Prevalência de Candida spp. na saliva de crianças com leucemia e

Comments

Transcription

Prevalência de Candida spp. na saliva de crianças com leucemia e
UNIVERSIDADE FEDERAL DO RIO DE JANEIRO
Centro de Ciências da Saúde
Faculdade de Odontologia
Departamento de Odontopediatria e Ortodontia
RAQUEL DOS SANTOS PINHEIRO
Prevalência de Candida spp. na saliva de crianças com
leucemia e a influência da lactoferrina na expressão de
genes relacionados com a formação de biofilme
Rio de Janeiro
2014
UNIVERSIDADE FEDERAL DO RIO DE JANEIRO
Centro de Ciências da Saúde
Faculdade de Odontologia
Departamento de Odontopediatria e Ortodontia
RAQUEL DOS SANTOS PINHEIRO
Prevalência de Candida spp. na saliva de crianças com
leucemia e a influência da lactoferrina na expressão de
genes relacionados com a formação de biofilme
Tese de Doutorado apresentada ao Programa de PósGraduação em Odontologia (Odontopediatria), Faculdade de
Odontologia, Universidade Federal do Rio de Janeiro, como
parte dos requisitos necessários à obtenção do título de Doutora
em Odontologia (Odontopediatria).
Orientadores:
Prof. Dra. Gloria Fernanda Barbosa de Araújo Castro
Prof. Dra. Maristela Barbosa Portela
Rio de Janeiro
2014
DE DIC ATÓRIA
Dedico minha tese aos meus Queridos Pacientes que venceram o câncer, aos que ainda
vencerão, e aos que infelizmente se foram. Dedico também ao meu grande amigo Cláudio
Muniz Barreto (in memorian) que sempre me incentivou a seguir a vida acadêmica, você foi
fundamental nas minhas escolhas, infelizmente, por uma ironia do destino, você foi mais
uma vítima da leucemia, sei que onde quer que você esteja, estará torcendo por mim. E ainda
dedico, a minha querida Tia Alzira uma guerreira que junto a sua fé está vencendo esta
doença.
AGRADECIMENTOS
À Deus e São Cipriano e a todas energias que acredito por iluminar e guiar meus
caminhos e sempre me protegerem.
Aos meus pais João Augusto e Josete que sempre incentivaram meus sonhos e
objetivos sem medir esforços para me ajudar no que fosse preciso. Nenhuma conquista
seria possível sem os valores que me passaram. Obrigada por todo incentivo, amizade e
amor. Amo Muito vocês!
Aos meus avós Nilsia e Joaquim (in memorian) os grandes exemplos da minha
vida, dizer simplesmente obrigada não seria suficiente por tudo o que fizeram por mim. Amo
vocês!
Aos meus irmãos Juliana e Thiago que sempre vibram com minhas conquistas e me
fizeram acreditar que tudo é possível; e ao meu sobrinho Brian que me alegra a cada dia
com sua inocência e esperteza, você é meu grande amigo e a grande paixão da minha vida.
Amo muito vocês!
A todos os meus tios e tias, em especial minha tia Leda e aos primos e primas
pelo incentivo e carinho.
Aos meus afilhados Rafael Fernandes e Maria Luísa por me alegrarem e me
encherem de carinho.
À minha querida amiga-professora Sueli que por muitas vezes clareou minhas
ideias, acalmou meu coração e me ajudou a conduzir meu caminho da forma mais
adequada, muito obrigada por tudo!
A minha querida amiga Martinna Bertolini que mesmo de longe esteve presente em
todas as fases do meu doutorado; participando de congressos, sanado minhas dúvidas, me
dando ideias e sempre me incentivando, obrigada por tudo!
Aos meus grandes amigos Juliana Dias, Cristiane Branco, Elisangela Souza,
Geane Castro, Anna Carolina Bastos, Daniela Marques, Luiz Felipe Araújo, Thiago
Cruz, Thiago Lima e Filipe Morete que estiveram ao meu lado independente das
circunstâncias, que me deram carinho, tiveram paciência, sempre me incentivaram e jamais
me deixaram desistir. Como dizia Vinicius de Moraes: “Mesmo que as pessoas mudem e
suas vidas se reorganizem, os amigos devem ser amigos para sempre, mesmo que não
tenham nada em comum”.
Aos meus amigos da Marinha do Brasil, CMG Pierre, CF Fortuna, CC Fátima
Vieira, CT Bruno Thiago, CT Dutra, Ten Cláudia Regina, , Ten Thalita e Cb Gabriele
pela força, incentivo e compreensão. E agradeço especialmente ao amigo Ten Marcelo
Silva pela amizade e por cuidar de mim com suas mãos mágicas de fisioterapeuta; e as
minhas queridas amigas Ten Maria Emília e Ten Rejane por terem se preocupado, me
incentivado, me ouvido; por terem me mostrados nos momentos tristes que tudo na vida tem
outro lado (o lado bom) e com isso me fizeram sorrir, vocês foram fundamentais no meu diaa-dia; muito obrigada!
À Profª. Dr.ª Gloria Fernanda, muito obrigada por todos os ensinamentos,
paciência, disponibilidade, pelos momentos de alegria e por me acalmar quando eu achava
que nada daria certo. Obrigada também pela confiança que depositou em mim para
realização deste trabalho, e por me permitir participar todos esses anos da clínica de
pacientes especiais.
Mais do que uma orientadora, você é uma grande amiga! Como
costumo dizer, você é a melhor!
À Profª. Dr.ª Maristela Portela, pela parceria na clínica de pacientes especiais, por
toda ajuda, ensinamentos, pela amizade e momentos de descontração. Você para mim é um
grande exemplo de pessoa e pesquisadora!
À Profª. Dr.ª Rosângela Maria, por abrir as portas do seu laboratório pra mim e por
todos os ensinamentos.
À Profª. Dr.ª Raquel Peixoto por disponibilizar seu laboratório para realização do
meu trabalho.
Aos professores: Rogério Gleiser, João Farinhas, Ivete Pomarico, Marcelo Costa,
Thomaz, Luciane Maia e Laura Primo pelos ensinamentos e incentivo. Muito Obrigada!
Ao prof. Dr Marcelo Marques obrigada por disponibilizar seu laboratório e me
receber para a finalização deste trabalho na FOP.
As Dra Renata Silva e Ana Paula por apoiarem meu trabalho e me receberem com
muito carinho no ambulatório de hematologia pediátrica do IPPMG–UFRJ. Admiro muito a
dedicação e competência que vocês cuidam daqueles pequenos pacientes.
Aos amigos de laboratório Alexandre Curvelo, Ana Léa, Ariadne Nunes, Daniel
Moraes, Analy, Gustavo Guimarães, Hugo Emliano e Henrique obrigada pela ajuda, não
seria possível realizar esse trabalho sem vocês!
As queridas amigas de turma Valéria, Márcia Thomas, Lívia Azeredo, por entrarem
na minha vida e compartilharem comigo tantos momentos. Agradeço pela amizade, carinho,
preocupação e por me ajudarem quando era preciso.
Aos queridos amigos que fiz durante todo esse tempo neste departamento fossem
eles da especialização, mestrado ou doutorado, Marcello Roter, Michele, Cristiana
Aroeira, Rafael Pedro, Ticiane Sabóia, Tacíria Bezerra, Queila, Luciana Pereira, Carla
Martins, Priscila Almeida, Renata Otero e Dennis Carvalho obrigada por compartilharem
os momentos alegres e difíceis e pelo enorme carinho. Agradeço especialmente a
mestranda Adriele Mangabeira por toda ajuda no laboratório e por tornar nosso ambiente
sempre descontrído e alegre.
À amiga Aline Laignier pela amizade e hospedagem no período em que estive em
Piracicaba, muito obrigada por tudo!
Ao João pela amizade e contribuição para a finalização deste trabalho.
Às queridas Kátia, Rose, Mary, Andréa e Isabel pela amizade, carinho e bons
momentos durante o nosso convívio. Obrigada!
Ao Robson, Zezé e Luiza pela amizade e momentos de descontração.
Aos pequeninos pacientes do IPPMG que fizeram parte deste trabalho e seus
responsáveis, pela colaboração. Que Deus abençoe vocês!
À Capes e CNPq, que possibilitaram o desenvolvimento desta pesquisa.
A todos os amigos dedico à seguinte passagem de Willian Barclay:
“Um dos mais elevados deveres humanos é o dever do encorajamento... É fácil rir
dos ideais dos outros. O mundo está cheio de desencorajadores. Temos o dever de
encorajas-nos uns aos outros. Muitas vezes uma palavra de reconhecimento, ou
agradecimento, ou de apreço, ou de ânimo tem mantido um homem de pé”.
“Todos os nossos sonhos podem tornar-se realidade
se tivermos a coragem de persegui-los”
Walt Disney
“Lute com determinação, abrace a vida com paixão, perca com
classe e vença com ousadia, porque o mundo pertence a quem
se atreve, e a vida é muito para ser insignificante.”
Charlie Chaplin
Resumo
PINHEIRO, Raquel dos Santos. Prevalência de Candida spp. na saliva de
crianças com leucemia e a influência da lactoferrina na expressão de genes
relacionados com a formação de biofilme / Rio de Janeiro, 2014. Tese (Doutorado
em Odontologia, área de concentração em Odontopediatria) – Faculdade de
Odontologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2014.
O objetivo deste estudo foi identificar e quantificar Candida spp. isolada da saliva
de crianças com leucemia correlacionando os achados com a doença; e analisar in
vitro a influência da lactoferrina na expressão de genes relacionados com o biofilme
formado por Candida albcans isolada de criança com leucemia. Amostras de saliva
foram coletadas por meio de swab de 32 crianças com leucemia (G1) e 32 crianças
saudáveis (G2) e cultivadas em meio ágar cromogénico. Um isolado de Candida
albicans de cada grupo e uma cepa de referência (ATCC 10231) foram utilizadas
para a formação de biofilme. Durante a formação do biofilme dois novos grupos
foram feitos; um grupo recebeu o tratamento com lactoferrina humana e o outro não.
Para a análise da expressão gênica foi realizada a reação em cadeia de polimerase
(PCR) utilizando os primers HWP1, SAP1,SAP4, SAP5 e SAP6. Em G1 a idade
média foi 5,41 anos e 53% eram meninas; foi observada uma freqüência de
Candida spp. em 53,10%. da amostra e Candida albicans foi a espécie mais
freqüente (82,35%) e outras espécies de Candida também encontradas.. Lesões
bucais durante o exame foram observadas em 12,5% da amostra e histórico de
lesões bucais foi relatado em 78,1%. Em G2, a idade média foi de 5,97 anos e 53%
eram do sexo feminino. Candida spp. foi encontrada em 21,90% do grupo e Candida
albicans também foi a espécie mais freqüente (57,14%). Houve uma diferença
estatísticamente significante em relação a colonização de Candida spp. entre os
grupos (p<0,01, Teste Qui-quadrado). Em relação à expressão gênica, todos os
grupos expressaram o gene HWP1; para SAP1, o biofilme de crianças saudáveis e
ATCC tratadas com lactoferrina humana não expressaram esse gene. Os o genes
SAP 4-6, foram expressos de forma variada nos biofilmes tratados com lactoferrina.
Podemos concluir que as crianças com leucemia apresentam maior freqüência de
Candida spp. quando comparadas a crianças saudáveis. Também foi observado que
a lactoferrina humana influenciou de forma variada a expressão dos genes
estudados nos diferentes grupos.
Palavras-chaves: Candida albicans, Candida spp., crianças, leucemia, PCR,
lactoferrina, SAP1, SAP4, SAP5, SAP6, HWP1.
Abst ra ct
PINHEIRO, Raquel dos Santos. Prevalência de Candida spp. na saliva de
crianças com leucemia e a influência da lactoferrina na expressão de genes
relacionados com a formação de biofilme / Rio de Janeiro, 2014. Tese (Doutorado
em Odontologia, área de concentração em Odontopediatria) – Faculdade de
Odontologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2014.
The aim of this study was to identify and quantify Candida spp. isolated from the
saliva of leukemic children and correlating the findings with the disease; also analyze
in vitro the lactoferrin effect on genes related with Candida albicans biofilm formation.
Saliva samples were collected from 32 children with leukemia (G1) and 32 healthy
children (G2), intraoral clinical examination was performed to detect the presence of
oral lesions. Saliva samples were grown on agar chromogenic. An isolate of Candida
albicans of each group and a reference strain (ATCC) were used for biofilm formation
. During biofilm formation two new groups were made; one group received treatment
with human lactoferrin and that did not receive. For the analysis of gene expression
polymerase chain reaction (PCR) was done using the follow primers: HWP1, SAP1,
SAP4, SAP5 and SAP6. In G1 the mean age was 5.41 (SD = 2.74) years and 53%
were girls. A high frequency of Candida spp was observed (53.10%) and most of
them showed a strong CFU growth. Candida albicans was the most frequent species
(82.35%). Other Candida species were found. Oral lesions during the oral exam were
observed in 12.5% of the sample, and history of oral lesions was reported in 78.1%.
In G2, the mean age was 5.97 (SD = 3.10) years and 53% were female. Candida
spp. was found in 21.90% and Candida albicans was also the most frequent species
(57.14%). There was a statistically significant difference in the colonization of
Candida spp. between the groups (p <0.01, chi-square test). Regarding gene
expression, all groups expressed HWP1 gene; for SAP1, the biofilm of healthy
children and ATCC (10231) treated with human lactoferrin did not express this gene.
For SAP 4 gene, the biofilm formed by ATCC (10231) treated with lactoferrin
expressed the gene; for SAP5 only the biofilm from healthy children yeast without
lactoferrin treating was expressed it. In relation to SAP6 only ATCC (10231) yeast
treated with human lactoferrin did not express this gene. We conclude that children
with leukemia had a higher frequency of Candida spp. compared to healthy children.
It was also observed that human lactoferrin affected the thickness of the biofilm
formed by Candida albicans; and that the studied genes had different expression in
the groups.
Key word: Candida albicans, Candida spp., children, leukemia, PCR, lactoferrin,
SAP1, SAP4, SAP5, SAP6, HWP1.
Ab st racto
PINHEIRO, Raquel dos Santos. Prevalência de Candida spp. na saliva de
crianças com leucemia e a influência da lactoferrina na expressão de genes
relacionados com a formação de biofilme. / Rio de Janeiro, 2014. Tese
(Doutorado em Odontologia, área de concentração em Odontopediatria) – Faculdade
de Odontologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2014.
El objetivo de este estudio fue identificar y cuantificar Candida spp aislada de
la saliva de los niños con leucemia al correlacionar los hallazgos con la enfermedad;
y analizar la influencia in vitro de lactoferrina en la expresión de genes relacionados
con la albcans de biofilm de Candida aisladas de niños con leucemia. Se
recolectaron muestras de saliva de 32 niños con leucemia (G1) y 32 niños sanos
(G2), intra oral examen clínico fue realizado para detectar la presencia de lesiones
orales. Las muestras de saliva se cultivaron en medio agar. Uno aísla de Candida
albicans de cada grupo y una cepa de referencia (ATCC 10231) fueron utilizados
para la formación de biofilm. Durante la formación del biofilm fueron reunidos dos
nuevos grupos; un grupo recibió tratamiento con lactoferrina humana y la otra no.
Para la análisisde la expresión génica se realizó una reacción en cadena de
polimerase (PCR) con la utilización de cebadores HWP1, SAP1, SAP4, SAP5,
SAP6,y SAP6. En G1 la edad media fue 5.41 años y 53 eran niñas. Se observó una
alta frecuencia de Candida spp (53.10). Candida albicans fue la especie más
frecuente (82.35). Otras especies de Candida fueron encontrados. Se observaron
lesiones orales durante el examen en 12.5 de la muestra e historia de lesiones
orales fue reportada en 78.1. En G2, la edad media fue 5,97 (DP: 3.10) años y 53
fueron hembras. Candida spp fue encontrado en 21,90 y Candida albicans fue la
especie más frecuente (57,14). Hubo una diferencia estadísticamente significativa
con respecto a la colonización de Candida spp entre grupos (p < 0.01, prueba de Chi
cuadrado). En cuanto a la expresión génica, todos los grupos expresaron gene
HWP1; para el biofilm de SAP1 niños sanos y ATCC (10231) tratado con lactoferrina
humana expresada que general para SAP 4 gen, el biofilm tratados con lactoferrina
formada a partir de aislado de ATCC (10231) expresada que el general para SAP 5
sólo el grupo de niños sanos sin el tratamiento de la lactoferrina humana expresó
que el gen y comparó el SAP6 sólo ATCC (10231) tratado con lactoferrina humana
no expresan este gen. Concluimos que los niños con leucemia tienen una mayor
frecuencia de Candida spp en comparación con niños sanos. También se observó
que la lactoferrina humana influenciada en el espesor de la biopelícula formada por
Candida albicans, y que los genes estuidiados se expresaron de forma distinta en
diferentes grupos.
Palabras clave: Candida albicans, Candida spp., leucemia, niños, PCR, lactoferrina,
SAP1, SAP4, SAP5, SAP6, HWP1.
Lista de Quadros, Tabelas e Figuras
Artigo1
Quadro 1: Interpretação da quantidade de unidadde foradora de colônia (UFC/Placa)
................................................................................................................................. 30
Quadro 2: Classificação de formação de biofilme por Candida spp. baseado no XTT
................................................................................................................................. 31
Table 1: Quality Assessment .................................................................................... 46
Table 2: Risk of Bias Criteria .................................................................................... 47
Table 3: Quality assessment of the studies included in the review ........................... 47
Table 4: Characteristics of the studies included in the review ................................... 20
Table 5: Risk of Bias. ............................................................................................... 20
Figure 1: Flow diagram of literature search .............................................................. 20
Artigo 2
Table 1: personal and medical data from leukemic children and the healthy group.
............................................................................................................................ 33
Table 2: Candida Spp. Of Leukemic And Healthy Children. ................................ 34
Table 3: Distribution Of Candida Spp. Isolates In Leukemic Children (N=17) And In
Heathy Children (N=7) With Positive Growth. ...................................................... 34
Table 5: Correlation Between Candida Spp. And History Of Oral Manifestation With
Therapy Phase, Antifungal Use And Neutropenia. .............................................. 20
Artigo 3:
Table 1: XTT-based classification of Candida spp. biofilm formation [20]. ........... 33
Table 2: Primer Sequence................................................................................... 33
Table 3: XTT-based classification of Candida spp.biofilm formation in the different
groups. ................................................................................................................ 34
Table 4: Expression of HWP1, SAP1, SAP4, SAP5 and SAP 6 in the different groups
............................................................................................................................ 34
List a d e ab reviatu ras
CEP
Comitê de ética em pesquisa
X2
Chi-squared
Yeast/ml
yeast per mililiter
°C
Grau Célcius
µg
Micrograma
µL
Microlitro
AIDS
Acquired Immunodeficiency Syndrome
BHI
Brain Heart Infusion
CD
Cirurgiã-dentista
CDC
Center for Disease Control and Prevention
cDNA
Ácido dexosirribonucléico complementar
cell/ml
Célula por mililitro
CEP
Comitê de ética em pesquisa
CFU
Colony forming unit
CFU/ml
Colony forming unit per milliliter
DNA
Ácido dexosirribonucléico
EPI
Equipamento de proteção individual
EUA
Estados Unidos da América
FO
Faculadade de Odontologia
g
grama
h
hora
HIV
Human Immunodeficiency Vírus
HWP1
Proteina da parede da hifa/ Hypha wall protein
IC
Intervalo de Confiança
IgA
Immunoglobulina A/ Immunoglobulin A
IPPMG
Instituto de Puericultura e Pediatria Martagão Gesteira
LF
Lactoferrina/ Lactoferrin
LLA
Leucemia linfoblástica aguda
LLC
Leucemia linfoblástica crônica
LMA
Leucemia mieloide aguda
LMC
Leucemia mieloide crônica
min
minuto
ml
mililitro
mM
miliMolar
n
número/number
NS
not significant/ não significativo
OR
Odds ratio
PB
Pares de base
PCR
Polymerase Chain Reaction/ Reação em cadeia de polimerase
pmol
Pico mol
RNA
Ácido ribonucleico
RPM
Rotação por minuto
SAP 1
Aspartil proteinase secretada 1 / secreted aspartyl proteinase 1
SAP 4
Aspartil proteinase secretada 4/ secreted aspartyl proteinase 4
SAP 5
Aspartil proteinase secretada 5/ secreted aspartyl proteinase 5
SAP 6
Aspartil proteinase secretada 6/ secreted aspartyl proteinase 6
UFC
Unidade formadora de colônia
UFRJ
Universidade Federal do Rio de Janeiro
X2
Chi-squared
XTT
2,3-Bis-(2metoxi-4-Nitro5-Sulfofenil)-2H-Tetrazólio5-Carboxanilida
Yeast/ml
Yeast per mililiter
Sumário
1.INTRODUÇÃO ................................................................................................. 20
2.PROPOSIÇÃO ................................................................................................. 26
2.1 OBJETIVO GERAL ....................................................................................... 26
2.2 OBJETIVOS ESPECÍFICOS ......................................................................... 26
3.DELINEAMENTO DA PESQUISA .................................................................... 27
3.1 Sujeitos da Pesquisa ..................................................................................... 27
3.2 Exame Clínico e Coleta dos dados dos pacientes ........................................ 28
3.3 Coleta para análise da microbiota fúngica ..................................................... 29
3.4 Análises laboratoriais .................................................................................... 29
3.4.1 Identificação e quantificação de Candida spp. ........................................... 29
3.4.2 Formação de biofilme e tratamento com lactoferrina humana .................... 30
3.4.2.1 Quantificação de biofilme ........................................................................ 31
3.4.3 Efeito da lactoferrina humana sobre a topografia e a espessura do biofilme
............................................................................................................................ 32
3.4.4 Extração de RNA ....................................................................................... 32
3.4.4 Síntese e quantificação de c-DNA .............................................................. 33
3.4.5 Reação em cadeia de polimerase (PCR) ................................................... 33
1.ARTIGOS ......................................................................................................... 35
4.1 ARTIGO 1 ..................................................................................................... 35
4.2 ARTIGO 2 ..................................................................................................... 21
4.3 ARTIGO 3 ..................................................................................................... 21
4.DISCUSSÃO .................................................................................................... 37
5.CONCLUSÃO .................................................................................................. 41
6.CONSIDERAÇÕES FINAIS ............................................................................. 42
REFERÊNCIAS BIBIOGRÁFICAS ...................................................................... 43
ANEXOS ............................................................................................................. 51
20
1 . I N T R OD U Ç Ã O
A leucemia (do grego leukos, "branco"; aima, "sangue") é uma neoplasia
maligna (cancro/câncer), que atinge o sangue, e possui origem na medula óssea.
