Molecular Bead Shaving : A new procedure for magnetic readout

Molecular Bead Shaving : A new
procedure for magnetic readout
biosensors
Harisha Ramachandraiah
Degree project in applied biotechnology, Master of Science (2 years), 2010
Examensarbete i tillämpad bioteknik 30 hp till masterexamen, 2010
Biology Education Centre and Department of Genetics and Pathology, Molecular Medicine, Uppsala
University
Supervisors: Associate Professor Dr.Mats Nilsson and Dr.David Herthnek
Table of contents
Abbreviations
Summary
1.0 Introduction..............................................................................................................
3
1.1 Biosensors.................................................................................................................
3
1.2 Magnetic particle based biosensors..........................................................................
4
1.2.1 SQUID..................................................................................................................
5
1.3 Nucleic acid based sensors and enzymes.................................................................
5
1.4 DNA Ligase.............................................................................................................
6
1.5 Restriction Enzymes.................................................................................................
6
1.6 Padlock probes and Rolling circle replication..........................................................
7
1.7 Volume- amplified magnetic nanobead detection assay..........................................
8
1.8 Molecular bead shaving...........................................................................................
10
1.8.1 Concept of the project and approach....................................................................
10
1.9 Aim of the project....................................................................................................
13
2.0 Results......................................................................................................................
14
2.1 Initial optimization of RCA primer and restriction oligonucleotides concentrations for the
preparation of Dreadlock probes.....................................................................................
14
2.2 Background signal reduction....................................................................................
14
2.2.1 Heat treatment of captured RCA primers...............................................................
15
2.2.1.2 Preheat treatment coupling and post hybridization ligation................................
16
2.2.2 Pre-restriction digestion before RCA to reduce background signal.......................
16
2.3 Selection of suitable enzyme for molecular bead shaving........................................
17
2.4 Determination of optimum restriction digestion time...............................................
18
2.5 Effect of salt on release of digested blobs from dreadlock probes............................
18
2.6 Finding the optimum post restriction digestion incubation time...............................
19
2.7 Effect of heat and incubation time after salt treatment.............................................
20
2.8 Blocking of beads to avoid non specific binding of RCA primers............................
20
2.9 Comparison of signals between 100 nM RO and 10 nM RO..................................... 21
2.10 Comparison between Dynabeads®MyOneTM Streptavidin C-1 and T-1 magnetic beads
with respect to signal........................................................................................................ 22
2.11 Theoretical calculation.............................................................................................
22
3.0 Discussion..................................................................................................................
23
4.0 Materials and Methods..............................................................................................
26
4.1 Oligonucleotides........................................................................................................
26
4.2 Padlock probes hybridization and ligation................................................................
27
4.3 Capturing of RCA primers to beads..........................................................................
27
4.4 RCA on magnetic beads............................................................................................
27
4.5 C2CA and monomerization.......................................................................................
27
4.6 Molecular bead shaving of DNA coils......................................................................
28
4.7 Blocking of beads surface..........................................................................................
28
4.8 Labeling of RCA coils...............................................................................................
28
4.9 Microfluidic quantification, image acquisition and analysis.....................................
28
5. Acknowledgment.........................................................................................................
30
6. References....................................................................................................................
31
Abbreviations
AMP
ATP
BSA
C2CA
DNA
dNTPs
ELISA
HRCA
MBS
NAD
OLA
PCR
PNK
RCA
RCP
RGB
RNA
RO
SMD
SSD
S/N
SNPs
SQUID
TIFF
VAM-NDA
Adenosine mono-phosphate
Adenosine tri-phosphate
Bovine serum albumin
Circle-to-circle amplification
Deoxy-ribonucleic acid
Deoxy-nucleotide tri-phosphate
Enzyme linked immunosorbent assay
Hyper-branched rolling circle amplification
Molecular bead shaving
Nicotinamide adenine dinucleotide
Oligonucleotide ligation assay
Polymerase chain reaction
Polynucleotide kinase
Rolling circle amplification
Rolling circle product
Red-green-blue
Ribonucleic acid
Restriction oligonucleotides
Single molecule detection
Salmon sperm DNA
Signal to noise ratio
Single nucleotide polymorphism
Superconducting quantum interference device
Tagged image file format
Volume- amplified magnetic nanobead detection assay
1
Summary
In diagnostics the detection of the causative agent or biomarkers is the most important step
before any treatment. A number of new biosensors have been developed for early stage
detection of many diseases, but magnetic particle based biosensors have received
considerable attention because of their unique properties of physical, chemical and biological
stability.
This project focuses mainly on the proof of principle and development of a new procedure
called “Molecular Bead Shaving” (MBS) for both magnetic and optical readout for detection
of DNA. To perform MBS, molecular tools such as padlock probes and rolling circle
amplification (RCA) were employed to synthesize DNA coils (Blobs) on the magnetic beads
to produce a probe. A target DNA-specific padlock was amplified and monomerized by
circle-to-circle amplification (C2CA) and used along with a specific enzyme to release the
DNA coils from the beads.
For the optical readout, micron-sized particles were used and the released blobs were labelled
with fluorescent oligonucleotides and visualized by confocal microscopy. For magnetic
readout the change in Brownian relaxation behaviour of magnetic nanobeads induced by a
change in hydrodynamic bead volume was measured using Superconducting Quantum
Interference Device magnetometers. More specifically, when beads contain DNA coils, the
hydrodynamic bead volume will be increased and by cutting off the DNA coils using
amplified target DNA and restriction enzyme the hydrodynamic bead volume will decrease.
This change in hydrodynamic bead volume induces a change in Brownian relaxation
frequency upon magnetization which is measured by Superconducting Quantum Interference
Device (SQUID).
We have successfully demonstrated the principle of MBS for optical readout and have begun
the work to translate this procedure for magnetic readout.
2
1.0 Introduction
Keeping good health is one of the biggest concerns for human civilization. Efforts towards
developing drugs are ongoing at an ever higher pace, but before treatment a suitable
diagnostic method is necessary to identify the disease. In spite of the extensive research and
medical revolutions we still lack the potential to efficiently combat various diseases. Many
times the failure to treat a disease is related to the improper or late diagnosis of the disease.
So it is imperative to identify the cause of disease at an early stage. In clinical diagnostics and
biomedical research the detection of biomolecules is most insistent. An ideal diagnostic
method should be reliable, robust, flexible, convenient, sensitive, high throughput, highly
selective, affordable, portable [52], and should be reliable at different places such as the
battle field, hospitals, post office, doctor’s office, food markets and even at home [11].
Apparently, the growing technological advancement in biomarker detection, quantification,
imaging and single molecule detection at low concentration, plays a vital role to detect the
infectious agents selectively.
Many conventional techniques like PCR, immunological techniques like radioactive
immunoassay (RIA) and enzyme linked immunosorbent assay (ELISA), fluorescence based
assay, culture and colony counting approaches are powerful, but they are laborious, timeconsuming and may require bulky instruments [42] [6]. In this context, biosensors are more
reliable, robust may allow label free detection and are expected to reach implications in
medicine, point-of-care clinical diagnostics, genomic and proteomic research [21].
1.1 Biosensors
According to the International Union of Pure and Applied Chemistry (IUPAC), a biosensor is
defined as a device, which provides quantitative analytical information using a biorecognition element when coupled to a signal transduction system [10]. A typical biosensor
consists of signal transduction and bio-recognition elements. Usually, nucleic acids, protein,
carbohydrates, lipids and whole cells are used as the bio-recognition elements, of which
nucleic acids and proteins are being widely used in this post genomic era [44]. There is a
wide range of transduction system including mechanical, potentiometric, thermal, optical,
magnetic, electrochemical and piezoelectric that are in use today. These versatile tools have
great applicability in both the academy and industry, specifically in the areas which
encompass diagnostics, environmental monitoring, life science and drug discovery.
A majority of available diagnostic methods requires some kind of fluorescent, luminescent,
radiometric or colorimetric readout to detect the biomolecules of interest (targets), levying
limitation of additional time, false positive results (due to unspecific interactions) and costs.
Especially, fluorescent tags are being widely used in many biological applications, but have
disadvantages of low intensity, self-absorption, photo bleaching, self- fluorescence and
thermal fluctuations [44]. To some extent quantum dots, the fluorescent semiconductor nano
crystals exhibit high quantum yield and overcome some of these problems related to
fluorescence. They also exhibit a tuneable emission profile, but the difficulty in synthesis of
quantum dots and high costs limit its application [44]. To overcome some of the limitations
3
posed by previously mentioned methods, a variety of label-free bio-sensing platforms were
developed based on optical and non-optical detection methods such as Surface Plasmon
Resonance, bilayer interferometer, cantilever detection systems, label-free intrinsic imaging,
acoustic detection systems and magnetic detection systems [37]. Consequently, more than
6000 articles and 1100 patents issued or pending have been published between 1998 and
2004 [56].
