Clostridium difficile - Université de Sherbrooke

Université de Sherbrooke
L’étude de la relation phage-hôte chez Clostridium difficile
Par
Ognjen Sekulović
Département de microbiologie et d’infectiologie
Thèse présentée à la Faculté de médecine et des sciences de la santé
en vue de l’obtention du grade de philosophiae doctor (Ph.D.) en microbiologie
Sherbrooke, Québec, Canada
Mai, 2015
Membres du jury d’évaluation
Pr Louis-Charles Fortier, Microbiologie et Infectiologie, directeur de thèse
Pr Brendan Bell, Microbiologie et Infectiologie, directeur du programme
Pr Vincent Burrus, Biologie, évaluateur externe du programme
Pr Roger C. Lévesque, Microbiologie-infectiologie et d'immunologie, Faculté de médecine,
Université Laval, évaluateur externe à l’Université
© Ognjen Sekulovic, 2015
ii
RÉSUMÉ
L’étude de la relation phage-hôte chez Clostridium difficile
Par
Ognjen Sekulović
Programme de microbiologie
Thèse présentée à la Faculté de médecine et des sciences de la santé en vue de l’obtention
du diplôme de philosophiae doctor (Ph.D.) en microbiologie, Faculté de médecine et des
sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4
De nos jours, les bactériophages (c.-à-d. des virus bactériens, ou phages) sont
reconnus comme un des principaux facteurs qui influencent l’évolution et la biologie
bactérienne. De plus, la nature dynamique des relations phage-hôte engendre des adaptations
mutuelles au niveau des stratégies d’infection et de défense, phénomène communément
appelé « course à l’armement ». Malgré une importance démontrée chez de nombreuses
espèces bactériennes, l’étude du rôle des phages dans la biologie du pathogène Clostridium
difficile est demeurée très limitée. Or, les infections à C. difficile sont considérées comme
étant la principale cause des diarrhées associées à la prise d’antibiotiques. Alors, l’objectif
de la présente étude avait pour but de mieux caractériser l’implication des phages dans la
biologie de C. difficile. Des travaux préalables ont montré que la lysogénisation par le phage
tempéré φCD38-2 pouvait mener à une augmentation de la production de toxines chez
certaines souches de C. difficile suggérant une implication des phages dans la virulence
bactérienne. En utilisant cette étude comme point de départ, nous avons évalué l’influence
de la lysogénisation du phage φCD38-2 sur le transcriptome global d’une souche de C.
difficile d’importance clinique. Ainsi, nous avons montré que la lysogénisation par le phage
φCD38-2 a un impact significatif sur la transcription de 39 gènes bactériens dont près de la
moitié encodent des protéines reliées au métabolisme des sucres, suggérant une implication
du phage dans les processus métaboliques de l’hôte. Cependant, le gène présentant la plus
grande altération transcriptionnelle encode une protéine de surface nommée CwpV. À partir
de sa localisation sur la surface bactérienne, nous avons démontré que son expression a un
effet protecteur sur les cellules face aux infections par les phages. Les expériences
subséquentes ont permis de lier l’activité antiphage au domaine carboxy-terminale variable
de la protéine. Étant donné que l’adsorption virale n’est pas affectée par la présence de
CwpV, nous avons établi que le mode d’action du système consiste à bloquer l’injection
d’ADN virale dans la cellule bactérienne. De plus, l’effet antiphage est plus prononcé envers
les siphophages comparé aux myophages suggérant un mode d’action dépendant de la
morphologie virale. Finalement, les expériences préliminaires suggèrent que les cellules qui
expriment la CwpV ont un avantage sélectif par rapport aux cellules qui ne l’expriment pas
dans un essai de co-culture soumise à une infection virale.
Mots clés : Clostridium difficile, bactériophage, transcriptome, CwpV, système antiphage
iii
iv
SUMMARY
Phage-host interactions in Clostridium difficile
By
Ognjen Sekulović
Microbiology Program
Thesis presented at the Faculty of medicine and health sciences for the obtention of
Doctor degree diploma philosophiae doctor (Ph.D.) in microbiology, Faculty of medicine
and health sciences, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4
Bacteriophages (or simply phages) are viruses that specifically infect and kill
bacteria. They are omnipresent in every niche where bacteria thrive and as such are
considered as the most abundant biological entities in the biosphere. Their massive impact
on bacterial biology has incited scientific community to consider the phages as the major
driving force in bacterial evolution. Nowadays, it is also assumed that phages act as the
principal vectors for horizontal transfer of genetic information among prokaryotes.
Moreover, highly dynamic nature of phage host relationships usually results in mutual
adaptations that effectively stimulates acquisition of new offensive and defensive strategies.
This phenomenon is generally described as the “phage-host arms race”. Despite their obvious
importance, the contribution of phages to the biology of Clostridium difficile, the main cause
of nosocomial infectious diarrhea, has not been extensively explored. Thus, the main
objective of this study was to assess the overall impact of phages to C. difficile lifestyle. Our
previous work has revealed the potential of a specific C. difficile phage termed φCD38-2 to
stimulate the production of bacterial toxins. Based on those results, we have performed a
global study of the impact of the φCD38-2 lysogeny on the bacterial transcriptome. Thus, we
have found a total of 39 genes whose expression was altered during the lysogeny of φCD382 with near half of them encoding proteins implicated in bacterial sugar metabolism. This
suggests phage implication in the regulation of bacterial utilization of carbon sources.
However, the largest transcriptional alteration has been observed for cwpV which encodes a
phase-variable surface-anchored protein. Owing to its variable nature, we have hypothesized
that CwpV might play a role in phage infection and indeed, we have shown that CwpV
expression protects bacterial cells from phage infection. Moreover, variable C-terminal
domain of CwpV was found to be essential for antiphage phenotype since its deletion restored
bacterial susceptibility to infection. Additionally, CwpV did not significantly affect phage
adsorption, but phage DNA replication was prevented suggesting that CwpV act as a
superinfection exclusion system. Interestingly, the antiphage effect was more pronounced
against phages from Siphoviridae family compared to phages from Myoviridae family
suggesting that structural differences are important for the antiphage phenotype. Finally, our
preliminary data suggest that CwpV expression confers selective advantage when mixed cocultures are challenged by phage infection.
Key words: Clostridium difficile, bacteriophage, transcriptome, CwpV, antiphage systems
v
TABLE DES MATIÈRES
Résumé.............................................................................................................................................ii
Summary ........................................................................................................................................ iv
Table des matières ....................................................................................................................... v
Liste des figures ........................................................................................................................... ix
Liste des tableaux ......................................................................................................................... x
Liste des abréviations ................................................................................................................ xi
Chapitre I ...................................................................................................................................... 13
Introduction ................................................................................................................................ 13
Nous ne sommes pas seuls ................................................................................................................ 13
Les bactériophages .............................................................................................................................. 14
Partenaire ou adversaire? ........................................................................................................................... 15
Les phages strictement lytiques ............................................................................................................... 16
Les phages tempérés ..................................................................................................................................... 16
Phage lambda (λ) ................................................................................................................................. 17
Le choix entre le cycle lytique ou lysogénique chez λ ...................................................................... 18
La lysogénie représente plutôt la règle que l’exception ........................................................ 20
Coévolution des phages tempérés avec leurs hôtes bactériens .......................................... 20
Régulation de l’expression génique durant le cycle lytique et lysogénique................... 22
Impact du cycle lytique et lysogénique sur le transcriptome de l’hôte ............................ 24
Induction spontanée et son rôle dans la biologie de l’hôte .................................................. 28
« La course à l’armement » ............................................................................................................... 29
L’adsorption ...................................................................................................................................................... 30
L’injection d’ADN............................................................................................................................................. 31
Interférence au niveau des étapes tardives du cycle lytique ........................................................ 33
Clostridium difficile .............................................................................................................................. 36
Facteurs de virulence .................................................................................................................................... 37
Épidémiologie et évolution de C. difficile .............................................................................................. 39
Les phages de C. difficile ............................................................................................................................... 42
vi
Les objectifs de la présente étude .................................................................................................. 44
Chapitre II .................................................................................................................................... 46
Article 1......................................................................................................................................... 46
Avant-propos ......................................................................................................................................... 46
Résumé : .................................................................................................................................................. 47
Abstract ................................................................................................................................................... 49
Introduction ........................................................................................................................................... 49
Materials and Methods....................................................................................................................... 51
Bacterial strains and growth conditions. .............................................................................................. 51
cDNA library construction and RNA sequencing ............................................................................... 53
Alignment of sequenced reads and bioinformatics analyses ........................................................ 54
Validation of RNA-seq expression data by RT-qPCR ........................................................................ 55
Pulsed-Field Gel Electrophoresis and Southern blotting................................................................ 55
Cell surface protein extraction and SDS-PAGE ................................................................................... 56
Immunofluorescence detection of CwpV .............................................................................................. 56
Quantitative PCR analysis of the ON/OFF cwpV genetic switch.................................................. 56
Gene inactivation using the ClosTron system ..................................................................................... 57
Results...................................................................................................................................................... 57
Creation of a R20291 lysogen carrying the ϕCD38-2 prophage ................................................. 57
Overview of the transcriptomic data in R20291 and R20291LYS................................................. 58
Transcriptome of the ϕCD38-2 prophage ............................................................................................ 61
Transcriptome and re-annotation of the endogenous phi-027 prophage............................... 62
Interference of ϕCD38-2 with transcription of host genes ........................................................... 65
The cell wall protein CwpV is upregulated in the R20291LYS ....................................................... 67
Discussion ............................................................................................................................................... 71
Effect of lysogeny on bacterial gene expression ................................................................................ 73
Effect of lysogeny on cwpV expression .................................................................................................. 74
Conclusion .............................................................................................................................................. 75
Acknowledgements ............................................................................................................................. 75
References .............................................................................................................................................. 76
Chapitre III ................................................................................................................................... 83
Article 2......................................................................................................................................... 83
Avant-propos ......................................................................................................................................... 83
vii
Résumé .................................................................................................................................................... 84
Abstract ................................................................................................................................................... 86
Author summary (200 words) ........................................................................................................ 87
Introduction ........................................................................................................................................... 88
Methods ................................................................................................................................................... 90
Bacterial strains, bacteriophages and plasmids ................................................................................. 90
Determination of phage titers and efficiency of plaquing (EOP) ................................................ 92
Isolation of R20291OFF and R20291ON clones ...................................................................................... 92
Cloning and expression of CwpV-related constructions ................................................................. 93
Immunoblotting for detection of CwpV ................................................................................................. 94
Bacterial survival assays .............................................................................................................................. 95
Phage adsorption assays .............................................................................................................................. 95
Detection of phage DNA replication ........................................................................................................ 95
Results...................................................................................................................................................... 96
CwpV protects against phage infection.................................................................................................. 96
CwpV protection is highly selective toward Siphoviridae phages ............................................102
The C-terminal domain of CwpV carries the antiphage activity ................................................104
CwpV functions as a superinfection exclusion (Sie) system .......................................................105
Discussion ............................................................................................................................................ 109
Concluding remarks ......................................................................................................................... 113
Authors' contributions .................................................................................................................... 114
Acknowledgements .......................................................................................................................... 114
References ........................................................................................................................................... 114
Chapitre IV .................................................................................................................................123
Discussion ..................................................................................................................................123
Rappel des objectifs du projet ...................................................................................................... 123
Les considérations préliminaires de l’étude........................................................................... 124
Le phage φCD38-2 dans son contexte biologique ...........................................................................124
R20291 dans son contexte biologique .................................................................................................125
Le choix de la technique .............................................................................................................................125
L’analyse du transcriptome viral ................................................................................................ 126
Le profil transcriptomique du prophage phi-027 ...........................................................................126
Le profil transcriptomique du prophage φCD38-2 .........................................................................129
viii
L’analyse du transcriptome bactérien ...................................................................................... 133
Observations générales ..............................................................................................................................133
Analyse des fonctions spécifiques ..........................................................................................................134
Le rôle biologique de CwpV ......................................................................................................................141
Le rôle de CwpV dans l’infection virale ................................................................................................142
La protection est sélective envers les siphophages ........................................................................142
La protection agit au niveau de l’injection d’ADN ...........................................................................144
Les hypothèses concernant le mécanisme d’inhibition d’injection d’ADN ...........................144
Autres fonctions de CwpV .........................................................................................................................147
CONCLUSION.............................................................................................................................. 148
REMERCIEMENTS ....................................................................................................................150
ANNEXE I.....................................................................................................................................151
ANNEXE II ...................................................................................................................................161
ANNEXE III..................................................................................................................................172
Liste des références ................................................................................................................183
ix
LISTE DES FIGURES
CHAPITRE I
Figure 1……………………………………………………………………………………15
Figure 2……………………………………………………………………………………18
Figure 3……………………………………………………………………………………30
Figure 4……………………………………………………………………………………35
Figure 5……………………………………………………………………………………41
Figure 6……………………………………………………………………………………42
CHAPITRE II
Figure 1……………………………………………………………………………………59
Figure 2……………………………………………………………………………………61
Figure 3……………………………………………………………………………………67
Figure 4……………………………………………………………………………………68
Figure 5……………………………………………………………………………………69
Figure S1…………………………………………………………………………………..58
Figure S2…………………………………………………………………………………..63
CHAPITRE III
Figure 1…………………………………………………………………………………..100
Figure 2…………………………………………………………………………………..101
Figure 3…………………………………………………………………………………..105
Figure 4…………………………………………………………………………………..106
Figure 5…………………………………………………………………………………..107
Figure S1……………………………………………………………………………..……98
Figure S2……………………………………………………………………..……………99
CHAPITRE IV
Figure 7…………………………………………………………………………………..131
Figure 8…………………………………………………………………………………..146
x
LISTE DES TABLEAUX
CHAPITRE II
Table 1……………………………………………………………………………………..59
Table 2……………………………………………………………………………………..66
Table S4……………………………………………………………………………………65
Table S5……………………………………………………………………………………53
CHAPITRE III
Table 1.……………………………………………………………………………………..91
Table 2…………………………………………………………………………………….103
Table S1……………………………………………………………………………………………93
xi
LISTE DES ABRÉVIATIONS
ABC
ADN
ARN
ARNm
ARNr
ARNt
BHI
BLAST
cAMP
CDAD
cDNA
CDT
CRISPRs
CWB2
CwpV
dNTP
DO600
EDTA
EHEC
FbpA
Fis
H-NS
HRP
HTH
ICD
IHF
kDa
LC-MS/MS
LSS
M
mM
MOI
NAP
NCBI
ng
NGS
ORF
PaLoc
pb
PBS
PBST
ATP-binding cassette
Acide désoxyribonucléique
Acide ribonucléique
Acide ribonucléique messager
Acide ribonucléique ribosomal
Acide ribonucléique de transfert
Brain Heart Infusion
Basic Local Alignment Search Tool
cyclic Adenosine Monophosphate
Clostridium difficile associated disease
Complementary deoxyribonucleic acid
Clostridium difficile toxin
Clustered regularly interspaced short palindromic repeats
Cell_wall_binding_2
Cell Wall Protein Variable
Déoxyribonucléotides
Densité Optique à la longueur d’onde 600 nanomètres
Acide éthylène-diamine-tetraacétique
Escherichia coli entérohémorragique
Fibronectin-binding protein A
Factor for inversion stimulation
Heat-stable nucleoid-structuring protein
Horseradish Peroxydase
Helix-turn-helix
Infections à Clostridium difficile
Integration host factor
Kilodaltons
Liquid Chromatography-tandem Mass Spectrometry
Leucine rich repeats
Molaire
Millimolaires
Multiplicity of Infection
North America Pulse field
National Center for Biotechnology Information
Nanogrammes
Next-generation sequencing
Open reading frame
Pathogenicity locus
Paires de base
Phosphate-Buffered Saline
Phosphate-Buffered Saline + 1% Tween
xii
PCR
PFGE
PFU/ml
pH
ppGpp
PTS
qRT-PCR
RM
RPKM
RPM
RT-PCR
Sie
SDS
SDS-PAGE
SLP
TAE
T/AT
TEM
TMP
TTSS
TY
UA
ufp/ml
w/v
Polymerase Chain Reaction
Pulsed-field gel electrophoresis
Plaque-forming units per millilitre
Potentiel hydrogen
Guanosine tétraphosphate
Phosphotransférase system
Quantitative Reverse-transcriptase Polymerase Chain Reaction
Restriction-modification
Reads per kilobase of transcript per million reads mapped
Rotation Par Minute
Reverse-transcriptase Polymerase Chain Reaction
Superinfection exclusion
Sodium Dodecyl Sulfate
Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
Surface Layer Protein
Tris-acétate EDTA
Toxin/Antitoxin
Transmission Electron Microscopy
Tape Measure Protein
Type three secretion system
Tryptose-Yeast extract
Uranyl-acétate
Unité formant des plages par millilitre
Rapport poids/volume
13
CHAPITRE I
INTRODUCTION
Nous ne sommes pas seuls
La coévolution des espèces est un concept clé qui a défini de nombreux aspects de
l’existence des êtres vivants. Ce concept, hautement dynamique et très commun au sein de la
biosphère, repose sur l’influence réciproque entre deux ou plusieurs espèces se traduisant par
une évolution antagoniste ou mutualiste commune. Le corps humain, en tant que système
biologique extrêmement complexe, n’échappe pas à la règle. Nous sommes habités par un
nombre impressionnant de microorganismes qui, en réalité, dépasse le nombre de nos propres
cellules dans un ratio 10:1 (Savage, 1977). Ce nombre titanesque est également accompagné
par une extraordinaire diversité qui englobe surtout les bactéries, mais aussi des
archéobactéries, fungi et virus (Human Microbiome Project, 2012). On estime que le tractus
gastro-intestinal abrite à lui seul quelques centaines d’espèces bactériennes communément
appelées le microbiote (Sperandio, 2012). En parallèle, il héberge une diversité étonnante de
virus qui se chiffre à environ 1500 virotypes communément appelés le virome (Breitbart et
al., 2003; Reyes et al., 2010). La très grande majorité de cette diversité virale est constituée
de bactériophages (ou simplement phages), c’est-à-dire des virus capables d’infecter
uniquement les bactéries. Le microbiote et le virome évoluent ensemble selon une dynamique
précise et avec une certaine conséquence pour l’homme, cependant cette dépendance n’est
pas exclusive aux espèces bactériennes commensales. Ainsi, de nombreux pathogènes ont
évolué de pair avec leurs phages spécifiques selon un mode mutualiste qui assure les
bénéfices pour les deux parties concernées au détriment de l’hôte. La colonisation de ce
dernier par un pathogène opportuniste (processus appelé infection), se caractérise
généralement par une disparition de la diversité générale du microbiote, apparition de
dommages au site de l’infection et parfois la mort de l’hôte. On sait maintenant que les
bactériophages sont intrinsèquement impliqués dans la biologie et la virulence d’un grand
nombre de pathogènes et peuvent fortement influencer l’issue d’une infection. À cet égard,
14
les relations phages-bactéries vont bien au-delà de la simple interaction prédateur-proie et
représentent un monde évolutif unique, fascinant et ayant des implications majeures pour la
santé de l’humain. Pourtant, malgré l’importance du sujet, notre compréhension de cette
relation est loin d’être complète.
Les bactériophages
Depuis leur découverte par Frederick Twort et Félix d’Hérelle en 1915 et 1917
respectivement, les phages ont continué de fasciner la communauté scientifique. Imaginé
initialement par d’Hérelle comme un traitement aux infections bactériennes, l’intérêt pour
les phages a diminué suite à la découverte et l’exploitation des antibiotiques. Toutefois, les
phages reprennent un rôle central en définissant les grands paramètres et les premières
découvertes en biologie moléculaire. Dû à la simplicité de leurs génomes et la facilité de
manipulation, ils furent utilisés comme modèles pour les découvertes majeures tels que la
nature du code génétique, la notion du gène ou encore la réplication et transcription du
matériel génétique. Un siècle après leur découverte, nous en savons infiniment plus sur la
biologie et l’évolution des phages, pourtant nous sommes loin d’en comprendre toutes les
subtilités.
Ce qui est certain de nos jours, c’est la distribution ubiquitaire des phages. Ils sont
retrouvés partout où les procaryotes prospèrent et dépassent typiquement le nombre de leurs
hôtes par un facteur 10. Cette caractéristique leur vaut l’épithète de l’entité biologique la plus
répandue sur Terre avec une estimation qui dépasse 1030 particules virales pour l’ensemble
de la biosphère (Chibani-Chennoufi et al., 2004; Mann, 2005). Morphologiquement, les
phages se présentent sous toutes les formes imaginables, cependant la très grande majorité
(96%) possède une structure commune caractérisée par l’absence d’une membrane
périphérique et la présence d’une capside et d’une queue (Fokine et Rossmann, 2014). Ces
phages font partie d’une des trois grandes familles soit Myoviridae (queue contractile),
Siphoviridae (longue queue non contractile), ou Podoviridae (courte queue non contractile)
regroupées dans le grand ordre des Caudovirales (Ackermann, 1998). Le génome d’un phage
est typiquement modulaire et présente un regroupement localisé des gènes ayant une fonction
similaire.
15
Partenaire ou adversaire?
Ultimement, un phage peut être perçu comme un parasite égoïste ayant pour but unique
la multiplication massive destinée à éviter l’extinction de la lignée. Après tout il ne s’agit que
du matériel génétique (génome) protégé par un emballage protéique (capside). Pourtant, au
fil du temps, les phages ont pu interagir, s’adapter et s’imposer pour finalement évoluer avec
les hôtes présents dans leur environnement. Afin de bien saisir l’ampleur de cette relation, il
est nécessaire de comprendre les fondements derrière le processus d’infection. En tenant
compte du mode réplicatif des phages, il nous est possible de les séparer en deux grandes
catégories : les phages strictement lytiques et les phages tempérés (ou à cycle lysogénique)
(Figure 1, Chapitre I).
Figure 1 Le cycle lytique et lysogénique du coliphage λ. L’adsorption du phage est
suivie rapidement par l’injection du génome viral dans la cellule bactérienne. Dans le
cas du cycle lysogénique, le génome viral est intégré dans le génome bactérien et se
réplique en même temps que celui-ci. Dans le cas du cycle lytique, les composantes
structurelles des phages sont produites et la cellule hôte est lysée pour libérer la
progéniture virale. Reproduit avec l’autorisation de (Campbell, 2003)
16
Les phages strictement lytiques
L’infection par un phage strictement lytique entraine obligatoirement la mort de la
cellule hôte. Dans cette optique, un phage lytique se comporte comme un prédateur
hautement sophistiqué qui, suite à l’infection, détourne le système cellulaire en son avantage
pour assurer la production de la progéniture virale. Cette prise d’assaut de la machinerie
cellulaire est brutale et extrêmement rapide, de telle sorte que le destin d’une cellule infectée,
la mort ou la survie, se décide typiquement dans les minutes suivant l’infection. Le résultat
final est le relâchement de la progéniture virale qui peut infecter d’autres cellules avoisinantes
et le cycle recommence. Ce mode de multiplication assure une augmentation locale de la
population virale dans un temps minimal. Par conséquent, la multiplication d’un phage
corrèle positivement avec la capacité reproductive de l’hôte dans un milieu donné (Riemann
et al., 2000; Sandaa et al., 2009). La conséquence d’une multiplication virale rapide réside
dans la disparition tout aussi rapide de l’hôte nécessaire pour l’infection. Cependant, une lyse
importante de la population bactérienne entraine un relâchement de nutriments essentiels
(carbone, azote, phosphate) sous forme de métabolites cellulaires tels que les sucres, acides
aminés et acides nucléiques. Ce flux nutritif peut être considérable (Riemann et al., 2009) au
point d’alimenter la même population bactérienne donnant lieu à un autre cycle de croissance
bactérienne et de prédation par les phages. Cette dynamique relationnelle est omniprésente
dans l’environnement marin résultant en 1023 infections par seconde et donnant lieu au
processus crucial du cycle de carbone (Fuhrman, 1999; Suttle, 2005). Ainsi, les phages
strictement lytiques sont considérés comme les principaux régulateurs de la biomasse
bactérienne dans l’environnement marin (Suttle, 2007), mais aussi des joueurs clés dans le
contrôle des populations microbiennes dans les sols (Allen et al., 2010; Srinivasiah et al.,
2008).
Les phages tempérés
Le mode réplicatif des phages tempérés diffère passablement avec celui des phages
strictement lytiques. Certes, les phages tempérés peuvent suivre la voie lytique classique et
donner lieu à une multiplication locale relativement rapide. Cependant, ils ont la possibilité
de suivre une voie alternative appelée voie lysogénique qui assure la survie de l’espèce sans
le génocide microbiologique propre aux phages lytiques.
17
Le mode de vie lysogénique repose sur le principe d’une coexistence passive du
génome viral avec le génome bactérien. En d’autres termes, l’infection d’une cellule
bactérienne par un phage tempéré peut se solder soit par la fusion des deux génomes, c’està-dire l’intégration du génome du phage dans celui de la bactérie, soit par une existence
épisomale (à la manière d’un plasmide) du phage en question. Typiquement, le génome du
phage est soumis aux mêmes contraintes que le génome bactérien et se réplique avec celuici de telle sorte que le matériel génétique viral est transmis efficacement à chaque génération
de division bactérienne. Ce mode de réplication est nettement moins brutal que la voie
lytique, mais il a le désavantage d’entièrement dépendre de l’hôte. Néanmoins, cette voie
passive peut être interrompue en tout temps suite aux signaux internes ou externes,
permettant au phage résidant de passer en mode lytique. Ce phénomène, appelé induction,
entraine la mort de la cellule hôte, mais permet un relâchement de la progéniture virale qui
peut infecter d’autres cellules avoisinantes. Ainsi, la régulation du cycle lytique et
lysogénique est d’une importance capitale pour un phage.
Phage lambda (λ)
Assurément, le phage tempéré le plus connu et le plus étudié est le coliphage λ. Décrit
pour la première fois en 1953 par Esther Lederberg (Lederberg et Lederberg, 1953), il a servi
comme outil génétique durant plus d’un demi-siècle. De nos jours, λ est considéré comme
l’archétype du phage tempéré. Il est en mesure d’infecter son hôte, Escherichia coli, de façon
lytique ce qui résulte au relâchement d’une progéniture d’environ 150 phages à partir d’une
seule cellule bactérienne infectée (Shao et Wang, 2009). Typiquement, ce type d’infection
est préféré lorsque l’hôte prospère dans un milieu nutritif riche, et donc une augmentation de
la population de l’hôte se traduit par une augmentation proportionnelle de la charge virale. À
l’inverse, dans les conditions de limitation nutritive, λ préfère la voie lysogénique qui assure
la protection du génome du phage à l’intérieur de la cellule bactérienne. Cette observation
implique que le phage tempéré est en mesure de percevoir l’état physiologique de la cellule
lors de l’infection et de s’ajuster en conséquence. Les effecteurs moléculaires du phage λ,
intrinsèquement reliés dans un réseau génétique complexe, sont maintenant bien connus.
18
Le choix entre le cycle lytique ou lysogénique chez λ
La régulation du cycle lytique-lysogénique chez λ est centrée autour de deux
régulateurs transcriptionnels, CI et Cro, confinés dans une région précise du génome du
phage illustrée à la Figure 2, Chapitre I.
Figure 2 La représentation schématique des régions du génome du coliphage λ impliquées
dans la prise de décision entre le cycle lytique et le cycle lysogénique. La figure n’est pas
à l’échelle et la distance entre les gènes n’est pas représentative des distances réelles dans
le génome. Les rectangles pointus représentent des gènes impliqués dans la lysogénie
(orange) ou le cycle lytique (bleu). Tous les gènes impliqués dans ces processus ne sont
pas représentés. Les rectangles verts illustrent les opérateurs. Les flèches noires sont
indicatives des promoteurs. Modifié à partir de (Calendar, 2006)
Ces deux régulateurs sont antagonistes de sorte que l’expression du CI assure la voie
lysogénique et inversement, l’expression du Cro assure la voie lytique. Cependant, l’équilibre
entre l’expression et l’action de chacun des régulateurs est finement contrôlé via les
promoteurs / opérateurs situés à proximité. Tout d’abord, une première région régulatrice se
trouve entre les deux gènes cI et cro. Elle comporte deux promoteurs en direction opposée,
PRM et PR, avec en plus trois opérateurs nommés OR1, OR2 et OR3. En principe, les deux
régulateurs transcriptionnels peuvent lier les opérateurs avec cependant des modes différents.
19
Par exemple, Cro lie les régions OR3-OR2-OR1 avec une affinité décroissante. De telle
manière, à des niveaux d’expression modérée, Cro lie tout d’abord la région OR3 bloquant
par le fait même l’expression du CI à partir du promoteur PRM. Ceci a pour effet de stimuler
la voie lytique. Or, avec les quantités croissantes de Cro, les sites OR2 et OR1 deviennent
occupés bloquant progressivement l’expression du Cro à partir du promoteur PR créant ainsi
une boucle d’autorégulation négative.
Le cas du CI est plus complexe. Par exemple, CI est en mesure de lier l’opérateur OR1
avec une grande affinité et les deux autres sites (OR2 et OR3) avec une faible affinité.
Cependant, cette liaison est coopérative, c’est-à-dire que la liaison sur le premier site (OR1)
stimule d’environ 200 fois la liaison sur le site suivant (OR2). Cette double liaison a deux
conséquences : premièrement, cela mène à la répression du promoteur PR (Cro réprimé) et
deuxièmement, cela active le promoteur PRM (CI activé). Le tout mène à une production en
continu du CI et une répression constante du Cro, avec comme conséquence finale la mise
en place du cycle lysogénique. De plus, durant la lysogénie, CI agit sur la deuxième région
régulatrice contenant trois opérateurs nommés OL1, OL2 et OL3. L’occupation des opérateurs
OL assure une répression du promoteur PL qui régule l’expression d’un autre facteur lytique
appelé N. Ainsi, CI et Cro sont au cœur même de cette régulation transcriptionnelle.
Cependant, lorsque le phage λ infecte une cellule, ni CI ni Cro ne sont pas présents
d’emblée. Alors, comment la prise de décision entre le cycle lytique et le cycle lysogénique
se fait-elle? La réponse se trouve dans la capacité du phage à percevoir l’état physiologique
de la cellule et à réagir en conséquence. Les deux régulateurs CI et Cro seront exprimés peu
après l’injection de l’ADN du phage dans la cellule bactérienne. L’expression du Cro est
assurée par son propre promoteur fort PR. À l’inverse, le promoteur PRM du CI est
relativement faible en absence du CI et donc l’expression du CI est assurée par un troisième
promoteur appelé PRE. En principe, la fluctuation entre les niveaux d’expression du Cro et
CI décideront de la voie à suivre. Cro étant exprimé en continu, c’est le CI qui a le potentiel
de pencher l’équilibre du côté du cycle lysogénique. Or, l’expression du CI à partir du PRE
est stimulée de manière directe par un troisième facteur clé appelé CII qui a son tour est sous
la régulation complexe par le facteur CIII et la protéase de l’hôte FtsH. Ainsi, CII est dégradé
rapidement par la protéase FtsH, mais l’action de la protéase bactérienne est régulée par CIII
qui agit comme un inhibiteur compétitif. Également, l’activité protéolytique de FtsH est
20
inhibée par la présence de l’AMP cyclique (cAMP) et de la guanosine tétraphosphate
(ppGpp), deux messagers qui sont synthétisés lorsque la cellule est en carence de carbone et
d’acides aminés.
Ainsi, la décision d’un phage tempéré à établir le cycle lysogénique plutôt que le cycle
lytique est multifactorielle et implique une cascade interactive et une relation complexe avec
les facteurs de l’hôte. Cependant, la dépendance envers l’hôte dans la prise de décision lyselysogénie n’est pas un aspect isolé. La nature même de la lysogénie, c’est-à-dire la
coexistence du génome viral et du génome bactérien, peut avoir des répercussions immenses
sur l’hôte bactérien.
La lysogénie représente plutôt la règle que l’exception
Avec l’arrivée des techniques de séquençage à haut débit, le nombre de génomes
bactériens séquencés a augmenté de manière exponentielle. L’analyse de cette quantité
phénoménale d’informations génomique a permis de constater que la distribution des
prophages est beaucoup plus grande que ce qui était soupçonné auparavant (Canchaya et al.,
2003). Ainsi, la lysogénie est un phénomène commun au sein des espèces bactériennes. De
plus, plusieurs espèces bactériennes peuvent contenir plus d’un phage dans leurs génomes
donnant lieu au phénomène de la polylysogénie. Par exemple, certaines souches de
Streptococcus pyogenes possèdent de 4 à 6 prophages dans leur génome, représentant de 12-16%
d’ADN génomique total (Aziz et al., 2005; Ferretti et al., 2001; Smoot et al., 2002). Un autre cas
extrême est décrit chez Escherichia coli O157:H7 ou on dénombre jusqu’à 18 prophages pouvant
atteindre 16% d’ADN génomique total (Hayashi et al., 2001; Ohnishi et al., 2001). Néanmoins,
cette distribution presque ubiquitaire des prophages dans les génomes bactériens s’explique
partiellement par une coévolution mutualiste alimentée par les avantages multiples que vont
procurer les phages tempérés à leurs hôtes.
Coévolution des phages tempérés avec leurs hôtes bactériens
Notre intérêt pour les bactéries provient en grande partie de l’impact qu’elles ont sur la
santé humaine. Ainsi, il n’est pas surprenant de constater qu’un effort particulier a été
naturellement dédié aux études portant sur les bactéries pathogènes. Assez tôt dans cette
exploration globale, les phages tempérés ont été mis en évidence comme des facteurs
21
importants et même déterminants dans la virulence de certains pathogènes. Par exemple, dès
1927, il a été remarqué que la capacité toxinogène des streptocoques était transférable via les
surnageant des cultures. Aujourd’hui, on sait que ce phénomène de transfert génique (appelé
transduction) était causé par les phages encodant les toxines érythrogènes (Johnson et al.,
1986). Également, dès le début des années 1960, il est devenu évidant que la toxine
diphtérique, facteur de virulence principal chez Corynebacterium diphtheriae, est encodée
par un prophage (Barksdale et al., 1960). Suite à ces observations initiales, de nombreux
phages tempérés ont été identifiés comme véhicules de toxines puissantes chez de nombreux
pathogènes notoires tels que Clostridium botulinum (toxine C1), Streptococcus pyogenes
(toxines type A et C), Staphylococcus aureus (Enterotoxin A et C), Vibrio cholerae (Cholera
Toxin), Pseudomonas aeruginosa (Cytotoxine) et Escherichia coli (Shiga Toxines 1 et 2)
(Brussow et al., 2004). Dès lors, il devint évident que les phages tempérés, malgré leur nature
potentiellement lytique, pouvaient être bénéfiques pour leurs hôtes bactériens, renversant du
coup le dogme qui illustrait les relations phage-hôte comme une simple extension du concept
prédateur-proie. De nos jours, les phages tempérés sont perçus comme un véritable réservoir
environnemental de toxines ayant la capacité de mobilité et de dissémination (Casas et al.,
2006). Concrètement, les facteurs de virulence encodés sur les phages, comme les toxines,
donnent la possibilité aux bactéries hôtes d’exploiter une nouvelle niche ou de mieux utiliser
une niche existante. Cet avantage peut devenir crucial dans la mesure où la bactérie-hôte
évolue dans un environnement nécessitant une compétition directe avec une flore existante;
d’ailleurs, c’est le cas pour la plupart des infections opportunistes chez l’Homme.
Ultimement, l’avantage procuré par l’acquisition d’un facteur de virulence via un
phage tempéré sera bénéfique pour la bactérie hôte, mais également pour le phage qui
l’encode. Cet aspect est lié à l’interdépendance phage-hôte : une meilleure propagation de
l’hôte dans un environnement donné favorisera également une meilleure propagation des
phages spécifiques à cet hôte. Cependant, seulement une minorité des phages tempérés
caractérisés jusqu’à présent semblent encoder dans leurs génomes des facteurs de virulence
démontrés. Certes, cette proportion peut augmenter avec la découverte de nouveaux phages
ou encore la caractérisation des nouvelles protéines encodées par les phages, néanmoins il
semblerait qu’une relation phage-hôte plus subtile est de mise dans la majorité des cas.
22
Régulation de l’expression génique durant le cycle lytique et lysogénique
La relation interdépendante phage-hôte a été extensivement explorée au cours des
dernières années. Beaucoup de ces études ont visé à comprendre le développement du cycle
lytique chez les coliphages modèles tels que le phage T4, T7 et λ (Roucourt et Lavigne,
2009). Typiquement, le transcriptome d’un phage lytique (ou d’un phage tempéré en mode
lytique) va suivre une activation temporelle qui consiste à exprimer simultanément des
groupes de gènes associés à une fonction précise. Ainsi, les premiers gènes exprimés durant
un cycle lytique (gènes précoces) servent généralement à détourner la machinerie cellulaire
de l’hôte dans le but de servir uniquement l’infection en cours et à protéger l’ADN viral des
nucléases bactériennes. Ce processus est habituellement atteint par l’expression de facteurs
sigma alternatifs et des protéines qui déstabilisent ou modifient les ARN polymérases de
l’hôte. La deuxième étape consiste en l’expression des gènes médians qui assurent la
réplication efficace et rapide du génome viral. La dernière série de gènes (gènes tardifs) est
constituée des composantes structurales des particules virales (capside, queue) ainsi que les
gènes nécessaires à la lyse bactérienne et la libération de la progéniture. Cette régulation
transcriptomique temporelle durant un cycle lytique est globalement conservée parmi les
différents phages. Par exemple, les phages T4 et λ infectant E. coli (Luke et al., 2002;
Osterhout et al., 2007), phage TP901-1 infectant Lactococcus lactis (Madsen et Hammer,
1998), phages DT1 et 2972 infectant Streptococcus thermophilus (Duplessis et al., 2005),
phage LUZ19 infectant P. aeruginosa (Lavigne et al., 2013) et phage Giles infectant
Mycobacterium smegmatis (Dedrick et al., 2013) ont tous un profil d’expression similaire
durant leur cycle lytique.
Contrairement au cycle lytique, la lysogénie est un mode qui ne nécessite aucune
régulation temporelle. Typiquement, un phage en mode lysogénie est transcriptionellement
silencieux. Les seuls gènes exprimés sont ceux nécessaires au maintien de la lysogénie tels
que les répresseurs et parfois les unités transcriptionnelles indépendantes qui constituent les
gènes de conversion lysogénique. Par exemple, les expériences d’hybridation de type
Northern ont permis de limiter l’activité transcriptomique des prophages résidant dans
diverses espèces de Lactobacillus principalement à proximité du répresseur (Ventura et al.,
2006; Ventura et al., 2004). De façon similaire, le profil transcriptomique a été restreint à
seulement deux régions dans les prophages Sfi21 et O1205 du S. thermophilus. La première
23
région englobait une section du module de la lysogénie contenant le répresseur et la deuxième
région comprenait un groupe de gènes sans fonction identifiable à la fin du module de lyse.
De par leur position génomique et du fait qu’ils soient transcrits durant la lysogénie, ces
gènes peuvent être potentiellement impliqués dans la biologie de l’hôte (Ventura et al., 2002).
De la même manière, l’activité transcriptomique du prophage Bbr-1 résidant dans le génome
de Bifidobacterium breve UCC 2003 a été confinée surtout au niveau du répresseur.
Cependant, un transcrit correspondant au gène encodant une β-glucosidase a également été
détecté. Encore une fois, l’hypothèse retenue est que gène peut potentiellement jouer un rôle
dans le métabolisme des sucres chez l’hôte.
À l’opposé de ces études qui ont utilisé l’hybridation de type Northern, des nouvelles
techniques ayant une meilleure résolution ont été mises à profit récemment pour la
détermination du profil transcriptomique des prophages. Ainsi, le transcriptome du coliphage
λ à l’état du prophage a été déterminé en utilisant les micropuces à ADN (Osterhout et al.,
2007). Tel qu’attendu, le répresseur cI constituait le gène le plus exprimé. Cependant, sept
autres transcrits ont été détectés incluant deux gènes (bet et xis) impliqués dans la
recombinaison et l’excision reflétant probablement le phénomène de l’induction spontané.
De plus, les gènes rexAB encodant le système d’immunité ont été exprimés presque aussi
fortement que le répresseur cI. Finalement, deux composantes de la queue du phage
(lambdap14 et lambdap18) ont été détectées ainsi qu’un gène codant pour une protéine sans
fonction connue (orf63).
RNA-seq est une technique récente et relativement puissante pour les études
transcriptomiques. Contrairement aux méthodes d’hybridation (Northern et micropuces à
ADN), cette technique est basée sur les récents développements au niveau du séquençage à
haut débit. Techniquement, l’ARN total est isolé dans les conditions voulues, rétrotranscrit
en ADN complémentaire (ADNc) pour ensuite être séquencé et aligné sur le génome
référence. De telle manière, on obtient une image globale, sensible et très précise de la
transcription à un moment donné (Garber et al., 2011; Marioni et al., 2008; Mortazavi et al.,
2008). Cette technique a été utilisée pour déterminer le transcriptome du phage Giles chez
M. smegmatis (Dedrick et al., 2013). Comme prévu, l’expression du répresseur (gp46) a été
détectée, avec cependant une amplitude dépassant largement celle décrite pour le phage λ
(Ptashne et al., 1980). Mis à part le répresseur, peu de gènes avaient une expression
24
significative. En effet, une expression très faible a été détectée pour seulement 6 autres gènes,
dont trois potentiellement impliqué dans le maintien de la lysogénie (gènes 44-46) et trois
autres sans fonction connue (2-4). Cependant, une région particulière d’environ 100 pb a été
très fortement exprimée sans toutefois couvrir un cadre de lecture ouvert suggérant qu’il
s’agit d’un petit ARN non-codant. Le rôle de ce dernier n’est pas connu, cependant sa
délétion n’a pas d’impact ni au niveau du cycle lytique ni au niveau du cycle lysogénique
supportant encore une fois l’idée d’un rôle chez l’hôte.
En résumé, les deux modes de vie des phages sont caractérisés par des profils
transcriptomiques différents et uniques. Ainsi, le cycle lytique implique une expression
séquentielle massive, mais finement contrôlée qui permet une régulation temporelle et
spatiale des gènes requis pour l’accomplissement du cycle. À l’inverse, le cycle lysogénique
est caractérisé par une expression très limitée et étroitement liée aux répresseurs et gènes
similaires nécessaires au maintien de la lysogénie. Cependant, durant la lysogénie, des gènes
de conversion lysogénique peuvent être exprimés indépendamment du reste du génome du
phage. Cette expression différentielle est possiblement sous régulation des facteurs de
transcription de l’hôte.
Impact du cycle lytique et lysogénique sur le transcriptome de l’hôte
Inévitablement, la conséquence ultime d’un cycle lytique est la mort de la cellule
infectée. Cependant, il est intéressant de constater que la réponse transcriptomique de l’hôte
face à une infection lytique va varier considérablement en fonction du phage qui infecte la
cellule. Par exemple, l’infection lytique par deux phages tempérés infectant L. lactis,
Tuc2009 et c2, provoque un changement relativement modeste sur le transcriptome
bactérien, représentant respectivement 5.5% et 7.5% du génome de l’hôte (Ainsworth et al.,
2013). Entre autres, l’altération transcriptomique présentait un enrichissement des gènes
impliqués dans le métabolisme des polysaccharides, de l’azote, des acides aminés et de la
séquestration et de l’utilisation des purines et pyrimidines. Une situation relativement
similaire a été observée lors de l’infection d’E. coli par le phage lytique PRD1 (Poranen et
al., 2006) et du phage PRR1 chez P. aeruginosa (Ravantti et al., 2008). Dans ces cas, il s’agit
de simplement rediriger les processus métaboliques de l’hôte afin d’assurer un apport
énergétique suffisant. En opposé, l’infection d’E. coli par la série-T des phages lytiques (T2,
25
T4, T5 et T7) provoque un arrêt presque instantané de la plupart des fonctions cellulaires,
accompagné peu après par la dégradation complète du génome bactérien (Hesselbach et
Nakada, 1977; Koerner et Snustad, 1979; Sadowski, 1971; Warner et al., 1975). Dans ces
cas, la cellule entière est séquestrée et les composantes structurelles (ex. les acides nucléiques
dérivés de la dégradation du génome de l’hôte) servent directement comme ressource
énergétique. Malgré cette différence dans la subversion de l’hôte, le but ultime est le même
et il consiste à assurer un flux énergétique suffisant pour soutenir la production de la
progéniture virale.
À l’inverse du cycle lytique, l’altération du transcriptome de l’hôte durant le cycle
lysogénique est moins dramatique, néanmoins elle peut avoir des conséquences très
importantes. Récemment, un exemple fascinant de la relation phage-hôte a été décrit chez E.
coli (Wang et al., 2010). En plus de contenir plusieurs prophages fonctionnels, la souche
modèle d’E. coli K12 contient également neuf prophages défectifs (CP4-6, DLP12, e14, rac,
Qin, CP4-44, CPS-53, CPZ-55 et CP4-57). Ces prophages sont généralement caractérisés par
l’incapacité de la production des particules virales, formation de plages de lyses ou de la lyse
cellulaire. Ces défauts proviennent de multiples réarrangements chromosomiques qui ont
amené à une perte de fonction et une désintégration de la structure génomique des prophages.
Ces prophages défectifs (ou cryptiques) ont longtemps été considérés comme superflus,
c’est-à-dire sans aucune utilité pour la bactérie hôte. Cependant, lorsque l’ensemble des neuf
prophages cryptique est enlevé du génome bactérien, la souche ainsi générée démontre
plusieurs altérations phénotypiques dont un ralentissement de croissance, un défaut de
formation de biofilm ainsi qu’une plus faible capacité à résister à certains antibiotiques
(quinolones et β-lactames) et aux stress environnementaux (pH, température, stress
osmotique et oxydatif). En combinant les mutants de délétion, les micropuces à ADN et le
PCR quantitatif en temps réel (qRT-PCR), les auteurs ont réussi à identifier les gènes
responsables de cette altération phénotypique. La résistance accrue aux quinolones et βlactames est en relation directe avec l’expression de deux gènes, dicB et kilR, situés
respectivement dans les prophages cryptiques rac et Qin. De manière similaire, trois gènes
de fonction inconnue, yfdK, yfdO and yfdS situés dans le prophage cryptique CPS-53 sont
responsables de la résistance au stress oxydatif. Finalement, l’altération au niveau de la
26
production du biofilm peut être attribuée aux prophages cryptiques e14 (gènes intE and ymfD)
et rac (gènes intR, stfR, ydaF, ydaS and ydaW).
De la même manière, un exemple intéressant a récemment été décrit chez Bacillus
anthracis, agent causal de la maladie de l’anthrax (Schuch et Fischetti, 2009). Dans cette
étude, les auteurs ont comparé l’effet phénotypique qu’avait l’introduction de certains phages
tempérés isolés dans la nature (ex. Wip1, Wip2, Wip4, Wip5, Frp1, Frp2, Slp1, Bcp1 et Wβ)
sur une souche modèle dépourvue de tout prophage (B. anthracis ΔStern). De façon
intéressante, la lysogénisation de la souche ΔStern avait des effets sévères sur plusieurs
processus bactériens importants. Par exemple, l’introduction des phages Bcp1, Wip1, Wip4
et Frp2 avait un effet drastique sur la capacité de la bactérie à produire un biofilm robuste et
viable. De la même manière, la capacité de sporulation a été affectée à la hausse via
l’introduction des phages Wip4, Wip5 ou Frp1 ou à la baisse via l’introduction des phages
Wβ, Wip1, Wip2 ou Frp2. Cette altération de la production de biofilm et de la sporulation
avait un impact considérable quant à la capacité de la bactérie à survivre dans le sol pendant
une période prolongée. Ultimement, en couplant une librairie d’expression d’ADN
complémentaire pour les phages Bcp1 et Wip4 aux tests phénotypiques, les auteurs ont réussi
à identifier deux régions spécifiques (bcp25-26 et wip48-49) codant pour des facteurs sigma
alternatifs. Ainsi, il a été proposé que les phages Bcp1 et Wip4 détournent la régulation
transcriptionnelle de l’hôte avec une reprogrammation des ARN polymérases via les facteurs
sigma alternatifs.
Ces deux exemples démontrent bien la complexité et l’enchevêtrement des régulations
transcriptomiques entre les phages tempérés et leurs hôtes bactériens. Cependant, dans les
deux cas, un effet phénotypique a été facilement observable, ce qui malheureusement n’est
pas applicable dans toutes les situations. Très souvent, des conditions particulières sont
nécessaires afin d’observer un impact significatif et ainsi certaines interactions phage-hôte
passent sous le radar. Afin de contourner ce problème, il est possible d’utiliser une approche
globale basée sur l’analyse du transcriptome entier de l’hôte en présence ou en absence d’un
phage afin de décrypter les relations phage-hôte qui ne résultent pas nécessairement en un
phénotype facilement observable. Toutefois, cette manière de procéder n’a pas été appliquée
systématiquement et seulement quelques exemples sont disponibles actuellement.
27
Ainsi, la confirmation que le cycle lysogénique est moins perturbateur pour l’hôte que
le cycle lytique a été obtenue en examinant l’impact de la lysogénisation du phage λ sur le
transcriptome d’E. coli (Chen et al., 2005). Le niveau d’expression de seulement 8 gènes
bactériens a été altéré dans le lysogène comparativement à la souche sauvage. Ces
changements transcriptomiques concernaient pour la plupart des gènes impliqués dans des
processus
métaboliques
(pckA,
phosphoenolpyruvate
carboxykinase;
nagA,
N-
acetylglucosamine-6-phosphate deacetylase) transport (b0572 et b0574, transporteurs de
cuivre) et les prophages résidants (b2002, prophage CP4-44; b0557 prophage DLP12). Des
résultats similaires ont été obtenus dans une étude subséquente portant sur la relation
lysogénique entre λ et une autre souche d’E. coli (Osterhout et al., 2007). Dans cette étude,
le niveau d’expression de 18 gènes bactériens a été altéré suite à la lysogénisation par le
phage λ. Il s’agissait principalement de gènes codant pour des protéines de transport impliqué
dans le métabolisme cellulaire tels que proWX (proline), pstB (phosphate), potCB
(spermidine), lldPR (L-lactate). Finalement, mis à part le couple classique λ-E. coli, la
relation prophage-hôte a été étudiée seulement chez L. lactis UC509 (Ainsworth et al., 2013).
La transcription de 44 gènes a été altérée (9 à la hausse et 35 à la baisse) suite à la
réintroduction du phage Tuc2009 dans une souche de L. lactis préalablement curée
(UC509.9). Parmi les gènes régulés à la baisse, on dénote des gènes codant pour les protéines
impliqués dans synthèse des nucléotides (ntd, dukA, nudH), métabolisme des acides aminés
(hisB, trpAD), respiration (menE, hemH) ainsi qu’une série de régulateurs transcriptionnels
de type MarR (uc509_0317 et uc509_0706), lysR (uc509_0396), MerR (uc509_1191), TetR
(uc509_1462) et de type HTH (uc509_2032). Parmi les gènes régulés à la hausse, on
remarque des gènes codant pour des transporteurs dont glycérol (glpF2), cadmium et
ammonium (cadA et amtB), lipides (uc509_2209) et le fer (uc509_1435 et uc509_1436).
En résumé, l’ensemble de ces études nous montre que malgré une différence dans les
espèces bactériennes ciblées, certains thèmes communs émergent dans les interactions
phage-hôte. Par exemple, la nature du mode lytique requiert une quantité d’énergie
considérable afin de soutenir la production massive de la progéniture virale. Donc, il est
commun d’observer une subversion des fonctions métaboliques bactériennes suite au
développement d’un cycle lytique. Ce détournement peut être relativement modeste, dans les
cas où les phages exploitent la machinerie cellulaire existante, mais parfois on observe une
28
séquestration totale des ressources cellulaires menant, entre autres, à une dégradation du
génome bactérien. À l’opposé, la lysogénie représente un mode de vie beaucoup plus passif.
L’expression de la majorité des gènes du phage est réduite par les répresseurs responsables
du maintien de la lysogénie. Toutefois, les études démontrent que l’interaction avec le
transcriptome bactérien n’est pas nulle. Encore une fois, le thème commun est centré autour
des gènes métaboliques même si les raisons derrière cette altération ne sont pas bien
comprises. De plus, cette interaction avec l’hôte semble reposer sur les régulateurs
transcriptionnels encodés par les phages tels que les répresseurs (Chen et al., 2005) ou les
facteurs sigma alternatifs (Schuch et Fischetti, 2009).
Induction spontanée et son rôle dans la biologie de l’hôte
Comme mentionnée précédemment, la lysogénie est un état très stable, néanmoins ce
cycle peut être rompu sous certaines conditions et donner lieu au phénomène d’induction,
caractérisé par le développement lytique du prophage résidant. Habituellement, l’induction
d’un prophage est dépendante de la réponse SOS de l’hôte. Ce dernier est généralement activé
soit suite à l’accumulation des dommages à l’ADN causés par la lumière UV ou les agents
mutagènes (induction provoquée) soit par des aberrations dans la réplication du génome
bactérien (induction spontanée). Dans le cas du prophage λ, l’activation du système SOS
entraine l’activation de la protéine RecA qui à son tour stimule l’activité autoprotéolytique
du répresseur CI. La diminution du niveau du régulateur transcriptionnel CI lève la répression
des promoteurs lytiques (dont le PR, voir Figure 2, Chapitre I) permettant ainsi l’expression
du Cro et l’établissement du cycle lytique. Cependant, tous les prophages ne sont pas activés
de la même manière. Dans le cas du coliphage 186, l’induction est dépendante du système
SOS, mais indépendante de la protéine RecA. En effet, une autre composante du système
SOS (protéine LexA) est responsable de l’activation d’un antirépresseur viral (protéine Tum)
qui à son tour interagit directement sur CI pour lever l’inhibition des promoteurs lytiques
(Lamont et al., 1989; Shearwin et al., 1998). D’autres phages (N15 d’E.coli, Fels-2 de
Salmonella enterica et CTXΦ de V. cholerae) présentent un mécanisme d’activation
similaire, dépendant de LexA plutôt que RecA (Bunny et al., 2002; Mardanov et Ravin, 2007;
Quinones et al., 2005).
29
Ainsi, même à l’état de prophage, la perception de l’état physiologique de l’hôte est
d’une grande importance pour les phages tempérés. Lorsque les conditions deviennent
critiques (accumulation importantes de dommages, activation du système SOS), le cycle
lytique est enclenché et le virus s’échappe pour éventuellement infecter d’autres hôtes. Alors,
en principe, un prophage peut être considéré comme une bombe à retardement et présente un
danger perpétuel pour l’hôte bactérien. Cependant, les bactéries ont évolué de manière à tirer
un certain profit de cette situation. Par exemple, le relâchement de certaines toxines encodées
par les prophages tels que la toxine Shiga Stx1 ou la toxine diphtérique est possible grâce à
la lyse bactérienne provoquée par l’induction des prophages (Barksdale et al., 1960; Wagner
et al., 2002). De plus, il semblerait que le relâchement de la toxine Shiga Stx2 chez E. coli
entérohémorragique (EHEC), causé par l’induction spontanée des prophages, a pour effet de
reloger certains récepteurs sur la surface des cellules épithéliales du tractus gastro-intestinal
ce qui augmente l’adhésion bactérienne (Los et al., 2012; Xu et al., 2012). Également, la
formation de biofilm par plusieurs espèces bactériennes est soutenue par le relâchement
d’ADN chromosomique suite à la lyse cellulaire causée par l’induction des prophages
(Carrolo et al., 2010; Godeke et al., 2011; Petrova et al., 2011).
En résumé, les divers exemples exposés dans les sections précédentes illustrent bien
les aspects de l’interdépendance et de la coévolution qui semblent façonner les relations
phages-bactéries. Toutefois, la nature de cette relation présente une certaine dualité. Certes,
les phages peuvent être extrêmement bénéfiques pour leurs hôtes bactériens, mais ils sont
avant tout un danger perpétuel et omniprésent, et donc cette relation peut être également
qualifiée d’antagoniste. Alors, il n’est pas surprenant de constater qu’au fil du temps, les
bactéries ont développé un arsenal impressionnant de stratégies de défense qui permettent de
limiter ou contrôler les interactions avec les phages et ainsi maintenir un équilibre relatif
entre les bénéfices et les dangers que présentent ces relations.
« La course à l’armement »
Les interactions compétitives dans la nature, telle que celle décrite précédemment entre
les phages et les bactéries, mènent invariablement à une transformation continuelle qui se
traduit par l’adaptation de l’hôte (bactérie) et la contre-adaptation du parasite (phage) (Stern
et Sorek, 2011). Cette relation constitue la base du concept de « la course à l’armement »
30
(phage-host arms race), ce qui implique qu’une exposition continuelle aux phages va mener
à l’émergence des mutants bactériens, résistants à l’infection. Cette adaptation peut être
active via l’acquisition ou la modification des systèmes antiphages ou encore passive via les
mutations ponctuelles ou modification des composantes intrinsèques. Dans les deux cas, le
temps requis pour l’adaptation et la contre-adaptation est extrêmement court ce qui stimule
la coévolution des deux entités et l’apparition de mutants fonctionnels. Les stratégies
évasives employées par les hôtes sont variées et peuvent intervenir à n’importe quel stade
d’infection, soit au niveau de l’adsorption, de l’injection d’ADN viral ou encore les étapes
subséquentes telles que la réplication ou la transcription des gènes viraux.
Ces stratégies défensives bactériennes et les contre-adaptations des phages seront
brièvement discutées dans les sections qui suivent.
L’adsorption
La première étape d’un cycle infectieux, qu’il soit lytique ou tempéré, consiste en
adsorption de la particule virale sur la cellule hôte. Cette étape présente une difficulté
considérable pour les phages due à l’immense variabilité présente au niveau des surfaces
cellulaires bactériennes. Le processus d’adsorption viral se fait typiquement en deux étapes.
Une première étape réversible implique une reconnaissance d’une structure protéique ou
glycoprotéique commune (récepteur primaire) sur la surface cellulaire. Suite à cette première
reconnaissance positive, un deuxième contact irréversible est établi avec un constituant
spécifique (récepteur secondaire) de la paroi cellulaire ce qui assure un ancrage permanent
du phage à la surface (Figure 3, Chapitre I).
31
Figure 3 Différentes étapes de l’adsorption du phage p2 infectant L. lactis. A) Les phages p2
se retrouvent à proximité de la cellule bactérienne. B) Une première interaction implique la
reconnaissance des structures communes de la surface bactérienne. Cette interaction est
faible, mais suffisante pour retenir le phage sur la paroi bactérienne. C) Une interaction
spécifique assure l’ancrage permanent du phage suivit de D) l’activation de la plaque basale
et d’un changement conformationnel des protéines de structure ce qui va ultimement
provoquer l’injection du génome viral dans le cytoplasme bactérien. Reproduit avec
autorisation de (Bebeacua et al., 2013)
Un mécanisme commun employé par les bactéries consiste à muter ou à masquer les
récepteurs reconnus par les phages. Par exemple, de multiples mutants spontanés du gène
csaB chez B. anthracis ont été isolés et positivement corrélés à une résistance à l’infection
par le phage lytique AP50c (Chen et al., 2010). CsaB est une protéine ancrée sur la surface
bactérienne et impliquée dans la maturation de la paroi cellulaire (S-layer) (Mesnage et al.,
2000). Les mutations identifiées sont délétères de telle sorte qu’une protéine fonctionnelle
n’est pas exprimée et des défauts majeurs dans la maturation de la paroi cellulaire sont
observés (Bishop-Lilly et al., 2012). Une situation similaire est observée chez certains
coliphages qui nécessitent les constituants internes du cœur lipopolysaccharidique (LPS) de
la surface bactérienne pour l’infection. Lorsque le LPS de S. enterica est modifié grâce aux
antigènes O de nature polysaccharidique, l’adsorption du phage P1 est abolie (Ho et Waldor,
2007; Ornellas et Stocker, 1974). À l’inverse, certains phages ont évolué à reconnaitre
spécifiquement les antigènes O (Xu et al., 2013) (Shin et al., 2012; Steinbacher et al., 1997)
(Pajunen et al., 2000; Perry et al., 2009). De plus, la production d’une matrice extracellulaire
peut empêcher les phages à accéder à leur récepteur spécifique (Hanlon et al., 2001; Scholl
et al., 2005). À l’inverse, les phages peuvent acquérir des enzymes capables de dégrader ces
structures cellulaires. D’autres mécanismes qui préviennent l’adsorption des phages ont été
décrits, comme la production d’inhibiteurs qui masquent spécifiquement les récepteurs
cellulaires reconnus par les phages (Nordstrom et Forsgren, 1974; Pedruzzi et al., 1998).
L’injection d’ADN
La reconnaissance d’un récepteur spécifique sur la surface cellulaire lors de l’étape de
l’adsorption stimule une série d’évènements irréversibles qui mènent à l’injection d’ADN
viral dans la cellule hôte (Kutter et Sulakvelidze, 2005). Le mécanisme moléculaire derrière
32
ce processus est variable d’un phage à un autre. Pour certains phages (ex. coliphage λ),
l’ADN viral, compacté sous haute pression dans la capside, est simplement éjecté suite aux
changements conformationnels des composantes de la queue du phage dû à l’interaction avec
le récepteur LamB (Evilevitch et al., 2003). Par contre, pour d’autres phages (ex. coliphage
T7), le processus d’injection est dépendant de la transcription bactérienne (Kemp et al., 2005;
Molineux, 2001).
Divers systèmes qui permettent un blocage de l’injection d’ADN viral ont été décrits,
mais on connait encore très peu les mécanismes moléculaires sous-jacents. Autre fait
intéressant, tous les systèmes qui bloquent le transfert d’ADN viral dans la cellule
bactérienne sont encodés par les phages et actuellement des systèmes bactériens n’ont pas
encore été décrits. Le nom utilisé pour décrire l’ensemble des systèmes qui agissent au niveau
de l’injection d’ADN est superinfection exclusion ou simplement Sie.
Le coliphage lytique T4 possède deux systèmes Sie, encodé par les gènes imm et sp.
