Cancer du sein et micro-environnement tumoral: rôle de la

Université Montpellier I – UFR Médecine
Thèse présentée pour obtenir le grade de
DOCTEUR DE L’UNIVERSITE MONTPELLIER I
Discipline : Biochimie, Biologie Cellulaire et Moléculaire
Ecole doctorale : Sciences Chimiques et Biologiques pour la Santé
Cancer du sein et micro-environnement
tumoral: rôle de la protéase cathepsine D
adipocytaire et de son récepteur LRP1
Par
Olivier MASSON
Soutenue le 15 janvier 2009
JURY :
Mme Martine BIARD-PIECHACZYK, Directeur de recherche, Montpellier
Mr Frédéric BOST, Chargé de recherche, Nice
Mr Gilles LALMANACH, Professeur, Tours
Mme Emmanuelle LIAUDET-COOPMAN, Chargé de recherche, Montpellier
Examinateur
Rapporteur
Rapporteur
Directeur de thèse
1
Remerciements
Je voudrais en premier lieu m’adresser aux membres du jury : Martine BiardPiechaczyk, Gilles Lalmanach et Frédéric Bost pour les remercier d’avoir accepté de lire et
d’évaluer ce travail.
Je tiens à remercier chaleureusement le Dr Emmanuelle Liaudet-Coopman pour
m’avoir accueilli dans son laboratoire et sans qui ce travail n’aurait pu voir le jour. Merci pour
ton encadrement, ton engouement, ta disponibilité, ta joie de vivre et ta gentillesse. Grâce à
tes grandes qualités de scientifique et de pédagogue tu m’as amené à toujours plus de rigueur
et de précision dans mon travail. Tu m’as formé, appris à mener à bien un projet. Tu m’as
également offert la chance de partir 3 mois à Vancouver ; cette expérience fut très
enrichissante tant sur le plan professionnel que personnel. Je te remercie enfin de m’avoir
permis de travailler dans des conditions matérielles et humaines optimales.
Bien-sûr, je remercie l’ensemble de l’équipe. Durant ces 3 années de thèse, j’ai eu la
chance de travailler avec des personnes merveilleuses. Dès mon arrivée dans l’équipe, vous
m’avez accueilli à bras ouvert et avez tout fait pour que cette thèse se passe dans les
meilleures conditions.
Christine, tu m’as beaucoup appris en ce qui concerne la culture cellulaire et la biochimie,
mais je n’oublierai pas non plus ta gentillesse et tes talents de cuisinière (sacrée mousse au
chocolat !) ainsi que nos discutions sur les expressions en patois (à bisto de nas)!
Danielle, je te remercie pour tout ce que tu m’as appris dans le domaine de la biologie
moléculaire, mais je garderai également en mémoire tes encouragements, tes conseils toujours
plein de bons sens et nos discutions touchant à tous les sujets …
Valérie, merci d’avoir toujours prêté une oreille attentive à mes questions, de t’être intéressée
à mon travail et d’avoir agrémenté le tout d’une bonne dose d’humour.
Mélanie, je n’oublierai pas ta gentillesse, ta spontanéité et ton dynamisme.
Sophie, la « Top Top Woman », tu es arrivée depuis moins d’un an, pourtant j’ai l’impression
de te connaître depuis le début de ma thèse. Une complicité s’est rapidement installée entre
nous, et tu as su m’écouter dans les moments ou j’en avais le plus besoin. Merci pour tes
conseils avisés (sur le plan professionnel mais aussi personnel), ta sympathie, ton amitié.
Anne-Sophie, merci pour ta gentillesse et ta bonne humeur.
J’ai beaucoup appris à vos côtés, je ne vous oublierai pas, j’ai passé 3 années merveilleuses,
on ne peut pas rêver d’un meilleur environnement de travail, c’est la « dream team » !
Un grand merci à tous mes collaborateurs, pour m’avoir conseillé et fait partager leur
connaissances sur les adipocytes et sans qui cette thèse ne serait pas ce qu’elle est, et tout
particulièrement à Carine Chavey, Catherine Mueller et Philippe Valet.
Merci aussi à tous mes collègues et amis du laboratoire qui se reconnaîtront ici. Je leur
exprime ma profonde sympathie et leur souhaite beaucoup de bien. J’ai une pensée pour tous
mes collègues et amis étudiants avec qui j’ai partagé de bons moments : Cycy, Iréna, Emilie,
Marie, Stef, Didier, et le clan de la cantine, Hayat, Mayssa, Aurélie (Louloute), Elsa,
Laurence, Vincent (la cantine c’est l’école de la vie!), ainsi que Max et Samir (même si vous
en avez gros, je vous considèrerai toujours en tant que tel!).
Je tiens également à remercier les personnes qui m’ont encadré durant mes stages de
master et qui m’ont donné le goût de la recherche. Un grand merci au Dr Martine BiardPiechaczyk, pour m’avoir accueilli lors de mon Master2, ainsi qu’à toute l’équipe de la mort
cellulaire, et tout particulièrement à Lucile qui m’a soutenu et poussé à faire cette thèse au
moment où j’en avais le plus besoin et où je doutais le plus de moi.
David, mon premier encadrant (tu m’as laissé te vouvoyer pendant 2 semaines mais je ne t’en
tiens pas rigueur), tu occupes une place particulière car tu m’as permis de découvrir le monde
de la recherche et si j’en suis là aujourd’hui, c’est aussi grâce à toi. J’ai également une pensée
pour mes anciens collègues qui sont devenus par la suite des partenaires de jorki et enfin des
amis qui me sont chers, Patrick et Stephan (mon Patou et mon Poussin).
J’ai également une pensée pour tous ceux que j’ai rencontrés et qui m’ont suivi durant
toutes ces années d’études. Je pense notamment à Ben, David, Georges, Arnaud, Olivier (le
Maury, un sacré coureur de fond), Adri, Amandine, et au Sanders, une sacrée bande de
copains! Merci pour tous ces bons moments et ces soirées d’anthologies !!!!!
Enfin, je tiens à remercier ma famille (Maman, Papa, Mamie, Juju, Tatie) qui m’a
soutenu sans relâche durant toutes ces années d’études dans les bons et les mauvais moments.
Merci pour l’amour que vous me témoignez chaque jour, votre présence et pour m’avoir
toujours encouragé dans mes choix. Merci à toute la petite famille, en espérant qu’elle
s’agrandisse encore (Juju et Sophie...). Merci à vous tous pour m’avoir offert ces moments
uniques qui nous rappellent qui on est et d’où l’on vient.
3
Résumé
L’aspartyl protéase cathepsine D, surexprimée et hyper-sécrétée par les cellules
épithéliales cancéreuses mammaires est un facteur de mauvais pronostic des cancers du sein et
stimule la prolifération des cellules cancéreuses et la formation des métastases. Elle affecte
également le micro-environnement tumoral en induisant la croissance invasive des
fibroblastes. Les travaux de l’équipe ont montré que le LDL-receptor related protein 1, LRP1,
est le récepteur fibroblastique de la cathepsine D. LRP1 est fortement exprimé par les
adipocytes. Les études cliniques indiquent que l’obésité est un facteur de risque dans de
nombreux cancers, dont le cancer du sein chez la femme ménopausée.
Dans cette thèse, nous avons étudié le rôle de la cathepsine D et du LRP1 dans les adipocytes,
type cellulaire prédominant du micro-environnement tumoral mammaire. Nos résultats
indiquent une surexpression de la cathepsine D et du LRP1 dans le tissu adipeux humain et
murin obèse. De plus, l’expression de la cathepsine D est augmentée pendant la
différenciation adipocytaire. Finalement, l’extinction de l’expression de la cathepsine D et du
LRP1 inhibe l’adipogenèse indiquant leurs rôles clefs dans ce processus.
L’ensemble de ces résultats suggère que la cathepsine D et son récepteur LRP1 pourraient être
des cibles thérapeutiques potentielles dans le traitement de l’obésité.
Mots-clés
Adipocytes, cancer du sein, cathepsine D, LRP1, micro-environnement tumoral, obésité.
Laboratoire d’accueil
INSERM U896 – cathepsines, autophagie et cancer
Institut de Recherche en Cancérologie de Montpellier
208 rue des apothicaires
34298 Montpellier – France
4
Title
Breast cancer and tumoral micro-environment : Role of the cathepsin-D protease and its LRP1
receptor in adipocytes.
Summary
The aspartyl protease cathepsin D, overexpressed and hyper-secreted by epithelial
breast cancer cells is a poor prognosis factor in breast cancers and stimulates cancer cell
growth and metastasis formation. It also affects the tumor microenvironment, inducing the
fibroblasts invasive outgrowth. Our works have shown that the LDL receptor-related protein1,
LRP1, is the fibroblastic receptor for cathepsin D. LRP1 is highly expressed in adipocytes.
Clinical studies indicate that obesity is a risk factor in many cancers, including breast cancer
in postmenopausal women.
During this thesis, we studied the role of cathepsin D and LRP1 in adipocytes, which are the
prominent cell type in the tumor microenvironment of breast cancers. Our results indicate that
cathepsin D and LRP1 are overexpressed in human and mouse obese adipose tissue.
Furthermore, the expression of cathepsin D is increased during adipocyte differentiation.
Finally, the inhibition of the cathepsin D and LRP1 expression inhibits adipogenesis
indicating their key role in this process.
All these results suggest that cathepsin D and its receptor LRP1 could be potential therapeutic
targets in the treatment of obesity.
5
PUBLICATIONS INCLUSES DANS LA THESE
1. Olivier Masson, Carine Chavey, Cédric Dray, Aline Meulle, Danielle Daviaud, Didier
Quilliot, Catherine Muller, Philippe Valet, Emmanuelle Liaudet-Coopman: LRP1 receptor
controls adipogenesis and is up-regulated in human and mouse obese adipose tissue. (PLoS
One. 2009 Oct 12;4(10):e7422.)
2. Olivier Masson, Christine Prébois, Carine Chavey, Cédric Dray, Aline Meulle, Danielle
Daviaud, Didier Quilliot, Catherine Muller, Philippe Valet, Emmanuelle Liaudet-Coopman:
Cathepsin D, a key factor in breast cancer, controls adipogenesis and is up-regulated in obese
adipose tissue. (soumis pour publication)
6
Cancer du sein et micro-environnement
tumoral: rôle de la protéase cathepsine D
adipocytaire et de son récepteur LRP1
7
TABLE DES MATIERES
A. BUT DE LA THESE .......................................................................................................10
But de la thèse ............................................................................................................................. 11
B. INTRODUCTION ...........................................................................................................12
I. Le tissu adipeux ....................................................................................................................... 13
1) Généralités ........................................................................................................................................ 13
2) L’adipocyte ....................................................................................................................................... 15
a. Morphologie .................................................................................................................................. 15
b. La lipogenèse ................................................................................................................................ 16
c. La lipolyse..................................................................................................................................... 19
d. L’adipocyte : une cellule sécrétrice ................................................................................................ 22
3) L’adipogenèse ................................................................................................................................... 24
a. Les différentes étapes .................................................................................................................... 24
b. Les facteurs de transcription .......................................................................................................... 26
c. Rôle des protéases dans l’adipogenèse ........................................................................................... 28
4) Obésité, micro-environnement et cancer ............................................................................................. 30
a. Le micro-environnement ................................................................................................................ 30
b. Obésité et cancer ........................................................................................................................... 32
II. La cathepsine-D ..................................................................................................................... 34
1) Synthèse, maturation et adressage lysosomal de la cath-D .................................................................. 34
a. Régulation de la transcription de la cath-D ..................................................................................... 34
b. Structure et maturation protéolytique de la cath-D .......................................................................... 35
c. Adressage lysosomal ..................................................................................................................... 37
2) Fonctions de la cath-D ....................................................................................................................... 40
a. Dans la physiologie ....................................................................................................................... 40
b. Dans les pathologies ...................................................................................................................... 42
3) Rôle de la cath-D dans le cancer du sein ............................................................................................. 42
a. Expression dans les lignées de cancer du sein ................................................................................. 42
b. Facteur pronostic ........................................................................................................................... 43
c. Rôles et mécanismes d’action dans le cancer .................................................................................. 44
4) Substrats et partenaires ...................................................................................................................... 48
a. Les substrats et partenaires de la cath-D ......................................................................................... 48
b. Identification de nouveaux substrats de la cath-D ........................................................................... 48
III. Le récepteur LRP1 ............................................................................................................... 54
1) Organisation structurale ..................................................................................................................... 54
2) Trafic intra-cellulaire ......................................................................................................................... 56
3) Mécanismes d’action ......................................................................................................................... 56
a. La phosphorylation ........................................................................................................................ 56
b. Le RIP .......................................................................................................................................... 57
4) Fonctions........................................................................................................................................... 58
8
C. PRESENTATION DU TRAVAIL DE THESE ...............................................................61
I. Etude du rôle de la cathepsine D dans les adipocytes............................................................. 62
1) Introduction : ..................................................................................................................................... 62
2) Article 1: ........................................................................................................................................... 63
II. Etude du rôle du LRP1 dans les adipocytes .......................................................................... 64
1) Introduction : ..................................................................................................................................... 64
2) Article 2: ........................................................................................................................................... 66
D. CONCLUSION ET PERSPECTIVES ............................................................................67
CONCLUSION ........................................................................................................................... 68
PERSPECTIVES ........................................................................................................................ 70
E. REFERENCES ...............................................................................................................75
F. ANNEXE.........................................................................................................................98
Article 3: ............................................................................................................................................... 99
9
A. BUT DE LA THESE
10
But de la thèse
La cathepsine-D (cath-D) est une aspartyl protéase lysosomale surexprimée et hypersécrétée
par un grand nombre de carcinomes (sein, ovaire, prostate, endomètre, colon, squameux).
C’est un marqueur de mauvais pronostic des cancers du sein associé à un risque augmenté de
récidive. Nos travaux indiquent que la cath-D surexprimée par les cellules cancéreuses
mammaires agit à différentes étapes de la progression tumorale métastatique. Elle stimule de
façon autocrine la prolifération des cellules cancéreuses et la formation des métastases. De
plus, elle joue un rôle déterminant dans le micro-environnement tumoral puisqu’elle agit de
façon paracrine en stimulant la croissance invasive des fibroblastes. Des travaux récents
réalisés dans le laboratoire ont montré que la cath-D interagit avec le domaine extracellulaire
de la chaîne b du récepteur LRP1 (LDL receptor related protein1). De façon intéressante,
LRP1 est fortement exprimé par les adipocytes, un des types cellulaires prédominant du
micro-environnement tumoral dans le cancer du sein. De plus LRP1 est un récepteur
d’endocytose appartenant à la famille des LDL-récepteurs. Cette interaction est responsable
de l’effet mitogène de la cath-D sur la croissance invasive des fibroblastes. Des travaux
récents indiquent des rôles fondamentaux des cystéines cathepsines dans la biologie de
l’adipocyte. Par ailleurs, les enquêtes épidémiologiques révèlent que l’obésité est un facteur
de mauvais pronostic dans de nombreux cancers dont le cancer du sein chez la femme
ménopausée. De nombreuses études suggèrent que les adipocytes, via leur capacité à sécréter
des facteurs de croissance, de nombreuses cytokines et/ou des composés de la matrice extracellulaire, favorisent la progression tumorale mammaire et pourraient jouer un rôle
déterminant dans les étapes précoces de la carcinogénèse mammaire.
Le but de ce travail de thèse a été d’étudier le rôle de la cath-D et de son récepteur LRP1 dans
la biologie de l’adipocyte, avec un aspect orienté vers l’obésité vu le rôle clef de la cath-D
dans le cancer et le lien entre obésité et cancer.
11
B. INTRODUCTION
12
I. Le tissu adipeux
1) Généralités
Le tissu adipeux dérive embryologiquement des cellules souches mésenchymateuses.
Ces cellules souches sont pluripotentes et possèdent la capacité de se différencier en
adipocyte, en myocyte, en osteocyte, et en chondrocyte (Figure 1) (Markert et al., 2009; Park
et al., 2008).
MSC
(Mesenchymal Stem Cell)
White adipocyte
precursor
White adipocyte
Brown adipocyte/muscle
precursor
Brown adipocyte
Myocyte
Osteoblast
Osteocyte
Chondroblast
Chondrocyte
Figure 1 : Origine du tissu adipeux (Adapté de Park et al., 2008)
Les cellules souches mésenchymateuses sont pluripotentes et possèdent la capacité de se différencier
en différents types cellulaires. Sous l’influence de différents facteurs de transcription (PPARγ, Myo D,
Run X2, …), ces cellules se différencieront en adipocyte blanc ou brun, en myocyte, en ostéocyte, ou
en chondrocyte.
On distingue généralement 2 types de tissu adipeux qui diffèrent de par leur fonction et leur
localisation (Figure 1). On retrouve ainsi :
1)-le tissu adipeux blanc, qui est un organe de réserve énergétique. Lorsque les apports
énergétiques sont supérieurs aux dépenses de l’organisme, ce tissu permet le stockage de
l’excès calorique sous forme de triglycérides (également appelés triacylglycérols) par le
13
processus de lipogenèse (Figure 2). A l’inverse, lorsque les apports caloriques sont
insuffisants, l’organisme mobilise ces triglycérides libérant ainsi des acides gras, c’est la
lipolyse. Ces derniers sont alors relargués dans la circulation pour être acheminés vers les
tissus consommateurs en énergie (muscles, cœur) afin d’être oxydés dans les mitochondries
via le processus de boxydation des acides gras.
ESTERIFICATION
Glycérol
+
3 acides gras
Triglycéride + 3 H2O
Figure 2 : Schéma de la formation d’un triglycéride
Durant la formation d’un triglycéride, les trois fonctions alcools portées par le glycérol s’estérifient
avec la fonction acide de trois acides gras. Cette réaction conduit à la formation d’un triglycéride et à
la libération de trois molécules d’H20.
Le tissu adipeux blanc joue également un rôle majeur au niveau de l’organisme puisqu’il
sécrète différents facteurs (hormones) impliqués dans de nombreux processus physiologiques
comme la régulation de l’appétit, la réponse inflammatoire, l’angiogenèse (Lefterova and
Lazar, 2009).
Chez l’homme, il est essentiellement situé sous la peau (graisse sous-cutanée) et dans la cavité
abdominale (graisse abdominale) et dans certains organes tels la prostate et le sein.
2)-le tissu adipeux brun, qui contrôle le processus de thermorégulation.
Ce tissu contient moins de lipides que le tissu adipeux blanc. Cependant les adipocytes bruns
sont riches en mitochondries qui possèdent un pigment respiratoire de couleur brune qui
confère sa couleur au tissu. Ces dernières expriment la protéine UCP1 (Uncoupling protein1), un transporteur situé dans la membrane interne mitochondriale, qui leur permet de
produire de la chaleur au lieu de fournir uniquement de l’énergie sous forme d’ATP
14
(Adenosine triphosphate). Cette protéine UCP1 permet l’entrée des protons dans la matrice
mitochondriale et dissipe le gradient de protons généré par la chaîne respiratoire. L'énergie
libérée par ce découplage entre la respiration cellulaire et la phosphorylation de l'ATP est
dissipée sous forme de chaleur. Ce tissu est important chez le nouveau né car il permet de
résister au choc thermique dû à la naissance. Chez l’adulte il est très faiblement présent et se
situe autour de certains organes comme les reins, le cœur ou encore le creux de l’aisselle.
2) L’adipocyte
a. Morphologie
Les adipocytes du tissu adipeux blanc sont des cellules sphériques, d'un diamètre de
100 micromètres voire plus. On retrouve à l’intérieur de ces cellules une volumineuse vacuole
lipidique unique composée de triglycérides (Schaefer et al., 1983), repoussant à la périphérie
de la cellule le noyau, le cytoplasme ainsi que certains organites cellulaires (appareil de Golgi,
réticulum endoplasmique granulaire, réticulum endoplasmique lisse, mitochondries) (Figure
3). Les adipocytes présentent une seule grande goutte lipidique et de ce fait le tissu adipeux
blanc est aussi appelé uniloculaire à l’inverse du tissu adipeux brun qui est multiloculaire.
Vacuole
lipidique
noyau
mitochondrie
Figure 3 : Schéma de microscopie électronique représentant un adipocyte blanc
(D’après Histologie, les tissus, Poirier et al., Masson 2006)
Les adipocytes blancs possèdent une volumineuse et unique vacuole lipidique qui occupe la majeure
partie du cytoplasme, repoussant à la périphérie de ces cellules le noyau ainsi que les organites
cellulaires.
15
Le tissu adipeux blanc est organisé en lobules délimités par des septa de tissu conjonctif lâche
richement vascularisés et innervés. Dans chaque lobule, les adipocytes sont serrés les uns aux
autres et ils présentent une forme polygonale (Figure 4).
Figure 4 : Coupe histologique de tissu adipeux blanc
Le tissu adipeux blanc est divisé en lobules par de fines cloisons de tissu conjonctif fibreux lâche. Ces
lobules qui contiennent les adipocytes sont richement innervés et vascularisés. Dans le tissu adipeux
blanc, les adipocytes, tassés les uns contre les autres, prennent une forme polyédrique.
b. La lipogenèse
La lipogenèse correspond à l’ensemble des voies métaboliques conduisant à la
formation des triglycérides dans les adipocytes (Figure 7). En effet, les adipocytes accumulent
l’essentiel des graisses sous forme de triglycérides (Arner, 2005; Barbaras et al., 1985). Ces
triglycérides sont constitués de trois molécules d’acides gras reliées à un glycérol par des
liaisons esters (Figure 2). Ils constituent une forme de mise en réserve hautement concentrée
en énergie. En effet, lors de la lipolyse, le rendement de l’oxydation complète des acides gras
est d’environ 9 kcal/g, par comparaison au 4 kcal/g environ des glucides et des protéines.
Les acides gras proviennent majoritairement de la circulation via les apports alimentaires, et
dans une faible proportion de la synthèse de novo des acides gras (Figure 5).
16
A
B
1
2
4
3
Figure 5 : Schéma représentant la synthèse de novo des acides gras
La synthèse des acides gras commence par la carboxylation de l’acétyl-CoA en malonyl-CoA grâce à
l’acetyl coenzymeA carboxylase1. Cette réaction irréversible est l’étape qui engage la synthèse des
acides gras. La chaîne des acides gras en croissance est allongée par addition séquentielle d’unités à
2 carbones. Chez les eucaryotes, un seul complexe multifonctionnel cytosolique catalyse toutes les
réactions de synthèse de l’acide gras, c’est le complexe de l’acide gras synthase (fatty acid synthase
FAS). L’acide gras est allongé par une séquence récurrente de 4 réaction : 1) Condensation ; 2)
Réduction par le NADPH ; 3) Déshydratation ; 4) Réduction par le NADPH. Le deuxième cycle et les
suivants permettent l’allongement de la chaîne par la condensation avec une nouvelle molécule de
malonyl-CoA. Les réactions d’allongement sont terminées quand la chaîne est composée de seize
carbones (palmitate).
17
Cette synthèse de novo a lieu dans les adipocytes et dans les hépatocytes, mais reste
cependant à un niveau très faible (Large et al., 2004; Sjostrom, 1972). La contribution des
adipocytes à la néosynthèse des acides gras est moins bien définie chez l’homme que chez la
souris (Large et al., 2004). Cependant les enzymes clés dans la synthèse des acides gras, la
fatty acid synthase et l’acetyl coenzyme A carboxylase 1 sont exprimés dans le tissu adipeux
humain (Angel and Bray, 1979; Letexier et al., 2003; Shrago et al., 1971; Shrago et al., 1969).
La principale source d’acides gras provient du plasma soit à partir des acides gras non
estérifiés liés à l’albumine plasmatique, soit à partir d’acides gras estérifiés incorporés dans
les lipoprotéines riches en triglycérides (principalement les chilomicrons et les VLDLs (Very
Low Density Lipoproteins)) durant la période qui suit la prise alimentaire (Large et al., 2004)
(Figure 7). Ces lipoprotéines riches en triglycérides vont interagir avec des récepteurs de la
famille des LDLs, principalement le récepteur aux VLDLs qui est exprimé au niveau du tissu
adipeux et qui lie les lipoprotéines riches en Apolipoprotéine E tels que les VLDL et les
chylomicrons. Les acides gras sont relargués à partir des triglycérides présents dans ces
lipoprotéines. C’est la lipoprotéine lipase qui hydrolyse ces triglycérides (Mead et al., 2002).
Son expression ainsi que son activité sont augmentées après la prise alimentaire. Cette
enzyme travaille de concert avec le récepteur aux VLDLs. Des études chez des souris
déficientes en récepteur aux VLDLs présentent une masse graisseuse réduite, ainsi qu’une
résistance à l’obésité, soulignant son rôle au niveau de la lipogenèse (Goudriaan et al., 2001).
Le glycérol-3P (Glycérol-3Phosphate) qui s’estérifie avec les acides gras libres pour former
les triglycérides provient soit de la glycérogenèse (à partir de substrat tel le pyruvate), soit du
glucose après la première étape de la glycolyse (Reshef et al., 2003). Le glucose rentre dans
les adipocytes grâce aux transporteurs de glucose situés au niveau de la membrane plasmique,
Glut1 et Glut4 (Figure 7).
La principale hormone régulant la lipogenèse est l’insuline. Elle permet d’augmenter l’entrée
de glucose dans l’adipocyte par le recrutement de transporteur de glucose (Glut4) au niveau
de la membrane plasmique (Bryant et al., 2002; Saltiel and Kahn, 2001). Elle inhibe
également la lipolyse en stimulant la phosphodiesterase 3B (PDE3B) responsable de
l’hydrolyse de l’AMPc (Adenosine MonoPhosphate cyclique) (Fukao et al., 2004; Langin,
2006b). L’insuline peut également inhiber la lipolyse en activant la protéine phosphatase-1
(PP1), qui déphosphoryle la lipase hormono-sensible (HSL Hormone-Sensitive Lipase), une
protéine qui joue un rôle clé dans la lipolyse, la rendant ainsi inactive (voir chapitre sur la
lipolyse).
18
c. La lipolyse
La lipolyse est le processus inverse de la lipogenèse. Elle a lieu principalement lors
des périodes de jeûne. Elle est régulée par les hormones telles les catécholamines et le
glucagon (Large and Arner, 1998) (Figure 7). En période de jeûne, ce sont principalement les
catécholamines qui sont responsables de la stimulation de la lipolyse (Langin, 2006a). Ces
hormones atteignent les adipocytes via la circulation comme l’adrenaline (epinephrine) ou via
l’innervation sympathique comme la noradrénaline (norepinephrine). Leur effet lipolytique
est médié par les récepteurs β adrénergiques. Ces récepteurs sont couplés aux protéines G et
leur activation par les catécholamines engendre une augmentation de l’activité adenylate
cyclase. Cette stimulation de l’adenylate cyclase entraine une augmentation de la
concentration d’AMPc intracellulaire, conduisant à l’activation de la PKA (Protéine Kinase
A) dépendant de l’AMPc. La PKA phosphoryle alors la périlipine, une protéine associée à la
gouttelette lipidique essentielle pour la régulation de la lipolyse, ainsi que la lipase
hormonosensible (HSL) qui se retrouve également activée et hydrolyse les triglycérides. Les
triglycérides sont alors hydrolysés en acides gras et glycérol (Bjorntorp and Ostman, 1971)
puis ces derniers sont relargués dans la circulation et transportés vers d’autres tissus,
principalement vers le foie pour le glycérol et vers les muscles et le cœur pour les acides gras
(Frayn et al., 2003) où ils seront dégradés dans les mitochondries via le processus de β
oxydation des acides gras afin de fournir de l’énergie sous forme d’ATP (Figure 6).
En conclusion, une fine régulation de la lipogenèse et de la lipolyse est déterminante pour la
maintenance de l’homéostasie énergétique.
19
A
B
Figure 6 : Schéma de la β oxydation des acides gras
Les acides gras sont dégradés par oxydation au niveau du carbone β (β oxydation).
(A) La première étape est l’activation des acides gras par liaison avec le Coenzyme A.
L’activation est effectuée dans la membrane mitochondriale externe, la dégradation (oxydation) dans
la matrice mitochondriale.
(B)Un acyl-CoA saturé est dégradé par une séquence récurrente de 4 réactions:
1) Oxydation par le FAD; 2) Hydratation; 3) Oxydation par le NAD+; 4) Thiolyse par le CoA.
20
glycolysis
PDE3B
PP1
Figure 7 : Lipogenèse et lipolyse (Adapté de Vazquez-Vela et al. 2008)
Ce schéma représente les différentes voies conduisant à la lipogenèse et à la lipolyse dans les
adipocytes. L’excès de glucose est oxydé par la glycolyse en acetyl-CoA dans l’adipocyte, puis
converti en acide gras pour être estérifié dans le réticulum endoplasmique en triglycéride (TG). Ces
triglycérides sont ensuite dirigés dans la gouttelette lipidique. Les acides gras captés à partir des
lipoprotéines sont également estérifiés en TG et stockés dans la gouttelette lipidique. En condition de
jeûne, la lipolyse est activée par des récepteurs couplés aux protéines G, ce qui entraîne une
augmentation du taux d’AMPc, conduisant à l’activation de la Protéine Kinase A (PKA). Cette PKA
phosphoryle la périlipine située dans la membrane de la gouttelette lipidique, et également l’Hormone
Sensitive Lipase (HSL), permettant son activation et son transfert à l’intérieur de la gouttelette
lipidique où elle hydrolysera les diglycérides (DG) (produits par l’adipocyte triglyceride lipase
(ATGL)) en monoglycérides (MG). Ces MG seront hydrolysés en acide gras et glycérol à l’extérieur
de la gouttelette lipidique avant d’être relargués dans la circulation et acheminés vers les tissus
consommateurs en énergie comme le foie, les muscles, le cœur.
21
d. L’adipocyte : une cellule sécrétrice
Les adipocytes ont longtemps été considérés comme des cellules de réserve
énergétique relativement inertes. Cependant, les adipocytes sécrètent de multiples facteurs
appelés adipokines. Parmi ces adipokines, on retrouve des hormones, des cytokines, et
d’autres protéines ayant des fonctions biologiques spécifiques (Ahima, 2006; Vazquez-Vela et
al., 2008) (voir tableau1).
Tableau 1 : Facteurs produits par le tissu adipeux blanc
(D’après Ahima RS, 2006)
Parmi les adipokines les mieux caractérisées, nous retrouvons la leptine, l’adiponectine,
l’angiotensinogène. Certaines de ces protéines ont des effets bénéfiques (leptine et
adiponectine) ou délétères (angiotensinogène) pour l’organisme.
La première adipokine à avoir été caractérisée est la leptine par l’équipe de Friedman et al. en
1994 (Zhang et al., 1994). Cette protéine principalement sécrétée par les adipocytes, agit au
niveau de l’hypothalamus et module le poids corporel, la prise alimentaire, ainsi que le
22
stockage des graisses (Wozniak et al., 2009). La fonction de la leptine a été déterminée par
des études sur des souris obèses ayant des dommages au niveau de l’hypothalamus. Ces
travaux ont permis de montrer que la leptine contrôle la croissance du tissu adipeux via son
action au niveau du système nerveux central (Maffei et al., 1995). De plus, l’administration
locale de leptine au niveau des régions hypothalamiques réduit la prise alimentaire et le poids
corporel chez les animaux (Campfield et al., 1995; Vazquez-Vela et al., 2008). Cependant, les
hauts niveaux de leptine retrouvés chez les patients obèses n’affectent pas la suppression de
l’appétit à cause de la résistance de l’hormone dûe à une absence de signalisation du récepteur
à la leptine ou un défaut de transport de la leptine au niveau de la barrière hématoencéphalique (Flier, 2004). En plus de son rôle majeur dans le métabolisme, elle joue un rôle
dans d’autres processus physiologiques comme l’immunité, ou la fertilité (Huang and Li,
2000).
Une autre adipokine bien caractérisée est l’adiponectine. C’est une protéine de 30 kDa
sécrétée par le tissu adipeux qui a été identifiée en 1995 (Scherer et al., 1995). Son expression
et celle de ses récepteurs sont fortement diminuées chez la souris obèse, et son taux
plasmatique est inversement corrélé à la résistance à l’insuline et au syndrôme métabolique
(Yatagai et al., 2003). L’adiponectine augmente la sensibilité à l’insuline, diminue l’influx
d’acides gras non estérifiés, et augmente l’oxydation des acides gras par le foie et les muscles.
De nombreuses études ont également souligné son rôle protecteur dans l’athérosclérose
(Antoniades et al., 2009; Han et al., 2009b; Kim et al., 2008).
Les adipocytes du tissu adipeux blanc représentent une source extra-hépatique majeure
d’angiotensinogène (AGT) (Ailhaud, 2006). L’hypertension est connue comme étant une
complication fréquente liée à l’obésité. Bien que les mécanismes par lesquels l’excès de
graisse entraîne cette hypertension soient mal connus, l’augmentation de la production d’AGT
pourrait contribuer à l’élévation de la pression artérielle chez les patients obèses. De plus, des
études menées chez des souris déficientes en AGT ont montré que sa ré-expression dans le
tissu adipeux induit la présence d’AGT dans le sang et la restauration d’une pression sanguine
normale (Massiera et al., 2001).
23
3) L’adipogenèse
a. Les différentes étapes
L’adipogenèse correspond à la formation d’un adipocyte mature à partir d’une cellule
précurseur, l’adipoblaste (Vazquez-Vela et al., 2008) (Figure 8).
Tout d’abord, les adipoblastes, qui présentent un morphotype fibroblastique, prolifèrent
jusqu’à atteindre un stade de confluence marqué par un arrêt de la multiplication cellulaire
(Avram et al., 2007; Reichert and Eick, 1999). Cette interruption de croissance est nécessaire
pour l’engagement vers la différenciation adipocytaire des cellules qui deviennent alors des
préadipocytes. Les cellules sont alors engagées (commises) dans le processus de
différenciation qui peut être divisé en évènements précoces et tardifs (Figure 8). Parmi les
évènements précoces, une phase d’expansion clonale, qui se caractérise par plusieurs mitoses
successives fait suite à cette phase d’arrêt. Ce retour dans le cycle cellulaire est indispensable
puisque des inhibiteurs du cycle cellulaire (Tang et al., 2003) ou des inhibiteurs de la synthèse
de l’ADN bloquent le processus adipogenique (Richon et al., 1997). On assiste également
lors de cette phase précoce à des remodelages de la matrice extracellulaire (Gregoire et al.,
1998; Kubo et al., 2000), ainsi que du cytosquelette ce qui se traduit par une diminution
importante de l’expression d’actine, tubuline, vimentine, entraînant le changement
morphologique de la cellule (Smas and Sul, 1995; Spiegelman and Farmer, 1982). Lors de
cette phase, on observe également l’expression de marqueurs précoces, tel que PPARγ
(peroxisome proliferator-activated receptor gamma). Durant la phase terminale de la
différenciation, l’expression des enzymes impliquées dans le métabolisme du glucose et des
lipides augmente très fortement (de 10 à 100 fois) (Avram et al., 2007; Gregoire et al., 1998).
De plus, les cellules acquièrent la sensibilité à l’insuline (avec une augmentation des
transporteurs du glucose et du nombre des récepteurs à l’insuline) et accumulent des
triglycérides. Les cellules différenciées expriment aussi des marqueurs spécifiques du tissu
adipeux tel que la protéine aP2 (qui est un transporteur des acides gras), ou la périlipine.
Enfin, les adipocytes produisent et sécrètent de nombreuses protéines qui leur sont spécifiques
comme la leptine, l’angiotensinogène, l’adipsine, conférant à ce tissus sa fonction endocrine
(Avram et al., 2007) (Figure 8).
24
Type cellulaire
Etape
Cellule souche
mésenchymateuse
Détermination
Adipoblaste
Remodelage de la MEC et
du cytosquelette
Arrêt de croissance
Préadipocyte
C/EBPβ, -δ
Précoce
Expansion clonale
PPARγ
C/EBPα
Gènes
adipocytaires
Différenciation
Enzymes lipogéniques
Tardif
Enzymes lipolytiques
Facteurs sécrétés
Adipocyte
mature
Figure 8 : Schéma représentant les différentes étapes de l’adipogenèse
Les cellules souches mésenchymateuses, sous l’influence de certains facteurs s’engagent dans le
processus adipogénique et deveniennent des adipoblastes. Ces cellules
vont proliférer jusqu’à
atteindre un état de confluence, marqué par un arrêt de croissance cellulaire. Les cellules vont alors
devenir des préadipocytes. Cette étape est suivie d’une expansion clonale qui se traduit par plusieurs
mitoses successives. Au cours du processus adipogenique, les cellules vont également changer de
morphologie grâce à une réorganisation des protéines du cytosquelette ainsi que de la matrice extracellulaire. Enfin les cellules entrent dans le processus de différenciation terminal et expriment les
enzymes nécessaires à la lipogenèse et à la lipolyse et acquièrent la capacité à synthétiser et sécréter
les adipokines.
25
b. Les facteurs de transcription
La différenciation des préadipocytes en adipocytes est régulée par différents facteurs
de transcription qui vont engendrer l’expression coordonnée de centaines de protéines qui
permettront l’engagement et le maintien du phénotype terminal des adipocytes (Farmer, 2006)
(Figure 8). Cette reprogrammation génétique complexe est contrôlée par des hormones, des
cytokines, des nutriments, des molécules de signalisation qui vont changer le niveau
d’expression ou l’activité de facteurs de transcription qui en retour réguleront le processus de
différenciation des adipocytes. Parmi les principaux facteurs de transcription régulant
l’adipogenèse, on retrouve notamment PPARγ (peroxisome proliferator-activated receptor
gamma), et des membres de la famille des C/EBPs (CCAAT/enhancer-binding proteins)
(Figure 9).
PPARγ appartient à la superfamille des récepteurs hormonaux nucléaires ; il est exprimé dans
de nombreux tissus et joue un rôle majeur dans la différenciation adipocytaire. Il existe 2
isoformes de PPARγ (PPARγ1, PPARγ2,). PPARγ1 est exprimé dans de nombreux types
cellulaires à des niveaux assez faibles, alors que PPARγ2 est principalement exprimé dans les
adipocytes à des taux élevés (Feve, 2005). PPARγ s’hétérodimérise avec le récepteur RXR
(Retinoid X Receptor) et lie l’ADN au niveau de séquences consensus composées d’une seule
répétition de l’hexamère AGGTCA séparée par un nucléotide. Cette séquence consensus est
appelée élément de réponse à PPARγ (PPARγ reponsive element). Récemment, les bases
moléculaires de la liaison de l’hétérodimère à cette séquence consensus ont été élucidées
grâce à des études cristallographiques (Chandra et al., 2008). Bien que la nature précise des
ligands endogènes de PPARγ ne soit pas encore bien établie, il a été décrit que certains acides
gras ainsi que leurs métabolites, telle la prostaglandine D2 qui dérive du métabolisme de
l’acide arachidonique (Forman et al., 1995; Kliewer et al., 1995) sont capables d’activer
PPARγ (Tsai and Maeda, 2005). La plupart des gènes cibles de PPARγ sont impliqués dans le
métabolisme des lipides et du glucose.
De façon intéressante, des études ont démontré que l’expression de PPARγ est nécessaire et
suffisante au déclenchement du processus adipogénique. En effet, l’expression ectopique de
PPARγ dans les fibroblastes (Tontonoz et al., 1994; Tontonoz et al., 1995) ou les myoblastes
(Hu et al., 1995) induit l’adipogenèse. L’importance de PPARγ dans le développement du
tissu adipeux a également été démontrée grâce aux modèles murins. L’absence de cette
protéine chez la souris s’avère létal au stade embryonnaire. Cependant, une délétion de
PPARγ au niveau du tissu adipeux inhibe le développement du tissu adipeux ainsi qu’un
stockage ectopique des graisses au niveau du foie (hépatostéatose) (Jones et al., 2005). Il a
26
également été décrit dans des modèles de souris déficientes en PPARγ2 que PPARγ1 peut
compenser cette absence et permettre le développement du tissu adipeux bien que
l’adipogenèse ex-vivo de MEFs ou de pré-adipocytes déficients en PPARγ2 soit fortement
diminuée (Medina-Gomez et al., 2005; Zhang et al., 2004b). Enfin, PPARγ est également
nécessaire à la survie des adipocytes matures puisque son extinction conduit à la mort
cellulaire (Imai et al., 2004). A l’heure actuelle, aucun facteur pouvant permettre
l’adipogenèse en absence de PPARγ n’a été décrit soulignant son rôle capital dans ce
processus (Lefterova et al., 2008).
L’autre grande famille des facteurs de transcription impliqués dans l’adipogenèse est la
famille des C/EBPs, avec notamment C/EBPα, β, δ. C/EBPβ et δ sont les premiers à être
exprimés au cours de l’adipogenèse et induisent en retour l’expression de PPARγ et de
C/EBPα (Figure 9).
C/EBPResponse
Element
PPARγ
Response
Element
C/EBPResponse
Element
PPARγ
Response
Element
Figure 9 : Modèle de l’action transcriptionelle des facteurs de transcription
PPARγ et C/EBP (Adapté de Lefterova et al., 2009)
Durant les étapes précoces de l’adipogenèse, C/EBPβ et δ activent l’expression de PPARγ, C/EBPα et
d’autres gènes adipogéniques en se fixant sur leur élément de réponse (C/EBP Response Element).
Les gènes caractéristiques des adipocytes matures sont quant à eux régulés par PPARγ (après son
hétérodimérisation avec RXR) et par C/EBP-α.
La surexpression des facteurs C/EBPβ et δ dans les préadipocytes augmente la différenciation
adipocytaire. Par contre, des MEFs déficientes en C/EBPβ, ou C/EBPδ présentent un niveau
de différenciation diminué par rapport aux souris sauvages (Feve, 2005). Ils sont aussi
responsables de l’arrêt du cycle cellulaire via la surexpression de p21 (un inhibiteur des CDKs
(Cyclin Dependant Kinase) générant une diminution de la phosphorylation de la protéine du
rétinoblastome (protéine Rb). Cette hypo-phosphorylation de la protéine Rb stimule l’arrêt du
cycle cellulaire.
