Historically Black Colleges and Universities - HBCU-UP

Transcription

PROGRAM BOOK
Transdisciplinary research and graduate education in experiential media
Research assistantship and NSF IGERT traineeship opportunities
Within AME, you can engage experiential
media research and education in a
multidisciplinary context.
Arts, Media and Engineering (AME) is a joint graduate
program of the Herberger College of the Arts and the Ira A.
Fulton School of Engineering at ASU.
Choose from the transdisciplinary:
UÊi`>ÊÀÌÃÊ>`Ê-ViViÃÊ*°°
Join collaborative research groups that apply innovative experiential
media solutions to problems of societal significance in the areas of
health, education, sustainability, creativity and communication.
or from 14 concentrations within
disciplinary graduate degrees.
Research is complemented by interdisciplinary courses co-taught
by internationally renowned faculty.
Concentrations with AME are available in:
Competitive award packages and research and teaching
assistantships are available to qualified applicants.
UÊ
«ÕÌiÀÊ-ViViÊ>`Ê}iiÀ}Ê
ÊÊÊ°-°Ê>`Ê*°°®Ê
UÊiVÌÀV>Ê}iiÀ}Ê°-°Ê>`Ê*°°®Ê
UÊi}iiÀ}Ê*°°ÊÃ«iV>â>Ì®
UÊ*ÃÞV}ÞÊ*°°®
UÊ`ÕV>Ì>Ê/iV}ÞÊ*°°®
UÊiÃ}Ê°-°°Ê>`Ê*°°®
UÊ>ViÊ°°°®
UÊÕÃVÊ°°Ê>`Ê°°°®
UÊ/i>ÌÀiÊ>`ÊÊ°°°®
UÊ6ÃÕ>ÊÀÌÊ°°°®Ê
Photos: Left: Graduate students Rebecca Stern and Lisa Tolentino with Reflective Living’s
sensor squid project – a wireless communication tool that allows groups to make
collaborative decisions. Top right: A student exploring an immersive audiovisual environment
for mediating a complex population-resource model. Bottom right: Research associate
Shawn Cook working on a collaborative project in AME’s Mediating Complexity course.
© 2008 ASU Herberger College of the Arts 0908
AME is fully committed to increasing diversity, resulting in a
student body that reflects and honors multiple perspectives.
More than 40 percent of AME's student population is female
and 15 percent come from under-represented backgrounds.
Students’ diverse cultural and disciplinary backgrounds also
contribute to the rich AME network.
For more information about AME’s research and
educational programs, visit ame.asu.edu, or contact the
education coordinator at [email protected].
ame.asu.edu
Integrating diverse perspectives and approaches for world-leading research
and education in digital media.
Historically Black Colleges and Universities Undergraduate Program (HBCU-UP) 2008 National Research Conference
AME
Historically Black Colleges and Universities
Undergraduate Program (HBCU–UP)
2008 National Research Conference
23–26 October 2008 • Atlanta
MASTER OF
ENGINEERING
MANAGEMENT
PROGRAM
Build a business
foundation with
four core courses
in management,
marketing, finance,
and law
Customize your
degree with a
wide variety of
engineering or
business electives
Develop leadership,
negotiation, and
communication
skills in our unique
workshop series
Engineering knows no limits.
Why should you?
MS/PhD
PROGRAMS IN
ENGINEERING
Explore course
study and research
opportunities that
go beyond the
boundaries of
traditional academic
disciplines
Become an
independent thinker
who can contribute
to diverse teams of
researchers from
other fields of
expertise
Publish with
faculty advisers
Present your
research to
professional peers
Duke University. Where an interdisciplinary approach to education
makes all the difference. Duke looks beyond traditional paradigms to
equip engineers with the perspective to solve our world’s most complex
problems. That’s Duke: No boundaries. No limits.
Master of Engineering Management Program: http://memp.pratt.duke.edu/us
MS/PhD Graduate Engineering Programs: http://www.pratt.duke.edu/graduates
biomedical • civil • environmental • electrical • computer • mechanical • materials science
P R A T T
S C H O O L
O F
E N G I N E E R I N G
A T
D U K E
U N I V E R S I T Y
Undergraduate Program (HBCU-UP)
Science and Technology: Knowledge Generators
for Global Competitiveness
October 23–26, 2008
The Westin Peachtree Plaza, Atlanta
Co-sponsored by
American Association for the Advancement of Science (AAAS)
Directorate for Education and Human Resources Programs
National Science Foundation
Directorate for Education & Human Resources
Division of Human Resource Development
Visit the conference Web Site later in December 2008 for information on the
2009 HBCU-UP National Research Conference – www.hbcu-up.org
© AAAS 2008
ISBN 978-0-87168-723-4
Cover design by Sandra Audia, AAAS Publications
Table of Contents
Overview of the Conference...............................................................4
About the NSF HBCU-UP Program......................................................5
About AAAS.......................................................................................6
Welcome Letters................................................................................7
. Cora B. Marrett, NSF
James H. Wyche, NSF
Shirley M. Malcom & Yolanda S. George, AAAS
Carlton E. Brown, Clark Atlanta University
John K. Haynes, Morehouse College
General Information for Attendees................................................... 12
Hotel Floor Plans & Key Rooms........................................................ 13
Conference Staff.............................................................................. 17
. NSF Staff
AAAS Staff & Consultants
Agenda and Room Locations............................................................ 19
Speaker Biographies........................................................................25
Abstracts.......................................................................................... A1
Exhibitors.........................................................................................39
Index................................................................................................ 61
2008 HBCU-UP National Research Conference
Program Book
3
Overview of the Conference
About the Conference
The HBCU-UP National Research Conference highlights
undergraduate student research and institutional strategies
to enhance the quality of undergraduate science, technology,
engineering, and mathematics (STEM) education and research
at HBCUs. The conference is co-sponsored by the National
Science Foundation (NSF) HBCU-UP Program and the American
Association for the Advancement of Science (AAAS). NSF
recognizes and supports the important role that HBCUs play in
increasing the numbers of underrepresented ethnic minorities
that are well prepared for participation and leadership at every
level of education and research in STEM.
4
Program Book
This gathering of more than 700 students, faculty, and
administrators will include:
• Oral and poster presentations by undergraduate students
about their research, and
• A faculty workshop with oral and poster presentations by
faculty and program administrators about their programs or
research.
In addition, exhibitors will have the opportunity to promote:
• Undergraduate student research programs
• Graduate school programs
• Fellowship opportunities
• Faculty research programs
About HBCU-UP
About the National Science Foundation (NSF)
Undergraduate Program (HBCU-UP)
The NSF HBCU-UP provides grants to enhance the quality
of undergraduate science, technology, engineering, and
mathematics (STEM) education and research at Historically
Black Colleges and Universities (HBCUs) as a means to
broaden participation in the Nation’s STEM workforce. Support
is available for Implementation Projects, Planning Grants,
Education Research Projects, and Targeted Infusion Projects.
Implementation Projects provide support to implement a
comprehensive institutional project to strengthen STEM
education and research. Proposed activities and strategies
should be the result of an institutional STEM self-analysis,
address institutional and NSF goals, and have the potential to
result in significant and sustainable improvements in STEM
program offerings. Typical project implementation strategies
include curriculum enhancement, faculty professional
development, undergraduate research, academic enrichment,
student support services, the infusion of technology to enhance
STEM instruction, collaborations with research institutions
and industry, and other activities that enhance the quality of
the undergraduate STEM education program. Proposers are
encouraged to analyze the strengths of the institution and
design innovative educational strategies, based on proven
best practices, to place the institution at the forefront of
undergraduate STEM education.
Planning Grants provide support to undertake self-analysis
of the institution’s undergraduate STEM programs to identify
components that need improvement or enhancement in order to
provide a high quality undergraduate STEM education. Planning
grants should also research existing activities and strategies that
could be implemented to improve the quality of undergraduate
STEM education at the institution. Typical activities include data
collection and analysis, stakeholder consultation, research of
potential activities and strategies, site visits to model programs,
and writing an Implementation Project proposal.
innovations, curricula enhancements, technology in education,
STEM teacher education, and the identification of successful
models. This is not a supplemental program. HBCUs do not
need to have an Implementation Project in order to submit ERP
proposals.
Targeted Infusion Projects provide support to achieve a
short-termed, well-defined goal to improve the quality of
undergraduate STEM education. Typically, projects are focused
on one activity within a single STEM department; however,
interdisciplinary and cross disciplinary projects are encouraged.
Potential goals include specialized accreditation or certifications,
establishing new programs or concentrations, establishing
collaborations between STEM disciplines and teacher education
programs, and updating programs to reflect advances in the
field and workforce requirements. This is not a supplemental
program. HBCUs do not need to have an Implementation Project
in order to submit a TIP proposal.
HBCU-UP is a program of the National Science Foundation (NSF).
NSF is an independent federal agency created by Congress
in 1950 “to promote the progress of science; to advance the
national health, prosperity, and welfare; to secure the national
defense…” With an annual budget of about $6.06 billion, NSF is
the funding source for approximately 20 percent of all federally
supported basic research conducted by America’s colleges and
universities. In many fields such as mathematics, computer
science and the social sciences, NSF is the major source of
federal backing.
For information about the HCBU-UP visit the Web
site http://nsf.gov/funding/pgm_summ.jsp?pims_
id=5481&org=EHR&from=home
Education Research Projects provide support to undertake a
three-year education research project that has the potential
to strengthen the STEM education and research programs at
HBCUs. Education Research Projects must be based on sound
education research methodologies and theories. Potential
education research topics include retention, diffusion of
Program Book
5
About AAAS
About AAAS
AAAS Mission
The American Association for the Advancement of Science (AAAS)
AAAS seeks to advance science, engineering, and innovation
is the world’s largest general scientific society, and publisher of
throughout the world for the benefit of all people. Its motto is
the journal, Science (www.sciencemag.org). AAAS was founded in
“Advancing science, serving society.” To fulfill this mission, the AAAS
1848, and includes some 262 affiliated societies and academies
Board has set these strategic goals:
of science, serving 10 million individuals. Science has the largest
•
Enhance communication among scientists, engineers, and the
public
paid circulation of any peer-reviewed general science journal in the
world, with an estimated total readership of one million. The non-
•
Promote and defend the integrity of science and its use
profit AAAS (www.aaas.org) is open to all and fulfills its mission to
•
Strengthen support for the science and technology enterprise
“advance science and serve society” through initiatives in science
•
Provide a voice for science on societal issues
policy; international programs; science education; and more. For the
•
Promote the responsible use of science in public policy
latest research news, log onto EurekAlert!, www.eurekalert.org, the
•
Strengthen and diversify the science and technology workforce
premier science-news Web site, a service of AAAS.
•
Foster education in science and technology for everyone
•
Increase public engagement with science and technology
Membership and Programs
•
Advance international cooperation in science
Open to all, AAAS membership includes a subscription to Science.
Four primary program areas fulfill the AAAS mission:
Visit the AAAS Web site at http://www.aaas.org/
•
Science and Policy
•
International Activities
•
Education and Human Resources
•
Project 2061
"#$!%&'($)*'+,!-.!/0&*0*!
123!4567"!
C-Change Project:
Climate Change, Humans, and Nature
in the Global Environment!
• Interdisciplinary graduate training program!
• Geoscience, bioscience, social science,
engineering!
• Human dimensions of global climate change!
• Fieldwork in Great Plains, Mexico, Greenland!
• Graduate certificate in climate change studies!
• Climate policy internship!
• Interdisciplinary advisory committee!
• 40 faculty members across disciplines !
• $30,000 for 2 years + 3 years addÕ l funding
• Application deadline, December 15, 2008
For more information, contact Joane!Nagel, [email protected]!
www.ipsr.ku.edu
!
(785) 864-9105
[email protected]
Welcome to Atlanta
Dear HBCU-UP Faculty and Students:
On behalf of the Directorate for Education and Human Resources at the National Science
Foundation (NSF), I want to welcome you to the 2008 National Student Research Conference
sponsored by the Historically Black Colleges and Universities Undergraduate Program (HBCUUP). This year’s conference theme “Science and Technology: Knowledge Generators for Global
Competitiveness,” reiterates NSF’s commitment to preparing a science and engineering
workforce that can foster innovation in an increasingly global marketplace.
This conference provides an opportunity for students to build their creativity and scientific
communication skills by sharing their research with faculty, administrators, and their peers.
Additionally, all of the participants have the opportunity to interact with their colleagues to
share strategies that will enhance their research, education, and mentoring programs.
Your commitment to improving your own science and technology endeavors and to
developing thriving institutional programs is critical to our nation. For your dedication and
ingenuity, thank you.
Cora B. Marrett
As always, we welcome your comments and suggestions for program improvements and for
future directions. I hope you have a productive conference.
Sincerely,
Cora B. Marrett
Assistant Director
Directorate for Education and Human Resources
Program Book
7
Welcome
Conference Participants:
On behalf of the National Science Foundation, Division of Human Resource Development, I am
pleased to welcome you to the 2008 HBCU-UP Student Research Conference.
Student scholarship is a unique blend of classroom learning and laboratory research
experiences. We believe approach better prepares undergraduate students as competitive
graduate school scholars who will go on to become the new face of the professoriate and
fill the future ranks in our public and private sectors. The U.S. workforce for the future will
be increasingly dependent on developing and expanding a requisite relationship between
various federal sectors, numerous colleges and universities, private foundations, and the
private industrial sector.
James H. Wyche, Ph.D.
In order to meet the NSF’s mandate for sustaining our Nation’s competitive global research
expertise in science and engineering, we must better prepare all students earlier and
throughout the educational pipeline. We must also encourage and stimulate curiosity, inquiry,
and increase the number of competitive scholars for current and future global challenges
that include but are not limited to climate change, natural resource management, biofuel
conversion, nanotechnology, the study of basic science and engineering mechanisms that
support and sustain life on our planet, and science literacy.
The educational foundation for these and other disciplines is found in creating a scholarly
environment which includes significant research experiences starting early in students’
academic careers and forging partnerships between our scholarly faculty and the rich blend of
institutions at which learning and research is conducted. A basic element that will continue to
contribute to the current and future success of programs like HBCU-UP is the faculty: student
relationship.
We come together at this conference to share our experiences. The National Science
Foundation is proud to play its role as a key facilitator in identifying our Nation’s basic science
and engineering needs, direction, and be a champion for broadening participation and global
competitiveness.
Division Director
Division of Human Resource Development
Directorate for Education and Human Resources
8
Program Book
Welcome
Dear HBCU-UP Conference Attendees:
On behalf of the American Association for the Advancement of Science (AAAS), publisher
of the journal Science, we welcome you to the 9th HBCU-UP National Research Conference.
Given its mission to “advance science, engineering, and innovation throughout the world for
the benefit of all people,” AAAS is delighted to cosponsor this conference with the National
Science Foundation.
We encourage you to visit exhibitors from academia, government, business, and the nonprofit sectors to find out about graduate school and summer research opportunities.
Workshops included in the conference are designed to help students prepare for academic
success and identify resources for entry and pursuit of graduate school degrees. Also, these
workshops provide information for faculty and administrators to mentor and guide students
on their paths to high level science, technology, engineering, and mathematics (STEM)
careers.
Shirley M. Malcom
After the conference, we suggest you visit http://sciencecareers.sciencemag.org/, to continue
to find out about graduate school and employment opportunities, grants and fellowships, and
careers in science and engineering. In addition, faculty members and administrators who are
looking for teaching resources or ideas to strengthen programs, and educational evaluation
and research should visit http://www.sciencemag.org/multimedia/, http://biosciednet.org/
portal/, and http://www.sciencemag.org/cgi/collection/education.
We hope the conference and these online resources provides you with new ideas, resources,
and contacts as you join AAAS in its mission to “advance science, engineering, and innovation
throughout the world for the benefit of all people.”
Sincerely,
Shirley M. Malcom & Yolanda S. George, AAAS
Yolanda S. George
Program Book
9
Welcome
Dear HBCU-UP Conference Participants:
On behalf of the Faculty, Students, Staff and Alumni Clark Atlanta University (CAU), I welcome
you to the city of Atlanta and the HBCU-UP National Research Conference. CAU was formed in
1988 by the historic consolidation of Atlanta University (1865) and Clark College (1869), two
institutions that were established with the primary mission of educating African Americans.
Atlanta University, the nation’s oldest graduate institution serving a predominately AfricanAmerican student body and Clark College were already connected by a common heritage
and commitment to educating African Americans for more than 100 years. The consolidation
achieved a Carnegie classification of Research University - High Research Activity and is one
of only four HBCUs to earn such a classification. CAU has built a significant base of basic and
applied research and development activity in a variety of areas that are of national and global
importance.
Carlton E. Brown
As developed and developing scientists and engineers, you all have the opportunity
to address national and global issues and discover answers to many of society’s most
pressing problems. I encourage students attending this conference to visit the more than
70 representatives from graduate institutions to find out more about the resources that are
available to help you to develop your science and engineering talent.
I encourage educators and administrators to mentor and guide the future scientists and
engineers so that they will be ready to offer ideas and notions that will transform their
communities, the nation, and the world. Solutions to the science and engineering challenges
that we face locally, nationally, and globally will require the diverse perspectives that we all
bring to the table.
I wish you a successful conference.
Sincerely,
Carlton E. Brown
President
Clark Atlanta Universit
10
Program Book
Welcome
Dear HBCU-UP Participants:
On behalf of Morehouse College, Division of Science and Mathematics, I want to welcome
you to the city of Atlanta and to the HBCU-UP National Research Conference. The mission of
Morehouse College is to provide comprehensive academic, social and spiritual experience
that prepares its students for leadership and success in the larger society.
In the spirit of Morehouse College mission, I encourage students attending the conference
to use this opportunity to find out more about what you need to become a leader in
the international scientific and engineering enterprise. As you already know from the
undergraduate research that you are doing, science and engineering benefits society and our
communities, as well as improves our quality of life.
I encourage faculty to continue to build programs and curriculum that help students to
become more aware of global sceince and engineering challenges. As part of the the 21st
century workforce, scientists and engineers will increasingly be called upon to work in
international environments and with international teams. In line with this, we at Morehouse
are actively seeking to provide more opportunities for our students to study and do research
abroad, and for faculty members to collaborate with scientists in other countries.
John K. Haynes
In closing, the path to a career in science while not easy is very exciting. The goal of serving
mankind utilizing the formidable approach of the scientific method is a laudable one and
whether you achieve all of your goals is less important than the journey. Benjamin Mays, the
legendary president of Morehouse, said that “not failure, but low aim is sin.”
I invite all of you to visit the Morehouse College campus, which is located 3 miles from
downtown Atlanta. The campus includes the Benjamin E. Mays Memorial, The Howard
Washington Thurman National Memorial, and the Martin Luther King International Chapel.
I wish all of you much continued success in the years ahead.
Sincerely,
John K. Haynes
David Packard Professor and
Dean of Science and Mathematics
Program Book
11
General Information for All Attendees
Cell Phone Usage
Name Badge & Badge Replacement Fee
All cell phones MUST BE turned off before you enter session
rooms out of courtesy for speakers and session participants.
Name badges are to be worn AT ALL TIMES. Badges permit
attendees to enter ALL sessions, exhibition area, conference
meals, and e-mail center. THERE WILL BE A $20.00 CHARGE FOR
BADGE REPLACEMENT.
E-Mail Center
Four (4) computers will be available in the registration area for
attendees to receive and send emails during the conference.
PLEASE LIMIT YOUR SESSION TO 5 MINUTES.
Evaluation
Conference evaluation forms will be available immediately after
each session. Please take advantage of this opportunity to share
with us your views and opinions regarding the 2008 HBCU-UP
National Research Conference.
Message Board
A message board will be displayed in the registration area.
The message board is a great location for attendees to post
messages, job openings, upcoming events, or announcements.
No Smoking Rule
We ask that all persons who attend the meeting comply with the
non-smoking policy in the Westin Peachtree Plaza hotel.
Staff Room Location
The Staff Room is located in the Boardroom on the 6th floor.
The ConvEne Doctoral Program in Energy Research
The new National Science Foundation IGERT (Integrative Graduate Education and
Research Traineeship) Program at UCSB: ConvEne – Conversion of Energy Through
Molecular Platforms, welcomes Ph.D. applicants for Fall admissions starting 2009.
The interdisciplinary technical training offered by the ConvEne IGERT will ensure
that students are equipped to participate in the development of versatile new
technologies for the generation, conversion, and use of energy. Students will also
be educated in issues of environmental sustainability, economic viability, and the
political feasibility of emerging alternative energy strategies. Successful applicants
will be supported by fellowships of $30,000 per year for two years.
For more information and to apply:
Web:
Email:
Tel:
12
http://www.convene.ucsb.edu
[email protected]
(805) 893-5314
Program Book
Hotel Floor Plans
INTERNATIONAL
E
D
F
G
H
VININGS
I
AMERICAN
ROOM
VININGS ROOM
VININGS
II
INTERNATIONAL
B
A
C
BOARDROOM
SIXTH FLOOR
AUGUSTA
ROOM
GROUP
OFFICE
E
THE
OVERLOOK
AUGUSTA
I
G
H
F
ATLANTA BALLROOM
AUGUSTA
II
D
C
B
AUGUSTA
III
A
SEVENTH FLOOR
Program Book
13
Hotel Floor Plans
D
E
ROSWELL
ROOM
F
ROSWELL
I
PEACHTREE BALLROOM
(MAIN FLOOR)
C
B
ROSWELL
II
A
EIGHTH FLOOR
PEACHTREE
G
PEACHTREE
H
NINTH FLOOR
14
Program Book
Hotel Floor Plans
TOWER ROOM
1201
PAN
TRY
TOWER ROOM
1202
TOWER ROOM
1203
TOWER ROOM
1208
TOWER ROOM
1204
TOWER ROOM
1207
TOWER ROOM
1205
TOWER ROOM
1206
TWELFTH FLOOR
TOWER ROOM
1401
PAN
TRY
TOWER ROOM
1402
TOWER ROOM
1403
TOWER ROOM
1408
TOWER ROOM
1404
TOWER ROOM
1407
TOWER ROOM
1405
TOWER ROOM
1406
FOURTEENTH FLOOR
Program Book
15
University of Maryland, Baltimore County
NSF IGERT Program
Water in the Urban Environment
www.umbc.edu/cuere/igert
Program
Solutions to complex problems associated with the effects of urbanization on the water cycle require
integrated and innovative ecological, economic, planning, and engineering approaches. UMBC’s
IGERT program will train the next generation of Ph.D. students who are prepared to work in
multidisciplinary teams to improve our understand and management of urban environmental systems.
The program is centered on three interwoven themes:
• urban hydrology and contaminant transport;
• urban biogeochemical cycles, aquatic ecosystems, human health; and
• urban water policy, management and institutions.
Elements
• Earn a PhD in one of nine participating programs:
Biological Science;
Chemistry and Biochemistry;
Civil and Environmental Engineering;
Geography and Environmental Systems;
Information Systems;
Marine, Estuarine and Environmental Science (MEES);
Mathematics and Statistics;
Public Policy (including Economic Policy); or
Physics.
• Participate in cross-cutting core courses and team research projects
• Complete internships in one of many collaborating organizations
• Collaborate with the Baltimore Ecosystem Study (http://beslter.org)
• Access to the Chesapeake Bay and Washington DC
Level of Support
The IGERT Traineeship provides a $30,000 stipend per year plus $10,500 toward cost of education
(tuition, fees, health insurance and other benefits). Assuming satisfactory progress, IGERT
trainees are funded for two years; teaching and research assistantships provide additional years of
support, at departmental funding levels.
Application Procedure
• See http://www.umbc.edu/academics/degrees.html for departmental deadlines.
• See http://umbc.edu/cuere/igert for IGERT application details.
• Applicants must be U.S. citizens or permanent residents.
• Applicants must identify a faculty mentor of interest.
• Applicants must submit an essay on interests and background as they relate to our theme.
• Application materials must be received by February 1, 2009.
• Please contact Dr. Bernadette Hanlon at [email protected] or (410) 455-1762 for details.
Advisors and Key Staff
2008 HBCU-UP National Research Conference Advisory
Board and Staff
co-chairs
Key AAAS EHR HBCU-UP Project Staff
directorate for education and human resources (ehr)
programs
Larry Mattix
Associate Dean, School of Science and Technology, Norfolk State
University
Shirley M. Malcom, Director
Sadanand Srivastava
Chair & Professor of Computer Science, Bowie State University
senior staff
members
Teresa Edwards
AAAS Committee on Opportunities in Science (COOS) Liaison,
Associate Professor, Georgia Gwinnett College
Yolanda S. George, Deputy Director
Donna Behar
Betty Calinger
Cathy Ledec
Marty McGihon
Sabira Mohamed
Caesar R. Jackson
Dean, College of Science and Technology, North Carolina Central
University
Richard Weibl
Adriane Ludwick
Professor, Department of Chemistry, College of Architecture,
Environmental & Natural Sciences, Tuskegee University
Cursilla Fenwick
Camille A. McKayle
Interim Dean of Science and Mathematics and Associate
Professor of Mathematics at the University of the Virgin Islands
Jessica Kunkler
Joe Omojola
Professor of Mathematics and Physics, Southern University at
New Orleans
Sandra Audia
Sandra (Sandy) Thomas
Executive Director, IGERT National Recruitment Program,
Institute for Broadening Participation
Nancy Greer-Williams
Former Dean, Liberal Arts/Social Sciences
University of Arkansas for Medical Sciences (UAMS)
Project Assistants
Derrick Kemp
Corrie Kramer
Office of Public Programs
Donald Norwood
Edward Lempinen
Key National Science Foundation HBCU-UP Leadership
and Staff
directorate for education and human resources (ehr),
office of the assistant director
Cora B. Marrett, Assistant Director
Wanda E. Ward, Deputy Assistant Director
Division of Human Resources Development (HRD)
James H. Wyche, Division Director
historically black colleges and universities undergraduate
program (hbcu-up)
Marilyn J. Suiter, Program Director
Program Book
17
Agenda
THURSDAY, OCTOBER 23, 2008
7:00 AM — 9:00 PM
Registration
10:30 AM – 12:15 PM
Educational Evaluation and Research Small Group Sessions will be in 1201, 1202 & 1203
Atlanta Ballroom Foyer, 7th Floor
12:30 PM — 1:30 PM
Continental Breakfast
Lunch for Faculty & Administrators Workshop
Foyer near the Roswell 1 Room, 8th Floor
Roswell 1 Room, 8th Floor
8:00 AM — 8:30 AM
8:30 AM — 10:30 AM
HBCU-UP Faculty & Administrators Workshop – Session 1
1:00 PM – 7:00 PM
Exhibit Set-Up
Atlanta Ballroom, 7th Floor
Roswell 1 Room, 8th Floor (General Session)
Welcome & Overview
Yolanda S. George, AAAS, EHR
Marilyn J. Suiter, NSF, EHR, HRD
Educational Evaluation and Research (Presentations and Small Group Discussions)
Speakers
Caesar R. Jackson, Dean of the College of Science
and Technology, North Carolina Central University
(NCCU)
Karen Marrongelle, NSF Program Officer, Division
of Research on Learning in Formal and Informal
Settings
Catherine Millett, Senior Research Scientist,
Policy Evaluation and Research Center, Educational
Testing Service
Panel
Cynthia E. Winston, Associate Professor,
Department of Psychology, Howard University
Kimberley Freeman, Assistant Professor of
Educational Psychology in the Department of
Human Development and Psychoeducational
Studies (HDPES), Howard University
1:30 PM --- 3:30 PM
HBCU-UP Faculty & Administrators Workshop – Concurrent Sessions
A. Student Outreach & Bridge Programs
Tower Room 1201, 12th Floor
Constance Bland, Mathematics, Computer &
Information Sciences - Mississippi Valley State
University
Curtis Clark, Mathematics, Morehouse College
Stephen I.N. Ekunwe, Biology, Jackson State
University
B. Student Support Services & Effective
Research Mentoring for Undergraduates
Aliecia R. McClain, Dozoretz National Institute
for mathematics and Applied sciences (DNIMAS),
Norfolk State University
Chellu S. Chetty, College of Science & Technology,
Savannah State University
Yassin Jeilani, Environmental Science, Spelman
College
Lorraine N. Fleming, Professor and Former Chair,
Department of Civil Engineering, Howard University
C. Innovative STEM Curriculum & Technology in
the Classroom
Felecia McInnis Nave, Assistant Professor,
Department of Chemical Engineering, Prairie View
A&M University
Mialy Rabe, Natural Sciences and Mathematics,
North Carolina State University
Earl B. Smith, Mechanical Engineering Tuskegee
University
Clement G. Yedjou, Biology, Jackson State
University
Program Book
19
Agenda
3:30 PM – 4:15 PM
HBCU-UP Faculty & Administrators Workshop
Grants Administration Session
Alfred W. Wilson, Senior Program Analyst, NSF,
Directorate for Education & Human Resources
(EHR), Division of Human Resource Development
(HRD)
4:15 PM — 4:30 PM
FRIDAY, OCTOBER 24, 2008
7:00 AM — 5:00 PM
Registration
7:00 AM — 7:45 AM
Oral Presentations 1 (Set-Up) Poster Presentations 1 (Set-Up
Augusta I, II, & III Rooms, 7th Floor
HBCU-UP Program Faculty &
Administrator Posters Set-Up
Judges Orientation/Sign-In
Augusta I, II & III Rooms, 7th Floor
5:00 PM — 6:00 PM
7:45 AM — 9:30 AM
Judges & Moderators & Packard
Scholars Orientation
Networking Breakfast & Plenary
Session
Peachtree Ballroom, 8th Floor
Exhibitors Orientation
6:00 PM — 7:30 PM
HBCU-UP Program Faculty & Administrator
Poster Session
7:30 PM — 10:00 PM
Moderator:
Marilyn J. Suiter, Program Director NSF, EHR, HRD
James H. Wyche, Division Director, NSF, EHR, HRD
John K. Haynes, David Packard Professor and Dean
of Science and Mathematics, Morehouse College
Carlton E. Brown, President, Clark Atlanta
University
9:45 AM — 11:45 AM
Poster Presentations 1
Opening Plenary Session & Dinner
Biology; Chemistry & Chemical Sciences;
Computer Sciences & Management Information
Sciences; Physical & Mathematical Sciences;
Technology & Engineering; and Social and
Behavioral Sciences
Moderator:
Yolanda S. George, Deputy Director, AAAS, EHR
Speakers:
Marilyn J. Suiter, Program Director, NSF, EHR, HRD
Ayanna Howard, Associate Professor, School
of Electrical and Computer Engineering, Georgia
Institute of Technology
9:45 AM — 11:45 AM
Oral Presentations 1
Session 1 – Biology A
Tower Room 1401
Session 2 – Biology B
Tower Room 1402
Session 3 – Biology C
Tower Room 1403
Session 4 – Computer & Information Sciences A
Tower Room 1404
20
Program Book
Agenda
Session 5 – Biology/Ecology A
3:30 PM — 5:30 PM
Tower Room 1405
Session 6 – Chemistry A
Tower Room 1406
Session 7 – Physics
Tower Room 1407
Session 8 – Mathematics & Statistics A
Tower Room 1408
Biology; Chemistry & Chemical Sciences;
Computer Sciences & Management Information
Sciences; Physical & Mathematical Sciences;
Technology & Engineering; and Social and
Behavioral Sciences
Session 9 – Electrical/Mechanical Engineering
Tower Room 1201
3:30 PM — 5:30 PM
Session 10 – Nuclear Engineering
Tower Room 1202
Session 11 – Biology D
Tower Room 1401
9:45 AM — 11:45 AM
Concurrent Sessions (Series A)
A1: WHO KNEW?: Questions about Graduate
School You Didn’t Know to Ask
Rosemary E. Phelps, Professor and Department
Head, Department of Counseling and Human
Development Services, University of Georgia
Vinings I Room, 6th Floor
Session 12 – Biology E
Tower Room 1402
Session 13 – Biology F (Nanosciences/ Biology/
Chemistry)
Tower Room 1403
Session 14—Biology/Ecology B
Tower Room 1404
Session 15 – Chemistry B
Tower Room 1405
A2: Graduate School Funding & Undergraduate
Research Opportunities
Session 16 – Mathematics & Statistics B &
Social & Behavioral Sciences
Sandra Thomas, Executive Director, IGERT National
Recruitment Program & Institute for Broadening
Participation
Tower Room 1406
Vinings II Room, 6th Floor
Session 17 – Biology /epidemiology
Tower Room 1407
Session 18 – Computer & Electrical Engineering
Tower Room 1201
Noon — 1:00 PM
Session 19 – Chemical & Civil Engineering
Box Lunch (Peachtree Ballroom, 8th floor)
Exhibitors may pick up lunch at 11:30 AM
Tower Room 1202
3:30 PM — 5:30 PM
Concurrent Sessions (Series B)
Noon — 3:00 PM
Exhibits Open
3:00 PM — 3:30 PM
Oral Presentations 2 (Set-Up)
Poster Presentations 2 (Set-Up)
Rowell 1 Room, 8th Floor
B1: WHO KNEW?: Questions about Graduate
School You Didn’t Know to Ask
Rosemary E. Phelps, Professor and Department
Head, Department of Counseling and Human
Development Services, University of Georgia
Vinings 1 Room, 6th Floor
B2: Unleashing the Power of Networking to
Advance a Career in the Life Sciences
Tamara Lewis Johnson, Women’s Health Program
Manager, National Institute of Allergy and
Infectious Diseases, National Institutes of Health,
U.S. Department of Health and Human Services,
Bethesda, MD
Vinings Room 2, 6th Floor
Program Book
21
Agenda
B3: Learning Strategies for Academic Success
Sarah Baird, Assistant Director, Center for
Academic Success, Louisiana State University,
Baton Rouge
Biology; Chemistry & Chemical Sciences; Computer
Sciences & Management Information Sciences;
Physical & Mathematical Sciences; Technology &
Engineering; and Social and Behavioral Sciences
5:30 PM — 8:30 PM
Exhibits Open
7:00 PM — 9:00 PM
Dinner Reception
9:00 PM — 10:30 PM
Talent Showcase Auditions
(Students & Faculty)
9:45 AM — 11:45 AM
Session 20 – Biology G
Tower Room 1401
Session 21 – Biology H
Tower Room 1402
Session 22 – Biology I
Tower Room 1403
Session 23 – Computer Sciences & Management
Information Sciences B
Tower Room 1404
Session 24 – Ecology and Environmental and
Earth Sciences C
Tower Room 1405
Session 25 – Chemistry C
SATURDAY, OCTOBER 25, 2008
Tower Room 1406
Session 26 – Nanosciences
Tower Room 1407
8:00 AM — 5:00 PM
Registration
8:00 AM — 8:45 AM
Oral Presentations 3 (Set-Up)
9:45 AM — 11:45 AM
Concurrent Sessions (Series C)
C1: Learning to Network Strategically: How to
Make Connections that Work for You
Poster Presentations 3 (Set-Up)
Brianna Blaser, Project Director for Outreach,
AAAS & Science Careers
C2: Making the Most of Poster Presentations:
What to Say after Hello!
8:00 AM — 8:45 AM
Continental Breakfast
9:00 AM — 1:00 PM
Exhibits Open for HBCU-UP Conferees and Local Students Atlanta Ballroom, 7th Floor
Jean H. Shin, Director, Minority Affairs Program,
American Sociological Association, Washington,
DC.
1:00 PM — 2:00 PM
Exhibits End — Remove Displays
1:00 PM — 2:00 PM
Lunch on Your Own
9:45 AM — 11:45 AM
22
Program Book
Agenda
2:00 PM – 4:00 PM
4:00 PM — 6:30 PM
dA Id &lUCI
dAv
&
lEPAC
P kARd HBCU SCHolARS
PAC
oRAl & PoSTERPRESEnTATIonS
fREETIME
6:30 PM — 9:00 PM
PlEnARy
AR SESSIon & AWARdSBAnQUET
ARy
2:00 PM — 4:00 PM
ConCURREnTSTUdEnT&fACU
&
&fACU
l y SESSIonS
lT
(SERIESd)
MODERATOR:
d1: Graduate Schoolfunding & Undergraduate
Researchopportunities
SPEAKERS:
Marilyn J. Suiter, NSF, EHR, HRD
Tasha R. Inniss, Assistant Professor, Mathematics,
Spelman College
Sandra Thomas, Executive Director, IGERT National
Recruitment Program & Institute for Broadening
Participation
James H. Stith, Vice President Physics Resources,
American Institute of Physics
PoSTERAndoRAl PRESEnTATIonSAWARdS
d2:learning Strategies for Academic Success
Sarah Baird, Assistant Director, Center for
Academic Success, Louisiana State University,
Baton Rouge
CloSInGREMARkS
9:00 PM — 10:30 PM
T lEnTSHoWCASE
TA
10:30 PM — MIDNIGHT
SoCIAl
SUNDAY, OCTOBER 26, 2008
8:00 AM — 10:00 AM
BRUnCH (Special Registration Required)
10:00 AM
ConfEREnCEEndS
Program Book
23
Are you motivated to pursue a
PhD, but require additional
coursework, training, and/or
research experience?
HOW THE PROGRAM WORKS
A PhD Program in Seattle, Washington
· Do research with caring mentors
& receive full funding support
· Earn a Master’s degree at Fisk
University
· Get fast-track admission to the
Vanderbilt PhD program
Come and talk to Terry at Table 18
Fisk Univ & Vanderbilt
Nashville, Tennessee
http://www.vanderbilt.edu/gradschool/bridge
materials science
F I S K - VA N D E R B I L T Master’s
Master’s-- to
to-- PhD Bridge Progra m
biological sciences
tú puedes · you can · tú puedes · you can · tú puedes
physics & astronomy
Biographies
Sarah Baird
Sarah Baird is the Assistant Director of the
Center for Academic Success at Louisiana
State University in Baton Rouge, Louisiana.
She received a B.A. degree from Luther
College in Decorah, Iowa and a Masters in
Counseling and Human Development from
the University of Iowa, Iowa City, Iowa.
Baird began her career by applying the study of psychology
and counseling to the field of Health Education at the University
of Arizona in Tucson. During her tenure in Arizona she developed
programs for sexual assault prevention and alcohol and other
drug education which culminated in the opening of the Oasis
Advocacy Center.
A move to Louisiana offered Baird the opportunity to transfer
the strategies used for inspiring student health and safety to
student learning and the application of cognitive science. She
has served at the Center for Academic Success at LSU for 11
years, including one sabbatical year as Director of the Spark
Center for Learning and Writing at Judson College near Chicago,
IL. She has received national recognition for the development
of a unique Resident Assistant Training Program and is a lead
developer of an award-winning college learning website. Baird
specializes in translating cognitive science principles such
as metacognition and cognitive restructuring to practical and
attainable learning experiences for students and application of
these principles to instructional practices for faculty.
Baird lives in Baton Rouge, LA with her husband, David
(faculty member in Architecture) and energetic sons Bo (8) and
Sky (5).
Brianna Blaser
Brianna Blaser is Project Director of
Outreach for AAAS & Science Careers
where she promotes Science Careers
resources though career and professional
development workshops to undergraduate
and graduate students, postdoctoral
scholars, and early career scientists.
Brianna earned her PhD in Women’s Studies at the University
of Washington. Her dissertation, More than Just Lab Partners:
Women Scientists and Engineers Married to and Partnered with
Other Scientists and Engineers, examined how women scientists’
relationships with other scientists affect both their professional
and personal lives. While at the University of Washington,
Brianna was a research assistant at the Center for Workforce
Development where she organized professional development
activities, including a newsletter, a mentoring program, and
workshops for graduate students in science and engineering.
In 2002, Brianna earned her BS with University Honors in
Mathematics and Psychology with a minor in Gender Studies
from Carnegie Mellon University. She has held internships with
the Association for Women in Science and the Mathematical
and Computational Sciences Division of the National Institute of
Standards and Technology and worked with the Carnegie Mellon
Institute for Talented Elementary Students.
Carlton E. Brown
Carlton E. Brown became the third
president of Clark Atlanta University on
August 1, 2008 after serving as Executive
Vice President and Provost since July 2007.
Dr. Brown brings to Clark Atlanta
University a great wealth of executive
experience and accomplishments in higher education, after
having served as the President of Savannah State University
(SSU) for nine and a half years and holding senior-level
administrative positions at several universities. Before coming
to CAU, Dr. Brown was appointed by Georgia Board of Regents
Chancellor Errol Davis to assist in the implementation of major
system-wide initiatives.
A native of Macon, Ga., Brown received both his Bachelor
of Arts degree and his doctorate from the University of
Massachusetts, Amherst. He earned his doctorate in
multicultural education in 1979, and his bachelor’s degree in
English and American Studies in 1971. After completing his
undergraduate degree, Dr. Brown worked as a teacher and
counselor in an inner-city alternative high school.
Dr. Brown served on the faculty of the School of Education at
Old Dominion University in Virginia from 1979 to 1987. He then
joined the faculty of Hampton University in Virginia as the Dean
of the School of Education, and later, as Dean of the School of
Liberal Arts and Education and in 1996, he was promoted to vice
president for planning and dean of the Graduate College.
During his tenure as SSU’s 11th president, the university
experienced several notable milestones. Among them were: an
increase in student enrollment of 48 percent from fall 1998 to
Program Book
25
Biographies
fall 2005, the transformation of student housing and academic
support facilities; the accreditation and reaccreditation of
several academic programs; major increases in grants and
contracts; improved student retention; and strengthened
graduate programs to increase the number of minorities
pursuing graduate degrees in science, technology, engineering
and mathematics.
Brown is married to T. LaVerne Ricks-Brown. The couple has
two adult children.
Teresa D. Edwards
Most of Teresa D. Edwards’s academic
experience has been at Spelman
College in Atlanta, Georgia. From 1986
to 2005, she served as the Chair of the
Mathematics Department and on many
college committees. Edwards taught a
wide range of mathematics courses and also conducted a handson workshop for secondary school teachers on mathematical
applications through the Spelman College Center for Scientific
Applications of Mathematics.
While on loan from Spelman College to Bennett College during
academic years 2003–2004 and 2004–2005, Edwards served
as Chair for the Division of Natural and Behavioral Sciences
and Mathematics and as the Interim Chair of the Department
of Mathematics and Computer Sciences. She was instrumental
in helping the college to secure several grant awards. She also
conducted a hands-on workshop for secondary school teachers
on discrete mathematics through Bennett College’s Project
Soaring High.
After leaving Bennett College in June 2005, Edwards joined
the Quality Education for Minorities (QEM) Network and worked
on mathematics, science, and engineering-related projects,
particularly those related to mathematics curriculum and
proposal development and implementation. She spent the
academic year 2006–2007 as a Visiting Associate Professor
of Mathematics at the University of the Virgin Islands (UVI). In
the fall of 2007, Edwards joined the faculty at the new Georgia
Gwinnett College near Atlanta, Georgia.
Edwards’ professional involvement includes serving on AAAS’s
Committee on Opportunities in Science (COOS); the Editorial
Board of the College Mathematics Journal (CMJ); the Executive
Board of the Association for Women in Mathematics (AWM); and
several Mathematical Association of America (MAA) committees.
26
Program Book
Edwards has been honored by many institutions for her work
in the field and holds a Doctorate Degree in Industrial and
Systems Engineering and a Master of Science in Operations
Research from the Georgia Institute of Technology. She also
holds a Bachelor of Arts in Mathematics from Spelman College.
Lorraine Fleming
Lorraine Fleming is a Professor and
former chair of the Department of Civil
Engineering at Howard University. Since
joining the Howard faculty, Dr. Fleming
has spearheaded initiatives to attract
and retain African American students in
science, technology, engineering, and mathematics (STEM).
Dr. Fleming has brought two major research projects, funded
by the National Science Foundation, to the university. The
Center for the Advancement of Engineering Education (CAEE), a
partnership among five research universities (Howard, Stanford,
U. of Washington, U. of Wisconsin, and Colorado School of
Mines), is dedicated to improving the quality of education for
undergraduate engineers. In pursuit of this goal, Dr. Fleming’s
team has been conducting a longitudinal study of engineering
students to understand the challenges they face and how
they respond to those challenges. Her newest project entitled,
“Examining the Post-Baccalaureate Decisions of High Achieving
Black Science and Engineering Students,” is designed to acquire
a basic understanding of how students transition into graduate
study in engineering and science and why they make the choices
they do.
Dr. Fleming has been selected by The Carnegie Academy
for the Scholarship of Teaching and Learning as a 2005-2006
Carnegie Scholar for her commitment to examining student
learning and investigating undergraduate teaching. She has
received the Carnegie Certificate of Excellence (2006) for her
work that advances the practice and profession of teaching in
support of significant student learning. Dr. Fleming received
her Ph.D. in civil engineering from the University of California
at Berkeley. She also holds M.S. and B.S. degrees in civil
engineering from George Washington University and Howard
University, respectively. She has several publications in
engineering and engineering education journals.
Biographies
Kimberley Edelin Freeman, Ph.D.
Dr. Kimberley Edelin Freeman is the
Principal Investigator of the Excellence
and Motivation in Education Research
Group (EMERG) at Howard University. Her
research interests include the motivation
and achievement of African American
children and adolescent, the training of African American
science and mathematics teachers at Historically Black Colleges
and Universities, social cognition, learning communities, and
effective African-American schools. She utilizes mixed-methods
in her research, including secondary data analysis, survey
research, and qualitative approaches such as observations,
interviews and case studies. Dr. Freeman is Principal
Investigator of an NSF HBCU-UP Education Research Project,
Black Excellence in Science/Math Teaching (BEST), to study best
practice in science and math teacher education at Historically
Black Colleges and Universities. She is also leading a study
on African American adolescents’ development and success in
science and mathematics during the middle school years, the
Mathematics/Science Success and Adolescent Development
Project (MSADP).
Dr. Freeman joined the School of Education faculty at Howard
University as an Assistant Professor in Educational Psychology in
August 2005. She also serves as Coordinator of the Educational
Psychology program. Dr. Freeman teaches graduate courses
in social science research methods and motivation in the
classroom. Previously, she served as the second Executive
Director of the Frederick Patterson Research Institute of the
United Negro College Fund (UNCF), Visiting Assistant Professor
at George Washington University, and an Adjunct Professor
at George Mason University. Dr. Freeman received her Ph.D.
with distinction from the Combined Program in Education and
Psychology at the University of Michigan, her Master’s degree in
psychology from the University of Michigan, and her Bachelor’s
degree in psychology from Spelman College. Dr. Freeman’s
recent publications include an article on student motivation
in STEM learning communities, a book chapter on high school
policies affecting African American students, a book chapter on
the achievement motivation of African American adolescents,
and an article in a special issue of Educational Psychologist on
schooling and student well-being.
Yolanda S. George
Yolanda Scott George is Deputy Director
and Program Director, Education and
Human Resources Programs, American
Association for the Advancement of Science
(AAAS). Her duties and responsibilities
include planning, development,
management, implementation, and evaluation of multi-year
science, mathematics, and technology (SMT) education and
educational research projects. She has served as Director of
Development, Association of Science-Technology Centers (ASTC),
Washington, DC; Director, Professional Development Program,
University of California, Berkeley, CA, a pre-college academic
enrichment, university retention, and pre-graduate school
program in SMT for minorities and women, and as a research
biologist at Lawrence Livermore Laboratory, Livermore, California
involved in cell cycle studies using flow cytometer and cell
sorters.
George conducts evaluations, project and program reviews,
and evaluation workshops for both the National Institutes of
Health and National Science Foundation, as well as reviews
SMT proposals for private foundation and public agencies,
including the Sloan Foundation, the Carnegie Corporation of New
York, the Ford Foundation, and the European Commission. She
develops and coordinates conferences and workshops related
to recruitment and retention of minorities, women, and persons
with disabilities in SMT. She works with UNIFEM, UNESCO,
and non-governmental organizations on gender, science,
and technology initiatives related to college and university
recruitment and retention and women leadership in SMT.
Over the last 25 years she has raised over $70 million for a
variety of SMT education initiatives for colleges and universities,
associations, and community-based groups. She currently
serves as Principal Investigator (PI) or co-PI on National Science
Foundation (NSF) grants related to developing evaluation
capacity of PIs, project directors and evaluators for the
Alliance for Graduate Education and the Professoriate (AGEP);
development of a National Science Education Digital Library
(NSDL) Biological Sciences Pathways for biological sciences
educators in undergraduate, graduate and professional schools;
Women’s International Scientific Cooperation Program (WISC);
Historically Black Colleges and Universities-Undergraduate
Programs (HBCU-UP); and Course, Curriculum, and Laboratory
Improvement (CCLI) for undergraduates. She serves on the board
of the International Women in Science and Engineering Network
Program Book
27
Biographies
(INWES); American Institute of Biological Sciences (AIBS)
Education Committee, Award Advisory Committee; Maria Mitchell
Women in Science Award, McNeill/Lehrer Productions Online
Science Reports and Resources Advisory Committee, Great
Science for Girls: Extension Services for Gender Equity in Science
Advisory Committee, Academy for Educational Development,
and the South Dakota Biomedical Research Network Advisory
Committee. George has authored or co-authored over 50 papers,
pamphlets, and hands-on science manuals. She received her
B.S. and M.S. from Xavier University of Louisiana and Atlanta
University in Georgia, respectively.
Nancy Greer-Williams
Nancy Greer-Williams’ most recent title
is Dean and Professor of the School of
Liberal Arts and Social Sciences and Title
III Coordinator. In addition to teaching and
motivating students on the advantages of
a higher education degrees, Greer-Williams
is most passionate regarding education and health disparities
research. She has launched several research initiatives on the
plight of minority students in higher education. Specifically these
include the high attrition rate of African-American, Hispanic/
Latino, and American Indian doctoral students, the cultural and
institutional barriers which prevent access to minority college
students, the connection between low social economic status
and chronic disease in African American college students,
cultural and institutional barriers in organizations which
impact minority leaders, and the crisis regarding diversity in
organizations.
Greer-Williams is pursuing a Masters’ of Public Health
emphasis in Epidemiology (2009) at the University of Arkansas
for Medical Sciences (UAMS). She earned a Ph.D. in Educational
Leadership emphasis in Higher Education Administration
(2004) from Western Michigan University, a Master’s degree
in Organizational Communication (2001) from Western
Michigan University, and a Bachelor of Science in Broadcast
Communication (1997) from Western Michigan University.
She has held several leadership positions in program design
and implementation. At Howard University, she was the Program
Director for the Howard University Science Engineering and
Mathematics (HUSEM) program, a program sponsored by the
National Science Foundation. At Western Michigan University,
Greer-Williams served as the Doctoral Associate for the graduate
28
Program Book
school in the Office of Recruitment and Retention. In this
position, she helped mentor, counsel, and plan programs for
retention of master’s and doctoral students. A component of her
doctoral internship included coordinating the adoption of the
Howard University Preparing Future Faculty (PFF) program at
Western Michigan University.
John K. Haynes
John K. Haynes is the David Packard
Professor in Science and Dean of the
Division of Science and Mathematics at
Morehouse College, in Atlanta, Georgia.
He was born in Monroe, Louisiana and
graduated from Morehouse College
with a B.S. degree in Biology in 1964. He earned the PhD in
Biology from Brown University, in Providence, R.I. in 1970.
After completing post-doctoral fellowships at Brown and the
Massachusetts Institute of Technology, he was appointed
Assistant Professor in the Division of Molecular Medicine at
Meharry Medical College in 1973.
In 1978, he returned to Morehouse as an Associate Professor
of Biology and Director of the Office of Health Professions. In
1981, he was appointed a Full Professor of Biology and in 1985,
Chairman of the Department of Biology. He served as chair until
1999 at which time he was appointed Dean of the Division of
Science and Mathematics at the College.
He has directed a number of externally funded programs at the
College whose purpose was to increase the number of students
pursuing careers in research and medicine, and he has also been
active in such efforts nationally. He served a six-year term as
Chair of the Minorities Affairs Committee of the American Society
for Cell Biology (ASCB) and an additional three years as ViceChair of this Committee.
He has served on two National Academy of Science
Committees, one on undergraduate science education and
the other on programs for advanced study of Mathematics
and Science in American high schools. He has also been a
member of the Committee on Equal Opportunities in Science
and Engineering (CEOSE), which advises the National Science
Foundation, and is currently a member of two other NSF Advisory
Committees: Biology Directorate (BioAC) and Government
Performance and Results (GPA/AC). Haynes has been Principal
Biographies
Investigator on grants from the Howard Hughes Medical
Institute, the Centers for Disease Control, and the National
Institutes of Health.
Dr. Haynes has been a member of the Board of Directors of
the Sickle Cell Foundation of Georgia since 1979. He is a cell
biologist whose current research aims at understanding why the
K-CI co-transporter in the sickle cell membrane is more active
than normal.
Ayanna Howard
Dr. Howard is an educator, researcher,
and innovator. Her academic career is
highlighted by her focus on technology
development for robots that must interact
with and in a human-centered world, as
well as on the education and mentoring of
students in the engineering field. Dr. Howard is a diligent person
who understands the importance of academic and professional
achievement for those pursuing science and technology careers.
Dr. Howard has made significant contributions in the technology
areas of artificial intelligence, computer vision and robotics. Her
published research, currently numbering over 70 peer-reviewed
publications, has been widely disseminated in international
journals and conference proceedings, and supported by NASA,
NSF, and branches of industry. She has found that the most
effective ways to perform research is to retrofit general-purpose
hardware as a baseline to achieve her research objectives. With
this characteristic, she continues to produce novel ideas and
supporting research results with applications that span from
assistive robots that provide self-care in the home to interfacing
climate-change scientists and robots in the Arctic. By working at
NASA before entering the academic world, she brings a unique
perspective to the academic environment. Dr. Howard’s thorough
research record and her breadth of experience and success in
several key technology areas qualifies her as a tremendous
source of knowledge and leadership, as well as inspiration for
students. From hosting of her Astronaut-Robot summer design
workshop for students to producing the book “Intelligence for
Space Robotics,” (TSI Press) she continues to positively affect
and change the world around her.
Ayanna Howard is currently an Associate Professor in the
School of Electrical and Computer Engineering at the Georgia
Institute of Technology. She received her B.S. from Brown
University, her M.S.E.E. from the University of Southern
California, and her Ph.D. in Electrical Engineering from the
University of Southern California. From 1993-2005, Dr. Howard
was at NASA’s Jet Propulsion Laboratory, California Institute of
Technology. Following this, she joined Georgia Tech in July 2005
and founded the Human-Automation Systems (HumAnS) Lab.
Tasha R. Inniss
Tasha Inniss is Assistant Professor,
Mathematics, at Spelman College in
Atlanta, Georgia. She received her
undergraduate degree, Summa Cum Laude,
in mathematics from Xavier University
of Louisiana in 1993 and her PhD degree
from the University of Maryland in applied mathematics in
December 2000. Inniss, along with Sherry Scott and Kimberly
Weems, were the first African-American women to receive PhDs
in mathematics from the University of Maryland, College Park.
Weems and Scott are also Assistant Professors at North Carolina
State University and Marquette University, respectively.
Inniss dissertation entitled, “Stochastic Models for
Determining Airport Arrival Capacity Distributions,” addressed
an essential problem in air traffic management of national
concern: the quantification of airport arrival capacity uncertainty.
Inniss has made scientific presentations on her work in air traffic
management at several professional meetings, including the
Institute for Operations Research and the Management Sciences
and the Society of Industrial and Applied Mathematics.
While at the University of Maryland, Inniss taught several
undergraduate mathematics courses for which she received
outstanding teaching evaluations. She was an active member
of the Black Graduate Students in Applied Mathematics and
Statistics Association, and was instrumental in its receiving the
University of Maryland’s Golden Geese Award for the mentoring
and tutoring program it established.
Inniss has held a faculty position at Trinity College, as the
Clare Booth Luce Professor. She received the Federal Aviation
Administration (FAA) Centers of Excellence Student of the Year
Award in 2002 and was honored at a reception sponsored by
Lieutenant Governor Kathleen Kennedy Townsend and the
Legislative Black Caucus in Annapolis. In addition, she was a
recipient of David and Lucille Packard HBCU Scholar award in
1993, which provided up to $100,000 for her graduate education.
Program Book
29
Biographies
Caesar R. Jackson
Caesar R. Jackson is presently the Dean of
the College of Science and Technology at
North Carolina Central University (NCCU).
He joined NCCU in August 2005 after being
employed at North Carolina Agricultural
and Technical State University (NCA&T)
for 13 years. At NCA&T, Jackson was Interim Dean of the College
of Arts and Sciences from 2002 to 2005, Associate Dean for
Research and Graduate Programs in the College from 1998 to
2000, Professor of Physics and Chairperson of the Department
of Physics from 1994 to 1998, and Assistant Professor from 1992
to 1994. Before NCA&T, Jackson was a Staff Engineer for the IBM
Corporation, where he was employed from 1977 to 1992. Jackson
earned a Bachelor of Engineering Technology in Electrical
Engineering from Florida Agricultural and Mechanical University
in 1977, a Master of Engineering in Electrical Engineering from
the University of Florida in 1980, and a Doctor of Philosophy in
Physics from North Carolina State University in 1992. He has
been engaged in nuclear physics research at Triangle Universities
Nuclear Laboratory in Durham, North Carolina, and at Thomas
Jefferson National Laboratory in Newport News, Virginia. He
continues to be involved in scholarly activities at the NCCU,
focusing on science education research and on issues associated
with increasing the number of minorities pursuing degrees and
careers in science, technology, engineering, and mathematics.
Tamara Lewis Johnson
Tamara Lewis Johnson is the Women’s
Health Program Manager for the National
Institute of Allergy and Infectious
Diseases at the National Institutes of
Health. She is responsible for advising
the executive management team on
policies and programs that advance women’s health research
and sex differences research in the scientific areas of infectious
diseases and immune mediated health conditions. Prior to that,
she has served as the Deputy Director of the Bureau of Primary
Health Care’s Office of Minority and Women’s Health where she
implemented a collaborative partnership that responds to the
unique cultural and linguistic needs of underserved populations.
She worked on assignment at the World Bank researching the
relationship between culture and gender roles for women’s
30
Program Book
health in Latin America and Africa. She began her federal career
in the Bureau of Primary Health Care’s Division of Community
and Migrant Health developing and establishing community
based primary health care delivery systems for underserved
populations. Prior to her fifteen years in federal service, she
worked in executive management positions at community
health centers, academic medical centers and for-profit hospital
systems. She has a bachelor’s of science degree in industrial
engineering from Stanford University and master’s degrees in
Business Administration and Public Health from the University of
California, Berkeley.
Adriane G. Ludwick
Adriane G. Ludwick is a retired Professor
of Chemistry at Tuskegee University.
She managed the NSF HBCU-UP grants
at Tuskegee University since 1999.
Currently, she is on the Board of Trustees
of the Alabama Academy of Science and
a Councilor for the Auburn Section of the American Chemical
Society. She was Chemistry Department Head at Tuskegee
University from 1992 to 1999. Her degrees in chemistry are from
Rutgers University (Douglass College) (BA) and the University
of Illinois at Urbana/Champaign (MS and PhD). Her career
has been entirely at Tuskegee, with summer interludes at Oak
Ridge National Laboratory, the Lawrence Livermore Laboratory,
Bell Laboratories in Murray Hill, New Jersey, and the Naval Air
Development Center. Faculty fellowships from the National
Institutes of Health and NSF (1978–1980) allowed study and
research in polymer science at the University of Michigan.
This led to her development of a course in polymer chemistry
and to her involvement in material science research. Some
of her current research centers on “green chemistry.” The
characterization and application of an anti-corrosion marine
coating containing extracts from algae and herbs is underway
in collaboration with Alexandria University in Egypt. A more
extensive collaboration with Assiut University in Egypt involves
the preparation of modified bagasse for use as an oil-absorbing
material. Other recent work includes the modification of phenol/
formaldehyde resins by the introduction of boron or halogen
or various nanosilicates and the study of the aging mechanism
of polyurethanes. This current research has been supported
by individual grants as well as by grants obtained by teams
of Tuskegee faculty members. Her teaching has ranged from
Biographies
general chemistry to organic chemistry to polymer chemistry
and from freshman to PhD-level classes. Most recently, she has
been developing a graduate-level polymer science course for
engineers and chemists.
Shirley M. Malcom
Shirley M. Malcom is Director, Education
and Human Resources (EHR) Programs at
AAAS. EHR includes programs in education,
activities for underrepresented groups,
and public understanding of science and
technology. Malcom was head of the AAAS
Office of Opportunities in Science from 1979 to 1989. Between
1977 and 1979, she served as a program officer in the Science
Education Directorate of the National Science Foundation (NSF).
Before this, she held the rank of assistant professor of biology,
University of North Carolina, Wilmington. Other work experience
includes two years as a high school science teacher.
Malcom received her PhD in Ecology from the Pennsylvania
State University a Master’s in Zoology from the University of
California, Los Angeles, and a Bachelor’s with distinction in
Zoology from the University of Washington. In addition, she
holds 15 honorary degrees.
Malcom serves on several boards, including the Heinz
Endowments, Commission on Professionals in Science &
Technology, and University Corporation for Atmospheric
Research. She serves as a trustee of Caltech and as a Regent of
Morgan State University. In addition, she has chaired a number
of national committees addressing education reform and access
to scientific and technical education, careers, and literacy. In
2003, Malcom received the Public Welfare Medal of the National
Academy of Science, the highest award granted by the Academy.
She was a member of the National Science Board, the
policymaking body of NSF, from 1994 to 1998 and of the
President’s Committee of Advisers on Science and Technology
from 1994 to 2001.
Karen Marrongelle
Karen Marrongelle is a Program Director
in the National Science Foundtation
Division of Research on Learning in Formal
and Informal Settings. Before coming to
NSF, Karen was an Associate Professor of
Mathematics and Statistics at Portland
State University in Portland, OR. Karen received her Ph.D. in
mathematics education from the University of New Hampshire in
2001. Her research interests include the learning and teaching of
undergraduate mathematics, mathematics teacher professional
development, and integrated mathematics and science
education. For the past several years her research has focused
on the learning and teaching of dynamical systems.
Cora B. Marrett
Dr. Cora B. Marrett is the Assistant Director
of the Directorate for Education and
Human Resources (EHR) at the National
Science Foundation (NSF). She leads
the NSF’s mission to achieve excellence
in U.S. science, technology, engineering
and mathematics (STEM) education with oversight of a budget
of approximately $825 million and a staff of 150. EHR is the
principal source of federal support for strengthening STEM
education through education research and development (R&D).
Dr. Marrett currently co-chairs the Subcommittee on science,
technology, engineering and mathematics Education of the
National Science and Technology Council, Committee on Science.
Prior to her appointment at the NSF, Dr. Marrett served as the
Senior Vice President for Academic Affairs in the University of
Wisconsin System. Her NSF position is in conjunction with the
UW-Madison Department of Sociology, where she remains a
tenured faculty member.
Earlier, she held the post of Senior Vice Chancellor for
Academic Affairs and Provost at the University of MassachusettsAmherst.
Her current position represents a return to NSF. She served at
NSF as the first Assistant Director of the Directorate for Social,
Behavioral and Economic Sciences. She received the NSF’s
Distinguished Service Award for her leadership in developing
new research programs and articulating the scientific projects of
Program Book
31
Biographies
the directorate. Dr. Marrett also served as the initial chair of the
Committee on Equal Opportunities in Science and Engineering
(CEOSE).
In addition to her faculty appointment at the University of
Wisconsin-Madison, she has been a faculty member at the
University of North Carolina and Western Michigan University.
Dr. Marrett holds a B.A. degree from Virginia Union University,
and M.A. and Ph.D. degrees from UW-Madison. She has an
honorary doctorate from Wake Forest University. She is a Fellow
of the American Association for the Advancement of Science,
the American Academy of Arts and Sciences, and Sigma Xi, the
Science Research Society.
Dr. Marrett received the Erich Bloch Distinguished Service
Award from the Quality Education for Minorities (QEM)
Network, given annually to an individual who has made
singular contributions to the advancement of science and to the
participation of groups underrepresented in science, technology,
engineering and mathematics. She is widely published in
the field of sociology, and has held a number of public and
professional service positions.
Larry Mattix
Larry Mattix is Professor of Physics at
Norfolk State University. In 2002, he
became the Associate Dean of the School
of Science and Technology. Mattix is the
Project Director for the STARS Program
(Science and Technology Academicians
on the Road to Success), Norfolk State University’s HBCUUP Implementation Project. He directs and coordinates the
University’s graduate Title III activities in Materials Science and
led the development of the PhD Program in Materials Science
and Engineering, which begins in the fall of 2007. His area of
research specialization is magnetic relaxation in solids and the
applications of magnetic resonance to structural polymers. His
research and educational efforts have resulted in numerous
publications and external federal, state, and private funding.
Mattix has more than 30 years of experience in higher
education. Before his appointment as Associate Dean, he served
as Director for the Center for Materials Research at Norfolk State
University for three years. He was Chairman of the Department
of Physics at Norfolk State University for three years. In 1985,
Mattix helped to found the Dozoretz National Institute for
Mathematics and Applied Science, a science honors program at
32
Program Book
Norfolk State University. He served as its Director for more than
12 years.
He graduated from Clark-Atlanta University (then Clark
College) in Atlanta, Georgia, with a Bachelor of Science in
Physics. He earned MS and PhD degrees in Solid State and
Materials Physics from the University of Illinois in Urbana and
the College of William and Mary in Williamsburg, Virginia,
respectively. He is a member of Alpha Kappa Mu honor Society,
Beta Kappa Chi Honor Society, and Sigma Xi Research Honor
Society. Mattix was also an Alpha Phi Alpha Fraternity Scholar,
an Institute for Services to Education Fellow, and a National
Research Council (NRC) Postdoctoral Fellow at the Naval
Research Laboratory in Washington, D.C.
Camille A. McKayle
Camille A. McKayle received her B.S. in
Mathematics from Bates College, Lewiston
ME, and went on to receive her Ph.D., also
in Mathematics, from Lehigh University,
in Bethlehem PA. She taught for three
years at Lafayette College, Easton PA,
before moving to the Virgin Islands in 1996, where is Interim
Dean of Science and Mathematics and Associate Professor of
Mathematics at the University of the Virgin Islands.
McKayle served as co-Principal Investigator and project
director for the NSF Historically Black College and University
Undergraduate Program (HBCU-UP) project at the University
of the Virgin Islands (UVI), as well as a variety of other grant
projects at the university that aimed to strengthen the quality of
the preparation that UVI students in science and mathematics,
with an overall goal of increasing the number of students that
choose graduate study in a Science, Technology, Engineering or
Mathematics (STEM) disciplines.
From Fall 2005 to Summer 2008, McKayle was at the National
Science Foundation, in the role of Program Officer for the
Historically Black Colleges and Universities Undergraduate
Program in the Division of Human Resource Development, in the
Directorate for Education and Human Resources.
McKayle has been quite active in a variety of outreach
activities aimed at increasing interest in science and
mathematics for students in grades 3 through 12. These
activities include GEMS (Girls Exploring Math Stuff ) for 6th
grade girls, MathLab for students in third through seventh grade,
Science Awareness Saturday Academies and Summer Science
Biographies
Enrichments Academies. Through these activities, she tries to
relay her love and enjoyment of mathematics to elementary,
middle, and high school students. She has also participated as
organizer and presenter in workshops for mathematics teachers
in the Virgin Islands.
Felecia McInnis Nave
Felecia McInnis Nave is an Assistant
Professor of Chemical Engineering in the
Department of Chemical Engineering at
Prairie View A&M University. She received a
B.S. degree in chemistry from Alcorn State
University and a M.S. and Ph. D. in chemical
engineering from the University of Toledo. Her research interests
include: functionalized membrane systems, bioseparations,
culturally responsive epistemology and pedagogy in engineering
education and issues impacting the academic success and
persistence of African American and women students in STEM
disciplines. She has received funding from agencies such as
the NSF, DOD, ExxonMobil, SWE, Engineering Information
Foundation and PVAMU research foundation totaling over $1.5M
for both her technical and education related research agenda.
She is the receipt of the 2008 Prairie View A&M
University College of Engineering Service Award, Carl Storm
Underrepresented Minority Fellowship - Gordon Conference
(2006), Texas A&M University Michael E. DeBakey Institute
Fellow (2006) Visiting Scholar, University of Missouri-Columbia
Southwestern Bell Science Education Center (2004), and
Recipient of Office of Naval Research (ONR) Historically Black
Engineering College Future Faculty Fellowship (2001-2003).
Dr. Nave’s scholarship has been published and presented
at local, regional, and national conferences such as the
International Congress On Membranes and Membrane Processes
(ICOM), North American Membrane Society (NAMS), American
Institute of Chemical Engineers (AICHE), American Society for
Engineering Education (ASEE), Frontiers in Engineering (FIE),
Faculty Resource Network Online Journal, National Association of
Student Affairs Professional (NASAP) Journal, and Separation &
Technology.
Catherine M. Millett
Catherine Millett is a Senior Research
Scientist in the Policy Evaluation and
Research Center at Educational Testing
Service in Princeton, NJ. Her research
focuses on educational access, student
performance and achievement, educational
equity, and student financing for various population groups in
the United States at the postsecondary educational level.
She co-leads an evaluation of the Goldman Sachs Foundation’s
Signature Initiative “Developing High-Potential Youth.” She is
also the Co-Principal Investigator of a national study of college
student retention entitled “High Achieving African American and
Hispanic College Dropouts: A Search for Strategies to Increase
Their Performance, Persistence, and Degree Completion.”
One area of her current research is on the doctoral student
experience. She is co-author of the book Three Magic Letters:
Getting to Ph.D. which is based on a research study of over 9,000
doctoral students at 21 universities.
She serves on the Technical Review Panel for the Educational
Longitudinal Study 2002 (ELS) 2002) as well as the Beginning
Postsecondary Study 2004/06 (BPS:2004/06) both sponsored
by the National Center for Education Statistics (NCES). Millett
was a visiting lecturer at the Woodrow Wilson School of Public
Policy at Princeton University in 2004 and 2005. From 1994 to
2003, Millett held various research positions at the University
of Michigan. From 1989 to 1994, she was the Housing Officer
for Harvard College. She received her B.A. degree in economics
from Trinity College, Hartford, CT; her Ed.M. in administration
planning and social policy from the Harvard Graduate School
of Education; and her Ph.D. in public policy in higher education
from the University of Michigan. She served on the University
of Michigan School of Education Alumni Society Board of
Governors.
Millett is a member of the Association of the Study of Higher
Education (ASHE), the American Education Research Association
(AERA), the Association for Institutional Research (AIR) and the
American Association of University Women (AAUW).
Program Book
33
Biographies
Joe Omojola
Joe Omojola is currently a Professor of
Mathematics and Physics at Southern
University at New Orleans (SUNO). He is
also the Campus Coordinator for SUNO’s
Louisiana Alliance for Minority Participation
(LAMP), the Director of SUNO’s component
of the Graduate Alliance for Education in Louisiana (GAELA),
and one of two managers for the Program for Excellence in
Science, Mathematics, and Computer Technology (PESMaCT).
Between these programs, over half a million dollars per year in
grants funding is attracted to SUNO. Previously, Omojola served
as the Dean of the College of Science and as the Chair of the
Department of Mathematics and Physics.
Results of Omojola’s mentoring work among the poorest
minority population are very impressive. For instance, five of
Omojola’s former students from SUNO and one from Dillard
University are currently in graduate schools in mathematics and
physics. In 2006, Omojola was awarded The National Role Model
Award for his dedication and commitment to the education
of minority and women and for increasing opportunities for
the same group, in the science, technology, engineering, and
mathematics (STEM) workforce. Additionally, Omojola was
nominated for the Presidential Awards for Excellence in Science,
Mathematics, and Engineering Mentoring (PAESMEM).
Through grants and other related activities, Omojola has been
able to foster effective collaborations with public school teachers
from the New Orleans Public Schools (NOPS) system and faculty
members from other institutions. Omojola has been a model of
passion, commitment, and dedication to teaching, mentoring,
and research. The broader impact of Omojola’s work is seen
in the number of his students being drawn into mentoring and
teaching.
Sadanand Srivastava
Sadanand Srivastava is a Professor and
Chair of the Department of Computer
Science. He has been associated with the
Bowie State University (BSU) for the last
37 years. His teachings in India, Canada,
and Iraq have provided him with a global
perspective in education.
Srivastava has been engaged in active research throughout
34
Program Book
his career. His work has been published in national and
international journals. His areas of interest have been applied
analysis, computational methods, artificial intelligence, and user
interface systems. Throughout his tenure at BSU, Srivastava has
been working on funded projects with NASA, the Department of
Defense, and NSF.
Srivastava is Project Director of the project BETTER (NSF:
HBCU-UP Program). He was Conference Chair for the 7th Annual
HBCU-UP Conference in Baltimore. He is principal investigator
(PI) of the grant Implementing Community-Based Participatory
Research…Women (an NSF-funded project). Srivastava is the
Institutional Director of the Chesapeake Information-Based
Aeronautics Consortium (a NASA-funded project).
He was PI of several funded research projects, such as a multiyear (1998–2003) NSF infrastructure grant (Project LEARN), a
3-year (1999–2002) NSF collaborative grant (CERI), a NASA grant
(Agent-Based Information Processing Systems), and an NSA/
UMBC grant (Document Ontology and Agent Monitors). He was
an institutional representative on MCTP (an NSF-funded project
for the Maryland Collaborative Teachers Preparation program).
Srivastava was a member of the Board of Directors for MAITI
(Maryland Applied Information Technology Initiative) and was
also a member of the Advisory Board for GAANN (Graduate
Assistance in Areas of National Need).
James H. Stith
James H. Stith is the Vice President,
Physics Resources Center for the American
Institute of Physics. He directs a broad
portfolio of programs and services that
includes AIP’s Magazine Division, the
Media and Government Relations Division,
the Education Division, the Center for the History of Physics, the
Statistical Research Division and the Careers Division.
His Doctorate in physics was earned from The Pennsylvania
State University, and his Masters and Bachelors in physics were
received from Virginia State University. A physics education
researcher, his primary interests are in Program Evaluation, and
Teacher Preparation and Enhancement. Throughout his career,
he has been an advocate for programs that ensure ethnic and
gender diversity in the sciences.
Dr. Stith was formerly a Professor of Physics at The Ohio State
University and also spent 21 years on the faculty of the United
States Military Academy at West Point. He has also been a
Biographies
Visiting Associate Professor at the United Air Force Academy, a
Visiting Scientist at the Lawrence Livermore National Laboratory,
a Visiting Scientist at the University of Washington, and an
Associate Engineer at the Radio Cooperation of America. He is a
past president of the American Association of Physics Teachers,
past president of the National Society of Black Physicists, a
Fellow of the American Association for the Advancement of
Science, a Fellow of the American Physical Society, a Chartered
Fellow of the National Society of Black Physicists, and a
member of the Ohio Academy of Science. In 2004 he was named
one of “50 Most Important Blacks in Research Science” by
the magazines Science Spectrum and US Black Engineer &
Information Technology. Additionally, he serves on a number
of national and international Advisory Boards and has been
awarded a Doctor of Humane Letters by his alma mater, Virginia
State University. In October 2005, he was named an Alumni
Fellow, the highest honor given by the Pennsylvania State
University Alumni Association.
Marilyn J. Suiter
Marilyn J. Suiter is a geologist and
educator with more than twenty-five
years of experience. She is a Program
Director in the Education and Human
Resources Directorate (EHR) at the
National Science Foundation (NSF). Her
responsibilities are in (geo) science education and diversity
issues as they are implemented in K-12, undergraduate, and
graduate education. Suiter recently completed a fifteen-month
detail in the Budget Division of the NSF Office of Budget,
Finance and Award Management (BFA). The position involved
NSF-wide performance activities including, but not limited
to: The Government Performance and Results Act, OMB’s
Program Assessment Rating Tool and Budget-Performance
integration activities in the President’s Management Agenda,
with particular focus on the Advisory Committee for GPRA
Performance Assessment. She is currently a program officer with
the Historically Black Colleges and Universities Undergraduate
Program, and the CREST/SBIR-IIP partnership, and manages the
Cooperative Activity with Department of Energy Programs for
Education and Human Resource Development.
Suiter’s career has included positions as Director of Education
and Human Resources at the American Geological Institute,
Exploration Geologist for Cities Service Oil & Gas, Geologist for
the U.S. Geological Survey, and educator positions at American
University and in the Philadelphia Public Schools. Suiter is
an AAAS Fellow. In addition to her wide-ranging interests and
experience in geosciences education and workforce issues, she
retains a special interest in activities in professional societies
and has held offices in the Association for Women Geoscientists,
the Association for Women in Science, and the Geological
Society of America.
Sandra H. Thomas
Sandra H. Thomas is currently the
Executive Director of the Institute for
Broadening Participation and Senior
Administrator for the IGERT National
Recruitment Program. Previously, Thomas
was the Vice President for Programs at
the Island Institute, a small nonprofit educational organization
on the coast of Maine. She also developed and directed an
international fellowship program sponsored by the U.S. Agency
for International Development (USAID). She has over 20 years
of experience in the administration of interdisciplinary science
and education projects at the University of Michigan, primarily
in environmental sciences. Her experience includes all aspects
of project management and student recruitment and retention.
She played a central role in developing one of the first successful
IGERT proposals at the University of Michigan in 1999.
Richard Weibl
Richard Weibl is Director of the AAAS
Center for Careers in Science and
Technology (www.aaas.org). He works
with AAAS career development programs
to strengthen their offerings and to
create new opportunities to support
the career aspirations and development needs of future and
current scientists. Weibl joined AAAS in 2005 after a tour of
service in the U.S. Peace Corps as an education and community
development volunteer based in the Northwest Province of
South Africa. Before the Peace Corps, Weibl served as U.S.
editor for Science’s Next Wave (www.sciencecareers.org) and
as editor at Next Wave’s Postdoc Network (now the National
Postdoctoral Association, www.nationalpostdoc.org). From
November 1996 to June 2001, he was manager of the national
Program Book
35
Biographies
Preparing Future Faculty (www.preparing-faculty.org) program
and Director of Programs, Education and Institutional Initiatives
at the Association of American Colleges and Universities and
the Council of Graduate Schools. Earlier, he served in research
and administrative positions at Antioch College, Ohio State
University, Marquette University, Longwood College, and
University of Georgia. You can contact Weibl at, Director, Center
for Careers in Science and Technology, AAAS, 1200 New York
Ave., NW, Washington, DC 20005. Email: [email protected], www.
aaascenterforcareers.org.
Middle School Academic and Psychological Development
Success Project, and the HBCU-UP Black Excellence in Science
Teaching Project.
Dr. Winston is the former Director of Educational, Fellowship,
and Internship Programs at the Congressional Black Caucus
Foundation (CBCF) and Program Director for the NSF Alliances
for Graduate Education and the Professoriate (AGEP) at Howard
