Untitled - Università di Bologna

Transcription

Izdavač Publisher
Veterinarski fakultet Sveučilišta u Zagrebu Faculty of Veterinary medicine Zagreb
Hrvatska veterinarska komora Croatian Veterinary Chamber
Urednici Editors
Prof. Dr. Ivica Harapin Prof. Dr. Josip Kos
Grafički urednik Graphic Editor
Josipa Skočibušić, graf. ing.
Tisak Printed By
Intergrafika d.o.o., Zagreb, Bistranska 19
Radovi tiskani u Zborniku su recenzirani
XVI. kongres Mediteranske federacije za zdravlje i produktivnost preživača (FeMeSPrum), Zadar, Croatia, 2008
POKROVITELJ
PATRONAGE
REPUBLIKA HRVATSKA
REPUBLIC OF CROATIA
MINISTARSTVO POLJOPRIVREDE
ribarstva i ruralnog razvitka
MINISTRY OF AGRICULTURE, Fisheries
and Rural Development
ORGANIZATORI
ORGANIZERS
VETERINARSKi FAKULTET
SVEUČILIŠTA U ZAGREBU
FACULTY OF VETERINARY MEDICINE
UNIVERSITY OF ZAGREB
Hrvatska veterinarska komora
Croatian Veterinary Chamber
POSEBNO ZAHVALJUJEMO
MINISTARSTVU ZANOSTI I
TEHNOLOGIJE REPUBLIKE HRVATSKE
NA POMOĆI PRI ORGANIZACIJI
XVI. KONGRESA MEDITERANSKE
FEDERACIJE ZA ZDRAVLJE I
PRODUKTIVNOST PREŽIVAČA
GREAT GRATITUDE TO THE MINISTRY
FOR SCIENCE AND TECHNOLGY OF
REPUBLIC CROATIA ON ASSIST TO THE
ORGANIZATION OF XVI. CONGRESS OF
THE MEDITERRANEAN FEDERATION
FOR HEALTH AND PRODUKTION OF
RUMINANTS
MEĐUNARODNI ORGANIZACIJSKI ODBOR
INTERNATIONAL ORGANIZING COMMITTEE
Prof. Dr. Sc. J. Kos, Croatia
Prof. Dr. Arcangelo Gentile, Italy
Prof. Dr. Antonio Pugliese, Italy
Dr. Sc. B. Fatur, Slovenia
Prof. Dr. M. Erman Or, Turkey
Prof. Dr. Paulino Garcia Partida, Spain
Prof. Dr. Pablo Diez-Banos, Spain
Prof. Dr. Hossein Hamali, Iran
XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008
NACIONALNI ORGANIZACIJSKI
ODBOR
Predsjednik: Prof. Dr. Josip Kos, DVM
Organizacijski tajnik: Prof. Dr. Ivica Harapin, DVM
Tehnički tajnik: dr. Nikica Prvanović, DVM
NATIONAL ORGANIZING
COMMITTEE
President: Prof. Dr. Josip Kos, DVM
Organisation secretary: Prof. Dr. Ivica Harapin, DVM
Technical secretary: dr. Nikica Prvanović, DVM
Članovi Members
Prof. Dr. Marijan Cergolj, DVM, Prof. Dr. Zdenko Makek, DVM,
Prof. Dr. Antun Tomašković, DVM, prof. dr. Ljiljana Bedrica, DVM,
Prof. Dr. Vlasta Šerman, DVM, doc. dr. Zoran Milas, DVM,
doc. dr. Tomislav Babić, DVM, doc. dr. Dražen Vnuk, DVM,
dr. Juraj Grizelj, DVM, Zlatko Hrastnik, DVM, Ivo Forgač, DVM
dr. Pero Božić, DVM, dr. Željko Cvetnić, DVM, Danimir Kolman, DVM
ZNANSTVENO STRUČNI
ODBOR
Predsjednik
SCIENTICIC PROFESSIONAL
COMMITTEE
President:
Prof. Dr. Ivica Harapin, DVM
Članovi: Members:
Prof. Dr. Josip Kos, DVM, Prof. Dr. Antun Tomašković, DVM,
Prof. Dr. Zdenko Makek, DVM, Prof. Dr. Darko Capak, DVM,
Prof. Dr. Zvonko Stojević
ODRŽAVANJE XVI. KONGRESA
MEDITERANSKE FEDERACIJE ZA
ZDRAVLJE I PRODUKTIVNOST
PREŽIVAČA
POMOGLI SU:
XVI. CONGRESS OF THE
MEDITERRANEAN FEDERATION
FOR HEALTH AND PRODUCTION OF
RUMINANTS IS SPONSORED BY:
INTERVET GLAVNI SPONZOR
ALAPIS
NEXE GRUPA
BAYER HEALTHCARE, Bayer Pharma d. o. o.
CENTAR ZA UNAPREĐIVANJE STOČARSTVA
GAVRILOVIĆ
MEDICAL INTERTRADE
PFIZER CROATIA Odjel veterine
PHOENIX FARMACIJA D. D.
VETERINA d. d.
VETERINARSKA MREŽA
ZIK 90
Contents - Sadržaj
Invited Lectures - Pozvana predavanja
Sušić, V., A. Ekert Kabalin, I. Štoković, Ž. Pavičić, B. Mioč, V. Pavić, Z. Barać, S. Menčik 13
Autochthonous Ruminant Breeds in Croatia
Autohtone pasmine preživača u Hrvatskoj
Antonio Gonzalez-Bulnes, Claudia A. Letelier, Ignacio Contreras-Solís, Juraj Grizelj 25
brief review of the state of the art in assisted reproduction in small ruminants
Situación actual de las técnicas de reproducción asistida en pequeños rumiantes
Aktualni status postupaka asistirane reprodukcije malih preživača
Infectious Diseases - Zarazne bolesti
Juan Muñoz Bielsa 35
NEW SOLUTION FOR THE CONTROL OF THE BOVINE RESPIRATORY COMPLEX
Nove mogućnosti kontrole zaraznog goveđeg respiratornog sindroma
Reina, R., Grego, E., Lacerenza, D., Profiti, M., Rosati, S. 43
GENETIC CHARACTERIZATION OF SMALL RUMINANT LENTIVIRUS GENOTYPE E
GENETSKA KARAKTERIZACIJA LENTIVIRUSA GENOTIPA E U MALIH PREŽIVAČA
Lika, E., Lika A., Gjino P., Turmalaj L., Grizelj J., Vince S. 47
Entomological surveillance for Bluetongue vectors in Tirana
ENTOMOLOŠKO ISTRAŽIVANJE BLUETONGUE VEKTORA U TIRANI
Habus, J., N. Turk, M. Friess, R. Zobel, Z. Grabarevic, Lj. Barbic, Z. Stritof, Z. Milas, V. Staresina 51
Sheep - associated malignant catarrhal fever – a case report
Zarazna korica goveda – prikaz slučaja
Nadalian M., Sadeghi-Nasab A., Hemmatzadeh F., Nadjafi J., Seifoori P., Gorjidooz M., Bahonar A. 57
Detection of persistently infected (PI) calves with bovine viral diarrhea
virus (BVDV) using “Ear Notch Test” and comparing it by Immuno-capture ELISA
Otkrivanje perzistentno inficirane (PI) teladi s goveđim virusom virusnog
proljeva (BVDV) koristeći rez uške i njegova usporedba s Immuno-capture ELISOM
Ata Ayhan, Mesih Kocamüftüoğlu, Sibel Hasircioğlu, Mehmet Kale 63
Investigation of Bovine Herpesvirus-1 (BHV-1) Infection in Relation to Fertility
in Repeat Breeder Cows
Istraživanje infekcije goveđim herpes-virusom-1 u odnosu na plodnost
krava koje se preganjuju
Lupo Tiziana, Daniele Macrì, Vitale Maria, Antonella Migliazzo, Stefano Reale, Fabrizio Vitale 71
PrP ANALISYS IN SICILIAN SCRAPIE OUTBREAKS
sc
Analiza PrPsc kod pojave svrbeža u ovaca na siciliji
Yavru, S., O. Yapici, M. Kale, Ş. Şahinduran, F. Pehlivanoğlu, m.k. Albay, o. Avci 75
SEROLOGICAL, VIROLOGICAL AND HAEMATOLOGICAL EXAMINATION OF CORONAVIRUS
INFECTION IN CALVES WITH DIARRHEA AND THEIR DAMS
Serološka, virusološka i hematološka pretraga na koronavirusnu
infekciju u teladi s proljevom te njihovih majki
Carcangiu V., Mura M. C., Vacca G. M., Parmeggiani A., Pazzola M., Dettori M. L., Bini P. P. 81
GH and some haematochemical parameters variation during the first two
months of lactation in mouflon (Ovis gmelini musimon)
II
GH I VARIJACIJE NEKIH HEMATOKEMIJSKIH PARAMETARA TIJEKOM PRVA DVA MJESECA
LAKTACIJE U MUFLONA (OVIS GMELINI MUSIMON)
Romero Tejeda A., Thiry J., Preziuso S., Thiry E., Petralia P., Valente C., Cuteri V. 89
Serological detection of a Bovine herpesvirus 1 related infection in
buffaloes (Bubalus bubalis) by using BoHV-1 blocking ELISA
Serološko otkrivanje goveđeg herpesvirusa 1 povezanog s infekcijom u
bufala (Bubalus bubalis)
Pavlak, M., M. Benić, D. Cvitković, M. Tadić 97
Epidemiological data of intrammamary infection in cattle - a quantitative
analysis of published data and comparison with data in Croatia
Epidemiološki podatci rasprostranjenosti mastitisa u goveda – analiza
publiciranih podataka i usporedba s podatcima pojave mastitisa u Hrvatskoj
Alireza Haghparast, Evert Hensen 113
Bovine MHC Class II Structure-Function Relationships: Implications for
Vaccine Development
ODNOSI GRAĐE I ULOGE GOVEĐIH MHC KLASE II: IMPLIKACIJE ZA RAZVOJ VAKCINE
Parasitology - Parazitologija
Díez-Baños, P., Dacal, V., Vázquez, L., Pardo, M., Cienfuegos, S., Díez-Baños, N., López, C.,
Panadero, R., Morrondo, P. 119
ANALYSIS OF THE PREVALENCE AND PARASITIC INTENSITY BY LUNG NEMATODA IN ROE
DEER (Capreolus capreolus) HUNTED IN GALICIA (NW SPAIN): EFFECT OF AGE
ANALIZA POJAVNOSTI I INTENZITETA INVAZIJE PLUĆNIM NEMATODIMA U SRNA
(Capreolus capreolus) ODSTRIJELJENIH U GALICIJI (SZ ŠPANJOLSKA): UTJECAJ DOBI
Díaz, P., J. Pedreira, J. L. Suárez, R. Sánchez-Andrade, R. Panadero, A. Paz-Silva,
P. Díez-Baños, P. Morrondo 123
INFLUENCE OF THE LIVER FLUKE-CONTROL PRACTICES ON THE PREVALENCE AND EGGOUTPUT IN SEMIEXTENSIVE BEEF CATTLE HERDS
UTJECAJ POSTUPAKA KONTROLE JETRENIH METILJA NA POJAVNOST I POLUČIVANJE
JAJAŠACA U SEMIEKSTENZIVNO DRŽANIH STADA TOVNIH GOVEDA
Morrondo, P., Vázquez, L., Pardo, M., Dacal, V., Díaz, P., Paz, A., Sánchez-Andrade, R., Arias,
M.S., Uriarte, J., Díez-Baños, P. 129
ROE DEER (Capreolus capreolus) AS A RESERVOIR OF PARASITIC INFECTIONS IN
DOMESTIC RUMINANTS UNDER FIELD CONDITIONS IN GALICIA
SRNA (Capreolus capreolus) KAO REZERVOAR PARAZITSKIH INVAZIJA ZA PAŠNO
DRŽANE DOMAĆE PREŽIVAČE U GALICIJI
Francisco, I., M. Arias, J. Pedreira, A. Paz-Silva, R. Francisco, R. Sánchez-Andrade, P. Díaz,
J. L. Suárez, P. Díez-Baños, P. Morrondo. 133
A SEROEPIDEMIOLOGICAL SURVEY OF BOVINE PARAMPHISTOMOSIS BY USING THE Cd2 ELISA
SEROEPIDEMIOLOŠKO ISTRAŽIVANJE GOVEĐE PARAMFISTOMOZE METODOM Cd2 ELISA
Vázquez, L., Dacal, V., Cienfuegos, S., Díaz, P., Lago, N., Panadero, R., Fernández, G.,
Morrondo, P., López, C. 139
OCURRENCE OF TREMATODE EGGS IN SHEEP FROM GALICIA (N.W. SPAIN)
Učestalost nalaza jajašaca metilja u ovaca iz pokrajine Galicija ( sjeverozapadna Španjolska)
Dacal, V., Vázquez L., Cienfuegos S., Panadero R., Pato J., Fernández G., Díez-Baños P., López C. 147
INFECTION BY INTESTINAL CESTODES IN SHEEP FROM GALICIA (N.W. SPAIN)
Infekcija ovaca iz područja Galicije crijevnim trakavicama
III
Vitale Maria, Scatassa Maria Luisa, La Giglia Maria, Giangrosso Giuseppe, Currò Vittoria,
Vitale Fabrizio, and Caracappa Santo 153
Toxoplasma gondii screening, by molecular and serological methods, in a
farm with a rural management in Sicily
Istraživanje Toxoplasmae gondii molekularnim i serološkim metodama na
farmama sa zastarijelom tehnologijom na području Sicilije
Pieragostini E., Alloggio I., de Ruvo G., Rubino G., Petazzi F. 157
Genetical markers of resilience to tick borne diseases (TBD) - a research
project for the improvement of sheep breeding and management strategies
Genetski markeri rezistencije na bolesti prenosive krpeljima (BPK)istraživački project sa ciljem napredka uzgoja ovaca i srategija upravljanja
Poglayen Giovanni, Stancampiano Laura, Varcasia Antonio, Anna Paola Pipia, Caterina Bio,
Costanza Romanelli 161
PASSIVE MONITORING EXPERIENCES ON CYSTIC ECHINOCOCCOSIS IN ITALY
ISKUSTVA PASIVNOG MONITORINGA CISTIČNE EHINOKOKOZE U ITALIJI
Pauling Bruce 163
A Field Report to Compare the Responses in calves with diarrhoea
associated with Cryptosporidiosis when treated with Electrolytes with or
without Betacyclodextrin
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG SA KRIPTOSPORIDIOZOM
PROVEDENU ELEKTROLITIMA SA I BEZ B-CIKLODEKSTRINA
Metabolic Diseases - Metaboličke bolesti
Masucci Marisa, Michela Pugliese, Alessio Scardillo, Antonio Sutera, Ferrantelli V., Giuseppe Licitra 169
NEUROLOGICAL MANIFESTATIONS AND LIVER DISEASE IN DAIRY COWS
Neurološki poremećaji i bolesti jetre u muznih krava
Abbasi, M, Gharzi, A. 173
Effects of sex on histological characteristics of skin in Lori sheep
Utjecaj spola na histološke osobitosti kože u Ovaca pasmine lori
Blanco-Penedo, I., López-Alonso, M., Miranda, M., Castillo, C., Hernández, J., Prieto Montaña,
F. Benedito, J. L. 177
Metabolic profile determination in calves from different management in NW Spain
ODREĐIVANJE METABOLIČKOG PROFILA TELADI S RAZLIČITIH UZGOJA
SJEVEROZAPADNE ŠPANJOLSKE
Tooloei, M. Nadalian, M., Khosravi, A., Helan, J. A., Najafie, R. 185
A field outbreak of Aflatoxicosis with high fatality rate in feedlot calves
in Tehran Province - Iran
A field outbreak of Aflatoxicosis with high fatality rate in feedlot calves
in Tehran Province - Iran
Morgante M., Stelletta C., Cannizzo C., Casalone M., Coppola L., Gianesella M. 193
Subacute rumen acidosis in dairy herds: diagnostics tools
Subakutna acidoza buraga u mliječnih krava: dijagnostički postupci
Radojičić Biljana, B. Dimitrijević, A. Krasnić 201
INFLUENCE OF PROPYLEN GLYCOL IN FEED FOR PROPHYLAXIS OF KETOSIS IN
PERIPARTAL PERIODS OF DAIRY COWS
utjecaj PROPiLEN GLikOLa u hrani na spriječavanje ketoze u muznih krava prije poroda
IV
Tabrizi, Afshin Davasaz, Roozali Batavani, Siamak Asri-Rezaei, Malahat Ahmadi 207
Electrophoretic study of plasma proteins in dairy cows with clinical and
subclinical mastitis by Agarose gel procedure
Istraživanje proteina plazme elektroforezom u mliječnih krava s kliničkim
i subkliničkim mastitisom postupkom gel Agara
Bustamante Cano J, Hernández Arroyave W., Gutiérrez Chávez A. J., Alonso Alonso P.,
González Montaña J. 213
SECONDARY COPPER DEFICIENCY IN CATTLE FROM MOLYBDENUM INTOXICATION: CLINIC
AND PATHOLOGICAL STUDY.