Ela tem como principal característica a proliferação anormal de células da medula
óssea, que originariam as células sanguínea. Sua classificação é feita
pela
combinação da classificação da linhagem dessas células: linfóide ou mielóide, e da
evolução da doença: aguda ou crônica (MAGUIRE et al., 1987; PHILIP & POPLACK,
2002). A leucemia linfoblástica aguda (LLA) é o tipo mais comum de câncer na
infância (WIANGNON et al., 2012), contabilizando em torno de 25-35% de todos os
tipo de cânceres pediátrico (BRAGA, LATORRE &CURADO, 2002; MEDEIROS et
al., 2002).
A etiologia da leucemia ainda é desconhecida, mas acredita-se que, como em
quase todos os cânceres, ela seja causada por anomalias no material genético das
células transformadas. Estas anomalias podem ser resultado dos efeitos de
carcinogênicos como: o tabagismo, radiação, substâncias químicas ou agentes
infecciosos. Outros tipos de anormalidades genéticas podem ser adquiridos através
de erros na replicação do DNA, ou são herdadas e, consequentemente, presentes
em todas as células ao nascimento. As interações complexas entre carcinogênicos e
o genoma do hospedeiro podem explicar porque somente alguns desenvolvem
câncer após a exposição a um carcinogênico conhecido (PHILIP &POPLACK, 2002).
As manifestações clínicas da leucemia são caracterizadas pelo aparecimento
de
sinais e sintomas resultantes da insuficiência de hematopoiese normal, a
infiltração de tecidos e órgãos por células malignas e pelas desordens metabólicas.
Dentre os sinais e sintomas da doença observa-se: dor nos ossos ou no abdômen,
anemia, hemorragias e infecções (BURKE & STARTZELL, 2008; TIJANIĆ et al.,
2009). Sinais e sintomas iniciais da leucemia também podem aparecer na boca e
pescoço devido à infiltração de células leucêmicas ou devido a associação do
decréscimo dos elementos da medula óssea (ILGENLI, OREN & UYSAL, 2001).
Outras alterações patológicas na boca também podem ocorrer devido ao tratameto
antineoplásico (BURKE & STARTZELL, 2008). As manifestações bucais mais
comuns no curso da doença são: alterações gengivais (LYNCH & SHIP, 1967;
21
NASIM, SHETTY & HEGDE, 2007); hemorragias (HOU, HUANG & TSAI, 1997;
LYNCH & SHIP, 1967; WAHLIN & MATSSON, 1988); úlceras (HOU, HUANG &
TSAI, 1997; LYNCH & SHIP, 1967; WAHLIN & MATSSON, 1988); e infecções
(MEYER et al., 2000); e as manifestações bucais mais comuns do tratamento
antileucemico em crianças são: mucosite (ANIRUDHAN et al., 2008; ELHOUSSEINY et al., 2007; NASIM, SHETTY & HEGDE, 2007); xerostomia (ELHOUSSEINY et al., 2007; PONCE-TORRES et al., 2010); cárie dentária (CUBUKCU
& GUNES, 2008; NASIM, SHETTY & HEGDE, 2007); infecções (ANIRUDHAN et al.,
2008; EL-HOUSSEINY et al., 2007); e alterações no desenvolvimento buco facial
(MACIEL et al., 2009).
Dentre as doenças infecciosas oportunistas observadas em crianças com
leucemia, principalmente em pacientes submetidos ao tratamento quimioterápico,
destaca-se a candidíase oral, que é uma doença causada pela colonização da
cavidade bucal por espécies de Candida, especialmente a Candida albicans
(EPSTEIN et al., 1996). Esta manifestação bucal foi observada numa prevalência
entre 3,5% a 27,22% em crianças com leucemia na literatura consultada (MICHAUD
et al., 1977; ORBAK & ORBAK, 1997; PONCE-TORRES
et al., 2010;
SUBRAMANIAM, BABU & NAGARATHNA, 2008). A Candida albicans atua como um
microrganismo comensal na cavidade bucal de indivíduos saudáveis sem causar
alterações (HOSSAIN et al., 2003). Entretanto, em pacientes imunocomprometidos,
tal agente assume características de patogenicidade, alterando a harmonia com o
hospedeiro. A presença de outras espécies de Candida vem emergindo como
agentes patogênicos causadores de infecções fúngicas, tais como: C. tropicalis, C.
stellatoidea, C. krusei, C. parapsilosis, C. glabrata, C. guillermondii e C dubliniensis
(PORTELA et al., 2004). Alguns fatores são considerados predisponentes para o
desenvolvimento da candidíase oral como deficiência de ácido fólico e ferro, uso de
antibióticos de amplo espectro e por tempo prolongado, xerostomia (GREENSPAN &
GREENSPAN, 1993), higiene bucal deficiente, dieta rica em carboidratos, gengivite
(JACOB et al., 1998), diminuição do fluxo e pH salivar, diminuição dos componentes
salivares (lactoferrina, histatina 5, Ig A), deficiências do sistema imunológico, como a
infecção pelo HIV (GREENSPAN & GREENSPAN, 1993; JACOB
et al., 1998;
PORTELA et al., 2004) e a presença de lesões cariosas (CERQUEIRA et al., 2010;
CHAGAS et al., 2009). Apesar da importância clínica da Candida spp. como fator
22
preditor de doença, e o desenvolvimento de lesão e comprometimento sistêmico
pela
disseminação
fúngica
ser
de
extrema
importância
em
pacientes
imunocomprometidos, pouco estudos têm sido realizados em crianças com
leucemia.
Alguns fatores predisponentes intrínsecos e extrínsecos do hospedeiro
tornam o indivíduo mais susceptível à infecção por fungos oportunistas como os do
gênero Candida. Dentre os fatores intrínsecos do hospedeiro, destaca-se idade
avançada, gravidez, prematuridade, neoplasias, hemopatias, endocrinopatias,
avitaminoses, tuberculose e AIDS; os fatores extrínsecos estão relacionados com o
uso de antimicrobianos, corticoides, agentes antineoplásicos, terapia intravenosa
prolongada (ELLIS & SPIVACK, 1967), intervenções cirúrgicas, agentes físicos e
químicos (ZAITZ et al., 1998). Já a virulência do fungo está correlacionada com a
aderência à célula epitelial, dimorfismo, capacidade de crescimento como
blastoporos, pseudo-hifas e hifas, a produção de enzimas hidrolíticas (proteases,
fosfolipases e lisofosfolipases) (NAGLIK, CHALLACOMBE & HUBE, 2003) e a
produção de endotoxinas de baixa e alta massa molecular, bem como a composição
da parede celular, que facilita a adesão e a penetração através do tecido infectado
(GHANNOUM & ABU-ELTEEN, 1990; SCHALLER et al., 2005).
Para a C. albicans a adesão às superfícies do hospedeiro é de extrema
necessidade para ocorrer o desenvolvimento da infecção. VERSTREPEN & KLIS
(2006) enfatizam a notável capacidade de formação de biofilme a partir da
propriedade de adesão de alguns fungos como C. albicans devido a hidrofobicidade
da parede celular. A composição do biofilme de C. albicans consiste em uma mistura
de células hospedeiras, células em forma de leveduras, pseudo-hifas e hifas, além
de matriz extracelular composta de proteínas e polissacarídeos (MUKHERJEE et al.,
2005). As vantagens dos microorganismos se organizarem em comunidades
consistem na maior capacidade de captação de nutrientes, favorecendo um
crescimento mais ordenado da comunidade e maior proteção contra radiações UV,
fagocitose, desidratação e resistência a antimicrobianos (SUZUKI, 2009). Além
disso, mecanismos responsáveis pela resistência a antifúngicos podem estar
relacionados a fatores como limitações difusionais dos antimicrobianos pela matriz
extracelular, alterações fenotípicas das células no biofilme e ainda com o
23
desenvolvimento de mecanismos de resistência por alteração do genótipo das
células (CHANDRA et al., 2001).
Estudos relacionados à expressão genética têm sido realizados para melhor
compreensão
das
vias
de
regulação
e
os
mecanismos
que
governam
o desenvolvimento de biofilme formado pela C. albicans e resistência de fármacos
relacionados à formação desse biofilme (FINKEL & MITCHELL, 2010). A transição
do comensalismo ao parasitismo está associado com alterações da transcrição, os
genes que codificam as adesinas e os que codificam enzimas hidrolíticas são
frequentemente expressos pela C. albicans durante a infecção (CALDERONE &
FONZI, 2001; HUBE, 2004; NAGLIK et al., 2004). Além disso, a formação de hifas e
a
mudança fenotípica
também
estão
envolvidos
na virulência
do fungo
(CALDERONE & FONZI, 2001). Genes pertencentes a proteína da parede das hifas
(HWP1) (STAAB et al., 1999) codificam a superfície celular associada a
glicosilfosfatidilinositol (GPI) a glicoproteína ancorada que medeia a adesão de C.
albicans em superfícies mucosas (HOYER et al., 2008). A HWP1 em particular, é um
substrato para a transglutaminase de mamíferos, e esta adesina medeia a ligação
estável de hifas as células epiteliais (STAAB
et al., 1999). C. albicans também
contém três famílias de genes que codificam enzimas hidrolíticas, incluindo a aspartil
protease secretada (SAP), lipase (LIP)
e fosfolipase (PL) (GHANNOUM, 2000;
HUBE et al., 2000; NAGLIK, CHALLACOMBE &HUBE, 2003). Aspartil proteases,
lipases e fosfolipases são enzimas secretadas pelos fungos e podem contribuir para
colonização e infecção por degradar componentes da membrana celular do
hospedeiro (SCHALLER et al., 2005). As SAPs de C. albicans são codificadas por
uma família de 10 genes homólogos (SAPs1-10),
e contribuem para a
patogenicidade fúngica devido à participação em várias etapas do processo
infeccioso, incluindo a degradação das barreiras do tecido do hospedeiro durante a
invasão; a destruição das moléculas de defesa do hospedeiro, por clivagem das
diferentes classes de imunoglobulinas; as proteínas complemento; os inibidores de
protease, citocinas e peptidos antimicrobianos;
substratos abióticos e superfícies bióticas
a nutrição; e a adesão aos
(DE BERNARDIS, SULLIVAN &
CASSONE, 2001; HUBE & NAGLIK, 2001; NAGLIK
CHALLACOMBE & HUBE, 2003).
et al., 2004; NAGLIK,
24
As atividades biológicas de peptídeos antimicrobianos tem sido estudadas
assim como seu papel na proteção contra a infecção de microorganismos,
principalmente no sistema imune inato contra a invasão microbiana (BROGDEN et
al., 2003; SHI et al., 1999). Deve-se destacar também que a saliva contém uma
grande quantidade de proteínas que participam da proteção dos tecidos bucais,
como por exemplo, a lisozima, lactoferrina, lactoperoxidase, imunoglobulinas,
aglutinina e mucinas (AMERONGEN & VEERMAN, 2002).
A lactoferrina (LF), também conhecida como lactotransferrin (LTF), é uma
proteína multifuncional da família de transferrina (SANCHEZ, CALVO & BROCK,
1992). Possui massa molecular de 80 kDa e um núcleo porfirínico semelhante ao da
hemoglobina, realizando através dele o transporte de ferro (TESTA, 2002). A LF é
expressa em mucosas, endométrio, no epitélio vaginal, próstata e vesícula seminal
(TENG et al., 2002). Ela está amplamente presente em vários fluidos secretados,
tais como leite, saliva, lágrimas e secreções nasais, também está presente nos
grânulos secundários dos polimorfonucleados e é secretada por algumas células
acinares (SANCHEZ, CALVO & BROCK, 1992). A LF pertence ao sistema imune
inato e ao mesmo tempo a reações imunológicas específicas, mas de forma indireta
(ADLEROVA, 2008; LEGRAND et al., 2005). A LF é considerada uma citocina,
responsável por coordenar a resposta celular humana, atuando na maturação e
ativação de macrófagos e neutrófilos, podendo sua deficiência causar supressão do
sistema imunológico e seu excesso, uma exacerbada resposta imune (SON et al.,
2002). Os neutrófilos polimorfonucleares são ricos em LF (PANELLA et al., 1991),
que agem como fator de proteção contra diversas infecções (WARD & CONNEELY,
2004). A LF pode regular diretamente a resposta inflamatória (BAKER & BAKER,
2004; SINGH et al., 2002). Sua ação antimicrobiana é atribuída à propriedade de
quelar o íon ferro, privando, assim, os microrganismos dos seus elementos
essenciais (BAKER & BAKER, 2004; SINGH, 2004; VAN NIEUW, BOLSCHER &
VEERMAN, 2004; VAN NIEUW AMERONGEN, BOLSCHER & VEERMAN, 2004).
Os principais mecanismos de ação da LF são: (1) sequestro de íons ferrosos,
levando à privação de ferro elementar necessário para o metabolismo da levedura
(MAZURIER & SPIK, 1980), (2) alterações estruturais induzidas nas paredes
celulares das leveduras (NIKAWA et al., 2003), (3) ativação dos sistemas
enzimáticos intracelulares autolíticos consequentes à adsorção da LF (LAIBLE &
25
GERMAINE, 1985) , e (4) o aumento no número de células natural Killer (NK) e
células T no sangue periférico (KUHARA et al., 2000), aumentando a atividade
fagocítica dos neutrófilos (SATO et al., 1996). Além de sua principal função
biológica, ou seja, ligação e transporte de íons de ferro, a LF também tem ação
antibacteriana, antiviral, antiparasitária, catalisador, anti-câncer, anti-alérgicos e
funções de radioproteção (KIRKPATRICK et al., 1971). NIKAWA et al (1993)
demonstraram a atividade fungicida da lactoferrina sobre C. albicans e C. krusei.
SAMARANAYAKE et al (2001) também mostraram que ela também atua modulando
o crescimento do fungo C. albicans na cavidade bucal (NIKAWA et al., 1993;
SAMARANAYAKE et al., 2001).
Recentemente, Alves et al. (2014), demonstraram efeito antifúngico da LF
contra isolados clínicos de C. albicans oriundos da cavidade bucal de crianças
infectadas pelo HIV e crianças sem evidências clínicas de imunossupressão.
Observaram ainda que esta atividade antifúngica, in vitro é inversamente
proporcional ao número de células de Candida, mantendo uma mesma
concentração de lactoferrina (100 g/ml). Não foi encontado na literatura consultada
nenhuma outra pesquisa sobre a atividade antifúngica da LF na saliva de crianças.
Diante do exposto acima é de extrema relevância um estudo que identifique e
quantifique a presença de Candida spp. isoladas da cavidade bucal de crianças com
leucemia, e que analise a influência da lactoferrina na expressão de genes
relacionados com a formação de biofilme em Candida albicans isoladas de crianças
com leucemia e saudáveis.
26
2.
P R OP O S I Ç Ã O
2.1 OBJETIVO GERAL
2.1.1 Identificar e quantificar Candida spp na saliva de crianças com leucemia
e avaliar a influência da lactoferrina na expressão de genes relacionados com a
formação de biofilme de Candida albicans isolada da saliva de criança com
leucemia.
2.2 OBJETIVOS ESPECÍFICOS
2.2.1 Realizar uma revisão sistemática sobre as manifestações bucais em
criança com leucemia.
2.2.2 Identificar as manifestações bucais em crianças com leucemia.
2.2.3 Identificar e quantificar a presença de Candida spp.da saliva de crianças
com leucemia, comparando com crianças clinicamente saudáveis.
Correlacionar os achados microbiológicos com dados clínicos relacionados à
doença nas crianças com leucemia.
2.2.5 Analisar, in vitro, a influência da lactoferrina na expressão de genes
(HWP1, SAP1, SAP4, SAP5, SAP6) relacionados com a formação de biofilme em
uma cepa de C. albicans isolada da saliva de criança com leucemia, comparando
com a de criança clinicamente saudável e uma cepa de C. albicans de referência
(ATCC 10231).
27
3 . D E L I N E AM E N T O D A P E S Q U IS A
O presente estudo caracterizou-se pela realização de uma revisão sistemática
e por uma pesquisa do tipo descritiva, seccional, observacional, clínico e laboratorial
na qual foram realizadas identificação e quantificação de Candida spp na cavidade
bucal de crianças portadoras de leucemia. Assim como, a influência, in vitro, da
lactoferrina na expressão de genes (HWP1, SAP1, SAP4, SAP5, SAP6)
relacionados à formação de biofilme. Nas crianças com leucemia, os dados
encontrados foram comparados com os achados em crianças clinicamente
saudáveis e também relacionados com os aspectos clínicos da doença,
manifestações bucais, tipos de tratamento e medicamentos utilizados pelos
indivíduos com leucemia.
Esta pesquisa teve a aprovação do Comitê de Étical do IPPMG (Instituto de
Puericultura e Pediatria Martagão Gesteira da Universidade Federal do Rio de
Janeiro, na cidade do Rio de Janeiro, Brasil) CEP: 85/11 (ANEXO 1). A seleção da
amostra adotou procedimentos intencionais por conveniência no ambulatório de
Hematologia Pediátrica do IPPMG da UFRJ, assim como, no Departamento de
Odontopediatria da Faculdade de Odontologia da UFRJ.
3.1 Sujeitos da Pesquisa
A população estudada foi constituída por todos os pacientes pediátricos com
diagnóstico de leucemia (G1) do Ambulatório de Hematologia Pediátrica do
IPPMG/UFRJ, e por crianças clinicamente saudáveis (G2), que procuravam por
atendimento odontológico (triagem) no Departamento de Odontopediatria da
Faculdade de Odontologia/UFRJ, (G2). Para todas as crianças foi obtido Termo de
Consentimento Livre e Esclarecido assinado pelo responsável legal dos pacientes e
anuência da criança (ANEXO 2).
Foram excluídas do estudo, crianças sem diagnóstico definitivo de leucemia
para o G1; e crianças com qualquer comprometimento sistêmico relatado durante a
anamnese ou que durante o exame apresentavam algum sintoma característico de
alguma doença para G2. Para ambos os grupos foram excluídas as crianças com
ausência de Consentimento Livre e Esclarecido assinado pelo responsável legal da
28
criança. Os grupos foram pareados em relação ao gênero. Foram considerados
saudáveis aqueles pacientes que durante a anamnese não relatavam nenhum
histórico médico relevante e no exame clínico não apresentavam nenhum sinal ou
sintoma característico de alguma doença sistêmica.
A amostra final foi constituída por 32 crianças em G1 e 32 crianças em G2, na
faixa etária de 2 a 12 anos de idade.
3.2 Exame Clínico e Coleta dos dados dos pacientes
Dados pessoais e história médica do paciente como diagnóstico definitivo
para leucemia (leucemia linfoblástica aguda (LLA), leucemia linfoblástica crônica
(LLC), leucemia mieloide aguda (LMA), leucemia mieloide crônica (LMC)), fase de
tratamento
(indução,
consolidação
e
manutenção),
uso
de
medicamentos
(antifúngicos e antibióticos), e o exame laboratorial (contagem de neutrófilos) colhido
no dia do exame bucal, foram obtidos dos respectivos prontuários médicos. As
informações sobre os pacientes do G2 foram obtidas durante a anamnese. Todos os
sujeitos da amostra foram questionados sobre histórico de manifestações bucais
como: infecção por herpes, aftas, gengivoestomatite, mucosite, sangramento
gengival, eritema e candidíase.
O exame clínico e a coleta das amostras salivares para a investigação
microbiológica foram realizados por uma única dentista (RSP) especializada em
Odontopediatria, depois de ser calibrada por um especialista experiente. Para
verificar a calibração intraexaminador foi realizado um segundo exame clínico em
10% da amostra depois de 2 semanas, com um coeficiente kappa de 0,93.
O exame clínico intra e extrabucal dos pacientes de G1 foram realizados no
ambulatório de Hematologia Pediátrica do IPPMG (UFRJ), e de G2 na Clínica de
Odontopediatria do Departamento de Odontopediatria da FO-UFRJ. Os pacientes
foram examinados em decúbito dorsal, sobre uma maca, e o examinador
posicionou-se em pé, atrás da cabeça do paciente, para G1. O exame clinico bucal
foi realizado sob fonte de luz natural utilizando-se espelho e gaze para a avaliação
de mucosas e língua assim como foram utilizados todos os equipamentos
necessários à proteção individual (EPI). No exame na região extrabucal foram
29
avaliados alterações nas comissuras labiais, nariz, bochecha e região mentoniana.
No exame intrabucal foram avaliados primeiramente os elementos dentários e
depois os tecidos moles, a seguir: língua, assoalho bucal, gengiva, mucosa jugal,
palato duro, palato mole, tonsilas, e secura das mucosas (OMS, 1997). O exame de
G2 foi realizado em equipo odontológico sob fonte de luz natural (sem uso do foco
do equipo) e seguiu a mesma sistemática, sendo realizado nas dependências da
clínica de odontopediatria da FO-UFRJ.
3.3 Coleta para análise da microbiota fúngica
A amostra para a detecção de colonização por leveduras foi coletada
utilizando-se a técnica adotada pelo Laboratório de Biologia de Protistas do Instituto
de Microbiologia Geral da UFRJ (DARWAZEH &AL-BASHIR, 1995; VARGAS et al.,
2000). Um swab estéril foi friccionado sobre a superfície da mucosa do dorso da
língua. O swab foi introduzido em um tubo de plástico com tampa de rosca estéril
contendo 1 ml de solução salina estéril (0,85 % NaCl) e transportado em banho de
gelo até o Laboratório de Biologia de Protistas do Departamento de Microbiologia
Geral da UFRJ em um prazo máximo de 2 horas após a coleta para processamento.
