Untitled - Latin American Journal of Aquatic Research

Transcription

Latin American Journal of Aquatic Research
www.lajar.cl
ISSN 0718 -560X
www.scielo.cl
CHIEF EDITOR
Sergio Palma
Pontificia Universidad Católica de Valparaíso, Chile
[email protected]
ASSOCIATE EDITORS
Cristian Aldea
Universidad de Magallanes, Chile
Álvaro J. Almeida Bicudo
Universidad Federal Rural de Permambuco, Brasil
José Angel Alvarez Perez
Universidade do Vale do Itajaí, Brasil
Patricio Arana
Pontifícia Universidad Católica de Valparaíso, Chile
Eduardo Ballester
Universidade Federal do Paraná, Brasil
Sandra Bravo
Universidad Austral de Chile, Chile
Claudia S. Bremec
Instituto de Investigación y Desarrollo Pesquero, Argentina
Enrique A. Crespo
Centro Nacional Patagónico, Argentina
Patricio Dantagnan
Universidad Católica de Temuco, Chile
Enrique Dupré
Universidad Católica del Norte, Chile
Diego Giberto
Instituto de Investigación y Desarrollo Pesquero, Argentina
Maurício Laterça-Martins
Universidade Federal de Santa Catarina, Brasil
César Lodeiros-Seijo
Instituto Oceanográfico de Venezuela
Universidad de Oriente, Venezuela
Beatriz E. Modenutti
Universidad Nacional del Comahue
Argentina
Luis M. Pardo
Universidad Austral de Chile, Chile
Guido Plaza
Jesús T. Ponce
Universidad Autónoma de Nayarit, México
Ricardo Prego
Instituto de Investigaciones Marinas, España
Erich Rudolph
Universidad de Los Lagos, Chile
Nelson Silva
Oscar Sosa-Nishizaki
Centro de Investigación Científica y Educación Superior
de Ensenada, México
Ingo Wehrtmann
Universidad de Costa Rica
Costa Rica
Financiamiento parcial de CONICYT obtenido en el Concurso
“Fondo de Publicación de Revistas Científicas año 2015”
Escuela de Ciencias del Mar, Pontificia Universidad Católica de Valparaíso
Casilla 1020, Valparaíso, Chile, Fax: 56-32-2274206, E-mail: [email protected]
INVITED REVIEWERS IN REGULAR ISSUES OF VOLUME 43 (2015)
Alejandro Abarca
Universidad Tecnológica de Chile
Coquimbo, Chile
Isabel Abdo
Centro de Investigación en Alimentos y Desarrollo
Sonora, México
Bernabé Aguilar
Universidad de Guadalajara, Guadalajara, México
Gabriel Aguirre
Universidad Autónoma de Tamaulipas, Tamaulipas, México
Gabriela Aguirre
Universidad de Cádiz, Cádiz, España
Jorge Alfaro
Universidad Nacional, Heredia, Costa Rica
Carlos Alvarez
Universidad Autónoma Metropolitana, Iztapalapa, México
Luis Alvarez
Grupo Piscimar, La Habana, Cuba
Píndaro Alvaréz
Instituto Politécnico Nacional, Sinaloa, México
Gustavo Arencibia
Centro de Investigaciones Pesqueras, La Habana, Cuba
Lenin Arias Rodríguez
Universidad Juárez Autónoma de Tabasco, Tabasco, México
Iván Arismendi
Oregon State University, Oregon, United State of America
Eddie Aristizabal
Instituto Nacional de Investigación y Desarrollo Pesquero
Mar del Plata, Argentina
Antônio Ávila
Centro APTA, Instituto de Pesca
Santos, Brasil
Julia Azanza
Instituto Superior de Tecnologías y Ciencias Aplicadas
La Habana, Cuba
Pedro Báez
Museo Nacional de Historia Natural
Santiago, Chile
Christine Band
Instituto Politécnico Nacional, Ciudad de México
México
Benjamín Barón
Centro de Investigación Científica y de Educación Superior de
Ensenada, Ensenada, México
Roberto Bastias
Pontificia Universidad Católica de Valparaíso
Valparaíso, Chile
Marcela Bastidas
Consejo Nacional de Investigaciones
Científicas y Técnicas, Buenos Aires, Argentina
Raymond Bauer
University of Louisiana, Louisiana, Estados Unidos
Mauro Belleggia
Mar del Plata, Argentina
Victoria Besada
Instituto Español de Oceanografía, Madrid, España
Álvaro Bicudo
Universidad Federal Rural de Pernambuco, Garanhuns, Brazil
Ramon Bonfil
Universidade Federal Rural, Recife, Brasil
Sandra Bravo
Universidad Austral de Chile, Puerto Montt, Chile
Odalisca Breedy
Universidad de Costa Rica, San José, Costa Rica
Alejandro Buschmann
Universidad de los Lagos, Puerto Montt, Chile
José Caballero
Centro de Investigación Científica de Yucatán
Yucatán, México
Ariel Cabreira
Buenos Aires, Argentina
Marco Cadena
Universidad Autónoma de Baja California Sur, México
Danilo Calliari
Universidad de la República, Montevideo, Uruguay
Antonio Camacho
Universidad de Valencia, Valencia, España
Bernardita Campos
Universidad de Valparaíso, Valparaíso, Chile
Jaime Cantera
Universidad del Valle, Cali, Colombia
Nicolás Castañeda
Universidad Autónoma de Sinaloa, Sinaloa, México
Leonardo Castro
Universidad de Concepción, Concepción, Chile
Rosario Cisneros
Instituto del Mar del Perú, Callao, Perú
Mauricio Coelho
Universidade do Estado de Santa Catarina, Santa Catarina, Brasil
Gabriel Claramunt
Universidad Arturo Prat, Iquique, Chile
Wilfrido Contreras
Universidad Juárez Autónoma de Tabasco
Tabasco, México
Bruno Correa
Centro de Información de Recursos Ambientales
Santa Catarina, Brazil
Marco Correa
Pontificia Universidad Católica de Valparaíso, Valparaíso, Chile
Alessandra Cristina
Universidade Federal do Ceará, Fortaleza, Brasil
José Cuesta
Consejo Superior de Investigaciones Científicas
Cádiz, España
Natalia da Costa Marchiori
Empresa Pesquisa Agropecuária Extensão Rural de Santa Catarina,
Itajaí, Brasil
Lilian da Silva
Universidade Federal do Paraná, Paraná, Brasil
Patricia da Silva
Universidade Federal da Paraíba, Paraíba, Chile
Patricio Dantagnan
Universidad Católica de Temuco, Temuco, Chile
Marcos De Donato
Universidad de Oriente, Cumaná, Venezuela
Patricio De Los Ríos
Luisa Delgado
Universidad de Chile, Santiago, Chile
Juan Díaz
Valparaíso, Chile
Verónica Diaz
Mariano Diez
Centro Austral de Investigaciones Científicas, Ushuaia, Argentina
Magda Domínguez
Instituto Nacional de Pesca, Ciudad de México, México
Fernanda Duarte
Universidade Federal de Pernambuco, Pernambuco, Brasil
Rodolfo Elias
Universidad Nacional de Mar del Plata, Buenos Aires, Argentina
Ileana Espejel
Universidad Autónoma de Baja California, Ensenada, México
Michael Frick
Caretta Research Project, Georgia, United State of America
Mario Galaviz
Universidad Autónoma de Baja California
Baja California, México
José Gallardo
Valparaíso, Chile
Ricardo Galleguillos
Felipe Galván
Centro Interdisciplinario de Ciencias Marinas, La Paz, México
Jonatan Gardner
Victoria University of Wellington, Wellington, New Zealand
Manuel García
Universidad Autónoma de Guadalajara, Guadalajara, México
Rebeca Gasca
El Colegio de la Frontera Sur, Villahermosa, México
Gabriel Genzano
Universidad Nacional de Mar del Plata, Mar del Plata, Argentina
Juliana Giménez
Universidad de Buenos Aires, Buenos Aires, Argentina
Ligia Gonçalves
Instituto Nacional de Pesquisas da Amazônia, Manaus, Brasil
Paola González
Universidad Católica de la Santísima Concepción
Concepción, Chile
Alejandro Guerra
Centro de Investigaciones Marinas, Vigo, España
Sandra M. Guerrero
Universidad Nacional Autónoma de México
Ciudad de México, México
María Fernández
Universidad Nacional de Río Cuarto, Córdoba, Argentina
Manuel Haimovici
Universidade Federal do Rio Grande, Rio Grande, Brasil
Cesar Hernández
Universidad Autónoma de Tamaulipas, Victoria Tamaulipas,
México
Daniel Hernández
Universidad Autónoma del Estado de Morelos, Morelos, México
María Hernández
Universidad Juárez Autónoma de Tabasco, Tabasco, México
Martha Hernández
Instituto Tecnológico de Boca del Río, Veracruz, México
Milton Hernández
Instituto Tecnológico de Mazatlán, Mazatlán, México
Monica Hoffmeyer
Margaret Hunter
Southeast Ecological Science, Gainesville, United State
José Iannacone
Universidad Nacional Federico Villarreal, Lima, Perú
Carlos Jara
Universidad Austral de Chile, Valdivia, Chile
Shaleyla Kelez
Centro para la Conservación Integral de los Ecosistemas Marinos
del Pacífico del Este, San Borja, Perú
Maurício Laterça
Universidade Federal de Santa Catarina, Florianópolis, Brasil
Javier Legua
Instituto de Fomento Pesquero, Valparaíso, Chile
Mairin Lemus
Universidad de Oriente, Sucre, Venezuela
Carlos Lezama
Universidad de Colima, Colima, México
Alejandra Llanos-Rivera
Karin Lohrmann
Universidad Católica del Norte, Coquimbo, Chile
Luis Lopes
Universidad de São Paulo, Sao Paulo, Brasil
Daniel López
Universidad de Playa Ancha, Valparaíso, Chile
Inmaculada López
La Universidad de Granada, Granada, España
Laura López
Luis López
Instituto Español de Oceanografía, Islas Canarias, España
Sebastián López
Universidad Andres Bello, Santiago, Chile
Christopher Lowe
California State University Long Beach, California
United State of America
Antonio Luna
Instituto Politécnico Nacional, Sinaloa, México
Cristiana Maciel
Universidade Federal do Pará, Pará, Brasil
Lidia Mansur
Pontificia Universidad Católica de Chile, Santiago, Chile
Alfonso Mardones
Luis Martínez
Universidad de Sonora, Sonora, México
Marcel Martínez
Centro de Investigación en Alimentación y Desarrollo, Sonora,
México
Silvio Maurano
Universidade de Recife, Recife, Brasil
Ricardo Medina
Universidad Central de Las Villas, Santa Clara, Cuba
Paola Mejía
Fundación SQUALUS, Cali, Colombia
Anselmo Miranda
Universidad Estatal de Sonora, Sonora, México
Vivian Montecinos
Universidad de Chile, Santiago, Chile
Cassiano Monteiro
Universidade Federal Fluminense, Niterói, Brasil
Américo Montiel
Universidad de Magallanes, Punta Arenas, Chile
Erika Montoya
Instituto de Investigaciones Marinas y Costeras, Santa Marta
Colombia
María Cristina Morales
María Monroy
Universidad Nacional Autónoma de México, Ciudad de México
México
Francisco Moyano
Universidad de Almería, Almería, España
Pablo Muniz
Universidad de la República, Montevideo, Uruguay
Jorge Navarro
Marcelo Oliva
Universidad de Antofagasta, Antofagasta, Chile
Alfreldo Olivera
Universidad Rural Federal de Pernambuco, Recife, Brasil
Mauricio Ortiz
International Commission for the Conservation of Atlantic Tunas
Madrid, España
Natalia Ospina
Universidad de Varsovia, Varsovia, Polonia
Yannis Papastamatiou
University of St Andrews, Scotland, United Kingdom
Jorge Paramo
Universidad de Magdalena, Santa Marta, Colombia
Germán Pequeño
Alitiene Pereira
Empresa Brasileira de Pesquisa Agropecuária, Brasilia, Brasil
Juan Pérez
El Colegio de la Frontera Sur, Chiapas, México
Montserrat Pérez
Instituto Español de Oceanografía, Vigo, España
Omar Pérez
Utah State University, Utah, United State of America
Jorge O. Pierini
Universidad Nacional del Sur, Bahía Blanca, Argentina
Marcelo Pinheiro
Universidade Estadual Paulista, São Paulo, Brasil
Sheng-Ping Wang
National Taiwan Ocean University, Keelung, Taiwan
Guido Plaza
German Poleo
Universidad Lisandro Alvarado, Barquisimeto, Venezuela
Jesús Ponce
Universidad Autónoma de Nayarit, Nayarit, México
Ricardo Prego
Instituto de Investigaciones Marinas, Vigo, España
Laura Prosdocimi
José Possebon
Universidad de São Paulo, São Paulo, Brasil
Andre Punt
University of Washington, Washington, United State of America
Javier Quiñones
Ilie Racotta
Centro de Investigaciones Biológicas del Noroeste, La Paz
México
Joana Raimundo
Instituto Português do Mar e da Atmosfera, Lisboa, Portugal
Sebastián Reyes
Francisco Rocha
Universidad de Vigo, Vigo, España
Gustavo Rodríguez
Universidad Autónoma de Sinaloa, Sinaloa, México
Jorge Rodríguez
Instituto Politécnico Nacional, Ciudad de México, México
Sara Rodríguez
Uriel Rodríguez
Research and Development Center, São Paulo, Brasil
Pablo Rojas
Instituto de Fomento Pesquero, Valparaíso, Chile
Elizabeth Romagosa
Instituto de Pesca, São Paulo, Brasil
Giovanna Romano
Stazione Zoologica Anton Dohrn, Napoli, Italia
María Soledad Romero
Erich H. Rudolph
Universidad de Los Lagos, Osorno, Chile
Guilerme Rupp
Universidade Federal de Santa Catarina, Florianópolis, Brasil
Italo Salgado
Arturo Sánchez
Centro de Investigaciones Biológicas del Noroeste
La Paz, Baja California Sur, México
Pedro Saucedo
Kurt Schaefer
Inter-American Tropical Tuna Commission
California, United State of America
Rodrigo Schveitzer
Manuel Segovia
Centro de Investigación Científica y de Educación Superior de
Ensenada, Ensenada, México
Chugey Sepulveda
Institute of Environmental Research, Oceanside
United State of America
Roger Sepulveda
Abilio Soares-Gomes
Universidade Federal Fluminense, Niterói, Brasil
Leonardo Tachibana
Instituto de Pesca, São Paulo, Brasil
María Isabel Toledo
Natalia Trabal
Mauricio Urbina
University of Canterbury, Mánchester, United Kingdom
Ivan Valdevenito
Universidad Catolica de Temuco, Tamuco, Chile
Marcia Vanacor
Instituto Capixaba de Pesquisa, Vitória, Brasil
Teodoro Vaske Junior
Universidade Federal de Pernambuco, Pernambuco, Brasil
Luz A. Velasco
Universidad del Magdalena, Santa Marta, Colombia
María Vega
Instituto Politécnico Nacional, Yucatán, México
Maria Teresa Viana
Universidad Autónoma de Baja California, Ensenada, México
Felipe Vieira
Universidad Federal de
Santa Catarina, Florianópolis, Brasil
Leandro Vieira
Manuel Villar
Universidad de Granada, Granada, España
Fresia Villalobos
Ingo Wehrtmann
Gabriela Williams
Centro Nacional Patagónico, Chubut, Argentina
Vernónica Williner
Instituto Nacional de Limnología, Santa Fe, Argentina
Roberto Zamora
Instituto Tecnológico de Conkal, Yucatán, México
Casilla 1020, Valparaíso, Chile, Fax: (56-32) 2274206, E-mail: [email protected]
LATIN AMERICAN JOURNAL OF AQUATIC RESEARCH
Lat. Am. J. Aquat. Res., 43(5) 2015
CONTENTS
Reviews
Erich H. Rudolph
Current state of knowledge on Virilastacus species (Crustacea, Decapoda, Parastacidae). Estado de conocimiento de las
especies de Virilastacus (Crustacea, Decapoda, Parastacidae)…………………………………..………………….…………807-818
Marcelo García-Guerrero, Rodolfo de los Santos Romero, Fernando Vega-Villasante & Edilmar Cortes-Jacinto
Conservation and aquaculture of native freshwater prawns: the case of the cauque river prawn Macrobrachium
americanum (Bate, 1868). Conservación y cultivo de especies nativas de langostinos: el caso del cauque Macrobrachium
americanum (Bate, 1868).……………………..………………………………………………………………………….………..819-827
Research Articles
Rafael Vieira de Azevedo, Karolina dos Santos-Costa, Karen Figueiredo de Oliveira, Fábio Flores-Lopes, Eduardo Arruda
Teixeira-Lanna & Luís Gustavo Tavares-Braga
Responses of Nile tilapia to different levels of water salinity. Respuestas de la tilapia del Nilo a diferentes niveles de
salinidad del agua………………………………………………………………………………………...…………….………..…828-835
Italo Salgado-Leu & Albert G.J. Tacon
Effects of different protein and carbohydrate contents on growth and survival of juveniles of southern Chilean
freshwater crayfish, Samastacus spinifrons. Efecto de diferentes niveles de proteína y carbohidratos sobre el crecimiento y
sobrevivencia de juveniles del camarón de río del sur de Chile, Samastacus spinifrons……………….……………….…836-844
Gema Hidalgo, Wilmer Toledo & Alejandro Granados-Barba
Diversidad y distinción taxonómica de la macrofauna en fondos blandos de la plataforma norte y suroccidental cubana. Macrofaunal diversity and taxonomic distinctness in soft bottoms of the northern and southwestern Cuban shelf… 845-855
Norberto Capetillo-Piñar, Marcial Trinidad Villalejo-Fuerte & Arturo Tripp-Quezada
Distinción taxonómica de los moluscos de fondos blandos del Golfo de Batabanó, Cuba. Taxonomic distinctness of softbottoms mollusks from Gulf of Batabanó, Cuba……………………………………………………………..….…………….…856-872
Laura Vidal, Adriana Vallarino, Ileana Benítez & Jorge Correa
Implementación del plan estratégico Ramsar en humedales costeros de la Península de Yucatán: normativas y
regulación. Implementation of the Ramsar strategic plan in coastal wetlands of the Península de Yucatán: regulations and
normativity……………………………………………………………………………………….…………….…..….……………….873-887
Wilson Massamitu Furuya, Mariana Michelato, Ana Lúcia Salaro, Thais Pereira da Cruz & Valéria Rossetto Barriviera-Furuya
Estimation of the dietary essential amino acid requirements of colliroja Astyanax fasciatus by using the ideal protein
concept. Estimación de los requerimientos dietéticos de aminoácidos esenciales de colliroja, Astyanax fasciatus, basadas en
el concepto de proteína ideal corporal………………………………………………………………………..….…………..…….888-894
Larissa G. Paiva, Luana Prestrelo, Kiani M. Sant’Anna & Marcelo Vianna
Biometric sexual and ontogenetic dimorphism on the marine catfish Genidens genidens (Siluriformes, Ariidae) in a
tropical estuary. Biometría sexual y dimorfismo ontogenético en el bagre marino Genidens genidens (Siluriformes, Ariidae),
en un estuario tropical…………………………………………………………………………………………..…...……………….895-903
Emmanuel Villanueva-Gutiérrez, Luis Rafael Martínez-Córdova, Marcel Martínez-Porchas & Miguel Antonio Arvayo
Efecto de la adición de un extracto acuoso de pionilla Lasianthaea podocephala en el cultivo del camarón blanco del
Pacífico Litopenaeus vannamei en condiciones de laboratorio. Effect of the addition of an aqueous extract of the San
Pedro Daisy Lasianthaea podocephala, in the culture of the Pacific white shrimp, Litopenaeus vannamei, under laboratory
conditions………………………………….…………………………………….….……………………………..….…………….….904-911
www.scielo.cl/imar.htm
www.lajar.cl
Anayeli Gutiérrez-Dagnino, Antonio Luna-González, Jesús A. Fierro-Coronado, Píndaro Álvarez-Ruíz, María del Carmen
Flores-Miranda, Saraí Miranda-Saucedo, Violeta Medina-Beltrán & Ruth Escamilla-Montes
Efecto de la inulina y del ácido fúlvico en la supervivencia, crecimiento, sistema inmune y prevalencia de WSSV en
Litopenaeus vannamei. Effect of inulin and fulvic acid on survival, growth, immune system, and WSSV prevalence in
Litopenaeus vannamei.……………….……………………………………………………………………..….……………...….…912-921
Eulogio Soto, Williams Caballero & Eduardo Quiroga
Composition and vertical distribution of metazoan meiofauna assemblages on the continental shelf off central Chile.
Composición y distribución vertical de los ensambles de meiofauna metazoaria en la plataforma continental frente a Chile
central.………………….……………..……….………………………………………………………………..….……………….…922-935
Huann Carllo Gentil-Vasconcelos & Marcos Tavares-Dias
First study on infestation of Excorallana berbicensis (Isopoda: Corallanidae) on six fishes in a reservoir in Brazilian
Amazon during dry and rainy seasons. Primer estudio de la infestación de Excorallana berbicensis (Isopoda: Corallanidae)
en seis peces en un embalse del Amazonas brasileño durante las estaciones seca y lluviosa…………....…….…936-943
Ricardo Yuji-Sado, Fernanda Raulino-Domanski, Patricia Franchi de Freitas & Francielli Baioco-Sales
Growth, immune status and intestinal morphology of Nile tilapia fed dietary prebiotics (mannan oligosaccharidesMOS). Crecimiento, estado inmunológico y morfología intestinal de la tilapia del Nilo alimentadas con prebióticos (mananoligosacáridos-MOS) en la dieta………………….………………………………………………………………..….……………….…944-952
Marcos F. Quiñones-Arreola, G. Fabiola Arcos-Ortega, Vicente Gracia-López, Ramón Casillas-Hernández, Charles Weirich,
Terry Morris, Mariana Díaz-Tenorio & Cuauhtémoc Ibarra-Gámez
Reproductive broodstock performance and egg quality of wild-caught and first-generation domesticated Seriola
rivoliana reared under same culture conditions. Desempeño reproductivo y calidad de huevos en reproductores de origen
silvestre y domesticado-F1 de jurel Seriola rivoliana bajo las mismas condiciones de cultivo………...….……………….953-962
Thiago Fernandes A. Silva, Thalita R. Petrillo, Jefferson Yunis-Aguinaga, Paulo Fernandes-Marcusso, Gustavo da SilvaClaudiano, Flávio Ruas de Moraes & Julieta R. Engrácia de Moraes
Effects of the probiotic Bacillus amyloliquefaciens on growth performance, hematology and intestinal morphometry in
cage-reared Nile tilapia. Efectos del probiótico Bacillus amyloliquefaciens en el crecimiento, hematología y morfometría
intestinal en tilapias del Nilo criadas en balsa jaula…………………….……………………..……….……..….……………….963-971
July A. Suárez, Ligia E. Urrego, Andrés Osorio & Hiara Y. Ruiz
Oceanic and climatic drivers of mangrove changes in the Gulf of Urabá, Colombian Caribbean. Controladores
oceánicos y climáticos de cambios en los manglares en el Golfo de Urabá, Caribe colombiano….….….……………….972-985
Short Communications
Felipe Becerril-Morales & Juan Pablo Alcántar-Vázquez
Atypical feminized male's agonistic behavior relative to males and females of Nile tilapia (Oreochromis niloticus L.).
Comportamiento agonístico de machos feminizados atípicos en relación a machos y hembras de tilapia del Nilo
(Oreochromis niloticus L.)……………………………………..…………….………………………………….…………….…986-992
Alfredo Borie, Natalia P.A. Bezerra, Sebastian A.L. Klarian & Paulo Travassos
Soundscape of a management and exploitation area of benthic resources in central Chile. Paisaje acústico de un área
de manejo y explotación de recursos bentónicos en Chile Central……………..……………….……..….……...……….…993-997
María Angélica Larraín, Nelson F. Díaz, Carmen Lamas, Carla Uribe, Felipe Jilberto & Cristián Araneda
Heterologous microsatellite-based genetic diversity in blue mussel (Mytilus chilensis) and differentiation among localities in southern Chile. Diversidad genética del mejillón (Mytilus chilensis) y diferenciación entre localidades del sur de
Chile usando marcadores microsatélites heterólogos….………………..……………………….….……..….……….….…998-1010
Elizabeth Labastida, Dorka Cobián, Yann Hénaut, María del Carmen García-Rivas, Pedro P. Chevalier & Salima MachkourM´Rabet
The use of ISSR markers for species determination and a genetic study of the invasive lionfish in Guanahacabibes,
Cuba. Uso de marcadores ISSR para la determinación de especies y estudios genéticos del pez león, especie invasora en
Guanahacabibes, Cuba………………………………..…………….………………………………….……..….………………1011-1018
www.lajar.cl
Libertad Alzamora-Gonzales, Carolina de Amat-Herbozo, Erasmo Colona-Vallejos, Elizabeth Cervantes-Aguilar, Richard Dyer
Velarde-Álvarez, Ronald Aquino-Ortega & Miguel Ángel Aguilar-Luis
Método rápido para la cuantificación de leucocitos sanguíneos y su utilidad en la evaluación del estado de salud en
trucha arcoíris Oncorhynchus mykiss. Rapid method for counting of blood leukocytes and its usefulness in health status
assessment of rainbow trout (Oncorhynchus mykiss) …..………….…………………………….……..….………………1019-1023
Italo Fernández, Marco Antonio Retamal, Miguel Mansilla, Francisco Yáñez, Víctor Campos, Carlos Smith, Guillermo Puentes,
Ariel Valenzuela & Hernán González
Analysis of epibiont data in relation with the Debilitated Turtle Syndrome of sea turtles in Chelonia mydas and
Lepidochelys olivacea from Concepción coast, Chile. Análisis de los datos de epibiontes en relación con el Síndrome de
Debilitamiento de Tortugas marinas en Lepidochelys olivacea y Chelonia mydas de la costa de Concepción, Chile..1024-1029
www.lajar.cl
Lat. Am. J. Aquat. Res., 43(5): 807-818, 2015 Current state of knowledge on Virilastacus species
DOI: 10.3856/vol43-issue5-fulltext-1
807
Review
Current state of knowledge on Virilastacus species
(Crustacea, Decapoda, Parastacidae)
Erich H. Rudolph1
Departamento de Ciencias Biológicas y Biodiversidad, Universidad de Los Lagos
P.O. Box 933, Osorno, Chile
1
Corresponding author: Erich H. Rudolph ([email protected])
ABSTRACT. The genus Virilastacus was created in 1991 to accommodate Parastacus araucanius Faxon, 1914.
At present, Virilastacus comprises four burrowing species, three of which were described at the beginning of
the XXI century, and biological knowledge about these species is mainly limited to taxonomic and distributional
aspects. This review compiles published information about these species, together with other data available to
the author in order to update the current state of biological knowledge and, in turn, to promote the conservation
of these species. An upgraded diagnosis of the genus Virilastacus is provided, together with information related
to each species with regard to: distinctive morphological traits, geographic distribution, habitat, burrow
morphology, burrowing behavior, body size, sexual system, and state of conservation. Some aspects related to
morphological adaptations to their burrowing life style, phylogenetic affinities and main threats to conservation
are also discussed. It is concluded that biological knowledge about these four species is scarce and fragmentary;
furthermore, they are currently under threat as a result of anthropogenic activities that are degrading and
fragmenting their habitat.
Keywords: Virilastacus, burrowing crayfish, morphology characters, geographic distribution, sexual system,
habitat, conservation status, Chile.
Estado de conocimiento de las especies de Virilastacus
(Crustacea, Decapoda, Parastacidae)
RESUMEN. El género Virilastacus fue creado en 1991 para ubicar a Parastacus araucanius Faxon, 1914.
Actualmente Virilastacus reúne a cuatro especies excavadoras, tres de ellas descritas a comienzos del siglo XXI,
cuyo conocimiento biológico se circunscribe principalmente a aspectos taxonómicos y distribución. Esta
revisión recopila la información publicada de estas especies, junto a otros datos accesibles al autor, para
actualizar el conocimiento biológico y a la vez promover su conservación. Se proporciona una diagnosis
actualizada del género, y de cada especie se entrega información sobre: rasgos morfológicos distintivos,
distribución geográfica, hábitat, morfología de las galerías, comportamiento excavador, tamaño corporal,
sistema sexual y estado de conservación. También se comentan algunas de las adaptaciones morfológicas a su
estilo de vida excavador, sus afinidades filogenéticas y las principales amenazas a su conservación. Se concluye
que el conocimiento biológico de estas cuatro especies es escaso y fragmentario, y que ellas se encuentran
amenazadas por actividades antropogénicas que están degradando y fragmentando su hábitat.
Palabras clave: Virilastacus, camarones excavadores, caracteres morfológicos, distribución geográfica, sistema
sexual, hábitat, estado de conservación, Chile.
INTRODUCTION
At the beginning of the XX century, 10 species of the
family Parastacidae had been described for South
America, all grouped within one genus: Parastacus.
Riek (1971) separated them into the genera Samastacus
_______________________
Corresponding editor: Ingo Wehrtmann
and Parastacus; he assigned two species [Parastacus
spinifrons (Philippi, 1882) and Parastacus araucanius
Faxon, 1914] to the genus Samastacus, in view of the
following characteristics: P1 dactyls moving horizontally and phallic papillae being relatively long,
articulated tubular projections. The other species, whose
808
dactyls move vertically and phallic papillae are only
small non-articulated protuberances, remained within
Parastacus. Additionally, Riek (1971) characterized
these genera in ecological terms: the Parastacus
species as burrowers and inhabitants of underground
waters, while the Samastacus species were characterized as weak burrowers, inhabiting rivers and lakes.
After a period of 69 years, during which the only
knowledge about Samastacus araucanius (Faxon,
1914) was based on the type specimen, Jara (1983)
collected a second specimen, a male captured in the
Botanical Gardens of the Universidad Austral de Chile
(Valdivia), cohabitating with Parastacus nicoleti
(Philippi, 1882). Rudolph & Rivas (1988) collected the
third representative of this species, also a male in
Hualqui (Concepción) cohabiting with Parastacus
pugnax (Poeppig, 1835). These discoveries provided
sufficient evidence to exclude the occurrence of S.
araucanius in open waters, as had been suggested in
Faxon’s (1914) description of the location where the
type material was obtained: “in a waterfall in Corral”.
Based on this evidence, as well as on morphological
differences [which were already mentioned by Jara
(1983) and Rudolph & Rivas (1988)], Hobbs (1991)
separated these two species into the genera Samastacus
(S. spinifrons) and Virilastacus (V. araucanius); this
author also provided diagnoses of the three South
American genera of Parastacidae. Crandall et al. (2000)
validated these three genera, based on the sequencing
of 500 nucleotides of the 16S mitochondrial DNA gene
in seven of the ten species of South American
parastacids. Rudolph & Crandall (2005, 2007, 2012)
described three new species of Virilastacus, extended
their geographic range, and confirmed that all the
species of this genus were burrowers. In the present
review, the scarce information published on the
Virilastacus species is compiled and systematized,
together with other data available to the author, with the
aim to update the biological knowledge about this
species and, in turn, to promote effective conservation
measures.
Family Parastacidae Huxley, 1879
Genus Virilastacus Hobbs, 1991
Diagnosis
Rostrum short. Carapace lacking spines, tubercules and
postorbital ridges; anterolateral portion of branchiocardiac groove clearly separated from the portion
subparallel to cervical groove, which is located close to
upper third portion of cephalothorax. Viewed dorsally,
cervical groove V-shaped, except in V. retamali. Pleon
lacking spines and tubercles; pleura of first abdominal
segment distinct from and partly overlapped by that of
the second abdominal segment. Telson without
transverse suture and wholly calcified; posterior half
with dorsomedian longitudinal groove. Ventral surface
of ischipodite of third maxilliped bearing a median
longitudinal band of tubercules; inside half of this
surface with tufts of rigid setae; distolateral end of
podomere rounded, except in V. jarai; merus lacking
spines or tubercules; exopodite reaches distal end of
merus. Caudal molar process of mandible quadricuspid
in V. araucanius and V. jarai; tricuspid in V.
rucapihuelensis and V. retamali; nodular cusp on
proximal margin of cuspidal triangle. P1 chelae
dimorphic, with almost completely tuberculated palms,
but lacking spines or large tubercules; ventrolateral
borders tuberculated to slightly subtoothed; carpus
lacking large tubercules medially or ventrally, when
upper surface held in a horizontal plane, dactyl moving
obliquely in V. rucapihuelensis and V. jarai, and
subhorizontally in V. araucanius and V. retamali. No
occurrence of male and female gonopores in the same
individual, except in V. rucapihuelensis. Male genitalia
with a semi-rigid, tubular, thin, articulated, and very
long phallic papilla extending forward from coxae in
very close proximity to each other; lacking male cuticle
partition, except in V. rucapihuelensis. Sternite XIII
with an anterior medial plate, and posterior orifice.
Viewed caudally, lateral processes of sternite XIV
separated by a pronounced vertical fissure.
Type species. Parastacus araucanius Faxon, 1914: 553
Gender: Male
Etymology. From the Latin virilis = masculine; socalled because of its comparatively long phallic papilla
(Hobbs, 1991; Rudolph & Crandall, 2012).
Virilastacus araucanius (Faxon, 1914) (Fig. 1a)
Common name: Dwarf crayfish
Synonymy
Parastacus araucanius Faxon, 1914: 353, pp. 4, Figs.
1-3; Van Straelen, 1942: 9; Holthuis, 1952: 84;
Bahamonde & López, 1963: 126 and 127, maps 1 and
2; Jara, 1983: R-163.
Samastacus araucanius Riek, 1971: 135; Manning &
Hobbs, 1977: 159; Rudolph & Rivas, 1988: 73, Fig. 1;
Hobbs, 1989: 80, Fig. 374; Buckup & Rossi, 1993: 167,
Figs 11-13; Martínez et al., 1994: 9, Figs. 1-11.
Distinctive morphological characteristics
Cephalothorax smooth, coloration: olive green. Small
eyes. Rostrum short, reaching distal end of middle
podomere of antennal flagellum; dorsally excavated.
Rostral carina long and slightly prominent. Cervical
groove weakly “V” shaped. Areola narrow and
extended. Antennal scale short with one small
distolateral spine. Basal podomere of antennula lacking
809
Figure 1. Virilastacus araucanius (Faxon, 1914). a) Dorsal view of male. Scale bar = 17.9 mm, b) partial view of habitat,
c) overhead view of chimneys. Photos: E. Rudolph.
spines. Opposable margin of propodite without pilosity,
bearing 11 to 18 teeth; dactyl moving sub horizontally,
opposable margin bearing nine to 15 teeth. Individuals
with female or male gonopores. Elongated phallic
papilla reaches base of lateral process of XII body
segment. In males, P5 coxae lack cuticle partition.
Pleon coloration light brown. Telson subrectangular,
dorsomedian longitudinal groove, and prominent spine
on each lateral border (Faxon, 1914; Riek, 1971;
Hobbs, 1991; Rudolph & Crandall, 2012). Species
relatively small. The largest specimen caught is a
female, measuring 28.7 mm cephalothorax length (CL)
(74.8 mm total length). The smallest specimen
collected is also a female, 18.3 mm CL (Martínez et al.,
1994). In the case of males, maximum and minimum
sizes recorded are 26.0 and 19.0 mm CL respectively
(Faxon, 1914; Jara, 1983). A summary of distinctive
morphological features of the four species of
Virilastacus is provided in Table 1.
Geographic distribution
V. araucanius has been recorded from areas
surrounding Concepción (36°46’22”S, 73°03’47”W),
Valdivia (39°48′30″S, 73°14′30″W), and Maicolpué
(40°36’27,74”S, 73°44’01,44”W) (Faxon, 1914; Jara,
1983; Rudolph & Rivas, 1988; Hobbs, 1991; Martínez
et al., 1994; Bahamonde et al., 1998). This discontinuous distribution may only be apparent, since it
coincides with the presence of university research
centers in these three areas (Jara et al., 2006).
Nevertheless, recordings of V. araucanius in Maicolpué
(Bahamonde et al., 1998) should be reviewed, given
that they may correspond to specimens of either V.
rucapihuelensis or V. retamali, described after the
studies of Bahamonde et al. (1998), in a location
(Rucapihuel) situated only 15 km from Maicolpué.
Finally, recordings of V. araucanius suggest that it is
distributed between the coast and the Coastal Cordillera
mountain range; the extent of occurrence is estimated
at 11.571,64 km2 (Ministerio del Medio Ambiente,
2013a).
Habitat
V. araucanius inhabits underground waters in
topographic basins with evergreen lowland forest
associations. Almost all recordings of this species occur
in these biotopes, commonly referred to as “vegas” or
“hualves” (Fig. 1b). Only the discovery of V.
araucanius in the Botanical Gardens of the Universidad
Austral de Chile in Valdivia (Jara, 1983; Hobbs, 1991)
indicates its presence in flatter zones, subject to
considerable anthropic intervention. Specimens of this
species have also been found coexisting with P. nicoleti
(Jara, 1994; Jara et al., 2006) in the same Botanical
Gardens. A similar situation occurs in the locality of
Hualqui (46o56´S, 72o55´W), where specimens of V.
araucanius have been found cohabiting with P. pugnax
(Rudolph & Rivas, 1988).
Burrow morphology
The burrows constructed by V. araucanius are shallow
(<1 m), but quite complex, with multiple ramifications,
many of them almost parallel to the surface, which
complicates their capture, whether manually or by
suction methods. In winter, V. araucanius constructs
mud “chimneys” 2.0-6.0 cm high, located around the
entrance orifices of their burrows (Jara, 1994) (Fig. 1c).
According to the classification of burrowing crayfish
810
proposed by Hobbs (1942), V. araucanius would be a
primary burrower, since it builds complex burrows are
not connected to permanent water bodies, and the entire
life cycle of this species occurs inside the burrows.
Sexual system
Descriptions of external sexual characteristics, together
with some anatomical analyses of gonads and
gonoducts, suggest that V. araucanius is a gonochoric
species. Adult females have ellipsoidal gonopores,
partially surrounded by setae and covered by a noncalcified membrane. These characteristics, suggesting
the occurrence of functional gonopores, are very
similar to those observed in V. rucapihuelensis adult
females (Rudolph et al., 2007). Males have an
elongated, calcified phallic papilla ( = 3.1 ± 0.4 mm;
n = 12) and the respective gonopore opens at the apical
end (Rudolph & Rivas, 1988; Hobbs, 1991; Martínez et
al., 1994; Rudolph & Almeida, 2000).
Conservation status
Bahamonde et al. (1998) categorized V. araucanius as
Insufficiently Known throughout its entire geographic
range. Nevertheless, they warned that water pollution
and substrate modification within its distribution area
could cause negative effects on the conservation of
these populations. Rudolph & Crandall (2007) classified the species as Vulnerable through its geographic
distribution range, based on the B1ab (iii) criteria of the
IUCN Red List (2001). Buckup (2010a) classified it as
Data Deficient. The Ministerio de Medio Ambiente
(2013a) described it as Vulnerable, in accordance with
the B1ab (iii) + 2ab (iii) criteria of the IUCN Red List
(2001). Finally, Almerao et al. (2014) also endorsed
this latter categorization.
Virilastacus rucapihuelensis Rudolph & Crandall,
2005 (Fig. 2a)
Common name: Vega crayfish
Synonym: Virilastacus araucanius Rudolph & Rojas,
2003: 835, Figs. 1-8
Cephalothorax with small tubercles only in
anteroventral regions of branchiostegites. Small eyes.
Rostrum short, reaching distal margin of basal
podomere of antennal flagellum; dorsally concave.
Rostral carina long and prominent. Epistome anteromedian lobe resembles a triangle. Cervical groove “V”
shaped. Basal podomere of antennula with small spine.
Dorsal surface of P1 carpus with faint median groove,
opposable margin of propodite bearing 5 to 9 teeth with
pilosity on both sides, but only of their proximal group,
dactyl moving obliquely. Abdominal pleura ventral
Figure 2. Virilastacus rucapihuelensis Rudolph &
Crandall, 2005. a) Dorsal view of specimen. Scale bar =
14.0 mm, b) partial view of habitat. Photos: E. Rudolph.
margins almost straight. Individuals with supernumerary gonopores. In adult females, pleura of second
pleomere with wide anteroventral flap, weakly
calcified. Males with slightly elongated phallic papillae
that reach the base of the P4 coxae. In males, P5 coxae
with cuticle partition. Telson subrectangular, lateral
margins almost parallel, each of them with a small,
blunt spine. Light brown body coloration (Rudolph &
Crandall, 2005, 2012). This species is slightly larger
than V. araucanius. The largest specimen collected
(33.6 mm CL) is an intersex individual in female phase
and the smallest, a primary female with 4.4 mm CL
(Rudolph et al., 2007) (Table 1).
This species has been reported from five nearby sites in
the Coastal Cordillera of the province of Osorno,
southern Chile: Rucapihuel (40°35’00.64”S, 73°34’42.
96”W), Coiguería (40°35’17.62”S, 73°32’10.00”W),
Carrico (40°35’34.14”S, 73°31’19.70”W), Contaco
(40°36’01.50”S, 73°31’00.97”W), and Loma de la
Piedra (40°40’13.59”S, 73°30’51.42”W) (Rudolph &
Crandall, 2005; Grosso & Peralta, 2009). The extent of
811
Table 1. Morphological characters useful for distinguish the four presently identified species of Virilastacus (Modified
from Rudolph & Crandall, 2012).
Character
V. araucanius
V. rucapihuelensis
V. retamali
V. jarai
Excavated
Long and not very
prominent
Small
Short. Distolateral
spine small
Spine absent
Concave
Long and prominent
Concave
Short and prominent
Small
Short. Distolateral
spine small
Small spine
Large
Long. Distolateral
spine large
Large spine
Concave
Short and
little prominent
Small
Short. Distolateral
spine small
Large spine
Molariform
Quadricuspide
Dentiform
Tricuspide
Molariform
Tricuspide
Molariform
Quadricuspide
Resembles a rhombus
With anterolateral
tubercles small
Resembles a triangle
With anterolateral
tubercles small
Resembles a rhombus
With anterolateral
tubercles large
Resembles a rhombus
With anterolateral
tubercles large
External distal border
With a band of small,
blunt tubercules and
scarce pilosity
Without extension
With a band of
small, blunt tubercles
and scarce pilosity
Without extension
With a band of large,
prominent tubercles
and abundant pilosity
Without extension
With a band of small,
blunt tubercles and
abundant pilosity
With a large extension
Opposable Propo margin
Pilosity
Absent
Only on both sides of
the proximal group
of teeth
On both sides of
the entire row of teeth
Number of teeth
Between 11 and 18
Between 5 and 9
Between 13 and 17
Throughout the dorsal
side and only on the
basal zone of the
ventral side
Between 11 and 22
Dactylus
Movement
Number of teeth
Precervical cephalothorax
Subhorizontal
Between 9 and 15
Dorsal ridges absent
Oblique
Between 5 and 10
Dorsal ridges absent
Subhorizontal
Between 10 and 15
With 4, smooth
dorsal ridges
Narrow and extended
Weakly V-shaped
Close together
Female or male
In close proximity,
long and thin
Absent
Narrow and extended
Strongly V-shaped
Widely separated
Supernumerary
Widely separated, more
robust and shorter
Present
Wide and short
U-shaped
Close together
Female or male
Very close together,
very long and thin
Absent
Oblique
Between 9 and 15
With 4 smooth dorsal
ridges, or with 2, or
absent
Wide and extended
Strongly V-shaped
Close together
Female or male
Very close together,
long and thin
Absent
With a small anterior
lobe, partially overlapped by the S2 pleuron
Anterior lobe absent,
not overlapped by
S2 pleuron
Flap absent
Flap present
lobe, partially
overlapped by the S2
pleuron
Flap absent
lobe, total or partially
overlapped by S2
pleuron
Flap absent
Subretangular
Prominent and sharp
Semi-marshland,
perennially green areas
Subretangular
Small and blunt
Semi-marshland,
perennially green areas
Subtriangular
Prominent and sharp
Peatlands
Subtriangular
Small and sharp
Fragment semimarshland, perennially
green areas
Rostrum
Dorsodistal surface
Rostral carina
Eyes
Antennal scale
Basal Podomere Antennula
Mandible
Cephalic molar process
Caudal molar process
Epistome
Anteromedial lobe
Posterior plate
Ischium of Maxilliped 3
Ventral surface
Areola
Cervical groove
P4 Coxae
Gonopores
Phallic Papillae
Male Cuticle Partition
Pleomere pleura
Somite 1
Somite 2 of the adult females
Telson
Form
Lateral spines
Habitat
812
their occurrence covers 39.3 km2 (Ministerio de Medio
Ambiente, 2013b).
Habitat
V. rucapihuelensis inhabits underground waters in
biotopes locally called “vegas” or “hualves” (Rudolph
& Crandall, 2005) (Fig. 2b). The soil profile of the
“vegas” located in Rucapihuel includes two layers
composed of fine clay sand. The upper layer comprises
abundant iron oxides, the lower layer (80 cm below the
soil surface) is of sandy gravel. In the winter, the
phreatic level is close to or above the surface, and in
summer, it descends as far as 1.0 or 1.5 m below the
surface (Bedatou et al., 2010). After carrying out yearround monthly recordings of some physicochemical
parameters of the water inside the burrows, Martínez
(2005) verified that temperature fluctuated between 11
y 19°C, pH between 4.1 and 5.3, and dissolved oxygen
between 2.6 and 6.5 mg L-1; on the other hand, total
hardness remained constant at 17.8 ppm de CaCO3.
Burrow morphology and burrowing behavior
The burrow morphology is variable. Some have several
relatively complex entrance orifices (diameter 2.5-3.5
cm) with multiple ramifications in the subsoil. Some of
these connected to a terminal chamber with a slightly
larger diameter than the tunnel, situated between 1 and
1.2 m below the surface. Others are blind tunnels (Type
1 burrow, Fig. 3a). Other burrows have only one
subvertical tunnel (3 to 4.5 cm diameter and up to 66
cm depth) with a few blind tunnels emerging from the
uppermost section. The lower terminal section of this
system is a sub-horizontal chamber with a slightly
wider diameter than the tunnel (Bedatou et al., 2010)
(Type 2 burrow, Fig. 3b). V. rucapihuelensis forms
small pellets (8-10 mm maximum diameter) from the
excavated material, and these pellets are deposited in
the winter around the entry orifices of the burrows,
forming “chimneys” of up to 12 cm height (Rudolph &
Crandall, 2005) (Fig. 3c), these burrows are usually
inhabited by one specimen; nevertheless, in springsummer, it may be possible to find a female with a
variable number of recently released juveniles in some
of these burrows. According to Hobbs´ (1942)
classification, aspects such as excavating complex
burrows, distanced from permanent water bodies,
together with no recordings of specimens outside the
burrows, suggest that this species can be considered as
a primary burrower.
Sexual system
V. rucapihuelensis presents partial protandric hermaphroditism with primary males and females (Rudolph
Figure 3. Virilastacus rucapihuelensis Rudolph &
Crandall, 2005. a) Lateral view of mould type 1 burrow,
b) lateral view of mould type 2 burrows, c) overhead view
of chimney. Arrowheads = surface entrances. Photos:
a) and b) E. Bedatou; c) E. Rudolph.
et al., 2007). Depending on the presence or absence of
gonopores in the P3 and P5 coxae; externally, six
sexual forms may be distinguished. Anatomical
analyses of the gonads and gonoducts of these sexual
forms enabled us to ascertain the presence of three basic
sexual types: primary males, primary females, and
intersex specimens. These latter comprise one malephase and two female-phase forms, that would originate from male-phase intersex individuals (Rudolph et
al., 2007).
Fecundity
The species produced up to 74 eggs, incubated by a
primary female of 27.9 mm CL. The lowest fecundity
(three eggs) observed was in a primary female of 23.1
mm CL (Rudolph et al., 2007).
Conservation status
Rudolph & Crandall (2007), based on the B1 ab (iii)
criteria of the IUCN Red List (2001), classified V.
rucapihuelensis as Endangered in its entire distribution
range, while Buckup (2010b) classified it as Data
Deficient. The Ministerio de Medio Ambiente (2013b)
classified it as Endangered, maintaining that it meets
the B1 ab (iii) + 2ab (iii) criteria of the IUCN Red List
(2001). Finally, Almerao et al. (2014) suggested that V.
rucapihuelensis is Critically Endangered, considering
that it falls within the B1 ab (iii) criteria associated with
this category.
813
Figure 4. Virilastacus retamali Rudolph & Crandall, 2007. a) Dorsal view of specimen. Scale bar = 12.0 mm, b) partial
view of habitat, c) lateral view of chimney. Photos: E. Rudolph.
Virilastacus retamali Rudolph & Crandall, 2007
(Fig. 4a)
Common name: Peatland crayfish
Precervical cephalothorax with four smooth ridges.
Eyes comparatively large. Rostrum short reaches distal
margin of middle podomere of antennal flagellum;
dorsally concave. Rostral carina short and prominent.
Cervical groove “U” shaped. Areola wide and short.
Antennal scale long with large distolateral spine.
Epistome anteromedian lobe resembling a rhombus.
Basal podomere of antennula with large spine.
Opposable margin of P1 propodite bearing 13 to 17
teeth, with pilosity on both sides of the row of teeth.
Dactyl moving subhorizontally. Abdominal pleura with
rounded ventral margins. Telson with converging
lateral margins resembling a triangle, with prominent,
sharp marginal spines. Individuals with female or male
gonopores. Phallic papillae very elongated, reaching as
far as the base of the P3 coxae. Males without cuticular
partition in P5 coxae. Cephalothorax dark-olive green
and pleon light olive green (Rudolph & Crandall, 2007,
2012). Species is small (17.9-30.0 mm CL; = 21.1 ±
3.0 mm CL; n = 21), but the only size data available
derives from the type series specimen (Rudolph &
Crandall, 2007) (see Table 1).
This parastacid, recorded in two Coastal Cordillera
localities in the provinces of Osorno and Llanquihue,
southern Chile: Rucapihuel (40º35’00.08”S, 73º34’
44.3”W), and Estaquilla (41º25’15.93”S, 73º46’51.
74”W) (Rudolph & Crandall, 2007) extends its
occurrence approximately 3.200 km2 (Rudolph, 2010).
Habitat
Both of these V. retamali populations inhabit
geogenous peatlands, i.e., depend on rainwater and
superficial underground waters to supply hydric needs
(Kulzer & Cook, 2001). These peatlands originated in
a small endorreic basin generated by the holocenic
deglacialization where, over the course of time, organic
matter has been deposited (Grignola & Ordoñez, 2002).
This organic material originated from the partially
decomposed, loosely compacted vegetal remains of the
genus Sphagnum, mixed with woody fragments,
gramineous and humus particles, accumulated in an
anoxic environment, highly saturated with water all
year round (Grignola & Ordoñez, 2002) (Fig. 4b). On
capturing the type series, (17 December 2002), the
water analyzed inside the burrows had a pH of 4.7,
dissolved oxygen of 2.8 mg L-1, constant hardness of
17.8 ppm of CaCO3, and a temperature of 12.5ºC
(Rudolph & Crandall, 2007).
Burrow morphology
Virilastacus retamali excavates shallow burrows (45
cm depth approximately) with few ramifications. A
mold made with polyester resin (Bedatou et al., 2010)
revealed six main entrances, with diameters ranging
from 3.0 to 3.5 cm. Fifteen centimeters below the
surface, three of these entrances converged into a short,
subhorizontal tunnel; one of its ends projected slightly
upwards to form a short blind tunnel; the other extreme
is connected to a main sub-horizontal tunnel. The
remaining three entrances converged at a depth of 30
cm, at the other end of the main tunnel. In the winter,
the species constructs “chimneys” reaching an average
height of 3.9 cm (SD = ± 0.729; n = 8) (Fig. 4c). Unlike
the other species of the genus, V. retamali has been
observed and captured outside its burrows, in nearby
814
surface pools. Based on these observations and
according to Hobbs´s criteria (1942), V. retamali can be
categorized as a secondary burrowing species (Rudolph
& Crandall, 2007).
Sexual system
No external morphological evidence of intersexuality
has been detected in the type series (Rudolph &
Crandall, 2007), suggesting that this species is
gonochoric. Females smaller than 20.0 mm CL have
strongly calcified semi-ellipsoidal gonopores, while
females larger than 20.0 mm CL have apparently
functional ellipsoidal gonopores, given that they are
only partially calcified and surrounded by abundant
pilosity. Males have a very elongated phallic papilla
( = 3.5 ± 0.5 mm) (Rudolph & Crandall, 2007).
Conservation status
Rudolph & Crandall (2007) classified V. retamali as an
Endangered throughout its entire geographic range,
given that it would meet the B1 ab(iii) criteria of the
IUCN (2001) Red List for this category. Nevertheless,
Buckup (2010c) classified it as Data Deficient, while
Almerao et al. (2014) supported the endangered species
classification of Rudolph & Crandall (2007).
Virilastacus jarai Rudolph & Crandall, 2012 (Fig. 5a)
Common name: Angeline crayfish
Precervical cephalothorax with four, two or lacking
smooth dorsal ridges. Eyes small. Rostrum short,
reaching distal margin of the middle podomere of
antennal flagellum; dorsally concave. Rostral carina
short, weakly prominent. Epistome anteromedial lobe
resembling a rhombus. Cervical groove “V” shaped.
Areola wide and extended. Opposable margin of P1
propodite bearing 11 to 22 teeth with pilosity along the
length of dorsal side, while only on basal part of ventral
side. Dactyl moving obliquely. Abdominal pleura with
straight ventral margins. Telson subtriangular with a
small, sharp spine in each lateral margin. Individuals
with female or male gonopores. Phallic papillae
elongated, reaching base of lateral process of XII body
segment. Males lacking cuticular partition in P5 coxae.
Cephalothorax and P1 chelipeds olive green. Pleon and
caudal fan light brown (Rudolph & Crandall, 2012). It
is a small species; size in the type series ranges from
6.7 to 24.8 mm CL ( = 17.5± 6.1 mm) (Rudolph &
Crandall, 2012) (see Table 1).
Virilastacus jarai has only been recorded in the type
locality, a fragment of wetland situated in the “El
Porvenir” sector (37º26’39.84”S, 72º18’37.12”W), 1.5
km northwest of the town of Los Ángeles in centralsouthern Chile (Rudolph & Crandall, 2012).
Habitat
The species inhabits the underground waters of a
fragment of semi-marshland, located in a topographic
basin of 861 m2 at 152 m above sea level. This area is
flooded for six months of the year (May to October) and
the phreatic level remains below the surface in springsummer (Fig. 5b). The soil, characterized by a large
accumulation of organic material, in addition to the
high percentage of moisture originating from partially
decomposed vegetal remains. On capturing the type
series (13 June 2010), analysis of the water inside the
burrows was as follows: dissolved oxygen = 4.9 mg L-1,
temperature = 14.1ºC, pH = 6.5, and constant hardness
of 53.4 ppm of CaCO3 (Rudolph & Crandall, 2012).
Burrowing behavior
The species excavates shallow (<1 m), but complex
burrows, not connected to lothic or lenthic waters
(Rudolph & Crandall, 2012). In winter, it also
constructs “chimneys” around the entrance orifices of
the burrows (Fig. 5c). Outside the burrows, no
specimens have been found, which suggest that the
entire life cycle of V. jarai occurs inside the burrows.
According to the Hobbs´s (1942) criteria, the species
can be considered as a primary burrower.
Sexual system
The revision of the type series revealed the occurrence
of an intersex individual; however, this is not sufficient
evidence to maintain that this is a transitional stage of
an eventual sex change or, even less likely, that the
species presents some form of hermaphroditism.
Consequently, the evidence available suggests that V.
jarai would be a gonochoric species (Rudolph &
Crandall, 2012).
Conservation status
Rudolph & Crandall (2012) categorized V. jarai as
Critically Endangered. This conclusion was based on
the B1ab (ii) criteria of the IUCN Red List (2001) for
this category, i.e., an estimated extent of occurrence of
less than 100 km2, only known recording in one
location, and a projected decline in habitat quality. The
V. jarai habitat has been subject to deforestation in the
recent past to clear land for agricultural purposes. At
present, this land has been divided up and the
topography modified to accommodate building development projects resulting from the rapid expansion of
the town of Los Ángeles. Almerao et al. (2014)
endorsed categorizing V. jarai as a critically endangered species.
815
Figure 5. Virilastacus jarai Rudolph & Crandall, 2012. a) Dorsolateral view of specimen. Scale bar = 9.0 mm, b) partial
view of habitat, c) lateral view of chimney. Photos: E. Rudolph.
REMARKS
The four Virilastacus species are endemic to Chile and
have a restricted geographic range, distributed between
the coastline and the Coastal Cordillera, from
Concepción (36o46’S) to Estaquilla (41o25’S), except
for V. jarai, whose presence has only been recorded in
one location, to the east of the coastal Cordillera (Fig.
6). Furthermore, within this coastal fringe, populations
present a clearly discontinuous distribution, associated
with wetlands. These species are burrowers, and
although their burrows are shallow (<1.5 m), have
multiple ramifications and are much elaborated
(Bedatou et al., 2010). The most significant
morphological adaptations to this life style include the
following aspects: (1) body without large
protuberances, facilitating their movement inside the
tunnels; (2) highly developed cephalothorax, in
comparison to the scarcely developed pleon; (3)
cephalothorax taller than broad, which increases the
volume of the branchial chamber and makes it possible
to house larger branchia than those species that inhabit
open waters; (4) P1 chelae relatively large and
vertically orientated, and (5) reduced eye size
(Rudolph, 1997; Reynolds et al., 2013). They also share
some biological characteristics of all freshwater
astacids (Families Astacidae, Cambaridae and
Parastacidae) such as: low fecundity, direct development with hatching in the juvenile stage, extended
parental care up to the second juvenile stage, as well as
omnivorous feeding habits (Rudolph & Rojas, 2003;
Rudolph, 2013). Like the other species of these three
families, they are very important functional elements in
the linmic ecosystems, both as prey and as consumers
(Jara et al., 2006; Almerao et al., 2014). Nevertheless,
Figure 6. Geographical distribution of Virilastacus
species. Gray fringe = Virilastacus araucanius; ● Virilastacus jarai; □ Virilastacus rucapihuelensis;▐ Virilastacus
retamali.
816
biological knowledge about these species is limited
mainly to taxonomic and distributional aspects, with
some information about their sexual system. Three of
the four species have separate sexes while V.
rucapihuelensis presents partial protandric hermaphroditism, with primary males and females (Rudolph
et al., 2007). Similarly, some information has been
acquired about their phylogenetic affinities (Rudolph &
Crandall, 2007, 2012). Reconstruction of phylogenetic
relationships revealed the monophyly of the
Virilastacus genus and of each one of its species.
Furthermore, they showed that there is clear genetic
differentiation between V. jarai and the other species of
the genus. Virilastacus jarai is situated in a different
basal clade with respect to the clade of the other three
species, with V. araucanius being the species
phylogenetically closest to V. jarai. Moreover, the
incubation period of V. rucapihuelensis and probably
that of the other three species extends from mid-winter
to mid-summer (from July to February) (Rudolph et al.,
2007). Recently, the Ministerio del Medio Ambiente
(2013a, 2013b) and Almerao et al. (2014), based on the
IUCN (2001) Red List criteria, have reevaluated and
updated the state of conservation of Chilean and South
American parastacids, respectively. Notwithstanding
these updates, no effective measures for their protection
have been implemented yet and, as a result, the
conservation of the Virilastacus species is still under
threat. Included among these threats are: (1) drainage
of the “vegas” for forestry, farming and livestock
development; (2) use of chemicals (agricultural
fertilizers and pesticides); (3) clearing of vegetation and
subsequent replacement of vegetation coverage; (4)
free-range pig farming, which removes the original
vegetation and compacts the soil, and (5) cattle
farming, with trampling and destruction of the burrows.
These threats are degrading, fragmenting, and
ultimately decreasing the geographical extension of
their habitat. Furthermore, certain intrinsic characteristics of parastacids [i.e., slow growth, low
fecundity, delayed sexual maturity and long periods of
embryonic and early post-embryonic development
(Holdich, 1993; Rudolph, 2013)], together with the
restricted geographic range and scarce mobility of the
Virilastacus species, render them particularly
vulnerable to the aforementioned threats. At present,
the Chilean parastacids in general, and the Virilastacus
species in particular, are not threatened by invasive
exotic species (Rudolph, 2013). However, this threat
could materialize in the near future, if we consider that
Procambarus clarkii (Girard, 1852), a species native to
North America and with considerable adaptive
plasticity, has been introduced successfully to almost
all continents, and has already been recorded in
Colombia, Ecuador and Brazil (Valencia-López et al.,
2012; Almerao et al., 2014). Furthermore, recent
studies revealed numerous areas in the southern cone of
South America (Argentina, Paraguay, Uruguay, and
Chile) suitable for P. clarkii occupation (Palaoro et al.,
2013). Fortunately, these four species are not under
threat from fishery activities for human consumption,
because they are small species whose edible part (the
pleon) is underdeveloped, thus, meat yield is very
meager; these species also construct very complex
burrows and considerable effort is required to capture
them. Finally, part of their geographic range is located
to the south of the Toltén River (39oS), where the local
inhabitants have no tradition of consuming these types
of crustaceans. Could this lack of socio-economic
significance account for the lack of legislation
regulating their protection? Probably not considering
that other Chilean parastacids exposed to elevated
extraction pressure for human consumption purposes
(i.e., Samastacus spinifrons and Parastacus pugnax)
and neither is protected. Minimum biological
knowledge (distribution range, habitat type, life style,
size, incubation period, and state of conservation)
necessary to establish regulations is now available.
Legislation in this respect, together with regulating
compliance with the law, would greatly contribute
towards the conservation of Chilean parastacids. It is
believed that protection of these species can be
achieved, considering that the Ministry of Environment
has announced a series of measures in both the National
Plan of Action on Climate Change and the draft law for
the creation of a Biodiversity and Protected Areas
Service.
ACKNOWLEDGEMENTS
The author is grateful to the Research Department of
the Universidad de Los Lagos, Osorno, Chile, for
financially supporting many of the studies carried out
on Virilastacus, in addition to the publication of this
article. The collaboration of Susan Angus with the
translation of the paper is appreciated.
REFERENCES
Almerao, M.P., E. Rudolph, C. Souty-Grosset, K.
Crandall, L. Buckup, J. Amouret, A. Verdi, S. Santos
& P.B. Araujo. 2014. The native South American
crayfishes (Crustacea, Parastacidae): state of
knowledge and conservation status. Aquat., Conserv.
Mar. Freshw. Ecosyst., 25(2). doi: 10.102/aqc.2488.
Bahamonde, N. & M.T. López. 1963. Decápodos de aguas
continentales en Chile. Invest. Zool. Chil., 10: 123149.
Bahamonde, N., A. Carvacho, C. Jara, M. López, F.
Ponce, M.A. Retamal & E. Rudolph. 1998. Categorías
de conservación de decápodos nativos de aguas
continentales de Chile. Bol. Mus. Nac. Hist. Nat., 47:
91-100.
Bedatou, E., E. Rudolph, J.F. Genise, M. González & R.N.
Melchor. 2010. Architecture of burrows of extant land
crayfishes from south-central Chile. Workshop on
Crustacean Bioturbation - Fossil and Recent. Lepe,
Spain, May 31-June 4, 2010, pp. 7-10.
Buckup, L. 2010a. Virilastacus araucanius. IUCN 2013.
IUCN Red list of threatened species. Version 2013.2.
Buckup, L. 2010b. Virilastacus rucapihuelensis. IUCN
2013. IUCN Red list of threatened species. Version
2013.2.
Buckup, L. 2010c. Virilastacus retamali. IUCN 2013.
IUCN Red list of threatened species. Version 2013.2.
Buckup, L. & A. Rossi. 1993. Os Parastacidae do espaço
meridional Andino (Crustacea, Astacidea). Rev. Bras.
Biol., 53: 167-176.
Crandall, K.A., J.W. Fetzner, C.G. Jara & L. Buckup.
2000. On the phylogenetic positioning of the South
American freshwater crayfish genera (Decapoda:
Parastacidae). J. Crustacean Biol., 20: 530-540.
Faxon, W. 1914. Notes on the crayfishes in the United
States National Museum and the Museum of
Comparative Zoology, with descriptions of new
species and subspecies, to which is appended a
catalogue of the known species and subspecies. Mem.
Mus. Comp. Zool., Harv., 40: 347-427.
Grignola, P. & A. Ordoñez. 2002. Perspectivas de
utilización de los depósitos de turba de la isla de
Chiloé. Décima Región de Los Lagos, Chile. Simposio
Internacional de Geología Ambiental para
Planificación del uso del Territorio, Puerto Varas, pp.
35-37.
Grosso, L.E. & M. Peralta. 2009. A new Paraleptamphopidae (Crustacea, Amphipoda) in the burrow of
Virilastacus rucapihuelensis (Parastacidae) and
surrounding peat bogs. Rudolphia macrodactylus n.
gen., n. sp. from southern South America. Zootaxa,
2243: 40-52.
Hobbs, H.H. 1942. The crayfishes of Florida. U. Fla. Publ.
Biol. Ser., 3: 1-79.
Hobbs, H.H. 1989. An illustrated checklist of the
American
crayfishes
(Decapoda:
Astacidae:
Cambaridae, and Parastacidae). Smithson. Contrib.
Zool., 480: 1-236.
Hobbs, H.H. 1991. A new generic assignment for a South
American crayfish (Decapoda, Parastacidae) with
revised diagnoses of the South American genera and
comments on the parastacid mandible. Proc. Biol. Soc.
Wash., 104(4): 800-811.
817
Holdich, D.M. 1993. A review of astaciculture: freshwater
crayfish farming. Aquat. Living Resour., 6, 307-317.
Holthuis, L.B. 1952. The crustacean Decapoda Macrura of
Chile. Reports of the Lund University Chile expedition
1948-49, Lunds Univ. Arssk, N.F. Avd. 2, Bd. 47, Nr.
10: 1-109.
International Union for Conservation of Nature (IUCN).
2001. IUCN Red list categories: Version 3.1. Gland,
Switzerland: IUCN Species Survival Commission, 32
pp.
Jara, C.G. 1983. Segundo registro de Parastacus
araucanius Faxon, 1914 (Crustacea: Decapoda:
Macrura). Arch. Biol. Med. Exp., 16(2): 163-164.
Jara, C.G. 1994. Camarones dulceacuícolas en Chile.
Informe técnico-científico, Instituto de Zoología,
Universidad Austral de Chile, Valdivia, 15 pp.
Jara, C.G., E.H. Rudolph & E.R. González. 2006. Estado
de conocimiento de los malacostráceos dulceacuícolas
de Chile. Gayana, 70(1): 40-49.
Kulzer, L. & S. Cooke. 2001. Introducction. In: L. Kulzer,
S. Luchessa, S. Cooke, R. Errington & F. Weinmann
(eds). Characteristics of the low-elevation Sphagnumdominated peatland of western Washington: a
community profile. Part 1: Physical, chemical and
vegetation characteristics. King County Water and
Land Resources Division, Washington, pp. 1-15.
Manning, R.B. & H.H. Hobbs, Jr. 1977. Decapoda. In:
S.H. Hulbert (ed.). Biota acuática de Sudamérica
austral. San Diego State University, San Diego, pp.
157-162.
Martínez, A.W. 2005. Revisión taxonómica del género
Virilastacus Hobbs, 1991 (Crustacea, Decapoda,
Parastacidae). Seminario de Título, Biología Marina,
Universidad de Los Lagos, Osorno, 83 pp.
Martínez, R.I., F.E. Llanos & A.E. Quezada. 1994.
Samastacus araucanius (Faxon, 1914): aspectos
morfológicos de un nuevo registro para Chile
(Crustacea, Decapoda, Parastacidae). Gayana Zool.,
58(1): 9-15.
Ministerio del Medio Ambiente (MMA). 2013a.
Virilastacus araucanius. URL: [http://www.mma.
gob.cl/clasificacionespecies/fichas10proceso/fichas_1
0_pac/Virilastacus_araucanius_10RCE_01_04_PAC.
pdf]. Reviewed: 31 July 2015.
Ministerio del Medio Ambiente (MMA). 2013b. Virilastacus rucapihuelensis. URL: [http://www.mma.gob.
cl/clasificacionespecies/fichas10proceso/fichas_10_pa
c/Virilastacus_rucapihuelensis_10RCE_01_PAC.pdf].
Reviewed: 31 July 2015.
Palaoro, A.V., M.M. Dalosto, G.C. Costa & S. Santos.
2013. Niche conservatism and the potential for the
818
crayfish Procambarus clarkii to invade South
America. Freshw. Biol., 58: 1379-1391.
Reynolds, J., C. Souty-Grosset & A. Richardson. 2013.
Ecological roles of crayfish in freshwater and
terrestrial habitats. Freshw. Crayfish, 19(2): 197-218.
Riek, E.F. 1971. The freshwater crayfishes of South
America. Proc. Biol. Soc. Wash., 84: 129-136.
Rudolph, E. 1997. Aspectos fisicoquímicos del hábitat y
morfología de las galerías del camarón excavador
Parastacus nicoleti (Philippi, 1882) (Decapoda,
Parastacidae) en el sur de Chile. Gayana Zool., 61(2):
97-108.
Rudolph, E. 2010. Sobre la distribución geográfica de las
especies chilenas de Parastacidae (Crustacea:
Decapoda: Astacidea). Bol. Biodivers., 3: 32-46.
Rudolph, E.H. 2013. Freshwater malacostracans in
Chilean inland waters: a checklist of the Chilean
Parastacidae (Decapoda, Astacidea). Crustaceana, 86:
1468-1510.
Rudolph, E. & A. Almeida. 2000. On the sexuality of
South American Parastacidae (Crustacea, Decapoda).
Invest. Rep. Dev., 37(3): 249-257
Rudolph, E. & K.A. Crandall. 2005. A new species of
burrowing crayfish, Virilastacus rucapihuelensis
(Crustacea: Decapoda: Parastacidae), from southern
Chile. Proc. Biol. Soc. Wash., 118(4): 765-776.
burrowing crayfish Virilastacus retamali (Decapoda:
Parastacidae) from the southern Chilean peatland. J.
Crustacean Biol., 27(3): 502-512.
Received: 12 December 2014; Accepted: 15 July 2015
burrowing crayfish, Virilastacus jarai (Crustacea,
Decapoda, Parastacidae) from central-southern Chile.
Proc. Biol. Soc. Wash., 125(3): 258-275.
Rudolph, E. & H. Rivas. 1988. Nuevo hallazgo de
Samastacus araucanius (Faxon, 1914) (Decapoda,
Parastacidae). Biota, 4: 73-78.
Rudolph, E. & C. Rojas. 2003. Embryonic and early
postembryonic development of the burrowing
crayfish, Virilastacus araucanius (Faxon, 1914)
(Decapoda, Parastacidae) under laboratory conditions.
Crustaceana, 76(7): 835-850.
Rudolph, E., F.A. Retamal & A.W. Martínez. 2007. Partial
protandric hermaphroditism in the burrowing crayfish
Virilastacus rucapihuelensis Rudolph & Crandall,
2005 (Decapoda, Parastacidae). J. Crustacean Biol.,
27(2): 229-241.
Straelen, V. van. 1942. À propos de la distribution des
écrevisses, des homards et des crabes d’eau douce.
Bull. Mus. Roy. Hist. Nat. Belgique, 18(56): 1-11.
Valencia-López, D.M., F. de P. Gutérrez-Bonilla & R.
Álvarez-León. 2012. Procambarus clarkii Girard,
1852 (Decapoda: Cambaridae), 5.3 Crustáceos
exóticos. In: F. de P. Gutiérrez-Bonilla, C.A. LassoAlcalá, M.P. Baptiste, P. Sánchez-Duarte & A.M.
Díaz-Espinosa (eds.). VI. Catálogo de la biodiversidad
acuática exótica y trasplantada en Colombia:
moluscos, crustáceos, peces, anfibios, reptiles y aves.
Bogotá D.C., pp. 275-321.
Lat. Am. J. Aquat. Res., 43(5): 819-827,
2015of the river prawn Macrobrachium americanum (Bate, 1868)
The case
819
Review
Conservation and aquaculture of native freshwater prawns: the case of the
cauque river prawn Macrobrachium americanum (Bate, 1868)
Marcelo García-Guerrero1, Rodolfo de los Santos Romero1
Fernando Vega-Villasante2 & Edilmar Cortes-Jacinto3
1
Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional-Instituto Politécnico Nacional
(CIIDIR-IPN) Unidad Oaxaca, Santa Cruz Xoxocotlán, Oaxaca, México
2
Centro de Investigaciones Costeras, El Centro Universitario de la Costa
Universidad de Guadalajara Puerto Vallarta, Jalisco
3
Centro de Investigaciones Biológicas del Noroeste (CIBNOR), La Paz, B.C.S., México
Corresponding author: Marcelo U. García-Guerrero ([email protected])
ABSTRACT. Latin America has a high diversity of Macrobrachium prawns, some of them with commercial
interest. Among them, the cauque river prawn Macrobrachium americanum is a large prawn of the western coast
with commercial value due to its size and taste, but it has been extensively subjected to fishery exploitation,
leading to population decline. Cultivation is an option for commercial production and conservation. Some
research focused on domestication has been performed. Here, we revise the status of that research and discuss
possibilities for sustainable freshwater prawn aquaculture in Mexico and elsewhere in Latin America.
Keywords: Macrobrachium americanum, river prawn, production, management, aquaculture.
Conservación y cultivo de especies nativas de langostinos: el caso del cauque
Macrobrachium americanum (Bate, 1868)
RESUMEN. América Latina tiene una gran diversidad de langostinos Macrobrachium, algunos de ellos con
interés comercial. Entre ellos, el cauque, Macrobrachium americanum, una especie de la costa occidental de
América que tiene valor comercial por su tamaño y sabor, que está ampliamente sujeto a explotación pesquera,
que ha causado la disminución de sus poblaciones. El cultivo es una opción para su conservación y producción
comercial. En el presente trabajo se revisó el estado de la investigación sobre la especie y se discuten sus
posibilidades para la acuicultura sostenible en México y en otros países Latinoamericanos.
Palabras clave: Macrobrachium americanum, langostino, producción, manejo, acuiculura.
INTRODUCTION
Freshwater Macrobrachium prawns are an important
product both cultivated and extracted from rivers,
mostly in Asia and Latin America (Grave et al., 2008).
These prawns can be cultivated in simple facilities
using low-cost methods (Valenti & New, 2000; Wahab
et al., 2012). The less intensive farming operations and
lower costs of freshwater prawn’s production compared
to marine shrimp could make their culture an option for
sustaining rural cultivation by small-scale farmers and
local markets (Valenti & New, 2000; Kutty, 2005;
Martínez-Córdova et al., 2009; Tidwell & D’Abramo,
______________________
Corresponding editor: Erich Rudolph
2010). There are some successful examples of intense
production in several regions of the world (Valenti &
New, 2000; Wahab et al., 2012; Almeida & MoraesValenti, 2012; Hongtuo et al., 2012; Nair & Salin,
2012; Na-Nakorn & Jintasataporn, 2012). In Asia,
prawn farming is an important activity in expansion
that plays an important role in alleviating poverty,
generating employment and foreign currency (Wahab
et al., 2012). Its expansion should continue if
aquaculture is to satisfy the global demand for food
products (Ross et al., 2008; Martínez-Córdova et al.,
2009). However, today, expansion relies on a range of
aquatic species representing only a small fraction of
820
those with potential for aquaculture (Ross & Beveridge,
1995). This is particularly true in the case of Latin
American Macrobrachium prawns, since only few
species are fished or cultivated. This work discusses the
potential for aquaculture of one of them, the cauque
prawn (Macrobrachium americanum Bate, 1868; Fig.
1), provides information on the research status, and
clarifies issues related to its exploitation.
General panorama of prawn culture in Latin
America
Most Latin American countries are multicultural with
many human societies still maintaining ancient
traditions and having a very high biodiversity in their
regions. In these countries, and Mexico in particular,
ancient tradition related to the exploitation criteria of
fisheries are still subjected to ancient methods, as they
are part of strong traditional roots. Because of this, in
addition to poverty issues, some of these fishery
resources in the region are over-exploited and seem to
be causing an adverse impact on particular populations.
Freshwater prawns are not exempt of these effects.
Most commercially available prawns come from
informal fisheries since aquaculture is not practiced due
to the lack of proper cultivation techniques for native
species and the lack of sufficient research. Therefore,
in Latin America this enterprise has failed to expand.
This can be improved with the generation of research
and proper management policies (Wahab et al., 2012;
García-Guerrero et al., 2013).
Why cultivate native species?
In Mexico, the Comision Nacional para la Biodiversidad (CONABIO) identified four priorities related
to conservation of live resources: a) protection and
conservation, b) evaluation of biodiversity, c) planning
and management of information, and d) diversification
of resources use. The last statement involves cultivation
of native species under sustainable aquaculture to
minimize impacts caused by introduced species (Ross
et al., 2008; Somoza & Ross, 2011). To be successful,
farming should have a constant, readily available and
affordable seed supply and, as far as possible, mostly of
native species, including prawns. Native species are
already adapted; there would be no heating expenses or
costly facilities so production costs will be low. It is
easy to avoid inbreeding problems by incorporating
wild individuals (García-Guerrero & Apun-Molina,
2008; Hongtuo et al., 2012). Their cultivation could be
an income source to local settlements and may provide
relief to wild populations impacted by overexploitation
and pollution (Schwantes et al., 2009). The economic
and environmental requirements of each country would
determine if cultivation is profitable and whether it will
reach markets as a live, fresh-killed, processed, or
frozen product.
In contrast, exotic species often bring complications
because they may not be adapted to exotic weather or
water conditions and may not resist local diseases or
incur in inbreeding or disease problems due to stocks
degradation (Nair & Salin, 2012; Na-Nakorn &
Jintasataporn, 2012). In addition, foreign species
frequently introduce new pathogens or parasites (Ross
et al., 2008). Since M. rosenbergii is exotic in Latin
America and production of this species has declined in
most of the continent, cultivation techniques for native
species are being considered (Valenti & MoraesRiodades, 2004; Goda, 2008; Vega-Villasante et al.,
2011). These studies have investigated Latin American
prawn species with aquaculture potential. Good
examples are known for M. amazonicum, M. tenellum
and M. americanum
The Macrobrachium americanum case
This prawn is distributed along the Pacific slope of
America between Baja California (Mexico) and Peru,
as well as at Cocos and Galapagos Islands (Holthius,
1980). It is still present in most coastal areas where the
rivers empty into lagoons and then to the ocean
(Hernández et al., 2007). In the past, it was collected in
areas far from coastal plains and it was widely present
even in habitats where the amount of water is minimal
during dry seasons, since it is able to overcome natural
barriers. However, current human activities are
contributing to a severe decrease of its populations. It
has become scarcer every year, and the current status of
its populations is unknown in most of its distribution
range. In recent years, there has been increased interest
in commercial farming of this species among producers
and research groups. However, since there are no
techniques for its culture its farming cannot start in its
native region in the near future.
General biology
M. americanum is a species with a wide distribution
potential either along the coast or into the continental
waters including freshwater lakes, reservoirs and rivers
in tropical and subtropical areas of western Mexico
(Hernandez et al., 2007), as this species can reach large
distances from the coast (more than 150 km). It could
become a good biological index of ecological fitness,
considering that domestic, agricultural, industrial and
human wastes cause pollution at different scales and
may easily kill larvae and juveniles that are very
sensitive to small concentrations of pesticides, heavy
metals (Piyan et al., 1985; Adhicari et al., 2007), and
other anthropogenic pollutants (Shinn-Pyng et al.,
2005). Females can spawn several times each year and
The case of the river prawn Macrobrachium americanum (Bate, 1868)
821
b
a
Figure 1. Macrobrachium americanum prawns. a) Male, b) females.
produce from some hundreds to almost three thousand
eggs at each spawning (García-Guerrero & Hendrickx,
2009). Males may grow to about 29 cm in total length;
the reproductive season occurs from May-September
(García-Guerrero, 2009). In the regions where these
prawns still exist, river conditions change intensely
with the season (high water flow from May to October
and low water flow from November to April). This
phenomenon allows its reproduction, but increases its
exposure to fishing (García-Guerrero et al., 2013). Its
larval development involves fifteen larval stages that
need salty water to survive (Holtschmit & Pfeiler, 1984;
Yamasaki-Granados et al., 2013). As in most
Macrobrachium species, wild females breed and spawn
in freshwater but planktonic larvae must grow in
brackish water. At juvenile stage, they become
benthonic and start migrating into inland freshwater
(Horne & Besser, 1977; Bauer, 2011). Based on
previous studies, it is known that juveniles and adults
are easy to feed in captivity, since they can consume all
kinds of food with animal protein, mainly commercial
shrimp pellets, fish, or squid meat (García-Guerrero &
Apun-Molina, 2008). Few formal general biology
studies have been done in this species. García-Guerrero
et al., (2011) studied how O2 consumption was related
to size and water temperature highlighting the negative
effect of low oxygen concentrations. García-Guerrero
& Hendrickx (2009) described embryonic development
and García-Guerrero (2009, 2010) and determined
variations in the proximate composition of eggs
incubated at different temperatures. As in most decapod
egg lipids are the main component for energy
production and protein is the most abundant component
(Holland, 1978).
Fisheries and aquaculture
The first studies in Mexico started in the 1970’s; but
most are informal reports, anecdotal or with conflicting
results (Mercado, 1959; Rodríguez de la Cruz, 1965,
1967; Arana-Magallón, 1974). Some formal studies
focused on the potential of this species for cultivation
have been done but still not enough to support
cultivation beyond experimental assays. Some assays
have been done in captivity by Ruiz et al. (1996) or
Arana & Ortega (2004), finding fast growth of juveniles
kept at low densities in tanks. García-Guerrero &
Apun-Molina (2008) studied how density and shelters
affect survival and growth of juveniles. Prawns kept at
low density with a shelter grew faster and survived
longer. The last authors stated that one disadvantage is
that M. americanum is a territorial prawn and often
aggressive, a behavior that is enhanced in large
specimens. Cannibalism is not rare and recently molted
specimens are the most likely preys. Larval cultivation
of M. americanum has been performed up to the postlarval stage, although very poor survival has been
822
attained (Arana-Magallón, 1974; Monaco, 1975;
Holtschmit & Pfeiler, 1984; Díaz-Monge et al., 2001;
Yamasaki-Granados et al., 2013). Monaco (1975) was
the first to complete all stages of larval development
(53 days at 29 ± 5°C) but with very poor survival.
Yamasaki-Granados et al. (2013) state that recently
hatched larvae (0 -72 h) can eat dead or slow nauplii;
but apparently, they do not fulfill nutritional
requirements and they seem to be hard to catch for such
larvae. In addition, Díaz-Monge et al. (2001) reported
that Artemia nauplii (24 h after hatching) are larger than
M. americanum larvae; therefore, they are not suitable
as food during early stages of development. YamasakiGranados et al. (2013) stated that the most important
tasks for raising larvae include monitoring physical and
chemical parameters of the water, breeding quality of
the adults, and the use of high nutritional value and
small in size live food, at least during the first half of
development. To be effective, the food must be easy to
be recognized and captured (Yamasaki-Granados et al.,
2013). These last authors suggest that feeding with
rotifers, which can tolerate brackish water, might be an
option to overcome this problem, in addition to
monitoring strictly temperature and salinity. In fact,
Yamasaki-Granados et al. (2013) offer a table of
salinities for cultivating the larvae of this prawn.
Macrobrachium larvae can be cultivated with success
in clear fresh water (Daniels et al., 1992), but including
microalgae is also common. From previous research on
cultivating prawn larvae, microalgae are recognized for
their role in removing wastes and controlling light and
dissolved O2 to benefit larvae (Lober & Zeng, 2009;
Nunes et al., 2011; Yamasaki-Granados et al., 2013).
Most recently, a study by Rojo-Cebreros et al. (2013)
found that M. americanum is a good companion for
tilapia fish and does not interfere with fish production.
In relation to fisheries and because of their biological cycle, M. americanum prawns are exposed to
year-round overfishing and there is an established local
market during the whole year, since this prawn is fished
for local consumption or sold to restaurants close to the
fishing area. There are no records on its fisheries and
most information available is informal and comes from
fishermen. In most places, populations have severely
declined or disappeared by overfishing, illegal fishing
practices, pollution, alteration of habitat, and intensive
collection of seed and juveniles since these are also
cached, dried, and sold as food for ornamental fish
(García-Guerrero et al., 2013). It is possible that this
last practice hinders new population recruitment, but its
real impact has not been examined yet.
Main concerns that are poorly explored
Studies on growth rate, survival, mortality, as well as
the detailed effect of most environmental parameters
that may affect this prawn either in the wild or under
culture are lacking. However, the most urgent topic that
should be addressed is the development of larval
culture techniques. Production of larvae is perhaps the
most critical issue before considering a species as a
good candidate for commercial cultivation. Monaco
(1975) was perhaps the first to obtain the larval
development, but with poor survival. Ever since, few
studies have addressed this particular issue. Highquality, laboratory-reared larvae are essential because
successful and profitable production requires a constant
supply of high quality juveniles for stocking, since no
commercial activity can rely forever on wild larvae or
postlarvae (New, 2005, 2009; New & Nair, 2012);
hence, commercial production will eventually fail
(Hongtuo et al., 2012; Yamasaki-Granados et al.,
2013). Previous studies on larval development provide
clues on larval management and feeding. Small larvae
make the cultivation of M. americanum a difficult
challenge. In recent studies, such as those of YamazakiGranados et al., 2013, the fry or seed supply was the
most urgent focus, and this remains so. Production
technology for larvae has to be standardized before
constant mass production of juvenile prawns can be
achieved. A well developed protocol for rearing
juveniles in the hatchery or in the laboratory is
necessary because gathering of wild juveniles does not
guarantee constant, homogeneous, and high quality fry
for stocking (Gopal, 2002). Success strongly depends
on a ready supply of fry from hatcheries, which often is
the hardest bottleneck to overcome and one of the main
requisites before introducing any aquatic species to
commercial cultivation. In spite of previous studies that
have advanced on M. americanum larval development,
there is no reliable technique for cultivating these
larvae (Yamasaki-Granados et al., 2013). The use of
antibiotics to prevent or control infectious diseases is
also understudied, as well as that of immune stimulants
and probiotics in food and water (Yamasaki-Granados
et al., 2013). These products must be strictly controlled
and supervised prior to their application, because they
can produce unwanted effects during cultivation or on
the environment (Gatesoupe, 1999; Yamasaki-Granados
et al., 2013).
Other considerations include the physiological
consequences on prawns exposed to high levels of
nitrogenous wastes (Romano & Zeng, 2013). Specific
diets have not been prepared for this prawn, even
though its nutritional requirements are similar to that of
other prawns. Behavior and genetic studies that lead to
selection of docile, resistant, and fast-growing lineages
for aquaculture are always required (Nguyen et al.,
2009), but none have been made in this species, and
there are no studies about mono-sex cultivation. Social
structure and behavioral studies are also necessary for
assessing maximum densities and combinations of
sizes, sex, and age classes to control crowding.
Hybridization with other Macrobrachium species,
marketing potential of the species out of its native area,
and tolerance to viral or bacterial infections are also
unknown and required. In relation to reproduction
issues, berried females availability is of major
importance. They can be captured from the wild, but
quality may be uncertain and stress can inhibit the
females from attending the grooming behavior of their
egg masses (García-Guerrero, 2009). In turn, this will
lead to egg loss or infections causing low hatching rates
(García-Guerrero, 2009). Because of this, research
must include laboratory-produced berried females.
Mating in captivity is easy in prawns, despite
cannibalism of soft-shelled females but a maturation
diet has not been developed yet for this species (GarcíaGuerrero & Apun-Molina, 2008). Other reproduction
issues, such as all the environmental cues that influence
gonadal activity (Ross & Beveridge, 1995) are still
unknown. In relation to grow-out, for juveniles or
adults under cultivation, balanced pelletized diets
fundamental for fast grow-out have not been developed
(D’Abramo et al., 1997). Since feeding is the most
expensive cost of production, 40-60% of the total
budget (Akiyama et al., 1992), studies on high quality
but cheap balanced diets are required.
Aggressiveness and cannibalism are other main
concerns; crowding stresses prawns, making them
aggressive and prone to infections, parasites, or loss of
appetite (Ross & Beveridge, 1995). This is worse
among aggressive prawns, and M. americanum is
particularly aggressive, with well-developed territorial
behavior, particularly adult males (García-Guerrero &
Apun-Molina, 2008). During confinement, crowding,
lack of shelters, and inappropriate food will cause
larger prawns to seriously injure or kill smaller ones
(García-Guerrero & Apun-Molina, 2008). During postmolt, mortality rates increase, even if appropriate food
and shelters are provided. To minimize this problem,
research on strains with docile behavior must be
performed, or techniques focused to deal with this issue
must be developed.
Other issues must be studied once the basic features
limiting cultivation technology are clarified. Specific
cultivation techniques are required, such as the use of
all-male stock, strains that grow fast, use of cheap local
materials and products that are compatible with
aquaculture. Legislation policies, management, weather,
availability and quality of water, road conditions,
electricity, communication, and distance from the final
market are other secondary issues to determine the best
areas for native prawns cultivation. In the case of
marketing, the adoption of native species new to
aquaculture into semi-intensive and intensive produc-
823
tion requires the generation of a vast body of
biotechnical information. This enterprise should be
executed after exploring marketing chances of success.
In some situations, large-scale production for processing
and shipping may not be economically competitive
with products imported from Asia (Tidwell, 2012).
Finally, outdoor cultivation studies are needed since
growth and performance in ponds have neither been
investigated.
DISCUSSION
Macrobrachium americanum’s potential for culture is
still to be clarified, but most cultivation techniques and
management strategies could be adapted from studies
and manuals dedicated to other species, such as M.
rosenbergii (New, 2005) or M. tenellum (VegaVillasante et al., 2011). These studies state that native
prawns cultivation could be profitable in the corresponding region. It provides working opportunities to
low-income farmers, with a product that can give them
a high return. It has happened in countries such as
Thailand or India, in which the culture of prawns is
common as part of an extensive strategy that implies
the use of wild berried females or wild juveniles
stocked in cheap facilities and managed by families
(Na-Nakorn & Jintasataporn, 2012). In China, breeding
and larval rearing of M. nipponense and grow-out
production has been developed (Hongtuo et al., 2012).
Research institutions, in the late 1980’s, have also
standardized in India mass production of prawn
juveniles of M. malcolmsonii and M. gangeticum, under
controlled culture schemes based on seed production
technology (Nair & Salin, 2012). Since 1996, various
research groups in Brazil have worked with the
experimental culture of M. amazonicum (e.g., MoraesValenti & Valenti, 2007, 2009). After a hard starting
with some unsuccessful results, basic technology is
now available for all phases of production of this latter
species. In addition, in Brazil, hatchery studies of M.
carcinus provide promising results (Rocha et al., 2011).
All those previous reports suggest that culture in a
profitable scheme is possible with M. americanum, or
with other native species if proper techniques are
developed.
Macrobrachium prawns culture may have
additional advantages: they are a good option for
aquaculture in tropical and semi-tropical regions
because all phases of cultivation can be done year round
since they can be stocked or harvested at any time, and
two or three grow-out cycles per year are possible, with
good profits (Tidwell, 2012). These prawns can be
raised without access to saltwater or expensive coastal
lands and they do not require much fishmeal in their
824
diet (Tacon & Metian, 2008). For example, Tidwell
(2012) evaluated freshwater prawns for sustainability
on the following criteria: 1) Use of marine resources, 2)
risk of escape of cultivated animals to the wild, 3) risk
of disease and parasite transfer to wild populations, 4)
risk of pollution and habitat degradation, and 5)
effective management. Freshwater prawns were rated
as “low environmental concern” in the five categories
and were designated as a “best choice”. He stated that
prawns were one of the most sustainable seafood
choices available, which means their cultivation could
be environmentally safe. In fact, Ross & Beveridge
(1995) mentioned that aquaculture of native species
could be suitable in economic, biotechnical, and
environmental terms. Of course, research on native
species needs to be analyzed through different criteria
prior to commercial production. If properly cultivated,
markets could include, in addition to human
consumption, ornamental trade and bait (AlmeidaMarques & Moraes-Valenti, 2012). In addition,
aquaculture may help to protect a species from
overfishing by giving additional product supply
(Bowles et al., 2000). For example, wild populations of
M. rosenbergii were overfished in Thailand, and
expansion of agriculture, habitat destruction, and water
pollution led to a rapid populations decline (Na-Nakorn
& Jintasataporn, 2012). However, since 1977, prawnbreeding technology for this species has improved; it
has been cultivated in Thailand and thereafter annual
production has increased and wild populations are
recovering.
Some areas of Mexico and shores all along western
Latin America are appropriate for the cultivation of M.
americanum, because they provide land areas with
suitable water and weather conditions. In addition,
juveniles produced from hatchery-reared larvae may
help restore wild populations if proper measures to
preserve genetic diversity are included in those
programs. However, to introduce prawn farming as an
option is hard not only because of lack of technologies,
but also because in certain areas active fishing still
provides easily catch product. This means that people
of those regions will prefer to capture the prawns for
consumption or for sale in the wild instead of working
with culture techniques, which implies more
investment and more work. To make it worse, most
countries where M. americanum lives have no fishery
policies, or have policies that are not enforced. Specific
social and economic factors are also involved,
depending on the region.
Since biodiversity must be preserved, development
of sustainable aquaculture requires consideration of an
ecosystem approach (Ross et al., 2008, MartínezCórdova et al., 2009), which can be reached only
working with native species in both culture and
conservation programs. If possible, conservation
programs including all research areas should be
financed or executed based on restoration programs of
this living resource. Since this task can be expensive
and lengthy, it is important to focus on the most
important factors (Ross et al., 2008). Ross & Beveridge
(1995) considered the most important issues to be
classified with these criteria:
1) Basic biology: natural habitat and habits, basic
ecology and functional biology.
2) Environmental physiology: optimum temperature,
salinity and photoperiod for growth and survival.
3) Closed reproductive cycle: developing the conditions for the whole cycle in captivity.
4) Nutrition: identification of natural feeding strategy
and food items, feeds, and diets.
5) Growing systems: development of appropriate
physical and farming systems for the species, its
environment and the socio-economic status of the
communities.
Of these, issues 1 and 2 are mostly known for M.
americanum, whereas issue 3 (part of larval studies) is
suggested as urgent and having priority over issues 4
and 5. Knowledge-oriented research on nutritional
requirements at the various stages of life and on
behavioral aspects (social stratification in pond culture
under high densities) must be carried out
simultaneously with studies identified as having the
highest priority. Additionally, cultivation of M.
carcinus, a co-generic species with M. americanum but
distributed on the Atlantic side of the tropical
Americas, may prove feasible if equivalent attention is
given.
CONCLUSIONS
Current knowledge of M. americanum cultivation is not
sufficient to support cultivation beyond research
purposes. The main problem that prevents cultivation
of M. americanum, on a commercial scale, is the
requirement of strict water quality control. Aggressiveness seems to be the other major obstacle. To
consider the species as a commercial culture option is
still not clear given its cannibalistic behavior and the
lack of proper larval production technologies. Because
of this, the case of M. americanum as a good option for
sustainable aquaculture should first be aimed at
conservation purposes since it needs special attention
as a natural resource that has to be protected. Future
studies must consider intraspecific variation in lifehistory traits of separate populations, which differ in
physiological responses to salinity, egg size, feeding,
and other variable larval traits. Outdoor cultivation
assays in ponds and managed with different techniques
are required to appraise production possibilities and
limitations.
ACKNOWLEDGEMENTS
M. García Guerrero thanks the Secretaría de Investigación y Posgrado and Comisión de Fomento de
Actividades Académicas del Instituto Politécnico
Nacional for their financial support. E. Cortes thanks
projects CB201/156252, 2014/227565, CONACYTMINCYT-MX/09/07 and AMEXCID CTC/06038/14.
Ingrid Mascher edited the final version of this
document.
REFERENCES
Adhicari, S., A. Ahmad, K. Naqvi, C. Pani, B. Pillai, K.
Jena & N. Sarangi. 2007. Effect of manganese and
iron on growth and feeding of juvenile giant river
Prawn, Macrobrachium rosenbergii (De-Man).
J.World Aquacult. Soc., 38(1): 161-168.
Akiyama, D., M. Dominy & G. Lawrence. 1992. Penaeid
shrimp nutrition. In: A. Fast & W. Lester (eds.).
Marine shrimp culture: principles and practices.
Elsevier, Amsterdam, pp. 535-568.
Almeida-Marques, H. & P. Moraes-Valenti. 2012. Current
status and prospects of farming the giant river prawn
Macrobrachium rosenbergii (De Man, 1879) and the
Amazon River prawn Macrobrachium amazonicum
(Heller, 1862) in Brazil. Aquacult. Res., 43: 984-992.
Arana-Magallón, F. 1974. Experiencias sobre el cultivo
del langostino Macrobrachium americanum Bate, en
el noroeste de México. Simposio FAO/Carpas sobre
Acuacultura en América Latina. Montevideo,
Uruguay, 26 November-2 December, 1974. Available
on line. [http://www.fao.org/docrep/005/ac866s/AC
866S19.htm].
Arana, F. & A. Ortega. 2004. Rearing of the cauque prawn
under laboratory conditions. N. Am. J. Aquacult., 66:
158-161.
Bauer, R. 2011. Amphidromy and migrations of
freshwater shrimps. II. Delivery of hatching larvae to
the sea, return of juvenile upstream migration, and
human impacts. New Front. Crust. Biol., 157: 168188.
Bowles, D., K. Aziz & C. Knight. 2000. Macrobrachium
(Decapoda: Caridea: Palaemonidae) in the contiguous
United States: a review of the species and an assess-
825
ment of threats to their survival. J. Crustacean Biol.,
20: 158-171.
DÀbramo, L., R. Conklin & D. Akiyama. 1997.
Crustacean nutrition advances in world aquaculture.
World Aquaculture Society, Baton Rouge, 6: 587 pp.
Daniels, W., L. DÀbramo & L. Parseval. 1992. Design
and management of a close recirculated clear water
hatchery system for freshwater Macrobrachium
prawns. J. Shellfish Res., 11: 65-73.
Díaz-Monge, F., M. Díaz & R. Rodríguez. 2001.
Producción larval de camarón de río nativo, Macrobrachium americanum en laboratorio. Centro de
Estudios del Mar y Acuicultura, Guatemala City, 78
pp.
García-Guerrero, M. 2009. Proximate biochemical
variations in eggs of the prawn Macrobrachium
americanum (Bate, 1869) during its embryonic
development. Aquacult. Res., 40: 575-581.
García-Guerrero, M. 2010. Effect of temperature on
consumption rate of main yolk components during the
embryo development of the prawn Macrobrachium
americanum (Crustacea: Decapoda: Palaemonidae). J.
World Aquacult. Soc., 41: 84-92.
García-Guerrero, M. & P. Apun-Molina. 2008. Density
and shelter influence the adaptation to wild juvenile
cauque prawns Macrobrachium americanum to
culture conditions. N. Am. J. Aquacult., 70: 343-346.
García-Guerrero, M. & M. Hendrickx. 2009. External
description of the embryonic development of the
prawn Macrobrachium americanum based on the
staging method. Crustaceana, 82: 1413-1422.
García-Guerrero, M., J. Orduña-Rojas & E. CortesJacinto. 2011. Oxygen consumption of the prawn
Macrobrachium americanum (Bate, 1868) over the
temperature range of its native environment and in
relation to its weight. N. Am. J. Aquacult., 73: 320326.
García-Guerrero, M., F. Becerril-Morales, F. VegaVillasante & L. Espinosa-Chuarand. 2013. Los langostinos del género Macrobrachium con importancia
económica y pesquera en América Latina: conocimiento actual, rol ecológico y conservación. Lat. Am.
J. Aquat. Res., 41: 651-675.
Gatesoupe, J. 1999. The use of probiotics in aquaculture.
Aquaculture, 180: 147-165.
Goda, A. 2008. Effects of dietary protein and lipid levels
and protein-energy ratio on growth indices, feed
utilization and body composition of freshwater prawn,
Macrobrachium rosenbergii (de Man, 1879) post
larvae. Aquacult. Res., 39: 891-901.
Grave, S., Y. Cai & A. Anker. 2008. Global diversity of
shrimps (Crustacea: Decapoda: Caridea) in freshwater.
Hydrobiologia, 595: 287-293.
826
Gopal, P. 2002. The potential of the freshwater giant
prawn Macrobrachium rosenbergii culture in
Muktagachha Upazila using GIS as a tool. Master
Thesis,
Bangladesh
Agricultural
University,
Mymensingh, 270 pp.
Hernández, L., G. Murugan, G. Ruiz & A. Maeda. 2007.
Freshwater shrimp of the genus Macrobrachium
(Decapoda Paleamonidae) from the Baja California
Peninsula, Mexico. J. Crustacean Biol., 27: 351-369.
Holthuis, L.B. 1980. FAO species catalogue. Vol.1.
Shrimps and prawns of the world. An annotated
catalogue of species of interest to fisheries. FAO Fish.
Synop., 125(l): 1-271 pp.
Holland, D. 1978. Lipid reserves and energy metabolism
in the larvae of benthic marine invertebrates. In: D.C.
Malins (ed.). Biochemical and biophysical
perspectives in marine biology. Academic Press,
Seattle, pp. 85-123.
Horne, F. & S. Besser.1977. Distribution of river shrimp
in the Guadalupe and San Marcos Rivers of central
Texas, U.S.A. (Decapoda, Caridea). Crustaceana, 33:
56-60.
Holtschmit, K. & E. Pfeiler. 1984. Effect of salinity on
survival and development of larvae and postlarvae of
Macrobrachium americanum Bate (Decapoda,
Palaemonidae). Crustaceana, 46: 23-28.
Hongtuo, F., S. Jiang & X. Yiwei. 2012. Current status
and prospects of farming the giant river prawn
(Macrobrachium rosenbergii) and the oriental river
prawn (Macrobrachium nipponense) in China.
Aquacult. Res., 43: 993-998.
Kutty, M.N. 2005.Towards sustainable freshwater prawn
aquaculture-lessons from shrimp farming, with special
reference to India. Aquacult. Res., 36: 255-263.
Lober, M. & C. Zeng. 2009. Effect of microalgae
concentration on larval survival, development and
growth of an Australian strain of giant freshwater
prawn Macrobrachium rosenbergii. Aquaculture, 289:
95-100.
Martínez-Córdova, L.R., M. Martínez-Porchas & E.
Cortés-Jacinto. 2009. Camaronicultura mexicana y
mundial: ¿Actividad sustentable o industria contaminante? Rev. Int. Cont. Amb., 25: 181-196.
Mercado, P. 1959. Proyecto para una estación rústica
dedicada al cultivo de los langostinos. Bol. Piscicult.
Rural Secret. Ind. Com., México, 6: 5-6.
Monaco, G. 1975. Laboratory rearing of larvae of the
palaemonid shrimp Macrobrachium americanum
(Bate). Aquaculture, 6: 369-375.
Moraes-Valenti, P. & W. Valenti. 2007. Effect of
intensification on grow out of the Amazon River
prawn, Macrobrachium amazonicum. J. World
Aquacult. Soc., 38: 516-526.
Moraes-Valenti, P. & W. Valenti. 2009. Culture of the
Amazon River prawn Macrobrachium amazonicum.
In: M.B. New, W.C. Valenti, J.H. Tidwell, L.R.
D’Abramo & M.N. Kutty (eds.). Freshwater prawns:
biology and farming. Wiley-Blackwell, Oxford, pp.
485-501.
Nair, M. & K. Salin. 2012. Current status and prospects of
farming the giant river prawn Macrobrachium
rosenbergii (De Man) and the monsoon river prawn
Macrobrachium malcolmsonii (H.M. Edwards) in
India. Aquacult. Res., 43: 999-1014.
Na-Nakorn, U. & O. Jintasataporn. 2012. Current status
and prospects of farming the giant river prawn
(Macrobrachium rosenbergii de Man 1879) in
Thailand. Aquacult. Res., 43: 1015-1022.
New, M. 2005. Freshwater prawn farming: global status,
recent research and a glance at the future. Aquacult.
Res., 36: 210-230.
New, M. 2009. History and global status of freshwater
prawn farming In: M.B. New, W.C. Valenti, J.H.
Tidwell, L.R. D’Abramo & M.N. Kutty (eds.).
Freshwater prawns: biology and farming. WileyBlackwell, Oxford, 560 pp.
New, M. & M. Nair. 2012. Global scale of freshwater
prawn farming. Aquacult. Res., 43: 960-969.
Nguyen, M., W. Ponzoni, N. Hong Nguyen, N. Thanh, A.
Barnes & B. Mather. 2009. Evaluation of growth
performance in a dialed cross of three strains of giant
freshwater prawn (Macrobrachium rosenbergii) in
Vietnam. Aquaculture, 287: 75-83.
Nunes, A., C. Sa & H. Sabry-Neto. 2011. Growth
performance of the white shrimp, Litopenaeus
vannamei fed on practical diets with increasing levels
of the Antarctic krill meal Euphausia superba reared
in clear-versus green-water culture tanks. Aquacult.
Nutr., 17: 511-520.
Piyan, B., A. Law & S. Cheah 1985. Toxic levels of
mercury for sequential larval stages of Macrobrachium rosenbergii de Man. Aquaculture, 46: 353359.
Rocha, D., L. Santos, F. Branco, J. Lima & E. Correia.
2011. Postlarvae survival of freshwater prawn
Macrobrachium carcinus (Linnaeus, 1758) reared
under different feeding protocols, Abstracts of the
Asian Pacific Aquaculture 2011, 17-20 Jan 2011,
Kochi, World Aquaculture Society, Baton Rouge, pp.
92.
Rodríguez de la Cruz, C. 1965. Contribución al conocimiento de los palemónidos de México, Secretaría de
Industria y Comercio, Dirección General de Pesca e
Industrias conexas. Contrib. Inst. Nac. Inv. Biol.‐Pesq.
II Congreso Nacional de Oceanografía, pp. 7-11.
Rodríguez de la Cruz, C. 1967. Contribución al
conocimiento de los palemónidos de México,
Palemónidos del Golfo de California con notas sobre
la biología de Macrobrachium americanum Bate. An.
Inst. Nac. Invest. Biol.‐Pesq., 8: 157 pp.
Rojo-Cebreros, A., M. García-Guerrero, A. Santamaría &
P. Apun. 2013. A preliminary assay on the mixed
culture of red Florida tilapia and freshwater prawn
Macrobrachium americanum stocked in outdoor tanks
at different tilapia densities. Agr. Sci., 4(7): 345-352.
Romano, N. & Ch. Zeng. 2013. Toxic effects of ammonia,
nitrite, and nitrate to decapod crustaceans: a review on
factors influencing their toxicity, physiological
consequences, and coping mechanisms. Rev. Fish.
Sci., 21: 1-21.
Ross, L. & M. Beveridge.1995. Is a better strategy
necessary for development of native species for
aquaculture? A Mexican case study. Aquat. Fish.
Manage., 26: 539-547.
Ross, L., C. Martínez-Palacios & E. Morales. 2008.
Developing native fish species for aquaculture: the
interacting demands of biodiversity, sustainable
aquaculture and livelihoods. Aquacult. Res., 39: 675683.
Ruiz, M., J. Peña & Y. López. 1996. Morfometría, época
reproductiva y talla comercial de Macrobrachium
americanum (Crustacea: Palaemonidae) en Guanacaste,
Costa Rica. Rev. Biol. Trop., 44: 127-132.
Shinn-Pyng, Y., S. Tzeng-Gan, C. Chin-Chyuan, C.
Winton & K. Ching-Ming, 2005. Effects of an
organophosphorus insecticide, trichlorfon
on
hematological parameters of the giant freshwater
prawn, Macrobrachium rosenbergii (de Man).
Schwantes, V., J. Diana & Y. Yang. 2009. Social,
economic, and production characteristics of giant river
prawn Macrobrachium rosenbergii culture in
Thailand. Aquaculture, 287: 120-127.
Somoza, G. & L. Ross. 2011. Introduction to the special
issue on development of native species for aquaculture
in Latin America II. Aquacult. Res., 42: 737-738.
Received: 1 May 2015; Accepted: 7 August 2015
827
Tacon, A. & M. Metian. 2008. Global overview on the use
of fish meal and fish oil in industrially compounded
aquafeeds: trends and future prospects. Aquaculture,
285: 146-158.
Tidwell, J. 2012. Current status and prospects of farming
the giant river prawn (Macrobrachium rosenbergii De
Man, 1879) in the United States. Aquacult. Res., 43:
1023-1028.
Tidwell, J. & L. D’Abramo. 2010. Grow-out systemsculture in temperate climates. In: M.B. New, W.C.
Valenti, J.H. Tidwell, L.R. D’Abramo & M.N. Kutty
(eds.). Freshwater prawns: biology and farming.
Wiley-Blackwell, Oxford, pp. 180-194.
Valenti, W. & P. Moraes-Riodades. 2004. Freshwater
prawn farming in Brazil. Global Aquacult. Advocate,
7: 52-53.
Valenti, W. & M. New. 2000. Grow out systemsmonoculture. In: M.B. New & W.C. Valenti (eds.).
Freshwater prawn culture: the farming of Macrobrachium rosenbergii. Blackwell Scientific, Oxford, pp.
157-176.
Vega-Villasante, F., L. Espinosa-Chaurand, S. YamasakiGranados, E. Cortés-Jacinto, M. García-Guerrero, A.
Cupul-Magaña, H. Nolasco-Soria & M. GuzmánArroyo. 2011. Acuicultura del langostino Macrobrachium tenellum: engorda en estanques semi rústicos.
Universidad de Guadalajara y Consejo Estatal de
Ciencia y Tecnología del Estado de Jalisco, 140 pp.
Wahab, A., A. Al-Nahid, A. Nesar Ahmed, M. Haque &
K. Mahmudul. 2012. Current status and prospects of
farming the giant river prawn Macrobrachium
rosenbergii (De Man) in Bangladesh. Aquacult. Res.,
43: 970-983.
Yamasaki-Granados, S., M. García-Guerrero, F. VegaVillasante, F. Castellanos-León, R. Cavalli & E.
Cortés-Jacinto. 2013. Experimental culture of the river
prawn Macrobrachium americanum larvae (Bate,
1868), with emphasis on the stocking density effect on
survival. Lat. Am. J. Aquat. Res., 41(4): 793-800.
Lat. Am. J. Aquat. Res., 43(5): 828-835, 2015
Nile tilapia in saline water
Research Article
Responses of Nile tilapia to different levels of water salinity
Rafael Vieira de Azevedo1, Karen Figueiredo de Oliveira2, Fábio Flores-Lopes3
Eduardo Arruda Teixeira-Lanna4, Sylvia Sanae Takishita5 & Luís Gustavo Tavares-Braga5
1
Universidade Estadual do Norte Fluminense Darcy Ribeiro-CCTA-LZNA
Campos dos Goytacazes, RJ, Brasil
2
Universidade Federal do Ceará, Fortaleza, CE, Brasil
3
Universidade Estadual de Santa Cruz-DCB-Ilhéus, BA, Brasil
4
Universidade Federal de Viçosa, Viçosa, MG, Brasil
5
Universidade Estadual de Santa Cruz-DCAA-Ilhéus, BA, Brasil
Corresponding author: Rafael Vieira de Azevedo ([email protected])
ABSTRACT. A 45 day experiment was carried out to evaluate the effect of water salinity on the performance,
haematological parameters and histological characteristics of the gills of the Nile tilapia, Oreochromis niloticus.
The water salinity levels evaluated were: 0, 7, 14 and 21 g L-1. Nile tilapia specimens (1.62 ± 0.01 g), distributed
into 20 fibreglass tanks (100 L) at a density of 15 fish per tank. There were no significant differences of the
water salinity levels on daily feed intake; however, there were differences (P < 0.05) on the daily weight gain,
feeding conversion rate and survival. The best results were observed for the water salinity levels of 0 and 7 g
L-1. There were no differences (P > 0.05) between these levels. Regarding the haematological parameters, it was
