Evidence against a common use of the diaphorase subunits by... bidirectional hydrogenase and by the respiratory complex I

Evidence against a common use of the diaphorase subunits by... bidirectional hydrogenase and by the respiratory complex I

FEMS Microbiology Letters 174 (1999) 159^165
Evidence against a common use of the diaphorase subunits by the
bidirectional hydrogenase and by the respiratory complex I
in cyanobacteria
Gudrun Boison a , Hermann Bothe
b
a
*, Alfred Hansel b , Peter Lindblad
b
a
Botanical Institute, University of Cologne, GyrhofstraMe 15, D-50923 Cologne, Germany
Department of Physiological Botany, Uppsala University, Villavaëgen 6, S-752 36 Uppsala, Sweden
Received 1 February 1999; received in revised form 8 March 1999; accepted 10 March 1999
Abstract
The diaphorase subunits Hox(E)FU of the cyanobacterial bidirectional hydrogenase complex have been suggested to serve
also as the three missing proteins of the cyanobacterial respiratory complex I. These subunits, encoded by nuoEFG in
Escherichia coli, contain the NAD‡ and FMN binding sites. Previous physiological and molecular experiments demonstrated
that neither the bidirectional hydrogenase activity nor hoxYH, encoding the hydrogenase dimer of the bidirectional enzyme,
occur in the heterocystous cyanobacterium Nostoc PCC 73102. The present study demonstrates, by heterologous Southern blot
hybridizations, that the genes hoxFU, encoding diaphorase subunits of the bidirectional enzyme, are both not present in Nostoc
PCC 73102, whilst the genes hoxFU were detectable in all other heterocystous and unicellular cyanobacteria examined which
possess the bidirectional hydrogenase. However, Nostoc PCC 73102 respires with rates comparable to those of other
cyanobacteria and sequences similar to the genes ndhJ, ndhD2, ndhA and ndhI, encoding subunits of the respiratory complex I
of Synechocystis PCC 6803, are present within the genome of Nostoc PCC 73102. Previous studies, using the unicellular strains
Anacystis nidulans and Synechocystis PCC 6803, demonstrated that mutants in the diaphorase genes hoxU or hoxF are unable
to evolve H2 , whereas the respiration is not affected. Altogether, these data are strongly against the hypothesis of a common
use of the hox(E)FU gene products by the bidirectional hydrogenase and by the respiratory complex I in
cyanobacteria. z 1999 Published by Elsevier Science B.V. All rights reserved.
Keywords : Bidirectional hydrogenase; Cyanobacterium ; Hydrogen metabolism ; Respiratory complex I; Nostoc PCC 73102
1. Introduction
The bidirectional hydrogenase of cyanobacteria
catalyzes the reversible formation of H2 from
2H‡ +2e3 in vitro [1]. The enzyme consists of the
* Corresponding author.
Tel.: +49 (221) 470 2760; Fax: +49 (221) 470 5181;
E-mail: [email protected]
hydrogenase dimer HoxYH containing the active
NiFe-site and the diaphorase moiety Hox(E)FU.
The latter mediates the transfer of electrons from
the hydrogenase dimer to NAD‡ . The relatedness
of the DNA and protein sequences of the cyanobacterial bidirectional hydrogenase to those of the
NAD‡ - or NADP‡ -dependent hydrogenases of Alcaligenes eutrophus or Desulfovibrio fructosovorans,
respectively, has been outlined in detail in a preced-
0378-1097 / 99 / $20.00 ß 1999 Published by Elsevier Science B.V. All rights reserved.
PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 1 3 6 - 6
FEMSLE 8733 15-4-99
160
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
ing publication ([2]). For cyanobacteria, the genes
hoxEFU have been described for the unicellular
strains Synechocystis (S.) PCC 6803 and A. nidulans
[3^5] whereas hoxFU, but presumably not hoxE, occur in the ¢lamentous Anabaena variabilis [2,5]. Immunological data suggested that the bidirectional hydrogenase is associated with the cytoplasmic
membrane in Anacystis nidulans [6] and mainly
with the thylakoid membranes in A. variabilis [7].