Após a coleta dos espécimens clínicos, os pacientes receberam escovação
supervisionada e aplicação tópica de flúor (Flúor gel DFL- Flúor fosfato acidulado
1,23%) e as crianças do G1 que necessitavam de tratamento odontológico foram
encaminhadas para a Clínica de Pacientes Especiais no departamento de
Odontopediatria e Ortodontia da FO-UFRJ, e os pacientes do G2 foram
matriculados.
3.4 Análises laboratoriais
3.4.1 Identificação e quantificação de Candida spp.
Identificação das
leveduras foram realizadas
pelo
meio de cultura
CHROMagar Candida ® (CHROMagar Microbiology, Paris, França), segundo
metodologia descrita por (ALVES et al., 2014). A análise do número de unidades
formadoras de colônia (UFC) foi realizada de forma semiquantitativa, e classificada
como leve, moderado e forte, de acordo como número de colônias exibidas em meio
30
sólido CHROMagar Candida ® em placa Petri. Os limites estão descritos no Quadro
1 (LAMEY & SAMARANAYAKE, 1988)
Quadro 1: Interpretação da quantidade de unidadde foradora de colônia (UFC/Placa)
UFC/Placa
Interpretação
<10
Leve
>11 e <50
Moderado
>50
Forte
Fonte: LAMEY et al, 1988
A caracterização fenotípica definitiva das espécies de leveduras foi realizada
por meio de teste de assimilação de carboidratos, utilizando o sistema API 20C
AUX® da empresa francesa BioMérieux (bioMerie Marcy l’Etoile, France).
3.4.2 Formação de biofilme e tratamento com lactoferrina humana
A formação de biofilme foi realizada em placa de 96 poços de fundo chato
estéril,
segundo
Thein
et
al.
(2007)
conforme
descrito
abaixo
(THEIN,
SAMARANAYAKE & SAMARANAYAKE, 2007). Para esta etapa do estudo, foram
selecionadas aleatoriamente uma cepa de C. albicans oriunda da cavidade bucal de
uma criança com leucemia, uma cepa de C. albicans do grupo controle (paciente
saudável) e uma cepa de C. albicans de referência (ATCC 10231).
O crescimento do microrganismo foi realizado no meio Yeast Carbon Base
(YNB) (Difco®, Becton Dickinson/EUA) suplementado com 10 mM de glicose por 48
horas à 370C com agitação suave (75 rpm). Após esse período, suspensões
padronizadas de 106 células/ml foram tratadas com 100 µg/mL de lactoferrina
humana (SigmaAldrich Chemical, St. Louis, MO) por 3 horas à 370C (grupo caso).
Os sistemas do grupo controle não tiveram a adição de lactoferrina. Após esse
período, todos os sistemas foram centrifugados (4000 rpm, 4 min, 40C) e os
sobrenadantes das reações foram removidos. As leveduras foram ressuspendidas
em 100 µL de YNB suplementado com glicose (10 mM) e transferidas para uma
placa de 96 poços que foi incubada à 370C por 90 min (fase de aderência). Após, o
sobrenadante foi removido e duas lavagens suaves com PBS foram realizadas; em
31
seguida adicionou-se 200 µl de YNB suplementado com glicose (10 mM) nos
sistemas controle. Já nos sistemas do grupo caso, além do meio de cultura, foi
colocado 100 µg/ml de lactoferrina. Um biofilme maduro foi conseguido após 48
horas de incubação nas mesmas condições da fase de aderência. Ao final do
processo de formação do biofilme, o sobrenadante foi totalmente removido e as
células foram lavadas suavemente com PBS estéril, e em seguida as células foram
raspadas do fundo de cada poço, com auxílio de uma lâmina de bisturi, e lavadas
com PBS estéril e centrifugadas (10000 rpm, 2 min). Todo o sobrenadante foi
cuidadosamente removido e cada pellet foi acondicionado no freezer à -800C até a
extração de RNA.
3.4.2.1 Quantificação de biofilme
Após a formação de biofilme o sobrenadante foi removido e duas lavagens
com 150 µl de PBS estéril foram feitas. A quantificação do biofilme foi realizada pela
adição
de
200
µl
XTT
(2,3-Bis-(2metoxi-4-Nitro5-Sulfofenil)-2H-Tetrazólio5-
Carboxanilida) (Invitrogen™, Life Technologies, Califórnia, EUA) com menadiona na
proporção de 1:20 nos poços que foram formados o biofilme. A redução de XTT
pelos fungos se deu a 37°C por 3 horas na ausência de luz. Após esta incubação,
100 µl do sobrenadante foram transferidos para outra placa de 96 poços e a leitura
foi realizada no espectofotômetro (Thermo plate- TP READER) em um comprimento
de onda de 492 nm (SANCHEZ-VARGAS et al., 2013). Os resultados foram
categorizados de acordo com Sanchez-Vargas (2013) (Quadro 2).
Quadro 2: Classificação de formação de biofilme por Candida spp. baseado no XTT
Grupos
Formação de
Biofilme
OD 492 nm
UFC
I
Sem produção
≤0,1
< 0.1 x 108
II
Fraca produção
0,11-0,40
0,1- 0.75 x 108
III
Moderada produção
0,41-0,74
0.76-2 x 108
IV
Forte produção
≥0,75
>2x 108
Fonte: Sanchez-Vargas et al, 2013.
32
3.4.3 Efeito da lactoferrina humana sobre a topografia e a espessura do biofilme
A arquitetura topográfica e a espessura dos biofilmes formados na presença e
ausência de lactoferrina humana foram analisadas por microscopia confocal de
varredura a laser. Foi utilizado o protocolo estabelecido por Thein et al (2007), com
modificações para possibilitar a formação dos biofilmes em placa de borosilicato de
8 poços Lab-Tec® (Thermo Fisher Scientific, Rochester, NY, EUA). O biofilme
maduro formado foi realizado como descrito anteriormente (item 3.4.2), e após a
última incubação (37°C por 48h), os biofilmes foram lavados com PBS mM, pH 7,2 e
incubados com uma solução contendo os corantes fluorescentes FUN-1 (10 µM) e
Concanavalin- A alexa flúor 488 (25µg/ml) por 40 minutos a 37°C na ausência de luz
(CHANDRA, MUKHERJEE & GHANNOUM, 2008). As imagens foram captadas em
microscópio confocal de varredura a laser LAICA TCS SP5 AOBS do Instituto de
Ciências Biomédicas da UFRJ, e analisadas pelo software FIJI® (Max Planck
Institute, Dresden, Alemanha) e pelo programa LAS AF Lite® (Leica, Berlim,
Alemanha).
3.4.4 Extração de RNA
No Laboratório de Ecologia Microbiana Molecular do Departamento de
Microbiologia Geral da UFRJ, o RNA total foi extraído com o Ambion Pure Yeast kit
(Ambion) (Austin, Texas, EUA) de acordo com as instruções do fabricante. Este kit
foi extensivamente testado com várias espécies de levedura, inclusive C.albicans, e
rompe as paredes celulares das leveduras através de lise mecânica (atrito das
células com as pérolas de zircônia, com diâmetro de 0,5mm).
Em resumo, os tubos com as amostras de biofilme, foram retirados do freezer
a -80°C, dois grupos de tubos para microcentrífuga de 1,5 ml em quantidade
equivalente ao número de amostras foram identificados. Um dos grupos foi
preenchido com 750 µL de pérolas de zircônia, e o outro com a combinação dos
reagentes para a lise celular: 480 µL de SDS 10% e 480 µL de fenol. Todo o
conteúdo de biofilme foi transferido para os tubos contendo as pérolas de zircônia e
agitados vigorosamente em vórtex por 10 min. Posteriormente, os tubos foram
centrifugados para separar a fase aquosa, contendo RNA, da fase orgânica. A fase
aquosa foi aspirada do tubo e transferida para um novo tubo, e foi adicionado 1,9 mL
33
de binding buffer (tampão de ligação que liga o RNA à coluna de filtragem), 1,25ml
de etanol 100%, sendo esse conteúdo misturado por agitação.
Em seguida, realizou-se a lavagem final do RNA fúngico, transferindo 700 µL
da amostra para um filtro de fibra de vidro, o qual foi centrifugado por um minuto, a
fim de filtrar a mistura. O RNA permaneceu aderido ao filtro e a solução foi
descartada. A fim de lavar o filtro, foi adicionado a cada tubo 700 µL de solução de
lavagem 1 e os mesmos foram centrifugados. Posteriormente, adicionou-se 500 µL
da solução de lavagem 2/3 e realizou-se nova centrifugação, o filtro foi removido e
transferido para um novo tubo de 2 mL onde foram adicionados 50 µL de água livre
de RNase para uma nova centrifugação.
O RNA total foi quantificado antes da síntese de cDNA, utilizando o Qubit
fluorometric Quantification.
3.4.4 Síntese e quantificação de c-DNA
A síntese de cDNA foi realizada utilizando SuperScript III –First- Standard
Synthesis SuperMix (Carisbad, Califórnia, EUA) de acordo com a orientação do
fabricante. Em resumo, um mix com de 5 μg de RNA, foi incubado por 5 minutos a
65°C e após esse tempo foi posto no gelo por 1 minuto, em seguida foi adicionado
10 μL de 2X First-Strand Reaction Mix e 2 μL de SuperScript ® III/RNaseOUT ™
Enzyme Mix e submetidos ao vórtex. Em seguida, essa mistura foi incubada por 50
minutos à 50°C, 5 minutos à 25°C, seguidos por 50 minutos a 50°C, e 5 minutos a
85°C. O c-DNA extraído foi estocado a -20°C até a realização da reação em cadeia
de polimerase (PCR).O c-DNA total foi quantificado utilizando o Qubit fluorometric
Quantification..
3.4.5 Reação em cadeia de polimerase (PCR)
Para a verificação da expressão gênica foi utilizado amplificação pela reação
em cadeia de polimerase (PCR) num volume total de 25 μL de mix de ração,
utilizando os primers HWP1, SAP1, SAP4, SAP 5 e SAP 6 (Quadro 3). O mix da
reação consistiu em: 19,5 μL de água estéril, 2,5 μL de reação tampão (Promega,
Madison, WI, EUA), 0,9 μL de dNTPs (Promega, Madison, WI, EUA), 0,5 μL de Taq
polimerase (Promega, Madison, WI, EUA), 0,8 μL de cada primer (FW e RV)
34
(Síntese Biotecnologia, Belo Horizonte, Minas Gerais) e 1 μL de c-DNA previamente
quantificado. O processo de amplificação foi realizado com uma desnaturação inicial
(1 min, 95°C); 45 ciclos de 30 segundos à 95°C, 45 segundos a 50°C para HWP1 e
58°C para as SAPs para o anelamento e 1 minuto a 72 °C; e 5min a 72 °C para
extensão final (NAS et al., 2008).
O produto foi analisado em gel de agarose 1,6% (M/V) contendo Syber DNA
gel Stain (3 μL/100ml de agarose) e visualizado através de trasiluminador
ultravioleta.
Quadro 3: Sequência dos primers
Gene
HWP1
SAP1
SAP4
SAP5
SAP6
Sequencia do Primer (5’-3’)
FW: GACCGTCTACCTGTGGGACAGT
RV: GCTCAACTTATTGCTATCGCTTATTACA
FW: AACCAATAGTGATGTCAGCAGCAT
RV: ACAAGCCCTCCCAGTTACTTTAAA
FW: AAACGGCATTTGAATCTGGAA
RV: CAAAAACTTAGCGTTATTGTTGACACT
FW: CCAGCATCTTCCCGCACTT
RV: GCGTAAGAACCGTCACCATATTTAA
FW: CCTTATTCGAACCGATCTCCAA
RV: CAATGCCTCTTATCAACGACAAGA
Para subsidiar a interpretação, entendimento e discussão dos resultados obtidos,
bem como apresentação dos mesmos e o detalhamento de toda a metodologia
empregada, foram elaborados três artigos científicos: Artigo 1: “Oral manifestation in
children with leukemia: A Systematic Review”; Artigo 2: “Candida spp. carriage in oral
cavity of children diagnosed with leukemia and its correlation with the oral health
status”; e Artigo 3: “Lactoferrin ifluences genes expression of C. albicans isolated
from leukemic children during biofilm formation”.
35
1 . AR T I G O S

Artigo 1: “Oral manifestation in children and adolecents with
leukemia: A Systematic Review.

Artigo 2: “Candida spp. carriage in oral cavity of children
diagnosed with leukemia and its correlation with the oral health status”

Artigo 3: “Lactoferrin Influences in expression of HWP1, SAP1,
SAP 4, SAP5 and SAP6 genes during biofilm formation by C. albicans isolated
from leukemic children.”
4.1 ARTIGO 1
Oral manifestation in children and adolecents with leukemia: A Systematic
Review.
Authors:
Raquel dos Santos Pinheiro1,
Maristela Barbosa Portela2
Rafael de Lima Pedro3,
Viviane Andrade Cancio de Paula4,
Gloria Fernanda Castro5,
Lucianne Cople Maia6.
1
DDS, MSD PhD student. Department of Pediatric Dentistry and Orthodontic,
Universidade Federal do Rio de Janeiro, Cidade Universitária, Rio de Janeiro; Brazil.
2
MSD, DDS, PhD - Department of Clinics and Pediatric Dentistry/School of
Dentistry/Universidade Federal Fluminense, Niterói, Brazil.
3
DDS, MSD PhD
Department of Pediatric Dentistry and Orthodontic, Universidade Federal do Rio de
Janeiro, Cidade Universitária, Rio de Janeiro, Brazil; 4DDS, MSD PhD. Department
of Pediatric Dentistry and Orthodontic, Universidade Federal do Rio de Janeiro,
Cidade Universitária, Rio de Janeiro, Brazil. 5DDS, MSD, PhD, Adjunct Professor.
Department of Pediatric Dentistry and Orthodontic, Universidade Federal do Rio de
Janeiro, Cidade Universitária, Rio de Janeiro, Brazil.
6
DDS, MSD, PhD, Full
36
Professor. Department of Pediatric Dentistry and Orthodontic, Universidade Federal
do Rio de Janeiro, Cidade Universitária, Rio de Janeiro, Brazil.
37
Abstract
Aim: The aim of this work is to systematically review the literature to
investigate the prevalence of oral manifestations in children and adolescent with
leukemia. Methods: The databases searched were: Pubmed, OVID ALL EMB
Reviews (1950-2014), and COCHRANE, and the search terms used were “oral
manifestations”, “children” and “leukemia”. Observational studies that addressed the
prevalence of oral manifestations in children with leukemia were included. The
studies were classified into 3 categories according to their methodological quality: (A)
High, (B) Moderate and (C) Low methodological quality. They were also evaluated
according to their risk of bias (low, moderate and high risk of bias). A total of 59
studies were selected, but only 6 remained after applying the inclusion and exclusion
criteria. Results: Three studies were classified as having a moderate methodological
quality and the other three were classified as having a low methodological quality;.
Gingivitis and mucositis were the two most common lesions presetting prevalence of
100% and 38.77% respectively. Conclusion: According to the criteria adopted for
this sistematic review, there is moderate evidence that children with leukemia have a
high prevalence of oral manifestations, .
Key Words: Leukemia, children, oral manifestations, review.
38
Introduction
Leukemia is characterized by an abnormal proliferation of immature
leukocytes and their precursors in bone marrow [1, 2]. The leukemic cell population
also has the propensity to invade extra medullar tissues and its presence as
leukemic infiltrates has been reported in the kidneys, lungs, bowels, breasts,
testicles, eyes, meninges, lymph nodes, liver, prostate, skin, and oral cavity.
Leukemic infiltrate diagnoses have been confirmed by tissue biopsy or fine needle
aspiration cytology [3-10].
Leukemia is the most common form of cancer in childhood. The disease is
characterized by a high incidence of oral complications at diagnosis and during
subsequent treatment. Oral complications can be divided in three groups. Primary
lesions are induced by the infiltration of malignant cells into oral structures: gingival
infiltration and infiltration into bony oral structures. Secondary lesions are the result of
the myelophthisic character of the disease. This group includes symptoms of anemia,
increased bleeding tendency and increased susceptibility to infections. Tertiary
complications are usually due to the complex interplay of the therapy itself, its side
effects, or a systemic condition arising out of the therapy. Such lesions and
complications include ulcerations, mucositis, taste alteration, skin desquamation,
candidiasis, gingival bleeding, xerostomia, dysphasia, opportunistic infections and
trismus [11, 12].
Acute oral problems that frequently occur during oncologic therapy include
mucositis, infections, and hemorrhage. Certain chemotherapeutic agents consistently
produce significant mucositis. The herpes simplex virus infection is a frequent cause
of oral ulceration. Gram-negative oral bacilli can cause severe local necrosis of oral
tissues and lethal bacteremia and sepsis. Sepsis with oral streptococci is common in
the early post-engraftment period following bone marrow transplant. Long-term
dental complications of oncologic therapy include abnormal dental and craniofacial
development. Dental abnormalities in children treated for acute lymphoblastic
leukemia are more severe if the oncologic therapy begins before 5 years of age and
if cranial irradiation is used. The combination of high-dose cranial irradiation (2400
cGy) and chemotherapy before 5 years of age results in deficient mandibular growth.
Reduced production of growth hormone and deficient mandibular growth can be due
39
to bone marrow transplantation treatment in young children. However the use of
growth hormones has been reported to be able to stimulate mandibular condylar
growth [13].
Although many works have addressed oral manifestations in children with
leukemia, many different methodologies have been used; therefore we decided to
carry out a systematic review to investigate the prevalence of oral manifestations in
children and adolescent with leukemia
Methods
Inclusion/Exclusion Criteria
This research included studies that addressed the prevalence of oral
manifestations in children and adolescent with leukemia. The language was
restricted to English. Qualitative studies, case reports, studies with animals,
guidelines or those whose assessment was based on non-clinical parameters were
excluded.
Research
Three researchers independently searched the databases Pubmed, OVID ALL
EMB Reviews (1950-2014), and CHOCRANE. The research terms used were ("oral
manifestations"[MeSH Terms] OR ("oral"[All Fields] AND "manifestations"[All Fields])
OR "oral manifestations"[All Fields]) AND ("child"[MeSH Terms] OR "child"[All Fields]
OR "children"[All Fields]) AND ("leukaemia"[All Fields] OR "leukemia"[MeSH Terms]
OR "leukemia"[All Fields]). Moreover, the reference lists of the selected articles and
literature reviews were searched manually.
The titles and abstracts of the retrieved studies were assessed and those wich
were potentially relevant were selected. After full-text evaluation, studies which
clearly did not fulfill the inclusion criteria were excluded. The studies independently
selected by the researchers were confronted, and in the case of disagreement, they
were discussed in order to reach consensus.
Data Extraction
40
The following data was extracted from all the selected articles: the country
where the study was performed, number of children and adolescent included, age of
the individuals, type of study, type of leukemia, criteria of clinical diagnoses, use of
chemotherapy and prevalence of oral lesions. (Table 1)
Assessment of Methodological Quality
The selected articles were assessed in accordance with the STROBE
Statement for observational studies, with some modifications [14]. For each item,
there were 4 possible options (Yes, No, Unclear and Not Applicable (N/A)), but only
one option could be mark for each item. The quality assessment is shown in Table 1.
Methodological quality
Category (A): High methodological quality, when the study rated at least 8
items of the assessed criteria “yes”;
Category (B): Moderate methodological quality, when the study rated 7-5 of
the items “yes”;
Category (C): Low methodological quality, when the study rated 4 or less of
the items “yes”.
The studies with the C classification were excluded due to low methodological
quality.
The risk of bias was also evaluated through the questions as shown in Table
2.
Risk of bias (Table 2):
 Category (A): High risk of bias, when the study was rated with 0-1 “yes”;
 Category (B): Moderate risk of bias, when the study was rated with 2 “yes”;
Category (C): Low risk of bias, when the study was rated with 3-4 “yes”.
The studies with the A classification were excluded due to high risk of bias.
41
Results
A total of 84 articles were initially identified in the electronic databases. The
duplicate abstracts from different databases were excluded. From 60 studies
selected, only 6 remained after applying the inclusion/exclusion criteria (Figure1).
The selected articles were categorized according to the quality assessment; three
articles were considered as B and the others ones as C (Table 3). The data extracted
from the studies is shown in Table 4. In relation to bias only one study was classified
as being low risk and one moderate risk and the other four were considered high risk
of bias according the adoptted criteria (Table 5).
The most frequent oral manifestations found were:
Gingivitis (100%)[15];
dental caries (81.63%) [16], mucositis (20.66 - 38.77%) [16, 17], pale of oral mucosa
(59.8%) [18], Candidiasis (16.5 - 27.22%) [18, 19], ulcers (5.2- 36.5%) [17, 19],
lymph node enlargement (38.9 - 67.6%) [19, 20] and petechiae 59.7% [19] and also
others lesions were observed.
Discussion
Leukemia is a malignancy with disseminated proliferation of immature or blast
cells of the bone marrow to accumulate in various tissues of the body [21]. Leukemia
is classified clinically on the basis of the duration and character of the disease (acute
or chronic), the type of cell involved (myeloid, lymphoid, or monocystic) and the
increase, or non-increase in the number of abnormal cells in the blood [22].
The relationship between leukemia in children and a wide variety of oral
lesions has been reported in several studies [15-20]. In 1986 Barrett suggested that
the oral manifestations of leukemia could be regarded as diagnostic indicators of the
disease [23]. Also a high frequency of oral lesions have been observed early in the
leukemia disease process. The early detection of such oral lesions may result in an
increased lifespan and reduction in the frequency and severity of complications [16,
17, 24-27].
The oral cavity of children with leukemia is at risk for complications that go
from mucosal lesions and infections to exacerbations of pre-existing dental diseases.
Among such complications are generalized ulcers, spontaneous bleeding of mucosa
42
and gingivae, coated tongue, limited mouth opening, foul odor, oral infections
(mucositis, candidiasis,
herpes simplex, varicella-zoster, and cytomegalovirus),
shallow papillae, differences in salivary flow rate and pH, mucosal pallor, swallowing
and chewing difficulties, ulcerations and edematous areas, erythema, trigeminal
nerve neuropathy, reticular lesions, ecchymosis, neuropathy, xerostomia, reddened,
tender and painful mucosa, gingival pain and hemorrhage [16-20, 28-30]. Despite
several oral manifestations are related in the literature we could not observed all of
them in the selected studies.