observed that the percentage of the haematocrits and the erythrocyte count were influenced (P < 0.05) by the
water salinity level, which was not observed for the leukocyte count. The observed histopathological alterations
were chloride cell hypertrophy, epithelial lifting, structure alteration, telangiectasia, primary lamellae cells
aggregation, fusion and occurrence of aneurisms of different sizes in some secondary lamellae. Regarding the
frequency of gills infection intensity, there were slight changes between the salinities of 0, 7 and 14 g L-1 and
moderate changes at 21 g L-1. It is concluded that Nile tilapia can be reared in water salinities of up to 7 g L -1
without damage to the parameters evaluated in this work.
Keywords: Oreochromis niloticus, haematology, histopathological alterations, aquaculture.
Respuestas de la tilapia del Nilo a diferentes niveles de salinidad del agua
RESUMEN. Se realizó un experimento de 45 días para evaluar el efecto de la salinidad sobre el crecimiento,
parámetros hematológicos y características histológicas de las branquias de la tilapia del Nilo, Oreochromis
niloticus. Los niveles de salinidad fueron: 0, 7, 14 y 21 g L-1. Los especímenes de tilapia del Nilo (1,62 ± 0,01
g) se distribuyeron en 20 estanques de fibra de vidrio (100 L) a una densidad de 15 peces por estanque. No hubo
diferencias significativas en los niveles de salinidad sobre el consumo diario de alimento, pero hubo diferencias
(P < 0,05) en la ganancia diaria de peso, conversión alimenticia y supervivencia. Los mejores resultados se
observaron en los niveles de salinidad de 0 y 7 g L-1, sin diferencias (P > 0,05) entre ellos. En cuanto a los
parámetros hematológicos, se observó que el porcentaje de hematocrito y número de eritrocitos fueron
influenciados (P < 0,05) por el nivel de salinidad, que no se observó para el recuento de leucocitos. Las
alteraciones histopatológicas observadas fueron: hipertrofia de las células de cloruro, elevación epitelial, cambio
en la estructura, telangiectasia, agregación de las células primarias de las laminillas, fusión y aparición de
algunos aneurismas de diferentes tamaños en laminillas secundarias. En cuanto a la frecuencia de la intensidad
en la infección de las branquias, hubo ligeros cambios entre las salinidades de 0,7 y 14 g L-1 y cambios
moderados a 21 g L-1. Se concluye que la tilapia del Nilo se puede cultivar en salinidades de hasta 7 g L-1 sin
daño a los parámetros evaluados en este trabajo.
Palabras clave: Oreochromis niloticus, hematología, cambios histopatológicos, acuicultura.
__________________
Corresponding editor: Jesús Ponce
828
1
829
2
INTRODUCTION
MATERIALS AND METHODS
In regions where fresh water is scarce, fish farming in
brackish or salt water can provide a source of extra
income (Dimaggio et al., 2009; Marengoni et al., 2010;
Jesus et al., 2011). Tilapias can be reared in this type of
environment provided gradual acclimatization procedures are adopted (Likongwe et al., 1996; Dominguez
et al., 2004). The Nile tilapia (Oreochromis niloticus)
is widely cultivated in fresh water; however, it tolerates
certain levels of salinity, being considered as
euryhaline. Despite its good adaptation capacity to
salinity, it is less tolerant than other species of tilapia
such as O. aureus and O. mossambicus (Kamal & Mair,
2005).
The way that each species of fish responds to
different salinity levels allows evaluation of the best
place for its culture. Thus, several studies have
evaluated the influence of this parameter on the
performance of euryhaline fish (Likongwe et al., 1996;
Boeuf & Payan, 2001; Tsuzuki et al., 2006; Luz et al.,
2008; Riche & Williams, 2010). Besides the performance it is necessary to evaluate the effect of the
salinity on fish health and organs (Árnason et al.,
2013). The digestive tube and the gills that remain in
direct contact with water and under physical and
chemical environment changes may suffer morphologic
alterations (Reis et al., 2009; Yuan et al., 2010). The
gills are vital structures for the fish health, being
involved in the processes of osmoregulation and
nitrogen composites excretion, as well as being the
main site for gaseous exchanges. Some functional
changes such as the gill epithelium chloride cells and
Na+-K+-ATPase activity were observed during the
adaptation of tilapia to saline water (Güner et al., 2005).
Thus, any damage to the filaments and branchial
lamellae that can interfere with their function, will
compromise the survival of these animals (Winkaler et
al., 2001; Reis et al., 2009).
Histopathological studies have been developed to
evaluate the effects of contaminants on fish health in
the environment and to help establish a causal
relationship between exposure to toxic substances and
various biological responses (Schwaiger et al., 1997).
There is an increased incidence of diseases and
pathological conditions in fish, as well as a variety of
aetiologies. This increase is an indicator of environmental stress and provides a definitive biological
endpoint of the history of exposure to a pollutant
(Schwaiger et al., 1997).
The aim of this study was to evaluate the performance, haematologic parameters and histological
characteristic of Nile tilapia gills submitted to different
levels of water salinity.
The experiment was carried out at Ilhéus city, Bahia,
Brazil (14º47’20”S, 39º02’58”W), during 45 days, with
300 juvenile (1.62 ± 0.01 g) Nile tilapia of Thai
ancestry, sexually reversed, bred in fresh water, in a
completely randomised design with four treatments
(salinity levels) and five repetitions.
The fish were distributed into 20 cylindrical
fibreglass tanks, with a useful volume of 100 L, at a
density of 15 fishes per tank. The tanks were placed in
a closed recirculation system in four groups, used with
biological filters through four water pumps, one for
each salinity level. Each tank received individual
aeration by means of porous stones fed by a 1 hp air
blower.
During the fish acclimatization period, the salinity
was raised by 2 g L-1 day-1 with seawater (35 g L-1)
replacing the fresh water from the experimental tanks.
The water salinity levels evaluated were 0, 7, 14 and 21
g L-1.
The fish were fed an extruded commercial feed with
360 g kg-1 crude protein, 70 g kg-1 ether extract, 130 g
kg-1 moisture, 120 g kg-1 mineral matter, 20 g kg-1
calcium, 10 g kg-1 phosphorus and 250 mg vitamin C
(guarantee levels). The feed was ground in a knife mill
with 1.0 mm sieve and supplied ad libitum four times a
day (07:00 am, 10:00 am, 01:00 pm and 04:00 pm).
Water-quality parameters were measured daily.
Dissolved oxygen, pH and temperature were measured
through multi-parameter devices (YSI model 55-12FT,
YSI Corporation, Owings Mills, MA, USA); salinity
was measured with a refractometer (Atago S/Mill-E,
Atago Co. Ltd., Tokio, Japan).
At the beginning of the experiment and after 45
days, all fish were weighed. The individual daily
consumption of feed was obtained by the ratio between
the total consumption of feed of each fish and the
experimental period. The daily weight gain was
calculated by difference between the final and initial
weights of each fish relative to the experimental period.
The feed conversion rate was calculated by the ratio
between the feed consumed and the weight gain at the
end of the experiment. The survival was calculated
through the ratio between dead and live individuals.
At the end of the experiment, after biometrics
measurements, four specimens were randomly selected
from each repetition for cardiac puncture blood
collection (after anaesthesia with benzocaine 0.1 g L-1)
with a syringe containing 10% EDTA (Ethylenediamine tetraacetic acid). The erythrocyte and
leukocyte counts were determined by dilution and
counting in a haemocytometer. The percentage of
830
3
haematocrits was carried out according to the
microhematocrit method.
One specimen (tilapia) of each treatment was
sacrificed (benzocaine) for the histopathological
examination of the gills. The material was fixed in 10%
formalin for a week and then preserved in 70% alcohol.
The gills of the most external gill arches were removed,
always on the right-hand side of the fish. The gills were
decalcified with EDTA for a period ranging from three
days to a week. The specimens were prepared for
histological analysis using an ethanol routine dehydration
technique, then impregnated and embedded in paraffin.
Sections of 5-7 m were made with a microtome. The
sections were stained with haematoxylin and eosin
(H&E) for visualisation of the affected tissues and
organs.
For a better understanding of the results, the
histopathological alterations were classified as scores
of 0 to 3, where 0 = no alteration, 1 = slight alteration,
2 = moderate alteration, and 3 = severe alteration. The
definitions slight, moderate and severe were modified
from Poleksic & Mitrovic-Tutundzic (1994) and are
characterised as follows: slight alteration (1) involves
changes that do not damage gill tissues so that the
restructuration and recovery of normal gill function can
occur with improvement of the environmental
conditions. These changes are limited to small parts of
the gills or some filaments; for example, slight
alteration of the epithelium of the primary lamella.
Moderate alteration (2) involves more severe changes
that lead to effects in tissues associated with the
functioning of the organ. These lesions are reparable,
but if wide areas of the gills are affected or maintained
in situations of chronic pollution, they can lead to
severe alterations, on practically the whole surface of
the gills, for example, the epithelial lifting of secondary
lamella. In cases of severe alteration (3), the recovery
of the gill structure is not possible, even with
improvement in water quality or no further exposure to
a toxic stimulus, for example, aneurysms. This scale
was used to determine the mean values of alteration
intensities for each treatment.
The presence of histopathological alterations for
gills was determined semi-quantitatively by the degree
of tissue alteration (Histopathological Alterations
Index - HAI), based on the severity of the injuries. In
the determination of the HAI (modified from Poleksic
& Mitrovic-Tutundzic, 1994), the alterations in each
organ were classified in progressive stages of tissue
damage (Table 1).
The HAI value was calculated for each animal using
the following formula:
HAI = (1X SI) + (10X SII) + (100X SIII),
where I, II and III correspond to the number of stages
of alterations 1, 2 and 3; and S represents the sum of the
number of alterations for each particular stage.
HAI values between 0 and 10 indicate normal
functioning of the organ; values 11 to 20 indicate slight
damage to the organ; 21 to 50 indicate moderate
alterations in the organ; values 50 to 100 indicate severe
lesions; and values >100 indicate irreparable lesions of
the organ (Poleksic & Mitrovic-Tutundzic, 1994).
Some cases were selected and photographed with the
use of a photomicroscope.
Data were analysed by ANOVA followed by
Tukey’s test (P < 0.05). To set the best water salinity
level was carried out the Regression analysis (P < 0.05).
The non-parametric Mann-Whitney test for independent samples with P < 0.05 was used for
comparison of anomaly intensity means between five
specimens of each treatment. The differences between
treatments were tested using non-parametric ANOVA.
The degree of significance was 95%. Statistical analyses
were carried out using the software R.
RESULTS
The addition of seawater to the fresh water did not
change the parameters of water quality, dissolved
oxygen, temperature and pH, monitored during the
experimental period, which had been similar (P > 0.05)
between the treatments and remained inside the
acceptable range for fish breeding (Table 2).
There was no effect (P > 0.05) of salinity levels on
daily feed intake, obtaining an average 0.54 g day-1. The
salinity levels affected the other variables of fish
performance (Table 3).
Water salinity levels had significant effect on the
daily weight gain (P = 0.0267), feed conversion rate (P
= 0.0072) and survival (P = 0.0005) of Nile tilapia. A
significant reduction of these parameters was observed
at 14 and 21 g L-1 of water salinity by Tukey’s test
analysis. Regression analysis showed a quadratic
behavior with better values for, respectively, daily
weight gain, feed conversion rate and survival of 5.62,
2.08 and 4.19 g L-1 of water salinity (Figs. 1, 3).
Regarding the haematological parameters evaluated,
it was observed that the haematocrit (P = 0.0001) and
the erythrocyte count (P = 0.0040) were influenced by
the water salinity level with higher values in 0 and 7 g
L-1; however, the leukocyte count did not change (P =
0.5376) regardless of the water salinity level (Table 4).
Regression analysis showed a quadratic behavior
with better values for, respectively, haematocrit and
erythrocyte count of 0.92 and 2.39 g L-1 of water
salinity (Figs. 4, 5).
4831
Table 1. List of histopathologic alterations observed in the gills of Oreochromis niloticus. I, II and II – Severity stages of
alterations.
Stage
I
II
III
Histopathologic alterations in the gills
Hypertrophy and hyperplasia of gill epithelium
Sanguineous congestion
Dilation of marginal vascular channels
Lifting of respiratory epithelium
Fusion and disorganisation of secondary gill lamellae
Shortening of secondary lamellae
Leukocyte infiltration of gill epithelium
Aggregation of cells of the primary lamella
Haemorrhage and rupture of lamellar epithelium
Hypertrophy and hyperplasia of mucous cells
Empty mucous cells or their disappearance
Hypertrophy and hyperplasia of chloride cells
Lamellar aneurism
Necrosis and cell degeneration
Lamellar telangiectasis
Table 2. Mean values and standard deviation of the physical and chemical parameters of the water of the experimental
tanks, in a accordance with the treatment.
Parameter
Dissolved oxygen (mg L-1)
Temperature (ºC)
pH
Salinity (g L-1)
0
4.75 ± 0.63
28.19 ± 1.25
7.06 ± 0.71
0.02 ± 0.01
Salinity (g L-1)
7
14
4.58 ± 0.13
4.51 ± 0.48
28.33 ± 1.10
28.27 ± 0.96
7.16 ± 0.11
7.14 ± 0.13
7.06 ± 0.71
13.75 ± 1.17
21
4.32 ± 0.45
28.31 ± 0.99
7.14 ±0.14
20.73 ± 1.59
Table 3. Performance and survival of Nile tilapia cultured in different salinity levels. *Significant, NS: not significant.
Means followed by different letters in the lines differ by Tukey’s test (P < 0.05).
Variable
Initial weight (g)
Daily feed intake (g day-1)
Daily weight gain (g day-1)
Feed conversion (g g-1)
Survival (%)
0
1.60 ± 0.21a
0.52 ± 0.01a
0.46 ± 0.01a
1.15 ± 0.10a
95.00 ± 5.53a
Salinity (g L-1)
7
14
1.63 ± 0.19a
1.61 ± 0.15a
0.57 ± 0.07a
0.52 ± 0.07a
a
0.52 ± 0.01
0.41 ± 0.02b
a
1.10 ± 0.02
1.28 ± 0.05b
a
97.33 ± 3.65
83.99 ± 3.64b
Regarding the histological analysis, Nile tilapia gills
have the same pattern as in other teleosts. The filament
is covered by a stratified epithelium in the interlamellar
region in which there are epithelial cells, melanocytes,
lymphocytes, macrophages, granulocytes and eosinophils, as well as chloride cells. The structure of the gill
arch and gill filaments shows mucosal cells. The
secondary lamella is covered by a squamous epithelium
that generally shows a thickness of one or two cell
layers. Below the epithelium there are lamellar blood
spaces that are bordered by pillar cells, which have a
contractile function. In the outermost region of the
21
1.62 ± 0.22a
0.53 ± 0.06a
0.42 ± 0.02b
1.29 ± 0.05b
80.83 ± 9.25b
F
2.54NS
2.79NS
3.64*
8.24*
15.87*
secondary lamella, there is a blood vessel that has an
internal covering of endothelium (Fig. 6).
The histopathological alterations observed in
Oreochromis niloticus were chloride cell hypertrophy,
epithelial lifting, structure alteration, telangiectasia,
aggregation of cells of primary lamellae, fusion and
occurrence of various sizes aneurysms in some
secondary lamellae.
Slight alterations were observed in the first
treatment, such as epithelial lifting and fusion of
secondary lamellae and severe alterations such as telan-
Figure 1. Effect of water salinity levels on the daily
weight gain of Nile tilapia.
8325
Figure 3. Effect of water salinity levels on the survival of
Nile tilapia.
respectively), indicating that individuals present
irreparable injury in the body and that even if water
conditions improve, the structure of the body cannot be
recovered (Table 5). The high average values is due to
the presence of aneurysms, which are regarded as a
serious injury, in almost all the individuals.
DISCUSSION
Figure 2. Effect of water salinity levels on feed
conversion rate of Nile tilapia.
giectasia in a few secondary lamellae. In salinity of 7 g
L-1, slight alterations were observed such as epithelial
lifting, fusion of secondary lamellae, aggregation of
cells in the primary lamella and severe alterations such
as telangiectasia and aneurysms in a few secondary
lamellae. In salinity of 14 g L-1 slight alterations were
observed such as bifurcation of secondary lamellae,
fusion of secondary lamellae, epithelial lifting and
severe alterations such as telangiectasia and aneurysms
with frequency higher than in previous treatments. In
salinity of 21 g L-1 a greater number of slight alterations
was observed, which were epithelial lifting, fusion of
secondary lamellae, change in the structure of
secondary lamellae, chloride cell hypertrophy, and
aggregation of cells of the primary lamella.
Telangiectasia and aneurysms were observed among
the severe alterations.
Only slight alterations (1) were found in salinities of
0, 7 and 14 g L-1 when we analysed the gills’ frequency
of infection intensity; in salinity of 21 g L -1 we
observed a high frequency of individuals with
moderate alterations (2) (Fig. 7).
The results of the Histopathological Alteration
Index (HAI) showed that in all treatments there were
averages above 100 (102.0, 136.7, 137.7 and 172.3,
The fish survival and growth can be influenced by the
water quality (Likongwe et al., 1996). The relationship
between salinity and fish growth seems to be complex,
because studies with different species have presented
varied results. Similar results were reported by
Likongwe et al. (1996), who evaluated different salinity
levels (0, 8, 12 and 16 g L-1) and water temperature (24,
28 and 32ºC) on the performance of juvenile Nile
tilapia (4.6 to 4.8 g), observing a better performance in
the highest temperatures evaluated, and a decrease from
8 g L-1 of water salinity. They also observed that the
combination between the salinity of 8 g L-1 and water
temperature of 32ºC resulted in better feed conversion
rate.
The best performance of the fish cultivated in the
lower water-salinity levels in this experiment can be
related to the energy cost for the ionic regulation, which
is lower when the fish are kept in an isotonic
environment, where ionic gradients between the blood
and the water are minimum, and this energy economy
can be directed towards growth (Boeuf & Payan, 2001).
Besides osmoregulation, the effect of water salinity
on the performance of fish can be explained by its
action upon digestive enzymes, where the exposure to
different salinities modifies the water ingestion,
altering the salinity of the intestinal content and
affecting the activity of digestive enzymes (Moutou et
al., 2004). This process can explain the worsening in
the alimentary conversion and consequent worsening of
the weight gain of tilapias in the highest salinities in this
experiment.
6833
Table 4. Hematological variables to Nile tilapia cultivated in different salinity levels. *Significant, NS: not significant.
Means followed by different letters in the lines differ by Tukey’s test (P < 0.05).
Variable
Haematocrit (%)
Erythrocyte (x106 µL-1)
Leukocyte (x103 µL-1)
Salinity (g L-1)
0
25.4 ± 1.82a
1.58 ± 0.20a
23.01 ± 8.63a
7
27.6 ± 1.72a
1.86 ± 0.29a
23.05 ± 10.21a
14
18.4 ± 1.34b
1.08 ± 0.15b
23.31 ± 7.04a
21
16.8 ± 3.11b
1.08 ± 0.15b
19.75 ± 3.11a
F
16.95*
7.77*
0.42NS
Figure 4. Effect of water salinity levels on the haematocrit
of Nile tilapia.
Figure 6. Histological sections of gills of Oreochromis
niloticus specimens: a) Normal gill (1: primary lamella,
2: secondary lamella, H&E, 400x), b-d) Histopathological
alterations. b and d) H&E 400x; c) H&E, 1000x; 3:
telangiectasis; 4: aggregation of cells of the primary
lamella; 5: hypertrophy of chloride cells; 6: intensive
epithelial lifting; 7: lamellar aneurysms.
Figure 5. Water salinity levels effect of upon erythrocyte
count of Nile tilapia.
In this study, although the leukocyte values were not
influenced (P > 0.05) by the different water salinity
levels, there was a decrease of these values with
increased salinity. This small difference between the
compared values may be due to the high standard
deviation.
The haematocrit and erythrocyte count found in this
study for the water salinity levels of 0 and 7 g L-1 were
similar to the reference erythrogram values for Nile
tilapia observed by Barros et al. (2009) and Teixeira et
al. (2012). However, for the salinity levels of 14 and 21
g L-1, the values were lower than those found by these
authors. The study of the haematological analyses
allows understanding of the influence of the nutritional
and environmental conditions on fish health (Ranzani-
Paiva & Silva-Souza, 2004). In this study, for the water
salinity levels of 0 and 7 g L-1, the blood parameters for
haematocrit percentage and erythrocyte and leukocyte
counts were adequate and indicated healthy fish as
described by Barros et al. (2009). In contrast, the
amounts obtained for the water salinity levels of 14 and
21 g L-1 were inadequate, suggesting that the fish may
have suffered stress caused by the higher levels of water
salinity.
The high variation between the haematological
parameters has also been shown by Ranzani-Paiva &
Silva-Souza (2004), who attributed this variation to
internal and external factors.
According to Aird (2000), the anaemia may be
characterised when two or more blood parameters are
below the normal average for the species. In this case,
the haematocrit and erythrocyte values support this
hypothesis for the water salinity levels of 14 and 21 g
L-1. The increased water salinity probably damaged the
erythropoiesis of juvenile tilapia, which could not main-
834
7
Table 5. Results of histopathological alteration index
(HAI) in each treatment. N: Number of individuals, M:
means, SD: standard deviation.
Salinity (g L-1)
0
7
14
21
Figure 7. Frequency of intensity of anomalies in gills, per
treatment, during the study period. 0: without alterations,
1: slight alteration, 2: moderate alteration, and 3: severe
alteration.
tain the minimum necessary production of erythrocytes
for health maintenance (Barros et al., 2009). Likewise,
the number of leukocytes, which are part of the
organism’s defence system, may have been reduced
(although not presenting a significant difference) as a
result of the stress caused by the highest salinity levels
evaluated, damaging the organism’s defence functions,
which can explain the highest mortality rates with the
highest water salinity levels.
Only a few micrometres separate the blood from the
water in the gills (Yada et al., 2012), which not only
facilitates the exchange of gases, but also allows the gill
tissue to be exposed to variations in the environment.
Consequently, the presence of toxic substances in the
environment causes alterations in the vital functions
carried out by the gills and alterations in the
morphologic structure of these organs (Poleksic &
Mitrovic-Tutundzic, 1994). Thus, the histopathological
analysis of fish gills has been used as a tool that is
extremely important in the evaluation of the quality of
aquatic ecosystems.
Physical and chemical changes in this ecosystem are
rapidly reflected as quantifiable physiologic measurements in the fish. In general, reactions of the fish gills
due to an irritant include inflammation, hyperplasia,
lamellar fusion, excessive production of mucus,
epithelial lifting, flattening of the secondary lamella
and formation of aneurysms. Inflammation,
hyperplasia, secretion of mucus and aneurysms were
also observed in O. niloticus, demonstrating that the
gills of these individuals had been affected by the action
of various stressors (Schwaiger et al., 1997). Because
of the epithelial lifting, there is an increase in the
distance between the water and blood, impairing
oxygen uptake. However, in these conditions, the fish
increase their rate of respiration by compensating for
the low entrance of oxygen (Emmanouil et al., 2008).
N
5
5
5
5
Means of HAI SD
102.0
54.4
136.7
45.3
137.7
44.5
172.3
0.9
According to Winkaler et al. (2001), these types of
histopathological lesions indicate that the fish respond
to the effects of toxic agents present in the water.
In this study, the high frequency of occurrence of
telangiectasia and aneurysms may be associated with
salinity. Stentiford et al. (2003) found an increased
frequency of aneurysms in specimens captured in
contaminated areas. These authors observed that these
lesions, which cause disturbances in blood flow in the
fish gills, can be associated with the presence of
irritants in the water. Therefore, the presence of these
alterations can be useful biomarkers for certain
substances. Histopathological alterations such as
lamellar aneurysm and epithelial lifting were also
observed by Winkaler et al. (2001) in different species.
The results of this study demonstrate that Nile
tilapia can be raised in environments with moderate
levels of water salinity. Up to 7 g L-1 were not observed
negative effects on growth, survival and haematological parameters by Tukey’s test, although by
Regression analysis were observed the best results for
daily weigh gain, feed conversion rate and survival,
respectively, with 5.62, 2.08 and 4.20 g L-1 of water
salinity; and worsening trend in the haematological
parameters from 0.92 g L-1 (erythrocyte count) and 2.39
g L-1 (haematocrit). Regarding the histological changes
in the gills slight alterations were found in salinities of
0, 7 and 14 g L-1 and moderate alterations were
observed in salinity of 21 g L-1, showing the
deleterious effects of higher salinities over the gills of
Nile tilapia.
REFERENCES
Aird, B. 2000. Clinical and hematological manifestations
of anemia. In: B.F. Feldman, J.G. Zinkl & N.C. Jain
(eds.). Schalm’s veterinary hematology. Lippincott
Williams & Wilkins, Philadelphia, 140-142 pp.
Árnason, T., B. Magnadóttir, B. Björnsson, A. Steinarsson
& B.T. Björnsson. 2013. Effects of salinity and
temperature on growth, plasma ions, cortisol and
immune parameters of juvenile Atlantic cod (Gadus
morhua). Aquaculture, 380-383(4): 70-79.
Barros, M.M., M.J.T. Ranzani-Paiva, L.E. Pezzato, D.R.
Falcon & I.G. Guimarães. 2009. Haematological
8835
response and growth performance of Nile tilapia
(Oreochromis niloticus) fed diets containing folic acid.
Aquacult. Res., 40(8): 895-903.
Boeuf, G. & P. Payan. 2001. How should salinity
influence fish growth? Comp. Biochem. Physiol. C,
Toxic. Pharmacol., 130(4): 411-423.
DiMaggio, M.A., C.L. Ohs & B.D. Petty. 2009. Salinity
tolerance of the Seminole killifish, Fundulus
seminolis, a candidate species for marine baitfish
aquaculture. Aquaculture, 293(1-2): 74-80.
Dominguez, M., A. Takemura, M. Tsuchiya & S.
Nakamura. 2004. Impact of different environmental
factors on the circulating immunoglobulin levels in the
Nile tilapia, Oreochromis niloticus. Aquaculture,
241(1-4): 491-500.
Emmanouil, C., R.M. Green, F.R. Willey & J.K. Chipman.
2008. Oxidative damage in gill of Mytilus edulis from
Merseyside, UK, and reversibility after depuration.
Environ. Pollut., 151(3): 663-668.
Jesus, L.S.F., R.V. Azevedo, J.S.O. Carvalho & L.G.T.
Braga. 2011. Farelos da vagem da algaroba e da folha
da mandioca em rações para juvenis de tilápia do Nilo
mantidos em água salobra. Rev. Bras. Saúde Prod.
Anim., 12(4): 1116-1125.
Güner, Y., O. Özden, H. Çagirgan, M. Altunok & V.
Kizak. 2005. Effects of salinity on the osmoregulatory
functions of the gills in Nile tilapia (Oreochromis
niloticus). Turk. J. Vet. Anim. Sci., 29: 1259-1266.
Kamal, A.H.M.M. & G.C. Mair. 2005. Salinity tolerance
in superior genotypes of tilapia, Oreochromis
niloticus, Oreochromis mossambicus and their
hybrids. Aquaculture, 247(1-4): 189-201.
Likongwe, J.S., T.D. Stecko, J.R. Stauffer-Jr. & R.F.
Carline. 1996. Combined effects of water temperature
and salinity on growth and feed utilization of juvenile
Nile tilapia, Oreochromis niloticus (Linnaeus).
Aquaculture, 146(1-2): 37-46.
Luz, R.K., R.M. Martínez-Álvarez, N. De-Pedro & M.J.
Delgado. 2008. Growth, food intake regulation and
metabolic adaptations in goldfish (Carassius auratus)
exposed to different salinities. Aquaculture, 276(1-4):
171-178.
Marengoni, N.G., D.M. Albuquerque, F.L.S. Mota, O.P.
Passos-Neto, A.A. Silva-Neto, A.I.M. Silva & M.
Ogawa. 2010. Performance and sexual proportion in
red tilapia under inclusion of probiotic in mesohaline
water. Arch. Zootec., 59(227): 403-414.
Moutou, K.A., P. Panagiotaki & Z. Mamuris. 2004.
Effects of salinity on digestive protease activity in the
euryhaline sparid Sparus aurata L.: a preliminary
study. Aquacult. Res., 35(9): 912-914.
Received: 10 October 2014; Accepted: 8 April 2015
Poleksic, V. & V. Mitrovic-Tutundzic. 1994. Fish gills as
a monitor of sublethal and chronic effects of pollution.
In: R. Müller & R. Lloyd (eds.). Sublethal and chronic
effects of pollutants on freshwater fish. Cambridge
University, Cambridge, pp. 339-352.
Ranzani-Paiva, M.J. & A.T. Silva-Souza. 2004.
Hematologia de peixes brasileiros. In: M.J. RanzaniPaiva, R.M. Takemoto & M.A.P. Lizama (eds.).
Sanidade de organismos aquáticos. Editora Varela,
São Paulo, pp. 89-120.
Reis, A.B., D.M.G. Santana, J.F. Azevedo, L.S. Merlini &
E.J.A. Araújo. 2009. The influence of the aquatic
environment in tanks sequentially interconnected with
PVC pipes on the gill epithelium and lamellas of
tilapia (Oreochromis niloticus). Pesq. Vet. Bras.,
29(4): 303-311.
Riche, M. & T.N. Williams. 2010. Apparent digestible
protein, energy and amino acid availability of three
plant proteins in Florida pompano, Trachinotus
carolinus L. in seawater and low-salinity water.
Aquacult. Nutr., 16(3): 223-230.
Schwaiger, J., R. Wanke, S. Adam, M. Pawert, W. Honnen
& R. Triebskorn, R. 1997. The use of histopathological
indicators to evaluate contaminant-related stress in
fish. J. Aquat. Ecosyst. Stress Recovery, 6(1): 75-86.
Stentiford, G.D., M. Longshaw, B.P. Lyons, G. Jones, M.
Green & S.W. Feist. 2003. Histopathological
biomarkers in estuarine fish species for the assessment
of biological effects of contaminants. Mar. Environ.
Res., 55(2): 137-159.
Teixeira, C.P., M.M. Barros, L.E. Pezzato, A.C.
Fernandes, J.F.A. Koch & C.R. Padovani. 2012.
Growth performance of Nile tilapia, Oreochromis
niloticus, fed diets containing levels of pyridoxine and
haematological response under heat stress. Aquacult.
Res., 43(8): 1081-1088.
Tsuzuki, M.Y., J.K. Sugai, J.C. Maciel, C.J. Francisco &
V.R. Cerqueira. 2006. Survival, growth and digestive
enzyme activity of juveniles of the fat snook
(Centropomus parallelus) reared at different salinities.
Aquaculture, 271(1-4): 319-325.
Winkaler, E.U., A.G. Silva, H.C. Galindo & C.B.R.
Martinez. 2001. Histological and physiological
biomarkers to assess fish health in Londrina streams,
state of Paraná. Acta Sci., 23(2): 507-514.
Yada, T., S.D. Mccormick & S. Hyodo. 2012. Effects of
environmental salinity, biopsy, and GH and IGF-I
administration on the expression of immune and
osmoregulatory genes in the gills of Atlantic salmon
(Salmo salar). Aquaculture, 362-363(1): 177-183.
Yuan, X., H. Yang, L. Wang, Y. Zhou & H.R. Gabr. 2010.
Effects of salinity on energy budget in pond-cultured
sea cucumber Apostichopus japonicus (Selenka)
(Echinodermata: Holothuroidea). Aquaculture, 306(2):
348-351.
Lat. Am. J. Aquat. Res., 43(5): 836-844,Effects
2015 of protein and carbohydrate on juveniles of Samastacus spinifrons
8361
Research Article
Effects of different protein and carbohydrate contents on growth and survival
of juveniles of southern Chilean freshwater crayfish, Samastacus spinifrons
Italo Salgado-Leu1 & Albert G.J. Tacon2
Escuela de Acuicultura, Universidad Católica de Temuco. Rudecindo Ortega 02950, Temuco, Chile
2
Aquatic Farms Ltd., 49-139 Kamehameha Hwy, Kaneohe, HI96744, USA
1
Corresponding author: Italo Salgado Leu ( [email protected])
ABSTRACT. In cultivated aquatic organisms nutritional requirements are critical, not only for their impact on
production techniques, but also, for their high incidence on production costs. There is limited knowledge on
some species such as the southern Chilean freshwater crayfish, Samastacus spinifrons. In order to generate
practical knowledge, a study was carried out to determine protein and carbohydrate content requirements. These
factors were evaluated upon their effects on growth and survival of juveniles. For this purpose, individual
weight, biomass gain, survival, and feed conversion parameters were measured. The assay was carried out in 42
days, It was conducted in a flow through system, using 21 plastic tanks of 10.6 L capacity. Each tank was seeded
with 20 juveniles weighing 50 mg average each. A 3x2 factorial design was proposed with three protein contents
(20, 30, 40%) and two carbohydrate contents (low: from 16.3 to 23.5% and high: from 34.6 to 35.8%). Six
treatments and three replicates were performed. Individuals were fed on apparent satiation once a day. The diets
formulated with 30% of protein and the two carbohydrate contents resulted in higher biomass increases, food
conversion efficiencies over 26%, and specific growth rate of 0.78%, all displaying significant differences.
Survival showed highly significant differences; in all diets were superior to 60%, however the diets with 30%
of protein surpassed 90%.
Keywords: Samastacus spinifrons, Crustacea, diets, protein-carbohydrate content, southern Chile.
Efecto de diferentes niveles de proteína y carbohidratos sobre el crecimiento y
sobrevivencia de juveniles del camarón de río del sur de Chile, Samastacus spinifrons
RESUMEN. En organismos cultivados, los requerimientos nutricionales, resultan ser de suma importancia, no
sólo por sus impactos en las técnicas de producción, sino también por su alta incidencia en los costos de
producción. Este conocimiento es escaso en algunas especies como el camarón de río del sur de Chile,
Samastacus spinifrons. A fin de generar un conocimiento práctico, se definieron los requerimientos de proteínas
y de carbohidratos y se evaluaron sus efectos en el crecimiento y supervivencia de juveniles. Para esto, se midió
peso individual, biomasa ganada, supervivencia y parámetros de conversión alimenticia. La parte experimental
se realizó en un sistema de flujo abierto, conformado por 21 estanques de plástico con capacidades de 10,6 L,
durante un periodo de 42 días. Se sembraron 20 individuos en cada estanque con pesos individuales de 50 mg
en promedio cada uno. Se propuso un diseño factorial de 3x2 con tres niveles de proteína (20, 30 y 40%) y dos
niveles de carbohidrato (bajo: 16,3 a 23,5% y alto: 34,6 a 35,8%). Se desarrollaron seis tratamientos con tres
réplicas. Los individuos fueron alimentados a aparente saciedad, una vez al día. Las dietas con 30% de contenido
proteínico con ambos niveles de carbohidratos ofrecieron incrementos de biomasa más altos, eficiencia de
conversión alimenticia de 26% y tasa de crecimiento específico de 0,78%, todos ellos con diferencias
significativas. La supervivencia presentó diferencias altamente significativas, si bien en todas las dietas fue
superior al 60%, en las dietas con 30% de proteína supeó el 90%.
Palabras clave: Samastacus spinifrons, Crustacea, dietas, niveles de proteínas y carbohidratos, sur de Chile.
INTRODUCTION
In the Astacidea field, several investigations on the
cultivation of species have been performed, the Astacus
____________________
Corresponding editor: Mauricio Laterça
and Austropotamobius in Europe, the Pacifastacus and
Procambarus in North America, and the Cherax in
Australia and South America (Celada et al., 1989;
Ackefors et al., 1992; Webster et al., 1994; Jones,
1995; Ghiasvand et al., 2012; Xu et al., 2013).
2837
Chile is a country located in South America,
sustaining one of the most intensive fish farming
activities for salmon, and sharing with Norway the first
places in salmon production (FAO, 2014). However,
the country’s intention is to diversify its aquaculture
activities towards other potential species. Thus, Chile
has implemented a National Aquaculture Policy to
fulfill this purpose. Among the species, with
possibilities to diversify the aquaculture, four species of
the family Parastacidae reported along the Chilean
coast are identified. However, most of the attention has
been drawn towards the southern Chilean crawfish,
Samastacus spinifrons, characterized by its good flavor
and corporal size. The existing data on S. spinifrons, is
mostly on its biology (Rudolph, 2002, 2015) and on
some preliminary production tests done by Fundación
Chile (Augsburger, 2003). However, in order to reach
an effective development of the cultured species, it is
necessary to have the base of seed production to assure
the following grow-out phase. A fundamental aspect to
succeed with its culture is the knowledge of juvenile
nutritional requirements (Saoud et al., 2012), from
weaning to juvenile size, that allow them to be placed
under growing techniques. S. spinifrons passes the
larval period in the abdominal cavity of gravid females
(Rudolph, 2002) as any other astacids (Jones, 1995)
which is an advantage for cultural purposes. Protein
will then be relevant to consider in for further stages, to
generate information on their protein requirements.
Probably in a similar way done for most practical
shrimp diets based upon cost and growth response
(Lim, 1997). Both elements are imperative to evaluate
different protein dietary content and determine the
optimal content to sustain maximum growth.
Taking into account the above-mentioned considerations, and the nutritional importance in culturing
production of aquatic species for juvenile S. spinifrons,
the present study was performed to establish a protein
content requirement, by setting up a factorial design
(3x2) formulating diets with three different protein
contents (20, 30 and 40%) and two carbohydrate
contents (low and high).
The assay was carried out at Universidad Católica de
Temuco (UC Temuco) Aquaculture Department, and
was conducted in a flow through system, using 21
rectangular plastic tanks of 10.6 L capacity with an
open flow (Q) of 0.12 L min-1 with constant aeration.
PVC pipe pieces of 1.27 cm diameter and length of 4
cm were placed into each tank as shelter elements.
Twenty juveniles weighing 49.6 ± 4.82 mg were seeded
into each tank and were maintained for 42 days. Six
diets were formulated to contain three contents of
protein and two relative carbohydrate contents. A 3×2
factorial design with three replicates per dietary
treatment was used in this study. Diets were prepared
with the ingredients indicated in Table 1. The feed
formulation model was developed using an Excel
software (Table 2) with the following factors and
contents: three protein contents (20, 30 and 40%) and
two carbohydrate contents (low: from 16.3 to 23.5%
referred to as: “C low” and high: from 34.6 to 35.8%,
named as: “C high”) (Table 3). Selected ingredients and
prepared diets were analyzed at UC Temuco
Aquaculture Department in the Nutritional Laboratory
according to the Official Methods of Analysis (AOAC,
1998).
For the food preparation, each grounded ingredient
was passed through a 300 µm mesh size and weighed
the recommended quantity according to the formulation. In the manufacture process of the experimental
diets, dry ingredients, except wheat flour, were mixed
during 40 min in a blender machine (Kitchen aid; model
K5SS). Separately, wheat flour was hydrated and put
under a cooking process for 15 min. The resulting
gelatinized wheat was mixed with fish oil and a capsule
of vitamin E (antioxidant). Finally, the oily gelatinized
wheat was combined with other dry ingredients for
further 45 min.
A meat grinder machine RCA (1 HP) with a matrix
screen of 1.5 mm orifices was used to make different
pelleted diets. The pellets were dried during 36 h at
55°C and later stored under freezing conditions
(-20ºC). The juveniles were fed once per day at same
time and mortality was checked and removed.
The amount of food provided in each diet was
registered on a daily basis. The uneaten diet in each
tank was removed every day before feeding with a
suction tube and stored in separate recipients into the
refrigerator, depending of the experimental unit. After
seven days, the removed uneaten diet was defrosted and
dried in a 55°C oven for 24 h. The removed uneaten
diet was discounted from the food placed into each tank
and then, the actual food consumption for each tank
was determined.
Individual weight was measured at the beginning
and at the end of the experiment (day 42) with a
Sartorious analytical scale (capacity of 217 g and
precision of 0.0001 g).
Growth parameters were calculated and evaluated:
individual weight gain (mg), specific growth rate
(SGR), biomass gain (%), and survival (%). Nutritional
parameters were also evaluated: feed conversion ratio
and feed conversion efficiency (%), according to De la
Higuera (1987) and Bureau et al. (2002).
8383
Effects of protein and carbohydrate on juveniles of Samastacus spinifrons
Table 1. Proximate composition (%) of ingredients used in the formulation of diets tested on Samastacus spinifrons
juveniles.
Crude protein Ether extract Nitrogen-free extract Crude fiber
Ingredients
Fishmeal
73.59
7.25
1.35
1.19
Blood meal
87.53
1.71
2.59
1.92
Lupine meal
49.23
10.59
32.73
3.64
Lupine fiber meal
3.00
0.70
35.40
50.10
Carrot meal
12.56
2.51
55.23
13.74
Kelp meal
14.89
0.65
56.27
5.75
Wheat meal
11.27
1.93
83.36
2.30
Fish oil
100.00
Ash
16.62
6.25
3.81
2.60
15.96
22.44
1.14
Water
10.34
5.44
9.33
8.20
16.19
23.25
12.65
Table 2. Composition of experimental diets (%), according to ingredient participation. CP: crude protein, C: carbohydrate.
Diets
Ingredients
20%CP 20%CP
C low
C high
Fish meal
24.8
2.1
Blood meal
1.0
2.0
Lupine meal
1.0
30.4
Lupine fiber meal
38.0
29.6
Carrot meal
5.0
5.0
Kelp meal
4.0
4.0
Wheat meal
2.5
15.6
Fish oil
7.8
6.3
Vitamins and minerals
1.5
1.5
Inorganic
14.4
3.5
Normality, homoscedasticity and independence
were tested previously on recollected data, then a twoway analysis of variance was applied to determine its
interactions. If significant (P < 0.05) differences were
found, Tukey tests were used to compare averages
between treatments. In each carbohydrate content,
protein diet contents were compared by one-way
ANOVA followed by a Tukey test. All values were
calculated using Minitab statistical software (version
16.1, Minitab State College, PA, USA).
Electric heaters kept the water temperature at
approximately 18ºC. Dissolved oxygen (5.2 ± 0.6 and
pH (7.0 ± 0.2) were measured with YSI-85 equipment.
RESULTS
Growth parameters such as individual weight gain
(mg), SGR, biomass gain (%), food conversion rate
(FCR), food conversion efficiency (FCE-%) and
survival rate (%) of S. spinifrons juveniles are shown in
Table 4. No significant interactions (P > 0.05) were
found for individual weight gain and SGR. Biomass
gain and FCR were significantly high for diets with
30%CP 30%CP
C low C high
23.0
4.0
14.0
3.9
2.1
47.4
36.0
14.5
5.0
5.0
4.0
4.0
2.6
16.0
4.7
1.6
1.5
1.5
7.1
2.1
40%CP 40%CP
C low C high
23.1
1.0
23.0
21.0
8.0
41.5
30.5
0.1
5.0
5.0
4.0
4.0
2.6
24.8
2.0
0.1
1.5
1.5
0.3
1.0
30% CP followed by 20% CP in interactions with low
carbohydrate concentration contents. 30% CP+C low
exhibited significantly higher FCE than other
combinations. Survival for 30% CP + C low was the
highest value (95%) however, differences only showed
to be significant with 20% CP + C low.
Protein content behavior under relative low
carbohydrate content, offered better growth values than
relative high carbohydrate content, not only in biomass
gain (Fig. 1), but also in all the other parameters
measured (individual weight gain, SGR, FCR, and
FCE). Survival had a punctual significant exception in
20% CP with C low (62.5%). Highest values were
significantly recorded at 30% CP for biomass gain,
FCR and FCE. For SGR, FCR and FCE, 30% CP was
significantly different to 20% and 40% CP. For survival
at C low significant differences were presented in all
CP content, being 30% CP the best. At relative high
carbohydrate content, there were no significant
differences between protein contents. Curves for
relative high carbohydrate content showed more
flattened tendency form than relative low carbohydrate
content.
4839
Table 3. Proximate composition analysis (%) of experimental diets. CP: crude protein, C: carbohydrate.
Diets
Crude protein Ether extract Nitrogen-free extract Crude fiber Ash Water
20% CP+C low
20% CP+C high
30% CP+C low
30% CP+C high
40% CP+C low
40% CP+C high
20.8
19.4
30.5
29.5
41.1
41.0
6.7
6.8
9.5
4.4
5.3
2.3
23.5
34.6
22.2
34.9
16.3
35.8
21.4
18.9
19.8
11.2
18.6
3.5
23.6
7.3
14.2
6.3
7.4
5.5
4.1
13.0
3.8
13.7
11.4
11.9
Table 4. Samastacus spinifrons. Growth and survival of juveniles after 42 days of feeding on experimental diets containing
different crude protein (20%, 30%, 40%), and relative carbohydrate contents (C high, C low) in diets. Different letters
indicate significant difference (P < 0.05). SGR: specific growth rate, FCR: food conversion rate, FCE: food conversion
efficiency.
20%
Parameters
Individual weight gain (mg)
SGR
Biomass gain (%)
FCR
FCE (%)
Survival (%)
C low
18.15 ± 0.91
0.67 ± 0.01
28.15 ± 3.18ab
3.18 ± 0.07ab
31.44 ± 0.69b
62.5 ± 3.54b
30%
C high
16.30 ± 3.39
0.63 ± 0.09
19.25 ± 0.91b
3.34 ± 0.35b
30.09 ± 3.16b
85.0 ± 0.00a
In both carbohydrate cases (relative low and high
contents), growth parameters increased their performance from 20% up to 30% CP and then descended to
40% CP. Mean biomass gain data was fitted to a
quadratic model to estimate the protein requirement
according to the dose-response relationship. Optimum
and maximum protein requirements were obtained by
applying the following quadratic model: y = -1080x2 +
618.6x - 52.35 (determination coefficient R2 = 0.927).
Calculations indicate the corresponding optimum
protein content to be 28.6% CP at low carbohydrate
content (Fig. 1), other parameters modelled followed
the same pathway. Each curve models for
corresponding parameters can be seen in Figure 1.
DISCUSSION
In the present study, 30% CP + C low, showed
significantly better results in evaluating the growth
parameters such as biomass gain, FCR and FCE.
Individual weight gain and SGR showed similar values
with no significant differences. Survival was higher
than 82% for most combinations except for 20% CP+C
low (62%).
Dietary protein content have been studied for other
crustacean species such as Macrobrachium rosenbergii,
ranging from 150 to 400 g kg-1 (Balazs & Ross, 1976;
New et al., 1980; D’Abramo & Reed, 1988; Mitra et
C low
20.25 ± 0.63
0.83 ± 0.01
36.00 ± 1.83a
2.32 ± 0.14a
43.15 ± 2.63a
95.0 ± 0.00a
C high
18.05 ± 0.77
0.72 ± 0.09
22.70 ± 1.98b
3.74 ± 0.06b
26.72 ± 0.43b
92.5 ± 3.53a
40%
C low
13.90 ± 1.69
0.57 ± 0.04
22.25 ± 1.20b
3.73 ± 0.30b
26.86 ± 2.19b
82.5 ± 3.54a
C high
16.90 ± 2.68
0.65 ± 0.07
19.3 ± 1.41b
3.98 ± 0.37b
25.2 ± 2.39b
85.0 ± 0.0a
al., 2005; Teshima et al., 2006). High dietary protein
content (500 g kg-1) reported maximum growth of M.
rosenbergii post larvae (Heinen & Mansi, 1991). If the
dietary protein content are too low (diet with 230 g kg-1
CP) the growth rate will be reduced (Balazs & Ross,
1976); Boonyaratpalin & New (1982) and Bartlett &
Enkerlin (1983) (diet with 150 g kg-1 CP) and Zaki et
al. (2002) (diet with 150-250 g kg-1 CP). This may be
due to the utilization of protein by M. rosenbergii
muscle tissue to maintain other vital functions (Goda,
2008). On the other side, growth depression was
reported in prawn fed diets exceeding their protein
requirement due to the excess dietary protein being
metabolized by prawns as a source of energy and
nitrogen excreted as ammonia (Burford et al., 2004).
Hari & Kurup (2003) suggested that further increase
over 300 g kg-1 CP in dietary protein does not have any
added advantage in M. rosenbergii. Moreover, for 400500 g kg-1 CP resulted in growth depression as it can
also be seen in the present work.
These protein contents are within 30-35% CP
requirements for juvenile M. rosenbergii (D’Abramo &
New, 2000). Ackefors et al. (1992) suggested that
commercial diets for juvenile Astacus astacus may
contain approximately 30-35% protein, 20-25%
carbohydrate and not more than 10% lipids for the best
growth rate. Ghiasvand et al. (2012) expressed that
Astacus leptodactylus can be fed a practical diet
containing 30% protein content. Celada et al. (1989)
840
5
Individual weight gain (mg)
25
1
y = -422.5x2 + 232.25x - 11.4
R² = 0.9383
20
SGR
a
a
0,8
b
ab
15
b
0,6
b
y = -145x2 + 90x + 4.1
R² = 0.197
10
y = -8.3333x2 + 5.1x - 0.0567
R² = 0.3838
0,4
0,2
5
Low carbohydrate
High carbohydrate
0
10%
20%
30%
10%
40%
20%
10
FCR
4
b
20
y = -342.5x2 + 205.75x - 8.2
R² = 0.7762
5
-1080x2
+ 618.5x - 52.35
R² = 0.9502
Low carbohydrate
0
10%
20%
High carbohydrate
30%
40%
a
y = 113.67x2 - 65.433x + 11.72
R² = 0.9628
1
Low carbohydrate
10%
20%
10
y = -750x2 + 450x + 25
R² = 0.9
100
b
a
80
b
20
40%
Survival (%)
120
a
30
30%
Diet protein level
FCE
40
High carbohydrate
0
Diet protein level
50
b
b
3
2
y=
40%
y = -18.833x2 + 13.45x + 1.4033
R² = 0.3891
ab
25
15
5
a
30
30%
Diet protein level
Biomass gain (%)
35
High carbohydrate
Low carbohydrate
0
Diet protein level
40
y = -20.667x2 + 11.9x - 0.88
R² = 0.9735
y = 93.667x2 - 80.667x + 42.483
R² = 0.7029
y = -1400x2 + 817.1x - 75.98
R² = 0.972
Low carbohydrate
High carbohydrate
b
60
c
40
20
y = -2250x2 + 1450x - 137.5
R² = 0.9847
Low carbohydrate
High carbohydrate
10%
30%
0
0
10%
20%
30%
40%
Diet protein level
0%
20%
40%
50%
Diet protein level
Figure 1. Protein content curves behavior of growth parameters and survival under low and high carbohydrate content in
juveniles of Samastacus spinifrons. Same letters above points at low carbohydrate curve mean no significant differences.
High carbohydrate curves did not present significant differences.
reported that the best growth of juvenile Pacifastacus
leniusculus was obtained with diets containing 27-33%
protein from several fresh and artificially compounded
diets and Gonzalez et al. (2012) expressed that a 40%
of protein can be suitable in commercial dry diets for
this species. For Cherax quadricarinatus, Webster et
6841
al. (1994) indicated that a diet formulated with 33%
protein appeared to be adequate for juvenile phase,
whereas Zenteno-Savin et al. (2008) stated that 31% of
protein is the content to satisfy nutritional requirements
for optimal growth. Xu et al. (2013) reported that 2730% protein diet provided the same growth efficiency
for Procambarus clarkia, P. leniusculus and P. clarkia.
These last species seem to be closer to S. spinifrons in
protein requirements than Cherax, which could be
explained due temperature dependence as Cherax are
more tropical than other colder species.
Several statistical methods can be used to estimate
nutrient requirements in dose-response experiments
based on mathematical and biological assumptions and
principles (Shearer, 2000). Estimates of requirements
for maximum growth were obtained by fitting doseresponse data to a quadratic model. The results that S.
spinifrons juveniles required between 28 and 29%
dietary crude protein for optimum growth as a result to
apply a model found (y = -1080x2 + 618.6x - 52.35). In
this sense, Cortes et al. (2003) expressed protein requirement of 31%, calculated for C. quadricarinatus from
using the same second order polynomial model than
this present study (y = -0.0071x2 + 0.484x + 1.142).
From a nutritional point of view, protein utilization
indexes can be considered as good indicators of
“protein sparing effect” (Goda, 2008). In the present
study, the diet containing a protein content of 30% CP
+ C low, provided the highest growth indexes and
dietary protein utilization efficiency compared with the
higher dietary carbohydrate content. These results
suggest that S. spinifrons could be using dietary
carbohydrate as main energy source at lower contents
to spare dietary protein for maximum growth. Similar
results were obtained by D’Abramo & New (2000), and
also by Goda (2008) for M. rosenbergii.
Best FCR was presented at 30% CP + C low (2.32),
less than those obtained by Jones et al. (1996) for C.
destructor and Cortes et al. (2003) for C.
quadricarinatus. Hari & Kurup (2003) reported their
better FCR (2.84 and 2.89 for 300 and 350 g kg-1 CP
diet, respectively) for M. rosenbergii juveniles,
comparable with results obtained by Millikin et al.
(1980), Ashmore et al. (1985) and Gomez et al. (1988).
The decreased growth rate showed by juveniles over
40% CP can be attributed to the high rate of protein
catabolism (Hari & Kurup, 2003). Growth depression
was already reported in prawn fed diets exceeding their
protein requirement as a result of toxicity (Zein-Eldin
& Corliss, 1976).
Regarding carbohydrate utilization, Bautista &
Subosa (1997) mentioned that protein contents in diets
improve growth when combined with carbohydrate
contents. This means that carbohydrate is used as an
economical energy source. In this study, two relative
contents of carbohydrate were used: low content (16.3
to 23.5%) and high content (34.6 to 35.8%). Results
showed that low relative content is enough to keep
better growth parameters. In this sense, carbohydrate is
used to build quitine (main component of exoskeleton)
and also a component of fatty acids and sterols (Clifford
& Brick, 1978; Kucharski & Da Silva, 1991; CruzSuarez, 1996). Diaz-Herrera et al. (1992) reported
carbohydrates as main energy sources for metabolic
requirements in post larvae and juveniles of M.
rosenbergii; later supported by Luna et al. (2007).
Rosas et al. (2000) stated the possibility to reduce
protein contents in diets by carbohydrates included as
starch ingredient.
Survival for CP + Carbohydrate combinations
showed values higher than 82%, except in 20% CP + C
low (62.5%). They can be compared with others.
Survival values during a period up to 94 days ranged
between 65-85% for C. destructor (Jones et al., 1996).
For C. quadricarinatus, Ponce et al. (1998) 60-95% of
survival rate; Webster et al. (1994) 50-71%; Thompson
et al. (2003a) 56-80%; Thompson et al. (2003b) 95100%; Jacinto et al. (2003) 65-89%; and Muzinic et al.
(2004) 79-98%. Mortality may be associated to
nutrition variations in the diet and experimental
conditions. A survival rate above 50% between
stocking and harvesting has been considered to be
acceptable by New & Singholka (1985) and Valenti
(1990); but Cuzon & Guillaume (1997) reported that
survival rates greater than 80% was considered good in
crustacean studies.
REFERENCES
Ackefors, H., J.D. Castell, L.D. Boston, P. Raty & M.
Svensson. 1992. Standard experimental diets crustacean nutrition research. II. Growth and survival of
juvenile crayfish Astacus astacus (Linné) fed diets
containing various amounts of protein, carbohydrate
and lipid. Aquaculture, 104: 341-356.
Association of Analytical Chemist (AOAC). 1998.
Official methods of analysis. Association of Analytical
Chemist, Washington DC, 1018 pp.
Ashmore, S.B., R.W. Stanley, L.B. Moore & S.R.
Malecha. 1985. Effect on growth and apparent
digestibility of diets varying in grain source and
protein level in Macrobrachium rosenbergii. J. World
Maricult. Soc., 16: 205-216.
Augsburger, A. 2003. La experiencia de cultivo de
camarón de río del sur Samastacus spinifrons en Chile.
Libro Resúmenes del Primer Seminario Internacional
de Astacicultura: Avances y perspectivas del cultivo
de crustáceos de agua dulce. Puerto Varas, pp. 2-12.
Balazs, G.M. & E. Ross. 1976. Effect of protein source
and level on growth performance of the captive
freshwater prawn. Aquaculture, 76: 299-313.
Bartlett, P. & E. Enkerlin. 1983. Growth of the prawn
Macrobrachium rosenbergii in asbestos asphalt ponds
in hard water and on a low protein diet. Aquaculture,
30: 353-356.
Bautista, M. & P. Subosa. 1997. Changes in shrimp feed
quality and effects on growth and survival of Penaeus
monodon juveniles. Aquaculture, 151: 121-129.
Boonyaratpalin, M. & M.B. New. 1982. Evaluation of
diets for Macrobrachium rosenbergii reared in
concrete ponds. In: M.B. New (ed.). Developments in
aquaculture and fisheries science, giant prawn
farming. Elsevier Scientific Publishing, Amsterdam,
10: 10246-256.
Bureau, D., S. Kaushik & C. Cho. 2002. Bioenergetics.
Fish nutrition. Academic Press, New York, 3: 1-59.
Burford, M.A., R.P. Thompson, R.P. McIntosh, R.H.
Bauman & D.C. Pearson. 2004. The contribution of
flocculated material to shrimp (Litopenaeus vannamei)
nutrition in a high-intensity, zero-exchange system.
Celada, J.D., J.M. Carral, V.R. Gaudioso, C. Temino & R.
Fernández. 1989. Response of juvenile freshwater
crayfish (Pacifastacus leniusculus Dana) to several
fresh and artificially compounded diets. Aquaculture,
76: 67-78.
Clifford, H. & R. Brick. 1978. Protein utilization in the
freshwater shrimp Macrobrachium rosenbergii. Proc.
World Maricult. Soc., 9: 195-208.
Cortes, J., H. Villarreal, R. Civera & R. Martinez. 2003.
Effect of dietary protein level on growth and survival
of juvenile freshwater crayfish Cherax quadricarinatus (Decapoda: Parastacidae). Aquacult. Nutr., 9:
207-213.
Cruz-Suarez, L. 1996. Digestión en camarón y su relación
con formulación y fabricación de alimentos
balanceados. In: L. Cruz-Suarez, D. Ricque-Marie &
R. Mendoza-Alfaro (eds.). Avances en nutrición
acuícola III.
Memorias del Tercer Simposium
Internacional de Nutrición Acuícola, Monterrey, pp.
207-232.
Cuzon, G. & J. Guillaume. 1997. Energy and protein:
energy ratio. In: L.R. D'Abramo, D.E. Conklin & D.M.
Akiyama (eds.). Crustacean nutrition. The World
Aquaculture Society, Baton Rouge, pp. 51-70.
D’Abramo, L.R. & L. Reed. 1988. Optimal dietary protein
level for juvenile freshwater prawn Macrobrachium
rosenbergii. Proceeding of the Annual Conference of
the World Mariculture Society. The World Aquaculture Society, Washington, 27 pp.
842
7
D’Abramo, L.R. & M. New. 2000. Nutrition, feeds and
feeding. In: M. New & W. Cotroni (eds.). Freshwater
prawn culture. The farming of Macrobrachium
rosenbergii. Blackwell Science, London, pp. 203-220.
De la Higuera, M. 1987. Diseños y métodos
experimentales de evaluación de dietas. Nutrición en
Acuicultura II, CAICYT, pp. 219-318.
Diaz-Herrera, F., E. Perez, C. Juarez & L. Buckle. 1992.
Balance energético de postlarvas y juveniles del
langostino malayo Macrobrachium rosenbergii (De
Man) (Crustacea Paleamonidae). Cienc. Mar., 18(2):
19-32.
Food and Agriculture Organization (FAO). 2014.
Aquaculture Statistics productions. In: [http://www.
fao.org/figis/servlet/SQServlet?file=/work/FIGIS/pro
d/webapps/figis/temp/hqp_6191256339247511943.x
ml&outtype=html]. Reviewed: 5 November 1914.
Ghiasvand, Z., A. Matinfar, A. Valipour, M. Soltani & A.
Kameli. 2012. Evaluation of different dietary protein
and energy levels on growth performance and body
composition of narrow clawed crayfish (Astacus
leptodactylus). Iranian J. Fish. Sci., 11(1): 63-77.
Goda, A. 2008. Effect of dietary protein and lipid levels
and protein-energy ratio on growth indices, feed
utilization and body composition of freshwater prawn,
Macrobrachium rosenbergii (de Man 1879) post
larvae. Aquacult. Res., 39: 891-901.
Gomez, G., H. Nagakawa & S. Kasahara. 1988. Effect of
dietary protein/starch ratio and energy level on growth
of the giant freshwater prawn, Macrobrachium
rosenbergii. Bull. Jap. Soc. Sci. Fish., 54: 1401-1407.
Gonzalez, A., J. Celada, M. Saez, R. Gonzalez, J. Carral
& V. Garcia. 2012. Response of juvenile astacid
crayfish (Pacifastacus leniusculus) to three
commercial dry diets with different protein levels
during the first 6 months of intensive rearing.
Aquacult. Res., 43: 99-105.
Hari, B. & M. Kurup. 2003. Comparative evaluation of
dietary protein levels and plant-animal protein ratios in
Macrobrachium rosenbergii (de Man). Aquacult.
Nutr., 9: 131-137.
Heinen, J.M. & M. J. Mansi. 1991. Feed and feeding
schedules for indoor nursery culture of post-larval
freshwater prawns. J. World Aquacult. Soc., 22: 118127.
Jacinto, E.C., H.V. Colmenares, R.C. Cerecedo & R.M.
Cordova. 2003. Effect of dietary protein level on
growth and survival of juvenile freshwater crayfish
Cherax quadricarinatus (Decapoda: Parastacidae).
Aquacult. Nutr., 9: 207-213.
Jones, C. 1995. Production of juvenile redclaw crayfish,
Cherax quadricarinatus (von Martens) (Decapoda
8843
Parastacidae): I. Development of hatchery and nursery
procedures. Aquaculture, 138: 221-238.
Jones, P.L., S.S. DeSilva & B.D. Mitchell. 1996. Effects
of replacement of animal protein soybean meal on
growth and carcass composition in juvenile Australian
freshwater crayfish. Aquacult. Int., 4: 339-359.
Kucharski, L. & R. Da Silva. 1991. Effect of diet
composition on the carbohydrate and lipid metabolism
in an estuarine crab, Chasmagnathus granulate (Dana,
1851). Comp. Biochem. Physiol. A, 99: 215-218.
Lim, C. 1997. Replacement of marine animal protein
with peanut meal in diets for juvenile white shrimp,
Penaeus vannamei. J. Appl. Aquacult., 7: 67-78.
Luna, M., C. Graziani, E. Villarroel, M. Lemus, C.
Lodeiros & G. Salazar. 2007. Evaluación de tres dietas
con diferente contenido proteico en el cultivo de
postlarvas del langostino de río Macrobrachium
rosenbergii. Zootec. Trop., 25(2): 111-121.
Millikin, M.R., A.R. Fortner, P.H. Fair & L.V. Siek. 1980.
Influence of dietary protein concentration on growth,
feed conversion and general metabolism of juvenile
prawn Macrobrachium rosenbergii. Proc. World
Maricult. Soc., 114: 382-399.
Mitra, G., D.N. Chattopadhyay & P.K. Mukhopadhyay.
2005. Nutrition and feeding in freshwater prawn
Macrobrachium rosenbergii farming. Aqua Feeds:
Formulation and Beyond, 2(1): 17-19.
Muzinic, L.A., K.R. Thompson, A. Morris, C.D. Webster,
D.B. Rouse & L. Manomaitis. 2004. Partial and total
replacement of fish meal with soybean meal and
brewer’s grains with yeast in practical diets for
Australian red claw crayfish Cherax quadricarinatus.
New, M.B., M. Boonyaratpalin, P. Vorasayn & S.
Intarapichate. 1980. An assessment of the performance
of Macrobrachium rosenbergii fed simple nonvitamin-supplemented pelleted diets. Internal Report
for UNDP/FAO Programmer for the Expansion of
Freshwater Prawn Farming (in Thailand). Working
Paper THA. 75.008/WP/80/16.
New, M.B. & S. Singholka. 1985. Freshwater prawn
farming: a manual for the culture of Marcobrachium
rosenbergii. FAO Fish. Tech. (Rev 1), Rome, 225 pp.
Ponce, P.J., F.J.L. Arredondo & R.M.A. Moreno. 1998.
The effects of varying dietary protein levels on growth
and survival of juvenile and pre-adult redclaw (Cherax
quadricarinatus). In: K.J.C. Von Vaupel & F. Schram
(eds.). The biodiversity crisis and crustacean.
Proceedings of the Fourth International Crustacean
Congress. A.A. Balkema, Amsterdam, 2: 715-719.
Rosas, C., G. Cuzon, G. Gaxiola, C. Pascual, R. Brito, M.
Chimal & A. Van Worhoudt. 2000. El metabolismo de
los carbohidratos de Litopenaeus setiferus, L.
vannamei y L. stylirostris. In: L. Cruz-Suarez, D.
Rique-Marie, M. Tapia-Salazar, M. Olivera-Novoa &
R. Civera-Cerecedo. (eds.). Avances en nutrición
acuícola V. Memorias V Symposium Internacional de
Nutrición Acuícola, Mérida, pp. 340-358.
Rudolph, E. 2002. Sobre la biología del camarón de río
Samastacus spinifrons (Philippi, 1882) (Decapoda,
Parastacidae). Gayana, 66(2): 147-159.
Rudolph, E. 2015. Current state of knowledge on
Virilastacus species (Crustacea, Decapoda, Parastacidae). Lat. Am. J. Aquat. Res., 43(5): 807-818.
Saoud, I., A. Garza de Yta & J. Ghanawi. 2012. A review
of nutritional biology and dietary requirements of
redclaw crayfish Cherax quadricarinatus (von
Martens 1868). Aquacult. Nutr., 18: 349-368.
Shearer, K.D. 2000. Experimental design, statistical
analysis and modeling of dietary nutrient requirement
studies for fish: a critical review. Aquacult. Nutr., 6:
91-102.
Teshima, S., S. Koshio, M. Ishikawa, S. Alam & L.
Hernandez. 2006. Protein requirements of the
freshwater prawn Macrobrachium rosenbergii
evaluated by the factorial method. J. World Aquacult.
Soc., 37(2): 145-153.
Thompson, K.R., L.A. Muzinic, T.D. Christian, C.D.
Webster, L. Manomaitis & D.B. Rouse. 2003a.
Lecithin requirements of juvenile Australian red claw
crayfish Cherax quadricarinatus. Aquacult. Nutr., 9:
223-230.
Thompson, K.R., L.A. Muzinic, T.D. Christian, C.D.
Webster, L. Manomaitis & D.B. Rouse. 2003b. Effect
on growth, survival and fatty acid composition of
Australian red claw crayfish Cherax quadricarinatus
fed practical diets with and without supplemental
lecithin and/or cholesterol. J. World Aquacult. Soc.,
34: 1-10.
Valenti, W.C. 1990. Criacao de camaroes de agua doce
Macrobrachium rosenbergii. Anais da 27 Reuniao
Anual da Sociedade Brasileira de Zootecnia e 12
Reuniao da Asociacao Latino-Americana de Producto
animal Campinas, Fundacao de Estudos Agrarios Luiz
de Queiroz (FEALQ), Piracicaba, pp.737-778.
Webster, C.D., L.S. Goodgame-Tiu, J.H. Tidwell & D.B.
Rouse. 1994. Evaluation of practical feed formulations
with different protein levels for juvenile red claw
crayfish (Cherax quadricarinatus). Trans. Kentucky
Acad. Sci., 55: 108-112.
Xu, W., W. Liu, M. Shen, G. Li, Y. Wang & W. Zhang.
2013. Effect of different dietary protein and lipid
levels on growth performance, body composition of
juvenile red swamp crayfish (Procambarus clarkii).
Aquacult. Int., 21(3): 687-697.
Zaki, M.A., H.A. Mabrouk & A.A. Nour. 2002. Optimum
dietary protein levels and stocking density for
freshwater prawn Macrobrachium rosenbergii juveniles reared in concrete basins. Egyp. J. Anim. Produc.,
7: 161-168.
Zein-Eldin, Z. & J. Corliss. 1976. The effect of protein
levels and sources on growth of Penaeus aztecus. In:
T.R.V. Pillay & J.A. Dill (eds.). Advances in
Aquaculture. FAO Technical Conference on
Aquaculture, Kyoto, Japan. Fishing News Books,
Farnham, pp. 592-596.
Received: 14 November 2014; Accepted: 10 July 2015
8449
Zenteno-Savin, T., E. Cortes-Jacinto, J. Vasquez-Medina
& H. Villarreal-Colmenares. 2008. Oxidative damage
in tissues of juvenile crayfish (Cherax quadricarinatus
von Martens, 1808) fed with different levels of
proteins and lipids. Hidrobiologica, 18(2): 147-154.
Lat. Am. J. Aquat. Res., 43(5): 845-855, 2015
Diversidad de la macrofauna en fondos blandos de Cuba
845
Research Article
Diversidad y distinción taxonómica de la macrofauna en fondos blandos
de la plataforma norte y suroccidental cubana
Gema Hidalgo1, Wilmer Toledo2 & Alejandro Granados-Barba3
Posgrado en Ecología y Pesquerías, Universidad Veracruzana, Independencia 30
Col. Centro, 94290, Boca del Rio, Veracruz, México
2
Instituto de Oceanología, 1ra. 18406 entre 184 y 186, Playa, La Habana, Cuba
3
Instituto de Ciencias Marinas y Pesquerías, Universidad Veracruzana, Hidalgo 617
Col. Río Jamapa, 94290, Boca del Río, Veracruz, México
1
Corresponding author: Gema Hidalgo ([email protected])
RESUMEN. Se evaluó la diversidad de la macrofauna en fondos blandos de la plataforma marina cubana norte
y suroccidental. Se utilizaron índices de variación taxonómica que aportan una nueva dimensión en la
interpretación de la diversidad de las comunidades, que son independientes del tipo de hábitat y del esfuerzo de
muestreo, y tienen respuesta monotónica ante las perturbaciones del ambiente. La heterogeneidad de taxones
fue significativamente mayor en los biotopos areno-fangoso con vegetación, arenoso con vegetación y arenoso
con vegetación sobre fondo duro. La diversidad por biotopos reflejó un gradiente de menor a mayor tamaño de
partícula y de ausencia a presencia de vegetación. La distinción taxonómica promedio (Δ +) esperada en estas
zonas de la plataforma cubana es de 92,5, con límites de confianza de 95% entre 76,7 y 100. Las estaciones con
distinción taxonómica promedio <92,5 y fuera del límite de confianza inferior, se pueden considerar con
condiciones ambientales de deterioro o que favorecen la diversidad de algún grupo en particular. Los grupos
dominantes en esta fracción del bentos son crustáceos y poliquetos, como ocurre en otras regiones tropicales y
templadas. Estos resultados sirven de base para la evaluación y monitoreo ambiental del macrozoobentos como
componente clave del funcionamiento de ecosistemas marinos en fondos blandos de Cuba.
Palabras clave: macrozoobentos, diversidad, distinción taxonómica, fondos blandos, Cuba.
Macrofaunal diversity and taxonomic distinctness in soft bottoms of the
northern and southwestern Cuban shelf
ABSTRACT. Diversity of macrofaunal groups in soft bottoms of the northern and southwestern Cuban shelf
was assessed using taxonomic indices that depend on community structure, are independent of habitat type and
sampling effort, and have a monotonic response to environmental disturbances. Taxa heterogeneity was
significantly higher in sandy-muddy with vegetation, sandy with vegetation, and sandy with vegetation on hard
bottom substrates. Biotopes diversity showed a gradient from smaller to greater particle size and from absence
to presence of vegetation. Average taxonomic distinctness expected in these zones of the Cuban marine shelf is
92.5 with 95% confidence limits between 76.7 and 100. Sites with average taxonomic distinctness lower than
92.5 and outside the estimated confident limits can be considered environmentally deteriorated or favoring
diversity of some particular groups. Dominant groups in this benthos fraction are crustaceans and polychaetes,
which is consistent with studies in other tropical and temperate regions. These results constitute a baseline for
environmental assessment and monitoring of macrofauna in Cuban soft bottoms, as a key component for marine
ecosystems functioning.
Keywords: macrofauna, diversity, taxonomic distinctness, soft bottoms, Cuba.
INTRODUCCIÓN
Los estudios sobre comunidades de la macrofauna
bentónica a nivel mundial son numerosos y diversos;
__________________
Corresponding editor: Diego Giberto
entre éstos, se ha destacado su uso como bioindicadores
de contaminación y perturbaciones ambientales
(Covazzi-Harriague et al., 2007; Pires-Vanin et al.,
2011), así como de la degradación de hábitats provoca-
846
dos por actividades antrópicas como la minería (Savage
et al., 2001), dragado (Chessa et al., 2007), eutrofización (Ferreira et al., 2011), actividades turísticas,
portuarias, descargas residuales urbanas e industriales,
y derrames de petróleo (Uhrin & Holmquist, 2003;
Muniz et al., 2013; Pires-Vanin et al., 2013; Souza et
al., 2013).
En otro ámbito, se ha evaluado también la
complejidad estructural del hábitat y su influencia sobre
el macrozoobentos (Attril et al., 2000; Arocena, 2007),
mientras que Biles et al. (2002), Norling et al. (2007),
Lloret & Marín (2011) y Kristensen et al. (2014)
analizaron la actividad bioperturbadora de estos
organismos y su relación con la funcionalidad del
ecosistema, estructura de comunidades y flujo de
nutrientes en el sedimento. Otro aspecto común es
destacar la importancia de la macrofauna asociada a
especies de interés económico, e.g., con relación a
fondos de pesca de camarón (Scelzo et al., 2002;
Valdés et al., 2011), bancos ostrícolas (Susan-Tepetlan
& Aldana-Aranda, 2007; Hernández-Ávila et al., 2013)
y nidos de Malacanthus plumieri (Gutiérrez-Salcedo et
al., 2007).
En Cuba, la importancia ecológica y económica de
las comunidades bentónicas ha sido reconocida desde
la década de los 70’ en varios estudios (Armenteros et
al., 2007; Arias-Schreiber et al., 2008; Ocaña et al.,
2012). No obstante, no hay trabajos integradores sobre
atributos de las comunidades de la macrofauna en
fondos blandos de la plataforma marina cubana. Los
estudios realizados son dispersos, y no tienen homogeneidad en cuanto a métodos de muestreo pues
responden a diferentes objetivos.
La diversidad bentónica es un indicador ampliamente utilizado, entre otros componentes del
ecosistema, para evaluar la integridad ecológica en
aguas marinas (Borja et al., 2009), y generalmente se
hace a través del uso de índices que tienen diferentes
consideraciones para su aplicación. Los índices de
diversidad "tradicionales" tienen problemas con la
dependencia del tamaño de muestra, y al momento de
diferenciar las variaciones ambientales naturales de
aquellas inducidas por acciones humanas (Mouillot et
al., 2005). Al depender del esfuerzo de muestreo, estos
índices subestiman la riqueza taxonómica real, por lo
que se han propuesto herramientas tales como los
índices de diversidad basados en la distancia
taxonómica, definida por el número de nodos o longitud
de la vía entre especies en el árbol o jerarquía
taxonómica linneana (Warwick & Clarke 1995, 2001;
Clarke & Warwick 1998, 2001a), como medida de su
relación filogenética y presumiblemente funcional
(Ricotta, 2005, Ricotta & Szeidl, 2006).
Los índices de diversidad taxonómica se han estado
valorando en diferentes ambientes (e.g., rocosos y
dulceacuícolas) (Terlizzi et al., 2005; Heino et al.,
2007), regiones y latitudes (e.g., polares, templadas y
tropicales) (Conlan et al., 2004; Miranda et al., 2005;
Nicholas & Trueman, 2005; Włodarska-Kowalczuk et
al., 2005; Leonard et al., 2006), siendo una herramienta
potencialmente útil para evaluar la diversidad en fondos
blandos de distintas zonas de la plataforma insular
cubana. El uso de los índices mencionados contribuye
a la comprensión de la estructura y distribución de las
comunidades para el monitoreo de los cambios en la
calidad ecológica de los hábitats. En consecuencia, el
propósito del presente estudio es comparar la
abundancia de la macrofauna en diferentes biotopos
sedimentarios de la plataforma marina cubana, y
analizar su diversidad mediante el uso de diferentes
índices ecológicos.
MATERIALES Y MÉTODOS
Diseño de la investigación
Se analizó la diversidad taxonómica de la macrofauna
en fondos blandos someros de la costa norte y
suroccidental de Cuba (<20 m de profundidad). A partir
de la literatura, bases de datos y mapas temáticos
elaborados entre 1975 y 2009, se obtuvo datos de
abundancia provenientes de 270 estaciones localizadas
en diferentes zonas de la plataforma insular, y
distribuidas como sigue: 22 en el archipiélago Los
Colorados, Pinar del Río, zona noroccidental
(Ibarzábal, 1982), 3 en Canasí, al Este de La Habana,
zona noroccidental (Martínez-Daranas & Hidalgo,
2003), 74 en el Archipiélago Sabana Camagüey, zona
norcentral (Jiménez & Ibarzábal, 1982; Sánchez-Noda
et al., 2006), 19 en Moa, Holguín, zona nororiental
(Hidalgo, 2004; Hidalgo & Busutil, 2008), 152 en el
Golfo de Batabanó, zona suroccidental (Ibarzábal,
1990, 1993; Arias-Schreiber et al., 2008; Hidalgo &
Areces, 2009).
Los biotopos de las 270 estaciones se clasificaron,
utilizando la información de mapas temáticos y/o
descripciones de los tipos de fondo en la literatura
consultada, de acuerdo al tamaño predominante de
partículas de sedimento y a la presencia de vegetación
acuática sumergida (algas y/o pastos marinos): F: fango
(sedimentos finos, con predominio de limos y arcillas),
FV: fango con vegetación, AF: areno-fangoso, AFV:
areno-fangoso con vegetación, A: arena (donde el
diámetro medio de partículas es >0.063 mm), AV:
arenoso con vegetación, R: capa de sedimento sobre
fondo rocoso, RV: capa de sedimento con vegetación
sobre fondo rocoso.
El equipo utilizado para la toma de muestras en los
trabajos analizados varió, incluyendo dragas de
gravedad, nucleadores y draga de succión operada
mediante buceo autónomo. Este último, sugerido por
Thomassin (1978), se utilizó en 81 de las 270 estaciones analizadas (Fig. 1), recogiendo el sedimento en
un área efectiva de 0.1 m2 y 10 cm de profundidad,
hacia un saco recolector de 0.5 mm de abertura de
malla.
Se usó una manga cónica adosada al tubo de succión
y al cilindro que delimita el área de muestreo, según lo
recomendado por Ibarzábal (1987), para retener
organismos de la fauna que escapan con facilidad
durante la colecta.
En todos los casos las muestras se fijaron en
solución de formaldehído al 4%, neutralizado con
tetraborato de sodio, y se obtuvo la macrofauna retenida
en el tamiz de 500 μm, para su cuantificación e
identificación hasta la menor resolución taxonómica
posible.
Análisis de datos
Se utilizaron índices de diversidad univariados, tanto
clásicos como taxonómicos. Para hacer el análisis
mediante los índices clásicos, se consideraron solo las
abundancias directamente comparables de individuos
provenientes de las 81 estaciones muestreadas con
draga succionadora.
Se determinó la diversidad (H') de Shannon &
Weaver (1949) y la equidad (J') de Pielou (1966).
Al utilizar diferentes fuentes de información sobre
abundancia de la macrofauna bentónica en zonas del
archipiélago cubano, obtenidas con distintos objetivos,
el nivel taxonómico al que se realizó la identificación
dentro de cada grupo no fue parejo, llegando algunos
hasta especies, como poliquetos con 86 en el Golfo de
Batabanó (Arias-Schreiber et al., 2008) y 98 en el
Archipiélago Sabana Camagüey (Ibarzábal, 2007),
mientras que otros aparecen solo hasta taxones
superiores. Por tal motivo, para uniformar protocolos y
homogeneizar los grados de precisión y exactitud del
análisis, en el presente estudio se analizó el nivel
taxonómico de clases de macrofauna, incluyendo 26 en
total.
Adicionalmente, para los crustáceos de la clase
Malacostraca, dada su representatividad y variabilidad
taxonómica, se consideró la clasificación hasta órdenes,
incluyendo 11 órdenes, lo que hizo un total de 36
grupos analizados. Se compararon los índices de
diversidad (H´) y equidad (J´) entre biotopos, mediante
análisis de varianzas y pruebas de comparación de
medias post-hoc (Zar, 1999). En el caso de los datos no
paramétricos se utilizó el análisis de varianza de
847
Kruskal-Wallis. Ambas pruebas estadísticas se
realizaron con un nivel de significación de 0,05
utilizando el programa Statistica 7.0 (StatSoft, Inc.
2004).
Para el total de las 270 estaciones analizadas, cuyas
muestras se tomaron con diferentes equipos, se obtuvo
los siguientes índices: diversidad taxonómica (Δ),
distinción taxonómica promedio (Δ+) y variación de la
distinción taxonómica (Λ+), propuestos por Warwick &
Clarke (1995). Para el procesamiento de los datos se
utilizó el programa Primer 6.0.2 (Clarke & Gorley,
2006).
Diversidad taxonómica:
𝛥 =
[ 𝛴𝛴𝑖<𝑗 𝜔𝑖𝑗 𝑥𝑖 𝑥𝑗 ]
𝑁(𝑁 − 1)
[
]
2
ωij es la distancia taxonómica entre todos los pares de
especies i,j; N = Σi xi el número total de individuos de
la muestra, y se utilizaron además las siguientes
expresiones:
Distinción taxonómica promedio:
𝛥+ =
[ 𝛴𝛴𝑖<𝑗 𝜔𝑖𝑗 ]
𝑆(𝑆 − 1)
[
]
2
Variación de la distinción taxonómica:
2
𝛬
+
=
[ 𝛴𝛴𝑖<𝑗 (𝜔𝑖𝑗 − 𝛥+ ) ]
𝑆(𝑆 − 1)
[
]
2
S = es el número de especies de la muestra
Para analizar la variabilidad regional de estos
índices, se elaboró una tabla comparativa de los valores
de Δ, Δ+ y Λ+ de la macrofauna en las zonas estudiadas.
Los índices de diversidad taxonómicos tienen la ventaja
de tener respuesta monotónica y ser independientes del
tipo de hábitat, del tamaño de muestra y de la presencia
de especies raras. No obstante, se vuelven imprecisos
cuando se dispone de escasas estaciones de muestreo
(Clarke & Warwick, 2001b). Por ello, al haber solo tres
estaciones próximas a Canasí, al noreste de La Habana,
no se consideró en la tabla de índices por zona.
RESULTADOS
Abundancia e índices de diversidad
La abundancia media (ind m-2) por biotopo varió entre
364,1 y 1470,9, siendo >1000 ind m-2 en el arenofangoso con vegetación y arenoso con vegetación, con
predominio de poliquetos (Tabla 1). Este grupo
constituyó el 31,8% de la densidad total, seguido por
anfípodos (9,8%), nemátodos (9,2%), ostrácodos
(8,7%), tanaidáceos (8,2%), misidáceos (4,5%), cumá-
848
Figura 1. Mapa del área de estudio con las 81 estaciones muestreadas con draga succionadora (puntos rojos), ubicadas
frente a Canasí (3), en el Archipiélago Sabana Camagüey (35) y Golfo de Batabanó (43).
ceos (4,1%), bivalvos (4,0%), decápodos (2,8%), gastrópodos (2,7%), isópodos (2,5%) y otros grupos menores.
El índice de diversidad (H') fue significativamente
mayor en el biotopo de sedimento con vegetación sobre
fondo rocoso (RV). Este se diferenció significativamente de los demás biotopos, excepto del arenofangoso con vegetación (AFV) y del arenoso con
vegetación (AV) (Fig. 2). Los biotopos de fango (F) y
sedimento con vegetación sobre fondo rocoso (RV)
mostraron las mayores diferencias significativas. En
cuanto a la equidad (J´), no hubo diferencias
significativas entre biotopos (Fig. 3).
La diversidad taxonómica (Δ) de los 14 filos
identificados varió por zonas geográficas entre 58,4 y
75,9, y la distinción taxonómica promedio (Δ+), entre
84,5 y 92,4 (Tabla 2). La mayor variación de la
distinción taxonómica (Λ+) se observó en el Golfo de
Batabanó y el Archipiélago Sabana-Camagüey.
La distinción taxonómica promedio (Δ+) esperada
en estas zonas de la plataforma cubana fue de 92,5; con
límites de confianza del 95% entre 76,7 y 100 (Fig. 4).
Fuera del límite de confianza se encontraron 13
estaciones con diferentes biotopos y números de
taxones. La zona de mayor precisión del estadístico se
encontró entre 10 y 20 taxones.
849
Tabla 1. Abundancia media (ind m-2) y error estándar de los grupos más abundantes (>5%) y total por biotopos; entre
paréntesis se indica el número de estaciones. F: fango, FV: fango con vegetación, AF: areno-fangoso, AFV: areno-fangoso
con vegetación, A: arena, AV: arenoso con vegetación, R: capa de sedimento sobre fondo rocoso, RV: capa de sedimento
con vegetación sobre fondo rocoso.
Grupo
Polychaeta
Amphipoda
Nematoda
Ostracoda
Tanaidacea
Total
F(16)
AF(5)
A(7)
R(6)
FV(13)
62,4±13,4
25,5±11,5
29,4±18,3
24,4±13,8
70,9±47,6
369,9±104,3
59,9±17,1
65±35,1
6,7±6,6
9,3±6,4
15,6±7,2
461,1±330,9
210,9±33,7
27,3±16,2
32,4±17,3
29,5±14,9
19,7±12,5
517,4±111
261,7±122,6
35±26,3
106,7±40,5
20,0±6,4
173,9±137,7
703±159
131.4±39
82.5±24,6
25,4±15,4
23.6±11,5
20.2±4,1
364,1±105,7
Figura 2. Valores del índice de diversidad de ShannonWeaver por biotopos (media ± error estándar). F: fango,
AF: areno-fangoso, FV: fango con vegetación, R: capa de
sedimento sobre fondo rocoso, A: arena, AFV: arenofangoso con vegetación, AV: arenoso con vegetación y
RV: capa de sedimento con vegetación sobre fondo
rocoso. F (7,73) = 2,3649; P = 0,031. Las letras a, b y c
indican diferencias significativas con P < 0,05.
DISCUSIÓN
Se encontraron diferencias claras en las comunidades
en cuanto a su composición y abundancia, según el tipo
de biotopo, mediante los valores del índice de diversidad
de Shannon-Weaver. La complejidad de hábitats, dada
por el mayor tamaño de partículas de los sedimentos y
la presencia de vegetación, influyó en la diversidad de
grupos que se obtuvo en los biotopos RV, AV y AFV.
Los factores y mecanismos que explican la relación
entre la complejidad estructural de los hábitats y los
patrones ecológicos de la macrofauna han sido
analizados por varios autores (e.g., Hewitt et al., 2005;
Hauser et al., 2006; Cortés et al., 2012), demostrando
AFV(21)
AV(10)
538,6±159,6
349±159,1
186,2±57,4
93,7±29,8
79,4±24,7
188±134
180,6±73,2
104±42,5
76,4±22
51,8±11,2
1470,9±383
1037,1±379,3
RV(3)
166,7±61,8
36,7±13,8
47,8±33,4
98,9±14,4
33,3±10,7
668,9±127,4
Figura 3. Valores del índice de equidad de Pielou por
biotopos (media ± error estándar). R: capa de sedimento
sobre fondo rocoso, A: arena, AFV: areno-fangoso con
vegetación, F: fango, AF: areno-fangoso, FV: fangoso con
vegetación, AV: arenoso con vegetación y RV: capa de
sedimento con vegetación sobre fondo rocoso. H (7,81) =
5,0235; P = 0,6571.
la importancia que tiene, tanto el incremento en
superficie disponible para la fauna, como la
configuración espacial y rugosidad del hábitat en sí,
formando una variedad de microhábitats que favorecen
la mayor riqueza de organismos. En el presente estudio
esto parece haber influido positivamente en las
abundancias de poliquetos y ostrácodos en particular.
Los grupos dominantes en los biotopos (poliquetos,
crustáceos), se encuentran comúnmente con mayor
diversidad en esta fracción del bentos. Esto se ha
evidenciado en diferentes regiones tropicales (Eklöf et
al., 2005; Gutiérrez-Salcedo et al., 2007; Díaz-Díaz et
al., 2013), subtropicales (Pires-Vanin et al., 2011,
2013) y templadas (Ríos et al., 2003; Moreira &
Troncoso, 2007). En el biotopo de sedimento con vege-
850
Tabla 2. Índices de diversidad taxonómicos en cinco
zonas de la plataforma insular cubana. (Diversidad taxonómica Δ, distinción taxonómica promedio Δ+, variación
de la distinción taxonómica Λ+).
Zonas
Archipiélago Sabana-Camagüey
Moa
Archipiélago Los Colorados
Golfo de Batabanó
Canasí
Δ
58.4
63.8
65.1
70.1
75.9
Δ+
90.1
89.5
92.4
84.5
92.1
Λ+
332.3
284.3
278.7
376.9
286.7
tación sobre fondo rocoso (RV) se puede encontrar
mayor diversidad, ya que generalmente en este tipo de
fondo el macrofitobentos se encuentra en parches, lo
que contribuye a la heterogeneidad de nichos y
recursos, y crea un efecto de borde que proporciona
mayor superficie de intercambio entre comunidades
(Hewitt et al., 2002; Bouma et al., 2009). Estas
condiciones deben favorecer la equidad entre grupos,
que fue mayor en este biotopo, aun cuando no hubo
diferencias significativas.
Los fondos arenosos y areno-fangosos con
vegetación (AV y AFV) también fueron propicios para
el desarrollo de grupos como poliquetos y anfípodos.
En estos biotopos, además de la complejidad estructural
del hábitat, influye una mayor disponibilidad de
alimento, a partir de la trama creada por las estructuras
vegetales en deposición y la retención de partículas que
contribuyen al detrito. Otros autores (Neira & Palma,
2007; Pires-Vanin et al., 2013; Jordana et al., 2015)
también observaron que el porcentaje de arena y
contenido de materia orgánica son los principales
factores ambientales que determinan la composición de
la macrofauna en fondos blandos. En los biotopos
fangosos y desprovistos de vegetación, la menor
complejidad estructural del hábitat, baja disponibilidad
de oxígeno y poca estabilidad de los sedimentos, deben
haber influido en su menor diversidad.
La distinción taxonómica promedio (Δ+) de las
comunidades analizadas en el Archipiélago SabanaCamagüey (ASC) y Moa fue muy similar, cercana a 90;
sin embargo, en el ASC hubo mayor variación de la
distinción taxonómica (Λ+), lo que indica que en Moa
la mayoría de los grupos pertenecen a pocos taxones
superiores. Esto evidencia las condiciones a que se
encuentra expuesta esta zona marina, con la influencia
de efluentes y residuos sólidos asociados a procesos
minero-metalúrgicos que se desarrollan en la región, así
como de aportes fluviales provenientes de actividades
urbana y portuaria (Rodríguez & Acero, 2006;
Cervantes et al., 2009, 2011).
Entre los principales problemas ambientales
generados por dichas actividades, se encuentra la resus-
Figura 4. Distinción taxonómica promedio (Δ+) de la
macrofauna en fondos blandos de las zonas estudiadas de
la plataforma marina cubana, con límites de confianza del
95%.
pensión de sedimentos, modificaciones del relieve
submarino y alteraciones de la dinámica de los
sedimentos, ingreso de contaminantes químicos tóxicos
e incremento en la concentración de nutrientes
(Rodríguez, 2006; Rodríguez & Acero, 2006). Todos
estos fenómenos provocan diferentes grados de
impacto e inciden en general sobre la estructura de las
biocenosis. La menor variación de la distinción
taxonómica donde el impacto de la contaminación es
mayor, ha sido referida por Warwick et al. (2002) al
comparar dos zonas costeras en el Reino Unido.
Además, Tweedley et al. (2015) encontraron
correlaciones significativas de la distinción taxonómica
promedio (Δ+) y de la variación de la distinción
taxonómica (Λ+) con concentraciones de siete metales
pesados, por lo que consideran estos índices apropiados
como indicadores de perturbaciones antropogénicas, y
que permiten plantear condiciones regionales de
referencia.
En el Archipiélago Los Colorados, se encontró la
estructura más diversa de las comunidades analizadas
(Δ+ = 92,4), lo que podría indicar mejor calidad de
hábitats, pues esta área ha tenido menor grado de
perturbación humana. Es también notable que los
menores valores de diversidad taxonómica (Δ = 58,4 y
Δ = 63,8) se registraron en zonas con mayor carga
contaminante por la influencia de actividades industriales y urbanas, en algunas bahías interiores del
Archipiélago Sabana-Camagüey (Montalvo-Estévez et
al., 2013) y Moa (Cervantes et al., 2011).
En el Golfo de Batabanó, aunque se observó la
menor distinción taxonómica promedio, la variación de
la distinción taxonómica fue la mayor encontrada. Esto
puede estar relacionado con diferencias en las
estructuras tróficas en los biotopos, que influyen
notablemente en este estadístico; la reducción en la
diversidad trófica conlleva una reducción en la
distinción taxonómica, aunque no necesariamente en la
riqueza de especies (Warwick & Clarke, 1998). Según
Mackie et al. (2005), en la Isla de Seychelles los valores
de Δ+ fueron inferiores a los del mar de Irlanda (zona
templada) y de una estación en Hong Kong (zona
subtropical). Sin embargo, un análisis estructural
detallado de las jerarquías taxonómicas mostró que
Seychelles e Irlanda tuvieron igual número de entidades
taxonómicas superiores, a niveles de familia a orden,
pero en Seychelles hubo mayor número de especies
dentro de algunas familias en particular, lo que resultó
en una reducción relativa de Δ+, que representa la
distancia taxonómica promedio ponderada entre cada
par de especies de la muestra, y en un incremento
relativo de su variación Λ+.
Los valores de Δ entre 58,4 y 70,1 al excluir las
estaciones de Canasí, fueron intermedios entre los
encontrados por Warwick et al. (2002) en el Reino
Unido (20-80), lo que pudiera deberse, además de las
variaciones que se deducen a priori a partir de la
diferencia latitudinal, al grado de resolución
taxonómica y a las escalas espaciales analizadas, así
como a diferencias en las condiciones de perturbación
y degradación de los hábitats. Este índice es altamente
dependiente de la distribución de abundancia de los
taxones y, por tanto, sigue muy de cerca los cambios de
H'. En ese sentido, es notable que en el presente estudio
los valores de H' también fueron intermedios a los
encontrados en el Reino Unido (0,5-2,5), tanto por
Warwick et al. (2002), como por Chainho et al. (2010).
Las estaciones analizadas en la plataforma cubana
que se encontraron por debajo de los límites de
confianza de la distinción taxonómica promedio (Δ+), y
con alto número de taxones, tienen mayor número de
grupos inferiores pertenecientes a una misma categoría
superior, lo que indica un ambiente más favorable para
el desarrollo y diversidad dentro de ese taxón, como es
en este caso Crustacea. No extraña entonces que la
tendencia general de H' y J´ no coincida con la de este
índice (Δ+), pero sí más con la de los índices diversidad
taxonómica (Δ) y variación de la distinción taxonómica
Λ+, siendo mayores como promedio en el Golfo de
Batabanó (H' = 2,40 y J´ = 0,69) que en el Archipiélago
Sabana-Camagüey (H' = 2,27 y J´ = 0,63).
El conocimiento actual sobre ecología de la
macrofauna en hábitats tropicales es limitado
comparado con el de zonas templadas y subtropicales
(Helguera et al., 2011). En estos ambientes, dicha
fracción del bentos alcanza una alta diversidad, incluso
dentro de algunos taxones superiores como Polychaeta
(Hernández-Alcántara et al., 2014). De ahí que el
trabajo con niveles taxonómicos superiores a especie, o
con grupos en particular, se ha considerado con fines
prácticos en algunos estudios de evaluación de
851
impactos y biomonitoreo de la calidad ambiental, para
optimizar el tiempo operacional y la relación
costo/beneficio (Muniz & Pires-Vanin, 2005; Musco et
al., 2009).
En ocasiones se ha utilizado un enfoque de
metanálisis a nivel de phylum, para comparar la
severidad del estrés de las comunidades por
perturbaciones antropogénicas en amplias regiones,
pues las variaciones por causas naturales son menos
evidentes a nivel de grandes grupos que de especies
(Warwick & Clarke, 1993; Venturini et al., 2004;
Somerfield et al., 2006). También se ha encontrado que
el nivel taxonómico de familia es, en general, suficiente
para evaluar los efectos de la contaminación en
ambientes de sustratos blandos, sublitorales y estuarinos (Domínguez-Castanedo et al., 2007; Marrero et
al., 2013).
Al no contar con información homogénea de las
abundancias hasta nivel de familias o especies de todos
los grupos macrobentónicos en las zonas de estudio, el
presente trabajo constituye un análisis general de la
diversidad hasta grandes grupos, que aporta por
primera vez un valor esperado de distinción taxonómica
promedio (Δ+) de la macrofauna y sus límites de
confianza en la plataforma cubana, como base o
referencia para la prospección y monitoreo de estas
comunidades, mediante el uso de estos índices de
diversidad que no dependen del tipo de hábitat ni del
tamaño de muestra, y para la descripción de los
patrones detallados de especies en cada zona.
CONCLUSIONES
- Los biotopos con mayor diversidad de la macrofauna
en fondos blandos de las zonas estudiadas de la
plataforma cubana fueron areno-fangoso con
vegetación (AFV), arenoso con vegetación (AV) y
sedimento con vegetación sobre fondo rocoso (RV),
reflejando un gradiente de menor a mayor tamaño de
partícula y de ausencia a presencia de vegetación.
- Las estaciones con distinción taxonómica promedio
de la macrofauna menor que 92,5 y por fuera del
límite de confianza inferior estimado, se pueden
considerar con condiciones ambientales de deterioro,
o que favorecen la diversidad de algún taxón en
particular.
- Los grupos dominantes de la macrofauna en fondos
blandos de las zonas de estudio fueron poliquetos y
crustáceos, lo que coincide con lo encontrado por
otros autores en regiones tropicales y templadas.
AGRADECIMIENTOS
Agradecemos a Rosa del Valle y Macario Esquivel por
su contribución en la búsqueda bibliográfica, al
852
Consejo Científico del Departamento de Bentos del
Instituto de Oceanología por las sugerencias en la
elaboración del presente trabajo, a la Secretaría de
Relaciones Exteriores del Gobierno de México y al
Posgrado en Ecología y Pesquerías de la Universidad
Veracruzana por su apoyo en la fase final del
manuscrito, así como a los revisores anónimos y
editores por sus comentarios y propuestas para mejorar
el mismo.
REFERENCIAS
Arias-Schreiber, M., M. Wolff, M. Cano, B. MartínezDaranas, Z. Marcos, G. Hidalgo, S. Castellanos, R. del
Valle, M. Abreu, J.C. Martínez, J. Díaz & A. Areces.
2008. Changes in benthic assemblages of the Gulf of
Batabanó (Cuba) results from cruises undertaken
during 1981-85 and 2003-04. Pan-Am. J. Aquat. Sci.,
3(1): 49-60.
Armenteros, M., J.P. Williams, G. Hidalgo & G.
González-Sansón. 2007. Community structure of
meio- and macrofauna in seagrass meadows and
mangroves from NW shelf of Cuba (Gulf of Mexico).
Rev. Invest. Mar., 28(2): 139-150.
Arocena, R. 2007. Effects of sumerged aquatic vegetation
on macrozoobentos in a coastal lagoon of the
southwestern Atlantic. Int. Rev. Hydrobiol., 92(1): 3347.
Biles, C.L., D.M. Paterson, R.B. Ford, M. Solan & D.G.
Raffaelli. 2002. Bioturbation, ecosystem functioning
and community structure. Hydrol. Earth Syst. Sci.,
6(6): 999-1005.
Borja, A., A. Ranasinghe & S.B. Weisberg. 2009.
Assessing ecological integrity in marine waters, using
multiple indices and ecosystem components:
challenges for the future. Mar. Pollut. Bull., 59: 1-4.
Bouma, T.J., V. Ortells & T. Ysebaert. 2009. Comparing
biodiversity effects among ecosystem engineers of
contrasting strength: macrofauna diversity in Zostera
noltii and Spartina anglica vegetations. Helgoland
Mar. Res., 63: 3-18.
Cervantes, Y., Y. Almaguer, A. Pierra, G. Orozco & H.J.
Gursky. 2009. Variación de la dinámica erosiva y
acumulativa en Cayo Moa Grande, Bahía de Moa,
Cuba. Período 1972-2007. Min. Geol., 25(4): 1-16.
Cervantes, Y., Y. Almaguer, A. Pierra, G. Orozco & H.J.
Gursky. 2011. Metales traza en sedimentos de la bahía
de Cayo Moa (Cuba): evaluación preliminar de la
contaminación. Min. Geol., 27(4): 1-19.
Chainho, P., G. Silva, M.F. Lane, J.L. Costa, T. Pereira,
C. Azeda, P.R. Almeida, I. Metelo & M.J. Costa. 2010.
Long-term trends in intertidal and subtidal benthic
communities in response to water quality improvement measures. Estuar. Coasts, 33: 1314-1326. doi:
10.1007/s 12237-010-9321-2.
Chessa, L.A., M. Scardi, S. Serra, A. Pais, P. Lanera, N.
Plastina, L.M. Valiante & D. Vinci. 2007. Small-scale
perturbation on soft bottom macrozoobenthos after
mechanical cleaning operations in a Central-Western
Mediterranean lagoon. Transit. Waters Bull., 2: 9-19.
Clarke, K.R. & R.N. Gorley. 2006. Primer v6: User
manual/tutorial. PRIMER-E Ltd., Plymouth, 190 pp.
Clarke, K.R. & R.M. Warwick. 1998. A taxonomic
distinctness index and its statistical properties. J. Appl.
Ecol., 35: 523-531.
Clarke, K.R. & R.M. Warwick. 2001a. A further
biodiversity index applicable to species lists: variation
in taxonomic distinctness. Mar. Ecol. Prog. Ser., 216:
265-278.
Clarke, K.R. & R.M. Warwick. 2001b. Change in marine
communities: an approach to statistical analysis and
interpretation. PRIMER-E Ltd, Plymouth, 176 pp.
Conlan, K.E., S.L. Kim, H.L. Lenihan & J.S. Oliver. 2004.
Benthic changes during 10 years of organic
enrichment by McMurdo Station, Antarctica. Mar.
Pollut. Bull., 49: 43-60.
Cortés, F.A., O.D. Solano & J.A. Ruiz-López. 2012.
Variación espacio-temporal de la fauna macrobentónica asociada a fondos blandos y su relación con
factores ambientales en el Parque Nacional Natural
Gorgona, Pacífico colombiano. Bol. Invest. Mar.
Cost., 41(2): 323-353.
Covazzi-Harriague, A., C. Misic, M. Petrillo & G.
Albertelli. 2007. Stressors affecting the macrobenthic
communiy in Rapallo Harbour (Ligurian Sea, Italy).
Sci. Mar., 71(4): 705-714.
Díaz-Díaz, O., I. Liñero-Arana, L. Troccoli & M.
Jiménez-Prieto. 2013. Estructura comunitaria de la
macrofauna bentónica de Caño Mánamo. Bol. Inst.
Oceanogr. Ven., 52(1): 131-143.
Domínguez-Castanedo, N., R. Rojas-López, V. SolísWeiss, P. Hernández-Alcántara & A. Granados-Barba.
2007. The use of higher taxa to assess the benthic
conditions in the southern Gulf of Mexico. Mar. Ecol.,
28(Suppl. 1): 161-168.
Eklöf, J.S., M. de la Torre-Castro, L. Adelsköld, N.S.
Jiddawi & N. Kautsky. 2005. Differences in
macrofaunal and seagrass assemblages in seagrass
beds with and without seaweed farms. Estuar. Coast.
Shelf Sci., 63: 385-396.
Ferreira, J.G., J.H. Andersen, A. Borja, S.B. Bricker, J.
Camp & M.C. Silva. 2011. Overview of eutrophication
indicators to assess environmental status within the
European Marine Strategy Framework Directive.
Estuar. Coast. Shelf Sci., 93(2): 117-131.
Gutiérrez-Salcedo, J.M., M.I. Aguilar-Pérez, A. Bermúdez,
N.H. Campos & G.R. Navas. 2007. Estructura de la
macrofauna de invertebrados presente en los nidos del
pez Malacanthus plumieri (Bloch, 1786) (Perciformes: Malacanthidae) en la bahía de Nenguange,
Parque Nacional Natural Tayrona, Mar Caribe
colombiano. Caldasia, 29(2): 309-328.
Hauser, A., M.J. Attrill & P.A Cotton. 2006. Effects of
habitat complexity on the diversity and abundance of
macrofauna colonising artificial kelp holdfasts. Mar.
Ecol. Prog. Ser., 325: 93-100.
Heino, J., H. Mykra, H. Hämäläinen, J. Aroviita & T.
Muotka. 2007. Responses of taxonomic distinctness
and species diversity indices to anthropogenic impacts
and natural environmental gradients in stream
macroinvertebrates. Freshwater Biol., 52: 1846-1861.
Helguera, Y., L. Díaz-Asencio, R. Fernández-Garcés, M.
Gómez-Batista, A. Guillén, M. Díaz-Asencio & M.
Armenteros. 2011. Distribution patterns of macrofaunal polychaete assemblages in a polluted semienclosed bay: Cienfuegos, Caribbean Sea. Mar. Biol.
Res., 7: 757-768.
Hernández-Alcántara, P., J.D. Cortés-Solano, N.M.
Medina-Cantú, A.L. Avilés-Díaz & V. Solís-Weiss.
2014. Polychaete diversity in the estuarine habitats of
Términos Lagoon, Southern Gulf of Mexico. Mem.
Mus. Victoria, 71: 97-107.
Hernández-Ávila, I., A. Tagliafico & N. Rago. 2013.
Composición y estructura de la macrofauna asociada
con agregaciones de dos especies de bivalvos en Isla
de Cubagua, Venezuela. Rev. Biol. Trop., 61(2): 669682.
Hewitt, J.E., S.F. Thrush, P. Legendre, V.J. Cummings &
A. Norkko. 2002. Integrating heterogeneity across
spatial scales: interactions between Atrina zelandica
and benthic macrofauna. Mar. Ecol. Prog. Ser., 239:
115-128.
Hewitt, J.E., S.F. Thrush, J. Halliday & C. Duffy. 2005.
The importance of small-scale habitat structure for
maintaining beta diversity. Ecology, 86: 1619-1626.
Hidalgo, G. 2004. Características de la biota marina. In: J.
Rodríguez-Rubio (ed.). Tercer monitoreo ambiental de
la explotación del yacimiento de cienos carbonatados
en la Bahía de Cayo Moa Grande. OC-270733-328, pp.
42-50.
Hidalgo, G. & L. Busutil. 2008. Biota marina. In: M.C.
Martínez (ed.). Estudio de impacto ambiental:
emisario del licor de desecho y las colas en aguas
profundas. Empresa Mixta Moa Nickel, S.A. Pedro
Sotto Alba. C-2007-A-43, pp. 118-130.
Hidalgo, G. & A. Areces. 2009. Estimación cualitativa y
cuantitativa del macrozoobentos en la macrolaguna del
853
Golfo de Batabanó, Cuba. Rev. Cub. Invest. Pesq.,
26(1): 73-78.
Ibarzábal, D.R. 1982. Evaluación cuantitativa del bentos
en la región noroccidental de la plataforma de Cuba.
Cienc. Biol., 8: 57-80.
Ibarzábal, D.R. 1987. Mejoras en el muestreo de
macrobentos con el equipo de succión. Rev. Invest.
Inst. Oceanol., 67: 1-8.
Ibarzábal, D.R. 1990. Características de la macroinfauna
de la macrolaguna del Golfo de Batabanó. In: P.
Alcolado (ed.). El bentos de la macrolaguna del Golfo
de Batabanó. Academia, La Habana, pp. 113-128.
Ibarzábal, D.R. 2007. (CD-ROM). Anélidos-Filo
Annelida. Poliquetos-Clase Polychaeta. In: R. Claro
(ed.). La biodiversidad marina de Cuba. Diversidad de
organismos, Instituto de Oceanología, Ministerio de
Ciencia, Tecnología y Medio Ambiente, La Habana,
pp. 62-67.
Jiménez, C. & D.R. Ibarzábal. 1982. Evaluación cuantitativa
del mesobentos en la plataforma nororiental de Cuba.
Cienc. Biol., 8: 53-69.
Jordana, E., S. Pinedo & E. Ballesteros. 2015. Macrobenthic assemblages, sediment characteristics and
heavy metal concentrations in soft-bottom Ebre Delta
bays (NW Mediterranean). Environ. Monit. Assess.,
187. doi: 10.1007/s10661-015-4315-y.
Kristensen, E., M. Delefosse, C.O. Quintana, M.R. Flindt
& T. Valdemarsen. 2014. Influence of benthic macrofauna community shifts on ecosystem functioning in
shallow estuaries. Front. Mar. Sci., 1:41. doi:
10.3389/fmars.2014.00041.
Leonard, D.R.P, K.R. Clarke, P.J. Somerfield & R.M.
Warwick. 2006. The application of an indicator based
on taxonomic distinctness for UK marine biodiversity
assessments. J. Environ. Manage., 78: 52-62.
Lloret, J. & A. Marín. 2011. The contribution of benthic
macrofauna to the nutrient filter in coastal lagoons.
Mar. Pollut. Bull., 62: 2732-2740.
Mackie, A.S.Y., P. Graham-Oliver, T. Darbyshire & K.
Mortimer. 2005. Shallow marine benthic invertebrates
of the Seychelles Plateau: high diversity in a tropical
oligotrophic environment. Phil. Trans. Roy. Soc.
London A, 363: 203-228.
Marrero, A., N. Venturini, L. Burone, F. GarcíaRodríguez, E. Brugnoli, M. Rodríguez & P. Muniz.
2013. Testing taxonomic sufficiency in subtidal
benthic communities of an anthropized coastal zone:
Río de la Plata (Uruguay). IJESER, 4(3): 29-45.
Martínez-Daranas, B. & G. Hidalgo. 2003. Fauna marina.
In: J. Rodríguez-Rubio (ed.). Solicitud de licencia
ambiental del proyecto construcción y operación de un
emisario submarino para la disposición de aguas de
capa tratadas Sherritt International (Cuba) Oil and Gas
Limited. C-2003-A-32, pp. 24-35.
854
Miranda, J.R., D. Mouillot, D.F. Hernandez, A.S. Lopez,
T.D. Chi & L.A. Perez. 2005. Changes in four
complementary facets of fish diversity in a tropical
coastal lagoon after 18 years: a functional
interpretation. Mar. Ecol. Prog. Ser., 304: 1-13.
Montalvo-Estévez, J.F., I.A. García-Ramil, E. PerigóArnaud, O.C. Alburquerque-Brook & N. GarcíaGarcía. 2013. Calidad química del agua y sedimento
en las bahías del Archipiélago Sabana-Camagüey.
Rev. Cub. Quím., 25(2): 123-133.
Moreira, J. & J.S. Troncoso. 2007. Inventario de la
macrofauna bentónica de sedimentos submareales de
la Ensenada de Baiona (Galicia, Península Ibérica).
Nova Act. Cient. Compostelana (Bioloxía), 16: 101128.
Mouillot, D., S. Gaillard, C. Aliaume, M. Verlaque, T.
Blesher, M. Troussellier & D.C. Thang. 2005. Ability
of taxonomic diversity indices to discriminate coastal
lagoon environments based on macrophyte communities. Ecol. Indic., 5(1): 1-17.
Muniz, P. & A.M.S. Pires-Vanin. 2005. More about
taxonomic sufficiency: a case study using polychaete
communities in a subtropical bay moderately affected
by urban sewage. Ocean Sci. J., 40: 127-143.
Muniz, P., A.M.S. Pires-Vanin & N. Venturini. 2013.
Vertical distribution patterns of macrofauna in a
subtropical near-shore coastal area affected by urban
sewage. Mar. Ecol., 34: 233-250.
Musco, L., A. Terlizzi, M. Licciano & A. Giangrande.
2009. Taxonomic structure and the effectiveness of
surrogates in environmental monitoring: a lesson from
polychaetes. Mar. Ecol. Prog. Ser., 383: 199-210.
Neira, K. & M. Palma. 2007. Estructura la macrofauna en
ambientes óxicos de Bahía Coliumo, Región del BioBio, Chile Central. Gayana, 71(2): 156-169.
Nicholas, W.L. & J.W.H. Trueman. 2005. Biodiversity of
marine nematodes in Australian sandy beaches from
tropical and temperate regions. Biodivers. Conserv.,
14: 823-883.
Norling, K., R. Rosenberg, S. Hulth, A. Grémare & E.
Bonsdorff. 2007. Importance of functional biodiversity and species-specific traits of benthic fauna for
ecosystem functions in marine sediment. Mar. Ecol.
Prog. Ser., 332: 11-23.
Ocaña, F.A., Y. Apín, Y. Cala, A. Vega, A. Fernández &
E. Córdova. 2012. Distribución espacial de los
macroinvertebrados de playas arenosas de Cuba
oriental. Rev. Invest. Mar., 32(1): 30-37.
Pielou, E.C. 1966. The measurement of diversity in
different types of biological collections. J. Theor.
Biol., 13: 131-144.
Pires-Vanin, A.M.S., P. Muniz & F.C. De Léo. 2011.
Benthic macrofauna structure in the northeast area of
Todos os Santos Bay, Bahia State, Brazil: patterns of
spatial and seasonal distribution. Braz. J. Oceanogr.,
59(1): 27-42.
Pires-Vanin, A.M.S., E. Arasaki & P. Muniz. 2013.
Spatial pattern of benthic macrofauna in a sub-tropical
shelf, São Sebastião Channel, Southeastern Brazil.
Lat. Am. J. Aquat. Res., 41(1): 42-56.
Ricotta, C. 2005. Through the jungle of biological
diversity. Acta Biotheor., 53: 29-38.
Ricotta, C. & L. Szeidl. 2006. Towards a unifying
approach to diversity measures: bridging the gap
between the Shannon entropy and Rao’s quadratic
index. Theor. Popul. Biol., 70: 237-243.
Ríos, C., E. Mutschke & E. Morrison. 2003. Biodiversidad
bentónica sublitoral en el estrecho de Magallanes,
Chile. Rev. Biol. Mar. Oceanogr., 38(1): 1-12.
Rodríguez, R. 2006. Hydrogeotechnical characterization
of a metallurgical waste. Can. Geotech. J., 43: 10421060.
Rodríguez, R. & P. Acero. 2006. Impacto y riesgo
ambiental de las actividades minero-metalúrgicas. In:
R. Rodríguez & A. García-Cortés (eds.). Los residuos
minero-metalúrgicos en el medio ambiente. Instituto
Geológico y Minero de España, Madrid, pp. 377-394.
Sánchez-Noda, R., R. del Valle, M. Cano, J.C. Martínez,
M.E. Chávez, Z. Marcos et al. 2006. (CD-ROM).
Sistema de información para la biodiversidad de la
fauna en las áreas protegidas del Archipiélago SabanaCamagüey. Proyecto PNUD/GEF CUB/98/G32, La
Habana.
Savage, C., J.G. Field & R.M. Warwick. 2001. Comparative meta-analysis of the impact of offshore marine
mining on macrobenthic communities versus organic
pollution studies. Mar. Ecol. Prog. Ser., 221: 265-275.
Scelzo, M.A., J. Martínez-Arca & N.M. Lucero. 2002.
Diversidad, densidad y biomasa de la macrofauna
componente de los fondos de pesca “CamarónLangostino”, frente a Mar del Plata, Argentina (19981999). Rev. Invest. Des. Pesq., 15: 43-65.
Shannon, C.E. & W. Weaver. 1949. The mathematical
theory of communication. University of Illinois Press,
Illinois, 117 pp.
Somerfield, P.J., M. Atkins, S.G. Bolam, K.R. Clarke, E.
Garnacho, H.L. Rees, R. Smith & R.M. Warwick.
2006. Relative impacts at sites of dredged-material
relocation in the coastal environment: a phylum-level
meta-analysis approach. Mar. Biol., 148: 1231-1240.
Souza, F.M., K.M. Brauko, P.C. Lana, P. Muniz & M.G.
Camargo. 2013. The effect of urban sewage on benthic
macrofauna: a multiple spatial scale approach. Mar.
Pollut. Bull., 67: 234-240.
StatSoft, Inc. 2004. Statistica (data analysis software
system), version 7. www.statsoft.com.
Susan-Tepetlan, P.V. & D. Aldana-Aranda. 2007. Macrofauna bentónica asociada a bancos ostrícolas en las
lagunas costeras Carmen, Machona y Mecoacán,
Tabasco, México. Rev. Biol. Trop., 56(1): 127-137.
Terlizzi, A., D. Scuderi, S. Fraschetti & M.J. Anderson.
2005. Quantifying effects of pollution on biodiversity:
a case study of highly diverse molluscan assemblages
in the Mediterranean. Mar. Biol., 148: 293-305.
Thomassin, B.A. 1978. Soft-bottom communities. In:
D.R. Stoddart & R.E. Johannes (eds.). Coral reefs:
research methods. UNESCO, Paris, pp. 263-298.
Tweedley, J.R., R.M. Warwick & I.C. Potter. 2015. Can
biotic indicators distinguish between natural and
anthropogenic environmental stress in estuaries?. J.
Sea Res., 102: 10-21. doi: 10.1016/j.seares.2015.04.
001.
Uhrin, A.V. & J.G. Holmquist. 2003. Effects of propeller
scarring on macrofaunal use of the seagrass Thalassia
testudinum. Mar. Ecol. Prog. Ser., 250: 61-70.
Valdés, E., V. Villafuerte, H. Domínguez & A. Pérez.
2011. Variabilidad temporal de la fauna acompañante
del camarón Farfantepenaeus notialis en el Golfo de
Ana María, Cuba. Rev. Cub. Invest. Pesq., 28(2): 1-7.
Venturini, N., P. Muniz & M. Rodríguez. 2004. Macrobenthic subtidal communities in relation to sediment
pollution: a test of the applicability of the phylum-level
meta-analysis approach in a southeastern coastal
region of South America. Mar. Biol., 144: 119-126.
Received: 2 February 2015; Accepted: 15 July 2015
855
Warwick, R.M. & K.R. Clarke. 1993. Comparing the
severity of disturbance: a metaanalysis of marine
macrobenthic community data. Mar. Ecol. Prog. Ser.,
92: 221-231.
Warwick, R.M. & K.R. Clarke. 1995. New “biodiversity”
measures reveal a decrease in taxonomic distinctness
with increasing stress. Mar. Ecol. Prog. Ser., 129: 301305.
Warwick, R.M. & K.R Clarke. 1998. Taxonomic
distinctness and environmental assessment. J. Appl.