1.2 Magnetic particle based biosensors
In 1986, Dynal Biotech introduced functionalized magnetic microparticles for the separation
of desired molecules from an arbitrary solution. Today such particles are used for bioseparation, cell sorting and as direct labels to detect molecules [42].
Usually, these magnetic nanoparticles are single magnetic domains made up of Fe3O4, Fe2O3
or CrO2 either dispersed in polymer matrix or in silica [4] and are super paramagnetic. Due to
the super paramagnetic properties the magnetic particles spontaneously flip upon
magnetization and randomize the magnetization directions at room temperature, avoiding
agglomeration [5].
Magnetic particles are widely used in bio-sensing platforms because of their unique
properties of physical, chemical and biological stability. They facilitate sensitive
measurement in body fluids such as blood, serum, plasma, urine, saliva cerebral spinal fluid
and urine, because these fluids virtually not exhibit magnetic background [21]. Furthermore,
their magnetic properties are stable over time and easy surface fuctionalization of magentic
beads with a plethora of biological and chemical surface coatings, which simplifies the
binding of specific biomolecules. Last but not least, the size of the particles can be tailored
from micron-to-nano scale, thus increasing surface to volume ratio [20].
In 1949 pioneering work by Neel et al. [5] showed the importance of single magnetic
particles and relaxation events. Later in 1974 Dreyer et al. used magnetic particles to label
biomolecules [5]. Many methods were developed for detection of magnetic labels either
directly or indirectly. In 1996, Kriz et al. demonstrated the magnetic bead assay for the first
time, by using induction coils to measure the change in magnetic permeability of specific
binding events in a Maxwell bridge setup [8]. In the same year, it was shown that
piezoresistive cantilevers could be used to measure the change in specific binding of
functionalized beads to the biomolecules [20]. Several magnetic based biosensors were
developed such as Hall effect biosensors [8], anisotropic magnetoresistance biosensors, giant
magnetoresistance
biosensors,
tunnelling
magnetoresistance
biosensors
[5],
magnetoimpedence biosensors, fluxgate biosensors and Magnetic signature based biosensors
[5].
4
1.2.1 SQUID
Superconducting Quantum Interference Device (SQUID) is a device which detects extremely
weak changes in the magnetic field of an applied magnetic flux. SQUID uses a
superconducting coil that contains Josephson junctions, which measures the decay in
remanence of magnetized nanoparticles. When an external magnetic field is applied to the
super paramagnetic particles they line up along the field lines and when the field is removed
they remained aligned for a short period before randomizing again. This decay in selfmagnetization is defined as remanence.
Biofunctionalized super paramagnetic nanoparticles increases in the hydrodynamic volume,
when binding to the target. When these particles are magnetized and demagnetized by an
external field, they undergo two types of relaxation; the Neel’s relaxation and Brownian
relaxation. Brownian relaxation depends on the hydrodynamic volume of the nanoparticles.
Compared to the target-bound particles, the unbound particles rapidly relax the Brownian
rotation and do not contribute to the overall signal. By measuring the difference in remanence
of samples using SQUID, it is possible to deduce the amount of surface bound particle [48].
The magnetic susceptibility measured by the SQUID is given by equation (1) [31].
(1)
ω is the angular frequency of the applied magnetic field, Hac is the amplitude of the applied
magnetic field, m(ω) is the complex magnetization, χ0 and χ∞ are the high and low frequency
susceptibility respectively. τ is the characteristic relaxation time. The Neel’s relaxation and
Brownian relaxation time is given by τN (2) and τB (3) respectively.
Vp is the nanoparticle volume, k is the Boltzman constant, T is temperature in Kelvin, τ0 is
microscopic relaxation time, K is magnetic anisotropic constant, Vb is the volume of the bead
and η is the viscosity of the solution.
1.3 Nucleic acid based sensors and enzymes
A major discovery of the 20th Century was the discovery of the double stranded DNA
structure by Watson and Crick in 1953 [54]. The unique properties of specific base pairing
between two DNA strands, and sequence variations within and between species provide a
unique tool for diagnostics [40]. Relying on the hybridization principle many techniques
emerged of which immunoassays like Immuno-RCA [46], Immuno-PCR [45], Biobarcodes
[40], Proximity ligation assay [49] and Aptamers [33] are widely in use today.
Apart from nucleic acids, enzymes are also used in the bio-sensing platform. Combination of
oligonucleotides and enzymes are utilized to facilitate a wide range of bio-sensing
applications. Enzymes such as polymerases, ligases and restriction enzymes are being widely
used and will be described below.
5
1.4 DNA Ligase
DNA ligase catalyzes the phosphodiester bond formation between 5’-phosphate and 3’-OH
group of nucleotides [28]. This end-joining event is necessary for DNA repair, replication
and recombination. Ligation is a three step process involving adenylation, deadenylation and
nick closure. During adenylation the adenosine mono-phosphate (AMP) group is transferred
from ATP or NAD to the catalytic site, followed by deadenylation where AMP is transferred
to the 5’- phosphate at the nick through a pyrophosphate linkage. Finally, forming of the
phosphodiester bond between 3’-OH and 5’-phosphate group is done by releasing AMP [55].
The high fidelity of ligase enabled ligase-based technologies such as Oligo Ligation Assay
(OLA) [53], Ligase mediated target amplification, Ligation detection reaction and universal
arrays, and ligation based sequencing [51].
1.5 Restriction enzymes
Restriction endonucleases is a group of deoxyribonucleases, which recognizes nucleotide
sequences specifically and cuts double stranded DNA, either forming blunt ends or sticky
ends depending on the type of enzymes used. They are widely used in gene cloning,
identification of single nucleotide polymorphisms (SNPs), genomic DNA digestion etc.
At certain specific reaction conditions some restriction enzymes shows relaxed, sequence
specificities called Star activity. Reaction conditions such as non-optimal buffer, high
glycerol concentration, presence of organic solvents, substitution of Mg2+ with other divalent
cations [Mn2+, Cu2+, Zn2+], high enzyme concentration and prolonged reaction time will
contribute to the star activity [18][19]. In this study we used four different restriction
enzymes (Table 1).
Table 1: Restriction enzymes used in this study
Name of
Enzymes
Recognition Site
Preferred
buffer
Optimal
temp
Inactivation temp
and time
Ref
MscI
5’…TGGCCA…3’
3’…ACCGGT…5’
NEBuffer 4
37 oC
[16]
ScaI
5’…AGTACT…3’
3’…TGCTGA…5’
NEBuffer 3
37 oC
65oC for 20 min
and at salt
concentrations
> 150 mM.
80o for 20 min
ScaI-HF™
5’…AGTACT…3’
3’…TGCTGA…5’
NEBuffer 4
37 oC
65oC for 20 min
[17]
AluI
5’...AGCT...3’
3’...TCGA...5’
NEBuffer 4
37 oC
65oC for 20 min
[15]
6
[14]
1.6 Padlock probes and Rolling circle replication
Padlock probes are the extension of Oligonucleotide Ligation Assay (OLA) [53], which relies
on a pair of independent oligonucleotide probes. Upon adjacent hybridization to a target
sequence, they are joined by the action of ligase and the can be amplified by PCR. By
contrast, the padlock probe is a linear single stranded oligonucleotide typically consisting of
70-90 nucleotides; it consists of a linker sequence that may carry a detection tag flanked by
two different segments complimentary to the target DNA or RNA [35, 34]. On proper
hybridization to the target sequence the 3’-OH and the added 5’-Phosphate terminal end of
the probe segments are brought in close proximity and by the action of ligase they are
converted into circularized probe (see Figure 1). The inability of ligase to covalently join
mismatching oligonucleotides, especially at the 3’-terminus, guarantees the selectivity by
distinguishing between similar sequences variants [53]. Some of the major advantages of
these probes are; the dual recognition target complimentary segments of probes, providing
high specificity and excellent sensitivity, circularization traps the probes by catenation to the
target sequence, resisting extreme stringent washes [35]. It has been demonstrated that the
padlock probes can detect single nucleotide variation in situ [36].
Figure 1: Schematic representation of nucleic acid target recognition using padlock probes. The ends of
padlock probe hybridized to specific matching nucleic acid is covalently joined by the action of ligase to form
circularized probe target complex, which can be amplified and detected.
In 1990s, two independent researchers showed that a circularized DNA molecule can be used
as a template for DNA replication by DNA polymerase in a RCA reaction [1, 12]. Later,
circularized padlock probes were used as template for RCA [43]. Researchers at Yale
University School of Medicine demonstrated isothermal exponential hyper branched RCA
[HRCA] by employing the highly processive φ29 DNA polymerase, which has a strong 3’-5’
strand displacement exonuclease activity [29,30] and showed that the visualization of
individual rolling circle products (RCP) was possible by hybridizing short fluorescent
detection probes to the tandem repeated sequence of the RCP. In an isothermal RCA singlestranded DNA concatamers will be generated and in solution spontaneously collapse into
7
sub-micron sized DNA coils (blobs), the size of which depends on the replication time (RCA
time).