The study by Thomaz et al (2013) was the better qualified study in terms of
quality and risk of bias in this systematic review; they carried out a longitudinal study
with twenty patients aged 3–15 years undergoing chemotherapy. The children and
adolescents were examined at two time points, at baseline and after 6 months.
Gingivitis and mucositis were the most frequent manifestations at the two times
examinations and oral aphthae were also diagnosed. There was an increase of the
mean DMFT index with a statistical significance between two examinations; however
the mean deft index was the same at the 1 st and 2nd evaluation [15].
The study by Ponce-Torres et al (2010), which was considered the second
best study, also reported that gingivitis was the most common manifestation
(91.84%), then caries (81.63%) and mucositis (38.7%). Other manifestations were
dry lips 93.80%, mucosal pallor 71.42% and mucosal ecchymosis and petechiae,
36.73%
and
34.70%
respectively.
The
standard-risk
patients
with
acute
lymphoblastic leukemia (ALL) had a 95.25% probability of developing gingivitis and
52.38% of developing mucositis, whereas the high-risk patients had a 14.29%
probability of developing candidiasis, 89.28% of developing gingivitis and 28.57% of
developing mucositis. Depending on the immunophenotype of leukemia as a risk
factor for the development of oral manifestation, these authors observed that patients
with B-cell ALL had a 6.82%, 90.70% and 38.64% probability of developing
candidiasis, gingivitis and mucositis respectively. Patients with T-cell ALL had a
100% probability of developing gingivitis and 40% for mucositis. Considering the
different phases as a risk factor for developing oral manifestations: a patient in the
induction phase had a 50% risk of developing mucositis, and in the maintenance and
consolidation phases 20% and 38.89% respectively. The risk of developing gingivitis
43
was 100%, 100% and 89% in the induction, consolidation and maintenance phases
respectively; and candidiasis was a 83.33% risk in the maintenance phase [16].
In this study we noted that despite the large number of works investigating the
prevalence of oral manifestations in patients with leukemia, only two studies had an
acceptable methodology. There are some points that should be addressed in a study
so that it can provide acceptable scientific evidence. Highlighted among these points
are: a representative sample size, elucidative inclusion and exclusion criteria of the
sample, criteria for lesion assessments, standardized assessment methods (including
examiner calibration), and a suitable statistical analysis. The use of radiotherapy, the
phases of the disease, the type of treatment, time of diagnosis and the type of
leukemia also need to be fully elucidated.
Clinical evidence is observed and the practice shows that, but scientific
evidence does not, and this is occurring, probably because the studies are old and in
poor methodological quality, and that is what is missing. More recent studies have
shown this. It is important to note that despite medical knowledge to be a consensus,
the scientific evidence can help on the implementation of new therapies, preventive
approach and thereby improve the prognosis and quality of life for these patients.
Conclusions
Based on the results of this systematic review and the criteria adopted we can
conclude that there is moderate scientific evidence that children with leukemia have a
high prevalence of oral manifestations. The most prevalent oral manifestations were
gingivitis and mucositis.
References
[1]
Anil S, Smaranayake LP, Nair RG, Beena VT. Gingival enlargement as a
diagnostic indicator in leukaemia. Case report. Aust Dent J. 1996 Aug;41(4):235-7.
[2]
Dean AK, Ferguson JW, Marvan ES. Acute leukaemia presenting as oral
ulceration to a dental emergency service. Aust Dent J. 2003 Sep;48(3):195-7.
44
[3]
Wu YK, Huang YC, Huang SF, Huang CC, Tsai YH. Acute respiratory distress
syndrome caused by leukemic infiltration of the lung. J Formos Med Assoc. 2008
May;107(5):419-23.
[4]
Abdullah BH, Yahya HI, Kummoona RK, Hilmi FA, Mirza KB. Gingival fine
needle aspiration cytology in acute leukemia. J Oral Pathol Med. 2002 Jan;31(1):558.
[5]
Kim FM, Fennessy JJ. Pleural thickening caused by leukemic infiltration: CT
findings. AJR Am J Roentgenol. 1994 Feb;162(2):293-4.
[6]
Eddes EH, Fibbe WE, Loyson SA, Zwartendijk J. Urinary symptoms due to
leukemic infiltration of the prostate. A case report. Ann Hematol. 1993 Jun;66(6):3234.
[7]
Nies BA, Bodey GP, Thomas LB, Brecher G, Freireich EJ. The Persistence of
Extramedullary Leukemic Infiltrates During Bone Marrow Remission of Acute
Leukemia. Blood. 1965 Aug;26:133-41.
[8]
Gordon KB, Rugo HS, Duncan JL, Irvine AR, Howes EL, Jr., O'Brien JM, et al.
Ocular manifestations of leukemia: leukemic infiltration versus infectious process.
Ophthalmology. 2001 Dec;108(12):2293-300.
[9]
Wu J, Fantasia JE, Kaplan R. Oral manifestations of acute myelomonocytic
leukemia: a case report and review of the classification of leukemias. J Periodontol.
2002 Jun;73(6):664-8.
[10] Akhtar M, Ali MA, Burgess A, Aur RJ. Fine-needle aspiration biopsy (FNAB)
diagnosis of testicular involvement in acute lymphoblastic leukemia in children. Diagn
Cytopathol. 1991;7(5):504-7.
[11] Vinckier F, Declerck D. [Oral manifestations in leukemic children and their
diagnostic value]. Acta Stomatol Belg. 1989 Oct;86(3):219-26.
[12] Emidio T, Maeda Y, Caldo-Teixeira A, Puppin-Rontani R. Oral manifestations
of leukemia and antineoplastic treatment - a literature review (part II).. Braz J Health
2010;1:136-49.
[13] Fleming P. Dental management of the pediatric oncology patient. Current
opinion in dentistry. 1991 Oct;1(5):577-82.
[14] von Elm E, Altman DG, Egger M, Pocock SJ, Gotzsche PC, Vandenbroucke
JP. The Strengthening the Reporting of Observational Studies in Epidemiology
(STROBE) statement: guidelines for reporting observational studies. PLoS Med.
2007 Oct 16;4(10):e296.
[15] Thomaz EB, Mouchrek JC, Jr., Silva AQ, Guerra RN, Liberio SA, da Cruz MC,
et al. Longitudinal assessment of immunological and oral clinical conditions in
patients undergoing anticancer treatment for leukemia. International journal of
pediatric otorhinolaryngology. 2013 Jul;77(7):1088-93.
45
[16] Ponce-Torres E, Ruiz-Rodriguez Mdel S, Alejo-Gonzalez F, Hernandez-Sierra
JF, Pozos-Guillen Ade J. Oral manifestations in pediatric patients receiving
chemotherapy for acute lymphoblastic leukemia. The Journal of clinical pediatric
dentistry. 2010 Spring;34(3):275-9.
[17] Subramaniam P, Babu KL, Nagarathna J. Oral manifestations in acute
lymphoblastic leukemic children under chemotherapy. The Journal of clinical
pediatric dentistry. 2008 Summer;32(4):319-24.
[18] Orbak R, Orbak Z. Oral condition of patients with leukemia and lymphoma. J
Nihon Univ Sch Dent. 1997 Jun;39(2):67-70.
[19] Michaud M, Baehner RL, Bixler D, Kafrawy AH. Oral manifestations of acute
leukemia in children. Journal of the American Dental Association (1939). 1977
Dec;95(6):1145-50.
[20] White GE. Oral manifestations of leukemia in children. Oral surgery, oral
medicine, and oral pathology. 1970 Mar;29(3):420-7.
[21] Ferretti GA, Ash RC, Brown AT, Largent BM, Kaplan A, Lillich TT.
Chlorhexidine for prophylaxis against oral infections and associated complications in
patients receiving bone marrow transplants. Journal of the American Dental
Association (1939). 1987 Apr;114(4):461-7.
[22] Genc A, Atalay T, Gedikoglu G, Zulfikar B, Kullu S. Leukemic children: clinical
and histopathological gingival lesions. The Journal of clinical pediatric dentistry. 1998
Spring;22(3):253-6.
[23] Barrett AP. Oral changes as initial diagnostic indicators in acute leukemia. J
Oral Med. 1986 Oct-Dec;41(4):234-8.
[24] Lynch MA, Ship, II. Initial oral manifestations of leukemia. Journal of the
American Dental Association (1939). 1967 Oct;75(4):932-40.
[25] Takagi M, Sakota Y, Ishikawa G, Kamiyama R, Nakajima T, Nomura T. Oral
manifestations of acute promyelocytic leukemia. J Oral Surg. 1978 Aug;36(8):589-93.
[26] Stafford R, Sonis S, Lockhart P, Sonis A. Oral pathoses as diagnostic
indicators in leukemia. Oral surgery, oral medicine, and oral pathology. 1980
Aug;50(2):134-9.
[27] Greenberg MS, Cohen SG, McKitrick JC, Cassileth PA. The oral flor as a
source of septicemia in patients with acute leukemia. Oral surgery, oral medicine,
and oral pathology. 1982 Jan;53(1):32-6.
[28] Williams MC, Lee GT. Childhood leukemia and dental considerations. The
Journal of clinical pediatric dentistry. 1991 Spring;15(3):160-4.
[29] Baliga AM, Brave VR, Vyas HA. Oral mucosal lesions in patients with acute
leukemias and related disorders due to cytotoxic therapy. J Indian Soc Pedod Prev
Dent. 1995 Aug;13(1):25-9.
46
[30] Sepet E, Aytepe Z, Ozerkan AG, Yalman N, Guven Y, Anak S, et al. Acute
lymphoblastic leukemia: dental health of children in maintenance therapy. The
Journal of clinical pediatric dentistry. 1998 Spring;22(3):257-60.
Tables and Figure
Table 1: Quality Assessment
ITEM QUALITY ASSESSMENT
1
Explain how the study size was arrived at and describe the
analytical methods taking into account the sampling strategy
Yes No Unclear
N/A
2
Description of inclusion and exclusion criteria of the sample,
give the eligibility criteria, and the sources and methods of
selection of participants
Yes No Unclear
N/A
3
Clearly define all outcomes, exposures, predictors, potential
confounders, and effect modifiers. Give diagnostic criteria.
Yes No Unclear
N/A
4
Describe any efforts to address potential sources of bias.
Yes No Unclear
N/A
5
Standardized assessment methods, including intra-examiner
calibration, or among researchers, if there were more than
one.
Yes No Unclear
N/A
6
Described the lesions in various stages of the disease
Yes No Unclear
N/A
7
Give characteristics of study participants (e.g., demographic,
clinical, social) and information on exposures and potential
confounders.
Yes No Unclear
N/A
8
Report numbers of outcome events or summary measures.
Yes No Unclear
N/A
9
Describe all statistical methods, including those used to
control for confounding.
Yes No Unclear
N/A
N/A=Not applicable
47
Table 2: Risk of Bias Criteria
ITEM DETECTION BIAS
1
Was the study blind?
Yes No Unclear N/A
2
Was an account sample size performed?
Yes No Unclear N/A
3
Were the examiners calibrated?
Yes No Unclear N/A
4
Were some patients excluded so as to avoid
confounding?
Yes No Unclear N/A
N/A=Not applicable
Table 3: Quality assessment of the studies included in the review
ITEM
Thoma
z et al
PonceTorres et al
Subramania
m et al
Orbak et al
Michaud et
al
White GE
1
Yes
No
No
No
No
No
2
Yes
Yes
Yes
Yes
Unclear
Yes
3
Yes
Yes
No
No
No
Yes
4
No
Yes
Yes
Yes
No
No
5
Yes
Yes
No
No
No
Unclear
6
No
Yes
Yes
Yes
Yes
Yes
7
No
No
No
No
Yes
Unclear
8
Yes
Yes
Yes
Yes
Yes
Yes
9
Yes
Yes
Yes
No
No
No
Total of
“yes”
(Category)
6(B)
7 (B)
5 (B)
4(C)
3 (C)
4 (C)
Category: (A) High methodological quality, (B) Moderate methodological quality, (C) Low
methodological quality
20
Table 4: Characteristics of the studies included in the review
Author
Thomaz et al.
[15]
Country
Year
Study Type
Sampl
e Size
Age
(years)
Criteria of clinical
diagnoses
Describe the Kind
of Leukemia
Describe the
use of
Chemotherapy
Brazil
2013
Longitudinal
20
3-15
World Health
Organization
Yes
Yes
Yes
Yes
Yes
Yes
Ponce-Torres,
[16]
et al.
Mexico
2010
Crosssectional
49
2-14
OHI-S index to
describe oral health
and the IMPA index to
differentiate gingivitis
from periodontitis
Subramaniam,
[17]
P. et al
India
2008
Crosssectional
with control
group
58
Mean
7.14♂
5.33♀
Not described
Orbak R et al
[18]
Michaud M et al
[19]
White GE.
[20]
Turkey
1997
Cross
sectional
97
2-14
Not described
Yes
No
USA
1977
Longitudinal
77
1-18
Not described
Yes
No
USA
1970
Longitudinal
34
0-16
Yes
Yes
Yes
Prevalence
Gingivitis: 100%
Mucositis: 8.3%
Aphta:3.1%
Gingivitis: 91.84%;
Caries: 81.63%;
Mucositis, 38.77%;
Periodontitis, 16.32%;
Cheilitis: 18.36%; Recurrent
herpes, 12.24%;
Primary herpetic
gingivostomatitis, 2.04%
Oral candidiasis: 6.12%.
Mucositis 20.6%
Ulcers 5.2%
Candidiasis 3.5%
Mucositis and Ulcers 8.6%
Pallor of oral Mucosa 59.8%
Gengival Beeding 7.2%
Herpes Labial 15.5%
Candidiais 16.5%
Chelitis 2.1%
Lymph node enlargement
38.9%
Erosions 28.5%
Ulcers 36.5%
Erythema of the oral mucosa
28.5%
Petechiae 59.7%
Candidiasis 27.2%
Cervical Lymph node 67.6%
Ulcers
Gingival Lesions 55.8%
20
Table 5: Risk of Bias.
Item
Thomaz et
al
Ponce-Torres
et al
Subramaniam
et al
Orbak et
al
Michaud
et al
White
GE
1
No
Unclear
Unclear
No
Unclear
Unclear
2
Yes
No
No
No
No
No
3
Yes
Yes
Unclear
N/A
Unclear
Unclear
4
Yes
Yes
Unclear
Unclear
Unclear
Unclear
Total of
“yes”
3 (C)
2 (B)
0 (A)
0 (A)
0 (A)
0 (A)
N/A=Not applicable; (A) High risk of bias; (B) Moderate risk of bias and (C) Low Risk of bias
ELETRONIC SEARCH
Initial search (84 studies)
Pubmed (n=59), OVID (n=24), Cochrane (n=1)
60 titles and abstracts evaluated
54 studies excluded on the basis of title and
abstract
6 studies retrieved for full text evaluation and
included in the systematic review
4 studies werwe excluded because of the risk of bias,
and only 2 studies were evaluate
Figure 1: Flow diagram of literature search
Exclusion of 24 studies
repeated on databases
21
4.2 ARTIGO 2
Candida spp. carriage in oral cavity of children diagnosed with leukemia and its
correlation with the disease and oral health status
Authors:
Raquel dos Santos Pinheiro1,
Maristela Barbosa Portela2,
Rosângela Maria de Araújo Soares3,
Luiz Alcino Gueiros 4
Gloria Fernanda Barbosa de Araújo Castro5.
1
MSD, DDS, PhD Student - Department of Pediatric Dentistry and Orthodontic
/School of Dentistry/, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil.
2
MSD, DDS, PhD - Department of Clinics and Pediatric Dentistry/School of
Dentistry/Universidade Federal Fluminense, Niterói, Brazil.
Department
of
General
Microbioly/Instituto
de
3
Associated Professor of
Microbiologia
Paulo
de
4
Góes/Universidade Federal do Rio de Janeiro, Brazil. MSD, DDS, PhD, Professor,
Department of Estomatology, School of Dentistry, Federal University of Pernambuco 5
MSD, DDS, PhD, Professor.
Department of Pediatric Dentistry and Orthodontic
/School of Dentistry/, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil.
Key words: Candida spp., children, leukemia, oral
22
Abstract
Aim: The aim of this study is to identify and quantify Candida spp. in the oral
cavity of children with leukemia and correlate our findings with oral manifestations,
and caries disease and medical data (therapy phase, use of medicines and
neutropenia). Methods: Saliva was collected from 32 leukemic children and 32
healthy children (control group), followed by oral manifestation assessments
performed according to the Oral health surveys: basic methods. Oral manifestations
(presence or history), caries disease, and use of medicines of the control group were
recorded. The salivary samples were cultured in chromogenic agar and the Candida
spp. colonies counted and then identified by sugar assimilation and fermentation.
Growth of Candida spp. was classified as mild (≤10 CFU/mL), moderate (11-49
CFU/mL), or strong (≥50 CFU/mL) Results: All leukemic children (mean age 5.41 ±
2.74 years old) were immunosuppressed and had a higher frequency of Candida
spp. (53.1%) compared to the control group; most of the leukemic children presented
a strong growth. Candida albicans was the most frequent specie (82.35%). Other
species of Candida were also found: C. parapsilosis in 11.76%, C. guillermondii and
C. famata in 23.52%, and C. pelliculosa and C.tropicallis in 5.88% in the leukemic
children. Oral examination shows that 12.5% of the children had oral manifestations,
and a history of oral manifestations was reported by 78.1% of them. Fourteen
(43.8%) leukemic children were caries free. In the control group, the mean age was
5.97 (SD 3.10 yars old), Candida spp. was found in 21.9% and Candida albicans was
also the most frequent specie (57.14%). Conclusion: Children with leukemia have a
strong growth of Candida spp. and a high frequency of this fungus in the oral cavity.
Candida albicans was the most frequent specie, but these findings were not related
to leukemia in our patients.
Introduction
Leukemia is a malignant neoplasm of mesenchymal origin that affects the
hematopoietic tissue [1-3]. The dissemination and proliferation of blasts leads to a
substitution of normal bone marrow elements, resulting in the accumulation of
immature cells in the blood. There are
four major types of leukemia they are
classified based on the primary cell line of origin, lymphoid or myeloid, and are
further divided according to the usual onset and progression of the disease, acute or
23
chronic [4-6]. Of the childhood cancers, leukemia is the most frequent, corresponding
to 25% to 35% of all childhood cancers [7]. Among the different types of leukemia,
acute lymphocytic leukemia (ALL) is the most frequent in children from 0 to 14 years,
with a prevalence of 80% [8, 9].
Initial signs and symptoms of leukemia can appear in the mouth or neck due to
the infiltration of leukemic cells or due to an associated decrease in normal marrow
elements. Also a number of oral and dental complications can be induced as a
systemic squeal resulting from the medication used with chemotherapy, irradiation, or
bone marrow transplantation, which are the usual treatments for ALL [10]. The direct
and indirect effects of leukemia to the oral cavity are associated with the
development of ulcerative, hemorrhagic, or infectious complications. Some of these
complications include: gingival bleeding, ulcerations, mucositis, taste alteration, skin
desquamation, xerostomia and opportunistic infections [10].
The mouth can be the local of a persistent infection in neutropenic patients,
with a potential role of systemic complications[11], even sepsis [12]. Candida species
(predominantly Candida albicans) are part of the conventional oral microbiota;
however, they may become opportunistic pathogens under immunocompromised
conditions, such as in patients with ALL [13]. Among opportunistic infections
candidiasis is one of the most common seen in leukemic children [14], with a
prevalence of between 3.5-27.2% [5, 15].
Despite the importance of opportunistic fungi in the oral cavity of
immunocompromised children, there are no studies that identify Candida spp. in the
oral cavity of leukemic children. Therefore, the aim of our study is identify and
quantify Candida spp. in the oral cavity of children with leukemia and assess oral
manifestations and caries disease in this group of children. Also, we correlate our
findings with medical data (therapy phase, medicines and neutrophil counts).
Patients and Methods
This is a descriptive, observational, cross-sectional and laboratorial study.
Protocols were approved by the local ethical committee (CEP/IPPMG: 85/11). Sixtyfour children aged between 2 and 12 years old were recruited for the study. Oral
scrapes were collected from all the participants. There were two groups. The
24
leukemic group was comprised of 32 children, who had been diagnosed for leukemia
at the Hematology/Pediatrics Outpatient Clinic at the Universidade Federal do Rio de
Janeiro (UFRJ). After informal consent was granted and the scrape samples had
been collected the following data were obtained from medical records: age; gender;
diagnosis (ALL- Acute Lymphoblastic Leukemia; AML- Acute Myeloid Leukemia or
CML- Chronic Myeloid Leukemia); therapy phase (induction, consolidation and
maintenance); use of chemotherapy; use of antifungal agents; history of oral
manifestations and neutrophil counts, which were done on the day of the sample
collection. History of oral manifestation was also obtained during anamnesis.
The
children
undergoing
chemotherapy
were
considered
to
be
immunocompromised [16]. For statistical correlations, the therapy phases were
regrouped as: initial treatment phase (induction and consolidation) and maintenance
phase (maintenance). Also; the patients were considered to be neutropenic when the
neutrophil count was less than 1000 cell/mm3 [17].
The control group was made up of 32 patients who sought care from the
Pediatric Dentistry Department and were clinically healthy, without any clinical signs
of immunosuppression and no history of any systemic disease, during anamnesis.
A clinical examination of the oral cavity was performed using a wooden
spatula under artificial light by the same trained professional for all patients. The oral
manifestation and caries disease examination was performed according to the Oral
health surveys: basic methods (WHO) [18]. Were considerate caries free patient, the
patient with DMFT and dmft = 0. Oral squamous cells were obtained using a swab
with a cotton-tipped applicator from the palate, tongue and jugal mucosa [19, 20].
The swab was then inserted into a Falcon® tube containing 1 ml of sterile saline
(0.85% NaCl) and transported on ice to the laboratory, for processing and analysis of
samples within 2 hours of collection.