Ecol., 35: 532-543.
Warwick, R.M. & K.R. Clarke. 2001. Practical measures
of marine biodiversity based on relatedness of species.
Oceanogr. Mar. Biol., 39: 207-231.
Warwick, R.M., C.M. Ashman, A.R. Brown, K.R. Clarke,
B. Dowell, B. Hart, R.E. Lewis, N. Shillabeer, P.J.
Somerfield & J.F. Tapp. 2002. Inter-annual changes in
the biodiversity and community structure of the
macrobenthos in Tees Bay and the Tees Estuary, UK,
associated with local and regional environmental
events. Mar. Ecol. Prog. Ser., 234: 1-13.
Włodarska-Kowalczuk, M., T.H. Pearson, M.A. Kendall.
2005. Benthic response to chronic natural physical
disturbance by glacial sedimentation in an Arctic
Fjord. Mar. Ecol. Prog. Ser., 303: 31-41.
Zar, J.H. 1999. Biostatistical analysis. Prentice Hall, New
Jersey, 662 pp.
Lat. Am. J. Aquat. Res., 43(5): 856-872, 2015
Distinción taxonómica de los moluscos del Golfo de Batabanó, Cuba
8561
Research Article
Distinción taxonómica de los moluscos de fondos blandos del
Golfo de Batabanó, Cuba
Norberto Capetillo-Piñar1, Marcial Trinidad Villalejo-Fuerte1 & Arturo Tripp-Quezada1
1
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacional
P.O. Box 592, La Paz, 23096 Baja California Sur, México
Corresponding author: Arturo Tripp-Quezada ([email protected])
RESUMEN. La distinción taxonómica es una medida de diversidad que presenta una serie de ventajas que dan
connotación relevante a la ecología teórica y aplicada. La utilidad de este tipo de medida como otro método para
evaluar la biodiversidad de los ecosistemas marinos bentónicos de fondos blandos del Golfo de Batabanó (Cuba)
se comprobó mediante el uso de los índices de distinción taxonómica promedio (Delta+) y la variación en la
distinción taxonómica (Lambda+) de las comunidades de moluscos. Para este propósito, se utilizaron los
inventarios de especies de moluscos bentónicos de fondos blandos obtenidos en el periodo 1981-1985 y en los
años 2004 y 2007. Ambos listados de especies fueron analizados y comparados a escala espacial y temporal. La
composición taxonómica entre el periodo y años estudiados se conformó de 3 clases, 20 órdenes, 60 familias,
137 géneros y 182 especies, observándose, excepto en el nivel de clase, una disminución no significativa de esta
composición en 2004 y 2007. A escala espacial se detectó una disminución significativa en la riqueza
taxonómica en el 2004. No se detectaron diferencias significativas en Delta+ y Lambda+ a escala temporal, pero
si a escala espacial, hecho que se puede atribuir al efecto combinado del incremento de las actividades
antropogénicas en la región con los efectos inducidos por los huracanes. Estos resultados sugieren que el par de
índices Delta+ y Lambda+ son buenos descriptores de la biodiversidad de las comunidades de moluscos
bentónicos de fondos blandos del Golfo de Batabanó.
Palabras clave: moluscos, distinción taxonómica, biodiversidad, fondos blandos, Golfo de Batabanó, Cuba.
Taxonomic distinctness of soft-bottoms mollusks from Gulf of Batabanó, Cuba
ABSTRACT. Taxonomic distinction is a measure of diversity that has a number of advantages that provides
relevant connotation to theoretical and applied ecology. The usefulness of this type of measure as an alternative
method for assessing the biodiversity of soft-bottom benthic marine ecosystems was tested using the indices of
average taxonomic distinctness (Delta+) and variation in taxonomic distinctness (Lambda+) for mollusk
communities of the Gulf of Batabanó (Cuba). For this purpose, inventories of soft bottom benthic mollusk
species obtained in the period 1981-1985 and the years 2004/2007 were used. Both species lists were analyzed
and compared at spatial and temporal scales. The taxonomic composition, between the period 1981-1985 and
years 2004 and 2007, consisted of 3 classes, 20 orders, 60 families, 137 genera and 182 species observed. With
the exception of the class level, a non-significant decrease of this composition in 2004 and 2007 was detected.
At a spatial scale, a significant decrease in the taxonomic richness was observed in 2004. Significant differences
were not detected in Delta+ and Lambda+ to time scale, but at spatial scale, results revealed significant
differences that could be attributed to the combined effect of increased anthropogenic activities in the region
with hurricane induced effects. These results suggest that the pair of indices, Delta+ and Lambda+, are good
descriptors of the biodiversity of soft-bottom benthic mollusk communities in the Gulf of Batabanó.
Keywords: mollusk, taxonomic distinctness, biodiversity, soft bottoms, Gulf of Batabanó, Cuba.
INTRODUCCIÓN
Para conocer los cambios o variaciones que tienen lugar
en los ensamblajes de especies, sean estas ocasionadas
_____________________
Corresponding editor: Ingo Wehrtmann
por factores naturales y/o antropogénicos, la reconstrucción de datos históricos es un elemento esencial
para lograr dicho objetivo (Falace, 2000). Los datos
ambientales históricos pueden ser difíciles de interpretar
857
2
cuando son analizados con medidas de riqueza y
abundancia de especies. Lo expuesto anteriormente se
debe a que esas medidas están afectadas por el tipo y
complejidad del hábitat, métodos de muestreo, tamaño
de muestra y esfuerzo de muestreo, así como por el
conocimiento sistemático del grupo (o grupos) que esté
bajo estudio o las discrepancias en la nomenclatura
existente entre diferentes autores (Ceshia et al., 2007).
Recientemente, algunos estudios ecológicos han
propuesto el uso de las categorías taxonómicas superiores para evaluar los patrones espacio-temporales de
la biodiversidad en las comunidades (Piazzi et al.,
2002; Giangrande, 2003). En este contexto se han
creados varios índices que incluyen en sus mediciones
de diversidad, la afinidad taxonómica que existe entre
las especies presentes en un sitio determinado. Dentro
de estos, se tiene los índices de Distinción Taxonómica
Promedio Delta+ (∆+, Clarke & Warwick, 1998) y la
Variación de la Distinción Taxonómica Lambda+ (Λ+
Clarke & Warwick, 2001). Delta+ (∆+) es la distancia
taxonómica promedio de las ramas del árbol
taxonómico mediante el cual se conectan todos los
pares de especies registradas en una muestra y puede
interpretarse como la amplitud taxonómica promedio
de la muestra. Lambda+ (Λ+) es la varianza de las
distancias taxonómicas entre cada par de especies, que
tiene la capacidad de distinguir diferencias entre la
estructura taxonómica de las comunidades con algunos
géneros que tengan alta riqueza de especies y otras con
taxones superiores que tengan una o pocas especies.
También se puede decir que este índice es un reflejo de
cuan equitativo es el árbol taxonómico de una muestra
(Clarke & Warwick, 1999).
∆+ y Λ+ están siendo ampliamente usadas para
detectar los efectos causados por factores naturales y/o
humanos en los ecosistemas (Brown et al., 2002;
Ceshia et al., 2007; Hong & Zhinan, 2010; Tan et al.,
2010; Xu et al., 2011, 2012). Esta utilidad se debe a que
ambos índices no están influenciados por el número de
especies, son poco afectados por el tipo y/o
complejidad del hábitat y presentan un marco
estadístico sobre el cual se puede obtener un valor
estándar para realizar las comparaciones con los valores
obtenidos a partir de las muestras de campo. Lo anterior
evidencia que estos índices no precisan de sitios
considerados como control (pocos perturbados) para
probar la magnitud de sus cambios (Warwick & Clarke,
1995, 1998, 2001; Leonard et al., 2006). Además, sus
cálculos se realizan a partir de simples listados o
inventarios de especies, lo que les confiere un uso
práctico en cuanto a costos y ahorro de tiempo y
personal en la realización de estudios de monitoreo e
impacto ambiental (Warwick & Light, 2002).
La importancia y robustez de los índices de
distinción taxonómica para evaluar la biodiversidad
marina y el estado ecológico de los ecosistemas ha sido
demostrada en diferentes grupos de organismos (Clarke
& Warwick, 1998; Hall & Greenstreet, 1998; Price et
al., 1999; Rogers et al., 1999; Warwick & Turk, 2002;
Mouillot et al., 2005; Campbell & Novelo-Gutiérrez,
2007; Tan et al., 2010; Xu et al., 2011). También la
sensibilidad de estos para detectar efectos negativos
inducidos por las actividades humanas ha sido probada
(Clarke & Warwick, 1998, 2001; Brown et al., 2002;
Leonard et al., 2006; Somerfield et al., 2006; Hong et
al., 2010; Xu et al., 2012) y cuestionada a través de
diferentes escenarios de perturbaciones antropogénicas
(Heino et al., 2005; Salas et al., 2006; Bevilacqua et al.,
2011).
Dentro de las comunidades zoobentónicas el Phylum
Mollusca ha sido considerado como grupo focal para
los estudios de biodiversidad en el ambiente marino,
dado que es el segundo en cuanto a número de especies
después de los artrópodos y presenta una gran variedad
de taxones marinos bentónicos (Lalli & Parsons, 1997).
Así mismo, los moluscos tienen un amplio espectro
trófico que engloba prácticamente a todas las formas
conocidas y presenta una elevada radiación evolutiva
(Espinosa, 1992). Estas caracte-rísticas, hacen muy
atractiva la sugerencia de utilizar a los moluscos para
determinar los cambios o las variaciones en las
comunidades ecológicas en una región determinada.
En el Golfo de Batabanó (GB) los efectos de las
perturbaciones naturales vinculadas al cambio climático
(huracanes), combinados con diversas acciones antropogénicas (represamiento de los ríos, deforestación del
manglar, construcción de diques, actividad industrial,
entre otros), han permitido observar señales de
deterioro ambiental en su medio físico y biológico.
Dentro de los físicos, se han detectado cambios en la
distribución textural de los sedimentos (Guerra et al.,
2000) y en la evolución de la hidrodinámica sedimentaria (Acker et al., 2004). Como biológicos están la
regresión y pérdida de áreas de pastos marinos en zonas
en contacto con tierra firme en la costa norte del golfo
(Cerdeira et al., 2008), cambios drásticos en la
densidad, biomasa, riqueza de especies y estructura de
las comunidades del bentos en varias zonas del litoral
de su costa norte y al noreste de la Isla de La Juventud,
asumiendo que estos cambios son debidos a las
actividades humanas realizadas en la región desde hace
25 años (Arias-Schreiber et al., 2008).
El objetivo del presente trabajo fue comprobar la
aplicabilidad de los índices de distinción taxonómica en
la malacofauna del GB, como herramienta para evaluar
la biodiversidad en los ecosistemas bentónicos de fon-
dos blandos de esta región, analizando la estructura
taxonómica de los ensamblajes de las especies de
moluscos registradas en el periodo 1981-1985 y los
años 2004 y 2007.
Área de estudio
El GB es un cuerpo de agua semicerrado ubicado en la
región suroccidental de Cuba (Fig. 1). Tiene una
superficie aproximada de 21.305 km2, con una
profundidad media de 6 m (Cerdeira et al., 2008). En
su litoral norte (N) y oeste (O), Isla de La Juventud y
en los centenares de cayos existentes en esta región se
localizan franjas de bosques de mangles. En el litoral
sur (S) está limitada por cayos, bajos y arrecifes
coralinos costeros que en determinadas regiones
emergen en forma de crestas arrecifales (GonzálezFerrer et al., 2004) y en otras están interrumpidas por
algunos canales de entrada que en ocasiones presentan
comuni-cación con el océano abierto (Fig. 1). En el
litoral norte se localizan la mayoría de los asentamientos
humanos donde se producen contaminantes residuales
industriales, agropecuarios y domésticos que son
vertidos a su interior.
La circulación de la corriente marina es de este a
oeste y describe una curva suave hacia el norte con baja
velocidad (10,6 cm s -1) (Emilsson & Tápanes, 1971).
Sus fondos van desde fangosos sin vegetación a los
arenosos, arenosos fangosos y fango arenosos con o sin
vegetación. En los fondos cubiertos por pastos marinos
la especie que predominó fue la fanerógama marina
Thalassia testudinum (Banks & König, 1805), la cual
se presentó en diferentes densidades (Cerdeira et al.,
2008).
Procedencia de los datos y nomenclatura
Se utilizó la información disponible de moluscos de
fondos blandos obtenida en 41 sitios de muestreo
distribuidos en el GB (Tabla 1, Fig.1). Los datos
provienen de nueve prospecciones ecológicas realizadas
en el periodo 1981-1985, en que se muestrearon 20
sitios (Tabla 1, Fig.1a) y en los años 2004 y 2007 en
que se muestreó 21 sitios, de los cuales 13 fueron
analizados en el 2004 (Tabla 1, Fig. 1b) y 8 en el 2007
(Tabla 1, Fig. 1c). Varios sitios de muestreo en 2004 y
2007 se ubicaron en los mismos sitios muestreados
durante 1981-1985, mientras que otros se localizaron
en áreas próximas a estos para establecer comparaciones. Siete sitios (21, 23, 24, 25, 30, 31, 33) de
muestreo del 2004 se confinaron próximos al litoral de
la costa norte del golfo, mientras que en 2007 todos se
ubicaron alejados de esta zona (Figs. 1b, 1c). El periodo
que se analizó en este estudio fue de 26 años.
8583
La información de 1981-1985 se obtuvo de
Alcolado (1990) y se refiere solamente a la presencia
de las especies de moluscos por sitio de muestreo. El
elenco sistemático de las especies de moluscos del año
2004 fue obtenido de la base de datos del Instituto de
Oceanología y el de 2007 mediante un crucero de
investigación realizado por especialistas del Centro de
Investigaciones Pesqueras de Cuba. En ambos elencos
sistemáticos se tiene el listado del número de individuos
por especie de molusco por cada sitio de muestreo, arte
de muestreo, número de réplicas (Tabla 1) y una
descripción detallada del hábitat béntico donde se
localizaron.
Para la colecta de las muestras de moluscos se
utilizó una rastra epibentónica constituida por un copo
interno con una malla de 4 mm de abertura y otro
externo, protector, con una malla de 1 cm de abertura.
En el periodo 1981-1985 y los años 2004 y 2007 las
dimensiones de las mallas usadas para la colecta de los
moluscos fueron similares. La diferencia de la rastra
varió solamente en la amplitud de su zona de arrastre
(Tabla 1). Los organismos colectados fueron pasados
por un tamiz de 4 mm de abertura de malla para
separarlos del sedimento y se seleccionaron solamente
los vivos.
Debido a la diferente naturaleza de los datos del
periodo 1981-1985 con respecto a los de 2004 y 2007 y
a las variaciones en el esfuerzo de muestreo (Tabla 1),
los datos fueron estandarizados como presencia/
ausencia (p/a). Dicha estandarización permitió hacer uso
de los índices Delta+ y Lambda+ ya que basan sus
análisis en datos cualitativos (p/a) y son robustos a las
diferencias de esfuerzo de muestreo (Warwick &
Clarke, 1995, 1998, 2001).
Un análisis de la eficiencia de muestreo en el
periodo 1981-1985 y los años 2004 y 2007 se realizó
mediante los estimadores de riqueza de especies no
paramétricos Chao-2, Jacknife-1 y Jacknife-2, cuyos
cálculos se realizaron con el programa PRIMER v6.1
(Clarke & Gorley, 2006). El resultado obtenido
demostró que la eficiencia fue mayor (82%) en el
periodo 1981-1985 que en los años 2004 y 2007 (50 y
68% respecti-vamente). Este resultado limita el uso de
los índices clásicos de diversidad (Shannon-Wiener,
Riqueza de Margalef, entre otros), así como los análisis
de abundancias de las especies con fines comparativos,
que es el objetivo propuesto en este estudio. Dada las
limitaciones expuestas con anterioridad, se utilizó el
índice de frecuencia de aparición de las especies
(número de sitios de muestreo donde las especies
aparecen contra el número total de sitios), para
determinar cuáles presentaron mayor frecuencia de
aparición o distribución espacial en el periodo y años
analizados. Este índice se expresó como un porcentaje.
4859
principal (Cuba) para la Zona II y mayor influencia
marina en la Zona III (Figs. 1a-1c).
Los nombres de las especies registradas en cada
período fueron actualizados con la literatura taxonómica más reciente: Espinosa et al. (1995); Espinosa &
Ortea (1998, 1999, 2001, 2003); Ortea & Espinosa
(2001) y Mikkelsen & Bieler (2008). El ordenamiento
taxonómico se basó fundamentalmente en Bouchet et
al. (2005), Espinosa et al. (2005, 2007) y Espinosa &
Ortea (2010).
Análisis de datos
Para estimar los índices de distinción taxonómica, una
clasificación Linneana de cinco niveles (clase, orden,
familia, género y especie), también llamada lista madre,
se utilizó como proxy para representar las relaciones
taxonómicas de los individuos de todas las especies
registradas en el periodo 1981-1985 y años 2004 y
2007. Se estimaron los índices de Distinción Taxonómica Promedio (Delta+, ∆+) y Variación de la
Distinción Taxonómica (Lambda+, Λ+) de las muestras
a partir de las ecuaciones propuestas por Clarke &
Warwick (1998, 2001).
∆+ = [∑∑ i<j w ij]/ [S(S-1)/2]
Λ+ = [∑∑ i<j (wij -∆+) 2]/ [S(S-1)/2]
Figura 1. Sitios de muestreos (números) de moluscos de
fondos blandos del Golfo de Batabanó en el período 19811985 (a) y los años 2004 (b) y 2007 (c). Las líneas
discontinuas señalan los límites imaginarios de las zonas
(Zona I, Zona II y Zona III), en que se dividió la región
estudiada.
Para facilitar el análisis espacial la región se dividió
en tres zonas de acuerdo al criterio de Arias-Schreiber
et al. (2008). La Zona I, se enmarcó entre la Ensenada
de La Broa y las aguas adyacentes del poblado
Batabanó, Guanimar y el sector este del sur de la
provincia de Pinar del Río, cerca de Punta Capitana,
que se caracterizó por presentar la mayor concentración
de focos contaminantes en la región (Perigó et al.,
2005). La Zona II ubicada en la región oeste y Zona III
ubicada en la región este, fueron propuestas considerando una mayor influencia de tierra firme de la isla
dónde: wij es la distancia taxonómica (peso taxonómico) a través del árbol de clasificación Linneana de
cualquier par de individuos, siendo el primero para la
especie i y el segundo para la especie j y S el número
total de especies en la muestra. El peso taxonómico
(wij) es un valor que debe aumentar con la separación
taxonómica entre las especies y para este trabajo los
valores fueron dados de forma tal que hubiese un
incremento constante de un nivel a otro, según lo
propuesto por Clarke & Warwick (1999). Los valores
de ∆+ y Λ+ fueron calculados usando la rutina Diverse
del programa PRIMER 6.1 (Clarke & Gorley, 2006).
Análisis espacio-temporal de los índices de distinción
taxonómica
A partir de la lista madre de especies de toda la región,
con la subrutina Taxdtest del programa PRIMER 6 v.1
(Clarke & Gorley, 2006), se calcularon a través de la
generación de submuestras (sublistas de números de
especies) provenientes de 1000 iteraciones aleatorias
sin remplazo los valores esperados de ∆+ y Λ+. Estos
valores generan una distribución de probabilidad en
forma de embudo con contornos de confianza al 95%
cuando se grafican contra el número de especies. Este
análisis se consideró para comparar los valores
calculados de estos índices a partir de las muestras con
los esperados o calculados a partir del proceso de
iteración. Para el cálculo de los índices de distinción
8605
Tabla 1. Tipo de arte, sitios y esfuerzo de muestreo y tipo de datos de las prospecciones ecológicas realizadas en el Golfo
de Batabanó durante el periodo 1981-1985 y los años 2004 y 2007. A/m: amplitud o el ancho de la zona de arrastre
(expresada en metros) de la rastra epibentónica.
Número prospecciones
ecológicas
7
Rastra epibentónica (1 m)
Número/sitios
muestreo
20
2004
1
Rastra epibentónica (0,70 m)
13
2007
1
Rastra epibentónica (0,70 m)
8
Periodo/Año
1981-1985
Arte/Muestreo
taxonómica promedio y su variación se excluyeron los
sitios 21 y 30, por presentar solo uno o dos individuos
representando a una especie, lo que es insuficiente para
realizar el cálculo de estos índices, ya que sus valores
son atípicos (Clarke & Warwick, 1999). Esto
condicionó al cálculo de los índices ∆+ y Λ+ solamente
a 39 sitios.
Para comprobar si la estructura taxonómica de la
malacofauna de la región había tenido cambios a escala
temporal en los 26 años, se calcularon los valores de los
índices ∆+ y Λ+ para cada uno de los sitios muestreados
en el periodo 1981-1985 y los años 2004 y 2007. Estos
valores se contrastaron con la distribución probabilística
en forma de embudo con límites de confianza del 95%.
Análisis espacio-temporal de la estructura comunitaria de la malacofauna
La riqueza taxonómica de la malacofauna de fondos
blandos del GB se comparó entre el periodo 1981-1985
y los años 2004 y 2007 a escala espacial y temporal
mediante el análisis del estadístico t. En aquellos casos
que no se cumplió con la normalidad, se aplicó la
prueba de Kruskal-Wallis (K-W). Además, se realizó el
diagrama de caja y bigote (Box-Plot) para conocer
cuales medianas diferían entre sí. Estos análisis
estadísticos se realizaron con el programa Statgraphics
Centurion XV (2007).
La similitud de la estructura comunitaria entre
1981-1985 y los años 2004 y 2007 se comprobó
mediante un análisis de clasificación, construyendo un
dendrograma por el método de agrupamiento de pares
con la media aritmética ponderada (UPGMA) (Clarke
& Gorley, 2006). Las relaciones entre los sitios de
muestreo (análisis espacial) se realizaron mediante la
prueba de escalamiento multidimensional no métrico
(nMDS). Para conocer el patrón de la estructura
comunitaria de los moluscos de la región y para detectar
la existencia de diferencias significativas entre los
grupos formados se realizó la prueba ANOSIM (Clarke
& Gorley, 2006). Las matrices de similaridad se
obtuvieron mediante el uso del índice de Sorensen a
Número réplicas
Tipo/Datos
Se desconoce
Presencia/Ausencia
3
Número/Individuos
3
Número/Individuos
partir de los datos de presencia/ausencia (p/a) de las
especies.
RESULTADOS
Composición taxonómica
Durante el periodo de estudio se registró un total de 182
especies de moluscos de fondos blandos en los 41 sitios
de muestreo, distribuyéndose en 3 clases, 20 órdenes, 60
familias y 137 géneros (Anexo 1). Los bivalvos estuvieron representados por 89 especies, 10 órdenes, 23
familias y 71 géneros, los gasterópodos por 91 especies,
8 órdenes, 35 familias y 64 géneros, y los escafópodos
por 2 especies, 2 órdenes, 2 familias y 2 géneros (Tabla
2).
La composición taxonómica de las tres clases de
moluscos (Bivalvia, Gastropoda y Scaphopoda), se
caracterizó por una disminución del número de
órdenes, familias, géneros y especies con respecto al
periodo 1981-1985. Sin embargo dichas variaciones
observadas no fueron significativas: bivalvos (t = 1,13;
P = 0,36), gasterópodos (t = 2,67; P = 0,12) y escafópodos
(t = 1,00; P = 0,40). La riqueza taxonómica disminuyó
en 2004 y 2007 en todas las zonas estudiadas al
compararla con la del período 1981-1985. Esta
disminución fue estadísticamente significativa (K-W =
8,62; P = 0,03) para el 2004 debido a la baja riqueza
encontrada en la Zona I (Fig. 2).
Las tres clases de moluscos fueron halladas en el 95
y 35% de los sitios muestreados en el periodo 19811985 y 2007 respectivamente. Además, en el 2007 se
registraron dos clases en el 65% de los sitios de
muestreo. En el 2004 no se registraron las tres clases en
ninguno de los sitios y se caracterizó por la presencia
solamente de la clase Bivalvia en el 46,1% de los sitios.
Desde el punto de vista temporal 32 especies de
moluscos (17,5%) fueron comunes entre el periodo
1981-1985 y años 2004 y 2007 (Anexo 1). De las cuales
16 (50%) correspondieron a bivalvos, 15 (46,8%) a
gasterópodos y 1 (3,1%) a escafópodos (Anexo 1).
861
6
Tabla 2. Número de taxones en cada nivel de resolución taxonómica para cada clase de moluscos de fondos blandos del
Golfo de Batabanó de los listados de especies analizados por cada año.
Clases
Bivalvia
Gastropoda
Niveles taxonómicos
Orden
Familia
Género
Especie
Orden
Familia
Género
Especie
Scaphopoda
Orden
Familia
Género
Especie
Año (s)
1981-1985
2004
10
8
21
14
59
28
72
32
7
6
35
16
65
20
89
20
2
2
2
2
1
1
1
1
1
1
1
1
2007
7
17
35
39
5
20
26
31
Total
10
23
71
89
8
35
64
91
2
2
2
2
Figura 2. Análisis espacial de la riqueza taxonómica de los moluscos de fondos blandos del Golfo de Batabanó registrada
por zona (Zona I, Zona II y Zona III) para el período 1981-1985 y los años 2004 y 2007.
Entre el 60% y 100% de los sitios muestreados se
registraron 24 especies de moluscos en el periodo 19811985 y 9 en el 2007. Durante 1981-1985 esas especies
estuvieron compuestas por 12 especies de bivalvos, 11
de gasterópodos y 1 de escafópodos y las del 2007 por
7 especies de bivalvos y 2 de gasterópodos. Ninguna
especie fue registrada en el 60% de los sitios
muestreados en el 2004 y solo 6 entre el 38 y 54% de
los sitios y de ellas 5 fueron bivalvos y 1 de gasterópodos.
Laevicardium serratum (100%), Cerithium
eburneum (95%), Nassarius albus (95%), Columbella
mercatoria (90%) y Antalis antillaris (90%) presentaron
los mayores porcentajes de aparición durante 19811985. En el 2004 los bivalvos L. serratum, Tucetona
pectinata y Chione cancellata presentaron los mayores
porcentajes de aparición con el 54% de los sitios cada
una, seguidas por Pitar fulminatus (46%), Ctena
orbiculata y C. eburneum con el 38% cada una. En el
2007 los bivalvos Laevicardium serratum y C.
cancellata se registraron en el 100% de los sitios de
muestreo, seguidos por P. fulminatus y C. eburneum con
el 87% cada una y T. pectinata con el 75%.
Variación temporal y espacial de la distinción
taxonómica
Los resultados expuestos en la Fig. 3 indican que ni en
el periodo 1981-1985 ni en 2004 y 2007 se localizaron
fuera de los contornos probabilísticos de la distribución
esperada en ambos índices: Delta+ (∆+) y Lambda+
(Λ+). El valor esperado del índice de distinción
taxonómica promedio ∆+ en los 26 años analizados fue
de 87 y la variación en la distinción taxonómica Λ+ de
240.
Los valores de ∆+ en 2004 y 2007 (86,21 y 86,90
respectivamente) fueron menores al de la media
esperada y en 1981-1985 fue superior (87,28), no
detectándose diferencias significativas (P > 0,05) en
ambos casos. Para Λ+ los valores de los años 2004
(271,42) y 2007 (257,82) fueron superiores a la media
esperada y menor (232,86) en 1981-1985, siendo no
significativo (P > 0,05) (Figs. 3a-3b).
Desde el punto de vista espacial la estructura
taxonómica de los moluscos mostró diferencias significativas. Para ∆+ y Λ+ los sitios de muestreo del 19811985 se localizaron dentro de la distribución esperada
con valores de ∆+ por encima o muy cerca de la media
esperada (87) y con valores por debajo de la media
esperada (240) para Λ+ (Figs. 3c-3d).
Cuatro sitios (24, 25, 27 y 33) del año 2004 se
localizaron fuera de la distribución esperada de ∆+, que
presentaron valores menores (77,14; 81,44; 74, 29 y 58
respectivamente) y estadísticamente significativos (P ≤
0,05) a la media esperada (87) y de estos el que presentó
el menor valor fue el 33 (Fig. 3c). Para Λ+, cinco sitios
de muestreo (24, 25, 27, 33 y 38) se localizaron fuera
de la distribución esperada, de los cuales tres (24, 27 y
33) se ubicaron fuera del contorno probabilístico
inferior y con valores bajos (48,98; 119,73 y 36
respectivamente) y significativos (P ≤ 0,05) respecto a
la media esperada (240). Los sitios 25 de 2004 y 38 de
2007 se localizaron fuera y por encima del contorno
probabilístico superior con valores altos (397,93 y
42,72 respectivamente) y significativos (P ≤ 0,05)
respecto a la media esperada (Fig. 3d).
Patrón espacio-temporal de la estructura comunitaria
de los moluscos
Los análisis de ordenación por escalamiento multidimensional no métrico (nMDS) y el de clasificación
mostraron la formación de dos grupos bien definidos
(Figs. 4a-4b). El análisis de clasificación identificó un
grupo conformado por 2004 y 2007 y otro por 19811985 (Fig. 4a). El nMDS también identificó la
formación de dos grupos pero en este caso de sitios de
muestreo, los que están en correspondencia con el
periodo y años analizados (Fig. 4b). El resultado del
862
7
ANOSIM
mostró
diferencias
estadísticamente
significativas entre los ensamblajes de moluscos del
periodo 1981-1985 y los años 2004 y 2007 (R = 0,30;
P = 0,01).
DISCUSIÓN
La no existencia de cambios significativos en la
estructura taxonómica de los moluscos del periodo
1981-1985 y años 2004 y 2007 indicó que ambas
estructuras se caracterizaron por la presencia de un
buen número de categorías taxonómicas (elevada
amplitud taxonómica), donde hubo una distribución
equitativa de especies. Además, las especies que
conformaron esta estructura taxonómica estaban
taxonómicamente poco emparentadas entre sí.
Situación similar se presentó en la composición taxonómica de las tres clases de moluscos registradas en el
periodo 1981-1985 y años 2004 y 2007 (Tabla 2).
El valor similar de ∆+ (87,28) en 1981-1985 y muy
próximo (86,90) el del año 2007 respecto a la media
esperada (87) (Fig. 3a), indicó que las estructuras
taxonómicas de los ensamblajes de moluscos fueron las
más estables durante los 26 años analizados. Dicha
estabilidad pudo ser reflejo de un ambiente con muy
bajo nivel de perturbación que permitió la coexistencia
de un mayor número de especies en los diferentes
hábitats bénticos de fondos blandos del GB. No
obstante el valor ligeramente superior de ∆+ en el
periodo 1981-1985 respecto a la media esperada, se
debería a características ambientales muy particulares
respecto a las de 2004 y 2007.
La amplia distribución espacial (60-100% de los
sitios de muestreo) de 32 especies de moluscos entre el
periodo 1981-1985 y el 2007 demuestra la existencia de
la estabilidad ambiental que existió en ese año al
compararla con el año 2004. Sin embargo, el hecho que
en el 95% de los sitios de muestreo se registraran las
tres clases de moluscos y que la cantidad de especies de
bivalvos (12) y gasterópodos (11) hayan sido similares
en el periodo 1981-1985 indica que las condiciones
ambientales en ese periodo fueron las más estables en
los 26 años analizados.
Las condiciones físicas, meteorológicas y bióticas
de la región en el período 1981-1985 fueron muy
diferentes a las de 2004 y 2007 y han quedado
reflejadas en varios estudios, donde se ha demostrado
la existencia de cambios sustanciales con el paso del
tiempo. Puga et al. (2010) hallaron un aumento en la
frecuencia e intensidad de los ciclones tropicales en
Cuba a partir de 2001, muchos de los cuales afectaron
al GB. Cambios de la hidrodinámica y depositación se-
863
8
Figura 3. Embudo de confianza (media: línea discontinua e intervalos de confianza al 95%: línea continua) del índice de
distinción taxonómica promedio (Delta+) y la variación de la distinción taxonómica (Lambda+) simulado de la lista madre
de especies de moluscos del Golfo de Batabanó. Los puntos son los valores observados en el periodo 1981-1985 y años
2004 y 2007 (a y b: análisis temporal) y de los 39 sitios de muestreos (c y d: análisis espacial) analizados en el mismo
periodo y años.
Figura 4. a) Análisis de clasificación y b) ordenamiento multidimensional no métrico de la estructura comunitaria de los
moluscos de fondos blandos del Golfo de Batabanó. Los sitios del 1-20 pertenecen al período 1981-1985 y del 21-41 a los
años 2004 y 2007.
dimentaria (Giermo & Volkov, 1988; Acker et al.,
2004; Guerra et al., 2000; Alonso-Hernández et al.,
2011), así como de la calidad de las aguas y sedimentos
(Perigó et al., 2005; Loza et al., 2007) y cambios en las
comunidades bentónicas (Arias-Schreiber et al., 2008;
Cerdeira et al., 2008; Lopeztegui & Capetillo, 2008),
han sido señaladas en varias localidades del golfo, las
que conjuntamente con la disminución en las capturas
de especies de interés comercial (Claro et al., 1990;
Baisre et al., 2003; Puga et al., 2010), dan indicios de
cambios a escalas locales y mesoescala en esta región.
La estructura taxonómica de los sitios de muestreo
24, 25, 27 y 33 del año 2004 se caracterizó por una
reducción en el número de categorías taxonómicas
(poca amplitud taxonómica) y una distribución desigual
de las especies en esas categorías. Lo anterior indica
que las especies que conformaron dicha estructura
estuvieron taxonómicamente más emparentadas entre
sí, demostrando la existencia de cierta inestabilidad
ambiental.
La menor distribución espacial (frecuencia de
aparición de las especies <60% de los sitios de
muestreo) de las especies de moluscos en el GB hallada
en el año 2004 sería resultado de los efectos
ocasionados por la combinación de factores naturales
(huracanes) y humanos. El registro de una clase de
moluscos en tres sitios de muestreo (21, 24 y 30), así
como el hallazgo de dos clases en cuatro sitios (23, 25,
31, 33) que fueron ubicados en el litoral N del GB (Fig.
1b) dan evidencias que en esta región del golfo, los
efectos inducidos por las actividades humanas
(Montalvo et al., 2000; Perigó et al., 2005; MartínezDaranas et al., 2009) fueron una de las causas que
afectaron la estructura taxonómica de los moluscos. Sin
embargo, las diferencias en cantidad y tipo de moluscos
registrados entre esos sitios, conllevan a pensar en que
no todo el litoral N del GB presentó el mismo nivel de
afectación generado por las actividades humanas. Esto
requiere un estudio ecológico más detallado, que
considere agentes contaminantes en agua y sedimentos,
distancia a la costa de los sitios de muestreo y el análisis
de varios grupos bentónicos para dilucidar la situación
ambiental en esta región del golfo.
Los valores bajos y significativos de ∆+ de los sitios
de muestreo 24, 25, 27 y 33 del 2004, así como los bajos
porcentajes de distribución espacial de las especies
también pueden ser explicados por los efectos
ocasionados por el impacto del huracán Charley
(Categoría 3, escala Saffir-Simpson) en agosto de ese
mismo año y a los inducidos indirectamente por los
fuertes oleajes e intensas lluvias del huracán Iván
(Categoría 5, escala Saffir-Simpson) durante su paso
por los mares adyacentes al sur del golfo, un mes
después (septiembre) del paso del Charley. Sin
864
9
embargo, los valores bajos y significativos de Λ+
observados en los sitios 24, 27 y 33 y alto y
significativo para el sitio 25 proporcionan evidencias
que el efecto de estos eventos no fue de igual magnitud
en cada uno de ellos. En este contexto varias investigaciones han demostrado que los huracanes pueden
inducir disminuciones, pérdidas o incrementos en la
abundancia y diversidad de los organismos bentónicos
de fondos blandos como fue la pérdida de algunas
especies en Bahía Chesapeake, después del paso de la
Tormenta Tropical Agnes en 1972 (Boesch et al., 1976)
y en la comunidad bentónica de La Cuenca Cape Fear,
después del Huracán Fran (Mallin et al., 1999).
También la disminución no significativa en la infauna
intermareal en Hawaii después del Huracán Iniki en
1992 (Dreyer et al., 2005), así como el incremento
significativo de la diversidad de especies de
invertebrados de fondos blandos, pero no significativo
en el número total de individuos al Este de Virginia,
después del Huracán Isabel (Hughes et al., 2009).
Los huracanes son eventos catastróficos que alteran
severamente los ecosistemas, induciendo un amplio
rango de respuesta a la biota intermareal y submareal
(Hughes et al., 2009). Esas respuestas estarán
condicionadas según la intensidad y frecuencia de esos
eventos, las características ecológicas de la zona
impactada y determinados efectos negativos
ocasionados por factores antropogénicos. Los más
bajos y significativos valores de ∆+ y Λ+ hallados en los
sitios 24 y 33 pudieron ser consecuencia de la
combinación de los efectos ocasionados por los
huracanes con las condiciones de deterioro que
presentó la zona donde se ubicaron estos sitios debido
a la pérdida de áreas de pastos marinos (Cerdeira et al.,
2008). Esta situación es más drástica para el sitio 33
donde sus fondos están desprovistos de vegetación,
además de presentar cierto nivel de afectación por
contaminación orgánica (Perigó et al., 2005). Los
efectos negativos observados en estos sitios (24 y 33)
fueron similares a los obtenidos por Arias-Schreiber et
al. (2008) e Hidalgo & Areces (2009), quienes
detectaron diferencias significativas en la estructura de
las comunidades bentónicas y valores bajos y
significativos de biomasas y densidades del macrozoobentos en estos mismos sitios, al compararlos con
los resultados obtenidos en 1981 por Alcolado (1990) e
Ibarzábal (1990). También son similares a los obtenidos
por Tan et al. (2010) y Xu et al. (2011) quienes
demostraron que el par de índices ∆+ y Λ+ presentaron
valores bajos y significativos en gradientes de estrés
ambiental ocasionados por el impacto de diferentes
actividades humanas.
La reducción en el número de categorías taxonómicas observada en el sitio 27 se debería a la combi-
865
10
nación de los efectos de los huracanes con las
características intrínsecas del hábitat donde se localizó
este sitio. Sus fondos se caracterizaron por ser fangosos
con poca vegetación lo que habría generado determinadas condiciones ambientales que al combinarse con
el efecto de los huracanes, afectaron la estructura
taxonómica de las comunidades de moluscos. Ibarzábal
(1982), Jiménez & Ibarzábal (1982) e Hidalgo &
Areces (2009) registraron mayores diversidades de
grupos taxonómicos en sustratos arenosos y arenofangoso con vegetación que en sedimentos fangosos, lo
que refuerza la idea que el sustrato fangoso con
vegetación puede estar imponiendo determinadas
restricciones ambientales de manera natural que afectan
la diversidad.
La estructura taxonómica que caracterizó al sitio
25, aunque fue similar a la del sitio 27, reflejó la
presencia de condiciones ambientales adversas. Señales
de deterioro ambiental (pérdidas de áreas y/o
disminución de cobertura de pastos marinos y presencia
de altas densidades de especies oportunistas de
poliquetos (Arias-Schreiber et al., 2008; Cerdeira et al.,
2008) observadas en el área donde se localizó este sitio,
hecho que puede justificar la afectación en la estructura
taxonómica de estos organismos.
La estructura taxonómica del sitio 38 muestreado en
el 2007, indicó la presencia de una distribución desigual
de las especies en las categorías taxonómicas. La escasa
equidad registrada en bivalvos originó el alto valor y
significativo de Λ+ (Fig. 3d). Dicha desigualdad se debió
a la desproporción en el número de familias (3) y géneros
(8) en el Orden Veneroida de la clase Bivalvia y a la
elevada presencia de Tucetona pectinata (Orden Arcida).
Respecto a los gasterópodos se observó una distribución
equitativa de familias (1 ó 2 por orden) y géneros (1 por
familia) en su estructura taxonómica. La baja
heterogeneidad espacial que presentó este sitio ubicado
en un fondo areno-fangoso sin o con muy poca
vegetación, pudo causar la estructura taxonómica
observada. Alcolado (1990), encontró en el periodo
1981-1985 que en el sector este del GB (zona donde se
ubicó el sitio 38), se localizaron las mayores biomasas
y densidades de bivalvos, evidencia que afirma que las
condiciones ambientales en esta zona del golfo
favorecen más a los organismos de esta clase de
moluscos.
Warwick & Clarke, (1995,1998) plantearon que los
índices ∆+ y Λ+ no solamente pueden ser afectados por
impactos antropogénicos o por contaminación
ambiental, sino que también por las características
edáficas del medio coincidiendo con los resultados
observados en el sitio 38. Un resultado similar fue
obtenido por Heino et al. (2005), Salas et al. (2006),
Ceschia et al. (2007) y Bevilacqua et al. (2011) quienes
al analizar la estructura taxonómica de los ensamblajes
de diferentes organismos bentónicos en hábitats de
sustratos blandos y duros en ríos y lagos de Finlandia y
en varias regiones de la plataforma marina de Portugal,
España e Italia, concluyeron que los índices ∆+ y Λ+
fueron afectados fuertemente por las características
intrínsecas del hábitat, más que por la influencia
antrópica.
Análisis de la estructura comunitaria
Desde el punto de vista espacial, los análisis de
clasificación y multidimensional no métrico mostraron
que las estructuras comunitarias de los moluscos en los
años 2004 y 2007 fueron diferentes estadísticamente a
las del periodo 1981-1985. Dicha diferencia se debería
a: (1) la elevada similitud espacial (60-100% de los
sitios de muestreo) en la composición de especies en el
periodo 1981-1985 a diferencia de la baja similitud
encontrada en 2004 y 2007; y (2) la similar equidad de
especies de bivalvos y gasterópodos registrada en 19811985, respecto a la baja similaridad en la equidad en
2004 y 2007, en los cuales se observó la dominancia de
bivalvos.
El cambio de estructura comunitaria de los moluscos
se explicaría por la inestabilidad ambiental registrada
en 2004 y 2007. Esa inestabilidad ambiental fue mayor
en el 2004 por haber sido la zona impactada directa o
indirectamente por dos huracanes y por ubicarse sitios
próximos al litoral de la costa N del GB, región afectada
por la actividad antrópica (Perigó et al., 2005; Loza et
al., 2007; Arias-Schreiber et al., 2008; Cerdeira et al.,
2008; Lopeztegui & Capetillo, 2008).
Un análisis detallado acerca de la elevada dispersión
observada en los sitios de muestreo del 2004 (Fig. 4b),
dio como resultado que varios de esos sitios se ubicaron
fuera de los contornos de probabilidad de ∆+ (24, 25, 27
y 33) o presentaron valores bajos (24, 27 y 33) ó altos
(25 y 38) de Λ+. Esto muestra que los resultados
obtenidos por este par de índices, reflejan con cierta
fidelidad, las características de los patrones de la
estructura taxonómica de estos moluscos.
Respecto a los cambios espaciales en la estructura
taxonómica de los moluscos del GB puede resumirse
que las mayores afectaciones se observaron en el litoral
N de las tres zonas en que se dividió el golfo para su
estudio. Sin embargo, en ciertas áreas (sitio: 27 de 2004
y 38 de 2007) no ubicadas en el litoral N, mostraron
ciertos niveles de afectación en la estructura taxonómica de las comunidades de moluscos.
Los resultados obtenidos permiten concluir que el
par de índices ∆+ y Λ+ son buenos descriptores de la
biodiversidad de la malacofauna de moluscos de fondos
blandos del GB, así como para detectar los cambios
ocurridos a escala temporal y espacial. La utilidad de
estos índices para revelar los efectos ocasionados por
perturbaciones humanas y/o naturales también quedó
demostrada, aunque para este caso en particular, se
deberán desarrollar investigaciones futuras para
confirmar estos resultados, contando con variables
abióticas relacionadas con el impacto antrópico en la
región, así como la existencia de información biótica y
abiótica antes y después del paso de los huracanes.
AGRADECIMIENTOS
Se agradece el apoyo recibido por el proyecto SIP-IPN
20141032, así como al Instituto Politécnico Nacional
de México a través de los programas, EDI, COFFA y
BEIFI. También se agradece al CONACyT por el
apoyo otorgado con una beca de Doctorado. Un
especial y cordial agradecimiento al Centro de Investigaciones Pesqueras (CIP) e Instituto de Oceanología
(IdO) de Cuba.
REFERENCIAS
Acker, J.C., A. Vasilkov, D. Nadeau & N. Kuring. 2004.
Use of SeaWiFS ocean color data to estimate neritic
sediment mass transport from carbonate platforms for
two hurricane-forced events. Coral Reefs, 23: 39-47.
Alcolado, P.M. 1990. El bentos de la macrolaguna del
Golfo de Batabanó. Editorial Academia, La Habana,
161 pp.
Alonso-Hernández, C.M., F. Conte, C. Misic, M. Barsanti,
M. Gómez-Batista, M. Díaz-Asencio, A. CovazziHarriague & F.G. Pannacciulli. 2011. An overview of
the Gulf of Batabanó (Cuba): environmental features
as revealed by surface sediment characterization.
Cont. Shelf Res., 31: 749-757.
Arias-Schreiber, M., M. Wolf, M. Cano, B. MartínezDaranas, Z. Marcos, G. Hidalgo, S. Castellanos, R. del
Valle, M. Abreu, J.C. Martínez, J. Díaz & A. Areces.
2008. Changes in benthic assemblages of the Gulf of
Batabanó (Cuba) results from cruises undertaken
during 1981-85 and 2003-04. Pan-Amer. J. Aquat.
Sci., 3(1): 49-60.
Baisre, J., S. Booth & D. Zeller. 2003. Cuban fisheries
catch within FAO area 31 (Western Central Atlantic):
1950-1999. FAO Fish. Center Res. Rep., 11: 133-139.
Bevilacqua, S., S. Fraschetti, L. Musco, G. Guarnieri & A.
Terlizzi. 2011. Low sensitiveness of taxonomic
distinctness indices to human impacts: evidences
across marine benthic organisms and habitat types.
Ecol. Indic., 11: 448- 455.
Boesch, D.F., R.J. Díaz & R.W. Virnstein. 1976. Effects
of tropical storm Agnes on soft-bottom macrobenthic
communities of the James and York estuaries and the
lower Chesapeake Bay. Chesapeake Sci., 17: 246-259.
866
11
Bouchet, P., J. Freda, B. Hausdorf, W. Ponder, A. Valdes
& A. Warén. 2005. Working classification of the
Gastropoda. In: P. Bouchet & J.P. Rocroi (eds.).
Classification and nomenclature of Gastropoda
families. Malacología, 47(1-2): 241-266.
Brown, B.E., K.R. Clarke & R.M. Warwick. 2002. Serial
patterns of biodiversity change in corals across
shallow reef flats in Ko Phuket, Thailand, due to the
effects of local (sedimentation) and regional (climatic)
perturbations. Mar. Biol., 141: 21- 29.
Campbell, W.B. & R. Novelo-Gutiérrez. 2007. Reduction
in odonate phylogenetic diversity associated with dam
impoundment is revealed using taxonomic distinctness. Fund. Appl. Limnol., 16: 83-92.
Cerdeira, S., S. Lorenzo-Sánchez, A. Areces-Molleda &
C. Martínez-Bayón. 2008. Mapping of the spatial
distribution of benthic habitats in the Gulf of Batabanó
using Lansad-7 images. Cienc. Mar., 34(2): 213-222.
Ceshia, C., A. Falace & R.M. Warwick. 2007. Biodiversity evaluation of the macroalgal flora of the Gulf
of Trieste (Northern Adriatic Sea) using taxonomic
distinctness indices. Hydrobiologia, 580: 43-56.
Clarke, K.R. & R.M. Warwick. 1998. A taxonomic
distinctness and its statistical properties. J. Appl. Ecol.,
35: 523-531.
Clarke, K.R. & R.M. Warwick. 1999. The taxonomic
distinctness measure of biodiversity: weighting of step
lengths between hierarchical levels. Mar. Ecol. Prog.
Ser., 184: 21-19.
Clarke, K.R. & R.N. Gorley. 2006. PRIMERv6: user
Manual/Tutorial. PRIMER-E, Plymouth, 192 pp.
Clarke, K.R. & R.M. Warwick. 2001. A further biodiversity index applicable to species lists: variation in
taxonomic distinctness. Mar. Ecol. Prog. Ser., 216:
265-278.
Claro, R., J.P. García-Arteaga, E. Valdés-Muñoz & L.M.
Sierra. 1990. Alteraciones de las comunidades de peces
en el Golfo de Batabanó, en relación con la explotación
pesquera. In: R. Claro (ed.). Asociaciones de peces en
los biótopos del Golfo de Batabanó. Editorial
Academia, La Habana, pp. 50-66.
Dreyer, J., J.H. Bailey-Brook & S.A. McCarthy. 2005. The
immediate effects of Hurricane Iniki on intertidal fauna
on the south shore of Oáhu. Mar. Environ. Res., 59: 367380.
Emilsson, I. & J. Tápanes. 1971. Contribución a la
hidrología de la plataforma sur de Cuba. Ser. Oceanol.,
9: 1-31.
Espinosa, J. 1992. Sistemática y ecología de los moluscos
bivalvos marinos de Cuba. Tesis de Doctor en Ciencias,
Instituto de Oceanología, La Habana, 125 pp.
867
12
Espinosa, J. & J. Ortea. 1998. Nuevas especies de la
Familia Marginellidae (Mollusca: Neogastropoda) de
Cuba y los cayos de la Florida. Avicennia, 8/9: 117134.
Espinosa, J. & J. Ortea. 1999. Nuevas especies de la
familia Marginellidae (Mollusca: Neogastropoda) de
Cuba y los Cayos de La Florida. Avicennia, 8/9: 117134.
Espinosa, J. & J. Ortea. 2001. Moluscos del Mar Caribe de
Costa Rica: desde Cahuita hasta Gandoca. Avicennia,
Suplemento, 4: 1-77.
Espinosa, J. & J. Ortea. 2003. Nuevas especies de
moluscos marinos (Mollusca: Gastropoda) del Parque
Nacional Guanahacabibes, Pinar del Río, Cuba.
Avicennia, 16: 143-156.
Espinosa, J. & J. Ortea. 2010. Inventario de los moluscos
marinos de la Península de Guanahacabibes. In: J.A.
Camacho, G. Baena-González & G. Leyva-Pagan
(eds.). Memorias del Proyecto: fortalecimiento de la
gestión del desarrollo integral y sostenible de la
Península de Guanahacabibes, Reserva de Biosfera,
Pinar del Río, Cuba. Colaboración Cuba-Canadá,
Editorial Científico-Técnica, La Habana, pp. 110-295.
Espinosa, J., R. Fernández-Garcés & E. Rolán. 1995.
Catálogo actualizado de los moluscos marinos actuales
de Cuba. Res. Malacol., 9: 1-90.
Espinosa, J., J. Ortea, M. Caballer & L. Moro. 2005.
Moluscos marinos de la península de Guanahacabibes,
Pinar del Río, Cuba, con la descripción de nuevos
taxones. Avicennia, 18: 1- 84.
Espinosa, J., J. Ortea, R. Férnandez-Gárces & L. Moro.
2007. Adiciones a la fauna de moluscos marinos de la
península de Guanahacabibes (I), con la descripción de
nuevas especies. Avicennia, 19: 63-88.
Falace, A. 2000. Variazioni fisionomiche spaziotemporali della vegetazione sommersa del Golfo di
Trieste: analisi delle principali influenze ambientali.
Ph.D. Thesis, University of Triesti, Triesti, 220 pp.
Giangrande, A. 2003. Biodiversity, conservation and the
taxonomic impediment. Aquat. Conserv., 13: 451-459.
Giermo, G. & I.I. Volkov. 1988. Ree in sediments of rivers
of Batabano Bay, Cuba. Geokhimiya, 6: 892-896.
González-Ferrer, S., S. Lorenzo-Sánchez & S. CerdeiraEstrada. 2004. Formaciones coralinas. In: S.
González-Ferrer (ed.). Corales pétreos jardines
sumergidos de Cuba, Colaboración Caja Madrid,
Editorial Academia e Instituto de Oceanología de
Cuba, pp. 45-77.
Guerra, R., M.E. Chávez, K. Hernández & E. Tristá. 2000.
Cambios sedimentarios en la cuenca marina sur de la
provincia Habana. Rev. Cienc. Tier. Espa. 1. Art., 8:
35-44.
Hall, S.J. & S.P. Greenstreet. 1998. Taxonomic distinctness
and diversity measures: response in marine fish
communities. Mar. Ecol. Prog. Ser., 166: 227-229.
Heino, J., J. Soininen, J. Lappalainen & R.R. Virtanen.
2005. The relationship between species richness and
taxonomic distinctness in freshwater organisms.
Limnol. Oceanogr., 50: 978-986.
Hidalgo, G. & A. Areces. 2009. Estimación cualitativa y
cuantitativa del macrozoobentos en la macrolaguna del
Golfo de Batabanó, Cuba. Rev. Cub. Invest. Pesq.,
26(1): 73-79.
Hong, Z., H. Er & Z. Zhinan. 2010. Taxonomic distinctness of macrofauna as an ecological indicator in
Laizhou Bay and adjacent waters. J. Ocean Univ.
China (Ocean. Coast. Sea Res.), 9: 350-358.
Hughes, C., C.A. Richardson, M. Luckenbach & R. Seed.
2009. Difficulties in separating hurricane induced
effects from natural benthic succession: hurricane
Isabel, a case study from Eastern Virginia, USA.
Estuar. Coast. Shelf Sci., 85: 377-386.
Ibarzábal, D. 1982. Evaluación cuantitativa del bentos en
la región noroccidental de la plataforma cubana. Rev.
Cienc. Biol., 7: 57-80.
Ibarzábal, D. 1990. Características de la macroinfauna de
la macroinfauna de la macrolaguna del Golfo de
Batabanó. In: P.M. Alcolado (ed.). El bentos de la
macrolaguna del Golfo de Batabanó. Editorial
Academia, La Habana, pp. 113-128.
Jiménez, C. & D. Ibarzábal. 1982. Evaluación cuantitativa
del mesobentos en la plataforma nororiental de Cuba.
Rev. Cienc. Biol., 7: 53-69.
Lalli, C.M. & T.R. Parsons. 1997. Biological oceanography:
an introduction. Butterworth-Heinemann, Oxford, 320
pp.
Leonard, D.R.P., K.R. Clarke, P.J. Somerfield & R.M.
Warwick. 2006. The application of an indicator based
on taxonomic distinctness for UK marine biodiversity
assessments. J. Environ. Manage., 78: 52-62.
Lopeztegui, A. & N. Capetillo. 2008. Macrozoobentos
como estimador del potencial alimentario para la
langosta espinosa (Panulirus argus) en tres zonas al
sur de Pinar del Río, Cuba. Bol. Cent. Invest. Biol.,
42(2): 187-203.
Loza, S., M. Lugioyo, M. Martínez, M.E. Miravet, J.
Montalvo & M. Sánchez. 2007. Evaluación de la
calidad de las aguas del Golfo de Batabanó a partir de
indicadores biológicos y químicos. Rev. Invest. Mar.,
28(2): 111-120.
Mallin, M.A., H.P. Martin, S.G. Christopher, R. Matthew,
S.H. McIver, H.E. Scott & D.A. Alphin. 1999.
Hurricane effects on water quality and benthos in the
Cape Fear watershed: natural and anthropogenic
impacts. Ecol. Appl., 9(1): 350-362.
Martínez-Daranas, B., M. Cano-Mallo & L. Clero-Alonso.
2009. Los pastos marinos de Cuba: estado de
conservación y manejo. Ser. Oceanol., 5: 24-44.
Mikkelsen, P.M. & R. Bieler. 2008. Seashells of Southern
Florida. Living marine mollusks of the Florida Keys
and adjacent regions. Bivalves. Princeton University
Press, Princeton, 503 pp.
Montalvo, J.F., E. Perigó, J. Espinosa & I. García. 2000.
Prospección de variables hidroquímicas de calidad
ambiental en la zona litoral entre el río Hatiguanico y
Majana, costa sur occidental de Cuba. Contrib. Educ.
Protec. Amb., 1: 193-197.
Mouillot, D., S. Gaillard, C. Aliaume, M. Verlaque, T.
Belsher & M. Troussellier. 2005. Ability of taxonomic
diversity indices to discriminate coastal lagoon
environments based on macrophyte communities.
Ecol. Indic., 5: 1-17.
Ortea, J. & J. Espinosa. 2001. Intelcysticus e Inbiocysticus
(Mollusca: Neogastropoda: Cysticidea) dos nuevos
géneros del Atlántico Occidental Tropical. Avicennia,
14: 107-114.
Perigó, A.E., J.F. Montalvo, M. Martínez-Canals, O.
Ramírez, G. Suárez, J. Simanca, A. Perigó, C. Martínez
& D.M. Pérez. 2005. Presiones antropogénicas y su
relación con la calidad ambiental de la ecoregión del
Golfo de Batabanó. Impactos y respuestas. [http://
www.redalyc.org/articulo.oa?id=181220525073] Revisado: 29 agosto 2014.
Piazzi, L., G. Pardi, D. Balata, E. Cecchi & F. Cinelli.
2002. Seasonal dynamics of a subtidal North-Western
Mediterranean macroalgal community in relation to
depth and substrate inclination. Bot. Mar., 45: 243252.
Price, A.R.G., M.J. Keeling & C.J. OĆallaghan. 1999.
Ocean scale patterns of biodiversity of Atlantic
asteroids determined from taxonomic distinctness and
other measures. Biol. J. Linnean Soc., 66: 187-203.
Puga, R., R. Piñeiro, S. Cobas, M.E. de León, N. Capetillo
& R. Alzugaray. 2010. (CD-ROM) La pesquería de la
langosta espinosa, conectividad y cambio climático en
Cuba. In: A. Hernández-Zanuy & P.M. Alcolado.
(eds.). La biodiversidad en ecosistemas marinos y
costeros del litoral de iberoamérica y el cambio
climático: I. Memorias del Primer Taller de la Red
Cyted Biodivmar, La Habana.
Rogers, S.I., K.R. Clarke & J.D. Reynolds. 1999. The
taxonomic distinctness of coastal bottom-dwelling fish
Received: 21 October 2014; Accepted: 20 July 2015
868
13
communities of the North-east Atlantic. J. Anim.
Ecol., 68: 769-782.
Salas, F., J. Patricio, C. Marcos, M.A. Pardal, A. PerezRuzafa & J.C. Marques. 2006. Are taxonomic
distinctness measures compliant to other ecological
indicators in assessing ecological status? Mar. Pollut.
Bull., 52: 162-174.
Somerfield, P.J., S.J. Cochrane, S. Dahle & T.H. Pearson.
2006. Free-living nematodes and macrobenthos in a
high-latitude glacial fjord. J. Exp. Mar. Biol. Ecol.,
330: 284-296.
Statgraphics Centurion XV. Versión 15.2.05. 2007. Edición
multilingüe. StatPoint, Inc. www.statgraphics.com
Tan, X., X. Shi, G. Liu, H. Xu & P. Nie. 2010. An
approach to analyzing taxonomic patterns of
protozoan communities for monitoring water quality
in Songhua River, northern China. Hydrobiologia,
683: 193-201.
Warwick, R.M. & K.R. Clarke. 1995. New biodiversity
measures reveal a decrease in taxonomic distinctness
with increasing stress. Mar. Ecol. Prog. Ser., 129: 301305.
Warwick, R.M. & K.R. Clarke. 1998. Taxonomic distinctness and environmental assessment. J. Appl. Ecol.,
35: 532-543.
Warwick, R.M. & K.R. Clarke. 2001. Practical measures
of marine biodiversity based on relatedness of species.
Oceanogr. Mar. Biol. Ann. Rev., 39: 207-231.
Warwick, R.M. & J. Light. 2002. Death assemblages of
mollusks on St. Martin´s Flats, Isles of Scilly: a
surrogate for regional biodiversity? Biodivers.
Conserv., 11: 99-112.
Warwick, R.M. & S.M. Turk. 2002. Predicting climate
effects on marine biodiversity: comparison of recent
and fossil Mollusca death assemblages. J. Mar. Biol.
Assoc. U.K., 82: 847-850.
Xu, G., CH. He, Y.H. Xu & H. Sun. 2012. Application of
taxonomic distinctness indices of litoral macroinvertebrate communities for assessing long-term
variation in ecological quality status of intertidal
ecosystems, northern China. Environ. Sci. Pollut. Res.,
19: 3859-3867.
Xu, H., Y. Jiang, A.S. Khaled, S. Al-Rasheid, S.A. AlFarraj & W. Song. 2011. Application of an indicator
based on taxonomic relatedness of ciliated protozoan
assemblages for marine environmental assessment.
Environ. Sci. Pollut. Res., 18: 1213-1221.
869
14
Anexo 1. Listado de especies ordenado en cinco niveles taxonómicos jerárquicos (clase, orden, familia, género y especies).
Presencia (x) y especies comunes de moluscos (*) en el periodo 1981-1985 y años 2004 y 2007.
Taxa
Clase Bivalvia
Arcida
Arcoidea
Glycymerididae
Noetiidae
Carditoida
Crassatellidae
Mytilliida
Isognomonidae
Mytilidae
Pteriida
Pinnidae
Pteriidae
Limida
Limidae
Ostreida
Ostreidae
Pectinoida
Anomiidae
Pectinidae
Lucinoida
Lucinidae
1981-1985
Acar domingensis (Lamarck, 1819)
Anadara notabilis (Röding, 1798)*
Arca imbricata (Bruguière, 1789)*
Arca zebra (Swainson, 1833)
Barbatia cancellaria (Lamarck, 1819)
Fugleria tenera (C.B. Adams, 1845)
Axinactis decusata (Linnaeus, 1758)
Glycymeris undata (Linnaeus, 1778)
Tucetona pectinata (Gmelin, 1791)*
Arcopsis adamsi (Dall, 1886)
x
x
x
x
Crassinella lunulata (Conrad, 1834)
x
Isognomon alatus (Gmelin, 1791)
Isognomon radiatus (Anton, 1839)
Brachidontes modiolus (Linnaeus, 1767)
Hormomya exustus (Linnaeus, 1758)
Lithophaga corrugata (Philippi, 1846)
Lithophaga teres (Philippi, 1846)
Modiolus americanos (Leach, 1815)
Modiolus squamosus (Baeuperthuy, 1967)
Musculus lateralis (Say, 1822)
x
x
x
x
x
x
x
Atrina seminuda (Lamarck, 1819)
Pinna carnea (Lightfoot, 1786)
Pinctada imbricata (Röding, 1798)*
Pteria colymbus (Röding, 1798)
x
x
x
x
Ctenoides mitis (Lamarck, 1807)
Ctenoides scaber (Born, 1778)
Lima caribaea (dÓrbigny, 1853)
Limaria pellucida (C.B. Adams, 1846)
x
x
x
Dendostrea frons (Linnaeus, 1758)
x
Anomia simplex (d’Orbigny, 1853)
Antillipecten antillarum (Récluz, 1853)*
Argopecten gibbus (Linnaeus, 1758)*
Caribachlamys ornata (Lamarck, 1819)
Caribachlamys pellucens (Linnaeus, 1758)
Caribachlamys sentis (Reeve, 1853)
Euvola laurentii (Gmelin, 1791)
Euvola raveneli (Dall, 1898)
Euvola ziczac (Linnaeus, 1758)
Lindapecten muscosus (Wood, 1828)
Anodontia alba (Link, 1807)
Callucina keenae (Chavan, 1971)
Clathrolucina costata (d'Orbigny, 1846)
Codakia orbicularis (Linnaeus, 1758)*
Ctena orbiculata (Montagu, 1808)*
Divalinga quadrisulcata (d’Orbigny, 1853)*
Lucina pensylvanica (Linnaeus, 1758)*
Lucinisca muricata (Spengler, 1778)
Parvilucina pectinella (C.B. Adams, 1852)
x
x
x
x
x
Año(s)
2004
2007
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
870
15
Continuación
Taxa
Clase Bivalvia
Veneroida
Cardiidae
Chamidae
Mactridae
Semelidae
Solecurtidae
Tellinidae
Ungulinidae
Veneridae
Myoida
Corbulidae
Clase Gastropoda
Patellogastropoda
Eoacmaeidae
Vetigastropoda
Calliostomatidae
Fissurellidae
Phasianellidae
Trochidae
1981-1985
Americardia guppyi (Thiele, 1910)
Americardia media (Linnaeus, 1758)*
Dallocardia muricata (Linnaeus, 1758)
Laevicardium serratum (Linnaeus, 1758)*
Lucinidae sp.
Papyridea soleniformis (Bruguière, 1789)
Trigonocardia antillarum (d’Orbigny, 1853)
Chama congregata (Conrad, 1833)
Chama sarda Reeve, 1847
Mactrotoma fragilis (Gmelin, 1791)
Semele bellastriata (Conrad, 1837)
Semele proficua (Pulteney, 1799)
Tagelus divisus (Spengler, 1794)*
Acorylus gouldi (Hanley, 1837)
Angulus mera (Say, 1834)*
Eurytellina nitens C.B. Adams, 1845
Macoma tenta Say, 1834
Merisca aequistriata (Say, 1824)
Merisca martinicensis (d'Orbigny, 1853)
Psammotreta intastriata (Say, 1826)
Scissula candeana (d’Orbigny, 1853)*
Scissula sandix (Boss, 1968)
Scissula similis Sowerby, 1806
Tellina radiata Linnaeus, 1758
Tellinella listeri (Röding, 1798)
Diplodonta notata (Dall y Simpson, 1901)
Diplodonta nucleiformis (Wagner, 1840)
Diplodonta punctata (Say, 1822)
Phlyctiderma semiaspera (Philippi, 1836)
Anomalocardia cuneimeris (Conrad, 1840)
Chione cancellata (Linnaeus, 1767)*
Chionopsis intapurpurea (Conrad, 1840)
Dosinia concentrica (Born, 1778)
Globivenus rigida (Dillwyn, 1817)
Gouldia cerina (C.B. Adams, 1845)
Periglypta listeri (J.E.Gray, 1838)
Pitar fulminatus (Menke, 1828)
Pitar stimpsoni (Dall, 1889)
Transennella conradina (Dall, 1884)
Caryocorbula swiftiana (C.B. Adams, 1852)
x
x
x
Año(s)
2004
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
2007
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
1981-1985
Eoacmaea pustulata (Helbling, 1779)
x
Calliostoma jujubinum (Gmelin, 1791)
Calliostoma pulchrum (C.B. Adams, 1850)*
Diodora cayenensis (Lamarck, 1822
Diodora listeri (d’Orbigny, 1842)
Emarginula phrixodes Dall, 1927
Eulithidium adamsi (Philippi, 1853)
Eulithidium affine (C.B. Adams, 1850)
Eulithidium bellum (M. Smith, 1937)
Eulithidium thalassicola (Robertson, 1858)
Cittarium pica (Linnaeus, 1758)
Pseudostomatella coccinea (A. Adams, 1850)
Pseudostomatella erythrocoma (Dall, 1889)
Tegula excavata (Lamarck, 1822)
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
2004
2007
x
x
x
x
x
x
871
16
Continuación
Taxa
Clase Bivalvia
Turbinidae
Cycloneritimorpha
Neritidae
Caenogastropoda
Cerithiidae
Cerithiopsidae
Epitoniidae
Eulimidae
Modulidae
Littorinimorpha
Caecidae
Calyptraeidae
Cassidae
Naticidae
Ranellidae
Rissoidae
Strombidae
Trividae
Xenophoridae
Neogastropoda
Columbellidae
Conidae
Cystiscidae
Fasciolariidae
Marginellidae
Tegula fasciata (Born, 1778)*
Tegula lividomaculata (C.B. Adams, 1845)
Lithopoma phoebium (Röding, 1798)*
Turbo castanea (Gmelin, 1791)*
1981-1985
x
x
x
x
Smaragdia viridis (Linné, 1758)
Año(s)
2004
x
x
x
2007
x
x
x
x
Cerithium eburneum (Bruguière, 1792)*
Cerithium litteratum (Born, 1778)
Cerithium lutosum (Menke, 1828)
Cerithium muscarum (Say, 1832)
Retilaskeya bicolor (C.B. Adams, 1845)
Seila adamsi (H.C. Lea, 1845)
Cycloscala echinaticosta (d’Orbigny, 1842)
Epitonium lamellosum (Lamarck, 1822)
Eulima bifasciata d’Orbigny, 1841
Hemiliostraca auricincta (Abbott, 1958)
Melanella conoidea (Kurtz & Stimpson, 1851)
Melanella eburnea (Mühlfeld, 1824)
Melanella polita (Linnaeus, 1758)
Modulus modulus (Linné, 1758)*
x
x
x
x
x
x
x
x
x
x
x
x
x
x
Caecum pulchellum (Stimpson, 1851)
Meioceras nitidum (Stimpson, 1851)
Bostrycapulus aculeatus (Gmelin, 1791)*
Crepidula depressa (Say, 1822)
Crepidula navícula (Mörch, 1877)
Cassis flammea (Linnaeus, 1758)
Cassis tuberosa (Linnaeus, 1758)
Charonia variegata (Lamarck, 1816)
Natica lívida (Pfeiffer, 1840)
Naticarius canrena (Linné, 1758)*
Polinices lacteus (Guilding, 1854)
Polinices uberinus (d’Orbigny, 1842)
Tectonatica pusila (Say, 1822)
Cymatium femorale (Linnaeus, 1758)
Rissoinacancellina (Rolán Garcés, 2010)
Rissoina multicostata (C.B. Adams, 1850)
Lobatus costatus (Gmelin, 1791)*
Lobatus gigas (Linnaeus, 1758)
Lobatus raninus (Gmelin, 1791)
Niveria quadripunctata (Gray, 1827)
Pusula pediculus (Linné, 1758)
Xenophora conchyliophora (Born, 1780)
x
x
x
x
x
x
x
x
x
x
Columbella mercatoria (Linnaeus, 1758)*
Costoanachis sparsa (Reeve, 1859)
Zafrona pulchella (Blainville, 1829)
Conasprella jaspidea (Gmelin, 1791)*
Gibberula lavalleeana (d’Orbigny, 1842)
Granulina ovuliformis (d’Orbigny, 1841)
Persicula aff. fluctuata (C.B. Adams, 1850
Fasciolaria tulipa (Linnaeus, 1758)
Leucozonia nassa (Gmelin, 1791)
Polygona infundibula (Gmelin, 1791)
Hyalina pallida (Linnaeus, 1758)
Prunum apicinum (Menke, 1828)*
Prunum batabanoensis (Espinosa & Ortea, 2002)
Prunum caneli (Ortea &Espinosa, 2007)
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
872
17
Continuación
Taxa
Clase Bivalvia
Mitridae
Muricidae
Nassariidae
Olivellidae
Pseudomelatomidae
Raphitominae
Allogastropoda
Pyramidellidae
Cephalaspidea
Bullidae
Haminoeoidae
Cylichnidae
Clase Scaphopoda
Dentaliida
Dentaliidae
Gadilida
Gadilidae
Prunum guttatum (Dillwyn, 1817)
Mitra nodulosa (Gmelin, 1791)
Chicoreus brevifrons (Lamarck, 1822)
Chicoreus florifer (Reeve, 1855)
Chicoreus spectrum (Reeve, 1846)
Coralliophila salebrosa (H. &A. Adams, 1863)
Phyllonotus pomum (Gmelin 1791)*
Vasula deltoidea (Lamarck, 1822)
Vokesimurex rubidus (Baker, 1897)
Nassarius albus (Say, 1822)*
Olivella dealbata (Reeve, 1850)
Olivella nivea (Gmelin, 1791)
Crassispira fuscescens (Reeve, 1843)
Pilsbryspira leucocyma (Dall, 1889)
Daphnella lymneiformis (Kierner, 1840)
1981-1985
x
x
x
Año(s)
2004
2007
x
x
x
x
x
x
x
x
x
x
x
x
Triptychus niveus Mörch, 1875
Turbonilla interrupta (Totten, 1835)
x
x
Bulla striata Bruguière, 1792*
Haminoea antillarum (d’Orbigny, 1841)
Haminoea elegans (Gray, 1825)
Acteocina candei (d’Orbigny, 1842)
Cylichnella bidentata (dÓrbigny, 1842)
x
Antalis antillaris (d’Orbigny, 1842)*
x
Polyschides teraschistus (Watson, 1879)
x
x
x
x
x
x
x
x
x
x
x
x
x
x
Lat. Am. J. Aquat. Res., 43(5): 873-887, 2015 Estrategia Ramsar en humedales costeros mexicanos
873
xxx
Research Article
Implementación del plan estratégico Ramsar en humedales costeros de la
Península de Yucatán: normativas y regulación
1
Laura Vidal1, Adriana Vallarino2, Ileana Benítez3 & Jorge Correa3
UMDI, Facultad de Ciencias, UNAM, Puerto de Abrigo S/N, CP 97356 Sisal, Yucatán México
2
El Colegio de la Frontera Sur (ECOSUR), Av. Rancho Polígono 2-A
Col. Ciudad Industrial, Lerma Campeche, Campeche, C.P. 24500, México
3
El Colegio de la Frontera Sur (ECOSUR), Ave. Centenario km 5.5, Chetumal
Quintana Roo, C.P.77014, México
Corresponding author: Laura Vidal ([email protected])
RESUMEN. Se analiza la forma en que México aplica la normativa y otras estrategias de manejo, para la
protección de los humedales costeros y aves de humedal de la Península de Yucatán según el Plan Estratégico
Ramsar 2009-2015, específicamente en dos de sus estrategias. Se analiza los criterios de regulación de los
Programas de Manejo de Áreas Naturales Protegidas y Ordenamientos Ecológicos Territoriales identificando
los aspectos científicos robustos en los que se fundamentan, así como en sus deficiencias bajo el concepto de
integridad ecológica. En los resultados se observa: a) la necesidad de homogenizar el uso del término integridad
en los instrumentos legales, b) crear una estructura jerárquica espacial de estrategias de manejo que favorezca
la conectividad, c) reforzar en la delimitación de áreas de amortiguamiento de humedales y hábitats críticos de
aves, d) incorporar reglas que protejan la heterogeneidad biológica espacio-temporal, los procesos ecológicos y
las redes tróficas, y e) diseñar un reglamento para la restauración de humedales. Se concluye que el escenario
normativo aplicable a la conservación de estos ecosistemas en México es aún muy ineficiente y que es necesario
incorporar una visión sistémica para proteger estos ecosistemas. Se incluyen además, nueve recomendaciones
para su mejoramiento.
Palabras clave: normatividad, humedales costeros, aves de humedal, Ramsar, Península de Yucatán.
Implementation of the Ramsar strategic plan in coastal wetlands of the
Península de Yucatán: regulations and normativity
ABSTRACT. The way how Mexico applies the normative and other management strategies, regarding coastal
wetland and wetlands birds conservation of the Península de Yucatán following the Ramsar Strategic Plan 20092015 is analyzed. Regulatory criteria within Management Programs of Natural Protected Areas and Ecologic
Ordinance Instruments were analyzed identifying strengths and weaknesses under an ecological integrity
concept. Results show the need to homogenize the concept of integrity within regulation, to develop a
hierarchical spatial structure for management strategies. It will: a) promotes connectivity, b) strength the
perception of buffer zones and critical habitats, c) emphasize in the protection of biologic heterogeneity in space
and time, ecological processes and trophic networks and, develop regulation about wetland restoration. We
conclude that current normative framework is still very inefficient and a systemic vision is required to protect
these ecosystems. Nine suggestions to improve the current scenario are included.
Keywords: regulations, coastal wetlands, wetlands birds, Ramsar, Yucatán Peninsula.
INTRODUCCIÓN
Los humedales costeros poseen reconocimiento
internacional por su extensión, variedad, importancia
biogeográfica y amplia gama de bienes y servicios
ambientales tales como retención de nutrientes, almace__________________
Corresponding editor: Sergio Palma
namiento y purificación de agua, protección contra
tormentas y huracanes (Hiraishi & Harada, 2003;
Dahdouh-Guebas et al., 2005), mitigación de crecidas
hídricas, estabilización de costas y control de erosión
(Millennium-Ecosystem-Assessment, 2005). En 1975
el reconocimiento de su importancia generó la creación
874
xxx
de la Convención Relativa a los Humedales de
Importancia Internacional (Ramsar) que enfatizó su
valor como hábitats de aves acuáticas. En México la
Convención Ramsar entró en vigor el 4 de noviembre
de 1986 y bajo este compromiso se han designado 142
humedales con una superficie total de casi nueve
millones de hectáreas en el territorio idóneas para ser
incluidas en la Lista de Humedales de Importancia
Internacional (CONANP, 2010).
En la Península de Yucatán (PY) existen 23 sitios
Ramsar, de los cuales 18 son humedales costeros
tropicales con comunidades con manglar reconocidos
nacionalmente por ser Regiones Hidrológicas Prioritarias y Áreas de Importancia para la Conservación de
las Aves (AICAS) (Arizmendi & Márquez, 2000;
CONABIO, 2009, 2010b, 2010a). Este tipo de
humedales corresponde al 67% de los sitios Ramsar del
país en la región del Golfo de México y a
aproximadamente el 30% de los sitios Ramsar de la
zona tropical caribeña, que junto con los arrecifes, son
relevantes por la diversidad de servicios ambientales
que proveen, amplia biodiversidad y endemismo. Se ha
estimado que una población de 1.200 millones de aves
migratorias utiliza estos humedales en la PY como zona
de refugio, alimentación, anidación, crianza y descanso
debido a la calidad del agua y gradientes de
profundidad (MacKinnon, 2005; Correa-Sandoval &
Contreras-Balderas, 2008). Estas aves pueden estar
adaptadas a un amplio espectro de humedales (desde las
aguas relativamente someras hasta los terrenos
simplemente húmedos) de manera “obligada”,
“facultativa” y “oportunista” (Weller, 1999) y su
presencia ha sido determinante para el diseño y
establecimiento de Áreas Naturales Protegidas (ANP)
en la región. El proteger algunas colonias de estas aves
por su unicidad, estado de amenaza, endemismo o
como especies bandera o sombrilla (conceptos
descritos por Roberge & Angelstam, 2004) ha
favorecido la conservación de otras especies menos
llamativas, ecológicamente no menos importantes o
coexistentes con ellas en estos ecosistemas (BerlangaCano et al., 2000; Correa-Sandoval et al., 2000). Dada
la naturaleza carismática de estas aves, en el país se ha
generado una creciente demanda de usos turísticos para
su avistamiento como una alternativa productiva para
pobladores locales colindantes con humedales costeros.
Siendo México signatario de la Convención
Ramsar, está comprometido a seguir los lineamientos
del Plan Estratégico para 2009-2015 (RAMSAR,
2008). En ellos se enfatiza la responsabilidad de cada
país para evaluar sus necesidades de capacitación y
formación con respecto a la aplicación de los
mecanismos de política, legislación y gobierno institucional, y a fundamentar las estrategias de manejo sobre
una base científica. Entre los mecanismos legislativos
que se han diseñado para proteger a los humedales y
manglares en México, destacan en orden cronológico:
1) Reglamento de la Ley de Aguas Nacionales que
incorporó la definición de humedal en 1994 (DOF,
2011); 2) Ley General de Vida Silvestre, creada en julio
2000, que protege manglares pero no humedales en
general, con la adición del Art. 60 Ter en febrero de
2007 (DOF, 2014a); 3) Norma Oficial Mexicana NOM022-SEMARNAT-2003 diseñada particularmente para
proteger humedales costeros en zonas de manglar
(DOF, 2004) y, 4) Ley de Aguas Nacionales que
incorporó la definición de humedal en 2004 (DOF,
2013). Además, existen dos instrumentos de política
ambiental definidos en la Ley General del Equilibrio
Ecológico y la Protección al Ambiente (LGEEPA)
(DOF, 2014b) que regulan el uso de suelo y las
actividades que impactan negativa o positivamente el
equilibrio ecológico y protegen indirectamente a los
humedales. Estos instrumentos son: el establecimiento
de ANP y la formulación del Ordenamiento Ecológico
del Territorio (OET). En la Península de Yucatán,
ambas estrategias de manejo (ANP y OET) coinciden
geográficamente algunas veces.
Pese a estos avances, existen cuestionamientos
sobre los escasos y aislados logros respecto a la
protección de los humedales costeros mexicanos
(Azuela et al., 2008). Se ha cuestionado la eficiencia
(grado de idoneidad que posee una norma jurídica para
satisfacer la necesidad que se tuvo en cuenta al
expedirla) y la eficacia (grado de acatamiento de una
norma jurídica por quienes son sus destinatarios) de la
legislación aplicable a tal materia basado en lo
siguiente: a) todas las especies de manglar en el área
(Rhizophora mangle, Laguncularia racemosa,
Avicennia germinans y Conocarpus erectus) y varias
especies de aves de humedal, algunas de ellas
endémicas, están listadas como especies que requieren
de protección especial o en alguna categoría de riesgo
en la Norma Oficial Mexicana NOM-059SEMARNAT-2010 (DOF, 2010), en la lista de especies
en riesgo de la Unión Internacional para la
Conservación de la Naturaleza (UICN) o por la
Convención sobre el Comercio Internacional de
Especies Amenazadas de Flora y Fauna Silvestres
(CITES) (CONABIO, 2010a); b) diversos hábitats en
los humedales costeros de la PY de importancia crucial
para la reproducción y alimentación de aves de
humedal, han sufrido continua destrucción y severas
modificaciones debido a cambios de uso de suelo,
aprovechamiento descontrolado de recursos forestales
y acuáticos, introducción de especies florísticas y
faunísticas, incendios, contaminación y disminución de
los flujos hídricos en los sistemas (Programas de
Estrategia Ramsar en humedales costeros mexicanos
manejo de ANP en la región-PM), y c) se ha estimado
una tasa de pérdida de manglar anual de 1,8 a 3,2% para
los tres estados de la Península utilizando fotografías
aéreas (Batllori-Sampedro et al., 1999) e imágenes
satelitales (INE, 2005).
Algunos autores consideran que dada la ausencia de
un instrumento de gestión ambiental nacional eficiente
para temas prioritarios de conservación de estos
ecosistemas y dadas las claras limitaciones de los
alcances de las estrategias de gestión aisladas, es
necesario construir mecanismos de coordinación
administrativa y la armonización de políticas que hagan
posible su complementariedad (Rivera-Arriaga &
Villalobos, 2001; Carrillo, 2007). También se considera
necesario evaluar la capacidad de gestión ambiental
para identificar los planos de referencia que se
consideran prioritarios en el manejo de este tema
ambiental (Vidal, 2010).
En consecuencia, este estudio tiene por objetivo
identificar cómo México aborda las recomendaciones
de gobierno del Plan Estratégico 2009-2015 Ramsar en
la zona costera de la Península de Yucatán. Esto,
particularmente a través del análisis de coincidencias,
vacíos y contradicciones entre los instrumentos
legislativos y a través de identificar los aspectos
científicos en los que se fundamentan los criterios de
regulación en dos de sus instrumentos de política
ambiental, recurriendo al concepto de “integridad
ecológica”. Esta información será de utilidad para
quienes toman decisiones y son responsables de la
elaboración y evaluación de estrategias de manejo de
humedales costeros (y de algunos de los recursos
faunísticos) de la Península de Yucatán, y será el primer
paso para realizar una revisión nacional comprensiva
sobre el marco jurídico que promueve la conservación
y uso racional de los humedales en México, en atención
a sus compromisos internacionales ambientales.
En seguimiento a dos de las estrategias del Plan
Estratégico 2009-2015 Ramsar: a) diseño y evaluación
de las necesidades de capacitación y formación en
relación a la aplicación de estrategias normativas y, b)
manejo de los humedales sobre una base científica, se
analizaron los instrumentos legales aplicables a los
humedales costeros con manglar de la Península de
Yucatán, México.
En la Península de Yucatán existen 18 sitios Ramsar
que son humedales costeros con comunidades con
manglar (asociaciones de mangle con tular, carrizal y
petenes), que totalizan una extensión aproximada de un
millón de hectáreas. Estos humedales costeros se
875
xxx
alimentan de agua marina del Golfo de México y del
Mar Caribe, y de aguas dulces continentales por
afluentes superficiales importantes como los ríos
Palizada, Chumpan, Mamantel, Candelaria, Champotón
y Hondo en su parte sur-poniente y sur, y por descargas
subterráneas a lo largo del resto de la costa dada la
naturaleza cárstica del terreno (Tabla 1).
Estrategia “a”
El análisis de los mecanismos de legislación nacional
respecto a la protección de humedales con manglar
(estrategia a) se abordó en dos niveles. Como primer
nivel, se estudió el uso del concepto de integridad
ecológica en instrumentos legales ambientales de
aplicación general en cualquier sitio del país. Entendida
la integridad ecológica como la condición bajo la cual
un sistema natural se auto-sostiene y auto-regula
(Parrish et al., 2003). El concepto de integridad
ecológica incluye: a) cadenas alimenticias completas
con diversidad en todos los niveles tróficos (Young et
al., 2010); b) especies nativas con poblaciones sanas
(Parrish et al., 2003); c) procesos ecológicos naturales
(flujos de nutrientes, de energía y de elementos
funcionales) completos y sin alteraciones extremas
(Guzy et al., 2012); d) composición y estructura
florística y faunística estables (Cafaro & Primack,
2001); e) resiliencia, auto-recuperación (Hodgson et
al., 2009); f) heterogeneidad espacio-temporal de
ecosistemas y hábitats (Rasouli et al., 2012); g) balance
físico y químico de sedimento y agua (Voss et al.,
2012); h) balance de hidroperiodo (Davenport et al.,
2010); i) productividad primaria y secundaria
constantes (Taylor et al., 1993); j) degradación de
materia orgánica constante (Fahring & Merriam, 1985) y
k) conectividad, esto es, continuidad estructural y
funcional en el espacio y en el tiempo, dispersión y
flujo (Lopez-Duarte et al., 2012). Como segundo nivel,
se identificó las deficiencias de las estrategias
normativas encontradas en los instrumentos de política
ambiental (OETs y ANP) de aplicación regional y local
en tres estados de la Península (Campeche, Yucatán y
Quintana Roo), bajo competencia de los tres órdenes de
gobierno (Federal, Estatal y Municipal).
Por una parte, de los modelos de OET que contienen
Unidades de Gestión Ambiental (UGA) en zonas con
manglares, se caracterizaron los criterios de regulación
ecológica sobre humedales y aves de humedal en sus
diferentes escalas de aplicación (Marino Regional,
Regional Estatal (Costero) y Municipal (Local) (Figs.
1, 2). Se consideraron OET en varios momentos de su
elaboración y decreto: de revisión (OE Municipales de
Campeche: Calkini, Hecelchakan, Tenabo, Carmen,
Palizada y el Estatal costero de Campeche), publicados
(OE Municipal de Benito Juárez, de la región Corredor
876
xxx
Tabla 1. Características de los humedales de manglar en la Península de Yucatán enlistados como Sitios Ramsar, Regiones
Hidrobiológicas prioritarias y Áreas de Importancia para la conservación de las aves (AICAS). En el nombre de cada área
se indica entre paréntesis su superficie. APF-F: área de protección de flora y fauna, RB: reserva de la biósfera, RE: reserva
ecológica.
Estado
Nombre y características
Especie de aves bandera, sombrilla o de interés particular
Campeche
APF-F. Laguna de Términos (705.016 ha)
Región de tres sistemas fluvio-lagunares que constituyen los humedales más
importantes de Mesoamérica, con 127.000 ha de manglares. Sitio con las
colonias de aves acuáticas de mayor tamaño en Mesoamérica.
RB Los Petenes (857 ha)
Comunidad de petenes (islotes de vegetación temporalmente inundados o
bosques de manglar asociados a manantiales de agua subterránea y cenotes),
pastos marinos y comunidades forestales de manglar botoncillo (C. erectus)
y palo de Campeche (Haematoxilon campechanum). Áreas de lodos
blanquizales.
Yucatán
RB Ría Celestún (81.482 ha)
Comunidades de manglares, camas de pastos marinos, pequeños estuarios,
dunas costeras, lagunas costeras hipersalinas, cuevas cársticas que propor cionan hábitat para especies de plantas y animales amenazadas y raras. Sitio
de anidación de tortugas marinas, de descanso y alimentación para especies
de aves migratorias y de colonias reproductoras de garzas.
RE El Palmar (50.177 ha)
Comunidades de manglares, camas de pastos marinos, llanuras de marea,
dunas costeras, petenes, cenotes, bosques de pantano y bosques deciduos;
zona de alimentación de patos, flamencos y de anidación de tortugas marinas.
Jabiru (Jabiru mycteria), gaitán (Mycteria americana), cocopato
(Eudocimus albus), garza blanca (Ardea alba), pichiche
(Dendrogygna autumnalis).
Jabiru (Jabiru mycteria), flamenco (Phoenicopterus ruber), garza
tigre (Tigrisoma mexicanum), cerceta de alas azules (Anas
discors), candelero (Himantopus mexicanus).
Flamenco (Phoenicopterus ruber), garza tricolor (Egretta
tricolor), garza blanca (Ardea alba).
Flamenco (Phoenicopterus ruber), cerceta alas azules (Anas
discors), pelícano alcatrás (Pelecanus erythrorynchos), garza
melenuda (Egretta rufescens).
RE Dzilam (61.707 ha)
Reserva marina-costera con sistema hidrológico único llamado “anillo de
cenotes” causado por el impacto de un meteorito. Pastos marinos, lagunas
intermareales, dunas costeras, selva inundada, selva mediana y selva baja.
Hábitat de más de 20.000 aves acuáticas.
Flamenco (Phoenicopterus ruber), boxpato (Cairina moschata),
anhinga (Anhinga anhinga).
RB Ría Lagartos (60.348 ha)
Sistema complejo de pequeños estuarios y lagunas costeras hipersalinas
separadas por el mar de un cordón de dunas. Con influjo de algunos acuíferos
subterráneos. Hábitat de variadas especies de fauna y flora amenazadas o en
peligro.
Flamenco (Phoenicopterus ruber), jabirú (Jabiru mycteria),
camacho (Phalacrocorax auritus), garza kuka (Cochlearius
cochlearius), chorlo silbador (Charadrius alexandrinus), playero
occidental (Calidris mauri), playero mínimo (C. minutilla).
Quintana Roo
APF-F Yum Balam (154.052 ha)
Lagunas costera con selva baja y mediana, manglares y petenes,
Comunidades de palmas tasiste (Acoelorraphe wrightii).
APF-F Manglares de Nichupté (4.257 ha)
Comunidades densas de manglares en bandas (R. mangle, A. germinans, C.
erectus, Laguncularia racemosa) que ofrecen protección a la costa y zonas
de palmeras en condición de amenaza (Thrinax radiata). Con ruinas
arqueológicas mayas.
Flamenco (Phoenicopterus ruber), garza melenuda (Egretta
rufescens), morfo blanco del garzón cenizo (Ardea herodias),
chocolatera (Platalea ajaja).
Rascón picudo (Rallus longirostris).
RB Sian Ka’an (528.147 ha)
Sitio Patrimonio de la Humanidad UNESCO
Planicie costera cárstica, paralela a una barrera arrecifal de 120 km, con dos
bahías someras rodeadas de manglares. Con numerosos cenotes inmersos en
una selva tropical decidua. Comunidades endémicas de bosque de pantano y
petenes. Hábitat de 320 especies.
Pelícano café (Pelecanus occidentalis), camacho (Phalacrocorax
auritus), garza blanca (Ardea alba), garza kuká (Cochlearius
cochlearius), garza tigre (Tigrisonma mexicanum), cocopato
(Eudocimus albus), chocolatera (Platalea ajaja).
877
xxx
indicadores de sustentabilidad institucional (Tabla 2),
como también en el manual Ramsar para examinar
leyes e instituciones orientadas a promover la conservación y el uso racional de los humedales (RAMSAR,
2010).
Estrategia “b”
La estrategia “b” analiza la pertinencia de los criterios
de regulación ecológica expresados en los OET y en los
PM de la ANP para las zonas de humedal en base en
una recopilación bibliográfica de la información
científica que caracteriza ecológicamente las zonas
habitadas por diversas familias de aves de humedal
(hábitat, depredadores, alimento y principales amenazas).
Se emplearon como referencias las compilaciones de
Weller (1999), Perlo (2006), Llamosa (2011), Badillo
et al. (2014) y del Cornell Lab of Ornithology (2010).
RESULTADOS
Figura 1. Humedales costeros de la Península de Yucatán
donde confluyen Áreas Naturales Protegidas y Ordenamientos Ecológicos del Territorio. Fuente: modificado de
mapa de ANP de CONANP.
Cancún-Tulum, de región Costa Maya, de la región de
Sian Kaán, Territorial de Quintana Roo, Estatal
costero de Yucatán (POETCY) y OE Marino Regional
del Golfo de México y Mar Caribe (GoM y MC). Por
otra parte, se identificaron las ANP de la PY con
humedales costeros cuyos hábitat destacan por su
importancia ecológica para aves de humedal, que son
consideradas sitios Ramsar y que poseen PM vigentes
(Laguna de Términos 1997, Río Lagartos 2000, Ría
Celestún 2002, Dzilam 2006 y Los Petenes 2009). Se
identificaron las reglas administrativas referentes a la
protección y aprovechamiento de humedales y aves de
humedal de manera explícita y se separaron en dos
secciones para facilitar su análisis: a) acciones que se
permiten o promueven y b) acciones que son prohibidas.
Para caracterizar las reglas administrativas o
criterios de regulación ecológica se emplearon cinco
apartados temáticos relevantes a la preservación o
impacto en estos recursos naturales: a) caminos y
vialidades, b) flujos hídricos, c) fauna y flora silvestre,
d) construcción y urbanización, y e) aprovechamiento
de humedales. Posteriormente, cada aspecto de regulación ecológica se categorizó según los criterios
utilizados para evaluar la capacidad de gestión
ambiental compilados por Vidal (2010), basados en
Estrategia “a”
En el análisis de los mecanismos de legislación a escala
nacional en relación a la protección de humedales con
manglares, se observaron varias inconsistencias: a) a
través de los ecosistemas que protegen (humedales,
humedales costeros o manglares); y b) a través del uso
del concepto de integridad. Mientras la NOM-022SEMARNAT-2003 establece las especificaciones para
garantizar la integridad de los humedales costeros en
zonas de manglar, el Art. 60 Ter de la LGVS prohíbe la
ejecución de cualquier obra o actividad que afecte la
integralidad de sus procesos y servicios ecológicos. Es
decir, se utilizan dos términos gramaticalmente distintos
"íntegro" e "integral", que podrían interpretarse con
ambigüedad jurídica para dar protección legal a los
humedales.
La presencia temática de aspectos relevantes a la
preservación o impacto en humedales y aves de
humedal entre los criterios de regulación ecológica de
los OET en los tres niveles espaciales (Marino
Regional, Estatal Costero y Municipal) y las reglas de
Programas de Manejo (PM) de ANP en zonas con
manglares (Tabla 3) muestran que no existe una
estructura jerárquica o anidada de estrategias de manejo
a diferentes escalas. Parece que cada instrumento se ha
diseñado sin consideración de las especificaciones de
sus predecesores, los que se sobreponen geográficamente y fueron diseñados en otra escala espacial.
Además, se observa que, aún en escala regional, sólo se
hace particular énfasis en aspectos de regulación
ecológica a pequeña escala: como impulsar programas
de recuperación de especies enlistadas en la NOM-059SEMARNAT-2001 e implementar programas (o campañas) de reforestación y recuperación en los márgenes
de ríos (manglares y humedales ribereños).
878
xxx
Figura 2. Jerarquía en el marco jurídico y político sobre la protección y aprovechamiento del ambiente y recursos naturales
en México. ANP: Áreas Naturales Protegidas, OET: Ordenamientos Ecológicos del Territorio.
Tabla 2. Criterios para evaluar la capacidad de gestión ambiental según su plano de referencia modificada por Vidal (2010).
Criterios para evaluar capacidad de Gestión Ambiental
Político-administrativos
1. Políticas de regulación y manejo.
2. Nivel de prioridad que el gobierno otorga a la protección del ambiente (financiamiento).
3. Viabilidad institucional (proyectos y programas a largo plazo y competencia institucional).
4. Calidad de la información disponible sobre causas de estrés ambiental y tasas de uso y deterioro ambiental
(monitoreo), como también uso de información para planificación y mitigación.
5. Nivel de conocimiento y entrenamiento técnico de los manejadores (staff).
6. Recomendaciones técnicas, generalmente con respecto a infraestructura.
Normativos
7. Existencia de un régimen de regulación que determine necesidades ambientales (presencia de
instrumentos de política ambiental o de procedimientos administrativos para aplicar tal régimen).
Sociales
8. Incorporación de factores socioculturales locales en el manejo y la planificación de los recursos.
A escala estatal y municipal, los OE del estado de
Quintana Roo poseen el mayor número de criterios de
regulación en comparación con los otros estados. Sin
embargo, aún para este estado existe un vacío en la
elaboración de un instrumento costero general que
favorezca una visión de continuidad ecológica. En
algunos casos hay, además, criterios de regulación
contradictorios sobre el aprovechamiento de los
humedales o del corte de árboles de mangle en zonas
adyacentes a la misma costa (e.g., áreas de manglar no
podrán utilizarse para ninguna actividad productiva en
el área de un OET mientras su aprovechamiento sí está
permitido en un área colindante de otro OET, siempre
que no exceda el 10% de la cobertura de mangle
incluida en el predio, o mientras se sujete a los
lineamientos del programa de manejo de la ANP).
Por una parte, entre los criterios de regulación
analizados en los OET, los aspectos de integridad
ecológica que están presentes son: especies nativas
sanas, conectividad y balance de hidroperiodo. Los
bienes ambientales que se procura conservar, aunque
escuetamente (15% de los criterios de regulación), son
los flujos hídricos y la calidad del agua.
Por otra parte, entre los PM de ANP se puede
apreciar que el de Laguna de Términos contiene el
mayor número de reglas de control con respecto a
humedales y aves de humedal (12) y contempla tres de
los cinco grupos temáticos analizados. El caso opuesto
lo presenta el PM de Los Petenes, de reciente creación
(2009) y estrechamente vinculado con Ría Celestún,
cuyo PM es aún muy limitado en alcances. Los
programas de manejo de las ANP revisados fueron dise-
Tabla 3. Presencia temática en criterios de regulación y reglas de control de los Ordenamientos Ecológicos Territoriales (OE) y Programas de Manejo
(PM) de ANP sobre humedales costeros y aves de humedal en la Península de Yucatán. GM: Golfo de México, MC: Mar Caribe. El símbolo √ señala
que en ese instrumento el criterio o regla estaba presente.
879
xxx
880
xxx
ñados entre 1996-2009, y solo el de Laguna de
Términos se encuentra en proceso de actualización.
Cada PM tiene siete reglas que no parecen seguir un
patrón particular.
Mientras que algunos aspectos de integridad
ecológica son muy repetidos entre los PM, otros
simplemente no se consideran o lo hacen de manera
muy limitada. Entre las reglas administrativas
restrictivas explícitas sobre humedales o aves en los
PM analizados, la mayoría están enfocadas a evitar: la
introducción de especies alóctonas, la alteración de
sitios de anidación y de reproducción, la perturbación
de organismos silvestres y extracción de partes, la
destrucción y aprovechamiento de especies de flora y
fauna enlistadas como en categoría de riesgo (que
incluyen los manglares) o en zonas núcleo y la
modificación de flujos naturales y desecación de
humedales. Las reglas propositivas incluyen: controles
de navegación (velocidad, distancia de acercamiento a
sitios con flamencos y uso de remos en zonas someras),
permanencia de visitantes en sitios con fauna silvestre,
manejo controlado de fauna silvestre para autoconsumo
(principalmente) y establecimiento de la obligación de
evitar ejercer presión (aquí empleado como estresor), a
especies silvestres que se encuentren bajo alguna
categoría de protección. Es decir, se vinculan solamente
con dos aspectos de integridad ecológica: especies
nativas sanas y balance de hidroperiodo. Entre ambos
instrumentos, algunos aspectos de heterogeneidad de
hábitats (áreas de anidación y reproducción), composición florística (reforestación, extracción forestal y
recuperación de manglares) y balance físico y químico
del agua (descargas de aguas residuales domésticas e
industriales) se retoman marginalmente entre los
criterios de regulación.
Estrategia “b”
La información científica que caracteriza ecológicamente a las 16 familias de aves de humedal más
abundantes de la Península de Yucatán y que sustenta
las reglas contenidas en los OET y los PM (Tabla 4,
constituye además una selección de un total de 29
familias, para representar en forma más definida
diferentes tipos de nichos ecológicos con respecto a
alimentos, sitios de reproducción y depredadores.
En relación a la presencia de los planos de referencia
de gestión ambiental sobre la conservación de aves de
humedal o humedales entre los criterios de regulación
de los OET (Fig. 3) se observa una ausencia total de
reglas sobre financiamiento y capacitación de personal
y únicamente un caso para aspectos sociales (educación
ambiental). En cambio, hay una mayor abundancia de
reglas que necesitan información y monitoreo científico
para ser aplicables (36%). Esta condición hace nece-
sario evitar ciertas conductas basándose solamente en
instrumentos normativos (leyes, reglamentos y NOMs),
en procedimientos administrativos (Evaluación del
Impacto Ambiental, diseños de zonas de exclusión o
regulaciones del uso de suelo) y en prohibiciones
explícitas (33%).
DISCUSIÓN
México, ante el compromiso internacional de haber
firmado la convención Ramsar para conservar sus
humedales, ha tenido importantes avances de gestión
reconocidos internacionalmente durante la COP12 en
junio 2015 en Uruguay. Entre ellos destacan: la
elaboración (en proceso) del Inventario Nacional de
Humedales; la implementación de la Estrategia Mexicana
de Comunicación, Educación, Concienciación y Participación en Humedales (CECoP) 2010-2015; el impulso
de crear una Norma Mexicana de Caudal Ecológico y
el Programa Nacional de Reservas de Agua; y
recientemente la formulación y lanzamiento de la
Política Nacional de Humedales (Informe Nacional de
México a la COP12 de Ramsar 2015). Sin embargo, a
nivel operativo aún hace falta reforzar la congruencia
entre los instrumentos legales aquí analizados y se
requiere elaborar estrategias de manejo a escala
regional.
Estrategia “a”
Algunas reformas recientes a la LGEEPA (mayo 2013)
han logrado avances que refuerzan lo expresado en los
lineamientos de las ANP. Por ejemplo, la introducción
de especies exóticas invasoras en ANP, prohibida
tajantemente (Art. 46) y el control de tráfico de
embarcaciones en zonas marinas, limitado de acuerdo
con el PM (Art. 48). Sin embargo, aún hay aspectos
contradictorios, como por ejemplo: la desecación de
humedales es permitida por la LAN, ya sea con fines de
protección o para prevenir daños a la salud pública,
mientras que entre las reglas administrativas de los PM
esta misma acción se restringe.
Por un lado, el uso indistinto de integro e integral en
referencia al concepto de integridad ecológica en los
instrumentos de legislación revisados en la estrategia
“a” hace suponer que el término “daño a la integralidad
del manglar” podría ser insuficiente para proteger
manglares expeditamente. Esto es, por jerarquía de
leyes en el Derecho Mexicano, una Ley General
expedida por el Congreso de la Unión, como lo es la
LGVS, tiene mayor rango y debe aplicarse por encima
de una NOM, que en caso de contradicción, se aplicaría
el término de “integralidad” determinado en la Ley
General que es un término que no aparece en el
diccionario de la Real Academia de la Lengua Española.
881
xxx
Tabla 4. Caracterización ecológica de familias de aves acuáticas (Weller, 1999) que habitan en mayor abundancia los
humedales costeros de la Península de Yucatán. Elaboración propia. *Sensibles a contaminantes. Orden taxonómico y
nomenclatura de acuerdo a Chesser et al. (2010).
Familia/especies en riesgo
Alimento
Hábitat de reproducción
Depredadores
Anatidae: Cairina moschata,
Nomonix dominicus, Anas
discors
Phoenicopteridae:
Phoenicopterus ruber
Ciconiidae: Jabiru mycteria y
Mycteria americana
*Phalacrocoracidae:
Phalacrocorax auritus,
P. brasilianus
*Anhingidae: Anhinga anhinga
*Pelecanidae: Pelecanus
occidentalis,
Ardeidae: E. rufescens, Ardea
alba, Ixobrychus exilis,
Tigrisoma mexicanum,
Cochlearius cochlearius,
Threskiornithidae: Eudocimus
albus, Platalea ajaja
*Pandionidae: Pandion
haliaetus
Charadriidae: Charadrius
alexandrinus, C. wilsonia,
C. melodus
Haematopodidae: Haematopus
palliatus
Recurvirostridae: Himantopus
mexicanus, Recurvirostra
americana
Jacanidae: Jacana spinosa
Plantas acuáticas, insectos,
peces, plancton, crustáceos,
frutos, Artrópodos, algas
Crustáceos, materia
orgánica
Peces, anfibios, crustáceos,
reptiles, aves, insectos
Peces
Pastos, raíces, vegetación
variada
Cocodrilos, mapaches, perros
ferales, ratas, gavilanes
Bajos de lodo y arena
Árboles y arbustos
Mapaches, perros ferales,
jaguares
Cocodrilos
Árboles y arbustos
Gaviotas, fragatas, iguanas.
Peces
Peces
Árboles
Árboles y arbustos
Peces, crustáceos, pequeños
anfibios, insectos
Árboles y arbustos
Tlacuaches, ratas, nutrias,
urracas, gavilanes, halcones,
iguanas y serpientes
Peces, crustáceos, anfibios,
insectos
Peces
Árboles y arbustos
Gaviotas, fragatas, iguanas
Copas de árboles
Halcones
Scolopacidae: Tringa flavipes,
Calidris alba, C. mauri, C.
minutilla
Laridae: Leucophaeus atricilla,
Larus argentatus, Sternulla
antillarum
Alcedinidae: Megaceryle
torquata, M. alcyon,
Chloroceryle amazona,
C. americana, C. aenea
Crustáceos, insectos, lapas, Playa arenosa con guijarros
almejas, gusanos, poliquetos o conchas
Gaviotas, fragatas, halcones,
perros ferales
Bivalvos, gusanos,
poliquetos.
Pequeños crustáceos,
materia orgánica, poliquetos
Playas con guijarros o
conchas
Playas arenosas con
vegetación rastrera
gaviotas
gaviotas
Vegetales, insectos,
gusanos, moluscos
Insectos, lapas, almejas,
gusanos, poliquetos
Vegetación herbácea
emergente de agua dulce
N/A
Cocodrilos, mapaches, perros
ferales, ratas, gavilanes
N/A
Peces
Playa arenosa con guijarros
o conchas
otras gaviotas
Peces
Huecos en la tierra en la
ribera de los cuerpos de
agua
Serpientes, urracas, iguanas
Esta situación podría favorecer posturas en contra de la
conservación de manglares en el campo litigioso. Como
ejemplo de esto, Connolly (2008) asegura que esta
situación de controversia en el campo de la
interpretación jurídica por el uso de términos es común
en los casos de regulación de humedales costeros en
USA.
A nivel de instrumentos de política ambiental,
ambos (OET y ANP) requieren ser fortalecidos en
México, debido a que presentan algunas debilidades
evidentes, tal como se observa tanto en los resultados
aquí presentados como en los discutidos por Cortina et
al. (2007). Este estudio identificó en la caracterización
temática de los criterios de regulación un particular én-
882
xxx
fasis en aspectos de regulación ecológica con
aplicación a pequeña escala, es decir, reforestación y
recuperación de especies amenazadas o en riesgo.
Cortina et al. (2007) identificaron diversos problemas
de carácter institucional y legal para las ANP y OET.
Entre los primeros destaca, la ausencia de una
definición clara y operativa de la “capacidad de carga
del ecosistema” y de las “proporciones y límites de
cambio aceptables” conceptos que son, indiscutiblemente, resultado de procesos de investigación científica
en aspectos de integralidad ecológica de un ecosistema.
Además, esos autores señalan, como ejemplo, las
dificultades existentes para controlar la actividad
turística en las ANP y las limitaciones para definir la
cantidad óptima de visitas, en función del desconocimiento de los impactos ambientales que las
actividades ocasionan en los recursos a conservar. Esto
claramente es aplicable a la actividad turística de
avistamientos de aves en humedales cuando no existe
el diseño y aplicación de reglas que eviten costos
ambientales indeseables en la integralidad del
ecosistema.
Además, Cortina et al. (2007) han identificado
como problema legal y normativo de los OET locales y
regionales el hecho que al estar supeditados a un OET
federal del territorio (de mayor escala geográfica), estas
disposiciones normativas pierden flexibilidad, y las
contribuciones de mayor definición por la visión más
detallada de los procesos que éstas representan se
diluyen. Por lo tanto, el presente trabajo, con otro
enfoque, evidencia la necesidad de conservar una
escala regional en los OET cuando se trata de
corredores biológicos de ecosistemas; de tal manera
que los criterios de regulación, por una parte, no se
pierdan en acciones de mínima escala y por otra parte,
se reduzca la contradicción en el aprovechamiento o
conservación de recursos naturales, como humedales y
mangle, compartidos entre zonas adyacentes como ha
sido el caso de los OET de Quintana Roo, claramente
aquí mencionado. Se entiende que esta variabilidad se
debe al momento político en el que cada instrumento se
formuló, especialmente en lo referido a las modificaciones realizadas en la NOM-022 en el 2004.
Actualmente, sin embargo, la controversia debe
resolverse con la adición del Art. 60 Ter en la LGVS en
el 2007, siempre y cuando se interprete el afectar la
“integralidad” de los procesos y servicios ecológicos
como afectar la “integridad”, en el sentido discutido
anteriormente.
El diseño de estrategias de manejo (planificación y
atención de problemas de impacto ambiental) con
consideración de escalas espaciales resulta esencial
para su éxito; tanto así que actualmente se enfoca
mucho esfuerzo en regionalizar las áreas marinas y
costeras según sus características ecológicas (Espejel &
Bermúdez, 2009). Desde hace dos décadas, Wiens
(1989) reconoció que la probabilidad de mantener
poblaciones silvestres dinámicas frecuentemente
depende de estrategias de manejo a diferentes escalas
espaciales. Esta visión es necesaria para la conservación, tanto de los humedales como para las aves de
esta región. Especialmente para estas últimas, tanto
para especies nativas como migratorias, y no sólo para
las nativas como se incluye en los criterios de
regulación analizados en los OET. Si bien es conocido
que la habilidad de gestionar recursos para manejar
efectivamente los humedales es mayor a escalas locales
(parques, refugios y áreas de manejo), la escala a la cual
el manejo tiene mayor repercusión biológica es mucho
mayor (cuencas regionales) (Erwin, 2002; Quoc-Tuan
et al., 2012). En este sentido, se debe enfatizar que el
aspecto de conservar la conectividad, manifestado en
los criterios de regulación analizados, sea en realidad
operativo. De tal forma, se esperaría que las
recomendaciones de mayor escala espacial favorecerán
la conectividad (Hall et al., 2011) entre ANP
regionales, resaltarán la conservación de los servicios
ambientales de estos sistemas costeros y, si bien darán
mayor importancia a las especies nativas regionales, no
excluirán a las migratorias, independientemente de si
están o no enlistadas en alguna categoría de riesgo.
Estas condiciones no se cumplen actualmente en los
ordenamientos analizados y ante ello, es necesario
mejorarlos.
Otro aspecto a destacar entre los criterios
administrativos analizados es el tema de la restauración
de humedales. Si bien la restauración es considerada
una estrategia prioritaria en la Evaluación de los
Ecosistemas del Milenio, también es cierto que obedece
a diferentes motivaciones y paradigmas (Davenport et
al., 2010; Jenkins et al., 2010). Estos van desde el deseo
de recuperar ambientes degradados, obtención de
beneficios económicos, publicidad e imagen, hasta
motivaciones puramente tecnócratas. Por ello, propiciar
esta política local o regionalmente, sin cuidado o
control adecuados, puede implicar algunos riesgos a la
integridad de los sistemas ecológicos (Hobbs et al.,
2011; Ma et al., 2011) y a su conectividad.
Otra línea potencial de mejora en el diseño de
medidas de regulación y, de investigación en estos
humedales es el aspecto del balance de hidro-periodo y
la calidad del agua. Ambos son cruciales para la
presencia de los humedales y si estos no se conservan
cabalmente, los servicios ambientales que ofrecen,
como aquéllos vinculados a la presencia de aves de
humedal y al consecuente uso de éstas con fines
turísticos, no será posible. Aunque estos aspectos están
presentes en los criterios de regulación de los POET,
profundizar en este tema, aportará más elementos para
identificar las amenazas asociadas con la pérdida y
degradación de los bienes y servicios ambientales, pero
también para reconocer los posibles límites de una
eventual regionalización que considere la conectividad
entre los ecosistemas.
Es importante mencionar que legalmente los PM de
ANP pueden ser revisados y actualizados por lo menos
cada cinco años (Art. 77 del Reglamento de la
LGEEPA en materia de ANP). Asimismo, las reformas
de febrero de 2005 y mayo de 2013 a la LGEEPA y su
Reglamento en materia de ANP (DOF, 2000) determinaron los diferentes tipos de zonas y subzonas en que
pueden dividirse sus territorios, así como las
actividades permitidas y prohibidas dentro de cada una
de ellas (Art. 47 Bis). Esta zonificación debe observarse
de manera obligatoria y, constituye, una oportunidad
para que la Comisión Nacional de Áreas Naturales
Protegidas (CONANP) promueva la actualización de
sus PM, tomando en cuenta la reciente información
científica que apoya las acciones de conservación de la
integridad y conectividad de los humedales.
Estrategia “b”
El análisis de las reglas administrativas restrictivas y
propositivas sobre humedales o aves en los PM
analizados y la información compilada en la Tabla 4
lleva a discutir dos aspectos: primero, que como
algunos expertos sugieren, los estudios orientados a las
acciones de conservación en estas zonas debieran
beneficiar directa y principalmente los hábitats de aves
migratorias amenazadas, no cinegéticas, y muchas
veces endémicas (e.g., cigüeña jabirú, cigüeña
americana, pato golondrino, cerceta aliazul clara, pato
chalcuán, pato boludo chico, y martín pescador,
listados en la NOM -059, UICN y CITES), más del 80%
de las especies de aves de humedal registrados en la
zona costera, quedarían desprotegidas. Segundo, hay
aspectos de la integralidad ecológica de los humedales
y de las aves de humedal ausentes en las reglas de los
PM, que es necesario reforzar o incorporar en los
instrumentos normativos para asegurar el mínimo
impacto y estrés en los mismos. Algunos a reforzar son:
dimensiones de las áreas de amortiguamiento para que
los manglares no sean afectados por los cambios de
flujos hídricos o desmonte y el porcentaje de cobertura
forestal que debe ser conservado sin perturbación
(Christensen et al., 2008; Quoc-Tuan et al., 2012),
como también las distancias mínimas y tiempos
máximos de acercamiento a los hábitats de descanso,
anidación y alimentación de las aves. Se debe
incorporar reglas sobre: la protección de vegetación
arbustiva y herbácea asociada a los cuerpos de agua (no
solo de árboles); la conservación de la integridad de las
883
xxx
raíces de las comunidades forestales; la conservación
de la heterogeneidad de comunidades biológicas y el
mantenimiento de su conectividad con otros
ecosistemas (Luther & Greenberg, 2009; Beger et al.,
2010). Todo esto para asegurar el flujo de agua,
nutrientes y energía determinantes para la sobrevivencia de aves de humedal (May et al., 2002). Se debe
reforzar la aplicación del respeto a la capacidad de
carga y límite de cambio aceptable para usos y
aprovechamientos dentro de las ANP, tal como lo
señalan los Art. 80 y 81 del reglamento de la LGEEPA
en materia de ANP. Con respecto a las aves de humedal,
es necesario incluir reglas sobre la determinación de
áreas mínimas para la reproducción y anidación
(aspectos que suelen ser empleados en los procedimientos de EIA); hábitats críticos de las presas y
depredadores (aspectos que definen su nicho ecológico,
Weller, 1999); control o eliminación de fauna feral y
monitoreo, control y vigilancia relacionados con la
descarga de contaminantes a los cuales varias familias
de aves son muy sensibles (Luther & Greenberg, 2009;
Beger et al., 2010).
De no efectuarse estas
modificaciones, es posible que las estrategias de
manejo sean aún muy generales y que no aseguren la
integridad de los ecosistemas de humedal.
Se sugiere reforzar los mecanismos de participación
de expertos para incluir criterios de manejo más
precisos en los PM. Además se considera que la
información debe ser individualizada por humedal,
pero las prioridades de información para regularlos
deben estar homogenizadas de manera que el
tratamiento o manejo de estas áreas persigan los
mismos objetivos y la aplicación normativa se facilite.
En particular, esto es relevante para ecosistemas que
funcionan como corredores biológicos a escala
continental (como todos los humedales costeros de la
Península de Yucatán), cuya protección diferenciada
podría causar el aislamiento de poblaciones de aves de
humedal y la pérdida de continuidad ecológica para
aves migratorias. Es decir, aunque la conectividad
ecológica se ha tratado de contemplar legalmente,
mediante el establecimiento de zonas de amortiguamiento y zonas de influencia en la definición de los
polígonos de las ANP, y que las reformas de 2007 a la
LGEEPA pretendieron promover la continuidad
ecológica de áreas protegidas a través de decretar que
los PM sean considerados en la formulación de los
OET, es necesario ahondar legal y prácticamente dicha
formulación.
El análisis de capacidad de gestión ambiental (Fig.
2) permite evidenciar un escaso interés en regular
recursos financieros, humanos (con capacitación
permanente) y materiales, así como la integración
social en el manejo de los recursos naturales. Este
884
xxx
último aspecto debilita mucho la posibilidad de hacer
eficiente la protección y conservación de recursos
naturales. Los avances más notables en la última década
en este tema se han logrado empleando estrategias de
co-manejo y manejo participativo (es decir, manejo
compartido entre usuarios y autoridades), más que
diseñando e imponiendo reglas estrictas impuestas por
las autoridades. Es necesario reforzar la participación
social, la comprensión de las reglas y la confianza de
los usuarios aún en caso de tener que aplicar el
Principio Precautorio (tomar medidas de control aún
con gran incertidumbre de información científica).
Se concluye que el enfoque transversal (entre
instrumentos) y espacial (a diferentes escalas) empleado en este análisis, permite detectar que el
escenario jurídico global aplicable a la conservación de
los humedales y aves de humedal de la región PY es
aún ineficiente (Brañez, 2004) por las siguientes
razones:
a) Hay conceptos en sus instrumentos legales como
“integralidad” por “integridad” que pueden
favorecer la ambigüedad de interpretación jurídica.
b) Aún hay ANP y OET sin reglas sobre la protección
de los humedales costeros y de las aves de humedal
de la PY.
c) No existen las normas jurídico-ambientales
