slice co‐cultures: effects of GDNF. Brain Res. Mol. Brain Res 134(1):139–146. (72) Ostergaard K, Jones SA, Hyman C and Zimmer J. 1996. Effects of donor age and brain‐derived neurotrophic factor on the survival of dopaminergic neurons and axonal growth in postnatal rat nigrostriatal cocultures. Exp. Neurol. 142(2):340–350. (73) Gates MA, Coupe VM, Torres EM, Fricker‐Gates RA and Dunnett SB. 2004. Spatially and temporally restricted chemoattractive and chemorepulsive cues direct the formation of the nigro‐striatal circuit. Eur. J. Neurosci. 19(4):831–844. (74) Gähwiler BH, Capogna M, Debanne D, McKinney RA and Thompson SM. 1997. Organotypic slice cultures: a technique has come of age. Trends Neurosci. 20(10):471–477. 69
REFERENCES
(75) Gähwiler BH. 1981. Morphological differentiation of nerve cells in thin organotypic cultures derived from rat hippocampus and cerebellum. Proc. R. Soc. Lond., B, Biol. Sci. 211(1184):287–
290. (76) Gähwiler BH. 1981. Organotypic monolayer cultures of nervous tissue. J. Neurosci. Methods 4(4):329–342. (77) Stoppini L, Buchs PA and Muller D. 1991. A simple method for organotypic cultures of nervous tissue. J. Neurosci. Methods 37(2):173–182. (78) Cho S, Wood A and Bowlby MR. 2007. Brain slices as models for neurodegenerative disease and screening platforms to identify novel therapeutics. Curr. Neuropharmacol. 5(1):19–33. (79) Heine C and Franke H. 2014. Organotypic slice co‐culture systems to study axon regeneration in the dopaminergic system ex vivo. Methods Mol. Biol. 1162:97–111. (80) Soderling SH and Beavo JA. 2000. Regulation of cAMP and cGMP signaling: new phosphodiesterases and new functions. Curr. Opin. Cell Biol. 12(2):174–179. (81) Bender AT and Beavo JA. 2006. Cyclic nucleotide phosphodiesterases: molecular regulation to clinical use. Pharmacol. Rev. 58(3):488–520. (82) Sutherland EW and Rall TW. 1958. Fractionation and characterization of a cyclic adenine ribonucleotide formed by tissue particles. J. Biol. Chem. 232(2):1077–1091. (83) Butcher RW and Sutherland EW. 1962. Adenosine 3',5'‐phosphate in biological materials. I. Purification and properties of cyclic 3',5'‐nucleotide phosphodiesterase and use of this enzyme to characterize adenosine 3',5'‐phosphate in human urine. J. Biol. Chem. 237:1244–1250. (84) Barnes PJ. 2013. Theophylline. Am. J. Respir. Crit. Care Med. 188(8):901–906. (85) Menniti FS, Faraci WS and Schmidt CJ. 2006. Phosphodiesterases in the CNS: targets for drug development. Nat. Rev. Drug. Discov. 5(8):660–670. (86) Wykes V, Bellamy TC and Garthwaite J. 2002. Kinetics of nitric oxide‐cyclic GMP signalling in CNS cells and its possible regulation by cyclic GMP. J. Neurochem. 83(1):37–47. (87) Boess FG, Hendrix M, van der Staay, Franz‐Josef, Erb C, Schreiber R, van Staveren W, Vente J de, Prickaerts J, Blokland A and Koenig G. 2004. Inhibition of phosphodiesterase 2 increases neuronal cGMP, synaptic plasticity and memory performance. Neuropharmacology 47(7):1081–1092. (88) Fujishige K, Kotera J and Omori K. 1999. Striatum‐ and testis‐specific phosphodiesterase PDE10A isolation and characterization of a rat PDE10A. Eur. J. Biochem. 266(3):1118–1127. (89) Seeger TF, Bartlett B, Coskran TM, Culp JS, James LC, Krull DL, Lanfear J, Ryan AM, Schmidt CJ, Strick CA, Varghese AH, Williams RD, Wylie PG and Menniti FS. 2003. Immunohistochemical localization of PDE10A in the rat brain. Brain Res. 985(2):113–126. (90) Siuciak JA, Chapin DS, Harms JF, Lebel LA, McCarthy SA, Chambers L, Shrikhande A, Wong S, Menniti FS and Schmidt CJ. 2006. Inhibition of the striatum‐enriched phosphodiesterase PDE10A: a novel approach to the treatment of psychosis. Neuropharmacology 51(2):386–396. (91) Menniti FS, Chappie TA, Humphrey JM and Schmidt CJ. 2007. Phosphodiesterase 10A inhibitors: a novel approach to the treatment of the symptoms of schizophrenia. Curr. Opin. Investig. Drugs 8(1):54–59. (92) Fleckenstein A. 1983. History of calcium antagonists. Circ. Res. 52(2):I3‐16. (93) Knorr A. 2005. Pharmakologie der Calcium‐Antagonisten. Pharm. Unserer Zeit 34(5):380–387. (94) Yasuda SU and Tietze KJ. 1989. Nimodipine in the treatment of subarachnoid hemorrhage. DICP 23(6):451–455. 70
REFERENCES
(95) Katz AM and Leach NM. 1987. Differential effects of 1,4‐dihydropyridine calcium channel blockers: therapeutic implications. J. Clin. Pharmacol. 27(11):825–834. (96) Welty TE. 1987. Use of nimodipine for prevention and treatment of cerebral arterial spasm in patients with subarachnoid hemorrhage. Clin. Pharm. 6(12):940–946. (97) Tomassoni D, Lanari A, Silvestrelli G, Traini E and Amenta F. 2008. Nimodipine and its use in cerebrovascular disease: evidence from recent preclinical and controlled clinical studies. Clin. Exp. Hypertens. 30(8):744–766. (98) Harper AM, Craigen L and Kazda S. 1981. Effect of the calcium antagonist, nimodipine, on cerebral blood flow and metabolism in the primate. J. Cereb. Blood Flow Metab. 1(3):349–356. (99) Kazda S and Towart R. 1982. Nimodipine: a new calcium antagonistic drug with a preferential cerebrovascular action. Acta Neurochir. 63(1‐4):259–265. (100) Tanaka K, Gotoh F, Muramatsu F, Fukuuchi Y, Amano T, Okayasu H and Suzuki N. 1980. Effects of nimodipine (Bay e 9736) on cerebral circulation in cats. Arzneimittelforschung 30(9):1494–
1497. (101) Przuntek H, Baumgarten F v. and Mertens HG. 1986. Treatment of vasospasm due to subarachnoid hemorrhage with calcium entry blockers. Eur. Neurol. 25 Suppl 1:86–92. (102) Brandt L, Andersson KE, Ljunggren B, Säveland H and Ryman T. 1988. Cerebrovascular and cerebral effects of nimodipine‐an update. Acta Neurochir. Suppl. 45:11–20. (103) Hasan M, Pulman J and Marson AG. 2013. Calcium antagonists as an add‐on therapy for drug‐
resistant epilepsy. Cochrane Database Syst. Rev. 3: Art. No. CD002750, 47 pages. (104) Gelmers HJ. 1985. Calcium‐channel blockers in the treatment of migraine. Am. J. Cardiol. 55(3):B139‐B143. (105) Greenberg DA. 1986. Calcium channel antagonists and the treatment of migraine. Clin. Neuropharmacol. 9(4):311–328. (106) Tanaka K, Gotoh F, Muramatsu F, Fukuuchi Y, Okayasu H, Suzuki N and Kobari M. 1982. Effect of nimodipine, a calcium antagonist, on cerebral vasospasm after subarachnoid hemorrhage in cats. Arzneimittelforschung 32(12):1529–1534. (107) Angelov DN, Neiss WF, Streppel M, Andermahr J, Mader K and Stennert E. 1996. Nimodipine accelerates axonal sprouting after surgical repair of rat facial nerve. J. Neurosci. 16(3):1041–