Laboratory Test
The tubes containing the swabs and specimens were vortexed for 60 seconds
to release the adherent cells. Aliquots of 100 µl were cultured in plates with
chromogenic agar (CHROMagar Candida®; PROBAC, São Paulo, Brazil) and
incubated at 37ºC for 48–72 h. Chromogenic agar is a medium which allows a
25
presumptive identification of Candida spp. through the color of each colony-forming
unit (CFU). Green colonies were inoculated in Sabouraud dextrose agar to screen
their ability to grow at 45ºC, for 48 h and thus promote the differentiation between C.
albicans and C. dubliniensis, since the latter is unable to grow at 45ºC. In addition,
the different colored colonies were characterized by sugar substrate assimilation
profiles using the API 20C system® (bioMeriéux, Marcy l’Etoile, France). This system
allows the phenotypical differentiation of clinical isolates according to their sugar
assimilation and fermentation reactions. The sugars methyl-a-D-glucopyranoside and
D-xylose (API 20D system; bioMerie´ux) were also screened to differ C. albicans
from C. dubliniensis. Growth of Candida was classified as mild (≤10 CFU/mL),
moderate (11-49 CFU/mL), or strong (≥50 CFU/mL) according to Lamey et al.[21]
Data analysis
Using the SPSS program 17.0, a descriptive analysis was performed;
variables were summarized using frequency for categorical variables and means for
continuous variables. The verification of the hypothesis of variances was performed
using the Qui-square test for categorical variables. To compare numeric variables
with the median values the Mann–Whitney and T student test tests were used. The
significance level was set at p<0.05.
Results
The clinical history showed that oral manifestations were present in 78.1%
(25/32) of the leukemic group and only 18.8% (6/32) of the control group, and
therefore a significant statistical difference was observed between the groups (Quisquare Test, p=0.00; OR=3.2 [0.31-32.6]). The different types of oral manifestations
and data described above are also shown in Table 1. During the oral examination
there were 4 patients with oral lesions in the leukemic group and only one child with
ulcers in the control group. In the leukemic children 43.8% (14/32) were caries free
and in the control group 53.1% (17/32) were caries free; thus there was no significant
difference between the groups (Qui-square test, p>0.05) for caries disease.
The mean age of the leukemic group was 5.41 years old (SD 2.74), and 46.9%
were female (17/32), most of the children had ALL (90.6%), 56.2% of children were in
the maintenance phase of treatment, and all children were undergoing chemotherapy
26
and taking antibiotics. No differences were found between the leukemic and control
groups in relation to age (T Student test, p>0.05) or sex (Qui-square test, p>0.05).
More data is shown in Table 1.
There was a significant statistical difference (p = 0.01, Qui-square test) when
the groups were compared for Candida spp. colonization: the leukemic group was
yeast positive in 53% (17/32), while the healthy group was positive in only 21.9%
(7/32) of the cases. The average CFU/ml was similar in the both groups, 78.29 (SD:
24.98) and 51.43 (SD: 24.98) in the leukemic group and healthy group respectively;
and a strong growth was observed in both groups (Table2). Candida albicans was
the most frequent specie found in both groups (82.35% and 57.14% in the leukemic
and healthy groups respectively). Mixed cultures (two or more species) were found
in 6 patients (33.3%) of the leukemic group and in 2 patients (28.6%) of the healthy
group (Table2). The distribution of Candida spp. in children with positive growth is
shown in Table 3 and the presence of different species of Candida in each patient is
shown in Table 4.
No statistical relation was observed among Candida spp. colonization and
history of oral manifestation with the therapy phase, antifungal use and neutropenia.
However, all patients undergoing antifungal medication were colonized by Candida
spp. (Table 5).
Discussion
The most common pediatric malignancy is acute lymphoblastic leukemia (ALL)
that accounts for nearly 75-80% of all newly diagnosed leukemia and 25% of all
malignancies in childhood [7-9, 22]. In the present study, ALL was the most common
type of leukemia corroborating with the literature.
Little is known about the different spectrum of Candida species colonizing the
oral cavity in leukemic children. In our study we found a high colonization of Candida
spp. in the oral cavity of leukemic children; this group of children had 4 times more
chance to be colonized by these fungi, compared with healthy children. This
significant difference is probably due to the chemotherapy agents that affect not only
cancer cells but also normal cells. In leukemic patients the clinical reference state is
observed by a decrease in the neutrophil count (neutropenic) and therefore presents
27
a reduced cellular defense against invading microorganisms like fungi, bacteria and
viruses [17, 23].
Candida albicans was the most frequent specie found in both groups, followed
by C. famata and C. guillermondii in the leukemic group and C. parapsilosis, C.
famata and C. lusitaniae in the control group. Mixed colonies were also observed in
both groups. Our findings corroborate with Alberth et al (2006) who observed that C.
albicans was also the most frequent specie in children and adolescents with
leukemia. They also related that this fungus was more frequent in patients with
severe neutropenia when compared with those with moderate neutropenia. In
addition they identified other species of Candida in patients with severe neutropenia:
C. kefyr, C. lusitaneae, C. sake and C. tropicalis [24].
In the literature, we could not observed studies about the different kinds of
Candida species in leukemic children, but we found studies with other kinds of
immunocompromised children (HIV infected children) that show similar data to ours.
In 2010, Cerqueira et al., in a study with HIV infected children, related that Candida
spp. was present in more than 80% of the HIV positive group and mixed cultures
were observed in HIV and healthy children. Also, Alves et al. (2014) related that
Candida spp. colonization was three times higher in the oral cavity of the HIV
children when compared with the control subjects and that the same ratio could be
observed with respect to the average CFU/ml. They found that C. albicans was the
most prevalent specie in both studies, with a higher prevalence in the HIV children
[25]. Other species that were frequent in HIV infected children were C. guillermondii
and C.krusei and in the healthy group there was C. parapsilosis [25, 26]. Based on
the above reports we have observed that regardless of what causes these children to
be immunocompromised, Candida spp. has a higher frequency in these children
when compared with healthy children. Therefore, it is important to detect these fungi
early so as to avoid dissemination, which could cause systemic candidiasis as a
consequence.
Oral manifestations have been described frequently in children with leukemia.
In our study a history of oral manifestations was described in 78.1% of the children
with leukemia and in only 18.8% of the control group. Oral manifestations were
observed at the oral exam in 12.5% and 3.1% of the leukemic children and healthy
28
children respectively. Probably the difference between the groups is associated with
the immunosuppression caused by the illness and chemotherapy. In addition we
observed a higher prevalence of the history of oral manifestations compared with the
presence in the oral exam; this is probably because we only examined these children
once. Analyzing the history of oral lesions is important because it can become a
predictor of improvement or worsening of the immunity in this group of patients.
The oral mucositis represents a major oral medcine [27] non-hematologic
complication [28] of antineoplastic chemotherapy or irradiation [29] especially in
patients with leukemia [27, 29]. It is the most frequent severe complication of
chemotherapy in children [30, 31]. In their studies Ponce-Torres et al. and
Subramaniam et al. found mucositis as being the most frequent lesion, with a
prevalence of 38.77% and 20.6% respectively [5, 13]. Our results corroborate with
the literature, where the history of oral mucositis is reported to be 72% in leukemia
patients. In relation to the oral findings detected during the oral exams we diagnosed
mucositis in only one patient so we could not associate mucositis with Candida spp;
however, it has already been described in patients with ALL.
Anirudhan et al.,
analyzed the oral mucosa in 100 episodes of mucositis, from a group of 70 children,
and these authors found that fungal organisms (n=39) were the commonest isolate
from these lesions [12]. Mendonça et al. found a prevalence of Candida spp.
associated with mucositis between 15- 25% depending on the stage of treatment
[32].
Candidiasis is the most common fungal infection occurring in leukemic
patients [1]. The immunodeficiency of leukemia or from the chemotherapeutic agents
can contribute to oral candidiasis because of the altered cell-mediated immunity or
severe neutropenia due to chemotherapy [2, 30]. Other factors can be related to the
development of Candida: extensive use of broad-spectrum antibiotics, poor oral
hygiene, malnutrition, and the general poor health of the patient [5]. However, the
literature shows a prevalence of candidiasis between 3.1% and 27.2% in the oral
cavity of children with leukemia under chemotherapy or not. In our study all patients
were under chemotherapy and three presented lesions related with Candida spp.
(oral candidiasis, angular cheilitis and linear gingival erythema); 12% had a history of
oral candidiasis.
29
In relation to caries, Hegde et al. (2011) investigated the decayed, missing,
and filled teeth (DMFT) scores of children with ALL and showed that they were
significantly higher when compared to their healthy counterparts. Nevertheless they
associated it to poor oral hygiene and not to chemotherapeutic agents [33].
Moreover, in our study the incidence of caries diseases and number of cavities was
high in both groups. This shows that even though caries cavity can be a niche for
Candida spp. [34], it did not influence our results. In addition, in the leukemic group,
we can hypothesize that the high prevalence of caries disease can be associate with
decreased salivary flow during chemotherapy, and restriction of toothbrushing during
some stages of the disease when a tooth brush can expose the patient to infection
and bleeding because of blood dyscrasia. Otherwise, our control group were patient
founding for treatment and it can explain the high prevalence of the disease as it was
expected that these children have some dental needs.
Correlations with Cadida spp. colonization with the therapy phase, use of
medicines and neutropenia were not observed. However, it was interesting to note
that all children who were using antifungal agents were colonized by Candida spp,
and two of them with strong growth. The development of resistant strains in leukemic
patients is a constant concern, and such patients should be monitored carefully in
order to ensure control of infections.
Although we examined all patients with leukemia at our institution, better
explanations of the findings could probably have been produced if our sample were
larger, or if we had performed a longitudinal study; these were the major limitations of
our study.
Based upon a clinical and laboratory analysis, we can conclude that children
with leukemia have a high frequency of Candida spp. and C.albicans is the most
frequent specie in this group of children. Although we did not observe a correlation
between oral Candida colonization and medical data in our sample, oral yeast
infections can be a predictor of immunity in this group of children. So it is extremely
important that an early diagnosis of fungal infection is made as this could help
prevent the development of oral manifestations, systemic fungal infections and
maybe reduce morbidity in this group of patients.
30
References
[1]
Nelson L, Pliskin ME. Dental considerations in children with leukemia. The
Compendium of continuing education in dentistry. 1984 Jul-Aug;5(7):538-43.
[2]
Burke VP, Startzell JM. The leukemias. Oral Maxillofac Surg Clin North Am.
2008 Nov;20(4):597-608.
[3]
Tijanić I, Vučić M, Govedarović N, Tijanić M, Mačukanović-Golubović L. How
to recognize acute leukemia in dental office. . Acta Stomatologica Naissi.
2009;25(59):883 - 8.
[4]
Costa SS, Silva AM, Macedo IAB. Conhecimento de manifestações orais da
Leucemia e protocolo de atendimento odontológico. . Rev Odontol Univ São Paulo.
2011;23:70-8.
[5]
Subramaniam P, Babu KL, Nagarathna J. Oral manifestations in acute
lymphoblastic leukemic children under chemotherapy. The Journal of clinical
pediatric dentistry. 2008 Summer;32(4):319-24.
[6]
Hamerschlak N. Leukemia: genetics and prognostic factors. Jornal de
pediatria. 2008 Aug;84(4 Suppl):S52-7.
[7]
Câncer. MdSINd. Estimativa 2010: incidência de câncer no Brasil / Instituto
Nacional de Câncer– Rio de Janeiro: INCA, 2009. 2009.
[8]
Orbak R, Orbak Z. Oral condition of patients with leukemia and lymphoma. J
Nihon Univ Sch Dent. 1997 Jun;39(2):67-70.
[9]
Ministério da Saúde INdC. Estimativa 2010: incidência de câncer no Brasil /
Instituto Nacional de Câncer. -.
. 2009.
[10] Mathur VP, Dhillon JK, Kalra G. Oral health in children with leukemia. Indian
journal of palliative care. 2012 Jan;18(1):12-8.
[11] Costerton J, Keller D. Oral periopathogens and systemic effects. General
dentistry. 2007 May-Jun;55(3):210-5.
[12] Anirudhan D, Bakhshi S, Xess I, Broor S, Arya LS. Etiology and outcome of
oral mucosal lesions in children on chemotherapy for acute lymphoblastic leukemia.
Indian pediatrics. 2008 Jan;45(1):47-51.
[13] Ponce-Torres E, Ruiz-Rodriguez Mdel S, Alejo-Gonzalez F, Hernandez-Sierra
JF, Pozos-Guillen Ade J. Oral manifestations in pediatric patients receiving
chemotherapy for acute lymphoblastic leukemia. The Journal of clinical pediatric
dentistry. 2010 Spring;34(3):275-9.
[14] Mathur VP, Dhillon JK, Kalra G. Oral health in children with leukemia. Indian
journal of palliative care. Jan;18(1):12-8.
31
[15] Michaud M, Baehner RL, Bixler D, Kafrawy AH. Oral manifestations of acute
leukemia in children. Journal of the American Dental Association (1939). 1977
Dec;95(6):1145-50.
[16] Freifeld AG, Bow EJ, Sepkowitz KA, Boeckh MJ, Ito JI, Mullen CA, et al.
Clinical practice guideline for the use of antimicrobial agents in neutropenic patients
with cancer: 2010 update by the infectious diseases society of america. Clin Infect
Dis. 2011 Feb 15;52(4):e56-93.
[17] Meyer U, Kleinheinz J, Handschel J, Kruse-Losler B, Weingart D, Joos U. Oral
findings in three different groups of immunocompromised patients. J Oral Pathol
Med. 2000 Apr;29(4):153-8.
[18] Organization WH. Oral health surveys: basic methods. 4th ed. Geneva:
ORH/EPID 1997.
[19] Darwazeh AM, al-Bashir A. Oral candidal flora in healthy infants. J Oral Pathol
Med. 1995 Sep;24(8):361-4.
[20] Vargas K, Messer SA, Pfaller M, Lockhart SR, Stapleton JT, Hellstein J, et al.
Elevated phenotypic switching and drug resistance of Candida albicans from human
immunodeficiency virus-positive individuals prior to first thrush episode. Journal of
clinical microbiology. 2000 Oct;38(10):3595-607.
[21] Lamey PJ, Samaranayake LP. Oral candidosis: 2. Diagnosis and
management. Dental update. 1988 Oct;15(8):328-31.
[22] Gurney JG, Severson RK, Davis S, Robison LL. Incidence of cancer in
children in the United States. Sex-, race-, and 1-year age-specific rates by histologic
type. Cancer. 1995 Apr 15;75(8):2186-95.
[23] Wahlin YB, Matsson L. Oral mucosal lesions in patients with acute leukemia
and related disorders during cytotoxic therapy. Scandinavian journal of dental
research. 1988 Apr;96(2):128-36.
[24] Alberth M, Majoros L, Kovalecz G, Borbas E, Szegedi I, I JM, et al.
Significance of oral Candida infections in children with cancer. Pathol Oncol Res.
2006;12(4):237-41.
[25] Alves TP, Simoes AC, Soares RM, Moreno DS, Portela MB, Castro GF.
Salivary lactoferrin in HIV-infected children: Correlation with Candida albicans
carriage, oral manifestations, HIV infection and its antifungal activity. Archives of oral
biology. 2014 Aug;59(8):775-82.
[26] Cerqueira DF, Portela MB, Pomarico L, de Araujo Soares RM, de Souza IP,
Castro GF. Oral Candida colonization and its relation with predisposing factors in
HIV-infected children and their uninfected siblings in Brazil: the era of highly active
antiretroviral therapy. J Oral Pathol Med. 2010 Feb;39(2):188-94.
[27] Pereira Pinto L, de Souza LB, Gordon-Nunez MA, Soares RC, de Brito Costa
EM, de Aquino AR, et al. Prevention of oral lesions in children with acute
32
lymphoblastic leukemia. International journal of pediatric otorhinolaryngology. 2006
Nov;70(11):1847-51.
[28] El-Housseiny AA, Saleh SM, El-Masry AA, Allam AA. Assessment of oral
complications in children receiving chemotherapy. The Journal of clinical pediatric
dentistry. 2007 Summer;31(4):267-73.
[29] Childers NK, Stinnett EA, Wheeler P, Wright JT, Castleberry RP, Dasanayake
AP. Oral complications in children with cancer. Oral surgery, oral medicine, and oral
pathology. 1993 Jan;75(1):41-7.
[30] Allen G, Logan R, Gue S. Oral manifestations of cancer treatment in children:
a review of the literature. Clinical journal of oncology nursing. 2010 Aug;14(4):48190.
[31] Thomaz EB, Mouchrek JC, Jr., Silva AQ, Guerra RN, Liberio SA, da Cruz MC,
et al. Longitudinal assessment of immunological and oral clinical conditions in
patients undergoing anticancer treatment for leukemia. International journal of
pediatric otorhinolaryngology. 2013 Jul;77(7):1088-93.
[32] de Mendonca RM, de Araujo M, Levy CE, Morari J, Silva RA, Yunes JA, et al.
Prospective evaluation of HSV, Candida spp., and oral bacteria on the severity of
oral mucositis in pediatric acute lymphoblastic leukemia. Support Care Cancer. 2012
May;20(5):1101-7.
[33] Hegde AM, Joshi S, Rai K, Shetty S. Evaluation of oral hygiene status,
salivary characteristics and dental caries experience in acute lymphoblastic leukemic
(ALL) children. The Journal of clinical pediatric dentistry. 2011 Spring;35(3):319-23.
[34] Chagas MS, Portela MB, Cerqueira DF, de Souza IP, Soares RM, Castro GF.
Reduction of Candida species colonization in the oral cavity of children infected with
human immunodeficiency virus after dental treatment. Oral surgery, oral medicine,
oral pathology, oral radiology, and endodontics. 2009 Sep;108(3):383-8.
33
Table 1: Personal and medical data from Leukemic children and the healthy group.
Gender
Male
Female
Mean Age (years)
Hystory of Oral Manifestation***
Mucositis
Candidiasis
Ulcers
Herpes
Gengivoestomatiteherpétic
Presence of oral manifestation
during oral exam
Mucositis
Candidiasis
Ulcers
Quelitis Angular
Linear Gingival Erythema
Leukemic Group N=32 (%)
Control Group N=32(%)
15 (46.9)
17 (53.1)
5.41 ± 2.74
N=25 (%)
18 (72)
3 (12)
3 (12)
1(4)
(0)
15 (46.9)
17 (53.1)
5.97 ± 3.1
N=6 (%)
0 (0)
1 (14.3)
5 (71.4)
0 (0)
1 (14.3)
N=4 (%)
N=1 (%)
1 (25)
1 (25)
0(0)
1(25)
1(25)
0(0)
0(0)
1(100)
(0)
(0)
Caries Disease*
No
14 (43.8)
Yes
18 (56.2)
Mean number of teeth with cavities in
1.24 ±2.21
dentin
Leukemic Group n=32 (%)/ Medical Data
17(53.1)
15 (46.9)
1.50±2.1
Diagnosis
Acute Lymphoblastic Leukemia: 29 (90.6)
Acute Myeloid Leukemia: 2 (6.3)
Chronic Myeloid Leukemia: 1 (3.1)
Therapy Phase
Induction: 12 (37.5)
Consolidation: 2 (6.3)
Maintenance: 18 (56.2)
Chemotherapy use
32 (100)
Antifungal Use
4 (12.5)
Neutropenia**
Neutropenic: 6 (18.75)
No neutropenic: 26 (81.25)
*Caries disease: No: DMFT and dmft =0; Yes= DMFT and dmft >0. **Neutropenia: “Neutropenic =
neutrophil ≤1000 cell/mm3; no neutropenic: neutrophil >1000 cell/mm3. *** Significant statistical
difference Qui-square Test, p=0.00.
34
Table 2: Candida spp. of leukemic and healthy children.
Leukemic group
N=32 (%)
Control Group
N=32 (%)
P value
OR (IC interval)
Yes
No
17 (53.1)
15 (46.9)
7 (21.9)
25 (78.1)
0.01
4.04 (1.3612.01)
Mean CFU(SD) of
Candida spp.
78.29 (24.98)
51.43 (24.98)
NS
NS
Candida spp.
growthclassification
CFU(SD)
N= 17
N=7
Mild (≤ 10)
6 (33.3)
2 (28.6)
NS
NS
Moderate (10-49)
2 (11.8)
2 (28.6)
NS
NS
Strong (>50)
9 (52.9)
3 (42.9)
NS
NS
Mix growth
N=17
N=7
Yes
No
6 (33.3)
11 (66.7)
2 (28.6)
5 (71.4)
NS
NS
NS
NS
Candida
spp.Colonization
Notes: NS=not significant_________A Qui-square Test
Table 3: Distribution of Candida spp. isolates in leukemic children (n=17) and in heathy
children (n=7) with positive growth.
Candida spp
Leukemic children
Healthy children
C. albicans
14 (82.35%)
4 (57.14%)
C. parapsilosis
2 (11.76%)
2 (28.57%)
C. pelliculosa
1 (5.88%)
0 (0.0%)
C. famata
4 (23.52%)
2 (28.57%)
C. guillermondii
4 (23.52%)
0 (0.0%)
C. tropicalis
1 (5.88%)
1 (14.28%)
C .lusitaniae
0 (0.0%)
2 (28.57%)
20
Table 4: Candida spp. distribution in patient with positive colonization.
Leukemic Group
Candida.sp
p
Patient
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
1
2
3
4
5
6
7
C.albicans
C. parapsilosis
C.pelliculosa
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-
+
+
-
+
-
+
+
+
+
-
+
+
-
-
C. famata
+
+
+
+
Control Group
+
+
-
C. guilliermondii
C. tropicalis
C.lusitaniae
Mix
Culture
+
+
+
+
+
-
+
+
+
+
+
+
-
+
-
+
+
+
+
-
20
Table 5: Correlation between Candida spp. and history of oral manifestation with therapy
phase, antifungal use and neutropenia.
Therapy Phase n(%)
Candida spp.