The diaphorase subunits show striking similarities,
on deduced amino acid sequence levels, to the
NADH oxidizing subunits NuoEFG of the NADH:ubiquinone oxidoreductase from Escherichia coli
and their counterparts with the NAD‡ and FMN
binding sites of respiratory complex I of bovine heart
mitochondria [8]. Generally, respiratory complex I
consists of at least 14 polypeptides. In cyanobacteria
and chloroplasts, only 11 of these have been identi¢ed [3,5,8,9]. The remaining three, corresponding to
the nuoEFG gene products of E. coli and containing
the NAD‡ and FMN binding sites, can, e.g., not be
deduced from the completely sequenced chromosome
of S. PCC 6803 [3,8,9]. The signi¢cant sequence
identities, the occurrence of conserved potential
iron-sulfur cluster binding motifs within the sequences and the results from the localization studies lead
us [8] to assume that the bidirectional hydrogenase in
these organisms is coupled to respiratory complex I
and that the diaphorase subunits Hox(E)FU function as the missing NADH oxidizing proteins of
complex I. However, mutants in hoxU of A. nidulans
[5] and in hoxF of S. PCC 6803 [10] showed nonimpaired respiratory O2 uptake whilst being a¡ected
in H2 evolution catalyzed by the bidirectional hydrogenase. These results do not necessarily disprove
the hypothesis of a common use of Hox(E)FU in
both the bidirectional hydrogenase and respiratory
complex I of cyanobacteria. The respiration in these
organisms is complex and several respiratory chains
with di¡erent electron carrier compositions exist
[11]. Other respiratory pathway(s) may overtake the
disposal of electrons when HoxF or HoxU is mutated.
The bidirectional hydrogenase is a common enzyme being present in both unicellar [1,3,5] and ¢lamentous cyanobacteria [1,2,7]. In the three strains
examined in detail (A. nidulans, A. variabilis and S.
PCC 6803), the physical arrangements of the struc-
tural genes and the occurrence of open reading
frames within the gene cluster(s) are remarkably dissimilar [5]. Interestingly, neither the bidirectional hydrogenase activity nor the corresponding genes hoxYH encoding the hydrogenase dimer are present in
Nostoc (N.) PCC 73102, a strain originally isolated
from a coralloid root of the cycad Macrozamia [12].
The occurrence of the diaphorase part Hox(E)FU in
this strain would be a strong indication for the involvement of these proteins in respiratory complex I.
The present investigation was, therefore, undertaken
to screen for hoxEFU in N. PCC 73102.
2. Materials and methods
2.1. Organisms and their growth
Nostoc sp. PCC 73102, Synechocystis PCC 6803,
Synechococcus PCC 7942 (= Anacystis R2), Nostoc
muscorum Agardh CCAP 1453/12, Anabaena variabilis ATCC 29413, Anabaena PCC 7120 and Anacystis
nidulans SAUG 1402-1 (= Synechococcus PCC 6301)
were purchased from the culture collections. All cyanobacteria were grown in BG11 medium, at 25³C,
as described [2,12].
2.2. DNA isolation and Southern blot hybridizations
Genomic DNA was isolated from the di¡erent cyanobacteria as described [13]. For each Southern
blot, 20 Wg of DNA from each strain was restricted
by EcoRI/HindIII. DNA was separated on 1% agarose gels and directly blotted onto nylon membranes
using 0.4 N NaOH as the transfer solution as described by the supplier (Amersham Pharmacia,
Uppsala, Sweden).
All probes (Table 1) were non-radioactively labelled using the digoxigenin labelling and hybridization kit (Boehringer, Mannheim, Germany). The labelling was performed during PCR ampli¢cation
(10 WM of each primer, 5^10 ng template DNA,
35 cycles of the following protocol: denaturation at
94³C for 40 s, annealing at 50³C for 1 min, elongation at 72³C for 1 min) including dig-dUTP in the
nucleotide mix as described in the dig-kit (Boehringer). The correct size of the obtained DNA fragments was veri¢ed by 1% agarose gel electrophoresis.
FEMSLE 8733 15-4-99
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
Hybridizations were carried out at 60³C using standard hybridization bu¡er (5UDenhardts/5USSPE/
0.5% SDS). Filters were washed (10 min, 60³C, two
times) with 2USSPE/0.1% SDS.
2.3. Respiratory O2 uptake measurements
The respiration rates by N. PCC 73102 and other
cyanobacterial strains were measured using a conventional Clark-type electrode [5].
3. Results and discussion
3.1. Absence of hoxFU homologues in N. PCC 73102
Representative cyanobacteria (two unicellular,
non-N2 -¢xing strains: Synechococcus PCC 7942
and S. PCC 6803, as well as four heterocystous,
N2 -¢xing forms: Nostoc muscorum CCAP 1453/12,
N. PCC 73102, A. variabilis ATCC 29413 and Anabaena PCC 7120) were screened for the presence of
hoxFU by heterologous Southern blot hybridizations. Distinct hybridization signals were detected
with the hoxF and hoxU probes in all strains examined, with the sole exception being N. PCC 73102
(Fig. 1). This is in agreement with previous data
161
demonstrating the absence of the structural genes
hoxYH, encoding the hydrogenase part, in this particular strain [12].