1048. (108) Mattsson P, Janson AM, Aldskogius H and Svensson M. 2001. Nimodipine promotes regeneration and functional recovery after intracranial facial nerve crush. J. Comp. Neurol. 437(1):106–117. (109) Scheller C, Wienke A, Wurm F, Simmermacher S, Rampp S, Prell J, Rachinger J, Scheller K, Koman G, Strauss C and Herzfeld E. 2014. Neuroprotective efficacy of prophylactic enteral and parenteral nimodipine treatment in vestibular schwannoma surgery: a comparative study. J Neurol Surg A Cent Eur Neurosurg 75(4):251–258. (110) Keating A. 2012. Mesenchymal stromal cells: new directions. Cell Stem Cell 10(6):709–716. (111) Morikawa S, Mabuchi Y, Kubota Y, Nagai Y, Niibe K, Hiratsu E, Suzuki S, Miyauchi‐Hara C, Nagoshi N, Sunabori T, Shimmura S, Miyawaki A, Nakagawa T, Suda T, Okano H and Matsuzaki Y. 2009. Prospective identification, isolation, and systemic transplantation of multipotent mesenchymal stem cells in murine bone marrow. J. Exp. Med. 206(11):2483–2496. (112) Sensebé L, Krampera M, Schrezenmeier H, Bourin P and Giordano R. 2010. Mesenchymal stem cells for clinical application. Vox Sang. 98(2):93–107. 71
REFERENCES
(113) Friedenstein AJ, Chailakhjan RK and Lalykina KS. 1970. The development of fibroblast colonies in monolayer cultures of guinea‐pig bone marrow and spleen cells. Cell Tissue Kinet. 3(4):393–
403. (114) Friedenstein AJ, Petrakova KV, Kurolesova AI and Frolova GP. 1968. Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 6(2):230–247. (115) Zuk PA, Zhu M, Ashjian P, De Ugarte, Daniel A, Huang JI, Mizuno H, Alfonso ZC, Fraser JK, Benhaim P and Hedrick MH. 2002. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 13(12):4279–4295. (116) Erices A, Conget P and Minguell JJ. 2000. Mesenchymal progenitor cells in human umbilical cord blood. Br. J. Haematol. 109(1):235–242. (117) Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S and Marshak DR. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284(5411):143–147. (118) Dominici M, Le Blanc K, Mueller I, Slaper‐Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D and Horwitz E. 2006. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8(4):315–317. (119) Mabuchi Y, Houlihan DD, Akazawa C, Okano H and Matsuzaki Y. 2013. Prospective isolation of murine and human bone marrow mesenchymal stem cells based on surface markers. Stem Cells Int 2013:Art. ID 507301, 7 pages. (120) Phinney DG and Isakova I. 2005. Plasticity and therapeutic potential of mesenchymal stem cells in the nervous system. Curr. Pharm. Des. 11(10):1255–1265. (121) Woodbury D, Schwarz EJ, Prockop DJ and Black IB. 2000. Adult rat and human bone marrow stromal cells differentiate into neurons. J. Neurosci. Res. 61(4):364–370. (122) Parr AM, Tator CH and Keating A. 2007. Bone marrow‐derived mesenchymal stromal cells for the repair of central nervous system injury. Bone Marrow Transplant. 40(7):609–619. (123) Uccelli A, Moretta L and Pistoia V. 2008. Mesenchymal stem cells in health and disease. Nat. Rev. Immunol. 8(9):726–736. (124) Tolar J, Le Blanc K, Keating A and Blazar BR. 2010. Concise review: hitting the right spot with mesenchymal stromal cells. Stem Cells 28(8):1446–1455. (125) Aertker BM, Bedi S and Cox CS. 2015. Strategies for CNS repair following TBI. Exp. Neurol. in press. (126) Drago D, Cossetti C, Iraci N, Gaude E, Musco G, Bachi A and Pluchino S. 2013. The stem cell secretome and its role in brain repair. Biochimie 95(12):2271–2285. (127) Horwitz EM and Dominici M. 2008. How do mesenchymal stromal cells exert their therapeutic benefit? Cytotherapy 10(8):771–774. (128) Pevsner‐Fischer M, Levin S and Zipori D. 2011. The origins of mesenchymal stromal cell heterogeneity. Stem Cell Rev 7(3):560–568. (129) Kucia M, Reca R, Campbell FR, Zuba‐Surma E, Majka M, Ratajczak J and Ratajczak MZ. 2006. A population of very small embryonic‐like (VSEL) CXCR4(+)SSEA‐1(+)Oct‐4+ stem cells identified in adult bone marrow. Leukemia 20(5):857–869. (130) Heider A, Danova‐Alt R, Egger D, Cross M and Alt R. 2013. Murine and human very small embryonic‐like cells: a perspective. Cytometry A 83(1):72–75. 72
SUMMARY - Introduction, aim and methods
Summary Introduction and the aim of the thesis The loss of neurons and their projections, is a common feature of mechanical injuries of the brain and of neurological diseases. This loss results in the disturbance of the affected neuronal circuits. Due to their importance in the regulation of many physiological and psychological functions in the CNS, the impairment of dopaminergic projections, resulting in disorders like e.g. Parkinson’s disease, depression and schizophrenia, is especially severe. The most important dopaminergic projections originate in the ventral mesencephalon (VM) containing among others the ventral tegmental area (VTA) and the substantia nigra (SN) pars compacta. Cell bodies of most of the brains dopaminergic cells, which are characterized by the expression of the key enzyme of dopamine (DA) synthesis: the tyrosine hydroxylase (TH), are located in the VM. Mesostriatal projections innervating the striatum (STR), mesocortical projections targeting cortical regions such as the prefrontal cortex (PFC), and mesolimbic projections innervating in limbic regions, are distinguished according to their target regions. New therapeutical approaches have to be developed and evaluated for the treatment of those diseases resulting from the impairment of dopaminergic projections or from mechanical lesions e.g. after traumatic brain injury. For this purpose, appropriate experimental models are needed. In recent decades, organotypic brain slice cultures were established as versatile and effective models. One of the main advantages of these models, in comparison to primary cell culture, is the preservation of the complex cytoarchitecture in the brain tissue under ex vivo conditions. Moreover, the specific innervation of target regions within slice co‐cultures of projection systems corresponds to the in vivo situation. Compared to in vivo experimental models, there is better accessibility to the sample material, and the extracellular milieu can be controlled more precisely. The aim of the work presented here was (i) to evaluate substances and cell populations with regard to their neuronal fiber/neurite growth‐promoting properties, utilizing mesostriatal (VTA/SN+STR) and mesocortical (VTA/SN+PFC) co‐cultures. Furthermore, it was intended (ii) to analyze possible toxic effects with appropriate methods and (iii) to investigate the influence of the treatment on gene expression after the cultivation. Summary of the applied methods The preparation of the above introduced brain slice co‐cultures started with brains of neonatal mice or rats (P0‐3). The co‐cultures were cultivated on semipermeable membrane inserts for 10‐11 days in vitro. The substances were added to the culture medium, whenever the medium was changed. The 73