University. She earned her Masters degree in Psychology
and Ph.D. in Psychology and Education from the University of
Michigan. She earned a Bachelor’s of Science degree from
Howard University.
Cynthia E. Winston
Dr. Winston is an Associate Professor in
the Howard University Department of
Psychology and Principal Investigator of the
Identity and Success Research Laboratory
(http://web.mac.com/cwinston.isrl). She
also is the Principal and founder of Winston
Synergy, L.L.C. (www.winstonsynergy.com), a psychology and
research consulting firm. As a leading edge narrative personality
psychologist, Dr. Winston’s professional career is devoted to
understanding identity, as well as the psychology of race, racism,
and success within lives. Dr. Winston has received several
professional awards including the Howard Hughes Medical
Institute Research Professor Fellowship from Brown University,
the Emerging Scholar Award from the Howard University Faculty
Senate, the Howard University Syllabus of the Year Award, and
the National Science Foundation Early CAREER Award.
Dr. Winston conducts interdisciplinary psychology, science,
and engineering education research. Adopting a novel
interdisciplinary approach, her research integrates personality
psychology, narrative psychology, educational psychology,
and psychology engineering. She also has a special interest
and expertise in mixed methods research design and data
analysis. Through integrating digital technology with narrative,
survey, and case study research methods, she has created the
Identity and Success Life Story Research Method to stimulate
the construction of autobiographical memories, life review, and
personality assessment. Currently, Dr. Winston is engaged in
five psychology and education research projects funded by the
National Science Foundation, Howard University, and Winston
Synergy, L.L.C.: the Identity and Success Life Story Project, the
Narrative Engineering Project, the Personality and Narrative
Identity Study, the Howard University Mathematics and Science
36
Program Book
Alfred Wilson
Al Wilson serves as Program Analyst in the
National Science Foundation’s Division
of Human Resource Development. From
1992 to 2006, Al served as Grants and
Agreements Specialist for NSF’s Division
of Grants and Agreements. Before joining
NSF in 1992, Al served as Grants Specialist at the National
Aeronautics Space Administration. In addition to his duties, he
serves as the Chair of the National Science Foundation’s Physical
Fitness Facility.
James H. Wyche received his undergraduate
degree from Cornell University in 1965 with
a B.S. degree in microbiology. He received
his Ph.D. at Johns Hopkins in Biology in
1972. His thesis problem was in the area
of histidine amino acid biosynthesis and
genetic analyses using the microbe, Salmonella typhimurium.
Upon receiving his Ph.D., he went to the University of California at
Berkeley as a postdoctoral fellow in the Biochemistry Department
working on the regulation of histidine biochemistry. In 1973,
his second postdoctoral appointment was at the University of
California, San Diego working on problems related to cellular
endocrinology in animal cells. His first academic position (1974)
at University of Missouri - Columbia was a joint appointment in
the Departments of Biological Sciences (Arts & Sciences) and
Biochemistry (Medical School). He moved to Hunter College,
City University of New York to take a position in the Department
of Biology in 1981. During the course of a sabbatical leave in
Biographies
1987 at Stanford Medical School, he left to take the position of
Associate Dean of Biology and Medicine and Associate Professor
of Medical Science at Brown University. In 1991 he was appointed
Associate Provost and created with President Vartan Gregorian
the Leadership Alliance (www.theleadershipalliance.org) based
at Brown University with 23 member institutions to advance the
number of underrepresented students going into academe and
private industry, and to advance minority faculty development.
From 1991 to 2001 he served as Executive Director of the Alliance
and its national programs as well as other international student
and faculty research initiatives in sixteen countries while
conducting an active research program as Professor of Medical
Science at Brown. From 2001-02 he served as interim-president at
Tougaloo College, Jackson, MS and then Vice-Provost and Dean,
College of Arts & Science (2002-04) and Professor of Biology
and Pharmacology (2002-2005) at the University of Miami. He
moved to the University of Oklahoma Health Sciences Center
as Vice Provost and Professor of Biochemistry from July 2005February 2007 and left to create and head PanCagen, Inc. with
six other scientists to link their efforts for new drug development
for pancreatic cancer. He has received grants from, consulted
and served on panels for the National Institutes of Health, the
National Science Foundation and private foundations. He has
been an active member of the American Society for Cell Biology
and the American Society for Biochemistry and Molecular Biology,
having also served on their national and international scientific
committees. His current and past research interests involved
investigating basic mechanisms regulating cell death or apoptosis
in human cancer cells as a model system for studying the effect of
natural products and their analogs on killing cancer cells.
Ford Foundation Diversity Fellowships
offered by the
Ford Foundation Diversity Fellowships are designed to increase the diversity of the
nation’s college and university faculties by increasing their ethnic and racial
diversity, to maximize the education benefits of diversity, and to increase the number
of professors who can and will use diversity as a resource for enriching the
education of all students. Fellowships are offered on the following three levels:
Predoctoral for 3 full years leading to the Ph.D., including 1 full year of coursework.
Dissertation for 1 year for writing the dissertation.
Postdoctoral for 1 year of career enhancement.
Approximately 60 predoctoral fellowships, 35 dissertation fellowships and 20 postdoctoral fellowships
will be offered in 2009.
For further information, including eligibility information and online applications, see
http://national-academies.org/fellowships. Direct questions to: [email protected] or 202-334-2872
Program Book
37
IGERT Traineeships in
Engineered Bioactive
Interfaces and Devices
The Integrative Graduate Education and
Research Traineeship (IGERT) program, funded
by the National Science Foundation, is a multidisciplinary doctoral fellowship program for
students interested in the science and engineering
of bioactive interfaces and devices.
The research program is focused around three integrative themes: Novel Bioactive Architectures, Cell/Protein Interactions at Interfaces, and Integration into Devices which are critical
areas for future biomedical advances. Participants in the IGERT program are from
the Departments of Chemical and Materials Engineering, Chemistry, Electrical and
Computer Engineering, Anatomy and Neurobiology, Molecular and Cellular
Biochemistry, the Center for Biomedical Engineering and the College of Pharmacy.
Graduate students participating in the IGERT program receive their Ph.D. in one of
these areas while benefiting from a host of multidisciplinary education and research
activities in bioactive interfaces and devices. IGERT fellows receive a $30,000/yr.
stipend for two years with standard competitive departmental support for the remaining years of study. In addition, funds are available for tuition, travel to conferences as
well as an allotment for research supplies.
http://igert.engr.uky.edu
Abstracts
Student Abstracts – Oral Presentations .......................... A2
Biology............................................................................. A2
Computer & Information Science.....................................A14
Ecology, Environmental & Earth Sciences........................A16
Physical & Mathematical Sciences..................................A18
Social & Behavioral Sciences......................................... A25
Technology & Engineering.............................................. A26
Student Abstracts – Poster Presentations........................ A30
Biology........................................................................... A30
Computer & Information Science.................................... A48
Ecology, Environmental & Earth Sciences........................A51
Physical & Mathematical Sciences................................. A54
Social & Behavioral Sciences......................................... A65
Technology & Engineering.............................................. A67
Faculty and Administrator Abstracts ................................ A72
Packard Scholars Abstracts.............................................. A76
Program Book
A1
Abstracts
Student Oral Presentation Abstracts
Biology
OA #1
Distribution of Intrinsic Choroidal Neurons in Chick Whole
Mounts
Richard Anderson, Department of Chemistry, Langston University
L. Shelton and J. Summers Rada, Department of Cell Biology,
University of Oklahoma Health Sciences Center
Recent investigations have demonstrated that the choroid plays a vital
role in regulation of myopic defocus. The current study suggests that the
changes in choroidal permeability, thickness, and blood flow that occur
during this ocular compensatory regulative behavior may be stimulated
by intrinsic choroidal neurons (ICN). The objective was to determine the
distribution of ICN in the chick choroid and the possible changes in distribution of the neurons during different stages of myopia.
Methods: Eyes were enucleated from untreated, day old chicks as well
as chicks undergoing form deprivation for 4 or 7 days to induce myopia.
NADPH-diaphorase was utilized to identify nitric oxide containing ICN in
choroidal whole mounts and cross sections. The neurons were counted
using a dissecting microscope, and diaphorase stained whole mounts and
cross sections were viewed with light microscopy at magnifications of 40
– 100X.
Quantitation of ICN in choroids of untreated, day old chicks indicated that
the neurons were most abundant in the superior and temporal regions of
the eye with averages of 45% and 30% respectively, and less abundant in
the nasal and inferior regions with averages of 19% and 8% respectively.
The number and distribution of ICN were similar in control and myopic
eyes. Additionally, examination of whole mounts and cross sections indicated localization of the neurons on the retinal side of the choroid.
Results of these studies indicate that ICN are most abundant in the superior and temporal regions of the choroid and less abundant in the nasal
and inferior regions. The finding that the neurons are located on the retinal surface suggests that ICN may play a role in controlling the blood vessels of the choroidal capillaries. Although the number of ICN was similar
in control vs. myopic eyes, this may indicate less density of the neurons
during elevated stages of myopia since the myopic eye is larger.
[Funding was provided by NIH (EY09391) and the LINC Program.]
OA #2
Study on the Growth Rates of Floating Aquatic Plants
Joya Anthony, Jackson State University
Hyun Jung Cho, Jackson State University
Aquatic plants provide food to aquatic organisms, serve as nursery habitats, help reduce shoreline erosion, and influence the supply of oxygen
in water. However, fast growing aquatic plants, especially free-floating
or floating-leaved plants of inland water bodies can become invasive by
outcompeting native species. Often times, the invasive aquatics form extensive surface canopies that prevent gas exchange and light penetration,
hinder recreational activities, and even harm fisheries. We conducted a
study to test a hypothesis: Aquatic plants that are common in Mississippi
natural waters have the ability to grow and become potentially invasive
when they are accidentally or intentionally transported to a new habitat
with relatively low nutrients.
We conducted a short-term experiment to observe the growth rates of
four species of floating aquatic plants: Lemna minor (duckweed), Azolla
caroliniana (mosquitofern), Eichhornia crassipes (waterhyacinth), and
A2
Program Book
Myriophyllum aquaticum (parrot feather). Nine (9) waterhyacinth and fifteen (15) parrot feather plants were placed in a 100 gallon tub and marked
off into a grid. Ten individual duckweeds and mosquitofern were separately placed in 250 ml glass containers. There were two nutrient levels
(control and 2-drops of plant nutrient added) and three replicates for each
species. The initial and final pat-dried biomass, shoot and root lengths,
and the number of leaves of each plant were measured. Plant nutrients
(AZOO Nutrients for plants) were added into the waterhyacinth tank. We
observed the growth of each plant and recorded the number of leaves
every day. Biomass doubling time (days) was calculated using the initial
biomass at the beginning of the study and the final biomass following the
Reddy and DeBusk equation (1984).
Our results indicated that daily growth rates of waterhyacinth were 1mm
per day for roots and 7 mm per day for shoots. According to our results,
it takes three to seven days for floating water plants to double their biomass with Waterhyacinth being the fastest growing plant. Parrot feather
that obtain nutrients mostly from the sediment had the slowest growth
rates when they were not rooted.
Fragments and parts of all of the plants can spread to new habitat and
possibly become invasive. It is also known that excess nutrients entering
the water supplies trigger the rapid growth of the plants. It is important to
know what species can cause problems and to not transport them as well
as to prevent eutrophication of natural water resources.
OA #3
Histological Examination of Channel Catfish (Ictalurus
punctatus)and Zebrafish (Danio rerio) Ovaries
Alana Antoine, LeMoyne-Owen College
S. Holmes and N.A. Bayakly, LeMoyne-Owen College
The maturation of channel catfish (Ictalurus punctatus) and zebrafish
(Danio rerio) ovarian follicles were examined histologically to study atresia in fish oocytes. Channel Catfish ovaries showed a typical follucilogenesis progression with blood vessels projecting through the lamellar
structure of the ovary. The Theca Folliculi of a mature follicle showed great
innervations of blood capillaries. Slides prepared from the Zebrafish ovary
showed all the follicular stages of development from Stage I through the
Yolky and fully mature stages. We have shown histologically that during
folliculogenesis in Zebrafish ovary there is a sub zonal layer that develops
in the early yolk stage and loses prominence in the advanced yolky stage.
Slides from the post ovulatory ovary showed the presence of only two
types of follicles: Post Ovulatory and Atretic follicles. Blood capillaries in
the Theca Folliculi of the post ovulatory follicle seem to develop rapidly
while in the atretic follicle the blood capillaries develop in the lumen of
the oocyte. This supports the concept that in Zebrafish, atresia is a strategy for energy reservation not folliculogenesis gone wrong.
OA #4
The Prevalence of Coliforms on the Restroom Doors
Monte Armstrong, Atlanta Metropolitan College
Dr. E Lyons and Tashiba Nelson, Albany State University
Eric Va’Shon Brown, Abraham Baldwin Agriculture College
Coliforms are rod shaped, gram negative, non-sporulating bacteria found
in the intestines and feces of humans. Coliforms are indicator bacteria
used to identify fecal contamination in water sources. These indicator bacteria can also be used to locate contamination on surfaces. The purpose
of detecting coliforms on a surface is to prevent the spread of bacteria
to other surfaces. The surface areas being tested are the individual male
and female restrooms on the third floor of Albany State’s ACAD building.
Due to the higher population of females in this specific area, there is an
expectation that more coliforms will be present on their restroom door.
Abstracts
The samples taken were colonized using the 1:10 serial dilution method in
Eosin Methylene Blue agar deep tubes. EMB agar is a nutrient rich source
which promotes the growth of gram negative bacteria. The 1:10 serial dilution resulted in very low counts of coliforms. The 1:5 serial dilutions were
employed to produce comparative results with increased sensitivity and
were presumed to be more accurate. The female restroom had 437,500
coliforms per ml, in contrast to the male restroom which only had 9,000
coliform per ml. These results are consistent with the hypothesis of a
higher prevalence of coliforms on the female restroom door. The results of
Most Probable Number Method were used to determine the specific location on the doors where coliforms were most prevalent. The area specified
was the inside of the female restroom door. Attempts to classify the specific types of coliforms detected using the IMViC tests were unsuccessful possibly due to faulty materials and experimental error. The next step
in this process would be to identify and test the coliforms found against
cleaning agents as well as antibiotics to determine resistances.
OA #5
The Effects of Aquatic Estrogen Pollution on the
Development of Rana Slyvatica
Candice Artis, Norfolk State University
Maureen Scott and Diana Adebambo, Norfolk State University
The significance of this study is to examine the effects of aquatic pharmaceutical pollution on the development of marine organisms. This research determines developmental changes in representative marine species, frogs, Rana slyvatica exposed to an estrogen polluted environment.
The major sources of pharmaceutical pollution are city sewage systems,
waste containing birth control pills, antidepressants, painkillers and other
residual compounds that enter into our waterways. According to the EPA
these pollutants are referred to as PPCPs, Pharmaceuticals and Personal
Care Products, which are bioactive chemical substances that have an effect on living tissue. These pollutants of the environment have potential
effects on organismal development and human health. Previous studies
have evaluated the impact of estrogen pollution in water, altering the gender of marine organisms and developmental patterns. Additional studies
have evaluated the consequences of pharmaceutical pollution of pesticides and prescription medications in drinking water that can have adverse effects on humans. This study examines the rate of Rana slyvatica
development in an estrogen polluted environment. Rana slyvatica eggs
were placed in a polluted aquatic environment containing Beta Estradiol,
a by product of estrogen, and eggs were placed in an unpolluted aquatic
environment on April 18, 2008. The aquatic environments were evaluated
daily and the developmental stages of the frogs were recorded. This study
determined that estrogen pollution had a dependent effect on the rate of
growth and development of Rana slyvatica by acting as a developmental
disrupter. This investigation illustrated a decline in growth and an alteration of developmental rate in Rana slyvatica. A developmental disrupter
or endocrine disrupter affects organisms by altering normal growth and
development. This research emphasizes the importance of understanding
the potential dangers of developmental disrupters on marine organisms
caused by aquatic pharmaceutical pollution.
OA #6
Regulating CB2 Cannabinoid Receptor Phosphorylation
phosphorylation and thus its internalization as well as prevent recruitment of the G protein receptor kinases (GRKs) 2 and 3. This hypothesis
is based on previous findings that hCB2 is phosphorylated at Ser352 following hCB2 activation and phosphorylation leads to the internalization
of other GPCRs. A PCR-based mutagenesis approach was used. Briefly,
sense and antisense primers were used to amplify and mutate the portion of hCB2 containing Ser352. Reaction mixtures were analyzed for the
presence of the desired amplicon by electrophoresis in 0.8% low melt
agarose stained with ethidium bromide. The product was extracted using
a QIAquick Gel Extraction Kit. The amplicon was restriction digested with
Bcl 1 and Bgl 2 and then ligated into a vector (pHhCB2-pcDNA3) containing hCB2 that had been cut with Bgl 2. Competent bacterial cells were
transformed with the ligation mix.
DNA was obtained from the transformed bacterial colonies and proper incorporation of the mutation was assessed by DNA sequencing. The role
of Ser352 phosphorylation will be assessed by transfecting HEK293 cells
with the mutated CB2 receptors and GFP-GRK3 or GFP-GRK2. Both hCB2
internalization and recruitment of the GFP-labeled GRK’s will be measured
and compared to control HEK293 cells transfected with wild type hCB2
and GFP-GRK3/GRK2. Other research has shown that GRK3, rather than
GRK2 plays a more significant role in GPCR internalization. Thus, I purpose
that if there is a distinct difference between the wild type hCB2 and the
mutated hCB2 the difference will be seen with GRK3. Preliminary issues in
mutating hCB2 included difficulties with cutting the insert before ligation.
Gel electrophoresis analysis showed unexpected cuts in the amplicon.
This was due to an overlooked BamH I site in-between the desired site
that could produce more than 5 different unwanted products. This issue
was solved when we replaced BamH with Bcl I.
OA #7
Investigating Behavioral Models of Substance Abuse with
Jugular Vein I.V. Self Administration
Shekelia Baccus, Morris College
Dr. Levin, Duke University
It has been shown that adolescents are more vulnerable to tobacco addiction compared to adults. Nicotine, the major psychoactive chemical in tobacco, may serve as a gateway drug to other drug habits. We hypothesized
that compared with adults, adolescents are more vulnerable to proceed to
other addictive drugs such as cocaine after nicotine self-administration.
Little is known about the role that age difference plays in the effectiveness of nicotine as a gateway substance. Since adolescents are already
more vulnerable to addiction, then it is possible that their transition from
one drug to another would be more likely. To test this hypothesis, the two
age groups of rats; six weeks for adolescents and eight weeks for adults;
were given access to nicotine (0.03 mg/kg/infusion) via the standard operant IV self-administration procedure. After ten sessions of 45 minutes
the rats were then given cocaine (0.08 mg/kg/infusion) in place of the
nicotine for another 10 sessions. After these sessions were completed, all
rats were put on a five-day hiatus followed by five reinstatement sessions
with cocaine. Understanding the correlation between adolescent nicotine
and adult cocaine addiction allows for future investigations of the causal
chain of molecular mechanisms underlying these behaviors. Most important are those underlying mechanisms associated with the priming of addiction neuronal pathways in the adolescent brain.
Brittanie Atkinson, Langston University at Langston
B. Atwood and K. Mackie, Indiana University at Bloomington
Most of the effect of cannabis and the endogenous cannabinoids are mediated by the G protein-coupled receptors (GPCRs), CB1 and CB2. GPCR
signaling is often regulated by phosphorylation of the receptor. We hypothesized a single amino acid replacement of serine at position 352 in
the human CB2 (hCB2) receptor by alanine will prevent hCB2 receptor
Program Book
A3
Abstracts
OA #8
Diabetes Type 2: Awareness Among Albany State
Students
fil, IPAH patients had significant improvement in NYHA class and 6MWD
compared to PAH-SSD patients. Our findings suggest that IPAH patients
are more responsive to sildenafil monotherapy than PAH-SSD patients.
Zuakernah Belo, Albany State University
Ashok Jain, Albany State University
OA #10
Induced Anti-Fungal Resistance in Candida albicans in
Simulated Microgravity
Young African American college level students, especially Albany State
Students, may be aware of the term “diabetes”, however, they may not
be aware of the different risk factors associated with the disease being
developed later on in life. To conduct this study, about 150 young African
American college level students here at Albany State University, approximately between the ages of 18-24, and a developed questionnaire were
used. The questionnaires were passed out randomly to Albany State students that were encountered in various places around the Albany State
University campus. Of the total 150 participants that participated, 141 of
them were used in the study. The participants responded to the eating
habits portion of the questionnaire as follows: 63% of the students reported eating fast foods often, 3 to 5 times a week, as opposed to the
31% that rarely ate fast foods, and the 6% of them that always did. 107
out of the 141 participants ate foods high in fats quite often as well, 3 to 5
times a week, in comparison to the 13 that always eats them, and the 20
participants who rarely do. The majority of the students surveyed reported to eat medium size meals. 63% of participants reported eating foods
high in carbohydrates often, and 67% ate foods high in salts and seasons
often as well, 3 to 5 times a week. Walking was the means of transportation for the majority of the students (95 of the students walk as a means
of transportation), and was also considered their physical activity. Of the
141 participants, 64 of them are not employed, 35 of them are inactive at
work, and 37 of them have jobs that require some type of physical activity.
Of the 141 participants, 65 of them do not partake in any extracurricular
physical activity, and 50 out of the 141 participants do not exercise during their leisure time. Based on the responses of the questionnaire, it is
assumed that if no lifestyle change is made, such as the type of foods
consumed or an increase in physical activity, it is possible that an accumulation of these foods could lead to health issues such as diabetes and
hypertension. In the future hopes of studying the overweight and obese
participants by conducting stress tests. This is in order to further educate
them on the importance of dietary and physical change, in conjunction
with their overall health.
OA #9
Observational Study of Sildenafil Monotherapy in
Patients with Scleroderma-Related and Idiopathic PAH
Hilliary Bland, Mississippi Valley State University
Rachel Beecham, Mississippi Valley State University
Paul Hassoun, Adel Boueiz, and Lynette Brown, Johns Hopkins
Medical Institute
Pulmonary arterial hypertension (PAH) is defined as having a mean pulmonary artery pressure (mPAP) greater than 25 mm Hg at rest. Since FDA
approval in 2002, sildenafil therapy has been a common practice in the
management of patients with this disease, and is often used as first line
therapy because of its safety profile. However, the majority of available
evidence about the effects of sildenafil monotherapy in PAH is based on
treatment of idiopathic PAH (IPAH). The aim of our study was to assess the
response to sildenafil monotherapy in patients with scleroderma-related
PAH (PAH-SSD) as compared to IPAH. Subjects were selected from an initial group of 45 patients with PAH; 19 patients with scleroderma-related
PAH and 14 patients with IPAH on sildenafil monotherapy were enrolled.
Six-minute walk distances (6MWD), New York Heart Association (NYHA)
classification, and hemodynamics were assessed at baseline and 3 - 6
months after starting sildenafil. At baseline, IPAH patients were more likely to have a lower CI and a higher PVR. However, after initiation of sildena-
A4
Program Book
Harry Bowden, Jr., Morehouse College
Linda Hyman and Sheila Neilsen-Preiss, Montana State University
The title of this project is Induced Anti-Fungal Resistance in Candida albicans in Simulated Microgravity. Its aim is to determine if the pathogenic
yeast, Candida albicans, behave as planktonic cells or biofilm when grown
in simulated microgravity via exhibited anti-fungal resistance. For each experiment a set pre-set concentration of yeast cells was introduced into a
flask containing sixty milliliters of YPD broth and an experimental concentration of the anti-fungal agent Amphotericin B. These flasks were allowed
to incubate overnight on a shaker at thirty degrees Celsius. Afterwards a
sample was taken from each flask and ocular density and cell count measurements were taken. There were three experimental variables tested,
with each having a control of no anti-fungal agent added to the broth.
In the first variable, planktonic cells were placed directly into the broth.
The second and third variables required that a set amount of cells were
incubated first on a polycarbonate membrane to form a biofilm. For one
set, this biofilm was placed directly into the broth. For the second set,
the biofilm was disrupted and then the free cells were introduced into the
broth. After each experiment, a sample from each flask was incubated on
an YPD plate to determine the viability of the remaining cells. The trends
suggest that yeast cells which form biofilm are less susceptible to the anti-fungal agent than planktonic cells. Also, both the intact and disrupted
membrane yeast cells, though having different values, followed a similar
pattern of susceptibility as the concentration of the anti-fungal agent increased. Likewise, the lower and higher concentrations of planktonic cells
also followed a similar trend of susceptibility. For future experiments done
with the micro-gravity apparatus, whether or not the yeast cell resistance
follows the trends of the biofilm or planktonic cell, is a good indicator of
how changes in genetic expression cause these cells to behave in a space
environment.
OA #11
Determination of the Photocatalysis Properties of
Immobilized TiO2 on Camouflage Fabric
Tabitha Bowens, Benedict College
Dr. Samuel Darko, Benedict College
The objective of this research was to decrease the amount of odor causing
bacteria by using Photocatalysis. Corynebacteria and Micrococcus were
selected as the two model microorganisms. The immobilized TiO2 was
added to the camouflage fabric through a dip coating. The bacteria was
applied to the fabric and placed under the UV light at different time intervals to observe if the bacteria would decrease on the fabric. A slurry solution, TiO2 mixed with water was also used as another method to observe
if the bacteria would decrease in the slurry solution. Bacteria was then
placed in the slurry solution and placed under the UV light at different
time intervals. The observation that was made was that the slurry solution
showed more degradation in bacteria than on the fabric.
Abstracts
OA #12
Variation in the Transposition of Alu Elements Among a
Group of Individuals
Faith Bupe, Allen University
Oluwole Ariyo, Allen University
Human DNA contains several thousand genes responsible for the phenotypic expression and functions of the body. However, the make up of
DNA is not only limited to functional genes but also contains thousands
of other repetitive segments of DNA called Alu elements which insert
themselves either between or within genes. These Alu elements have
mobilized throughout primate genomes by retrotransposition over the
past 65 million years of primate evolution. Thus, the goal of this research
was to amplify the PV 92 locus on chromosome 16 of various individuals
and determine the presence or absence of the Alu element. This paper
presents preliminary data on amplification of PV92 locus and analysis of
the transposition rate of Alu elements. The DNA used was extracted from
cheek epithelia cells of 17 individuals. Integrity of isolated DNA samples
was determined by the use of a spectrophotometer and gel electrophoresis using 1% agarose gel. Polymerase Chain Reaction (PCR) was then
used to amplify the PV92 locus, using primers specific for the locus. The
results showed that some of the 17 individuals had the insertion on both
pairs of chromosome 16. Others had the insertion on only one chromosome, and others had no insertion at all. These results suggest how the
random insertions of Alu sequences contribute to genetic diversity at the
molecular level. Further research shall be on understanding the rate of
transposition of Alu elements among people from different locations and
ethnicities. This will present a clearer picture on the evolutionary trend of
PV92 Alu insertion.
OA #13
Determining the Inhibitory Effect of Vernonia amygdalina
and Drimiopsis botryoides Plant Extracts on Hela-CD4+
Cell lLnes Infected with HIV-1
Maurissa Charles, Claflin University
Florence Anoruo and Omar Bagasra, Claflin University
Vernonia amygdalina, commonly known as bitter leaf, is an edible shrub
used in the diets of many African countries including Nigeria. The phytochemicals, such as tannins, alkaloids and saponins, present in Vernonia
amygdalina give it its characteristic bitter taste. Drimiopsis which belongs
to the Liliales order and the Hyacintaceae family, has five species in southern Africa including Drimiopsis botryoides. The objective of this study is to
evaluate the inhibitory effects of V. amygdalina and D. botryoides extract
on the Hela-CD4+ cell lines infected with HIV-1. Ethanol and PBS aqueous
extracts were made using the leaves of the bitter leaf and the leaves and
roots of the Pakistani Lily. A toxicity assay was performed with the serially
diluted PBS extracts, from 1:2 to 1: 1024 concentration, in 96 well plates to
determine which concentration would have the most effect on the viability
of the Hela-CD4+ cell lines. Results indicated that the highest percentage of viability (95%) was observed in cells treated with the most diluted
concentration (1:1024) for both the Ethanol and PBS aqueous extracts of
Vernonia amygdalina and Drimiopsis botryoides respectively. The 1:1024
concentration of the Ethanol and PBS aqueous extracts of both plants
were subsequently used in p24 assays to determine their inhibitory effects on HIV-1 infected Hela-CD4+ cell lines. Based on the results we can
conclude that V. amygdalina alcohol leaf extract had the most significant
inhibitory effects on the proliferation of the HIV-1 infected Hela-CD4+
cells. However, the PBS extracted root sample from the D. botryoides has
potential as an HIV-1 inhibitor as well. Future studies are to be carried
out to determine the anti-viral, anti-bacterial and anti-fungal properties of
these plants species. If promising results are obtained, the phytochemical
components responsible for these properties can be quantitatively and
structurally determined.
OA #14
Characterization of a Recombinant Virus Expressing a
Riral Fibroblast Growth Factor
Maria Da Cunha, Savannah State University
Dr. Lorena Passarelli, Christopher Lehiy, and Olga Martinez, Kansas
State University
Many insects are responsible for extensive crop damage, so it is important to develop innovative methods for insect control. Baculoviruses have
served as bioinsectsides, an alternative to chemical pesticides. Baculoviruses are double-stranded DNA viruses, which primarily infect insects,
including insect pests. Most baculoviruses encode a fibroblast growth
factor homolog (VFGF). Fibroblast growth factors (FGFs) are responsible
for regulation of developmental processes, cell differentiation, and cell
migration. The specific role of VFGF in insect pathogenesis is not known.
However, previous work showed that deletion of VFGF delayed insect mortality. We hypothesized that over expressing VFGF would result in accelerated insect mortality. To further understand the function of vfgf and to
begin testing our hypothesis, a recombinant virus was constructed which
expressed VFGF from a stronger promoter. The construction of the recombinant virus and production of VFGF was verified, and virus growth in permissive insect cells was assessed. In the future, we hope to characterize
this virus in more detail, its effect on permissive hosts, and its potential
as a bioinsecticide.
OA #15
Identification of Norvel Adhesion Molecules of
Trichomonas Vaginalis
DeAnna Daniels, Albany State University
Dr. Phillip Jemilohun, Albany State University
T. vaginalis is a protozoan parasite and the ethological agent of an STD
called Trichomoniasis. The parasite is sphere-shaped, and has five flagella. Besides being involved in human urethra and vaginal, the parasite
is implicated in transmission of HIV. It is implicated in adverse pregnancy
outcomes such as low-birth and pre-mature babies. Some symptoms include a green frothy vaginal discharge, genital soreness, and pain when
peeing. We propose that there are still some adhesins of Trichomonas
vaginalis that have not been identified nor characterized. To identify potential adhesions, time course and reconstitution experiments were used.
Eight 25mL flasks containing TYM were set up. Before the experiment, half
of these flasks were coated with a vaginal epithelial cell membrane protein at 5µg/ml. All the flasks were inoculated with 3 x 105 Trichomonas
vaginalis cells. The flasks were incubated at 37°C, and samples of 2 flasks
were taken out and processed at a time interval of 6, 12, 24, 36, and 48
hrs post incubation. The processing of the flask involved adherent (A) and
non-adherent (NA) T. v. cells. SDS- PAGE was used to analyze the potential adhesins observed in the time course and reconstitution experiment.
From this, proteins of 20- 200 kDa in size were observed. Some of these
are proteins that have not been identified nor characterized as adhesions.
This study showed that there are many minor and major Trichomonas vaginalis proteins of 20-200 kDa. Based on the reconstitution experiment, 34
and 43 are potential norvel adhesins of Trichomonas vaginalis. These proteins have not been identified nor characterized as Trichomonas vaginalis
adhesins. In future studies, we hope to take this work further by using the
blot overlay technique to identify these potential adhesins.
Program Book
A5
Abstracts
OA #16
Current Perceptions on Cancer Prevention and Control:
Part III
Harshini Dinesdurage, University of the District of Columbia
C. Memar Ayalew, Stephenna Knight, Milfred Standifer, Freddie
Dixon, and Carolyn Cousin, University of the District of Columbia
This is the third phase of an ongoing study to obtain results from a cancer control intervention that was conducted for African American seniors,
55 years or older, in order to reduce the disproportionate rate of cancer
among this population in Washington, D.C. In Phase I, IRB approval was
obtained and four focus groups were conducted to determine their current perceptions on cancer. In Phase II, a featured cancer activity was
conducted that included a request for volunteers from each site to participate in a one-year cancer control intervention. Phase III consisted of six
months of support-group meetings in which cancer control information
on nutrition and exercise was given to the participants and six months
without the support groups.
The results of Phase I were used to determine the procedures employed in
Phases II and III. The focus groups in Phase I cited that finding appropriate
and affordable screening sites was difficult, while a buddy system and a
permanent reminder (e.g. a calendar) was extremely helpful. Furthermore,
the focus groups suggested that an appropriate “show-and-tell” cancer
featured activity would help in understanding how cancer control could be
incorporated into one’s daily lifestyle. During Phases II and III, the intervention was undertaken and changes were seen in both diet and exercise
routines. Baseline data when compared to final data indicated that 16%
alcoholic beverage usage dropped to 5% and fruit juice consumption increased from 18% to 40%. Exercise routines increased considerably from
less than twice per week at baseline to five times per week.
In this pilot study it was determined that following the suggestions of the
Phase I focus groups brought about a substantial change in the lifestyle
of the participants as seen in Phase III, thus providing the necessary evidence to undertake a full study using the pilot’s protocol. This study is
funded by AAAS-MERCK grant, UDC-AES and NSF funded HBCU-UP grant.
OA #17
Genetic Mapping of a Locus Involved in Hypostatin
Sensitivity
Byron W. Doyle, Fort Valley State University
Sean Cutler and Simon Alfred, University of California, Riverside
Glycosylation is a process in which saccharides link to one another and
glycans are produced which can be independent or attached to proteins
and lipids. Glycosylated molecules demonstrate the ability to modify
the duration and intensity of biological activity and have been shown to
modulate drug response. It is important to understand how glycans can
affect biological processes and can enhance understanding of biological
processes with plant development. Previous experiments by natural variation in Arabidopsis successions have shown that the small molecule Hypostatin is a pro-drug and is activated by HYR1, a UDP glycosyltransferase
(UGT), to form a bioactive glycoside. Glycosylated Hypostatin modulates
causes the cell expansion and etiolated growth,resulting in a shortened
hypocotyls and an elongated root. The target site of Glycosylated Hypostatin in the plant system is still unknown. To identify the target site and
mechanism of Glycosylated Hypostatin, we are using a map-based cloning approach. Hypostatin resistant mutants were obtained via a mutant
screening and are being used to find the target site of Glycosylated Hypostatin. Currently, linkage has been mapped to chromosome III. Identifying the target site and pathway of Glycosylated Hypostatin will further
our understanding of Arabidopsis growth and shed light on Glycosylated
regulation in general. [This work was supported in part by a grant from
the National Science Foundation, DBI REU-Site at University of California
A6
Program Book
and HBCU-UP/Targeted Infusion to Prof. Seema Dhir at Fort Valley State
University.]
OA #18
Conducting Nanotoxicity Studies of C60 Fullerenes with
Bacteria Cultures
Preston Fowler, Jackson State University
Sean Cook, Winfred Aker, and Huey-Min Hwang, Jackson State
University
C60 Fullerenes are widely investigated with respect to their biological
activity, including the following: antioxidant activity, enzyme inhibition,
antiviral activity, DNA cleavage, photodynamic therapy, electron transfer, and miscellaneous uses. C60 is a highly insoluble nanoparticle that
can form colloidal suspended aggregates in water, which may lead to
environmental exposure in aquatic organisms. C60 is not very soluble in
most organic solvents. Therefore, evaluation and characterization of their
cytotoxic potential need special approaches. In this study, we used the
spread plate viability test of E. coli (ATCC#25254) to determine the LC50
of C60 in different organic solvents at different C60 concentrations. Each
experiment was conducted at least twice, with triplicate samples. The final common concentration of the test solvents was chosen based on C60
solubility and bacteria culture survivability. The objective was to determine the LC50 of C60 in different organic solvents to enrich the database
of its nanotoxicity for NanoQSAR application. Solubility of C60 in 1% test
organic solvents (N,N-dimethylformamide and pyridine) was verified with
spectrophotometry analysis. LC50 for C60 could be calculated only with
the solvent N,N-dimethylformamide, because the test E. coli were able
to survive substantially in this particular organic solvent, whereas they
failed to survive in pyridine at 1%. LC50 for E. coli after exposure to C60 in
the organic solvent N, N-dimethylformamide was calculated at 76.7 ppm
(vs. solvent control) and 85.7 ppm (vs. absolute control) respectively by
using linear regression analysis of data.
This research was supported by: (1) STARGE - HBCU-UP of Jackson State
University; and
(2) U. S. Department of the Army Research and Development Grant #
W912H2-04-2-0002.
OA #19
Determining the Prevalence of the Fim Recombinases in
Escherichia coli: Regulators of the Preeminent Virulence
Determinant, Type I Pili
Cynthia D. Grady, Winston-Salem State University
Patrick Seed, M.D., Ph.D., Duke University
Uropathogenic Escherichia coli (UPEC) cause over 85% of the communityacquired cases of urinary tract infections. The type 1 pilus is a key virulence
determinant of UPEC; without which, the bacteria are unable to attach and
penetrate into the superficial bladder epithelium, thus initiating cystitis.
In UPEC and commensal E. coli, type 1 pili are regulated by phase variation
via combinations of five homologous, unlinked Fim recombinases, but
their combined prevalence in strains of different environmental origins is
undetermined. In this study, we predicted that the recombinases FimX,
IpuA and IpuB are more prevalent in UPEC than commensal strains while
FimB and FimE are common to a large majority of E.coli. Using genomic
DNA from clinical and commensal E.coli, a multiplex Polymerase Chain Reaction assay was developed for the detection of the five known Fim recombinase genes, fimB, fimE, fimX, ipuA, and ipuB. The assay was applied to
genomic DNA from 75 and 69 UPEC and commensal isolates, respectively.
Among UPEC, 25.3% had all 5 Fim recombinase genes, 69.3% carried the
combination fimB, fimE,and fimX, and 4% had only fimB and fimE. One
UPEC strain carried fimB, fimE, fimX, and ipuA. Of the commensal strains,
Abstracts
9.3% had all 5 Fim recombinases, 55.6% exclusively carried the genes
fimB and fimE, 20.4% had only fimB, fimE,and fimX, and 11.1% had just
fimB, fimE, ipuA and ipuB, One strain had fimB, fimX, ipuA and ipuB, and 1
strain had fimB, fimE, fimX, and ipuB. Additionally, FimB and FimE were in
99.75% of the observed E.coli isolates. These data demonstrate that fimX,
ipuA, and ipuB are more prevalent in UPEC than commensal E. coli and
that these recombinases may be evolutionarily conserved among UPEC to
promote niche-specific regulation of type 1 pili.
OA #20
Use of Sphingolipids as Markers for Premature Heart
Disease in Lupus
Demarus Heller, Morris College
Dr. Samar Hammad, SURP Cardiovascular Biology, Medical
University of South Carolina
Sphingolipids are a class of lipids that comprise the structural components of eukaryotic cell membranes and circulating lipoprotein particles.
Sphingolipids are also signaling molecules implicated in mediating survival and inflammatory responses. We hypothesize that blood sphingolipids could have potential significance similar to lipoproteins (HDL and LDL)
as risk factors for accelerated heart disease. Our objective is to determine
whether sphingolipids could be markers for premature heart disease in
Lupus. We used a mouse model for lupus nephritis (nitric oxide synthase
2 (NOS2) knockout mice) to study acceleration of atherosclerotic plaque.
These mice carry the gene that exhibits the autoimmune disorder, but
symptoms are shown later in life which makes it similar to lupus nephritis.
Lupus nephritis is an autoimmune disease that can damage the kidney
and eventually cause death. We have shown that the sphingolipid profile
changed significantly in the diseased animals relative to the corresponding wild type controls. Sphingolipids C20-Ceramide, C20:1-Ceramide,
C20:4-Ceramide, C22-Ceramide, C22:1-Ceramide, C24-Ceramide, C24:1Ceramide, DihydroC16- Ceramide, Dihydrosphingosine, Dihydrosphingosine 1 Phosphate, Sphingosine, and Sphingosine 1 Phosphate were at
higher levels compared to wild type control (p< 0.05). C24-Ceramide,
C22:1-Ceramide, and Sphingosine increased 5, 3, and 2 fold , respectively,
compared to controls. We are currently in the process of determining the
lipoprotein profile and scoring the aortae for lipid deposition. The elevated sphingolipids could be used as possible markers for accelerated heart
disease in Lupus.
OA #21
Lead Bioremediation of New Orleans Environmental Water
Using Spirulina
Gabrielle High, Dillard University
Dr. Bernard Singleton, Miquell Miller, Kristen Guilford, and Shermett
Corbett, Dillard University
Lead contamination is a major concern for New Orleans residents since
the aftermath of Hurricane Katrina. There were the Meraux Murphy oil
spill, auto service stations, and other buildings where chemicals were
stored as well as lead paint from damaged old houses. Lead is known
to cause adverse affects on human health and it is important that this
toxin is removed from the environment. The objective of this experiment
is to remove lead from environmental water by the process of bioremediation. To complete this objective, live Spirulina was used to adsorb lead
from the water. Spirulina is a blue green algae that can be used to adsorb
heavy metals from the water. In this experiment, live Spirulina was tested
on 50 μg/mL to 500 μg/mL concentrations of lead and water from Lake
Pontchartrain. The effectiveness of lead removal was determined by spectrophotometry using DMTD to detect the concentration of lead remaining
in the water. It was found that Spirulina effectively removed all the lead
from the Lake Pontchartrain water. Spirulina works best at lead concentrations below 50 μg/mL.
OA #22
Localization of Thioredoxin Peroxidase (TPx) in
Biomphalaria Glabrata Part I.
Stephenna Knight, University of the District of Columbia
Edith Alvarez, Milfred Standifer, Selamawit Mekonnen, Freddie Dixon
and Carolyn Cousin, University of the District of Columbia
LAC-A Biomphalaria glabrata snails are resistant to Schistosoma mansoni infection. These snails are derived from the highly susceptible NMRI
snails. Differences between these two snail lines, also, exist in the reproductive potential. Specifically, the resistant LAC-A snails have decreased
fecundity, distorted egg clutches, and an abnormal albumen gland. The albumen gland plays a role in both internal defense and reproduction in the
snail. Studies have been done to determine the molecular mechanisms
involved in these phenotypic differences. A cDNA library of NMRI snails
was constructed and screened with antibodies from albumen gland protein extracts that had been injected into mice. Clones specific for LAC-A,
NMRI and both LAC-A and NMRI were obtained. One clone, specific for
LAC-A, was designated as pBGC2. It was sequenced, placed in a protein
data base, and found to have a 78% similarity to Thioredoxin peroxidase
(TPx) in mice. TPx is a natural killer enzyme found to be present in large
amounts in LAC-A snails and relatively absent in NMRI. Immunocytochemistry was performed at the light microscopic level. Frozen sections were
prepared of the entire snail (de-shelled). A strong positive reaction was
obtained for TPx in the albumen gland and several areas of the surrounding muscle in the LAC-A strain. A mild reaction for TPx occurred in the
same areas of the parent NMRI strain. This research was funded by UDCAES and NSF HBCU-UP grant.
OA #23
Study of Hepatotoxicity Biomarkers in Carbon NanotubeInduced Swiss Webster Mice
Brionna Knighten, Jackson State University
Anita K. Patlolla, Jackson State
Carbon nanotubes [CNT’s] are an example of a carbon-based nanomaterial that has won enormous popularity in nanotechnology due to its unique
properties and applications. As such, they are highly desirable for use
within the commercial, environmental and medical sectors. Despite the
wide application of nanomaterials, there is a serious lack of information
concerning their impact on human health and the environment. Moreover,
very little is yet known about the toxicity of carbon nanotubes. To date only
a few studies report on toxic effects of CNTs either in vivo or in vitro and
the results are often divergent. Therefore, evaluation and characterization
of their toxic potential is necessary. The main objective of this study was
to conduct biochemical analysis to determine the effect of oxidized multiwalled carbon nanotube (MWCNT) on the activities of specific enzymes including alkaline/acid (ALP/ACP) phosphatase, aminotransferases (GOT/
GPT) and histology of liver, which may be useful as biomarkers of hepatotoxicity. Three groups of five male mice each weighing approximately 30
+ 2 g were injected intraperitoneally once a day for five days with doses
of 0.25, 0.5, and 0.75 mg/kg bodyweight of oxidized MWCNT. A control
group was also made of 5 mice. Following anaesthetization, blood specimens were immediately collected using heparinized syringes, and enzyme
identification and quantification were performed in serum samples by
spectrophotometry. Oxidized MWCNT exposure induced dose-dependent
increases in the activities of both alkaline and acid phosphatases in the
serum of Swiss-Webster mice. However, the highest dose 0.75 mg/kg was
found to show statistically significant effect only in elevating the activity of both ALP and ACP when compared with the control. Similar results
Program Book
A7
Abstracts
were found in the amino-transferases ALT and AST activities, however,
the highest doses of 0.5 and 0.75 mg/kg showed a statistically significant elevation in ALT/GPT activity alone when compared with the control.
These results suggest that carbon nanotubes indeed can be very toxic at
sufficiently high doses and those serum phosphatases (alkaline andacid)
aminotransferases (alanine & aspartate) can be candidate biomarkers for
carbon nanotube-induced hepatotoxicity in Swiss-Webster mice.
OA #24
A Distribution Survey of the New York State Threatened
Banded Sunfish (Enneacanthus obesus) Conducted in
Zeke’s Pond, the Peconic River, and the Peconic River
Drainage.
Carmen Maldonado, Southern University at New Orleans
Timothy Green, Ph.D, Brookhaven National Lab, Upton, NY
Tyra Bunch, Southern University at New Orleans
The New York State threatened banded sunfish (E. obesus) inhabit rivers,
lakes, and ponds along the Atlantic coast. Because the banded sunfish is
a voracious predator of mosquito larvae, they provide a biologically efficient means of controlling the mosquito population. Previous population assessments completed in Zeke’s Pond and the Peconic River have
suggested that the fish’s populations are at risk of declining. In order
to formulate a plan to promote the growth of the species, a distribution
study of the sunfish was performed in the Peconic River Drainage. The
study began by observing and identifying the aquatic vegetation in each
pond along with documenting the location of each pond with a Global Positioning System (GPS) unit. The next step was to seine and dip net in the
areas identified with vegetation favored by the banded sunfish. The fish
and predatory species obtained were then measured, documented, and
released. A rubric was devised to evaluate the correlation between the
banded sunfish’s distribution and the aquatic vegetation present in the
seined areas. A total of twenty-seven bodies of water have been studied,
obtaining 321 predatory species. Of the twenty-seven waterways, twelve
bodies of water yielded 329 banded sunfish. Results of the distribution
survey indicate a correlation between the banded sunfish and ponds with
a higher density of bladderwort, white water lilies, and smartweed. Of the
sites surveyed by this team, results revealed banded sunfish to be present in all of the ponds listed on the Department of Environmental Conservation’s (DEC) historic banded sunfish sites. This distribution survey was
part of a larger survey that is currently being conducted by the DEC.
OA #25
Effects of Lycopene on Prostate Cells
Marla D. McCray, Albany State University
Dr. Ashok Jain, Albany State University
With the evaluation and research of both prostate cells and tomato consumption, this data is an indication to support the hypothesis that lycopene reduces the risk of prostate cancer. A daily consumption of various
tomato products can lower the risk of the second leading cause of cancer
deaths in men. Lycopene is a phytochemical which is found abundantly
in tomatoes and may be the significant property that can reduce prostate cancer. Phytochemicals are found in plants that contain protective
factors or disease preventive properties and can play a major role in the
inhibition of cancerous cells. Through research it has been demonstrated
that these chemicals may also be used to protect humans against some
cancers through various techniques. Prostate cells (LNCaP) were grown
in tissue culture dishes with RPMI 1640 medium in an incubator before
being coupled with certain treatments. The treatments consisted of 2.5
μM of lycopene, 5.0 μM of lycopene, 10-5 MEIQ with 2.5 μM of lycopene,
and 10-5 MEIQ with 5.0 μM of lycopene. Two controls were tested which
included RPMI 1640 medium and RPMI 1640 medium with chloroform
A8
Program Book
(solvent for lycopene). The cells were washed with Hank’s Salt Solution,
trypsinized with 0.25% w/v trypsin and RPMI 1640 medium was added to
the cells. 50μl of the cells were removed from each treatment and placed
in eppendorf tubes with 50μl of trypan blue solution for a cell count. The
remaining cells were centrifuged for 3-4 minutes and resuspended with
PBS twice. In certain treatments such as RPMI 1640 medium, 5.0 μM of lycopene, and 10-5 MEIQ with 5.0 μM of lycopene contained only nonviable
cells. However, 2.5 μM of lycopene and the 10-5 MEIQ with 2.5 μM of lycopene treatments contained viable and nonviable cells which did not show
consistency. The data that was gathered may show improvement through
experience and more trials since various techniques were recently learned
such as sub-culturing, aseptic techniques, and cell counting. A better understanding has been established on how and why these techniques were
used. In conclusion, more trials will be done to demonstrate the effects
of phytochemicals until a consistent pattern can be exposed. Through
bioengineering, new plants will be developed in future studies which will
contain higher levels of defensive properties and protective factors. This
will allow more food products to incorporate enough phytochemicals to
support the reduction of prostate cancer.
OA #26
Manipulation of the Nanostructure of Ionic Polymer-Metal
Composites via Post Polymerization Sulfonation
Jacqueline M. McRae, Norfolk State University
S. D. Benson, J. K. Park, and R. B. Moore, Macromolecules and
Interfaces Institute, Virginia Polytechnic Institute and University
Sulfonated syndiotactic polystyrene (SsPS) membranes are being investigated as electro-active materials for applications as ionic polymer-metal
composites (IPMCs). Our hypothesis is that the semi-crystalline morphologies of these ionomers will lead to mechanical properties that can
be used to apply force against an object when they are electrochemically
actuated. Our strategy is to develop an IPMC with an ionomer backbone
that has been partially sulfonated in the gel state. This may lead to nonrandom sulfonation that may be important for increasing the mechanical
properties of the styrene-based actuator materials. These smart materials
have potential applications in biomedical devices such as artificial muscles and robotics. Current ionomers used in IPMCs include perfluorinated
films such as Nafion, which exhibit bending motions up to 1/3 of their
relative size, but these materials are amorphous and cannot be utilized to
apply significant forces. Our new SsPS ionomers have shown tip displacements and rates of up to 245 mm and 63 mm/sec respectively. Further
investigations of the properties of this class of novel IPMCs must be conducted to better understand the origin of our results.
OA #27
Synthesis and Anti-Cancer Activity of Ionic Triorganotins
on Pancreatic Cancer Cells
Somaly Neang, University of the District of Columbia
Chezaray Anjorin, Dorrelyn Patacsil, Anh Thu Tran, Mudit Verma,
Xueging Song and Deepak Kumar, University of the District of
Columbia
Pancreatic cancer is the fourth leading cause of cancer death in the United
States with less than a 4% survival rate of 5 years. Despite attempts of
resection and adjuvant therapy, patients diagnosed with pancreatic cancer continue to have a poor prognosis. Gemcitabine is the most effective
chemotherapeutic drug against pancreatic cancer with a response of 24%
and median survival of 5.6 months, thus the need for newer therapeutic
approaches. Metal-based anti-cancer compounds constitute a discrete
class of cancer chemotherapeutics. Platinum based Cisplatin is the most
effective metal-based, widely used, anti-cancer drug in clinic. In this study,
we have synthesized ionic triorganotin compounds with increased solubil-
Abstracts
ity due to their partially ionic characteristic and tested their anti-cancer
activity using COLO-357 pancreatic cancer cells. Methods: COLO-357 cells
were plated in 96-wellplate and treated with varying concentration (1ng to
100μg) of triorganotin derivatives for 24, 48 and 72 hours. WST-1 cell proliferation reagent was used to assess the cytotoxicity after the treatment
periods. Results: A time and dose dependent decrease in cell proliferation
was observed following the treatment. Conclusion: Based on our results,
novel triorganotin derivatives exert cytotoxic effects on pancreatic cancer
cells at very low doses. Comparative analysis of anti-proliferative effects
of various derivatives will be performed. Apoptotic effects of triorganotin compounds using cellular biomarkers such as poly ADP-ribose polymerase cleavage and caspase activation will be discussed. This study was
supported by AAAS/MERCK Undergraduate Science Research program
and a HBCU-UP grant from the National Science Foundation.
OA #28
Determination of Optimum Oligonucleotide Probe Length
to Achieve Virus Species-Specific Hybridization
Cherie Ognibene, Langston University
Ulrich Melcher and Veenita Grover, Oklahoma State University
This work was done in support of plant virus ecology network (PVEN)
whose main focus is to stimulate research at the interface of virology and
ecology. To this end, the development of tools such as microarrays to determine the temporal and spatial distributions of viruses is important. The
specific interest of my project was to determine the optimum oligonucleotide probe length to achieve species-specific hybridization using three
target tymovirus species: Kennedya yellow mosaic virus (KYMV), Turnip
yellow mosaic virus (TYMV) and Tallgrass prairie preserve Asclepias asymptomatic virus1 (TPP AsAV1). The 70mer and 50mer probes designed
for each of the three tymovirus species were spotted on carbodiimidecoated slides followed by UV irradiation. The labeled and fragmented RNA
targets, made from infected and uninfected plant tissues were hybridized
to the array of the probes on the slide and further scanned to obtain image
and intensity of fluorescence of each spot in the array. Our hypothesis is
that 70mer probes will discriminate better between species than 50mer
probes. This research was supported by the US NSF grant number IOS0639139.
OA #29
Cdc42 Constructs with Mutations in Important Effector
Interacting Regions Show Altered Binding Activity with an
Important Regulator Peptide Derived from p-21 Activated
Kinase
Nikita Patton, Bennett College for Women
Huimin Liu and Paul D. Adams, Ph.D., University of ArkansasFayetteville
Cdc42 is a member of the Ras super family of proteins that bind GTP or
GDP to regulate multiple signal transduction pathways. The levels of active GTP-bound or inactive GDP-bound forms are controlled by regulatory
proteins. Mutations in Cdc42 have been shown to alter its role in signal
transduction. Effector/regulator proteins bind to essentially two regions
in Cdc42 known as Switch I and II. An active peptide derivative of one
regulator, mPAK-3, a p-21 activated kinase, which inhibits GTP hydrolysis from Cdc42 known as PBD46, has been characterized. Studies of the
Cdc42-PBD46 wild type complex have shown that the Switch regions show
altered conformations relative to the protein in the absence of PBD46. In
addition, chemical shift changes were observed for residues comprising
the nucleotide-binding site of Cdc42, where Phenylalanine 28 (F28) provides the principal stabilizing interaction with the nucleotide, in the complex. When this amino acid is mutated to leucine, there are several inter-
actions involving the nucleotide that are lost that could facilitate altered
effector interactions necessary for proper cell-signaling activity of Cdc42.
Another important region in Cdc42 has been designated the Rho insert
region, ∆L8, and consists of residues 121-133. When this 13 –amino acid
region is deleted from Cdc42, the mutant protein exhibits altered GDP dissociation activity relative to wild type. The interaction of Cdc42(F28L) and
Cdc42(∆L8) with PBD46 using in-vitro binding assays has been examined.
The qualitative differences in the binding affinity of PBD46 for the mutant
proteins relative to wild type suggests that there may be conformational
changes imparted by the given mutation that affects effector interactions
involving Cdc42.
OA #30
Effects of Nutritional Supplementation on Cardiovascular
Dysfunction in Microgravity
Jamail Plumber, Texas Southern University
Dr. Alamelu Sundaresan, Texas Southern University, NASA/Johnson
Space Center
Dianne Hammond, Bioanalytical Core Lab, EASI, JSC, NASA,
Houston, TX
Many space missions have shown that prolonged space flight increases
the risk of cardiovascular problems, human lung epithelial cell dysfunction, and bone density lost. Alterations of the vascular endothelium together with a decreased release of endothelin-1 may entail post-flight
health hazards for astronauts. In our study, Placental induced growth
factor (PLGf ) gene expression was up regulated in modeled microgravity
(MMG). This is a cardiovascular mediator and a negative regulator of VEGF
(Vascular endothelial growth factor) and is now clinically considered a
more specific biomarker than C-reactive protein for predicting stroke and
heart attacks. It can also be detected in early onset and progressive stages of cardiovascular dysfunction. This newly described molecular marker
of inflammation is the best indicator yet of trouble for people who suffer
chest pain serious enough to bring them to emergency rooms, according
to German cardiologists.
To assess the role of PlGf in microgravity, experiments will be performed to
assess expression in cells grown in modeled microgravity and compared
with those of 1g controls. Also mechanistic studies with endothelial cells
in modeled microgravity and 1g controls will be conducted.
OA #31
HoxC6 Maintenance of Normal Mammary Epithelial Cell
Growth, Migration and Morphology
Twillow Rhodes, Morris College
Demetri D. Spyropoulos, Ph.D., Medical University of South Carolina
HoxC6 controls several cellular activities and has a high level of expression in normally mammary epithelial cells, the origin of breast cancer.
HoxC6 keeps these normal cells alive. However, HoxC6 is loss in breast
cancer, but these cells still survival. Akt is a signaling pathway molecule
important in cell survival and its activation is associated with poor prognosis in cancers. Our studies indicate that HoxC6 and Akt can regulate one
another in mammary epithelial cells and that this linkage is important in
cancer. To study this linkage, we exposed MCF-7 (human mammary epithelial) cells with and without Akt activation to agents that control HoxC6
expression. We observe that, in low serum conditions, MCF-7 cells are
stimulated to grow by estrogen and growth suppressed by Akt3 activation and that MCF-7 cells are stimulated to migrate by Akt3 activation and
inhibited from migrating by estrogen. The results from this test showed
that estrogen had the greatest impact on HoxC6 expression (repression)
compared to the other agents tested. Other assays indicated that Akt activation is also associated with morphological change in cell shape, from
Program Book
A9
Abstracts
cuboidal to spindle-shaped. These results are significant since our mouse
studies indicate that HoxC6 regulates the IGF signaling process leading
to Akt activation in normal mammary epithelial cells. We also observe
that activation of Akt can suppress the repression of HoxC6 by estrogen.
These results suggest that HoxC6 and Akt can regulate one another, with
consistent findings between our in vivo mouse model and our in vitro human cell line systems. Collectively, these data indicate that HoxC6 plays
an important role in the transition from normal mammary epithelial cells
to breast cancer, thus identifying a novel coordination of pathways for intervention.
OA #32
Disinfection of Bacteria via Photocatalysis
Davetta Robinson, Benedict College
Dr. Samuel Darko and Dr. Helen Tamboue, Benedict College
Photocatalysis was the primary mode of disinfection of two odor causing
bacteria. Corynebacteria xerosis and micrococcus luteus were disinfected
via two routes, immobilized catalyst on camouflage fabric and slurry, respectively. Bacteria were inoculated onto the fabric and irradiated under
ultraviolet light in five minute increments. TiO2 in slurry form was also applied for disinfection of the model organisms and for comparative analysis. Irradiated samples were then incubated and analyzed for bactericidal
or disinfection properties of both the slurry and immobilized form.
Although the slurry showed a better disinfection outcome, results from
the immobilized TiO2 on the fabric are inconclusive. Multiple runs are being conducted to ascertain the pathway of disinfection using immobilized
TiO2 on the fabric of choice.
OA #33
Phenotypic Analysis of Xenorhabdus Bovienii Using
Transposon Mutagenesis
Quintina Rogers, Albany State University
Darby Rennecker and Heidi Goodrich-Blair, University of WisconsinMadison
Previous research on the mutualistic relationship between the bacterium
X. nematophila and its nematode host, S. carpocapsae, led us to examine the sequenced genome of X. bovienii and its symbiont, S. jollieti.
What makes the mutualistic symbionts X. bovienii-S.jolieti of interest is
because together they can also become pathogenic towards their insect
host. Both relationships are equally important in the role they play in the
development, immunity, and nutrition of plants and animals. It is hypothesized that by initially analyzing phenotypic expressions of X. bovienii,
we can then sequence gene expressions and further research specific
genes required for X. bovienii-S. jolllieti symbiosis. In order to analyze the
genetic expression of X. bovienii, we preformed transposon mutagenesis
using conjugation and a miniTn5Cm transposon. Conjugation consisted of
donor E. coli cells which housed the plasmid containing the Tn5Cm with
recipient X. bovienii cells. The X. bovienii cells were then underwent transposition. A Southern Blot was also performed to verify the presence of the
transposon in the chromosome of the mutants. We created approximately
500 mutants and screened them for three specific phenotypes; Protease
production, lipase production, and, antibiotic activity towards E. coli K12.
Out of 480 mutants, 5 mutants displayed alternative phenotypes from
wildtype. One mutant was determined to produce lipase but not antibiotic
activity, displaying two phenotypes different from wildtype. This specific
phenotypic pattern points towards phenotypic variation in the mutant and
potentially indicates the transposon disrupted a gene necessary for phenotypic variation in X. bovienii. Arbitrary PCR and additional experiments
are being conducted to further analyze each of the phenotypic mutants.
A larger mutant bank is also desired. Overall, continued research of the
mutualistic symbiotic pair between X. bovienii and S. jolietii will lead to
A10
Program Book
the overarching goal of understanding host-microbe relationships and
symbiosis in general.
OA #34
A Role for Conserved Regulatory Sequences in the
Repression of TMPRSS2-ERG Fusion Gene, a Prevalent
Oncogenic Alteration in Prostate Cancer
Francisco Sáenz, University of the District of Columbia
Rajesh Thangapazham, Deepak Kumar, Shiv Srivastava, and Albert
Dobi, University of the District of Columbia, Washington, DC and
Center for Prostate Disease Research, Department of Surgery,
Uniformed Services University, Rockville, Maryland
Prostate cancer is the most common non-skin cancer among American
men and is the second leading cause of cancer mortality in the United
States. However, the mechanism of prostate tumorigenesis is not well
understood. Loss of tumor suppressor genes may significantly contribute
to cancer initiation and progression. The NKX3.1 transcription factor is a
tumor suppressor that plays key roles in prostate development as well
as in maintaining the normal prostate epithelial cells in a differentiated
state. In prostate cancer the level of NKX3.1 tumor suppressor is often decreased. Thus, biological importance of NKX3.1 and its prominent role as
a transcription factor in prostate oncogenesis has been increasingly recognized. Recently, our team at the Center for Prostate Disease Research
revealed that the most commonly overexpressed oncogene in primary
prostate cancer is the ETS-Related Gene ERG. Following reports suggested that ERG overexpression is due to genomic rearrangement resulting in
the fusion of the androgen-inducible TMPRSS2 gene promoter to the ERG
gene in the majority of prostate cancer patients. Together these findings
suggest that expression of ERG protooncogen is controlled by androgenic
signals providing selection advantage for cancer cells carrying TMPRSS2ERG genomic rearrangement. Although it is known that androgen receptor
activates the TMPRSS2 promoter, the possible role of repressor elements
in controlling the TMPRSS2-ERG fusion gene has never been investigated.
Therefore, the regulation of TMPRSS2 promoter within the prostate cancer genomic context has become a central question in prostate cancer biology . Here we show the conservation of TMPRSS2 regulatory sequences
among mammalian species by using a computational approach to pinpoint transcription factors that may play critical roles in regulating this
promoter. Comparative promoter and enhancer analysis of human, mouse
and rat TMPRSS2 promoters and promoter upstream sequences revealed
low degree of conservation in the androgen receptor binding sites. In contrast, intriguing conservation of the positions and frequency of NKX sites
was found. Earlier reports suggested transcriptional repressor functions
for NKX3.1 in prostate epithelial context. Thus, we evaluated the transcriptional repressor function of NKX3.1 by assessing the consequences of decreased NKX3.1 levels in prostate tumorigenesis.
[This study was part of the UDC-CPDR program funded by the DoD Prostate
Cancer HBCU Student Summer Training Program Award # PC073564.]
Abstracts
OA #35
Determining the Effects of N-Acyl Amino Acids on TRPV1
Cells Using Calcium Imaging
Nitrecus Simmons, Bennett College for Women
Heather Bradshaw, Indiana University at Bloomington
Transient receptor potential channel type V1 (TRPV1), a ligand-gated, nonselective, cation channel that is highly sensitive to temperature, acid, and
capsaicin, is found primarily in afferent neurons located in various areas of
the body. TRPV1 is transfected in human embryonic kidney (HEK) cells due
to their rapid growth and transfection. TRPV1 is activated by capsaicin and
the endogenous cannabinoid N-Arachidonyl Dopamine (NADA), two compounds that play an essential role in TRPV1 gating in the central nervous
system where the environmental conditions include high temperature and
low pH. We hypothesized that N-acyl amino acids will have an effect on the
TRPV1 receptor. This study was conducted to evaluate whether this effect
can provide a framework for endogenous compounds that positively activate the TRPV1 receptor and play an essential role in pain and inflammation. Specifically, the objectives of this study were to become familiar with
the technique calcium imaging using NADA as a positive control for TRPV1
activation and to investigate and monitor the activity of the novel N-acyl
amino acids at the TRPV1 receptor. The HEPES Tyrode buffer, pluronic, and
Fura were added to a centrifuge tube, mixed completely, and then placed
in a reagent reservoir. The cells used in this experiment were located in a
96 well plate containing HEK cells that were 80% confluent. The media on
these cells were removed and simultaneously the buffer containing the
Fura (a dye highly sensitive to light) was added to each well. The cells
remaining in the well plate were incubated for an hour to allow the Fura 2
AM (ester) to penetrate the cell. While cells incubated, a drug plate was
prepared with the appropriate concentration of each drug. After an hour
the incubation buffer was removed and cells were washed twice and incubated for an additional 20 minutes to remove the ester. The HEPES Tyrode
Buffer was forcefully inserted into the well plate, causing the cells that
were present to propel out of the well plate. Additionally, when washing
the cells many bubbles were formed, which were an indication that the solution was dispensed on the plate at a fast or extremely slow rate allowing
the cells to dry out. Therefore, the experiment will be repeated to rectify
the mistakes which occurred during the calcium imaging process. Studying NADA and capsaicin effectiveness and the activity of the N-acyl amino
acids at the TRPV1 receptor may have a beneficial role in treatments and
medications for patients experiencing inflammation and pain.
OA #36
Sugar Production from the Degradation of Lignocellulose
in Pine Sawdust by Pycnoporus Cinnabarinus
Felix Slater, Jackson State University
Halima Stringer, Jennifer Ntoni, and Rose Kishinhi, Jackson State
University
Drs. Maria Begonia and Gregorio Begonia, Jackson State University
Lignocelluosic materials are the most abundant agricultural residues in
the world. Biofuels such as ethanol can be produced by microbial fermentation of simple sugars derived from lignocellulose degradation. However,
a major obstacle to the effective utilization of lignocellulose is the chemically unreactive nature of its polymeric components. Therefore, the polymeric components must first be hydrolyzed to simple sugars before conversion to ethanol. A potential cost-effective technology for hydrolyzing
lignocellulose to sugar is the use of microorganisms such as fungi. This
experiment was carried out to evaluate the degradation of pure cellulose
and Southern pine sawdust lignocellulose by the fungus Pycnoporus cinnabarinus aerobic and anaerobic conditions. Desired amounts of cellulose and pine sawdust materials were separately added to tubes containing the liquid medium inoculated with P. cinnabarinus, and grown for four
weeks under aerobic and anaerobic conditions. Samples were analyzed
periodically for glucose production as a measure of lignocellulose degradation. Our results revealed that generally, a higher rate of sugar production from media amended with pure cellulose and sawdusts occurred
under anaerobic than aerobic conditions. Furthermore, a higher amount
of glucose was produced from fungal degradation of pure cellulose (about
4 times) compared to those produced from sawdusts at day 16 under anaerobic condition. These results indicate that the presence or absence of
oxygen can differentially affect sugar production from the degradation of
lignocelluloses by P. cinnabarinus.
OA #37
Recombinant Opium Poppy Salutaridine Synthase and
Salutaridinol Acetyltransferase Expression in Pichia
Pastoris
Erica Smith, Langston University
Dr. Toni Kutchan and Megan Gahr, Donald Danforth Plant Science
Center
The morphine biosynthesis pathway has been under investigation for
many years. Morphine is a commonly used analgesic drug that acts directly on the central nervous system. Salutaridine synthase and salutaridinol acetyltransferase are vital enzymes in the biosynthesis of morphine
in opium poppy. Salutaridine synthase is an enzyme that is responsible for
production of salutaridine, an alkaloid that is involved in the biosynthesis of morphine. Salutaridinol acetyltransferase is an enzyme responsible
for the conversion of salutaridinol to salutaridinol-7-0-acetate, also in the
biosynthetic pathway of morphine. In the present study we used Pichia
pastoris as an expression system to determine if propagation of these
specific genes could occur and functional proteins could be obtained from
the cloned genes. With each enzyme, polymerase chain reactions were
used to amplify specific DNA in our vector, pA0815. By performing phenol chloroform isoamyl alcohol extractions (P:C:I), ethanol precipitations,
and gel extractions; we were able to perform restriction digest with EcoRI
on each PCR product and the vector. P:C:I and ethanol precipitation were
then performed again before conducting Calf Intestinal Alkaline Phosphatase (C:I:A:P). A gel extraction was performed to remove all proteins
from the gene insert, whereas P:C:I and ethanol precipitation were done
on the vector. DNA ligation was then performed in preparation for transformation into E. coli. With our gene inside of pA0815, we transformed
salutaridinol acetyltransferase and salutaridine synthase into E. coli and
grew the bacteria on plates made up of LB with ampicillin. Only the ampicilin resistant colonies would grow, thereby increasing our chances of
finding the clone. Colony PCR was then performed on several colonies to
confirm that the gene and vector were present. Mini-preps were done on
those colonies of salutaridinol acetyltransferase that showed positive results. They were then prepared for DNA sequencing. Sequencing of the
salutaridinol acetyltransferase showed that the gene and the vector were
present and the gene had been placed in the right direction inside of the
vector. Salutaridine synthase had a lower transformation efficiency and
colony PCR confirmed that one colony carried the gene and the vector.
Transformation into Pichia pastoris with subsequent assay tests will be
done in the future.
OA #38
Sun Exposure and Prostate Cancer: An Investigation
Prestina Smith, Bennett College for Women
Stephen J. Freedland and Lionel Bañez, Duke University
Collaboration Around Research and Education (CARE) in Prostate
Cancer Program
Most studies report that the diagnosis of skin cancer has a protective role
against prostate cancer. Investigators believe that increased levels of Vi-
Program Book
A11
Abstracts
tamin D resulting from sun exposure may be the reason for this phenomenon as Vitamin D has been linked to decreased risk for prostate cancer.
The purpose of this investigation is to determine whether skin lesions due
to sun exposure will decrease the likelihood of a protein specific antigen
(PSA) recurrence in radical prostatectomy patients. Retrospective studies were conducted from 1988 to 2007 using the Shared Equal-Access
Regional Cancer Hospital (SEARCH) database. The database is a multicenter collection of men treated with radical prostatectomy (RP) at the
Durham, West LA, and Palo Alto Veteran Affairs Medical Centers. The study
included 1,370 men. Sixty-three (4.6%) had sun exposure related skin lesions diagnosed before a radical prostatectomy. Univariate analysis was
done using the Chi-squared and Mann-Whitney U tests; and a multivariate
analysis was done using Cox Proportional Hazards model adjusting for
age, PSA, body mass index (BMI), Gleason Score, stage, center, year, and
prostate weight. Of the 1,370 men included in the study, 90% Caucasian
men were of the population with sun exposure related skin lesions, African
Americans were 6.67% and other races were 3.33%, RP patients with sun
exposure related skin lesions included in this study tended to be younger
(mean age of 62 vs. 60), have lower PSA values (median: 7.4 vs. 6.2) and
diagnosed in later years (median: 1998 vs. 2000). Among Caucasians,
men with sun exposure related skin lesions are almost twice as likely to
experience a PSA recurrence compared to those without lesions (hazard
ratio=1.81;95% CI=1.05-3.11; p=0.03). From these results, we concluded
that the diagnosis of sun exposure related skin lesions in Caucasian men
undergoing RP is independently associated with increased risk for PSA
recurrence. Further studies are warranted to determine the underlying
reason for this association.
OA #39
Sequence Variations in Nod C and Structural
Characterization of Cowpea Bradyrhizobial Isolates
Milfred Standifer, University of the District of Columbia
Carolyn Cousin Ph.D and Freddie Dixon Ph.D, University of the
District of Columbia
Desta Beyene Ph.D, Howard University.
Preliminary work on the effect of biosolid application on cowpea bradyrhizobial had shown that two (73-3 and 73-28 from biosolid treatment
of 73 tons/ha) cowpea bradyrhizobial isolates were able to effectively
nodulate both cowpea and soybeans. The occurrence of this cross nodulation is a significant finding that warranted genetic analysis. Transmission
electron microscopy was used to compare the nodules from the two isolates with known standards that routinely nodulate Vigna unguiculata and
Glycine max. Ultrastructure of nodules from the two isolates was similar
in the morphology, number and distribution of the bacteroids, when compared to the nodules from USDA 6 and USDA 3456. Genomic DNA from
these two isolates was amplified using random primers as well as specific
nod C primers. The PCR-based fingerprint analysis showed that these two
cowpea isolates are distinctly different from the Bradyrhizobium japonicum that nodulates only soybeans and the Bradyrhizobium sp. that nodulates cowpeas. Further genetic analysis of these bacterial strains also
showed significant sequence variations within the nod C nodulation gene.
We concluded that these two unique isolates are genetically dissimilar to
the bradyrhizobium reference strains. This study is funded by UDC-AES
and NSF funded HBCU-UP grant.
A12
Program Book
OA #40
Bacterial and Fungal Populations in Lead and ChelateContaminated Soils
Halima Stringer, Jackson State University
Felix Slater, Olive Branch High School
April Wesley, Madison Shannon Palmer High School
Jennifer Ntoni, Jackson State University
Drs. Gregorio Begonia and Maria Begonia, Jackson State University
Lead (Pb) is a common inorganic toxicant at contaminated sites. Unlike
other metals, Pb has no biological role and is nonessential and potentially
toxic to microorganisms. Ethylenediaminetetraacetate ( EDTA), a chelating agent, and its complexes with heavy metals (chelates) are also toxic
in soil environments. However, reports on the combined effects of Pb and
EDTA on soil bacterial and fungal populations are very limited. The objective of this study was to investigate the effects of Pb and EDTA on the
microbial (bacteria and fungi) growth or populations on Pb and EDTA-contaminated soils that had been previously cropped with tall fescue for eight
weeks. Soils were treated with different concentrations of Pb, aged for six
weeks, and planted with tall fescue for eight weeks. The chelating agent
EDTA was applied to the soil one week before harvest. After harvest, soils
were cleaned from debris, pulverized, sieved, and stored until microbial
growth assessment. Results revealed that lead differentially affected both
soil bacterial and fungal populations. Across 3 Pb treatments, bacterial
populations were lower at both 1,000 and 2,000 mg Pb/kg dry soil compared to those found at 500 mg Pb/kg dry soil. In the presence of EDTA,
bacterial populations were also higher at 1,000 and 2,000 mg Pb/kg dry
soil, indicating the alleviation of the toxic effect of Pb. Fungal populations
were higher at 500 and 2,000 mg Pb/kg dry soil than at 1,000 mg Pb/kg
dry soil where growth was inhibited. Generally, EDTA decreased the fungal
populations at all Pb levels and also in the absence of Pb. The growth of
soil bacteria and fungi to soil-applied Pb indicates that these microorganisms may have resistance mechanisms to deal with metal toxicity.
OA #41
The Effect of Coadsorption on Organic Acid Monolayer
Formation
Ja’Pel Sumpter, Winston-Salem State University
Nuri Oncel, David Rampulla, and Steven L. Bernasek, Princeton
University
In this study, the monolayer structures of 5-Octadecyloxyisophthalic acid
(5OIA) are investigated at the liquid-solid interface. 5OIA is a useful model
molecule that allows the comparison of the effects of intermolecular hydrogen bonding and the van der Waals interactions on the formation of
ordered monolayer structures. The monolayer is formed from a solution of
5OIA dissolved in various solvents deposited on highly oriented pyrolytic
graphite (HOPG). The structures are examined with Scanning Tunneling
Microscopy (STM). Typically, lamellar structures of 5OIA co-absorbed with
solvents are observed. The high- resolution STM images show double-row
structures displaying the occurrence of buckling in various domains. Upon
observing the formation of ordered films, the molecular level structure of
the 5OIA monolayer is investigated by a thorough analysis of structural
features for different solvents and solution conditions. This study will provide a better understanding of the observed monolayer structures as well
as understanding of the forces which govern ordered structure formation.
This research can be a new approach to the advancement of surface templating, the controlled formation of particular structures on the nanometer length scale.
Abstracts
OA #42
The Complication Rate of 3rd Generation Cryosurgical
Ablation of the Prostate
OA #44
Lead-Induced Cytotoxicity and Genootoxicity in Human
Breast Carcinoma(MCF-7) Cells Via Oxidative Stress
Jessica Terry, Bennett College for Women
Thomas Polascik, MD, PhD, and Vladimir Mouraviev, MD, PhD, Duke
Prostate Center
Nicholas Walker, Jackson State University
Dr. Clement G. Yedjou and Dr. Paul B. Tchounwou, Jackson State
University
A significant factor in evaluating treatment outcome for prostate cancer
(PCa) is the effect on the quality of life. Third generation cryotherapy results in fewer complications and a better quality of life than first and second generations of cryotherapy.
Lead is ubiquitous in the human environment as a result of industrialization. Historical literature extensively documents that chronic, excessive