Usually padlock probes are produced synthetically by phosphoroamidite chemistry, and is
limited by the length and high cost. Comparatively, longer and cheaper padlock probes can be
synthesized using PCR and shown to have three-fold greater signal in in situ analysis [9] even
though it resulted in lower yield than chemical synthesis. Recently, it has been shown that by
using padlock probes and RCA it is possible to detect microRNA [50] and in situ detection of
individual transcripts [7].
A highly controlled amplification of reacted padlock probes was demonstrated by Circle-toCircle amplification (C2CA) [13]. C2CA is a three-step process initiated by RCA of
circularized probes, followed by monomerization of concatemeric amplification products and
another cycle of circularization and RCA reaction. After three cycles of C2CA a billion-fold
amplification is possible but the reaction is completely depending on the RCA time and
number of cycles. The reaction kinetics is represented by nc: where c is the number of cycles
and n is the number of monomer produced during RCA reaction per cycle [13].
Advancing technological development in microscopy and fluorescence based technology
makes it possible to visualize and measure single molecule responses. In contrast to the
golden standard for nucleic acid, quantitative real-time PCR, single molecule detection
(SMD) provides better precision and more accurate measurement [23]. RCP are the true
single molecule amplified signal, containing 1000 tandem repeats of a 100-mer DNA circle
after one hour polymerization [22]. Hybridization of fluorescent-labelled oligonucleotides
(detection probes) to RCP makes them to appear as a bright spot under confocal microscope
due to confined cluster of fluorophore. In 2006 Jarvius et al reported a novel approach of
homogenous detection and enumeration of labelled blobs by pumping them through a
microfluidic chamber, fabricated using thermoplastic injection moulding and visualized under
confocal microscope [24, 25], where each Blobs visible as a bright spot compared to the
background fluorophore. Multiplexing was made possible by tagging different RCP with
different fluorescent tagged detection oligos [23].
1.7 Volume- amplified magnetic nanobead detection assay [VAM-NDA]
In 2001 Connolly and St. Pierre theoretically proposed a biosensor based on Brownian
relaxation frequency of magnetic beads. Later, the same principle was employed by others
and demonstrated antibody-antigen binding activity [48]. By combining the DNA technology
with nano-diagnostic technology Stromberg et al developed [38] a novel nucleic acid
detection assay. In this assay the magnetic nanoparticles are biofunctionalized with singlestranded covalently conjugated oligonucleotide detection probes, which contains a sequence
that complementary to the tandem repeating sequences of the RCP. In the presence of RCP in
the test sample, the bio-functionalized magnetic beads cluster together with the RCP by
sequence specific hybridization and increases the hydrodynamic volume of the beads, which
essentially corresponds to the size of the blobs, thus the Brownian relaxation frequency of
magnetic beads was considerably lowered, which was measured by SQUID magnetometer at
8
37oC. However, no changes in the magnetic frequency spectrum can be seen in the absence of
RCA coils in the test sample (see Figure 2) [38]. The positive samples has essentially exhibit
two different frequencies High frequency peak (HFP) and low frequency peak (LFP) in the
imaginary part of the complex magnetisation spectrum. Using this HFP and LFP peak
discrimination between the negative and positive samples can be done, which is referred as
“turn-off” or “turn-on” detection. ”Turn-on” detection is possible by using 40 nm sized beads
but only turn off detection is possible with larger beads [32].
Positive sample
Negative sample
No circularization
No Ligation
No RCA
m’’
log(f)
Figure 2: Schematic illustration of the VAM-NDA. In positive samples the padlock probe recognise target
single stranded DNA molecule (grey lines) and the ends of the padlock probes (light blue lines) hybridized to
the target DNA molcules and joined by the action of ligase. Circularized probes obtained after ligation are
amplified by RCA for a specified period. The produced RCP is detected by the addtion of biofunctionalized
nanoparticle that contains a detection sequence, which are complementary to the RCP repeating motifs. Upon
this, binding of biofunctionalized beads to the RCP exhibits Brownian relaxation behavior measured by SQUID
magnetometer. In negative sample no change in the magnetic spectrum can be observed, where as in positive
samples the magnetic spectrum decreases.
A limit of detection of 4 pM target DNA was reported in this method [38], and showed that
an excess of genomic background material in the test sample will not affect the detection
sensitivity. A increasing in temperature significantly increases the bead incorporation
kinetics, but immobilization kinetics is limited by diffusion of coil and also depends on bead
size [38, 32]. Multiplexing was reported by incorporating different sized (40 nm, 130 nm and
250 nm) specific biofunctionalized beads for each kind of targets [39]. However, there are
several problem associated with this procedure such as enhanced kinetics and increase
amplification signal [32].
9
1.8 Molecular bead shaving
In this study we would like to modify the VAM-NDA method by developing a new principle
called “Molecular bead shaving”.
1.8.1 Concept of the project
Instead of having covalently conjugated detection probes on the nanobeads as previously
described in VAM-NDA [38], RCA primers were covalently conjugated to the nanoparticles
and blobs will be synthesized by employing Padlock probes and RCA. These Blobs-on-bead
complexes were named “Dreadlock probes”, which will be used as the reporter molecule (see
Figure 3a).
Specific target DNA identified by using specific padlock probes was amplified by using
C2CA. Furthermore, RCP obtained after C2CA were monomerized. These monomers, which
contain a sequence complementary to a Dreadlock root sequence, are used as restriction
oligos (RO) and together with a specific restriction enzyme can cut off the blobs from the
Dreadlock probes and release them into solution. This process of cutting off the Blobs from
the bead surface is referred as to “Molecular bead shaving” (MBS). The loss of Blobs from
the Dreadlock probes reduces the hydrodynamic volume of the beads and shifts the Brownian
relaxation frequency from low to high, which can be measured by a SQUID magnetometer.
This change in magnetic frequency spectrum from low to high is easier to interpret than
measuring the reduction of the frequency spectrum from high to low as described in VAMNDA [38]. If the target DNA is not present in the test sample, there will not be any restriction
oligos synthesised for restriction digestion of Dreadlock probes, and thus no changes in the
Brownian relaxation frequency will be observed. By developing this new principle of
molecular bead shaving a better sensitivity can be achieved. In an ideal case, we expect each
monomer formed after C2CA and final monomerization will potentially release every
synthesized blob from the Dreadlock probes, thus increasing the sensitivity, and amplifying
the signal. The disadvantage of this method is the presence of non-biofunctionalized beads,
which constitute part of the background signal. Since, the SQUID magnetometer
measurement takes around 2.5 hour per sample, which is a limiting factor when large
numbers of samples were used; thus, we modified our approach for optical readout instead of
magnetic readout as explained below.
10
A). Preparation of Dreadlock probes
B).Positive sample
C).Negative sample
No circularization
No Ligation
No RCA
RCA
No C2CA
C2CA
Monomerization
No monomerization
Restriction
enzyme
m’’
log(f)
Figure 3a: Schematic illustration of the Molecular bead shaving concept. (A) Preparation of Dreadlock
probes: The DNA coils (Blobs) syntheized onto the nanoparticles that conatins covalently conjuagted RCA
primer, by emlpoying padlock probes and RCA. (B) In positive samples the padlock probe recognizes the target
single stranded DNA molecule (grey lines) and the ends of the padlock probes (light blue lines) hybridized to
the target DNA molcules and joined by the action of ligase, and these circularized probes were amplified by
C2CA and finally monomerized. These monomer have a sequence that are complementary to the dreadlock root
(yellow line). Together with suitable enzyme release the blob from the dreadlock probes and reduces the
hydrodynamic bead volume that induces a change in Brownian relaxation frequency, that is measured by
SQUID. (C) In the absence of target DNA molecule, no monomers were produced, thus no change in the
magnetic spectrum will be observed.
Approach
To investigate the principle of Molecular bead shaving, Dreadlock probes were synthesized
on streptavidin coated micron-sized beads using biotinylated RCA primers instead of
biofunctionalized nanobeads as explained in the concept. After restriction digestion of
dreadlock probes, the blobs will be released from the bead surface and labeled with the
fluorescently tagged oligonucleotides that are complementary to the tandem repeat sequence
of blobs. Furthermore, homogenous detection and enumeration of the labelled blobs was
achieved by pumping the sample through the microfluidic chamber and visualized under
confocal microscope. In the absence of target DNA in the original sample no blobs will be
11
released from the Dreadlock probes and no fluorescent signal can be observed (see Figure
3b). Dreadlock probes without added RO were used as negative control in all the
experiments.