The absence of any hybridization signal between
the probes for the cyanobacterial diaphorase genes
hoxF and hoxU and genomic DNA isolated from N.
PCC 73102 might not necessarily mean the absence
of such genes within the N. PCC 73102 genome.
Negative results in Southern experiments have to
be interpreted with caution. However, cyanobacterial
hydrogenases generally show high sequence similarities. HoxF and HoxU from A. variabilis, A. nidulans
and S. PCC 6803 reveal identities of 59^69% on the
amino acid sequence level [5,14,15]. Moreover, a part
of the C-terminus of hoxH is 89 and 79% identical
when comparing the corresponding sequences in A.
variabilis with those of A. PCC 7120 and Nostoc
muscorum, respectively [14,15]. In addition, in Anabaena PCC 7120 and N. PCC 73102, the structural
genes hupSL, encoding an uptake hydrogenase, are
84% identical [16]. The uniformity of the negative
results with the two diaphorase genes hoxF and
hoxU (Fig. 1, Table 2) as well as the two genes encoding the hydrogenase part of the enzyme [12] and
only in the case of N. PCC 73102 clearly indicate the
absence of all subunits, including the diaphorase
moiety, of the bidirectional hydrogenase in this pe-
Table 1
Primers and probes used for the detection of DNA sequences homologous to diaphorase and respiratory complex I genes in cyanobacteria
Genes
Diaphorase genes
hoxE
hoxF
hoxU
Complex I genes
ndhA
ndhD2
ndhI
ndhJ
DNA fragment and size
Source organism
560-bp PCR fragment
(primers CTACTTCTGAAACGACACCC and CTTGGACTTGTTGCCAGACC)
850-bp PCR fragment
(primers GATCGCTGCCTATGCTGTGG and ACCAAGACCACACAAGCTGG)
560-bp PCR fragment ([13])
Synechococcus PCC 6301
900-bp PCR fragment
(primers CTGGAAAGAAAGATTTCCGC and CAATTGGTCAATACGCACCC)
900-bp PCR fragment
(primers TTCATCATGTGGGAACTGGA and ATGGACAACAGGTAAATCGG)
390-bp PCR fragment
(primers CAAGCGGCTAAGTATATCGG and GGGCAACCTTCCCAAAGCCAC)
380-bp PCR fragment
(primers TGGCTGACCACCAATGGCTTTG and CCGGCATCAAAATCCGTTTC)
Synechocystis PCC 6803
A. variabilis
Synechococcus PCC 6301
Synechocystis PCC 6803
Synechocystis PCC 6803
Synechocystis PCC 6803
The primers indicated are based on sequences of the genes in the source organisms indicated and were used to generate probes by PCR. All
probes are given from the 5P to the 3P end.
FEMSLE 8733 15-4-99
162
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
FEMSLE 8733 15-4-99
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
163
Fig. 1. (A) Southern blots of hybridizations of genomic DNA with probes for the diaphorase genes hoxE, F, U. Genomic DNA from several cyanobacterial strains was digested by a combination of HindIII and EcoRI and probed with digoxigenin-labelled DNA fragments
covering parts of the diaphorase genes hoxE, U (source Anacystis nidulans SAUG 1402-1) and hoxF (source Anabaena variabilis). 1: Nostoc muscorum, 2: N. PCC 73102, 3: Anabaena variabilis, 4: Anabaena PCC 7120, 5: Synechococcus PCC 7942 (hoxU, F)/Anacystis nidulans
1402-1 (hoxE), 6: S. PCC 6803. Obtained hybridization signals in lanes 3, 5 and 6 all have the expected sizes, which were deduced from
the published sequences of the bidirectional hydrogenase hox cluster from A. variabilis, Synechoccus PCC 7942 and S. PCC 6803 [5]. (B)
Southern blots of hybridizations of genomic DNA with probes for the four complex I genes ndhJ, D2, A, I. Genomic DNA from several
cyanobacterial strains was digested by a combination of HindIII and EcoRI and probed with digoxigenin-labelled DNA fragments covering parts of the complex I genes ndhJ, D2, A, I (source Synechocystis PCC 6803). 1: Nostoc muscorum, 2: N. PCC 73102, 3: Anabaena
variabilis, 4: Anabaena PCC 7120, 5: Anacystis nidulans 1402-1, 6: S. PCC 6803. The obtained hybridization signals in lane 6 all have the
expected sizes, which were deduced from the completely published sequences of the chromosome of S. PCC 6803 [5]. More than one
band per lane indicates either the occurrence of a second copy of the gene (especially in the case of ndhD2, which is only one of ¢ve
ndhD genes) or a restriction site within the hybridizing sequence.