exposure to lead is associated with increased rates of infertility, miscarriage, stillbirth, and poor infant outcomes. Research indicates that exposure to lead during pregnancy is only one source from which a fetus can be
exposed to lead. Pregnancy and breastfeeding can cause a state of physiologic stress that increases bone turnover of lead. However, the molecular
mechanisms of toxicity are still largely unknown.
Methods: Between January 2002 and May 2008, 94 men have undergone
cryoablation of the prostate to treat localized PCa. All men had a bone
scan prior to treatment. Complications were collectively entered into a
database and were represented as preoperative complications and postoperative complications. Over 80% of procedures were done on an outpatient basis.
Of the 36 preoperatively potent men, 24 (66.7%) were able to retain their
previous level of potency and 7 (19.4%) were potent with the use of medical assistance. The incontinence level was as low as 2.3%, only requiring
2-3 pads per day. Ten patients developed temporary urinary retention due
to catheter issues. One patient developed urethral slough, and one patient developed urethral stricture. There were no cases of fistula, but two
unusual cases of prostatic abscess were reported which were percutaneously drained and successfully treated. There were two cases of temporary pelvic pain. The mean follow-up time was 26.8 months.
In conclusion, third generation cryoablation of the prostate is safe and
effective. This confirms that third generation cryoablation has reduced
the number of reported complications and has provided a much more improved quality of life in comparison to first and second generation cryotherapy.
The aim of this research was to use human breast adenocarcinoma
(MCF-7) cells as a test model to evaluate the toxicity, oxidative stress, and
genotoxic damage induced by lead nitrate.
In the present investigation, human breast adenocarcinoma (MCF-7) cells
were exposed to different doses of lead nitrate for 48 hours. Malonhydelhyde (MDA) production and the degree of DNA damage were also evaluated by the means of lipid peroxidation and comet assays, respectively.
Data obtained from the MTT assay indicated that lead nitrate significantly
decreases the viability of MCF-7 cells in a dose-dependent manner. Upon
48 h of exposure, the cell viability (mean ±SE, n = 6) compared to untreated control was 100 ± 2%, 102 ± 3%, 105 ± 6%, 112 ± 3%, 102 ± 2%,
97 ± 4%, 74 ± 2% and 33 ± 1% in 0, 0.80, 1.58, 3.12, 6.25, 12.50, 25.00,
and 50.00 ug/mL of lead nitrate, respectively. Data generated from a lipid
peroxidation assay resulted in a significant increase (p < 0.05) in malondiadehyde (an end product of lipid peroxidation) with increasing doses of
lead nitrate. The comet assay results indicated that lead nitrate causes
DNA damage in MCF-7 cells in a dose-dependent manner.
OA #43
Defining How Calcium Signalling is Perturbed in EarlyOnset Alzheimer’s Disease
Our results indicate that lead nitrate is cytotoxic to MCF-7 cells and induces the formation of MDA and DNA damage in exposed human breast
adenocarcinoma (MCF-7) cells as measured by the MTT, Lipid peroxidation, and Comet assays.
Kendra Vann, Langston University
Amy Palmer, PhD, University of Colorado
[Acknowledgements: This research was financially supported in part by
a grant from the National Institutes of Health (Grant No. 1G12RR13459),
through the RCMI Center for Environmental Health, and in part by a
grant from the U.S. Department of the Army (Cooperative Agreement No.
W912H2-04-2-0002) through the CMCM Program at Jackson State University. The authors thank Dr. Abdul Mohamed: Dean Emeritus, Dr. Mark
Hardy: Interim Dean, and Dr. James Perkins: Director of the LSMAMP Program.]
The intensifying research of many scientists has driven a vast amount of
progress in understanding how neurodegenerative diseases affect the
brain. However, the relationship between Ca2+ signalling and Amyloid
Precursor Protein (APP) mutations that cause early-onset Alzheimer’s
disease (EOAD) is not yet clear. Alzheimer’s disease (AD) is an incurable,
progressive degenerative disease of the brain, which leads to cognitive
and behavioral impairment and produces two hallmark abnormalities:
Amyloid-β(Aβ) plaques, and intracellular neurofibrillary tangles. Aβ is a
fragment of a protein that is snipped from APP. In a healthy brain, these
protein fragments would be broken down and eliminated. In AD, the fragments accumulate to form hard, insoluble plaques. The objective of this
research was to gain insight of how EOAD-causing mutations impact Ca2+
signals. I investigated the mutants APP T714I and V717L, which are considered to be aggressive EOAD, and used genetically-encoded fluorescent
sensors to measure the concentration and localization of cellular Ca2+. The
central hypothesis was that the EOAD APP mutants T714I and V717L will
cause Ca2+ dyshomeostasis. I discovered that the EOAD mutant V717L had
a significant (P < .05) effect on the resting Ca2+ levels compared to the APP
wild-type, where the mutant caused a decrease in resting Ca2+, while the
APP mutant T714I did not. These results support experimental use of APP
mutants as a useful tool for understanding the mechanisms of Ca2+ dysregulation in Alzheimer’s disease.
OA #45
Disparities in Health Care in the Tri-County Area: Who,
What, Where, and Ways to Close the Divide.
Jerrica Washington, Morris College
Dr. Lisa Vandemark, Medical University of South Carolina
Dr. Radman Ali, Morris College
Nearly half of all Americans are affected by a mental disorder at some time
in their lives, yet there are significant barriers that keep persons with mental illnesses from seeking and receiving treatment in areas that suffer from
community and neighborhood deprivation. Lack of knowledge about mental illness and hesitancy on the part of people with mental illness to seek
treatment are among barriers that affect the mental health status in these
areas. This project focuses on disadvantaged locations in the target areas of Berkeley, Charleston, and Dorchester counties in South Carolina. In
South Carolina, 24% of the population is considered to be rural. In Berke-
Program Book
A13
Abstracts
ley County, 16,066 people are living in poverty, or 11.8%, in Charleston
County, 49,330 people are living in poverty, or 16.4% and in Dorchester
County, 9,108 are living in poverty, or 9.7%. The purpose and goal of this
project is to study the correlation between area deprivation and the general and mental health status among residents of disadvantaged neighborhoods in these areas and to help implement a solution to the problem.
The methods used in the project consist of literature searches as well as
key-informant interviews to garner the knowledge and opinions of health
care professionals in these areas. Through my research I found that some
of the factors that causes disparities in health care and affects access to
health care are race, ethnicity, gender, geographic location, lack of health
insurance, likeliness to seek help, socioeconomic group, ability to speak
English, and availability of health care providers, to name a few. It is our
hope that as a result of this project, the barriers will be better understood
and, as a result, more can be done to treat those that need help in disadvantaged areas.
OA #46
Influence of Antioxidant Status in MCF-7 Cell Line to
Etoposide Treatment
Brittney Williams, Texas Southern University
Dr. Mario Hollomon, Texas Southern University
Breast cancer is the second leading cause of death among American women in the United States. Breast cancer treatment includes several modalities such as radiation, chemotherapy and surgery. As with other cancers,
the impact of diet on breast cancer has long been an interest to a number
of investigators. Investigators have examined the impact of various diet
manipulations on the response to drugs used to treat breast cancer. The
aim of this project is to investigate the response of the MCF-7 cancer cell
line grown in media supplemented with vitamin E and antioxidant depleting agents to etoposide treatment. The MCF-7 cell line was derived from
a 69-year old Caucasian woman who underwent two mastectomies in a
five year span. Etoposide is topoisomere II inhibitor. This study will investigate cell cycle, cell viability, apoptosis, and oxidative stress. Propidium
iodide will be used to evaluate cell cycle. Cell cycle will be evaluated by
MTT assay. Apoptosis will be evaluated by immunoblotting for caspase
activity. Oxidative stress will be determined by flow cytometry. The aim of
this study is to assess the response of the influence of antioxidant status
in MCF-7 cell line to etoposide treatment.
OA #47
Evaluation of the variants of ERG oncogene in prostate
cancer.
Emmanuel Woode, University of the District of Columbia
Ying Hu, Gyorgy Petrovics, Deepak Kumar, and Shiv Srivastava,
University of the District of Columbia, Washington, DC and Center
for Prostate Disease Research, Department of Surgery, Uniformed
Services University, Rockville, Maryland
Prostate cancer is the most common malignancy in American men and
the second leading cause of cancer mortality. The wide spectrum of biological behavior exhibited by prostate cancer poses a difficult problem in
predicting the clinical course for the individual patient. Molecular studies have shown a high frequency of ERG overexpression in about 60% of
prostate cancer. However, virtually nothing is known about the nature of
various full-length ERG transcripts and encoded proteins in prostate cancer. Therefore, identification and characterization of ERG variants expression in prostate cancer is crucial in understanding the biology and clinical
course of this disease.
Our study focuses on the evaluation of ERG variant transcripts originally cloned and identified from a cDNA library of human prostate tumors.
A14
Program Book
Laser-captured, microdissected malignant and benign prostate tissues
have been used. Cloning, Quantitative PCR and Western Blot have been
employed in my study.
We have identified frequent overexpression of different ERG variants in
prostate cancer. The transcripts levels and encoded ERG protein products
have been analyzed. The clinical relevance of ERG variants overexpression
has been discussed.
High prevalence of ERG overexpression in prostate cancer cells suggests
for causal roles of ERG protein in the neoplastic process and also possible
diagnosis, prognosis and therapy targets.
Computer & Information Sciences
OA #48
Modeling the Life-Like Interactive Behaviors of a 3D
Animated Virtual Storyteller
Ruth Agada, Bowie State University
Dr. Jie Yan, Bowie State University
Most computer tutoring or storytelling software cannot compare to their
human counterparts. They lack the effective communication skills that
their human counterparts possess. They are either too distracting or not
engaging enough for users. In this research, we aim to develop a new
experimental approach to investigating effective communication by animated virtual characters through speech, head movements and facial expressions. In addition, we will conduct experiments to gain new insights
into the optimum combination of voice and facial expressions to enable
pedagogical agents to provide a more believable communication experience. We contracted students in the performing arts department at Bowie
State University to act out stories that have been written for this project.
These stories were developed to contain six basic emotions (fear, anger,
disgust, happy, sad, surprise) so that we can create a fully informed virtual storyteller. Firstly, we will videotape the actors as they perform the
stories and then proceed to analyze their head movements and facial
expressions. These analyses will inform the head movements and facial
expressions of the virtual storyteller in the experiment. Secondly, we will
build a 3D animated African American virtual storyteller that can produce
head movements and facial expressions similar to those produced by human storytellers. We will identify facial expressions, head movements and
points of prominence in the stories through ratings of human listeners,
analyze videos of storytellers at those points, and then create a set of facial expressions and head movement animation sequences that mimic the
head movements and facial expressions of the human storyteller. Finally,
the virtual storyteller will be tested in three head movement conditions
(No Head Movement, Head movements, and Head movements with Prominence Movements) and two face emotion conditions (No Emotions, Emotions) to yield six different possible conditions for each story. A human
listener will test all six conditions. We hypothesize that the listener will be
more attentive, have more positive impressions of the storyteller and will
recall and comprehend stories better as animation conditions more closely approximate human communication behaviors. Successful outcomes of
this project will provide a new procedure for developing more engaging
and natural dialogs and narrations by pedagogical agents, which are expected to lead to more effective learning outcomes.
OA #49
Merging Two Images
Kierra Baltimore, Albany State University
Courtney Beach and Dr. Wanjun Hu, Albany State University
Mathematical representation of an image is a two dimensional function f(x,
y), which assigns each point (x, y) a color value f(x, y). Image processing
Abstracts
is the process to obtain a new function g(x, y) based on f(x, y) to achieve
different results such as increasing brightness and sharpness, etc. In this
study, the author investigated the algorithm to merge two images. The
algorithm finds the boundary of an image inside a rectangle area by calculating the color distance of consecutive pixels on a row. The boundary
will be further smoothed to reduce the noise using some basic statistics
calculations. After finding the boundary, the two images will be processed
to have blue background so that when merging, pixels in the blue background are replaced by pixels from the other image. Future research will
merge two images with overlapping areas and merge and then repair two
images with both overlapping areas and missing areas. The program is
written in Java using a media library developed by Georgia Tech.
OA #50
The Development of a Regents Test Database
Management System Using Visual Basics 2005 and ADO.
Net
Jamaz Hall, Albany State University
Carl White, Professor Gwendolyn Campbell, Derren Lewis, and
Courtney White, Albany State University
The Regents Test coordinators needed a Database to manage the data of
students who needed to take the regents’ test and to determine whether
the students have passed or failed. In past years, the advisors used an
excel spreadsheet to manually sort and determine the number of students
that passed or failed the test. In this project, a database was created using
Visual Basics 2005 and ADO.Net. ADO.Net is an enhanced version of ADO
designed specifically for Microsoft.Net applications. ADO.NET provides
consistent access to data sources such as Microsoft SQL Server, as well as
data sources exposed through OLE DB and XML. The components of ADO.
Net include Datasets (a collection of data), DataReaders (a broad category
of objects used to sequentially read data from a data source), DataTables
(represents a single table in the database), and DataAdaptors (functions
as a bridge between a data source, and a disconnected data class, such
as a DataSet). The user would first log on. Once the user enters the correct
user name and password, the program then goes to a selection where the
user can then choose what she/he wants to do next. She/he can either
choose to “add/edit/delete”, “Queries”, or “display/print”.
OA #51
When Kids Meet Humanoids: Robots Created as a
Therapeutic and Educational Tool for Children.
Jonecia Keels, Spelman College
Dr. Andrew Williams, Spelman College
Dr. Ayanna Howard, Georgia Institute of Technology
Extensive research proves that children are more prone to interact with
a robot than a therapist or teacher. Creating a humanoid that is capable
of interacting with children for therapeutic or educational purposes can
provide society with a beneficial and advantageous tool for the younger
generation. This research focuses on using a generally inexpensive humanoid and expanding its abilities to aid child rehabilitation, counseling,
and edification. The specific robot that is utilized in this research is the
Manoi AT01; a Japanese humanoid built specifically for its advanced athletic capabilities. Since there is no camera or microphone on the robot,
these tools will be added to provide a better interactive experience between child and robot. Taking advantage of the information and research
implemented in this project can improve the efficiency and paradigm of
child education and therapy.
OA #52
Using Java Net Beans to Design Secure Wireless
Dashboard Applications
Marcus Lloyd, Albany State University
Norbert Thomas and Dr. Robert Owor, Albany State University
Wireless connectivity is becoming the most ubiquitous form of data
transmission. Some of the main issues facing wireless systems are application security and portable usable interfaces. The purpose of our research project is to design secure dashboard based applications that can
be used on various wireless mobile devices. To accomplish our objective,
we researched various design frameworks and finally chose the JDE (Java
Development Environment), called Net Beans. Net Beans is a product developed by Sun Microsystems to implement java based web services and
mobile applications. We examined various wireless simulators including
Nokia, Ericsson and iPhone among others. We chose the RIM Blackberry
as the most appropriate platform to use because of its wide development
base and open architecture. To preview our applications, Net Beans Blackberry JDE was downloaded from the RIM website. After studying the JDE,
we implemented encryption and decryption using a variation of the MD5
encryption algorithm.
Additionally, we tested the environment with a view to determining how
flexible it was with regard to the design of portable dashboard applications. We developed three portable applications: GPS/GIS, Wireless
Security, and an Albany State University Mobile registration simulation.
The GPS/GIS application displays an interactive city wide map of Albany
and various streets based on the Embedded Google GIS framework. The
Wireless Security application secures the 5050 port used for wireless interconnection. The ASU mobile registration simulates wireless forms for
class registration at ASU. Hopefully, it will be implemented into the ASU
registration system in the near future. A comparison of a number of wireless simulators was conducted; among them Nokia, Ericsson, BlackBerry,
and IPhone. After the comparison, a tabulation of the strengths and weaknesses of each wireless device is discussed. Our research reveals that the
JDE is a powerful framework for designing portable wireless applications
and enables one to test an idea from conception to complete simulation.
OA #53
Analysis of PROTEIN FASTA Data for Viruses
Naja Mack, Claflin University
Ananda Mondal and Kelechi Agu, Claflin University
This research project is based on the hypothesis that the viral genomes
can be classified based on genome lengths, number of genes, distribution
of single amino acids, distribution of pairs of amino acids, and distribution of triples of amino acids. PROTEIN FASTA data from NCBI is used for
analysis. 60 dsDNA viral genomes of 6 different families- Adenoviridae,
Asfarviridae, Herpesviridae, Papillomaviridae, Polymaviridae, and Poxviridae have been considered. PROTEIN FASTA data provide the amino acid
sequences for different genes. A Perl script is developed to find i) Total
number of genes a genome composed of, ii) Average number of genes
in a family, iii) Average length of genes in a family, and iv) Average length
of genomes in a family. To characterize the properties of dsDNA viruses,
we investigated the relationships between genome lengths, number of
genes, and gene length within each family. Analysis shows that at least
four families could be classified by the length of genomes. For example,
average length of Adenoviridae is 10,000, Herpesviridae is 43,000, Papillomaviridae and Polymaviridae are 2,000, and Poxviridae is 49,000. This
study also shows that the number of genes in each family is a good criterion to classify the different families of dsDNA viruses. For example, average number of genes for Adenoviridae, Herpesviridae, Papillomaviridae,
Polymaviridae, and Poxviridae are 31, 96, 8, 6, and 171 respectively. One
interesting criterion for dsDNA viruses is that the average length of genes
Program Book
A15
Abstracts
is between 300 and 500. The present study shows that dsDNA viruses can
approximately be classified based on length of genomes and number of
genes. This classification method can be improved by incorporating the
distribution of single amino acid, pairs of amino acid and triples of amino
acid. Presently, we are working on developing codes to find the amino acid
distributions. Our future plan is to find the classification criteria for other
types of viruses such as ssDNA, dsRNA, etc. Our final goal is to develop
a model which will be able to classify a viral genome given in PROTEIN
FASTA format. The developed model, along with others, can be used as a
potential technique for identifying new viruses, which in turn helps in drug
selection or drug design for new viruses.
OA #54
Deploying a Solar Powered Wireless Local Area Network
for Remote Data Acquisition
Alton Render, Savannah State University
Ijaz A. Awan, Savannah State University
Solar and wireless walk hand in hand as if they are made for each other,
because they both do something very important and unique. Without any
wired connection both provide something to any location. Solar provides
energy and power whereas wireless provides data. So we can use solar
energy to provide power to wireless equipment. We are planning to design and implement a solar-powered WLAN to access data remotely. Our
research will consider the solar panel array size that provides wattage and
voltage needed between 100w@ 12v – 400w @ 12v. With data being transmitted wirelessly over distances and power harvested from solar energy,
several scenarios will be tested to ensure minimum power consumption
and conforming to IEEE 802.15.4 low powered standard products. Plans
are to test Proxim Tsunami MP.11 5012 and Zigbee technology for outdoor
access points that offer aggressive features like supporting VLANs and
fast roaming, enabling traffic separation and mobility, preventing nodes
from interfacing with each other and increasing system throughput. In order to ensure accuracy and efficiency of our remote network, we will be
using microcontrollers to gather the data from the analog sensorsm storing them into an external memory and sending commands to the wireless
modems. Constant power input will be maintained using a simple trickle
charger connected to a rechargeable battery.
OA #55
Creating Application Shutdown Scripts for the Caterpillar
Inc. Server Maintenance Process
DeMarcus Thomas, Mississippi Valley State University
Colleen Keough, Caterpillar, Inc.
Colleen Bland, Mississippi Valley State University
This project was created in an effort to develop a methodology to generate an automated process of application shutdown at Caterpillar Inc.
These processes would be used to improve total shutdown times for server maintenance, reduce personnel required to manually work on servers
during change windows, and initiate their course of action to decrease
the separation of Information Technology groups within Caterpillar Inc.
For this to be accomplished, application groups were consulted to provide
requirements on how their applications could be shutdown and those requirements were implemented in shell scripts. A shell script would provide an efficient means of server maintenance and reduce the chance of
human error during work on mission critical server systems.
A16
Program Book
OA #56
Network Security: Cracking Passwords and Sniffing Traffic
India Waddell, North Carolina Agricultural and Technical State
University
Jinsheng Xu and Crystal Steed, North Carolina Agricultural and
Technical State University
Computer networks and network protocols are not designed to be very
secure. Due to the fact that computers are faster, it has become easier to
intercept encrypted traffic and crack a user’s password. We first discussed
how passwords in operating systems are stored through hash function.
Then we investigated how two of the most popular hash functions, MD5
and SHA-1, work. Next, we cracked passwords in our computers using the
password cracking software Cain & Abel, with emphasis on Cain. The algorithms used by the tool included dictionary and brute force methods.
Subsequent to that, we did research on how to intercept traffic over an
Ethernet and monitor the activity using Cain & Abel. Following this, we
explained how ARP poisoning works and showed how vulnerable current
network protocols are. We tested how to crack VoIP passwords by intercepting the traffic and then used a password cracking algorithm to crack
the password. It has shown us that computer networks are very insecure.
Therefore, by knowing the process of retrieving passwords and intercepting traffic, we understand how to use computer networks more securely.
Thus, we are able to help users secure solid passwords to protect themselves and their networks.
Ecology, Environmental & Earth Sciences
OA #57
Microbial Community Mapping of Long Island’s Pine
Barren Forest Soil
Jeffery Ambrose, Southern University at New Orleans
Murty S. Kambhampati and Nyesha Smith, Southern University at
New Orleans
Vishal Shah and Fred Rispoli, Dowling College, Oakdale, NY
Timothy Green, Brookhaven National Laboratory, Upton, NY
Management of any ecosystem requires the information on the flora and
fauna present in the environment. The current management plans for terrestrial ecosystems are mainly based on the macrofauna. While microorganisms are very critical for maintaining the balance in an ecosystem, no
information is available on the types and behavior of microorganisms in
the soil of Long Island Pine Barren Forest. Thus, the existing management
plan for an ecosystem does not consider the influence of the actions on
the microbial diversity. In the first study of its kind, we mapped the Long
Island Pine Barren Forest (LIPBF) soils based on its microbial community
level physiological profile (CLPP). Soil samples were collected from different parts of the forest and upon preparation of the inoculum, BIOLOG EcoPlates were inoculated. The clustering analysis based on color intensities
illustrate that the entire LIBPF can be divided into four different clusters
at every horizon. Current data shows that the following substrates are utilized largely by the soil microbial community: D-Galacturonic Acid, D-Glucosaminic Acid, D-Mannitol, Itaconic Acid, L-Asparagine, L-Phenylalanine,
N-Acetyl-D-Glucosamine, Pyruvic Acid Methyl Ester, Tween 40, Tween
80, and γ-Hydroxybutyric Acid. We also noticed that the least consumed
carbon sources were i-Erythritol, 2-Hydroxy Benzoic Acid, α-D-Lactose in
horizons O and B in all sites. However, the physiological response of microbial community at each horizon and cluster is different. No correlation
between sampling sites and the physiological profile was obtained based
on vegetation or geographical location. In conclusion, comparing the
physiological profile of the microbial community from each horizon, one
Abstracts
can make a list of substrates that are utilized more throughout the LIPBF.
However, further studies need to be carried out to test this hypothesis.
OA #58
Phytoremediation: The Percentage Rate of Reduction
of Formaldehyde (CH2O) in Closed Environment using
Boston Fern Nephrolepsis Exaltata Bostoniensis
Tameshia Blackwell, Shaw University
Dr. Mialy Rabe, Shayvonne Been, and Sarem Hailemariam, Shaw
University
There is scientific evidence that Boston fern Nephrolepsis exaltata bostoniensis removes formaldehyde (CH2O) at a rate of 1514.6ppb/h in an open
room. However, the majority of the samples with “high” (50 - >800ppb)
concentrations of formaldehyde are from areas with little air circulation
such as storage cases. We want to measure the percentage rate of reduction (25%, 50%, 75%, and 100%) of CH2O of different concentrations
(0ppb, 20ppb, 150ppb and >800ppb) in a glass cabinet closed environment at 23°C.
Eight Boston ferns (3 sets of 2 replicates) and a control set were respectively put in closed cabinets with 1 cup formaldehyde solution of different concentrations in ppb(0, 20, 150, and >500). The level of (CH2O) was
measured and recorded with a formaldehyde meter z-300 at time (mn) t=0
prior to and after inclusion of (CH2O); t=3, t=5, and t=10 and every 5 minutes. The air volume of each cabinet was calculated for accurate numbers
of Boston ferns needed to keep the air clean. Plant chlorophyll contents
to measure plant health (N sufficiency) were also recorded prior to the
experiment and throughout.
Data from formaldehyde meter readings yielded 0ppb for the control (set
s0 s0') throughout the experiment. The percentage levels of formaldehyde
reduction at 10%, 25%, and 50% was fastest for the samples s3, s3' (n=2)
with highest formaldehyde concentration (>800ppb). Data yielded 25%
reduction at t=3, 27.33% at t=5, 54.66% at t=10, 82% at t=15 min; and
100% at t=12 min. Data for plant sets s1-s1' (20ppb) and s2-s2' (150ppb)
yielded a quasi-similar rate of reduction. The mean average rate of reduction (n=4) was 25% at t=4, 50% at t=10, 75% at t= 30, and 100% at t=50
min. The chlorophyll meter reading show N decrease in the fern leaves
at 100% reduction for s3-s3'. The N content remained the same at 100%
removal for s1-s1’and s2-s2'.
From this experiment, we learned that formaldehyde at high concentration (>800pbb) was removed faster than at lower concentration (20ppb)
or medium concentration (150ppb). In areas where formaldehyde concentration is high, the air is saturated with CH2O molecules due to the high
amount released in the air-ready and available for the fern’s leaf tissue
to take at a greater pace. If the area is not well ventilated, such as in our
case (closed cabinet), the rate of reduction is faster as formaldehyde molecules in the air are not scattered by ventilation. It would be interesting
to use material-releasing formaldehyde at different age instead of fresh
formaldehyde from a preserved specimen to test the validity of our data
in the future.
OA #59
Development of an EcoPDA: Beach Protocol
Charisse Carter, Norfolk State University
Maureen Scott, Norfolk State University
Christine Lee, University of California, Los Angeles
while making observations in the field. Currently, research performed in
the field requires the observations to be handwritten, which is time consuming and also a large inducer of human error being calculated in the
data. The development of the EcoPDA will assist researchers by prompting
questions to answer while in the field to ensure a standard of information
gathered. The information can then be recorded and stored in databases
that can be easily accessed for analysis.
The EcoPDA was enhanced to receive GPS location information via a bluetooth connection which is extremely useful for data collection. Another
adaptation contributed to the EcoPDA was a camera that could be attached and capture pictures of the field area being observed. The development of the EcoPDA involved testing to be performed in the field on local
deployments to select local beaches in the Los Angeles, CA area. Testing
in the field failed due to bugs in the coding system of the EcoPDA. However, the field deployment identified more aspects of research that the
EcoPDA could serve beneficial in. Other applications involve the camera
being interactive by examining pictures and being able to identify weather
conditions and physical water attributes.
Further research will look at implementing applications into the EcoPDA
that will enable it to actually perform tests to examine the status of bacteria levels in the beach water. Future hopes are to implement sensors
into the EcoPDA so that the EcoPDA can both take tests of samples and
organize and store the data.
OA #60
Mini-Size it: Local Action for a Global Climate Crisis
Ashley Queen, Coppin State University
Michael Washington, Dr. Mintesinot Jiru, and Dr. Sean Brooks,
Coppin State University
Global warming unequivocally exists despite the skepticism. It is increasing at an alarming rate, and the consequences are felt in the form
of natural disasters (tsunamis, hurricanes, wildfires, and the melting of
the polar icecaps). Humans are believed to be the cause of global warming mainly through deforestation, industrialization, and agricultural practices. Research thus far has shown that greenhouse gases [which include
CO2, CH4, O3, N2O, and H2O vapor] are the driving force to the rapidly accelerating warming of the Earth’s atmospheric temperature over the past
100 years. Of these gases, Carbon dioxide (CO2) is the most prevalent: it
accounts for 72% of the greenhouse gases. On a global scale, there is a
known linear relationship between CO2 concentration and temperature.
However, at a local scale the functional relationship is unknown. The objective of this research is to establish the local pattern between CO2 concentration and temperature fluctuation. The area of research is comprised
of five geographic regions in Maryland. Specific study sites were selected
within each geographic region to provide 100 years of monthly averaged
atmospheric CO2 concentration and temperature data. This data is being
thoroughly analyzed using appropriate statistical and graphical methods
to establish a functional correlation between these two variables. Cross
reference through use of surveying will provide insight on ‘how’ humans
are contributing to the results thereby magnifying the comprehension of
the issue. As a guideline for a survey the carbon footprint calculator (a
tool that measures the impact that human activity has on the environment) will be used. Looking at the progress of our analysis, it’s expected
that on a local scale, the trend between CO2 and temperature fluctuation
will be different from the global pattern. This will help establish a local
carbon management option that significantly reduces global warming.
The significance of this research is to test and develop a personal digital
assistant (PDA) that can collect and organize data gathered from research
performed in the field. A goal of this research is to devise the EcoPDA, a
PDA that has been modified to be used in the research field of environmental science, to be used as a template for researchers to record information
Program Book
A17
Abstracts
OA #61
A Comparative Study of the Concentration of Airborne
Microbes in Selected Communities Affected by Hurricane
Katrina
Lewins Walter, Dillard University
Bernard Singleton, Lawrance Mullen, and Brandon Carter, Dillard
University
The environment in New Orleans post Hurricane Katrina is a concern.
Nearly the entire city was under as much as 10 feet of water for weeks.
Broken sections in the sewer lines contaminated the waters. Mold is
growing everywhere in all of the once flooded buildings. Dead bodies
were present. It is hypothesized that there are higher concentrations of
airborne microbes inside versus outside areas in selected communities
that can potentially pose a risk to the residents of New Orleans that are
returning to the city. Infectious disease cases that have already been reported that were associated with Katrina affected areas(1). Sampling and
testing the air have shown the presence of high concentrations of bacteria
and fungi. Now it needs to be determined what communities have unsafe
levels of airborne microbes. Liquid impinger apparatuses were used to
collect samples in several different communities with different levels of
destruction in the Greater New Orleans area. The impingers were filled
with 20 ml of sterile water and attached to a vacuum pump that ran for 90
minutes. Impinger samples were split to compare culturing, microscopy,
and molecular analyses. The data from the culturing of colony forming
units as well as the DAPI staining indicated that the concentrations are
higher inside the buildings than they are outside. Also, the data collected
showed that areas that had the most flood waters had the highest concentration of contaminants. The short and long term effects on the health
of individuals working in and returning to the areas are of concern. There
is a need to continue to monitor the concentration of microbes present as
well as the relevant cases that may develop even after remediation. Also,
there is a need to determine what specific airborne pathogens are present
and their significance. Broad range PCR amplification was conducted on
the microbes cultured through collaboration with the University of Colorado at Boulder Department of Civil, Environmental, and Architectural Engineering. All of the microbes of the genetic analyses indicate that most of
the organisms collected at this point are bacteria and some are potentially
pathogenic.
OA #62
Physiological Basis of Arabidopsis Scaffold Protein RACK1
Mediated Protein-Protein Interactions
Jordee Wells, Howard University
Nabanita Kundu and Hemayet Ullah, Howard University
Plants encounter a combination of environmental stress conditions and
in response, they often utilize overlapping signaling pathways. In this regard, scaffold proteins are uniquely poised to integrate signals from multiple pathways by bringing interacting signaling components to proximity.
Scaffold protein RACK1 in metazoan mediates diverse signaling pathways
and is reported to interact with more than eighty diverse proteins. Lossof-function alleles of three RACK1 genes in Arabidopsis implicate the proteins in diverse environmental stress signaling pathways. The proteins can
potentially dimerize, and higher levels of homo/hetrodimerization were
observed under water stress conditions. Arabidopsis split ubiquitin cDNA
library screen identified diverse stress related RACK1 interacting proteins.
RACK1 proteins maintain potential residues for post-translation modifications like sumoylation and phosphorylation. Site-directed mutagenesis
and Bimolecular Fluorescence Complementation assays are utilized to
study the RACK1 dimerization and interaction events. Understanding the
physiological basis of RACK1 interactions with diverse stress related proteins will certainly help in elucidating environmental stress signal transduction pathways.
A18
Program Book
OA #63
Comparing Chemical Components of a Baseline Type of
Switchgrass Leaves to Efficiently Promote the Conversion
of Lignocellulose into Sugar for Ethanol Production
Megan Wilkerson, Fort Valley State University
Vernell VP. Cutter, Savannah State University
C Neal Stewart Jr., Ph.D., Nicole Labbe, Ph.D., Jason S. Yaun, Joseph
J. Bozell, Ph.D., Jason Burris, John Collier, Ph.D., and Maya
Swamidoss, Ph.D., University of Tennessee at Knoxville
Many scientific advances have been made in the process of converting
lignocellulosic feedstock into sugar for ethanol production. Ethanol is a
suitable biofuel for these feedstocks since celluslosic ethanol is chemically identical to ethanol from other sources, such as corn starch or sugarcane sugar, but has the advantage that the lignocellulose raw material is
highly abundant and diverse. Since switchgrass is a fast growing, widely
adapted, perennial grass, there is much research being undertaken to
improve its biomass, including our work at the University of Tennessee,
Knoxville. Another challenging factor in the conversion of lignocellulosic
material into sugar to produce ethanol is the delignification to release cellulose and hemicellulose from their complex matrix that is obscured with
lignin. We wish to better understand the nature of lignification and cell
wall structure as it relates to the degradation of cellulose and hemicellulose to sugars. Conclusively, the basis of my experiment is to conduct
a comparative analysis of two growth conditions through switchgrass
leaves. We harvested switchgrass leaves that were field grown and growth
chambered with both flowering and no flowering, and then compared
the chemical signatures through infrared spectroscopy to quantify each
chemical compound for detailed chemical features.
Hypothesis: Comparing the chemical signatures, features and compounds of a baseline type of Alamo switchgrass leaves in various growth
conditions (field grown, or growth chamber) will make purposeful breakthroughs in the production of celluslosic ethanol.
Methods: Over a nine week extensive research study we compared types
of lowland switchgrass leaves (Alamo and Alamo2) with regards to lignin
content. We tested the chemical composition, and compared physical
properties between both types. Through further characterization, quantitative mid-infrared spectroscopy was used as a viable alternative along
with near-infrared spectroscopy for the determination of plant tissue
chemistry to predict/determine the composition of lignin in our samples.
Physical & Mathematical Sciences
OA #64
Ferromagnetic Resonance Study of FePd Magnetic
Nanoparticles Fabricated by Ion Sputtering Technique
Osei Amponsah, Norfolk State University
Natalia Noginova, Norfolk State University
Magnetic nanoparticles with strong magnetic anisotropy are promising
for spintronics and magnetic memory applications. Ferromagnetic resonance (FMR) is a spectroscopic technique to probe the magnetization and
magnetization dynamics of ferromagnetic materials. FMR is studied in the
samples with 5, 10, 20, and 30 nm magnetic nanoparticles of FePd, fabricated by ion sputtering technique. Samples with 5 and 10 nm particles
demonstrate strong ferromagnetic resonance signal with the position depending on orientation. The data can be fitted with the model accounting
for the high perpendicular anisotropy. The sample with 20 nm nanoparticles demonstrates very broad line with no particular angular dependence. Samples with 30 nm particles show several resonances indicating
the presence of the particles of different size and anisotropy. The model
Abstracts
with perpendicular anisotropy does not fit the data. Different models
should be developed with account of broad distribution of the directions
of anisotropy fields.
OA #66
Molluscicidal activities of some triorganotin complexes on
Biomphalaria glabrata
OA #65
Design and Synthesis of Ionic Triorganotin Derivatives as
Anti-Cancer Agents
Olaniran Atchade, University of the District of Columbia
Selamawit Mekonnen, Harshini Dinesdurage, Xueqing Song, Carolyn
Cousin, and George Eng, University of the District of Columbia
Chezaray Anjorin, University of the District of Columbia
Somaly Neang and Dorrelyn Patacsil, University of the District of
Columbia
Deepak Kumar and Xueqing Song, University of the District of
Columbia
Metal-based compounds constitute a discrete class of cancer chemotherapeutics. Cisplatin and carboplatin are the most widely used metal-based
anticancer agents. There is still a large need for the development of new
metal-based compounds due to the low solubility and high organ toxicity
of metal-based compounds such as cisplatin and its analogues. An important aspect of a molecule’s activity in an organism is its water solubility.
One way to modify the structure is to incorporate an ionic moiety into the
molecule. Since they have a partially ionic characteristic, ionic organometallic compounds may have enhanced solubility in water as solubility is a
result of an interaction between polar water molecules and the ions which
make up the crystals. Our hypothesis is that ionic triorganotin derivatives will have better solubility and better activity as potential anticancer
agents with reduced toxicity.
Methods: The reaction involved coordinating malonic acid with triphenyltin chloride in the presence of potassium carbonate (K2CO3). The structures of the complexes were characterized by IR, NMR, and Mössbauer
spectroscopies. The IR spectra for the solid state were recorded as Nujol
mulls between CsI plates. The Mössbauer spectra were recorded at liquid
nitrogen temperature and fitted to the best least squares Lorentzian using
BaSnO3 as the reference. Crystal structure analysis was done using X-Ray
crystallography. The anticancer activities of the compounds were evaluated on Colo-357 human pancreatic cancer cells.
Results: Two triphenyltin malonate complexes were successfully obtained.
Structural analysis by X-ray crystallography revealed that one triphenyltin
malonate complex was a non-ionic polymeric bistriphenyltin malonate.
The other triphenyltin malonate complex was found to be monomerically
ionic by IR and NMR spectroscopies. The preliminary data showed that the
two triphenyltin complexes were effective on the Colo-357 human pancreatic cancer cells at very low doses.
Conclusion and Future Research: Ionic triphenyltin complexes with other
ligands, for example oxalic acid, will be prepared and tested for anti-cancer activity.
[Acknowledgement Financial support from the National Science Foundation HBCU-UP STEM Program and MERK/AAAS undergraduate Research
Program is gratefully acknowledged]
Triorganotins (R3SnX) have been shown to be effective against some mollusks. Biomphalaria glabrata, a species of freshwater snail is the intermediate host for Schistosoma mansoni, a flatworm that causes schistosomiasis. This disease is the second most lethal infectious human disease
after malaria. It is also known that triorganotins are environment-friendly,
because they decompose into non-toxic inorganic tin. The objective of this
project is to determine if commercially available triorganotins are effective molluscicides against Biomphalaria glabrata. Toxicity studies were
performed by incubating 10 snails of approximately 10 mm diameter in
6-oz cold drink cups, containing varying concentrations of toxicants. After
24 hours, the snails were removed, rinsed thoroughly, placed in ultra pure
distilled water, and fed a small leaf of Romaine lettuce. Mortality was recorded by checking the heart beat of each snail, in order to determine the
LC50 value; this value denotes the concentration that is lethal to 50% of
the snails. Preliminary studies indicated that the commercial triorganotins
are effective against Biomphalaria glabrata. The LC50 values for triphenyltin chloride and triphenyltin hydroxide are 0.6 ppm and 0.5 ppm, respectively. Currently, other triorganotins are being screened to determine their
effectiveness on Biomphalaria glabrata. Fecundity and imposex induction
studies are being evaluated with the same compounds.
[The study is supported by AAAS-MERCK grant and NSF-funded HBCU-UP
grant.]
OA #67
Expression of and Measurement of the Binding Affinity
of Isotopically-labeled Cdc42 Wild type and Cdc42(F28L)
with a Minimal Binding Domain Peptide of a p21-Activated
Serine/Threonine Kinase
Karole Blythe, Langston University
Dr. Paul Adams, Arkansas University
Cdc42 (cell division cycle 42) belongs to the Rho subfamily of the Ras
superfamily of G proteins (guanine nucleotide binding proteins). The ultimate goal of this research is to study the solution structure of an oncogenic mutant of Cdc42, Cdc42(F28L), bound to an important effector
peptide that regulates Cdc42-induced cell signaling activity using NMR
Spectrometry. Both wild type and mutant Cdc42 were expressed using an
Escherichia coli expression system, and purified using immobilized metal
affinity chromatograph (IMAC). The binding affinity of wild type and mutant was tested by performing a protein pull down assay with PBD46, a
minimal binding domain peptide of 46 amino acids of PAK (p21- activated
serine/threonine kinases). The results showed that both the Cdc42 and
Cdc42(F28L) were both successfully expressed in the minimal media containing the isotopic label, 15N-Nitrogen, which is necessary for NMR studies. Pull down assays were performed to determine whether the presence
of the 15N-isotopic label affected binding of the PBD46 peptide.
Program Book
A19
Abstracts
OA #68
Deposition Patters of Nonionic Surfactant on a Glass
Substrate
Neville Brackett, Albany State University
Dr. K. C. Chan, Albany State University
Non-ionic surfactants are comprised of linear or nonyl-phenol alcohols
and/or fatty acids. This class of surfactant reduces surface tension and
improves spreading, sticking and herbicide uptake. Some of the most
common nonionic surfactants are X-77 (UAP), Induce (Helena), Activator 90 (UAP), Triton Ag 98 (Rhone-Poulenc), and R-11 (Wilfarm). In this
research we investigated the effects of varying the concentrations of Surfactant to water ratio and investigating the effect of the post evaporation
deposition patterns. To maintain similar conditions for all drops, a chamber was used with the temperature and relative humidity kept constant at
24 C and 50% respectively. Concentrations varying from 0.075% to 0.75%
Non Ionic Surfactant (NIS) diluted using HPLC grade water were used to
analyze the differences in spreading patterns and also ring formation. The
results showed that for increasing concentrations there was an increase in
the total base area of deposition formed. It was also noticed that at lower
concentrations multiple rings are observed. The results for evaporation
patterns were consistent with the properties of the surfactant; however,
it is still unclear why there are various numbers of rings being formed at
different concentrations.
OA #69
The Travel-Time Variability of Ocean-Acoustic Rays
Stephen T. Broughton II, University of Arkansas at Pine Bluff
Dr. Mansour Mortazavi, University of Arkansas at Pine Bluff
Dr. Michael Vera, University of Southern Mississippi
Four thousand acoustic rays were shot to a distance of 1000 km in the
ocean. These rays were propagated by internal waves using a simulation
taken from an experiment conducted in the North Pacific, called Slice89.
The sound speed of rays in the ocean is generally 1500 meters/second.
This speed can be affected by the ocean in the three factors: temperature,
pressure, and salinity. Temperature has the greatest effect near the surface of the ocean while pressure is more of a factor in the greater depths.
The principles given by Snell’s Law help describe the characteristics of the
ray paths as they refract throughout the ocean. The Runge-Kutta method
was used to calculate the integrals of the ray paths at the desired time
steps. These calculations were performed by a computer program created
from FORTRAN. The arrival times of these rays at different locations in the
ocean were recorded, and the variability of these times was defined as
the variable tow. From my tow value results, I can conclude that they were
very similar and within uncertainty when compared to an acoustic wave
simulation and other integration techniques. Also, the depth dependence
of the sound speed has a major effect on the ray paths and the internal
wave field alters the sound speed causing travel time variability.
[My research project was conducted with the help of Dr. Michael Vera at
the University of Southern Mississippi and with the support of the AGEM
program.]
OA #70
Dscam Binding and Microsphere Interactions
Jennifer Caldwell, University of Arkansas at Pine Bluff
Jesse Collins, University of Arkansas at Pine Bluff
Vinothan N. Manoharan, PhD., School of Engineering and Applied
Sciences, Harvard University
Our research project deals with soft matter physics, specifically microspheres and proteins. We study Dscam (Down Syndrome Cell Adhesion)
A20
Program Book
which is a unique protein due to its homophilic binding and alternative
splicing pattern. The protein has three immunoglobulin domains that are
spliced and combined to form 19,008 different isoforms. The purpose of
our study is to reverse the binding pattern of Dscam and control Dscam
self assembly. The proteins are attached to micrometer-sized Colloids and
form aggregates. Microscopy is used to observe the aggregate’s reaction
to specific conditions. Dynamic and Static Light Scattering experiments
are done to study the distribution of particles in solution. Eventually, these
particle-protein systems might be used to engineer photonic crystals.
OA #71
The Additive Properties of Euler’s Totient Function
Andre Douglas, University of the Virgin Islands
Douglas Iannucci, University of the Virgin Islands
The purpose of the project is to to find all possible cases where Euler’s
Totient Function is additive. We have experimented with different cases
such as m+n=p (where p is prime) and m+n=p^2 (where p^2 is a prime
squared).
Let φ(n) denote Euler’s Totient Function, which counts the relatively prime
residues to n.
We observe that φ(n) is multiplicative, i.e., φ(mn)=φ(m)φ(n) if (m,n)=1
(m and n are relatively prime). We are interested in finding all integers
m,n such that φ(m+n)=φ(m)+φ(n). We investigate special cases (such as,
m+n=p where p is prime, and m+n =p2 where p is prime), and search for
ways to generate (possibly) infinitely many solutions.
We observed that Fermat Primes satisfy our problem. Research is still being conducted in order to find infinitely many solutions. However, our findings have eliminated certain cases. As a result, we are closer to finding
something that works. Then we will be certain that infinitely many integers exist.
OA #72
Chiral Analysis Using Cyclodextrins Chiral Selectors and
Fourier Transform Infrared Spectroscopy
Lizbeth Esquivel, Winston-Salem State University
Sayo O. Fakayode, David A. Pollard, and Abdul K. Mohammed,
Winston-Salem State University, NC
Chiral analysis continues to be of significant interest in medical and biomedical research because of the wide differences in the pharmacological
and physiological characteristics of enantiomer drugs. Thus, several analytical techniques and chiral selectors have been developed for effective
enantiomeric discrimination of chiral molecules. In this study, we investigated the possibility of the use of simple Fourier transform infrared (FTIR)
spectroscopy and cyclodextrins (CDs) as chiral selectors for enantiomeric
discrimination of chiral molecules. In addition, we explored the possibility
of use of FTIR spectroscopy for rapid investigation of the specific binding mechanism of enantiomer-CD guest-host complexation. The influence
of the type (α-CD, β-CD and Me-CD), CD concentration and time on the
enantiomer-CD guest-host complexation were also investigated.
The FTIR spectral of sample solutions containing R- and S-enantiomers
of chiral molecules in the presence of CDs were recorded and compared
for similarities and differences. The results of the study showed that, Rand S-enantiomers have remarkably different FTIR spectral properties in
the presence of CD chiral selectors, indicating different interaction and
binding mechanisms of enantiomers with CDs. In addition, the spectral
properties of enantiomer-CD guest-host complexes were found to be significantly influenced by the type of CD used as selectors, CD cavity size
and the size of the chiral molecules. The FTIR spectral of enantiomer-CD
complexes were also influenced by the CD concentration as well as the
time of the complexation. The use of CDs as chiral selectors in this study
Abstracts
is advantageous because CDs are commercially available at affordable
cost, making chiral analysis relatively inexpensive. Overall, the technique
reported in this study is attractive because it is rapid, inexpensive and
required small sample size, with potential in medical and biomedical research areas. Some of the future study includes the investigation of more
chiral analytes of different molecular size, shape, polarity and structural
property, as well as the possible determination of binding constant of the
enantiomer-CD complexes. [This study was supported by NSF-HBCU-UP
Grant number HRD-0308747]
OA #73
Development of Raman Spectroscopy as a tool for
Monitoring Organic Reactions
Kelvin M. Frazier, Savannah State University
Nicholas E. Leadbeater and Jason R. Schmink, University of
Connecticut
Traditionally, reactions that require heat are performed using a hotplate
or oil bath. Now, scientists are moving toward microwaves as the new
method of synthesis. The use of microwaves has been proven to provide
a cleaner and more efficient heating method. Reactions can be complete
within minutes and often product yields are higher than conventionally
heated counterparts. To perform experiments, the reactions are placed in
the cavity of the microwave which offers safety but creates unique issues.
The cavity of the microwave is dark and not readily accessible; therefore,
it is not possible to see a reaction while it runs. As a result, monitoring
the progress of a reaction requires stopping the microwave which allows
the mixture to cool. For that reason, two possibilities can develop. One
case is that the reaction does not reach completion. The second case is
that the reaction goes beyond completion, thus risking production of
by products and wasting energy. Finding the precise moment a reaction
completes would take trial and error. As a solution to this problem, our
research group has been using Raman spectroscopy as an in-situ tool for
monitoring reactions since this has no mechanical interactions with the
sample. We have shown that this is an effective tool for in-situ reaction
monitoring. In a test reaction, we were able to detect a distinct signal of
the product and plot the signal intensity as a function of time. This feature gives us the opportunity to monitor in real time the growth of the
signals due to product formation. We can also monitor the consumption
of the reagents by finding a signal that is unique for the reagent. In my
study, I performed two important organic transformations: namely the
preparation of coumarins and the Biginelli multi-component synthesis
of dihydropyrimidines. I investigated the effects of varying substituents
on the starting materials. Substrates ranging from those bearing electron
donating groups (OCH3) through to those bearing electron withdrawing
groups (NO2) were screened. The objective of the work was to see if we
could determine when each reaction reached completion simply by using
the in-situ Raman monitoring tool. The longer term aim of the work is to
develop an apparatus where there is a direct connection between the Raman spectrometer and the microwave unit. The spectrometer would monitor the reaction and then, once it reaches completion, will send a signal
to the microwave to stop heating. This could then be further developed to
produce an automated methodology.
OA #74
Investigation of Enantiomeric Recognition Properties of
Chiral Ionic Liquids by FTIR-Spectroscopy
CheToya A. Gaskins, Winston-Salem State University
Sayo O. Fakayode and David A. Pollard, Winston-Salem State
University
David K. Bwanbok and Isiah M. Warner, Louisiana State University
The development of new chiral selectors for enantiomeric recognition of
chiral molecules in separation science, analytical spectroscopy, biomedical
research and pharmaceutical industry continues to be an active research
area for effective chiral analysis, drug design and drug development. In
this study, the use of L-alanine tert-butyl ester nitrate (L-AlaBuNO3) chiral
ionic liquids as a possible selector for enantiomeric recognition of chiral
molecules was investigated by Fourier transform infrared (FTIR) spectroscopy. The FTIR was also employed to investigate the complexation
mechanism of R- and S-limonene on L-AlaBuNO3. The FTIR spectra data
of sample solutions containing R-limonene-L-AlaBuNO3 and S-limoneneL-AlaBuNO3 complexes were recorded and compared. In addition, the
influence of experimental factors such as the L-AlaBuNO3 concentration
and time on complexation was examined. Statistical data analysis, involving the use of mean-centered plot was further used to analyze the FTIR
spectra of limonene-L-AlaBuNO3 complexes to gain better insight to the
binding mechanism of limonene enantiomers on L-AlaBuNO3.
The results from this study demonstrate that R- and S-limonene have
different FTIR spectral properties in the presence of chiral ionic liquids,
indicating differential binding of limonene enantiomers on L-AlaBuNO3.
FTIR spectral of ionic liquid shows a prominent broad hydroxyl band and
strong carbonyl peak. However, these peaks disappeared when limonene
binds with L-AlaBuNO3. The dramatic changes in FTIR spectra observed
around the hydroxyl and carbonyl wavelength regions indicate the binding
sites of the complexation. In addition, the limonene-L-AlaBuNO3 complexation was found to be highly dependent on the L-AlaBuNO3 concentration and the time of analysis. The use of chiral ionic liquid selector for
enantiomeric recognition reported in this study is advantageous because
of the non-toxicity, non-flammability, high thermal stability and recyclability properties of ionic liquids. The future study includes investigation of
enantiomeric recognition properties of more chiral ionic liquids and the
evaluation of specific binding mechanisms of more chiral drugs on ionic
liquids. [This study was supported in part by NSF-HBCU-UP Grant number
HRD-0308747].
OA #75
Comparing the Biodiesel Fuel Produced From Benedict
College Cafeteria Waste Frying Oil Using the One-Step
and Two-Step Process.
Alex George, Benedict College
Dr. Helene Tamboue and Dr. Saphronia Johnson, Benedict College
Benedict College is one of the largest private HBCU in South Carolina,
hosting over 2,800 full time students in the cafeteria daily. During the
summer months, the cafeteria produces over 43 pounds of waste frying
oil (WFO) weekly. With the increasing cost of energy, rising environmental concerns, and the perceived scarcity of fossil fuel; researchers have
focused on using WFO as an alternative source, collectively termed biodiesel fuel. The frying oil at Benedict College is a blend of canola and corn
oils and is used to fry a variety of meats, poultry and vegetables. The aim
of this project is to establish a biodiesel production laboratory at Benedict
College utilizing the WFO from the cafeteria to produce fuel for in-house
use. Biodiesel is a clean burning non-petroleum based alternative fuel
derived from 100% renewable resources. Biodiesel fuel consists of alkyl
esters and is produced through the transesterfication of triglycerides and
low molecular weight alcohols. The purpose of this experiment was to op-
Program Book
A21
Abstracts
timize a production process using the WFO obtained from the cafeteria.
The masses of biodiesel/100 g of WFO produced in a one-step and twostep alkali-catalyzed process were compared.
OA #76
The Alabama vs. USA SAT Report
Winston Gunter, Alabama State University
Dr. Ana M. Tameru, Alabama State University
College-Bound Seniors presents data for high school graduates in the
year 2007 who participated in the SAT Program. Students are counted
only once, no matter how often they tested, and only their latest scores
and most recent SAT Questionnaire responses are summarized. Because
the accuracy of self-reported information has been documented and the
college-bound population is relatively stable from year to year, SAT Questionnaire responses from these students can be considered highly accurate. In this report we will compare the results of the Average SAT score of
the National with the Alabama for the college-bound seniors.
OA #77
Thermodynamic Characterization of Metal
Phthalocyanines-Human Serum Albumin Interactions
Chakeeta Jones, Savannah State University
Cecil L. Jones, Savannah State University
Lana Thomas, Johnson High School
One of the key problems with the application of photodynamic therapy
is selectivity. FDA approved photosensitizers accumulate in cancerous to
normal tissue at a current ratio of about 2:1. Serum albumin is widely recognized as a transport protein for various drugs including photosensitizers. This work investigates the thermodynamics of metal-phthalocyanines
binding to human serum albumin. Fluorescence spectroscopy was used to
measure the change in spectral characteristics of the protein during titration with the photosensitizer. Temperature dependent affinity constants
were calculated by fitting the data to appropriate nonlinear models. A
van’t Hoff analysis was used to calculate the enthalpy, (ΔH), and entropy,
(ΔS), changes associated receptor-ligand interactions.
OA #78
Investigating the Effects of pH on the Hydrolysis of
Sinigrin in Green Cabbage
Khalifa Jordan, Tuskegee University
Monica Frazier, Columbus State University
Pamela M. Leggett-Robinson, Dunwoody Campus, Georgia Perimeter
College
Prostate cancer is a disease that claims thousands of lives each year.
African-American males in the black belt region have a high incidence of
prostate cancer. It is well known and accepted that good nutrition is a
key component in eliminating the risk of cancer. Therefore, the control of
cancer through dietary compounds has gained acceptance. Diets rich in
cruciferous vegetables such as broccoli, cabbage, brussel sprouts, bok
choy, and cauliflower, have been shown to lower the risk of one developing several cancers such as lung, pancreatic, breast, and prostate cancer.
The nutritional aspects of cruciferous vegetables in cancer research have
been attributed to the isothiocyanates(ITCs) components. ITCs are a derivative from the family of glucosinolates. The amount of glucosinolates and
ITC derivatives formed during hydrolysis are influenced by various intrinsic and extrinsic factors, i.e., culinary processing, pH, storage conditions.
In this qualitative study, the hydrolysis of sinigrin (major glucosinolate in
green cabbage), was investigated using varying pH environments to gain
A22
Program Book
a better understanding of the biochemical changes (before and after digestion), which influence the sinigrin/ITC ratio.
OA #79
Synthesis and Anticancer Activity of δ-Toccopherol-Aspirin
Drug Hybrids
Heran Kalyie, University of the District of Columbia
Norman Kondo, Lydia Yimer, Somaly Neang, and Deepak Kumar,
University of the District of Columbia.
The purpose of the project was to synthesize δ-tocopherol-aspirin drug
hybrids to determine whether the hybrids had improved anticancer activity over the constituents. Vitamin E is the collective name for a set of 8
related tocopherols and tocotrieneols, which are fat soluble vitamins with
antioxidant properties. Vitamin E components were attached to aspirin by
means of an ester linkage using acetylsalicyloyl chloride. Previous work
in our laboratory has shown that α-tocopherol the most plentiful component of vitamin E is too sterically hindered to undergo facile conversion
to the corresponding alkyl ether. Therefore, the sterically less hindered
δ-tocopherol was used to be transformed to the corresponding ester.
Equimolar amounts of δ-tocopherol and acetylsalicyloyl chloride were refluxed in toluene. The reaction was monitored by thin layer chromatography which indicates the rate of formation and the number of components
being formed. Unreacted aspirin (from acetylsalicyloyl chloride) formed
upon standing from the reaction mixture. After filtration, the toluene solution was evaporated to dryness and the products were isolated and purified by silica gel chromatography. An infrared spectrum of the product
(viscous oil) showed the presence of an ester carbonyl band and the absence of the phenolic-OH group. The hybrid drug is currently being tested
on pancreatic and breast cancer cells to determine its anticancer activity.
[This study was supported by the NSF STEM and the NCI U56 cancer partnership programs].
OA #80
Molecular Dynamics Study of DNA Behavior in an
Aqueous Environment
Brittany Katz,Dillard University
Dr. Eric Buckles,Dillard University
Al’ona Furmanchuk and Jerzy Leszczynski, Jackson State University
There is a well-known fact that the DNA structure is very strongly influenced by the environment. The effect of the environment ranges from
global changes based on the solvent and ionic concentration leading to
conversions between the distinct A, B and Z-DNA structural families to
more local structural effects such as the radical 90º bend presented in
the DNA bound to CAP (catabolite activating protein)1. Thus, the modeling of such effects is crucial for understanding of biomolecular structural
organization.
In present work, we focused on the study of mechanism and timescale of
the water induced transition from A- to B-DNA form. The transition event
itself was judged with respect to the reference simulation of B-DNA. The
evolution of hydration patterns on the surface of DNA will be analyzed in
terms of radial distribution function and hydrogen bond lifetime correlation functions.
The atomistic molecular dynamics was performed under constant pressure-constant temperature conditions (NPT). Both, A and B forms of
duplex d(GCCGCGAGGTGTCAGGGATTG)2 were modeled with the AMBER
force field2 and periodic boundary conditions.
The following general features of the hydration were found:
1. Hydration is greater and held stronger around the phosphate groups
that run along the inner edges of the major grooves.
Abstracts
2. The water molecules are not permanently situated, probably due to the
rather diffuse electron distribution of the phosphate groups.
3. Hydration is more ordered and more persistent around the bases with
their more directional hydrogen-bonding ability and restricted space.
OA #81
Singular Perturbation Problems in Mechanical Systems
and Hydrodynamics
Shawn King, Albany State University
Dr. Zephyrinus Okonkwo, Albany State University
This project deals with singular perturbation problems encountered in mechanical systems and hydrodynamics. Essentially, we consider the springmass system governed by Newton’s Second law of Motion described by
the differential equation:
(1.1) m
d2y
dy
+κ
+ cy = F ,
dt 2
dt
where m denotes the vibrating mass, c the spring constant, κ the
damping factor, and y the length coordinate measured from the position of equilibrium, and t is the time. The initial condition associated with
equation (1.1) is
(1.2) y (0) = 0, y′(0) = 0.
Suppose the mass of the vibrating spring is very small, that is, m = ε << 1,
the equation above can be written in the form
(1.3) ε
d2y
dy
+κ
+ cy = F ,
dt 2
dt
d2y
CMM concentration and was time dependent. The quality and the performance of the regression models to accurately predict the enantiomeric
composition of future samples were highly CMM and analytes dependent.
Overall, the technique reported in this study is rapid and require small
sample size with high potential for the monitoring, and investigation of
the specific binding mechanism of guest-host complexes and for the determination of drug purity in pharmaceutical industry. Future studies include analysis of more chiral drugs, optimization of the regression models
for prediction of enantiomeric composition of more chiral analytes. [This
study was supported by NSF-HBCU-UP Grant number HRD-0308747].
OA #83
Mathematical Model of HPV in the United States and its
Impact on Cervical Cancer
Shernita Lee, Alabama State University
Dr. Ana M. Tameru, Alabama State University
The objective of this project is to evaluate the impact of human papillomavirus (HPV) on a given population and determine what can decrease the
rate in which American women become infected.
Design: A mathematical model of the cycle of HPV was made showing
routes individuals may choose once they become infected: treatment or
no treatment. Based on their decisions, they can either increase or decrease the chance of them progressing to the stage of cervical cancer.
Then the term with the highest ( ε 2 ) order is very small. Equation (1.3)
dt
is a singular perturbation problem.
OA #84
Logistic Regression Analysis for Obesity
We shall focus on the solution of such problems and their connections to
hydrodynamics.
Stephanie Loggins, Albany State University
Dr. Mohammed Hanif Talukder, Albany State University
OA #82
The Use of Poly(Sodium N Undecanoyl-L-Leucylvalinate
and Poly(Sodium N Undecanoyl-L-Leucylalanate)
Molecular Micelles as Chiral Selectors for Chiral Analysis
by Fourier Transform Infrared Spectroscopy
Patrick A. Lawson, Winston-Salem State University
Sayo O. Fakayode and Abdul K. Mohammed, Winston-Salem State
University
Gabriela M. Ganea and Isiah M. Warner, Louisiana State University
Fourier transform infrared (FTIR) analytical spectroscopy was employed
to investigate the use of poly(sodium N undecanoyl-L-leucylvalinate
(poly-L-SULV) and poly(sodium N undecanoyl-L-leucylalanate (poly-LSULA) chiral molecular micelles (CMMs) as possible chiral selectors for
the enantiomeric discrimination of chiral molecules. A 200 μL of R- and
200 uL of S-enantiomer of liquid chiral analytes was pippetted into a separate sample vial containing a known weight of CMM. The FTIR spectra
of samples containing CMM-R-enantiomer, CMM- S-anantiomer, pure R-,
pure S-enantiomer and pure CMM were recorded using FTIR, Shimadzu
8000S spectrometer. The FTIR of the samples was scanned between 400
cm-1 and 4000cm-1 and each sample was scanned 20 times at a resolution of 4. The average of the 20 scans was used for the data analysis. In
addition, the influence of the CMM concentration and time dependency
on CMM guest-host complexation was investigated. Furthermore, multivariate regression models were developed from the FTIR spectral data of
CMM guest-host complexes and subsequently used for the prediction of
enantiomeric composition of future samples.
The results of the study indicated that, the R- and S- enantiomers have
significantly different FTIR spectra in the presence of CMMs, indicating
the enantiomeric recognition properties of poly-L-SULV and poly-L-SULA
CMMs. The guest-host complexation was found to be influenced by the
The purpose of this study is to analyze the risk factors for obesity. Obesity
is a condition in which the natural energy reserve, stored in the fatty tissue
of humans and other mammals, exceeds healthy limits, and also can be
defined as a high proportion of body fat. It has become a growing issue
in the United States, which is the highest rated nation of obesity, having
one hundred twenty-seven million overweight people. About sixty million
adults, or thirty percent of the adult population, are now obese, which
represents a doubling of the rate since 1980. During the past decade, the
sharpest increase of seventy percent in rates of overweight and obesity
occurred among the ages eighteen through twenty-nine. The rate of obesity continues to grow year by year. I used the program SPSS, Statistical
Package for the Social Sciences, to observe data. The result from the data
is obese or non-obese, making the variables binary or dichotomous. In
this study, logistic regression model was developed to estimate the odds
ratio (with confidence interval) of the risk factors, such as blood pressure,
gender, age, and cholesterol. Also, the likelihood ratio test was performed
to test the significance of the risk factors. The factors that showed the
most risk from obesity were blood pressure and cholesterol.
OA #85
Cytotoxic Metabolites of Agelas Conifera
Vanessa Malone, University of the Virgin Islands
Omar Christian, University of the Virgin Islands
Agelas conifera (aka the brown tube sponge) is a common Caribbean
sponge specie known for its musky brown color and its symbiotic relationships with fish and coral. The symbiotic relationships are especially
important and have drawn much attention to the sponge. Additionally,
Agelas produces a plethora of antibacterial and wound initiated metabolites, such as bromonated ageliferins and debromoscletins.
Program Book
A23
Abstracts
There has been renewed interest in this genus due in large part to the
intriguing biogenesis of the secondary metabolites obtained from this
family. Dispyrin, a new metabolite isolated from A. dispar displayed a
novel tyramine core, presumably obtained from the condensation of
5-bromopyrrole carboxylic acid and a tyrosine sub unit. Continuing our
quest to expand the range of structural types assessable and to unearth
new and more potent solid tumor selective metabolites from Caribbean
sponges, we have examined the extracts of Virgin Island A. conifera. The
dried sponge material was sequentially extracted with hexane, ethyl acetate, and methanol. The crude ethyl acetate extract was the most potent; significantly inhibiting the proliferation of human and murine colon
and lung carcinoma cell lines at a concentration of 5 μg/ mL. The ethyl
acetate etract also displayed classic microtubule depolymerization activity at 10 μg/ mL. The bioassay guided fractionation of the ethyl acetate
has yielded several pure bioactive metabolites. We herein describe the
bioassay guided fractionation and purification of these metabolites. The
identity of these metabolites will be elucidated based on 1D and 2D NMR
spectroscopic studies.
OA #86
Equilibrium Atomic Configurations of Methanol Adsorbed
on Ag(111) Surface Studied from First Principles
Carla McKinney, Norfolk State University
V.I. Gavrilenko, Center for Materials Research, Norfolk State
University
Adsorption of methanol molecules on an Ag (111) surface is studied by
density functional theory. Equilibrium atomic geometries are obtained
through the total energy minimization method, and molecular adsorption
is studied using the super cell method. The Ag (111) surface is modeled
by a 6 monolayer thick slab, in which the top four layers are allowed to
relax. The entire unit super cell consists of a 10 Å thick vacuum layer in order to prevent spurious intermolecular interaction between the molecule
and the back surface. The electron energy structure of the entire system
is calculated using the ultrasoft pseudopotential method. This way different equilibrium orientations of the physisorbed molecules of methanol on
an Ag (111) surface are predicted, and Atomic geometries characterized
by minimal total energy are identified. Calculations were collected for the
different orientations in order to find the most energetically favorable configurations. Equilibrium geometry configurations, which are characterized
with lowest total energy values are shown in the figures. Atomic coordinates and adsorption energies corresponding to the equilibrium geometries were calculated.
OA #87
The Synthesis of Coumarins and Boronic Acid Derivatives
of Coumarins to be used as Chemopreventives.
Brandon Mills, North Carolina A&T State University
B. Mills & M. A. Franks, Ph.D., North Carolina A&T State University
Cancer is a group of diseases characterized by the growth of uncontrolled
abnormal cells leading to the impairment of normal bodily functions. A
total of 1,437,180 new cancer cases and 565,650 deaths from cancer are
projected to occur in the United States in 2008. One of the most promising avenues for controlling cancer is through “chemoprevention”. Chemoprevention is the use of natural, synthetic, or biological chemical agents
to reverse, suppress, or prevent carcinogenesis. It has been shown that
coumarins and boronic acids are effective chemopreventive treatments
when used to treat carcinogenic prostate cancer cells. I synthesized and
characterized coumarin derivatives for chemopreventive testing using
an indium chloride catalyst. Thus far, we have characterized and purified
several coumarins and derivatives using IR, GC-MS, and NMR spectros-
A24
Program Book
copy. The compounds that are synthesized and purified will be assayed for
chemopreventive activity against prostate cancer cell lines.
OA #88
Heat Assisted Electron Beam Induced Polycrystalline
Nanodots
Benjamin S. Newton, University of Arkansas, Pine Bluff
Mansour Mortazavi, University of Arkansas, Pine Bluff
Dr. Husam Abu-Safe and Dr. Hameed Naseem, University of
Arkansas, Fayetteville
The process of Aluminum Induced Crystallization (AIC) of amorphous
silicon is widely known. The applications for the polycrystalline silicon
range from thin film transistors to photovoltaic cells. Traditionally annealing is done across the entire surface of the substrate simultaneously. In
the present work, amorphous silicon and aluminum were deposited using plasma enhanced chemical vapor deposition (PECVD). The substrates
consisted of a nickel transmission electron microscope (TEM), grid with
a thin film of carbon between the grating. The substrates were annealed
in specific areas using an electron beam from the Phillips XL30 Environmental Scanning Electron Microscope (ESEM). Then, these samples were
investigated for a change in the morphology of the surface and for the
presence of polycrystalline silicon using the ESEM and TEM.
OA #89
Using Optical Techniques to Study Biological NanoParticles
Sarah Newton, University of Arkansas Pine Bluff
Mansour Mortazavi, University of Arkansas Pine Bluff
A.J. Salois and Lin Oliver, University of Arkansas
Knowing the properties of biological nano-particles introduces a series of
applications and techniques into performing a simple task. Just looking at
these particles or measuring the diameter would be impossible without
the aids used in performing these simple but hard tasks. In this experience there were three studies; denaturation proteins through dynamic
light scattering, vesicles with NBD or fluorescence, and vesicles containing peptides. The denaturation included the applications of the filtration
pump, high powered argon laser, PMT, temperature controller with thermocouples, a heating device called a variac, the starna cell and furnace.
Along with using the PMT, a voltage box is used which is also hooked up
to software called Brookhaven Instruments. The second and third studies
are similar in preparation. Both are made from a two-day process which
includes mixing the contents. Dry Nitrogen gas is used to dry the sample,
and it is placed in a vacuum over night to remove any solvent remaining.
On the second day, applications such as extrusion by a mini extruder take
place. Later, ,dynamic light scattering is used but without the temperature
controller and the variac. The other applications as stated earlier are still
used but heat is not required. Microscopy is then used to view these tiny
particles, but only the samples with fluorescence.
OA #90
Culturally Situated Design Tools
Capricia Petteway, Benedict College
Dr. Caroline Eastman, University of South Carolina
Culturally situated design tools (CSDTs) provide background information
on different cultures and the designs they make, along with a math concept to help students learn math while learning culture at the same time.
The CSDT I am developing is Sweet Grass Baskets of South Carolina. I will
be using the Polar Coordinates math concept for my CSDT. Using the Po-
Abstracts
lar Coordinates system should help students learn standard mathematics
while creating baskets of their own. The process of weaving sweet grass
baskets starts with making spirals to build the foundation of the basket.
Students will create baskets using the same spiral concept and adding the
appropriate number of rows using the Polar Coordinate System. By using
the sweet grass basket weaving cultural design, I have created a polar
coordinates design for students to use to make their own sweet grass baskets. I have created a layout and format for the background information
on sweet grass baskets and the use of polar coordinates as an addition to
the current CSDT website. The current system uses an adaptation of an existing graffiti CSDT. Future work will involve in dependent implementation
of the design and possible experimentation to determine its pedagogical effectiveness. The combination of cultural design and math concepts
should help students understand math from a different perspective.
OA #91
Mutated Human Mitochondrial DNA Polymerase, Pol y,
Aids in Prostate Cancer Aggressiveness
Diana N. Spell, Spelman College
Kimberly Jackson, PhD, Spelman College
William C. Copeland, PhD, National Institute of Environmental Health
Sciences
Mitochondrial DNA replication is necessary for proper mitochondrial function and cell viability. Certain amino acid sequences in Human POLG, the
gene which encodes for the catalytic subunit of human mitochondrial
polymerase, Pol γ, have been linked to several mitochondrial diseases by
causing increased mutagenesis and dominant effects on mitochondrial
DNA replication fidelity. With the alarming rates of men dying annually
from metastatic prostate cancer, it is hypothesized that there is a correlation between mitochondrial polymerase fidelity and the rapid proliferation
of prostate cancer cells in this population. To facilitate characterization
of POLG disease mutations in prostate cancer cells, a comparison assay
was developed to compare prostate cancer cell lines DU145, and LNCaP
(2 Caucasian), with normal prostate cancer cells in a large-scale mutagenesis assay. Isolated genomic DNA of each prostate cancer cell line will be
sequenced at the Center for Medical Genomics (CMG), Emory University,
and then analyzed to select for POLG disease mutations in all four DNA
strains. Strains indicating the presence of POLG disease mutations will
undergo a series of mutagenesis assays to determine cell viability and
proliferation rates of prostate cancer cells.
OA #92
Synthesis and Thermal Characterization of Modified
Resole Phenolic Resins Using Thermogravimetric Analysis
Dereca T. Watkins, Albany State University
Mary Ellen Rogers, Dr. Adriane Ludwick, and Dr. Melissa Reeves,
Tuskegee University
Major disadvantages associated with the synthesis of resole phenol formaldehyde resins are the negative environmental impact and the toxic effects of the starting materials of phenol and formaldehyde on the human
body. In order to create less hazardous materials, the present research
was geared towards finding alternate materials to serve as replacements
for the phenol precursor. To reach this objective, pyridoxine and 3-hydroxypyridine were selected as potential alternatives. The materials were
reacted with formaldehyde at 75C for one hour and cured using a multitemperature cure schedule. An unmodified resole phenol formaldehyde
resin was also fabricated using the same method to serve as the control
sample. Thermogravimetric analysis (TGA) was used to observe the oxidative stability, thermal stability, and thermal degradation kinetics of the
three materials. The syntheses of the modified phenolic resins were successful and reproducible. Replacing the phenol with the pyridoxine and
3-hydroxypyridoxine decreased the oxidative stability. However, replacing
the phenol with the 3-hydroxypyridine increased the thermal stability. The
use of pyridoxine and 3-hydroxypyridine altered the thermal degradation
kinetics of the resins. The Flynn-Wall model was used to evaluate the Ea
values of thermal decompositon of the three materials. Another degradation model must be used to fit the phenolic-type systems due to the correlation coefficient values not being optimum with the Flynn-Wall model.
Future research will explore other models that may fit the phenolic-type
systems, such as the Madhusudanan-Krishnan-Ninan Method or the
Kissinger Method as well as re-running experiments for reproducibility.
[Funding for this work was provided by the Tuskegee University Research
Experience for Undergraduates Site in Material Science and Engineering,
NSF Award EEC-0452332.]
OA #93
Racial and Gender Differences in Empowerment,
Constructive Use of Time, Commitment to Learning, and
Positive Identity in High-Achieving College Students
Gregory K. Davis, Morehouse College
John W. Hagen, University of Michigan - Ann Arbor
The current research is on positive development in adolescents and college students and is based on the research from the Search Institute,
which identified developmental assets – both external and internal –
which are predicted to foster positive development in young people
(Scales & Leffert, 1999). To evaluate the levels of developmental assets
in high-achieving Caucasian and African American college students, a 30
minute self-report questionnaire designed to identity these assets was
administered to University of Michigan students, and participants from
two of the university’s summer programs (N = 54: Caucasian, N = 29,
Males, N = 20). Four developmental asset subcategories were studied:
Empowerment, Constructive Use of Time, Commitment to Learning, and
Positive Identity. High-achieving African American college students were
found to have higher levels of Empowerment assets than Caucasian students. High-achieving Caucasian college students have higher levels of
Constructive Use of Time assets than African American students. No gender or racial differences were found in Commitment to Learning scores.
Contrary to the researchers’ hypothesis, high-achieving female college
students obtained higher levels of Positive Identity assets than did male
students. Future research on this topic will discern developmental asset
differences based on student athlete status, learning disabilities, parental
socioeconomic status, and the availability of a non-parent mentor.
OA #94
How to Improve Movie Popularity Predictions
Steven Siggers, LeMoyne-Owen College
Marko Puljic, LeMoyne-Owen College
We can substantially improve the accuracy of predictions about how much
someone is going to love a movie based on their movie preferences. We
find correlations among many movie viewers, and correlations between
movie viewers and the movies they have viewed. Our root mean squared
error is lower then 0.95 for grades from 1 to 5, which can help ‘netflix’
serve their customers better.
Program Book
A25
Abstracts
OA #95
Sickle Cell Anemia: The Forgotten Disease
Kai Adia Turner, Howard University
Tiffany Lathan, Howard University
Sickle Cell Anemia is a blood disorder that causes the production of abnormal hemoglobin, which leads to the sickling of red blood cells and