[HIPOCUPROSIS BOVINA SECUNDARIA A MOLIBDENOSIS: ESTUDIO CLÍNICO,
HISTOPATOLÓGICO Y HEMATOLÓGICO
Sekundarna deficijencija bakra u goveda otrovanih molibdenom: Klinički i
patološki nalaz
Comin A., Tidu L., Cornacchia G., Cappa A., Renaville B., Prandi A. 221
NEONATAL PERIOD AND HAIR CORTISOL IN CATTLE AS A MARKER OF STRESs
NEONATALNO RAZDOBLJE I DLAČNI KORTIZOL U GOVEDA KAO MARKER STRESA
Kostelić, A., Branka Artuković, R. Beck, M. Benić, M. Cergolj, I. Štoković, Z. Barać 227
Diseases of sheep on Croatian islands
Bolesti ovaca na hrvatskim otocima
Stojević, Z., Natalija Filipović, Z. Tuček, Blanka Beer Ljubić, K. Dolanski, Lina Bačar-Huskić 233
The influence of calcium-propionate in diet on energy status in dairy cows
Utjecaj dodavanja propionata u hrani na energetski status mliječnih krava
Kayar, A., Mehmet Erman OR, Remzi Gonul, Banu Dokuzeylul, Ali Rıza Kiziler, Birsen
Aydemir, Abdullah Aksu, Cağla Parkan, Tamercan Morkoc, and Bora Bartucu 237
The Clinical Efficiency of Minerasol® Which is a New Trace Element
Combination on Sheep
Učinak kombinacije minerala u pripravku Minerasol na nivo nekih
elemenata u ovaca
Trojacanec, P., T. Dovenski, V. Ilieski, S. Trojacanec, K. Ilievska, L. Pendovski 243
Possibilities for teaching reproductive clinical anatomy using laparoscopy
Primjena laparoskopije u nastavi reproduktivne kliničke anatomije
Reproduction, Obstretics and Udder Health - Reprodukcija, porodništvo i zdravlje vimena
González Montaña JR, Cal L, Benech A, Lataste V, Grille L, Rodas E. 247
PREGNANCY TOXEMIA IN EWES: ALTERNATIVE THERAPEUTIC IN EXTENSIVE SYSTEM
CONDITIONS
GESTOSIS OVINA SUBCLÍNICA: ALTERNATIVAS TERAPÉUTICAS EN CONDICIONES DE
EXPLOTACIÓN EXTENSIVA
GRAVIDITETNA TOKSEMIJA U OVACA: ALTERNATIVNA TERAPIJA U EKSTENZIVNOM OVČARENJU
Hamali H., S. Mosafery 253
A Survey of Teat End Hyper Keratosis Prevalence in the Tabriz Dairy Herds
Hiperkeratoza sisa u stadima mliječnih krava u provinciji Tabriz
Pengov A, Podpečan O. 261
PERACUTE STAPHYLOCOCCUS AUREUS MASTITIS IN EWES
PERAkutni STAPHYLOCOCCUS AUREUS MASTITIS u ovaca
Zobel ,R., D. Gereš, R. Turk, D. Gračner, D. Žubčić 267
Onset of ovulation analysis in dairy cows
Analiza vremena nastupa ovulacije u mliječnih plotkinja
Prvanović, N., D. Đuričić, S. Vince, J. Sulon, J. F. Beckers, N. Filipović, M. Cergolj, J. Grizelj,
M. Samardžija, T. Dobranić, M. Lipar 275
Influence of breed, parity and lactation on PAG and progesterone profiles
in pregnant saanen and boer goats
Utjecaj pasmine, pariteta i laktacije na koncentraciju PAG i progesterona
tijekom gravidnosti sanskih i burskih koza
Šeol, B., T. Naglić, H. Ball, D. Finlay, K. Matanović, M. Martinec 281
An outbreak of Mycoplasma bovis mastitis on a diary cows farm in Croatia
Epizootija mastitisa uzrokovanog bakterijom Mycoplasma bovis u mliječnih
krava u Hrvatskoj
Grizelj, J., S. Vince, A. González de Bulnes, M. Karadjole, T. Dobranić, M. Samardžija, I. Getz,
N. Prvanović, M. Belić, A.Tomašković, M. Lipar, D. Cvitković 287
THE ULTRASONIC EXAMINATION OF OVARIES AS A TOOL IN GOAT SUPEROVULATION
PROCEDURES
ULTRAZVUČNA PRETRAGA JAJNIKA U SUPEROVULACIJSKIM POstSTUPCIMA U KOZA
Saif A. Balios 293
SYNCHRONIZATION OF OESTRUS IN KARADI EWES: THE USE OF DIFFERENT PMSG DOSES
Sinkronizacija estrusa u karadi ovaca: uporaba različitih PMSG DOza
Surgery, Miscellaneous - Kirurgija, ostalo
Gjino P., Koleci Xh., Turmalaj L., Grizelj J., Vince S., Lika E. 301
Role of Bovine Digital Dermatitis (BDD) on service period of dairy cattle
Utjecaj bovinog digitalnog dermatitisa na servis period krava muzara
Zemljič, Borut
307
INFLUENCE ON PREVALENCE OF THE DERMATITIS DIGITALIS PAPILLOMATOSA IN THE
DAIRY HERDS
UTJECAJ NA POJAVNOST PAPILOMATOZNOG DIGITALNOG DERMATITISA U MLIJEČNIH
KRAVA
Capak, D., B. Radišić, D. Vnuk, I. Harapin, J. Kos, T. Babić, Marija Lipar, and D. Matičić 313
Unilateral scrotal hernia in ram
JEDNOSTRANA SKROTALNA HERNIJA U OVNA
Cabras, P. A., A. Firinu, S. Tola, A. Orrù, A. M. Deiana, S. Usai, S. R. Poddighe, V. Petruzzi 317
Infectious Keratoconjunctivitis (Pink Eyes) in Sardinian Goats: Clinical,
Diagnostics and Epidemiological Considerations
Zarazni Keratokonjunktivitis (Pink Eyes) u sardinijskih koza: klinička,
dijagnostička i epiemiološka razmatranja
Babić, T., Kos J., Smolec O. 321
THE FIGURATIVE OUTLINE OF HORN DEFORMATION AND HORN INJURIES OF THE FARM
CATTLE TREATED IN THE WIDER SURROUNDING COUNTRYSIDE OF ZAGREB
SLIKOVIT PRIKAZ DEFORMACIJA I OZLJEDA ROGOVA FARMSKIH GOVEDA OBRAĐENIH U
ŠIROJ OKOLICI ZAGREBA
Morelli C., Cubeddu M. G., Calabrò G., Russo M., Di Pietro C., Passantino A. 325
PENALTIES FOR BREACH OF EC FOOD LAW IN ITALY
Kazne za kršenje EC zakona o hrani u Italiji
Cubeddu G. M., Lai M. G., Coda S., Fois G. M. 329
Penal and Civil Cases in the matter of cattle: forensic observations
Il contenzioso penale e civile in materia di bovini: osservazioni medico-legali
KRIVIČNE I GRAĐANSKE PARNICE S PREDMETOM GOVEDA: SUDSKI OSVRTI
VI
Pugliese A., Tortorella A., Di Marco V., Di Pietro S., Russo M., Gruppillo A., Scardillo A., Niutta P.P. 333
EPIDEMIOLOGICAL DATA ON INFECTIOUS KERATOCONJUNTIVITIS (IKC) OF SHEEP AND
GOAT IN SICILY
EPIDEMIOLOški pokazatelji zaraznog KERATOkonjUNTIVITISa (IKC) ovaca i
koza na Siciliji
Robles-Robles, R., Revuelta, J.F., González-Montaña, J.R. 337
THE ECONOMICS OF EXTENSIVE BEEF PRODUCTION IN SPAIN
Isplativost ekstenzivnog uzgoja goveda u Španjolskoj
Džaja., P., M.Čuljak, J. Bagarić., V. Vrkić., K. Rukavec, F. Martinković., E. Šatrović, M.
Radačić,
I. Vranješ, A. Lokin., I. Semren 345
CERTAIN FEATURES OF RAW SKIN FROM LARGE DOMESTIC HOOFED ANIMALS
NEKA SVOJSTVA SIROVIH GOVEĐIH KOŽA
Džaja P., Z. Perić, M. Vujić, J. Kos, Ž. Grabarević, E. Šatrović, J. Bagarić, M. Radačić, B.
Artuković, A. Lokin, T. Zubak 351
THE MOST COMMON JURIDICAL CASSES OF CATTLE SINCE 1923 -2007
NAJČEŠĆI SUDSKI SLUČAJEVI IZ GOVEDARSTVA OD 1923-2007.
Bazargani T. T., Hemmatzadeh F., Nadjafi J. and Sadeghi-Nasab A. 361
Outbreak of the BVDV induced gastro-neuropathy in a feedlot calves
around Tehran (Iran)
POJAVA BVDV-OM INDUCIRANE NEFROPATIJE KOD TELADI U OKOLICI TEHERANA (IRAN)
Šehić, M., V. Butković, D. Stanin, B. Škrlin, B. Radišić, J. Kos 369
Comparison of conventional and digital radiography of phalangeal bone
and soft tissue in cattle
Usporedba konvencionalne i digitalne radiografije kosti i mekih česti
falangi goveda
Fernández, G., Lago, N., Pato, J.,López, C.M., Díez-Baños, P., Cienfuegos, S, Viña, M. 377
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO (NORTH-WEST SPAIN)
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO (NORTH-WEST SPAIN)
Posters - Posteri
Kale, M., Ö. Kurşunb, A. S. Akcan Kalec, F. Pehlivanoğlud, S. Hasırcıoğlua, S. Yavrue 383
SPINAL CORD TISSUE DETECTION IN COMMINUTED BEEF IN A PRIVATE ABATTOIR IN
SOUTHERN TURKEY
Detekcija tkiva leđne moždine u usitnjenoj govedini iz privatne mesnice u
južnoj Turskoj
Kale, M., Ayhan ATA, Sibel Yavru, Orhan Yapkiç, Oya Bulut, Uğur Büyükyörük, Mehmet Şükrü
Gülay, Oğuzhan Avci 389
INVESTIGATION OF BOVINE VIRAL DIARRHEA VIRUS (BVDV) INFECTION IN RELATION TO
FERTILITY IN CATTLE
Istraživanje utjecaja BVD ( Bovine Viral Diarrhea) na plodnost u goveda
Kale, M., O. Kursun, A. S. Akcan Kale, F. Pehlivanoglu, A. Guner, R. Baskaya, Y. Dogruer,
C. Outurk 397
DETECTION OF SPINAL CORD TISSUES AS BOVINE SPONGIFORM ENCEPHALOPATHY
SPECIFIED RISK MATERIAL (BSE-SRM) IN BEEF CARCASSES DURING SPLITTING IN TURKEY
OTKRIVANJE TKIVA RIZIČNOG ZA PRIJENOS BSE PRILIKOM ODVAJANJA GOVEĐIH
POLOVICA U TURSKOJ
VII
Dobranić, T., M. Samardžija, D. Đuričić, I. Harapin, S. Vince, D. Gračner, N. Prvanović,
J. Grizelj, M. Karadjole, Lj. Bedrica, D. Cvitković 403
THE METABOLIC PROFILE OF BOER GOATS DURING PUERPERIUM
THE METABOLIC PROFILE OF BOER GOATS DURING PUERPERIUM
NIVELES DE METALES TÓXICOS (As, Cd, Hg y Pb) EN HÍGADOS DE BOVINOS CRIADOS EN
INTENSIVO EN LA PROVINCIA DE LEÓN (N.O. ESPAÑA).
Escudero, A., González JR, Miranda M, Hernández J, Lechuga A, Castillo C, Benedito JL. 409
TOXIC METAL CONCENTRATIONS (As, Cd, Hg y Pb) IN LIVER OF BEEF CATTLE FROM
PROVINCE OF LEON (NW SPAIN).
KONCENTRACIJE TOKSIČNIH METALA (As, Cd, Hg I Pb) U JETRI TOVNE JUNADI S
PODRUČJA LEONA (SJEVEROZAPADNA ŠPANJOLSKA)
Benech, A., Cal L, Martín A, Da Silva S, Lataste V, Torío R, Fernández Rodríguez F, González
Montaña JR, Prieto Montaña F y Rodas E. 415
STARVED PERIOD IN LATE GESTATION: EFFECTS ON EWES AND LAMBS
RESTRICCIÓN DEL ALIMENTO EN LA GESTACIÓN AVANZADA: EFECTOS SOBRE LA OVEJA
Y SOBRE EL CORDERO
UTJECAJ GLADOVANJA TIJEKOM KASNE GRAVIDNOSTI NA OVCU I JANJAD
Filipović, Natalija, Nikica Prvanović, T. Mašek, Ž. Mikulec, Z. Stojević 421
Bone metabolism in dairy ewes during lactation
Koštani metabolizam u mliječnih ovaca tijekom laktacije
Majić-Balić, I., S. Milinković-Tur, J. Piršljin, B. Beer Ljubić, A. Orak, P. Božić 427
Activity of glutathione peroxidase in sperm and blood serum of simmental
breeding bulls
Aktivnost glutation peroksidaze u spermi i krvnom serumu bikova
simentalske pasmine
Marenjak, T. M., Nina Poljičak-Milas,Jasna Piršljin, Blanka Beer Ljubić, Ivančica Delaš 433
Interactive fat supplementation changed the milk quality and plasma
thyroid hormone concentration in Simmental cows
DODATAK NEŽAŠTIĆENE MASTI U OBROK MIJENJA KVALITETU MLIJEKA I
KONCENTRACIJU HORMONA ŠTITNJAČE U SIMENTALSKIH KRAVA
Blanka Beer Ljubić, Renata Laškaj, Jasna Piršljin, Ivanka Majić-Balić, Terezija Silvija
Marenjak, Suzana Milinković-Tur 441
Seasonal changes in lipid composition of bovine serum and seminal plasma
Utjecaj godišnjih doba na sastav masnih tvari u serumu i sjemenoj plazmi bikova
Karadjole, M., I. Getz, N. Macesic, M. Samardzija, T. Karadjole, G. Bacic, Z. Makek, T.
Dobranic, M. Knezevic, G. Perculija, D. Cvitkovic 451
EFFECT OF DONOR BREED ON BOVINE OOCYTE RECOVERY AND IN VITRO EMBRYO
DEVELOPMENT AFTER OVUM PICK UP
Utjecaj pasmine goveda na jajne stanice dobivene postupkom
transvaginalne ultrazvučne punkcije I embrionalni razvoj in vitro
Maćešić, N., Marijan Cergolj, Nikica Prvanović, Marko Samardžija, Tugomir Karadjole,
Martina Karadjole, Goran Bačić, Tomislav Dobranić, Antun Kostelić, Miroslav Benić 457
THE ETIOLOGY AND PREVALENCE OF INTRAMAMMARY INFECTION OF DAIRY GOATS IN
REGIONS OF NORTH CROATIA
ETIOLOGIJA I PREVALENCIJA INTRAMAMARNIH INFEKCIJA KOZA U SJEVERNOJ HRVATSKOJ
Šakić Vedad, Katica Velija, Crnkić Ćazim, Softić Almira, Brdarić Maja 461
PHENOTYPE AND PRODUCTIVE CHARACTERISTICS OF DUBIAN ZECKEL SHEEP
FENOTIPSKE I PROIZVODNE KARAKTERISTIKE OVCE DUBSKE PRAMENKE
VIII
Grabarević, Ž., Seiwerth, S., Čorić, M., Šoštarić-Zuckermann, I.C., Hohšteter, M., Artuković, B.,
Beck, A, Gudan-Kurilj, A., Džaja, P., Švić, L. 467
Metastatic cholangiocarcinoma in a cow - case report
Metastatski kolangiocelularni karcinom krave – prikaz slučaja
Dettori, M.L., G.M. Vacca, V. Carcangiu, M. Pazzola, M. Sanna, G. Maricosu, P.P. Bini 473
POLIMORFISMO DEL GENE CSN1S2 NELLA CAPRA SARDA
POLIMORFIZAM GENA CSN1S2 U SARDINIJSKE KOZE
Sanchez, L, Cantalapiedra, J.A., Carril, J. A., Iglesias, A. 481
ANALYSIS OF GROWTH CURVE OF CROSSES RUBIA GALLEGA X NELLORE BY MEANS OF
MICHAELIS-MENTEN EQUATION
ANALISIS DE LA CURVA DE CRECIMIENTO DE CRUCES DE RUBIA GALLEGA X NELORE
MEDIANTE LA ECUACION DE MICHAELIS-MENTEN
Gönül Remzi, Abdullah Kayar, Tanay Bílal, M. Erman Or, Çağla Parkan, H. Tamer
Dodurka, Tevfik Gülyaşar, Bora Barutçu 485
COMPARISON OF MINERAL LEVELS IN BONE AND BLOOD SERUM OF CATTLE IN
NORTHWESTERN TURKEY
USPOREDBA RAZINE MINERALA U KOŠTANOM SUSTAVU I KRVI KRAVA U
SJEVEROZAPADNOJ TURSKOJ
Cubeddu G.M., Coluccio P., Lai M.G., Pintori G.,Vacca E. 491
Forensic observation on the use of auricular marks on the Sardinian purebred
sheep
Osservazioni cliniche, medico-legali, legislative e di benessere animale
sull’applicazione delle marche auricolari in ovini di razza sarda
MEDICINSKO-PRAVNI OSVRT NA PRIMJENU UŠNIH MARKICA KOD SARDINIJSKIH PASMINA
OVACA
Gharzi, A and Abbasi, M 497
Biometry and histomorphometry of ovary in Lori local sheep
Biometrija i histomorfometrija ovarija ovce pasmine Lori
Hassanpour, A., Amougli Tabrizi, B. 498
Biochemical and hematological parameters in cows with TRP
Biokemijski i hematološki pokazatelji u goveda sa TRP
Yahya Tahamtana, Seyyed Shahram Shekarforooshb, Seyyed Ali Pourbakhshc 499
The survey on prevalence of E.coli O157:H7 using VT1, 2 and eae genes from
sheep in Shiraz-Iran
Pregled pojavnosti E.coli O157:H7 upotrebom VT 1,2 i eae gena iz pokrajine
Shiraz u Iranu
Yahya Tahamtana, Ali Pourbakhsh, Shahram Shekarforoosh 500
First Identification of Escherichia coli O157:H7 by Improved Trypticase Soy
Broth and Sorbitol MacConkey Agar containing cefixime and tellurite and
comparison with PCRs from cattle carcasses in Shiraz-Iran
Prva identifikacija E.coli O157:H7 na poboljšanoj podlozi bujona sojine
triptikaze i sorbitol McConkey agaru koji sadrže cefexim i telurit u
usporedbi s PCR od goveđih lešina u iranskoj pokrajini Shiraz
Saif A. Balios, Muaffq S. Kassim and Rabea A.S.Al-Oramary. 501
Induction of parturition in ewes (local breeds) and subsequent survival of
neonates
Brianti, E., Abbene S., Gaglio G., Risitano A.L., Ferlazzo M., Chiofalo B., Cavallaro M., Giannetto S. 502
Effects of untreated gastrointestinal nematode infections on performances
and development of effective immune response in lambs of Valle del Belice
breed
IX
Bahari Aliasghar, Mohammadreza Sadeghi, Shamsedin Ghaemmaghami, Ali Sadeghi-nasab 503
Serological survey on bovine viral diarrhea virus infection of cattle in
Hamadan area-Iran
Haghparast Alireza, Gholamreza Mohammadi, Shalaleh Mousavi 504
Seroepidemiology of Bovine Leukemia Virus (BLV) infection in the north
eastern provinces of Iran
Leoni, G. G., Bebbere D., Satta V., °Berlinguer F., Mereu P., Pirastru M., Manca L., Naitana S. 505
GENETIC CARACTERIZATION OF SARDINIAN MOUFLON POPULATION USING
MICROSATELLITES AND mtDNA MARKERS.
Kocamüftüğlu Mesih, Ayhan Ata, Mehmet Kale, Sibel Hasircioğlu 506
Investigation of Bovine Viral Diarrhea Virus (BVDV) Infection in Relation to
Fertility in Dairy Cows with Repeat Breeding
Prvanović, N., M. Cergolj, A. Tomašković, N. Maćešić, J. Grizelj, M. Samardžija, T. Dobranić,
N. Filipović, G. Bačić, M. Lipar 507
Influence of impropriate milking on udder health of dairy cows
Mohagheghzadeh Ali 508
ANTIMICROBIAL EFFECT OF EDTA_TRIS AND ANTIBIOTICS ON SALMONELLA
TYPHIMURIUM INVITRO AND ON BROILER CARCASE
Nicolussi P, Bonelli P, Pau S, Canalis M, Soru A, Sarria A, Patta C, Marongiu E, Di Gennaro A,
Bonfini B, Savini G. 509
Effects of Bluetongue live modified vaccine on early and mid pregnancy in
sheep
Vicari D., Mancuso R., Cicero A., Randazzo V., Martorana C., Chetta M., Ferrantelli V., Castiglione F. 510
Epidemiological survey of infectious causes of diarrhea in young small
ruminants in Sicily
Castiglione F., Tamburello A., Macrì D., Emanuele M.C., Alaimo C., Monteverde V., Puleio R.,
Manno C., Ferrantelli V., Nicholas R.A.J. *, Loria G.R.
511
Development of “potency test” for evaluation of farm vaccines against
contagious agalactia in a natural outbreak
Galia S., Pugliese M., De Majo M., Mazzullo G. 515
CLINICAL AND HISTOPATHOLOGICAL FINDINGS IN A CASE OF OVINE OCULAR SQUAMOUS
CELL CARCINOMA (OSCC)
Sušić, V., A. Ekert Kabalin, I. Štoković, Ž. Pavičić, B. Mioč, V. Pavić, Z. Barać
521
Sheep of the Island of Pag: lambing frequency and lamb birth weight during
winter-spring season
Paška ovca: učestalost janjenja i porodna masa janjadi tijekom zimskoproljetne sezone
Benić, M., Ž. Cvetnić, M. Lojkić, B. Habrun, G. Kompes, M. Cergolj,, N. Maćešić
527
Prevalence and aethiology of cow mastitis in small dairy holdings in Croatia
Prevalencija i etiologija mastitisa krava u malim obiteljskim gospodarstvima
Di Marco Vincenzo, Russo Miriam, Aronica Vincenzo, Fiasconaro Michele, Scimeca Salvatore,
Alongi Angelina, Torina Alessandra
531
Case Report of anaplasmosis on a sheep farm in the Nebrodi Mountain range
(Sicily – Italy - Europe)
Caracappa Santo, Torina Alessandra, Nicosia Silviane, D’Agostino Rosalia, Russo Miriam, Alongi
Angelina, Di Marco Vincenzo
533
Theileria equi in ovine: a cases report
Barriada Alvarez M., Martínez López L. M. 535
ANIMAL IDENTIFICATION: CONDITIONS OF THE INDIVIDUAL IDENTIFICATION OF BOVINE
ANIMALES IN ASTURIAS (SPAIN)
Invited Lectures
Pozvana predavanja
11
12
Autochthonous Ruminant Breeds in Croatia
Autohtone pasmine preživača u Hrvatskoj
V. Sušić1, A. Ekert Kabalin1, I. Štoković1, Ž. Pavičić2, B. Mioč3, V. Pavić3, Z. Barać4, S.
Menčik1
1
2
Department of Animal Husbandry, Faculty of Veterinary Medicine, University of Zagreb, Croatia
Department of Animal Hygiene, Environment and Ethology, Faculty of Veterinary Medicine, University of
Zagreb, Croatia
3
Department of Animal Science II, Faculty of Agriculture, University of Zagreb, Croatia
4
Croatian Livestock Centre, Zagreb, Croatia
In every geographical region, as well as in the regions of the Republic of Croatia, autochthonous
breeds of animals evolved and adapted under the influence of a number of factors - ranging from natural
selection to those implemented by man (Posavi et al., 2001). Declining numbers or the disappearance
of autochthonous domestic animal breeds in the last hundred years is the result of an increasingly
rapid technological development and the establishment of greater economic requirements, in addition
to socio-economic changes and the migration of the rural population to urban areas. Consequently, at
present time in the world, like in Croatia, a great deal of attention has been given to the preservation
of autochthonous breeds of animals.