6
culiar strain. An extensive sequence alteration resulting in negative results in all four structural genes and
only in this strain is highly unlikely.
3.2. Peculiarities in the case of the hoxE gene
Hybridization with the hoxE probe from A. nidulans gave a distinct signal only with genomic DNA
from A. nidulans (Fig. 1A) and S. PCC 7942 (= Anacystis R2, Table 2), but not with the other strains
tested. This is somewhat surprising in the case of S.
6803 since the hoxE sequence is included in the chromosome ([3]). Even when the stringency was lowered
to 50³C, no unequivocal signal was detected when
hybridizing S. 6803 DNA with the hoxE probe
from A. nidulans encompassing the whole hoxE
gene. On the other hand, the homologous hybridization was positive with DNA and the probe from
S. 6803 (not documented). The hoxE gene from A. nidulans and S. 6803 shares only 53% sequence identity
on the amino acid level, which may explain the negative results in heterologous probing. The gene hoxE
may have developed by duplication of part of hoxF
[5]. The physiological role of its gene product remains as unclear as its distribution. HoxE may serve
as the protein which couples the bidirectional hydrogenase with the cytoplasmic membrane in unicellular
strains, e.g. in A. nidulans. Immunogold labelling [6]
and solubilization experiments [17] showed that the
bidirectional enzyme is associated with the cytoplasmic membrane in this cyanobacterium. Using di¡erent polyclonal antisera and the ¢lamentous strain A.
variabilis, a subcellular localization mainly to the
thylakoid regions of the cells was demonstrable [7]
which would be in accordance with the presumptive
absence of HoxE in ¢lamentous heterocystous forms.
Table 2
Summary of the results from the heterologous Southern blot hybridizations
Strain
N. muscorum
N. PCC 73102
A. variabilis
A. PCC 7120
S. PCC 7942
S. PCC 6803
Probe
hoxE
A. nidulans
hoxF
A. variabilis
hoxU
A. nidulans
ndhJ
S. PCC 6803
ndhD2
S. PCC 6803
ndhA
S. PCC 6803
ndhI
S. PCC 6803
3
3
3
3
+
3
+
3
+
+
+
+
+
3
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Genomic DNA isolated from several cyanobacteria and di¡erent probes containing parts of either the diaphorase moiety of the bidirectional
hydrogenase (hoxE, hoxF and hoxU) or four subunits of the cyanobacterial respiratory complex I (ndhJ, ndhD2, ndhA and ndhI) were used.
+, indicates a clear, unequivocal signal ; 3, means no detectable signal in the respective heterologous Southern blot hybridizations.
FEMSLE 8733 15-4-99
164
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
3.3. Respiratory capacity of N. PCC 73102
N. PCC 73102 was originally isolated from a coralloid root of the cycad Macrozamia. In the symbiosis in situ, the host provides photosynthase to the
cyanobiont (see [18]). Therefore it had to be ruled
out that N. PCC 73102, like clostridia, is an obligate
fermentative cyanobacterium which does not respire.
Probes containing parts of genes encoding other subunits of the respiratory complex I were therefore
developed, based on the sequences in S. PCC 6803
[3], to identify the corresponding sequences in N.
PCC 73102. The following single copy genes in S.
PCC 6803 were chosen: NdhJ (slr1281) from the operon ndhCKJ, ndhA, containing the sequence motif
for the plastoquinone binding site, and ndhI with the
motif for the FeS-cluster of the peripheral part. In
addition, ndhD2 (slr1291) was selected as a representative out of ¢ve putative ndhD genes. Probes encoding parts of all four genes gave distinct hybridization
signals in all six strains examined, including N. PCC
73102 (Fig. 1B, Table 2). This exempli¢es that at
least four of the genes of the cyanobacterial complex
I are present in N. PCC 73102.
Despite of harboring this genetic information, N.