affects the hemoglobin levels that organs receive. Approximately sixty
thousand Americans have Sickle Cell Disease and millions carry the trait.
The disease originated in countries along the equator and rapidly arose
in parts of Africa, where malaria spread as a deadly epidemic (Vedro &
Morrison, 1994, p. 4). Sickle Cell is frequently compared to Cystic Fibrosis, an inherited disease which affects the lungs, digestive system, sweat
system, sweat glands, and male fertility of about 30,000 people with a
European background (Robinson, n.d). It has statistically been found that
despite the big difference between the amount of people Sickle Cell affects in comparison to Cystic Fibrosis, the former receives far less funding.
Sickle Cell Anemia, most prevalent among African Americans and those of
Mediterranean descent; may not be considered a serious ailment, or receive sufficient research funding because it is often race specific does not
receive adequate media coverage, and does not routinely cause death.
Technology & Engineering
OA #96
Modeling of the Piezoelectric Effect
LaVonda Brown, Norfolk State University
Dr. Gabriel Rincon-Mora, Dongwon Kwon, and Jinjh Su, Georgia
Institute of Technology
Energy harvesting in microelectronic devices, using the piezoelectric
effect, is an exciting technology that will be useful for various applications of the near future. In order to reach this level of performance, a
lumped-element circuit model must first be developed for researchers.
A transformer will be used to model the change from electrical voltage
to mechanical strain in a piezoelectric material (in this experiment lead
zirconate titanate, PZT, will be used). The ratio of N1 to N2, the number of
turns in the coil, will determine the relationship between the electrical and
mechanical characteristics. By observing the electrical domain alone via
eliminating the mechanical domain and solving for the impedance across
the PZT, a lumped-circuit model will be developed. Next, the mechanical
domain will be observed by eliminating the electrical domain. From this, a
lumped-circuit model of the mechanical domain will be developed. Finally,
the value of N2/ N1 will be determined, which will exhibit the relationship
between the electrical and mechanical domains. Once the model of the
piezoelectric effect has been developed, future researchers will be able
to use this model to test and observe how the piezoelectric material will
function within a microelectronic device.
OA #97
Glucose Measurement Based on Föster Resonance
Energy Transfer between Concanavalin A- Fluorescein
Isothiocyanate and Dextran/Gold Nanoparticles
Felicia Ekpo, Langston University
Dr. Kaiming Ye, Jared Garret, School of Engineering, University of
Arkansas
Diabetes affects approximately 16 million people in the United States and
over 100 million people worldwide. Numerous diabetics prefer a painless
method to measure their blood glucose levels in order to manage the fluctuation of their levels more effectively. The goal of the experiment is to
develop a new glucose sensor that will act effectively with the fluores-
A26
Program Book
cent light in order to be sensed through the tissue after excitation from
an internal or external source by the Föster resonance energy transfer
(FRET). If the goal is accomplished there will be a great possibility to develop biocompatible materials for assay encapsulation. If results are sufficient, the ideas of implantable glucose-sensitive microspheres will be
more feasible. During experimentation, the concentrations of the dextran,
gold nanoparticles, and ConcanavalinA-Fluorescein Isothiocyanate (Con
A-FITC) solutions were established and several tests were run to ensure
accurate results. The results proved that the .6 µM of ConA-FITC at the
fluorescence intensity of 520 nm would be most effective when testing because the concentration is neither too high nor low and demonstrated that
the effects were consistent with the Föster Resonance Energy Transfer.
OA #98
Quantitative Analysis of Some Radioisotopes in Local
Well-Water Samples
Joy Epps, South Carolina State University
Dr. Z. Chang, South Carolina State University
Radionuclides in the soil are left over from the creation of the Earth (primordial radionuclides), produced and deposited by cosmic ray interactions, and created through man-made releases.
Primordial radionuclides usually have half-lives over hundreds of millions
of years. Examples include 238U, 235U, 232Th, 226Ra and 40K. These radionuclides and their radioactive daughters are frequently found in soil,
rock and water. Groundwater is one of the key roles responsible for the
transport of these radionuclides through the ecosystem. Eventually, the
natural radionclides are distributed in plants, animals and human beings.
Therefore, the investigation on the radioactivity concentrations of these
radionuclides in groundwater is an interesting topic to many disciplines
such as radiochemistry, environmental health physics and hydrogeology.
The object of this research is to measure the concentration of some natural radionuclides in groundwater sampled from local private wells. Three
well-water samples were collected around Orangeburg, South Carolina.
The water samples were condensed before the analysis. About 1~2 liters of original samples were boiled down into between 120 mL – 30 mL.
Concentrated nitrate acid with high purity was used to dissolve residuals produced in condensed water samples. The condensed samples were
transferred into vials with different geometric dimensions. The prepared
samples were counted with an HPGe gamma spectrometer for 18 to 58
hrs. The photopeaks on the gamma spectra were analyzed and assigned
to different radionuclides including 238U, 226Ra, 40K, etc. The radioactivity concentrations of these radionuclides were calculated by the efficiency
calibration of the gamma spectrometer.
The effect of the geometric dimension of the sample vials on the count
efficiency was also studied in this research. A computer program named
‘Microshield®’ was used to simulate the effect of the geometric dimension
of the radioactive source on the radioactive intensity and radiation dose
measured by the Ge detector. The simulations were compared with the
experimental measurements obtained with the samples of different volumes. The results are discussed.
OA #99
Effect of Interfacial Tensions on 3-phase Liquid
Morphology
Jonathan Evans, South Carolina State University
Anderson Shum, Harvard University School of Engineering and
Applied Sciences
My experiment focuses on controlling the structure of oil-in-oil-in-water
double emulsion to eventually make a Janus structure. An emulsion is a
Abstracts
mixture of two unblendable substances. Janus, much like the greek god,
has two faces that is considered an ideal condition in microfluidics for my
research. In the experiments, we normally see a core-shell structure, a
droplet inside of another droplet in a solvent; or a completely separated
structure, two non interacting droplets inside of a solvent. The Janus condition could form a sphere with two sides that could possibly stabilize
emulsions and help us understand the different properties such as travel
direction or rotation.
After reviewing and importing the AutoCAD files of the 2nd floor of the
MCAR building into 3DSMax, images taken of textures in CGS were used in
order to provide realism to the environment. In order to create a simulated
version of CGS in XNA, the structure along with the furniture had to be
broken up into three different files to avoid a ‘system memory error’ and
properly display the virtual environment.
OA #100
Extractive Determination of Silver
In the future, more of the furniture will be created to enhance the realism
of V-CGS. Future work will include enhancing the interactive aspect of VCGS in XNA to create a 3D educational environment based in CGS.
Tena Hunter, Howard University
Dr. James Mitchell, Howard University
Silver nanoparticles are valued for their bactericidal properties. However
to harness these properties for biological purposes, the Ag nanoparticles
must be introduced at extremely low concentrations. During preparation
of Ag0 particles, mixtures of silver nitrate and sodium citrate are reacted
under appropriate conditions. Measurements of any free Ag+ remaining
in the nanoparticle formulation are required. One approach to the determination of Ag+ is based on the formation of a chelate of Ag+ with 1,10
phenanthroline and it’s extraction into 1,2 dichloroethane as an ion pair
with tetrabromophenolthalein ethyl ester. Beer-Lambert absorbance relationship for silver ions was achieved at 600nm in the 10-5 to 10-6 molar
range in 10mL aqueous phases. Results indicate that citrate at ≤ 0.1 M
levels produces no interference with the determination of silver cation
present initially at 10-6 to 10-8 M. This method was applied to determine
unknown levels of Ag+ in Ag0 nanoparticle citrate systems.
OA #101
Impact of the Wettability on the distribution of Residual
Non Aqueous Phase Liquid (NAPL) in saturated Porous
Media using Microtomography.
Maude Johnson, Southern University and A&M College
Riyadh Al-Raoush, Southern University and A&M College
In this research, tomography is used to investigate the impact of wettability on the distribution of NAPL in saturated porous media. Boron Carbide
of 250 micron grain size will be used to represent natural porous media.
Boron Carbide will be treated to obtain systems with different fractional
wettability. Special columns (6.0 mm ID) will be fabricated to conduct the
flow and entrapment of NAPL at the residual level. Microtomograpy will
provide 3D high resolution images of the interior of the systems in a non
destructive way. These images will be used to compute the following: (1)
complete characterization of the pore structure of the porous media (i.e.,
obtaining pore network elements such as pore bodies and pore throats);
and (2) complete characterization of the NAPL including locations, shapes,
sizes, interfacial areas, orientations and correlation to the pore structure
obtained in (1). The findings of this research will be very critical to numerical and theoretical models for contamination assessment risk and ,an
environmental remediation and enhanced oil recovery.
OA #102
V-CGS: Virtual Center for Gaming and Simulation
Brandon Littler-Darku, Norfolk State University
Dr. Rasha Morsi, Norfolk State University
The goal of this project is to create a virtual simulated environment of the
Center for Gaming and Simulation that is interactive through the use of
a gaming engine, which will provide the basis for the implementation of
educational programs within the structure. This project is a component of
the Virtual Marie V. McDemmond Center for Applied Research (V-MCAR).
A successful version of CGS was created within XNA which can be navigated by the Xbox controller, as well as a completed version of CGS within
3DS Max.
OA #103
Optimizing Transparent Armor Design Subject to Various
Projectile Impact Conditions
Carlton McMullen, Jackson State University
Xin Sun, Pacific Northwest National Laboratory, Richland,
Washington
Design and manufacturing of transparent armor have been historically carried out using experimental approaches. In this study, we use advanced
computational modeling tools to perform virtual design optimization of
transparent armor under different projectile impact conditions. LaGrangian-based finite element analyses combined with Eulerian-based particle
dynamics are used to simulate the damage initiation and propagation process for the armor system under different impact conditions. Different armor designs with various glass thickness lay-ups, bonded and un-bonded
interfaces, as well as various types of adhesives are studied for different
projectile sizes and tip shapes. It is found that armor systems with bonded
interfaces perform significantly better than their un-bonded counterparts.
It is also found that under the typical muzzle velocity of 1118m/sec, the
conical shaped projectile induced the most damage compared to other
projectile shapes. Our future work will focus on more numerical experiments to examine the effects of different types of interfacial bonds as well
as polymer layer thickness on the armor system performance.
OA #104
Imaging Residual Immiscible Fluids at Different
Wettability Conditions of Permeable Media
Meagan Pinkney, Southern University A&M College
Riyadh Al-Raoush, Maude Johnson, and Lindsey Thomas, Southern
University A&M Collge
The objective of this research was to investigate the impact of wettability on the special distributions and configurations of immiscible fluids
in permeable media that mimic natural subsurface soil systems. X-ray
microtomography was used to obtain high-resolution three-dimensional
images of the systems non-destructively. Boron carbide with grain size
of 250 micron was used to represent the soil because of its geometrical
and topological characteristics (e.g, angularity, surface structure) and
low x-ray absorption. System image consisted of permeable media (boron carbide) of different fractional wettability fully saturated with water
and containing oil at the residual level. Soltrol 220 was used to represent
the oil and it was doped with Iodononane to enhance its image contrast
to be distinguished from water. Boron carbide was rendered hydrophobic by its treatment using Octadecyltrichlorosilane. Fractional wettability
systems were prepared by mixing certain ratios by weight of hydrophobic
and hydrophilic boron carbide. Four different fractional wettablity systems
containing the residual oil were imaged (i.e., 100%, 75%, 50%, and 0% hydrophilic solid phase by weight). Special columns (7.0 cm height and 5.4
mm ID) were fabricated to conduct the fluid flow and the establishment
Program Book
A27
Abstracts
of Soltrol at the residual level. Visual inspection of the images revealed
that the wettability of the solid phase has a significant impact of the distribution and configuration of immiscible fluids in saturated porous media
systems.
OA #105
Website for International Partners of NASA (Remote
Access)
Demetrius Powell, Texas Southern University
Dr. Bobby Wilson, Teresa McCoy
The focus of my project was to determine and develop remote access to
NASA’s International Partners. Our international partners consist of JAXA
(Japan), ESA (European), CSA (Canada), ASI (Italy), and RSA (Russian). Teresa McCoy is helping me learn the different acronyms of NASA, and also
has taken me around to meet with different organizations of NASA to give
me different outlooks on the page I am suppose to create. Teresa and I will
also meet with the International Partners of NASA to see what inputs they
would like to see on the web page. All of these partners need access to
different databases of NASA. One of the first requirements of the network
remote access control is to determine who the user is and what that user
will be allowed to do. The ACP (Access Control Plan) plays a big role in this
project. This is where they will have to go to fill out where and what they
need access for. Another program that will play a big part of this project is
NFNMS. NFNMS is NASA’s Foreign National Management System. This is a
badge system that all foreigners must go through. Some of the questions
that they will be asked is their country of citizenship, and also if they are a
CPRA (Country Resident Alien). These are some of the questions they will
have to answer when they are filling out the information on the ACP page.
HSPD-12 is another very big part of this project. Homeland Security Presidential Directive 12 (HSPD-12) requires a Federal standard for secure and
reliable forms of identification, as further defined by Department of Commerce regulations. Secure and reliable forms of identification must be issued based on sound criteria for verifying an individual’s identity: strongly
resistant to identity fraud, tampering, counterfeiting, and terrorist exploitation; able to rapidly authenticate electronically; and issued only by providers whose reliability has been established by an official accreditation
process. This project also created another project for me, and that was
to make an HTML page. The Hyper Text Makeup Language will provide a
means to describe the structure of text-based information in a document
by noting certain text as links, headings, paragraphs, and so on.
OA #106
The Use of Robotics in Engineering Education
Carolyn D. Reynolds, Norfolk State University
Dr. Patricia Mead, Norfolk State University
The Norfolk State University Engineering Department is actively exploring
reforms in its undergraduate curriculum to enhance student learning. Active learning is a powerful pedagogy that engages students and enhances
retention of knowledge. The use of robotics kits, such as those created
by Vex robotics and Lego Mind-storms, has been implemented by many
programs to help students become more excited about engineering. The
robotics activities help to engage students and allow them an insight into
their careers as engineers.
The goal of this project is to implement a guided robotics assignment
that integrates design and building requirements for first-year engineering students at Norfolk State University. It is to also challenge students
to properly master certain skills such as critical thinking, team work with
individual accountability, engineering design, and basic programming. An
assessment of student attitudes and self-reported skills will be administered prior to and following the assignment. The results will be used to
A28
Program Book
guide future activities that would integrate robotics-based assignments in
other engineering department courses.
OA #107
Control System Fault Detection Using Monitoring and
Diagnostic Techniques
Chester Rodrigues III – University of Tennessee, Knoxville
Chester Rodrigues, South Carolina State University
In this research a SIMULINK model for the two-tank water level control
system was developed and a PID controller was designed to control the
water levels in both tanks during operation by adjusting the inlet flow
rates. Aside from the theoretical work, our research group fabricated a
new piping system and installed new components into the process flow
loop laboratory Two-Tank Loop (TTL) at the University of Tennessee (Knoxville). The process flow loop laboratory will be ran by LABVIEW software
interfaced with Virtual Instrumentation (VI) and ultimately control the systems such as the (CV, TFM) used to regulate temperature, pressure, flow
rate, speed and practically every other variable for which measurement
we desire. The operation condition of a plant must be fine tuned in order
to make the additional plant design produce to a desired target. These advanced monitoring techniques simulate everyday applications of Nuclear
Power Plants (LWR), Chemical Plants, Fossil Fuel Processes, and other advanced utilities used in today’s industry.
The new installed components consist of four manually operated control
valves (Bray Series), and three turbine flow meters. The valves and turbine
flow meters are operated electronically by LABVIEW software interfaced
with three data acquisition boards (DAQ) in order to produce optimal
readout. The four manually operated control valves will control the systems flow rate by inputting different voltage signals. In addition, the upgraded turbine flow meters will measure the flow rates. It is necessary to
monitor the functionality of these systems and components by identifying
the measurements that reflect the health of its equipment.
Prognostic methods were developed to predict the remaining useful life
(RUL), time to failure (TTF), and probability of failure (POF) in instrumentation and equipment. In this case, one can think of diagnosing conditions of plant components and systems by inputting data that characterizes fault detection. A brief example of fault detection can be as simple
as crud layer thickness deposited on a control valves inner tube walls.
This can be done by using empirical modeling techniques such as autoassociative kernel regression. These models give predictions of the sensor readings and compare them to the actual recorded data. This can be
used to discover degradation parameters that can be used for prognostics. Some of the techniques presented here are considered the modified
version of the general path model or using the Markov Chain model. These
techniques are extremely vital in industrial applications involving active
components.
OA #108
Renewable Energy Applications
Abdulaziz Sirag, University of the District of Columbia
Kafayat Olayinka, Dr. Esther Ossosanya, and Dr. Samuel Lakeou,
University of the District of Columbia
Hydrogen is one of the most promising fuels in the future energy mix.
When produced from renewable energy sources, hydrogen is the cleanest
fuel we have at our disposal. In addition, the only waste product from a hydrogen-fueled fuel cell is pure water vapor. In this research, we are using
Solar Powered Electrolysis of water to produce Hydrogen gas. Electrolysis
of water is an electrolytic process which decomposes water into oxygen
and hydrogen gas with the aid of an electric current. The electrolysis cell
consists of two electrodes (usually an inert metal such as platinum) sub-
Abstracts
merged in an electrolyte and connected to opposite poles of a source of
direct current. In this process we are using an existing renewable energy
source, the Solar/Wind Combo system, from a prior experiment, as current source. This makes the process carbon-neutral, or even carbon-free.
It contributes to reducing Green House Gas emissions and can reduce the
production of many toxic pollutants. The hydrogen produced is used to
power an existing prototype demo fuel cell generator that we have built.
The electrolysis method demonstrates continuous and abundant production of clean hydrogen on a sunny day. The other method we used to collect hydrogen is by adding Aluminum to a sodium hydroxide solution. By
combining the two methods together we observed a higher and prolonged
production of hydrogen.
OA #109
An Automated Configurable Processor Design System
Gerard Spivey, Howard University
Dr. Clay Gloster, Howard University
Configurable Computing (CC) systems, using one or more Field Programmable gate arrays (FPGA’s ) in conjunction with a microprocessor, outperform standalone microprocessors. The main problem in this research is to
reduce the time required to implement an application using a CC system.
CC system design requires an experienced engineer to manually write
thousands of lines of code using a hardware description language. The
time it usually takes for an engineer to design a CC system including the
testing phase can span 1-3 months depending on the complexity of the
project. The automated processor design system is intended to reduce
that amount of time to 1-4 weeks.
Our approach to the problem is to develop a toolset that automates configurable processor design. The toolset reads an algorithm written in C
and produces the thousands of line of code normally written by an engineer. Hence, the process of implementing an application on a CC system
becomes much more straightforward. With the automated design system,
users need not know hardware design techniques and/or details of the
syntax of specific hardware description languages.
In our experiments, we selected six application benchmarks. For each
application, we developed two implementations. The first, a software
implementation of the application written in C was executed on a typical
desktop computer. The second, a hardware implementation of the application was produced after submitting the same C code to the automated
configurable processor design system. Execution time was measured on
both systems and recorded for all application benchmarks. For each of the
benchmarks the hardware implementation was significantly faster than
its software counterpart. The benchmark that computes the magnitude of
a vector of complex numbers executed 13 times faster than the software
implementation on the microprocessor. This is significant, as the clock frequency of the microprocessor (2.7GHz) was much greater than that of the
CC system implementation (50Mhz on average).
OA #110
Design of a Nuclear Battery
Whitney Verner, South Carolina State University
Musa Danjaji, PhD., and Michael Collingwood, South Carolina State
University
The report covers the main components of a nuclear battery and my future project of building a thermoelectric nuclear battery. There are two
categories of nuclear batteries and many types under each category.
There should be many concepts that apply to actually understanding how
a nuclear battery works and have to be taken into consideration. Nuclear
batteries advantages are that they are environmentally, economically, and
prove to be very dependable. I plan to build the battery so that it creates
significant amounts of energy in order to provide power to a load. There
will be many concepts that will be applied to the foundation of building
a nuclear battery. The basic concepts are: Seebeck effect, Peltier effect,
Thomson effect, and Fourier effect. These concepts will be used to determine the voltage, energy, and many other factors to ensure I have a safe
and efficient design.
OA #111
Optical & Rheological Properties of Pre-Polymer Solutions
Nicole M. Walker, Tuskegee University
Dr. Tamara Floyd-Smith, David Baah, Dr. Melissa Reeves, and Dr. Kyle
Willian, Tuskegee University
The objective of this study is to investigate the rheological and optical
properties of polyethylene glycol diacrylate pre-polymer solutions. The
pre-polymer solutions may also contain dispersed titanium dioxide. Currently, the pre-polymer solutions are flowed through a microfluidic channel and UV-cured to create polymer films for optical applications. Gaining
a better understanding of the rheological properties of the pre-polymer
solutions should aid in optimizing the materials processing parameters
for preparing polymer films. Additionally, based on preliminary data, it
is expected that the optical properties of the pre-polymer solution and
cross-linked polymer will not vary significantly. Thus, investigating the optical properties of the pre-polymer solutions will provide direct insight into
the optical properties of the final material. Results from this study will be
discussed.
Applications implemented on the FPGA have been shown to be faster than
microprocessors. Specifically, it was my task to make the resource allocation section of the Automated Processor Design System more robust.
Resource allocation is where the system analyzes the algorithm written in
C, then finds core computations, and takes that data to create the lines of
hardware description language. Time was reduced to implement applications using the CC system. Users only need to submit an algorithm written
in C/C++ to use the CC system. This research can be considered a success
due to problems being met with an applicable solution.
Program Book
A29
Abstracts
Student Poster Abstracts
BIOLOGY
1
Silver Cluster Formation using Cytosine-Rich
Oligonucleotides
Oluwamuyiwa Abe, Allen University
Bidisha Sengupta, Jenna Buckman, Kerianne Springer, and Jeff Petty,
Furman University
The affinity of silver cations for DNA bases has enabled the creation of
short oligonucleotide-encapsulated silver nanoclusters without the formation of large nanoparticles. This work describes studies with oligonucleotides of cytosine, thymine and guanine. Absorption, fluorescence, and
circular dichroism spectroscopy are used to follow the formation of the
nanoclusters. Gel permeation (size exclusion) chromatography is used to
measure the size of the DNA-bound cluster. The temperature and pH effects were considered in order to discriminate the oligometric states of the
oligo. Using the size exclusion chromatography, we were able to observe
the different components of the oligonucleotides and were able to separate the DNA sample according to their sizes. Future work is to carefully
examine the structure of and different sizes of oligonucleotides.
2
The Affects of Metridium Senile on Larval Recruitment
Jerri Adams, Fort Valley State University
Dr. Sean Craig and Matt Nelson, Humboldt State University, Arcata,
CA
Metridium senile is a common sea anemone which may have important
effects on larval recruitment and early community development in marine
subtidal habitats. These sea anemones may eat larvae in the water column
as they attempt to settle, smother and kill newly recruited larvae when
they move or exude chemical substances (e.g. mucus) that larvae avoid.
In order to test these different alternatives, three different treatments, two
in the field and one in the laboratory, were designed. In the field, 40 artificial ABS plastic recruitment panels measuring 150 cm2 were deployed 1 m
below the floating docks at Woodley Island Marina in Humboldt Bay, CA.
On 10 of these panels, anemones were added to obtain 25% cover, 10 panels were covered (100%) with sea anemone mucus by roughly smearing a
large anemone over their surface. The remaining 20 blank panels served
as controls. These panels served to examine the effects of M. senile feeding and movement, and mucus secretion on settlement. Following one
week in the field, control panels were brought into the lab and housed
in flow through sea tables at the Telonicher marine lab. Roughly half of
these 20 panels had anemones added to them to obtain 25% cover. Because of the highly efficient filtration system at the Telonicher marine lab,
additional settlement on these panels was negligible. Therefore, the lab
experiment tested the affect of anemone movement (versus controls without anemones) on newly settled larvae. Panels with anemones in the lab
were photographed every day for one week. Results from the field showed
a higher level of recruitment to panels with mucus or anemones relative
to controls, suggesting that anemone presence may actually enhance recruitment of Botrylloides sp. (a colonial sea squirt) and Molgula manhattensis (a solitary sea squirt). Lab experiments suggested that smothering
by adult anemones causes significant mortality of newly recruited larvae.
In conclusion, predation by sea anemones may not be the most important
factor determining the patterns of larval recruitment in marine communities, and the physical structure of Metridium senile may help to entrain
larval recruits. [This work was supported by a grant from NSF/ HBCU-UP
awarded to Dr. Sarwan Dhir*, at Fort Valley State University].
A30
Program Book
3
Creation of a YopD Mutant to Study Type III Secretion
System in Yersinia Pseudotuberculosis
Emmanuel Adomfeh, SUNY University at Albany
Nikolai Cassanova, James Bliska, and Gloria I. Viboud, Stony Brook
University
Yersinia pseudotuberculosis is a gram-negative bacteria closely related
to Yersinia pestis, the causative agent of Black Death. However, Yersinia
pseudotuberculosis causes a much milder type of infection, restricted to
the mesenteric lymph nodes. Both species infect host cells by utilizing the
Type III Secretion System (TTSS). The TTSS is a syringe-like apparatus that
allows the bacteria to deliver protein effectors, known as Yersinia Outer
Proteins (Yops), across the plasma membranes of the host cell. The action of translocated Yops hinders the immune defenses of the host cell
by modulating different cellular pathways. YopD, along with YopB, mediates translocation by forming a channel for effector proteins to enter the
host cell. This process is thought to be modulated by the host cell GTPase
protein Rho. Thus, membrane damage caused by insertion of the translocation channel during infection is prevented by the inhibitory action of
one of the effector Yops (YopE) on the host cell Rho GTPase. To determine
whether YopD is involved in Rho activation, we created a yopD deletion
mutant by allelic exchange. A suicide vector carrying a DNA fragment with
homology to the upstream and downstream region of yopD was inserted
into a YopE- mutant of Y. Pseudotuberculosis by conjugation. The YopEDmutant (YP62) was obtained after two homologous recombination events.
We also inserted a plasmid containing YopD by conjugation (YP62/pyopD)
to complement the yopD gene deletion in YP62. To verify the phenotype
of the YopED-mutant and the complemented strain, a Yersinia infection
assay was performed in HeLa cell. This mutant will be used in further studies to elucidate the mechanism of regulation of the TTSS. [This research
was funded by a grant from the National Institute of Health (AI043389) to
James Bliska and by the NSF AGEP grant # HRD0450106].
4
Associating Single Nucleotide Poplymorphism Found
on AOAH Gene in Relation to Asthma Among African
Americans
Kelly Akah, Howard University
Emmanuel Jingwi, Howard University
Asthma is a chronic respiratory condition which effects individuals regardless of age, sex, or race. Asthma is caused by a complex interaction of
genetic and environmental factors and it is these factors that further influence how severe an individuals asthma is and how well one responds to
appropriate medication. In the study of asthma, our focus is centralized on
the single nucleotide polymorphism found in Acyloxyacyl hydrolase, commonly referred to as AOAH. AOAH is a 2-subunit lipase which selectively
hydrolyzes the secondary fatty acyl chains from the lipid A region of bacterial endotoxins. Enzymatically, deacylated lipopolysaccharides, (LPS), are
much less potent than lipopolysaccharides at inducing responses in human cells and thus can provoke the ability of LPS to activate human macrophages, neutrophils, and endothelial cells. This study focuses on this
correlation by analyzing ninety-six samples through a series of molecular
techniques: polymerase chain reaction and sequencing. Results are still
pending in our study.
Abstracts
5
Localization of Thioredoxin Peroxidase in Biomphalaria
Glabrata Part II
Edith Alvarez, University of the District of Columbia
Stephenna Knight, Milfred Standifer, Selamawit Mekonnen, Freddie
Dixon, and Carolyn Cousin, University of the District of Columbia
The albumen gland plays a role in both internal defense and reproduction
in the snail Biompharlaria glabrata. LAC A, a resistance strain, differs in
several reproductive features from NMRI, its resistant parent. A clone that
has a 78% similarity to thioredoxin peroxidase (TPx) in mice was found
in B glabrata. TPx is a natural killer enzyme found to be present in large
amounts in LAC A strain and relatively absent in NMRI strain of B glabrata
snails. This enzyme may be instrumental in the resistance phenotype
displayed by the LAC A snails. Using immunocytocemistry at the electron
microscopic level, the reproductive organs of the albumen gland and the
ovatestes were fixed in 2.5% glutaraldehyde and divided into a positive
control, negative control, and experimental group. TPx, the primary antibody, and goat anti-mouse IgG, the secondary antibody, were used with
the experimental group. At the electron microscopic level, gold-particles
were seen in the fundus of the albumen gland and in the proximal part of
the albumen gland duct and in the ovatestes of the experimental group.
TPx was not seen in the positive nor negative controls in the same regions
of these two organs. The enzyme TPx is closely associated with the two
major reproductive organs (albumen gland and ovatestes).
[This study is funded by UDC-AES and NSF funded HBCU-UP grant.]
6
Thymoquinone Inhibits Nuclear Factor-kappaB
Phosphorylation and Induces Death of Glioblastoma Cells
Keshia N. Avant, University of Virginia
Dr. Isa M. Hussaini and Zachary A. Kohutek, University of Virginia
Glioblastomas (GBMs) are the most highly aggressive astrocytic tumors
that are capable of invading extensively throughout the brain. They consist of populations of poorly differentiated neoplastic astrocytes, macroglia and trapped portions of normal brain structures. Genetic alterations
leading to changes in cell cycle regulation and growth factor signaling
transform astrocytes into a tumor phenotype. We investigated the effects
of Thymoqunione (TQ), derived from the medicinal plant Nigella sativa,
which exhibits anti-inflammatory and anticancer activities on the NF-kB
activation pathway induced by various carcinogens and inflammatory
stimuli. NF-kB is a pro survival transcription factor, widely used by eukaryotic cells as a regulator of genes that control cell proliferation and
cell survival. We found that NF-kB phosphorylation was induced by the
tumor promoting growth factor protein kinase C (PKC) activator phorbol
12-myristate 13-acetate (PMA). This led to potentiation of apoptosis induced by tumor necrosis factor and chemotherapeutic agents. Overall,
our results indicated that the anticancer and anti-inflammatory activities
previously assigned to TQ may be mediated in part through the suppression of the NF-kB activation pathway and thus may have potential in treatment of GBM’s.
7
Detection of Human Pathogens from Discharge of
Wastewater Treatment Plant Effluent in Port Jefferson
Harbor Waters, Sediment, and Air
Alejandro Avilés, University of Puerto Rico-Humacao
Alexandra Valdés and Josephine Aller, School of Marine and
Atmospheric Sciences Stony Brook University, NY
After wastewater treatment processing, the effluent product still contains
measureable numbers of pathogenic organisms. These include bacteria
and viruses that survived the different treatment stages. Many of these
pathogens enter coastal waters potentially becoming the source of many
illnesses. Both viruses and bacteria have been found in sediments, water
and aerosol samples in the Port Jefferson Harbor. Viruses were concentrated from water samples using two filtration methods: Tangential Flow
Filtration (TFF) and Adsorption-Elution (AE). Aerosols were analyzed after
collection using the SKC BioSampler into glycerol. Organisms associated
with bottom sediments were analyzed after resuspension with sterile seawater. Abundances of both bacteria and viruses were determined by total
direct counts using epifluorescence microscopy following staining with
SYBR-Gold. Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR)
was performed to detect the presence of enteroviruses, and the Readycult
Coliform 100 test was used to detect the presence of total coliform bacteria. Viral-like particles (VLPs) in water ranged from 1.08 x 108 to 1.374 x
109 per mL, while bacteria ranged between 2.211 x 106 to 4.394 x106 per
mL. Though enteroviruses were detected in sludge samples, none were
detectable in Harbor water samples. The presence of total coliforms and
E. coli were found when samples were taken at low tide but no coliforms
were detected at high tide. Even though VLPs were present in the water
we were unable to detect Enteroviruses at either of the two sampling
sites. VLPs, bacteria, and eukaryotes were collected in aerosol samples
although we did not determine whether they were natural marine organisms or possibly pathogens.
8
The Lack of p53 Tumor Suppressor Effects in LNCaP was
Associated with FOXO3a Hyperphosphorylation
Chiedozie J. Ayika, University of the District of Columbia
Katerina Mezhevaya, Meera Srivastava, and Yelizaveta Torosyan,
Uniformed Services University of the Health
Deepak Kumar, University of the District of Columbia
Shiv Srivastava, Center for Prostate Disease Research
Our previous study on apoptosis detection assays and cell cycling showed
that p53 failed to match programmed cell death (PCD), and cell growth arrest that were induced by ANXA7 in androgen-responsive prostate cancer
cells (LNCaP). Cell cycle regulator p53 is known to phosphorylate FOXO3a
that can affect its nuclear localization and suppress FOXO3a transcription,
thereby preventing the FOXO3a-induced cell cycle arrest and apoptosis.
By using Western blotting, we studied the expression of both (phosphorylated and total) FOXO3a in response to ANXA7 and p53 in LNCaP cells
transfected with Ad-Easy vectors containing ANXA7 or p53 insertions versus vector alone (used as control). In p53-transfected LNCaP cells with the
reduced PCD and cell growth inhibition, p53 did not change total FOXO3a
expression, but upregulated its phosphorylated fraction that implied a predominantly cytoplasmic FOXO3a localization. In contrast, ANXA7 (which
displayed tumor suppressor effects in LNCaP) did not essentially affect
either total or phospho- FOXO3a expression that suggested a maintained
nuclear localization of FOXO3a with intact FOXO3a-induced proapoptotic
transcription. Thus, hyperphosphorylation of FOXO3a by p53 could prevent the FOXO3a nuclear localization and proapoptotic FOXO3a transcription that was consistent with the lack of p53-induced apoptosis in LNCaP
cells. On the other hand, the maintained non-phosphorylated fraction of
Program Book
A31
Abstracts
FOXO3a implicated the FOXO3a-induced apoptosis in ANXA7 tumor suppressor effects in androgen-sensitive prostate cancer cells (LNCaP).
Acknowledgement: This study was part of the UDC-CPDR program funded by the DoD Prostate Cancer HBCU Student Summer Training Program
Award # PC073564
9
Function of JNK1 Signaling Pathway in Zebrafish
Development.
Marshall Bailey, Langston University
Daniel S. Wagner, Rice University
The aim of our research is to understand the role of JNK1 signaling pathway in the embryonic development of zebrafish, Danio rerio. Understanding the function of JNK is important because the mechanisms that regulate embryonic development in the zebrafish also regulate development in
human embryos. JNK is a kinase that phosphorylates a diverse set of proteins including the transcription factor c-Jun, and likely regulates multiple
embryonic processes. Therefore, we hypothesize that JNK is essential for
understanding the embryonic development of Danio rerio. Wild-type cDNA
of the zebrafish JNK1 and it’s upstream regulators MAP2K4a and MAP2K7
were isolated from standard PCR methods and gel electrophoresis. The
purified products were cloned and sequenced to confirm their identity.
cDNA containing the open reading frame for each gene was cloned into
PCS2+, a plasmid designed for efficient in vitro mRNA production. A dominant negative form of JNK1 (DN-JNK) was created by site directed mutagenesis and mRNA was produced by in vitro-transcription reaction. This
RNA was microinjected into developing zebrafish embryos for analysis
and observation of the resulting phenotype.
10
Quantification of Maternal Behavior following a Neonatal
Stress Paradigm in Stressed Mouse Pups versus their
Litter Mates
Isis Bonney, Morgan State University
Aaron Newby, Yahya Wada, Amber B. Hodges, PhD, Christine F.
Hohmann, PhD, Morgan State University
Early maternal separation has been shown to produce changes in the hippocampus and other brain structures. Previous studies have shown that
maternal separation, which includes both neonatal handling and maternal deprivation, can induce changes in brain structures and behavior in
adulthood. Maternal deprivation has been reported to alter synaptic pruning and hippocampal development, increase stress reactivity, and impair
cognitive behavior in adult mice. Conversely, neonatal handling induces
enhanced hippocampal development and hippocampal dependent learning, decreases stress reactivity in adulthood, and facilitates cognitive behavior in adulthood. Previous research in the Hohmann laboratory investigated the effects of early stress on cognitive performance in adulthood
in Balb/CbyJ mice. A split litter design was used in which half of a litter
was exposed to early maternal separation/temperature stress (STR) for
one hour on postnatal days 2 through 7 (PND 2 through PND 7), while
their littermate controls (LMCs) remained with the dam. In adulthood, STR
mice displayed impairments on the open field object recognition (OFOR)
task, a cognitive task which measures spatial and novelty memory; however LMC also showed altered behavior. Studies report that changes in
the early environment (i.e. early stress and maternal environment) can
induce cognitive changes in adulthood. Therefore, our lab was interested
in quantifying maternal care behavior received by STR versus LMC during
the neonatal stress period. We hypothesize that the STR pups will receive
increased maternal behavior compared to the LMC pups. The litters were
divided into STR and LMC and maternal behaviors were video recorded
A32
Program Book
before and after the neonatal stress period. An additional group of age
matched control (AMC) mice was used as an additional control group.
11
TRIP Expression in the Adult Rat Brain
Andrea Branch, University of Arkansas at Pine Bluff
Dr. Sandra L. Petersen, University of Massachusetts
Previous studies have shown that the rostral Anteroventral Periventricular
Nucleus (AVPV) of the hypothalamic preoptic area (POA) of the brain is
sexually dimorphic and consists mainly of GABA/Glutamate neurons. The
female AVPV has approximately three times the number of GABA/Glutamate as in males. TRAF Interacting Protein (TRIP) gene expression is highly upregulated in the male GABA/Glutamate neurons via the derivative of
testosterone, estradiol (E2) and stimulates the apoptosis. It is unknown
whether TRIP is expressed in adult brain. My hypothesis is that since TRIP
inhibits the cell survival in the postnatal male brain, then TRIP will not be
expressed in the adult rat brain. For my study, I used in situ hybridization
in sections of rat pups postnatal day two and adult brains from the AVPV
region. Interestingly, I found TRIP gene expression in the adult rat brain,
nevertheless, the postnatal rat brain still exhibited more TRIP expression.
This opens up the possibility that the TRIP gene is involved in other functions, or apoptosis is still present in adult the AVPV region.
12
Blood Phsyiology of Blue x Channel Hybrid Catfish at
Three Stocking Densities During the Summer of 2007.
Ravin Byrd, Mississippi Valley State University
Rachel Beecham, Doug Minchew, and Susan LaBarre, Mississippi
State University
Osmolarity, blood urea nitrogen, lactate, glucose, magnesium, calcium,
chloride, sodium, potassium, SO2, HCO3, partial pressure of oxygen
(pO2), pCO2, and ph were measured in whole blood of 450 blue x channel
hybrid catfish (Ictalurus punctatus) from 30 one acre ponds at Stoneville Agricultural Research Center. The fish were observed at three different stocking densities including 4330, 6490, and 8650. The samples were
collected from May 2007 to July 2007 to measure monthly fluctuations.
The fish were collected with standard rods and reels with catfish bait. The
blood values were higher for osmolarity, calcium, sodium, and po2 for
the 4330 stocking density. The blood values were higher for lactate, glucose, magnesium, potassium SO2, HCO3, and pCO2 for the 8650 stocking
density, and higher for blood urea nitrogen and pH for the 6490 stocking density. Monthly mean values for lactate and pH showed a gradual
increase for all three months under all three stocking densities. Values for
osmolarity, calcium, sodium, SO2, pO2, and pCO2 each showed a gradual
decrease for all three months under all three stocking densities. Blood
urea nitrogen, lactate, glucose, magnesium, chlorine, and HCO3 each
showed fluctuations with no major increasing or decreasing trend. These
data were collected for further research on the blood and health of the
hybrid species.
13
Informatics to Improve Clinical Brain Magnetic Resonance
Spectroscopy
Kenta Caldwell, Langston University
Dee H. Wu, PhD, The University of Oklahoma Health Sciences Center
Magnetic Resonance Spectroscopy (MRS) Imaging is an analytical technique that radiologists use to gain information about biological chemicals
in the body, in this case the brain. In this particular project, MRS images
from brain cancer patients were collected from several research papers
Abstracts
for an informatics meta-analysis; furthermore, from these sources, a Meta-analysis will be conducted for brain tumors. The primary goal of this
project was to standardize information from different sources and to provide standardized information to differentiate between different glioma
grades.
Our lab has developed specialized software to extract metabolite information from several MRS images. We used specialized informatics software
designed in the lab to go through all of the relevant articles, which are
available in PubMed, to extract metabolite information from several MRS
images in goal to create standardized information to many different types
of brain tumors.
Informatics Methodology provides better information for clinicians to
evaluate our clinical MRS exams.
We created Confidence intervals for Brain Glioma MRS Data. This information was useful in improving our clinical services as it was able to provide
us with the baseline expectations from the literature which will help us
compare our results with these baselines.
14
The Modulation of the Induced Oxidative Stress Response
of Saccharomyces Cerevisiae by Herbal Formulations of
Essiac
Conner Carter, Abraham Baldwin College
Sheriff Phaal, Atlanta Metropolitan College
J.A.P, PhD, McCrary, Darryl Miller, and Jessica Williams, Albany State
University
Essiac is a widely used herbal formulation sold as a nutritional supplement. It has been alleged as beneficial in several health conditions, including cancer. Few scientific investigations have been conducted to examine the possible mechanism(s) through which this herbal preparation
may exert its supposed positive health effects. In this investigation, the
effects of selected Essiac preparations on modulation of an induced oxidative stress response in the yeast, Saccharomyces cerevisiae, was evaluated. The oxidative stress response induced by heat, sugar and complex
mixtures was assessed using cell viability and mitochondrial functionality
studies. Green tea, an herbal tea known to protect cells against oxidative
stress through a variety of metabolic interactions, was used as a reference
control. Preliminary findings suggested that the Essiac preparations used
in this study may promote differential levels of protection against induced
oxidative stress which varies according to concentration. The overall
trends observed suggested that these Essiac preparations may possibly
exert their reported health effects through modulation of the cellular response to oxidative stress. Additional studies are in progress.
15
Creation of Yersinia Pseudotuberculosis YopD Mutation
Library Using Error Prone Polymerase Chain Reaction
(PCR)
Nikolai Gauntlet Cassanova, SUNY University at Albany
Dr. Gloria Viboud, Stony Brook University
Emmanuel Adomfeh, SUNY University at Albany
The Identification of single point mutations in YopD Gene that impair Yop
translocation
Yersinia pseudotuberculosis is a gram negative bacteria that causes diseases in animals and humans. Yersinia produces a type three secretion
system (TTSS) to deliver toxins into the host cell. The TTSS comprises
a needle like structure, three “translocator” proteins (YopB, YopD and
LcrV), and six “effector” proteins (YopE, YopH, YopJ, YopO, YopM, YopT)
that act to disarm the host immune system. To identify residues in YopD
that are required for translocation, we created a YopD mutation library
using error-prone Polymerase Chain Reaction (PCR). We expect to create
a single point mutation per kilo base-pair for the YopD gene encoded in
the plasmid pMMB67HE. We will then use our mutated YopD gene from
pMMB67HE as megaprimers for our EZClone reaction. During the EZClone
reaction the megaprimers are denatured then annealed to the original
pMMB67HE plasmid and then extended. The significance of doing this
is that by making mutations in the YopD gene of Y. pseudotuberculosis
we can understand how the TTSS translocon works and would potentially
lead to the discovery of novel antimicrobials.
16
Determining the Most Effective Human Adenovirus That
Can Be Used to Kill Cancerous Cells
Karissa Cave, University of the Virgin Islands
Michael A. Thomas, PhD, Wake Forest University
Currently, there are three options that can be used to treat cancer – chemotherapy, radiation therapy, and surgery - that are either toxic or invasive. Therefore, a need for a less invasive and non toxic method to treat
cancer is critical. In clinical trials, adenoviruses have been proven to be
safe, showing minimal toxicity. An adenovirus is a non-enveloped virus
that is composed of a nucleocapsid and a double stranded linear DNA
genome that is responsible for upper respiratory infections. Additionally,
adenoviruses’ unique ability to selectively kill cancer cells made it an excellent candidate to treat cancerous cells.
Even though adenoviruses are found to be effective at killing cells in
culture, there are aspects that can be improved. In this experiment, we
compared eight mutant adenoviruses to determine which would be most
effective in killing HeLa cells. Based on the information that was acquired
from reading several papers, I hypothesized that dl1520 would have been
the most effective adenovirus used to kill HeLa cells compared to the others used in the experiment. Graphs were made to compare the percent of
infected cells that were still alive after pre-determined hours. The results
illustrated that my hypothesis was false and that dl1005 was most efficient
in killing the infected cells. A P-value (.03) was determined, which showed
that the percentage viable cells between the dl1520 and dl1005 were significant; meaning dl1005 can be a better candidate in treating cancerous
cells. [Acknowledgements: Dr Michael Thomas, mentor,NSF HBCU-UP Program, MARC Program – NIH, John-Holloway-Bryan Foundation,University
of the Virgin Islands – ESC Program]
17
Assessing Plasma GLP-1 Concentrations & Associations
with Insulin Secretion in Patients with Type 2 Diabetes
Acutely Following Bariatric Surgery
Chanel Cobey, Albany State University
Dr. Edward Lin and Dr. Nana Gletsu Miller, Emory University School of
Medicine
GLP-1 is a gut hormone released from the L-cells that stimulates glucose
dependent insulin secretion and augments pancreatic beta cell mass.
Other research studies have shown that GLP-1 also inhibits gastric emptying, gastric acid, and glucagon secretion; and is also involved in inducing satiety. Since GLP-1 is involved in insulin secretion; decrease in GLP-1
secretion is hypothesized to be a major contributor to diabetes. Because
the peptide also reduces circulating levels of glucose both in patients with
normal glucose levels and in subjects with type II diabetes, GLP-1 is now
being used for management of diabetes. Endogenous GLP-1 is rapidly
degraded by the catalytic activity of the protease dipeptidyl peptidase-IV
(DPP-IV). We have shown that at 2 years following bariatric surgery, the
plasma concentrations of GLP-1 increases. Very little data exists on acute
Program Book
A33
Abstracts
changes in GLP-1 post surgery. In this research study we used recently
available blood collection tubes which contain DPP-IV inhibitors to preserve GLP-1 (P700, BD Diagnostics, Franklin NJ). The objective of this experiment is to measure GLP-1 using the new blood collection tubes and to
assess associations with insulin secretion. It is predicted that the GLP-1
hormone will increase along with increases in insulin secretion. Plasma
concentrations of GLP-1 & insulin were measured using enzyme-linked
immunosorbent assays (ELISA). Ongoing study measurements will also
be obtained at 6 and 24 months following restrictive and malabsorptive
weight loss surgery. The research concluded that it is possible to measure GLP-1 at early time points using P700 blood collection tubes and that
GLP-1 may be associated with insulin secretion.This is an essential concept because establishing these mechanisms will aid in understanding
the physiology of GLP-1 following weight loss surgery, and also assist in
development of GLP-1 therapies for diabetes treatment.
18
Response of a Non-Hyperaccumulator, Alyssum
montanum, to Variation in Soil Nickel
Tyrone Dash, Howard University
Mary McKenna and Iman Sylvain, Howard University
Previous research (Sylvain and McKenna, 2007) has demonstrated that
nickel plays a powerful role in influencing seedling fitness in the nickel hyperaccumulator, Alyssum murale. This study aimed to study the response
of a congener, Alyssum montanum, to varying levels of soil nickel. Like
Alyssum murale, Alyssum montanum is native to the Mediterranean region of Europe and parts of eastern Europe. Unlike Alyssum murale, Alyssum montanum does not grow on serpentine soils and it is not a nickel
hyperaccumulator. The purpose of this study was to enable comparison
of the seedling growth response to soil nickel of these two closely related
species, one serpentine hyperaccumulator and one non-serpentine, nonhyperaccumulator. A series of soil nickel levels were created by adding
nickel to commercial soil mix (Sunshine Mix #3) to produce the following
concentrations: 0, 10 ppm, 50 ppm, 200 ppm and 500 ppm. Nickel was
added as a 1:1 ratio of nickel acetate and nickel sulfate to avoid the pH
changes that would occur by adding nickel chloride or pure nickel sulfate.
Each of the soil nickel treatments contained 100 2" square pots. Alyssum montanum seeds were planted singly in each pot. Pots were placed
randomly in flats on a greenhouse bench, and all pots were watered and
rotated daily. Germination was monitored daily for the first three weeks,
and seedling height and leaf number were measured at periodic intervals.
After six weeks, shoots and roots were harvested and dried in a laboratory
oven at 70 degrees Centigrade for 48 hours. Shoot and root biomass were
measured for seedlings in all soil treatments. The germination results
clearly showed that A. montanum cannot tolerate elevated soil nickel levels. The germination percentage in soil without nickel was 71%; germination in soil with 10 ppm Ni was 66% ; germination in soil with 50 ppm Ni
was 7% and no seedlings germinated at higher nickel levels (200 and 500
ppm). There was no significant difference in seedling height or numbers
of leaves per seedling in soil without nickel and soil with 10 ppm nickel.
Biomass values will also be obtained. These results indicate that Alyssum
montanum responds very differently than Alyssum murale to soil nickel
levels. Normal soils generally contain a nickel in the range of 0-40 ppm;
serpentine soils generally contain nickel in the range of 2000 ppm to 5000
ppm. It is likely that an inability to tolerate elevated soil nickel is an important factor explaining the absence of this species on serpentine soils.
Other factors may also be important, since serpentine soils also generally
have low soil fertility and elevated Mg/Ca ratios that can lead to magnesium toxicity.
[Funded by NSF-Award # 0405151-UMEB-Environmental Biology Scholars
Program, Mary A McKenna, PI]
A34
Program Book
19
Preparation of Aqueous Leaf Extract of Ocimum
gratissimum and Selection of Solvent Developer for its
Thin Layer Chromatographic Separation
Ariel Dawkins, Jackson State University
Stephen I.N. Ekunwe, Jackson State University
Ocimum gratissimum (Og) is an edible medicinal herb. In earlier in-vitro
studies, Dr. Stephen I.N. Ekunwe and his group showed that aqueous
Og leaf extract inhibits growth of cancer cells. The objective of this work
was to obtain aqueous Og extract and determine the best solvent for its
separation on silica gel thin layer chromatographic (TLC) plates. In a 1L
flask, 50g Og powder was extracted with 500mL distilled water in an orbital shaker for 2h at 100 rpm (revolutions per minute) at 27°C. The supernatant was collected in a 2L flask. This process was repeated twice
with 250mL distilled water. The Og extract was centrifuged at 5,000 rpm
at 4°C for 10 minutes to obtain a clear, dark, brown liquid. By rotary evaporation, Og extract was concentrated. A mixture of 100% ethanol and 3-4
drops glacial acetic acid was empirically determined to be the most suitable developer for TLC separation of the Og extract. Fifty milligrams of the
concentrated Og extract was re-dissolved in 500µL distilled water. With an
ultra-fine capillary tube, the re-dissolved Og extract was spotted on TLC
plates and developed in the solvent developer. For results, a dark brown
sticky Og extract was obtained. Also, the TLC plate resolved the Og extract
into a single band. In conclusion, we accomplished our goal of obtaining
aqueous Og leaf extract and selecting a solvent developer for its TLC separation. [Acknowledgements: This research was supported by the STARGE/
NSF HBCU-UP program at Jackson State University.]
20
Analysis of Nicotine’s Effect on Rapid Dopamine Release
in the Striatum
Emmanuel Dowuona, Morgan State University
Dr. R. Mark Wightman and Nii A. Addy, University of North Carolina at
Chapel Hill
Recent studies show that repeated exposure to nicotine can have a direct
effect on the mesolimbic dopamine pathway. This pathway begins in the
ventral tegmental area (VTA) and sends increasing signals to the nucleus
accumbens (NA) and the prefrontal cortex, respectively (Laviolette and
van der Kooy, 2004). Carbon-fiber microelectrodes, with dimensions of
less than 5µm, can be used to monitor dopamine changes in the striatum
and nucleus accumbens of rats on a 100 millisecond time scale (Heien and
Wightman, 2006). FSCV experiments were performed in urethane anesthetized male Sprague-Dawley rats who had previously received saline
injections several minutes prior to injection with nicotine. We electrically
stimulated the dopamine-containing neurons in the VTA of the rats and
monitored the resulting dopamine response in the nucleus accumbens.
First, we characterized the baseline dopamine responses to stimulations
at frequencies from 10 to 60 Hz and pulses of 4 to 24. With the increase
in frequency, there was less time for dopamine uptake to occur, thus increasing the amount of dopamine in the extracellular space whereas, an
increase in the pulse number led to more dopamine release events, which
in turn, led to a larger dopamine signal. We used FSCV at carbon fiber microelectrodes to determine whether nicotine administration in rats alters
the rapid dopamine responses in the nucleus accumbens that are a direct
result of firing of dopamine in the ventral tegmental area (VTA). Using 24
pulses, we compared nicotine’s effects on the mesolimbic dopamine pathway using stimulation frequencies of 20 and 60 Hz. The results showed
that at the lower frequency (20 Hz), there was no significant variation in
dopamine release, however at 60 Hz, dopamine release was half its initial
amount prior to the nicotine injection. Future work will involve using different frequencies to determine if and why this relationship persists.
Abstracts
21
The Microbial Quality of Air in the Biology and Chemistry
Building at Howard University
Emmanuel Ekanem, Howard University
Brodrick Eribo, Howard University
The purpose of this study is to collect microbial air samples from the biology and chemistry building at Howard University. These buildings are currently undergoing extensive renovation while still in use. Previous studies
have shown that the agitation and exposure of aged building structures
tend to have negative effects on the indoor microbial air quality. The most
common airborne microbes in aged buildings are fungi such as Cladosporium, Penicillium, Aspergillus, Stachybotrys chartarum and bacterial
species. Exposure to these microbes has been reported to cause several
types of human health problems such as irritations, infections, allergies
and toxic effects. The first phase of this study will be the enumeration of
fungi. In order to accomplish this goal, Brain Heart Infusion CC and Potato
Dextrose Agar will be used to select for pathogenic fungi. The isolates will
then be identified through careful examination of their reproductive structures. The next phase of the study will be the collection and characterization of bacterial samples using Nutrient agar. Several biochemical tests
will be utilized to identify the bacterial isolates. The fungal and bacterial
samples will then be quantified and compared to samples from control
buildings to determine if there are any variations in microbial concentration. The results obtained from this study will be compared to previous
data collected from similar studies to determine if there is any possible
variation in the microbial air quality. These variations could indicate potential health risks to the current inhabitants of the buildings in question.
22
Cyclooxygenase Assay of Hypertensive Rat Hearts
Freddie Eskridge, Tuskegee University
Dr. Kyle Willian and Lashawndra Lawrence, Tuskegee University
Cardiovascular disease is one of the leading killers of Americans and affects African Americans more than any other ethnic group. Cyclooxygenase
(COX) is an enzyme that is a biological mediator for prostaglandin found
in inflamed tissues. Increased activity of the COX-2 isozyme has been associated with an increased risk of cardiovascular disease. Diets high in
antioxidants and other phytochemicals, however, are known to ameliorate
cardiovascular disease risks.
The main objective of this study therefore, was to determine the amount of
COX-2 activity in the heart tissue of hypertensive rats fed diets containing
greens, common in the African American diet. If the percentage of COX-2
inhibition is lower in the modified diets than in the control diet, then the
addition of the greens may lower the risk of cardiovascular disease. Rats
(n=10 per group) were fed one of four different diets over a three-week
period: a normal ANI-76 rat food control and ANI-76 supplemented with
either 4% purslane, collard greens, or sweetpotato greens. At the end of
the three weeks, the rats were killed and heart tissue was collected and
COX activity was subsequently assayed using commercial enzyme kits.
23
Characterizing the Stress Phenotypes of Common
Phylogenetic Groups
determine specific stress tolerance phenotypes. Strains of V. splendidus
were characterized to identify how their stress phenotypes correlate with
phylogenetic divergence. This fundamental research aids in understanding the extent of phenotypic diversity naturally occurring in the environment and how indigenous organisms adapt to changing conditions in their
environment. The fact that some Vibrio strains can be pathogenic might
also provide deeper insight into water borne diseases.
24
The Effect of an Aniline Analog on the Glucose-6Phosphate Dehydrogenase Activity in Male Rat
Erythrocytes
Kristina Grant, Savannah State University
Elissa T. Purnell, Ph.D., Savannah State University
Glucose-6-phosphate dehydrogenase (G-6-PD) is an important erythrocytic enzyme. As a vital component in the pentose phosphate pathway,
this enzyme helps supply reducing energy to erythrocytes by maintaining the level of the co-enzyme NADPH. The NADPH subsequently maintains the level of glutathione in red blood cells and helps protect against
oxidative damage. Deficiencies in this enzyme are more prominent in
males due to a X-linkage. Males of African, Asian, and Mediterranean
descent are commonly afflicted with this condition and are more susceptible to hemolytic episodes. The objective of this project was to assess
the activity of G-6-PD in erythrocytes from male rats exposed to an aniline analog. Whole Sprague-Dawley blood was purchased commercially
(Valley Biomedical Products and Services). Blood was washed (x3) with
50 ml of phosphate buffered saline supplemented with glucose (PBSG,
pH 7.4) and centrifuged to yield a population of packed red blood cells
(PRBCs). Aliquots of PRBCs (1 ml) were incubated with 100, 200, or 300
µM of para-fluoro-phenylhydroxylamine or acetone (control) for various
time periods. Total hemoglobin was obtained by mixing 10 µl of control
and treated blood with 5 ml of Drabkin’s reagent. The resulting solution
was incubated for 15 minutes before 1 ml samples were placed in clean
cuvettes and read at 540nm. Linear regression was used to convert the
absorbance values to hemoglobin concentrations. Glucose-6-phosphate
activity was determined using a commercially available G-6-PD kit. One
ml of G-6-PD Assay solution was mixed with 10 µl of control and treated
samples. After 10 minutes, 2 ml of G-6-PD Substrates solution was added
to the tubes, which were placed in a 37˚C water bath for 5 minutes to
attain thermal equilibrium. One ml aliquots from each treatment group
were placed in clean cuvettes and read at 340nm for the initial reading.
The remaining portion of the samples were put back into the water bath
for an additional 5 minutes before another 1 ml sample was removed and
placed in the spectrophotometer for the final reading. Enzyme activity was
calculated using an equation provided in the kit. In brief, the initial absorbance was subtracted from the final absorbance and divided by 5 (time in
minutes). These values, along with the total hemoglobin concentrations,
were substituted into the equation to arrive at the G-6-PD activity associated with each sample. The enzymatic activity in cells exposed to acetone
at time zero was 30.83 U/g Hb. Cells exposed to the aniline analog demonstrated a steady decline as aniline analog concentration increased from
100 µM to 300 µM at time zero (23.91, 23.77, and 16.77 U/g Hb respectively). Enzyme activity levels in cells treated with varying concentrations
of chemical displayed fluctuations over time. In conclusion, alterations in
G-6-PD activity may expose the cells to oxidative damage, triggering their
premature removal from circulation.
April Gillens, North Carolina Agricultural and Technical State
University
Eric Alm and Arne Materna, Massachusetts Institute of Technology
To understand microbial niche adaptation in marine environments, various strains of the bacterial species Vibrio splendidus (found in ocean water) were grown under gradually changing salinity and temperatures to
Program Book
A35
Abstracts
25
Effects of DNA Vaccines for Autoimmune Diabetes on
Stress and NF-κβ Responses in Cultured Dendritic Cells
and Fibroblasts.
Jesseca M. Gray, Johnson C. Smith University
Alan Escher, Jeffrey Chen, and Alice Li; Center for Transplant
Immunology Research, Loma Linda University School of Medicine
and Medical Center
Diabetes type 1 is a result of autoimmunity where the immune system
destroys the insulin-producing pancreatic beta cells. Individuals with the
disease cannot produce insulin and show high blood glucose leading to
increased morbidity and mortality. Our laboratory has previously reported
the development of a new plasmid DNA vaccine strategy for the prevention and therapy of spontaneous autoimmune diabetes in NOD mice. The
strategy requires that plasmid DNA encodes the pro-apoptotic protein
BAX and the pancreatic β-cell antigen glutamic acid decarboxylase (GAD).
Furthermore, our results show that DNA vaccines coding for a secreted
form of GAD (SGAD55) prevent diabetes and induce an immunoregulatory response, but that, in contrast, DNA vaccines coding for the wild-type,
cytosolic protein (GAD65) do not prevent diabetes and are pro-inflammatory. Results also indicate that cells transfected with SGAD55-BAX contain
lower amounts of GAD antigen compared to cells transfected with GAD65BAX. We hypothesized that the lower amounts of GAD in SGAD55-BAXtransfected cells did not induce a stress response that could be sensed
as a pro-inflammatory danger signal, and which might explain the proinflammatory nature of the GAD65-BAX vaccine in NOD mice. Here, we
investigated the effects of plasmid DNA vaccine coding for BAX alone,
GAD65-BAX, and SGAD55-BAX on stress and inflammation in dendritic
cells and fibroblast cultured in vitro using a luciferase cDNA under transcriptional control of the heat-shock element and NF- κβ promoters.
26
The Relationship between HIV and the Cellular Protein
Sprouty2: Does Spry2 Help in the Release of Virus-Like
Particles?
Erica Green, Allen University
Carol Carter, Min-Huei Chen, Gisselle Medina, Lorna Ehrlich, Stony
Brook University
A chimeric protein is created through the joining of two or more gene
products. The relationship between the Human Immunodeficiency Virus
(HIV) protein Gag and the cellular protein Sprouty (Spry2) was investigated by creating chimeric proteins consisting of an assembly-defective Gag
mutant, P7L, fused to Spry2 or mutants of Spry2. P7L-Gag encodes a point
mutation in the late domain, which inhibits the release of the virus. Spry2
seems to participate in the late stages of virus budding. The purpose of
the experiment was to determine whether the cellular protein Spry2 helps
the virus to exit from cells. This report describes the construction of P7L
fused to Spry2 in which the amino acid Arginine 252 had been mutated to
Aspartic acid (R252D) to test the hypothesis that cellular protein Spry2
helps the virus to exit from cells. Cultures of E. coli containing the plasmid
encoding P7L-Gag-GFP or the Spry2 mutant were grown. The restriction
enzyme BamH I was used to linearize (open) the P7L-Gag-GFP DNA, and
the polymerase chain reaction (PCR) was then used to amplify the Spry2
gene and to add BamH I restriction sites to its 5' and 3' ends. DNA analysis
to ensure the presence of fragments of the correct size was done through
examination of the reaction products in an agarose gel. The anticipated result is to create P7L-Spry2-R252D-GFP, introduce it into mammalian cells
(Cos-1), and determine through the use of the confocal microscope or by
Western blotting whether or not Spry2 will rescue the release of viruslike particles. The construct of chimeric proteins, cloning, and transfection
were all successful. Answering the main question of whether or not Spry2
A36
Program Book
helps in the release of VLPs. The answer is no, because results show the
mutant form Spry2 R252D cannot help virus-like particles exit from cells,
therefore suggesting that for Spry2, this mutant (Spry2 R252D) affects the
VLP release efficiency. Further research will have to be done in order to
clearly understand in detail why Spry2 R252D stops the release of VLPs
for a major HIV breakthrough.
27
Forensic Testing of Synthetic Blood Substitutes
Sarem Hailemariam, Shaw University
Renata Dusenbury, Shaw University
There has been an increasing need for oxygen carrying blood substitutes
around the world. The ideal blood substitute would drastically lower the
cost of transportation and storage as well as function much like whole
blood. Fortunately, there has been some progression in the research of
manufacturing a safe blood substitute that could be used clinically. Biopure Corporation has released two products that are paving the way for an
oxygen-carrying blood substitute available for use in United States. Their
product, Hemopure, has already been approved in South Africa, and in use
in treatment of adult surgical patients who are acutely anemic. It is “ultra
purified glutaldehyde-polymerized bovine hemoglobin in balanced electrolyte solution,” whose molecular structure is similar to that of human
hemoglobin. Even though Hemopure has been approved for use in South
Africa, it is still undergoing clinical trials in the United States of America
for potential human use. However, Biopure does have another blood substitute that is the first and only oxygen therapeutic to receive marketing
clearance from the United States Food and Drug Administration (U.S. FDA)
and the European Commission for veterinary use, Oxyglobin. This product
is used in the treatment of canine anemia. It is stated that Oxyglobin is
“an ultra pure solution of highly polymerized bovine hemoglobin that has
almost identical properties as Hemopure”. With the prospect of artificial
blood products being available for public use very soon, the premise of
the proposed research is to determine what effect, if any, synthetic blood
substitutes, will have on forensic tests for blood. It is predicted that when
it is transfused whole or mixed with blood substitutes mainly modifiedhemoglobin oxygen carrier products, there will be an enhanced reaction
from serological presumptive tests.
From previous research it has been concluded that luminol is the most
sensitive presumptive test for blood and is capable of having positive results for blood in the smallest dilutions of blood. In the completion of this
research two catalytic color tests, Kastyle-Meyer test and Leuco crystal
Violet, and one chemilumicescencent test, luminol, would be performed.
Ultimately, spectrophotometric assay will be developed to determine the
intensity of each positive reaction for blood with each presumptive test.
28
Using Saponified Spent Oil as a Carbon Source for the
Production of Polyhydroxyalkanoates
Anais Hall-Garrison, Albany State University
Dr. Morris Blaylock, Darton College
Polyhydroxyalkanoates (PHAs) are a group of polymers that are produced
by certain bacteria that exhibit physical properties very similar to that of
petroleum-based plastics. Unlike petroleum-based plastics that do not
readily degrade, PHAs are nontoxic and completely biodegradable. This
fact makes PHAs very attractive in the plastic industry as an alternative
plastic for consumer use. A major setback to the full utilization of PHA
products in consumer markets is the production cost. This investigation
explores the use of spent oil as a relatively cheap carbon source for the
production of PHA. Our findings indicate that Ralstonia eutropha (ATCC
17697) and Pseudomonas oleovorans (ATCC 29347) can successfully use
spent oil as a carbon source to be converted into polyhydroxyalkano-
Abstracts
ates. Seed cultures of both bacteria were grown in Trypticase Soy Broth,
harvested by centrifugation, and placed in a minimal media for batch
fermentation. Spent oil obtained from local Wendy’s® and Red Lobster®
restaurants was saponified and served as the sole carbon source in the
study. Experimental results suggested that the optimum concentration of
saponified spent oil to be used in batch fermentation is 0.7% (w/v). Spectrophotometric analysis indicated that both P. oleovorans and R. eutropha
began accumulating PHA as early as 48h of fermentation. In addition, P.
oleovorans outperforms R. eutropha in the batch fermentation by producing higher cell-density yields by 3-fold. Results from this investigation
suggest that spent oil, a relatively cheap carbon source, can be used to
produce PHA. Future research plans include assessing the quality of the
extracted PHA using GC/MS and C14 NMR.
29
Simulated Hospital Environment for Nursing
Tomia Hines, Fort Valley State University
Dr. Fatma Mili, Oakland University
Reshard Horne, Huston-Tillotson University
For the past decade a nursing shortage, especially among nursing faculty,
has been reported in the US. To remedy this shortage, VI-MED, an interactive computer-simulated hospital environmen, was created in 2007 to enhance nursing student education. The goal of VI-MED is to train students
in the application of classroom knowledge in a clinical setting without
the risks attached to clinical training. Currently, the focus of the project
is redesigning and expanding the system architecture in ways that will
allow the addition of new disorders, interventions, and faculty input. This
is accomplished by the implementation of a database, created in PHP and
MySQL, that includes four main subsystems: a medical encyclopedia of
disorders and corresponding interventions, a population model with appropriate demographics for each disorder, a student profile subsystem
with logs of each user’s games and an evaluation of their performance, and
a faculty interaction subsystem through which the disorders encountered
by the students can be altered. The results of these additions permit educators to reinforce classroom training and evaluate the in-game actions
of their students. Overall, this is an upgrade introducing customizability,
scalability, and the broadened use of physiological concepts. Future areas
of work include: adding new diseases and interventions, along with their
corresponding vital signs; adding evaluation algorithms that can identify
more specific areas where student improvement is needed; adding pediatric patients to the game, emphasizing the different treatments age
demographics require; adding a Drug Database that will include descriptions, usages, and side effects of each medication presented to players in
the game; expanding the software to interface with databases maintained
by national agencies; testing the game further on nursing students; and
expanding the software to medical students. [NSF and NIH funded this
work through grants number 0609152 as part of BBSI program at Oakland
University and HBCU-UP/Targeted Infusion to Prof. Seema Dhir at Fort Valley State University.]
30
Seed Weight and Seed and Seedling Nickel Uptake In Two
Species of Hyperaccumulators Grown in Soil with Varying
Nickel Levels
Elyse Holtz, Howard University
Mary A. McKenna and Iman Sylvain, Howard University
Rufus L Chaney, USDA, Beltsville Agricultural Center
Previous research (Sylvain and McKenna, 2007) demonstrated that nickel
plays a powerful role in influencing seedling fitness in the nickel hyperaccumulator, Alyssum murale. A. murale seeds and seedlings are significantly heavier when plants are grown in soil with nickel. Differences in
seed and seedling nickel levels may contribute to better growth through a
positive effect on protein metabolism since the nickel-containing urease
enzyme aids in providing amino acids for protein synthesis. Differences in
seed and seedling nickel might also promote seedling growth by inhibiting attack by fungae or other pathogens. This study aims to explain the
differences in seed and seedling weight between seeds grown on soils
with varying nickel levels. Seeds and seedlings from two species of Alyssum were compared: (1) A. corsicum, a serpentine endemic with restricted
distribution in Turkey and Corsica (Reeves 1992); and (2) A. murale, a
widespread species on serpentine soils in southern Europe and Asia that
also grows in non-serpentine areas in the Balkans (Brooks, 1998). Individual seed weights of A. corsicum and A. murale were obtained, and seeds
were classified by weight and origin (from plants grown with or without
nickel). Seeds were grown in 50 cell seedling trays in two soil treatments
(commercial soil with and without 500 ppm nickel; 1:1 nickel acetate: nickel sulfate). Analyses of nickel levels in seeds and seedlings was carried
out on weighed and ashed samples using AA and ICP in the lab of Rufus
Chaney at USDA-Beltsville Agricultural Research Center. Results for seed
weight analysis of Alyssum corsicum show a similar pattern to that seen in
Alyssum murale. Soil nickel has a significant effect on seed weight in Alyssum corsicum (p= 0.000). Seeds from plants grown in soil with high nickel
levels are significantly heavier than seeds from plants grown in soil with
medium and low nickel levels (p= 0.000; p=0.000). Seeds from plants
grown in soil with medium nickel levels are also significantly heavier than
seeds from plants grown in soil with low nickel levels (p= 0.001). Analysis
of seed and seedling nickel concentrations is ongoing. These results will
also be reported. These seed weight results are notable since no previous
studies have measured variation in seed weight associated with soil metals in hyperaccumulators. The fact that a similar pattern in seed response
to soil nickel is seen in A. murale and A. corsicum suggests that nickel
hyperaccumulators in the genus Alyssum may respond to soil nickel levels
in a similar fashion. This research provides insight into the influence of
soil nickel on important life history parameters in Alyssum corsicum and
Alyssum murale including reproductive processes and fitness during the
seed and seedling life stages. [Funded by NSF-Award # 0405151-UMEBEnvironmental Biology Scholars Program, Mary A McKenna, PI]
31
High Frequency Plant Regeneration in Valeriana officinalis
via Somatic Embryogenesis
Tameka Howard, Fort Valley State University
T. Janea Howard, Hari P. Singh, Sarwan K. Dhir, Fort Valley State
University
Valeriana officinalis is a perennial flowering medicinal herb which is native
of Europe and parts of Asia. Valeria is known to be used as herbal or dietary
supplement to cure against insomnia, restlessness and anxiety. In nature,
Valeria is propagated through seed which is often a limitation for mass
production due to poor seed production and variation in germinations
rates. Propagation by cutting is not only difficult, it is also time consuming and costly. A protocol of somatic embryogenesis and plant regeneration from leaf derived callus of Valeria has been developed using different
treatment combinations of cytokinins (Bezylaminopurine (BA), Kinetin
(Kn), and Thidiazuron (TDZ)) and auxins (2,4-Dichlorophenoxyacetic acid
(2,4-D), 1-Naphthaleneacetic acid (NAA)). Leaf explants were cultured on
Murashige and Skoog’s (MS) media supplemented with 0.1, 0.5, 1.0, 2.0,
3.0 mg/L-1 of cytokinin alone or in conjunction with 0.1 mg/L-1 of NAA and
2,4-D. The results have shown that somatic embryogenesis was induced
in all the cultures irrespective of treatment combinations. Use of NAA in
conjunction with cytokinins favored production of more number of somatic embryos than in comparison to 2, 4-D. Combination of BA (2mg/L-1) and
NAA at 0.1mg/L-1 was found to be the best for callus induction and somatic embryogenesis while 1 mg/L-1 of Kn and 0.1 mg/L-1 NAA was found best
for plant regeneration from these embryogenic cultures. Ninety percent of
Program Book
A37
Abstracts
normal somatic embryos were converted into plantlets directly on MS medium free of plant growth regulators. Regenerated plants were transferred
to soil and grown to maturity with 90% survival. The protocol described
here offers a good potential for genetic improvement using gene transfer
techniques and the production of synthetic seeds of V. officinalis. [This
work was supported in part by a grant from NSF/ HBCU-UP awarded to
Dr. Sarwan Dhir*, Director for Center for Biotechnology at Fort Valley State
University].
32
Δpmt2 Suppressor Screen in Aspergillus nidulans
Jessica Jewell, Norfolk State University
Michelle Momany, Thanyanuch Kriangkripipat, and Yainitza
Hernandez-Rodriguez, University of Georgia
Protein O-mannosyltransferase 2 (pmt2) is involved in polarity maintenance at restrictive temperature in Aspergillus nidulans. It is not an essential gene and its deletion mutant does not send out germ tubes at 42
C. In order to understand pmt2 roles in polarity maintenance and uncover
other genes involved in this process and/or genes that might interact with
pmt2, we designed a suppressor screen. To do this, we transformed the A.
nidulans library into Δpmt2 and screened for partial or total restoration to
wild type phenotype at restrictive temperature.
33
The Role of the EGF Receptor in the Transcriptional
activity of C/EBPβ
Dominique Johnson, Johnson C. Smith University
C/EBPβ is expressed early in adipogenesis, where it induces C/EBPα, a
promoter of terminal adipocyte differentiation. Our goal was to test the
hypothesis that the EGF receptor, which promotes sustained ERK activity, favors adipogenesis via the regulation of C/EBPβ activity. Our results
showed that there is a correlation between EGFR expression and C/EBPα
in adipose tissue of subjects having a wide range of BMI. In 3T3-L1, we
demonstrated that EGFR inhibition was accompanied by a reduction in C/
EBPα but not C/EBPβ expression, and Western blot analysis showed that
C/EBPβ phosphorylation was delayed by two days. This suggests that C/
EBPβ might be involved downstream of the EGFR in the adipogenic process.
34
The Vertical Distribution of Phytoplankton in a Tidal Creek
Under Flood and High Tide Conditions
Leandra Jones, Savannah State University
Carol Pride, Savannah State University
Phytoplankton are important to all marine animals because they are the
base of most marine food chains. Phytoplankton require sunlight in order
to survive and carry out photosynthesis, but light diminishes rapidly with
depth in the ocean especially in coastal environments. Different biological mechanisms are used by phytoplankton to maximize their time in the
sunlit surface waters (photic zone). Physical parameters such as water
turbulence also influence their vertical distribution. Turbulence varies
considerably in narrow salt marsh tidal creeks such as Country Club Creek
(Savannah, GA). The purpose of this project was to determine whether
phytoplankton standing stocks, represented by the two major taxanomic
groups of diatoms and dinoflagellates, varied vertically in the water column during high tide and flood tide. High tide represents slack tide conditions when waters are calmer and flood tide represents a period of significant water influx to the creek and turbulent conditions. The secchi depth in
this study averaged 43 cm, representing an estimated photic zone depth
A38
Program Book
of 1.3 m. Standing stocks of diatoms and dinoflagellates were measured in
surface waters and waters beneath the photic zone (“bottom”) in Country
Club Creek on the Savannah State University campus during high tide and
flood tide on three separate days with varying tidal ranges. Also measured
were the tidal creek salinity and temperature. Vertical variations in these
properties were not significant enough (mean 0.3 deg. C and 0.2 ppt difference) to impact phytoplankton distribution. Diatoms dominated the
phytoplankton in all samples (mean 78%). Phytoplankton at high (slack)
tide were more concentrated at the surface of the creek (8.9/L) rather than
at the bottom (1.7/L) suggesting that they are able to control their buoyancy and movement toward the sunlight in the calmer water. During the
more turbulent flood tide conditions, phytoplankton standing stocks were
greater at depth (14.0/L) than at the surface (0.3/L) suggesting that that
sinking is significant and that turbulence in the creek during flood tide is