A).Preparation of Dreadlock probes B).Positive sample
C).Negative sample
No circularization
No Ligation
No RCA
RCA
No C2CA
C2CA
Monomerization
No monomerization
No Signals
Figure 3b: Schematic illustration of the Molecular bead shaving appraoch. (A) Preparation of Dreadlock
probes: The blobs are syntheized onto the streptavidin coated micron-sized beads by capturing biotinylayed
RCA primers using padlock probes and RCA. (B) In positive samples the padlock probe recognizes the target
single stranded DNA molecule (grey lines) and the ends of the padlock probes (light blue lines) hybridized to
the target DNA molcules and joined by the action of ligase. Reacted probes are amplified by C2CA and finally
monomerized. These monomer have a sequence that are complementary to the dreadlock root (yellow line).
Together with suitable enzyme releases the blobs from the dreadlock probes. The released blobs were labelled
with the fluorescent tagged oligonucleotides that are complementary to the tandem repeat sequence of RCP.
Furthermore, homogenous detection and enumeration of the labelled blobs was achieved by pumping the sample
through the microfluidic chamber and visualized under confocal microscope. (C) In the absence of target DNA
in the original sample no blobs will be seen.
12
1.9 Aim of the present study
The principle aim of this project work is to develop a new magnetic biosensor principle
called Molecular bead shaving, a potential platform for rapid and low cost magnetic nano
diagnostic assay.


To set up and test the concept of Molecular bead shaving onto micron-sized beads for
optical readout.
Translation of the MBS procedure for biofunctionalized nanometer sized beads for
magnetic readout.
o To optimize covalent conjugation of oligos onto to the nanobeads.
o Separation of non-biofunctionalized beads, which constitute part of the
background signal.
13
2.0 Results
2.1 Initial optimization of RCA primer and restriction oligonucleotides concentrations for the
preparation of dreadlock probes
To test the principle of molecular bead shaving our first aim was to obtain an optimum
coverage of blobs onto the streptavidin-coated beads. This was necessary in order to have a
good dynamic range. Since the amount of dreadlock probe synthesis depends on the number
of biotinylated RCA primers coupled onto the beads, we started our investigation by
determining the optimal concentration of RCA primers required to produce dreadlock probes
and restriction oligos required for restriction digestion to cleave blobs from the dreadlock
complex. Three different concentration of RCA primers (10 pM, 100 pM and 1 nM) and two
different concentration of restriction oligos (RO) 10nM and 1µM were used. In the following
experiments synthetic oligos, which have same polarity as their C2CA monomerized products
were used as a restriction oligos.
Number of counted Blobs
(log10)
100000
10000
1000
10pM
100
100pM
10
1nM
1
neg
10nM
1µM
Concentration of Restriction oligos
Figure 4: Determination of optimal concentration of RCA primers and restriction oligos. 1 nM, 100 pM
and 10 pM represent three different concentrations of RCA primers. X axis represents the concentration of RO
and Y axis represents the number of Blobs counted under confocal microscope respectively. The Negative
samples contain no restriction oligonucleotides.
As shown in Figure 4 increasing the concentration of RCA primers, resulted in high signal
with low standard deviation, but equally increased signals were seen in negative samples (no
added RO). Thus the signal to noise ratio (S/N) was drastically reduced, where S/N ratio is
the number of blobs counted in positive samples divided by number of blobs counted in the
negative samples
2.2 Background signal reduction
It was hypothesized that the cause for background signal could be due to nonspecific binding
of RCA primers to the beads surface or it could be due to the complementary binding of RCA
primer to itself and others due to its palindromic nature as shown in Figure 5. We also
suspected that the reduction in S/N could be due to star activity of the ScaI enzyme.
14
5'
TTTTTTTTTTTTTTTTTTTTAATTACCAGTACTCGACAACATTGGCGTGACTCAAAGGCTCAC 3’
3' ACTCGGAAACTCAGTGCGGTTACAACAGCTCATGACGATTAATTTTTTTTTTTTTTTTTTTT
5’
Figure 5: Schematic representation of streptavidin coated magnetic beads coupled to RCA primers. RCA
primer self-annealing sites are marked in red.
2.2.1 Heat treatment of captured RCA primers
To test the proposed hypothesis of non-specific binding of RCA primers onto the bead
surface, an experiment was performed in which beads coupled with RCA primes with prehybridized circularized padlock probes were heated at different temperatures for 10 min
before RCA, presuming that the heat treatment might reduce the non-specific binding of the
RCA primers to beads surface.
Number of counted Blobs
4000
3500
3000
neg
2500
100nM RO
2000
1500
1000
500
0
noheat
55
65
75
85
Temperature (oC)
Figure 6: Preheat treatment coupling and post ligation. Padlock probes were hybridized with RCA primers
and ligated; thereafter these RCA primers were coupled onto to the beads and heated at different temperatures
before RCA for 10 minutes.
The results shown in Figure 6 demonstrate that the background signal linearly decreased with
increase in temperature. The value at 55oC may be an experimental error and the signals tend
to disappear at higher temperatures of 75oC and 85oC.
15
2.2.1.2 Preheat treatment coupling and Post hybridization ligation
In this experiment, the beads initially coupled only with RCA primers were heated at
different temperature for 10 minutes and washed with 1X B&Wtw buffer, after which the
hybridization and ligation of padlock probes were carried out.
A
B
Number of counted Blobs
(log10)
100000
1000
10000
100nM RO
100
S/N
100
neg
1000
10
10
1
1
RT
RT
55
65
75
55
65
75
Temperature (oC)
Temperature (oC)
Figure 7: Preheat treatment coupling and Post ligation. (A) Number of amplified signals (B) Signal to noise
ratio in the experiment.
As shown in the Figure 7A the number of blobs drastically diminished with the increase in
temperature, but at higher temperatures (65oC and 75oC) the background signal was reduced
significantly with proportional decrease in positive signals. Figure 7B shows an increase in
the S/N ratio with the increase in temperature.
2.2.2 Pre-restriction digestion before RCA to reduce background signal
To test the hypothesis of complementary binding of RCA primers forming itself and others
causing background signal, an experiment was performed in which RCA primers coupled
onto the beads were treated with ScaI to digest the dimers of RCA primers. After restriction
digestion the beads were washed with 1X B&Wtw buffer followed by RCA and MBS.
16
Number of counted Blobs
(log10)
10000
1000
100
Pre ScaI
digestion
No pre ScaI
digestion
10
1
neg
100 nM RO
Concentration of Restriction oligos
Figure 8: Pre-restriction digestion of RCA primers. Number of amplified single blobs
As seen in Figure 8 there is no difference in the signal between the pre-restriction digestion
and normal sample. From this result it is clear that complementary sequence of RCA primers
might not be responsible for causing the background signal.
2.3 Selection of suitable enzyme for Molecular bead shaving
After several experiments with ScaI the background signals did not reduce. So we tested a
High Fidelity ScaI-HF and MscI enzymes for molecular bead shaving. In this experiment we
used three different enzymes ScaI, MscI and ScaI-HF respectively.
A
B
25
20
1000
15
100
S/N
Number od counted Blobs
(log10)
10000
ScaI-HF
10
MscI
10
ScaI
5
1
0
neg
100nM RO
ScaI-HF
MscI
ScaI
concentration of RO
Enzymes
Figure 9: Finding a right enzyme for molecular bead shaving (A) Number of amplifed signals obtained after
restriction digestion with three enzymes (B) Signal to noise ratio in the experiment.
From the above results it is evident that Sca1-HF is not suitable for molecular bead shaving.
Even though the S/N ratio of MscI is higher than the ScaI, the numbers of blobs in the
positive sample are proportionally lower. However, here afterwards we used MscI enzyme
for rest of our experiments unless mentioned.
17
2.4 Determination of optimum Restriction digestion time
When MscI was used for the restriction digestion, we observed a low background signal and
also the numbers of counted blobs in the positive samples were too low when compared to
the theoretical amount of blobs. Therefore, to increase the signal, we investigated the
optimum time required by the enzymes to cut the blobs from dreadlock probes, by digesting
the samples at different incubation periods at 37oC.
A
B
Number of counted Blobs
(log10)
10000
100
100
neg
10
S/N
1000
10
100nM
RO
1
1
3
10
30
1
60
1
Time (minutes)
3
10
30
60
Time (minutes)
Figure 10: Restriction Digestion time study (A) Dreadlock probes were treated with Mscl and digested at
different incubation periods at 37 0C (B) Signal to noise ratio in the experiment.
The results above show that the signals increased linearly with the incubation time and seem
to saturate after 30 minutes. From Figure 10B it was evident that the S/N increased with
increasing in the incubation time. This suggests an incubation time of 30 minutes is quite
sufficient. Hereafter we used 30 minutes restriction digestion time for rest of the experiments
unless mentioned.
2.5 Effect of salt on release of digested blobs from Dreadlock probes
It was suspected that the low signals in the positive samples could be due to non-specific
adsorption of cleaved blobs onto the surface of beads, caused by van der Waals force or by
electrostatic interaction between beads surface and blobs. Therefore, in order to reduce these
interactions and to increase the signals, an experiment was performed in which 1% (v/v)
Tween20 and a high concentration of salt was added to the restriction digested samples.