After signing the Convention of Biological Diversity in 1992 and its ratification by the Croatian
Parliament in 1996, creating of national strategies for protecting Croatia’s biological and landscape
diversity have started. The main reasons for protection the diversity of autochthonous animal breeds
are their value as components of Croatian heritage, as well as their inclusion in the historico-cultural
development of certain regions (Ekert Kabalin and Štoković, 2007; Posavi et al, 2001; Sušić et al.,
2001).
The main ways to preserve autochthonous breeds includes identification, ascertaining size
and status of endangered breeds, their genotyping and conservation methods in situ and ex situ.
Preservation in situ implies the preservation of the population in their original environment, while
ex situ implies the preservation of animals removed from their original environment. Two methods
of preservation can be used: in vivo (live animals) and in vitro (storage of genetic material like
semen, embryos or other tissues in the gene bank) (Štoković et al., 2007 a and b; FAO 2005; Henson
1992).
As an urgent measure to put a stop to the disappearance of autochthonous breeds, the Republic
of Croatia increased financial Subsidies for their breeding. Besides that, several research and
aplied programes started with the goals to develop favourable marketing conditions with the
commercialization of autochthonous products that need to find a place on the domestic and foreign
markets (Ekert Kabalin and Štoković, 2007).
Status of autochthonous ruminant breeds in Croatia
According to the World Watch List categorization, Croatian autochthonous ruminant breeds are
located on different levels of endangerment (Barać et al., 2007; Bulić et al., 2007; Ekert Kabalin
13
and Štoković, 2007; CLC, 2007; DZZP, 2006; Sušić et al., 2006b and 2001; Posavi et al., 2004 and
2001).
2.
The present status of autochthonous ruminant breeds in Croatia are illustrated in Tables 1 and
Table 1: Status of Croatian autochthonous cattle breeds in the year 2006 (Source: CLC, 2007; Annual Report
for 2006)
Number of animals
Breed
Istrian cattle
Buša of Lika
Şlavonian-Syrmian
Podolian
Number
of males
18
11
Number
of females
343
100
1
26
Effective
population
size*
Population
status
68,41
39,64
in danger
in danger
3,85
critical
* Effective population size (Ne) is the fundamental criteria for the determination of endangered
breeds. It is calculated according to the expression: Ne = (Nm * Nf) / (Nm + Nf)
Table 2: Breed structure of sheep and goats under selection control and estimate of population size in 2006
(Source: CLC, 2007- Annual Report for 2006)
Breed
Number of
sheep /goats
Istrian Sheep
Sheep of the Island of Cres
Sheep of the Island of Pag
Ruda Sheep
Pramenka of Lika
Pramenka of Dalmatia
Tsigai
Sheep of the Island of Rab
Croatian variegated goat
1.923
603
1.944
253
4.035
2.311
1.841
645
210
Number of
yearlings
285
121
411
37
866
447
682
129
23
Number of
rams /hegoats
53
23
88
17
81
78
39
22
7
Total heads
2.261
747
2.443
307
4.982
2.836
2.562
796
240
Estimate of
population
size
2.261
15.000
30.000
307
30.000
200.000
3.000
6.500
20.000
Primary characteristics of Croatian autochthonous cattle, sheep and goat breeds
According to the List of autochthonous and protected breeds and strains of domestic animals
(NN 127/98, 73/03, 39/06, 126/07) in autochthonous breeds of ruminants are included: Istrian cattle,
Buša of Lika, Şlavonian-Syrmian Podolian, Pramenka of Dalmatia, Ruda Sheep (Dubrovnik Sheep),
Sheep of the Island of Cres, Sheep of the Island of Rab, Pramenka of Lika, Istrian Sheep, Sheep of
the Island of Pag, Tsigai, Sheep of the Island of Krk, Croatian variegated goat and Croatian white
goat (MPŠVG, 1998, 2003, 2006 and 2007).
CATTLE
The Istrian cattle belongs to a group of primitive primigenius European cattle. Among the people
it’s still called boškarin. The creation of this cattle breed favours arable land, gentle climate and a rich
14
Istrian cattle
millenial livestock tradition. Cows of a mature age are tall in withers around 138 cm and the length
of the body is around 155 cm. Bulls are on average tall in withers around 155 cm and can attain 170
cm. On average, they weigh between 1000 and 1200 kg (some examples can attain up to 1400 kg).
Istrian cattle has a coarse physical constitution and strong bone structure, resistant and strong with
great working abilities. Most often, they are light grey to white in colour transitioning to darker grey
tones. The horns are proportionally long in a shape that resembles a lyre. At the roots they are greyish
to yellowish, and from the half way point to the tops they are dark grey to black. The hooves are hard
made with very sturdy keratin, trimmed with black hair. At birth, the calves are often red, although
they can be white to grey. Istrian cattle belongs to a late maturing breed of cattle whose maturity
reaches 6-7 years in age providing the extraordinary possibility for long lasting useage of these
cattle in work. High resistancy, modesty and adaptability to the conditions of the Istrian climate,
gives the possibility to use poorer, marginal pastures and overgrown wooded vegetation which is
the main food source in the time of drought. Today we endeavour to include this breed in sustainable
production based on the meat production as well as autochthonous cheeses (www.hssc.hr; Posavi et
al., 2004 and 2002).
The Buša of Lika was included in the critical breeds category, however, according to the report
from the Croatian Livestock Centre for 2006 (CLC, 2007) it is mentioned as a breed in danger. It
belongs to the group of short-horned cattle - Bos brachyceros europaeus. It belongs to the primitive
(extensive) breed of cattle which can be found in regions where man’s influence on its breeding is
very weak. The Buša of Lika is a tiny cattle with a coarse physical constitution. The height of the
wither is 100 to 110 cm. The cow weighs from 180 to 250 kg and the bull approximately 300 kg. It
is nearly always one colour, from completely bright, brown throughout, prutaste (national name for
buša with concealed, bushy, narrow tiger stripes) red to black colour with stripes on its back which
is in contrast with its basic colour. The horns and hooves are always dark. It is a late maturing cattle.
The first time heifers mate is from 2 years. The calves are tiny, their birth weight is approximately 15
kg. The fertility of the Buša ok Lika is about 85-90%. Female animals remain fertile between 10 to
12 years. They live about 20 years. The Buša of Lika is the result of poor nutrition and little care so
that its milk production is not greater than 700 to 800 litres. The milk is excellent quality because it
15
Buša of Lika
has 4 to 6% milk fat. Lactation lasts about 8 months. The production of meat is poor (55%) because
the Buša is bony and tiny animal. The work ability of the Buša of Lika is modest, but satisfactory for
the extensive agricultural needs of its breeding area. This breed is suitable for individual breeding
in families which are involved in extensive raising and who have modest breeding facilities. Cattle
are held outside in summers and winters, whether they are in the pastures or corrals. Only during the
Slavonian-Syrmian Podolian
coldest winter or in bad weather they are closed in the stables. It is favourable for the economical
production of cattle meat and the production of autochthonous cheeses (www.hssc.hr; Posavi et al.,
2004 and 2002).
The Şlavonian-Syrmian Podolian belongs to the group of long-horned cattle - Bos taurus. At
the beginning of the 20th century it was the most significant and the most representative of cattle
breeds in Croatian regions of Baranja, Syrmia and Slavonia and in the part of Podravina. Today,
most of the animals are raised in The Croatian Centre for Reproduction in Cattle Breeding. It is a
late-maturing, very resistant and perservering cattle with a sturdy skeleton. The height of the cow is
16
approximately 130 cm, while the bulls are approximately 10 cm higher. The colour of the SlavonianSyrmian Podolian is white grey to dark grey, often with dark pigmentation on the lower neck and
head. In bulls, there is noticeable pigmentation, and bigger dark circles around the eyes. The horns
are the main feature of this breed, differing in length, often in a slanted position to the tops which
portrude on the side, with a big span between the tops (lyre-shape). The other type of horns are in
a more vertical position and the tops hooked backwards so these horns have a pitch fork shape. In
the past, this breed of cattle was raised mainly because of work and meat. Milk products range from
800 to 1000 litres in lactation. Today we can regard this breed as an important genetic resource, and
in addition, it is necessary to emphasize its ecological and economic value in producing specific
products - cattle meat and the production of autochthonous cheeses (www.hssc.hr; Posavi et al., 2004
and 2002).
SHEEP
The Pramenka of Dalmatia belongs to the large group of pramenka sheep. This is a Croatian
autochthonous breed of sheep raised in the wider territory of Dalmatia region. It is very resistant,
adaptable to the specific climate conditions (high summer temperatures often accompanied by long
lasting drought) and characterized by its good use of low quality grass. The Pramenka of Dalmatia
represents a very valuable population of sheep, esspecially in territories with difficult economic
conditions (karstic, mountainous terrains, Dalmatian hinterland). Rams have strong horns, while
sheep are generally hornsless. The ears are in a straight position. The fleece is an open end kind with
piercing tufts. The body mass of a sheep is between 30 to 40 kg and the ram is 45-55 kg. It is a late
maturing breed. The colour of the wool is mostly white, although we have a significant percentage
of animals with black colour, and a smaller percentage with brown and grey wool. Fertility is low
(liter size is 1.1). Milk production varies from 50 to 100 kg of milk in a lactation period of 150-180
days. Until age of 120 days weight gain is approximately 170 grams per day. Randement is from 45
to 52%, with high meat quality. Today the Pramenka of Dalmatia is mostly bred for its lamb meat.
Only a small number of sheep are used for milk and cheese production (www.hssc.hr ; Posavi et al.,
2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Cres
Sheep of the Island of Rab
17
Pramenka of Lika
Tsigai (Source: Posavi et al., 2004)
Istrian Sheep
Sheep of the Island of Pag
Ruda Sheep (Dubrovnik Sheep) is breed which is raised on a narrow Croatian coastal belt from
the Pelješac peninsula to the border with Montenegro. It is assumed that breed came into existence
with time in the Republic of Dubrovnik through crossbreeding of domestic pramenka sheep and
merino fine wooled sheep which were imported by sailors from Spain, Portugal and Italy. According
to the colour of the wool, the Dubrovnik Sheep is in 90% of cases white, and rarely black. The
average body mass of the sheep is 30-40 kg, and of rams 42-52 kg. Sheep are in wither height 58-62
cm and rams 62-66 cm. Sheep breeding is mainly extensive and nutrition is based on pasture. Just a
small number of sheep breeders use concentrated fodder for feeding. The remaining heads are raised
exclusively for their meat products (lamb). Sheep fertility is 120-150%, the body mass of lambs of
30-45 days old weigh 12-15 kg, in a period of 3-4 months the body weight is 25-30 kg. Currently the
Dubrovnik sheep is one of the most endangered of all indigenous breeds of sheep in the Republic of
Croatia (www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2003 and 2000).
18
Sheep of the Island of Cres have origins and are raised on the islands Cres and Lošinj. Based
on the environment the Sheep of the Island of Cres is small, quite lively and rather resistant. The
torso of the Sheep of the Island of Cres is middle length and height, rather well built with some
thinner, longer but distinctively strong legs adapted to the difficult rocky terrains on the island Cres.
The height of the withers of the sheep is approximately 60-65 cm and for rams 63-70 cm. The body
mass of the sheep is approximately 33-40 kg and of the rams about 50 kg. Sheep are with or without
horns, and rams have strong, sturdy and very pronounced horns. They belong to the category of long
tailed sheep. Concerning its production quality the Sheep of the Island of Cres belongs to a group
of breeds with combined production properties. Fertility is 120-150%. The body mass of lambs 3045 days old amounts from 12 to 15 kg. Milk production is 100-150 litres. Annual shear amount per
sheep is 1-1,5 kg and rams from 2 to 3 kg. The lambs of Sheep from Island Cres are highly requested
because of theirs meat quality. (www.hssc.hr; Pavić et al. 2006; Posavi et al., 2004 and 2002; Mioč
et al., 2000).
The Sheep of the Island of Rab is remarkable resistant breed and adaptive to the climate of the
island of Rab (high summer temperatures often accompanied by long lasting drought, bora wind in
winter months). In the sheep profile the nasal bone is slightly prominent and they are often horned.
The fleece is white and half closed. The head and the legs are often white but on the legs, head and
ears there might appear black, brown or grey spots. Sheep lamb one lamb in a litter, rarely two
so the average size of the litter is 1,1 -1,2 lambs. During lactation from 150-170 days the sheep
produces from 80-120 kg of milk. The daily weight gain of lambs aged up to 100 days amounts to
approximately 180 g. Slaughtery utilization of lambs amounts from 45-55% and the quality of the
meat is excellent so it represents a culinary speciality. Today sheep are mainly raised for lamb-meat,
and just a small number of sheep are used for milk production (www.hssc.hr; Posavi et al., 2004 and
2002; Mioč et al., 2006 and 2000).
The Pramenka of Lika is a breed which was developed in the mountainous area of Lika and
Gorski Kotar. It is the most typical type of pramenka in Croatia. This sheep belongs to the group of
medium developed sheep, pronoucedly resistant and adaptive. The Pramenka of Lika is well built
with a strong physical constitution. Sheep have an average weight of 45-55 kg, while rams 65-75 kg.
Usually some have pronounced length rather than body height. The height of the withers in sheep is
62-65 cm, while in rams 67-72 cm. The body ends with a tail which reaches as far as under the ankle
joints. The body is covered in open fleece mixed wool, composed of pointed tufts. Rams are horned,
sheep are mostly hornless. White is the typical colour. Head is spotty with bigger and smaller black
speckles. Milk production during lactation is 120-150 litres. A lamb of 3-4 months reaches a weight
of 20-25 kg ( www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2000 and 1998).
The Istrian Sheep is breed expanded in the wider territories of Istra. Although the origin of this
breed isn’t completely clear, it’s exterior implies the type of mediterranean sheep in which were
left traces by certain Italian breeds, particularly Bergamo sheep. Istrian Sheep are included in the
sturdiest pramenka in Croatia, which is confirmed by the fact that the average mass of sheep reaches
up to 70 kg, and rams up to 100 kg. The height of wither in rams is 82-88 cm and in sheep 76-80
cm. They are well built, with a strong physical constitution and pronounced body length. The head is
mid length with a convex profile line. In many sheep ear agility can be entirely limited inside closed
spiral horns. The fleece covers the upper side of the neck and back, while the stomach, legs and face
are covered in short hair. The body is fundamentally white with spots while the stomach and the
legs are usually entirely black. Sometimes the pigmentation is so pronounced that it looks like its
black foundation. Istrian Sheep belong to the group of sheep with combined meat-milk production
19
characteristics. In the course of lactation from 200 days on average sheep produce about 120 kg of
milk, a smaller number of heads produce even more than 200 kg. The most of breeders of Istrian
Sheep produce hard sheep cheese which is greatly valued on the market. The fertility of the Istrian
sheep is 130-150 %, and the body weight of lambs at the age of 45-60 days is 15-18 kg (www.hssc.
hr; Mikulec et al., 2007; Posavi et al., 2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Pag are raised almost exclusively on the island of Pag. This breed is a
little smaller than other island sheep breeds. The torso is well built, with middle pronounced width
and depth. Sheep have an average body weight of 30-40 kg and rams 50 kg or more. The height of
wither in sheep is 57-60 cm, and in rams 59- 63 cm. They are mainly white and in approximately 2%
of cases they appear in a black colour, and that individuals are rarely remaining for breeding. Sheep
are mainly hornless while rams are mostly horned, though there are some without horns. Because the
back is not much higher than the withers, the back line lightly climbs towards the back. The body is
well covered with wool. The fleece is closed to half closed. The legs are sturdy. The length of the tail
reaches under the ankle joint. Fertility is approximately 120%. Lambs suckle until 30 days. The birth
weight of lambs is about 3 kg. The body mass of lambs 30-45 days old is 12-15 kg. After the suckling
period sheep are milked about 5 months so that the average length of lactation is about 180 days,
and in that time Sheep of the Island of Pag produce from 80 to 150 litres of milk. The fundamental
production goal in breeding Sheep of the island of Pag is the production of milk and well known
cheese. A special place on the Croatian market is also reserved for the high quality lamb meat. (www.
hssc.hr; Sušić et al., 2006a; Pavić et al., 2005; Posavi et al., 2004 and 2002; Mioč et al., 2000).
The Tsigai is one of the oldest breeds which was created in the Middle East from where it
expanded into the Balkan peninsula and in certain parts of Europe. In Croatia it is bred in regions of
Slavonia and Barania. It is a large breed, with a well built body and a strong physical constitution.
The average height in sheep amounts to 60-76 cm while 70-85 cm in rams. Rams have a prominent
profile. Sheep are hornless and rams may have horns. The ears are big and often slouching. The head,
ears and legs are black. At birth the lamb is a grey mouse colour. With time this colour is lost, so
that at the age of 4 months the lamb gets white coloured wool, except for grey-born lambs which are
mostly black and rarely variegated. The Tsigai is a breed of combined production characteristics - for
meat, milk and wool production. Adult sheep weigh 50-65 kg and rams 70-100 kg. Although during
lactation the Tsigai can give up to 120 litres of milk, today it is bred exclusively for the production of
lamb-meat. Fertility is 140-180%, and the weight gain of lambs of 3-4 months amounts to 30-35 kg
(www.hssc.hr; Posavi et al., 2004 and 2002; Mioč et al., 2000).
Sheep of the Island of Krk is breed especially resistant, adaptive to the climate on the island of
Krk (high summer temperatures often accompanied by long lasting drought, bora wind in the winter
months). It is a smaller sheep, but proportional with a sturdy build. It is lively and resistant. The sheep
are most often white, rarely black, grey or brown. The head of the sheep is small, with a straight
profile and hornless. In rams the nasal bone profile is pronounced and they are often horned. The
fleece is half closed to closed. The head and the legs are most often white but on the legs, heads and
ears can appear black, brown or grey spots. These sheep most often lamb one lamb in a litter, rarely
two, so the average size of the litter is 1,1-1,2 lambs. During lactation from 150 to 170 days sheep
produce from 90 to 120 kg of milk. Aged up to 100 days, the average daily weight gain amounts to
about 180 g. Randement of slaughterd lambs amounts to approximately 45%, the meat quality is
excellent and represents a culinary speciality. Sheep of the Island of Krk are mostly raised today for
their lamb-meat which is highly regarded on the Croatian market („Lamb from the island of Krk“). A
small number of sheep are used for milk production, although there is growing interest in the market
20
for hard sheep cheeses („Sheep cheese from the island of Krk“) (www.hssc.hr; Posavi et al., 2004 and
2002; Mioč et al., 2004 and 2000).
GOAT
The Croatian variegated goat is characterized by its resistance and adaptability to difficult
available passages and difficult karst terrains. The average body weight amounts to 30-40 kg in
females and to 40-60 kg in males. The body is covered with long, thick and shiny hair of different
colours. The horns are dark, coarse and dull and grow behind like a sabre. Breeding of Croatian
varietgated goats is organized primarily in extremely extensive conditions. Goat fertility on average
amounts to 100% and in some flocks it can be 20-30% twins. The average milk production is about
100 l during lactation from 150-200 days. At present time the major production goal for breeders of
Croatian varieated goat is meat (www.hssc.hr; Posavi et al., 2004 and 2002).