not strong enough to completely mix the phytoplankton throughout the
water column. There were significant vertical (> near surface) and tidal (>
during high tide) differences in dissolved oxygen concentrations that may
indicate influence of phytoplankton photosynthesis and physical processes on vertical oxygen profiles in the tidal creek.
35
Climatic and Seasonal Factors Affecting the Frequency and
Diversity of Microbial Isolates Obtained by Atmospheric
Sampling in Washington DC
Douglas Mansell, Howard University
Andre McNair, Howard University
Over the past 10 years there has been heightened interest in the movement of microbial organisms such as fungal spores, pollen and bacteria
through the atmosphere. Bacteria play many roles in the environment,
and they are essential to the functioning of the global ecosystem. Bacteria can be harmless or cause harm to humans, other animals, plants
and agricultural systems. The purpose of this study was to examine the
diversity of bacterial isolates in air samples collected over a six month period in Washington DC. Air samples were collected bi-weekly from August
2007 through January 2008, with a sampling filter apparatus stationed on
the South Main campus of Howard University in Washington, DC. These
samples were screened and all 16S rDNA bacteria isolates were cultured
and analyzed under the direction of Andre McNair in the laboratory of Clarence Lee at Howard University. Climatic and weather variables were also
recorded. A total of three hundred and sixty two bacterial isolates were
recovered from the atmospheric samples. Cell wall analysis revealed three
hundred and thirty four Gram positive isolates, and 28 Gram negative isolates. The presence of Gram positive organisms was unrelated to seasonal
temperature differences; the frequency of Gram positive isolates was high
during the high and low temperature conditions. However, the frequency
of Gram negative organisms increased during conditions of high temperature and high humidity. The very high frequency of Gram positive isolates
may reflect the presence of methicillin-resistant organisms and community acquired pneumonias that are occurring in the urban communities.
Although the isolates were not analyzed for possible virulence factors,
these results provide critical insight of microbial biodiversity in the Washington DC, Metro Area. The microorganisms identified have the potential
for impacts on humans, plants, and agricultural life and could contribute
to spread of human and animal disease.
Funded by NSF-Award # 0405151-UMEB-Environmental Biology Scholars
Program, Mary A McKenna, PI
Abstracts
36
Human Embryonic Stem Cell Derived Astrocytes
Expressing Mutant SOD1 Display Phenotypes Similar to
ALS Patients
Chinakasiobi Mbata, Fort Valley State University
Robert Krencik and Su-Chun Zhang, University of Wisconsin
In this study, we proposed to use Astrocytes derived from human embryonic stem cells (HESC), expressing a mutant form of SOD1 (A4V and G85R)
fused to green fluorescent protein (GFP) created by lentiviral infection, to
test the hypothesis of whether these cells display abnormalities seen in
ALS patients. Immunostaining was done to observe aggregations in the
Astrocytes. We blocked the cells with 2% normal donkey serum and permeabilized with 0.2% Triton X-100. Next, we incubated with primary antibodies over night in blocking buffer (GFAP 1:5000, S100β 1:2000, Ubiquitin 1:400). Primary antibodies were washed off three times for ten minutes
in phosphate buffered saline (PBS) and then incubated with a secondary
fluorescent conjugated antibody (donkey anti rabbit, donkey anti mouse)
for one hour. Cells were washed again with PBS, mounted on slides, and
visualized with fluorescent microscopy. We found that the percentage of
cells expressing reactive Astrocytes markers S100β and GFAP was not
significantly different in mutant SOD1 Astrocytes compared to wild-type
(WT) SOD1. Next, we found large aggregations in the cytoplasm of mutant
Astrocytes (and a few smaller ones in WT), which contained GFP-SOD1
and ubiquitin, but not GFAP or S100β. Aggregation number and size were
measured, and in the mutants these aggregations were large and numerous. However, there were also a few smaller aggregations found in the WT
Astrocytes, which has also been observed by other groups. These aggregations are currently being analyzed by western blot for further confirmation. In summary, these cells indeed display hallmarks of ALS (aggregation formation) and can be used in future research, such as co-culturing
with motor neurons, to study mechanisms of Astrocytes induced neurodegeneration. [This work was supported in part by a grant from the National
Science Foundation, HBCU-UP/Targeted Infusion to Prof. Seema Dhir at
Fort Valley State University.]
37
Development of Yeast-Derived Vaccine for Low Pathogenic
Avian Influenza Virus
Ashley Mccollum, Alabama State University
Hongzhuan Wu, Karyn-scissum Gunn, Shree R Singh, Alabama State
University
Joseph J. Giambrone, Auburn Unversity
Vaccines can be used in programs to prevent, manage or eradicate AI.
However, vaccines should only be used as part of a comprehensive control
strategy that also includes biosecurity, quarantine, surveillance and diagnostic, education, and elimination of infected poultry. Potent AI vaccines,
when properly used, can prevent disease and death, increase resistance
to infection, reduce field virus replication and shedding, and reduce virus transmission. Inactivated AI vaccines and recombinant fowl pox-H5-AI
vaccines are licensed and used in various countries. Vaccines have been
shown to protect chickens, geese, and ducks from H5 HPAI.
Viruses of all H subtypes have the potential to cause disease. Currently
there are suggestions that all highly pathogenic viruses are derived from
low-pathogenic viruses;. However, no low pathogenic AI vaccines have
been developed up-to-now. Therefore, there is urgent need to develop a
vaccine as the reservoir for the control of low pathogenic AI.
Yeast-expressed recombinant protein provides many advantages over
other recombinant vaccines expressed by other expression systems when
used in poultry practice. It not only provides protection against virus infection but also prevent secondary bacteria and mycoplasma infection. Our
previous work confirmed yeast-derived sigma C protein induced immunity
against avian reovirus.
In this study, we designed a pair of primer based on the fact that 15 and 21
terminal segment specific nucleotides of the genomic RNA are conserved
between all influenza virus and are unique for each fragment. We amplified Hemagglutinin(HA) gene from a H10N7 strain isolated from Alabama
aquatic wild birds by our lab. The resulting gene (1.8kb) will be cloned into
two separate yeast expression systems, schizasaccharomyes(S) pombe
and pichia pastoris, we will then then select the one which has the higher
level of functional recombinant protein to do further chicken experiments.
By now, HA gene of this H10N7 strain was expressed in the S.pombe system. A 62.2 KDa protein of AIV was demonstrated by Western blotting
using polyclonal antibody offered by USDA lab. This protein was further
purified with a pro-bond purification system (Invitrogen), and its expression efficiency was roughly estimated. The purified protein consists of
only 0.1% of the total soluble protein. Currently we are trying to optimize
the expression condition to try to get more protein and clone the HA gene
into the other alternative yeast expression system, the pichia expression
system.
38
Deciphering Structural Features Important for
Heteroarotinoid Growth Inhibition Activity in Normal and
Cancerous Ovarian Cells
Sheree McDaniel, Langston University
Dr. Doris Benbrook, University of Oklahoma Health Sciences Center
Objective: The hypothesis is that specific structural features of the flexible
heteroarotinoid (Flex-Het) chemicals are responsible for their differential
killing of cancer cells over normal cells. Our objective was to determine
which Flex-Het structural features are responsible for the cell killing activities.
Cancer cells and normal cells were plated into 96 well plates. The cultures
were incubated with a series of Flex-Hets that differed by single structural
alterations over a range of concentrations from 0 to 10 micromolar. After 72 hours treatment, the CellTiter 96 Assay was used to measure the
number of cells remaining after each treatment. For each compound, the
potency was derived as the concentration that induced 50% cell kill, and
the efficacy was derived as the maximal percent cell loss observed.
Both compounds with and without N heteroatoms exhibited differential
effects on cancer vs. normal cultures. The potencies and efficacies of
compounds with the N heteroatoms were weaker than their counterparts
without heteroatoms. Other changes to the drug structure had minor consequences.
Since the compounds with N heteroatoms were weaker than their counterparts without heteroatoms, we propose that the N heteroatom decreases
the cytotoxicity in general and that other structural features are important
for the differential cytotoxity on cancer over normal cells. [Funding was
provided by The Jeffrey Benbrook Memorial Fund and LINC.]
39
The Induction of the Imposex Condition in Biompharlaria
glabrata, a Hermaphroditic Snail.
Selamawit Mekonnen, University of the District of Columbia
Harshini Dinesdurage, Freddie Dixon, George Eng, Olaniran Atchade
and Carolyn Cousin, University of the District of Columbia
Biomphalaria glabrata, the intermediate host for Schistosoma mansoni,
is the flatworm that causes the parasitic disease schistosomiasis. These
gastropods are hermaphrodites, possessing both male and female sex
organs on the same individual. These organisms can self-fertilize and pos-
Program Book
A39
Abstracts
sess organs such as an ovatestes that helps facilitate the process. Studies
have suggested that triorganotin compounds induce reproductive failure
in several aquatic organisms. The major reproductive failure caused by
these compounds is imposex, a masculinization of female gastropods
caused by alterations to endocrine-mediated pathways. The objective of
this study is to produce imposex in B. glabrata snails by using triorganotin
compounds. Producing these conditions in B glabrata is significant because it will disrupt the life cycle of the schistosome and eliminate the disease schistosomiasis. Ten snails were treated with the varying concentrations of triphenyltin chloride (These concentrations were 0.5, 0.75, 1, 1.15,
1.25, 3, and 5ppm) by placing them in 100ml beaker with 75 mls of aged
tap water. After 24 hours, the snails were washed and placed in separate
100 ml beakers containing 75 mls of aged tap water and examined for egg
production. The snails treated with the 0.5 ppm and 0.75 ppm showed
decreased fecundity and had an abnormal egg clutches. The snails lived
in the 1.25 ppm concentration did not produce any eggs. The reproductive
organs of the snails treated with 1.25 ppm were excised from the snails
and prepared for transmission electron microscope. At electron microscopic level the ovatestes section that produces the ova appeared abnormal. Where as the gland that produces the sperm appeared normal. [This
study is funded by AAAS-MERCK grant and NSF founded HBCU-UP grant.]
40
Signaling Pathways and Gene Expression Patterns During
Sporulation in Ustilago maydis
Sakinah Miller, Fort Valley State University
Dr. Scott Gold and Emir Islamovic, Department of Plant Pathology,
University of Georgia,
For Ustilago maydis, a maize pathogen, it is essential to generate teliospores in order to complete its life cycle. Investigation of teliosporogenesis, which occurs only in planta in wild type U. maydis, is hindered due to
various host effects. Deletion of ust1, a stuA transcription factor ortholog,
in a budding haploid yielded a striking phenotype of strong filamentous
growth and the production of highly pigmented spore-like structures in
culture. Therefore, the ust1 mutant provides a host free genetic system
to begin to decipher the sporulation associated transcriptome. To identify
novel genes implicated in sporulation in U. maydis, we are utilizing microarray analysis of the ust1 mutant for comparison with in planta sporulation. Through NimbleGen Systems Inc., we designed NimbleGen arrays
for 6866 U. maydis ORFs and have carried out preliminary experiments including two biological replicates of two time points each for the wild type
and ust1 mutant. Samples were sent to NimbleGen and hybridized onto
NimbleGen microarray containing all U. maydis genes distributed into four
technical replicates. Normalized data have been received and analyzed.
We observed that ssp1, a gene that is specifically and highly expressed in
teliospores, is highly induced when the spore-like structures are produced
by the Δust1 mutant in culture. This confirms that the approach is working
well. A putative laccase gene was highly induced in the ust1 mutant, suggesting a role in pigmentation of the spore-like structures associated with
the ust1 mutant. We have confirmed differential expression by real time
PCR for several genes identified on the arrays. Based on these results,
several gene deletions are in progress. [This work was supported in part
by a grant from NSF/ HBCU-UP awarded to Dr. Sarwan Dhir*, Director for
Center for Biotechnology at Fort Valley State University].
A40
Program Book
41
Stretching of Bacteriophage Lambda DNA
Charles Molokwu, Delaware State University
Jessica Dennings, Morgan State University
Michael Meadows and Chandran Sabanayagam, Delaware State
University
Optical DNA mapping has been known as an efficient technique to study
the organizations of genomes. Characterizing a genome can give an insight to the genetic causes for human diseases. This project involves the
manipulation of lambda (λ)-DNA for single-molecule genotyping. The goal
of this project is to stretch DNA in a uniform manner on a glass coverslip.
Stretching DNA was performed using the receding meniscus technique.
A micro-fluidic cell was created to push a small volume of DNA over a
glass coverslip. DNA was labeled with a fluorescence dye and imaged
under a confocal laser microscope. DNA stretching was observed in all
experiments, but the extent of stretching varied. Completely stretched
λ-DNA has a length of 16 µm, and our initial flow-cell experiments created
stretched DNA ranging from 5 to 25 µm.
42
Effects of Treatment with Vitamins C and E on Hepatic
Biotransformation in Diabetic Rats
Shabree Nichols, Langston University
Ruth Sanders and John B. Watkins III, Indiana University
Diabetes is a disease that is characterized by the body’s inability to produce sufficient insulin to maintain normal glucose levels in the blood. Diabetes has many known effects such as “diabetic nephropathy, retinopathy,
neuropathy, and cardiovascular complications,” many of which stem from
oxidative stress. Oxidative stress has been proven to stem from many factors such as free radicals, whose disruption of metabolic activities causes
a disturbance of normal cellular activity. The antioxidant characteristics
of vitamins C and E were therefore tested to reverse the oxidative stress
caused by diabetes. This study sought to show the effects of vitamin C
and E treatment on hepatic detoxification in normal and diabetic rats. We
hypothesized that the treatment of rats with vitamins C and E would reverse some of the complications associated with diabetes. The results of
this study suggest that treatment with vitamins C and E is beneficial in the
reduction of cytochrome P450 enzymes in the liver.
43
Creation of a GATEWAY Cloning Vector and its Application
for Functional Analysis of Type III Effectors from Plant
Bacteria
Brittney M. Nobles, Norfolk State University
Dr. Masanao Soto, University of Minnesota
Pseudomonas syringae pv. tomato DC3000 infects Arabidopsis with a process called type III secretion method (T3SS) in order to deliver proteins
into the host cell. P. syringae is the model bacteria for Arabidopsis because it was the first pathogen known in a laboratory setting to infect the
plant and cause disease. The T3SS has the ability to directly inject bacterial virulence proteins into the cell. However, the delivery system of the
type III effectors from the cytoplasm of the bacteria to the cytoplasm of
the plant is not known. With the help of promoters AvrB, AvrRpt2, and AvrRpm1, the effects of type III effectors are able to be displayed. The effects
of type III effectors are imperative in the effort to combat plant disease.
Expressing type III effectors with a GATEWAY cloning-compatible plasmid
is a pertinent matter in order to make useful genomics of pathogenicity of
plant bacteria. To create a compatible plasmid, certain processes have to
be completed. To accomplish the task at hand, PCR- amplified promoters
Abstracts
cut with Nsi I were ligated and transformed into PCPP5372. Lastly, was the
mating of Escherichia coli with the Pseudomonas. With the allotted time,
successful transformations and ligation of Avr B and Avr Rpt2 were created. The future goal of the project is to understand the bacterial pathogenicity of type III effectors in Arabidopsis and to analyze bacterial growth
within the Arabidopsis.
vitamins D and E may somehow work in concert, with vitamin E helping to
boost the effectiveness of vitamin D in killing cancer cells.
44
Vitamin E Makes Prostate Cancer Cells Vulnerable
Edwinna C. Patterson, Savannah State University
Elissa T. Purnell, Ph.D., Savannah State University
Joshua Osondu, Darton College
Dr. Jain Ashok, Albany State University
Exposure to aniline-derived analogs leads to an increase in methemoglobin (MetHb) formation in erythrocytes, which is the first hemotoxic
response in the induction of hemolytic anemia (the premature removal
of mature erythrocytes from the circulation following chemical exposure).
This disease state has been recognized as a side effect of drugs used to
treat malaria and leprosy as well as other environmental chemicals. The
objective of the project was to evaluate the ability of an aniline analog
to bring about alterations in the electrophoretic mobility pattern of skeletal membrane proteins from rat erythrocytes. Whole blood from male
Sprague-Dawley rats was purchased from Valley Biomedical Products
and Services (Winchester, VA). Aliquots of blood (5-10 mls) were washed
(x3) with 50 ml of phosphate buffered saline supplemented with glucose
(PBSG, pH 7.4) and centrifuged to yield a population of packed red blood
cells (PRBCs). Red blood cell ghosts were prepared from 1 ml aliquots of
PRBCs that were incubated with various concentrations of p-fluoro-PHA
or acetone for 0 to 90 minutes at 37°C. After incubation, the cells were
washed with PBSG (x1) and centrifuged for 5 minutes. Cells were lysed in
20 ml of phosphate buffer (5mM, pH 8.0) and centrifuged for 10 minutes.
The supernatant was aspirated and the ghosts were repeatedly washed
until opaque, homogenous cells were obtained. Protein yield was determined using the bicinchoninic acid assay (BCA). Protein samples from
each treatment group were subjected to SDS-PAGE. Visual analysis of
erythrocyte skeletal membrane proteins exposed to 100, 200, and 300
µM of p-fluoro-PHA for 30 and 60 minutes demonstrated a reduction in
the staining of specific membrane proteins as compared to the controls.
Bands 2, 2.1, and 3 diminished as chemical concentration increased for
cells exposed to the halogenated aniline analog for 30 minutes. Bands
2.2, 2.3, 4.1, and 4.2 are not visible in cells incubated with 200 or 300 µM
of p-fluoro-PHA. In cells incubated for 60 minutes at all chemical concentrations, band 2.0 was thinner than in the control. In addition, Bands 3, 4.1
and 4.2 were not as intensely stained in the treatments groups. Similar
electrophoretic mobility patterns were noted for cells incubated in chemical for 90 minutes. Bands 2, 2.1 and 3 were thinner in samples treated
with 100 and 300 µM p-fluoro-PHA, and did not demonstrate the staining
intensity observed in this particular band from the control cells. Bands 4.1
and 4.2 were not as prevalent in cells exposed to 100 and 300 µM as in the
control. The banding pattern of cells incubated with 200 µM appeared to
be similar to the control. In conclusion, the data demonstrates treatment
with aniline analogs caused alterations in the erythrocyte skeletal membrane proteins. Changes in these membrane proteins may be a part of the
underlying mechanism that targets the red cells for premature removal.
Prostate cancer is the most common internal human malignancy and the
second leading cause of cancer death among North American and western countries. There is evidence that many prostate cancers may be preventable. Research indicates that diet can lower the prostate cancer risk
through the following prostate-healthy products: Vitamin E, Green tea,
Alliums, Red Wine, and Soy. The key seems to be increased consumption of dietary antioxidants. Since vitamin E is a known anti-oxidant that
destroys harmful molecules known as free radicals, we hypothesize that
its anti-oxidant properties might help prevent prostate cancer. Vitamin E,
also known as Alpha-Tocopherol, was most effective in halting prostate
cancer cells in the laboratory. Tocopherol proved to suppress the effects
of Prostate cell.
This research was started with cell culturing, where a Prostate Cancer
cell was removed from the preserving chamber (freezer) which contains
Liquid Nitrogen. Then the Prostate cells were defrosted, and a serum or
media was used to feed the cells. The cell culturing took 4 weeks to attain the amount of cells needed to continue the research. Cell culturing is
a process where the cells will be changed from the old media by adding
a new media of about 5ml of media. After about 3-4 days it was required
to change the media and after about 5 days the cells split into a bigger
flask. For Ccell splitting the media will be removed; and Hanks Solution,
which is a salt solution that neutralized the media effects, will be added
to the cells. Consequently, Hanks solution was used to wash the media
later and 0.3 ml of Trypsin ETDA solution was added to the cells. Trypsin
ETDA will be left with the cells to release them from the bottom of the
flask (this process is called Trypsinization), and will stay on the incubator for 1 minute. The incubated cells with Trypsin will be mixed with 1ml
of media. About 0.5ml of the cells with media will be added with Trypan
Blue for cell count. Then the cells with the media will be centrifuged for
5 minutes on 3000 RPM. The media is then aspirated for a new media to
be added. The cells with the media will then be separated into a different
flask until the cells have grown or multiply for another splitting process.
Cell count was performed every time we split the cells. For microbiology,
cell culture, and many applications that require the use of suspensions of
cells, it is necessary to determine cell concentration with a device used
for determining the number of cells per unit volume of a suspension. The
most widely used type of chamber is called a hemocytometer, since it was
originally designed for performing blood cell counts. At first we had about
1 million cells in one flask. Then it grew to about 54 million cells. We had
some fungus attack on the cells which delayed the research. After we had
enough cells, I found the solvent needed to dilute about 0.46 µmol/L of
Alpha-Tocopherol. Many solvents can be used which includes ethanol,
chloroform, acetone, vegetable oil, etc. Ethanol was used as the solvent.
Then some questions were raised about how much solvent was needed to
dilute into 0.46 µmol/L Vitamin E to make a 1000 times concentration of
the solution needed?
After calculating, the media for Alpha Tocopherol was made and then it
was fed to cells in a well .The number of cancerous cells was reducing
tremendously. About 2,560,000 cells/well were in each well that was fed
with Vitamin E and 500,000 cell/well prostate cancer cells where dead. In
further studies, we intend to test whether either vitamin E or selenium,
or a combination prevents the disease. These studies could indicate that
45
Alterations in the Electrophoretic Mobility of Male Rat
Erythrocytes Exposed to a Halogenated Aniline Analog
46
Active and Inactive G Proteins
Saskia C. Patterson, Norfolk State University
Dr. Scott Vande Pol, Nicole Brimmer, University of Virginia
Maureen Scott, Norfolk State University
Papillomaviruses cause the most common lethal malignancy in women
world-wide: cervical cancer. Our laboratory studied the actions of the papillomavirus E6 oncoprotein. By identifying host proteins also known as G
proteins that associate with E6, we identify those cellular factors that are
critical in signal transduction and cell cycle progression. We use a variety
of biochemical and genetic approaches to identify the cellular targets of
Program Book
A41
Abstracts
E6, and then we study the consequences of the interaction and the role of
the cellular protein in cancer.
G proteins, short for guanine nucleotide-binding proteins, are called G proteins because they function as molecular switches, alternating between an
inactive guanosine diphosphate (GDP) and active guanosine triphosphate
(GTP). G proteins are important signal transducing molecules in cells. In
fact, diseases such as diabetes and certain forms of cancer, among other
pathologies, are thought to arise due to derangement of G protein signaling. The purpose of this study was to determine whether the G proteins
that were used were active or inactive. In determining if these proteins
are active, they were tested against abnormal cells to establish whether
treating these cells with different methods would establish solid ground
to getting down to the core of cervical cancer. A goal of this study was
to establish how many antigens were present in these activated G proteins by using abnormal cells to test the generation of antibodies that can
cause an immune response. In response to the G proteins being active, an
effector molecule also became active. The effector molecules bind to the
protein and thereby alter the activity of the protein. Signaling molecules,
like a hormone, bind to a given receptor. This receptor makes a conformational change, which in turn affects other molecules (like G proteins), and
the G protein can affect other effector molecules.
47
Investigating Root-Knot Nematode Infection of Amino
Acid Transport Mutants
Charlie Ponder, III, Fort Valley State University
Heather Marella, and Christopher Taylor, Donald Danforth, Plant
Science Center, St. Louis, MO
Previous work in our laboratory showed that certain Arabidopsis amino
acid transporter mutants were hyper-susceptible to the root-knot nematode, Meloidogyne incognita. Arabidopsis amino acid transporter mutants
used in our experiments included AAP1 (Amino Acid Permease), ANT1
(Aromatic and Neutral Amino Acid transporter) and LHT1 (Lysine Histidine
transporter). Our studies showed that mutants of LHT1 or ANT1 carry more
adult female nematodes than wild-type plants. The AAP1 mutant was used
as a negative control and produced similar numbers of female nematodes
as wild-type. Early infection of the mutants was examined by staining
nematode infested roots with acid fuchsin after 5 days. We observed that
the LHT1 mutant had twice as many juvenile nematodes inside the root
as compared to wild-type. Since LHT1 is involved in the uptake of amino
acids from around the roots, we tested the idea that the amino acids surrounding the plant roots attract nematodes. We designed a choice experiment, with agar plates containing an agar plug infused with 100μM of an
amino acid on one side of the plate and a control plug on the other. Juvenile nematodes were placed in the center of the plate. After two days, the
numbers of juveniles around the plugs were counted. In our experiments,
we saw that the amino acids tryptophan, threonine, and aspartate attracted more nematodes than other amino acids. In addition, we will measure
the rate of root growth for the different mutants to see if the loss of amino
acid uptake affects root growth. Roots will be measured every three days
for three weeks. Initial data already shows that by day 6, roots of the LHT1
mutant were shorter than wild-type. Our data collected to date seem to
support the hypothesis that amino acids secreted by the plant root are
important for nematode infection. [This work was supported in part by a
grant from NSF/ HBCU-UP awarded to Dr. Sarwan Dhir, Director for Center
for Biotechnology at Fort Valley State University].
48
Investigation of Arbuscular Mycorrhizal Fungi (AMF)Spore
Competition between White Clover Trifolium repens and
Annual Blue Grass Poa annua
Jeremy Sanders, Shaw University
Dr. Mialy Rabe, Chilea Dickson, and Onah Chukwebeze, Shaw
University
Invasion of white clover weed Trifolium repens is a major problem in most
urban lawns of NC as it competes with turf grass growth such as annual
blue grass Poa annua. This study investigates the probable competition
between the AMF spores of annual bluegrass and white clover. Surveys of
percent AMF root colonization, AMF spore number and spore species varieties of an urban lawn with white clover and annual blue grass in Raleigh,
NC were undertaken in the late spring of 2008.
Two plant species, annual bluegrass Poa annua and white clover Trifolium
repens, growing next to each other on same soils (pH, organic matter contents, N and total P) were randomly sampled for roots and soils (150g,
at 0-10cm depths) in two square sites, S1 and S2 of similar size (3m2).
Site 1 was >70% annual bluegrass, and site 2 was 85% white clover. Eight
soil samples including control were air-dried at room temperature (23°C),
stored at 4°C before spore extraction, counted, identified under light microscope and assessed for AM percent root colonization from bioassay
plant culture.
Comparison of the difference in spore number between S1 (>70% annual
bluegrass) and S2 (85% white clover) revealed a negligible difference in
the number of spores. There was, however, significantly more species variety overall for S2 than S1. Percent AM fungal colonization levels were
higher on site 2 than on site 1. A total of 15 different AM fungal species in 4
genera: Acaulospora, Scutellospora, Gigaspora, and Glomus were identified from the 2 sites examined. Glomus clarum Nicol. & Schenck was the
most abundant species (532 in 8 samples), because it comprised half of
all spores. Glomus clarum Nicol. & Schenck is also considered the most
widespread species; it is present in all samples in site 2 and in almost
all samples from site 1 detected. The soils had a pH 6.5, organic matter
content of 20%, and moisture content of 30%.
We think that the negligible difference in spore numbers (35) of both host
plants is related to the similar efforts of annual blue grass and white clover to tap into the same pool of nutrients in the loamy soil. The significant
difference in species variety (higher in white clover S2) explains the more
adaptive behavior of white clover as compared to annual bluegrass. White
Clover is an invasive species that had to be supported by more variety of
AMF species in order to compete with annual bluegrass in an established
lawn. White clover is also said to have the capacity to supply its AMF with
more C, hence its ability to support higher numbers of AMF species in its
root system. The extent of this experiment is rather limited and we think of
replicating the experiment in more sites and closely look at relationships
between soil nutrient availability and AMF spore densities and species
varieties.
49
Do the Cleaner Shrimps Periclimenes pedersoni and
Stenopus hispidus Affect the Size of Flatworm parasites
Neobenedenia mellini on a Caribbean Reef Fish?
Kiara Scatliffe, University of the Virgin Islands
Donna Nemeth and Johnasha Stuart, University of the Virgin Islands
Ectoparasites are harmful to reef fish because they damage the fishes’
skin and make them more susceptible to disease (Thoney and Hargis
1991). Fish may be cleaned of parasites and other debris by cleaner fish or
shrimp at cleaning stations (Côté 2000). The effectiveness of cleaner fish
is well documented, but the role of different cleaner shrimp species is not
A42
Program Book
Abstracts
well studied (Becker and Grutter 2004). Two Caribbean shrimps, Pederson cleaning shrimp (Periclimenes pedersoni) and banded coral shrimp
(Stenopus hispidus), were recently tested for their effect on fish parasite
loads (McCammon et al. 2008). Pederson cleaning shrimp reduced parasite loads on fish, but the banded coral shrimp did not (McCammon et al.
2008). Another way cleaners can affect parasite populations is by changing the size of parasites on the host fish. The mean length of parasites
from fish that did or did not have access to cleaning shrimp was quantified to test the hypothesis that Pederson cleaner shrimp and banded coral
shrimp affect the average size of monogenean parasites on the blue tang
fish (Acanthurus coeruleus). Blue tang were housed in an aquarium where
they were constantly exposed to the infective stages of the parasite. The
control treatment contained fish alone, and the experimental treatment
included access to cleaner shrimps. After two weeks each fish was recaptured and put in a freshwater bath for five minutes to remove the parasites. Parasites were preserved in ethanol, photographed under a microscope and their lengths measured using NIH Image. J. Pederson shrimp
significantly reduced the average size of parasites on the blue tang (p<
0.05, t-test), suggesting that they prey selectively on larger parasites.
Banded coral shrimp also affected the mean parasite size on the blue tang
(p<.001, t-test) but they did not have as great an effect as the Pederson
shrimp. The ability of cleaner shrimps to remove parasites, especially larger ones, should have a positive impact on fish health by reducing damage
to the host’s skin. In addition, reduced parasite size could reduce overall
parasite populations on the reef by removing the parasites with the greatest reproductive output. [Acknowledgements: This study was supported,
in part, by an Earthwatch grant to Paul Sikkel Ph.D., Centre College, KY,
and Donna Nemeth Ph.D., University of the Virgin Islands, ST. Thomas,
VI 00802, and NSF HBCU-UP. Research facilities were provided by Coral
World Ocean Park, St. Thomas]
50
West Nile Virus Infection in Humans: Trends from 2003 to
2007 in Mississippi and its Neigboring States
Sean Scott, Jackson State University
Raphael D. Isokpehi, Gabrielle A. Cooper, Tolulola Oyeleye, and Hari
H.P. Cohly, Jackson State University
West Nile virus (WNV) is a single stranded, RNA flavivirus. WNV is carried
by birds and transmitted to humans by Culex mosquitoes. This zoonotic
disease was first discovered in New York in 1999 and is now the dominant
vector-borne disease in this continent. Currently there is no particular
treatment or vaccine. After Hurricane Katrina, the incidence of West Nile
neuroinvasive disease (WNND) sharply increased in the hurricane-affected regions of Louisiana and Mississippi. As of June 24, 2008, the State
of Mississippi is among 7 states in the United States that have reported
human West Nile virus infection, including severe neuroinvasive forms
(http://www.cdc.gov). West Nile virus infection is a hazard in the aftermath of flooding that may accompany natural disasters such as hurricanes
or heavy rainfall. Our objective was to analyze the trends in numbers of
human infections in Mississippi and its neighboring states of Alabama,
Arkansas, Louisiana and Tennessee. We obtained data from the Center for
Disease Control CDC (http://www.cdc.gov/ncidod/dvbid/westnile/index.
htm) on the number of cases that were reported for each state. Graphs of
the months in which human infection cases were reported in each state
were downloaded from http://www.diseasemaps.usgs.gov. We have analyzed the trends from 2003 to 2007. During the 5 year period Mississippi
and its surrounding states reported a total of 1,476 human WNV infections
and 87 fatalities. Irrespective of the state or number of cases of human
WNV infections reported, most infections occurred during the months of
July and September, with August being the most frequent Highest Incidental Month. The weather patterns during these summer months provide
hospitable conditions that allow the mosquito population to increase,
thus, contributing to the high occurrence of human WNV infections. Loui-
siana reported the highest number of infection cases in 2003, 2004 and
2005 with 124, 109 and 171 respectively. Mississippi reported the highest
number of infection cases in 2006 with 183 cases, and 136 cases in 2007.
Future research will determine the impact of local geographical and occupational differences on trends of WNV human infections in Mississippi
and its neighboring states.
[Acknowledgements: NSF-EPS-0556308; NIH-NCRR G12RR13459-09);
DHS-2007-ST-104-000007; Science and Technology Access to Research
and Graduate Education - Historically Black Colleges and Universities Program funded by the National Science Foundation – Grant Number – HRD0411559.]
51
Searching Potential Plant Species for Biodiesel
Production
Deanna A. Seabrooks, South Carolina State University
Dr. Ajoy G. Chakrabarti, South Carolina State University
Most of the experimental crop seed species used in this research are commonly grown in South Carolina. The production of fatty acids in plants has
a direct relationship with biodiesel production. Seeds usually possess
more lipids in plants, as compared to any other parts of the plant. Plant
lipids usually carry long chain fatty acids attached to glycerol molecules.
Seed lipids can represent the overall fatty acid content of plant species
to be used for biodiesel production. Used vegetable oil is increasingly
being processed into biodiesel, and at a smaller scale, cleaned off water particulates used as fuel. Petroleum ether was used as a solvent for
lipid extraction in the research. The percent lipid per fresh weight of seeds
was measured gravimetrically. The highest percent lipid per fresh weight
of crop seeds was exhibited in mustard, string bean and soybean species; and they were 10.0, 12.05 and 14.2% respectively per fresh weight of
seeds. The highest percent lipid content per fresh weight of weed seeds
was exhibited in crotalaria and cocklebur species, and they were 8.01 to
10.2% respectively. Crotalaria and cocklebur species showed 8.01 to 10%
lipid production per fresh weight of seeds. It is still not a feasible source
for biodiesel production. The cost of raising plants in farm fields will not
be supportive for a fuel economy. The high lipid yield was observed between 10 to 14% in mustard, string bean, and soybean seeds per fresh
weight of seeds among selective crop seed species. The cost for agricultural production will not support the biodiesel production from an economical standpoint. The mechanical extraction of oil is much superior to
the recovery of total lipids using petroleum ether as a solvent.
52
Turning Cotton into Glucose
Rahja’ M. Sharp, Savannah State University
Dr. Hua Zhao, Savannah State University
The objective of this research is to study the effect of ionic liquid-pretreatment on the enzymatic hydrolysis of cotton cellulose. The efficient hydrolysis of cellulose into reducing sugars such as glucose is the first and critical step in turning renewable biomass into fuel ethanol. Currently, there is
an urgent need to efficiently convert cellulose into ethanol.
It is an emerging research to convert inexpensive cellulosic biomass into
fuel ethanol. The enzymatic hydrolysis is a promising method in degrading
cellulose into glucose, which is then fermented into ethanol. The current
hydrolysis methods suffer from slow reaction rates and incomplete reactions. We hypothesized that the regenerated cellulose from ionic liquids
will have more open structures, and thus will be easily hydrolyzed into
reducing sugars.
We completely dissolved cotton in an ionic liquid, 1-butyl-3-methylimidazolium acetate. The cellulose was further regenerated by the addition of
Program Book
A43
Abstracts
water. After filtration and drying, the regenerated cotton was hydrolyzed
in citrate buffer by adding the enzyme cellulase. The reaction mixture was
periodically withdrawn and analyzed by the DNS method. The reaction was
monitored every hour for 6 hrs by taking a sample and mixing it with DNS
reagent. After boiling for 5 min, the absorbance of DNS-glucose solution
was measured by a UV-Vis spectrophotometer. For comparison purposes,
the untreated cotton was also hydrolyzed under the same condition.
In conclusion, from our experiments, we observed that the regenerated
cotton was hydrolyzed into reducing sugars much faster than the untreated cotton. By the end of 6 h, the majority of regenerated cotton was
turned into soluble sugars, while most of the untreated cotton remained
unchanged. Therefore, pretreatment of cellulose by ionic liquids is an effective tool in modifying the cellulose structures and enhancing the enzymatic hydrolysis rate of cotton. This research has demonstrated the
applicability of ionic liquids as non-volatile and environmentally benign
pretreatment agents for the hydrolysis of cellulose and the production of
fuel ethanol.
53
The Synthesis and Testing of Halogenated Piperidines as
Possible Medications for Cocaine Addiction
Leona Smith, Winston Salem State University
Dr. Jill Harp and Antionette Helm, Winston-Salem State University
The widespread abuse of cocaine has stimulated extensive efforts to develop treatment programs for this type of addiction. The National Institute on Drug Abuse (NIDA) has a top research priority to find one or more
medications to reduce the effects of cocaine and to use these medications as part of a comprehensive treatment program. Cocaine analogs,
i.e., tropanes, with high affinity for the dopamine transporter (DAT) attenuate some cocaine effects, but there is often the potential for abuse
of the tropane. Removal of the two-carbon bridge of these tropanes gives
rise to piperidines.
Prior reports have shown that some piperidines act as dopamine reuptake
inhibitors without having reinforcing properties that may lead to abuse.
It is our hypothesis that the synthesis and testing of piperidines derived
from the most potent tropanes may give rise to promising drug candidates
for eventual testing as medications for cocaine addiction. The synthesis,
purification and analysis of the fluoro- and chloro-substituted piperidines
was undertaken in our lab.
54
Comparative Ecological Study: Long Island Pine Barren
Pond’s Sediments
Ha’Wanna St. Cyr, Southern University at New Orleans
Murty S. Kambhampati, Southern University at New Orleans
Dr. Timothy Green, Brookhaven National Laboratory, Upton, NY
The purpose of this research was to collect scientific ecological data on
sediments from the Long Island Pine Barren Ponds including the ponds
on the Brookhaven National Laboratory (BNL) site and to compare results
between the on-site (Zone-I) and off-site (Zone-II) ponds. The specific objectives were to: (a) analyze samples for physio-chemical factors; (b) compile and analyze data statistically; and (c) identify the interrelationships
between abiotic factors in ponds of two zones. We have collected 99 surface sediment samples (<15cm deep at 50 - 200m intervals, depending on
the size of each pond) randomly from 5 experimental sites (Groups 1-5).
Experimental sites were plotted using eXplorist 200 Global Positioning
System (GPS) and ArcInfo Geographic Information Systems (GIS). Sediment samples were air dried, sieved, and saved for elemental analysis
using DCP. Macro and micronutrients were analyzed using LaMotte Soil
Test Kits. Samples were also dried in an oven at 65°C for 36-48 hr to ob-
A44
Program Book
tain moisture. The majority of sediments were acidic and nutrient poor.
Soil texture is mostly either sand or silt. Moisture content varied between
20.98±10.35 to 50.02±6.13% in NRP and BNL samples, respectively. Sediment ANOVA results indicated positive and negative significances (P<0.05
and P<0.01) between elements, aluminum (Al), iron (Fe), lead (Pb), and
chromium (Cr). In conclusion, the Long Island Pine Barren pond sediments
are acidic and nutrient poor. Sediments have higher concentrations of
metals (Al and Fe) in general. Future research is needed to identify the interrelationships between biotic and abiotic factors in these unique types
of ecosystems in Northeast USA.
55
Construction of N-Terminally Deleted Vpu Proteins For
Expression and Localization Studies in HeLa CD-4 Cells
Tiffany Steele, Morgan State University
The HIV-1 protein, Vpu, is inserted into the membrane of the rough endoplasmic reticulum (RER) after synthesis in the cell through the first 27
N-terminal amino acids of the protein. Vpu functions by binding to the
CD4 Receptor protein while it is being synthesized in the RER, then presents CD4 for destruction through the ubiquitin-proteasome pathway. My
research project is designed to develop Enhanced Green Fluorescence
Protein (EGFP) fused Vpu proteins that are missing part or all of the membrane spanning hydrophobic region of the protein, and to investigate the
ability of the soluble EGFP-Vpu proteins to induce the intracellular degradation of the CD4 Receptor in transfected HeLa-CD4 cells. To construct
Vpu gene segments missing 11 codons and 27 codons, respectively, from
the 5’-end of the HIV-1 Vpu gene, two oligonucleotide primer sets were
designed with 5’-BamH1 and 3’-EcoR1 restriction enzyme sites, and used
in Polymerase Chain Reaction (PCR). The PCR amplified Vpu gene segments, which code for the soluble cytoplasmic region of the HIV-1 Vpu
protein, were digested with BamH1 and EcoR1 restriction enzymes to create sticky ends and were ligated into the BamH1 and EcoR1 ends of the
pEGFP-C1 plasmid to generate two recombinant Vpu expression plasmids,
pEGFP-ΔN1Vpu and pEGFP-ΔN2Vpu, respectively. These recombinant Vpu
expression plasmids will then be used in DNA transfection experiments
in the HeLa-CD4 cell line for analysis of Vpu expression and subcellular
localization, and for investigating the intracellular stability of the CD4 Receptor. [This study was supported by NSF HRD grant #0506066, and NCRR
RCMI grant #5G12RR017581-05.]
56
Ecological Investigations on Long Island Pine Barren
Ponds: Water Quality
LaTonya Stemley, Southern University at New Orleans
Murty S. Kambhampati, PhD., Southern University at New Orleans
Timothy Green, PhD., Brookhaven National Laboratory, Upton, NY
The purpose of this research was to collect scientific ecological data on
water from the Long Island Pine Barren Ponds including the ponds on
the Brookhaven National Laboratory (BNL) site and to compare results
between the on-site (Zone-I) and off-site (Zone-II) ponds. The specific
objectives were to: (a) analyze samples for physico-chemical factors; (b)
compile and analyze data statistically; and (c) identify the interrelationships between abiotic factors in ponds of two zones. We have collected
99 surface water samples (<15cm deep at 50 - 200m intervals, depending
on size of each pond) randomly from 5 experimental sites (Groups 1-5).
Experimental sites were plotted using eXplorist 200 Global Positioning
System (GPS) and ArcInfo Geographic Information Systems (GIS). Field
data were obtained on dissolved oxygen (DO), temperature, pH, turbidity,
and conductivity using Yellow Spring Instruments, Inc. (YSI) probe. Water
samples were analyzed using HACH DR890 colorimeter. Filtered and acidified water samples (pH<2) were used to estimate metal content using a Di-
Abstracts
rect Coupled Plasma Spectrometer (DCP). Water was acidic (5.31±0.35 to
6.84±0.13 at CP and GP, respectively) and low in DO (4.12±0.89 to 6.92±0.55
ppm at CP and SBP, respectively). Alkalinity ranged from 27.71.1±60 ppm
in BNL ponds to 82.9332±0.50 ppm in GP. One-way ANOVA results indicated mean differences between groups (df = 4) and within groups (df =
28). In conclusion, the Long Island Pine Barren pond waters are acidic and
nutrient poor. Future studies are needed to explore the interrelationships
between water quality and biota such as phytoplankton, microbes, salamanders, and sunfish that are living in these habitats.
57
Zooplankton Distribution, Standing Stock and Biomass on
the Georgia Shelf (South Atlantic Bight)
Ebony Steverson, Savannah State University
Carol Pride, Savannah State University
The purpose of this investigation was to determine the biomass, standing stock and distribution of zooplankton in Georgia Shelf waters from
samples extending from Wassaw Sound to the mid-shelf. Samples were
collected from five different stations along a transect extending off shore
with stations 10 nautical miles apart. The surface temperature along the
transect ranged from 14.5-17.30 C over the course of the day. The salinity
ranged from 31.7 PSU in the estuary to 36.0 PSU at stn. 8. Copepods were
the prevalent zooplankton with relative abundances of 18-63%. Zooplankton biomass was highest in the estuary (Wassaw Sound), dropped just
off-shore, and increased to the mid-shelf. This biomass pattern was unexpected and deserves further exploration. There is inconclusive support of
a potential decrease in the diversity of zooplankton off-shore.
58
Comparison of Seedling Fitness in the Hyperaccumulator
Alyssum murale in Soils With and Without Nickel
Iman Sylvain, Howard University
Mary McKenna, Howard University
Alyssum murale Waldst and Kit (Brassicaceae) is a nickel-hyperaccumulator plant originating in serpentine areas in the Mediterranean with
naturally high levels of soil nickel. A. murale has a remarkable ability to
accumulate and compartmentalize high levels of nickel without apparent
phytotoxicity (Broadhurst et al 2004), and high interest has developed in
developing this species for phytoremediation (Li et al, 2003). This study examined the effect of seed origin, soil type, and seed weight on the growth
and survivorship of A. murale seedlings. Seeds from plants grown with or
without nickel were individually weighed and planted singly in 2 in2 plastic
cells containing pure commercial soil (Sunshine Mix #3) or commercial
soil amended with 500 ppm nickel (1:1 Ni acetate: Ni sulfate). Effects of
seed origin and soil type were compared by two-way ANOVA with seed
weight as a covariate. Seeds produced by plants grown in soil with nickel
had significantly greater seed weight (p=0.020), germination percentage
(p=0.000) and shoot weight (p=0.009). Seed weight had a significantly
positive effect on germination (p=0.000), leaf number (p=0.026), shoot
weight (p=0.042) and root weight (p=0.008) after six weeks. Although A.
murale germinated equally well on soil with and without nickel, seedlings
grown in soil with nickel had significantly greater numbers of leaves (p
=0.000), shoot biomass (p=0.000) and root biomass (p=0.000) after six
weeks. This study suggests that soil nickel has a positive effect on seedling fitness in A. murale. The data also indicate that seed origin (from soils
with or without nickel) also had a very significant effect on fitness by influencing the probability of germination and significantly affecting seedling
biomass, regardless of what type of soil the seedling develops in. Seeds
from plants produced on soil containing nickel were twice as likely to germinate (on both types of soil) as seeds produced from plants grown on
soil without nickel. The strong positive growth response in the presence of
nickel combined with the seed and seedling weight advantage of offspring
originating on nickel soils, suggests nickel plays a powerful role in influencing seedling fitness in A. murale. This positive response to soil nickel
is likely to influence the colonization patterns and competitive ability of
A. murale on serpentine and non-serpentine soils. Understanding this
response is important because the role of edaphic factors in influencing
endemism and competitive ability of serpentine species has long been of
interest to plant ecologists. In addition, because Alyssum murale is under
development for phytoremediation and phytomining of nickel-rich soils in
North America, it is important to explore the potential for this species to
spread inadvertently to soils adjacent to target sites.
Program, Mary A McKenna, PI]
59
Protein Profile of Alloscutum, Cement Cones, and the Eggs
of Female Ixodid Tick: Dermacentor Variabilis
Chantrice Tate, LeMoyne-Owen College
Sabita Majumdar, Jasmine Scott, and Samill Meriwether, LeMoyneOwen College
The protein profile of the Alloscutum, cement cones and the eggs of female Ixodid Tick Dermacentor variabils is presented. Once the ticks enter their final feeding phase, rapid engorgement, they were removed
from their host (rabbit). The alloscutum was dissected from three different stages of feeding in the life of the adult tick: unfed, partially fed and
fully engorged and ovipositing. The alloscutum and cement cones were
collected and cleaned with 1% tetra-borate tetra hydrate. The eggs were
collected within five to six hours of laying. The samples were individually
homogenized with (Bio-Rad-Sequential Extraction kit) solutions to extract
the proteins.
Following centrifugation the supernatant was collected, subjected to 1D
SDS PAGE, and stained with R-250 Coomasie Blue stain. It is hypothesized
that additional proteins are added to the alloscutum during the slow feeding stage but not in the rapid engorgement stage, and that proteins are
removed from the cuticle during oviposition.
In this study, proteins specific for (a) cement cones, (b) alloscutum of partially fed when compared with the un-fed, fully-fed and ovipositing stage,
and (c) eggs are reported.
Future work: With the extracts of the alloscutum of selected feeding stage,
cement cones and the eggs –we will run a 2D gel and blot on to PVDF
membranes. From the 2D gel, selected spots of interest will be manually
picked and sequenced by matrix-assisted laser desorption/ionization
time of flight (MALDI-ToF). A BLAST search of other arthropod sequences
will also be done.
60
The Role of MESD and Chibby in Normal Mouse
Development
Luisa Torres, University at Albany
Dr. Bernadette Holdener, Janet Chang, and Dr. Ken-Ichi Takemaru,
Stony Brook University
One approach toward understanding embryonic patterning is to study
mutations that disrupt development. This study focuses on examining
two genes previously shown to be essential for normal mouse embryogenesis.
Loss of mesd function (mesoderm development) blocks gastrulation and
mesoderm differentiation in mice. Polarity defects likely result from improper localization of Wnt co-receptors LRP5/6, which are members of the
low-density lipoprotein related receptors
Program Book
A45
Abstracts
(LRP) family. Using immunohistochemistry, we suggest that localization
of other members of the LRP family, such as LRP2, may also depend on
MESD.
The second part of this study focuses on the small nuclear protein Chibby
(Cby), an inhibitor of the Wnt/b-catenin pathway. Perturbations to this
pathway have been implicated in a variety of human diseases, especially
cancer. Approximately 30% of mouse embryos lacking Cby die during development; but the exact stage at which this occurs is still unknown. By
photographing embryos at 10.5 days after fertilization, we identified abnormal embryo morphology that might be associated with lack of Cby during embryogenesis, though we did not observe a consistent phenotype
among the mutants. For future work, the exact stage of embryonic lethality will be determined by dissecting mice at later stages of development.
61
Synthesis and Characterization of Azo-Dye Salicylidene
Derivatives as Anion Sensors
Brandon Vice, University of Southern Mississippi
Dr. Yousef Hijji, Morgan State University
Dr. Alvin Holder, University of Southern Mississippi
Sensor 1 was synthesized by mixing 1:1 mole ratio of F-azodye and 2-aminophenol in DMSO then recrystallization to give the sensor. The structure of
1 was confirmed by NMR, and the purity was shown by TLC and had a sharp
melting point. Sensor 1 was determined to be anion sensor based on the
observations of significant colorimetric change upon treatment with anions. Strong binding and color changes were observed with F¯, AcO¯, and
H2PO4¯. A significant red shift was observed in the UV spectra with a new
maxima at 481 nm while the original maxima at 350 nm decreased. Other
anions used such as Br¯, Cl¯, ClO4¯, and HSO4¯ did not show significant
color change when titrated with 1 or any significant change in the visible
spectrum. Job’s plots indicated a 1:1 ratio for anion to sensor in the three
cases. The binding constants were in the order F¯> AcO¯> H2PO4¯.
62
Approaches to Clone the Promoter Region of Human NK
Cell Receptor CS1
Randall Walker, University of Arkansas at Pine Bluff
Stephen O. Mathew and Porunelloor A. Mathew, University of North
Texas Health Science Center
The immune system is a complex network of specialized cells and organs
that has evolved to defend the body against attacks by “foreign” invaders.
Natural killer (NK) cells are part of the innate immune system and form the
first line of defense against various cancer and viral infections. NK cells
have the ability to kill certain cancer cells without prior stimulation, and
their function is regulated by a delicate balance between activating and
inhibitory signals received through cell surface receptors. CS1 (CRACC,
novel Ly9, CD319) is one such activating receptor and is expressed on NK,
T, and activated B cells. CS1, a self ligand, activates NK cells when there
is CS1-CS1 interaction. In our study, we have attempted to clone the CS1
promoter region to further understand the gene regulation of the human
NK cell receptor CS1. We isolated the genomic DNA from human whole
blood and using standard PCR techniques attempted to clone the putative promoter region of the human CS1 gene to better understand how
the CS1 gene is regulated and expressed. Understanding the regulation
of gene expression will shed more light on how CS1 stimulates NK cells to
effectively target and kill cancer cells. This will allow us to make attempts
towards developing better immunotherapy treatments for different cancer
types.
A46
Program Book
63
CXCL12 and CXCR4 mediate Remyelination in the Central
Nervous System
Clorissa Washington, Benedict College
Dr.Jigisha Patel and Dr. Robyn Klein, Washington University
Multiple sclerosis (MS) is a demyelinating disease of the central nervous
system (CNS) in which the brain and spinal cord may become severely
damaged. This process of demyelination is believed to be due to the actions of infiltrating myelin-specific T-cells. Post-mortem tissue specimens
from patients with MS indicate that remyelination does occur to some
extent, but the process is inconsistent, and its failure leads to severe
axonal injury. Understanding the molecular mechanisms that regulate
demyelination and remyelination are important for identifying potential
targets to prevent the former and promote the latter. Prior studies have
implicated the chemokine CXCL12 and its receptor CXCR4 in the biology
of myelination. CXCL12 is expressed by demyelinated neurons and CXCR4
is expressed by oligodendrocyte precursor cells (OPCs). Our lab utilizes a
copper chleator, cuprizone, to examine remyelination in the CNS. C57Bl6
mice fed 0.2% cuprizone-embedded chow for 12 weeks predictably develop extensive demyelination of the corpus callosum (CC). Cessation of
cuprizone feeding is associated with remyellination of the CC and astrocyte expression of CXCL12. In order to examine the role of CXCR4 signaling duiring remylenation, subcutaneous pumps containing AMD3100, a
CXCR4 antagonist, or phosphate buffered saline (PBS) were implanted.
Continuous administration of AMD3100 leads to decreased numbers of
NG2+CXCR4+ oligodendrocyte precursor cells (OPCs) in the CC during remyelination and decreased myelin. In conclusion, the results demonstrate
that the presence of CXCR4 antagonism inhibits myelin production.
64
Autotomy and the Clinging Performance in Spiny Lizards
(Sceloporus genus)
William Webb, Howard University
George Middendorf III, Howard University
Losos (1990) and Zani (2000) have shown that morphology has a significant effect on the performances of lizards in the areas of locomotion, agility, and balance. My study focused on a different aspect, clinging, and the
effect of tail loss. My hypothesis was that the clinging ability of lizards
should be dependent on the structure of the foot, toes and nails and is
not necessarily affected by tail autotomy. The clinging ability was tested
by placing lizards on a sheet of 100 grit sanding-paper. I placed a slip knot
at positions on the neck, behind the forelimbs, and in front of hind limbs
of each lizard. This was attached to a 50 g Pesola scale which was pulled
at 0 , 45 , 90 , 135 , 180 angles until the lizard lost its grip. Lizards were
then randomly assigned to either a tail autotomy or control group. Following autotomy of at least 50 percent of their tail (autotomy group), clinging
performance of all lizards was reexamined. The position and angle of tension, and the sex of the lizards all affected clinging performance. For Sceloporus virgatus, the average clinging performance of males was better
than that of females. The clinging performance of the lizards decreased as
the angle position of the pull exerted on the lizards approached a perpendicular position. Clinging performances were greatest for pulls closest to
the position of tension. Lizards were least able to sustain pulls directed in
opposition to the site of tension, e.g. in a posterior direction to an anterior
attachment location. The correlation between sex, the angle at which lizards were attempting to cling, and the position of tension during clinging
performance all suggest that there may be several factors affecting the
clinging ability of lizards. The differences in performance between genders
may be influenced by the size of the lizards. This will be examined in future
studies. The position of tension may influence the balance and center of
gravity for the lizards, particularly as influenced by the morphology of the
Abstracts
lizard toes and claws. To examine the effects of these possible variables,
further experimentation will be conducted to observe the performance of
lizards in similar size classes, lizards with intact and autotomized tails,
and compare toe and claw morphology by examining another species of
the Sceloporus genus (S. jarrovii) that inhabits a different microhabitat.
Program, Mary A McKenna, PI.]
65
Encapsulation of Drug Reservoir (BSA-f ) in PLA by
Electrospinning of Emulsions
Zaynah Welcome, Alabama State University
Elijah Nyairo, Alabama State University
67
Osteonectin (SPARC) Expression Correlates with PSA
Recurrence after Radical Prostatectomy
Yelekal Fiteh, University of the District of Columbia
Deepak Kumar, University of the District of Columbia
Y. Fiteh, B. Furusato, C.A. DeRosa, Y. Chen, L. Ravindranath, C. Cook,
J. Cullen, D.G. McLeod, G. Petrovics, I.A. Sesterhenn, S Srivastava,
University of the District of Columbia, Center for Prostate Disease
Research, Uniformed Services University, Walter Reed Army
Medical Center, and the Armed Forces Institute of Pathology,
Washington, DC
Conventional methods of polymer fiber production rely on mechanical
forces to produce fibers by extruding polymer solution through a spinneret and subsequently drawing the fibers as they solidify or coagulate
to produce typical fiber diameters in the range of 5 to 500 microns. Electrospinning is a unique method that produces fibers with diameters in the
nanometer range using electric potential to initiate spinning of a charged
polymer solution. Polymer fibers (scaffolds) with nanoscale dimensions
have high porosity with interconnected pores and a high surface areato-volume ratio that makes them ideal for several bioengineering applications, such as tissue regeneration, biosensors, and drug delivery
applications. Our research is driven by the hypothesis that improved biocompatibility of polymeric scaffolds can occur by attempting to replicate
the natural “architecture,” composition and functionality of the native extracellular matrix (ECM). In this work, polymer nanofibers were produced
by electrospinning poly(lactides) such as poly(lactic acid) (PLA) and
poly(lactide-co-glycolide) (PLGA) as well as poly(e-caprolactone) (PCL).
The nanofibers were characterized based on morphology using SEM and
on thermal properties using DSC. In addition, FT-IR spectra of the electrospun polymer nanofibers were recorded. Drug encapsulation efficiency
and drug release characteristics of the scaffolds were studied.
Global gene expression profiling in prostate cancer (CaP) highlighted alterations of the SPARC gene. SPARC is a secreted glycoprotein that supports the migration of CaP cells to bone and demonstrates increased expression in metastatic foci (met-CaP) as well as CaP cell lines. We found
that quantitative determination of SPARC expression in mRNA levels
showed potential ability to predict clinically aggressive behavior. We further assessed SPARC expression in protein level to test whether SPARC
protein expression levels and mRNA levels would be similar or different
in prostate cancer. Radical prostatectomy (RP) specimens were employed
for validating SPARC expression in protein levels by utilizing immunohistochemistry (IHC). Grade and stage matched samples were retrospectively selected and specimens were stained with antihuman SPARC antibody.
SPARC expression was correlated with clinical-pathological features. In
mRNA level, using Student t-test and ANOVA, higher SPARC mRNA expression was found in patients with overall Gleason sums of 8-9 (N=26,
p=0.0061) and with poorly differentiated cells (N=23, p=0.0137). KaplanMeier unadjusted survival analysis revealed that patients with the highest
SPARC expression across median split groups (p=0.0186) had increased
risk of PSA recurrence (mean f/u 46.5 months). The comparative evaluation of mRNA and SPARC protein levels in primary specimens will be discussed. This research will contribute to the endeavor of early identification of prostate tumors with predictable bad outcome.
66
The Effects of Extracellular Calcium on Dictyostelium
Motility
68
Corticosterone Does not Impair CD8+ Memory T cell
Function.
Nicole Whitfield, Allen University
Ran-Der Hwang and David Knecht, University of Connecticut
Randon Young, Savannah State University
Kathleen Ashcraft and Robert Bonneau, Pennsylvania State
University College of Medicine
Motility is a fundamental process carried out by eukaryotic cells. Calcium
ions regulate many of the molecular processes that are essential for cell
movement. We hypothesized that the increase in cell speeds was due to
an increased calcium concentration in the cytoplasm of the cells. To investigate that role, we modulated the external calcium concentration in
growth medium and measured the effect on cell movement using Dictyostelium discoideum cells as our model organisms. Dictyostelium cells were
grown in HL5 growth medium, harvested and allowed to attach to a 60mM
petri dish for 30 minutes. The HL5 medium was removed and replaced
with FM defined growth medium. The cells were then incubated overnight.
Images were collected every 15 seconds using Micro-Manager software.
Data were collected for 30 minutes in growth medium before addition of
calcium or gadolinium. Cells in FM growth medium move at an average
rate of about 2 µM/min. Comparing over a range of 50 µM to 1 mM Ca2+,
the higher the calcium added, the faster the cells moved. Gadolinium ions
are known to block channels in the plasma membrane that allow calcium
entry from the external medium. However, the data show that treatment
of cells with gadolinium caused an increase in cell speed. Future work
will focus on directly measuring the intracellular calcium concentration
in each condition to directly measure how the various treatments affect
calcium dynamics.
In the United States, 58% of individuals are Herpes Simplex Virus-1 seropositive. HSV-1 is a large, double-stranded, DNA virus that is commonly
associated with oral and genital lesions. Such viruses are generally controlled by locally residing CD8+ T cells, but may spread to the brain of
neonates and immunosuppressed adults. During an infection, the virus
spreads from cell to cell. Thus it is unable to be contained by antibodies.
Accordingly, a T cell-mediated immune response is necessary to eliminate
the infection.
CD8+ T cells recognize and eliminate virally-infected target cells. These
cells have receptors that are specific for a particular antigen and recognize peptides displayed by major histocompatibility complex (MHC) class
I molecules. The interaction of CD8+ T cell receptors with MHC class I molecules, along with simultaneous recognition of appropriate co-stimulatory signals, induces T cell proliferation. Following activation, CD8+ T cells
that recognize their cognate peptide release proteases called granzymes,
thereby inducing the infected target cell to undergo apoptosis. This process is referred to as degranulation.
Following clearance of an infection, the majority of activated T cells migrate to the gut and are eliminated. However, roughly 5% of activated T
cells differentiate into long-lived memory T cells (CTLm). Upon re-chal-
Program Book
A47
Abstracts
lenge with the same pathogen, CTLm are rapidly activated and undergo
clonal expansion, with less stringent co-stimulation requirements, and
often clear the infection before it becomes clinically apparent.
Corticosterone is a hormone produced by rodents in response to psychological stress. Generally, exposure to corticosterone results in immunosuppression. Previous studies in our laboratory have shown that corticosterone decreases T cell numbers, reduces their proliferation, and impairs
their anti-viral function. However, the effects of corticosterone on CTLm
reactivation and degranulation are not known.
In our experiments, we used 2D5 cells, a previously described syngeneic
CTLm clone which is specific for the HSV-encoded, H-2Kb-restricted immunodominant peptide gB498-505. In the studies presented here, we first
adapted an in vitro assay for use with the 2D5 clones. This was done to detect degranulation following stimulation. Next, we evaluated the impact
of corticosterone on degranulation. Stimulating cells in the presence of
corticosterone did not reduce degranulation. Furthermore, pre-treatment
for 12 or 24 hours also showed no reduction in the ability of the cells to
degranulate. Future work will extend the studies presented here by examining the amount of interferon-gamma produced, along with the amount
of granzymes being expressed within, and released by, cells treated with
corticosterone.
69
Use of Transposon Mutagenesis to Identify Genes
Involved in Virulence Activation of Vibrio Cholerae
Jun Zhu, University of Pennsylvania
Karissa Grier, Savannah State University
Vibrio cholerae is a facultative gram-negative bacterium which causes
cholera, the severe intestinal disease still endemic in the world. V. cholerae has two different living conditions: the aquatic environment and the
host intestine. V. cholerae can regulate its gene expression in response to
the environmental variation, which is the key reason for V. cholerae’s as
a successive pathogen. To colonize a host intestine efficiently, the toxincoregulated pilus (TCP) genes expression is necessary. In our preliminary
research, we found that there is a factor that exists in the intestine that
can activate the virulence gene expression of V. cholerae, including TCP
biosynthesis genes. In this research, we use genetic screening methods to
find the genes related to TCP expression induced by the virulence induction factor (VIF) isolated from the intestine, which will help to discover the
secret and the mechanism of V. Cholerae colonization in host intestines.
70
The Apoptotic Effect of Vitamin E Succinate on Pancreatic
Cancer Cells
Lydia Yimer, University of the District of Columbia
Dorrelyn Patacsil, Francisco Sáenz, Anh Thu Tran, Sylvester Osayi
and Deepak Kumar, University of the District of Columbia
Vitamin E Succinate (VES α- tocopheryl succinate) is the most potent
analog of Vitamin E that selectively induces apoptosis in cancer cells by
modulating the expression of Bcl-2 family proteins. VES has been studied
extensively as a chemopreventive, chemotherapeutic, and chemosensisitizing agent in various cancer types. However, there is limited data
on the role of VES in pancreatic cancer. Pancreatic cancer is the number
four cancer killer in the US, and about 32,000 new cases are reported
every year. The five year survival rate is only 5%. We used WST-1 cell proliferation assay and western blotting to investigate the effects of Vitamin
E Succinate on pancreatic cancer cells. We have found that VES inhibits
cell proliferation and induces apoptosis in COLO-357 and PANC-1 pancreatic cancer cell lines in a time and dose dependent manner. Cell cycle and
apoptosis related proteins play an important role in growth regulation of
A48
Program Book
cancer cells. Various signaling pathways such as Mitogen Activated Protein Kinase (MAPK) Phosphoinositide 3-Kinase (PI3) are suggested to be
involved in the proliferation of cancer cells. Cell Cycle regulation by cyclin
dependent kinases and cyclins are also important. Regulation of various
proteins in different signaling pathways after treatment with Vitamin E
Succinate in pancreatic cancer cells will be discussed. The present study
was jointly supported by NSF funded HBCU-UP grant and UDC AES grant.
Computer & Information Sciences
71
A* Algorithm for GPS Path Finding
Trevil Baker, University of the Virgin Islands
Marc Boumedine, University of the Virgin Islands
With the recent growth in the use of highly accurate geodetic surveying techniques, primarily due to the widespread adoption of GPS by the
surveying community, the desire developed for a general framework for
the optimal design of GPS surveying networks. GPS allows us to perform
precise positioning at a fraction of the cost required by traditional methods. However, the time and cost of achieving this precision on networks
can only be optimized if the logistics of the GPS fieldwork are properly
investigated. This study presents and analyzes an example of a path finding problem and the time taken to calculate the shortest path. Therefore,
rather than adopting normal shortest path search methods, a best first
search that employs heuristics will be used to produce good and time efficient results.
A* (A Star) search algorithm is an example of a Best-First search that uses
a more complex heuristic to select a path through the tree. It is an admissible heuristic method that provides optimal solutions and guarantees to
find the shortest path. In this research, A* search algorithm is proposed.
The proposed algorithm is adjusted and customized to suit the conditions
on the road network. [Acknowledgement: This work is partially supported
by NSF CSEMS Award number 0123074]
72
Bioinformatic Investigation of Iron Metabolism in the
Bdellovibrio Bacteriovorus Genome
Mema Bamba, Morgan State University
Dr. Eric Sakk, Morgan State University
The genome of Bdellovibrio bacteriovorus (B.bacteriovourus) has recently
been sequenced and annotated. However, many genes and regulatory sequences involved in the predatory and reproductive phases of its life cycle
still remain enigmatic. In this work, we present results from bioinformatic
and computational analyses of the B.bacteriovorus genome. In particular,
this presentation focuses on novel genes and regulatory sequences that
appear to play a role in iron metabolism. Based upon existing literature
and by applying various bioinformatic tools, we have identified several
operons containing genes implicated in iron metabolism. In addition to
these novel genes, we also identify associated regulatory sequences using two approaches. First, we extract noncoding DNA sequences upstream
of the operon candidates and perform a multiple alignment. Second, regulatory sequence models are constructed based upon existing literature
and string searches are performed using these models. The two approaches are then compared in order to verify the regulatory sequences. After
identifying operons containing genes implicated in iron metabolism and
regulatory sequences, future steps in our investigation will focus on mapping out the iron metabolism system within the bdellovibrio bacteriovorus
genome. [This research is supported in part by NSF0506066].
Abstracts
73
GPU Implementation of Scientific Computation
Applications
Chanelle Green, Spelman College
David Kaeli, Diego Rivera, Northeastern University
James Hale, Spelman College
This project demonstrates the use of novel technologies for the purpose
of solving Scientific Computation Applications. Graphics Processing Units
(GPUs), which usually handle graphics rendering in game consoles and
computers, are equipped with a highly parallel and scalable architecture
that is perfect for handling intensive computations. NVIDIA GTX8800
cards were used and programmed using an NVIDIA specific middleware
known as CUDA. By studying the architecture of the GPU, we were able to
develop computation intensive programs in such a way that they efficiently made full use of its 128 stream processors. We then put our knowledge
to use with a real world application.
The Imaging Division of Massachusettes General Hospital developed an
iterative Digital Breast Tomosynthesis (DBT) technique to improve the accuracy and efficiency of Breast Cancer detection. The serial version of the
algorithm returned an execution time of 4,157 seconds (70 mins), while
the GPU implementation took only 349 seconds (6 mins). We were able to
modify the code to print necessary data between iterations to ensure that
the algorithm was running efficiently. We also began modifying the algorithm to enable it to run on multiple GPUs. Through GPU implementation,
we achieved an increase in both time and cost efficiency.
74
Java Based Reasoning System
Mitchell Jackson, Bowie State University
Dr. Darsana Josyula, Bowie State University
The purpose of this research is to create a reasoning system that accepts
a set of axioms to produce new information. The reasoning system has
two components: the knowledge base and the inference engine. The goal
of the reasoning system is to continually modify its knowledge base using
its inference engine.
The Knowledge Base of the reasoner can store facts and rules in the following format, where A and B are predicate symbols, X is a variable and
c is a constant.
The rules use the existing facts in order to create new facts; thus, increasing the size of the knowledge base as the program runs. The project consists of the following two steps:
Creating the Knowledge Base and Implementing an inference mechanism
to apply on the Knowledge Base in order to produce new facts.
The first step involves creating a knowledge base for storing all the rules
and facts. The knowledge base is implemented as three Java data structures that interact to store and process data efficiently. All the axioms in
the input file are stored in a Hash Map. The key of the Hash Map acts
as the formula number that other data structures can use to identify an
input rule or fact. The formulas in the Hash Map are organized into a Tree
Map such that the structure of each formula is accessible. Unique formula
numbers act as the index for this Tree Map. If the formula is a rule, then it
is structured as an implication with an antecedent and a consequent. The
antecedents and consequents are stored as disjunction or conjunction of
2 atoms. If the formula is a fact it is stored either as a simple atom or as a
disjunction or conjunction of 2 atoms. Each atom is stored as a predicate
name, a list of terms and each term is stored as a variable or a constant.
The last data structure is a Tree Map of all atoms and the number of the
formula to which each atom is associated with. The Tree Map is indexed
by predicate names to provide an easy access to all atoms with the same
predicate name. The terms in the atoms are stored as constants or variables as in the previous Tree Map of formula structures.
The second step involves implementing the Generalized Modus Ponens
inference mechanism. If A(X) Λ B(X) á C(X), A(‘c’) and B(‘c’) occur in the
Tree Map of formulas, the variable X in A(X) is unified with the constant
in A(‘c’) to obtain the substitution X/’c’. This substitution is applied to the
rest of the formula to replace X with the constant ‘c’. After the substitution, B(‘c’) is unifiable and hence a new formula C(‘constant’) is obtained.
This new formula is then added to the storage structures, allowing the
new formula to be used by the inference mechanism during the next read
of the storage structures to produce other formulas.
75
Building Lego Mindstorms NXT-G Robots to Enhance
Problem Solving Skills of Programmers
Derren Lewis, Albany State University
Courtney White, Albany State University, Professor Gwendolyn
Campbell, Jamaz Hall, and Carl White, Albany State University
Lego Robots are machines designed using Lego blocks that can be used for
programming purposes. In this project, two robots were created using the
Lego Mindstorms NXT Development kit to demonstrate how programming
Lego robots can enhance programming skills following the steps of the
programming development cycle (analyze the problem, write the pseudo
code, draw flow chart, program in high level language, and input/debug).
The first robot (MACS) was designed to wait until an object is placed in
front of him, give a warning, wait ten seconds, and attack. The second
robot (BEBOP ZITTI) was designed to walk toward the first robot and walk
backwards before it is attacked by MACS, the first robot. The programming
code was uploaded to the NXT (an intelligent, computer-controlled Lego
Brick also known as the brain of the robot). Each brick in the program
represents a movement. The NXT consists of four sensors (touch, sound,
light, and ultrasonic) and three motors. The NXT is just one of almost 580
pieces used to assemble the robots. The tools in the program that allow
the robots to perform certain actions are called blocks. The move block
controls the robot’s motors and synchronizes its movement. The Record/
Play block allows the user to record a physical movement with the robot
and then play back the recorded movement elsewhere in the program.
The Sound block is used to play a sound file or different tones. The Display block allows the user to display an image, write some text, or draw a
shape on the display screen. The Wait block allows the user to sense its
environment for a specific condition before it continues with the program.
The Loop block allows the user to be able to make the robot perform a certain action over and over again. The Switch block allows the robot to make
its own decisions, such as going left when it hears a loud noise and going
right when it hears a softer noise. Future research is needed to determine
how to control the movement of the second robot, BEBOP ZITTI, based on
the sound commands from the second robot, MACS.
76
Creating a Healthcare Humanoid
Jazmine Miller, Spelman College
Andrew Williams, PhD, Spelman College
Ayana Howard, PhD, Georgia Institute of Technology
Robots are a technological innovation that can be designed to aid our
society in numerous ways. The objective of this research is centered on
building a humanoid robot and integrating it with a vision software by manipulating it to recognize color and specific objects. These capabilities can
assist small children and the mentally disabled by becoming a playmate;
and further evolve into a method in which to assist the elderly and physically disabled people in everyday tasks such as fetching objects; and even
in hospitals as aids for patients with color coded objects without needing
Program Book
A49
Abstracts
the aid of a nurse. Using the Kyosho Manoi AT01 robot kit, we build a humanoid programmable robot and customize it by incorporating a camera,
thusly integrating the hardware of the robot with robotic vision software.
By manipulating both the servos and the color values for the vision, the
humanoid will have the ability to recognize objects, colors, and motion.
Utilizing these capabilities, this robot can without a doubt, aid with small
children and the mentally disabled. This research can inherently improve
a mentally ill child’s education and simultaneously remove some of the
stress packaged with disabled and immobile individuals.
77
Installing Collaborative Virtual Machine on Win32
Stephanie Moore, Alabama State University
Timothy Holland, Alabama State University
CoLinux is a subclass of a virtual machine (VM) such as WMware, Bochs,
and VirtualBox that uses the real machine resources to construct a virtual
operating system on a real (physical) machine. The advantage of constructing a real machine with multiple virtual operations system configuration will allows seamless intercommunication betweens the machines
resulting in software multiplication and productivity with the result that
windows 98, XP, Vista, and Linux can be consolidate into one machine as
virtual operating systems. This configuration will allow the integration of
proprietary and open source applications under one machine.
The purpose of this project is to adumbrate the procedures to download,
install, and configure CoLinux and Virtualbox (VB) on Windows’ XP. CoLinux and VB can be used to install various versions of Linux on Windows,
but in this development, the Fedora Core 6 (FC6) version of Red Hat Linux and Ubuntu 7.0 are used as the virtual OS on windows’ XP machine.
CoLinux is used to install FC6. Subsequently, using the same paradigm
as above, another Linux OS (Ubuntu) is installed onto windows XP using
virtualbox. As a result, the two virtual OS (FC6 and Ubuntu) is integrated
in one XP machine in order to compare the efficacy of memory management in the real machine under the two VMs. Between the two VM, VB was
more efficient than CoLinux, used less memory, and communicated better
with the real machine (XP). Since the VMs shares memory with the real
machine, the integrated system requires at least 2 gigabyte of RAM and at
least 100 gigabytes of hard drive space. The installation of WMware and
Bochs was beyond the purview of this project and was not installed.
78
Comparing the Two Major Image Compression Algorithms
JPEG & GIF Used on the Web
Marlon Richardson, University of the Virgin Islands
Dr. Marc Boumedine, University of the Virgin Islands
Image compression today plays great importance in many different areas
that utilize images as their eye catcher, so to speak. This encourages users to explore web pages in more depth and also plays a great role to
help users understand what they are doing. Image compression is minimizing the size, in bytes, of a graphics file without degrading the quality
of the image to an unacceptable level. The reduction in file size allows
more images to be stored in a given amount of disk or memory space. It
also reduces the time required for images to be sent over the Internet or
downloaded from Web pages.
For Internet use, the two most common compressed graphic image formats are the JPEG format and the GIF format. The JPEG method is more
often used for photographs, while the GIF method is commonly used for
line art and other images in which geometric shapes are relatively simple.
Image compression can be lossy or lossless. Lossy methods are especially
suitable because the loss of fidelity is acceptable to achieve a substantial
reduction in bit rate.
A50
Program Book
The problem today is that JPEG and GIF are so well used that new users
are unsure of which to use. This research uses both compression algorithms on different image types in an effort to find and compare in the
fields of image quality, space performance and the greatest factor of all visual representation. The final results caused us to accept our hypothesis,
because the JPEG compression algorithm produced better overall results
than that of the GIF compression algorithm.
79
Security Issues in Principal Component Analysis for Face
Recognition
Donald Thompson II, North Carolina Agricultural and Technical State
University
Dr. John Paul Roop and Phylicia Lockhart, North Carolina Agricultural
and Technical State University
Technology is changing everyday and the way people decide to use technology is becoming more dangerous. Biometrics provides a way to secure
information in a technical world. This particular project goes into the
biometrics system of face recognition, where we discuss the process of
Principal Component Analysis and its utility in face recognition. Principal
Component Analysis (also referred to as PCA) is an algorithmic technique
used in the process of face recognition. After giving a step-by-step illustration of PCA, we will then present our trials and experiments. There are
three experiments we used to illustrate the application of PCA to face recognition and the accuracy of face recognition itself. The first experiment
utilized a database of individuals from Cambridge University Engineering
Department, and the final two experiments used images of participants
from the Summer Information Assurance Program 2008 at North Carolina
Agricultural and Technical State University. We have provided tables and
figures of our experiments to illustrate our results and an explanation of
the results, the imperfections, and possible solutions to enhance this process. Furthermore, our project led us to important conclusions about the
reliability of face recognition in biometric security.
80
Study of Embedded Controllers
Samuele Whaley, South Carolina State University
Dr. Nikunja Swain and Lerond Freeman, South Carolina State