PCC 73102 may not respire due to the absence of the
NuoEFG/HoxFU counterparts. However, the respiratory O2 uptake in N. PCC 73102 was 306 þ 89
nmol O2 h31 mg31 protein and lies thus in the
same range as in the other cyanobacteria tested
(for N. muscorum 333 þ 66, A. variabilis 180 þ 30,
A. nidulans 213 þ 46 and S. PCC 7942 141 þ 53
nmol O2 consumed h31 mg31 protein). Thus, the
composition of the respiratory complexes in N.
PCC 73102 might be the same as in other cyanobacteria.
The question remains which are the NuoEFG
counterparts in cyanobacteria, in particular in strains
like N. PCC 73102 which does respire despite the
absence of hoxFUYH. One possible candidate could
be NADPH:ferredoxin oxidoreductase (FNR)
[9,19,20]. This enzyme accepts either NADPH or
NADH as an electron donor and has recently been
shown to associate with the chloroplastic NAD(P)H
dehydrogenase complex [21]. In chloroplasts, cyclic
photophosphorylation may involve NAD(P)H and
FNR [22]. In unicellular cyanobacteria, as shown
with particles from A. nidulans, an active ferredox-
in-dependent cyclic photophosphorylation exists
which is apparently independent of NAD(P)H,
FNR and of a complex poising which is in contrast
to the reaction in chloroplasts of higher plants ([23],
but see [24]). Thus, chlororespiration and cyclic photophosphorylation might be di¡erent in chloroplasts
and in cyanobacteria. Several isoenzymes of FNR
exist in cyanobacteria [11]. One of the isoenzymes
of FNR may substitute for the missing NuoEFG
counterparts in cyanobacterial complex I, thus being
speci¢cally involved in the respiration but not in the
cyclic photophosporylation. However, a direct involvement of the cyanobacterial complex I, containing only the 11 identi¢ed subunits, in a cyclic electron £ow passing electrons from photosystem I back
to the plastoquinone pool can not be ruled out [25].
Acknowledgments
This work was kindly supported by a travel scholarship from the E.U. COST 8.18 (`Hydrogenases')
(G.B.), by grants from the Deutsche Forschungsgemeinschaft (H.B.) and from the Swedish National
Energy Administration and the Swedish Natural Science Research Council (P.L.).
References
[1] Houchins, J.P. (1984) The physiology and biochemistry of
hydrogen metabolism in cyanobacteria. Biochim. Biophys.
Acta 768, 227^255.
[2] Schmitz, O., Boison, G., Hilscher, R., Hundeshagen, B.,
Zimmer, W., Lottspeich, F. and Bothe, H. (1995) Molecular
biological analysis of a bidirectional hydrogenase from cyanobacteria. Eur. J. Biochem. 233, 266^276.
[3] Nakamura, Y., Kaneko, T., Hirosawa, M., Myajima, N. and
Tabata, S. (1998) Cyanobase, a www database containing the
complete nucleotide sequence of Synechocystis sp. strain PCC
6803. Nucleic Acids Res. 26, 63^67
[4] Appel, J. and Schulz, R. (1996) Sequence analysis of an operon of a NAD(P)-reducing nickel hydrogenase from the cyanobacterium Synechocystis sp. PCC 6803 gives additional evidence for direct coupling of the enzyme to NAD(P)Hdehydrogenase (complex I). Biochim. Biophys. Acta 1298,
142^147.
[5] Boison, G., Schmitz, O., Schmitz, B. and Bothe, H. (1998)
Unusual gene arrangement of the bidirectional hydrogenase
and functional analysis of its diaphorase subunit HoxU in
FEMSLE 8733 15-4-99
G. Boison et al. / FEMS Microbiology Letters 174 (1999) 159^165
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
respiration of the unicellular cyanobacterium Anacystis nidulans. Curr. Microbiol. 36, 252^258.
Kentemich, T., Bahnweg, M., Mayer, F. and Bothe, H. (1990)
Localization of the reversible hydrogenase in cyanobacteria.
Z. Nat.forsch. 44c, 384^391.
Serebriakova, L., Zorin, N.A. and Lindblad, P. (1994) Reversible hydrogenase in Anabaena variabilis ATCC 29413. Presence and localization in non-N2 -¢xing cells. Arch. Microbiol.
161, 140^144.
Schmitz, O. and Bothe, H. (1996) The diaphorase subunit
HoxU of the bidirectional hydrogenase as electron transferring protein in cyanobacterial respiration? Nat.wiss. 83, 525^
527.
Berger, S., Ellersiek, U., Kinzelt, D. and Steinmuëller, K.