Besides Croatian variegated goat, there is also the Croatian white goat, but this population is not
introduced as a breed in the National Register, nor does it exist in the FAO’s reports of endangered
autochthonous breeds. Basic characteristics of this population are resistance, adaptability, modesty,
agility, liveliness and persistance. Goats are white, sometimes cream to a light yellowish colour. They
are raised primarly because of the meat. The main breeding regiones are territories with difficult
economic conditions (mountain karstic terrains, Dalmatian hinterland, islands) similar to the Croatian
variegated goat. The average body mass of an adult female is between 40-60 kg while the male is 5070 kg, depending on the environmental conditions, mostly feeding. Goats have good fertility, early
maturity, most often give birth to twins, so the average fertility is from 160-180 %. During lactation
from 250 to 280 days they produce 250 to 300 kg of milk, and the average daily weight gain of kids
is about 180 g (www.hssc.hr; Posavi et al., 2004 and 2002).
Croatian variegated goat (Source: Posavi et al.,
2004)
Croatian white goat (Source: Posavi et al., 2004)
Financial Subsidies
It is clear fact that the production capacity of autochthonous breeds is relatively low and that those
populations cannot be competitive with other high productive breeds and/or crossbreeds concerning
the conditions of conventional livestock production. Taking into consideration that the protection of
autochthonous domestic animal breeds are special interest, the Republic of Croatia insured financial
21
resources for their breeding. Those financial resources are used for paying breeders/owners through
subsidies (Dadić and Jakopović, 2007).
Subsidies in Croatian livestock production can be divided into three fundamental groups:
subsidies in conventional production (in milk production, for fattening cattle, for breeding cattle…),
then subsidies in ecological production and subsidies for the breeding of autochthonous and protected
breeds. The legal regulations for subsidies in cattle production is based on the Law of the country
subsidiary in agriculture, fishery and forestry (NN 87/02; NN 117/03; NN 82/04; NN 12/05; NN
85/06; NN 141/06 - MPŠVG 2002, 2003, 2004, 2005 and 2006) and the Regulation of manners and
conditions concerning the implementation of the production subsidies model (NN 17/07 - MPŠVG,
2007) (Dadić and Jakopović, 2007; www.hssc.hr).
Table 3: Paid subsidies for Croatian autochthonous ruminant breeds during the year 2006
(Source: www.hssc.hr)
Breed
Istrian cattle
Buša of Lika
Slavonian Syrmian Podolian cattle
Istrian sheep
Sheep of the island of Cres
Sheep of the island of Pag
Ruda Sheep
Pramenka of Lika
Pramenka of Dalmatia
Tsigai
Sheep of the island of Rab
Croatian variegated goat
Number of
heads
613
141
141
1849
593
1620
265
1997
164
294
668
200
Sum Total
Kunas
2.431.500
603.000
550.500
647.150
207.550
567.000
139.125
698.950
57.400
102.900
233.800
70.000
≈ Euros
≈ 334.500
≈ 83.000
≈ 76.000
≈ 89.000
≈ 29.000
≈ 78.000
≈ 19.000
≈ 96.000
≈ 8.000
≈ 14.000
≈ 32.000
≈ 10.000
≈ Euros per
head
≈ 550
≈ 600
≈ 550
≈ 50
≈ 50
≈ 50
≈ 70
≈ 50
≈ 50
≈ 50
≈ 50
≈ 50
Conclusion
The most rational strategies for the protection of autochthonous ruminant breeds are to ensure
that they evolve or that they remain as a functional part of the production system. Therefore, in
their economic assessment we have to take into consideration some specific factors which give
them preference in comparison with high productive breeds. Those factors are: genotype diversity,
environment adaptation, socio-cultural contributions in heritage as well as production of some
autochthonous products or some other unique use (Kuterovac et al., 2001; Rege, 1999; WWL-DAD
3, 2000). Also, breeding and production of autochthonous ruminant breeds can be opportunity to
increase market and tourist offer (national parks, eco-villages…) (Sušić et al., 2001; Horvath, 1996).
In this way, a part of Croatian future agriculture could be based on raising autochthonous breeds in
an ecologically acceptable manner, within sustainable production systems, in order to gain optimal
results as well as to protect biological diversity.
Reference:
1. Barać, Z., B. Mioč, V. Pavić, V. Sušić (2007): Uzgoj izvornih pasmina ovaca i koza u Republici Hrvatskoj.
Konferencija o izvornim pasminama i sortama kao dijelu prirodne i kulturne baštine. Šibenik, 13. - 16.
studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 12-13.
22
2. Bulić, V., A. Ivanković, Z. Ivkić, M. Špehar, N. Kelava, M. Konjačić (2007): Stanje i odlike izvornih
pasmina goveda u Hrvatskoj. Konferencija o izvornim pasminama i sortama kao dijelu prirodne i kulturne
baštine. Šibenik, 13. - 16. studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 41-42.
3. Croatian Livestock Centre - CLC (2007): Annual Report for 2006. Zagreb.
4. Dadić, M., I. Jakopović (2007): Zakonske odrednice uzgoja izvornih i zaštićenih pasmina i sojeva domaćih
životinja u Republici Hrvatskoj. Konferencija o izvornim pasminama i sortama kao dijelu prirodne i
kulturne baštine. Šibenik, 13. - 16. studenog 2007. Knjiga sažetaka (Radna verzija), Zagreb, 67-70.
5. DZZP - Državni zavod za zaštitu prirode, Ministarstvo kulture RH / State Institute for Nature Protection,
Ministry of Culture (2006): Biodiversity of Croatia.
6. Ekert Kabalin, A., I. Štoković (2007): Očuvanje hrvatskih izvornih pasmina. Drugi kongres studenata
veterinarske medicine s međunarodnim sudjelovanjem. Zagreb, 13. - 16. lipnja, 2007. Zbornik, Zagreb,
19-20.
7. FAO (2005): Options and Srategies for the Conservation of Farm Animal Genetic Resources. FAO
international workshop from 7th to 10th November 2005. (http://www.fao.org/ag/againfo/subjects/en/
genetics/documents/ITCMTGSWI/fagr.pdf), Montpellier, France.
8. Henson, Elizabeth L. (1992): In situ conservation of livestock and poultry. FAO animal production and
health paper 99,Rome, FAO and UNEP, 1992.
9. Horvath, Š. (1996): Hrvatske baštinjene pasmine. Pokret prijatelja prirode “Lijepa naša”. Zagreb.
10. Kuterovac, K., A. Kljujev, M. Janeš, A. Pezo, K. Sinković, Z. Nushol, M. Dražić (2001): Zaštita i očuvanje
raznolikosti domaćih životinja u Hrvatskoj. Biološka raznolikost u stočarstvu Republike Hrvatske, Zbornik
radova, 13.-27. HAZU, Zagreb.
11. Mikulec, D., Pavić, V., Sušić, V., Mioč, B., Mikulec, K., Barać, Z., Prpić, Z., Vnučec, I. (2007) Odlike
vanjštine različitih kategorija istarskih ovaca
12. Mioč, B., Ivanković, A., Pavić, Vesna, Barać, Z., Sinković, Karmen, Marić, I. (2003): Odlike eksterijera i
polimorfizmi proteina krvi dubrovačke ovce. Stočarstvo 57 (1), 3-11. Stočarstvo. 61 (1), 13-22.
13. Mioč, B., Pavić V., Barać, Z. (1998): Odlike eksterijera ličke pramenke. Stočarstvo 52 (1): 93-98.
14. Mioč, B., Pavić, V. and Ivanković, A. (2000): Tipovi i pasmine ovaca i koza u Republici Hrvatskoj.
Stočarstvo 54 (1): 56-61.
15. Mioč, B., Pavić, V., Barać, Z., Sušić, V., Prpić, Z., Vnučec, I., Mulc, D. (2006): Vanjština rapske ovce.
Stočarstvo. 60 (3); 163-171.
16. Mioč, B.; Pavić, V.; Ivanković, A.; Barać, Z.; Vnučec, I.; Čokljat, Z. (2004): Odlike eksterijera i polimorfizmi
proteina krvi krčke ovce. Stočarstvo. 58, (5) 331-341.
17. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (1998, 2003, 2006, 2007): Popis
izvornih i zaštićenih pasmina i sojeva domaćih životinja. Izmjene i dopune popisa izvornih i zaštićenih
pasmina i sojeva domaćih životinja te njihov potrebni broj. NN 127/98, 73/03, 39/06, 126/07.
18. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (2002, 2003, 2004, 2005, 2006):
Zakon o državnoj potpori u poljoprivredi, ribarstvu i šumarstvu. Izmjene i dopune Zakona o državnoj
potpori u poljoprivredi, ribarstvu i šumarstvu. NN 117/03, 82/04, 12/05, 85/06, 141/06.
19. MPŠVG - Ministarstvo poljoprivrede šumarstva i vodnog gospodarstva (2007): Pravilnik o načinu i
uvjetima provedbe modela poticanja proizvodnje. NN 17/07.
20. Pavić, V., Mioč, B., Sušić, V., Barać, Z., Vnučec, I., Prpić, Z., Čokljat, Z. (2006): Vanjština creske ovce.
Stočarstvo. 60 (1); 3-11.
21. Pavić, Vesna, B. Mioč, Z. Barać, I. Vnučec, V. Sušić, N. Antunac, Dubravka Samardžija (2005): Vanjština
paške ovce. Stočarstvo 59 (2): 83-90.
23
22. Posavi, M., R. Ozimec, M. Ernoić, F. Poljak (2004): Enciklopedija hrvatskih domaćih životinja. Katarina
Zrinski d.o.o., Varaždin.
23. Posavi, M., M. Ernoić, R. Ozimec, F. Poljak (2002): Hrvatske pasmine domaćih životinja. Ministarstvo
zaštite okoliša i prostornog uređenja, Zagreb.
24. Posavi, M., M. Ernoić, R. Ozimec, F. Poljak (2001): Hrvatske izvorne pasmine domaćih životinja.
Veterinarski dani 2001. Znanstveno-stručno savjetovanje s međunarodnim sudjelovanjem. Opatija, 17.-19.
listopada 2001. Zbornik, Zagreb, 187-189.
25. Rege, J. E. O. (1999): Economic valuation of farm animal genetic resources. Proceedings of an FAO/ILRI
Workshop, 25.-27., Rim.
26. Štoković, I., A. Ekert Kabalin, V. Sušić, I. Karadjole, T. Balenović, A. Kostelić (2007a): Zaštita zdravlja i
rizici u in situ modelima očuvanja ugroženih izvornih pasmina domaćih životinja. Konferencija o izvornim
pasminama i sortama kao dijelu prirodne i kulturne baštine. Šibenik, 13. - 16. studenog 2007. Knjiga
sažetaka (Radna verzija), Zagreb, 261-264.
27. Štoković, I., A. Ekert Kabalin, V. Sušić, I. Karadjole, T. Balenović, A. Kostelić, S. Menčik (2007b): Zaštita
zdravlja, zakonska regulativa i rizici u očuvanju izvornih pasmina domaćih životinja. Stočarstvo 61 (6):
481-487.
28. Sušić, V., A. Ekert Kabalin, I. Karadjole, T. Balenović, I. Štoković, Igor (2006a): Paška ovca. IV. simpozij
poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i Hercegovina. (poster).
29. Sušić, V., A. Ekert Kabalin, I. Štoković, I. Karadjole, T. Balenović (2006b): Hrvatske izvorne pasmine
domaćih životinja. IV. simpozij poljoprivrede, veterinarstva, šumarstva i biotehnologije. Zenica, Bosna i
Hercegovina. (pozvano predavanje).
30. Sušić, V., T. Balenović, I. Martinić, D. Katica, I. Štoković, A. Ekert Kabalin (2001): Hrvatske autohtone
pasmine domaćih životinja. Veterinarski dani 2001. Znanstveno-stručno savjetovanje s međunarodnim
sudjelovanjem. Opatija, 17.-19. listopada 2001. Zbornik, Zagreb, 177-186.
31.WWL-DAD:3 (World watch list for domestic animal diversity), 3rd edition. Ed. Beate D. Scherf FAO,
Rome, 2000.
32. ...www.hssc.hr - Croatian Livestock Centre - CLC web page - accessed March 15., 2008.
24
brief review of the state of the art in assisted
reproduction in small ruminants
Situación actual de las técnicas de reproducción
asistida en pequeños rumiantes
Aktualni status postupaka asistirane reprodukcije
malih preživača
Antonio Gonzalez-Bulnes, Claudia A. Letelier, Ignacio Contreras-Solís, Juraj Grizelj
Departamento de Reproducción Animal, INIA. Avda. Puerta de Hierro s/n, 28040-Madrid, Spain.
Faculty of Veterinary Medicine
Abstract
The use of assisted reproduction techniques is crucial for the improvement of productive yields in small
ruminants, either applying artificial insemination or embryo transfer or combining both techniques; a previous
oestrus synchronization is always necessary. Current work is a brief review of the state of the art in assisted
reproduction in small ruminants.
Sažetak
Korištenje postupaka asistirane reprodukcije ključno je za poboljšanje produktivnosti malih preživača, bilo
korištenjem umjetnog osjemenjivanja (U.O.) ili embriotransfera (ET), bilo kombiniranjem obaju tehnika; uz
uvijek neophodnu prethodnu sinkronizaciju estrusa. Ovaj rad predstavlja skraćeni pregled spoznaja iz područja
asistirane reprodukcije malih preživača.
Introducción
Ovino y caprino son especies tradicionalmente importantes en el área Mediterránea. Los
pequeños rumiantes, desde un punto de vista social, favorecen la producción de productos de primera
necesidad, a un coste menor que otras especies, y permiten el mantenimiento de las actividades
agrarias en zonas desfavorecidas; desde un punto de vista medioambiental permiten la utilización
de los recursos naturales mediante la explotación de los recursos pastables, facilitan la conservación
del medio gracias al aprovechamiento de zonas de matorral, limpiando las zonas de explotación y
evitando la propagación de incendios. En el esquema de producción actual, los pequeños rumiantes
tienen un tercer papel, la elaboración de productos de calidad, de origen natural y con posibilidades
de competir en el mercado frente a productos similares. Este sistema debe partir de razas susceptibles
de aportar buenos rendimientos en las condiciones ambientales y de manejo de cada país, de cada
región y de cada explotación. A partir de ello, la aplicación de programas de manejo reproductivo y
de selección y mejora genética es básica para conseguir un aumento de las producciones.
Las técnicas de manejo reproductivo y de reproducción asistida pueden ser dirigidas al macho,
inseminación artificial, o a la hembra, producción y transferencia de embriones. Ambas técnicas
permiten la optimización de la eficiencia reproductiva y, en el caso de los programas de selección y
mejora genética, el testaje de los reproductores mediante pruebas de progenie, posibilitando con ello
la disponibilidad de genealogías paternas y/o maternas, la difusión amplia y rápida de los caracteres
mejorantes y la conexión entre los rebaños adscritos al sistema de selección. Ambas pueden ser
25
combinadas, y ambas exigen previamente la inducción y sincronización del celo y la ovulación en
las hembras. Sus procedimientos, rendimientos y la influencia de factores intrínsecos, principalmente
genéticos, y extrínsecos, derivados de factores medioambientales y de manejo, son revisados en el
presente manuscrito.
Inducción y sincronización de celos y ovulaciones
El control del momento de aparición del celo y la ovulación es esencial para un adecuado manejo
de la reproducción tanto en ovejas como cabras. Esta acción permite inducir el periodo de partos en
la época más adecuada para el ganadero, aumentando la eficiencia reproductiva del rebaño. Y lo que
es más, la sincronización de celos es indispensable para ser aplicado previamente a la inseminación
artificial y/o la transferencia de embriones.
La sincronización de celos es comúnmente realizada mediante la administración de progesterona,
o sus derivados, y eCG (gonadotropina coriónica equina). Los tratamientos progestativos disminuyen
la pulsatilidad de LH a valores similares a una fase luteal, evitando la ovulación de los folículos
de tamaño preovulatorio; la retirada del progestágeno, junto a la administración de eCG, induce la
aparición de una fase folicular, del celo y la ovulación.
La progesterona o los progestágenos pueden ser aplicados por vía oral, intramuscular, subcutánea
e intravaginal. Sin embargo, su uso en la práctica está restringido a la aplicación vaginal, en esponjas
de poliuretano impregnadas con un progestágeno (Robinson, 1967); los más comúnmente utilizado
son el FGA (acetato de fluorogestona) y el MAP (acetato de medroxiprogesterona), con una
eficacia similar (Steffan et al., 1982). La progesterona puede ser aplicada también en dispositivos
intravaginales (CIDR, Rhodes et al., 1988).
En ovejas, los dispositivos intravaginales son mantenidos entre 12 y 14 días (Robinson, 1965), para
sobrepasar la vida activa de un posible cuerpo lúteo. En cabras, las esponjas pueden ser mantenidas
por 16 días (tratamiento largo, Armstrong et al., 1982); pero una duración tan larga puede causar
vaginitis y otros problemas y, así, el protocolo más utilizado es la combinación de un progestágeno
por 11 días y una dosis de prostaglandina F2α para lisar un posible cuerpo lúteo (Corteel et al., 1988).
La eCG se inyecta en el momento de la retirada de la esponja, con el objetivo tanto de favorecer un
mayor número de folículos preovulatorios como de inducir la ovulación. La dosis de eCG es también
crucial; la dosis media en ovejas es 500 UI, pero varía desde 250 a 600 UI, dependiendo de la raza,
edad, estación del año y estado fisiológico (Cognie et al., 1970; Evans y Robinson, 1980).
Sin embargo, la sincronización de celos con progestágenos tiene varios inconvenientes. En primer
lugar, las tasas de concepción son menores que en celo natural. Esta disminución en la fertilidad se
ha relacionado, en la oveja, con anomalías en el transporte espermático y su supervivencia en el
tracto reproductivo femenino (Hawk y Conley, 1971), alteraciones en los patrones de secreción de
LH (Scaramuzzi et al., 1988) y calidad de las ovulaciones (Killian et al., 1985). Las posibles causas
parecen estar relacionadas con deficiencias en la secreción de esteroides durante el desarrollo folicular
preovulatorio (Gonzalez-Bulnes et al., 2005a). En cabras, el uso de eCG también contribuye a los
fallos en fertilidad debido a que induce la producción de anticuerpos, lo que disminuye la fertilidad de
sucesivos tratamientos. Finalmente, el aumento de la regulación internacional en material de residuos
químicos, que ha causado la prohibición de su uso en Estados Unidos o una fuerte restricción en los
límites máximos de residuos permitidos en la Unión Europea.
La sincronización de celos en pequeños rumiantes puede ser obtenida, en razas no estacionales o
durante la época reproductiva en animales estacionales, mediante la inducción de luteolisis controlada
por la administración de dos dosis de prostaglandina F2a, o sus análogos, separados 9–11 días (Nuti
26
et al., 1992). Este tratamiento es efectivo para sincronizar celos en estación sexual, con más del 90%
de las hembras mostrando sintomatología de celo (Greyling, 1996), pero la fertilidad es menor que
con progestágenos (67% vs 80%) (Kusina et al., 2000). Las posibles causas de esta disminución
no son bien conocidas. Estudios en ovejas (Boland et al., 1978), indican posibles alteraciones en
la dinámica de crecimiento de los folículos preovulatorios y/o el momento de ovulación (Barret
et al., 2002). Estudios en cabras indican que el momento de la fase luteal afecta la respuesta de las
cabras a la inducción de celos con prostaglandinas. Los tratamientos con prostaglandinas se inyectan
con un intervalos de 9-11 días; así, la mayoría de los animales estarán en mitad de la fase luteal
en el momento de la segunda inyección. Esto asegura que todos los animales ovularán de forma
sincronizada. Sin embargo, este sería el peor momento para el tratamiento, considerando la dinámica
folicular; el mejor momento sería temprano en la fase luteal. Así, hay un mayor número de hembras
con síntomas de celo, una aparición más temprana de esta sintomatología y un mayor número de
animales respondiendo con ovulaciones en cabras tratadas en fase luteal temprana (GonzalezBulnes et al., 2005b). En cabras, como en otros rumiantes, la mayoría de los folículos en la primera
onda de crecimiento están en estado creciente (ver la revisión de Rubianes y Menchaca, 2003). El
número de ondas foliculares y el día de emergencia de los folículos es muy variable entre animales e
impredecible (Ginther y Kot, 1994; de Castro et al., 1999; Gonzalez-Bulnes et al., 1999; Menchaca
y Rubianes, 2002). Así, algunos de los folículos más grandes están en crecimiento en los días 11 y
16, pero otros están estáticos o en regresión (Gonzalez-Bulnes et al., 2005b). Esta alta variabilidad
individual causa una pérdida total de sincronización de la segunda y sucesivas ondas foliculares; lo
que interfiere con la fertilidad.