University
In today’s world, embedded systems (microcontrollers) are everywhere -homes, offices, cars, factories, hospitals, wireless devices and consumer
electronics. Their huge numbers and new complexity call for a new design
approach, one that emphasizes high-level tools and hardware/software
tradeoffs. The recent technological advances have produced very powerful microprocessors and revolutionized the electronics industry. But this
also requires many external circuits to build a complete microprocessor
system (memory, peripheral interface chips, and several support circuits)
and makes the development process time consuming and complex. On
the other hand, a microcontroller is a whole computer system on a chip,
integrating central processing unit, memory, input/output ports, and
some peripheral devices (timers, converters, etc.). Thus, microcontrollers
simplify the design of many embedded products, which in addition have
smaller size and lower power consumption. Thus, while high performance
microprocessors are used in powerful computers, modest microcontrollers
are embedded in multiple products in many application areas. Embedded
controllers are becoming part and parcel of every industry and industries
need a trained workforce to manage this new development. As a result,
the engineering, technology, and science programs are under pressure to
incorporate microcontrollers into their curriculum, so that their graduates
can be well trained in the use and application of these changing technologies and serve the needs of the industrial community. The study of micro-
Abstracts
controller system design involves very different topics, such as processor
architecture, programming and interfacing; which students should learn
and practice. There follows a need for suitable training tools; both software (assemblers, simulators) and hardware (boards, emulators). Most
embedded controllers today are programmed using high and low level
computer languages such as C and Assembly. When dealing with these
computer languages, there are certain syntax that must be followed for
the embedded controller to carry out the task given. Assembly language,
in terms of Mnemonics, requires conversion in to machine language. C
language is in terms of natural language that requires conversion into
assembly language, then into machine language. Both languages have
to be converted to hexadecimal via a compiler, because the embedded
controllers only understand this number system. After programming the
embedded controller with these languages, devices such as liquid crystal
displays, light emitting diodes, and seven-segment displays can be interfaced to perform the commands given by the embedded controller. This
project achieved these important objectives.
81
Determining The Optimal Programming Technique
Daryl T. White Jr., Morgan State University
Dr. William Lupton, Morgan State University
A programming algorithm can be defined as a set of rules or methods
designed for computer programming. There are various different kinds
of programming algorithms. For example, agile programming, aspectoriented programming, and literate programming just to name a few. All
of these methodologies where designed to fit a specific purpose or need
in which most where created for business solutions. Since algorithms are
generally created to serve a certain purpose, one may want to design a
technique that would be useful in a fast-paced or competitive environment. One may combine several techniques used from existing methodologies to enhance and complete a methodology designed for competitive
programming needs. This new algorithm would then have to be tested to
see if it serves its purpose. If the methodology is not successful in accomplishing the goal it was designed for, then it may be modified with
software engineering techniques. Ultimately, one can determine whether
or not this methodology is an optimal programming technique for a fast
paced or competitive environment.
82
Educational Tools to Assist Students in Understanding
Concepts in Computer Science, Especially Recursion
Amber Williams, Mississippi Valley State University
Dr. Wolfgang Pelz, Mississippi Valley State University
Recursion is the process of defining something in terms of itself (Lewis
& Depasquale, 2009). It is a declarative approach to computer programming. When a method is called, the method continues to loop until it has
satisfied the purpose of the function that is being performed. There are
many problems that use recursive concepts. Those problems include the
Fibonacci sequence, factorial, and binary sort. These problems are used in
a number of programming software applications similar to Java. Different
methods can be used to explore and aid in the understanding of recursive
concepts. The use of textual models is characteristic in teaching recursive
concepts. Textual models are common because all programming software
is text-based; however, some programming applications use visual output
similar to Java. Visual models are infrequently used in programming; as a
result, it sometimes takes students longer to learn recursive concepts. It
would be ideal to use visual models to introduce these concepts because
visual models heighten the human senses. This simply means that pictures grasp the human interest more easily than words. People are able
to visualize what is actually going on with the problem they are program-
ming. Informally, visualization is the transformation of data or information into pictures (Schroeder, Martin, & Lorensen, 1996). Visualization
employs the major human sensory gland, vision, and power to process
things more clearly in the human mind (Schroeder, Martin, & Lorensen,
1996). In computer science, visualization is termed scientific visualization.
This term encompasses user interface, data representation and processing algorithms, visual representations, and other sensory presentation
such as sound and touch (McCormick, 1987). Using the Java programming
language and the jGrasp programming software, tests will be conducted
on the theory to prove that incorporating visual aids with textual models
will enhance students’ ability to learn recursive concepts.
Ecology, Environmental & Earth Sciences
83
Effect of Environmental Conditions on Biomass Production
and Cellulose Composition in Different Verities of Switch
Grass
Amber N. Davis, Fort Valley State University
C. Neal Stewart Jr., Joseph J. Bozell, Joshua S. Yuan, and Nicole
Labbe, University of Tennessee
Switch grass is rich in cellulose, which could make it an ideal candidate
for biofuel, especially for ethanol production. Unlike corn, switch grass
is a perennial and has a large biomass output while needing little fertilizer. Decreased lignin composition has been shown to render two major
advantages: plant biomass with decreased lignin could be more easily
processed for saccharification, and reduced lignin biosynthesis may lead
to more carbon allocated to sugar synthesis and thus lead to a higher
amount of cellulose and hemicelluloses production. In this study we will
compare two different switch grass types: Alamo, a population, and Alamo 2, a clone derived from Alamo, to determine their lignin content. The
two different types will be further investigated by their growth conditions
(field grown or chamber grown) and by their maturity (flowering or no flowering) to determine how these conditions might effect their lignin content.
It is known that stems and leaves have different chemical compositions;
therefore our research will focus completely on the stems of the feedstock
and on the biomass compositions. We have used infrared spectroscopy
techniques to distinguish the chemical differences of the stems from the
switch grass, especially lignin. Wet chemistry technique was also used to
measure the chemical composition of each sample and to quantify the
differences. [This work was supported in part by a grant from the National
Science Foundation, HBCU-UP/Targeted Infusion to Prof. Seema Dhir at
84
Examination of Caffeine Levels in Caffeinated and
Decaffeinated Consumer Products
Adriana Hawkins, Dillard University
Dr. Lovell Agwaramgbo, Travis Demley, and Kelsey Joseph, Dillard
University
Caffeine is widely used as a naturally occurring stimulant and psycho-active drug. It has an effect on the central nervous system and mental function. It stimulates the sympathetic system and triggers stress response
which produces anger, fear, anxiety, increased heart rate and blood pressure, tremor, rapid shallow breathing, and jittery feelings. Caffeine is usually found in coffee beans, tea leaves and cocoa. It is so potent that it acts
as a natural pesticide for plants by killing off invasive bugs. The fear of
such effect drove many people into decaffeinated products. However, the
decaffeinating solvents, such as dichloromethane, used in the decaffeination process may leave some residues that are harmful to humans. Many
Program Book
A51
Abstracts
consumers do not know their daily amount of caffeine intake, nor do the
producers list the caffeine content of many consumer products. This study
decided to investigate the caffeine content of many caffeinated consumer
products and decaffeinated consumer products, which had caffeine levels
between 4-8%. In order to calculate the caffeine concentrations, a 5000
ppm caffeine solution is made the control, and three diluted concentrations were tested to set a calibration curve. In the case of coffee and tea,
a 2 g or 1 serving bag (where applicable) of each product was prepared
with hot water and diluted to 250 ml of solution. For the beverages, a nine
fold dilution was done on each product directly using distilled water. A
2000 ppm solution of caffeine was prepared (2.00 g in 1L solution) using
authentic caffeine samples from Fisher Scientific. Several dilutions were
made to obtain a calibration curve and to determine the detection limits
and absorption wavelength using a Shimadzu UV-2550 Spectrophotometer. Results suggest that tea has the highest caffeine content of all beverages and that decaffeinated beverages still contain more caffeine than
reported on the product labels. In conclusion, a future study of this experiment will contain a study of decaffeinating caffeinated and decaffeinated
products by using charcoal and filtering the products as well.
85
The Affects of a Dominant Competitor, Distaplia
occidentalis, on Species Richness and Community
Structure in Humboldt Bay, California
Gabrielle Jones, Fort Valley State University
Dr. Sean Craig and Matt Nelson, Humboldt State University
Distaplia occidentalis is a common colonial sea squirt that forms a large
canopy over the substrate. D. occidentalis is found on solid substrates
in fouling communities which are characterized by high species richness
and rapid species turnover. In Humboldt Bay, CA, recruitment panels
were placed 1 m under the docks at the Woodley Island Marina to test
the hypothesis that species richness is reduced by the presence of the
colonial ascidian Distaplia occidentalis, which outcompete other species
for space. Six months prior to the start of the experiment, natural communities of marine invertebrates were established by deploying artificial ABS
plastic panels (10 x 15cm) below these docks to allow natural settlement
and community development of a marine “fouling” community. Twentyone of these panels were used in the experiment, ten of which contained
a high percent cover of D. occidentalis, while the remaining eleven panels
had all D. occidentalis removed. After removal, these settlement panels
were left under the docks for four weeks to examine the effects of this
colonial sea squirt on further growth and development of the community.
Digital photographs of the panels were taken every two weeks to examine
canopy-level changes in growth and species richness through time. After four weeks, the twenty-one panels were removed from the docks and
brought back to the Telonicher Marine Laboratory for analysis. All species
on these panels were identified and counted, and those living under or
around D. occidentalis were noted. The results of this study indicate that
more species occur in communities without D. occidentalis, while fewer
species were found on panels dominated by D. occidentalis. In conclusion, D. occidentalis is a highly successful competitor which recruits in
high numbers and grows straight up, mushrooming out to take over the
canopy. Future research will investigate the mechanisms by which D. occidentalis outcompetes other species. [This work was supported in part
by a grant from NSF/ HBCU-UP awarded to Dr. Sarwan Dhir, Director for
Center for Biotechnology at Fort Valley State University].
A52
Program Book
86
Sequencing the Sixth Chromosome of the Potato Genome
Lillian Oglesby, Fort Valley State University
Robin Buell, Mike Geoffrey, and Steven Lundback, Michigan State
University
Alkaline Lysis, in combination with the detergent SDS (Sodium Dodecyl
Sulfate) has been used for more than 20 years to isolate plasmid DNA
from E. coli. BAC-by-BAC DNA sequencing is used to find the sequence for
the entire Potato Chromosome Six. After completion, comparisons can be
done to see if the results are similar to the Solanaceae relatives. Making
a shotgun library seems to be the safe way to recover the Potato DNA for
further research. Polymerase chain reaction (PCR) is used to replicate the
potato DNA. Recent tests show that during Midi preparation plasmid DNA
may be isolated from bacterial cultures by treating them with alkali and
SDS. The results from this Midi-prep can be used for analysis by electrophoresis or restriction endonucelease digestion. Nebulization is a method
used to cut the DNA into smaller pieces. Electrophoresis is done to get
the size of the DNA that we want from the gel. By ligating the Potato DNA
and Vector, it can be transformed into E. coli that can be replicated and
inoculated onto agar plates to grow. Plasmid DNA can be amplified by
cell-pop PCR directly from bacterial colonies plucked from the surface of
agar media with toothpicks. The results are formed once the DNA strand
is sequenced. A small sample of shotgun clones is test sequenced. BLAST
is then used to check if these sequences match any existing Potato DNA
sequences. Once the entire chromosome has been sequenced, chromosome 6 will be put together with the other 12 chromosomes to determine
its significance. [This work was supported in part by grants from the National Science Foundation, DBI 2010 Plant Genomics program at Michigan
State University and HBCU-UP/Targeted Infusion to Prof. Seema Dhir at
87
Mapping of QTL Involved in Early Tomato Fruit Ripening
Charles C. Okonkwo, Fort Valley State University
Valeriano Dal Cin and Harry J. Klee, University of Florida
Early ripening of fruits is an important trait with high value to farmers.
Efforts to develop varieties with earlier ripening are therefore a valuable
target for breeders. We are working to develop earlier ripening tomato varieties by screening a population of introgression lines that resulted from
a cross between a tomato (Solanum lycopersicum) and the wild relative,
S. habrochaites. We previously identified several lines from this population in which ripening occurs 3-5 days earlier: LA-3934, 3943, 3931, 3938,
and 3959. Plants of these lines were transplanted 30 days after germination in a field. Experiments were performed on at least two groups of
three plants randomly distributed in the field. Fruits were collected at four
harvest dates from each group and staged according to USDA ripening
guideline: breaker (B), turning (T), pink (P), light red (LR) and ripe red (R).
In order to verify if earliness affected weight, at least 30 fruits per line
were weighed. Fruit production for lines 3938 and 3934 was earlier than
the parental control, 4024. LA-3934 showed a higher number of fruits in
both the first and second date, whereas LA-3938 only showed this in the
second date. These results validated the results from the previous season. LA-3931, LA-3934 and LA-3938 produced significantly more fruit than
the control whereas LA3958 produced many less fruit. The screening with
genetic (CAPS) markers confirmed the presence of the donor genotype in
the position expected in the different introgression lines. The early ripening phenotype was partially confirmed for LA-3934 and LA-3938. All
the lines will have to be retested in the field in the fall season to assess
whether season affects the trait. Furthermore, some other physiological
parameters that may play a role in time to ripening will be assessed. In the
case of the lines showing the best phenotype, new CAPS markers will be
designed and the progeny screened for recombinants in aid of the map-
Abstracts
ping of the QTL. Furthermore, these lines will be crossed to other commercial varieties to verify if these loci affect time to ripening in other varieties
and to improve existing varieties. [This study was supported by NSF grant
DBI – 0501778 awarded to Dr. Harry Klee and by USDA Capacity Building
grant awarded to Dr. Sarwan Dhir at Fort Valley State University.]
90
PV and Renewable Energy Research: Introduction of
Renewable Energy System in High School Curriculum
88
The Trophic Role of Herring in the Puget Sound
In this increasingly consumer-oriented world, the power market is soon
becoming one of the few in which consumers do not play an active role
in the maintenance of the dependability and quality of the product, the
power supply. In an attempt to increase the contribution of consumers
in the maintenance of a dependable power supply, a power management
system is to be designed which will utilize real time data, will monitor the
quality of the supply and indicate steps where needed to pre-empt irregularities in the supply.
Delawrence Sykes, Morehouse College
Dr. David Beauchamp and Elisabeth Duffy, Morehouse College
Pacific herring Clupea harengus are considered a keystone species in
Puget Sound, Washington because they are both the primary planktivorous fish species and an important prey species for predatory fish, birds,
and mammals. Given their important roles as consumers and prey, a quantitative examination of their feeding habits and rates will be an important
step toward understanding the food web dynamics of Puget Sound. In recent years mid-water trawling surveys indicated a slow decline in Pacific
herring biomass. Probable factors for this decline include changes in food
supply, climatic and environmental variation, competition, or predation.
Stomach samples were examined from juvenile salmon, smelt, and other
planktivores in mid-water trawling samples during July 2008 and from frozen archival samples from other seasons. These analyses will determine
seasonal and inter-annual variability in diet composition of herring and
the degree of dietary overlap with other planktivores. It is postulated that
if diet of Pacific herring overlaps significantly with diets of other planktivorous species, then competition among species could be a factor in recent
herring decline in the Puget Sound .
89
Isolation and Characterization of Listeria and Salmonella
from Organic Produce from a Delaware Farm
Johnny Taylor, Delaware State University
Clytrice Austin-Watson and Andy Wetherill, Delaware State University
Organically grown produce has become very attractive to consumers
seeking to improve overall health and reduce the risk of exposure to toxic
pesticides and herbicides used in conventional farming. The safety of organic produce has raised concerns regarding the risk of exposure to potential pathogenic organisms. The purpose of this study was to evaluate
the level of aerobic/mesophillic bacteria associated with organic produce
and to investigate the presence of Listeria and Salmonella spp. in organically grown produce from a Delaware farm. Samples collected included
Arugula, broccoli Raab, chard, potatoes and tomatoes. The presence of E.
coli/coliforms was also evaluated using 3M E.coli/coliform count plates.
Enrichment procedures for Listeria monocytogenes and Salmonella were
done and evaluated on palcam and XLT4 media respectively. The presumptive pathogens were gram stained for further characterization and
subjected to API E20 or API-Listeria. Confirmation of the presumptive
Salmonella isolates was inconclusive based on the API. Three of the four
presumptive Listeria isolates were identified as L. monocytogenes, L. innocua and L. grayii. E. coli/coliform bacteria are indicators organisms for
the presence of other pathogenic organisms and were not detected on the
produce tested in this study. The total mean population counts for aerobic
bacteria for tested produce are as follows: arugula-7.5 log/CFU, broccoli
raab-8 log/CFU, chard-7.8 log/CFU, potatoes-6.4 log/CFU, and tomatoes6.2 log/CFU. This study provides preliminary data for future investigation
regarding the safety of organic produce.
Kelly Watson, Howard University
Dr. James Momoh and Dr. Gerunda Hughes, Howard University
Nevertheless, education on renewable energy plays a key roll in the distribution of the management system. This paper will discuss the importance
of starting that education in high schools and an idea of how to instruct
high school students on renewable energy and the power management
system that will be constructed. Education is valuable in order to promote
options for the consumer world since consumption depends on people’s
understanding and awareness. Education in the area of renewable energy
will bring about changes in behavior and lifestyles, to disseminate knowledge and develop skills, and to prepare the public to support changes
toward the future of renewable energy systems.
High school students would be the target student audience representing
the public at large, in order to “sensitize” them on the potential of renewable energy and to develop familiarity and positive attitudes towards it.
Teaching and educating high school students requires careful consideration of the approach and pedagogy.
The approach that will be taken will be pedagogy based on psychologist
Howard Gardner’s theory of Multiple Intelligences (1983) which is widely
used in education today. Gardner defines intelligences as “the capacity
to solve problems or to fashion products that are valued in one or more
cultural setting”. Gardner originally created seven multiple intelligences
including Logical-Mathematical Intelligence, Linguistic Intelligence, Spatial Intelligence, Musical Intelligence, Bodily-Kinesthetic Intelligence,
Intrapersonal Intelligence, and Interpersonal Intelligence. Also included
will be educational psychologist Benjamin Bloom’s Taxonomy of Education Objectives, often called Bloom’s Taxonomy. It is a classification of the
different objectives and skills that educators set for students; learning objectives. The taxonomy was proposed in 1956 at the University of Chicago
and is hierarchical, meaning that learning at the higher levels is dependent on having attained prerequisite knowledge and skills at lower levels.
Bloom’s Taxonomy divides educational objectives into three “domains:”
Affective, Psychomotor, and Cognitive. A goal of Bloom’s Taxonomy is to
motivate educators to focus on all three domains, creating a more holistic
form of education. A lesson plan will be constructed that adheres to the
District of Columbia Standards of learning for K-12 science. The overall
goal of teaching high school students about renewable energy is to inform
future consumers about its advantages in hopes of a changed energy market in prosperity.
91
The Effects of Urbanization on the Growth and
Reproduction of Alliaria petiolata (Garlic Mustard,
Brassicaceae)
Saundra Wheeler, Fort Valley State University
Dr. Steven Franks and Dr. James Lewis, Fordham University
Urbanization often encourages the growth of invasive plants. Invasive
plants displace native vegetation and disrupt habitats as they become
established and spread over time. Garlic Mustard (Alliaria petiolata) is an
Program Book
A53
Abstracts
invasive biennial flowering plant in the mustard family, Brassicaceae. We
examined the effects of urbanization on garlic mustard growth and reproduction.
We established plots containing garlic mustard in urban and suburban
sites and measured plant density and cover, growth, and seed number as
well as leaf and soil nitrogen and light interception. We found that after
accounting for differences in light interception, there is no difference in
plant growth in urban and suburban sites.
While the analysis of nitrogen is not yet complete, we expect that soil nitrogen will be higher in urban than in suburban areas, and that this will
lead to an increase in plant tissue nitrogen concentrations, plant growth
and allocation to reproduction in urban areas. Furthermore, increased nutrient reserves should allow urban plants to better compensate for herbivory than suburban plants. If the findings are as expected, then there
is evidence that urbanization facilitates plant invasion through increased
nutrient inputs.
We observed fungal and some bacterial infections on some of our field
samples. We plan to perform DNA analysis to identify the source of infection. We will also examine what caused the herbivory we observed in our
field studies. We also plan to use seeds that will be collected at the end of
this growing cycle to further study phenology in garlic mustard.
Physical & Mathematical Sciences
92
Investigating Thermal Distribution of MicrowaveIrradiated Emulsions
Sarah Addae, Morgan State University
Dr. Alvin P Kennedy, Morgan State University
Oil in water liquid emulsions were used as models for temperature studies of microwave irradiated emulsions. A complete understanding of this
mechanism can lead to practical applications in the food, petroleum and
pharmaceutical industries. Comparative studies done on the heating profiles of emulsions and layered systems show that emulsions have higher
heating profiles. This is being attributed to the presence of droplets. A
significant increase in energy occurs when microwaves are repeatedly reflected within the micelle due to differences in refractive index between
the two immiscible liquids. Hence, temperature within the droplets is suspected to be higher than in the dispersed phase. Since droplet radius is on
a micrometer scale, thermocouples used in studying layered systems cannot be employed in the thermal studies of emulsion droplets. Therefore,
chromophores will be used to study thermal energy changes by studying
the ultra-violet spectrum of irradiated emulsions which have been incorporated with a suitable dye. The Emulsions of hexane in distilled water of
varying concentrations were prepared using Tween 20 as surfactant. Heating profiles of these emulsions were obtained as irradiation proceeded.
Layered systems made up of the same proportions of hexane and distilled
water were studied as controls. Heating profiles of emulsions were higher
than that of layered systems, leading to the conclusion that the presence
of droplets greatly increased heating. Emulsions were studied using differential scanning calorimetry. The heterogeneous nature of emulsion
sampling indicates that DSC studies are best for qualitative studies. Reichardt’s dye, due to its applications in probing micellar environments,
was the chosen chromophore in studying changes within micelles. The
dye was characterized using a Beer Lambert’s plot of absorbance versus
concentration. It was not found to be soluble in both hexane and distilled
water hence investigations are ongoing to effectively incorporate Reichardt’s dye into the emulsion. [This study was supported, by NSF-RISE
grant number NSF HRD 0627276 awarded to the Chemistry Department
Morgan State University, Baltimore MD 21251]
A54
Program Book
93
SH-wave Propagation in Heterogenous Media Using 2D
Finite Difference on Staggered Grid
Kossi A. Agbeve, North Carolina Agricultural and Technical State
University
Dr. Guoquing Tang, North Carolina Agricultural and Technical State
University
Geophysicists have the capabilities to model the behavior of waves that
propagate through the Earth using their computational abilities. To be
able to accurately find the numerical solutions to seismic wave propagation, they solve the fundamental partial differential equations (PDEs)
and model and plot the numerical solutions of the PDEs. The finite difference method (FDM) that consists of transforming the partial derivatives
in difference equations over a small interval was widely used to simulate
the seismic wave propagation. This paper will describe the physical characteristics of the shear wave propagation and the governing equations
used in the approximation of the shear wave propagation. Next, in the
numerical analysis, we will discuss the discretization on the staggered
grid mode and the excitation source of the wave. Then we will use appropriate absorbing boundary conditions coupled with stability conditions to
model our equations. Matlab computer programming will be developed to
simulate the shear wave propagation using the finite difference method
by solving the iterative difference equations numerically and to mesh the
numerical solution and finally interpret the results.
94
Efficient Synthesis of Enaminones Using Ammonium
Acetate Under Microwave Conditions.
Chidi Anyanwutaku, Morgan State University
Dr. Hijji, Morgan State University
Enaminones are versatile intermediates for the synthesis of many natural
and pharmaceutical compounds such as anticancer drugs, oxytocin antagonists, and interesting heterocycles such as pyrroles and pyridines,
antiepileptic drugs,and anticonvulsants. Previous syntheses of these
compounds suffer from low selectivity, high cost of substrates, and associated environmental problems. The purpose of this project is to efficiently
synthesize enaminones under microwave irradiation and to determine the
effect of varying the stoichiometric ratios of the reactants. Reaction mixtures consisting of 1,3-diones and ammonium acetate in 1 to 2 ratios, 1 to 1
ratios and 1 to 3 ratios, respectively, were heated under the microwave for
three minutes at 1500C in a Biotage synthesis microwave. No solvent was
needed, and the products were purified by washing with diethyl ether and
by recrystallization. The formation of products was confirmed via melting points, thin layer chromatography, and NMR. The 1 to 1 ammonium
acetate to ketone ratio showed a minimum yield of 69%, the 2 to 1 ratio
showed a minimum yield of 81%, and the 3 to 1 ratio showed a minimum
yield of 98%. The results show no clear differences as a result of the varied
stoichiometric ratios. The process is simple, quick and high yielding and
demonstrates the efficiency of this microwave synthesis technique. Future
work involves varying the reaction temperatures and times to see if and
how such variations affect product formation and yield. [This study was
supported by a grant from NSF- UP 0506066]
Abstracts
95
Interactions of Cyclooctapeptides Containing Cys2/His2
or Met2/His2 Residues with Some Common Heavy Metal
Ions
Kshawna Askew, Winston Salem State University
Maria Ngu-Schwemlein, Winston-Salem State University
Optical sensors for the detection and identification of heavy metal ions
have been given great attention in the area of environmental chemistry.
While there are recent reports of such sensors, we are particularly interested in developing cyclopeptide-based scaffolds for selective metal ion
binding and sensing. Previous studies by our group showed that P1, a
model acidic cyclopeptide [D-Leu-Leu-D-Leu-Trp-(D-Glu-Glu)2] exhibits selective binding and sensitive fluorescent signals towards Hg2+ and Pb2+.
The present study was undertaken to investigate the interactions of cyclooctapeptides containing the zinc finger binding motifs ((Cys2/His2 and
Met2/His2 domains) with heavy metal ions (Pb2+, Hg2+ and Cd2+). Cyclo
[D-Leu-Leu-D-Phe-Met-D-His-Met-D-His-Lys-Trp] (P2) and cyclo [D-Leu-LeuD-Phe-Cys-D-His-Cys-D-His-Lys-Trp] (P3) were prepared for this study. Their
metal-ion binding and associated thermodynamic parameters were evaluated by isothermal titration calorimetry (ITC). Specific metal ion signaling
by these cyclooctapeptides containing the intrinsic Trp fluorophore was
assessed by fluorescence spectroscopy to study how the bound metal ion
modulates the Trp fluorescence emission properties. The ITC binding isotherms of P2 and P3 for these heavy metal ions show two strong binding
sites for Hg2+, a relatively weaker binding affinity for Pb2+ and negligible
interaction with Cd2+. Their interactions with Hg2+ and Pb2+ are enthalpically and entropically driven. The results from this study show that the
binding affinity trend for Hg2+ is P3 > P2 > P1. However, P2 shows the
highest selectivity in fluorescence response to the presence of Hg2+. Variable temperature Stern-Volmer plots show that the bimolecular quenching between P3 and Hg2+ is through strong complex formation. Changes
in the UV-Vis spectrum for the Trp chromophore absorption indicate that
Trp was involved in the complex formation with Hg2+. The above study
shows that the zinc finger binding domains in fluorophore-tagged cyclooctapeptide scaffolds are promising receptor units for selective heavy metal
ion binding. Appropriately, fluorophore-tagged cyclooctapeptides containing Cys2/His2 domains could be useful chemosensors for Hg2+. [This
study was supported, in part, by a grant from NSF-RUI, awarded to Maria
Ngu-Schwemlein Ph.D., Chemistry Department, Winston-Salem State University, Winston-Salem, NC 27110].
96
Pre-Cooled Chemical Reations
Ghea Barden, Morgan State University
Dr. Yousef Hijji and Dr. Alvin Kennedy, Morgan State University
The objective of this experiment is to prove that microwave irradiation on
pre-cooled chemical reactions, with the use of a cooling bath, will provide
a slower and better approach to completing these reactions that would
normally take place under room temperature. By first testing different solvents, such as Acetontrile or Hexane, we study the different profiles. Then
by testing different reactants we can find what works best in a chemical
reaction. Since the reaction being used is heated from a temperature that
is below zero (for example-40), it shows information about the reaction
mechanism that would not usually appear or would usually be destroyed
if the reaction was at room temperature. The temperature profiles for
chemical reactions that were previously cooled and then heated to about
1000C were taken and compared to temperature profiles of the same reactions heated from room temperature to 100°C to determine any similarities and differences. Some chemical reactions are damaged once they
reach a certain temperature, but we plan to prove that if the reactions are
first cooled, it will allow more time for the reaction to take place. With this
information, scientists will no longer have to use the traditional approach
for conducting a chemical reaction. [This study was supported, in part by a
grant from NSF 0506066 and HBCU-UP Program awarded to Dr. Alvin Kennedy PhD, Department of Chemistry, Morgan State University, Baltimore,
MD 21251.]
97
Explorations in Microwave-Assisted Perkin
Rearrangement Reactions
Rena Bartee, Savannah State University
Karla-Sue Marriott, Savannah State University
Synthesis of the benzofuran-2-carboxylic acid follows a Perkin (coumarin-benzofuran ring contraction) rearrangement reaction mechanism
in the presence of excess sodium hydroxide in ethanol. The Perkin reaction mechanism entails initial base catalyzed ring fission. The resulting
phenoxide anion then attacks the vinylic carbon to produce an unstable
intermediate carbon anion. Rapid loss of the bromide ion results in the
formation of the benzofuran-2-carboxylic acid. We explored this reaction
under microwave reaction conditions and obtained high product yields
over short reaction times.
98
Thermodynamic Characterization of Carbohydrates
Asha Bolton, Savannah State University
Cecil L. Jones, Savannah State Univeristy
Carbohydrates are the most abundant bio-molecules in nature. As the
products of photosynthesis and the driving force for biosynthesis of energy-rich organic molecules, carbohydrates represent a direct link between
solar energy and life on earth. Before structural analysis, they were once
believed to be hydrated carbon compounds because they have the general empirical formula CH2O. Depending on the number of simple sugar
units they contain, carbohydrates are classified as monosaccharide, disaccharides, oligosaccharides, and polysaccharides. Differential scanning
calorimetry (DSC) was employed to measure the enthalpy change, ΔH,
(heat of fusion) for the structural isomers of three monosaccharides (“single” sugars); glucose, galactose, and fructose. Two monosaccharides can
be linked together to form a “double” sugar or disaccharide. Sucrose, lactose, and maltose are the three disaccharides that were also investigated.
Correlations between the structure and the thermal stability of these compounds will also be determined. Shifts in the baseline of thermograms
recorded by the DSC will be used to measure the heat capacity changes at
constant pressure, ΔCp, materials as they undergo phase transitions.
99
Labeling of Liposomes with Tc-99m for Gamma Camera
Imaging
Kirk Braggs, Langston University
V. Awasthi, University of Oklahoma College of Pharmacy, University
of Oklahoma Health Sciences Center
Liposomes are a lipid-based drug delivery system and are used as a vehicle for a few clinically used anticancer and antifungal drugs. Knowing the
distribution of liposomes after administration may be of interest to determine whether the drug has reached its intended destination in the body.
Labeling liposomes with a gamma ray emitting radionuclide, coupled with
non-invasive imaging can be particularly useful. Our objective was to prepare liposomes capable of being labeled with technetium-99m (Tc-99m).
Methods: Our first goal was to synthesize a lipid that can chelate Tc-99m
while structurally inside the lipid bilayer of liposomes. To this effect we
synthesized, Distearoylphosphatidylethanolamine conjugated to 6-hy-
Program Book
A55
Abstracts
drazinonicotininate (DSPE- HYNIC). The compound was monitored by TLC.
Next, we prepared liposome with distearoylphosphatidylcholine, DSPEHYNIC, dimyristoylphosphatidylglycerol and cholesterol (1:0.07:0.02:1,
molar ratio). The liposomes were allowed to react with Tc-99m as the
pertechnetate, in the presence of stannous chloride reductant and tricine
as a co-ligand. Labeling efficiency was monitored by gel exclusion chromatography with a PD-10 column.
102
Quantum Random Walks with Two Entangled Coins on
One Line
We could successfully synthesize the chelating lipid DSPEC-HYNIC (Rf =
0.5) in high yields - 62%. The labeling efficiency of liposomes containing this lipid ranged from 10-61%. After PD-10 column purification the
labeled product demonstrated >95% radioactivity associated with the
liposomes.
Quantum random walks in one-dimensional discrete lattice with two entangled coins and one particle are studied. Such quantum random walks
are characterized by two features: one is that its spatial distribution of
probability has a spike staying at the initial position and two other minor
spikes traveling off to infinity in either direction; and the other is that the
limiting probability of finding the particle at any location is stationary and
not vanishing.
Liposomes can be successfully labeled with Tc-99m. More work needs to be
performed for optimal conditions of labeling in order to obtain higher labeling efficiency. Future work will entail the use of this technique to follow in
vivo distribution of labeled liposomes with gamma camera imaging.
100
Longitudinal Relationship Among Cognitive Score,
Hippocampal, and Brain Volumes in Late Onset
Alzheimer’s Disease Participants
Shantay Branton, Allen University
Stephen J. Finch and Rose M.E. Saint Fleur, Stony Brook University
The Mental Mini State Examination (MMSE) is a widely used brief cognitive test for the screening of Alzheimer’s disease (AD). It is used to test the
major domains of cognitive functions, including language, visual construction ability, and memory. The hippocampus is thought to be critical for the
consolidation of new memories, that is, the capacity to retain information
over delays. We looked at whether there was longitudinal homogeneity in
the MMSE, hippocampal volume, and brain volume data; whether APOE-4
allele has an association with group membership given that there is heterogeneity; and if the changes of the volume variables were associated
with the changes in the MMSE Score. The SAS PROC TRAJ procedure was
used to test for the presence of heterogeneity with and without the APOE-4
allele. The SAS PROC PLOT procedure was used to fit a basic scatter plot in
the data to find any potential trend between the change in MMSE and the
other variables. Our analysis indicates that there is heterogeneity in the
data. However, APOE-4 allele was not associated with group membership.
We also found that change in MMSE has a strong association with change
in hippocampal volume and brain volume for some subjects.
101
Optical Recognition of Rare Earth Metal Ions with a New
Fluorescent Dendrimer
Essie Collins, Howard University
Galina Talanova, Howard University
Dendrimers are hyperbranched polymeric materials which find application in different fields of science, technology, and medicine. The purpose
of our research is the development of new fluorescent chelator-modified
dendrimers as optical chemosensors of heavy metal ions. Herein, a generation 6 PAMAM2 dendrimer with conjugated Cy3 dye units and diethylenetriamine pentaacetic acid (DTPA) chelating moieties was employed in
recognition of rare earth metal ions. In the preliminary studies, the effect
of La3+, Pr3+, Nd3+, Sm3+, Eu3+, Gd3+, Er3+, and Yr3+ on the dendrimer
fluorescence emission was studied in buffered aqueous solutions at pH
8.3. Complexation of different lanthanide(III) ions with the dendrimer
DTPA units was accompanied by contrasting changes in the fluorescence
intensity of the reagent. Therefore, the fluorescent dendrimer is capable
of selective metal ion recognition.
A56
Program Book
Brian Cunningham, Bowie State University
Jamin Gallman, Dr. Chaobin Liu, and Dr. Nelson Petulante, Bowie
State University
In this project, we only offer theoretical explanations for the first observation in numerical simulations of quantum random walks (QRW). An explicit
formula is given to quantify the height of the observed spike at the origin,
and we locate the two minor spikes and demonstrate that their positions
are determined by the phases of non-degenerated eigenvalues of the time
evolution operator U(k). Theoretical results are illustrated by way of extensive numerical simulations using the software package MATHEMATICA.
103
Characterization of Organic Compounds in the Effluent of
Wastewater Treatment Plants
Zuri Dale, Texas Southern University
Amber Walker, Anthony Maye, Renard L. Thomas, and Bobby Wilson,
Texas Southern University
Houston is the fourth largest city in the United States of America and the
largest city within the state of Texas. Houston is the economic center of
the Houston–Sugar Land–Baytown metropolitan area—the sixth largest
metropolitan area in the U.S. with a population of around 5.6 million.
With so many people living in the Houston area, the issue of contaminants such as pharmaceuticals, steroids, and other organic compounds
in wastewater effluent is becoming a rising concern amongst researchers. The importance of ensuring that wastewater effluent is sufficiently
treated is imperative to ensuring clean surface water. This study was conducted to detect and characterize organic compounds in the effluent of
wastewater treatment plants. Analyzing the components of wastewater
effluent is important because it represents the water being released into
the environment. High Performance Liquid Chromatography is used to
analyze the components of the samples gathered. The instrument identifies contaminants via ultraviolet detection. Samples are collected from
the effluents of multiple wastewater treatment plants in the Houston area.
The wastewater treatment plant being analyzed is 69th Street Wastewater Treatment Plant. Prior studies have shown that this treatment plant
is contaminated with natural and synthetic hormones which leads us to
believe that there may be other undetected contaminants present in the
treated water. The characterization of these organic compounds will aid in
the development of new standards to measure the cleanliness of water for
human consumption.
Abstracts
104
The CDSSOLN Software Package: Efficient Software for
Solving Large Sparse Linear Systems
Moses Davis, Alabama State University
Dr. Carolyn D. Simmons, Alabama State University
The CDSSOLN Software package, written using MATLAB code, was designed by Carolyn D. Simmons, Ph.D. to find solutions to large sparse linear systems. Such systems often arise from elliptical partial differential
equations whose solutions are estimated using finite difference methods.
These linear systems may be symmetric or nonsymmetric in nature. The
CDSSOLN software package is user-interactive and consists of basically
five components: the selection of an iterative method, the selection of a
preconditioner, input of initial settings, the performance of computations,
and the selection of solution output. The objective of this research project
is to revise and update the CDSSOLN software package to include current
MATLAB programming code thus making the software more efficient.
105
Total Phenolic Content and Antioxidant Activity of
Breadfruit Leaf Tea
Andre’a J. Dorsey, University of the Virgin Islands
Dr. Omar Christian, Keisha Christian, Al’Lima deLugo, and
Mutahammis Kareem, University of the Virgin Islands
The total phenolic content of green, yellow, and dried breadfruit leaf teas
was determined using the Folin-Ciocalteau (FC) method. All three teas had
similar total phenolic content; the phenolic content is described in Gallic Acid Equivalence (GAE). Yellow breadfruit leaf tea (YBLT) had a total
phenolic content of 0.032mM GAE/mg tea concentrate, green breadfruit
leaf tea (GBLT), had a total pheloci content of 0.018mM GAE/mg tea concentrate and dried breadfruit leaf tea (DBLT), had a total phenolic content
of 0.027mM GAE/mg tea concentrate. The antioxidant activities of the
breadfruit leaves and vervine are also discussed.
106
Structures and Dissociation Energies of Open-chain N4C2
Kiara Fairman, Alabama State University
Kasha Casey, Jessica Thomas, and Douglas L. Strout, Alabama State
University
Complex forms of nitrogen are of interest due to their potential as highenergy materials. Many forms of nitrogen, including open-chain and
cage molecules, have been studied previously. While many all-nitrogen
molecules Nx have been shown to be too unstable for high-energy applications, it has been shown that certain heteroatoms (including carbon)
can stabilize a nitrogen structure. A molecule that is not 100% nitrogen
will be less energetic, but that energy loss is a trade-off for the improved
stability. In this study, open-chain N4C2 (70% nitrogen by mass) isomers
are studied by theoretical calculations to determine isomer stability and
dissociation energies. Calculations are carried out with density functional
theory (PBE1PBE), perturbation theory (MP2), and coupled-cluster theory
(CCSD(T)). Trends in stability of the molecules are calculated and discussed.
107
Synthesis and Characterization of a Rhenium Complex
of Dipyrazolylmethyl Ferrocene (Fcbis): Development of
Potential Precursors for Fuel Storage Applications
Lukmon Folarin, Winston-Salem State University
Dr. Ken Brown, Winston-Salem State University
Owing to the steep rise in petroleum-based fuel costs and the Federal Government’s Hydrogen Fuel Initiative, current research efforts are focused on
the development of porous solid materials which have the potential to
store gaseous fuels, such as hydrogen, within their voids to serve as fuel
cells for cars, homes, and businesses. Metal-containing organometallic
complexes are being studied for this purpose.
This project serves as a preliminary study to determine the viability of the
ferrocene-based bis(pyrazolyl)methane ligand, dipyrazolylmethyl ferrocene (Fcbis), as a building block for the construction of porous solid materials. The primary objective was to synthesize and characterize (structurally and electrochemically) a novel rhenium coordination complex of
Fcbis. The synthetic route and structural and electrochemical properties
of the rhenium complex, FcbisRe(CO)3Br will be detailed. [This study was
supported, in part, by a grant from the NSF awarded to Dr. Abdul Mohammed, Chair, Department of Chemistry, Winston-Salem State University,
Winston-Salem, NC 27110].
108
Interaction of Adenine with Group 12 Metal Ions
Shandera Gardiner, LeMoyne Owen College
Yahia Hamada, LeMoyne Owen College
Adenine is one of the five nitrogenous bases (adenine, cytosine, guanine,
thymine and uracil) that helps make up the code in DNA and RNA. These
nitrogenous bases pair with one another to make the “step” of the DNA
double-helix molecule. Many researchers reacted Adenosine mono-, di-,
and tri-phosphates (AMP, ADP and ATP) with almost all metal ions, but not
with free Adenine. From the reaction of Adenine and these metal ions, it
appeared that Adenine is bound to these metal ions in a way that is yet
to be identified. Thus far, we have collected the potentiometric titration
graphs and have strong evidence that Adenine is bound to these metal
ions individually. NMR and Speciation data are confirming the binding nature of this ligand to these metal ions.
109
Speciation and Equilibria of Cr3+ with Aspartate in
Aqueous Solutions
Jasmine T. Greene, LeMoyne-Owen College
Yahia Z. Hamada, LeMoyne-Owen College
Interaction of aspartic acid (Asp) with the chromium metal ion (Cr3+) in
aqueous solutions is presented. The potentiometric titrations demonstrate strong Cr3+-Asp interaction with respect to the number of protons
released per Cr3+ ion. The acidic ion exchange resin confirmed the Cr3+ concentrations of the stock solutions. At the pH-value of 1.55 the UV-Vis of the
Cr3+-Asp titration system reflected molar absorptivities with the respective
values of (ε λ nm ) ε 405 ≈ 29 M-1cm-1 and ε 550 ≈ 42 M-1cm-1 due to the
4
A2g > 4T1g and 4A2g > 4T1g Cr3+ d > d electronic transitions respectively. At the
pH-value of 4.10 the molar absorptivities have the respective values of >
405 ≈ 22 M-1cm-1 and > 550 ≈ 32 M-1cm-1 due to same d > d electronic transitions. The corresponding values of the energies at these two wavelengths
appeared to be ≈ 24, 691 cm-1 and ≈ 18,182 cm-1, which are in a good agreement with the Tanabe-Sugano diagrams. These data have been collected
from a system that reached a higher level of equilibrium state.
Program Book
A57
Abstracts
110
A Study of Two Statistical Process Control Problems
Arising in Healthcare
Felicia Griffin, Albany State University
Dr. Zephyrinus Okonkwo, Albany State University
Statistical Process Control (SPC) has a wide range of applications in manufacturing systems, service sectors, and other sectors of the economy where
quality is regarded as very essential for cost minimization, profit maximization, customer satisfaction, competitive advantage, and enhancement
of market share of a product. SPC has also become very essential for the
improvement of quality service and minimization of healthcare cost for the
healthcare industry. This paper focuses on two statistical process problems arising in health; statistical process control problems for outpatient
doctor visits and statistical process control problems for urology surgery.
Solutions to these problems have ramifications on efficient scheduling of
services, optimal use of resources, and optimal use of manpower resources at care centers. These impact improvement of services, minimization of
cost, improvement of image of the hospitals, care centers, and insurance
companies whose goal is to attract more customers in order to increase
their profit margins. Two sets of real data were collected from two doctors, a surgeon and an internist. A urology surgeon stated that it takes a
minimum of 30 minutes to perform a surgery and a maximum of 3 hours
to perform a surgery. The surgeon also stated that the average amount of
time to perform a surgery is an hour and a half. The internist stated that
it takes a minimum of 12 minutes to see a patient and a maximum of 30
minutes to see a patient. No other empirical data was available. This is a
problem of incomplete data. The TI-84 Plus graphing calculator was used
to generate random integers (times) between the maximum and minimum
times for each of the problems. The assumption that the number of surgeries carried out by the surgeons and the number of outpatients seen by
the internist, is large, is in order. By using the random generator menu,
97 random numbers were generated for surgery times and doctor’s time
spent with patients. The numbers for surgery times range from 25 as the
minimum and 185 as the maximum. The numbers for doctor’s time spent
with patients range from 12 as the minimum and 30 as the maximum.
Again, 97 random numbers were generated between these two numbers.
The data is analyzed using statistical tools. Run-Charts are then plotted
using the results. Ramifications of these run charts in SPC for healthcare
is delineated.
111
Liquid Crystal Membrane in Liquid Solutions
Saba Hamidi Vadeghani, South Carolina State University
Antal Jakli and John Harden, Kent State University
We study the optical properties of thermotropic liquid crystal membranes
in water solution.
Many studies have been done on lyotropic liquid crystals that form membranes in water, but this work is motivated by the fact that thermotropic liquid crystals present a better electrooptic response than lyotropics.
Liquid crystal membranes were fabricated using the method of Okuda
[Okuda et al, JJAP. 45:7 (2006)] in an effort to study electrooptic properties of thermotropic liquid crystals underwater. Since thermotropic liquid
crystals are incompatible with water, lecithin was used as a surface-active
agent (SAA) [Okuda et al. ]. Membranes were made using nematic, smectic
and cholesteric liquid crystals. The effects of change in temperature, lecithin water concentration and hole size for stretching the membranes were
studied. Future studies will be done on “banana” bent-core liquid crystals
to be used in sensors and biosystems.
A58
Program Book
112
Information Hiding: Steganography and Images
Kevin Harris, North Carolina A&T State University
Dr. Kossi Edoh and Denecia Scott, North Carolina A&T State
University
Steganography is the science of hiding information within information so
as not to bring suspicion. Modern steganography deals with hiding information in digital picture files, audio files, and video. This study focuses
on steganography within digital picture files, and evaluates the feasibility of the Least Significant Bit (LSB) insertion and Haar wavelet transform
steganography techniques on a larger scale to test the hypothesis that
the Haar wavelet transform is the best technique to implement on a larger
scale. The techniques will be evaluated based on their implementation,
ease of use, and susceptibility to steganalysis attacks. The ease of use
was tested by the ability for a person with basic math knowledge to implement the techniques. The steganalysis attacks were implemented by
statistical analysis, image compression, and visual analysis. All attacks
will be cover-stego-attacks, meaning the steganalyst has access to both
the original image and the stego-image, which contains embedded data.
Future work will compare the discrete cosine transform and fast Fourier
transform with the Haar wavelet transform. Payload will also be discussed
as it relates to steganalysis.
113
Potentiometric Titrations of Malic and Citramalic Acids
with Aluminum in Aqueous Solutions
Marcus Harris, LeMoyne-Owen College
Yahia Hamada, LeMoyne-Owen College
From our ongoing efforts to study the interaction of various hydroxycarboxylates with a variety of essential and non-essential metal ions (Inorg.
Chem. 2003, 42, 3262-3273), (Syn. and Reac. in Inorg. Metal-Org and
Nano-Metal Chem. 2005 35, 515-522), and (Syn. and Reac. in Inorg. MetalOrg and Nano-Metal Chem. 2006 36, 469-476) we are presenting accurate
potentiometric work in aqueous solutions at 25oC for the interaction of
Al(III) with malic acid and Al(III) with citramalic acid. Although malic acid
and citramalic acid have a slight structure difference, (the former has a
hydrogen on its chiral center while the latter has a methyl on its chiral
center); there are great differences in their behavior in solutions independently and when reacting with the Al(III) ion. Our data presented are
in good agreement with what have been reported in the literature. The
proper speciation and simulation diagrams of these reaction systems will
be presented and discussed.
114
Separation of Lanthanide Ions with Kläui Ligand Resin
Victoria A. Henry, University of the Virgin Islands
Stanley L. Latesky and Trinity D. Granger, University of the Virgin
Islands, Greg J. Lumetta, Pacific Northwest National Laboratory
Current procedures for separating and concentrating radionuclides for
detection are complex, and can be both expensive and time consuming. Therefore, the purpose of this research is to attempt an alternative
method of separating lanthanide ions through the use of an extraction
chromatography resin containing a surface adsorbed Kläui ligand salt.
Based on prior research with actinide ions, it is hypothesized that the
lanthanide ions would bond strongly with the Kläui ligand. Klaüi ligand,
C5Me5Co(OP(OR)2)3- (R=Me, Et, i-Pr, n-r)(LOR), has a unique affinity for
lanthanide and actinide ions in the presence of competing metal ions.
The use of 1 wt% NaLOR (R=Et or n-Pr) adsorbed onto resin support was
shown to selectively extract lanthanide ions from aqueous nitric acid solutions of different concentrations. In order to further evaluate the efficacy
Abstracts
of these materials in radiochemical separations, the selectivity of the resins in separating lanthanide ions were examined by measuring the distribution coefficient (Kd) values for Eu+3, Nd+3, and Pr+3 over a range of
solution conditions. As the amount of resin used increased, the Kd value
increased; therefore, the more ligand added to the metal, the more the
lanthanide ions would bind. Future work will involve the determination of
the Kd values for the remainder of the lanthanide series to further assess
the potential of the Kläui ligand for intra-group lanthanide separations.
The success of this research is important, because it will assist in expanding and improving current automated radiochemical methods, which
should lead to a decrease in the cost of developing and implementing.
115
Residual and Delay Effects of Triorganotin Compounds on
Mosquito Larvae
Jana Hoerner, University of the District of Columbia
Dr. Xueqing Song and Dr. George Eng, University of the District of
Columbia
Organotin compounds have been documented to be toxic against various
biological systems. They show a toxicity which depends on the number
and the nature of the organic groups attached to the tin atom. Those containing three carbon-tin bonds, R3SnX, have shown the highest biological
activities. Triorganotins are also species specific and have been shown to
be effective against mosquitoes as well as their larvae. Three series of triorganotin pyretheroids were synthesized and screened for their long term
effects (residual and delay) against three different species of mosquito
larvae; Ae. aegypti, An. stephensi, and Cx. P. quinquefasciatus.
The complexes were synthesized according to literature procedure. The
stock solutions were prepared by dissolving the desired compound in either acetone or 95% ethanol, depending on their solubility. The dissolution of the triorganotins in the organic media was to facilitate the dispersion of the compounds in water. The residual studies were performed with
25 larvae, which were exposed to the compound for 24 hours. The mortality rate was determined through visual counting. Larvae that survived the
24 hours of exposure to the compound were placed into growth trays and
were monitored daily until either all the larvae were dead or pupated/
emerged for the delay studies. Positive and negative controls were also
used.
Preliminary studies indicated that the most effective compounds against
the An. stephensi larvae were the butyrates and the least effective were
the chrysanthemumates. The most effective compounds against the Ae.
aegypti larvae were the carboxylates, with the butyrates having the least
effectiveness against them. The chrysanthemumates showed the longest
effect against the Cx. P. quinquefasciatus. The Cx. P.quinquefasciatus larvae were the least tolerant to all three series of triorganotin compounds.
Based on the averages of all the results, the carboxylates were the most
effective against all three species.
The preliminary data indicated that the carboxylate series appear to be
the most effective; thus future work would involve synthesizing other
carboxylate derivatives and screening them against these three species
of larvae. [Acknowledgment: Financial support from the National Science
Foundation STEM program and MERK/AAAS undergraduate Research Program is gratefully acknowledged.]
116
Phthalocyanines Fluorescence & Singlet Oxygen Quantum
Yield
Tomul Howard, Savannah State University
Cecil L. Jones, Savannah State University
Neti Pleasant, Johnson High
Singlet oxygen, 1O2 (1∆g), which is characterized by its spin-multiplicity, is
a highly reactive form of oxygen. Phthalocyanines are photosensitizers, or
a dye-like species that absorbs light and transfers much of the absorbed
energy to molecular oxygen to produce O2 (1∆g). The relatively high efficiency of O2 (1∆g) generation from photosensitizers combined with the
preferential uptake of these molecules by cancerous tissue, serve as the
basis of photodynamic therapy (PDT); a developing method that is currently being extensively evaluated for reducing the growth and proliferation of solid tumors. Our rational for this research is that the development
of sulfonated phthalocyanines (PcSn) with high optimum quantum yields
of O2 (1∆g) that exhibit minimum photobleaching will offer potentially
new treatment regimens for various forms of cancer. Our objective in this
application is to elucidate the molecular characteristics of selected PcSn
that dictate their capacity to generate O2 (1∆g), and trigger necrosis/
apoptosis. Detection and quantum yields of O2 (1∆g) will be measured by
the iodide method. The formation of the triiodide ion (I3-) can be observed
at 355 nm by ultraviolet-visible spectroscopy.
117
Synthesis of Calcium Silicate
Amirah Hurst, Georgia State University
Dr. Vijaya K. Rangari, Tarig A. Hassan, and Shaik Jeelani, Tuskegee
University
Calcium silicate (CaSiO3), also known as Wollastonite, is a mineral material that has many uses in numerous branches of national economies over
the world and can be used for the production of special radio ceramics,
sanitary components, porcelain materials, lining bricks, glaze and flux.
Its high tenacity and good thermal conductivity makes it a favorable material to use for ceramics and fire protection. Nanocomposite structures
are one of the important applications of calcium silicate nanoparticles. In
this study, we explore the synthesis of calcium silicate nanoparticles using the sonochemical method. In this technique, tetrabutyl orthosilicate
was used as the source of silica, and egg shell particles were used as the
source of calcium carbonate. TBOS and eggshell particles were irradiated
with a high intensity ultrasonic horn (Ti-horn, 20 kHz, 100 W/cm2 at 50%
amplitude) for 5 hours at room temperature in the presence of ethanol,
water, and ethylenediamine. The resultant material was separated from
the solvents via centrifuge and dried under a vacuum and used for XRD
and TEM analysis.
118
Substituent Effects of Trans-Chalcones on Ultra-Violet
Absorption Spectra
Conrad Hurt, Jr., Tuskegee University
Pamela M. Leggett-Robinson, Georgia Perimeter College
Vitus Apalanyga, Tuskegee University
Chalcones are often used to represent cancer preventive food components in a human diet that is rich in fruits and vegetables. Chalcones are
aromatic ketones that form the central core for a variety of biological
compounds and have shown anti-bacterial, anti-fungal, anti-tumor, and
anti-inflammatory properties. In breast cancer research, studies suggest
that the blockade of cell cycle progression and initiation of cell apoptotic
system may participate in the anti-proliferative activity of chalcone (1,3-
Program Book
A59
Abstracts
diphenyl-2-propen-1-one) in human breast cancer cells. More recently,
a structure-activity relationship analysis of several chalcone (mainly
4-monosubstituted and 3,4-disubtituted) derivatives show a quantitative
correlation in the case of anti-tumor activity in human colon adenocarcinoma (HT-29) cells. The ultraviolet spectra of these chalcone derivatives
will allow an opportunity to explore the effect of resonance and inductive contributions of the 4- and 4’-substituents on the absorption spectra;
thus gaining a better understanding of the structure-activity relationship
of chalcone derivatives in cancer research. In this study, the UV absorption
spectra of 10 substituted chalcones were studied.
119
Microwave Assisted Synthesis of Asymmetric NearInfrared Dyes
Jamiece Johnson, Morgan State University
Dr. Angela Winstead, Morgan State University
Near Infrared dyes are important sensitizers because of their strong spectral properties in the longer wavelength region with minimal background
from biomolecules and high sensitivity. Heptamethine cyanine dyes are
useful as fluorescent tags in DNA sequencing, immunoassay and flow cytometry. Asymmetric dyes are important when changes in the spectral and
physical properties of the dyes are preferred when using specific applications that need to be compatible with instrumentation.
In the previous method, synthesizing asymmetric dyes produces a good
yield. Our approach uses microwave assisted organic synthesis to synthesize asymmetric dyes with faster times, comparable yields and without
toxic solvents. The first step in our procedure is the preparation of quaternary salts, where indolenine and alkyl halide are combined and heated in
a microwave system, with a pure salt being obtained by crystallization using ethyl ether, producing yields of 24%, 22%, and 26%. The next step is
to combine the salt, sodium acetate, bisimine and ethanol in a microwave
vial, for 15 min. at 100°C. The Methyl-Ethyl, Propyl-Ethyl, Alcohol-Ethyl,
and Carboxylic Acid-Methyl, asymmetric dyes have been synthesized in
yields ranging from 40% to 95%. All products have characterized using
NMR spectroscopy.
120
Synthesis of Ligands Containing Diamagnetic Metal
Ligands to Form a Single Molecule Magnet Containing F
and D Block Elements
Francis Jordan, Claflin University
Muthukrishna Raja, Claflin University
The purpose of this study is to form a single molecular magnet (SMM)
containing both ‘D’ and ‘F’ block elements with ligands containing diamagnetic metal(s). Various SMMs have been synthesized and studied
with variuos ‘D’ block elements, such as Manganese, Iron, Vanadium, and
Nickel. We have chosen Iron containing aromatic molecule Ferrocene as
our cornerstone to build new SMMs.
Future studies can be done using a different aromatic organ metallic compound containing different ‘D’ block elements.
A60
Program Book
121
An Investigation of the Use of Chitosan as a Substitute for
3-(Amino-Propyl) Triethoxysilane (APS) in the Fabrication
of Glass Surfaces for use as a Substrates in Metal
Enhanced Fluorescence Techniques
Ichhuk Karki, Morgan State University
Richard Williams, Morgan State University
Metal Enhanced Fluorescence is a promising analytical technique that offers several advantages in overall detection sensitivity. The current preparation for glass surfaces calls for a time consuming and corrosive colonization step before the application of APS as a precursor for the deposition of
silver onto the glass substrate. APS is expensive and potentially harmful
to the environment. Therefore, this research seeks to investigate the use
of chitosan as a substitute of APS in metal enhanced fluorescence techniques. Chitosan is a relatively inexpensive, friendly to the environment,
and readily available biopolymer which contains amino groups that allow
it to form stable complexes with silver metal. The main aim of this research
is to examine the chitosan as a substitute for the silanization step and to
deposit silver on the glass substrates, in order to investigate their potential use in the metal enhanced fluorescence techniques. The silver coated
glass slides silanized with chitosan and APS were compared. All absorption measurements were performed using a UV-vis spectrophotometer. In
the final steps, human serum albumin (HSA) and indocyanine green (ICG)
will be adsorbed onto the surface of both types of silver coated glass
slides and their fluorescence was measured using a spectrofluorometer.
The results will be compared and analyzed.
122
Understanding the Mechanisms of Trichloroactic AcidInduced Precipitation of Proteins
Charles Loftis, Langston Univeristy
Dr. David Paul, University of Arkanss
Protein folding is a process by which an unfolded polypeptide chain folds
into a specific native biological active structure. Protein aggregation is a
widespread phenomenon that occurs during protein folding in vivo and in
vitro. Understanding the mechanism of protein aggregation is important
in solving the problem of formation of inclusion bodies during overexpression of recombinant proteins in host vectors and also in the prevention
and cure of various human diseases (including Alzheimer’s disease). 2,2,2trichloroacetic acid (TCA) is a well-known protein precipitating agent. In
the present study, we attempt to understand the mechanism by which TCA
induces precipitation of proteins, using various biophysical techniques
including polyacrylamide gel electrophoresis, steady state fluorescence,
8-anilino-1-napthalene sulfonate (ANS) binding, circular dichroism, and
multidimensional NMR spectroscopy. The TCA-induced protein precipitation curves are observed to be U-shaped and maximum protein precipitation is observed between 5% to 45% (w/v) of TCA. The TCA-induced protein precipitation curve does not significantly depend on the nature and
size of the protein. However, in the presence of increasing concentrations
of urea (denaturant), the amount of protein precipitated is significantly
decreased. It is observed that the protein-precipitate-inducing effects of
TCA are due to the trichloro group. Using acidic fibroblast growth factor
(aFGF) as a model protein, we attempt to understand the molecular basis
for the TCA-induced effects. We demonstrate that aFGF is in a partially
structured “molten-globule” state in 5% (w/v) sodium trichloroacetate
(STCA). It appears that TCA-induced protein precipitation occurs through
coalescence of partially structured state(s) of the protein.
Abstracts
123
Microwave Assisted Synthesis of a Novel Smallpox
Biosensor
Charlee McLean, Morgan State University
Near infrared (NIR) dyes have been used in various biological applications
as fluorescence labeling probes. Asymmetric cyanine-5 (Cy-5) dyes have
been used over the years as biosensor for the detection of smallpox. The
Cy-5 dyes exhibit emission spectra between the regions of 670-710 nm.
This is a problem as biological molecules such as haem also fluoresce in
this same region. The objective of this research is to synthesis NIR dyes
that will be used to detect smallpox, using a more efficient method; a biosensor that will fluoresce at a longer wavelength than the Cy-5 dyes.
Initial studies have been done towards optimizing the synthesis of various heptamethine dyes in an efficient time using Microwave Assisted Synthesis (MAOS). This method uses heterocyclic salt, bisimine and sodium
catalysts (used as the catalyst). The five substituted cyanine dyes: ethyl
dye, methyl dye, propyl dye, carboxylic dye and alcohol dye, have been
synthesized with percentage yields of 79.0, 70.5, 81.0, 83.5, and 64.5 respectively. The dyes fluoresce between the 780-790 nm regions. Based
on the analysis of the H1 NMR it as been determined that the dyes have
been synthesized, and they are significantly pure compared to previous
methods. The cyanine dyes have been synthesized successfully using the
new method. The new method using the microwave Biotage is advantageous as it does not require purification of the NIR-dyes after synthesis.
The synthesis of the asymmetric dye used in the detection of smallpox
without the sulfonate group, using the new method, will be investigated.
MOAS synthesis of complex Cy-dye derivatives and their active NHS esters
used the synthesized symmetric dyes. [This study was supported, in part,
by a grant from NSF awarded to Dr. Angela Winstead, Assistant Professor,
Morgan State University, Baltimore, MD 21251.]
125
Generating Functions of Plane Partitions
Shatina Morgan, Winston-Salem State University
Dr. Wanda Patterson, Winston-Salem State Univesity
In this project we are exploring and examining the theory of plane partitions and how they relate to the number of n x n Alternating Sign Matrices. We began by examining the mathematical concepts of the Alternating
Sign Matrix Conjectures. With this project, we are exploring the generating
functions of plane partitions to find the connection between alternating
sign matrices and plane partitions.
126
Development and Evaluation of Nano-Modified Epoxy
Coatings with Enhanced Adhesion Properties
Jiman Nelson, Jackson State University
Derrick Stokes, Jackson State University
Wilbur Walters, PhD, Jackson State University
In this investigation, epoxy coatings were modified using various compositions of nanostructured chemicals. Modified epoxy coatings were applied
to steel substrates, and the influence of the nanostructured additives on
the coating adhesion strength was studied. The nanostructured chemical
that was added to the coatings was Epoxycyclohexl POSS® Cage Mixture;
the term POSS stands for Polyhedral Oligomeric Silsesquioxane Systems.
The POSS was used as an additive to improve adhesion strength. Preliminary results and recent literature suggests that nanostructured chemical
systems have an effect on adhesion. In this study, scanning electron microscopy was used to analyze the coating surface morphology and substrate/coating interface. Coating pull-off strength was measured using an
Elcometer 106 pull off adhesion test system.
124
Electrodeposition of Metal alloys and Oxide Films from
the Tetranuclear Hetroploymetallic Complexes
127
Electrode-Induced Crosslinking and Deposition of
Chitosan and Enzymes
Eric Morgan, Delaware State University
Bizuneh Workie, DonnaRae Boucek, and Jessica Tyson, Delaware
State University
Babatunde Odukoya, Morgan State University
Dr. Yongchao Zhang, Morgan State University
Electrochemical studies of the tetranuclear Cu/Ni heteropolymetallic
(HPM) complexes have shown that the complexes can be used as a single
source (unimolecular ) precursor to electrochemically deposit Cu, Cu/Ni
alloy, and Cu and Ni oxide films whose net deposition stoichiometry is
controlled by the metal stoichiometry of the precursor. This controlled
unimolecular electrodeposition technique may hold key to producing new
types of nano sized particles of metals, alloys and mixed oxide film with
specific predefined stoichiometries, and new types of metal alloy and oxide catalysts and coatings. The electrochemical work done, however, was
limited only to the Cu/Ni HPM complexes. In this work, we have extended
the electrochemical studies to Cu/Co HPM complexes. The electrochemical results of Cu3Co HPM complex show that the complex initially exhibits
redox reaction with no electrodeposition and/or adsorption, and at higher
cathodic potential the complex forms a deposited film on the electrode
surface. Further work will be conducted to study the property of the film
and extend the project to other types of HPM complexes.
The pH-dependent solubility of chitosan has been exploited to make chitosan films on the electrode surface for various applications. At low pH
(<6) the amines on the chitosan backbone are protonated and chitosan
is water-soluble; when a high reduction potential (~3 V) is applied to a
chitosan solution protons are reduced to H2 and the local pH near the
electrode increases, causing deprotonation of the chitosan amines and
precipitation and deposition of chitosan on the electrode surface. This deposition process is, however, reversible; and the deposited chitosan film
can redissolve in low pH. The required high potential may also be detrimental to enzymes and other biomolecules. In this study, we developed a
new method of electrode-induced crosslinking and subsequent immobilization of chitosan and enzymes on conductive solid surfaces.
Chitosan solutions containing Ru(bpy)2Cl2 was subjected to a reduction potential of -1.5 V for a certain period of time. Upon reduction, the
Ru-chlorine bond became labile and chlorine was replaced by stronger
ligands such as the primary amines from chitosan, and when the two
Cl were replaced by amines from two chitosan chains the chitosan was
crosslinked.
Crosslinked chitosan became insoluble, deposited on the electrode surface and became a hydro gel. It was also found that enzymes with surface
amines could also participate in the Cl-replacing reaction and become
immobilized in the crosslinked chitosan network. As a proof of concept,
tyrosinase (PPO) was mixed with chitosan and Ru(bpy)2Cl2 solution and a
polymer/enzyme crosslinked matrix modified electrode was fabricated by
Program Book
A61
Abstracts
electrodeposition. The electrode showed excellent enzymatic response to
the addition of phenols.
This electrodeposition method is superior to the literature methods in
that it requires a much milder condition (1.5 V vs. 3 V), and the crosslinking prevents dissolution of the chitosan film in low pH media.
Immobilized enzyme showed excellent response upon addition of dopamine. The amount of enzyme immobilized in the matrix increased as
deposition time increased. The enzyme was more responsive when the
ratio of Ru(bpy)2Cl2 and tyrosinase to chitosan were increased. Further
investigation and optimization of the process is underway.
128
Synthesis of Hepthamethine Cyanine Dyes with a Large
Stokes Shift and Strong Fluorescence
Stanley Oyaghire, Morgan State University
Heptamethine cyanine dyes are currently used as fluorescence labels and
sensors of biomolecules in vivo because their spectra reach into the near
infrared (NIR) region, where auto fluorescence by a biological matrix least
occurs. However, a major disadvantage of these dyes is that their Stokes
shifts are small (less than 25nm). The Stokes shift, which determines the
fluorescence of the emitted photon, has to be large in order for the dye to
be detected amidst other molecules that fluoresce in the same region. The
purpose of this research is to synthesize an NIR dye with greater Stokes
Shift which would improve the fluorescence of the dyes used as fluorescent labels.
Conventionally, the heptamethine cyanine dyes have been synthesized by
refluxing a mixture of a heterocyclic quaternary salt and an unsaturated
bisaldehyde in ethanol for about 12-24 hrs. Our method involves heating
a mixture of an ethyl salt and bisimine (N-[3-Anilinomethylene)-2-chloro1-cyclohexen-1-yl)methylene]-aniline monohydrochloride), but the reaction is run through a microwave oven which reduces the reaction time.
Our objective in this research is to synthesize the ethyl dye precursor and
then attach amine groups to the central reactive site of the dye in order
to improve the Stokes shift while maintaining timely reaction times and
improved quality of yield. Currently, studies of this reaction have provided
indeterminate yields. Consequently, conditions such as temperature and
reaction times are currently under investigation.
129
Chitosan-Assisted Synthesis of Silver Nanoparticles by
Electrodeposition
Melissa Pinard, Morgan State University
Dr. Yongchao Zhang, Morgan State University
In this study, silver nanoparticles were prepared by electrodeposition in
the presence of chitosan, a polysaccharide polymer with glucosamine as
its building block. Indium tin oxide (ITO) coated glass was used as the
base electrode. The ITO electrode was inserted in 0.1 M KNO3 solutions
containing different concentrations of AgNO3 and chitosan, and a potential of -0.1 V (vs. Ag/AgCl) was applied. Ag+ ions were reduced and Ag atoms were deposited on the electrode surface. It is believed that chitosan
regulates the size of the Ag particles and prevents further aggregation
of the Ag particles; with chitosan, Ag particles with diameters of several
hundred nanometers were found uniformly distributed on the electrode
surface, while in the absence of chitosan Ag clusters on the order of microns were found. The investigation of the electrical, optical and catalytical properties of these Ag nanoparticles is underway. [This research was
supported by a grant from NSF-RISE.]
A62
Program Book
130
Investigation of Ruthenium Complexes and Heptamethine
Cyanine Near-Infrared Fluorophores as Donor/Acceptor
Groups for Fluorescence Resonance Energy Transfer
(FRET) Analysis.
Isha Pradhan, Morgan State University
Dr. Richard Williams, Morgan State University
There has been increasing interest in the use of infrared (IR) and near infrared (NIR) dyes as biological micro-sensors due to their unique spectral
characteristics. Two essential characteristics are the ability to minimize
background interference from less useful biological components and the
ability to exhibit optimal detection sensitivity and chemical stability. Fluorescence Resonance Energy Transfer (FRET) is an important technique for
characterizing biological phenomena that are associated with changes
in intermolecular distances. In this study, micelles were used to identify
potential acceptor/donor pairs with luminescent properties in the far red
and near infrared region of the visible spectrum for use in FRET analyses.
A library of microwave synthesized heptamethine cyanine dyes were incorporated onto micellular surfaces along with Ru(bpy)32+ compounds
(bpy = 2,2-bipyridine). This mixture was excited at the maximum absorbance wavelength of the Ru(bpy)32+ compound and evidence for FRET
was searched for at the fluorescence wavelengths of the near-IR cyanine
fluorophores. Time resolved lifetime measurements of the donor compound were obtained and used to calculate the Förster distance for acceptor compounds in the presence of the micelles. An immunoassay utilizing
near-infrared cyanine fluorophores and the FRET phenomena were also
developed. The results are reported.
131
Extraction of Oxytetracycline from Manure and Soil with
Direct Analysis by HPLC
Vinay V. Prajapati, Delaware State University
Richeng Xuan and Qiquan Wang, Delaware State University
An analytical method for the determination of oxytetracycline, a member
of tetracyclines, in steer manure was developed and optimized with acidified methanol extraction and high performance liquid chromatography
analysis. Better extraction recovery, species and amount of added acids,
extraction shaking time, methanol/water ratio of extraction solvent, manure weight, and repeated times of extraction were optimized. The developed method was also used to extract oxytetracycline from a silt loam
soil at 2 spiked concentration levels. Oxytetracycline recoveries for investigated manure and soil were in the range of 89.3±2.2% to 102.5±5.0%,
demonstrating that the developed analytical method had a robust extraction ability for oxytetracycline and provided a reliable quantification of
oxytetracycline content in different manures.
132
Investigating the Polymerization of Thermosetting
Epoxy/Amine System using Dielectric Spectroscopy and
Differential Scanning Calorimetry
Abdul-Rahman Raji, Morgan State University
Dr. Alvin Kennedy and Solomon Tadesse, Morgan State University
We aim at developing an accurate and reproducible technique for understanding structure-property relationship and how processing affects the
morphology of thermosetting epoxy/amine system. Our focus is on correlating dielectric spectra with calorimetric data under varying epoxy resin,
curing agent, mixing ratio, cure time, and frequency to monitor the in-situ
polymerization of epoxy/amine system. To monitor thermosetting epoxy/
amine system, we used the dielectric analyzer and the differential scan-
Abstracts
ning calorimeter. A stoichiometric amount of Epon 825 with 3,3-Diphenyl
diamine sulfone was prepared and sandwiched between the parallel plates
of a calibrated ceramic surface electrode. The experiments were conducted at an isothermal condition of 100 C for 10 hours at different frequencies. The samples were scanned from -40 to 350 C and from 0.0 to 200 C.
The glass transition temperature (Tg) observed for the Epon 825/3,3 DDS
is 112.33 C compared to Tg of -19.52 C for the neat resin. This is an effect of
the network formed during the polymerization. We have been able to find
some correlation between the glass transition temperature (Tg) obtained
from the differential scanning calorimeter and the dielectric analyzer.
From the DSC, the Tg corresponds to a point in the region where there is a
sharp decrease in the heat flow, and hence heat capacity, of the sample.
In contrast, the DEA revealed the Tg at a point where there is a drastic
change in the slope of the dielectric spectra as a function of temperature.
We have been able to see the effect of the network-formation characteristic of the property enhancement of the thermoset in terms of the increase
in the glass transition temperature of the cured thermoset over the neat
resin. In addition, there is coherence between the temperature scan from
the DSC and the DEA. We intend to conduct more experiments to see how
the peaks observed in the dielectric spectra during isothermal cure correlates to the peaks observed during the post cure temperature scan. [This
research is supported by NSF HRD 0627276.]
133
Photochemical Reaction of a Hair Dye Ingredient Chemical
4-chloro-1,2-phenylenediamine
Keonia Smith, Jackson State University
Shuguang Wang, Gernerique Stewart, and Hongtao Yu, Jackson
State University
4-Chloro-1,2-phenylenediamine (CPD) is an aromatic amino compound
used as an active ingredient for the manufacture of hair dyes. CPD has
been found to be mutagenic in bacteria when exposed to simulated sunlight irradiation. It is anticipated that the photochemical reaction and the
associated reactive species generated are responsible for the phototoxicity of CPD. Therefore, the photochemical reaction of CPD is investigated.
CPD was dissolved in water (50 mg in 200 mL with 1% methanol) and irradiated with a solar simulator lamp (Suntest, 1500 W Xe Lamp with light
output intensity of 250 J/cm2). After the CPD solution was irradiated for 5
h, about 90% of the original CPD disappeared and one main photoproduct appeared as detected by both High Pressure Liquid Chromatography
(HPLC) and Thin Layer Chromatography (TLC). The solution was then
freeze-dried and a brownish solid photoproduct mixture was obtained.
The brownish solid was column chromatographed on silica gel eluting
with ethyl acetate and hexane (7:3). After evaporation of the solvent, a
solid product was obtained which has a molecular mass at m/z 244 (100%)
and an isotope ion at 246 (30 %). This molecular mass indicates that the
product is likely dimerized since CPD’s molecular weight is 142.6 and the
isotope ratio of 3:1for ions 244/246 indicates that only one chlorine atom
remains in the photoproduct. 1H-NMR (d6-DMSO): δ: 7.92-7.88 ppm ( 2 H,
t, arom-H), δ: 7.54-7.50 ppm ( 1 H, dd, J = 2.4 and 9.0 Hz, arom-H), δ: 6.88
ppm ( 1 H, s, arom-H), δ: 6.87 ppm ( 1 H, s, arom-H, δ: 6.42 ppm ( 2 H, s,
-NH2), δ: 6.37 ppm ( 2 H, s, NH2). These results match the previously published NMR spectra for 2,3-diamino-7-chlorophenazine, C12H9N4Cl. [We are
grateful for the National Institutes of Health for financial support (NIHSCORE S06GM08047) and equipment use in the Core Research Laboratory through the NIH-RCMI grant. GS wishes to thank the Department of
Education for the financial support through the Title III grant.]
134
Carbon Nanotube Facilitated Electromigrated BreakJunctions
Derrick Stokes, Jackson State University
Luke Donev and Paul McEuen, Cornell University
Carbon Nanotubes (CNTs) are extremely valuable tools used in the various scientific fields today. Carbon Nanotubes provide more strength and
stability to many different projects. Our team has been working very diligently on the study of both CNTs as well as break-junctions. The purpose
of this research is to manipulate a break-junction. A break-junction is an
electrical junction between two wires formed by pulling the wires apart
to produce electrodes. By understanding how break-junctions and CNTs
behave, it is believed that placing a CNT in an apparatus will provide more
localized control of a break-junction. Thus, resulting in a third electrode,
that can be used to manipulate the electrical principals of a molecule.
Knowing the location of a break-junction is important because it will make
it easier to study molecules that have been placed in the gaps. This research is on-going, and can be used for many different applications.
135
Investigation of Stoichiometric Ratios on the Microwave
Chemistry of Quaternary Salt Synthesis
Tiffany Strickland, Morgan State University
Dr. Alvin Kennedy and Dr. Angela Winstead, Morgan State University.