Les deux systèmes sont exprimés peu après l’infection d’une cellule par le phage T4 et
préviennent une surinfection par d’autres phages similaires. Cependant, ils agissent
séparément et leur mode d’action est différent. Par exemple, le système Imm est localisé au
niveau de la membrane interne chez E.coli et possiblement associé au récepteur. Cette
association altère le site d’injection et l’ADN entrant est dévié dans l’espace périplasmique
au lieu de pénétrer dans le cytosol de la cellule (Lu et al., 1993). Le système Sp est également
situé au niveau de la membrane, mais son mécanisme d’action est différent. Ce système agit
comme inhibiteur de l’activité lysozyme encodée par gp5 sur le génome du phage T4 et ainsi
prévient la dégradation du péptidoglycan et l’injection subséquente de l’ADN viral (Lu et
Henning, 1994). D’autres systèmes Sie ont été identifiés chez diverses espèces
d’Enterobacteriaceae, cependant le mécanisme précis n’a pas été décrit. Par exemple, le
système Sim encodé par le phage P1 prévient la surinfection sans toutefois affecter
l’adsorption des particules virales ni la réplication d’ADN du phage si celui-ci est transféré
par transfection (Kliem et Dreiseikelmann, 1989). Également, le système SieA encodé par le
phage lysogénique P22 infectant S. enterica agit également au niveau de la membrane et
prévient l’infection par les phages L, MG148 et MG40 (Ebel-Tsipis et Botstein, 1971; Hofer
et al., 1995; Susskind et al., 1971). Quelques systèmes Sie ont été décrits chez les bactéries
à Gram positif. Le premier système décrit, nommé Sie2009, est encodé sur le génome du phage
33
tempéré Tuc2009 qui infecte une série de souches de L. lactis (McGrath et al., 2002). Tout
comme pour les systèmes décrits plus haut, Sie2009 empêche l’infection par un groupe de
phages génétiquement différents du Tuc2009 sans toutefois affecter l’adsorption des
particules virales. Subséquemment, trois autres systèmes semblables ont été identifiés sur des
prophages présents dans trois différentes souches de L. lactis, mais aucun mécanisme
moléculaire n’a été décrit (Mahony et al., 2008). À l’inverse, le système Sie encodé par le
phage TP-J34 infectant Streptococcus thermophilus a été étudié plus en détail. Tout d’abord,
il a été montré qu’une lipoprotéine encodée par le gène ltp sur le génome du TP-J34 est en
mesure d’interférer avec l’infection de certains phages (Sun et al., 2006). Par la suite, cet
effet a été attribué à une interaction directe de LtpTP-J34 avec les composantes de la queue du
phage ce qui empêchait son bon positionnement au niveau de la membrane. Des mutants de
phages, partiellement insensibles à l’effet de LtpTP-J34, ont été isolés et leur caractérisation
par la microscopie électronique et le séquençage de génomes entiers a montré une altération
au niveau de la tail tape measure protein (TMP), une composante essentielle de la queue du
phage. La structure tridimensionnelle de la LtpTP-J34 a été obtenue et des prédictions bioinformatiques in silico ont montré une interaction possible entre les charges négatives de la
LtpTP-J34 et les charges positives de la TMP (Bebeacua et al., 2013).
Interférence au niveau des étapes tardives du cycle lytique
Les dernières étapes dans un cycle lytique englobent la réplication d’ADN viral, la
production des composantes structurales (queue, capside) et la lyse de la cellule infectée. La
restriction d’ADN viral avant sa réplication via un système de restriction-modification (RM)
est un mécanisme très commun présent sur le génome de divers genres bactériens. Les
systèmes RM peuvent être classifiés en quatre grands types (type I à IV), mais le mécanisme
général est relativement similaire. Typiquement, ces systèmes englobent une composante
« restrictive » qui est responsable du clivage du nouvel ADN entrant dans la cellule via la
reconnaissance de certains sites spécifiques. À l’inverse, le génome bactérien est protégé par
la méthylation des sites sensibles sur le génome par la composante « protectrice » du système
RM. Ce système de protection étant quasi universel, il n’est pas surprenant de constater que
beaucoup de phages ont évolué des mécanismes leur permettant de résister aux enzymes
restrictives. Les stratégies telles que la mutation des sites reconnus par les nucléases (Kruger
34
et al., 1988), l’utilisation des bases modifiées (Bickle et Kruger, 1993), la protection des sites
de restriction avec une méthylase encodée par le phage (McGrath et al., 1999) ou encore
l’expression des inhibiteurs spécifiques des nucléases (Atanasiu et al., 2002) ont été décrites.
Également, d’autres systèmes plus complexes ont récemment été caractérisés et ils
impliquent soit une restriction phage-dépendant (systèmes CRISPR/Cas) ou encore un
suicide altruiste de la cellule infectée (systèmes Abi) (Barrangou et al., 2007; Chopin et al.,
2005; Sorek et al., 2008).
Plus particulièrement, le système CRISPRs (clustered regularly interspaced short
palindromic repeats) a gagné un intérêt colossal dû aux applications de biologie moléculaire
qui ont été développées suite à la caractérisation biologique du système (Jiang et al., 2013;
Larson et al., 2013; Mali et al., 2013; Martel et Moineau, 2014; Qi et al., 2013; Sampson et
Weiss, 2013). La fonctionnalité du système repose sur la présence d’un locus particulier,
composé de courtes séquences non contigües d’environ 30 pb (DRs, direct repeats) séparées
par des séquences variables (spacers) ayant une homologie avec les éléments génétiques
mobiles (protospacers), généralement les phages (Barrangou et al., 2007) (Figure 4, Chapitre
I). La transcription du locus produit une longue molécule d’ARN appelée pre-crRNA qui
sera prise en charge par une série de protéines appelées cas (CRISPR-associated proteins).
Le résultat final est la production d’une panoplie de courtes molécules d’ARN matures,
appelés crRNAs, qui serviront de guide pour les nucléases (ex. Cas9) afin de sélectivement
cibler et dégrader l’ADN entrant, par exemple l’ADN viral (Garneau et al., 2010). De plus,
les systèmes CRISPRs sont généralement capables d’expansion grâce à l’ajout de séquences
spacers à celles déjà présentes au niveau du locus de répétitions. Ces nouvelles séquences
sont dérivées de phages qui sont séquestrés avant de pouvoir enclencher un cycle lytique ou
lysogénique. Récemment, les prophages cryptiques ont été impliqués dans ce processus
(Hynes et al., 2014). Ainsi, il s’agit d’un véritable système d’immunité acquise, permettant
de contrer les infections virales et de garder une « empreinte » des rencontres passées ce qui
permet aux cellules bactériennes de mieux résister à l’infection du même ou d’un phage
similaire. Récemment, il a été montré que les systèmes CRISPRs peuvent aussi participer à
la réparation du génome de l’hôte (Babu et al., 2011). L’idée selon laquelle les systèmes
antiphages peuvent participer à d’autres processus biologiques est séduisante et ouvre de
nouvelles perspectives dans l’étude des relations phage-hôte.
35
Figure 4. Représentation schématique d’un système d’intérférence de type CRISPRsCas. A) Le locus est composé de séquences répétitives non contigües (DRs), identifiés
par les rectangles clairs et espacés par les spacers identifiés par des rectangles colorés et
numérotés. L’ensemble du locus est transcrit à partir d’une région en amont appelé leader
region ce qui résulte dans la formation de l’ARN précurseur (pre-crRNA). Ce long ARN
précurseur est clivé par le complexe des protéines Cas, dont la Cas6, afin générer une
série de petits ARNs (crRNA matures) ayant une structure secondaire caractéristique. B)
Le complexe effecteur est responsable de recruter les crRNA comme guides pour la
reconnaissance d’acide nucléique étranger à la bactérie. Une reconnaissance parfaite va
résulter dans le clivage de l’ADN étranger. Reproduit avec l’autorisation de (Marraffini
et al., 2010).
36
En résumé, la pression sélective exercée par les phages sur les populations bactériennes
a forcé l’adoption et l’évolution par les bactéries de multiples systèmes antiphages.
Généralement, ces systèmes peuvent viser diverses étapes du cycle infectieux et vont du
camouflage au suicide altruiste de la bactérie ciblée (Labrie et al., 2010). À l’inverse, la
riposte des phages face à ces mécanismes est étonnamment diversifiée (Samson et al., 2013).
De plus, cette guerre froide entre les phages et les bactéries n’est pas terminée : les bactéries
continuent à perfectionner leurs défenses et s’adaptent aux diverses stratégies élaborées par
les phages, mais à l’inverse, les phages continuent à évoluer de manière à contourner ces
nouvelles entraves. Le résultat final est une coévolution hautement dynamique imbriquée
dans une guerre microbiologique sans rémission.
Sur une échelle plus large, ce transfert horizontal du matériel génétique stimule
drastiquement l’évolution à court terme. À cet égard, les phages sont considérés comme les
principaux vecteurs de dissémination et constituent de véritables moteurs évolutifs
(Canchaya et al., 2003). Les évidences exposées dans les sections précédentes montrent
clairement à quel degré les phages tempérés ont influencé la virulence de nombreux
pathogènes que ce soit en encodant directement des facteurs de virulence ou en participant à
la régulation des processus de virulence chez l’hôte. D’une part, cette relation phage-hôte a
été explorée et assez bien caractérisée chez nombreux pathogènes notoires, par contre elle
est restée relativement obscure pour certaines espèces bactériennes dont le pathogène
entérique Clostridium difficile.
Clostridium difficile
Dans la dernière décennie, Clostridium difficile, pathogène entérique à Gram positif
relativement méconnu du grand public, s’est forgée une épithète peu-reluisant de super
bactérie (superbug). Isolé pour la première fois au début des années 1930, C. difficile est
maintenant reconnu comme la principale cause des diarrhées associées aux antibiotiques chez
les patients hospitalisés (Brazier, 2008; Hall et Snyder, 1934; Solomon et Oliver, 2014).
Généralement, une altération du microbiote intestinal normal, par exemple par la prise
d’antibiotiques à large spectre, est nécessaire pour le développement d’une infection
(infections à Clostridium difficile, ICD). Ainsi, la prise de certains antibiotiques tels que la
clindamycine, les céphalosporines et toutes les classes de fluoroquinolones, a été associée à
37
un risque plus grand de contracter l’ICD (Bartlett et al., 1977; Coia, 2009; Owens et al.,
2008; Rupnik et al., 2009). La nature strictement anaérobe de la bactérie implique
l’impossibilité de transmission à l’état végétatif. Par conséquent, la dispersion et la
persistance dans l’environnement sont assurées par la production de spores qui sont des
formes dormantes de la bactérie, hautement résistantes aux conditions externes défavorables.
Dû à ces caractéristiques, l’environnement hospitalier est particulièrement propice à la
propagation de la maladie et peut constituer un réservoir d’infection. Cependant, des études
récentes ont montré une augmentation des cas acquis dans la communauté (non-associés aux
hôpitaux), relançant le débat sur la question (Johnson et Gerding, 1998; Khanna et al., 2012;
Wilcox et al., 2008).
Facteurs de virulence
Les signes cliniques d’une infection de C. difficile vont de douleurs abdominales et
diarrhées jusqu’aux complications sévères qui peuvent être fatales tels que les
pseudomembranes et le mégacôlon toxique. Ces symptômes sont causés principalement par
l’altération de l’épithélium entérique sous l’action de deux cytotoxines, appelées toxine A
(TcdA) et toxine B (TcdB), encodées sur un locus de pathogénicité appelé PaLoc. Les deux
toxines comportent plusieurs domaines distincts, qui assurent la reconnaissance d’un
récepteur sur les cellules épithéliales, l’endocytose et le relâchement du domaine catalytique
dans le cytosol. Le domaine catalytique est responsable de la monoglucosylation des
GTPases de la famille des protéines Rho et Ras, qui sont impliquées dans la régulation de la
synthèse du cytosquelette d’actine (Dillon et al., 1995). La manifestation phénotypique,
qu’on appelle effet cytopathique, se présente sous forme de la perte d’intégrité cellulaire ce
qui mène à l’apoptose (Just et al., 1995; Voth et Ballard, 2005). Récemment, il a été montré
qu’une autre protéine bactérienne, nommée Srl, stimule l’effet cytopathique des toxines A et
B (Miura et al., 2011).
En plus des toxines A et B, certaines souches de C. difficile produisent une troisième
toxine, appelée toxine binaire CDT. Cette toxine possède une activité d’ADP-ribosylase
causant la dépolymérisation d’actine et la formation de protrusions de microtubules ce qui
augmente l’adhérence bactérienne aux cellules épithéliales (Schwan et al., 2014; Schwan et
al., 2009). Malgré un effet cytopathique démontré sur une lignée cellulaire in vitro et sur un
38
modèle ex vivo, des souches de C. difficile naturellement négatives pour la présence du
PaLoc, mais possédant la toxine binaire CDT peuvent coloniser un modèle animal (hamster)
sans toutefois causer de diarrhées ou autres signes cliniques sévères (Geric et al., 2006).
Mis à part les toxines, d’autres facteurs ont été impliqués dans la virulence de C.
difficile, dont une série de protéines de surface. L’adhésion bactérienne aux cellules
épithéliales représente la première étape d’une colonisation efficace. Chez C. difficile, cette
étape semble dépendre, du moins en partie, des protéines de surface cellulaire de type SLPs
(surface layer proteins) (Calabi et al., 2002; Calabi et al., 2001; Fagan et Fairweather, 2014).
D’autres protéines de surface ont été impliquées dans l’adhésion dont la Cwp66 (Waligora
et al., 2001) ou la FbpA (Barketi-Klai et al., 2011; Hennequin et al., 2003). L’activité de
certaines enzymes hydrolytiques et protéolytiques a également été détectée, mais leur rôle
dans la pathogenèse n’a pas été confirmé (Seddon et al., 1990). De plus, une protéase de
surface, la Cwp84, a été impliquée dans la dégradation des principaux constituants de la
matrice extracellulaire (fibronectine, vitronectine et laminine) de l’épithélium entérique
(Chapeton Montes et al., 2011; Janoir et al., 2007), mais également dans la maturation de
SLPs bactériens (de la Riva et al., 2011; Kirby et al., 2009). Une panoplie d’autres protéines
de surface ont été identifiée dans le génome de C. difficile CD630, notamment grâce à la
présence d’un motif conservé composé d’un signal peptide et de trois domaines d’ancrage
CWB2 (cell_wall_binding_2) (Fagan et Fairweather, 2014). Cependant, pour la grande
majorité de ces protéines, la fonction biologique exacte reste à déterminer.
Récemment, il a été montré qu’une protéine de surface, nommé CwpV, est exprimée
selon un mécanisme de variation de phase (Emerson et al., 2009). La variation de phase est
un mécanisme qui assure une expression protéique hétérogène dans une population
bactérienne provoquant une variation phénotypique observable. Ce type de régulation a été
décrit chez plusieurs espèces bactériennes dont Neisseria meningitidis, Haemophilus
influenzae, Campylobacter jejuni, Escherichia coli etc. et implique des mécanismes et gènes
cibles très variés (van der Woude et Baumler, 2004). En ce qui concerne la variation de phase
des protéines de surface, il est assumé de manière générale qu’une expression hétérogène
favorise l’évasion bactérienne face au système immunitaire de l’hôte, cependant d’autres
fonctions biologiques peuvent être envisagées. Jusqu’à présent, cwpV est l’unique gène chez
C. difficile dont l’expression est sous contrôle d’un mécanisme de variation de phase. Le
39
mécanisme moléculaire sous-jacent implique une recombinase bactérienne, nommé RecV,
qui est responsable de l’inversion d’un segment d’ADN situé à l’intérieur de la région
promotrice de cwpV. La conséquence de cette inversion est la déstabilisation d’un terminateur
transcriptionnel rho-indépendant qui, en temps normal, bloque la transcription de cwpV à
partir d’un promoteur situé en amont (Figure 5, chapitre 2). Ainsi, la région promotrice de
cwpV a toutes les caractéristiques d’un interrupteur génétique : en temps normal, l’expression
de cwpV est inhibée par la présence du terminateur (mode génétique fermé ou OFF), mais
sous l’action de la RecV, cette configuration peut être changée (mode génétique ouvert ou
ON) ce qui permet la transcription du gène. De plus, il a été montré que la recombinase RecV
est en mesure de catalyser la réaction d’inversion dans les deux sens (OFF→ ON et
ON→OFF).
Également, dans l’ensemble d’une population bactérienne, seulement une minorité de
cellules (~5%) vont exprimer activement la CwpV et la grande majorité des cellules (~95%)
sera transcriptionellement silencieuse. Toutefois, les signaux environnementaux qui dictent
l’ouverture ou la fermeture de l’interrupteur génétique ne sont pas encore connus.
Néanmoins, on sait que la protéine CwpV est clivée de manière autoprotéolytique pour être
réassemblée à la surface cellulaire de manière non covalente (Dembek et al., 2011). Le
processus d’exportation est dépendant du système alternatif de sécrétion SecA2 (Fagan et
Fairweather, 2011). Ainsi, la protéine mature est ancrée dans la paroi cellulaire via son
domaine d’ancrage situé dans la partie amino-terminale ce qui expose la partie carboxyterminale vers l’extérieur de la cellule. La partie carboxy-terminale est composée de
répétitions peptidiques qui varient en séquence et en nombre selon les souches. Jusqu’à
présent, cinq différents types de CwpV ont été identifiés basés sur la variabilité de la partie
carboxy-terminale (Reynolds et al., 2011). Même si une surexpression de CwpV à partir d’un
plasmide cause l’agrégation cellulaire, la fonction biologique précise n’a pas encore été
élucidée.
Épidémiologie et évolution de C. difficile
L’incidence des ICDs a été relativement stable durant de nombreuses années.
Cependant, un changement épidémiologique majeur et inattendu a été observé au début de
l’année 2001 caractérisé par une augmentation brusque du nombre de cas de C. difficile. Ce
40
changement épidémiologique, observé en Amérique du Nord et dans certains pays de
l’Europe, a été accompagné par des manifestations cliniques plus sévères chez les patients
ainsi qu’un taux de mortalité plus grand (Kuijper et al., 2006; Pepin et al., 2004). Un typage
moléculaire des souches cliniques en circulation a permis de constater que ce bouleversement
pouvait être attribué à l’émergence d’un clone unique, nommé alors clone BI/NAP1/027
selon les différentes méthodes de typage utilisées (Labbe et al., 2008; Loo et al., 2005;
McDonald et al., 2005). L’observation que ce clone semble produire davantage de toxines in
vitro a mené à l’instauration de l’épithète « hypervirulent » même si cet aspect a été
largement débattu par la suite (Deneve et al., 2009; Razavi et al., 2007; Sirard et al., 2011;
Smits, 2013; Warny et al., 2005). Durant les années post-épidémiques, beaucoup d’études ce
sont penchées sur les causes sous-jacentes qui ont mené à l’émergence du clone hypervirulent
(Coia, 2009; Deneve et al., 2009; He et al., 2010; Phillips et al., 2011; Razavi et al., 2007;
Stabler et al., 2006; Stabler et al., 2009). Suivant les efforts déployés pour caractériser ce
génotype particulier, le génome complet d’un isolat clinique provenant d’un contexte
épidémique a été entièrement séquencé (Figure 5, Chapitre I) (Stabler et al., 2009). L’analyse
du génome a permis de constater des différences notables par rapport au génome de la souche
non-épidémique (CD630). Cette différence génomique englobe 234 gènes encodant des
protéines impliquées dans divers processus métabolique tels que la motilité, la résistance aux
antibiotiques et la toxicité. Cependant, la différence majeure résulte dans l’absence des deux
prophages présents dans la souche non-épidémique (φCD630-1 et φCD630-2) et l’acquisition
d’un nouveau prophage (phi-027). Toutefois, la comparaison génomique n’a pas permis
d’expliquer l’émergence et le succès épidémique du clone hypervirulent. Ultimement, une
acquisition de la résistance aux fluoroquinolones a été identifiée comme élément clé qui a
mené à la dispersion du clone épidémique à travers le monde (He et al., 2012). Toutefois,
cette caractéristique ne peut pas expliquer l’augmentation du taux de mortalité associée au
clone BI/NAP1/027 et donc, l’évolution et l’émergence de clones cliniquement importants
restent un sujet ouvert. Le séquençage massif des génomes de C. difficile a mis en évidence
la grande plasticité génomique et le rôle du transfert horizontal dans l’évolution de ce
pathogène (Brouwer et al., 2012; He et al., 2010; Sebaihia et al., 2006). Par exemple, le rôle
des transposons conjugatifs dans la dissémination des gènes de résistance et la mobilité du
locus de pathogénicité a été examiné récemment (Brouwer et al., 2011) (Brouwer et al., 2013;
41
Brouwer et al., 2012; Corver et al., 2012). À l’inverse, le rôle des phages tempérés dans la
biologie de C. difficile a été relativement peu exploré.
Figure 5. Représentation circulaire comparative entre la souche épidémique R20291 et
les souches non-épidémiques CD196 et CD630. Partant de l’extérieur, le 1er et le 2e cercle
représentent les gènes de la R20291 transcrits en sens horaire et antihoraire
respectivement. Le 3e cercle représente les gènes uniques à la souche CD196 (même
génotype, isolement pré-épidémique). Le 4e cercle illustre les gènes uniques à la CD196
et R20291 par rapport à la CD630. Le 5e cercle représente le pourcentage de G+C avec la
déviation de G+C illustrée sur le 6e cercle (couleur mauve <0%, couleur olive >0%).
Reproduit avec l’autorisation à partir de (Stabler et al., 2009). L’étoile rouge à l’extérieur
des cercles marque approximativement la position du prophage phi-027.
42
Les phages de C. difficile
Les premiers rapports faisant mention des phages de C. difficile remontent au début des
années 1980. Dans un premier temps, leur utilité en tant que méthode de typage a été évaluée
avec un succès partagé (Dei, 1989; Nagy et Foldes, 1991; Sell et al., 1983). Cependant,
l’intérêt envers les phages diminue progressivement suite à l’observation qu’ils ne semblent
pas participer à la transduction des gènes de toxines (Mahony et al., 1985). Suite à ces
premiers rapports, il a fallu attendre près de vingt ans pour que d’autres phages de C. difficile
soient caractérisés (Figure 6, Chapitre I).
Figure 6. Histoire chronologique (1978-2014) des travaux portant sur les bactériophages
de C. difficile. La découverte principale est mentionnée à proximité de la date respective.
Reproduit avec l’autorisation à partir de (Hargreaves et Clokie, 2014).
Dans une première étude datant de 2005, quatre nouveaux phages, obtenus suite à
l’induction de souches lysogènes, ont été décrits (Goh et al., 2005). Leur caractérisation
partielle a confirmé les rapports précédents qui faisaient mention de l’absence du phénomène
de conversion lysogénique. Cependant, la présence de certains des phages à l’état
lysogénique semblait influencer la transcription et la production de toxines A et B chez C.
difficile (Goh et al., 2005). Ces observations ainsi que la publication de la séquence complète
du premier génome de C. difficile qui contenait deux prophages, ont été suffisantes pour
43
rallumer l’intérêt scientifique envers ce groupe de phages (Sebaihia et al., 2006). Sur une
période relativement courte, plusieurs études sur les phages de C. difficile se sont succédées
dont le séquençage et la caractérisation de deux génomes entiers, notamment φC2 et φCD119
de la famille de Myoviridae (Goh et al., 2007; Govind et al., 2006) ainsi que l’isolement et
la caractérisation d’une série de phages tempérés, famille de Myoviridae et Siphoviridae,
provenant de souches cliniques (Fortier et Moineau, 2007). La preuve supplémentaire que
les phages tempérés participent à la régulation de la production de toxines chez C. difficile a
été apportée dans deux études subséquentes. La première étude a montré l’implication d’un
répresseur du phage φCD119 dans l’atténuation de la transcription de l’ensemble des gènes
du PaLoc (Govind et al., 2009). À l’inverse, la deuxième étude a montré une augmentation
de la transcription des gènes du PaLoc et la production accrue des toxines dans le contexte
génétique d’un clone B1/NAP1/027, considéré à la base comme hypervirulent (Sekulovic et
al., 2011). Également, entre ces deux études, la séquence du premier génome de phage de C.
difficile appartenant la famille de Siphoviridae a été publiée (Horgan et al., 2010). De même,
dans une étude subséquente qui a montré que les prophages de C. difficile sont inductibles
dans un contexte d’infection in vivo, deux autres génomes de phages ont été rendus publics
(Meessen-Pinard et al., 2012). S’ensuit une série d’études qui ont permis d’isoler et
partiellement caractériser un nombre considérable de prophages induits à partir de souches
de C. difficile provenant soit d’un contexte clinique (Nale et al., 2012), environnemental
(Hargreaves et al., 2013) ou d’origine animale (Sekulovic et al., 2014). Récemment,
l’implication du phage phiC2 dans la transduction des gènes de résistance aux antibiotiques
a également été démontrée (Goh et al., 2013). De même, la possibilité d’une implication dans
la signalisation de groupe et le contrôle d’expression génique cordonnée (phénomène
bactérien de quorum sensing) a été soulevée suite à la découverte que certains phages
encodent sur leurs génomes des gènes de quorum sensing (Hargreaves et al., 2014).
En résumé, l’histoire des phages de C. difficile est relativement courte avec la très
grande majorité d’études réalisées dans les dix dernières années. Malgré un nombre
considérable d’études exploratoires qui ont démontré l’omniprésence et la fonctionnalité des
prophages dans les souches de C. difficile provenant de diverses sources d’isolement,
relativement peu d’information est disponible quant à l’impact des phages tempérés sur la
biologie de C. difficile. Les récents rapports faisant mention d’une altération au niveau de la
44
production des toxines, du potentiel transducteur ainsi que de l’implication potentielle des
phages au niveau du quorum sensing de l’hôte ont incontestablement prouvé que les phages
de C. difficile participent à la biologie de l’hôte. Le prochain défi sera de déterminer
l’amplitude de cette relation en examinant l’ensemble des interactions possibles, mais aussi
de profiter de la disponibilité des données génétiques autant pour l’hôte que pour les phages.
Les objectifs de la présente étude
La ligne directrice du projet présenté dans ce manuscrit s’inscrit dans cette idée
générale qui consiste à examiner en détail la relation phage-hôte chez C. difficile. Tel que
mentionné précédemment, un nombre considérable de phages de C. difficile ont été décrits
récemment. Étant donné qu’une étude impliquant un grand nombre de phages n’aurait pas
pu permettre un examen détaillé de la relation, un seul couple phage-hôte a été sélectionné
pour l’ensemble de l’étude. Le dévolu a été jeté sur le phage tempéré φCD38-2, isolé par
induction à partir d’une souche clinique de C. difficile (Fortier et Moineau, 2007). Durant
mes travaux de maîtrise, j’ai effectué une caractérisation microbiologique approfondie de ce
phage. Cet aspect couvrait, entre autres, la détermination de la morphologie des virions par
microscopie électronique, sa dynamique d’infection, le spectre d’hôte sur plus de 200 isolats
cliniques, l’identification des protéines structurales par spectrométrie de masse et le
séquençage du génome entier. De plus, j’ai montré que ce phage était en mesure d’influencer
positivement la production de toxines lorsque présent sous forme de prophage dans une
souche d’intérêt clinique (Sekulovic et al., 2011). Le manuscrit découlant de ces travaux est
présenté en Annexe I.
Du côté de l’hôte, la souche bactérienne sélectionnée était également un isolat
épidémique de type BI/NAP1/027 appelée R20291. Cette souche comportait plusieurs
avantages dont son intérêt clinique, une sensibilité à l’infection par φCD38-2, possibilité de
manipulation génétique et la disponibilité de la séquence génomique entière ainsi que d’une
annotation manuelle complète (Stabler et al., 2009).
Le premier objectif consistait à utiliser une approche très large pour tenter de saisir
l’ensemble des interactions possibles entre le φCD38-2 et la souche de C. difficile R20291.
Afin de mener à bien ce premier objectif, j’ai voulu examiner les changements
transcriptomiques associés à la lysogénie du φCD38-2 lorsque la souche bactérienne est
45
soumise aux conditions de culture standards au laboratoire. Cet objectif devait répondre
directement à la question quant à savoir quels sont les gènes bactériens affectés au niveau
transcriptionnel en présence du prophage. De cette manière, nous aurions une vue globale
des interactions possibles au niveau du transcriptome.
Le deuxième objectif découle directement du précédent. En fonction des résultats
obtenus suite à l’accomplissement du premier objectif, il s’agit de faire la caractérisation fine
en fonction de certains gènes ou groupes de gènes en particulier. Certes, il est difficile à
prévoir à quel degré la présence du phage affectera le transcriptome bactérien, mais si on se
base sur les études précédentes, cette altération devrait être relativement limitée. Cet objectif
permettra de caractériser plus en profondeur un aspect particulier de la relation phage-hôte
et par le fait même de nous indiquer les mécanismes moléculaires qui peuvent
potentiellement s’appliquer à d’autres phages de la même famille.
Finalement, le troisième objectif consistait à examiner les implications biologiques des
relations observées préalablement. Cet objectif est important dans la mesure où il permettra
d’évaluer l’impact biologique véritable qui repose sur cette relation phage-hôte chez C.
difficile.
46
CHAPITRE II
ARTICLE 1
Global Transcriptional Response of Clostridium difficile Carrying the ϕCD38-2
Prophage
Auteurs de l’article: Ognjen Sekulovic, Louis-Charles Fortier
Statut de l’article: publié : Sekulovic, O. and L. C. Fortier (2014) "Global Transcriptional
Response of Clostridium difficile Carrying the ϕCD38-2 Prophage" Appl Environ Microbiol,
pii: AEM.03656-14.
Avant-propos: Ce manuscrit englobe les résultats obtenus durant la première partie de mes
travaux de recherche dans le cadre de mes études de 3e cycle. Notre motivation première
consistait à faire suite à mes travaux de maîtrise durant lesquelles j’ai démontré qu’un phage
particulier de C. difficile, appelle phiCD38-2, était en mesure d’influencer la transcription
des gènes de toxines tcdA et tcdB (Sekulovic et al., 2011). Dans le présent manuscrit, nous
avons voulu évaluer l’impact global de la lysogénie du phiCD38-2 sur le transcriptome total
d’un isolat épidémique de C. difficile (R20291). L’article a été accepté pour publication le 7
décembre 2014 dans le journal « Applied and Environmental Microbiology ». Ma
contribution englobe l’ensemble des expériences effectuées et présentées dans cet article,
sous les conseils et la supervision de mon directeur de thèse, Pr Louis-Charles Fortier. Ma
contribution dans l’écriture du manuscrit est également majeure, puisque j’ai rédigé la
version initiale qui a été revue, corrigée et soumise pour publication par Pr Louis-Charles
Fortier.
Note au lecteur : Compte tenu de la quantité de données présentées dans les tables S1, S2 et
S3, nous les avons exclues du présent ouvrage mais elles sont disponibles pour
téléchargement sur le site internet du journal «Applied and Environmental Microbiology ».
47
Résumé : Les récentes analyses ont montré que les prophages sont omniprésents dans les
génomes de Clostridium difficile, et certains d'entre eux, comme le phiCD38-2 et le
phiCD119, peuvent influencer l'expression des gènes encodant des toxines TcdA et TcdB,
considérées comme de principaux facteurs de virulence. Cependant, très peu d’informations
sont disponibles quant à l’impact global des prophages sur la biologie de ce pathogène
entérique. Afin de combler cette lacune, nous avons mis à profit la technique de séquençage
d’ARN à haut débit (ARN-seq) afin d’analyser le transcriptome global d’une souche
épidémique de C. difficile (R20291) portant le prophage phiCD38-2 sous forme d’un épisome
non-intégratif stable. Au total, 39 gènes bactériens ont été exprimés de manière différentielle
dans la souche R20291 lysogène dont 26 d'entre eux étant régulés à la baisse. Plusieurs de
ces gènes encodent des régulateurs transcriptionnels et des systèmes de phosphotransférase
(PTS) impliquée dans le métabolisme du glucose, fructose et sorbitol. La présence du
phiCD38-2 avait également comme conséquence une augmentation de l'expression d'un
groupe de gènes faisant partie du Phi-027, un prophage résident commun à la plupart des
isolats du ribotype 027. Toutefois, le gène présentant la plus grande altération
transcriptionnelle en présence du phage (augmentation d’environ 20 fois) est le cwpV. Ce
gène, exprimé selon un mécanisme de variation de phase, encode une protéine de surface,
CwpV, conservée dans toutes les souches de C. difficile analysées jusqu’à présent. Une
analyse d’expression en PCR quantitative en temps réel a montré que l’augmentation
d’expression en présence du phage phiCD38-2 était due à une plus grande proportion de
cellules qui expriment activement le gène. Ainsi, 95% des cellules lysogènes expriment cwpV
contre seulement 5% des cellules de la souche sauvage. Également, nous avons démontré que
ce phénotype provenait d’une plus grande fréquence de recombinaison de l’interrupteur
génétique qui contrôle l’expression du gène cwpV. De plus, nous avons confirmé que cet effet
était dépendant de la recombinase RecV encodée par l’hôte. En résumé, cette étude a mis en
évidence l’implication du phage phiCD38-2 dans le mécanisme de variation de phase
permettant l’expression variable de la protéine de surface CwpV ainsi que son implication
dans l'expression de divers opérons métabolique.
48
Global Transcriptional Response of Clostridium difficile Carrying
the phiCD38-2 Prophage
Ognjen Sekulovic, Louis-Charles Fortier#
Département de microbiologie et d’infectiologie, Faculté de médecine et des sciences de la
santé, Université de Sherbrooke, Pavillon de recherche appliquée sur le cancer, Sherbrooke,
Québec, Canada
Running Head: Transcriptional response of a C. difficile lysogen
#Address correspondence to Louis-Charles Fortier, [email protected]
49
Abstract
Clostridium difficile is one of the most dangerous pathogens in hospital settings. Most strains
of C. difficile carry one or more prophages and some of them, like ϕCD38-2 and ϕCD119,
can influence the expression of toxin genes. However, little is known about the global host
response in the presence of a given prophage. In order to fill this knowledge gap, we used
RNA-seq to conduct a genome-wide transcriptomic analysis of the epidemic C. difficile strain
R20291 carrying the ϕCD38-2 prophage. A total of 39 bacterial genes were differentially
expressed in the R20291 lysogen, 26 of them being downregulated. Several of the regulated
genes encode transcriptional regulators and PTS subunits involved in glucose, fructose and
glucitol/sorbitol uptake and metabolism. ϕCD38-2 also upregulated the expression of a group
of regulatory genes located in phi-027, a resident prophage common to most ribotype 027
isolates. The most differentially expressed gene was that encoding the conserved phasevariable cell wall protein CwpV, which was upregulated ~20-fold in the lysogen.
Quantitative PCR and immunofluorescence showed that the increased cwpV expression
results from a greater proportion of cells actively transcribing the gene. Indeed, ~95% of
lysogenic cells express cwpV as opposed to only ~5% of wild type cells. Furthermore, the
higher proportion of cells expressing cwpV results from a higher frequency of recombination
of the genetic switch controlling phase variation, which we confirmed to be dependent on the
host-encoded recombinase RecV. In summary, ϕCD38-2 interferes with phase-variation of
the surface protein CwpV and the expression of metabolic genes.
Introduction
Bacteriophages (or simply phages) are the most abundant biological entities in the biosphere
(1). Temperate phages have the ability to kill their host via a lytic replication cycle, but they
can also establish a stable parasitic relationship with their host through a lysogenic cycle (2).
Some phages like λ will integrate into the chromosome of their host via the expression of a
phage-encoded integrase, while other prophages like c-st and N15 will be maintained as selfreplicating circular or linear plasmids that will be partitioned into dividing cells (3, 4). The
maintenance of lysogeny has been extensively studied in λ and relies on the expression of a
limited number of phage genes. For example, the CI repressor is constitutively expressed at
50
low levels and plays a central role by repressing the initiation of transcription of lytic genes,
thereby maintaining the prophage in a quiescent state (5).
In principle, only a few genes should be required to maintain lysogeny and therefore, most
of the remaining prophage genome should be silent. Several studies in Lactobacillus,
Bifidobacterium and Streptococcus thermophilus support this (6-9). However, prophages are
not always completely silent and their transcriptional activity may depend on the growth
conditions (10). In addition, several prophages encode “extra genes” that are expressed
independently from the prophage regulatory circuits (11-13). In some cases, such genes
encode powerful toxins and other fitness and virulence factors (13, 14). A classic example is
the bor and lom genes in λ, encoding two outer membrane proteins conferring resistance to
animal serum (15, 16). Another good example is the botulinum toxin encoded by Clostridium
botulinum phages CEβ and CEϒ (17). Yet, some phages express membrane-associated or
periplasmic proteins such as Imm encoded by the Escherichia coli phage T4 (18) or LTP
encoded by the S. thermophilus phage TP-J34 (19) that function as phage superinfection
exclusion systems (for a review see (1, 20)).
Phage-host interactions have been extensively studied in E. coli and other species during a
productive lytic infection and multiple proteins have been shown to interfere with
transcription, translation or DNA replication (2, 21-25). On the other hand, the study of
phage-host interactions during lysogeny, and the influence of prophages on host genes have
not been investigated extensively (3, 4, 25, 26). A recent study described the response of
Lactococcus lactis to lysogenization with phage Tuc2009 (25). Several genes were
downregulated by Tuc2009, in particular genes encoding proteins involved in nucleotide
biosynthesis and amino acid metabolism, as well as transcriptional regulators. The λ CI
repressor was found to bind the promoter region upstream of the pckA gene encoding a
phosphoenolpyruvate carboxykinase required for gluconeogenesis in E. coli, thereby causing
a reduction in bacterial growth (27). In Bacillus anthracis, certain prophages were shown to
express alternative sigma factors that stimulate biofilm formation and inhibit sporulation,
thus profoundly affecting the lifestyle and the capacity of B. anthracis to survive in various
harsh environments (28).
Clostridium difficile is an important human pathogen causing severe diarrhea and leading to
pseudomembranous colitis. It is currently one of the most dangerous pathogens in hospitals
51
(29). Toxigenic strains produce two main exotoxins, TcdA and TcdB, encoded on a ~19.6kb pathogenicity locus (PaLoc) (30). Most strains of C. difficile analyzed to date carry one
or more integrated prophages (31-36) and a limited number of genome sequences from
characterized temperate phages are available in public databases (37-44). Of note, none of
them seem to encode virulence factors or toxins, although recent studies suggest that some
of them might influence the lifestyle and virulence of C. difficile. For example, the RepR
repressor encoded by ϕCD119 binds the regulatory region upstream of the alternative sigma
factor TcdR controlling toxin gene expression. Hence, in a lysogen carrying ϕCD119,
transcription of tcdA and tcdB is reduced (45). More recently, phage phiCDHM1 was found
to encode three homologs of bacterial genes involved in quorum sensing, AgrB, AgrC and
AgrD, and transcriptional analysis showed that agrB and agrC were transcribed during
lysogeny (41). This suggests that prophages of C. difficile can express genes that possibly
affect whole bacterial populations.
In a previous study (39), we have shown that lysogenization of certain strains of C. difficile
with ϕCD38-2 causes an increase in toxin production. In the present study, we describe the
global transcriptional response of C. difficile in a stable lysogen carrying the ϕCD38-2
prophage. Using high-throughput RNA sequencing (RNA-seq), we determined the whole
transcriptome of a R20291 lysogen carrying ϕCD38-2, and compared it to the wild type nonlysogenic strain. We show that some prophage regions were highly transcribed, and several
bacterial genes were differentially expressed in the presence of ϕCD38-2.
Materials and Methods
Bacterial strains and growth conditions. The Clostridium difficile strain used in this study
was R20291, a recent epidemic ribotype 027 clinical isolate kindly given by Trevor Lawley
from the Sanger Institute, UK. This strain was used to create a stable lysogen carrying the
temperate phage ϕCD38-2 using a procedure described previously (39). Briefly, appropriate
dilutions of a C. difficile R20291 culture were plated on top of a BHI soft agar overlay
containing >108 phages/mL of ϕCD38-2 and 10 mM each of MgCl2 and CaCl2. After
overnight incubation, most of the colonies that grew were lysogens and carried the
corresponding prophage, which was confirmed by PCR using phage-specific primers and by
inducing the prophage with mitomycin C or UV light (39). One lysogen was further selected
for transcriptome analysis. C. difficile and all derivative strains were routinely grown at 37°C
52
in pre-reduced tryptose-yeast extract (TY) broth under anaerobic atmosphere (10%
hydrogen, 5% CO2 and 85% nitrogen) inside an anaerobic chamber (Coy Laboratories).
RNA extraction. Bacteria from R20291 (wild type) and the R20291LYS (lysogen) were grown
in TY broth until they reached the exponential phase of growth (optical density at 600 nm,
OD600 = 0.5). Then, 0.4 mL of this pre-culture was used to inoculate 40 mL of fresh TY
broth and the culture was allowed to grow for 12 h, corresponding to early stationary phase.
At this point, 10 mL of the culture was removed and immediately mixed with 10 mL of icecold 1:1 ethanol-acetone mixture to stabilize the RNA. Cells were centrifuged at 3200 x g
for 10 min, and the bacterial pellet was suspended in TRIzol reagent (Invitrogen) and stored
at -80°C until use. A second independent biological replicate was performed the same way
on a different day. Total RNA was extracted and processed as described before (39). Briefly,
bacterial suspensions in TRIzol were thawed on ice and combined with 0.5 g of acid-washed
glass beads (106 μm, Sigma). Samples were processed in a FastPrep apparatus (MP
Bioscience) for 45 sec at 4m/s with a 5 min pause on ice and the treatment was repeated. The
standard RNA extraction protocol from Invitrogen was then followed. The RNA pellet was
solubilized in RNase-free water (Wisent) and the RNA concentration was determined on a
NanoDrop apparatus (BioTek). Aliquots of 10 μg of total RNA were treated with RNase-free
Turbo DNase (Ambion) following the manufacturer’s instructions. The absence of DNA
contamination was verified by real-time quantitative PCR (qPCR) using 200 ng of total RNA
and PCR primers targeting the 16S rRNA gene as previously reported (39) (Supplementary
Table S5). RNA integrity was assessed with an Agilent 2100 BioAnalyzer (Agilent
Technologies) through the RNomic platform of the Université de Sherbrooke (LGFUS.ca).
53
Supplementary Table S5. Primers used in this study.
Target
16S rRNA
rpoA
CDR20291_0210
CDR20291_0440
CDR20291_0694
CDR20291_1425
CDR20291_2862
φCD38-2_gp30
Phi-027 attPP’
Phi-027 attBB’
cwpV ON form
cwpV OFF form
Sequence
Product
(5’- 3’)
size (bp)
Strand
Primer
Fwd
LCF 408
GGGAGACTTGAGTGCAGGAG
Rev
LCF 409
GTGCCTCAGCGTCAGTTACA
Fwd
LCF 769
TCATTACCAGGTGTAGCAGTGAATGC
Rev
LCF 770
TGATAGAGCATGGTCCTTGAGCTTCT
Fwd
LCF 899
AGGGGAAAAGTGCAACTCTTTTAGGAA
Rev
LCF 890
AACCGCCACCTAGTTCATCTGCA
Fwd
LCF 891
GCACTAGCAGTAGGTGTATTAGGTGC
Rev
LCF 892
TGCTGTCTCATTACCATTCCCACC
Fwd
LCF 893
AGCTCAGATAGTGGGGGTATTGGT
Rev
LCF 894
TCAGGTTCAGCTTCTGCAAGACC
Fwd
LCF 895
TGGAGAACCTAAACAACTCACGCC
Rev
LCF 896
AGCTCTCTGCCTACCATATATTTTCCCA
Fwd
LCF 897
CAGTATCTTTCCCACCTTCAACGCT
Rev
LCF 898
GCGAAGGTTTTGAGGCATTGGTG
Fwd
LCF 316
CTTGTCTGCTGAAATGCTCTTTAGT
Rev
LCF 317
AGAGCTATCACCTTTACCAGCCAG
Fwd
LCF 890
GAAGCTACCTAGAAGGAAGGTATTT
Rev
LCF 889
AGACATGCACATGCTACTCTATT
Fwd
LCF 887
CCTATTGTAGCACCTAATGATGCATTGGAA
Rev
LCF 898
CACCCAACTGTTCTTGCATTAAA
Fwd
LCF 801
GGTAAGTTTGATTTTTATGTTAATGAATTG
Rev
LCF 714
CAGTTTGTGCACTAGCTATGCCTGC
Fwd
LCF 796
CGCAATTATTTGTTTTTCATATGGATAAAATTGG
Rev
LCF 797
GATTTTTATGTTAATGAATTGTTATAAAAAACATGG
120
183
146
146
149
126
191
463
824
346
223
163
cDNA library construction and RNA sequencing. Library construction and RNA
sequencing were performed at the Génome Québec Innovation Centre of McGill University
(Montréal, QC, Canada). Briefly, 4 μg of total RNA from two independent biological
replicates of R20291 and R20291LYS were treated with Ribo-Zero™ rRNA Removal Kit for
Gram-Positive Bacteria (Epicentre Biotechnologies). Residual RNA was cleaned up using
RiboMinus™ Concentration Module columns (Invitrogen) and eluted directly in the
Elute/Frag/Prime buffer of the Illumina TruSeq RNA Sample Preparation Kit v2. The
remaining of the protocol has been performed as per the manufacturer’s recommendation,
54
except that cDNA was sheared on a Covaris instrument. Libraries were quantified using the
Quant-iT™ PicoGreen® dsDNA Assay Kit (Life Technologies) and the Kapa Illumina GA
with Revised Primers-SYBR Fast Universal kit (D-Mark). Average size fragment was
determined using a 2100 Bioanalyzer (Agilent Technologies) instrument. cDNA libraries
were multiplexed on a single sequencing lane and sequenced on a HiSeq2000 system (Kapa
Biosystems) for 50 cycles yielding single-end 50 nucleotide reads. Fastq files were generated
using HCS v1.5 and BclToFastq.
Alignment of sequenced reads and bioinformatics analyses. The overall quality of raw
sequencing data was first verified with the FastQC program v10.1. Reads from two R20291
wild type libraries were then aligned to the R20291 reference genome sequence (NCBI
RefSeq: NC_013316.1). Likewise, libraries from the R20291LYS were aligned on the R20291
reference sequence, as well as on the ϕCD38-2 genome sequence (NCBI RefSeq:
NC_015568.1). Alignments were performed with Bowtie2 version 2.1.0 (46) with default (-end-to-end) alignment mode and by specifying --sensitive as additional parameter. By
default, all reported reads were stored under SAM file format. Reads that mapped only once
to the genome (uniquely mapping reads) were extracted from SAM files by filtering for the
'XS:' tag used by bowtie2 for reporting secondary alignments for a given read. Only uniquely
mapped reads stored under SAM file format were used for the subsequent operations. For
visualization of transcriptional activity across the genome, SAM files were converted to
corresponding binary format (BAM files) with SAMtools version 0.1.19 (47) and viewed
with Artemis version 15 (48). For differential expression analysis and RPKM (Reads Per
Kilobase per Million mapped reads) calculations, uniquely-mapped reads were sorted with
htseq-count command from HTSeq package version 0.5.4 (49) with the following
parameters: -m intersection-nonempty -s no -t gene -i locus_tag. This step aimed at producing
a matrix composed of raw read counts per gene for each library. The matrix of read counts
was then utilized for manual RPKM calculations using the following formula: RPKM =
(10^9 * C)/(N * L), where C = number of reads mapped to a gene, N = total mapped reads in
the experiment inferred from HTSeq matrix, L = gene length in base pairs. RPKM values
have been calculated for both wild type libraries and the arithmetic mean has been used. The
matrix of read counts was also used in DESeq2 package (50) for differential expression
analysis and statistical comparison between wild type and lysogen transcriptomes. Genes
55
were considered differentially expressed if fold change (FC) ≥ 1.75 and corresponding
adjusted p-value (padj) ≤ 0.05. Raw sequencing files have been deposited in the NCBI Gene
expression Omnibus (GEO) database under the accession number GSE56818.
Validation of RNA-seq expression data by RT-qPCR. Differential expression determined
by RNA-seq was validated by real-time reverse-transcriptase qPCR (RT-qPCR) through a
service provided by the RNomic platform of the Université de Sherbrooke (LGFUS.ca). Five
differently expressed genes, located in different operons were chosen for the analysis. cDNA
synthesis was performed with SuperScript III (Life Technologies) according to the
manufacturer’s instructions on 1 μg of RNA from the two independent assays used for RNAseq, plus a third independent replicate. qPCR reactions were performed in 10-µL reactions
on a CFX-96 thermocycler (BioRad) with 5 μL of 2X iTaq Universal SYBR Green Supermix
(BioRad), 10 ng of cDNA, and 200 nM of primers. The following cycling conditions were
used: 3 min at 95°C, 50 cycles: 15 sec at 95°C, 30 sec at 60°C, 30 sec at 72°C. The relative
expression level was calculated using the ΔΔCt method with rpoA as the housekeeping gene
(NCBI Gene ID: 8470231). Primer design and validation was performed by the RNomic
platform as described elsewhere (51). All primer sequences are available in Supplementary
Table S5.
Pulsed-Field Gel Electrophoresis and Southern blotting. Pulsed-field gel electrophoresis
was performed as previously described (52) with modifications. Briefly, 3 mL of
exponentially grown bacterial cultures (DO600 = 0.4 – 0.8) were centrifuged, washed once
in cell suspension buffer (0.18M NaCl, 10 mM Tris pH 8.0) and adjusted to 109 CFU/mL in
the same buffer. Cells were mixed with an equivalent volume of warm 1.5% Seakem Gold
agarose and poured in plug molds. Solidified agarose plugs were transferred in 1.5-mL
eppendorf tubes and incubated overnight at 37°C in cell lysis buffer (10 mM Tris pH 8.0, 0.5
M EDTA, 1% SDS) supplemented with 0.1 mg/mL of proteinase K. Following proteinase K
treatment, plugs were extensively washed in TE2 buffer (10 mM Tris, 2 mM EDTA, pH 8.0)
and incubated overnight at ambient temperature in 1X SureCut buffer supplemented with 15
U SmaI (New England Biolabs). The next day, plugs were loaded into wells of a 1% Seakem
Gold agarose gel along with lambda low-range PFGE marker (New England Biolabs) and
run in 0.5X TBE buffer (Tris-Borate-EDTA, pH 8.0) in a CHEF-DR-II apparatus (Bio-Rad
56
Laboratories). The migration conditions were: 15 h at 14°C, 6V/cm with a pulse ramp of 513 sec. Following migration, the gel was stained with ethidium bromide and visualized under
UV lights and photographed using an ImageQuant 300 gel documentation system (GE
Healthcare). DNA fragments were then transferred onto positively charged nylon membranes
(Roche) using standard Southern protocols (53). Southern blot hybridizations were
performed as described previously (32), with digoxigenin (DIG)-labeled probes consisting
of a PCR product covering the ϕCD38-2_gp30 (39).
Cell surface protein extraction and SDS-PAGE. C. difficile cell surface proteins were
glycine-extracted as previously described (54) with minor modifications. Briefly, 10 mL of
stationary-phase cells grown in TY broth were harvested and washed once in PBS. The
bacterial pellet was suspended in 0.2 mL of 0.2 M glycine pH 2.2 and incubated 30 min at
room temperature. Cells were harvested by centrifugation for 5 min at 10 000 x g and the
supernatant containing the cell surface proteins was neutralized by the addition of 30 µL of
1 M Tris-HCl pH 8. Thirty-microliter samples were analyzed by 10% polyacrylamide gel
electrophoresis in denaturing conditions (SDS-PAGE) followed by Coomassie blue staining
(53). Mass spectrometry was performed on excised bands through a service available at the
Université de Sherbrooke.
Immunofluorescence detection of CwpV. Immunofluorescence was used to visualize the
expression of the CwpV protein at the surface of bacterial cells. Briefly, bacteria from 1 mL
of an overnight culture in TY broth were collected by centrifugation and suspended in 0.5
mL of PBS + 1% BSA blocking buffer and incubated for 30 min, followed by 2 hours of
incubation with a rabbit anti-CwpVrptII antibody kindly provided by Neil Fairweather
(London, UK) (55) diluted 1:100 in the same buffer. Following extensive washing in PBS,
bacterial cells were incubated for 45 minutes with a secondary Alexa Fluor® 568 donkey
anti-rabbit IgG (H+L) antibody (Life Technologies) followed by extensive washing in PBS.
Finally, cells were suspended in 50 µL of Nanopure water, spotted on glass slides and
visualized with an Olympus IX-81 fluorescence microscope (Olympus) equipped with a
QColor3 CCD camera.
Quantitative PCR analysis of the ON/OFF cwpV genetic switch. Quantitative real-time
PCR (qPCR) was used to quantify the proportion of bacteria with the cwpV genetic switch in
57
the “ON” or “OFF” configuration. Primer pairs LCF 796/797 and LCF 714/801were used to
quantify the OFF and ON configuration, respectively. Primers LCF 769 and LCF 770
targeting the rpoA housekeeping gene were used as the internal reference for ΔCt
determination. Primer concentrations and cycling conditions were optimized in order to reach
high and as close as possible PCR amplification efficiencies (E). The final conditions were
100 nM of primers targeting the OFF switch configuration and the rpoA gene (E = 91% and
97%, respectively), and 200 nM of primers targeting the ON switch configuration (E = 95%).
KAPA SYBR® FAST Universal 2X qPCR Master Mix (Kapa Biosystems) was used
following the manufacturer’s recommendations in a total volume of 10 µL. The DNA
template consisted of 100 ng of purified genomic DNA from a 12-h culture of C. difficile in
TY broth. Amplifications were carried out in an Eppendorf Mastercycler® ep realplex PCR
thermal cycler with the following cycling conditions: initial denaturation of 3 min at 95°C
followed by 35 cycles of 15 sec at 95°C and 1 min at 60°C. The ΔΔCt method was used to
calculate the ratio of ON versus OFF configurations.
Gene inactivation using the ClosTron system. The recV gene was inactivated by insertion
of a group II intron using the ClosTron system (56) as described previously using the same
integration site (424/425s) (55). Synthesis and cloning of the retargeted intron was done by
DNA2.0 (CA, USA).
Results
Creation of a R20291 lysogen carrying the ϕCD38-2 prophage
Current data on the impact of prophages on the lifestyle and virulence of C. difficile are very
limited. In order to fill this knowledge gap, we performed whole transcriptome analysis of
the epidemic ribotype 027 strain R20291 and a lysogenic derivative carrying the ϕCD38-2
prophage, R20291LYS. We previously showed that the ϕCD38-2 prophage does not integrate
into the chromosome of its host, despite the presence of a putative phage integrase gene (39).
We confirmed that this was also the case in strain R20291 using pulsed field gel
electrophoresis (PFGE) and Southern blot hybridization (Supplementary Figure S1).
58
Supplementary Figure S1. Maintenance of the ϕCD38-2 prophage as a plasmid. A) Whole
bacterial DNA from R20291 and R20291LYS was digested with SmaI, which does not cut the
ϕCD38-2 genome, run through a 1% low-melting agarose gel (PFGE) along with Low Range
PFGE Marker (M), and B) hybridized with a DNA probe specific for ϕCD38-2_gp30. A
single band co-migrating with the one corresponding to purified phage DNA was observed
in the lysogen, confirming that ϕCD38-2 was maintained as a plasmid in R20291LYS;
otherwise the prophage genome would have co-migrated with one of the SmaI fragments
from the bacterial chromosome.
Overview of the transcriptomic data in R20291 and R20291LYS
RNA-seq was performed with Illumina HiSeq on two independent replicate cultures of the
R20291 and R20291LYS grown to early stationary phase (OD600 = 1.0). A summary of the
RNA-seq data is presented in Table 1 and the complete transcriptomic data for R20291 and
R20291LYS is reported in Supplementary Table S1.
59
Table 1. Summary of RNA-seq data
1Total
reads
2Total
aligned reads
3Uniquely
4rRNA
1
aligned reads
reads
R20291
R20291
R20291LYS
R20291LYS
replicate 1
replicate 2
replicate 1
replicate 2
61,402,323
52,482,242
37,334,968
43,250,916
59,920,394
49,932,146
36,281,251
41,753,166
97.59%
95.14%
97.17%
96.54%
50,993,115
48,142,550
35,393,073
40,691,760
83.05%
91.73%
94.80%
94.08%
5,712,006
110,808
79,057
87,322
9.30%
0.18%
0.21%
0.20%
Sequencing depth expressed as total, raw, untrimmed number of reads obtained from
Illumina HiSeq sequencing run. 2Total number of reads that aligned to the reference genome.
3
Number of reads that mapped only once to the reference genome. 4Number of reads that
aligned on multiple 5S, 16S and 23S rRNA regions on the reference genome. Percentage
values are based on the number of total reads for each library.
A plot presenting the relative expression of all C. difficile genes in the lysogen versus the
wild type R20291 strain is presented in Figure 1.
locus_tag of R20291
6
5
4
log2 FC
(relative to R20291)
3
2
1
0
-1
-2
-3
0
500
1000
1500
2000
2500
3000
3500
60
Figure 1. Dot plot of differential gene expression between R20291 and R20291LYS. Each
dot corresponds to a single gene. Genes are shown along the horizontal axis in reference to
their locus tag, which is indicated on the top horizontal scale. The log2 fold change in
expression relative to that in wild-type R20291 is presented on the y axis. The horizontal
dotted lines indicate the 1.75-fold change cutoff range that was used in the analysis. Genes
that were differentially expressed with a Padj of ≤ 0.05 are colored in red, and those that are
not significantly different are colored in blue. The average fold change and the corresponding
names(s) and locus tag are indicated next to relevant genes.
Visual inspection of transcriptional activity was also done by loading directly into the
Artemis program the reads alignments along with the corresponding reference sequences (the
R20291 or ϕCD38-2 genome). The relative gene expression within each library was
evaluated using RPKM values (i.e. Reads Per Kilobase per Million mapped reads) as reported
in Methods. RPKM values were used to arbitrarily separate genes into low (0 ≤ RPKM < 10),
moderate (10 ≤ RPKM < 100), high (100 ≤ RPKM < 1000) and very high (RPKM ≥ 1000)
expression profiles. Total absence of expression (RPKM = 0) was detected for only 15 genes.
The majority (2676/3560, 75.2%) of genes were either within the low (N = 1008) or moderate
(N = 1668) expression groups. Finally, the remaining 874 genes were classified either as
highly (N = 750) or very highly (N = 124) expressed. Genes involved in core metabolic
processes, and those encoding the TcdA and TcdB toxins were among the very highly
expressed ones. Taken altogether, the mean RPKM value for all genes (N = 3560, excluding
rRNA and tRNA and including novel genes from phi-027, see below) was 279 for R20291,
and 285 for R20291LYS. It is noteworthy to mention that since very high and very low RPKM
values were observed for a number of genes, we calculated the median RPKM value, which
is 31 for R20291 and 30 for R20291LYS, and which better reflects the actual dispersion of the
data. Overall, global transcriptomic profiles of both R20291 and R20291LYS were similar,
except for a number of genes whose expression was differentially expressed in the lysogen
(see below).
61
Transcriptome of the ϕCD38-2 prophage
RNA-seq data with the R20291LYS enabled us to draw a global transcriptomic portrait of the
newly introduced ϕCD38-2 (Figure 2).
6000
800
4000
600
2000
400
200
1000
750
500
250
Figure 2. Transcription profiles of temperate phages φCD38-2 and phi-027. Genes are
represented by arrowhead boxes and colored according to their putative function. Some of
the genes are numbered to facilitate orientation on the map and in reference to the tables. The
density of sequence reads is plotted above each map, and the vertical scales indicate the
absolute number of reads. A different scale is presented for φCD38-2 to account for highly
transcribed regions relative to the rest of the genome.
Gene expression was observed across the whole phage genome and seemed to be slightly
higher than most of the bacterial genes, with mean and median RPKM values for the whole
prophage of 134 and 70, respectively (Table S2). As a comparison, the mean RPKM value
for the whole bacterial transcriptome was 285, but the median was 30. These data suggest a
certain degree of spontaneous prophage induction within a subset of the bacterial population,
which we confirmed to correspond to phage titers around 5-log PFU/mL (data not shown).
62
One region spanning ϕCD38-2_gp24-34 that we previously identified as a putative lysogenic
conversion region (39) was expressed to higher levels, with mean and median RPKM values
of 423 and 167, respectively (Figure 2). For example ϕCD38-2_gp28 encoding a putative
protein of unknown function was highly expressed with an RPKM value of 550. Likewise,
ϕCD38-2_gp33 and gp34 encoding a putative membrane-associated and a secreted protein,
were also very highly expressed, with RPKM values of 1784 and 1280, respectively. In
summary, our data show that some regions of the ϕCD38-2 prophage and in particular a
putative lysogenic conversion module are more actively transcribed than others, suggesting
that it is not completely silent during the lysogenic cycle.
Transcriptome and re-annotation of the endogenous phi-027 prophage
The R20291 strain used in this study already carries an integrated prophage in its genome,
phi-027. This prophage is highly conserved across ribotype-027 isolates and is present in the
majority of 027 isolates sequenced to date (57, 58). In the R20291 genome sequence, the phi027 prophage annotation initially comprised 50 putative genes (CDR20291_1415-1465)
(57). Our transcriptome analysis revealed several transcribed regions that were not annotated
and upon closer analysis, we were able to identify 20 additional putative genes in the phi027 prophage. The phi-027 prophage re-annotation is detailed in Supplementary Table S3,
with a suffix letter indicating the newly annotated genes. Using PCR primers flanking the
putative bacterial integration site and prophage boundaries, we were able to detect PCR
products corresponding to the excised prophage as well as the regenerated bacterial
integration site. Sequencing of the PCR products allowed determination of the integration
site (Figure S2). Both products were detected in bacteria grown under normal conditions and
after mitomycin C treatment, confirming the functionality of the phi-027 prophage in
R20291, and showing that spontaneous prophage induction occurred.
63
5’ TTTAGAATAGTATTACAACTTAAGTAAATA TTAAGTTTTA 3’
5’ TTTAGAATAGTATTACAACTTAAGTAAATA ATAATTTTGA 3’
5’ TTTAGAATAGTATTACAACTTAAGTAAATA TTAAGTTTTA 3’
5’ CCTAGAATAATATTACAACTTAAGTAAATA TTAAGTTTTA 3’
Supplementary Figure S2. phi-027 prophage integration site and excision. A) Schematic
representation of the integrated phi-027prophage. Bacterial and prophage genes are identified
with grey and red arrowhead boxes, respectively and the corresponding locus_tag
identification is shown beneath each gene. The left (attL) and right (attR) attachment sites
are indicated with black boxes. The relative position of the primers used to detect the circular
form of phi-027 and the regenerated empty bacterial integration site is indicated with black
arrows. B) Representation of the phi-027 circular form generated upon excision and showing
the attP, along with the empty bacterial site showing the attB. C) Detection in 2% agarose
gel of the PCR products corresponding to the attB and attP sites. M, molecular weight
marker; lanes 1 and 3, attB and attP amplified from standard culture; lanes 2 and 4, attB and
attP amplified from cultures induced with 1 μg/ml mitomycin C; NTC, no template control
D) DNA sequences of the attL and attR sites, along with the empty bacterial site (attB) and
the attP site from the circular prophage. Nucleotides in black correspond to the conserved
core sequence of the integration site, nucleotides in grey and red represent bacterial and phage
sequences, respectively.
64
We used the DESeq2 package with an adjusted p value (padj) ≤ 0.05 as the cut-off to identify
genes that were differently expressed in the R20291LYS compared to the R20291 (50). It is
noteworthy to mention that DESeq2 takes into consideration variance within samples. For
example, a principal component analysis (PCA) revealed some variation between data from
the two wild type replicates (not shown). However, the lysogen samples grouped very well
in PCA and did not cluster with the wild type samples, confirming the difference between
data from the wild type and lysogen condition. In addition, only values that were significantly
different at an adjusted p value (padj) ≤ 0.05 (i.e. that considered this variance) were retained
in our analysis.