18
A
B
100000
10000
50
1000
40
S/N
Number of counted Blobs
60
neg
100
30
pos
20
10
10
1
0
0
0.5
1
2
0
Concentration of NaCl (M)
0.5
1
2
Concentration of NaCl (M)
Figure 11: Effect of salt on release of digested blobs. (A) Number of amplified signals, after the addition of
1% (v/v) Tween20 and with varying concentration of NaCl to the restriction digested samples (B) Signal to
noise ratio in the experiment.
Figure 11 (A and B) shows that the signals increased linearly with the increasing
concentration of salt, thereby increasing the S/N ratio. This results suggest that salt is
necessary to release the blobs from the dreadlock probes. However, the values at 1 M NaCl in
both the panels might be an experimental error. Hereafter, 2 M NaCl and 1% Tween20 was
added to the restriction digested dreadlock probe samples unless mentioned.
2.6 Finding the optimum post restriction digestion incubation time
Addition of salt appeared to increase the S/N ratio. However, to further increase the S/N ratio,
the salt treated restriction digested dreadlock probes were incubated at 650C for different
interval time, presuming that increase in temperature with sufficient incubation time could
probably enhance the kinetics of blob release from the dreadlock probes and might yield
better S/N ratios.
A
B
60
50
10000
40
1000
neg
100
pos
10
S/N
Number of counted Blobs
(log10)
100000
30
20
10
1
0
normal
0
10
30
60
normal
Time (minutes)
0
10
30
60
Time (minutes)
Figure 12: To determine the optimum post-restriction digested incubation time (A) Number of amplified
signals, after the heat treatment of restriction digested dreadlock probes (B) Signal to noise ratio in the
19
experiment. Normal in the panel (A) represents the sample without addition of any salt and also not heated, 0
minute in both the panels represent sample with no salt added but heated at 65oC.
As shown in the Figure 12A the signal increased linearly with respect to the incubation time,
but as shown in the panel (B) the S/N ratio decreased over incubation time.
2.7 Effect of heat and incubation time after salt treatment
It was suspected from the previous experiment that heating the samples at 65oC for an hour
would cause subsequent unspecific release of blobs from the dreadlock probes thus
decreasing the S/N ratio. Therefore, to investigate the effect of heat and incubation time, in
this experiment the temperature was further increased from 65oC to 75oC and incubated for
15 min instead of one hour incubation.
Number of counted blobs
(log10)
100000
10000
1000
100
10
1
+
+
+
-
-
75 ºC
-
-
-
+
+
65 ºC
-
+
+
+
+
Mscl
-
-
+
-
+
100
nM_RO
Figure 13 Effects of heat and incubation time Samples after restriction digestion were heated at two different
temperatures 65oC and 75oC respectively. A negative control without the enzyme was also included in this
experiment.
The above result in Figure 13 shows that, at temperature of 75 0C the background signal
increased and supports our theory of breakage of streptavidin and biotin interactions.
2.8 Blocking of beads to avoid non specific binding of RCA primers
From our previous experimental results it was evident that addition of salt is necessary to
reduce the electrostatic interaction between beads. Therefore, to reduce the non-specific
interaction of blobs to the surface and binding of RCA primers, we used blocking agents such
as 2% dry milk and Salmon Sperm DNA (SSD) to block the bead surface.
20
Number of counted Blobs
(log10)
100000
10000
1000
100
10
1
-
-
-
-
+
+
2% milk
-
-
+
+
-
-
SSD
-
+
-
+
-
+
100 nM
RO
Figure 14: Blocking of bead surface. To reduce non-specific binding of blobs and RCA primers, blocking was
carried out as described in the material and methods.
As seen in Figure 14 blocking of bead surface did not sufficiently decreases the S/N ratio.
2.9 Comparison of signals between 100 nM RO and 10nM RO
In order to measure the sensitivity of the molecular bead shaving, two different
concentrations of RO for digestion of blob-on-beads complex were used and the differences
in signal were measured.
Number of counted Blobs
100000
10000
1000
100
neg
10
pos
1
Figure 15: Signal comparison between 100 nM and 10 nM RO respectively. Restriction digestion was
performed at two different concentrations to RO to find the difference in signal. STD and SHTD represent salt
treated dreadlock probes and salt and heat treated dreadlock probes respectively.
Initially, it was shown in the Figure 4 that no signal can be observed at the 10nM RO
concentration. However, the addition of salt and heat, the S/N ratio was increased and signals
tend to appear at the 10nM RO concentration Figure 15. This sets a new limit of detection for
molecular bead shaving, but the S/N is comparatively lower than that of 100 nM RO treated
samples.
21
2.10 Comparison between Dynabeads®MyOneTM Streptavidin C-1 and T-1 magnetic beads
with respect to signal
It was suggested that by using C-1 beads a better coverage of RCA primers and non-specific
binding of released blobs might be possible. In this experiment C-1 beads were compared
with T-1 beads C-1 Beads have a hydrophilic surface, whereas T-1 Beads have a hydrophobic
surface. Two different enzymes MscI and ScaI were tested at the same time.
Number of counted Blobs
(log10)
A
B
100000
100000
10000
10000
1000
1000
100
100
10
10
1
1
T1
C1
Figure 16: Signal comparisons between C1 and T1 Beads. (A) Number of amplified signal from MscI
digested Dreadlock probes. (B) Number of amplified signals from ScaI restriction digested dreadlock probes.
SD represents no salt and heat treated and SAHT represents salt and heat treated samples respectively.
From these results in Figure 16 it can be easily seen that the S/N ratio is much lower in C-1
beads compared to T-1 beads.
2.11 Theoretical calculation
Name of Oligo
Capture Oligo
RO
Concentration
500pM
100nM
Volume Moles
1µl
5E-16
10µl
1E-12
Number of Oligos (moles X Avogadro number)
3.01E+08
6.02E+11
Therefore, Number of RO to required to release the blobs from dreadlock probes
= Number of RO/Number of Blobs in dreadlock probes
=6.02E+11/3E+8= 2000
Note: To obtain 1picomoles of RO from C2CA protocol requries 10attomoles of target oligos
22
3.0 Discussion
The main purpose of this project was to investigate the principle of Molecular bead shaving,
which is a novel procedure for magnetic readout.
As a “Proof of principle” for Molecular bead shaving. Our investigation started with finding
the optimum amount of blobs that can be synthesised on the beads. Such a high coverage of
blobs was necessary to obtain a good dynamic range, while the background was expected to
be reduced. We showed that the optimum amount of RCA primer required for a good
coverage was around 6 per bead and above this amount the beads tend to aggregate after
RCA. Aggregation of beads might be due to cross linking or chain entanglement of RCA
products [38, 41] and was found to be irreversible after vortexing. The signals increased with
an increasing concentration of the RCA primer, with an equal increase in the background
signal. However, before proceeding to further experiments, at this point it was imperative to
have a steady background to set a threshold and to limit the sensitivity.
Initially, we hypothesised that the background problem might be due to nonspecific
adsorption of RCA primers onto the bead surface or it could be due to complementary
binding of RCA primers to itself and others or it could be due to star activity of the restriction
enzyme. We tested our hypotheses by performing several experiments, which included
removal of any non-specific adsorbed RCA primers, by heat treating the beads coupled with
RCA primers and ligated padlock probes. This resulted, a significant reduction in the
background signal. Subsequently, incubation at higher temperatures reduced the positive
signals. But above 75oC the signals completely disappeared as shown in Figure 6. This could
be due to slipping off circularized padlock probes from the template RCA primers, which
depends on the Tm of the padlock probes. To avoid such problem of slipping off circularized
padlock probes another experiment was conducted in which the beads were coupled only
with RCA primers were heated at different temperatures. After washing, the padlock probes
were ligated on RCA primers, and interestingly it showed a drastic reduction in the
background signal, but equally decreased the positive signals as well. This heat-treatment
experiment supported our hypothesis that the RCA primers were non-specific adsorbed onto
the bead surface thus constitute the background problem. Since this heat treatment step was
laborious and MscI seemed to solve the background problem, this protocol was put on hold
and there was no time to revisit.
To validate our theory of complementary binding of RCA primers which constitute
background problems, the RCA primer-coupled onto the beads initially was treated with
restriction enzyme. Unfortunately, the experimental results did not support our hypothesis
and also the theory of star activity of enzyme was disapproved (data not shown).
In this investigation three different Restriction enzymes Scal, ScaI-HF and Msc1 were tested
for molecular bead shaving. A very low S/N was observed with ScaI-HF treated sample.
Even though the S/N ratio of MscI treated dreadlock probes showed a higher S/N, the
numbers of blobs in the positive were very less compared to the ScaI treated samples. Our
observation suggested the NEBuffer 3 facilitates non specific drop off of blobs, which was
23
not observed in NEBuffer 4 (data not shown). Further, the time required by Msc1 to release
the blobs from the dreadlock probes was determined by digesting the dreadlock probes at
different time intervals at 37oC. The results suggested that 30 minutes incubation was quite
sufficient to obtain a good signal and above this incubation time the signal might saturate
(Figure 10).