27
L’expression de C/EBPα est quant à elle plus tardive et survient après l’expression de PPARγ
(Figure 9). C/EBPα est fortement exprimé dans les adipocytes matures où il joue un rôle
crucial dans la prise de glucose dépendant de l’insuline (Wu et al., 1999). Il a été décrit que
des MEFs déficientes en C/EBPα sont incapables de se différencier en adipocyte, mais que ce
défaut est compensé en sur-exprimant PPARγ2 (Wu et al., 1999). En revanche, la
surexpression de C/EBPα dans des MEFs déficientes en PPARγ ne permet pas de rétablir le
processus adipogénique (Rosen et al., 2002). L’ensemble de ces travaux montre que PPARγ2
est le régulateur clé de l’adipogenèse et que C/EBPα permet de maintenir le taux élevé de
PPARγ2.
En conclusion, il est important de souligner que PPARγ et les C/EBPs sont les facteurs de
transcription essentiels à la différenciation adipocytaire et qu’ils agissent de concert afin de
générer l’adipocyte mature (Feve, 2005). Le mécanisme moléculaire précis par lequel ils
coopèrent reste encore à être élucidé (Lefterova and Lazar, 2009).
c. Rôle des protéases dans l’adipogenèse
Des travaux réalisés au cours des 10 dernières années montrent l’implication de
certaines protéases dans le processus adipogénique. Leur action se ferait en grande partie via
le remodelage de la matrice extra-cellulaire (MEC). En effet, au cours de la différenciation
adipocytaire, on observe un profond changement des composés de la MEC, et ce remodelage
est indispensable à la suite du processus adipogénique. L’expression de certains composés
comme la fibronectine, l’intégrine β, le collagène de type I et III est régulée négativement
alors que d’autres sont surexprimés comme le collagène de type IV ou l’entactine (nidogène)
(Lilla et al., 2002; Smas and Sul, 1995). On sait aujourd’hui que ces composants jouent un
rôle crucial dans ce processus puisque lorsque des préadipocytes sont cultivés sur une matrice
de fibronectine, ils sont incapables de se différencier, suggérant que la fibronectine pourrait
réguler l’expression de certains gènes ou de certaines enzymes lipogéniques (Spiegelman and
Ginty, 1983). Elle pourrait également interférer avec les protéines du cytosquelette empêchant
les changements morphologiques nécessaires à l’expression de nouveaux gènes. Il a été décrit
que les MMPs et plus particulièrement les MMP2 et 9 sont impliquées dans le processus de
différenciation adipocytaire. En effet, lorsque les préadipocytes sont traités à l’aide
d’inhibiteurs des MMPs ou d’anticorps neutralisants anti-MMP2 et 9, on observe une forte
diminution de la différenciation adipocytaire (Bouloumie et al., 2001; Chavey et al., 2003;
Croissandeau et al., 2002). Ceci se traduit par une absence d’induction de marqueurs de la
différenciation adipocytaire (PPARγ et adipsine), une baisse de l’accumulation des
28
triglycérides dans les cellules, ainsi qu’une absence de dégradation du réseau de fibronectine
(Croissandeau et al., 2002). De plus, des cultures primaires de préadipocytes humains traitées
par un inhibiteur des MMP-2 et MMP-9 (Batimastat) présentent une très forte diminution de
la différenciation adipocytaire (Bourlier et al., 2005).
Il a également été décrit que des souris traitées par du galardin, un inhibiteur à large spectre
des MMPs, et soumises à un régime hyper-lipidique, présentent des dépôts graisseux
gonadiques et sous-cutanés significativement diminués par rapport au groupe non traité
(Lijnen et al., 2002). Il semblerait que la croissance et le développement du tissu adipeux
soient limités par la formation d’une matrice de collagène entourant les cellules, suggérant un
rôle fonctionnel pour les MMPs dans le développement du tissu adipeux.
Plus récemment, des travaux sur les cystéines cathepsines K (cath-K) (Funicello et al., 2007;
Han et al., 2009a; Xiao et al., 2006; Yang et al., 2008), L (cath-L) (Yang et al., 2007) et S
(cath-S) (Taleb et al., 2006)
mettent en exergue leur implication dans l’adipogenèse.
L’utilisation d’inhibiteurs spécifiques de ces protéases suggère également que leur action se
ferait via le remodelage de la matrice extracellulaire, plus précisément via la dégradation du
réseau de fibronectine (Taleb et al., 2006; Yang et al., 2008; Yang et al., 2007). Les travaux
plus récents de Han et al. suggèrent que la cath-K pourrait aussi réguler la différenciation des
adipocytes en dégradant le collagène de type I (Han et al., 2009a).
De plus, des études in vivo utilisant des souris déficientes en cath-L ou en cath-K ont montré
que ces souris deviennent partiellement résistantes à l’obésité induite par un régime hyperlipidique en comparaison avec le groupe de souris sauvages, soulignant le rôle potentiel de ces
protéases dans le contrôle de l’accumulation du tissu adipeux (Funicello et al., 2007; Yang et
al., 2007).
Pour finir, la cath-S a récemment été identifiée comme étant un nouveau bio-marqueur sécrété
par le tissu adipeux (Taleb et al., 2006). L’expression de son ARN messager dans le tissu
adipeux sous-cutané ainsi que ses taux circulants sont positivement corrélés avec l’indice de
masse corporel (IMC), faisant de cette protéine un nouveau marqueur potentiel de l’obésité.
De façon paradoxale, il a été décrit que la MMP11 (stromélysine3) est puissant régulateur
négatif de l’adipogenèse (Andarawewa et al., 2005). Ces travaux réalisés dans le cadre d’une
étude sur le cancer du sein, suggèrent que les cellules cancéreuses induisent la sécrétion de
stromélysine3 par les adipocytes situés au niveau du front invasif des tumeurs, ce qui en
retour entraînerait une « dédifférenciation » de ces adipocytes, aboutissant à l’accumulation
d’une population de fibroblastes péri-tumoraux particuliers. De façon intéressante, les souris
déficientes en stromélysine3 présentent un poids corporel plus élevé ainsi qu’un excès de tissu
29
adipeux. Les analyses histologiques ont révélé que le diamètre des adipocytes des souris
déficientes en stromélysine3 est plus grand que celui des souris sauvages, indiquant une
hypertrophie de ces adipocytes. On retrouve également une augmentation de l’expression de
l’ARN messager de marqueurs adipogéniques tel que PPARγ ou la protéine aP2 au niveau du
tissu adipeux des souris déficientes en stromélysine3.
L’ensemble de ces travaux souligne le rôle primordial des protéases dans le processus
adipogenique, via le contrôle de la composition et/ou de l’organisation de la MEC.
Cependant, cet effet pourrait également être induit par la libération et l’activation de facteurs
de croissance emprisonnés dans la MEC, ou par la dégradation d’inhibiteurs de croissance.
4) Obésité, micro-environnement et cancer
a. Le micro-environnement
Les cellules épithéliales évoluent dans un contexte tissulaire dynamique, appelé microenvironnement, contenant des cellules stromales (fibroblastes, macrophages, lymphocytes,
adipocytes et cellules endothéliales) entourées de matrice extra-cellulaire (Mueller and
Fusenig, 2004) (Figure 10).
De nombreux travaux ont souligné l’importance du stroma dans la progression tumorale. Les
premiers travaux ont permis d’établir le rôle majeur de la néo-angiogenèse tumorale dans la
progression et la dissémination des tumeurs (Folkman and Kalluri, 2004). En effet,
l’angiogénèse joue un rôle important dans la progression du cancer car les tumeurs solides, au
delà d’une certaine taille (1 à 2 mm de diamètre) ne peuvent plus grandir ni s’étendre car elles
ne sont pas vascularisées (Folkman, 2003). Les cellules au centre de la tumeur solide ont
besoin d’oxygène (O2) et de nutriments mais également doivent pouvoir se débarrasser des
déchets métaboliques. D’autres composants du stroma ont été identifiés comme des acteurs
importants de la progression tumorale comme les myo-fibroblastes ou les macrophages
(Mueller and Fusenig, 2004). Leur implication dans la progression tumorale dépend
principalement de leur capacité à sécréter des facteurs de croissance, des composants de la
matrice extra-cellulaire permettant l’augmentation de la migration des cellules tumorales ainsi
que des sérines protéases et des métallo-protéases permettant la dégradation et le remodelage
de la matrice extra-cellulaire (De Wever et al., 2004; Mueller and Fusenig, 2004; Sato et al.,
2004; Sieuwerts et al., 1998).
30
Cependant, le rôle de ce micro-environnement tumoral ne semble pas limité à un soutien à la
progression tumorale dans le cadre d’une tumeur établie mais pourrait activement participer
aux étapes précoces du processus de carcinogenèse (Bissell and Labarge, 2005; Elenbaas and
Weinberg, 2001; Tlsty, 2001; Wiseman and Werb, 2002). Les premiers travaux montrent que
des myofibroblastes obtenus à partir de tumeurs prostatiques stimulent la transformation
tumorale des cellules épithéliales (Olumi et al., 1999).
Parmi les cellules qui constituent le stroma tumoral, les adipocytes sont probablement celles
donc le rôle a été le moins bien caractérisé malgré le fait qu’ils représentent un des types
cellulaires prédominant du micro-environnement de certaines tumeurs comme le cancer du
sein (Wiseman and Werb, 2002). Des études récentes suggèrent que les adipocytes
favoriseraient la progression tumorale mammaire (Iyengar et al., 2003) et pourraient jouer un
rôle dans les étapes précoces de la carcinogenèse mammaire (Iyengar et al., 2005). Ces
résultats pourraient s’expliquer par la capacité des adipocytes à sécréter de nombreux facteurs
incluant des facteurs de croissance, de nombreuses cytokines ou adipokines, des protéases
ainsi que certains composés de la matrice extra-cellulaire comme le collagène VI (Iyengar et
al., 2005; Rajala and Scherer, 2003).
31
adipocyte
Figure 10 : Schéma représentant les différents types cellulaires qui composent le
microenvironnement tumoral (D’après (Mohamed and Sloane, 2006)).
b. Obésité et cancer
Le tissu adipeux n’est pas seulement un organe de réserve. En effet, il intervient dans
divers processus physiologiques (métabolisme du glucose, appétit, réponse inflammatoire,
angiogenèse, pression sanguine, fonction reproductive) via la sécrétion de nombreuses
adipokines. La dérégulation de la sécrétion de ces molécules, constatée en cas d’obésité,
pourrait être responsable de certaines pathologies. En effet, l’obésité, qui se caractérise par
une hypertrophie et une hyperplasie des adipocytes, est fréquemment associée à certaines
pathologies comme le diabète de type 2, l’hypertension, l’athérosclérose (Bluher, 2009). De
plus, l’obésité et les désordres métaboliques qui en découlent sont associés à un risque accru
de développer certains types de cancer comme le cancer du colon, de la vésicule biliaire, du
rein, du pancréas, ainsi que le cancer du sein chez la femme ménopausée (Asseryanis et al.,
2004; Reeves et al., 2007; Renehan et al., 2008; Rose et al., 2004; van Kruijsdijk et al., 2009).
32
De récentes enquêtes épidémiologiques appuient le fait que l’obésité est un facteur de risque
pour ces cancers (Pan and DesMeules, 2009; Renehan et al., 2008).
Ces dernières années, de nombreux travaux ont été réalisés afin de comprendre le rôle des
adipocytes dans la progression tumorale. Il a été décrit que des milieux conditionnés issus de
culture d’adipocytes sont capables de stimuler la croissance des cellules cancéreuses
mammaires MCF7 et également d’induire des programmes transcriptionnels anti-apoptotiques
(Iyengar et al., 2003). Très récemment, il a été rapporté que le milieu conditionné
d’adipocytes stimule la migration et la capacité invasive des cellules de cancer du sein MDAMB-231 via la production de la chimiokine CCL20 (Kim et al., 2009). D’autre part, des
expériences de coculture dans des matrices de collagène entre des adipocytes et des cellules
de cancer du sein (Manabe et al., 2003) ou de cancer de colon (Amemori et al., 2007) ont
montré que les adipocytes favorisent la prolifération de ces cellules cancéreuses.
Les mécanismes par lesquels l’obésité participe au processus carcinogénique sont encore mal
connus. Cependant, de nombreuses études indiquent la participation de certaines adipokines
dans ce processus. Ainsi la leptine, dont le taux plasmatique est augmenté chez les patients
obèses (Munzberg and Myers, 2005), stimule (Vona-Davis and Rose, 2007) la croissance des
cellules de cancer du sein, de l’œsophage, de la prostate, mais inhibe la croissance des cellules
de cancer du pancréas (Housa et al., 2006; Somasundar et al., 2003). Son effet antiapoptotique a également été décrit dans les cellules de cancer de colon et de prostate (van
Kruijsdijk et al., 2009). A l’inverse, l’adiponectine, dont le taux plasmatique est inversement
corrélé avec l’indice de masse corporelle (IMC), a un effet anti-mitogène (Vona-Davis and
Rose, 2007) en diminuant la prolifération cellulaire et en augmentant l’apoptose (Dieudonne
et al., 2006). Dans le cadre du cancer du sein, il a été suggéré qu’une autre adipokine,
l’aromatase, serait impliquée dans le processus carcinogénique. Cette enzyme catalyse la
biosynthèse des œstrogènes à partir des androgènes. La biosynthèse des œstrogènes diffère
entre la femme pré-ménopausée et la femme ménopausée (Cleary and Grossmann, 2009).
Avant la ménopause, la principale source d’œstrogènes provient des ovaires. Par contre, chez
la femme ménopausée, cette biosynthèse se fait à partir de tissus périphériques tel le tissu
adipeux. Les enquêtes épidémiologiques ont souligné qu’un taux élevé d’œstrogène
plasmatique augmente le risque de développer un cancer du sein chez la femme ménopausée
(Kaaks et al., 2005; Kendall et al., 2007; Missmer et al., 2004). Chez la femme ménopausée et
obèse, le tissu adipeux représente la principale source d’œstrogène, c’est pourquoi l’aromatase
serait un bon candidat pour comprendre la relation entre l’obésité et le risque de développer
un cancer du sein chez la femme ménopausée.
33
II. La cathepsine-D
1) Synthèse, maturation et adressage lysosomal de la cath-D
a. Régulation de la transcription de la cath-D
La cathepsine-D (cath-D) est une aspartyl-endopeptidase lysosomale ubiquitaire active
à pH acide. Le gène de la cath-D contient 9 exons et est localisé sur le bras court du 11ème
chromosome, en 11p15 (Augereau et al., 1988; Redecker et al., 1991). La transcription de ce
gène conduit à la formation d’un ARNm de 1988 bases (Minarowska et al., 2008). Il a été
décrit que le promoteur de la cath-D est un promoteur mixte (Cavailles et al., 1993; Zaidi et
al., 2008). En effet comme de nombreux gènes eucaryotes régulés (appelés regulated genes),
il comporte une boite TATA (TATA box) (séquence riche en adénine et thymine), qui permet
la liaison au facteur de transcription IID (Transcription Factor II-D TFII-D) et l’initiation de
la transcription. Cette région promotrice contient également de multiples boites GC (GC box)
(séquence riche en guanine et cytosine), comme de nombreux gènes de ménage (appelés
house-keeping genes), tels les gènes codants pour les enzymes lysosomales. Ces GC box sont
des sites putatifs de liaison à certains facteurs de transcription comme Sp1. Il a été décrit que
la transcription de la cath-D est initiée à partir de cinq sites principaux d’initiation de la
transcription (transcription starting site TSS). L’expression ubiquitaire de cath-D, chez
l’homme, est indépendante de la TATA box (TATA-independent) et débute sur l’un des TSS
(TSS-II à -V) en amont de la TATA box et est probablement contrôlée par les GC box et le
facteur Sp1 comme pour de nombreux gènes de ménage (Cavailles et al., 1993; Zaidi et al.,
2008). Par contre, dans les lignées cellulaires de cancer du sein MCF7 qui expriment le
récepteur aux œstrogènes (RE), il a été décrit un élément de réponse aux œstrogènes (ERE) au
niveau du promoteur (fragment situé de -365 à -122) de la cath-D (Augereau et al., 1994;
Cavailles et al., 1991). L’induction de la cath-D par les oestrogènes est réalisée par
l’interaction du RE sur son ERE.
Ceci demande également l’action d’autres éléments situés en amont et en aval de cet ERE
(Augereau et al., 1994). Dans ce cas la transcription dépend de la TATA box (TATA
dependent) et débute 28 paires de bases en aval de la TATA box (TSS-I) (Figure 11).
34
Figure 11 : Schéma représentant la région promotrice de la cath-D (d’après Zaidi 2008)
En condition basale, l’expression de la cath-D humaine est TATA-independent et débute sur l’un des
TSS (transcription stating site) (TSS-II à –V) et est dirigée par les GC box et le facteur Sp1. Dans les
cellules de cancer de sein stimulées par les oestrogènes, la transcription est TATA-dependent et
débute à partir du TSS-I. La partie inférieure de la figure représente une comparaison schématique de
la longueur des différents ARN messagers de la cath-D.
En résumé, le promoteur de la cath-D présente une structure mixte ayant les caractéristiques à
la fois des gènes de ménages (GC box) et des gènes régulés (TATA box). Le gène de la cath-D
peut ainsi à la fois être exprimé constitutivement à partir de sites d’initiation de la
transcription indépendants de la TATA box, et aussi être surexprimé dans certaines conditions
physiologiques tel le développement ou le remodelage de certains tissus via une transcription
dépendante de la TATA box.
b. Structure et maturation protéolytique de la cath-D
La cath-D est synthétisée dans le réticulum endoplasmique rugueux (RER) sous forme
d’une pré-pro-enzyme de 412 acides aminés et va subir des glycosylations et de nombreux
clivages protéolytiques au cours de son routage lysosomal. Après synthèse et protéolyse du
peptide signal (20 acides aminés N-terminaux), la cath-D est sous la forme d’une pro-enzyme
protéolytiquement inactive de 52 kDa. Sous l’action des cystéines-protéases (autres que les
cath-B et -L) et non par auto-activation, elle est maturée en plusieurs formes intermédiaires
52-48 kDa, pour aboutir à une forme intermédiaire active simple chaîne de 48 kDa (LaurentMatha et al., 2006). Cet intermédiaire est ensuite clivé, par des cystéines-protéases telles que
35
les cath-B et –L, en une forme mature à deux chaînes de 34 kDa, en position C-terminale, et
14 kDa en position N-terminale (Laurent-Matha et al., 2006). Les deux chaînes s’associent de
façon non covalente via des liaisons de types hydrophobes. La maturation des deux chaînes
est complétée par des amino-peptidases et des carboxy-peptidases (Faust et al., 1985) (Figure
12).
Figure 12 : Maturation intracellulaire de la cath-D (d’après Laurent-Matha et al.,2006)
La cath-D est synthétisée dans le RER sous forme d’une pré-pro-enzyme de 412 acides aminés qui va
subir plusieurs clivages protéolytiques lors de sa maturation. Ainsi, après la perte du peptide signal,
la pro-cath-D est maturée en plusieurs formes intermédiaires 52-48 kDa, pour aboutir à une forme
simple chaîne active de 48 kDa. Cet intermédiaire est ensuite clivé par des cystéines protéases, telles
que les cath-B et –L, en une forme mature à deux chaînes de 14 kDa en position N-terminale, et de 34
kDa en position C-terminale. La maturation des deux chaînes est complétée par des amino- et
carboxy-peptidases.
De plus, il est décrit qu’à pH acide, in vitro, la procath-D sécrétée s’autoactive en pseudocath-D présentant une activité protéolytique. Elle présente un poids moléculaire apparent de
36
51 kDa, et possède 18 résidus (27-44) du pro-fragment résultant du clivage de ce pro-peptide
entre la Leucine 26 et l’Isoleucine 27 (Capony et al., 1987; Richo and Conner, 1994).
Cependant, cet intermédiaire de 51 kDa n’a pas encore été observé in vivo (Laurent-Matha et
al., 2006; Richo and Conner, 1994).
Le site catalytique de la cath-D contient deux acides aspartiques (33 et 231) situés dans une
séquence bien conservée de type Asp-Thr-Gly et localisés respectivement sur les chaînes 14 et
34 kDa. D’après l’étude de la structure tridimensionnelle de la cath-D de 48 kDa par
cristallisation, ces deux acides aspartiques situés au niveau du site catalytique se font face
(Metcalf and Fusek, 1993; Metcalf and Fusek, 1995).
A l’heure actuelle, aucun inhibiteur endogène de l’activité protéolytique de la cath-D n’a été
encore mis en évidence dans les cellules mammifères. Cependant, une étude récente à révélé
que la maspine, une protéine sécrétée inhibe la dégradation de la matrice extra-cellulaire par
de la cath-D (Khalkhali-Ellis and Hendrix, 2007). Toutefois, le mécanisme précis de cette
inhibition reste à être déterminé car aucun effet direct n’a été démontré. Le seul inhibiteur
naturel des aspartyl-protéases, la pepstatine A, a été isolé à partir d’actinomycètes (Umezawa
et al., 1970). Il est utilisé en routine pour étudier la fonction de la cath-D in vitro et pour sa
purification par chromatographie d’affinité (Metcalf and Fusek, 1993). La cristallisation de la
forme mature active (Baldwin et al., 1993) et de la forme inhibée par la pepstatine A de la
cath-D humaine (Metcalf and Fusek, 1993) montre l’existence de similitudes entre la structure
3D de la cath-D et celle des autres aspartyl-protéases (la pepsine, la rénine et la protéase du
virus HIV, par exemple). Ces enzymes adoptent une structure bilobulaire. A l’heure actuelle,
il n’existe pas de structure 3D de la forme précurseur de la cath-D.
c. Adressage lysosomal
La maturation intracellulaire de la pro-cath-D se déroule lors de son routage vers les
lysosomes et comprend plusieurs étapes conduisant à la synthèse d’une enzyme active
(Erickson, 1989). Lors de son transit dans l’appareil de golgi, la pro-enzyme est glycosylée
sur certains résidus asparagine par addition d’oligosaccharides de type oligomannosique. Elle
est ensuite reconnue de façon concertée par deux enzymes qui assurent la formation du signal
Mannose-6-Phosphate (M6P) (Baranski et al., 1992; Cantor et al., 1992) qui permettra la
liaison ultérieure des hydrolases à des récepteurs du Mannose-6-Phosphate (RM6P)
spécifiques dans le réseau trans-Golgien qui assurent son transport vers les lysosomes
(Kornfeld, 1990) (Figure 13).
37
Il existe deux RM6P : le RM6P/IGFII, ou grand récepteur ou récepteur cation indépendant, a
un poids moléculaire de 275 kDa. Le second de 46 kDa se nomme le petit récepteur, ou le
récepteur cation dépendant. Ces récepteurs sont des glycoprotéines trans-membranaires
comprenant une séquence signal, un domaine extra-cytoplasmique N-terminal, une région
transmembranaire hydrophobe et un petit domaine cytoplasmique C-terminal. C’est le
RM6P/IGFII qui réalise en majorité l’adressage lysosomal de la cath-D car son affinité pour
la protéase est supérieure à celle du petit récepteur (Ludwig et al., 1994; Ludwig et al., 1993).
En effet, des fibroblastes n’exprimant plus le récepteur RM6P/IGFII hypersécrètent la procath-D (Ludwig et al., 1994). Ce récepteur est aussi responsable de l’endocytose de la procath-D sécrétée (Stein et al., 1987) (Figure 13).
Bien que les récepteurs du M6P soient les partenaires les mieux connus pour l’adressage
lysosomal, il existe d’autres systèmes transportant les hydrolases aux lysosomes (Rijnboutt et
al., 1991).
En effet, plusieurs études ont décrit une association membranaire de la pro-cath-D et un
transport lysosomal indépendant des RM6P (Diment et al., 1988; McIntyre and Erickson,
1991; McIntyre and Erickson, 1993). Dans la lignée cellulaire HepG2, il existe une
association membranaire de la pro-cath-D indépendante des RM6P et une interaction avec la
pro-saposine (Zhu and Conner, 1994).
Dans le cancer du sein, la surexpression de la cath-D induit l’hypersécrétion de la pro-enzyme
et un ralentissement de son routage intra-cellulaire, avec une accumulation des formes actives
intracellulaires de la cath-D dans les endosomes et les lysosomes (Capony et al., 1989).
L’endocytose de la pro-cath-D sécrétée dans les cellules cancéreuses mammaires se fait par la
voie classique du RM6P/IGFII, mais également par un récepteur alternatif encore non
identifié (Laurent-Matha et al., 1998; Vignon and Rochefort, 1992). Récemment, notre
laboratoire a montré que l’internalisation de la pro-cath-D par les fibroblastes serait réalisée
par interaction avec la sous unité β du LRP1 (LDL Receptor Related Protein 1) (manuscrit
soumis pour publication).
38
Activation
at acidic pH ?
51K
Tumor micro-environment
52K
52K
Secretion
Endocytosis
M6P receptors and
unknown receptors
RER
Golgi
52K
Endosomes
Lysosomes
34+14K
48K
34+14K
Nucleus
Cytoplasm
Figure 13 : Schéma de la localisation de la cath-D
dans les cellules cancéreuses mammaires
La cath-D, synthétisée sur le réticulum endoplasmique rugueux (RER), transite par le réseau
trans-Golgi avant d’être adressée aux lysosomes via son interaction avec les récepteurs au
mannose-6-phosphate (RM6P). Dans les cellules cancéreuses mammaires, la cath-D est
surexprimée et s’accumule dans la cellule. Son routage lysosomal est ainsi perturbé,
conduisant à l’hypersécrétion de la cath-D. Durant la mort cellulaire programmée de type I
ou apoptose, la cath-D est relarguée dans le cytoplasme suite à la perméabilisation des
lysosomes.
39
2) Fonctions de la cath-D
a. Dans la physiologie
La cath-D est une aspartyl protéase majeure des lysosomes et endosomes (Braulke et al.,
1995). C’est une endo-protéinase clivant préférentiellement les liaisons peptidiques entre deux
acides aminés hydrophobes (e.g. -Phe-Phe-, -Leu-Tyr-, -Tyr-Leu-, and –Phe-Tyr-) à pH acide
(pH optimum 3,5 (Barrett, 1970)). Elle joue un rôle crucial dans le catabolisme intracellulaire
des protéines dans les lysosomes. De nombreuses fonctions physiologiques de la cath-D ont
été suggérées, basées sur sa capacité à cliver des protéines et des peptides (voir tableau 2).
Ainsi il a été montré que la cath-D active des précurseurs de protéines biologiquement actives
comme l’hormone parathyroide (Diment et al., 1989) ou la prolactine (Piwnica et al., 2006;
Piwnica et al., 2004) dans les compartiments pré-lysosomaux dans des cellules spécialisées.
Dans les cellules spécialisées, elle participe à la maturation des antigènes (Baechle et al.,
2006; Barrera et al., 2001; Mohamadzadeh et al., 2004; Zaidi et al., 2007) et à la dégradation
d’hormone comme l’insuline ou le glucagon (Authier et al., 2002; Authier et al., 1995).
Dans la mort cellulaire programmée de type I, ou apoptose, le rôle de la cath-D est en cours
d’étude et semble être complexe. En effet, la cath-D peut soit prévenir l’apoptose comme cela
a été décrit en condition physiologique avec les expériences utilisant les souris déficientes en
cath-D (Koike et al., 2003; Saftig et al., 1995), soit favoriser l’apoptose induite par des agents
cytotoxiques (Deiss et al., 1996; Emert-Sedlak et al., 2005) ou chimiothérapeutiques
(Beaujouin et al., 2006).
Par ailleurs, la génération de souris déficientes en cath-D a permis de montrer que la cath-D
n’est pas indispensable au développement embryonnaire, mais est nécessaire au maintien de
l’homéostasie de certains tissus. Elle participe au renouvellement et au remodelage de certains
épithéliums comme le thymus et l’intestin grêle. En effet, les souris déficientes en cath-D
meurent quatre semaines (26 jours ±1) après leur naissance. On retrouve chez ces souris une
nécrose intestinale massive, ainsi qu’une destruction importante des organes lymphoïdes
entraînant une chute importante des lymphocytes B et T (Saftig et al., 1995). On retrouve
également chez ces souris une atrophie rétinienne, qui fait que ces souris deviennent aveugles
dans les derniers jours de leur vie (Steinfeld et al., 2006).
40
Tableau 2 : Tableau référençant les possibles fonctions et substrats biologiques de la cath-D
(d’après Benes et al 2008)
Le système nerveux central est également affecté, on note une neurodégénération dans le
cerveau de ces souris. Dans les neurones de ces souris, on retrouve une accumulation dans les
lysosomes d’un matériel autofluorescent, la lipofuscine céroide. Ce phénotype est retrouvé
naturellement chez des animaux (mouton, bulldog américain) ayant une mutation du gène de
la cath-D (Awano et al., 2006; Tyynela et al., 2000).
Chez l’homme, la maladie de Batten (ou neuronal ceroid lipofuscinosis NCL) présente les
mêmes caractéristiques. Des études ont montré que des patients atteints de cette pathologie
présentent une mutation du gène de la cath-D (Kuronen et al., 2009; Siintola et al., 2006;
Steinfeld et al., 2006).
Des travaux récents suggèrent que la cath-D joue un rôle dans le transport intracellulaire du
cholestérol et des sphingolipides ainsi que dans la régulation du flux lipidique contrôlé par la
protéine ABCA-1 (ATP-binding cassette protein A1) (Haidar et al., 2006; Mutka et al., 2009).
41
b. Dans les pathologies
En plus de ses fonctions physiologiques, de nombreuses études ont suggéré
l’importance de la cath-D dans certains processus pathologiques.
En effet, comme cela a été décrit dans le chapitre précédent, la cath-D participe à la maladie
de Batten. Des mutations de la cath-D sont responsables des formes les plus sévères de NCLs
(Kuronen et al., 2009; Siintola et al., 2006; Steinfeld et al., 2006).
Dans la maladie d’Alzheimer, où son expression est augmentée (Cataldo et al., 1995; Haque
et al., 2008), elle serait impliquée dans la maturation de APP (Amyloid Precursor Protein),
apoE (apolipoprotein E) et de la protéine Tau, trois des facteurs importants de cette pathologie
(Kenessey et al., 1997; Sadik et al., 1999; Zhou et al., 2006). De plus, une variation génétique
de la cath-D constituerait un facteur de risque majeur pour le développement de cette maladie
(Papassotiropoulos et al., 2002).
Des études récentes suggèrent que la cath-D serait impliquée dans la maladie de Parkinson via
sa capacité à cliver l’a synucléine (une protéine retrouvée sous forme d’agrégats dans les
neurones de patients atteints de maladie de Parkinson) (Cullen et al., 2009; Qiao et al., 2008;
Sevlever et al., 2008).
Dernièrement, une étude a montré que l’expression de la cath-D est augmentée dans les
cerveaux de patients atteints d’autisme. Les auteurs suggèrent que la cath-D jouerait un rôle
dans le développement de la maladie en régulant le processus apoptotique (Sheikh et al.,
2009).
Chez les patientes atteintes de cardiomyopathie du post-partum, le taux de cath-D activée
dans le sérum est élevé et serait impliqué dans le clivage de la prolactine en multiple
fragments de 16 kDA anti-angiogéniques et pro-apoptotiques qui seraient responsables de la
maladie (Hilfiker-Kleiner et al., 2007).
Enfin, dans le cancer, la cath-D a été largement décrite comme étant une composante active
du processus métastatique (voir revue (Benes et al., 2008; Liaudet-Coopman et al., 2006)).
3) Rôle de la cath-D dans le cancer du sein
a. Expression dans les lignées de cancer du sein
Le cancer du sein est la première cause de mortalité par cancer chez la femme jeune et
touche une femme sur dix. L’expression de la cath-D dans les lignées cancéreuses
mammaires, est fortement augmentée en comparaison avec les cellules mammaires normales.
42
En effet, les cellules cancéreuses mammaires humaines produisent un taux d’ARNm codant
pour la cath-D de 8 à 50 fois supérieur à celui produit par les cellules épithéliales mammaires
normales et la concentration cytosolique totale de la cath-D (précurseur et enzyme mature) est
8 fois plus élevée (Capony et al., 1989). De plus, son expression dépend de la présence ou non
de récepteurs aux œstrogènes (estrogen receptor RE). En effet, dans les lignées hormonosensibles de cancer du sein (RE+) telles les cellules MCF7 ou T47D, l’expression de la cath-D
est stimulée par les œstrogènes et les facteurs de croissance (Cavailles et al., 1988). Par
contre, dans les lignées hormono-indépendantes de cancer du sein (RE-) telles les cellules
MDA-MB231 ou BT20, la cath-D est surexprimée de façon constitutive. De plus, la
surexpression de la cath-D induit l’hypersécrétion de la forme pro-enzyme ainsi qu’une
altération de son adressage lysosomal avec une accumulation des formes intracellulaires
(Capony et al., 1989).
De façon intéressante, l’expression du récepteur aux œstrogènes permet de traiter les
patientes atteintes d’un cancer du sein avec un traitement hormonal. Environ 80% des
patientes dont les tumeurs expriment le RE répondent à une thérapie anti-oestrogénique
(Tamoxifène), alors que seulement 10% des patientes ayant des tumeurs RE négatives
répondent favorablement au traitement.
b. Facteur pronostic
Sur le plan clinique, l'augmentation de la concentration de cath-D dans les cytosols de
cancers du sein est associée à un mauvais pronostic avec un risque accru de dissémination
métastatique (Fitzgibbons et al., 2000) et aide à prédire le risque de rechute le plus souvent
indépendamment des autres paramètres cliniques et biologiques (pour revue : (Rochefort,
1996)). Une étude regroupant 2810 patients indique de façon irrévocable la valeur de mauvais
pronostic de la cath-D quantifiée dans les cytosols de tumeurs primaires du sein dans tous les
groupes de patientes de cancer du sein (Foekens et al., 1999). De plus, une méta-analyse
regroupant 11 études avec un total de 2690 patientes confirme la valeur de mauvais pronostic
de la cath-D dans le cancer du sein chez les patientes sans métastases ganglionnaires
lymphatique (N-) (Ferrandina et al., 1997). Une étude pilote indique la valeur de mauvais
pronostic de la cath-D dans les lésions précoces pT1, suggérant un rôle potentiel de la cath-D
dans les étapes précoces de la progression tumorale (Nikolic-Vukosavljevic et al., 2005).
43
c. Rôles et mécanismes d’action dans le cancer
De nombreuses études sur le cancer du sein ont montré que la cath-D stimule la
prolifération des cellules cancéreuses in vitro et la progression métastatique in vivo. La cath-D
a été décrite comme étant mitogène pour les cellules de cancer du sein ou de prostate (Fusek
and Vetvicka, 1994; Vetvicka et al., 1994; Vetvicka et al., 1998). La pro-cathD, purifiée à
partir des milieux de sécrétion de cellules cancéreuses mammaires MCF7 et MDA-MB-231,
stimule leur prolifération (Vetvicka et al., 1999; Vignon et al., 1986). De plus, la cath-D
humaine, surexprimée par transfection stable, augmente la prolifération cellulaire et le
potentiel métastatique de cellules tumorales de rat 3Y1-Ad12 chez la souris athymique
(Garcia et al., 1990; Liaudet et al., 1995; Liaudet et al., 1994). Il a été montré que, dans la
lignée cancéreuse mammaire humaine métastatique MDA-MB-231, l’inhibition de
l’expression endogène de la cath-D par des ARNs antisens (Glondu et al., 2002), des
ribozymes (Vashishta et al., 2007) et des shRNA (Ohri et al., 2007), inhibe la prolifération
cellulaire in vitro, la croissance tumorale et le potentiel métastatique chez la souris athymique
in vivo. De façon intéressante, il a été rapporté que l’expression de NFkappaB2, qui joue un
rôle important dans la tumorigenèse (Baldwin, 2001; Garg and Aggarwal, 2002; Takata et al.,
2004), est diminuée dans ces cellules (Ohri et al., 2007).
Plusieurs mécanismes ont été proposés pour expliquer l’effet mitogène de la cath-D :
1) la cath-D pourrait agir en tant que protéase. En effet, son activité catalytique intra-cellulaire
pourrait être impliquée dans l’inactivation de la sécrétion d’inhibiteurs de croissance (Liaudet
et al., 1995), telle la protéine heat shock cognate 70 (hsc70) (Nirde et al., 2009). Cette
protéine appartient à la famille des hsp70, qui sont des protéines chaperone intracellulaires.
De plus, son activité protéolytique extra-cellulaire pourrait intervenir dans l’activation de
facteurs de croissance (Briozzo et al., 1991). On sait depuis longtemps que le pH extracellulaire des tumeurs est plus acide que celui des tissus normaux correspondants (Griffiths,
1991). Toutefois, l’activation extra-cellulaire de la pro-cath-D n’a jamais pu être démontrée,
suggérant qu’elle pourrait agir par un autre mécanisme.
2) elle pourrait aussi agir par interaction avec d’autres protéines. En effet, notre laboratoire a
montré qu’un mutant catalytiquement inactif de la cath-D stimule toujours la prolifération des
cellules tumorales in vitro et in vivo, indiquant l’existence de mécanismes alternatifs
indépendants de son activité protéolytique (Berchem et al., 2002; Glondu et al., 2001;
Laurent-Matha et al., 2005). De plus, puisque la pro-cath-D sécrétée mime en partie l’action
de la cath-D transfectée, il est envisageable que cette protéase agisse comme un ligand, en
44
interagissant avec un récepteur couplé à une voie de signalisation. Des études du laboratoire
ont montré que l’action mitogène de la cath-D est indépendante des récepteurs RM6P (Glondu
et al., 2001), suggérant l’existence d’un récepteur membranaire mitogène (Glondu et al.,
2001; Vetvicka et al., 1999). Les travaux plus récents de l’équipe ont découvert un nouveau
récepteur de la cath-D, LRP1 (LDL receptor-related protein1), responsable de son effet
mitogène dans les fibroblastes (manuscrit soumis pour publication) (Figure 14). Des travaux
sont en cours pour déterminer si le récepteur LRP1 est impliqué dans l’effet mitogène
autocrine de la cath-D sur les cellules cancéreuses.
Il est clair aujourd’hui qu’il existe des inter-connexions, entre cellules cancéreuses et
stromales, responsables de la croissance invasive des tumeurs, dans lesquelles les protéases
semblent être impliquées. La pro-cath-D sécrétée agit également au niveau du microenvironnement tumoral, en affectant les cellules stromales tels les fibroblastes, les cellules
endothéliales (Figure 14) (Laurent-Matha et al., 2005).
On sait que les tumeurs solides, au delà d’une certaine taille (1 à 2 mm3) ne peuvent plus
grandir ni s’étendre car elles ne sont pas vascularisées. Les cellules au centre de la tumeur
solide ont besoin d’oxygène (O2) et de nutriments mais également doivent pouvoir se
débarrasser des déchets métaboliques. C’est pourquoi l’angiogenèse (formation de nouveaux
vaisseaux) joue un rôle important dans la progression du cancer. Une étude clinique portant
sur 102 carcinomes invasifs du sein a révélé une association statistiquement significative entre
l’expression de cath-D et la densité vasculaire (Gonzalez-Vela et al., 1999). D’autres travaux
ont montré que la cath-D stimule l’angiogenèse tumorale dans des xénogreffes de tumeurs
dans des souris athymiques et que cet effet est indépendant de l’activité catalytique de la cathD (Berchem et al., 2002). Il est donc possible que son action passe par des voies de
signalisations activées par la liaison de la cath-D à un récepteur de surface qui n’a pas encore
été identifié (voir figure 15). L’angiogenèse étant contrôlée par un équilibre entre les facteurs
pro- et anti –angiogéniques, la cath-D pourrait libérer et activer des facteurs de croissance ou
bien dégrader des inhibiteurs de croissance présents dans la matrice extra-cellulaire. Dans ce
sens, les travaux de Briozzo et al. ont montré que la cath-D facilite le relargage de facteurs
pro-angiogéniques à partir de la matrice extra-cellulaire (Briozzo et al., 1991). Des travaux
plus récents ont montré que la thrombine augmente l’expression et la sécrétion de la cath-D
qui en retour induit l’angiogenèse (Hu et al., 2008).
Cependant, de façon paradoxale, des études in vitro indiquent que la cath-D clive la prolactine
en multiples fragments de 16kDa anti-angiogéniques (Hu et al., 2008; Piwnica et al., 2006;
Piwnica et al., 2004). Il a également été rapporté que la pro-cath-D sécrétée par les cellules de
45
carcinome de prostate serait responsable de la génération d’angiostatine, un puissant
inhibiteur de l’angiogenèse (Morikawa et al., 2000). A l’heure actuelle, le rôle de la cath-D
dans l’angiogenèse demeure complexe et doit encore être élucidé car cette protéase semble
présenter à la fois des fonctions pro- ou anti-angiogéniques suivant les modèles
expérimentaux.
Des études du laboratoire ont également montré que la cath-D sécrétée stimule de façon
paracrine la croissance invasive des fibroblastes du stroma mammaire (Laurent-Matha et al.,
2005). De plus, l’expression ectopique de la cath-D humaine dans des fibroblastes
embryonnaires de souris (MEF) déficients en cath-D stimule la croissance tridimensionnelle
dans le matrigel et est associée à une augmentation significative de la prolifération de ces
fibroblastes, de la survie, de la motilité, et de la capacité invasive par activation de la voie des
MAP kinases (Laurent-Matha et al., 2005). Tous ces effets sur les fibroblastes sont
indépendants de l’activité protéolytique, puisque les MEFs exprimant la cath-D
protéolytiquement inactive présentent les mêmes caractéristiques. De plus, les fibroblastes ont
la capacité de capturer la pro-cath-D sécrétée par les cellules tumorales par un processus
dépendant du RM6P (Heylen et al., 2002) ou indépendant du RM6P (Laurent-Matha et al.,
2005). Les résultats du laboratoire ont montré que cet effet mitogène de la cath-D sur les
fibroblastes est médié par le récepteur LRP1 (Figure 14) (manuscrit soumis pour publication).
secreted
pro-cath-D
LRP1
fibroblast
cancer cell
+ Invasive growth
Figure 14 : Schéma représentant l’interaction de la cath-D et de son récepteur LRP1
La pro-cath-D hyper-sécrétée par les cellules épithéliales cancéreuses mammaires interagit avec le
récepteur fibroblastique LRP1. L’interaction de la pro-cath-D sur son récepteur est responsable de
l’effet mitogène observé sur les fibroblastes.