SUMMARY - Results
cell populations to be tested were seeded on coated glass slides and placed underneath the membrane inserts without direct contact to the co‐cultures. The glass slides were replaced by new ones when cells were confluent. For the analysis of neuroregenerative processes within the co‐cultures, newly built neurites were visualized by biocytin tracing; dopaminergic structures were detected with the immunostaining of TH. For the tracing, biocytin crystals were placed directly onto the VTA/SN. After the uptake of the tracer by the cells, it was transported anterogradely into the cellular processes. After the fixation of the co‐cultures the biocytin‐labeled structures were visualized with immunohistochemical methods. Microscopic images of the border region between the two brain slices of the co‐cultures that were taken, following biocytin tracing or TH labeling, were used for the quantification of fiber density, applying automated image processing procedures. The percentage of pixels belonging to fibrous structures was determined using this procedure. In addition to fiber growth analysis, toxicological effects and the effects on gene expression potentially exerted by the tested substances or cells were analyzed. Necrotic cell death was assessed by the quantification of (a) the activity of the lactate dehydrogenase (LDH) released from the tissue, and (b) propidium iodide (PI) uptake by the cells. Apoptotic events were detected by the immunostaining of active caspase 3 in tissue sections and subsequently quantified by the counting of active caspase 3‐positive cell bodies. Further, gene expression in co‐cultures and cells has been analyzed on microarrays and with quantitative real time reverse transcription polymerase chain reaction (qPCR), on the RNA level, and by immunostainings, on the protein level. Results Phosphodiesterase inhibitors in rat mesostriatal co‐cultures Cyclic adenosine/guanosine monophosphates (cAMP/cGMP) are second messengers that mediate many important signaling pathways within a cell. The degradation of cAMP and cGMP by 3’,5’‐cyclic‐
nucleotide phosphodiesterases (PDEs) inactivates these pathways. In the work presented here, we focused on two PDE families: PDE2 and PDE10. As there is only one gene/isoform (PDE2A and PDE10A, respectively) belonging to each of these two families, I will refer to them as PDE2 and PDE10, in the following. Both PDE2 and PDE10 are strongly expressed in the STR. With the first experiments, IC50 values of the tested PDE inhibitors (PDE‐I) were determined, using human purified proteins from each PDE family. It was shown that both the inhibitors of PDE2 (BAY60‐
7550, ND7001) and of PDE10 (MP‐10) are highly potent and highly specific for the respective isoform. In addition, the cGMP level was measured following the PDE2‐I application to HEK293 cells stably transfected with the complete sequence encoding for the human PDE2. It was found that PDE2‐Is increased the cGMP level in a concentration‐dependent manner. 74
SUMMARY - Results
In another set of experiments, co‐cultures of the mesostriatal projection system of rats were characterized immunohistochemically after 10‐11 days in vitro. Besides the analysis of the expression of dopaminergic (TH), neuronal (microtubule‐associated protein 2, MAP2, βIII‐tubulin) and glial (glial fibrillary acidic protein, GFAP) markers employing multiple fluorescence stainings, the expression of PDE2 and PDE10 in the co‐cultures was of interest. Both PDE isoforms were detected on fibers and cell bodies in VTA/SN and STR, respectively. No co‐localization of the PDE2 or PDE10 with TH was found. Following the characterization of substances and co‐cultures as described above, the co‐cultures were treated with BAY60‐7550, ND7001 and MP‐10. The biocytin tracing and immunohistochemical staining of TH revealed that BAY60‐7550 and ND7001 increased neurite outgrowth in a similar fashion to the nerve growth factor (NGF). In contrast, MP‐10 did not enhance fiber density compared to the vehicle control (0.1% DMSO). These observations suggest an involvement of PDE2‐regulated cell signaling pathways in the neuronal fiber outgrowth within the mesostriatal system. Nimodipine in rat mesocortical co‐cultures The dihydropyridine derivative nimodipine is a specific inhibitor of L‐type voltage gated calcium channels with a vasodilatory effect, preferentially on cerebral blood vessels. Additionally, nimodipine was shown to inhibit calcium channels that are expressed by neurons. Studies in animal models and clinical trials have demonstrated the neuroregenerative and neuroprotective properties of nimodipine in the peripheral nervous system. However, the underlying mode of action had not been elucidated so far. The aim of the work presented here was to examine the influence of nimodipine on gene expression and neurite outgrowth in mesocortical rat co‐cultures. Employing microarrays, the comparison of gene expression patterns of VTA/SN and PFC, which were divided after the cultivation and analyzed separately, revealed that the expression of the immediate early genes (Arc, Egr1, Egr2, Egr4, Fos and JunB) was increased in the 10 µM nimodipine‐treated samples of the PFC. However, neuronal fiber growth quantification following treatment with 10 µM nimodipine revealed that there was no significant change in fiber density in the border region between the two brain slices of the co‐
cultures in comparison to vehicle control co‐cultures (0.1% ethanol). Instead, it was found that 10 µM nimodipine induced the activation of caspase 3. In contrast, the number of active caspase 3‐positive cells was not altered by the application of 0.1 µM and 1 µM nimodipine. None of the tested concentrations of nimodipine (0.1‐10 µM) influenced the amount of LDH release nor the uptake of PI by the co‐cultures. Neurite growth analysis was repeated with 0.1 µM and 1 µM nimodipine and a significant enhancement in fiber density was found, similar to the effect of NGF. 75