In comparison to the theoretically calculated values the signals obtained in the positive
sample was very low. We suspected that even after restriction digestion of dreadlock probes,
the blobs cleaved from the deadlock probes were not freely released into the solution, rather
they remain attached to the bead surface. This sticking of blobs to the bead surface could be
due to Van der Waals or electrostatic interactions between them. Interestingly, when
restriction digested samples were treated with 1% (v/v) Tween20 and 2 M NaCl Figure 11, a
significant 3.5 times increase in S/N ratio was observed, and this result suggested that the
electrostatic interaction between the beads and blobs could be reduced by adding high
concentrations of salt and non-ionic surfactants. Our experiments directed to increase the S/N
ratio by heat treatment did not yield fruitful results. However, incubating the samples for
longer time at higher temperature increased the signals in positive samples, but also a slight
increase in the background signal was observed. Thus, the S/N ratio was reduced linearly
with respect to incubation time. From these results it was suspected that the reduction in S/N
ratio is most likely due to breakage of streptavidin and biotin interactions or it could be due to
leakage of streptavidin from the beads [3]. To investigate the effect of heat causing
background signal and to reduce the incubation time, we further heated the previously salt
treated restriction digested sample at 75oC for 15 minutes, this experimental results support
the fact that increase in background signal could be due to breakage of streptavidin and biotin
interactions or it could be due to leakage of streptavidin from the beads.
Non-specific binding is a common problem associated with hybridization assays and factors
like hydrophobicity of the monolayer and electrostatic interaction could be responsible for the
nonspecific binding [20]. To reduce the nonspecific binding we blocked the beads using
blocking agents like BSA, dry milk and SSD. Here we expected to have a better signal with
less background. But from the experiment we found out that this was not the case and there
was no change in the signal. We also investigated two different types of beads, C-1 and T-1,
having different surface properties, to increase the coverage and to reduce the S/N ratio. As
shown in Figure 16, T-1 beads were better than C-1 beads for our experiments due to the
higher S/N ratios.
According to our theoretical calculation it has been estimated that roughly 2000 RO were
required to release a blob from the dreadlock probes. It suggests that a very high
concentration of restriction oligos is required to drive the reaction. Requirement of high
concentration of RO suggests that the digestion process is limited by diffusion of RO or
restriction enzymes. At low concentration of RO very few will diffuse through the dreadlock
probes and hybridizes with the dreadlock root thus limiting the restriction digestion, this
could probably be the reason for low sensitivity, which was also hinted by the need of more
time for restriction digestion.
24
With this method originally developed for magnetic readout, a detection limit of one
attomole of target DNA sequence was achieved by using synthetic RO Figure 15, but it is
interesting to see how the C2CA derived monomers affects the detection sensitivity.
However, we envisage that better sensitivity might be possible by translating this method to
biofunctionalized nanobeads, that might give less sterical problems and have better kinetics,
but the drawback of that bead entrapment by the blobs has to be considered.
In conclusion, we have partly achieved our aim, and showed that as a proof of principle the
Molecular bead shaving method was successfully developed for optical readout. Further, we
would like to translate this molecular bead shaving procedure to the magnetic readout.
Translation of this principle for nanobeads might offer possibilities to design a new
generation, point-of-care diagnostic devices.
25
4.0 Materials and Methods:
4.1 Oligonucleotides
The oligonucleotide sequences used for this study are listed in Table 1. 1µM padlock probe
were 5’ phosphorylated enzymatically by 0.1U/µl T4 PNK (Fermentas) in 1X manufacture’s
Buffer A and 1mM ATP for 30 min at 37oC, followed by inactivation at 65oC for 20 min.
Name
Snag_Dreadlocklock1
Snag_Root_MscI_EC
Snag_Root_ScaI_EC
B2_CO_EC
DNA sequence 5’-3’
ACGCCAATGTTGTCGGTGGATATTG
TCTTACACGATTGCAGACCTGGTGT
GAGCCTTTGAGTC
TACCTTTGCTCATTGACGTGTATGCA
GCTCCTCAGTATTTGTTGTCGTGGCC
AGATAATCTTTGGAAGGGAGTAAAG
TTAA
TACCTTTGCTCATTGACGTGTATGCA
GCTCCTCAGTATTTGTTGTCGAGTAC
TGGTAATTTTTGGAAGGGAGTAAAG
TTAA
Kind of
Oligonucleotide
Padlock probe
Modific
ations
_
Padlock probe
_
Manufactur
ers
Integrated
DNA
Technology
”
”
_
Biomers
5’Biotin
Biomers
Padlock probe
CTCTCTCTCTCGTGCCAGCAGCCGCG
GTAATACGGAGGGTGCAAGCGTTA
Capture Oligo
TAACGCTTGCACCCTCCGTATTACCG
CGGCTGCTGGCACGGAGTTAGCCGG
TGCTTCTTCTGCGGGTAACGTCAATG
AGCAAAGGTATTAACTTTACTCCCTT
CC
Sandwich probe
BNL_DO_EC1RCA
GTGGATAGTGTCTTACACGAUUUU
Detection Oligo
_
Integrated
DNA
Technology
”
B2_AluIprimer
TACTGAGGAGCTGCATACAC
Primer
_
”
BNL_AluI_RO
GTGTATGCAGCTCCTCAGTA
Restriction Oligo
_
B2_SW_EC_ny
_
5’-Cy3
”
Snag_Primer_Scal_
Biotin
TTTTTTTTTTTTTTTTTTTTAATTACC
AGTACTCGACAACATTGGCGTGACT
CAAAGGCTCAC
Snag_Primer_MscI_Bi
otin
TTTTTTTTTTTTTTTTTTTTGATTATC
TGGCCACGACAACATTGGCGTGACT
CAAAGGCTCAC
RCA-Primer
5’Biotin
”
Note: a) Poly (T) tail at the 5’ of RCA primers acts as a spacers.
26
RCA-Primer
5’Biotin
4.2 Padlock probes hybridization and ligation
Padlock probe hybridization and ligation was carried out in a single reaction containing 10
nM padlock probes, 0.25 U/µl AmpLigase (Epicenter Biotechnologies) 1 X AmpLigase
buffer [20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl, 0.25 mM NAD, 0.01% (v/v)
Triton® X-100], sterile filtered (stf) 0.2 µg/µl BSA (New England BioLabs) and 500 pM of
RCA Primers and the reaction mixture was incubated at 55oC for 10 min.
4.3 Capturing of RCA primers to beads
A bead suspension of 5 µl (5*107 beads) Dynabeads® MyOneTM Streptavidin T1
(Invitrogen) beads were washed using the same initial bead volume with 1X B&Wtw buffer
(10 mM Tris-HCl [pH 7.5], 5 mM EDTA, 0.1 % [v/v] Tween20, and 1M NaCl) Beads were
trapped along one side of the tube by using permanent magnet and the storage buffer is
removed. After removing the magnet 1 X B&Wtw buffer was added along the wall of the
tubes and vortex to resuspend the beads, this washing procedure repeated for three times.
Coupling of RCA primers was carried out by adding 20 µl of ligated Padlock probes solution
to the washed beads followed by incubation for 5 min at room temperature with rotation. The
beads were washed with 1X B&Wtw buffer two times to remove non captured RCA primers.
4.4 RCA on magnetic beads
RCA reaction was performed on the RCA primers coupled beads by adding the solution
containing 0.1 U/µl of φ29 DNA Polymerase (Fermentas) 1X φ29 buffer (33 mM Tris-acetate
[pH 7.9 at 37oC], 10 mM Mg-acetate, 66 mM K-acetate, 0.1% [v/v] Tween20, 1 mM DTT),
(stf) 0.2µg/µl BSA and 125µM dNTPs in a total volume of 20µl, followed by incubation at
37oC for 20 min. The polymerization reaction was terminated by inactivating the DNA
polymerase at 65oC for 5 min.