The purpose of this research is to determine if stoichiometric ratios have
an effect on microwave induced chemical reactions. The substitution reaction between 2, 3, 3 – Trimethylindolenine and Iodoethane was investigated using the following mole ratios of 1:1 and 1:2, different volumes
and different temperatures in a single mode microwave system was used.
The volumes used were determined using the corresponding mole ratios.
The two compounds were added to a CEM Discover/Explorer Microwave
vial with a metal stirbar via syringe. Each vial was heated for 300 sec hold
time and 150 sec ramp time. Thus far, it can be stated that product formation only occurs at the 1:1 ratio at 130 C with 1mL total volume and at 1:2
ratio at 130 C with a 1mL and 2mL total volume. At other temperatures in
the 1:1 and 1:2 ratio the products were decomposed. A relationship has
been determined between the product yield and the experimental parameters of pressure, total volume and temperature. The reaction will not go
to completion if the pressure exceeds 250 PSI, independent of the volume
and temperature of the reaction. In addition, it has been observed that
there must be a minimum pressure of 40 PSI for any product formation
to occur. In a 1:1 ratio product formation only occurred at 1mL volume,
whereas, in 1:2 ratio product formation occurred at 1mL and 2mL volume
with similar percent yields. Therefore, it can be concluded at this point
that stoichiometric ratios do have an effect on a microwave-induced reaction. Future work will include investigating other mole ratios, investigating
how the power of the microwave affects the reaction, and determining if
polarity has an effect on microwave-induced reactions.
136
A Novel Approach to the Undergraduate Research
Expereince: Mentorship of High School Students from
Across the Country
Gerald Talley, Tuskegee University
Albert E. Russell and Nichole L. Powell, Tuskegee University
Pamela M. Leggett-Robinson, Georgia Perimeter College
Research Experience for Undergraduates (REU) is typically a summer
program that engages undergraduate students in research projects in
the STEM disciplines. Mentorship is traditional in an REU program. The
Program Book
A63
Abstracts
principal investigator (PI) is the mentor and the undergraduate student is
the mentee. This summer, we took a different approach to the REU mentorship. Seven high school students used chromatographic separations
of gel/erasable ink and food coloring via thin layer chromatography and
column chromatography to investigate the effects of polarity on a system.
Although the project conception was that of the advising faculty members, the project design and implementation was that of the undergraduate researcher. The high school students observed separation differences
based upon variations in stationary and mobile phases. The undergraduate student gained experience in research design and teaching as well as
communication, organizational, and supervisory skills. More importantly,
both the undergraduate researcher and the high school students had an
opportunity to engage in informal mentoring sessions.
137
Application of Ratiometric Spectral Properties of
Salicylidene Derivatives in the Analysis of Selected
Anions
Dharendra Thapa, Morgan State University
Dr. Richard Williams and Dr. Yousuf Hijji, Morgan State University
Intermolecular proton transfer in the ground and/or excited states contributes to changes in spectral properties that can be correlated to the
intermolecular hydrogen bonding between the salicylidene derivatives
and selected anions (fluoride, acetate, and phosphate) in an aprotic environment. The three derivatives of salicylidene family being investigated
can be used as spectral probes to detect and quantitate the presence of
anions on the degree of anion basicity. The absorbance and fluorescence
properties were observed in the presence of varying concentrations of
fluorine, acetate and phosphate anions in order to identify wavelengths
that could effectively be utilized in the ratiometric analysis of selected
anions. A plot of fluorescence intensity against anion concentration was
used to obtain binding constants of derivatives with anions in acetonitrile.
The absorbance ratiometric analysis for the three derivatives shows good
correlation between their acidity and ability to complex with fluoride
ions. The shift in the absorbance wavelength after addition of different
concentrations of anions suggests the change in spectral properties of
the derivatives. The fluorescence intensity of the derivatives increases as
we increase the concentrations of anions added into it. The anion-sensor
hydrogen-bonding complex is responsible for the change in spectral properties. Basicity of anions and intermolecular transfer play an important
role in anion recognition. Fluorescence intensity and binding constants
for anions correlate with the basicity of anions as they complex with derivative 1 and 3. Determination of fluorescence and binding constants of
anions for derivative 2 is currently being investigated. Moreover, the absorbance ratiometric analysis for acetate and phosphate anions will be
studied. Also, Job plots for varying concentrations of anions and the three
derivatives will be done. The correlation of anion basicity in ratiometric
analysis and fluorescence intensity provides evidence to support the hypothesis that these derivatives can be used as spectral probes for anion
sensing and recognition.
138
Dissociation Energies of N8C4H4: How Does Nitrogen
Enrichment Affect Stability?
Jessica Thomas, Alabama State University
Douglas L. Strout, Alabama State University
Complex forms of nitrogen are of scientific interest for their potential as
high-energy materials, since dissociation reactions of the type Nx > (x/2)
N2 are strongly exothermic. However, many such Nx molecules are too unstable to serve in a practical application. Previous studies on cage isomers
of N6C6H6 have shown the ability of carbon to stabilize nitrogen systems,
A64
Program Book
with a corresponding cost in energy production because of the dilution of
the nitrogen content. N6C6H6 is only 52% nitrogen by mass, and it would
be preferable to design stable high-energy materials that are richer in
nitrogen because of the additional energy release from the nitrogen. In
the current study, cage isomers of N8C4H4 (an enriched form of N6C6H6)
are studied to determine their stability with respect to dissociation. Theoretical calculations using Hartree-Fock theory and perturbation theory are
carried out to calculate dissociation energies of N12C4H4. Stability with respect to dissociation, as well as the potential usefulness of the molecule,
is discussed.
139
The Synthesis of Cyano and Fluoro Cyanine Dyes using
Microwave Chemistry
Deveine Toney, Morgan State University
There have been successful attempts using cyanine dyes in live cell imaging, photographic sensitizers, and chemotherapy. However, in some
cases, cyanine dyes tend to be unstable in light. α cyano and polyfluorinated dyes have shown improvement in photostability. The main focus
of this research is to improve the synthesis of cyanine dyes and enhance
photostability through structure manipulation. The reflux method was initially used to synthesize the dyes. In this experiment, microwave assisted
organic synthesis will be used. 2-methylbenzothiazole and iodoethane,
were reacted in the microwave to serve as a reference point for the more
complex salt benzothiazole-2-acetonitrile used in cyano dyes. Five alkyl
halides with various functional groups were obtained in good percent
yields. All synthesis was fully characterized using 1H, 13C, and dept NMR.
Benzothiazole-2-acetonitrile studies are currently under investigation.
140
Searching for H2- using the ORNL Ion-Atom Merged-Beams
Alan B. Tyson II, Morehouse College
Charles Havener, Physics Division ORNL, U.S. Department of Energy
Associative detachment of H and H- (H- + H→H2 + e-) is an important step
in the formation of galaxies and the universe. Within the yielding process,
it is believed that H2- is formed. Those who study the H2- molecule know
little about it. H2- is unique because it is not a stable molecule, yet it is
more stable than what theory suggests. It has a lifetime of 10-15 seconds.
Theoretically it would want to decay immediately. In the ion-atom merged
beam experiment, we hope to implement associative detachment and
low collision energies to discover H2- via the ion-atom merged beam apparatus. Hydrogen is pumped into a duoplasmatron and creates H-. The
duoplasmatron floats at -4000 eV. The beam accelerates from the duoplasmatron to ground potential where it has a voltage of 4000eV. A voltage cell surrounds the laser. Depending on the setting of the voltage cell
(in this case +/- 200V), H will move with a voltage of 3800 eV or 4200eV.
The laser acts as a photon source and knocks off the extra electron from Hcreating H. Because H has no charge, it will continue to travel at the fixed
voltage of the voltage cell. Once H- leaves the voltage cell, it will return to
the original energy of 4000eV. At this point the H and H- will have different
velocities, which will allow for collisions to take place. As the beams of H
and H- travel through the apparatus, a wire scanner gives a graphical representation of what is happening in the diagram. The data is represented
at two different motor points on the apparatus. In the end we found in the
graphical representation that H2- could not be detected because the beam
formed a background count rate of 80 kHz. In the future we will design the
apparatus in such a way that there are detectors for all traces of H, H- , and
H2- so that the background count rate will be significantly reduced.
Abstracts
141
Investigations in Microwave-Assisted Reactions towards
the Improved Synthesis of Benzazepines
143
X-Ray Crystal Structure of Ag Complexes of 1,10phenanthroline-5,6-dione
Julian Wesby, Savannah State University
Karla-Sue Marriott, Savannah State University
Cynthia Williams, Howard University
Jonathan Oneugbu, Dr. Charles Hosten, and Dr. Raymond Butcher,
Howard University
Benzazepine derivatives have been found to possess anti-depressant
properties and are quite useful in the treatment of chronic neurological
disorders including brain damage resulting from epilepsy, stroke, Alzheimer’s disease, methamphetamine abuse and AIDS-related dementia.
Previously, we have reported a synthetic approach to a novel benzazepine
derivative and in our current project we explore a modification to this synthetic pathway via microwave-assisted regioselective bromination reaction. This investigation has lead to the development of a more efficient
synthetic pathway with reduced reaction times and overall increased
product yield. This research project will impact the future development of
pharmacotherapies to combat addiction and hence improve drug abuse
rehabilitation therapies.
Phendione (1,10-phenanthroline-5,6-dione) is an excellent ligand that incorporates two functional groups with different coordination properties.
This well-known ligand possesses both the α-diimine and orthoquinone
moieties. Metal complexes of this ligand potentially allow for the variation
and control of redox properties over a wide range.
144
Modeling Early Cortical Serotonergic Deficits in Autism
142
Preparation of Biodiesel from Waste Oil
Michelle Ayorinde, Morgan State University
Marcina Garner and Dr. Christine F. Hohmann, Morgan State
University
Ashley White, Jackson State University
Dr. Ken S. Lee, Jasmine LuAllen, and Dr. Bruce Wenzell, Jackson State
University
Autism Spectrum Disorder (ASD) is a developmental brain disorder with
deficits in social and cognitive behavior, affecting many individuals. Diagnosis is still on the rise [Di-Cicco-Bloom 2007]. The cause of ASD and its
associated brain changes are unknown. Our lab has developed a mouse
model of serotonin-removal from cortex and hippocampus at birth; this
induces in mature mice, brain and behavioral changes similar to ASD [Hohmann 2007]. Since ASD is a developmental brain disorder, we are investigating in this study, if mice at one week of age, already show deficits in
social cognition. Male and female Balb/CByJ mice received injections of
5,7-Dihydroxytriptamine (5,7-DHT,n=12 ) or saline (vehicle controls, n=13)
into the medial forebrain bundle at birth. Age matched controls (AMC, n=
10) stayed with their mothers until behavioral testing. At postnatal day
(PND) 7 all mice were tested on the “homing task”. This task assesses
whether the pups show preference for home bedding versus clean bedding as an indicator of normal social behavior. As predicted, AMC pups at
PND7 preferred home bedding to clean bedding. We are currently analyzing data from 5,7-DHT and vehicle injected mice.
There is a large quantity of used vegetable oil as a result of cooking by
restaurants. Most of this is simply discarded as waste. At the same time,
the United States is in an energy crisis. We report on our efforts to recycle
waste cooking oils by converting it to biodiesel fuel.
The used cooking oils contain other materials other than vegetable oil,
which is originally started with for frying. In the course of frying foods, carbohydrates from flour and batter, water from the raw foods, proteins and
collagen from chicken and fish, and free fatty acid resulting from oxidizing
the unsaturated vegetable oils. All these end up in the used cooking oil,
so we have to remove these prior to making biodiesel because they would
interfere with the chemistry for making biodiesel from vegetable oils.
We have investigated pretreatment of the used oils to handle free fatty
acids, which inhibit the transesterification reaction. In order to remove
fatty acids, basic resins and lime have been used and their effectiveness
has been evaluated with the acidity of used vegetable oil before and after
the treatment. Acidity, defined as mg KOH/ g sample, ranged from 10.0 to
14.0 for used oils. For comparison, pure vegetable oil has an acidity of 0.2
while oleic acid has an acidity of 210.
Another pretreatment approach is to use column chromatography. It was
reasoned that gravity column chromatography with a basic, polar stationary phase and a non-polar mobile phase would accomplish a number of
things: 1) anhydrous alumina (Al2O3) would remove the water; 2) alumina, being basic, would latch on to the fatty acids; 3) alumina, being polar,
would hold up carbohydrates and proteins; and 4) a non-polar phase like
hexane should wash the tri- and di- glycerides, perhaps the mono-glycerides also.
Results of this approach will be reported. Characterization and quantification of the triglycerides and the methyl esters were achieved by 1H NMR,
IR, and GC/MS.
[Acknowledgement: This research was supported by the DOE-MRT/SBIR
DEFG3605G085002/07-08-001, NSF STARGE (HRD-0411559) and NIHRCMI (R21 NS054862-01) programs.]
145
Virgin Islanders Can Identify Corals: Divers More So Than
Non-Divers
Tanicia A. Corke, University of the Virgin Islands
Christine Settar, Ferlicia Fergusson, Agene’ Rogers, and Dr. Theresa
Turner, University of the Virgin Islands
Coral reefs are a vital part of the marine ecosystem and are home to the
most biodiversity in the world. However, the number of healthy reefs on
the planet is sharply declining due to natural and human activity. As the
need to conserve our reefs increases, so too does the need for the public to become better aware of the threats posed to the reefs and the marine ecosystem. Before management measures can be implemented, the
knowledge of the public must first be assessed. To do this, a survey was
conducted in the summer of 2008 in St. Thomas, United States Virgin Islands. Participants were asked to identify pictures of ocean organisms and
answer question regarding their perception and knowledge of coral and
how they relate to the ocean. The survey found that the average of correctly identified pictures for scuba divers was highly significantly greater than
the average of participants that stated they did not dive (p<0.001, t-test).
The same was true for snorkelers whose total average of correct answers
was significantly greater than those who did not snorkel (p<0.001, t-test).
Virgin Islanders were better able to identify coral than participants of a
Program Book
A65
Abstracts
similar study done in Brazil. For example, 90% of the Virgin Islanders surveyed could identify the Elkhorn coral (Acropora palmata) in contrast to
less than 50% of the Brazilians surveyed. [Funded by NSF HBCU-UP; Lana
Vento Charitable Trust. Special thanks to Coki Beach, Frenchtown Deli, KMart, Nisky Shopping Center, Red Hook Ferry Terminal and Tutu Park Mall
for letting us conduct our survey on their facilities.]
146
The Effects of Body Mass Index and Gender on
Cardiovascular Reactivity to Racial Stress
Christina M. Crawford, Virginia State University
Vernessa Clark, Virginia State University
Obesity is currently a growing epidemic in the United States. It is a chronic
disease affecting over 26.64% of adults, aged 20 and over (CDC, 2007).
According to the Centers for Disease Control, 25.5% of men and 25.3% of
women were obese in 2006 (CDC, 2007). African Americans, particularly
women, have the greatest prevalence of obesity. For example, in 2006
over 38.6% of African American females were obese compared to 29.3 %
of African American males (CDC, 2007). Obesity is typically measured using body mass index, which is defined as a measurement of an individual’s
total body fat. The current study examined the effects of body mass index
on cardiovascular reactivity to racial stressors. Would individuals who are
obese and overweight have greater cardiovascular reactivity to the racial
stressor than participants of normal body weight? The participants were 39
African American college students (11 men and 28 women) from a predominantly black university. A cardiovascular profiling instrument was used to
measure heart rate, blood pressure, stroke volume, and body mass index.
Measurements were taken as the participants viewed a videotaped scene
depicting racism. The first major finding showed that in response to the
racially noxious stressor, obese participants had greater stroke volume
than participants of normal weight. The second major finding revealed an
interaction between gender and BMI for heart rate reactivity. This finding
revealed that obese women recovered from the racially noxious stressor
quicker than obese men. Since obese women encounter weight discrimination and prejudices more than any other group (Crandall, et al., 2001),
they may habituate to other types of discrimination more readily.
147
A Primary Prevention Program on Reducing the Risk of
Type II Diabetes, Metabolic Syndrome, and Cardiovascular
Disease in Hispanic Families
Felicia Ekpo, Langston University
Dr. Maria Jimenez and Dr. Ximena Urrutia-Rojas, University of North
Texas Health Science Center
Obesity has become a growing problem throughout the US, and is also the
cause of 112,000 deaths per year. Obesity is the leading cause of diabetes
mellitus II, metabolic syndrome, and cardiovascular disease, and obesity
is most prevalent in minorities. The research that has been conducted relates the high minority obesity rates to a combination of genetics, culture,
environment, and socioeconomic factors. The highest rates of obesity are
observed in Hispanic children. The purpose of the study is to provide an in
depth assessment, counseling, and referral of nuclear families with overweight or obese children at risk for type II Diabetes. The study provides
early detection of the risk of Type II Diabetes, Coronary heart disease, and
metabolic disorders, and counseling on risk factors, nutrition and physical
activity, as well as the opportunity to practice in the preventive intervention through the “Promotora Program.”
A66
Program Book
148
Multi-year Comparison of Intimate Partner Violence
among Adolescents
Youth Risk Behavioral Survey, Texas and the United
States, 2001-2007
J.K. Harris, Langston University
K. P. Singh, PhD and R.Y. Qualls-Hampton, MS, PhD; University of
North Texas Health and Science Center
Intimate partner violence (IPV), is defined as abuse between two people
in an intimate relationship who are not married. A relationship does not
require sexual intimacy to be classified as IPV. According to the Centers for
Disease Control, there are four main types of IPV, which can also include
stalking. The four types include, physical violence which is the intentional
use of physical force with the potential for causing death, disability, injury,
or harm. Secondly, threats of physical or sexual violence which includes
using words, gestures, or weapons to communicate the intent to cause
death, disability, injury or physical harm. Psychological and emotional violence is the third type of IPV which involves trauma to the victim caused
by acts, threats of acts, or coercive tactics, and the fourth type is sexual
violence.
This descriptive review compares the prevalence rates of IPV among adolescents in Texas and the United States using YRBS data. The YRBS data
was used to collect data prevalence rates of IPV among adolescents for
the United States and Texas, 2001, 2005, and 2007 while also comparing
gender, grade, and race. During this study, there were several interesting
trends that were displayed in the YRBS data such as the trend between
males and females, and the grade to which adolescents report IPV. Our
research has sparked potential future studies to find out why males are
reporting more than females and also evaluate the trend to which adolescents are reporting more as they get older.
[Funded by the Department of Health and Human Services National Institutes of Health, NATIONAL HEART, LUNG, AND BLOOD INSTITUTE grant,
2R25HL007786-16 to Dr. Thomas Yorio.]
149
REST Expression Patterns During Zebrafish Nervous
System Development
Uruj Kamal, Wesleyan University
Keith Gates, Wesleyan University
Howard Sirotkin, SUNY Stony Brook University
REST is a transcriptional repressor involved in regulation of neural gene
expression. REST protein represses neural genes in non-neural tissue and
neural precursors. Sox is a gene expressed in neural precursors, which are
undifferentiated (proliferative) cells within the central nervous system. In
situ hybridization on fixed embryos at different stages of development will
lead to a better understanding of REST functioning during neural development. Comparing and contrasting these expression patterns to those
of sox2 will reveal more information on REST function and can then be
compared to other animals such as frogs, chicks and mice.
We are also interested in determining how REST expression is affected
when signaling pathways involved in neural development are disturbed.
Mutations in the mindbomb gene causes uncontrolled neurogenesis
early in development due to disruptions in the Notch signaling pathway.
We would like to compare differences in REST expression between these
mutant mindbomb embryos and wildtype embryos. Retinoic acid (RA) is
known to play an active role in neurogenesis. We are interested in determining RA’s role in promoting the differentiation of neural stem cells to
REST expression. We will be investigating the effects of excess RA and
blocking of RA with DEAB on REST expression.
Abstracts
150
Effects of Chronic Psychological Stress: A Rat Model
152
Battery Health Prognostics System
Jeremiah S. Miller, SUNY Potsdam
Dr. Brenda J. Anderson and Diane Kim, SUNY Stony Brook University
Yohance Campbell, Virginia State University
LaDarren Smith, Christopher Oliver, Anthony Gitilado, Dr. Ehsan
Sheybani, Dr. Thongchai Phairoh
Dr. Gymama Slaughter, School of Engineering Science and
Technology, Virginia State University
Threats to physiological homeostasis result in stress. Physical stress refers to a direct threat to homeostasis. Psychological stressors refer to the
anticipation of a threat to homeostasis. Chronic psychological stresses in
humans produce adverse psychological effect, but the neural substrates
are not well understood. To understand the neural consequences of psychological stress without physical stress, we tested a new rodent model
of psychological stress. We sought to determine if chronic psychological
stress in rats causes deficit of spatial working memory and other effects.
In humans, stress can impair working memory. Male rats were handled
and randomly assigned to stress tunnels (ST), control tunnels (CT), and
non tunnels (NT). The ST group was exposed to ferret dander odor, which
was paired with light, sound and air, which simulate the threat of a predator attack. Stimuli were delivered randomly. The stress group and nonstress groups were kept in separate rooms. After 21 days, the rats were
tested for spatial working memory, timidity, learned helplessness, and defensive behavior. Chronic and psychologically stressed rats were found to
have deficits in spatial working memory and higher levels of timidity.
Technology & Engineering
151
Reusable Solid Rocket Motor Ballistics: Low Level Tail-Off
Analysis
Leethaniel Brumfield, III, Langston University
Stanley Tieman, NASA
Tail-off, the earliest time to the latest action time, was defined for the newly
designed 06907 reusable solid rocket motor (RSRM) model as 20 seconds
of motor operation after the time the motor reached 50 psia measured
head-end pressure. Low pressure tail-off thrust model enveloped SRB
performance from thrust tail-off through separation from the shuttle to
ensure no contact would occur. RSRM ballistics was performed to analyze
whether the flight operation pressure from the 06907 model was comparable to that of the new five segment RSRMV. An adjusted RSRM shape
term was used to calculate low level θ tail-off traces. The RSRM shape
term scaled during the first 1.4 seconds to match the dispersion peak
times for the RSRMV dispersions, which suggest that the new shape term
allows for more variation than the trace projects. Low pressure SRM/HPM
data appropriate for RSRM characterization was performed, which proved
that mean and variation of low pressure data for RSRMV was very similar
to RSRM. In addition, burn rate was calculated as 0.368 in/sec nominal,±
0.005 in/sec variations, while propellant mean bulk temperature (PMBT)
variation ranged from 50-82° F. Uncertainty equaled 1% on thrust and
scale factor uncertainty was 2.6% on thrust, which were both the same as
the loads equation. Low level tail-off data cut off at ~7 seconds after 50
psi and there was no data beyond this point. The upper 3-θ; limit after cutoff was extrapolated from last value and followed similar shape to RSRM.
In conclusion, flight operation pressure from 06907 model was 4486 lbf/
psia (versus 4088 for RSRM) and the updated performance nominal and
dispersed values corresponded to the RSRMV.
The continuous progression of unmanned vehicle systems (UVS) and the
rapid evolution of modern tactical warfare have lead to the increasing demand and market for unmanned vehicles. The unmanned systems, either
in the form of ground, aerial, and maritime vehicles have become an important and integral element in military operations. The recent successful
military operations in Iraq and Afghanistan, have lead to the increased
needs for UVS in the broader spectrum.
The purpose of this study is to prevent absolute physical separation from
the combat action, assisting in current/future military operations, giving
real-time support for data acquisition operations, enduring research and
development goals, and for intended demonstration purposes. This alone
allows rapid growth and development for opportunities for future generations to exceed past the stars.
This would allow endless innovations and Engineers Developers Incorporated (ED, Inc.) to spearhead the many challenges. With the research,
funds, and time available, ED Inc. came up with a ground-breaking solution for any UVS battery prognostic health system (BPHS). In order to
understand the performance of the BPHS, these would have to include the
following but are not limited to:
• Characterize the failure within the battery voltage drop
• Develop algorithms for the processes
• Data acquisition of the battery voltage into the Analog-to-Digital Converter
• Develop user friendly to simplify the read-out
• Package and integrate the system into the UVS electrical power source
and BPHS
During the course of project design manufacturing, the question arose of
whether the BPHS was for either diagnostic or prognostic use. Depending
on the technical feasibility of the purpose, we generally agreed it was to
be used as a prognostic system, which would greatly benefit the research
by reducing research time, cost, and other parameters.
153
Calculation of the High Frequency Dispersion Resistance,
Rc, for a GaAs pHEMT using Matlab
Michelle Collins, Morgan State University
Dr. Michel A. Reece, Morgan State University
The purpose of this research is to create a program in Matrix Laboratory
(Matlab), an interactive mathematical programming environment, which
will automate the current manual process of calculating the dispersion
resistance, Rc. Rc is a parameter often used to model the low frequency
dispersive nature seen in transistors. This dispersive nature is characterized by the AC output resistance having a different value from the DC output resistance. The low frequency dispersion resistance can be found by
setting the AC output resistance (RAC) equal to the equivalent resistance
of Rc and the DC output resistance (RDC) connected in parallel. The Center of Microwave, Satellite, and RF Engineering (COMSARE) currently obtain the value of Rc manually which is time consuming, subject to human
calculation errors, and requires significant data manipulation. In order to
automate this process, a program will be developed in Matlab that will
have the capability of reading measured DC and AC data as a function of
gate and drain bias to calculate Rc. Creating this program will support an
Program Book
A67
Abstracts
automative process to obtain Rc and expand COMSARE’s current modeling efforts [This study was supported by a grant from NSF-UP, NSF HRD
0506066.]
154
CuInSe2 Solar Cell Physical Device Modeling
Shamara Collins, Morgan State University
Dr. Corey Dickens, Morgan State University
“CuInSe2 Solar Cell Physical Device Modeling” is one of the most useful projects for the times in attacking the problem of Global Warming.
Considering our economy is in a huge energy crisis, alternatives to the
normal production of fossil fuels is most needed. One alternative is using renewable energy sources, such as solar power. In developing solar
power, one must first focus on the semiconductors in which the solar panels are generated. Therefore, it is important to optimize silicon solar cells
by using the Silvaco ATLAS device-modeling program. In using Silvaco ATLAS, a silicon solar cell was simulated. ATLAS generates a doping profile,
mesh structure, and spectral response which are useful in analyzing the
efficiency of the semiconductor. The device characteristics obtained using silicon in this work will be later compared to the device characteristic
based upon CuInSe2. [This study was supported by HBCU-UP and NSF
HRD 0506066.]
155
Sense-O-Matic Cane: “Ungrounded Detection for the
Blind”
Leon Crawley, Virginia State University
Tona Booker, Celina Green, Kynesha Mason, and Dr. Ehsan Sheybani,
Virginia State University
Blind people have a daily routine that is different from one who has visual
capabilities, where their disability can hinder them from having a conventional lifestyle. One of the main mobility aids used to assist them in everyday travel is the standard blind cane. The standard cane has proven to be
reliable, but it has some limitations in which actions have been taken to
expand the functionality. However, after researching the enhancements of
the cane, we realized that these actions were successful yet futile due to
the lack of consumer interest.
Although some products were successful in creation, there is much room
for improvement. If there was a way to make the “blind” cane more effective and efficient, it would be helpful to those who are not able to see.
With these thoughts in mind we propose to the “Sense-o-matic Cane”. The
“Sense-o-matic Cane” will not make life perfect but it will make moving
around (for the blind) more efficient.
Our mission is to improve on the limitations of the existing blind cane by
adding ultrasonic technology that will notify its user of objects that sit
off the ground. The problem with the current blind cane is that it can only
detect objects through direct contact. The standard cane detects objects
that sit on or within a few inches off the ground. This has shown to be
problematic in detecting items that are overhead and items that sit a few
feet off the ground.
We have designed and developed a blind cane that will notify its users of
such objects by using ultrasonic sensors. The Sense-o-matic Cane uses
an ultrasonic sensor to detect an object at up to a distance of three feet.
Once the object has been detected, the electronic voice playback module
is activated. The playback module outputs a message warning the user of
the detected object. It is at the user’s discretion to act accordingly.
There are currently no other products available on the market that will
notify its user when objects sit off the ground. We’ve interviewed a variety
of potential consumers and have developed a product that will meet the
A68
Program Book
expectations and specifications that the consumers are seeking and are
willing to purchase, use, and love.
156
Segmentation of Medical Images
Amanda Dean, Howard University
Dr. Mohamed Chouikha, Howard University
Automatic segmentation of human organs (such as prostate or liver) or
cancer in the medical images (such as MRI, X-ray or ultrasound images)
is clinically significant but technically challenging. Accurate segmentation
of an organ in a medical image enables a computer to construct a threedimensional (3D) model of the organ and thus helps a doctor correctly
estimate the size of the organ for transplant procedures. Segmentation
of cancer images is critical to the doctors in identifying the cancer margins for planning a successful treatment intervention. Segmentation of
medical images is difficult because the human anatomy is complicated
and differentiation of different tissue types in an image is not obvious. In
this research, we are developing a software system for segmenting MRI
prostate images by using a deformable Snake model. This model technique segments the target in the images by finding the largest change in
intensity gradients. We use the Matlab system and a GVF Snake system to
determine the most accurate boundaries of the prostate. The segmented
prostate boundaries will be used for the construction of 3D prostate models for the planning of prostate cancer surgery. We believe if we can segment the images on an automatic basis, the surgeons will have a better
flexibility on where and how to operate on the prostate of the patients.
157
Characterization of a Laser Diode
Ramona Diaz, Norfolk State University
Dr. Shyh-Chiang Shen, Georgia Institute of Technology
Green light is desirable because of its variety of uses ranging from mobile
projectors to undersea optical communications. However, this has proven
to be a challenge due to the materials needed to create the wavelengths
of green light. If green light can be produced, white light can be created
with an equal mixture of each primary color. This would help reduce the
United States dependence on other countries for energy. In our research,
the overall goal was to create a laser diode that emits light at a wavelength of 500nm using a GaN substrate. The particular wavelength falls
in the green light region. GaN and its alloys, including InGaN, increase
the efficiency of the light. Upon fabrication of the laser diode, I characterized its quality by taking three measurements: the current density, the onresistance, and a power curve. The results showed that the current laser
diodes measured need improvements, possibly in the material growth,
due to the poor quality of each measurement.
158
Bipedal Walking Robot
James Dillard, Morgan State University
Dr. S. Keith Hargrove and Tonya Doram, Morgan State University
This project presents the construction of a 9-inch tall, autonomous, bipedal walking robot with a PIC 16F819 microcontroller for a brain. A bipedal
walking robot allows us to study the dynamic walking and to prove some
intelligent control techniques. We chose to design, fabricate, and operate
a Bi-Pedal Robot to demonstrate basic fundamentals in Robotics using
off-the-shelf electronics and metal parts. This bipedal walking robot is a
prototype task and does not address a problem but is focused on design.
The objective of this project is to build a platform to study the dynamic
walking and to prove some intelligent control techniques. All the electron-
Abstracts
ics were implemented in a low cost PIC16F873 microcontroller. To create
this bipedal walking robot we identified a robotic design for bi-pedal motion and selected the appropriate parts for assembly and operation. The
robot should demonstrate basic robot concepts and provide research experience in product design and development. The research is not finished
and the bipedal walking robot has not been created. We expect the robot
to be able to have the ability to walk on two legs; the ability to explore its
environment and the ability to react to sensory feedback. Further research
should provide us with a finished and fabricated robot along with ways to
improve research on robotics. [NSF HRD 0506066 Historically Black Colleges and Universites Undergraduate Programs.]
159
Design and Construction of a Robotic Bear Simulation
Tonya Doram, Morgan State University
Darian Berry, Morgan State University
Dr. K. Hargrove, Morgan State University
Using VexLabs Robotics Systems, a team of industrial engineering students will construct a robotic bear that will be able carry out various tasks.
The robotic bear will be able to move at the arms, neck, and jaw; and will
be operated using rechargeable batteries. The robot will be programmed
to perform a “roar” when the jaws open and will be programmed to perform other tasks in the future. The steps that were used to build this robot
will be documented for the construction of a system that could be used
in the future when building other robots for other tasks. There is a possibility that the robot will be used in Morgan State University’s homecoming parade. During the parade the efficiency durability of the robot will be
monitored.
160
Layer-specific Glycosaminoglycan Content and
Mechanobiology of the Aortic Valve
161
Most Comfortable Listening
Levels (MCLL) in the Conditions of Music of Students with
Normal Hearing.
Susan Hinmon, Morgan State University
B. Kattel, Morgan State University
What if the music you listened to was the reason why you did not understand your schoolwork? In college campuses all around the world, students listen to music while they are studying. This research analyzed the
Most Comfortable Listening Level (MCLL) in the conditions of music, or
the point at which the students got distracted from his or her studies and
was no longer able to comprehend what they were studying. One of the
difficulties was finding a type of music all of the subjects were used to
listening to. This study tested my hypothesis that The Most Comfortable
Listening Level for students was predicted to be between -50 dB and -60
dB. The MCLL was predicted to have nothing to do with gender. The type of
music was predicted to affect the MCLL of the students. Ten students who
passed hearing test at frequencies from 500 Hz to 4000 Hz were selected
to participate in the experiment. In order to determine the MCLL, the students sat in an Acoustic Chamber with two speakers at a 45 degree angle
from azimuth on each side of the student. Each student was told to the
read a specific passage from a chemistry book while listening to the music
in the background. The student was told to signal through three different
hand signals whether the music was too loud, too quiet or acceptable,
respectively. The music was introduced at -100 dB (the quietest level) and
the volume was increased until the student gave the signal to lower the
volume. When the student reached the MCLL the music continued to play
for three minutes more at that level. At the end, the student was asked
to summarize what was read. Using direct comparison of results it was
found that male students could concentrate at volumes louder than that
for female students. The type of music used in this study did not affect the
results. [This study was funded by HBCU-UP, NSF HRD 0506066.]
Samuel A. Henderson, Langston University
Jane Grande-Allen and Hubert Tseng, Rice University
162
Smart Cones in a Construction Zone
The aortic valve is paramount to the ability of the heart to pump blood to
the rest of the body. During ventricular systole, pressure rises in the left
ventricle. Once the pressure in left ventricle has risen above the pressure
in the aorta the aortic valve opens allowing blood to exit the left ventricle
and flow into the aorta. This process also closes the aortic valve. The aortic valve exists as a tricuspid valve meaning there are three valves, the
right, left, and non coronary valves. Each of these valves can be split up
into three layers, fibrosa, spongiosa, and ventricularis. Until recently, it
was widely believed that tissue engineering a heart valve could be done
by examining the leaflets as a whole. This research intends to investigate
the valve leaflets by their three layers. Particularly close attention will be
paid to the fibrosa and ventricularis layers because the spongiosa layer is
difficult to extract. The ventricularis layer is known for its elasticity while
fibrosa is known for its strength. Glycosaminoglycans (GAGs) can be covalently linked to a protein to form proteoglycans (PGs). Using this knowledge an inference can be made as to which PGs comprise each valve layer.
Once a quantitative analysis of the GAGs and subsequent PGs in each layer is complete inferences about the mechanobiology of the proteoglycans
in each layer can be made. To do this a technique known as Fluorophore
Assisted Carbohydrate Electrophoresis (FACE) will be implemented.
Amanda Magabo, Savannah State University
Jibada Green and Mohamed Mustafa, Savannah State University
The intent of this research is to have students from the Civil and Electronics Engineering Technology program collaborate on the design/development of building a physical model of a Smart Cone in a construction zone.
The project in an experimental setup will consist of a radio remote control
car, Basic Stamp 2 Discovery kit, LCD, and sensors.
In this research, students will construct a highway model with construction zone. The construction zone will be equipped with a smart cone. We
will then design/develop the smart cone through programming the microcontroller (BASIC Stamp II) using Basic language to display appropriate
messages to reroute the path of the vehicle approaching the construction
zone. We will also install appropriate sensors; display message system on
the physical highway model to accomplish the task.
The communication between the smart cone and the driver is achieved
through a message system that displays appropriate messages as the
vehicle approaches the construction zone: 1) once the vehicle is within
20 feet, a “MERGE” message is displayed to indicate to the driver that
he/she is approaching a construction zone; 2) If the driver does not respond and the vehicle is now between one and two meters, a warning
message will be displayed “MERGE IMMEDIATELY, OTHERWISE A CONTROL OF THE VEHICLE WILL BE TAKEN OVER BY THE SMART CONE TO A
SAFE LOCATION;” and 3) Again if the driver fails to respond to the warning
message and the vehicle is at one meter distance from the construction
zone, a message will be displayed “YOU NO LONGER HAVE CONTROL OF
Program Book
A69
Abstracts
THE VEHICLE.” To display the messages several programs were written to
activate the sensors.
Our goal was to communicate with the driver in multiple stages. This was
achieved through the appropriate programs that were written for the sensors to communicate appropriately. In the third stage of communication,
“YOU NO LONGER HAVE CONTROL OF THE VEHICLE,” the smart control will
take over the vehicle and redirect its path to a safe location and communicate with appropriate authorities. Beyond this stage, further research is
needed for the takeover case.
163
Radioactivity Concentration of 222Radon in the City-water
and Well-water Samples at Orangeburg, South Carolina
Stephanie E. Mitchum, South Carolina State University
Dr. Zheng Chang, South Carolina State University
We have measured the radioactivity concentrations of 222Rn in water
samples collected from the city water and groundwater in the area around
Orangeburg, South Carolina. The tap water samples were obtained
from different buildings on the campus of South Carolina State University (SCSU). The groundwater samples were obtained from private wells
around Orangeburg.
As the radon concentrations are generally small in this area, the radon
gas was extracted from 1 liter of the sample water with an organic liquid
scintillator before it is counted on a scintillation analyzer (Tri-Carb 2900®,
PerkinElmer). Long-time measurements (~1 month) were conducted on
some of the samples. It was found that counts over the range of 300 and
1100 keV are attributed to the alpha particles emitted from 222Rn and
its decay daughters 214Po and 218Po. All the three radionuclides are in
secular equilibrium after 3.5 hours from the sampling time. Thus, the radon concentrations were measured from the counts in this range on the
spectra.
It was observed that the activity concentration of 222Rn in the tap water
roughly remains constant (60 pCi/L) over the SCSU campus. However, the
radon concentration changes dramatically with the water temperature.
More measurements are planned in the future in order to find the origin of
radon gas presented in the city water.
As to the groundwater from private wells, it was found that the radioactivities of 222Rn at most of the locations around Orangeburg are low and
stay at the same level (60 to 100 pCi/L). However, a sample obtained from
one location (20 mi from Downtown Orangburg) showed remarkably high
radon activity (~1000 pCi/L). More investigation is scheduled on this location to find out the reason for this significant variation.
164
New Leakage Free Connectors
Miquel Moe, Bowie State University
Eleanya Onuma and Dr. Goloubev, Bowie State University
Almost all modern industries, and the majority of existing services, demand advanced and reliable techniques of tube connections capable to
withstand high pressure, temperature, and aggressive medium. This requirement can be satisfied only by metal seals created through a swaging
process, which in turn, may be broken up into two stages. The first stage
is similar to the process of drawing wire, when the fitting is forced through
a confining die to reduce its diameter. The second stage is when the tubing spring backs on the fitting securing a perfect match between the inner
and outer pipes.
The present research is dedicated to the analysis of metal seal process
based on radial deformation of both fitting and tubing and, as a result,
leading to the proper selection of materials and swaging procedures. Con-
A70
Program Book
ducted research creates grounds for designing and patenting of a new
portable metal sealing device.
165
Reflective Memory vs. Ethernet: Evaluating Data Network
Solutions for LCLS Fast Feedback Controls
Marya Pearson, Norfolk State University
Ernest Williams Jr. and Sheng Peng, Stanford Linear Accelerator
Center, Menlo Park, CA
For reliable beam performance and X-ray Free Electron Laser delivery, the
Linear Coherent Light Source (LCLS) requires a feedback system. Currently, LCLS has software in place for temporary use, but no dedicated
data network exists for feedback. While software is an essential factor in
the feedback system, the focus of this study is an appropriate data network system that can support 120 Hz beam operation, provide reliable
data transfer, and remain scalable for future modifications. Reflective
memory and Ethernet are particularly interesting solutions for this task
as they may provide deterministic, scalable, and unique networking options. Reflective memory handles data by simultaneously replicating and
storing data to multiple memories in the network architecture. Ethernet,
a common data network technology, transports data according to MAC
address and other higher-level protocol. A review of the advantages and
disadvantages of each data network solution was conducted based on
cost, performance, topology, and compatibility.
Although no measurements were collected in favor of either solution, this
assessment suggests that Ethernet with multicast capability will fulfill the
performance requirements.
166
Measurement of Residual Strains in Cube Specimens
Charlotte Peterson, Southern University
Hak-Chul Shin, Southern University
This study explores residual stress in pre-stress concrete structures as
it relates to the determining the safe load limit for transporting vehicles
across a bridge. In the experimental process, an experimental procedure
was developed to measure pre-stress in plain concrete cubes under a defined static load. The concrete cubes measured 203 mm on each side and
designed to have a 28-day compressive strength of 18.6 MPA. Before any
stress relieving slots or holes were applied, the concrete cube specimens
were statically loaded and the resulting strains were measured to obtain
baseline values of strains. After the baseline strains were measured, slots
of two spacing (63.5 mm and 76.2 mm) and four depths (12.7mm, 25.4
mm, 38.1 mm, and 50.8 mm) were applied to eight opposing faces, two on
each cube. Strain relief was observed as a function of depth and spacing
between the slots and holes. Based on the analysis, it was concluded that
cutting slots and measuring strain relief between the holes is a promising technique to estimate pre-stress in pre-tensioned or post tensioned
concrete structures. Some insights were developed to expand the experimental program to expand the experimental program to explorer in small
scale laboratory tests.
167
Military Path Planning using a Geographic Information
System
Donald Phillips, Morgan State University
Dr. Manoj K. Jha, Morgan State University
The United States military accomplishes many missions in other countries. When the U.S. military is stationed in other countries, precise details
about the terrain and geographic features of those countries is generally
Abstracts
not known. Therefore, the military has to find a way to map out its path
from the origin to a desired destination. This problem is called military
path planning. A safe and efficient path must be found between the origin
and destination (O/D).
169
Parameter Optimization of an Equivalent Circuit for the
AlGaN/GaN High Electron Mobility Transistor (HEMT)
In this research we use the Geographic Information System (GIS) technology to obtain an optimal path between a given O/D pair. Specifically,
we use the spatial and network analyst extensions of the ArcView GIS
software to run a few examples to obtain optimal paths for U.S. military
working in foreign territories. The results suggest that ArcView’s spatial
and network analyst extensions can be used effectively for simple military
path planning. For real-world applications, the GIS software will have to
be integrated with optimization algorithms by using actual terrain data.
Casey Smith, Savannah State University
Dr. Douglas Yoder and Anusha Venkatachalam, Georgia Institute of
Technology Savannah
168
Durability Study of SOFC Cathodes in the Presence of
Metallic Interconnects
Chester M. Rodrigues III, University of South Carolina
Dr. Branko N. Popov and Dr. Xugang Lee, University of South
Carolina
Solid Oxide Fuel Cells (SOFC) are electrochemical conversion devices that
produce electricity directly from fuel. They are often intended mainly for
stationary applications with an output ranging from 1 kW to 2 MW. Fuel
Cells are often characterized by their electrolyte composition. The SOFC
is composed of a solid oxide, or ceramic electrolyte material. In turn, it
operates at much higher temperatures (between 700°C and 1100°C) and
can handle various fuels that would otherwise poison or destroy polymer
based fuel cells. Its Achilles heel, in a sense, is that during operation it degrades in performance due to chromium poisoning at various interfaces.
One of the major causes for this long-term performance degradation of
the SOFC is the accumulation of Cr species at or near the cathode/electrolyte interface. At high temperatures, the CrO2(OH)2 vapor is generated
from the oxide scales on the metallic interconnects. Since the oxygen partial pressure at the interface between the cathode and the electrolyte is
lowered by electrode polarization, the CrO2(OH)2 vapor is reduced electrochemically during oxygen reduction, resulting in Cr precipitation. The
overall objective of our research work at the University of South Carolina
is to construct electrochemical solid oxide fuel cells used for polarization
and durability studies. In completion of this task, we evaluated the initial
polarization characteristics of SOFC cathode prior to the durability study
in the presence of metallic interconnects. To provide electrical conduction,
Au meshes and wires were attached to the three kinds of electrodes. For
the investigation of the Cr species poisoning, an E-brite alloy specimen (1
cm2) was placed onto the Au mesh current collector of the working electrode. This helps to prevent a direct solid-state reaction between the LSCF
electrode and the interconnect. And controls the significant degradation
of cell performance resulting from the decrease in the electrical conductivity of the E-brite interconnects. The final objective we achieved was to
develop an efficient protective coating material based on Mn1.5Co1.5O4
spinel for the production of commercially viable metallic interconnects to
further promote strategic advancement in the fuel cell industry.
GaN-based HEMTs are currently an intensely active area of research due
to the industry’s demand for a device that can withstand high temperatures, power, and electrical current over long periods of time, and still be
able to function with little to no damage done to the device. A HEMT is a
type of heterostructure field effect transistor (HFET) that is primarily used
for high-power, high-frequency applications. This particular research focuses on a large-signal equivalent circuit model of the HEMT. Given a set
of experimental I-V curves, our goal was to do a parametric optimization
to match those curves using the circuit simulation software PSPICE.
170
EcoCAR: The NeXt Challenge
Robert Wesley Jr., Howard University
Grant M. Warner, Ph.D., Howard University
At the beginning of the semester, several members of the Howard University community became involved in a project aimed at demonstrating technologies that addressed the critical need for sustainable personal transportation. This project is EcoCAR: The NeXt Challenge. EcoCAR: The NeXt
Challenge seeks to build and test advanced vehicles with a wide range of
potentially feasible production technologies that can be used in future
cars and light trucks to achieve much higher energy efficiency and lower
Green House Gas(GHG) emissions. The main goal of EcoCAR: The NeXt
Challenge is to allow college students the opportunity to obtain handson experience with automotive research and development at the leading
edge of technology with the use of contemporary industrial practices.
As part of the application process, Howard University was presented with
a series of modeling problems from which a conceptual design for a hybrid
vehicle must be made. The problems required the calculation of propulsion power, range of vehicle, fuel consumption, and GHG emissions. A
team of students, supported by faculty advisors from most of the departments in CEACS, completed the application according to the guidelines
given by EcoCAR: The NeXt Challenge. The team is serious about confronting the technical challenges of greenhouse gas reduction and improved
fuel economy; and is equally excited about the prospects of using this
as a vehicle to educate the larger community that the University serves.
If selected, we are confident that this project will continue to excite our
peers and that Howard will be able to field a winning team for the duration
of the competition.
Program Book
A71
Abstracts
Faculty Abstracts
FA #1
Constance G. Bland
Project Director
Mathematics, Computer & Information Science
Mississippi Valley State University
[email protected]
Category: Student Outreach & Bridge Programs
Goals:The Mississippi Valley State Univesity outreach activities are designed to increase the interest in and corresponding selection of STEM
college majors by high school program participants. These efforts are impacted by two major activities which include a summer science program
and the initiation of a dual enrollment program.
The summer science program is designed to affect the science and mathematics interest and readiness of 9th, 10th, 11th and 12th grade students
through a series of academic year activities culminating in an annual three
week residential program on the campus of MVSU. Additionally, the program is designed to provide technology training and corresponding equipment for students, in order to facilitate a deeper understanding of the use
of technology in enhancing their lives. Students participating in the program engage in a series of activities which will allow them to understand
the usefulness of technology in improving their quality of life. The major
outcome of the program is expected to be an increase in STEM activities
and a subsequent increase in enrollment in college preparatory courses in
high school and selection of STEM majors in college.
A second major outreach activity involves the establishment of a dual enrollment program with area high schools. The goal of this initiative is to
improve the mathematics skills of students and to allow students to experience the rigor of a University course while still enrolled in high school.
Evaluation
Methods: A summative evaluation methodology is used to assess the
quality and impact of these outreach activities. The achievement of goals
for these activities are primary based on qualitative data collected from
program participants regarding pre/post test knowledge acquisition,
improvement in ACT Scores, enrollment and completion of STEM college
preparatory classes and selection of STEM majors upon entry into college.
The merit of the project will be determined and measured according to
these variables.
The analysis of the progress made toward these objectives is the major
indicator that measures the success of the project. Tabular data will be
presented which shows the result and impact of program activities.
FA #2
Dr. Chellu S. Chetty
Dean, Graduate Studies and Sponsored Research
College of Sciences and Technology
Savannah State University
[email protected]
Category: Effective research mentoring for undergraduates
Goals: Savannah State University (SSU) received an HBCU-UP grant in July
2003 to establish a Minority Access to Graduate Education and Careers in
Science, Technology, Engineering and Mathematics (MAGEC-STEM) program with engineering as a flagship. The goal was to establish a framework for the production of a continuous stream of highly competent and
well qualified minority scientists, technologists, engineers and mathematicians. This goal was achieved through a vigorous and cost effective implementation of a number of activities including a pre-freshman summer
A72
Program Book
enrichment program and experiential research training which includes:
a) Semester Undergraduate Research Training (SURT), and b) Summer
Undergraduate Research Experience (SURE). Under the SURT program,
approximately 30 freshman (MAGEC-STEM) students participated in the
training from March through July of each year of the grant. More than 25
faculty mentors from SSU, Armstrong Atlantic State University and the
Georgia Institute of Technology (Georgia Tech - Savannah Campus) have
mentored these students. These research activities have produced technical papers coauthored by the students. In their sophomore year, under
the SURE program, the MAGEC-STEM students were placed in research
universities during the summer. The students participating in both the
SURT and SURE programs were required to write a project report at the
conclusion of the term and to give a presentation at the Student Seminar
Series in the following fall semester and also at regional, national conferences. The SURT participants received a $1,500 stipend and free campus
housing during each summer.
Evaluation
Methods: Evaluation Plan: One of the MAGEC-STEM goals is to encourage
program students to participate in both the on- and off-campus research.
The semester/summer research experience mainly includes development
of skills in observation, recording and data analysis. The outcome of the
undergraduate student research participation will be evaluated using the
following methods: a) the evaluation of student performance by the faculty mentor, b) ability to conduct independent research, c) evaluation of
various options for pursuing a career in science and d) how the research
experience helped the student to pursue graduate studies.
FA #3
Dr. Curtis Clark
Boosting Mathematics Skills: Project Identity Summer Institute
2008
Mathematics
Morehouse College
[email protected]
Goals: Ideally, calculus should be the first college course for a student who
plans to pursue a career in the physical or natural sciences or engineering.
The further a student is away from this starting course, the less likely he
or she is to prusue a career in these areas. The goal of this project is to
elevate the level of the starting mathematics course for its participants.
In the mathematics component of the three-week Project Identity Summer
Institute, forty-four rising tenth and eleventh graders were given a college
mathematics placement examination on the first day. Through an analysis
of the placement test, each student was given feedback on the skills that
needed improvement, as well as, general feedback on how the class did as
a whole on each skill. Through in-class work and homework exercises, students enhanced those skills. As a post-test, students were given another
form of the placement examination.
Evaluation
Methods: I did a comparison of the pre- and post- placement examinations. The results were as follows: 1) 11 out of 22 students (50%) moved up
from Basic Math (remedial math) to College Algebra, 2) 4 out of 6 students
(67%) moved from College Algebra to Precalculus, 3) 7 out of 12 students
(58%) moved from Precalculus to Calculus, and 4) Each of the four students who initially placed into calculus raised his overall score. Overall,
55% of the students who were below calculus moved up one level.
Abstracts
FA #4
FA #5
Dr. Freddie M. Dixon
Biological and Environental Sciences
University of the District of Columbia
[email protected]
Category: Innovative STEM curriculum
Stephen I.N. Ekunwe, Ph.D.
Associate Professor/Assistant Chair
Biology
Jackson State University
[email protected]
Goals: STEM Research at the University of the District of Columbia
The goal of this project is to establish a Science, Technology, Engineering, and Mathematics (STEM) Research and Training Center for students
to develop research problem-solving skills by taking revised entry-level
(gate-keeper) and sophomore-level STEM Center courses with a research
component, having research experiences in laboratories, and being exposed to academic enrichment activities. These activities will enhance
students’ interest; improve academic performance; increase retention
rates in STEM programs; increase students’ scores on graduate and professional schools admissions tests; improve competitive employment opportunities; and enhance faculty teaching competencies.
Goals: The goals and intended outcomes of my project are: 1) to separate
the extract of Ocimum gratissimum leaves into its component compounds,
2)use this project as an opportunity for in-coming college students to gain
access to research training.
Each STEM Center laboratory course contains a research component to
complement the STEM Center lecture course. This course emphasizes
deductive reasoning and analytical thinking. Organizing the laboratory
research component involves identifying the problem, conducting a literature search, proposing a hypothesis, designing a research protocol, conducting research, analyzing data, and drawing a conclusion. The research
problem was performed along with the other laboratory assignments from
the traditional syllabus, unless the concept was established as a result of
the experimentation done as a part of the research problem.
Evaluation
The classes were divided into groups which addressed various aspects
of the problem and performed specific experiments to test the hypothesis. Once the experiments were completed, the groups met to analyze
the data. A joint manuscript was written with a results-section delineating
specific data contributed by each group. A conclusion or conclusions were
made from the data presented.
Evaluation
Methods: A major initiative of the STEM Center is to offer gate-keeper and
sophomore-level courses in biology, chemistry, computer science, and environmental science with a research component added to the laboratory
course. Each STEM Center course provided an overview of research activities which included hands-on experiences in data collection and analysis
and interpretation of research data. STEM Center courses taught since
2004 include: Biological Science I, Biological Science II, Integrated Science I, Cell Biology I, Signals and Systems I, and General Chemistry I Laboratory. Examples of research projects include: “Lead in Paint and Drinking Water in the District of Columbia”, “Dry Matter of Various Fruits and
Vegetables”, “DNA Extraction: A Comparison of Liver, Yeast, and Wheat
Germ”, and “Etoposide (VP16) induces Cell Death in MDA-MB 231 Breast
Cancer Cells”. Comparisons were made of passing rates of C or better of
students enrolled in STEM courses before introduction of a research component and after the research component was added (STEM Center Courses). Passing rates of C or better for all courses taught in the STEM Center
since 2004 increased from 77% to 89% respectively. Additionally, student
grades of D and F decreased. A survey was developed and given to faculty
to determine student reaction to conducting research in the classroom.
Faculty teaching STEM Center courses indicate increased enthusiasm and
greater satisfaction of students enrolled in these courses.
The methods and strategies include: (i)aqueous extraction of Ocimum
gratissimum leaves, (ii)concentration of extract by rotary evaporation,
(iii) extract separation on silica gel thin layer chromatography plates, (iv)
visualization and speciation of compounds in extract by appropriate chromogenic reagents and (v) spectral analysis of extracts and its fractions by
ultra-violet spectrometry.
Methods: Stained silica gel plates are examined for particular colors for
the presence or absence of specific compounds. Results show that Ocimum gratissimum leaf extracts contain proteins, steroids, saccharides,
aldehydes and ketones. Spectral analysis also show that some of the fractions may contain different amounts of the compound(s).
The impact of the STARGE High school-to-college summer program is
evident in the number of alumni of the program who will enroll at Jackson
State University and other HBCUs this Fall. My mentee, Ms Ariel Dawkins,
will enroll at JSU as a Biology major this Fall semester and will continue
undergraduate research work in my lab.
FA #6
Dr. Aliecia R. McClain
Director of DNIMAS
DNIMAS/ School of Science and Technology
Norfolk State University
[email protected]
Category: Student support services
Goals: The Dozoretz National Institute for Mathematics and Applied Sciences (DNIMAS) is rigorous honors program at Norfolk State University for
students who major in biology, chemistry, computer science, engineering,
mathematics, or physics. This program was created to reduce the severe
shortage of scientists by producing highly trained graduates who are capable of entering and successfully completing graduate studies in the basic and applied sciences. DNIMAS students receive full scholarships and
other special considerations for their participation in the program. Currently, the graduation rate for students who enter the DNIMAS Program
is approximately 70%. The primary goal of DNIMAS is to raise the level of
academic performance of the students, create an environment that promotes scholarship and enhance retention of students majoring in STEM
courses. Accordingly, a more proactive approach to retaining students
has been introduced. Activities include a more structured Summer Bridge
Program, peer-tutoring, collaborative learning, and mentoring. The goal of
these three new intervention programs is to increase that rate to 100%.
Academic performance data suggests that these structured academic
support initiatives have been successful.
These programs are also designed to help prepare DNIMAS students for
graduate or professional schools by getting them involved in peer-tutoring
and mentoring. In these programs, each DNIMAS student will be required
to spend two hours per week participating in the Peer-Tutoring Program,
Collaborative Evening Tutorial and at least one hour per week in a Shadow
Program Book
A73
Abstracts
Mentoring Program. These 3 intervention programs are designed to help
both the tutor and the student
Evaluation
Methods: Each student was required to complete a minimum of five hours
per week participation in the Peer Tutoring and Mentoring Program.
The Peer Tutoring included one-on-one or peer group tutoring led by a team
of volunteer upperclassmen who were proficient in a given course. The tutorial format fostered peer group learning and one-on-one learning.
To assist first year students in making a smooth transition, we have implemented a student tracking/monitoring process called Shadow Mentoring.
The purpose of the program was to help first year students manage their
academic schedule, to provide proactive mentor support and to monitor
the student’s academic progress.
The Evening Study/Tutorial sessions integrated a variety of tutorial formats to foster learning through student group and student-tutor interactions. Students openly exchanged problem solving ideas and methods.
The idea was to create a forum where students in need of academic assistance were comfortable asking questions and to promote an environment
conducive to camaraderie and studying.
Academic performance data was tracked each fall to determine the percentage of students who earn grade point averages above 3.5. This statistic was used to measure the success of the intervention programs. The
data illustrates that the number of students with a GPA greater than or
equal to 3.5 has increased steadily during the last three years from 35%
in Fall 2005 to 74% in Fall 2007. Moreover, these students had almost 100
% participation in the intervention programs.
FA #7
Mialy Rabe
Assistant Professor of Biology
Natural Science and Mathematics
Shaw University
[email protected]
Category: Innovative STEM curriculum
Goals: Among biological science disciplines, the Human Anatomy and
Physiology Curriculum is one that requires the most memory capabilities
from the students: approximately 850 new vocabularies and terminology should be memorized at the end of the academic year. This Innovative Intensive Assessment Project has three-fold goals by means of a new
technique of “Self-body Focus and Awareness Strategy”:(1) to enhance
student’s memory of Human Anatomy and Physiology terms, (2)to increase their interest in the subject matter, and (3)to improve their critical thinking and communication skills. Food, vitamin supplements, good
learning habits, and techniques aiding memorization will be explained a
the beginning of the semester. Initial student’s learning skill is also assessed at beginning of the semester. Each Session will be preceded by
“My Body Knowledge Quiz” related to the topics of the day based on
the student’s knowledge of his/her own body, and a “Daily Quiz” to test
their knowledge of previous topic covered. Students will answer specific
comprehensive questions and label diagrams to facilitate comprehension
during the lecture. The session will end with an “Individual Chapter Assessment Quiz” and a Critical Thinking/Ingegrative Assessment Group
Assignment. A Laboratory practice conducted at the end of each lecture
session will illustrate the new scientific topic covered and help students
to apply their new knowledge with hands-on activities. The project term
will cover 15 class sessions for one academic semester. The quizzes length
and complexity will increase throughout the semester.
tal class attendance throughout the term of this Project. Each session is
worth 100 points. The respective grade point of each assignment is distributed as follows: “My Body Knowledge Quiz” (5 points), “Daily Quiz” (20
points),”Class Worksheet”(10 points), end of the class “Individual chapter
Assessment Quiz” (15 points), Critical Thinking/Integrative Assessment
Group Assignment (20 points), Laboratory Activities (30 points). Questions
are Multiple Choice, True-and False, label the diagram, Match-the Pair,
Open-ended quesions, Short Essays, puzzles, small problems, hands-on
activity quesions and clinical-related problem quesions. The lecture will be
based on Hole’s Essentials of Human Anatomy and Physiology Textbook
(10th edition) by David Shier et.al. The success of the students will depend
on their total mental presence (complete interest and total concentration)
throughout the class hours (session of 3h 30min). It is anticipated that 85%
of the Human Anatomy and Physiology class of 27 students will get at least
B (above 79%) in the class at the end of the academic year.
FA #8
Earl B. Smith
Using Mechatronics to Introduce Technology in the Classroom
Mechanical Engineering
Tuskegee University
[email protected]
Category: Technology in the classroom
Goals: One goal is to have mechanical engineering students learn in a practical manner about electrical and electromechanical systems. Another goal
is having the students improve their overall practical and hands-on skills.
An expected outcome will be students learning about system response and
how electric devices and circuits work. The students will be able to use the
devices and build various circuits that will perform certain tasks relating to
sound, light, frequency and other things. The students will build upon their
knowledge from the lectures and hands-on assignments/experiments to
build a mobile robot. The students will be able to relate terms such as bits
and bytes to devices like resistors, capacitors and motors.
Lectures will be used to teach the students the fundamentals of circuits,
system response, electric devices and other topics in the course. Handson assignments and experiments will be assigned so the students will
get a firsthand knowledge on how the devices work. This is expected to
engage the student more, where they may describe their project, than it
would in a purely lecture based course. The project will be assigned so
the students can put the knowledge they obtained in the course in order
to build the robots.
Evaluation
Methods: Evaluations will include a variety of methods. One will include
the grading of homework assignments out of the textbook. Assignments
will also include the experiments/hands-on type, where the students will
use a kit to set up the circuits. The project will primarily be where the
student will work on a mobile robot. The evaluations will include how successful the student will complete the project. They will also consider the
difficulty of the task that the robot will attempt. The expected impact is
to have the student better prepared to handle manufacturing issues or
electromechanical systems when they head into industry and/or graduate
school. Another anticipated impact is the student will be better prepared
for the rest of the undergraduate engineering courses like senior design.
Evaluation
Methods: Students will be evaluated by an average of their total grade (100
points X15 sessions) of the 5 daily Quizzes or Assignments and their to-
A74
Program Book
Abstracts
FA #9
Russell Winn
NSF SPEED-UP Program Director
SPEED-UP Program Director
J.F. Drake State Technical College
[email protected]
Goals: In order to expand the current enrollment in the STEM field on campus, the SPEED UP team (NSF HBCU-UP Grant # 0625155) has initiated a
Summer Bridge Program to expose high school and non-traditional adult
students to educational and career opportunities in the STEM fields. During a 64 hour program, 80 high school students and 20 adult students will
take classes in mathematics, physics, biology, and computer science. In
addition to class time, students will participate in field trips to local industries, including the Marshall Space Flight Center.
As a Historically Black College, Drake State is particularly adept at recruiting minority students and this skill is demonstrated in our recruiting
process for the Summer Bridge Program. Minorities represent 96% of the
students we recruited, and of these 59% were women. In order to aid the
recruiting process, Drake State is offering students a stipend of $8.50 per
class hour to attend. With 80 slots, Drake State has received 181 applications from twenty-two high schools in the Northern Alabama area.
The poster presentation our team will make will include the following information:
1. Curriculum and pedagogical modifications to teach the subject matter
in a hands-on and fun way.
2. Minority/Female recruitment best practices.
3. Summer Bridge publications, websites, and readings.
4. Data collected, evaluation, and use.
Evaluation
Methods: The summer bridge program will be evaluated using the following methods:
1. Analysis of Applicant Demographic Data.
2. Analysis of Participant Demographic Data.
3. Analysis of Participant evaluations of classes.
4. Analysis of Participant evaluation of the impact of the program.
5. Analysis of Participant requests for transcripts for the summer bridge
program when making application to Drake State for admission.
6. Analysis of Participant requests for transcripts for the summer bridge
program when making application to other post-secondary institutions.
7. Analysis of Participant enrollment and performance in STEM programs
at Drake State.
8. Program leadership evaluation of the Summer Bridge Program.
This data will be compiled into a poster presentation representing the
best practices of the Drake State recruitment and retention of students
into the program and the STEM fields upon completion of the program.
FA #10
Clement G. Yedjou
Distance Learning/Research Assistant Professor Biology
Jackson State University
[email protected]
Category: Technology in the classroom
Goals: Hybrid course is a blend of face-to-face instruction with Web-based
activities or virtual classes that reduces the amount of classroom seattime. Today, many colleges and universities are used hybrid model to address students’ needs and increase student learning through Web-based
activities. This article explores the use of hybrid course as model to assess
student performance and satisfaction outcomes in a Human Anatomy and
Physiology laboratory course.
Evaluation
Methods: In this research, we hypothesize that virtual laboratories combined with face-to-face laboratories improve students’ performance
than do face-to-face laboratories alone. To test this hypothesis, Human
Anatomy and Physiology laboratory course was taught using virtual and
face-to-face versions, respectively. The course activities included animation quizzes, online survey, labeling exercises, computerized homework,
virtual and wet lab experiments. The outcome of this study demonstrated
that students perform comparably in face-to-face laboratories (wet lab)
and virtual laboratories, but are more satisfied with the activities available in virtual laboratories. These findings provide clear evidence that
virtual labs may be promising in both traditional and online laboratories
courses when used to enhance the course materials.
FA #11
Dr. Yongchao Zhang
Assistant Professor, Chemistry Department
Morgan State University
[email protected]
Category: Effective research mentoring for undergraduates
Goals: Chitosan is a polysaccharide and is an ideal candidate for biosensor applications because of its biocompatibility and biodegradability. The
purpose of this research is to incorporate electro-conductivity and redox
properties into chitosan which is desirable in making electrochemical sensors. Ferrocene carboxaldehyde (C11H12FeO) was used in this research as
the redox species, and the reaction between the aldehyde of Ferrocene
carboxaldehyde and the amines of chitosan led to the formation of Schiff
base which linked the ferrocene species (Fc) to the chitosan backbone.
The redox species (Fc) linked to the chitosan acted as electron mediators
and could transport electrons between the redox centers of the enzymes
and the electrode. Also functionalized chitosan co-deposition with silver
was investigated. Functionalized chitosan deposition was relatively small
to silver; therefore, the proper condition for significant deposition of functionalized chitosan relative to silver was study. The performance of the
redox species-functionalized chitosan in the application of electrochemical biosensors is being evaluated and the modification of the procedure
is underway.
Evaluation
Methods: Biosensors are device for the identification of a substance or
chemical constituent that is determined in an analytical procedure. It combines a biological component and physiochemical detector component. In
recent years attentions have shifted on the environment and quest to make
our environment safer has been intensified; hence, biopolymers are been
employed in the making of electrochemical sensors. Chitosan is one of the
few biological polymers that combine biocompatibility and biodegradability. In essence, chitosan can be covalently linked to other organic functional
group thereby rendering addition features to the properties of chitosan;
also, it can be broken down by enzymes produced in living organism. As
a functional material, the polymer chitosan offers excellent characteristics
such as biocompatibility, film forming ability, non-toxicity, physiological inertness, antibacterial properties and high mechanical strength.
Thus, used extensively for the immobilization of enzymes and in this research modified with redox specie. Chitosan is a linear;-1,4-linked polysaccharide (similar to sugar) that is obtained by partial deacetylation
of chitin. It is a linear copolymer of D-glucosamine and N-acetyl-D-glucosamine. In its linear polyglucosamine chains of high molecular, chitosan
have reactive amino and hydroxyl groups. Its pKa is about 6.5. In aqueous
acidic media (pH <6.5), most of the amino groups are protonated, making chitosan a cationic water-soluble polyelectrolyte. The amine groups
attached along the backbone of chitosan are very reactive and readily react with aldehyde and carboxyl functional groups under mild condition to
form Schiff base and amide
Program Book
A75
Abstracts
Packard Scholars Abstracts
PS #1
Investigating the Role of Nkx3.1 Loss in the Progression of
Prostate Cancer
Sydika Banks, Department of Pathology, Vanderbilt University, 2003
Scholar
Nkx3.1 encodes an androgen regulated homeodomain protein expressed
predominantly within the luminal epithelium of the prostate. Nkx3.1 is
one of the earliest markers of the developing prostatic epithelium and
plays an important role in prostate growth, branching morphogenesis and
secretion production. Expression of this protein is lost in 40% of human
prostate tumors and 20% of prostate intraepithelial neoplasia (PIN) lesions. In mice, conditional loss of Nkx3.1 results in prostatic epithelial
hyperplasia and PIN formation, and increases the susceptibility of mice
with compound mutations to the development of invasive adenocarcinoma. This suggests that Nkx3.1 loss plays a key role in tumor initiation,
and additional genetic alterations are required for progression to carcinoma. Regeneration studies have provided evidence of a small population of progenitor cells dormant within the prostate, which differentiate
into intermediate transient amplifying cells essential for repopulating the
prostate. Interestingly, Nkx3.1 has been shown to regulate this phase of
regeneration. In the absence of Nkx3.1 proliferation is prolonged, therefore increasing the amplifying cell population. Our goal is to investigate
whether loss of Nkx3.1 results in the expansion of a less mature (transit
amplifying) cellular population that is more susceptible to tumorigenic
transformation. We intend to utilize a 3-dimensional in vitro model to
characterize epithelial differentiation stages associated with Nkx3.1 loss
alone or with additional oncogenic mutations. Additionally, we will study
the role and sensitivity of Nkx3.1 loss in cellular transformation using tissue recombination, an in vivo prostate regeneration model system.
PS #2
Effects of Pesticide Exposure on Development,
Phonotaxis, and Call Production in Xenopus laevis
Travis M. Brown, Integrative Biology, University of California,
Berkeley, 2002 Scholar
Amphibian populations have been declining precipitously in the last several decades. Many factors such as habitat loss, emergent diseases, introduced predators and pesticide exposure are thought to be some of the
most immediate causes of the drop in populations. Atrazine, a pesticide
used widely in the United States, has been shown to alter normal gonadal and laryngeal development in male frogs. These effects do not cause
death of the individual frog; but the perturbations are more subtle, possibly negatively impacting the male frog’s reproductive behavior and calling/mating ability, which are crucial in order to win females and successfully mate with them. To test mating ability, I continuously exposed male
Xenopus laevis, from larvae to adulthood, to five different treatments.
Adult males were then used in a phonotaxis experiment, where a sexually
stimulating female call was played through an underwater speaker, and
male behavioral response (calling and movement) was scored. Pesticide
exposure was found to significantly decrease weight and length at metamorphosis, as well as increase the time to metamorphosis. Treatment did
not affect mortality. Behavioral results showed that males alter the interclick-interval if calling simultaneously with a female, regardless of treatment. Click number was not affected by female calling or treatment and
was not found to correlate with size of the male. Also, seasonality exists,
but only for controls, with males tested later in the season taking longer
to begin calling. For most movement variables, no differences between
treatments were found. Animals injected with HCG injection also showed
A76
Program Book
no differences between treatments for most movement variables. Tested
individually, behavioral differences were not born out, but when males
were tested in competition in a concurrent experiment, control males consistently win mates over exposed males.
PS #3
Mechanisms of Axonal Degeneration in Chemotherapyinduced Peripheral Neuropathy
Kavan T. Clifford, Department of Neuroscience, Johns Hopkins
University School of Medicine, 2003 Scholar
Giorgia Melli: Fondazione IRCCS, National Neurological Institute
Carlo Besta, Milan, Italy, Jonathan Glass: Emory University School
of Medicine, Atlanta, Georgia, USA, and Ahmet Höke: Johns
Hopkins University School of Medicine, Baltimore, Maryland, USA
Distal axonal degeneration is a common feature of many peripheral neuropathies, including toxic neuropathies. Although cellular events leading to Wallerian degeneration are known, mechanisms underlying distal
axonal degeneration are not well studied. We examined mechanisms
underlying axonal degeneration in toxic neuropathies induced by ddC,
paclitaxel, cisplatin and acrylamide using a compartmentalized culture
system, which allows physical separation between cell bodies and axons
and differential manipulation of their environment. Due to its widespread
use in oncological settings, we focused our investigation on the chemotherapeutic drug Paclitaxel. We evaluated Paclitaxel’s neurotoxic effects
on peripheral neurons using in vitro assays of cell degradation pathways,
Caspase, Calpains and the Ubiquitin-Proteasome System. In vivo work
evaluating the cell degradation pathways was also performed. We found
that neurotoxic drugs induce distal axonal degeneration to varying degrees in cultured DRG neurons. Each neurotoxic drug has a unique cellular
effector-pathway activation profile. Inhibition of the Caspase Pathway is
upstream of Calpain Activation and inhibition of the Ubiquitin-Proteasome
System is upstream of Caspase Activation. This study shows that distal
axonal degeneration can be mediated through both caspase- and calpaindependent mechanisms. Further elucidation of these different pathways
of axonal degeneration can lead to a better understanding as to why most
peripheral neuropathies affect distal axons.
PS #4
The Role of Msr1 during the Inflammatory Response
Robert Drummond, Cellular and Molecular Medicine, Johns Hopkins