SUMMARY - Results
To get some insight into the mechanisms, underlying the observed enhanced neurite outgrowth induced by 0.1 µM and 1 µM nimodipine, the expression levels of selected genes were quantified with qPCR, following cultivation and treatment. The genes were coding for (a) glial (Gfap) and oligodendrocytic structure proteins (Mal, Mog, Plp1), (b) calcium binding proteins (Pvalb, S100b) and (c) immediate early genes (Arc, Egr1, Egr2, Egr4, Fos and JunB). With one exception (Egr4), the expression of the genes of interest was not significantly altered by nimodipine treatment, when compared to the vehicle control samples. In conclusion, besides the well‐described indications of nimodipine application (inhibition of delayed cerebral ischemia caused by vasospasms following subarachnoid hemorrhage; perioperative application during surgery of vestibular schwannoma), this study demonstrates the concentration‐
dependent neurite growth‐promoting effect of nimodipine within a model of a CNS projection system. MSC‐derived cell populations and mouse mesocortical co‐cultures With regard to new therapeutical strategies for the treatment of neurological and neurodegenerative diseases, research on cell therapies has attracted enormous attention in the last decades with a special focus on mesenchymal stromal/stem cells (MSCs). An enhancement of neurite outgrowth by MSCs has been shown in many in vitro and in vivo studies. These findings indicate a neuroregenerative potential of these cells that seems to result from the release of immunomodulatory and trophic factors. Bulk MSCs, classically obtained by plastic adhesion, are generally heterogeneous. Different isolation and cultivation protocols yield MSC cultures with different proportions of the respective subpopulations, resulting in varying compositions of the above‐mentioned secreted factors. There have been efforts to isolate and characterize homogeneous subpopulations, e.g. with regard to specific surface markers by fluorescence‐activated cell sorting from bulk MSCs. One of these described subpopulations are Sca‐1+Lin‐CD45‐‐derived MSCs (SL45‐MSCs). The aim of the present work was the comparison of bulk bone marrow (BM) derived MSCs (bulk BM‐
MSCs) and SL45‐MSCs, both obtained from the BM of adult mice. The basic characterization of the two MSC populations revealed that (a) SL45‐MSCs contain 105‐fold higher portion of fibroblast colony forming units (CFU‐f), (b) the morphological appearance of the rather small SL45‐MSCs was more homogeneous, (c) nestin was significantly higher expressed in SL45‐MSCs, while there was no difference in βIII‐tubulin expression between the cell populations (both proteins are considered as markers for mesenchymal cells as well as for progenitors of the mesenchymal and neuronal lineage) and (d) transcripts coding for several growth factors (e.g. BDNF, FGF2, GDNF, and NGF) were 76
SUMMARY - Conclusions and outlook
detected in RNA extracts of samples of both cell populations, with a significantly higher expression of BDNF and FGF2 in SL45‐MSCs, which was confirmed for BDNF on the protein level. For the evaluation of neurite growth‐promoting properties on mesocortical mouse co‐cultures, the MSCs were seeded on glass slides that were placed underneath the membrane inserts without direct contact to the co‐cultures. A significantly enhanced neuronal fiber growth within the co‐cultures was induced by both bulk BM‐MSCs and SL45‐MSCs, when compared to untreated and BDNF‐treated control co‐cultures. Comparing the two MSC populations, neurite density in the co‐cultures was increased to a higher degree by SL45‐MSCs (being significantly higher than the fiber density resulting from BDNF treatment), possibly due to the higher expression of BDNF and FGF2, as described and to other factors secreted by SL45‐MSCs. Hence, this study clearly demonstrated that the isolation method applied to obtain MSC preparations influences their neuroregenerative properties. The more homogeneous SL45‐MSCs possess a higher potency with regard to CFU‐f and to the fiber growth enhancement potential in the mesocortical projection system. Conclusions and Outlook The neurite regrowth after injury or in neurological diseases is a complex process with many intrinsic and extrinsic orchestrating factors. The growth‐promoting effects of (i) the modulation of second messenger (cAMP, cGMP) turnover with PDE‐Is, (ii) the partial blockade of calcium currents by nimodipine and (iii) the paracrine effects of MSCs, e.g. by secretion of growth factors, as demonstrated in the studies presented here, reflect the diversity of potential molecular targets for the enhancement of regenerative neurite regrowth. However, the detailed molecular mechanisms underlying the above mentioned observations remain to be elucidated in further studies. Moreover, it is not fully understood, to which extent the different cell types of the CNS contribute to the beneficial effects of the applied treatments during the different phases of regeneration. A better understanding of the intracellular signaling events and their interactions would allow to make use of potential synergistic effects of different treatment, more efficiently. 77
ZUSAMMENFASSUNG - Einführung und Zielstellung