Inseminación Artificial
Actualmente, el uso de la inseminación artificial (IA) es ineludible en programas de selección
genética, ya sea para leche, lana o carne. El uso de la IA se desarrolló fuertemente en Australia en
la década de 1970, en ovejas de lana, de forma similar a como se realizaba en novillas lecheras,
inseminando entre 15 y 17 horas después de la detección de celos (Lightfoot y Salamon, 1970). La
aplicación de tratamientos progestativos, diseñados en el mismo país a finales de 1960 y principios
de los 70 fue muy importante para el desarrollo de la IA, debido a la posibilidad de inseminar en
tiempo prefijado sin detección de celos, 55-56 horas después de la retirada del progestágeno, con una
fertilidad del 50% (Colas y Brice, 1970). En cabras, la inseminación debe ser aplicada antes, 46-47
horas después de la retirada de la esponja.
El uso combinado de IA y progestágenos permite el uso de semen refrigerado a 15ºC, con dosis
no menores de 400 x 106, con una fertilidad de aproximadamente el 50% (Fieni et al., 1992). En
cabras, la estructura anatómica del cérvix permite una deposición del semen más profunda, incluso
en el útero, en un 30-50% de las hembras, así, la fertilidad puede alcanzar el 70% (Amoah y Gelaye,
1997). Las tasas de fertilidad obtenidas estarán determinadas por la viabilidad de los espermatozoides
(Hawk y Conley, 1971) y el intervalo entre la ovulación y la deposición del semen (Signoret y
Cognie, 1975).
El uso de semen congelado está dificultado en ovejas por la imposibilidad de traspasar el cérvix;
en cabras, es posible alcanzar un 40% de fertilidad. El desarrollo de la IA mediante laparoscopía
(IAL) por Killeen y Caffrey (1982), permitió depositar el semen en el interior del útero y, así, un
significativo incremento en las tasas de fertilidad con semen congelado. El uso de IAL con semen
refrigerado es también beneficioso, ya que aumenta la fertilidad usando dosis con menor número de
espermatozoides.
27
Desde un punto de vista técnico, en el uso de IAL, es importante asegurar la deposición del
semen en el interior del útero y no en la pared uterina, evitar el uso de anestesia que puede interferir
con la ovulación (Radford, 1966), y distribuir la mitad de cada dosis en cada cuerno uterino, evitando
la exteriorización de los ovarios (McKelvey et al., 1985).
Superovulación y transferencia de embriones
Si la IA es la técnica de elección para maximizar el progreso genético a partir del macho, la
tecnología de embriones es la técnica para realizarlo usando la hembra. En esencia, la superovulación
consiste en la administración de altas dosis de productos comerciales de FSH para estimular el
crecimiento de un alto número de folículos preovulatorios y, así, un alto número de oocitos para la
producción in vitro de embriones o un alto número de ovulaciones para la producción in vivo.
Actualmente, los protocolos para producción de embriones in vivo aplicados en nuestro grupo en
ganado caprino consisten en la sincronización de celos con la aplicación de 45mg de FGA durante
16 días, combinada con una dosis única de 0.4ml de cloprostenol en la primera inyección de FSH;
el tratamiento superovulatorio consiste en 8 dosis de 1.25ml de FSH ovina (OvagenTM, ICP, NZ), a
intervalos de 12h. El uso de este protocolo permite una media de 14.3 cuerpos lúteos, 11.3 embriones
recuperados y 6.8 embriones viables por cabra superovulada. En ovejas, el protocolo es similar,
excepto que las dosis son decrecientes (1.5mLx3; 1.25mLx2; 1mlx3); el número medio de cuerpos
lúteos es 15.9, con una media de 13.5 embriones recuperados y 7.0 embriones viables por hembra
(Gonzalez-Bulnes et al., 2004).
Sin embargo, los rendimientos están limitados por una alta variabilidad en la respuesta ovárica
a los tratamientos superovulatorios necesarios para incrementar el número de embriones, por
alteraciones en los procesos de fertilización y en la viabilidad de los embriones durante los estadios
tempranos de desarrollo.
Aktualni status postupaka asistirane reprodukcije malih preživača
Uvod
Ovce i koze su tradicionalno važne vrste u području Sredozemnog bazena. Mali preživači, sa
socijalnog gledišta, omogućuju proizvodnju primarnih proizvoda uz manji trošak nego ostale vrste
te omogućuju poljoprivrednu aktivnost u područjima s nepovoljnim uvjetima. S gledišta okoliša,
mali preživači omogućuju iskorištavanje prirodnih dobara putem korištenja pašnjaka, oni olakšavaju
očuvanje okoliša zahvaljujući iskorištavanju šipražja, krčeći takova područja te na taj način ujedno
smanjuju i mogućnost pojave požara.
U smislu suvremene proizvodnje, mali preživači imaju novu ulogu, a to je produkcija kvalitetnih
proizvoda, prirodnog podrijetla, spremnih za tržišnu utrku sa sličnim proizvodima. Takav sustav
kreće od odgovarajućeg pasminskog odabira koji može ostvariti dobre prinose u datim prirodnim
okolnostima i načinima uzgoja u svakoj pojedinoj zemlji ili području te napose tipu iskorištavanja.
Krenuvši od toga, primjena reproduktivnih i selekcijskih programa te genetskog unaprijeđenja
predstavlja temelj ostvarenja veće proizvodnje.
Tehnologija upravljanja reprodukcijom i postupci asistirane reprodukcije, mogu biti orijentirani
prema mužjaku (umjetno osjemenjivanje) ili prema ženki (proizvodnja i transfer zametaka). Obje
tehnike omogućuju optimizaciju reproduktivne učinkovitosti te, u slučaju selekcijskih programa
i genetskog unaprijeđenja, testiranje takovih rasplodnih potencijala putem progenih testova,
28
omogućujući tako poznavanje podrijetla matera i očeva, široku i brzu difuziju poželjnih osobina
i vezu između stada uključenih u sustav selekcije. Obje tehnike mogu biti kombinirane, a svaka
zahtijeva predhodnu indukciju estrusa te sinkronizaciju estrusa i ovulacije u ženki. Njihovi postupci,
rezultati i utjecaj unutarnjih čimbenika (primarno genetskih) te vanjskih (proizašli iz okoliša i uzgoja),
tema su ovog rada.
Indukcija i sinkronizacija estrusa i ovulacije
Kontrola trenutka pojave estrusa i ovulacije temelj je adekvatnog upravljanja reprodukcijom u
ovaca i koza. Ovaj postupak omogućuje poticanje razdoblja janjenja i jarenja u razdoblju kada je to
stočaru najpoželjnije, povećavajući tako reproduktivnu učinkovitost stada. I ne samo to, sinkronizacija
estrusa neophodna je za provođenje umjetnog osjemenjivanja i embriotransfera.
Sinkronizacija estrusa uobičajeno se provodi aplikacijom progesterona ili njegovih derivata i
eCG-a (konjski korionski gonadotropin). Progestagenski postupak smanjuje pulsatorno izlučivanje
LH na vrijednosti slične onima u lutealnoj fazi ciklusa, spriječavajući tako ovulaciju preovulatornih
folikula. Vađenje progestagena, uz istodobnu aplikaciju eCG-a inducira pojavu folikularne faze
ciklusa, estrus i ovulaciju.
Progesteron ili progestageni mogu se aplicirati peroralno, intramuskularno, subkutano te
intravaginalno. Ipak, njegovo korištenje je u praksi ograničeno na vaginalnu aplikaciju, u vidu
poliuretanskih spužvica impregniranih nekim progestagenom (Robinson, 1967). Najčešće se koriste
FGA (fluorogeston acetat) i MAP (medroksiprogesteron acetat) sa sličnom učinkovitošću (Steffan
i sur., 1982). Progesteron može biti korišten i u vidu intravaginalnih spirala (CIDR, Rhodes i sur.,
1988).
U ovaca se takovi intravaginalni umetci postavljaju na razdoblje od 12 do 14 dana (Robinson,
1965) kako bi vremenski nadmašili razdoblje aktivnosti žutog tijela koje se možda u tom trenutku
nalazi na jajniku.
U koza se pak spužvice mogu držati i 16 dana (dugi tretman; Armstrong i sur., 1982); ali u tom
slučaju moguća je pojava vaginitisa i drugih problema pa se zato koristi protokol koji kombinira
aplikaciju progestagena kroz 11 dana i jednokratnu aplikaciju prostaglandina F2α koji će dovesti do
lize eventualno prisutnog žutog tijela (Corteel i sur., 1988).
Injekcija konjskog korionskog gonadotropina (eCG) se aplicira paralelno sa vađenjem spužvice,
s ciljem kako nastanka većeg broja preovulatornih folikula, tako i indukcije ovulacije. Doziranje
eCG-a je od odlučujuće važnosti; prosječna doza u ovaca je 500 i.j., ali varira od 250 do 600 i.j.,
ovisno o pasmini, dobi životinje, razdoblju godine i fiziološkom statusu (Cognie i sur., 1970; Evans
y Robinson, 1980).
Ipak, sinkronizacija estrusa progestagenskim preparatima ima i svoje nedostatke. Na prvom
mjestu svakako je niža stopa koncepcije, nego što je slučaj u spontanom, prirodno nastalom estrusu.
Navedeno smanjenje plodnosti povezuje se u ovaca, sa anomalijama u transportu spermija i njihovom
preživljavanju u reproduktivnom traktu (Hawk i Conley, 1971), promijenjenim modelom sekrecije
LH (Scaramuzzi i sur., 1988) i kvalitetom ovulacije (Killian et al., 1985). Mogući uzroci čini se da su
povezani sa manjkavostima u sekreciji steroida tijekom razvoja preovulatornih folikula (GonzalezBulnes i sur., 2005a).
U koza pak, korištenje eCG-a također doprinosi smanjenoj plodnosti zbog indukcije nastanka
antitijela koji umanjuju učinkovitost sljedećih tretmana. Konačno, pooštrena je međunarodna
29
legislativa vezano uz kemijske rezidue, što je dovelo do njegove zabrane korištenja u SAD-u te do
jake restrikcije maksimalno dozvoljenih granica rezidua u Europskoj Uniji.
Sinkronizacija estrusa se u malih preživača može ostvariti kod nesezonalnih pasmina ili tijekom
trajanja sezone spolne aktivnosti u sezonalnih životinja, inukcijom luteolize aplikacijom dvaju doza
prostaglandina F2α ili njihovog analoga, u razmaku od 9-11 dana (Nuti i sur., 1992). Ovaj je postupak
učinkovit u sinkroniziranju estrusa tijekom trajanja sezone spolne aktivnosti, sa više od 90% ženki
koje pokazuju znakove estrusa (Greyling, 1996), ali je plodnost niža u odnosu na postupke koji
uključuju progestagene (67% nasuprot 80%) (Kusina i sur., 2000). Mogući uzroci ovoga smanjenja
nisu posvema poznati. Istraživanja u ovaca (Boland i sur., 1978) ukazuju na moguće promjene u
dinamici rasta preovulatornih folikula i trenutak pojave ovulacije (Barret i sur., 2002). Studije na
kozama su pokazale da odgovor koza na indukciju estrusa prostaglandinima ovisi o razdoblju lutealne
faze u kojoj je tretman obavljen. Tretman prostaglandinima odvija se dvostrukom aplikacijom istih, u
razmaku od 9-11 dana; na taj način većina životinja će biti u sredini lutealne faze u trenutku aplikacije
druge injekcije. To će osigurati da sve životinje ovuliraju u isto vrijeme. Ipak, to je najgori trenutak
za tretman s gledišta folikularne dinamike. Najbolji bi trenutak bio tijekom rane lutealne faze što bi
dovelo do većeg broja koza sa simptomima estrusa, ranije pojave estrusa i većeg broja životinja koje
će ovulirati (Gonzalez-Bulnes i sur., 2005b).
U koza, kao i u ostalih preživača, većina folikula u prvom valu folikularnog rasta nalazi se
u fazi rasta (Rubianes y Menchaca, 2003). Broj folikularnih valova i dan pojave folikula veoma
varira između životinja i nepredvidiv je (Ginther i Kot, 1994; de Castro i sur., 1999; GonzalezBulnes i sur., 1999; Menchaca i Rubianes, 2002). Na taj način, samo su neki od najvećih folikula
11. i 16. dana ciklusa u rastu, dok su ostali statični ili u regresiji (Gonzalez-Bulnes i sur., 2005b). Ta
visoka individualna varijabilnost svih folikularnih valova, osim prvog, uzrok je potpunog gubitka
sinkronizacije drugog i svih sljedećih folikularnih valova spolnog ciklusa, što utječe na smanjenje
plodnosti.
Umjetno osjemenjivanje
Korištenje umjetnog osjemenjivanja (U.O.) neizbježno je u programima genetske selekcije,
bilo u smislu produkcije mlijeka, vune ili mesa. Uporaba UO-a snažno se razvila u Australiji 70-tih
godina 20. stoljeća u ovaca za proizvodnju vune na sličan način kako se realizira u krava muzara,
osjemenjujući ih između 15 i 17 sati nakon detekcije estrusa (Lightfoot i Salamon, 1970). Primjena
progestagenskih postupaka, osmišljenih u istoj zemlji koncem 60-tih i početkom 70-tih godina prošlog
stoljeća, odigrala je vrlo važnu ulogu u razvoju U.O.-a, zahvaljujući mogućnosti osjemenjivanja u
unaprijed određeno vrijeme, bez detekcije estrusa, 55-56 sati nakon vađenja spužvica te sa plodnošću
od 50% (Colas i Brice, 1970).
U koza osjemenjivanje mora biti izvršeno nešto ranije, 46-47 sati nakon izvlačenja spužvice.
Kombiniranje U.O.-a i progestagena omogućuje uporabu sjemena ohlađenog na 15ºC, u dozi ne
manjoj od 400x106 te plodnosću od približno 50% (Fieni i sur., 1992).
U koza anatomska građa cerviksa omogućuje dublje polaganje sjemena, uključujući čak i uterus u
30-50% ženki; na taj način plodnost može dosegnuti i 70% (Amoah i Gelaye, 1997). Stope ostvarene
plodnosti određene su vitalnošću spermija (Hawk i Conley, 1971) te razmakom između ovulacije i
polaganja sjemena (Signoret y Cognie, 1975).
Uporaba smrznutog sjemana otežana je u ovaca zbog nemogućnosti prolaza kroz cerviks. U koza
pak moguće je dosegnuti 40% plodnosti.
30
Razvoj laparoskopskog umjetnog osjemenjivanja (L.U.O.) kojeg su uveli Killeen i Caffrey
(1982), je omogućio polaganje sjemena u maternicu i na taj način značajan porast stope plodnosti
pri korištenju smrznutog sjemena. Korištenje L.U.O.-a s ohlađenim sjemenom je također koristno jer
povećava plodnost korištenjem doza s manjim brojem spermija.
S tehničkog gledišta, prilikom L.U.O. važno je ostvariti polaganje sjemena u unutrašnjost
maternice, a ne greškom u samu materničnu stijenku. Nadalje, treba izbjeći korištenje anestezije
jer može interferirati sa ovulacijom (Radford, 1966) te je potrebno raspodijeliti polovicu korištene
doze u svaki od materničnih rogova, izbjegavajući prilikom manipulacija eksteriorizaciju jajnika
(McKelvey i sur., 1985).
Superovulacija i trensfer zametaka
Ako je U.O. tehnika izbora kojom maksimiziramo genetski napredak koji polazi od mužjaka,
onda je tehnologija sa zametcima tehnika koja se temelji na ženkama.
Sažeto rečeno, superovulacija se sastoji od aplikacije visokih doza komercijalnih produkata FSH
kako bi se izazvala stimulacija rasta velikog broja preovulatornih folikula i na taj način velik broj
oocita za in vitro produkciju zametaka ili velik broj ovulacija za proizvodnju zametaka in vivo.
Protokoli za proizvodnju zametaka in vivo u koza koji se trenutačno koriste u našem
istraživačkom timu se sastoje od sinkronizacije estrusa aplikacijom spužvica 45mg FGA tijekom
16 dana u kombinaciji sa jednom dozom 0,4mL cloprostenola paralelno sa prvom injekcijom FSH.
Superovulacijski tretman sastoji se od 8 doza od 1,25mL ovčjeg FSH (OvagenTM, ICP, Novi Zeland) u
razmacima od 12 sati. Korištenje ovog protokola ostvaruje u prosjeku 14,3 žutih tijela; 11,3 zametaka
nakon ispiranja maternice i 6,8 vitalnih zametaka po svakoj superovuliranoj kozi.
U ovaca je protokol sličan, osim što su doze hormona u padajućem nizu (1,5mLx3; 1,25x2;
1mLx3). Prosječan broj žutih tijela je 15,9; prosjek dobivenih zametaka nakon ispiranja maternice
13,5 te 7 vitalnih zametaka po svakoj ženki (Gonzalez-Bulnes i sur., 2004).
Ipak, učinkovitost tehnike ograničena je visokom varijabilnošću jajničkog odgovora na
superovulatorne tretmane neophodne za povećanje broja zametaka te promjenama u procesu oplodnje
i vitalnosti zametaka tijekom ranog razvojnog razdoblja.
Referencias bibliográficas
1. Amoah EA, Gelaye S.. Biotechnological advances in goat reproduction. J Anim Sci 1997; 75: 578-585.
2. Armstrong DT, Pfitzner AP, Porter KJ, Warnes GM, Janson PO, Seamark RF.. Ovarian responses of anoestrous
goats to stimulation with pregnant mare serum gonadotrophin. Anim. Reprod. Sci. 1982; 5: 15-23.
3. Baril G, Vallet JC. Time of ovulation in dairy goats induced to superovulate with porcine follicle stimulating
hormone and out of the breeding season. Theriogenology 1990; 34: 303-311.
4. Barret DW, Bartlewski PM, Cook SJ, Rawlings NC. Ultrasound and endocrine evaluation of the ovarian
response to PGF2α given at different stages of the luteal phase in ewes. Theriogenology 2002; 58: 1409–
1424.
5. Boland MP, Gordon IR, Kellcher DL. The effect of treatment by prostaglandin analogue (ICI-80996) or
progestagen (SC-9880) on ovulation and fertilization in cyclic ewes. J Agric Sci Cambr 1978; 91: 727–
730.
6. Cognie Y, Mariana JC, Thimonier J. Etude du moment d’ovulation chez la brebis normale ou traitee par un
progestagen associe ou non a une injection de PMSG. Ann Biol Anim Bioch Biophys 1970; 10: 15-24.
31
7. Colas G, Brice G. Fertility of fluorogestona acetate treated ewes inseminated with frozen sperm. Ann Zootech
1970; 19: 353
8. Corteel JM, Leboeuf B, Baril G. Artificial breeding of adults goats and kids induced with hormones to ovulate
outside the breeding season. Small Rumin Res 1988; 1: 19-35.
9. de Castro T, Rubianes E, Menchaca A, Rivero A. Ovarian dynamics, serum estradiol and progesterone
concentrations during the interovulatory interval in goats. Theriogenology 1999; 52: 399–411.
10. Evans G, Robinson TJ. The control of fertility in sheep: endocrine and ovarian responses to progestagen-PMSG
treatment in the breeding season and in anoestrous. J Agric Sci Camb 1980; 94: 69-88.
11. Fieni F, Roques JM, Tainturier D, Bruyas JF. Utilisation du contrôle endoscopique pour l’insémination intrautérine chez les petits ruminants. Rec. Méd. Vét. 1992 ; 168: 295-302.
12. Ginther OJ, Kot K. Follicular dynamics during the ovulatory season in goats. Theriogenology 1994; 42:
987–1001.
13. Gonzalez de Bulnes A, Osoro K, Lopez Sebastian, A. Factores condicionantes de la respuesta del ganado
caprino a la sincronización de celos mediante progestágenos y PMSG. Archivos de Zootecnia, 1999; 48:
231-234.