University School of Medicine, 2002 Scholar
Anh Pham, Will Yutzy, Stephen Cheng, Antonio De Maio, Johns
Hopkins University
Septic shock is a major complication observed after trauma and infection
and is likely the product of a prolonged and poorly controlled systemic
inflammatory response. The inflammatory condition can be reproduced in
an endotoxemia mouse model by injection of bacterial lipopolysaccharide
(LPS) into mice. Differences in mortality between C57BL/6J(B6)high and
A/Jlow mice after LPS injection have been correlated with differences in
the inflammatory response between these two inbred strains. Inbred analysis of B6 x A/J pups identified a locus on chromosome 8 that appeared to
modify the levels of IL-10 after LPS challenge. Consomic studies confirmed
this linkage and haplotype analysis further reduced the locus down to a
24cM region of Chr8. Macrophage Scavenger Receptor 1 (Msr1) within this
locus emerged as a candidate gene for the modulation of IL-10 after LPS
challenge. Comparison of A/J and B6 Msr1 haplotypes revealed 9 polymorphisms between the two strains of mice. Initial experiments showed
that protein expression levels between the A/J and B6 strains were also
different. When comparing A/J and B6 mice after LPS challenge, B6 mice
repeatedly responded with a higher secretion of IL-10. In contrast to wild
type B6 mice, Msr1 knock out mice (MSR1-/-) on a B6 background dis-
Abstracts
played reduced levels of LPS-induced IL-10, but not of TNF-a or IL-6, thus
showing the specific role for this gene in the regulation of IL-10. Our goal is
to elucidate the role of Msr1 in the inflammatory response and gain a better understanding of the functional mechanisms behind Msr1 modulation
of IL-10 during inflammation.
PS #7
A Mixed-methods Approach to Understanding Students’
Career Aspirations
PS #5
Sn37Pb Solder Durability vs. Sn3.0Ag0.5Cu Solder
Durability on BGA256
Recent work has shown that having options or choices can be beneficial
in domains ranging from task motivation to health outcomes. (Botti & Lyengar, 2006) While there are data suggesting that all choices, or increasing the number of choices is not beneficial in all situations, learning more
about the conditions that induce the perception of opportunities may be
an essential first step in learning more about the associated outcomes.
Patrice B. Gregory, University of Maryland College Park, 2003
Scholar
Donald Barker, Ph.D, University of Maryland College Park
The durability of lead-free, Sn3.0Ag0.5Cu, solder under shock and cyclic
loads has been investigated. The results are compared to previous tests
involving Sn37Pb eutectic solder. The board was fabricated with two plastic ball grid array (PBGA) packages, and organic solder preservative (OSP)
was used as the board finish. A four point bending setup was used, and
the printed wiring board strain was measured. The results show that the
typical low cycle fatigue to high-cycle fatigue transition region that exists
for lead solders does not exist for the lead-free solder. It is also shown
that Sn37Pb is more durable than the Sn3.0Ag0.5Cu in the low cycle regime, but the two are equally durable in the high-cycle regime.
PS #6
Encapsulated Stretchable Conductors
Joyelle E. Jones, Princeton University
Stretchable electronic circuits are attainable by patterning rigid islands
on an elastomeric substrate. Devices can be built on these islands and
then interconnected by stretchable thin gold lines. When the circuit is
stretched, the gold interconnects between the islands will experience
large strain. Therefore, interconnects that remain electrically conductive
under large strains are critical to the functionality of the stretchable circuitry. This presentation describes the fabrication process for such interconnects. Gold was deposited by electron beam evaporation on an elastomeric silicone substrate – poly dimethyl siloxane (PDMS). The gold was
then patterned by a new photolithography procedure that accommodates
the dimensional instability of PDMS. Finally, the lines were encapsulated
with a stretchable insulating material – photopatternable silicone. All
lines remain electrically conductive during elastic stretch and relaxation.
David E. Myles, Department of Psychology, Yale University, 2002
Scholar
A related line of research focuses specifically on imagined future lifestyle
possibilities. Entitled “Possible Selves,” they are perceptions of what an
individual “would like to become, and what they are afraid of becoming”
(Markus & Nurius, 1986). Having increasing numbers of balanced possible
selves (having expected and feared future selves in related domains) has
been positively associated with declines in risky behavior and increases in
beneficial academic outcomes (Oyserman, 2006). One unanswered question is: How do possible selves come into existence?
There were three themes that emerged from coding of the focus group
conversations: 1. acknowledgement of the social obstacles faced in pursuing the lifestyles they imagine for themselves as adults; 2. realizing the
disparity in their ability vs. those of their age-matched peers to pursue
those lifestyles; and 3. offering suggestions to increase the likelihood that
they and peers in similar circumstances are more likely to realize their
desired career and lifestyle goals. Quantitative analysis revealed that the
number of balanced possible selves increased over the course of the program (Mpre = 0.38; Mpost = 0.78; F = 3.06; p < 0.05).
The insights and commentary provided by the participants offers a perspective not often heard in much of the literature concerning maximizing
adolescent potential (Pjares, 1996). Such information is crucial to creating interventions that address that goal.
Program Book
A77
www.hbcu-up.org
Visit the Conference Website in December 2008 for Information
on the 2009 HBCU-UP National Research Conference.
Preparing your next
biological sciences
lecture or laboratory?
The BEN portal provides access to peer-reviewed
online educational resources from professional
societies, educational organizations, and educators
like you. With BEN resources, educators can incorporate
images and animations into lectures; use virtual labs
and simulations to introduce students to experimental
methods, data gathering, and scientific analysis or
problem solving; and assign articles such as historical
documents for journal club discussions. Discover the
rich array of materials for use in higher education
resources.
www.biosciednet.org
www.aaas.org
Exhibitors
Exhibitor List........................................................................40
Exhibitor Descriptions.......................................................... 41
2007 National Research Conference • 4–7 October 2007
Program Book
39
Exhibitors
Table/ Organization/School
Table/ Organization/School
23
87
26
1
3
32
57
34
31
100
40
55
29
65
88
13
78
5
63
19
14
130
24
69
49
90
46
25
15
33
37
28
American Society for Microbiology
Amgen Scholars Program-Massachusetts Institute of
Technology
Association of American Veterinary Medical Colleges
Boston College Graduate School of Arts & Sciences
Carnegie Mellon University
Centers for Disease Control and Prevention (CDC)
Cleveland Clinic, Lerner College of Medicine
Columbia University
Cornell University
Dartmouth College
67
8
4
56
89
38
Emory University School of Medicine
Environmental Protection Agency, NCER (8723F)
Genius 360, Inc.
Georgia Tech-School of Chemistry & Biochemistry
Harvard University, Graduate School of Arts & Sciences
Indiana University Department of Biology
Indiana University School of Medicine Graduate Division
Johns Hopkins University-Institute for NanoBioTechnology
Johns Hopkins Bloomberg School of Public Health
Johns Hopkins University
Johns Hopkins University School of Nursing
Keck Graduate Institute of Applied Life Sciences
Massachusetts Institute of Technology
Medical College of Wisconsin
Medical University of South Carolina
Miami University-The Graduate School
Michigan Technological University-Graduate School
National Nanotechnology Infrastructure Network
National Research Council of the National AcademiesFellowship Programs
Ohio Aerospace Institute/NASA
Rensselaer Polytechnic Institute
Rice University
Rutgers University, Graduate Admissions
Science Careers - AAAS
Southwest College of Naturopathic Medicine
40
Program Book
43
30
36
66
11
22
20
2
47
62
48
17
42
45
6
9
12
54
44
21
10
35
16
18
7
27
64
Stony Brook University- The Graduate School
The Ohio State University
The Ohio State University/College of Mathematical and
Physical Sciences
The Pennsylvania State University – Huck Institutes of the
Life Sciences
The University of Alabama
UGA-The College of Veterinary Medicine
University of California San Diego & Scripps Institution of
Oceanography
University of California, San Francisco
University of California, Davis
University of Cincinnati College of Medicine
University of Colorado at Boulder
University of Connecticut
University of Delaware
University of Houston
University of Illinois-Graduate College
University of Illinois at Chicago
University of Massachusetts Amherst
University of Minnesota-Biomedical Sciences Graduate
Programs
University of Minnesota Combined MD/PhD Training
Program
University of New Mexico
University of North Carolina at Chapel Hill
University of Pennsylvania-Nano/Bio Interface Center
University of Pittsburgh-Department of Rehabilitation
Science and Technology
University of South Florida
University of Texas Southwestern Medical Center at Dallas
University of Virginia
University of Washington-Molecular & Cellular Biology
Program
University of Wisconsin-Madison
UW Genome Sciences
Virginia Bioinformatics Institute
Exhibitors
American Society for Microbiology
As an Amgen Scholar, students will have the opportunity to:
1752 N Street NW
Washington, DC 20036
http://www.asm.org/Awards/index.asp?bid=14930.
www.asmgap.org.
• Take part in important university research projects, gain
hands-on lab
• Experience and contribute to the advancement of science;
• Interact with and receive guidance from faculty mentors,
including some of the nation’s top academic scientists;
• Attend scientific seminars, workshops and other networking
activities.
Contact: Tiffani Fonseca
[email protected]
Table #23
The American Society for Microbiology (ASM) is the largest
scientific society of individuals interested in the microbiological
sciences. The ASM Education Board offers a variety of programs
and opportunities for undergraduate students, graduate
students and postdoctoral scientists. ASM also offers intensive,
interactive, hands-on training professional development
programs for graduate and postdoctoral scientists, focusing on
presentation and career planning, grant writing, and teaching
strategies.
• The Education Board programs and opportunities include:
• ASM/CCID Postdoctoral Research Fellowship
• ASM Robert D. Watkins Graduate Research Fellowship
• ASM Undergraduate Research Fellowship (URF)
• ASM Microbiology Undergraduate Research Fellowship (MURF)
• ASM Undergraduate Teaching Fellowship (UTF)
• ASM Kadner Institute
• ASM Presentation Skills Institute for Graduate Students
Amgen Scholars Program
Bldg W31-223
77 Massachusetts Avenue
Cambridge, MA 02139
http://www.amgenscholars.com/
http://www.amgenscholars.com/programflyer.pdf
Contact: Stephanie Johnson
[email protected]
Table #87
The Amgen Scholars Program provides hundreds of selected
undergraduate students with the opportunity to engage in a
hands-on research experience at some of the nation’s leading
educational institutions. Currently, 10 universities host the
summer research program.
Association of American Veterinary Medical Colleges
1101 Vermont Avenue, NW
Suite 301
Contact: Lisa Greenhill
[email protected]
Table #32
The Association of American Veterinary Medical Colleges
(AAVMC) represents all 32 veterinary medical colleges in the
United States and Canada, nine departments of veterinary
science, seven departments of comparative medicine, three
veterinary medical education institutions, and six international
colleges of veterinary medicine in its collective dealings with
governmental bodies, veterinary medical organizations, the
animal and human health industry, educational and scientific
organizations and the public.
Boston College Graduate School of Arts & Sciences
140 Commonwealth Ave.
McGuinn 221
Chestnut Hill, MA 02467
http://gsas.bc.edu/
Contact: Natalie Joubert
[email protected]
Table #57
Founded in the early 1920s, the Graduate School of Arts and
Sciences at Boston College is the oldest of BC’s seven graduate
and professional schools. Comprised of 17 departments the
Graduate School offers doctoral and Master’s degrees in the
humanities, social and natural sciences. The faculty determines
admission standards and establishes the requirements for the
various degree programs.
Program Book
41
Exhibitors
The Graduate School also offers several dual-degree options in
cooperation with: The Carroll School of Management; the Boston
College Law School; the Lynch School of Education; and the
Graduate School of Social Work.
Carnegie Mellon University
533 Warner Hall
5000 Forbes Avenue
Pittsburgh, PA 15235
Contact: Suzie Laurich-McIntyre
[email protected]
Table #34
Carnegie Mellon is a global research university of more than
10,000 students, and 4,000 faculty and staff. Recognized for its
world-class arts and technology programs, collaboration across
disciplines and innovative leadership in education, Carnegie
Mellon is consistently a top-ranked university. Its real-world
impact is visible within our local communities, across the country
and around the world.
The university consists of seven schools and colleges:
Carnegie Institute of Technology, College of Fine Arts, College
of Humanities and Social Sciences, Heinz School of Public
Policy and Management, Mellon College of Science, School of
Computer Science and the Tepper School of Business.
Cleveland Clinic Lerner College of Medicine
Cleveland Clinic NA21
9500 Euclid Ave
Cleveland, OH 44195
Contact: Elizabeth Myers
[email protected]
Table #100
The College Program is a distinct curriculum offered by the
Cleveland Clinic Lerner College of Medicine in collaboration with
Case Western Reserve University School of Medicine. The goal of
the College Program is to train physician investigators, and the
curriculum is designed to foster a passion for scientific inquiry,
skills for critical thinking and clinical expertise. This is the only
program in the country that combines an integrated didactic and
experiential research curriculum that extends throughout the
five years of medical school with a required master’s level thesis
based on hypothesis-driven clinical or basic research. Students
graduate with an “MD with Special Qualifications in Biomedical
Research.” The basic science curriculum provides a graduate
education approach, with interactive seminars, problem based
learning sessions, and laboratories aimed at developing in-depth
problem solving skills. The ideal applicant will have some prior
research experience and the ability to learn in self-directed small
group settings. All students receive a full tuition scholarship.
Centers for Disease Control and Prevention (CDC)
1600 CLIFTON ROAD, E67
ATLANTA, Georgia 30329
http://www.cdc.gov/about/
Contact: Corlis Voltz
[email protected]
Table #31
Centers for Disease Control and Prevention (CDC) celebrated its
60th anniversary in 2006. Since day one (July 1, 1946), CDC has
been a leader in Public Health. Explore CDC’s past and learn how
our Health Protection Goals have become an integral part of our
present and future plans to improve Public Health.
There are many employment, education, training, and volunteer
programs at CDC. If you want to get involved with public health,
CDC has a program that may be right for you.
42
Program Book
Exhibitors
Columbia University
819 IAB Mail Code 3355
420 W 118th St.
New York, NY 10027
http://www.columbia.edu
Contact: Eva Kaplan
[email protected]
Table #40
From its beginnings in a schoolhouse in lower Manhattan,
Columbia University has grown to encompass two principal
campuses: the historic, neoclassical campus in the Morningside
Heights neighborhood and the modern Medical Center further
uptown, in Washington Heights. Today, Columbia is one of the
top academic and research institutions in the world, conducting
pathbreaking research in medicine, science, the arts, and the
humanities. It includes three undergraduate schools, thirteen
graduate and professional schools, and a school of continuing
education.
Cornell University
350 Caldwell Hall
Graduate School
Ithaca, NY 14853
Contact: Ayana Richardson
[email protected]
institutes, see the Catalog or the Cornell Centers and Institutes
Web site http://www.cornell.edu/academics/centers.cfm.
Dartmouth College
304 Wentworth Hall
Dartmouth College
Hanover, NH 37550
http://www.dartmouth.edu
Contact: Sandra Spiegel
[email protected]
Table #29
Dartmouth College educates the most promising students and
prepares them for a lifetime of learning and of responsible
leadership, through a faculty dedicated to teaching and the
creation of knowledge. Since its founding in 1769 to educate
Native students, English youth, and others, Dartmouth has
provided an intimate and inspirational setting where talented
faculty, students, and staff - diverse in background but united
in purpose - contribute to the strength of an exciting academic
community that cuts easily across disciplines.
Emory University School of Medicine
School of Medicine
1648 Pierce Drive, Room P374
P-374
Atlanta, GA 30322
Table #55
With 94 major fields and 16 minor fields of study, and with 15
different graduate degrees awarded, graduate study at Cornell
defies easy categorization. But despite our enormously diverse
academic offerings, a few common practices unify the Graduate
School experience. Our faculty members are truly available to
our students. The Graduate School’s unique organization into
fields of study -- which groups faculty by common academic
interest, regardless of college or department affiliation --ensures
that faculty and students across the university can share ideas
and work together freely and without undue administrative
barriers.
For more detailed information on the academic structure of the
Graduate School, degrees offered, and opportunities for study,
see the Graduate School Catalog http://catalog.gradschool.
cornell.edu. For information regarding research centers and
Contact: Mary Horton
[email protected]
Table #65
The Division of Biological and Biomedical Sciences consists of
eight interdisciplinary Ph.D. Programs:
• Biochemistry, Cell and Developmental Biology
• Genetics and Molecular Biology
• Immunology and Molecular Pathogenesis
• Microbiology and Molecular Genetics
• Molecular and Systems Pharmacology
• Neuroscience
• Nutrition and Health Sciences
• Population Biology, Ecology and Evolution
The MD/PhD Program provides the opportunity for exceptionally
Program Book
43
Exhibitors
bright and dedicated students to acquire both clinical and
basic research training to pursue careers in academic medicine.
Graduate training is available within the biological, physical and
social sciences, public health, and humanities. These physicianscientists will become future medical leaders.
Environmental Protection Agency
National Center for Environmental Protection (NCER)
1200 Pennsylvania Ave, NW
Mail Code 8723F
Contact: Georgette Boddie
[email protected] (Undergraduate Fellowships)
Stehanie Willett
[email protected] (Graduate Fellowships)
Table #88
EPA is continuing to offer undergraduate and graduate
fellowships to students in environmentally related fields of study.
Students conducting research in the physical and biological
sciences, as well as the social sciences and engineering, are
eligible to apply for these fellowships beginning in September
2008. Minority applicants are especially encouraged to apply
since the number of minority applicants has historically been
low. The application period for GRO Undergraduate fellowships
ends December 11, 2008. Awards will be determined in May of
2009 for 2009-20010 academic year. See http://es.epa.gov/
ncer/fellow/ for more details.
Greater Research Opportunities (GRO) Undergraduate
Fellowships
• College sophomores should apply now in order to be eligible
to receive financial support for their junior and senior years
• Up to $19,250K yearly financial support to students attending
school in the U.S.
• Additionally, $8,000 paid summer internship between junior
and senior year is facilitated by EPA
• GRO undergraduate fellowships can only be awarded to
U.S. citizens or permanent residents attending specified
institutions (see website).
44
Program Book
Genius 360, Inc.
GRE Preparation
604 Augusta Drive
Marietta, GA 30067
Contact: George Diaz
[email protected]
Table #13
Since our inception, the philosophy of Genius 360, Inc. has been
to provide motivated students with the tools to realize their
highest potential. One of our core competencies is to help HBCUUP students maximize their scores on the GRE exam. We provide
students with critical reasoning workshops as a complement
to our GRE preparatory course, and tailor design any program
to fit the needs of any Historically Black College or University.
From superb structure to indelible instruction and materials;
every aspect of preparation has been carefully designed around
the student. We look forward to helping your students become
successful candidates to graduate programs.
Georgia Tech
School of Chemistry & Biochemistry
901 Atlantic Drive
Atlanta, GA 30332-0400
Contact: Dr. Keith Oden
[email protected]
Table #78
The Center on Material and Devices for Information Technology
Research (CMDITR) is a NSF Science Technology Center (STC).
The Center’s (www.stc-mditr.org) three lead institutions are
the Georgia Institute of Technology (Atlanta), the University of
Washington (Seattle) and the University of Arizona (Tucson).
CMDITR provides students with opportunities for paid summer
research experiences (via Hooked on Photonics ten-week
summer program), graduate school enrollment opportunities
and graduate school funding.
The CMDITR provides opportunities for excellence in research,
education, and technology for scientists, graduate students and
undergraduate students in: chemistry, physics, optical sciences,
materials science, and engineering. For further information on
opportunities contact: [email protected].
Exhibitors
Harvard University, Graduate School of Arts & Sciences
Indiana University School of Medicine Graduate Division
Harvard University - GSAS
Holyoke Center 350
1350 Massachusetts Avenue
Cambridge, MA 02138
http:// www.gsas.harvard.edu.
IU School of Medicine
635 N. Barnhill Drive, MS 207
Indianapolis , IN 46202
Phone: 317.274.3441
Fax: 317.278.5211
[email protected]
http://grad.medicine.iu.edu/HowtoApply
Contact: Stephanie Parsons
[email protected]
Table #5
The Graduate School of Arts & Sciences (GSAS) offers over 50
PhD programs in the Humanities, Social Sciences, and Natural
Sciences, including the School of Engineering and Applied
Sciences. We have a generous program of financial assistance
for those programs. We also offer some AM, ME, SM degrees as
well as the MFS. More information can be found at www.gsas.
harvard.edu.
Indiana University
Biology Department
Myers Hall 150
915 E. Third Street
Bloomington, IN 47405
Contact: Tracey Stohr
[email protected]
Table #63
The Indiana University Department of Biology offers graduate
programs in Molecular Biology & Genetics (Ph.D.); Microbiology
(M.A. or Ph.D.); Ecology, Evolution & Behavior (Ph.D.), and
Plant Biology (M.A. or Ph.D.). Ph.D. students receive full
support in the form of fellowships or assistanceships. As part
of our commitment to diversity, we waive application fees for
minority students. Also, HBCU graduates are eligible to apply
for one of four, 4-year, $25,000 IU fellowships. The I.U. Biology
Department ranks in the Top 10% of all biology departments.
Fall 2009 admission deadlines: (domestic) January 5, 2009;
(international) December 1, 2008.
Contact: Jennifer Williams
[email protected]
Monica Henry, Program Director
Indiana University School of Medicine - Graduate Division
[email protected]
Table #19
Offering programs in the Life Sciences, and Biomedical Sciences,
the Indiana University School of Medicine (IUSM) offers
graduate degrees in 10 basic medical science disciplines. Ph.D.
students enter through an Open Admission program (IBMG
Program) where they have up to one year to select a research
laboratory and degree program [students participate in three
lab rotations to facilitate their decision]. Research-based M.S.
degrees are offered in each of the 10 disciplines and 3 specialty
degrees are also offered: Biotechnology; Genetic Counseling;
and Pathologists’ Assistant. M.S. students enter directly into
the program they apply to. In addition to the Ph.D. and M.S.
programs the IUSM offers a special Indiana Medical Scientist
Training (MSTP) program leading to the combined M.D./Ph.D.
3400 N. Charles St
Baltimore, MD 21218
Contact: Ashanti Edwards
[email protected]
Table #14
The Institute for NanoBioTechnology (INBT) at Johns Hopkins
University integrates research, education with outreach and
technology transfer. Through INBT, researchers from the schools
of engineering, medicine, public health, and arts and sciences
study diagnostics and therapeutics, human health and the
environment, and molecular and cellular dynamics.
Program Book
45
Exhibitors
Training opportunities through INBT include the National Science
Foundation funded IGERT (Integrative Graduate Education and
Research Traineeship), IRES (International Research Experience
for Students in Nanobiotechnology), and REU (Research
Experience for Undergraduates); and the National Institutes
of Health T32 postdoctoral fellowship in Nanotechnology for
Cancer.
Johns Hopkins Bloomberg School of Public Health
2017 E. Monument Street
Baltimore, MD 21205
http://www.jhsph.edu/
Contact: Kimberly Saunders
[email protected]
Table #130
The Johns Hopkins Bloomberg School of Public Health is
dedicated to the education of a diverse group of research
scientists and public health professionals, a process inseparably
linked to the discovery and application of new knowledge, and
through these activities, to the improvement of health and
prevention of disease and disability around the world. To this
end, the School’s Student Diversity Office facilitates a Diversity
Summer Internship Program, recruitment and retention of
underrepresented minority students in search of a quality
education. Review the School’s website at www.jhsph.edu. Write
[email protected] with inquiries or to schedule a campus visit.
3400 N. Charles Street
101 Whitehead Hall
Baltimore, MD 21218
http://www.grad.jhu.edu
Contact: Rita Banz
[email protected]
Table #24
Since its founding in 1876 as the nation’s first research
university, Johns Hopkins has nurtured a community of learners
who push ever outward the boundaries of knowledge and use
their Hopkins education to make a meaningful difference in
the world. The Schools of Arts and Sciences and Engineering,
located on Hopkins’ Homewood campus in the vibrant city
46
Program Book
of Baltimore, offer comprehensive graduate education in 34
programs that span the humanities, social and natural sciences,
and engineering. Graduate students work as junior investigators
alongside world-renowned Hopkins faculty members, and in so
doing, they engage in exciting original research and an intensity
of academic experience unlike any other.
Immersed in this remarkably collaborative and richly diverse
environment, graduate students in Arts and Sciences and
Engineering are guided by the university’s founding principle of
“expanding knowledge and putting that knowledge to work for
the good of humanity.”
Johns Hopkins University School of Nursing
525 N Wolfe St.
Baltimore, Maryland 21205
http://www.son.jhmi.edu/
Contact: Denelle Alton
[email protected]
Table #69
Johns Hopkins University School of Nursing offers academic
preparation for the future leaders in the profession of nursing
to practice in national and international settings. Degreed
programs include Baccalaureate, Master’s and Doctoral
education. Areas of focus include, but are not limited to,
Forensic Nursing, Emergency Preparedness/Disaster Response,
Nurse Practitioner, MSN/MBA, MSN/MPH, DNP & PhD.
Keck Graduate Institute of Applied Life Sciences
Office of Admissions
535 Watson Drive
Claremont, CA 91711
http://www.kgi.edu/x66.xml
Contact: Tanya Dumrongmanee
[email protected]
Table #49
Founded in 1997, Keck Graduate Institute of Applied Life
Sciences (KGI) is the only American graduate institution devoted
solely to bioscience education and discovery. The Institute is
the seventh and newest member of the Claremont Colleges
consortium.
Exhibitors
KGI features the innovative Masters of Bioscience (MBS)
degree, a graduate program designed to educate scientists and
engineers to be the bioscience business leaders of the 21st
Century. A unique professional degree, the MBS emphasizes
interdisciplinary and team-based active learning and is rapidly
becoming the premier degree for individuals entering the
biotechnology, medical device, pharmaceutical development,
and modern agricultural industries. With the support of key
industry partners, the MBS program has recently expanded to
include a distinctive educational opportunity in bioprocessing.
In addition to the MBS-PhD in Applied Life Sciences, KGI
collaborates with Claremont Graduate University to offer a
doctoral degree in Computational and Systems Biology.
graduate programs. This representation of students from
diverse backgrounds contributes greatly to the richness of the
MIT community and to the excellence of its graduate academic
programs.
Carol Knapp, Program Coordinator
Medical Scientist Training Program
8701 Watertown Plank Road
Milwaukee, WI 53226
Phone: 800-457-2775
Fax: 414-456-6345
Contact: Carol Knapp
[email protected]
77 Massachusetts Ave
Building 3-138
Cambridge, MA 02139
http://web.mit.edu/aboutmit/
Contact: Manu Platt
[email protected]
Table #90
For more than a century, MIT graduate programs have provided
ideal environments for advanced study by faculty and students
working together to extend the boundaries of knowledge. The
Institute has traditionally been a national leader in engineering
graduate education, and its doctoral programs in mathematics
and the physical and life sciences have also attained national
prominence. In addition, top-ranked graduate programs in
economics; political science; linguistics; science, technology,
and society; architecture; urban studies; and management have
broadened the spectrum of graduate education.
The most important factor in the effectiveness of graduate
programs at MIT is the quality of the faculty. MIT is proud of its
nationally and internationally recognized faculty of scholars and
academic leaders, who are also effective teachers and research
collaborators.
The broad scope and high quality of its graduate education
have made MIT an international leader. More than a third of
its graduate students come from foreign nations. Significant
efforts have been made, with some success, to increase the
numbers of minority and women students attending MIT’s
Table #46
The Medical Scientist Training Program (MSTP) at the Medical
College of Wisconsin supports students in the pursuit of medical
and research training that leads to the combined MD-PhD
degree. MSTP students train as basic scientists in the Graduate
School of Biomedical Sciences and as physicians in the Medical
School to become Physician-Scientists. Students are supported
throughout their studies to reduce the cost associated with their
training experience. MCW is one of the fastest growing medical
schools and ranks in the top third of medical schools for NIH
funding. Our Program provides a supportive environment to earn
the combined MD-PhD degree.
Medical University of South Carolina
173 Ashley Ave, BSB 102
MSC 501
Charleston, SC 29425
Contact: Cynthia Wright
[email protected]
Table #25
A free-standing academic health center, the Medical University
of South Carolina (MUSC) has a special mission to translate
advances in fundamental science to improvements in health
care. The College of Graduate Studies at MUSC offers M.S.,
Ph.D., M.D./Ph.D., D.M.D./Ph.D. and Pharm.D./Ph.D. programs
in the biomedical sciences. Located in scenic Charleston, SC we
offer competitive stipends ($23,000-$25,000 /year), paid health
Program Book
47
Exhibitors
insurance and tuition, and travel awards to Ph.D. students.
We also have a robust Summer Undergraduate Research
Program that provides funding for undergraduates to obtain
research experience. The College of Graduate Studies has an
interdisciplinary first year curriculum composed of coursework,
laboratory rotations, and special topics seminars.
Michigan Technological University
Miami University
Table #33
The Graduate School
102 Roudebush Hall
Oxford, OH 45056
Contact: Valerie Robinson
[email protected]
Table #15
In affiliaton with the Public university of Ohio, Miami University is
located in Oxford, Ohio, 35 miles north of Cincinnati and 45 miles
south of Dayton.
A student-centered university, Miami University emphasizes
student-faculty partnerships in learning and research. Miami
University was established in 1809, named for the Miami Indian
Tribe which inhabited the area now known as the Miami Valley
region of Ohio.
Miami University has a distinguished graduate faculty in
the natural sciences, social sciences, humanities, the arts,
education, engineering, and business. Miami University offers
12 doctoral programs and more than 50 master’s programs, with
more than 15,000 undergraduates, 1,700 graduate students.
Miami University has been named one of the “Public Ivies,” a
distinguished group of public academic institutions.
Miami University attracts students from throughout the nation
and the world. International graduate students at Miami
represent many nations.
48
Program Book
Graduate School
1400 Townsend Drive
Houghton, MI 49931
http://www.mtu.edu/
Contact: Betty Chavis
[email protected]
Michigan Tech was founded in 1885 in response to the first
mining boom in the U.S. — the clamor for Michigan’s copper,
which preceded the California Gold Rush by several years.
At its outset, the college trained mining and metallurgical
engineers. Today, the University offers certificates, associate,
bachelors, masters, and doctoral degrees in arts, humanities,
and social sciences; business and economics; computing;
engineering, forestry and environmental science, sciences; and
technology.
National Nanotechnology Infrastructure Network
ECE
1301 Beal Ave, 2239 EECS
Ann Arbor, MI 48109-2122
http://www.nnin.org/
Contact: Sandrine Martin
[email protected]
Table #37
The National Nanotechnology Infrastructure Network ( NNIN ) is
an integrated partnership of thirteen user facilities, supported by
NSF, providing unparalleled opportunities for nanoscience and
nanotechnology research.
The network provides extensive support in nanoscale
fabrication, synthesis, characterization, modeling, design,
computation and hands-on training in an open, hands-on
environment, available to all qualified users.
Exhibitors
National Research Council of the National Academies
Rensselaer Polytechnic Institute
Fellowship Programs
500 5th Street NW
Keck 568
110 8th St
Admissions Office
Troy, NY 12180
http://gradadmissions.rpi.edu
Contact: Dannetta Winstead
[email protected]
Contact: George Robbins
[email protected]
Table #28
Table #8
The National Research Council of the National Academies offers
Ford Foundation Diversity Fellowships for research-based study
in the sciences and humanities. Fellowships are offered at the
predoctoral, dissertation, and postdoctoral levels. Qualified
applicants must be U.S. citizens who are committed to a career in
teaching at the college or university level. These Fellowships are
portable and provide a generous stipend as well as an institution
allowance for predoctoral and postdoctoral fellows. Complete
information, including instructions on how to apply online,
is available at http://national-academies.org/fellowships.
Questions can be directed to 202-334-2872 or [email protected].
Rensselaer Polytechnic Institute is the nation’s oldest
technological research university. Located in the Capital
District of New York State, Rensselaer offers a broad range of
graduate programs from five schools—Engineering, Science,
Lally School of Management and Technology, Architecture, and
Humanities and Social Sciences. Unique programs include
interdisciplinary degrees in information technology, the MFA in
Electronic Arts, and extensive opportunities in biotechnology
and nanotechnology.
Ohio Aerospace Institute/NASA
22800 Cedar Point Road
Cleveland, Ohio 44142
Contact: Mary Roberts
[email protected]
Table #67
OAI offers superior experience and knowledge in aerospacerelated research and technology, multi-disciplinary services
in meeting our clients’ diverse education and training needs,
and a wide range of mechanisms to promote networking and
information exchange.
Rice University
6100 Main Street
Duncan Hall Room 1091
Mail Stop 641
Houston, TX 77005
http://www.rice.edu/
Contact: Theresa Chatman
[email protected]
Table #4
Rice University is consistently ranked as one of the nation’s best
teaching and research universities. That’s not surprising, since it
shares much in common with the nation’s other top universities,
including applicants. Rice applications overlap with Ivy League
schools and other schools such as MIT, Stanford, and Duke.
Whether you’re seeking research experience, a career change
or a boost up the corporate ladder, completing your graduate
studies at Rice University can offer a significant edge. Our
prestigious professional and research-oriented programs are
highly selective, and they attract some of the world’s brightest
and most talented minds. In addition to a personalized — and
personable — education experience with noted faculty who
lead their professions, Rice graduate students have access to
Program Book
49
Exhibitors
a variety of fellowships and other awards that help turn their
academic dreams into financial realities. Success starts here!
Rutgers University, Graduate Admissions
18 Bishop PLace
New Brunswick, NJ 08901
http://www.rutgers.edu
Contact: James Delacruz
[email protected]
Table #56
Rutgers is one of the nation’s major public institutions of higher
education. Chartered in 1766, Rutgers has a unique history as a
colonial college, a land-grant institution, and a state university.
The university’s 27 degree-granting units offer majors in more
than 100 fields, with thousands of courses covering the full range
of human experience.
Science Careers
American Association for the Advancement of Science
(AAAS)
1200 New York Ave, NW
Ste. 351
Contact: Allison Pritchard
[email protected]
Table #89
Science Careers, published by Science and AAAS, offers the
key resources you need to advance your career. Thousands
of searchable jobs from industry, academia, and government
are available online. The free, newly enhance website also
offers scientists Job Alert e-mails, Career Advice, a Resume/
CV Database and more. Our Career Forum offers scientists the
chance to connect with advisers from industry and academia, as
well as peers, to get advice and guidance. The site will also add
a diversity focused portal in early 2009. Visit ScienceCareers.
org today. Your future awaits.
50
Program Book
Southwest College of Naturopathic Medicine
2140 E Broadway
Tempe, Arizona 85282
http://www.scnm.edu
Contact: Allen Caldwell
[email protected]
Table #38
SCNM offers a four-year professional medical degree
in Naturopathic Medicine accredited by the Council on
Naturopathic Medical Education (CNME) and The Higher Learning
Commission of the North Central Association of Colleges and
Schools. Graduates are educated in the same basic sciences as
MDs, including natural therapeutics and nontoxic approaches to
therapy with an emphasis on disease prevention and optimizing
wellness. The beautiful campus is home to the SCNM Research
Department, and the Southwest Naturopathic Medical Center is
located in nearby Scottsdale.
Stony Brook University - The Graduate School
Melville Library E-1340
Stony Brook, NY 11794-3387
http://www.grad.sunysb.edu
Contact: Toni Vicari
[email protected]
Table #26
With the collaborative, interdisciplinary atmosphere of our
departments, our outstanding faculty, and our dedication to
providing students with a variety of opportunities for research,
the Graduate School offers students a well-rounded education
that fully enables them to excel in whatever career path they
choose.
Exhibitors
Rm 310H Lincoln Tower
1800 Cannon Dr
Columbus, OH 43210
Contact: Lakisha Mays
[email protected]
classroom instruction and faculty-supervised research
experiences.
The mission of the College is to promote curiosity-driven
research in fundamental sciences while simultaneously stressing
teaching at the undergraduate and graduate levels to enhance
the University’s goals as set forth in the Academic Plan.
Table #1
Ohio State University is a world-class research university
committed to diversity and providing unparalleled opportunities
for underrepresented minorities, to pursue graduate work in a
welcoming, supportive learning atmosphere. Ohio State is one of
the country,s top 10 research institutions supported by federally
funded research dollars—with nearly $750 million in 2008.
World-renowned faculty and leaders in their field are available
to offer professional expertise and guidance in a friendly and
inclusive atmosphere. You will have the opportunities to interact
with the best and brightest faculty, staff and students that were
drawn to Ohio State due to our reputation of excellence.
College of Mathematical and Physical Sciences
425 Stillman Hall
1947 College Road
Columbus, OH 43210
http://www.mps.ohio-state.edu/?q=aboutus
Contact: Oludurotimi Adetunji
[email protected]
Table #3
The Pennsylvania State University- Huck Institutes of the
Life Sciences
101 Life Sciences Building
University Park, Pennsylvania 16802-2123
Contact: Michael Radis
[email protected]
Table #43
The Huck Institutes of the Life Sciences at The Pennsylvania
State University is an umbrella unit for 11 interdisciplinary
life sciences programs/options including: Bioinformatics and
Genomics, Cell and Developmental Biology, Chemical Biology,
Ecology, Genetics, Immunology and Infectious Diseases,
Molecular Medicine, Molecular Toxicology, Neuroscience,
Physiology, and Plant Biology. These programs involve over 300
faculty and 315 graduate students. Programs are located at both
the University Park and Hershey College of Medicine campuses
in central Pennsylvania.
Students receive training and experience as college teachers,
rotations through several labs, and dual faculty mentorships as
well as receiving full funding for their education.
The College of Mathematical and Physical Sciences is one of the
five Colleges of the Arts and Sciences at Ohio State. The College
includes the departments of Astronomy, Chemistry, Mathematics,
Physics and Statistics, and the School of Earth Sciences as
well as seven affiliated centers. More than 230 distinguished
faculty members explore the fundamental sciences, in diverse
areas ranging from string theory to cosmology, from polar
climate trends to biostatistics. The College serves thousands
of undergraduate students and hundreds of graduate students
each year, training them to become the scientific leaders of
tomorrow.
Students at all levels receive one of the most innovative
scientific training programs available through strongly integrated
Program Book
51
Exhibitors
The University of Alabama
712 Capstone Drive
Box 870268
Tuscaloosa, AL 35487-0268
Contact: Vo Thanh Liem
[email protected]
Table #30
The University of Alabama is a major, comprehensive, studentcentered research university founded in 1831 as Alabama’s first
public college. Dedicated to excellence in teaching, research and
service, we provide a creative, nurturing campus environment
where our students can become the best individuals possible …
learn from the best and brightest faculty … and make a positive
difference in the community, the state and the world.
UGA- The College of Veterinary Medicine
The University of Georgia
501 DW Brooks Dr
Room 220
Athens, GA 30602
Contact: Tracia Cloud, M.S.
Coordinator for Diversity and International Affairs
College of Veterinary Medicine
[email protected]
Table #36
Educating tomorrow’s Veterinarians!
Founded in 1946, the University of Georgia College of Veterinary
Medicine is located in Athens, GA., about 60 miles northeast
of downtown Atlanta. The College currently admits 96 students
each fall and has graduated over 4,000 students since its
founding. Our mission is to educate tomorrow’s veterinarians,
serve the needs of the public, and provide high quality animal
care. Today’s veterinarians are in a unique position of being the
only doctors educated to protect the health of both animals and
people. They are not only educated to meet the health needs
of every species of animal but they play an important role in
environmental protection, food safety, and public health.
University of California San Diego & Scripps Institution of
Oceanography
CMBC (MC0202) Scripps Institution of Oceanography
University of California San Diego
9500 Gilman Drive
La Jolla, CA 92093-0202
Contact: Russell Chapman
[email protected]
Table #66
Nestled by the Pacific Ocean, UC San Diego attracts those
seeking a next-generation approach to education and research.
It is one of the nation’s premier institutions for higher education
and research. Its interdisciplinary ethos and tradition of
innovation and risk-taking underlie its research strength and
ability to recruit top scholars and students. Scripps Institution
of Oceanography at UCSD is one of the oldest, largest, and most
important centers for global science research, education, and
public service in the world. Research at Scripps encompasses
physical, chemical, biological, geological, geophysical, and
atmospheric studies of the earth as a system; and includes
exciting undergraduate research opportunities.
University of California San Francisco
1875 Owens street, CC310
San Francisco, CA 94143-0523
http://www.ucsf.edu/
Contact: Donald Woodson
[email protected]
Table #11
University of California, San Francisco is a leading university
dedicated to defining health worldwide through advanced
biomedical research, graduate-level education in the life
sciences and health professions, and excellence in patient care.
The roots of this public health sciences university, dedicated to
saving lives and improving health, can be traced in San Francisco
to the 1864 establishment of the Toland Medical College, which
nine years later would become the Medical Department of a then
fledgling University of California across the bay.
The University’s foundation was laid when leaders foresaw the
campus as more than a medical school, and they decided to
combine a few scattered colleges — including the colleges of
52
Program Book
Exhibitors
pharmacy and dentistry — on land donated by San Francisco
Mayor Adolph Sutro just above Golden Gate Park. In 1907, the
campus built its own hospital and a clinics building that would
serve the city and eventually people from all over the world. The
original nucleus of schools grew to include the School of Nursing
in 1939 and a Graduate Division in 1961.
University of California, Davis
One Shields Ave
250 Mark Hall
Office of Graduate Studies
Davis, CA 95616
http://www.ucdavis.edu/index.html
Contact: Gloria Myers
[email protected]
Table #22
With more than 80 graduate programs in both the arts and
sciences, UC Davis is the most academically diverse campus
in the UC system. Many programs offer study through
interdisciplinary graduate groups, giving students the
opportunity to broaden their intellectual experiences. Attracted
by the reputations of award-winning faculty, our students are
highly qualified and come from every point on the globe. This mix
of cultures and ideas makes Davis an exciting place to live, study
and work.
University of Cincinnati College of Medicine
231 Albert Sabin Way
PO Box 6700548
Medical Science Bldg, Suite 2005
Cincinnati, OH 45267-0548
http://www.med.uc.edu/about/historyhighlights.cfm
Contact: Laura Hildreth
[email protected]
Table #20
to medicine and to the medical sciences. With an international
renowned faculty of 850 members, it would be impossible to list
all of our accomplishments here. Please visit http://www.med.
uc.edu/about/historyhighlights.cfm
University of Colorado at Boulder
Regent Administrative Center
UCB 26, Room 1B53C
Boulder, Colorado 80309
Contact: Deborah Irwin
[email protected]
Table #2
The Graduate School at the University of Colorado at Boulder
offers strong foundational programs, outstanding teaching
and research opportunities, and interdisciplinary connections
that produce highly marketable graduate degrees. Specifically,
the Graduate School offers 51 doctoral and 62 master’s degree
programs.
At the premier research institution in the Rocky Mountain region,
you’ll find strong foundational programs and interdisciplinary
work that lead to highly valued degrees in a wide range of
disciplines:
• Arts and Sciences
• Business
• Education
• Engineering
• Journalism
• Law
• Music
With quality programs across all of the major academic
disciplines, a CU-Boulder graduate education offers students the
opportunity to expand their educational interests into a variety
of practical, real-world possibilities and advance their personal
and career goals.
The College of Medicine was established in 1819 and is
considered the oldest medical college west of the Allegheny
Mountains. As a medical school, we are known for our strong
educational program, student services, research, and clinical
facilities. We have an exceptional list of alumni and current
and past faculty who have made considerable contributions
Program Book
53
Exhibitors
University of Connecticut
University of Houston
438 Whitney Road Extension
Graduate School
Storrs, CT 06269-1006
214 Science & Research
Bldg 1
Houston, TX 772004-5008
http://www.uh.edu/
Contact: Ruth Washington
[email protected]
Contact: Christina Chan
[email protected]
Table #47
Table #48
The University of Connecticut is a vibrant learning and research
community providing academic programs designed to challenge
an array of intellectual interests. We offer doctoral programs that
are advanced, focused, scholarly, and dedicated to your holistic
development as a researcher and educator. With more than 80
graduate programs, we help each individual reach personal postsecondary education goals.
Every year, students come from all over the world to pursue
graduate and undergraduate programs at the University of
Houston. What do they find when they get here?
The STEM fields offer many avenues to successful careers.
Professionals in the STEM fields prosper as leaders at the
forefront of scientific discovery and inquiry. All students
pursuing advanced study in STEM fields find a welcoming
community at the University of Connecticut.
Our students find more than 100 undergraduate majors and
minors and nearly 200 graduate degree programs, including
some that rank among the nation’s best. They find the
opportunity to conduct world-class research with award-winning
faculty, like Ioannis A. Kakadiaris, who’s working toward early
detection of heart attack risk, and Kishore Mohanty, developer
of a technology that brings “dead” oil wells back to life. Discover
more of what you’ll find at UH, visit http://www.uh.edu/.
University of Delaware
University of Illinois
210 Dupont Hall
Newark, DE 19716
http://www.udel.edu/
Graduate College
204 Coble Hall
801 S. Wright Street
Champaign, Illinois
Contact: Robert Opila
[email protected]
Table #62
The University of Delaware has a great tradition of excellence,
from our founding as a small private academy in 1743, to the
research-intensive, technologically advanced institution of today.
Our alumni tell our story of achievement, from our first class,
which included three signers of the Declaration of Independence
and one signer of the U.S. Constitution, to the more than 135,000
living Blue Hens who are making vital contributions to the world-in science, business, education, the arts, policy, health care, the
environment, and many other areas.
54
Program Book
Contact: Ave Maria Alvarado
[email protected]
Table #17
The University of Illinois is the state’s best and most
comprehensive public university. The three distinct campuses in
Chicago, Springfield and Urbana-Champaign serve the people
of Illinois through a shared commitment to our missions of
excellence in teaching, research, public service and economic
development. The Global Campus expands educational
opportunities for residents of the state of Illinois and beyond.
The University of Illinois is a world leader in research and
discovery. Our internationally renowned faculty win more
federal research dollars than all other public Illinois universities
and colleges combined, resulting in priceless new knowledge
and life-changing breakthroughs in medicine, agriculture and
technology. Visit - http://www.uillinois.edu/
Exhibitors
University of Illinois at Chicago
University of Minnesota
601 S. Morgan St.
603 University Hall
Chicago, IL 60607
http://www.uic.edu/index.html/
Biomedical Sciences Graduate Programs
G-254 Mayo, MMC293
420 Delaware Street
Minneapolis, MN 055455
http://www.orbs.umn.edu/
Contact: Francisco Pina
[email protected]
Contact: Jon Gottesman
[email protected]
Table #42
Table #6
UIC is located in the heart of Chicago, and reflects the full variety
and vitality of this world class city. UIC has one of the most
diverse campuses in the nation, and the most diverse student
body of any University in the Midwest. Students come from 44
states, 101 countries, and almost every ethnic group in the world.
Our faculty, staff and graduate students are committed to
excellence in Teaching, Research, and Service to our Community
and Profession. To find out more about UIC, visit http://www.
uic.edu/index.html/
University of Massachusetts Amherst
Northeast Alliance
Rm. 524 Goodell Building
140 Hicks Way
Amherst, MA 01003
Contact: Michael Alderman
[email protected]
Table #45
The Northeast Alliance for Graduate Education and the
Professoriate (NEAGEP) at the University of Massachusetts
Amherst (www.NEAGEP.org). The National Science Foundation
(NSF) sponsored Northeast Alliance for Graduate Education and
the Professoriate (NEAGEP) at the University of Massachusett
Amherst supports a number of activities designed to address
the shortage of U.S. students, particularly underrepresented
minority students, who receive Ph.D.s in the science, technology,
engineering and mathematics (STEM) and become professors.
Students accepted into STEM programs at The University of
Massachusetts Amherst are offered financial support packages
and supportive mentoring to ensure that their graduate school
experiences are successful as well as rewarding. Students in this
program are encouraged to consider entering the professoriate
once they have received their Ph.D.
The University of Minnesota is one of the most comprehensive
public universities in the United States and ranks among the
most prestigious. It is both the state land-grant university,
with a strong tradition of education and public service, and the
state’s primary research university, with faculty of national and
international reputation.
To find out more about the Biomedical Sciences Graduate
Programs, visit http://www.orbs.umn.edu/ and explore
the exciting opportunities for PhD training in the biomedical
sciences, investigate our outstanding multidisciplinary
programs, and learn how you can work with some of the best
graduate faculty in the world.
University of Minnesota Combined MD/PhD Training
Program
MMC293 B690 Mayo Building
420 Delaware Street SE
Minneapolis, MN 55455
Contact: Susan Shurson
[email protected]
Table #9
The overarching goal of the University of Minnesota’s Combined
MD/PhD Program is to attract and challenge the most gifted
students to obtain exceptional training in medicine and a
research area of their choice, preparing them for leadership roles
in academic medicine. We have been competitively funded as a
NIH Medical Scientist Training Program (MSTP) since 1988, and
reside in the heart of the University of Minnesota’s Twin Cities
campus. The University of Minnesota ranks among the top 10
public research universities in both NIH funding and federal
funding for science and engineering.
Program Book
55
Exhibitors
University of New Mexico
Center for High Tech Materials
MSC04 2710
1313 Goddard SE
Albuquerque, NM 87106-4343
Contact: Linda Bugge
[email protected]
Table #12
The University of New Mexico is the state’s flagship research
institution. UNM research injects millions of dollars into New
Mexico’s economy, funds new advancements in healthcare,
and augments teaching – giving students valuable hands-on
training in state-of-the art laboratories. Offering more than
210 degree and certificate programs, UNM has 94 bachelor’s
degrees, 74 master’s degrees and 40 doctoral programs. The
Health Sciences Center is the state’s largest integrated health
care treatment, research and education organization. For more
information visit http://www.unm.edu/
University of North Carolina at Chapel Hill
130 Mason Farm Road
University of North Carolina
CB 7108
Chapel Hill, NC 25799
http://www.unc.edu/
our graduate students, with more than 10 percent coming from
underrepresented groups: African-American, Hispanic, and
American Indian. Another 14 percent are international students.
To find out more visit http://www.unc.edu/.
University of Pennsylvania
Nano/Bio Interface Center
3231 Walnut Street
Phialadelphia, Pennsylvania 19104
http://www.nanotech.upenn.edu/
Contact: James McGonigle
[email protected]
Table #44
The Nano/Bio Interface Center at the University of Pennsylvania
in Philadelphia offers a variety of opportunities for
undergraduate student research as well as graduate studies
in all STEM areas. The Undergraduate Research at the Nano/
Bio Interface program provides research experience at the
cutting edge of the nanotechnology and nanoscale science.
This 10-week program offers a $4,000 stipend. Likewise, there
are numerous opportunities for graduate studies leading to
advanced degrees in engineering, medicine, and arts and
sciences. One example is the Drexel-Penn IGERT Fellowship in
Nanotechnology. This interdisciplinary Ph.D. program offers the
resources of two universities on essentially one campus.
Contact: Pat Phelps
[email protected]
Table #54
The University of North Carolina at Chapel Hill is the nation’s
oldest state university, with a rich history of more than two
centuries. This virtual museum retells that history much as a
physical museum might do, with texts and images arranged in
a series of roughly chronological exhibits. Along the way, there
is much for the university’s friends to take pride in, and other
truths that are now painful to remember. The virtual museum is
Carolina’s open eye to its own past.
The Graduate School University of North Carolina at Chapel
Hill encompasses 89 graduate programs offering 66 doctoral
and 102 master’s degrees. Graduate students and professional
students make up about 40 percent of Carolina’s total number
of enrolled students. There is a great deal of diversity among
56
Program Book
University of Pittsburgh
Department of Rehabilitation
Science and Technology
4020 Forbes Tower
Pittsburgh, PA 16260
412-383-6556
Contact: Lauren O’Brien
[email protected]
Table #21
The ASPIRE (American Student Placements in Rehabilitation
Engineering) and QoLT (Quality of Life Technology) REU Programs
are a collaboration between the University of Pittsburgh and
Carnegie Mellon University.
They are both ten week programs running May 26th through
July 31st, 2009. The research experience is supplemented
Exhibitors
by workshops, lecture series, and field trips. A stipend is
provided, along with financial assistance for travel, and housing
is available. Additional information along with a program
application is available through the ASPIRE/QoLT REU WebPages
at http://www.herlpitt.org/education.htm. The program recruits
students from the following backgrounds: engineering, computer
science, rehabilitation science, and other physical sciences.
Information on our graduate programs will also be available.
University of Texas Southwestern Medical Center at
Dallas
Division of Basic Science Graduate Program/Medical Scientist
Training Program
5323 Harry Hines Blvd
Dallas, Texas 75390-9004
Contact: Nancy Street
[email protected]
Table #35
University of South Florida
4202 E. Fowler Ave ENB 118
Tampa, FL 33620
http://www.grad.usf.edu/newsite/catalog/main.asp
Contact: Bernard Batson
[email protected]
Table #10
The University of South Florida is one of the nation’s
top 63 public research universities as designated by the
Carnegie Foundation for the Advancement of Teaching. USF
offers graduate and doctoral programs in the Colleges of
Engineering, Arts and Sciences, Medicine, and Public Health.
Signature research strengths include Interdisciplinary Cancer
Biology, Nanotechnology and Nanomedicine, Environmental
biotechnology, Alzheimer’s disease, Drug Discovery, and Marine
Science. Fellowships sponsored by NSF, the GEM Consortium,
the Alfred P. Sloan Foundation, McKnight Doctoral Program,
and USF Graduate School are available for students from
underrepresented backgrounds. Various summer research
opportunities are available for interested undergraduates.
Division of Basic Science Graduate Program/Medical Scientist
Training Program, UT Southwestern provides opportunities to
prepare for careers in the biomedical sciences through study
and research leading to the Ph.D. degree through the Division of
Basic Science and the M.D./Ph.D. degree through the Medical
Scientist Training Program. Over 260 faculty offer training in
genomics, cancer biology, computational biology, developmental
biology, molecular genetics, structural biology, cell biology,
chemical biology, systems biology, pharmacology, microbiology,
neurosciences and immunology. Our NIH-sponsored MSTP
contains a highly integrated curriculum, premiere teaching
hospitals and renowned clinical faculty. The essence of
education at UT Southwestern is an exciting research experience
in an active, productive and critical scientific environment.
University of Virginia
P.O.Box 400882
Thornton Hall A123
351 McCormick Road
Charlottesville, Virginia 22904-4882
www.virginia.edu/vprgs/gradstudies
Contact: Cheryl Apprey
[email protected]
Table #16
The University of Virginia (U.Va.) is one of the top public
universities in the nation, ranked 22nd overall by U.S. News and
World Report and with ten top-25 departments for graduate
study. U.Va. offers graduate degrees in nine schools: Graduate
Schools of Arts and Sciences Graduate School of Architecture;
Darden Graduate School of Business Administration; Graduate
School of Commerce; Curry Graduate School of Education School
of Graduate Engineering and Applied Science; School of Law;
School of Medicine; School of Graduate Nursing; and the School
Program Book
57
Exhibitors
of Continuing and Professional Studies. Information on these
programs will be available during this conference, please visit
Table #16.
academic resources at UW-Madison offer graduate students a
wide selection of supporting course work and interdisciplinary
opportunities.
University of Washington
UW Genome Sciences
Interdisciplinary PhD Program in Molecular and Cellular Biology
Molecular & Cellular Biology Program
Box 357275
Seattle, WA 98915-7275
Genome Sciences Ph.D. Program
University of Washington
Box 355065
Seattle, Washington 98195-5065
Contact: Terry Duffey
[email protected]
Contact: Brian Giebel
[email protected]
Table #18
Table #27
Recognizing the need for highly trained scientists conversant
across disciplines, the University of Washington (UW), the Fred
Hutchinson Cancer Research Center (FHCRC), and the Institute
for Systems Biology (ISB) have collaborated to create an
interdisciplinary research program, the Molecular and Cellular
Biology Graduate Program (MCB).
Our goal is to address leading edge questions in biology and
medicine by developing and applying genetic, genomic and
computational approaches that take advantage of genomic
information now available for humans, model organisms and a
host of other species. Our faculty study a broad range of topics,
including the genetics of E. coli, yeast, C. elegans, Drosophila,
and mouse; human and medical genetics; mathematical,
statistical and computer methods for analyzing genomes,
and theoretical and evolutionary genetics; and genome-wide
studies by such approaches as sequencing, transcriptional and
translational analysis, polymorphism detection and identification
of protein interactions.
For more than 15 years, MCB has combined the strengths of the
FHCRC together with ten UW biomedical research departments-from Biochemistry to Pharmacology--to foster an innovative
and flexible, education-training program for graduate students
interested in biomedical problems that cross disciplinary
boundaries. Recently, ISB has joined this collaborative effort.
University of WI-Madison
1710 University Avenue Room 217
Madison, Wisconsin 53726
http://www.wisc.edu/
Contact: Carmela Diosana
[email protected]
Washington St. (0477)
Blacksburg, VA 24061
https://www.vbi.vt.edu/
Contact: Bryan Lewis
[email protected]
Table #64
Table #7
UW-Madison is a world-class university with many opportunities
for graduate study. 146 programs offer master’s degrees and 110
programs offer doctorate degrees. More than 30,770 doctorates
have been awarded by UW-Madison.
Excellence in research is a top priority here. UW-Madison ranks
as one of the most prolific research universities in the world,
consistently ranking in the top 3 among American universities
for research expenditures. The tremendous breadth of
58
Virginia Bioinformatics Institute
Program Book
Virginia Bioinformatics Institute (VBI) is a research institute
dedicated to the study of the biological sciences. The research
platform of VBI focuses on the “disease triangle” of hostpathogen-environment interactions.
By using bioinformatics, which combines transdisciplinary
approaches to information technology and biology, researchers
at VBI interpret and apply vast amounts of biological data
generated from basic research to some of today’s key challenges
in the biomedical, environmental and agricultural sciences.
Exhibitors
Work at VBI involves collaboration in diverse disciplines such
as mathematics, computer science, biology, plant pathology,
biochemistry, systems biology, statistics, economics and
synthetic biology.
The institute develops genomic, proteomic and bioinformatic
tools that can be applied to the study of infectious diseases
as well as the discovery of new vaccine, drug and diagnostic
targets.
Program Book
59
5
2
XPSMESFOPXOFEOBUJPOBMMBCPSBUPSJFT
NBKPSSFTFBSDIVOJWFSTJUJFT
6
TDJFODFBOEUFDIOPMPHZNVTFVNT
)PNFUP4DJFODF$IJDBHP-JGFµTB-BCUIFXPSMEµTMBSHFTUTDJFODFDFMFCSBUJPO
)PTUUPBO"""4HBUIFSJOHPGTDJFOUJTUTBOEFOHJOFFSTGSPN
56
DPVOUSJFT
"""4"OOVBM.FFUJOHJO$IJDBHP
°'FCSVBSZ
TBWFUIFEBUF
(PUPXXXBBBTPSHNFFUJOHT
UPTJHOVQGPSVQEBUFTUISPVHIPVUUIFZFBS
Index of Names
A
Abe, Oluwamuyiwa A30
Abu-Safe, Husam A24
Adams, Jerri A30
Adams, Paul D. A9, A19
Addae, Sarah A54
Addy, Nii A. A34
Adebambo, Diana A3
Adomfeh, Emmanuel A30 , A33
Agada, Ruth A14
Agbeve, Kossi A. A54
Agu, Kelechi A15
Agwaramgbo, Lovell A51
Akah, Kelly A30
Aker, Winfred A6
Alfred, Simon A6
Ali, Radman A13
Aller, Josephine A31
Alm, Eric A35
Al-Raoush, Riyadh A27
Alvarez, Edith A7, A31
Ambrose, Jeffery A16
Amponsah, Osei A18
Anderson, Brenda J. A67
Anderson, Richard A2
Anjorin, Chezaray A8, A19
Anoruo, Florence A5
Anthony, Joya A2
Antoine, Alana A2
Anyanwutaku, Chidi A54
Apalanyga, Vitus A59
Ariyo, Oluwole A5
Armstrong, Monte A2
Artis, Candice A3
Ashcraft, Kathleen A47
Ashok, Jain A41
Askew, Kshawna A55
Atchade, Olaniran A19, A39
Atkinson, Brittanie A3
Atwood, B. A3
Audia, Sandra 17
Austin-Watson, Clytrice A53
Avant, Keshia N. A31
Avilés, Alejandro A31
Awan, Ijaz A. A16
Awasthi, V. A55
Ayalew, C. Memar A6
Ayika, Chiedozie J. A31
Ayorinde, Michelle A65
B
Baccus, Shekelia A3
Bagasra, Omar A5
Baah, David A29
Bailey, Marshall A32
Baird, Sarah 22, 23, 25
Baker, Trevil A48
Baltimore, Kierra A14
Bamba, Mema A48
Bañez, Lionel A11
Banks, Sydika A76
Barden, Ghea A55
Barker, Donald A77
Bartee, Rena A55
Bayakly, N. A. A2
Beach, Courtney A14
Beauchamp, David A53
Beecham, Rachel A4, A32
Been, Shayvonne A17
Begonia, Gregorio A11, A12
Begonia, Maria A11, A12
Behar, Donna 17
Belo, Zuakernah A4
Benbrook, Doris A39
Benson, S. D. A8
Bernasek, Steven L. A12
Berry, Darian A69
Besta, Carlo A76
Beyene, Desta A12
Blackwell, Tameshia A17
Bland, Colleen A16
Bland, Constance G. 19, A72
Bland, Hilliary A4
Blaser, Brianna 22, 25
Blaylock, Morris A36
Bliska, James A30
Blythe, Karole A19
Bolton, Asha A55
Bonneau, Robert A47
Bonney, Isis A32
Booker, Tona A68
Boucek, DonnaRae A61
Boueiz, Adel A4
Boumedine, Marc A48, A50
Bowden, Harry Jr. A4
Bowens, Tabitha A4
Bozell, Joseph J. A18, A51
Brackett, Neville A20
Bradshaw, Heather A11
Braggs, Kirk A55
Branch, Andrea A32
Branton, Shantay A56
Brimmer, Nicole A41
Brooks, Sean A17
Broughton, Stephen T. A20
Brown, Carlton E. 3, 10, 20, 25
Brown, Eric Va’Shon A2
Brown, Ken A57
Brown, LaVonda A26
Brown, Lynette A4
Brown, Travis M. A76
Brumfield, Leethaniel III A67
Buckles, Eric A22
Buckman, Jenna A30
Buell, Robin A52
Bunch, Tyra A8
Bupe, Faith A5
Burris, Jason A18
Butcher, Raymond A65
Bwanbok, David K. A21
Byrd, Ravin A32
C
Caldwell, Jennifer A20
Caldwell, Kenta A32
Calinger, Betty 17
Campbell, Gwendolyn A15, A49
Campbell, Yohance A67
Carter, Brandon A18
Carter, Carol A36
Carter, Charisse A17
Carter, Conner A33
Casey, Kasha A57
Cassanova, Nikolai Gauntlet A30, A33
Cave, Karissa A33
Chakrabarti, Ajoy G. A43
Chan, K. C. A20
Chaney, Rufus L. A37
Chang, Janet A45
Chang, Zheng A26, A70
Charles, Maurissa A5
Chen, Jeffrey A36
Chen, Min-Huei A36
Program Book
61
Index of Names
Chen, Y. A47
Cheng, Stephen A76
Chetty, Chellu S. 19, A72
Cho, Hyun Jung A2
Chouikha, Mohamed A68
Christian, Keisha A57
Christian, Omar A23, A57
Chukwebeze, Onah A42
Clark, Curtis 19, A72
Clark, Vernessa A66
Clifford, Kavan T. A76
Cobey, Chanel A33
Cohly, Hari H. P. A43
Collier, John A18
Collingwood, Michael A29
Collins, Essie A56
Collins, Jesse A20
Collins, Michelle A67
Collins, Shamara A68
Cook, C. A47
Cook, Sean A6
Cooper, Gabrielle A. A43
Copeland, William C. A25
Corbett, Shermett A7
Corke, Tanicia A. A65
Cousin, Carolyn A6, A7, A12, A19, A31, A39
Craig, Sean A30, A52
Crawford, Christina M. A66
Crawley, Leon A68
Cullen, J. A47
Cunningham, Brian A56
Cutler, Sean A6
Cutter, Vernell V.P. A18
D
Da Cunha, Maria A5
Dal Cin, Valeriano A52
Dale, Zuri A56
Daniels, DeAnna A5
Danjaji, Musa A29
Darko, Samuel A4, A10
Dash, Tyrone A34
Davis, Amber N. A51
Davis, Errol 25
Davis, Gregory K. A25
Davis, Moses A57
Dawkins, Ariel A34
62
Program Book
De Maio, Antonio A76
Dean, Amanda A68
DeLugo, Al’Lima A57
Demley, Travis A51
Dennings, Jessica A40
De Rosa, C. A. A47
Dhir, Sarwan K. A30, A38, A40, A42, A52, A53
Dhir, Seema A6, A37, A39, A51, A52
Diaz, Ramona A68
Dickens, Corey A68
Dickson, Chilea A42
Dillard, James A68
Dinesdurage, Harshini A6, A19, A39
Dixon, Freddie A6, A7, A12, A31, A39, A73, 19
Dobi, Albert A10
Donev, Luke A63
Doram, Tonya A68, A69
Dorsey, Andre’a J. A57
Douglas, Andre A20
Dowuona, Emmanuel A34
Doyle, Byron W A6
Drummond, Robert A76
Duffy, Elisabeth A53
Dusenbury, Renata A36
E
Eastman, Caroline A24
Edoh, Kossi A58
Edwards, Teresa D. 17, 26
Ehrlich, Lorna A36
Ekanem, Emmanuel A35
Ekpo, Felicia A26, A66
Ekunwe, Stephen I.N 19, A34, A73
Eng, George A19, A39, A59
Epps, Joy A26
Eribo, Brodrick A35
Escher, Alan A36
Eskridge, Freddie A35
Esquivel, Lizbeth A20
Evans, Jonathan A26
F
Fairman, Kiara A57
Fakayode, Sayo O. A20, A21, A23
Fenwick, Cursilla 17
Fergusson, Ferlicia A65
Finch, Stephen J. A56
Fiteh, Yelekal A47
Fleming, Lorraine N. 19, 26
Floyd-Smith, Tamara A29
Folarin, Lukmon A57
Fowler, Preston A6
Franks, M.A. A24
Franks, Steven A53
Frazier, Kelvin M. A21
Frazier, Monica A22
Freedland, Stephen J. A11
Freeman, Kimberley E. 19, 27
Freeman, Lerond A50
Furmanchuk, Al’ona A22
Furusato, B. A47
G
Gahr, Megan A11
Gallman, Jamin A56
Ganea, Gabriela M. A23
Gardiner, Shandera A57
Garner, Marcina A65
Garret, Jared A26
Gaskins, CheToya A. A21
Gates, Keith A66
Gavrilenko, V.I. A24
Geoffrey, Mike A52
George, Alex A21
George, Yolanda S. 3, 9, 17, 19, 20, 27, 28
Gillens, April A35
Gitilado, Anthony A67
Glass, Jonathan A76
Gloster, Clay A29
Gold, Scott A40
Goloubev A70
Goodrich-Blair, Heidi A10
Grady, Cynthia D. A6
Grande-Allen, Jane A69
Granger, Trinity D. A58
Grant, Kristina A35
Gray, Jesseca M. A36
Green, Celina A68
Green, Chanelle A49
Green, Erica A36
Green, Jibada A69
Green, Timothy A8, A16, A44
Greene, Jasmine T. A57
Greer-Williams, Nancy 17, 28
Gregory, Patrice B. A77
Grier, Karissa A48
Griffin, Felicia A58
Grover, Veenita A9
Index of Names
Guilford, Kristen A7
Gunn, Karyn-scissum A39
Gunter, Winston A22
H
Hagen, John W. A25
Hailemariam, Sarem A17, A36
Hale, James A49
Hall, Jamaz A15, A49
Hall-Garrison, Anais A36
Hamada, Yahia A57, A58
Hamidi Vadeghani, Saba A58
Hammad, Samar A7
Hammond, Dianne A9
Hanif Talukder, Mohammed A23
Harden, John A58
Hargrove, S. Keith. A68, A69
Harp, Jill A44
Harris, J.K. A66
Harris, Kevin A58
Harris, Marcus A58
Hassan, Tarig A. A59
Hassoun, Paul A4
Havener, Charles A64
Hawkins, Adriana A51
Haynes, John K. 3, 11, 20, 28, 29
Heller, Demarus A7
Helm, Antoinette A44
Henderson, Samuel A. A69
Henry, Victoria A. A58
Hernandez-Rodrigues, Yainitza A38
High, Gabrielle A7
Hijji, Yousuf A46, A54, A55, A64
Hines, Tomia A37
Hinmon, Susan A69
Hodges, Amber B. A32, A65
Hoerner, Jana A59
Hohmann, Christine F. A32, A65
Höke, Ahmet A76
Holdener, Bernadette A45
Holland, Timothy A50
Hollomon, Mario A14
Holmes, S. A2
Horne, Reshard A37
Hosten, Charles A65
Howard, Ayanna 20, 29, A15, A49
Howard, T. Janea A37
Howard, Tameka A37
Howard, Tomul A59
Hu, Wanjun A14
Hu, Ying A14
Hughes, Gerunda A53
Hunter, Tena A27
Hurst, Amirah A59
Hurt, Conrad Jr. A59
Hussaini, Isa M. A31
Hwang, Huey-Min A6
Hwang, Ran-Der A47
Hyman, Linda A4
I
Iannucci, Douglas A20
Innis, Tasha R. 23, 29
Islamovic, Emir A40
Isokpehi, Raphael D. A43
J
Jackson, Caesar R. 17, 19, 30
Jackson, Kimberly A25
Jackson, Mitchell A49
Jain, Ashok A4, A8, A41
Jakli, Antal A58
Jeelani, Shaik A59
Jemilohun, Phillip A5
Jewell, Jessica A38
Jha, Manoj K. A70
Jimenez, Maria A66
Jingwi, Emmanuel A30
Jiru, Mintesinot A17
Johnson, Dominique A38
Johnson, Jamiece A60
Johnson, Maude A27
Johnson, Saphronia A21
Johnson, Tamara Lewis 21, 30
Jones, Cecil L. A22, A55, A59
Jones, Chakeeta A22
Jones, Gabrielle A52
Jones, Joyelle A77
Jones, Leandra A38
Jordan, Francis A60
Jordan, Khalifa A22
Joseph, Kelsey A51
Josyula, Darsana A49
K
Kaeli, David A49
Kalyie, Heran A22
Kamal, Uruj A66
Kambhampati, Murty S. A16, A44
Kareem, Mutahammis A57
Karki, Ichhuk A60
Kashinhi, Rose A11
Kattel, B. A69
Katz, Brittany A22
Keels, Jonecia A15
Kemp, Derrick 17
Kennedy, Alvin A54, A55, A62, A63
Keough, Colleen A16
Kim, Diane A67
King, Shawn A23
Klee, Harry J. A52, A53
Klein, Robyn A46
Knecht, David A47
Knight, Stephenna A6, A7, A31
Knighten, Brionna A7
Kohutek, Zachary A. A31
Kondo, Norman A22
Kramer, Corrie 17
Krencik, Robert A39
Kriangkripipat, Thanyanuch A38
Kumar, Deepak A8, A10, A14, A19, A22, A31,
A47, A48
Kundu, Nabanita A18
Kunkler, Jessica 17
Kutchan, Toni A11
Kwon, Dongwon A26
L
LaBarre, Susan A32
Labbe, Nicole A18, A51
Lakeou, Samuel A28
Latesky, Stanley L A58
Lathan, Tiffany A26
Lawrence, Lashawndra A35
Lawson, Patrick A. A23
Leadbeater, Nicholas E. A21
Ledec, Cathy 17
Lee, Christine A17
Lee, Ken S. A65
Lee, Shernita A23
Lee, Xugang A71
Leggett-Robinson, Pamela M. A22, A59, A63
Lehiy, Christopher A5
Lempinen, Edward 17
Leszczynski, Jerzy A22
Levin A3
Lewis, Derren A15, A49
Program Book
63
Index of Names
Lewis, James A53
Li, Alice A36
Lin, Edward A33
Littler-Darku, Brandon A27
Liu, Chaobin A56
Liu, Huimin A9
Lloyd, Marcus A15
Lockhart, Phylicia A50
Loftis, Charles A60
Loggins, Stephanie A23
LuAllen, Jasmine A65
Ludwick, Adriane G. 17, 30, A25
Lumetta, Greg J A58
Lundback, Steven A52
Lupton, William A51
Lyons, E. A2
M
Mack, Naja A15
Mackie, K. A3
Magabo, Amanda A69
Majumdar, Sabita A45
Malcom, Shirley M. 3, 9, 17, 31
Maldonado, Carmen A8
Malone, Vanessa A23
Manoharan, Vinothan N. A20
Mansell, Douglas A38
Marella, Heather A42
Marrett, Cora B. 3, 7, 17, 31, 32
Marriott, Karla-Sue A55, A65
Marrongelle, Karen 19, 31
Martinez, Olga A5
Mason, Kynesha A68
Materna, Arne A35
Mathew, Stephen O. A46
Mathew, Porunelloor A. A46
Mattix, Larry 17, 32
Maye, Anthony A56
Mbata, Chinakasiobi A39
McClain, Aliecia R. 19, A73
Mccollum, Ashley A39
McCrary, J.A.P. A33
McCray, Marla D. A8
McDaniel, Sheree A39
McEuen, Paul A63
McGihon, Marty 17
McInnis Nave, Felecia 19, 33
McKayle, Camille A. 17, 32
McKenna, Mary A34, A37, A38, A45, A47
64
Program Book
McKinney, Carla A24
McLeod, D. G. A47
McLean, Charlee A61
McMullen, Carlton A27
McNair, Andre A38
McRae, Jacqueline M. A8
Mead, Patricia A28
Meadows, Michael A40
Medina, Gisselle A36
Mekonnen, Selamawit A7, A19, A31, A39
Melcher, Ulrich A9
Melli, Giorgia A76
Meriwether, Samill A45
Mezhevaya, Katerina A31
Middendorf, George III A46
Mili, Fatma A37
Miller, Darryl A33
Miller, Jazmine A49
Miller, Jeremiah S. A67
Miller, Miquell A7
Miller, Nana Gletsu A33
Miller, Sakinah A40
Millett, Catherine 19, 33
Mills, Brandon A24
Minchew, Doug A32
Mitchell, James A27
Mitchum, Stephanie E. A70
Moe, Miquel A70
Mohammed, Abdul K. A20, A23
Molokwu, Charles A40
Momany, Michelle A38
Momoh, James A53
Mondal, Ananda A15
Moore, R.B. A8
Moore, Stephanie A50
Morgan, Eric A61
Morgan, Shatina A61
Morsi, Rasha A27
Mortazavi, Mansour A20, A24
Mouraviev, Vladimir A13
Mullen, Lawrance A18
Mustafa, Mohamed A69
Myles, David E. A77
N
Naseem, Hameed A24
Neang, Somaly A8, A19, A22
Neilsen-Preiss, Sheila A4
Nelson, Jiman A61
Nelson, Matt A30, A52
Nelson, Tashiba A2
Nemeth, Donna A42, A43
Newby, Aaron A32
Newton, Benjamin S. A24
Newton, Sarah A24
Ngu-Schwemlein, Maria A55
Nichols, Shabree A40
Nobles, Brittney M. A40
Noginova, Natalia A18
Norwood, Donald 17
Ntoni, Jennifer A11, A12
Nyairo, Elijah A47
O
Odukoya, Babatunde A61
Oglesby, Lillian A52
Ognibene, Cherie A9
Okonkwo, Charles C. A52
Okonkwo, Zephyrinus A23, A58
Olayinka, Kafayat A28
Oliver, Christopher A67
Oliver, Lin A24
Omojola, Joe 17, 34
Oncel, Nuri A12
Oneugbu, Jonathan A65
Onuma, Eleanya A70
Osayi, Sylvester A48
Osondu, Joshua A41
Ossosanya, Esther A28
Owor, Robert A15
Oyaghire, Stanley A62
Oyeleye, Tolulola A43
P
Palmer, Amy A13
Park, J.K. A8
Passarelli, Lorena A5
Patacsil, Dorrelyn A8, A19, A48
Patel, Jigisha A46
Patlolla, Anita K. A7
Patterson, Edwinna C. A41
Patterson, Saskia C. A41
Patterson, Wanda A61
Patton, Nikita A9
Paul, David A60
Pearson, Marya A70
Pelz, Wolfgang A51
Peng, Sheng A70
Index of Names
Petersen, Sandra L. A32
Peterson, Charlotte A70
Petrovics, Gyorgy A14, A47
Petteway, Capricia A24
Petty, Jeff A30
Petulante, Nelson A56
Phairoh, Thongchai A67
Phaal, Sheriff A33
Pham, Anh A76
Phelps, Rosemary E. 21
Phillips, Donald A70
Pinard, Melissa A62
Pinkney, Meagan A27
Pleasant, Neti A59
Plumber, Jamail A9
Polascik, Thomas A13
Pollard, David A. A20, A21
Ponder, Charlie III A42
Popov, Branko N. A71
Powell, Demetrius A28
Powell, Nichole L. A63
Pradhan, Isha A62
Prajapati, Vinay V. A62
Pride, Carol A38, A45
Puljic, Marko A25
Purnell, Elissa T. A35, A41
Q
Qualls-Hampton, R.Y. A66
Queen, Ashley A17
R
Rabe, Mialy 19, A17, A42, A74
Rada, J. Summers A2
Raja, Muthukrishna A60
Raji, Abdul-Rahman A62
Rampulla, David A12
Rangari, Vijaya K. A59
Ravindranath, L A47
Reece, Michel A. A67
Reeves, Melissa A25, A29
Render, Alton A16
Rennecker, Darby A10
Reynolds, Carolyn D. A28
Rhodes, Twillow A9
Richardson, Marlon A50
Rincon-Mora, Gabriel A26
Rispoli, Fred A16
Rivera, Diego A49
Robinson, Davetta A10
Rodrigues, Chester M. III A28, A71
Rogers, Agene’ A65
Rogers, Mary Ellen A25
Rogers, Quintina A10
Roop, John Paul A50
Russell, Albert E. A63
S
Sabanayagam, Chandran A40
Sáenz, Fransisco A10, A48
Saint Fleur, Rose M.E. A56
Sakk, Eric A48
Salois, A.J. A24
Sanders, Jeremy A42
Sanders, Ruth A40
Scatliffe, Kiara A42
Schmink, Jason R. A21
Scott, Denecia A58
Scott, Jasmine A45
Scott, Maureen A3, A17, A41
Scott, Sean A43
Seabrooks, Deanna A. A43
Seed, Patrick A6
Sengupta, Bidisha A30
Sesterhenn, I.A. A47
Settar, Christine A65
Shah, Vishal A16
Sharp, Rahja’ M. A43
Shelton, L A2
Shen, Shyh-Chiang A68
Sheybani, Ehsan A67, A68
Shin, Hak-Chul A70
Shin, Jean H. 22
Shum, Anderson A26
Siggers, Steven A25
Simmons, Carolyn D. A57
Simmons, Nitrecus A11
Singh, Hari P. A37
Singh, K.P. A66
Singh, Shree R. A39
Singleton, Bernard A7, A18
Sirag, Abdulaziz A28
Sirotkin, Howard A66
Slater, Felix A11, A12
Slaughter, Gymama A67
Smith, Casey A71
Smith, Earl B. 19, A74
Smith, Erica A11
Smith, Keonia A63
Smith, LaDarren A67
Smith, Leona A44
Smith, Nyesha A16
Smith, Prestina A11
Song, Xeuqing A8, A19, A59
Soto, Masanao A40
Spell, Diana N. A25
Spivey, Gerard A29
Springer, Kerianne A30
Spyropoulos, Demetri D. A9
Srivastava, Meera A31
Srivastava, Sadanand 17, 34
Srivastava, Shiv A10, A14, A31, A47
St. Cyr, Ha’Wanna A44
Standifer, Milfred A6, A7, A12, A31
Steed, Crystal A16
Steele, Tiffany A44
Stemley, LaTonya A44
Steverson, Ebony A45
Stewart, C. Neal Jr. A18, A51
Stewart, Gernerique A63
Stith, James H. 23, 34, 35
Stokes, Derrick A61, A63
Strickland, Tiffany A63
Stringer, Halima A11, A12
Strout, Douglas L. A57, A64
Stuart, Johnasha A42
Su, Jinjh A26
Suiter, Marilyn J. 17, 19, 20, 23, 35
Sumpter, Ja’pel A12
Sun, Xin A27
Sundaresan, Alamelu A9
Swain, Nikunja A50
Swamidoss, Maya A18
Sykes, Delawrence A53
Sylvain, Iman A34, A37, A45
T
Tadesse, Solomon A62
Takemaru, Ken-Ichi A45
Talanova, Galina A56
Talley, Gerald A63
Tamboue, Helene A10, A21
Tameru, Ana M. A22, A23
Tang, Guoquing A54
Tate, Chantrice A45
Taylor, Christopher A42
Taylor, Johnny A53
Program Book
65
Index of Names
Tchounwou, Paul B. A13
Terry, Jessica A13
Thangapazham, Rajesh A10
Thapa, Dharendra A64
Thomas, DeMarcus A16
Thomas, Jessica A57, A64
Thomas, Lana A22
Thomas, Lindsey A27
Thomas, Michael A. A33
Thomas, Norbert A15
Thomas, Renard L. A56
Thomas, Sandra 17, 21, 23, 35
Thompson, Donald II A50
Tieman, Stanley A67
Toney, Deveine A64
Torosyan, Yelizaveta A31
Torres, Luisa A45
Tran, Anh Thu A8, A48
Tseng, Hubert A69
Turner, Kai Adia A26
Turner, Theresa A65
Tyson, Alan B. II A64
Tyson, Jessica A61
U
Ullah, Hemayet A18
Urrutia-Rojas, Ximena A66
V
Valdés, Alexandra A31
Vande Pol, Scott A41
Vandemark, Lisa A13
Vann, Kendra A13
Venkatachalam, Anusha A71
Vera, Michael A20
Verma, Mudit A8
Verner, Whitney A29
Viboud, Gloria A30, A33
Vice, Brandon A46
66
Program Book
W
Wada, Yahya A32
Waddell, India A16
Wagner, Daniel S. A32
Walker, Amber A56
Walker, Nicholas A13
Walker, Nicole M. A29
Walker, Randall A46
Walter, Lewins A18
Walters, Wilbur A61
Wang, Qiquan A62
Wang, Shuguang A63
Ward, Wanda E. 17
Warner, Grant M. A71
Warner, Isiah M. A21, A23
Washington, Clorissa A46
Washington, Jerrica A13
Washington, Michael A17
Watkins, Dereca T. A25
Watkins, John B. III A40
Watson, Kelly A53
Webb, William A46
Weibl, Richard 17, 35, 36
Welcome, Zaynah A47
Wells, Jordee A18
Wenzell, Bruce A65
Wesby, Julian A65
Wesley, April A12
Wesley, Robert Jr. A71
Wetherill, Andy A53
Whaley, Samuele A50
Wheeler, Saundra A53
White, Ashley A65
White, Carl A15, A49
White, Courtney A15, A49
White, Daryl T. Jr. A51
Whitfield, Nicole A47
Wightman, R. Mark A34
Wilkerson, Megan A18
Williams, Amber A51
Williams, Andrew A15, A49
Williams, Brittney A14
Williams, Cynthia A65
Williams, Ernest Jr. A70
Williams, Jessica A33
Williams, Richard A60, A62, A64
Willian, Kyle A29, A35
Wilson, Alfred W. 20, 36
Wilson, Bobby A28, A56
Winn, Russell 19, A75
Winstead, Angela A60, A61, A62, A63, A64
Winston, Cynthia E. 19, 36, 37
Woode, Emmanuel A14
Workie, Bizuneh A61
Wu, Dee H. A32
Wu, Hongzhuan A39
Wyche, James 3, 8, 17, 20, 36, 37
X
Xu, Jinsheng A16
Xuan, Richeng A62
Y
Yan, Jie A14
Yaun, Jason S. A18
Ye, Kaiming A26
Yedjou, Clement G. 19, A13, A75
Yimer, Lydia A22, A48
Yoder, Douglas A71
Young, Randon A47
Yu, Hongtao A63
Yuan, Joshua S. A51
Yutzy, Will A76
Z
Zhang, Su-Cheu A39
Zhang, Yongchao 19, A61, A62, A75
Zhao, Hua A43
Zhu, Jun A48
9
)PXDBO"""4BEWBODFNZDBSFFS
)
"""4JTBUUIFGPSFGSPOUPGBEWBODJOHFBSMZDBSFFSSFTFBSDIFST°PGGFSJOHKPCTFBSDI
HSBOUTBOEGFMMPXTIJQTTLJMMCVJMEJOHXPSLTIPQTBOETUSBUFHJDBEWJDF
4DJFODF$BSFFST3FTPVSDFT
+PC4FBSDI5PPMT
1PTU3FTVNFT
$BSFFS%FWFMPQNFOU"EWJDF
'PSVN"TLBO&YQFSU
3FTVNF8SJUJOH
(SBOUT/FU'VOEJOH3FTPVSDFT
.JOPSJUZ4DJFOUJTUT/FUXPSL
"""4"OOVBM.FFUJOH
$BSFFS'BJSBOE$BSFFS
%FWFMPQNFOU8PSLTIPQT
BOENPSF
'FMMPXTIJQT*OUFSOTIJQT
$BOPO/BUJPOBM1BSLT4DJFODF4DIPMBST
&OUSZ1PJOU*OUFSOTIJQTGPS4UVEFOUT
XJUI%JTBCJMJUJFT
.BTT.FEJB4DJFODFBOE&OHJOFFSJOH
'FMMPXTIJQT
.JOPSJUZ4DJFODF8SJUFST*OUFSOTIJQT
4DJFODF5FDIOPMPHZ1PMJDZ'FMMPXTIJQT
4DJFODF/FXT8SJUJOH*OUFSOTIJQT
$FOUFSGPS$BSFFSTJO4DJFODFBOE5FDIOPMPHZ
XXXBBBTPSHDBSFFSDFOUFS
Special Introductory Offer
to Students and Postdocs
Only 50
$
for a one year
membership
in AAAS*
*including a subscription to Science
International addresses will receive Science Digital
Introductory AAAS Membership for Students and Postdocs
� Student � Postdoc (please check one)
� I prefer to receive Science Digital instead of the print version.
name
Payment Method
address
� Check enclosed in the amount of
address
city
state/province
country
zip/postal code
phone
fax
e-mail
______________
(Payable to AAAS)
Bill my credit card in the amount of _______________
�
VISA
�
MasterCard
�
American Express
Card No.
Exp. Date
Signature
Date
Price valid until 30 September 2008.
M8XAP
MASTER OF
ENGINEERING
MANAGEMENT
PROGRAM
Build a business
foundation with
four core courses
in management,
marketing, finance,
and law
Customize your
degree with a
wide variety of
engineering or
business electives
Develop leadership,
negotiation, and
communication
skills in our unique
workshop series
Engineering knows no limits.
Why should you?
MS/PhD
PROGRAMS IN
ENGINEERING
Explore course
study and research
opportunities that
go beyond the
boundaries of
traditional academic
disciplines
Become an
independent thinker
who can contribute
to diverse teams of
researchers from
other fields of
expertise
Publish with
faculty advisers
Present your
research to
professional peers
Duke University. Where an interdisciplinary approach to education
makes all the difference. Duke looks beyond traditional paradigms to
equip engineers with the perspective to solve our world’s most complex
problems. That’s Duke: No boundaries. No limits.
Master of Engineering Management Program: http://memp.pratt.duke.edu/us
MS/PhD Graduate Engineering Programs: http://www.pratt.duke.edu/graduates
biomedical • civil • environmental • electrical • computer • mechanical • materials science
P R A T T
S C H O O L
O F
E N G I N E E R I N G
A T
D U K E
U N I V E R S I T Y
PROGRAM BOOK
Transdisciplinary research and graduate education in experiential media
Research assistantship and NSF IGERT traineeship opportunities
Within AME, you can engage experiential
media research and education in a
multidisciplinary context.
Arts, Media and Engineering (AME) is a joint graduate
program of the Herberger College of the Arts and the Ira A.
Fulton School of Engineering at ASU.
Choose from the transdisciplinary:
UÊi`>ÊÀÌÃÊ>`Ê-ViViÃÊ*°°
Join collaborative research groups that apply innovative experiential
media solutions to problems of societal significance in the areas of
health, education, sustainability, creativity and communication.
or from 14 concentrations within
disciplinary graduate degrees.
Research is complemented by interdisciplinary courses co-taught
by internationally renowned faculty.
Concentrations with AME are available in:
Competitive award packages and research and teaching
assistantships are available to qualified applicants.
UÊ
«ÕÌiÀÊ-ViViÊ>`Ê}iiÀ}Ê
ÊÊÊ°-°Ê>`Ê*°°®Ê
UÊiVÌÀV>Ê}iiÀ}Ê°-°Ê>`Ê*°°®Ê
UÊi}iiÀ}Ê*°°ÊÃ«iV>â>Ì®
UÊ*ÃÞV}ÞÊ*°°®
UÊ`ÕV>Ì>Ê/iV}ÞÊ*°°®
UÊiÃ}Ê°-°°Ê>`Ê*°°®
UÊ>ViÊ°°°®
UÊÕÃVÊ°°Ê>`Ê°°°®
UÊ/i>ÌÀiÊ>`ÊÊ°°°®
UÊ6ÃÕ>ÊÀÌÊ°°°®Ê
Photos: Left: Graduate students Rebecca Stern and Lisa Tolentino with Reflective Living’s
sensor squid project – a wireless communication tool that allows groups to make
collaborative decisions. Top right: A student exploring an immersive audiovisual environment
for mediating a complex population-resource model. Bottom right: Research associate
Shawn Cook working on a collaborative project in AME’s Mediating Complexity course.
© 2008 ASU Herberger College of the Arts 0908
AME is fully committed to increasing diversity, resulting in a
student body that reflects and honors multiple perspectives.
More than 40 percent of AME's student population is female
and 15 percent come from under-represented backgrounds.
Students’ diverse cultural and disciplinary backgrounds also
contribute to the rich AME network.
For more information about AME’s research and
educational programs, visit ame.asu.edu, or contact the
education coordinator at [email protected].
ame.asu.edu
Integrating diverse perspectives and approaches for world-leading research
and education in digital media.
Historically Black Colleges and Universities Undergraduate Program (HBCU-UP) 2008 National Research Conference
AME
Undergraduate Program (HBCU–UP)
23–26 October 2008 • Atlanta

Historically Black Colleges and Universities - HBCU-UP

Transcription

Similar documents

conference flyer

Initiative for the Future Water - Water Initiative for the Future (WatIF)

Getting to Philcomm, Changing Your Clothes

the cuban film series

Cartridge Specications and Performance D ata *Based on

Public Policy and Administration

Collection of Degree Certificate and Transcript 1

KayoorKayoko - Sampson Communication Consulting

The Clash and the two Bobs

- Pleasant View Christian School