46
Figure 15 : Schéma hypothétique des rôles de la cath-D dans la progression du cancer
(d’après Benes P., 2008)
La pro-cath-D hyper-sécrétée par les cellules épithéliales cancéreuses mammaires stimule la
prolifération des cellules cancéreuses de façon autocrine, en ce fixant à un récepteur de surface qui
n’a pas encore été identifié. Cette interaction active la voie des MAPKinases qui va promouvoir
l’expression de certains gènes dont certaines cytokines ou NFKB2 qui seront ensuite sécrétées. En
retour ces protéines vont stimuler la croissance de la tumeur et l’invasion.
Cette pro-cath-D va également agir de façon paracrine en stimulant la croissance invasive des
fibroblastes. De plus, cette pro-cath-D sécrétée va favoriser l’angiogenèse en se liant sur un récepteur
présent sur la membrane de ces cellules, et/ou en libérant et activant des facteurs angiogéniques (une
fois que la pro-cath-D est activée dans des zones acides du milieu extra-cellulaire).
47
La cath-D joue donc un rôle important dans la progression du cancer, et affecte plusieurs
types cellulaires du stroma tumoral (cellules endothéliales, fibroblastes). De façon
surprenante, bien que les adipocytes représentent un des types cellulaires prédominant du
microenvironnement tumoral dans le cancer du sein, et que de nombreuses études suggèrent
l’implication de l’obésité dans le cancer, aucun travail concernant le rôle de la cath-D dans les
adipocytes n’a encore été publié. Récemment, l’étude du sécrétome des adipocytes 3T3-L1
montre une sécrétion augmentée de cath-D en réponse à l’insuline (Zhou et al., 2009a).
4) Substrats et partenaires
a. Les substrats et partenaires de la cath-D
La cath-D est une aspartyl protéase qui dégrade les protéines à pH acide dans les
lysosomes. De nombreux substrats de la cath-D ont été décrits in vitro (voir tableau 2)
suggérant son implication dans divers processus physiologiques. Toutefois, ses substrats
endogènes sont encore mal connus et restent à être identifiés. De plus, le rôle de la cath-D ne
se limite pas à la protéolyse des protéines dans les lysosomes et les endosomes. La cath-D
peut se lier à d’autres protéines. En effet de récentes études suggèrent que son effet mitogène
dans le cancer pourrait être médié par une liaison à d’autres protéines, certains récepteurs
membranaires non identifiés à ce jour (Fusek and Vetvicka, 2005). L’interaction avec les
RM6P via les motifs M6P portée par la cath-D a été décrite lors de son adressage lysosomal
(Ludwig et al., 1994) et de son endocytose (Stein et al., 1987).
Différents travaux ont montré que la pro-cath-D interagit avec la pro-saposine dans les
cellules HepG2 (Zhu and Conner, 1994), et dans les cellules de cancer du sein en extra- et
intra-cellulaire (Laurent-Matha et al., 2002) et cette interaction stimulerait l’auto-activation de
la pro-cath-D (Gopalakrishnan et al., 2004). Des travaux récents réalisés au laboratoire ont
mis en exergue que l’interaction de la cath-D avec la sous unité β du LRP1 est responsable
des effets engendrés par la cath-D sur les fibroblastes (manuscrit soumis pour publication).
b. Identification de nouveaux substrats de la cath-D
L’identification des substrats d’une protéase est essentielle pour la compréhension des
voies protéolytiques qui vont permettre de réguler la fonction d’une cellule. Durant ma thèse,
nous avons collaboré avec le laboratoire du Professeur Christopher Overall afin d’identifier
les substrats naturels de la cath-D en utilisant une approche protéomique récemment
48
développée dans ce laboratoire et dénommé TAILS (Terminal Amine Isotopic Labeling of
Substrates).
Cette technique repose sur la comparaison des protéines présentes dans le milieu de culture
(sécrétome) provenant de cellules exprimant ou non la protéase d’intérêt.
En présence de la protéase, les protéines vont être coupées et générer une nouvelle extrêmité
NH2 spécifique de ce clivage. La première étape consiste à récupérer les milieux de cultures
où se trouvent les protéines sécrétées (ainsi que les peptides générés par le clivage des
substrats par la protéase d’intérêt), puis à les marquer au niveau des extrêmités NH2 libres
(extrêmité N-terminale et Lysine) à l’aide de marqueurs isotopiques de type iTRAQ (isobaric
Tag for Relative and Absolute Quantitation) (un marqueur différent pour chaque condition)
(voir Figure 16).
PRG
Figure 16 : Représentation schématique des réactifs iTRAQ
Les réactifs iTRAQ sont dits isobariques car ils possèdent tous une masse moléculaire de 145 Da.
Chaque réactif iTRAQ est constitué de trois parties :
- un groupement reporteur qui diffère entre les quatre formes du réactif utilisé par sa masse (m=114,
115, 116 et 117 Da)
- un groupement balance qui sert de contre poids afin que la masse globale du marqueur soit de 145
Da. Sa masse varie de 28 à 31 Da.
- un groupement fonctionnel qui lie de façon covalente le réactif iTRAQ aux amines primaires libres
du peptide (les lysines (K) qui portent un NH2 libre au niveau de leur chaîne latérale seront également
marquées).
49
Une fois le marquage des peptides et protéines effectué, les deux conditions (avec et sans
protéase) sont mélangées de façon équimolaire puis clivées par la trypsine. Cette digestion
permet d’obtenir un mélange de peptides qui facilitera l’analyse en spectrométrie de masse et
va générer de nouvelles extrêmités NH2 libres (Figure 17). Afin de sélectionner
spécifiquement les sites de coupures générés par la protéase d’intérêt, une sélection négative
par un polymère aldéhyde va être employée. Cette étape va permettre de simplifier
l’échantillon et de récupérer uniquement les peptides marqués et protégés à leur extrêmité Nterminale. L’échantillon contenant les peptides marqués est ensuite fractionné par
chromatographie liquide haute performance (HPLC), puis les différentes fractions sont
analysées par spectrométrie de masse en tandem (MS/MS).
Lors de l’analyse en spectrométrie de masse (MS), les peptides marqués seront donc détectés
avec la masse intrinsèque du peptide plus 145 Da provenant du marqueur. Ce n’est que lors de
l’étape de fragmentation du peptide (MS/MS) que la contribution de chaque peptide pourra
être appréciée, ce qui se traduira par la libération d’ions reporteurs ayant des masses de 114,
115, 116, ou 117 Da, suivant le marquage utilisé. Enfin, l’analyse bioinformatique des
peptides identifiés par spectrométrie de masse permettra de déterminer la proportion de
peptides d’un milieu de culture à l’autre et d’identifier les protéines qui leur sont associées.
En résumé, lorsqu’une protéine est clivée dans l’échantillon où la protéase est présente, ceci
génère une nouvelle extrêmité NH2 qui réagit avec le marqueur. C’est ce peptide marqué dans
une seule condition qui sera identifiée par la spectrométrie de masse. Cette technique permet
donc d’identifier des substrats naturels qui devront être validés par des études biochimiques.
En effet, la présence d’un peptide clivé dans le milieu de culture ou la protéase d’intérêt y a
été ajoutée ou exprimée, peut être le résultat d’un effet indirect de cette protéase (via
l’activation d’autre protéase par exemple). Cette technique peut être également utilisée pour
l’identification de substrats membranaires (Butler et al., 2009).
50
Figure 17 : Schéma représentant la technique du TAILS
Les milieux de culture sont collectés puis marqués avec les réactifs iTRAQ. Puis, les deux conditions
sont mélangées et clivées par la trypsine, ce qui produit de nouvelles extrêmités Nter.
Un polymère chimique est ajouté au mélange et va permettre de le simplifier en liant les extrêmités
NH2 libres nouvellement générées. Les peptides marqués sont ensuite fractionnés par
chromatographie liquide haute performance et analysés par spectrométrie de masse en tandem.
Enfin, une analyse bioinformatique permet de traiter les résultats.
51
Afin de réaliser ce projet, nous avons utilisé deux modèles cellulaires développés au
laboratoire (Figure 18) :
1- des fibroblastes embryonnaires de souris (MEF) immortalisés exprimant ou pas la cath-D
humaine ou la cath-D humaine mutée au niveau du site catalytique et donc protéolytiquement
inactive. Ces trois lignées cellulaires ont déjà été publiées (Laurent-Matha et al., 2005).
2- des cellules de cancer du sein (MDA-MB-231) transfectées de façon stable avec un shRNA
ciblant le gène de la luciférase ou celui de la cath-D. Ces cellules de cancer du sein expriment
ou pas la cath-D.
L’utilisation de cette technique peut sembler ne pas être appropriée à l’étude des substrats
endogènes de la cath-D car cette dernière a besoin d’un pH acide pour cliver ses substrats.
Pourtant, il a été décrit l’existence de formes actives de la cath-D dans le milieu extracellulaire capables de cliver la prolactine du côté basal des acini de la glande mammaire
(Castino et al., 2008). De plus, les travaux de Piwnica en 2006 suggèrent que la cath-D
sécrétée cliverait la prolactine à l’extérieur de la cellule, mais que ce clivage nécessite une
acidification locale qui passerait par des pompes à protons et des échangeurs de cations
Na+/H+. Par ailleur, il est possible que le clivage de protéines par la cath-D se fasse à
l’intérieur de la cellule et que les produits de dégradations soient relargués par exocytose. Une
des hypothèses serait que la pro-cath-D sécrétée lie son substrat et que ce complexe soit
internalisé. La vésicule d’endocytose devenant acide la cath-D cliverait son substrat et ses
produits de dégradation seraient relargués dans le milieu extra-cellulaire. Nous avons donc
appliqué cette technique à nos deux modèles cellulaires, les travaux sont en cours.
52
A
B
• cathD-/-MEFcath-D
• cath-D-/-MEFD231Ncath-D
• MDA-MB-231
shLuc
shcath-D1
P2 P3 P6
P2 P3 P6
shcath-D2
P2 P3 P6
cath-D
bactin
cath-D
D231Ncath-D
Figure 18 : Expression de la cath-D dans différents modèles cellulaires
A) Des fibroblastes embryonnaires de souris immortalisés (MEF) déficientes en cath-D ont été
transfectés avec de la cath-D humaine ou de la cath-D humaine mutée au niveau de son site
catalytique. Il existe une différence d’un 1 kDa au niveau de la masse moléculaire apparente de la
cath-D mutée qui est due à une augmentation de la mobilité électrophorétique de la protéine mutée.
B) Des cellules de cancer du sein, les MDA-MB-231, ont été transfectées à l’aide de shRNA ciblant le
gène de la luciférase (shLuc) ou le gène de la cath-D (shcath-D1 et shcath-D2). Dans les cellules
transfectées avec le shRNA ciblant le gène de la cath-D, l’expression de la cath-D est très fortement
inhibée.
53
III. Le récepteur LRP1
1) Organisation structurale
LRP1 (LDL receptor-related protein1) est un récepteur d’endocytose qui appartient à
la famille des LDL-récepteurs qui compte sept membres (Figure 19). Chaque membre de cette
famille est composé d’un domaine extra-cellulaire (composé de régions de liaison du ligand et
de répétitions EGF), d’un domaine trans-membranaire, et d’une queue cytoplasmique
contenant au moins un motif NPxY. Ce récepteur est capable de lier et internaliser une
quarantaine de ligands différents et est impliqué dans divers processus biologiques dont le
métabolisme des lipoprotéines, l’élimination de protéases, le développement embryonnaire, la
fonction neuronale, l’entrée de toxines bactériennes et de virus à l’intérieur des cellules. Il se
compose d’une chaîne α extra-cellulaire de 515 kDa, qui contient différents domaines de
liaison aux ligands, et d’une chaîne β trans-membranaire de 85 kDa (pour revue (Boucher and
Gotthardt, 2004; Lillis et al., 2008; Strickland and Ranganathan, 2003)). LRP1 a été localisé
dans les râdeaux lipidiques en réponse au PDGF-BB et à l'insuline (Boucher et al., 2002; Wu
and Gonias, 2005; Zhang et al., 2004a).
On retrouve dans la partie extra-cellulaire de la chaîne β, des répétitions de type complément
riches en cystéines (CR) (cysteine-rich complement-type repeats) qui sont généralement
appelées répétitions de liaison au ligand (ligand-binding repeats) puisque la plupart des
ligands se lient au niveau de ces répétitions. Concernant la chaîne α du récepteur LRP1, ces
CRs sont localisées dans des régions précises appelées clusters (de I à IV), chacune contenant
un nombre variable de CR. Les expériences de liaison de ligand indiquent que la plupart des
ligands interagissent avec la chaîne α du récepteur au niveau des clusters II et IV (Neels et al.,
1999; Willnow et al., 1994). On retrouve également dans cette partie extracellulaire des
répétitions EGF et des domaines β-propeller.
Tous les membres de cette famille contiennent une chaîne β qui comporte une région transmembranaire ainsi qu’un domaine cytoplasmique de longueur variable. Concernant la chaîne
β du LRP1, son domaine cytoplasmique est constitué de 100 résidus d’acides aminés, et
comprend 2 motifs di-leucines (LL) et 2 motifs NPxY phosphorylables par v-Src (Barnes et
al., 2001) et en réponse au PDGFR-β (Boucher and Gotthardt, 2004; Boucher et al., 2002;
Loukinova et al., 2002; Newton et al., 2005), et CTGF (connective tissue growth factor)
(Yang et al., 2004). Cette région cytoplasmique peut également interagir avec des molécules
adaptatrices telles Shc (van der Geer, 2002), disabled (Zhang et al., 2008), Fe65 (Kinoshita et
54
al., 2003) impliquées dans le trafic cellulaire et la signalisation cellulaire. Il a également été
décrit que chaîne β du LRP1 pouvait subir une protéolyse intra-membranaire régulée
(regulated intramembrane proteolysis) appelée RIP, qui aboutira à la libération d’un domaine
intra-cellulaire (LRP1-ICD) qui, in vitro, a été impliqué dans la régulation de la transcription
de certains gènes (Zurhove et al., 2008).
Figure 19 : Organisation structurale des membres de la famille des LDL-récepteurs
(D’après Lillis 2008)
Chaque membre de la famille des LDL-récepteurs est composé d’un domaine extracellulaire
(présentant des régions de liaison au ligand, et des répétitions EGF), d’un domaine transmembranaire, et d’une queue cytoplasmique contenant au moins un motif NPxY.
55
2) Trafic intra-cellulaire
Comme le récepteur LRP1 reconnaît de nombreux ligands différents, son trafic vers la
membrane plasmique est contrôlé afin de prévenir toute interaction précoce avec certains de
ses ligands dans le réticulum endoplasmique. La protéine RAP (receptor associated protein),
une protéine chaperone, interagit fortement avec LRP1 et empêche toute autre liaison
prématurée du récepteur avec ses ligands. Cette protéine a été découverte comme étant copurifiée avec LRP1 par chromatographie d’affinité de ligand (Ashcom et al., 1990; Strickland
et al., 1990). La protéine RAP interagit avec de multiples sites de LRP1 et l’escorte du
réticulum endoplasmique jusqu’à l’appareil de Golgi. Cette interaction est régulée par le pH
des différents compartiments cytoplasmiques. Dans le réticulum endoplasmique, l’interaction
se fait à pH neutre (pH 7.2) et la dissociation a lieu à pH plus acide (pH<6.5) dans l’appareil
de Golgi (Lillis et al., 2008). Ce changement de pH induirait une protonation de certains
résidus histidines, nécessaire à la dissociation de ce complexe (Lee et al., 2006). L’importance
de cette protéine dans la maturation et l’adressage du LRP1 à la membrane plasmique a été
démontrée par la génération de souris déficientes en RAP. La quantité de LRP1 mature est
fortement diminuée au niveau du foie et du cerveau de ces souris, deux organes où LRP1 est
fortement exprimé et joue un rôle important en condition physiologique (Willnow et al., 1995)
(voir chapitre suivant).
3) Mécanismes d’action
a. La phosphorylation
Plus récemment, il a été montré qu’outre sa fonction classique comme récepteur
d’endocytose, la chaîne β du LRP1 participe à la transduction du signal de part sa
phosphorylation sur résidus tyrosines sur ses motifs NPxY cytoplasmiques dans les
fibroblastes transformés par vSrc (Barnes et al., 2001) ou en réponse au PDGF-BB (Boucher
et al., 2002; Loukinova et al., 2002; Newton et al., 2005), au CTGF (Yang et al., 2004) et plus
récemment au tPA (Hu et al., 2006). Le LRP1 phosphorylé sur tyrosines interagit alors avec la
protéine adaptatrice Shc et active la voie des MAP kinases (Barnes et al., 2001; Hu et al.,
2006; Yang et al., 2004). LRP1 interagit également avec d’autres protéines adaptatrices telles
que Fe65, Dab, Jip1 et 2 (Strickland and Ranganathan, 2003). De plus LRP1 peut aussi agir
comme co-répresseur de Frizzled-1 (Zilberberg et al., 2004). LRP1 participe également à la
56
transduction du signal par la phosphorylation des motifs NPxY cytoplasmiques sur résidus
tyrosine dans les fibroblastes transformés par vSrc (Barnes et al., 2001), en réponse au PDGFBB (Boucher et al., 2002; Loukinova et al., 2002; Newton et al., 2005), au CTGF (Yang et al.,
2004) et au tPA (Hu et al., 2006).
b. Le RIP
De façon intéressante, LRP1 est aussi détecté sous forme soluble dans la circulation,
dû au clivage in vivo de son domaine extracellulaire (ecto-domain shedding) (Quinn et al.,
1997). Le fragment produit comporte la chaîne alpha (sous-unité de 515 kDa) et un fragment
de 55 kDa de la chaîne β, indiquant une protéolyse proche de la membrane plasmique (Quinn
et al., 1999). Le clivage de l’ecto-domaine de la chaîne β du LRP1 est effectué par des
protéases associées à la membrane plasmique tel des métalloprotéases (Quinn et al., 1999;
Rozanov et al., 2004; Liu et al., 2009), ou la β sécrétase BACE 1 (von Arnim et al., 2005)
(Figure 20).
Le clivage de l’ecto-domaine des récepteurs est parfois suivi d’un clivage intracellulaire, par
un mécanisme appelé RIP (Regulated intra-membrane proteolysis). Le premier clivage libère
le domaine extracellulaire et produit une protéine membranaire comportant un domaine
extracellulaire très court appelé CTF (Carboxy Terminal Fragment). Cette protéine devient
alors substrat pour un clivage intra-membranaire généré par différentes enzymes incluant les
γ-sécrétases. Ce clivage aboutit à la formation d’un fragment intracellulaire appelé LRP1βICD (LRP1β- intracellular domain). La fonction de LRP1β-ICD dans la signalisation est
encore mal caractérisée mais implique certainement son association avec des protéines
adaptatrices. Ainsi, LRP1β-ICD interagit avec la protéine adaptatrice Fe65 et l’histone
acétyltransférase Tip60 au noyau (Kinoshita et al., 2003). Des travaux ont suggéré que
l’interaction entre LRP1β et BACE1 aurait lieu dans une zone intracellulaire du LRP1β et
également que le domaine cytoplasmique libéré du LRP1β activerait la transcription de gènes
cibles (von Arnim et al., 2005). La fonction de LRP1-ICD comme répresseur transcriptionel
du promoteur de l’interferon-γ ainsi que ses gènes cibles viennent d’être caractérisés (Zurhove
et al., 2008).
57
1
LRP1β
LRP1α
Membrane associated
proteases
LRP1β-CTF
2
LRP1β-ICD
γ-secretases
transcription
Figure 20 : Représentation schématique du RIP (Regulated intra-membrane proteolysis)
Le mécanisme du RIP consiste en deux clivages successifs : le premier clivage est initié par une
protéase et libère l’ecto-domaine du récepteur. La protéine membranaire restante, le LRP1β-CTF,
devient substrat d’un 2ème clivage intra-membranaire réalisé par des γ-sécrétases. Le fragment intracellulaire libéré, appelé ICD (Intra-cellular domain), diffuse alors au noyau afin de réguler la
transcription de gènes cibles.
4) Fonctions
Le LRP1 reconnaît une quarantaine de ligands différents et est impliqué dans divers
processus physiologiques (Tableau 3). La délétion du gène du LRP1 chez la souris s’avère
létale au stade embryonnaire, soulignant un rôle déterminant mais encore mal caractérisé de
ce récepteur dans le développement (Herz et al., 1992). LRP1 est fortement exprimé dans
certains types cellulaires tels que les hépatocytes, les neurones, des cellules musculaires lisses,
et les adipocytes. Des mutants tissus-spécifiques ont permis une meilleure compréhension des
divers rôles de ce récepteur.
Au niveau du foie, ce récepteur permet d’éliminer de la circulation sanguine de multiples
molécules tels des cofacteurs impliqués dans la coagulation (Facteur VIII), des complexes
enzyme-inhibiteur (complexe α2-Macroglobulin-protéase ou encore complexe Serpineprotéase), ainsi que des particules lipoprotéiques (chylomicron remnants) grâce à son
interaction avec la protéine ApoE (Lillis et al., 2008). L’interaction du récepteur LRP1 avec
ces molécules permet leur endocytose et leur dégradation intra-cellulaire. Au niveau du foie, il
joue un rôle dans l’élimination des protéines plasmatiques.
58
Il a été démontré, par des études de délétion du gène du LRP1 dans les cellules musculaires
lisses, que ce récepteur joue un rôle protecteur de l’athérosclérose en empêchant la voie de
signalisation du PDGF (Boucher et al., 2003). Il permet le maintient de l’intégrité de la paroi
vasculaire en supprimant l’activation du récepteur au PDGF (PDGFR) (Zhou et al., 2009b).
Au niveau des neurones, LRP1 est abondamment exprimé, cependant sa fonction est encore
mal caractérisée. Les souris déficientes en LRP1 dans les neurones développent des troubles
moteurs et du comportement. Il semblerait que le LRP1 soit impliqué dans la transmission
synaptique (May et al., 2004).
L’expression de ce récepteur est également élevée dans les adipocytes. La stimulation du
LRP1 par l’insuline, augmente l’assimilation des triglycérides et des esters de cholestérol à
partir des lipoprotéines circulantes, en agissant de concert avec la lipoprotéine lipase
(Beisiegel et al., 1996). Il a été récemment décrit que des souris déficientes en LRP1 au
niveau du tissu adipeux, présentent de plus petites réserves lipidiques, un poids corporel plus
faible, un retard dans l’élimination des lipides après la prise alimentaire (Hofmann et al.,
2007) suggérant un rôle dans l’homéostasie des lipides. De plus LRP1 semble jouer un rôle
dans les voies de signalisation conduisant à la synthèse des acides gras, et pourrait également
réguler l’homéostasie du cholestérol via la voie de signalisation Wnt5a (Terrand et al., 2009).
Son rôle dans l’invasion, la migration et la prolifération des cellules cancéreuses est en
émergence. De façon intéressante, une étude décrit que le polymorphisme C766T dans le gène
du LRP1 est associé à un risque augmenté de développer un cancer du sein (Benes et al.,
2003). De plus, il est exprimé dans les fibroblastes sur le front invasif dans les carcinomes
colorectaux (Obermeyer et al., 2007). Des études décrivent que LRP1 stimule la prolifération
des cellules cancéreuses, la motilité et l’invasion (Dedieu et al., 2008; Li et al., 2003; Song et
al., 2009).
59
Tableau 3 : Ligands connus du LRP1
(d’après Lillis et al., 2008)
60
C. PRESENTATION DU
TRAVAIL DE THESE
61
I. Etude du rôle de la cathepsine D dans les adipocytes
1) Introduction :
La cathepsine-D (cath-D) est une aspartyl protéase lysosomale qui est surexprimée et
fortement sécrétée par les cellules épithéliales cancéreuses mammaires. C’est un facteur de
mauvais pronostic dans le cancer du sein associé à un risque plus élevé de récidives. De plus,
cette protéase stimule la croissance des cellules cancéreuses, la croissance invasive des
fibroblastes et la formation des métastases.
Les cellules cancéreuses interagissent de façon dynamique avec les cellules normales des
différents types cellulaires présents dans le tissu de support environnant appelé microenvironnement tumoral. Le micro-environnement tumoral est composé de cellules stromales
et de matrice extra-cellulaire. Les cellules stromales jouent un rôle important dans la
progression du cancer, notamment via la sécrétion de certains facteurs tels des facteurs de
croissance ou des protéases. Parmi les cellules présentes dans le micro-environnement
tumoral, l’adipocyte est probablement celui qui a été le moins bien étudié alors qu’il
représente un des types cellulaires prédominants du micro-environnement de certains cancers
comme le cancer du sein. On sait aujourd’hui que l’adipocyte n’est pas uniquement une
cellule de réserve énergétique, mais qu’il sécrète de nombreuses molécules, appelées
adipokines, dont certaines hormones, des cytokines, des facteurs de croissance qui pourraient
influencer le comportement des cellules tumorales. Ces dernières années, des études cliniques
ont mis en évidence que l’obésité est un facteur de risque majeur ainsi qu’un facteur de
mauvais pronostic pour de nombreux cancers, dont le cancer du sein chez la femme
ménopausée. De façon intéressante, des travaux récents indiquent que les cystéines
cathepsines modulent la biologie de l’adipocyte et jouent un rôle important dans l’obésité. A
ce jour, le rôle de la cath-D adipocytaire demeure inexploré. Dans cette étude, nous avons
quantifié le taux d’expression de la cath-D chez l’homme et la souris obèse. Nous avons
également analysé l’expression de la cath-D au cours de la différenciation des adipocytes dans
des modèles humain et murin. Finalement, afin de déterminer le rôle de cette protéase au
cours de l’adipogenèse, nous avons inhibé de façon stable son expression dans les préadipocytes par l’utilisation de shRNA anti-cath-D et nous avons étudié les conséquences sur
l’expression des marqueurs de la différenciation adipocytaire, PPARg, aP2 et HSL et sur
l’accumulation des lipides pendant l’induction de l’adipogenèse.
62
2) Article 1:
Cathepsin-D, a key protease in breast cancer,
is up-regulated in obese tissue and controls adipogenesis
63
Cathepsin-D, a key protease in breast cancer, is up-regulated in obese adipose
tissue and controls adipogenesis
Olivier Masson1, Christine Prébois1, Aline Meulle2,3, Cédric Dray2,4, Danielle
Daviaud2,4, Didier Quilliot5, Philippe Valet2,4, Catherine Muller3, Emmanuelle
Liaudet-Coopman1
1
IRCM, Institut de Recherche en Cancérologie de Montpellier, Montpellier, F-34298,
France; INSERM, U896, Montpellier, F-34298, France; Université Montpellier1,
Montpellier, F-34298, France; CRLC Val d’Aurelle Paul Lamarque, Montpellier, F34298, France. 2Université de Toulouse, UPS, Institut de Médecine Moléculaire de
Rangueil, Equipe n°3, IFR31, Toulouse, France. 3Institute of Pharmacology and
Structural Biology CNRS UMR 5089, Toulouse, France; Université de Toulouse,
Toulouse, France. 4Institut National de la Santé et de la Recherche Médicale
(INSERM),
U858,
Toulouse,
France.
5
Service
de
diabétologie,
Maladies
métaboliques et nutrition, CHU de Nancy, Hôpital J. d’Arc, 54201 Nancy Cedex,
France.
*Corresponding author: E Liaudet-Coopman, Inserm U896, IRCM Val d'AurellePaul Lamarque, 34298 Montpellier Cedex 5, France ; Tel (33) 467 61 24 23 ; FAX
(33) 467 31 37 87 ; E-mail: [email protected]
Running title: Role of cathepsin D in obesity and adipogenesis
Keywords: cathepsin D, adipocyte, obesity, adipogenesis, differentiation, cancer
1
ABSTRACT
The aspartic protease cathepsin-D (cath-D) is overexpressed by human epithelial
breast cancer cells and is closely correlated with poor prognosis in breast cancer.
Adipocyte is one of the most prominent cell types in the tumor-microenvironment of
breast cancers and clinical studies pointed out that obesity increases the incidence of
breast cancer. Here, we provide the first evidence that cath-D expression is upregulated in adipose tissue of obese human as well as in adipocytes of obese
C57BI6/J mouse model. Cath-D expression is also increased during human and
mouse adipocyte differentiation. We demonstrate that cath-D silencing in NIH3T3F442A murine preadipocytes significantly inhibits the expression of PPARg, HSL
and aP2 adipocyte differentiation markers after adipogenesis induction, and leads to
lipid-depleted cells. This study highlights the key role of cath-D in the control of
adipogenesis, and suggests that this protease may be a novel target in obesity.
Since cath-D is implicated in breast cancer progression, we propose that cath-D may
represent a molecular link between cancer and obesity.
2
Introduction
Consumption of meals rich in fat and carbohydrates is a major causative factor of
obesity, resulting in excessive white adipose tissue. An increase of adipose tissue
mass results from combined hypertrophy of existing adipocytes (hypertrophic
adipocytes) and adipogenic differentiation of precursor cells (adipocyte hyperplasia).
A large amount of adipose tissues has been associated with poor prognosis for
breast cancer in obese postmenauposal women (Calle & Kaaks, 2004). Recently,
clinical studies pointed out that obesity is a major risk factor for cancer (Renehan et
al., 2008; van Kruijsdijk et al., 2009; Wright et al., 2007).
Tumor progression has been recently recognized as the product of an evolving
cross talk between tumor cells and its surrounding supportive tissue, the tumor
stroma (Mueller & Fusenig, 2004). Cancer cells interact dynamically with multiple
normal cell types such as fibroblast, infiltrating immune cells, endothelial cells and
adipocytes within the context of extra-cellular matrix (Mueller & Fusenig, 2004). Of all
the cells present in the
microenvironment, adipocyte is probably the least well
studied despite the fact that it corresponds to one of the most prominent cell type in
tissues such as breast and bone marrow (Wiseman & Werb, 2002). Until recently,
adipocytes were mainly considered as an energy storage depot, but there is now
clear evidence pointing to the fat tissue as an endocrine organ that produces
hormones,
growth
factors,
cytokines,
proteases
and
other
molecules,
an
heterogeneous group of molecules included under the term of adipokines (Rajala &
Scherer, 2003). Accordingly, the adipocyte is therefore an excellent candidate to
influence tumor behaviour through heterotypic signalling processes and may prove to
be critical for tumor survival, growth, and metastasis.
3
The aspartic protease cathepsin D (cath-D), a marker of poor prognosis in breast
cancer (Ferrandina et al., 1997; Foekens et al., 1999; Rochefort, 1992; Rodriguez et
al., 2005; Westley & May, 1999), is overexpressed and secreted at high levels by
human epithelial breast cancer cells (Capony et al., 1987; Capony et al., 1989;
Liaudet-Coopman et al., 2006; Rochefort & Liaudet-Coopman, 1999; Westley &
Rochefort, 1980). Cath-D stimulates cancer cell proliferation, fibroblast outgrowth,
angiogenesis and metastasis (Berchem et al., 2002; Fusek & Vetvicka, 1994; Garcia
et al., 1990; Glondu et al., 2001; Glondu et al., 2002; Hu et al., 2008; Laurent-Matha
et al., 2005; Liaudet et al., 1995; Liaudet et al., 1994). Here, we investigated the
expression of cath-D in obese adipocytes and its role in the control of adipogenesis.
We show that cath-D expression is up-regulated in human and mouse obese adipose
tissues as well as during adipogenesis. Moreover, we demonstrate that cath-D
positively controls the adipogenic process.
Results
Cath-D transcription is up-regulated in human and mouse obese adipose
tissues
Because of the recently established relationship between obesity and cancer
incidence (Renehan et al., 2008; van Kruijsdijk et al., 2009; Wright et al., 2007) and
of the demonstrated role of cath-D in both cancer cells and stromal cells (LiaudetCoopman et al., 2006), we investigated cath-D expression in human and mouse
adipose tissues.
Cath-D mRNA expression was examined in human intra-abdominal visceral
adipose tissue (VAT) from lean and obese human (Fig. 1A, panel a). Interestingly,
cath-D mRNA was significantly increased in human obese visceral adipose tissue
4
(Fig. 1A, panel a). This differential expression of cath-D was also observed in
subcutaneous adipose tissue (SAT) from lean and obese human (Fig. 1A, panel b).
To assess whether this cath-D up-regulation was a general characteristic of
obese adipocytes, we next analysed cath-D mRNA levels in adipocytes isolated from
C57BI6/J mice either fed a HFD or ND (Fig. 1B). As attempted HFD-fed C57BI6/J
mice exhibited a significant increase in body mass (47.6 ± 1.4 g) when compared to
their control littermates (31.1 ± 1.2 g) (data not shown). Cath-D expression was
significantly enhanced in adipocytes of HFD obese mice when compared to ND
control mice (Fig. 1B). Altogether, our results indicate that cath-D expression is upregulated in human and mouse obese adipose tissues.
Cath-D expression is increased during mouse and human adipocyte
differentiation
Since no report described cath-D expression in adipocyte cells, we analysed cathD expression in the well-established mouse adipocyte cell lines (NIH-3T3F442A and
NIH-3T3L1), and compared it to that of mouse fibroblasts (NIH-3T3), human breast
fibroblasts (HMF), and in epithelial breast cancer (MCF-7) cells. As shown in Figure
2, mouse cells expressed preponderantly the single intermediate cath-D chain of 48
kDa whereas human cells produced the mature cath-D double chain of 34 +14 kDa,
as previously described (Felbor et al., 2002). As attempted, up-regulation of cath-D
was observed in MCF7 breast cancer cells when compared to HMF fibroblasts.
Interestingly, cath-D expression was increased in mature adipocytes in both NIH3T3F442A and NIH-3T3L1 cell lines (Fig. 2).
Given that cath-D transcription is up-regulated in obese tissues and as obesity is
characterized by the increase of intracellular lipid accumulation, a characteristic of
5
adipocyte differentiation which shows a significant correlation with adipocyte
differentiation, we next investigated whether cath-D may play a role in adipogenesis.
We first examined the regulation of cath-D expression during the course of
differentiation of NIH-3T3F442A preadipocyte cell line, a valuable model of
adipogenesis (Maquoi Neese et al., 2002) (Fig. 3). Interestingly, cath-D mRNA (Fig.
3A) and protein (Fig. 3B) expression was progressively up-regulated during
adipogenesis. Secreted cath-D was only detected in fully-differentiated adipocytes
from day 10 of differentiation (Fig. 3B). To validate our experimental conditions, we
studied in parallel the expression of PPARg (Fig. 3A), HSL (Fig. 3B) and aP2 (Fig.
3A) adipocyte markers of differentiation. As expected, the level of these markers was
progressively increased during acquisition of the adipocyte phenotype (Fig. 3A-B). In
addition, the cytoskeletal β actin protein amount was diminished during adipocyte
differentiation reflecting the change in cellular morphology (Fig. 3B), as described
before (Spiegelman & Farmer, 1982). To further assess that insulin treatment was
not specifically involved in the observed effect, we used fully-differentiated NIH3T3F442A adipocytes. As shown in Fig. 3C, the levels of cath-D protein remained
unaffected.
Although NIH-3T3F442A cells are a valuable experimental model, these
preadipocytes have distinct attributes compared with human cells in primary culture
beyond the obvious species differences. Therefore, we next examined the regulation
of cath-D expression during adipogenesis in human preadipocytes purified from
abdominal subcutaneous adipose tissue (Bour et al., 2007) (Fig. 4). These primary
human cells were differentiated in an efficient manner since about 75 % of
preadipocytes were converted to the adipocyte phenotype (Fig. 4A). As observed for
mouse adipocyte, expression of cath-D protein was also increased in human
6
differentiated adipocyte (Fig. 4B). Taken together, these findings indicate that cath-D
expression is up-regulated during mouse and human preadipocyte differentiation.
Silencing of cath-D inhibits adipogenesis
Since cath-D was up-regulated in obese tissue and as its expression was increased
during the adipocytic process, we subsequently investigated whether preadipocyte
requires cath-D expression in order to differentiate into mature adipocyte. Cath-D
expression was stably silenced in NIH-F442A preadipocytes with cath-D shRNA1 and
shRNA2 generating, respectively, the D10 and A4 clones (Fig. 5A). Control C34 and
C37 clones were obtained using Luc shRNA stably transfected in NIH-F442A
preadipocytes (Fig. 5A).
To evaluate the consequences of cath-D silencing in adipocyte differentiation, we
quantified the expression of PPARg, HSL and aP2 adipocyte differentiation markers
in Luc and cath-D shRNA transfected NIH-3T3F442A clones at day 7 of
differentiation (Fig. 5B). Cath-D silencing (Fig. 5B, panel a) significantly inhibited
PPARg (Fig. 5B, panel b), HSL (Fig. 5B panel c) and aP2 (Fig. 5B, panel d) mRNA
levels. These findings indicate that cath-D silencing inhibits adipogenic expression
markers.
Then, we analysed the cellular lipid levels in adipocytes silenced or not for cathD (Fig. 6). Indeed, the most obvious feature of adipocytes is the synthesis and
storage of triglycerides in lipid droplets and therefore the gradual appearance and
growth of lipid droplets are characteristic for adipocyte precursor cells undergoing
adipogenic differentiation. The presence of these neutral lipids was detected by oil
red O staining (Fig. 6A-B). As illustrated in Fig. 6A, oil red O staining after 7 days of
differentiation revealed that extinction of cath-D expression in A4 and D10 clones
7
strongly decreased neutral lipid droplet formation and/or accumulation as compared
to control C34 and C37 clones and to parental NIH-3T3F442A cells. Microscopic
analysis at day 7 of differentiation illustrated that, as attempted, C34 and C37 clones
accumulated numerous large lipid droplets and adopted a non adherent round
morphology characteristic of mature NIH-3T3F442A adipocytes (Fig. 6B). By
contrast, in A4 and D10 clones silenced for cath-D, the lipid droplet size and number
were strongly reduced (Fig. 6B). Moreover, cells kept the morphological feature of
adherent fibroblastic cells, suggesting that preadipocyte differentiation process did
not occur in the absence of cath-D. Quantification of lipids afterwards demonstrated
that silencing of cath-D in A4 and D10 clones significantly decreased lipid content
levels at day 7 of differentiation as compared to C34 and C37 control clones (Fig.
6C). Together, these findings reveal that cath-D silencing in preadipocytes inhibits
adipogenesis, leading to lipid-depleted cells.
8
Discussion
Our results demonstrate that cath-D expression is up-regulated in human obese
tissue. This up-regulation of cath-D expression in the VAT and SAT of
overweight/obese patients is in consensus with our results in obese mice. Obesity is
characterized by the increase of intracellular lipid accumulation which shows a
significant
correlation
with adipocyte
differentiation. Terminally differentiated
adipocytes cannot divide. Hence, alterations in the number of fat cells within the body
must be accomplished by the differentiation of preadipocytes, which act as a
renewable source of adipocytes.
Our data point out that cath-D expression increased gradually along with the
differentiation of NIH-3T3F442A cells into mature adipocytes. The comparable
increase between mRNA and protein levels observed in NIH-3T3F442A cells
suggests that the overall increase in cath-D expression following differentiation may
be primarily due to an increase in transcription with little or no post-transcriptional
regulation. Interestingly, our findings further revealed that fully-differentiated NIH3T3F442A adipocytes secrete pro-cath-D, suggesting its potential new function as an
adipokine. A recent study analysing the secretome of adipocytes reported that cathD is a secretory protein induced by insulin (Zhou et al., 2009). Similar up-regulation of
cath-D was observed during adipocyte conversion of primary culture of preadipocytes
isolated from human sub-cutaneous adipose tissue. Most functional studies on
adipocyte differentiation and function have been performed in the murine adipogenic
NIH-3T3L1 and NIH-F442A cell lines and in genetically modified mice. However,
there are fundamental differences in the lipoprotein metabolism of mouse and human
(Prawitt et al., 2008). Therefore, it is important to investigate the regulation cath-D
expression in human adipocytes as presented in this report. Our report highlights that
9
cath-D silencing by shRNAs in NIH-3T3F442A preadipocytes leads to lipid-depleted
cells and to a significant reduction of the expression of PPARg, HSL and aP2
adipocyte markers of differentiation, indicating that cath-D acts as a key positive
regulator of adipogenesis. Given that cath-D protein is required for adipocyte
differentiation and as it is abundantly expressed in fully-differentiated adipocytes, we
propose that cath-D may participate in the onset of obesity. Interestingly, murine
cath-D deficiency led to accumulation of cholesteryl esters in the brain, suggesting a
key role of cath-D in lipid metabolism (Mutka et al., 2009).
Experimental studies revealed that adipocytes support breast growth (Iyengar et al.,
2005; Iyengar & Scherer, 2003; Manabe et al., 2003). A supportive role of adipocytes
for breast growth has been demonstrated both in vivo and ex vivo (Iyengar et al.,
2005; Iyengar & Scherer, 2003; Manabe et al., 2003). Different proteases, described
to promote cancer and metastasis, have been shown to affect the biology of the
adipocyte. The metalloproteinases (Bouloumie et al., 2001; Maquoi et al., 2002) and
the cysteine cathepsins -K, -S and –L (Taleb et al., 2006; Xiao et al., 2006; Yang et
al., 2007) stimulate adipogenesis and are up-regulated in obesity. By contrast,
Stromelysin 3 inhibits adipogenesis and induces de-differentiation of adipocyte,
generating a population of fibroblast-like cells supporting the desmoplastic reaction
and
progression (Andarawewa et al., 2005). The role of cath-D up-regulated in
mature adipocyte regarding cancer remains unknown. Preliminary experiments
indicate that breast cancer cells secrete soluble factors that decrease cath-D
expression in adipocytes (data not shown), leading possibly to adipocyte dedifferentiation conversion, as described for Stromelysin 3 (Andarawewa et al., 2005).
In the near future, it will be important to investigate cath-D expression in biopsies
10
from normal and peri-al breast adipocytes to assess its possible role in the
adipocyte/cancer cells interface.
In conclusion, our findings highlight that cath-D plays a crucial role in the control of
adipogenesis. Moreover, our results indicate that cath-D is up-regulated in human
and mouse obese tissues. We propose that cath-D targeting in obesity may lead to a
decrease of hypertrophic adipocytes and of adipocyte hyperplasia. Since cath-D is
implicated in breast cancer progression, it may represent a molecular link between
cancer and obesity. Indeed, cath-D secreted by fully-differentiated adipocytes in large
amounts in obesity, may stimulate proliferation of breast cancer epithelial cells and
stromal fibroblasts, participating in the homeostasis of progression and metastasis.