14. Gonzalez-Bulnes A, Baird DT, Campbell BK, Cocero MJ, Garcia-Garcia RM, Inskeep EK, Lopez-Sebastian
A, McNeilly AS, Santiago-Moreno J, Souza CJ, Veiga-Lopez A. Multiple factors affecting the efficiency of
multiple ovulation and embryo transfer in sheep and goats. Reprod Fertil Dev 2004; 16: 421-435
15. Gonzalez-Bulnes A, Veiga-Lopez A, Garcia P, Garcia-Garcia RM, Ariznavarreta C, Sanchez MA, Tresguerres
JAF, Cocero MJ, Flores JM. Effects of progestagens and prostaglandin analogues on ovarian function and
embryo viability in sheep. Theriogenology. 2005a; 63: 2523-2534.
16. Gonzalez-Bulnes A, Diaz-Delfa C, Garcia-Garcia RM, Urrutia B, Carrizosa JA, Lopez-Sebastian A. Origin
and fate of preovulatory follicles after induced luteolysis at different stages of the luteal phase in goats.
Anim Reprod Sci 2005b 6: 237-245.
17. Greyling JPC. The effect of dose of prostaglandin in the synchronization of oestrus in the Boer goat doe. In:
Proceedings of the Sixth International Conference in Goats, Beijing, China, 1996, p. 826 (abstract).
18. Hawk HW, Conley HH. Sperm transport in ewes administred synthetic progestagen. J Anim Sci 1971; 24:
233.
19. Killeen ID, Cafrey GJ. Uterine insemination of ewes with the aid of a laparoscope. Aust Vet J 1982; 59:
95.
20. Killian DB, Kiesling DO, Warren JR. Lifespan of corpora lutea induced in estrous-synchronized cycling and
anoestrous ewes. J Anim Sci 1985; 61: 210.
21. Kusina NT, Tarwirei H, Hamudikuwanda H, Agumba G, Mukwena J.. A comparison of the effects of
progesterone sponges and ear implants, PGF2α, and their combination on efficacy of estrus synchronization
and fertility of Mashona goat does. Theriogenology 2000; 53: 1567–1580.
22. Lightfoot RJ, Salamon S. Fertility of ram spermatozoa frozen by the pellet method. J Reprod Fertil 1970;
22: 385-398.
23. McKelvey WAC, Robinson JJ, Aitken RP. The evaluation of a laparoscopic insemination technique in ewes.
Theriogenology, 1985; 24: 519-535.
24. Menchaca A, Rubianes E. Relation between progesterone concentrations during the early luteal phase and
follicular dynamic in goats. Theriogenology 2002; 57: 1411–1419.
25. Nuti LC, Minhas BS, Baker WC, Capehart JS, Marrack P. Superovulation and recovery of zygotes from Nubian
and alpine dairy goats. Theriogenology 1987; 28: 481-488.
26. Radford HM.. Pharmacological blockade of ovulation in the ewe. J Endocrinol 1966; 34: 135-136.
32
27. Rhodes L, Nathanielsz PW. Comparison of a controlled internal drug release device containing progesterone
with intravaginal medroxiprogesterone sponges for estrus synchronization in ewes. Theriogenology 1988;
4: 831.
28. Robinson TJ, Moore NW, Holst PJ, Smith JF.. The evaluation of several progestogens administered in
intravaginal sponges for the synchronization of oestrus in the entire cyclic Merino ewe. In: T.J. Robinson
(ed.). Control of the ovarian cycle in the sheep. White and Bull PTY Ltd., Sydney, 1967: 76-91.
29. Robinson TJ. Use of progestagen impregnated sponges inserted intravaginally or subcutaneously for the control
of the oestrous cycle in the sheep. Nature, 1965; 206: 39-41.
30. Robinson TJ. The control of the ovarian cycle in the sheep. Sydney University Press, Sydney, Australia, 1967;
pp: 237-244.
31. Rubianes E, Menchaca A. The pattern and manipulation of ovarian follicular growth in goats. Anim Reprod
Sci 2003; 78: 271–287.
32. Scaramuzzi RJ, Downing JA, Campbell BK, Cognie Y. Control of fertility and fecundity of sheep by means of
hormonal manipulation. Austr J Biol Sci 1988; 41: 37-45.
33. Signoret JP, Cognie Y. Determination of the moment of ovulation in ewe and sow. Influence of environment
and hormonal treatment. Ann Biol Anim Bioch Biophys 1975; 15: 205-214.
34. Steffan J, Poissonet P, Thibier M. Control of oestrus in ewe lambs and yearling ewes with medroxiprogesterone
acetate and fluorogestone acetate. Anim Reprod Sci 1982; 5: 191-198.
33
34
NEW SOLUTION FOR THE CONTROL OF THE BOVINE RESPIRATORY
COMPLEX
Nove mogućnosti kontrole zaraznog goveđeg
respiratornog sindroma
Juan Muñoz Bielsa
International Marketing, International Product Manager Ruminant Biologicals, Intervet International bv
( part of Schering Plough, P.O. Box 31, 5830 AA Boxmeer, The Netherlands, E-mail: juan.munozbielsa@
intervet.com
The respiratory disease complex of ruminants consists of the single clinical entity of
bronchopneumonia, but is caused by numerous combinations of infectious agents, compromised
host defences, and environmental conditions. Over the past decade, a number of viruses and bacteria/
mycoplasma have been associated with acute bovine respiratory disease. The importance of these
different agents depend on the prevalence and incidence in the herd, control measures available on
the farm (such as vaccination) and if the pathogen can cause direct damage to the lung or if it works
more as a predisposing factor.
MAIN RESPIRATORY PATHOGENS
Depending on if the pathogens cause direct damage to the lungs or not we could propose the
following classification:
Predispose to damage
BHV-1
BVDV
Parainfluenza-3
Bovine Adenovirus
Bovine Coronavirus
Direct damage
BRSV
M haemolytica
P multocida
H sommus
M bovis
Predispose to damage
Bovine Herpesvirus Type 1 (BHV-1)
BHV-1 is a member of the family of the Herpesviridae and the subfamily of Alphaherpesvirinae.
Depending on the route of inoculation, infection with BHV-1 results mostly in acute inflammation
of the mucous membrane of either the upper respiratory tract, giving rise to infectious bovine
rhinotracheitis (IBR), or of the genital tract, causing infectious pustular vulvovaginitis (IPV) in
female cattle and infectious pustular balanoposthitis (IPB) in bulls. BHV-1.1 strains are associated
with the more severe respiratory infections and BHV-1.2 with the milder genital infections, but both
subtypes can however be isolated from both tracts.
The acute infection is characterized by fever, depression, loss of appetite, hyperaemia of the
mucosae, mucosal lesions and discharge. This sometimes results in complete obstruction of the nasal
passage or even the trachea, with animals eventually suffocating to death. In the field, the clinical
signs of disease are often worsened by secondary infections.
35
Parainfluenza-3 (PI-3)
Parainfluenza virus type 3 (PI-3) is a RNA virus classified in the paramyxovirus family. Variation
in virulence between strains has been reported.
The widespread prevalence of antibodies to this virus indicates that it is ubiquitous in the
cattle population. This finding suggests the possibility of repeat infections or at least persistence of
antibodies after infection.
Infection appears to spread rapidly in susceptible cattle housed at high population densities and
in close contact. By itself, PI-3 is a relatively mild infection; death loss to the disease is rare, and
maybe non-existent. The clinical signs include fever, cough, nasal and ocular discharge, increased
respiratory rate, and increased breath sounds.
Following initial multiplication in the upper respiratory tract, the virus multiplies in the lung,
growing in high titters in pneumocites and alveolar macrophages, and by adversely affecting the
function of these cells may pave the way for secondary bacterial infection. The most important
role of PI-3 is in predisposing the respiratory tract to subsequent infection by other viruses and
bacteria such as M haemolytica, making the mixed infections more damaging and dangerous.
Bovine alveolar macrophages (BAM) are the initial cellular defenders of the lungs against
bacterial colonization. Impaired BAM function may help to explain the pathogenesis of the severe
bacterial pneumonia in cattle that often follows PI-3 infection. The results from a challenge study
showed that microbicidal activity was almost completely eliminated in alveolar macrophages from
control calves at 4 to 8 days after virus challenge (Adair, 2000). It was also found the presence of
virus antigen in circulating mononuclear cells following challenge.
Bovine Virus Diarrhea Virus (BVDV)
BVD is an RNA virus of the genus Pestivirus and included in the family Flaviviridae. It is
recognised the existence of two species of BVDV, BVDV Type 1and Type 2. Within the BVDV1 species there are at least 5 serologically distinct subspecies, 1a-1e. BVDV-1 has a worldwide
distribution while BVDV-2 is largely restricted to USA although some have been isolated from
Europe. The role of BVDV in the bovine respiratory complex is controversial. As a single infection
it causes a mild respiratory disease (some strains are more pneumopathogenic than others). The most
important feature of BVDV infection is its immunosupressor effect that may enhance the disease
caused by other viruses (particularly IBR and BRSV) and bacteria (synergistic interaction between
M haemolytica and BVDV has been shown experimentally).
Bovine Adenovirus (BAV)
There are 9 different types of Adenovirus and they are usually responsible of a mild subclinical
infection. It has been associated with pneumonia, enteritis and/or conjunctivitis. Type 3 BAV is the
serotype most often associated with respiratory infection. In late 70,s and early 80’s it was considered
part of the Bovine Respiratory Complex but later on lost importance and we eliminated from most
of the commercial vaccines.
Coronavirus
The role of Coronavirus is still under discussion and although recent studies in USA detect
seroconversion against Coronavirus in cases of pneumonia, it is not clear what is the real significance
of this virus.
36
Direct Damage
Bovine Respiratory Syncytial Virus (BRSV)
BRSV) is classified in the genus Pneumovirus of the family Paramyxovirinae. There are antigenic
differences between G proteins of BRSV isolates. Based on antigenic reactivity RSV isolates were
divided into 3 subgroups (A, B and AB). The biological appearance of different subgroups of RSV
has not yet been assessed, but some degree of cross protection is evident.
BRSV antibodies are found in cattle all over the world. Prevalence of antibodies to BRSV
increases with age and is over 70% in cattle of 2 years of age and more.
BRSV plays a significant role in the pathogenesis of pneumonia in cattle. In calves less than 6
months of age induces an acute interstitial pneumonia with alveolitis and bronchitis. Respiratory
tract signs of BRSV in older cattle are moderate or absent and seldom severe. The clinical signs
in calves are elevated body temperature (40-42.2 C), depression, decreased feed intake, elevated
respiratory rates, hypersalivation, and nasal and lacrimal discharges. Subcutaneous emphysema and
intermandibular edema are sometimes noted.
Primary BRSV infections tend to occur mainly in autumn and winter. Respiratory disease during
BRSV infection is severe in some cases and absent in others. It is not clear which factors are responsible
for the severity of the disease: virulence of the virus, level of specific maternal antibodies, presence
of concurrent viral, bacterial and mycoplasma infections, housing and management conditions or
weather conditions.
Re-infections can happen in animals of all ages. The re-infections are most often observed in
autumn and winter but they can also be observed in summer. Re-infections, determined by measuring
significant antibody rises, can result not only from virus replication after re-exposure to the virus,
but also from activation of a putative persistent virus infection. RSV may circulate in herds through
continuous subclinical re-infections or through chronically or persistently infected cattle, which shed
BRSV for some undetermined period, or through both of these epidemiological mechanisms. (Wim
van der Poel, 1995)
Observations from experimental infection studies and natural outbreaks indicate that maternally
derived antibodies (MDA) does not prevent BRSV infection in calves but modify the severity of
the disease. Most cases of severe BRSV mediated disease develop in calves aged 1-3 months, at
which time they still possess maternal antibodies in serum. Nevertheless, maternal antibodies may be
protective to a certain degree, since the severity and incidence of disease in calves less than 3 months
of age seem to be inversely related to the serum level of MDA (Larsen, 2000)
Mannheimia haemolytica
M haemolytica is a normal inhabitant of the nasal pharyngeal mucosa of healthy cattle.
Fifteen different serotypes of M haemolytica have been identified in cattle. In the UK, pneumonic
pasteurellosis in cattle is associated mainly with serotype A1. During the years 1982-85, serotype A1
comprised 56% of all M. haemolytica isolates and 63% of lung isolates submitted to the Moredun
Research Institute for serotyping (Quirie et al, 1986). Other biotype A serotypes accounted for only
14% of the total (serotype A2, 8%; all other A serotypes combined, 6%). In the early ‘90s, it became
apparent that the incidence of serotype A6 was increasing, and during the years 1990-99 serotypes
A1 and A6 each accounted for approximately 30% of bovine isolates (unpublished observations).
37
Under conditions of impaired pulmonary defences caused by stress (transport, weaning…),
nutritional deficiencies, and/or pre-existing viral infections (in particular BHV-1, BVD and PI-3), M
haemolytica is able to proliferate rapidly within the lung and then produce a severe fibrinopurulent
bronchopneumonia.
M haemolytica causes the most severe damage of all the recognised bacterial pathogens. It
produces a potent leukotoxin that destroys the macrophages and the neutrophiles.
Pasteurella multocida
P Multocida is a normal inhabitant of the nasal pharyngeal mucosa of healthy cattle. There
are different serotypes being A and D the ones involved in the bovine respiratory complex. P
multocida causes less damage in the respiratory tract than M haemolytica and cause a fibrinous
bronchopneumonia.
Mycoplasma bovis
Mycoplasma bovis is not ubiquitous and the occurrence of this agent in a herd is always connected
with cases of mastitis, arthritis and/or pneumonia. Clinically healthy calves can harbour M bovis
in the respiratory tract and shed the agent through nasal discharge fro months. The most common
histological findings are interstitial and catarrhal to catarrhal-purulent bronchopneumonia.
Haemophilus somnus
H somnus is a gram-negative bacteria and is a normal inhabitant of the nasal pharyngeal mucosa
of healthy cattle. It has been associated with pneumonia, fibrinous pleuritis, myocarditis, septicemis,
pericarditis, polyarthritis and meningoencephalitis. It is considered a significant component of
the respiratory complex that affects calves in the feedlots of USA. The isolation of H somnus has
been published in United Kingdom, Denmark, Germany and Hungary, but it is believed to have a
worldwide distribution.
CONTROL OF BOVINE RESPIRATORY COMPLEX
The health status of a calf depends on the level of management, nutrition, parasite control,
environmental conditions and presence of respiratory pathogens. The control of the bovine respiratory
complex should be directed to all the parameters mentioned already but we will focus in this article
in the control of respiratory disease through vaccination.
Different technologies have been used in the production of respiratory vaccines and they have
been presented in different combinations. The efficacy of a vaccine depends on: choice of the right
antigen, active on the presence of maternally derived antibodies, safe and right combination.
It is very important that veterinarians and farmers have a clear idea of what is the purpose of
our vaccination scheme: control of clinical signs, control of the infection and/or eradication of the
disease.
There are currently vaccines available in the market for the control of BHV-1, BVDV, PI-3,
BRSV, M haemolytica and P multocida. Former vaccines containing bovine adenovirus were
withdrawn from all different markets and current research on adenovirus vaccines is focused on
the use of apathogenig strains of adenovirus as vector vaccines. In the case of bovine Coronavirus
there are vaccines available fro the control of enteric Coronavirus but not respiratory Coronavirus.
A vaccine against respiratory Mycoplasma bovis infection was developed in the 80’s but was never
38
commercialised and there is at least one inactivated vaccine available in USA but its efficacy is
unknown.
Recommended vaccination programme
IBR: control and eradication of the disease with the use of marker vaccines. Vaccination should
be carried out every 6 months and use of live vaccines is particularly recommended to achieve
reduction of virus circulation (Bovilis IBR marker live)
BVDV: Control should be aimed primarily to avoid the birth of animals persistently infected
in utero and for that reason vaccination of the dam with a vaccine that has been proved to provide
foetal protection is recommended (Bovilis BVD). In feed-lots where animals may be supplied
from different sources there can be circulation of BVDV and vaccination against BVDV may be
necessary. Maternally derived antibodies can be present until month six of life and they can interfere
with vaccination.
Bovine Adenovirus and Bovine Respiratory Coronavirus: There are currently no vaccines
available for the control of these viruses in western Europe. The only product available in Hungary
is a combined product that will be removed from the market when the IBR eradication programme
starts. Bovine adenovirus has lost importance as a respiratory pathogen while the role of bovine
Coronavirus could result to be more important than we believe now.
Mycoplasma bovis and Pasteurella multocida: There are bacterins available for the control of
Pasteurella multocida A and D, but they have not been proved to be very efficacious. Mycoplasma
bovis vaccines are not available in Europe and the efficacy of those sold in USA is unknown.
BRSV: Vaccination against BRSV is widespread in Europe as it is considered the major component
of the bovine respiratory complex. As the disease can affect animals even when maternally derived
antibodies are present, it is crucial that vaccination is efficacious on the presence of MDA.
Parainfluenza-3: Due to the fact of being spread worldwide and its negative effect on pulmonary
macrophages it is common practice to vaccinate against PI-3.
M haemolytica: Major bacterial pathogen. Former inactivated M haemolytica vaccines were
of very low efficacy. It was found that those vaccines did not contain the relevant antigens required
to provide protection against M haemolytica infection. Two main technologies were developed
and are currently being used in the production of these vaccines: Iron regulated proteins (IRP) and
leukotoxins. Iron regulated proteins have been shown to be highly protective and moreover they are
cross protective within different strains of M haemolytica, making them the most suitable antigen to
be used in M haemolytica vaccines.
Bovilis Bovipast
Vaccine developed for the control of BRSV, PI-3 and M haemolytica infections even when
maternally derived antibodies are present in the calf. First dose can be administered when the calf
is two weeks old. The fact of being efficacious in the presence of maternally derived antibodies is
extremely important because diseases such as BRSV can cause disease despite of MDA being present
Primary course consists of two injections (5 mls each) administered subcutaneosly and animals
should be booster prior to each pneumonia season. It combines the three major respiratory pathogens
and it is the ideal complement for IBR marker vaccination in those farms where there is evidence of
bronchopneumonia.
39
The vaccine includes an inactivated BRSV and PI-3 strains, and iron regulated proteins of M
haemolytica A1. Iron regulated proteins have been proved to be highly immunogenic and because
they are shared by the different serotypes of M haemolytica they guarantee protection against them.
IRP’s are located in the outer membrane of M haemolytica grown in vivo or under iron-restricted
in vitro conditions. Former M haemolytica vaccines lack thse IRP’s and that was the reason of their
non-efficacy when used in the field.
The vaccine efficacy against BRSV and PI-3 was assessed in different challenge studies. In both
studies the response from vaccinated animals was very good but in the case of the BRSV challenge it
was extremely good showing the superior efficacy of the BRSV strain included in the Table 1 shows
the effect of vaccination in the level of clinical signs induced by BRSV.
T able 1-E ffec t of vac c ination on c linic al s c ore (tem perature, nas al dis c harge,
c oughing)
9
Total clinical score
7
5
3
V ac c inates
C ontrols
1
-1
0
2
4
6
8
D ay after B R S V c hallenge
10
12
14
We also studied the quality of the immunological response induced by the BRSV strain of Bovilis
Bovipast. Two antibody responses are generally considered to contribute to BRSV protection. These
are against G and F antigens. Virus neutralization (VN) measures F and G antibody and most of
the ELISA s employed measure primarily F antibody. F antibody has been correlated with a good
degree of protection by trials involving the administration of monoclonal passive F antibody. Trials
with vaccines suggest the VN response is not always well correlated to protection. A study carried
out by P. Kerkhofs at VAR (Veterinary and Agrochemical Research Centre) in Belgium showed that
the inactivated BRSV strain from Bovilis Bovipast induced a higher serological response than a live
(mlv) strain against F protein (Table 2)
40
mean ELISA titre (OD)
Table 2. ELISA response Live vs Bovilis Bovipast
1
0.8
0.6
inac
mlv
0.4
0.2
0
v1
v2
day 7
14
24
44
56
sample time
In the case of M haemolytica protection was showed not only against challenge with serotype
A1 (table 3) but also when challenged with serotype A6 (table 4), showing the efficacy and crossprotection of the IRP’s. Moredun Research Institute in Scotland developed the challenge model and
it is a very severe challenge model that induces high mortality level in non-vaccinated animals.