Zusammenfassung Einführung und Zielstellung der Arbeit Der Verlust von Nervenzellen und deren Fortsätzen ist sowohl die Folge mechanischer Verletzungen des Gehirns als auch ein gemeinsamer Aspekt vieler neurologischer Erkrankungen. Dieser Verlust führt zur Störung betroffener Projektionsbahnen. Bedingt durch die große Bedeutung dopaminerger (DAerger) Projektionen für physiologische und psychologische Funktionen, wie die gezielte Ausführung von Bewegungsabläufen, Belohnung und Kognition; sind Beeinträchtigungen dieser Projektionssysteme besonders schwerwiegend und werden in Krankheitsbildern, wie zum Beispiel Morbus Parkinson, Depression oder Schizophrenie deutlich. Die wichtigsten DAergen Projektionsbahnen haben ihren Ursprung im ventralen Mesencephalon (VM), das unter anderem das ventrale tegmentale Areal (VTA) und die Substantia nigra (SN) pars compacta enthält. In diesen Regionen des Gehirns befindet sich ein Großteil der DAergen Zellkörper des Gehirns, die sich durch die Expression des Schlüsselenzyms der Dopamin (DA)‐Synthese, der Tyrosin‐Hydroxylase (TH), auszeichnen. Die einzelnen Projektionsbahnen werden nach den Zielgebieten unterschieden: mesostriatale Projektionen innervieren das Striatum (STR), mesokortikale Projektionen innervieren kortikale Regionen, z.B. den präfrontalen Kortex (PFC), und mesolimbische Projektionen innervieren limbische Areale. Um die Störungen der DAergen Projektionen oder auch mechanische Verletzungen des Gehirns, z.B. nach Schädel‐Hirn‐Traumen, adäquat behandeln zu können, müssen neue Therapieformen entwickelt und geprüft werden. Dafür sind geeignete Modellsysteme notwendig. In den letzten Jahrzehnten wurden organotypische Hirnschnittkulturen als vielseitige und effektive Modelle etabliert. Ein entscheidender Vorteil dieser Modelle gegenüber Primärzellkulturen ist der Erhalt der komplexen Cytoarchitektur des Gehirngewebes unter Kulturbedingungen. Darüber hinaus wurde in Co‐Kulturen aus zwei oder mehreren Hirnschnitten gezeigt, dass das zielgerichtete Auswachsen neuronaler Fortsätze unter ex vivo‐Bedingungen den in vivo‐Mustern entsprechend erfolgt. Gegenüber klassischen in vivo‐Versuchen bieten organotypische Kulturen eine bessere Zugänglichkeit zum Probenmaterial und erlauben die genaue Kontrolle des extrazellulären Milieus. Ziel der hier dargestellten Arbeit war die Charakterisierung verschiedener Substanzen und Zellpopulationen hinsichtlich ihrer Wirkung auf das neuronale Faserwachstum (auch als Neuritenwachstum bezeichnet) unter Verwendung von mesostriatalen (VTA/SN+STR) und mesokortikalen (VTA/SN+PFC) Gewebe‐Co‐Kulturen. Mögliche toxische (Neben‐)Wirkungen an den Co‐Kulturen sollten mit geeigneten Methoden erfasst werden. Weiterhin sollten im Anschluss an die Kultivierung eventuelle Einflüsse der Behandlung auf die Genexpression untersucht werden. 78
ZUSAMMENFASSUNG - Methoden und Ergebnisse
Überblick über die angewandten Methoden Auf die Präparation der oben beschriebenen Co‐Kulturen aus Hirngewebsschnitten neugeborener Ratten oder Mäuse (P0‐3) folgte die Kultivierung auf semipermeablen Membraneinsätzen für einen Zeitraum von 10‐11 Tagen. Die Substanzen wurden bei jedem Medienwechsel über das Kulturmedium appliziert. Die zu testenden Zellen wurden auf Glasplättchen unterhalb der Membraneinsätze ohne direkten Kontakt zu den Co‐Kulturen platziert und bei Konfluenz ausgetauscht. Zur Analyse neuroregenerativer Prozesse in den Co‐Kulturen wurden die neu auswachsenden Neuriten mittels Biocytin‐Tracing dargestellt bzw. die DAergen Strukturen durch immunohistochemische Färbung von TH nachgewiesen. Für die erstgenannte Methode wurden Biocytinkristalle auf die VTA/SN aufgebracht. Der Tracer wurde von den Zellen aufgenommen und anterograd in die Fortsätze transportiert. Nach Fixierung der Co‐Kulturen wurden die so markierten Zellkörper und Fortsätze mit immunhistochemischen Methoden sichtbar gemacht. Die Quantifizierung der Faserdichte nach Tracing oder TH‐Färbung erfolgte an mikroskopischen Aufnahmen der Grenzregion zwischen den zwei Hirnschnitten einer Co‐Kultur mittels digitaler Bildverarbeitung. Dabei wurde der Anteil der Pixel im Bild, der Neuriten zuzuordnen ist, bestimmt. Darüber hinaus kamen Methoden zur Untersuchung toxischer Eigenschaften der Substanzen und der Wirkung auf die Genexpression in den Co‐Kulturen zum Einsatz: Die Quantifizierung nekrotischer Zelluntergänge erfolgte durch (a) die Aktivitätsbestimmung der aus dem Gewebe freigesetzten Laktatdehydrogenase (LDH) und (b) die Quantifizierung der Propidiumiodid (PI)‐Aufnahme durch beschädigte Zellen. Apoptotische Vorgänge infolge der Substanzapplikation wurden mittels Immunfluoreszenz‐Markierung und Quantifizierung des frühen Apoptose‐Markers, der aktivierten Caspase 3, in den Gewebeschnitten erfasst. Weiterhin war die Analyse der Expression verschiedener Gene in den Co‐Kulturen und Zellen Gegenstand der experimentellen Arbeiten. Verwendete Methoden waren auf RNA‐Ebene Microarray‐Untersuchungen und quantitative Echtzeit‐Reverse‐
Transkriptase‐Polymerase‐Kettenreaktion (qPCR), sowie auf Proteinebene immunhistochemische Färbungen. Ergebnisse Phosphodiesterase‐Inhibitoren in mesostriatalen Co‐Kulturen der Ratte Die zyklischen Mononukleotide cAMP und cGMP (zyklisches Adenosin‐bzw. Guanosinmonophosphat) sind second messenger, über die viele wichtige Vorgänge in der Zelle vermittelt werden. Die „Abschaltung“ des Signals erfolgt enzymatisch durch Phosphodiesterasen (PDEs). In der vorliegenden Arbeit lag der Fokus auf PDE2A und PDE10A. Da dies jeweils die einzigen Isoformen der PDE2‐ bzw. 79
ZUSAMMENFASSUNG - Ergebnisse
PDE10‐Familie sind, werde ich mich im Folgenden mit PDE2 bzw. PDE10 auf sie beziehen. Eine deutliche Expression von beiden PDEs, PDE2 und PDE10, ist im STR gezeigt worden. Der erste Teil dieser Studie bestand in der Bestimmung der IC50‐Werte der ausgewählten PDE‐
Inhibitoren (Is) unter Verwendung gereinigter humaner Proteine jeder PDE‐Familie. Es konnte gezeigt werden, dass sowohl die PDE2‐Is (BAY60‐7550, ND7001) als auch der PDE10‐I (MP‐10) hochspezifisch und potent wirken. Die Applikation der PDE2‐Is in Kulturen der Zelllinie HEK293, die stabil mit der vollständigen Sequenz der humanen PDE2 transfeziert war, führte zu einer konzentrationsabhängigen Erhöhung von cGMP. Mit weiteren Versuchen wurden organotypische Co‐Kulturen (VTA/SN+STR) im Anschluss an die Kultivierung immunhistochemisch charakterisiert. Neben der Untersuchung der Expression DAerger (Tyrosinhydroxylase, TH), neuronaler (Mikrotubuli‐assoziiertes Protein 2, MAP2, βIII‐Tubulin) und gliärer (Saures Gliafaserprotein, GFAP) Markerproteine mittels Mehrfachfluoreszenzfärbungen war die Expression von PDE2 und PDE10 von Interesse. Beide PDEs wurden jeweils in den Zellkörpern und Fasern in VTA/SN und STR detektiert. Weder PDE2 noch PDE10 war mit TH co‐lokalisiert. Nach den oben beschriebenen Charakterisierungen der PDE‐Is und der Co‐Kulturen erfolgte die Behandlung der Co‐Kulturen mit BAY60‐7550, ND7001 und MP‐10, gefolgt von der Quantifizierung des neuronalen Faserwachstums mittels Biocytin‐Tracing und nach immunhistochemischer Detektion der TH. BAY60‐7550 und ND7001 verstärkten das Auswachsen