In terms of gene expression, the mean and median RPKM values for the whole phi-027
prophage in R20291 were 66 and 48, respectively (Supplementary Table S1). Like for
ϕCD38-2, moderate expression was observed across the whole phi-027 prophage, and a
region within the DNA replication and gene regulation module (CDR20291_1419d-1427)
was expressed to higher levels (4-fold) in the R20291LYS (Figure 2 and Supplementary Table
S1). Of note, two regions between CDR20291_1445 and 1445a, and between
CDR20291_1446 and 1446a were transcriptionally active according to our RNA-seq data
(Figure 2). These two regions encode CRISPR arrays, as identified using the CRISPRfinder
tool (http://crispr.u-psud.fr/Server/). The first CRISPR array contains 6 repeats and 5 spacers,
and the second CRISPR array contains 5 repeats and 4 spacers (Supplementary Table S4).
65
Supplementary Table S4. Characteristics of the CRISPR loci in phi-027
CRISPR locus 1
#
Start
Pos.
DR1
1705739
GTTTTAGATTAACTATATGGAATGTAAAT
29
DR2
1705804
GTTTTAGATTAACTATATGGAATGTAAAT
29
DR3
1705870
GTTTTAGATTAACTATATGGAATGTAAAT
29
DR4
1705936
GTTTTAGATTAACTATATGGAATGTAAAT
29
DR5
1706001
GTTTTAGATTAACTATATGGAATGTAAAT
29
DR6
1706067
GTTTTATATTAACTATGTGGATTCAAAAT
29
S1
1705768
GTTGTAAGAAGTATCATTCTATTTTTTAATCTTTCT
36
S2
1705833
TTCAGTGAGAATAAGCTTTATTGTCGATGTAACACTC
37
S3
1705899
AGTACATATAATGAGTCTTTAACATCAGTTATGAAAG
37
S4
1705965
GATTGTACTTTAGCGTCTGCACTAGCTTTGTCTATC
36
S5
1706030
TATTTTACAGATGAACAATTACAGTTACTTCTTGAAT
37
Sequence (5’->3’)
Length
(nt)
CRISPR locus 2
#
Start
Pos.
DR7
1707960
GTTTTATATTAACTATATGGAATGTAAATC
30
DR8
1708026
GTTTTATATTAACTATATGGAATGTAAATC
30
DR9
1708091
GTTTTATATTAACTATATGGAATGTAAATA
30
DR10
1708158
GTTTTATATTAACTATGTGGTATGTAAAAG
30
DR11
1708221
GTTTTATATTAACTATGTGGACTTAAAATT
30
S6
1707990
TTTGTAATGGTAGTGTATTTAAGATTGAAACATCAA
36
S7
1708056
AACATTAGTAGTTGTCTTTATACACATAGCATCAC
35
S8
1708121
CAGCTCCCAAGACATACAACGAATCTGTAACATCAGT
37
S9
1708188
ACTTATTTACAGCTTTATTTGCTAAATCAGAAG
33
Sequence (5’->3’)
Length
(nt)
Interference of ϕCD38-2 with transcription of host genes
The consequence of lysogeny on the expression of host genes has been studied in different
bacteria such as E. coli (27) and L. lactis (25) and the common feature is that only a limited
number of host genes are affected by the presence of prophages. To discriminate bacterial
genes that were differentially expressed in the R20291 lysogen, we chose a 1.75 fold-change
in RNA-seq with an adjusted p value (padj) ≤ 0.05 as the cut-off. Based on these criteria, we
66
identified a total of 39 genes grouped in several putative operons that were differentially
expressed (Table 2).
Table 2. Modulation of bacterial gene expression in the presence of φCD38-2
Locus
tag
0206
0207
0208
0209
0210
0211
0440
0539
0541
0690
0691
0692
0693
0694
0695
0696
0802
0803
1420
1421
1422
1423
1424
1425
1426
1461
1928
1929
2304
2509
2554
2555
2862
2864
2865
3422
3423
3424
3425
Gene
name
cwpV
gutM
gutA
srlE
srlE=
srlB
gutA
crr
ptsG
crr
malY
malX
Putative function
Fold
change
(RNA-seq)
Padj
(RNA-seq)
Transcription antiterminator
PTS transporter subunit IIA
Fructose-like permease EIIC subunit 2
PTS fructose-like transporter subunit EIIB
Sugar phosphate kinase
Hydrolase
Hemagglutinin/adhesin
MerR family transcriptional regulator
Transcriptional regulator
Transcription antiterminator
Glucitol operon activator protein
PTS glucitol/sorbitol-specific transporter subunit IIC2
PTS glucitol/sorbitol-specific transporter subunit IIB
PTS glucitol/sorbitol-specific transporter subunit IIC
PTS glucitol/sorbitol-specific transporter subunit IIA
Sorbitol-6-phosphate dehydrogenase
ABC transporter substrate-binding protein
ABC transporter ATP-binding protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
DNA-directed DNA polymerase I
Virulence-associated protein E
Snf2-related protein
Holin
Hypothetical protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
PTS glucose-specific transporter subunit IIA
Pseudo
PTS glucose-specific transporter subunit IIA
Bifunctional protein repressor/cystathionine beta-lyase
PTS maltose/glucose-specific transporter subunit IIBC
ABC transporter permease
ABC transporter ATP-binding protein
Two-component sensor histidine kinase
Two-component response regulator
0.55
0.52
0.50
0.51
0.43
0.42
20.42
0.56
0.55
0.34
0.40
0.31
0.36
0.30
0.47
0.34
0.53
0.57
1.83
1.97
2.32
2.05
2.18
2.19
1.98
0.46
0.56
0.32
0.52
0.49
1.83
1.94
2.25
1.85
2.10
0.56
0.55
0.53
0.53
0.0013
0.0004
0.0001
0.0002
0.0000
0.0000
0.0000
0.0514
0.0597
0.0000
0.0000
0.0000
0.0000
0.0000
0.0006
0.0000
0.0259
0.0707
0.0369
0.0102
0.9894
0.0002
0.0026
0.0007
0.0006
0.0004
0.0594
0.0000
0.0026
0.0028
0.0369
0.0152
0.0004
0.0321
0.0016
0.0570
0.0514
0.0222
0.0263
Fold change
(RT-qPCR)
0.69 ± 0.09
27.59 ± 3.52
0.29 ± 0.04
6.00 ± 0.77
2.99 ± 0.31
Twenty-six of the 39 genes (67%) were downregulated in the presence of ϕCD38-2 while
13/39 genes (33%) were upregulated. Almost half of the differentially expressed genes
(18/39, 46%) were related to carbon metabolism and sugar transport systems like
phosphotransferase systems (PTS) specific to glucose and fructose. Quantitative real-time
RT-qPCR was performed in triplicate on 5 selected genes present in one of the different
operons. We tested the same RNA preparations used for RNA-seq, and we added a third
67
independent biological replicate. As shown in Table 2, the expression data obtained by RTqPCR correlated well with those obtained by RNA-seq (correlation coefficient of 96%, not
shown), thus validating our data.
The cell wall protein CwpV is upregulated in the R20291LYS
One particular gene was upregulated 20-fold in RNA-seq and 27-fold in qRT-PCR in the
R20291LYS (Figure 1 and Table 2). CDR20291_0440, also named cwpV, encodes a conserved
cell wall-associated protein for which expression is subjected to phase variation. Under
normal conditions, only about 5% of bacterial cells express the protein. We analyzed crude
surface-layer protein extracts by SDS-PAGE and observed a band of the expected size and
corresponding to CwpV in the R20291LYS extract whereas no visible band could be detected
in the extract of the non-lysogenic R20291 strain, likely due to the low number of cells
expressing cwpV (Figure 3) (55).
Figure 3. SDS-PAGE analysis of surface layer proteins, with Coomassie staining of total
glycine-extracted surface layer proteins. The doublet band corresponding to CwpV is
indicated, along with the high (HMW)- and low (LMW)-molecular-mass forms of the SlpA.
The molecular mass marker is on the left.
This result therefore corroborated our transcriptional data (Table 2). We also confirmed using
mass spectrometry analysis that the band corresponded to CwpV (not shown). Using anti-
68
CwpV antibodies in immunofluorescence microscopy, we observed that a greater proportion
of R20291LYS bacteria were expressing cwpV compared to the R20291 (Figure 4).
Figure 4. Immunofluorescence detection of CwpV-expressing cells. Culture samples from
the R20291, the R20291LYS, and the recV-OFF strains were analyzed by light and
fluorescence microscopy. The left column shows the view of total cells in differential
interference contrast (DIC), the middle column shows the CwpV-expressing cells colored in
red by the anti-CwpV antibody, and the right column shows the merged pictures of DIC plus
immunofluorescence.
This suggested that the higher level of CwpV expression detected by SDS-PAGE and RNAseq was the result of a greater number of cells expressing cwpV rather than a higher level of
expression in each positive cell. The tyrosine recombinase RecV (CDR20291_1004) is
known to catalyze the inversion of a DNA segment between the cwpV promoter and the gene,
thereby creating a genetic switch that can turn transcription of cwpV “ON” and “OFF”
69
(Figure 5A) (59). We therefore used real-time qPCR to determine the proportion of ON
versus OFF cells within liquid cultures. Using specific PCR primers that discriminate either
form (Table S5), we observed that ~5% of bacterial cells from the R20291 strain were in the
ON configuration (Figure 5B), which is in agreement with previous reports (59) and with our
immunofluorescence observations (Figure 4).
Figure 5. (A) Schematic representation of the genetic switch controlling the expression of
the cwpV gene. The bacterial tyrosine recombinase RecV catalyzes the inversion of the DNA
region between the left inverted repeat (LIR) and the right inverted repeat (RIR), thereby
disrupting the transcriptional terminator and allowing cwpV expression. (B) Quantification
of the genetic switch status. Total genomic DNA was extracted from culture samples of the
R20291 and recV-OFF strains carrying or not the CD38-2 prophage (indicated by a plus or
minus at the bottom of the graph). Real-time quantitative PCR and the CT method were used
to determine the relative number of DNA copies corresponding to the ON and OFF
configurations.
70
In the R20291LYS carrying the ϕCD38-2 prophage, the proportion of bacteria with the switch
in the ON configuration was ~95%, which also corroborated our immunofluorescence results
(Figure 4). Because we could still detect a small proportion (i.e. ~5%) of cells from the
lysogen that were OFF, we could rule out the possibility that the switch had been permanently
“locked” in the ON position in the lysogen due to a mutation abolishing the site of
recombination (LIR or RIR, Figure 5A) or the activity of the recombinase RecV (55). Of
note, the level of expression of recV (CDR20291_1004) in R20291 and R20291LYS was not
significantly different in RNA-seq (Supplementary Table S1). Nevertheless, since we could
not exclude the possibility that a point mutation could have affected the efficacy of the
recombination process without abolishing it, we re-sequenced the recV gene and the whole
genetic switch in the R20291LYS but found no mutations. We next hypothesized that ϕCD382 was displacing the equilibrium towards the ON configuration, possibly by interfering
directly with RecV, or indirectly through another putative host factor. Alternatively, ϕCD382 could encode its own recombinase/integrase that could complement the RecV activity and
compete for the recombination sites. The genome of ϕCD38-2 encodes two proteins that
could potentially fulfill this type of activity: the putative integrase phiCD38-2_gp53 and the
putative resolvase phiCD38-2_gp55 (Supplementary Table S2). To test the latter hypothesis,
we inactivated recV in the R20291 strain using the ClosTron gene inactivation system (56).
Since ~95% of wild type cells have their switch in the OFF configuration under normal
growth conditions, we obtained multiple recV mutants in which the switch was in a stable
OFF configuration (recV-OFF). We then reintroduced the ϕCD38-2 prophage into the recVOFF mutant (recV-OFFLYS) to see if it was able to catalyze recombination of the switch
towards the ON configuration. As shown in Figures 3, 4, and 5B, the recV-OFFLYS mutant
was unable to switch ON the expression of cwpV. We also inactivated recV in the R20291LYS
already carrying the prophage and in this case, most of the recV mutants were in a stable ON
configuration because about 95% of cells from the R20291LYS were already ON when the
ClosTron inactivated recV (not shown). Since there was no ON-to-OFF or OFF-to-ON
conversion in lysogenic recV mutants, our results demonstrate that the prophage does not
carry a recombinase or a factor that can catalyze recombination of the switch on its own and
that RecV is essential for the switch function of the cwpV gene.
71
Discussion
In this work, we report the analysis of the transcriptional response of C. difficile upon
introduction of a prophage, in the present case ϕCD38-2. We also describe the complete
transcription profile of the prophage during lysogeny. The transcriptomes of a number of
prophages have been described during the lysogenic cycle in different hosts including E. coli,
L. lactis, and S. thermophilus (5, 7, 25, 60). In this study with C. difficile, we noted expression
across the whole ϕCD38-2 prophage genome during lysogeny, including within clusters of
genes encoding structural proteins composing the virions. In stable lysogens, structural genes
are transcribed only when the phage enters a lytic cycle, and the majority of prophage genes
are transcriptionally silent. Hence, only a few genes are generally expressed, like phage
repressors that maintain lysogeny (5, 8). For example, λ achieves a highly stable and
quiescent prophage state by expressing the CI repressor that binds to the oL and oR operators
that overlap the pL and pR promoters, thereby blocking the expression of genes involved in
the lytic cycle (5). In the case of ϕCD38-2, the putative CI repressor (ϕCD38-2_gp39) was
expressed at a level similar to the rest of the prophage genes, suggesting that moderate
expression of the repressor is sufficient to maintain lysogeny. Indeed, spontaneous prophage
induction is a well-known phenomenon (61-63), and we have shown that several prophages
of C. difficile, including ϕCD38-2, can spontaneously induce during lysogeny (43). It is likely
that some cells were engaged in a lytic cycle when we sampled the RNA for our transcriptome
analysis, resulting in background expression of all genes. A recent microarray-based study
with the L. lactis phage Tuc2009 compared the whole phage transcriptome during lysogeny
and during a lytic cycle (25). The study revealed that most genes were repressed in the
prophage state, but a few genes were expressed within the lysogeny module, in the replication
module, as well as in the structural module. However, in the case of the structural genes, the
level of expression was at least 10-40 times higher during the lytic cycle. Because of this
background expression possibly caused by spontaneous ϕCD38-2 induction, it is more
difficult to discriminate genes that are expressed only during lysogeny from those expressed
during a lytic cycle. Performing the same RNA-seq experiment during a synchronized lytic
infection with ϕCD38-2 would help better discriminate those genes.
Of note, an actively transcribed region from ϕCD38-2 contains plasmid-related sequences
including a parA partitioning homolog, generally involved in plasmid maintenance and
72
chromosome segregation (64). It is therefore possible that some of these sequences are
expressed in order to maintain the prophage in its plasmid form during lysogeny. Genes or
clusters of genes expressed independently from the phage regulatory circuit have also been
described in the literature and their expression during lysogeny often leads to lysogenic
conversion (11). For example, several group A streptococci, E. coli and Salmonella
prophages encode proven virulence factors that are part of these so called “morons” (for a
review see (13)). Certain prophages also confer phage immunity to their host via the
expression of superinfection exclusion proteins such as gp15 in the E. coli phage HK97, the
sie2009 encoded by the lactococcal phage Tuc2009 (65), and the ltp gene encoded by the S.
thermophilus phage TP-J34 (66). A recent study by Hargreaves et al reported the presence of
three homologs of quorum sensing genes within a lysogenic conversion region of the
phiCDHM1 phage. These genes are located next to the endolysin gene, as in ϕCD38-2, and
two of them were shown to be actively transcribed during lysogeny (41). Therefore, this
particular genomic region seems to be associated with lysogenic conversion in some C.
difficile phages.
An element that is worth mentioning is the transcription of two CRISPR arrays within the
indigenous phi-027 prophage genome. These CRISPR arrays have been described in a recent
paper showing that several C. difficile prophages carry diverse CRISPR arrays (42). For
example, five CRISPR arrays have been identified in prophages of C. difficile strain 630 (67)
and three of them were shown to be highly transcribed in Northern blot experiments (68).
The fact that some CRISPR arrays contain highly conserved repeats suggests that they might
be processed by CRISPR-associated proteins (Cas) from other CRISPR loci in the genome,
thereby providing resistance (42, 68). The presence of CRISPR arrays on phage genomes
also suggests that horizontal transfer of these arrays might represent another strategy used by
C. difficile to rapidly adapt its immunity repertoire.
Another observation was that some genes within the phi-027 prophage were upregulated ~4fold in the presence of ϕCD38-2, suggesting cross regulation between the two prophages.
This is not surprising considering the extent of sequence similarity between certain phages,
suggesting that phage regulators might function on other related phages besides the one on
which they are encoded. Such examples have been described in E. coli where λ was shown
to increase the expression of a λ bor homolog found in the DLP12 prophage, while repressing
73
the expression of a putative DNA repair protein of the RadC family encoded on the CP4-44
prophage (27). These examples show that prophages interact with each other, and that it is
important to study the interplay between them to better understand their impact on the host.
Effect of lysogeny on bacterial gene expression
Globally, a rather small number of host genes were differentially expressed, most of them
being downregulated, and several genes were related to carbon metabolism and sugar
transport. As such, the transcription profile described here for C. difficile has a number of
common features with other studies conducted in other phage-host systems during lysogeny.
For example, a study in L. lactis described the host response to lysogenization with phage
Tuc2009 (25). Using tilling microarrays, the authors found a total of 44 host genes
differentially expressed in the lysogen, 36 of which were significantly downregulated. The
recorded changes in expression ranged from ~5 to ~26-fold, and the downregulated genes
encoded proteins involved in nucleotide biosynthesis, amino acid metabolism, and cell wall
polysaccharide synthesis. Multiple transcriptional regulators were also downregulated, and 8
bacterial genes were upregulated in the presence of the Tuc2009 prophage, of which 4
encoded transport proteins (25). In E. coli W3350 lysogens carrying the λ prophage, Chen et
al (2005) found only 8 genes that were differentially expressed during lysogeny, most of
which were repressed (27). Some genes were part of other endogenous prophages, while
others were unrelated to phages, like pckA. This gene, encoding a phosphoenolpyruvate
carboxykinase required for gluconeogenesis, was downregulated by about ~10-fold in the
presence of λ (27). As such, the growth rate of λ lysogens was 30% slower than the wild type
cells when grown on succinate and other carbon sources that feed into oxaloacetate, a
susbstrate for PckA, whereas there was no difference when grown on glucose. The authors
identified target sites for binding of the λ CI repressor upstream of the pckA gene. Expression
of a CI repressor from a plasmid resulted in the same impairment on growth as the whole
prophage, and gel shift assays showed that purified CI was able to bind the pckA promoter
region. Of note, the pckA promoter region is conserved in Salmonella, Shigella and E. coli
and several other putative CI-related binding sites were identified upstream of pckA,
suggesting that regulation of this gene by CI repressors is probably widespread among
Enterobacteriaceae (27). In Bacillus anthracis, Schuch et al (2009) identified phage-encoded
74
alternative sigma factors that were shown to induce the production of exopolysaccharides
and biofilm formation and that inhibit sporulation, thereby profoundly affecting their host
lifestyle (28). In C. difficile the temperate phage ϕCD119 encodes a repressor called RepR,
which is involved in the regulation of its own expression. Using gel shifts and reporter assays,
Govind et al (2009) demonstrated that RepR was also capable of binding the regulatory
region upstream of the alternative sigma factor TcdR, thereby inhibiting transcription of the
tcdA and tcdB toxin genes (18, 45). Likewise, although we did not demonstrate that a
regulatory protein from ϕCD38-2 could bind to the PaLoc regulatory regions, our previous
study (39) showing that ϕCD38-2 can boost toxin gene transcription in ribotype 027 isolates
further supports a mechanism similar to the one described for ϕCD119 and λ. In summary, a
phage-encoded regulatory protein can modulate important metabolic and virulence genes
within the host via binding of phage-related regulatory sequences. There are only two
putative transcriptional regulators readily identifiable in ϕCD38-2 and that could potentially
affect the host transcription: gp39, which encodes the putative CI repressor, and gp52,
encoding a putative Sigma70/SigmaF-like factor. It is also possible that one or more of the
bacterial transcriptional regulators affected by the presence of ϕCD38-2 cause most of the
observed differential bacterial gene expression. Further investigations are underway to
clarify this.
Effect of lysogeny on cwpV expression
An unexpected observation was the upregulation of cwpV by about 20-fold in the lysogen
carrying ϕCD38-2. CwpV is a conserved cell wall-associated protein present in all C. difficile
isolates analyzed to date and the main feature of this protein is that it is normally expressed
in a phase-variable manner. Hence, only a fraction of bacterial cells from a given population
actively express the protein whereas the remaining cells do not express cwpV (55, 59). Our
results show that the proportion of cells expressing cwpV reach 95% in the lysogen carrying
ϕCD38-2, as opposed to about 5% in wild type cells. We demonstrate that ϕCD38-2 does not
directly catalyze recombination of the switch because without RecV, the genetic switch is
locked. The signals responsible for phase variation are unknown, and a previous study
suggested that RecV alone could possibly catalyze recombination of the switch in both
orientations (59). Yet we cannot exclude the possibility that another factor is required in the
75
recombination process. Indeed, RecV is a member of the tyrosine recombinase family that
includes the phage λ integrase (69). These recombinases generally require another protein
partner to function, such as the bacterial integration host factor (IHF). λ also uses a phageencoded excisionase protein (Xis), in addition to IHF to catalyze the excision of the prophage
DNA and the reaction can be further enhanced by the host factor for inversion stimulation
(FIS) (69). Therefore, it is possible that a phage factor is interfering with the RecV-dependent
recombination process through interaction with RecV or another host factor, thus altering the
ON/OFF ratio in the presence of a functional RecV. Studies are currently underway in our
laboratory to address this question.
Conclusion
Using a genome-wide transcriptomic approach, we show that upon introduction of ϕCD38-2
into the epidemic strain R20291, a number of host genes are differentially expressed, about
two-thirds of them being downregulated and being associated with sugar transport and
metabolism. Our data also suggest that some cross talk exists between newly introduced
prophages and resident prophages, in the present case between ϕCD38-2 and phi-027.
Furthermore, the resident phi-027 prophage was found to express two CRISPR arrays,
suggesting that this prophage might protect its host from invading mobile genetic elements.
The most differentially expressed gene in our study was that encoding CwpV, a cell surfacelayer protein involved in auto aggregation and that could possibly promote host colonization.
We demonstrate that recombination of the genetic switch controlling transcription of the
cwpV gene is affected in a ϕCD38-2 lysogen, thereby increasing the proportion of cells within
a bacterial culture that express CwpV. The exact mechanism by which ϕCD38-2 achieves
this remains to be elucidated, but we show that the host-encoded recombinase RecV is
essential. In summary, this work provides novel data and further insights into phage-host
interactions in this important human pathogen.
Acknowledgements
We thank David Lalonde Séguin and Julian Garneau for technical help, as well as Marc
Monot for help with transcriptome analyses. This work was supported by a discovery grant
76
from the Natural Sciences and Engineering Research Council of Canada (NSERC). LCF is a
member of the Centre de Recherche du Centre Hospitalier Universitaire de Sherbrooke
(CRCHUS) and is the holder of a Junior 2 salary award from the Fonds de la Recherche du
Québec - Santé (FRQS).
References
1.
Brussow H, Hendrix RW. 2002. Phage genomics: small is beautiful. Cell 108:13–16.
2.
Guttman B, Raya R, Kutter E, Kutter E, Sulakvelidze A. 2005. Basic phage biology.,
pp. 29–66. In Kutter, E, Sulakvelidze, A (eds.), Bacteriophages: biology and
applications. CRC Press, Boca Raton.
3.
Ravin NV. 2011. N15: the linear phage-plasmid. Plasmid 65:102–109.
4.
Sakaguchi Y, Hayashi T, Kurokawa K, Nakayama K, Oshima K, Fujinaga Y, Ohnishi
M, Ohtsubo E, Hattori M, Oguma K. 2005. The genome sequence of Clostridium
botulinum type C neurotoxin-converting phage and the molecular mechanisms of
unstable lysogeny. Proc Natl Acad Sci U S A 102:17472–17477.
5.
Oppenheim AB, Kobiler O, Stavans J, Court DL, Adhya S. 2005. Switches in
bacteriophage lambda development. Annu Rev Genet 39:409–429.
6.
Ventura M, Canchaya C, Bernini V, Altermann E, Barrangou R, McGrath S, Claesson
M, Li Y, Leahy S, Walker C, Zink R, Neviani E, Steele J, Broadbent J, Klaenhammer
T, Fitzgerald G, O'Toole P, van Sinderen D. 2006. Comparative Genomics and
Transcriptional Analysis of Prophages Identified in the Genomes of Lactobacillus
gasseri, Lactobacillus salivarius, and Lactobacillus casei. Appl Environ Microbiol
72:3130–3146.
7.
Ventura M, Bruttin A, Canchaya C, Brussow H. 2002. Transcription analysis of
Streptococcus thermophilus phages in the lysogenic state. Virology 302:21–32.
8.
Ventura M, Canchaya C, Pridmore RD, Brussow H. 2004. The prophages of
Lactobacillus johnsonii NCC 533: Comparative genomics and transcription analysis.
Virology 320:229–242.
9.
Ventura M, Lee J-H, Canchaya C, Zink R, Leahy S, Moreno-Munoz JA, O'ConnellMotherway M, Higgins D, Fitzgerald GF, O'Sullivan DJ, van Sinderen D. 2005.
Prophage-like elements in bifidobacteria: insights from genomics, transcription,
77
integration, distribution, and phylogenetic analysis. Appl Environ Microbiol
71:8692–8705.
10.
Ventura M, Turroni F, Lima-Mendez G, Foroni E, Zomer A, Duranti S, Giubellini V,
Bottacini F, Horvath P, Barrangou R, Sela DA, Mills DA, van Sinderen D. 2009.
Comparative analyses of prophage-like elements present in bifidobacterial genomes.
Appl Environ Microbiol 75:6929–6936.
11.
Hendrix R, Lawrence J, Hatfull G, Casjens S. 2000. The origins and ongoing
evolution of viruses. Trends Microbiol 8:504–508.
12.
Banks D, Beres S, Musser J. 2002. The fundamental contribution of phages to GAS
evolution, genome diversification and strain emergence. Trends Microbiol 10:515–
521.
13.
Brussow H, Canchaya C, Hardt W-D. 2004. Phages and the evolution of bacterial
pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol
Biol Rev 68:560–602.
14.
Fortier L-C, Sekulovic O. 2013. Importance of prophages to evolution and virulence
of bacterial pathogens. Virulence 4:354–365.
15.
Barondess JJ, Beckwith J. 1990. A bacterial virulence determinant encoded by
lysogenic coliphage lambda. Nature 346:871–874.
16.
Barondess JJ, Beckwith J. 1995. bor gene of phage lambda, involved in serum
resistance, encodes a widely conserved outer membrane lipoprotein. J Bacteriol
177:1247–1253.
17.
Eklund MW, Poysky FT, Reed SM, Smith CA. 1971. Bacteriophage and the
Toxigenicity of Clostridium botulinum Type C. Science (New York, NY) 172:480–
482.
18.
Lu MJ, Stierhof YD, Henning U. 1993. Location and unusual membrane topology of
the immunity protein of the Escherichia coli phage T4. Journal of Virology 67:4905–
4913.
19.
Bebeacua C, Lorenzo Fajardo JC, Blangy S, Spinelli S, Bollmann S, Neve H,
Cambillau C, Heller KJ. 2013. X-ray structure of a superinfection exclusion
lipoprotein from phage TP-J34 and identification of the tape measure protein as its
target. Mol Microbiol 89:152–165.
78
20.
Labrie SJ, Samson JE, Moineau S. 2010. Bacteriophage resistance mechanisms. Nat
Rev Micro 8:317–327.
21.
Wagemans J, Lavigne R. 2012. Phages and their hosts, a web of interactions—
applications to drug design, pp. 119–133. In Hyman, P, Abedon, ST (eds.),
Bacteriophages in Health and Disease. CABI Press, Wallingford, United Kingdom.
22.
Liu B, Shadrin A, Sheppard C, Mekler V, Xu Y, Severinov K, Matthews S,
Wigneshweraraj S. 2014. The sabotage of the bacterial transcription machinery by a
small bacteriophage protein. Bacteriophage 4:e28520.
23.
Roucourt B, Lavigne R. 2009. The role of interactions between phage and bacterial
proteins within the infected cell: a diverse and puzzling interactome. Environ
Microbiol 11:2789–2805.
24.
Fallico V, Ross RP, Fitzgerald GF, McAuliffe O. 2011. Genetic response to
bacteriophage infection in Lactococcus lactis reveals a four-strand approach
involving induction of membrane stress proteins, D-alanylation of the cell wall,
maintenance of proton motive force, and energy conservation. J Virol 85:12032–
12042.
25.
Ainsworth S, Zomer A, Mahony J, van Sinderen D. 2013. Lytic infection of
Lactococcus lactis by bacteriophages Tuc2009 and c2 triggers alternative
transcriptional host responses. Appl Environ Microbiol 79:4786–4798.
26.
Cenens W, Makumi A, Mebrhatu MT, Lavigne R, Aertsen A. 2013. Phage-host
interactions during pseudolysogeny: Lessons from the Pid/dgo interaction.
Bacteriophage 3:e25029.
27.
Chen Y, Golding I, Sawai S, Guo L, Cox EC. 2005. Population fitness and the
regulation of Escherichia coli genes by bacterial viruses. PLoS Biol 3:e229.
28.
Schuch R, Fischetti VA. 2009. The secret life of the anthrax agent Bacillus anthracis:
bacteriophage-mediated ecological adaptations. PLoS ONE 4:e6532.
29.
Barbut F, Jones G, Eckert C. 2011. Epidemiology and control of Clostridium difficile
infections in healthcare settings: an update. Curr Opin Infect Dis 24:370–376.
30.
Rupnik M, Wilcox MH, Gerding DN. 2009. Clostridium difficile infection: new
developments in epidemiology and pathogenesis. Nat Rev Micro 7:526–536.
79
31.
Goh S, Riley TV, Chang BJ. 2005. Isolation and characterization of temperate
bacteriophages of Clostridium difficile. Appl Environ Microbiol 71:1079–1083.
32.
Fortier L-C, Moineau S. 2007. Morphological and genetic diversity of temperate
phages in Clostridium difficile. Appl Environ Microbiol 73:7358–7366.
33.
Nale JY, Shan J, Hickenbotham PT, Fawley WN, Wilcox MH, Clokie MRJ. 2012.
Diverse temperate bacteriophage carriage in Clostridium difficile 027 strains. PLoS
ONE 7:e37263.
34.
Shan J, Patel KV, Hickenbotham PT, Nale JY, Hargreaves KR, Clokie MRJ. 2012.
Prophage Carriage and Diversity within Clinically Relevant Strains of Clostridium
difficile. Appl Environ Microbiol 78:6027–6034.
35.
Hargreaves KR, Colvin HV, Patel KV, Clokie JJP, Clokie MRJ. 2013. Genetically
diverse Clostridium difficile strains harboring abundant prophages in an estuarine
environment. Appl Environ Microbiol 79:6236–6243.
36.
Nagy E, Foldes J. 1991. Electron microscopic investigation of lysogeny of
Clostridium difficile strains isolated from antibiotic-associated diarrhea cases and
from healthy carriers. APMIS 99:321–326.
37.
Govind R, Fralick J, Rolfe R. 2006. Genomic organization and molecular
characterization of Clostridium difficile bacteriophage phiCD119. J Bacteriol
188:2568–2577.
38.
Mayer MJ, Narbad A, Gasson MJ. 2008. Molecular characterization of a Clostridium
difficile bacteriophage and its cloned biologically active endolysin. J Bacteriol
190:6734–6740.
39.
Sekulovic O, Meessen-Pinard M, Fortier L-C. 2011. Prophage-stimulated toxin
production in Clostridium difficile NAP1/027 lysogens. J Bacteriol 193:2726–2734.
40.
Horgan M, O'Sullivan O, Coffey Aidan, Fitzgerald GF, van Sinderen D, McAuliffe
O, Ross RP. 2010. Genome analysis of the Clostridium difficile phage PhiCD6356, a
temperate phage of the Siphoviridae family. Gene 462:34–43.
41.
Hargreaves KR, Kropinski AM, Clokie MRJ. 2014. What does the talking?: quorum
sensing signalling genes discovered in a bacteriophage genome. PLoS ONE
9:e85131.
80
42.
Hargreaves KR, Flores CO, Lawley TD, Clokie MRJ. 2014. Abundant and diverse
clustered regularly interspaced short palindromic repeat spacers in Clostridium
difficile strains and prophages target multiple phage types within this pathogen. mBio
5:e01045–13.
43.
Meessen-Pinard M, Sekulovic O, Fortier L-C. 2012. Evidence of in vivo prophage
induction during Clostridium difficile infection. Appl Environ Microbiol 78:7662–
7670.
44.
Goh S, Ong PF, Song KP, Riley TV, Chang BJ. 2007. The complete genome sequence
of Clostridium difficile phage phiC2 and comparisons to phiCD119 and inducible
prophages of CD630. Microbiology (Reading, Engl) 153:676–685.
45.
Govind R, Vediyappan G, Rolfe RD, Dupuy B, Fralick JA. 2009. Bacteriophagemediated toxin gene regulation in Clostridium difficile. J Virol 83:12037–12045.
46.
Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nature
methods 9:357–359.
47.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G,
Durbin R, 1000 Genome Project Data Processing Subgroup. 2009. The Sequence
Alignment/Map format and SAMtools. Bioinformatics 25:2078–2079.
48.
Carver T, Harris SR, Berriman M, Parkhill J, McQuillan JA. 2012. Artemis: an
integrated platform for visualization and analysis of high-throughput sequence-based
experimental data. Bioinformatics 28:464–469.
49.
Anders S, Pyl PT, Huber W. 2014. HTSeq-a Python framework to work with highthroughput sequencing data. Bioinformatics.
50.
Anders S, Huber W. 2010. Differential expression analysis for sequence count data.
Genome Biol 11:R106.
51.
Brosseau J-P, Lucier J-F, Lapointe E, Durand M, Gendron D, Gervais-Bird J,
Tremblay K, Perreault J-P, Elela SA. 2010. High-throughput quantification of
splicing isoforms. RNA 16:442–449.
52.
Lingohr E, Frost S, Johnson RP. 2009. Determination of bacteriophage genome size
by pulsed-field gel electrophoresis. Methods Mol Biol 502:19–25.
53.
Sambrook J, Russell D. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor NY.
81
54.
Calabi E, Ward S, Wren B, Paxton T, Panico M, Morris H, Dell A, Dougan G,
Fairweather N. 2001. Molecular characterization of the surface layer proteins from
Clostridium difficile. Mol Microbiol 40:1187–1199.
55.
Reynolds CB, Emerson JE, La Riva de L, Fagan RP, Fairweather NF. 2011. The
Clostridium difficile cell wall protein CwpV is antigenically variable between strains,
but exhibits conserved aggregation-promoting function. PLoS Pathog 7:e1002024.
56.
Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007. The ClosTron:
a universal gene knock-out system for the genus Clostridium. J Microbiol Methods
70:452–464.
57.
Stabler RA, He M, Dawson L, Martin M, Valiente E, Corton C, Lawley TD, Sebaihia
M, Quail MA, Rose G, Gerding DN, Gibert M, Popoff MR, Parkhill J, Dougan G,
Wren BW. 2009. Comparative genome and phenotypic analysis of Clostridium
difficile 027 strains provides insight into the evolution of a hypervirulent bacterium.
Genome Biol 10:R102.
58.
He M, Miyajima F, Roberts P, Ellison L, Pickard DJ, Martin MJ, Connor TR, Harris
SR, Fairley D, Bamford KB, D'Arc S, Brazier J, Brown D, Coia JE, Douce G, Gerding
D, Kim HJ, Koh TH, Kato H, Senoh M, Louie T, Michell S, Butt E, Peacock SJ,
Brown NM, Riley T, Songer G, Wilcox M, Pirmohamed M, Kuijper E, Hawkey P,
Wren BW, Dougan G, Parkhill J, Lawley TD. 2012. Emergence and global spread of
epidemic healthcare-associated Clostridium difficile. Nat. Genet. 45:109–113.
59.
Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF. 2009.
A novel genetic switch controls phase variable expression of CwpV, a Clostridium
difficile cell wall protein. Mol Microbiol 74:541–556.
60.
Seegers JFML, Mc Grath S, O'Connell-Motherway M, Arendt EK, de Guchte van M,
Creaven M, Fitzgerald GF, van Sinderen D. 2004. Molecular and transcriptional
analysis of the temperate lactococcal bacteriophage Tuc2009. Virology 329:40–52.
61.
Husson-Kao C, Mengaud J, Cesselin B, van Sinderen D, Benbadis L, Chapot-Chartier
MP. 2000. The Streptococcus thermophilus autolytic phenotype results from a leaky
prophage. Appl Environ Microbiol 66:558–565.
82
62.
Carrolo M, Frias MJ, Pinto FR, Melo-Cristino J, Ramirez M. 2010. Prophage
spontaneous activation promotes DNA release enhancing biofilm formation in
Streptococcus pneumoniae. PLoS ONE 5:e15678.
63.
Baugher JL, Durmaz E, Klaenhammer TR. 2014. Spontaneously induced prophages
in Lactobacillus gasseri contribute to horizontal gene transfer. Appl Environ
Microbiol 80:3508–3517.
64.
Pratto F, Cicek A, Weihofen WA, Lurz R, Saenger W, Alonso JC. 2008.
Streptococcus pyogenes pSM19035 requires dynamic assembly of ATP-bound ParA
and ParB on parS DNA during plasmid segregation. Nucleic Acids Res 36:3676–
3689.
65.
McGrath S, Fitzgerald GF, van Sinderen D. 2002. Identification and characterization
of phage-resistance genes in temperate lactococcal bacteriophages. Mol Microbiol
43:509–520.
66.
Sun X, Gohler A, Heller KJ, Neve H. 2006. The ltp gene of temperate Streptococcus
thermophilus phage TP-J34 confers superinfection exclusion to Streptococcus
thermophilus and Lactococcus lactis. Virology 350:146–157.
67.
Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, Thomson
NR, Roberts AP, Cerdeño-Tárraga AM, Wang H, Holden MTG, Wright A, Churcher
C, Quail MA, Baker S, Bason N, Brooks K, Chillingworth T, Cronin A, Davis P,
Dowd L, Fraser A, Feltwell T, Hance Z, Holroyd S, Jagels K, Moule S, Mungall K,
Price C, Rabbinowitsch E, Sharp S, Simmonds M, Stevens K, Unwin L, Whithead S,
Dupuy B, Dougan G, Barrell B, Parkhill J. 2006. The multidrug-resistant human
pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat. Genet.
38:779–786.
68.
Soutourina OA, Monot M, Boudry P, Saujet L, Pichon C, Sismeiro O, Semenova E,
Severinov K, Le Bouguenec C, Coppée J-Y, Dupuy B, Martin-Verstraete I. 2013.
Genome-Wide Identification of Regulatory RNAs in the Human Pathogen
Clostridium difficile. PLoS Genet 9:e1003493.
69.
Groth AC, Calos MP. 2004. Phage integrases: biology and applications. J Mol Biol
335:667–678.
83
CHAPITRE III
ARTICLE 2
The Clostridium difficile Cell Wall Protein CwpV Confers Phase-Variable Phage
Resistance
Auteurs de l’article: Ognjen Sekulovic, Maicol Ospina Bedoya, Amanda S. Fivian-Hughes,
Neil Fairweather, Louis-Charles Fortier
Statut de l’article: soumis à Molecular Microbiology : Sekulovic, O., M. Ospina Bedoya,
A. S. Fivian-Hughes, N. Fairweather and L. C. Fortier " The Clostridium difficile CwpV
Family Confers Phase-Variable Phage Resistance"
Avant-propos: Ce manuscrit englobe les résultats obtenus durant la deuxième partie de mes
travaux de recherche et fait partie de la suite directe du premier manuscrit présenté en tant
que 2e chapitre dans cette thèse. Dans cette partie, nous avons caractérisé la fonctionnalité
d’une protéine de surface appelée CwpV et dont une augmentation de l’expression a été
observée suite à la lysogénisation par le phage phiCD38-2. Ces travaux ont été soumis pour
publication dans le journal « Molecular Microbiology » en date du 27 mars 2015 (numéro de
soumission : MMI-2015-15066). Ma contribution englobe l’ensemble des expériences
effectuées avec l’aide technique de Maicol Ospina Bedoya. Ma contribution dans l’écriture
du manuscrit est également majeure, puisque j’ai rédigé la version initiale qui a été revue,
corrigée et soumise pour publication dans « Molecular Microbiology » par mon directeur de
thèse, Pr Louis-Charles Fortier. Nos collaborateurs Amanda S. Fivian-Hughes et Pr Neil
Fairweather du « Imperial College London » ont participé dans la réalisation de cette étude
en fournissant du matériel de travail (plasmides et anticorps) ainsi qu’en participant dans la
lecture et la correction du manuscrit.
84
Résumé : Notre compréhension de la pathogènes moléculaire de Clostridium difficile a
récemment connue des progrès importants suite au développement des outils de biologie
moléculaire applicables à l’étude de la bactérie. Cependant, le rôle des phages dans la
biologie de C. difficile reste encore inconnu. Des composantes de surface bactérienne jouent
souvent un rôle essentiel dans les étapes initiales de l’infection par les phages. Ainsi, la
variation des constituants de la surface est un stratagème couramment utilisé par les bactéries
pour éviter la prédation virale, mais la caractérisation fonctionnelle d’un système antiphage
chez C. difficile n'a pas encore été faite. Il est intéressant de noter que C. difficile encode 5
types d'une protéine de paroi cellulaire (CwpV, type I à V) qui sont exprimées selon un
mécanisme de variation de phase. Le rôle biologique de CwpV n’est pas encore clair, donc
nous avons tenté de déterminer si cette famille de protéines peut jouer un rôle dans l'infection
par les phages. L'expression de CwpV est contrôlée par l’inversion d’un segment génomique
par une recombinase bactérienne appelée RecV. En inactivant le gène recV dans la souche
de C. difficile R20291, nous avons pu isoler des clones stables dans lequel l'expression de
cwpV a été verrouillée soit en configuration « ON » (R20291ON) ou « OFF » (R20291OFF).
Nous avons également exprimé indépendamment tous les cinq types de CwpV à partir d'un
plasmide dans la souche R20291OFF. Nous avons ensuite évalué la susceptibilité bactérienne
à l’infection par cinq phages faisant partie de deux familles distinctes. Tous les cinq types de
CwpV démontré forte effet protecteur contre l'infection par trois phages différents de la
famille des Siphoviridae, soit phiCD38-2, phiCD111 et phiCD146 (efficacy of plaquing, EOP
<10-7). De plus, dans les expériences de survie bactérienne, CwpV-II a empêché l'infection
par phiCD38-2 lorsqu'exprimé à partir d'un plasmide ou à partir du chromosome dans
R20291ON. Également, l'expression de CwpV type I, III et V dans une souche différente
(CD384), a résulté en une protection partielle contre l'infection par phiMMP1 et phiCD52,
deux phages de la famille des Myoviridae. Les expériences subséquentes ont montré que le
domaine carboxy-terminal variable de CwpV-II est essentiel pour l’effet antiphage puisque
sa délétion restaure la susceptibilité à l'infection virale. L’expression de CwpV-II n’affecte
pas significativement l'adsorption du phage, mais l’absence de la réplication de l'ADN viral
a observée. Finalement, en empêchant l’exportation de CwpV-II vers la surface de la cellule
via la délétion du peptide signal, l’effet antiphage a été aboli. En résumé, nos travaux sont
les premiers à démontrer que CwpV agit en tant que système antiphage.
85
THE CLOSTRIDIUM DIFFICILE CELL WALL PROTEIN CWPV
CONFERS PHASE-VARIABLE PHAGE RESISTANCE
Ognjen Sekulovic1, Maicol Ospina Bedoya1, Amanda S Fivian-Hughes2, Neil Fairweather2
and Louis-Charles Fortier1*
1
Département de microbiologie et d’infectiologie, Faculté de médecine et des sciences de la
santé, Université de Sherbrooke, Québec, Canada
2
Faculty of Natural Sciences, Department of Life Sciences, Imperial College London,
London, UK
*
Corresponding author
E-mail: [email protected]
86
Abstract
Bacteriophages (phages) are present in virtually all ecosystems, and outnumber bacteria by
a factor of at least 10. Hence, to avoid being killed by lytic phages, most bacteria have
evolved multiple antiphage mechanisms, a number of which are subject to phase variation.
Clostridium difficile is an important healthcare-associated pathogen causing severe intestinal
infections in humans and animals. This bacterium encodes an array of conserved surface
layer proteins (SLPs) and cell wall proteins (CWPs), CwpV being the largest member of the
latter group. Five types of CwpV have been described, each type sharing a common cell wall
anchoring domain, and differing in the composition of the repeat-containing C-terminal
domain. Of note, expression of the cwpV gene is phase-variable. Here we show that CwpV
provides strong antiphage protection in C. difficile R20291when expressed constitutively
from a plasmid, or from the chromosome of locked “ON” cells. We also observed differences
in the level of phage protection depending on the phage morphological group. For example,
all five types of CwpV were highly effective against the three siphophages ϕCD38-2,
ϕCD111, and ϕCD146, with efficiency of plaquing (EOP) values of <5x10-7. However,
protection was reduced against the two myophages ϕMMP01 and ϕCD52, with EOP values
between 9.0x10-3 and 1.1x10-1. We also demonstrate that the C-terminal domain of CwpV is
responsible for the antiphage activity, since deleting the entire domain, or part of it
significantly reduced the antiphage protection. Phage adsorption was not affected when
CwpV was overexpressed at the cell surface, but phage DNA replication was prevented and
no phage mutants could be isolated. Together, our data suggest that CwpV functions in a
manner reminiscent of other phage superinfection exclusion (Sie) systems normally encoded
on prophages. CwpV thus represents a ubiquitous host-encoded and phase-variable wide
spectrum Sie-like antiphage system in C. difficile.
87
Author summary (200 words)
Phages are ubiquitous on earth and their high prevalence puts a huge pressure on bacteria
that have to deal with constant phage attacks, including within the mammalian gut where
thrives the opportunistic pathogen C. difficile. Bacteria evolved multiple antiphage strategies
to avoid being killed by phages. One of them consists in blocking phage infection at an early
step of the process, such as phage adsorption or phage DNA injection. Here we demonstrate
that the conserved phase-variable cell surface protein CwpV protects C. difficile from phage
infection. The C-terminal part of the protein containing amino acid repeats is responsible for
the antiphage activity. Furthermore, CwpV structure, rather than the sequence, seems to be
determinant for phage resistance. Indeed, all five types of CwpV, which differ in their Cterminal domain, are highly efficient against infection by siphophages. Although less
efficient, CwpV also blocks infection by myophages, suggesting a certain specificity towards
a particular phage morphotype. Phage adsorption is not affected, but phage DNA replication
is prevented, suggesting a mechanism reminiscent of superinfection exclusion systems
generally encoded by prophages. C. difficile therefore seems to have evolved a highly
efficient, yet phase-variable, broad spectrum antiphage system to avoid phage predation.
88
Introduction
With an estimated 1031 particles in the biosphere, bacteriophages (phages) outnumber
bacteria by a factor of at least 10. This means phages are present in all ecosystems essentially
[1]. Bacteria sometimes benefit from the incorporation into their genome of new prophages
(i.e. integrated phages) that improve their fitness and/or virulence [2,3]. Nevertheless,
bacteria have evolved multiple strategies to protect themselves from phage attacks [4].
These strategies aim at hampering various steps of the infection process, from phage
adsorption to DNA injection, DNA replication and maturation, transcription and translation
(for a review see [4]. For example, bacteria can modify or block receptors onto which phages
adsorb to initiate the infection. Restriction-modification (R-M) systems are also widespread
and cleave the incoming phage DNA [5]. Abortive infection (Abi) systems are mechanisms
of “innate immunity” adopted by bacteria to limit phage propagation. This “altruistic suicide”
strategy aims at protecting the uninfected surrounding cells and keeping phage populations
at a minimum but the net result is the death of the infected cells [6]. Clustered regularly
interspaced short palindromic sequences (CRISPRs) represent an RNA-based “adaptive
immunity” system protecting cells from phage infection and from the transfer of foreign
DNA [7].
Superinfection exclusion (Sie) systems prevent phage infection by interfering at a very early
step in the infection process. Contrary to other antiphage systems that are mostly encoded on
plasmids or on the chromosome of the bacterial host, Sie are generally encoded by temperate
phages. When a Sie-encoding prophage integrates into the chromosome of its host to initiate
a lysogenic cycle, it expresses a protein that is directed to the cell surface to prevent lytic
reinfection (or superinfection) by the same phage or related phages. The mode of action of
Sie is blocking of phage DNA entry. A number of Sie systems have been described in Gramnegative bacteria, including the Imm and Sp membrane proteins encoded by coliphage T4,
and the Sim and SieA systems encoded by many prophages from Enterobacteriaceae species
[4]. The molecular mode of action of Sie systems is not always fully understood but for
example, Imm changes the conformation of the phage DNA injection site, thereby preventing
DNA entry into the cytoplasm. Sp inhibits the lysozyme activity located at the tip of the T4
89
phage tail and which is required to drill a whole into the peptidoglycan wall to enable DNA
injection [8].
In Gram-positive bacteria, a few Sie systems have been identified, mainly in phages of
Lactococcus lactis [9,10] and Streptococcus thermophilus [11,12]. They are all predicted or
have been shown to be membrane-associated proteins and to function by blocking phage
DNA injection. The prototype Sie system in L. lactis is Sie2009 encoded by the lactococcal
phage Tuc2009. Although Tuc2009 is a member of the P335 phage species [13], Sie2009
confers resistance to a genetically distinct group of lactococcal phages, the 936 [9].
Additional genes encoding similar Sie systems have been identified in multiple lactococcal
strains [9,10]. In S. thermophilus, the temperate phage TP-J34 encodes Ltp, a 142 amino acid
lipoprotein conferring antiphage activity against similar S. thermophilus phages, but that also
provides strong protection against a completely distinct group of L. lactis phages, in
particular P008 [14]. Analysis of P008 mutants capable of overcoming the Ltp system
revealed mutations in the tail tape measure protein (TMP). Crystal structure analysis of Ltp
suggests that the antiphage activity results from the interaction between Ltp and the phage
TMP while it is being ejected from the tail tube during infection, thereby preventing the
formation of a channel through the bacterial membrane for the passage of the viral DNA [12].
Clostridium difficile is the main cause of antibiotic-associated diarrhea in industrialized
countries [15]. Although many phages infecting C. difficile have been described [16,17], no
functional antiphage system has been functionally characterized in this species so far.
Nevertheless, bioinformatics analyses revealed the presence of putative Abi systems in a few
phage genomes, including AbiF in phage ϕC2 (ORF37) [18,19] and an Abi-like protein
(CDR20291_1462) in the phi-027 prophage present in all ribotype 027 isolates, including the
R20291 [20]. In addition, CRISPRs and CRISPR-associated (Cas) proteins are widely
present in C. difficile genomes [21] but although the system seems to be functional [22], an
antiphage phenotype has never been demonstrated experimentally. Likewise, the
CdiCD6I/M.CdiCD6I and CdiCD6II/M.CdiCD6II R-M systems have been described in C.
difficile, but their activity against phages has never been tested [23].
CwpV is a conserved cell wall protein present in all C. difficile isolates and which is the
largest member of the family of cell wall proteins (CWPs). Five different types of CwpV
90
have been described to date, each differing in their C-terminal domain. The characteristic
feature of this domain is the presence of 4-9 tandem repeats of amino acids, each repeat
comprising between 79 and 120 amino acids [24]. CwpV is exported to the cell surface
through a secA2-dependent secretion system [25]. Once exported, auto-processing of the
protein at a specific cleavage site generates an N-terminal fragment of ~42-kDa and a Cterminal fragment of variable size depending on the CwpV type. The two fragments then reassociate through non-covalent bonding into a heterodimer to generate the mature CwpV
protein, which is anchored to the cell wall via three CWB2 cell wall-anchoring domains
[26,27]. CwpV is a major constituent of the C. difficile cell wall, representing ~13% of the
total surface layer proteins [24]. The biological function of CwpV is still unclear, but a
previous study has shown that CwpV promotes bacterial aggregation in vitro, suggesting a
possible implication in gut colonization [24].
One of the characteristic features of CwpV is its phase-variable expression, which is
conserved among all CwpV types identified [28]. Only ~5% of bacteria from a culture
actively transcribe the cwpV gene. The site-specific recombinase RecV catalyzes the
recombination of a genetic switch located between the gene and the promoter, thereby turning
“ON” and “OFF” the expression of cwpV [28].
In this study, we provide experimental evidence showing that the conserved cell wall protein
CwpV from C. difficile has antiphage activity. We show that cells turning the expression of
cwpV “ON” become resistant to infection by different phages, including members of the
Siphoviridae and Myoviridae families. Our data strongly support a model in which CwpV
prevents phage DNA from entering the cell, which is a mechanism reminiscent of
superinfection exclusion systems encoded by other temperate phages.
Methods
Bacterial strains, bacteriophages and plasmids
A complete list of bacterial strains, plasmids and bacteriophages used in this study is
presented in Table 1. C. difficile strains were routinely grown inside an anaerobic chamber
(Coy Laboratories), under anaerobic atmosphere (10% H2, 5% CO2, and 85% N2) at 37°C in
pre-reduced brain hearth infusion (BHI) broth or TY broth (3% tryptose, 2% yeast extract,
91
pH 7.4). Thiamphenicol (15 μg/mL) and norfloxacin (12 μg/mL) were added when necessary.
Escherichia coli strains were grown aerobically in Luria Bertani (LB) broth in a shaking
incubator at 37°C with appropriate antibiotics (chloramphenicol 25 μg/mL or kanamycin 50
μg/mL) when necessary. Concentrated phage lysates (≥109 pfu/mL) were prepared by
standard phage induction and amplification protocols as described elsewhere [29] and stored
at 4°C.
Table 1. List of bacterial strains, plasmids and phages used in this study.
Strain, plasmid
or phage
C. difficile
Characteristic or description
Reference
or source
R20291
Epidemic isolate, ribotype 027
[70]
R20291OFF
[32]
This study
R20291OFF(pCBR080)
R20291 Cd1004-144a::CT, recV mutant, cwpV genetic switch
OFF
R20291 Cd1004-144a::CT, recV mutant, cwpV genetic switch
ON
R20291OFF containing pCBR080, cwpV-I full length
R20291OFF(pCBR106)
R20291OFF containing pCBR106, cwpV-III full length
This study
R20291OFF(pCBR107)
R20291OFF containing pCBR107, cwpV-IV full length
This study
R20291OFF(pCBR109)
R20291OFF containing pCBR109, cwpV-V full length
This study
R20291OFF(pOS200)
R20291OFF containing pOS200, cwpV-II full length
This study
R20291OFF(pOS201)
R20291OFF containing pOS201, cwpV-II N-term fragment
This study
R20291OFF(pOS202)
R20291OFF containing pOS202, cwpV-II 3 repeats
This study
R20291OFF(pOS203)
R20291OFF containing pOS203, cwpV-II ΔSignalP
This study
CD384
Human isolate
[71]
Escherichia coli
CA434
HB101 carrying plasmid R702
[23]
Siphoviridae
Siphoviridae
Siphoviridae
Myoviridae
Myoviridae
[29]
[17]
[17]
[46]
[40]
R20291ON
This study
Phage
ϕCD38-2
ϕCD111
ϕCD146
ϕMMP01
ϕCD52
Plasmid
pRPF144
Pcwp2-gusA cassette from pRPF137 subcloned into pMTL960
pRPF144E
pRPF144 without gusA and with a unique BamHI site
pCBR080
pMTL960 containing the full-length cwpV-I gene from strain
630 with C-terminal streptavidin-tag
pMTL960 containing the full-length cwpV-III gene from strain
CDKK167 with C-terminal streptavidin-tag
pMTL960 containing the full-length cwpV-IV gene from strain
M9 with C-terminal streptavidin -tag
pMTL960 containing the full-length cwpV-V gene from strain
AY1 with C-terminal streptavidin -tag
pRPF144 containing the full-length cwpV-II gene from strain
R20291
pCBR106
pCBR107
pCBR109
pOS200
[25]
This study
[24]
[24]
[24]
[24]
This study
92
pOS201
pOS202
pOS203
pRPF144 containing the N-terminal domain of the cwpV-II
gene from strain R20291
pRPF144 containing the N-terminal domain + 3 proximal
repeats of the cwpV-II gene from strain R20291
pRPF144 containing the cwpV-II gene with deleted signal
peptide from strain R20291
This study
This study
This study
Determination of phage titers and efficiency of plaquing (EOP)
For determination of phage titers, we used a standard soft agar overlay method [30] with
0.5 mL of a log-phase sensitive strain and 10 mM CaCl2 + 0.4M MgCl2. For rapid evaluation
of bacterial sensitivity to phage infection, 5 µL of serially diluted phage lysates were spotted
directly on top of the soft agar overlay. Clear zones of lysis in the bacterial lawn were
indicative of a productive phage infection. The efficiency of plaquing (EOP) was used for
quantitative analysis of bacterial sensitivity to phage infection and consisted in dividing the
phage titer (in plaque forming units (pfu)/mL) of a given phage on the test strain, by the
phage titer (in pfu/mL) of that phage on a sensitive reference strain [31].
Isolation of R20291OFF and R20291ON clones
Inactivation of the bacterial recombinase RecV from strain R20291 (CDR20291_1004) using
the ClosTron system has been described previously [24,32]. Colony PCR on putative recV
mutants was performed in order to identify clones for which the genetic switch controlling
the expression of the cwpV gene [28] was locked either in the ‘ON’ (primer pair LCF 801 +
LCF 714) or ‘OFF’ (primer pair LCF 796 + LCF 797) configuration (Table S1). Surface
protein extracts from positive clones were analyzed on polyacrylamide gel electrophoresis
(SDS-PAGE) followed by Coomassie blue staining to validate the presence (“ON” clones)
or the absence (“OFF” clones) of CwpV protein at the cell surface.
93
Table S1. List of primers used in this study.
Product
size (bp)
Target
LCF 312
ϕCD38-2
detection
Fwd
AGCGGTATCGGCTTGGTTGTAGAT
Rev
TGCTAGTTTCCTGTCAAGGTCGCT
cwpV OFF
switch
Fwd
CGCAATTATTTGTTTTTCATATGGATAAAATTGG
Rev
GATTTTTATGTTAATGAATTGTTATAAAAAACATGG
cwpV ON
switch
Fwd
GGTAAGTTTGATTTTTATGTTAATGAATTG
Rev
CAGTTTGTGCACTAGCTATGCCTGC
Fwd
NNNNGAGCTCGTATCCTTTAGAATTAGAACGGGAAC
Rev
NNNNGGATCCCTTTACATGATAAAAAGGCTGTG
Rev
NNNNGGATCCTTTATATTCACCTACATTTGTTCCCTC
1743
Rev
NNNNGGATCCAGCATATTCTCCCTCTGCTGTTCC
2454
Fwd
AAATAAGGAAAAAATAATAAGAACAATTCATTAACATAAAAATCAAAC
Rev
CATTTTATTTTCTTCCCCCTCATTTTATTTTCTTCCCCCTTG
Fwd
AGGGGGAAGAAAATAAAATGCAAACTGTGGCAACAAATTTAAC
Rev
ACTGGCGGCCGTTACTAGTGCTTTACATGATAAAAAGGCTGTG
LCF 313
LCF 796
LCF 797
LCF 801
LCF 714
LCF 756
LCF 757
LCF 896
LCF 897
LCF 941
LCF 942
LCF 943
LCF 944
cwpV-II
cwpV-II Nterminal
cwpV-II 3
repeats
Gibson 5’
cwpV
fragment
Gibson 3’
cwpV
fragment
Strand
Sequence
(5’- 3’)
Primer
537
163
223
3704
291
3567
Cloning and expression of CwpV-related constructions
The full-length cwpV-II gene including the putative ribosome-binding site was amplified by
PCR from C. difficile R20291 using primers LCF 756 and LCF 757. Truncated versions of
the cwpV-II gene were also amplified by PCR as follows: primers LCF756 and LCF896 were
used to amplify the region encoding the N-terminal domain of CwpV-II, while primers
LCF 756 and LCF 897 were used to amplify the region spanning the N-terminal domain + 3
proximal amino acid repeats. The PCR products were cloned in place of the gusA gene
downstream of the constitutive Pcwp2 promoter in the pRPF144 plasmid [25] (Table 1) using
SacI and BamHI restriction enzymes. The resulting plasmids were named pOS200, pOS201
and pOS202, respectively. An in-frame deletion of the signal peptide from CwpV was also
constructed as follows. The signal peptide was identified using SignalP 4.1
(http://www.cbs.dtu.dk/services/SignalP/) [33], and further verified manually based on
conserved characteristics for Gram-positive species [34,35]. Next, the 5’ fragment of the
cwpV gene including the ribosome binding site and ATG start codon was PCR-amplified
with primers LCF 941 and LCF 942. A 3’ fragment downstream of the signal peptide and
94
including the N-terminal cell wall binding domain, C-terminal repeats and a putative
transcriptional terminator was PCR-amplified with primers LCF 943 and LCF 944. A Gibson
isothermal assembly procedure [36] was then used to clone the two PCR fragments into a
modified pRPF144 backbone. Briefly, the pRPF144 plasmid was digested with SacI and
BamHI to remove the gusA gene. The remaining plasmid fragment was then treated with T4
DNA polymerase (NEB) to generate blunt ends, and ligated with T4 DNA ligase (NEB) to
give pRPF144E. The plasmid was linearized with BamHI and purified by EZ-10 spin column
DNA cleanup kit (BioBasic). Equimolar ratios of 5’and 3’ cwpV fragments and linearized
pRPF144E were pooled in a total volume of 5 µL and mixed with 15 µL of Gibson enzyme–
reagent master mix containing 5% PEG-8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2, 10
mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U
Taq ligase and 0.5 U Phusion polymerase (NEB). The reaction mix was incubated at 50°C
for 1 h, and 1 µL was used to transform E. coli CA434 competent cells using standard
procedures [37]. Positive clones carrying the correct constructs were verified by DNA
sequencing and subsequently transferred by conjugation into C. difficile R20291OFF as
described previously [32].
Immunoblotting for detection of CwpV
Expression of the recombinant proteins was confirmed by Western immunoblotting. Briefly,
C. difficile cell surface proteins were glycine-extracted as previously described [32].
Following S-layer extraction, cells were washed in 1X PBS and then mechanically lysed
using 0.5 g of acid-washed glass beads (106 μm, Sigma) in a FastPrep apparatus (MP
Bioscience) for 45 sec at 4m/s. Proteins were separated by 10% SDS-PAGE and then
transferred on nitrocellulose membranes using standard procedures [37]. Immunoblotting
was performed either with chicken IgY primary antibodies specific to the N-terminal part of
CwpV protein (Cat# Immune Biosolutions) or rabbit primary antibodies raised against the
first two C-terminal repeats [24]. Primary antibodies were detected using either an HRPconjugated goat anti-rabbit secondary antibody (Life Technologies) or an HRP-conjugated
alpaga anti-chicken secondary antibody (Immune Biosolutions) following manufacturers’
recommendations.