11
Materials and Methods
Ethics Statement
All subjects gave their informed written consent to participate to the study, and
investigations were performed in accordance with the declaration of Helsinki as
revised in 2000 (http://www.wma.net/e/policy/b3.htm).
Cells and cell culture
Cell lines were cultured in DMEM (Invitrogen) supplemented with 10% fetal calf
serum (FCS). Differentiation was induced by incubating 3T3-F442A confluent cells in
differentiation medium (DMEM supplemented with 10% FCS and 50 nM insulin) as
described (Prawitt et al., 2008). Differentiation was induced by incubating 3T3-L1
confluent cells in differentiation medium (DMEM supplemented with 10% FCS and
10µg/ml insulin, 250 µM isobutylmethylxanthine, 1 µM rosiglitazone, 1 µM
dexamethasone).
RNA extraction and analysis
Total RNA was extracted using the Reasy minikit (QIAGEN Sciences, Maryland)
according to the manufacturer's instructions. Reverse transcription of total RNA was
performed at 37°C using Moloney murine leukemia virus reverse transcriptase
enzyme (Invitrogen, Carlsbad, CA) and random hexanucleotide primers (Promega,
Madison, WI). Quantitative PCR was carried out by real-time PCR using a
LightCycler and the DNA double-strand-specific SYBR green I dye for detection
(Roche, Basel, Switzerland). Results were normalized to RS9 levels. Sequences of
primers are:
12
mouse RS9 (sens 5’CGGCCCGGGAGCTGTTGACG3’, reverse
5’CTGCTTGCGGACCCTAATGTGACG3’),
mouse aP2 (sens 5’AACACCGAGATTTCCTTCAA3’, reverse
5’AGTCACGCCTTTCATAACACA3’),
mouse cath-D (sens 5’TTCGTCCTCCTTCGCGATT3’; reverse
5’TCCGTCATAGTCCGACGGATA3’)
mouse HSL (sens 5’CTGAAGGCTCTGAGTTGGTCAA3’, reverse
5’GGCTTACTGGGCACAGATACCT3’),
mouse PPARγ (sens 5’ AGGCCGAGAAGGAGAAGCTGTTG3’, reverse
5’TGGCCACCTCTTTGCTCTGCTC3’),
human cath-D (5’TTGCTGTTTTGTTCTGTGGTTTTC’, reverse
5’CAGACAGGCAGGCAGCATT3’).
Stable transfection of shRNAs in NIH-3T3F442A cells
NIH-3T3F442A cells were transfected with 1 µg of shLuc, anti-cath-D shRNA1 or
shRNA2 expression vectors (Invivogen) using Nucleofector Technology (Amaxa
biosystems) according to the manufacturer’s instructions and 40 clones resistant to
Blasticidin (4 µg/ml) were isolated. Clone D10 transfected with anti-cath-D shRNA1
and clone A4 transfected with anti-cath-D shRNA2 were the best clones selected for
cath-D silencing.
sh1 5’GGTTCCATGTAAGTCTGACCATCAAGAGTGGTCAGACTTACATGGACCC3’
sh2 5’GACCAGTCAAAGGCAAGAGGTTCAAGAGACCTCTTGCCTTTGACTGGTC3’
Oil Red O staining
13
NIH-3T3F442A adipocytes were washed with phosphate-buffered saline (pH 7.4) and
then fixed with Antigenfix (Diapath, Italy). Cells were stained with Oil Red O dye
(saturated Oil Red O dye in six parts of isopropanol and four parts of water), an
indicator
of
cell lipid
content,
and
then
exhaustively rinsed
with
water.
Spectrophotometric quantification of the stain was performed by dissolving the
stained oil droplets in the cell in isopropanol and measuring absorbance at 540 nm.
Human samples
Human adipose tissue was collected according to the guidelines of the Ethical
Committee of Toulouse-Rangueil and Nancy J. d’Arc Hospitals and received full
ethical approval from the Ethical Committee of Toulouse-Rangueil and Nancy J. d'Arc
Hospitals. All subjects gave their informed written consent to participate to the study.
Human abdominal visceral (VAT) adipose tissue and human subcutaneous adipose
tissue (SAT) samples were obtained from 9 patients healthy volunteers (42.7 +/- 4.5
yr old, BMI: 23.1 +/- 3.3 kg/m2) undergoing abdominal lipectomy for plastic surgery.
No clinical data from these patients were available. Human VAT adipose tissue
samples were obtained from 27 morbidly (grade III) obese subjects (44.5+/-1.8 yr old,
BMI: 47.6 +/- 1.3 kg/m2) before a bariatric surgery.
All subjects were drug-free and besides obesity they did not suffer of any disease.
Tissue samples were immediately frozen in liquid nitrogen and stored at -80°C. Total
RNAs of isolated adipocytes were extracted and cath-D expression analysed by RTPCR.
For in vitro differentiation, human preadipocytes were isolated from human
subcutaneous adipose tissue obtained from patients undergoing abdominal lipectomy
at the plastic surgery department of Rangueil Hospital (Toulouse, France) under the
14
agreement of local ethic committee. All subjects gave their informed written consent
to participate to the study. Adipose tissue pieces were immediately used for
collagenase digestion as previously described (Bour et al., 2007). The digestate was
centrifuged to separate adipocytes from the stroma-vascular fraction, containing
preadipocytes (pellet). Cells isolated from the SVF fraction were induced to
differentiate into adipocytes as previously described (Gesta et al., 2003). Briefly,
confluent cells (day 0) were induced to differentiate in DMEM/Ham’s F12 (1:1)
medium containing 0.01 mg/ml transferrin, 100 nM cortisol, 0.2 nM triiodothyronine,
and 20 nM insulin. To trigger differentiation, 25 nM dexamethasone, 500 mM IBMX
and 2 mM rosiglitazone were present from day 0 to day 4. Intracellular accumulation
of lipid droplets became clearly evident at day 10 (Bour et al., 2007).
Mice
Mice were handled in accordance with the principles and guidelines established by
the National Institute of Medical Research (INSERM). C57Bl6/J female mice were
obtained from Charles River laboratory (l’Arbresle, France). Mice were housed
conventionally in a constant temperature (20-22°C) and humidity (50–60%) animal
room and with a 12 h light–dark cycle. All mice had free access to food and water
throughout the experiment. C57Bl6/J mice were assigned to normal-fat diet (ND) or
high-fat diet (HFD) (SAFE, France). Energy contents of the specific diets were (%
kcals): 20% protein, 70% carbohydrate, and 10% fat for ND; 20% protein, 35%
carbohydrate, and 45% fat for HFD. The main source of fat in HFD was lard (20
g/100g of food). C57Bl6/J (10 week old) mice were fed a ND or HFD for 20 weeks. All
mice were sacrificed at 30 weeks of age.
15
Isolation of adipocytes from mouse adipose tissue
Mouse intra-abdominal adipose tissues were dissected immediately after sacrifice,
minced in 5 ml of Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies,
Inc., Invitrogen, Paisley, UK) supplemented with 1 mg/ml collagenase (SIGMA) and
1% BSA for 30 min at 37°C under shaking. Digestion was followed by filtration
through a 150 µm screen, and the floating adipocytes were separated from the
medium containing the stroma-vascular fraction (SVF). Adipocytes were washed
twice in DMEM and further processed for RNA extraction using the RNeasy mini kit
(Qiagen, Germany).
Immunoblots
Cells were lysed in lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol,
1 % Triton X100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPI, 500 µm
Na-Vanadate, 1 mM PMSF, 10µM Aprotinine, and a protease inhibitor cocktail). After
gentle shaking for 20 min at 4°C, cell extracts were obtained by centrifugation in a
microfuge at 13,000 rpm for 15 min at 4°C. Equal amounts of protein (100 μg) from
cell extracts, quantitated by the Bradford assay, were separated on a 7% gel by SDSPAGE. Proteins were electro-transferred to PVDF membrane and incubated with 1
µg/ml anti-mouse cath-D (Santa Cruz Biotechnology), 1 μg/ml anti-α tubulin (Lab
Vision Corporation), 1 µg/ml anti-b actin (Sigma), 1 µg/ml ERK2 (Santa Cruz
Biotechnology), or 0.4 µg/ml anti-HSL (Santa Cruz Biotechnology). Proteins were
visualized
with
horseradish
peroxidase-conjugated
sheep
anti-mouse
immunoglobulin (ECL Amersham) or horseradish peroxidase-conjugated rabbit antigoat
immunoglobulin
(ECL
Amersham)
followed
by
the
Renaissance
chemiluminescence system (Perkin Life Sciences).
16
Statistical analysis. Results are expressed as means ± SEM. Statistical differences
between two groups were evaluated using Student’s t tests. The level of significance
was set at P < 0.05.
ACKNOWLEDGEMENTS
This work was supported by the ‘Institut National de la Santé et de la Recherche
Médicale’, the University of Montpellier I, the Canceropole Grand Sud-Ouest and the
Institut National du Cancer (INCA grants PL2006_035).
CONFLICT OF INTEREST
The authors declare no conflict of interest.
REFERENCES
Andarawewa KL, Motrescu ER, Chenard MP, Gansmuller A, Stoll I, Tomasetto C and
Rio MC. (2005). Cancer Res, 65, 10862-71.
Berchem G, Glondu M, Gleizes M, Brouillet JP, Vignon F, Garcia M and LiaudetCoopman E. (2002). Oncogene, 21, 5951-5.
Bouloumie A, Sengenes C, Portolan G, Galitzky J and Lafontan M. (2001). Diabetes,
50, 2080-6.
Bour S, Daviaud D, Gres S, Lefort C, Prevot D, Zorzano A, Wabitsch M, SaulnierBlache JS, Valet P and Carpene C. (2007). Biochimie, 89, 916-25.
Calle EE and Kaaks R. (2004). Nat Rev Cancer, 4, 579-91.
Capony F, Morisset M, Barrett AJ, Capony JP, Broquet P, Vignon F, Chambon M,
Louisot P and Rochefort H. (1987). J Cell Biol, 104, 253-62.
17
Capony F, Rougeot C, Montcourrier P, Cavailles V, Salazar G and Rochefort H.
(1989). Cancer Res, 49, 3904-9.
Felbor U, Kessler B, Mothes W, Goebel HH, Ploegh HL, Bronson RT and Olsen BR.
(2002). Proc Natl Acad Sci U S A, 99, 7883-8.
Ferrandina G, Scambia G, Bardelli F, Benedetti Panici P, Mancuso S and Messori A.
(1997). Br J Cancer, 76, 661-6.
Foekens JA, Look MP, Bolt-de Vries J, Meijer-van Gelder ME, van Putten WL and
Klijn JG. (1999). Br J Cancer, 79, 300-7.
Fusek M and Vetvicka V. (1994). Biochem J, 303 ( Pt 3), 775-80.
Garcia M, Derocq D, Pujol P and Rochefort H. (1990). Oncogene, 5, 1809-14.
Gesta S, Lolmede K, Daviaud D, Berlan M, Bouloumie A, Lafontan M, Valet P and
Saulnier-Blache JS. (2003). Horm Metab Res, 35, 158-63.
Glondu M, Coopman P, Laurent-Matha V, Garcia M, Rochefort H and LiaudetCoopman E. (2001). Oncogene, 20, 6920-9.
Glondu M, Liaudet-Coopman E, Derocq D, Platet N, Rochefort H and Garcia M.
(2002). Oncogene, 21, 5127-34.
Hu L, Roth JM, Brooks P, Luty J and Karpatkin S. (2008). Cancer Res, 68, 4666-73.
Iyengar P, Espina V, Williams TW, Lin Y, Berry D, Jelicks LA, Lee H, Temple K,
Graves R, Pollard J, Chopra N, Russell RG, Sasisekharan R, Trock BJ,
Lippman M, Calvert VS, Petricoin EF, 3rd, Liotta L, Dadachova E, Pestell RG,
Lisanti MP, Bonaldo P and Scherer PE. (2005). J Clin Invest, 115, 1163-76.
Iyengar P and Scherer PE. (2003). Pediatr Diabetes, 4, 32-7.
Laurent-Matha V, Maruani-Herrmann S, Prebois C, Beaujouin M, Glondu M, Noel A,
Alvarez-Gonzalez ML, Blacher S, Coopman P, Baghdiguian S, Gilles C,
18
Loncarek J, Freiss G, Vignon F and Liaudet-Coopman E. (2005). J Cell Biol,
168, 489-99.
Liaudet-Coopman E, Beaujouin M, Derocq D, Garcia M, Glondu-Lassis M, LaurentMatha V, Prebois C, Rochefort H and Vignon F. (2006). Cancer Lett, 237, 16779.
Liaudet E, Derocq D, Rochefort H and Garcia M. (1995). Cell Growth Differ, 6, 104552.
Liaudet E, Garcia M and Rochefort H. (1994). Oncogene, 9, 1145-54.
Manabe Y, Toda S, Miyazaki K and Sugihara H. (2003). J Pathol, 201, 221-8.
Maquoi E, Munaut C, Colige A, Collen D and Lijnen HR. (2002). Diabetes, 51, 1093101.
Maquoi Neese RA, Misell LM, Turner S, Chu A, Kim J, Cesar D, Hoh R, Antelo F,
Strawford A, McCune JM, Christiansen M and Hellerstein MK. (2002). Proc
Natl Acad Sci U S A, 99, 15345-50.
Mueller MM and Fusenig NE. (2004). Nat Rev Cancer, 4, 839-49.
Mutka AL, Haapanen A, Kakela R, Lindfors M, Wright AK, Inkinen T, Hermansson M,
Rokka A, Corthals G, Jauhiainen M, Gillingwater TH, Ikonen E and Tyynela J.
(2009). J Neurochem.
Prawitt J, Niemeier A, Kassem M, Beisiegel U and Heeren J. (2008). Exp Cell Res,
314, 814-24.
Rajala MW and Scherer PE. (2003). Endocrinology, 144, 3765-73.
Renehan AG, Tyson M, Egger M, Heller RF and Zwahlen M. (2008). Lancet, 371,
569-78.
Rochefort H. (1992). Eur J Cancer, 28A, 1780-3.
Rochefort H and Liaudet-Coopman E. (1999). Apmis, 107, 86-95.
19
Rodriguez J, Vazquez J, Corte MD, Lamelas M, Bongera M, Corte MG, Alvarez A,
Allende M, Gonzalez L, Sanchez M, Vijande M, Garcia Muniz J and Vizoso F.
(2005). Int J Biol Markers, 20, 103-11.
Spiegelman BM and Farmer SR. (1982). Cell, 29, 53-60.
Taleb S, Cancello R, Clement K and Lacasa D. (2006). Endocrinology, 147, 4950-9.
van Kruijsdijk RC, van der Wall E and Visseren FL. (2009). Cancer Epidemiol
Biomarkers Prev, 18, 2569-78.
Westley B and Rochefort H. (1980). Cell, 20, 353-62.
Westley BR and May FE. (1999). Br J Cancer, 79, 189-90.
Wiseman BS and Werb Z. (2002). Science, 296, 1046-9.
Wright ME, Chang SC, Schatzkin A, Albanes D, Kipnis V, Mouw T, Hurwitz P,
Hollenbeck A and Leitzmann MF. (2007). Cancer, 109, 675-84.
Xiao Y, Junfeng H, Tianhong L, Lu W, Shulin C, Yu Z, Xiaohua L, Weixia J, Sheng Z,
Yanyun G, Guo L and Min L. (2006). J Clin Endocrinol Metab, 91, 4520-7.
Yang M, Zhang Y, Pan J, Sun J, Liu J, Libby P, Sukhova GK, Doria A, Katunuma N,
Peroni OD, Guerre-Millo M, Kahn BB, Clement K and Shi GP. (2007). Nat Cell
Biol, 9, 970-7.
Zhou H, Xiao Y, Li R, Hong S, Li S, Wang L, Zeng R and Liao K. (2009). Acta
Biochim Biophys Sin (Shanghai), 41, 910-21.
20
a
*
3000
cath-D mRNA
(arbitrary unit)
B
b
*
4000
3000
2000
2000
**
8000
cath-D mRNA
(arbitrary unit)
A
6000
4000
1000
1000
0
normal
VAT
obese
VAT
0
2000
0
normal
SAT
obese
SAT
ND
HFD
Figure 1
Figure 1. Cath-D expression is up-regulated in human and mouse obese adipose
tissues
(A) Cath-D expression in adipose tissue from lean and obese human. Cath-D mRNA
level was quantified in human intra-abdominal visceral adipose tissue samples (VAT)
(panel a) and in human subcutaneous adipose tissue samples (SAT) (panel b) obtained
from 27 morbide grade III obese patients (44.5+/-1.8 year old, BMI: 47.6 +/- 1.3 kg/m2)
before a bariatric surgery and from 9 control patients undergoing abdominal lipectomy for
plastic surgery (42.7 +/- 4.5 year old, BMI: 23.1 +/- 3.3 kg/m2). Results are means +/SEM, *P<0.01 when compared with controls (normal VAT or normal SAT).
(B) Cath-D expression in adipocytes from obese mouse. Cath-D mRNA level was
quantified in adipocytes isolated from intra-abdominal adipose tissues from 30-week-old
overweight C57Bl6/J mice fed in high-fat diet (HFD) and from C57Bl6/J control mice fed
in normal diet (ND). Results are means +/- SEM from 5 mice for ND group and 4 mice for
HFD group. *P<0.005 when compared with ND controls.
Co
D7
MCF-7
D7
HMF
Co
3T3-L1
NIH-3T3
3T3-F442A
52K 48K cath-D
34K -
a-tubulin
Figure 2
Figure 2. Cath-D expression in pre-adipocytes, adipocytes, fibroblasts and breast
epithelial cancer cells
Cath-D expression was analysed by immunoblotting in confluent preadipocytes (Co) and
adipocytes differentiated for 7 days (D7) in NIH-3T3F442A and NIH-3T3-L1 cell lines, in
NIH-3T3 mouse fibroblasts, HMF human breast fibroblasts, and MCF-7 human epithelial
breast cancer cells . a-tubulin served as a loading control.
A
cath-D mRNA
(ratio RS9)
8
cath-D
*
6
*
*
*
4
2
0
PPARg mRNA
(ratio RS9)
25
PPARg
20
15
10
5
0
aP2
aP2 mRNA
(ratio RS9)
100
80
60
40
20
0
Ex
Co
D1
D2
D3
D7
D10 D14 D17
days relative to confluence
B
Ex
Co
D1
D2
D3
D7
D10
D14
cellular cath-D
secreted cath-D
HSL
b actin
ERK2
C
8h
Insulin
-
24h
+
-
48h
+
cath-D
ERK2
Figure 3
-
+
D17
Figure 3. Cath-D expression increases during adipogenesis of NIH-3T3F442A
preadipocytes
(A) Cath-D mRNA expression during adipogenesis. RNA expression of cath-D,
PPARg and aP2 were analysed in exponentially growing NIH-3T3F442A
preadipocytes (Ex), in NIH-3T3F442A grown to confluence (Co) and after the
indicated time of culture in adipogenic differentiation medium by real-time
quantitative RT-PCR. Mean ± SD of 4 independent experiments is shown. P<0.05
when compared to confluent adipocytes (Co).
(B) Cath-D expression during adipogenesis. Protein expression of cath-D HSL, bactin and ERK2 were analysed by immunoblotting in exponentially growing NIH3T3F442A preadipocytes (Ex), in NIH-3T3F442A grown to confluence (Co), and
after the indicated time following induction of the differentiation process. Pro-cath-D
secreted for 24h was analyzed during differentiation. ERK2 was used as a loading
control. Similar results were observed in two independent experiments.
(C) Cath-D regulation by insulin in adipocytes. NIH-3T3F442A adipocytes
differentiated for 10 days were grown for 8h, 24h and 48h in adipogenic
differentiation medium. Cath-D protein expression was analysed by immunoblotting
and ERK2 served as loading control.
A
a
D0
D3
D7
D7
D14
D14
D0
cath-D
cath-D
NS
NS
HSL
b
Exp 1
400
cath-D protein
(% D0)
B
D3
D0
Exp2
300
200
100
0
D0
D7
Figure 4
D14
D3
D7
D14
Figure 4. Expression of cath-D during adipogenesis in human
(A) Micrographs of human adipocytes. Human preadipocytes isolated from
subcutaneous adipose tissue digested with collagenase and separated from the
stromal vascular fraction were grown for 0, 3, 7 and 14 days in the presence of the
adipogenic medium as illustrated in the micrographs. A representative experiment is
shown.
(B) Cath-D protein expression during adipogenesis. Protein expression of cath-D and
HSL was analysed by immunoblotting after the indicated time following induction of
the differentiation process (panel a). Two independent experiments (panel a, left and
right panels) are presented. NS, non specific band showing sample loading.
Quantification of cath-D expression in non-differentiated adipocytes at day 0 (D0)
and in differentiated adipocytes at days 7 and 14 (D7, D14) is shown in panel b.
Exp; experiment.
shLuc
A
F442A
C34
shcath-D
C37
A4
D10
cath-D
α tubulin
B
a
140
b
cath-D
PPARg mRNA (% F442A cells)
cath-D mRNA (% F442A cells)
B
120
100
80
60
*
40
*
20
0
400
300
200
100
*
*
0
F442A
C34
C37
A4
F442A
D10
c
C34
C37
A4
D10
*
*
A4
D10
d
HSL
250
ap2 mRNA (% F442A cells)
HSL mRNA (% F442A cells)
PPARg
300
200
100
*
*
aP2
200
150
100
50
0
0
F442A
C34
C37
A4
D10
Figure 5
F442A
C34
C37
Figure 5. Silencing of cath-D inhibits expression of adipocyte differentiation markers.
(A) Silencing of cath-D by shRNAs. NIH-3T3F442A preadipocytes were stably transfected
with Luc shRNA (C34 and C37 clones), cath-D shRNA1 (D10 clone) and cath-D shRNA2
(A4 clone). Cath-D protein expression was monitored by immunoblotting in C34, C37, A4,
D10 clones and in parental F442A cells. a tubulin was used as a loading control. A
representative experiment out of 3 is shown.
(B) mRNA expression of cath-D, PPARg, HSL and aP2 in cath-D-silenced preadipocytes.
RNA expression of cath-D, PPARg, HSL and aP2 was analysed in Luc shRNA clones
(C34 and C37) or cath-D shRNA clones (A4 and D10) after 7 day in the adipogenic
differentiation medium. Mean ± SD of 3 independent experiments is shown. *P< 0.005
when compared with C37 clone.
A
F442-A
C34
C37
A4
D10
F442-A
C34
C37
A4
D10
B
C
lipid content (% F442-A cells)
200
150
100
*
*
50
0
F442A
C34
C37
Figure 6
A4
D10
Figure 6. Cath-D expression is required for adipogenesis.
(A) Staining of neutral lipids. Plates of parental NIH-3T3F442A cells, Luc shRNA
(C34 and C37) and cath-D shRNA (A4 and D10) clones are presented at day 7 of
differentiation. The extent of cellular lipid accumulation was revealed by oil Red O
staining. A representative experiment out of 3 is shown.
(B) Micrographs. Micrographs of parental NIH-3T3F442A cells, Luc shRNA (C34 and
C37) and cath-D shRNA (A4 and D10) clones were performed at 7 of differentiation.
A representative experiment out of 3 is shown.
(C) Quantification of neutral lipids. Lipid content was quantified at day 7 of
differentiation in parental NIH-3T3F442A cells, Luc shRNA (C34 and C37) and cathD shRNA (A4 and D10) clones. Mean ± SD of triplicate of is shown. *P< 0.025 when
compared with C37 clone. A representative experiment out of 2 is shown.
II. Etude du rôle du LRP1 dans les adipocytes
1) Introduction :
L’obésité qui se caractérise par l’augmentation de la taille (hypertrophie) et du nombre
(hyperplasie) des adipocytes est fréquemment associée à certaines pathologies comme le
diabète de type 2, des troubles cardio-vasculaires, l’hypertension et certains cancers. Le
nombre des adipocytes d’un organisme est déterminé par un processus finement régulé de
différenciation de cellules précurseur. Ce processus est régulé par différents facteurs de
transcription, qui vont engendrer l’expression coordonnée de centaines de protéines qui
permettront l’engagement et le maintien du phénotype terminal des adipocytes. Parmi eux,
PPARγ (peroxisome proliferator-activated receptor gamma) joue un rôle capital, car les
souris déficientes en PPARγ au niveau des adipocytes présentent un tissu adipeux très peu
développé. PPARγ induit l’expression de gènes lipogéniques tel aP2 (fatty acid binding
protein), ou de gènes lipolytiques tel la lipase hormono-sensibles. De façon très intéressante,
ce récepteur nucléaire up-régule également la transcription du gène du LRP1 (LDL receptorrelated protein1), récemment identifié par l’équipe comme étant un nouveau récepteur de la
cath-D (publication soumise). LRP1 est un récepteur d’endocytose composé d’une sous-unité
α et d’une sous-unité β. Ce récepteur reconnaît une quarantaine de ligands différents, et est
impliqué dans divers processus physiologique. LRP1 est fortement exprimé dans les
hépatocytes, les neurones, et les cellules musculaires lisses. Il participe à l’élimination de
nombreux complexes protéiques dans le foie, est impliqué dans la transmission synaptique et
joue un rôle protecteur de l’athérosclérose. L’expression de LRP1 est particulièrement élevée
dans les adipocytes où il participerait à l’homéostasie des lipides. Ce récepteur interagit avec
la protéine ApoE présente dans les lipoprotéines circulantes et permet l’assimilation des
triglycérides et des esters de cholestérol en agissant de concert avec la lipoprotéine lipase.
Une étude récente montre que les souris déficientes en LRP1 dans les adipocytes matures
présentent un poids corporel plus faible, des réserves lipidiques réduites, ainsi que élimination
des lipides après la prise alimentaire. De plus, il a été suggéré que ce récepteur serait impliqué
dans les voies de signalisation conduisant à la synthèse des acides gras et qu’il régulerait
également l’homéostasie du cholestérol. Cependant, la fonction de LRP1 dans la biologie du
pré-adipocyte demeure encore inconnue. De plus, l’expression de LRP1 chez l’individu obèse
n’a pas été rapportée. Dans cette étude, nous avons quantifié le taux d’expression du LRP1
chez l’homme et la souris obèse. Nous avons également analysé l’expression du LRP1 au
cours de la différenciation des adipocytes dans des modèles humain et murin. De plus, afin de
64
déterminer le rôle de ce récepteur au cours de l’adipogenèse, nous avons inhibé de façon
stable son expression dans les pré-adipocytes par l’utilisation de siRNA anti-LRP1 et nous
avons étudié les conséquences sur l’expression des marqueurs de la différenciation
adipocytaire, PPARg, aP2 et HSL et sur l’accumulation des lipides pendant l’induction de
l’adipogenèse. Finalement, l’expression du LRP1 a été inhibée dans l’adipocyte mature et les
conséquences sur l’accumulation a été étudiée.
65
2) Article 2:
LRP1 receptor controls adipogenesis and is up-regulated
in human and mouse obese adipose tissue
66
LRP1 Receptor Controls Adipogenesis and Is UpRegulated In Human and Mouse Obese Adipose Tissue
Olivier Masson1, Carine Chavey1, Cédric Dray2,3, Aline Meulle3,4, Danielle Daviaud2,3, Didier Quilliot5,
Catherine Muller4, Philippe Valet2,3, Emmanuelle Liaudet-Coopman1*
1 IRCM, Institut de Recherche en Cancérologie de Montpellier, INSERM, U896, Université Montpellier1, CRLC Val d’Aurelle Paul Lamarque, Montpellier, France, 2 Institut
National de la Santé et de la Recherche Médicale (INSERM), U858, Toulouse, France, 3 Université de Toulouse, UPS, Institut de Médecine Moléculaire de Rangueil, Equipe
nu3, IFR31, Toulouse, France, 4 Institute of Pharmacology and Structural Biology CNRS UMR 5089, Université de Toulouse, Toulouse, France, 5 Service de diabétologie,
Maladies métaboliques et nutrition, CHU de Nancy, Hôpital J. d’Arc, Nancy France
Abstract
The cell surface low-density lipoprotein receptor-related protein 1, LRP1, plays a major role in lipid metabolism. The
question that remains open concerns the function of LRP1 in adipogenesis. Here, we show that LRP1 is highly expressed in
murine preadipocytes as well as in primary culture of human adipocytes. Moreover, LRP1 remains abundantly synthesised
during mouse and human adipocyte differentiation. We demonstrate that LRP1 silencing in 3T3F442A murine preadipocytes
significantly inhibits the expression of PPARc, HSL and aP2 adipocyte differentiation markers after adipogenesis induction,
and leads to lipid-depleted cells. We further show that the absence of lipids in LRP1-silenced preadipocytes is not caused by
lipolysis induction. In addition, we provide the first evidences that LRP1 is significantly up-regulated in obese C57BI6/J
mouse adipocytes and obese human adipose tissues. Interestingly, silencing of LRP1 in fully-differentiated adipocytes also
reduces cellular lipid level and is associated with an increase of basal lipolysis. However, the ability of mature adipocytes to
induce lipolysis is independent of LRP1 expression. Altogether, our findings highlight the dual role of LRP1 in the control of
adipogenesis and lipid homeostasis, and suggest that LRP1 may be an important therapeutic target in obesity.
Citation: Masson O, Chavey C, Dray C, Meulle A, Daviaud D, et al. (2009) LRP1 Receptor Controls Adipogenesis and Is Up-Regulated In Human and Mouse Obese
Adipose Tissue. PLoS ONE 4(10): e7422. doi:10.1371/journal.pone.0007422
Editor: Yihai Cao, Karolinska Institutet, Sweden
Received March 9, 2009; Accepted September 22, 2009; Published October 12, 2009
Copyright: ß 2009 Masson et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Institut National de la Santé et de la Recherche Médicale’, the University of Montpellier I, the Canceropole Grand Sud-Ouest and the Institut National du
Cancer (INCA grants PL2006_035). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]
triglycerides and cholesteryl esters from remnant lipoproteins in
postprandial adipocytes in a synergistic action with lipoprotein lipase
[10]. Adipose-specific LRP1-knockout mice generated by crossing
LRP1flox/flox mice with aP2-Cre transgenic mice recently revealed its
prominent role in lipid assimilation affecting energy metabolism and
diet-induced obesity in mature adipocytes [12]. Even through the
fundamental function of LRP1 in lipid homeostasis was recently
revealed in mouse model [12], its role in adipogenesis remains to be
elucidated. Here, we report that LRP1 expression is necessary for
adipocyte differentiation. Silencing of LRP1 in preadipocytes by the
use of siRNAs significantly inhibits the expression of PPARc, HSL and
aP2 adipocyte differentiation markers, and leads to lipid-depleted cells
inept to induce lipolysis. Moreover, we corroborated the key function
of LRP1 in maintaining the lipid levels in mature adipocytes. Until
now, the implication of LRP1 in obesity has not been reported yet in
human. Our study highlights, for the first time, that LRP1 expression is
up-regulated in obese human tissue, and suggests that this receptor may
be an interesting therapeutic target in obesity.
Introduction
Consumption of meals rich in fat and carbohydrates is a major
causative factor of obesity, resulting in excessive white adipose tissue.
Adipose tissue serves as an energy reservoir and as an endocrine organ.
An increase of adipose tissue mass results from combined hypertrophy
of existing adipocytes (hypertrophic adipocytes) and adipogenic
differentiation of precursor cells (hyperplasic adipocytes) [1]. Expression of the nuclear peroxisome proliferator-activated receptor c
(PPARc) is known to be crucial for the initiation of adipocyte
differentiation. Indeed, mice with a targeted adipocyte-specific deletion
of the PPARc gene display a decreased adipose tissue mass [2].
Activation of PPARc induces the expression of lipogenic genes, such as
adipocyte fatty acid binding protein (aP2), and of lipolytic genes, such
as hormone-sensitive lipase (HSL) [3]. Interestingly, activated PPARc
also stimulates the transcription of the low-density lipoprotein receptorrelated protein 1 (LRP1) in adipocytes [4].
LRP1 is a 600-kDa multifunctional endocytic receptor that binds
and internalizes a broad range of biologically diverse ligands including
proteins important in lipoprotein metabolism [5]. LRP1 mediates the
endocytotic internalization of dietary lipids carried in postprandial
chylomicron remnants into hepatocytes by binding to Apolipoprotein
E (ApoE) [6,7], particle–bound lipoprotein lipase (LpL) [8] and hepatic
lipase [9]. Interestingly, LRP1 is expressed in adipocytes [4,10,11] and
insulin stimulation of LRP1 increases the endocytic uptake of
PLoS ONE | www.plosone.org
Results
LRP1 is highly expressed in adipocytes during
adipogenesis in mouse and human
In order to explore the function of adipocytic LRP1, we first
investigated the level of LRP1 protein expression in preadipocytes
1
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
relative to fibroblasts and epithelial cancer cells. As illustrated in
Figure 1A, LRP1 was abundantly expressed in preadipocytes (3T3F442A, 3T3-L1) and in fibroblasts (NIH-3T3, LRP1+/2MEFs, HMF),
when compared to epithelial mammary immortalized (HMT3522S1) or cancer (MCF7, MDA-MB231) cells. As expected, no LRP1
expression was detected in LRP12/2MEF cells (Fig. 1A).
To assess the role of LRP1 in preadipocytes, we next examined
the regulation of its expression during the course of adipogenesis
in the well-established murine 3T3F442A preadipocyte cell line,
which has been validated as a valuable model of adipogenesis [13]
(Fig. 1B–C). LRP1 mRNA (Fig. 1B) and LRP1b protein (Fig. 1C)
were expressed at high levels along adipogenesis. Even through, a
tendency of LRP1 up-regulation was observed, no statistical
significance was reached (Fig. 1B–C). To validate our experimental
conditions, we studied in parallel the expression of PPARc (Fig. 1B),
HSL (Fig. 1C) and aP2 (Fig. 1B) adipocyte markers of differentiation. As attempted, the level of these markers was progressively
increased during acquisition of the adipocyte phenotype (Fig. 1B–
C). In addition, the cytoskeletal bactin protein amount was
diminished during adipocyte differentiation reflecting the change
in cellular morphology (Fig. 1C), as described before [14].
Although 3T3F442A cells are a valuable experimental model,
these preadipocytes have distinct attributes compared with human
cells in primary culture beyond the obvious species differences.
Therefore, we also analysed LRP1 expression during adipogenesis
in human preadipocytes purified from abdominal subcutaneous
adipose tissue using a recent approach [15] (Fig. 2). These primary
human cells were differentiated in an efficient manner since about
75% of preadipocytes were converted to the adipocyte phenotype
(Fig. 2A) and as reflected by HSL induction (Fig. 2B). As observed
for the mouse adipocyte, LRP1b protein remained abundantly
expressed along human adipocyte differentiation (Fig. 2B). Taken
together, these findings report the presence of high LRP1 levels
during adipocyte differentiation in both mouse and human.
Silencing of LRP1 expression inhibits adipogenesis
To determine whether preadipocyte requires LRP1 to differentiate into mature adipocyte, LRP1 expression was silenced in
3T3F442A preadipocytes using 3 LRP1 siRNAs. As shown in
Figure 3A, a robust LRP1b extinction was observed two days posttransfection with LRP1 siRNAs as compared to control Luc siRNA.
Consequently, we induced adipogenesis in control (Luc siRNA) and
LRP1-silenced 3T3F442A preadipocytes two days post-transfection
(Fig. 3B). As shown in Fig. 3B, LRP1b protein expression was
inhibited by the 3 LRP1 siRNAs as compared to Luc siRNA during
differentiation. The most efficient siRNA, LRP1 siRNA1, inhibited
LRP1b protein still after 7 days of differentiation (Fig. 3B). A
gradual lost of efficiency was observed with LRP1 siRNA2 and
siRNA3 at days 3, 5 and 7 days of differentiation (Fig. 3B). Similar
LRP1 silencing was observed at the mRNA level (Fig. 4A, panel a;
Fig. 4B, panel a), with a significant reduction of 74% and 50% for
LRP1 siRNA1 after 3 and 7 days of differentiation.
In order to evaluate the consequences of LRP1 silencing in
adipocyte differentiation, we first quantified the expression of
PPARc, HSL and aP2 adipocyte differentiation markers in Luc and
LRP1 siRNA transfected 3T3F442A cells (Fig. 4). LRP1 siRNA1
silencing (Fig. 4A, panel a) significantly inhibited PPARc (Fig. 4A,
panel b), HSL (Fig. 4A, panel c) and aP2 (Fig. 4A, panel d) mRNA
levels at days 3 and 7 of differentiation. Extinction of LRP1
expression by LRP1 siRNA2 and siRNA3 (Fig. 4B, panel a) also
reduced PPARc (Fig. 4B, panel b), HSL (Fig. 4B, panel c) and aP2
(Fig. 4B, panel d) mRNA levels at days 3 and 7 of differentiation but
to a lesser extend as compared to LRP1 siRNA1. Hence, our results
indicate that the gradual lost of LRP1 expression by LRP1 siRNAs
PLoS ONE | www.plosone.org
Figure 1. Expression of LRP1 in mouse adipocytes during
adipogenesis. (A) LRP1b protein expression. Expression of LRP1b,
and ERK2 were analysed by immunoblotting in preadipocytes (3T3F442A, 3T3-L1), fibroblasts (NIH-3T3, LRP12/2MEF, LRP1+/2MEF, HMF), and
epithelial (HMT3522-S1, MCF7, MDA-MB-231) cells. COS cells transfected
with LRP1b serve as a positive control for LRP1b expression. ERK2 was
used as a loading control. (B) LRP1 mRNA expression during
adipogenesis. RNA expression of LRP1, PPARc and aP2 were analysed
in exponentially growing 3T3F442A preadipocytes (Ex), in 3T3F442A
grown to confluence (Co) and after the indicated time of culture in
adipogenic differentiation medium by real-time quantitative RT-PCR.
Mean 6 SD of 5 independent experiments quantified in duplicate is
shown. LRP1 mRNA expression was not statistically different during
adipogenesis. (C) LRP1b protein expression during adipogenesis.
Protein expression of LRP1b, HSL, bactin and ERK2 were analysed by
immunoblotting in exponentially growing 3T3F442A preadipocytes (Ex)
and after the indicated time following induction of the differentiation
process. ERK2 was used as loading control. Similar results were
observed in 3 independent experiments. LRP1b protein expression
was not statistically different during adipogenesis.
doi:10.1371/journal.pone.0007422.g001
(Fig. 4B, panel a) led to a concomitant decrease of adipocyte
differentiation marker expression (Fig. 4B, panels b-d). Altogether,
these findings highlight that LRP1 tightly controls adipogenic
expression markers in a dose-dependent manner.
2
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Figure 2. Expression of LRP1 during adipogenesis in human. (A) Micrographs of human adipocytes. Human preadipocytes isolated from
subcutaneous adipose tissue digested with collagenase and separated from the stromal vascular fraction were grown for 0, 3, 7 and 14 days in the
presence of the adipogenic medium as illustrated in the micrographs. A representative experiment is shown. (B) LRP1b protein expression
during adipogenesis. Protein expression of LRP1b and HSL was analysed by immunoblotting after the indicated time following induction of the
differentiation process. NS, non specific band showing sample loading. Two independent experiments (left and right panels) are presented.
doi:10.1371/journal.pone.0007422.g002
We finally studied the effects of silencing LRP1 in preadipocyte
on lipolysis. Indeed, only mature adipocytes possess the complete
apparatus for lipolysis. Our results indicating a significant decrease
of HSL expression in LRP1 silenced cells (Fig. 4), we, therefore,
advocate that lipolysis should be absent in LRP1-silenced
preadipocytes. An alternative could be that LRP1 silenced cells
have an increased lipolysis, leading to lipid depleted cells.
However, our results revealed that glycerol release over 18 h
was significantly reduced in LRP1 silenced cells, indicating
inhibition of basal lipolysis (Fig. 6A). Moreover, glycerol and
NEFA released in the media after isoproterenol treatment were
also significantly decreased in LRP1 silenced cells, evidencing
inhibition of induced-lipolysis. Therefore, extinction of LRP1 in
preadipocytes abolishes expression of adipocyte differentiation
markers and leads to lipid-depleted cells inept to induce lipolysis.
Then, we analysed the cellular lipid levels in adipocytes silenced
or not for LRP1 (Fig. 5). Indeed, the most obvious feature of
adipocytes is the synthesis and storage of triglycerides in lipid
droplets and therefore the gradual appearance and growth of lipid
droplets are characteristic for adipocyte precursor cells undergoing
adipogenic differentiation. The presence of these neutral lipids was
detected by oil red O staining (Fig. 5A–B). As illustrated in Fig. 5A,
oil red O staining after 7 days of differentiation revealed that
extinction of LRP1 expression by siRNA1 strongly decreased
neutral lipid droplet formation and/or accumulation. Microscopic
analysis at day 3 and 7 of differentiation illustrated that, as
attempted, Luc siRNA-transfected 3T3F442A cells accumulated
numerous large lipid droplets and adopted a non adherent round
morphology characteristic of mature adipocytes (Fig. 5B, panels a
and c). By contrast, in 3T3F442A cells silenced with LRP1
siRNA1, the lipid droplet size and number were strongly reduced
(Fig. 5B, panels b and d). Moreover, cells kept the morphological
feature of adherent fibroblastic cells, suggesting that preadipocyte
differentiation process did not occur in the absence of LRP1.
Quantification of lipids afterwards demonstrated that silencing of
LRP1 with LRP1 siRNA1 significantly decreased lipid content
levels by 7 fold at day 7 of differentiation (Fig. 5C, panel a). LRP1
siRNA2 and siRNA3 also lowered the lipid content but to a lesser
extend as compared to LRP1 siRNA1 (Fig. 5C, panel a). Similar
results were obtained by quantifying triglycerides (Fig. 5C, panel
b). These results reveal that LRP1 silencing in preadipocytes
inhibits adipogenesis, leading to lipid-depleted cells.