Colonization
Yes
No
History of Oral
Manifestation
Yes
No
Antifungal Use
n(%)
Under
No
Use
Use
(n=4)
(n=28)
Initial
(n=15)
Maintenance
(n=17)
8
(53.3)
7
(46.7)
9 (52.9)
4 (100)
8 (47.1)
0 (0)
11
(73.3)
4
(28.7)
4 (82.4)
2 (50
3 (17.6)
2 (50
Neutropenic Patient n(%)
Neutropenic
(n=6)
No
Neutropenic
(n=26)
13
(46.4)
15
(53.6)
3 (50)
14 (53.8)
3 (50)
12 (46.2)
23
(82.1)
5
(17.9)
5 (83.3)
20 (66.9)
1 (87.7)
6 (26.1)
21
4.3 ARTIGO 3
Lactoferrin influences genes expression of C. albicans isolated from leukemic
children during biofilm formation.
Authors:
Raquel dos Santos Pinheiro1,
Maristela Barbosa Portela2,
Hugo Hemiliano3,
Raquel Silva Peixoto4,
Rosângela Maria de Araújo Soares5,
Jair Carneiro Leão6,
Gloria Fernanda Barbosa de Araújo Castro7.
1
MSD, DDS, PhD Student - Department of Pediatric Dentistry and Orthodontic
/School of Dentistry/, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil.
2
MSD, DDS, PhD -
Department of Clinics and Prediatric Dentistry/School of
Dentistry/Universidade Federal Fluminense, Niterói, Brazil.
Department
of
General
Microbioly/Instituto
de
3
PhDStudent of
Microbiologia
Paulo
de
Góes/Universidade Federal do Rio de Janeiro, Brazil.4 Professor of Department of
General Microbioly/Instituto de Microbiologia Paulo de Góes/Universidade Federal do
Rio de Janeiro, Brazil.5 Titular Professor of Department of General Microbioly/Instituto
de Microbiologia Paulo de Góes/Universidade Federal do Rio de Janeiro, Brazil.
6
Associate Professor, Department of Estomatology, School of Dentistry, Federal
University of Pernambuco.7 MSD, DDS, PhD, Professor. Department of Pediatric
Dentistry and Orthodontic /School of Dentistry/, Universidade Federal do Rio de
Janeiro, Rio de Janeiro, Brazil.
22
Abstract
Aim: assess if HWP1, SAP1, SAP 4, SAP5 and SAP6 genes are expressed
during biofilm formation by C. albicans isolated from leukemic children, in the
presence or not of human lactoferrin (LF). Methods: C. albicans yeast isolated from
the saliva of leukemic and health children were cultured on agar chromogenic and
the phenotypic characterization of the final yeast species was performed by the
carbohydrate assimilation test. A reference strain of C. albicans (ATCC 10231) was
used. During the biofilm formation four groups were made: two groups treated with
human lactoferrin (Leukemic+LF and Health+LF groups) and the others two without
human lactoferrin treatment (Leukemic and Health control groups). Biofilm
quantification was performed using the XTT reduction and evaluation of the
architecture and topographic thickness of the biofilm by confocal laser scanning
microscopy (CLS). The polymerase chain reaction (PCR) was performed using the
primers HWP1, SAP1, SAP4, SAP5 and SAP6. Results: All groups had a
moderately measurement of biofilm formation that were confirmed by XTT reduction
measurement and CLS. In relation to the genes, the biofilm formed by C. albicans
from leukemic child expressed the genes: HWP1, SAP1, and SAP6 when treated or
not with lactoferrin. Otherwise, the biofilm formed by C. albicans from health children,
without lactoferrin, expressed HWP1, SAP1, SAP 5 and SAP6 but with lactoferrin
treatment, expressed only the genes HWP1 and SAP6. Conclusion: We could
conclude that the studied genes related to biofilm formation were influenced variably
by the treatment with human lactoferrin in the different groups.
Key words: Candida albicans, SAP1, SA4, SAP5, SAP6, HWP1, Leukemia,
Children.
Introduction
Among the opportunistic infectious diseases in children with leukemia,
(especially in patients undergoing chemotherapy) oral candidiasis is frequently
observed. This infection is caused especially by Candida albicans [1] an ubiquitous
fungus that is a part of the normal microbial flora found on mucosal surfaces such as
those of the oral cavity, gastrointestinal tract, and vagina in human [2]. Its conversion
from commensalism to parasitism is usually associated with intraoral environmental
23
changes or systemic factors such as the immunodeficiency caused by leukemia. The
virulence of C. albicans is correlated with the adherence to the epithelial cell,
dimorphism, growth capacity as blastospores, pseudohyphae and hyphae,
production of hydrolytic enzymes [3], and the composition of the cell wall which
facilitates the adhesion and penetration of infected tissue [4, 5].
Biofilm formation is a multicellular process, consisting of cell adhesion, growth,
morphogenic switching between yeast and filamentous states, and quorum sensing
[7, 8]. Numerous C. albicans genes products have been identified as relevant to
biofilm development and formation [9]. The gene HWP1 is known to encode a major
C. albicans protein involved in several functions such as cell wall assembly,
intracellular signaling and hyphal development. Moreover, HWP1 promotes Candida
binding to epithelial cells as the initial step of colonization [10, 11]. The secretion of
aspartic proteases (SAP) during infection and biofilm formation is required as a
virulence attribute to aid adhesion, invasion, and the destruction of host immune
factors, in addition to nutrient acquisition [12]. These hydrolytic enzymes are encoded
by a family of 10 SAP genes.
Human lactoferrin (LF) is a protein presented in various secreted fluids such
as milk, saliva, tears and nasal secretions. Also, it is present in the granules of
polymorphonuclear neutrophils and secreted by some acinar cells [14, 15, 16].
Recently, Alves et al. (2014) showed LF antifungal effect against clinical isolates of
C. albicans from the oral cavity of immunocompromise HIV children in different
yeasts density suspensions in vitro [17].
In this study, we hypothesized if the
antifungal effect of lactoferrin could interfere in the biofilm formation by C. albicans
strain isolated from a leukemic immunocompromised child. So, it is extremely
important to conduct research that analyzes the efficacy of salivary proteins with
fungicidal action.
Therefore, the aim of our study is to assess if human lactoferrin influences the
expression of genes related to biofilm formation (HWP1, SAP1, SAP 4, SAP5 and
SAP6) by C. albicans isolated from leukemic children compared to health children..
24
Methods
Yeast Isolates
Yeast of Candida albicans was isolated from saliva of a child with leukemia
attending at the Pediatric Hematology Outpatient Clinic, Universidade Federal do Rio
de Janeiro (UFRJ), Brazil; and from a health child attending at the Pediatric Dentistry
Department, UFRJ. A reference strain (ATCC 10231) was also used. The child with
leukemia was immunessupresed (under chemotherapy and neutrophil number count
= 3890). This study was approved by the Ethics Committee of the Instituto de
Puericultutra e Pediatria Martagão Gesteira, Universidade Federal do Rio
de
Janeiro, Brazil (CEP/IPPMG: 85/11) and informed consent was obtained for each
child from their legal guardians.
Strains were isolated and identified by conventional methods and the
identification was confirmed using the API 20C system® (bioMérieux, Inc, France).
Isolates were stored at -80ºC in Sabouraud dextrose broth with 20% [18].
Biofilm formation and treatment with human lactoferrin
Biofilm formation was performed in a sterile 96-well microtitre plate according
Thein et al (2007) [19]. The microorganism growth was performed on Yeast Carbon
Base (YNB) (Difco ®, Becton Dickinson / USA) supplemented with 10 mM glucose
for 48 hours at 37°C with gentle agitation (75 rpm). After this period, standard
suspensions of 106 cells/ml were treated or not with 100 g/ml of human lactoferrin
(Sigma-Aldrich Chemical, St. Louis, MO) for 3 hours at 37°C [17]. After this period,
all cells suspensions were centrifuged (4000 rpm, 4 min, 4°C) and the supernatants
were removed. The yeasts were resuspended in 100 µL YNB supplemented with
glucose (10 mM), transferred to a 96-well microtitre plate and incubated at 37°C for
90 min (adhesion stage). After, the supernatant was removed and two gentle washes
with PBS were performed; then 200 µl of YNB supplemented with glucose (10 mM)
and with or without 100 µg/ml of lactoferrin were added in each well. A mature biofilm
was observed after 48 hours of incubation under the same conditions of adhesion
phase. After the biofilm formation, the supernatant was completely removed and the
cells were gently washed with sterile PBS, then cells were scraped from the well
using a scalpel, rinsed with sterile PBS and then centrifuged (10.000 rpm, 2 minutes).
25
Then, all supernatant was carefully removed and each pellet was placed in a freezer
at -80°C until RNA extraction.
Measurement of biofilm formation
After biofilm formation, as described previously, the supernatant was removed
and two washes with sterile PBS were made Biofilm quantification was performed by
adding 200 µl of 2,3 bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino)carbonyl]2H-tetrazolium hydroxide (XTT) (Invitrogen ™, Life Technologies, California, USA)
with menadione 1:20 in each well. The reduction reaction of XTT was done at 37 °C
for 3 hours without light. After this incubation, 100 µl of the supernatant were
transferred to another 96-well microtitre plate. The plate was read at 492 nm using a
spectrophotometer (Thermo TP-plate Reader) and the results were categorized
according Sanchez-Vargas et al (2013) (table1) [20].
Effect of human lactoferrin on the topography and biofilm thickness
The topographic architecture and the thickness of biofilms formed in the
presence and absence of human lactoferrin were analyzed by confocal laser
scanning microscopy (CLS). The protocol established by Chandra et al (2008) [21]
was used with modifications to enable the biofilm formation in borosilicate Lab-Tec ®
8 well plate (Thermo Fisher Scientific, Rochester, NY). The mature biofilm was
performed as previously described and after the last incubation (37 °C for 48 hours),
the biofilm was washed with sterile PBS to remove the non-adherence cells and
after, added a solution containing fluorescent dyes FUN-1 (10 mM) and
Concanavalin a-Alexa Fluor 488 (25 μg/ml) for 40 minutes at 37 °C without light
(Chandra, Mukherjee et al., 2008). The images were captured in confocal laser
scanning microscope TCS SP5 AOBS SECULAR Institute of Biomedical Sciences,
UFRJ and analyzed by FIJI ® software (Max Planck Institute, Dresden, Germany)
and the software LAS AF Lite ® (Leica, Berlin, Germany).
RNA extraction
The total RNA was extracted with the Ambion Pure Yeast kit (Ambion, Austin,
TX, USA) according to the manufacturer's instructions. In brief, the cells that were
participated the mature biofilm were transferred to tubes containing zirconia beads
26
and vortexing vigorously stirred for 10 min. Subsequently, the tubes were centrifuged
so as to separate the aqueous phase containing RNA from the organic phase. The
aqueous phase was aspirated from the tube and transferred to a new one contains
1.9 µL of binding buffer and 1.25 ml of ethanol 100%. Then, a final wash of fungal
RNA was conducted and 700 µL of the sample was transferred to a glass fiber filter,
which was centrifuged for one minute in order to filter the mixture. The RNA remained
attached to the filter and the solution was discarded. In order to clean the filter, was
added to each tube 700 µL of Wash Solution 1 and they were centrifuged.
Thereafter, 500 µL of Wash Solution 2/3 were added and further centrifugation was
carried out. The filter was removed and transferred to a new tube with 50 µL of water
RNase-free and a new centrifugation was conducted. Total RNA was quantified
before cDNA synthesis using the Fluorometric Quantification Qubit.
c-DNA synthesis
c-DNA synthesis was performed using Superscript III First-Standard Synthesis
SuperMix (Carisbad, California, USA) according to the manufacturer's instructions. In
brief, a mix with 5 μg of RNA was incubated for 5 minutes at 65 ° C and on ice for 1
minute, then was added to 10 µL of 2X First Strand Reaction Mix and 2 μl of
SuperScript ® III / RNaseOUT™ Enzyme Mix and submitted to vortex. The mixture
was incubated for 50 minutes at 50 ° C, 5 minutes at 25 ° C followed by 50 minutes
at 50 °C and 5 minutes at 85 °C. The c-DNA obtained was stored at -20 °C until the
polymerase chain reaction (PCR) be performed. The total c-DNA was quantified
using the Qubit Fluorometric Quantification.
Polymerase Chain Reaction (PCR)
The PCR amplification was performed in a total volume of 25 μL of mix using
the HWP1, SAP1, SAP4, SAP, SAP 6 and 5 (Table 2) primers. The reaction mix
consisted of: 19.5 μL of sterile water, 2.5 μL of reaction buffer (Promega, Madison,
WI, USA), 0.8 μL dNTP (Promega, Madison, WI, USA), 0,5 μLof Taq polymerase
(Promega, Madison, WI, USA), 0.8 μL of each primer (FW and RV) (Synthesis
Biotechnology, Belo Horizonte, Minas Gerais, Brazil) and 1 μL c-DNA. Amplification
procedure was performed with an initial desnaturation (1 min,95°C); 45 cycles of 30s
27
at 95°C, 45s at 50°C for HWP1 and 58°C for SAPs for annealing and 1 min at 72 °C;
with a final extension per 5min at 72 °C [22].
The product was separated in 1.6% (M/V) agarose gels containing DNA Syber
Stain (3 μL/100ml agarose) and viewed on a UV transiluminator.
All experiments were performed in triplicate to confirm the results.
Results
According to XTT-based classification, the biofilms formed by C. albicans
isolated from leukemic patient, healthy child and ATCC had a moderately profile of
production (Table3). The quantification of biofilm formed by C. albicans from the
leukemic group was higher than the other groups; and the groups with lactoferrin
treatment had a less quantification compared with those that were not treated with it
(Figure1). The same occurred with the mean thickness of biofilm analyzed by a
confocal laser scanning (Figure 2).
In figure 3, we could observe that the biofilm topography from health group
and ATCC were more uniform when compared with those treated with lactoferrin that
showed areas with low cellular density. This characteristic was not observed in
leukemic group, because both systems (with and without lactoferrin) presented
similar topography.
The lactoferrin appears to influence more in strains from healthy child and
ATCC strain in relation to genes expression. The biofilm yeasts from leukemic child
expressed the same genes with and without lactoferrin treatment: HWP1, SAP1,
SAP6. Otherwise, the biofilm yeasts from healthy child expressed HWP1, SAP1,
SAP5 and SAP6 genes, and with lactoferrin treatment the yeasts expressed only
HWP1 and SAP6. The HWP1 was expressed in all groups, regardless the presence
of lactoferrin. Others genes expression is showed in table 2.
Discussion
Candida albicans can invade humans and may lead to mucosal and skin
infections or to deep-seated mycoses of almost all inner organs, especially in
immunocompromised patients. The host immune status and the ability of C. albicans
28
to modulate the expression of its virulence factors are relevant aspects that drive the
candidal susceptibility or resistance [23]. Salivary anti-microbial proteins are
considered to be an important part of the non-immune host defense system in
preventing colonization and infection of the oral cavity by oral microorganisms. The
protective effects of saliva are evidenced by the microbial overgrowth found in
patients with salivary deficiencies [24]. According to the literature, lactoferrin has an
antifungal capacity but there is no consensus with regard to its inhibitory potency in
terms of cell density and lactoferrin concentration against Candida species [25, 26].
Alves et al. (2014) showed that lactoferrin were able to kill over 50% of cell growth of
C. albicans at concentrations less than 1X106 cell/ml with 100 µg/ml of lactoferrin. In
our study, we used 1X106 cell/ml of C. albicans and 100 µg/ml of lactoferrin so as to
have sufficient viable cells to induce the biofilm formation [17].
Inicial contact of C. albicans to host tissue, whether during commensal or
pathogenic phases, requires adhesion of the fungus to host cells. In fact, the physical
contact of C. albicans yeast to epithelial cells is sufficient to trigger rapid hyphal
formation and the expression of genes which mediate adhesion [27, 28], such as
adhesins, including members of the agglutinin-like sequence (Als) family and hyphal
wall protein 1 (Hwp1). Genes encoding these adhesins were shown to be expressed
in sample from patient suffering from oral candidiasis [29, 30]. The HWP1 gene is
responsible for the stable connection between germ tubes and biofilm formation
structures and also of the irreversibility of its formation [31]. Probably the lactoferrin
do not interfere in a expression of
HWP1 gen in this stage of biofilm formation
(mature biofilm) since in our study all groups expressed independent of lactoferrin
treatment
The secretion of aspartic proteases has long been recognized as a virulence
associated trait of this fungal pathogen [32]. The secreted aspartic proteases (Saps)
of C. albicans, which are encoded by a family of 10 homologous genes (SAPs1-10),
are known to contribute to the fungal pathogenicity due to the participation in several
facets of the infective process, including (i) degradation of tissue barriers during
invasion; (ii) destruction of host defense molecules by cleavage of different classes of
immunoglobulins, complement proteins, proteinaceous protease inhibitors, cytokines
and antimicrobial peptides; (iii) nutrition and (iv) adherence to both abiotic substrates
and biotic surfaces [3, 12, 33, 34]. The regulation of SAP genes results in changes in
29
growth environment, the morphological transition from yeast to hyphae, and the
presence of alternative phenotypes. The expression of these genes is a highly
regulated and linked to a complex co-regulation of transcription with other virulence
factors of Candida and the diverse functions of proteases [5, 33]. These genes
exhibit differential expression profiles at different stages and sites of infection [3,
33].The C. albicans yeast phase express predominantly SAP1-SAP3 genes while
SAP4-SAP6 are predominately express in the filamentous phase [3, 5]. Our finds
suggest that lactoferrin may be interfering in the yeast phase expression because in
health child isolate and ATCC (10231), SAP 1 was not express when it was treated
with lactoferrin, in the leukemic group it did not occur, probably because these yast
had more virulence. In addition the leukemic child isolation could be less susceptible
to lactoferrin.
In the yeast from leukemic child, it seems that lactoferrin did not affect the
expression of studied genes; perhaps it could have happened because the fungus
could be more virulent or even resistant due to constant exposure of these patients to
different drugs. But, in the healthy child yeast, it seems that lactoferrin interfere in
SAPs expression during biofilm formation, and it occur similarly with the reference
yeast (ATCC). Generally, our results seem to be promising and justify further studies
in order to detect these genes expression at different stages/time of biofilm
development.
Moreover, it would be interesting combine others methods such as
real time PCR that could exhibit other differences related with the expression amount
of each gene studied.
Conclusion
Lactoferin seems do not influence the expression of genes related to biofilm
formation by C. albicans isolated from leukemic child compared to C. albicans
isolated from health children.
30
References
[1]
Epstein JB, Ransier A, Lunn R, Chin E, Jacobson JJ, Le N, et al. Prophylaxis
of candidiasis in patients with leukemia and bone marrow transplants. Oral surgery,
oral medicine, oral pathology, oral radiology, and endodontics. 1996 Mar;81(3):291-6.
[2]
Semlali A, Killer K, Alanazi H, Chmielewski W, Rouabhia M. Cigarette smoke
condensate increases C. albicans adhesion, growth, biofilm formation, and EAP1,
HWP1 and SAP2 gene expression. BMC microbiology.14:61.
[3]
Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl
proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev. 2003
Sep;67(3):400-28, table of contents.
[4]
Ghannoum MA, Abu-Elteen KH. Pathogenicity determinants of Candida.
Mycoses. 1990 Jun;33(6):265-82.
[5]
Schaller M, Borelli C, Korting HC, Hube B. Hydrolytic enzymes as virulence
factors of Candida albicans. Mycoses. 2005 Nov;48(6):365-77.
[6]
Ramage G, Saville SP, Thomas DP, Lopez-Ribot JL. Candida biofilms: an
update. Eukaryotic cell. 2005 Apr;4(4):633-8.
[7]
Li F, Svarovsky MJ, Karlsson AJ, Wagner JP, Marchillo K, Oshel P, et al.
Eap1p, an adhesin that mediates Candida albicans biofilm formation in vitro and in
vivo. Eukaryotic cell. 2007 Jun;6(6):931-9.
[8]
Deveau A, Hogan DA. Linking quorum sensing regulation and biofilm
formation by Candida albicans. Methods in molecular biology (Clifton, NJ.
2011;692:219-33.
[9]
Orsi CF, Borghi E, Colombari B, Neglia RG, Quaglino D, Ardizzoni A, et al.
Impact of Candida albicans hyphal wall protein 1 (HWP1) genotype on biofilm
production and fungal susceptibility to microglial cells. Microbial pathogenesis. 2014
Apr-May;69-70:20-7.
[10] Staab JF, Bradway SD, Fidel PL, Sundstrom P. Adhesive and mammalian
transglutaminase substrate properties of Candida albicans Hwp1. Science (New
York, NY. 1999 Mar 5;283(5407):1535-8.
[11] de Groot PW, Bader O, de Boer AD, Weig M, Chauhan N. Adhesins in human
fungal pathogens: glue with plenty of stick. Eukaryotic cell. Apr;12(4):470-81.
[12] Hube B, Naglik J. Candida albicans proteinases: resolving the mystery of a
gene family. Microbiology (Reading, England). 2001 Aug;147(Pt 8):1997-2005.
[13] Amerongen AV, Veerman EC. Saliva--the defender of the oral cavity. Oral
diseases. 2002 Jan;8(1):12-22.
[14] Sanchez L, Calvo M, Brock JH. Biological role of lactoferrin. Archives of
disease in childhood. 1992 May;67(5):657-61.
31
[15] Panella TJ, Liu YH, Huang AT, Teng CT. Polymorphism and altered
methylation of the lactoferrin gene in normal leukocytes, leukemic cells, and breast
cancer. Cancer research. 1991 Jun 1;51(11):3037-43.
[16] Ward PP, Conneely OM. Lactoferrin: role in iron homeostasis and host
defense against microbial infection. Biometals. 2004 Jun;17(3):203-8.
[17] Alves TP, Simoes AC, Soares RM, Moreno DS, Portela MB, Castro GF.
Salivary lactoferrin in HIV-infected children: Correlation with Candida albicans
carriage, oral manifestations, HIV infection and its antifungal activity. Archives of oral
biology. 2014 Aug;59(8):775-82.
[18] Lee J, Willians L, Warnock D, Arthington-Skaggs B. Drug resistance genes
and trailing growth in Candida albicans isolates. J Antimicrob Chemother.
2004;53:217-24.