95
Bacterial survival assays
Bacterial survival assays were performed as follows. C. difficile overnight cultures were used
to inoculate 5 mL of fresh TY broth and bacteria were grown until exponential phase
(OD600nm = 0.5). Then, 0.9 mL of the culture was taken and mixed with ϕCD38-2 phage lysate
in order to obtain a multiplicity of infection (MOI) of 1. MgCl2 and CaCl2 were added to a
final concentration of 10 mM each and the volume was completed to 1 mL with sterile TY
broth. An uninfected control without phage was run in parallel. Both samples were mixed by
inversion and incubated for 15 minutes at 37°C, after which aliquots were quickly diluted in
triplicate in 96-well plates. Then, 0.1 mL of these dilutions was plated on BHI agar and
incubated overnight. The next day, colonies were counted and the ratio between infected and
uninfected controls was indicative of bacterial sensitivity to phage infection and expressed
as percentage of survival ([infected/uninfected] x 100).
Phage adsorption assays
Phage adsorption assays were performed as previously described with slight modifications
[38]. Briefly, bacteria from an overnight culture were inoculated in TY broth and grown until
exponential phase (OD600nm = 0.5). Then, 0.9 mL of cells were mixed with 1 x 104 pfu in the
presence of salts (10 mM CaCl2 and MgCl2) and the volume was completed to 1 mL with
fresh TY broth. Phages were allowed to adsorb for 30 minutes at 37°C after which cells were
collected by centrifugation. Free phages in the supernatant that did not adsorb were counted
on standard soft agar overlays and titers were compared to the initial phage inoculum. The
percentage of adsorption was calculated with the following formula: 100 – ([residual
titer/initial titer] x 100).
Detection of phage DNA replication
Phage DNA replication within bacterial cells was monitored as previously described with
modifications [39]. Briefly, bacteria from an overnight culture were inoculated in 100 mL of
fresh TY broth and allowed to grow until exponential phase (OD600nm = 0.5) at which point
CaCl2 and MgCl2 were added directly to the culture at final concentrations of 10 mM each.
One 5-mL aliquot was immediately taken as a non-infected control. Then, the phage lysate
was added at a MOI of 1 and 5-mL aliquots were taken at 0, 20, 40, 60 and 90 minutes. Each
sample was mixed with an equal amount of cold acetone-ethanol mix (1:1) in order to stop
96
the replication machinery in the cell and stabilize the DNA. Cells were harvested by
centrifugation, washed in 1X PBS and total DNA was extracted by phenol-chloroform
extraction followed by ethanol precipitation. Two micrograms of total DNA was digested
with HindIII (NEB) following manufacturer’s instructions and run through a 0.8% agarose
gel. DNA transfer and Southern hybridization with whole-phage digoxigenin (DIG)-labeled
probe were performed as described previously [40].
Results
CwpV protects against phage infection
In a previous transcriptomic study with C. difficile R20291, we isolated a lysogen carrying
the episomal ϕCD38-2 prophage in which the cwpV gene (CDR20291_0440) was
upregulated about 20 fold [32]. This observation was intriguing, and although it is still
unknown how ϕCD38-2 interferes with cwpV expression, it raised interesting questions. The
cwpV gene encodes a cell wall protein present in all C. difficile isolates analyzed to date.
Although the function of the protein remains uncertain, experimental evidence suggest that
it participates in bacterial aggregation, which could possibly contribute to colonization of the
gut mucosa [24]. Of note, cwpV expression is subject to phase variation, i.e. only a fraction
of a bacterial population expresses the gene [28]. The biological reason for such phase
variation is still unknown and different hypotheses have been proposed. One of them is that
CwpV could possibly participate in resistance to bacteriophage infection [24]. Indeed, a
number of phage receptors and phage resistance systems are subject to phase variation
[41,42]. We therefore sought to verify if CwpV could protect against phage infection in C.
difficile.
We used the R20291 strain, a ribotype 027 epidemic isolate that is susceptible to infection
by three temperate siphophages from our collection: ϕCD38-2, ϕCD111 and ϕCD146
[17,29]. We also used the R20291OFF strain, a R20291 mutant in which cwpV is not expressed
[32] (Table 1). This mutant was created by inactivating the recV gene encoding the sitespecific recombinase RecV, using the ClosTron system [24,43]. Inactivation of recV prevents
recombination of the epigenetic switch controlling transcription of cwpV [28], thereby
allowing the isolation of clones in which the switch is locked in the ON or OFF configuration.
97
The absence of cwpV expression in R20291OFF was confirmed by RT-qPCR, Western blot
and immunofluorescence [32].
We then cloned the R20291 type II cwpV gene (cwpV-II) on the pRPF144 plasmid [25], under
the control of the constitutive promoter Pcwp2, leading to pOS200 (Table 1). This plasmid was
transferred by conjugation into the R20291OFF mutant that does not express the chromosomal
copy of cwpV. The presence of CwpV-II at the bacterial surface was verified by Western blot
and immunofluorescence on stationary-phase cells (Figs. S1 and S2).
98
99
Fig. S1. Immunofluorescence detection of CwpV in different strains. The presence of
CwpV at the bacterial surface was assessed by immunofluorescence using antibodies directed
against the C-terminal repeats of the protein. We can notice the absence of the protein in the
“OFF” strain that does not express the endogenous copy of the cwpV gene (R20291OFF), in
the strain expressing the truncated version of the protein lacking all the C-terminal repeats
(R20291OFF(pOS201)), and in the strain with a CwpV lacking the signal peptide
(R20291OFF(pOS203)).
Fig. S2. Western immunoblotting for detection of various CwpV constructs in C.
difficile surface-layer extracts. A) Coomassie Blue staining (upper panel) and Western
immunoblot detection (lower panel) of CwpV-II constructions in S-layer extracts of R20291
(A) or CwpV-I, III and V in S-layer extracts from strain CD384. An anti-CwpVNter primary
antibody targeting the N-terminal portion of the protein was used. The presence of a weak
band in CD384 is due to the expression of the endogenous cwpV gene, which is not expressed
in the R20291OFF (recV locked “OFF” strain). C) Detection of CwpV-II in S-layer extracts
(SLPs) and in the cytosol (Cyt.) using anti-CwpVrptI primary antibodies targeting the Cterminal repeats. The dotted line arrows indicate the N-term fragment and the solid line
arrows indicate the C-term fragment. The pOS203 plasmid expresses a version of CwpV
100
lacking the signal peptide, resulting in the accumulation of CwpV in the cytosolic fraction
only.
Next, using a spot-test infection assay, we assessed the impact of the overexpression of cwpVII on the susceptibility to infection by ϕCD38-2, ϕCD111 and ϕCD146. While the R20291OFF
strain was fully susceptible to infection by all three phages, as it is the case for the wild type
strain [17] (not shown here), we observed a complete absence of infection in the strain
overexpressing cwpV-II (R20291OFF(pOS200)) (Fig. 1).
R20291 OFF
pOS200
-
+
-
+
-
+
pfu
10 6
10
5
10 4
10 3
CD38-2
CD111
CD146
Fig. 1. Susceptibility of C. difficile to phage infection in spot-test assays. Bacterial lawns
were prepared with the wild type R20291, or the R20291OFF mutant strain, carrying (+) or
not (-) the pOS200 plasmid expressing the CwpV type II. A 5-µL drop containing different
titers of the phages ϕCD38-2, ϕCD111 or ϕCD146 were then deposited on top of the lawns.
Zones of clearing after incubation denote susceptibility to phage infection. The assay has
been repeated at least three times and a representative result is shown.
In spot-test assays, the relative multiplicity of infection (MOI) is very high at the point of
phage deposition, especially with high titer dilutions. Therefore, we also assessed the
influence of cwp-II expression on susceptibility to phage infection in conditions where
phages and bacteria were in a ratio of 1 to 1 (MOI = 1). We performed a cell survival assay
in which we infected C. difficile in broth with ϕCD38-2, followed by plating of the infected
bacteria. As shown in Fig. 2, 96.2% ± 18.5% of the R20291OFF(pOS200) bacteria survived
101
the infection, while only 13.3% ± 6.8% of the R20291OFF bacteria survived. As a comparison,
we also infected the parental wild type R20291 strain, and 20.8% ± 2.5% of bacteria survived.
These results further confirmed that overexpression of cwpV-II confers phage resistance, and
that the complete absence of CwpV from the cell surface of the R20291OFF strain increases
susceptibility to phage infection.
**
Bacterial survival (%)
125
****
****
100
75
50
25
91
02
2
R
FF
R
1O
29
20
R
1O
29
20
N
pOS200
pOS201 pOS202
R20291 OFF
Fig. 2. Bacterial survival following infection with phage ϕCD38-2. Bacteria were infected
with phage ϕCD38-2 at an MOI of 1, and were subsequently plated after 15 min of
incubation. The R20291ON (locked “ON”) and R20291OFF (locked “OFF”) strains were
compared to the wild type R20291. Plasmids carrying either the full-length cwpV-II
(pOS200), a truncated version with only the N-terminal portion (pOS201) or a partially
truncated version lacking the distal 5 repeats (pOS202) were also tested in R20291OFF.
Colonies representing bacteria that survived the infection were counted and the result is
expressed as a percentage of the ratio between infected and uninfected controls. Vertical bars
represent means ± standard deviation (SD) of three independent biological replicates, which
were each plated in technical triplicates. One-way ANOVA comparisons were done with
R20291OFF as the reference condition (**, p < 0.01; ****, p < 0.0001).
Because the R20291OFF(pOS200) strain overexpresses cwpV from an unrelated constitutive
promoter on a plasmid, which does not reflect the natural condition, we constructed a strain
102
in which cwpV was expressed from its own promoter on the chromosome. This was done by
selecting recV mutants in which the genetic switch controlling the expression of cwpV was
locked in the “ON” configuration, i.e. strain R20291ON (Table 1). The constitutive expression
of cwpV in all cells of the R20291ON strain was confirmed by immunofluorescence (Fig. S1).
A strong protection against ϕCD38-2 infection was observed in bacterial survival assays
performed with the R20291ON strain, with a survival rate of 76.7% ± 10.8% (Fig. 2). This
suggests that under normal conditions, when an individual cell expresses cwpV-II, phage
infection is inhibited efficiently in that cell.
The presence of surviving R20291OFF cells after phage exposure suggested that some cells
were not infected, or some of them became lysogenic. Once a lysogen is formed, it becomes
resistant to further killing by the same phage. We used an MOI of 1 in our survival assay to
minimizing lysogeny, which is promoted at higher MOI [44]. However, at an MOI of 1, we
could expect that some cells will not be infected, and we could not rule out the possibility
that lysogens also formed during the process. We therefore determined the proportion of
lysogens among surviving cells following infection with ϕCD38-2. We randomly picked 30
colonies from each infection experiment and analyzed them by PCR for the presence of
ϕCD38-2 using specific primers (LCF 312 and LCF 313). No lysogens could be detected in
R20291(pOS200), but 3/30 (10%) of survivors from R20291 and 6/30 (20%) from
R20291OFF were positive for ϕCD38-2, confirming that lysogens were formed during the
assay. However, most of the non-lysogenic colonies were likely non-infected cells. It is also
noteworthy that no lysogens could be detected following infection of the R20291ON strain.
CwpV protection is highly selective toward Siphoviridae phages
The CwpV protein is found in all C. difficile isolates analyzed to date, and it has been further
classified into five different types according to the number and sequence of amino acid
repeats composing the variable C-terminal region [24] (Fig. 3). In order to verify if the
antiphage activity observed with the type II CwpV could be extended to other types, we
transferred into the R20291OFF strain plasmids carrying one of the other known types, i.e.
cwpV type I, III, IV and V (Table 1). By incorporating into soft agar overlays [30] dilutions
of a phage lysate from ϕCD38-2, ϕCD111 or ϕCD146 (up to 5x107 pfu), we were able to
calculate their efficiency of plaquing (EOP) on the different strains, i.e. the proportion of
103
phages that can infect a given strain, compared to a reference strain, in this case wild type
R20291. As shown in Table 2, we confirmed that all types of CwpV successfully blocked
infection by the three siphophages, with EOP values below the maximum phage input used
in the assay (i.e. EOP < 5x10-7) (Table 2). In fact, no phage plaques could be detected neither
with ϕCD38-2, ϕCD111 nor ϕCD146, confirming that all five types of CwpV provided strong
antiphage activity against these siphophages.
Table 2. Efficiency of plaquing (EOP) for morphologically different phages infecting strains
expressing various types of CwpV.
Siphoviridae
CwpV
type
I
ϕCD38-2
ϕCD111
< 5 x 10-7
II
Myoviridae
ϕCD146
ϕMMP01
ϕCD52
< 5 x 10-7 < 5 x 10-7
9 x 10-3
1.5 x 10-2
< 5 x 10-7
< 5 x 10-7 < 5 x 10-7
ND
ND
III
< 5 x 10-7
< 5 x 10-7 < 5 x 10-7
5.6 x 10-2
3.3 x 10-2
IV
< 5 x 10-7
< 5 x 10-7 < 5 x 10-7
ND
ND
V
< 5 x 10-7
< 5 x 10-7 < 5 x 10-7
9.7 x 10-2
1.1 x 10-1
ND = Not determined
Next, we wanted to determine if CwpV could also protect C. difficile against other
morphologically unrelated phages, for example members of the Myoviridae family, i.e.
phages with non-flexible contractile tails [45]. However, one limitation that we faced was
that only Siphoviridae phages from our collection could infect the R20291 strain. To address
this, we selected another C. difficile strain that was susceptible to infection by myophages
and into which conjugation was possible, CD384 [17]. We had two different myophages that
could replicate efficiently on this strain, ϕMMP01 [46] and ϕCD52 [40]. We transferred by
conjugation the plasmids carrying the different types of cpwV into CD384. However, despite
several attempts, the plasmids carrying the type II and type IV cwpV could not be transferred.
EOP assays with ϕMMP01 and ϕCD52 revealed that CwpV type I was the most effective at
preventing infection, especially against ϕMMP01 with an EOP of 9 x 10 -3, and that type V
104
was the least effective, with an EOP of 1.1 x 10-1 with phage ϕCD52 (Table 2). Overall,
CwpV seemed to provide some protection against infection by myophages, but the EOP
values were at least 3 to 4-log higher suggesting that CwpV is less effective against this phage
family. Taken all together, our results suggest that the antiphage activity provided by all five
types of CwpV is highly selective towards siphophages.
The C-terminal domain of CwpV carries the antiphage activity
Since the N-terminal domain of CwpV is involved in cell wall attachment [27], we
hypothesized that the antiphage property was provided by the C-terminal domain carrying
the amino acid repeats. In order to verify this, we constructed two deletion mutants of the
CwpV type II protein from R20291. The first plasmid, pOS201, encoded a CwpV-II lacking
the entire C-terminal domain, and only the N-terminal domain required for cell wall
anchoring was retained [24,26] (Fig. 3). The second plasmid, pOS202, lacked the five distal
amino acid repeats and retained only the first 3 proximal repeats within the N-terminal
domain. Both plasmids were transferred by conjugation into R20291OFF and the presence of
the protein at the cell surface was verified by immunofluorescence and western blot (Figs.
S1 and S2). Then, we performed bacterial survival assays to assess the susceptibility to phage
infection. The pOS201 plasmid lacking the whole C-terminal domain did not efficiently
protect against ϕCD38-2 infection, with a survival rate of 33.07% ± 0.72%, which was not
significantly different from the rate observed with wild type R20291 (20.8% ± 2.5%) (Fig. 2).
With the pOS202 plasmid encoding a partially deleted CwpV, the protection was
intermediate, with a survival rate of 52.07% ± 5.90. These results suggest that the C-terminal
repeats are indeed responsible for the antiphage activity of CwpV.
105
Fig. 3. Schematic representation of the CwpV constructions used in this study. The type
of CwpV is indicated on the left, along with the strain in which it originates, and the plasmid
carrying a copy of the corresponding gene used for expression assays in R20291 OFF. Colour
code: Black, signal peptide; gray, cell wall-anchoring domain (PF04122); white, unknown
function; pink, serine/glycine-rich region; blue, type I repeats; orange, type II repeats; green,
type III repeats; red, type IV repeats, purple, type V repeats. Colour shades represent different
sequence variants of a repeat type. Constructions marked with * are not naturally occuring.
Modified from [24].
CwpV functions as a superinfection exclusion (Sie) system
The spot-test and EOP experiments suggest that when cwpV is expressed, no progeny phages
are generated (no plaques and no lysis), but the infection process could be abrogated at many
different steps. Considering the location of CwpV at the cell surface, the first obvious
hypothesis was that CwpV blocked phage adsorption, thus cutting short the whole infection
process at the very early steps. To test this, we performed phage adsorption assays with C.
difficile strains expressing either the full-length cwpV-II gene from a plasmid
(R20291pOS200), or from the chromosome (R20291ON). We also compared adsorption with
a strain that does not express cwpV (R20291OFF). As shown in Fig. 4, results with wild type
R20291 and the R20291OFF strains were almost identical, with adsorption rates of 98.7% ±
0.5 and 98.0% ± 0.5 respectively. The adsorption on R20291ON and R20291pOS200 was
106
similar but slightly lower, with rates of 92.9% ± 2.2 and 92.8% ± 1.4, respectively. Although
the difference in phage adsorption between R20291OFF and R20291pOS200 was statistically
significant (p = 0.014), it cannot explain the difference seen in phage infection and the high
level of protection observed in spot-test, EOP and bacterial survival assays. Therefore, we
concluded that the antiphage activity does not result from a defect in phage adsorption, but
that a step downstream in the infection process is probably affected.
*
% phage adsorption
100
90
80
70
60
50
0
0
R2
29
1
R2
9
02
FF
1O
R2
9
02
N
1O
FF
91 O
02 0
R 2 S2 0
pO
Fig. 4. Phage adsorption assay of ϕCD38-2 on strains expressing or not the type II
CwpV. Phages were allowed to adsorb for 30 min and then bacteria were pelleted. The
adsorption rate is expressed as a percentage of the ratio between non-adsorbed phages in the
supernatant compared to the initial phage inoculum. Vertical bars represent means ± SD of
three independent biological replicates, which were also plated in technical triplicates. Oneway ANOVA comparisons were done with R20291OFF as the reference strain (*, p < 0.05).
A logical hypothesis would be that CwpV blocks phage DNA injection, since the protein is
located at the cell surface. To verify this, we performed time-course phage infection assays
during which ϕCD38-2 genomic DNA replication was monitored by Southern blotting in the
absence (R20291OFF) or presence (R20291pOS200 of the full-length CwpV-II (Fig. 5).
Replication of phage DNA was readily detected after 20 min post-infection in R20291OFF
and reached its maximum intensity after 60-90 minutes, which is in agreement with our
previous data on the phage lytic cycle [29]. On the other hand, no phage DNA replication
could be detected at any time point in R20291pOS200 expressing cwpV even after 90
107
minutes. This result strongly suggests that phage DNA does not enter bacterial cells when
0 20 40 60 90
CD38-2
Time post-infection
(min)
NI
Marker
0 20 40 60 90
CD38-2
NI
Time post-infection
(min)
Southern blot
Agarose gel
Marker
CwpV is present at the cell surface.
R20291OFF
R20291OFF(pOS200)
Fig. 5. Phage DNA replication assay. The R20291OFF and R20291OFF strain carrying the
pOS200 plasmid enabling overexpression of the type II CwpV were each infected with
ϕCD38-2 at an MOI of 1. Samples of the infected cultures were collected at different time
points post-infection and whole bacterial genomic DNA was extracted. DNA was digested
with HindIII and analysed by agarose gel and ethidium bromide staining (upper panel).
Southern blot hybridization using a Dig-labelled whole phage DNA probe was then
performed to detect phage DNA replication (lower panel). A non-infected (NI) control was
run in parallel, along with a positive control consisting in the purified ϕCD38-2 DNA.
Yet, we could not rule out the possibility that phage DNA was injected, but that intracellular
CwpV in transition to the cell surface quickly inhibited phage replication. To address this,
we constructed pOS203, a plasmid encoding a CwpV mutant lacking only the signal peptide;
108
we do not expect such a mutant to be exported to the cell surface (Fig. 3). The pOS203
plasmid was transferred into the R20291OFF strain (yielding R20291pOS203) to avoid
contribution from the chromosomal copy of cwpV. The absence of CwpV from the cell
surface was confirmed by immunofluorescence on intact cells (Fig. S1) and by analyzing Slayer extracts by SDS-PAGE and Western blot (Fig. S2). However, CwpV was detected in
the cytoplasmic fraction, confirming that the protein was expressed (Fig. S2). Strain
R20291pOS203 proved to be fully susceptible to infection with phage ϕCD38-2, with an
EOP value of ~1. Therefore, the presence of intracellular CwpV-II does not interfere with
phage DNA replication and the infection proceeds normally. Taken together, our results show
that CwpV does not block adsorption, but it likely block phage DNA injection. Therefore,
our data strongly suggest that CwpV functions in a way similar to superinfection exclusion
(Sie) systems, although it is not encoded by a prophage.
109
Discussion
In this study, we provide experimental evidence showing that the cell wall protein CwpV
protects C. difficile from phage infection. We show that all five types of CwpV protect against
siphophages, whereas types I, III and V protect against infection by myophages, although
less efficiently. The C-terminal, repeat-containing region of CwpV carries the antiphage
activity. Our data further show that phage particles are able to adsorb to their host, but the
absence of phage DNA replication suggests that the inhibition occurs at the step of DNA
injection. Such antiphage phenotype is reminiscent of the superinfection exclusion (Sie)
family of proteins, which are generally membrane-associated prophage-encoded proteins
[4,9,10]. CwpV thus represents a novel host-encoded cell wall-associated and phase-variable
Sie-like antiphage system ubiquitous within the C. difficile species.
Constitutive expression of any type of CwpV from a plasmid was sufficient to completely
block infection by three related phages from the Siphoviridae family. However, in the
R20291ON strain in which cwpV is expressed constitutively from its own promoter, protection
was somewhat reduced in survival assays with ~75% survival. In addition, EOP values of
only 0.5 to 10-1 were observed with the R20291ON strain (data not shown), suggesting that
the phage-to-host ratio is critical for optimal protection. According to a previous study, the
amount of CwpV in “ON” cells represents 13.3% of the total surface proteins [24]. The major
cell wall protein is SlpA that forms a two-dimensional array into which CwpV is likely
inserted. Hence, areas or zones of the cell surface may be devoid of CwpV, which would
explain why at high MOI, phages successfully infect the cell. The accumulation of CwpV at
the cell surface is greater when expression occurs from a multi-copy plasmid. In agreement
with this, our qRT-PCR analyses showed 6.25-fold more expression in R20291OFFpOS200
compared with the R20291ON. Likewise, SLP extractions also showed higher amounts of
CwpV in extracts from cells expressing the gene from a plasmid compared to locked-ON
cells (Figure S1). It is also possible that a certain amount of CwpV must be present at the
surface to reach a stoichiometric threshold with a bacterial component participating in phage
infection. For example, the number of copies of the outer membrane porin OmpC used as a
phage receptor by phage T4 is estimated at around 102 to 103 per E. coli K-12 cell [47]. A
similar dose-dependent response has been reported with other antiphage systems such as
110
those from lactic acid bacteria, whereby transferring the antiphage gene onto a high copy
plasmid leads to a stronger antiphage phenotype [9,11,48]. C. difficile cells that turn “ON”
the expression of cwpV probably produce enough of the protein to acquire significant
protection against phage infection in an in vivo context, where the MOI for a specific phages
is probably low compared to in vitro conditions.
We showed that CwpV has a very strong antiphage activity towards all three siphophages
tested (ϕCD38-2, ϕCD111 and ϕCD146) whereas it has only modest activity against the
myophages (ϕMMP01 and ϕCD52). Of note, the three siphophages used are very similar
genetically and morphologically, yet they have slightly different host spectra [17]. On the
other hand, the ϕMMP01 and ϕCD52 myophages are different from the siphophages, both
genetically and morphologically, and they also have distinct host spectra [17]. The fact that
CwpV is active against both phage families suggests that it interferes with a phage structure
or at a step of the infection process common to both groups. Knowledge on the biology and
molecular structure of C. difficile phages is very limited so it is hard to tell which features of
the siphophages and myophages CwpV could target. Likewise, the bacterial receptor(s)
recognized by these phages to infect their host is(are) unknown. Such receptor could be a
surface carbohydrate, a membrane protein, or other another surface component [49].
However, phage adsorption is not prevented in cells expressing cwpV, suggesting that CwpV
does not block a phage receptor. Moreover, since we did not detect phage DNA replication
inside infected cells, the most logical hypothesis is that CwpV interferes with phage DNA
injection. This is further supported by the fact that the infection process was not altered in
cells expressing a cwpV mutant lacking the signal peptide required to export CwpV to the
cell surface. In summary, CwpV does not interfere with phage DNA replication, so the
interaction is likely occurring at the cell surface with the fully processed CwpV.
We observed that the C-terminus of CwpV carrying tandem amino acid repeats is responsible
for the antiphage phenotype. All five types of CwpV share a common structure [24]. The Nterminal part contains a signal peptide and three highly conserved CWB2 domains required
for CwpV anchoring at the cell surface. On the other hand, the C‑ terminal region is
composed of four to nine amino acid repeats, which vary in size and sequence among C.
difficile isolates. The C-terminal part extends outward from the bacterial surface. Therefore,
111
we hypothesized that the C-terminal domain was responsible for the antiphage activity of
CwpV. This was confirmed by deleting the entire set of repeats from CwpV-II, which
completely abolished the antiphage phenotype, although the protein was still exported to the
cell surface (Fig. S2). On the other hand, the antiphage activity was only partially disrupted
after deletion of the five distal repeats, leaving only the three proximal repeats associated
with the N-terminal fragment. This observation suggests that the number of repeats rather
than their sequence is crucial for CwpV-mediated antiphage activity.
Our hypothesis is that CwpV interacts with a structural component of the phage tail, which
would be conserved between similar siphophages, and that would be sufficiently different in
myophages to cause a reduction in the observed antiphage activity. Both Myoviridae and
Siphoviridae phages are part of the order Caudovirales, which includes all tailed phages, and
it is not uncommon to find phages with identical morphologies, but which are completely
different genetically. By extension, the structure of phage tails is thus highly conserved [50].
For example, siphophages and myophages have similar tail complexes composed of a distal
tail tip (or baseplate) required for host recognition. This baseplate also initiates
polymerization of the tail tube during phage assembly, through which phage DNA is ejected
during infection. Terminator proteins complete the tail assembly and enable attachment to
the capsid. Polymerization of the tail tube is directed by the ruler protein, also called the tape
measure protein (TMP) which determines the length of the tail tube [50]. The structural
distinction between siphophages and myophages therefore lies mainly in the presence of a
contractile tail sheath surrounding the tail tube of the latter.
Because there is no sequence homology between the siphophages and myophages used in
our study, it is hard to tell which phage structural component(s) CwpV could target. We
hypothesize that CwpV interacts with components conserved between the two families and
that are less accessible in myophages. The absence of a tail sheath in siphophages leaves the
tail tube entirely exposed and might serve as a potential target for CwpV. In myophages such
as the coliphage T4, the tail tube becomes exposed only after tail sheath contraction, which
is triggered by interactions of phage tail fibers with bacterial host receptors [51]. In the
siphophage λ, the tail tube protein gpV harbors an Ig-like domain 2 (Big_2) in its C-terminal
region, which protrudes outside of the tail tube, and which was shown to be required for
112
optimal host adsorption and infectivity [52]. The importance of the tail tube and TMP in
resistance to superinfection exclusion activity was recently evidenced with coliphages HK97
and HK022 [53]. HK97 encodes gp15, a membrane protein with superinfection exclusion
activity. Although HK97 and HK022 share extensive sequence homology in their capsid and
tail tip proteins, HK022 is not susceptible to the action of gp15. However, a HK97/022 hybrid
phage in which a genomic region encoding the tail tube and TMP from HK97 has been
replaced with that of HK022 is no longer inhibited by gp15. Therefore, gp15 from HK97
prevents phage DNA entry through interaction with the phage tail tube or TMP [53].
In Gram-positive bacteria, only a few examples of Sie systems have been described,
including the 142 amino acids lipoprotein Ltp encoded by the the S. thermophilus phage TPJ34 [11]. Most phages infecting S. thermophilus are related to the lactococcal BK5-T-like
phages, and Ltp from TP-J34 confers protection against streptococcal phages (EOP of about
10-2) [11]. Surprisingly though, it provides stronger protection against some 936 phages
infecting L. lactis, in particular phage P008, with an EOP < 10-9 [12]. This highlights the
potentially wide spectrum of some Sie systems. In a recent study, the crystal structure of the
Ltp protein was reported [12] and mutants of phage P008 capable of bypassing the Ltp
antiphage activity were also isolated. Genome sequencing revealed specific mutations in the
gene encoding the TMP, suggesting that Ltp targets this specific protein. However, there is
no direct experimental evidence of the interaction between Ltp and TMP [54]. In myophages,
exposure of the tail tube and TMP is physically and temporally limited contrary to
siphophages [51]. Hence, it is tempting to speculate that CwpV interacts with the tail tube
protein or the TMP, which would explain why myophages are less sensitive to the antiphage
activity of CwpV. The polymeric and helical nature of the tail tube and TMP [51,55] could
possibly allow for interaction with the repetitive nature of CwpV. In agreement with this, a
partially truncated version of CwpV in which 5 of the distal C-terminal repeats have been
deleted has a reduced antiphage activity against siphophages, whereas complete removal of
the C-terminal repeats cause a complete loss of activity. Despite the use of high phage titers
(up to 5x109 pfu), we did not detect phage plaques upon infection of a C. difficile strain overexpressing cwpV, showing that the CwpV antiphage system is very efficient. As a result, we
were unable to isolate phage mutants capable of overcoming the antiphage activity of CwpV,
which could have give us hints about the possible phage target.
113
One limitation of our study was the availability of a susceptible strain that could be similarly
infected by both siphophages and myophages and that could be genetically manipulated to
reintroduce various cwpV genes. Phages infecting C. difficile generally have narrow host
spectra [17,56-60], and isolates that are fully susceptible to siphophages are not, or only
partially susceptible to infection by myophages and vice versa [17,29,46]. The use of such
isolates for EOP and bacterial survival assays is therefore not appropriate.
Concluding remarks
The mammalian gut is probably the only environment where C. difficile can develop
adequately due to its extreme sensitivity to oxygen. Outside the mammalian host, spores are
likely the dominant form. The mammalian gut is a flourishing ecosystem where hundreds of
species and trillions of bacteria compete to keep a foothold in the lumen or on the mucosal
layer. It is not surprising to find numerous phages in the gut, for the most part temperate
phages resulting from prophage induction [61]. Several of the identified phages fall within
the Siphoviridae family of the order Caudovirales [62]. Therefore, gut bacteria are expected
to experience frequent encounters with temperate phages, with the consequence of being
killed or lysogenized. Alternatively, bacteria can acquire new genetic material through
transducing particles that were shown to have a role in dissemination of antibiotic resistance
genes [63]. Phase variation in the bacterial world has often been associated with immune
evasion during pathogenic infections. But in fact, phase variation might serve multiple other
functions associated with virulence, persistence, and colonization [64-68]. The phasevariable expression of R-M systems present in many bacteria is another interesting example
[42,69] whereby sub-populations of cells that express the R-M system are protected against
phage infection, while the remaining cells are susceptible to phage attacks and transduction
[42,64]. Hence, bacteria have evolved multiple mechanisms to avoid being killed by lytic
phages, while remaining susceptible to the acquisition of new potentially beneficial
prophages [2,3]. The expression of a phase-variable antiphage system such as CwpV
becomes highly relevant in a context where multiple phage marauders are present in the gut.
The importance of CwpV in protection against phage infection in vivo will need to be
investigated but the ubiquitous, yet variable nature of CwpV suggests that C. difficile has
114
evolved a highly efficient system that could possibly provide broad-spectrum antiphage
resistance in the gut environment.
Authors' contributions
Conceived and designed the experiments: OS, LCF. Performed the experiments: OS, MOB.
Contributed reagents/materials/analysis tools: NF, AFH, LCF. Analyzed the data: OS, LCF.
Wrote the paper: OS, NF, LCF.
Acknowledgements
We thank people at Immune Biosolutions for technical help with antibodies.
References
1.
Hatfull GF (2008) Bacteriophage genomics. Curr Opin Microbiol 11: 447–453.
doi:10.1016/j.mib.2008.09.004.
2.
Brussow H, Canchaya C, Hardt W-D (2004) Phages and the evolution of bacterial
pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol
Biol Rev 68: 560–602. doi:10.1128/MMBR.68.3.560-602.2004.
3.
Fortier L-C, Sekulovic O (2013) Importance of prophages to evolution and virulence
of bacterial pathogens. Virulence 4: 354–365. doi:10.4161/viru.24498.
4.
Labrie SJ, Samson JE, Moineau S (2010) Bacteriophage resistance mechanisms. Nat
Rev Micro 8: 317–327. doi:10.1038/nrmicro2315.
5.
Pingoud A, Fuxreiter M, Pingoud V, Wende W (2005) Type II restriction
endonucleases: structure and mechanism. Cellular and Molecular Life Sciences
(CMLS) 62: 685–707. doi:10.1007/s00018-004-4513-1.
6.
Chopin M-C, Chopin A, Bidnenko E (2005) Phage abortive infection in lactococci:
variations
on
a
theme.
Curr
Opin
Microbiol
8:
473–479.
doi:10.1016/j.mib.2005.06.006.
7.
Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, et al. (2007) CRISPR
115
provides acquired resistance against viruses in prokaryotes. Science (New York, NY)
315: 1709–1712.
8.
Lu MJ, Henning U (1994) Superinfection exclusion by T-even-type coliphages.
Trends Microbiol 2: 137–139.
9.
McGrath S, Fitzgerald GF, van Sinderen D (2002) Identification and characterization
of phage-resistance genes in temperate lactococcal bacteriophages. Mol Microbiol 43:
509–520.
10.
Mahony J, McGrath S, Fitzgerald GF, van Sinderen D (2008) Identification and
characterization of lactococcal-prophage-carried superinfection exclusion genes. Appl
Environ Microbiol 74: 6206–6215. doi:10.1128/AEM.01053-08.
11.
Sun X, Gohler A, Heller KJ, Neve H (2006) The ltp gene of temperate Streptococcus
thermophilus phage TP-J34 confers superinfection exclusion to Streptococcus
thermophilus
and
Lactococcus
lactis.
Virology
350:
146–157.
doi:10.1016/j.virol.2006.03.001.
12.
Bebeacua C, Lorenzo Fajardo JC, Blangy S, Spinelli S, Bollmann S, et al. (2013) Xray structure of a superinfection exclusion lipoprotein from phage TP-J34 and
identification of the tape measure protein as its target. Mol Microbiol 89: 152–165.
doi:10.1111/mmi.12267.
13.
Jarvis A, Fitzgerald G, Mata M, Mercenier A, Neve H, et al. (1991) Species and type
phages of lactococcal bacteriophages. Intervirology 32: 2–9.
14.
Mahony J, Deveau H, Mc Grath S, Ventura M, Canchaya C, et al. (2006) Sequence
and comparative genomic analysis of lactococcal bacteriophages jj50, 712 and P008:
evolutionary insights into the 936 phage species. FEMS Microbiol Lett 261: 253–261.
doi:10.1111/j.1574-6968.2006.00372.x.
15.
Vecchio Lo A, Zacur GM (2012) Clostridium difficile infection: an update on
epidemiology, risk factors, and therapeutic options. Curr Opin Gastroenterol 28: 1–9.
doi:10.1097/MOG.0b013e32834bc9a9.
116
16.
Hargreaves KR, Clokie MRJ (2014) Clostridium difficile phages: still difficult? Front
Microbiol 5: 184. doi:10.3389/fmicb.2014.00184.
17.
Sekulovic O, Garneau JR, Néron A, Fortier L-C (2014) Characterization of Temperate
Phages Infecting Clostridium difficile Isolates of Human and Animal Origins. Appl
Environ Microbiol 80: 2555–2563. doi:10.1128/AEM.00237-14.
18.
Goh S, Ong PF, Song KP, Riley TV, Chang BJ (2007) The complete genome sequence
of Clostridium difficile phage phiC2 and comparisons to phiCD119 and inducible
prophages
of
CD630.
Microbiology
(Reading,
Engl)
153:
676–685.
doi:10.1099/mic.0.2006/002436-0.
19.
Hargreaves KR, Kropinski AM, Clokie MR (2014) Bacteriophage behavioral ecology:
How phages alter their bacterial host's habits. Bacteriophage 4: e29866.
doi:10.4161/bact.29866.
20.
Stabler RA, He M, Dawson L, Martin M, Valiente E, et al. (2009) Comparative
genome and phenotypic analysis of Clostridium difficile 027 strains provides insight
into the evolution of a hypervirulent bacterium. Genome Biol 10: R102.
doi:10.1186/gb-2009-10-9-r102.
21.
Hargreaves KR, Flores CO, Lawley TD, Clokie MRJ (2014) Abundant and diverse
clustered regularly interspaced short palindromic repeat spacers in Clostridium
difficile strains and prophages target multiple phage types within this pathogen. mBio
5: e01045–13. doi:10.1128/mBio.01045-13.
22.
Soutourina OA, Monot M, Boudry P, Saujet L, Pichon C, et al. (2013) Genome-Wide
Identification of Regulatory RNAs in the Human Pathogen Clostridium difficile. PLoS
Genet 9: e1003493. doi:10.1371/journal.pgen.1003493.
23.
Purdy D, O'Keeffe TAT, Elmore M, Herbert M, McLeod A, et al. (2002) Conjugative
transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile
through circumvention of the restriction barrier. Mol Microbiol 46: 439–452.
24.
Reynolds CB, Emerson JE, La Riva de L, Fagan RP, Fairweather NF (2011) The
117
Clostridium difficile cell wall protein CwpV is antigenically variable between strains,
but exhibits conserved aggregation-promoting function. PLoS Pathog 7: e1002024.
doi:10.1371/journal.ppat.1002024.
25.
Fagan RP, Fairweather NF (2011) Clostridium difficile has two parallel and essential
Sec secretion systems. Journal of Biological Chemistry 286: 27483–27493.
doi:10.1074/jbc.M111.263889.
26.
Dembek M, Reynolds CB, Fairweather NF (2012) Clostridium difficile Cell Wall
Protein CwpV Undergoes Enzyme-independent Intramolecular Autoproteolysis.
Journal of Biological Chemistry 287: 1538–1544. doi:10.1074/jbc.M111.302463.
27.
Willing SE, Candela T, Shaw HA, Seager Z, Mesnage S, et al. (2015) Clostridium
difficile surface proteins are anchored to the cell wall using CWB2 motifs that
recognise the anionic polymer PSII. Mol Microbiol: n/a–n/a. doi:10.1111/mmi.12958.
28.
Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, et al. (2009) A novel
genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell
wall protein. Mol Microbiol 74: 541–556. doi:10.1111/j.1365-2958.2009.06812.x.
29.
Sekulovic O, Meessen-Pinard M, Fortier L-C (2011) Prophage-stimulated toxin
production in Clostridium difficile NAP1/027 lysogens. J Bacteriol 193: 2726–2734.
doi:10.1128/JB.00787-10.
30.
Fortier L-C, Moineau S (2009) Phage production and maintenance of stocks, including
expected stock lifetimes. Methods Mol Biol 501: 203–219. doi:10.1007/978-1-60327164-6_19.
31.
Fortier L-C, Bouchard JD, Moineau S (2005) Expression and site-directed
mutagenesis of the lactococcal abortive phage infection protein AbiK. J Bacteriol 187:
3721–3730. doi:10.1128/JB.187.11.3721-3730.2005.
32.
Sekulovic O, Fortier L-C (2014) Global transcriptional response of Clostridium
difficile
carrying
the
phiCD38-2
doi:10.1128/AEM.03656-14.
prophage.
Appl
Environ
Microbiol.
118
33.
Petersen TN, Brunak S, Heijne von G, Nielsen H (2011) SignalP 4.0: discriminating
signal peptides from transmembrane regions. Nature methods 8: 785–786.
doi:10.1038/nmeth.1701.
34.
Heijne von G, Abrahmsén L (1989) Species-specific variation in signal peptide design.
Implications for protein secretion in foreign hosts. FEBS Lett 244: 439–446.
35.
van Roosmalen ML, Geukens N, Jongbloed JDH, Tjalsma H, Dubois J-YF, et al.
(2004) Type I signal peptidases of Gram-positive bacteria. Biochim Biophys Acta
1694: 279–297. doi:10.1016/j.bbamcr.2004.05.006.
36.
Gibson DG, Young L, Chuang R-Y, Venter JC, Hutchison CA, et al. (2009) Enzymatic
assembly of DNA molecules up to several hundred kilobases. Nature methods 6: 343–
345. doi:10.1038/nmeth.1318.
37.
Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual, 3rd ed. Cold
Spring Harbor NY.: Cold Spring Harbor Laboratory Press.
38.
Hyman P, Abedon ST (2009) Practical methods for determining phage growth
parameters. Methods Mol Biol 501: 175–202. doi:10.1007/978-1-60327-164-6_18.
39.
Domingues S, Chopin A, Ehrlich SD, Chopin M-C (2004) The lactococcal abortive
phage infection system AbiP prevents both phage DNA replication and temporal
transcription switch. J Bacteriol 186: 713–721. doi:10.1128/JB.186.3.713-721.2004.
40.
Fortier L-C, Moineau S (2007) Morphological and genetic diversity of temperate
phages in Clostridium difficile. Appl Environ Microbiol 73: 7358–7366.
doi:10.1128/AEM.00582-07.
41.
Seed KD, Faruque SM, Mekalanos JJ, Calderwood SB, Qadri F, et al. (2012) Phase
variable O antigen biosynthetic genes control expression of the major protective
antigen and bacteriophage receptor in Vibrio cholerae O1. PLoS Pathog 8: e1002917.
doi:10.1371/journal.ppat.1002917.
42.
Hoskisson PA, Smith MCM (2007) Hypervariation and phase variation in the
119
bacteriophage
'resistome'.
Curr
Opin
Microbiol
10:
396–400.
doi:10.1016/j.mib.2007.04.003.
43.
Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The ClosTron: a
universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70:
452–464. doi:10.1016/j.mimet.2007.05.021.
44.
Oppenheim AB, Kobiler O, Stavans J, Court DL, Adhya S (2005) Switches in
bacteriophage
lambda
development.
Annu
Rev
Genet
39:
409–429.
doi:10.1146/annurev.genet.39.073003.113656.
45.
Ackermann H-W, Prangishvili D (2012) Prokaryote viruses studied by electron
microscopy. Arch Virol 157: 1843–1849. doi:10.1007/s00705-012-1383-y.
46.
Meessen-Pinard M, Sekulovic O, Fortier L-C (2012) Evidence of in vivo prophage
induction during Clostridium difficile infection. Appl Environ Microbiol 78: 7662–
7670. doi:10.1128/AEM.02275-12.
47.
Lu MJ, Stierhof YD, Henning U (1993) Location and unusual membrane topology of
the immunity protein of the Escherichia coli phage T4. Journal of Virology 67: 4905–
4913.
48.
Bouchard JD, Dion E, Bissonnette F, Moineau S (2002) Characterization of the twocomponent abortive phage infection mechanism AbiT from Lactococcus lactis. J
Bacteriol 184: 6325–6332.
49.
Chapot-Chartier M-P (2014) Interactions of the cell-wall glycopolymers of lactic acid
bacteria
with
their
bacteriophages.
Front
Microbiol
5:
236.
doi:10.3389/fmicb.2014.00236.
50.
Fokine A, Rossmann MG (2014) Molecular architecture of tailed double-stranded
DNA phages. Bacteriophage 4: e28281. doi:10.4161/bact.28281.
51.
Leiman PG, Kanamaru S, Mesyanzhinov VV, Arisaka F, Rossmann MG (2003)
Structure and morphogenesis of bacteriophage T4. Cell Mol Life Sci (CMLS) 60:
120
2356–2370. doi:10.1007/s00018-003-3072-1.
52.
Pell LG, Gasmi-Seabrook GMC, Morais M, Neudecker P, Kanelis V, et al. (2010) The
solution structure of the C-terminal Ig-like domain of the bacteriophage λ tail tube
protein. J Mol Biol 403: 468–479. doi:10.1016/j.jmb.2010.08.044.
53.
Cumby N, Edwards AM, Davidson AR, Maxwell KL (2012) The bacteriophage HK97
gp15 moron element encodes a novel superinfection exclusion protein. J Bacteriol
194: 5012–5019. doi:10.1128/JB.00843-12.
54.
Bebeacua C, Tremblay D, Farenc C, Chapot-Chartier M-P, Sadovskaya I, et al. (2013)
Structure, adsorption to host, and infection mechanism of virulent lactococcal phage
p2. J Virol 87: 12302–12312. doi:10.1128/JVI.02033-13.
55.
Plisson C, White HE, Auzat I, Zafarani A, São-José C, et al. (2007) Structure of
bacteriophage SPP1 tail reveals trigger for DNA ejection. EMBO J 26: 3720–3728.
doi:10.1038/sj.emboj.7601786.
56.
Sell TL, Schaberg DR, Fekety FR (1983) Bacteriophage and bacteriocin typing
scheme for Clostridium difficile. J Clin Microbiol 17: 1148–1152.
57.
Dei R (1989) Observations on phage-typing of Clostridium difficile: preliminary
evaluation of a phage panel. Eur J Epidemiol 5: 351–354.
58.
Mahony DE, Clow J, Atkinson L, Vakharia N, Schlech WF (1991) Development and
application of a multiple typing system for Clostridium difficile. Appl Environ
Microbiol 57: 1873–1879.
59.
Mahony DE, Bell PD, Easterbrook KB (1985) Two bacteriophages of Clostridium
difficile. J Clin Microbiol 21: 251–254.
60.
Goh S, Riley TV, Chang BJ (2005) Isolation and characterization of temperate
bacteriophages of Clostridium difficile. Appl Environ Microbiol 71: 1079–1083.
61.
Mills Susan, Shanahan F, Stanton C, Hill C, Coffey Aidan, et al. (2013) Movers and
121
shakers: Influence of bacteriophages in shaping the mammalian gut microbiota. Gut
microbes 4: 3–2. doi:10.4161/gmic.22371.
62.
Breitbart M, Hewson I, Felts B, Mahaffy JM, Nulton J, et al. (2003) Metagenomic
analyses of an uncultured viral community from human feces. J Bacteriol 185: 6220–
6223.
63.
Modi SR, Lee HH, Spina CS, Collins JJ (2013) Antibiotic treatment expands the
resistance reservoir and ecological network of the phage metagenome. Nature 499:
219–222. doi:10.1038/nature12212.
64.
van der Woude MW (2006) Re-examining the role and random nature of phase
variation.
FEMS
Microbiol
Lett
254:
190–197.
doi:10.1111/j.1574-
6968.2005.00038.x.
65.
Kearns DB, Losick R (2005) Cell population heterogeneity during growth of Bacillus
subtilis. Genes Dev 19: 3083–3094. doi:10.1101/gad.1373905.
66.
Li X, Lockatell CV, Johnson DE, Mobley HLT (2002) Identification of MrpI as the
sole recombinase that regulates the phase variation of MR/P fimbria, a bladder
colonization factor of uropathogenic Proteus mirabilis. Mol Microbiol 45: 865–874.
67.
Alamro M, Bidmos FA, Chan H, Oldfield NJ, Newton E, et al. (2014) Phase variation
mediates reductions in expression of surface proteins during persistent meningococcal
carriage. Infect Immun 82: 2472–2484. doi:10.1128/IAI.01521-14.
68.
Tauseef I, Ali YM, Bayliss CD (2013) Phase variation of PorA, a major outer
membrane protein, mediates escape of bactericidal antibodies by Neisseria
meningitidis. Infect Immun 81: 1374–1380. doi:10.1128/IAI.01358-12.
69.
Dybvig K, Sitaraman R, French CT (1998) A family of phase-variable restriction
enzymes
with
differing
specificities
generated
by
high-frequency
gene
rearrangements. Proc Natl Acad Sci U S A 95: 13923–13928.
70.
Stabler RA, Gerding DN, Songer JG, Drudy D, Brazier JS, et al. (2006) Comparative
122
phylogenomics of Clostridium difficile reveals clade specificity and microevolution of
hypervirulent strains. J Bacteriol 188: 7297–7305. doi:10.1128/JB.00664-06.
71.
Sirard S, Valiquette L, Fortier L-C (2011) Lack of association between clinical
outcome of Clostridium difficile infections, strain type, and virulence-associated
phenotypes. J Clin Microbiol 49: 4040–4046. doi:10.1128/JCM.05053-11.
123
CHAPITRE IV
DISCUSSION
Rappel des objectifs du projet
Les relations phages-hôtes s’inscrivent dans le grand concept de la coévolution des
espèces. Contrairement à d’autres systèmes qui présentent un aspect évolutif unidirectionnel
caractérisé par une relation soit mutualiste soit antagoniste, la nature des relations phage-hôte
présente une certaine dualité. Elle peut être qualifiée de mutualiste dans le cas des phages
tempérés ou à l’inverse d’antagoniste lorsqu’on examine les conséquences du phénomène de
phage-host arms race. Au final, les conséquences de ces relations, autant mutualistes
qu’antagonistes, peuvent avoir de grandes implications pour la santé de l’Homme, tel
qu’illustré par l’impact des phages tempérés sur la virulence des bactéries pathogènes. Cet
aspect a été largement étudié durant les cinquante dernières années et concerne les principaux
pathogènes bactériens qui causent des maladies communes (Brussow et al., 2004; Fortier et
Sekulovic, 2013). Cependant, les relations phage-hôte ont été relativement peu explorées par
la communauté scientifique dans l’étude de la virulence du pathogène entérique Clostridium
difficile. Les premières études sur le sujet ont constaté la présence de multiples prophages
inductibles au sein de l’espèce, mais ils ne semblaient pas véhiculer de facteurs de virulence
majeurs. Cependant, il est bien connu que les phages tempérés peuvent influencer la biologie
de leurs hôtes bactériens par divers moyens plus subtils. De plus, les études subséquentes ont
remarqué que la présence de certains prophages (dont φCD38-2, caractérisé dans notre
laboratoire) altère la production de toxines par C. difficile suggérant qu’il existe un lien entre
les phages et la virulence bactérienne. Le but de la présente étude visait à élargir nos
connaissances sur les relations phage-hôte chez C. difficile en examinant l’impact du phage
φCD38-2 sur le transcriptome de la souche épidémique R20291.
Dans un premier temps, nous nous sommes intéressés à l’expression génique des
prophages impliqués dans cette étude. Ainsi, nous avons caractérisé les profils
124
transcriptomiques détaillés du phage φCD38-2, mais aussi du prophage phi-027 qui est
présent d’emblée dans le génome de la souche bactérienne utilisée pour l’étude.
Par la suite, nous avons entrepris la caractérisation de l’impact du phage φCD38-2 sur
le transcriptome intégral de la souche épidémique R20291 de C. difficile. Cet objectif a été
réalisé en comparant le transcriptome de la R20291 en présence ou en absence du prophage
φCD38-2. Ainsi, les gènes exprimés de manière différentielle en présence du phage ont été
identifiés et répertoriés.
Finalement, le produit du gène présentant la plus grande altération transcriptionnelle
en présence du phage a été caractérisé davantage dans son contexte biologique. Il s’agit d’une
protéine de surface nommée CwpV dont l’expression est régulée par un mécanisme de
variation de phase. Son implication dans le processus d’infection des phages de C. difficile a
été explorée en détail.
Les considérations préliminaires de l’étude
Le phage φCD38-2 dans son contexte biologique
Le phage φCD38-2, utilisé tout au long de l’étude, est un phage tempéré appartenant à
la famille Siphoviridae de l’ordre Caudovirales. Son isolement par induction à la mitomycine
C à partir d’une souche clinique a été rapporté en 2007 (Fortier et Moineau, 2007). À cette
époque, seulement deux phages, φCD119 et φC2 de la famille des Myoviridae, avaient été
caractérisés au niveau moléculaire. Donc, par souci d’explorer la diversité des phages
infectant C. difficile, nous avons entrepris une caractérisation microbiologique et moléculaire
du φCD38-2.
Dans un premier temps, nous avons déterminé le spectre d’hôte sur une collection de
souches de C. difficile. Ainsi, nous avons déterminé que φCD38-2 était en mesure d’infecter
une proportion considérable des isolats épidémiques de type BI/NAP1/027. Cet aspect était
particulièrement intéressant, car cela nous permettait d’étudier l’impact du phage sur la
biologie bactérienne dans le contexte de souches d’intérêt clinique.
Le séquençage du génome entier a permis de constater une structure génomique
modulaire, typique des phages de l’ordre Caudovirales. Également, malgré l’absence de
facteurs de virulence évidents sur le génome du φCD38-2, nous avons évalué son implication
125
dans la production de toxines lorsqu’introduit sous forme de prophage dans une souche
épidémique. Ainsi, nous avons pu déterminer que la lysogénisation de la souche épidémique
CD274 par φCD38-2 résultait en une accumulation accrue des toxines A et B dans le
surnageant de culture. Une analyse subséquente a permis de constater une augmentation de
la transcription de l’ensemble des gènes du locus de pathogénicité en présence du phage. Ces
travaux préliminaires sur le phage φCD38-2 ont été publiés suite à mes travaux de maîtrise
et le manuscrit intégral est inclus dans l’Annexe I. L’ensemble de ces résultats a grandement
contribué à ce que le phage φCD38-2 soit choisi pour la suite de l’étude.
R20291 dans son contexte biologique
Mentionné pour la première fois en 2006 dans une étude sur la génomique comparative
de C. difficile, R20291 a été isolée dans un contexte épidémique dans l’hôpital Stoke
Mandeville en Angleterre (Stabler et al., 2006). Le génotypage a confirmé qu’il s’agit d’un
isolat de type BI/NAP1/027 très proche du clone épidémique nord-américain. Dans un effort
destiné à comprendre l’évolution de l’hypervirulence chez C. difficile, le génome de R20291
a été entièrement séquencé et comparé à un isolat BI/NAP1/027 pré-épidémique (Stabler et
al., 2009) ou utilisé dans une étude évolutive plus large (He et al., 2010). Ainsi, R20291 est
rapidement devenue la souche épidémique de référence. Également, la décision d’utiliser la
souche R20291 dans cette étude était basée sur plusieurs caractéristiques intéressantes, dont
son intérêt clinique, la disponibilité de sa séquence génomique, la possibilité de manipulation
génétique ainsi que la sensibilité au φCD38-2.
Le choix de la technique
En absence d’un phénotype facilement observable, les relations phage-hôte doivent être
décryptées à l’aide des techniques d’analyse à grande échelle. Ces interactions peuvent
prendre place au niveau du transcriptome bactérien et impliquer une altération de
l’expression génique ou des modifications post-transcriptionnelles. Également, on peut
imaginer des interactions au niveau du protéome bactérien qui peuvent impliquer des
modifications post-traductionnelles ou encore des interactions protéine-protéine. Cependant,
les interactions au niveau du protéome sont relativement difficiles à détecter et impliquent
l’utilisation de techniques laborieuses telles qu’un double hybride de levure couplée ou non
126
à une validation par la spectrométrie de masse. À l’inverse, l’étude des interactions au niveau
du transcriptome est techniquement plus facilement réalisable. Le développement des puces
à ADN a révolutionné l’analyse transcriptomique simultanée et à large échelle. D’ailleurs,
comme présentée dans l’introduction, cette technique a été amplement utilisée pour étudier
les relations phage-hôte. Cependant, une résolution relativement faible et une plage
dynamique limitée ont quelque peu restreint l’observation des changements mineurs. Avec
l’avènement de séquençage à haut débit (NGS, Next Generation Sequencing), de nouvelles
techniques d’analyse de transcriptome ont été développées dont la technique d’ARN-seq qui
implique le séquençage d’ADNc issu de l’ARN total. Elle présente plusieurs avantages par
rapport aux puces à ADN, notamment une plage dynamique pratiquement illimitée, une
meilleure sensibilité envers les transcrits faiblement exprimés et la possibilité de détecter de
nouveau transcrits. De plus, l’alignement des séquences permet de visualiser le profil
transcriptomique complet. En raison de ces caractéristiques, l’ARN-seq s’est imposé comme
technique de choix pour la présente étude.
L’analyse du transcriptome viral
Le profil transcriptomique du prophage phi-027
L'existence d’un myophage inductible présent dans plusieurs isolats de type
BI/NAP1/027 a été rapportée dès 2007 (Fortier et Moineau, 2007). Cependant, il a été
officiellement décrit en tant que phage phi-027 deux ans plus tard dans une analyse
génomique comparative entre les souches bactériennes pré-épidémiques et épidémiques
(Stabler et al., 2009). Également, sa distribution quasi universelle au sein du génotype
épidémique a soulevé des questions concernant son implication dans la virulence bactérienne
(He et al., 2010).
L’examen du profil transcriptomique du phi-027 à l’état du prophage dans la souche
R20291 a permis de constater une transcription soutenue dans l’ensemble du génome, avec
des variations prononcées dans certains modules (Figure 1, Chapitre II). À la lumière des
exemples présentés dans l’introduction, ce comportement semble plutôt inhabituel.
Généralement, les prophages ont une activité transcriptomique limitée surtout aux gènes
nécessaires pour le maintien de la lysogénie, tel que les répresseurs. Dans le cas du phi-027,
trois gènes possèdent la signature typique d’un répresseur CI qui comprend un domaine de
127
liaison à l’ADN à l’extrémité amino-terminale et un domaine de dimérisation à l’extrémité
carboxy-terminale. Toutefois, par analogie au système décrit chez le phage λ, seulement deux
de ces gènes sont en orientation opposée à un potentiel antirépresseur et donc, représentent
possiblement les véritables répresseurs nécessaires pour le maintien de la lysogénie. Leur
niveau d’expression est légèrement en dessous, mais globalement très similaire à la moyenne
du phage. Cette information nous indique qu’un niveau d’expression modérée des répresseurs
est nécessaire pour le maintien de la lysogénie chez phi-027. À ce niveau, le système est
similaire au phage λ qui nécessite une expression modérée du répresseur CI (Ptashne et al.,
1980), mais contraste avec le système décrit chez le mycobactériophage Giles infectant ou
une expression très élevée du répresseur a été observée durant la lysogénie (Dedrick et al.,
2013). Ces dissimilitudes reflètent possiblement les différentes stratégies évolutives
dépendantes du système de l’hôte. Ainsi, l’expression des répresseurs est attendue durant la
lysogénie, mais l’expression de la majorité des autres gènes, incluant les gènes structuraux,
est plutôt inhabituelle. Cette observation peut être expliquée par le phénomène d’induction
spontanée ou une faible proportion de prophages enclenchent le cycle lytique suite à
l’activation du système SOS bactérien. La détection du phage circulaire par PCR dans une
culture bactérienne sans inducteur et la reconstitution du site d’attachement bactérien (attB)
ont confirmé l’induction spontanée du phage phi-027, ce qui en revanche explique la
transcription des gènes normalement associés à un cycle lytique (Sekulovic et Fortier, 2014).
Dû à ce phénomène, il est difficile de distinguer les régions qui sont constitutivement
exprimées durant la lysogénie de celles qui sont exprimées durant le cycle lytique. Toutefois,
deux régions particulières méritent d’être mentionnées.
La première constitue deux gènes encodant des protéines hypothétiques situées à la fin
du module de régulation. Ces deux gènes comptent parmi les gènes les plus exprimés et
peuvent constituer une unité transcriptionnelle indépendante du reste du prophage. La
présence d’un promoteur canonique très similaire à celui identifié pour les gènes d’ARN
ribosomal chez C. difficile confirme cette hypothèse (Mani et al., 2006). Pour l’instant, le
rôle des protéines encodées par ces gènes n’est pas connu, cependant leur localisation suggère
un rôle dans la réplication, transcription ou la stabilité du phage.
La deuxième région intéressante comprend deux gènes situés à la fin du module de
lyse. Leur localisation génomique suggère une acquisition par accrétion, c’est-à-dire suite à
128
une excision imparfaite du phage. Ainsi, il pourrait s’agir de gènes de conversion
lysogénique, potentiellement impliqués dans la biologie de l’hôte. Le premier gène encode
une protéine de surface possédant un domaine classique d’ancrage à la paroi cellulaire
(CWB_2) à l’extrémité carboxy-terminale et un domaine de répétitions leucine-riche (leucine
rich repeats, LRR) à l’extrémité amino-terminale. Les protéines possédant un domaine LRR
semblent promouvoir les interactions protéine-protéine et donc peuvent être impliquées dans
divers processus biologiques (Kobe et Kajava, 2001). Par exemple, chez Salmonella
typhimurium et Yersinia pestis, des protéines de type LRR sont des effecteurs d’un système
de sécrétion de type III (TTSS) et sont essentielles pour la virulence (Evdokimov et al., 2001;
Miao et al., 1999). Chez Listeria monocytogenes, pathogène intracellulaire, les protéines de
surface de type LRR sont déterminantes dans le processus d’invasion cellulaire (Marino et
al., 2000). Ainsi, la protéine de type LRR encodée par le phi-027 pourrait potentiellement
jouer un rôle dans la virulence. Le deuxième gène de cette région encode une protéine ayant
une homologie avec les systèmes de toxine-antitoxine. Ces systèmes sont typiquement
encodés par les éléments génétiques mobiles tels que les plasmides ou les transposons
conjugatifs et assurent leur maintien lors de la division cellulaire.
La troisième région d’intérêt est comprise dans le module structural de la
morphogénèse de la queue du phage. Il s’agit d’une région non-codante comprise d’un
ensemble de répétitions de type CRISPR impliqué dans la résistance bactérienne aux
infections par les phages. Pour l’instant, il est impossible de confirmer la fonctionnalité du
système, mais son expression suggère une potentielle prise en charge par les protéines Cas
bactériennes, nécessaires pour la maturation du transcrit et son utilisation comme guide pour
la restriction de l’ADN entrant. Par contre, sa localisation sur le phi-027 suggère fortement
l’implication des phages dans la mobilité de ce type de système chez C. difficile. Cette
hypothèse est corroborée par l’observation que de nombreux phages et prophages chez C.
difficile encodent des cassettes de type CRISPRs. Cependant, leur fonctionnalité en tant que
systèmes antiphage n’a pas encore été confirmée (Hargreaves et al., 2014).
En somme, l’utilisation d’une technique de pointe telle que l’ARN-seq a permis
d’établir pour la première fois le profil transcriptomique détaillé du phage phi-027, qui est
ubiquitaire chez les souches épidémiques de type NAP1/027. Basés sur ce profil
transcriptomique, nous étions en mesure de déterminer l’existence de nombreux nouveaux
129
cadres de lectures dans le génome du phage qui ont échappé à l’annotation préalable.