PLoS ONE | www.plosone.org
LRP1 expression is up-regulated in human and mouse
obese adipose tissues
Obesity is characterized by the increase of intracellular lipid
accumulation which shows a significant correlation with adipocyte
differentiation. LRP1 mRNA expression was investigated in human
intra-abdominal visceral adipose tissue (VAT) from lean (42.764.5
year old, BMI: 23.163.3 kg/m2) and obese (44.561.8 year old,
BMI: 47.661.3 kg/m2) human (Fig. 7). Interestingly, LRP1 mRNA
was significantly increased in human obese adipose tissue (Fig. 7A).
To assess whether this LRP1 up-regulation was a general
characteristic of obese adipocytes, we then analysed LRP1 mRNA
3
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Figure 3. Inhibition of LRP1 expression by silencing during adipocyte differentiation. (A) Silencing of LRP1 by siRNAs. 3T3F442A
preadipocytes were transiently transfected with Luc siRNA or LRP1 siRNAs. LRP1b protein expression was monitored by immunoblotting 2 days posttransfection. a tubulin was used as a loading control. A representative experiment out of 3 is shown. (B) Time-course of LRP1b protein
expression after Luc siRNA or LRP1 siRNAs transfection during adipogenesis. 3T3F442A preadipocytes were transiently transfected with
Luc siRNA or LRP1 siRNAs. Two-days post-transfection, LRP1b protein expression was monitored by immunoblotting 0, 3, 5 or 7 days after
differentiation induction. ERK2 was used as a loading control.
doi:10.1371/journal.pone.0007422.g003
expression in adipocytes isolated from C57BI6/J mice either fed a
HFD or ND (Fig. 7B). As attempted HFD-fed C57BI6/J mice
exhibited a significant increase in body mass (47.661.4 g) when
compared to their control littermates (31.161.2 g) (data not shown).
LRP1 expression was significantly enhanced in adipocytes of HFD
obese mice when compared to ND control mice (Fig. 7B).
Altogether, our results indicate that LRP1 expression is upregulated in human and mouse obese adipose tissues.
panel a) and fully-differentiated adipocytes were transiently
transfected with Luc siRNA or LRP1 siRNA1 (Fig. 8A, panel b).
Oil red O staining revealed that, after 7 days of culture, the lipid
droplet size and number were decreased in LRP1 siRNA1
transfected adipocytes (Fig. 8B–C). Quantification of lipids at
days 2 and 7 of culture revealed that, in Luc siRNA transfected
adipocytes, the level of cellular lipid remained unchanged whereas,
in LRP1 siRNA1 transfected cells, the amount of lipid was
significantly diminished by 27.8% (Fig. 8D). Interestingly, basal
lipolysis was significantly stimulated in LRP1 siRNA1 transfected
adipocytes (Fig. 9, panel a). We postulate that, since cells could not
internalized triglycerides in the absence of LRP1 as previously
shown [12], they were metabolizing their intracellular lipid stock.
However, induced lipolysis was not different in LRP1 and Luc
siRNA transfected cells (Fig. 9, panel b). Altogether, these findings
highlight, for the first time, the crucial role of LRP1 in controlling
adipogenesis and maintaining the lipid content in fully-differen-
Silencing of LRP1 expression inhibits the cellular lipid
content of fully-differentiated adipocytes
Since we observed that LRP1 expression was up-regulated in
obese adipose tissues, we finally investigated whether extinction of
LRP1 expression in fully-differentiated adipocytes could diminish
their lipid content (Fig. 8), as recently suggested in adipose-specific
LRP12/2 mouse model [12]. 3T3F442A preadipocytes were
cultured for 10 days in adipogenic differentiation medium (Fig. 8A,
PLoS ONE | www.plosone.org
4
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Figure 4. Silencing of LRP1 inhibits expression of adipocyte differentiation markers in a LRP1 dose-dependent manner. (A) mRNA
expression of LRP1, PPARc, HSL and aP2 in LRP1 siRNA1-silenced preadipocytes. RNA expression of LRP1, PPARc, HSL and aP2 was analysed
in 3T3F442A preadipocytes transfected with Luc siRNA or LRP1 siRNA1. RNA was quantified by RT-PCR in 3T3F442A cells after 3 and 7 days in adipogenic
differentiation medium. Mean 6 SD of 4 independent experiments is shown. *P,0.025 when compared with Luc siRNA transfected cells. (B) Inhibition
of PPARc, HSL and aP2 mRNA expression in LRP1-silenced preadipocytes in a LRP1 dose-dependent manner. RNA levels of LRP1, PPARc,
HSL and aP2 in 3T3F442A preadipocytes transfected with Luc siRNA or the 3 LRP1 siRNA1-3 were performed as described in panel A.
doi:10.1371/journal.pone.0007422.g004
tiated adipocytes, and suggest that LRP1 may be an important
therapeutic target in obesity.
preadipocytes and embryonic fibroblasts [16,17]. Since LRP1 is
expressed at high levels in preadipocytes, it therefore can be
involved in the early steps of adipocyte differentiation. Indeed, our
report demonstrate that LRP1 silencing by siRNAs in 3T3F442A
preadipocytes significantly inhibits the expression of PPARc, HSL
and aP2 adipocyte markers of differentiation and leads to lipiddepleted cells, indicating that LRP1 is a key regulator of the
Discussion
Here, we show that LRP1 is highly expressed in 3T3F442A
murine preadipocyte cell line, as previously described for 3T3L1
PLoS ONE | www.plosone.org
5
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Figure 6. Silencing of LRP1 in pre-adipocytes inhibits lipolysis.
(A) Basal lipolysis. Glycerol release in the medium after 18 h was
quantified in 3T3F442A transfected with Luc or LRP1 siRNA1 after 7 days
of differentiation. Results were normalised with mg of DNA. Data are
presented as mean 6 SD of one experiment performed in quadruplicate. P,0.025 when compared with Luc siRNA transfected cells. (B)
Induced lipolysis. Glycerol and non esterified fatty acid (NAFA)
releases were quantified after 7 days of differentiation in 3T3F442A cells
transfected with Luc or LRP1 siRNA1 and treated with increasing
concentrations of isoproterenol. Results were normalised per mg of
DNA. Mean 6 SD of an experiment performed in quadruplicate is
presented. P,0.025 when compared with Luc siRNA transfected cells.
doi:10.1371/journal.pone.0007422.g006
Figure 5. LRP1 expression is required for adipogenesis. (A)
Staining of neutral lipids. Plates of 3T3F442A transfected with Luc
siRNA (panel a) or LRP1 siRNA1 (panel b) at day 7 are presented. Twodays post Luc or LRP1 siRNA transfection, confluent 3T3F442A cells
were grown in the presence of the adipogenic differentiation medium.
After 7 days of differentiation, the extent of cellular lipid accumulation
was revealed by oil Red O staining. A representative experiment out of
3 is shown. (B) Micrographs of 3T3F442A preadipocytes. Cells
were transfected with Luc siRNA (panels a and c) or LRP1 siRNA1 (panels
b and d) and micrographs were performed after 3 (panels a and b) and
7 (panels c and d) days of differentiation. A representative experiment
out of 3 is shown. (C) Quantification of neutral lipids and
triglycerides. In panel a, lipid content was quantified at 3, 5 and 7
days of differentiation in 3T3F442A transfected with Luc or LRP1 siRNAs.
Mean 6 SD of 3 independent experiments is shown. *P,0.0025 when
compared with Luc siRNA transfected cells. In panel b, triglycerides
were quantified at day 5 and 7 of differentiation in 3T3F442A
transfected with Luc or LRP1 siRNAs. Results were normalised per mg
of DNA. Data are presented as mean 6 SD of an experiment performed
in triplicate. *P,0.0025 when compared with Luc siRNA transfected
cells.
doi:10.1371/journal.pone.0007422.g005
PLoS ONE | www.plosone.org
adipogenic process. Our experiments using 3 LRP1 siRNAs show
that LRP1 extinction abrogates adipocyte differentiation in a
LRP1 dose-dependent manner. Our results also pinpoint that
extinction of LRP1 expression in pre-adipocytes prevents their
lipolytic response both at a basal level and after isoproterenol
induction. Therefore the inhibition of lipid accumulation and
triglyceride levels observed in LRP1-silenced preadipocytes is not
the consequence of a stimulation of lipolysis, indicating a direct
effect of LRP1 on the control of the adipogenic process. PPARc is
known to be crucial for the initiation of adipocyte differention [2].
Interestingly, PPARc has been described to induce LRP1
transcription [4] and our results indicate that LRP1 silencing
inhibits PPARc expression. This suggests the existence of a
regulatory loop between these two factors. Our findings reveal that
LRP1 silencing inhibits the expression of PPARc by 80% at day 3
of differentiation, indicating an early effect of LRP1 at the
commencement of adipogenesis. It is therefore important to
determine how LRP1 lost down-regulates PPARc expression. A
recent study demonstrates that LRP1 controls gene transcription
via Regulated Intramembrane Proteolysis through the cytoplasmic
6
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Figure 7. LRP1 expression is up-regulated in human and mouse
obese adipose tissues. (A) LRP1 expression in adipose tissue
from lean and obese human. LRP1 mRNA level was quantified in
human intra-abdominal visceral adipose tissue samples (VAT) obtained
from 27 morbide grade III obese patients (44.5+/21.8 year old, BMI: 47.6
+/2 1.3 kg/m2) before a bariatric surgery and from 10 control patients
undergoing abdominal lipectomy for plastic surgery (42.7 +/2 4.5 year
old, BMI: 23.1 +/2 3.3 kg/m2). Results are mean values +/2 SEM,
*P,0.01 when compared with controls (normal VAT). (B) LRP1
expression in adipocytes from obese mouse. LRP1 mRNA level
was quantified in adipocytes isolated from intra-abdominal adipose
tissues from 30-week-old overweight C57Bl6/J mice fed in high-fat diet
(HFD) and from C57Bl6/J control mice fed in normal diet (ND). Results
are mean value +/2 SEM from 5 mice for ND group and 4 mice for HFD
group. *P,0.05 when compared with ND controls.
doi:10.1371/journal.pone.0007422.g007
Figure 8. LRP1 silencing in fully-differentiated adipocytes leads
to lipid-depleted cells. (A) Silencing of LRP1 in fully-differentiated adipocyte. 3T3F442A pre-adipocytes were maintained for 10 days
in adipogenic differentiation medium (panel a) and were transfected with
Luc siRNA or LRP1 siRNA1. LRP1b protein expression was monitored by
immunoblotting 2 days post-transfection (panel b). ERK2 was used as a
loading control. (B) Staining of neutral lipids. Plates of differentiated
3T3F442A transfected with Luc siRNA (panel a) or LRP1 siRNA1 (panel b)
are shown. After siRNA transfection, 3T3F442A mature adipocytes were
grown in DMEM + 10% FCS. The extent of cellular lipid accumulation was
determined at day 2 and 7 of culture by oil Red O staining. A
representative experiment out of 3 is shown. (C) Micrographs of
3T3F442A adipocytes. Micrographs of differentiated adipocytes
transfected with Luc siRNA (panel a) or LRP1 siRNA1 (panel b) were
performed 7 days post-transfection. A representative experiment out of 3
is shown. (D) Quantification of lipid content. Lipid content was
quantified at days 2 and 7 post-tranfection of differentiated adipocytes
transfected with Luc or LRP1 siRNA1. Mean 6 SD of 3 independent
experiments is shown. *P,0.005 when compared with Luc siRNA
transfected cells.
doi:10.1371/journal.pone.0007422.g008
release of LRP1 intracellular domain, LRP1-ICD [18]. Studies in
the future will investigate whether LRP1-ICD regulates PPARc
expression in preadipocytes.
Our results also indicate, for the first time, that LRP1 expression
is up-regulated in human obese tissue. This up-regulation of LRP1
expression in the VAT of overweight/obese patients is in
consensus with our results in obese mice. Obesity is characterized
by the increase of intracellular lipid accumulation which shows a
significant correlation with adipocyte differentiation. Terminally
differentiated adipocytes cannot divide. Hence, alterations in the
number of fat cells within the body must be accomplished by the
differentiation of preadipocytes, which act as a renewable source of
adipocytes. Interestingly, our in vitro study in 3T3F442A cells
indicates that LRP1 expression is required for adipocyte
differentiation and since LRP1 is abundantly expressed in
adipocytes, we propose that LRP1 may participate in the onset
PLoS ONE | www.plosone.org
of obesity. The crucial role of LRP1 in obesity is also supported by
a recent study showing that adipocyte LRP12/2 mice have an
overall decrease in fat mass and are protected from high-fat dietinduced obesity [12]. Our experiments further show that silencing
7
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Some insight into LRP1 function in mature adipocyte was
obtained by generating mice with adipocyte-specific inactivation of
the LRP1 gene [12]. Adipocyte LRP1 knockout mice displayed
delayed postprandial lipid clearance, smaller fat stores, and lipiddepleted adipocytes which resulted in reduced body weight due to
overall decrease in fat mass. This work highlights the importance
of adipocyte LRP1 in postprandial triglyceride metabolism, where
LRP1 in collaboration with LpL mediates both the endocytic and
lipolytic processes responsible for triglyceride catabolism
[23,28,29]. Our results are in accordance with this study and
indicate that extinction of LRP1 expression in mature adipocytes
leads to increased basal lipolysis. In addition, we show that the
capacity of mature adipocytes to induce lipolysis in response to
isoproterenol is not modified by LRP1 silencing. This suggests that
LRP1 does not directly control lipolysis. We propose that
inhibition of LRP1 expression stimulates basal lipolysis in order
to compensate the lack of lipid intake in the absence of LRP1.
Recently, it was shown that LRP1 is also required for lipolysis and
the control of intracellular cholesterol storage and fatty acid
synthesis via the Wnt5a signaling pathway in LRP12/2MEF cells
[30].
In conclusion, our findings highlight that LRP1 plays a crucial
role in the control of adipogenesis and lipid homeostasis in mature
adipocytes. Moreover, our results indicate that LRP1 is upregulated in human obese tissues and mouse adipocytes.
Therefore, we propose that LRP1 targeting in obesity may lead
to a reduction of hypertrophic and hyperplasic adipocytes.
Materials and Methods
Ethics Statement
All subjects gave their informed written consent to participate to
the study, and investigations were performed in accordance with
the declaration of Helsinki as revised in 2000 (http://www.wma.
net/e/policy/b3.htm).
Figure 9. Analysis of lipolysis in fully-differentiated adipocytes
silenced for LRP1. Adipocytes differentiated for 10 days were
transfected with Luc siRNA or LRP1 siRNA1. Two days post-transfection,
glycerol release over 18 h (panel a) and glycerol and NEFA release after
isoproterenol stimulation (panel b) were quantified. Results were
normalised per mg of DNA. Mean 6 SD of an experiment in
quadruplicate is shown. P,0.025.
doi:10.1371/journal.pone.0007422.g009
Cells and cell culture
Cell lines were cultured in DMEM (Invitrogen) supplemented
with 10% fetal calf serum (FCS). Differentiation was induced by
incubating 3T3F442A confluent cells in differentiation medium
(DMEM supplemented with 10% FCS and 50 nM insulin) as
described previously for up to 7 days [31]. After 7 days of
differentiation, cells were maintained in DMEM with 10% FCS.
of LRP1 in fully-differentiated adipocytes significantly reduces
cellular lipid content, suggesting that LRP1 may be an important
therapeutic target in obesity. Most functional studies on adipocyte
differentiation and function have been performed in the murine
adipogenic 3T3L1 cell line and in genetically modified mice.
However, there are fundamental differences in the lipoprotein
metabolism of mouse and human [19]. Therefore, it is important
to investigate the LRP1 expression in human adipocytes as
presented in this report.
Results from the literature have suggested that LRP1 is a likely
contributor to adipogenesis, adipocyte homeostasis and obesity
given its high expression in adipocytes [4,10,11], that it binds
ApoE [7,8], LpL [20,21] and hepatic lipase [9], and that it
collaborates with heparin sulfate proteoglycans to mediate the
internalization of ApoE and LpL [22,23]. The dietary lipids are
carried in chylomicron remnants (CR) which are taken up into the
liver mainly via LRP1. LRP1 interacts with CR via ApoE [6,7] and
LpL in vitro and in vivo [8,24]. Interestingly, ApoE has been
reported to be crucial for the accumulation of triglycerides in
mouse adipocytes [25] and also appears to have an important
function in adipocyte differentiation [26] and obesity [27].
Altogether, these observations strongly suggest that a deregulation
of LRP1 expression may have important consequences in
adipocytes and obesity.
PLoS ONE | www.plosone.org
Human samples
Human adipose tissue was collected according to the guidelines
of the Ethical Committee of Toulouse-Rangueil and Nancy J.
d’Arc Hospitals and received full ethical approval from the Ethical
Committee of Toulouse-Rangueil and Nancy J. d’Arc Hospitals.
All subjects gave their informed written consent to participate to
the study. Human abdominal visceral (VAT) adipose tissue
samples were obtained from 10 patients healthy volunteers (42.7
+/2 4.5 yr old, BMI: 23.1 +/2 3.3 kg/m2) undergoing
abdominal lipectomy for plastic surgery. No clinical data from
these patients were available. Human abdominal visceral adipose
tissue samples were obtained from 27 morbidly (grade III) obese
subjects (44.5+/21.8 yr old, BMI: 47.6 +/2 1.3 kg/m2) before a
bariatric surgery. All subjects were drug-free and besides obesity
they did not suffer of any disease. Tissue samples were
immediately frozen in liquid nitrogen and stored at 280uC. Total
RNAs of isolated adipocytes were extracted and LRP1 expression
analysed by RT-PCR. For in vitro differentiation, human
preadipocytes were isolated from human subcutaneous adipose
tissue obtained from patients undergoing abdominal lipectomy at
8
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
the plastic surgery department of Rangueil Hospital (Toulouse,
France) under the agreement of local ethic committee. All subjects
gave their informed written consent to participate to the study.
Adipose tissue pieces were immediately used for collagenase
digestion as previously described [15]. The digestate was
centrifuged to separate adipocytes from the stroma-vascular
fraction, containing preadipocytes (pellet). Cells isolated from the
SVF fraction were induced to differentiate into adipocytes as
previously described [31]. Briefly, confluent cells (day 0) were
induced to differentiate in DMEM/Ham’s F12 (1:1) medium
containing 0.01 mg/ml transferrin, 100 nM cortisol, 0.2 nM
triiodothyronine, and 20 nM insulin. To trigger differentiation,
25 nM dexamethasone, 500 mM IBMX and 2 mM rosiglitazone
were present from day 0 to day 4. Intracellular accumulation of
lipid droplets became clearly evident at day 10 [15].
RNA extraction and analysis
Total RNA was extracted using the RNeasy minikit (QIAGEN
Sciences, Maryland) according to the manufacturer’s instructions.
Reverse transcription of total RNA was performed at 37uC using
Moloney murine leukemia virus reverse transcriptase enzyme
(Invitrogen, Carlsbad, CA) and random hexanucleotide primers
(Promega, Madison, WI). Quantitative PCR was carried out by
real-time PCR using a LightCycler and the DNA double-strandspecific SYBR green I dye for detection (Roche, Basel,
Switzerland). Results were normalized to RS9 levels. Sequences
of primers are:
mouse RS9 (sens 59CGGCCCGGGAGCTGTTGACG39,
reverse 59CTGCTTGCGGACCCTAATGTGACG39),
mouse aP2 (sens 59AACACCGAGATTTCCTTCAA39, reverse 59AGTCACGCCTTTCATAACACA39),
mouse LRP1 (sens 59GACCAGGTGTTGGACACAGATG39,
reverse 59AGTCGTTGTCTCCGTCACACTTC39),
mouse HSL (sens 59CTGAAGGCTCTGAGTTGGTCAA39,
reverse 59GGCTTACTGGGCACAGATACCT39),
mouse PPARc (sens 59 AGGCCGAGAAGGAGAAGCTGTTG39, reverse 59TGGCCACCTCTTTGCTCTGCTC39),
human LRP1 (sens 59TAGACCGGCCCCCTGTGCTGTTGA39, reverse 59GGTCTGCCGCGTGCTCGTAGGTGT39).
Mice
Mice were handled in accordance with the principles and
guidelines established by the National Institute of Medical
Research (INSERM). C57Bl6/J female mice were obtained from
Charles River laboratory (l’Arbresle, France). Mice were housed
conventionally in a constant temperature (20–22uC) and humidity
(50–60%) animal room and with a 12 h light–dark cycle. All mice
had free access to food and water throughout the experiment.
C57Bl6/J mice were assigned to normal-fat diet (ND) or high-fat
diet (HFD) (SAFE, France). Energy contents of the specific diets
were (% kcals): 20% protein, 70% carbohydrate, and 10% fat for
ND; 20% protein, 35% carbohydrate, and 45% fat for HFD. The
main source of fat in HFD was lard (20 g/100 g of food). C57Bl6/
J (10 week old) mice were fed a ND or HFD for 20 weeks. All mice
were sacrificed at 30 weeks of age.
siRNAs and 3T3F442A transfection
Mouse intra-abdominal adipose tissues were dissected immediately after sacrifice, minced in 5 ml of Dulbecco’s modified Eagle’s
medium (DMEM; Life Technologies, Inc., Invitrogen, Paisley,
UK) supplemented with 1 mg/ml collagenase (SIGMA) and 1%
BSA for 30 min at 37uC under shaking. Digestion was followed by
filtration through a 150 mm screen, and the floating adipocytes
were separated from the medium containing the stroma-vascular
fraction (SVF). Adipocytes were washed twice in DMEM and
further processed for RNA extraction using the RNeasy mini kit
(Qiagen, Germany).
Silencing of LRP1 gene expression in adipocytes was achieved by
the use of siRNAs. Duplexes of 21-nucleotide mouse LRP1 siRNA1
(target sequence AAGCATCTCAGTAGACTATCA) [32], mouse
LRP1 siRNA2 (target sequence AACTTCTTAAACTCATAGCTT)
(Dharmacon), mouse LRP1 siRNA3 (target sequence AAGCAGTTTGCCTGCAGAGAC) or firefly luciferase (Luc) siRNA
(target sequence AACGTACGCGGAATACTTCGA) were synthesized by MWG Biotech S.A. (France). 2 106 3T3F442A mature
adipocytes were transiently transfected with 2 mg of siRNA using
Nucleofector Technology (Amaxa biosystems) according to the
manufacturer’s instructions using kit L (# VCA-1005) and were
replated in 2 wells of 6-well plates. After 48 h of transfection, cells have
recovered and were maintained in DEM 10% FCS for further analysis.
Analysis of LDH release monitored at 48 h revealed no toxicity of
transfecting mature adipocytes with LRP1 or Luc siRNAs (CytoTox96
Non-Radioactive Cytotoxicity Assay, Promega). For preadipocytes,
106 cells were transfected and were treated with insulin 48 h posttransfection.
Immunoblots
Oil Red O staining
Cells were lysed in lysis buffer (50 mM HEPES pH 7.5,
150 mM NaCl, 10% glycerol, 1% Triton X100, 1.5 mM MgCl2,
1 mM EGTA, 100 mM NaF, 10 mM NaPPI, 500 mm NaVanadate, 1 mM PMSF, 10 mM Aprotinine, and a protease
inhibitor cocktail). After gentle shaking for 20 min at 4uC, cell
extracts were obtained by centrifugation in a microfuge at
13,000 rpm for 15 min at 4uC. Equal amounts of protein
(100 mg) from cell extracts, quantitated by the Bradford assay,
were separated on a 7% gel by SDS-PAGE. Proteins were electrotransferred to PVDF membrane and incubated with 1 mg/ml antia tubulin (NeoMarkers), 1 mg/ml anti-b2actin (Sigma), 1 mg/ml
ERK2 (D-2, Santa Cruz Biotechnology), 11H4 anti-LRP1b
hybridoma (1/10 dilution, ATCC) or 0.4 mg/ml anti-HSL (Santa
Cruz). Proteins were then visualized with horseradish peroxidaseconjugated sheep anti-mouse immunoglobulin (ECL Amersham)
or horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin (ECL Amersham) followed by the Renaissance
chemiluminescence system (Perkin Life Sciences).
3T3F442A adipocytes were washed with phosphate-buffered
saline (pH 7.4) and then fixed with Antigenfix (Diapath, Italy).
Cells were stained with Oil Red O dye (saturated Oil Red O dye
in six parts of isopropanol and four parts of water), an indicator of
cell lipid content, and then exhaustively rinsed with water.
Spectrophotometric quantification of lipids was performed by
dissolving the stained oil droplets with isopropanol and measuring
absorbance at 540 nm as previously described [33].
Isolation of adipocytes from mouse adipose tissue
PLoS ONE | www.plosone.org
Quantification of triglycerides
Cells scraped in PBS were centrifugated for 5 min at 1200 rpm
at 4uC. Cell pellet was dissolved in 40 ml isopropanol and
centrifugated at 13 000 rpm for 5 min at 4uC. The supernatant
was used to determine the triglyceride content using the
Triglyceride FS kit (Diasys Diagnostic Systems, Germany)
according to the manufacturer’s instructions. The pellet was used
to quantify DNA concentration by a diaminobenzoic aci
fluorescence assay [34].
9
October 2009 | Volume 4 | Issue 10 | e7422
LRP1, Adipogenesis, Obesity
Lipolysis Assay
Statistical analysis
Cells were incubated in DMEM without serum in the presence
of 2% fatty acid-free bovine serum albumin (A7030, Sigma)
overnight. Fresh medium containing isoproterenol was added for
90 min. Glycerol and NEFA contents in the medium were
measured with free glycerol reagent (F6428 Sigma) and NEFA C
kit (Wako Chemicals, Germany).
Results are expressed as means 6 SEM. Statistical differences
between two groups were evaluated using Student’s t tests. The
level of significance was set at P,0.05.
Author Contributions
Conceived and designed the experiments: OM ELC. Performed the
experiments: OM CD AM DD. Analyzed the data: OM CC CM PV ELC.
Contributed reagents/materials/analysis tools: CC DQ CM PV. Wrote the
paper: OM ELC.
References
19. Prawitt J, Niemeier A, Kassem M, Beisiegel U, Heeren J (2008) Characterization
of lipid metabolism in insulin-sensitive adipocytes differentiated from immortalized human mesenchymal stem cells. Exp Cell Res 314(4): 814–824.
20. Chappell DA, Fry GL, Waknitz MA, Iverius PH, Williams SE, et al. (1992) The
low density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor
binds and mediates catabolism of bovine milk lipoprotein lipase. J Biol Chem
267(36): 25764–25767.
21. Willnow TE, Goldstein JL, Orth K, Brown MS, Herz J (1992) Low density
lipoprotein receptor-related protein and gp330 bind similar ligands, including
plasminogen activator-inhibitor complexes and lactoferrin, an inhibitor of
chylomicron remnant clearance. J Biol Chem 267(36): 26172–26180.
22. Ji ZS, Brecht WJ, Miranda RD, Hussain MM, Innerarity TL, et al. (1993) Role
of heparan sulfate proteoglycans in the binding and uptake of apolipoprotein Eenriched remnant lipoproteins by cultured cells. J Biol Chem 268(14):
10160–10167.
23. Chappell DA, Fry GL, Waknitz MA, Muhonen LE, Pladet MW, et al. (1993)
Lipoprotein lipase induces catabolism of normal triglyceride-rich lipoproteins via
the low density lipoprotein receptor-related protein/alpha 2-macroglobulin
receptor in vitro. A process facilitated by cell-surface proteoglycans. J Biol Chem
268(19): 14168–14175.
24. Heeren J, Niemeier A, Merkel M, Beisiegel U (2002) Endothelial-derived
lipoprotein lipase is bound to postprandial triglyceride-rich lipoproteins and
mediates their hepatic clearance in vivo. J Mol Med 80(9): 576–584.
25. Huang ZH, Reardon CA, Mazzone T (2006) Endogenous ApoE expression
modulates adipocyte triglyceride content and turnover. Diabetes 55(12):
3394–3402.
26. Yue L, Rasouli N, Ranganathan G, Kern PA, Mazzone T (2004) Divergent
effects of peroxisome proliferator-activated receptor gamma agonists and tumor
necrosis factor alpha on adipocyte ApoE expression. J Biol Chem 279(46):
47626–47632.
27. Gao J, Katagiri H, Ishigaki Y, Yamada T, Ogihara T, et al. (2007) Involvement
of apolipoprotein E in excess fat accumulation and insulin resistance. Diabetes
56(1): 24–33.
28. Chappell DA, Inoue I, Fry GL, Pladet MW, Bowen SL, et al. (1994) Cellular
catabolism of normal very low density lipoproteins via the low density
lipoprotein receptor-related protein/alpha 2-macroglobulin receptor is induced
by the C-terminal domain of lipoprotein lipase. J Biol Chem 269(27):
18001–18006.
29. Nykjaer A, Bengtsson-Olivecrona G, Lookene A, Moestrup SK, Petersen CM,
et al. (1993) The alpha 2-macroglobulin receptor/low density lipoprotein
receptor-related protein binds lipoprotein lipase and beta-migrating very low
density lipoprotein associated with the lipase. J Biol Chem 268(20):
15048–15055.
30. Terrand J, Bruban V, Zhou L, Gong W, El Asmar Z, et al. (2009) LRP1
Controls Intracellular Cholesterol Storage and Fatty Acid Synthesis through
Modulation of Wnt Signaling. J Biol Chem 284(1): 381–388.
31. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, et al. (2006) TNFalpha upregulates apelin expression in human and mouse adipose tissue. Faseb J 20(9):
1528–1530.
32. Fears CY, Grammer JR, Stewart JE, Jr., Annis DS, Mosher DF, et al. (2005)
Low-density lipoprotein receptor-related protein contributes to the antiangiogenic activity of thrombospondin-2 in a murine glioma model. Cancer Res
65(20): 9338–9346.
33. Ramirez-Zacarias JL, Castro-Munozledo F, Kuri-Harcuch W (1992) Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids
with Oil red O. Histochemistry 97(6): 493–497.
34. Vignon F, Capony F, Chambon M, Freiss G, Garcia M, et al. (1986) Autocrine
growth stimulation of the MCF 7 breast cancer cells by the estrogen-regulated 52
K protein. Endocrinology 118: 1537–1545.
1. Kahn SE, Hull RL, Utzschneider KM (2006) Mechanisms linking obesity to
insulin resistance and type 2 diabetes. Nature 444(7121): 840–846.
2. He W, Barak Y, Hevener A, Olson P, Liao D, et al. (2003) Adipose-specific
peroxisome proliferator-activated receptor gamma knockout causes insulin
resistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A 100(26):
15712–15717.
3. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM (1994) mPPAR
gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8(10):
1224–1234.
4. Gauthier A, Vassiliou G, Benoist F, McPherson R (2003) Adipocyte low density
lipoprotein receptor-related protein gene expression and function is regulated by
peroxisome proliferator-activated receptor gamma. J Biol Chem 278(14):
11945–11953.
5. Lillis AP, Van Duyn LB, Murphy-Ullrich JE, Strickland DK (2008) LDL
receptor-related protein 1: unique tissue-specific functions revealed by selective
gene knockout studies. Physiol Rev 88(3): 887–918.
6. Beisiegel U, Weber W, Ihrke G, Herz J, Stanley KK (1989) The LDL-receptorrelated protein, LRP, is an apolipoprotein E-binding protein. Nature 341(6238):
162–164.
7. Kowal RC, Herz J, Goldstein JL, Esser V, Brown MS (1989) Low density
lipoprotein receptor-related protein mediates uptake of cholesteryl esters derived
from apoprotein E-enriched lipoproteins. Proc Natl Acad Sci U S A 86(15):
5810–5814.
8. Beisiegel U, Weber W, Bengtsson-Olivecrona G (1991) Lipoprotein lipase
enhances the binding of chylomicrons to low density lipoprotein receptor-related
protein. Proc Natl Acad Sci U S A 88(19): 8342–8346.
9. Kounnas MZ, Chappell DA, Wong H, Argraves WS, Strickland DK (1995) The
cellular internalization and degradation of hepatic lipase is mediated by low
density lipoprotein receptor-related protein and requires cell surface proteoglycans. J Biol Chem 270(16): 9307–9312.
10. Descamps O, Bilheimer D, Herz J (1993) Insulin stimulates receptor-mediated
uptake of apoE-enriched lipoproteins and activated alpha 2-macroglobulin in
adipocytes. J Biol Chem 268(2): 974–981.
11. Vassiliou G, Benoist F, Lau P, Kavaslar GN, McPherson R (2001) The low
density lipoprotein receptor-related protein contributes to selective uptake of
high density lipoprotein cholesteryl esters by SW872 liposarcoma cells and
primary human adipocytes. J Biol Chem 276(52): 48823–48830.
12. Hofmann SM, Zhou L, Perez-Tilve D, Greer T, Grant E, et al. (2007) Adipocyte
LDL receptor-related protein-1 expression modulates postprandial lipid
transport and glucose homeostasis in mice. J Clin Invest 117(11): 3271–3282.
13. Neese RA, Misell LM, Turner S, Chu A, Kim J, et al. (2002) Measurement in
vivo of proliferation rates of slow turnover cells by 2H2O labeling of the
deoxyribose moiety of DNA. Proc Natl Acad Sci U S A 99(24): 15345–15350.
14. Spiegelman BM, Farmer SR (1982) Decreases in tubulin and actin gene
expression prior to morphological differentiation of 3T3 adipocytes. Cell 29(1):
53–60.
15. Bour S, Daviaud D, Gres S, Lefort C, Prevot D, et al. (2007) Adipogenesisrelated increase of semicarbazide-sensitive amine oxidase and monoamine
oxidase in human adipocytes. Biochimie 89(8): 916–925.
16. Zhang H, Links PH, Ngsee JK, Tran K, Cui Z, et al. (2004) Localization of low
density lipoprotein receptor-related protein 1 to caveolae in 3T3-L1 adipocytes
in response to insulin treatment. J Biol Chem 279(3): 2221–2230.
17. Willnow TE, Herz J (1994) Genetic deficiency in low density lipoprotein
receptor-related protein confers cellular resistance to Pseudomonas exotoxin A.
Evidence that this protein is required for uptake and degradation of multiple
ligands. J Cell Sci 107 (Pt 3): 719–726.
18. Zurhove K, Nakajima C, Herz J, Bock HH, May P (2008) Gamma-secretase
limits the inflammatory response through the processing of LRP1. Sci Signal
1(47): ra15.
PLoS ONE | www.plosone.org
10
October 2009 | Volume 4 | Issue 10 | e7422
D. CONCLUSION ET
PERSPECTIVES
67
CONCLUSION
La cathepsine D (cath-D) est une aspartyl protéase lysosomale surexprimée et
hypersécrétée par un grand nombre de carcinomes (sein, ovaire, foie, colon). C’est un
marqueur reconnu de mauvais pronostic dans le cancer du sein associé a un risque plus élevé
de rechute (Ferrandina et al., 1997; Foekens et al., 1999; Liaudet-Coopman et al., 2006). Cette
protéase stimule la prolifération des cellules cancéreuses (Fusek and Vetvicka, 1994; Glondu
et al., 2001; Vignon et al., 1986) et la formation des métastases (Garcia et al., 1990; Glondu et
al., 2002). Elle stimule aussi la croissance invasive des fibroblastes et l'angiogenèse tumorale,
indiquant son rôle clef dans le micro-environnement tumoral (Berchem et al., 2002; Garcia et
al., 1990; Glondu et al., 2002; Laurent-Matha et al., 2005). Les travaux récents du laboratoire
ont mis en évidence l’interaction de la cath-D avec le domaine extracellulaire de la chaîne β
du récepteur LRP1 (LDL receptor-related protein1) et ont montré que cette liaison est
responsable de la stimulation de la croissance des fibroblastes (manuscrit soumis pour
publication). LRP1 est un récepteur d’endocytose reconnu par une quarantaine de ligands
différents et impliqué dans divers processus physiologiques tels l’élimination du cholestérol
par le foie, la transmission synaptique ou encore la protection contre l’athérosclérose (Lillis et
al., 2008). Des études récentes indiquent que le récepteur LRP1 joue aussi un rôle biologique
important chez l’adipocyte mature qui représente un des types cellulaire prédominant du
micro-environnement du cancer du sein (Hofmann et al., 2007; Terrand et al., 2009).
Les études épidémiologiques récentes indiquent que l’obésité est un facteur de risque de
cancer ainsi qu’un facteur de mauvais pronostic dans de nombreux cancers dont le cancer du
sein chez la femme ménopausée (Pan and DesMeules, 2009; Renehan et al., 2008). Les
adipocytes sécrètent de nombreuses molécules appelées adipokines, ainsi que des constituants
de la matrice extra-cellulaire. Ils participent à la progression tumorale mammaire en sécrétant
différentes adipokines telles la leptine, le TNFα, des métalloprotéases (MMP2, MMP9). Ces
dernières années, plusieurs études décrivent également que certaines protéases, connues pour
favoriser la progression des cancers, affectent le comportement des adipocytes. Ainsi, les
métalloprotéases MMP2 et MMP9 et les cystéines cathepsines K, S, L contrôlent le processus
de différenciation adipocytaire (Bouloumie et al., 2001; Chavey et al., 2003; Croissandeau et
al., 2002; Funicello et al., 2007; Pan and DesMeules, 2009; Renehan et al., 2008; Taleb et al.,
2006; Xiao et al., 2006; Yang et al., 2007). A ce jour, la participation de la cath-D dans la
biologie de l’adipocyte n’a pas encore été étudiée.
68
Principaux résultats de l’article 1
La première partie de ce travail de thèse a mis en exergue l’implication de la cath-D
dans la biologie de l’adipocyte. Notre étude montre que l’expression de la cath-D est
significativement augmentée au cours de l’adipogenèse dans des modèles murin (lignée préadipocytaire murine 3T3-F442A) et humain (pré-adipocyte sous-cutané). De plus, nous avons
mis en évidence une sécrétion de pro-cath-D par les adipocytes murins matures, confirmant
une étude protéomique indiquant que les adipocytes matures sécrètent la pro-cath-D en
réponse à l’insuline (Zhou et al., 2009a). Pour étudier le rôle de la cath-D dans l’adipogenèse,
nous avons généré des pré-adipocytes (3T3-F442A) déficients en cath-D en utilisant une
stratégie shRNA anti-cath-D. Nos résultats indiquent que l’extinction de l’expression de la
cath-D inhibe significativement l’expression des marqueurs de la différenciation adipocytaire,
PPARγ (Peroxisome Proliferator-Activated Receptor gamma), HSL (Hormone Sensitive
Lipase) et aP2 (Adipocyte lipid binding Protein2). De plus, les préadipocytes déficients en
cath-D accumulent significativement moins de triglycérides indiquant que le processus
d’adipogenèse est inhibé en l’absence de cath-D. Ces travaux sont les premiers à démontrer le
rôle clef positif de la cath-D dans la différenciation du tissu adipeux et son implication
possible dans l’obésité.
Principaux résultats de l’article 2
Dans la deuxième partie de ce travail de thèse, nous avons étudié le rôle du LRP1,
récepteur de la cath-D identifié récemment dans notre équipe, dans les pré-adipocytes et les
adipocytes. Des études sur des souris déficientes en LRP1 au niveau des adipocytes ont
montré que ce récepteur joue un rôle majeur dans l’homéostasie du tissu adipeux (Hofmann et
al., 2007). En effet, ces souris présentent un poids corporel plus faible, des troubles de
l’assimilation des lipides après la prise alimentaire ainsi qu’un tissu adipeux extrêmement
réduit. De plus il a été décrit que ce récepteur interagit avec la protéine apoE présente au
niveau des lipoprotéines et permet l’assimilation des lipides après la prise alimentaire. Une
étude récente indique son implication dans le stockage du cholestérol, et également dans la
synthèse des acides gras via la modulation de la voie Wnt (Terrand et al., 2009). Nos travaux
montrent que les pré-adipocytes expriment des taux élevés de LRP1, comparativement aux
cellules épithéliales mammaires. De plus l’expression de LRP1 demeure élevée au cours de la
différenciation adipocytaire chez l’homme et la souris. De plus, nos résultats indiquent que
l’expression du LRP1 est significativement augmentée dans le tissu adipeux chez l’homme et
69
la souris obèses. Enfin, l’inhibition de l’expression du LRP1 par la technique de l’ARN
interférence, a mis en évidence le rôle majeur de ce récepteur dans l’adipogenèse. En absence
de LRP1, les cellules ne se différencient plus, n’accumulent plus de triglycérides et
n’expriment plus les marqueurs adipocytaires PPARγ, aP2 et HSL. Nos études suggèrent que
cette absence d’accumulation de triglycérides n’est pas due à une augmentation de la lipolyse
mais à l’inhibition de l’adipogenèse. Pour compléter notre étude, nous avons inhibé
l’expression du LRP1 dans les adipocytes matures. En absence de LRP1, le contenu en
triglycérides est significativement diminué et la lipolyse basale est augmentée. Sachant que
LRP1 participe à l’incorporation d’acides gras précurseurs des triglycérides, il est possible
que l’extinction de l’expression du LRP1 dans l’adipocyte mature induise une stimulation de
la lipolyse des triglycérides pour le maintien énergétique de l’adipocyte. Ces derniers résultats
confirment le rôle du LRP1 dans le maintien du contenu en triglycérides des adipocytes,
comme suggéré par les études réalisées sur les souris avec invalidation de LRP1 dans les
adipocytes matures (Hofmann et al., 2007; Terrand et al., 2009).
PERSPECTIVES
L’ensemble de ces travaux apporte de nouvelles informations quant à l’implication de
la cath-D et de son récepteur LRP1 dans la différenciation adipocytaire et dans la biologie de
l’adipocyte normal et obèse. Ces données suggèrent que ces deux protéines seraient des cibles
potentiellement intéressantes dans le traitement de l’obésité. Cependant, des études
complémentaires devront être réalisées afin de mieux comprendre leur fonction dans la
biologie de l’adipocyte ainsi que dans le micro-environnement tumoral.
I Rôle de la cath-D et du LRP1 dans la biologie de l’adipocyte
Pour compléter ce travail, il serait intéressant de déterminer si l’effet de la cath-D sur
le processus adipogénique est contrôlé par son activité protéolytique. Les travaux impliquant
des protéases dans la différenciation des adipocytes indiquent une action extra-cellulaire via le
remodelage et la dégradation de la matrice extra-cellulaire, mais également une action intracellulaire.