der Neuriten, ähnlich dem Wachstumsfaktor NGF (engl. nerve growth factor). MP‐10 bewirkte hingegen keinen wachstumsfördernden Effekt im Vergleich zur Lösungsmittel‐Kontrolle (0,1% DMSO). Diese Beobachtungen legen eine Beteiligung PDE2‐regulierter Signalwege am neuronalen Faserwachstum nahe. Nimodipin in mesokortikalen Co‐Kulturen der Ratte Das Dihydropyridinderivat Nimodipin ist ein spezifischer Inhibitor des spannungsgesteuerten Calciumkanals vom L‐Typ mit gefäßerweiternder Wirkung ‐ vorwiegend auf zerebrale Blutgefäße. Zudem ist eine Wirkung der Substanz auf die Calciumkanäle von Neuronen bekannt. Präklinische und klinische Studien konnten eine neuroregenerative bzw. neuroprotektive Wirkung von Nimodipin im peripheren Nervensystem zeigen, wobei der zugrunde liegende Wirkmechanismus bisher nicht bekannt ist. In der vorliegenden Arbeit sollte in mesokortikalen Co‐Kulturen der Ratte eine mögliche Regulation der Genexpression mittels Microarray‐Untersuchungen sowie ein Einfluss auf das Auswachsen von Neuriten durch Nimodipin geprüft werden. Die Analyse der Genexpressionsmuster in VTA/SN und PFC, die nach der Kultivierung und Behandlung der Co‐Kulturen getrennt voneinander untersucht wurden, ergab eine erhöhte Expression von sogenannten „Frühe‐Antwort‐Genen (engl. immediate early genes)“ (Arc, Egr1, Egr2, Egr4, JunB und Fos) in den Proben des PFC in der mit 10 µM 80
ZUSAMMENFASSUNG - Ergebnisse
Nimodipin behandelten Gruppe. Die nachfolgende Quantifizierung des Neuritenwachstums nach Behandlung mit 10 µM Nimodipin ergab jedoch, dass diese Konzentration der Substanz die Neuritendichte in der Grenzregion zwischen VTA/SN und PFC im Vergleich zu Kontroll‐Co‐Kulturen nicht signifikant veränderte. Stattdessen ergaben toxikologische Untersuchungen, dass 10 µM Nimodipin die Aktivierung der Caspase 3 induzierte. Nach Behandlung mit 0,1 µM und 1 µM Nimodipin wurde keine Veränderung der Anzahl aktiver Caspase 3‐positiver Zellen beobachtet. Ein Einfluss auf die Freisetzung von LDH bzw. der Aufnahme von PI wurde bei keiner der applizierten Nimodipin‐Konzentrationen (0,1 µM‐10 µM) gefunden. Eine erneute Neuritenwachstumsstudie mit 0,1 µM und 1 µM Nimodipin zeigte eine Erhöhung der Neuritendichte, ähnlich der nach Applikation des Wachstumsfaktors NGF. Um Einblick in den molekularen Wirkmechanismus zu bekommen, der dem verstärkten Auswachsen der Neuriten zu Grunde liegen könnte, wurde im Anschluss an die Kultivierung und die Behandlung mit 0,1 µM und 1 µM Nimodipin die Expression von Genen kodierend für (a) Strukturproteine von Gliazellen (Gfap) und Oligodendrozyten (Mal, Mog, Plp1), (b) Calcium‐bindende Proteine (Pvalb, S100b) und (c) „Frühe‐Antwort‐Gene“ (Arc, Egr1, Egr2, Egr4, JunB und Fos) mittels qPCR untersucht. Mit einer Ausnahme (Egr4) wurden durch die Behandlung mit Nimodipin keine signifikanten Veränderungen der Expression der betrachteten Gene im PFC im Vergleich zu den Kontrollgruppen (unbehandelt und Lösungsmittelkontrolle: 0,1% Ethanol) gefunden. Mit dieser Studie konnte am Beispiel mesokortikaler Co‐Kulturen erstmals gezeigt werden, dass Nimodipin neben den bisher bekannten Anwendungen (z.B. Verhinderung von verzögerter zerebraler Ischämie durch Vasospasmen infolge von Subarachnoidalblutung, perioperative Applikation bei operativer Entfernung von Vestibularschwannomen) in Abhängigkeit der Konzentration einen regenerativen Effekt im zentralen Nervensystem hat. MSC‐Populationen und mesokortikale Co‐Kulturen der Maus Im Hinblick auf neue Behandlungsstrategien für neurologische und neurodegenerative Erkrankungen ist die Verwendung von Zelltherapien seit einigen Jahren ein intensiv beforschtes Feld. Dabei richtete sich besondere Aufmerksamkeit auf mesenchymale Stroma‐/Stammzellen (MSCs). Das in zahlreichen in vitro‐ und in vivo‐Studien beobachtete neuroregenerative Potential von MSCs, das sich u.a. durch eine Verstärkung des neuronalen Faserwachstums zeigte, scheint auf die Sezernierung immunmodulatorischer und wachstumsfördernder Faktoren zurückzuführen zu sein. Bei klassisch durch Adhäsion auf Plastikoberflächen gewonnenen MSCs handelt es sich um eine heterogene Zellpopulation (bulk MSCs), wobei die Anteile der entsprechenden Subpopulationen in Abhängigkeit von Isolierungs‐ und Kultivierungsprotokollen variieren können. Daraus ergeben sich voneinander abweichende Zusammensetzungen der freigesetzten Faktoren. In der Vergangenheit gab es Bemühungen, einzelne Subpopulationen zu isolieren und zu charakterisieren. Dies erfolgt zum 81
ZUSAMMENFASSUNG - Fazit und Ausblick
Beispiel anhand der exprimierten Zelloberflächenmarker mittels Fluoreszenz‐aktivierter Zellsortierung ausgehend von bulk MSCs. Eine der bisher beschriebenen Subpopulationen sind die Sca‐1+Lin‐CD45‐(SL45)‐MSCs. In der vorliegenden Studie sollten aus dem Knochenmark (engl. bone marrow, BM) von adulten Mäusen gewonnene bulk BM‐MSCs mit der daraus isolierten SL45‐MSC‐Subpopulation verglichen werden. Die Grundcharakterisierung der beiden Zellpopulationen zeigte, dass sich die SL45‐MSCs von den bulk BM‐MSCs durch einen 105‐fach höheren Anteil an kolonieformenden Einheiten (CFU‐f) unterschieden. Zudem waren sie von gleichmäßigerer Morphologie, mit vorwiegend kleineren Zellen. Die Expression von Nestin war in den SL45‐MSCs signifikant höher, während es keinen Unterschied in Bezug auf die Expression von βIII‐Tubulin gab. Beide Proteine gelten als Marker sowohl für mesenchymale Zellen als auch für Vorläuferzellen neuronaler und mesenchymaler Linien. Die Expression verschiedener Wachstumsfaktoren (BDNF, FGF2, GDNF, NGF, u.a.) wurde mittels qPCR in RNA‐Extrakten beider Zellpopulationen nachgewiesen, wobei eine signifikant höhere Expression von BDNF und FGF2 durch SL45‐MSCs festgestellt wurde, die im Fall von BDNF auch auf Proteinebene bestätigt werden konnte. Zur Bestimmung wachstumsfördernder Eigenschaften der MSC‐Populationen auf Neuriten in mesokortikalen Co‐Kulturen der Maus wurden bulk BM‐MSCs und SL45‐MSCs jeweils auf Glasplättchen ohne direkten Kontakt zu den Gewebe‐Co‐Kulturen unterhalb der Membraneinsätze eingebracht. Beide untersuchten Zellpopulationen steigerten das Neuriten‐Wachstum in den Co‐Kulturen signifikant, wobei der Effekt der SL45‐MSCs stärker (signifikant höhere Neuritendichte als nach Behandlung mit BDNF) ausfiel als der der bulk BM‐MSCs. Eine mögliche Erklärung dafür könnte u.a. die