Également, en comparant l’expression de chacun des gènes par rapport à la moyenne
d’expression du génome, nous étions en mesure d’observer une surexpression significative
de certaines régions particulières du phi-027. Toutefois, à ce stade-ci, il est difficile d’évaluer
si cette expression peut avoir un impact quelconque sur la biologie de la bactérie hôte. Donc,
malgré une abondance de données transcriptomiques, la caractérisation fonctionnelle de
certains gènes d’intérêt sera nécessaire pour apprécier davantage les relations de ce couple
phage-hôte.
Le profil transcriptomique du prophage φCD38-2
L’examen du profil transcriptomique du φCD38-2 a révélé plusieurs similitudes avec
le transcriptome du phage phi-027. Par exemple, on observe une expression relativement
constante à travers le génome, incluant les gènes structuraux et les gènes du module de lyse.
Encore une fois, cette expression peut être attribuée au phénomène de l’induction spontanée
puisqu’on détecte environ 5x105 PFU/ml lorsque R20291LYS est cultivée sans stress externe.
Cependant, deux observations sont uniques au transcriptome du φCD38-2.
Premièrement, l’expression moyenne pour l’ensemble des gènes (incluant le répresseur
CI) est environ deux fois plus grande par rapport au phage phi-027. Une plus grande activité
transcriptomique peut signifier une plus grande activité lytique. Cependant, en absence d’une
souche sensible pour le phage phi-027, il est très difficile de comparer le niveau d’induction
spontanée entre le phi-027 et φCD38-2. Également, il ne faut pas oublier que la comparaison
directe des valeurs d’expression (RPKM) peut être trompeuse. Certes, le RPKM est une
valeur normalisée, qui en théorie tient compte de la profondeur du séquençage et de la
longueur des gènes, toutefois son inconsistance a amené un certain débat quant à son
utilisation (Dillies et al., 2012; Oshlack et Wakefield, 2009; Wagner et al., 2012). Ainsi, cette
différence apparente au niveau de l’expression génique entre les deux prophages peut
possiblement être expliquée par l’inconsistance de la valeur de RPKM, plutôt que par une
véritable augmentation de l’expression des gènes.
La deuxième particularité du transcriptome du φCD38-2 se rapporte à la région putative
de conversion lysogénique. Cette région, située entre le module de lyse et le module de
régulation, est composée de 11 gènes (ϕCD38-2_gp24 à gp35) dont la plupart encodent des
130
protéines sans fonction connue. Ce qui distingue cette région du reste du génome est la
déviation du pourcentage de G+C. Ce type de signature génétique peut indiquer une récente
acquisition d’une région par transfert horizontal (Canchaya et al., 2003). Ce phénomène a
été fréquemment observé chez d’autres phages dont les phages 370.1, 370.2 et 370.3 chez S.
pyogenes qui encodent des protéines de conversion lysogénique prouvées dans une région
située à la fin du module de lyse et dont le pourcentage de G+C est significativement différent
du reste du génome (Ferretti et al., 2001). De plus, l’analyse d’homologie au niveau
nucléotidique (BLASTn) de cette région particulière du φCD38-2 a révélé une similitude
avec des séquences plasmidiques. Cette observation penche en faveur d’une possible
recombinaison du phage φCD38-2 avec un plasmide. On pourrait même imaginer que cette
recombinaison est à l’origine du cycle lysogénique épisomale du phage φCD38-2. Cette
hypothèse pourrait expliquer la présence d’un gène dans le module de conversion
lysogénique qui encode une protéine de type ParA. Les protéines ParA/ParB sont
normalement retrouvées sur les plasmides et assurent la ségrégation plasmidique lors de la
division bactérienne. Également, cette hypothèse pourrait expliquer pourquoi le phage
φCD38-2 encode une intégrase même s’il ne s’intègre pas dans le génome bactérien.
Advenant un changement récent du mode lysogénique, l’intégrase sera toujours encodée et
exprimée par le phage, mais elle sera sans aucune utilité. Cependant, il est important de
mentionner que la présence d’intégrase n’est pas un élément déterminant puisque certains
phages épisomaux encodent une intégrase sur leur génome (ex. phage φSM101 de C.
perfringens et phage φVHS1 de Vibrio harveyi) et d’autres non (phage P1 d’E. coli et phage
de c-st Clostridium botulinum). Pour l’instant, il n’existe pas de bénéfices évidents pour un
phage d’adopter un mode lysogénique épisomale plutôt qu’intégratif.
Quoi qu’il en soit, l’analyse du profil d’expression a révélé la présence d’une activité
transcriptomique accrue au niveau de trois gènes situés dans la région de conversion
lysogénique. Le premier gène (ϕCD38-2_gp28) encode une protéine hypothétique de
fonction inconnue, mais largement conservée dans les génomes séquencés de C. difficile. Les
deux autres gènes (ϕCD38-2_gp33 et gp34) encodent des protéines qui pourraient être
localisées à la membrane due à la présence d’une hélice transmembranaire unique.
Cependant, l’alignement des séquences provenant des librairies de séquençages montre une
couverture transcriptomique incomplète pour ϕCD38-2_gp34 (Figure 7, Chapitre IV, panel
131
A). Cette observation pourrait indiquer la présence d’un transcrit non codant, tel qu’un petit
ARN régulateur ou un ARN antisens. Les ARN non codants sont impliqués dans divers
processus de régulations en cis ou en trans et généralement agissent par appariement de bases
(base pairing) sur d’autres transcrits d’ARN messagers (Gottesman, 2005).
Figure 7 Représentation schématique du locus encodant potentiellement un système de
toxine-antitoxine de type I. A) Profil transcriptomique de la toxine et de l’antitoxine. Le
niveau de transcription relatif est indiqué en couleur bleue au-dessus des cadres de lecture en
orientation opposés indiqués en orange. La position relative sur le génome du phage
φCD38-2 est indiquée en paire de bases (bp) en dessous des cadres de lectures. B) La
structure secondaire potentielle du transcrit de l’antitoxine. Le code de couleur représente la
probabilité d’appariement de bases sur une échelle de 0 (faible) à 1 (forte).
La présence de protéines membranaires et d’un éventuel ARN non codant est une
caractéristique typique des systèmes toxine-antitoxine (T/AT) de type I (Brantl, 2012). Ces
systèmes sont souvent retrouvés sur les plasmides et autres éléments génétiques mobiles tels
que les prophages et phages cryptiques (Goeders et Van Melderen, 2014; Jahn et al., 2012;
Weaver et al., 2009). Leur fonction consiste à assurer le maintien de l’élément mobile en
expriment simultanément une toxine stable et une antitoxine instable. La toxine est
typiquement de nature protéique et lorsqu’exprimée seule, cause la mort cellulaire. Dans le
cas des systèmes T/AT de type I, l’antitoxine est constituée d’un petit ARN non-codant. Sa
132
fonction consiste à inhiber la traduction de la toxine par appariement avec son ARN
messager. Advenant une perte de l’élément mobile, le niveau d’antitoxine dans la cellule
diminue rapidement ce qui cause une accumulation de la toxine. Ultimement, l’accumulation
de la toxine cause la mort cellulaire possiblement en endommageant la membrane plasmique
par un mécanisme similaire aux holines de phages. De telle manière, la survie de la cellule
bactérienne dépend de la conservation du système entier (toxine et antitoxine) encodé sur
l’élément génétique mobile.
Typiquement, les toxines de type I sont des petites protéines hydrophobes de moins de
60 acides aminés avec la partie carboxy-terminale constituée d’acides aminés chargés.
Également, il semble y avoir un résidu de tryptophane conservé à proximité de la partie
carboxy-terminale (Fozo et al., 2010). La protéine encodée par ϕCD38-2_gp33 a toutes ces
caractéristiques et ainsi peut constituer un bon candidat pour une toxine de type I. Également,
dans le sens opposé, on détecte l’expression d’un transcrit ayant un repliement fort complexe
composé d’une tige centrale et de deux boucles aux extrémités (Figure 7, Chapitre IV, panel
B). La plus petite des boucles comporte six nucléotides parfaitement complémentaires à la
séquence Shine-Dalgarno de l’ARN messager de la toxine (ϕCD38-2_gp33). Ainsi, il est fort
probable que le petit ARN régulateur agit en tant que composante antitoxine en séquestrant
le site de liaison aux ribosomes empêchant ainsi la traduction de la toxine. La séquestration
de la séquence Shine-Dalgarno par un petit ARN régulateur exprimé en cis constitue le
mécanisme principal d’interférence dans le cas des systèmes de toxine-antitoxine de type I
(Fozo et al., 2008). Par exemple, chez E. coli un petit ARN régulateur nommé symR lie
l’ARN messager de la toxine SymE au niveau de la séquence Shine-Dalgarno prévenant la
traduction et par conséquent la synthèse de la toxine (Kawano, 2012). De plus, ce couple
toxine-antitoxine constitue l’élément le plus exprimé dans le génome du phage φCD38-2 ce
qui témoigne certainement de sa fonctionnalité. On peut supposer que la fonction du système
est d’assurer la stabilité du phage φCD38-2 au sein de la population bactérienne. Dans cette
optique, il est intéressant de noter que les phages épisomaux qui n’encodent pas de système
T/AT sont extrêmement instables et la perte du prophage est fréquemment observée dans une
culture bactérienne soumise à aucun stress externe (ex. siphophage VHS1 infectant Vibrio
harveyi) (Khemayan et al., 2006). À l’inverse, en conditions de culture standards au
laboratoire, le prophage φCD38-2 s’est montré d’une stabilité exceptionnelle. Ainsi, il est
133
définitivement possible que cette stabilité résulte de la présence d’un système T/AT de type
I sur le génome du phage. Il est intéressant de noter que le mycobactériophage Giles exprime
également un ARN non codant dans le module de la régulation, cependant le rôle de cet ARN
régulateur n’a pas été élucidé jusqu’à présent (Dedrick et al., 2013).
En somme, l’ensemble de ces observations supporte l’hypothèse d’un récent échange
de matériel génétique entre le phage φCD38-2 et un plasmide ce qui a pu résulter en une
adaptation du mode lysogénique par le phage. Également, il est possible que la présence d’un
système de type T/AT sur le génome du phage pourrait potentiellement avoir un impact sur
la biologie de l’hôte. Par exemple, il a été suggéré qu’en carence de nutriments une
population d’E. coli peut utiliser le system T/AT de type MazE/F pour un suicide altruiste
d’une fraction de la population. En revanche, le contenu cellulaire libéré lors de la lyse
bactérienne libère des nutriments assurant ainsi la survie de l’ensemble de la population
(Engelberg-Kulka et al., 2006). Il sera intéressant d’examiner si un phénomène similaire est
en jeu dans le cas du system T/AT découvert sur le phage φCD38-2.
Encore une fois, l’identification d’un tel système grâce aux données
transcriptomiques a ouvert une piste intéressante qui devra être considérée dans le cadre
d’une exploration détaillée des relations phage-hôte chez C. difficile.
L’analyse du transcriptome bactérien
Observations générales
Le deuxième objectif de l’étude consistait à évaluer les changements transcriptomiques
induits par la présence du prophage φCD38-2. Ainsi, en comparant l’abondance relative des
transcrits, nous avons déterminé qu’au total, l’expression de 39 gènes bactériens est
influencée par la présence du φCD38-2. Cette observation suggère que l’impact du φCD382 sur le transcriptome bactérien est plutôt modeste. Toutefois, cette caractéristique semble
typique des phages tempérés qui établissent une relation lysogénique avec leur hôte bactérien.
Par exemple, l’influence du prophage λ sur le transcriptome d’E. coli implique un
changement d’expression de 8 à 18 gènes, selon la souche et la technique d’analyse utilisée
(Chen et al., 2005; Osterhout et al., 2007). Également, la lysogénisation d’une souche de L.
lactis par le phage Tuc2009 résulte en un changement transcriptomique totalisant 44 gènes,
dont la majorité (35/44) est altérée à la baisse (Ainsworth et al., 2013). Toutefois, il faut noter
134
que l’utilisation des techniques basées sur différentes technologies (ex. hybridation versus
séquençage) peut causer une disparité non négligeable au niveau des gènes identifiés. De
même, l’approche statistique et les critères utilisés pour déterminer les gènes
différentiellement exprimés ne sont pas standardisés d’une étude à une autre et peuvent
également introduire un biais. Toutefois, dans l’ensemble, la relation phage-hôte chez C.
difficile semble suivre la même tendance que pour d’autres phages tempérés.
Analyse des fonctions spécifiques
Dérégulation de l’expression des gènes métaboliques
Les gènes bactériens ayant une expression altérée en présence du φCD38-2 encodent
des protéines impliquées dans des processus cellulaires variés. Dans un premier temps, on
observe un enrichissement des gènes ayant une relation avec le métabolisme du carbone ou
divers systèmes de la phosphotransférase des sucres (PTS-systems). Encore une fois, ces
observations reflètent le comportement de la lysogénie chez E. coli et L. lactis décrits dans
l’introduction. Ainsi, le coliphage λ semble altérer l’expression des gènes impliqués dans le
métabolisme de phosphoenolpyruvate, N-acétylglucosamine, succinate, lactate, spermidine,
nitrate et phosphate. Également, chez L. lactis, la lysogénisation par le phage Tuc2009
provoque une altération de la transcription des gènes impliqués dans le métabolisme du
glycérol, des acides aminés, du pyruvate, du fer et d’ammonium. Parfois, la dérégulation de
l’expression des gènes encodant des enzymes impliqués dans des voies métaboliques a des
phénotypes facilement observables. Par exemple, l’inhibition de l’expression du gène pckA
(métabolisme du phosphoenolpyruvate, voie de néoglucogenèse) par le répresseur CI du
coliphage λ provoque un ralentissement important de la croissance lorsque le lysogène est
cultivé en présence de succinate comme seule source de carbone (Chen et al., 2005).
Cependant, la plupart des altérations d’expression génique induites par les phages tempérés
ne mène pas à des phénotypes observables dans les conditions standards de laboratoire.
Ainsi, à la lumière des exemples disponibles dans la littérature, il semblerait que la
caractéristique commune de la lysogénie réside dans l’altération de la transcription des gènes
encodant des protéines impliquées dans le métabolisme de l’hôte. Toutefois, les raisons
derrière cette préférence ne sont pas connues (Cenens et al., 2013). Une hypothèse veut que
135
cette dérégulation transcriptionnelle puisse avantager l’hôte dans des conditions de limitation
nutritive. Par exemple, chez S. typhimurium, la pseudo-lysogénie engendrée par le phage P22
dérégule l’expression de l’opéron dgo impliqué dans le métabolisme du galactonate (Cenens
et al., 2013). Or, l’opéron dgo a été impliqué dans la virulence et la survie intracellulaire de
S. typhimurium (Eriksson et al., 2003; Ku et al., 2005). De même, il a été postulé que
l’utilisation sélective des sources de carbones est une des principales caractéristiques qui
détermine le succès de la colonisation d’un pathogène opportuniste (Hentges, 1983; Roth,
1988).
La dérégulation de l’opéron fructose, sorbitol et glucose dans le lysogène du phage
φCD38-2 n’affecte pas la croissance bactérienne dans les conditions standards de culture au
laboratoire. Par contre, on peut supposer que ce changement transcriptomique peut procurer
un avantage sélectif dans un contexte d’infection, in vivo. Toutefois, cette hypothèse reste
relativement spéculative, puisque les sources de carbone dans le colon sont constituées
principalement de polysaccharides complexes étant donné que les sucres simples (tels que le
fructose, glucose et sorbitol) sont absorbés au niveau du petit intestin (Hill, 1995).
Dérégulation de l’expression des transporteurs cellulaires
Parmi les autres gènes différentiellement régulés, on dénombre deux transporteurs de
type ABC dont l’expression est réprimée d’environ deux fois en présence du φCD38-2. Ce
système est composé de trois gènes encodant notamment un transporteur, un capteur de
substrat et une perméase. Les deux premiers gènes ne sont pas exprimés fortement, mais
étonnamment, le troisième n’est pas exprimé du tout. À ce stade, il est difficile de déterminer
la spécificité du système envers un substrat particulier, cependant la proximité d’un opéron
responsable de l’assimilation du glycogène suggère une implication dans le transport de ce
dernier. Toutefois, on peut se questionner sur l’impact biologique de la réduction dans
l’expression d’un système qui, à la base, est faiblement exprimé. De manière similaire, un
autre système de transport de type ABC, couplé à un système à deux composantes, est
réprimé d’environ deux fois dans la souche lysogène. Encore une fois, la spécificité du
substrat est difficile à déterminer. Toutefois, la dérégulation de l’expression des transporteurs
cellulaires a été également observée chez les lysogènes d’E. coli (phage λ) et de L. lactis
136
(phage Tuc2009) suggérant qu’il s’agit d’une autre caractéristique commune de la lysogénie
(Ainsworth et al., 2013; Chen et al., 2005; Osterhout et al., 2007).
Dérégulation de l’expression des prophages résidants
Il est intéressant de mentionner que la présence du φCD38-2 influence l’expression de
certains gènes du phage phi-027. Il s’agit d’un groupe de sept gènes faisant possiblement
partie d’un même opéron dans le module de la réplication et régulation transcriptionnelle.
L’interaction transcriptionnelle entre les différents prophages au sein d’une même souche
bactérienne a préalablement été observée chez S. enterica (Lemire et al., 2011). Dans cet
exemple, l’interaction entre les répresseurs et antirépresseurs avait pour effet une induction
coordonnée de plusieurs prophages au sein d’une souche polylysogénique. Il n’est pas exclu
qu’il s’agisse d’un phénomène similaire dans le cas de l’interaction entre le φCD38-2 et le
phi-027, cependant les preuves expérimentales ne sont pas disponibles.
Également, deux gènes encodant des protéines hypothétiques sans fonctions connues
ainsi que deux régulateurs transcriptionnels sont réprimés de deux à trois fois en présence du
φCD38-2. Le rôle de ces protéines n’est pas connu, cependant, dans les deux cas, on retrouve
à proximité plusieurs gènes encodant des protéines d’origine virale, sans toutefois constituer
un prophage complet. Ainsi, ce groupe de gènes fait possiblement partie d’un prophage
cryptique. Présentement, les implications biologiques de ces dérégulations ne sont pas
connues, mais comme mentionné dans l’introduction, les phages cryptiques peuvent jouer un
rôle très important dans la biologie de l’hôte (Wang et al., 2010). De même, il est probable
que les régions régulatrices chez les phages cryptiques sont conservées et reconnues par les
phages existants d’où l’observation d’une régulation croisée.
Dérégulation de l’expression de cwpV
La plus grande variation transcriptionnelle en présence du prophage φCD38-2 est
attribuée au gène cwpV qui encode une protéine de surface. Tel que décrit dans l’introduction,
l’expression de cwpV est soumise à une régulation de variation de phase dépendante de la
recombinase bactérienne RecV. Cette dernière fait partie de la famille des tyrosinerecombinases, largement présentes et utilisées pour l’intégration et l’excision des génomes
viraux (ex. Int du coliphage λ) ou des transposons circulaires (ex. Int du transposon Tn916),
137
réorganisation des cassettes géniques (IntI des intégrons), réductions de la dimérisation
plasmidique (ex. Cre du phage P1) ou chromosomale (ex. XerC/D chez E. coli) et le contrôle
de la variation de phase (ex. FimB et FimE chez E. coli) . Typiquement, le processus de
recombinaison implique la liaison d’un dimère d’enzymes à chacun des sites de
recombinaison suivit d’une coupure simple brin séquentielle qui permet l’échange de brins
d’ADN via la formation et la résolution d’une jonction de Holliday (Grindley et al., 2006).
Parfois, ce processus requiert uniquement la recombinase (ex. Flp et Cre), mais dans la
plupart des cas, l’implication des facteurs externes aura comme conséquence de faciliter le
processus catalytique et forcer l’équilibre d’un côté ou de l’autre. Par exemple, l’intégration
du coliphage λ dans le génome bactérien requiert l’intégrase Int du phage, mais aussi une
protéine de l’hôte appelé IHF (Integration Host Factor). Cependant, l’excision du génome
viral à partir du génome bactérien est dépendant d’autres facteurs additionnels tels que Xis
et Fis (Nash, 1981; Seah et al., 2014).
Dans le cas de la recombinase RecV, les partenaires potentiels ne sont pas connus. Par
contre, il est intéressant de noter que le gène recV semble être exprimé en opéron avec un
gène encodant une protéine membranaire, mais l’implication de cette dernière dans le
mécanisme de variation de phase de cwpV n’a pas été documentée à ce jour. L’activité
enzymatique de la RecV est bidirectionnelle, c’est-à-dire que la même recombinase est en
mesure de catalyser la réaction d’inversion dans le sens ON→OFF mais aussi dans le sens
inverse OFF→ON. De plus, cette réaction est possible lorsque le système (région d’inversion
et la RecV) est exprimé chez E. coli à partir d’un plasmide. Ceci implique que la RecV n’a
probablement pas besoin d’autres facteurs pour catalyser la réaction et si c’est le cas, ces
facteurs sont conservés entre C. difficile et E. coli ce qui est peu plausible. Cependant, ces
deux possibilités ne sont pas mutuellement exclusives. Par exemple, on peut imaginer que la
RecV est en mesure de catalyser la réaction d’inversion dans les deux sens sans l’aide des
facteurs externes. Or, en absence de facteurs externes, il est à prévoir que la réaction atteindra
un équilibre et que les deux formes (OFF et ON) existeront en proportions égales à l’échelle
de la population. Toutefois, chez C. difficile, on observe un biais significatif envers la
configuration OFF ce qui suggère l’implication d’autres facteurs qui influencent l’équilibre
catalytique. À titre de comparaison, l’expression de fimbriae de type I chez E. coli est sous
contrôle d’un mécanisme de variation de phase dépendant de deux tyrosine-recombinases
138
appelées FimB et FimE. La première recombinase, FimB, est bidirectionnelle tout comme la
RecV,
tandis
que
FimE
montre
une
forte
préférence
pour
la
réaction
ON → OFF. Le niveau d’expression de chacune des recombinases détermine en grande partie
la configuration finale du système et par conséquent la production de fimbriae de type I. On
peut facilement imaginer une situation similaire chez C. difficile.
Altération de l’équilibre par le phage φCD38-2
Dans un premier temps, nous nous sommes penchés sur les mécanismes moléculaires
qui définissent l’altération de la transcription de cwpV en présence du phage φCD38-2.
En utilisant la technique d’immunofluorescence et de qRT-PCR, nous avons pu
confirmer que le lysogène présente un plus grand nombre de cellules qui expriment la CwpV
sur la surface bactérienne (Figure 4, Chapitre II) et une configuration ON plus fréquente à
l’échelle de la population (Figure 5, Chapitre II). Ces observations argumentent en faveur de
l’hypothèse qui veut que le phage φCD38-2 interfère avec une composante de l’interrupteur
génétique penchant l’équilibre vers la configuration ON. De plus, en utilisant des mutants
d’inactivation de recV, nous avons déterminé que la présence de la recombinase bactérienne
était essentielle pour l’activation de l’interrupteur génétique dans le lysogène. Cette
observation implique que la RecV ne peut pas être substituée par une des deux recombinases
encodées par le phage φCD38-2. Au final, les causes exactes qui provoquent le
débalancement dans le mécanisme de variation de phase dans le lysogène ne sont pas
connues. De plus, le rôle même du phage φCD38-2 a été mis en doute par une série
d’observations subséquentes.
Afin de s’assurer hors de tout doute que le phage φCD38-2 est à l’origine du
débalancement des ratios OFF/ON, nous avons tenté de curer la souche lysogène du prophage
φCD38-2. Malheureusement, chaque tentative s’est montrée infructueuse indépendamment
de la technique utilisée. Nous avons présumé que la grande stabilité du phage est
possiblement due à la présence du locus T/AT sur son génome. Alors, nous avons essayé la
méthode alternative, c’est-à-dire de recréer d’autres lysogènes en utilisant le même couple
phage-hôte. De manière surprenante, la réintroduction du φCD38-2 dans la souche R20291
n’avait généralement pas d’effet stable sur le mécanisme de variation de phase et la plupart
des nouveaux lysogènes présentaient une configuration similaire à la souche sauvage. Parmi
139
ceux qui présentaient une configuration majoritairement ouverte, la plupart étaient instables
et le phénotype était perdu après quelques passages. Toutefois, un seul lysogène additionnel
s’est avéré stable. Il présentait une configuration majoritairement ouverte (~97%) à l’échelle
de la population bactérienne et elle était immuable indépendamment du nombre de passages.
Le même exercice avec la souche sauvage n’a pas permis d’isoler de clones stables présentant
une configuration majoritairement ouverte.
À ce stade, la contribution exacte du phage φCD38-2 dans le mécanisme de variation
de phase du gène cwpV reste obscure. La faible fréquence d’isolement de clones stables au
niveau du mécanisme suggère que le phage a un rôle mineur à jouer dans l’ensemble du
processus. Cependant, l’implication de phages dans la variation de phase bactérienne a déjà
été documentée auparavant. Par exemple, le phage Mu utilise un système de variation de
phase basé sur l’inversion d’un fragment d’ADN sur son génome pour incorporer
sélectivement des versions différentes de protéines de fibres dans la queue du phage
(Symonds et Coelho, 1978; van de Putte et al., 1980). Cette stratégie génère une population
de phages hétérogènes ayant un spectre d’hôte différent. L’inversion du fragment génomique
viral, appelé fragment G, est catalysée par la recombinase Gin. Également, un système
identique a été décrit chez le phage P1 ou l’inversion d’un fragment génomique viral, appelé
fragment C, est assurée par la recombinase Cin (Chow et Bukhari, 1976). Toutefois, il a été
montré que les recombinases virales Gin et Cin peuvent interférer avec le système de
variation de phase bactérien, nécessaire pour l’expression sélective de gènes de flagelles chez
S. enterica et E. coli (Iino et Kutsukake, 1981; Kutsukake et Iino, 1980; Kutsukake et Iino,
1980). De plus, un autre phage, Fels-2, a récemment été impliqué dans l’interférence de la
variation de phase flagellaire chez S. enterica (Kutsukake et al., 2006). Ces exemples
démontrent que les phages peuvent être impliqués dans la variation de phase et donc, le rôle
du φCD38-2 dans l’expression variable de cwpV mérite d’être exploré davantage.
Considérations alternatives
En outre, mis à part l’implication évidente de la recombinase RecV, peu de détails
mécanistiques sont disponibles concernant ce système. La première question concerne
l’implication d’autres facteurs qui peuvent faciliter la recombinaison ou forcer le sens de
l’inversion. Si d’autres facteurs sont requis, quels sont-ils et quel est leur rôle? Par exemple,
140
la réaction de recombinaison nécessaire pour l’expression de fimbriae de type I chez E. coli,
catalysée par FimB et FimE, est modulée par plusieurs facteurs de l’hôte, dont IHF, Lrp
(Leucine-responsive protein) et H-NS (Heat-stable nucleoid-structuring protein) (Cho et al.,
2008; Dorman et Higgins, 1987; Kelly et al., 2006; Oshima et al., 2006). De manière
similaire, le recrutement du facteur Fis (Factor-for-inversion stimulation) stimule d’environ
150 fois l’activité catalytique de la sérine-recombinase Hin, nécessaire pour l’expression
variable des sous-unités flagellaires FliC et FljB chez S. enterica (Heichman et Johnson,
1990; Johnson et al., 1987; Merickel et al., 1998). Ainsi, il est probable que la recombinase
RecV a également besoin de certains facteurs qui peuvent déterminer l’orientation de
l’inversion dans le système. Cette hypothèse pourra aussi expliquer la préférence du système
envers la configuration fermée qui est majoritaire dans une souche sauvage. Logiquement,
sans facteurs externes qui dictent l’orientation de l’inversion, on aura un équilibre entre les
deux formes, à moins que la RecV ne possède une préférence naturelle pour un des deux
substrats.
La deuxième question concerne les signaux environnementaux qui gouvernent le sens
de l’orientation du système de variation de phase. Nos expériences précédentes ont démontré
que l’interrupteur génétique peut être activé temporellement pour l’ensemble de la
population. Cependant, cette activation n’est pas forcement définitive et un retour au
phénotype naturel (configuration fermée majoritaire) est de mise dans la plupart des cas.
Alors, on peut supposer l’existence d’un signal environnemental qui dicte quelle proportion
de la population sera positive pour l’expression de CwpV. Par exemple, la carence en fer est
un signal externe qui active le système de modification antigénique contrôlant la variation
structurelle de pili chez Neisseria gonorrhoeae (Serkin et Seifert, 2000). Également,
l’expression de fimbriae chez E. coli et S. enterica est sous la régulation d’un système de
variation de phase dont l’activation est sujette à la température, pH, sources de carbone et la
concentration d’acides aminés dans le milieu externe (van der Woude et Baumler, 2004; van
der Woude et al., 1995; White-Ziegler et al., 1998). Toutefois, peu importe la nature du
signal, il doit être en mesure d’altérer simultanément l’ensemble de la population bactérienne.
Dans cette optique, l’implication d’un système de comportement coordonné (quorum
sensing) peut également être envisagée, toutefois cette hypothèse présente deux défauts
majeurs. Premièrement, le quorum sensing implique une réponse coordonnée lorsque la
141
population atteint une certaine densité. Les observations chez C. difficile montrent plutôt un
comportement irrégulier dans la fréquence de changement phénotypique. Par exemple, sur
des centaines de colonies qui poussent dans les mêmes conditions et qui sont soumises aux
mêmes contraintes environnementales, seulement une minorité (~2%) présente un
changement phénotypique majeur envers l’activation du système de variation de phase.
Deuxièmement, le phénomène de quorum sensing implique que le comportement de groupe
retombe « à la normale » lorsque la concentration de l’inducteur diminue (ex. suite à la
dilution de la culture bactérienne). Toutefois, l’isolement de clones stables qui possèdent une
configuration majoritairement ouverte même après dilutions argumente contre l’implication
d’un phénomène de quorum sensing. Au final, il est évident que l’identification des signaux
environnementaux est essentielle pour une meilleure compréhension des mécanismes
moléculaires responsables de l’altération dans l’expression de CwpV.
Le rôle biologique de CwpV
L’implication du phage φCD38-2 dans le mécanisme d’expression de cwpV est certes
très captivante, toutefois nous étions également intéressés par sa fonction biologique. Tel que
mentionné précédemment, la fonction biologique précise de CwpV n’est pas connue.
Cependant, on sait que la protéine est ancrée à la paroi cellulaire suivant une translocation
dépendante du système de sécrétion alternatif SecA2 (Fagan et Fairweather, 2011). Il est
intéressant de noter que ce système est généralement impliqué dans la sécrétion de protéines
ayant un rôle à jouer dans la virulence bactérienne (Braunstein et al., 2003; Lenz et al., 2003;
Xiong et al., 2008).
La partie amino-terminale de CwpV est responsable de l’ancrage à la paroi cellulaire,
tandis que la partie carboxy-terminale est projetée vers l’extérieur. Curieusement, cette
dernière est composée de répétitions peptidiques qui peuvent varier en séquence et en
nombre. L’analyse de la partie carboxy-terminale de CwpV dans une série de souches de C.
difficile a permis de constater une variation entre 4 et 9 répétitions peptidiques dont la
longueur est généralement comprise entre 79 et 120 acides aminés (Reynolds et al., 2011).
L’absence de site catalytique identifiable dans la partie carboxy-terminale suggère que la
fonction de la CwpV est plutôt orientée vers l’interaction de la bactérie avec le milieu externe.
Conformément à cette hypothèse, il a été observé qu’une surexpression de CwpV à partir
142
d’un plasmide provoque l’agrégation cellulaire à haute densité bactérienne. Cependant,
l’observation que certains types de CwpV ne provoquent pas d’agrégation visible suggère
que ce phénotype ne constitue pas la fonction principale. Cette hypothèse est appuyée par
l’observation que la CwpV ne semble pas altérer ni la formation de biofilm, ni la capacité de
la bactérie à adhérer sur les cellules Caco-2 en culture, deux phénomènes typiquement reliés
à l’agrégation.
Le rôle de CwpV dans l’infection virale
Étant donné sa localisation à la surface cellulaire, sa nature hautement variable ainsi
que son expression en variation de phase, nous avons émis l’hypothèse que la CwpV pourrait
interagir avec les phages lors des premières étapes d’un cycle infectieux. La variation des
protéines de surface est une stratégie commune employée par les bactéries afin d’échapper à
la prédation virale. De plus, la variation de phase est un moyen efficace de balancer les
avantages d’une protection virale versus le coût métabolique associé au maintien constitutif
d’un système antiphage. Effectivement, en accord avec notre hypothèse, les expériences
subséquentes ont montré que la famille des protéines de types CwpV protège les bactéries de
l’infection par les phages.
La protection est sélective envers les siphophages
Nos résultats ont démontré que l’expression de CwpV (les types I à V) à partir d’un
plasmide confère une protection très forte envers l’infection par les phages de la famille des
Siphoviridae. À l’inverse, l’expression des types I, III et V a un effet protecteur significatif,
mais limité envers les phages de la famille des Myoviridae. Cette observation n’est pas
inhabituelle dans la mesure où la plupart des systèmes antiphages présentent une certaine
sélectivité envers un groupe ou une famille particulière de phages. Par exemple, le système
antiphage Sie2009 est généralement encodé sur les phages du groupe P335 infectant L. lactis.
Cependant, ce système est efficace pour bloquer l’infection par les phages du groupe 936 qui
infectent également L. lactis mais qui sont génétiquement différents (Mahony et al., 2008;
McGrath et al., 2002). De même, le système antiphage AbiV, retrouvé sur le génome
bactérien de L. lactis MG1363, confère une résistance à l’infection par les phages de groupes
936 et c2, mais pas contre l’infection par les phages du groupe P335 (Haaber et al., 2008).
143
Toutefois, les trois groupes mentionnés ci-dessus font partie de la même famille de
Siphoviridae et ainsi la sensibilité envers les divers systèmes antiphages ne peut pas être
expliquée par les différences structurales (Deveau et al., 2006).
Dans le cas du système CwpV, on observe une sélectivité nette envers les phages de la
famille de Siphoviridae par rapport aux phages de la famille de Myoviridae, ce qui suggère
que l’efficacité du système est dépendante des composantes structurales des virions. Tel que
mentionné dans l’introduction, les différences majeures entre ces deux familles se retrouvent
au niveau de la queue du phage. Cette composante structurale est nécessaire à la
reconnaissance de l’hôte, pénétration de la membrane cellulaire et l’injection d’ADN dans la
cellule bactérienne. Également, ces processus diffèrent considérablement entre les deux
familles. Par exemple, les phages de la famille des Myoviridae possèdent une queue rigide et
contractile. À l’inverse, les phages de la famille des Siphoviridae possèdent une queue
flexible et noncontractile. Les dissimilitudes relativement mineures entre les composantes
individuelles expliquent cette différence structurelle. Par exemple, dans les deux familles,
l’assemblage d’une queue de phage est initié à partir de la structure terminale appelée
baseplate qui contient les protéines nécessaires à la reconnaissance des récepteurs sur la
surface bactérienne (Rajagopala et al., 2011). La partie interne est composée par
l’assemblage multimérique d’une protéine majeure appelée tail tube protein qui polymérise
autour d’une longue protéine appelée tail tape measure protein (TMP) qui détermine la
longueur de la queue du phage et qui est présente en plusieurs copies, du moins dans le
coliphage λ (Fokine et Rossmann, 2014). Dans le cas des myophages, le tail tube est protégé
par une gaine supplémentaire (tail sheath) qui est contractile. Lors de l’infection par les
myophages, la contraction de la gaine provoque une contrainte mécanique qui pousse le tail
tube à pénétrer à travers la membrane plasmique bactérienne. À l’inverse, les siphophages ne
possèdent pas de gaine contractile, et donc le tail tube est entièrement exposé à
l’environnement. Alors, suite à la reconnaissance de l’hôte et à l’adhésion efficace sur la
surface bactérienne, il est possible que les TMPs soient poussées en dehors du tail tube pour
former un canal dans la membrane plasmique bactérienne ce qui va permettre le passage de
l’ADN (Davidson et al., 2012).
144
La protection agit au niveau de l’injection d’ADN
Plusieurs observations expérimentales appuient l’hypothèse que les différences
structurales des virions entre les deux familles définissent les motifs de résistance imposés
par le système antiphage de CwpV.
Comme mentionné auparavant, la CwpV est une protéine localisée à la surface
cellulaire. La présence du peptide signal à l’extrémité amino-terminale est absolument
nécessaire pour une prise en charge efficace et la translocation subséquente à la paroi
cellulaire. Lorsque l’expression de la protéine est confinée au cytoplasme par une délétion
du peptide signal, l’effet protecteur est entièrement perdu et la bactérie devient sensible au
même niveau que la souche sauvage. Cette observation indique qu’un positionnement
approprié de la CwpV à la surface cellulaire est nécessaire pour une protection efficace.
Ainsi, comme supposée, l’interférence avec l’infection virale se fait lors des premières
étapes, c’est-à-dire l’adsorption ou l’injection d’ADN.
L’altération de l’adsorption virale est un mécanisme commun employé par les bactéries
afin de diminuer l’efficacité d’une infection virale. Par exemple, il a été montré que
l’expression de la protéine A chez S. aureus a un effet négatif sur l’adsorption des phages 52,
80 et 80α. Le mécanisme évoqué implique possiblement un camouflage des récepteurs
cellulaires des phages (Nordstrom et Forsgren, 1974). Toutefois, les évidences
expérimentales démontrent que la présence de la CwpV à la surface cellulaire n’affecte pas
significativement l’adsorption des phages. Ainsi, contrairement à ce qui a été observé chez
S. aureus, la CwpV ne semble pas affecter la localisation ni la disponibilité des récepteurs
normalement utilisés par les phages pour l’adsorption. En accord avec ces observations, nos
données suggèrent que la CwpV agit au niveau de l’injection d’ADN viral dans la cellule
bactérienne constituant ainsi un système de superinfection exclusion ou Sie.
Les hypothèses concernant le mécanisme d’inhibition d’injection d’ADN
À priori, il est important de noter que le mécanisme précis derrière le blocage
d’injection d’ADN viral par CwpV n’est pas connu. Toutefois, un élément de réponse a été
obtenu suite à l’observation que les répétitions peptidiques présentes dans le domaine
carboxy-terminal de CwpV sont essentielles pour l’activité antivirale. La délétion de
l’ensemble des répétitions abolit l’effet antiphage tandis qu’une délétion partielle a un effet
145
protecteur limité. Ces résultats suggèrent non seulement que les répétitions sont importantes,
mais que leur nombre l’est également. C’est une observation intéressante dans la mesure où
les répétitions varient en séquence et en nombre selon les différents types de CwpV.
Du côté des phages, deux possibilités logiques peuvent être envisagées : une interaction
de CwpV avec l’ADN du phage ou l’interaction avec une composante structurale de la
particule virale. La première hypothèse est peu probable, puisque normalement, l’ADN viral
n’est jamais exposé à l’environnement durant l’injection. Alors, l’hypothèse la plus plausible
implique une interaction directe entre la CwpV et une structure protéique de la particule
virale. À ce stade-ci de l’étude, la nature exacte de cette interaction n’est pas connue,
cependant plusieurs hypothèses sont envisageables.
Tout d’abord, on peut imaginer une interaction directe avec une composante exposée
de la particule virale, par exemple la partie basale (tail tip complex) ou interne (tail tube) de
la queue du phage, ou encore une composante de la capside (Figure 8, Chapitre IV). Les
composantes de la partie basale servent principalement à l’adsorption et au forage de la paroi
cellulaire. Alors, une interaction avec la partie basale aura possiblement des conséquences
au niveau de l’adsorption virale, phénomène qui n’est pas affecté par la présence de la CwpV.
Ainsi, sans éliminer complètement cette hypothèse, on peut supposer que l’interaction se fait
ailleurs.
Ensuite, la liaison avec la capside aurait pour effet un positionnement inapproprié de
la particule virale sur la surface bactérienne. De même, une interaction avec la partie interne,
mais exposée de la queue du phage (ex. tail tube) pourrait affecter la position ou la
transmission du signal nécessaire pour l’ouverture de l’espace compris entre la queue et la
capside qui est essentielle au relâchement de l’ADN (Fokine et al., 2013; Lhuillier et al.,
2009). Ainsi, l’injection d’ADN pourrait être complètement inhibée et le génome du phage
restera emprisonné dans la capside même après l’adsorption virale. La rétention du génome
viral à l’intérieur de la capside est également observée chez le coliphage T4 via l’action du
système antiphage Sp (Lu et Henning, 1994). Cette hypothèse pourra également expliquer
les différences d’efficacité de blocage d’infection entre les siphophage et les myophages. Tel
que mentionné plus haut, le tail tube est structurellement masqué chez les myophages par
une gaine contractile. Cette partie du phage devient exposée seulement après la contraction
de la gaine et donc après le déclenchement de l’injection du génome viral. Alors, dans le cas
146
d’une interaction entre la CwpV et les composantes du tail tube, les myophages seront moins
affectés, phénomène que l’on observe expérimentalement et qui confirme cette hypothèse.
Finalement, la dernière possibilité constitue l’interaction entre la CwpV et une
composante structurale normalement masquée qui devient accessible seulement suite aux
changements conformationnels provoqués par l’adsorption virale. Par exemple, le système
LtpTP-J34 semble interférer avec les TMPs du phage Ltp infectant L. lactis. Tel que mentionné
auparavant, les TMPs sont poussées en dehors du tail tube par l’ADN sortant lorsque
l’éjection d’ADN est enclenchée. En traçant le parallèle, on peut imaginer qu’une interaction
directe entre la CwpV et les TMPs des Siphoviridae empêchera l’éjection du génome viral.
Toutefois, cette hypothèse présente un inconvénient non négligeable. En principe, la CwpV
est ancrée via le domaine amino-terminal sur la paroi bactérienne de manière à exposer les
répétitions de la partie carboxy-terminale vers l’extérieur. Cette localisation place les
répétitions peptidiques loin de la membrane plasmique bactérienne. Or, on croit que les TMPs
sont éjectés en dehors du tail tube juste avant l’éjection d’ADN dans le cytosol et se
retrouvent donc au niveau de la membrane plasmique. Alors, une interaction CwpV-TMPs
est improbable en termes de localisation spatiale au niveau de la surface bactérienne. Dans
le cas de l’exemple du phage TP-J34 cité plus haut, le système antiphage LtpTP-J34 est une
lipoprotéine et donc elle est ancrée directement dans la membrane plasmique ce qui lui
permet d’interagir avec les TMPs du phage.
147
Figure 8 La reconstitution tridimensionnelle du phage T4 (Myoviridae) et p2
(Siphoviridae). MTP, Major Tail Protein, composante majeure du tail tube qui est
structurellement caché par la gaine contractile (tail sheath) chez les phages de la famille
de Myoviridae. Dans les deux familles, la TMP (tail tape measure) se retrouve à l’intérieur
du tail tube. Modifié avec l’autorisation à partir de (Veesler et Cambillau, 2011).
Autres fonctions de CwpV
Bien que son activité antiphage ne puisse pas être mise en doute, on peut soupçonner
que la CwpV possède d’autres fonctions biologiques. Les protéines ayant plus qu’une activité
biologique distincte au sein de la même cellule bactérienne ont été décrites dans la littérature.
Par exemple, les évidences récentes suggèrent que le système antiphage CRISPR/Cas est
impliqué dans la réparation d’ADN bactérien en plus de servir comme une immunité
adaptative contre l’invasion par les éléments génétiques mobiles (Babu et al., 2011). Alors,
il est tout à fait possible que la CwpV possède d’autres fonctions biologiques qui pour
l’instant restent inconnues. Toutefois, il a été observé que la surexpression de CwpV cause
l’agrégation cellulaire autant en milieu liquide que sur un milieu solide (Reynolds et al.,
2011). Généralement, l’agrégation cellulaire est directement reliée à la répression de la
motilité et la formation de biofilm (Hall-Stoodley et al., 2004) ce qui peut avoir un impact
au niveau de divers processus tels que la colonisation ou la résistance aux antibiotiques.
Cependant, la surexpression de CwpV n’affecte pas la motilité en milieu semi-solide ni
l’adhésion aux cellules Caco2 en culture. Par contre, il faut garder en tête que ces expériences
ont été effectuées dans des conditions qui ne représentent pas fidèlement la dynamique d’un
processus d’infection in vivo. Ainsi, l’utilisation d’un modèle animal qui mime l’infection
chez l’humain pourra apporter d’autres éléments de réponse quant à l’implication de CwpV
dans des processus biologiques d’importance.
148
CONCLUSION
La double nature des phages tempérés, c.-à-d. leur capacité à initier un cycle lytique ou
un cycle lysogénique, peut avoir des répercussions variées sur l’hôte bactérien. Toutefois, la
nature des interactions phage-hôte chez C. difficile a été très peu explorée possiblement dû à
l’absence de facteurs de virulence démontrés sur les génomes des phages infectant C.
difficile. Dans la présente étude, nous avons examiné le transcriptome bactérien d’un isolat
épidémique de C. difficile en présence et en absence du phage tempéré nommé φCD38-2.
Notre objectif premier consistait à déterminer comment le phage régule la transcription de
ses gènes durant la lysogénie, mais également de déterminer comment le phage peut affecter
la transcription des gènes de l’hôte.
L’analyse du transcriptome du φCD38-2 à l’état du prophage a révélé que l’ensemble
du génome viral est transcrit, incluant les gènes encodant des protéines de structure virale.
Cette observation allait à l’encontre de l’idée générale selon laquelle
l’activité
transcriptionnelle des prophages est principalement limitée à certains gènes nécessaires au
maintien de la lysogénie. Ainsi, nos observations suggèrent qu’un certain nombre de
bactéries lysogènes subissent l’induction spontanée des prophages. Cette hypothèse est
également supportée par des données expérimentales puisqu’on observe jusqu’à 105 UFP/ml
dans une culture bactérienne soumise à aucun stress externe. Ainsi, à l’état actuel, il nous est
impossible à déterminer quels gènes du phage sont réellement exprimés durant la lysogénie.
À l’inverse, l’impact du phage φCD38-2 sur le transcriptome bactérien a pu être
déterminé en établissant des critères précis (altération de ± 1.75 avec une signifiance
statistique de padj ≤ 0.05). Ainsi, sur 39 gènes bactériens altérés en présence du φCD38-2, la
grande majorité encode des protéines impliquées dans le métabolisme du carbone. Les
raisons biologiques derrière cette dérégulation ne sont toujours pas claires, mais un impact
similaire a été préalablement observé avec d’autres phages et peut ainsi constituer la marque
distinctive de l’état lysogénique de la majorité des phages tempérés.
Le gène présentant la plus grande variation transcriptionnelle encode une protéine de
surface nommée CwpV. L’expression de cette protéine est sous contrôle d’un mécanisme de
variation de phase, impliquant la recombinaison d’un fragment génomique situé dans la
149
région promotrice du gène cwpV. Toutefois, le rôle du phage dans le système de variation de
phase n’est pas clair et une meilleure compréhension de l’ensemble des facteurs qui
participent à la régulation de l’expression de cwpV sera fort utile afin de déterminer le rôle
précis du φCD38-2.
À l’inverse, notre étude est la première à attribuer un rôle biologique à CwpV. Ainsi,
nos résultats démontrent que l’expression de cette protéine protège les bactéries contre
l’infection par les phages. Le mécanisme moléculaire sous-jacent n’a pas été déterminé,
cependant nos résultats suggèrent que CwpV empêche l’injection d’ADN viral lors de
l’infection d’un hôte bactérien. Ce type de protection, appelé Sie (Superinfection exclusion)
est généralement encodé par les phages. Ainsi, dans le cas de CwpV, il s’agira du premier
système Sie encodé par une bactérie.
En résumé, cette étude est la première à examiner le rôle des phages tempérés sur le
transcriptome global chez C. difficile. Les résultats obtenus suggèrent fortement que la
relation phage-hôte joue un rôle central dans la biologie de cet important pathogène
entérique. Toutefois, il ne faut pas perdre la vue le contexte technique dans lequel cette
interaction a été examinée. Par exemple, il est possible que l’ampleur de l’effet soit plus ou
moins grande dans un contexte d’infection, ou la bactérie doit faire face à une compétition
féroce pour les nutriments. Les phages étant abondements présents dans le tractus gastrointestinal, on peut imaginer qu’un système antiphage de type CwpV pourrait procurer un
avantage sélectif à C. difficile.
Finalement, cette étude a soulevé de nombreuses questions qui devraient être adressées
dans le futur afin de mieux saisir le lien délicat qui relie la vie des phages tempérés à celle
de leurs hôtes bactériens. Par exemple, il sera très intéressant de déterminer le rôle précis des
phages dans la régulation du mécanisme de variation de phase. Étant donné que d’autres
exemples de mécanismes similaires seront certainement découverts prochainement chez C.
difficile, le rôle des phages dans la régulation de ces systèmes devient d’autant plus
intéressant. Également, la caractérisation des systèmes antiphages sera d’une grande
importance puisque la capacité lytique des phages ou des enzymes dérivées de phages a déjà
été soulevée comme approche thérapeutique pour traiter les infections à C. difficile.
Chose certaine, cette exploration n’est qu’à son début et de nouvelles découvertes
fascinantes sont à notre porté.
150
REMERCIEMENTS
Mes plus sincères remerciements vont tout d’abord à Pr. Louis-Charles Fortier qui
m’a donné l’opportunité de combler ma curiosité scientifique dans son laboratoire. Son
support constant, son enthousiasme envers les idées nouvelles ainsi que ses qualités
scientifiques et personnelles font de lui un mentor exceptionnel. Boss, le succès de cette thèse
t’appartient tout autant. Un grand merci à Pr Brendan Bell, Pr Vincent Burrus et Pr Roger
Lévesque pour avoir accepté de faire partie de mon jurry et d’avoir participé à ce que cet
ouvrage atteigne la rigueur scientifique requise à ce niveau.
Je tiens également à remercier mes collègues de travail, étudiants et stagiaires avec
qui j’ai partagé de bons moments tout au long des mes études doctorales. Mentions spéciales
à David Lalonde Séguin (hey, hey, we’re the 60’s), Erich « Casual » Smith, señor Maicol
Ospina Bedoya (The Bajones and Friends will play one day), Émilie St-Pierre, Auréliane
Michaud, François « John » Kirouac, Marie-Pierre Dubeau et Éric Bordeleau. Merci pour
tout, votre aide et votre support m’ont été précieux. Je remercie toutes les personnes au
département de Microbiologie qui m’ont aidé et/ou conseillé dans les différents aspects de
mes études, particulièrement au Pr Raymund Wellinger et Pr Alfredo Menendez, Mathieu
Lavoie, ainsi que Mmes Carole Picard et Chantale Simard.
Également, je remercie Sofiane Yacine Mersaoui, Emmanuel Bajon et Nancy
Laterreur. Je suis heureux de pouvoir vous compter en tant qu’amis maintenant. Kind and
OB, united from day one, qu’il en reste ainsi (N34°6’38.98’’, W118°19’6.48’’ : ▲)
Finalement, rien de ceci ne sera pas possible sans le support inconditionnel de ma
famille. Stéphanie, « this one's for you and me, living out our dreams, we're all right where
we should be, with my arms out wide, I open my eyes, and now all I wanna see, is a sky full
of lighters ». Za tatu, mamu, Andrijanu, Marija, Lucu i Katu: familija iznad svega. One love.
Word.
151
ANNEXE I
JOURNAL OF BACTERIOLOGY, June 2011, p. 2726–2734
0021-9193/11/$12.00 doi:10.1128/JB.00787-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 193, No. 11
Prophage-Stimulated Toxin Production in Clostridium difficile
NAP1/027 Lysogens䌤†
Ognjen Sekulovic, Mathieu Meessen-Pinard, and Louis-Charles Fortier*
Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de
Sherbrooke, Québec J1H 5N4, Canada
Received 6 July 2010/Accepted 17 March 2011
TcdA and TcdB exotoxins are the main virulence factors of Clostridium difficile, one of the most deadly
nosocomial pathogens. Recent data suggest that prophages can influence the regulation of toxin expression.
Here we present the characterization of ␾CD38-2, a pac-type temperate Siphoviridae phage that stimulates
toxin expression when introduced as a prophage into C. difficile. Host range analysis showed that ␾CD38-2 was
able to infect 99/207 isolates of C. difficile representing 11 different PCR ribotypes. Of 89 isolates corresponding
to the NAP1/027 hypervirulent strain, which recently caused several outbreaks in North America and Europe,
79 (89%) were sensitive to ␾CD38-2. The complete double-stranded DNA (dsDNA) genome was determined,
and a putative function could be assigned to 24 of the 55 open reading frames. No toxins or virulence factors
could be identified based on bioinformatics analyses. Our data also suggest that ␾CD38-2 replicates as a
circular plasmid in C. difficile lysogens. Upon introduction of ␾CD38-2 into a NAP1/027 representative isolate,
up to 1.6- and 2.1-fold more TcdA and TcdB, respectively, were detected by immunodot blotting in culture
supernatants of the lysogen than in the wild-type strain. In addition, real-time quantitative reverse transcriptase PCR (qRT-PCR) analyses showed that the mRNA levels of all five pathogenicity locus (PaLoc) genes were
higher in the CD274 lysogen. Our study provides the first genomic sequence of a new pac-type Siphoviridae
phage family member infecting C. difficile and brings further evidence supporting the role of prophages in toxin
production in this important nosocomial pathogen.
of deletions were reported in the tcdC gene from various clinical isolates (6). A particular 1-bp deletion causing a ⫺1 frameshift mutation and the expression of a truncated protein could
possibly explain the increased toxin production observed in
vitro for the NAP1/027 epidemic strain (6, 27, 32, 45).
Temperate bacteriophages (or simply phages) have played a
determinant role in the virulence and evolution of major bacterial pathogens (5). Temperate phages can lead to lysogeny,
which occurs when the phage integrates into the bacterial chromosome and remains as a “latent” prophage. During this lysogenic cycle, prophages sometimes modify the phenotype of
their host, for example, by expressing highly potent toxins, like
the Shiga toxins (Stx) in Escherichia coli, the cholera toxin
(CT) in Vibrio cholerae, or the botulinum neurotoxins (BoNTs)
in Clostridium botulinum (5).
A number of phages infecting C. difficile have been isolated
and partially characterized so far (7, 12, 15–17, 20, 28, 34, 37,
40), and all of them are temperate. Besides the two prophages
that were identified in the genome of C. difficile strain 630 (39),
only four phages have been characterized at the molecular
level, including complete genome sequencing, namely,
␾CD119 (17), ␾C2 (15), ␾CD27 (34), and ␾CD6356 (20). All
of these phages are members of the Myoviridae family (phages
with contractile tails), except ␾CD6356, which is the first and
only Siphoviridae member (phage with a long noncontractile
tail) from C. difficile for which a complete genome sequence is
currently available (20). Hence, there is a clear lack of genomic
data for this group of phages, especially those of the Siphoviridae family. So far, C. difficile phages have not been found to
encode proven virulence factors or to convert nontoxigenic C.
difficile isolates into toxin-producing lysogens (15, 17, 20, 34).
Nevertheless, two recent studies suggest that phages may
Clostridium difficile is a Gram-positive, strictly anaerobic,
spore-forming bacillus that causes infections with various
symptoms ranging from asymptomatic carriage to fulminant
diarrhea and pseudomembranous colitis (44). C. difficile infection is the most frequent cause of antibiotic-associated nosocomial diarrhea in industrialized countries (19). This opportunistic pathogen has caused severe outbreaks in North America
and Europe over the last 8 years (22, 24, 38). TcdA and TcdB
exotoxins are the main virulence factors of C. difficile and are
encoded on a 19.6-kb chromosome region called the pathogenicity locus (PaLoc), which is found in all toxigenic isolates
(44). A hypervirulent epidemic strain, called BI/NAP1/027, was
shown to produce 16 times more TcdA and 23 times more
TcdB in vitro than other isolates (45). The increased toxin
production is thought to be responsible for the greater disease
severity and higher mortality rates reported for patients infected with this particular strain (22, 24, 38).
The expression of C. difficile toxins is growth phase dependent. This regulation is achieved through the expression of
TcdR, an alternative sigma factor that acts as a positive regulator of toxin expression, and TcdC, an early-expressed antisigma factor that prevents the TcdR-containing RNA polymerase from binding to toxin promoters (9, 29, 30, 32). A number
* Corresponding author. Mailing address: Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la
Santé, Université de Sherbrooke, 3001 12e Ave. Nord, Sherbrooke,
Québec J1H 5N4, Canada. Phone: (819) 564-5322. Fax: (819) 5645392. E-mail: [email protected].
† Supplemental material for this article may be found at http://jb
.asm.org/.
䌤
Published ahead of print on 25 March 2011.
2726
VOL. 193, 2011
PROPHAGE-STIMULATED TOXIN PRODUCTION IN C. DIFFICILE
somehow contribute to the regulation of toxin production in C.
difficile (14, 18), but the clear lack of data regarding phages of
C. difficile makes it difficult to appreciate the real impact of
prophages on C. difficile lifestyle and virulence.
In a previous study, we identified ␾CD38-2, a temperate
Siphoviridae phage induced from a C. difficile clinical isolate
(12). Here, we provide the full characterization of this phage,
including whole genome sequencing and phenotypic characterization of lysogens. We also provide additional evidence supporting that prophages contribute to the virulence of this important nosocomial pathogen.
MATERIALS AND METHODS
Bacteria and growth conditions. All strains used in this study were isolated
from human fecal samples kindly provided by Louis Valiquette of the Université
de Sherbrooke. Strain CD274, the host strain for ␾CD38-2, has all the characteristics of the BI/NAP1/027 hypervirulent strain (binary toxin positive, PCR
ribotype 027, tcdC deletion at position 117). Bacteria were routinely grown inside
a ThermoForma model 1025 anaerobic chamber (Fisher Scientific) under anaerobic atmosphere (10% H2, 5% CO2, and 85% N2) at 37°C in prereduced brain
heart infusion (BHI) broth (Oxoid) or in TY broth (3% tryptose, 2% yeast
extract, pH 7.4).
Bacterial DNA extraction and PCR ribotyping. Three milliliters of an overnight C. difficile culture was centrifuged, and total genomic DNA was extracted
using an Illustra bacterial genomic DNA extraction kit following the manufacturer’s recommendations (GE Healthcare). PCR ribotyping was performed on
an Eppendorf Mastercycler with 20 ng purified DNA and primers published by
Bidet et al. (3), with modifications described previously (12). Band patterns were
analyzed and compared using GelComparII (Applied Maths).
Prophage induction and phage propagation. Phage ␾CD38-2 was isolated
from a mitomycin C induction lysate (12). Three rounds of purification from
single plaques were performed using the double agar overlay method (13) and
0.5 ml of a log-phase culture (optical density at 600 nm [OD600] of 0.4) of C.
difficile strain CD274 as the sensitive host. The addition of 10 mM CaCl2 and 0.4
M MgCl2 into the soft agar was required to obtain plaques. For routine prophage
induction, 10 ␮l of serial 10-fold dilutions of an overnight culture of C. difficile
was spotted onto a BHI agar plate and incubated for 4 h at 37°C under anaerobic
atmosphere to allow cells to reach the log phase. Plates were then irradiated
under UV light (302 nm) for 10 s on a standard UV Transilluminator (GE
Healthcare). A soft agar overlay was then poured on top of the plates as described above. Clear zones in the bacterial lawn were indicative of a successful
prophage induction. Phages were then purified from an agar plug as described
above. Standard procedures were used for amplification in BHI broth. CaCl2 and
MgCl2 were added to a final concentration of 10 mM each, and phage titers were
determined by the soft agar overlay method described above. Titers of ⱖ109
PFU/ml were easily obtained with this method.
Transmission electron microscopy (TEM). Phage particles were washed with
0.1 M ammonium acetate, pH 7.5, deposited onto 400-mesh Formvar/carboncoated copper grids (Cedarlane Laboratories), and negatively stained with 2%
uranyl acetate (UA) as described before (12). The grids were observed at 60 kV
with a Hitachi H-7500 transmission electron microscope equipped with a 1,000by 1,000-pixel digital camera controlled with AMT software (Advanced Microscopy Techniques).
Host range determination and one-step growth curve assays. A spot test on
soft agar overlays prepared as described above was used to determine the host
range of ␾CD38-2, with 10 ␮l of a 10-fold-diluted phage lysate and a collection
of 207 clinical isolates representing 41 different PCR ribotypes. For one-step
growth curve assays, cells were grown in prereduced BHI broth until the OD600
reached 0.8. Then, a phage aliquot was added to 2 ml of bacterial culture to
obtain a multiplicity of infection (MOI) of 0.05. CaCl2 and MgCl2 were added to
a final concentration of 10 mM each, followed by a 5-min incubation at 37°C
to allow adsorption. One milliliter of the cell suspension was washed three times
with prereduced BHI broth to remove nonadsorbed phages. Serial 10-fold dilutions were then made in 10 ml BHI broth containing 10 mM CaCl2 and MgCl2
and incubated at 37°C under anaerobic atmosphere. Aliquots were taken at fixed
intervals over 180 min, and phage titers were determined as described above. The
burst size was calculated as follows: (final phage titer ⫺ initial phage titer)/initial
phage titer.
Analysis of structural proteins by SDS-PAGE and mass spectrometry. Phage
particles from a 1-liter cleared lysate (⬃109 PFU/ml) were purified by two
2727
successive rounds of discontinuous cesium chloride gradient, as described previously (11). Twenty microliters of purified phage particles (5 ⫻ 1011 PFU/ml)
was analyzed on a 12% denaturing SDS-polyacrylamide gel as described before
(11). After Coomassie blue staining, protein bands were cut out of the gel,
digested with trypsin, and analyzed by liquid chromatography-tandem mass spectrometry (LC–MS-MS) at the Proteomics Platform of the Génome Québec
Innovative Center at McGill University (Montréal, Québec, Canada).
Phage DNA purification, restriction analysis, and Southern hybridization.
Small-scale preparations of whole phage DNA were obtained from cleared
lysates by using a rapid miniprep protocol described elsewhere (35). For larger
preparations, a maxi-Lambda DNA purification kit was used following the manufacturer’s recommendations (Qiagen). Phage DNA was digested with various
restriction enzymes (NEB, Roche), including EcoRV, HaeII, HindIII, and SwaI,
and the digested products were heated at 75°C for 10 min and immediately run
through a 0.8% agarose gel. Gels were stained with ethidium bromide, exposed
to UV, and photographed using an ImageQuant 300 gel documentation system
(GE Healthcare). Southern blot hybridizations were performed on restricted
DNA as described before, with digoxigenin (DIG)-labeled probes consisting of
PCR product A or B (primer sequences in Table S1 in the supplemental material) or whole phage genomic DNA (12).