Pour cela, des expériences de ré-expression de cath-D pourraient être réalisées dans les clones
shRNA cath-D que nous avons générés dans la lignée adipocytaire F442A. Nous avons à
notre disposition au laboratoire, des vecteurs codants pour la cath-D sauvage ou une forme
70
mutée dépourvue d’activité catalytique. La ré-expression de ces deux formes de la protéase
dans nos clones permettrait de déterminer si les cellules sont à nouveau capables de se
différencier, et si l’activité de la cath-D est nécessaire à la différenciation des adipocytes.
L’ajout direct dans le milieu de culture de cath-D recombinante inactive (forme 52 kDa) ou
active (forme 51 kDa) pourrait apporter des informations supplémentaires sur l’effet de la
cath-D sécrétée dans la différenciation des adipocytes. Même si la cath-D nécessite un
environnement acide pour cliver ses substrats, il est décrit que la cath-D sécrétée clive la
prolactine à pH physiologique et ce clivage est dépendant des pompes à protons et des
échangeurs de cations présents sur la membrane plasmique (Piwnica et al., 2006). Dans cette
même étude, il a été rapporté que le proN peptide, qui correspond à la partie N-terminale du
propeptide de la cath-D, lie le site actif de la cath-D à pH neutre ou légèrement acide (Fusek
et al., 1991; Lee et al., 1998; Piwnica et al., 2006; Wittlin et al., 1999). Il en résulte une
inhibition de l’activité catalytique de la cath-D. L’utilisation de pepstatine A et du proN
peptide dans le milieu de culture des pré-adipocytes permettrait de déterminer si l’activité
catalytique de la cath-D est nécessaire à l’adipogenèse.
Enfin, le développement de souris knock-out pour la cath-D dans les adipocytes permettrait
d’étudier le rôle de cette protéase dans le tissu adipeux in vivo. Une étude morphologique du
tissu adipeux ainsi que des analyses portant sur l’homéostasie énergétique (assimilation des
lipides, tolérance au glucose, …) de ces souris pourrait être réalisées.
Concernant le LRP1, son mode d’action est complexe et peut passer par :
1- l’endocytose de certaines molécules,
2- l’activation des voies de signalisation par phosphorylation de résidus tyrosines présents sur
sa queue cytoplasmique,
3- la protéolyse intra-membranaire régulée (RIP) qui génère un fragment intra-cellulaire qui
ira au noyau pour réguler la transcription génique.
Il sera important de déterminer le mécanisme d’action du LRP1 impliqué dans la
différenciation des adipocytes en présence ou en absence de cath-D.
II Rôle de la cath-D et du LRP1 adipocytaires dans le micro-environnement tumoral
Les travaux accomplis durant cette thèse mettent en évidence le rôle de la cath-D et de
son récepteur LRP1 dans les adipocytes et leur implication dans l’adipogenèse. Toutefois, il
serait intéressant d’approfondir ces recherches en axant nos travaux futurs en cancérologie.
Des études épidémiologiques indiquent que l’obésité est un facteur de risque pour de
nombreux cancer. Cependant les mécanismes par lesquels l’obésité participe au processus
71
carcinogénique sont encore mal connus. Des études suggèrent la participation de certaines
adipokines dans ce processus et les données de la littérature indiquent que la cath-D participe
à la progression tumorale.
Durant cette thèse, nous avons montré que l’expression de la cath-D est augmentée au cours
de la différenciation des adipocytes et également que les adipocytes matures sécrètent la cathD, suggérant que la cath-D est une nouvelle adipokine. De plus, les individus obèses
expriment d’avantage de cath-D et l’on sait aujourd’hui que l’obésité est un facteur de risque
pour certains cancers. Il est possible que la cath-D sécrétée chez l’individu obèse participe à la
progression de tumeurs. En effet il est connu que la cath-D est mitogène sur les cellules
cancéreuses (Vignon et al., 1986). La cath-D sécrétée par les adipocytes en surnombre
pourrait favoriser les étapes précoces de prolifération de petites tumeurs initiées nécessitant
des facteurs de croissance pour leur survie.
Tout d’abord, l’analyse du niveau d’expression de la cath-D et du LRP1 dans des adipocytes
mammaires purifiés à partir de patientes atteintes de cancer du sein ou de réduction
mammoplastique, permettrait de déterminer si l’expression de ces deux protéines est
perturbée dans les adipocytes au cours de la pathologie.
Par la suite, une analyse immunohistochimique de l’expression adipocytaire de la cath-D et du
LRP1 dans des biopsies de cancer du sein et de réduction mammoplastique apporterait
également des informations quant à la localisation de ces protéines en condition
physiologique et pathologique.
Par ailleurs, en plus d’un rôle de charpente du tissu cancéreux, les cellules stromales
participent activement à la nutrition et à la progression tumorale. Les cellules cancéreuses et
stromales interagissent et plusieurs protéases notamment sont impliquées dans cet échange.
Dans ce sens, les travaux réalisés par l’équipe du Dr Marie-Christine Rio, révèlent que les
cellules cancéreuses induisent la sécrétion de stromélysine 3 par les adipocytes, et qu’en
retour cette stromélysine 3 entraîne la dé-différenciation des adipocytes, générant une
population de fibroblastes péritumoraux particuliers (Andarawewa et al., 2005). Il serait donc
intéressant de déterminer la régulation de l’expression de la cath-D et du LRP1 adipocytaires
par les cellules épithéliales mammaires cancéreuses. Pour cela, il faudrait réaliser des
expériences de co-culture entre des adipocytes cultivés seuls ou co-cultivés avec des lignées
cancéreuses mammaires ou normales immortalisées.
Enfin, le croisement de souris déficientes en cath-D ou LRP1 dans les adipocytes avec des
souris transgéniques capables de développer « spontanément » des tumeurs de la glande
72
mammaire, permettrait de déterminer in vivo, le rôle de ces deux protéines dans l’initiation et
la progression du cancer.
73
Ce travail de thèse a étudié, pour la première fois, le rôle de la cathepsine D dans
les adipocytes. Nous avons montré que l’expression de la cathepsine D est augmentée au
cours de la différenciation adipocytaire dans des modèles humain et murin. De plus, nos
résultats indiquent que les adipocytes matures sécrètent la pro-cathepsine D. De façon
intéressante, nos travaux révèlent que l’expression de la cathepsine D et du récepteur
LRP1 sont nécessaires pour la différenciation adipocytaire. Par ailleurs, nos travaux
indiquent que le LRP1 participe également au maintien du contenu en triglycérides des
adipocytes différenciés. Enfin, nous avons montré que les taux d’expression de la
cathepsine D et de son récepteur LRP1 sont augmentés chez l’homme et la souris obèse.
L’ensemble de ces résultats suggère que la cathepsine D et le LRP1 seraient des cibles
thérapeutiques potentielles dans le traitement de l’obésité.
74
E. REFERENCES
75
REFERENCES
Ahima, R. S. (2006). Adipose tissue as an endocrine organ. Obesity (Silver Spring) 14 Suppl
5, 242S-249S.
Ailhaud, G. (2006). Adipose tissue as a secretory organ: from adipogenesis to the metabolic
syndrome. C R Biol 329, 570-577; discussion 653-575.
Amemori, S., Ootani, A., Aoki, S., Fujise, T., Shimoda, R., Kakimoto, T., Shiraishi, R.,
Sakata, Y., Tsunada, S., Iwakiri, R., and Fujimoto, K. (2007). Adipocytes and preadipocytes
promote the proliferation of colon cancer cells in vitro. Am J Physiol Gastrointest Liver
Physiol 292, G923-929.
Andarawewa, K. L., Motrescu, E. R., Chenard, M. P., Gansmuller, A., Stoll, I., Tomasetto, C.,
and Rio, M. C. (2005). Stromelysin-3 is a potent negative regulator of adipogenesis
participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. Cancer
Res 65, 10862-10871.
Angel, A., and Bray, G. A. (1979). Synthesis of fatty acids and cholesterol by liver, adipose
tissue and intestinal mucosa from obese and control patients. Eur J Clin Invest 9, 355-362.
Antoniades, C., Antonopoulos, A. S., Tousoulis, D., and Stefanadis, C. (2009). Adiponectin:
from obesity to cardiovascular disease. Obes Rev 10, 269-279.
Arner, P. (2005). Human fat cell lipolysis: biochemistry, regulation and clinical role. Best
Pract Res Clin Endocrinol Metab 19, 471-482.
Ashcom, J. D., Tiller, S. E., Dickerson, K., Cravens, J. L., Argraves, W. S., and Strickland, D.
K. (1990). The human alpha 2-macroglobulin receptor: identification of a 420-kD cell surface
glycoprotein specific for the activated conformation of alpha 2-macroglobulin. J Cell Biol
110, 1041-1048.
Asseryanis, E., Ruecklinger, E., Hellan, M., Kubista, E., and Singer, C. F. (2004). Breast
cancer size in postmenopausal women is correlated with body mass index and androgen
serum levels. Gynecol Endocrinol 18, 29-36.
Augereau, P., Garcia, M., Mattei, M. G., Cavailles, V., Depadova, F., Derocq, D., Capony, F.,
Ferrara, P., and Rochefort, H. (1988). Cloning and sequencing of the 52K cathepsin D
complementary deoxyribonucleic acid of MCF7 breast cancer cells and mapping on
chromosome 11. Mol Endocrinol 2, 186-192.
Augereau, P., Miralles, F., Cavailles, V., Gaudelet, C., Parker, M., and Rochefort, H. (1994).
Characterization of the proximal estrogen-responsive element of human cathepsin D gene.
Mol Endocrinol 8, 693-703.
76
Authier, F., Metioui, M., Fabrega, S., Kouach, M., and Briand, G. (2002). Endosomal
proteolysis of internalized insulin at the C-terminal region of the B chain by cathepsin D. J
Biol Chem 277, 9437-9446.
Authier, F., Mort, J. S., Bell, A. W., Posner, B. I., and Bergeron, J. J. (1995). Proteolysis of
glucagon within hepatic endosomes by membrane-associated cathepsins B and D. J Biol
Chem 270, 15798-15807.
Avram, M. M., Avram, A. S., and James, W. D. (2007). Subcutaneous fat in normal and
diseased states 3. Adipogenesis: from stem cell to fat cell. J Am Acad Dermatol 56, 472-492.
Awano, T., Katz, M. L., O'Brien, D. P., Taylor, J. F., Evans, J., Khan, S., Sohar, I., Lobel, P.,
and Johnson, G. S. (2006). A mutation in the cathepsin D gene (CTSD) in American Bulldogs
with neuronal ceroid lipofuscinosis. Mol Genet Metab 87, 341-348.
Baechle, D., Flad, T., Cansier, A., Steffen, H., Schittek, B., Tolson, J., Herrmann, T., Dihazi,
H., Beck, A., Mueller, G. A., et al. (2006). Cathepsin D is present in human eccrine sweat and
involved in the postsecretory processing of the antimicrobial peptide DCD-1L. J Biol Chem
281, 5406-5415.
Baldwin, A. S. (2001). Control of oncogenesis and cancer therapy resistance by the
transcription factor NF-kappaB. J Clin Invest 107, 241-246.
Baldwin, E. T., Bhat, T. N., Gulnik, S., Hosur, M. V., Sowder, R. C., 2nd, Cachau, R. E.,
Collins, J., Silva, A. M., and Erickson, J. W. (1993). Crystal structures of native and inhibited
forms of human cathepsin D: implications for lysosomal targeting and drug design. Proc Natl
Acad Sci U S A 90, 6796-6800.
Baranski, T. J., Cantor, A. B., and Kornfeld, S. (1992). Lysosomal enzyme phosphorylation. I.
Protein recognition determinants in both lobes of procathepsin D mediate its interaction with
UDP-GlcNAc:lysosomal enzyme N-acetylglucosamine-1-phosphotransferase. J Biol Chem
267, 23342-23348.
Barbaras, R., Grimaldi, P., Negrel, R., and Ailhaud, G. (1985). Binding of lipoproteins and
regulation of cholesterol synthesis in cultured mouse adipose cells. Biochim Biophys Acta
845, 492-501.
Barnes, H., Larsen, B., Tyers, M., and van Der Geer, P. (2001). Tyrosine-phosphorylated low
density lipoprotein receptor-related protein 1 (Lrp1) associates with the adaptor protein SHC
in SRC-transformed cells. J Biol Chem 276, 19119-19125.
Barrera, C., Ye, G., Espejo, R., Gunasena, S., Almanza, R., Leary, J., Crowe, S., Ernst, P., and
Reyes, V. E. (2001). Expression of cathepsins B, L, S, and D by gastric epithelial cells
77
implicates them as antigen presenting cells in local immune responses. Hum Immunol 62,
1081-1091.
Barrett, A. J. (1970). Cathepsin D. Purification of isoenzymes from human and chicken liver.
Biochem J 117, 601-607.
Beaujouin, M., Baghdiguian, S., Glondu-Lassis, M., Berchem, G., and Liaudet-Coopman, E.
(2006). Overexpression of both catalytically active and -inactive cathepsin D by cancer cells
enhances apoptosis-dependent chemo-sensitivity. Oncogene 25, 1967-1973.
Beisiegel, U., Krapp, A., Weber, W., Olivecrona, G., and Gliemann, J. (1996). The role of
lipases and LRP in the catabolism of triglyceride-rich lipoproteins. Z Gastroenterol 34 Suppl
3, 108-109.
Benes, P., Jurajda, M., Zaloudik, J., Izakovicova-Holla, L., and Vacha, J. (2003). C766T lowdensity lipoprotein receptor-related protein 1 (LRP1) gene polymorphism and susceptibility to
breast cancer. Breast Cancer Res 5, R77-81.
Benes, P., Vetvicka, V., and Fusek, M. (2008). Cathepsin D--many functions of one aspartic
protease. Crit Rev Oncol Hematol 68, 12-28.
Berchem, G., Glondu, M., Gleizes, M., Brouillet, J. P., Vignon, F., Garcia, M., and LiaudetCoopman, E. (2002). Cathepsin-D affects multiple tumor progression steps in vivo:
proliferation, angiogenesis and apoptosis. Oncogene 21, 5951-5955.
Bissell, M. J., and Labarge, M. A. (2005). Context, tissue plasticity, and cancer: are tumor
stem cells also regulated by the microenvironment? Cancer Cell 7, 17-23.
Bjorntorp, P., and Ostman, J. (1971). Human adipose tissue dynamics and regulation. Adv
Metab Disord 5, 277-327.
Bluher, M. (2009). The distinction of metabolically 'healthy' from 'unhealthy' obese
individuals. Curr Opin Lipidol.
Boucher, P., and Gotthardt, M. (2004). LRP and PDGF signaling: a pathway to
atherosclerosis. Trends Cardiovasc Med 14, 55-60.
Boucher, P., Gotthardt, M., Li, W. P., Anderson, R. G., and Herz, J. (2003). LRP: role in
vascular wall integrity and protection from atherosclerosis. Science 300, 329-332.
Boucher, P., Liu, P., Gotthardt, M., Hiesberger, T., Anderson, R. G., and Herz, J. (2002).
Platelet-derived growth factor mediates tyrosine phosphorylation of the cytoplasmic domain
of the low Density lipoprotein receptor-related protein in caveolae. J Biol Chem 277, 1550715513.
78
Bouloumie, A., Sengenes, C., Portolan, G., Galitzky, J., and Lafontan, M. (2001). Adipocyte
produces matrix metalloproteinases 2 and 9: involvement in adipose differentiation. Diabetes
50, 2080-2086.
Bourlier, V., Zakaroff-Girard, A., De Barros, S., Pizzacalla, C., de Saint Front, V. D.,
Lafontan, M., Bouloumie, A., and Galitzky, J. (2005). Protease inhibitor treatments reveal
specific involvement of matrix metalloproteinase-9 in human adipocyte differentiation. J
Pharmacol Exp Ther 312, 1272-1279.
Braulke, T., Claussen, M., Saftig, P., Wendland, M., Neifer, K., Schmidt, B., Zapf, J., von
Figura, K., and Peters, C. (1995). Proteolysis of IGFBPs by cathepsin D in vitro and in
cathepsin D-deficient mice. Prog Growth Factor Res 6, 265-271.
Briozzo, P., Badet, J., Capony, F., Pieri, I., Montcourrier, P., Barritault, D., and Rochefort, H.
(1991). MCF7 mammary cancer cells respond to bFGF and internalize it following its release
from extracellular matrix: a permissive role of cathepsin D. Exp Cell Res 194, 252-259.
Bryant, N. J., Govers, R., and James, D. E. (2002). Regulated transport of the glucose
transporter GLUT4. Nat Rev Mol Cell Biol 3, 267-277.
Butler, G. S., Dean, R. A., Smith, D., and Overall, C. M. (2009). Membrane protease
degradomics: proteomic identification and quantification of cell surface protease substrates.
Methods Mol Biol 528, 159-176.
Campfield, L. A., Smith, F. J., Guisez, Y., Devos, R., and Burn, P. (1995). Recombinant
mouse OB protein: evidence for a peripheral signal linking adiposity and central neural
networks. Science 269, 546-549.
Cantor, A. B., Baranski, T. J., and Kornfeld, S. (1992). Lysosomal enzyme phosphorylation.
II. Protein recognition determinants in either lobe of procathepsin D are sufficient for
phosphorylation of both the amino and carboxyl lobe oligosaccharides. J Biol Chem 267,
23349-23356.
Capony, F., Morisset, M., Barrett, A. J., Capony, J. P., Broquet, P., Vignon, F., Chambon, M.,
Louisot, P., and Rochefort, H. (1987). Phosphorylation, glycosylation, and proteolytic activity
of the 52-kD estrogen-induced protein secreted by MCF7 cells. J Cell Biol 104, 253-262.
Capony, F., Rougeot, C., Montcourrier, P., Cavailles, V., Salazar, G., and Rochefort, H.
(1989). Increased secretion, altered processing, and glycosylation of pro-cathepsin D in
human mammary cancer cells. Cancer Res 49, 3904-3909.
Castino, R., Delpal, S., Bouguyon, E., Demoz, M., Isidoro, C., and Ollivier-Bousquet, M.
(2008). Prolactin promotes the secretion of active cathepsin D at the basal side of rat
mammary acini. Endocrinology 149, 4095-4105.
79
Cataldo, A. M., Barnett, J. L., Berman, S. A., Li, J., Quarless, S., Bursztajn, S., Lippa, C., and
Nixon, R. A. (1995). Gene expression and cellular content of cathepsin D in Alzheimer's
disease brain: evidence for early up-regulation of the endosomal-lysosomal system. Neuron
14, 671-680.
Cavailles, V., Augereau, P., Garcia, M., and Rochefort, H. (1988). Estrogens and growth
factors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells. Nucleic
Acids Res 16, 1903-1919.
Cavailles, V., Augereau, P., and Rochefort, H. (1991). Cathepsin D gene of human MCF7
cells contains estrogen-responsive sequences in its 5' proximal flanking region. Biochem
Biophys Res Commun 174, 816-824.
Cavailles, V., Augereau, P., and Rochefort, H. (1993). Cathepsin D gene is controlled by a
mixed promoter, and estrogens stimulate only TATA-dependent transcription in breast cancer
cells. Proc Natl Acad Sci U S A 90, 203-207.
Chandra, V., Huang, P., Hamuro, Y., Raghuram, S., Wang, Y., Burris, T. P., and Rastinejad,
F. (2008). Structure of the intact PPAR-gamma-RXR- nuclear receptor complex on DNA.
Nature 456, 350-356.
Chavey, C., Mari, B., Monthouel, M. N., Bonnafous, S., Anglard, P., Van Obberghen, E., and
Tartare-Deckert, S. (2003). Matrix metalloproteinases are differentially expressed in adipose
tissue during obesity and modulate adipocyte differentiation. J Biol Chem 278, 11888-11896.
Cleary, M. P., and Grossmann, M. E. (2009). Minireview: Obesity and breast cancer: the
estrogen connection. Endocrinology 150, 2537-2542.
Croissandeau, G., Chretien, M., and Mbikay, M. (2002). Involvement of matrix
metalloproteinases in the adipose conversion of 3T3-L1 preadipocytes. Biochem J 364, 739746.
Cullen, V., Lindfors, M., Ng, J., Paetau, A., Swinton, E., Kolodziej, P., Boston, H., Saftig, P.,
Woulfe, J., Feany, M. B., et al. (2009). Cathepsin D expression level affects alpha-synuclein
processing, aggregation, and toxicity in vivo. Mol Brain 2, 5.
De Wever, O., Nguyen, Q. D., Van Hoorde, L., Bracke, M., Bruyneel, E., Gespach, C., and
Mareel, M. (2004). Tenascin-C and SF/HGF produced by myofibroblasts in vitro provide
convergent pro-invasive signals to human colon cancer cells through RhoA and Rac. Faseb J
18, 1016-1018.
Dedieu, S., Langlois, B., Devy, J., Sid, B., Henriet, P., Sartelet, H., Bellon, G., Emonard, H.,
and Martiny, L. (2008). LRP-1 silencing prevents malignant cell invasion despite increased
pericellular proteolytic activities. Mol Cell Biol 28, 2980-2995.
80
Deiss, L. P., Galinka, H., Berissi, H., Cohen, O., and Kimchi, A. (1996). Cathepsin D protease
mediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha.
Embo J 15, 3861-3870.
Dieudonne, M. N., Bussiere, M., Dos Santos, E., Leneveu, M. C., Giudicelli, Y., and
Pecquery, R. (2006). Adiponectin mediates antiproliferative and apoptotic responses in human
MCF7 breast cancer cells. Biochem Biophys Res Commun 345, 271-279.
Diment, S., Leech, M. S., and Stahl, P. D. (1988). Cathepsin D is membrane-associated in
macrophage endosomes. J Biol Chem 263, 6901-6907.
Diment, S., Martin, K. J., and Stahl, P. D. (1989). Cleavage of parathyroid hormone in
macrophage endosomes illustrates a novel pathway for intracellular processing of proteins. J
Biol Chem 264, 13403-13406.
Elenbaas, B., and Weinberg, R. A. (2001). Heterotypic signaling between epithelial tumor
cells and fibroblasts in carcinoma formation. Exp Cell Res 264, 169-184.
Emert-Sedlak, L., Shangary, S., Rabinovitz, A., Miranda, M. B., Delach, S. M., and Johnson,
D. E. (2005). Involvement of cathepsin D in chemotherapy-induced cytochrome c release,
caspase activation, and cell death. Mol Cancer Ther 4, 733-742.
Erickson, A. H. (1989). Biosynthesis of lysosomal endopeptidases. J Cell Biochem 40, 31-41.
Farmer, S. R. (2006). Transcriptional control of adipocyte formation. Cell Metab 4, 263-273.
Faust, P. L., Kornfeld, S., and Chirgwin, J. M. (1985). Cloning and sequence analysis of
cDNA for human cathepsin D. Proc Natl Acad Sci U S A 82, 4910-4914.
Ferrandina, G., Scambia, G., Bardelli, F., Benedetti Panici, P., Mancuso, S., and Messori, A.
(1997). Relationship between cathepsin-D content and disease-free survival in node-negative
breast cancer patients: a meta-analysis. Br J Cancer 76, 661-666.
Feve, B. (2005). Adipogenesis: cellular and molecular aspects. Best Pract Res Clin
Endocrinol Metab 19, 483-499.
Fitzgibbons, P. L., Page, D. L., Weaver, D., Thor, A. D., Allred, D. C., Clark, G. M., Ruby, S.
G., O'Malley, F., Simpson, J. F., Connolly, J. L., et al. (2000). Prognostic factors in breast
cancer. College of American Pathologists Consensus Statement 1999. Arch Pathol Lab Med
124, 966-978.
Flier, J. S. (2004). Obesity wars: molecular progress confronts an expanding epidemic. Cell
116, 337-350.
Foekens, J. A., Look, M. P., Bolt-de Vries, J., Meijer-van Gelder, M. E., van Putten, W. L.,
and Klijn, J. G. (1999). Cathepsin-D in primary breast cancer: prognostic evaluation involving
2810 patients. Br J Cancer 79, 300-307.
81
Folkman, J. (2003). Fundamental concepts of the angiogenic process. Curr Mol Med 3, 643651.
Folkman, J., and Kalluri, R. (2004). Cancer without disease. Nature 427, 787.
Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M.
(1995). 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination
factor PPAR gamma. Cell 83, 803-812.
Frayn, K. N., Karpe, F., Fielding, B. A., Macdonald, I. A., and Coppack, S. W. (2003).
Integrative physiology of human adipose tissue. Int J Obes Relat Metab Disord 27, 875-888.
Fukao, T., Lopaschuk, G. D., and Mitchell, G. A. (2004). Pathways and control of ketone
body metabolism: on the fringe of lipid biochemistry. Prostaglandins Leukot Essent Fatty
Acids 70, 243-251.
Funicello, M., Novelli, M., Ragni, M., Vottari, T., Cocuzza, C., Soriano-Lopez, J., Chiellini,
C., Boschi, F., Marzola, P., Masiello, P., et al. (2007). Cathepsin K null mice show reduced
adiposity during the rapid accumulation of fat stores. PLoS One 2, e683.
Fusek, M., Mares, M., Vagner, J., Voburka, Z., and Baudys, M. (1991). Inhibition of aspartic
proteinases by propart peptides of human procathepsin D and chicken pepsinogen. FEBS Lett
287, 160-162.
Fusek, M., and Vetvicka, V. (1994). Mitogenic function of human procathepsin D: the role of
the propeptide. Biochem J 303 ( Pt 3), 775-780.
Fusek, M., and Vetvicka, V. (2005). Dual role of cathepsin D: ligand and protease. Biomed
Pap Med Fac Univ Palacky Olomouc Czech Repub 149, 43-50.
Garcia, M., Derocq, D., Pujol, P., and Rochefort, H. (1990). Overexpression of transfected
cathepsin D in transformed cells increases their malignant phenotype and metastatic potency.
Oncogene 5, 1809-1814.
Garg, A., and Aggarwal, B. B. (2002). Nuclear transcription factor-kappaB as a target for
cancer drug development. Leukemia 16, 1053-1068.
Glondu, M., Coopman, P., Laurent-Matha, V., Garcia, M., Rochefort, H., and LiaudetCoopman, E. (2001). A mutated cathepsin-D devoid of its catalytic activity stimulates the
growth of cancer cells. Oncogene 20, 6920-6929.
Glondu, M., Liaudet-Coopman, E., Derocq, D., Platet, N., Rochefort, H., and Garcia, M.
(2002). Down-regulation of cathepsin-D expression by antisense gene transfer inhibits tumor
growth and experimental lung metastasis of human breast cancer cells. Oncogene 21, 51275134.
82
Gonzalez-Vela, M. C., Garijo, M. F., Fernandez, F., Buelta, L., and Val-Bernal, J. F. (1999).
Cathepsin D in host stromal cells is associated with more highly vascular and aggressive
invasive breast carcinoma. Histopathology 34, 35-42.
Gopalakrishnan, M. M., Grosch, H. W., Locatelli-Hoops, S., Werth, N., Smolenova, E.,
Nettersheim, M., Sandhoff, K., and Hasilik, A. (2004). Purified recombinant human
prosaposin forms oligomers that bind procathepsin D and affect its autoactivation. Biochem J
383, 507-515.
Goudriaan, J. R., Tacken, P. J., Dahlmans, V. E., Gijbels, M. J., van Dijk, K. W., Havekes, L.
M., and Jong, M. C. (2001). Protection from obesity in mice lacking the VLDL receptor.
Arterioscler Thromb Vasc Biol 21, 1488-1493.
Gregoire, F. M., Smas, C. M., and Sul, H. S. (1998). Understanding adipocyte differentiation.
Physiol Rev 78, 783-809.
Griffiths, J. R. (1991). Are cancer cells acidic? Br J Cancer 64, 425-427.
Haidar, B., Kiss, R. S., Sarov-Blat, L., Brunet, R., Harder, C., McPherson, R., and Marcel, Y.
L. (2006). Cathepsin D, a lysosomal protease, regulates ABCA1-mediated lipid efflux. J Biol
Chem 281, 39971-39981.
Han, J., Luo, T., Gu, Y., Li, G., Jia, W., and Luo, M. (2009a). Cathepsin K regulates
adipocyte differentiation: possible involvement of type I collagen degradation. Endocr J 56,
55-63.
Han, S. H., Sakuma, I., Shin, E. K., and Koh, K. K. (2009b). Antiatherosclerotic and antiinsulin resistance effects of adiponectin: basic and clinical studies. Prog Cardiovasc Dis 52,
126-140.
Haque, A., Banik, N. L., and Ray, S. K. (2008). New insights into the roles of endolysosomal
cathepsins in the pathogenesis of Alzheimer's disease: cathepsin inhibitors as potential
therapeutics. CNS Neurol Disord Drug Targets 7, 270-277.
Herz, J., Clouthier, D. E., and Hammer, R. E. (1992). LDL receptor-related protein
internalizes and degrades uPA-PAI-1 complexes and is essential for embryo implantation.
Cell 71, 411-421.
Heylen, N., Vincent, L. M., Devos, V., Dubois, V., Remacle, C., and Trouet, A. (2002).
Fibroblasts capture cathepsin D secreted by breast cancer cells: possible role in the regulation
of the invasive process. Int J Oncol 20, 761-767.
Hilfiker-Kleiner, D., Kaminski, K., Podewski, E., Bonda, T., Schaefer, A., Sliwa, K., Forster,
O., Quint, A., Landmesser, U., Doerries, C., et al. (2007). A cathepsin D-cleaved 16 kDa form
of prolactin mediates postpartum cardiomyopathy. Cell 128, 589-600.
83
Hofmann, S. M., Zhou, L., Perez-Tilve, D., Greer, T., Grant, E., Wancata, L., Thomas, A.,
Pfluger, P. T., Basford, J. E., Gilham, D., et al. (2007). Adipocyte LDL receptor-related
protein-1 expression modulates postprandial lipid transport and glucose homeostasis in mice.
J Clin Invest 117, 3271-3282.
Housa, D., Housova, J., Vernerova, Z., and Haluzik, M. (2006). Adipocytokines and cancer.
Physiol Res 55, 233-244.
Hu, E., Tontonoz, P., and Spiegelman, B. M. (1995). Transdifferentiation of myoblasts by the
adipogenic transcription factors PPAR gamma and C/EBP alpha. Proc Natl Acad Sci U S A
92, 9856-9860.
Hu, K., Yang, J., Tanaka, S., Gonias, S. L., Mars, W. M., and Liu, Y. (2006). Tissue-type
plasminogen activator acts as a cytokine that triggers intracellular signal transduction and
induces matrix metalloproteinase-9 gene expression. J Biol Chem 281, 2120-2127.
Hu, L., Roth, J. M., Brooks, P., Luty, J., and Karpatkin, S. (2008). Thrombin up-regulates
cathepsin D which enhances angiogenesis, growth, and metastasis. Cancer Res 68, 46664673.
Huang, L., and Li, C. (2000). Leptin: a multifunctional hormone. Cell Res 10, 81-92.
Imai, T., Takakuwa, R., Marchand, S., Dentz, E., Bornert, J. M., Messaddeq, N., Wendling,
O., Mark, M., Desvergne, B., Wahli, W., et al. (2004). Peroxisome proliferator-activated
receptor gamma is required in mature white and brown adipocytes for their survival in the
mouse. Proc Natl Acad Sci U S A 101, 4543-4547.
Iyengar, P., Combs, T. P., Shah, S. J., Gouon-Evans, V., Pollard, J. W., Albanese, C.,
Flanagan, L., Tenniswood, M. P., Guha, C., Lisanti, M. P., et al. (2003). Adipocyte-secreted
factors synergistically promote mammary tumorigenesis through induction of anti-apoptotic
transcriptional programs and proto-oncogene stabilization. Oncogene 22, 6408-6423.
Iyengar, P., Espina, V., Williams, T. W., Lin, Y., Berry, D., Jelicks, L. A., Lee, H., Temple,
K., Graves, R., Pollard, J., et al. (2005). Adipocyte-derived collagen VI affects early
mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma
microenvironment. J Clin Invest 115, 1163-1176.
Jones, J. R., Barrick, C., Kim, K. A., Lindner, J., Blondeau, B., Fujimoto, Y., Shiota, M.,
Kesterson, R. A., Kahn, B. B., and Magnuson, M. A. (2005). Deletion of PPARgamma in
adipose tissues of mice protects against high fat diet-induced obesity and insulin resistance.
Proc Natl Acad Sci U S A 102, 6207-6212.
Kaaks, R., Rinaldi, S., Key, T. J., Berrino, F., Peeters, P. H., Biessy, C., Dossus, L.,
Lukanova, A., Bingham, S., Khaw, K. T., et al. (2005). Postmenopausal serum androgens,
84
oestrogens and breast cancer risk: the European prospective investigation into cancer and
nutrition. Endocr Relat Cancer 12, 1071-1082.
Kendall, A., Folkerd, E. J., and Dowsett, M. (2007). Influences on circulating oestrogens in
postmenopausal women: relationship with breast cancer. J Steroid Biochem Mol Biol 103, 99109.
Kenessey, A., Nacharaju, P., Ko, L. W., and Yen, S. H. (1997). Degradation of tau by
lysosomal enzyme cathepsin D: implication for Alzheimer neurofibrillary degeneration. J
Neurochem 69, 2026-2038.
Khalkhali-Ellis, Z., and Hendrix, M. J. (2007). Elucidating the function of secreted maspin:
inhibiting cathepsin D-mediated matrix degradation. Cancer Res 67, 3535-3539.
Kim, K. Y., Baek, A., Park, Y. S., Park, M. Y., Kim, J. H., Lim, J. S., Lee, M. S., Yoon, S. R.,
Lee, H. G., Yoon, Y., et al. (2009). Adipocyte culture medium stimulates invasiveness of
MDA-MB-231 cell via CCL20 production. Oncol Rep 22, 1497-1504.
Kim, S. H., Kang, E. S., Hur, K. Y., Lee, H. J., Han, S. J., Kwak, J. Y., Nam, C. M., Ahn, C.
W., Cha, B. S., and Lee, H. C. (2008). Adiponectin gene polymorphism 45T>G is associated
with carotid artery plaques in patients with type 2 diabetes mellitus. Metabolism 57, 274-279.
Kinoshita, A., Shah, T., Tangredi, M. M., Strickland, D. K., and Hyman, B. T. (2003). The
intracellular domain of the low density lipoprotein receptor-related protein modulates
transactivation mediated by amyloid precursor protein and Fe65. J Biol Chem 278, 4118241188.
Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I., Morris, D. C., and Lehmann, J. M.
(1995). A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor
gamma and promotes adipocyte differentiation. Cell 83, 813-819.
Koike, M., Shibata, M., Ohsawa, Y., Nakanishi, H., Koga, T., Kametaka, S., Waguri, S.,
Momoi, T., Kominami, E., Peters, C., et al. (2003). Involvement of two different cell death
pathways in retinal atrophy of cathepsin D-deficient mice. Mol Cell Neurosci 22, 146-161.
Kornfeld, S. (1990). Lysosomal enzyme targeting. Biochem Soc Trans 18, 367-374.
Kubo, Y., Kaidzu, S., Nakajima, I., Takenouchi, K., and Nakamura, F. (2000). Organization
of extracellular matrix components during differentiation of adipocytes in long-term culture.
In Vitro Cell Dev Biol Anim 36, 38-44.
Kuronen, M., Talvitie, M., Lehesjoki, A. E., and Myllykangas, L. (2009). Genetic modifiers
of degeneration in the cathepsin D deficient Drosophila model for neuronal ceroid
lipofuscinosis. Neurobiol Dis 36, 488-493.
85
Langin, D. (2006a). Adipose tissue lipolysis as a metabolic pathway to define
pharmacological strategies against obesity and the metabolic syndrome. Pharmacol Res 53,
482-491.
Langin, D. (2006b). Control of fatty acid and glycerol release in adipose tissue lipolysis. C R
Biol 329, 598-607; discussion 653-595.
Large, V., and Arner, P. (1998). Regulation of lipolysis in humans. Pathophysiological
modulation in obesity, diabetes, and hyperlipidaemia. Diabetes Metab 24, 409-418.
Large, V., Peroni, O., Letexier, D., Ray, H., and Beylot, M. (2004). Metabolism of lipids in
human white adipocyte. Diabetes Metab 30, 294-309.
Laurent-Matha, V., Derocq, D., Prebois, C., Katunuma, N., and Liaudet-Coopman, E. (2006).
Processing of human cathepsin D is independent of its catalytic function and auto-activation:
involvement of cathepsins L and B. J Biochem 139, 363-371.
Laurent-Matha, V., Farnoud, M. R., Lucas, A., Rougeot, C., Garcia, M., and Rochefort, H.
(1998). Endocytosis of pro-cathepsin D into breast cancer cells is mostly independent of
mannose-6-phosphate receptors. J Cell Sci 111 ( Pt 17), 2539-2549.
Laurent-Matha, V., Lucas, A., Huttler, S., Sandhoff, K., Garcia, M., and Rochefort, H. (2002).
Procathepsin D interacts with prosaposin in cancer cells but its internalization is not mediated
by LDL receptor-related protein. Exp Cell Res 277, 210-219.
Laurent-Matha, V., Maruani-Herrmann, S., Prebois, C., Beaujouin, M., Glondu, M., Noel, A.,
Alvarez-Gonzalez, M. L., Blacher, S., Coopman, P., Baghdiguian, S., et al. (2005).
Catalytically inactive human cathepsin D triggers fibroblast invasive growth. J Cell Biol 168,
489-499.
Lee, A. Y., Gulnik, S. V., and Erickson, J. W. (1998). Conformational switching in an aspartic
proteinase. Nat Struct Biol 5, 866-871.
Lee, D., Walsh, J. D., Mikhailenko, I., Yu, P., Migliorini, M., Wu, Y., Krueger, S., Curtis, J.
E., Harris, B., Lockett, S., et al. (2006). RAP uses a histidine switch to regulate its interaction
with LRP in the ER and Golgi. Mol Cell 22, 423-430.
Lefterova, M. I., and Lazar, M. A. (2009). New developments in adipogenesis. Trends
Endocrinol Metab 20, 107-114.
Lefterova, M. I., Zhang, Y., Steger, D. J., Schupp, M., Schug, J., Cristancho, A., Feng, D.,
Zhuo, D., Stoeckert, C. J., Jr., Liu, X. S., and Lazar, M. A. (2008). PPARgamma and C/EBP
factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale. Genes
Dev 22, 2941-2952.
86
Letexier, D., Pinteur, C., Large, V., Frering, V., and Beylot, M. (2003). Comparison of the
expression and activity of the lipogenic pathway in human and rat adipose tissue. J Lipid Res
44, 2127-2134.
Li, Y., Lu, W., and Bu, G. (2003). Essential role of the low density lipoprotein receptorrelated protein in vascular smooth muscle cell migration. FEBS Lett 555, 346-350.
Liaudet-Coopman, E., Beaujouin, M., Derocq, D., Garcia, M., Glondu-Lassis, M., LaurentMatha, V., Prebois, C., Rochefort, H., and Vignon, F. (2006). Cathepsin D: newly discovered
functions of a long-standing aspartic protease in cancer and apoptosis. Cancer Lett 237, 167179.
Liaudet, E., Derocq, D., Rochefort, H., and Garcia, M. (1995). Transfected cathepsin D
stimulates high density cancer cell growth by inactivating secreted growth inhibitors. Cell
Growth Differ 6, 1045-1052.
Liaudet, E., Garcia, M., and Rochefort, H. (1994). Cathepsin D maturation and its stimulatory
effect on metastasis are prevented by addition of KDEL retention signal. Oncogene 9, 11451154.
Lijnen, H. R., Maquoi, E., Hansen, L. B., Van Hoef, B., Frederix, L., and Collen, D. (2002).
Matrix metalloproteinase inhibition impairs adipose tissue development in mice. Arterioscler
Thromb Vasc Biol 22, 374-379.
Lilla, J., Stickens, D., and Werb, Z. (2002). Metalloproteases and adipogenesis: a weighty
subject. Am J Pathol 160, 1551-1554.
Lillis, A. P., Van Duyn, L. B., Murphy-Ullrich, J. E., and Strickland, D. K. (2008). LDL
receptor-related protein 1: unique tissue-specific functions revealed by selective gene
knockout studies. Physiol Rev 88, 887-918.
Liu, Q., Zhang, J., Tran, H., Verbeek, M. M., Reiss, K., Estus, S., and Bu, G. (2009). LRP1
shedding in human brain: roles of ADAM10 and ADAM17. Mol Neurodegener 4, 17.
Loukinova, E., Ranganathan, S., Kuznetsov, S., Gorlatova, N., Migliorini, M. M., Loukinov,
D., Ulery, P. G., Mikhailenko, I., Lawrence, D. A., and Strickland, D. K. (2002). Plateletderived growth factor (PDGF)-induced tyrosine phosphorylation of the low density
lipoprotein receptor-related protein (LRP). Evidence for integrated co-receptor function
betwenn LRP and the PDGF. J Biol Chem 277, 15499-15506.
Ludwig, T., Munier-Lehmann, H., Bauer, U., Hollinshead, M., Ovitt, C., Lobel, P., and
Hoflack, B. (1994). Differential sorting of lysosomal enzymes in mannose 6-phosphate
receptor-deficient fibroblasts. Embo J 13, 3430-3437.
87
Ludwig, T., Ovitt, C. E., Bauer, U., Hollinshead, M., Remmler, J., Lobel, P., Ruther, U., and
Hoflack, B. (1993). Targeted disruption of the mouse cation-dependent mannose 6-phosphate
receptor results in partial missorting of multiple lysosomal enzymes. Embo J 12, 5225-5235.
Maffei, M., Fei, H., Lee, G. H., Dani, C., Leroy, P., Zhang, Y., Proenca, R., Negrel, R.,
Ailhaud, G., and Friedman, J. M. (1995). Increased expression in adipocytes of ob RNA in
mice with lesions of the hypothalamus and with mutations at the db locus. Proc Natl Acad Sci
U S A 92, 6957-6960.
Manabe, Y., Toda, S., Miyazaki, K., and Sugihara, H. (2003). Mature adipocytes, but not
preadipocytes, promote the growth of breast carcinoma cells in collagen gel matrix culture
through cancer-stromal cell interactions. J Pathol 201, 221-228.
Markert, C. D., Atala, A., Cann, J. K., Christ, G., Furth, M., Ambrosio, F., and Childers, M.