gezeigte höhere Expression von BDNF und FGF2 sowie weiterer nicht identifizierter durch die SL45‐MSCs sezernierter Faktoren sein. Die Studie machte also deutlich, dass MSC‐Populationen, die mit verschiedenen Isolationsmethoden gewonnen wurden, unterschiedliche neuroregenerative Eigenschaften aufweisen. Die homogeneren SL45‐MSCs sind potenter als die bulk BM‐MSCs, sowohl im Hinblick auf die Bildung von Kolonien als auch im Hinblick auf die regenerationsfördernde Wirkung im mesokortikalen Projektionssystem. Fazit und Ausblick Das erneute Auswachsen von Neuriten infolge mechanischer Schädigung oder neurologischer Erkrankungen umfasst ein komplexes Zusammenspiel verschiedener extrinsischer und intrinsischer Faktoren. Die wachstumsfördernden Wirkungen (i) der PDE‐Is, die in die Deaktivierung der second messenger cAMP/cGMP eingreifen, (ii) der teilweisen Blockade von Calciumströmen durch Nimodipin und (iii) der parakrinen Effekte von MSCs, z.B. durch die Freisetzung von Wachstumsfaktoren; wie es 82
ZUSAMMENFASSUNG - Fazit und Ausblick
in den hier dargestellten Studien gezeigt wurde, verdeutlicht die Vielfältigkeit möglicher molekularer Angriffspunkte für die Verstärkung regenerativen Auswachsens neuronaler Fasern. Die molekularen Mechanismen, die den beschriebenen Effekten zugrunde liegen, müssen jedoch Gegenstand zukünftiger Studien sein. Darüber hinaus ist bisher nicht vollständig verstanden, über welche Zelltypen des ZNS die Effekte der Behandlungen in den verschiedenen Phasen der Regeneration vermittelt werden. Mit einem umfassenden Verständnis der intrazellulären Signalwege und deren Wechselwirkungen könnten mögliche synergistische Effekte von verschiedenen Behandlungen effizient genutzt werden. 83
CV
Curriculum Vitae Personal Data Name Contact private: Katja Sygnecka, born Kohlmann Oststr. 95, 04317 Leipzig Phone: 01577 195 44 93 [email protected] functional: Rudolf Boehm Institute of Pharmacology and Toxicology, Leipzig University Härtelstr. 16‐18, 04107 Leipzig [email protected]‐leipzig.de [email protected]‐leipzig.de Date of birth 23rd December 1983 German Nationality Research Experience since 2009/07 Research assistant, PhD student TRM Leipzig/ Rudolf Boehm Institute of Pharmacology and Toxicology, Leipzig University Subject: Organotypic brain slice co‐cultures: an ex vivo high content analysis tool for multiple applications. 2008/12‐2009/06 Research assistant Institute of Anatomy, Leipzig University Subject: Regulated intramembranous proteolysis of KIT – a process relevant for arteriosclerosis? 2007/05‐12 Student research assistant Endocrinological Research Laboratory, University Hospital Leipzig Techniques: PCR, cloning, protein isolation, chelate‐chromatography and western blot Formal Education 2008/09 Graduation with public defense as Dipl. Biochem. 2008/04‐09 Diploma thesis Institute of Biochemistry, Faculty of Medicine, Leipzig University, Subject: Establishment of a protocol for chromatin immune precipitations (ChIP). 2007/03‐04 Project work Division of Molecular biological‐biochemical Processing Technology, Center for Biotechnology and Biomedicine (BBZ) Subject: Establishment of an impedance‐based screening system for the detection of apoptotic events in suspension cell lines 2005 – 2006 Study abroad: Biochemistry/Biotechnology at INSA de Lyon in Lyon, France 2003 – 2008 Study of Biochemistry at the Leipzig University 1994 – 2003 Grammar school Lucas‐Cranach‐Gymnasium, Lutherstadt Wittenberg, Certificate: Abitur 84
TRACK RECORD
Track Record Research Articles C. Heine, K. Sygnecka, N. Scherf, M. Grohmann, A. Bräsigk, H. Franke (2015) P2Y1 receptor mediated neuronal fibre outgrowth in organotypic brain slice co‐cultures. Neuropharmacology 93:252‐266 K. Sygnecka, A. Heider, N. Scherf, R. Alt R, H. Franke, C. Heine. (2015) Mesenchymal Stem Cells Support Neuronal Fiber Growth in an Organotypic Brain Slice Co‐culture Model. Stem cells and development 24(7):824‐835 K. Sygnecka*, C. Heine*, N. Scherf, M. Fasold, H. Binder, C. Scheller, H. Franke. (2015) Nimodipine enhances neurite outgrowth in dopaminergic brain slice co‐cultures. International journal of developmental neuroscience 40:1–11. E. Dossi, C. Heine, I. Servettini, F. Gullo, K. Sygnecka, H. Franke, P. Illes, E. Wanke. (2013) Functional regeneration of the ex‐vivo reconstructed mesocorticolimbic dopaminergic system. Cerebral cortex 23:2905–2922. C. Heine*, K. Sygnecka* N. Scherf, A. Berndt, U. Egerland, T. Hage, H. Franke. (2013) Phosphodiesterase 2 inhibitors promote axonal outgrowth in organotypic slice co‐cultures. Neurosignals 21:197–212. C. Merkwitz, P. Lochhead, N. Tsikolia, D. Koch, K. Sygnecka, M. Sakurai, K. Spanel‐Borowski, A.M. Ricken. (2011) Expression of KIT in the ovary, and the role of somatic precursor cells. Progress in histochemistry and cytochemistry 46(3):131‐84. * The authors KS and CH contributed equally to the studies Poster Presentations K. Sygnecka, C. Heine, N. Scherf, H. Franke. Organotypic brain slice co‐cultures as a screening system for fibre growth promoting substances. 8th Leipzig Research Festival for Life Sciences 2009; Leipzig, 17 – 18 Dec. 2009 K. Sygnecka, C. Heine, N. Scherf, H. Franke. The model of organotypic dopaminergic slice co‐cultures –a screening system for fibre growth promoting substances. 7th FENS Forum of European Neuroscience; Amsterdam, 3 – 7 July 2010 K. Sygnecka, C. Heine, M. Grohmann, N. Scherf, H. Franke. Qualitative and quantitative toxicological methods in organotypic brain slice co‐cultures. 9th Leipzig Research Festival for Life Sciences 2010; Leipzig, 16 – 17 Dec. 2010 K. Sygnecka, C. Heine, M. Grohmann, N. Scherf, H. Franke. Organotypic brain slice co‐cultures of the dopaminergic system –a versatile tool for the investigation of toxicological properties of novel substances. 9th Göttingen Meeting of the German Neuroscience Society; Göttingen, 23 – 27 March 2011 85
TRACK RECORD