[19] Thein ZM, Samaranayake YH, Samaranayake LP. Characteristics of dual
species Candida biofilms on denture acrylic surfaces. Archives of oral biology. 2007
Dec;52(12):1200-8.
[20] Sanchez-Vargas LO, Estrada-Barraza D, Pozos-Guillen AJ, Rivas-Caceres R.
Biofilm formation by oral clinical isolates of Candida species. Archives of oral biology.
2013 Oct;58(10):1318-26.
[21] Chandra J, Mukherjee PK, Ghannoum MA. In vitro growth and analysis of
Candida biofilms. Nature protocols. 2008;3(12):1909-24.
[22] Nas T, Kalkanci A, Fidan I, Hizel K, Bolat S, Yolbakan S, et al. Expression of
ALS1, HWP1 and SAP4 genes in Candida albicans strains isolated from women with
vaginitis. Folia microbiologica. 2008;53(2):179-83.
[23] Santos AL, Braga-Silva LA. Aspartic protease inhibitors: effective drugs
against the human fungal pathogen Candida albicans. Mini reviews in medicinal
chemistry. 2013 Jan;13(1):155-62.
[24] Back-Britto G, Mota A, Vasconcellos T, Querido S, Jorge A, Reis A, et al.
Frequenc Frequency of Candida spp. in the Oral Cavity of Brazilian HIV-Positive
Patients and correlation with CD4 Cell Counts and Viral Load. Mycopathologia.
2009;167:81-7.
[25] Rudney JD, Kajander KC, Smith QT. Correlations between human salivary
levels of lysozyme, lactoferrin, salivary peroxidase and secretory immunoglobulin A
with different stimulatory states and over time. Archives of oral biology. 1985;30(1112):765-71.
[26] van der Strate BW, Harmsen MC, The TH, Sprenger HG, de Vries H,
Eikelboom MC, et al. Plasma lactoferrin levels are decreased in end-stage AIDS
patients. Viral immunology. 1999;12(3):197-203.
[27] Wachtler B, Wilson D, Haedicke K, Dalle F, Hube B. From attachment to
damage: defined genes of Candida albicans mediate adhesion, invasion and damage
during interaction with oral epithelial cells. PloS one. 2011;6(2):e17046.
32
[28] Zakikhany K, Naglik JR, Schmidt-Westhausen A, Holland G, Schaller M, Hube
B. In vivo transcript profiling of Candida albicans identifies a gene essential for
interepithelial dissemination. Cellular microbiology. 2007 Dec;9(12):2938-54.
[29] Green CB, Marretta SM, Cheng G, Faddoul FF, Ehrhart EJ, Hoyer LL. RTPCR analysis of Candida albicans ALS gene expression in a hyposalivatory rat
model of oral candidiasis and in HIV-positive human patients. Medical mycology.
2006 Mar;44(2):103-11.
[30] Zhao X, Daniels KJ, Oh SH, Green CB, Yeater KM, Soll DR, et al. Candida
albicans Als3p is required for wild-type biofilm formation on silicone elastomer
surfaces. Microbiology (Reading, England). 2006 Aug;152(Pt 8):2287-99.
[31] Sundstrom P. Adhesins in Candida albicans. Current opinion in microbiology.
1999 Aug;2(4):353-7.
[32] Staib F. Proteolysis and pathogenicity of Candida albicans strains.
Mycopathologia et mycologia applicata. 1969 May 28;37(4):345-8.
[33] Naglik J, Albrecht A, Bader O, Hube B. Candida albicans proteinases and
host/pathogen interactions. Cellular microbiology. 2004 Oct;6(10):915-26.
[34] De Bernardis F, Sullivan PA, Cassone A. Aspartyl proteinases of Candida
albicans and their role in pathogenicity. Medical mycology. 2001 Aug;39(4):303-13.
33
Tables and Figures
Table 1: XTT-based classification of Candida spp. biofilm formation [20].
Group
Biofilm formation
OD 492 nm
I
Not producer
≤0,1
II
Weakly producer
0,11-0,40
III
Moderately producer
0,41-0,74
IV
Strongly producer
≥0,75
Table 2: Primer Sequence
Primer
HWP1
SAP1
SAP4
SAP5
SAP6
5’- sequence- 3’
FW: GACCGTCTACCTGTGGGACAGT
RV: GCTCAACTTATTGCTATCGCTTATTACA
FW: AACCAATAGTGATGTCAGCAGCAT
RV: ACAAGCCCTCCCAGTTACTTTAAA
FW: AAACGGCATTTGAATCTGGAA
RV: CAAAAACTTAGCGTTATTGTTGACACT
FW: CCAGCATCTTCCCGCACTT
RV: GCGTAAGAACCGTCACCATATTTAA
FW: CCTTATTCGAACCGATCTCCAA
RV: CAATGCCTCTTATCAACGACAAGA
34
Table 3: XTT-based classification of Candida spp.biofilm formation in the different groups.
Mean of absorvance values (nm)
Biofil formation
Leukemia1
0,539
Moderately
Leukemia+LF2
0,528
Moderately
Health3
0,510
Moderately
Health+LF4
0,490
Moderately
ATCC5
0,484
Moderately
ATCC+LF6
0,428
Moderately
(1) Biofilme formed by C.albicans isolated from leukemic child; (2) Biofilme formed by C.albicans isolated from
leukemic child treated with lactoferrin; (3) Biofilme formed by C.albicans isolated from health child; (4) Biofilme
formed by C.albicans isolated from leukemic child treated with lactoferrin (5) Biofilme formed by ATCC (10231)
yeast (6) Biofilme formed by ATCC (10231) yeast treated with lactoferrin.
Table 4: Expression of HWP1, SAP1, SAP4, SAP5 and SAP 6 in the different groups
Group
HWP1
SAP1
SAP4
SAP5
SAP6
Leukemic
+
+
-
-
+
Leukemic + LF
+
+
-
-
+
Health
+
+
-
+
+
Health +LF
+
-
-
-
+
ATCC
+
+
-
-
+
ATCC + LF
+
-
+
-
-
Gen
35
0,6
0,5
nm
0,4
0,3
0,2
0,1
0
Leukemia
No Lactoferrin
Health
ATCC
Lactoferrin
Figure 1: Quantification of biofilm through mean value of absorvance (nm) based on XTT in the
different groups.
35
30
25
µm
20
15
10
5
0
Leukemic
Health
No Lactoferrin
ATCC
Lactoferrin
Figure 2: Mean thickness of biofilms formed by C.albicans isolated from leukemic children,
healthy children and ATCC without lactoferrin treatment (no Lactoferrin) and with lactoferrin
tratment (Lactoferrin), analyzed by confocal laser scanning.
36
Confocal laser scanning image (Magnitude 40X) in a front view (left) and 3D reconstruction (right) of
biofilm formed by C. albicans from: leukemic yeast (A); leukemic yeast with lactoferrin treatment (B);
healthy yeast (C); healthy yeast with lactoferrin treatment (D); ATCC (10231) (E); and ATCC (10231)
with lactoferrin treatment (F). Biofilms were formed per 48 hours and after washed and stained by
FUN-1 (red, representing metabolically active cells) and Con-A alexa fluor 488 (green, representing
binding with polysaccharide from cell wall or extracellular matrix).
Figure 3 : Biofilm topography formed by C. albicans in the different groups analyzed by
confocal laser scanning (Magnitude 40X)
37
4 . D IS C U S S Ã O
As
manifestações
bucais
associadas
à
leucemia
geralmente
são
consequências da intensa imunossupressão causada pela quimioterapia. Vários
estudos têm revelado um aumento na incidência de manifestações bucais que
ocorrem em pacientes pediátricos com doenças oncológicas (ANIRUDHAN et al.,
2008; LEVY-POLACK, SEBELLI & POLACK, 1998; SEPULVEDA et al., 2005).
Nossa revisão sistemática analisou diversos artigos na literatura científica, sobre
manifestações bucais em crianças com leucemia, de acordo com os nossos critérios,
dois artigos dos seis selecionados tiveram moderada qualidade metodológica.
Devido ao número reduzido de estudos selecionados, não pudemos realizar uma
meta-análise desses estudos. O trabalho de Ponce-Torres et al (2010) foi o estudo
com melhor classificação de acordo com nossos critérios. Eles relataram a presença
de
gengivite,
cárie,
mucosite,
periodontite,
quelite,
herpes
recorrente,
gengivoestomatiteherpética e candidíase oral. De acordo com a imunofenotipagem
da leucemia como fator de risco para o desenvolvimento de manifestação bucal, os
autores observaram que os pacientes que tinham ALL (células B) tinham uma
probabilidade de 6,82% de desenvolver candidíase; 90,70% de desenvolver
gengivite e 38,64% de desenvolver mucosite; e pacientes com ALL (células-T)
tinham uma probabilidade de 100% de desenvolver gengivite e 40% de desenvolver
mucosite (PONCE-TORRES et al., 2010).
Em nosso estudo, o histórico de manifestação bucal foi relatado três vezes
mais no grupo de crianças com leucemia, quando comparada com o grupo controle.
Porém, durante o exame intra bucal, manifestações bucal foram observadas em
apenas 4 pacientes com leucemia e 1 paciente saudável. Provavelmente
encontramos uma baixa incidência de manifestações bucal, pois a maioria dos
pacientes não apresentavam neutropenia ou porque grande parte da nossa amostra
está na fase de manutenção do tratamento, fase esta que os pacientes recebem
menor quantidade de quimioterápico.
Uma manifestação oral bastante frequente em crianças com leucemia é a
candidíase 3,5-27,2% (MICHAUD et al., 1977; ORBAK & ORBAK, 1997; PONCE-
38
TORRES et al., 2010; SUBRAMANIAM, BABU & NAGARATHNA, 2008) que tem
como principal fator etiológico a Candida albicans, porém outras espécies têm sido
associadas como a C. tropicalis, C. stellatoidea, C. krusei, C. parapsilosis, C.
glabrata (BOSCO et al., 2003; POWDERLY, 1992) e C.dubliniensis (MEILLER et al.,
1999; SULLIVAN et al., 1995). Em nosso estudo a candidíase oral foi relatada por 3
pacientes da amostra e a presença dessa lesão durante o exame foi diagnosticada
em apenas uma criança com leucemia; porém Candida spp. foi isolada em 53,2%
da amostra, tendo uma diferença estatisticamente significante quando comparada ao
grupo controle (p=0,01, teste qui-quadrado). Dentre as espécies de Candida isoladas
da cavidade bucal das crianças com leucemia observou-se que a C.albicans foi a
mais prevalente, seguida pelas C. famata; C. guillermondii, C. parapsilosis; C.
pelliculosa e C. tropicallis. Em 2006, um estudo com crianças e adolescentes com
câncer (16 com LLA), C. albicans também foi à espécie mais prevalente, e outras
espécies também foram identificadas em pacientes com alto grau de neutropenia: C.
Kefyr, C. lusitaniae, C. sake e C. tropicalis (ALBERTH et al., 2006). É importante
ressaltar que a identificação do nosso estudo ocorreu, antes mesmo que esse fungo
provocasse a lesão e isso é de extrema importância, uma vez que a disseminação
desse fungo pode além de desenvolver a lesão bucal, causar uma infecção
sistêmica o que é extremamente perigoso devido à baixa imunidade desses
pacientes.
Proteínas salivares com ação antimicrobiana são consideradas como parte
importante do sistema de defesa do hospedeiro a fim de prevenir a colonização e
infecção da cavidade bucal por microrganismos (GROOT et al., 2006). Estudos
destacam que os componentes intrínsecos deste sistema tais como; histatinas,
cistatina, imunoglobulinas e outras proteínas salivares, como a lisozima e a
Lactoferrina são capazes de inibir o crescimento de várias espécies de Candida
(VAN NIEUW, BOLSCHER & VEERMAN, 2004; WRAY, FELIX & CUMMING, 1990).
Esses componentes podem representar, portanto, escolhas atraentes para serem
utilizados em combinação com antifúngicos clássicos, desde que a disponibilidade e
toxicidade destes agentes endógenos estejam bem estabelecidas (KUIPERS et al.,
1999). As vantagens adicionais da utilização destes fatores intrínsecos presentes na
saliva são: disponibilidade, baixo custo e falta de toxicidade (OPPENHEIM et al.,
1988; POLLOCK et al., 1992)
39
A atividade antifúngica da lactoferrina humana já foi previamente descrita na
literatura (NIKAWA et al., 1993; SAMARANAYAKE et al., 2001). Alves et al. (2014)
relatou que a média da concentração de lactoferina humana na boca de crianças
saudáveis é de aproximadamente 5,74 μg/ml, e que a concentração de 100 μg/ml
pode matar cerca 50% de isolados clínicos de C. albicans. Nosso estudo utilizou a
concentração de 100 μg/ml de lactoferrina humana com referência no estudo acima
para avaliar sua influência na formação do biofilme.
A formação de biofilme pela C.albicans é um processo multicelular complexo,
composto pela adesão celular, crescimento do fungo e mudança morfogênica do
estado leveduriforme para o estado filamentoso (DEVEAU & HOGAN, 2011; LI et al.,
2007). O monitoramento da expressão gênica pela mensuração dos níveis de RNA
mensageiro (RNAm) em células do biofilme pode identificar genes envolvidos na
formação do biofilme (BUSTIN, 2002). A adesão das células de C. albicans a células
hospedeiras é um pré-requisito para a formação de biofilme, as interações célulacélula é importante na organização hierárquica de células dentro do biofilme
(RAMAGE et al., 2005). Numerosos genes de C. albicans já foram identificados
como relevantes para o desenvolvimento do biofilme (ORSI et al., 2014).
O gene HWP1 é conhecido por codificar proteínas de C. albicans envolvida
em várias funções, dentre elas a adesão a parede celular, a sinalização intracelular
e desenvolvimento de hifas; além disso, promove a ligação as células epiteliais, que
é o passo inicial da colonização (DE GROOT et al., 2013; STAAB et al., 1999). Ele é
responsável pela ligação estável entre os tubos germinativos e as estruturas
formadoras do biofilme e pela irreversibilidade de sua formação (SUNDSTROM,
1999). De acordo com nossos resultados, podemos supor que a lactoferrina não
interfere nessa fase inicial da formação do biofilme, uma vez que todas as mostras
expressaram esse gen.
A regulação dos genes SAP resulta de mudanças no ambiente, crescimento,
na transição morfológica de levedura para hifa, e na presença de fenótipos
alternativos. A expressão desses genes é um processo altamente regulado e
interligado a uma complexa co-regulação da transcrição com outros fatores de
virulência da Candida e com as múltiplas funções das proteases in vivo (NAGLIK et
al., 2004; SCHALLER
et al., 2005). As células leveduriformes da C. albicans
40
expressam predominantemente os genes SAP1 a SAP3, enquanto na fase
filamentosa predominam SAP4 a SAP6 (NAGLIK, CHALLACOMBE & HUBE, 2003;
SCHALLER et al., 2005). Nossos achados sugerem que a lactoferrina pode estar
interferindo na expressão da fase leveduriforme pois SAP1 não foi expressa no
grupo de crianças com leucemia e ATCC (10231) quando tratados com lactoferrina.
Porém, na fase filamentosa, não tivemos um resultado conclusivo sobre a
interferência da lactoferrina, uma vez que observamos uma identificação variada da
expressão dos genes SAP4, SAP5 e SAP 6.
41
5 . C ON C L U S Ã O
6.1 Com base nos estudos selecionados pela revisão sistemática, podemos
concluir que a alta prevalência de manifestações bucais em crianças com
leucemia tem moderada evidência científica, e que gengivite e mucosite são
as manifestações orais mais prevalentes.
6.2 As manifestações orais identificadas em crianças com leucemia foram:
candidiase, mucosite, eritema linear gengival e cárie.
6.3 O crescimento das colônias foi classificado forte em ambos os grupos.
Candida spp. foi identificada na saliva de crianças com leucemia com uma
frequência quatro vezes maior do que nas crianças saudáveis. C. albicans foi
a espécie mais freqüente nos dois grupos. As espécies identificadas no grupo
com leucemia foram: C. Albicans, C. parapsilosis, C. Guillermondii, C.famata,
C. pelliculosa e C.tropicallis. E no grupo saudáveis foram: C. Albicans, C.
parapsilosis, C.famata, C.tropicallis e C.lusitaniae
6.4 Não houve correlação dos achados microbiológicos com os dados clínicos
relacionados à doença nas crianças com leucemia.
6.5 A lactoferrina humana influenciou de forma variada a expressão dos gens
estudados. O gen HWP1 foi expresso em todos os grupos, independente do
uso da lactoferrina. O gen SAP1 sofreu influência da lactoferrina nas cepas de
crianças saudáveis e ATCC (10231), quando comparado à cepa da criança
com leucemia. E a influência da lactoferrina na expressão dos genes SAP4-6
ocorreu de forma variada.
42
6 . C ON S ID E R AÇ Õ E S F IN AI S
Mais estudos sobre a influência da lactoferrina devem ser realizados para
uma melhor compreensão dos seus efeitos sobre os fatores de virulência da
Candida albicans. A análise nas diferentes fases (6h, 12h, 24h, 36h e 48h) da
formação do biofilme deve elucidar de forma mais precisa em que momento os
genes relacionados com esta formação estão sendo expressos. Além disso, outras
técnicas que quantifiquem a expressão desses genes possam colaborar para melhor
compreensão do quanto que a lactoferrina está influenciando nesse processo.
43
R E F E R Ê N C I AS B IB I O GR Á F IC AS
ADLEROVA, L. B., A; FALDYNA,M. Lactoferrin: a review. Veterinarni Medicina.
53(9), 457-468, 2008.
ALBERTH, M., MAJOROS, L., KOVALECZ, G., BORBAS, E., SZEGEDI, I., I, J. M.
&KISS, C. Significance of oral Candida infections in children with cancer. Pathol
Oncol Res. 12(4), 237-241, 2006.
ALVES, T. P., SIMOES, A. C., SOARES, R. M., MORENO, D. S., PORTELA, M. B.
&CASTRO, G. F. Salivary lactoferrin in HIV-infected children: Correlation with
Candida albicans carriage, oral manifestations, HIV infection and its antifungal
activity. Arch Oral Biol. 59(8), 775-782, 2014.
AMERONGEN, A. V. &VEERMAN, E. C. Saliva--the defender of the oral cavity.
Oral Dis. 8(1), 12-22, 2002.
ANIRUDHAN, D., BAKHSHI, S., XESS, I., BROOR, S. &ARYA, L. S. Etiology and
outcome of oral mucosal lesions in children on chemotherapy for acute
lymphoblastic leukemia. Indian Pediatr. 45(1), 47-51, 2008.
BAKER, H. M. &BAKER, E. N. Lactoferrin and iron: structural and dynamic
aspects of binding and release. Biometals. 17(3), 209-216, 2004.
BOSCO, V. L., BIRMAN, E. G., CURY, A. E. &PAULA, C. R. Yeasts from the oral
cavity of children with AIDS: exoenzyme production and antifungal resistance.
Pesqui Odontol Bras. 17(3), 217-222, 2003.
BRAGA, P. E., LATORRE, M. M. R. &CURADO, M. P. Childhood cancer: a
comparative analysis of incidence, mortality, and survival in Goiania (Brazil)
and other countries]. Cad Saude Publica. 18(1), 33-44, 2002.
BROGDEN, K. A., ACKERMANN, M., MCCRAY, P. B., JR. &TACK, B. F.
Antimicrobial peptides in animals and their role in host defences. Int J
Antimicrob Agents. 22(5), 465-478, 2003.
BURKE, V. P. &STARTZELL, J. M. The leukemias. Oral Maxillofac Surg Clin North
Am. 20(4), 597-608, 2008.
BUSTIN, S. A. Quantification of mRNA using real-time reverse transcription
PCR (RT-PCR): trends and problems. J Mol Endocrinol. 29(1), 23-39, 2002.
CALDERONE, R. A. &FONZI, W. A. Virulence factors of Candida albicans. Trends
Microbiol. 9(7), 327-335, 2001.
CERQUEIRA, D. F., PORTELA, M. B., POMARICO, L., DE ARAUJO SOARES, R.
M., DE SOUZA, I. P. &CASTRO, G. F. Oral Candida colonization and its relation
with predisposing factors in HIV-infected children and their uninfected siblings
44
in Brazil: the era of highly active antiretroviral therapy. J Oral Pathol Med. 39(2),
188-194, 2010.
CHAGAS, M. S., PORTELA, M. B., CERQUEIRA, D. F., DE SOUZA, I. P., SOARES,
R. M. &CASTRO, G. F. Reduction of Candida species colonization in the oral
cavity of children infected with human immunodeficiency virus after dental
treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 108(3), 383-388,
2009.
CHANDRA, J., KUHN, D. M., MUKHERJEE, P. K., HOYER, L. L., MCCORMICK, T.
&GHANNOUM, M. A. Biofilm formation by the fungal pathogen Candida
albicans: development, architecture, and drug resistance. J Bacteriol. 183(18),
5385-5394, 2001.
CHANDRA, J., MUKHERJEE, P. K. &GHANNOUM, M. A. In vitro growth and
analysis of Candida biofilms. Nat Protoc. 3(12), 1909-1924, 2008.
CUBUKCU, C. E. &GUNES, A. M. Caries experience of leukemic children during
intensive course of chemotherapy. J Clin Pediatr Dent. 32(2), 155-158, 2008.
DARWAZEH, A. M. &AL-BASHIR, A. Oral candidal flora in healthy infants. J Oral
Pathol Med. 24(8), 361-364, 1995.
DE BERNARDIS, F., SULLIVAN, P. A. &CASSONE, A. Aspartyl proteinases of
Candida albicans and their role in pathogenicity. Med Mycol. 39(4), 303-313,
2001.
DE GROOT, P. W., BADER, O., DE BOER, A. D., WEIG, M. &CHAUHAN, N.
Adhesins in human fungal pathogens: glue with plenty of stick. Eukaryot Cell.
12(4), 470-481, 2013.
DEVEAU, A. &HOGAN, D. A. Linking quorum sensing regulation and biofilm
formation by Candida albicans. Methods Mol Biol. 692, 219-233, 2011.
EL-HOUSSEINY, A. A., SALEH, S. M., EL-MASRY, A. A. &ALLAM, A. A.