K. (2009). Mesenchymal stem cells: emerging therapy for Duchenne muscular dystrophy. Pm
R 1, 547-559.
Massiera, F., Bloch-Faure, M., Ceiler, D., Murakami, K., Fukamizu, A., Gasc, J. M.,
Quignard-Boulange, A., Negrel, R., Ailhaud, G., Seydoux, J., et al. (2001). Adipose
angiotensinogen is involved in adipose tissue growth and blood pressure regulation. Faseb J
15, 2727-2729.
May, P., Rohlmann, A., Bock, H. H., Zurhove, K., Marth, J. D., Schomburg, E. D., Noebels,
J. L., Beffert, U., Sweatt, J. D., Weeber, E. J., and Herz, J. (2004). Neuronal LRP1
functionally associates with postsynaptic proteins and is required for normal motor function in
mice. Mol Cell Biol 24, 8872-8883.
McIntyre, G. F., and Erickson, A. H. (1991). Procathepsins L and D are membrane-bound in
acidic microsomal vesicles. J Biol Chem 266, 15438-15445.
McIntyre, G. F., and Erickson, A. H. (1993). The lysosomal proenzyme receptor that binds
procathepsin L to microsomal membranes at pH 5 is a 43-kDa integral membrane protein.
Proc Natl Acad Sci U S A 90, 10588-10592.
Mead, J. R., Irvine, S. A., and Ramji, D. P. (2002). Lipoprotein lipase: structure, function,
regulation, and role in disease. J Mol Med 80, 753-769.
Medina-Gomez, G., Virtue, S., Lelliott, C., Boiani, R., Campbell, M., Christodoulides, C.,
Perrin, C., Jimenez-Linan, M., Blount, M., Dixon, J., et al. (2005). The link between
nutritional status and insulin sensitivity is dependent on the adipocyte-specific peroxisome
proliferator-activated receptor-gamma2 isoform. Diabetes 54, 1706-1716.
Metcalf, P., and Fusek, M. (1993). Two crystal structures for cathepsin D: the lysosomal
targeting signal and active site. Embo J 12, 1293-1302.
88
Metcalf, P., and Fusek, M. (1995). Cathepsin D crystal structures and lysosomal sorting. Adv
Exp Med Biol 362, 193-200.
Minarowska, A., Gacko, M., Karwowska, A., and Minarowski, L. (2008). Human cathepsin
D. Folia Histochem Cytobiol 46, 23-38.
Missmer, S. A., Eliassen, A. H., Barbieri, R. L., and Hankinson, S. E. (2004). Endogenous
estrogen, androgen, and progesterone concentrations and breast cancer risk among
postmenopausal women. J Natl Cancer Inst 96, 1856-1865.
Mohamadzadeh, M., Mohamadzadeh, H., Brammer, M., Sestak, K., and Luftig, R. B. (2004).
Identification of proteases employed by dendritic cells in the processing of protein purified
derivative (PPD). J Immune Based Ther Vaccines 2, 8.
Mohamed, M. M., and Sloane, B. F. (2006). Cysteine cathepsins: multifunctional enzymes in
cancer. Nat Rev Cancer 6, 764-775.
Morikawa, W., Yamamoto, K., Ishikawa, S., Takemoto, S., Ono, M., Fukushi, J., Naito, S.,
Nozaki, C., Iwanaga, S., and Kuwano, M. (2000). Angiostatin generation by cathepsin D
secreted by human prostate carcinoma cells. J Biol Chem 275, 38912-38920.
Mueller, M. M., and Fusenig, N. E. (2004). Friends or foes - bipolar effects of the tumour
stroma in cancer. Nat Rev Cancer 4, 839-849.
Munzberg, H., and Myers, M. G., Jr. (2005). Molecular and anatomical determinants of
central leptin resistance. Nat Neurosci 8, 566-570.
Mutka, A. L., Haapanen, A., Kakela, R., Lindfors, M., Wright, A. K., Inkinen, T.,
Hermansson, M., Rokka, A., Corthals, G., Jauhiainen, M., et al. (2009). Murine cathepsin D
deficiency is associated with dysmyelination/myelin disruption and accumulation of
cholesteryl esters in the brain. J Neurochem.
Neels, J. G., van Den Berg, B. M., Lookene, A., Olivecrona, G., Pannekoek, H., and van
Zonneveld, A. J. (1999). The second and fourth cluster of class A cysteine-rich repeats of the
low density lipoprotein receptor-related protein share ligand-binding properties. J Biol Chem
274, 31305-31311.
Newton, C. S., Loukinova, E., Mikhailenko, I., Ranganathan, S., Gao, Y., Haudenschild, C.,
and Strickland, D. K. (2005). Platelet-derived growth factor receptor-beta (PDGFR-beta)
activation promotes its association with the low density lipoprotein receptor-related protein
(LRP). Evidence for co-receptor function. J Biol Chem 280, 27872-27878.
Nikolic-Vukosavljevic, D., Markicevic, M., Grujic-Adanja, G., Petrovic, A., Kanjer, K., and
Neskovic-Konstantinovic, Z. (2005). Cathepsin D-related disease-free interval in pT1 primary
breast carcinomas: a pilot study. Clin Exp Metastasis 22, 363-368.
89
Nirde, P., Derocq, D., Maynadier, M., Chambon, M., Basile, I., Gary-Bobo, M., and Garcia,
M. (2009). Heat shock cognate 70 protein secretion as a new growth arrest signal for cancer
cells. Oncogene.
Obermeyer, K., Krueger, S., Peters, B., Falkenberg, B., Roessner, A., and Rocken, C. (2007).
The expression of low density lipoprotein receptor-related protein in colorectal carcinoma.
Oncol Rep 17, 361-367.
Ohri, S. S., Vashishta, A., Proctor, M., Fusek, M., and Vetvicka, V. (2007). Depletion of
procathepsin D gene expression by RNA interference: a potential therapeutic target for breast
cancer. Cancer Biol Ther 6, 1081-1087.
Olumi, A. F., Grossfeld, G. D., Hayward, S. W., Carroll, P. R., Tlsty, T. D., and Cunha, G. R.
(1999). Carcinoma-associated fibroblasts direct tumor progression of initiated human
prostatic epithelium. Cancer Res 59, 5002-5011.
Pan, S. Y., and DesMeules, M. (2009). Energy intake, physical activity, energy balance, and
cancer: epidemiologic evidence. Methods Mol Biol 472, 191-215.
Papassotiropoulos, A., Lewis, H. D., Bagli, M., Jessen, F., Ptok, U., Schulte, A., Shearman,
M. S., and Heun, R. (2002). Cerebrospinal fluid levels of beta-amyloid(42) in patients with
Alzheimer's disease are related to the exon 2 polymorphism of the cathepsin D gene.
Neuroreport 13, 1291-1294.
Park, K. W., Halperin, D. S., and Tontonoz, P. (2008). Before they were fat: adipocyte
progenitors. Cell Metab 8, 454-457.
Piwnica, D., Fernandez, I., Binart, N., Touraine, P., Kelly, P. A., and Goffin, V. (2006). A
new mechanism for prolactin processing into 16K PRL by secreted cathepsin D. Mol
Endocrinol 20, 3263-3278.
Piwnica, D., Touraine, P., Struman, I., Tabruyn, S., Bolbach, G., Clapp, C., Martial, J. A.,
Kelly, P. A., and Goffin, V. (2004). Cathepsin D processes human prolactin into multiple
16K-like N-terminal fragments: study of their antiangiogenic properties and physiological
relevance. Mol Endocrinol 18, 2522-2542.
Qiao, L., Hamamichi, S., Caldwell, K. A., Caldwell, G. A., Yacoubian, T. A., Wilson, S., Xie,
Z. L., Speake, L. D., Parks, R., Crabtree, D., et al. (2008). Lysosomal enzyme cathepsin D
protects against alpha-synuclein aggregation and toxicity. Mol Brain 1, 17.
Quinn, K. A., Grimsley, P. G., Dai, Y. P., Tapner, M., Chesterman, C. N., and Owensby, D.
A. (1997). Soluble low density lipoprotein receptor-related protein (LRP) circulates in human
plasma. J Biol Chem 272, 23946-23951.
90
Quinn, K. A., Pye, V. J., Dai, Y. P., Chesterman, C. N., and Owensby, D. A. (1999).
Characterization of the soluble form of the low density lipoprotein receptor-related protein
(LRP). Exp Cell Res 251, 433-441.
Rajala, M. W., and Scherer, P. E. (2003). Minireview: The adipocyte--at the crossroads of
energy homeostasis, inflammation, and atherosclerosis. Endocrinology 144, 3765-3773.
Redecker, B., Heckendorf, B., Grosch, H. W., Mersmann, G., and Hasilik, A. (1991).
Molecular organization of the human cathepsin D gene. DNA Cell Biol 10, 423-431.
Reeves, G. K., Pirie, K., Beral, V., Green, J., Spencer, E., and Bull, D. (2007). Cancer
incidence and mortality in relation to body mass index in the Million Women Study: cohort
study. Bmj 335, 1134.
Reichert, M., and Eick, D. (1999). Analysis of cell cycle arrest in adipocyte differentiation.
Oncogene 18, 459-466.
Renehan, A. G., Tyson, M., Egger, M., Heller, R. F., and Zwahlen, M. (2008). Body-mass
index and incidence of cancer: a systematic review and meta-analysis of prospective
observational studies. Lancet 371, 569-578.
Reshef, L., Olswang, Y., Cassuto, H., Blum, B., Croniger, C. M., Kalhan, S. C., Tilghman, S.
M., and Hanson, R. W. (2003). Glyceroneogenesis and the triglyceride/fatty acid cycle. J Biol
Chem 278, 30413-30416.
Richo, G. R., and Conner, G. E. (1994). Structural requirements of procathepsin D activation
and maturation. J Biol Chem 269, 14806-14812.
Richon, V. M., Lyle, R. E., and McGehee, R. E., Jr. (1997). Regulation and expression of
retinoblastoma proteins p107 and p130 during 3T3-L1 adipocyte differentiation. J Biol Chem
272, 10117-10124.
Rijnboutt, S., Kal, A. J., Geuze, H. J., Aerts, H., and Strous, G. J. (1991). Mannose 6phosphate-independent targeting of cathepsin D to lysosomes in HepG2 cells. J Biol Chem
266, 23586-23592.
Rochefort, H. (1996). The prognostic value of cathepsin D in breast cancer. A long road to the
clinic. Eur J Cancer 32A, 7-8.
Rose, D. P., Komninou, D., and Stephenson, G. D. (2004). Obesity, adipocytokines, and
insulin resistance in breast cancer. Obes Rev 5, 153-165.
Rosen, E. D., Hsu, C. H., Wang, X., Sakai, S., Freeman, M. W., Gonzalez, F. J., and
Spiegelman, B. M. (2002). C/EBPalpha induces adipogenesis through PPARgamma: a unified
pathway. Genes Dev 16, 22-26.
91
Rozanov, D. V., Hahn-Dantona, E., Strickland, D. K., and Strongin, A. Y. (2004). The low
density lipoprotein receptor-related protein LRP is regulated by membrane type-1 matrix
metalloproteinase (MT1-MMP) proteolysis in malignant cells. J Biol Chem 279, 4260-4268.
Sadik, G., Kaji, H., Takeda, K., Yamagata, F., Kameoka, Y., Hashimoto, K., Miyanaga, K.,
and Shinoda, T. (1999). In vitro processing of amyloid precursor protein by cathepsin D. Int J
Biochem Cell Biol 31, 1327-1337.
Saftig, P., Hetman, M., Schmahl, W., Weber, K., Heine, L., Mossmann, H., Koster, A., Hess,
B., Evers, M., von Figura, K., and et al. (1995). Mice deficient for the lysosomal proteinase
cathepsin D exhibit progressive atrophy of the intestinal mucosa and profound destruction of
lymphoid cells. Embo J 14, 3599-3608.
Saltiel, A. R., and Kahn, C. R. (2001). Insulin signalling and the regulation of glucose and
lipid metabolism. Nature 414, 799-806.
Sato, T., Sakai, T., Noguchi, Y., Takita, M., Hirakawa, S., and Ito, A. (2004). Tumor-stromal
cell contact promotes invasion of human uterine cervical carcinoma cells by augmenting the
expression and activation of stromal matrix metalloproteinases. Gynecol Oncol 92, 47-56.
Schaefer, E. J., Woo, R., Kibata, M., Bjornsen, L., and Schreibman, P. H. (1983).
Mobilization of triglyceride but not cholesterol or tocopherol from human adipocytes during
weight reduction. Am J Clin Nutr 37, 749-754.
Scherer, P. E., Williams, S., Fogliano, M., Baldini, G., and Lodish, H. F. (1995). A novel
serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270, 2674626749.
Sevlever, D., Jiang, P., and Yen, S. H. (2008). Cathepsin D is the main lysosomal enzyme
involved in the degradation of alpha-synuclein and generation of its carboxy-terminally
truncated species. Biochemistry 47, 9678-9687.
Sheikh, A. M., Li, X., Wen, G., Tauqeer, Z., Brown, W. T., and Malik, M. (2009). Cathepsin
D and apoptosis related proteins are elevated in the brain of autistic subjects. Neuroscience.
Shrago, E., Glennon, J. A., and Gordon, E. S. (1971). Comparative aspects of lipogenesis in
mammalian tissues. Metabolism 20, 54-62.
Shrago, E., Spennetta, T., and Gordon, E. (1969). Fatty acid synthesis in human adipose
tissue. J Biol Chem 244, 2761-2766.
Sieuwerts, A. M., Klijn, J. G., Henzen-Logmand, S. C., Bouwman, I., Van Roozendaal, K. E.,
Peters, H. A., Setyono-Han, B., and Foekens, J. A. (1998). Urokinase-type-plasminogenactivator (uPA) production by human breast (myo) fibroblasts in vitro: influence of
92
transforming growth factor-beta(1) (TGF beta(1)) compared with factor(s) released by human
epithelial-carcinoma cells. Int J Cancer 76, 829-835.
Siintola, E., Partanen, S., Stromme, P., Haapanen, A., Haltia, M., Maehlen, J., Lehesjoki, A.
E., and Tyynela, J. (2006). Cathepsin D deficiency underlies congenital human neuronal
ceroid-lipofuscinosis. Brain 129, 1438-1445.
Sjostrom, L. (1972). Adult human adipose tissue cellularity and metabolism with special
reference to obesity and fatty acid synthesis de novo. Acta Med Scand Suppl 544, 1-52.
Smas, C. M., and Sul, H. S. (1995). Control of adipocyte differentiation. Biochem J 309 ( Pt
3), 697-710.
Somasundar, P., Yu, A. K., Vona-Davis, L., and McFadden, D. W. (2003). Differential effects
of leptin on cancer in vitro. J Surg Res 113, 50-55.
Song, H., Li, Y., Lee, J., Schwartz, A. L., and Bu, G. (2009). Low-density lipoprotein
receptor-related protein 1 promotes cancer cell migration and invasion by inducing the
expression of matrix metalloproteinases 2 and 9. Cancer Res 69, 879-886.
Spiegelman, B. M., and Farmer, S. R. (1982). Decreases in tubulin and actin gene expression
prior to morphological differentiation of 3T3 adipocytes. Cell 29, 53-60.
Spiegelman, B. M., and Ginty, C. A. (1983). Fibronectin modulation of cell shape and
lipogenic gene expression in 3T3-adipocytes. Cell 35, 657-666.
Stein, M., Zijderhand-Bleekemolen, J. E., Geuze, H., Hasilik, A., and von Figura, K. (1987).
Mr 46,000 mannose 6-phosphate specific receptor: its role in targeting of lysosomal enzymes.
Embo J 6, 2677-2681.
Steinfeld, R., Reinhardt, K., Schreiber, K., Hillebrand, M., Kraetzner, R., Bruck, W., Saftig,
P., and Gartner, J. (2006). Cathepsin D deficiency is associated with a human
neurodegenerative disorder. Am J Hum Genet 78, 988-998.
Strickland, D. K., Ashcom, J. D., Williams, S., Burgess, W. H., Migliorini, M., and Argraves,
W. S. (1990). Sequence identity between the alpha 2-macroglobulin receptor and low density
lipoprotein receptor-related protein suggests that this molecule is a multifunctional receptor. J
Biol Chem 265, 17401-17404.
Strickland, D. K., and Ranganathan, S. (2003). Diverse role of LDL receptor-related protein
in the clearance of proteases and in signaling. J Thromb Haemost 1, 1663-1670.
Takata, H., Tomizawa, K., Matsushita, M., and Matsui, H. (2004). 2-methoxyestradiol
enhances p53 protein transduction therapy-associated inhibition of the proliferation of oral
cancer cells through the suppression of NFkappaB activity. Acta Med Okayama 58, 181-187.
93
Taleb, S., Cancello, R., Clement, K., and Lacasa, D. (2006). Cathepsin s promotes human
preadipocyte differentiation: possible involvement of fibronectin degradation. Endocrinology
147, 4950-4959.
Tang, Q. Q., Otto, T. C., and Lane, M. D. (2003). Mitotic clonal expansion: a synchronous
process required for adipogenesis. Proc Natl Acad Sci U S A 100, 44-49.
Terrand, J., Bruban, V., Zhou, L., Gong, W., El Asmar, Z., May, P., Zurhove, K., Haffner, P.,
Philippe, C., Woldt, E., et al. (2009). LRP1 controls intracellular cholesterol storage and fatty
acid synthesis through modulation of Wnt signaling. J Biol Chem 284, 381-388.
Tlsty, T. D. (2001). Stromal cells can contribute oncogenic signals. Semin Cancer Biol 11,
97-104.
Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994). Stimulation of adipogenesis in
fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79, 1147-1156.
Tontonoz, P., Hu, E., and Spiegelman, B. M. (1995). Regulation of adipocyte gene expression
and differentiation by peroxisome proliferator activated receptor gamma. Curr Opin Genet
Dev 5, 571-576.
Tsai, Y. S., and Maeda, N. (2005). PPARgamma: a critical determinant of body fat
distribution in humans and mice. Trends Cardiovasc Med 15, 81-85.
Tyynela, J., Sohar, I., Sleat, D. E., Gin, R. M., Donnelly, R. J., Baumann, M., Haltia, M., and
Lobel, P. (2000). A mutation in the ovine cathepsin D gene causes a congenital lysosomal
storage disease with profound neurodegeneration. Embo J 19, 2786-2792.
Umezawa, H., Aoyagi, T., Morishima, H., Matsuzaki, M., and Hamada, M. (1970). Pepstatin,
a new pepsin inhibitor produced by Actinomycetes. J Antibiot (Tokyo) 23, 259-262.
van der Geer, P. (2002). Phosphorylation of LRP1: regulation of transport and signal
transduction. Trends Cardiovasc Med 12, 160-165.
van Kruijsdijk, R. C., van der Wall, E., and Visseren, F. L. (2009). Obesity and cancer: the
role of dysfunctional adipose tissue. Cancer Epidemiol Biomarkers Prev 18, 2569-2578.
Vashishta, A., Ohri, S. S., Proctor, M., Fusek, M., and Vetvicka, V. (2007). Ribozymetargeting procathepsin D and its effect on invasion and growth of breast cancer cells: an
implication in breast cancer therapy. Int J Oncol 30, 1223-1230.
Vazquez-Vela, M. E., Torres, N., and Tovar, A. R. (2008). White adipose tissue as endocrine
organ and its role in obesity. Arch Med Res 39, 715-728.
Vetvicka, V., Vektvickova, J., and Fusek, M. (1994). Effect of human procathepsin D on
proliferation of human cell lines. Cancer Lett 79, 131-135.
94
Vetvicka, V., Vetvickova, J., and Fusek, M. (1998). Effect of procathepsin D and its
activation peptide on prostate cancer cells. Cancer Lett 129, 55-59.
Vetvicka, V., Vetvickova, J., and Fusek, M. (1999). Anti-human procathepsin D activation
peptide antibodies inhibit breast cancer development. Breast Cancer Res Treat 57, 261-269.
Vignon, F., Capony, F., Chambon, M., Freiss, G., Garcia, M., and Rochefort, H. (1986).
Autocrine growth stimulation of the MCF 7 breast cancer cells by the estrogen-regulated 52 K
protein. Endocrinology 118, 1537-1545.
Vignon, F., and Rochefort, H. (1992). Interactions of pro-cathepsin D and IGF-II on the
mannose-6-phosphate/IGF-II receptor. Breast Cancer Res Treat 22, 47-57.
von Arnim, C. A., Kinoshita, A., Peltan, I. D., Tangredi, M. M., Herl, L., Lee, B. M.,
Spoelgen, R., Hshieh, T. T., Ranganathan, S., Battey, F. D., et al. (2005). The low density
lipoprotein receptor-related protein (LRP) is a novel beta-secretase (BACE1) substrate. J Biol
Chem 280, 17777-17785.
Vona-Davis, L., and Rose, D. P. (2007). Adipokines as endocrine, paracrine, and autocrine
factors in breast cancer risk and progression. Endocr Relat Cancer 14, 189-206.
Willnow, T. E., Armstrong, S. A., Hammer, R. E., and Herz, J. (1995). Functional expression
of low density lipoprotein receptor-related protein is controlled by receptor-associated protein
in vivo. Proc Natl Acad Sci U S A 92, 4537-4541.
Willnow, T. E., Orth, K., and Herz, J. (1994). Molecular dissection of ligand binding sites on
the low density lipoprotein receptor-related protein. J Biol Chem 269, 15827-15832.
Wiseman, B. S., and Werb, Z. (2002). Stromal effects on mammary gland development and
breast cancer. Science 296, 1046-1049.
Wittlin, S., Rosel, J., Hofmann, F., and Stover, D. R. (1999). Mechanisms and kinetics of
procathepsin D activation. Eur J Biochem 265, 384-393.
Wozniak, S. E., Gee, L. L., Wachtel, M. S., and Frezza, E. E. (2009). Adipose tissue: the new
endocrine organ? A review article. Dig Dis Sci 54, 1847-1856.
Wu, L., and Gonias, S. L. (2005). The low-density lipoprotein receptor-related protein-1
associates transiently with lipid rafts. J Cell Biochem 96, 1021-1033.
Wu, Z., Rosen, E. D., Brun, R., Hauser, S., Adelmant, G., Troy, A. E., McKeon, C.,
Darlington, G. J., and Spiegelman, B. M. (1999). Cross-regulation of C/EBP alpha and PPAR
gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell
3, 151-158.
95
Xiao, Y., Junfeng, H., Tianhong, L., Lu, W., Shulin, C., Yu, Z., Xiaohua, L., Weixia, J.,
Sheng, Z., Yanyun, G., et al. (2006). Cathepsin K in adipocyte differentiation and its potential
role in the pathogenesis of obesity. J Clin Endocrinol Metab 91, 4520-4527.
Yang, M., Huang, H., Li, J., Li, D., and Wang, H. (2004). Tyrosine phosphorylation of the
LDL receptor-related protein (LRP) and activation of the ERK pathway are required for
connective tissue growth factor to potentiate myofibroblast differentiation. Faseb J 18, 19201921.
Yang, M., Sun, J., Zhang, T., Liu, J., Zhang, J., Shi, M. A., Darakhshan, F., Guerre-Millo, M.,
Clement, K., Gelb, B. D., et al. (2008). Deficiency and inhibition of cathepsin K reduce body
weight gain and increase glucose metabolism in mice. Arterioscler Thromb Vasc Biol 28,
2202-2208.
Yang, M., Zhang, Y., Pan, J., Sun, J., Liu, J., Libby, P., Sukhova, G. K., Doria, A., Katunuma,
N., Peroni, O. D., et al. (2007). Cathepsin L activity controls adipogenesis and glucose
tolerance. Nat Cell Biol 9, 970-977.
Yatagai, T., Nagasaka, S., Taniguchi, A., Fukushima, M., Nakamura, T., Kuroe, A., Nakai,
Y., and Ishibashi, S. (2003). Hypoadiponectinemia is associated with visceral fat
accumulation and insulin resistance in Japanese men with type 2 diabetes mellitus.
Metabolism 52, 1274-1278.
Zaidi, N., Burster, T., Sommandas, V., Herrmann, T., Boehm, B. O., Driessen, C., Voelter,
W., and Kalbacher, H. (2007). A novel cell penetrating aspartic protease inhibitor blocks
processing and presentation of tetanus toxoid more efficiently than pepstatin A. Biochem
Biophys Res Commun 364, 243-249.
Zaidi, N., Maurer, A., Nieke, S., and Kalbacher, H. (2008). Cathepsin D: a cellular roadmap.
Biochem Biophys Res Commun 376, 5-9.
Zhang, H., Lee, J. M., Wang, Y., Dong, L., Ko, K. W., Pelletier, L., and Yao, Z. (2008).
Mutational analysis of the FXNPXY motif within LDL receptor-related protein 1 (LRP1)
reveals the functional importance of the tyrosine residues in cell growth regulation and signal
transduction. Biochem J 409, 53-64.
Zhang, H., Links, P. H., Ngsee, J. K., Tran, K., Cui, Z., Ko, K. W., and Yao, Z. (2004a).
Localization of low density lipoprotein receptor-related protein 1 to caveolae in 3T3-L1
adipocytes in response to insulin treatment. J Biol Chem 279, 2221-2230.
Zhang, J., Fu, M., Cui, T., Xiong, C., Xu, K., Zhong, W., Xiao, Y., Floyd, D., Liang, J., Li,
E., et al. (2004b). Selective disruption of PPARgamma 2 impairs the development of adipose
tissue and insulin sensitivity. Proc Natl Acad Sci U S A 101, 10703-10708.
96
Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994).
Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.
Zhou, H., Xiao, Y., Li, R., Hong, S., Li, S., Wang, L., Zeng, R., and Liao, K. (2009a).
Quantitative analysis of secretome from adipocytes regulated by insulin. Acta Biochim
Biophys Sin (Shanghai) 41, 910-921.
Zhou, L., Takayama, Y., Boucher, P., Tallquist, M. D., and Herz, J. (2009b). LRP1 regulates
architecture of the vascular wall by controlling PDGFRbeta-dependent phosphatidylinositol 3kinase activation. PLoS One 4, e6922.
Zhou, W., Scott, S. A., Shelton, S. B., and Crutcher, K. A. (2006). Cathepsin D-mediated
proteolysis of apolipoprotein E: possible role in Alzheimer's disease. Neuroscience 143, 689701.
Zhu, Y., and Conner, G. E. (1994). Intermolecular association of lysosomal protein precursors
during biosynthesis. J Biol Chem 269, 3846-3851.
Zilberberg, A., Yaniv, A., and Gazit, A. (2004). The low density lipoprotein receptor-1,
LRP1, interacts with the human frizzled-1 (HFz1) and down-regulates the canonical Wnt
signaling pathway. J Biol Chem 279, 17535-17542.
Zurhove, K., Nakajima, C., Herz, J., Bock, H. H., and May, P. (2008). Gamma-secretase
limits the inflammatory response through the processing of LRP1. Sci Signal 1, ra15.
97
F. ANNEXE
98
Article 3:
Cathepsin D is a new ligand for extracellular domain of LRP1 β chain and promotes
LRP1-dependent fibroblast outgrowth
99
Cathepsin D is a new ligand for extracellular domain of LRP1 b chain and
promotes LRP1-dependent fibroblast outgrowth
Mélanie Beaujouin1, Christine Prébois1, Danielle Derocq1, Valérie Laurent-Matha1,
Olivier Masson1, Sophie Pattingre1, Peter Coopman2, Nadir Bettache2, Jami
Grossfield3, Robert E. Hollingsworth3, Hongyu Zhang4, Zemin Yao4, Bradley T
Hyman5, Peter van der Geer6, Gary K Smith7, and Emmanuelle Liaudet-Coopman1*.
1
IRCM, Institut de Recherche en Cancérologie de Montpellier, Montpellier, F-34298,
France; INSERM, U896, Montpellier, F-34298, France; Université Montpellier1,
Montpellier, F-34298, France; CRLC Val d’Aurelle Paul Lamarque, Montpellier, F34298, France. 2Centre de Recherche de Biochimie Macromoléculaire, CNRS UMR
5237, Université Montpellier 2, 34293 Montpellier Cedex 5, France.
3
Genetics
Research, GlaxoSmithKline, Inc. Five Moore Drive, Research Triangle Park, North
Carolina, 27709, USA. 4Department of Biochemistry, Microbiology and Immunology,
University of Ottawa, Ottawa K1Y4W7, Canada.
5
Alzheimer Disease Research
Laboratory, Massachusetts General Hospital, Harvard Medical School, Charlestown,
Massachusetts 02129, USA. 6Department of Chemistry and Biochemistry, San Diego
State University, 5500 Campanile Drive, MC 1030, San Diego, CA 92182-1030, USA.
7
Screening and Compound Profiling, GlaxoSmithKline, Inc. Five Moore Drive,
Research Triangle Park, North Carolina, 27709, USA.
*Corresponding author: E Liaudet-Coopman, Inserm U896, IRCM Val d'AurellePaul Lamarque, 34298 Montpellier Cedex 5, France ; Tel (33) 467 61 24 23 ; FAX
(33) 467 31 37 87 ; E-mail: [email protected]
Running title: cath-D promotes LRP1-dependent fibroblast outgrowth
Key words: cancer, fibroblast, cathepsin, LRP1, tumor micro-environment
1
ABSTRACT
The aspartic protease cathepsin-D (cath-D) is highly secreted by breast cancer cells
and triggers fibroblast outgrowth via a paracrine loop. Here, we demonstrate that the
LDL receptor-related protein-1, LRP1, is the cath-D fibroblastic receptor. Cath-D
binds to residues 349-394 of LRP1b and is therefore the first identified ligand of the
extra-cellular domain of the b chain of LRP1. Interaction occurs at the cell surface
and in vesicle-like structures. Cath-D is partially endocytosed by LRP1 in fibroblasts.
Our results revealed that the ability of secreted cath-D to promote fibroblast
outgrowth depends on LRP1 expression. These observations demonstrate that procath-D secreted by epithelial cancer cells promotes fibroblast outgrowth in a
paracrine LRP1-dependent manner in the breast tumour micro-environment.
2
INTRODUCTION
Lysosomal aspartic protease cathepsin-D (cath-D) is overexpressed and highly
secreted by human epithelial breast cancer cells (1-4). Its overexpression in breast
cancer is correlated with poor prognosis (5-7). Cath-D is synthesized as a 52-kDa,
catalytically-inactive precursor. It is present in endosomes as an active 48-kDa,
single-chain intermediate that is subsequently converted in the lysosomes into the
fully active mature protease, composed of a 34-kDa heavy chain, and a 14-kDa light
chain. The 52-kDa pro-cath-D hypersecreted by breast cancer cells into the
extracellular environment is endocytosed by both cancer cells and fibroblasts (1, 8,
9).
While cath-D endocytosis is mainly performed by the mannose-6-phosphate
receptors (M6PR), the existence of alternative cath-D receptors has been postulated
(10, 11). Cath-D affects both cancer cells and stromal cells in the tumor microenvironment by increasing cell proliferation, metastasis, angiogenesis and fibroblast
outgrowth (1, 12-16). We previously observed that a mutated catalytically-inactive
version of cath-D (D231N) remains mitogenic for tumor cells and fibroblasts (12, 14,
15), suggesting that cath-D acts as an extracellular messenger that interacts either
directly or indirectly with an as-yet unidentified cell surface receptor.
Here, we identify the fibroblast receptor that mediates the cath-D-induced
paracrine fibroblast outgrowth, LDL receptor-related protein-1 (LRP1). LRP1 is
composed of a 515-kDa extracellular a chain, and an 85-kDa b chain (17, 18). The
b chain contains an extracellular domain, a trans-membrane region, and a
cytoplasmic tail. The extracellular a chain contains binding-sites for many structurally
unrelated ligands, including lipoprotein particles, proteases and protease-inhibitor
complexes. At present, the ligands of the extracellular domain of the LRP1b chain are
3
still unknown. In this study, we report for the first time the interaction between cath-D
and the extracellular domain of the b chain of LRP1.
MATERIALS AND METHODS
Materials. Human mammary fibroblasts (HMFs), kindly provided by J. Piette (IGM,
Montpellier, France), were obtained from reduction mammoplasty tissues from a
patient without cancer.
cath-D-/-
MEF-cath-D,
cath-D-/-
MEF-D231Ncath-D and cath-D
transfected 3Y1-Ad12 cells were previously described (15).
MEFs were purchased from ATCC. B-41 cells,
LRP1-/-
LRP1-/-
MEF and
LRP1+/-
MEF cells stably transfected with
the full-length human LRP1, were kindly provided by D. Strickland (University
Maryland School of Medicine, Baltimore, USA). Cells were cultured in DMEM
medium with 10% fetal calf serum (FCS, GibcoBRL). The 11H4 hybridoma directed
against the C-terminal part of LRP1b chain was purchased at ATCC. Polyclonal antihuman LRP1b-chain antiserum was previously described (19). The anti-human cathD monoclonal antibody (BD Biosciences) used for immuno-blotting recognized 52-,
48- and 34-kDa forms of cath-D. The anti-human cath-D M1G8 monoclonal antibody
used for immuno-precipitation and purification recognized 52-, 48- and 34-kDa forms
of cath-D. The anti-human, cath-D monoclonal antibody M2E8, used for immunofluorescence, interacts only with 52-kDa pro-cath-D. Anti-b actin polyclonal antibody
was purchased from Sigma.
Plasmids.
pcDNA3.1(+)Myc-tagged
LRP1b chain,
pcDNA3.1(-)cath-D
and
pcDNA3.1(-)D231Ncath-D expression plasmids have previously been described (12).
The pcDNA3.1(+)LRP1b extracellular domain (1-476) expression plasmid was
created by inserting the PCR-amplified cDNA encoding LRP1b (1-476) from
4
pcDNA3.1(+)Myc-tagged LRP1b into pcDNA3.1(+) previously digested by NheI and
XbaI. pGEX-4T-1 LRP1b (307-479) was generated by inserting PCR-amplified cDNA
encoding LRP1b (307-479) from pYESTrp2-LRP1b (307-479) identified by a twoyeast hybrid assay into pGEX-4T-1 previously digested by EcoRI. pGEX-2TK -34, -14
and -4 kDa cath-D domains were obtained by inserting PCR-amplified cDNA
encoding cath-D fragments into pGEX-4T-1 previously digested by EcoRI. pSG5APP695 plasmid was kindly provided by B. De Strooper (Laboratory of Neuronal Cell
Biology, University of Leuven, Belgium).
Yeast two-hybrid assay. Human cath-D was fused with the LexA DNA-binding
domain in the pMW101 vector. A cDNA library derived from normal breast tissue was
cloned into the galactosidase-inducible pYESTrp2 vector (Invitrogen) containing a
B42 activating domain. The yeast two-hybrid screen was performed as described
previously (20).
siRNA transfections and outgrowth assays. 30,000 HMF cells were transiently
transfected with 10-µg human LRP1 or Luc siRNAs using Oligofectamine
(Invitrogen).
50,000
cath-D-/-
MEF-cath-D
or
cath-D-/-
MEF-D231Ncath-D
cells
were
transiently transfected with 2.5 µg mouse LRP1 or Luc siRNAs. For outgrowth
assays, 50,000
cath-D-/-
MEF-cath-D ,
cath-D-/-
MEF-D231Ncath-D and HMF cells cells were
re-suspended at 4°C in Matrigel (BD Biosciences) 24 or 48 h post-transfection with
LRP or Luc siRNAs, and added to a pre-set layer of Matrigel (12). In co-culture
outgrowth assays, 100,000 cells from mock- or cath-D-transfected 3Y1-Ad12 cell
lines were plated and then covered with a layer of Matrigel, and then with a layer of
Matrigel containing 50,000 HMFs 48h post-transfection with LRP or Luc siRNAs (15).
5
siRNAs. Duplexes of 21-nucleotide human LRP1 siRNA1 (target sequence
AAGCAGTTTGCCTGCAGAGAT, residues 666-684) (21), human LRP1 siRNA2
(target sequence AAGCTATGAGTTTAAGAAGTT) (Dharmacon), mouse LRP1
siRNA3 (target sequence AAGCAUCUCAGUAGACUAUCA) (22), mouse LRP1
siRNA4 (target sequence AAGCAGTTTGCCTGCAGAGAC) or firefly luciferase (Luc)
siRNA (target sequence AACGTACGCGGAATACTTCGA) were synthesized by
MWG Biotech S.A. (France) or Dharmacon.
GST pull-down assays
[35S]methionine-labeled pro-cath-D, LRP1β (1-476) or APP695 were obtained by
transcription and translation using the TNTT7-coupled reticulocyte lysate system
(Promega). GST, GST-LRP1b (307–479), GST-LRP1b shorter fragments, GST-cathD-52K, -34K, -14K and -4K fusion proteins were produced in Escherichia coli B strain
BL21 using isopropyl-1-thio-b-D-galactopyranoside (1 mM) for 3 h at 37°C. GST
fusion
proteins
were
purified
on
glutathione-Sepharose
beads
(Amersham
Biosciences). For pull-down assays, 20-µl bed volume of glutathione-Sepharose
beads with immobilized GST fusion proteins were incubated overnight at 4°C with
either [35S]methionine-labeled proteins in 500 µl PDB buffer (20 mM HEPES-KOH
[pH 7.9], 10% glycerol, 100 mM KCl, 5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 0.2 mM
phenylmethylsulfonyl fluoride) containing 15 mg/ml BSA and 0.1% Tween 20. The
beads were washed with 500 µl PDB buffer, and bound proteins were resolved by
15% SDS-PAGE, stained with Coomassie blue, and exposed to autoradiographic
film. The refolding of GST proteins was performed using a multi-step dialysis protocol
6
(Protein refolding kit, Novagen) followed by disulfide bond formation using a redox
system (cystein/cystin).
Co-transfection, co-immunoprecipitation and co-purification. COS cells were
transfected with 10 µg of pcDNA3-Myc-LRP1b and 10 µg of pcDNA3.1, pcDNA3.1cath-D, or pcDNA3.1-D231Ncath-D vectors. Transient transfections were carried out
using Lipofectamine and Opti-MEM (Gibco-BRL). Two days post-transfection, cells
were lysed in 50 mM Hepes [pH 7.5], 150 mM NaCl, 10% glycerol, 1% Triton X-100,
1.5 mM MgCl2 1 mM EGTA, 100 mM NaF, 10 mM sodium pyrophosphate, 500 µM
sodium vanadate, 1 mM phenylmethylsulfonyl fluoride and a protease inhibitor
cocktail (PLC lysis buffer). Lysates were incubated with 3 µg of anti-cath-D M1G8, or
anti-IgG monoclonal antibodies, or 40 µl
of the anti-LRP1b 11H4 hybridoma
overnight at 4°C, and subsequently with 25 µl of 10% protein A- or G-Sepharose, for
2 h at 4°C on a shaker. Sepharose beads were washed 4 times with PLC buffer,
boiled for 3 min in SDS sample buffer, and resolved by SDS-PAGE and
immunoblotting. For cath-D purification, cells lysed in PLC buffer were passed over
an anti-cath-D M1G8-coupled agarose column. The column was washed with 20 ml
of phosphate buffer (0.5 M NaPO4, 150 mM NaCl, 0.01% Tween 80, 5 mM bglycerophosphate) containing protease inhibitors, and then eluted in different
fractions with 20 mM lysine, pH 11.
Immunoblotting. Cell extracts (100 µg) or conditioned media (80 µl) were submitted
to SDS-PAGE and anti-LRP1b, anti-cath-D or anti-b-actin immuno-blotting.
7
Cath-D endocytosis. Human cath-D transfected 3Y1-Ad12 cells (12) were labeled
with 175 µCi/ml [35S]Translabel (MP Biomedicals, Inc.) for 24 h in serum-,
methionine- and cysteine-free DMEM medium, and the labeled conditioned culture
medium containing secreted labeled-pro-cath-D was used for internalization. In
parallel, 100,000 HMF cells were transiently transfected with 10 µg human LRP1 or
Luc siRNAs using Oligofectamine (Invitrogen). Two days post-transfection, the
expression of human LRP1 (100 µg cellular protein) was monitored by
immunoblotting using the 11H4 hybridoma. For endocytosis experiments, siRNAtransfected HMFs were incubated for 18h in DMEM medium supplemented with the
conditioned medium prepared from 3Y1-Ad12-cath-D cells corresponding to 3 x
106 cpm of total TCA-precipitable proteins, 10% FCS, 10 mM of methionine and
5 mM of cysteine in the absence or presence of 10 mM mannose-6-phosphate
(M6P). Cell extracts were prepared in PLC buffer. Similar amounts of total protein
were obtained in LRP1- and Luc siRNA-transfected HMFs, indicating that cell viability
was not affected by LRP1 silencing. [35S]cath-D endocytosed into cells was
immunoprecipitated with M1G8 anti-cath-D antibody, and analyzed by 15% SDSPAGE and autoradiography (23).
LRP1-/-
MEF-LRP1 cells (clone B-41) and
LRP1-/-
MEF
cells were tested for cath-D endocytosis, as described above for HMF fibroblasts in
the presence of 10 mM M6P.
Immunogold. Cells were fixed with 3% paraformaldehyde and 0.1% glutaraldehyde
in a phosphate buffer (pH 7.2) overnight at 4°C, and then cryoprotected. Ultra-thin
sections (85 nm) were incubated in PBS with 0.1 % cold water fish gelatin, 1% BSA,
and 0.05% Tween 20, and then with rabbit anti-LRP1b (1/20) and mouse anti-cath-D
M2E8 (4 µg/ml), and subsequently with 15-nm goat anti-rabbit-gold and 6-nm goat
8
anti-mouse-gold (Aurion). Sections were observed using a Hitachi 7100 transmission
electron microscope.
RESULTS
Identification of LRP1 as the cath-D receptor in fibroblasts
Since cath-D hypersecreted by cancer cells is able to stimulate fibroblast outgrowth
in a paracrine manner (15), we postulate that cath-D acts via a cell surface receptor.
To identify potential cath-D receptors, we performed a yeast two-hybrid screen using
LexA DNA-binding domain fused to cath-D as bait (Fig. 1A, panel a), and a cDNA
library isolated from normal breast. The clone isolated in our screen was 100%
identical to amino acids 307-479 of the extracellular domain of LRP1 b chain (Fig. 1A,
panel b).