necesarias para lograr una protección sistémica para
que los humedales mantengan la integridad
ecológica, particularmente la conectividad, el hidroperiodo con adecuado balance físico y químico, la
degradación constante de materia orgánica, procesos
ecológicos completos, cadenas alimentarias completas, productividad primaria y secundaria, heterogeneidad espacio-temporal y variedad florística y
faunística.
d) No existen suficientes elementos científicos sobre
las causas de estrés ambiental en humedales y
protección de aves en zonas de anidación, reproducción y alimentación, así como sobre los servicios
ecológicos que ofrecen los humedales que se
reflejen en criterios regulatorios.
Recomendaciones para fortalecer las condiciones
normativas
a) Elaborar compendios de información científica
básica necesaria para el diseño de reglas administrativas ad-hoc para cada ANP y sistemas de
humedales (a nivel local y regional), pero
homogenizando en temas prioritarios que deben
regularse.
b) Intensificar la investigación sobre nichos ecológicos
y requerimientos de hábitats de las aves que habitan
c)
d)
e)
f)
g)
h)
i)
los humedales de la costa peninsular y reflejar tal
información en los PM.
Promover el diseño de estrategias y reglas de manejo
que favorezcan la integridad de los ecosistemas y la
conectividad entre ANP regionales y asegurar así, las
medidas para conservar todos los servicios ambientales
de estos sistemas costeros. Además, controlar el
seguimiento de su aplicación.
Procurar el diseño de reglas de manejo que incluyan la
protección de diferentes doseles de la vegetación y
variedades de hábitats (visión de sistema), de forma que
no se espere proteger a las aves de humedal con reglas
muy generales.
Solicitar a las autoridades competentes en materia
ambiental de los tres niveles de gobierno, que
consideren una estructura jerárquica o anidada de
estrategias de manejo a diferentes escalas espaciales
(considerando zonas de amortiguamiento y zonas de
influencia), que homogenice criterios y prioridades. De
tal forma que, al validar los OET y PM se consideren
las estrategias previamente diseñadas y se busque la
congruencia y complementariedad entre ellas. Sin
duda, la atención a los retos que México aborda en
materia de planeación territorial y ecológica podrán ser
de utilidad para otros países latinoamericanos, sobre
todo para aquellos ecosistemas donde la conectividad
es crítica.
Diseñar y robustecer mecanismos de consulta a
expertos y usuarios de bienes naturales para que
participen en la evaluación de estrategias de manejo de
recursos naturales en ANP (como el Directorio en línea
de especialistas de manglares en México, promovido
por la CONABIO como parte del programa “Los
Manglares en México: estado actual y establecimiento
de un programa de monitoreo a largo plazo”) y crear
una base de datos sobre información científica de
recursos naturales a nivel regional que pueda se
consultada al actualizar PM.
Incentivar a los ecólogos a involucrarse en los procesos
del manejo de los recursos y ecosistemas naturales y a
publicar en medios de difusión accesibles a los
tomadores de decisiones.
Realizar un análisis comprensivo de políticas públicas
y un reglamento acerca de las estrategias de restauración de humedales costeros.
Complementar con la evaluación de estrategias
institucionales de manejo y conocimientos tradicionales acerca de estas estrategias para abordar los
compromisos del Plan Estratégico Ramsar 2009-2015.
AGRADECIMIENTOS
Los autores agradecen al CONACyT y la Dirección
General de Personal Académico (DGAPA) de la UNAM
por su apoyo financiero para realizar estancias
posdoctorales durante las cuales se elaboró este trabajo.
Los autores agradecen al ICMyL (UNAM) por facilitar
el uso del servicio bibliotecario, equipo de cómputo e
instalaciones en la estación El Carmen durante la
misma estancia posdoctoral. Agradecemos al Biol.
Hernán Álvarez Guillén (estación El Carmen ICMyL)
por su apoyo logístico en la búsqueda de material
bibliográfico empleado en la elaboración de este
documento y al M. en C. Imre Páramo por su apoyo en
la edición del documento.
REFERENCIAS
Arizmendi, M.C. & L. Márquez. 2000. Áreas de
importancia para la conservación de las aves de
México. CIPAMEX-CONABIO, México, 40 pp.
Azuela, A., M.A. Cancino, C. Contreras & A. Rabasa.
2008. Una década de transformaciones en el régimen
jurídico del uso de la biodiversidad. In: J. Carabias, A.
Mohar, S. Anta & J. de la Maza (eds.). Capital natural
de México. III. Políticas públicas y perspectivas de
sustentabilidad. CONABIO, pp. 259-282.
Badillo, A.M., M.F. López, T.A. Gallardo & C.X.
Chiappa. 2014. Catálogo de aves de la costa norte de
Yucatán. CONACYT, UNAM, México, 167 pp.
Batllori-Sampedro, E., J. Febles-Patrón & J. Díaz-Sosa.
1999. Landscape change in Yucatan's northwest
coastal wetlands (1948-1991). Hum. Ecol. Rev., 6(1):
8-20.
Beger, M., H.S. Grantham, R.L. Pressey, K.A. Wilson,
E.L. Peterson, D. Dorfman, P.J. Mumby, R. Lourival,
D.R. Brumbaugh & H.P. Possingham. 2010. Conservation planning for connectivity across marine,
freshwater, and terrestrial realms. Biol. Conserv., 143:
565-575.
Berlanga-Cano, M., P. Wood, J. Salgado-Ortiz, E.M.
Figueroa-Esquivel & J. Correa-Sandoval. 2000. Laguna
de Términos. In: M.C. Arizmendi & L. Márquez (eds.).
Áreas de importancia para la conservación de las aves de
México. CIPAMEX-CONABIO, pp. 67-70.
Brañez, R. 2004. Manual de Derecho Ambiental Mexicano.
Fondo de Cultura Económica, México, 756 pp.
Cafaro, P. & R. Primack. 2001. Ecological integrity:
evaluating success in national parks and protected
areas. [http://onlinelibrary.wiley.com/doi/10.1038/
npg.els.0003656/full]. Revisado: 25 Junio 2014.
Carrillo, J.C. 2007. El marco legal e institucional aplicable
a la gestión de humedales y ecosistemas acuáticos en
México. In: O. Sánchez, M. Herzig, E. Peters, R.
Márquez & L. Zambrano (eds.). Perspectivas sobre
conservación de ecosistemas acuáticos en México.
SEMARNAT, INE, USF&WS, Unidos para la
Conservación y Escuela de Biológica de la Univer-
xxx
885
sidad de Michoacán de San Nicolás de Hidalgo, pp.
245-285.
Comisión Nacional para el Conocimiento y Uso de la
Biodiversidad (CONABIO). 2009. Manglares de
México: extensión y distribución. CONABIO, México,
99 pp.
Biodiversidad (CONABIO). 2010a. La red de
conocimiento sobre las aves de México. [http://aves
mx.conabio.gob.mx/]. Revisado: 3 Julio 2014.
Biodiversidad (CONABIO). 2010b. Regiones hidrológicas prioritarias. [http://www.conabio.gob.mx/
conocimiento/regionalizacion/doctos/Hlistado.html].
Revisado: 3 Julio 2014.
Comisión Nacional de Áreas Naturales Protegidas
(CONANP). 2010. Sitios Ramsar. [http://ramsar.
conanp.gob.mx/]. Revisado: 30 Junio 2014.
Connolly, K.D. 2008. Regulation of coastal wetlands and
other waters in the United States. In: D.C. Baur, T.
Eichenberg & M. Sutton (eds.). Ocean and coastal law
and policy. Section of Environment, Energy and
Resources, American Bar Association, pp. 87-146.
Cornell-Lab-of-Ornithology 2010. Neotropical birds.
[http://neotropical.birds.cornell.edu/-portal/home].
Revisado: 3 Julio 2014
Correa-Sandoval, J. & A.J. Contreras-Balderas. 2008.
Distribution and abundance of shorebirds in the coastal
wetlands of the Yucatan Peninsula, Mexico. Wader
Study Group Bull., 115(3): 148-156.
Correa-Sandoval, J., S. Hernández-Betancourt, M.
Berlanga-Cano, B. MacKinnon, P. Wood & J.
Salgado-Ortiz. 2000. Humedales costeros del norte de
la península de Yucatán. In: M.C. Arizmendi & L.
Márquez (eds.). Áreas de importancia para la
conservación de las aves de México. CIPAMEXCONABIO, pp. 75-76.
Cortina, S.S., B.G. Brachet, M. Ibañez-de la Calle & V.L.
Quiñones 2007. Océanos y costas. Análisis del marco
jurídico e instrumentos de política ambiental en
México. SEMARNAT-INE, 233 pp.
Chesser, R.T., R.C. Banks, F.K. Barker, C. Cicero, A.W.
Kratter, I.J. Lovette, P.C. Rasmussen, J.V. Remsen,
J.D. Rising, D.F. Stotz & K. Winker. 2010. Fifty-first
supplement to the American Ornithologists’ Union
check-list of North American birds. Auk, 127(3): 726744.
Christensen, S.M., P. Tarp & C.N. Hjortso. 2008.
Mangrove forest management planning in coastal
buffer and conservation zones, Vietnam: a multimethodological approach incorporating multiple stakeholders. Ocean Coast. Manage., 51: 712-726.
Dahdouh-Guebas, F., L.P. Jayatissa, D. Di Nitto, J.O.
Bosire, D. Lo Seen & N. Koedam. 2005. How effective
886
xxx
were mangroves as a defense against the recent
tsunami? Current Biol., 15(12): 443-447.
Davenport, M.A., C.A. Bridges, J.C. Mangun, A.D.
Carver, K.W.J. Williard & E.O. Jones. 2010. Building
local community commitment to wetlands restoration:
a case study of the river Wetlands in southern Illinois,
USA. Environ. Manage., 45: 711-722.
Diario Oficial de la Federación (DOF). 2000. Reglamento
de la Ley General del Equilibrio Ecológico y la
Protección al Ambiente en Materia de Áreas Naturales
Protegidas
[http://www.diputados.gob.mx/Leyes
Biblio/regley/Reg_LGEEPA_ANP.pdf]. Revisado: 4
Julio 2014.
Diario Oficial de la Federación (DOF). 2004. Acuerdo
que adiciona la especificación 4.43 a la Norma Oficial
Mexicana NOM-022-SEMARNAT 2003. Que establece las especificaciones para la preservación,
conservación, aprovechamiento sustentable y restauración de los humedales costeros en zonas de manglar.
[http://www.profepa.gob.mx/innovaportal/file/3282/1
/nom-022-semarnat-2003_acuerdo_que_especifica_4.
43_d.o.f_7-may-2004.pdf]. Revisado: 25 Junio 2014.
Diario Oficial de la Federación (DOF). 2010. Norma
Oficial Mexicana NOM-059-SEMARNAT-2010,
Protección ambiental, especies nativas de México de
flora y fauna silvestres, categorías de riesgo y
especificaciones para su inclusión, exclusión o
cambio, Lista de especies en riego. México.
[http://www.profepa.gob.mx/-innovaportal/file/435/1/
NOM_059_SEMARNAT_2010.pdf]. Revisado: 25
Junio 2014.
Diario Oficial de la Federación (DOF). 2011. Reglamento
de la Ley de aguas Nacionales. México. [http://www.
diputados.gob.mx/LeyesBiblio/regley/Reg_LAN.pdf].
Revisado: 30 Junio 2014.
Diario Oficial de la Federación (DOF). 2013. Ley de
Aguas Nacionales México. [http://www.diputados.
gob.mx/LeyesBiblio/pdf/16.pdf]. Revisado: 25 Junio
2014.
Diario Oficial de la Federación (DOF). 2014a. Ley
General de Vida Silvestre. México. [http://www.diputados.gob.mx/LeyesBiblio/pdf/146.pdf]. Revisado: 30
Junio 2014.
Diario Oficial de la Federación (DOF). 2014b. Ley
General del Equilibrio Ecológico y Protección al
Ambiente. México. [http://www.diputados.gob.mx/
LeyesBiblio-/pdf/148.pdf]. Revisado: 30 Junio 2014.
Erwin, R.M. 2002. Integrated management of waterbirds:
beyond the conventional. waterbirds 25(Spec. Publ. 2):
5-12.
Espejel, I. & R. Bermúdez. 2009. Propuesta metodológica
para la regionalización de los mares mexicanos. In: A.
Córdova y Vásquez, V.F. Rosete, H.G. Enríquez & B.
Hernández-de la Torre (eds.). Ordenamiento ecológico
marino. Visión integrada de la regionalización.
SEMARNAT, INE, México, pp. 232.
Fahring, L. & G. Merriam. 1985. Habitat patch connectivity
and population survival. Ecology, 66: 1762-1768.
Guzy, J.C., E.D. McCoy, A.C. Deyle, S.M. Gonzalez, N.
Halstead & H.R. Mushinsky. 2012. Urbanization
interferes with the use of amphibians as indicators of
ecological integrity of wetlands. J. Appl. Ecol., 49:
941-952.
Hall, T., M. MacLean, S. Coffen-Smout & G. Herbert.
2011. Advancing objectives-based, integrated ocean
management through marine spatial planning: current
and future directions on the Scotian Shelf off Nova
Scotia, Canada. J. Coast. Conserv., 15: 247-255.
Hiraishi, T. & K. Harada. 2003. Greenbelt tsunami
prevention in south Pacific region. Reports of the port
and airport research institute. Ministry of Land,
Infrastructure and Transport, Yokosuka City, Kanagawa,
pp: 3-25
Hobbs, R.J., L.M. Hallett, P.R. Ehrlich & H.A. Mooney.
2011. Intervention ecology: applying ecological
science in the twenty-first century. Bioscience, 61:
442-450.
Hodgson, J.A., C.D. Thomas, B.A. Wintle & A. Moilanen.
2009. Climate change, connectivity and conservation
decision making: back to basics. J. Appl. Ecol., 46:
964-969.
Instituto Nacional de Ecología (INE). 2005. Evaluación
preliminar de las tasas de pérdida de superficie de
manglar en México. Dirección General de Investigación de Ordenamiento Ecológico y Conservación de
los Ecosistemas, México, 22 pp.
Jenkins, W.A., B.C. Murray, R.A. Kramer & S.P.
Faulkner. 2010. Valuing ecosystem services from
wetlands restoration in the Mississippi alluvial valley.
Ecol. Econ., 69: 1051-106.
Lopez-Duarte, P.C., H.S. Carson, G.S. Cook, F.J. Fodrie,
B.J. Becker, C. DiBacco & L.A. Levin. 2012. What
controls connectivity? An empirical, multi-species
approach. Integr. Comp. Biol., 52: 511-524.
Luther, D.A. & R. Greenberg. 2009. Mangroves: a global
perspective on the evolution and conservation of their
terrestrial vertebrates. Bioscience, 59: 602-612.
Llamosa, N.E. 2011. Aves comunes de la Península de
Yucatán. Editorial Dante, México, 144 pp.
Ma, C., G. Zhang, H. Li, M. Ju, T. Mao & X. Zhang. 2011.
Research trends of ecological restoration: new
opportunities to match new changes. In: X. Zhou,
(ed.). International Conference on Energy and
Environmental Science (ICEES), Shenzhen, China.,
IEEE, pp. 3017-3024.
MacKinnon, B.H. 2005. Aves y reservas de la Península
Yucatán. Amigos de Sian Ka’an, A.C., México, 76 pp.
May, S.M., D.E. Naugle & K.F. Higgins. 2002. Effects of
land use on nongame wetland birds in western south
Dakota stock ponds. Waterbirds, 25(Spec. Publ. 2):
51-55.
Millennium-Ecosystem-Assessment. 2005. Ecosystems
and human well-being: wetlands and water synthesis.
World Resources Institute, Washington DC, 68 pp.
Parrish, J.D., D.P. Braun & R.S. Unnach. 2003. Are we
conserving what we say we are? Measuring ecological
integrity within protected areas. Bioscience, 53: 851860.
Perlo, V.B. 2006. Birds of Mexico and Central America.
Princeton University Press, New Jersey, 336 pp.
Quoc-Tuan, V., C. Kuenzer, V. Quang-Minh, F. Moder &
N. Oppelt. 2012. Review of valuation methods for
mangrove ecosystem services. Ecol. Indic., 23: 431446.
RAMSAR. 2008. Declaración de Changwon sobre el
bienestar humano y los humedales. 10ª Reunión de la
Conferencia de las Partes en la Convención
RAMSAR, mediante la Resolución X.1. Changwon,
República de Corea. [http://www.ramsar.org/pdf/cop10/cop10_changwon_spanish.pdf]. Revisado: 30
Junio 2014.
RAMSAR. 2010. Leyes e instituciones: examen de leyes
e instituciones para promover la conservación y el uso
racional de los humedales. Manuales Ramsar para el
uso racional de los humedales. Gland, Suiza. [http://
www.ramsar.org/pdf/lib/hbk4-03sp.pdf]. Reviewed:
30 Junio 2014.
RAMSAR. 2015. Informe Nacional de México sobre la
aplicación de la Convención Ramsar sobre los Humedales. 12ª Reunión de la Conferencia de las Partes
Contratantes, Uruguay, 2015 [http://www.ramsar.org/
sites/default/files/documents/2014/nationalreports/CO
P12/cop12_nr_mexico.pdf]. Revisado: 4 Agosto 2015.
Received: 14 July 2014; Accepted: 13 August 2015
xxx
887
Rasouli, S., M.M. Farkhondeh, H.R. Jafari, R. Suffling, B.
Kiabi & A.R. Yavari. 2012. Assessment of ecological
integrity in a landscape context using the Miankale
Peninsula of Northern Iran. Int. J. Environ. Res., 6:
443-450.
Rivera-Arriaga, E. & G. Villalobos. 2001. The coast of
Mexico: approaches for its management. Ocean Coast.
Manage., 44: 729-756.
Roberge, J.M. & P. Angelstam. 2004. Usefulness of the
umbrella species concept as a conservation tool.
Conserv. Biol., 18(1): 76-85.
Taylor, P.D., L. Fahrig, K. Heinen & G. Merriam. 1993.
Connectivity is a vital element of landscape structure.
Oikos, 68: 571-573.
Vidal, L. 2010. Análisis de la capacidad de gestión
ambiental ante el cambio climático en instrumentos de
planeación de la costa de Quintana Roo. In: E. RiveraArriaga, I. Azuz-Adeath, G.J. Villalobos-Zapata & L.
Alpuche-Gual (eds.). Cambio climático en México un
enfoque costero-marino. Universidad Autónoma de
Campeche CETYS-Universidad, Gobierno del Estado
de Campeche, Campeche, pp. 689-710.
Voss, K.A., A. Pohlman, S. Viswanathan, D. Gibson & J.
Purohit. 2012. A study of the effect of physical and
chemical stressors on biological integrity within the
San Diego hydrologic region. Environ. Mon. Assess.,
184: 1603-1616.
Weller, M.W. 1999. Wetland birds: habitat resources and
conservation implications. Cambridge University
Press, London, 271 pp.
Wiens, J.A. 1989. Spatial scaling in ecology. Funct. Ecol.,
3: 385-397.
Young, J.C., M. Marzano, R.M. White, D.I. McCracken,
S.M. Redpath, D.N. Carss, C.P. Quine & A.D. Watt.
2010. The emergence of biodiversity conflicts from
biodiversity impacts: characteristics and management
strategies. Biodivers. Conserv., 19: 3973-3990.
Lat. Am. J. Aquat. Res., 43(5): 888-894, 2015
Amino acid requirements of Astyanax fasciatus
888
1
Research Article
Estimation of the dietary essential amino acid requirements of colliroja
Astyanax fasciatus by using the ideal protein concept
Wilson Massamitu Furuya1,2, Mariana Michelato2, Ana Lúcia Salaro3
Thais Pereira da Cruz1 & Valéria Rossetto Barriviera-Furuya1
1
Departamento de Zootecnia, Universidade Estadual de Ponta Grossa
Av. Carlos Cavalcanti 4748, 84030-900, Uvaranas, Paraná, Brazil
2
Programa de Pós-Graduação em Zootecnia, Universidade Estaudual de Maringá
Av. Colombo 5790, Zona 07, 87030-900, Maringá, Paraná, Brazil
3
Departmento de Biologia, Universidade Federal de Viçosa
Avenida Peter Henry Rolfs s/n, Campus Universitário, Viçosa-MG, 36570-000, Brazil
Corresponding author: Wilson Massamitu Furuya ([email protected])
ABSTRACT. Colliroja, Astyanax fasciatus, is a new aquaculture species, and information on its dietary
essential amino acid requirements is lacking. The whole body composition of 120 farmed fish (16.2 ± 8.8 g) was
determined to estimate the dietary essential amino acid requirement based on the ideal protein concept ((each
essential amino acid/lysine) ×100), and the findings were correlated to the whole body essential amino acid
content of Nile tilapia Oreochromis niloticus. The dietary essential amino acids, including cysteine and tyrosine,
accounted for 5.46, 4.62, 1.16, 3.28, 5.63, 2.01, 2.59, 2.84, 4.66, 3.39, 0.65, and 3.51% of the total protein for
lysine, arginine, histidine, isoleucine, leucine, methionine, methionine+tyrosine, phenylalanine,
phenylalanine+tyrosine, threonine, tryptophan, and valine, respectively. There were positive linear and high
correlations (r = 0.971) between the whole body amino acid profiles of colliroja and Nile tilapia. Thus, the whole
body amino acid profile of colliroja might be used to estimate accurately the essential amino acid requirement.
Keywords: Astyanax fasciatus, amino acids, nutrition, protein, ideal protein concept, aquaculture.
Estimación de los requerimientos dietéticos de aminoácidos esenciales de colliroja,
Astyanax fasciatus, basadas en el concepto de proteína ideal corporal
RESUMEN. Colirroja, Astyanax fasciatus, es una nueva especie de la acuicultura y no hay información sobre
sus requerimentos de aminoácidos esenciales en la dieta. Se determinó la composición corporal de 120 peces de
cultivo (16,2 ± 8,8 g) para estimar los requirimientos nutricionales de aminoácidos essenciales en la dieta,
incluyendo cistina y tirosina, basada en el concepto de proteína ideal ((cada aminoácido essencial/lisina) x 100)
y los resultados se correlacionaron con el perfil corporal de la tilapia del Nilo Oreochromis niloticus. El perfil
dietético de aminoácidos essenciales explica el 5,46, 4,62, 1,16, 3,28, 5,63, 2,01, 2,59, 2,.84, 4,66, 3,39, 0.65 y
3,51% de la proteína, respectivamente para lisina, arginina, histidina, isoleucina, leucina, metionina,
metionina+cistina, fenilalanina, fenilalanina+tirosina, treonina, triptófano y valina. Hubo una alta correlación
lineal positiva (r = 0,971) entre el perfil corporal de aminoácidos de colirroja y el de tilapia del Nilo. Por lo
tanto, el perfil corporal de los aminoácidos basado en el concepto de proteína ideal podría ser utilizado para
estimar con precisión el requisito de aminoácidos essenciales de colirroja.
Palabras clave: Astyanax fasciatus, aminoácidos, nutrición, proteína, concepto de proteína ideal, acuicultura.
INTRODUCTION
Protein is the most costly portion of aquaculture feeds.
Estimating the amino acid requirements of fish is im__________________
Corresponding editor: Ronaldo Cavalli
portant, because fish do not actually require dietary
protein, but a rather well-balanced supply of dietary
amino acids. The essential amino acid requirements
have been established for only a few cultured fish spe-
2889
cies (NRC, 2011). Individual amino acid requirements
for fish have been determined by using time-consuming
and costly dose-response feeding assays. As an alternative, the whole body composition of a species can be
used to estimate simultaneously the requirements for all
ten essential amino acids (Tacon, 1989). This technique
has been currently used to estimate the essential amino
acid requirements for fish (Portz & Cyrino, 2003;
Gurure et al., 2007), because there is high correlation
between the content of dietary amino acids required
determined using dose-response experiments and that
of amino acids in the whole body tissue (Wilson & Poe,
1985).
Since the amino acid requirements of a growing
animal are known to be reflected by its amino acid
composition (Mitchell, 1950), the ideal protein concept
that uses the relationships of each essential amino acid
profile in relation to lysine has been developed as a
basis to formulate diets for fish (Furuya et al., 2004a;
Kaushik & Seiliez, 2010; NRC, 2011). The advantage
of this concept is that it can be adapted to various
situations, provided the relationships between amino
acids do not change for a given growth stage (Portz &
Cyrino, 2003). For fish, the quantitative lysine
requirement might vary, but not the ideal amino acid
profile expressed relative to lysine. Given the dietary
requirement for lysine, the requirement for the
remaining essential amino acids can be predicted based
on the relative ratio of amino acids in the whole body.
A. fasciatus (Cuvier, 1819) is an omnivorous
freshwater fish; it is widely used as a game and food
fish. Rapid growth, low dietary protein requirement,
and mild white flesh attract consumers, rendering it an
economically important fish. However, at present, the
information on the dietary requirements for this fish
species is not available. Thus, this study aimed to
estimate the dietary essential amino acid requirement
for colliroja by analyzing the whole body composition.
Coleção Ictiológica at the Universidade Estadual de
Maringá (NUP 11864), Maringá, Paraná, Brazil.
The fish samples were obtained from two earth
ponds of 300 m2 each. While collecting colliroja, 30
Nile tilapias (15 fish during each collection) were
collected (621 ± 37 g) from a 100 m2 earth pond for
whole body analysis of crude protein and amino acids.
They were fed only naturally available feed and not
artificial diets. Fish were caught using surface and
bottom trawl nets (mesh size = 1 cm (colliroja) and 12
cm (Nile tilapia)), and placed in a 500 L indoor
fiberglass tank aerated to maintain a dissolved oxygen
of >5 and <6 mg·L-1. They were fasted for 24 h before
the beginning of the experiment and euthanized by an
overdose of benzocaine (3 g 10 L-1). The total length
(0.1 cm) and body weight (0.01 g) of colliroja were
measured. Fish samples were stored in a freezer at 80ºC for subsequent analysis.
Analytical procedures
Pooled samples of fish were ground in a meat grinder
and analyzed in duplicate for body composition of
moisture and protein, as per the standard methods
(AOAC, 2003). Moisture content was determined by
drying the samples in an oven (TE-391-1; Tecnal,
Piracicaba, SP, Brazil) at 105°C until a constant weight
was reached. Nitrogen content was determined using a
micro-Kjeldahl apparatus, and crude protein was
estimated by multiplying the nitrogen content by 6.25.
Amino acid content was determined after acidic and
basic digestion for chromatographic and ionic change
analyses (high-performance liquid chromatography)
performed in sealed glass tubes under nitrogen atmos-
Fish and management
The study was performed at an application unit of the
Aquaculture Laboratory, Universidade Estadual de
Ponta Grossa, Paraná, Brazil. Fish were obtained from
a local fish farm (Piscicultura Águas Claras, Castro,
Paraná, Brazil; 24o42’32”S, 50o02’37”W). In total, 120
cultivated mixed-sex fish (16.2 ± 8.8 g) were collected
randomly in March (60 fish) and October (60 fish) of
2013, and fish collected during each month were
divided in two groups (30 fish each) and considered as
replicates. Specimens are deposited in the Núcleo de
Pesquisa em Limnologia, Ictiologia e Aquicultura/
Calculation
The whole body profile of essential amino acids,
including cysteine and tyrosine, was expressed relative
to the lysine content according to equation (1): EAAP =
EAA/L × 100, where EAAP is the whole body essential
amino acid profile, and L is the whole body lysine
content. The dietary lysine requirement was estimated
to be 5.46% of the protein; this represents the mean
value of dietary lysine requirement of common carp
(Cyprinus carpio), grass carp (Ctenopharyngodon
idella), and Nile tilapia (Oreochromis niloticus)
reported by the NRC (2011). The essential amino acid
profile in the diets for colliroja was estimated according
to equation (2): EAAD = 5.46 × (EAAP/100), where
EAAP (% dietary protein) is the essential amino acid
profile in the diet, 5.46 is the mean value of dietary
lysine requirement (% dietary protein) of common carp,
grass carp, and Nile tilapia (NRC, 2011), and EAAP is
the whole body essential amino acid profile determined
using equation (1).
phere at 110oC. Cysteine and methionine contents were
determined by hydrolysis after oxidation with performic acid. After hydrolysis, the solutions were vacuumfiltered, diluted to 0.25 M with 0.02 N HCl for adjusting
the pH to 8.5, and filtered through a Millipore
membrane (0.45 mm). Tryptophan analysis was
performed after alkaline hydroxylation of the samples
with lithium hydroxide. Free amino acids were
separated using an auto-analyzer (Hitachi L-8500A;
Tokyo, Japan).
Statistical analysis
The results are presented as means ± standard deviation
of duplicate samples. Data of whole body amino acid
profile of Nile tilapia and colliroja were subjected to
one-way analysis of variance (ANOVA), and differences between treatment means were determined using
t-test. The correlation among the dietary essential
amino acid profiles determined based on the ideal
protein concept of Nile tilapia and colliroja was
expressed using linear regression analysis, and each
essential amino acid mean was compared using t-test (P
< 0.05) by using the SPSS Statistical Package (Version
15.0; SP Inc., Chicago, IL). The dietary amino acid
requirement was recommended as percentage of
protein found in the whole body composition of
colliroja.
8903
Table 1. Whole body composition of essential and nonessential amino acids of colliroja Astyanax fasciatus (dry
matter basis). Values are mean ± standard deviation of two
replicate analyses.
Composition
Crude protein
Arginine
Phenilalanine
Phenilalanine + tyrosine
Histidine
Isoleucine
Leucine
Lysine
Methionine
Methionine + cysteine
Threonine
Tryptophan
Valine
Glutamic acid
Aspartic acid
Alanine
Cysteine
Glycine
Serine
Tyrosine
%
42.44 ± 0.41
2.74 ± 0.05
1.64 ± 0.03
2.82 ± 0.04
0.76 ± 0.00
1.64 ± 0.03
2.89 ± 0.05
3.15 ± 0.06
1.04 ± 0.01
1.39 ± 0.01
1.66 ± 0.02
0.41 ± 0.00
1.92 ± 0.04
5.25 ± 0.07
3.64 ± 0.01
2.69 ± 0.01
0.34 ± 0.00
3.10 ± 0.01
1.68 ± 0.00
1.18 ± 0.01
essential amino acid profile recommended for colliroja
is shown in Table 3.
RESULTS
The results of the quantitative analysis of whole body
essential and non-essential amino acids of colliroja are
shown in Table 1.
Among the essential amino acids, the mean
concentration of lysine in the whole body composition
of colliroja was the highest, followed by those of
leucine and arginine. The concentration of tryptophan
was the lowest. The profiles of essential amino acids,
including cysteine and tyrosine, of colliroja and Nile
tilapia obtained on the basis of the ideal protein concept
are shown in Table 2 and Figure 1.
There were no differences between whole body
concentrations of arginine, histidine, isoleucine,
methionine, methionine+cysteine, phenylalanine, phenylalanine+tyrosine, and tryptophan of Nile tilapia and
colliroja. However, Nile tilapia showed higher (P <
0.05) values of methionine, threonine, and valine than
those in colliroja.
Regression analysis showed high correlation (r =
0.9710) between whole body essential amino acid
profiles of colliroja and Nile tilapia (Fig. 2); the
regression could be described according to the
following equation: y = 8.4964+6.4956x. The dietary
DISCUSSION
Among all essential amino acids, the proportion of
lysine was high in colliroja; this is in agreement with
the results obtained in carnivorous pikeperch, Sander
lucioperca (Jarmolowicz & Zakęś, 2014), black bass,
Micropterus salmoides (Portz & Cyrino, 2003), and
omnivorous fish species (Abimorad & Castellani, 2011;
Taşbozan et al., 2013). According to the ideal protein
concept, amino acid profile is expressed relative to
lysine content, because lysine is usually the first
limiting amino acid and exclusively used for body
protein synthesis. In addition, lysine is one of the most
studied amino acids in fish nutrition, and adequate
crystalline lysine supplementation is positively related
to the growth and feed efficiency of fish (Wu, 2013).
Despite the higher quantitative value of whole body
lysine, the arginine to lysine ratio obtained for colliroja
(0.87:1) approached 0.83:1 for Nile tilapia as revealed
by a dose-response experiment (Santiago & Lovell,
1988) and 0.84:1 for channel catfish, Ictalurus
punctatus (NRC, 2011). The lysine to arginine ratio
might be evaluated in fish diets to avoid antagonisms,
because impaired ratios of lysine or arginine can reduce
fish growth and feed efficiency (Wu, 2013). Crystalline
4891
Table 2. Whole body amino acid profile of colliroja A. fasciatus and Nile tilapia Oreochromis niloticus determined on the
basis of the ideal protein concept. EEA/L: each essential amino acid (including cysteine and tyrosine) relative to lysine.
Values are means ± standard deviation (n = 2), and values within the same row with different letters are significantly different
(P < 0.05) by t-test.
Amino acid
Lysine
Arginine
Histidine
Isoleucine
Leucine
Methionine
Phenylalanine
Phenylalanine + tyrosine
Threonine
Tryptophan
Valine
Nile tilapia
100.00 ± 0.00
84.76 ± 10.82a
21.32 ± 1.43a
60.16 ± 2.57 a
103.39 ± 0.85a
36.95 ± 0.03a
47.51 ± 1.04a
52.09 ± 1.99a
85.56 ± 4.64a
62.15 ± 0.43a
11.85 ± 1.08a
64.34 ± 0.41a
Figure 1. Whole body essential amino profile (including
cysteine and tyrosine) of Nile tilapia Oreochromis
niloticus and colliroja A. fasciatus determined on the basis
of the ideal protein concept. Arg: arginine, His: histidine,
Ile: Isoleucine, Leu: leucine, Met: methionine, Met+Cys:
methionine+cysteine, Phe: phenylalanine, Phe+Tyr:
phenylalanine+tyrosine, Thr: treonine, Trp: triptofano,
and Val: valine.
amino acid supplementation based on the ideal protein
profile is useful for estimating the dietary requirement
of all essential amino acids from the analysis of only
one amino acid, lysine (NRC, 2011).
EEA/L
Colirroja
100.00 ± 0.00
87.13 ± 0.42a
24.07 ± 0.37a
52.08 ± 0.23a
92.01 ± 0.55b
33.12 ± 0.31b
44.01 ± 0.42a
52.08 ± 0.34a
89.51 ± 0.70a
52.60 ± 0.45b
12.88 ± 0.13a
61.06 ± 0.17b
P-value
0.628
0.399
0.165
0.013
0.033
0.152
0.552
0.883
0.040
0.060
0.037
Cysteine and tyrosine are considered semi-essential
because they are only biosynthesized from methionine
and phenylalanine, respectively, and their dietary
requirement should be presented as the sum of
methionine+cysteine (sulfur amino acids) and phenylalanine+tyrosine (aromatic amino acids; Wu, 2013).
However, methionine is the most limiting amino acid in
soybean meal, one of the most frequently used plantprotein in fish diets, and minimum dietary methionine
is included during feed formulation to avoid methionine
deficiency (Furuya et al., 2004b). In contrast, phenylalanine is not considered a limiting amino acid in fish
nutrition, and few studies have determined its dietary
requirement.
There are contradicting results on methionine and
total sulfur amino acid concentrations determined in
dose-response experiments and values estimated from
whole body amino acid composition of fish. The dietary
amino acid requirements of colliroja were compared to
those of Nile tilapia obtained from dose-response
experiments and whole body analysis, considering the
similarity between colliroja and Nile tilapia in terms of
food habits (omnivorous) and taxonomic classification
(Characidae family). Moreover, both are freshwater
fish, and the complete dietary requirement of all
essential amino acids is known for Nile tilapia (NRC,
2011). Santiago & Lovell (1988) described the dietary
sulfur amino acid requirement of 0.90% for fingerlings
of Nile tilapia fed purified diet, which included 0.75%
of methionine and 0.25% of cysteine. However, Furuya
et al. (2004b) suggested the requirement of 1.13%
sulfur amino acids, including 0.54% of methionine. The
proportion of methionine was higher in relation to
cysteine (0.83:0.17) in the purified diets used by Santiago
892
5
Figure 2. Linear correlation between Nile tilapia Oreochromis niloticus and colliroja Astyanax fasciatus whole body amino
acid profile determined on the basis of the ideal protein concept (EEA/L × 100), considering the essential amino acids
(EAAs) to lysine (L) ratios. Arg: arginine, His: histidine, Ile: Isoleucine, Leu: leucine, Met: methionine, Met+Cys:
methionine+cysteine, Phe: phenylalanine, Phe+Tyr: phenylalanine+tyrosine, Thr: treonine, Trp: triptophan, and Val: valine.
Table 3. Dietary quantitative essential amino acid requirement (including cysteine and tyrosine) of colliroja
Astyanax fasciatus considering the diets containing
different levels of crude protein (as feed basis).
Amino acid
Lysine
Arginine
Histidine
Isoleucine
Leucine
Methionine
Phenylalanine
Phenylalanine + tyrosine
Threonine
Tryptophan
Valine
Dietary amino acid profile
(% dietary protein)
5.46
4.62
1.16
3.28
5.63
2.01
2.59
2.84
4.66
3.39
0.65
3.51
& Lovell (1988), whereas Teixeira et al. (2008)
revealed a methionine to cysteine ratio of 0.75:0.25 for
Nile tilapia by analyzing the body composition. There
is a discrepancy in these ratios because food used for
the preparation of commercial diets for fish and other
aquatic organisms possess higher proportions of
cysteine relative to methionine, unlike that in purified
casein, which is the main protein source used in fish
nutrition dose-response studies.
Adequate dietary methionine supplementation is
necessary for the maximum growth and health of fish.
Methionine plays a role in protein synthesis and is
important for physiological functions. Further, it is
essential for normal growth of fish and is a donor of
methyl groups required for methylation reactions via
S-adenosylmethionine (Bender, 2003). S-adenosylmethionine is synthesized from methionine, which is then
catalyzed by adenosyl triphosphate cyclase, allowing
methyl group donation to various substrates, including
nucleic acids, proteins, phospholipids, and biogenic
amines. The S-adenosyl methionine generates
compounds such as carnitine (Wu, 2013), cysteine, and
choline (Kasper et al., 2000), which are important
compounds required for the metabolism of lipids and
affect the growth performance and lipid deposition of
Nile tilapia (Graciano et al., 2010).
The complete quantitative essential amino acid
requirements have been established for only a few fish
species (NRC, 2011), and determining the amino acid
requirements of the new aquacultural species colliroja
is of economic importance. Dose-response experiments
require large numbers of feeding trials to determine
individual essential amino acid profiles. In addition,
these trials are time-consuming and very costly. As a
practical alternative, whole body essential amino acid
profile has been extensively used to estimate
simultaneously the requirements for all essential amino
acids. This technique was used in the present study by
considering that dietary amino acid profile is close to
the pattern in the muscle tissues of fish (Mitchell, 1950;
Fuller et al., 1989). However, the whole body amino
acid composition varies across fish species (Bicudo et
al., 2009). To date, Taşbozan et al. (2013) found large
variations among whole body amino acid profiles of
five different Tilapia species. Thus, estimating the
dietary amino acid requirements for each fish species is
6893
important for precisely formulating aquafeeds.
However, the quantitative dietary requirement of fish is
more precisely obtained by dose-response experiments
compared to estimates from whole body amino acid
profiles (NRC, 2011). Nonetheless, comparison of
profiles obtained using the two methods in colliroja and
Nile tilapia revealed that there is not much difference in
the estimated values. In conclusion, the whole body
composition of amino acids might be used to estimate
the dietary requirements of essential amino acids,
including cysteine and tyrosine, for new aquaculture
fish species such as colliroja.
tilápia-do-nilo alimentados com dietas suplementadas
com metionina e colina. Pesq. Agropec. Bras., 45: 737743.
Gurure, R., J. Atkinson & R.D. Moccia. 2007. Amino acid
composition of Arctic charr, Salvelinus alpinus (L.)
and the prediction of dietary requirements for essential
amino acids. Aquacult. Nutr., 13: 266-272.
Jarmolowics, S. & Z. Zakęś. 2014. Amino acid profile in
juvenile pikeperch (Sander lucioperca (L.) impact of
supplementing feed with yeast extract. Arch. Pol.
Fish., 22: 135-143.
ACKNOWLEDGMENTS
Kasper, C.S., M.R. White & P.B. Brown. 2000. Choline is
required by tilapia when methionine is not in excess. J.
Nutr., 130: 238-242.
We are grateful to Ajinomoto do Brasil Indústria e
Comércio de Alimentos Ltda. - Animal Nutrition
Division, for performing the amino acid analysis.
Kaushik, S.M. & I. Seiliez. 2010. Protein and amino acid
nutrition and metabolism in fish: current knowledge
and future needs. Aquacult. Res., 41: 322-332.
REFERENCES
Abimorad, E.G. & D. Castellani. 2011. Exigências nutricionais de aminoácidos para o lambari-do-raboamarelo baseadas na composição da carcaça e do
músculo. Bol. Inst. Pesca, 37: 31-38.
Association of the Official Methods of Analysis (AOAC).
2003. Official Methods of Analysis, Association of
Official Analytical Chemists, Washington, D.C., 1115
pp.
Bender, D.A. 2003. Nutritional biochemistry of the
vitamins. Cambridge University Press, Cambridge,
488 pp.
Bicudo, A.J. de. 2009. Estimating amino acid requirement
of Brazilian freshwater fish from muscle amino acid
profile. J. World Aquacult. Soc., 40: 818-823.
Fuller, M.F., R. McWilliam, T.C. Wang & L.R. Giles.
1989. The optimum amino acid amino for growing pig.
2. Requirement for maintenance and for tissue
protection accretion. Brit. J. Nutr., 62: 255-261.
Furuya, W.M., L.E. Pezzato, M.M. Barros, A.C. Pezzato,
V.R.B. Furuya & E.C. Miranda. 2004a. Use of ideal
protein concept for precision formulation of amino
acid levels in fish-meal-free diets for juvenile Nile
tilapia (Oreochromis niloticus L.). Aquacult. Res., 3:
1110-1116.
Furuya, W.M., L.C.R. Silva, P.R. Neves, D. Botaro, C.
Hayashi, E.S. Sakaguti & V.R.B. Furuya. 2004b.
Exigências de metionina + cistina para alevinos de
tilápia-do-Nilo (Oreochromis niloticus). Ciênc. Rural,
34: 1933-1937.
Graciano, T.S., M.R.M. Natali, L.V.O. Vidal, M.
Michelato, J.S. Righetti & W.M. Furuya. 2010.
Desempenho e morfologia hepática de juvenis de
Mitchell, H.H. 1950. Some species and age differences in
amino acid requirements. In: A.A. Albanese (ed.).
Protein and amino acid requirements of mammals,
Academic Press, New York, pp. 1-32.
Namulawa, V.T., J. Rutaisire & P.J. Britz. 2012. Whole
body and egg amino acid composition of Nile perch,
Lates niloticus (Linnaeus, 1758) and prediction of its
dietary essential amino acid requirements. Afr. J.
Biotechnol., 11: 16615-16624.
National Research Council (NRC). 2011. Nutrient
requirements of fish and shrimp. National Academy
Press, Washington DC, 376 pp.
Portz, L. & J.E.P. Cyrino. 2003. Comparison of the amino
acid contents of roe, whole body and muscle tissue and
their A/E ratios for largemouth bass Micropterus
salmoides (Lacépède, 1802). Aquacult. Res., 34: 585592.
Santiago, C.B. & R.T. Lovell. 1988. Amino acid requirements for growth of Nile tilapia. J. Nutr., 118: 15401546.
Tacon, A.J. 1989. Nutrición y alimentación de peces y
camarones cultivados. FAO, Brasília, 572 pp.
Taşbozan, O., O. Özcan, C. Erbaş, E. Ündağ, A. Atici &
A. Adakli. 2013. Determination of proximate and
amino acid composition of five different Tilapia
Species from the Cukurova Region (Turkey). J. Appl.
Biol. Sci., 7: 17-22.
Teixeira, E.A., D.V. Crepaldi, P.M.C. Faria, L.P. Ribeiro,
D.C. de Melo & A.C.C. Euler. 2008. Composição
corporal e exigências nutricionais de aminoácidos para
alevinos de tilápia (Oreochromis sp.). Rev. Bras.
Saúde Prod. Anim., 9: 239-246.
Wilson, R. & E.W.E. Poe. 1985. Relationship of whole and
egg essential amino acid patterns to amino acid
requirement patterns in channel catfish (Ictalurus
punctatus). Comp. Biochem. Physiol. B, 80: 385-388.
Wu, G. 2013. Amino acids: biochemistry and nutrition.
CRC Press, Boca Raton, 481 pp.
Received: 6 August 2014; Accepted: 17 August 2015
8947
Lat. Am. J. Aquat. Res., 43(5): 895-903, 2015Dimorphism on the marine catfish Genidens genidens
Research Article
Biometric sexual and ontogenetic dimorphism on the marine catfish
Genidens genidens (Siluriformes, Ariidae) in a tropical estuary
Larissa G. Paiva1, Luana Prestrelo1,2, Kiani M. Sant’Anna1 & Marcelo Vianna1
Laboratório de Biologia e Tecnologia Pesqueira, Instituto de Biologia, Universidade Federal
do Rio de Janeiro, Av. Carlos Chagas Filho 373 Bl. A, 21941-902 Rio de Janeiro, RJ, Brazil
2
Fundação Instituto de Pesca do Estado do Rio de Janeiro, Escritório Regional Norte Fluminense II
Avenida Rui Barbosa 1725, salas 57/58, Alto dos Cajueiros, Macaé, RJ, Brazil
1
Corresponding author: Larissa G. Paiva ([email protected])
ABSTRACT. This paper aims to study the ontogenetic sexual dimorphism of Genidens genidens in Guanabara
Bay, southeastern coast of Brazil. Altogether 378 specimens were anayzed (233 females and 145 males) with
total length ranging from 13.3 to 43.5 cm. Specimens were measured for 12 body measurements, sex was
identified and maturity stages were recorded and classified. Pearson’s linear correlation reveled a significant
positive correlation between total length and all other body measures, except for base adipose fin, mouth depth
and eye depth for immature females. Analyses nested PERMANOVA desing showed significant differences
between maturity stages for each sex, between sexes considering or not maturity stages, indicating a variation
in morphometric characteristics driven by sexual dimorphism. Differences among all maturity stages were also
found, indicating an ontogenetic morphological difference. But immature individuals didn’t differ between sexes
indicating that differentiation patterns starts with sexual development. The most important measures differing
males and females were related to head characteristics, which appears to be key parameters to evaluate sexual
differences. Due to male incubation of fertilized eggs and juvenile individuals <59 mm in their oral cavity, head
measures are proposed to be sex dimorphism not related to reproduction, but with post reproductive fase due to
ecological and biological needs.
Keywords: Genidens genidens, catfish, Teleostei, morphometry, biometry, dimorphism, tropical estuary.
Biometría sexual y dimorfismo ontogenético en el bagre marino Genidens genidens
(Siluriformes, Ariidae), en un estuario tropical
RESUMEN. Se analizó el dimorfismo sexual y ontogenético del bagre marino Genidens genidens en la Baía de
Guanabara, costa sureste de Brasil. Se capturó un total de 378 ejemplares (233 hembras y 145 machos) con
longitud total entre 13,3 y 43,5 cm. Se realizaron 12 medidas morfométricas, además de identificar el sexo y los
estadios de madurez de los individuos. La correlación lineal de Pearson reveló correlación positiva significativa
entre la longitud total y otras medidas corporales excepto la base de la aleta adiposa, altura de la boca y altura
de los ojos en hembras inmaduras. Los análisis de PERMANOVA anidados mostraron diferencias significativas
entre los estados de madurez de cada sexo, entre los sexos, considerando o no, los estados de madurez, lo que
indica una variación en las características morfométricas reguladas por el dimorfismo sexual. También se
encontraron diferencias entre los estadios de madurez, lo que indica una diferencia ontogenética para el sexo y
estadios de madurez. Los individuos inmaduros no difirieron entre los sexos, indicando que los patrones de
diferenciación se inician sólo con el desarrollo sexual. Las medidas más importantes que difieren entre machos
y hembras se relacionaron con las características de la cabeza que, al parecer, serían los principales parámetros
para evaluar las diferencias sexuales. Debido a que los machos realizan la incubación en su cavidade oral de los
huevos fertilizados y de individuos juveniles <59 mm, se sugiere que las medidas de la cabeza corresponden a
un dimorfismo sexual no relacionado con la reproducción, pero vinculado a una fase post-reproductiva debido
a sus necesidades ecológicas y biológicas.
Palabras clave: Genidens genidens, bagre, Teleostei, morfometría, biometría, dimorfismo, estuario tropical.
__________________
Corresponding editor: Guido Plaza
895
896
INTRODUCTION
It is well known that morphology is directly related to
species life history and habitat use. Thus fish
morphometric analysis represents an important tool to
determine their systematic, growth variation, population
parameters and environmental relationships (Kováč et
al., 1999; Pathak et al., 2013; Sampaio et al., 2013;
Souza et al., 2014). Morphometry cover several study
fields such as: ecomorphology, relating species
morphology with environment characteristics and
evaluating the role of environmental preasures on
shaping species diet, feeding behavior, ecological
strategies, niche partitioning, habitat use and trophic
structure (Peres-Neto, 1999; Haas, 2010; Manimegalai
et al., 2010; Palmeira & Monteiro-Neto, 2010; Souza et
al., 2014) population ecology and metapopulations
studies, investigating differences in body shape among
populations spatially isolated (Gunawickrama, 2007;
Mwanja, 2011; Santos & Quilang, 2012; Sampaio et
al., 2013; Souza et al., 2014) and taxonomy, to differ
and describe species and taxonomic groups based on
internal and external features, which can result in
misidentification if the individual is of diferent life
stage than the ones used for classification (Marceniuk,
2005a, 2005b). However, intraspecific characteristics
are often forgotten in studies investigating species
morphological diversity, mainly in taxonomic studies.
When this occurs, males and females of the same
species may be identified as different species, therefore
information about morphological sexual variation is
important to avoid species misleading identification
(Rapp Py-Daniel & Cox-Fernandes, 2005; Marceniuk,
2007).
Sexual dimorphism can be an important evolutionay
adaptation mechanism, conditioning sexual selection
and diminishing intraspecific competition by
encreasing nich partioning (Hedrick & Temeles, 1989;
Herler et al., 2010), being an important study fill
whithin morphometric research. An organism must
function properly in all life stages and function and
form are strictly related (Galis et al., 1994). Ontogenetic changes can determinate the success of an
individual due to the importance of morphological
features, environment adaptation and reproductive
selection. Thus clarify how morphological changes
develop throughout individuals growth is important to
establish the relationship between morphology and
behaviour, elucidating possible ontogenetic nich shifts
and the evolutionary plasticity of an organism (Galis et
al., 1994).
Marine catfish of the genus Genidens (Siluriformes,
Ariidae) are endemic of South Atlantic coasts and are
commercially important estuarine fishes in Brazil
(Mendoza-Carranza & Vieira, 2009; Silva-Junior et al.,
2013). Due to Ariidae benthic habits and broad diet,
they have good potential for biomonitoring studies
(Azevedo et al., 2012). Furthermore studies with
Genidens genidens (Curvier, 1829) in Guanabara Bay
and Santos-São Vicente estuary suggested that they
should be used as estuarine sentinels, due to their
tolerance to eutrophication and others anthropogenic
changes (Azevedo et al., 2012; Silva-Junior et al.,
2013). In Guanabara Bay, a Brazilian tropical estuary,
G. genidens is one of the most abundant species,
occupying shallow waters with low salinity and low
water transparency (Rodrigues et al., 2007; SilvaJunior et al., 2013). Guanabara Bay has great economic
and social importance due to fishing and navigation
activities, industrial surrounding areas and ecological
relevance due its importance for many marine and
freshwater lifecycle (Vasconcelos et al., 2010). Despite
their ecological importance G. genidens’s morphological sexual and ontogenetic variations are little
known. This paper is the first study aiming to evaluate
G. genidens’s morphological changes between sexes
and through ontogenetic development. It will provide
more detailed biometric information on the species
which could assist further studies on its biology and
ecology.
Guanabara Bay is located in Rio de Janeiro State,
southeastern Brazil (22°40’S, 43°02’W) (Fig. 1). It has
an area of 384 km², 7.6 m of mean depth and has an
average water residence time of 20 ± 5 days. It is an
estuarine environment with minimum salinity of 25 and
maximum of 34.5, low hydrodynamics, small grain size
bottom and great influence of freshwater runoff and
domestic sewage resolting in a major eutrophicated
system (Kjerfve et al., 1997; Quaresma et al., 2000).
Specimens of G. genidens (voucher MNRJ 42040)
were collected, twice a month, from August 2010 to
September 2011. Samples were collected covering the
three most important local fisheries (gill net, bottom
trawl and stationary pound net) and all Guanabara Bay
habitat zones. All specimens were cooled on ice and
then measured for 11 body measures (by convention,
always on the left side) using a ichtyometer and a
electronic caliper rul with precision of 0.01 mm,
without being fixed, according to metric measures
proposed by Marceniuk (2005a) and Souza & Barrella
(2009) (Fig. 2) (Table 1). Measures were standardized
as a percentage of total length (TL), excluding total
length’s effect on body measures. The determination of
sex and sexual maturity stages were made by gonads
macroscopic observation through an adaptation of
Dimorphism on the marine catfish Genidens genidens
897
RESULTS
Figure 1. Study location highlighting Guanabara Bay in
Rio de Janeiro state, southeastern coast, Brazil.
A total of 378 specimens were captured, 233 females
(immature (A) = 9, in maturation process (B) = 68,
mature (C+D) = 156) and 145 males (immature (A) =
27, in maturation process (B) = 53, mature (C+D) = 65).
Total length ranged from 13.3 to 43.5 cm (Fig. 3).
Morphometric features and Pearson’s linear
correlations are presented in Table 2. Body measures
were significant correlated with total length (TL),
except for base adipose fin (AF), mouth depth (MD)
and eye depth (ED) of immature females (Table 2).
Morphometric measures showed significant differences
for maturity stages within sex, sex within maturity
stages and between sexes, but not for maturity stages
alone (Table 3a), indicating a possible alteration in
morphometric characteristics driven by sexual dimorphism along with maturation process. The post-hoc test
showed a significant difference between sexes for all
maturity stages except A, indicating that imamture
individuals did not have morphological differences and
the differentiation only starts at the beginning of sexual
development (Table 3b). SIMPER analysis indicated
maximum body depth (BD), upper caudal fin lobe
length (CL), head length (HL), barbeus length (BL),
interorbital distance (ID) and mouth depth (MD) as the
six most important metric measurements descrimitating
females from males and the group A from B and C+D.
DISCUSSION
Vazzoler (1996): A = immature, B = in maturation
process, C+D = mature.
The degree of association between G. genidens size
and body proportions, within sex and maturity stages
were tested with Pearson’s linear correlation analyses
using Statistica 8 software, with the significance level
of 0.05.
A multivariate nested PERMANOVA design was
used to evaluate differences in maturity stages within
each sex [maturity (sex)] (ontogenetic differences) and
between sexes within maturity stages [sex (maturity)]
(sexual dimorphism). A pair-wise post-hoc test was
performed to further investigate differences between
groups. This test uses an ANOVA experimental design
on the basis of any distance measure, using Monte
Carlo permutation method (Anderson, 2005) and
provides which factor was most important for data
differences. A pair-wise post-hoc test was performed to
analyze differences among male and female maturity
stages. SIMPER analysis was performed to evaluate
witch metric measurements were most important for
determining group dissimilarity. These analyses were
performed using Primer 6 + PERMANOVA software
(Clarke & Gorley, 2006).
The present study evaluated morphological onthogenetic changes in Genidens genidens and found a well
defined sexual dimophism reveled through changes in
head measures. Those differences are related to the
maturity process responsible for differing male from
female individuls due to their reproductive role. Sexual
dimorphism may be an evolutionary adaptative mechanism favouring sexual selection, acting on males when
females for choosing partners for mating and in mate
competition, enhancing selection towards certain male
traits (Hedrick & Temeles, 1989). When compered with
other vertebrates, teleosts have a wide range of sexual
dimorphism described, including color, size, shape and
feeding mechanisms (Kitano et al., 2007; Herler et al.,
2010; Mcgee & Wainwright, 2013). For G. genidens
sexual dimorphism has been observed in pelvic fins,
that are higher in females compared to males (Barbieri
et al., 1992), but it had never been evaluated to
ontogenetic variations along with sexual changes until
this study.
Ontogenetic differences have been described by
most studies based on morphology but they are often
898
Figure 2. Body measures used to characterize Genidens genidens’s biometrics. TL: total length, AF: base adipose fin,
CF: base caudal fin, BL: barbeus length, HL: head length, CL: upper caudal fin lobe length, ID: interorbital distance,
BD: maximum body depth, ED: eye depth, BW: mouth width, MD: mouth depth. This image is a modification of Figueiredo
& Menezes (1978).
Table 1. Description of body measures used to characterize Genidens genidens’s biometrics.
Measurements
Code
Description
Total length
Base adipose fin
Base caudal fin
Barbeus length
Head length
Upper caudal fin lobe length
Interorbital distance
Maximum body depth
Eye depth
Maximum body width
Mouth width
Mouth depth
TL
AF
CF
BL
HL
CL
ID
BD
ED
BW
MW
MD
Greater distance between the tip of the snout and caudal fin.
Distance between the beginning and end of adipose fin.
Height of the top of the caudal fin.
Distance between the base and the end of the longest barbel.
Distance from the tip of the snout to the end of the operculum.
Distance between the base of the caudal fin and the tip of the upper lobe of the caudal fin.
Distance between the eyes taken from the upper portion.
The longest distance between the belly and back perpendicular to the body axis.
Taken away the eyes of the height of the iris to the womb.
Largest body width.
Internal distance from the mouth when fully open.
Greater distance between the measured lips with mouth open, stretch the muscles without.
related to feeding habits and habitat use (Zimmerman
et al., 2009; Lima et al., 2012) and not to diffenreces
between sex. We observed differences between male
and female in head measures (BD, CL, HL, BL, ID,
MD), which we suggest to be the key parameters to
evaluate sexual dimorphism in this species. Head
measures where bigger in male than female probably
due to their different roles on the reproductive process,
since marine catfish have parental care where male
incubates fertilized eggs and larvae in their mouth
(Velasco et al., 2006; Silva-Junior et al., 2013). We
know that G. genidens, beyond fertilized eggs, the
incubators males may present in their oropharyngeal
cavity larvae up to 59 mm (Chaves, 1994). Changes in
head measures also have been observed in fish species,
related with oral incubation behavior. Herler et al. (2010),
Figure 3. Frequency distribution of total length, of
Genidens genidens, for female and male, in Guanabara
Bay, Rio de Janeiro, Brazil.
899
Table 2. Morphometric characteristics, of Genidens genidens, and Pearson’s linear correlation (r), for the associations
between total lenght and body proportions, within sex and maturity stages. Range: minimum and maximum values; 𝑥̅ =
mean values (± standard deviation). *P < 0.05. **P < 0.001.
Parameters
Sex
Female
Total length (TL)
Male
Female
Base adipose Fin (AF)
Male
Female
Base caudal Fin (CF)
Male
Female
Barbeus length (BL)
Male
Female
Head length (HL)
Male
Female
Upper caudal fin lobe length (CL)
Male
Female
Interorbital distance (ID)
Male
Female
Maximum body depth (BD)
Male
Maturity stage
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
Range (cm)
14.1 - 18.9
14.1 - 41.4
16.4 - 43.5
13.3 - 24.9
16.1 - 33.4
17.5 - 38.6
0.8 - 1.1
0.9 - 3.2
0.6 - 3.4
0.7 - 1.7
1.0 - 4.8
0.6 - 2.9
1.3 - 1.8
0.9 - 4.5
0.7 - 6.1
1.0 - 2.5
1.4 - 4.5
1.8 - 6.2
2.5 - 3.8
2.8 - 7.7
3.2 - 7.9
1.6 - 4.6
3.2 - 6.3
3.0 - 7.9
2.8 - 3.8
2.6 - 8.3
2.3 - 9.4
2.6 - 5.8
2.5 - 7.5
2.7 - 9.1
3.1 - 3.8
2.8 - 8.3
2.2 - 8.3
2.6 - 4.5
1.6 - 6.5
3.3 - 7.5
0.9 - 1.6
0.9 - 4.1
1.1 - 4.4
0.8 - 2.1
1.1 - 3.5
1.2 - 4.0
2.3 - 3.2
1.8 - 7.1
1.4 - 7.0
1.5 - 3.8
2.4 -6.3
2.4 - 6.3
𝑥̅ (± SD)
15.7 (± 1.5)
26.3 (± 6.9)
26.4 (± 4.1)
18.4 (± 2.9)
23.0 (± 4.1)
25.9 (± 5.1)
1.0 (± 0.1)
1.8 (± 0.6)
1.8 (± 0.4)
1.3 (± 0.3)
1.7 (± 0.5)
1.8 (± 0.5)
1.5 (± 0.2)
2.6 (± 0.8)
2.6 (± 0.6)
1.8 (± 0.3)
2.3 (± 0.6)
2.6 (± 0.7)
3.1 (± 0.4)
4.8 (±1.2)
4.8 (± 0.8)
3.5 (± 0.6)
4.4 (± 0.8)
4.7 (± 1.0)
3.1 (± 0.3)
5.3 (± 1.5)
5.4 (± 1.0 )
3.6 (± 0.8)
4.9 (± 1.1)
5.7 (± 1.4)
3.3 (± 0.2)
5.2 (± 1.4)
5.3 (± 1.0)
3.6 (± 0.5)
4.4 (± 1.1)
5.1 (± 1.1)
1.2 (± 0.2)
2.2 (± 0.8)
2.2 (± 0.5)
1.4 (± 0.4)
2.0 (± 0.5)
2.4 (± 0.7)
2.5 (± 0.3)
4.1 (± 1.2)
4.1 (± 0.7)
2.7 (± 0.6)
3.5 (± 0.8)
4.0 (± 0.9)
r
-
0.5
0.9**
0.8**
0.9**
0.7**
0.8**
0.9**
0.9**
0.9**
0.8**
0.6**
0.8**
0.7*
0.9**
0.9**
0.9**
0.9**
0.9**
0.9**
1.0**
0.9**
0.8**
0.7**
0.9**
0.9*
0.9**
0.8**
0.9**
0.8**
0.9**
0.9*
1.0**
0.9**
0.9**
0.9**
0.9**
0.9**
0.9*
0.8**
0.9**
0.9**
0.9**
900
Continuation
Parameters
Sex
Female
Mouth depth (MD)
Male
Female
Eye depth (ED)
Male
Female
Maximum body width (BW)
Male
Female
Mouth width (MW)
Male
investigated the sexual dimorphism in populations of
the cichlid genus Tropheus, oral incubators fishes, in
Lake Tanganyika, in Africa, and found significant
differences in mean shape between sexes among the
seven populations analyzed related to oral landmarks
with larger head length and ventral area (buccal region)
in females (the oral breeders). Barnett & Bellwood
(2005) investigated the sexual dimorphism in seven fish
species with incubation behaviour of eggs and larvae in
the oral cavity, in Lizard Island, and observed that
males had bigger oral volumes than females in five of
them.
For some fishes, clear morphometric differences
between sexes appear only in certain gonadal stages in
specific body measurements, as observed in this study.
Manimegalai et al. (2010) studied the ciclhid Etroplus
maculates in India and observed significant correlation
between body length growth and morphometric measure
and suggested that body measures increases as a
function of total growth. Kitano et al. (2007) studied
Gasterosteus aculeatus (Gasterosteidae) and also
observed sexual dimorphism only after the fish became
reproductively mature. Lima et al. (2012) studied the
development and allometric growth patterns of the
Ariidae catfishes Cathorops spixii and C. agassizii and
observed that after hatching, mouth-breeded free
embryos of both species grow isometric in all body
Maturity stage
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
A
B
C+D
Range (cm)
0.8 - 1.3
0.8 - 3.1
1.0 - 3.5
0.6 - 1.9
0.9 - 3.0
1.0 - 2.9
0.6 - 1.3
0.5 - 2.0
0.5 - 2.3
0.3 - 1.2
0.5 - 2.2
0.6 - 1.9
1.9 - 3.0
2.2 - 6.4
2.0 - 6.6
2.0 - 4.1
2.5 - 5.6
2.8 - 6.6
0.9 - 1.3
0.9 - 4.1
1.2 - 4.1
0.8 - 2.1
1.0 - 2.9
1.4 - 4.0
𝑥̅ (± SD)
1.0 (± 0.2)
1.8 (± 0.5)
1.7 (± 0.4)
1.3 (± 0.3)
1.6 (± 0.4)
1.8 (± 0.5)
0.8 (± 0.4)
1.1 (± 0.4)
1.0 (± 0.3)
0.7 (± 0.2)
0.9 (± 0.3)
1.0 (± 0.3)
2.4 (± 0.3)
4.1 (± 1.1)
4.2 (± 0.7)
2.9 (± 0.5)
3.6 (± 0.7)
4.2 (± 0.9)
1.1 (± 0.1)
2.1 (± 0.8)
2.1 (± 0.5)
1.3 (± 0.3)
1.8 (± 0.4)
2.2 (± 0.6)
r
0.5
0.9**
0.7**
0.5*
0.5**
0.8**
0.2
0.8**
0.8**
0.6*
0.7**
0.8**
0.9**
0.9**
0.9**
0.9**
0.7**
0.9**
0.8*
0.9**
0.9**
0.9**
0.9**
0.9**
regions, suggesting that they already bear most of
characteristics of adult fish. They suggested that the
quick growth of morphometric features related to
sensorial organs before hatching, reflect the
developmental priorities during the earliest stages when
important sensorial organs are being developed for
juvenile survival strategies. Our study suggests that the
priorities in development of specific body features of
G. genidens returns when it reaches maturity and the
proportional development of body measures and
individual growth can occur differently between male
and female especially due different reproduction roles
between sexes. Thus when sexual maturity starts males
concentrate their growth in head features increasing
breeding capacity and reproduction success while
female maintain their normal growth.
Our study showed the importance of considering
ontogenetic changes related to sex in G. genidens since
changes in morphological measures observed around
the mouth region is a feature related to male’s mouth
breeding behavior during reproductive period. Thus the
observations made in the present study related to
changes in morphometric characteristics in male G.
genidens are important to assist future studies about
species biology and morphology. Moreover our study
also highlight that the same ontogenetic changes may
occur with other Ariidae species due to the family’s
Table 3. a) Nested PERMANOVA results, df: degrees of
freedom, F: test value, P (MC): Monte Carlo asymptotic
P-values. Significance level 95% (P < 0.05), b) Post-hoc
pair-wise test between male and female for each maturity
stage.
a)
Source of variation
Sex
Maturity
Maturity (sex)
Sex (maturity)
b)
Maturity Stages
A
B
C
df
1
3
6
4
F
2.94
0.98
3.10
3.96
P (MC)
0.00
0.51
0.00
0.00
t
0.97
2.06
3.70
P (MC)
0.46
0.00
0.00
similar reproductive behavior (Figueiredo & Menezes,
1978), thus further studies should be develop aiming to
elucidate this pattern which can be essential for a better
understanding of the biology, behaviour and life history
of those species as well as to determine differences
between populations (Kitano et al., 2007).
Marceniuk (2005a, 2005b) discribed Ariidae
species of Brazilian coast based on morphological
characteristics but didn’t observed sexual variations to
differenciate species groups. Those studies considered
morphological characteristics, neurocranium patterns
and vomero-palatine tooth patches. Despite the sex and
ontogenetic variation observed in our study for G.
genidens, Marceniuk’s works are important identification guides for Ariidae family since they are based on
other body characteristics besides morphometric
measures.
Morphometric estimates differ in degree of
precision due to variation in fixation and storage
methods and sometimes body structures are injured,
making accurate measurements difficult. Nevertheless,
due to the importance of these structures for
reproduction, we assume that this bias is minimal. The
parameters obtained here are realistic and our analysis
showed an important role of head measurements in sex
dependent ontogenetic differentiation driven by species
behavior. We suggest that these measurements are
secondary sexual characters not directly related to
reproduction.
ACKNOWLEDGEMENTS
To all directly or indirectly involved in this study,
especially to colleagues of the Laboratory of Fishery
Biology and Technology for their assistance in
901
collecting and biometrics, the fishermen who supplied
fish for the study, the Long Term Ecological Program CNPq (PELD program, process 403809/2012-6) and
FAPERJ (Thematic Programme, process E-26/110.
114/2013).
REFERENCES
Anderson, M.J. 2005. Permanova: a Fortran computer
program for permutational multivariate analysis of
variance. Department of Statistics, University of
Auckland, Auckland, 24 pp.
Azevedo, J.S., J.E.S. Sarkis, M.A. Hortellani & R.J. Ladle.
2012. Are catfish (Ariidae) effective bioindicators for
Pb, Cd, Hg, Cu and Zn? Water Air Soil Pollut., 223(7):
3911-3922.
Barbieri, L.R., R.P. Santos & J.V. Andreata. 1992.
Reproductive biology of the marine catfish, Genidens
genidens (Siluriformes, Ariidae), in the Jacarepaguá
Lagoon system, Rio de Janeiro, Brazil. Environ. Biol.
Fish., 35(1): 23-35.
Barnett, A. & D.R. Bellwood. 2005. Sexual dimorphism
in the buccal cavity of paternal mouthbrooding
cardinalfishes (Pisces: Apogonidae). Mar. Biol., 148:
205-212.
Chaves, P.T.C. 1994. Eggs and larvae mouthbreeding in
Genidens genidens (Valenciennes) (Siluriformes,
Ariidae) from Guaratuba Bay, Paraná, Brazil. Rev.
Bras. Zool., 11(4): 641-648.
Clarke, K.R. & R.N. Gorley. 2006. Primer v6: user
manual/tutorial. Plymouth, Plymouth Marine Laboratory, 190 pp.
Figueiredo, J.L. & N.A. Menezes. 1978. Manual de peixes
marinhos do sudeste do Brasil. Teleostei (1). MZUSP,
São Paulo, 113 pp.
Galis, F., A. Terlouw & J.W.M. Osse. 1994. The relation
between morphology and behaviour during ontogenetic and evolutionary changes. J. Fish Biol., 45(A):
13-26.
Gunawickrama, K.B.S. 2007. Morphological heterogeneity in some estuarine populations of the catfish Arius
jella (Ariidae) in Sri Lanka. Ceylon J. Sci. Biol. Sci.,
36(2): 101-108.
Haas, T.C., M.J. Blum & D.C. Heins. 2010. Morphological response of a stream fish to water
impoundment. Biol. Lett., 6: 803-806.
Hedrick, A.V. & E.J. Temeles. 1989. The evolution of
sexual dimorphism in animals: hypotheses and tests.
Trends Ecol. Evol., 4(5): 136-138.
Herler, J., M. Kerschbaumer, P. Mitteroecker, L. Postl &
C. Sturmbauer. 2010. Sexual dimorphism and
population divergence in the lake Tanganyika cichlid
fish genus Tropheus. Front. Zool., 7: 4.
902
Kitano, J., S. Mori & C.L. Peichel. 2007. Sexual
dimorphism in the external morphology of the
threespine stickleback (Gasterosteus aculeatus).
Copeia, 2007(2): 336-349.
Kjerfve, B., C.H.A. Ribeiro, G.T. Dias, A.M. Filippo &
V.S. Quaresma. 1997. Oceanographic characteristics
of an impacted coastal bay: Baía de Guanabara, Rio de
Janeiro, Brazil. Cont. Shelf Res., 17(13): 1609-1643.
Kováč, V., G.H. Copp & M.P. Francis. 1999.
Morphometry of the stone loach, Barbatula barbatula:
do mensural characters reflect the species life history
thresholds? Environ. Biol. Fish., 56(1-2):105-115.
Lima, A.R.A., M. Barletta, D.V. Dantas, F.E. Possato,
J.A.A. Ramos & M.F. Costa. 2012. Early development
and allometric shifts during the ontogeny of a marine
catfish (Cathorops spixii-Ariidae). J. Appl. Ichthyol.,
28(2012): 217-225.
Manimegalai, M., S. Karthikeyeni, S. Vasanth, S. ArulGanesh, T. Siva-Vijayakumar & P. Subramanian.
2010. Morphometric analysis - A tool to identify the
differents in a fish species E. maculatus. Int. J.
Environ. Sci., 1(4): 52-56.
Marceniuk, A.P & N.A. Menezes. 2007. Systematics of
the family Ariidae (Ostariophysi, Siluriformes), with a
redefinition of the genera. Zootaxa, 1416: 3-126.
Marceniuk, A.P. 2005a. Redescrição de Genidens barbus
(Lacépède, 1803) e Genidens machadoi (MirandaRibeiro, 1918), Bagres marinhos (Siluriformes,
Ariidae) do Atlântico Sul Occidental. Pap. Avulsos
Zool., 45(11): 111-125.
Marceniuk, A.P. 2005b. Key for identification of the sea
catfishes species (Siluriformes, Ariidae) of the
Brazilian coast. Bol. Inst. Pesca, São Paulo, 31(2): 89101.
Mcgee, M.D. & P.C. Wainwright. 2013. Sexual
dimorphism in the feeding mechanism of threespine
stickleback. J. Exp. Biol., 216: 835-840.
Mendoza-Carranza, M. & J.P. Vieira. 2009. Ontogenetic
niche feeding partitioning in juvenile of white sea
catfish Genidens barbus in estuarine environments,
southern Brazil. J. Mar. Biol. Assoc. U.K., 89(4): 839848.
Mwanja, M.T., V. Muwanika, S. Nyakaana, C. Masembe,
D. Mbabazi, R. Justus & W.W. Mwanja. 2001.
Population morphological variation of the Nile perch
(Lates niloticus, L. 1758), of East African lakes and
their associated waters. Afr. J. Environ. Sci. Technol.,
5(11): 941-949.
Palmeira, L.P. & C. Monteiro-Neto. 2010. Ecomorphology and food habits of teleost fishes Trachinotus
carolinus (Teleostei: Carangidae) and Menticirrhus
littoralis (Teleostei: Sciaenidae), inhabiting the surf
zone off Niterói, Rio de Janeiro, Brazil. Braz. J.
Oceanogr., 58(4): 1-9.
Pathak, N.B., A.N. Parikh & P.C. Mankodi. 2013.
Morphometric analysis of fish population from two
different ponds of vadodara city, Gujarat, India. J.
Anim. Veter. Fish. Sci., 1(6): 6-9.
Peres-Neto, P.R. 1999. Alguns métodos e estudos em
ecomorfologia de peixes de riachos. Oecol. Bras., 6:
209-236.
Quaresma, V.S., G.T.M. Dias & J.A. Baptista. 2000.
Characterization of side-scan sonar and high
resolution seismic (3.5-7.0 kHZ) reflection patterns
along the southern margin of the Guanabara Bay-RJ.
Rev. Bras. Geofis., 18(2): 201-214.
Rapp Py-DanieL, L.R. & C. Cox-Fernandes. 2005. Sexual
dimorfism
in
amazonian
siluriformes
and
gymnotiformes (Ostariophysi). Acta Amaz., 35(1): 97110.
Rodrigues, C., H.P. Lavrado A.P.C. Falcão & S.H.G.
Silva. 2007. Distribuição da ictiofauna capturada em
arrastos de fundo na Baía de Guanabara, Rio de
Janeiro, Brasil. Arq. Mus. Nac., 65: 199-210.
Sampaio, A.L.A., J.P.A. Pagotto & E. Goulart. 2013.
Relationships between morphology, diet and spatial
distribution: testing the effects of intra and
interspecific morphological variations on the patterns
of resource use in two Neotropical cichlids. Neotrop.
Ichthyol., 11(2) :351-360.
Santos, B.S. & J.P. Quilang. 2012. Geometric
morphometric analysis of Arius manillensis and Arius
dispar (Siluriformes: Ariidae) populations in Laguna
de Bay. Philipp. J. Sci., 141(1): 1-11.
Silva-Junior, D.R., D.M.T. Carvalho & M. Vianna. 2013.
The catfish Genidens genidens (Cuvier, 1829) as a
potential sentinel species in Brazilian estuarine waters.
J. Appl. Ichthyol., 9(6): 1297-1303.
Silva-Junior, L.C., A.C. Andrade & M. Vianna. 2011.
Length-weight relationships for elasmobranchs from
southeastern Brazil. J. Appl. Ichthyol., 27(6): 14081410.
Souza, C.E. & W. Barrella. 2009. Atributos ecomorfológicos de peixes do Sul do Estado de São Paulo. Rev.
Electron. Biol., 2(1): 1-34.
Souza, M.A., D.C. Fagundes, C.G. Leal & P.S. Pompeu.
2014. Ecomorphology of Astyanax species in estrems
with diferente substrates. Zoologia, 31(1): 42-50.
Vazzoler, A.E.A.M. 1996. Biologia da reprodução de
peixes teleósteos: teoria e prática. EDUEM, Maringá,
196 pp.
Vasconcelos, R.P., P. Reis-Santos, A. Maia, V. Fonseca,
S. França, N. Wouters, N.M.J. Costa & H.N. Cabral.
2010. Nursery use patterns of commercially important
marine fish species in estuarine systems along the
portuguese coast. Estuar. Coast. Shelf Sci., 86(4): 613624.
Velasco, G., E.G. Reis & J.P. Vieira. 2006. Calculating
growth parameters of Genidens barbus (Siluriformes,
Ariidae) using length composition and age data. J.
Appl. Ichthyol., 23(1): 64-69.
Received: 28 November 2014; Accepted: 18 August 2015
903
Zimmerman, M.S., S.N. Schmidt, C.C. Krueger, M.J. Van
der Zanden & R.L. Eshenroder. 2009. Ontogenetic
niche shifts and resource partitioning of lake trout
morphotypes. Can. J. Fish Aquat. Sci., 66: 1007-1018.
Lat. Am. J. Aquat. Res., 43(5): 904-911, 2015
Extracto de pionilla en el cultivo de L. vannamei
9041
Research Article
Efecto de la adición de un extracto acuoso de pionilla Lasianthaea podocephala
en el cultivo del camarón blanco del Pacífico Litopenaeus vannamei en
condiciones de laboratorio
Emmanuel Villanueva-Gutiérrez1, Luis Rafael Martínez-Córdova1
Marcel Martínez-Porchas2 & Miguel Antonio Arvayo2
1
DICTUS, Universidad de Sonora, Blvd. Luis Donaldo Colosio entre
Reforma y Sahuaripa, Hermosillo, Sonora
2
Centro de Investigación en Alimentación y Desarrollo
Km 1,5 Carretera a La Victoria, Hermosillo, Sonora, México
Corresponding author: Luis Rafael Martínez-Córdova ([email protected])
RESUMEN. Se evaluó el efecto de dos concentraciones de un extracto acuoso de la raíz de pionilla (Lasianthaea
podocephala Gray), sobre las variables de la calidad del agua, condición fisiológica y parámetros de producción
del camarón blanco del Pacífico, Litopenaeus vannamei (Boone), cultivado en condiciones intensivas de
laboratorio. Dos tratamientos y un control fueron evaluados por triplicado: T1 (1 mL de extracto por acuario),
T2 (3 mL) y C (control, 0 mL). No se observó un efecto negativo de los tratamientos sobre los parámetros de la
calidad del agua, los cuales estuvieron dentro de rangos aceptables, sin presentar diferencias significativas entre
tratamientos (P < 0,05). Algunos de los parámetros de producción tales como la supervivencia, biomasa final y
FCA fueron mejores en los tratamientos en que se utilizó el extracto bajo las condiciones experimentales
empleadas. La concentración de metabolitos hemolinfáticos, sugiere que los organismos cultivados en los
acuarios con extracto tuvieron mejores condiciones, considerando los niveles mayores de proteína y colesterol
en su músculo en relación con el control; además los resultados de expresión de genes indican que el extracto
podría tener algún efecto inmunoestimulante sobre los camarones. No obstante, se recomienda efectuar estudios
adicionales para evaluar y determinar a nivel molecular los ingredientes activos de los tubérculos de raíz
de pionilla, para obtener mayor información sobre el uso potencial de este vegetal en la acuacultura.
Palabras clave: Lasianthaea podocephala, Litopenaeus vannamei, producción, metabolitos hemolinfáticos,
calidad del agua, respuesta inmune.
Effect of the addition of an aqueous extract of the San Pedro Daisy
Lasianthaea podocephala, in the culture of the Pacific white shrimp,
Litopenaeus vannamei, under laboratory conditions
ABSTRACT The effect of two concentrations of an aqueous extract of the San Pedro Daisy, (Lasianthaea
podocephala Gray) roots was evaluated on the water quality, physiological condition and production parameters
of the white Pacific shrimp, Litopenaeus vannamei (Boone), farmed under intensive laboratory conditions. Two
treatments and a control were considered: T1 (1 mL of extract per aquarium), T2 (3 mL of the extract per
aquarium) and C (control, 0 mL of the extract). No negative effects of the treatments on water quality parameters
were observed, which ranged into acceptable limits and without significant differences (P < 0,05). Some of the
production parameters such as final biomass and FCA were slightly better in the treatments using the extract.
The concentration of haemolymph metabolites indicate that shrimp from treatments with the extract were under
better conditions, suggested by the levels of protein and cholesterol in the muscle; moreover, the gene expression
results suggest that the extract could have an immunostimulatory effect on shrimp. However, additional studies
are required to evaluate the active ingredients of the root extract at the molecular level in order to have more
information for the potential use of the plant.
Keywords: Lasianthaea podocephala, Litopenaeus vannamei; shrimp production, haemolymph metabolites,
water quality, immune response.
__________________
Corresponding editor: Erich Rudolph
905
2
INTRODUCCIÓN
En acuacultura es fundamental evaluar los requerimientos tanto ambientales como nutrimentales de cada
especie, a fin de mantenerlos, en la medida de lo
posible, dentro de los rangos óptimos para lograr una
adecuada respuesta productiva y un buen estado
sanitario. Un manejo adecuado de todos estos
parámetros influirá en una menor contaminación a los
cuerpos de agua ocasionada por las descargas de
efluentes de los sistemas de cultivo (Sánchez et al.,
2001; Martínez-Córdova, 2009; Martínez-Porchas &
Martínez-Córdova, 2012).
El manejo inadecuado de las prácticas acuaculturales tiene graves repercusiones en la actividad
camaronícola. Entre ellos se destaca el manejo relacionado con el alimento y prácticas de alimentación, que
representan alrededor del 50% de los costos operativos
de la camaronicultura. El desperdicio de alimento no
consumido se ha vuelto un problema serio a nivel
mundial, ya que además del grave impacto ambiental,
causa pérdidas económicas a las empresas camaronícolas. La adición de atrayentes, quimio-atractantes y
aperitivos se considera crucial para garantizar la
localización e ingesta de alimento en granjas comerciales, donde las condiciones a menudo resultan
adversas para la fácil localización y posterior ingestión
del alimento en los estanques (Lee & Meyers, 1997).
Costero & Meyers (1993) destacan la importancia de
los atrayentes químicos alimenticios en la formulación
de dietas comerciales. Estas sustancias son ampliamente
reconocidas como medio para incrementar la respuesta
de las diferentes especies a un cierto alimento en
términos de su atractabilidad y palatabilidad. Sin
embargo, la mayoría de estos productos no han sido
suficientemente probados y algunos tienen un precio
extremadamente alto para su uso en los alimentos. Por
lo anterior, es necesario buscar alternativas de
productos naturales que puedan optimizar de alguna
manera las condiciones de cultivo, ya sea como
aperitivos para mejorar el consumo, o bien para mejorar
alguna condición fisiológica, nutricional o de estrés en
los organismos cultivados.
Actualmente, la herbolaria medicinal es una
práctica relativamente novedosa en la acuacultura y
solo a partir de los 90’ comenzaron a desarrollarse
investigaciones en esta disciplina. Sin embargo, las
investigaciones en este campo y su empleo por los
acuicultores son aún insuficientes a pesar de la probada
efectividad e inocuidad de algunos de estos productos
(Citarasu, 2010). Algunas hierbas medicinales utilizadas en la acuicultura promueven la capacidad de
crecimiento, mejoran el sistema inmune y actúan como
estimuladores del apetito; otras, tienen la capacidad de
inducir la maduración, amortiguar el estrés y actuar
como agentes antimicrobianos. Dichas características
son de gran utilidad en el cultivo de camarones y peces,
además de que tales productos no provocan daños
graves al medio ambiente.
Algunos estudios relacionados con el uso de plantas
medicinales como estimuladores del apetito, incluyen
los de Citarasu (2010), quien encontró que algunos
extractos como el de pimienta, jengibre, canela, entre
otros, son capaces de mejorar el rendimiento de los
animales por la acción estimulante de las secreciones
intestinales o por tener un efecto bactericida directo
sobre la microflora intestinal. Martínez-Córdova et al.
(2008), al evaluar el efecto de un extracto de Yucca
schidigera (Roezl) en el alimento del camarón blanco
Litopenaeus vannamei (Boone), encontraron una
disminución significativa de los niveles de nitrógeno
amoniacal en la columna de agua y una mejora en la
respuesta productiva, a niveles de inclusión de 2 y 3
ppmil.
Lasianthaea podocephala Gray, también conocida
como pionilla de la montaña, es una pequeña hierba
perenne distribuida en las laderas montañosas de la
sierra de Sonora, México. El extracto acuoso de su raíz
se utiliza en comunidades rurales como aperitivo y
antiparasitario para las personas (Martin et al., 1998).
Recientemente, se realizó un estudio en condiciones de
laboratorio (Martínez-Porchas et al., 2013), donde se
incluyeron en la dieta del camarón blanco, dos
concentraciones diferentes de un extracto de la raíz y se
encontró que no tiene efectos negativos sobre la calidad
del agua, pero tiene efecto positivo en la supervivencia
y ganancia de biomasa, con solamente 1% de inclusión
en la dieta.
De acuerdo a lo anterior, la presente investigación
tiene como objetivo evaluar el efecto de la incorporación de un extracto acuoso de la raíz de L.
podocephala directamente en la columna de agua,
sobre el consumo de alimento, respuesta productiva y
estado fisiológico del camarón blanco en condiciones
de laboratorio.
El estudio fue realizado durante ocho semanas en las
instalaciones del Laboratorio Húmedo de Acuacultura
del Departamento de Investigaciones Científicas y
Tecnológicas de la Universidad de Sonora, México
(DICTUS). Nueve acuarios rectangulares de plástico
con 40 L de capacidad fueron utilizados como unidades
experimentales; el aporte de oxígeno disuelto (OD) en
el agua fue suministrado por piedras difusoras conectadas a una red de distribución de aire unida a un
9063
soplador de 1/4 HP. Se utilizó agua de mar filtrada y
esterilizada por medio de filtros de arena, un biofiltro y
una lámpara de UV.
Un total de 225 postlarvas de camarón blanco (0.06
± 0.005 g de peso promedio) obtenidas del laboratorio
“Maricultura del Pacífico S.A. de C.V.”, en Bahía de
Kino, Sonora, se utilizaron en el experimento. Los
camarones se distribuyeron en acuarios con una
densidad de 125 m-2 (25 organismos por acuario). Una
dieta comercial (Aquaprofile 35 de Purina®, México)
se suministró dos veces al día en pequeñas charolas
(12x12 cm), ajustando la ración de acuerdo al consumo
aparente, siguiendo las recomendaciones de Salame
(1993).
Los tubérculos de la raíz de L. podocephala se
recolectaron en campos ubicados en el Municipio de
Sahuaripa, Sonora, México. Para la preparación del
extracto, las raíces se lavaron previamente con agua
estéril y posteriormente se secaron al horno a 60°C
durante 8 h. Después del secado los tubérculos fueron
triturados a pequeños trozos. La obtención del extracto
acuoso se hizo mediante una infusión de 50 g de polvo
de tubérculo en 1 L de agua destilada cocida durante 2
h en una plancha de calentamiento y agitación
magnética. Posteriormente, se separó el extracto del
residuo vegetal por filtración y se guardó en una botella
de vidrio ámbar en refrigeración para su posterior
utilización.
Los tratamientos consistieron en el uso de dos
concentraciones de extracto añadidos a la columna de
agua a 1 y 3 mL L-1 y un tratamiento control sin la
inclusión del extracto. Tanto los tratamientos como el
control fueron evaluados por triplicado mediante un
diseño experimental simple en un arreglo al azar. Las
concentraciones se seleccionaron en base a
experiencias preliminares y estudios realizados con
otros extractos.
Se efectuaron recambios semanales del 20% de
agua, retirando mediante sifoneo manual los restos de
fecas, alimento no consumido, organismos muertos y
exoesqueletos producto de la ecdisis. Se determinaron
los parámetros de la calidad del agua como
temperatura, salinidad, oxígeno disuelto y pH,
utilizando una sonda multiparamétrica (YSI 6600®).
Las concentraciones de ortosfatos (PO4), nitritos (NO2),
nitratos (NO3) y nitrógeno amoniacal total (NAT) se
midieron semanalmente por espectrofotometría,
utilizando un equipo programable HACH DR 2000.
Al final del experimento se contaron y pesaron
individualmente los organismos de cada tratamiento en
una balanza digital (Sartorius® con una precisión de 0,1
g). Se evaluó el desempeño de los organismos en
términos de peso final (PF), tasa de crecimiento
específica (TCE), supervivencia (SF) y factor de
conversión alimenticia (FCA), de acuerdo a la siguiente
fórmula:
Consumo de alimento total
FCA = [
Biomasa ganada
]
Para evaluar el estado de salud y detectar cambios
fisiológicos del camarón, se tomó una muestra de 100
mg de tejido muscular del abdomen de 10 organismos
de cada tratamiento. Los camarones de todos los
tratamientos se dejaron de alimentar 24 h antes de ser
muestreados y posteriormente, se extrajeron 10 camarones por acuario, los cuales se sacrificaron de
inmediato. Cada muestra de tejido muscular se
homogenizó (FastPrep 5G, MP Biomedicals EUA) y
centrifugó (Legend XTR, Thermo, EUA) a 5000 g
durante 30 min a 2°C. Posteriormente, se tomaron 10
µL de la muestra liquida sin residuo de tejido. Las
mediciones de glucosa, lactato, colesterol y proteína se
realizaron con kits comerciales de Randox (Laboratorios Randox, Oceanside, CA, EE.UU), utilizando
un espectrofotómetro con lector de microplacas (BIORAD Model 680).
Adicionalmente, se tomó una muestra de hepatopáncreas para medir la expresión de dos genes
relacionados con el sistema inmune como proteína
unidora de lipopolisacáridos y β-glucanos (LGBP) y
profenoloxidasa (proPO). Se extrajo ARN del tejido
por medio del kit comercial Master Pure RNA
Purification Kit (Epicentre, EUA), la síntesis del ADN
complementario se realizó utilizando el kit Quantitect
Reverse Transcriptase Kit (QIAGEN, USA), seleccionando aquellas muestras con valores de absorbancia
cercanos a 2 (260/280; NanoDrop, Thermo, EUA). Se
utilizó 1 ug de ARN para medir la expresión relativa.
La expresión de ambos genes se realizó mediante un
termociclador Step One (Applied Biosystems, USA)
utilizando un fluoróforo (iTaq™ universal SYBR®
Green, BIORAD, EUA) e iniciadores específicos para
cada gen (Tabla 2); el gen constitutivo L8 se consideró
como control endógeno. Se efectuaron reacciones de 20
uL y se establecieron las siguientes condiciones
térmicas: 1 ciclo de 5 min a 95°C, 40 ciclos de 30 seg a
95°C y 60 seg a 60°C, y un paso final de extensión a
60°C.
La expresión relativa de cada gen se midió
utilizando el método Ct comparativo (∆∆Ct), utilizando
la siguiente ecuación:
ΔΔCt= (Ct gen interés - Ct gen L8) del tratamiento
T1 o T2 - (Ct gen interés- Ct gen L8) del tratamiento
control
Los datos obtenidos de los parámetros de la calidad
del agua, parámetros de producción, metabolitos y
expresión de genes del tejido muscular se analizaron
4907
mediante un análisis de varianza (ANDEVA) de una
sola vía. Para la confrontación de los resultados y
verificación de las diferencias entre los tratamientos, se
realizaron pruebas de comparación múltiples de Tukey.
Se tomaron como diferencias significativas aquellas
con valor de probabilidad P < 0,05.
RESULTADOS
En cuanto a los parámetros físicos, químicos y calidad
del agua, no se observaron diferencias significativas en
la concentración de oxígeno disuelto, temperatura,
salinidad, pH) (Tabla 1), NAT, NO3 y PO4 (Fig. 1). La
concentración de NO2 en el tratamiento control
presentó un valor significativamente más alto que el de
T1 y no se registraron diferencias respecto a T2 (Fig.
1).
Se observaron diferencias en algunos de los
parámetros de producción entre los tratamientos (Fig.
2). La ganancia en peso total fue similar entre
tratamientos con un rango de 1,40 a 1,45 g. La
supervivencia fue mayor en T1 (56%) y T2 (48%), en
comparación al control (28%). La biomasa total en T1
(20,72 g) presentó un promedio significativamente
mayor al registrado en el tratamiento control (10,60 g),
mientras que no se observó una diferencia significativa
con respecto a T2 (16,85 g); no se detectaron
diferencias entre T1 y T2. El FCA del tratamiento
control (4,3) fue significativamente mayor que el
registrado en T1 (2,12) y T2 (2,53), los cuales
resultaron ser estadísticamente similares entre sí. No se
presentaron diferencias significativas en el consumo de
alimento entre T1 (44,0g), T2 (42,6g) y C (45,6). Los
valores de la TCE fueron de 6,19% día-1 para el control,
6,10% día-1 para T1 y 6,12% día -1 para T2, sin
diferencias significativas entre los tratamientos.
En relación a la concentración de proteína en el
músculo, el valor en T1 (87,3 mg g-1) fue significativamente mayor que en el control (76,4 mg g-1), pero
similar al encontrado en T2 (86,1 mg g-1). Para la
concentración de glucosa se registraron valores en un
rango de 3,40 a 4,10 mg g-1, mientras que para lactato
los valores oscilaron entre 1,90 y 2,90 mg g-1. En ambos
casos no hubo diferencias significativas entre los
tratamientos. La concentración de colesterol del tratamiento control (0,90 mg g-1) fue menor respecto a T1
(1,87 mg g-1), y a T2 (1,65 mg g-1) sin diferencias
significativas entre estos últimos (Fig. 3).
En relación a la expresión de los genes relacionados
con el sistema inmune, se observó una sobreexpresión
de LGBP (~2) en los camarones de ambos tratamientos
con extracto de L. podocephala, mientras que no se
observó un cambio en la expresión de proPO para
alguno de ambos tratamientos con respecto al control.
(Fig. 4).
Figura 1. Parámetros de la calidad del agua en los
tratamientos con concentraciones de 0 (C) 1 (T1) y 3 mL
L-1 (T2) de extracto acuoso de raíz de L. podocephala.
Letras distintas indican diferencias significativas (P <
0,05). NAT: nitrógeno amoniacal total (NH3-NH4).
Figura 2. Parámetros de producción de Litopenaeus
vannamei en los tratamientos con concentraciones de
0 (C) 1 (T1) y 3 mL L-1 (T2) de extracto acuoso de raíz de
L. podocephala. TCE: tasa de crecimiento específico,
FCA: factor de conversión alimenticia. Letras distintas
indican diferencias significativas (P < 0,05).
908
5
Tabla 1. Parámetros físicos y químicos monitoreados en las unidades experimentales de los tratamientos con
concentraciones de 0 (C) 1 (T1) y 3 mL L-1 (T2) de extracto acuoso de raíz de L. podocephala.
Parámetro
Oxígeno disuelto (mg·L-1)
Temperatura (°C)
pH
Salinidad
C
T1
T2
4,8 ± 0,1
27 ± 0,1
6,8 - 7,0
35,5 ± 0,3
4,7 ± 0,1
27 ± 0,5
6,7 - 6,8
35,8 ± 0,1
4,7 ± 0,1
27 ± 0,3
6,7 - 6,8
35,4 ± 0,3
Tabla 2. Iniciadores utilizados para amplificar y medir expresión de genes.
Genes
Profenoloxidasa
Sentido
Antisentido
LGBP
Sentido
Antisentido
L8
Sentido
Antisentido
Secuencia de iniciadores (5’-3’)
Nº de acceso en Genbank
5´GCCTTGGCAACGCTTTCA3´
5ĆGCGCATCAGTTCAGTTTGT3´
EU373096.1
5ĆATGTCCAACTTCGCTTTCAGA3´
5ÁTCACCGCGTGGCATCTT3´
EU102286.1
5´TAGGCAATGTCATCCCCATT3´
5´TCCTGAAGGGAGCTTTACACG3´
DQ316258
Figura 3. Concentración de metabolitos en tejido muscular
del camarón de los tratamientos con concentraciones de
0 (C) 1 (T1) y 3 mL L-1 (T2) de extracto acuoso de raíz de L.
podocephala.
DISCUSIÓN
Durante el experimento los parámetros de calidad del
agua como temperatura, salinidad, oxígeno disuelto y
pH se mantuvieron estables y dentro de los intervalos
que recomiendan diversos autores (Brock & Main 1994;
Figura 4. Expresión relativa de los genes que codifican
para la proteína unidora de lipopolisacáridos y β-glucanos
(LGBP) y profenoloxidasa (proPO) en hepatopáncreas de
camarones de los tratamientos con concentraciones de 0
(C) 1 (T1) y 3 mL L-1 (T2) de extracto acuoso de raíz de
L. podocephala. La línea semicontinua indica el nivel
basal de expresión (1) considerada a partir del control.
Martínez-Córdova, 2009). Para el caso de amonio,
nitrito, nitrato y fosfato, los valores estuvieron dentro de
los rangos adecuados para el desarrollo de L. vannamei
6909
sugeridos por varios autores(Boyd, 1990; ArredondoFigueroa & Ponce-Palafox, 1998; Martínez-Córdova,
2009).
La supervivencia registrada por los camarones en
todos los tratamientos fue menor al 60%, posiblemente
afectada por la falta de sedimento que sirve como
refugio para escapar del canibalismo durante la muda,
tal como ha sido reportado en estudios anteriores
(Arnold et al., 2006a, 2006b). Es probable también, que
los acuarios con los que se trabajó no sean adecuados
para el desarrollo de la especie considerando que estos
organismos son bentónicos y en granjas se encuentran
a una profundidad de 1,5 m; aunque el posible efecto
negativo fue el mismo para todos los tratamientos. La
ganancia en peso total fue baja, lo cual se atribuiría a
que el crecimiento se ve limitado como consecuencia
del incremento en la densidad de siembra como lo
señala Coman et al. (2004).
El alto factor de conversión alimenticio obtenido en
el tratamiento control es consecuencia de la baja
supervivencia que se ve reflejada en una baja biomasa
final. Sin embargo, los valores registrados están dentro
del rango comúnmente encontrado en granjas comerciales en la región (M. Porchas-Cornejo, com. pers.).
Sin embargo, la supervivencia, biomasa final y FCA,
fueron mejores en los tratamientos que incluyeron el
extracto de la raíz en comparación con el tratamiento
control, lo cual indica preliminarmente que el extracto
en las concentraciones utilizadas, tiene un efecto
positivo en la respuesta productiva del camarón.
Aunque la mejor respuesta productiva en camarones
expuestos al extracto del tubérculo no se puede asociar
a un estímulo sobre el consumo de alimento, es
probable que este extracto presente un efecto positivo
sobre la condición fisiológica del organismo. Estudios
anteriores han demostrado que algunos componentes
del tubérculo de L. pododephala tales como (+)curcufenol, exhiben actividad antimicrobiana contra
bacterias tipo Vibrio (Ono et al., 2001), que son
comunes en el cultivo de camarón. Además, la
sobreexpresión de LGBP y proPO en los tratamientos
que recibieron extracto de la raíz, se asociaría a una
inmunoestimulación por alguno de los componentes del
extracto. Las LGBP participan en el reconocimiento de
bacterias Gram negativas y hongos, a la vez que
estimulan la síntesis de proPO que participa en la
melanización, patógenos y tejidos dañados (GollasGalván et al., 1999). Diversos productos derivados de
plantas han demostrado tener un efecto inmunoestimulante sobre crustáceos decápodos como los
camarones (Citarasu et al., 2006).
Las concentraciones de proteína en el musculo de L.
vannamei, son similares a los encontrados por Aparicio
-Simon et al. (2010), quienes reportaron rangos de 75 a
90 mg g-1 en juveniles de la misma especie. NoreñaRivera (2012) al evaluar el efecto de la inclusión
dietaria de un extracto de la raíz de L. podocephala en
el cultivo de L. vannamei, encontró valores de proteína
de 61,5 mg g-1 con un nivel de inclusión de 0,2%, 64,41
mg g-1 con un nivel de 1% y 77,39 mg g-1 en el
tratamiento control. Estos menores valores de proteína,
a pesar de considerarse como normales, se atribuyeron
a que los organismos estuvieron bajo algún grado de
estrés durante el cultivo en laboratorio.
La concentración de colesterol registró mayores
valores que los reportados por Mercier et al. (2006)
para camarones sometidos a estrés por manejo; pero
menores a los reportados por Noreña-Rivera (2012)
quien obtuvo concentraciones de 0,9; 4,32 y 12,14 mg
g-1 para el tratamiento control, con niveles de inclusión
de 0,2 y 1% del extracto de pionilla, respectivamente.
En dicho estudio se argumenta que es posible que algún
componente de la pionilla incentivara un mejor
aprovechamiento del colesterol suministrado en el
alimento. Los resultados de la presente investigación
tienen una tendencia similar, ya que se obtuvo mayor
concentración de colesterol y mayor supervivencia en
los tratamientos T1 y T2, mientras que los camarones
del tratamiento control presentaron una deficiencia de
este nutriente, lo cual indica un pobre estado nutricional
que pudiera haber sido una de las causas de la mayor
mortalidad en este tratamiento. La hipótesis anterior se
fundamenta en que el colesterol es un nutriente esencial
para el camarón, debido a sus múltiples funciones
fisiológicas y metabólicas como componente estructural de membranas, fuente de energía, precursor de
hormonas esteroideas y hormonas relacionadas con la
muda, entre otros (Bonilla-Gómez et al. 2012); además
este no puede ser sintetizado per se por los organismos.
El valor de referencia de lactato obtenido para
juveniles de L. vannamei es de 0.14 mg g-1 según
estudios anteriores (López et al., 2003). Sin embargo,
en el presente estudio se registraron valores mucho
mayores. Racotta & Palacios (1998) y López et al.
(2003) señalan que valores >0,5 mg g-1 de lactato
sugieren una condición de estrés. Así como el lactato y
la proteína, la glucosa es útil como indicador de estrés
en camarones (Mercier et al., 2006, 2009; Ávila-Villa
et al., 2012), de lo cual se asume que los mayores
valores encontrados en el experimento (3,40 a 4,10 mg
g -1), se podrían asociar a condiciones estresantes como
el tipo de acuarios utilizados, falta de sedimento,
manejo y otros.
A diferencia del estudio anterior, realizado por
Noreña-Rivera (2012), en que se utilizó el extracto de
pionilla en el alimento de L. vannamei, en el presente
estudio, el extracto acuoso en la columna de agua no
funcionó como aperitivo con solo dos raciones al día.
No obstante, tuvo un efecto positivo en algunos
indicadores de la condición fisiológica, inmune y
nutricional de los organismos, lo que sugiere que el uso
combinado del producto tanto en el alimento como en
el agua, pudiera tener un mayor efecto en el
mejoramiento del desempeño del camarón en
condiciones controladas de cultivo. Por último, una vez
demostrado el efecto benéfico del extracto sobre
distintas respuestas del camarón, es necesario efectuar
estudios cinéticos en relación al comportamiento de
biomoléculas y expresión de genes con respecto al
tiempo.
REFERENCIAS
Aparicio-Simón, B., M. Piñon, R. Racotta & I.S. Racotta.
2010. Neuroendocrine and metabolic responses of
Pacific whiteleg shrimp Litopenaeus vannamei
exposed to acute handling stress. Aquaculture, 298:
308-314.
Arnold, S.J., J.M.J. Sellars, P.J. Crocos & G.J. Coman.
2006a. An evaluation of stocking density on the
intensive production of juvenile brown tiger shrimp
(Penaeus esculentus). Aquaculture, 256: 174-179.
Arnold, S.J., P.J. Sellars, M.J. Crocos & G.J. Coman.
2006b. Intensive production of juvenile tiger shrimp
Penaeus monodon: an evaluation of stocking density
and artificial substrates. Aquaculture, 261: 890-896.
Arredondo-Figueroa, J.L. & J.T. Ponce-Palafox. 1998.
Calidad del agua en acuicultura: conceptos y
aplicaciones. AGT Editor S.A., México D.F., 236 pp.
Ávila-Villa, L.A., D. Fimbres-Olivarría, G. GarcíaSánchez, T. Gollas-Galván, J. Hernández-López & M.
Martínez-Porchas. 2012. Physiological and immune
responses of white shrimp (Litopenaeus vannamei)
infected with necrotizing hepatopancreatitis bacterium.
Bonilla-Gómez, J.L., X. Chiappa-Carrara, C. Galindo, G.
Jeronimo, G. Cuzon & G. Gaxiola. 2012. Physiological and biochemical changes of wild and cultivated
juvenile pink shrimp Farfantepenaeus duorarum
(Crustacea: Penaeidae) during molt cycle. J. Crustacean Biol., 32: 597-606.
Boyd, C.E. 1990. Water quality in ponds for Aquaculture.
Birmingham
Publishing,
Auburn
University,
Alabama, 37 pp.
Brock, J. & K.L. Main. 1994. A guide to the common
problems and diseases of cultured Penaeus vannamei.
World Aquaculture Society, Baton Rouge, Louisiana,
242 pp.
Citarasu, T., V. Sivaram, G. Immanuel, N. Rout & V.
Murugan. 2006. Influence of selected Indian immunostimulant herbs against white spot syndrome virus
(WSSV) infection in black tiger shrimp, Penaeus
9107
monodon with reference to haematological, biochemical and immunological changes. Fish Shellfish
Immunol., 21: 372-384.
Citarasu, T. 2010. Herbal biomedicines: a new opportunity for aquaculture industry. Aquacult. Int., 18: 403414.
Coman, G.J., P.J. Crocos, N.P. Preston & D. Fielder. 2004.
The effects of density on the growth and survival of
different families of juvenile Penaeus japonicus Bate.
Costero, M.C. & S.P. Meyers. 1993. Evaluation of
chemoreception by Penaeus vannamei under experimental conditions. Prog. Fish Cult., 55: 157-162.
Gollas-Galván, T., J. Hernández-López & F. VargasAlbores. 1999. Prophenoloxidase from brown shrimp
(Penaeus californiensis) hemocytes. Comp. Biochem.
Physiol. B, 122: 77-82.
Lee, P.G. & S.P. Meyers. 1997. Chemoattraction and
feeding stimulation. In: L.R. DÁbramo, D.E. Conklin
& D.M. Akiyama (eds.). Crustacean nutrition. World
Aquacult. Soc., Baton Rouge, Louisiana, pp. 292-351.
López, N., G. Cuzon, G. Gaxiola, G. Taboada, M.
Valenzuela, C. Pascual, A. Sánchez & C. Rosas. 2003.
Physiological, nutritional, and immunological role of
dietary β 1-3 glucan and ascorbic acid 2monophosphate in Litopenaeus vannamei juveniles.
Martin, P.S., D. Yetman, M. Fishbein, P. Jenkins, T. Van
Devender & R.K. Wilson. 1998. Gentry´s Río Mayo
plants; the tropical deciduous forest and environs of
northwest Mexico. University of Arizona Press,
Tucson, 538 pp.
Martínez-Córdova, L.R., A. Campaña-Torres, L. BringasAlvarado & M. Porchas-Cornejo. 2008. Efectos de la
inclusión dietaria de Yucca schidigera en los
parámetros de calidad del agua y producción del
camarón blanco del Pacífico, Litopenaeus vannamei. Invest. Cienc., 16: 4-10.
Martínez-Córdova, L.R. 2009. Camaronicultura sustentable. Editorial Trillas, México D.F., 174 pp.
Martínez-Porchas, M. & L.R. Martinez-Cordova. 2012.
World aquaculture: environmental impacts and troubleshooting alternatives. Sci. World J., 2012. Article
ID 389623. doi: 10.1100/2012/389623.
Martínez-Porchas, M., E.I. Noreña-Rivera, L.R. MartínezCórdova, J.A. López-Elías, F. Mendoza-Cano, L.
Bringas Alvarado & M.E. Lugo-Sánchez. 2013
Evaluación preliminar del polvo de tubérculo de San
Pedro Daisy (Lasianthaea podocephala), como aditivo
alimenticio en el cultivo intensivo de camarón (Litopenaeus vannamei) bajo condiciones de laboratorio. Lat.
Am. J. Aquat. Res., 41: 440-446.
911
8
Mercier, L., E., Palacios, A. Campa-Córdova, D. TovarRamírez, R. Hernández-Herrera & I. Racotta. 2006.
Metabolic and immune responses in Pacific whiteleg
shrimp Litopenaeus vannamei exposed to a repeated
handling stress. Aquaculture, 258: 633-640.
Mercier, L., I.S. Racotta, G. Yepiz-Plascencia, A. MuhliaAlmazán, R. Civera, M.F. Quiñones-Arreola, M.
Wille, P. Sorgeloos & E. Palacios. 2009. Effect of diets
containing different levels of highly unsaturated fatty
acids on physiological and immune responses in
Pacific whiteleg shrimp Litopenaeus vannamei
(Boone) exposed to handling stress. Aquacult. Res.,
40: 1849-1863.
Noreña-Rivera, E. 2012. Evaluación del efecto de la
inclusión dietaria de un extracto de la raíz de pionilla
(Lasianthaea podocephala) sobre el consumo de
alimento, respuesta productiva y condición nutricional
del camarón blanco del Pacífico Litopenaeus
vannamei. Tesis de Licenciatura, Universidad de
Sonora, Hermosillo, 57 pp.
Received: 2 June 2015; Accepted: 24 August 2015
Ono, M., Y. Ogura, K. Hatogai & H. Akita. 2001. Total
synthesis of (S)-(+)-curcudiol, and (S)-(+)-and (R)
-(-)-curcuphenol. Chem. Pharm. Bull., 49: 1581-1585.
Racotta, I.S. & E. Palacios. 1998. Hemolymph metabolic
variables in response to experimental manipulation
stress and serotonin injection in Penaeus vannamei. J.
World Aquacult. Soc., 29: 351-356.
Salame, M. 1993. Feeding trays in penaeid shrimp ponds.
Aquacult. Mag., 19: 59-63.
Sánchez, A., C. Pascual, A. Sánchez, F. Vargas-Albores,
G. LeMoullac & C. Rosas. 2001. Hemolymph metabolic variables and immune response in Litopenaeus
setiferus adult males: the effect of acclimation.
Lat. Am. J. Aquat. Res., 43(5): 912-921, 2015
Efecto del ácido fúlvico y la inulina en Litopenaeus vannamei
Research Article
Efecto de la inulina y del ácido fúlvico en la supervivencia, crecimiento,
sistema inmune y prevalencia de WSSV en Litopenaeus vannamei
Anayeli Gutiérrez-Dagnino1, Antonio Luna-González1, Jesús A. Fierro-Coronado1
Píndaro Álvarez-Ruíz1, María del Carmen Flores-Miranda1, Saraí Miranda-Saucedo1
Violeta Medina-Beltrán1 & Ruth Escamilla-Montes1
1
Instituto Politécnico Nacional, Centro Interdisciplinario de Investigación para el
Desarrollo Integral Regional-Unidad Sinaloa, Boulevard Juan de Dios Bátiz Paredes 250
Col. San Joachín, C.P. 81101, Guasave, Sinaloa, México
Corresponding author: Antonio Luna-González ([email protected])
RESUMEN. Se estudió el efecto del prebiótico inulina y ácido fúlvico, adicionados en el alimento, sobre el
crecimiento, supervivencia, prevalencia de WSSV y sistema inmune de Litopenaeus vannamei. Para esto, se
realizó un bioensayo, con tratamientos por triplicado, donde se probaron diferentes concentraciones de los
aditivos. Se hizo un análisis de WSSV en organismos infectados con una carga viral relativamente alta utilizando
la PCR sencilla y anidada. Al final del bioensayo se extrajo la hemolinfa y se estudió el sistema inmune en
hemocitos a nivel bioquímico y genético (PCR cuantitativo). El peso final fue similar en todos los tratamientos
y la supervivencia estuvo entre 66,7% y 93,3%. La prevalencia de WSSV disminuyó un 13% respecto al control.
El número de hemocitos, la actividad de la fenoloxidasa y la concentración de anión superóxido fueron similares
en todos los tratamientos. Los aditivos modularon la expresión de los genes transglutaminasa, superóxido
dismutasa y profenoloxidasa, pero no la del receptor Toll. Los aditivos no afectan negativamente el crecimiento
y protegen al camarón contra WSSV en organismos infectados con una carga viral relativamente alta. No se
observó efecto de los aditivos en los efectores del sistema inmune estudiados a nivel bioquímico pero si
modularon la expresión de algunos genes relacionados con el sistema inmune en L. vannamei.
Palabras clave: Litopenaeus vannamei, inulina, ácido fúlvico, sistema inmune, prebiótico, acuicultura.
Effect of inulin and fulvic acid on survival, growth, immune system, and WSSV
prevalence in Litopenaeus vannamei
ABSTRACT. The effect of inulin and fulvic acid, added in the feed, on growth, survival, WSSV
prevalence, and immune system was studied in Litopenaeus vannamei. To the above, a bioassay, with
treatments in triplicate, was performed to test different additive concentrations. WSSV analysis was
done in organisms infected with a relatively high viral load using single and nested PCR. At the end of
the bioassay, hemolymph was extracted and the immune system was studied in hemocytes at
biochemical and genetic level (quantitative PCR). The final growth was similar in all treatments and
survival was between 66,7% and 93,3%. WSSV prevalence decreased 13% as compared to control.
The number of hemocytes, phenoloxidase activity, and superoxide anion concentration were similar in
all treatments. Inulin and fulvic acid modulated the expression of transglutaminase, superoxide
dismutase, and prophenoloxidase genes, but not the Toll receptor. Additives do not negatively affect
growth of white shrimp and they protect them against WSSV when infected with a relatively high viral
load. Additives did not affect the immune system effectors studied at biochemical level but they
modulated the expression of some immune-related genes in L. vannamei.
Keywords: Litopenaeus vannamei, inulin, fulvic acid, immune system, prebiotic, aquaculture.
__________________
Corresponding editor: Sandra Bravo
9121
2913
INTRODUCCIÓN
A nivel mundial, la acuicultura representa una actividad
económica de gran potencial, rentabilidad y en constante
expansión. Respecto a la camaronicultura, ésta ha
mostrado un constante incremento durante las últimas
décadas (Goarant et al., 2006; Tassanakajon et al.,
2013). La principal amenaza para el desarrollo de la
industria camaronera son las enfermedades infecciosas
especialmente las causadas por virus (Lightner, 2011;
Tassanakajon et al., 2013). Actualmente, el virus del
síndrome de la mancha blanca (WSSV), es una de las
enfermedades más devastadoras para los camarones
peneidos en cultivo, ocasionando grandes pérdidas
económicas (Leu et al., 2009; Lightner, 2011).
Como los problemas virales son una amenaza seria
para la camaronicultura, es importante el estudio del
sistema inmune del camarón, relacionado con la
resistencia a los patógenos (Seibert & Pinto, 2012). En
la respuesta inmune de los crustáceos se distinguen dos
líneas de defensa. La primera es la cutícula, que
constituye una barrera física que impide la entrada del
patógeno al organismo y la segunda consiste en
efectores celulares y humorales que actúan en conjunto
para eliminar agentes extraños. La defensa celular
incluye todas las reacciones realizadas directamente
por los hemocitos como citotoxicidad, coagulación,
encapsulación, fagocitosis, melanización y nodulación
(Jiravanichpaisal et al., 2006; Sun et al., 2010). Los
mecanismos de defensa humorales, incluyen enzimas
hidrolíticas, aglutininas, proteínas de la coagulación,
péptidos antimicrobianos y radicales libres del oxígeno
y nitrógeno (Muta & Iwanaga, 1996; Destoumieux et
al., 2000; Fagutao et al., 2012).
Contra las infecciones virales no existe la
alternativa de los antibióticos, por lo tanto es necesario
desarrollar estrategias como la adición de sustancias
naturales con actividad antiviral en las dietas de los
camarones, pues no sólo proporcionan nutrientes
esenciales para el crecimiento y desarrollo del
organismo cultivado, sino que también pueden influir
en la salud de los organismos y su resistencia al estrés
(Gatlin, 2002).
Un grupo de moléculas que ha demostrado
numerosos efectos benéficos en los animales terrestres,
así como en algunos animales acuáticos, se conocen
como prebióticos, polisacáridos no digeribles adicionados al alimento que influyen benéficamente en el
organismo mediante la estimulación del crecimiento
y/o actividad metabólica de una/o varias cepas de
bacterias benéficas (probióticos) en el intestino (Gibson
& Roberfroid, 1995; Li et al., 2007). Además, algunos
prebióticos como los fructo-oligosacáridos (Li et al.,
2007) y la inulina (Luna-González et al., 2012; Partida-
Arangure et al., 2013) aumentan la capacidad inmune
de L. vannamei.
El ácido fúlvico es otro compuesto que puede ser
incorporado a las dietas, que se forma a partir de materia
orgánica en descomposición y tiene la propiedad de
formar compuestos de bajo peso molecular con iones
de carga positiva, un proceso conocido como quelación.
El ácido fúlvico adicionado al agua de cultivo mejora
el crecimiento y la respuesta inmune en peces, también
promueve una curación más rápida de los peces
infectados con ectoparásitos y la eliminación de
metales y sustancias químicas en el agua (Meinelt et al.,
2004).
En el presente estudio se evaluó el efecto de la
inulina y el ácido fúlvico, adicionados en el alimento,
en la supervivencia, crecimiento, sistema inmune y
prevalencia de WSSV en L. vannamei, cultivado en el
laboratorio.
Colecta y mantenimiento de camarones
Se colectaron 170 camarones (12,74 ± 0,84 g) de una
granja del municipio de Guasave (Sinaloa, México) y
se aclimataron por 4 días colocándolos en tanque de