K. Sygnecka, C. Heine, N. Scherf, H. Franke. Organotypic brain slice co‐cultures – an ex vivo test system to investigate regeneration supporting substances in the central nervous system. 10th Leipzig Research Festival for Life Sciences 2011; Leipzig, 15 – 16 Dec. 2011 K. Sygnecka, C. Heine, N. Scherf, H. Franke. Enhancement of neuronal fibre growth in organotypic brain slice co‐cultures. 11th Leipzig Research Festival for Life Sciences 2012; Leipzig, 13 – 14 Dec. 2012 K. Sygnecka, C. Heine, N. Scherf, H. Franke. Different approaches to enhance neuronal fibre growth in organotypic dopaminergic brain slice co‐cultures. 10th Göttingen Meeting of the German Neuroscience Society; Göttingen, 13 – 16 March 2013 K. Sygnecka, C. Heine, N. Scherf, C. Strauss, C. Scheller, H. Franke. Enhanced Regeneration of Neuronal Fibres after Nimodipine Treatment in an Organotypic Dopaminergic Brain Slice Co‐Culture Model. World Conference on Regenerative Medicine; Leipzig, 23 – 25 Oct. 2013 K. Sygnecka, C. Heine, A. Heider, N. Scherf, R. Alt, H. Franke. Mesenchymal stem cells support neuronal fiber growth in organotypic brain slice co‐cultures of the dopaminergic projection system. Fraunhofer Life Science Symposium Leipzig 2014; Leipzig, 9 – 10 Oct. 2014 86
Selbstständigkeitserklärung Hiermit erkläre ich, die vorliegende Dissertation selbständig und nur unter Verwendung der aufgeführten Literatur und Hilfsmittel angefertigt zu haben. Direkt oder indirekt übernommene Gedanken aus fremden Quellen wurden in dieser Arbeit als solche kenntlich gemacht. Leipzig, 20.05.2015 ____________________________________ Katja Sygnecka 87
ACKNOWLEDGMENTS
Acknowledgments I would like to thank Prof. Robitzki and Prof. Schaefer for being the formal supervisors of this dissertation. This constellation allowed me, on the one hand, to submit the dissertation to the Institute of Biochemistry at the Faculty of Biosciences, Pharmacy and Psychology and, on the other hand, to do the experimental work in PD Dr. Heike Franke's group at the Rudolf Boehm Institute for Pharmacology and Toxicology (RBI) at the Medical Faculty of the University of Leipzig. I would like to thank Prof. Bernd Heimrich from the Department of Anatomy and Cell Biology, University of Freiburg for taking time out from his busy schedule to serve as my external reader. A very special thanks goes out to my supervisors, Dr. Claudia Heine and PD Dr. Heike Franke, who were always open to my questions, ideas and sorrows. They were always on hand to listen and give helpful advice and inspiration regarding the experimental work in the lab, as well as during the writing process of research reports and this dissertation. This thoroughly engaging project that I was entrusted with, presented many challenges as well as the opportunity to apply a wide range of techniques allowing me to grow as a research scientist. I owe them thanks for giving me the opportunity to gain experience outside the lab in terms of participation at conferences and a summer school, and the archival position at the GLP facilities of the Translational Center for Regenerative Medicine (TRM) Leipzig. In addition to this, they supported me in my first attempts to guide younger researchers. This was made possible when I applied for DAAD grants within the RISE project (Research Internships in Science and Engineering); and also when they entrusted me with the guidance of undergraduates. I appreciate all the freedom, trust and encouragement I received during my PhD from these two ladies. Two other very important ladies during my PhD were the technical assistants Anne‐Kathrin Krause and Katrin Becker. Anne‐Kathrin Krause took care of the laboratory animals used for this work. Katrin Becker took over increasingly more of the laboratory work, especially during the last half of my work, which allowed me to focus on data analysis and the publication of results. I must also acknowledge the members of the Schaefer group and the Aigner group (Division of Clinical Pharmacology, RBI) for giving me access to the various instruments in their laboratories and their kind help with my technical questions. I would further like to thank Prof. Bechmann and PD Dr. Ricken for the use of the laser scanning microscope at the Institute for Anatomy. The members of the core unit “DNA technologies”, led by PD Dr. Knut Krohn at the Interdisciplinary Center for Clinical Research, were very helpful with the preparation of the samples for gene expression analysis and the conduction of the microarray analysis. 88
ACKNOWLEDGMENTS
I thank all my co‐authors for the fruitful cooperation and helpful discussions during the various experimental phases of the studies, as well as during the writing process of the research articles. I recognize that this research would not have been possible without financial support from the BMBF. This financed the research project via the TRM Leipzig. Moreover, I would like to thank the TRM Leipzig for the organization of numerous training sessions and workshops (e.g. project management, intercultural communication). I am also grateful for having been made an associate member of the graduate school InterNeuro, which gave me the opportunity to meet other neuroscientists and gain insight into their research topics. Additionally, I would like to thank InterNeuro for providing travel grants for my participation at conferences. I also want to express my gratitude to the DAAD and InterNeuro who provided scholarships, within the framework of RISE, for the undergraduates from American universities with whom I worked. Their names are Susan Sheng and Jennifer Ding. Of course, I am also very thankful for Susan and Jennifer's ambitious engagement and demonstrable interest in my PhD project. I would also like to thank Ria Hylton for language editing. Finally, I would like to express my gratitude to my friends and my family for being there in times of intense hardship, as well as during the more enjoyable and relaxing moments. Among other things, it was the exchange of perspectives and ideas beyond (bio‐)scientific questions that provided me with the drive and energy that I needed to get through the PhD and to finish it. 89

Organotypic brain slice co-cultures of the dopaminergic

Transcription

Similar documents

Anatomically shaped foil for hair coloring

Exceptionally High-AyO nity Binding in A 7r5 and AIO Cells

PDF-Datei (englisch): 2,6 MB

View - ENBALA Power Networks Inc.

(Das) Werk Band (Jahr): 61 (1974) - E

¿Manipulan los ácaros el sistema inmunológico?

1512-1594 Gerardus Mercator, or Gerard Kremer as he was called

Digital and innovative solutions for Industry 4.0 in the heart of Europe

Modelling - Universität Stuttgart

Tracer Studies of Atmospheric Exchange Based on Measurements

9-Online-Micro-jobs - The Moonlighter`s Guide