To validate the cath-D/LRP1 interaction, we performed GST pull-down experiments
by using GST-fusion proteins containing the 52-, 34-, 14- or 4-kDa cath-D fragments
(Fig. 1B, panels a and c). The full-length extracellular LRP1b domain, LRP1b (1-476),
was shown to bind to 52-, 34- and 14-kDa cath-D fragments (Fig. 1B, panels b and
d). However, LRP1b (1-476) was shown to bind poorly to GST-RAP, a ligand of the
LRP1a chain (Fig. 1B, panel f). Subsequently, a polypeptide containing amino acids
307-479 of the extracellular domain of the LRP1b chain, GST-LRP1b (307-479), was
expressed as a GST fusion protein (Fig. 1C, panel a), and tested for its ability to bind
pro-cath-D. Our results show that pro-cath-D bound to GST-LRP1b (307-479) (Fig.
1C, panel b). In contrast, APP, a ligand of the LRP1a chain, did not bind to GSTLRP1b (307-479) (Fig. 1C, panel d). The LRP1b (307-479) domain contains four
juxtaposed complete EGF-like repeats (19-22) (Fig. 2A, panel a). In order to identify
the LRP1 cath-D-binding domain, GST-fusion proteins containing various fragments
9
of LRP1b (307-479) were tested for their ability to bind to pro-cath-D (Fig. 2A, panel
b). We identified the fragment of LRP1b (349-394) that contains the EGF-like repeat
20, as the shortest fragment able to bind cath-D (Fig. 2B, panels b and d). Because
of the lack of disulfide linkage in E. coli, we verified that binding of pro-cath-D was
comparable after GST-LRP1b refolding (Fig. 2B, panel f). Our results provide
independent confirmation of the yeast two-hybrid screen, and reveal direct interaction
between cath-D and residues 349-394 of the extracellular domain of the LRP1
b chain.
To find out whether cath-D interacts with LRP1b chain in cellulo, LRP1b was
expressed in COS cells in presence of wild-type cath-D or of a cath-D mutant devoid
of proteolytic activity (D231Ncath-D). Our results show that both wild-type and D231N
pro-cath-D precursor co-immunoprecipitated with the b chain of LRP1 either by
performing the immunoprecipitation using anti-LRP1b antibody (Fig. 3A, panel a) or
anti-cath-D antibody (Fig. 3A, panel b).
D231N
cath-D displayed greater electrophoretic
mobility, corresponding to an apparent molecular mass shift of ~1 kDa (Fig. 3A, panel
a), as previously reported (24). We, therefore, conclude that co-transfected cath-D
and LRP1b interact in cells.
To study endogenous interaction, we screened a variety of cell lines for LRP1
expression (Fig. 3B). It is known that cath-D is overexpressed and hypersecreted by
breast cancer cells (2) but our survey revealed that breast cancer cells (MCF-7 and
MDA-MB-231) express low levels of LRP1 (Fig. 3B). By contrast, LRP1 was highly
expressed in all the fibroblastic cell lines tested (LRP1-/+MEF,
cath-D-/-
MEF-cath-D and
CCL146 mouse fibroblasts, HMF human mammary fibroblasts and CCD45K skin
fibroblasts) (Fig. 3B), as observed in cancer biopsies (25, 26) whereas fibroblasts do
10
not secrete detectable levels of pro-cath-D (data not shown) as previously reported
(15).
Since the cells that express high LRP1 levels and those that secrete pro-cath-D
were distinct, we studied the interaction of cath-D with endogenous LRP1 using
cath-D-
/-
MEF cells stably transfected with human wild-type or mutated D231N cath-D that
had previously been shown to secrete pro-cath-D (15). Cath-D immuno-affinity
purification revealed that LRP1b was co-eluted with both wild-type (Fig. 3C panel a)
and D231N cath-D (Fig. Sup1). Our results show that endogenous LRP1 interacts
with transfected cath-D. We next studied the paracrine interaction of endogenous
LRP1 with cath-D. Interestingly, LRP1 was co-purified with cath-D in human
mammary fibroblasts (HMFs) incubated with 15 nM cath-D (Fig. 3C, panel b). We
conclude that cath-D interacts with intact LRP1 in fibroblasts.
To investigate LRP1/cath-D subcellular co-localization, HMF cells incubated
with 15 nM of pro-cath-D were analyzed by immunogold electron microscopy after
double staining with a monoclonal antibody anti-pro-cath-D and a polyclonal antibody
directed against the cytoplasmic tail of LRP1b (Fig. 4A, panels a-c). It has been
reported that LRP1 is localized both at the cell surface and in early endosomes (27).
Our data revealed that, in HMF fibroblasts, pro-cath-D and LRP1 b co-localized at the
cell surface (Fig. 4A, panel a) and in vesicle-like structures proximal to the plasma
membrane (Fig. 4A, panels b and c). These findings indicate that, in intact cells, procath-D and LRP1b co-localized at the cell surface and in vesicle-like structures.
Given that we observed the co-localization of cath-D and LRP1 in vesicle-like
structures proximal to the plasma membrane (Fig. 4A), and as LRP1 is an endocytic
receptor, we hypothesized that pro-cath-D internalization may alternatively be
mediated through its interaction with LRP1 (Fig. 4B). The endocytosis of secreted
11
pro-cath-D was analyzed in HMF fibroblasts in which endogenous LRP1 expression
had or had not been silenced. As previously observed (23), labeled 52-kDa proenzyme was transformed into a 48-kDa intermediate, and a 34-kDa mature enzyme
after binding and internalization into cells (Fig. 4B, panel a). Moreover, as expected,
mannose-6-phosphate, that neutralizes the cath-D primary receptor (e.g. M6P
receptors) (23), strongly reduced pro-cath-D internalization (Fig. 4B, panel a,
compare lanes 1 and 3). Interestingly, in the presence of M6P, siRNA-mediated
inhibition of LRP1 expression (Fig. 4B, panel b) led to a significant reduction in the
uptake of pro-cath-D independent of the M6P receptors (Fig. 4B, panel a, compare
lanes 3 and 4; panel c for quantification). These findings strongly suggest that LRP1
is a cath-D alternative endocytosis receptor. To support these results, additional
experiments were performed using
LRP1-/-
MEF fibroblasts transfected or not with full-
length LRP1. LRP1-dependent cath-D endocytosis was also observed in
LRP1-/-
fibroblasts transfected with LRP1 (MEF-B41) (Fig. 4C, panels a-b). Altogether, these
findings indicate that pro-cath-D is partially endocytosed by LRP1 in fibroblasts. We,
therefore, propose that LRP1 is an internalization pathway of pro-cath-D alternative
to the M6P receptors.
LRP1 is the receptor that mediates the cath-D-induced stimulation of fibroblast
outgrowth
We previously observed that pro-cath-D secreted by cancer cells mediates fibroblast
outgrowth in a paracrine manner (15). As we identified LRP1 as the novel receptor
for cath-D on fibroblasts, we further checked whether paracrine cath-D would induce
fibroblast outgrowth via its interaction with LRP1. To find out whether cath-D requires
LRP1 expression to trigger fibroblast outgrowth, we performed 3D culture assays
12
using
cath-D-/-
MEF transfected with human cath-D (cath-D-/-MEF-cath-D),
cath-D-/-
MEF
transfected with proteolytically-inactive cath-D (cath-D-/-MEF-D231Ncath-D), and HMF
cells, which express LRP1 (Fig. 5 and Fig. 6).
Our findings demonstrate that LRP1 silencing in
cath-D-/-
MEF-cath-D cells using
siRNA3 (Fig. 5A, panel e) and siRNA4 (Fig. Sup. 2, panel e) reduced their cath-Ddependent outgrowth (Fig. 5A, panels a and c; Fig. Sup. 2, panels a and c),
compared to cells transfected with Luc siRNA (Fig. 5A, panels b and d; Fig. Sup. 2,
panels b and d). Similar results were observed when LRP1 expression was inhibited
in
cath-D-/-
MEF-D231Ncath-D cells, indicating a mechanism independent of cath-D
proteolytic activity (Fig. 5B). These findings indicate that cath-D does indeed require
LRP1 expression to promote fibroblast invasive outgrowth.
To gain further insight into whether LRP1 mediates the paracrine action of
secreted pro-cath-D on fibroblast outgrowth, we performed 3D co-culture assays of
Luc- and LRP1-silenced HMF fibroblasts (Fig. 6, panel e) and control- or cath-Dsecreting 3Y1-Ad12 cancer cell lines (Fig. 6, panel f). The co-culture assay revealed
that only pro-cath-D-secreting 3Y1-Ad12 cells stimulated the outgrowth of HMF
fibroblasts (Fig. 6, panel b), in contrast to 3Y1-Ad12 control cells (Fig. 6, panel a).
Our results further showed that silencing LRP1 expression in HMF fibroblasts using
siRNA1 (Fig. 6, panel e) blocked their mitogenic response to secreted pro-cath-D
(Fig. 6, panel d). Similar results were obtained with LRP1 siRNA2 (Fig. Sup. 3). In
control experiments, we verified that the viability of HMF cells remained unaffected by
LRP1-silencing (data not shown). These experiments demonstrate that the paracrine
stimulation of cath-D-induced fibroblast outgrowth requires LRP1 expression.
DISCUSSION
13
In this report, we identified LRP1 as the cath-D fibroblastic receptor. At present,
no ligand of the extracellular domain of the LRP1b chain has been discovered. Our
results demonstrate that in fibroblasts the pro-cath-D protease interacts with the
extracellular domain of the b chain of LRP1 and establishe cath-D as the first
discovered ligand of the extracellular LRP1 b chain. We identified the LRP1b (349394) fragment, that contains the EGF-like repeat 20, as the shortest fragment able to
bind cath-D. A previous work excluded LRP1 as a cath-D receptor in cancer cells
(28). These observations were, however, based on the use of the RAP chaperone
protein (29) that competes with ligands that bind to the LRP1a chain. Consequently,
our findings showing that cath-D binds to the LRP1b chain, explains why RAP did not
compete with cath-D for binding to LRP1.
LRP1 was originally identified as an endocytosis receptor that shuttles between
the cell surface and early endosomes (27). Here, we showed that cath-D interacts
with LRP1 at the cell surface, as well as in vesicle-like structures resembling
endosomes. Our results also indicate that pro-cath-D is partially endocytosed by
LRP1 in fibroblasts and show that LRP1 is a novel cath-D endocytic receptor
alternative to the M6P receptor. Since pro-cath-D is secreted by cancer cells in the
nanomolar range, LRP1-dependent endocytosis should result in the internalization of
significant levels of pro-cath-D by fibroblasts.
We previously observed that pro-cath-D secreted by cancer cells mediates
fibroblast outgrowth in a paracrine manner (15). In this study, we reported that LRP1
is the fibroblast receptor responsive for the cath-D-induced outgrowth stimulation. A
screen for cell types that express LRP1 and secrete cath-D revealed that fibroblasts
express high LRP1 levels whereas breast cancer cells secrete pro-cath-D. Outgrowth
assays using cath-D-transfected MEFs, silenced or not silenced for LRP1, and 3D
14
co-culture outgrowth assays with cancer cells, secreting or not cath-D, and HMFs,
silenced or not silenced for LRP1, demonstrated that cath-D requires LRP1
expression to promote fibroblast invasive outgrowth. These findings support a model
in which pro-cath-D hypersecreted by cancer cells stimulates the outgrowth of
surrounding fibroblasts in a paracrine and LRP1-dependent manner. Other studies
have reported the stimulatory role of LRP1 in cancer cell proliferation, motility and
invasion (21, 30, 31). LRP1 may also be involved in the onset and progression of
various human malignancies. Indeed, LRP1 is expressed by fibroblasts in breast
cancer biopsies and at the invasive front in colon cancer biopsies (25, 26). In
addition, the C766T LRP1 gene polymorphism is associated with an increased risk of
breast cancer development (32). Although breast cancer cells express LRP1 at a
much lower level than fibroblasts, several studies reported that hypoxia upregulates
LRP1 expression in breast cancer cells (33-35). Therefore, it is possible that cathDenhanced breast cancer cell proliferation and/or migration may be also dependent on
LRP1 expression.
The mechanism by which LRP1 controls the cath-D-dependent stimulation of
fibroblast outgrowth implies an action of cath-D independent of its catalytic activity.
The serine protease tPA has also been shown to act as a cytokine via LRP1 (36).
LRP1 is known to modulate signal transduction via cytoplasmic LRP1b tyrosine
phosphorylation (36-40), and gene transcription by RIP (41-44). Future studies will
investigate the mechanism by which cath-D promotes fibroblast outgrowth
independently of its proteolytic activity.
In conclusion, we report, for the first time, that cath-D interacts with the
extracellular domain of LRP1 b chain and that it promotes an LRP1-dependent
fibroblast outgrowth.
15
ACKNOWLEDGEMENTS
We would like to thank Nadia Kerdjadj for secretarial assistance, Jean-Yves
Cance for the photographs, and Chantal Cazevieille (Centre de Ressources en
Imagerie Cellulaire, Montpellier) for the immunogold microscopy. We would also
thank Stephan Jalaguier for helpful discussions regarding the GST pull-down
experiments. This work was supported by the ‘Institut National de la Santé et de la
Recherche Médicale’, University of Montpellier I, ‘ANR Jeunes Chercheuses, Jeunes
Chercheurs’ and the ‘Ligue Nationale contre le Cancer’, and the ‘Association pour la
Recherche sur le Cancer’, which provided a fellowship for Mélanie Beaujouin.
16
REFERENCES
1.
Vignon, F., Capony, F., Chambon, M., Freiss, G., Garcia, M., and Rochefort,
H. Autocrine growth stimulation of the MCF 7 breast cancer cells by the
estrogen-regulated 52 K protein. Endocrinology, 118: 1537-1545, 1986.
2.
Capony, F., Rougeot, C., Montcourrier, P., Cavailles, V., Salazar, G., and
Rochefort, H. Increased secretion, altered processing, and glycosylation of
pro-cathepsin D in human mammary cancer cells. Cancer Res, 49: 39043909, 1989.
3.
Rochefort, H. and Liaudet-Coopman, E. Cathepsin D in cancer metastasis: a
protease and a ligand. Apmis, 107: 86-95, 1999.
4.
Liaudet-Coopman, E., Beaujouin, M., Derocq, D., Garcia, M., Glondu-Lassis,
M., Laurent-Matha, V., Prebois, C., Rochefort, H., and Vignon, F. Cathepsin D:
newly discovered functions of a long-standing aspartic protease in cancer and
apoptosis. Cancer Lett, 237: 167-179, 2006.
5.
Ferrandina, G., Scambia, G., Bardelli, F., Benedetti Panici, P., Mancuso, S.,
and Messori, A. Relationship between cathepsin-D content and disease-free
survival in node-negative breast cancer patients: a meta-analysis. Br J
Cancer, 76: 661-666, 1997.
6.
Foekens, J. A., Dall, P., Klijn, J. G., Skroch-Angel, P., Claassen, C. J., Look,
M. P., Ponta, H., Van Putten, W. L., Herrlich, P., and Henzen-Logmans, S. C.
Prognostic value of CD44 variant expression in primary breast cancer. Int J
Cancer, 84: 209-215, 1999.
7.
Rodriguez, J., Vazquez, J., Corte, M. D., Lamelas, M., Bongera, M., Corte, M.
G., Alvarez, A., Allende, M., Gonzalez, L., Sanchez, M., Vijande, M., Garcia
17
Muniz, J., and Vizoso, F. Clinical significance of cathepsin D concentration in
tumor cytosol of primary breast cancer. Int J Biol Markers, 20: 103-111, 2005.
8.
Laurent-Matha, V., Farnoud, M. R., Lucas, A., Rougeot, C., Garcia, M., and
Rochefort, H. Endocytosis of pro-cathepsin D into breast cancer cells is mostly
independent of mannose-6-phosphate receptors. J Cell Sci, 111 ( Pt 17):
2539-2549, 1998.
9.
Heylen, N., Vincent, L. M., Devos, V., Dubois, V., Remacle, C., and Trouet, A.
Fibroblasts capture cathepsin D secreted by breast cancer cells: possible role
in the regulation of the invasive process. Int J Oncol, 20: 761-767, 2002.
10.
Rijnboutt, S., Kal, A. J., Geuze, H. J., Aerts, H., and Strous, G. J. Mannose 6phosphate-independent targeting of cathepsin D to lysosomes in HepG2 cells.
J Biol Chem, 266: 23586-23592, 1991.
11.
Capony, F., Braulke, T., Rougeot, C., Roux, S., Montcourrier, P., and
Rochefort, H. Specific mannose-6-phosphate receptor-independent sorting of
pro-cathepsin D in breast cancer cells. Exp Cell Res, 215: 154-163, 1994.
12.
Glondu, M., Coopman, P., Laurent-Matha, V., Garcia, M., Rochefort, H., and
Liaudet-Coopman, E. A mutated cathepsin-D devoid of its catalytic activity
stimulates the growth of cancer cells. Oncogene, 20: 6920-6929, 2001.
13.
Glondu, M., Liaudet-Coopman, E., Derocq, D., Platet, N., Rochefort, H., and
Garcia, M. Down-regulation of cathepsin-D expression by antisense gene
transfer inhibits tumor growth and experimental lung metastasis of human
breast cancer cells. Oncogene, 21: 5127-5134, 2002.
14.
Berchem, G., Glondu, M., Gleizes, M., Brouillet, J. P., Vignon, F., Garcia, M.,
and Liaudet-Coopman, E. Cathepsin-D affects multiple tumor progression
18
steps in vivo: proliferation, angiogenesis and apoptosis. Oncogene, 21: 59515955, 2002.
15.
Laurent-Matha, V., Maruani-Herrmann, S., Prebois, C., Beaujouin, M., Glondu,
M., Noel, A., Alvarez-Gonzalez, M. L., Blacher, S., Coopman, P., Baghdiguian,
S., Gilles, C., Loncarek, J., Freiss, G., Vignon, F., and Liaudet-Coopman, E.
Catalytically inactive human cathepsin D triggers fibroblast invasive growth. J
Cell Biol, 168: 489-499, 2005.
16.
Hu, L., Roth, J. M., Brooks, P., Luty, J., and Karpatkin, S. Thrombin upregulates cathepsin D which enhances angiogenesis, growth, and metastasis.
Cancer Res, 68: 4666-4673, 2008.
17.
Strickland, D. K. and Ranganathan, S. Diverse role of LDL receptor-related
protein in the clearance of proteases and in signaling. J Thromb Haemost, 1:
1663-1670, 2003.
18.
Lillis, A. P., Mikhailenko, I., and Strickland, D. K. Beyond endocytosis: LRP
function in cell migration, proliferation and vascular permeability. J Thromb
Haemost, 3: 1884-1893, 2005.
19.
Zhang, H., Links, P. H., Ngsee, J. K., Tran, K., Cui, Z., Ko, K. W., and Yao, Z.
Localization of low density lipoprotein receptor-related protein 1 to caveolae in
3T3-L1 adipocytes in response to insulin treatment. J Biol Chem, 279: 22212230, 2004.
20.
Slentz-Kesler, K., Moore, J. T., Lombard, M., Zhang, J., Hollingsworth, R., and
Weiner, M. P. Identification of the human Mnk2 gene (MKNK2) through protein
interaction with estrogen receptor beta. Genomics, 69: 63-71, 2000.
19
21.
Li, Y., Lu, W., and Bu, G. Essential role of the low density lipoprotein receptorrelated protein in vascular smooth muscle cell migration. FEBS Lett, 555: 346350, 2003.
22.
Fears, C. Y., Grammer, J. R., Stewart, J. E., Jr., Annis, D. S., Mosher, D. F.,
Bornstein, P., and Gladson, C. L. Low-density lipoprotein receptor-related
protein contributes to the antiangiogenic activity of thrombospondin-2 in a
murine glioma model. Cancer Res, 65: 9338-9346, 2005.
23.
Capony, F., Morisset, M., Barrett, A. J., Capony, J. P., Broquet, P., Vignon, F.,
Chambon, M., Louisot, P., and Rochefort, H. Phosphorylation, glycosylation,
and proteolytic activity of the 52-kD estrogen-induced protein secreted by
MCF7 cells. J Cell Biol, 104: 253-262, 1987.
24.
Laurent-Matha, V., Derocq, D., Prebois, C., Katunuma, N., and LiaudetCoopman, E. Processing of human cathepsin D is independent of its catalytic
function and auto-activation: involvement of cathepsins L and B. J Biochem,
139: 363-371, 2006.
25.
Christensen, L., Wiborg Simonsen, A. C., Heegaard, C. W., Moestrup, S. K.,
Andersen, J. A., and Andreasen, P. A. Immunohistochemical localization of
urokinase-type plasminogen activator, type-1 plasminogen-activator inhibitor,
urokinase receptor and alpha(2)-macroglobulin receptor in human breast
carcinomas. Int J Cancer, 66: 441-452, 1996.
26.
Obermeyer, K., Krueger, S., Peters, B., Falkenberg, B., Roessner, A., and
Rocken, C. The expression of low density lipoprotein receptor-related protein
in colorectal carcinoma. Oncol Rep, 17: 361-367, 2007.
27.
Herz, J. and Strickland, D. K. LRP: a multifunctional scavenger and signaling
receptor. J Clin Invest, 108: 779-784, 2001.
20
28.
Laurent-Matha, V., Lucas, A., Huttler, S., Sandhoff, K., Garcia, M., and
Rochefort, H. Procathepsin D interacts with prosaposin in cancer cells but its
internalization is not mediated by LDL receptor-related protein. Exp Cell Res,
277: 210-219, 2002.
29.
Herz, J. The switch on the RAPper's necklace. Mol Cell, 23: 451-455, 2006.
30.
Dedieu, S., Langlois, B., Devy, J., Sid, B., Henriet, P., Sartelet, H., Bellon, G.,
Emonard, H., and Martiny, L. LRP-1 silencing prevents malignant cell invasion
despite increased pericellular proteolytic activities. Mol Cell Biol, 28: 29802995, 2008.
31.
Song, H., Li, Y., Lee, J., Schwartz, A. L., and Bu, G. Low-density lipoprotein
receptor-related protein 1 promotes cancer cell migration and invasion by
inducing the expression of matrix metalloproteinases 2 and 9. Cancer Res, 69:
879-886, 2009.
32.
Benes, P., Jurajda, M., Zaloudik, J., Izakovicova-Holla, L., and Vacha, J.
C766T low-density lipoprotein receptor-related protein 1 (LRP1) gene
polymorphism and susceptibility to breast cancer. Breast Cancer Res, 5: R7781, 2003.
33.
Montel, V., Gaultier, A., Lester, R. D., Campana, W. M., and Gonias, S. L. The
low-density lipoprotein receptor-related protein regulates cancer cell survival
and metastasis development. Cancer Res, 67: 9817-9824, 2007.
34.
Koong, A. C., Denko, N. C., Hudson, K. M., Schindler, C., Swiersz, L., Koch,
C., Evans, S., Ibrahim, H., Le, Q. T., Terris, D. J., and Giaccia, A. J. Candidate
genes for the hypoxic tumor phenotype. Cancer Res, 60: 883-887, 2000.
21
35.
Bando, H., Toi, M., Kitada, K., and Koike, M. Genes commonly upregulated by
hypoxia in human breast cancer cells MCF-7 and MDA-MB-231. Biomed
Pharmacother, 57: 333-340, 2003.
36.
Hu, K., Yang, J., Tanaka, S., Gonias, S. L., Mars, W. M., and Liu, Y. Tissuetype plasminogen activator acts as a cytokine that triggers intracellular signal
transduction and induces matrix metalloproteinase-9 gene expression. J Biol
Chem, 281: 2120-2127, 2006.
37.
Boucher, P. and Gotthardt, M. LRP and PDGF signaling: a pathway to
atherosclerosis. Trends Cardiovasc Med, 14: 55-60, 2004.
38.
Boucher, P., Liu, P., Gotthardt, M., Hiesberger, T., Anderson, R. G., and Herz,
J. Platelet-derived growth factor mediates tyrosine phosphorylation of the
cytoplasmic domain of the low Density lipoprotein receptor-related protein in
caveolae. J Biol Chem, 277: 15507-15513, 2002.
39.
Yang, M., Huang, H., Li, J., Li, D., and Wang, H. Tyrosine phosphorylation of
the LDL receptor-related protein (LRP) and activation of the ERK pathway are
required for connective tissue growth factor to potentiate myofibroblast
differentiation. Faseb J, 18: 1920-1921, 2004.
40.
Barnes, H., Ackermann, E. J., and van der Geer, P. v-Src induces Shc binding
to tyrosine 63 in the cytoplasmic domain of the LDL receptor-related protein 1.
Oncogene, 22: 3589-3597, 2003.
41.
May, P., Reddy, Y. K., and Herz, J. Proteolytic processing of low density
lipoprotein receptor-related protein mediates regulated release of its
intracellular domain. J Biol Chem, 277: 18736-18743, 2002.
22
42.
Zurhove, K., Nakajima, C., Herz, J., Bock, H. H., and May, P. Gammasecretase limits the inflammatory response through the processing of LRP1.
Sci Signal, 1: ra15, 2008.
43.
von Arnim, C. A., Kinoshita, A., Peltan, I. D., Tangredi, M. M., Herl, L., Lee, B.
M., Spoelgen, R., Hshieh, T. T., Ranganathan, S., Battey, F. D., Liu, C. X.,
Bacskai, B. J., Sever, S., Irizarry, M. C., Strickland, D. K., and Hyman, B. T.
The low density lipoprotein receptor-related protein (LRP) is a novel betasecretase (BACE1) substrate. J Biol Chem, 280: 17777-17785, 2005.
44.
Kinoshita, A., Shah, T., Tangredi, M. M., Strickland, D. K., and Hyman, B. T.
The intracellular domain of the low density lipoprotein receptor-related protein
modulates transactivation mediated by amyloid precursor protein and Fe65. J
Biol Chem, 278: 41182-41188, 2003.
23
Beaujouin, Figure 1
A a
NH2
4K
-44
b
Asp33
14K
34K
1
1
51
101
151
201
251
301
351
401
451
501
551
601
348
QIDRGVTHLN
TLISGMIDEP
IQWPTGLAVD
SIDVFEDYIY
QPEVTNPCDR
APRPGTCNLQ
GTCAASPSGM
CLPGFLG DRC
CSRCLEGACV
MPECQCPPHM
YKRRVQGAKG
LDPDKPTNFT
A
ISGLKMPRGI
HAIVVDPLRG
YHNERLYWAD
GVTYINNRVF
KKCEWLCLLS
CFNGGSCFLN
PTCRCPTGFT
QYRQCSGYCE
VNKQSGDVTC
TGPRCEEHVF
FQHQRMTNGA
NPVYATLYMG
Coomassie
B
COOH
Asp231
a
AIDWVAGNVY
TMYWSDWGNH
AKLSVIGSIR
KIHKFGHSPL
PSGPVCTCPN
ARRQPKCRCQ
GPKCTQQVCA
NFGTCQMAAD
NCTDGRVAPS
SQQQPGHIAS
MNVEIGNPTY
GHGSRHSLAS
WTDSGRDVIE
PKIETAAMDG
LNGTDPIVAA
VNLTGGLSHA
GKRLDNGTCV
PRYTGDKCEL
GYCANNSTCT
GSRQCRCTAY
CLTCVGHCSN
ILIPLLLLLL
KMYEGGE PDD
TDEKRELLGR
VAQMKGENRK
TLRETLVQDN
DSKRGLSHPF
SDVVLYHQHK
PVPSPTPPPD
DQCWEHCRNG
VNQGNQPQCR
FEGSRCEVNK
GGSCTMNSKM
LVLVAGVVFW
VGGLLDADFA
GPEDEIGDPL
Autoradiography
b
79K -
LRP1b [1-476]
27K -
c
d
61K -
LRP1b [1-476]
27K -
e
f
66K -
LRP1b [1-476]
27K -
C
a
b
43K -
52K pro-cath-D
27K -
c
d
43K -
APP
27K -
Figure 1. Cath-D interacts with the b chain of LRP1 in vitro
(A) Sequence of the LRP1b chain interacting with cath-D. Panel a shows a
schematic representation of human cath-D. The locations of 4-kDa cath-D profragment, 14-kDa light and 34-kDa heavy mature chains are indicated. The
intermediate 48-kDa form (not shown) corresponds to non-cleaved 14 + 34-kDa
chains. Number 1 corresponds to the first amino acid of the mature cath-D. The
position of the catalytic aspartic acid is shown.
The sequence of the LRP1 b chain is shown in panel b. LRP1 is synthesized as a
4544-amino acid precursor that is cleaved into a a chain and a b chain. The
sequence of the b chain is shown, and the amino acids are numbered starting at
the first residue of the b chain. Residues 307-479, which form the cath-D binding
site, are shown in bold. The trans-membrane sequence is underlined, and the
two NPXY motifs are in italics.
(B) Binding of the full-length extracellular domain of LRP1b to cath-D. The radiolabeled, full-length extracellular domain of LRP1b (1-476) was incubated with
glutathione-Sepharose beads containing GST-cath-D/52K, GST-cath-D/34K, GSTcath-D/14K, GST-cath-D/4K, GST-RAP and GST. GST proteins were stained by
Coomassie (panels a, c and e). Bound LRP1b (1-476) was detected by
autoradiography (panels b, d and f). The input corresponds to the lysate used for
the binding reaction.
(C) Binding of pro-cath-D to LRP1b (307-479). Radio-labeled pro-cath-D was
incubated with beads containing GST-LRP1b (307-479) or GST. GST proteins
stained by Coomassie are shown in panels a and c. Bound pro-cath-D (panel b)
was detected by autoradiography. APP was used a negative control (panel d).
Beaujouin, Figure 2
203
a
1
b
F0
239 252
16
288
17
18
348 349
307
F7
324
19
a
20
431
21
465
22
432 433
F6
F4
Coomassie
396
394
F5
383
382
F9 349
363
F10 349
356
372
F11
F12
382
364
363
357
F13
B
360
membrane
A
479
F8
394
Autoradiography
b
43K pro-cath-D
27K -
c
d
43K pro-cath-D
27K -
refolding
e
refolding
f
pro-cath-D
Figure 2. Cath-D binds to residues (349-394) of LRP1b in vitro
(A) Schematic representation of LRP1b extracellular domain and GST-LRP1b
fragments. In panel a, schematic representation and numbering of EGF-like
repeats 16 to 22 located in the extracellular domain of LRP1b is illustrated. In
panel b, shorter GST-LRP1b fragments (F4, F6-F8) were derived from GSTLRP1b (307-479) (F0). The F4 (349-394) GST-LRP1b fragment was then subdivided into shorter fragments (F5, F9-13).
(B) Binding of pro-cath-D to GST-LRP1b fragments. Radio-labeled pro-cath-D was
incubated with beads containing GST-LRP1b fragments or GST. GST proteins
bound to beads were stained by Coomassie (panels a, c and e) and bound procath-D was detected by autoradiography (panels b, d and f).
Beaujouin, Figure 3
A
IP cath-D
CE
a
IP LRP1b
IP IgG
- Ab
pro-cath-D
52K 48K -
34K -
- Ab
WB cath-D
b
85K -
WB LRP1b
fibroblasts
breast cancer cells
B
a
LRP1b
bactin
C
a
52K 48K -
cath-D-/-MEF-cath-D
3
4
5
6
7
(N° fractions)
8
9
10
b
52K 48K -
cath-D
34K 34K -
85K LRP1b
85K -
2
3
HMF (N° fractions)
4
5
6
7
8
9
10
Figure 3. Cath-D interacts with LRP1b in cellulo
(A) Co-transfected cath-D and LRP1b co-immunoprecipitate. COS cells were
transiently co-transfected with LRP1b in the presence or the absence of cath-D or
D231Ncath-D.
Cath-D,
LRP1b,
and
non-immune
IgG
(control)
immunoprecipitations (IP) and cell extracts (CE) were analyzed by anti-cath-D
(panel a) and anti-LRP1b (panel b) immunoblotting. Arrows show coimmunoprecipitated cath-D.
(B) Expression of LRP1 in fibroblasts and breast cancer cells. Protein expression
of LRP1b chain is shown in panel a. Whole cell extracts were subjected to SDSPAGE and immunoblotting with the anti-LRP1b hybridoma. LRP1b transfected
COS lysate was used as a positive control, LRP1-deficient MEF cells as a
negative control, and b actin as a loading control.
(C) Co-purification of endogenous LRP1 with cath-D. Panel a shows the copurification of endogenous LRP1 with cath-D in cath-D-transfected MEFs. Eluted
fractions were subjected to SDS-PAGE and immunoblotting with the anti-cath-D
antibody (top panels) and anti-LRP1b hybridoma (bottom panels). Panel b shows
the co-purification of endogenous LRP1 with cath-D in HMF cells treated with
cath-D. HMF fibroblasts were incubated for 48h with conditioned medium
containing 15 nM of pro-cath-D. HMF cell extracts were purified on an M1G8coupled column and analyzed by immunoblotting as described in panel a.
Beaujouin, Figure 4
A
a
b
c
PM
PM
PM
a
siRNA
- M6P
+ M6P
c
b
siRNA siRNA1
Luc LRP1
Luc LRP1 Luc LRP1
1
2
3
4
52K
48K
LRP1b
bactin
34K
cath-D uptake
+ M6P (% siLuc)
B
100
80
60
**
**
40
*
20
0
52K
C
+ M6P
a
LRP1-/-
LRP1-/-
MEF MEF-B-41
52K
48K
34K
48K
34K
cath-D forms
b
LRP1-/-
LRP1-/-
MEF MEF-B41
LRP1b
Figure 5. Silencing LRP1 in cath-D and D231Ncath-D expressing MEFs inhibits
invasive growth capacities
(A) Silencing LRP1 in cath-D expressing MEFs inhibits outgrowth. cath-D-/-MEFcath-D cells transfected with LRP1 siRNA3 (panels a and c) or Luc siRNA (panels
b and d) were embedded in Matrigel 24 h post-transfection. Phase contrast optical
photomicrographs (panels a and b), and p-nitrotetrazolium violet stained cells
(panels c and d) are shown after 4 days of culture. Data from one representative
experiment out of 2 are shown. LRP1b expression was monitored 24h posttransfection of cath-D-/-MEF-cath-D cells with Luc siRNA or LRP1 siRNA3
(panel e). Bars, 75 µm.
(B) Silencing LRP1 in D231Ncath-D expressing MEFs inhibits outgrowth. cath-D/-MEF-D231Ncath-D cells transfected with LRP1 siRNA3 (panels a and c) or Luc
siRNA (panels b and d) were embedded in Matrigel 24 h post-transfection and
analyzed as described in A.
Beaujouin, Figure 5
cath-D-/-MEF-cath-D
A
LRP1 siRNA3
a
Luc siRNA
b
e
siRNA siRNA3
Luc LRP1
LRP1b
bactin
d
c
cath-D-/-MEF-D231Ncath-D
B
LRP1 siRNA3
a
Luc siRNA
b
e
LRP1b
bactin
c
d
siRNA siRNA3
Luc LRP1
Figure 1. Cath-D interacts with the b chain of LRP1 in vitro
(A) Sequence of the LRP1b chain interacting with cath-D. Panel a shows a
schematic representation of human cath-D. The locations of 4-kDa cath-D profragment, 14-kDa light and 34-kDa heavy mature chains are indicated. The
intermediate 48-kDa form (not shown) corresponds to non-cleaved 14 + 34-kDa
chains. Number 1 corresponds to the first amino acid of the mature cath-D. The
position of the catalytic aspartic acid is shown.
The sequence of the LRP1 b chain is shown in panel b. LRP1 is synthesized as a
4544-amino acid precursor that is cleaved into a a chain and a b chain. The
sequence of the b chain is shown, and the amino acids are numbered starting at
the first residue of the b chain. Residues 307-479, which form the cath-D binding
site, are shown in bold. The trans-membrane sequence is underlined, and the
two NPXY motifs are in italics.
(B) Binding of the full-length extracellular domain of LRP1b to cath-D. The radiolabeled, full-length extracellular domain of LRP1b (1-476) was incubated with
glutathione-Sepharose beads containing GST-cath-D/52K, GST-cath-D/34K, GSTcath-D/14K, GST-cath-D/4K, GST-RAP and GST. GST proteins were stained by
Coomassie (panels a, c and e). Bound LRP1b (1-476) was detected by
autoradiography (panels b, d and f). The input corresponds to the lysate used for
the binding reaction.
(C) Binding of pro-cath-D to LRP1b (307-479). Radio-labeled pro-cath-D was
incubated with beads containing GST-LRP1b (307-479) or GST. GST proteins
stained by Coomassie are shown in panels a and c. Bound pro-cath-D (panel b)
was detected by autoradiography. APP was used a negative control (panel d).
Beaujouin, Figure 6
C
Luc siRNA HMF co-cultured on
3Y1Ad12/control
3Y1Ad12/cath-D
a
HMF
e
siRNA siRNA1
Luc LRP1
b
LRP1b
bactin
LRP1 siRNA1 HMF co-cultured on
3Y1Ad12/cath-D
3Y1Ad12/control
c
f
Luc siRNA
HMF
LRP1 siRNA1
HMF
d
- NS
52K
pro-cath-D
Figure 6. LRP1 is the receptor mediating the cath-D-induced paracrine
stimulation of fibroblast outgrowth
HMFs transfected with Luc siRNA (panels a, b) or LRP1 siRNA1 (panels c, d) were
embedded 48 h post-transfection in the presence of a bottom layer of 3Y1-Ad12
cancer cell lines that did not secrete cath-D (control, panels a and c) or did
secrete human cath-D (cath-D, panels b and d). Panels (a-d) correspond to phase
contrast optical photomicrographs of HMFs after 3 days of co-culture. Data from
one representative experiment out of 3 is shown. LRP1b expression was
monitored 48h post-transfection and before the co-culture assays (panel e). Procath-D secretion was analyzed by immunoblotting after 3 days of co-culture of Luc
siRNA (panel f, left panel) or LRP1 siRNA1 (panel f, right panel) transfected HMFs
with 3Y1Ad12 control or cath-D-transfected cells. NS = non-specific contaminant
protein. Bars, 75 µm.
Beaujouin, Figure Sup.1
cath-D-/-MEF-D231Ncath-D
3
4
5
6
7
(N° fractions)
8
9
10
52K 48K -
cath-D
34K -
85K -
LRP1b
Figure Sup. 1. Co-purification of endogenous LRP1 with D231Ncath-D
Eluted fractions were subjected to SDS-PAGE and immunoblotting with the
anti-cath-D antibody (top panels) and anti-LRP1b hybridoma (bottom panels).
Beaujouin, Figure Sup. 2
cath-D-/-MEF-cath-D
LRP1 siRNA4
Luc siRNA
a
b
e
siRNA siRNA4
Luc LRP1
LRP1b
bactin
c
d
Figure Sup. 2. Silencing LRP1 in cath-D expressing MEFs inhibits
invasive growth
cath-D-/-MEF-cath-D cells transfected with LRP1 siRNA4 (panels a and
c) or Luc siRNA (panels b and d) were embedded in Matrigel 24 h posttransfection, and analyzed as described in the legend to Figure 6A.
Beaujouin, Figure Sup. 3
Luc siRNA HMF co-cultured on
3Y1Ad12/control
a
3Y1Ad12/cath-D
b
e
HMF
siRNA siRNA2
Luc
LRP1
LRP1b
bactin
LRP1 siRNA2 HMF co-cultured on
3Y1Ad12/cath-D
3Y1Ad12/control
c
d
f
Luc siRNA
HMF
LRP1 siRNA2
HMF
- NS
52K
pro-cath-D
Figure Sup. 3. LRP1 silencing in HMF fibroblasts prevents cath-D-induced outgrowth
HMF fibroblasts transfected with Luc siRNA (panels a, b) or LRP1 siRNA2 (panels c, d)
were embedded 48h post-transfection in the presence of a bottom layer of 3Y1-Ad12
cancer cell lines secreting either no cath-D (control, panels a and c) or human cath-D (cathD, panels b and d). Phase contrast optical photomicrographs of HMF fibroblasts after 3
days of co-culture are shown in panels a-d. HMF cells were transfected with Luc siRNA or
LRP1 siRNA2 and LRP1b expression was monitored 48h post-transfection and before the
co-culture assays (panel e). Pro-cath-D secretion was analyzed after 3 days of co-culture
of Luc (panel f, left panel) or LRP1 (panel f, right panel) siRNA HMF fibroblasts with
3Y1Ad12/control or 3Y1Ad12/cath-D cells by immunoblotting. NS = non-specific
contaminant protein. Bars, 75 µm.
Résumé
L’aspartyl protéase cathepsine D, surexprimée et hyper-sécrétée par les cellules
épithéliales cancéreuses mammaires est un facteur de mauvais pronostic des cancers du sein et
stimule la prolifération des cellules cancéreuses et la formation des métastases. Elle affecte
également le micro-environnement tumoral en induisant la croissance invasive des
fibroblastes. Les travaux de l’équipe ont montré que le LDL-receptor related protein 1, LRP1,
est le récepteur fibroblastique de la cathepsine D. LRP1 est fortement exprimé par les
adipocytes. Les études cliniques indiquent que l’obésité est un facteur de risque dans de
nombreux cancers, dont le cancer du sein chez la femme ménopausée.
Dans cette thèse, nous avons étudié le rôle de la cathepsine D et du LRP1 dans les adipocytes,
type cellulaire prédominant du micro-environnement tumoral mammaire. Nos résultats
indiquent une surexpression de la cathepsine D et du LRP1 dans le tissu adipeux humain et
murin obèse. De plus, l’expression de la cathepsine D est augmentée pendant la
différenciation adipocytaire. Finalement, l’extinction de l’expression de la cathepsine D et du
LRP1 inhibe l’adipogenèse indiquant leurs rôles clefs dans ce processus.
L’ensemble de ces résultats suggère que la cathepsine D et son récepteur LRP1 pourraient être
des cibles thérapeutiques potentielles dans le traitement de l’obésité.
Mots-clés
Adipocytes, cancer du sein, cathepsine D, LRP1, micro-environnement tumoral, obésité.
Laboratoire d’accueil
INSERM U896 – cathepsines, autophagie et cancer
Institut de Recherche en Cancérologie de Montpellier
208 rue des apothicaires
34298 Montpellier – France
100