cultivo (120 L de capacidad) con 80 L de agua de mar
filtrada (20 µm) y salinidad de 30. Los camarones se
mantuvieron a temperatura ambiente y con aireación
constante. En cada tanque se colocaron 10 organis-mos
y se alimentaron ad-libitum dos veces al día (9:00 y
17:00 h) con alimento comercial. Se realizó un análisis
preliminar de PCR a 12 camarones para evaluar el
estatus del WSSV en los organismos experimentales.
Incorporación de la inulina y ácido fúlvico en el
alimento
El alimento comercial (Camaronina ®, Purina, 35% de
proteína) se pulverizó en un molino de café y se le
agregó la inulina de agave tequilero (IIDEAL, S.A. de
C.V., Guadalajara, Jalisco, México) y ácido fúlvico
(Fertichem, Cuernavaca, Morelos, México). Se elaboró
una pasta con la mezcla, añadiendo 410 mL de agua
destilada y 40 g de grenetina a cada kg de alimento. Los
pellets se hicieron en un molino de carne y se secaron a
temperatura ambiente con un ventilador durante 24 h.
Se preparó alimento para 30 días y se almacenó a 20°C. Para el tratamiento control se sustituyó la mezcla
de aditivos (inulina y ácido fúlvico) por α-celulosa
(Sigma, St. Louis, MO, USA). La longitud y diámetro
final del pellet fue de 5 y 3 mm, respectivamente.
Extracción de ADN para WSSV
La extracción del ADN se realizó con DNAzol
(Invitrogen, Carlsbad, CA, USA), utilizando 100 mg de
tejido (pleópodos) y siguiendo las indicaciones del
fabricante con algunas modificaciones. El tejido en
DNAzol (500 µL) se maceró con un pistilo, se incubó
por 30 min y se centrifugó a 10,000 g, durante 10 min.
Se recuperaron 300 µL del sobrenadante, se adicionaron 250 µL de etanol absoluto frío (-20°C), se mezcló
por inversión y se dejó reposar por 3 min. La muestra
se centrifugó a 7,500 g, durante 5 min y se descartó el
sobrenadante. La pastilla se lavó con 300 µL de etanol
al 75% frío y se centrifugó a 13,000 g durante 5 min.
Posteriormente, se descartó el etanol y se secó a
temperatura ambiente (5 a 15 min) y luego, se agregó
30 µL de buffer TE pH 8,0 (tris 10 mM, EDTA 1 mM).
La cantidad y calidad del ADN se determinó en un
nanofotómetro Pearl (IMPLEN, Inc., Westlake Village,
CA, USA) a 260/280 y 260/230 nm. Antes de los
análisis de PCR, las muestras se diluyeron con buffer
TE para obtener una concentración de 100 ng µL-1.
Análisis de WSSV
Antes de los bioensayos, los camarones fueron
analizados, mediante una PCR sencilla y anidada, para
determinar si eran portadores del WSSV. Para la PCR
sencilla se utilizaron los oligos WSSV1 out (sentido:
5’-ATC ATG GCT GCT TCA CAG AC-3’) y WSSV2
out (contrasentido: 5’-GGC TGG AGA GGA CAA
GAC AT-3’). Para la PCR anidada se utilizaron los
oligos WSSV1 in (sentido: 5’-TCT TCA TCA GAT
GCT ACT GC -3’) y WSSV2 in (contrasentido: 5’TAA CGC TAT CCA GTA TCA CG-3’) (Kimura et
al., 1996), que amplifican fragmentos de 982 y 570 pb,
respectivamente. La mezcla de reacción se realizó en
tubos Eppendorf de 0,2 mL e incluyó 18,75 µL de H2O,
2,5 µL de búfer de reacción 10X (Bioline, Tauton, MA,
USA®), 1,0 L de MgCl2 (50 mM; Bioline), 0,5 µL de
dNTPs (2,5 mM de cada uno; Bioline), 0,5 µL de cada
oligo (10 µM; Sigma-Genosys®), 0,25 µL de Taq
polimerasa (5 U µL-1, Bioline) y 1 L de ADN (100 ng)
para un volumen total de 25 L. La amplificación se
realizó en un termociclador BIOER LifePro®, usando el
siguiente programa: desnaturalización inicial a 95C
por 4 min, seguida de 35 ciclos de 30 s a 95C, 30 s a
55C, 2 min a 72C, y una extensión final a 72C por 4
min. Los fragmentos amplificados se visualizaron bajo
luz UV (DigiDoc-It®, UVP, Upland, CA, USA) en un
gel de agarosa al 1%, teñido con bromuro de etidio (0,5
µg mL-1). En la PCR anidada se redujo a 45 s el tiempo
de elongación (72°C).
Control interno de la PCR (gen GAPDH)
Para confirmar la existencia y calidad del ADN se
realizó la amplificación del gen GAPDH que codifica
914
3
la enzima gliceraldehído-3-fosfato deshidrogenasa en
L. vannamei. Este gen funciona como un control
interno del ADN genómico del camarón (Tang et al.,
2000). Se utilizaron los oligos reportados por Tang et
al. (2000) (GAPDH298F 5’-TCA CCG TCT TCA
ACG AGA TG-3’ y GAPDH298R 5’-ACC CTC CAG
CAT CTC GAA CT-3’), que amplifican un fragmento
de 298 pb. La mezcla de reacción y programa de
amplificación fueron los mismos de la PCR para
WSSV.
Preparación del inóculo viral
Se preparó el inóculo a partir de tejido branquial y
muscular de camarones infectados con una carga viral
baja de WSSV (detectados en el laboratorio por PCR
anidada). Se maceraron los tejidos por 5 min con un
homogenizador Pellet Pestle motor (Kontes, NY, USA)
y se mezclaron con solución salina (NaCl 2%) en una
proporción 1:10 (p/v). La mezcla resultante se dividió
en alícuotas de 20 mL colocadas en tubos Falcón y se
centrifugaron a 3,900 g durante 10 min a 4ºC.
Posteriormente, se repartió el sobrenadante en tubos
Eppendorf (1,5 mL en cada tubo) y se centrifugó a
14,000 g a 4oC por 20 min. El sobrenadante fue filtrado
(0,45 µm) y almacenado en alícuotas a -70ºC.
Elaboración de pasta infectada con WSSV
Se infectaron camarones juveniles (5-12 g) inyectando
30 µL de inóculo viral por vía intramuscular en el
segundo segmento abdominal utilizando una jeringa
para insulina. Se registró la evolución de la enfermedad
dos veces al día. Los camarones moribundos (24-48 h)
se sacrificaron, se tomó una muestra de tejido para
verificar la presencia de WSSV por PCR y se almacenaron a -80ºC. Posteriormente, se tomó el músculo
abdominal y se cortó en trozos muy finos con un bisturí
hasta formar una pasta. Se extrajeron las branquias de
los organismos con unas pinzas de disección y se
mezclaron de manera homogénea con el músculo. Se
determinó la carga viral alta en la pasta mediante PCR
sencillo (Lo et al., 1996a, 1996b) y se congeló a -70°C
hasta su uso.
Se realizó el mismo procedimiento en otro grupo de
camarones, pero se sacrificaron a las 10 h antes de
presentar los signos de la enfermedad (letargia, intestino
vacío, nado errático). Se determinó la carga viral baja
en la pasta mediante PCR anidada (Lo et al., 1996a,
1996b) y se congeló a -70°C hasta su uso.
Bioensayo
Se realizó un bioensayo de 30 días en tanques de
plástico (120 L) sin arena con 80 L de agua de mar
filtrada (20 µm), salinidad de 30 y aireación constante
(sistema abierto). En cada tanque se colocaron 10
4915
individuos aparentemente sanos con peso promedio de
12,74 ± 0,84 g. En el día 10, los camarones se
alimentaron con pasta de tejido infectado de camarón
con carga viral baja (2 g tanque-1). En el día 16 se
alimentaron con una pasta de tejido infectado con carga
viral alta (2 g tanque-1). En el día 17 se adicionaron 800
μL de inóculo viral en el agua de cada tanque. Los
cuatro tratamientos se realizaron por triplicado: I)
Camaronina + celulosa (control); II) Camaronina +
inulina (0,625 g kg alimento-1) + ácido fúlvico (0,125 g
kg alimento-1); III) Camaronina + inulina (1,25 g kg
alimento-1) + ácido fúlvico (0,25 g kg alimento-1); IV)
Camaronina + inulina (2,50 g kg alimento-1) + ácido
fúlvico (0,5 g kg de alimento-1). La alimentación con la
dieta comercial se realizó durante los 30 días del
bioensayo de acuerdo al porcentaje de biomasa (tabla
de Purina), dos veces al día (9:00 y 17:00 h). Se registró
diariamente la temperatura y cada 3 días el oxígeno,
salinidad y pH. Se evaluaron las concentraciones de
nitritos, nitratos y amonio al principio y al final del
bioensayo (Strickland & Parsons, 1972). Los parámetros físicos y químicos, y de calidad de agua se
mantuvieron dentro de los intervalos óptimos según
Brock & Main (1994) durante los 30 días que duró el
bioensayo.
Se eliminaron los sólidos sedimentados cada 3 días
por sifoneo, recuperando el agua perdida. Se realizó un
recambio del 50% de agua cada 5 días. El agua del
recambio fue clorada y desechada. El incremento en
peso se determinó semanalmente para ajustar la ración
del alimento. La supervivencia (%) se determinó diariamente. Al final se registraron los pesos, parámetros del
sistema inmune y prevalencia de WSSV (porcentaje de
organismos infectados por tratamiento).
Tasa de crecimiento específico (TCE)
Al final del bioensayo se determinó la tasa de
crecimiento específico (TCE) utilizando la siguiente
fórmula (Ziaei-Nejad et al., 2006):
TCE (% día-1) = 100 (ln W2 – ln W1)/t
donde: W2 es el peso final, W1 el peso inicial y t es el
número de días de cultivo.
Parámetros del sistema inmune
Obtención de la hemolinfa
Este proceso se realizó manteniendo todos los
componentes en hielo. Se extrajo la hemolinfa de
camarones experimentales (8 por estanque, 24 por
tratamiento) con jeringas para tuberculina (27G x 13
mm) del sinus ventral del camarón (primer segmento
abdominal). Antes de la extracción, la jeringa se cargó
con una solución isotónica para camarón y un
anticoagulante con citrato trisódico pH 7,5 (citrato
trisódico 27 Mm, NaCl 385 mM, glucosa 115 mM) en
una proporción 2:1 (2 volúmenes de anticoagulante por
cada volumen extraído de hemolinfa, 600 µL:300 µL)
(Huang et al., 2010). La muestra de hemolinfa se
colocó en tubos Eppendorf de 1,5 mL. Se utilizaron
tres, dos y tres camarones por estanques para el anión
superóxido, expresión de genes y actividad de la fenoloxidasa, respectivamente. Para el conteo de hemocitos
se utilizaron 50 µL de la hemolinfa destinada para
medir la actividad de la fenoloxidasa antes de
centrifugarla.
Separación de plasma y obtención del sobrenadante
del lisado de hemocitos (SLH)
Se separaron los hemocitos del plasma centrifugando a
800 g por 10 min a 4°C (Hernández-López et al., 1996).
El plasma se colocó en otro tubo y se almacenó a -80°C
hasta su análisis. Al paquete celular se adicionó 1 mL
de anticoagulante frío y se centrifugó nuevamente a 800
g por 10 min a 4°C. Se descartó el sobrenadante y se
adicionó 300 µL de búfer de fosfato de potasio 0,1 M
pH 7,6 (86,6 mL de K2HPO4 1M, 13,4 mL de KH2PO4).
Para lisar los hemocitos se centrifugó a 14,000 g por 10
min a 4°C, se recuperó el SLH y se guardó a -80°C
hasta su análisis. Las muestras de plasma y SLH se
utilizaron para el análisis de la actividad de la
fenoloxidasa.
Conteo total de hemocitos (CTH)
Para el CTH se tomaron 50 µL de hemolinfa y se
mezclaron con 150 µL (1:3) de formol al 6%. El conteo
se realizó individualmente en una cámara Neubauer.
Actividad de la fenoloxidasa
La actividad de la fenoloxidasa (FO) se determinó
según Hernández-López et al. (1996). La actividad de
la FO presente en el plasma se midió espectrofotométricamente por la formación de dopacromo a partir
de L-dihidroxifenilalanina (L-Dopa, Sigma, St. Louis,
MO, USA). A 50 µL de muestra, se adicionaron 50 µL
de búfer de fosfato de potasio 0,1 M (pH 7,6) y 50 µL
de L-Dopa [3 mg mL-1 en buffer de fosfato de potasio
(0,1 M pH 6,6 38,1 mL de K2HPO4 1M, 61,9 mL de
KH2PO4 1M,)]. Se incubó durante 10 min a 37°C y se
determinó la absorbancia a 492 nm. Para activar la
profenoloxidasa (proFO) en el SLH se tomó 50 µL de
muestra, se adicionó 50 µL de tripsina (1 mg mL-1) en
buffer de fosfato de potasio (0,1 M, pH 7,6) y se incubó
por 30 min a 37°C. La actividad de la FO en el SLH se
determinó como se describió anteriormente para el
plasma. Se utilizó como blanco 100 µL de buffer de
fosfato de potasio y 50 µL de L-Dopa. Las muestras
individuales de nueve camarones se procesaron por
triplicado.
Anión superóxido intracelular
El anión superóxido se cuantificó mediante la metodología de Song & Hsieh (1994). La hemolinfa se
centrifugó a 800 g, por 5 min a 4°C. Posteriormente, se
descartó el sobrenadante y los hemocitos se lavaron dos
veces con 900 µL de anticoagulante. Se centrifugó
nuevamente a 800 g, por 5 min a 4°C y se desechó el
sobrenadante. Los hemocitos se tiñeron con 100 µL de
una solución de nitroblue tetrazolium al 0,3% (NBT,
Sigma®) durante 30 min a 37ºC. La reacción de tinción
se finalizó eliminando la solución NBT y adicionando
100 µL de metanol absoluto. Después de tres lavados
con metanol al 70%, los hemocitos fueron secados a
temperatura ambiente por 30 min. Se adicionó 120 μL
de KOH (2 M) y 140 μL de dimetil sulfóxido (DMSO,
sigma ®) para disolver el formazán citoplasmático. Se
colocaron 200 µL de cada muestra por triplicado en una
microplaca y se utilizó como blanco 200 µL de la
mezcla (300 µL de KOH y 350 µL de DMSO). La
densidad óptica del formazán disuelto se cuantificó a
630 nm.
Extracción de ARN y síntesis de ADNc
Para evaluar la expresión de los genes en hemocitos, se
separaron del plasma por centrifugación (800 g por 10
min a 4°C) y se adicionó 300 µL de Trizol para extraer
el ARN total de acuerdo al protocolo del fabricante
(Invitrogen, Carlsbad, CA, USA). La concentración y
pureza del ARN total se determinó midiendo la
absorbancia a 260/280 nm en un nanofotómetro Pearl
(Implen®, Westlake Village, CA, USA) y se almacenó
a -70ºC hasta su uso en la transcripción reversa.
Para sintetizar el ADN complementario (ADNc), el
ARN se trató con ADNsa 1 (1 U µL-1, Sigma) y se
utilizó la transcriptasa reversa Improm II siguiendo la
metodología del fabricante (Promega®, Madison, WI,
USA), a partir de 500 ng de ARN total con oligo dT20.
El ADNc se resuspendió en 80 µL de agua ultrapura y
se almacenó a -70ºC hasta el análisis de PCR en tiempo
real.
Expresión de genes mediante PCR en tiempo real
Se evaluó la expresión relativa de genes del sistema
inmune del camarón en hemocitos. Los resultados
fueron normalizados contra la expresión del gen que
codifica para la subunidad ribosomal 18s como gen de
referencia. Los oligos (Sigma Genosys®) específicos se
muestran en la Tabla 1. Las amplificaciones se
realizaron en un equipo CFX96 Touch Real-Time
System (BIO-RAD®) utilizando el software CFX
Manager versión 3.0 (BIO-RAD) para la obtención de
los datos.
Las amplificaciones se efectuaron por duplicado en
placas de 96 pozos con un volumen de reacción final de
15 µL, conteniendo 7,5 µL de PCR Master Mix 2x [3
9165
µL de buffer de reacción 5x; 1,5 µL de MgCl 2 25 mM;
0,3 µL de dNTPs 10 mM; 0,75 µL de EvaGreen 20x
(Biotium In., Hayward, CA, USA); 0,15 µL de Go Taq;
1,8 µL de agua ultrapura], 0,7-1,0 µL de primers
[sentido y contrasentido, 10 µM c/u (Sigma
Genosys®I],1,5-1,8 µL de agua ultrapura y 5 µL de
templado (ADNc). Las condiciones de amplificación
fueron: desnaturalización inicial a 95°C por 3 min,
seguida de 40 ciclos a 95°C por 10 s, 60°C por 15 s,
72°C por 30 s y un paso adicional de 79°C por 5 s para
adquirir la fluorescencia. Después de cada reacción, se
realizó un análisis de disociación (Curva de Melting) de
65 a 95°C, con un aumento de 0,5°C cada 5 s para
confirmar la ausencia de dímeros de oligos o fragmentos inespecíficos.
La eficiencia de las amplificaciones se determinó
mediante una curva de calibración, calculando una
pendiente con cinco diluciones seriales (factor 5) de
una mezcla representativa, formada con 5 µL de cada
ADNc del experimento. La cantidad de oligos para cada
gen fue optimizada realizando curvas con diferentes
cantidades de oligos y tomando como referencia la
mejor eficiencia de reacción.
Adicionalmente, para corregir pequeñas variaciones
de Cq entre una y otra placa, se preparó un pool de
reacciones con una misma muestra como templado
(ajustadores), se formaron alícuotas de 50 µL y se
congelaron a -20°C. Se descongeló una alícuota para
cada placa y se corrieron tres muestras de 15 µL.
Finalmente, se sumó a cada valor en la placa, la
diferencia entre el promedio general de los ajustadores
menos el promedio de ajustadores en cada placa.
Los valores de Cq se transformaron a cantidades
relativas usando la fórmula de Pfaffl. La expresión
relativa se calculó normalizando contra la cantidad
relativa en el tratamiento control (como un calibrador
con nivel de expresión de 1) (Pfaffl, 2001).
Análisis estadístico
Los resultados en porcentaje se transformaron a arcoseno √%/100 para normalizar su distribución y se
sometieron a un análisis de varianza (Ostle, 1965). Los
datos de crecimiento, supervivencia (%) y sistema
inmune se analizaron con un ANDEVA de una vía para
determinar diferencias significativas entre tratamientos
(P < 0,05) y una prueba de Tukey (HSD) para
identificar la naturaleza de estas diferencias (P < 0,05).
RESULTADOS
Supervivencia y prevalencia de WSSV de los
camarones experimentales
La supervivencia obtenida fue de 66 a 93% mientras
que la prevalencia de WSSV varío entre 53,3 y 66,7%
6917
Tabla 1. Oligos utilizados en el estudio de expresión de genes con PCR cuantitativa (Wang et al., 2010).
Gen
Secuencia de los oligos
18s ARN (control interno)
Profenoloxidasa (proFO)
Transglutaminasa (TGasa)
Superóxido Dismutasa (SOD)
Toll receptor (LvToll)
F 5’-AGCAGGCTGGTTTTTGCTTA-3’
R 5’-ATGCTTTCGCAGTAGGTCGT-3’
F 5'-GAGATCGCAAGGGAGAACTG-3'
R 5'-CGTCAGTGAAGTCGAGACCA-3'
F 5'-CCTCAGGATCTCCTTCACCA-3'
R 5'-TTGGGAAAACCTTCATTTCG-3'
F 5'-ATCCACCACACAAAGCATCA-3'
R 5'-AGCTCTCGTCAATGGCTTGT-3'
F 5'-ATGTGCGTGCGGATACATTA-3'
R 5’-GGGTGTTGGATGTCGAGAGT3'
Tabla 2. Supervivencia, tasa de crecimiento especifico, prevalencia de WSSV, conteo total de hemocitos, anión superóxido
y actividad de la fenoloxidasa en el camaron blanco L. vannamei. Tratamientos: I) Control; II) inulina (0,625 g kg-1 alimento-1) +
ácido fúlvico (0,125 g kg alimento-1); III) inulina (1,25 g kg alimento-1) + ácido fúlvico (0,25 g kg alimento-1); IV) inulina
(2,50 g kg alimento-1) + ácido fúlvico 0,5 g kg alimento-1). Los valores se indican como promedio ± EE. TCE: tasa de
crecimiento específico. SLH: sobrenadante del lisado de hemocitos. FO: fenoloxidasa.
Parámetro estudiado
Supervivencia (%)
Prevalencia de WSSV (%)
TCE (% diario)
Hemocitos mL-1 (x 106)
Anión superóxido (Abs 630 nm)
FO total (Abs 492 nm)
Tratamientos
I
83,30 ± 16,66
66,66 ± 1,44
0,33 ± 0,04
27,73 ± 2,16
1,17 ± 0,09
2,04 ± 0,08
(Tabla 2). No se observaron diferencias significativas
de la supervivencia en los tratamientos (P > 0,05).
Tasa de crecimiento específico
La TCE (% diario) en los tratamientos estuvo entre 0,25
y 0,35. No hubo diferencias significativas (P > 0,05)
entre tratamientos (Tabla 2).
Conteo total de hemocitos (CTH)
Los resultados mostraron que el número de hemocitos
por mililitro de hemolinfa fue similar entre los
tratamientos (P > 0,05) (Tabla 2).
Actividad total de la fenoloxidasa (plasma + SLH)
No se observaron diferencias significativas en la
actividad de la fenoloxidasa en los tratamientos (P >
0,05) (Tabla 2).
Anión superóxido en SLH
Los resultados no mostraron diferencias significativas
en la concentración del anión superóxido entre los
tratamientos (P > 0,05) (Tabla 2).
II
66,67 ± 17,63
55,00 ± 2,60
0,35 ± 0,08
28,90 ± 2,20
1,22 ± 0,05
2,23 ± 0,14
III
86,67 ± 8,81
55,00 ± 1,75
0,31 ± 0,05
25,17 ± 1,28
1,26 ± 0,07
2,33 ± 0,07
IV
93,33 ± 8,16
53,33 ± 0,71
0,25 ± 0,02
27,69 ± 3,50
1,32 ± 0,07
2,13 ± 0,06
Análisis de la expresión de genes del sistema inmune
Los resultados de expresión muestran que la inulina y
el ácico fúlvico modularon significativamente la
expresión de los genes profenoloxidasa, SOD y transglutaminasa entre los tratamientos (Tabla 3). La
expresión de los genes mostró una tendencia a
disminuir en el tratamiento IV (mayor cantidad de
aditivos) respecto a los tratamientos I y II.
DISCUSIÓN
No existen reportes sobre el efecto de la mezcla de
inulina y ácido fúlvico, adicionados a la dieta, en el
crecimiento (TCE), supervivencia, sistema inmune y
prevalencia de WSSV en L. vannamei.
En este estudio se observó que la TCE no aumentó
significativamente en los camarones alimentados con
inulina y ácido fúlvico, coincidiendo con los resultados
reportados por Li et al. (2007) y Luna-González et al.
(2012), quienes probaron fructo-oligosacáridos e
inulina en L. vannamei, respectivamente. Sin embargo,
los resultados contrastan con los de Zhou et al. (2007)
quienes observaron un aumento significativo en el cre-
9187
Tabla 3. Expresión relativa de genes relacionados con el sistema inmune de L. vannamei alimentado con inulina y ácido
fúlvico. Tratamientos: I) Control; II) inulina (0,625 g kg alimento-1) + ácido fúlvico (0,125 g kg alimento-1); III) inulina
(1,25 g kg alimento-1) + ácido fúlvico (0,25 g kg alimento-1); IV) inulina (2,50 g kg alimento-1) + ácido fúlvico 0,5 g kg
alimento-1). La expresión del gen 18S fue usada como control interno (gen de referencia). Letras distintas indican diferencias
significativas (P < 0,05). Barras de error = promedio ± EE.
Genes
Transglutaminasa
Receptor Toll
Superóxido dismutasa
Profenoloxidasa
I
1b
1
1ab
1ab
Expresión relativa a 18 S
II
III
1,50 ± 0,14a
1,17 ± 0,11ab
0,69 ± 0,06
0,63 ± 0,15
1,32 ± 0,14a
0,76 ± 0,03b
1,62 ± 0,24a
1,33 ± 0,20ab
cimiento de L. vannamei alimentado con fructooligosacáridos (0,4 g kg alimento-1) y también con los
obtenidos por Meinelt et al. (2004) quienes alimentaron
al pez cola de espada Xiphophorus helleri con
substancias húmicas (ácidos húmicos y fúlvicos) y
lograron aumentar su crecimiento significativamente.
Las diferencias en los resultados se explicarían por el
tipo y cantidad de prebiótico utilizado, cantidad de
ácido fúlvico probado y mezcla del mismo con la
inulina. Respecto a la supervivencia, ésta fue mejor en
el tratamiento con la concentración más alta de aditivos
aunque la diferencia no fue significativa respecto al
control y los otros tratamientos. Los resultados son
similares a los obtenidos por Li et al. (2007) quienes
obtuvieron supervivencias altas pero similares entre
tratamientos en L. vannamei alimentado con fructooligosacáridos adicionados en la dieta (0,025; 0,0500;
0,075; 0,100; 0,200; 0,400 y 0,800%). Sin embargo, es
importante mencionar que, a diferencia de este trabajo,
los investigadores mencionados no infectaron a los
camarones con WSSV.
La duración del bioensayo fue de 30 días y la
diferencia en la prevalencia de WSSV entre el
tratamiento IV y el control fue de 13,3% en camarones
infectados con una carga viral relativamente alta (PCR
sencilla: >1000 copias de ADN viral, Lo et al., 1996a,
1996b), lo que contrasta con el 41% reportado por
Luna-González et al. (2012) en la misma especie,
utilizando como aditivo inulina, en un bioensayo de 60
días con camarones que venían infectados con baja
carga viral (PCR anidada: 10-50 copias de ADN viral,
Lo et al., 1996a, 1996b) desde la granja y no se reinfectaron en el laboratorio. Por otro lado, el ácido
fúlvico tiene propiedades antivirales (Van Rensburg et
al., 2002), debido a que bloquea la entrada de los virus
a la célula al interactuar con lípidos o carbohidratos o
ambos de glucoproteínas de superficie de virus
envueltos (Kotwal, 2008). Por lo anterior, es probable
que el efecto en la disminución en la prevalencia de
WSSV haya sido inferior a lo reportado por Luna-
IV
0,45 ± 0,08c
0,96 ± 0,10
0,71 ± 0,10b
0,64 ± 0,22b
González et al. (2012) debido a la menor duración del
bioensayo, a la mayor cantidad de partículas virales en
los camarones debido a la reinfección y/o a la mutua
neutralización entre la inulina (carbohidrato) y el ácido
fúlvico.
El estudio del sistema inmune del camarón es un
elemento clave para establecer estrategias para el
control de enfermedades (Peña et al., 2013;
Tassanakajon et al., 2013). Al respecto, los hemocitos
son responsables de la coagulación, endurecimiento del
exoesqueleto y eliminación de materiales extraños
(Song & Hsieh, 1994). Un incremento en el número de
hemocitos aumenta la respuesta inmune de los
crustáceos durante los periodos de estrés y los hace más
resistentes a las enfermedades (Le Moullac et al.,
1998). En el bioensayo, el número total de hemocitos
fue similar en todos los tratamientos, lo que coincide
con lo reportado por Luna-González et al. (2012),
quienes no encontraron diferencias significativas entre
tratamientos cuando alimentaron camarones blancos
sólo con inulina (2,5 g kg alimento-1). Aunque no hubo
un aumento de los hemocitos respecto al control, no se
observó un efecto negativo de los aditivos ya que
Campa-Córdova et al. (2002) mencionan que la
disminución en el número de hemocitos, está asociada
a la susceptibilidad momentánea de los camarones a los
patógenos.
El anión superóxido se produce durante el proceso
de fagocitosis en los hemocitos, es una molécula
oxidante y tiene efecto bactericida (Wang et al., 2010).
En el bioensayo no se presentaron diferencias
significativas entre los tratamientos en la concentración
del anión superóxido. Contrariamente a lo encontrado,
Ibrahem et al. (2010) mencionan que la inulina (5 g kg
alimento-1) incrementó significativamente el estallido
respiratorio (fagocitosis) en la tilapia Oreochromis
niloticus, en comparación con el grupo control. En L.
vannamei, Li et al. (2007) mencionan que la adición de
FOS de cadena corta (0,1 y 0,8%) en el alimento,
incrementa significativamente el estallido respiratorio
8919
de los hemocitos, lo cual se asocia a un aumento en la
generación de anión superóxido durante el proceso de
fagocitosis. A nivel molecular, se observó una
disminución en la expresión del gen de la SOD (que
tiene como sustrato al anión superóxido) en los
tratamientos III y IV (con mayor concentración de
aditivos), respecto al tratamiento II (con menor
concentración de aditivos). Es probable que la
invariabilidad del anión superóxido y la disminución en
la expresión del gen SOD se deba al ácido fúlvico, ya
que algunos resultados obtenidos en ratones indican
que este ácido secuestra radicales libres, inhibe la
fagocitosis específica y funciones celulares linfocíticas
(Van Rensburg et al., 2001).
El sistema profenoloxidasa (proFO) es uno de los
mecanismos defensivos más importantes en crustáceos
(Okumura, 2007). En L. vannamei, el sistema proFO
está involucrado en la defensa inmune contra Vibrio
alginolyticus (Yeh et al., 2009), pero se inhibe por la
infección con WSSV (Ai et al., 2008, 2009). La
actividad de la fenoloxidasa fue similar en todos los
tratamientos. Lo anterior no coincide con lo reportado
por Luna-González et al. (2012) quienes encontraron
un aumento significativo en la actividad de FO en los
camarones infectados con baja carga de WSSV y
tratados con inulina (2,5 g kg alimento-1) respecto al
control sin el prebiótico. En este estudio, se observó una
disminución significativa en la expresión del gen en el
tratamiento con la mayor concentración de aditivos
(tratamiento IV), respecto al de menor concentración
(tratamiento II). Es probable que, junto con el efecto
inhibidor de WSSV, la disminución en la expresión del
gen se deba al ácido fúlvico, ya que como se mencionó
anteriormente, éste interactúa con lípidos y carbohidratos, como la inulina. Los resultados del análisis
bioquímico y molecular son diferentes pero hay que
considerar que el sistema proFO se almacena en
gránulos dentro de los hemocitos.
La proteína de la coagulación (PC) se encuentra en
el plasma en crustáceos decápodos y su polimerización
se realiza mediante la acción de la enzima transglutaminasa en presencia de calcio. La transglutaminasa se
encuentra en el interior de las células hialinas del
camarón y se libera al plasma por daño tisular o como
una repuesta de los hemocitos ante la presencia de
lipopolisacáridos y β-1,3-glucanos (Yeh et al., 1998;
Montaño-Pérez et al., 1999; Fagutao et al., 2012).
Según Fagutao et al. (2012) el silenciamiento génico de
la transglutaminasa hace al camarón más susceptible a
infecciones bacterianas y virales; por tanto, esta enzima
es un componente esencial de su sistema inmune y está
implicada en la regulación de otros genes (crustina y
lisozima). En este trabajo, el gen de la transglutaminasa
presentó una expresión signifi-cativamente mayor en el
tratamiento II (menor concentración de aditivos)
respecto al control sin aditivos y al tratamiento IV
(mayor concentración de aditivos). Los resultados
indican una mayor capacidad de coagulación en el
tratamiento II respecto al I y IV y una mejor respuesta
ante WSSV. Sin embargo, el porcentaje de
supervivencia en el tratamiento II fue menor respecto al
tratamiento IV.
En relación con la expresión del gen LvToll, no
hubo diferencias significativas entre los tratamientos.
El sistema inmune innato identifica los agentes
infecciosos mediante receptores celulares, los cuales
son proteínas que se unen a macromoléculas de
patógenos microbianos. La familia de receptores,
llamada Toll, fue originalmente identificada y descrita
en la mosca de la fruta (Drosophila sp.) como receptora
necesaria para el desarrollo dorso-ventral durante la
embriogénesis, y en adultos como activadores de la
respuesta inmune antifungal (Hashimoto et al., 1988).
Los resultados muestran que los aditivos probados no
parecen interactuar con los receptores Toll de los
hemocitos.
En conclusión, la mezcla de inulina y ácido fúlvico
en el alimento disminuyen la prevalencia de WSSV en
camarones infectados con una carga viral relativamente
alta. No se observó un efecto de los aditivos en el
sistema inmune a nivel bioquímico pero si modularon
la expresión de algunos genes relacionados con el
sistema inmune en L. vannamei.
AGRADECIMIENTOS
Los autores agradecen a la Secretaría de Investigación
y Posgrado del Instituto Politécnico Nacional (SIPIPN) y al Consejo Nacional de Ciencia y Tecnología
(CONACyT) por el soporte económico. Anayeli
Gutiérrez Dagnino agradece a la SIP-IPN y al
CONACyT por las becas otorgadas para la realización
de estudios de posgrado.
REFERENCIAS
Ai, H.S., Y.C. Huang, S.D. Li, S.P. Weng, X.Q. Yu & J.G.
He. 2008. Characterization of a prophenoloxidase
from hemocytes of the shrimp Litopenaeus vannamei
that is down-regulated by white spot syndrome virus.
Fish Shellfish Immunol., 25: 28-39.
Ai, H.S., J.X. Liao, X.D. Huang, Z.X. Yin, S.P. Weng,
Z.Y. Zhao, S.D. Li, X.Q. Yu & J.G. He. 2009. A novel
prophenoloxidase 2 exists in shrimp hemocytes. Dev.
Comp. Immunol., 33: 59-68.
Brock, J. & K.L. Main. 1994. A guide to the common
problems and diseases of cultured Penaeus vannamei.
World Aquaculture Society, Baton Rouge, Louisiana,
242 pp.
Campa-Córdova, A.I., N.Y. Hernández-Saavedra, R. De
Philippis & F. Ascencio. 2002. Generation of superoxide anion and SOD activity in haemocytes and
muscle of American white shrimp (Litopenaeus
vannamei) as a response to beta-glucan and sulphated
polysaccharide. Fish Shellfish Immunol., 12(4): 353366.
Destoumieux, D., M. Muñoz, C. Cosseau, J. Rodríguez, P.
Bulet, M. Comps & E. Bachère. 2000. Penaedins,
antimicrobial peptides with chitin binding activity, are
produced and stored in shrimp granulocytes and
released after microbial challenge. J. Cell Sci., 113:
461-469.
Fagutao, F.F., M.B.B. Maningas, H. Kondo, T. Aoki & I.
Hirono. 2012. Transglutaminase regulates immunerelated genes in shrimp. Fish Shellfish Immunol., 32:
711-715.
Gatlin, D.M. III. 2002. Nutrition and fish health. In: J.E.
Halver & R.W. Hardy (eds.). Fish nutrition. Academic
Press, San Diego, pp. 671-702.
Gibson, G.R. & M.B Roberfroid. 1995. Dietary
modulation of the human colonic microbiota:
introducing the concept of prebiotics. J. Nutr., 125:
1401-1412.
Goarant, C., Y. Reynaud, D. Ansquer, S. Decker, D.
Saulnier & F. Le Roux. 2006. Molecular epidemiology
of Vibrio nigripulchritudo, a pathogen of cultured
penaeid shrimp (Litopenaeus stylirostris) in New
Caledonia. Syst. Appl. Microbiol., 29: 570-580.
Hashimoto, C., K.L. Hudson & K.V. Anderson. 1988. The
Toll gene of Drosophila, required for dorso-ventral
embryonic polarity, appears to encode a transmembrane protein. Cell, 52: 269-279.
Hernández-López, J., T. Gollás-Galván & F. VargasAlbores. 1996. Activation of the prophenoloxidase
system of the brown shrimp (Penaeus californiensis
Holmes). Comp. Biochem. Physiol. C, 113: 61-66.
Huang, J., Y. Yang & A. Wang. 2010. Reconsideration of
phenoloxidase activity determination in white shrimp
Litopenaeus vannamei. Fish Shellfish Immunol.,
28(1): 240-244.
Ibrahem, M.D., M. Fathi, S. Mesalhy & A.M. El-Aty.
2010. Effect of dietary supplementation of inulin and
vitamin C on the growth, hematology, innate
immunity, and resistance of Nile tilapia (Oreochromis
niloticus). Fish Shellfish Immunol., 29: 241-246.
Jiravanichpaisal, P., B.L. Lee & K. Söderhäll. 2006. Cellmediated immunity in arthropods: hematopoiesis,
coagulation,
melanization
and
opsonization.
Immunobiology, 211: 213-236.
Kimura, T., K. Yamano, H. Nakano, K. Momoyama, M.
Hiraokay & K. Inouye. 1996. Detection of penaeid
9209
rod-shaped DNAvirus (PRDV) by PCR. Fish Pathol.,
31: 93-98.
Kotwal, G.J. 2008. Genetic diversity-independent
neutralization of pandemic viruses (e.g., HIV), potentially pandemic (e.g., H5N1 strain of influenza) and
carcinogenic (e.g., HBV and HCV) viruses and
possible agents of bioterrorism (variola) by enveloped
virus neutralizing compounds (EVNCs). Vaccine, 26:
3055-3058.
Le Moullac, G., C. Soyez, D. Saulnier, D. Ansquer, J.C.
Avarre & P. Levy. 1998. Effect of hypoxia stress on
the immune response and the resistance to vibriosis of
the shrimp Penaeus stylirostris. Fish Shellfish
Immunol., 8: 621-629.
Leu, J.H., F. Yang, X. Zhang, X. Xu, G.H. Kou & C.F. Lo.
2009. Whispovirus. Curr. Top. Microbiol. Immunol.,
328: 197-227.
Li, J., G.S. Burr, D.M. Gatlin III, M.E. Hume, S. Patnaik,
F.L. Castille & A.L. Lawrence. 2007. Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and
immunity characteristics of Pacific white shrimp,
Litopenaeus vannamei, cultured in a recirculating
system. J. Nutr., 137: 2763-2768.
Lightner, D.V. 2011. Virus diseases of farmed shrimp in
the Western Hemisphere (the Americas): a review. J.
Invertebr. Pathol., 106(1): 110-130.
Lo, C.F., J.H. Leu, C.H. Ho, C.H. Chen, S.E. Peng, Y.T.
Chen, C.M. Chou, P.Y. Yeh, C.J. Huang, H.Y. Chou,
C.H. Wang & G.H. Kou. 1996a. Detection of
baculovirus associated with white spot syndrome
(WSBV) in penaeid shrimps using polymerase chain
reaction. Dis. Aquat. Org., 25: 133-141.
Lo, C.F., C.H. Ho, S.E. Peng, C.H. Chen, H.C. Hsu, Y.L.
Chiu, C.F. Chang, K.F. Liu, M.S. Su, C.H. Wang &
G.H. Kou. 1996b. White spot syndrome baculovirus
(WSBV) detected in cultured and captured shrimp,
crabs and other arthropods. Dis. Aquat. Org., 27: 215225.
Luna-González, A., J.C. Almaraz-Salas, J.A. FierroCoronado, M.C. Flores-Miranda, H.A. GonzálezOcampo & V. Peraza-Gómez. 2012. The prebiotic
inulin increases the phenoloxidase activity and reduces
the prevalence of WSSV in whiteleg shrimp (Litopenaeus vannamei) cultured under laboratory conditions.
Aquaculture, 362-363: 28-32.
Meinelt, T., K. Schreckenbach, K. Knopf, A. Wienke, A.
Stuber & C.E.W. Steinberg. 2004. Humic substances
affect constitution and sex ratio of swordtail
Xiphophorus helleri (Heckel, 1848). Aquat. Sci., 66:
239-245.
Montaño-Pérez, K., T. Reyes-Izquierdo & F. VargasAlbores. 1999. El proceso de coagulación en camarones penaeidos. Ciencia, 50: 23-28.
921
10
Muta, T. & S. Iwanaga. 1996. The role of hemolymph
coagulation in innate immunity. Curr. Opin. Immunol.,
8: 41-47.
Okumura, T. 2007. Effects of lipopolysaccharide on gene
expression of antimicrobial peptides (penaeidins and
crustin), serine proteinase and prophenoloxidase in
haemocytes of the Pacific white shrimp, Litopenaeus
vannamei. Fish Shellfish Immunol., 22: 68-76.
Ostle, B. 1965. Estadística aplicada. Limusa-Wiley,
México, 629 pp.
Partida-Arangure, B.O., A. Luna-González, J.A. FierroCoronado, M.C. Flores-Miranda & H.A. GonzálezOcampo. 2013. Effect of inulin and probiotic bacteria
on growth, survival, immune response, and prevalence
of WSSV in Litopenaeus vannamei cultured under
laboratory conditions. Afr. J. Biotechnol., 12(21):
3366-3375.
Peña, N., R. Vargas & A. Varela. 2013. Productos
naturales como estimuladores del sistema inmunológico de Litopenaeus vannamei, infectado con Vibrio
parahaemolyticus. Rev. Agron. Mesoam., 24(1): 133147.
Pfaffl, M.W. 2001. A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids
Res., 29(9): 2002-2007.
Seibert, C. & A.R. Pinto. 2012. Challenges in shrimp
aquaculture due to viral diseases: distribution and
biology of the five major penaeid viruses and
interventions to avoid viral incidence and dispersion.
Braz. J. Microbiol., 43(3): 857-864.
Song, Y.L. & Y.T. Hsieh. 1994. Immunostimulation of
tiger shrimp (Penaeus monodon) hemocytes for
generation of microbiocidal substances: analysis of
reactive oxygen species. Dev. Comp. Immunol., 18:
201-209.
Strickland, J.H.D. & T.R. Parsons. 1972. A practical
handbook of seawater analysis. J. Fish. Res. Bd. Can.,
167: 310 pp.
Sun, J., A. Wang & T. Zhang. 2010. Flow cytometric
analysis of defense functions of hemocytes from the
Penaeid shrimp, Penaeus vannamei. J. World
Aquacult. Soc., 41(1): 92-105.
Received: 25 March 2015; Accepted: 5 September 2015
Tang, K.F.J., S.V. Durand, B.L. White, R.M. Redman,
C.R. Pantoja & D.V. Lightner. 2000. Postlarvae and
juveniles of a selected line of Penaeus stylirostris are
resistant to infectious hypodermal and hematopoietic
necrosis virus infection. Aquaculture, 190: 203-210.
Tassanakajon, A., K. Somboonwiwat, P. Supungul & T.
Sureerat. 2013. Discovery of immune molecules and
their crucial functions in shrimp immunity. Fish
Shellfish Immunol., 34(4): 954-967.
Van Rensburg, C.E.J., J. Dekker, R. Weis, T.L. Smith, E.J.
Rensburg & J. Schneider. 2002. Investigation of antiHIV properties of oxihumate. Exp. Chemother., 48:
138-143.
Van Rensburg, C.E.J., S.C.K. Malfeld & J. Dekker. 2001.
Topical application of oxifulvic acid suppresses the
cutaneous immune response in mice. Drug Dev. Res.,
53: 29-32.
Wang, K.H.C., C.W. Tseng, H.Y. Lin, I.T. Chen, Y.H.
Chen, Y.M. Chen, T.Y. Chen & H.L. Yang. 2010.
RNAi knock-down of the Litopenaeus vannamei Toll
gene (LvToll) significantly increases mortality and
reduces bacterial clearance after challenge with Vibrio
harveyi. Dev. Comp. Immunol., 34: 49-58.
Yeh, M.S., Y.L. Chen & I.H. Tsia. 1998. The hemolymph
clottable proteins of tiger shrimp, Penaeus monodon,
and related species. Comp. Biochem. Physiol., B, 121:
169-176.
Yeh, M.S., C.Y. Lai, C.H. Liu, C.M. Kuo & W. Cheng.
2009. A second proPO present in white shrimp
Litopenaeus vannamei and expression of the proPOs
during a Vibrio alginolyticus injection, molt stage, and
oral sodium alginate ingestion. Fish Shellfish
Immunol., 26: 49-55.
Zhou, Z., Z. Ding & L.V. Huiyuan. 2007. Effects of
dietary short-chain fructooligosaccharides on intestinal microflora, survival and growth performance of
juvenile white shrimp, Litopenaeus vannamei. J.
World Aquacult. Soc., 38(2): 296-301.
Ziaei-Nejad, S., M.H. Rezaei, G.A. Takami, D.L. Lovett,
A.R. Mirvaghefi & M. Shakouri. 2006. The effect of
Bacillus spp. bacteria used as probiotics on digestive
enzyme activity, survival and growth in the Indian
white shrimp Fenneropenaeus indicus. Aquaculture,
252: 516-524.
Lat. Am. J. Aquat. Res., 43(5): 922-935, 2015
Metazoan meiofauna assemblages off central Chile
9221
Research Article
Composition and vertical distribution of metazoan meiofauna assemblages on
the continental shelf off central Chile
Eulogio Soto1, Williams Caballero1 & Eduardo Quiroga2
Facultad de Ciencias del Mar y de Recursos Naturales, Universidad de Valparaíso
P.O. Box 5080, Reñaca, Viña del Mar, Chile
P.O. Box 1020, Valparaíso, Chile
1
Corresponding author: Eulogio Soto ([email protected])
ABSTRACT. A quantitative study of metazoan meiofauna was carried out in Valparaiso Bay (33°S 71°W)
which is affected by seasonal hypoxia in central Chile. The contents of bottom water, dissolved oxygen
(BWDO), organic carbon, chloroplast pigments and composition of stable carbon isotope (δ13C) in the sediment
were used as a measure of the contribution of primary production in the water column, which accumulates in
the sediment. Meiofauna abundances in the three sampling stations (80-140 m depth) ranged from 2.218 ± 643
to 1.592 ± 148 ind 10 cm-2. Nine upper metazoan meiofauna groups were recorded, with nematodes as the
dominant group, contributing with more than 95% of total abundances. The abundance vertical distribution was
concentrated in the first layers of sediment in most groups except Acari and nauplii larvae. Canonical
correspondence analysis revealed significant correlations (P < 0.05) between the meiofauna abundance and
organic content, depth and redox potential from sediments. These results represent a first approach to
understanding the ecology of meiofaunal assemblages in the Valparaiso Bay and may be useful as a baseline for
future comparisons and descriptions of the ENSO (El Niño Southern Oscillation) and seasonal variations of
these unknown benthic communities.
Keywords: meiofauna, nematodes, abundance, sediment, Valparaiso Bay, southeastern Pacific.
Composición y distribución vertical de los ensambles de meiofauna metazoaria
en la plataforma continental frente a Chile central
RESUMEN. Se realizó un estudio cuantitativo de la meiofauna metazoaria en la Bahía de Valparaíso (33°S,
71°W), afectada por hipoxia estacional en Chile central. Los contenidos de oxígeno disuelto en el agua de fondo,
carbono orgánico, pigmentos cloroplásticos y composición de isotopos estables de carbono en el sedimento
(δ13C) se usaron como una medida del aporte de producción primaria en la columna de agua, que se acumula en
el sedimento. La abundancia de la meiofauna en las tres estaciones de muestreo (80-140 m de profundidad) varió
de 2.218 ± 643 a 1.592 ± 148 ind 10 cm-2. Se registraron nueve grupos superiores de la meiofauna metazoaria,
siendo los nemátodos el grupo dominante, contribuyendo con más de 95% de la abundancia total. La distribución
vertical de la abundancia se concentró en las primeras capas del sedimento en la mayoría de los grupos a
excepción de Acari y larvas nauplii. El análisis de correspondencia canónico reveló correlaciones significativas
(P < 0,05) entre la abundancia de la meiofauna y el contenido orgánico, profundidad y potencial redox de los
sedimentos. Estos resultados representan una primera aproximación al conocimiento de la ecología de ensambles
de meiofauna de fondos blandos en la Bahía de Valparaíso y pueden ser útiles como línea de base para futuras
comparaciones y descripciones de las condiciones ENSO (El Niño Oscilación del Sur) y las variaciones
estacionales de estas desconocidas comunidades bentónicas.
Palabras clave: meiofauna, nematodos, abundancia, sedimentos, Bahía de Valparaíso, Pacífico suroriental.
INTRODUCTION
The seafloor benthic assemblages inhabiting the
continental shelf off north and central Chile are influen__________________
Corresponding editor: Claudia Bremec
ced by several oceanographic features such as oxygen
minimum zones (OMZs) (Gallardo et al., 2004;
Sellanes et al., 2007, 2010; Fuenzalida et al., 2009,
Ulloa & Pantoja, 2009), coastal upwelling (Fossing et
923
2
al., 1995; Gutiérrez et al., 2006) and the ENSO events
(Arntz et al., 1991; Neira et al., 2001a, 2001b; Sellanes
et al., 2007; Moreno et al., 2008). In this region, a large
fraction of the organic matter derived from primary
production is accumulated on the sediment, which is
characterized by having high remineralization rates
(Gutiérrez et al., 2000). These factors may change the
biochemical properties of the sediments (Cowie, 2005;
Neira et al., 2013) and bottom water column with
observable effects on the composition, abundance,
diversity and distribution of benthic fauna as has been
observed in another regions (Levin, 2003; Gooday et
al., 2009, 2010).
The meiofauna represents the most abundant
metazoan group in the marine benthic system,
distributed from the intertidal to abyssal depths, and
with productivity rates similar to or higher than those
of macrofauna (Gerlach, 1971; Giere, 2009). The
meiofauna enhance organic matter biomineralization
enhancing the recycling of nutrients and organic carbon
making them available for assimilation into new
biomass (e.g., Gerlach, 1971; Fenchel, 1978; Giere,
2009; Neira, et al., 2013). In addition, these
communities are also food supply for a large number of
larger organisms and show sensitivity to anthropogenic
impacts, serving as environmental indicators (Boyd et
al., 2000). Meiobenthic studies from Chilean waters
have been carried out from intertidal (Asencio et al.,
1995; Rodríguez et al., 2001; Lee & Riveros, 2012;
Valderrama-Aravena et al., 2014), continental shelf
(Neira et al., 2001a, 2001b; Sellanes et al., 2003;
Sellanes & Neira, 2006; Veit- Köhler et al., 2009; Neira
et al., 2013) and hadal trenches environments
(Danovaro et al., 2002; Gambi et al., 2003). There are
also studies on the use of these organisms as
anthropogenic bioindicators (Lee et al., 2006; Lee &
Correa, 2007) and their relationships with abiotic
parameters from sediments in fjords ecosystems (Chen
et al., 1999; George & Schminke, 1999; Stead et al.,
2011).
Investigations made on the continental shelf have
been mostly developed off Concepción, south central
Chile (36°40’S). They have focused on describing the
composition, structure and function of meiofaunal
assemblages in response to ENSO and OMZs
conditions as well as their function in the energetic flux
of benthic systems (Sellanes et al., 2003; Sellanes &
Neira, 2006; Neira et al., 2013). In Valparaíso Bay
(33°S), there are limited studies on continental shelf
mega- and macrobenthic communities (Andrade, 1986,
1987) and virtually there are no studies about the
meiobenthos. Therefore, the current research is the first
to investigate the composition and community structure
of soft bottom meiofauna assemblages in Valparaíso
Bay. The aims were a) to describe the taxonomic
composition, density and vertical distribution of the
metazoan meiofauna, and b) to characterize environmental factors influencing the meiofauna distribution.
Study area
Valparaíso Bay (32°9´S, 71°6´W) is located on the
continental shelf off central Chile. In this area,
oceanographic process such as upwelling, OMZs,
ENSO and local organic enrichment associated with
sewage outfalls influence sediment conditions and
benthic communities (Brandhorst, 1971; Andrade et al.,
1986; Sievers & Vega, 2000; Silva & Valdenegro,
2003; Rutllant et al., 2004; Bello & Maturana, 2004).
In addition, terrestrial inputs from Aconcagua River
contribute to organic enrichment and habitat heterogeneity in coastal zones, and are distributed by complex
local hydrographic conditions thus enhancing the
species sensitivity levels, which may lead to changes in
their geographical distribution limits as has been
already documented for other locations (Teixeira et al.,
2012). An oceanographic campaign was undertaken in
March 2013, considering three stations along a depth
transect. The two shallowest stations (3 and 4) are
situated on the inner continental shelf at 80 and 100 m
depth respectively (Fig. 1). The deepest station (5) is
situated on the outer continental shelf at 140 m depth,
where hypoxic conditions have been recorded (Fig. 1).
Records of the location and depth of each sampling
station were made using a GPS Echo-sounder Garmin.
Sampling and processing
Water column temperature, salinity and dissolved
oxygen (DO) were measured using a CTDO Seabird 19
Plus. In addition, discrete water samples at different
depths were collected with Niskin bottles for DO.
Samples for meiofauna and sediment parameters were
collected using a gravity corer with a 50 mm internal
diameter. Five sediment samples were collected in each
station for organic matter content (OM), grain size,
redox potential (EhNHE), chlorophyl-a (Chl-a), phaeopigment (Phaeop), carbon stable isotope ratio (δ13C),
total organic carbon (TOC) and carbon-nitrogen ratio
(C:N) analyses. From each station two replicates for
meiofauna were sub-sampled with Plexiglas tubes 30
mm internal diameter. To study the vertical distribution
the first six centimeters of sediment column were
examined. In order to achieve these the tubes were
processed and subdivided into three horizontal layers
(0-2, 2-4 and 4-6 cm). All samples were fixed in 4%
formalin buffered with sodium borate. A 63 µm mesh
sieve was used and meiofauna were extracted using the
9243
Figure 1. Study site showing the oceanographic sampling stations.
methodology of resuspension-decantation (Wieser,
1960) after sonicating the sediment for 10 s (Thiel et
al., 1975). The efficiency of this method has been
reported by Murrell & Fleeger (1989). All meiofaunal
individuals were sorted, identified into major taxa and
counted under a stereo microscope Nikon Eclipse E
200. Abundance was expressed as individuals per 10
cm2.
Laboratory analyses
The samples for DO were analyzed by the Winkler
method as modified from Carpenter’s technique
(Knap et al., 1993), and microtitrated with a
DOSIMAT. Total organic matter (TOM) in marine
sediments was determined at 2 cm intervals by loss of
weight on ignition at 475-500ºC for 4 h (Byers et al.,
1978). Carbon stable isotope content (δ13C) was
analyzed by mass spectrometry (VG Micromass
602C equipment) at the Environment Isotopes
Laboratory of the CCHEN (Chile). The δ13C (‰)
values are relative to the Pee Dee Belemnite (PDB)
Standard (Silva et al., 2011). In order to estimate the
contribution of allochthonous organic matter (Alloch)
in the study area, we used -26.9‰ as terrestrial
reference value, and we used for marine sediment an
average value obtained from samples in the study area
(-21.7‰), which were consistent with those reported
by Silva et al. (2011).
The total organic carbon (TOC) and total nitrogen
(TN) content of the surface sediments were analyzed on
freeze-dried and homogenized sample material.
Measurements were made in a CHN elemental analyzer
(Flash EA 2000) after acidification treatment with 1 N
HCl. Redox potential (EhNHE) was measured at 2 cm
intervals in the laboratory using a platinum standard
combination electrode with a calomel internal reference
(SG™, Mettler Toledo). The total sulfides content in
was determined colorimetrically according to method
of Cline (1969). Chl-a and phytopigment degradation
products (i.e., phaeopigments) were extracted from
duplicate subsamples of wet sediment (ca. 1 g) using
90% acetone. After 24 h of darkness at 4°C, the samples
were sonicated for 5 min, centrifuged at 3,000 rpm
(1,000 g) for 10 min, and extracts were fluorometrically analyzed for Chl-a and Phaeop content. Chla and Phaeop values were obtained before and after
acidification with 1 N HCl, respectively, according to
Lorenzen’s method, as described in Parsons et al.
(1984), where the volume of water is substituted by the
dry weight (DW) of the sediment expressed in gram.
Values were thus expressed, corrected for porosity as
measured by the water content, as µg Chl-a g-1 DW.
This was obtained after drying duplicate sediment
subsamples (ca. 1 g) at 105°C for 20 h. Chloroplast
pigment equivalents (CPE) is the sum of Chl-a and
Phaeop, which is an indicator of fresh organic matter
4925
(Pfannkuche & Soltwedel, 1998). Particle grain size
data were analyzed following Folk and Ward scale
(Folk, 1980; Blott & Pye, 2001).
Data analyses
Kruskal-Wallis test were used to detect differences in
meiofauna mean abundance between sites. The
correlations between biological and sediment variables
were calculated using Spearman correlation analyses.
All tests were performed using the Statistica software
package version 7.0. In addition, Canonical correspondence analysis (CCA) was performed with the software
PAST 3.01 (Hammer et al., 2001). CCA was applied to
relate the set of environmental parameters and
meiofaunal groups among sampling stations, as
suggested by Jongman et al. (1987).
RESULTS
Sediment properties
Details of environmental parameters are shown in
Table 1. Bottom water DO concentrations showed a
decreasing pattern with depth with a mean of 2.42 ±
0.29 mL L-1. Similar spatial trends were observed for
Chl-a, Alloch and δ13C variables with mean values of
10.9 ± 1.35 µg g-1, 41.03 ± 22.95 (%) and -23.83 ± 1.19
‰, respectively. The opposite pattern was observed for
organic matter content (%) with a higher proportion at
station 5 in the 0-2 and 2-4 cm sediment layers. The
same situation was recorded for EhNHE (mV) with the
highest values recorded in the 2-4 and 4-6 cm sediment
layers. The values observed for these parameters
indicate the low oxidation of sediments at the study site.
The rest of sediment variables showed spatial
variability without a clear pattern with mean values of
15.23 ± 4.44 mg g-1 for TOC, 12.21 ± 1.11 molar for
C:N, 22.97 ± 8.28 µg g-1 for Phaeop, and 33.88 ± 9.41
µg g-1 for CPE. The sediment composition (e.g., grain
size) was characterized by a higher proportion of mud
(>70%) and lower content of sand (<28%) in all
stations. However, the sediment parameters did not
exhibit significant differences among stations in the
study area (Kruskal-Wallis test P > 0.05).
Taxonomic composition and abundance
A total of 40 taxa (different morphotypes) were
recognized in the study site belonging to nine upper
metazoan meiofaunal groups. Nematodes were the
dominant group contributing with more than 95% of
relative abundance at all sites (Table 2). In this group
22 taxa were distinguished belonging to 14 familias.
Copepoda and Acari with 6 and 9 taxa respectively
were the next most important groups, but they did not
exceed 3 and 6% of total relative abundance, respectively. The rest of taxa: nauplii larvae, gastrotrichs,
kinorhynchs, polychaetes, oligochaetes and cumaceans
exhibited low relative abundances (below 1%) and
scarce taxonomic representation. The main taxonomic
groups are show in Fig. 2. Details of taxonomic
composition and hits relative abundance are show in
Annex 1.
Meiofaunal abundance decreased with the depth
ranging from 2,218 ± 643 ind 10 cm-2 at stn. 3 to 1,592
± 148 ind 10 cm-2 at stn. 4. No significant differences
were observed between stations (Kruskal-Wallis test,
H2 = 1.21, P > 0.05). Nematode abundances reached
maximum values at station 3 with 2,136 ± 634 ind 10
cm-2, while the lowest abundances were recorded at stn.
4 with 1,528 ± 138 ind 10 cm-2 (Fig. 3a). Acari
abundances were two to three orders of magnitude
lower than nematodes, and were the second most
abundant meiofaunal group, which ranged from 56 ± 9
ind 10 cm-2 at stn. 3 to 7 ± 2 ind 10 cm-2 at station 5
(Fig. 3b). Copepod abundances varied from 10 ind 10
cm-2 at stn. 4 and 5, to 5 ± 0.98 ind 10 cm-2 at stn. 3.
The rest of taxa recorded abundances lower than 2 ind
10 cm-2. Nematodes, nauplii larvae, copepods, acari and
gastrotrichs were recorded at all stations. Contrasting,
kinorhynchs were recorded at stn. 4 and 5, with higher
abundances at the stn. 5 (27 ± 6 ind 10 cm-2).
Cumaceans and oligochaetes were also recorded at
station 4, while polychaetes only at stn. 5. These taxa
always were recorded with very low abundances (<1
ind 10 cm-2).
Vertical distribution
Vertical distribution profiles of the major meiofaunal
taxa are shown in Figure 4. The meiofauna vertical
distribution varied in the three stations. Meiofaunal
abundances decreased with the sediment depth and
nematodes were the dominant group at each depth
(>90% of abundance) dictating the overall vertical
distribution pattern for the whole community. The
single exception to this trend was Acari. This group
increased with sediment depth recording the highest
density in the 4-6 cm layer with a mean of 19.3 ± 14,9
ind 10 cm-2. On the other hand, nauplii larvae recorded
a density slightly lower at 4-6 cm layer (3.79 ± 4.13 ind
10 cm-2) in comparison to 0-2 cm layer (3.83 ± 4.37 ind
10 cm-2). The great majority of the taxa were
concentrated in the 0-2 cm sediment layer. Even some
groups such as kinorhynchs, cumaceans and polychaetes were not recorded in the lower layers, while
copepods and gastrotrichs had a wider vertical
distribution. Including all sites and sediment layers, the
median proportion of specimens (relative abundance)
recorded in the 0-2, 2-4 and 4-6 cm layers was 75.2%,
9265
Table 1. Abiotic properties of three sampling stations off central Chile. Sedimentary parameters are given for the top 0-1
cm layer (means of 3 samples). TOC: total organic carbon; C:N: carbon-nitrogen ratio; Chl-a: chlorophyll-a; Phaeop:
phaeopigments; Eh: redox potential; TOM: total organic matter; δ13C: ratio of stable isotopes; CPE: chloroplast pigment
equivalents; Alloch: allochthonous organic matter.
Station 3
80
32°54'31
71°35'44
11.31
2.73
12.41
12.79
12.28
32.44
44.73
Depth (m)
Latitude
Longitude
Bottom water temperature (°C)
Bottom water oxygen (mL L-1)
TOC (mg g-1)
C:N ratio (molar)
Chla (µg g-1)
Phaeop (µg g-1)
CPE (µg g-1)
EhNHE (mV)
0-2 cm
2-4 cm
4-6 cm
Sulfides (mg kg-1)
Mud (%)
Sand (%)
TOM (%)
0-2 cm
2-4 cm
4-6 cm
δ13C (‰)
Alloch (%)
Station 4
100
32°54'31
71°36'48
11.26
2.37
20.35
12.91
10.84
17.06
27.91
Station 5
140
32°54'31
71°38'57
11.2
2.16
12.95
10.93
9.59
19.42
29.01
56
-26
-68
15
84.4
15.6
27
-32
-76
17.2
72
28
33
-44
-107
1.15
93.6
6.3
6.1
6.5
6.4
-24.8
59.62
7.6
7.7
6.8
-24.2
48.08
7.7
8.4
6.5
-22.5
15.38
Table 2. Relative abundance (%) of meiofaunal groups in the study area in different sediment layers (0-2, 2-4 and 4-6 cm).
Nem: Nematoda, Cop: Copepoda, Nau: Nauplii, Pol: Polychaeta, Aca: Acari, Cum: Cumacea, Gas: Gastrotricha, Olig:
Oligochaeta, Kin: Kinorhyncha
Station
3
0-2 cm
2-4 cm
4-6 cm
Total
4
0-2 cm
2-4 cm
4-6 cm
Total
5
0-2 cm
2-4 cm
4-6 cm
Total
Nem
Cop
Nau
Pol
Aca
Cum
Gas
Olig
Kin
98.3
97.2
82.4
96.3
0.25
0.60
0.23
0.20
0.13
3.57
0.55
-
0.65
2.70
13.40
2.54
-
0.55
0.35
-
-
97.6
95.9
72.4
95.9
0.78
0.63
0.66
1.60
0.63
-
0.11
4.10
25.20
2.10
0.06
0.04
0.17
0.13
0.79
0.04
0.61
0.49
97.1
97.2
90.5
97
0.64
0.31
0.57
0.31
3.17
0.12
0.05
0.04
1.80
6.40
0.41
-
0.29
0.31
0.29
-
1.90
1.60
18% and 6.8% respectively for the total meiofauna.
Nevertheless, without considering the nematode
abundances this proportion changed between stations.
At stn. 3 the higher proportion of specimens, 51.8%,
was concentrated at 4-6 cm sediment layer. At stn. 4
specimens were slightly more abundant at 0-2 cm
6927
Figure 2. Light microscope photographs of meiofaunal taxa found at Valparaiso Bay. a) Nematoda, b) Copepoda,
c) Nauplii, d) Gastrotricha, e) Kinorhyncha, f) Oligochaeta, g) Polychaeta, h) Cumacea, i) Acari.
Figure 3. Meiofauna mean abundance in each sampling station. a) Nematoda, b) Copepoda, c) Acari, and d) Total
meiofauna. Error bars indicate the standard deviation.
9287
Figure 4. Mean abundance vertical distribution at 0-2, 2-4 and 4-6 cm sediment layers. a) Nematoda (all stations), b) Station 3,
c) Station 4, and d) Station 5. Graphs b, c and d: nematodes excluded.
(47.7%), while that at stn. 5 the distribution was closer
to the overall pattern (nematodes included) with 79.4%
at 0-2 cm sediment layer.
Relationships between environmental parameters
and meiofauna
The results of the CCA are shown in Fig. 5. Only the
five environmental variables that explained most of the
variance were included in the analysis (i.e., Depth, C/N,
Allochthonous OM, TOC and Redox potential). When
the abundance of the dominant meiofaunal groups is
related to the environmental variables the first CCA
axis eigenvalues accounted for 89.8% of the total
variance and the second CCA axis eigenvalues
accounted for 10.3% of the explained variance. This
suggests a relatively good dispersal of the biological
data along the different axis in both analyses. For the
meiofauna composition, the first axis reveals gradients
influenced by allochthonous content of organic matter
(r = 0.99), C/N ratio (r = 0.96) and depth (r = -0.85),
while the second axis reflects a gradient influenced by
TOC (r = 0.97) and redox potential (r = -0.84). In terms
of meiofauna composition, Nematoda was the
dominant group in all stations, but Cumacea and
Oligochaeta were more representatives in stn. 4, while
Polychaeta and Kinorhyncha in stn. 5.
DISCUSSION
Environmental parameters
Meiofaunal assemblages at central Chile are influenced
by the Equatorial Subsurface Water (ESSW), which
flows poleward over the shelf and upper slope (Sellanes
& Neira, 2006). This water mass has low oxygen
concentrations and is the source of coastal upwelling
that drives high primary production (Fossing et al.,
1995; Daneri et al., 2000) and generates the food supply
to the seabed (Gutiérrez et al., 2000). The C/N ratio
value recorded in this study was 10.93 on the outer
continental shelf. This value indicates that accumulated
organic matter has been decomposed from nitrogen
compounds (Scheffer & Schachtschabel, 1984). C/N
ratio values in the first few centimeters of sediment
were similar to values found off Peru with 9.8 (Levin et
al., 2002) and higher in comparison to values recorded
in Concepción Bay by Veit-Köhler et al. (2009) and
Neira et al. (2013) with 7.8 and 7.06, respectively. TOC
contents in the study area were similar to those recorded
by Neira et al. (2013) off Concepción at 122 m depth
with 46.91 mg g-1. In comparison with other upwelling
areas, TOC values were also similar to those reported
at the Arabian Sea (14.3-54.3 mg g-1) (Smallwood &
Wolff, 2000), but lower that those recorded off Peru
8929
Figure 5. Canonical correspondence analysis displaying the meiofaunal groups in relation to environmental variables that
best explain the abundance distribution among stations. Relationships were significant (P < 0.05).
(>205 mg g-1) (Neira et al., 2001b). The concentrations
of Chl-a and Phaeop in the current research were lower
than found in studies made by Neira et al. (2013)
(124.62 and 196.76 µg g-1, respectively). However,
they were higher than those recorded by Neira et al.
(2001b) (4.30 µg g-1) on the continental slope off Peru.
Meiofauna
It is known that habitat heterogeneity due to physical or
chemical properties of the sediment would be an
important factor controlling the meiobenthos
community structure (Gooday et al., 2010). In physical
terms the grain size variations recorded were not
important as correlations with meiofaunal groups were
not found. However in chemical terms in addition to
the DO, content of organic matter, Chl-a and CPE
decreased with depth and significant correlations were
found between meiofauna abundance and organic
content (C/N, Allochthonous organic matter and TOC),
depth and redox potential sediment parameters. For
instances, the organic matter content, Chl-a and DO
were positively correlated with meiofauna abundance
in Concepción Bay (Neira et al., 2013; Sellanes et al.,
2003; Sellanes & Neira, 2006; Veit-Köhler et al.,
2009). In our study area, nematodes constitute more
than 95% of total meiofauna abundances, being
considered the taxon that can best cope with low
oxygen conditions and high organic matter content on
the sediments. In fact, only meiofauna is well adaptated
to low oxygen in the suboxic to anoxic layers
(Braeckman et al., 2013). In this sense the deeper
vertical distribution of Acari and nauplii larvae in some
sedimentos layers, where negative values of redox
potential were recorded, would demonstrate this kind
adaptation in the current study.
Table 3 shows the meiofaunal abundance from
different locations with similar characteristics to
Valparaíso Bay. The total abundances of nematodes at
the three stations were slightly higher than those
reported by Sellanes et al. (2003) and Veit-Köhler et al.
(2009) for the continental shelf off central Chile. Mean
abundances recorded on the inner and outer continental
shelf in the current study (Fig. 3d) were similar to those
described by De Bovée et al. (1996), where meiofaunal
9309
Table 3. Comparison of meiofaunal abundances among areas sharing similar characteristics with Valparaíso Bay and/or
adjacent continental shelf. Abundances reported as ind 10 cm -2.
Zone
Arabian Sea
Southeast continental shelf of India
Continental shelf Perú (12°S)
Atacama Trench
Continental shelf central Chile
Continental shelf central Chile
Continental shelf, Valparaiso Bay
Depth (m)
400
75-100
100-150
305
1.050
7.800
88
120
126
80
100
140
Environment
Upwelling
Upwelling
OMZ
Bathyal depths
Hadal depths
OMZ
OMZ
OMZ
Seasonal hypoxia
Seasonal hypoxia
Seasonal hypoxia
densities ranged between 1.000 and 2.000 ind 10 cm-2
from subtidal muddy environments. It is important to
note that the study area is influenced by a seasonal
hypoxia with DO concentrations about 2.34 mL L-1,
while low oxygen levels (<0.5 mL L-1) have been
documented at Concepción bay. Indeed, low oxygen
levels have been registered on the continental shelf off
Peru (Neira et al., 2001b) and in the Arabian Sea (Cook
et al., 2000), where nematodes abundance appear to be
similar to our study. On the other hand, the number of
taxonomic groups found in this study (9 taxa) was
lower than observed for Concepción Bay by Sellanes et
al. (2003) with 13 taxa and for Chiloé, southern Chile
by Veit-Köhler et al. (2009) where 16 taxa were
recorded. This minor presence of taxonomic groups
could be explained by nematode dominance (total
abundance >95%) (Table 2) or due to minor number of
samples considered. Levin et al. (1991) and Neira et al.
(2001b) argue that these organisms are highly
successful in sediments rich on organic matter and with
low dissolved oxygen concentrations. In this respect the
organic matter content averaged 7.13% in surficial
sediments (0-2 cm) while hypoxic conditions were
recorded (Table 2). These authors affirm that the
oxygen could control the meiofauna composition at
level of major taxonomic groups within the OMZ
zones.
Meiofauna vertical distribution is mainly controlled
by food deficiency and oxygen availability with around
90% of total meiofauna being concentrated between 05 cm sediment layers (Giere, 2009). In our study, 93%
of total meiofauna was concentrated in the 0-4 cm
sediment layer (Fig. 4a) which could be an adaptive
response related to their trophic strategies. However
our results suggest that this vertical distribution pattern
would be mainly determined by higher concentrations
Nematode
abundance
1.700
1.502 ± 430
498 ± 157
5.072 ± 2.344
1.193 - 2.417
738 - 1.268
1.555 - 3.077
2.136 ± 633
1.528 ±138
1.687 ± 69
Total
meiofauna
700
800
1.517 ± 431
550 ± 186
6.378 ± 3,061
1.202 - 2.433
895 - 1.318
1.577 - 3.229
2.218 ± 643
1.592 ± 148
1.739 ± 82
Reference
Cook et al. (2000)
Ansari et al. (2012)
Neira et al. (2001b)
Danovaro et al. (2002)
Sellanes et al. (2003)
Veit-Köhler et al. (2009)
This study
of fresh organic content in the surficial sediment layers.
It is well know that nematodes have a wide variety of
trophic strategies from carnivore predators to
bacterivorous guilds (Wieser, 1960; Neira et al., 2013)
and they are dominants in all type of sediments
inhabiting in both oxidized and reduced conditions.
However a trophic guild classification was not made for
this study, although some similar trophic strategies to
those reported by Neira et al. (2013) for Concepción
could be found. In addition, nematodes dominance is
thought to be the result of the capacity to tolerate low
oxygen conditions and the reduced predation
pressure/competition as a result of the higher sensitivity
of other benthic organisms to hypoxia/anoxia (Neira et
al., 2001a, 2001b; Levin et al., 2002). The results
recorded in the current study showed that the vertical
distribution of nematode abundances changed mainly
between 2-4 and 4-6 cm sediment layers (Table 2). This
minor relative abundance that was clearly observed at
station 4, where a higher proportion of sand was
recorded, could be explained by the higher relative
abundance of Acari and nauplii at 4-6 cm layer. This
could be suggesting a nematode response to
competition with other taxa or sensitivity to redox
potential conditions of the sediments as revealed by
CCA.
Gastrotrichs, kinorhynchs and copepods concentrated their abundances in the first centimeters of the
sediment. The vertical distribution in these groups
could be explained by their sensitivity to low levels of
DO, their morphology and body size (Giere, 2009). In
the case of copepods they could be unable to easily
adapt to interstitial environments. A different vertical
distribution pattern was observed for nauplii and Acari.
Nauplii did not show a higher abundance in surficial
sediment layers, with wide vertical variation between
931
10
stations. Contrastingly, Acari were mainly distributed
in sub-surficial sediment layers (2-4 and 4-6 cm) at all
stations. Vertical distribution pattern for nauplii and
Acari could be associated to predation pressure and
bioturbation in surficial sediment where the competition for habitat and fresh food supply is very high. For
instances, a similar vertical distribution pattern also
have been recorded for Acari (Acarina) in seamounts
(Zeppilli et al., 2013).
It is known that oceanographic characteristics along
the continental margin off central Chile are influencing
the spatial distribution of mega-, macro- and
meiobenthic communities (e.g., Palma et al., 2005;
Quiroga et al., 2009; Sellanes & Neira, 2006). In fact,
the effects of upwelling under normal, ENSO and
OMZs conditions have been well documented off
central Chile (Neira et al., 2013; Sellanes et al., 2003;
Sellanes & Neira, 2006), the continental shelf off Peru
(Neira et al., 2001b; Levin et al., 2002) and in the
Arabian sea (Cook et al., 2000; Gooday et al., 2000).
From these studies, the organic matter quality and
oxygen availability have been the main variables
explaining the meiofauna community structure. In the
current study the organic content of the sediments
comes from primary production together to redox
potential and depth were the only environmental
variables explaining the distribution of meiofauna
groups, while oxygen levels were not correlated. The
composition, abundance and distribution of the
meiobenthic community provided in this study
represents a non-ENSO condition and can be useful as
a baseline for future descriptions of this relevant
oceanographic phenomena, which has already been
confirmed for the South Pacific Ocean by 2015
(National Wheather Service, 2014). Time series studies
are suggested to assess the ecological response of these
assemblages to conditions before mentioned and to
another such as OMZ and upwelling seasonal changes.
ACKNOWLEDGEMENTS
Authors wish thank to Francisco Gallardo for his field
work assistance. Williams Caballero thanks to Meioscool
International Workshop 2013 organization and
Universidad of Valparaíso for the financial support to
attend to Meioscool International Workshop held in
Brest, France. Authors also thank to Benjamin Ganga
for the statistical analyses support and Carlos Neira
(Scripps, UCSD) for his comments and assistance for
improving this manuscript. This research was funded
by Fondecyt 11121487 grant from National Science
and Technology Commission belonging to the Chilean
Education Ministry.
REFERENCES
Andrade, H. 1986. Observaciones biológicas sobre
invertebrados demersales de la zona central de Chile.
In: P. Arana (ed.). La pesca en Chile, Universidad
Católica de Valparaíso, Ediciones Universitarias,
Valparaíso, pp. 51-56.
Andrade, H. 1987. Distribución batimétrica y geográfica
de macro-invertebrados del talud continental de Chile
central. Cienc. Tecnol. Mar, 11: 61-94.
Andrade, H., S. Gutiérrez & A. Salinas. 1986. Efectos del
vertimiento de desechos orgánicos no tratados sobre la
macroinfauna bentónica de un sector de la bahía de
Valparaíso (Chile). Cien. Tecnol. Mar, 10: 21-49.
Ansari, K.G.M.T., P.S. Lyla & S.A. Khan. 2012. Faunal
composition of metazoan meiofauna from the
continental shelf of India. Indian J. Geomar. Sci.,
41(5): 457-467.
Arntz, W., J. Tarazona, V.A. Gallardo, L. Flores & H.
Salzwedel. 1991. Benthos communities in oxygen
deficient shelf and upper slope areas of the Peruvian
and Chilean Pacific coast, and changes caused by El
Niño. Geol. Soc., 58: 131-154.
Asencio, G., E. Clasing, C. Herrera, R. Stead & J.M.
Navarro. 1995. Larval development of Amphiascopsis
cinctus Claus, 1866 (Harpacticoida: Diosaccidae) and
Laophonte parvula Sars, 1908 (Harpacticoida:
Laophontidae). Rev. Chil. Hist. Nat., 68: 283-301.
Bello, M. & J. Maturana. 2004. Condiciones oceanográficas frente a Valparaíso durante la fase fría del
ciclo ENOS 1997-2000. In: S. Avaria, J. Carrasco, J.
Rutllant & E. Yáñez (eds.). El Niño-La Niña 19972000, sus efectos en Chile. Comité Oceanográfico
Nacional, Valparaíso, pp. 29-42.
Blott, S.J. & K. Pye. 2001. Gradistat: a grain size
distribution and statistics package the analysis of
unconsolidated sediments. Earth Surf. Process.
Landforms, 26(11): 1237-1248.
Boyd, S.E., H.L. Rees & C.A. Richardson. 2000.
Nematodes as sensitive indicators of change at
dredged material disposal sites. Estuar. Coast. Shelf
Sci., 51: 805-819.
Braeckman, U., J. Vanaverbeke, M. Vincx, D. van
Oevelen & K. Soetaert. 2013. Meiofauna metabolism
in suboxic sediments: currently overestimated. PLoS
ONE 8(3): e59289. doi:10.1371/journal.pone.0059
289.
Brandhorst, W. 1971. Condiciones oceanográficas estivales frente a la costa de Chile. Rev. Biol. Mar., 14(3):
45-84.
Byers, S.C., E.L. Mills & P.L. Stewart. 1978. A comparison of methods of determining organic carbon in
marine sediments, with suggestions for a standard
method. Hydrobiologia, 58(1): 43-47.
Chen, G.T., R.L. Herman & M. Vincx. 1999. Meiofauna
communities from the Straits of Magellan and the
Beagle Channel. Sci. Mar., 63(Suppl. 1): 123-132.
Cline, J.D. 1969. Spectrophotometric determination of
hydrogen sulfide in natural waters. Limnol. Oceanogr.,
14: 454-458.
Cook, A.A., P.J. Lambshead, L.E. Hawkins, N. Mitchell
& L.A. Levin. 2000. Nematode abundance at the
oxygen minimum zone in the Arabian Sea. Deep-Sea
Res. II, 47: 75-85.
Cowie, G.L. 2005. The biogeochemistry of Arabian Sea
surficial sediments: a review of recent studies. Prog.
Oceanogr., 65: 260-289.
Daneri, G., V. Dellarossa, R. Quiñones, B. Jacob, P.
Montero & O. Ulloa. 2000. Primary production and
community respiration in the Humboldt Current
System off Chile and associated oceanic areas. Mar.
Ecol. Prog. Ser., 197: 41-49.
Danovaro, R., C. Gambi & N. Della-Croce. 2002.
Meiofauna hotspot in the Atacama Trench, eastern
South Pacific Ocean. Deep-Sea Res. I, 49(5): 843-857.
De Bovée, F., P.O.J. Hall, S. Hulth, G. Hulthe, A. Landen
& A. Tengberg. 1996. Quantitative distribution of
metazoan meiofauna in continental margin sediment
of the Skaggerak (Northeastern North Sea). J. Sea
Res., 35(1): 189-197.
Fenchel, T.M. 1978. The ecology of micro- and
meiobenthos. Annu. Rev. Ecol. Syst., 9: 99-121.
Folk, R.L. 1980. Petrology of sedimentary rocks.
Hemphill Publishing Company, Austin, 181 pp.
Fossing, H., V.A. Gallardo, B.B. Jørgensen, M. Hüttel,
L.P. Nielsen, H. Schulz et al. 1995. Concentration and
transport of nitrate by the mat-forming sulphur
bacterium Thioploca. Nature, 374: 713-715.
Fuenzalida, R., W. Schneider, J. Garcés-Vargas, L. Bravo
& C. Lange. 2009. Vertical and horizontal extension
of the oxygen minimum zone in the eastern South
Pacific Ocean. Deep-Sea Res. II, 56: 992-1003.
Gallardo, V.A., M. Palma, F.D. Carrasco, D. Gutiérrez,
L.A. Levin & J.I. Cañete. 2004. Macrobenthic
zonation caused by the oxygen minimum zone on the
shelf and slope off central Chile. Deep-Sea Res. II, 51:
2475-2490.
Gambi, C., A. Vanreusel & R. Danovaro. 2003.
Biodiversity of nematode assemblages from deep-sea
sediments of the Atacama Slope and Trench (South
Pacific Ocean). Deep-Sea Res. I, 50: 103-117.
George, K.H. & H.K. Schmink. 1999. Sublittoral
Harpacticoida (Crustacea, Copepoda) from the
Magellan Straits and the Beagle Channel (Chile).
932
11
Preliminary results on abundances and generic
diversity. Sci. Mar., 63 (Suppl. 1): 133-137.
Gerlach, S.A. 1971. On the importance of marine meiofauna for benthos communities. Oecologia, 6: 176190.
Giere, O. 2009. Meiobenthology. The microscopic fauna
in aquatic sediments. Springer Verlag, Berlin, 538 pp.
Gooday, A.J., J.M. Bernhard, L.A. Levin & S.B. Suhr.
2000. Foraminifera in the Arabian Sea oxygen
minimum zone and other oxygen-deficient settings:
taxonomic composition, diversity, and relation to
metazoan faunas. Deep-Sea Res. II, 47: 25-54.
Gooday, A.J., B.J. Bett, E. Escobar, B. Ingole, L.A. Levin,
C. Neira, A.V. Raman & J. Sellanes. 2010. Habitat
heterogeneity and its influence on benthic biodiversity
in oxygen minimum zones. Mar. Ecol., 31: 125-147.
Gooday, A.J., LA Levin, A. Aranda da Silva, B.J. Bett,
G.L. Cowie, D. Dissard, et al. 2009. Faunal responses
to oxygen gradients on the Pakistan margin: a
comparison of foraminiferans, macrofauna and megafauna. Deep-Sea Res. II, 56: 488-502.
Gutiérrez, D., V.A. Gallardo, S. Mayor, C. Neira, C.
Vasquez, J. Sellanes, M. Rivas, A. Soto, F.D. Carrasco
& M. Baltazar. 2000. Effects of dissolved oxygen and
fresh organic matter on macrofaunal bioturbation
potential in sublittoral bottoms off central Chile,
during the 1997-1998 El Niño. Mar. Ecol. Prog. Ser.,
202: 81-99.
Gutiérrez, D., A. Sifeddine, J.L. Reyss, G. Vargas, F.
Velazco, R. Salvatecci et al. 2006. Anoxic sediments
off Central Peru record interannual to multidecadal
changes of climate and upwelling ecosystem during
the last two centuries. Adv. Geosci., 6: 119-125.
Hammer, O., D. Harper & P. Ryan. 2001. PAST: Palaeontological statistics, versión 0.96. Palaeontol. Electron.,
4(1): 9 pp.
Jongman, R., C. Ter Braak & O. van Tongeren. 1987. Data
analysis in community and landscape ecology.
PUDOC, Wageningen, 299 pp.
Knap, A., R. Michaels, R. Dow, K. Johnson, J. Gundersen,
A. Sorensen, F. Close, M. Howse, N. Hammer, A.
Bates & T. Waterhouse. 1993. Bermuda Atlantic timeseries study methods manual (Version 3). Bermuda
Biological Station for Research, U.S. JGOFS, 108 pp.
Lee, M.R., J.A. Correa & R. Seed. 2006. A sediment
quality triad assessment of the impact of copper mine
tailings disposal on the littoral sedimentary
environment in the Atacama region of northern Chile.
Mar. Pollut Bull., 52: 1389-1395.
Lee, M.R. & J.A. Correa. 2007. An assessment of the
impact of copper mine tailings disposal on meiofaunal
933
12
assemblages using microcosm bioassays. Mar.
Environ. Res., 64(1): 1-20.
Lee, M.R. & M. Riveros. 2012. Latitudinal trends in the
species richness of free-living marine nematode
assemblages from exposed sandy beaches along the
coast of Chile (18-42°S). Mar. Ecol., 33(3): 317-325.
Levin, L.A. 2003. Oxygen minimum zone benthos:
adaptations and community response to hypoxia.
Oceanogr. Mar Biol. Annu. Rev., 41: 1-45.
Levin, L.A., C.L. Huggett & K.F. Wishner. 1991. Control
of deep-sea benthic community structure by oxygen
and organic matter gradients in the Eastern Pacific
Ocean. J. Mar. Res., 49: 763-800.
Levin, L., D. Gutierrez, A. Rathburn, C. Neira, J. Sellanes,
P. Muñoz, V. Gallardo & M. Salamanca. 2002.
Benthic processes on the Peru margin: a transect across
the oxygen minimum zone during the 1997-1998 El
Niño. Prog. Oceanogr. 53: 1-27.
Moreno, R.A., R.D. Sepúlveda, E.I. Badano, S. Thatje, N.
Rozbaczylo & F.D. Carrasco. 2008. Subtidal
macrozoobenthos communities from northern Chile
during and post El Niño 1997-1998. Helgoland Mar.
Res., 62(1): 45-55.
Murrell, M.C. & J.W. Fleeger. 1989. Meiofauna
abundance on the Gulf of Mexico continental shelf
affected by hypoxia. Cont. Shelf Res., 9(12): 10491062.
National Weather Service. 2014. National Centers of
Environmental Prediction. [http://www.ncep.noaa.
gov]. Reviewed: 20 December 2013.
Neira, C., J. Sellanes, A. Soto, D. Gutiérrez & V. Gallardo.
2001a. Meiofauna and sedimentary organic matter off
Central Chile: response to changes caused by the 19971998 El Niño. Oceanol. Acta, 24: 313-328.
Neira, C., J. Sellanes, L.A. Levin & W.E. Arntz. 2001b.
Meiofaunal distributions on the Peru margin:
relationship to oxygen and organic matter availability.
Deep-Sea Res. I, 48: 2453-2472.
Neira, C., I. King, G. Mendoza, J. Sellanes, P. De Ley &
L.A. Levin. 2013. Nematode community structure
along a central Chile margin transect influenced by the
oxygen minimum zone. Deep-Sea Res. I, 18: 1-15.
Parsons, T.R., Y. Maita & C.M. Lalli. 1984. A manual of
chemical and biological methods for seawater
analysis. Pergamon Press, Oxford, 173 pp.
Palma, M., E. Quiroga, V.A. Gallardo, W.A. Arntz, D.
Gerdes, W. Schneider & D. Hebbeln. 2005.
Macrobenthic animal assemblages of the continental
margin off Chile (22° to 42°S). J. Mar. Biol. Assoc.
U.K., 85: 233-245.
Pfannkuche, O. & T. Soltwedel. 1998. Small benthic size
classes along the European continental margin: spatial
and temporal variability in activity and biomass. Prog.
Oceanogr., 42: 189-207.
Quiroga, E., J. Sellanes, W.E. Arntz, D. Gerdes, V.A.
Gallardo & D. Hebbeln. 2009. Benthic megafaunal
and demersal fish assemblages on the Chilean
continental margin: The influence of the oxygen
minimum zone on bathymetric distribution. Deep-Sea
Res. II, 56(16): 1112-1123.
Rodríguez, J.G., J. López & E. Jaramillo. 2001.
Community structure of the intertidal meiofauna along
a gradient of morphodynamic sandy beach types in
southern Chile. Rev. Chil. Hist. Nat., 74: 885-897.
Rutllant, J., B. Rosenbluth & S. Hormazabal. 2004.
Intraseasonal variability in the local wind forcing of
coastal upwelling off Central Chile (30°S). Cont. Shelf
Res., 24: 789-804.
Scheffer, F. & P. Schachtschabel. 1984. Lehrbuch der
Bodenkunde. Enke Verlag, Stuttgart, 442 pp.
Sellanes, J. & C. Neira. 2006. ENSO as a natural
experiment to understand environmental control of
meiofaunal community structure. Mar. Ecol., 27: 3143.
Sellanes, J., C. Neira & E. Quiroga. 2003. Composición,
estructura y flujo energético del meiobentos frente a
Chile central. Rev. Chil. Hist. Nat., 76: 401-415.
Sellanes, J., C. Neira, E. Quiroga & N. Teixido. 2010.
Diversity patterns along and across the Chilean
margin: a continental slope encompassing oxygen
gradients and methane seep benthic habitats. Mar.
Ecol., 31: 111-124.
Sellanes, J., E. Quiroga, C. Neira & D. Gutiérrez. 2007.
Changes of macrobenthos composition under different
ENSO cycle conditions on the continental shelf off
central Chile. Cont. Shelf Res., 27: 1002-1016.
Sievers, H. & A. Vega. 2000. Respuesta físico-química de
la bahía de Valparaíso a la surgencia generada en punta
Curaumilla y al fenómeno El Niño. Rev. Biol. Mar.
Oceanogr., 35(2): 153-168.
Silva, N. & A. Valdenegro. 2003. Evolución de un evento
de surgencia frente a Punta Curaumilla, Valparaíso.
Invest. Mar., Valparaiso, 31(2): 73-89.
Silva, N., C. Vargas & R. Prego. 2011. Land-ocean
distribution of allochthonous organic matter in the
surface sediments of the Chiloé and Aysén interior
seas (Chilean Northern Patagonia). Cont. Shelf Res.,
31: 330-339.
Smallwood, B.J. & G.A. Wolff. 2000. Characterization of
organic matter in sediments underlying the oxygen
minimum zone at the Oman Margin, Arabian Sea.
Deep-Sea Res. II, 47: 353-375.
Stead, R., A. Schmidt, S. Pereda, M. Anzieta, G. Asencio
& E. Clasing. 2011. Relación de la comunidad de
meiofauna y bioquímica del sedimento en canales
norpatagónicos. Cienc. Tecnol. Mar, 34(1-2): 49-68.
934
13
Teixeira, H., S.B. Weisberg, A. Borja, J.A. Ranasinghe,
D.B. Cadien, R.G. Velarde, L.L Lovell, D. Pasko, C.A.
Phillips, D.E. Montagne, K.J. Ritter, F. Salas & J.C.
Marques. 2012. Calibration and validation of the
AZTI’s Marine Biotic Index (AMBI) for Southern
California marine bays. Ecol. Indic., 12: 84-95.
Thiel, H., D. Thistle & G.D. Wilson. 1975. Ultrasonic
treatment of sediment samples for more efficient
sorting of meiofauna. Limnol. Oceanogr., 20: 472-473.
Ulloa, O. & S. Pantoja. 2009. The oxygen minimum zone
of the eastern South Pacific. Deep-Sea Res. II, 56: 987991.
Valderrama-Aravena, N., K. Pérez-Araneda1, J. AvariaLlautureo, C.E. Hernández, M. Lee & A. Brante. 2014.
Diversidad de nemátodos marinos de Chile continental
y antártico: una evaluación morfológica y molecular.
Rev. Biol. Mar. Oceanogr., 49(1): 147-155.
Veit-Köhler, G., D. Gerdes, E. Quiroga, D. Hebbeln & J.
Sellanes. 2009. Metazoan meiofauna within the
oxygen-minimum zone off Chile: results of the 2001PUCK expedition. Deep-Sea Res. II, 56: 1093-1099.
Wieser, W. 1960. Benthic studies in Buzzards Bay. II. The
meiofauna. Limnol. Oceanogr., 5: 121-137.
Zeppilli, D., L. Bongiorni, A. Cattaneo, R. Danovaro &
R.S. Santos. 2013. Meiofauna assemblages of the
Condor Seamount (North-East Atlantic Ocean) and
adjacent deep-sea sediments. Deep-Sea Res. II, 98: 87100.
Received: 9 January 2015; Accepted: 7 September 2015
Annex 1. Meiofaunal community composition and its relative abundance (%) in the study site.
Nematoda
Axonolaimidae sp.1
Odontophora sp.
Cyatholaimidae sp.1
Cyatholaimidae sp.2
Enoplidae
Ironidae
Oncholaimidae
Selachinematidae
Ceramonematidae
Ceramonema sp.
Pselionema sp.
Desmoscolecidae sp.1
Desmoscolecidae sp.2
Desmoscolex sp.
Oxystominidae
cf Halalaimus sp.
Diplopeltidae sp.1
Campylaimus sp.
Comesomatidae sp.1
Sabatieria sp.
Chromadoridae sp.1
Neochromadora sp.
Microlaimidae
Thoracostromopsidae
Acari (Halacarids)
Acari sp.1
Acari sp.2
Acari sp.3
Acari sp.4
Acari sp.5
Acari sp.6
Acari sp.7
Station 3
Station 4
Station 5
12
14
7
13
3
6
1
15
4
6
3
5
17
8
13
6
4
2
11
13
5
13
11
24
13
13
8
7
4
9
3
2
7
8
5
5
32
23
21
16
8
34
14
18
5
12
7
12
7
29
7
20
6
935
14
Continuation
Station 3
Acari sp.8
Acari sp.9
Copepoda (Harpacticoidea)
Copepoda sp.1
54
Copepoda sp.2
39
Copepoda sp.3
7
Copepoda sp.4
Copepoda sp.5
Copepoda sp.6
Nauplii larvae
Nauplii sp.1
47
Nauplii sp.2
36
Nauplii sp.3
17
Nauplii sp.4
Nauplii sp.5
Cumacea
Dyastilidae sp.1
Polychaeta
Paraonidae sp.1
Gastrotricha
Gastrotricha sp.1
75
Gastrotricha sp.2
25
Gastrotricha sp.3
Kinorhyncha
Kinorhyncha sp.1
Kinorhyncha sp.2
Oligochaeta
Oligochaeta sp.1
Station 4
10
46
17
25
12
Station 5
14
5
12
38
34
16
40
29
12
19
29
23
8
24
16
100
100
60
20
10
100
100
100
60
40
Lat. Am. J. Aquat. Res., 43(5): 936-943, 2015
Seasonal infestation of Excorallana berbicensis
9361
Research Article
First study on infestation of Excorallana berbicensis (Isopoda: Corallanidae) on
six fishes in a reservoir in Brazilian Amazon during dry and rainy seasons
Huann Carllo Gentil-Vasconcelos1 & Marcos Tavares-Dias1,2
1
Postgraduate Program on Tropical Biodiversity (PPGBIO)
Federal University of Amapá Macapá, AP, Brazil
2
Aquatic Organism Health Laboratory, Embrapa Amapá, Rodovia Juscelino Kubitschek
N°2600, 68903-419, Macapá, AP, Brazil
Corresponding Author: Marcos Tavares Dias ([email protected])
ABSTRACT. We analyzed the infestation levels of Excorallana berbicensis on Acestrorhynchus falcirostris,
Ageneiosus ucayalensis, Geophagus proximus, Hemiodus unimaculatus, Psectrogaster falcata and Serrasalmus
gibbus in a reservoir in the Araguari River basin, northern Brazil, during the dry and rainy seasons. For P.
falcata, the infestation levels due to E. berbicensis were greater during the rainy season. For all the species
studied, the peak parasite prevalence was in the month of highest rainfall levels and there were two peaks of
parasite abundance: one in the month with highest rainfall level and the other in the month of transition from
the rainy season to the dry season. In these hosts, around 70% of the E. berbicensis specimens were collected
during the rainy season. The body conditions of the hosts also did not suffer any seasonal influence. Despite the
differences in seasonal rainfall levels, there was no fluctuation in transparency, turbidity, pH, electric
conductivity, temperature and dissolved oxygen levels in the water, due to the stability of these parameters
during the seasonal cycle investigated in this artificial Amazon ecosystem. This was the first report on the
seasonality of infestation by E. berbicensis associated with fish.
Keywords: Excorallana berbicensis, isopod, ectoparasites, wild fish, seasonality, Amazon River.
Primer estudio de la infestación de Excorallana berbicensis
(Isopoda: Corallanidae) en seis peces en un embalse del Amazonas
brasileño durante las estaciones seca y lluviosa
RESUMEN. Se analizó los efectos de las estaciones seca y lluviosa sobre los niveles de infestación de
Excorallana berbicensis en Acestrorhynchus falcirostris, Ageneiosus ucayalensis, Geophagus proximus,
Hemiodus unimaculatus, Psectrogaster falcata y Serrasalmus gibbus en un embalse en la cuenca del Río
Araguari, norte de Brasil. Para P. falcata, la prevalencia y abundancia de E. berbicensis fue mayor en la estación
lluviosa. Para todas las especies estudiadas, la prevalencia máxima del parásito fue en el mes más lluvioso,
donde hubo máximos de abundancia de parásitos: una en el mes con mayores precipitaciones y la otra en el mes
de transición de la estación lluviosa a seca. En estos hospederos, se obtuvo alrededor del 70% de muestras de E.
berbicensis durante la estación lluviosa. Las condiciones del cuerpo de los hospederos tampoco sufrieron
influencia estacional. A pesar de las diferencias en los niveles estacionales de precipitaciones, no hubo
fluctuaciones en transparencia, turbidez, pH, conductividad eléctrica, temperatura y oxígeno disuelto en el agua,
debido a la estabilidad de estos parámetros durante el ciclo estacional analizado en este ecosistema artificial
Amazónico. Este es el primer registro sobre la estacionalidad de la infestación de E. berbicensis asociado a
peces.
Palabras clave: Excorallana berbicensis, isópodos, ectoparásitos, peces salvajes, estacionalidad, Amazónia.
__________________
2937
INTRODUCTION
Excorallana Stebbing, 1904 (Corallanidae) are isopods
consisting of 24 species (Schotte, 2014) occurring
predominantly in marine environments of tropical and
subtropical latitudes (Guzmán et al., 1988; Delaney
1989). They are associated especially with substrates
(Delaney, 1984; Hendrickx & Espinosa-Pérez, 1998;
Morgado & Tanaka, 2001). Corallanids of this genus
have also been occasionally described associated to
zooplankton (Guzmán et al., 1988), also collected from
the intertidal zone (Kensley et al., 1995) and to marine
fish species from different environments (Williams Jr.
& Bunkley-Williams, 1994; Semmens et al., 2006;
Álvarez-León, 2009). Some species of Excorallana
occur especially in environments of great depth
(Delaney, 1989), but only Excorallana berbicensis
Boone, 1918, E. tricornis occidentalis Richardson,
1905, E. quadricornis Hansen, 1890 and E. longicornis
Lemos de Castro, 1960 have been collected from
mangroves (Delaney, 1984). Corallanids are voracious
carnivore isopods that act as predators and also as
scavengers (Brusca & Wehrtmann, 2009). E. tricornis
occidentalis is a facultative parasite for many marine
fish and, when in massive infestations, it causes serious
damage to fishing of Epinephelus striatus Bloch, 1792
(Semmens et al., 2006). However, information on
Excorallana spp. on freshwater fish is scarce (Van
Name, 1925; Monod, 1969; Thatcher, 1995).
Excorallana spp. has mostly been studied regarding
their taxonomy (Van Name, 1925; Monod, 1969;
Delaney, 1984, 1989; Kensley et al., 1995; Thatcher,
1995; Hendrickx & Espinosa-Pérez, 1998), but a few
studies on their epidemiology in fish have been
conducted (Semmens et al., 2006).
Excorallana berbicensis was described parasitizing
Lycengraulis grossideus Spix & Agassiz, 1829 in rivers
from French Guiana (Van Name, 1925); a species of
shark in freshwater from Guyana (Monod, 1969); and
Ageneiosus inermis Linnaeus, 1766 from Amazon
River basin, in Brazil (Thatcher, 1995). However, in
addition to the small number of studies on E.
berbicensis in association with fish, there are no reports
regarding seasonal variation in infestation levels of
these isopods in host fish population.
In the Amazon region, seasonality influenced by
precipitation is characterized by two cycles, the rainy
and dry season (Souza & Cunha, 2010; Cunha et al.,
2013). These seasonal dynamics greatly influence in
ichthyofauna community structures (Galacatos et al.,
2004) and can also influence infracommunities of
parasites in fish populations. For different fish species
from Amazon, low levels of infestation by argulids
species have been reported in the dry season (Malta,
1982; Malta & Varella, 1983). In contrast, parasitism
by Dolops nana (Neves et al., 2013), Miracetyma sp.
(Vital et al., 2011) and Ergasilus turucuyus Malta &
Varella, 1996 (Vasconcelos & Tavares-Dias, 2014)
have not been found to be influenced by the dry season
or rainy season. However, Bauer & Karimov (1990)
argued that, in regions between the tropics, the
relatively constant climate does not favor seasonal
fluctuations of parasitism. In temperate climatic
regions, temperature has been considered to be the most
important factor influencing the seasonality of parasite
infracommunities. Consequently, it can directly or
indirectly influence ectoparasites crustacean infestations (Jones, 1974; Guzmán et al., 1988; Kadlec et al.,
2003; Pech et al., 2010; Alsarakibi et al., 2014). In the
Reservoir of the Coaracy Nunes hydroelectric power
plant in Araguari River basin, in the eastern Amazon
region (Northern Brazil), Ageneiosus ucayalensis
Castelnau, 1855; Hemiodus unimaculatus Bloch, 1794;
Serrasalmus gibbus Castelnau, 1855; Geophagus
proximus Castelnau, 1855, Acestrorhynchus falcirostris
Cuvier, 1819 and Psectrogaster falcata Eigenmann and
Eigenmann, 1889 are the most abundant fish species
(Sá-Oliveira et al., 2013, 2015). These six fish species
presents different life habits, once H. unimaculatus has
omnivorous diet, mainly consuming algae, detritus and
other aquatic invertebrates, and P. falcata is detritivorous, feeding on detritus and microorganisms
associated with the substrate. Geophagus proximus is
omnivorous, mainly feeding of plant material,
mollusks, insects and other aquatic invertebrates, and
A. ucayalensis is carnivorous, consuming fish, insects
and other aquatic invertebrates. Acestrorhynchus
falcirostris and S. gibbus are piscivorous fish (Santos et
al., 2004). However, the parasites fauna on fish of this
reservoir is few known (Vasconcelos & Tavares-Dias,
2014). Thus, the aim of study was to investigate the
prevalence and abundance of E. berbicensis in these six
species of fish from this Amazonian reservoir during
rainy and dry seasons.
Study area
The water Reservoir of the Coaracy Nunes Hydroelectric Power Plant (Fig. 1) is located in the
municipality of Ferreira Gomes, Amapá State, in the
eastern Amazon region (northern Brazil). Its area is
23.5 km2, capacity 138 Hm3 and average depth 15 m.
This reservoir began its operations in 1974 and is
connected to the Araguari River basin, which originates
south of the Lombada and Tumucumaque mountain
ranges and flows to the Atlantic Ocean (Bárbara et al.,
2010; Sá-Oliveira et al., 2013). This reservoir is a tran-
9383
Figure 1. Fish collection locality, in a reservoir from Araguari River basin, in the eastern Amazon region (Brazil).
sition area between lotic and lentic environments and
has marginal areas with only a few aquatic macrophytes, especially Eichhornia crassipes and Eleocharis
sp., and great quantities of decomposing arboreal
vegetation, due to non-deforestation of the area that was
destined for the reservoir.
Fish and collection procedures
For study of parasites, specimens of Acestrorhynchus
falcirostris (Acestrorhynchidae), Ageneiosus ucayalensis
(Auchenipteridae), Geophagus proximus (Cichlidae),
Hemiodus unimaculatus (Hemiodontidae), Serrasalmus
gibbus (Serrasalmidae) and Psectrogaster falcata
(Curimatidae) were collected in the Coaracy Nunes
Reservoir (Fig. 1), a long-established ecosystem, about
40 years (Sá-Oliveira et al., 2015). A total of 296 fish
specimens were caught during the dry season (October
2012 to February 2013) and rainy season (April to
August 2013) at six sampling points, located at a
distance of 889 ± 498 m (range: 544-1777 m) from each
other (Fig. 1), for analysis on the seasonal level of E.
berbicensis infestation. A total of 65 P. falcata, 63 A.
ucayalensis, 62 A. falcirostris, 56 H. unimaculatus, 36
S. gibbus and 14 G. proximus were examined. The fish
were caught using simple gill nets (20, 30, 40, 50 and
60 mm mesh), grouped into lengths of 100 m. These
nets were installed near the reservoir margins and were
left in the water for 12 h, with inspection every two
hours. This study was developed in accordance with the
principles adopted by the Brazilian College of Animal
Experimentation (COBEA).
Collection procedures and analysis of parasites
After the fish had been removed from the nets, the
mouth, integument and fins of each fish were
immediately examined for the presence of crustacean
parasites. The gills were collected and fixed in 5%
formalin, and then were examined with the aid of a
stereomicroscope to collect and count the parasites. The
crustacean species were conserved in 70% glycerinated
alcohol and were prepared for identification, following
the recommendations of Eiras et al. (2006).
The ecological descriptors used followed the
recommendations of Bush et al. (1997). Differences in
the prevalence of E. berbicensis between the rainy and
dry seasons, as well as between months were evaluated
using the chi-square test (2) with the Yates correction.
Differences in the abundance of E. berbicensis between
rainy and dry seasons were evaluated using the MannWhitney (U) test, and between months using KruskalWallis test (H). The Shapiro-Wilk test was used to
determine whether the parasite abundance presented
4939
normal distribution. Each fish was measured for body
weight (g) and length (cm), which were used to
determine the relative condition factor of the hosts/Kn
(Le-Cren, 1951). The Kn of the overall hosts was
compared with the Kn of the hosts during dry and rainy
seasons, using the Kruskal-Wallis test (Zar, 2010).
Water temperature, electric conductivity and
dissolved oxygen in water were obtained by means of
the YSI 85 multiparameter measuring device, and pH
by means of the YSI 60 pHmeter. Turbidity was
determined using the obtained by means of the Plus II
microprocessing turbidimeter. Transparency was
measured using Secchi’s disc. Rainfall levels were
obtained through the National Environmental Data
System (SINDA-INPE), from the Coaracy Nunes dam
hydrometeorological station.
RESULTS
The body parameters and number of the examined fish
by seasons are showed in Table 1. The physical and
chemical parameters, with the exception of rainfall
levels, were similar during the dry and rainy seasons
(Table 2).
Excorallana berbicensis infestations occurred on
the mouth, gills and integument of the hosts, except for
S. gibbus, which only had infestation on its integument.
Differences in the prevalence and abundance of this
corallanid only occurred in P. falcata, which were
greater during the rainy season (Table 3). In G.
proximus, infestations occurred only during the rainy
season, but the number of hosts examined was low.
In A. ucayalensis, A. falcirostris, H. unimaculatus,
S. gibbus, G. proximus and P. falcata, there was
seasonal fluctuation of E. berbicensis, with highest
prevalence in April and highest abundance in April and
August (Fig. 2). Considering all the hosts examined,
262 specimens of E. berbicensis were collected during
the dry season and 600 during the rainy season.
The Kn of the hosts parasitized by E. berbicensis did
not differ between the grouped hosts (overall), or
between the rainy season and dry season (Table 4). In
addition, for A. falcirostris (t = -0.014; P = 0.989), A.
ucayalensis (t = -0.058; P = 0.954), H. unimaculatus (t
= 0.006; P = 0.995), P. falcata (t = -0.005; P = 0.996)
and S. gibbus (t = -0.155; P = 0.877), the grouped Kn
also did not differ from the standard (Kn = 1), thus
indicating that the hosts presented good body condition.
DISCUSSION
In P. falcata, the levels of infestation by E. berbicensis
were greater during the rainy season. Similar seasonal
patterns were reported for abundance of infestations by
Dolops discoidalis Bouvier, 1899, D. bidentata
Bouvier, 1899 (Malta, 1982), D. striata Bouvier, 1899
and D. carvalhoi Lemos de Castro, 1949 (Malta &
Varella, 1983), in different fish of the Amazon region.
Pech et al. (2010) also reported that seasonal
fluctuation in rainfall levels influenced the levels of
infestation by Argulus sp. and Ergasilus sp. in
Cichlasoma urophthalmus Günther, 1862 from
Yucatan Peninsula (Mexico). In the Amazon region, the
environmental conditions during the rainy season are
favorable for reproduction of some ectoparasite
species, thus providing opportunities for encountering
infectious forms with their hosts and contributing
towards completing their life cycle (Vital et al., 2011).
However, in piranha Pygocentrus nattereri Kner, 1858,
Serrasalmus spilopleura Kner, 1858 and S. marginatus
Valenciennes, 1837 from Pantanal of Mato Grosso
(Brazil), infestation by D. carvalhoi, Argulus elongatus
Heller, 1857 and Argulus juparanaensis Lemos de
Castro, 1950 was greater during the dry season
(Carvalho et al., 2003).
Seasonal dynamics influence the environmental
quality of different natural ecosystems such as the
Araguari River basin, which has pH and dissolved
oxygen levels that are lower during the dry season in
the Amazon basin (Bárbara et al., 2010). During the
period of the present study, the water level in the
reservoir of the Coaracy Nunes hydroelectric power
plant was relatively constant during the entire year, as
also were the water temperature, electric conductivity,
dissolved oxygen, pH, turbidity and transparency,
which were similar during the rainy and dry seasons.
Thus, these factors did not influence the levels of
infestation by E. berbicensis in A. falcirostris, A.
ucayalensis, H. unimaculatus, G. proximus and S.
gibbus. However, Alsarakibi et al. (2014) reported that
the occurrence of A. japonicus Thiele, 1900 was
strongly influenced by pH, temperature, biochemical
oxygen demand, ammonia and dissolved oxygen levels
in the water. In river reservoirs, such as the one of the
present study, the reduction in water speed contributed
towards decreasing the turbidity, which consequently
could increase the population of parasite crustaceans, in
comparison with the river itself (Morley, 2007).
Carvalho et al. (2003) suggested that the behavior of S.
marginatus favored greater levels of infestation by
ectoparasite crustaceans in environments with higher
turbidity. Water turbidity also negatively affects
ectoparasite crustaceans, because particulate material
in suspension can cause damage to filtration and to
delicate feeding organs in planktonic stages (Morley,
2007). Therefore, crustacean ectoparasites seem to
have strong interaction with the environment and host
fish population, because these factors are directly invol-
9405
Table 1. Body parameters of six fish of a reservoir from Araguari River basin, in the eastern Amazon region (Brazil).
Season
Fish species
Acestrorhynchus falcirostris
Ageneiosus ucayalensis
Geophagus proximus
Hemiodus unimaculatus
Serrasalmus gibbus
Psectrogaster falcata
Length (cm)
18.2 ± 3.2
16.3 ± 2.8
14.4 ± 4.2
14.8 ± 2.3
10.9 ± 2.5
18.2 ± 3.9
Weight (g)
62.4 ± 36.0
39.7 ± 18.3
84.9 ± 77.5
51.5 ± 19.9
26.9 ± 36.6
138.4 ± 96.7
Dry
Rainy
N
44
48
4
42
12
35
N
18
15
10
14
24
30
Table 2. Physical and chemical parameters of the water in a reservoir from Araguari River basin, in the eastern Amazon
region (Brazil). Different values in the same column indicate differences according to the Mann-Whitney test (U) at the 5%
probability level. Precipitation: rainfall. NTU: nephelometric turbidity units.
Dry season
Rainy season
Precipitation Transparency
(mm)
(m)
87.6 ± 52.4b
1.3 ± 0.3a
317.5 ± 194.1a 1.1 ± 0.1a
Turbidity
Conductivity
pH
(NTU)
(µS/cm-1)
6.7 ± 1.9a 6.2 ± 0.5a 21.6 ± 2.8a
4.9 ± 2.1a 6.5 ± 0.2a 19.5 ± 0.9a
ved in their different life cycles and may cause different
responses to seasonal fluctuations in water levels.
The dry season was from September to February
and the rainy season was from March to August.
However, the lowest rainfall rates occurred from
September to November and the highest rates occurred
from March to May, while the months of June through
to August and December through to February were
transitional periods between the two seasonality
seasons. Although the levels of infestation by E.
berbicensis were influenced by seasonality only in P.
falcata, it was found when considering all hosts
together that the prevalence of this ectoparasite
presented a peak in the month of April, while the
abundance showed two peaks, one in April and the
other in August. These results possibly indicate that
there are two reproductive cycles for E. berbicensis:
one occurring in the rainiest month (April) and the other
at the beginning of the transition period (August).
Furthermore, the prevalence and abundance peaks of E.
berbicensis also coincided with the reproduction period
of these fish in the Araguari River basin region (Favero
et al., 2010). Massive infestation of E. tricornis
occidentalis was reported in E. striatus soon after their
spawning (Semmens et al., 2006).
In the region from Costa Rica, Guzmán et al. (1988)
observed that E. tricornis occidentalis has a migration
cycle over the course of the day, because were found
mostly in the water column during the night and it
migrates to the benthos during the day, particularly to
coral habitats or rocky substrates, in areas under strong
thermocline influence. Moreover, this marine coralla-
Temperature
(ºC)
28.9 ± 1.6a
26.5 ± 0.5a
Dissolved
oxygen (mg L-1)
5.2 ± 1.5a
5.2 ± 0.5a
nid presented an influence weaker during the dry
season (December to February). The high densities of
these corallanid parasites also suggested that there was
a seasonal effect relating to the beginning of the dry
season. These authors concluded then that the nocturnal
migration of these ectoparasites might be a form of
behavior aimed at saving resources and might be
related to predation of this isopod by fish and
planktonic invertebrates. Despite of the life history of
E. berbicensis is still little known, almost 70% of the
specimens of this parasite on fish we collected during
the rainy season. Although the migration of E.
berbicensis to the water surface was not evaluated here,
it was also found that there was greater presence of
these parasites during nighttime. However, this
migratory pattern still needs to be investigated.
The condition factor is a quantitative parameter of
fish wellbeing that is used in studies on the parasitehost relationship (Lizama et al., 2006; Guidelli et al.,
2011; Vasconcelos & Tavares-Dias, 2014). It was not
influenced by the rainy and dry seasons among the fish
investigated here, due to low abundance of parasites.
Similar results were reported for A. falcirostris and H.
unimaculatus from eastern Amazon parasitized by E.
turucuyus (Vasconcelos & Tavares-Dias, 2014).
However, high infestation of E. tricornis occidentalis
reduced the body condition of E. striatus in Costa Rica
(Semmens et al., 2006), due to the high cost of
parasitism to the hosts. Corallanid species have been
considered to be temporary parasites that change hosts
to feed (Bunkley-Williams & Williams Jr., 1998).
6941
Table 3. Seasonal variation of infestation by Excorallana berbicensis in fish species in a reservoir from Araguari River
basin, in the eastern Amazon region (Brazil). P: prevalence, MA: mean abundance, χ2: chi-square test for prevalence, U:
Mann-Whitney test for mean abundance, P: probability.
Dry season
Hosts fish
Serrasalmus gibbus
Geophagus proximus
P (%)
15.9
33.3
35.7
25.7
33.3
0
MA
0.9 ± 3.0
1.7 ± 3.6
1.3 ± 3.6
2.2 ± 4.3
0.3 ± 4.3
0
Rainy season
P (%)
38.9
40.0
7.1
53.3
12.5
40.0
MA
5.1 ± 17.3
2.9 ± 17.4
0.5 ± 19.1
6.8 ± 17.4
0.1 ± 18.4
8.5 ± 11.8
χ2
3.859
0.224
4.200
5.206
2.217
2.240
P
0.103
0.871
0.087
0.043
0.297
0.134
U
299.0
342.0
215.0
373.0
114.0
12.0
P
0.133
0.771
0.135
0.045
0.314
0.129
Table 4. Relative condition factor (Kn) for fish species in a reservoir from Araguari River basin, in the eastern Amazon
region (Brazil). Values in the same line with different letters indicate differences according to the Kruskal-Wallis test (H).
P: probability.
Hosts fish
Serrasalmus gibbus
Overall
1.00 ± 0.06a
1.00 ± 0.07a
0.99 ± 0.04a
1.00 ± 0.06a
1.00 ± 0.14a
Dry season
1.00 ± 0.03a
1.00 ± 0.06a
1.00 ± 0.03a
1.00 ± 0.04a
1.00 ± 0.11a
Rainy season
1.00 ± 0.09a
1.00 ± 0.07a
1.00 ± 0.03a
1.00 ± 0.05a
1.00 ± 0.08a
H
0.272
0.159
0.008
0.091
0.134
P
0.873
0.923
0.996
0.955
0.935
Figure 2. Seasonal fluctuation of infestation by Excorallana berbicensis in fish species in a reservoir from Araguari River
basin, in the eastern Amazon region (Brazil). Values above each column indicate the total number of hosts examined.
Different letters in each line indicate differences according to the Dunn test (P < 0.05). *Indicate differences between
prevalence according to the χ2 test (P < 0.05).
Therefore, the lack of studies on the biology of
isopods of the genus Excorallana makes exact
interpretation of their relationship with their hosts
difficult.
In summary, since the physical and chemical
characteristics of the artificial ecosystem investigated
were relatively homogeneous, except for rainfall levels,
this latter can be a factor causing the levels of
infestation of E. berbicensis in P. falcata. Moreover, as
P. falcata, A. falcirostris, A. ucayalensis, H. unimaculatus, G. proximus and S. gibbus presented seasonal
variation of infestation by E. berbicensis on a temporal
scale, and biological factors relating to these hosts and
parasites seemed to be influencing these infestations.
Since homogeneous conditions among environmental
parameters in the Amazon region are uncommon,
additional studies using more than one seasonal cycle
must be conducted to better comprehend the biology
and ecology of this Corallanidae in fresh water.
Investigation of whether the levels of infestation of E.
berbicensis in fish in this long-established reservoir in
the eastern Amazon are higher than the infestation in
fish in the Araguari River is also needed, because water
stability can restrict occurrences of these ectoparasites
in different aquatic systems, i.e., infestations are
possibly lower in fish in an environment of running
water, like the Araguari River.
ACKNOWLEDGEMENTS
The authors are grateful to the National Council for
Technological Research and Development (CNPq), for
the research scholarship granted to Tavares-Dias, M.;
to ICMBio, for the authorization for fish specimen
collection (License: 35636-1); and to Eletronorte-AP,
for logistic support.
REFERENCES
Alsarakibi, M., H. Wadeh & G. Li. 2014. Influence of
environmental factors on Argulus japonicus occurrence of Guangdong Province, China. Parasitol. Res.,
113: 4073-4083.
Álvarez-León, R. 2009. Asociaciones y patologías en los
crustáceos dulceacuícolas, estuarinos y marinos de
Colombia: aguas libres y controladas. Rev. Acad.
Colomb. Cienc. Exact., Fís. Nat., 33: 129-144.
Bárbara, V.F., A.C. Cunha, A.S.L Rodrigues & E.Q.
Siqueira. 2010. Monitoramento sazonal da qualidade
da água do rio Araguari/AP. Rev. Biociênc., 16: 57-72.
Bauer, O.N. & S.B. Karimov. 1990. Patterns of parasitic
infections of fishes in a water body with constant
temperature. J. Fish Biol., 36: 1-8.
Brusca, R.C. & I.S. Wehrtmann. 2009. Isopods. In. I.S.
Wehrtmann & J. Cortés (eds.). Marine biodiversity of
Costa Rica, Central America. Springer Science, New
York, pp. 257-264.
Bunkley-Williams, L. & H. Williams Jr. 1998. Isopods
associated with fishes: a synopsis and corrections. J.
Parasitol., 84: 893-896.
Bush, A.O., K.D. Lafferty, J.M. Lotz & A.W. Shostak.
1997. Parasitology meets ecology on its own terms:
Margolis revisited. J. Parasitol., 83: 575-583.
Carvalho, L.N., K. Del-Claro & R.M. Takemoto. 2003.
Host-parasite interaction between branchiurans (Crustacea: Argulidae) and piranhas (Osteichthyes:
942
7
Serrasalminae) in the Pant anal wetland of Brazil.
Environ. Biol. Fish., 67: 289-296.
Cunha, A.C., H.F.A Cunha & L.A.R. Pinheiro. 2013.
Modelagem e simulação do escoamento e dispersão
sazonais de agentes passivos no Rio Araguari -AP:
Cenários para a AHE Ferreira Gomes-I-Amapá/Brasil.
Rev. Brasil. Rec. Hídricos, 18: 67-85.
Delaney, P.M. 1984. Isopods of the genus Excorallana
Stebbing, 1904 from the Gulf of California, Mexico
(Crustacea, Isopoda, Corallanidae). Bull. Mar. Sci.,
34: 1-20.
Delaney, P.M. 1989. Phylogeny and biogeography of the
marine isopod family Corallanidae (Crustacea,
Isopoda, Flabellifera). Contrib. Sci. Nat. Hist. Mus.
Los Angeles County, 409: 1-75.
Eiras, J.C., R.M. Takemoto & G.C. Pavanelli. 2006.
Métodos de estudo e técnicas laboratoriais em
parasitologia de peixes. Eduem, Maringá, 199 pp.
Favero, J.M., P.S. Pompeu & A.C. Prado-Valladares.
2010. Biologia reprodutiva de Heros efasciatus
Heckel, 1840 (Pisces, Cichlidae) na reserva de
desenvolvimento sustentável Amanã-AM, visando seu
manejo sustentável. Acta Amazon., 40: 373-380.
Galacatos, K., R. Barriga-Salazar & D.J. Stewart. 2004.
Seasonal and habitat influences on fish communities
within the lower Yasuni River basin of the Ecuadorian
Amazon. Environ. Biol. Fish., 71: 33-51.
Guidelli, G., W.L.G. Tavechio, R.M. Takemoto & G.C.
Pavanelli. 2011. Relative condition factor and
parasitism in anostomid fishes from the floodplain of
the Upper Paraná River, Brazil. Vet. Parasitol., 177:
145-151.
Guzmán, H.M., V.L. Obando, R.C Brusca & P.M. Delane.
1988. Aspects of the population biology of the marine
isopod Excorallana tricornis occidentalis Richardson,
1905 (Crustacea: Isopoda: Corallanidae) at Cano
Island, Pacific Costa Rica. Bull. Mar. Sci., 43: 77-87.
Hendrickx, M.E. & M.D.C. Espinosa-Pérez. 1998. A new
species of Excorallana Stebbing (Crustacea: Isopoda:
Corallanidae) from the Pacific coast of Mexico, and
additional records for E. bruscai Delaney. Proc. Biol.
Soc. Wash., 111: 303-313.
Jones, M.B. 1974. Breeding biology and seasonal
population changes of Jaera nordmanninordica
Lemercier (Isopoda, Asellota). J. Mar. Biol. Assoc.
U.K., 54: 727-736
Kadlec, D., A. Šimková, J. Jarkovský & M. Gelnar. 2003.
Parasite communities of freshwater fish under flood
conditions. Parasitol. Res., 89: 272-283.
Kensley, B., G. Nelson & M. WSchotte. 1995. Marine
isopod biodiversity of the Indian River Lagoon,
Florida. Bull. Mar. Sci., 57: 136-142.
8943
Le-Cren, E.D. 1951. The length-weight relationship and
seasonal cycle in gonad weight and condition in the
perch (Perca fluviatilis). J. Anim. Ecol., 20: 201-219.
Lizama, M.L.A., R.M. Takemoto & G.C. Pavanelli. 2006.
Parasitism influence on the hepato, splenosomatic and
weight/length relation and relative condition factor of
Prochilodus lineatus (Valenciennes, 1836) (Prochilodontidae) of the upper Paraná River Floodplain, Brazil.
Rev. Brasil. Parasitol. Vet., 15: 116-122.
Malta, J.C.O. 1982. Os Argulídeos (Crustacea, Branchiura)
da Amazônia Brasileira. 2. Aspectos da ecologia de
Dolops geayi Bouvier, 1897 e Argulus juparanaensis
Castro, 1950. Acta Amazon., 12: 701-705.
Malta, J.C.O. & A.M.B. Varella. 1983. Os Argulídeos
(Crustacea: Branchiura) da Amazônia Brasileira. 3.
Aspectos da ecologia de Dolops striata Bouvier, 1899
e Dolops carvalhoi Castro, 1949. Acta Amazon., 13:
299-306.
Monod, T. 1969. Sur trois crustacés isopodes marins de la
région Guyane-Amazone. Cah. Orstom, Sér.
Océanogr., 7: 47-68.
Morgado, E.H. & M.O. Tanaka. 2001. The macrofauna
associated with the bryozoan Schizoporella errata
(Walters) in southeastern Brazil. Sci. Mar., 65: 173181.
Morley, N.J. 2007. Anthropogenic effects of reservoir
construction on the parasite fauna of aquatic wildlife.
EcoHealth, 4: 374-383.
Neves, L.R., F.B. Pereira, M. Tavares-Dias & J.L. Luque.
2013. Seasonal influence on the parasite fauna of a
wild population of Astronotus ocellatus (Perciformes:
Cichlidae) from the Brazilian Amazon. J. Parasitol.,
99: 718-721.
Pech, D., M.L.Aguirre-Macedo, J.W. Lewis & V.M.
Vidal-Martínez. 2010. Rainfall induces time-lagged
changes in the proportion of tropical aquatic hosts
infected with metazoan parasites. Inter. J. Parasitol.,
40: 937-944.
Sá-Oliveira, J.C., R. Angelini & V.J. Isaac-Nahum. 2015.
Population parameters of the fish fauna in a longestablished Amazonian reservoir (Amapá, Brazil). J.
Appl. Ichthyol., 31: 290-295.
Sá-Oliveira, J.C., H.C.G. Vasconcelos, S.W.M. Pereira,
V.J. Isaac-Nahum & A.P Teles-Junior. 2013. Caracterização da pesca no Reservatório e áreas adjacentes da
UHE Coaracy Nunes, Ferreira Gomes, Amapá-Brasil.
Biota Amazônia, 3: 83-96.
Received: 22 June 2015; Accepted: 21 September 2015
Santos, G.M., B. Mérona, A.A. Juras & M. Jégu. 2004.
Peixes do baixo Rio Tocantins: 20 anos depois da
Usina Hidrelétrica Tucuruí. Eletronorte, Brasília, 215
pp.
Semmens, B.X., K.E. Luke, Bush P.G., C.M.R. McCoy &
B.C. Johnson. 2006. Isopod infestation of post
spawning Nassau grouper around Little Cayman
Island. J. Fish Biol., 69: 933-937.
Schotte, M. 2014. Excorallana Stebbing, 1904. In: M.
Schotte, C.B. Boyko, N.L. Bruce, G.C.B. Poore, S.
Taiti & G.D.F. Wilson, (eds.). World marine, freshwater and terrestrial isopod crustaceans database.
Accessed through: world Register of Marine Species
at [http://www.marinespecies.org/aphia.php?p=taxedtails&id=248749]. Reviewed: 28 February 2015.
Souza, E.B. & A.C. Cunha. 2010. Climatologia de
precipitação no Amapá e mecanismos climáticos de
grande escala. In: A.C. Cunha, E.B. Souza & H.F.A.
Cunha (eds.). Tempo, clima e recursos hídricos resultados do projeto REMETAP no Estado do
Amapá. IEPA, Macapá, 216 pp.
Thatcher, V.E. 1995. Comparative pleopod morphology
of eleven species of parasitic isopods from Brazilian
fish. Amazoniana, 8: 305-314.
Van Name, W.G. 1925. The isopods of the Kartabo
Bartica District, British Guiana. Zoologica, 6: 461503.
Vasconcelos, H.C.G & M. Tavares-Dias. 2014. Influência
da sazonalidade na infestação de Ergasilus turucuyus
(Copepoda: Ergasilidae) em Acestrorhynchus falcirostris e Hemiodus unimaculatus (Osteichthyes:
Characiformes) do Reservatório Coaracy Nunes,
Estado do Amapá, Brasil. Biota Amazônia, 4: 106110.
Vital, J.F., Varella A.M.B., D.B. Porto & J.C.O. Malta.
2011. Sazonalidade da fauna de metazoários de
Pygocentrus nattereri (Kner, 1858) no lago Piranha
(Amazonas, Brasil) e a avaliação de seu potencial
como indicadora da saúde do ambiente. Biota
Neotropica, 11: 199-204.
Williams, Jr., E.H. & L. Bunkley-Williams. 1994. New
hosts and locality records for copepod and isopod
parasites of Colombian marine fishes. J. Aquat. Anim.
Health, 6: 362-364.
Zar, J.H. 2010. Biostatistical analysis, Prentice Hall, New
Jersey, 944 pp.
Lat. Am. J. Aquat. Res., 43(5): 944-952, 2015
Prebiotics in Nile tilapia diets
1
944
Research Article
Growth, immune status and intestinal morphology of Nile tilapia
fed dietary prebiotics (mannan oligosaccharides-MOS)
Ricardo Yuji-Sado1, Fernanda Raulino-Domanski2
Patricia Franchi de Freitas1 & Francielli Baioco-Sales3
1
Universidade Tecnológica Federal do Paraná, 85660-000, Dois Vizinhos, PR, Brazil
2
Bolsista Iniciação Científica CNPq, Universidade Tecnológica Federal do Paraná
85660-000, Dois Vizinhos, PR, Brazil
3
Programa de Pós-Graduação em Zootecnia PPGZO
Universidade Tecnológica Federal do Paraná 85660-000, Dois Vizinhos, PR, Brazil
Corresponding author: Ricardo Yuji-Sado ([email protected])
ABSTRACT. Farmers must conform to Best Management Practices in fish production such as the development
of non-antibiotic dietary supplements for fish growth and health management. We determined the effects of
increasing levels of dietary mannan oligosaccharides on growth, immune system and intestine integrity of Nile
tilapia. Fish (49.6 ± 10.8 g) were randomly distributed into 12 tanks (250 L; 20 fish per tank) and fed during 60
days with a practical diet supplemented with 0.0, 0.2, 0.4 and 0.6% dietary mannan oligosaccharides (n = 3).
Fish growth and immune system were not affected (P > 0.05) by treatments. Fish fed 0.4% prebiotic
supplementation presented increased (P < 0.05) intestinal fold height. Moreover, the intestine muscular layer
thickness was increased in fish fed 0.4 and 0.6% dietary prebiotic. After 60 days, there were no effects on
intestinal morphology. Studies regarding characterization of intestinal microbiota and experiment that reproduce
commercial fish production systems hearing conditions are necessary to determine the effective use of this
dietary supplement for the species.
Keywords: Oreochromis niloticus, fish, oligosaccharides, nutrition, immune system, aquaculture.
Crecimiento, estado inmunológico y morfología intestinal de la tilapia del Nilo
alimentadas con prebióticos (mananoligosacáridos-MOS) en la dieta
RESUMEN. Los acuicultores deben cumplir con buenas prácticas de gestión en la producción de peces, como
el uso de probióticos en la dieta, dado que las prácticas amigables com el medio ambiente merecen atención
creciente. Se determinó los efectos de los crecientes niveles de mananoligosacáridos en la dieta sobre el
crecimiento, sistema inmunológico y morfología intestinal de la tilapia del Nilo. Los peces (49,6 ± 10,8 g) fueron
distribuidos al azar en 12 estanques (250 L; 20 peces por estanque) y alimentados durante 60 días con una dieta
práctica suplementada con 0,0; 0,2; 0,4 y 0,6% de mananoligosacáridos (n = 3). El crecimiento de los peces y
el sistema inmunológico no fueron afectados (P > 0,05) por los tratamientos. En los peces alimentados com
probióticos durante 30 días se encontraron alteraciones histológicas. Los peces alimentados con 0,4% de
suplementación probiótica presentaron incremento (P < 0,05) de la altura de las pliegues intestinales. Además,
el espesor de la capa muscular del intestino se incrementó en los peces alimentados con 0,4 y 0,6% de probiótico
dietético. Después de 60 días no se observaron efectos sobre la morfología intestinal. Se requiere efectuar
estudios relativos a la caracterización de la microbiota intestinal y experimentos que reproducen las condiciones
de cultivo en los sistemas de producción de peces, para determinar el uso eficaz de este suplemento dietético
para esta especie.
Palabras clave: Oreochromis niloticus, peces, oligosacáridos, nutrición, sistema inmunológico, acuicultura.
INTRODUCTION
In animal production, including aquaculture, for
decades antibiotics are usually used to prevent diseases
__________________
Corresponding editor: Alvaro Bicudo
outbreaks or/and as growth promoters in subtherapeutic dosage that can select bacterial strains with
resistance to these antibiotics (Antibiotic Multiple
Resistance-AMR) and already described in Brazil in
2945
fish (Belém-Costa & Cyrino, 2006). Moreover, the
growing concern in public health, fish farmers must
conform to Best Management Practices (BMPs) in fish
production for human consumption (Boyd et al., 2005).
Attention start being given to the use of mannan
oligosaccharides (MOS) derived from yeast Saccharomyces cerevisiae. These molecules are easily isolated
from yeast cell wall as well as incorporated into fish
feed and do not cause environmental impact (Hisano et
al., 2004).
The effects of dietary MOS on growth and health
parameters have been recently performed in aquatic
animals such as European sea bass Dicentrarchus
labrax (Torrecillas et al., 2007), rainbow trout
Oncorhynchus mykiss (Staykov et al., 2007), Nile
tilapia (Sado et al., 2008), channel catfish Ictalurus
punctatus (Peterson et al., 2010), Atlantic salmon
Salmo salar (Refstie et al., 2010) and marron Cherax
tenuimanus (Sang et al., 2011) and promising results
such as improved weight gain, serum lysozyme
concentration and disease resistance were observed.
Fish immune system can recognizes non-selfmolecules (i.e., MOS prebiotic) through receptors that
identify molecular patterns, which are characteristic of
microbes (MAMPs-Microbe Associated Molecular
Patterns) that stimulates fish leukocytes to produce
lysozyme and others antimicrobial peptides (Song et
al., 2014). Moreover, MOS provide mannose substrate
upon which pathogenic gut bacteria selectively attach,
impairing the adhesion to enterocytes, leading to better
gut health and villi integrity and diet nutrients uptake
(Ghosh & Mehla, 2012).
The effect of dietary MOS on fish intestinal
morphology was described for several economic
important fish species (Dimitroglou et al., 2010a,
2010b; Genc et al., 2007; Pryor et al., 2003; Salze et
al., 2008; Zhou et al., 2010) including the Brazilian
Neotropical characin fish pacu, Piaractus mesopotamicus (Sado et al., 2014a). However, the use of MOS
as prebiotic in fish nutrition is still in infancy as well as
for the one of the most important fish in aquaculture,
the Nile tilapia. Therefore, this study was set out to
determine the effects of increasing levels of dietary
MOS supplementation on growth, immune system and
intestinal morphology of juvenile Nile tilapia.
Experimental design and animals
Trials were set up in water recirculation system, with
continuous aeration and temperature control. Juvenile
Nile tilapia (49.6 ± 10.8 g; 13.9 ± 7.1 cm) were
randomly distributed into 250 L polyethylene circular
tanks (20 fish per tank) in a totally randomized
experimental design with four treatments, 0.0, 0.2, 0.4
and 0.6% MOS (YES-MOS®, YES - YesSinergy do
Brasil Agroindustrial, Jaguariuna, Sao Paulo, Brazil)
dietary supplementation (n = 3). Fish were acclimated
to basal diet for 15 days prior experiment. Fish were fed
with experimental diets for 60 days until apparent
satiation (09:00 and 17:00h). Water quality parameters
(pH 7.3 ± 0.4; dissolved oxygen 4.12 ± 0.52 mg L-1 and
temperature 25.3 ± 1.2oC) were monitored electronically on a daily basis.
Experimental diets
A commercial fish feed formulation (PEIXES 32®,
Anhambi Alimentos Ltda., Itapejara do Oeste, Parana,
Brazil) was used for the basal experimental diets
composition (Table 1). Into this basal diet it was added
the respective treatments (0.0, 0.2, 0.4 and 0.6% dietary
MOS) and extruded. The extruded feeds were dried in
a forced ventilation oven at 45ºC for 24 h; and pellets
were packed in black plastic bags and stored under
refrigeration until use.
Growth parameters
At 30 and 60 days trial fish were fasted for 24 h and
sedated for biometrical procedures and growth
parameters calculated as follows: weight gain (WG (g)
Table 1. Chemical composition of basal, practical diet
(dry matter basis). *Anhambi Alimentos Ltda., Itapejara
do Oeste, Parana, Brazil. Vitamin and mineral supplementation per kg of feed: calcium (min-max):14-34 g kg-1,
phosphorous (min) 10 g kg-1, lysine 17 g kg-1, metionin
6100 mg kg-1, vitamin A (min) 15,000 UI kg-1, vitamin D3
(min): 3,000 UI kg-1, vitamin E (min): 180 mg kg-1,
vitamin K3 (min): 6.0 mg kg-1, vitamin B1 (min): 18 mg
kg-1, vitamin B2 (min): 32 mg kg-1 vitamin B6 (min): 22
mg kg-1, vitamin B12 (min): 40 mcg, vitamin C (min): 422
mg kg-1, nicotinic acid 150 mg kg-1, pantothenic acid 60
mg kg-1, folic acid (min): 10 mg kg-1, biotin (min): 1.50
mg kg-1, inositol (min): 238 mg kg-1, Fe (min): 65 mg kg-1,
Cu (min): 10.40 mg kg-1, Zn (min): 130 mg kg-1, Mg
(min): 65 mg kg-1, iodine (min): 1.30 mg kg-1, Se (min):
0.40 mg kg-1, cobalt (min): 0.35 mg kg-1, Sodium 2400 mg
kg-1, choline 350 mg kg-1, antioxidant 200 mg kg-1,
enzimatic aditive 125 mg kg-1.
Levels of guarantee (according to the manufacturer*)
Nutrient
Moisture (max)
Crude protein (min)
Crude fat (min)
Crude fiber (max)
Ash (max)
Content (g kg-1)
120
320
40
60
130
946
3
= FW-IW); feed consumption (FC); feed conversion
rate (FCR = FC/WG); specific growth rate (SGR (%
day-1) = 100 x [(lnFW-lnIW) / t]; feed efficiency (FE =
WG/FC); daily feed intake index (DFI = 100 x {FC/
[(FW-IW)/2]} /t) and condition factor (CF = WG/ [total
length]3). Where: FW = final weight (g); IW = initial
weight (g); t = experimental time (days); lnFW =
natural logarithm of final weight; lnIW = natural
logarithm of initial weight.
Growth parameters at 30 days trial was calculated
taken in account the biomass of 20 animals and for 60
days, 18 fishes, since two fishes from each replicate
was euthanized for histological procedures at 30 days
of experiment.
Histological procedures
Histological procedures were performed at 30 and 60
days trial. A snippet of the proximal intestine (3.0 cm
from pyloric sphincter) of two specimens from each
treatment replicate was sampled. Tissue samples were
washed with saline solution (0.6%) and fixed for 24 h
in Alfac solution. After 24 h, fixed samples were stored
in a 70% alcohol solution, dehydrated in ethanol,
diaphanized in xilol and blocked in histological
paraffin. Histological sections (5 µm) were stained with
haematoxylin and eosin (H & E) and documented
photographically with a digital camera (DCM 130E/1.3
megapixels, CMOS Software Scopephoto, China)
connected to a light microscope (EDUTEC 502 AC,
Brazil). The images were analyzed by using BEL
Eurisko Software (BEL-Engineering, Italy) for
intestinal fold height and muscular layer thickness
measures.
Immunological parameters
Immunological analyses were performed at 30 and 60
days trial. Four fish from each tank were anesthetized
in benzocaine solution (1:10,000) and blood samples
were drawn from caudal vessel using sterilized syringes
and separated into two 1.5 mL microtubes, one
containing EDTA for leukocyte respiratory burst and
the other with no anticoagulant for serum lysozyme and
total protein concentration.
Blood samples with EDTA were used for leukocyte
respiratory burst by NBT (Nitroblue tetrazolium)
colorimetric assay. To this, 100 µL of blood was added
to 100 µL of 0.2% NBT solution (Sigma, St Louis, MO,
USA), homogenized and incubated for 30 min at 25oC.
After the incubation, 50 µL of this suspension was
added to 1.0 mL of N, N-dimethylformamide (DMF,
Sigma, St Louis, MO, USA) and centrifuged (755 g) for
5 min. The absorbance of the supernatant was
determined using a spectrophotometer at 540 nm.
Lysozyme concentrations (LC) were determined
using fish serum from blood without EDTA based on
the lyses of Micrococcus lysodeikticus microorganism
by reduction of optical density during bacterial cell wall
lyses. Prior to fish serum analysis, it was determined
the calibration curve by quantification the difference of
optical density (ΔOD) (0.5 to 5 min) of different
concentrations of standard lysozyme (L 6876, Sigma,
St Louis, MO, USA) according to Abreu et al. (2009).
Serum samples were submitted to heat (56oC for 30
min) to inactivate complement system proteins and
certify that lysis of M. lysodeikticus had occurred solely
by lysozyme action. After this, 150 µL of fish serum
and 150 µL sodium phosphate buffer was dispensed
into glass cuvette and incubated at 26oC for 2 min in the
spectrophotometer and 300 µL of M. lysodeikticus
suspension (0.2 mg mL-1 sodium phosphate buffer) was
added to complete 600 µL final volumes. Difference
between the initial and final optical density (Δ OD) was
measured between 0.5 and 5 min in spectrophotometer
at 450 nm. The equation of lysozyme calibration curve
was used to determine the serum lysozyme levels (µg
mL-1).
Total serum protein concentrations were determined
using a portable refractometer (Biobrix 301/Protein
0.0-12 g dL-1) after blood sample without EDTA
centrifugation and serum collection.
Significant effects of dietary MOS levels for 30 and 60
days were determined by one-way analysis of variance
(ANOVA), at 5% probability. Brown and Forsythe and
Shapiro-Wilk test, respectively validated the assumption
of homogeneity of variance (homocedasticity) and
normalit-y. Means of statistically difference were
compared using Tukey's test (α = 0.05) (Steel & Torrie,
1980).
This research was approved by the Ethics
Committee on Animal Use (CEUA) of UTFPR
(protocol No2014-001).
RESULTS
Dietary MOS supplementation for 30 and 60 days to
juvenile Nile tilapia did not influenced (P > 0.05)
growth parameters (Table 2).
Histological analysis carried on this study revealed
increase (P < 0.05) in intestinal fold height (Fig. 1) and
muscular layer thickness (Fig. 2) between fish fed
control diet and MOS supplemented diets for 30 days.
Intestinal fold height was increased (P < 0.05) in
fish fed dietary MOS when compared to fish fed control
diet. Moreover, fish fed 0.4% dietary MOS presented
4947
Table 2. Growth parameters (µ ± SD) of Nile tilapia O. niloticus fed increasing levels of dietary mannan oligosaccharide
(MOS) for 30 and 60 days. *Mannan oligosaccharide-YES-MOS® (YES-YesSinergy do Brasil Agroindustrial, Jaguariuna,
São Paulo, Brazil). WG: weight gain, FC: feed consumption, FRC: feed conversion rate, SGR: specific growth rate, FE:
feed efficiency, DFI: daily feed intake index, CF: condition factor.
MOS* %
WG (g)
FC (g)
FCR
SGR (% day-1)
FE
DFI (%)
CF
0.0
797.5 ± 103.7
1161.6 ± 128.3
1.45 ± 0.04
1.93 ± 0.23
0.68 ± 0.02
1.66 ± 0,13
1.03 ± 0.20
MOS* %
WG (g)
FC (g)
FCR
SGR (% day-1)
FE
DFI (%)
CF
0.0
1562.6 ± 59.1
2363.5 ±161.6
1.51 ± 0.05
3.11 ± 0.13
0.66 ± 0.02
2.55 ± 0.16
1.03 ± 0.14
30 days
0.2
0.4
965.1 ± 113.7
921.0 ± 54.2
1118.8 ± 122.6
1270.9 ± 11.3
1.17 ± 0.24
1.38 ± 0.06
2.40 ± 0.26
2.18 ± 0.12
0.87 ± 0.21
0.72 ± 0.03
1.60 ± 0.23
1.75 ± 0.04
0.95 ± 0.15
0.86 ± 0.08
60 days
0.2
0.4
1548.0 ± 40.5
1566.2 ± 71.2
2385.1 ± 249.6
2139.3 ± 216.6
1.53 ± 0.13
1.36 ± 0.16
3.30 ± 0.14
3.15 ± 0.06
0.65 ± 0.05
0.73 ± 0.09
2.71 ± 0.20
2.34 ± 0.29
1.07 ± 0.14
1.03 ± 0.15
0.6
905.1 ± 51.6
1261.6 ± 29.4
1.39 ± 0.10
2.07 ± 0.10
0.71 ± 0.05
1.70 ± 0.11
0.85 ± 0,19
P-values
0.128
0.182
0.163
0.096
0.224
0.642
0.549
0.6
1637.9 ± 144.5
2400.6 ± 165.4
1.46 ± 0.10
3.13 ± 0.20
0.68 ± 0.04
2.49 ± 0.06
1.04 ± 0.01
P-values
0.618
0.399
0.399
0.440
0.384
0.229
0.982
Figure 1. Intestinal fold height of Nile tilapia O. niloticus
fed increasing levels of dietary mannan oligosaccharides
(MOS) for 30 and 60 days trial. Different letters above
same color columns indicate differences by Tukey test (α
= 0.05).
Figure 2. Intestinal muscular thickness of Nile tilapia O.
niloticus fed increasing levels of dietary mannan
oligosaccharides (MOS) for 30 and 60 days trial. Different
letters above same color columns indicate differences by
Tukey test (α = 0.05).
the highest (P < 0.05) intestinal fold height (430.27 ±
89.72 µm) compared to others treatments: control
(292.81 ± 45.11 µm), 0.2% (351.31 ± 56.00 µm) and
0.6% (348.23 ± 37.69 µm). Fish fed 0.4 and 0.6%
dietary MOS had significant increasing in muscular
layer thickness (72.5 ± 21.95 µm and 71.44 ± 24.48 µm,
respectively). After 60 days trial there were no effects
(P > 0.05) on gut morphology.
Fish immunological parameters also did not
influenced by dietary MOS (Table 3). Serum lysozyme
concentrations (LC) were determined based on
calibration curve equation (LC = 7150.7(Δ OD) +
50.793; R2 = 0.972).
948
5
Table 3. Immunological parameters (µ ± SD) of Nile tilapia O. niloticus fed increasing levels of dietary mannan
oligosaccharide (MOS) for 30 and 60 days. *Mannan oligosaccharide-YES-MOS® (YES-YesSinergy do Brasil
Agroindustrial, Jaguariuna, São Paulo, Brazil). Lys: serum lysozyme concentrations, Burst: leukocyte respiratory burst
activity, Prot: serum total protein concentration, DO: optical density.
MOS* %
Lys (µg mL-1)
Burst (DO)
Prot (g dL-1)
0.0
1.50 ± 0.16
0.268 ± 0.01
5.38 ± 0.42
MOS* %
Lys (µg mL-1)
Burst (DO)
Prot (g dL-1)
0.0
1.73 ± 0.18
0.304 ± 0.09
5.21 ± 1.37
30 days
0.2
0.4
1.50 ± 0.08
1.03 ± 0.38
0.269 ± 0.02 0.272 ± 0.02
5.78 ± 0.43
5.47 ± 0.52
60 days
0.2
0.4
1.67 ± 0.13
1.41 ± 0.21
0.346 ± 0.08 0.307 ± 0.07
5.85 ± 0.45
5.88 ± 1.06
DISCUSSION
Prebiotics in aquaculture are used to enhance fish
growth and disease resistance, improving economic
viability and sustainability of fish farming (Ringø et al.,
2010). Several studies have shown that dietary
prebiotics enhances growth and health of aquatic
animals (Sakai, 1999; Bricknell & Dalmo, 2005;
Mazlum et al., 2011).
Increased growth parameters in fish fed dietary
MOS was observed in rainbow trout (Staykov et al.,
2007), European sea bass (Torrecillas et al., 2007,
2011) and gilthead sea bream Sparus aurata (Gültepe
et al., 2011). However, dietary MOS in fish nutrition
are still controversial since some studies did not
observe improvements on growth parameters.
As herein observed, increasing levels of dietary
MOS did not affect fish growth and similar results was
observed for Nile tilapia supplemented for 45 days with
0.0, 0.2, 0.4, 0.6, 0.8 and 1.0% (Sado et al., 2008) and
0.0, 1.0, 2.0 and 3.0% MOS for 53 days trial (Schwarz
et al., 2010) as well as for pacu fed 0.2, 0.4, 0.6, 0.8,
1.0, 1.5 and 2.0% dietary MOS for 63 days (Sado et al.,
2014a).
In the same way, several authors observed no effects
on growth in another fish species such as for Gulf of
Mexico sturgeon Acipenser oxyrinchus desotoi fed
0.3% dietary MOS (Pryor et al., 2003), Atlantic salmon
Salmo salar fed 1.0% dietary MOS (Grisdale-Helland
et al., 2008), gilthead sea bream Sparus aurata fed 0.2
and 0.4% dietary MOS (Dimitroglou et al., 2010a) and
giant sturgeon Huso huso fed 0.2 and 0.4% dietary
MOS (Mansour et al., 2012).
The variability in results found in literature may be
explained by the complex carbohydrate structure
present in the cell wall of yeast, different strains and
fermentation conditions, processing methods can all
0.6
1.35 ± 0.04
0.268 ± 0.02
5.72 ± 0.26
P-values
0.245
0.986
0.196
0.6
1.49 ± 0.11
0.332 ± 0.07
5.81 ± 1.00
P-values
0.171
0.651
0.497
alter their function (Newman, 2007). Moreover,
depending on MOS concentration, administration
period, fish growing stage, rearing conditions, feed
formulation and extrusion procedures different results
can be presented (Pryor et al., 2003; Carvalho et al.,
2011; Peterson et al., 2012; Torrecillas et al., 2014).
Prebiotics are defined as short-chain carbohydrates
that modulate the composition and metabolism of the
microorganisms of the intestinal tract in a beneficial
way (Macfarlane et al., 2006). They are non-digestible
fibers by enzymes, acids and salts produced by the
animals’ digestion process, acting as a substrate,
stimulating the growth of beneficial bacteria in the
gastrointestinal system, which produce acids, which
decrease the concentration of bacteria and other
pathogenic microorganisms and protect the intestinal
mucosa (Song et al., 2014). This brings benefits to the
host with improvements in growth, digestion of
nutrients, immunity and resistance to disease (Burr &
Gatlin 2005).
Dietary MOS can enhance gut health by eliciting
better intestinal development and increase nutrient
absorption area and well documented in fish such as
cobia (Salze et al., 2008), red drum (Zhou et al., 2010),
gilthead sea bream (Dimitroglou et al., 2010a), white
sea bream (Dimitroglou et al., 2010b) and Nile tilapia
(Hisano et al., 2006; Carvalho et al., 2011), corroborating the results observed in this trial.
Mannan oligosaccharides provide mannose substrate
upon which pathogenic gut bacteria selectively attach.
The inhibition of pathogenic bacteria adhesion to
enterocyte prevents colonies formation and infection of
host cells, increasing gut health, regularity, height and
integrity of the gut tissue and consequent better
utilization and absorption of nutrients (Pryor et al.,
2003; Heidarieh et al., 2013).
6949
Contradictory results was observed for hybrid
tilapia (O. niloticus x O. aureus) (Genc et al., 2007) and
pacu (Sado et al., 2014a) fed increasing levels of
dietary MOS for 60 days and did not show improved
fold height. In addition, Pryor et al. (2003) also did not
find any significant difference in intestinal morphology
of sturgeons fed 0.3% MOS supplementation for 28
days and similar results were reported by Torrecillas et
al. (2007) for European sea bass fed diets containing
0.2 and 0.4% MOS for 48 days. Feeding 0.2 and 0.4%
dietary MOS to gilthead sea bream also did not result
in differences in gross intestinal and liver histology
(Dimitroglou et al., 2010a).
Although ultrastructural analysis were not performed, the increased fold height herein observed in fish
fed dietary MOS for 30 days that did not reflect better
growth could be explained by the impossibility to
observe integrity of intestinal brush border and
microvilli by optical microscopy (Sado et al., 2014a).
Ultrastructural analysis of anterior intestine of cobia
larvae fed rotifers enriched with 0.2% MOS showed
increased microvilli height (Salze et al., 2008) as well
as for gilthead sea bream fed 0.2 and 0.4% dietary MOS
(Dimitroglou et al., 2010a) and red drum fed 1% dietary
prebiotics such as MOS, FOS (fructooligosaccharides)
and GOS (galactooligosaccharides) (Zhou et al., 2010).
However, in both cases, in spite the fact that
ultrastructural analysis showed increased density of
microvilli structures and length that could improve the
potential of nutrient absorption, dietary MOS did not
influence the species’ growth rate and feed utilization.
Moreover, white sea bream larvae fed artemia enriched
with 0.2% MOS also showed improved intestinal
microvilli surface (about 12%) and length (Dimitroglou
et al., 2010b), but no effects on performance of fish
were reported.
Fish digestive system shows high phenotypic
plasticity in response to diet composition, and it is more
evident in omnivorous fishes (Gonçalves et al., 2011).
Oligosaccharides such as MOS can increase mucus
secretion by enterocytes that improves digest's
viscosity (Torrecillas et al., 2011). Therefore, the
increase in digest's viscosity could stimulate intestine's
muscular layer development to move the alimentary
bolus through digestive tract as herein observed.
The innate immune system of fish can recognize
non-self substances through protein recognition
receptors that identify molecular patterns, which are
characteristics of microbes (polysaccharides, lipopolysaccharide, peptidoglycans, bacterial DNA, and
double-stranded viral RNA) and not ordinarily found
on the surface of multicellular organisms, called
Pathogen Associated Molecular Patterns-PAMPs
(Rauta et al., 2014; Song et al., 2014).
Mannan oligosaccharides are compounds isolated
from cell wall of yeast Saccharomyces cerevisiae.
Thus, it can stimulate fish immune system such as
antibody production, leukocyte bactericidal, lysozyme
and complement activity, as observed for rainbow trout
(Staykov et al., 2007) and European seabass
(Torrecillas et al., 2007). In the same way, Labeo rohita
fish fed prebiotic for 28 and 42 days (Misra et al.,
2006a) or intraperitoneal injection (Misra et al., 2006b)
showed increase in lysozyme concentrations, demonstrating that time and via of administration can influence
the prebiotic effect.
Lysozyme is a molecule, primarily produced by
leukocytes for protection against microbial infection,
preventing bacteria invasion and infection (Saurabh &
Sahoo, 2008). After phagocytosis initiates by
leukocytes, increase in molecular oxygen consumption
occurs, known as respiratory burst. In this process, the
phagocytes produce reactive oxygen species that
contribute for microorganism destruction (BillerTakahashi; Urbinati, 2014).
However, in this trial it was observed no effect of
dietary MOS on fish immune status. This results can be
explained by the fact of the present work was
performed under ideal controlled laboratory conditions
and fishes were not challenged by biological and/or
ambient stressor that reproduces intensive fish
production system hearing conditions. In fact, when
fish is exposed to biological challenge, the potential
effect of dietary prebiotic on fish immune system can
be expressed as observed for snakehead (Channa
striata) fingerlings fed dietary prebiotics (MOS and
glucans) and probiotics after challenge with Aeromonas
hydrophila (Talpur et al., 2014).
Dietary MOS did not influence serum total protein
concentrations. However, rainbow trout fed dietary
prebiotic for seven days showed increase in total
plasmatic protein (Siwicki et al., 1994) as well as for L.
rohita (Misra et al., 2006a, 2006b). In addition, pacu
fed 0.2% dietary MOS also showed increased total
plasmatic protein (Sado et al., 2014b).
Total plasmatic protein represents several blood
peptides such as lysozyme, immunoglobulins and
albumin as well as complement factors (Misra et al.,
2006a). Thus, the result regarding total plasmatic
protein herein observed corroborate the absent of
significant effect of treatments on serum lysozyme
concentration.
This study shows the potential and functionality of
prebiotics compounds such as mannan oligosaccharides as dietary supplement for Nile tilapia to modulate
gut morphology. However, further researches must
focus experiments that reproduce commercial fish pro-
duction systems hearing conditions are necessary to
determine the effective use of this dietary supplement
for the specie.
ACKNOWLEDGMENTS
To Yes Sinergy (Jaguaiuna, SP, Brazil) for providing
the tested feed supplement-Yes-MOS®, Anhambi
Alimentos Ltda. (Itapejara do Oeste, PR, Brazil) for
providing the practical diet formulation and CNPq
(Proc. 474153/2011-8) for financial support.
REFERENCES
Abreu, J.S., C.M. Marzocchi-Machado, A.C. Urbaczek,
L.M. Fonseca & E.C. Urbinati. 2009. Leukocytes
respiratory burst and lysozyme level in pacu
(Piaractus mesopotamicus Holmberg, 1887). Braz. J.
Biol., 69(4): 1133-1139.
Belém-Costa, A. & J.E.P. Cyrino. 2006. Antibiotic
resistence of Aeromonas hydrophila isolated from
Piaractus mesopotamicus (Holmberg, 1887) and
Oreochromis niloticus (Linnaeus, 1758). Sci. Agric.,
63(3): 281-284.
Biller-Takahashi, J.D. & E.C Urbinati. 2014. Fish
immunology. The modification and manipulation of
the innate immune system: Brazilian studies. An.
Acad. Bras. Ciênc., 86(3): 1483-1495.
Boyd, C.E., A.A. McNevin, J. Clay & H.M. Johnson.
2005. Certification issues for some common
aquaculture species. Rev. Fish. Sci., 13: 231-279.
Bricknell, I. & R.A. Dalmo. 2005. The use of
immunostimulants in fish larval aquaculture. Fish
Shellfish Immunol., 19: 457-472.
Burr, G. & D. Gatlin. 2005. Microbial ecology of the
gastrointestinal tract of fish and the potential
application of prebiotics and probiotics in finfish
aquaculture. J. World Aquacult. Soc., 36(4): 425-436.
Carvalho, J.V., A.D. Lira, C.S.P. Costa, E.L.T. Moreira,
L.F.B. Pinto, R.D. Abreu & R.C.B. Albinati. 2011.
Desempenho zootécnico e morfometria intestinal de
alevinos de tilápia-do-Nilo alimentados com Bacillus
subtilis ou mananoligossacarídeo. Braz. J. Anim.
Health Prod., 12(1): 176-187.
Dimitroglou, A., D.L. Merrifield, P. Spring, J. Sweetman,
R. Moate & S.J. Davies. 2010a. Effects of mannan
oligosaccharide (MOS) supplementation on growth
performance, feed utilization, intestinal histology and
gut microbiota of gilthead sea bream (Sparus aurata).
Dimitroglou, A., S.J. Davies, J. Sweetman, D. Pascal & S.
Chatzifotis. 2010b. Dietary supplementation of
9507
mannanoligosaccharide on white sea bream (Diplodus
sargus L.) larvae: effects on development, gut morphology and salinity tolerance. Aquacult. Res., 41:
245-251.
Genc, M.A., E. Yilmaz, E. Genc & M. Aktas. 2007.
Effects of dietary mannan oligosaccharides (MOS) on
growth, body composition, and intestine and liver
histology of the hybrid tilapia (Oreochromis niloticus
x O. aureus). Isr. J. Aquacult., 59: 10-16.
Ghosh, S. & R.K. Mehla. 2012. Influence of dietary
supplementation of prebiotics (mannanoligosaccharide) on the performance of crossbred calves. Trop.
Anim. Health Prod., 44(3): 617-622.
Gonçalves, L.U., A.P.O. Rodrigues, G.V. Moro, E.
Cargnin-Ferreira & J.E.P. Cyrino. 2011. Morfologia e
fisiologia do sistema digestório de peixes. In: D.M.
Fracalossi & J.E.P. Cyrino (eds.). Nutriaqua: nutrição
e alimentação de espécies de interesse para aquicultura
brasileira. Aquabio, Florianopólis, pp. 9-36.
Grisdale-Helland, B., S.J. Helland & D.M. Gatlin. 2008.
The effects of dietary supplementation with mannanoligosaccharide fructooligosaccharide or galactooligosaccharide on the growth and feed utilization of
Atlantic salmon (Salmo salar). Aquaculture, 283: 163167.
Gültepe, N., S. Salnur, B. Hossu & Q. Hisar. 2011. Dietary
supplementation with mannanoligo saccharides (MOS)
from Bio-Mos enhances growth parameters and
digestive capacity of gilthead sea bream (Sparus
aurata). Aquacult. Nutr., 17: 482-487.
Heidarieh, M., A.R. Mirvaghefi, M. Akbari, N.
Sheikhzadeh, Z. Kamyabi-Moghaddam, H. Askari &
A.A. Shahbazfar. 2013. Evaluations of HilysesTM,
fermented Saccharomyces cerevisiae, on rainbow
trout (Oncorhynchus mykiss) growth performance,
enzymatic activities and gastrointestinal structure.
Aquacult. Nutr., 19: 343-348.
Hisano, H., L.E. Pezzato, M.M. Barros, E.S. Freire, G.S.
Gonçalves & J.E.C. Ferrari. 2004. Zinc and spray dried
alcohol yeast as pronutrient for Nile tilapia fingerlings
(Oreochromis niloticus L.). Acta Sci. Anim. Sci.,
26(2): 171-179.
Hisano, H., M.D.P. Silva, M.M. Barros & L.E. Pezzato.
2006. Levedura íntegra e derivados do seu processamento em rações para tilápia do Nilo: aspectos
hematológicos e histológicos. Acta Sci. Biol. Sci.,
28(4): 311-318.
Macfarlane, S., G.T. Macfarlane & J.H. Cummings. 2006.
Review article: prebiotics in the gastrointestinal tract.
Aliment. Pharmacol. Ther., 24: 701-714.
Mansour, M.R., R. Akrami, S.H. Ghobadi, H. Amani
Denji, N. Ezatrahimi & A. Gharaei. 2012. Effect of
dietary mannan oligosaccharide (MOS) on growth
8951
performance, survival, body composition, and some
hematological parameters in giant sturgeon juvenile
(Huso huso Linnaeus, 1754). Fish Physiol. Biochem.,
38: 829-835.
Mazlum, Y., E. Yilmaz, M.A. Genc & O. Guner. 2011. A
preliminary study on the use of mannan
oligosaccharides (MOS) in fresh water crayfish,
Astacus leptodactylus Eschscholtz, 1823 juvenile
diets. Aquacult. Int., 19: 111-119.
Misra, C.K., B.K. Das, S.C. Mukherjee & P. Pattnaik.
2006a. Effect of long term administration of dietary βglucan on immunity, growth and survival of Labeo
rohita fingerlings. Aquaculture, 255: 82-94.
Misra, C.K., B.K. Das, S.C. Mukherjee & P. Pattnaik.
2006b. Effect of multiple injections of β-glucan on nospecific immune response and disease resistance in
Labeo rohita fingerlings. Fish Shellfish Immunol., 20:
305-319.
Newman, K. 2007. Form follows function in picking MOS
product. Feedstuffs, 79: 1-2.
Peterson, B.C., N.J. Booth, F.T. Barrows & B.B.
Manning. 2012. Improved survival in channel catfish
fed mannanoligosaccharides in an extruded diet. Open
J. Anim. Sci., 2: 57-61.
Peterson, B.C., T.C. Bramble & B.B. Manning. 2010.
Effects of Bio-Mos® on growth and survival of channel
catfish challenged with Edwardsiella ictaluri. J. World
Aquacult. Soc., 41(1): 149-155.
Pryor, G.S., J.B. Royes, F.A. Chapman & R.D. Miles.
2003. Mannan oligosaccharides in fish nutrition:
effects of dietary supplementation on growth and
gastrointestinal villi structure in Gulf of Mexico
sturgeon. N. Am. J. Aquacult., 65: 106-111.
Rauta, P.R., M. Samanta, H.R. Dash, B. Nayak & S. Das.
2014. Toll-like receptors (TLRs) in aquatic animals:
signaling pathways, expressions and immune
responses. Immunol. Lett., 158: 14-24.
Refstie, S., G. Baeverfjord, R. Seim & O. Elvebo. 2010.
Effects of dietary yeast cell wall β-glucans and MOS
on performance, gut health, and salmon lice resistance
in Atlantic salmon (Salmo salar) fed sun flower and
soy bean meal. Aquaculture, 305: 109-116.
Ringø, E., R.E. Olsen, T.O. Gifstad, R.A. Dalmo, H.
Amlund, G.I. Hemre & A.M. Bakke. 2010. Prebiotics
in aquaculture: a review. Aquacult. Nutr., 16: 117-136.
Sado, R.Y., A.J.A. Bicudo & J.E.P. Cyrino. 2008. Feeding
dietary mannan oligosaccharides to juvenile Nile
tilapia, Oreochromis niloticus have no effect on
hematological parameters and showed decreased feed
consumption. J. World Aquacult. Soc., 39(6): 821826.
Sado, R.Y., A.J.A. Bicudo & J.E.P. Cyrino. 2014a.
Growth and intestinal morphology of juvenile pacu
Piaractus mesopotamicus (Holmberg, 1887) fed
dietary prebiotics (mannanoligosaccharides-MOS).
An. Acad. Bras. Ciênc., 86(3): 1517-1523.
Sado, R.Y., A.J.A. Bicudo & J.E.P. Cyrino. 2014b.
Hematology of juvenile pacu, Piaractus mesopotamicus (Holmberg, 1887) fed graded levels of
mannan oligosaccharides (MOS). Lat. Am. J. Aquat.
Res., 42(1): 30-39.
Sakai, M. 1999. Current research status of fish
immunostimulants. Aquaculture, 172: 63-92.
Salze, G., E. Mclean, M.H. Schwarz & S.R. Craig. 2008.
Dietary mannan oligosaccharide enhances salinity
tolerance and gut development of larval cobia.
Sang, H.M., R. Fotedar & K. Filer. 2011. Effects of dietary
mannan oligosaccharide on survival, growth,
physiological condition, and immunological responses
of marron, Cherax tenuimanus (Smith 1912). J. World
Aquacult. Soc., 42(2): 230-241.
Saurabh, S. & P.K. Sahoo. 2008. Lysozyme: an important
defence molecule of fish innate immune system.
Aquac. Res., 39: 223-239.
Schwarz, K.K., W.M. Furuya, M.R.M. Natali, M.
Michelato & M.C. Gualdezi. 2010. Mananoligossacarídeo em dietas para juvenis de tilápias do
Nilo. Acta Sci. Anim. Sci., 32(2): 197-203.
Siwick, A.K., D.P. Anderson & G.L. Rumsey. 1994.
Dietary intake of immunostimulants by rainbow trout
affects non-specific immunity and protection against
furunculosis. Vet. Immunol. Immunopathol., 41: 125139.
Song, S.K., B.R. Beck, D. Kim, J. Park, J. Kim, H.D. Kim
& E. Ringø. 2014. Prebiotics as immunostimulants in
aquaculture: a review. Fish Shellfish Immunol., 10:
40-48.
Staykov, Y., P. Spring, S. Denev & J. Sweetman. 2007.
Effect of mannan oligosaccharide on the growth
performance and immune status of rainbow trout
(Oncorhynchus mykiss). Aquacult. Int., 15: 153-161.
Steel, R.G.D. & J.H. Torrie. 1980. Principles and procedures of statistics: a biometrical approach. McGrawHill, New York, 569 pp.
Talpur, A.D., M.B. Munir, A. Mary & R. Hashim. 2014.
Dietary probiotics and prebiotics improved food
acceptability, growth performance, haematology and
immunological parameters and disease resistance
agains Aeromonas hydrophila in snakehead (Channa
striata) fingerlings. Aquaculture, 426-427: 14-20.
Torrecillas, S., A. Makol, R.J. Caballero, D. Montero, L.
Robaina, F. Real, J. Sweetman, L. Tort & M.S.
Izquierdo. 2007. Immune stimulation and improved
infection resistance in European sea bass (Dicentrar-
chus labrax) fed mannan oligosaccharides. Fish
Torrecillas, S., A. Makol, M.J. Caballero, D. Montero, R.
Ginés, S. Sweetman & M. Izquierdo. 2011. Improved
feed utilization, intestine mucus production and
immune parameters in sea bass (Dicentrarchus labrax)
feed mannan oligosaccharides (MOS). Aquacult.
Nutr., 17: 223-233.
Received: 22 December 2014; Accepted: 22 September 2015
9
952
Torrecillas, S., D. Montero & M. Izquierdo. 2014.
Improved health and growth of fish fed mannan
oligosaccharides: potential mode of action. Fish
Zhou, Q.C., J.A. Buentello & D.M. Gatlin. 2010. Effects
of dietary prebiotics on growth performance, immune
response and intestinal morphology of red drum
(Sciaenops ocellatus). Aquaculture, 309: 253-257.
Lat. Am. J. Aquat. Res., 43(5): 953-962, 2015 Reproduction and egg quality in Seriola rivoliana
953
Research Article
Reproductive broodstock performance and egg quality of wild-caught
and first-generation domesticated Seriola rivoliana reared under
same culture conditions
Marcos F. Quiñones-Arreola2,1, G. Fabiola Arcos-Ortega1, Vicente Gracia-López1
Ramón Casillas-Hernández2, Charles Weirich3, Terry Morris3
Mariana Díaz-Tenorio2 & Cuauhtémoc Ibarra-Gámez2
1
Centro de Investigaciones Biológicas de Noroeste, S.C. (CIBNOR)
Avenida Instituto Politécnico Nacional 195, Col. Playa Palo de Sta. Rita Sur
La Paz B.C.S. 23096, México
2
Departamento de Ciencias Agronómicas y Veterinarias, Área de Acuicultura
Instituto Tecnológico de Sonora, Ciudad Obregón, Sonora 85000, México
3
Empresa Rancheros del Mar, Carretera Pichilingue km 2.5, Lomas de Palmira
La Paz, B.C.S. 23000, México
Corresponding author: Vicente Gracia-López ([email protected])
ABSTRACT. Almaco jack, Seriola rivoliana as well as some related species is of great interest in marine fish
aquaculture. However, there are few studies about their reproduction in captivity. In this research work,
reproductive performance and egg quality in two groups of adult Seriola rivoliana, caught in the wild and
domesticated-F1 analyzed and compared, reared under optimal maturation conditions in a commercial private
Laboratory. A total of 28 wild adult (>5 kg) were caught at La Paz Bay, Baja California Sur, Mexico, and 30
adult domesticated-F1 broodstock (>5 kg), were obtained from an original stock of 1,000 juveniles (3.5 g body
weight) produced at Kona Blue (Hawaii, USA) sea farm. Fishes were transported to the Rancheros del Mar
commercial private hatchery, where they were grown to adult size. Both groups were evaluated during eight
months (May to December 2012) and compared in terms of reproduction performance (total number of spawning
events, monthly spawning frequency, total number of eggs, total number of eggs per mL, and fertilization
rate), egg biochemical composition (total proteins, total lipids, total carbohydrates, and triacylglycerides) and
egg diameter. Results indicated that wild caught broostock showed a better reproductive performance in terms
of fertilization rate, total number of spawning, monthly spawning frequency and total number of eggs produced.
However, biochemical composition and egg diameter did not show statistical differences (P < 0.05) between
two groups. The reproductive performance of broodstock and quality of eggs analyzed in this study are important
traits to improve the aquaculture management of this species.
Keywords: Seriola rivoliana, reproductive performance, egg quality, wild-caught fish, domesticated fish,
aquaculture.
Desempeño reproductivo y calidad de huevos en reproductores de origen silvestre y
domesticado-F1 de jurel Seriola rivoliana bajo las mismas condiciones de cultivo
RESUMEN. El jurel Seriola rivoliana así como algunas especies relacionadas, son de gran interés en la
acuicultura de peces marinos. Sin embargo, existen pocos estudios sobre su reproducción en cautiverio. En este
trabajo se analizó y comparó el desempeño reproductivo y calidad del huevo en dos grupos de adultos de Seriola
rivoliana, capturados en el medio silvestre y domesticados-F1 criados en óptimas condiciones de maduración
en un laboratorio comercial. Un total de 28 adultos silvestres (>5 kg) se capturaron en la Bahía La Paz, Baja
California Sur, México y 30 adultos de origen domesticado-F1 (>5 kg), se obtuvieron a partir de un lote de 1.000
juveniles (3,5 g de peso) producidos en la empresa Kona Blue (Hawái, EE.UU.) y transportados a la empresa
Rancheros del Mar para su engorda y posterior maduración. Los reproductores de ambos orígenes, fueron
evaluados durante echo meses (mayo a diciembre 2012) y comparados en términos de desempeño reproductivo
(número de desoves totales, frecuencia mensual de desoves, número total de huevos, número total de huevos
__________________
Corresponding editor: Alvaro Bicudo
954
por mL, tasa de fertilización) y composición bioquímica del huevo (proteínas totales, lípidos totales,
carbohidratos totales y triglicéridos), así como el diámetro del huevo. Los resultados obtenidos, indican que los
reproductores de origen silvestre presentaron un mejor desempeño reproductivo en términos de porcentaje de
fertilización, número total de desoves, frecuencia mensual de desoves y número total de huevos producidos. Sin
embargo, la composición bioquímica y el diámetro del huevo no mostraron diferencias estadísticas (P < 0,05)
entre los dos grupos. El desempeño reproductivo y la calidad de los huevos analizados en este estudio son
aspectos importantes para mejorar el manejo en cautiverio de esta especie.
Palabras clave: Seriola rivoliana, desempeño reproductivo, calidad de huevos, peces silvestres, peces
domesticados, acuicultura.
INTRODUCTION
World fishery production in marine waters was 82.6
million ton in 2011 and 79.7 million ton in 2012 (74.3
and 75.0 million ton excluding anchovy). Between
1980 and 2012, world aquaculture production volume
increased at an average rate of 8.6 percent per year
(FAO, 2014). World food fish aquaculture production
more than doubled from 32.4 million ton in 2000 to
66.6 million ton in 2012. According to the latest
information, FAO estimates that world food fish
aquaculture production rose by 5.8% to 70.5 million ton
in 2013 (FAO, 2014). Longfin yellowtail Seriola
rivoliana as other Seriola species is considered as one
of the most important emerging marine finfish species
in Japan, Australia and the United States (Roo et al.,
2014). In the American Pacific, Seriola rivoliana is
distributed from the United States to Peru (Eschmeyer
et al., 1983; Peterson et al., 1999) and in the Atlantic,
from the US to Argentina (Cervigón, 1993).
Almaco jack has excellent aquaculture potential due
to its adaptability to captivity, fast growth, and high
market value, but information about rearing this species
in captivity is limited (Kolkovski & Sakakura, 2004;
Roo et al., 2014). Sexual maturation under different
culture conditions has been studied in different Seriola
species, including S. lalandi (Poortenaar et al., 2001),
S. rivoliana (Blacio et al., 2003, Roo et al., 2014) and
S. dumerilli (Roo et al., 2009). A major constraint on
the development of aquaculture for several Seriola
species is their insufficient supply of eggs and the
variable quality of larvae (Yamamoto et al., 2008).
Successful conditioning of broodstock remains a
crucial step to produce a large quantity of eggs and
good-quality larvae in this species. In fish as in other
marine organisms, such as crustaceans and mollusks,
several factors affect the quality of eggs and larvae.
These factors may be endogenous (genotype origin,
age, and size of broodstock) or exogenous (egg size,
egg management, broodstock feeding, bacterial
colonization of egg surface) (Ballestrazzi et al., 2003;
Kamler, 2005). Differences between egg batches often
become apparent only well after their collection.
Many studies of marine organisms have used
physical, biological, or biochemical parameters as
indicators of broodstock reproductive performance and
egg quality (Arcos et al., 2003, 2009, 2011; Evans et
al., 1996; Kjørsvik et al., 2003; Sangsawangchote et
al., 2010). Among teleost’s, dietary components, such
as proteins and lipids, have been implicated in various
reproduction-related processes, such as gonadal
maturation, gamete quality, and spawning performances (Izquierdo et al., 2001; Coward et al., 2002;
Varghese et al., 2009; Korwin-Kossakowski, 2011).
Assessing the reproductive physiology of Seriola spp.,
broodstocks are important goals to improving the
culturing of these fish.
First-generation domesticated “Hawaiian” (Seriola
rivoliana) broodstock are already being reared for
commercial production at the Rancheros del Mar
hatchery in La Paz, Baja California, Mexico. This
facility has achieved natural spawning of both wildcaught and domesticated broodstocks. However,
maintaining actively spawning stocks of wild-collected
S. rivoliana has proven difficult due to their
susceptibility to a number of parasitic and bacterial
pathogens. Domesticated (S. rivoliana) broodstocks
appear to be substantially different from their wild
counterparts (Rancheros del Mar, pers. comm.).
The present study analyzed the reproductive
performance and egg quality of wild-caught and firstgeneration domesticated populations of S. rivoliana,
under same maturation conditions in the Rancheros del
Mar commercial hatchery. A multidisciplinary approach
was used to evaluate possible differences in adult
reproductive performance between populations. Egg
biochemical composition was used as an indicator of
broodstock nutritional and physiological condition.
Broodstocks and rearing system
The study was carried out from May to December 2012.
A total of 28 wild-caught adult S. rivoliana (>5 kg)
were captured near the south coast of Bay La Paz, Baja
California Sur, Mexico, and transported to the Rancheros
Reproduction and egg quality in Seriola rivoliana
del Mar commercial private hatchery (24°14’N,
110°18’W).
In addition, 30 S. rivoliana first-generation
domesticated individuals (>5 kg) were obtained from
an original stock of juveniles (average 3.5 g body
weight) brought from Kona-Blue Water farms in
Hawaii and transported to the Rancheros del Mar
commercial private hatchery.
At the beginning of the reproductive season, the
wild caught group had an average body weight of 9.1
kg, whiles the domesticated-F1, had 5.5 kg. Each group
was distributed into 55 m3 circular fiberglass blue tanks
with no more than 5 kg per metric ton of stocking
density. Fish were kept under artificial photoperiod
conditions (12 h light, 12 hours dark). Water was
exchanged in each tank 18 times per day, using a closed
recirculation system at 95%. Salinity was 36 g L-1 and
temperature ranged from 26 to 26.5oC year-round.
After capture, fish were weighed, measured, and sexed
by introducing a polyethylene cannula (1.6 mm e.d.)
into the oviduct and oocyte samples were preserved in
Davidson solution in seawater. Fish were fed daily with
commercial pellets (13 mm, Vitalis Repro™: Skretting,
Burgos, Spain) corresponding to 1% of body weight
(BW), supplemented with frozen squid, sardine, and
mackerel, adjusted to equal a total daily supply
equivalent to 2% of their BW. The collector tanks of
eggs with an 800 µm mesh size bags, were placed on
the perimeter of the broodstock tanks (one per tank of
each origin). Egg collectors were monitored early each
morning, and the floating eggs were collected by
overflow of a side opening of the broodstock tank due
to the positive buoyancy of the eggs.
Reproductive performance of broodstocks
Reproductive performance of each broodstock type
(wild-caught and domesticated) was evaluated in terms
of total number of spawning events, spawning
frequency per month, total number of eggs, volume of
floating eggs (mL), and fertilization rate.
Total BW of each broodstock was recorded before
they were returned to the maturation tank at the
beginning of the spawning season. The survival rate of
each group was measured until the end of the
experimental evaluation (8 months).
Every day, the spawns were sampled and recorded.
Eggs were separated into floating and non-floating in a
measuring cylinder, and the volumes and number of
eggs were counted. Floating eggs were removed by 500
µm mesh, washed thoroughly, and subsequently kept in
seawater that had been UV treated. The eggs were
observed under a stereo microscope to assess the
955
morphology, fertilization success, and embryological
stage.
Fertilization rate was assessed taking three 5 mL
samples from each spawning, and eggs with normal
cleavage were counted. Fertilization rate was calculated
as follows:
Fertilization rate =
Number of fertilized eggs
∗ 100
Total number of eggs
Hatching rate was calculated by the counting of larvae
(after 24 h of the spawn) versus fertilized eggs:
Hatching rate =
Total number of larvae
∗ 100
Total number of fertilized eggs
Egg diameter
Egg samples from each spawning of the two groups
were collected every day during the 8-month experimental period and preserved in Davidson solution.
From the fixed samples, eggs were observed and photos
of each spawn event were taken using a fluorescence
microscope Olympus BX41 (magnification 10x)
connected to a video camera (CoolSNAP-ProColor).
The recorded images were digitized using an image
analysis program (Image Pro Plus, v.6.0).
Egg measurements were performed from digitized
images and Image-Pro® analysis software. Fifty eggs
were measured daily for each group (Fig. 1)
Egg biochemical analyses
In order to perform biochemical analysis, an approximately 200 mg egg mass from each of the two
populations was concentrated using a 75-µm mesh
filter and frozen at -80°C for later analysis.
Samples of eggs were weighed and individually
homogenized in equal volumes of a buffer solution
[0.05 M Tris, 0.5 M NaCl, 5 mM EDTA, pH 7 (3:1 v/v
buffer: tissue)], and a protease inhibitor cocktail
(0.003% ref. P2714, Sigma, St. Louis, MO, USA),
using a FAST PREP-24 homogenizer for 1 min. The
homogenate was centrifuged at 10,000 g for 15 min at
4ºC (Beckman ultracentrifuge, Pasadena, CA, USA),
and the supernatant was stored at -80ºC for later
quantification of total proteins (P), total lipids (L), total
carbohydrates (C), and triacylglycerides (Tg). Enzymatic and colorimetric analyses adapted for small
micro plates (Palacios et al., 1998) were performed, and
the quantification of P was realized (Bradford, 1976)
after digestion in 0.1 N NaOH. Carbone was quantified
by the Anthrone method, after precipitation of proteins
with trichloroacetic acid (Roe, 1955). Lipids were
measured according to the sulfophosphovanillin
method (Barnes & Blackstock, 1973) and Tg was
quantified using a kit (GOD-PAP, Merck).
956
Figure 1. Measurement and recording of the oocytes diameter from digitized images (4x).
Statistical analyses
Broodstock reproductive performance
First, single-factor fixed ANOVA analysis was used to
assess differences in broodstock reproductive performance variables (total number of spawning events,
spawning frequency per month, total number of eggs,
total number of eggs per mL, fertilization rate, and
average egg diameter) between the two population
groups. The factor “broodstock type” was considered
with two levels, wild-caught and domesticated
populations. A post-hoc Tukey’s test for multiple
comparisons of means was used in cases in which the
results of ANOVA were significant.
Next, ANCOVA analysis was used to assess
differences in the reproductive performance between
the two population groups. The factor “broodstock
type” was considered with two levels, wild-caught and
domesticated populations, but female total weight was
introduced as a covariate. Mean comparisons were
performed by specific contrast of least square means,
and adjusted means.
Egg diameter
Two different ANOVA models were used for
morphometric and biochemical egg variables. First,
single-factor fixed ANOVA was used for morphometric variables, including egg diameter. For the
independent variable “broodstock type”, there were two
levels, wild-caught and domesticated populations. A
post-hoc Turkey’s test for multiple comparisons of
means was realized in cases in which the results of
ANOVA were significant.
In addition, ANCOVA analysis was conducted for
biochemical composition of eggs. The same factor
“broodstock type” was considered with the two levels,
but female body weight and egg diameter were
introduced as covariates. Mean comparisons were
performed using a specific contrast of least square
means, and adjusted means are presented.
Pearson’s correlation was applied to establish the
relationship between the broodstock reproductive
performance variables and egg variables (morphometric and biochemical composition).
For all ANOVA analyses, biochemical data was
transformed to logarithm base 10 to fit a normal
distribution, and the percentage fertilization data was
transformed to arcsine (Zar, 2010), before analyses.
Means and back-transformed means are presented and
the standard errors are those obtained from
untransformed variables.
Statistical significance was preset at P < 0.05,
although P values obtained are indicated. Statistical
analyses were performed with the General Linear
Model module in Statistica version 10 (StatSoft Inc.,
Tulsa, OK, USA).
RESULTS
Broodstock reproductive performance
There were significant differences between wild-caught
and domesticated broodstocks in all measured
reproductive variables (Table 1). The total weight of
wild-caught broodstocks was significantly higher than
that of the domesticated broodstocks. Wild-caught
broodstocks showed a greater spawning frequency and
produced more eggs, but the eggs of both populations
were the same size. No differences in broodstock
survival at the end of the 8-month experimental
evaluation were observed.
Egg diameter
Although no significant differences were found in the
egg diameter average between eggs from the different
broodstocks, the wild caught group showed average
values slightly higher over time, and more spawning’s
during the same period (Table 1).
Egg biochemical analyses
There was no difference between the two groups in the
total content of proteins, lipids, carbohydrates, or
triacylglycerides (Table 2). The proportion of carbohydrates was very low in eggs of both broodstock types,
compared with the amounts of proteins and lipids.
Correlations among reproductive performance
variables
Correlations among the reproductive performance
variables evaluated in both populations are shown in
Table 3. There were significant positive correlations
between total female weight of wild-caught individuals
and fertilization rate (0.518), total number of spawning
events (0.732), total number of eggs (0.963), and
diameter of eggs (0.950). The total number of eggs was
significantly correlated with the fertilization rate
(0.936) and the total number of spawning events
(0.857). Positive correlations among the same reproductive performance variables were also observed in
domesticated broodstock.
Correlations among reproductive performance
variables and egg variables
Correlations among all egg quality variables and
between all reproductive performance variables and
egg variables for the two broodstocks populations are
shown in Table 4. The highest values and the most
consistent correlations were found between wildcaught female total weight and protein in comparison
with domesticated broodstock respectively (0.982),
(0.965); lipid (0.917), (0.891); and triacylglycerides
957
(0.794), (0.738), respectively. Significant positive
correlations were observed between the two factors egg
diameter and fertilization rate with the three
biochemical variables proteins, lipids, and triacylglycerides. The total number of eggs was significantly
correlated with proteins and lipids for both broodstock
populations. There were also correlations between the
total number of spawning events and proteins, lipids,
and triacylglycerides.
DISCUSSION
The costs of feeding and maintaining Seriola spp.
broodstock are high; thus, it is desirable to develop a
methodology to compare different broodstock types in
order to select broodstock with high reproductive
performance and high egg quality. In this study, a
multidisciplinary approach was used to evaluate
possible differences in reproductive performance and
egg quality between wild-caught and domesticated
broodstock populations.
Significant differences in total BW, fertilization
rate, total number of spawning events, monthly
spawning frequency, total number of eggs, and total
number of egg per mL were observed between wildcaught and domesticated broodstocks. Some morphometric variables regarding females or eggs could be
used as non-invasive predictive criteria to select
females with higher reproductive performance. For
example, in our study, females with a greater total
weight had a higher spawning capacity. However, this
evaluation should be applied only to homogeneous
populations (of the same age and reared under the same
culture conditions) and should be further evaluated.
Such a selection procedure could be combined with
other criteria, such as biochemical levels in eggs. It is
known that lipids, followed by proteins, are the major
sources of energy available in vitellus for embryogenesis (Evans et al., 1996; Kjørsvik et al., 2003; Kamler,
2005). More studies are needed to evaluate the value of
total protein levels as predictive criteria in Seriola spp.
Several studies of fish have used biochemical
components of eggs as indices of quality, particularly
lipids, which perform energetic and structural functions
during embryonic development (Kamler, 2005). In this
study, no differences were observed between two
different broodstocks in the amount of proteins, lipids,
carbohydrates, or triacylglycerides in eggs, indicating
not only that females transfer biochemical reserves to
eggs, but also that wild-caught and domesticated
females produce good quality eggs. This finding is
reinforced by the observation of good egg quality in
terms of the L and Tg content of eggs obtained from
these females. Previous studies have reported the rela-
958
Table 1. Reproductive performance of Seriola rivoliana wild-caught and first-generation domesticated broodstocks
evaluated for 8 months. Mean values (± standard error) of the variables are presented. Different superscripts indicate
significant differences according to Tukey’s test or specific contrast of least squares for multiple comparisons of means (P
< 0.05). ANCOVA significance for the covariate (female body weight) is presented in the second column
Broodstock types
Total body weight (kg)
Survival during 8 months (%)
Fertilization rate (%)
Total number of spawning
Monthly spawning frequency (%)
Total number of eggs (× 103)
Total number of eggs (mL)
Egg diameter (µm)
Wild-caught
9.1 ± 2.3a
92.8 ± 1.4
94.5 ± 1.9a
57.0 ± 2.0a
9.2 ± 2.0a
610.44 ± 2.5a
612.28 ± 2.1a
1044.87 ± 22.8a
Domesticated
5.5 ± 1.1b
90.0 ± 2.0
75.3 ± 2.8b
28.0 ± 1.0b
5.5 ± 1.0b
163.79 ± 6.6b
164.44 ± 6.4b
1035.83 ± 20.8b
ANOVA
ANCOVA
P < 0.01
P < 0.05
P < 0.01
P < 0.01
P < 0.01
P < 0.01
P < 0.01
P > 0.05
P < 0.05
P < 0.01
P < 0.01
P < 0.01
P < 0.01
P < 0.01
P > 0.05
Table 2. Overall comparisons of the total content (mean ± standard error) of proteins (P), lipids (L), carbohydrates (C), and
triacylglycerides (Tg) in the eggs of wild-caught and first-generation, domesticated, Seriola rivoliana females. N = 28 wildcaught females and 30 domesticated females. ANCOVA significance for the covariate (egg diameter) is presented.
Variable
-1
P (mg g )
L (mg g-1)
C (mg g-1)
Tg (µg g-1)
Wild-caught
Domesticated
ANOVA
ANCOVA
120.41 ± 2.5
151.07 ± 4.9
5.51 ± 1.5
57.7 ± 1.3
113.44 ± 2.5
167.38 ± 4.8
5.94 ± 1.5
53.35 ± 1.06
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
tionship between egg biochemical composition and the
performance of the resulting larvae (Evans et al., 1996;
Kjørsvik et al., 2003); therefore, it is expected that both
broodstock types would produce high-quality larvae
when egg biochemical components are high.
The proportion of carbohydrates was very low in
both types of eggs, compared with the amounts of
proteins and lipids. Apparently, this component is not
an important source of energy during embryonic
development; it may play a greater role in later
structural growth (Salze et al., 2005).
No differences were observed in egg biochemical
composition between the broodstock types; however, it
has been reported that egg quality decreases over time
in production. Therefore, the 8 months that elapsed
during this study could have affected egg quality
measurements. We do not know whether a longer
period of evaluation in which more first spawning
events occurred would produce a different result.
To compare reproductive performance and egg
quality between wild-caught and domesticated
broodstocks, female total weight, and egg diameter
were used as covariates. The choice of these covariates
was justified by the positive correlations found between
female total weight and all reproductive performance
variables and biochemical components analyzed, and
between egg diameter and the biochemical components. Our ANCOVA analysis used female total weight
and/or egg diameter as covariates to analyze
reproductive performance and egg quality variables
between different broodstock types, independently of
female weight or egg size.
The use of covariates to correct data is common
among animal breeders when estimating differences in
parameters (Anang et al., 2001). This improvement in
the estimation of the parameters by the use of covariates
has been observed in other marine species studies
(Perez-Rostro & Ibarra, 2003a, 2003b). In shrimp and
fish, some of the common effects on reproduction
variables indicate that correction or an adjustment of
data by the use of covariates is needed (Ojanguren et
al., 1996; Arcos et al., 2003).
Positive correlations between broodstock weight or
length and egg traits have also been reported for various
other fish species, as rainbow trout, bighead carp, Nile
tilapia, and channel catfish (Huang & Gall, 1990;
Bolivar et al., 1993; Walser & Phelps, 1993; Estay et
al., 1994). A surprisingly large positive correlation was
obtained between female weight and the amounts of
proteins, lipids, carbohydrates, and triacylglycerides in
their eggs, suggesting that female weight plays an
important role in egg quality.
959
Table 3. Pearson’s correlation coefficient (r) between reproductive performance variables assessed for wild-caught and
first-generation broodstocks, domesticated females and the reproductive performance parameters of each group of females.
*Significant correlation (P < 0.05).
Wild-caught broodstocks
Female total weight (kg)
Total number of spawning events
Egg diameter (µm)
Domesticated Broodstocks
Total female weight
Total number of spawning events
Egg diameter (µm)
Female total
weight (kg)
Fertilization
rate (%)
Total number of
spawning events
Total number
of eggs
Egg
diameter (µm)
0.518*
0.732*
0.963*
0.950*
0.207
0.936*
0.545
0.857*
0.250
0.478
-
0.439*
0.718*
0.889*
0.918*
0.339
0.871*
0.414
0.894*
0.301
0.369
-
Table 4. Pearson’s correlation coefficient (r) between biochemical variables assessed in the eggs of wild and domesticatedF1, females and the reproductive performance parameters of each group of females. *Significant correlation (P < 0.05).
Proteins (P), lipids (P), carbohydrates (C), and triacylglycerides (Tg).
Eggs from wild-caught females
P (mg g-1)
L (mg g-1)
C (mg g-1)
Tg (mg g-1)
Eggs from domesticated females
P (mg g-1)
L (mg g-1)
C (mg g-1)
Tg (mg g-1)
Total female
weight (kg)
0.982*
0.917*
0.237
0.794*
Fertilization
rate (%)
0.639*
0.701*
0.120
0.731*
Total number of
spawning events
0.513
0.593
0.101
0.492
Total number
of eggs
0.852*
0.845*
0.180
0.774
Egg
diameter (µm)
0.998*
0.661*
0.207
0.701*
0.965*
0.891*
0.149
0.738*
0.714*
0.695*
0.222
0.593*
0.422
0.534
129
0.492
0.731*
0.701*
0.151
0.695
0.997*
0.647*
0.260
0.685*
Furthermore, a positive correlation between body
weight or body length and number of eggs has also been
reported in fish (Huang & Gall, 1990), and was
observed in the present study. Some studies have shown
that female size and spawning time affect egg size,
fecundity, and egg viability (Kamler, 2005;
Sangsawangchote et al., 2010).
Typically, teleosts show a trade-off between egg
number and size, but during a spawning season, the
sizes of eggs in successive batches may differ (Evans et
al., 1996; Kamler, 2005), although Kamler (2005) also
reported no effect of egg batch sequence. In the present
study, egg number and size were not significantly
correlated.
In some fish, such as Atlantic halibut (Hippoglossus
hippoglossus), egg biochemical composition was size
dependent (Evans et al., 1996), although in other fish
species, such as Pseudopleuronectes americanus, the
amounts of protein and lipids in the eggs were
independent of egg size (Buckley et al., 1991). In this
study, however, the biochemical composition of eggs
from both populations was highly correlated with egg
size.
Our preliminary estimate of the correlation between
reproductive performance and egg quality variables
from different broodstock types indicated an association between these variables. Therefore, some
females spawn more and faster, or produce eggs with
higher quality. By selecting the females that display
those traits for use in aquaculture, hatchery managers
can increase egg production and egg quality.
Egg diameter is easily measured and is one of the
most frequently reported quality criteria in studies of
marine reproductive biology (Kamler, 2005). The
biochemical composition of eggs, particularly the
composition of yolk components, which support the
energetic and structural needs of developing embryos,
is also a useful indicator of egg quality (Fraser, 1989;
Racotta et al., 2003). The Tg concentration is an
indicator of nutritional status and therefore a predictor
960
of survival among fish larvae. Hilton et al. (2008)
reported greater Tg reserves in eggs and larvae of fish
that developed faster. Tg levels in eggs also can be used
to infer the nutritional status of broodstocks (Hilton et
al., 2008; Saito, 2012).
The proper development of eggs depends on the
biochemical reserves that are transferred to the eggs
from the female. As the levels of these reserves could
determine larval quality at a later stage, the quantities
of those reserves may be considered indicators of future
larval quality (Racotta et al., 2003). The biochemical
composition of the egg itself could indicate the
quantities of nutrients transferred to that egg.
Arcos et al. (2003) found higher fecundity and
fertilization rates and higher levels of triacylglycerides
and vitellin in the eggs, of the first spawning of females
that later had multiple spawns. They proposed that
those traits could be used as non-invasive predictive
criteria to select females with high reproductive quality.
Further studies on predictive criteria are needed in
Seriola culture species. A capacity for multiple
spawning events within a reproductive season has been
demonstrated in several Seriola species and is a
promising trait for aquaculture (Poortenaar et al.,
2001).
CONCLUSIONS
This study indicates that broodstock from a wild-caught
population of S. rivoliana was in better physiological
condition than that of a domesticated population in
terms of morphometric production variables (body
weight, fertilization rate, total number of spawning
events, spawning frequency per month, and total
number of eggs produced). However, biochemical
composition of eggs was the same for both populations.
Our results confirm that the physiological condition and
egg quality of fish were not affected by Rancheros del
Mar hatchery conditions, and the reproductive
performance and egg quality could even be improved
with the use of a specific diet. The egg and female
quality variables analyzed in this study are important
reproductive traits that are applicable to programs to
improve the culturing of this species.
ACKNOWLEDGMENTS
The authors are grateful to Rancheros del Mar of La Paz
for providing the S. rivoliana spawns and for permitting
the evaluation of the broodstocks. We gratefully
acknowledge the staff of the Rancheros del Mar
Hatchery: Chuck, Arturo, José, Raúl, and Chepina.
In addition, we would thank Roberto Hernandez and
Carmen Rodriguez-Jaramillo for their invaluable
technical support during this study and the staff of the
Laboratory of Marine Fish Reproduction at CIBNOR
for their support during the first experimental trials with
this species: Tec. Francisco Encarnación Ramírez,
M.C. Gerardo González, and M.C. Ana Trasviña. This
research was supported by grants to CONACYT.
Marcos Fabian Quinones-Arreola is a Ph.D. student
fellow of CONACYT-Instituto Tecnológico de Sonora,
and the results presented here are part of his Ph.D.
Thesis.
REFERENCES
Anang, A., N. Mielenz & L. Schüler. 2001. Monthly
model for genetic evaluation of laying hens. 1. Fixed
regression. Br. Poult. Sci., 42: 191-196.
Arcos, F.G., A.M. Ibarra & I.S. Racotta. 2011.
Vitellogenin in hemolymph predicts gonad maturity in
adult female Litopenaeus (Penaeus) vannamei shrimp.
Arcos, F.G., A.M. Ibarra, E. Palacios, C. VazquezBoucard & I.S. Racotta. 2003. Feasible predictive
criteria for reproductive performance of white shrimp
Litopenaeus vannamei: egg quality and female
physiological condition. Aquaculture, 228: 335-349.
Arcos, F.G., A.M. Ibarra, M.C. Rodríguez-Jaramillo, E.A.
García-Latorre & C. Vazquez-Boucard. 2009.
Quantification of vitellin/vitellogenin-like proteins in
the oyster Crassostrea corteziensis (Hertlein, 1951) as
a tool to predict the degree of gonad maturity.
Aquacult. Res., 40: 644-655.
Ballestrazzi, R., S. Rainis, F. Tulli & A. Bracelli. 2003.
The effect of dietary coconut oil on reproductive traits
and egg fatty acid composition in rainbow trout
(Oncorhynchus mykiss). Aquacult. Int., 11: 289-299.
Barnes, H. & J. Blackstock. 1973. Estimation of lipids in
marine animals and tissues: detailed investigation of
the sulphophosphovanillin method for ‘total lipids’. J.
Exp. Mar. Biol. Ecol., 12: 103-108.
Blacio, E., J. Darquea & S. Rodríguez. 2003. Avances en
cultivo de huayaipe, Seriola rivoliana, en las
instalaciones del Cenaim. Mundo Acuícola, 9: 21-24.
Bolivar, R.B., A.E. Eknath, H.L. Bolivar & T.A. Abella.
1993. Growth and reproduction of individually tagged
Nile tilapia (Oreochromis niloticus) of different
strains. Aquaculture, 111: 159-169.
Bradford, M.M. 1976. A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal.
Biochem., 72: 248-254.
Buckley, L.J., A.S. Smigielski, T.A. Halavik, E.M.
Caldarone, B.R. Burns & G.C. Laurence. 1991. Winter
flounder Pseudopleuronectes americanus reproductive success. II. Effects of spawning time and female
size on size, composition, and viability of eggs and
larvae. Mar. Ecol. Prog. Ser., 74: 125-135.
Cervigón, F. 1993. Los peces marinos de Venezuela.
Fundación Científica Los Roques, Caracas, 2: 497 pp.
Coward, K., N.R. Bromage, O. Hibbitt & J. Parrington.
2002. Gametogenesis, fertilization and egg activation
in teleost fish. Rev. Fish Biol. Fisher., 12: 33-58.
Eschmeyer, W.N., E.S. Herald & H. Hammann. 1983. A
field guide to Pacific coast fishes of North America.
Houghton Mifflin, Boston, 336 pp.
Estay, F., N.F. Díaz, R. Neira & X. Fernández. 1994.
Analysis of reproductive performance of rainbow trout
in a hatchery in Chile. Prog. Fish. Cult., 56: 244-249.
Evans, R.P., C.C. Parrish, J.A. Brown & P.J. Davis. 1996.
Biochemical composition of eggs from repeat and
first-time spawning captive Atlantic halibut
(Hippoglossus hippoglossus). Aquaculture, 139: 139149.
Food and Agriculture Organization (FAO). 2014. The
state of world fisheries and aquaculture 2014. Food
and Agriculture Organization, Rome, 223 pp.
Fraser, A.J. 1989. Triacylglycerol content as a condition
index for fish, bivalve, and crustacean larvae. Can. J.
Fish. Aquat. Sci., 46: 1868-1873.
Hilton, Z., C.W. Poortenaar & M.A. Sewell. 2008. Lipid
and protein utilization during early development of
yellowtail kingfish (Seriola lalandi). Mar. Biol., 154:
855-865.
Huang, N. & G.A.E. Gall. 1990. Correlation of body
weight and reproductive characteristics in rainbow
trout. Aquaculture, 86: 191-200.
Izquierdo, M.S., H. Fernández-Palacios & A.G.J. Tacon.
2001. Effect of broodstock nutrition on reproductive
performance of fish. Aquaculture, 197: 25-42.
Kamler, E. 2005. Parent-egg-progeny relationships in
teleost fishes: an energetics perspective. Rev. Fish
Biol. Fisher., 15: 399-421.
Kjørsvik, E., K. Hoehne-Reitan & K.I. Reitan. 2003. Egg
and larval quality criteria as predictive measures for
juvenile production in turbot (Scophthalmus maximus
L.). Aquaculture, 227: 9-20.
Kolkovski, S. & Y. Sakakura. 2004. Yellowtail kingfish,
from larvae to mature fish-problems and opportunities.
In: L.E. Cruz-Suárez, D. Ricque-Marie, M.G., NietoLópez, D. Villarreal, U. Scholz, & M. González (eds.).
Avances en nutrición acuícola. Memorias del VII
Simposium Internacional de Nutrición Acuícola.
Hermosillo, Sonora, México, pp. 109-125.
Korwin-Kossakowski. 2011. Fish hatching strategies: a
review. Rev. Fish Biol. Fisher., 22: 225-240.
961
Ojanguren, A.F., F.G. Reyes-Gavilán & F. Braña. 1996.
Effects of egg size on offspring development and
fitness in brown trout, Salmo trutta L. Aquaculture,
147: 9-20.
Palacios, E., A.M. Ibarra, J.L. Ramírez, G. Portillo & I.S.
Racotta. 1998. Biochemical composition of egg and
nauplii in Pacific white shrimp Penaeus vannamei
(Boone), in relation to the physiological condition of
spawners in a commercial hatchery. Aquacult. Res.,
29: 183-189.
Pérez-Rostro, C.I. & A.M. Ibarra. 2003a. Quantitative
genetic parameter estimates for size and growth rate
traits in Pacific white shrimp, Penaeus vannamei
(Boone, 1931), when reared indoors. Aquacult. Res.,
34: 543-553.
Pérez-Rostro, C.I. & A.M. Ibarra. 2003b. Heritabilities
and genetic correlations of size traits at harvest size in
sexually dimorphic Pacific white shrimp (Litopenaeus
vannamei) grown in two environments. Aquacult.
Res., 34: 1079-1085.
Peterson, R.T., W.N. Eschmeyer, E.S. Herald, H.E.
Hammann & K.P. Smith. 1999. A field guide to Pacific
coast fishes of North America. Houghton Mifflin
Harcourt, Boston, 352 pp.
Poortenaar, C.W., S.H. Hooker & N. Sharp. 2001.
Assessment of yellowtail kingfish (Seriola lalandi)
reproductive physiology, as a basis for aquaculture
development. Aquaculture, 201: 271-286.
Racotta, I.S., E. Palacios & A.M. Ibarra. 2003. Shrimp
larval quality in relation to broodstock condition.
Roe, J.H. 1955. The determination of sugar in blood and
spinal fluid with anthrone reagent. J. Biol. Chem., 212:
335-343.
Roo, J., D. Schuchardt, J.A. Socorro, R. Guirao, C.M.
Hernández-Cruz & H. Fernández-Palacios. 2009.
Evolución de la maduración gonadal de ejemplares de
Seriola dumerilli mantenidos en cautividad. In: D.
Beaz-Paleo, M. Villaroel-Robinson & S.C. Rojas
(eds.). Libro de Resúmenes, XII Congreso Nacional de
Acuicultura. Ministerio de Medio Ambiente y Medio
Rural y Marino, Secretaría del Mar; Sociedad
Española de Acuicultura, Fundación Observatorio
Español de Acuicultura, Madrid, pp. 596-597.
Roo, J., H. Fernández-Palacios, C.M. Hernández-Cruz, A.
Mesa-Rodriguez, D. Schuchard & M. Izquierdo. 2014.
First results of spawning and larval rearing of longfin
yellowtail Seriola rivoliana as a fast-growing candidate for European marine finfish aquaculture
diversification. Aquacult. Res., 45: 689-700.
Saito, H. 2012. Lipid characteristics of two subtropical
Seriola fishes, Seriola dumerili and Seriola rivoliana,
with differences between cultured and wild varieties.
Food Chem., 135: 1718-1729.
962
Salze, G., D.R. Tocher, W.J. Roy & D.A. Robertson.
2005. Egg quality determinants in cod (Gadus morhua
L.): egg performance and lipids in eggs from farmed
and wild broodstock. Aquacult. Res., 36: 1488-1499.
Sangsawangchote, S., N. Chaitanawisuti & S.
Piyatiratitivorakul. 2010. Reproductive performance,
egg and larval quality and egg fatty acid composition
of hatchery-reared Spotted Babylon (Babylonia
areolata) broodstock fed natural and formulated diets
under hatchery conditions. Int. J. Fisher. Aquacult., 1:
49-57.
Varghese, B., R. Paulraj, G. Gopakumar & K.
Chakraborty. 2009. Dietary influence on the egg
production and larval viability in true Sebae clownfish
Amphiprion sebae Bleeker 1853. Asian Fish. Sci., 22:
7-20.
Received: 7 May 2015; Accepted: 22 September 2015
Walser, C.A. & R.P. Phelps. 1993. Factors influencing the
enumeration of channel catfish eggs. Prog. Fish. Cult.,
55: 195-198.
Yamamoto T., K. Teruya, T. Hara, H. Hokazono, H.
Hashimoto, N. Suzuki, Y. Iwashita, H. Matsunari, H.
Fuguita & K. Mushiake. 2008. Nutritional evaluation
of live food organisms and commercial dry feeds used
for seed production of amberjack Seriola dumerili.
Fish. Sci., 74: 1096-1108.
Zar, J.H. 2010. Biostatistical analysis. Pearson PrenticeHall, New Jersey, 944 pp.
Lat. Am. J. Aquat. Res., 43(5): 963-971, 2015 Dietary B. amyloliquefaciens in cage-reared tilapia
963
Research Article
Effects of the probiotic Bacillus amyloliquefaciens on growth performance,
hematology and intestinal morphometry in cage-reared Nile tilapia
Thiago Fernandes A. Silva1, Thalita R. Petrillo2, Jefferson Yunis-Aguinaga1, Paulo Fernandes
Marcusso2, Gustavo da Silva Claudiano2, Flávio Ruas de Moraes2 & Julieta R. Engrácia de Moraes1,2
1
Aquaculture Center of Unesp, São Paulo State University (Unesp), Jaboticabal, Brazil
Via Prof. Paulo Donato Castellane, km 05, Jaboticabal, SP. 14.884-900
2
Department of Veterinary Pathology, São Paulo State University (Unesp), Jaboticabal, Brazil
Corresponding author: Julieta Engrácia de Moraes ([email protected])
ABSTRACT. The aim of this study was to evaluate the effect of probiotic Bacillus amyloliquefaciens on the
growth performance, blood profile and intestinal morphometry in Nile tilapia (Oreochromis niloticus) reared in
cages. 936 Nile tilapias were distributed in 12 cages (1.5 m3). Fish were fed for 90 days on basal diets containing
0 (control); 1×106 CFU g-1; 5×106 CFU g-1; and 1×107 CFU g-1 of the probiotic. The results showed no significant
difference on performance and proximal composition of fish. Blood glucose and hemoglobin were lower in
1×107 CFU g-1 group, suggesting improves of the homeostatic state of the fish. Other hematimetric indices did
not differ between groups. It was observed significant increase of villi height and in the number of goblet cells
of the intestine in fish supplemented 5×106 CFU g-1 and 1×107 CFU g-1 of food suggesting that fish improved
the digestion and absorption of nutrients. However, more studies are needed to determine the efficacy of this
probiotic in field conditions in Nile tilapia.
Keywords: Oreochromis niloticus, homeostatic state, intestinal morphology, blood glucose, aquaculture.
Efectos del probiótico Bacillus amyloliquefaciens en el crecimiento, hematología y
morfometría intestinal en tilapias del Nilo criadas en balsa jaula
RESUMEN. El objetivo de este estudio fue evaluar el efecto del probiótico Bacillus amyloliquefaciens en el
desempeño del crecimiento, hemograma y morfometría intestinal en tilapia del Nilo (Oreochromis niloticus)
criadas en balsas jaulas. 936 tilapias del Nilo se distribuyeron en 12 balsas jaulas (1,5 m3). Los peces fueron
alimentados durante 90 días con dietas que contenían 0 (control); 1×106 UFC g-1; 5×106 UFC g-1 y 1×107 UFC
g-1 del probiótico. Los resultados no mostraron diferencias significativas en el rendimiento y composición
proximal de los peces. La glucosa en sangre y hemoglobina fue menor en el grupo 1×107 UFC g-1, lo que sugiere
un mejor estado homeostático de los peces. Otros parámetros hematimétricos no difirieron entre los grupos. Se
observó aumento significativo de la altura de las vellosidades y número de células caliciformes del intestino en
los peces suplementados con 5×106 UFC g-1 y 1×107 UFC g-1 de alimento que sugieren que los peces mejoraron
la digestión y absorción de nutrientes. Sin embargo, se necesitan más estudios para determinar la eficacia de
este probiótico en condiciones de campo en tilapia del Nilo.
Palabras clave: Oreochromis niloticus, homeostasis, morfología intestinal, glucosa sanguínea, acuicultura.
INTRODUCTION
Nile tilapia reared in cages presents advantages over
traditional pond and tank systems due to the easier
handling, high volume of production, and use of areas
unsuitable for other purposes, and the biological
characteristics of this species (García et al., 2014). Al__________________
though the productivity advantages (Kim et al., 2014),
fish at high stocking densities may present stress and
depress the immune system, increasing susceptibility to
bacterial and parasitic diseases (Telli et al., 2014).
The use of antibiotics as prophylactic is questioned
for being a source of environmental pollution (Ayandiran
et al., 2014), accumulating in the fillet, and promoting
964
resistance to drugs with risks to human and animal
health (Kersarcodi-Watson et al., 2008).
Probiotics are live microorganisms able to establish,
multiply and colonize the intestine of the host in order
to promote a beneficial balance of microorganisms.
These benefits are explain due to these microorganisms
inhibit the proliferation of harmful agents in the
intestinal mucosa, improve the digestibility and
absorption of nutrients (Nayak, 2010), promote the
synthesis of vitamins (Lee et al., 2013), and improve
the growth performance of animals (Mohapatra et al.,
2014) by increasing the survival percentage (Wu et al.,
2014) and water quality (Chi et al., 2014).
Bacteria from genus Bacillus are one of the main
probiotics used in aquaculture. These bacteria are ease
to cultivate and form spores, which facilitates its
conservation (Wang et al., 2008; Nayak, 2010; Han et
al., 2015). In addition, several bacteria of this genus
have the capacity to secrete antimicrobial compounds
and different exoenzymes that aid digestion (ZiaeiNejad et al., 2006).
Bacillus amyloliquefaciens (ex Fukomoto, 1943)
Priest et al., 1987 is a non-pathogenic bacterium rodshaped, aerobic, Gram-positive, and catalase positive
(Loncar et al., 2014). This bacterium is highly resistant
to environmental changes (Mahdhi et al., 2012; Das et
al., 2013), presents antibacterial activity of broad
spectrum (Kaewklom et al., 2013), and is an important
producer of α-amylase, an enzyme that acts in the
digestion of carbohydrates (Wang et al., 2008).
Recently, in studies with B. amyloliquefaciens Reda
& Selim (2015) observed in O. niloticus reared in
laboratory conditions; improve in body composition
and intestinal morphology. Ridha & Azad (2012)
reported in the same fish improvements on growth
performance and immune response. Cao et al. (2011)
observed in Anguilla anguilla, antagonist activity of B.
amyloliquefaciens and Aeromonas hydrophila. The
same effect was observed by Ran et al. (2012) in
Ictalurus punctatus against A. hydrophila and
Edwardsiella ictaluri. Das et al. (2013) observed an
increase in disease resistance in Catla catla.
The aim of this study was to evaluate the effect of
diet containing three concentrations of the probiotic B.
amyloliquefaciens on performance, blood profile and
intestinal morphology in Nile tilapia, O. niloticus,
reared in cages.
Fish culture, diet and feeding
Masculinized Nile tilapia (Oreochromis niloticus) (35
± 5 g) from the same spawning were obtained from
commercial breeding. The cages (1.5 m3) were distri-
buted in four experimental groups (triplicate) in a
completely randomized design (78 fish per cage). The
experiment was conducted in the reservoir 3 of the
Aquaculture Center of Sao Paulo State University,
Jaboticabal (21°14.33'S, 48°17.55'W) in April-June
2014. This reservoir has approximately 10,000 surface
m2.
The animals were acclimated for 10 days and fed
with basal diet (pellets used in this experiment without
addition of probiotics). It was used the program “Super
Crac Premium” to formulate the diet according the
suggestions of Furuya (2010). Feed was extruded. The
feed rate was 3% of body weight, 3 times a day for 90
days on basal diets containing 0 (control); 1×106 CFU
g-1; 5×106 CFU g-1; and 1×107 CFU g-1 of Bacillus
amyloliquefaciens.
Diet composition is shown in Table 1. To achieve
homogeneous final concentrations of bacteria in the
diet and to facilitate the adhesion of the probiotic, the
bacterial suspension was added and homogenized
manually with commercial vegetable oil (4% by
weight; 4.000 kcal L-1). Thus, according to the
recommendations of Das et al. (2013) food was
prepared every 7 days to maintain optimal probiotic
levels.
Fish were measured at 30 and 60 days for diet
amount adjustment. During the experimental period,
except temperature, there were no important changes in
the water quality that could have interfered in the
experiment results (Boyd & Massaut, 1999). The values
were maintained as follows: the water temperature
varied from 27.1 to 21.9°C (24.35 ± 2.43°C) and
dissolved oxygen (7.31 ± 0.48 mg L-1). Both were
measured using an YSI 53 device (YSI Company,
USA); pH (7.50 ± 0.30) and electrical conductivity
(45.54 ± 10.40 µV) were measured using a 63 YSI
device (YSI Company, USA). Water transparency
(26.03 ± 2.10 cm) was measured using the Secchi disk
at 11:00 h on alternate days.
Isolation and identification of the probiotic bacterial
strain
The bacterium was isolated from a commercial product
containing Bacillus amyloliquefaciens. To confirm the
presence of the bacteria in the product, 1.0 g of the
probiotic was homogenized in 99 mL of phosphate
buffered saline (145 mM NaCl, 1.4 mM NaH 2PO4, 8
mM Na2HPO4, pH 7.4). Thus, it was performed serial
dilutions with peptone solution (4%) (Sigma-Aldrich,
USA), distributed into Petri dishes containing culture
medium trypticase soy Agar (TSA), and incubated for
48 h under aerobic conditions at 26°C. Colonies of
Bacillus sp. were identified according their morphological, biochemical and dyeing features (Priest et al.,
Dietary B. amyloliquefaciens in cage-reared tilapia
Table 1. Ingredients and proximal composition of the
basal diet.
Ingredients
Corn flour
Soybean meal (38% CP)
Rice bran
Wheat flour
Corn gluten (20% CP)
Poultry by-product meal (65% CP)
Fish meal (60% CP)
DL-Methionine
Dicalcium phosphate
L-Tryptophan
L-Lysine
Antifungi
Antioxidant
Vitamin mix¹
Proximal composition (%)
Dry matter
Crude protein
Digestible energy (kcal kgˉ¹)
Ether extract
Fiber
Ash
%
30.000
20.000
14.766
13.000
12.000
5.000
3.000
0.700
0.610
0.200
0.164
0.030
0.030
0.500
90.10
30.21
2990.12
4.98
4.67
4.78
¹Composition of vitamin-mineral supplement (Fri-Ribe):
vitamin A, 600,000 IU; Vitamin D3 600,000 IU; Vitamin
E 12,000 IU; Vitamin K3, 1200 mg; vitamin B1, 1200
mg; vitamin B2, 1536 mg; vitamin B6, 1287 mg; B12,
4000 mg; folic acid, 198 mg; pantothenic acid, 3800 mg;
Vitamin C, 48,000 mg; biotin, 20 mg; choline, 30,000 mg;
niacin 19,800 mg; Fe, 25,714 mg; Cu, 1960 mg; Mn,
13,334 mg; Zn, 6000 mg; I, 948 mg; Co, 2 mg; Se, 30.10
mg.
1987). The sequencing of 16S rDNA gene was
performed from isolated colonies by the method of
Sanger et al. (1977).
The quantification of the probiotic bacteria in the
feed was performed by homogenizing 1.0 g of diet in
99 mL of PBS. Then, it was performed serial dilutions
as described above. Finally, they were evaluated the
colonies that showed morphological, biochemical, and
dyeing features compatible with B. amyloliquefaciens.
Samples of all treatments were subjected to molecular
identification of the bacterium as described previously.
Growth performance
After 90 days, fish were measured and weighed to
determinate performance indices:
 Weight gain (WG) = Final weight - initial weight
 Specific growth rate (SGR) = (In[final weight] In[initial weight]) x 100/number of days
965
 Feed efficiency (FE) = weight gain x 100/food
consumed
Proximal composition
After the feeding period, 10 fish from each group were
euthanized using benzocaine (0.5 g L-1) (Wedemeyer,
1970) and stored at -18°C for later analysis of proximal
composition. Then the samples were ground to obtain a
homogenous product and dried in an oven at 55°C for
48 h. The humidity was determined by drying in an
oven at 105°C for 24 h. The ash content was obtained
after incineration in a muffle furnace at 550°C and the
energy by bomb calorimetry. Protein was determined
by Kjeldahl method and the ether extract by Soxhlet
method (AOAC, 2005).
Hematological profile and glucose
After anesthesia, blood of 10 fish per replicate were
collected by puncture of the caudal vessel and
distributed in tubes containing EDTA (10%) for
determination of hematocrit (Goldenfarb et al., 1971),
hemoglobin (Collier, 1944) and, red blood cell counts
using the solution Natt & Herrick as diluent and dye.
Then, they were calculated the mean corpuscular
volume (MCV), mean corpuscular hemoglobin (MCH)
and, mean corpuscular hemoglobin concentration
(MCHC).
Blood smears were stained with Panotic dye
(Laborclin, PR, Brazil) to count leukocytes and thrombocytes. The determination of blood glucose was
performed with the rapid glucose analyzer One Touch
UltraMini® (Lifescan, CA, USA).
Analysis of intestinal morphometry
The collection of the intestine was performed in the
same fish used in the blood analysis. After deep
anesthesia, it was performed a longitudinal incision in
the abdomen and collected a fragment of the anterior
portion of the intestine located two centimeters after the
pylorus. The fragments were fixed in Bouin solution for
24 h. Then, they were dehydrated in 70% alcohol to
histological processing (Honorato et al., 2011). The
slides were stained with hematoxylin-eosin (HE) for
morphometric evaluation of villi and with periodic
acid-Schiff (PAS) for goblet cell count.
The measurement of the height and width of the
villi, epithelial thickness, and counting of goblet cells
were performed according to Mello et al. (2013). It was
used a Zeiss Axio Vision image analyzer.
Data were subjected to analysis of variance (ANOVA),
differences between treatments were compared by Tukey
966
test (P < 0.05). Data were analyzed by statistic R
software (version 0.98.1) and presented as mean ±
standard deviation.
number of goblet cells comparing to control group
(Table 6, Fig. 2).
DISCUSSION
RESULTS
Performance and proximal composition
Under the conditions evaluated, there was no statistical
difference in weight gain, feed conversion, specific
growth rate, and feed efficiency (Table 2). Proximal
analysis of fish carcass showed no significant
difference between treatment and control groups (Table
3).
Hemoglobin and glucose levels showed differences
between treatments. The group supplemented with the
highest concentration of probiotic (1×107 UFC g-1)
showed the lower values for these variables. Other red
blood cell parameters (Table 4) and differential
leukocyte count (Table 5) showed no statistical
difference between treatments.
Intestinal morphometry
Histomorphometric evaluation of the anterior portion
of the intestine showed significant difference in the
height of the villi in groups supplemented with 5×106
CFU g-1 and 1×107 CFU g-1 compared to 1×106 CFU g1
and control groups (Fig. 1). There were observed no
lesion in the intestine and no differences in the width
and thickness of the villi between control and treatment
groups (Table 6). Fish that received the highest
concentration of probiotic also had significantly greater
The use of B. amyloliquefaciens as a probiotic in fish
feeding is recent and information is scarce. However, it
has demonstrated that dietary supplementation with this
bacterium improves growth performance in fish. In
tilapia fingerlings reared in glass aquaria, supplementation with this bacterium improved weight gain,
specific growth rate and feed conversion after
supplement with 10 6 CFU g-1 of B. amyloliquifaciens
for 60 days (Reda & Selim, 2015). However, no
differences were observed when the probiotic was
administered at 104 CFU g-1 of concentration. Similarly,
Telli et al. (2014) found no effect of Bacillus subtilis
(5×106 CFU g-1) on performance of Nile tilapia, even
after 84 days of feeding supplemented diet.
In this study, there was no effect of the probiotic B.
amyloliquefaciens on growth performance. This can be
explained due to the low temperatures in the last 2
months. Marcusso et al. (2015) reported that the
homeostasis of Nile tilapia rearing at temperatures
below 24ºC could be affected, enhancing the
susceptibility to bacterial infections and impairing the
growth performance.
Ridha & Azad (2012) tested B. amyloliquefaciens
(108 CFU g-1) in Nile tilapia reared in tanks for 99 days
and did not find any difference in performance indices
either. However, they observed 60 days after that fish
Table 2. Growth performance indices of Nile tilapia fed with experimental diets. WG: weight gain, SGR: specific growth
rate, FE: feed efficiency. Mean ± SD. There were no statistical differences (P > 0.05) between treatments.
Treatments
Control
1×106 UFC g-1
5×106 UFC g-1
1×107 UFC g-1
WG (g)
SGR (%)
FE
86.84 ± 36.53
83.47 ± 30.84
90.44 ± 39.68
94.5 ± 39.66
1.10 ± 0.51
1.09 ± 0.44
1.13 ± 0.53
1.18 ± 0.55
0.842 ± 0.245
0.864 ± 0.245
0.791 ± 0.300
0.906 ± 0.206
Table 3. Body composition (%) and gross energy (kcal kg-1) of Nile tilapia fed with experimental diets. CP: crude protein,
EE: ether extract, M: moisture, Ash; GE: gross energy. Mean ± SD. There were no statistical differences (P > 0.05) between
treatments. Values are in % of dry weight.
Treatments
Control
1×106 UFC g-1
5×106 UFC g-1
1×107 UFCg-1
CP%
EE %
M%
Ash %
GE (kcal kg-1)
43.1 ± 0.3
44.6 ± 0.4
39.9 ± 0.6
42.8 ± 0.4
25.8 ± 0.8
24.2 ± 0.9
25.4 ± 0.7
26.6 ± 0.8
77.5 ± 0.5
76.2 ± 0.3
76.8 ± 0.6
77.3 ± 0.5
11.8 ± 0.7ª
13.8 ± 0.4ª
12.3 ± 0.4ª
12.0 ± 0.6ª
5064 ± 21.1
5716 ± 13.5
5150 ± 16.1
5635 ± 18.3
967
Table 4. Hematological parameters. Hct: hematocrit, Hb: hemoglobin, RBC: red blood cells, MCHC: mean corpuscular
hemoglobin concentration, MCH: mean corpuscular hemoglobin, MCV mean corpuscular volume, and G: plasma glucose
of the Nile tilapia fed different probiotic concentrations in feed. Means ± SD. Values (mean ± SD) with different letter are
significantly different (P < 0.05).
Treatment
Control
1×106 UFC g-1
5×106 UFC g-1
1×107 UFC g-1
Hct (%)
36.8 ± 2.9ª
38.5 ± 3.4ª
39.2 ± 1.6ª
37.4 ± 1.9a
Hb (g dL-1)
RBC (104 µL-1)
a
10.75 ± 1.0
11.20 ± 1.6ª
10.90 ± 1.3ª
8.53 ± 1.2b
295.93 ± 49.6ª
292.33 ± 34.6ª
303.06 ± 33.4ª
293.50 ± 36.5ª
MCHC (g dL-1)
27.01 ± 3.4ª
24.44 ± 3.2ª
27.95 ± 4.9ª
26.36 ± 4.6ª
MCH (pg)
a
33.05 ± 5.8
32.53 ± 4.6a
35.72 ± 7.0a
35.08 ± 7.9a
MCV (fL)
G (mg dL-1)
125.96 ± 21.7ª
123.78 ± 11.0a
127.89 ± 11.8ª
133.31 ± 20.4ª
110.00 ± 34.9ª
66.80 ± 36.8ab
41.40 ± 9.8b
36.25 ± 5.8b
Table 5. Differential leukocyte count in the circulating blood of Nile tilapia fed the experimental diets. Means ± SD. There
were no statistical differences (P > 0.05) between treatments.
Treatment
Control
1×106 UFC g-1
5×106 UFC g-1
1×107 UFC g-1
Leukocyte
(mm3)
110.2 ± 20.5
129.4 ± 27.8
105.92 ± 14.3
112 ± 13.4
Lymphocytes
(103 µL-1)
31.44 ± 8.1
26. 31 ± 13
30. 72 ± 9.3
28.11 ± 6.4
Neutrophils
(103 µL-1)
16.3 ± 4.92
19.55 ± 5.21
16.2 ± 4.16
14.11 ± 3.1
Monocytes
(103 µL-1)
16.02 ± 3.4
15.03 ± 4.7
17.46 ± 6.2
14.6 ± 7.2
Basophils
(103 µL-1)
0±0
0±0
0±0
0±0
Eosinophils
(103 µL-1)
0.3 ± 0.04
0.31 ± 0.2
0.27 ± 0.18
0.32 ± 0.23
Figure 1. Comparative photomicrographs of the anterior portion of the intestine of Nile tilapia fed different probiotic
concentrations in the diet. a) Control group, b) 1×106 CFU g-1, c) 5×106 CFU g-1, and d) 1×107 CFU g-1. Villi height enhanced
proportionally to the concentration of the probiotic. Scale bar: 200 µm. Stain: hematoxylin-eosin.
968
Figure 2. Comparative photomicrographs of the epithelial
layer of the intestinal villi of Nile tilapia supplemented
with different probiotic concentrations in the diet. a)
Control group, b) 1×106 CFU g-1, c) 5×106 CFU g-1, and
d) 1×107 CFU g-1. Goblet cells (deep red colour -magentacells on the edge of the villi) increased proportionally to
the concentration of the probiotic in the diet. Scale bar:
100 µm. Stain: Periodic acid-Schiff (PAS).
previously supplemented with the bacterium showed
better growth performance than control group,
suggesting that the effects of this probiotic occur over
time. Unlike this report, in the present study fish were
reared in cages in a reservoir with abundant algae (low
transparency of water). This availability of food could
influence the growth performance of fish, explaining
why there was no difference between treatments.
The efficiency of nutrient transfer from food to the
organism can be measured by the proximal composition
analysis. This is of great importance due to it may
reflect the nutritional value of the fish and its
organoleptic characteristics (Contreras, 1994). Several
authors have reported improvements in body composition of Nile tilapia supplemented with probiotics
(Mello et al., 2013; Hassaan et al., 2014; Reda & Selin,
2015). However, in this study, body composition
analysis values showed no significant difference
between treatment and control groups. Similar results
were found by Telli et al., (2014) in Nile tilapia fed diet
supplemented with B. subitilis.
Hematological variables are commonly used as
indicators of physiological condition in fish
(Mohapatra et al., 2014). Some studies reported that
after feeding with Bacillus sp., Nile tilapia presented
alterations on the hematological variables (Hassaan et
al., 2014; Telli et al., 2014.) or not (Kumar et al., 2006;
Soltan & El-Laithy, 2008). In the present study, we did
not observe differences in hematocrit, red blood cells
count and hematological indices (MCHC, MCH and
MCV). However, there was a higher hemoglobin levels
in the fish fed with lower concentrations of probiotic.
This could be related to the necessity of transport more
oxygen in blood to meet the increasing energy demand
of fish promoted by high levels of glucose (Nikinmaa
et al., 1983).
As in current study, Reda & Selim (2015) observed
increase in hemoglobin levels in blood of Nile tilapia
supplemented with B. amyloliquefaciens. However, the
authors also observed an increase in the number of
erythrocytes and leukocytes in blood, but without
changes in blood glucose. They were reporter that
probiotic bacteria enhance the iron absorption due to
the release of organics acids in the gut. This would
increase the availability of iron to produce hemoglobin
in rats (Yadav et al., 2007) and fish (Dahiya et al.,
2012).
Probiotics enhance fish tolerance to stress agents of
environmental origin or related to handling (TapiaPaniagua et al., 2014). During stress, the release of
catecholamines stimulates glycogenolysis (MartínezPorchas et al., 2009). The rapid increase of glucose in
blood is one indicator of stress in fish (Simoes et al.,
2012). In the present study, the higher blood glucose
observed in the control group compared to
supplemented ones with the greater inclusion of
probiotic in the diet may reflect the homeostatic state of
the animals against adverse conditions. B. amyloliquefaciens seems to have positively influenced the
glucose levels of fish supplemented with 5×106 CFU g-1
and 1×107 CFU g-1 of feed, enhancing the homeostatic
state of fish. Similar findings have been reported by
Mohapatra et al. (2014) in Labeo rohita stressed that
presented lower glucose levels in fish fed with this
probiotic.
969
Table 6. Histomorphometric parameters and goblet cells per villus in the intestine of Nile tilapia fed the experimental diets.
Mean ± SD. Values (mean ± SD) with different letter are significantly different (P < 0.05).
Treatments
Control
1×106 UFC g-1
5×106 UFC g-1
1×107 UFC g-1
Total height
of villi (µm)
466.0 ± 92.9a
407.2 ± 121.1a
438.4 ± 105.5a
487.2 ± 31.2a
Height of villi
(µm)
378.1 ± 99.7b
371.3 ± 91.6b
423.2 ± 95.3a
469.4 ± 25.1a
Stress is one of the factors that contribute to the
emergence of primary diseases and mortality of reared
fish. Both food and environmental changes could
promote stress modifying the gut microbiota and the
establishment of pathogens in the gastrointestinal tract
(Tannock & Savage, 1974). Thus, it is likely that an
improvement in the homeostatic level promoted by the
probiotic in this study may be related to increased
stability of the gut microbiota with reduction of harmful
bacteria in the epithelium (Rollo et al., 2006).
The intestinal lumen of the fish is lined by a simple
columnar epithelium interspersed with goblet cells
(Reifel & Travill, 1979). The integrity of the intestinal
mucosa is a consequence of the intensity of epithelial
cell renewal that determines the uniformity of the villi
and the number of goblet cells (Mello et al., 2013).
The increased villi height observed in the
supplemented groups in this study and the lower
number of pathogenic bacteria in the enterocytes could
be related to the increased availability of nutrients and
reduced desquamation of the epithelium. Furthermore,
it is known that some proteins produced by probiotic
bacteria promote increased cellular survival time of the
intestinal tract due to the inhibition of apoptosis
signaling induced by cytokines (Sherman et al., 2009).
Mello et al. (2013) observed in Nile tilapia fed diets
containing Bacillus cereus and B. subtilis an increasing
of the area of absorption, nutrient retention and
consequent improvement in growth performance and
body composition. In this study, although the intestinal
absorption area has grown substantially, there was no
difference in performance. This can be explained due to
the short evaluation time, which was not enough to
show its effects in performance and proximal analysis.
It can also relate to the low concentration of the
probiotic or due to the adverse weather conditions
recorded in the last month of the experiment in which
the temperature decreased.
The production of mucus by goblet cells is an
important mechanism of protection against the entry of
pathogens through the intestinal tract (Ellis, 2001).
Furthermore, the mucus has bactericidal effect, protects
Width of
villi (µm)
62.5 ± 27.7a
51.4 ± 8.7a
54.2 ± 11.4a
57.0 ± 13.3a
Epithelium
thickness (µm)
113.3 ± 83.4a
98.9 ± 19.8a
118.3 ± 21.5a
107.3 ± 23.9a
Goblet cell
count per villi
11.38 ± 5.2b
16.45 ± 6.63ab
25.24 ± 8.32a
23.32 ± 8.43a
against toxic substances and aids the transport between
the luminal contents and epithelial cells (Smirnov et al.,
2005).
It is well documented that probiotics stimulate the
development of goblet cells in the intestine (Nayak,
2010; Mello et al., 2013). In this study, fish that
received the highest level of inclusion of probiotic
showed significantly higher number of goblet cells
compared to control group. This result corroborates the
observations of Reda & Selim (2015) that observed
growth of the villi and increased goblet cell number in
fish supplemented with B. amyloliquefaciens.
From the results obtained, it is possible to suggest
that in the tested conditions, the use of B. amyloliquefaciens in the diet presented good indications,
increasing the size of the intestinal villi, number of
goblet cells and enhancing the homeostatic state of the
fish. However, it is necessary longer studies with larger
concentrations of the probiotic in field conditions to
asseverate that the use of this product is suitable to Nile
tilapia.
ACKNOWLEDGEMENTS
We would like to thank FAPESP (2012/10090-4) for
financing this study.
REFERENCES
Association of Official Analytical Chemists (AOAC).
2000. Official methods of analysis of the Association
of Official Analytical Chemists. AOAC, Arlington,
1234 pp.
Ayandiran, T.A., A.A. Ayandele, S.O. Dahunsi & O.O.
Ajala. 2014. Microbial assessment and prevalence of
antibiotic resistance in polluted Oluwa River, Nigeria.
Egypt. J. Aquat. Res., 40, 3: 291-299.
Boyd, C. & L. Massaut. 1999. Risks associated with the
use of chemicals in pond aquaculture. Aquacult. Eng.,
20: 113-132.
970
Cao, H., S. He, R. Wei, M. Diong & L. Lu. 2011. Bacillus
amyloliquefaciens G1: a potential antagonistic bacterium
against eel-pathogenic Aeromonas hydrophila. Evidence-based complement. Altern. Med., pp. 1-7.
Chi, C., B. Jiang, X.-B. Yu, T.-Q, Liu, L, Xia & G.-X
Wang. 2014. Effects of three strains of intestinal
autochthonous bacteria and their extracellular products
on the immune response and disease resistance of
common carp, Cyprinus carpio. Fish. Shellfish
Immunol., 36: 9-18.
Collier, H.B. 1944. Standardization of blood haemoglobin
determinations. Can. Med. Assoc. J., 50: 550-552.
Contreras, G.E.S. 1994. Bioquímica de pescados e derivados. Funep, Jaboticabal, 409 pp.
Dahiya, T., R.C. Sihag & S.K. Gahlawat, 2012. Effect of
Probiotics on the Haematological Parameters of Indian
Magur (Clarius batrachus L.). J. Fish Aquat. Sci., 7:
279-290.
Das, A., K, Nakhro, S. Chowdhury & D, Kamilya. 2013.
Effects of potential probiotic Bacillus amyloliquifaciens FPTB16 on systemic and cutaneous mucosal