Phage genome sequencing and bioinformatics analysis. Whole phage genome
sequencing and assembly were performed on a Roche 454 GS-FLX platform
using the Titanium chemistry at the Génome Québec Innovation Center of
McGill University (Montréal, Québec, Canada). Additional sequencing reactions were done directly on purified phage DNA with specific primers on an
Applied Biosystems ABI 3730xl sequencer at the genomic platform of the CHUL
research center (Québec, Canada). Additional sequence assembly was done
using the Gap v4.10 application of the Staden package v1.6.0. Some editing was
also done using BioEdit v7.0.5.3 and Artemis 11.22. Putative open reading
frames (ORFs) were predicted using GeneMark.hmm for Prokaryotes v2.4 and
Glimmer v3.02. The predicted proteins were compared with the BLASTp tools
of the NCBI (2) and ACLAME (23) databases. Structural features and domains
in predicted proteins were identified using InterProScan.
Isolation of lysogens. Lysogens were created using a modified soft agar overlay
method. Briefly, 0.1 ml of a ␾CD38-2 lysate (⬃108 PFU/ml) was incorporated
into BHI soft agar containing CaCl2 and MgCl2 that was then poured over BHI
agar plates. Serial 10-fold dilutions of a log-phase (OD600 of 0.4) sensitive host
were spread over this phage lawn and incubated overnight at 37°C under anaerobic atmosphere. Five phage-resistant colonies were picked and restreaked 3
times onto BHI agar plates without phages to purify the lysogens. The presence
of the prophage in each lysogen was confirmed by PCR and Southern hybridization, and prophage functionality was assessed by UV induction followed by
phage isolation, DNA extraction, and HindIII restriction profiling as described
above.
Detection of toxins A and B. An overnight preculture of C. difficile in TY broth
was used to inoculate a fresh tube of the same broth (3% inoculum). Cells were
grown as described above, and the OD600 was monitored over a 24-h period.
Aliquots were taken at 2, 8, 12, 18, 24, and 48 h postinoculation. For extracellular
toxin detection, cells were removed by centrifugation, and cleared supernatants
were stored at ⫺20°C until analysis. For intracellular toxin detection, bacteria
from a 10-ml culture sample were collected by centrifugation and suspended in
0.5 ml phosphate-buffered saline (PBS). Cells were then broken with glass beads
(ⱕ106 ␮m; Sigma) using a FastPrep apparatus (MP Biomedicals). The lysate was
cleared by centrifugation, and the supernatant was stored at ⫺20°C until analysis.
Detection of the toxins was done on appropriate dilutions using an enzymelinked immunosorbent assay (ELISA) (Premier Toxins A and B kit; Meridian
Biosciences), as recommended by the supplier. The ELISA unit definition corresponds to the absorbance at 450 nm of the ELISA reaction multiplied by the
dilution factor and converted to a volume of 1 ml of cells (intracellular toxins),
culture supernatant (extracellular toxins), or a combination of both (total toxins).
An immunodot blot method was used to specifically detect TcdA and TcdB. For
this, culture supernatants were serially diluted in TY broth and directly spotted
(0.1 ml) onto nitrocellulose membranes using a 96-well dot blotter apparatus. All
wells were washed twice with PBS, after which the membrane was allowed to air
dry for 30 min. Toxins were detected with monoclonal anti-TcdA or anti-TcdB
mouse antibody (Meridian Life Science) at a 1:3,000 or 1:1,000 dilution, respectively. A secondary anti-mouse IgG horseradish peroxidase (HRP)-linked antibody (Cell Signaling) was used at a 1:3,000 dilution, and the membranes were
revealed with an ECL Plus Western blotting detection system (GE Healthcare)
as recommended by the manufacturer, followed by exposition to Hyperfilm ECL
autoradiography films (GE Healthcare) (33). Spot intensities were compared
using ImageJ 1.42q software (http://rsbweb.nih.gov/ij/).
2728
SEKULOVIC ET AL.
FIG. 1. TEM picture of ␾CD38-2 negatively stained with 2% uranyl acetate. Bar, 100 nm.
RNA extraction and gene expression analysis. Total RNA was extracted from
10-ml culture samples after two successive treatments with TRIzol (Invitrogen).
Cells were broken during the first treatment by adding glass beads (ⱕ106 ␮m;
Sigma) and using a FastPrep apparatus (MP Biomedicals). Total RNA was
dissolved in RNase-free water, and 10 ␮g was treated with 6 units of RNase-free
Turbo DNase I (Ambion) for 30 min at 37°C, as recommended by the manufacturer. The absence of contaminating genomic DNA was verified by performing a 40-cycle PCR with primers targeting the 16S rRNA gene in the presence of
200 ng total RNA. First-strand cDNA synthesis was performed on 3 ␮g total
RNA using SuperScriptII RT (Invitrogen) with random primers (Promega) according to the manufacturer’s specifications. Real-time quantitative reverse
transcriptase PCRs (qRT-PCRs) were performed on a Mastercycler EP Realplex
instrument (Eppendorf) in a total volume of 10 ␮l, with the following components: 1⫻ PCR buffer (12 mM Tris-HCl, pH 8.3, 50 mM KCl, 8 mM MgCl2, 150
mM trehalose, 0.2% Tween 20, 0.2 mg/ml bovine serum albumin [BSA], 0.2⫻
SYBR green [Roche]), 150 ng of template cDNA, and one of the primer sets
specific for tcdA, tcdB, tcdC, tcdR, tcdE, or the 16S rRNA gene (see Table S1 in
the supplemental material). The cycling conditions were as follows: 95°C for 2
min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The ⌬⌬CT
(threshold cycle) comparative method was used to calculate the relative expression of each gene, with the 16S rRNA gene as the reference gene.
Nucleotide sequence accession number. The complete genome sequence of
␾CD38-2 has been submitted to GenBank under the accession number
HM568888.
RESULTS
Phage isolation. We have previously reported the induction
of two temperate phages, ␾CD38-1 and ␾CD38-2, after mitomycin C treatment of CD38, a clinical isolate of C. difficile (12).
Several C. difficile isolates were found to be sensitive to
␾CD38-2, including CD274, which has all the common characteristics of the hypervirulent NAP1/027 strain, which has
caused several outbreaks in North America and Europe (ribotype 027, tcdC deletion, binary toxin positive). Phage
␾CD38-2 was purified from single plaques using CD274 as the
host and further propagated in BHI broth to ⱖ109 PFU/ml.
Transmission electron microscopy (Fig. 1) and DNA restriction profiling confirmed that the isolated phage, a member of
the Siphoviridae family of the order Caudovirales (1), corresponded to the ␾CD38-2 phage that we described before (12).
Host range and lytic growth cycle. The host range of
␾CD38-2 was determined using a collection of C. difficile clinical isolates and spot tests on soft agar overlays. ␾CD38-2
J. BACTERIOL.
infected 99 of the 207 isolates tested (48%), among which 79
(80%) corresponded to the NAP1/027 epidemic strain (PCR
ribotype 027). The other, non-NAP1/027 sensitive isolates represented 10 different PCR ribotypes (see Table S2 in the supplemental material). The lytic growth cycle of ␾CD38-2 was
determined on strain CD274. The latent period was 95 min,
and the burst size was 35 ⫾ 11 PFU per infected cell, which is
in the range reported for other C. difficile phages (16, 28).
Genome sequence. Full genome sequencing was performed
on a Roche 454 GS-FLX platform. A total of 17,659 sequence
reads were obtained and assembled in two large contigs totaling 40,468 bp, with an average coverage of ⬃90-fold. The two
contigs were joined, and gaps were filled after sequencing
reactions were performed directly on the phage DNA. The
␾CD38-2 genome is composed of a double-stranded DNA
(dsDNA) molecule of 41,090 bp with a G⫹C content of
30.83%, which is a little above, but in the range reported for,
that of other C. difficile phages (28.7 to 29.4%) (15, 17, 34) and
of C. difficile strain 630 (29.06%) (39). Digestion of the purified
phage DNA with various restriction enzymes gave profiles perfectly corresponding to a circular genomic map, except for a
faint submolar fragment of ⬃0.9 kb that was observed with
EcoRV (see Fig. S1 in the supplemental material). Heating the
digested DNAs at 75°C for 10 min prior to loading on the
agarose gel did not reveal cohesive termini. Moreover, Southern hybridization of the restricted DNA with probe A, covering
nucleotides 39450 to 40663, which we suspected to be the
region containing the pac site, revealed the expected submolar
fragments in all digestions (see Fig. S2 in the supplemental
material). Thus, our data indicate that ␾CD38-2 is a pac-type
phage that packages its DNA using a headful mechanism and
that the pac site is located between orf53 and orf54. To our
knowledge, this represents the first pac-type Siphoviridae phage
to be described in C. difficile.
DNA homology and other similar prophages. BLASTn analyses
against the nonredundant nucleotide and whole genome shotgun
databases at NCBI revealed the existence of unassembled genomic
fragments nearly identical to ␾CD38-2 in two C. difficile isolates
currently being sequenced at McGill University: strains QCD37x79 (contig NZ_ABHG02000044) and QCD-63q42 (contigs
NZ_ABHD02000046, NZ_ABHD02000048, NZ_ABHD02000049,
and NZ_ABHD02000057).
Gene products and annotation. Fifty-five putative orf genes
encoding proteins of ⱖ30 amino acids were identified by
GeneMark.hmm and Glimmer analyses using standard (ATG)
and alternative (GTG, TTG, CTG) start codons. Manual validation of each orf was then performed, and the most probable
start codon was selected based on the presence of a suitable
ribosome-binding site complementary to the 3⬘ end of the 16S
rRNA gene of C. difficile 630 (39). A genomic map of ␾CD38-2
is presented in Fig. 2.
All predicted ORFs were translated into proteins and compared against nonredundant protein sequences from GenBank
and ACLAME databases using BLASTp. Putative functions
were attributed to each ORF based on BLAST results, by
comparison with homologous proteins found in the ACLAME
database, and based on the presence of conserved domains
found through searches in the conserved domain database
(CDD) at NCBI and by InterProScan analyses. Overall, a putative function could be attributed to 23 of the 55 ORFs (42%),
VOL. 193, 2011
PROPHAGE-STIMULATED TOXIN PRODUCTION IN C. DIFFICILE
2729
FIG. 2. Genetic organization of the complete ␾CD38-2 genome (41,090 bp). Predicted ORFs and their orientations are represented by arrows.
Functional assignments are indicated above the ORFs, along with functional modules that were inferred based on gene annotation and whole
genomic organization. Thick black arrows correspond to proteins identified by LC–MS-MS. The relative G⫹C content, calculated on a 10-base
window along the whole ␾CD38-2 genome, is shown below the map to highlight a region of possible horizontal gene transfer (gray arrows). RBP,
receptor-binding protein; SSB, single-strand binding protein.
and the best BLAST hits corresponding to gene products identified in strain QCD-37x79 are listed in Table S3 in the supplemental material, along with a second relevant hit from another source, when available (excluding hits from strain QCD63q42). The complete genome sequence of ␾CD6356, the first
cos-type temperate Siphoviridae phage described in C. difficile,
has recently been published (20). Protein similarity was found
between the lysis, lysogeny control, and DNA replication, recombination, and modification modules of phages ␾CD38-2
and ␾CD6356, but their structural genes were unrelated. Also,
only a few hits corresponded to gene products from ␾CD27
and ␾CD119, thus confirming that ␾CD38-2 is completely
different from all Myoviridae phages of C. difficile described so
far (15, 17, 34, 39). The gene organization and modular structure of the ␾CD38-2 genome are similar to those of other C.
difficile phages and other temperate phages infecting low-G⫹C
bacteria (25). Key features of the ␾CD38-2 annotation are
described below.
Structural proteins. Protein BLAST analyses showed that
except for the two highly related prophages identified in C.
difficile, strains QCD-37x79 and QCD-63q42, most structural
proteins were related to other Clostridium genomic sequences,
including C. perfringens, C. botulinum, and C. tetani (see Table
S3 in the supplemental material). ORF18 corresponds to a tail
protein with a putative endopeptidase activity and is probably
the phage receptor-binding protein (RBP) responsible for host
specificity. Structural proteins of CsCl-purified ␾CD38-2 particles were separated by SDS-PAGE, followed by LC–MS-MS
analysis of the trypsin-digested protein bands (Fig. 3A). The
experimental and calculated masses were in agreement, and
peptide mapping did not reveal any evidence of posttransla-
tional proteolytic processing (Fig. 3B). Based on local genomic
organization and BLAST analyses, ORF7 was annotated as the
major capsid protein (MCP) and ORF17 as the major tail
protein (MTP). Because the boundary between the capsid and
tail morphogenesis modules could not clearly be defined,
ORF12 could be either a capsid or a tail protein, and as a
consequence, it was annotated as a major structural protein
(MSP), without reference to any particular virion structure
(Fig. 3B).
Lysogeny control and putative lysogenic conversion genes.
In most phages infecting low-G⫹C Gram-positive bacteria,
including C. difficile phages ␾C2, ␾CD27, and ␾CD119, the
lysogeny module is located between the lysis cassette and the
DNA replication and regulation module. This region generally
encodes Cro and cI repressors, transcriptional regulators, and
antirepressors, as well as the integrase (15, 17, 20, 26, 34). A
lysogeny module could not clearly be defined in ␾CD38-2, and
a different organization was observed. ORF39, a putative cI
phage repressor based on BLAST results and on the presence
of a helix-turn-helix (HTH) DNA-binding domain, was found
approximately 10 kb downstream of the lysis cassette. ORF53,
a phage integrase of the tyrosine recombinase/integrase
family, was found 5 kb downstream of orf39 near ORF55, a
protein of the SR serine recombinase family. In ␾CD6356, a
site-specific recombinase (orf57) is also located apart from
the lysogeny module (orf34 to orf40). However, in the latter
case, 3 putative transcriptional regulators are clustered in
the lysogeny module (orf35, orf37, and orf38), whereas in
␾CD38-2, we found only one.
A putative function could be assigned to only 8 (25%) of the
32 nonstructural genes (orf24 to orf55), of which 4 could be
2730
SEKULOVIC ET AL.
J. BACTERIOL.
FIG. 3. Analysis of ␾CD38-2 structural proteins. (A) Coomassie brilliant blue staining of a 12% SDS-polyacrylamide gel, showing ␾CD38-2
structural proteins, along with a protein molecular mass marker (lane M). Arrows and letters on the right correspond to protein bands identified
by LC–MS-MS analysis, which are further characterized in panel B.
related to DNA replication, transcription, and gene regulation.
InterProScan analyses predicted the presence of a signal peptide and/or transmembrane regions within ORF32, ORF33,
and ORF34, suggesting that these proteins could potentially be
targeted to the membrane or be secreted. Interestingly, the
␾CD38-2 genome showed a marked deviation in its G⫹C
content from orf24 to orf34, where the average G⫹C content
was 25.6% ⫾ 1.2%, while it was 31.6% ⫾ 3.1% in the rest of
the genome (Fig. 2). Such deviations are often traces of past
horizontal gene transfer (HGT) events. In line with this, a
BLASTp analysis with ORF35 retrieved hits corresponding to
DNase, including CDP07 (see Table S3 in the supplemental
material), a putative DNase found on plasmid pCD630 (NCBI
accession no. NC_008226.1) carried by C. difficile strain 630
(39). Moreover, a nucleotide BLAST analysis revealed a region extending from positions 31112 to 32991 in ␾CD38-2
sharing 65% identity with a region from plasmid pCD630 that
corresponds to ⬃2/3 of the gene coding for a DNase. Taken
together, these data suggest that a portion of the ␾CD38-2
genome, located next to the lysis module, has been acquired
through HGT and could possibly participate in lysogenic conversion of the host. Further experiments are needed to confirm
this hypothesis. Note that we performed a similar analysis with
␾C2, ␾CD27, and ␾CD119, and only the last shared significant
homology (68% nucleotide identity over 794 bp) with a region
coding for a methyltransferase in plasmid pCKL555A (NCBI
accession no. CP000674.1) of Clostridium kluyveri DSM 555
(17). Interestingly, a note in the ACLAME database mentions
that pCKL555A is a prophage. These observations support the
idea that other phages of C. difficile have probably recombined
with plasmids as well.
Prophage maintenance as a circular plasmid. The attachment site (attP) in most temperate phages is generally located
near the integrase gene. Also, when a prophage integrates into
the chromosome of its host, at least one band from the phage
restriction profile shifts in the lysogen due to its fusion with
bacterial DNA. In order to locate attP and to determine
whether or not ␾CD38-2 integrates, we performed Southern
blot hybridizations with DIG-labeled PCR probes covering the
integrase region (probe A, orf53 to orf55) and tail (probe B,
orf18 to orf20) genes (see Fig. S2 in the supplemental mate-
rial). We also used the whole phage genome as a probe. As can
be seen in Fig. S2, the whole restriction profiles and the sizes
of specific fragments detected by the two PCR probes were
identical in the purified phage and in the lysogen, except for
the submolar fragment that was present only in the purified
phage DNA. Because no visible shift in size could be observed
with any bands and since the submolar fragment was absent
from the lysogen, we concluded that ␾CD38-2 did not integrate and that its genome was circular in the lysogen (see Fig.
S2). Interestingly, the presence of a 1.5-kb fragment sharing
65% identity at the DNA level with the pCD630 plasmid from
C. difficile strain 630 further supports the evidence that the
␾CD38-2 prophage replicates as a circular plasmid. Also noteworthy to mention, the two contigs from strains QCD-37x79
and QCD-63q42 that are almost identical to ␾CD38-2 were
found as unassembled fragments in public databases, suggesting that they could not be associated with bacterial DNA.
Finally, a ParA homolog (ORF30) similar to a Spiroplasma citri
Soj-like protein was found in ␾CD38-2 (ParA cd02042, 1e⫺3;
Soj COG1192, 1e⫺18; CbiA pfam01656, 4e⫺9; SopA
PHA02519, 3e⫺6) (see Table S3 in the supplemental material). Since ParA/Soj-like proteins are involved in chromosome
segregation and plasmid maintenance (31), the presence of
ORF30 in ␾CD38-2 supports a role in prophage maintenance
as a plasmid. To our knowledge, this represents the first example of such a prophage in C. difficile.
Prophage-stimulated toxin production in ␾CD38-2 lysogens. Previous reports have shown that toxin production in C.
difficile can be affected by some prophages (14, 18). In order to
test whether ␾CD38-2 could influence toxin production in C.
difficile, we infected the host isolate CD274, which is a representative member of the hypervirulent strain BI/NAP1/027, to
create lysogens. The growth profiles in TY broth and total
biomass yields after 24 h were not significantly different between the CD274/␾CD38-2 lysogen and the wild-type parental
strain (Fig. 4A). Aliquots of cells and culture supernatants
were collected at different time intervals, and intracellular and
extracellular relative toxin levels were determined using a commercial ELISA. At 8 and 12 h, most of the toxins detected were
intracellular, and the level increased 3-fold at 12 h, which is
consistent with the entry into stationary phase. A slight and
VOL. 193, 2011
PROPHAGE-STIMULATED TOXIN PRODUCTION IN C. DIFFICILE
2731
FIG. 5. Immunodot blot detection of toxins in cleared supernatants
from 24-h cultures of wild-type CD274 and a CD274/␾CD38-2 lysogen.
TcdA and TcdB toxins were detected using monoclonal anti-TcdA and
anti-TcdB antibodies. Each spot represents an independent biological
experiment.
FIG. 4. Growth and toxin production of wild-type CD274 and the
CD274/␾CD38-2 lysogen. (A) Growth of the wild type (white circles)
and the lysogen (black circles) in TY broth was monitored by measuring the optical density at 600 nm over 24 h. (B) The relative amounts
of TcdA and TcdB toxins were determined by a toxin A/B ELISA.
Data represent the means ⫾ standard deviations from three independent biological replicates. Extracellular, intracellular, and total (extracellular plus intracellular) toxin levels of the wild type (WT) and the
lysogen (LYS) were compared by a Student t test. Significant differences (ⴱ, P ⬍ 0.05) were observed for total and extracellular, but not
for intracellular, toxins.
gradual decrease was observed afterward, but the levels did not
differ significantly between the wild type and the lysogen (Fig.
4B). On the contrary, extracellular toxins accumulated faster
and to a higher level in culture supernatants from the CD274/
␾CD38-2 lysogen, with 2.1-, 2.4-, and 2.0-fold more toxins than
in wild-type CD274 after 12, 18, and 24 h of growth, respectively (P ⬍ 0.05 at 18 and 24 h). The proportion of extracellular
toxins also represented ⬃80 to 90% of the total toxins detected
in culture samples. The amount of extracellular toxins reached
a plateau at 24 h in supernatants from the wild-type strain but
continued to accumulate gradually in the lysogen until 48 h
(see Fig. S3 in the supplemental material). The total toxin
production, expressed in ELISA units/ml of culture and obtained by combining the intracellular and extracellular toxin
values, yielded 1.2-, 2.3-, and 1.8-fold higher toxin levels in the
lysogen after 12, 18, and 24 h of growth, respectively (P ⬍ 0.05
at 18 and 24 h) (Fig. 4B). An immunodot blotting experiment
using specific anti-TcdA and anti-TcdB antibodies revealed
that both toxins, in particular, TcdB, accumulated to higher
levels in culture supernatants of the lysogen (Fig. 5). Densitometry analysis of the dots showed that the amounts of TcdA
and TcdB were ⬃1.6- and 2.1-fold larger, respectively, in the
CD274/␾CD38-2 lysogen than in the wild-type CD274 strain.
This was consistent with the results obtained with the ELISA
(Fig. 4B; also see Fig. S3 in the supplemental material).
We then performed real-time qRT-PCR assays to compare
the relative expression levels of the five PaLoc genes in both
strains. Total RNA was extracted from the CD274/␾CD38-2
lysogen and the wild-type parental strain CD274 at 4, 12, 18,
and 24 h postinoculation. Based on ⌬CT values (compared to
that for the 16S rRNA gene), the expression profiles were
consistent with what we expected. For example, the expression
of tcdR, tcdA, and tcdB increased sharply between 4 and 12 h
and then decreased gradually afterwards. Expression of tcdC
reached its maximum at 4 h and then gradually decreased.
Finally, the expression of tcdE remained relatively constant
over the first 18 h and then decreased at 24 h (data not shown).
By use of the ⌬⌬CT relative comparison, the expression levels
of all PaLoc genes were found to be similar in lysogenic and
wild-type strains after 4 h of growth (ratio of ⬃1), but after
24 h, the levels of tcdA, tcdB, tcdC, tcdE, and tcdR mRNA
were, respectively, 2.7-, 2.9-, 2.7-, 5.7-, and 2.7-fold higher in
the lysogen than in the wild-type strain (Fig. 6). Again, these
data are in agreement with the toxin levels that were detected
by ELISA and immunodot blotting. Our results show that the
expression patterns are similar in both strains but that the
presence of the prophage leads to higher expression of all
PaLoc genes.
Four additional ␾CD38-2 lysogens were created in different
FIG. 6. Relative expression of PaLoc genes in the CD274/␾CD38-2
lysogen versus the wild-type CD274 strain at different time points.
Data are presented as the fold change in gene expression in the lysogen
relative to that for the wild-type strain and represent the means ⫾
standard errors of the means from 4 independent biological replicates.
A value of 1 means that there is no difference in mRNA levels between
the two strains. For each gene, the fold change at 12, 18, and 24 h was
compared to the value at 4 h by using the Student t test (*, P ⬍ 0.05;
**, P ⬍ 0.01).
2732
SEKULOVIC ET AL.
genetic backgrounds to verify if the above-described observations made with the CD274 lysogen could be extended to other
C. difficile isolates. Phage ␾CD38-2 was introduced into strains
CD45 (PCR ribotype 035) and CD62 (PCR ribotype 014), as
well as CD66 and CD111 (both PCR ribotype 027). Toxins A
and B were detected in culture supernatants using the ELISA
and were comparable to levels for strain CD274 (418 ELISA
units/ml), with 379, 113, 780, and 724 ELISA units/ml for
strains CD45, CD62, CD66, and CD111, respectively. When
the amounts of toxins produced by the corresponding lysogens
were compared, only the CD45 lysogen showed a 2-fold increase in extracellular toxins after 24 h compared to the level
for the wild-type strain. Toxin levels in the supernatants of the
CD62, CD66, and CD111 lysogens were, respectively, 1.3-, 0.6-,
and 1.3-fold the level for the wild-type strain and were not
significantly different. The amounts of tcdA and tcdB transcripts were determined by real-time qRT-PCR analysis of
total RNA extracted from these lysogens and the corresponding parental strain after 24 h of growth in TY broth. The
detected mRNA levels were higher in the CD45/␾CD38-2 lysogen, with 29- and 22-fold increases in tcdA and tcdB mRNA,
respectively (see Fig. S4 in the supplemental material). The
CD62, CD66, and CD111 lysogens showed on average 5.76/
5.57-, 0.75/0.44-, and 2.14/1.32-fold differences, respectively, in
toxin A/B mRNA levels compared to levels for the parental
strain. Five colonies were picked at the end of each culture
experiment, and the presence of the prophage was confirmed
by PCR in all cases, thus excluding prophage loss as a possible
explanation for the observed variability in toxin production
from one lysogen to another. Taken together, our results demonstrate that ␾CD38-2 can stimulate toxin production in some
lysogens, including the NAP1/027 epidemic strain, by increasing mRNA transcription and/or stability and that this effect
seems to be strain dependent.
DISCUSSION
The molecular basis for the hypervirulence and hyper-toxinproducing phenotype of the NAP1/027 epidemic strain is still
unclear, and it is reasonable to presume that prophages might
be involved. Here we report the microbiological and molecular
characterization of ␾CD38-2, a temperate phage of the Siphoviridae family infecting Clostridium difficile, and our study provides further evidence that temperate phages can affect important virulence-associated phenotypes, like toxin production, in
C. difficile.
The genomes of only a few phages of C. difficile have been
fully sequenced to date. In addition, all currently available C.
difficile phage sequences represent members of the Myoviridae
family that are related genetically (15, 17, 34, 39). The only
exception is phage ␾CD6356, a cos-type phage of the Siphoviridae family (20). The complete genome of ␾CD38-2 was
sequenced, and protein comparisons revealed that the lysis and
DNA replication/gene regulation modules of ␾CD38-2 and
␾CD6356 are related but that their structural genes are completely different. The fact that ␾CD38-2 is a pac-type Siphoviridae phage whereas ␾CD6356 is a cos-type phage confirms
that they are part of two distinct phage families that package
their DNA using two different mechanisms. The presence of a
putative integrase gene (orf53) would have a priori suggested
J. BACTERIOL.
that ␾CD38-2 should integrate upon lysogenization, but our
experimental data support the conclusion that ␾CD38-2 maintains itself as a circular plasmid and does not integrate into the
chromosome of the lysogens that we tested. Of note, the
genomic organization of ␾CD6356 is very similar to that of
␾CD38-2 regarding the nonstructural genes, and it would be
interesting to know whether the ␾CD6356 prophage integrates
or maintains itself as a circular plasmid, but this information
was not provided by the authors (20). Also, the identification of
a ParA homolog in ␾CD38-2, as in ␾CD6356 and ␾C2, was
interesting because ParA/Soj-like proteins are involved in
chromosome segregation and plasmid maintenance (31). ParA
and ParB homologs were also shown to enable the temperate
phage LE1 from Leptospira biflexa to replicate autonomously
as a circular plasmid (4). Finally, we found an ⬃1.9-kb fragment in the region encoding ParA in ␾CD38-2 that shares
significant homology with the plasmid from C. difficile strain
630. This suggests that a past recombination event between a
prophage and a plasmid occurred, leading to a chimeric phage
that can autonomously replicate as a circular plasmid. To our
knowledge, this represents the first example of such a prophage in C. difficile.
Prophage-stimulated toxin production in NAP1/027 lysogens. TcdR and TcdC are positive and negative regulators of
toxin production in C. difficile, respectively (44). A number of
deletions were identified in tcdC, in particular, a 1-bp deletion
at position 117 that leads to the synthesis of a severely truncated TcdC protein in the NAP1/027 epidemic strain (6, 27).
This deletion is thought to be responsible for the increased
toxin production reported in this strain (45). However, recent
studies suggest that deletions in tcdC alone cannot explain
hyper-toxin production and hypervirulence of NAP1/027 isolates (36, 43). The regulation of toxin production in C. difficile
thus seems to be complex, and other mechanisms are likely
involved in this process. A previous report by Goh et al. suggested that lysogens carrying the temperate phages ␾C2, ␾C6,
and ␾C8 could modify toxin production in C. difficile (14).
Interestingly, the PaLoc shares some sequence similarity with
phage proteins, in particular, TcdE, suggesting that it is probably the remains of an ancient prophage. This also suggests
that phage regulatory networks could be intertwined with those
of the PaLoc (14, 42). Further evidence supporting a possible
interconnection between prophages and the PaLoc was recently provided by Govind et al., who showed that during
lysogeny, the RepR transcriptional regulator encoded by
␾CD119 was able to bind to a promoter region in the PaLoc
upstream of tcdR, causing a downregulation of the expression
of all PaLoc genes, including tcdA and tcdB (18).
Lysogenization of CD274 with ␾CD38-2 led to 1.6- and
2.1-fold increases in toxins A and B in culture supernatants,
respectively (Fig. 4 and 5). Although not dramatic, the increase
was significant. Also, the levels of intracellular toxins were not
very different between the two strains, and most of the toxins
(80 to 90%) were found in the culture supernatant. Using a
real-time qRT-PCR approach, we demonstrated that the
mRNA levels of all 5 PaLoc genes were higher in the lysogen
carrying ␾CD38-2 than in the wild-type strain (Fig. 6). In
addition, there seemed to be greater expression of tcdE than of
the other PaLoc genes in the lysogen. Together, these results
lead us to conclude that the lysogen carrying ␾CD38-2 synthe-
VOL. 193, 2011
PROPHAGE-STIMULATED TOXIN PRODUCTION IN C. DIFFICILE
sized and secreted more toxins, as a result of increased expression of PaLoc genes and especially tcdE. The net result is a
higher extracellular toxin level in cultures of the lysogen and
similar intracellular toxin levels in both strains. Our bioinformatics analyses identified only one HTH putative DNA-binding protein in the ␾CD38-2 genome (ORF39), and this protein
is likely the cI phage repressor involved in lysogeny maintenance. The only other identifiable candidate that could possibly affect RNA transcription is a putative sigma factor
(ORF52). This gene product could bind directly to promoter
regions upstream of PaLoc genes and recruit the RNA polymerase to increase the rate of transcription initiation. Alternatively, it could interfere with TcdC. In the latter case, TcdC
would be impaired in its ability to destabilize the TcdR-RNA
polymerase holoenzyme, thus promoting transcription initiation through binding of TcdR. Because ␾CD38-2 does not
seem to integrate into the chromosome of its host, disruption
of a bacterial gene is unlikely to be the reason explaining the
difference in PaLoc gene transcript levels. Further experiments
are necessary to determine the exact mechanism leading to
increased toxin expression.
Our study and those of Govind (18) and Goh (14) also
showed that depending on the phage-host system and the bacterial genetic background, the impact of different prophages on
toxin production varies. We found that transcription was significantly increased in some lysogens and was unaffected or
slightly decreased in others (see Fig. S4 in the supplemental
material). It is already known that toxin expression varies
greatly from one strain to another and that several factors may
participate in such regulation (10, 21). The strains we selected
to create additional lysogens produced similar amounts of toxins. Hence, at least in our study, we can rule out the possibility
that differences in basal toxin production explain the variable
impact of ␾CD38-2 on these strains. The presence of a putative
integrase gene in ␾CD38-2 suggests that the phage could potentially integrate into the chromosome of its host. However,
consistent experimental evidence suggests that the ␾CD38-2
prophage replicates autonomously as a circular plasmid. Although we cannot completely exclude the possibility that this
phage could integrate in some strains but not in others, the
strain-dependent difference in toxin production that we observed in our study is unlikely due to gene disruption at different sites. We did not determine systematically the prophage
content of the strains we used in our study, but we can confirm
that strain CD111 contains at least one Siphoviridae phage
different from ␾CD38-2 (unpublished data). We also found
that strain CD274 contains a prophage of the Myoviridae family
identical or highly similar to ␾CD5, which we previously characterized (12), and to ␾027 from the epidemic strain R20291
(41) (NCBI accession no. accession number NCO13316). It is
thus possible that multiple synergistic and/or antagonistic prophage interactions contribute to a complex network regulating
toxin expression.
Conclusion. In summary, we characterized and sequenced
the first genome of a pac-type Siphoviridae phage infecting C.
difficile. In addition, our data strongly suggest that ␾CD38-2
replicates as a circular plasmid and does not integrate into the
chromosome of its host. Phage ␾CD38-2 is able to infect several isolates of the hypervirulent epidemic strain NAP1/027,
which recently caused severe outbreaks in North America and
2733
Europe. Complete genome sequencing did not reveal the presence of identifiable virulence factors, but lysogenization of a
NAP1/027 isolate with ␾CD38-2 led to increased in vitro toxin
production through increased transcription of all PaLoc genes.
Because ␾CD38-2 has the capacity to alter virulence-associated phenotypes through modulation of toxin expression, this
phage represents a very interesting model to study phage-host
interactions. The impacts of prophages in this clinically important pathogen remain relatively unexplored, and our study
warrants further research in this area.
ACKNOWLEDGMENTS
We are grateful to Louis Valiquette for providing clinical isolates of
C. difficile. We also thank Pier-Luc Dudemaine for helping with the
host range analysis.
This study was supported by the Centre de Recherche Clinique
Étienne-Le Bel, by a discovery grant from the Natural Sciences and
Engineering Council of Canada (NSERC), and by a seed grant from
the Canadian Institutes of Health Research (CIHR).
L.-C.F. is a research scholar from the Fonds de la Recherche en
Santé du Québec (FRSQ).
REFERENCES
1. Ackermann, H. 2007. 5500 phages examined in the electron microscope.
Arch. Virol. 152:227–243.
2. Altschul, S., et al. 1997. Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res. 25:3389–3402.
3. Bidet, P., F. Barbut, V. Lalande, B. Burghoffer, and J. Petit. 1999. Development of a new PCR-ribotyping method for Clostridium difficile based on
ribosomal RNA gene sequencing. FEMS Microbiol. Lett. 175:261–266.
4. Bourhy, P., et al. 2005. Complete nucleotide sequence of the LE1 prophage
from the spirochete Leptospira biflexa and characterization of its replication
and partition functions. J. Bacteriol. 187:3931–3940.
5. Brussow, H., C. Canchaya, and W. Hardt. 2004. Phages and the evolution of
bacterial pathogens: from genomic rearrangements to lysogenic conversion.
Microbiol. Mol. Biol. Rev. 68:560–602.
6. Curry, S., et al. 2007. tcdC genotypes associated with severe TcdC truncation
in an epidemic clone and other strains of Clostridium difficile. J. Clin. Microbiol. 45:215–221.
7. Dei, R. 1989. Observations on phage-typing of Clostridium difficile: preliminary evaluation of a phage panel. Eur. J. Epidemiol. 5:351–354.
8. Reference deleted.
9. Dupuy, B., R. Govind, A. Antunes, and S. Matamouros. 2008. Clostridium
difficile toxin synthesis is negatively regulated by TcdC. J. Med. Microbiol.
57:685–689.
10. Dupuy, B., and A. Sonenshein. 1998. Regulated transcription of Clostridium
difficile toxin genes. Mol. Microbiol. 27:107–120.
11. Fortier, L., A. Bransi, and S. Moineau. 2006. Genome sequence and global
gene expression of Q54, a new phage species linking the 936 and c2 phage
species of Lactococcus lactis. J. Bacteriol. 188:6101–6114.
12. Fortier, L., and S. Moineau. 2007. Morphological and genetic diversity of
temperate phages in Clostridium difficile. Appl. Environ. Microbiol. 73:7358–
7366.
13. Fortier, L., and S. Moineau. 2009. Phage production and maintenance of
stocks, including expected stock lifetimes. Methods Mol. Biol. 501:203–219.
14. Goh, S., B. Chang, and T. Riley. 2005. Effect of phage infection on toxin
production by Clostridium difficile. J. Med. Microbiol. 54:129–135.
15. Goh, S., P. Ong, K. Song, T. Riley, and B. Chang. 2007. The complete
genome sequence of Clostridium difficile phage {phi}C2 and comparisons to
{phi}CD119 and inducible prophages of CD630. Microbiology 153:676–685.
16. Goh, S., T. Riley, and B. Chang. 2005. Isolation and characterization of
temperate bacteriophages of Clostridium difficile. Appl. Environ. Microbiol.
71:1079–1083.
17. Govind, R., J. Fralick, and R. Rolfe. 2006. Genomic organization and molecular characterization of Clostridium difficile bacteriophage {Phi}CD119. J.
Bacteriol. 188:2568–2577.
18. Govind, R., G. Vediyappan, R. Rolfe, B. Dupuy, and J. Fralick. 2009. Bacteriophage-mediated toxin gene regulation in Clostridium difficile. J. Virol.
83:12037–12045.
19. Gravel, D., et al. 2009. Health care-associated Clostridium difficile infection
in adults admitted to acute care hospitals in Canada: a Canadian Nosocomial
Infection Surveillance Program study. Clin. Infect. Dis. 48:568–576.
20. Horgan, M., et al. 2010. Genome analysis of the Clostridium difficile phage
PhiCD6356, a temperate phage of the Siphoviridae family. Gene 462:34–43.
21. Hundsberger, T., et al. 1997. Transcription analysis of the genes tcdA-E of
the pathogenicity locus of Clostridium difficile. Eur. J. Biochem. 244:735–742.
2734
SEKULOVIC ET AL.
22. Kuijper, E., B. Coignard, and P. Tull. 2006. Emergence of Clostridium
difficile-associated disease in North America and Europe. Clin. Microbiol.
Infect. 12(Suppl. 6):2–18.
23. Leplae, R., A. Hebrant, S. J. Wodak, and A. Toussaint. 2004. ACLAME: a
CLAssification of Mobile genetic Elements. Nucleic Acids Res. 32:D45–
D49.
24. Loo, V., et al. 2005. A predominantly clonal multi-institutional outbreak of
Clostridium difficile-associated diarrhea with high morbidity and mortality.
N. Engl. J. Med. 353:2442–2449.
25. Lucchini, S., F. Desiere, and H. Brussow. 1999. Comparative genomics of
Streptococcus thermophilus phage species supports a modular evolution theory. J. Virol. 73:8647–8656.
26. Lucchini, S., F. Desiere, and H. Brussow. 1999. Similarly organized lysogeny
modules in temperate Siphoviridae from low GC content gram-positive bacteria. Virology 263:427–435.
27. MacCannell, D. R., et al. 2006. Molecular analysis of Clostridium difficile
PCR ribotype 027 isolates from eastern and western Canada. J. Clin. Microbiol. 44:2147–2152.
28. Mahony, D., P. Bell, and K. Easterbrook. 1985. Two bacteriophages of
Clostridium difficile. J. Clin. Microbiol. 21:251–254.
29. Mani, N., and B. Dupuy. 2001. Regulation of toxin synthesis in Clostridium
difficile by an alternative RNA polymerase sigma factor. Proc. Natl. Acad.
Sci. U. S. A. 98:5844–5849.
30. Mani, N., et al. 2002. Environmental response and autoregulation of Clostridium difficile TxeR, a sigma factor for toxin gene expression. J. Bacteriol.
184:5971–5978.
31. Marston, A., and J. Errington. 1999. Dynamic movement of the ParA-like
Soj protein of B. subtilis and its dual role in nucleoid organization and
developmental regulation. Mol. Cell 4:673–682.
32. Matamouros, S., P. England, and B. Dupuy. 2007. Clostridium difficile toxin
expression is inhibited by the novel regulator TcdC. Mol. Microbiol. 64:
1274–1288.
33. Matte, I., et al. 2009. Anti-apoptotic proteins Bcl-2/Bcl-XL inhibit Clostridium difficile toxin A-induced cell death in human epithelial cells. Infect.
Immun. 77:5400–5410.
J. BACTERIOL.
34. Mayer, M. J., A. Narbad, and M. J. Gasson. 2008. Molecular characterization of a Clostridium difficile bacteriophage and its cloned biologically active
endolysin. J. Bacteriol. 190:6734–6740.
35. Moineau, S., S. Pandian, and T. R. Klaenhammer. 1994. Evolution of a lytic
bacteriophage via DNA acquisition from the Lactococcus lactis chromosome.
Appl. Environ. Microbiol. 60:1832–1841.
36. Murray, R., D. Boyd, M. Mulvey, P. Levett, and M. Alfa. 2009. Truncation in
the tcdC region of the Clostridium difficile PathLoc of clinical isolates does
not predict increased biological activity of toxin B or toxin A. BMC Infect.
Dis. 9:103.
37. Nagy, E., and J. Foldes. 1991. Electron microscopic investigation of lysogeny
of Clostridium difficile strains isolated from antibiotic-associated diarrhea
cases and from healthy carriers. APMIS 99:321–326.
38. Pepin, J., L. Valiquette, and B. Cossette. 2005. Mortality attributable to
nosocomial Clostridium difficile-associated disease during an epidemic
caused by a hypervirulent strain in Quebec. CMAJ 173:1037–1042.
39. Sebaihia, M., et al. 2006. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat. Genet. 38:779–786.
40. Sell, T., D. Schaberg, and F. Fekety. 1983. Bacteriophage and bacteriocin
typing scheme for Clostridium difficile. J. Clin. Microbiol. 17:1148–1152.
41. Stabler, R., et al. 2009. Comparative genome and phenotypic analysis of
Clostridium difficile 027 strains provides insight into the evolution of a hypervirulent bacterium. Genome Biol. 10:R102.
42. Tan, K., B. Wee, and K. Song. 2001. Evidence for holin function of tcdE gene
in the pathogenicity of Clostridium difficile. J. Med. Microbiol. 50:613–619.
43. Verdoorn, B., et al. 2010. High prevalence of tcdC deletion-carrying Clostridium difficile and lack of association with disease severity. Diagn. Microbiol. Infect. Dis. 66:24–28.
44. Voth, D. E., and J. D. Ballard. 2005. Clostridium difficile toxins: mechanism
of action and role in disease. Clin. Microbiol. Rev. 18:247–263.
45. Warny, M., et al. 2005. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America
and Europe. Lancet 366:1079–1084.
161
ANNEXE II
Evidence of In Vivo Prophage Induction
during Clostridium difficile Infection
Updated information and services can be found at:
http://aem.asm.org/content/78/21/7662
These include:
SUPPLEMENTAL MATERIAL
REFERENCES
CONTENT ALERTS
Supplemental material
This article cites 47 articles, 26 of which can be accessed free
at: http://aem.asm.org/content/78/21/7662#ref-list-1
Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
Mathieu Meessen-Pinard, Ognjen Sekulovic and
Louis-Charles Fortier
Appl. Environ. Microbiol. 2012, 78(21):7662. DOI:
10.1128/AEM.02275-12.
Published Ahead of Print 24 August 2012.
Evidence of In Vivo Prophage Induction during Clostridium difficile
Infection
Mathieu Meessen-Pinard, Ognjen Sekulovic, and Louis-Charles Fortier
Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec, Canada
C
lostridium difficile is the leading cause of antibiotic-associated
nosocomial diarrhea in developed countries (18). Highly virulent strains, such as NAP1/027, have caused severe outbreaks in
North America and Europe since 2003 and are now spreading
worldwide, reaching Central America, Asia, and Australia (14). C.
difficile infections (CDI) are a consequence of antibiotic treatments that reduce the diversity of the intestinal microbiota (11).
C. difficile is a strictly anaerobic spore-forming Gram-positive bacillus that causes a wide range of clinical symptoms varying from
mild to severe diarrhea to fatal pseudomembranous colitis. The
pathogenic potential of C. difficile lies mainly in the expression of
two large exotoxins, TcdA and TcdB, encoded on a pathogenicity
locus (PaLoc) (26, 29). Additional virulence determinants are
probably important for full virulence of this pathogen, but little is
known about these factors and their importance in the development of CDI (38).
The rapid change in the epidemiology of C. difficile over the last
decade has raised several concerns, and the genetic basis for the
evolution of this pathogen is still unclear. With the advent of nextgeneration sequencing, several genomes of C. difficile have been
sequenced recently. The data obtained reveal that the horizontal
transfer of mobile genetic elements (MGE), such as conjugative
transposons and prophages, likely accounts for the great plasticity
of the C. difficile genome (23, 39, 43). For instance, 11% of the
genomic DNA of strain 630 is made up of MGE, including 8
conjugative transposons and 2 functional and highly similar
prophages (39). Moreover, the new epidemic NAP1/027 strain
R20291 was found to have acquired 5 unique DNA regions containing phage and transposon genes, two-component systems,
and transcriptional regulators, compared with the historic NAP1/
027 strain CD196 and strain 630 (43). This suggests that the acquisition of genetic material through horizontal gene transfer is
important in modeling the genome of C. difficile.
Recent studies have highlighted the great diversity of prophages in the clinical isolates of C. difficile (17, 36, 42), but only 5
7662
aem.asm.org
Applied and Environmental Microbiology
fully characterized phages with complete genomic sequences
are available in public databases. Phages ␾C2 (20), ␾CD119 (21),
and ␾CD27 (33) are members of the Myoviridae family, i.e.,
phages with long nonflexible contractile tails (1), whereas phages
␾CD6356 (24) and ␾CD38-2 (40) are members of the Siphoviridae family, i.e., phages with long and flexible noncontractile tails.
It is noteworthy to mention that all known phages of C. difficile are
temperate, i.e., they can adopt either a lytic or a temperate lifestyle
upon the infection of their host. Prophages are well-known contributors to the evolution of most bacterial species, including important pathogens (10), but their role in the virulence and evolution of C. difficile is still highly speculative. Two recent studies have
shown that C. difficile phages ␾CD119 and ␾CD38-2 can modulate toxin production, even if these phages do not encode identifiable virulence factors (22, 40).
DNA-damaging and SOS-inducing stresses are often good
prophage inducers that can contribute to horizontal gene transfer
in bacteria (3, 32). The phenomenon of spontaneous and antibiotic-triggered prophage induction has been described for several
phage-host systems, and the consequences of this phenomenon
can be significant. For example, the increase in the production of
Shiga toxins was shown to be tightly linked with spontaneous and
quinolone-triggered induction of prophages in Escherichia coli
(45, 47). Spontaneous prophage-induced lysis has been associated
Received 18 July 2012 Accepted 16 August 2012
Published ahead of print 24 August 2012
Address correspondence to Louis-Charles Fortier, louis-charles.fortier
@usherbrooke.ca.
M.M.-P. and O.S. contributed equally to this work.
Supplemental material for this article may be found at http://aem.asm.org/.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.02275-12
p. 7662–7670
November 2012 Volume 78 Number 21
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
Prophages contribute to the evolution and virulence of most bacterial pathogens, but their role in Clostridium difficile is unclear. Here we describe the isolation of four Myoviridae phages, ␾MMP01, ␾MMP02, ␾MMP03, and ␾MMP04, that were recovered as free viral particles in the filter-sterilized stool supernatants of patients suffering from C. difficile infection (CDI). Furthermore, identical prophages were found in the chromosomes of C. difficile isolated from the corresponding fecal samples. We
therefore provide, for the first time, evidence of in vivo prophage induction during CDI. We completely sequenced the genomes
of ␾MMP02 and ␾MMP04, and bioinformatics analyses did not reveal the presence of virulence factors but underlined the
unique character of ␾MMP04. We also studied the mobility of ␾MMP02 and ␾MMP04 prophages in vitro. Both prophages were
spontaneously induced, with 4 to 5 log PFU/ml detected in the culture supernatants of the corresponding lysogens. When lysogens were grown in the presence of subinhibitory concentrations of ciprofloxacin, moxifloxacin, levofloxacin, or mitomycin C,
the phage titers further increased, reaching 8 to 9 log PFU/ml in the case of ␾MMP04. In summary, our study highlights the extensive genetic diversity and mobility of C. difficile prophages. Moreover, antibiotics known to represent risk factors for CDI,
such as quinolones, can stimulate prophage mobility in vitro and probably in vivo as well, which underscores their potential
impact on phage-mediated horizontal gene transfer events and the evolution of C. difficile.
In vivo Prophage Induction in C. difficile
TABLE 1 C. difficile isolates used in this study
Isolates used for phage
enrichment and
detection
CD19
CD24
CD71
CD73
CD95
CD114
CD117
CD121
CD127
CD132
CD139
CD161
CD162
CD171
CD173
036
038
017
012
014
014
023
010
014
012
014
027
036
027
027
Naturally occurring lysogensb
CD343
CD368
CD380
023
026
006
Clinical isolate carrying ␾MMP02b
Clinical isolate carrying ␾MMP03b
Clinical isolate carrying ␾MMP04b
Laboratory-generated
lysogensc
CD407
CD408
CD411
CD412
036
023
023
012
CD19 isolate lysogenized with ␾MMP01
CD117 isolate lysogenized with ␾MMP02
CD117 isolate lysogenized with ␾MMP03
CD73 isolate lysogenized with ␾MMP04
Comment
a
PCR ribotype 027 represents the current BI/NAP1/027 epidemic clone, and the other
ribotype numbers were given arbitrarily according to our internal database.
b
Naturally occurring lysogens were isolated from stool samples that contained the
indicated free phages.
c
Laboratory-generated lysogens were obtained upon stable infection with the indicated
phage.
with the release of extracellular genomic DNA from Streptococcus
pneumoniae and increased biofilm formation (13). Prophage induction from a subpopulation of bacteria can also lead to the
killing of competing species, thus increasing the fitness of noninduced lysogens (8, 10, 31, 41), and can also promote horizontal
gene transfer among bacteria, thereby speeding up genomic evolution (5, 10). CDI is a consequence of antibiotic treatments that
destroy the intestinal microbiota, and recent epidemic clones of C.
difficile are resistant to numerous antibiotics, including most fluoroquinolones (37). Studying the impact of antibiotics, in particular fluoroquinolones, on horizontal gene transfer and prophage
mobility during C. difficile infection is thus of great interest.
In this study, we report the isolation of four different C. difficile
phages that were recovered as free viral particles in the feces of
patients suffering from CDI. We studied spontaneous and antibiotic-triggered prophage induction in vitro to assess the mobility of
these phages. Finally, the complete genomic sequence was determined for two of these phages, thus providing additional genomic
data on an understudied group of phages.
MATERIALS AND METHODS
Bacterial strains and culture conditions. All bacterial isolates used in this
work are listed in Table 1 and were kindly provided by Louis Valiquette
and Jacques Pépin from the Université de Sherbrooke. When required, C.
difficile was isolated from the feces of patients suffering from CDI and was
subjected to alcohol shock and growth on Clostridium difficile moxalactam norfloxacin (CDMN) selective agar (Oxoid) supplemented with 5%
sheep blood, 0.1% taurocholate, and 1 mM glycine. The institutional review board of the Centre Hospitalier Universitaire de Sherbrooke
November 2012 Volume 78 Number 21
(CHUS) approved the study protocol. Bacteria were routinely grown at
37°C in an anaerobic chamber (Coy Laboratories) in brain heart infusion
broth (BHI) (BD Bioscience) or TY broth (3% tryptose, 2% yeast extract
[pH 7.4]). All media were prereduced overnight under anaerobic conditions.
Bacterial DNA extraction and PCR ribotyping. Total genomic DNA
was purified using the Illustra bacterial genomic DNA extraction kit (GE
Healthcare) as described previously (40). All C. difficile isolates were analyzed by PCR ribotyping using an Eppendorf Mastercycler with 20 ng
purified genomic DNA and primers published by Bidet et al. (7), with
modifications described elsewhere (17). Band patterns were analyzed with
GelComparII (Applied Maths), and Pearson’s correlation coefficient was
used for cluster analyses.
Phage enrichment and isolation. Sewage samples from two water
treatment plants in Sherbrooke and human fecal samples from patients
suffering from CDI collected over a 1-year period were screened for the
presence of free phages. Raw sewage samples (400 ml) were passed
through 1.5-␮m Whatman filters (Schleicher & Schuell), followed by another filtration through 0.45-␮m EZ-Pak filters (Millipore), and then
5-ml volumes from 3 different samples were pooled. Stool samples were
homogenized in 10 ml of BHI, centrifuged at 4,000 x g for 60 min at room
temperature, and then passed through 0.45-␮m filter discs to remove
bacteria. Five stool samples were then pooled before the phage enrichment procedure. For phage enrichment, 15 C. difficile isolates were used as
hosts, which represented 8 different PCR ribotypes, including 3 isolates of
ribotype 027 (Table 1). Enrichment was done by adding 1.25 ml of the
pooled sewage sample to 1.5 ml of BHI containing 10 mM CaCl2 and 10
mM MgCl2 (BHIS) and a 2% (vol/vol) inoculum of an overnight C. difficile culture. For enrichment from stool samples, 2.5 ml of pooled stool
supernatants was combined with 2.5 ml of BHIS and 2% of an overnight
C. difficile culture. The next day, the cultures were centrifuged for 15 min
at 4,000 ⫻ g and passed through 0.45-␮m filter discs (Sarstedt). A second
enrichment was performed in a total volume of 5 ml BHIS, using 2.5 ml of
the first enrichment as the phage inoculum. Finally, a third enrichment
step was done as described above using the second enrichment broth as
the phage inoculum. Culture supernatants were then filter sterilized on
0.45-␮m disks, and 0.1-ml samples were added to soft agar overlays inoculated with the same strains as the hosts, as described previously (40).
Phage purification and amplification. Phages obtained after the enrichment procedure were purified from single isolated phage plaques using three successive rounds of soft agar overlays as described before (40).
Phage titers of ⱖ109 PFU/ml were routinely obtained with this method.
Creation of lysogens and prophage induction. C. difficile lysogens
carrying ␾MMP02 or ␾MMP04 prophages were created by spreading
dilutions of phage-sensitive C. difficile cultures on soft agar overlays containing phages (108 PFU/ml), as described previously (40). Five potentially phage-immune colonies were picked and restreaked 3 times on BHI
agar plates without phage to purify the lysogens. The presence of the
integrated prophage was confirmed by Southern blot hybridization using
lysogenic bacterial DNA and a digoxigenin (DIG)-labeled whole-phage
DNA probe (17). Alternatively, PCR with phage-specific primers was
used. The functionality of the integrated prophage was verified by treating
lysogens with UV light (302 nm) or mitomycin C (3 ␮g/ml), followed by
phage DNA purification and restriction analyses, as described previously
(40).
MIC determination. The MICs for ciprofloxacin (CIP), moxifloxacin
(MXF), and levofloxacin (LVX) were determined in 96-well plates.
Briefly, antibiotics were serially diluted in 96-wells plates in a final volume
of 0.1 ml. An equal volume of a bacterial culture at an optical density at
600 nm (OD600) of 0.3 was added to each well. Plates were incubated
under anaerobic conditions at 37°C, and the OD600 was monitored every
10 min over 16 h using a PowerWave XS microplate reader (BioTek Instruments).
Prophage induction by quinolones. Lysogenic bacteria were grown
on BHI soft agar plates containing either ␾MMP02 or ␾MMP04 to ensure
aem.asm.org 7663
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
Isolate no.
PCR
ribotypea
Meessen-Pinard et al.
RESULTS
Phage isolation. Our initial goal was to isolate strictly lytic (“virulent”) phages in raw sewage samples and the feces from CDI
patients using an enrichment protocol. A total of 30 sewage samples and 59 stool samples were processed, and only 6 stool samples
contained free phage particles capable of infecting the C. difficile
isolates we selected. Phage plaques were detected on isolates
7664
aem.asm.org
FIG 1 HindIII restriction profiles of isolated phages. The ethidium bromidestained gel shows ␾MMP01 (lane 1), ␾MMP02 (lane 2), ␾MMP03 (lane 3),
and ␾MMP04 (lane 4). Lane M, DNA Logic Ladder.
CD19, CD73, and CD117, which represent three different PCR
ribotypes (Table 1). Six phages were isolated from independent
stool samples, 3 of which had identical HindIII DNA restriction
profiles. Hence, they were considered to be identical phages, and
only one of them, ␾MMP02, was studied further (Fig. 1). Overall,
4 phages had unique HindIII restriction profiles and were thus
considered to be different. Phage ␾MMP01 was isolated on strain
CD19, ␾MMP02 and ␾MMP03 on strain CD117, and ␾MMP04
on strain CD73. Phage particles were observed under TEM, and
they all had an isometric head with a diameter of 58 to 70 nm
connected by a neck to a sheathed tail of 106 to 248 nm long and
about 20 nm wide (Table 2). Some particles with contracted
sheaths were observed in the lysates (data not shown), and based
on our observations, these phages would be classified as members
of the Myoviridae family of the order Caudovirales (1).
We verified whether the 15 C. difficile isolates that we used in
the enrichment protocol contained endogenous prophages corresponding to those that we isolated from fecal samples. As shown in
Fig. 2, Southern hybridizations with whole-phage DNA probes
corresponding to ␾MMP01, ␾MMP02, ␾MMP03, and ␾MMP04
confirmed that the C. difficile-sensitive isolates CD19, CD73, and
CD117 did not carry these prophages, although CD19 carried a
somewhat similar prophage but with a different restriction profile.
Thus, the phages that we isolated had not been induced from C.
difficile isolates used in the course of our enrichment and screening protocol but were truly free phage particles present in the stool
samples. We attempted to detect the phage particles by direct plating of fecal supernatants on indicator strains without prior enrichment, but the titers were below the limit of detection.
Phage lifestyle. In order to determine whether ␾MMP01,
␾MMP02, ␾MMP03, and ␾MMP04 were virulent or temperate,
we infected the sensitive hosts CD19, CD73, and CD117 at a high
multiplicity of infection (MOI) with the corresponding phages
and screened for lysogens. Several colonies were obtained, and
Southern hybridization assays were performed on the extracted
genomic DNA using whole-phage DNA probes. As shown in Fig. 2,
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
that bacteria were still phage immune and carrying the prophages. A single
colony was picked and grown overnight in TY broth. Cultures were then
washed by centrifugation in TY broth in order to eliminate any free-phage
particle that could have induced spontaneously, and 0.1 ml of washed
bacteria was used to inoculate 10 ml of fresh TY broth. When the OD600
reached 0.15, 0.5⫻ the MIC and lower concentrations of antibiotics were
added and the OD600 was monitored for a total of 8 h. Mitomycin C was
used as a control for prophage induction (17). One-milliliter aliquots
from each induction assay were then centrifuged at 14,000 x g for 1 min to
remove bacterial cells, and the supernatants were stored at 4°C. Phage
titers were determined by soft agar overlays containing the sensitive host
strain as described earlier. A control without antibiotic was also run in
parallel to determine the level of spontaneous prophage induction. At
least three independent assays were performed, and the mean ⫾ standard
error of the mean (SEM) of the log PFU/ml was plotted. Student’s t test
and one-way analysis of variance (ANOVA) analyses were performed with
Prism 5.04 (GraphPad) to determine whether antibiotics stimulated prophage induction compared to untreated controls. The level of statistical
significance was set to a P value of ⬍0.05.
Transmission electron microscopy. Phage particles were washed in
ammonium acetate, fixed onto 400-mesh Formvar/carbon-coated copper
grids (Cederlane Laboratories), and negatively stained with 2% uranyl
acetate (Cederlane Laboratories) as described previously (17). Phage particles were observed with a Hitachi H-7500 transmission electron microscope (TEM) operating at 60 kV, and pictures were taken with a 10megapixel digital camera (Hamamatsu) controlled with the AMT
software (Advanced Microscopy Techniques).
Phage DNA purification, restriction analysis, and Southern hybridization. A rapid phenol-chloroform protocol was used for small-scale
phage DNA purification from crude lysates (34), and the Lambda Maxi
DNA purification kit (Qiagen) was used for large-scale preparations. Restriction enzyme analysis of whole-phage DNA was done as described
elsewhere (40), and Southern hybridization was carried out using DIGlabeled whole-phage DNA probes (17).
Phage genome sequencing and bioinformatics analysis. Complete
phage genome sequencing was performed on a 454 GS FLX sequencer
system (Roche) at the Génome Québec Innovation Center of McGill University (Montréal, QC, Canada). Single contigs were obtained for both
phages, and additional sequencing was performed directly on purified
phage DNA with specific primers on an ABI 3730xl sequencer (Applied
Biosystems) at the genomic platform of the CHUL research center (Québec, QC, Canada). Additional sequence assembly was done using the Gap
v4.10 application of the Staden v1.6.0 package. Some editing was also
done using BioEdit v7.0.5.3 and Artemis 13.0. Putative open reading
frames (ORFs) encoding ⱖ30 amino acids were predicted using GeneMark.hmm for Prokaryotes v2.8 (28). All predicted ORFs were translated into proteins using the standard ATG initiation codon or the alternative codons GTG and TTG, based on the presence of a suitable
ribosome-binding site. The predicted proteins were compared with the
BLASTp tools of the NCBI (4) and A CLAssification of Mobile genetic
Elements (ACLAME) (27) databases. The identification of conserved domains was performed through searches in the Conserved Domains Database (CDD) (NCBI) and InterProScan analyses (46).
Nucleotide sequence accession number. The complete genome sequences of phages ␾MMP02 and ␾MMP04 have been deposited in
GenBank under the accession numbers JX145341 and JX145342, respectively.
In vivo Prophage Induction in C. difficile
TABLE 2 Morphological characteristics of isolated phages in the family
Myoviridae
Phage
Tail length
Capsid
diameter (nm)a (nm)a
133 ⫾ 2
␾MMP02 62 ⫾ 3
248 ⫾ 10
␾MMP03 70 ⫾ 4
135 ⫾ 7
␾MMP04 58 ⫾ 1
106 ⫾ 3
a
b
Means of 5 measurements obtained with different viral particles.
The black bars represent 100 nm.
prophages with restriction profiles corresponding to each infecting phage were found in the chromosome of the CD19, CD73, and
CD117 lysogens but not in the parental uninfected isolates. A few
minor differences were observed between the restriction pro-
November 2012 Volume 78 Number 21
aem.asm.org 7665
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
␾MMP01 67 ⫾ 3
TEM pictureb
files of the purified phages and the lysogens, which is the consequence of integration of the phage DNA into the bacterial
chromosome. Additional UV and mitomycin C treatments
were done on the lysogens to confirm the functionality of the
prophages (data not shown). Our results confirmed that
␾MMP01, ␾MMP02, ␾MMP03, and ␾MMP04 are all temperate phages.
Since free temperate phages were isolated directly from stool
samples, we deduced that they had probably been released from
indigenous C. difficile cells during infection. To demonstrate that,
we isolated C. difficile from the phage-positive stool samples and
looked for the presence of the corresponding prophage by Southern blot hybridization. We could not recover C. difficile from the
stool sample containing ␾MMP01 due to loss of the initial sample,
but as predicted, isolates CD343, CD368, and CD380 carried a
prophage corresponding to ␾MMP02, ␾MMP03, and ␾MMP04,
respectively (Fig. 2). This confirmed that the prophages had been
induced and released by C. difficile during infection. To our
knowledge, this is the first report of such in vivo prophage induction by C. difficile.