Assessment of oral complications in children receiving chemotherapy. J Clin
Pediatr Dent. 31(4), 267-273, 2007.
ELLIS, C. A. &SPIVACK, M. L. The significance of candidemia. Ann Intern Med.
67(3), 511-522, 1967.
EPSTEIN, J. B., RANSIER, A., LUNN, R., CHIN, E., JACOBSON, J. J., LE, N.
&REECE, D. Prophylaxis of candidiasis in patients with leukemia and bone
marrow transplants. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 81(3), 291296, 1996.
FINKEL, J. S. &MITCHELL, A. P. Genetic control of Candida albicans biofilm
development. Nat Rev Microbiol. 9(2), 109-118, 2010.
GHANNOUM, M. A. Potential role of phospholipases in virulence and fungal
pathogenesis. Clin Microbiol Rev. 13(1), 122-143, table of contents, 2000.
45
GHANNOUM, M. A. &ABU-ELTEEN, K. H. Pathogenicity determinants of
Candida. Mycoses. 33(6), 265-282, 1990.
GONZALEZ-CHAVEZ, S. A., AREVALO-GALLEGOS, S. &RASCON-CRUZ, Q.
Lactoferrin: structure, function and applications. Int J Antimicrob Agents. 33(4),
301 e301-308, 2009.
GREENSPAN, D. &GREENSPAN, J. S. Oral manifestations of human
immunodeficiency virus infection. Dent Clin North Am. 37(1), 21-32, 1993.
GROOT, F., SANDERS, R. W., TER BRAKE, O., NAZMI, K., VEERMAN, E. C.,
BOLSCHER, J. G. &BERKHOUT, B. Histatin 5-derived peptide with improved
fungicidal properties enhances human immunodeficiency virus type 1
replication by promoting viral entry. J Virol. 80(18), 9236-9243, 2006.
HOSSAIN, H., ANSARI, F., SCHULZ-WEIDNER, N., WETZEL, W. E.,
CHAKRABORTY, T. &DOMANN, E. Clonal identity of Candida albicans in the
oral cavity and the gastrointestinal tract of pre-school children. Oral Microbiol
Immunol. 18(5), 302-308, 2003.
HOU, G. L., HUANG, J. S. &TSAI, C. C. Analysis of oral manifestations of
leukemia: a retrospective study. Oral Dis. 3(1), 31-38, 1997.
HOYER, L. L., GREEN, C. B., OH, S. H. &ZHAO, X. Discovering the secrets of the
Candida albicans agglutinin-like sequence (ALS) gene family--a sticky pursuit.
Med Mycol. 46(1), 1-15, 2008.
HUBE, B. From commensal to pathogen: stage- and tissue-specific gene
expression of Candida albicans. Curr Opin Microbiol. 7(4), 336-341, 2004.
HUBE, B. &NAGLIK, J. Candida albicans proteinases: resolving the mystery of a
gene family. Microbiology. 147(Pt 8), 1997-2005, 2001.
HUBE, B., STEHR, F., BOSSENZ, M., MAZUR, A., KRETSCHMAR, M. &SCHAFER,
W. Secreted lipases of Candida albicans: cloning, characterisation and
expression analysis of a new gene family with at least ten members. Arch
Microbiol. 174(5), 362-374, 2000.
ILGENLI, T., OREN, H. &UYSAL, K. The acute effects of chemotherapy on the
oral cavity. Prevention and management. . Turkish J Cancer. 31, 93-105, 2001.
JACOB, L. S., FLAITZ, C. M., NICHOLS, C. M. &HICKS, M. J. Role of dentinal
carious lesions in the pathogenesis of oral candidiasis in HIV infection. J Am
Dent Assoc. 129(2), 187-194, 1998.
KIRKPATRICK, C. H., GREEN, I., RICH, R. R. &SCHADE, A. L. Inhibition of
growth of Candida albicans by iron-unsaturated lactoferrin: relation to hostdefense mechanisms in chronic mucocutaneous candidiasis. J Infect Dis.
124(6), 539-544, 1971.
KUHARA, T., IIGO, M., ITOH, T., USHIDA, Y., SEKINE, K., TERADA, N.,
OKAMURA, H. &TSUDA, H. Orally administered lactoferrin exerts an
46
antimetastatic effect and enhances production of IL-18 in the intestinal
epithelium. Nutr Cancer. 38(2), 192-199, 2000.
KUIPERS, M. E., DE VRIES, H. G., EIKELBOOM, M. C., MEIJER, D. K. &SWART,
P. J. Synergistic fungistatic effects of lactoferrin in combination with antifungal
drugs against clinical Candida isolates. Antimicrob Agents Chemother. 43(11),
2635-2641, 1999.
LAIBLE, N. J. &GERMAINE, G. R. Bactericidal activity of human lysozyme,
muramidase-inactive lysozyme, and cationic polypeptides against
Streptococcus sanguis and Streptococcus faecalis: inhibition by chitin
oligosaccharides. Infect Immun. 48(3), 720-728, 1985.
LAMEY, P. J. &SAMARANAYAKE, L. P. Oral candidosis: 2. Diagnosis and
management. Dent Update. 15(8), 328-331, 1988.
LEGRAND, D., ELASS, E., CARPENTIER, M. &MAZURIER, J. Lactoferrin: a
modulator of immune and inflammatory responses. Cell Mol Life Sci. 62(22),
2549-2559, 2005.
LEVY-POLACK, M. P., SEBELLI, P. &POLACK, N. L. Incidence of oral
complications and application of a preventive protocol in children with acute
leukemia. Spec Care Dentist. 18(5), 189-193, 1998.
LI, F., SVAROVSKY, M. J., KARLSSON, A. J., WAGNER, J. P., MARCHILLO, K.,
OSHEL, P., ANDES, D. &PALECEK, S. P. Eap1p, an adhesin that mediates
Candida albicans biofilm formation in vitro and in vivo. Eukaryot Cell. 6(6), 931939, 2007.
LYNCH, M. A. &SHIP, II. Oral manifestations of leukemia: a postdiagnostic
study. J Am Dent Assoc. 75(5), 1139-1144, 1967.
MACIEL, J. C., DE CASTRO, C. G., JR., BRUNETTO, A. L., DI LEONE, L. P. &DA
SILVEIRA, H. E. Oral health and dental anomalies in patients treated for
leukemia in childhood and adolescence. Pediatr Blood Cancer. 53(3), 361-365,
2009.
MAGUIRE, A., CRAFT, A. W., EVANS, R. G., AMINEDDINE, H., KERNAHAN, J.,
MACLEOD, R. I., MURRAY, J. J. &WELBURY, R. R. The long-term effects of
treatment on the dental condition of children surviving malignant disease.
Cancer. 60(10), 2570-2575, 1987.
MAZURIER, J. &SPIK, G. Comparative study of the iron-binding properties of
human transferrins. I. Complete and sequential iron saturation and
desaturation of the lactotransferrin. Biochim Biophys Acta. 629(2), 399-408, 1980.
MEDEIROS, E. B., CARVALHO, D. S. S., GOMINHO, L. F., QUINTAS, C. L.
&RODRIGUES, M. J. Oral manifestations in children submitted to antineoplasic
treatment at the Oncology Center of Oswaldo Cruz University Hospital. J. Bras.
Odontopediatr. Odontol. Bebe. 5(476-483), 2002.
47
MEILLER, T. F., JABRA-RIZK, M. A., BAQUI, A., KELLEY, J. I., MEEKS, V. I.,
MERZ, W. G. &FALKLER, W. A. Oral Candida dubliniensis as a clinically
important species in HIV-seropositive patients in the United States. Oral Surg
Oral Med Oral Pathol Oral Radiol Endod. 88(5), 573-580, 1999.
MEYER, U., KLEINHEINZ, J., HANDSCHEL, J., KRUSE-LOSLER, B., WEINGART,
D. &JOOS, U. Oral findings in three different groups of immunocompromised
patients. J Oral Pathol Med. 29(4), 153-158, 2000.
MICHAUD, M., BAEHNER, R. L., BIXLER, D. &KAFRAWY, A. H. Oral
manifestations of acute leukemia in children. J Am Dent Assoc. 95(6), 1145-1150,
1977.
MUKHERJEE, P. K., ZHOU, G., MUNYON, R. &GHANNOUM, M. A. Candida
biofilm: a well-designed protected environment. Med Mycol. 43(3), 191-208,
2005.
NAGLIK, J., ALBRECHT, A., BADER, O. &HUBE, B. Candida albicans proteinases
and host/pathogen interactions. Cell Microbiol. 6(10), 915-926, 2004.
NAGLIK, J. R., CHALLACOMBE, S. J. &HUBE, B. Candida albicans secreted
aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev.
67(3), 400-428, table of contents, 2003.
NASIM, V. S., SHETTY, Y. R. &HEGDE, A. M. Dental health status in children
with acute lymphoblastic leukemia. J Clin Pediatr Dent. 31(3), 210-213, 2007.
NIKAWA, H., SAMARANAYAKE, L. P., TENOVUO, J., PANG, K. M. &HAMADA, T.
The fungicidal effect of human lactoferrin on Candida albicans and Candida
krusei. Arch Oral Biol. 38(12), 1057-1063, 1993.
NIKAWA, H., YAMASHIRO, H., MAKIHIRA, S., NISHIMURA, M., EGUSA, H.,
FURUKAWA, M., SETIJANTO, D. &HAMADA, T. In vitro cariogenic potential of
Candida albicans. Mycoses. 46(11-12), 471-478, 2003.
OPPENHEIM, F. G., XU, T., MCMILLIAN, F. M., LEVITZ, S. M., DIAMOND, R. D.,
OFFNER, G. D. &TROXLER, R. F. Histatins, a novel family of histidine-rich
proteins in human parotid secretion. Isolation, characterization, primary
structure, and fungistatic effects on Candida albicans. J Biol Chem. 263(16),
7472-7477, 1988.
ORBAK, R. &ORBAK, Z. Oral condition of patients with leukemia and lymphoma.
J Nihon Univ Sch Dent. 39(2), 67-70, 1997.
ORSI, C. F., BORGHI, E., COLOMBARI, B., NEGLIA, R. G., QUAGLINO, D.,
ARDIZZONI, A., MORACE, G. &BLASI, E. Impact of Candida albicans hyphal wall
protein 1 (HWP1) genotype on biofilm production and fungal susceptibility to
microglial cells. Microb Pathog. 69-70, 20-27, 2014.
PANELLA, T. J., LIU, Y. H., HUANG, A. T. &TENG, C. T. Polymorphism and
altered methylation of the lactoferrin gene in normal leukocytes, leukemic cells,
and breast cancer. Cancer Res. 51(11), 3037-3043, 1991.
48
PHILIP, A. &POPLACK, D. G. Principles and practice of Pediatric Oncology.
Childhood cancer: incidence, survival, and mortality. 4, 1-11, 2002.
POLLOCK, J. J., SANTARPIA, R. P., 3RD, HELLER, H. M., XU, L., LAL, K.,
FUHRER, J., KAUFMAN, H. W. &STEIGBIGEL, R. T. Determination of salivary
anticandidal activities in healthy adults and patients with AIDS: a pilot study. J
Acquir Immune Defic Syndr. 5(6), 610-618, 1992.
PONCE-TORRES, E., RUIZ-RODRIGUEZ MDEL, S., ALEJO-GONZALEZ, F.,
HERNANDEZ-SIERRA, J. F. &POZOS-GUILLEN ADE, J. Oral manifestations in
pediatric patients receiving chemotherapy for acute lymphoblastic leukemia. J
Clin Pediatr Dent. 34(3), 275-279, 2010.
PORTELA, M. B., SOUZA, I. P., COSTA, E. M., HAGLER, A. N., SOARES, R. M.
&SANTOS, A. L. Differential recovery of Candida species from subgingival sites
in human immunodeficiency virus-positive and healthy children from Rio de
Janeiro, Brazil. J Clin Microbiol. 42(12), 5925-5927, 2004.
POWDERLY, W. G. Mucosal candidiasis caused by non-albicans species of
Candida in HIV-positive patients. Aids. 6(6), 604-605, 1992.
RAMAGE, G., SAVILLE, S. P., THOMAS, D. P. &LOPEZ-RIBOT, J. L. Candida
biofilms: an update. Eukaryot Cell. 4(4), 633-638, 2005.
SAMARANAYAKE, Y. H., SAMARANAYAKE, L. P., POW, E. H., BEENA, V. T.
&YEUNG, K. W. Antifungal effects of lysozyme and lactoferrin against
genetically similar, sequential Candida albicans isolates from a human
immunodeficiency virus-infected southern Chinese cohort. J Clin Microbiol.
39(9), 3296-3302, 2001.
SANCHEZ-VARGAS, L. O., ESTRADA-BARRAZA, D., POZOS-GUILLEN, A. J.
&RIVAS-CACERES, R. Biofilm formation by oral clinical isolates of Candida
species. Arch Oral Biol. 58(10), 1318-1326, 2013.
SANCHEZ, L., CALVO, M. &BROCK, J. H. Biological role of lactoferrin. Arch Dis
Child. 67(5), 657-661, 1992.
SATO, R., INANAMI, O., TANAKA, Y., TAKASE, M. &NAITO, Y. Oral administration
of bovine lactoferrin for treatment of intractable stomatitis in feline
immunodeficiency virus (FIV)-positive and FIV-negative cats. Am J Vet Res.
57(10), 1443-1446, 1996.
SCHALLER, M., BORELLI, C., KORTING, H. C. &HUBE, B. Hydrolytic enzymes as
virulence factors of Candida albicans. Mycoses. 48(6), 365-377, 2005.
SEPULVEDA, E., BRETHAUER, U., ROJAS, J., FERNANDEZ, E. &LE FORT, P.
Oral ulcers in children under chemotherapy: clinical characteristics and their
relation with Herpes Simplex Virus type 1 and Candida albicans. Med Oral Patol
Oral Cir Bucal. 10 Suppl 1, E1-8, 2005.
49
SHI, J., ZHANG, G., WU, H., ROSS, C., BLECHA, F. &GANZ, T. Porcine epithelial
beta-defensin 1 is expressed in the dorsal tongue at antimicrobial
concentrations. Infect Immun. 67(6), 3121-3127, 1999.
SINGH, P. K. Iron sequestration by human lactoferrin stimulates P. aeruginosa
surface motility and blocks biofilm formation. Biometals. 17(3), 267-270, 2004.
SINGH, P. K., PARSEK, M. R., GREENBERG, E. P. &WELSH, M. J. A component
of innate immunity prevents bacterial biofilm development. Nature. 417(6888),
552-555, 2002.
SON, K. N., PARK, J., CHUNG, C. K., CHUNG, D. K., YU, D. Y., LEE, K. K. &KIM, J.
Human lactoferrin activates transcription of IL-1beta gene in mammalian cells.
Biochem Biophys Res Commun. 290(1), 236-241, 2002.
STAAB, J. F., BRADWAY, S. D., FIDEL, P. L. &SUNDSTROM, P. Adhesive and
mammalian transglutaminase substrate properties of Candida albicans Hwp1.
Science. 283(5407), 1535-1538, 1999.
SUBRAMANIAM, P., BABU, K. L. &NAGARATHNA, J. Oral manifestations in acute
lymphoblastic leukemic children under chemotherapy. J Clin Pediatr Dent. 32(4),
319-324, 2008.
SULLIVAN, D. J., WESTERNENG, T. J., HAYNES, K. A., BENNETT, D. E.
&COLEMAN, D. C. Candida dubliniensis sp. nov.: phenotypic and molecular
characterization of a novel species associated with oral candidosis in HIVinfected individuals. Microbiology. 141 ( Pt 7), 1507-1521, 1995.
SUNDSTROM, P. Adhesins in Candida albicans. Curr Opin Microbiol. 2(4), 353357, 1999.
SUZUKI, L. C. Desenvolvimento de biofilme formado por Candida albicans in
vitro para estudo da terapia fotodinâmica. Instituto de Pesquis as Energéticas
Nucleares, Universidade de São Paulo, São Paulo, 2009. 48 p.
TENG, C. T., GLADWELL, W., BEARD, C., WALMER, D., TENG, C. S. &BRENNER,
R. Lactoferrin gene expression is estrogen responsive in human and rhesus
monkey endometrium. Mol Hum Reprod. 8(1), 58-67, 2002.
TESTA, U. Proteins of iron metabolis. . CRC press. (71-139), 2002.
THEIN, Z. M., SAMARANAYAKE, Y. H. &SAMARANAYAKE, L. P. In vitro biofilm
formation of Candida albicans and non-albicans Candida species under
dynamic and anaerobic conditions. Arch Oral Biol. 52(8), 761-767, 2007.
TIJANIĆ, I., VUČIĆ, M., GOVEDAROVIĆ, N., TIJANIĆ, M. &MAČUKANOVIĆGOLUBOVIĆ, L. How to recognize acute leukemia in dental office. . Acta
Stomatologica Naissi. 25(59), 883 - 888, 2009.
VAN NIEUW, A., BOLSCHER, J. G. &VEERMAN, E. C. Salivary proteins:
protective and diagnostic value in cariology? Caries Res. 38(3), 247-253, 2004.
50
VAN NIEUW AMERONGEN, A., BOLSCHER, J. G. &VEERMAN, E. C. Salivary
proteins: protective and diagnostic value in cariology? Caries Res. 38(3), 247253, 2004.
VARGAS, K., MESSER, S. A., PFALLER, M., LOCKHART, S. R., STAPLETON, J.
T., HELLSTEIN, J. &SOLL, D. R. Elevated phenotypic switching and drug
resistance of Candida albicans from human immunodeficiency virus-positive
individuals prior to first thrush episode. J Clin Microbiol. 38(10), 3595-3607, 2000.
WAHLIN, Y. B. &MATSSON, L. Oral mucosal lesions in patients with acute
leukemia and related disorders during cytotoxic therapy. Scand J Dent Res.
96(2), 128-136, 1988.
WARD, P. P. &CONNEELY, O. M. Lactoferrin: role in iron homeostasis and host
defense against microbial infection. Biometals. 17(3), 203-208, 2004.
WIANGNON, S., JETSRISUPARB, A., KOMVILAISAK, P. &SUTRA, S. Childhood
neoplasms: analysis of Thai children 2010. J Med Assoc Thai. 95 Suppl 7, S123133, 2012.
WIESNER, J. &VILCINSKAS, A. Antimicrobial peptides: the ancient arm of the
human immune system. Virulence. 1(5), 440-464, 2010.
WRAY, D., FELIX, D. H. &CUMMING, C. G. Alteration of humoral responses to
Candida in HIV infection. Br Dent J. 168(8), 326-329, 1990.
ZAITZ, C., CAMPBELL, I., MARQUES, A., RUIZ, L. &SOUZA, V. Compêndio de
Micologia Médica. Rio de Janeiro: MEDSI. 1998
51
AN E X O S
ANEXO 1
52
ANEXO 2
Termo de Conscentimento Livre e Esclarecido
FACULDADE DE ODONTOLOGIA / DEPARTAMENTO DE ODONTOPEDIATRIA E ORTODONTIA
/DISCIPLINA DE ODONTOPEDIATRIA
“Identificação e Quantificação de Candida spp na saliva de crianças com Leucemia e a
influência da Lactoferrina na expressão de genes relacionados com a formação de biofilme.”
Termo de Consentimento Livre e Esclarecido
Prezado responsável,
A Disciplina de Odontopediatria da UFRJ está estudando a Identificação e Quantificação de
Candida spp na saliva e a influência da Lactoferrina na expressão de genes relacionados com a
formação de biofilme em crianças com Leucemia em tratamento no ambulatório de Hematologia
Pediátrica do IPPMG e de crianças atendidas na Faculdade de Odontologia da UFRJ. Para isso, será
necessário colher um pouco da saliva com um swab (cotonete com um cabo longo), para ser
estudada num laboratório e será feito um exame clínico da cavidade bucal da criança. É importante
lembrar que os procedimentos realizados pelos próprios dentistas para coletar a saliva não causarão,
de maneira alguma, dano à criança.
A criança também receberá instrução de higiene oral, e caso ela necessite de tratamento
odontológico este será realizado na Clínica de Pacientes Especiais da Odontopediatria – FO/UFRJ.
Este estudo está de acordo com o estabelecido na Resolução do CNS 196/96 e suas
complementares e com o Código de Ética Médica de 1988. A participação é voluntária e em casos de
desistência, a criança não sofrerá prejuízos em relação ao atendimento odontológico. As informações
sobre cada criança retiradas de suas fichas médicas são confidenciais e sigilosas, sendo que a
identidade de cada participante só será utilizada por membros da equipe da pesquisa.
O responsável pelo paciente poderá solicitar sua saída do estudo em qualquer momento,
assim como a própria criança, e neste caso, os responsáveis pelo projeto se comprometem a não
utilizar as informações obtidas.
Em caso de dúvidas ou necessidades, o responsável poderá entrar em contato com: Dra. Raquel dos
Santos Pinheiro, na Faculdade de Odontologia da UFRJ (Departamento de Odontopediatria e
Ortodontia), ou pelos telefones (21) 2562-2101 / (21) 2562-2098.
Atenciosamente,
___________________________________
Assinatura do Pesquisador Responsável
Eu, _________________________________________ identidade nº _______________ responsável
pelo menor __________________________________________ , concordo com o que foi exposto
acima e autorizo sua participação na pesquisa.
Rio de Janeiro, _____ de ______________ de _______.
______________________________________________
Assinatura do Responsável
ANEXO 3
Ficha de Exame Clínico e Laboratoriais do Paciente
53
1) Identificação do Paciente
No Prontuário:__________
Idade: ______ Telefones: ___________________________________
Diagnóstico: _____________________________________________
2) Dados Clínicos
Início do tratamento:_______________________________________
Medicamentos Utilizados:________________________________________________________
Bloco do tratamento: 1o( )
2o( )
3o( )
Exame de Sangue:
Neutrófilos:_______________________
Leucócitos:________________________
Plaquetas:_________________________
Manifestação Oral: _______________________________________________________
Odontograma:
_1
_1
_2
_2
_3
_3
_4
_4
_5
_5
16
26
17
27
_1
_1
_2
_2
_3
_3
_4
_4
_5
_5
46
36