immune responses and disease resistance of catla
(Catla catla). Fish Shellfish Immunol., 35: 1547-1553.
Ellis, A.E. 2001. Innate host defense mechanisms of fish
against viruses and bacteria. Dev. Comp. Immunol.,
25: 827-839.
Furuya, W. 2010. Tabelas brasileiras para a nutrição de
tilápias. Grafica & Editora, Toledo, 100 pp.
Garcia, F., J.M. Kimpara, W.C. Valenti & L.A Ambrosio.
2014. Emergy assessment of tilapia cage farming in a
hydroelectric reservoir. Ecol. Eng., 68: 72-79.
Goldenfarb, P.B., F.P. Bowyer, E. Hall & E. Brosious.
1971. Reproducibility in the hematology laboratory:
the microhematocrit determination. Am. J. Clin.
Pathol., 56: 35-39.
Han, Y., E. Liu, L. Liu, B. Zhang, Y. Wang, M. Gui, R.
Wu & P. Li. 2015. Rheological, emulsifying and
thermostability properties of two exopolysaccharides
produced by Bacillus amyloliquefaciens LPL061.
Carbohyd. Polym., 115: 230-237.
Hassaan, M.S., M.A. Soltan & M.M.R. Ghonemy. 2014.
Effect of synbiotics between Bacillus licheniformis
and yeast extract on growth, hematological and
biochemical indices of the Nile tilapia (Oreochromis
niloticus). Egypt. J. Aquat. Res., 40: 199-208.
Honorato, C.A., C.D. Cruz, D.J. Carneiro & M.R.F.
Machado. 2011. Histología e histoquímica do intestino
anterior de tilápia do Nilo (Oreochromis niloticus)
alimentadas com dietas contendo silagem de peixe.
Braz. J. Vet. Res. Anim. Sci., 48: 4 pp.
Kaewklom, S., S. Lumlert, W. Kraikul & R. Aunpad.
2013. Control of Listeria monocytogenes on sliced
bologna sausage using a novel bacteriocin, amysin,
produced by B. amyloliquefaciens isolated from Thai
shrimp paste (Kapi). Food Control, 32: 552-557.
Kersarcodi-Watson, A., H. Kaspar, M.J. Lategan & L.
Gibson. 2008. Probiotics in aquaculture: the need,
principles and mechanisms of action and screening
processes. Aquaculture, 274: 1-14.
Kim, T., J. Lee, D.W. Fredriksson, J. DeCew, A. Drach &
K. Moon. 2014. Engineering analysis of a submersible
abalone aquaculture cage system for deployment in
exposed marine environments. Aquacult. Eng., 63:
72-88.
Kumar, R., S.C. Mukherjee, K.P. Prasad & A.K. Pal.
2006. Evaluation of Bacillus subtilis as a probiotic to
Indian major carp Labeo rohita (Ham.). Aquacult.
Res., 37: 1215-1221.
Lee, J., S. Rheem, B. Yun, Y. Ahn, J. Joung, S.J. Lee, S.
Oh, T. Chun, I. Rheem, H.S. Yea, K.S. Lim, J.M. Cha
& S. Kim. 2013. Effects of probiotic yoghurt on
symptoms and intestinal microbiota in patients with
irritable bowel syndrome. Int. J. Dairy Technol., 66:
243-255.
Loncar, N., N. Gligorijević, N.A. Božić & Z. Vujčić.
2014. Congo red degrading laccases from Bacillus
amyloliquefaciens strains isolated from salt spring in
Serbia. Int. Biodeter. Biodegr., 91: 18-23.
Mahdhi, A., M. Esteban, Z. Hmila, K. Bekir, F. Kamoun,
A. Bakhrouf & B. Krifi. 2012. Survival and retention
of the probiotic properties of Bacillus sp. strains under
marine stress starvation conditions and their potential
use as a probiotic in Artemia culture. Res. Vet. Sci.,
93: 1151-1159.
Marcusso P., J. Yunis, G. Claudiano, S. Eto, D. Fernandes,
H. Mello, F. Marinho Neto, R. Salvador, J.R. Moraes
& F.R. Moraes. 2015. Influence of temperature on
Streptococcus agalactiae infection in Nile tilapia.
Braz. J. Vet. Res. Anim. Sci., (52)1: 57-62.
Martinez-Porchas, M., L.R. Martinez-Cordova & R.
Ramos-Enriquez. 2009. Cortisol and glucose: reliable
indicators of stress? Pan-Am. J. Aquat. Sci., 4: 158178.
Mello, H.D., J.R.E. Moraes, I.G. Niza, F.R.D. Moraes,
R.O.A. Ozório, M.T. Shimada, J.R. Engracia Filho &
G.S. Claudiano. 2013. Efeitos benéficos de probióticos
no intestino de juvenis de Tilápia-do-Nilo. Pesq. Vet.
Brasil., 33: 724-730.
Mohapatra, S., T. Chakraborty, A. Prusty, K. PaniPrasad
& K. Mohanta. 2014. Beneficial effects of dietary
probiotics mixture on hemato-immunology and cell
apoptosis of Labeo rohita fingerlings reared at higher
water temperatures. PLoS ONE, 9(6): 1-9.
Nayak, S. 2010. Probiotics and immunity: a fish perspective. Fish Shellfish Immunol., 29: 2-14.
Nikinmaa, M., A. Soivio, T. Nakari & S. Lindgren. 1983.
Hauling stress in brown trout (Salmo-trutta):
physiological responses to transport in fresh-water or
salt-water, and recovery in natural brackish water.
Priest, F., M. Goodfellow, L. Shute & R. Berkeley. 1987.
Bacillus amyloliquefaciens sp. nov., nom rev. Int. J.
Syst. Bacteriol., 37: 69-71.
Ran, C., A. Carrias, M. Williams, N. Capps, B. Dan, J.
Newton, J. Kloepper, E. Ooi, C. Browdy, J. Terhune &
M. Liles. 2012. Identification of Bacillus strains for
biological control of catfish pathogens. PLoS ONE,
7(9): 1-8.
Reda, R. & K. Selim. 2015. Evaluation of Bacillus
amyloliquefaciens on the growth performance,
intestinal morphology, hematology and body composition of Nile tilapia, Oreochromis niloticus. Aquacult.
Int., 23: 203-217.
Reifel, C.W. & A.A. Travill. 1979. Structure and carbohydrate histochemistry of the intestine in ten teleostean
species. J. Morphol., 162: 343-359.
Ridha, M. & I. Azad. 2012. Preliminary evaluation of
growth performance and immune response of Nile
tilapia Oreochromis niloticus supplemented with two
putative probiotic bacteria. Aquacult. Res., 43: 843852.
Rollo, A., R. Sulpizio, M. Nardi, S. Silvi, C. Orpianesi, M.
Caggiano, A. Cresci & O. Carnevali. 2006. Live
microbial feed supplement in aquaculture for improvement of stress tolerance. Fish. Physiol. Biochem.,
32: 167-177.
Sanger, F., S. Nicklen & A. Coulson. 1977. DNA
sequencing with chain-terminating inhibitors. P. Natl.
Acad. Sci. Usa., 74: 5463-5467.
Sherman, P., J. Ossa & K. Johnson-Henry. 2009.
Unraveling mechanisms of action of probiotics. Nutr.
Clin. Pract., 24: 10-14.
Simões, L.N., A.T.M. Gomide, V.M.F. Almeida-Val, A.L
Val & L.C Gomes. 2012. O uso do óleo de cravo como
anestésico em juvenis avançados de tilápia do Nilo
(Oreochromis niloticus). Acta Sci. Anim. Sci., 34:
175-181.
Smirnov, A., R. Perez, E. Amit-Romach, D. Sklan & Z.
Uni. 2005. Mucin dynamics and microbial populations
in chicken small intestine are changed by dietary
probiotic and antibiotic growth promoter supplementation. J. Nutr., 135: 187-192.
Received: 28 July 2015; Accepted: 25 September 2015
971
Soltan, M.A. & S.M.M. El-Laithy. 2008. Effect of
probiotics and some spices as feed additives on the
performance and behaviour of Nile tilapia, Oreochromis
niloticus. Egypt. J. Aquat. Biol. Fish., 12(2): 63-80.
Tannock, G. & D. Savage. 1974. Influences of dietary and
environmental stress on microbial populations in
murine gastrointestinal-tract. Infect. Immunol., 9: 591598.
Tapia-Paniagua, S.T., S. Vidal, C. Lobo, M.J. PrietoÁlamo, J. Jurado, H. Cordero, R. Cerezuela, I. García
de la Banda, M.A. Esteban, M.C. Balebona & M.A.
Moriñigo. 2014. The treatment with the probiotic
Shewanella putrefaciens Pdp11 of specimens of Solea
senegalensis exposed to high stocking densities to
enhance their resistance to disease. Fish Shellfish
Immunol., 41: 209-221.
Telli, G., M. Ranzani-Paiva, D. Dias, F. Sussel, C.
Ishikawa & L. Tachibana. 2014. Dietary administration of Bacillus subtilis on hematology and nonspecific immunity of Nile tilapia Oreochromis
niloticus raised at different stocking densities. Fish
Wang, L., F. Lee, C. Tai & H. Kuo. 2008. Bacillus
velezensis is a later heterotypic synonym of Bacillus
amyloliquefaciens. Int. J. Syst. Evol. Microbiol. 58:
671-675.
Wedemeyer, G. 1970. Stress of anesthesia with ms-222
and benzocaine in rainbow trout (Salmo gairdneri). J.
Fish. Res. Bd. Can., 27: 909 pp.
Wu, H-J., L-B. Sun, C-B. Li, Z-Z. Li, Z. Zhang, X-B.
Wen, Z. Hu, Y-L. Zhang & S-K. Li. 2014.
Enhancement of the immune response and protection
against Vibrio parahaemolyticus by indigenous
probiotic Bacillus strains in mud crab (Scylla
paramamosain). Fish Shellfish Immunol., 41: 156162.
Yadav H., J. Shalini & P.R. Sinha. 2007. Antidiabetic
effect of probiotic dahi containing Lactobacillus
acidophilus and Lactobacillus casei in high fructose
fed rats. Nutrition, 23: 62-68.
Ziaei-Nejad, S., M. Rezaei, G. Takami, D. Lovett, A.
Mirvaghefi & M. Shakouri. 2006. The effect of
Bacillus spp. bacteria used as probiotics on digestive
enzyme activity, survival and growth in the Indian
white shrimp Fenneropenaeus indicus. Aquaculture,
252: 516-524.
Lat. Am. J. Aquat. Res., 43(5): 972-985, 2015
Oceanic and climatic drivers of mangrove changes
Research Article
Oceanic and climatic drivers of mangrove changes in the
Gulf of Urabá, Colombian Caribbean
July A. Suárez1*, Ligia E. Urrego2*, Andrés Osorio1* & Hiara Y. Ruiz2
*Oceanography and Coastal Engineering Research Group (OCEANICOS)
1
Universidad Nacional de Colombia, Sede Medellín, Escuela de Geociencias
Facultad de Minas AA, 569 Medellín, Calle 59A Nº 63-20. Medellín, Colombia
2
Universidad Nacional de Colombia, Sede Medellín. Departamento de Ciencias Forestales
Colombia Núcleo El Volador AA 569 Medellín, Colombia
Corresponding author: July A. Suárez ([email protected])
ABSTRACT. The Gulf of Uraba is the largest estuary on the Caribbean coast of Colombia. The aim of this
research was to analyse the oceanic, climatic and environmental variables that influence mangrove structure and
composition in the gulf. Based on the availability of remote sensing, the study area was divided into western
and eastern zones. The spatial pattern of environmental variables (water salinity, pH and percentage of organic
matter, sand, silt and clay in the soils) and oceanic and climatic variables (winds, wave height and wave period)
was analysed. The relationship of these variables with variables of vegetation structure (basal area, diameter at
breast height, tree height, and abundance of seedlings of mangrove species in 1 m2 subplots) was analysed in 27
plots of 500 m2 containing fringe mangroves and 5 plots containing basin mangroves. Mangroves of the western
zone showed a higher structural development and were dominated by Rhizophora mangle (red mangrove). This
zone is supplied by fresh water and sediments, and the soils have a high content of organic matter and clay and
a low degree of anthropogenic disturbance. The eastern zone was characterized by higher pore water salinity
due to lower freshwater input from rivers. In this area there is a smaller impact of waves and winds, higher
sedimentation rates, high anthropogenic disturbance and mangroves are dominated by Avicennia germinans
(black mangrove). Although Laguncularia racemosa (white mangrove) did not show a particular spatial pattern,
due to its tolerance to open canopy conditions it was commonly found in anthropogenically disturbed areas.
Keywords: coastal ecosystems, swell, winds, coastal erosion, sediment transport, river flow, Colombian
Caribbean.
Controladores oceánicos y climáticos de cambios en los manglares
en el Golfo de Urabá, Caribe colombiano
RESUMEN. El Golfo de Urabá es el mayor estuario en la costa caribe de Colombia. El objetivo de esta
investigación fue analizar las variables oceánicas, climáticas y ambientales que influyen en la estructura y
composición de los manglares en el golfo. Según la disponibilidad de información de sensores remotos, el área
de estudio se dividió en una zona occidental y otra oriental. Se analizó el patrón espacial de las variables
ambientales (salinidad del agua, pH y porcentaje de materia orgánica, arena, limo y arcilla en los suelos) y las
variables oceánicas y climáticas (vientos, altura y período del oleaje). Se analizó la relación de estas variables
con las variables estructurales de la vegetación (área basal, diámetro a la altura del pecho, altura de los árboles
y abundancia de plántulas de especies de manglar en sub-parcelas de 1 m2), en 27 parcelas de 500 m2 que
contienen manglares de borde y 5 parcelas que contienen manglares de cuenca. Los manglares de la zona
occidental mostraron un desarrollo estructural superior y fueron dominados por Rhizophora mangle (mangle
rojo). Esta zona recibe gran cantidad de agua dulce y sedimentos, y los suelos tienen alto contenido de materia
orgánica y arcilla, y bajo grado de perturbación antrópica. La zona oriental se caracteriza por mayor salinidad
del agua debido a una menor entrada de agua dulce de los ríos. En esta zona se presenta un menor impacto de
oleaje y vientos, altas tasas de sedimentación, alta perturbación antrópica y los manglares están dominados por
Avicennia germinans (mangle negro). Aunque Laguncularia racemosa (mangle blanco) no mostró un patrón
__________________
Corresponding editor: Ricardo Prego
972
1
973
2
espacial particular, debido a su tolerancia a las condiciones abiertas de dosel, se encuentra comúnmente en áreas
con mayor intervención antrópica.
Palabras clave: ecosistemas costeros, mar de fondo, viento, erosión costera, transporte de sedimentos, caudal
del río, Caribe colombiano.
INTRODUCTION
Mangroves are important ecosystems for human
communities not only because of their economic
benefit but also because they protect coasts from
tsunamis, storm surges and erosion (Mazda et al., 1997;
Alongi, 2008). In addition, they reduce coastal water
eutrophization, contribute to sediment and human
waste uptake and play an important role in organic
matter exchange, carbon assimilation and faunal
feeding and reproduction (Ewel et al., 1998; Alongi,
2008). Since they are restricted to the ocean-continent
ecotone and catch high fluvial water and sediment
loads, mangroves structure, floristic composition and
natural regeneration of mangrove vegetation are
determined by several biotic, abiotic and anthropogenic
drivers, and are vulnerable to global and regional
environmental and climatic changes. Regional climate
change, especially that related to precipitation patterns,
the flooding of rivers, rises in sea level and ocean
circulation patterns (Duke et al., 1998; Gilman et al.,
2008) may influence mangrove distribution and
dynamics. Local drivers, such as the magnitude and
direction of winds, geomorphology, pore water salinity,
and soil conditions also play an important role in
vegetation patterns (Krauss et al., 2006).
Tidal range and amplitude, and sea level rise may
affect the distribution of mangroves, depending of the
rate of fluvial sediment supply. If the rate of sea level
rise is higher than sediment input, coastal erosion
occurs and the mangroves may disappear (Parkinson et
al., 1994), but if the rate of sediment supply exceeds the
increase in sea level rise, mangroves may colonize on
prograding deltas and beaches (Gilman et al., 2008;
Perillo et al., 2009; Shearman, 2010) or may even be
replaced by upland forests.
Despite the low tides on the Colombian Caribbean
coast (0.40 m), a decreasing west-eastern gradient in
rainfall drives deterioration in the mangrove vegetation
structure. In the Gulf of Urabá, located at the
Colombian Caribbean coast, higher mean annual
precipitation (2,500 mm), means that mangrove forests
can reach 9 m average height and contain about 10 tree
species (Urrego et al., 2014). In contrast, in La Guajira
in the north-eastern extreme of the country,
significantly drier conditions (mean annual precipitation 500-1000 mm) mean that trees reach only 5 m
in average height and no more than three true mangrove
species are found (Ulloa-Delgado et al., 1998). Along
the coast of the Gulf of Urabá, where there are more
than 4500 ha of mangroves, structural, floristic and
environmental differences have also been identified
(Urrego et al., 2014). In these forests, flooding, pore
water salinity and sediment input are responsible for
differences in physiographical mangrove types (GarcíaValencia, 2007; Hoyos et al., 2012; Molina et al., 2014;
Urrego et al., 2014).
In addition, large temporal changes in mangrove
forest expanses and composition recorded in the
Caribbean have been related to coastal erosion and
accretion processes (Torres et al., 2008; Rangel et al.,
2012), as have extreme events like hurricanes (OrtizRoyero, 2012) and storm surges as well as anthropogenic disturbances (Urrego et al., 2014). In fact,
between 2004 and 2011, 16% of the Colombian
Caribbean mangroves were lost due to both causes
(Rangel et al., 2012). Despite the current sea level rise
(Torres et al., 2008) in the Colombian Caribbean,
mangrove colonization has taken place along river
deltas and beaches that receive high fluvial sediment
input (Parkinson et al., 1994; Urrego et al., 2014).
Nevertheless, it is not clear how important drivers such
as winds, marine currents and sediment dynamics are
associated to both coastal geomorphology and
mangrove distribution and dynamics (Posada, 2011).
However, neither the sedimentation-erosion processes
that are closely linked to wave dynamics in the gulf
(Molina et al., 2014), nor sea level changes and
sediment transport and dispersion have as yet been
related to mangrove vegetation (García-Valencia,
2007). As a first approach, we propose the hypothesis
that besides continental processes related to geomorphology, the force of winds and waves and their
influence on sediment composition and dynamics
(sedimentation and erosion) play an important role in
the structure, composition and dynamics of mangroves
in the Gulf of Urabá. This is in spite of the gulf’s pocket
shape that could homogenize marine conditions and
their influence on vegetation.
Study area
The Gulf of Urabá is located in the northwestern corner
of the Colombian Caribbean (Fig. 1). The study area
covers 10,461 ha, of which 2,874 ha were covered with
9743
Figure 1. Location of the study area showing the two zones, the sampling sites and the main vegetation types found in the
Gulf of Urabá.
mangrove forests in 2009. Other vegetation types
present are tropical rain forests and open vegetation
(grasslands). Water bodies and urban constructions are
also present in the area. Based on the availability and
dates of remote sensing (satellite images and aerial
photographs), the study area was divided into two
zones: the western zone that includes the Atrato River
delta, and the eastern zone that includes the mouths of
the Turbo and Currulao rivers (Fig. 1).
In the gulf, the mean annual precipitation is 2,500
mm. The mean monthly precipitation is 250 mm during
the rainy season (from May to November) and 100 mm
during the dry season (From December to April). The
mean annual temperature is 27°C (CIOH, 2010) and the
greatest variation (26-28oC) occurs during the day time
(Francois et al., 2007). According to the Holdridge
classification system it is a typical tropical rainforest
climate (Espinal, 1990).
The Intertropical Convergence Zone (ITCZ)
modulates the annual rain fall distribution in the gulf.
During the dry season, when the ITCZ is farthest from
the gulf, winds come from a north-easterly direction.
The circulation currents present in these winds are
persistently high speed and are characterized by dry
atmospheric stability, low levels of cloud and
precipitation, and low atmospheric humidity (Francois
et al., 2007).
The Gulf of Urabá is a pocket shaped water body
located near the Caribbean border between Panamá and
Colombia. While the northern part of the gulf is wider
4975
and west-east oriented, the southern part is semi-closed
and north-south oriented. The length of the gulf from
north to south is approximately 80 km, and the average
width is 25 km. The microtidal regime is mixed semidiurnal with an average maximum height between 0.30
and 0.92 m. While the deepest waters (80 m) are found
towards the northern part of the gulf the shallowest ones
(30 m) are concentrated towards the southern area
(Bernal et al., 2005a; Montoya & Toro, 2006; Francois
et al., 2007).
The winds enter the gulf seasonally from several
directions and at different speeds. While during the wet
season the south-west winds had a speed between 1.5
and 2.7 m s-1, during the dry season the north to northeasterly winds reached speeds of 3-4 m s-1 with
maximum of 10 m s-1 (Francois et al., 2007).
From a hydrodynamic perspective, wave modelling
data that included both average and extreme conditions
validated with wave sensors identified two areas
dominated by different types of waves in the gulf
(Osorio et al., 2010). The first area is located to the
north of the boundary between the Atrato and Turbo
rivers deltas and the offshore limit of the gulf. The
second is located towards the south between the
aforementioned deltas and the end of the gulf in the
Bahia Colombia. While the first area was strongly
dominated by swell waves (waves coming from deep
water), the second area was strongly dominated by sea
waves (waves generated by local winds). Deep surge
energy is dissipated while propagating landwards into
the gulf and especially near the mouth of the Atrato
River (Molina et al., 2014). Our main study area is
located in the south (see the eastern and south-western
zone in Fig. 1).
The Atrato River is the main source of freshwater
and sediments to the gulf. The river flow distribution is
synchronous with that of precipitation. The multiannual mean runoff flow of the river is 2372 m3 s-1
(Francois et al., 2007; Posada, 2011). The coastal
erosion- sedimentation pattern is spatially variable
along the gulf’s shores. Strong erosion processes have
been recorded in the eastern zone as a result of the
Turbo River being artificially diverted in 1954. On the
other hand, the western zone is dominated by the highly
dynamic Atrato River delta. In this area both erosion
processes and the deposition and accumulation of
sediments take place (Bernal et al., 2005b; Francois et
al., 2007).
Six percent of Colombian Caribbean mangroves are
found along the coasts of the Gulf of Uraba
(INVEMAR, 2012). In the tidal flooded zones and
swamps, two physiographic mangrove types are
present: fringe mangroves dominated by R. mangle and
basin mangroves dominated by A. germinans. In
alluvial flooded zones that are not heavily influenced
by the tide, other mangrove species such as Conocarpus
erectus (button mangrove) and Pelliciera rhizophorae
(tea mangrove), and transitional tropical rain forest
species such as Montrichardia arborescens (yautia
madera), Raphia taedigera (yolillo palm), Pterocarpus
officinalis (corkwood) and Margaritaria nobilis (bastard
hogberry) are commonly found (Sánchez et al., 1997;
Urrego et al., 2014).
Space-time analysis of mangroves
Oceanic and climate variables such as wave height (Hs)
and peak period (Tp) of the mean regime, modelled by
Molina et al. (2014), were included in our analysis. For
the analysis of oceanic and climatic variables, only data
values obtained during the rainy season were available.
The sediment dynamics in each plot were included as
nominal variables in accordance with the classification
of Bernal et al. (2005b) (erosion: 1, sedimentation: 100
and stability: 50).
The analysis of forest structure and floristic
composition was based on field data from 32 plots each
of 500 m2, mostly located 100 m landwards along the
coasts at both sides of the gulf. At each plot, the
diameter at breast height (DBH), mean tree height and
basal area of all trees with DBH >2.5 cm were
measured. Values of pH and the percentages of sand,
silt, clay and organic matter in surface soil samples, as
well as the salinity and pH of pore water, were also
measured during the rainy season and included in the
analysis as environmental variables of each plot.
Temporal mangrove extension changes in the gulf
were based on analysis of aerial photographs and were
used for correlations with oceanic and climatic features.
While changes in vegetation cover in the western zone
were analysed between 1975 and 2009, in the eastern
zone they were assessed between 1980 and 2009. Gains
and losses in expanses of fringe, riverine and disturbed
mangroves were analysed. Net gain occurred when
non-mangrove coastal vegetation such as tropical rain
forest and herbaceous vegetation, or bare soil zones,
water bodies (sea, rivers, lakes and lagoons) and
urbanized areas, were converted into mangroves. Net
losses occurred when mangroves shifted into any one
of the aforementioned areas. The anthropogenic
influence on vegetation structure was assessed by
measuring the distance between each plot to the closest
human settlement (the city of Turbo in the eastern zone
and the Bocas de Atrato Village on the western side),
since such a distance influences the feasibility of
humane displacement to mangroves for harvesting.
Mangrove sedimentation rates were obtained from
two sediment cores of 50 and 60 cm deep, retrieved
using a Mackauley corer (Traverse, 1988). The first in
El Uno Bay (eastern zone) and the second in The
Candelaria Bay (western zone). In order to estimate the
chronology, isotopic analysis with 210Pb was achieved
at My Core Scientific Inc., Laboratory (Dunrobin,
Ontario, Canada)
Based on environmental variables recorded at each
plot, the spatial variation of the percentages of sand and
organic matter in the soil, the magnitude of the winds
and coastal sediment dynamics (sedimentation or
erosion) in the study area were assessed using trend
analysis with Arcgis 9.3 software (ESRI. Inc., 9.3).
After performing the Kolmogorov-Smirnov normality test using Statgraphics Centurion XV software
(Statpoint, 2005), vegetation, hydrodynamics and
climatic variables were normalized by means of the
function log(x) + 6, where x is equal to a variable value
and 6 was added to eliminate the negative values. In
order to establish the relationship between vegetation
and environmental, climatic and oceanic variables, and
to look for spatial differences in mangrove vegetation
patterns, Principal Component Analysis (PCA) and
Redundancy Analysis (RAD) were performed using
Canoco 4.5 (Ter Braak & Smilauer, 2002). The relative
weight of each of the oceanic, environmental and
anthropogenic variables was established through
multiple regression analysis.
RESULTS
Spatial analysis of hydrodynamic and vegetation
variables
Mangrove extension changes based on analysis of
aerial photographs, were correlated with oceanic and
climatic features and show the impact of oceanic and
environmental variables on the spatial distribution of
the mangrove species. Winds from south-western with
mean speed between 1.5 and 2.7 m s -1 were included in
the analysis. The areas sheltered from winds were
located mainly inside the bays of the western gulf.
However, the effects of waves (Hs and Tp) on
vegetation structure were spatially heterogeneous.
Even though some areas were sheltered, they were
highly influenced by waves (Hs of 0.17 and 0.22 m and
Tp between 2.4 and 2.8 s). Along most of the coasts,
especially in the bays, the magnitude of waves was
lower (Hs of 0.1 m and Tp between 1.5 and 2 s) in both
seasons and its effect on vegetation structure was also
softer since it was protected from the direct action of
waves (Fig. 2).
In the study area, sea waves predominated (Hs
decreased to about 0.1-0.4 m) due to the dissipation of
swell energy, especially when they approached the
Atrato River delta. However, the north-westerly waves
9765
were influenced by swell waves, where the waves
reached up to 1.2 m in the dry season and affect the
fringe mangroves. In contrast, the lowest Hs were
recorded along the internal bays of the Atrato River
delta in the west (Hs of 0.1 m and wave periods of 1.5
to 2 s), which were sheltered from the direct impact of
winds and waves, and where both fringe and basin
mangroves were found. At the eastern, along the
prograding zone of the spits of the rivers, where the
waves reached up to 0.5 m in some areas, mangroves
were influenced the least by the waves.
Regarding environmental variables (Fig. 3),
mangroves in the western zone of the gulf were
characterized by low values of water salinity (nearly 0)
and pH (average 3.8), but high percentages of organic
matter (30-50%) and clays (20-65%) in the soils. The
high flow of the Atrato and León rivers diminished the
pore water salinity and the impact of wave energy on
fringe mangroves and tropical rain forests that were
highly influenced by the sediment loads of these rivers.
In contrast, the mangrove stands of the eastern zone
showed higher values of pH (7.1-7.5), higher
percentages (100% in basin mangroves and 0-18% in
fringes) of sand in the soils, and greater pore water
salinity (13.8-20.8).
The relationship between oceanic, environmental
and anthropogenic variables and the structure and
composition of mangrove vegetation was evaluated by
multiple regression analysis and is shown in Table 1. A
strong relationship was found regarding the structure of
the three main mangrove species. While the averaged
DBH and basal area of R. mangle and A. germinans
adult trees increased with distance to human
settlements, the abundance of seedlings and saplings
declined in the first species but increased in the second.
On the other hand, the averaged DBH and basal area of
saplings and small trees of L. racemosa showed an
inverse relationship with distance to human
settlements. Therefore, distance from mangroves to
human settlements better explained the variability in
the structure of L. racemosa than other variables (Hs,
pore water salinity and river flow).
The averaged DBH (of trees with DBH >10 cm) of
A. germinans showed a stronger relationship with
distance from human settlements than with the soil pH
and percentage of clay. The seedling abundance was
also more strongly related to this distance than pore
water salinity and river flow. However, when the
averaged DBH of saplings and small trees (DBH <10
cm) were the dependent variables, the negative
relationship was stronger than previously important
variables such as the percentage of sand in the soil,
wind speed and Hs.
977
6
a
b
Figure 2. a) Wave height (Hs), b) peak period (Tp) in the mean wave regime for the most likely magnitudes of winds and
swell during the wet season.
Three groups of mangrove stand related to the
environmental variables analysed were identified by
the RDA (Fig. 4, Table 2). The first group corresponds
to the A. germinans dominated mangrove stands of the
eastern zone that had the highest values of pore water
pH and the greatest percentages of sand in the soil, but
lower wave periods (Tp) and wind speed. This group
recorded the highest basal area of A. germinans (10 m2
ha-1) and not only had the greatest density of small trees
(2.5 < DBH <10 cm) but also the lowest mean basal
area (3.59 m2 ha-1 of R. mangle and 1.31 m2 ha -1 de L.
racemosa) R. mangle had the highest seedling
abundance. All these parameters were also related to
lower percentages of clay and organic matter in the
soils when compared to the other groups.
The second group includes the mangrove stands
located to the north of the western zone and is
characterized by the high relative abundance of L.
racemosa adult trees, as well as L. racemosa and R.
Mangle seedlings. These vegetation features were
positively related to sediment deposition and pore water
pH, but negatively related to the wave period (Tp).
The third group includes the forests located towards
the south of the western zone and is characterized by
the high dominance of R. mangle in all size categories
and the low relative abundance of Pelliciera rhizophorae
and non-mangrove species. In this area there were
higher percentages of clay and organic matter in the
soils and high wind speeds. The third group is clearly
related to the maximum values of Hs (0.15 m) and Tp
(4.5 s). The strong relationship between Tp and R.
mangle seedling density (Fig. 4b, Table 2) might be the
result of wider propagule dispersion due to the increase
in Tp.
In summary, the vegetation structure was highly
correlated not only to physical environmental variables
such as the percentage of organic matter in the soils and
pore water salinity and pH, but also to hydrodynamic
variables like the maximum Tp, wind speed and river
flow (Fig. 4, Table 2).
Temporal vegetation analysis and sediment
dynamics
According to the remote sensing and the 210Pb analysis,
the highest sediment deposition rate was recorded at
Table 1. Multiple regression analysis between dependent variables (vegetation variables) and environmental, oceanic, climatic and anthropogenic variables
(independent variables). DBH: diameter at breast height (cm), Hs: significant wave height, Tp: peak period of waves, coastal processes, 100: sedimentation, 50:
stability, 1: erosion, river flow (m3 s-1), wind speed measured during the wet season, distance Hs: distance to humane settlements (m).
978
7
sites flooded by rivers, mainly in deltas and on river
banks where either the river flow or the wind speed was
rather low (Fig. 3). However, both zones showed
contrasting sediment dynamics. The sedimentation
rates measured along sediment cores showed changes
between 1939 and 2009, from 0.41 to 1.37 cm yr-1
(mean= 0.96 cm yr-1) in Candelaria Bay (western zone),
0.34 to 1.50 cm yr-1 in El Uno Bay (eastern zone)
(mean= 1.16 cm yr-1). While new accreted zones
increased 0.4% in the western zone between 1975 and
2009, in the eastern zone they grow 14.9% between
1980 and 2009.
The multi-temporal analysis based on aerial
photographs, revealed that 26.6% of the study area was
occupied by fringe mangroves. Of these, 83.7% were
located along the western zone of the gulf and 16.3%
are along the eastern zone. Along the western zone, the
expanse of fringe mangroves, dominated by R. mangle,
on newly deposited substrates offshore increased by
22% between 1975 and 2009 (Table 3). These new
areas were formed by accretion processes along the
banks of the Atrato River in wind and surge protected
bays.
While mangrove areas increased in accreted places
previously occupied by water bodies (rivers, lakes or
sea), mangroves losses occurred in eroded zones
formerly covered by mangroves but appeared occupied
by these water bodies at the end of analysed period.
The eastern zone had a higher input of sediments
and was less affected by strong winds than the western
zone. The higher percentages of sand found in the soils
(Fig. 3) were associated to littoral drift, higher
significant wave height and sedimentation along the
river beds. It caused increased of bare area by about
500% between 1980 and 2009. During this time span,
78 ha of fringe mangroves were lost due to coastal
erosion and onshore coastline displacement (Fig. 3). In
addition, the urbanized area increased by 20% (1.13 ha
yr-1) at the expense of basin and fringe mangroves.
Fringe mangroves were dominated by R. mangle close
to the shoreline, but where daily tidal influence
diminished onshore, the dominance of A. germinans
and L. racemosa increased.
In the western zone, between 1975 and 2009 the
mangroves grew on 80.4 ha of newly deposited
substrates along the Atrato River banks. Besides these
new areas, 62.2 ha were colonized by grasses and salt
marshes and the bare areas diminished. The highest
rates of erosion and the greatest mangrove losses were
recorded (195 ha) at both the north and south extremes
of the Atrato River delta. These processes were
associated to the highest recorded wave energy, with Hs
values of 0.2 m in the wet season and 0.5 m in the dry
season, respectively.
979
8
Figure 3. Environmental variables trend analysis. Green lines show the projection of the spatial variability of each variable
from west to east (X axis). Blue lines show south-north variability (Y axis).
While in the western zone, 14.2 ha of early
successional mangrove stands were lost due to coastal
erosion, onshore tidal flooding and conversion into
grasslands, in the eastern zone, 29.29 ha of these
mangrove stands were lost in the studied periods. These
mangroves were displaced by tropical rain forests,
which grow on recent deposited due to the increase in
alluvial sediment input, especially sands, as well as an
improvement in drainage conditions and soil stabilization, and a decrease in pore water salinity. This
impeded young mangrove tree species from competing
with non-mangrove species. The remaining young
mangrove stands (13.81 ha) of the eastern zone were
lost due to coastal erosion in sites affected by strong
winds (1.6 m s-1), and waves (20 cm).
DISCUSION
Relationship between hydrodynamics and vegetation
structure
The extended natural regeneration of mangroves in the
gulf is related to physical and anthropogenic processes
that have occurred in the region during last 30 years. In
particular, changes in sedimentation processes have led
to high relative abundances of A. germinans and L.
racemosa. The influence of waves and littoral drift on
the eastern gulf clearly shows that the accumulation of
sediments along the river spits gave place to formation
of new lands that plays an important role in the
colonization of mangroves. The natural regeneration of
A. germinans in the gulf is related to the high porewater salinity and the percentage of sand in the soils.
The survival of seedlings and saplings of this species is
associated not only to higher salinity and sedimentation
processes, but also to the increased availability of light
caused by anthropogenic disturbance of the forest
(Clarke & Allaway, 1993; Mckee, 1995). While the
establishment of Rhizophora implies high soil humidity
and organic matter accumulation (Lacerda et al., 1995),
sites colonized by Avicennia are continuously losing
organic matter due to the aforementioned factors
(Rajkaran & Adams, 2012).
In the western zone, R. mangle-dominated mangroves recorded 19.2 cm and 12.8 m of average tree
9809
a
b
Figure 4. Relation among variables from the redundancy analysis. a) Biplot of vegetation plots (circles) and oceanic and
climatic variables (arrows), b) biplot of vegetation variables (dotted arrows and solid arrows). AG: Avicennia germinans,
RM: Rhizophora mangle, LR: Laguncularia racemosa.
981
10
Table 2. Results of the redundancy analysis, canonical coefficients and intra set correlations of environmental variables for
the first two axes of RDA. Redundancy analysis of correlation matrix.
Axis
Eigenvalues
Plot-variable correlations
Cumulative percentage variance of plot data
of the plot-environment relationship
Variable
Wave height
Peak period
Coastal processes
River flow
Clay
Sand
Salinity
Pore water pH
Soil pH
Organic matter
Wind speed
1
2
3
4
0.28 0.09 0.08 0.03
0.89 0.76 0.64 0.67
28.1 37.4 45.5 48.7
51.1 68.1 82.8 88.8
Coefficients
Axis 1
Axis 2
-0.25
0.009
-0.28
-0.78
-0.03
0.15
0.24
0.13
-0.003
1.31
0.39
0.48
-0.23
-0.58
-0.35
-0.25
-0.22
0.51
-0.11
-0.98
-0.12
0.39
Total variance
1
Correlations
Axis 1 Axis 2
0.1
-0.11
-0.50
-0.11
0.33
0.19
0.14
0.30
0.29
-0.51
0.33
-0.20
-0.21
-0.62
0.20
0.07
0.59
-0.35
0.14
-0.51
-0.37
0.25
Table 3. Expanses of the types of vegetation cover (m2 ha-1) in the western and eastern zones of the Gulf of Urabá. Losses
and gains are indicated by negative and positive sign, respectively.
Coverage
Fringe mangroves
Basin mangroves
Early successional mangroves
Alluvial forests
Grasslands
Without coverage
Urban zone
Western zone
1975
2009
%
1906.6 2325.3
+22
286.8
3291.2
2304.1
223.7
3307.6
2494.8
38
-100
+0.5
+8.3
-83
DBH and height, respectively, and basal areas 17.39 m2
ha-1. These values are higher than those recorded in
mangroves of La Guajira at the north-eastern
Colombian Caribbean (Molina, 2009), where the R.
mangle-dominated mangroves showed values of 8.8
cm and 6.6 m of average tree DBH and height,
respectively, and mean basal areas of 12.9 m2 ha-1. And
they are also higher than those exhibited by fringe
mangroves in the Island of San Andrés (also in the
Caribbean) with average values of 6.25 of DBH, 9 m of
height, 16 m2 ha-1 of basal area (Urrego et al., 2009).
These larger heights and basal areas recorded in
mangrove trees in the gulf when compared with other
Colombian Caribbean mangroves are a result of high
rainfall, freshwater, nutrient and sediment input from
rivers. This causes salinity diminutions and an impro-
1980
238.4
137.3
89.2
321.4
411.4
11.6
158.2
Eastern zone
2009
%
451.6
+89.4
97.3
-29.1
-100.0
381.2
+18.6
349.6
-15
71.8
+519
191.1
+20.8
Total
1975-80
2009
2145
2777
137.3
97.3
376
0
3612.5 3688.8
2715.5 2844.4
235.7
109.9
158.2
191.1
%
+29.5
-29.1
-100
+2.1
+4.7
-53.4
+20.8
vement in mangrove productivity, as has been widely
recorded for other mangroves (Menezes et al., 2003;
Krauss et al., 2006a, 2006b; Rajkaran & Adams, 2012).
The best mangrove structure (R. mangle), represented by higher basal areas (22 m2 ha-1) and taller (7
m) trees, was recorded far away from urbanized areas
like the city of Turbo (in the eastern zone) or the Bocas
de Atrato Village (in the western zone). However,
mangroves closer to them showed smaller tree
diameters (8.3 cm) and basal areas (7.1 m2 ha -1)
(Estrada, 2014). This is the reason for the dominance of
small sized (<5 cm) R. mangle trees and a lack of trees
with a DBH greater than 20 cm in the surroundings of
urban areas. The same situation is found in other anthropogenically disturbed mangrove swamps (LópezHoffman et al., 2006). In mangrove swamps in the Gulf
of Urabá, the selective logging of R. mangle of both
large diameter mangroves for construction and small
diameter mangroves to make fishing poles is quickly
reducing their populations. The greatest number of
juvenile trees, the smallest basal areas, and most light
are commonly found in these anthropogenically
disturbed forests (Walters, 2005b).
However, the distance to urban populations also
explains the high relative abundance of A. germinans,
since the increase in open canopies in disturbed areas
favors its establishment and growth. In addition, close
to towns selective logging removes juvenile and adult
R. mangle and L. racemosa trees, allowing A.
germinans trees to reach a higher DAP and establish
extended stands in heavily managed patches, giving a
higher density of trees of this species Human pressure
on mangroves can lead to changes in the dynamics of
the natural regeneration and structure of mangrove
forests (Benfield et al., 2005; Walters, 2005a),
depending on the physiology and environmental
requirements of each of the species.
Multi-temporal analysis of vegetation cover
The expansion of fringe mangroves along the Gulf of
Urabá is mainly related to the formation of new
available lands fed by the increase in fluvial sediment
input. Major expansions have taken place in river
mouths and deltas where the wave energy is dissipated
by river currents and the sedimentation of coarse
sediments is more feasible, as has been recorded in
other areas of the Colombian Caribbean (Molina, 2009;
Urrego et al., 2014) and French Guyana (Proisy et al.,
2009). Mangrove expansion is favoured by two forces
that counteract each other simultaneously: firstly, the
increase in sediment accumulation (40 m yr-1 between
1940 and 1999 in the eastern zone in the mouth of the
Turbo River) (Correa & Vernette, 2004) and secondly
the sea level rise from 1993 to the present (Average
global sea level rise of 3.1 mm yr-1) (IPCC, 2007). An
increase in the mangrove extensions was favoured by
the sediment input from the Turbo River diversion in
the 50´s which caused an increase of 32% (from 305.38
to 403.29 ton yr-1 km-2) in sediment transport along the
river bed between 1946 and 2004 (Posada, 2011) that
created new deposited substrates to be colonized by
vegetation.
Both processes have contributed to substrate
stabilization and the creation of new sites for mangrove
colonization (Parkinson et al., 1994; Gilman et al.,
2008). However, mangroves may expand onshore as a
response to sea level rise, when an extensive flat coastal
plain is available. There, mangroves can establish
themselves at the expense of other vegetation types or
anthropogenic land uses. Such intertidal land recla-
982
11
mation by mangroves has been also recorded in other
Caribbean regions (Benfield et al., 2005) and has
caused the replacement of some vegetation types by
water bodies. The highest mangrove expansion
recorded in the eastern zone is related to the small size
of basins on the new lands created by the high sediment
loads brought in by rivers (Restrepo & Kjerfve, 2000;
Arroyave et al., 2012). High sedimentation rates have
been associated with the increase in river bank
deforestation during the second half of the XX century
which favoured the export of sediments (Arroyave et
al., 2012; Blanco-Libreros et al., 2013). In fact, annual
deforestation rates around the Turbo River headwaters
from 1960-2007 are among the highest in the world
(1.36%; Blanco-Libreros et al., 2013). In addition,
important vectors of regional development such as
agricultural and urbanized lands (Taborda & Blanco,
2012) have expanded during recent decades at the
expense of the natural vegetation covers. Increases in
mangrove cover along the shorelines of the gulf are
related to the increment in sediment input from the
Atrato River, especially to the artificial Turbo River
bed diversion created in 1954 (Posada, 2011). At these
sites, the colonization of vegetation has followed the
typical pattern recorded in other places, e.g., the growth
of R. mangle on recent river bank deposits and A.
germinans on the boundary between the filling area and
the dikes (Thom, 1967).
In addition, the direction of the littoral drift prevents
deltaic sediments of the Atrato River from being
distributed along the coasts of the gulf. Therefore, sand
spits are also fed by biogenic contributions from cliffs
in the western zone and small rivers in the eastern zone
(Francois et al., 2007). With regards to wave direction
and geomorphological features, the prevailing drift has
a southerly direction on both coasts, although seasonal
variations occur (Molina et al., 1992; Chevillot et al.,
1993; Bernal et al., 2005a; Montoya & Toro, 2006).
Despite the predominance of the high flow of the Atrato
River in the western zone of the gulf, sedimentation and
mangrove colonization rates are higher in the eastern
zone. This is not only due to littoral drift and high river
sediment loads, but more importantly due to low wave
energy. According to Molina et al. (2014) the patterns
of littoral drift along the Eastern Gulf are clearly
dominated by the oblique incidence of the NW and
NNW wave direction. This is the main mechanism of
longshore currents along the eastern coast and therefore
the main driver of littoral drift. For example, the
magnitude of potential sediment transport (based on the
influence of wave direction) in Punta Yarumal (the
mouth of the Turbo River) is about 23,523 m3 yr-1
during the dry season, when the littoral drift increases,
and around 6,326 m3 yr -1 during the wet season
983
12
(Posada, 2011). This pattern may explain the sedimentation of the spits and the mangrove colonization
rates in the eastern gulf.
CONCLUSIONS
According to our results, the distribution, structure and
composition of mangroves in the Gulf of Urabá are
closely influenced by oceanic, climatic and anthropogenic drivers. There is a strong relationship between
sediment acumulation and the increse in mangrove
expanses in the gulf in sites sheltered from waves,
winds and littoral drift where there is also a high fluvial
sediment input. In contrast, the highest mangrove loss
was recorded in sites highly impacted by waves (high
values of Hs and Tp) and coastal erosion processes.
Although it is clear that the establishment and
distribution of mangrove stands are strongly related to
the influence of Tp and Hs, our results cannot be
generalized since it is necessary to gather more field
data about the relationship between wave speed (related
to Tp) and the colonization process, as well as the drag
force and mangrove hydraulic properties during
extreme events.
Despite the relationship between mangrove
distribution and physical factors, there is a clear
anthropogenic impact on mangrove structure and
composition. While the density of A. germinans
increases with distance to human settlements, the
relative abundance of R. mangle and L. racemosa
decreases. However, it is necessary to carry out more
detailed studies on the impact of human activities, like
waste disposal, deforestation and chemical spills, on
mangrove ecosystems.
ACKNOWLEDGEMENTS
The authors are grateful to the research Direction of the
Universidad Nacional de Colombia for its financial
support, to Luis Jairo Toro and to the Geomatics
Laboratory of the Universidad Nacional de Colombia,
Medellín, (Department of Forestry Science) for their
support, and David Budd for English revision.
REFERENCES
Alongi, D.M. 2008. Mangrove forests: resilience,
protection from tsunamis, and responses to global
climate change. Estuar. Coast. Shelf Sci., 76(1): 1-13.
doi: 10.1016/j.ecss.2007.08.024.
Arroyave, A., J. Blanco & A. Taborda. 2012. Exportación
de sedimentos desde cuencas hidrográficas de la
vertiente oriental del Golfo de Urabá: influencias
climáticas y antrópicas. Rev. Ing. Univ. Medellín,
11(20): 13-30.
Benfield, S., H. Guzman & J. Mair. 2005. Temporal
mangrove dynamics in relation to coastal development
in Pacific Panama. J. Environ. Manage., 76: 263-276.
doi: 10.1016/ j.jenvman.2005.02.004.
Bernal, G., L. Montoya, C. Garizábal & M. Toro. 2005a.
La complejidad de la dimensión física en la
problemática costera del golfo de Urabá, Colombia.
Gestión Amb., 8: 123-135.
Bernal, G., M. Toro, L. Montoya & C. Garizábal. 2005b.
Estudio de la dispersión de sedimentos del río atrato y
sus impactos sobre la problemática ambiental costera
del Golfo de Urabá. Escuela de Geociencias y Medio
Ambiente, Facultad de Minas, Universidad Nacional
de Colombia, Sede Medellín, 61 pp.
Blanco-Libreros, J., A. Taborda-Marín, V. AmorteguiTorres, A. Arroyave-Rincón, A. Sandoval, E. Estrada,
J. Leal-Florez, J. Vásquez & A. Vivas. 2013.
Deforestación y sedimentación en los manglares del
golfo de Urabá. Gestión Amb., 16(2): 19-36.
Centro de Investigaciones Oceanográficas e Hidrográficas
del Caribe (CIOH). 2010. Climatología de los principales puertos del Caribe Colombiano. Centro de Investigaciones Oceanográficas e Hidrográficas del Caribe,
Cartagena, 6 pp.
Clarke, P. & W. Allaway. 1993. The regeneration niche of
the grey mangrove (Avicennia marina): effects of
salinity, light and sediment factors on establishment,
growth and survival in the field. Oecologia, 93: 548556.
Correa, I. & G. Vernette. 2004. Introducción al problema
de la erosion litoral en Urabá (sector Arboletes-Turbo)
costa Caribe colombiana. Bol. Invest. Mar. Cost., 33:
7-28.
Chevillot, P., A. Molina, L. Giraldo & C. Molina. 1993.
Estudio geológico e hidrológico del golfo de Urabá.
Centro de Investigaciones Oceanográficas e Hidrográficas del Caribe. Bol. Cient., 14: 79-89.
Duke, N., M. Ball & J. Ellison. 1998. Factors influencing
biodiversity and distributional gradients in mangroves.
Global Ecol. Biogeogr., 7: 27-47.
Espinal, T.L. 1990. Zonas de vida de Colombia. Universidad Nacional de Colombia, Medellín, 121 pp.
ESRI Inc., R., CA. (9.3). Corporate headquarters. ESRI.
380 New York Street Redlands, 92373-8100. Aregis,
9.3.
Estrada, E. 2014. Pérdida y fragmentación de los manglares asociadas a condiciones antrópicas y naturales
de la costa oriental del Golfo de Urabá, Caribe
Colombiano. Tesis de Maestría, Universidad de
Antioquia, Medellín, 82 pp.
Ewel, K., R. Twilley & J. Eong-Ong. 1998. Different
kinds of mangrove forests provide different goods and
services. Global Ecol. Biogeog., 7: 83-94. doi:
10.1111/ j.1466-8238.1998.00275.x.
Francois, Y., C. García, M. Cesaraccio & X. Rojas. 2007.
El paisaje en el golfo. In: C. García-Valencia (ed.).
Atlas del golfo de Urabá: una mirada al Caribe de
Antioquía y Chocó. Santa Marta, Colombia: Instituto
de Investigaciones Marinas y Costeras -INVEMAR- y
Gobernación de Antioquia. Ser. Publ. Espec. Invemar,
12: 75-128.
García-Valencia, C.E. 2007. Atlas del golfo de Urabá: una
mirada al Caribe de Antioquia y Chocó. Santa Marta,
Colombia: Instituto de Investigaciones Marinas y
Costeras -INVEMAR- y Gobernación de Antioquia.
Ser. Publ. Espec. Invemar, 12: 188 pp.
Gilman, E., J. Ellison, N. Duke & C. Field. 2008. Threats
to mangroves from climate change and adaptation
options: a review. Aquat. Bot., 89: 237-250. doi:
10.1016/j.aquabot.2007.12.009.
Hoyos, R., L. Urrego & A. Lema. 2012. Respuesta de la
regeneración natural en manglares del golfo de Urabá
(Colombia) a la variabilidad ambiental y climática
intra-anual. Rev. Biol. Trop., 61: 1445-1461.
Instituto de Investigaciones Marinas y Costeras
(INVEMAR). 2012. Informe del estado de los
ambientes y recursos marinos y costeros en Colombia.
Año 2011. Ser. Publnes. Periódicas Invemar, 8: 206
pp.
Intergovernmental Panel on Climate Change
2007. Cambio climático 2007: informe de
Contribución de los grupos de trabajo I, II
Cuarto Informe de evaluación del
Intergubernamental de Expertos sobre el
Climático, Ginebra, 114 pp.
(IPCC).
síntesis.
y III al
Grupo
Cambio
Krauss, K., T. Doyle, R. Twilley, V. Rivera- Monroy & J.
Sullivan. 2006a. Evaluating the relative contributions
of hydroperiod and soil fertility on growth of south
Florida mangroves. Hydrobiologia, 569: 311-324. doi:
10.1007/s10750-006-0139-7.
Krauss, K., B. Keeland, J. Allen, K. Ewel & D. Johnson.
2006b.
Effects
of
season,
rainfall,
and
hydrogeomorphic setting on mangrove tree growth in
Micronesia.
Biotropica,
39:
161-170.
doi:
10.1111/j.1744-7429.2006.00259.x.
Lacerda, L., V. Ittekkot & S. Patchineelam. 1995.
Biogeochemistry of mangrove soil organic matter: a
comparison between Rhizophora and Avicennia soils
in south-eastern Brazil. Estuar. Coast. Shelf Sci., 40:
713-720. doi: 0272-7714/95/060713+08.
López-Hoffman, L., I. Monroe, E. Narvaez, M. MartinezRamos & D. Ackerly. 2006. Sustainability of
984
13
mangrove harvesting: how do harvesters’ perceptions
differ from ecological analysis? Ecol. Soc., 11(2): 18.
Mazda, Y., M. Magi, M. Kogo & P. Nguyen. 1997.
Mangroves as a coastal protection from waves in the
Tong King delta, Vietnam. Mangr. Salt Marsh., 1: 127135.
Mckee, K. 1995. Seedling recruitment patterns in a
Belizean mangrove forest: effects of establishment
ability and physico-chemical factors. Oecologia, 101:
448-460.
Menezes, M., U. Berger & M. Worbes. 2003. Annual
growth rings and long-term growth patterns of
mangrove trees from the Bragança Peninsula, North
Brazil. Wetlands Ecol. Manage., 11: 233-242.
Molina, E. 2009. Dinámica de los manglares de Bahía
Portete, Alta Guajira a escala de paisaje y su relación
con variables climáticas asociadas al cambio climático
global y regional. Tesis Maestría en Bosques y
Conservación Ambiental, Universidad Nacional de
Colombia, Sede Medellín, Medellín, 67 pp.
Molina, A., C. Molina & P. Chevillot. 1992. La
percepción remota aplicada para determinar la
circulación de las aguas superficiales del Golfo de
Urabá y las variaciones de su línea de costa. Centro de
Investigaciones Oceanográficas e Hidrográficas del
Caribe. Bol. Cient., 11: 43-58.
Molina, L., A. Osorio & L. Otero. 2014. Capacidad de
transporte potencial longitudinal de sedimentos a
escala intra-anual en la zona costera de punta yarumal
delta del río turbo, Golfo de Urabá, Antioquia a partir
de la simulación de un clima marítimo. Bol. Invest.
Mar. Cost., 43(2): 207-242.
Montoya, L. & M. Toro. 2006. Calibración de un modelo
hidrodinámico para el estudio de los patrones de
circulación en el Golfo de Urabá, Colombia. Av. Rec.
Hidráulicos, 13: 37-54.
Ortiz-Royero, J. 2012. Exposure of the Colombian
Caribbean coast, including San Andres Island, to
tropical storms and hurricanes, 1900-2010. J. Int. Soc.
Preven. Mitig. Nat. Haz., 61(2): 815-827. doi:
10.1007/s11069-011-0069-1.
Osorio, A., A. Gómez, L. Molina, O. Alvarez & J. Osorio.
2010. Bases metodológicas para caracterizar el oleaje
local (sea) y de fondo (swell) en el Golfo de Urabá.
Congreso Latinoamericano de Hidráulica, Punta del
Este, 12 pp.
Parkinson, R., de R., Laune & J. White. 1994. Holocene
sea-level rise and the fate of mangrove forests within
the wider Caribbean region. J. Coastal Res., 10: 10771086.
Perillo, G., E. Wolanski, D. Cahoon & M. Brinson. 2009.
Coastal wetlands: an integrated ecosystem approach.
Elsevier, Amsterdam, 974 pp.
985
14
Posada, L. 2011. Efecto del cambio de las coberturas del
suelo sobre la geomorfología costera en las cuencas de
los ríos Acandí y Turbo del Golfo de Urabá. Maestría
en Medio Ambiente y Desarrollo, Universidad
Nacional de Colombia, Sede Medellín, Medellín, 133
pp.
Proisy, C., N. Gratiot, E. Anthony, A. Gardel, F. Fromard
& P. Heuret. 2009. Mud bank colonization by
opportunistic mangroves: a case study from French
Guiana using lidar data. Cont. Shelf Res., 29: 632- 641.
doi: 10.1016/j.csr.2008.09.017.
Rajkaran, A. & J. Adams. 2012. The effects of
environmental variables on mortality and growth of
mangroves at Mngazana Estuary, Eastern Cape, South
Africa. Wetlands Ecol. Manage, 20: 297-312. doi:
10.1007/s11273-012-9254-6.
Rangel, N., E. Galeano & O. Coca. 2012. Estudios para la
prevención y mitigación de la erosión costera.
Convenio MADS - INVEMAR. Informe Técnico Final
para Ministerio de Ambiente y Desarrollo Sostenible.
Santa Marta, D.T.C., 76 pp.
Restrepo, J. & B. Kjerfve. 2000. Water discharge and
sediment load from the western slopes of the
Colombian Andes with Focus on Río San Juan. J.
Geol., 108: 17-33.
Sánchez, H., R. Álvarez, F. Pinto, A. Sánchez, J. Pino, I.
García & M. Acosta. 1997. Diagnóstico y zonificación
preliminar de los manglares del Caribe de Colombia.
Ministerio del Medio Ambiente. Organización
Internacional de Maderas Tropicales. Dirección de
proyectos de repoblación y ordenación forestal.
Proyecto PD 171-91 Rev. 2 (F) Fase 1. Unión Gráfica,
Santa Fe de Bogotá, 250 pp.
Shearman, P. 2010. Recent change in the extent of
mangroves in the northern Gulf of Papua, Papua New
Guinea. AMBIO, 39: 181-189. doi: 10.1007/s13280010-0025-4.
Statpoint, I. 2005. Statgraphics Centurion XV Version
15.0.04.
Taborda, A. & J. Blanco. 2012. Exportación y depósito de
sedimentos en la franja costera del delta del Río Turbo.
In: J. Blanco-Libreros, M. Taborda & J. Vásquez.
(eds.). Sedimentación en manglares: relación con la
deforestación de la cuenca e impactos sobre la fauna
estuarina. El caso del delta del río Turbo y la costa sur-
Received: 24 July 2015; Accepted: 16 October 2015
oriental del Golfo de Urabá. Informe Final Proyecto
Impactos de las tasas de sedimentación sobre la
estructura trófica macrobentónica e íctica y el procesamiento de la hojarasca del manglar en el delta del Río
Turbo, Golfo de Urabá, Caribe colombiano. Universidad de Antioquia y Corporación para el Desarrollo
Sostenible de Urabá, Corpouraba, 274 pp.
Ter Braak, C. & P. Smilauer. 2002. Canoco 4.5. Canoco
Reference Manual and User's Guide to Canoco for
Windows: software for canonical community ordination (version 4). Microcomputer Power, Ithaca, New
York, 500 pp.
Thom, B. 1967. Mangrove ecology and deltaic geomorphology: Tabasco, Mexico. J. Ecol., 55(2): 301-343.
Torres, R., L. Otero, F. Franco & L. Marriaga. 2008.
Comportamiento del nivel del mar en el litoral Caribe
colombiano. Centro de Investigaciones Oceanográficas e Hidrográficas del Caribe. Bol. Cient., 26: 8-21.
Traverse, A. 1988. Paleopalynology. Unwin Hyman,
London, 600 pp.
Ulloa-Delgado, G., H. Sánchez-Páez, W. Gil-Torres, J.
Pino-Renjifo, H. Rodriguez-Cruz & R. Alvarez-León.
1998. Conservación y uso sostenible de los manglares
del Caribe Colombiano. MMA/ACOFORE/OIMT.
Santa Fe de Bogotá D.C., 224 pp.
Urrego, L., E. Molina & J. Suárez. 2014. Environmental
and anthropogenic influences on the distribution,
structure, and floristic composition of mangrove
forests of the Gulf of Urabá (Colombian Caribbean).
Aquat. Bot., 114: 42-49. doi: [http://dx.doi.org/
10.1016/j.aquabot. 2013.12.006].
Urrego, L., J. Polanía, M. Buitrago, L. Cuartas & A. Lema.
2009. Distribution of mangroves along environmental
gradients on San Andrés Island (Colombian Caribbean).
Bull. Mar. Sci., 85(1): 27-43.
Walters, B. 2005a. Ecological effects of small-scale
cutting of Philippine mangrove forests. Forest. Ecol.
Manage., 206: 331-348. doi: 10.1016/j.foreco.2004.
11.015.
Walters, B. 2005b. Patterns of local wood use and cutting
of Philippine mangrove forests. Econ. Bot., 59(1): 6676.
Lat. Am. J. Aquat. Res., 43(5): 986-992, 2015
Agonistic behavior of atypical feminized males
9861
Short Communication
Atypical feminized male's agonistic behavior relative to males and females
of Nile tilapia (Oreochromis niloticus L.)
Felipe Becerril-Morales1 & Juan Pablo Alcántar-Vázquez1
Laboratorio de Acuicultura, Dependencia de Educación Superior, Ciencias Agropecuarias
Universidad del Papaloapan (UNPA), Av. Ferrocarril s/n, Col. Ciudad Universitaria
Loma Bonita, Oaxaca, C.P. 68400, México
1
Corresponding author: Juan Pablo Alcántar-Vázquez ([email protected])
ABSTRACT. Early maturity during tilapia culture is a recurring problem. To avoid this, a series of techniques
have been developed, including the production of YY-males. This technique involves the use of hormones to
produce phenotypic females (XY genotype). However, incomplete transformations are frequently observed and
the produced atypical feminized males (AFM) could display an ambiguity in the phenotypic expression of
behavioral patterns. The aim of this study was to measure the frequency and intensity of aggressive behavior as
well as the role that initial residence plays when involving three phenotypes (males, females and AFM). The
experiment consisted of three stages. Resident fish were AFM in the first stage, males in the second and females
in the third. In each stage the resident fish confronted males, females and AFM acting as intruders. Aggressive
behavior was exercised more frequently by resident fish. Intersexual confrontations showed higher levels of
aggression compared to intrasexual confrontations. The frequency of confrontations was not significantly
different in confrontations involving AFM, however, differences were observed in intensity of aggression. It is
possible that an incomplete transformation at physiological level could be responsible for an inaccurate decoding
of signal during confrontations.
Keywords: Oreochromis niloticus, agonistic behavior, atypical feminized males, aquaculture.
Comportamiento agonístico de machos feminizados atípicos en relación
a machos y hembras de tilapia del Nilo (Oreochromis niloticus L.)
RESUMEN. La madurez temprana durante el cultivo de tilapia es un problema recurrente. Para evitarlo, existe
una serie de técnicas, incluyendo la producción de machos-YY. Esta técnica implica el uso de hormonas para
producir hembras fenotípicas (genotipo XY). Sin embargo, son frecuentes transformaciones incompletas y los
machos feminizados atípicos (MFA) producidos podrían mostrar ambigüedad en la expresión fenotípica de los
patrones de comportamiento. El objetivo del presente trabajo fue determinar la frecuencia e intensidad del
comportamiento agresivo, así como el papel que juega la residencia inicial al involucrar tres fenotipos (machos,
hembras y MFA). El experimento abarcó tres etapas. En la primera etapa, MFA actuaron como residentes, en la
segunda machos, y en la tercera, hembras. En cada etapa el residente enfrentó a machos, hembras y MFA que
actuaron como intrusos. El comportamiento agresivo lo ejercieron con mayor frecuencia los peces residentes.
Las confrontaciones intersexuales mostraron mayores niveles de agresión en comparación con las intrasexuales.
La frecuencia de confrontaciones no fue significativamente diferente en confrontaciones que incluyeron MFA,
sin embargo, se observaron diferencias en la intensidad de la agresión. Es posible que una transformación
incompleta a nivel fisiológico pueda ser responsable de una decodificación incorrecta de señales durante las
confrontaciones.
Palabras clave: Oreochromis niloticus, comportamiento agonístico, machos feminizados atípicos, acuicultura.
In Mexico, tilapia represents 60% of the production of
farmed fish and is estimated to reach an annual
production of 200,000 ton by the year 2020
(Norzagaray et al., 2013). Tilapia culture, specially the
__________________
one of Nile tilapia (O. niloticus), offers many
advantages over other fish species. However, and
despite its relatively low fecundity (Phelps & Popma,
2000), the control of its early maturity is a recurring
problem. In mixed-sex cultures, Nile tilapia fish reach
2987
sexual maturity (30-50 g) long before commercial size
(350-400 g) (Jiménez & Arredondo, 2000; ArboledaObregón, 2005). To avoid this, a series of techniques
have been developed in recent years. One of the more
promising techniques involves the production of YYmales, which, when combined with normal females
(XX) produce progenies composed of 100% genetic
males. While the ultimate goal of YY-technology is to
reduce the use of hormones, the first step of this
technology still involves using hormones to feminize
normal male fry (XY). This produces a phenotypic
transformation, i.e. the morphology and function of
adult females from male fingerlings (Vera & Mair,
2000; Ovidio et al., 2002; Desprez et al., 2003).
During this process, it is common to observe the
presence of atypical fish, in this case atypical feminized
males (AFM), which are normally characterized by
having either abnormal genital papilla or male papilla
and with ovaries. AFM are usually discarded due to the
suspicion of not having a functional oviduct resulting
from a morphologically incomplete transformation.
Previous experiments performed in our laboratory have
shown that AFM selected were not only able to generate
a number of viable fry, but also a sex ratio that confirms
the presence of an XY genotype (Alcántar-Vázquez et
al., 2014). However, the number of spawns obtained
from crosses between AFM and normal males was
lower compared to those where normal females are
used and in some cases it was possible to observe
severely beaten AFM when they were placed in a
reproduction tank with one male of similar size,
suggesting some physiological disorder.
It is possible that in the AFM, an ambiguity in the
phenotypic expression provoked by the differences
between morphology and functionality of sexual
structures could have a profound behavioral effect, for
example in the aggression behavior, which is relevant
to fish populations in terms of social structure, levels of
stress and, consequently, in the overall performance of
fish farming (Øverli et al., 2002; Huntingford et al.,
2006; Boscolo et al., 2011). In the context of animal
behavior and particularly in what is known as fight
theory (Maynard-Smith, 1982; Riechert, 1998; Arnott
& Elwood, 2009; Mowles & Ord, 2012), the AFM
represents an interesting opportunity to observe how to
resolve conflicts against opponents with similar fight
capabilities (RHP) based in their phenotype (females)
but with probable differences arising from its genotype
(males).
During a conflict between fish of either the same sex
(intrasexual) or the opposite sex (intersexual), aggression
can be defined as a behavior directed to harm or
intimidate another individual. It is known that in
vertebrates the mechanism of hormonal regulation acts
on the central nervous system, closely interacting with
sex determination at the embryonic level (SalameMéndez, 1998) and with how aggression is expressed
between fish (Rosvall et al., 2012). The objective of this
work is to measure both the frequency of certain behavioral components used as indicators of confrontation
intensity as well as the role that initial residence
(dominance of a site) plays when involving the three
phenotypes usually present in a population of Nile
tilapia subjected to the sex reversal process.
Considering that the feminization process involves
morphological and functional (physiological) transformation from male to female, it is assumed that the
change extends to the behavioral level. Typically,
females are less aggressive than males, which are more
commonly involved in confrontational behavior related
to the dominance of a given site (Bradbury &
Vehrencamp, 1998). Considering a likely modified
physiological profile in sex-reversed fish in a context
of confrontation dyads, in this work we predict that
AFM will display behavior different from normal
females in both frequency and intensity of aggressive
behavior against normal male and female fish.
The experimental Nile tilapia fish (O. niloticus) fish
used in this study was males, females and atypical
feminized males (AFM) from the same batch. All were
produced using locally available strains (Centro
Acuícola de Temascal, Oaxaca and Sistema
Cooperativo Integral, Veracruz) in the experimental
aquaculture station from the Universidad del
Papaloapan (18°06′N, 95°53′W; at a height of 30 m
above sea level) and maintained in 3 m diameter
concrete tanks with recirculating fertilized water. AFM
were produced by feeding fry at swim-up stage with
120 mg of E2 kg-1 of powdered tilapia pellets for 30
days. Before starting the experiment, fish were reared
up to sexual maturity (six months of age) and fed with
a commercial diet according to their stage of
development. In total, 72 fish were used for this
experiment on confrontations.
The study was conducted in a recirculating water
system composed of 12-85 L acrylic aquaria. Water in
the recirculating system was filtered with a mechanical
filter (Hayward, Model S310T2, Hayward Pool
Products Inc., Elizabeth, NJ, USA) and a biofilter
containing only plastic Bio-Balls (Aquatic Eco-System,
Model CBB1, Pentair Ltd., Apopka, FL, USA) and then
passed through a UV lamp (Lumiaction, Model
BE1X20, Lumiaction Co. Ltd., Taipei, Taiwan). During
the period of treatment, a photoperiod of 12L:12D was
used and water temperatures were thermostatically
controlled and maintained at 28 ± 1ºC. All aquaria were
covered with non-reflective paper on three sides and
separated 2 cm from each other to prevent the fish could
see or interact with the fish from other aquaria.
The experiment consisted of three stages. Resident
fish were AFM in the first stage (designated AR), males
in the second (designated MR) and females in the third
(designated FR). In each stage the resident fish
confronted males, females and AFM all acting as
intruders. Each combination was carried out in
quadruplicate form and randomly assigned. A resident
was defined as the fish that occupied each aquarium in
the first instance. Before each stage, residents remained
in the aquaria for a period of seven to ten days for
acclimatization. During this period, fish were fed with
commercial diet at 25% protein two times a day. Each
intruder was previously weighed using a digital scale (±
0.01) (Scout Pro, Ohaus) to ensure that its size were as
similar as possible (± 20 g) to the size of the resident.
Additionally, considering that the ability to fight may
involve the length or weight of the contender, we
decided to use an index that considers both simultaneously, so standard and total length were obtained
using an ictiometer, in order to calculate the fish
condition factor (Froese, 2006).
Confrontations were recorded at different times of
day (except at night) for a full minute using a digital
camera (Sony Handycam DCR-DVD 610). Each
recording session consisted of the recording made at a
specific time of all combinations presented in the
aquaria. Each stage lasted for a period of 24-h,
consisting of a variable number of sessions (5 in AR, 6
on MR and 7 in FR). The first session of recording in
each stage lasted for 2 min with the objective to
measure the latency, that is, the elapsed time (in
seconds) from the moment the intruder was placed into
the aquaria until the first observed interaction between
resident and intruder. After completing each stage, the
fish were returned to 3 m diameter quarantine tanks for
recovery before being transferred along with the rest of
the population. Recordings were cataloged and sorted
to obtain the following behavioral patterns: number of
interactions in a minute of observation (in the first
session, data were taken during the second minute),
number of interactions for each fish (resident/intruder),
and intensity level of aggression (I to V scale, based to
the operational definitions of Evans et al. (2008), level
I: body facing the opponent and erect dorsal fin; level
II: fast and directed movement towards the opponent
without physical contact; level III: short and lateral
movements making contact with the mouth on the side
of the opponent; level IV: chasing the opponent; level
V: contact with both fish mouths, pushing the
opponent). Finally, the number of times that an
individual recoiled after the attack (called submission)
was included. These observations were performed for
each opponent (focal observations).
9883
Aggressive behavior was calculated by subtracting
the number of submissions from the number of
aggressions recorded for each fish. This value can be
positive (high aggressiveness), negative (high submission) or zero (aggressiveness-submission in equal
terms). Median, quartiles and extreme values were
calculated. Since in most fights, the majority of
confrontations occurred in the first observation session
(in the rest, the number of confrontations represent only
13%), data were pooled for each category of contenders
and compared as independent groups (different
aquaria) using a Wilcoxon or Kruskal Walllis test. We
calculated the proportion of each intensity level of
aggression with respect to the total number of
confrontations and then compared in terms of the
residence roles and sex categories. A chi-square test of
independence was applied in a contingency table to
measure the relative frequencies between level of
aggression and type of confrontation. The proportion
values obtained were arcsine transformed and then
analyzed using an ANOVA test for each type of
confrontation, using as classification variable the levels
of intensity of aggression (Zar, 1984). Condition factor
was calculated using basic Fulton’s equation (K = 100x
W/L3; see Froese, 2006), and length (L) and weight (W)
data. Comparisons between contenders were applied
using t Welch test. All tests were performed at 0.05
significant level.
All of our comparisons showed no significant
differences in terms of condition factor (t-Student
statistic, all P > 0.05) and time of latency between
categories of contenders (H = 7.19; DF = 8; P = 0.517).
However, time of latency showed a tendency to be
longer and more variable when resident females were
faced with female intruders.
Each resident fish showed an increase in aggressive
activity once a second fish, an intruder, was placed into
the aquarium. Aggressive behavior (in relation to
submissive behavior) was exercised more frequently by
resident fish (Fig. 1). Intrasexual confrontations (malemale and female-female) showed a lower median
number of attacks when compared to intersex confrontations (male-female), however, no significant
differences were detected (H = 2.81; df = 3; P = 0.422).
In confrontations where AFM were involved either as
residents or as intruders, the median number of attacks
was not significantly different (H = 4.05; df = 4; P =
0.399) to that observed in confrontations between
normal males and females. As with the number of
attacks, no significant differences (W = 11,153.5; P =
0.78) were observed in the frequency of attacks
between confrontations with or without AFM.
However, confrontations involving AFM displayed a
tendency toward a higher frequency of attacks.
In general, when comparing the role of residentintruder against the intensity of aggression in all com-
4989
Figure 1. Relative differences between aggression and retreats (submission), according the role of resident or intruder of
each contestant (mean: black box, median: horizontal line; quartiles: box, extreme values: asterisks) (P > 0.05). The top
panel refers to interactions with atypical feminized males (AFM). The bottom panel refers to inter and intrasexual
confrontations between normal males and females.
binations recorded, significant differences (chi-square
= 178.03; df = 24; P < 0.001) were observed in the
relative frequency of each intensity level of aggression
and the mean proportion of different aggression levels
(F values are showed in Fig. 2). Two levels of intensity
were in proportion more frequent: the less intense
aggression (level I) and one in which there was physical
contact with the mouth on the side of the opponent
(level III). Intrasexual confrontations showed almost no
increase in intensity of aggression, while intersexual
confrontation showed in each confrontation an increase
in intensity (level III). Meanwhile, in confrontations
that included AFM, it was observed that, as residents,
they showed a higher level of aggression (level III) only
toward other AFM. As intruders, AFM were attacked
with more intensity (level III) in almost all cases by
both males and females. In some confrontations, male
aggression toward AFM reached a level IV (Fig. 2).
There are few references to aggressive behavior of
sex-reversed fish, particularly males transformed into
females. According to our results, AFM behave like
normal females but with differences at inner aggressive
behavior, something knows as behavioral pattern
(Lehner, 1996). This is supported by the fact that AFM
were not shown to be more aggressive than normal
females or males with respect to frequency of
aggressive behavior but did prove to be so in terms of
intensity level. This result contrasts with that observed
by Ovidio et al. (2002), who reported that aggressive
behavior in feminized males was higher when
compared to that observed in normal females, a result
based only on the frequency of confrontations and not,
as was observed in our study, on the differential
occurrence of certain behavioral acts.
In our work, AFM had genital papilla which
retained mainly the male form with no obvious oviduct
but that could expel viable eggs after abdominal
massage. It is possible that this incomplete transformation at morphological level could be associated with
an incomplete transformation at the physiological level,
which in turn could be responsible for the altered
agonistic behavior observed in AFM (AlcántarVázquez et al., 2014).
According to Varadaraj (1989), partial transformations can occur, apparently caused by variations in
dose, and to a lesser degree, by duration of exposure to
the hormone. Therefore, partial transformation could
produce not only an incomplete sex-reversal from male
to female at physiological level but also an incomplete
transformation at tissue level, more specifically at
gonadal tissue, generating intersex individuals (with
both types of gonadal tissues at the same time).
Chemical signals translated to behaviors coming from
this intersex gonad could be mixed and ambiguous in
AFM.
There is evidence that aggressive behavior in mice
is the result of hormonal action rather than chromosomal differences between sexes (Canastar et al., 2008).
9905
Figure 2. Proportion of behavioral components (levels of aggression) for different contender’s combinations (role of
resident-intruder and sex categories). Mean median, quartiles, and extreme values are presented. Statistic values for ANOVA
tests among levels of aggression are presented for each type of confrontation. ♂ = male, ♀ = female, A = atypical feminized
males (AFM).
It is possible then to consider that in other vertebrate
groups such as fish something similar would occur and
the underlying differences between the experimental
groups analyzed would be related only to the effect of
the levels of sexual hormones. Therefore, it is possible
that the incomplete feminization reached at the
physiological level could be responsible for increasing
intensity of the aggressive behavior displayed by and
toward the AFM. This could provoke, as our data
suggests, that AFM behave similarly to females or
males depending on the sex of the resident with whom
they share the aquarium.
Although an incomplete feminization could be
responsible for the agonistic behavior observed in the
AFM, we cannot rule out the effect on hormonal
patterns and therefore on behavior of the interaction of
the three components that govern sex in the Nile tilapia:
a complex genetic sex determination system with a
major determinant locus, some minor genetic factors,
as well as the influence of temperature (Baroiller et al.,
2009). Baroiller & DĆotta (2001) mention that fish
have certain plasticity during sex differentiation since
several functional sex phenotypes can be generated by
diverse mechanisms, including sex-reversal. Therefore,
a sex-reversed fish, especially an atypical one, would
show altered hormonal patterns caused by the
combination of gene expression of sex genes of both
sexes, in this case, probably male sexual genes that
were not completely inactivated due to an incomplete
feminization at genetic level. These altered hormonal
patterns will finally be reflected in an altered behavior
of AFM (more aggressive in intensity) or in the sending
of mixed signals (combination of the expression of
genes of both sexes) that would cause further
aggression against them.
Aggressive behavior was issued by the resident
toward the intruding fish. In most cases the lower level
of aggression was the most frequent (dorsal erection).
Based in our results on time of latency, residents
probably did not make distinctions when evaluating (to
confront) different types of intruders. Therefore the
conflict, by the dominance, usually was resolved
quickly and with little effort made by the resident.
In our work, it was possible to observe that male and
female residents increased the intensity of confrontation only toward intruders of the opposite sex while
AFM acted similarly only against other AFM. In the
first case, it is probable that confrontations emerged
between sexes had an origin based on a conflict
associated with the reproductive process (Shuster &
Wade, 2003). In the second case, it is possible that the
aggression intensity rose due to the fact that they faced
fish whose responses to agonistic signals were
ambiguous. In consequence, fish that escalated con-
6991
frontation by showing more aggression, reiterated and
even magnified signals originally issued in low
aggression levels (Payne & Pagel, 1997). This
emphasizes why behavioral acts such as "persecution"
(level IV of aggression) have predominantly occurred
in cases of confrontation with AFM.
In this experiment, it was not the confrontation
frequency but rather the way each aggressive
confrontation was displayed (different proportion of
behavioral components) that determined the patterns of
aggressive behavior observed in males, females and
AFM. Our experiment suggests one of two possible
scenarios for the confrontation dynamics observed: in
the first scenario, the resident fish was required to
escalate to a higher level of aggression even if the
intruder decided not to repel the attack, probably
because the intruder showed signs (perhaps chemical)
received by the resident fish as a challenge to
dominance of the territory (aquarium). In the other
scenario, it is probable that resident fish fell into a
mechanized behavior (stereotypy) and exerted
unnecessary and unavoidable higher levels of
aggression. It is not clear why, in the case of O.
niloticus, a dominant fish can apply a level of
aggression that results in death of a subordinate fish.
Although some studies have insisted on the
artificiality that surrounds this kind of experimental
observations made in conditions of captivity,
particularly in the case of aggressive behavior as a
response variable (Sloman & Armstrong, 2002), our
experiment showed the relevance of the resident status
or intruder on the outcome of fights and that the AFM
analyzed possess a behavioral ambiguity, suggesting
that these fish probably display altered communication
codes that could exert some unbalanced influence in the
natural or artificial social environment of fishes.
Further investigation would be required to clarify and
explain this scenario.
ACKNOWLEDGEMENTS
The authors thank Nayeli Aguilar for video data register
and the Laboratorio de Acuicultura of the Universidad
del Papaloapan work group for their technical and
logistic support. This project has been supported by
PROMEP (Programa para el Mejoramiento del
Profesorado) de Mexico (Project; PROMEP/103.5/
11/6720). Special thanks to James Patrick Killough for
editorial improvements.
REFERENCES
Alcántar-Vázquez, J.P., R. Moreno-de la Torre, D.
Calzada-Ruíz & C. Antonio-Estrada. 2014. Production
of YY-male of Nile tilapia Oreochromis niloticus L.
from atypical fish. Lat. Am. J. Aquat. Res., 42(3): 644648.
Arboleda-Obregón, D.A. 2005. Reversión sexual de las
tilapias rojas (Oreochromis sp.), una guía básica para
el acuicultor. Rev. Electr. Vet., 6: 1-5.
Arnott, G. & R.W. Elwood. 2009. Assessment of fighting
ability in animal contests. Anim. Behav., 77: 9911004.
Baroiller, J.F. & H. D'Cotta. 2001. Environment and sex
determination in farmed fish. Comp. Biochem. Physiol.
C, 130: 399-409.
Baroiller, J.F., H. D ́Cotta, E. Bezault, S. Wessels & G.
Hoerstgen-Schwark. 2009. Tilapia sex determination:
where temperature and genetics meet. Comp. Biochem.
Physiol. A, 153: 30-38.
Boscolo, C.N.P., R.N. Norais & E. Gonçalves de Freitas.
2011. Same sized increase aggressive interaction of
sex reversed males Nile tilapia GIF strain. Appl. Anim.
Behav. Sci., 135: 154-159.
Bradbury, J.W. & S.L. Vehrencamp. 1998. Principles of
animal communication. Sinauer Associates, Sunderland,
882 pp.
Canastar, A., S.C. Maxson & C.E. Bishop. 2008.
Aggressive and mating behaviors in two types of sex
reversed mice: XY females and XX males. Arch. Sex
Behav., 37: 2-8.
Desprez, D., C. Melard, M.C. Hoareau, Y. Bellemene, P.
Bosc & J.F. Baroiller. 2003. Inheritance of sex in two
ZZ pseudofemale lines of tilapia Oreochromis aureus.
Evans, J.J., D.J. Pasnik, P. Horley, K. Kraeer & P.H.
Klesius. 2008. Aggression and mortality among Nile
tilapia (Oreochromis niloticus) maintained in the
laboratory at different densities. Res. J. Anim. Sci.,
2(2): 57-64.
Froese, R. 2006. Cube law, condition factor and weightlength relationships: history, meta, analysis and
recommendations. J. Appl. Ichthyol., 22: 241-253.
Huntingford, F.A., C. Adams, V.A. Braitewaite, S. Kadri,
P.T. Pottinger, P. Sandøe & J.F. Tournbull. 2006.
Current issues in fish welfare. J. Fish Biol., 68: 332372.
Jiménez, B.M.L. & F. Arredondo. 2000. Manual técnico
para la reversión sexual de la tilapia. Serie Desarrollos
Tecnológicos en Acuicultura, Universidad Autónoma
Metropolitana, Unidad Iztapalapa, 36 pp.
Lehner, N.P. 1996. Handbook of ethological methods.
Cambridge University Press, Cambridge, 672 pp.
Maynard-Smith, J. 1982. Evolution and the theory of
games. Cambridge University Press, New York, 234
pp.
Mowles, S.L. & T.J. Ord. 2012. Repetitive signals and
mate choice: insights from contest theory. Anim.
Behav., 84: 295-304.
Norzagaray, C.M., S.P. Muñoz, V.L. Sánchez, F.L.
Capurro & C.O. Llánes. 2013. Acuacultura: estado
actual y retos de la investigación en México. Rev.
Aquat., 38: 20-25.
Øverli, Ø., S. Kotzian & S. Winberg. 2002. Effects of
cortisol on aggression and locomotor activity in
rainbow trout. Horm. Behav., 42: 53-61.
Ovidio, M., D. Desprez, C. Mélard & P. Poncin. 2002.
Influence of sexual genotype on the behavior of
females (genotype WZ) and pseudofemales (genotype
ZZ) in the tilapia Oreochromis aureus. Aquat. Living
Resour., 15: 163-167.
Payne, R.J.H. & M. Pagel. 1997. Why do animals repeat
displays? Anim. Behav., 54: 109-119.
Phelps, R.P. & T.J. Popma. 2000. Sex reversal of tilapia.
In: B.A. Costa-Pierce & J.E. Rakocy (eds.). Tilapia
aquaculture in the Americas. The World Aquaculture
Society, Baton Rouge, 2: 34-59.
Riechert, S.E. 1998. Game theory and animal contests. In:
L.A. Dugatkin & H.K. Reeve (eds.). Game theory and
animal behavior. Oxford University Press, New York,
pp. 64-93.
Received: 14 June 2014; Accepted: 4 June 2015
9927
Rosvall, K.A., C.M. Bergeon-Burns, J. Barske, J.L.
Goodson, B. A. Schlinger, D.R. Sengelaub & E.D.
Ketterson. 2012. Neural sensitivity to sex steroids
predicts individual differences in aggression: implications for behavioral evolution. Proc. Roy. Soc. B,
279: 3547-3555.
Salame-Méndez, A. 1998. Influencia de la temperatura de
incubación en la determinación del sexo de quelonios.
Rev. Soc. Mex. Hist. Nat., 48: 125-136.
Shuster, S.M. & M.J. Wade. 2003. Mating systems and
strategies. Princeton University Press, New Jersey, 525
pp.
Sloman, K.A. & J.D. Armstrong. 2002. Physiological
effects of dominance hierarchies: laboratory artifacts
or natural phenomena? J. Fish Biol., 61: 1-23.
Varadaraj, K. 1989. Feminization of Oreochromis
mossambicus by the administration of diethylstilbestrol. Aquaculture, 80: 337-341.
Vera, C.E.M. & G.C. Mair. 2000. Optimization of
feminization of Oreochromis niloticus L. by oral
administration of diethylstilbestrol (DES): the effects
of stocking density, treatment duration and environment. Asian Fish. Sci., 13: 39-48.
Zar, J.H. 1984. Biostatistical analysis. Prentice Hall, New
Jersey, 718 pp.
Lat. Am. J. Aquat. Res., 43(5): 993-997, 2015
Chilean coastal underwater soundscape
993
Short Communication
Soundscape of a management and exploitation area
of benthic resources in central Chile
Alfredo Borie1, Natalia P.A. Bezerra2, Sebastian A.L. Klarian3 & Paulo Travassos1
1
Departamento de Pesca e Aquicultura, Universidade Federal Rural de Pernambuco
CEP 52.171-900, Recife, Brasil
2
Departamento de Oceanografia, Universidade Federal de Pernambuco
CEP 50670-901, Recife, Brasil
3
Centro de Investigaciones Marinas Quintay, Facultad de Ecología y Recursos Naturales
Universidad Andres Bello, Valparaíso, Chile
Corresponding author: Alfredo Borie-Mojica ([email protected])
ABSTRACT. Acoustic ecology is an emerging and poorly known field of research. Soundscape has been used
to infer the behavior of several species in different environments and can serve as a reliable indicator of the
habitat type and quality; also, it is believed that it is an important factor for larvae orientation in settlement areas.
We used the passive acoustic method to evaluate the soundscape of a management and exploitation area of
benthic resources, a rocky reef area in central Chile. It was possible to hear a continuous cracking sound during
recording and underwater observations. We detected two distinct frequency bands with similar parameters
during the night and day, a band between 90 and 300 Hz, which corresponded to the effects of sea waves
(geophony), and a frequency band with a range of 1,500 to 2,700 Hz (biophony), with a fundamental frequency
of 2,070 Hz. Both bands had similar energy (~88.0 dB re: 1V/µPa). These results show the relevant acoustic
activity in the area, which may have important ecological implications for the recruitment of commercially
important benthic resources.
Keywords: bioacoustics, acoustic ecology, coastal zone, biophony, geophony, central Chile.
Paisaje acústico de un área de manejo y explotación de recursos
bentónicos en Chile Central
RESUMEN. La ecología acústica es un campo de investigación emergente y poco conocido. El paisaje acústico
se ha utilizado para inferir el comportamiento de varias especies en diferentes ambientes y puede servir como
un indicador confiable del tipo y calidad de hábitat, además se considera un factor importante para la orientación
de larvas en zonas de asentamiento. Se utilizó el método acústico pasivo para evaluar el paisaje acústico de un
área de manejo y explotación de recursos bentónicos, en una zona de arrecife rocoso en el centro de Chile. Se
escuchó continuamente un crujido durante la grabación y se efectuaron observaciones submarinas. Se detectaron
dos bandas de frecuencia con parámetros similares durante día y noche, una banda entre 90 y 300 Hz, que
correspondía a los efectos de las olas del mar (geofónico), y una banda de frecuencia con rango de 1.500 a 2.700
Hz (biofónicos), con la frecuencia fundamental de 2.070 Hz. Ambas bandas tenían energía similar (~88,0 dB re:
1V/µPa). Estos resultados muestran la relevante actividad acústica de la zona, que puede tener importantes
implicancias ecológicas para el reclutamiento de recursos bentónicos de importancia comercial.
Palabras clave: bioacústica, ecología acústica, zona costera, biofonía, geofonía, Chile central.
The set of sounds for a given environment can be
considered as a soundscape and the use of such sounds
for ecological studies can be termed acoustic ecology,
an emerging field of ecological research (Pijanowski et
al., 2011a). Among the different perspectives with which
__________________
Corresponding editor: Diego Giberto
it is possible to explore, describe and manage the
ecological complexity of such environments, the
soundscape may be an excellent proxy for both shortand long-term scientific investigations (Farina &
Pieretti, 2012).
994
The subaquatic soundscape could be a composition
of several types of sound sources, including biophonics,
produced by aquatic mammals, fish and invertebrates
in a given environment, but also both anthrophonics
(i.e., vessels) and geophonics (i.e., sea waves)
(Pijanowski et al., 2011b).
Biological sounds have been used to infer the
behavior of several terrestrial and recently aquatic
species. This production of sounds has been demonstrated in different aquatic environments, such as, the
deep ocean (Wall et al., 2014), estuaries (Lillis et al.,
2014), coral reefs (Staaterman et al., 2013, 2014). In
addition, there are significant differences in the spectral
and temporal composition of ambient sound associated
with different coastal habitat types (Radford et al.,
2010).
The characterization of the soundscape could serve
as a reliable indicator of habitat type and potentially
transmit habitat quality information to disperse
organisms (Lillis et al., 2014). The soundscape can be
used by larvae of marine organisms to return to
settlement areas, in those species where settlement
occurs. Research has indicated that juvenile fish (Leis
& Lockett, 2005; Radford et al., 2011) and invertebrate
larvae (Vermeij et al., 2010; Stanley et al., 2012;
Eggleston et al., 2013; Lillis et al., 2013) use sound to
locate habitats.
The monitoring of changes in the environment and
its inhabitants is critical for management and a
considerable technological challenge in many marine
habitats. Monitoring tools, like passive acoustics, can
be an effective way to assess the biological activity in
places where continuous monitoring by traditional
research methods is not easy or possible.
We used passive acoustics to evaluate biophonic
and geophonic (sea wave effect) components of
soundscape in Quintay (33º11’31”S, 71º42’05”W), one
of the Management and Exploitation Areas of Benthic
Resources (MEABRs) existing in Chile. Quintay
MEABR is a typical rocky coastline of temperate
marine environment. The most economically important
benthic artisanal resources in this area are the muricid
snail (Concholepas concholepas), the red sea urchin
(Loxechinus albus) and keyhole limpets (Fissurella sp.)
(Fernandez et al., 2000).
For an initial approach of Quintay soundscape, we
first carried out free-diving observations for 1 h 20 min
(starting at 05:00 pm), that helped us to identify
representative fauna and potential sound sources in
February (summer).
In addition, we recorded sounds in natural and
captive environments using a hydrophone (H2a
Aquarian, sensibility of 180 dB re: 1V/µPa and range
of 10 Hz a 100 KHz) connected to a digital recorder
(Olympus Digital Voice Recorder VN-701PC). In
natural habitat, recordings were made during the night
(12:15 am) and day (01:15 pm) at low tide and waning
crescent moon, for 8 min and 44 sec each time, in
Quintay Bay.
Captive species of representative local benthic
fauna were recorded in different types of captive
systems (ponds, tank and aquaria) at night and day for
10 min in each system in the Quintay Center of Marine
Research (CIMARQ) installations. The captive species
included L. albus, Tegula atra, Fissurella sp. C.
concholepas, and also L. albus seeds with macroalgae,
the Chilean blue crab Homalaspis plana, and fishes
such as red cusk-eel (Genypterus chilensis), Chilean
Figure 1. Spectrogram of soundscape of a management and exploitation area of benthic resources in central Chile. a) 12:15
am, and b) 01:15 pm. Hanning 256 points with 50% overlap, 70% brightness and 90% contrast.
Figure 2. Soundscape power spectrum of a benthic
resource management and exploitation area in central
Chile. Red line: 12:15 am, and black line: 01:15 pm.
Hanning 256 points with 50% overlap, brightness 70%
and contrast 90%.
flounder (Paralichthys adspersus) and Paralabrax
humeralis.
Sounds were analyzed in the software Raven pro
v1.4, using acoustic parameters like energy (dB),
fundamental, minimum and maximum frequencies
(Hz), the analysis of the frequency bins of the acoustic
spectrogram can provide proxies for understanding and
interpreting acoustic patterns and processes in action
across a landscape (Farina & Pieretti, 2012).
Continuously audible biological cracking sounds
were heard during subaquatic observations. We
observed a characteristic benthic diversity in the zone,
including patches of macroalgae (Lessonia sp.),
echinoderms (L. albus, Tetrapygus niger, Meyenaster
995
gelatinosus, Heliaster helianthus), gastropods (Tegula
atra, Fissurella sp., C. concholepas), and crustaceans
(Rhynchocinetes typus, Taliepus dentatus) as expected
and observed by Fernandez et al. (2000).
The spectrogram and power spectrum analyses of
natural environment sounds showed two easily distinct
bands and peaks respectively, at low tide and waning
crescent moon during summer. A continuous band of
biophony of cracking sounds and periodic geophony of
waves (Fig. 1) were detected during recordings.
The cracking bands had similar acoustic parameters
to the natural environment during recordings at night
(12:15 am) and day (01:15 pm), low and high frequency
band between 1,500 and 2,700 Hz respectively, with a
fundamental frequency of 2,070 Hz and an energy
around 88.0 dB re: 1V/µPa (Figs. 1-2). Radford et al.
(2010) found two bands dominated by sea urchins with
a peak around 1,000 to 1,200 Hz, and snapping shrimp
with a broad peak at 5,000 Hz in New Zealand. A
distinct peak (2-4 kHz) was observed in habitat patches,
attributable to a snapping shrimp focused in these
frequency bands of inshore marine soundscapes
(McWilliam & Hawkins, 2013).
We found an absence of audible sound in all captive
species. This was unexpected; the acoustic signals may
be a significant component in the social behavior in
crustaceans (Boon et al., 2009; Buscaino et al., 2011).
The sea urchin Evechinus chloroticus in captivity can
produce sound with frequencies in the range of 800 to
2,800 Hz during feeding, and it was consistent with the
dominant component of the ambient chorus recorded
near a reef (in the range of 700 to 2,000 Hz) (Radford
Figure 3. a) Ocillogram and b) spectrogram of cracking train of a filtered section (1.0 and 5.5 kHz) recorded during the day
(01:15 pm). Hanning 256 points with 50% overlap, 70% brightness and 90% contrast.
996
et al., 2008). We found similar fundamental frequency
in an isolated cracking composed of a train of pulses,
with duration around 10 milliseconds and a variable
interval (Fig. 3). For this reason, we believe that
biological sounds in our study area were probably
produced by the rocky shrimp Rhynchocinetes typus
and sea urchin L. albus, even when we did not hear
them in captivity.
The sea wave effect did not have an influence due
to the very low frequency, in our case with a range
between 90 and 300 Hz (note the continuously wave
sound during the day, Fig. 1b) and the energy (dB)
similar to the cracking sounds (Fig. 2). Ambient levels
in frequencies affected by surf-generated noise (f <100
Hz) characterize the site as a high-energy end member
within the spectrum of shallow water coastal areas
influenced by breaking waves (Haxel et al., 2013). In
general, the rocky reef soundscape includes bands of
small waves, some fish and low frequency noise from
distant shipping and offshore storms in a 100 to 800 Hz
range (Radford et al., 2010).
Quintay soundscape could indicate that sounds can
be used for larval orientation of important economic
benthonic resources like C. concholepas and L. albus.
However, we still need to evaluate the possibility of
soundscape seasonality (including biophonic and
anthrophonic sounds) during future long-term monitoring and find out the potential biological sound
sources and larval orientation by sound in protected and
exploited marine areas.
REFERENCES
Boon, P.Y., D.C.J. Yeo & P.A. Todd. 2009. Sound production and reception in mangrove crabs Perisesarma
spp. (Brachyura: Sesarmidae). Aquat. Biol., 5: 107116.
Buscaino, G., F. Filiciotto, M. Gristina, A. Bellante, G.
Buffa, V. Di Stefano, V. Maccarrone, G. Tranchida, C.
Buscaino & S. Mazzola. 2011. Acoustic behaviour of
the European spiny lobster Palinurus elephas. Mar.
Ecol. Prog. Ser., 441: 177-184.
Eggleston, D., A. Lillis & D.R. Bohnenstiehl. 2013. Larval
settlement in response to estuarine soundscapes. J.
Acoust. Soc. Am., 134(5): 4148-4148.
Farina, A. & N. Pieretti. 2012. The soundscape ecology: a
new frontier of landscape research and its application
to islands and coastal systems. J. Mar. Isl. Cult., 1: 2126.
Fernandez, M., E. Jaramillo, P. Marquet, C. Moreno, S.
Navarrete, P. Ojeda, C. Valdvinos & J. Vasquez. 2000.
Diversity, dynamics and biogeography of Chilean
benthinc nearshore ecosytems: an overview and
gidelines for conservation. Rev. Chil. Hist. Nat., 73:
797-830.
Haxel, J.H., R.P. Dziak & H. Matsumoto. 2013.
Observations of shallow water marine ambient sound:
the low frequency underwater soundscape of the
central Oregon coast. J. Acoust. Soc. Am., 133(5):
2586-2596.
Leis, J.M. & M.M. Lockett. 2005. Localization of reef
sounds by settlement-stage larvae of coral-reef fishes
(Pomacentridae). Bull. Mar. Sci., 76: 715-724.
Lillis, A., D. Eggleston & D.R. Bohnenstiehl. 2013.
Oyster larvae settle in response to habitat-Associated
Underwater Sounds. PloS ONE, 8: e79337.
Lillis, A., D. Eggleston & D.R. Bohnenstiehl. 2014.
Estuarine soundscapes: distinct acoustic characteristics of oyster reefs compared to soft-bottom
habitats. Mar. Ecol. Prog. Ser., 505: 1-17.
McWilliam, J.N. & A.D. Hawkins. 2013. A comparison of
inshore marine soundscapes. J. Exp. Mar. Biol. Ecol.,
446: 166-176.
Pijanowski, B.C., A. Farina, S.H. Gage, S.L. Dumyahn &
B.L. Krause. 2011a. What is soundscape ecology? An
introduction and overview of an emerging new
science. Landscape Ecol., 26: 1213-1232.
Pijanowski, B.C., L.J. Villanueva-Rivera, S.L. Dumyahn,
A. Farina, B.L. Krause, B.M. Napoletano, S.H. Gage
& N. Pieretti. 2011b. Soundscape ecology: the science
of sound in the landscape. Bioscience, 61(3): 203-216.
Radford, C.A., A.G. Jeffs, C.T. Tindle & J.C. Montgomery. 2008. Resonating sea urchin skeletons create
coastal choruses. Mar. Ecol. Prog. Ser., 362: 37-43.
Radford, C.A., J.A. Stanley, S.D. Simpson & A.G. Jeffs.
2011. Juvenile coral reef fish use sound to locate
habitats. Coral Reefs, 30: 295-305.
Radford, C.A., J.A. Stanley, C.T. Tindle, J.C. Montgomery
& A.G. Jeffs. 2010. Localized coastal habitats have
distinct underwater sound signatures. Mar. Ecol. Prog.
Ser., 401: 21-29.
Staaterman, E., A.N. Rice, D.A. Mann & C.B. Paris. 2013.
Soundscapes from a Tropical Eastern Pacific reef and
a Caribbean Sea reef. Coral Reefs, 32: 553-557.
Staaterman, E., C.B. Paris, H.A. DeFerrari, D.A. Mann,
A.N. Rice & E.K. D’Alessandro. 2014. Celestial
patterns in marine soundscapes. Mar. Ecol. Prog. Ser.,
508: 17-32.
Stanley, J.A., C.A. Radford & A.G. Jeffs. 2012. Location,
location, location: finding a suitable home among the
noise. Proc. Biol. Sci., 279: 3622-3631.
Vermeij, M.J.A., K.L. Marhaver, C.M. Huijbers, I.
Nagelkerken & S.D. Simpson. 2010. Coral larvae
move toward Reef Sounds. PloS ONE, 5: e10660.
Wall, C.C., R.A. Rountree, C. Pomerleau & F. Juanes.
2014. An exploration for deep-sea fish sounds off
Vancouver Island from the Neptune Canada ocean
observing system. Deep-Sea Res, I, 83: 57-64.
997
Lat. Am. J. Aquat. Res., 43(5): 998-1010,
2015
SSR-based
genetic diversity and differentiation in Mytilus chilensis
9981
Short Communication
Heterologous microsatellite-based genetic diversity in blue mussel
(Mytilus chilensis) and differentiation among localities in southern Chile
María Angélica Larraín1, Nelson F. Díaz2, Carmen Lamas2, Carla Uribe2
Felipe Jilberto2 & Cristián Araneda2
1
Departamento de Ciencia de los Alimentos y Tecnología Química
Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile
Sergio Livingstone 1007 Independencia, Santiago, Chile
2
Departamento de Producción Animal, Facultad de Ciencias Agronómicas, Universidad de Chile
Corresponding author: María Angélica Larraín ([email protected])
ABSTRACT. Mussels (Mytilus spp.) are one of the most cultivated and commercialized bivalves in southern
Chile; culture is currently supplied almost entirely from wild-caught seed obtained from relatively few collection
centers. The genetic diversity and differentiation of the blue mussel in southern Chile was investigated by
sampling six locations: one natural bank and five seed collection centers. Nine polymorphic microsatellite (SSR)
loci were genotyped (Mgu1, Mgu3, MT203, MT282, Mg15, Mg56, Med737, MIT02 and MGE005). We found
75 different alleles, six of which were private alleles. Of the analyzed loci, 45 of 54 tests performed deviated
from Hardy-Weinberg equilibrium after sequential Bonferroni correction (P < 0.05), revealing significant
heterozygote deficiencies. The polymorphic information content (PIC) ranged from 0.322 (MGE005) to 0.893
(Mgu1). Despite the long distance between some sampling sites (up to 1360 km), genetic differentiation among
the sites was low (FST = 0.043, P < 0.0001). The Bayesian cluster analysis (STRUCTURE) indicated two
probable clusters, while the non-parametric cluster analysis (AWclust) identified two to four clusters. Both
analyses showed a high level of admixture within clusters. Our results indicate that blue mussels in southern
Chile show lower genetic diversity than in other countries, low inbreeding levels, and limited genetic
differentiation among locations.
Keywords: Mytilus, mussels, genetic diversity, genetic differentiation, microsatellites, southern Chile.
Diversidad genética del mejillón (Mytilus chilensis) y diferenciación entre localidades
del sur de Chile usando marcadores microsatélites heterólogos
RESUMEN. Los mejillones (Mytilus spp.) constituyen unos de los bivalvos más cultivados y comercializados
en el sur de Chile. Su cultivo está actualmente abastecido completamente con semillas obtenidas desde el medio
natural, de relativamente pocos centros de captación. La diversidad y diferenciación genética de los mejillones
en el sur de Chile fue investigada muestreando seis lugares, un banco natural y cinco centros de captación de
semilla. Se genotiparon nueve loci microsatélite (SSR) polimórficos (Mgu1, Mgu3, MT203, MT282, Mg15,
Mg56, Med737, MIT02 y MGE005). Se encontraron 75 alelos diferentes, seis de ellos fueron alelos privados.
En los loci analizados, 45 de los 54 test realizados mostraron desviación significativa (P < 0,05) del equilibrio
de Hardy-Weinberg después de la corrección secuencial de Bonferroni, revelando un significativo déficit de
heterocigotos. El contenido de información polimórfica (PIC) varió entre 0,322 (MGE005) y 0,893 (Mgu1). A
pesar de la gran distancia entre algunos sitios de muestreo (hasta 1.360 km), la diferenciación genética entre
ellos fue baja (FST = 0,043; P = 0,00). El análisis Bayesiano de agrupamiento (STRUCTURE) indicó que la
estructura poblacional más probable consiste en dos grupos, en tanto el análisis de agrupamiento no paramétrico
(AWclust) identificó entre dos y cuatro grupos, ambos análisis mostraron un alto nivel de mezcla dentro de los
grupos. Estos resultados indican que los mejillones del sur presentan menor diversidad genética que en otros
países, baja endogamia y diferenciación genética entre localidades.
Palabras clave: Mytilus, mejillones, diversidad genética, diferenciación genética, microsatélites, sur de Chile.
__________________
Corresponding editor: Cristian Aldea
2
999
Mussels from the genus Mytilus, widely used for human
consumption, are among the most cultivated and
marketed bivalves. Chilean mussel culture yielded
10.8% of the world's Mytilidae production in 2012
(FAO, 2015). The distribution range for this species
extends along the Chilean coast from Arauco (35ºS) to
Cape Horn (55ºS) (Hernández & González, 1976), but
nearly 100% of production comes from Chiloé Island
and the mainland in the 41-44ºS region (SERNAPESCA, 2015).
The name Mytilus chilensis (Hupé, 1854) was
initially given to the native Chilean blue mussel, but the
names M. edulis chilensis (Toro, 1998) and M.
galloprovincialis chilensis (Cárcamo et al., 2005) were
later proposed. Also, the species M. galloprovincialis
described in the coasts of Chile was found to be distinct
from the endemic Mytilus according to various
molecular evidence (Tarifeño et al., 2005; Toro et al.,
2005; Astorga & Toro, 2010), other authors (Westfall
& Gardner, 2010) reported that the blue mussel now
found in Chile is a mix of native Southern-hemisphere
and introduced Northern-hemisphere M. galloprovincialis and M. edulis and their respective hybrids.
Borsa et al. (2012) proposed the taxonomic status M.
galloprovincialis planulatus and M. edulis platensis for
these species, respectively. Since 2013, the WoRMS no
longer recognizes the name Mytilus chilensis Hupé,
1854 (Boxshall et al., 2014) for the native Chilean
smooth-shelled mussel, replacing it with the name
Mytilus edulis platensis d'Orbigny, 1842 (Borsa et al.,
2012). However, the name Mytilus chilensis is still used
commercially, in statistics, in certifications, and on
food product labels (GAA, 2013; FAO, 2015), and also
by authors (Gazeau et al., 2013; Riisgard et al., 2013;
Astorga, 2014; Larraín et al., 2014; Oyarzún et al.,
2014; Ouagajjou & Presa, 2015). Moreover, there is
evidence suggesting that M. chilensis is a valid, distinct
species within the genus based on the strong genetic
and reproductive differences versus the native Chilean
mussel, M. galloprovincialis (Mediterranean and
Atlantic populations) and M. edulis found when these
taxa were evaluated with a 54-SNP panel developed by
Zbawicka et al. (2014) as marker for Mytilus taxa (R.
Wenne pers. comm.), with microsatellite markers
(Ouagajjou et al., 2011), mitochondrial cytochrome
oxidase I gene (COI) (Seguel, 2011), and sperm
morphology (Oyarzún et al., 2014). Therefore, we use
the name M. chilensis for the native and predominant
blue mussel species that inhabits the Chilean coast.
The long larval phase of the Mytilus lifecycle
extends its dispersal capacity to large geographic areas,
increasing gene flow, preventing differentiation among
populations, and preserving high levels of diversity
within populations (Toro et al., 2006). Currently,
aquaculture farms are supplied solely with seed
collected from the wild in the area of the Reloncaví
estuary and Chiloé Island (Bagnara & Maltraín, 2008).