Influence of antibiotics on prophage induction. Prophage induction from lysogens was assessed in vitro in the presence of three
common quinolones. We focused our analyses on ␾MMP02 and
␾MMP04 because we determined the genomic sequence of these
two phages only (see below). The MICs for CIP, MXF, and LVX
were determined on lysogenic isolates CD343 and CD380, which
correspond to the naturally occurring clinical isolates purified
from phage-positive stools and carry ␾MMP02 and ␾MMP04,
respectively. The MICs were also determined on CD408 and
CD412 that were obtained upon lysogenization of strains CD117
and CD73 with ␾MMP02 and ␾MMP04, respectively (Table 1).
Bacteria were grown in the presence of sub-MICs (ⱕ0.5⫻ MIC) of
antibiotics, and phage titers were determined in culture supernatants after 8 h of growth. As shown in Fig. 3, ␾MMP02 and
␾MMP04 spontaneously induced and initiated a lytic cycle, leading to the release of ⬃4 to 5.5 log PFU/ml after 8 h of growth
(white bars). In addition, the spontaneous induction of ␾MMP04
from the naturally occurring CD380 lysogen led to a phage titer
⬃1.5 log higher than that of the laboratory-generated CD412
lysogen, suggesting a greater stability in the latter strain. In contrast, the spontaneous induction of ␾MMP02 was similar in both
CD343 and CD408 lysogens, with titers of ⬃5 ⫻ 104 PFU/ml (Fig.
3A and B).
Treatment of C. difficile lysogens carrying ␾MMP02 with different sub-MICs of CIP, MXF, or LVX or with mitomycin C (MC)
had little effect on prophage induction (Fig. 3A and B). A slight
increase in the phage titers was observed at some concentrations,
but these differences were not statistically significant after oneway ANOVA analyses. The only exception was observed with 16
␮g/ml CIP (0.25⫻ MIC), where a statistically significant increase
in the phage titer was noted (7.5 ⫻ 105 versus 4.5 ⫻ 104 PFU/ml,
P ⬍ 0.01). These results suggest that induction of the ␾MMP02
prophage by quinolones and MC is not very efficient, at least under the conditions tested.
In contrast, the ␾MMP04 prophage was more sensitive to
treatment with MXF, LVX, and MC with phage titers 2 to 4 logs
higher than in the untreated controls in both lysogens tested (Fig.
3C and D). For example, the highest phage titers obtained with the
CD402 lysogen were 8.1 ⫻ 107, 5.1 ⫻ 106, and 3.1 ⫻ 108 PFU/ml
after treatment with MXF, LVX, and MC, respectively, whereas
Meessen-Pinard et al.
to confirm the presence of corresponding prophages in wild-type strains and laboratory-generated lysogens. (A) Ethidium bromide (EtBr)-stained gel of
HindIII-digested bacterial genomic DNA and purified phage DNA (␾MMP01 to -04). (B) Southern blot hybridization of the gel shown in panel A; the phage
probes used are indicated below the corresponding panels. Lane M, DIG-labeled lambda HindIII DNA marker (NEB).
the untreated control released 8.3 ⫻ 103 PFU/ml (Fig. 3C). For the
CD380 lysogen, treatment with CIP, MXF, LVX, and MC led to
the release of 1.7 ⫻ 108, 7.4 ⫻ 108, 3.3 ⫻ 108, and 5.4 ⫻ 108
PFU/ml, respectively, as opposed to a phage titer of 4 ⫻ 105
PFU/ml in the untreated control (Fig. 3D). Interestingly, treatment with CIP stimulated prophage induction in the wild-type
CD380 lysogen (Fig. 3D) but not in the laboratory-generated
CD402 lysogen (Fig. 3C). Taken together, our results suggest that
FIG 3 Effect of antibiotics on ␾MMP02 and ␾MMP04 induction. Prophage induction was assessed after 8 h of growth in the presence of various sub-MICs of
ciprofloxacin (CIP), moxifloxacin (MXF), or levofloxacin (LVX). Mitomycin C (MC) was used as a positive control of induction. (A and C) Induction from
laboratory-generated lysogens. (B and D) Induction from wild-type lysogens. The differences in phage titers were analyzed by one-way ANOVA followed by
Dunnett’s posttest using the noninduced control (NI) as the comparator. One asterisk indicates significance with a P value of ⬍0.05, two asterisks indicate
significance with a P value of ⬍0.01, and three asterisks indicate significance with a P value of ⬍0.001.
7666
aem.asm.org
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
FIG 2 Prophage detection by Southern blot hybridization with whole-phage DNA probes. DIG-labeled whole-phage DNA probes (␾MMP01 to -04) were used
In vivo Prophage Induction in C. difficile
Purified phage DNA from different temperate phages in our collection was
compared using DIG-labeled whole-phage genomes as probes. Phages
␾CD38-2, ␾CD24-1, ␾CD111, and ␾CD29 are Siphoviridae phages, whereas
all the others are Myoviridae phages. Lane M, DIG-labeled lambda HindIII
DNA marker (NEB).
the stability of ␾MMP02 and ␾MMP04 prophages is similar, but
␾MMP04 is significantly less stable in the presence of antibiotics.
Whole-genome comparison. We assessed the overall genome
similarity of the phages ␾MMP01, ␾MMP02, ␾MMP03, and
␾MMP04 by Southern blot hybridization with whole-phage
probes (Fig. 4). We compared the four phages with each other and
also with other phages from our collection (17). Hybridization
with a ␾MMP02 probe revealed significant DNA similarity with
␾CD52 but limited similarity with ␾MMP01 and ␾MMP03,
whereas hybridization with a ␾MMP03 probe revealed extensive
similarity with ␾MMP01, ␾CD52, ␾CD630-2, and ␾CD24-2. The
4 ␾MMP phages were also found to be genetically distant from
␾CD38-2, a Siphoviridae phage that we described previously (data
not shown) (40). The phage ␾MMP04 seemed to be very different
from the 3 other ␾MMP phages, suggesting that this phage is
genetically unique among our collection of isolates. In brief,
␾MMP01, ␾MMP02, and ␾MMP03 were similar to other known
Myoviridae phages, but ␾MMP04 seemed genetically unique.
Genome sequencing. The low similarity observed by Southern
hybridizations between ␾MMP02, ␾MMP04, and the other
phages prompted us to determine their whole genomic sequences.
The complete genome of ␾MMP02 was determined after 454 sequencing and the assembly of 51,685 reads with an average length
of 317 bp. The sequencing of ␾MMP04 also resulted in a single
contig of 31,662 bp assembled from 23,416 reads (average length
of 318 bp). For both phages, additional PCR and direct sequencing
on purified phage DNA confirmed the completeness of the genomes. The phage ␾MMP02 is composed of a double-stranded
November 2012 Volume 78 Number 21
aem.asm.org 7667
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
FIG 4 Whole-phage-genome comparison using Southern blot hybridization.
DNA of 48,396 bp with an average G⫹C content of 29.6%, while
the ␾MMP04 genome is much smaller, with 31,674 bp of doublestranded DNA and a G⫹C content of 30.0%. To our knowledge,
this is the smallest C. difficile phage genome sequence reported
so far.
Genomic organization and comparative analysis. GeneMark.hmm analyses were performed on both the ␾MMP02 and
␾MMP04 genomes (28). Seventy-six and fifty-one putative open
reading frames (ORFs) encoding ⱖ30 amino acids were found in
␾MMP02 and ␾MMP04, respectively. Comparison against the
NCBI and ACLAME databases enabled us to assign a putative
function to 36 of the 76 ORFs (47%) in ␾MMP02 and 24 of the 51
ORFs (47%) in ␾MMP04 (see Tables S1 and S2 in the supplemental material). The overall genomic organization of both phages
appeared to be classical, with clusters of genes coding for distinct
functional modules (Fig. 5). It is noteworthy to mention that virulence factors and toxin genes were not found in the two genomes
using the bioinformatics approach. Protein comparison against
public databases and the 5 C. difficile phage genomic sequences
currently available revealed a great extent of similarity between the
phage ␾MMP02 and previously characterized Myoviridae phages.
For example, the whole DNA packaging, structural, and lysis
modules (ORFs 1 to 34) encode proteins highly similar, and for
the most part unique, to phage ␾CD27 (Fig. 5, upper panel).
However, some tail proteins, as well as the holin and endolysin
(ORFs 22 to 34), were also similar to phages ␾C2 and ␾CD119,
prophages from C. difficile strain 630, and a putative prophage
from strain ATCC 43255. In fact, besides ␾CD27, the prophage in
strain ATCC 43255 was the most similar to ␾MMP02, with 30
ORFs showing ⬎71% protein identity. Some divergence was observed in ORFs 24 to 28 between ␾MMP02 and ␾CD27, suggesting that these tail proteins are probably involved in host specificity.
In the case of ␾MMP04, little similarity was observed with
previously characterized C. difficile phage genomes over the packaging, capsid, and part of the tail modules (ORFs 1 to 13) (Fig. 5,
lower panel). However, similarity was observed with proteins
found in Clostridium hiranonis, Clostridium cellulovorans, and
Clostridium botulinum. Also, a prophage with extensive similarity
to ␾MMP04 was identified in a draft genome of a C. difficile strain
(UniProt accession no. AGAB01000039). The whole packaging,
head and tail structural modules, as well as the lysis cassette (ORFs
1 to 26) were highly similar at the protein level (⬎81% identity).
As for ␾MMP02, some of the tail fiber proteins (ORFs 20 to 22)
diverged between ␾MMP04 and the other phages, suggesting that
these proteins may also be responsible for host specificity. Some of
the tail proteins (ORFs 9 to 26) were also similar to proteins from
phage ␾CD119 and prophages from strain 630. We found several
ORFs whose products had significant similarity with proteins
from two Siphoviridae phages, ␾CD6356 and ␾CD38-2 (Fig. 5),
and the similarity was concentrated downstream from the lysis
cassette (ORF 26).
Lysogeny module. The phage ␾MMP02 has a lysogeny module delimited by the endolysin gene on the left side (ORF 34) and
a set of phage repressors and regulators on the right side (ORFs 42
to 48). A similar organization was also reported in other Myoviridae phages infecting C. difficile (20, 21, 33). However, a lysogeny
module could not be clearly identified in ␾MMP04; an integrase
gene (ORF 47) and a putative phage repressor (ORF 37) were
found interspersed between other DNA replication and regulation
Meessen-Pinard et al.
inferred from bioinformatics analyses are indicated below the ORFs. Functional modules were assigned with regard to gene annotation and whole genomic
organization, and the color code is as follows: yellow, DNA packaging; red, capsid morphogenesis; blue, tail morphogenesis; gray, lysis; orange, lysogeny; and
green, DNA replication, transcription, and gene regulation. The dot matrices above and below the genomic maps show the degree of protein identity observed
among ␾MMP02, ␾MMP04, and other known phages using BLASTp analysis.
genes (Fig. 5). This type of organization was also reported in the
temperate Siphoviridae phage ␾CD38-2 (40). In brief, the similarity observed at the protein level between ␾MMP04, ␾CD38-2, and
␾CD6356 in the DNA replication/gene regulation and lysogeny
modules suggests that ␾MMP04 is somewhat related to the Siphoviridae phages.
DISCUSSION
We report the isolation and characterization of four phages infecting C. difficile: ␾MMP01, ␾MMP02, ␾MMP03, and ␾MMP04.
TEM observations revealed that they are morphologically similar
to other Myoviridae phages in C. difficile that were recently described (17, 20, 21, 33, 36, 42). These phages were isolated as free
viral particles in the feces from patients infected by C. difficile, and
identical prophages were found in the chromosomes of the C.
difficile strains present in the corresponding fecal samples. We
demonstrated that the phages were also able to lysogenize other
laboratory strains of C. difficile, confirming their temperate lifestyle. We therefore conclude that the ␾MMP phages were spontaneously induced from C. difficile in vivo. To our knowledge, this
is the first report providing evidence of in vivo prophage induction
during C. difficile infection.
The search for strictly lytic phages, i.e., those that can only
infect and kill their host by lysis, has become very attractive in
recent years because of their potential usefulness as therapeutic
agents (2). Nobody has ever reported the isolation of such phages
that are active against C. difficile, and all phages known to infect
this species are temperate (15, 19, 21, 24, 30, 33, 35, 36, 40, 42).
Using only 15 different C. difficile test strains, we were able to
7668
aem.asm.org
detect free phages in 10% of the fecal samples tested. Considering
the very narrow host spectrum of C. difficile phages in general, we
could probably detect more phages if additional test strains were
used. Therefore, in vivo prophage induction appears to occur frequently during CDI. On the contrary, free phage particles could
not be isolated in sewage samples. In fact, due to extreme oxygen
sensitivity, most live cells of C. difficile are expected to be in their
spore form outside the mammalian gut and are thus insensitive to
phage infection. The propagation of a virulent phage under these
conditions should therefore be very unlikely. Conversely, bacteria
are metabolically active during infection and are thus susceptible
to phage attacks. In this context, a temperate lifestyle with controlled spontaneous prophage induction from a subset of the bacterial population seems to be a better strategy for guaranteeing
phage survival and dissemination than is a strictly lytic lifestyle.
Such a strategy seems to be the one adopted by phages infecting
Streptococcus pyogenes (9, 16).
In an effort to gain insight into the genetics of the C. difficile
phages, we determined the complete genomic sequence of ␾MMP02
and ␾MMP04. No virulence factors or toxin genes could be readily inferred from bioinformatics analyses, which so far seems to be
a common feature of this group of phages (20, 21, 24, 33, 39, 40).
Nevertheless, recent studies have suggested that even in the absence of identifiable virulence factors or toxin genes, ␾CD119 and
␾CD38-2 prophages can influence toxin production in C. difficile
(22, 40). Our comparative genomic analyses also further demonstrate the mosaic nature and the great genetic diversity of this
group of phages, with ␾MMP02 and ␾MMP04 forming distinct
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
FIG 5 Genome organization of ␾MMP02 and ␾MMP04. The arrows indicate the predicted ORFs and their respective orientation. The putative functions
In vivo Prophage Induction in C. difficile
ACKNOWLEDGMENTS
This work was supported by a discovery grant from the Natural Sciences
and Engineering Research Council of Canada (NSERC), by a seed grant
from the Canadian Institutes of Health Research (CIHR), and by the
Centre de Recherche Clinique Étienne-Le Bel. L.-C.F. is the holder of a
Junior 2 research award from the Fonds de la Recherche du Québec–Santé
(FRQ-S).
REFERENCES
1. Ackermann HW. 2009. Phage classification and characterization. Methods Mol. Biol. 501:127–140.
2. Adhya S, Merril C. 2006. The road to phage therapy. Nature 443:754 –
755.
3. Allen HK, et al. 2011. Antibiotics in feed induce prophages in swine fecal
microbiomes. mBio 2:e00260-11. doi:10.1128/mBio.00260-11.
4. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local
alignment search tool. J. Mol. Biol. 215:403– 410.
November 2012 Volume 78 Number 21
5. Asadulghani M, et al. 2009. The defective prophage pool of Escherichia
coli O157: prophage-prophage interactions potentiate horizontal transfer
of virulence determinants. PLoS Pathog. 5:e1000408. doi:10.1371/
journal.ppat.1000408.
6. Banks DJ, Lei B, Musser JM. 2003. Prophage induction and expression of
prophage-encoded virulence factors in group A Streptococcus serotype M3
strain MGAS315. Infect. Immun. 71:7079 –7086.
7. Bidet P, Barbut F, Lalande V, Burghoffer B, Petit J. 1999. Development
of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing. FEMS Microbiol. Lett. 175:261–266.
8. Bossi L, Fuentes JA, Mora G, Figueroa-Bossi N. 2003. Prophage contribution to bacterial population dynamics. J. Bacteriol. 185:6467– 6471.
9. Broudy TB, Fischetti VA. 2003. In vivo lysogenic conversion of Tox(⫺)
Streptococcus pyogenes to Tox(⫹) with lysogenic streptococci or free
phage. Infect. Immun. 71:3782–3786.
10. Brussow H, Canchaya C, Hardt WD. 2004. Phages and the evolution of
bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68:560 – 602.
11. Buffie CG, et al. 2012. Profound alterations of intestinal microbiota
following a single dose of clindamycin results in sustained susceptibility to
Clostridium difficile-induced colitis. Infect. Immun. 80:62–73.
12. Cao R, et al. 2012. Elevated enterotoxin A expression and formation in
Staphylococcus aureus and its association with prophage induction. Appl.
Environ. Microbiol. 78:4942– 4948.
13. Carrolo M, Frias MJ, Pinto FR, Melo-Cristino J, Ramirez M. 2010.
Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae. PLoS One 5:e15678. doi:
10.1371/journal.pone.0015678.
14. Clements ACA, Magalhães RJS, Tatem AJ, Paterson DL, Riley TV. 2010.
Clostridium difficile PCR ribotype 027: assessing the risks of further worldwide spread. Lancet Infect. Dis. 10:395– 404.
15. Dei R. 1989. Observations on phage-typing of Clostridium difficile: preliminary evaluation of a phage panel. Eur. J. Epidemiol. 5:351–354.
16. Fischetti V. 2007. In vivo acquisition of prophage in Streptococcus pyogenes. Trends Microbiol. 15:297–300.
17. Fortier LC, Moineau S. 2007. Morphological and genetic diversity of
temperate phages in Clostridium difficile. Appl. Environ. Microbiol. 73:
7358 –7366.
18. Freeman J, et al. 2010. The changing epidemiology of Clostridium difficile
infections. Clin. Microbiol. Rev. 23:529 –549.
19. Goh S, Riley T, Chang B. 2005. Isolation and characterization of temperate bacteriophages of Clostridium difficile. Appl. Environ. Microbiol.
71:1079 –1083.
20. Goh S, Ong PF, Song KP, Riley TV, Chang BJ. 2007. The complete
genome sequence of Clostridium difficile phage phiC2 and comparisons to
phiCD119 and inducible prophages of CD630. Microbiology 153:676 –
685.
21. Govind R, Fralick J, Rolfe R. 2006. Genomic organization and molecular
characterization of Clostridium difficile bacteriophage PhiCD119. J. Bacteriol. 188:2568 –2577.
22. Govind R, Vediyappan G, Rolfe RD, Dupuy B, Fralick JA. 2009.
Bacteriophage-mediated toxin gene regulation in Clostridium difficile. J.
Virol. 83:12037–12045.
23. He M, et al. 2010. Evolutionary dynamics of Clostridium difficile over
short and long time scales. Proc. Natl. Acad. Sci. U. S. A. 107:7527–7532.
24. Horgan M, et al. 2010. Genome analysis of the Clostridium difficile
phage PhiCD6356, a temperate phage of the Siphoviridae family. Gene
462:34 – 43.
25. Imamovic L, Muniesa M. 2012. Characterizing RecA-independent induction of Shiga toxin2-encoding phages by EDTA treatment. PLoS One
7:e32393. doi:10.1371/journal.pone.0032393.
26. Kuehne SA, et al. 2010. The role of toxin A and toxin B in Clostridium
difficile infection. Nature 467:711–713.
27. Leplae R, Hebrant A, Wodak SJ, Toussaint A. 2004. ACLAME: a CLAssification of Mobile genetic Elements. Nucleic Acids Res. 32:D45–D49.
28. Lukashin AV, Borodovsky M. 1998. GeneMark.hmm: new solutions for
gene finding. Nucleic Acids Res. 26:1107–1115.
29. Lyras D, et al. 2009. Toxin B is essential for virulence of Clostridium
difficile. Nature 458:1176 –1179.
30. Mahony D, Bell P, Easterbrook K. 1985. Two bacteriophages of Clostridium difficile. J. Clin. Microbiol. 21:251–254.
31. Maiques E, et al. 2006. beta-lactam antibiotics induce the SOS response
aem.asm.org 7669
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
phage families based on their head and tail structural components.
Moreover, the presence of an atypical regulatory/lysogeny module
and similarity with phages ␾CD6356 and ␾CD38-2 also suggest
that ␾MMP04 might have arisen from a past recombination event
between a Myoviridae and a Siphoviridae phage. This is the first
example of such an unusual genomic organization among C. difficile phages, but only two Siphoviridae phage genomes, ␾CD6356
(24) and ␾CD38-2 (40), have been sequenced so far. As we obtain
more sequences of Siphoviridae phages in the future, we might
observe other examples of cross-family recombination events.
Under laboratory conditions, the ␾MMP02 and ␾MMP04 lysogens spontaneously released 4 to 5 log PFU/ml after 8 h of incubation, thus suggesting a certain degree of instability among C.
difficile prophages. Similar phage titers have also been reported
after growth of lysogenic staphylococcal strains under normal laboratory conditions (31). Some years ago, Mahony et al. reported
the spontaneous release of two bacteriophages after in vitro
screening of 94 C. difficile isolates (30). Goh et al. also noticed that
72% of their laboratory-generated lysogens carrying either ␾C2,
␾C6, or ␾C8 spontaneously lost their prophage upon storage at
⫺70°C, while no stable lysogen of ␾C5 could be obtained (19).
The biological impacts of spontaneous prophage induction on the
virulence and lifestyle are well established for other bacteria, such
as Staphylococcus aureus, S. pneumoniae, S. pyogenes, and E. coli (6,
12, 13, 25), but the importance of this phenomenon in C. difficile
has yet to be demonstrated.
Ciprofloxacin and beta-lactams were shown to promote the
transfer of pathogenicity islands (SaPIs) in S. aureus (31, 44), and
norfloxacin was recently used to induce several prophages from C.
difficile isolates (36, 42). We have shown that ␾MMP04 was particularly unstable compared to ␾MMP02 in the presence of ciprofloxacin, moxifloxacin, and levofloxacin, and phage titers several orders of magnitude above the titers of noninduced cultures
were observed. Our in vitro results strongly suggest that antibiotics
such as fluoroquinolones, known to represent risk factors for CDI
(37), could also increase the frequency of prophage induction in
vivo and, potentially, the frequency of phage-mediated gene transfer during CDI. Antibiotic pressure is an important driving force
in bacterial evolution, and the extensive use of antibiotics that
induce CDI and that stimulate prophage mobility at the same time
could provide an ideal background for the rapid evolution of C.
difficile and its associated phages. Further genetic and molecular
studies will be needed to better grasp the impacts of prophages on
the lifestyle and evolution of C. difficile.
Meessen-Pinard et al.
32.
33.
34.
36.
37.
38.
39.
7670
aem.asm.org
40.
41.
42.
43.
44.
45.
46.
47.
tridium difficile has a highly mobile, mosaic genome. Nat. Genet. 38:779 –
786.
Sekulovic O, Meessen-Pinard M, Fortier L-C. 2011. Prophagestimulated toxin production in Clostridium difficile NAP1/027 lysogens. J.
Bacteriol. 193:2726 –2734.
Selva L, et al. 2009. Killing niche competitors by remote-control bacteriophage induction. Proc. Natl. Acad. Sci. U. S. A. 106:1234 –1238.
Shan J, et al. 2012. Prophage carriage and diversity within clinically
relevant strains of Clostridium difficile. Appl. Environ. Microbiol. 78:
6027– 6034.
Stabler RA, et al. 2009. Comparative genome and phenotypic analysis of
Clostridium difficile 027 strains provides insight into the evolution of a
hypervirulent bacterium. Genome Biol. 10:R102.
Ubeda C, et al. 2005. Antibiotic-induced SOS response promotes horizontal dissemination of pathogenicity island-encoded virulence factors in
staphylococci. Mol. Microbiol. 56:836 – 844.
Wagner PL, et al. 2002. Bacteriophage control of Shiga toxin 1 production and release by Escherichia coli. Mol. Microbiol. 44:957–970.
Zdobnov EM, Apweiler R. 2001. InterProScan–an integration platform
for the signature-recognition methods in InterPro. Bioinformatics 17:
847– 848.
Zhang X, et al. 2000. Quinolone antibiotics induce Shiga toxin-encoding
bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:
664 – 670.
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on October 5, 2012 by UNIVERSITE DE SHERBROOKE
35.
and horizontal transfer of virulence factors in Staphylococcus aureus. J.
Bacteriol. 188:2726 –2729.
Matsushiro A, Sato K, Miyamoto H, Yamamura T, Honda T. 1999.
Induction of prophages of enterohemorrhagic Escherichia coli O157:H7
with norfloxacin. J. Bacteriol. 181:2257–2260.
Mayer MJ, Narbad A, Gasson MJ. 2008. Molecular characterization of a
Clostridium difficile bacteriophage and its cloned biologically active endolysin. J. Bacteriol. 190:6734 – 6740.
Moineau S, Pandian S, Klaenhammer T. 1994. Evolution of a lytic
bacteriophage via DNA acquisition from the Lactococcus lactis chromosome. Appl. Environ. Microbiol. 60:1832–1841.
Nagy E, Foldes J. 1991. Electron microscopic investigation of lysogeny of
Clostridium difficile strains isolated from antibiotic-associated diarrhea
cases and from healthy carriers. Acta Pathol. Microbiol. Immunol. Scand.
99:321–326.
Nale JY, et al. 2012. Diverse temperate bacteriophage carriage in
Clostridium difficile 027 strains. PLoS One 7:e37263. doi:10.1371/
journal.pone.0037263.
Pepin J, et al. 2005. Emergence of fluoroquinolones as the predominant
risk factor for Clostridium difficile-associated diarrhea: a cohort study during an epidemic in Quebec. Clin. Infect. Dis. 41:1254 –1260.
Rupnik M, Wilcox MH, Gerding DN. 2009. Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7:526 –536.
Sebaihia M, et al. 2006. The multidrug-resistant human pathogen Clos-
172
ANNEXE III
Characterization of Temperate Phages
Infecting Clostridium difficile Isolates of
Human and Animal Origins
Updated information and services can be found at:
http://aem.asm.org/content/80/8/2555
These include:
REFERENCES
CONTENT ALERTS
This article cites 59 articles, 32 of which can be accessed free
at: http://aem.asm.org/content/80/8/2555#ref-list-1
Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
Ognjen Sekulovic, Julian R. Garneau, Audrey Néron and
Louis-Charles Fortier
Appl. Environ. Microbiol. 2014, 80(8):2555. DOI:
10.1128/AEM.00237-14.
Published Ahead of Print 14 February 2014.
Characterization of Temperate Phages Infecting Clostridium difficile
Isolates of Human and Animal Origins
Ognjen Sekulovic, Julian R. Garneau, Audrey Néron, Louis-Charles Fortier
Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec, Canada
C
lostridium difficile is currently the principal cause of antibiotic-induced infectious diarrhea and is an important nosocomial pathogen (1). This Gram-positive, spore-forming, anaerobic
bacterium also causes infections in a number of animal species,
especially horses, piglets, calves, and dogs (2). In humans, the
clinical symptoms range from mild watery diarrhea and abdominal pain to fulminant pseudomembranous colitis and are caused
by two main exotoxins, TcdA and TcdB, encoded by the pathogenicity locus of toxigenic isolates. Other virulence factors, like a
binary toxin (CDT) and various cell surface proteins, possibly
contribute to the overall virulence of this species as well (3). The
epidemiology of C. difficile infections (CDI) has changed significantly over the last decade, in particular after the emergence of
epidemic strains such as NAP1/BI/027, simply referred to as PCR
ribotype 027 (4). This particular strain caused several outbreaks in
North America and Europe, and although other PCR ribotypes,
such as 014, 001, and 078, have gradually replaced 027 in Europe
(5), 027 is still dominant in North America (6).
C. difficile is generally considered to be a nosocomial pathogen,
but a growing number of studies suggest that asymptomatic carriage and infections contracted outside hospitals, in the community, may be more frequent than previously thought (7). In addition, some PCR ribotypes that were previously associated mainly
with animal infections, like 078, are now recognized as causing
significant human infections (8). This led to the hypothesis that
the environment, and in particular farm animals, could represent
a natural reservoir for the amplification of C. difficile (9). A number of C. difficile isolates from animals have the same PCR ribotype
as human isolates (e.g., ribotype 078), which suggests that these
strains can pass from one host to another and vice versa (2, 10).
However, current epidemiologic and genomic data are insufficient to clearly establish that transmission of CDI can be zoonotic.
Integrated bacteriophages, i.e., prophages, often drive the evo-
April 2014 Volume 80 Number 8
lution of bacteria and represent a major source of genetic diversity
(11). Unfortunately, the importance of these prophages is often
neglected in epidemiological studies with C. difficile, mainly because of the typing methods used, which do not take into consideration mobile genetic elements (MGE). Indeed, the most common typing methods, like PCR ribotyping (12), multilocus
variable-number tandem-repeat analysis (MLVA) (13), and multilocus sequence typing (14), do not take into account the gain or
loss of prophages and other MGE, which can make up as much as
10% of the whole bacterial genome (15). Pulsed-field gel electrophoresis (PFGE), which is another common C. difficile typing
method in North America (16), can, in principle, reveal such differences, but whether these differences are due to the acquisition
or loss of specific DNA fragments or the result of acquisition or
loss of a particular restriction site is difficult to establish.
Several putative prophages can be identified by bioinformatic
analyses of C. difficile whole-genome sequences available in public
repositories. Several prophages and phage tail-like particles have
also been induced from C. difficile lysogens by using UV, mitomycin C, and other antibiotics, and some of these phages have been
partially characterized by electron microscopy, PFGE, and restriction profiling (17–22). Most phages are members of the Myoviridae family, i.e., phages with nonflexible and contractile tails,
Received 21 January 2014 Accepted 6 February 2014
Published ahead of print 14 February 2014
Editor: M. W. Griffiths
Address correspondence to Louis-Charles Fortier,
[email protected].
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.00237-14
Applied and Environmental Microbiology
p. 2555–2563
aem.asm.org
2555
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
Clostridium difficile is a Gram-positive pathogen infecting humans and animals. Recent studies suggest that animals could represent potential reservoirs of C. difficile that could then transfer to humans. Temperate phages contribute to the evolution of
most bacteria, for example, by promoting the transduction of virulence, fitness, and antibiotic resistance genes. In C. difficile,
little is known about their role, mainly because suitable propagating hosts and conditions are lacking. Here we report the isolation, propagation, and preliminary characterization of nine temperate phages from animal and human C. difficile isolates. Prophages were induced by UV light from 58 C. difficile isolates of animal and human origins. Using soft agar overlays with 27 different C. difficile test strains, we isolated and further propagated nine temperate phages: two from horse isolates (␾CD481-1 and
␾CD481-2), three from dog isolates (␾CD505, ␾CD506, and ␾CD508), and four from human isolates (␾CD24-2, ␾CD111,
␾CD146, and ␾CD526). Two phages are members of the Siphoviridae family (␾CD111 and ␾CD146), while the others are
Myoviridae phages. Pulsed-field gel electrophoresis and restriction enzyme analyses showed that all of the phages had unique
double-stranded DNA genomes of 30 to 60 kb. Phages induced from human C. difficile isolates, especially the members of the
Siphoviridae family, had a broader host range than phages from animal C. difficile isolates. Nevertheless, most of the phages
could infect both human and animal strains. Phage transduction of antibiotic resistance was recently reported in C. difficile. Our
findings therefore call for further investigation of the potential risk of transduction between animal and human C. difficile
isolates.
Sekulovic et al.
MATERIALS AND METHODS
Bacterial strains and culture conditions. The human C. difficile isolates
used in this study were kind gifts from collaborators (for details, see Table
1) or were isolated from fecal samples with the approval of the institutional review board of the Centre Hospitalier Universitaire de Sherbrooke
(CHUS) (33). All animal and meat C. difficile isolates were obtained from
Scott Weese of the University of Guelph (Guelph, Ontario, Canada). Animal isolates were from clinical cases. Two isolates were purified from
effluents from water treatment plants in Sherbrooke, and one isolate was
purified from our hospital sewer (27). Bacteria were routinely grown at
37°C in an anaerobic chamber (Coy Laboratories) in prereduced brain
heart infusion (BHI) broth (BD Biosciences) or TY broth (3% tryptose,
2% yeast extract, pH 7.4).
Bacterial DNA extraction and PCR ribotyping. Bacteria were grown
overnight in BHI broth, and genomic DNA was extracted with the bacteria genomicPrep kit (GE Healthcare Canada). Capillary-based PCR ribotyping was performed on the RNomic platform of the Laboratoire de
Génomique Fonctionnelle de l’Université de Sherbrooke (http://lgfus.ca
/public/). Briefly, amplifications were done in a final volume of 10 ␮l with
primers CD16S-1F and CD23S-2R (12), 1⫻ PCR buffer, 200 ␮M deoxynucleoside triphosphates, 1.5 mM MgCl2, 0.6 ␮M each primer, 0.2 U of
Platinum Taq DNA polymerase (Invitrogen), and 20 ng of purified
genomic DNA. The cycling conditions were initial incubation for 2 min at
95°C, followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 60
s. The amplification was completed by a 2-min incubation at 72°C. The
amplified products were analyzed by automated chip-based microcapillary electrophoresis on a Caliper LC-90 instrument (Caliper Life Sciences). The chromatograms generated by the Caliper software were converted into band profiles that were exported as tagged image file format
images and integrated into the GelCompar II database (Applied Maths)
2556
aem.asm.org
for cluster analysis. Reference strains of known ribotypes were included in
our panel, and the corresponding ribotypes were assigned accordingly. All
other isolates were assigned ribotype designations according to our internal database (designations beginning with the letter N).
Prophage induction. Prophages were induced from C. difficile isolates
by UV irradiation (302 nm) (28). Briefly, aliquots of overnight cultures
were diluted 10⫺1, 10⫺2, and 10⫺3 and further spotted onto the surface of
a BHI agar plate and bacteria were allowed to grow in an anaerobic atmosphere for 4 h. Bacteria were then exposed to UV light (302 nm) for 10 s
with a transilluminator and overlaid with molten top agar containing a
log-phase culture of a C. difficile test strain (optical density at 600 nm of
⬃0.3 to 0.5) (27, 34). After overnight incubation under anaerobic conditions, a clearing zone in the bacterial lawn above a given spot was indicative of phage induction and further propagation on the test strain. These
zones of lysis were collected with a pipette tip and transferred into BHI
broth to allow phages to diffuse out of the agar plug. Aliquots were then
diluted and plated again on the same sensitive host to isolate single phage
plaques, and two additional rounds of soft agar overlaying were performed to purify the phages. After the last round, the purified phages were
amplified in BHI broth supplemented with 10 mM MgCl2, 10 mM CaCl2,
and the sensitive host to allow high titers to be reached (⬃1 ⫻ 109 PFU/
ml). The lysates were then passed through a 0.45-␮m filter and stored at
4°C until further DNA purification and analysis (28).
Transmission electron microscopy (TEM). Phage particles were
washed in ammonium acetate buffer as described before (17) and transferred onto 400-mesh Formvar/carbon-coated copper grids (Cedarlane
Laboratories). After negative staining with 2% uranyl acetate (Cedarlane
Laboratories), phage particles were observed on a Hitachi H-7500 transmission electron microscope operating at 60 kV and pictures were taken
with a 10-megapixel digital camera (Hamamatsu) controlled with the
AMT software (Advanced Microscopy Techniques). The average sizes of
viral capsids and tails were determined from five different images of isolated phage particles.
Phage DNA purification, PFGE, and restriction analysis. Phage
DNA purification was done by a rapid phenol-chloroform protocol starting with 5 ml of crude lysate (35). For PFGE analysis, undigested DNA was
heated at 75°C for 10 min before being loaded onto a 1% SeaKem Gold
agarose gel and run in 0.5⫻ TBE buffer (Tris-borate-EDTA, pH 8.0) in a
CHEF-DR-II apparatus (Bio-Rad Laboratories). The migration conditions were 15 h at 14°C and 6 V/cm with a pulse ramp of 5 to 13 s. The gel
was stained with ethidium bromide, and DNA bands were visualized under UV light and photographed with the ImageQuant IQ300 gel documentation system (GE Healthcare). Restriction enzyme analysis of whole
phage DNA was done with HindIII (High Fidelity; New England BioLabs)
as described before (28).
Host range analysis. Five-microliter volumes of undiluted and 10⫺2diluted phage lysates (107 to 109 PFU/ml) were deposited on top of soft
agar overlays containing different log-phase cultures of C. difficile test
strains. Additional phages previously isolated by our group, i.e., ␾CD38-2
(28), ␾CD52 (17), ␾MMP01, ␾MMP02, ␾MMP03, and ␾MMP04 (27),
were also included to complete the list. A total of 47 test strains of various
origins (humans, animals, the environment) and PCR ribotypes were
tested (see Table 1). The intensities of the clearing zones were recorded,
and only isolates that were sensitive to at least one phage are reported (see
Table 2).
RESULTS
Prophage induction and phage isolation. In order to gain insight
into the diversity of temperate phages of C. difficile infecting animals, we analyzed a set of C. difficile isolates from different animal
species. We also included C. difficile from meat products, as well as
a number of human isolates (Table 1). Using a combination of UV
induction and soft agar overlays, we performed both prophage
induction and host screening simultaneously. We induced 58 isolates, of which 9 were from horses, 10 were from calves, 9 were
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
whereas very few are members of the Siphoviridae family, i.e.,
phages with long, flexible, and noncontractile tails (23). So far,
only seven temperate phages infecting C. difficile have been characterized in more detail, including whole-genome sequencing:
␾CD119 (24), ␾C2 (25), ␾CD27 (26), ␾MMP02, ␾MMP04 (27),
␾CD38-2 (28), and ␾CD6356 (29). The latter two phages are
members of the Siphoviridae family, whereas the others are members of the Myoviridae family.
The role of prophages in the evolution and virulence of most
bacterial pathogens has been extensively studied (for reviews, see
references 30 and 31), but in C. difficile, their exact contribution is
still unclear. So far, bioinformatic analyses have failed to identify
virulence factors in the available phage genomes, but nevertheless,
two studies have reported that ␾CD119 and ␾CD38-2 can repress
and induce toxin production, respectively (28, 32). In the case of
␾CD119, a phage repressor was shown to bind to the promoter
region within the pathogenicity locus, thereby repressing toxin
production (32). However, this is only what we know about the
possible role of prophages in this species. One likely reason for
such limited data and the small number of completely characterized phages is the lack of suitable bacterial hosts and conditions to
isolate and propagate these phages.
To gain insight into the biology and genomics of temperate
phages infecting C. difficile, we sought to induce prophages from a
number of C. difficile lysogens of various origins, including human
and animal isolates, and to screen for suitable hosts to replicate
and further characterize them. Using this strategy, we isolated and
propagated to high titers nine new temperate phages. We characterized these phages by electron microscopy, PFGE, and DNA
restriction profiling, and we determined their host ranges by using
a panel of C. difficile isolates.
Prophages from Human and Animal C. difficile Isolates
TABLE 1 C. difficile isolates used in this study
Origin
Ribotype
Source
Straina
Origin
Ribotype
Source
CD3
CD19
CD24
CD62
CD71
CD73
CD77
CD93
CD105
CD107
CD111
CD112
CD117
CD118
CD124
CD125
CD132
CD137
CD146
CD186
CD192
CD211 (ATCC 9689)
CD272 (CD630)
CD273 (VPI 10463)
CD274
CD316
CD326
CD337
CD383
CD384
CD386
CD390
CD398
CD419 (R20291)
CD420 (CD196)
CD422 (CF5)
CD424 (M120)
CD425 (BI9)
CD426 (Liv022)
CD427 (Liv024)
CD428 (TL174)
CD429 (TL176)
CD430 (TL178)
CD431 (CD305)
CD474
CD475
CD476
CD478
CD479
CD480
CD481
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Waterb
Waterb
Sewagec
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Horse
Horse
Horse
Horse
Horse
Horse
Horse
014
N007
078
001
N010
N002
N001
012
N003
078
027
N002
014
N006
N011
N010
N002
N005
027
N003
N004
001
012
037
027
N011
078
N002
027
N012
027
027
N012
027
027
017
078
001
106
001
015
014
002
023
N052
N002
N002
014
015
027
014
J. Pépin
J. Pépin
J. Pépin
J. Pépin
J. Pépin
J. Pépin
J. Pépin
J. Pépin
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
ATCC
J. Parkhill
ATCC
L. Valiquette
CD482
CD483
CD484
CD485
CD486
CD487
CD488
CD489
CD490
CD491
CD492
CD493
CD494
CD495
CD496
CD498
CD499
CD500
CD501
CD502
CD503
CD504
CD505
CD506
CD507
CD508
CD510
CD511
CD513
CD514
CD515
CD516
CD518
CD519
CD520
CD521
CD522
CD523
CD524
CD525
CD526
CD527
CD528
CD529
CD530
CD531
CD532
CD533
CD540
CD544
Horse
Horse
Calf
Calf
Calf
Calf
Calf
Calf
Calf
Calf
Calf
Calf
Pig
Pig
Pig
Pig
Pig
Pig
Pig
Pig
Pig
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Meat
Meat
Meat
Meat
Meat
Meat
Meat
Meat
Meat
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
N003
015
002
N003
017
017
078
N003
002
N003
NAd
078
078
078
078
037
078
NA
NA
078
NA
015
014
N050
N003
014
NA
N054
NA
NA
N003
NA
017
015
002
027
NA
015
001
017
014
N054
N002
001
027
027
002
027
N051
N053
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
C. Bergeron
C. Bergeron
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
L. Valiquette
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
T. Lawley
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
S. Weese
a
Alternative names are in parentheses. Shaded isolates were used as potential hosts in the first screening, and those in boldface were induced with UV.
Isolated from water effluent samples from a water treatment plant in Sherbrooke, Québec, Canada.
Sewage from CHUS.
d
NA, not available.
b
c
from pigs, 8 were from dogs, 9 were from meat, and 13 were from
humans (Table 1). After testing 27 different C. difficile isolates as
potential hosts in soft agar, we ended up with nine new phages that
could be further propagated well in broth culture, five of which
were of animal origin (Table 2). Horse isolate CD481 released two
April 2014 Volume 80 Number 8
different phages named ␾CD481-1 and ␾CD481-2. Three dog
isolates released phages ␾CD505, ␾CD506, and ␾CD508, whereas
four human isolates released phages ␾CD526, ␾CD24-2,
␾CD111, and ␾CD146. Note that by using mitomycin C, we had
previously induced the Siphoviridae phage ␾CD24-1 from isolate
aem.asm.org 2557
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
Straina
Sekulovic et al.
TABLE 2 Characteristics of isolated phages and their hosts
Origin
Ribotypea
Phage
Family
Propagating
hostb
Origin
Ribotypea
Reference
CD481
CD481
CD505
CD506
CD508
CD526
CD24
CD111
CD146
CD38
CD52
NAc
CD343
CD368
CD380
Horse
Horse
Dog
Dog
Dog
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
014
014
014
N050
014
014
078
027
027
N010
N055
NA
014
014
002
␾CD481-1
␾CD481-2
␾CD505
␾CD506
␾CD508
␾CD526
␾CD24-2
␾CD111
␾CD146
␾CD38-2
␾CD52
␾MMP01
␾MMP02
␾MMP03
␾MMP04
Myoviridae
Myoviridae
Myoviridae
Myoviridae
Myoviridae
Myoviridae
Myoviridae
Siphoviridae
Siphoviridae
Siphoviridae
Myoviridae
Myoviridae
Myoviridae
Myoviridae
Myoviridae
CD515
CD515
CD117
CD493
CD117
CD117
CD19
CD274
CD274
CD274
CD24
CD19
CD117
CD117
CD73
Meat
Meat
Human
Calf
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
N003
N003
014
078
014
014
N007
027
027
027
078
N007
014
014
N002
This study
This study
This study
This study
This study
This study
This study
This study
This study
28
17
27
27
27
27
a
Ribotype designations starting with the letter N were assigned arbitrarily on the basis of our internal database; the other ribotypes correspond to reference strains.
Propagating hosts are C. difficile isolates routinely used to propagate the corresponding phages.
c
NA, not available.
b
CD24, which is different from phage ␾CD24-2 isolated here (17).
This suggests that using different inducing conditions with the
same isolate can release different phages. Of note, five of the nine
newly isolated phages originated from ribotype 014 isolates of
both human and animal origins. If we include the other phages
that we previously described (27), a total of seven phages originated from this ribotype. Likewise, five of the sensitive hosts routinely used for propagation of these phages are also of ribotype
014. This suggests that prophage diversity within ribotype 014 is
important, which might result from a natural susceptibility of this
particular ribotype to multiple infecting phages.
Phage morphology. TEM revealed that newly isolated phages
␾CD111 and ␾CD146 had long and flexible tails reminiscent of
members of the Siphoviridae family within the order Caudovirales
(23). All of the other phages had long, straight, and thick striated
tails, suggesting contractile tails. Therefore, these phages would be
members of the Myoviridae family (Fig. 1). We determined the
sizes of the phage particles, and the capsid diameters ranged from
47.3 ⫾ 1.8 nm for ␾CD481-1 to 64.3 ⫾ 1.9 nm for ␾CD505. Tail
lengths ranged from 92.3 ⫾ 2.5 nm for ␾CD481-1 to 283.5 ⫾ 3.9
nm for ␾CD111. These values fall within the range of other phages
described previously (17, 21, 24, 26–29).
Genome size and restriction profiling. The total genomic
DNA was extracted from the isolated phages and separated by
PFGE to get estimates of the genome sizes. All of the phages had
double-stranded DNA genomes ranging in size between ⬃30 and
FIG 1 Phage morphology as observed by TEM after negative staining with uranyl acetate. The sizes of the capsids and tails were measured on five different
particles, and the average values ⫾ the standard deviations are reported below each phage. Note that all of the phages are not displayed on the same scale. The
black bar represents 100 nm.
2558
aem.asm.org
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
Natural host
Prophages from Human and Animal C. difficile Isolates
TABLE 3 Host range analysis of isolated phagesa
⬃60 kb, which is in the range of most phages previously described
in C. difficile. Phages ␾CD506 and ␾CD481-1 had the smallest
genomes at ⬃30 kb, whereas ␾CD24-2 and ␾CD526 had the largest genomes at ⬃55 to 60 kb (Fig. 2). The HindIII restriction
profiles of the different phages were compared, and as shown in
Fig. 3, all of the phages had distinct profiles, confirming that they
are all different.
Host range analysis. We selected a panel of 47 isolates from
various sources: 9 from animals, 1 from meat, and 3 from the
environment. The other 34 isolates were of human origin. The
selected panel comprised major PCR ribotypes like 001, 014, 027,
and 078, as well as other ribotypes (Table 1). The isolates were
used as potential sensitive hosts in spot tests with phage lysates
(107 to 109 PFU/ml), and the results are reported in Table 3. The C.
difficile isolates that were not susceptible to any of the phages
tested included CD124, CD137, CD146, CD272 (CD630), CD422,
CD424, CD431, CD474, CD494, and CD506. Phages of animal
and human origins were capable of infecting both human and
animal isolates. However, the most striking observation was that
phages originating from human isolates generally had the broadest host spectrum. For example, ␾CD38-2, ␾CD146, ␾CD24-2,
+
++
+++ ++
+ +++
+
+++ + +
+
+
+ +
+
+
+
+ +++ +
+
CD146
CD111
CD52
CD38-2
CD24-2
MMP04
MMP03
MMP02
+++
+
+
+
MMP01
CD526
CD508
CD506
CD505
CD481-2
Origin
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Human
Horse
Horse
Calf
Calf
Dog
Dog
Meat
Human phages
+
++
+
+ +++
+
+
+
+
+
+
++ +++
+ ++
+
+ +++
+++
+
++
+
+
+
+
+
++
+++
+++ +
+
+++
+
+
+
+
+
+
+
+
+
+
++
++
+
+++
+
+
+
++
+
Nb sensitive isolates 5
Phage family M
4
M
+++
+
++
5
M
1
M
4
M
4
M
+
+
+
+
14
M
2
M
2
M
+
+
++
+++
+++ + +++
+ +
+
+++
+
+ +++
+ +
+
+
+
+ + +
+ +
+
+
+
+
+
+
+ +
+
+++
+ +
+++
+
+
+ +
+
+
+
+
+
+ +
12
M
15
M
24
S
4
M
14
S
18
S
a
Isolate sensitivity (indicated as follows: ⫹, sensitive; ⫹⫹, moderately sensitive; ⫹⫹⫹,
very sensitive) is based on the intensity of the clearing zones. The total number of
sensitive isolates is indicated at the bottom. Phage families: M, Myoviridae; S,
Siphoviridae.
and ␾CD111 infected, respectively, 24 (51%), 18 (38%), 15
(32%), and 14 (30%) different isolates out of the 47 tested. This is
in contrast to animal phages, which generally infected fewer
strains, on average, between one (2%; ␾CD506) and five (11%;
␾CD481-1) isolates. It is also worth noting that Siphoviridae
phages ␾CD38-2, ␾CD111, and ␾CD146 were among those with
the broadest host spectra, including epidemic isolates of ribotype
027 (Table 3).
DISCUSSION
FIG 3 Restriction enzyme analysis of isolated phages. Purified phage DNA
was digested with HindIII, and fragments were separated on a 0.8% agarose gel
and then stained with ethidium bromide (the inverted image is presented).
The sizes of selected bands from the mass marker are indicated on the left.
April 2014 Volume 80 Number 8
In this work, we describe the isolation of nine temperate phages
infecting the enteric pathogen C. difficile. We were able to further
propagate them to high titers and characterize them by TEM,
PFGE, restriction profiling, and host range analysis. Although several prophages have been induced from clinical and environmental C. difficile isolates (17–21), there is a dearth of genomic and
functional data on this group of phages and one main reason for
that is the lack of suitable propagating hosts and conditions, which
are essential for further characterization. It is also worth mentioning that, to our knowledge, strictly lytic (i.e., virulent) phages in-
aem.asm.org 2559
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
FIG 2 PFGE analysis of the genomic DNA of isolated phages. Undigested
purified phage DNA was separated by PFGE and stained with ethidium bromide. The sizes of the mass marker fragments are indicated on the left.
Strain
CD19
CD24
CD73
CD77
CD93
CD105
CD111
CD117
CD118
CD125
CD192
CD211
CD273
CD274
CD316
CD326
CD337
CD383
CD384
CD398
CD419
CD420
CD425
CD426
CD427
CD428
CD429
CD430
CD540
CD544
CD475
CD481
CD490
CD493
CD505
CD511
CD515
CD481-1
Animal phages
Sekulovic et al.
2560
aem.asm.org
background for C. difficile phages to propagate and disseminate,
thereby increasing the likelihood of lysogenic conversion, phagemediated horizontal gene transfer, and phage-phage recombination events. Prophage acquisition has long been known to contribute to the emergence of new epidemic and highly virulent bacterial
lineages, such as the Escherichia coli O157:H7 strain that acquired
two different prophages carrying the Shiga toxins (30). In 2011, a
new E. coli O104:H4 strain caused an outbreak in Germany and
genome sequencing revealed the acquisition of a Shiga toxin-encoding prophage and a plasmid carrying diverse virulence genes
(48). Current data on C. difficile suggest that prophages are very
diverse (17, 19, 20) and that some of them contribute in different
ways to the fitness and virulence of this species, for example, by
modulating toxin production (28, 32, 49). This underlines the
importance of considering prophages and other MGE in the study
of C. difficile evolution. Unfortunately, PCR ribotyping, one of the
methods most frequently used to study the epidemiology of C.
difficile, does not account for their presence.
Like humans, different animals can also be colonized and infected by C. difficile and epidemiological studies based on PCR
ribotyping suggest that strains of the same type can infect both
humans and animals. For example, ribotype 078 was historically
associated mainly with animals, but it was found to be increasingly
associated with human infections in recent years (8, 38, 50–52).
This led to the hypothesis that animals could represent a potential
reservoir for the amplification of C. difficile that can then pass on
to humans and cause disease. Along the same line, spores of C.
difficile have been isolated in ground meat (53, 54), which further
supports the general idea that livestock could represent a potential
source of C. difficile contamination. However, drawing conclusions about the similarity of animal and human isolates on the
basis of PCR ribotyping alone is risky. A case in point is a study by
Zidaric et al. that demonstrated that multiple strains of the same
PCR ribotype and isolated at the same cattle farm could be differentiated by PFGE, sporulation characteristics, antibiotic susceptibility, and tetracycline resistance determinants (45). Likewise, in
the present study, we isolated different prophages from different
isolates of the same PCR ribotype, 014. A similar situation was also
reported in ribotype 027 isolates (18). Therefore, care should be
taken when using PCR ribotyping alone in epidemiological studies, and when possible, another more discriminatory technique,
like MLVA or PFGE, should be used in parallel to differentiate
subtypes. Phage typing with phage-specific PCR primers or host
range analysis or detection of conjugative transposons by PCR
could also complete the epidemiological portrait. Construction of
a comprehensive list of the various MGE in C. difficile would
therefore be highly useful. Yet, whole-genome sequencing seems
to be the most powerful approach because it allows the detection
of all MGE and genomic variations. However, although the cost of
whole-genome sequencing has significantly decreased in recent
years, this approach is still not accessible to all laboratories.
Our C. difficile phage host range analysis revealed some interesting data. For example, the three Siphoviridae phages ␾CD38-2,
␾CD111, and ␾CD146 were the ones with the lowest specificity;
i.e., they infected the largest set of isolates. Moreover, they infected
major epidemic isolates of PCR ribotypes 001, 014, 027, and 106.
Also of particular interest, ␾CD111 and ␾CD146 were both isolated from lysogenic 027 clinical isolates and yet they could infect
other 027 isolates as well. Together, this suggests that 027 isolates
carry different and unrelated functional prophages, as reported
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
fecting C. difficile have not been described yet. Therefore, these
new phages provide a good start for further study of their functional role in C. difficile. Five of these new phages were isolated
from C. difficile that infected animals, specifically, horses
(␾CD481-1 and ␾CD481-2) and dogs (␾CD505 ␾CD506, and
␾CD508). Morphological analysis revealed that the five phages
from animal C. difficile isolates, in addition to two other phages
induced from human isolates (␾CD24-2 and ␾CD526), were
members of the Myoviridae family, whereas two other phages
from human isolates (␾CD111 and ␾CD146) were members of
the Siphoviridae family. Most of the phages characterized so far,
like ␾CD119 (24), ␾C2 (25), ␾CD27 (26), ␾MMP02, and
␾MMP04 (27), are members of the Myoviridae family, and only
two Siphoviridae phages have been fully characterized and sequenced, namely, ␾CD38-2 (28) and ␾CD6356 (29). Of note,
␾CD38-2 was shown to stimulate toxin production in C. difficile
(28) and it will be interesting to determine if these new Siphoviridae phages can have similar impacts, which could give us clues
about a possible mechanism. The phages described herein have
double-stranded DNA genomes of a size similar to that of other
phages described before in C. difficile.
The epidemiology of C. difficile has changed rapidly over the
last decade (36), and the exact reasons for such a rapid evolution
are still not fully understood. Recent studies have estimated the
mutation rate of C. difficile to be about a single nucleotide variation per genome per year (37), which could seem marginal on a
10- to 20-year time scale. However, this is when only the core
genome is considered. In fact, other factors could have contributed to the rapid evolution of C. difficile, like MGE. Indeed, wholegenome sequencing and DNA microarray analyses revealed that
prophages and MGE contribute to the genetic variability and genome evolution of C. difficile (15, 38, 39). For example, the complete genome sequence of historical strain CD196 isolated in 1985
was compared with that of a recent epidemic strain (R20291) isolated in England in 2006. Interestingly, although both strains are
classified as PCR ribotype 027, five new genetic regions containing
234 genes were identified in the recent R20291 clone. Among others, phage-related genes and transposons were identified in these
new regions, suggesting that horizontal gene transfer contributed
to the evolution of strain R20291 (39).
It is worth mentioning that seven of the phages used in our
study were induced from ribotype 014 lysogens and that this particular ribotype was also sensitive to several phages as well. The
fact that we isolated and propagated several different phages on
this particular ribotype could have important implications. Indeed, along with ribotypes 027 and 078, 014 is one of the most
prevalent ribotypes in the world (it was reported in at least 19
countries), with a prevalence ranging between 16 and 34% in
North America and Europe (40–43). This ribotype seems to be
prevalent in cats and dogs as well (44). Ribotype 014 isolates are
generally associated with nonsevere CDI cases in humans (40),
they are TcdA⫹ TcdB⫹ CDT⫺ (45), and resistance to clindamycin
is highly common, as well as resistance to ceftriaxone and tetracycline to a lesser extent (46). The genome sequences of two ribotype
014 C. difficile strains (E14 and T6) have been recently released
(47). Although only contig scaffolds are available at the moment, a
quick search for prophage genes suggested the presence of at least
one possibly complete prophage in each strain. The high degree of
sequence similarity and synteny also suggested that the two prophages are highly related. Therefore, ribotype 014 offers a good
Prophages from Human and Animal C. difficile Isolates
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
ACKNOWLEDGMENTS
This work was supported by a discovery grant from the Natural Sciences
and Engineering Research Council of Canada. L.C.F. is a member of the
Centre de Recherche Clinique Étienne-Le Bel and is the holder of a Junior
2 salary award from the Fonds de la Recherche du Québec-Santé.
16.
REFERENCES
1. He M, Miyajima F, Roberts P, Ellison L, Pickard DJ, Martin MJ,
Connor TR, Harris SR, Fairley D, Bamford KB, D’Arc S, Brazier J,
Brown D, Coia JE, Douce G, Gerding D, Kim HJ, Koh TH, Kato H,
Senoh M, Louie T, Michell S, Butt E, Peacock SJ, Brown NM, Riley T,
Songer G, Wilcox M, Pirmohamed M, Kuijper E, Hawkey P, Wren BW,
Dougan G, Parkhill J, Lawley TD. 2013. Emergence and global spread of
epidemic healthcare-associated Clostridium difficile. Nat. Genet. 45:109 –
113. http://dx.doi.org/10.1038/ng.2478.
2. Arroyo LG, Kruth SA, Willey BM, Staempfli HR, Low DE, Weese JS.
April 2014 Volume 80 Number 8
17.
18.
19.
2005. PCR ribotyping of Clostridium difficile isolates originating from human and animal sources. J. Med. Microbiol. 54:163–166. http://dx.doi.org
/10.1099/jmm.0.45805-0.
Rupnik M, Wilcox MH, Gerding DN. 2009. Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7:526 –536. http://dx.doi.org/10.1038/nrmicro2164.
Loo V, Poirier L, Miller M, Oughton M, Libman M, Michaud S,
Bourgault A, Nguyen T, Frenette C, Kelly M, Vibien A, Brassard P,
Fenn S, Dewar K, Hudson T, Horn R, Rene P, Monczak Y, Dascal A.
2005. A predominantly clonal multi-institutional outbreak of Clostridium
difficile-associated diarrhea with high morbidity and mortality. N. Engl. J.
Med. 353:2442–2449. http://dx.doi.org/10.1056/NEJMoa051639.
Barbut F, Jones G, Eckert C. 2011. Epidemiology and control of Clostridium difficile infections in healthcare settings: an update. Curr. Opin.
Infect. Dis. 24:370 –376. http://dx.doi.org/10.1097/QCO.0b013e3283474
8e5.
Cheknis AK, Sambol SP, Davidson DM, Nagaro KJ, Mancini MC,
Hidalgo-Arroyo GA, Brazier JS, Johnson S, Gerding DN. 2009. Distribution of Clostridium difficile strains from a North American, European
and Australian trial of treatment for C. difficile infections: 2005-2007.
Anaerobe 15:230 –233. http://dx.doi.org/10.1016/j.anaerobe.2009.09.001.
Centers for Disease Control and Prevention. 2005. Severe Clostridium
difficile-associated disease in populations previously at low risk—four
states, 2005. MMWR Morb. Mortal. Wkly. Rep. 54:1201–1205.
Rupnik M, Widmer A, Zimmermann O, Eckert C, Barbut F. 2008.
Clostridium difficile toxinotype V, ribotype 078, in animals and humans. J.
Clin. Microbiol. 46:2146. (Letter.) http://dx.doi.org/10.1128/JCM.00598
-08.
Rupnik M. 2007. Is Clostridium difficile-associated infection a potentially
zoonotic and foodborne disease? Clin. Microbiol. Infect. 13:457– 459.
http://dx.doi.org/10.1111/j.1469-0691.2007.01687.x.
Weese JS, Finley R, Reid-Smith RR, Janecko N, Rousseau J. 2010.
Evaluation of Clostridium difficile in dogs and the household environment.
Epidemiol. Infect. 138:1100 –1104. http://dx.doi.org/10.1017/S09502688
09991312.
Canchaya C, Fournous G, Brüssow H. 2004. The impact of prophages on
bacterial chromosomes. Mol. Microbiol. 53:9 –18. http://dx.doi.org/10
.1111/j.1365-2958.2004.04113.x.
Bidet P, Barbut F, Lalande V, Burghoffer B, Petit JC. 1999. Development of a new PCR-ribotyping method for Clostridium difficile based on
ribosomal RNA gene sequencing. FEMS Microbiol. Lett. 175:261–266.
http://dx.doi.org/10.1111/j.1574-6968.1999.tb13629.x.
van den Berg R, Schaap I, Templeton K, Klaassen C, Kuijper E. 2007.
Typing and subtyping of Clostridium difficile isolates by using multiplelocus variable-number tandem-repeat analysis. J. Clin. Microbiol. 45:
1024 –1028. http://dx.doi.org/10.1128/JCM.02023-06.
Lemee L, Dhalluin A, Pestel-Caron M, Lemeland J-F, Pons J-L. 2004.
Multilocus sequence typing analysis of human and animal Clostridium
difficile isolates of various toxigenic types. J. Clin. Microbiol. 42:2609 –
2617. http://dx.doi.org/10.1128/JCM.42.6.2609-2617.2004.
Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler
R, Thomson NR, Roberts AP, Cerdeño-Tárraga AM, Wang H, Holden
MTG, Wright A, Churcher C, Quail MA, Baker S, Bason N, Brooks K,
Chillingworth T, Cronin A, Davis P, Dowd L, Fraser A, Feltwell T,
Hance Z, Holroyd S, Jagels K, Moule S, Mungall K, Price C, Rabbinowitsch E, Sharp S, Simmonds M, Stevens K, Unwin L, Whithead S,
Dupuy B, Dougan G, Barrell B, Parkhill J. 2006. The multidrug-resistant
human pathogen Clostridium difficile has a highly mobile, mosaic genome.
Nat. Genet. 38:779 –786. http://dx.doi.org/10.1038/ng1830.
Hubert B, Loo VG, Bourgault A-M, Poirier L, Dascal A, Fortin E,
Dionne M, Lorange M. 2007. A portrait of the geographic dissemination
of the Clostridium difficile North American pulsed-field type 1 strain and
the epidemiology of C. difficile-associated disease in Québec. Clin. Infect.
Dis. 44:238 –244. http://dx.doi.org/10.1086/510391.
Fortier L-C, Moineau S. 2007. Morphological and genetic diversity of
temperate phages in Clostridium difficile. Appl. Environ. Microbiol. 73:
7358 –7366. http://dx.doi.org/10.1128/AEM.00582-07.
Nale JY, Shan J, Hickenbotham PT, Fawley WN, Wilcox MH, Clokie
MRJ. 2012. Diverse temperate bacteriophage carriage in Clostridium difficile 027 strains. PLoS One 7:e37263. http://dx.doi.org/10.1371/journal
.pone.0037263.