(1993) Immunopuri¢cation of the subcomplex of the
NAD(P)H-plastoquinone oxidoreductase from the cyanobacterium Synechocystis sp. PCC 6803. FEBS Lett. 326, 246^250.
Howitt, C.A. and Vermaas, W.F.J. (1997) Analysis of respiratory mutants of Synechocystis 6803. In: Book of Abstracts
of the IX. International Symposium on Photosynthetic Prokaryotes (Peschek, G.A., Loë¡elhardt, W. and Schmetterer,
G.A., Eds.), p. 36, Vienna, Austria.
Schmetterer, G. (1994) Cyanobacterial respiration. In: The
Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.),
pp. 409^435, Kluwer, Dordrecht, The Netherlands.
Tamagnini, P., Troshina, O., Oxelfelt, F., Salema, R. and
Lindblad, P. (1997) Hydrogenases in Nostoc sp. strain PCC
73102, a strain lacking a bidirectional enzyme. Appl. Environ.
Microbiol. 63, 1801^1807.
Boison, G., Schmitz, O., Mikheeva, L., Shestakov, S. and
Bothe, H. (1996) Cloning, molecular analysis and insertional
mutagenesis of the bidirectional hydrogenase genes from the
cyanobacterium Anacystis nidulans. FEBS Lett. 394, 153^158.
Lindblad, P., Oxelfelt, F., Tamagnini, P. and Troshina, O.
(1998) Cyanobacterial biotechnology. Nostoc PCC 73102
and H2 : knowledge, research and biotechnological challenges.
In : Cyanobacterial Biotechnology (Subramarian, G., Kaushik, B.D. and Venkataraman, G.S., Eds.), pp. 1^5, Oxford and
IBH Publishing, New Delhi, India.
Boison, G. (1998) Molekulare Charakterisierung der Bidirektionalen Hydrogenase des Einzelligen Cyanobakteriums Ana-
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
165
cystis nidulans. Ph.D. Thesis, The University of Cologne, Cologne, Germany.
Oxelfelt, F., Tamagnini, P. and Lindblad, P. (1998) Hydrogen
uptake in Nostoc sp. strain PCC 73102. Cloning and characterization of a hupSL homologue. Arch. Microbiol. 169, 267^
274
Kentemich, T., Casper, M. and Bothe, H. (1991) The reversible hydrogenase in Anacystis nidulans is a component of the
cytoplasmic membrane. Nat.wiss. 78, 559^560.
Lindblad, P. and Bergman, B. (1990) The cycad - cyanobacterial symbiosis. In: Handbook of Symbiotic Cyanobacteria,
Chapter 6 (Rai, A.N., Eds.), pp. 137^159, ISBN 0-8493-32753, CRC Press, USA.
Alpes, I., Schrautemeier, B., Scherer, S. and Boëger, P. (1985)
Di¡erent enzymes involved in NADH- and NADPH-dependent respiration in the cyanobacterium Anabaena variabilis.
FEMS Microbiol. Lett. 26, 147^151.
Friedrich, T., Steinmuëller, K. and Weiss, H. (1995) The proton-pumping respiratory complex I of bacteria and mitochondria and its homologues in chloroplasts. FEBS Lett. 367, 107^
111.
Guedeney, G., Corneille, S., Cuineè, S. and Peltier, G. (1996)
Evidence for an association of ndh B, ndh J gene products and
ferredoxin-NADP-reductase as components of the chloroplastic NAD(P)H dehydrogenase complex. FEBS Lett. 378, 277^
280.
Burros, P.A., Sazanov, L.A., Svab, Z., Maliga, P. and Nixon,
P.J. (1998) Identi¢cation of a functional respiratory complex
in chloroplasts through analysis of tobacco mutants containing disrupted plastid ndh genes. EMBO J. 17, 868^876.
Bothe, H. (1969) Ferredoxin als Kofaktor der cyclischen Photophosphorylierung in einem zellfreien System aus der
Blaualge Anacystis nidulans. Z. Nat.forsch. 24b, 1574^1582.
Mi, H., Endo, T., Ogawa, T. and Asada. K. (1995) Thylakoid
membrane- bound, NADPH- speci¢c pyridine nucleotide dehydrogenase complex mediates cyclic electron transport in the
cyanobacterium Synechocystis sp. PCC6803. Plant Cell. Physiol. 36, 661^668.
Friedrich, T. and Weiss, H. (1997) Modular evolution of the
respiratory NADH:ubiquinone oxidoreductase and the origins of its modules. J. Theor. Biol. 187, 529^540.
FEMSLE 8733 15-4-99