4.5 C2CA and Monomerization
Preparation of DNA Circle for C2CA reaction was carried out slight differently from padlock
probe hybridization and ligation. 500 nM synthetic E.coli Sandwich probes (B2_SW_EC_ny)
acts as template (which are complementary to both the capture oligo and the padlock probes),
100 nM Padlock probes, 50 nM capture oligo (B2_CO_EC) were added to the reaction
mixture containing 0.25 U/µl AmpLigase in 1X AmpLigase buffer and (stf) 0.2 µg/µl BSA
and incubated at 55oC for 10 min. Coupling of capture oligo and RCA reaction was
performed as before with an excess of 0.1U/µl of φ29 DNA Polymerase. The RCP were
monomerized by adding 120 nM of replication oligo (BNL_ALU_RO) complementary to the
replication sequence in the RCP products together with 120 mU/µl of Alul in 1 X φ29
polymerase buffer and 0.2 µg/µl BSA. Addition was made in 5 µl to an initial 20 µl RCA
solution, final volume 25 µl, followed by incubation for 10 min at 37oC, and inactivation at
65oC for 10 min. Further, the monomerized solution separated from the magnetic beads. And
27
the monomerized RCR product were religated and amplified in the same reaction containing
(stf) 0.2 µg/µl BSA, 0.67 mM ATP, 14 mU/µl T4 DNA Ligase, 60 mU/µl φ29 DNA
polymerase, 100µM dNTPs in 1 X φ29 polymerase Buffer, addition were made in 10 µl to an
initial 25 µl monomerized solution and the final volume 35µl, followed by incubation for
37oC for 20 min and the enzyme is inactivated at 65oC for 5 min. The second RCA Products
were monomerized by adding 120 nm of replication oligo (B2_ ALU primer) complementary
to the replication sequence for the second RCR products together with 55 mU/µl of Alul in 1
X φ29 polymerase buffer and 0.2 µg/µl BSA, addition was made in 5µl to the above solution
to total volume 40 µl, incubated 37oC for 10 min, followed by enzyme inactivation at 65oC
for 10 min. These monomerized RCP were used as target molecules for the Reporter
Dreadlock Probes for Molecular bead shaving.
4.6 Molecular bead shaving of DNA coils
After performing RCA on beads, the beads are washed twice as before using 1X B&Wtw
buffer. Releasing of DNA coils from the dreadlock probes was performed by adding 100 nM
restriction oligo or C2CA amplified monomers (that recognise the complementary sequence
present at the root of the DNA coil) with 0.08 U/µl of Mscl or Scal (New England Biolabs)
depending upon the Oligos used, in the manufactures 1X NEBuffer 3 or 4 respectively, in a
total volume of 50 µl, followed by incubation at 37oC for 30 min. After vortexing for 30 sec,
2 M NaCl with 1% (v/v) Tween20 added and incubated for 1 hour at 65oC. The beads were
separated from the released coils by using a permanent magnet.
4.7 Blocking of beads surface
A bead suspension of 5 µl were washed using the same initial bead volume with 1X saline
sodium citrate (SSC) buffer (150mM NaCl, 15 mM sodium citrate) and 100 mg/ml of SSD
was added and incubated for 1 hour with rotation. After incubation the beads was washed
with 1X SSC buffer three times and RCA was performed as explained above. Blocking of
beads with milk was carried similarly expect SSD, 2% dry milk dissolved in 1X PBS was
added.
4.8 Labeling of RCA coils
The solution of released RCA coils obtained after molecular bead shaving was mixed with
the labeling mixture containing 5 nM Cy3 labeled detection oligos, (stf) 20 mM EDTA, (stf)
20mM Tris-Hcl (pH 8.0), 0.1% (v/v) Tween20 (stf) and 1 M NaCl (stf) in a total final volume
of 100 µl and incubate at 70oC for 2 min, and 55oC for 15 min.
4.9 Microfluidic quantification, image acquisition and analysis
The homogenous solution of labelled blobs was pumped at a flow rate of 5 µl/min through a
custom made microfluidic channel (200 x 40µm cross section) using syringe pump (PHD2000, Harvard Instruments, USA). The microfluidic setup was placed onto the confocal
microscope (LSM 5 META, Zeiss, Germany) the microscope focus was set to the centre of
microfluidic channel and the pinhole was set to 300 µm, 40X objective used for detecting the
labeled blobs. The microscope operated in line scan mode with scanning path perpendicular
28
to liquid flow direction and 30,000 line scans of 512 pixels were recorded with pixel time of
1.6 µs [51].
The Images were stored as 24 bit RGB TIFF files and analyzed using dedicated software
written in MATLAB 7.0. A threshold of 40% was set and objects between 2 pixels and 10
pixels retained and the rest were removed from the list. The signal intensity subsequently
calculated were used to produce a dot plot and the collective signals in dot plots were
partitioned by defined gates and the number of objects calculated as an average of 10%
brightest objects to avoid out-of- focus objects [26].
29
5.0 Acknowledgement
This project was carried out at Rudbeck laboratory at Uppsala University. I would like to
thank Professor Mats Nilsson for providing me an opportunity to carry out my Master degree
project.
I am wholeheartedly thankful to Dr. David Herthnek, whose encouragement, guidance,
excellent supervision and support throughout the project, enabled me to understand how to
and how not to conduct experiments. I was motivated by the scientific discussion, which we
had during my thesis work, which helped to me think critically. And I appreciate his patience
and support.
I would also like to thank Mattis Strömberg and Teresa Zardan Gomez de la Torre for
introducing me to the DynoMag instruments and for the useful discussion. I thank Rongqin
ke for showing me the fabrication of microfluidic channels. And also I thank Anja Mezger
and Anna Engström for the useful discussions.
I express my gratitude to professor Staffan Svärd for his support and guidance throughout my
master degree and for his generosity.
I am thankful to all those whoever I met during this project work.
I owe my gratitude to my friends Sagar S Manoli, Naveen Kumar GC, Chetan Nagaraja and
Sanjith Kallipati for providing me the financial help and support, without which it would
have been difficult.
I am thankful to my Parents and Sisters for everything.
30
6.0 References
1. A. Fire and S. Q. Xu. 1995. Rolling replication of short DNA circles. Proc. Natl.
Acad. Sci 92: 4641-4645.
2. Allen T. Christian, Melissa S. Pattee, Christina M. Attix, Beth E. Reed, Karen J.
Sorensen, and James D. Tucker. 2001. Detection of DNA point mutations and mRNA
expression levels by rolling circle amplification in individual cells. Proc. Natl. Acad.
Sci. 98: 14238-14243.
3. Anders Holmberg, Anna Blomstergren, Olof Nord, Morten Lukacs, Joakim
Lundeberg, Mathias Uhlen. 2005. Electrophoresis 26: 501-510.
4. An-Hui Lu, E. L. Salabas, and Ferdi Schuth. 2007. Magnetic Nanoparticles:
Synthesis, Protection, Fuctionalization, and Application. Angew. Chem. Int. Ed. 46:
1222 – 1244.
5. C.R. Tamanaha, S.P. Mulvaney, J.C. Rife, L.J.Whitman. 2008. Magnetic labelling,
detection and system integrations. Biosens Bioelectron 24: 1-13.
6. Charalambos Kaittanis, Santimukul Santra, J.Manuel Perez. 2010 Emerging
nanotechnology-based strategies for the identification of microbial pathogenesis. Adv
Drug Deliv Rev 62: 408–423
7. Chatarina Larsson, Ida Grundberg, Ola Söderberg and Mats Nilsson. 2010. In situ
detection and genotyping of individual mRNA molecules. Nature Methods 7: 395 –
397.
8. Christine Berggren Kriz, Kajsa Rådevik, and Dario Kriz. 1996. Magnetic
Permeability Measurements in Bioanalysis and Biosensors. Anal. Chem. 68: 19661970.
9. D.-O. Antson, A.Isaksson, U.Landegren and M. Nilsson. 2000. PCR-generated
padlock probes detect single nucleotide variation in genomic DNA. Nucleic Acids
Res. 28: e58
10. Daniel R. Theavenot, Klara Toth, Richard A. Durst and George S. Wilson. 1999.
Electrochemical biosensors: Recommended definitions and classifications. Pure Appl.
Chem 71:2333-2348.
11. David A.Giljohann and Chad A. Mirkin. 2009. Drivers of bio diagnostics
development. Nature 462: 461-464.
12. Dongyu Liu, Sarah L. Daubendiek, Martin A. Zillman, Kevin Ryan, and Eric T.
Kool.1995. Rolling Circle DNA Synthesis: Small Circular Oligonucleotides as
Efficient Templates for DNA Polymerases, J. Am. Chem. Soc. 118: 1587–1594.
13. Fredrik Dahl, Johan Baner, Mats Gulberg, Maritha Mendel-Hartvig, Ulf Landegren,
and Mats Nilsson. 2004. Circle-to-circle amplification for precise and sensitive DNA
analysis. Proc. Natl. Acad. Sci. 101: 4548-4553.
14. http://www.neb.com/nebecomm/products/productR0122.asp. Date visited 16 July
2010.
15. http://www.neb.com/nebecomm/products/productR0137.asp. Date visited 16 july
2010.
16. http://www.neb.com/nebecomm/products/productR0534.asp. Date visited 16 July
2010.
17. http://www.neb.com/nebecomm/products/productR3122.asp. Date visited 16 July
2010.
31
18. http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/star_activity.asp
date visited 15 July 2010.
19. Hyone-Myong Eun . 1996. Restriction Endonucleases and Modification Methylases.
Hyone-Myong Eun. Enzymology Primer for Recombinant DNA Technology, 233306. Academic Press.
20. J. Llandro, J.J. Palfreyman, A. Ionescu, and C.H.W. Barnes. 2010. Magnetic
biosensor technologies for medical applications: a review. Med Biol Eng Comput.