Shan J, Patel KV, Hickenbotham PT, Nale JY, Hargreaves KR, Clokie
MRJ. 2012. Prophage carriage and diversity within clinically relevant
aem.asm.org 2561
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
before (18), and that they have the potential to reinfect multiple
and clinically relevant strains of C. difficile. Furthermore, 027 isolates seem to have different phage susceptibility profiles, which
could reflect the expression of different phage receptors at the
bacterial surface, the presence of different prophages that provide
phage-specific immunity, the presence of different CRISPR spacers, or any other antiphage mechanism(s) (55). Also of note, the
host ranges of ␾CD38-2 and ␾CD146 seemed to be more closely
related than that of ␾CD111. Further genome sequencing of
␾CD111 and ␾CD146 and comparison with the sequence of
␾CD38-2 will eventually provide clues about the phage genes responsible for host specificity.
Phages from animal strains infected fewer isolates from our
panel than did phages from human isolates, such as ␾CD38-2,
␾CD146, and ␾CD24-2. This observation could possibly be biased by the fact that we included fewer animal isolates in our host
range experiment (9 animal isolates versus 34 human isolates).
Therefore, we cannot exclude the possibility that some phage
specificity for animal or human isolates exists. Nevertheless,
phages from animal strains were able to infect both human and
animal isolates. The possibility of C. difficile transmission from
animals to humans was proposed (56). The apparent lack of phage
specificity for animal or human isolates, at least in the phages
described in this work, suggests that prophages released from C.
difficile lysogens of animal origin could, in principle, reinfect human isolates as well. The massive use of antibiotics as growth
promoters in livestock creates a huge selective pressure and a perfect environment for the development and spread of antibiotic
resistance (57). Our observations could therefore have important
implications, since Goh et al. recently reported that phage ␾C2
could promote the transduction of Tn6215-encoded erythromycin resistance between C. difficile isolates (58). Modi et al. also
reported that antibiotic exposure of mice promoted the enrichment and further transduction of phage-encoded antibiotic resistance among gut bacteria (59). Although we did not try to generate
lysogens with all of the newly isolated phages, we created such
lysogens by introducing ␾CD111 and ␾CD146 into CD419 (strain
R20291 of ribotype 027), and ␾CD481-2 was introduced into
CD515 (a ribotype N003 strain isolated from meat). It will be
important in future studies to better assess the contribution of
temperate phages to transduction and the spread of antibiotic
resistance in C. difficile. Our new panel of temperate phages will
provide new opportunities to address this question and to better
understand their role in the evolution and virulence of this important pathogen.
Sekulovic et al.
20.
21.
22.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
2562
aem.asm.org
39. Stabler RA, He M, Dawson L, Martin M, Valiente E, Corton C, Lawley
TD, Sebaihia M, Quail MA, Rose G, Gerding DN, Gibert M, Popoff
MR, Parkhill J, Dougan G, Wren BW. 2009. Comparative genome and
phenotypic analysis of Clostridium difficile 027 strains provides insight
into the evolution of a hypervirulent bacterium. Genome Biol. 10:R102.
http://dx.doi.org/10.1186/gb-2009-10-9-r102.
40. Walk ST, Micic D, Jain R, Lo ES, Trivedi I, Liu EW, Almassalha LM,
Ewing SA, Ring C, Galecki AT, Rogers MAM, Washer L, Newton DW,
Malani PN, Young VB, Aronoff DM. 2012. Clostridium difficile ribotype
does not predict severe infection. Clin. Infect. Dis. 55:1661–1668. http:
//dx.doi.org/10.1093/cid/cis786.
41. Barbut F, Rupnik M. 2012. Editorial commentary: 027, 078, and others:
going beyond the numbers (and away from the hypervirulence). Clin.
Infect. Dis. 55:1669 –1672. http://dx.doi.org/10.1093/cid/cis790.
42. Bauer MP, Notermans DW, Van Benthem BH, Brazier JS, Wilcox MH,
Rupnik M, Monnet DL, van Dissel JT, Kuijper EJ. 2011. Clostridium
difficile infection in Europe: a hospital-based survey. Lancet 377:63–73.
http://dx.doi.org/10.1016/S0140-6736(10)61266-4.
43. Weber I, Riera E, Déniz C, Pérez JL, Oliver A, Mena A. 2013. Molecular
epidemiology and resistance profiles of Clostridium difficile in a tertiary
care hospital in Spain. Int. J. Med. Microbiol. 303:128 –133. http://dx.doi
.org/10.1016/j.ijmm.2013.02.016.
44. Schneeberg A, Rupnik M, Neubauer H, Seyboldt C. 2012. Prevalence
and distribution of Clostridium difficile PCR ribotypes in cats and dogs
from animal shelters in Thuringia, Germany. Anaerobe 18:484 – 488. http:
//dx.doi.org/10.1016/j.anaerobe.2012.08.002.
45. Zidaric V, Pardon B, Vultos Dos T, Deprez P, Brouwer MSM, Roberts
AP, Henriques AO, Rupnik M. 2012. Different antibiotic resistance and
sporulation properties within multiclonal Clostridium difficile PCR ribotypes 078, 126, and 033 in a single calf farm. Appl. Environ. Microbiol.
78:8515– 8522. http://dx.doi.org/10.1128/AEM.02185-12.
46. Taori SK, Hall V, Poxton IR. 2010. Changes in antibiotic susceptibility
and ribotypes in Clostridium difficile isolates from southern Scotland,
1979-2004. J. Med. Microbiol. 59:338 –344. http://dx.doi.org/10.1099
/jmm.0.014829-0.
47. Kurka H, Ehrenreich A, Ludwig W, Monot M, Rupnik M, Barbut F,
Indra A, Dupuy B, Liebl W. 2014. Sequence similarity of Clostridium
difficile strains by analysis of conserved genes and genome content is reflected by their ribotype affiliation. PLoS One 9:e86535. http://dx.doi.org
/10.1371/journal.pone.0086535.
48. Muniesa M, Hammerl JA, Hertwig S, Appel B, Brüssow H. 2012. Shiga
toxin-producing Escherichia coli O104:H4: a new challenge for microbiology. Appl. Environ. Microbiol. 78:4065– 4073. http://dx.doi.org/10.1128
/AEM.00217-12.
49. Goh S, Chang BJ, Riley TV. 2005. Effect of phage infection on toxin
production by Clostridium difficile. J. Med. Microbiol. 54:129 –135. http:
//dx.doi.org/10.1099/jmm.0.45821-0.
50. Bakker D, Corver J, Harmanus C, Goorhuis A, Keessen EC, Fawley
WN, Wilcox MH, Kuijper EJ. 2010. Relatedness of human and animal
Clostridium difficile PCR ribotype 078 isolates determined on the basis of
multilocus variable-number tandem-repeat analysis and tetracycline resistance. J. Clin. Microbiol. 48:3744 –3749. http://dx.doi.org/10.1128
/JCM.01171-10.
51. Goorhuis A, Debast S, van Leengoed L, Harmanus C, Notermans D,
Bergwerff A, Kuijper E, Songer J. 2008. Clostridium difficile PCR ribotype
078: an emerging strain in humans and in pigs? J. Clin. Microbiol. 46:
1157–1158. http://dx.doi.org/10.1128/JCM.01536-07.
52. Keel K, Brazier JS, Post KW, Weese S, Songer JG. 2007. Prevalence of
PCR ribotypes among Clostridium difficile isolates from pigs, calves, and
other species. J. Clin. Microbiol. 45:1963–1964. http://dx.doi.org/10.1128
/JCM.00224-07.
53. Rodriguez-Palacios A, Staempfli HR, Duffield T, Weese JS. 2007. Clostridium difficile in retail ground meat, Canada. Emerging Infect. Dis. 13:
485– 487. http://dx.doi.org/10.3201/eid1303.060988.
54. Weese JS, Avery BP, Rousseau J, Reid-Smith RJ. 2009. Detection and
enumeration of Clostridium difficile spores in retail beef and pork. Appl.
Environ. Microbiol. 75:5009 –5011. http://dx.doi.org/10.1128/AEM.004
80-09.
55. Labrie SJ, Samson JE, Moineau S. 2010. Bacteriophage resistance mechanisms.Nat.Rev.Microbiol.8:317–327.http://dx.doi.org/10.1038/nrmicro
2315.
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
23.
strains of Clostridium difficile. Appl. Environ. Microbiol. 78:6027– 6034.
http://dx.doi.org/10.1128/AEM.01311-12.
Hargreaves KR, Colvin HV, Patel KV, Clokie JJP, Clokie MRJ. 2013.
Genetically diverse Clostridium difficile strains harboring abundant prophages in an estuarine environment. Appl. Environ. Microbiol. 79:6236 –
6243. http://dx.doi.org/10.1128/AEM.01849-13.
Goh S, Riley TV, Chang BJ. 2005. Isolation and characterization of temperate bacteriophages of Clostridium difficile. Appl. Environ. Microbiol. 71:
1079 –1083. http://dx.doi.org/10.1128/AEM.71.2.1079-1083.2005.
Gebhart D, Williams SR, Bishop-Lilly KA, Govoni GR, Willner KM,
Butani A, Sozhamannan S, Martin D, Fortier L-C, Scholl D. 2012. Novel
high-molecular-weight, R-type bacteriocins of Clostridium difficile. J. Bacteriol. 194:6240 – 6247. http://dx.doi.org/10.1128/JB.01272-12.
Ackermann H-W. 2009. Phage classification and characterization. Methods Mol. Biol. 501:127–140. http://dx.doi.org/10.1007/978-1-60327-164
-6_13.
Govind R, Fralick J, Rolfe R. 2006. Genomic organization and molecular
characterization of Clostridium difficile bacteriophage {Phi}CD119. J. Bacteriol. 188:2568 –2577. http://dx.doi.org/10.1128/JB.188.7.2568-2577
.2006.
Goh S, Ong PF, Song KP, Riley TV, Chang BJ. 2007. The complete
genome sequence of Clostridium difficile phage phiC2 and comparisons to
phiCD119 and inducible prophages of CD630. Microbiology 153:676 –
685. http://dx.doi.org/10.1099/mic.0.2006/002436-0.
Mayer MJ, Narbad A, Gasson MJ. 2008. Molecular characterization of
a Clostridium difficile bacteriophage and its cloned biologically active endolysin. J. Bacteriol. 190:6734 – 6740. http://dx.doi.org/10.1128/JB.00686
-08.
Meessen-Pinard M, Sekulovic O, Fortier L-C. 2012. Evidence of in vivo
prophage induction during Clostridium difficile infection. Appl. Environ.
Microbiol. 78:7662–7670. http://dx.doi.org/10.1128/AEM.02275-12.
Sekulovic O, Meessen-Pinard M, Fortier L-C. 2011. Prophagestimulated toxin production in Clostridium difficile NAP1/027 lysogens.
J. Bacteriol. 193:2726 –2734. http://dx.doi.org/10.1128/JB.00787-10.
Horgan M, O’Sullivan O, Coffey A, Fitzgerald GF, van Sinderen D,
McAuliffe O, Ross RP. 2010. Genome analysis of the Clostridium difficile
phage PhiCD6356, a temperate phage of the Siphoviridae family. Gene
462:34 – 43. http://dx.doi.org/10.1016/j.gene.2010.04.010.
Brüssow H, Canchaya C, Hardt W-D. 2004. Phages and the evolution of
bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68:560 – 602. http://dx.doi.org/10.1128
/MMBR.68.3.560-602.2004.
Fortier L-C, Sekulovic O. 2013. Importance of prophages to evolution
and virulence of bacterial pathogens. Virulence 4:354 –365. http://dx.doi
.org/10.4161/viru.24498.
Govind R, Vediyappan G, Rolfe RD, Dupuy B, Fralick JA. 2009.
Bacteriophage-mediated toxin gene regulation in Clostridium difficile. J.
Virol. 83:12037–12045. http://dx.doi.org/10.1128/JVI.01256-09.
Sirard S, Valiquette L, Fortier L-C. 2011. Lack of association between
clinical outcome of Clostridium difficile infections, strain type, and virulence-associated phenotypes. J. Clin. Microbiol. 49:4040 – 4046. http://dx
.doi.org/10.1128/JCM.05053-11.
Fortier L-C, Moineau S. 2009. Phage production and maintenance of
stocks, including expected stock lifetimes. Methods Mol. Biol. 501:203–
219. http://dx.doi.org/10.1007/978-1-60327-164-6_19.
Moineau S, Pandian S, Klaenhammer T. 1994. Evolution of a lytic
bacteriophage via DNA acquisition from the Lactococcus lactis chromosome. Appl. Environ. Microbiol. 60:1832–1841.
Freeman J, Bauer MP, Baines SD, Corver J, Fawley WN, Goorhuis B,
Kuijper EJ, Wilcox MH. 2010. The changing epidemiology of Clostridium
difficile infections. Clin. Microbiol. Rev. 23:529 –549. http://dx.doi.org/10
.1128/CMR.00082-09.
Didelot X, Eyre D, Cule M, Ip C, Ansari A, Griffiths D, Vaughan A,
O’Connor L, Golubchik T, Batty E, Piazza P, Wilson D, Bowden R,
Donnelly P, Dingle K, Wilcox M, Walker S, Crook D, Peto T, Harding
R. 2012. Microevolutionary analysis of Clostridium difficile genomes to
investigate transmission. Genome Biol. 13:R118. http://dx.doi.org/10
.1186/gb-2012-13-12-r118.
Stabler RA, Gerding DN, Songer JG, Drudy D, Brazier JS, Trinh HT,
Witney AA, Hinds J, Wren BW. 2006. Comparative phylogenomics of
Clostridium difficile reveals clade specificity and microevolution of hypervirulent strains. J. Bacteriol. 188:7297–7305. http://dx.doi.org/10.1128/JB
.00664-06.
Prophages from Human and Animal C. difficile Isolates
56. Rupnik M. 2010. Clostridium difficile: (re)emergence of zoonotic potential. Clin. Infect. Dis. 51:583–584. http://dx.doi.org/10.1086/655693.
57. Witte W. 2000. Selective pressure by antibiotic use in livestock. Int. J.
Antimicrob. Agents 16(Suppl 1):S19 –S24.
58. Goh S, Hussain H, Chang BJ, Emmett W, Riley TV, Mullany P. 2013.
Phage ␾C2 mediates transduction of Tn6215, encoding erythromycin re-
sistance, between Clostridium difficile strains. mBio 4:e00840 –13. http:
//dx.doi.org/10.1128/mBio.00840-13.
59. Modi SR, Lee HH, Spina CS, Collins JJ. 2013. Antibiotic treatment
expands the resistance reservoir and ecological network of the phage
metagenome. Nature 499:219 –222. http://dx.doi.org/10.1038/nature
12212.
Downloaded from http://aem.asm.org/ on April 17, 2014 by UNIVERSITE DE SHERBROOKE
April 2014 Volume 80 Number 8
aem.asm.org 2563
183
LISTE DES RÉFÉRENCES
Ackermann HW. Tailed bacteriophages: the order caudovirales. Adv Virus Res.
1998;51:135-201.
Ainsworth S, Zomer A, Mahony J, van Sinderen D. Lytic Infection of Lactococcus lactis by
Bacteriophages Tuc2009 and c2 Triggers Alternative Transcriptional Host Responses. Appl
Environ Microbiol. 2013;79(16):4786-98.
Allen B, Willner D, Oechel WC, Lipson D. Top-down control of microbial activity and
biomass in an Arctic soil ecosystem. Environ Microbiol. 2010;12(3):642-8.
Atanasiu C, Su TJ, Sturrock SS, Dryden DT. Interaction of the ocr gene 0.3 protein of
bacteriophage T7 with EcoKI restriction/modification enzyme. Nucleic Acids Res.
2002;30(18):3936-44.
Aziz RK, Edwards RA, Taylor WW, Low DE, McGeer A, Kotb M. Mosaic prophages with
horizontally acquired genes account for the emergence and diversification of the globally
disseminated M1T1 clone of Streptococcus pyogenes. J Bacteriol. 2005;187(10):3311-8.
Babu M, Beloglazova N, Flick R, Graham C, Skarina T, Nocek B, et al. A dual function of
the CRISPR-Cas system in bacterial antivirus immunity and DNA repair. Mol Microbiol.
2011;79(2):484-502.
Barketi-Klai A, Hoys S, Lambert-Bordes S, Collignon A, Kansau I. Role of fibronectinbinding protein A in Clostridium difficile intestinal colonization. J Med Microbiol.
2011;60(Pt 8):1155-61.
Barksdale L, Garmise L, Horibata K. Virulence, toxinogeny, and lysogeny in
Corynebacterium diphtheriae. Annals of the New York Academy of Sciences.
1960;88:1093-108.
Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, et al. CRISPR
provides acquired resistance against viruses in prokaryotes. Science. 2007;315(5819):170912.
Bartlett JG, Onderdonk AB, Cisneros RL, Kasper DL. Clindamycin-associated colitis due to
a toxin-producing species of Clostridium in hamsters. J Infect Dis. 1977;136(5):701-5.
Bebeacua C, Lorenzo Fajardo JC, Blangy S, Spinelli S, Bollmann S, Neve H, et al. X-ray
structure of a superinfection exclusion lipoprotein from phage TP-J34 and identification of
the tape measure protein as its target. Mol Microbiol. 2013
184
Bebeacua C, Tremblay D, Farenc C, Chapot-Chartier MP, Sadovskaya I, van Heel M, et al.
Structure, Adsorption to Host, and Infection Mechanism of Virulent Lactococcal Phage p2.
J Virol. 2013.
Bickle TA, Kruger DH. Biology of DNA restriction. Microbiological reviews.
1993;57(2):434-50.
Bishop-Lilly KA, Plaut RD, Chen PE, Akmal A, Willner KM, Butani A, et al. Whole genome
sequencing of phage resistant Bacillus anthracis mutants reveals an essential role for cell
surface anchoring protein CsaB in phage AP50c adsorption. Virol J. 2012;9:246.
Brantl S. Bacterial type I toxin-antitoxin systems. RNA biology. 2012;9(12):1488-90.
Braunstein M, Espinosa BJ, Chan J, Belisle JT, Jacobs WR, Jr. SecA2 functions in the
secretion of superoxide dismutase A and in the virulence of Mycobacterium tuberculosis.
Mol Microbiol. 2003;48(2):453-64.
Brazier JS. Clostridium difficile: from obscurity to superbug. British journal of biomedical
science. 2008;65(1):39-44.
Breitbart M, Hewson I, Felts B, Mahaffy JM, Nulton J, Salamon P, et al. Metagenomic
analyses of an uncultured viral community from human feces. J Bacteriol.
2003;185(20):6220-3.
Brouwer MS, Roberts AP, Hussain H, Williams RJ, Allan E, Mullany P. Horizontal gene
transfer converts non-toxigenic Clostridium difficile strains into toxin producers. Nat
Commun. 2013;4:2601.
Brouwer MS, Roberts AP, Mullany P, Allan E. In silico analysis of sequenced strains of
Clostridium difficile reveals a related set of conjugative transposons carrying a variety of
accessory genes. Mobile genetic elements. 2012;2(1):8-12.
Brouwer MS, Warburton PJ, Roberts AP, Mullany P, Allan E. Genetic Organisation,
Mobility and Predicted Functions of Genes on Integrated, Mobile Genetic Elements in
Sequenced Strains of Clostridium difficile. PLoS One. 2011;6(8):e23014.
Brussow H, Canchaya C, Hardt WD. Phages and the evolution of bacterial pathogens: from
genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev. 2004;68(3):560602.
Bunny K, Liu J, Roth J. Phenotypes of lexA mutations in Salmonella enterica: evidence for
a lethal lexA null phenotype due to the Fels-2 prophage. J Bacteriol. 2002;184(22):6235-49.
Calabi E, Calabi F, Phillips AD, Fairweather NF. Binding of Clostridium difficile surface
layer proteins to gastrointestinal tissues. Infect Immun. 2002;70(10):5770-8.
185
Calabi E, Ward S, Wren B, Paxton T, Panico M, Morris H, et al. Molecular characterization
of the surface layer proteins from Clostridium difficile. Mol Microbiol. 2001;40(5):1187-99.
Calendar R. The bacteriophages. second edition ed. New York: Oxford university press Inc.;
2006.
Canchaya C, Fournous G, Chibani-Chennoufi S, Dillmann ML, Brussow H. Phage as agents
of lateral gene transfer. Curr Opin Microbiol. 2003;6(4):417-24.
Canchaya C, Proux C, Fournous G, Bruttin A, Brussow H. Prophage genomics. Microbiol
Mol Biol Rev. 2003;67(2):238-76, table of contents.
Carrolo M, Frias MJ, Pinto FR, Melo-Cristino J, Ramirez M. Prophage spontaneous
activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.
PLoS One. 2010;5(12):e15678.
Casas V, Miyake J, Balsley H, Roark J, Telles S, Leeds S, et al. Widespread occurrence of
phage-encoded exotoxin genes in terrestrial and aquatic environments in Southern California.
FEMS Microbiol Lett. 2006;261(1):141-9.
Cenens W, Makumi A, Mebrhatu MT, Lavigne R, Aertsen A. Phage-host interactions during
pseudolysogeny: Lessons from the Pid/dgo interaction. Bacteriophage. 2013;3(1):e25029.
Cenens W, Mebrhatu MT, Makumi A, Ceyssens PJ, Lavigne R, Van Houdt R, et al.
Expression of a Novel P22 ORFan Gene Reveals the Phage Carrier State in Typhimurium.
PLoS Genet. 2013;9(2):e1003269.
Chapeton Montes D, Candela T, Collignon A, Janoir C. Localization of the Clostridium
difficile cysteine protease Cwp84 and insights into its maturation process. J Bacteriol. 2011.
Chen PE, Willner KM, Butani A, Dorsey S, George M, Stewart A, et al. Rapid identification
of genetic modifications in Bacillus anthracis using whole genome draft sequences generated
by 454 pyrosequencing. PLoS One. 2010;5(8):e12397.
Chen Y, Golding I, Sawai S, Guo L, Cox EC. Population fitness and the regulation of
Escherichia coli genes by bacterial viruses. PLoS Biol. 2005;3(7):e229.
Chibani-Chennoufi S, Bruttin A, Dillmann ML, Brussow H. Phage-host interaction: an
ecological perspective. J Bacteriol. 2004;186(12):3677-86.
Cho BK, Barrett CL, Knight EM, Park YS, Palsson BO. Genome-scale reconstruction of the
Lrp regulatory network in Escherichia coli. Proc Natl Acad Sci U S A. 2008;105(49):194627.
Chopin MC, Chopin A, Bidnenko E. Phage abortive infection in lactococci: variations on a
theme. Curr Opin Microbiol. 2005;8(4):473-9.
186
Chow LT, Bukhari AI. The invertible DNA segments of coliphages Mu and P1 are identical.
Virology. 1976;74(1):242-8.
Coia JE. What is the role of antimicrobial resistance in the new epidemic of Clostridium
difficile? Int J Antimicrob Agents. 2009;33 Suppl 1:S9-12.
Corver J, Bakker D, Brouwer MS, Harmanus C, Hensgens MP, Roberts AP, et al. Analysis
of a Clostridium difficile PCR ribotype 078 100 kilobase island reveals the presence of a
novel transposon, Tn6164. BMC Microbiol. 2012;12(1):130.
Davidson AR, Cardarelli L, Pell LG, Radford DR, Maxwell KL. Long noncontractile tail
machines of bacteriophages. Adv Exp Med Biol. 2012;726:115-42.
de la Riva L, Willing S, Tate EW, Fairweather NF. Roles of cysteine proteases Cwp84 and
Cwp13 in biogenesis of the cell wall of Clostridium difficile. J Bacteriol. 2011.
Dedrick RM, Marinelli LJ, Newton GL, Pogliano K, Pogliano J, Hatfull GF. Functional
requirements for bacteriophage growth: gene essentiality and expression in
mycobacteriophage Giles. Mol Microbiol. 2013;88(3):577-89.
Dei R. Observations on phage-typing of Clostridium difficile: preliminary evaluation of a
phage panel. Eur J Epidemiol. 1989;5(3):351-4.
Dembek M, Reynolds CB, Fairweather NF. The Clostridium difficile cell wall protein CwpV
undergoes enzyme-independent intramolecular autoproteolysis. J Biol Chem. 2011.
Deneve C, Janoir C, Poilane I, Fantinato C, Collignon A. New trends in Clostridium difficile
virulence and pathogenesis. Int J Antimicrob Agents. 2009;33 Suppl 1:S24-8.
Deveau H, Labrie SJ, Chopin MC, Moineau S. Biodiversity and classification of lactococcal
phages. Appl Environ Microbiol. 2006;72(6):4338-46.
Dillies MA, Rau A, Aubert J, Hennequet-Antier C, Jeanmougin M, Servant N, et al. A
comprehensive evaluation of normalization methods for Illumina high-throughput RNA
sequencing data analysis. Briefings in bioinformatics. 2012.
Dillon ST, Rubin EJ, Yakubovich M, Pothoulakis C, LaMont JT, Feig LA, et al. Involvement
of Ras-related Rho proteins in the mechanisms of action of Clostridium difficile toxin A and
toxin B. Infect Immun. 1995;63(4):1421-6.
Dorman CJ, Higgins CF. Fimbrial phase variation in Escherichia coli: dependence on
integration host factor and homologies with other site-specific recombinases. J Bacteriol.
1987;169(8):3840-3.
Duplessis M, Russell WM, Romero DA, Moineau S. Global gene expression analysis of two
Streptococcus thermophilus bacteriophages using DNA microarray. Virology.
2005;340(2):192-208.
187
Ebel-Tsipis J, Botstein D. Superinfection exclusion by P22 prophage in lysogens of
Salmonella typhimurium. 1. Exclusion of generalized transducing particles. Virology.
1971;45(3):629-37.
Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF. A novel
genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall
protein. Mol Microbiol. 2009;74(3):541-56.
Engelberg-Kulka H, Amitai S, Kolodkin-Gal I, Hazan R. Bacterial programmed cell death
and multicellular behavior in bacteria. PLoS Genet. 2006;2(10):e135.
Eriksson S, Lucchini S, Thompson A, Rhen M, Hinton JC. Unravelling the biology of
macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol
Microbiol. 2003;47(1):103-18.
Evdokimov AG, Anderson DE, Routzahn KM, Waugh DS. Unusual molecular architecture
of the Yersinia pestis cytotoxin YopM: a leucine-rich repeat protein with the shortest
repeating unit. J Mol Biol. 2001;312(4):807-21.
Evilevitch A, Lavelle L, Knobler CM, Raspaud E, Gelbart WM. Osmotic pressure inhibition
of DNA ejection from phage. Proc Natl Acad Sci U S A. 2003;100(16):9292-5.
Fagan RP, Fairweather NF. Clostridium difficile has two parallel and essential Sec secretion
systems. J Biol Chem. 2011.
Fagan RP, Fairweather NF. Biogenesis and functions of bacterial S-layers. Nat Rev
Microbiol. 2014;12(3):211-22.
Ferretti JJ, McShan WM, Ajdic D, Savic DJ, Savic G, Lyon K, et al. Complete genome
sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci U S A.
2001;98(8):4658-63.
Fokine A, Rossmann MG. Molecular architecture of tailed double-stranded DNA phages.
Bacteriophage. 2014;4(1):e28281.
Fokine A, Zhang Z, Kanamaru S, Bowman VD, Aksyuk AA, Arisaka F, et al. The molecular
architecture of the bacteriophage T4 neck. J Mol Biol. 2013;425(10):1731-44.
Fortier LC, Moineau S. Morphological and genetic diversity of temperate phages in
Clostridium difficile. Appl Environ Microbiol. 2007;73(22):7358-66.
Fortier LC, Sekulovic O. Importance of prophages to evolution and virulence of bacterial
pathogens. Virulence. 2013;4(5).
Fozo EM, Hemm MR, Storz G. Small toxic proteins and the antisense RNAs that repress
them. Microbiol Mol Biol Rev. 2008;72(4):579-89, Table of Contents.
188
Fozo EM, Makarova KS, Shabalina SA, Yutin N, Koonin EV, Storz G. Abundance of type I
toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel
families. Nucleic Acids Res. 2010;38(11):3743-59.
Fuhrman JA. Marine viruses and their biogeochemical and ecological effects. Nature.
1999;399(6736):541-8.
Garber M, Grabherr MG, Guttman M, Trapnell C. Computational methods for transcriptome
annotation and quantification using RNA-seq. Nat Methods. 2011;8(6):469-77.
Garneau JE, Dupuis ME, Villion M, Romero DA, Barrangou R, Boyaval P, et al. The
CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature.
2010;468(7320):67-71.
Geric B, Carman RJ, Rupnik M, Genheimer CW, Sambol SP, Lyerly DM, et al. Binary toxinproducing, large clostridial toxin-negative Clostridium difficile strains are enterotoxic but do
not cause disease in hamsters. J Infect Dis. 2006;193(8):1143-50.
Godeke J, Paul K, Lassak J, Thormann KM. Phage-induced lysis enhances biofilm formation
in Shewanella oneidensis MR-1. The ISME journal. 2011;5(4):613-26.
Goeders N, Van Melderen L. Toxin-antitoxin systems as multilevel interaction systems.
Toxins. 2014;6(1):304-24.
Goh S, Chang BJ, Riley TV. Effect of phage infection on toxin production by Clostridium
difficile. J Med Microbiol. 2005;54(Pt 2):129-35.
Goh S, Hussain H, Chang BJ, Emmett W, Riley TV, Mullany P. Phage C2 Mediates
Transduction of Tn6215, Encoding Erythromycin Resistance, between Clostridium difficile
Strains. MBio. 2013;4(6).
Goh S, Ong PF, Song KP, Riley TV, Chang BJ. The complete genome sequence of
Clostridium difficile phage phiC2 and comparisons to phiCD119 and inducible prophages of
CD630. Microbiology. 2007;153(Pt 3):676-85.
Goh S, Riley TV, Chang BJ. Isolation and characterization of temperate bacteriophages of
Clostridium difficile. Appl Environ Microbiol. 2005;71(2):1079-83.
Gottesman S. Micros for microbes: non-coding regulatory RNAs in bacteria. Trends in
genetics : TIG. 2005;21(7):399-404.
Govind R, Fralick JA, Rolfe RD. Genomic organization and molecular characterization of
Clostridium difficile bacteriophage PhiCD119. J Bacteriol. 2006;188(7):2568-77.
Govind R, Vediyappan G, Rolfe RD, Dupuy B, Fralick JA. Bacteriophage-mediated toxin
gene regulation in Clostridium difficile. J Virol. 2009;83(23):12037-45.
189
Grindley ND, Whiteson KL, Rice PA. Mechanisms of site-specific recombination. Annual
review of biochemistry. 2006;75:567-605.
Haaber J, Moineau S, Fortier LC, Hammer K. AbiV, a novel antiphage abortive infection
mechanism on the chromosome of Lactococcus lactis subsp. cremoris MG1363. Appl
Environ Microbiol. 2008;74(21):6528-37.
Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment
to infectious diseases. Nat Rev Microbiol. 2004;2(2):95-108.
Hall IC, Snyder ML. Isolation of an Obligately Anaerobic Bacillus from the Feces of
Newborn Infants and from Other Human Sources, and Its Probable Identity with the
"Kopfchenbakterien" of Escherich, Rodella's "Bacillus III," and Bacillus paraputrificus
(Bienstock). J Bacteriol. 1934;28(2):181-98.
Hanlon GW, Denyer SP, Olliff CJ, Ibrahim LJ. Reduction in exopolysaccharide viscosity as
an aid to bacteriophage penetration through Pseudomonas aeruginosa biofilms. Appl
Environ Microbiol. 2001;67(6):2746-53.
Hargreaves KR, Clokie MR. phages: still difficult? Front Microbiol. 2014;5:184.
Hargreaves KR, Colvin HV, Patel KV, Clokie J, Clokie MR. Genetically diverse Clostridium
difficile strains harbouring abundant prophages in an estuarine environment. Appl Environ
Microbiol. 2013.
Hargreaves KR, Flores CO, Lawley TD, Clokie MR. Abundant and diverse clustered
regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and
prophages target multiple phage types within this pathogen. MBio. 2014;5(5):e01045-13.
Hargreaves KR, Kropinski AM, Clokie MR. What does the talking?: quorum sensing
signalling genes discovered in a bacteriophage genome. PLoS One. 2014;9(1):e85131.
Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, et al. Complete
genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison
with a laboratory strain K-12. DNA Res. 2001;8(1):11-22.
He M, Miyajima F, Roberts P, Ellison L, Pickard DJ, Martin MJ, et al. Emergence and global
spread of epidemic healthcare-associated Clostridium difficile. Nat Genet. 2012.
He M, Sebaihia M, Lawley TD, Stabler RA, Dawson LF, Martin MJ, et al. Evolutionary
dynamics of Clostridium difficile over short and long time scales. Proc Natl Acad Sci U S A.
2010;107(16):7527-32.
Heichman KA, Johnson RC. The Hin invertasome: protein-mediated joining of distant
recombination sites at the enhancer. Science. 1990;249(4968):511-7.
190
Hennequin C, Janoir C, Barc MC, Collignon A, Karjalainen T. Identification and
characterization of a fibronectin-binding protein from Clostridium difficile. Microbiology.
2003;149(Pt 10):2779-87.
Hentges DJ. Human intestinal microflora in health and disease. New York: Academic Press;
1983. xvii, 568 p. p.
Hesselbach BA, Nakada D. "Host shutoff" function of bacteriophage T7: involvement of T7
gene 2 and gene 0.7 in the inactivation of Escherichia coli RNA polymerase. J Virol.
1977;24(3):736-45.
Hill MJ. Bacterial fermentation of complex carbohydrate in the human colon. European
journal of cancer prevention : the official journal of the European Cancer Prevention
Organisation. 1995;4(5):353-8.
Ho TD, Waldor MK. Enterohemorrhagic Escherichia coli O157:H7 gal mutants are sensitive
to bacteriophage P1 and defective in intestinal colonization. Infect Immun. 2007;75(4):16616.
Hofer B, Ruge M, Dreiseikelmann B. The superinfection exclusion gene (sieA) of
bacteriophage P22: identification and overexpression of the gene and localization of the gene
product. J Bacteriol. 1995;177(11):3080-6.
Horgan M, O'Sullivan O, Coffey A, Fitzgerald GF, van Sinderen D, McAuliffe O, et al.
Genome analysis of the Clostridium difficile phage PhiCD6356, a temperate phage of the
Siphoviridae family. Gene. 2010.
Human Microbiome Project C. Structure, function and diversity of the healthy human
microbiome. Nature. 2012;486(7402):207-14.
Hynes AP, Villion M, Moineau S. Adaptation in bacterial CRISPR-Cas immunity can be
driven by defective phages. Nat Commun. 2014;5:4399.
Iino T, Kutsukake K. Trans-acting genes of bacteriophages P1 and Mu mediate inversion of
a specific DNA segment involved in flagellar phase variation of Salmonella. Cold Spring
Harbor symposia on quantitative biology. 1981;45 Pt 1:11-6.
Jahn N, Preis H, Wiedemann C, Brantl S. BsrG/SR4 from Bacillus subtilis--the first
temperature-dependent type I toxin-antitoxin system. Mol Microbiol. 2012;83(3):579-98.
Janoir C, Pechine S, Grosdidier C, Collignon A. Cwp84, a surface-associated protein of
Clostridium difficile, is a cysteine protease with degrading activity on extracellular matrix
proteins. J Bacteriol. 2007;189(20):7174-80.
Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. RNA-guided editing of bacterial
genomes using CRISPR-Cas systems. Nat Biotechnol. 2013;31(3):233-9.
191
Johnson LP, Tomai MA, Schlievert PM. Bacteriophage involvement in group A
streptococcal pyrogenic exotoxin A production. J Bacteriol. 1986;166(2):623-7.
Johnson RC, Glasgow AC, Simon MI. Spatial relationship of the Fis binding sites for Hin
recombinational enhancer activity. Nature. 1987;329(6138):462-5.
Johnson S, Gerding DN. Clostridium difficile--associated diarrhea. Clin Infect Dis.
1998;26(5):1027-34; quiz 35-6.
Just I, Selzer J, Wilm M, von Eichel-Streiber C, Mann M, Aktories K. Glucosylation of Rho
proteins by Clostridium difficile toxin B. Nature. 1995;375(6531):500-3.
Kawano M. Divergently overlapping cis-encoded antisense RNA regulating toxin-antitoxin
systems from E. coli: hok/sok, ldr/rdl, symE/symR. RNA biology. 2012;9(12):1520-7.
Kelly A, Conway C, T OC, Smith SG, Dorman CJ. DNA supercoiling and the Lrp protein
determine the directionality of fim switch DNA inversion in Escherichia coli K-12. J
Bacteriol. 2006;188(15):5356-63.
Kemp P, Garcia LR, Molineux IJ. Changes in bacteriophage T7 virion structure at the
initiation of infection. Virology. 2005;340(2):307-17.
Khanna S, Pardi DS, Aronson SL, Kammer PP, Orenstein R, St Sauver JL, et al. The
epidemiology of community-acquired Clostridium difficile infection: a population-based
study. The American journal of gastroenterology. 2012;107(1):89-95.
Khemayan K, Pasharawipas T, Puiprom O, Sriurairatana S, Suthienkul O, Flegel TW.
Unstable lysogeny and pseudolysogeny in Vibrio harveyi siphovirus-like phage 1. Appl
Environ Microbiol. 2006;72(2):1355-63.
Kirby JM, Ahern H, Roberts AK, Kumar V, Freeman Z, Acharya KR, et al. Cwp84, a surfaceassociated cysteine protease, plays a role in the maturation of the surface layer of Clostridium
difficile. J Biol Chem. 2009;284(50):34666-73.
Kliem M, Dreiseikelmann B. The superimmunity gene sim of bacteriophage P1 causes
superinfection exclusion. Virology. 1989;171(2):350-5.
Kobe B, Kajava AV. The leucine-rich repeat as a protein recognition motif. Current opinion
in structural biology. 2001;11(6):725-32.
Koerner JF, Snustad DP. Shutoff of host macromolecular synthesis after T-even
bacteriophage infection. Microbiological reviews. 1979;43(2):199-223.
Kruger DH, Barcak GJ, Smith HO. Abolition of DNA recognition site resistance to the
restriction endonuclease EcoRII. Biomedica biochimica acta. 1988;47(1):K1-5.
192
Ku YW, McDonough SP, Palaniappan RU, Chang CF, Chang YF. Novel attenuated
Salmonella enterica serovar Choleraesuis strains as live vaccine candidates generated by
signature-tagged mutagenesis. Infect Immun. 2005;73(12):8194-203.
Kuijper EJ, Coignard B, Tull P. Emergence of Clostridium difficile-associated disease in
North America and Europe. Clin Microbiol Infect. 2006;12 Suppl 6:2-18.
Kutsukake K, Iino T. Inversions of specific DNA segments in flagellar phase variation of
Salmonella and inversion systems of bacteriophages P1 and Mu. Proc Natl Acad Sci U S A.
1980;77(12):7338-41.
Kutsukake K, Iino T. A trans-acting factor mediates inversion of a specific DNA segment in
flagellar phase variation of Salmonella. Nature. 1980;284(5755):479-81.
Kutsukake K, Nakashima H, Tominaga A, Abo T. Two DNA invertases contribute to
flagellar phase variation in Salmonella enterica serovar Typhimurium strain LT2. J Bacteriol.
2006;188(3):950-7.
Kutter E, Sulakvelidze A. Bacteriophages : biology and applications. Boca Raton, FL: CRC
Press; 2005. 510 p. p.
Labbe AC, Poirier L, Maccannell D, Louie T, Savoie M, Beliveau C, et al. Clostridium
difficile infections in a Canadian tertiary care hospital before and during a regional epidemic
associated with the BI/NAP1/027 strain. Antimicrob Agents Chemother. 2008;52(9):31807.
Labrie SJ, Samson JE, Moineau S. Bacteriophage resistance mechanisms. Nat Rev
Microbiol. 2010;8(5):317-27.
Lamont I, Brumby AM, Egan JB. UV induction of coliphage 186: prophage induction as an
SOS function. Proc Natl Acad Sci U S A. 1989;86(14):5492-6.
Larson MH, Gilbert LA, Wang X, Lim WA, Weissman JS, Qi LS. CRISPR interference
(CRISPRi) for sequence-specific control of gene expression. Nat Protoc. 2013;8(11):218096.
Lavigne R, Lecoutere E, Wagemans J, Cenens W, Aertsen A, Schoofs L, et al. A multifaceted
study of Pseudomonas aeruginosa shutdown by virulent podovirus LUZ19. MBio.
2013;4(2):e00061-13.
Lederberg EM, Lederberg J. Genetic Studies of Lysogenicity in Escherichia Coli. Genetics.
1953;38(1):51-64.
Lemire S, Figueroa-Bossi N, Bossi L. Bacteriophage crosstalk: coordination of prophage
induction by trans-acting antirepressors. PLoS Genet. 2011;7(6):e1002149.
193
Lenz LL, Mohammadi S, Geissler A, Portnoy DA. SecA2-dependent secretion of autolytic
enzymes promotes Listeria monocytogenes pathogenesis. Proc Natl Acad Sci U S A.
2003;100(21):12432-7.
Lhuillier S, Gallopin M, Gilquin B, Brasiles S, Lancelot N, Letellier G, et al. Structure of
bacteriophage SPP1 head-to-tail connection reveals mechanism for viral DNA gating. Proc
Natl Acad Sci U S A. 2009;106(21):8507-12.
Loo VG, Poirier L, Miller MA, Oughton M, Libman MD, Michaud S, et al. A predominantly
clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high
morbidity and mortality. N Engl J Med. 2005;353(23):2442-9.
Los JM, Los M, Wegrzyn A, Wegrzyn G. Altruism of Shiga toxin-producing Escherichia
coli: recent hypothesis versus experimental results. Frontiers in cellular and infection
microbiology. 2012;2:166.
Lu MJ, Henning U. Superinfection exclusion by T-even-type coliphages. Trends Microbiol.
1994;2(4):137-9.
Lu MJ, Stierhof YD, Henning U. Location and unusual membrane topology of the immunity
protein of the Escherichia coli phage T4. J Virol. 1993;67(8):4905-13.
Luke K, Radek A, Liu X, Campbell J, Uzan M, Haselkorn R, et al. Microarray analysis of
gene expression during bacteriophage T4 infection. Virology. 2002;299(2):182-91.
Madsen PL, Hammer K. Temporal transcription of the lactococcal temperate phage TP9011 and DNA sequence of the early promoter region. Microbiology. 1998;144 ( Pt 8):2203-15.
Mahony DE, Bell PD, Easterbrook KB. Two bacteriophages of Clostridium difficile. J Clin
Microbiol. 1985;21(2):251-4.
Mahony J, McGrath S, Fitzgerald GF, van Sinderen D. Identification and characterization of
lactococcal-prophage-carried superinfection exclusion genes. Appl Environ Microbiol.
2008;74(20):6206-15.
Mali P, Esvelt KM, Church GM. Cas9 as a versatile tool for engineering biology. Nat
Methods. 2013;10(10):957-63.
Mani N, Dupuy B, Sonenshein AL. Isolation of RNA polymerase from Clostridium difficile
and characterization of glutamate dehydrogenase and rRNA gene promoters in vitro and in
vivo. J Bacteriol. 2006;188(1):96-102.
Mann NH. The third age of phage. PLoS Biol. 2005;3(5):e182.
Mardanov AV, Ravin NV. The antirepressor needed for induction of linear plasmid-prophage
N15 belongs to the SOS regulon. J Bacteriol. 2007;189(17):6333-8.
194
Marino M, Braun L, Cossart P, Ghosh P. A framework for interpreting the leucine-rich
repeats of the Listeria internalins. Proc Natl Acad Sci U S A. 2000;97(16):8784-8.
Marioni JC, Mason CE, Mane SM, Stephens M, Gilad Y. RNA-seq: an assessment of
technical reproducibility and comparison with gene expression arrays. Genome Res.
2008;18(9):1509-17.
Martel B, Moineau S. CRISPR-Cas: an efficient tool for genome engineering of virulent
bacteriophages. Nucleic Acids Res. 2014.
McDonald LC, Killgore GE, Thompson A, Owens RC, Jr., Kazakova SV, Sambol SP, et al.
An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med.
2005;353(23):2433-41.
McGrath S, Fitzgerald GF, van Sinderen D. Identification and characterization of phageresistance genes in temperate lactococcal bacteriophages. Mol Microbiol. 2002;43(2):50920.
McGrath S, Seegers JF, Fitzgerald GF, van Sinderen D. Molecular characterization of a
phage-encoded resistance system in Lactococcus lactis. Appl Environ Microbiol.
1999;65(5):1891-9.
Meessen-Pinard M, Sekulovic O, Fortier LC. Evidence of in vivo prophage induction during
Clostridium difficile infection. Appl Environ Microbiol. 2012;78(21):7662-70.
Merickel SK, Haykinson MJ, Johnson RC. Communication between Hin recombinase and
Fis regulatory subunits during coordinate activation of Hin-catalyzed site-specific DNA
inversion. Genes Dev. 1998;12(17):2803-16.
Mesnage S, Fontaine T, Mignot T, Delepierre M, Mock M, Fouet A. Bacterial SLH domain
proteins are non-covalently anchored to the cell surface via a conserved mechanism involving
wall polysaccharide pyruvylation. EMBO J. 2000;19(17):4473-84.
Miao EA, Scherer CA, Tsolis RM, Kingsley RA, Adams LG, Baumler AJ, et al. Salmonella
typhimurium leucine-rich repeat proteins are targeted to the SPI1 and SPI2 type III secretion
systems. Mol Microbiol. 1999;34(4):850-64.
Miura M, Kato H, Matsushita O. Identification of a novel virulence factor in Clostridium
difficile modulating toxin sensitivity of cultured epithelial cells. Infect Immun. 2011.
Molineux IJ. No syringes please, ejection of phage T7 DNA from the virion is enzyme driven.
Mol Microbiol. 2001;40(1):1-8.
Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying
mammalian transcriptomes by RNA-Seq. Nat Methods. 2008;5(7):621-8.
195
Nagy E, Foldes J. Electron microscopic investigation of lysogeny of Clostridium difficile
strains isolated from antibiotic-associated diarrhea cases and from healthy carriers. APMIS.
1991;99(4):321-6.
Nale JY, Shan J, Hickenbotham PT, Fawley WN, Wilcox MH, Clokie MR. Diverse temperate
bacteriophage carriage in Clostridium difficile 027 strains. PLoS One. 2012;7(5):e37263.
Nash HA. Integration and excision of bacteriophage lambda: the mechanism of conservation
site specific recombination. Annu Rev Genet. 1981;15:143-67.
Nordstrom K, Forsgren A. Effect of protein A on adsorption of bacteriophages to
Staphylococcus aureus. J Virol. 1974;14(2):198-202.
Ohnishi M, Kurokawa K, Hayashi T. Diversification of Escherichia coli genomes: are
bacteriophages the major contributors? Trends Microbiol. 2001;9(10):481-5.
Ornellas EP, Stocker BA. Relation of lipopolysaccharide character to P1 sensitivity in
Salmonella typhimurium. Virology. 1974;60(2):491-502.
Oshima T, Ishikawa S, Kurokawa K, Aiba H, Ogasawara N. Escherichia coli histone-like
protein H-NS preferentially binds to horizontally acquired DNA in association with RNA
polymerase. DNA Res. 2006;13(4):141-53.
Oshlack A, Wakefield MJ. Transcript length bias in RNA-seq data confounds systems
biology. Biol Direct. 2009;4:14.
Osterhout RE, Figueroa IA, Keasling JD, Arkin AP. Global analysis of host response
to induction of a latent bacteriophage. BMC Microbiol. 2007;7:82.
Owens RC, Jr., Donskey CJ, Gaynes RP, Loo VG, Muto CA. Antimicrobial-associated risk
factors for Clostridium difficile infection. Clin Infect Dis. 2008;46 Suppl 1:S19-31.
Pajunen M, Kiljunen S, Skurnik M. Bacteriophage phiYeO3-12, specific for Yersinia
enterocolitica serotype O:3, is related to coliphages T3 and T7. J Bacteriol.
2000;182(18):5114-20.
Pedruzzi I, Rosenbusch JP, Locher KP. Inactivation in vitro of the Escherichia coli outer
membrane protein FhuA by a phage T5-encoded lipoprotein. FEMS Microbiol Lett.
1998;168(1):119-25.
Pepin J, Valiquette L, Alary ME, Villemure P, Pelletier A, Forget K, et al. Clostridium
difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of
disease severity. CMAJ. 2004;171(5):466-72.
196
Perry LL, SanMiguel P, Minocha U, Terekhov AI, Shroyer ML, Farris LA, et al. Sequence
analysis of Escherichia coli O157:H7 bacteriophage PhiV10 and identification of a phageencoded immunity protein that modifies the O157 antigen. FEMS Microbiol Lett.
2009;292(2):182-6.
Petrova OE, Schurr JR, Schurr MJ, Sauer K. The novel Pseudomonas aeruginosa twocomponent regulator BfmR controls bacteriophage-mediated lysis and DNA release during
biofilm development through PhdA. Mol Microbiol. 2011;81(3):767-83.
Phillips ST, Nagaro K, Sambol SP, Johnson S, Gerding DN. Susceptibility of hamsters to
infection by historic and epidemic BI Clostridium difficile strains during daily administration
of three fluoroquinolones. Anaerobe. 2011.
Poranen MM, Ravantti JJ, Grahn AM, Gupta R, Auvinen P, Bamford DH. Global changes in
cellular gene expression during bacteriophage PRD1 infection. J Virol. 2006;80(16):8081-8.
Ptashne M, Jeffrey A, Johnson AD, Maurer R, Meyer BJ, Pabo CO, et al. How the lambda
repressor and cro work. Cell. 1980;19(1):1-11.
Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, et al. Repurposing
CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell.
2013;152(5):1173-83.
Quinones M, Kimsey HH, Waldor MK. LexA cleavage is required for CTX prophage
induction. Mol Cell. 2005;17(2):291-300.
Rajagopala SV, Casjens S, Uetz P. The protein interaction map of bacteriophage lambda.
BMC Microbiol. 2011;11:213.
Ravantti JJ, Ruokoranta TM, Alapuranen AM, Bamford DH. Global transcriptional
responses of Pseudomonas aeruginosa to phage PRR1 infection. J Virol. 2008;82(5):23249.
Razavi B, Apisarnthanarak A, Mundy LM. Clostridium difficile: emergence of
hypervirulence and fluoroquinolone resistance. Infection. 2007;35(5):300-7.
Reyes A, Haynes M, Hanson N, Angly FE, Heath AC, Rohwer F, et al. Viruses in the faecal
microbiota of monozygotic twins and their mothers. Nature. 2010;466(7304):334-8.
Reynolds CB, Emerson JE, de la Riva L, Fagan RP, Fairweather NF. The Clostridium difficile
cell wall protein CwpV is antigenically variable between strains, but exhibits conserved
aggregation-promoting function. PLoS Pathog. 2011;7(4):e1002024.
Riemann L, Holmfeldt K, Titelman J. Importance of viral lysis and dissolved DNA for
bacterioplankton activity in a P-limited estuary, Northern Baltic Sea. Microb Ecol.
2009;57(2):286-94.
197
Riemann L, Steward GF, Azam F. Dynamics of bacterial community composition and
activity during a mesocosm diatom bloom. Appl Environ Microbiol. 2000;66(2):578-87.
Roth JA. Virulence mechanisms of bacterial pathogens. Washington, D.C.: American
Society for Microbiology; 1988. xii, 390 p. p.
Roucourt B, Lavigne R. The role of interactions between phage and bacterial proteins within
the infected cell: a diverse and puzzling interactome. Environ Microbiol. 2009;11(11):2789805.
Rupnik M, Wilcox MH, Gerding DN. Clostridium difficile infection: new developments in
epidemiology and pathogenesis. Nat Rev Microbiol. 2009;7(7):526-36.
Sadowski PD. Bacteriophage T7 endonuclease. I. Properties of the enzyme purified from T7
phage-infected Escherichia coli B. J Biol Chem. 1971;246(1):209-16.
Sampson TR, Weiss DS. Alternative Roles for CRISPR/Cas Systems in Bacterial
Pathogenesis. PLoS Pathog. 2013;9(10):e1003621.
Samson JE, Magadan AH, Sabri M, Moineau S. Revenge of the phages: defeating bacterial
defences. Nat Rev Microbiol. 2013;11(10):675-87.
Sandaa RA, Gomez-Consarnau L, Pinhassi J, Riemann L, Malits A, Weinbauer MG, et al.
Viral control of bacterial biodiversity--evidence from a nutrient-enriched marine mesocosm
experiment. Environ Microbiol. 2009;11(10):2585-97.
Savage DC. Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol.
1977;31:107-33.
Scholl D, Adhya S, Merril C. Escherichia coli K1's capsule is a barrier to bacteriophage T7.
Appl Environ Microbiol. 2005;71(8):4872-4.
Schuch R, Fischetti VA. The secret life of the anthrax agent Bacillus anthracis:
bacteriophage-mediated ecological adaptations. PLoS One. 2009;4(8):e6532.
Schwan C, Kruppke AS, Nolke T, Schumacher L, Koch-Nolte F, Kudryashev M, et al.
Clostridium difficile toxin CDT hijacks microtubule organization and reroutes vesicle traffic
to increase pathogen adherence. Proc Natl Acad Sci U S A. 2014.
Schwan C, Stecher B, Tzivelekidis T, van Ham M, Rohde M, Hardt WD, et al. Clostridium
difficile toxin CDT induces formation of microtubule-based protrusions and increases
adherence of bacteria. PLoS Pathog. 2009;5(10):e1000626.
Seah NE, Warren D, Tong W, Laxmikanthan G, Van Duyne GD, Landy A. Nucleoprotein
architectures regulating the directionality of viral integration and excision. Proc Natl Acad
Sci U S A. 2014;111(34):12372-7.
198
Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, et al. The
multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic
genome. Nat Genet. 2006;38(7):779-86.
Seddon SV, Hemingway I, Borriello SP. Hydrolytic enzyme production by Clostridium
difficile and its relationship to toxin production and virulence in the hamster model. J Med
Microbiol. 1990;31(3):169-74.
Sekulovic O, Fortier LC. Global transcriptional response of Clostridium difficile carrying the
phiCD38-2 prophage. Appl Environ Microbiol. 2014.
Sekulovic O, Garneau JR, Neron A, Fortier LC. Characterization of Temperate Phages
Infecting Clostridium difficile Isolates of Human and Animal Origins. Appl Environ
Microbiol. 2014;80(8):2555-63.
Sekulovic O, Meessen-Pinard M, Fortier LC. Prophage-Stimulated Toxin Production in
Clostridium difficile NAP1/027 Lysogens. J Bacteriol. 2011;193(11):2726-34.
Sell TL, Schaberg DR, Fekety FR. Bacteriophage and bacteriocin typing scheme for
Clostridium difficile. J Clin Microbiol. 1983;17(6):1148-52.
Serkin CD, Seifert HS. Iron availability regulates DNA recombination in Neisseria
gonorrhoeae. Mol Microbiol. 2000;37(5):1075-86.
Shao Y, Wang IN. Effect of late promoter activity on bacteriophage lambda fitness. Genetics.
2009;181(4):1467-75.
Shearwin KE, Brumby AM, Egan JB. The Tum protein of coliphage 186 is an antirepressor.
J Biol Chem. 1998;273(10):5708-15.
Shin H, Lee JH, Kim H, Choi Y, Heu S, Ryu S. Receptor diversity and host interaction of
bacteriophages infecting Salmonella enterica serovar Typhimurium. PLoS One.
2012;7(8):e43392.
Sirard S, Valiquette L, Fortier LC. Lack of association between clinical outcome of
Clostridium difficile infections, strain type, and virulence-associated phenotypes. J Clin
Microbiol. 2011.
Smits WK. Hype or hypervirulence: a reflection on problematic C. difficile strains. Virulence.
2013;4(7):592-6.
Smoot JC, Barbian KD, Van Gompel JJ, Smoot LM, Chaussee MS, Sylva GL, et al. Genome
sequence and comparative microarray analysis of serotype M18 group A Streptococcus
strains associated with acute rheumatic fever outbreaks. Proc Natl Acad Sci U S A.
2002;99(7):4668-73.
199
Solomon SL, Oliver KB. Antibiotic resistance threats in the United States: stepping back
from the brink. American family physician. 2014;89(12):938-41.
Sorek R, Kunin V, Hugenholtz P. CRISPR--a widespread system that provides acquired
resistance against phages in bacteria and archaea. Nat Rev Microbiol. 2008;6(3):181-6.
Sperandio V. Microbiology. Virulence or competition? Science. 2012;336(6086):1238-9.
Srinivasiah S, Bhavsar J, Thapar K, Liles M, Schoenfeld T, Wommack KE. Phages across
the biosphere: contrasts of viruses in soil and aquatic environments. Res Microbiol.
2008;159(5):349-57.
Stabler RA, Gerding DN, Songer JG, Drudy D, Brazier JS, Trinh HT, et al. Comparative
phylogenomics of Clostridium difficile reveals clade specificity and microevolution of
hypervirulent strains. J Bacteriol. 2006;188(20):7297-305.
Stabler RA, He M, Dawson L, Martin M, Valiente E, Corton C, et al. Comparative genome
and phenotypic analysis of Clostridium difficile 027 strains provides insight into the
evolution of a hypervirulent bacterium. Genome Biol. 2009;10(9):R102.
Steinbacher S, Miller S, Baxa U, Weintraub A, Seckler R. Interaction of Salmonella phage
P22 with its O-antigen receptor studied by X-ray crystallography. Biological chemistry.
1997;378(3-4):337-43.
Stern A, Sorek R. The phage-host arms race: shaping the evolution of microbes. BioEssays :
news and reviews in molecular, cellular and developmental biology. 2011;33(1):43-51.
Sun X, Gohler A, Heller KJ, Neve H. The ltp gene of temperate Streptococcus
thermophilus phage TP-J34 confers superinfection exclusion to Streptococcus thermophilus
and Lactococcus lactis. Virology. 2006;350(1):146-57.
Susskind MM, Wright A, Botstein D. Superinfection exclusion by P22 prophage in lysogens
of Salmonella typhimurium. II. Genetic evidence for two exclusion systems. Virology.
1971;45(3):638-52.
Suttle CA. Viruses in the sea. Nature. 2005;437(7057):356-61.
Suttle CA. Marine viruses--major players in the global ecosystem. Nat Rev Microbiol.
2007;5(10):801-12.
Symonds N, Coelho A. Role of the G segment in the growth of phage Mu. Nature.
1978;271(5645):573-4.
van de Putte P, Cramer S, Giphart-Gassler M. Invertible DNA determines host specificity of
bacteriophage mu. Nature. 1980;286(5770):218-22.
200
van der Woude MW, Baumler AJ. Phase and antigenic variation in bacteria. Clin Microbiol
Rev. 2004;17(3):581-611, table of contents.
van der Woude MW, Kaltenbach LS, Low DA. Leucine-responsive regulatory protein plays
dual roles as both an activator and a repressor of the Escherichia coli pap fimbrial operon.
Mol Microbiol. 1995;17(2):303-12.
Veesler D, Cambillau C. A common evolutionary origin for tailed-bacteriophage functional
modules and bacterial machineries. Microbiol Mol Biol Rev. 2011;75(3):423-33.
Ventura M, Bruttin A, Canchaya C, Brussow H. Transcription analysis of Streptococcus
thermophilus phages in the lysogenic state. Virology. 2002;302(1):21-32.
Ventura M, Canchaya C, Bernini V, Altermann E, Barrangou R, McGrath S, et al.
Comparative genomics and transcriptional analysis of prophages identified in the genomes
of Lactobacillus gasseri, Lactobacillus salivarius, and Lactobacillus casei. Appl Environ
Microbiol. 2006;72(5):3130-46.
Ventura M, Canchaya C, Pridmore RD, Brussow H. The prophages of Lactobacillus
johnsonii NCC 533: comparative genomics and transcription analysis. Virology.
2004;320(2):229-42.
Voth DE, Ballard JD. Clostridium difficile toxins: mechanism of action and role in disease.
Clin Microbiol Rev. 2005;18(2):247-63.
Wagner GP, Kin K, Lynch VJ. Measurement of mRNA abundance using RNA-seq data:
RPKM measure is inconsistent among samples. Theory in biosciences = Theorie in den
Biowissenschaften. 2012;131(4):281-5.
Wagner PL, Livny J, Neely MN, Acheson DW, Friedman DI, Waldor MK. Bacteriophage
control of Shiga toxin 1 production and release by Escherichia coli. Mol Microbiol.
2002;44(4):957-70.
Waligora AJ, Hennequin C, Mullany P, Bourlioux P, Collignon A, Karjalainen T.
Characterization of a cell surface protein of Clostridium difficile with adhesive properties.
Infect Immun. 2001;69(4):2144-53.
Wang X, Kim Y, Ma Q, Hong SH, Pokusaeva K, Sturino JM, et al. Cryptic prophages help
bacteria cope with adverse environments. Nat Commun. 2010;1(9):147.
Warner HR, Drong RF, Berget SM. Early events after infection of Escherichia coli by
bacteriophage T5. Induction of a 5'-nucleotidase activity and excretion of free bases. J Virol.
1975;15(2):273-80.
Warny M, Pepin J, Fang A, Killgore G, Thompson A, Brazier J, et al. Toxin production by
an emerging strain of Clostridium difficile associated with outbreaks of severe disease in
North America and Europe. Lancet. 2005;366(9491):1079-84.
201
Weaver KE, Reddy SG, Brinkman CL, Patel S, Bayles KW, Endres JL. Identification and
characterization of a family of toxin-antitoxin systems related to the Enterococcus faecalis
plasmid pAD1 par addiction module. Microbiology. 2009;155(Pt 9):2930-40.
White-Ziegler CA, Angus Hill ML, Braaten BA, van der Woude MW, Low DA.
Thermoregulation of Escherichia coli pap transcription: H-NS is a temperature-dependent
DNA methylation blocking factor. Mol Microbiol. 1998;28(6):1121-37.
Wilcox MH, Mooney L, Bendall R, Settle CD, Fawley WN. A case-control study of
community-associated Clostridium difficile infection. J Antimicrob Chemother.
2008;62(2):388-96.
Xiong YQ, Bensing BA, Bayer AS, Chambers HF, Sullam PM. Role of the serine-rich
surface glycoprotein GspB of Streptococcus gordonii in the pathogenesis of infective
endocarditis. Microb Pathog. 2008;45(4):297-301.
Xu J, Zhang J, Lu X, Liang W, Zhang L, Kan B. O antigen is the receptor of Vibrio cholerae
serogroup O1 El Tor typing phage VP4. J Bacteriol. 2013;195(4):798-806.
Xu X, McAteer SP, Tree JJ, Shaw DJ, Wolfson EB, Beatson SA, et al. Lysogeny with Shiga
toxin 2-encoding bacteriophages represses type III secretion in enterohemorrhagic
Escherichia coli. PLoS Pathog. 2012;8(5):e1002672.