In 2012-2013 a significant decrease in seed supply from
the collection centers was reported for the zone.
Understanding the genetic diversity and differentiation of economically-important species is fundamental for supporting management and conservation
programs, enhancing production, and exploring the
possibility of developing DNA-based traceability
systems using allocation algorithms. In Chile, studies
of Mytilus genetic diversity and differentiation have
been performed using RAPDs and allozyme markers
(Toro et al., 2004, 2006), producing no evidence of
discrete stocks, with the possible exception of a
Magallanes population (Punta Arenas 53ºS). Microsatellite markers are an important tool used to assess
genetic diversity levels and population structures in
marine species (Liu & Cordes, 2004); these markers
have been applied to the Mytilidae family for species
such as Perumytilus purpuratus (Perez et al., 2008;
Briones et al., 2013), M. galloprovincialis (Diz &
Presa, 2008, 2009), M. edulis, and M. trossulus
(Kijewski et al., 2009; Shields et al., 2010). In Chilean
blue mussels, SSR have been used by Vidal et al.
(2009) and Ouagajiou et al. (2011) in cross-species
amplification and allelic variation assessment, respectively, on a limited number of individuals from a single
location, but to date there are no published studies of
genetic diversity or differentiation among locations
using this tool.
The current study aims to investigate the genetic
diversity and differentiation of Mytilus chilensis in
southern Chile using nine heterologous SSR loci. This
survey complements previous population studies
conducted in the region based on allozyme and RAPDs
analysis, with more informative SSR markers.
Mussel samples (n = 50 by location) were collected
in southern Chile from three zones: 1) Reloncaví
(Quillaipe: 1-QI, Pichicolo: 1-PI, Caleta La Arena: 1LA, and Canutillar: 1-CN), 2) Chiloé (Canal ColditaPiedra Blanca: 2-CB), and 3) Magallanes (Isla Peel: 3IP). In zones 1 and 2, where mussel aquaculture
activities are carried out, we sampled seed collection
centers, and in zone 3, the source was a natural bank.
Detailed information about sampling, DNA extraction,
genus, and species identification can be found in
Larraín et al., (2012, 2014). Only M. chilensis
individuals, identified according to designation at the
RFLP-PCR Me 15-16 Aci I marker (Inoue et al., 1995;
Santaclara et al., 2006), were used for microsatellite
analysis. Nine SSR loci were genotyped. The repeat
motifs obtained from GenBank sequences by accession
number were: mononucleotide (Mg15) (Cruz et al.,
SSR-based genetic diversity and differentiation in Mytilus chilensis
2005), perfect dinucleotide (Mgu3, MT203, MT282,
MIT02, MGE005) (Presa et al., 2002; Gardeström et al.,
2007; Yu & Li, 2007; Vidal et al., 2009), compound
dinucleotide (Mgu1, Med737) (Presa et al., 2002;
Lallias et al., 2009), and complex (Mg56) (Cruz et al.,
2005). Detailed information about primers and PCR
conditions used to amplify eight of the motifs (Mgu1,
Mgu3, MT203, MT282, Mg15, Mg56, Med737 and
MIT02) are described in Larraín et al. (2014). The other
locus used in this work was MGE005 (Yu & Li, 2007).
For this last locus, primers (F: 5´-AGACCAAGGTA
TTGCAACCATGTG-3 and R: 5´-TCGAAAGCATG
GTACCTGGTCA-3´) were obtained using AmplifX
(http://crn2m.univ-mrs.fr/recherche/brue/jullien(http://crn2m.univ-mrs.fr/recherche/brue/jullien-nicolas/
programmation/amplifx) and the Primer Blast NCBI
utility (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/).
The primers were commercially synthesized by
Integrated DNA technologies Inc. (IDT) (Singapore).
The PCR thermal profile to amplify the MGE005 locus
was 95°C for 5 min, followed by 35 cycles at 95°C (1
min), 67ºC (30 s), 72°C (50 s), and a final 10-min
extension step at 72°C. PCR amplification was carried
out in a 15-µL reaction mixture containing 1.5 L of
10x PCR buffer, 1.5 mM MgCl2, 100 M each of
dNTP, 0.3 M of each primer, 0.5 U Taq DNA
Polymerase (RBC Bioscience®), and 40 ng of DNA. A
negative control with template DNA replaced by water
was performed for each set of amplifications. To
evaluate amplification, PCR products were visualized
on an agarose gel (1.8%) in TBE buffer with 10 mg mL-1
of ethidium bromide under ultraviolet light. For
genotyping, polyacrylamide gels (6%) with silver
staining were used to resolve alleles (Larraín, 2012); for
every gel, the size of amplified fragments was
estimated from a 10-bp DNA ladder (Invitrogen®) or
HyperLadder V (Bioline®).
The Excel add-in MS tools (Park, 2001) and
CONVERT software (Glaubitz, 2004) were used to
reformat diploid genotypic data. MICRO-CHECKER
(Van Oosterhout et al., 2004) was used to test for the
presence of null alleles, stuttering, and large allele
dropout. Genetic diversity was determined by the
observed number of alleles per locus (Na), observed
(Ho) and expected (He) heterozygosities, polymorphic
information content (PIC), and the presence of private
alleles, using MS tools (Park, 2001). Genepop 4.0.10
(Raymond & Rousset, 1995; Rousset, 2008) was used
to test genotypic linkage disequilibria (LD) between
each pair of loci, to evaluate genotypic distributions for
conformation to Hardy-Weinberg equilibrium (HWE),
and to estimate Wright's fixation indices (FIS, FST, and
FIT) according to Weir & Cockerham (1984). Exact Pvalues were estimated by the Markov chain method
(Guo & Thompson, 1992), using default software
conditions. Sequential Bonferroni correction was used
3
1000
for multiple tests (Holm, 1979; Rice, 1989). The
relatedness index rxy (Queller & Goodnight, 1989) for
each pair of individuals was obtained using Identix
software (Belkhir et al., 2002). Genetic differentiation
among locations was determined with Genetix 4.05
(Belkhir et al., 1996) to estimate pairwise FST and its
statistical significance and to perform a three-dimensional
factorial correspondence analysis (3D-FCA). The
Mantel test (Mantel, 1967) was performed to test an
isolation-by-distance model of genetic differentiation.
Correlation coefficient (r) calculations were performed
with Genetix 4.05, and the significance of the
associations was tested with 10,000 iterations. We
compared the genetic distance matrices (FST / (1-FST))
with the logarithm of the minimal geographic distance
estimated by the coastline (Abbott et al., 2013), as
recommended for a two-dimensional habitat (latitude
and longitude) (Rousset, 2008). The genetic structure
was investigated with parametric-with -STRUCTURE
2.3.4 (Pritchard et al., 2000)- and non-parametric AWclust (Gao & Stramer, 2008)- frameworks. The
Bayesian approach (STRUCTURE) was performed
using the standard burn-in period length (50,000) and
number of MCMC reps after burn-in (100,000) (Falush
et al., 2007), achieving convergence with our data. Ten
repeated runs were performed, selecting K = 6, the
admixture ancestry, and the correlated allele frequency
models. The number of clusters (K) that best fit the data
was inferred using Delta K values as described by
Evanno et al. (2005) and calculated using the
STRUCTURE Harvester webpage (Earl & von Holdt,
2012). The R package AWclust -allele sharing distance
and Ward's minimum variance hierarchical clustering(Gao & Starmer, 2008) was used, converting the
multiallelic SSR data according to Wei et al. ( 2013).
Null alleles were present in all locations for loci
Mgu1, Mgu3, MT203, Mg15, Mg56, and MIT02 and in
some locations for loci MT282 and Med737 but not
detected in any location for locus MGE005. The
frequency of non-amplifying individuals (putative null
allele homozygotes) was less than 5% for all loci, and
thus all were used in further analysis (Dąbrowski et al.,
2014).
All loci showed common allele distributions among
sites. Six private alleles, i.e., alleles unique to a single
site, were found at low frequency (0.01-0.02) in the
seed collection centers Pichicolo (1-PI) and Caleta La
Arena (1-LA) at locus Mgu3, Canal Coldita-Piedra
Blanca (2-CB) at locus Mg56, Quillaipe (1-QI) at locus
Med737, and Quillaipe (1-QI) and Canutillar (1-CN) at
locus MGE005 (Annex 1). A total of 75 alleles were
detected at the nine loci among the analyzed individuals
(Table 1). All loci were polymorphic in all locations
as the frequency of the most common allele did not
41001
Table 1. Global genetic diversity estimators by locus in samples (n = 300) of blue mussel (Mytilus chilensis) in southern
Chile using nine SSR loci. Na: number of alleles, Ho: the observed heterozygosity, He: the expected heterozygosity, PIC:
polymorphic information content and the fixation indices FIS, FST, FIT, according to Weir & Cockerham (1984).
Locus
Mgu1
Mgu3
MT203
MT282
Mg15
Mg56
Med737
MIT02
MGE005
Global
Na
15
6
10
4
4
11
10
5
10
75
Ho
0.407
0.097
0.453
0.543
0.416
0.470
0.483
0.365
0.320
0.395
He
0.903
0.610
0.782
0.616
0.694
0.760
0.756
0.617
0.330
0.674
exceed 0.95; average number of alleles per locus was
8.3 ± 3.8, ranging from four for MT282 and Mg15 in all
locations to 15 for Mgu1 in Quillaipe (1-QI) and
Pichicolo (1-PI) (Annex 2). PIC values ranged from
0.322 at locus MGE005 to 0.893 at locus Mgu1 (Table
1). With the exception of locus MGE005, which was
moderately informative, all other loci were highly
informative (PIC > 0.5) (He et al., 2012). Ho ranged
from 0.097 (Mgu3) to 0.543 (MT282), while He values
ranged from 0.330 (MGE005) to 0.903 (Mgu1) (Table
1). Significant deviations from HWE were observed in
45 of the 54 tests (9 loci × 6 locations), performed after
correction for multiple testing (Holm, 1979; Rice,
1989). Significant deviations corresponded to positive
FIS values observed in various loci, indicating heterozygote deficiencies. Tests for linkage disequilibrium
(LD) showed no significant deviations for any of the
216 tests performed (36 locus combinations × 6
locations) after sequential Bonferroni correction for
multiple tests (Holm, 1979; Rice, 1989).
Although average relatedness (rxy) between pairs of
individuals from the same site was significantly higher
than between pairs of randomly-mixed individuals
from different locations, at -0.019 ± 0.0013 and -0.137
± 0.0009, respectively (P < 0.0001), neither value was
significantly different from zero.
Pairwise FST values among all six locations indicate
(Table 2) that the highest FST (0.1112) value was
between Canal Coldita-Piedra Blanca (2-CB) and
Caleta La Arena (1-LA). Fourteen of the 15 tests (P <
0.05) showed significant pairwise FST values after
correction for multiple comparisons (Holm, 1979; Rice,
1989). The global FST value indicates that 4.3% of the
total allele frequency variance lies among sample sites
and is highly significant (P < 0.0001), while 95.7% is
explained by the variation within sites. The first three
PIC
0.893
0.540
0.757
0.543
0.630
0.725
0.721
0.544
0.322
0.631
FIS
0.542
0.802
0.413
0.111
0.395
0.369
0.319
0.411
0.032
0.393
FST
0.021
0.227
0.015
0.010
0.012
0.026
0.073
0.000
0.000
0.043
FIT
0.551
0.847
0.422
0.119
0.403
0.385
0.369
0.409
0.031
0.419
components of the 3D-FCA (Fig. 1) account for
81.78% of the total variation in multilocus genotypes,
43.38% of which is explained by Axis 1, which
separates Caleta La Arena (1-LA) from the other five
sites, 22.18% by Axis 2, which separates Quillaipe (1QI) and Canal Coldita-Piedra Blanca (2-CB) from the
other sites, and 16.22% by Axis 3, which separates the
most southern sample (3-IP). The Mantel test showed
no significant correlation (r = -0.0130, P = 0.3610)
between genetic and geographic distance.
Bayesian clustering analysis indicated that K = 2
(Fig. 2a) is the most likely value for inferred Mytilus
chilensis clusters in the zone. The analysis showed that
individuals from 1-LA were grouped together in cluster
II and 2-CB in cluster I, with high average proportions
of membership at 0.966 and 0.824, respectively (Table
3a), coinciding with the separation of these sites as
shown by 3D-FCA. All other sites appeared to be
highly admixed with individuals sharing membership
between both clusters. The gap analysis from AWclust
showed 3 clusters, by a narrow margin with widely
overlapping error bars for K = 2 and 4 (Fig. 2b). As in
the STRUCTURE analysis, a large proportion (0.72) of
1-LA individuals were grouped into a single cluster
(cluster III) (Table 3b).
Microsatellites are one of the most informative
genetic markers at the intra-specific level, used extensively to study marine species. However, in Mytilus, a
relatively low number of SSR markers have been
described compared with other aquaculture species
such as salmon or trout, which have more than 2000
mapped SSR markers (Guyomard et al., 2012).
Genetic diversity is essential because it allows for
population and species survival and adaptation to
changing environmental conditions (Mohanty et al.,
2014). The total of 75 alleles detected after genotyping
10025
Table 2. Pairwise FST values between the blue mussel’s (Mytilus chilensis) locations in southern Chile. Zone and location
codes: 1) Reloncaví (Quillapie: 1-QI, Pichicolo: 1-PI, Caleta La Arena: 1-LA and Canutillar: 1-CN), 2) Chiloé (Canal
Coldita-Piedra Blanca: 2-CB), and 3) Magallanes (Isla Peel: 3-IP). *P < 0.05 after correction with sequential Bonferroni
correction.
1-QI
1-PI
1-LA
1-CN
2-CB
1-PI
0.0191*
1-LA 1-CN
0.0390* 0.0305*
0.0650* 0.0049
0.0712*
2-CB
0.0787*
0.0255*
0.1112*
0.0196*
3-IP
0.0323*
0.0146*
0.0740*
0.0245*
0.0250*
Figure 1. Three-dimensional factorial correspondence analysis plot (3D-FCA) for the six blue mussel (Mytilus chilensis)
populations in southern Chile. Sample codes are indicated in Table 2.
all nine SSR loci across the six sampling locations
suggests lower genetic diversity than in other SSR
studies of Mytilus (Diz & Presa, 2009; Shields et al.,
2010). This is also evident from the global levels of
observed and expected heterozygosities (Ho: 0.395 and
He: 0.674) (Table 1). For example, in locus Mgu3,
twelve alleles were found in Spain (Diz & Presa, 2009)
and in a hybrid zone in Canada (Shields et al., 2010),
while in this study we found only six alleles.
The genetic diversity range (0.330  He  0.903) in
Mytilus chilensis from the zone studied was wider than
observed in M. galloprovincialis from Galicia, Spain
(0.72  He  0.80) as assessed with six SSR loci (Diz
& Presa, 2008). But the observed heterozygosity in this
study exceeds that reported for allozymes in the same
species and area (Ho = 0.29) (Toro et al., 2006), as
expected due to the highly polymorphic nature of SSR.
Deviations from HWE as shown by positive FIS
values observed at several loci, at many sites, revealed
heterozygote deficiencies. Toro et al. (2006) also
reported widespread heterozygote deficiencies in
population STRUCTURE studies in the same species
and area using allozymes. Null alleles cause
heterozygous individuals to appear homozygous if they
carry a visible allele and the null allele (Brookfield,
1996). This is the best-known reason for underestimation of heterozygosity with microsatellites (Shields
et al., 2010) and a common phenomenon in marine
bivalve population genetics (Chapuis & Estoup, 2007).
Although we used only loci with <5% of nonamplifying individuals (putative null allele
homozygotes) (Dąbrowski et al., 2014), null alleles
could be a reason for the heterozygote deficiencies
observed.
The heterologous nature of the microsatellites used
in this study -SSR developed for M. edulis, M. trossulus,
and M. galloprovincialis were applied to Chilean blue
mussels- could explain the presence of null alleles.
Using the SSR developed in M. chilensis, not available
61003
Figure 2. Number of clusters identified by a) Parametric
approach implemented in STRUCTURE. Plot of the Delta
K calculated as ∆𝐾 =
𝑚𝑒𝑎𝑛 ǀ𝐿´´(𝐾)ǀ
.
𝑠𝑑 [𝐿(𝐾)]
The modal value of
this distribution is the true K or the uppermost level of
structure, b) non-parametric approach implemented in
AWclust. Plot of the gap statistics between the observed
and expected Wk results for K = 1-6 in M. chilensis. The
largest gap indicates the most appropriate number of
clusters for the data.
until after the completion of this experimental work,
may have reduced the frequency of null alleles found
(Ouagajjou et al., 2011). However, these species are
genetically and phenotypically close in both hemispheres, as evidenced by the controversy over the
taxonomic status of the Chilean blue mussel and the
widely-described presence of null alleles in Mytilus
SSR (Presa et al., 2002; Gardeström et al., 2007; Yu &
Li, 2007; Shields et al., 2010; Ouagajjou et al., 2011).
Also, in other studies in the literature, correcting allele
frequencies for null alleles between Mytilus populations did not change the results of statistical tests to
estimate population differentiation (Gardeström et al.,
2007; Diz & Presa, 2008) or had a only minor effect on
the population differentiation estimates, genetic distance
determinations, and allocation of individuals to
populations (Hauser et al., 2006; Chapuis & Estoup,
2007). Given the above, along with the consideration
that null alleles may not be the only reason for the
observed heterozygote deficiencies, we decided not to
correct the allele frequencies. Other possible reasons
for heterozygote deficiencies found in Mytilus population studies are, among others, inbreeding, aneuploidy,
molecular imprinting, and selection (Beaumont, 1991;
Toro et al., 2006; Diz & Presa, 2009). Although the
relatedness between pairs of individuals from the same
site was significantly higher than between individuals
from different sites, in both cases relatedness was no
higher than expected by chance (data not shown),
providing no evidence of mating between related
individuals (inbreeding).
The results of the microsatellite analyses revealed a
common distribution of alleles between blue mussel
locations in southern Chile. The global FST (0.040)
obtained in this survey was low but significant, and it is
within the range reported by Toro et al. (2004) using
allozymes (FST = 0.03), although it is higher than the
value reported by Cárcamo et al. (2005), also using
allozymes (FST = 0.012), and those found in mussel
populations on the Iberian Peninsula (FST = 0.0240 and
0.0122) using microsatellites. However, a greater
differentiation between localities cannot be discounted
due to cryptic allelic homoplasy described for SSR
markers (Diz & Presa, 2008, 2009).
Although individuals taken from seed collection
centers in zones 1 and 2 are intended for transport to
grow-out centers and never will spawn in the place
where they were recruited, they account for the
composition of the fixed individuals in each location
and may be informative regarding the location's genetic
diversity and differentiation. Despite the geographical
barriers of the coastline (fjords) and the considerable
geographical distance between the most southern
sample from Isla Peel (3-IP) in zone 3 and the
Reloncaví and the Chiloé zones (zones 1 and 2
respectively), the mussel's reproductive system (external fertilization), the prolonged pelagic larval stage of
this species (40-45 days) (Toro et al., 2004), the intense
aquaculture activities in the Reloncaví and Chiloé
zones (transportation of juveniles from seed collection
centers to ongrowing centers), and the ocean currents
(Cape Horn and Chilean Coastal Current) (Strub et al.,
1998) promote dispersal, preventing higher levels of
genetic differentiation.
Furthermore, in studies of other bivalves in the area
with lower production levels than Mytilus chilensis,
such as the clam (Venus antiqua) and the ribbed mussel
(Aulacomya atra) (Mena et al., 2001), higher genetic
differentiation values were found using allozymes (FST
= 0.107 and 0.147, respectively). This finding led us to
infer that some of the genetic homogeneity between
locations in the current study could be attributed to the
10047
Table 3. Number of blue mussel (Mytilus chilensis) individuals in each location (n) and proportion of membership of
individuals from each location to each of: a) the two clusters inferred by STRUCTURE, and b) the three clusters inferred
by AWclust. Sample codes are indicated in Table 2.
a
Locations
1-QI
1-PI
1-LA
1-CN
2-CB
3-IP
STRUCTURE-inferred
clusters
n
I
II
50 0.391
0.609
50 0.623
0.377
50 0.034
0.966
50 0.731
0.269
50 0.824
0.176
50 0.634
0.366
effect of extensive seed transfer, as reported in Galicia
(Diz & Presa, 2009). The extent of pairwise genetic
differentiation among the six sampled locations was
small, but pairwise FST showed significant allelic
differentiation, revealing unpatterned genetic heterogeneity among the local population, or genetic
patchiness. This effect results in geographically close
populations that may differ genetically as much as very
distant populations, as has been reported in other
marine organisms (Larson & Julian, 1999; Appleyard
et al., 2002).
The numbers of clusters inferred from the
parametric (K = 2) and non-parametric methods (K = 3)
were different; however, they were not in conflict
because the gap statistic to determine the discrete
number of clusters in AWclust gave widely overlapping
error bars for K = 2, 3, and 4, providing a better
resolution of the population structure (Fig. 2b). The
parametric clustering approach in STRUCTURE
provided more information (i.e., about the probability
an individual's membership in each cluster), but it relies
on assumptions like HWE that were not always met
during this study. Therefore, the non-parametric
method for population structure analysis is more
appropriate. According to Gao & Starmer (2008), the
two methods can be complementary in structure
analysis.
Our results for blue mussels using nine
microsatellite loci indicate low inbreeding levels and
lower levels of genetic diversity in Chile than in Spain
or Canada; this latter is recognized as a hybrid zone, so
higher levels of allelic richness and heterozygosity are
expected. Furthermore, we found low but significant
genetic differentiation among locations in southern
Chile. These findings may be partly explained by
reproduction conditions, prolonged pelagic larval
stage, oceanographic conditions, and intense Chilean
blue mussel aquaculture in the region.
b
AWclust-inferred clusters
Locations
1-QI
1-PI
1-LA
1-CN
2-CB
3-IP
n
50
50
50
50
50
50
I
0.26
0.42
0.08
0.32
0.48
0.26
II
0.16
0.24
0.20
0.46
0.36
0.36
III
0.58
0.34
0.72
0.22
0.16
0.38
ACKNOWLEDGEMENTS
This research was supported by CONICYT,
FONDECYT/Regular N°1130302, and Universidad de
Chile (Vice-Rectoría de Investigación-Proyecto Domeyko-Alimentos). The authors thank Dr. Carlos
Varela (Universidad de Los Lagos), for contacts with
the shellfish cultivation industry; Eugenio Yokota and
Julio Bañados from Granja Marina Chauquear, Marcela
Cárcamo from Cultivos Quillaipe, and Armando
Salinas from Aguas del Sur S.A., who kindly allowed
us to perform the sampling at their farms; José
Villarroel, for collecting the wild population sample;
Dr. Elie Poulin (Universidad de Chile, Facultad de
Ciencias),
for
access
to
the
NanoDrop
spectrophotometer; Andrea Bravo, for helping with
DNA extraction; and Dr. Juhani Pirhonen, for critical
review of this manuscript.
REFERENCES
Abbott, R., D. Albach, S. Ansell, J.W. Arntzen, S.J.E.
Baird, N. Bierne et al., 2013. Hybridization and
speciation. J. Evol. Biol., 26(2): 229-246.
Appleyard, S.A., R.D. Ward & R. Williams. 2002.
Population structure of the Patagonian toothfish
around Heard, McDonald and Macquarie Islands.
Antarct. Sci., 14(04): 364-373.
Astorga, M.P. 2014. Genetic considerations for mollusc
production in Aquaculture: current state of
knowledge. Front. Genet., 5: 1-6.
Astorga, M.P. & J. Toro. 2010. Genetic differentiation in
Mytilus (Mollusca: Bivalvia) in the Chilean coast. XIV
Congreso Latinoamericano de Genética-ALAG.
Sociedad Chilena de Genética- SOCHIGEN. Viña del
Mar, 723: 419 pp.
Bagnara, M. & G. Maltraín. 2008. Descripción del sector
mitilicultor en la Región de Los Lagos, Chile:
81005
evolución y proyecciones. In: A. Lovatelli (ed.).
Estado actual del cultivo y manejo de moluscos
bivalvos y su proyección futura: factores que afectan
su sustentabilidad en América Latina. Actas de pesca y
acuicultura. Taller Técnico-Regional de la FAO, 20-24
de Agosto de 2007. Puerto Montt, Chile, 12: 189-198.
Beaumont, A.R. 1991. Genetic studies of laboratory
reared mussels, Mytilus edulis: heterozygote
deficiencies, heterozygosity and growth. Biol. J. Linn.
Soc., 44(3): 273-285.
Belkhir, K., V. Castric & F. Bonhomme. 2002. Program
Note Identix: a software to test for relatedness in a
population using permutation methods. Mol. Ecol.
Notes, 2: 611-614.
Belkhir, K., P. Borsa, L. Chikhi, N. Raufaste & F.
Bonhomme. 1996. Genetix 4.05, Logiciel sous
WindowsTM pour la génetique des populations.
Laboratorie Génome Populations Interactions CNSR
UMR 5000. Université de Montpellier. MontpellierFrance. [http://www.univ-montp2.fr/~genetix/genetix/
genetix.htm]. Reviewed: 27 January 2015.
Borsa, P., V. Rolland & C. Daguin-Thiébaut. 2012.
Genetics and taxonomy of Chilean smooth-shelled
mussels, Mytilus spp. (Bivalvia: Mytilidae). C. R.
Biol., 335(1): 51-61.
Boxshall, G.A., J. Mees, M.J. Costello, F. Hernandez, S.
Gofas, B.W. Hoeksema, et al., 2014. World register of
marine species (WoRMS). Society for the Management of Electronic Biodiversity Data (SMEBD).
[http://www.marinespecies.org.]. Reviewed: 27 January 2015.
Briones, C., P. Presa, M. Pérez, A. Pita & R. Guiñez. 2013.
Genetic connectivity of the ecosystem engineer
Perumytilus purpuratus north to the 32°S Southeast
Pacific ecological discontinuity. Mar. Biol., 160(12):
3143-3156.
Brookfield, J.F.Y. 1996. A simple method for estimating
null allele frequency from heterozygote deficiency.
Mol. Ecol., 5: 453-455.
Cárcamo, C., A.S. Comesaña, F.M. Winkler & A. Sanjuan.
2005. Allozyme identification of mussels (Bivalvia:
Mytilus) on the Pacific coast of South America. J.
Shellfish Res., 24: 1101-1115.
Chapuis, M.P. & A. Estoup. 2007. Microsatellite null
alleles and estimation of population differentiation.
Mol. Biol. Evol., 24(3): 621-631.
Cruz, F., M. Pérez & P. Presa. 2005. Distribution and
abundance of microsatellites in the genome of
bivalves. Gene, 346: 241-247.
Dąbrowski, M.J., S. Bornelöv, M. Kruczyk, N. Baltzer &
J. Komorowski. 2014. True null allele detection in
microsatellite loci: a comparison of methods,
assessment of difficulties and survey of possible
improvements. Mol. Ecol. Res., 15(3): 477-488.
Diz, A.P. & P. Presa. 2008. Regional patterns of
microsatellite variation in Mytilus galloprovincialis
from the Iberian Peninsula. Mar. Biol., 154(2): 277286.
Diz, A.P. & P. Presa. 2009. The genetic diversity pattern
of Mytilus galloprovincialis in Galician Rías (NW
Iberian Estuaries). Aquaculture, 287(3-4): 278-285.
Earl, D.A & B.M. von Holdt. 2012. STRUCTURE
harvester: a website and program for visualizing
structure output and implementing the Evanno
method. Conserv. Genet. Res., 4(2): 359-361.
Evanno, G., S. Regnaut & J. Goudet. 2005. Detecting the
number of clusters of individuals using the software
STRUCTURE: a simulation study. Mol. Ecol., 14(8):
2611-2620.
Falush, D., M. Stephens & J.K. Pritchard. 2007. Inference
of population structure using multilocus genotype
data: dominant markers and null alleles. Mol. Ecol.
Notes, 7(4): 574-578.
Food and Agriculture Organization of the United Nations
(FAO). 2015. Global statistical collections. [http://
www.fao.org/fishery/statistics/en.]. Reviewed: 27 January
2015.
Global Aquaculture Alliance (GAA). 2013. Best
aquaculture practices certification. Mussel farms. BAP
Standards, Guidelines. USA: Global Aquaculture
Alliance, 16 pp.
Gao, X. & J. Starmer. 2008. AWclust: point-and-click
software for non-parametric population STRUCTURE
analysis. BMC Bioinformatics, 9(1): 77.
Gardeström, J., R.T. Pereyra & C. André. 2007. Characterization of six microsatellite loci in the Baltic blue
mussel Mytilus trossulus and cross-species amplification in North Sea Mytilus edulis. Conserv. Genet., 9(4):
1003-1005.
Gazeau, F., L.M. Parker, S. Comeau, J.P. Gattuso, W.A.
O’Connor, S. Martin, H.O Pörtner & P.M. Ross. 2013.
Impacts of ocean acidification on marine shelled
molluscs. Mar. Biol., 160(8): 2207-2245.
Glaubitz, J.C. 2004. Convert: a user-friendly program to
reformat diploid genotypic data for commonly used
population genetic software packages. Mol. Ecol.
Notes, 4(2): 309-310.
Guo, S.W. & E.A. Thompson. 1992. A Monte-Carlo
Method for combined segregation and linkage
analysis. Am. J. Hum. Genet., 51(5): 1111-1126.
Guyomard, R., M. Boussaha, F. Krieg, C. Hervet & E.
Quillet. 2012. A synthetic rainbow trout linkage map
provides new insights into the salmonid whole genome
duplication and the conservation of synteny among
teleosts. BMC Genet., 13(1): 15.
Hauser, L., T.R. Seamons, M. Dauer, K.A. Naish & T.P.
Quinn. 2006. An empirical verification of population
assignment methods by marking and parentage data:
hatchery and wild steelhead (Oncorhynchus mykiss) in
Forks Creek, Washington, USA. Mol. Ecol., 15(11):
3157-3173.
He, L., Y.N. Xie, W. Lu, Y. Wang, L.L. Chen, P.B. Mather,
Y.L. Zhao, Y.P. Wang & Q. Wang. 2012. Genetic
diversity in three redclaw crayfish (Cherax
quadricarinatus, von Martens) lines developed in
culture in China. Aquacult. Res., 43(1): 75-83.
Hernández, J.M. & L.E. González. 1976. Observaciones
sobre el comportamiento de mitílidos chilenos en
cultivo suspendido: I Chorito Mytilus chilensis (Hupe,
1854). [http://books.google.cl/books?id=kZy5HAAA
CAAJ]. Reviewed: 25 January 2015.
Holm, S. 1979. A Simple sequentially rejective multiple
test procedure. Scand. J. Stat., 6(2): 65-70.
Inoue, K., J.H. Waite, M. Matsuoka, S. Odo & S.
Harayama. 1995. Interspecific variations in adhesive
protein sequences of Mytilus edulis, M. galloprovincialis, and M. trossulus. Biol. Bull., 189(3): 370375.
Kijewski, T., J.W.M. Wijsman, H. Hummel & R. Wenne.
2009. Genetic composition of cultured and wild
mussels Mytilus from The Netherlands and transfers
from Ireland and Great Britain. Aquaculture, 287(3-4):
292-296.
Lallias, D., R. Stockdale, P. Boudry, S. Lapegue & A.R.
Beaumont. 2009. Characterization of ten microsatellite
loci in the blue mussel Mytilus edulis. J. Shellfish Res.,
28(3): 547-551.
Larraín, M.A. 2012. Utilización de marcadores genético
moleculares en calidad e inocuidad de los alimentos.
Aplicaciones en trazabilidad y denominación de
origen geográfico de Mytilus chilensis. Ph.D. Thesis.
Universidad de Santiago de Chile, Santiago, 101 pp.
Larraín, M.A., N.F. Díaz, C. Lamas, C. Uribe & C.
Araneda. 2014. Traceability of mussel (Mytilus
chilensis) in Southern Chile using microsatellite
molecular markers and assignment algorithms.
Exploratory survey. Food Res. Int., 62(0): 104-110.
Larraín, M.A., N.F. Díaz, C. Lamas, C. Vargas & C.
Araneda. 2012. Genetic composition of Mytilus
species in mussel populations from Southern Chile.
Lat. Am. J. Aquat. Res., 40(4): 1077-1084.
Larson, R.J. & R.M. Julian. 1999. Spatial and temporal
genetic patchiness in marine populations and their
implications for fisheries management. CalCOFI Rep.,
40: 94-99.
Liu, Z.J. & J.F. Cordes. 2004. DNA marker technologies
and their applications in aquaculture genetics.
Aquaculture, 238(1-4): 1-37.
1006
9
Mantel, N. 1967. The detection of disease clustering and a
generalized regression approach. Cancer Res., 27(2
Part 1): 209-220.
Mena, C., C. González, E. Clasing & M. Garllardo. 2001.
Variabilidad genética en Aulacomya atra (Molina,
1782) en el sur de Chile. Cienc. Tecnol. Mar, 24: 7179.
Mohanty, P., Lakshman S., Bindu R.P., P. Jayasankar & P.
Das. 2014. Genetic divergence in indian populations of
M. rosenbergii using microsatellite markers. Aquacult.
Res., 30: 1-10.
Ouagajjou, Y. & P. Presa. 2015. The connectivity of
Mytilus galloprovincialis in northern Morocco: a gene
flow crossroads between continents. Estuar. Coast.
Shelf Sci., 152: 1-10.
Ouagajjou, Y., P. Presa, M. Astorga & M. Pérez. 2011.
Microsatellites of Mytilus chilensis: a genomic print of
its taxonomic status within Mytilus sp. J. Shellfish
Res., 30(2): 325-330.
Oyarzún, P., J.E. Toro, O. Garrido, C. Briones & R.
Guiñez. 2014. Differences in sperm ultrastructure
between Mytilus chilensis and Mytilus galloprovincialis (Bivalvia, Mytilidae): could be used as a
taxonomic trait? Lat. Am. J. Aquat. Res., 42(1): 172179.
Park, S.D.E. 2001. Trypanotolerance in west African cattle
and the population genetic effects of selection. Ph.D.
Thesis. University of Dublin. [http://animalgenomics.
ucd.ie/sdepark/ms-toolkit/]. Reviewed: 25 January
2015.
Perez, M., R. Guiñez, A. Llavona, J.E. Toro, M. Astorga
& P. Presa. 2008. Development of microsatellite
markers for the ecosystem bioengineer mussel
Perumytilus purpuratus and cross-priming testing in
six Mytilinae genera. Mol. Ecol. Resour., 8(2): 449451.
Presa, P., M. Pérez & A. Diz. 2002. Polymorphic
microsatellite markers for blue mussels (Mytilus spp.).
Conserv. Genet., 3: 441-443.
Pritchard, J.K., M. Stephens & P. Donnelly. 2000.
Inference of population structure using multilocus
genotype data. Genetics, 155(2): 945-959.
Queller, D.C. & K.F. Goodnight. 1989. Estimating
relatedness using genetic markers. Evolution, 43 (2):
258-275.
Raymond, M. & F. Rousset. 1995. Genepop (Version 1.2):
population genetics software for exact tests and
ecumenicism. J. Hered., 86(3): 248-249.
Rice, W.R. 1989. Analyzing tables of statistical tests.
Evolution, 43(1): 223-225.
1007
10
Riisgard, H.U., D. Pleissner, K. Lundgreen & P.S. Larsen.
2013. Growth of mussels Mytilus edulis at algal
(Rhodomonas salina) concentrations below and above
saturation levels for reduced filtration rate. Mar. Biol.
Res., 9(10): 1005-1017.
Rousset, F. 2008. Genepop’007: a complete reimplementation of the Genepop software for Windows
and Linux. Mol. Ecol. Resour., 8(1): 103-106.
Santaclara, F.J., M. Espiñeira, A.G. Cabado, A. Aldasoro,
N. Gonzalez-Lavín & J.M. Vieites. 2006. Development of a method for the genetic identification of
mussel species belonging to Mytilus, Perna,
Aulacomya, and other genera. J. Agric. Food Chem.,
54(22): 8461-8470.
Seguel, M. 2011. Evaluation of the taxonomic status of
Mytilus chilensis using the mitochondrial gene
citochrome C oxidase subunit I (COI). XXXI
Congreso de Ciencias del Mar, Viña del Mar, 220 pp.
Servicio
Nacional
de
Pesca
y Acuicultura
(SERNAPESCA). 2015. Anuario Estadístico de
Pesca-2013. Servicio Nacional de Pesca y Acuicultura
(disponible online https://www.sernapesca.cl/index.
php?option=com_content&task=view&id=1806&Ite
mid=889). Reviewed: 27 January 2015.
Shields, J.L., J.W. Heath & D.D. Heath. 2010. Marine
landscape shapes hybrid zone in a broadcast spawning
bivalve: introgression and genetic structure in
Canadian west coast Mytilus. Mar. Ecol. Prog. Ser.,
399: 211-223.
Strub, P.T., J.M. Mesías, V. Montecino & J. Rutllant. 1998.
Coastal ocean circulation off western South América.
In: A.R. Robinson & K.H. Brink (eds.).The Sea, 11:
273-313.
Tarifeño, E., R. Galleguillos, J. Gardner, I. Lépez, D.
Arriagada, A. Llanos, S. Astete, S. Ferrada, S.
Rodríguez & S. Gacitúa. 2005. Presencia de mejillón,
Mytilus galloprovincialis (Lmk) (Bivalvia, Mollusca)
en las costas de la región del Biobío, Chile. XI
Congreso Latinoamericano de Ciencias del Mar. Viña
del Mar. Chile. [http://www.xxvcongreso2005.ucv.
cl/]. Reviewed: 25 January 2015.
Toro, J.E. 1998. PCR-based nuclear and mtDNA markers
and shell morphology as an approach to study the
taxonomic status of the chilean blue mussel, Mytilus
chilensis (Bivalvia). Aquat. Living Resour., 11(5):
347-353.
Toro, J.E., J.A. Ojeda & A.M. Vergara. 2004. The genetic
STRUCTURE of Mytilus chilensis (Hupé, 1854)
Populations along the Chilean coast based on RAPDs
analysis. Aquacult. Res., 35(15): 1466-1471.
Toro, J.E., R.J. Thompson & D.J. Innes. 2006.
Fertilization success and early survival in pure and
hybrid larvae of Mytilus edulis (Linnaeus, 1758) and
M. trossulus (Gould, 1850) from laboratory crosses.
Aquacult. Res., 37(16): 1703-1708.
Toro, J.E., G.C. Castro, J.A. Ojeda & A.M. Vergara. 2006.
Allozymic variation and differentiation in the Chilean
blue mussel, Mytilus chilensis, along its natural
distribution. Genet. Mol. Biol., 29(1): 174-179.
Toro, J.E., J.A. Ojeda, A.M. Vergara, G.C. Castro & A.C.
Alcapán. 2005. Molecular characterization of the
chilean blue mussel Mytilus chilensis (Hupé, 1854)
demonstrates evidence for the occurrence of Mytilus
galloprovincialis in southern Chile. J. Shellfish Res.,
24(4): 1117-1121.
Van Oosterhout, C., W.F. Hutchinson, D.P.M. Wills & P.
Shipley. 2004. MICRO-CHECKER: software for
identifying and correcting genotyping errors in
microsatellite Data. Mol. Ecol. Notes, 4(3): 535-538.
Vidal, R., C. Peñaloza, R. Urzua, & J.E. Toro. 2009.
Screening of ESTs from Mytilus for the detection of
SSR markers in Mytilus californianus. Mol. Ecol.
Resour., 9(5): 1409-1411.
Wei, K.J., A.R. Wood & J.P.A. Gardner. 2013. Population
genetic variation in the New Zealand greenshell
mussel: locus-dependent conflicting signals of weak
structure and high gene flow balanced against
pronounced structure and high self-recruitment. Mar.
Biol., 160(4): 931-949.
Weir, B.S. & C.C. Cockerham. 1984. Estimating Fstatistics for the analysis of population STRUCTURE.
Evolution, 38: 1358-1370.
Westfall, K.M. & J.P.A. Gardner. 2010. Genetic diversity
of Southern Hemisphere blue mussels (Bivalvia:
Mytilidae) and identification of non-indigenous taxa.
Biol. J. Linn. Soc., 101: 898-909.
Yu, Hong & Q.I. Li. 2007. Development of EST-SSRs in
the Mediterranean blue mussel, Mytilus galloprovincialis. Mol. Ecol. Notes, 7(6): 1308-1310.
Zbawicka, M., T. Sanko, J. Strand & R. Wenne. 2014. New
SNP markers reveal largely concordant clinal variation
across the hybrid zone between Mytilus spp. in the
Baltic Sea. Aquat. Biol., 21 (1): 25-36.
1008
11
Annex 1. Allele frequencies for nine SSR loci genotyped in blue mussels (Mytilus chilensis) from six locations in southern
Chile. Zone and location codes: 1) Reloncaví (Quillaipe: 1-QI, Pichicolo: 1-PI, Caleta La Arena: 1-LA and Canutillar: 1CN), 2) Chiloé (Canal Coldita-Piedra Blanca: 2-CB), and 3) Magallanes (Isla Peel: 3-IP).
Allele size [bp]
Location
Locus
Mgu1
1-QI
1-PI
1-LA 1-CN 2-CB 3-IP
115
151
4.00
6.00
153
155
163
171
173
175
177
181
187
189
6.00
21.00
6.00
2.00
6.00
10.00
11.00
13.00
7.00
2.00
197
217
1.00
5.00
2.00
2.00
1.00
-
6.00
2.00
8.00
3.00
Mgu3
225
141
-
2.00
1.00
-
2.00
-
-
MT203
143 31.00
147 51.00
151
157 9.00
159 9.00
178 36.00
62.00 1.00 74.49
36.00 47.00 23.47
48.00
1.00 1.02
1.00 3.00 1.02
45.00 25.00 34.00
184 6.00
188 30.00
13.00 25.00 12.00 6.00 6.00
21.00 17.00 18.00 12.00 18.00
MT282
Mg15
17.00
3.00 2.00
2.00 6.00
3.00 14.00
3.00
8.00
12.00 24.00 9.00 18.00 19.00
17.00 8.00 8.00 7.00 26.00
12.00 3.00 13.00 4.00 1.00
1.00 6.00 3.00 3.00
4.00 6.00 4.00 2.00
2.00 10.00 13.00 16.00 2.00
12.00 14.00 24.00 15.00 11.00
20.00 8.00 11.00 10.00
5.00
3.00 4.00 6.00
6.00 1.00
2.00 -
192
2.00
1.00
-
194
198
6.00
7.00
6.00
4.00 10.00
202
206
7.00
3.00
11.00
1.00
216
220
3.00
-
3.00
1.00
335
347
353
381
115
120
28.00
18.00
49.00
5.00
9.78
38.04
1.00
4.00
5.00
-
83.00 58.00
15.00 33.00
1.00 7.00
1.00 2.00
50.00 44.00
6.00
-
7.00 7.00 4.00
8.00 10.00 10.00
1.00 11.00
3.00 7.00
4.00 10.00
1.00 5.00
9.00
4.00
4.00
-
2.00
-
2.00
1.00
41.00 33.00 33.00 37.00 40.00
14.00 2.00 10.00 5.00 17.00
41.00 60.00 52.00 55.00 41.00
4.00 5.00 5.00 3.00 2.00
2.08 3.06 7.14 2.04 3.00
31.25 32.65 29.59 28.57 43.00
1009
12
Continuation
Allele size [bp]
Location
Locus
Mg56
Med737
MIT02
MGE005
1-QI
1-PI
1-LA 1-CN 2-CB 3-IP
123 10.87
135 41.30
247
294 1.04
301 7.29
30.21 35.71 36.73 39.80 29.00
36.46 28.57 26.53 29.59 25.00
1.00
6.12 8.00 2.04 6.00 2.00
4.08 7.00 8.16 1.00 3.00
337 2.08
344 26.04
351 45.83
372 3.13
399
425 4.17
441 10.42
464
122 1.00
134
-
9.18 4.00 5.10 11.00 9.00
32.65 26.00 41.84 51.00 30.00
24.49 46.00 26.53 17.00 32.00
2.04 1.00 5.10 3.00 2.00
1.02
1.02 1.00 1.00
3.06 3.00 1.02 3.00 4.00
13.27 4.00 8.16 4.00 17.00
4.08 1.00 1.02 2.00
1.00 1.00 3.00
-
140 57.00
142 4.00
146 18.00
152 8.00
164 8.00
168 2.00
174 2.00
184
197 4.00
221 7.00
40.00 52.00 51.00 13.00 19.00
7.00 4.00 4.00 1.00
35.00 21.00 22.00 35.00 8.00
3.00 2.00 3.00 2.00 6.00
12.00 11.00 14.00 29.00 37.00
4.00 2.00 1.00 13.00 12.00
3.00 4.00 4.00 13.00
2.00
2.00
4.00
1.00 2.00 6.00 7.14 7.00
14.00 3.00 5.00 10.20 2.00
227 51.00
237 2.00
243 36.00
113 2.00
119 2.00
122 3.00
125 4.00
128 2.00
134 5.00
137 79.00
51.00
4.00
30.00
2.00
3.00
7.00
2.00
82.00
140
143
149
2.00
1.00
-
52.00
4.00
39.00
3.00
5.00
1.00
3.00
83.00
52.00 39.80 45.00
2.04 3.00
37.00 40.82 43.00
1.00
3.00 5.00
7.00 3.00 4.00
2.00 3.00
11.00 3.00 2.00
77.00 83.00 85.00
2.00 4.00 3.00
2.00 1.00 1.00
1.00
3.00
2.00
-
1.00
-
1010
13
Annex 2. Diversity parameters for nine SSR loci analyzed in six mussel locations (Mytilus chilensis) from southern Chile. Sample
codes are indicated in Annex 1. Note: The number of alleles (Na), the number of private alleles (Ap), the observed
heterozygosity (Ho), the expected heterozygosity (He), and the fixation index Fis according to Weir & Cockerham are
provided for each locus and sample site. * Significant departures from Hardy-Weinberg expectations are corrected with
sequential Bonferroni correction.
Locus/Location
Mgu1
A(Ap)
Ho
He
Fis (W&C)
Mgu3
A(Ap)
Ho
He
Fis (W&C)
MT203
A (Ap)
Ho
He
Fis (W&C)
MT282
A (Ap)
Ho
He
Fis (W&C)
Mg15
A (Ap)
Ho
He
Fis (W&C)
Mg56
A (Ap)
Ho
He
Fis (W&C)
Med737
A (Ap)
Ho
He
Fis (W&C)
MIT02
A (Ap)
Ho
He
Fis (W&C)
MGE005
A (Ap)
Ho
He
Fis (W&C)
Mean acrossloci ± SD
A (Ap)
Ho
He
Fis (W&C)
1-QI
1-PI
1-LA
14(0)
0.500
0.902
0.448*
14(0)
0.300
0.886
0.664*
12(0)
0.560
0.871
0.360*
4(0)
0.160
0.634
0.750*
4(1)
0.040
0.491
0.919*
9(0)
0.380
0.769
0.508*
9(0)
0.420
0.729
0.426*
4(0)
0.420
0.653
0.359*
4(0)
0.560
0.649
0.139*
2-CB
3-IP
13(0)
0.340
0.883
0.617*
12(0)
0.500
0.888
0.440*
13(0)
0.240
0.866
0.725*
5(1)
0.200
0.553
0.641*
4(0)
0.041
0.394
0.897*
4(0)
0.040
0.291
0.864*
4(0)
0.100
0.555
0.821*
9(0)
0.440
0.830
0.473*
9(0)
0.420
0.817
0.488*
9(0)
0.500
0.717
0.305*
9(0)
0.560
0.753
0.259*
4(0)
0.600
0.563
-0.067
4(0)
0.480
0.649
0.263*
4(0)
0.413
0.671
0.387*
4(0)
0.396
0.685
0.425*
4(0)
0.490
0.690
0.293*
4(0)
0.469
0.709
0.341*
4(0)
0.347
0.679
0.492*
4(0)
0.380
0.674
0.439*
8(0)
0.521
0.710
0.269*
10(0)
0.469
0.807
0.421*
9(0)
0.460
0.712
0.357*
10(0)
0.408
0.743
0.453*
11(1)
0.380
0.698
0.458*
9(0)
0.580
0.775
0.254*
8(1)
0.634
0.595
0.245*
8(0)
0.706
0.650
0.152*
8(0)
0.673
0.630
0.378*
8(0)
0.675
0.628
0.499*
7(0)
0.764
0.719
0.269*
8(0)
0.792
0.758
0.371*
5(0)
0.280
0.769
0.543*
5(0)
0.300
0.729
0.530*
5(0)
0.400
0.830
0.313*
4(0)
0.320
0.817
0.463*
5(0)
0.449
0.717
0.328
5(0)
0.440
0.753
0.284
9(1)
0.320
0.373
0.143
7(0)
0.320
0.323
0.011
7(0)
0.280
0.381
0.092
6(1)
0.360
0.393
0.085
8(0)
0.340
0.310
-0.099
6(0)
0.300
0.275
-0.093
7.1 ± 3.3
0.386 ± 0.117
0.662 ± 0.141
0.406*
7.2 ± 3.4
0.378 ± 0.167
0.657 ± 0.167
0.410*
6.9 ± 2.5
0.426 ± 0.123
0.639 ± 0.170
0.313*
7.0 ± 3.2
0.369 ± 0.154
0.647 ± 0.170
0.426*
7.0 ± 2.9
0.413 ± 0.167
0.620 ± 0.200
0.332*
6.9 ± 3.1
0.398 ± 0.159
0.661 ± 0.175
0.369*
4(0)
0.580
0.534
-0.088
1-CN
4(0)
0.620
0.614
-0.009
14
Lat. Am. J. Aquat. Res., 43(5): 1011-1018, 2015
ISSR markers for Pterois species
1011
Short Communication
The use of ISSR markers for species determination and a genetic study
of the invasive lionfish in Guanahacabibes, Cuba
Elizabeth Labastida1, Dorka Cobián2, Yann Hénaut3, María del Carmen García-Rivas4
Pedro P. Chevalier5 & Salima Machkour-M´Rabet1
1
Laboratorio de Ecología Molecular y Conservación, El Colegio de la Frontera Sur (ECOSUR)
Av. Centenario km 5.5, C.P. 77014, Chetumal, Quintana Roo, México
2
Parque Nacional Guanahacabibes, Centro de Investigaciones y Servicios Ambientales (ECOVIDA)
La Bajada, Municipio Sandino, Pinar del Río, Cuba
3
Laboratorio de Conducta Animal, El Colegio de la Frontera Sur (ECOSUR)
Av. Centenario km. 5.5, C.P. 77014, Chetumal, Quintana Roo, México
4
Secretaría de Medio Ambiente y Recursos Naturales, Comisión Nacional de Áreas Naturales Protegidas
(SEMARNAT-CONANP), Smza 86 Mza 2 Lote 4 Carretera Punta Sam, Puerto Juárez, Quintana Roo, México
5
Acuario Nacional de Cuba, 3ª y 62 Miramar, Playa, Ciudad Habana, Cuba
Corresponding author: Salima Machkour-M'Rabet ([email protected])
ABSTRACT. The red lionfish (Pterois volitans) and devil fire-fish (Pterois miles) are invasive species that
pose a threat to the biodiversity and stability of coral reefs in the Western Atlantic, Gulf of Mexico and Caribbean
Sea. Species identification of lionfish is uncertain in some parts of Cuba, and research has mainly been focused
on their biology and ecology. The principal aim of this study was to determine highly polymorphic markers
(Inter Simple Sequence Repeat, ISSR) that could be used in research on lionfish population genetics in addition
to confirming the presence of Pterois species in the Guanahacabibes National Park. The genetic profile or
“fingerprint” of individuals collected in Mexico, formally identified as P. volitans, was compared with the
genetic profile of specimens from Cuba. There were very few “diagnostic bands” and a high number of "common
bands", demonstrating that the same species exists in both countries. Furthermore, Nei's genetic distance and
the unrooted tree do not show significant differences between both localities. In light of these results, we can
confirm the presence of P. volitans in the Guanahacabibes National Park, Cuba. This study demonstrates the
functionality of ISSR as a molecular tool for species identification and their application for genetic population
studies of this invasive fish species.
Keywords: Pterois volitans, fish, fingerprint, ISSR, Caribbean Sea.
Uso de marcadores ISSR para la determinación de especies y estudios genéticos
del pez león, especie invasora en Guanahacabibes, Cuba
RESUMEN. El pez león rojo (Pterois volitans) y el pez fuego diablo (Pterois miles) son especies invasoras que
amenazan la biodiversidad y estabilidad de los arrecifes coralinos del Atlántico occidental, Golfo de México y
Mar Caribe. La identificación del pez león sigue incierta en unas zonas de Cuba y la investigación se ha centrado
principalmente en su biología y ecología. El propósito principal de este estudio fue determinar marcadores
altamente polimórficos (secuencias repetidas inter simples, ISSR) útiles para estudios de genética poblacional
del pez león y aplicarlos para determinar la especie de Pterois presente en el Parque Nacional Guanahacabibes.
Se comparó el perfil genético de individuos colectados en México, formalmente identificados como P. volitans,
con el perfil genético de especímenes de Cuba. Los perfiles genéticos mostraron un bajo número de “bandas
diagnósticas” y un alto número de bandas comunes lo que demuestra que en ambos países está presente la misma
especie. Por otra parte, los resultados de distancia genética de Nei y el árbol no enraizado no muestran ninguna
diferencia significativa entre ambas localidades. Estos resultados confirman la presencia de P. volitans en el
Parque Nacional Guanahacabibes, Cuba, y se demostró la funcionalidad de ISSR como herramienta molecular
para la identificación de especies y su aplicación para estudios de genética poblacional de este pez invasor.
Palabras clave: Pterois volitans, fingerprint, ISSR, peces, Mar Caribe.
__________________
Corresponding editor: Patricio Arana
1012
Invasive species are a major threat to marine
ecosystems. They impact the ecosystem structure and
function and have a negative effect on biodiversity
(Costello et al., 2010; Ojaveer et al., 2014). During the
last decade, considerable efforts were made to
understand and eradicate one of the most important
invasive predators in the Atlantic, the Indo-Pacific
lionfish complex: the red lionfish Pterois volitans
(Linnaeus, 1758) and the devil fire-fish Pterois miles
(Bennett, 1828). The invasion has progressed rapidly
since the first observation of lionfish in Florida in 1985
(Morris & Akins, 2009). Today, the species has invaded
an area over 7 million km2 (Dahl & Paterson, 2014),
including the eastern coast of the USA, Gulf of Mexico,
Caribbean Sea (Schofield, 2009) and has extended their
range throughout of the eastern coast of South America,
mainly in Venezuela and Brazil (Fortunato &
Avigliano, 2014; Ferreira et al., 2015).
According to Sakai et al. (2001), the study of the
genetic diversity and population structure of a new
invasive species is essential as the obtained information
may contribute to understanding the potential
establishment and geographical dispersion of invasive
species. This information could also play an important
role in the development of appropriate strategies for the
management of such species. Another fundamental
aspect concerning invasive species is the correct
identification of the introduced species and the
determination of their origin (Le Roux & Wieczorek,
2009).
An erroneous taxonomic classification may obscure
accurate invasion history and preclude management
strategies. Because of inter- and intraspecific
variations, morphological identification often presents
difficulties, whereas molecular markers can accurately,
reliably and rapidly identify species as well as variants
and cryptic taxa (Holland et al., 2004; Le Roux &
Wieczorek, 2009; García-Morales & Elías-Gutiérrez,
2013). These examples show the efficacy and
importance of molecular tools when carrying out
research on invasive organisms, especially as
taxonomic identification is a first important step
towards developing effective control and management
decisions (Le Roux & Wieczorek, 2009).
The choice of markers is important and depends on
the specific research aims. In this context, dominant
ISSR markers (Inter Simple Sequence Repeats) use the
PCR-method to amplify DNA sequences between two
closed but inverted SSR (Simple Sequence Repeats) by
means of a single primer, generally composed of 18-20
base pairs from a microsatellite sequence (Zietkiewicz
et al., 1994). The great advantage of ISSR is that the
primers work universally for most animal and plant
species, so prior knowledge of genome sequences is not
required. This method finds abundant polymorphisms
in many systems and provides genomic information for
a wide range of applications (Maltagliati et al., 2006;
Wink, 2006). Furthermore, ISSR is straightforward,
demands fewer experimental steps, and incurred costs
are relatively low (Huang & Sun, 2000; Le Roux &
Wieczorek, 2009).
Only one recent study (Butterfield et al., 2015),
about phylogeographic structure of red lionfish over a
wide-range geographical scale, include samples from
Cuba (Guantanamo Bay). Otherwise, any other geneticrelated information on the lionfish invasion in other
parts of Cuba is available (Chevalier et al., 2013). The
first, albeit non-confirmed, observation of lionfish in
Cuba was in 2005 (Schofield et al., 2009), and the first
official report of its presence was in 2007 (Chevalier et
al., 2008) at six sites along the Atlantic coast (northern
Cuba) and two localities on the Caribbean coast
(Santiago de Cuba, southeastern Cuba). These authors
identified both collected specimens as P. volitans based
on morphological characters following Schultz (1986).
However, both species of Pterois present in Florida, P.
volitans and P. miles, are not 100% distinguishable
based solely on morphology (Schofield, 2009; Jud et
al., 2015).
Consequently, the identification of Pterois species
in different parts of Cuba requires validation using
molecular tools. Recent study (Butterfield et al., 2015)
confirms that this species occupy the eastern part of the
island, but for other regions, such as the northern coast,
no genetic information is available. This region of Cuba
is particularly important, because the model of
biological connectivity, proposed by Cowen et al.
(2006), suggests that ocean currents could exchange
individuals of P. miles between Bahamas and northern
Cuba; so the distribution of P. miles could be extended
to this part of the archipelago.
In this study, we propose to (1) determine the ISSR
markers that may be useful for molecular genetic
studies of lionfish and (2) use the ISSR technique to
confirm the identification of the lionfish species in
Guanahacabibes National Park, Cuba.
Cuban lionfishes were collected at Guanahacabibes
National Park, the westernmost point of Cuba, within
the Biosphere Reserve "Peninsula de Guanahacabibes".
Sampling was conducted over a wide area from Cabo
Corrientes to La Bajada (Fig. 1), performed by scuba
divers, between 9:00-14:00 h at a water depth of 10 to
20 m. Nineteen fishes were captured using a spear,
conserved in ice and transported to the laboratory.
Muscle tissue was cut from each individual, placed in
96° ethanol, and finally conserved at 4°C for molecular
analysis at ECOSUR (El Colegio de la Frontera Sur,
Chetumal, Mexico). Reference specimens were obtained
1013
Figure 1. Location of the lionfish samples in the Caribbean Sea. Black dots indicate sampling locations. a) Localities in
Cuba: 1: La Bajada and 2: Cabo Corrientes, b-c) locality in Mexico: 3: Banco Chinchorro.
at the “Coral Negro” locality within the Banco
Chinchorro Biosphere Reserve in the Mexican
Caribbean (Fig. 1). Twenty individuals were captured
and preserved in similar conditions to the Cuban
specimens. Using the barcoding method, the lionfish
from the Mexican Caribbean were formally identified
as P. volitans (Valdéz-Moreno et al., 2012).
Genomic DNA was extracted from a small part of
the lionfish muscle tissue using the Wizard Genomic
DNA Purification Kit (Promega) following the
manufacturer’s instructions, stored at -20°C until
amplification. DNA-concentration was determined by
the Qubit®2.0 fluorometer (Invitrogen). Quality was
checked using agarose gel (1% with TAE buffer 1X;
Promega) and the post-gel staining method using
GelRed™ (Quimica Valaner).
To identify the more reliable ISSR markers for
lionfish, we probed 23 sequences (Table 1). All primers
were tested using five individuals from each locality
and the optimal PCR conditions were determined for
each primer. PCR amplifications were performed under
the following conditions: 15 µL reaction volume
containing: ~20 ng de template DNA, 1.5 µL of 5X
Green Buffer (Promega), 200 µM of each dNTP from
dNTP mix (Promega), 3 mM MgCl2 (Promega), 1 µM
of primer (Integrated DNA Technologies), 1.25 U of
GoTaq Flexi DNA Polymerase (Promega) and finally
the volume was adjusted by adding ultrapure water. All
amplifications were conducted in a T100 Thermal
Cycler (Bio-Rad™). The cycling conditions were as
follows: initial denaturation step at 94°C for 4 min, 39
cycles of denaturation at 94°C for 45s, annealing
temperature (Ta) from 57°C to 66°C depending on the
ISSR primer (Table 1), extension temperature at 72°C
for 2 min, and a final extension at 72°C for 10 min.
Amplification products were separated by electrophoresis (110 V for 2 h) using 3 µL of amplified
product on agarose gels (2% in a 1X TAE Buffer,
Promega) and a 100 bp DNA Ladder (Promega) was
used as reference for fragment length. The bands were
detected with the GelRed™ under UV light and
digitized using an Imaging System (AlphaImager®
Mini, ProteinSimple).
A binary matrix was generated, scoring band
presence (coded 1) or absence (coded 0) for each
individual and primer. Only bands that scored
consistently among populations were used, and we
assumed that each marker band represented a distinct
locus. The following informative parameters were
determined at the population level: total number of
bands, number of diagnostic bands and number of
polymorphic bands. The binary matrix was applied to
determine the percentage of polymorphism (P) and the
Nei’s gene diversity (h), using corrected allele
frequency (Lynch & Milligan, 1994), at the species and
localities level. All analyses were carried out using
GenAlex 6.501 (Peakall & Smouse, 2006) and Popgen
1.32 (Yeh & Boyle, 1999).
1014
Table 1. ISSR primers screened for ISSR-PCR in lionfish. %GC (proportion of G and C bases in the sequence), Tm (melting
temperature), Ta (annealing temperature), B = T, C or G; D = A, G or T; R = A or G; Y = C or T and W = A or T. Number
of total bands is of 5 individuals from each locality. Primers written in bold were used for the analysis.
Abbreviation
(CA)7
(CT)8C
(GAA)6
(CA)8GT
(AC)8C
(GA)8G
(AC)8G
(GT)8C
(GA)8C
(CA)8AC
(GACA)4
(AG)8Y
(AG)8C
(GTG)5GC
(CA)8AG
WB(GACA)4
BDB(ACA)5
(AG)8YC
(GAG)5GC
(AG)8G
(ACA)5BDB
(GACA)4WB
(CA)8RY
% GC
50
52.9
33.3
50
52.9
52.9
52.9
52.9
52.9
50
50
50
52.9
70.6
50
48.1
37
52.8
70.6
52.9
37
48.1
50
Tm
55.2
55.7
53.9
62.5
62.3
55.7
62.5
60.4
56
61.4
57.1
57.6
58.2
67.8
61.1
61.5
58.4
59.5
64.8
57.5
58.6
59
62.1
Ta
54
54
52
61
61
54
61
59
54
60
56
56
57
66
60
60
57
58
63
56
57
57
61
Amplification pattern
Poor amplification
Poor amplification
Smeared with bands
Smeared with bands
Smeared with bands
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Good
Smeared
In order to describe the genetic structure and
variability between localities, a non-parametric
analysis of molecular variance (AMOVA) (Excoffier et
al., 1992, 9999 permutations) and Nei’s genetic
distance analysis were performed using GenAlex 6.501
(Peakall & Smouse, 2006). In addition, a mean distance
analysis using a heuristic search for an optimal tree,
performed by TBR (tree–bisection-reconnection)
branch swapping, was conducted using Paup 4.0b10
(Swofford, 2001). The tree was displayed using
TreeView 1.5 software (Page, 1996). The distance
measurement (minimum evolution) was calculated
using the mean character difference. Negative branch
lengths were allowed, but set to zero for tree-score
calculation. Steepest descent options were not in effect.
Starting tree(s) were obtained via neighbor-joining and
bootstrap values were calculated under the same
criteria.
To confirm the reliability of the ISSR technique for
identifying species, we sent samples of five individuals
from Cuba for “DNA barcoding” analysis. Samples
were placed in a lysis 96-well plate with a drop of 96%
ethanol. Genomic DNA was extracted from tissue and
the extraction process was conducted following
Ivanova et al. (2006). DNA amplification and sequen-
Total bands
4
5
6
4
5
5
7
8
8
8
8
9
9
10
11
11
12
13
13
14
-
Size range (pb)
900-300
1100-300
800-600
800-450
1100-400
1500-900
900-200
1500-200
1500-200
1200-200
1200-200
1500-400
1600-200
1500-200
1700-100
1600-200
1400-400
1600-200
1700-200
1500-200
-
cing followed the protocols of Ivanova et al. (2007).
Sequences and all collateral data from specimens are
available on the BOLD website (www.boldsystems.org)
in the project entitled “PVCU”.
We obtained functional DNA in 14 samples from
Cuba and 20 from Banco Chinchorro. Out of the 23
primers tested on five individuals from each
population, 17 produced clear reproducible fragments
(Table 1). For this study, we selected five primers (Fig.
2) which presented a high percentage of G/C bases and
a high number of bands. Finally, we obtained 113 bands
of ISSR fragments (GACA) 4WB: 18 bands; (CA)8AC:
17 bands; (CA)8AG: 23 bands; (AG)8YC: 24 band and
(GAG)5GC: 31 bands) using 34 individuals from both
localities. Table 2 shows the numbers of bands scored,
the polymorphic bands present at each locality and the
number of diagnostic bands found in only one
population (Luque et al., 2002). Polymorphism is high
(83.5%), with the Cuban samples presenting the lowest
value, Global Nei's gene diversity is 0.26 ± 0.017) with
Mexican samples presenting the lowest value.
AMOVA revealed that the majority of variability
occurred among individuals within populations (98%,
P = 0.08) and this was supported by Nei’s genetic
distance value which presented very low values between
1015
Figure 2. Example of polymorphic banding patterns of the five selected markers [(AG) 8YC, (CA)8AC, (CA)8AG,
(GAG)5GC, (GACA)4WB] for both localities. The first line corresponds to the DNA ladder (from 100 bp to 1000 bp by
steps of 100 bp and one band at 1500 bp), Cu: individuals from Cuba, BC: individuals from Mexico.
both localities (0.035) (Fig. 2). Distance analysis did
not demonstrate any significant differences or grouping
between our two populations. No clusters were
discernible and there were no bootstrap values above
50% (Fig. 3).
Using the tools provided by bold-ids, the obtained
DNA barcode confirmed the identification of P.
volitans in the Guanahacabibes National Park, Cuba,
regrouped into the cluster with P. volitans individuals
from Quintana Roo, previously identified (ValdezMoreno et al., 2012). The BLAST® tool from
GenBank also confirmed the species found in the
Guanahacabibes National Park, Cuba, as P. volitans.
This first preliminary study identified a high
number of ISSR loci for the analysis of genetic
variability and population structure of the lionfish in the
Caribbean. Due to the high level of ISSR resolution for
the study of contemporary events, these markers are
excellent candidates for genetic studies of biological
invasions.
In this study, the number of bands amplified by five
primers were 113 (102 polymorphic) considered
sufficient for species determination and studies of
population genetics. Indeed, other studies of molecular
identification and population genetics in fish species
detected a similar number of bands. For example, Casu
et al. (2009) detected 97 fragments when considering
eight primers in Dentex dentex L. 1758 (Perciformes,
Figure 3. Unrooted tree obtained by distance analysis of
lionfish samples from localities in Cuba and Mexico.
Sparidae). A study on Cynoglossus semilaevis Günther,
1873 (Pleuronectiformes, Cynoglossidae) reported 137
fragments using 19 ISSR primers (Liu et al., 2009).
1016
Table 2. Lionfish genetic diversity based on ISSR markers in Cuban and Mexican localities. n: number of individuals kept
for analysis; N1: number of bands scored; N2: number of polymorphic bands; N3: number of diagnostic bands; P: percentage
of polymorphism; h: Nei’s gene diversity; SD: standard deviation.
Locality
Mexico
Cuba
n
14
20
N1
107
105
N2
82
79
Maltagliati et al. (2006) recorded 101 bands amplified
by nine ISSR primers in cyprinodontiform fish.
This study provides definite confirmation that the
species presents in the Guanahacabibes National Park,
Cuba is P. volitans. Diagnostic bands (Luque et al.,
2002) are important for the discrimination of species,
particularly fish species (Maltagliati et al., 2006; Casu et
al., 2009). The identification of species using the ISSR
method always reveals a high number of diagnostic
bands (Maltagliati et al., 2006; Casu et al., 2009). Our
study did not identify many diagnostic bands; however,
we observed a high number of common bands between
both localities, confirming that all the individuals belong
to the same species: P. volitans. This is further
confirmed by the lack of structure in the unrooted tree,
the results of AMOVA and the very low genetic
distances.
This work is an initial analysis of genetic aspects of
the lionfish invasion in Cuba using ISSR. Additionally,
we suggest that this technique is an excellent alternative
for low-cost genetic monitoring focused on improving
control programs of this invasive species in regions with
insufficient financial resources.
Given that Guanahacabibes was one of the last places
in Cuba to be colonized by lionfish (late 2009)
(Chevalier et al., 2013), we recommend extending this
research to the rest of the Cuban Archipelago.
Considering that the first sightings of P. volitans were
reported on the north coast of Cuba, the genetic analysis
of populations both in the north of the archipelago and
along the entire Cuban coast is advocated, with the aim
of obtaining a complete genetic characterization of this
invasive fish in Cuba.
ACKNOWLEDGEMENTS
We are grateful to the “Consejo Nacional de Ciencia y
Tecnología” (CONACyT) for the financial support
provided through the scholarship No. 288387. Thanks to
the Comisión Nacional de Áreas Naturales Protegidas”
(CONANP) and the “Comisión Nacional de Acuacultura
y Pesca” (CONAPESCA) for granting permission for
the collection of specimens in Mexico. We are indebted
N3
4
2
P (%)
75.2
72.5
h (± SD)
0.246 (0.018)
0.253 (0.019)
to the fishermen of “Banco Chinchorro” for their help
during the capture of specimens and appreciate the
permission for the collection and exportation of
specimen provided by the “Instituto de Medicina
Veterinaria de Cuba”. Many thanks to Dr. Juan Jacobo
Schmitter Soto (ECOSUR) for his helpful comments and
suggestions on this manuscript and M. Sc. Arely
Martinez Arce (ECOSUR) for her support during
laboratory work. This paper represents a contribution
from the Mexican Barcode of Life, in particular the
Chetumal node where the extraction and amplification
were performed by Arely Martínez Arce (ECOSURChetumal). Finally, we express our gratitude to the
Laboratorio de secuenciación genómica de la
biodiversidad y de la salud at Universidad Nacional
Autónoma de México, for sequencing the samples and
to Oc. Fernando Tlaloc Valdez Miranda who helped
create the maps.
REFERENCES
Butterfield, J.S.S., E. Díaz-Ferguson, B.R. Silliman, J.W.
Saunders, D. Buddo, A.A. Mignucci-Giannoni, L.
Searle, A.C. Allen & M.E. Hunter. 2015. Wide-ranging
phylogeographic structure of invasive red lionfish in the
Western Atlantic and Greater Caribbean. Mar. Biol.,
162(4): 773-781.
Casu, M., T. Lai, M. Curini-Galletti, A. Ruiu & A. Pais.
2009. Identification of Mediterranean Diplodus spp.
and Dentex dentex (Sparidae) by means of DNA InterSimple Sequence Repeat (ISSR) markers. J. Exp. Mar.
Biol., 368(2): 147-152.
Chevalier, P.P., H. Caballero, E. Cabrera-Sansón, A.
Fernandez & R.I. Corrada. 2013. Estudio preliminar de
la presencia del pez león (Teleostei: Scorpaenidae:
Pterois spp.) en aguas cubanas. Informe de
investigación. Acuario Nacional de Cuba, La Habana,
70 pp.
Chevalier, P.P., E. Gutiérrez, D. Ibarzábal, S. Romero, V.
Isla, J. Calderín & E. Hernández. 2008. Primer registro
de Pterois volitans (Pisces: Scorpaenidae) para aguas
cubanas. Solenodon, 7: 37-40.
Costello, J., M. Coll, R. Danovaro, P. Halpin, H. Ojaveer
& P. Miloslavich. 2010. A census of marine biodiver-
1017
sity knowledge, resources, and future challenges. PLoS
ONE, 5(8): e12110.
towards a better understanding of invasive species
management. Ann. Appl. Biol., 154: 1-17.
Cowen, R.K., C.B. Paris & A. Srinivasan. 2006. Scaling of
connectivity in marine populations. Science, 311: 522527.
Dahl, K. & W. Patterson. 2014. Habitat-specific density
and diet of rapidly expanding invasive red lionfish,
Pterois volitans, populations in the northern Gulf of
Mexico. PLoS ONE, 9(8): e105852. doi:10.1371/
journal.pone.0105852.
Liu, G., Z. Yu, L. Bao, B. Bao, X. Sun, Q. Shi & X. Liu.
2009. Population genetics studies of half-smooth
tongue sole Cynoglossus semilaevis usin ISSR markers.
Biochem. Syst. Ecol., 36: 821-827.
Excoffier, L., P. Smouse & J. Quattro. 1992. Analysis of
molecular variance inferred from metric distances
among DNA haplotypes: application to human
mitochondrial DNA restriction sites. Genetics, 131:
479-491.
Lynch, M. & B. Milligan. 1994. Analysis of population
genetic structure with RAPD markers. Mol. Ecol., 3:
91-99.
Ferreira, C., O. Luiz, S. Floeter, M. Lucena, M. Barbosa,
C. Rocha & R. Rocha. 2015. First record of invasive
lionfish (Pterois volitans) for the Brazilian coast. PLoS
ONE, 10(4): e0123002. doi:10.1371/journal. pone.
0123002.
Fortunato, R. & E. Avigliano. 2014. Presence of genus
Pterois (Oken, 1817) (Scorpaeniformes, Scorpaenidae): extension of invasive range in Caribbean Sea
and first published record for Los Frailes Archipelago.
J. Fish. Sci., 8(2): 88-91.
García-Morales, E. & M. Elías-Gutiérrez. 2013. DNA
barcoding freshwater Rotifera of Mexico: evidence of
cryptic speciation in common rotifers. Mol. Ecol.
Resour., 13(6): 1097-1107.
Holland, B., M. Dawson, G. Crow & D. Hofmann. 2004.
Global phylogeography of Cassiopea (Scyphozoa:
Rhizostomeae): molecular evidence for cryptic species
and multiple invasions of the Hawaiian Islands. Mar.
Biol., 145: 1119-1128.
Huang, J. & M. Sun. 2000. Fluorescent page analysis of
microsatellite-primed PCR: a fast and efficient
approach for genomic fingerprinting. Biotechniques,
2(8): 1068-1072.
Ivanova, N.V., J. de Waard & P.D.N. Hebert. 2006. An
inexpensive, automation-friendly protocol for recovering high-quality DNA. Mol. Ecol. Notes, 6: 998-1002.
Ivanova, N.V., T.S. Zemlak, R.H. Hanner & P.D.N. Hebert.
2007. Universal primer cocktails for fish DNA
barcoding. Mol. Ecol. Notes, 7: 544-548.
Jud, Z.R., P. Nichols & A. Layman. 2015. Broad salinity
tolerance in the invasive lionfish Pterois spp. may
facilitate estuarine colonization. Environ. Biol. Fish.,
98: 135-143. doi: 10.1007/s10641-014-0242-y.
Le Roux, J. & A. Wieczorek. 2009. Molecular systematics
and population genetics of biological invasions:
Luque, C., L. Legal, H. Staudter, C. Gers & M. Wink. 2002.
ISSR (Inter Simple Sequence Repeats) as genetic
markers in Noctuids (Lepidoptera). Hereditas, 136:
251-253.
Maltagliati, F., T. Lai, M. Casu, S. Valdesalici & A.
Castelli. 2006. Identification of endangered Mediterranean cyprinodontiform fish by means of DNA intersimple sequence repeats (ISSRs). Biochem. Syst. Ecol.,
34(8): 626-634.
Morris, J. & J. Akins. 2009. Feeding ecology of invasive
lionfish (Pterois volitans) in the Bahamian Archipelago. Environ. Biol. Fish., 86(3): 389-398.
Ojaveer, H., B. Galil, D. Minchin, S. Olenin, A. Amorim,
J. Canning-Clode & A. Zeneto. 2014. Ten recommendations for advancing the assessment and management
of non-indigenous species in marine ecosystems. Mar.
Policy, 44: 160-165.
Page, R. 1996. Treeview: an application to display
phylogenetic trees on personal computers. Bioinformatics, 12: 357-358.
Peakall, R. & P. Smouse. 2006. Genalex V6.501: genetic
analysis in Excel. Population genetic software for
teaching and research. Mol. Ecol. Notes, 6: 288-295.
Sakai, A., F. Allendorf, J. Holt, D. Lodge & J. Molofsky.
2001. The population biology of invasive species.
Annu. Rev. Ecol. Syst., 32: 305-332.
Schofield, P. 2009. Geographic extend and chronology of
the invasion of non-native lionfish (Pterois volitans
(Linnaeus, 1758) and P. miles (Bennett, 1828) in the
Western North Atlantic and Caribbean Sea. Aquat.
Invasions, 4(3): 473-479.
Schofield, P.J., J.A. Morris & L. Akins. 2009. Field guide
to nonindigenous marine fishes of Florida. NOAA
Technical Memorandum, NOS NCCOS 92, 120 pp.
Schultz, E.T. 1986. Pterois volitans and Pterois miles: two
valid species. Copeia, 1986(3): 686-690.
Swofford, D. 2001. PAUP: Phylogenetic analysis using
parsimony. Sinauer, Sunderland (Version 4.0b10).
Valdez-Moreno, M., C. Quintal-Lizama, R. Gómez-Lozano
& M. García-Rivas. 2012. Monitoring an alien invasion:
1018
DNA barcoding and the identification of lionfish and
their prey on coral reefs of the Mexican Caribbean.
PLoS ONE, 7(6): e36636.
Wink, M. 2006. Use of DNA markers to study bird’s
migration. J. Ornithol., 147: 234-244.
Yeh, F. & T. Boyle. 1999. Population genetic analysis of
co-dominant and dominant markers and quantitative
traits. Belg. J. Bot., 129: 157.
Received: 25 November 2014; Accepted: 21 September 2015
Zietkiewicz, E., A. Rafalski & D. Labuda.1994. Genome
fingerprinting by simple sequence repeat (SSR)anchored polymerase chain reaction amplification.
Genomics, 20(2): 176-183.
1019
Lat. Am. J. Aquat. Res., 43(5): 1019-1023,
2015 rápido para el conteo de leucocitos en trucha arcoíris
Método
1019
Short Communication
Método rápido para la cuantificación de leucocitos sanguíneos y su utilidad en la
evaluación del estado de salud en trucha arcoíris Oncorhynchus mykiss
Libertad Alzamora-Gonzales1, Carolina de Amat-Herbozo1, Erasmo Colona-Vallejos1
Elizabeth Cervantes-Aguilar2, Richard Dyer Velarde-Álvarez2
Ronald Aquino-Ortega1 & Miguel Ángel Aguilar-Luis1
1
Laboratorio de Inmunología, Instituto de Investigación de Ciencias Biológicas
Antonio Raimondi, Universidad Nacional Mayor de San Marcos
Av. Universitaria s/n, Ciudad Universitaria de San Marcos, Lima, Perú
2
Cytometric Bioservices S.A.C., Av. José Gálvez Barrenechea Nº387, San Isidro, Lima, Perú
Corresponding autor: Libertad Alzamora Gonzales ([email protected])
RESUMEN. El análisis de la proporción y cantidad de células sanguíneas es una forma muy confiable de evaluar
el estado de salud en humanos y otras especies. El objetivo fue estandarizar una metodología para la
cuantificación rápida de poblaciones de leucocitos sanguíneos de Oncorhynchus mykiss (trucha arcoíris). Se
procesaron muestras de leucocitos obtenidos de la sangre de un grupo de truchas juveniles saludables mantenidas
en el laboratorio. Las muestras fueron analizadas empleando el minicitómetro Scepter™ y los resultados fueron
contrastados con los obtenidos por citometría de flujo. Los histogramas generados por ambos métodos mostraron
un máximo correspondiente a la población de linfocitos/trombocitos y otro a la de monocitos/neutrófilos. No se
encontraron diferencias significativas entre los resultados de ambos métodos (P > 0,05). El método con el
minicitómetro se utilizó para evaluar muestras de truchas procedentes de una piscigranja, el perfil obtenido
mostró la disminución significativa de neutrófilos compatible con los signos clínicos de enfermedad observados
en los especímenes evaluados. Estos resultados indican que la metodología aplicada es válida y útil para
determinar las concentraciones y proporciones celulares en muestras de sangre en trucha arcoíris y permiten
el análisis rápido de su estado de salud.
Palabras clave: Oncorhynchus mykiss, trucha arcoíris, hemogramas en peces, leucocitos sanguíneos,
acuicultura.
Rapid method for counting of blood leukocytes and its usefulness in health
status assessment of rainbow trout (Oncorhynchus mykiss)
ABSTRACT. The analysis of the ratio and number of blood cells is a very reliable way to assess the health
status in humans and other species. The aim was to standardize a methodology for rapid quantification of blood
leukocytes in rainbow trout Oncorhynchus mykiss. Samples of blood leukocytes obtained from a group of
healthy juvenile trout maintained in the laboratory were processed. The samples were analyzed using a Scepter™
minicytometer, the results were compared with those obtained by flow cytometry. Histograms generated by both
methods showed a peak corresponding to the population of lymphocytes/thrombocytes and one of
monocyte/neutrophil. Non-significant differences were found between the results of both methods (P > 0.05).
The method employing minicytometer was used to evaluate samples of trout from a fish farm, the profile
obtained showed a significant decrease in the neutrophils consistent with clinical signs of disease observed in
the tested specimens. These results indicate that the methodology is valid and useful in determining the
concentrations and cell proportions in blood samples of rainbow trout and allow rapid analysis of its health
status.
Keywords: Oncorhynchus mykiss, rainbow trout, blood counts in fish, blood leukocytes, aquaculture.
__________________
Corresponding editor: Herman Dantagnan
1020
La trucha arcoíris Oncorhynchus mykiss es una especie
con alto grado de adaptabilidad a condiciones
artificiales de cría, lo cual ha favorecido la intensificación de su producción en varios países del mundo,
especialmente en los últimos años.
Las condiciones en que los peces se crían los
exponen a problemas de contaminación del agua y
crean una serie de limitaciones fisiológicas que
provocan estrés y brotes epizoóticos, causados por
diversos microorganismos patógenos perjudicando así
la economía de las empresas productoras. La oportuna
evaluación y monitoreo del estado de salud de los
animales es importante porque ayuda a prevenir y
controlar oportunamente estos problemas (Bueñaño,
2010), facilitado por el desarrollo de una serie de
herramientas biotecnológicas.
Las alteraciones en los parámetros hematológicos
constituyen un buen indicativo del estado de salud en
vertebrados (Blaxhall, 1972; Amend & Smith, 1975;
Clauss et al., 2008; Bueñaño, 2010). El grado y tipo de
alteración varía según la especie y agente causal. Así,
en algunas especies incluyendo la trucha arcoíris, se ha
observado que la proporción de leucocitos, linfocitos,
monocitos, trombocitos y/o neutrófilos aumenta o
disminuye según se trate de un proceso infeccioso o una
exposición a productos químicos contaminantes
(Amend & Smith, 1975; Sjöbeck et al., 1984; Gill &
Pant, 1985; Oluah & Mgbenka, 2004; Velisek et al.,
2009; Zorriehzahra et al., 2010; Li et al., 2011).
Para este tipo de estudios se puede optar por realizar
un hemograma convencional. Sin embargo, este
método puede tomar mucho tiempo, sin mencionar la
dificultad en diferenciar los diferentes tipos celulares
presentes en trucha arcoíris. Además, la citometría de
flujo ha resultado ser una técnica rápida y muy
confiable para cuantificar y caracterizar algunas
poblaciones celulares y estudiar procesos inmunopatológicos en peces (Morgan et al., 1993;
Chilmonczyk & Monge, 1999). Para trucha arcoíris, la
citometría de flujo permite diferenciar básicamente la
población de eritrocitos, linfocitos/trombocitos y
granulocitos, facilitando el monitoreo de la dinámica de
la población celular de manera rápida y confiable
(Morgan et al., 1993). No obstante, esta técnica por su
de elevado costo, es poco accesible.
El objetivo del presente trabajo fue estandarizar una
metodología para cuantificar poblaciones de leucocitos
en sangre de juveniles de trucha arcoíris utilizando el
contador celular Scepter™ 2.0 (Merck Millipore),
comparando los datos con los obtenidos por citometría
de flujo (Gold standard). Además, se evaluó su
potencial para diferenciar el estado inmunológico de
especímenes sanos y con signos clínicos de enfermedad
(oscurecimiento del cuerpo, exoftalmia, etc.).
Para la estandarización del método, se evaluó un
grupo de truchas juveniles saludables (n = 12),
procedentes de Canta (Lima, Perú), que fueron
mantenidas durante 2 meses en acuarios del
Laboratorio de Inmunología de la Facultad de Ciencias
Biológicas (Universidad Nacional Mayor de San
Marcos, Lima, Perú), para verificar su estado y
descartar una posible infección. Los especímenes se
anestesiaron empleando MS-222 (Sigma), las muestras
de sangre se extrajeron por punción cardiaca o de la
vena caudal en tubos con EDTA y se mantuvieron en
frío hasta su procesamiento dentro de las 24 h
siguientes.
Los eritrocitos de las muestras fueron eliminados
por lisis hipotónica siguiendo el método de Crippen et
al. (2001) con ligeras modificaciones. Se tomaron 200
µL de la sangre obtenida y se agregaron 200 µL de una
mezcla de solución Alsever con solución de Hank (1:1).
Se adicionaron 3,6 mL de agua destilada a 4°C y se
incubó por 30 s invirtiendo el tubo dos veces para
mezclar. Para detener la lisis se agregó 400 µL de PBS
10X. Se centrifugó a 700 g por 10 min, se retiró
cuidadosamente el sobrenadante, el pellet de leucocitos
se resuspendió en 800 µL de solución Alsever- Hank
(1:1) y se analizaron por citometría de flujo (n = 6) y
con el minicitómetro Scepter™ 2.0 (n = 6).
Para las pruebas de citometría se empleó el
citómetro de flujo BD FACS Calibur y las células se
identificaron con anticuerpos policlonales contra
leucocitos de trucha arcoíris obtenidos en ratón. Los
anticuerpos se marcaron con Fab-anti Fc de ratón
(IgG1) unido a aloficocianina (Zenon ® de Invitrogen),
se adquirió un total de 20.000 eventos por cada muestra
y los datos obtenidos se analizaron con el programa
WinList 3D 8.0. Para la cuantificación de leucocitos
empleando el Scepter™ 2.0 se siguieron las instrucciones del fabricante, la suspensión de leucocitos se
diluyó 1:10 (5x105 células mL-1 aproximadamente) y se
leyó con un sensor de 40 µm. Los histogramas
generados fueron analizados con Scepter Software Pro.
Para verificar la utilidad del método rápido descrito,
empleando Scepter™ 2.0, se procesaron muestras de
sangre de 12 truchas con signos clínicos de enfermedad
(exoftalmia, oscurecimiento del cuerpo o hinchazón
abdominal), procedentes de la Piscigranja Municipal de
Callahuanca, Provincia de Huarochirí-Departamento
de Lima, Perú (11°49’35.39”S, 76°37’7.1”W). El peso
promedio de las truchas evaluadas criadas en
laboratorio fue de 35 g y la talla media de 16 cm, estos
son juveniles de edad promedio de 4 meses. En el caso
de las truchas procedentes de la Piscigranja, el peso
medio fue de 46 g y la talla media de 20 cm, que se
extrajeron de las pozas de juveniles. Sin embargo, es
probable que el peso y talla de estos especímenes estén
Método rápido para el conteo de leucocitos en trucha arcoíris
influenciados por el mal estado de salud que mostraban
al momento de la evaluación.
Mediante la prueba t-Student se compararon los
valores porcentuales obtenidos por el método
ScepterTM 2.0 y citometría de flujo; y las concentraciones celulares que resultaron con ScepterTM 2.0
para las muestras procedentes de las truchas saludables
(n = 12) y con signos de enfermedad (n = 12).
Los gráficos de puntos Forward scatter vs Side
scatter obtenidos por citometría de flujo indican tres
poblaciones (Fig. 1a). La población más densa (71.974.0%) fue aquella de menor tamaño y granularidad
(R1), que correspondería principalmente a la población
de linfocitos y en muy baja proporción a la de
trombocitos. Las otras dos poblaciones son menos
densas (6,7-10,5 y 17.9-19.9%), de mayor tamaño y
complejidad, correspondiente a poblaciones de
monocitos y polimorfonucleares (R2 y R3 respectivamente). Los histogramas de las muestras presentan dos
máximos (Fig. 1b), de los cuales el primero y más alto
1021
corresponde a la población R1 y el segundo a una
superposición de las otras dos poblaciones (R2 y R3).
Los histogramas de muestras de truchas saludables
obtenidos por ScepterTM presentaron un patrón similar
a los de citometría de flujo (Fig. 1c). Los marcadores
de los dos máximos se describen en el Scepter software
Pro como O1 (primer máximo) y O2 (segundo
máximo). No se encontraron diferencias significativas
al comparar los porcentajes de los marcadores O1 con
el correspondiente al primer máximo de citometría de
flujo (P = 0,48) ni de los marcadores O2 con el segundo
máximo (P = 0,39) (Tabla 1). Sin embargo, los valores
obtenidos con ScepterTM presentan mayor desviación
estándar.
El método ScepterTM tiene la ventaja de
proporcionar datos de porcentaje y concentración de
células en una muestra considerando el factor de
dilución. En el análisis realizado se obtuvo un promedio
general de 23,82 ± 4,39x106 cél mL-1, que coincide con
los resultados de otros autores para trucha arcoíris
Figura 1. Muestras de leucocitos de sangre de trucha arcoíris. a) Gráfica de puntos obtenida por citometría de flujo donde
se definen las poblaciones R1 de linfocitos/trombocitos (verde), R2 de monocitos (anaranjado) y R3 de polimorfonucleares
(azul), b) histogramas de ejemplares saludables generados por citometría de flujo. Se observa un primer máximo que
representa a R1 unido a un segundo máximo correspondiente a una superposición de R2 con R3, c) histogramas de truchas
saludables generados por Scepter, que presentan el mismo perfil del histograma generado por citometría de flujo, se
muestran las regiones O1 y O2 delimitadas, d) histogramas de truchas con signos clínicos de enfermedad generados por
ScepterTM, los cuales presentan menor cantidad de células en la región O2, con respecto a los histogramas de truchas
saludables.
1022
Tabla 1. Comparación de porcentajes de leucocitos de sangre de truchas saludables utilizando Scepter TM y citometría de
flujo. PROM: promedio; DE: desviación estándar; Región O1: primer máximo del histograma para Scepter TM y citometría
de flujo; Región O2: segundo máximo del histograma para Scepter TM y citometría de flujo; N° de muestras evaluadas: 12.
Las evaluaciones por ambos métodos (Scepter y citometría de flujo) se realizaron por duplicado.
Método
ScepterTM
Citometría de flujo
Región O1
% PROM
DE
73,9
11,14
78,9
6,00
Región O2
% PROM
DE
27,3
11,54
20,9
5,85
Tabla 2. Comparación de las concentraciones de leucocitos de sangre de trucha arcoíris saludable y de truchas con signos
clínicos de enfermedad, utilizando Scepter TM. Región O1: Primer máximo del histograma para Scepter TM y citometría de
flujo. Región O2: Segundo máximo del histograma para Scepter TM y citometría de flujo. (*) P < 0,05.
Leucocitos
Truchas saludables (n = 12)
Truchas con signos de enfermedad (n = 12)
(Yasutake & Wales, 1983; Crippen et al., 2001;
Bueñaño, 2010).
Por otro lado, empleando ScepterTM se observaron
diferencias significativas (P < 0,05) entre las muestras
de sangre de truchas saludables adaptadas al laboratorio
y truchas con signos de enfermedad procedentes de la
piscigranja. En estas últimas muestras se observó
mayor porcentaje en el máximo correspondiente a
linfocitos, que alcanzó un promedio de 98,83 ± 0,39%;
mientras que en la región de los otros leucocitos, el
porcentaje bajó a un promedio de 1,37 ± 0,47%.
El empleo del ScepterTM permitió calcular la
concentración celular en las muestras de sangre de
trucha y se pudo evaluar el aumento o disminución de
células de cada región, independientemente de su
proporción. De esta manera, se pudo determinar que el
máximo correspondiente a linfocitos fue relativamente
superior (O1), sin mostrar diferencias significativas
respecto a las muestras de truchas mantenidas en
laboratorio; mientras que la diferencia entre el número
de células de la región O2 (segundo máximo) fue
significativamente inferior en las truchas con signos de
enfermedad, con disminución en la cantidad de
monocitos y neutrófilos (neutropenia) (Fig. 1d) (Tabla
2).
El método de recuento de células sanguíneas de
trucha arcoíris empleando el minicitómetro Scepter TM
2.0 (Merck Millipore) permite determinar las
concentraciones y proporciones celulares en muestras
de sangre, apostando de una imagen rápida del estado
de salud de los especímenes evaluados. Sin embargo,
para el análisis de mayor precisión es recomendable
realizar evaluaciones mediante citometría de flujo
Región O1
N° células x 106 mL-1
Región O2
N° células x 106 mL-1
17,63 ± 3,79
19,98 ± 3,06
6,19 ± 3,42
0,25 ± 0,11*
utilizando anticuerpos monoclonales, ya que lo
anticuerpos policlonales no permitieron discriminar
adecuadamente las poblaciones celulares, por esta
razón los resultados se basan en los parámetros de
citometría de flujo: Fordware scatter vs Side scatter.
Estos resultados muestran que el método utilizado
para la cuantificación de linfocitos y otros leucocitos
empleando ScepterTM es válido y útil para el análisis
rápido del estado de salud de trucha arcoíris. El método
también tiene la cualidad que no es necesario sacrificar
a los especímenes, pues no se utiliza el bazo o el riñón
anterior para determinar la cantidad de las células que
participan en la inmunidad. En cuanto a rapidez tiene
ventaja sobre la cuantificación por hemograma
convencional, la cual es muy laboriosa y requiere
mayor experiencia, emplea mayor tiempo aunque
proporciona mayores detalles. Finalmente, los
resultados indican que el método Scepter TM es
comparable a la citometría de flujo con la ventaja de ser
más económico.
AGRADECIMIENTOS
Los autores agradecen al Consejo Nacional de Ciencia,
Tecnología e Innovación Tecnológica (Proyecto
FONDECYT 393-2012-CONCYTEC-OAC) por el
financiamiento otorgado para la realización del estudio.
REFERENCIAS
Amend, D.F. & L. Smith. 1975. Pathophysiology of
infectious hematopoietic necrosis virus disease in
Método rápido para el conteo de leucocitos en trucha arcoíris
rainbow trout: hematological and blood chemical
changes in moribund fish. Infect. Immunol., 11(1):
171-179.
Blaxhall, P. 1972. The haematological assesment of the
health of freshwater fish. J. Fish Biol., 4: 593-604.
Bueñaño, M.V. 2010. Hemograma de trucha arco iris
(Oncorhynchus mykiss) en tres etapas de producción
en la cuenca alta de la provincia del Napo, Ecuador.
Bol. Téc. 9, Ser. Zool., 6: 1-14.
Chilmonczyk, S. & D. Monge. 1999. Flow cytometry as a
tool for assessment of the fish cellular immune
response to pathogens. Fish. Shellfish Immunol., 9:
319-333.
Clauss, T.M., A.D.M. Dove & J.E. Arnold. 2008.
Hematologic disorders of fish. Vet. Clin. Exot. Anim.,
11: 445-462.
Crippen, T.L., L.M. Bootland, J.C. Leong, M.S.
Fitzpatrick, C.B. Schreck & A.T. Vella. 2001.
Analysis of salmonid leukocytes purified by hypotonic
lysis of erythrocytes. J. Aquat. Anim. Health, 13: 234245.
Gill, T.S. & J.C. Pant. 1985. Mercury-induced blood
anomalies in the freshwater teleost Barbus conchonius
Ham. Water Air Soil Pollut., 24(2): 165-171.
Li, Z.H., V. Zlabek, J. Velisek, R. Grabic, J. Machova, J.
Kolarova, P. Li & T. Randak. 2011. Acute toxicity of
carbamazepine
to
juvenile
rainbow
trout
(Oncorhynchus mykiss): effects on antioxidant
responses, hematological parameters and hepatic
EROD. Ecotox. Environ. Safe., 74: 319-327.
Received: 22 August 2014; Accepted: 26 September 2015
1023
Morgan, J.A.W., T.G. Pottinger & P. Rippon. 1993.
Evaluation of flow cytometry as a method for
quantification of circulating blood cell populations in
salmonid fish. J. Fish Biol., 42(1): 131-141.
Oluah, N.S. & B.O. Mgbenka. 2004. Effect of actellic 25
EC on the differential leucocyte counts of the catfish
Clarias albopunctatus (Nichole & Lamonte, 1953).
Anim. Res. Int., 1(1): 52-56.
Sjöbeck, M.L., C. Haux, Å. Larsson & G. Lithner. 1984.
Biochemical and hematological studies on perch,
Perca fluviatilis, from the cadmium-contaminated
river Emån. Ecotox. Environ. Safe., 8(3): 303-312.
Velisek, J., Z. Svobodova & V. Piackova. 2009. Effects of
acute exposure to bifenthrin on some haematological,
biochemical and histopathological parameters of
rainbow trout (Oncorhynchus mykiss). Vet. MedCzech., 54(3): 131-137.
Yasutake, W. & J. Wales. 1983. Microscopic anatomy of
salmonids: an atlas. Fish and Wildlife Service,
Washington D.C., 207 pp.
Zorriehzahra, M.J., M.D. Hassan, M. Gholizadeh & A.A.
Saidi. 2010. Study of some hematological and
biochemical parameters of rainbow trout (Oncorhynchus mykiss) fry in western part of Mazandaran
province, Iran. J. Fish. Sci., 9(1) 185-198.
Lat. Am. J. Aquat. Res., 43(5):
1024-1029,
Epibiont
data in2015
relation with the Debilitated Turtle Syndrome in sea turtles from Chile coast
1024
1
Short Communication
Analysis of epibiont data in relation with the Debilitated Turtle Syndrome
of sea turtles in Chelonia mydas and Lepidochelys olivacea
from Concepción coast, Chile
Italo Fernández1, Marco Antonio Retamal2, Miguel Mansilla3, Francisco Yáñez1, Víctor Campos1
Carlos Smith1, Guillermo Puentes6, Ariel Valenzuela4 & Hernán González5
1
Departamento de Microbiología, Facultad de Ciencias Biológicas
2
Departamento de Oceanografía, Facultad de Ciencias Naturales y Oceanográficas
3
Facultad de Medicina Veterinaria, Universidad San Sebastián, Concepción, Chile
4
Laboratorio de Piscicultura y Patología Acuática, Facultad de Ciencias Naturales y Oceanográficas
5
Facultad de Medicina Veterinaria, Universidad Iberoamericana de Ciencias y Tecnología, Santiago, Chile
6
Facultad de Medicina Veterinaria, Universidad Santo Tomás, Concepción, Chile
Corresponding author: Italo Fernández ([email protected])
ABSTRACT. Epibionts on the surface of the skin and shell of a specimen of Chelonia mydas and three
Lepidochelys olivacea found floating on the coast of Concepción, Chile, between June 2010 and December
2012, were analyzed. These epibionts were analyzed during the clinical inspection and the tissue changes related
to its settlement, with filamentous algae around, were observed. Subsequently, the epibionts were identified by
morphological observation. The knowledge about theses epibionts in Chile is reviewed and the potential
occurrence of Debilitated Turtle Syndrome (DTS) in these turtles is discussed. The presence of sea turtles in the
Chilean coast is considered a casual event, so there is little information on this issue. We propose it is necessary
to carry out more studies on the association between turtles and epibionts because their identification, colonizing
reptiles’ surface may give relevant information to a better understanding of different diseases, including DTS,
that affect these marine reptiles and facilitates the development of strategies intended to recover their
populations.
Keywords: Lepidochelys olivacea, Chelonia mydas, sea turtles, epibionts, Concepción coast, Chile.
Análisis de los datos de epibiontes en relación con el Síndrome de Debilitamiento
de Tortugas marinas en Lepidochelys olivacea y Chelonia mydas
de la costa de Concepción, Chile
RESUMEN. Se presenta el hallazgo de epibiontes en la superficie de la piel y caparazón de un ejemplar de
Chelonia mydas y tres de Lepidochelys olivacea encontrados flotando frente a la costa de Concepción, Chile,
entre junio de 2010 y diciembre de 2012. Los epibiontes se visualizaron clínicamente y se observaron
alteraciones tisulares relativas a su asentamiento junto con algas filamentosas a su alrededor. Los epibiontes se
identificaron por observación morfológica. Se presenta una revisión respecto del conocimiento en Chile de los
organismos encontrados y se discute la potencial ocurrencia del Síndrome de Debilitamiento de Tortugas (SDT)
en los caparazones analizados. La presencia de tortugas marinas en el litoral chileno es un evento ocasional y
existe escasa información respecto de esta problemática. Se recomienda realizar estudios sobre la asociación
entre las tortugas y epibiontes porque su identificación, colonizando la superficie de estos reptiles, puede aportar
datos relevantes para una mejor comprensión de las enfermedades que afectan a las tortugas marinas, incluyendo
el SDT, y facilita el desarrollo de estrategias destinadas a recuperar sus poblaciones.
Palabras clave: Lepidochelys olivacea, Chelonia mydas, tortugas marinas, epibiontes, costa de Concepción,
Chile.
__________________
1025
2
Among the seven sea turtles species existing
worldwide, four of them have been recorded in Chilean
waters: Green turtles (Chelonia mydas Linnaeus,
1758), Loggerhead turtles (Caretta caretta, Linnaeus
1758), Leatherback turtles (Dermochelys coriacea
Vandelli, 1761) and Olive Ridley turtles (Lepidochelys
olivacea Eschcholtz, 1829). Although few turtles are
documented in northern Chile, their movements into
Chilean waters is considered passive and likely
attributable to oceanic currents, meteorological events
and atmospheric changes due to El Niño Oscillation
events (Ibarra-Vidal & Ortiz, 1990). On the other hand,
in certain seasons, when the littoral waters of central to
southern Chile are suitable, their pelagic habits may
allow them to migrate and temporarily occupy habitats
beyond their typical southernmost range in northern
Chile reaching the waters of the present study area
(Azócar et al., 2011).
Sea turtles are an appropriate substrate for the
attachment of a great variety of algae and invertebrate
larvae present in the water column. This attachment
results in associations of the commensal, opportunistic
and mutualism type with organisms such as cirripeds,
algae, bryozoans, cnidarians, polychaetes and amphipods among others (Frick & Pfaller, 2013). Because
these associations occur only when the distribution of
these species and their hosts overlap, these organisms
can be important biological markers of the movement
patterns and geographical distribution of sea turtles, as
well as indicators of host turtle activity and migration
routes (Eckert & Eckert, 1988).
From June 2010 to December 2012, one specimen
of Chelonia mydas and three of Lepidochelys olivacea
were found at four different localities along the centralsouth coast of Chile, particularly in the littoral habitats
of the Concepción coast (36°46’22’’S-37°23’52’’S).
The four turtles were collected by the National Fishery
Service of Chile and they were sent to the Veterinary
Hospital of San Sebastian University, Concepcion,
Chile. Species were identified on the basis of
morphological characteristics, as defined by Márquez
(1990), and sex, maturity status, length and weight for
each animal were also recorded (Table 1). The health
condition of each animal was determined through
clinical examinations all of which showed that the four
turtles in question were clinically unhealthy (inattentive
to surrounding stimuli, general weakness, plastron
weakness and lesions of diverse degrees, notably ocular
ulcerations and scars in the skin and carapace).
Haematology and clinical biochemistry tests were
perfomed and obtained values from the four turtles
showed alterations when compared with normal
reference values (Anderson et al., 2011; Santoro &
Meneses, 2014). Consequently, condition of the four
animals determined their hospitalization and emergency clinical procedures were applied. After a careful
external examination (carapace, plastron, flippers, skin,
head and neck, cloaca and tail) epibiotic organisms and
algae were removed using tweezers and a spatula, fixed
in 10% buffered formalin and finally placed in 70%
ethyl alcohol for further analysis. Epibionts and algae
were sent to the Laboratory of Parasitology, Faculty of
Biological Sciences, University of Concepcion,
Concepción. Chile where, using light microscopy and
bibliographic references (Hoffmann & Santelices,
1997; Young, 1999), specimens were identified to the
lowest possible taxon.
The taxonomic identification of epibionts and algae
found on the four turtles is detailed in Figure 1 and
Table 1. In the case of epibionts found on C. mydas,
they were two specimens of Chelonibia testudinaria
located on the second central scute and second lateral
scute, as two masses firmly adhered to the surface and
with abundant filamentous algae of the genus Ulva
(Case study 1). One L. olivacea turtle, whose clinical
condition was considered as the most serious, displayed
the highest density of epibiont aggregations and died
shortly after collection (Case study 3). On post-mortem
exami-nations, this turtle had emaciation and
abundance signs of secondary infections. The
remaining three turtles recovered satisfactorily and
where set free along the coast of northern Chile. The
epibionts of L. olivacea were typically represented by
masses of filamentous algae and sand. Goose barnacles
Lepas anatifera were observed from all three L.
olivacea at various locations on the skin, including both
front flippers on one animal (Case study 2), on the left
front flipper of the second (Case study 3) and on the
right back flipper of the third turtle (Case study 4).
Additionally, two L. olivacea hosted numerous
hydrozoans growing in association with the macroalgae
Ulva on several carapace scutes where sandy areas had
accrued (Case study 2 and 3). The most intensively
colonized animal also showed the presence of algae of
genera Polysiphonia and Rhodymenia (Case study 3).
In Chilean waters, the presence of epibionts in C.
mydas is recorded in only five specimens at the
northern coast, revealing the presence, on the shells, of
gastropod mollusks and crustacean belonging to the
families Talitridae, Aoridae and Gammaridae (López et
al., 2007). Although C. testudinaria has already been
reported in Chilean waters (Bettini & Ross, 2002), this
is the first report of this organism attached to a C. mydas
in Chile. C. testudinaria, an obligate commensal of
motile marine animals with a cosmopolitan distribution, is frequently found on the shell and plastron of
turtles but they also can be found on the head, flippers
and skin (Frick & Ross, 2001). Three species of cirri-
Epibiont data in relation with the Debilitated Turtle Syndrome in sea turtles from Chile coast
1026
3
Table 1. Sea turtle species, location rescue, reproductive and biometrical characteristics, epibionts and algae found of four
sea turtles from south-central Chile (2010-2012).
Case report sea turtle species
Date/Location
Reproductive and
biometrical characteristics
Adult, male
Weight: 48 Kg
Lenght:
Head: 34 cm; tail: 27 cm
Carapace: lenght:78 cm
width: 74 cm
Epibionts and algae
(number of specimens/locations)
- Chelonibia testudinaria (2/carapace)
- Ulva sp. (carapace)
Case 2
Lepidochelys olivacea
08/12/2011
Penco Beach
(36°43’0”S, 72°58’00”W)
Adult, male
Weight: 32 Kg
Lenght:
width: 70 cm
- Hydrozoa (55/carapace)
- Lepas anatifera
(10/anterior flippers) - Ulva sp. (carapace)
Case 3
05/30/2012
Tubul Beach
(37°13’44”S, 73°26’36”W)
Adult, female
Weight: 45 Kg
Lenght:
Carapace: lenght: 67 cm
width: 71 cm
- Hydrozoa (17/carapace)
- Lepas anatifera (3/left anterior flipper)
-Ulva sp., Polysiphonia sp.,Rhodymenia sp. (carapace)
Case 4
12/11/2012
Talcahuano Beach
(36°43’0”S; 73°07’00”W)
Adult, female
Weight: 35 Kg
Lenght:
width: 70 cm
- Lepas anatifera (8/right back flipper)
Case 1
Chelonia mydas
06/21/2010
Itata Beach
(36°37’0”S, 72°57’00”W)
peds and one decapod has been reported on L. olivacea
turtles captured along the central to southernmost
portions of Chile (Retamal & Hermosilla, 1969; Brito,
2007). Meanwhile, Lepas anatifera, is an opportunist
pelagic barnacle common in all oceans, including
Chilean waters (Hinojosa et al., 2006). It is frequently
observed on the carapace region and skin of turtles of
different species that spend a great deal of time at the
water’s surface –including healthy turtles. This
barnacle has been detected on the carapaces of two
specimens of L. olivacea along the central-south coast
of Chile (Miranda & Moreno, 2002). Their occurrence
on the tips of the front and rear flippers of turtles,
however, is generally indicative of limited flipper
activity by host turtles, and could indicate relatively
inactive turtles (M.G. Frick, pers. comm.). Although,
hydrozoans specimens found on L. olivacea have not
been identified, their presence associated to barnacles,
such as Lepas anatifera and algae would be frequent
due to their necessity to occupy the surface of these
animals to settle, feed and reproduce themselves. With
respect to the algae observed on the turtles examined
here, their presence on the surface of the epibiotic
barnacles we observed is not surprising as all are
common and often lead to the recruitment of other
epibiotic forms onto host turtles (Scharer, 2003). In the
present case, however, the density and size of some of
the algal species encountered herein suggests that a
potential decrease in the activity of the host turtle is
likely the responsible for the observed growth. Algae of
genera Ulva, Polysiphonia and Rhodymenia are
common in the Chilean coast (Hoffmann & Santelices,
1997).
The observation of specimens of sea turtles into the
waters of central-southern Chile is unusual and, in
accordance with our experience, it is the result of an
event implying some damage or health deterioration of
the animal. While meteorological events may be
involved, we think that the debilitated state of the
turtles of this study likely represent turtles that were
cold-stunned, then got sick, and then were passively
carried into more southerly waters. Cold-stunning symp-
41027
a
b
c
d
Figure 1. Macroscopic and microscopic features of epibionts and algae observed on sea stranded turtles at the coast south
central Chile (2010-2012). a) Chelonibia testudinaria extracted from C. mydas (2010), b) Polysiphonia sp. from L. olivacea,
100x (2012), c) two specimens of Lepas anatifera (back-lateral location; left anterior flipper of C. mydas (2012), d) Turtle’s
carapace (L. olivacea) densely colonized by epibionts and algae.
toms, such as debilitation, lethargic movement, scarce
mobility in head and flippers and feeble attempts to
dive, may be present when sea turtles are exposed to
rapidly cooling water temperatures or are exposes to
water temperatures of less than 15°C (Milton & Lutz,
2003) as it is the case of waters of central-southern
Chile (Sobarzo, 1994). Moreover, we believe that the
four turtles suffering Debilitated Turtle Syndrome
(DTS), based on the clinical features described above
and the results of haematology and clinical
biochemistry tests. Turtles exhibiting symptoms of
DTS are characteristically emaciated, anemic, hypoglycaemic, and are often covered by barnacles when they
strand (Sloan et al., 2014). Consistent with this, it was
remarkable that at least two of the four turtles (case
study 2 and 3) of this study showed low plasmatic
concentration of total protein, albumin, cholesterol and
glucose, which could be attributed to poor nutrition or
altered carbohydrate metabolism by liver damage. In
addition, the same turtles showed high levels of uric
acid and urea nitrogen, elements which are considered
as the best indicators of liver damage, because both are
end products of protein metabolism. Therefore, these
values may reflect poor nutrition, protein loss due to
diarrhea or nephropathy, chronic infection, parasitism,
immune deficiency related to their state of weakness, or
a combination of all these causes (Deem et al., 2009).
This condition (DTS) may have favoured the epibiont
colonization. The state of debilitation of turtles were
suffering DTS results in a sustained period of reduced
activity, stationary floating and decreased grooming,
which likely facilitates algae and invertebrate larvae
attachment (Day et al., 2010). Current information
indicates that debilitated turtles are immunosuppressed
or lethargic prior to barnacle colonization and that
limited mobility by the host likely facilitates rapid and
prolific colonization of barnacles (Frick & Pfaller,
2013). Likewise, the type of epibiont growth and the
effects associated reported here would represent
secondary agents in the decline in the health of these
turtles.
Epibiont data in relation with the Debilitated Turtle Syndrome in sea turtles from Chile coast
We conclude it is necessary to realize the studies on
the association between turtles and epibionts because
their identification, colonizing reptiles’ surface may
give relevant information to a better understanding of
different diseases that affect marine turtles and
facilitates the development of strategies intended to
recover their populations.
REFERENCES
Anderson, E.T., C. Harms, E.M. Stringer & W. Cluse.
2011. Evaluation of hematology and serum biochemistry of cold-stunned green sea turtles (Chelonia
mydas) in North Carolina, USA. J. Zool. Wildlife
Med., 42(2): 247-255.
Azócar, J., A. Olguín & P. Gálvez. 2011. Consultoría
Nacional: Diagnóstico sobre tortugas marinas en
Chile. CPPS-Instituto de Fomento Pesquero, Informe
Final Chile, 178 pp.
Bettini, F. & A. Ross. 2002. A checklist of the intertidal
and shallow-water sessile barnacles of the Eastern
Pacific, Alaska to Chile. In: M.E. Hendrickx (ed.)
Contributions to the study of Eastern Pacific
crustaceans. Instituto de Ciencias del Mar y
Limnología, UNAM, pp. 97-108.
Brito, J. 2007. Segundo reporte de asociación entre Planes
cyaneus (Decapoda: Grapsidae) y tortuga olivácea
Lepidochelys olivacea en la zona central de Chile.
Estado actual y perspectivas de investigación y
conservación de las tortugas marinas en las costas del
Pacífico Sur Oriental. VII Simposio sobre medio
ambiente, Antofagasta, 43 pp.
Day, R.D., J.M. Keller, C.A. Harms, A.L. Segars, W.M.
Cluse, M.H. Godfrey, A.M. Lee, M. Peden-Adams, K.
Thorvalson, M. Dodd & T. Norton. 2010. Comparison
of mercury burdens in chronically debilitated and
healthy loggerhead sea turtles (Caretta caretta). J.
Wildl. Dis., 46(1): 111-117.
Deem, S.L., T.M. Norton, M. Mitchell, A. Segars, A.R.
Alleman, C. Cray, R.H. Poppenga, M. Dodd & W.B.
Karesh. 2009. Comparison of blood values in foraging,
nesting, and stranded loggerhead turtles (Caretta
caretta) along the coast of Georgia, USA. J. Wildlife
Dis., 45(1): 41-56.
Eckert, K. L. & S. Eckert. 1988. Pre-reproductive
movements of leatherback sea turtles (Dermochelys
coriacea) nesting in the Caribbean. Copeia, 1988(2):
400-406.
Frick, M.G. & J.B. Pfaller. 2013. Sea turtle epibiosis. In:
J. Wyneken, K.J. Lohmann & J.A. Musick (eds.). The
biology of sea turtles. Vol III. CRC Press, Florida, pp.
399-426.
1028
5
Frick, M.G. & A. Ross. 2001. Will the real Chelonibia
testudinaria please come forward: an appeal. Mar.
Turtle Newslett, 94: 16-17.
Hinojosa, I., S. Boltaña, D. Lancellotti, E. Macaya, P.
Ugalde, N. Valdivia, N. Vásquez, W. Newman & M.
Thiel. 2006. Geographic distribution and description
of four pelagic barnacles along the south east Pacific
coast of Chile - a zoogeographical approximation.
Rev. Chil. Hist. Nat., 79: 13-27.
Hoffmann, A. & B. Santelices. 1997. Flora marina de
Chile central. Ediciones Universidad Católica de
Chile, Santiago, 434 pp.
Ibarra-Vidal, H. & J.C. Ortiz. 1990. Nuevos registros y
ampliación de la distribución geográfica de algunas
tortugas marinas en Chile. Bol. Soc. Biol. Concepción,
61: 149-151.
López, C., M. Marambio & J. Brito. 2007. Primer registro
de epibiontes en una población de Chelonia mydas
(Linnaeus, 1758) en la III Región de Chile. Estado
actual y perspectivas de investigación y conservación
de las tortugas marinas en costas del Pacífico Sur
Oriental. VII Simposio sobre medio ambiente,
Antofagasta, 40 pp.
Márquez, M. 1990. FAO Species Catalogue. Vol. 11: Sea
turtles of the world. An annotated and illustrated
catalogue of sea turtle species known to date. FAO
Fish. Synop., 125(11): 1-81.
Milton, S.L. & P.L. Lutz. 2003. Physiological and genetic
responses to environmental stress. In: P. Lutz, J.
Musick & J. Wyneken (eds.). The biology of sea
turtles. Vol II. CRC Press, Florida, pp. 163-197.
Miranda, L. & R. Moreno. 2002. Epibiontes de
Lepidochelys olivacea (Eschscholtz, 1829) (Reptilia:
Testudinata: Cheloniidae) en la región centro sur de
Chile. Rev. Biol. Mar. Oceanogr., 37(2): 145-146.
Retamal, M.A. & J.G. Hermosilla. 1969. Aspectos morfológicos de Conchoderma virgatum var. Chelonophilus
Leach, 1818. Bol. Soc. Biol. Concepción, 42: 237-243.
Santoro, M. & A. Meneses. 2007. Haematology and
plasma chemistry of breeding olive ridley sea turtles
(Lepidochelys olivacea). Vet. Rec., 161: 818-819.
Scharer, M.T. 2003. A survey of the epibiota of
Eretmochelys imbricata (Testudines: Cheloniidae) of
Mona Island, Puerto Rico. Rev. Biol. Trop., 51(4): 8790.
Sloan, K., J.D. Zardus & M.L. Jones. 2014. Substratum
fidelity and early growth in Chelonibia testudinaria, a
turtle barnacle especially common on debilitated
loggerhead (Caretta caretta) sea turtles. Bull. Mar.
Sci., 90(2): 581-597.
Sobarzo, M. 1994. Oceanografía física entre Punta
Nugurne (35°57'S; 72°47'W) y Punta Manuel (38°30'S;
61029
73º31'W), Chile: una revisión histórica (1936-1990).
Gayana Oceanol., 2(1): 5-17.
Received: 29 April 2014; Accepted: 6 October 2015
Young, P.S. , 1999. Subclasse Cirripedia. In: L. Buckup
& G. Bond-Buckup (eds.). Os crustáceos do Rio
Grande do Sul. Ed. Universidade/UFRGS, Porto
Alegre, pp. 24-53.

Untitled - Latin American Journal of Aquatic Research

Transcription

Similar documents

St. Therese

Diptico de la Comarca de Guadix

File

blessed virgin mary help of christians church

bâÜ _twç Éy _ÉâÜwxá V{âÜv - Our Lady of Lourdes

St. Joseph Catholic Church

Cuarteles - Portal de Turismo de Puente Genil

THE TRIDUUM - TRIDUO PASCUAL

Christ the King Roman Catholic Church, Hollywood

23-June-The-influenc..