Table 3. Challenge with M haemolytica A1
Number of animals
Dead
% Mortality
Control
12
8
66.60%
Bovilis Bovipast
12
2
16.60%
Table 4. Challenge with M haemolytica A6
Number of animals
Dead
% Mortality
Control
8
7
87.50%
Bovilis Bovipast
8
1
12.50%
The vaccine is currently available in most of the European countries and it is the first choice by
most veterinarians in the control of bronchopneumonia in cattle due to its efficacy against the most
important pathogens in calves of almost all ages. Iron regulated proteins meant a major breakthrough
in Mannheimia haemolytica vaccines and this superior technology ensures high cross-protection
against this deadly bacteria.
41
References
AdairBM. Effect of parainfluenza-3 virus challenge on cell-mediated immune function in parainfluenza-3
vaccinated and non-vaccinated calves. Res Vet Sci. 2000 Apr;68(2):197-9.
Larsen LE: Bovine Respiratory Syncytial Virus (BRSV): A review. Acta Vet. Scan. 2000, 41, 1-24
Van der Poel W: Epidemiology of Bovine Respiratory Syncytial Virus Infections. Ph D Thesis 1995
42
GENETIC CHARACTERIZATION OF SMALL RUMINANT LENTIVIRUS
GENOTYPE E
GENETSKA KARAKTERIZACIJA LENTIVIRUSA GENOTIPA E U
MALIH PREŽIVAČA
Reina, R., Grego, E., Lacerenza, D., Profiti, M., Rosati, S.
Dipartimento di Produzioni Animali Epidemiologia ed Ecologia, Universita di Torino, Torino.Italy.
INTRODUCTION
Small ruminant lentiviruses (SRLV) are wide world distributed affecting sheep and goats and
cause slow and insidious disease affecting lungs, brain, mammary gland and articular joints. Although
the prototypes Maedi Visna Virus (MVV) and Caprine arthritis-Encephalitis Virus (CAEV) have been
originally isolated from sheep and goat respectively, the species barrier is less tight than previously
thought and an increased number of recent studies characterized goat isolates more related to MVV
cluster and vice versa.
Main target cell of SRLV is the monocyte/macrophage lineage although it has been found in vivo
in some epithelial tissues, brain, among others. Also in vitro SRLV are able to infect a wide range of
cell types including several immortalized cell lines
Genetic organisation of SRLV fits in with other complex lentiviruses such as HIV or SIV. Thus,
structural genes gag, pol and env as well as accessory genes tat, vif and rev are usually present in
the genome, all of them controlled by the regulation of the LTR. Artificial deletions in the AML,
AP1 and CAAAT sites of the LTR have shown to decrease viral titers in vitro. Among the structural
genes, viruses artificially deleted in the dUTPase subunit of the pol gene have shown to be competent
for viral replication in dividing cells, but viral growth in terminally non-dividing cells is reduced or
abrogated, with an increase in G→A transition mutations hampering viral fitness. In a similar way,
among the accessory genes, the SRLV tat or vpr-like increased the viral load, tissue distribution and
severity of inflammatory lesions when compared with vpr-deleted counterpart.
The majority of SRLVs can be classified in 3 groups attending to genetic homologies in gag
and pol genes. Group A includes the prototypes of Visna Maedi viruses. Group B includes caprine
arthritis encephalitis virus prototypes and group C houses the divergent CAEV1GA strain.
Recently, a new highly divergent subtype named E have been found in Italian goats. In this work
we have isolated, sequenced and analysed the complete genome of the first double naturally deleted
SRLV, the genotype E, as well as its in vitro biological features.
Sažetak
Lentivirusi malih preživača (SRLV) rasprostranjeni su širom svijeta djelujući na ovce i koze
uzrokojući sporu, ali progredirajuću bolest koja djeluje na pluća, mozak, mliječnu žlijezdu i zglobove.
Iako su prototipovi Maedi Visna Virusa (MVV) i kozjeg artritis - encefalitis virusa (CAEV) izvorno
izolirani iz ovaca tj. koza, vrsna granica je tanja nego što se ranije mislilo, a više je novijih istraživanja
pronašlo kozje izolate povezanijima sa MVV skupinom i obrnuto. Glavna ciljna stanica SRLV su
monocitno / makrofagnog podrijetla iako ih se in vivo pronašlo i u nekim epitelnim tkivima i mozgu,
između ostalog. Sedam godina stara koza, klinički zdrava i visoko reaktivna na antigen tipa E, ali
43
negativna na genotip A i B je odabrana za izolaciju virusa. Nakon žrtvovanja, dobiveni su različiti
uzorci ciljnih tkiva. DNK i RNK su ekstrahirani iz kultura i korišteni za amplifikaciju genoma.
Kompletni genom genotipa E amplificiran je PCR-om. Test infektivnosti izveden je inficiranjem
različitih kozjih staničnih tipova konvencionalnim sojem CAEV-To1/89 i genotipom E. Izolacija
virusa bila je uspješna iz tkiva slezene, mliječne žlijezde i mamarnog limfnog čvora dok sinovijska
membrana, korioidni pleksus, pluća i medijastinalni limfni čvor ostadoše intaktni barem do 5. pasaže
što je ocijenjeno prisutstvom CPE i/ili PCR pozitivnom reakcijom. Genom genotipa E sastojao se od
8454bp uključujući funkcionalni LTR, 3 strukturna gena (gag, pol i env) i 2 akcesorna gena normalno
prisutna u SRLV vif i rev. Ipak, utvrđena je delecija u pol genu što je bilo prisutno u svim stadima
u kojima je taj genotip E bio prisutan. Zbog toga što dvostruka delecija može spriječiti replikaciju
u nedijelećim stanicama kao što su makrofagi akumulacijom mutacija tijekom rane infekcije,
predmnijevali smo ranu infekciju premonocita u koštanoj srži. Potom, ti rano inficirani monociti
mogu doseći mliječnu žlijezdu te zajedno sa epitelnim stanicama mogu odigrati ključnu ulogu u
patogenezi tog novog genotipa.Serološka dijagnostika sa komercijalnim kitovima koja se bazira na
gag i TM regijama može bit umanjena jer su uočene mnoge razlike u tim regijama kod SRLV-E.
MATERIAL AND METHODS
Animals, Virus and Cells. A seven year old goat, clinically healthy and highly reactive against
type E antigen but negative against genotypes A and B was selected for virus isolation. Following
sacrifice, different target tissue explants were obtained. Co-cultivation of blood derived macrophages
with ovine foetal choroid plexus cells was also carried out. DNA and RNA from the cultures were
extracted and used for genome amplification. CAEV field isolate TO1/89 was obtained by explantation
of synovial membrane from arthritic goat and was used in in-vitro experiments as conventional
strain.
Amplification cloning and sequencing of viral genome. The complete genome of genotype E was
amplified by PCR with primers which were designed based on known fragments, resulting in five
overlapping products. PCR was performing using Qiagen Long Range PCR following manufacturer’s
instructions. In parallel, when necessary the amplicons were cloned into pCR-XL TOPO vector
(Invitrogen). Sequencing was carried out with fluorescent dye terminators on an ABI PRISM 310
Genetic Analyzer. One step RT-PCR (Superscript; Invitrogen) was carried out to amplify the Revencoding regions according to the instructions manual.
Infectivity assay. Different caprine cell types were infected with conventional strain CAEVTo1/89 and genotype E. Titres were calculated using an indirect non-radioactive method (HS-Lenti
RT Activity kit, Cavidi) at different times post-infection.
RESULTS
Virus isolation was successfully carried out in spleen, mammary gland and mammary lymph
node while synovial membrane, choroid plexus, lung and mediastinal lymph node remained all
negative at least until the 5th passage as assessed by presence of CPE and/or PCR positive reactions.
Supernatant from positive cultures were used to replicate the isolate in foetal choroid plexus (CP),
spleen, synovial membrane (SM) and epithelial milk cells (EM). RT activity increased with every
passage reaching a maximum level at passage 4 with viral titre of 1.5 x 105 TCID50/ml in CP as well as
SM but not in spleen. However, the SRLV-E behavior was only comparable with that of conventional
strain when using EM cells.
44
The genome of genotype E consisted in 8454 bp including a functional LTR, the three structural
genes (gag, pol and env) and two accessory genes normally present in SRLV vif and rev. However,
a deletion in the pol gene corresponding to the dUTPase subunit was found. We could demonstrate
that this deletion was present in all the flocks in which this genotype E was present, representing
a peculiar genetic marker of this distant genotype. A second deletion based on SRLV consensus
sequences and corresponding to tat or vpr-like accessory gene was identified between vif and env
genes. Regarding LTR we have found a single copy of the 70 bp repeat described for CAEV-Co
reference strain which includes additional AP-1, CAAAT, GAS and TAS sites.
CONCLUSIONS
The first double naturally deleted SRLV in dUTPase and vpr-like regions showed a restricted
growth limited to mammary cells and only after several adaptation steps was able to replicate on
GM and CP cells. Since the double deletion could hamper replication in non dividing cells such
as macrophages (target cell of the SRLV) by accumulation of mutations in early infection, we
have hypothesized the early infection of pre-monocytes in bone marrow. After that, pre-infected
monocytes could reach mammary gland and together with epithelial cells could develop a key role
on the pathogenesis of this new genotype centered in vertical transmission. Serodiagnosis with
commercial kits normally based on gag and TM regions may be impaired since a high number of
differences were observed in these regions in SRLV-E.
(Extended results are currently being written in a full paper for publication)
45
46
Entomological surveillance for Bluetongue vectors
in Tirana
ENTOMOLOŠKO ISTRAŽIVANJE BLUETONGUE VEKTORA U TIRANI
Lika E.,1 Lika A.2, Gjino P.1, Turmalaj L.1, Grizelj J.³, Vince S.3
1
2
Faculty of Veterinary Medicine, Tirana, Albania
Institute of Food Safety and Veterinary, Tirana, Albania
3
Faculty of Veterinary Medicine, Zagreb, Croatia
Abstract
The incursion of Bluetongue virus (BTV) in the Mediterranean basin have implicated numerous countries
that had never experienced the infection in their territory before. To define the infection area and better control
the infection, some of them have established entomological and serological surveillance plans. The circulation
of bluetongue virus (BTV) was detected serologically in Albania in 2002. In the same season a survey for
Culicoides Latreille, 1809, was also made to establish whether Culicoides imicola Kieffer, 1913, the main vector
of BTV in the Mediterranean Basin or any other suspected vector species were present. The present study was
designed to analyse the monthly activity of Culicoides species in the region of Tirana, particularly secondary
vector species such as C. obsoletus, C. pulicaris and C. punctatus. While the main vector, C. imicola was not
detected in the present study, a number of species which are known or suspected BTV vectors including C.
obsoletus and C. pulicaris complex were among the most prevalent in Tirana. Here we report the results of this
entomological survey during the year 2005.
Key word: Bluetongue virus, Culicoides vectors, entomology, surveillance, trap
Sažetak
Prodor Bluetongue virusa (BTV) u područje Sredozemlja obuhvatio je brojne zemlje koje do tada nikada
nisu imale infekciju na svom području. Kako bi odredile područje infekcije i bolje kontrolirale istu, neke od
njih su načinile entomološke i serološke planove nadzora. Cirkuliranje Bluetongue virusa serološki je utvrđeno
u Albaniji 2002. U istoj sezoni provedeno je istraživanje Culicoides Latreille, 1809 kako bi se utvrdilo da li je
prisutan Culicoides imicola Kieffer, 1913, glavni vector BTV-a na Sredozemlju ili neki drugi pretpostavljeni
vektor. Ova je studija osmišljena u svrhu analize mjesečne aktivnosti Culicoides sp. u Tiranskoj regiji, posebice
sekundarnih vrsta vektora poput C. obsoletus, C. pulicaris i C. punctatus. Iako u ovoj studiji provedenoj u Tirani
nije utvrđen glavni vector - C. imicola, utvrđene su brojne druge vrste poznatih i pretpostavljenih BTV vektora
uključujući C. obsoletus i C. pulicaris kompleks kao najprevalentnije. U radu se iznosi izvješće ove entomološke
studije obavljene 2005.
Ključne riječi: Bluetongue virus, Culicoides vektori, entomologija, nadzor, klopka
Introduction
Bluetongue virus causes an infectious, non-contagious disease of ruminants, and is transmitted
between its vertebrate hosts by Culicoides biting midges (Diptera: Ceratopogonidae). Bluetongue
virus is thought to infect all known species of ruminant. However, severe disease usually occurs only
in certain breeds of sheep, particularly the fine-wool and mutton breeds and some species of deer,
most notably the North American white-tailed deer. Clinical signs may include fever, depression,
excessive salivation, nasal discharge (serous, muco-purulent or bloody), facial oedema, hyperaemia
47
and ulceration of the oral mucosa, coronitis, lameness, muscle weakness and death. The mortality
rate and the severity of the clinical signs seem to vary with the breed and age of the animal infected
(with the older age groups being more susceptible), the type and strain of the virus and certain rather
ill-defined interactions with the environment.
In the field BTV is transmitted between its vertebrate hosts almost entirely via the bites of various
species of biting arthropod, and extensive experimental and epidemiological investigation has shown
that by far the most important of these are certain species of Culicoides biting midge which are true
biological vectors. The distribution of BTV is therefore limited to those geographical areas where
competent vector species of Culicoides are present and its transmission to those times of the year
when the climatic conditions are favorable for adult vector activity.
The BTV epizootic started in 1998 when the virus serotype BTV-9 was isolated on four Greek
islands, Rhodes, Leros, Kos and Samos close to the Turkish mainland. In the following years the
disease spread to northern Greece and nearby Balkan countries including Albania, Kosovo, Bulgaria
and Bosnia-Herzegovina. It is thought that the disease first appeared in Albania during 2001 as an
extension of the outbreak in the neighboring Greek regions of Epirus and Western Macedonia. In
2002, a sero-survey was carried out in 15 district of Albania to detect antibodies to BTV in cattle
and small ruminants (Di Ventura M. et al., 2004). In total, 1754 sera samples from cattle and small
ruminants were examined of which 264 (15,1%) were positive using C-ELISA, with sero-positive
cases being widely distributed, even in mountainous areas.
The relatively high sero-prevalence of antibodies to BTV in Albania is evidence that Culicoides
vectors are present but there is little entomological data as to which species are prevalent in the
country. A limited survey of 43 catches carried out in conjunction with the 2002 sero-prevalence
study (Goffredo M. et al., 2004), identified 20 Culicoides species of which C. obsoletus was the most
prevalent.
The present study was undertaken to study the monthly activity of Culicoides species in the
region of Tirana, in order to reevaluate the medical importance of Culicoides Complexes such as
Obsoletus, Pulicaris and Nubeculosus Complexes according to each season of the year.
Material and Methods
Study Area
Entomological monitoring was carried out in Tirana region (in the territory of the Institute of
Food Safety and Veterinary in the suburb part of Tirana). According to the sero-survey of 2002,
Tirana was the district with the highest BTV prevalence; interestingly Tirana was also the district in
which animals showed the highest neutralising antibody titres.
Sampling Protocols
Monitoring activity was carried out during the period 1 January – 31 December 2005. The
capture, catch analysis and identification of species of Obsoletus and Pulicaris Complex were carried
out according to the methods described by Goffredo and Meinswinkel, 2004. One light trap for
insects of the type “Onderstepoort” with 8 W UV-light tube and downdraught suction motor was
available for the study. The light trap was positioned in open air with the UV-light tube 1.5-2 m
above ground level. The light trap was operated overnight, starting from 1 hour before sunset to
08.00 am the following morning. The resultant insect catch was poured through a fine gauze square
and then transferred to a plastic jar containing 70 % alcohol. The insect were identified under a
stereomicroscope Stemi 2000-C using appropriate taxonomic keys.
48
Results
During the course of this study, a total of 3680 Culicoides specimens (2964 females and 716 males)
were obtained from 365 trap collection during all the year 2005. The species of Obsoletus, Pulicaris
and Nubeculosus Complexes and Other Culicoides species were identified under a stereomicroscope
Stemi 2000-C using appropriate taxonomic keys according to the methods described by Goffredo
and Meinswinkel, 2004.
The abundance of the Obsoletus, Pulicaris and Nubeculosus Complexes according to each month
is shown in the Table No. 1.
Table No. 1. The abundance of the Obsoletus, Pulicaris, Nubeculosus Complexes and other species of Culicoides every month
Number of Culicoides according to each month
Complexes
Jan
Feb
Mars
April
May
June
July
Aug
Sep
Oct
Nov
Dec
Obsoletus
16
11
38
217
89
91
187
41
44
6
31
36
37
48
37
26
62
13
16
5
1
402
274
67
23
Pulicaris
Nubeculosus
Other species
of Culicoides
4
18
110
1
389
419
919
2
1000
900
800
700
600
500
C . o b s o le tus
C . p ulic a ris
C . nub e c ulo s us
O the r
400
300
200
100
December
October
November
C . o b s o le tus
September
August
July
May
C . nub e c ulo s us
June
April
Mars
February
January
0
Fig. 1. The abundance of the Obsoletus, Pulicaris, Nubeculosus Complexes and Other species of Culicoides
every month
Obsoletus Complex was the most abundant complex and accounting for 21.9 % of the total
catch; Pulicaris Complex accounted for 6.65 % followed by Nubeculosus Complex that accounted
for 0.13 %. Other Culicoides species accounted for 71.3 % of the total.
49
Discussion
Of more than 1400 Culicoides species worldwide, fewer than 20 are considered to be actual or
possible vectors of bluetongue virus. While the main vector, C. imicola was not detected in the present
study, a number of species which are known or suspected BTV vectors including obsoletus and
pulicaris complex were among the most prevalent in Tirana region. These findings are in agreement
with the results of the previous survey in Albania and similar to those reported for other countries
(Purse B. V. et al. 2006)
As for the seasonal trend of culicoides fauna, it could be determined especially for Obsoletus
Complex which is also the most abundant complex. The first adult appeared on 13 January 2005 and
the last one was collected on 27 December 2005, the highest number of specimens being collected
at the end of April.
All of these new finding are of interest since they suggest that BTV may be able to overwinter in
Tirana region were adult vector, especially of Obsoletus Complex, are present during all the year.
In general, our survey confirms what previously observed on the Culicoides fauna composition
of Albania, and particularly on the distribution and abundance of Obsoletus Complex. During the
entomological survey of 2002, the species of the Obsoletus Complex result the most abundant, and
at least two species of the complex, C. obsoletus and C. scoticus, were present.
References
1. Di Ventura M., Tittarelli M., Semproni G., Bonfini B., Savini G., Conte A., Lika A. (2004): Serological
surveillance of bluetongue virus in cattle, sheep and goats in Albania. Vet. Ital., 40 (3), 101-104.
2. Goffredo M., Delécolle J., Semproni G., Lika A. (2004): Culicoides (Diptera: Ceratopogonidae) in Albania:
results of the 2002 entomological survey for bluetongue. Vet. Ital., 40 (3), 209-211.
3. Goffredo M. and Meiswinkel R. (2004): Entomological surveillance of bluetongue in Italy: methods of
capture, catch analysis and identification of Culicoides biting midges. Vet. Ital., 40 (3), 260-265.
4. Purse B. V., Nedelchev N., Georgiev G., Veleta E., Boorman J., Denison E., Veronesi E., Carpenter S., Baylis
M., Mellor S. (2006): Spatial and temporal distribution of bluetongue and its Culicoides vectors in Bulgaria.
Medical and Veterinary Entomology 20 (3), 335-344.
50
Sheep - associated malignant catarrhal fever – a case
report
Zarazna korica goveda – prikaz slučaja
Habus, J1., N. Turk1, M. Friess2, R. Zobel3, Z. Grabarevic4, Lj. Barbic1, Z. Stritof1,
Z. Milas1, V. Staresina1
Department of Microbiology and Infectious Disease with Clinic, Faculty of Veterinary Medicine,
of Zagreb, Zagreb, Croatia.
1
2
Institute of Virology, Faculty of Veterinary Medicine, Zurich, Switzerland.