Doi: 10.1007/s 1157-0101-0649-3.
21. Jered B. Haun, Tae-Jong Yoon, Hakho Lee and Ralph Weissleder. 2010. Magnetic
nanoparticle biosensors. Wiley Interdisciplinary Reviews: Nanomed and
Nanobiotechnol 2: 291-304.
22. Johan Baner, Mats Nilsson, Maritha Mendel-Hartvig and Ulf Landegren. 1998. Signal
amplification of padlock probes by rolling circle replication. Nucleic Acids Res. 26:
5073-5078.
23. Jonas Jarvius, Jonas Melin, Jenny Göransson,Johan Stenberg, Simon Fredriksson,
Carlos Gonzalez-Rey, Stefan Bertilsson and Mats Nilsson. 2006. Digital
quantification using amplified single-molecule detection. Nat Methods 9: 725-727.
24. Jonas Melin, Henrik Johansson, Ola Soderberg, Fredrik Nikolajeff, Ulf Landegren,
Mats Nilsson, and Jonas Jarvius. 2005. Thermoplastic Microfluidic Platform for
Single-Molecule Detection, Cell Culture, and Actuation. Anal. Chem. 77: 7122-7130.
25. Jonas Melin, Jonas Jarvius, Chatarina Larsson, Ola Söderberg, Ulf Landegren and
Mats Nilsson. 2008. Ligation-based molecular tools for lab-on-a-chip devices. New
Biotechnology 25: 42-48.
26. Jonas Melin, Jonas Jarvius, Jenny Göransson, Mats Nilsson. 2007. Homogeneous
amplified single-molecule detection: Characterization of key parameters. Anal.
Biochem 368: 230-238.
27. Judy St. John and Thomas W. Quinn. 2008. Rapid capture of DNA targets.
Biotechniques 44: 259-264.
28. Lehnman I.R. 1974. DNA Ligase: Structure, Mechanism and Function. Science 29:
790-797
29. Luis Blanco and Margarita Salas. 1984. Characterization and purification of a phage
φ29-encoded DNA polymerase required for the initiation of replication. Proc. Natl.
Acad. Sci. 81: 5325-5329.
30. Luis Blanco and Margarita Salas. 1985. Characterization of a 3'
5' exonuclease
activity in the phage φ29-encoded DNA polymerase. Nucleic Acids Res 13:12391249.
31. M.Strömberg, K Gunnarson, S. Valizadeh, P. Svedlindh and M. Stromme. 2007.
Aging phenomenon in ferrofluids suitable for magnetic biosensor applications. J.
Appl. Phy. 101: 023911-11
32. M.Strömberg, T. Zardan Gomez de la Torre, J. Göransson, K. Gunnarsson, M.
Nilsson, M. Stromme, P. Svedlindh. 2008. Microscopic mechanisms influencing the
volume amplified magnetic nanobead detection assay. Biosens.Bioelectro 24: 696703.
33. Makobetsa Khati.2010. The future of aptamers in medicine. J Clin Pathol
doi:10.1136/jcp.2008.062786
34. Mats Nilsson, Gisela Barbany, Dan-Oscar, Antson, Karl Gertow, and Ulf Landegren.
2000. Enhanced detection and distinction of RNA by enzymatic probe ligation. Nat.
Biotechnol 18: 791-793.
32
35. Mats Nilsson, Helena Malmgren, Martina Samiotaki, Marek Kwiatkowski, Bhanu P.
Chowdhary, Ulf Landegren. 1994. Padlock Probes: Circularizing Oligonucleotides for
Localized DNA Detection. Science 265: 2085-2088
36. Mats Nilsson, Katerina Krejci, Jorn Koch, Marek Kwiatkowski, Peter Gustavsson and
Ulf Landegren. 1997. Padlock probes reveal single-nucleotide differences, parent of
origin and in situ distribution of centromeric sequence in human chromosomes 13 and
21. Nat Genet 16: 252-255
37. Matthew A.Cooper. 2003. Label free screening of bio-molecular interactions. Anal
Bioanal Chem 377: 834-842.
38. Mattias Strömberg, Jenny Göransson, Klas Gunnarsson, Mats Nilsson, Peter
Svedlindh and Maria Stromme. 2008. Sensitive Molecular Diagnostics Using
Volume-Amplified Magnetic Nanobeads. Nano Lett 8: 816-821.
39. Mattias Strömberg, Teresa Zardan Gomez de la Torre, Jenny Göransson, Klas
Gunnarsson, Mats Nilsson, Peter Svedlindh, and Maria Stromme. 2009. Multiplex
Detection of DNA Sequences Using the Volume-Amplified Magnetic Nanobead
Detection Assay. Anal. Chem. 81: 3398-3406.
40. Nathaniel L. Rosi and Chad A. Mirkin. 2005. Nanostructures in Biodiagnostics.
Chem. Rev. 105: 1547-1562
41. Nienke Geerts, Tatiana Schmatko,and Erika Eiser. 2008. Clustering versus
Percolation in the Assembly of Colloids Coated with Long DNA. Langmuir. 24:
5118-5123.
42. Nuria sanvicens, Carme Pastells, Nuria Pascual, M.-Pilar Marco.2009.Nanoparticlebased biosensors for detection of pathogenic bacteria. Trends in Anal Chem 28: 12431252.
43. Paul M. Lizardi, Xiaohua Huang, Zhengrong Zhu, Patricia Bray-Ward, David C.
Thomas and David C. Ward. 1998. Mutation detection and single-molecule counting
using isothermal rolling-circle amplification. Nat Genet 19: 225-232
44. Peter J. Vikesland and Krista R. Wigginton. 2010. Nanomaterial Enabled Biosensors
for Pathogen Monitoring- A Review. Environ.Sci.Technol 44: 3656-3669
45. Sano, T.; Smith, C. L. and Cantor, C. R. 1992. Immuno-PCR: very sensitive antigen
detection by means of specific antibody-DNA conjugates. Science 258: 120-122
46. Schweitzer Barry, Steven Wiltshire, Jeremy Lambert, Shawn O'Malley, Kari
Kukanskis, Zhengrong Zhu, Stephen F. Kingsmore, Paul M. Lizardi and David C.
Ward.2000. Immunoassays with rolling circle DNA amplification: A versatile
platform for ultrasensitive antigen detection. Proc Natl Acad Sci 97: 10113–10119.
47. S. J. Swithenby. 1987. SQUID magnetometers: Uses in medicine. Phys. Technol 18:
17-24.
48. S.H. Chung, A.Hoffmann, S.D. Bader. 2004. Biological sensors based on Brownian
relaxtion of magnetic nanoparticles. Appl.Phys. Lett., 85: 2971-2973.
49. Simon Fredriksson, Mats Gullberg, Jonas Jarvius, Charlotta Olsson, Kristian Pietras,
Sigrun Margret Gustafsdottir, Arne Östman and Ulf Landegren. 2002. Protein
detection using proximity-dependent DNA ligations assays. Nature Biotechnol
20:473-477.
50. Soren Peter Jonstrup, Jorn Koch and Jorgen Kjems.2006. A microRNA detection
system based on padlock probes and rolling circle amplification RNA 12:1747–1752.
51. Sydney Brenner, Maria Johnson, John Bridgham, George Golda, David H. Lloyd,
David Johnson,Shujun Luo, Sarah McCurdy, Michael Foy, Mark Ewan, Rithy Roth,
Dave George, Sam Eletr, Glenn Albrecht, Eric Vermaas, Steven R. Williams, Keith
Moon, Timothy Burcham, Michael Pallas, Robert B. DuBridge, James Kirchner,
33
Karen Fearon, Jen-i Mao, and Kevin Corcoran. 2000. Gene expression analysis by
massively parallel signature sequencing [MPSS] on micro bead arrays. Nat.
Biotechnol 18: 630-634.
52. Tomasz Heyduk. 2010. Practical biophysics: sensors for rapid detection of biological
targets utilizing target- induced oligonucleotide annealing. Biophys. Chem, Doi:
10.1016/j.bpc.2010.05.008.
53. Ulf Landegren, Robert Kaiser, Jane Sanders and Leroy Hood. 1988. A LigaseMediated Gene Detection Technique. Science 241: 1077-1080.
54. Watson J.D. and Crick F.H.C. 1953. A structure for Deoxyribose Nucleic Acid.
Nature 171: 737-738
55. Weiguo Cao. 2001. DNA ligases and ligase-based technologies. Clin. Applied
Immunol. Rev. 2: 33–43
56. Vivian Scognamiglio, Gianni Pezzotti, Ittalo Pezzotti, Juan Cano, katia Buanasera,
Daniela Giannini, Maria Teresa Giardi. 2010. Biosensors for effective environment
and agrifood protection and commercialization: from research to market. Microchim
Acta. doi 10.1007/s00604-010-0313-5.
34