3
4
University
Vetmed d.o.o., Stružec, Croatia
Department of General Pathology and Pathological Morphology, Faculty of Veterinary Medicine, University
of Zagreb, Zagreb, Croatia.
SUMMARY
Sheep associated malignant catarrhal fever is severe, highly fatal, viral disease of cloven-hoofed animals.
SA-MCF occurs worldwide, usually sporadically, although significant herd outbreaks are occasionally seen. It
is caused by ovine herpesvirus 2 (OvHV-2), member of the emerging subfamily Gammaherpesvirinae, genus
Rhadinovirus. Sheep are the natural hosts of OvHV-2 but the infection may be transmitted to cattle, pigs and
big variety of wild ruminant species. Interestingly, sheep remain healthy upon infection with OvHV-2, while
other susceptible hosts develop clinically evident disease. Exact mechanism of transmission from sheep to the
susceptible species is still not cleared. Up to now, OvHV-2 has never been successfully propagated in vitro.
However, OvHV-2 DNA has been detected in nasal secretions of sheep. Aerosolized nasal secretions containing
infectious virus has been speculated as a way in which sheep transmit OvHV-2 to susceptible animals. Generally,
infected cattle and pigs which develop symptoms of SA-MCF are considered unable to transmit disease to other
hosts. Several suspected cases of SA-MCF in cows without identification of the causative agent have been
reported previously in Croatia. In June 2005, on a farm in Stružec, north-west Croatia, where 17 diary cows and
2 heifers shared stables and meadows with dozen sheep, one of the heifers developed symptoms reminiscent
of SA-MCF. Symptoms included anorexia, high fever, profuse catarrhal discharge from the eyes and nares,
bilateral corneal opacity, necrosis of the muzzle and erosions of the buccal epithelium. Due to anorexia there
was also a significant weight loss. Ten days following onset of the disease neurological symptoms such as
ataxia, tremor, convulsions and hyperesthesia occurred. Animal died within 14 days. During the autopsy sharply
demarcated erosions on the mucosal surfaces including tongue, oral mucosa, oesophagus, abomasums, jejunum,
colon, caecum and urinary bladder were found. Histopathology revealed significant perivascular and intramural
arterial infiltrations with mononuclear cells, mostly lymphocytes. In order to confirm diagnosis, samples from
brain, cerebellum, spleen and lymph nodes were obtained and submitted to DNA extraction procedures for
molecular diagnosis. Fluorogenic real-time PCR amplification specific for OvHV-2 was preformed and OvHV-2
DNA was detected in all investigated organs. For the first time in Croatia OvHV-2 was identified and quantified
as a causative agent of SA-MCF.
Sažetak
Zarazna korica je izuzetno teška i najčešće letalna virusna zarazna bolest domaćih i divljih papkara. Bolest
se javlja širom svijeta, najčešće sporadički, no moguća je i pojava epizootija sa znatnim gospodarskim štetama.
Uzročnik zarazne korice je ovčji herpesvirus 2 (OvHV2), unutar emergentne podporodice Gammaherpesvirinae,
rod Rhadinovirus. Prirodni rezervoar ove bolesti su ovce koje ne pokazuju znakove bolesti, dok se bolest klinički
može očitovati u goveda, svinja te u različitih divljih papkara. Točan način prijenosa s ovce na prijemljive životinje
51
nije još u potpunosti razjašnjen. Također, do danas nije uspjelo izdvajanje uzročnika in vitro, no molekularnim
metodama dokazana je virusna DNA u nosnom sekretu ovaca te se smatra da je infekcija primljivih životinja
posljedica širenja kapljične infekcije s ovce na goveda. Bolest prelazi isključivo s rezervoara na domaćine,
a bolesne životinje ne izlučuju virus i ne mogu širiti infekciju. U Hrvatskoj je do sada zabilježeno nekoliko
slučajeva zarazne korice goveda, a dijagnosticiranje se osnivalo na epizootiološkim podacima, kliničkoj slici,
patoanatomskom i histopatološkom nalazu. U lipnju 2005, na jednoj farmi u mjestu Stružec (Sisačko-moslavačka
županija), u istom objektu bilo je smješteno 17 mliječnih krava i 2 junice zajedno sa desetak ovaca. U jedne
od junica pojavili su se klinički znakovi koji su upućivali na zaraznu koricu goveda. Bolest je nastupila naglo,
a očitovala se gubitkom apetita, povišenom tjelesnom temperaturom, profuznim sluzavim iscjetkom iz očiju i
nosa, obostranim zamućenjem rožnica, nekrotičnim promjenama na nosnom ogledalu i erozijama po sluznici
usne šupljine. Životinja je značajno izgubila na tjelesnoj masi, a desetak dana nakon pojave prvih znakova bolesti
došlo je i do poremetnje funkcije SŽS-a u smislu otežanog kretanja, drhtanja, grčeva i pojačane osjetljivosti
na podražaje. Životinja je uginula 14-og dana od pojave bolesti. Razudbom su ustanovljene oštro ograničene
erozije na sluznici jezika, usta, jednjaka, sirišta, tankog i debelog crijeva, slijepog crijeva i mokraćnog mjehura.
Histopatološki, ustanovljena je znatna perivaskularna i intramuralna infiltracija arterija mononuklearnim
stanicama, uglavnom limfocitima. U cilju objektivnog dijagnosticiranja bolesti uzorkovana su tkiva mozga,
slezene i limfnih čvorova u cilju identifikacije i kvantifikacije virusne DNA. Iz spomenutih organa ekstrahirana
je virusna DNA te je amplificirana metodom lančane reakcije polimeraze u stvarnom vremenu (Real-time PCR)
uporabom početnica specifičnih za OvHV-2. U svim istraživanim organima ustanovljena je i kvantificirana
OvHV-2 DNA što predstavlja prvi dokaz i kvantifikaciju uzročnika zarazne korice goveda u Hrvatskoj.
INTRODUCTION
Malignant catarrhal fever (MCF) is severe and frequently fatal disease syndrome of certain domestic
and wild cloven-hoofed animals caused by closely related members of family Gammaherpesvirinae.
Two major epidemiological forms of MCF are defined; one is known as wildebeest associated MCF
(WA-MCF) reflecting the fact that the causative agent (Alcephaline herpesvirus 1) exist in nature
as endemic subclinical infection in wildebeest. Second epidemiological form is described as sheepassociated malignant catarrhal fever (SA-MCF) and it is caused by closely related ovine herpesvirus 2
(OvHV-2) (PLOWRIGHT et al., 1990). Wildebeest associated MCF is restricted to African continent
e.g. to the places inhabited by the wildebeest, while sheep associated MCF occurs worldwide. Though
never successfully propagated in vitro there is a substantial epidemiologic, serologic and molecular
evidence that all varieties of domestic sheep represent a reservoir of OvHV-2 that can be transmitted
to susceptible, poor adopted ruminants, such as domestic cattle, deer, other wild ruminants and,
recently reported, also to pigs (ALBINI et al., 2003; KIM et al., 2003; LI et al., 2005). SA-MCF
usually appears sporadically and affects only one or few animals, but occasionally significant herd
outbreaks can be seen (BEREZOWSKI et al., 2005).
The disease may present a wide spectrum of clinical manifestations ranging from the peracute
form, when minimal changes are observed prior to death, to the more florid cases characterized with
more specific symptoms. In both forms of the disease, animals with clinical signs are not a source of
infection as virus is only excreted by the natural hosts – wildebeest and sheep, respectively (LI et al.,
1995; ACKERMANN, 2006).
Since the etiological agent has never been propagated in vitro, routine diagnostics of the diseases
in the past relied mostly on clinics, pathology and histopathology. Recently usefulness and advantages
of molecular methods for detection and identification of viral DNA were reported (BAXTER et al.,
1993; LI et al., 1995).
Suspected cases of SA-MCF in cows without identification of the agent have already been
reported in Croatia during the last decades. This paper describes a case of SA-MCF in 13 month52
old heifer from northwest Croatia and subsequent diagnostic findings including identification and
quantification of OvHV-2 DNA in different organs.
CASE HISTORY
Assessment of epidemiological data and clinical signs. In June 2005, on a farm in northwest Croatia, where 17 Simmental diary cows and 2 heifers shared stables and meadows with a
dozen sheep, a 13 month-old heifer showed symptoms reminiscent of SA-MCF; anorexia, high
fever, bilateral corneal opacity, profuse catarrhal discharges from the eyes and nares, necrosis of the
muzzle and erosion of the buccal epithelium. Due to anorexia there was also a significant weight
loss. Ten days following onset of the disease neurological symptoms occurred, such as ataxia, tremor,
convulsions and hyperesthesia and animal died.
Pathology and histopathology. Macroscopically lymph nodes were swollen. Sharply demarcated
erosions were found on the most mucosal surfaces including tongue, oral mucosa, oesophagus,
abomasums, jejunum, colon, coecum and urinary bladder. Hemorrhagic punctuations were found on
the larynx, trachea, pericardium, endocardium and gall bladder. Epicardium of the right atrium was
thickened and covered with fibrinoso-haemorrhagic exudates. In the eyes, congestion and oedema
with bluish opacity were noted. Sharply demarcated necrotic skin lesions on the thorax were also
seen. A brain was congested and the lungs were oedematous.
Following the autopsy, organ samples were taken for histopathological analysis. After formalin
fixation, the samples were embedded in paraffin and cut on 5 µm thick slices which were deparaffinized
and stained with routine haematoxylin-eosin method. Histopathologicaly, the most important finding
was very significant perivascular and intramural arterial infiltrations with mononuclear cells, mostly
lymphocytes.
Real-time PCR. Formaldehyde fixed samples from brain (73a, non-identified region), cerebellum (73b),
spleen (73c, 73d), and lymph nodes (73e, 73f) were obtained. 25 mg from each brain, cerebellum, and lymph
nodes or 10 mg from spleen were washed twice with phosphate buffered saline (PBS) before DNA extraction.
DNA was extracted from tissues using the QIAamp DNA Mini Kit (Qiagen, Basel, Switzerland)
according to the protocol of the supplier. In order to reduce viscosity, the lyzed sample was transferred
to a QIAshredder column (Qiagen) and centrifuged at room temperature for 5 minutes (ALBINI et
al., 2003). The DNA was eluted in a volume of between 70 and 100 µl. Fluorogenic real-time PCR
amplification specific for OvHV 2 DNA was performed in duplicate wells with 10 µl template or with
a 1:10 dilution of it, using the primers, probe, reaction mix and thermal cycle conditions essentially
as described previously (HUSSY et al., 2001). A synthetic 72mer consisting of the primary target
sequences was used as a positive control. Negative controls consisted of one sample without added
DNA (negative control 1) and one sample containing the eluted from an unloaded column (negative
control 2).
Results are shown in Table 1. Indeed, OvHV-2 DNA was detected in brain, cerebellum, spleen as
well as lymph nodes, indicating that the corresponding animals had been infected with OvHV-2, the
agent of sheep-associated malignant catarrhal fever.
53
Table 1. Detection of OvHV-2 DNA in samples from Croatian cattle with suspected MCF.
Sample
Positive control
Ct value
Interpretation
29, 31
OvHV-2 DNA detected
Negative control 1
Not applicableb
Not detected
Negative control 2
Not applicable
Not detected
Brain (73a)
26, 26
OvHV-2 DNA detected
Brain (73a) 1:10
33, 32
OvHV-2 DNA detected
Cerebellum (73b)
Not tested
a
Cerebellum (73b) 1:10
32, 31
OvHV-2 DNA detected
Spleen (73c)
28, 28
OvHV-2 DNA detected
Spleen (73c) 1:10
27, 28
OvHV-2 DNA detected
Spleen (73d)
26, 27
OvHV-2 DNA detected
Spleen (73d) 1:10
26, 26
OvHV-2 DNA detected
Lymph node (73e)
Not applicable
Not detected
Lymph node (73e) 1:10
24, 24
OvHV-2 DNA detected
Lymph node (73f)
27, 27
OvHV-2 DNA detected
Lymph node (73f) 1:10
25, 24
OvHV-2 DNA detected
Ct values from two independent wells are shown
a
If a Ct value has not been detected until cycle 40 of the real-time PCR reaction, the corresponding sample is
considered to be negative. The term “Ct value” is therefore not applicable for negative samples.
b
DISCUSSION
Suspected cases of SA-MCF in cows without identification of the agent have already been
reported in Croatia, especially in northwest areas where cows usually share stables and meadows with
sheep. Also in this case epidemiological data revealed close contact of heifer with sheep. Clinical
findings were consistent with those already described in literature (OIE, 2004), but regarding the
fact that clinical findings and gross pathological examination can not be relied on, cause they can
be extremely variable, histopathological examination of a variety of tissues has been preformed.
Finding of significant perivascular and intramural arterial infiltration of mononuclear cells, mostly
lymphocytes, is characteristic for SA-MCF and provide us a more certain diagnosis.
It must be emphasised that SA-MCF is one of the few known infectious diseases for which an
etiological agent has never been isolated. An evidence of OvHV-2 infection relies only on presence
of antibodies in reactions where AVH-1 infected cells were used as antigen and on the detection
and amplification of viral DNA in various clinical materials such as peripheral blood leukocytes of
clinically affected animals as well as fresh tissues and paraffin-embedded samples collected post
mortem (LI et al., 1994; HUSSY et al., 2001). Since viral DNA has been detected, a various highly
specific and sensitive PCR (Polymerase chain reaction) methods have been employed worldwide in
studies of the disease in clinically affected animals and the natural hosts.
Fluorogenic real-time PCR amplification specific for OvHV-2 DNA was performed in our study
and OvHV-2 DNA was detected in brain, cerebellum, spleen as well as lymph nodes. Detection of
OvHV-2 DNA in a variety of tissues from animals with MCF-like disease, clearly demonstrates
54
that those animals had been infected with OvHV-2. Since OvHV-2 is found only on extremely rare
occasions in healthy animals (MULLER-DOBLIES et al., 2001A, 2001B), a causative involvement
of OvHV-2 in the observed disease is extremely likely. However, inhibition of the PCR reaction
in undiluted samples has previously been observed (ALBINI et al., 2003). Therefore it was not
surprising that one undiluted sample reacted negatively, whereas the Ct values obtained from the
1:10 dilution were often equal to or even lower than Ct values obtained from undiluted DNA. A PCR
method, especially real-time PCR emerged as a robust test that can be employed to detect viral DNA
in various clinical materials such as peripheral blood leukocytes of clinically affected animals as well
as fresh tissues and paraffin-embedded samples collected post mortem (BAXTER et al., 1993; LI et
al., 1995; HUSSY et al., 2001). Finally, for the first time, using fluorogenic real-time PCR, OvHV-2
was identified and quantified in one Croatian cow as the causative agent of SA-MCF.
LITERATURE
ACKERMANN, M. (2006): Pathogenesis of gammaherpesvirus infections. Vet. Microbiol. 113, 211-222.
ALBINI, S., W. ZIMMERMANN, F. NEFF, B. EHLERS, H. HANI, H. LI, D, HUSSY, M. ENGELS, M.,
ACKERMANN (2003): Identification and quantification of ovine gammaherpesvirus 2 DNA in fresh and
stored tissues of pigs with symptoms of porcine malignant catarrhal fever. J. Clin. Microbiol. 41, 900-904.
BAXTER, S.I.F., I. POW, A. BRIDGEN, H.W. REID (1993): PCR detection of the sheep-associated malignant
catarrhal fever. Arch.Virol., 132, 149-159.
BEREZOWSKI, J.A., G.D. APPLEYARD, T.B. CRAWFORD, J. HAIGH, H. LI, D.M. MIDDLETON, B.P.
O’CONNOR, K. WEST, M. WOODBURY (2005): An outbreak of sheep-associated malignant catarrhal
fever in bison (Bison bison) after exposure to sheep at a public auction sale. J.Vet. Diagn. Invest. 17, 5558.
HUSSY, D., N. STAUBER, C.M. LEUTENEGGER, S. RIEDER, M. ACKERMANN (2001): Quantitative
fluorogenic PCR assay for measuring ovine herpesvirus 2 replication in sheep. Clin. Diagn. Lab. Immunol.
8,123-128.
KIM, O., H. LI, T.B. CRAWFORD (2003): Demonstration of sheep-associated malignant catarrhal fever virions
in sheep nasal secretions. Virus Res. 98, 117-122.
LI, H., D. O’TOOLE, O. KIM, L. OAKS, T.B. CRAWFORD (2005): Malignant catarrhal fever-like disease in
sheep after intranasal inoculation with ovine herpesvirus. J.Vet. Diagn. Invest. 2. 17, 171-175.
LI, H., SHEN, D.T., D. O’TOOL, D.P KNOWLES, J.R. GORHAM, T.B. CRAWFORD, (1995): Investigation of
sheep-associated malignant catarrhal fever virus infection in ruminants by PCR and competitive inhibition
enzyme-linked immunoadsorbant assay. J. Clin. Microbiol. 8, 2048-2053.
LI, H., D.T. SHEN, D. O’TOOL, D.P. KNOWLES, J.R. GORHAM, T.B. CRAWFORD (1994): Competitive
inhibition enzyme-linked immunoadsorbant assay for antibody in sheep and other ruminants to a conserved
epitope of malignant catarrhal fever virus. J. Clin. Microbiol 7, 1674-1679.
OIE (2004): Manual of diagnostic tests and vaccines for terrestrial animals. Malignant catarrhal fever. 5th
edition. Chapter 2.3.14.
MULLER-DOBLIES, U. U., J. EGLI, B. HAUSER, H. LI, M. STRASSER, F. EHRENSPERGER, U. BRAUN,
M. ACKERMANN (2001a): Malignant catarrhal fever in Switzerland: 2. Evaluation of the diagnosis.
Schweiz Arch. fur Tierheilkd. 143, 581-91.
MULLER-DOBLIES, U. U., J. EGLI, H. LI, U. BRAUN, M. ACKERMANN (2001b): Malignant catarrhal
fever in Switzerland. 1.Epidemiology. Schweiz Arch. fur Tierheilkd. 143, 173-83.
PLOWRIGHT, W. (1990): Malignant catarrhal fever virus. In: Virus Infection of Ruminants (Dinter, Z.,B.
Morein,, Eds), 123-150.
55
56
Detection of persistently infected (PI) calves with
bovine viral diarrhea virus (BVDV) using “Ear Notch
Test” and comparing it by Immuno-capture ELISA
Otkrivanje perzistentno inficirane (PI) teladi s goveđim
virusom virusnog proljeva (BVDV) koristeći rez uške i
njegova usporedba s Immuno-capture ELISOM
Nadalian M.1, Sadeghi-Nasab A.2*, Hemmatzadeh F.3, Nadjafi J.4, Seifoori
P.4, Gorjidooz M.6, Bahonar A.7
1
Faculty of Veterinary Medicine, University of Tehran, Clinical Sciences, Tehran, Iran
Junior school of veterinary medicine, Bu-Ali Sina University, Clinical Sciences, Hamedan, Iran
2
Faculty of Veterinary Medicine, University of Tehran, Department of Microbiology, Tehran, Iran
3
Iran Veterinary Organization, Department of pathobiology, Tehran, Iran
4
Bovine herd helth manager, Tehran, Iran
6
7
Facutly of Veterinary Medicine, University of Tehran, Department of Food Hygiene, Tehran, Iran
*Corresponding author’s e-mail: [email protected]
Abstract
For detection of persistent infected (PI) calves with bovine viral diarrhea virus (BVDV) immunohistochemistry
(IHC) using ear notch samples compared with an antigen-capture ELISA (ACE) technique and confirmed by
RT-PCR. Blood samples of 552 Holstein calves and cows with 6-24 months old from 15 dairy farms located
in Tehran province (Iran), submitted for detection of BVDV antigen in buffy coat cells using ACE, RT-PCR
and also their formalin fixed ear notch samples by IHC. The results analyzed by SPSS for determination of
sensitivity, specificity and Kappa value of ACE and IHC. Calves were classified as PI if they remained positive
by 3 separate weeks double ACE or RT-PCR. Accordingly, RT-PCR confirmed 13 PI calves but ACE detected
6 cases, 46.15% (6/13) and IHC 10 cases, 76.92% (10/13), correctly. According to RT-PCR, specificity of ACE
and IHC was determined 100% and 84.21% respectively. Kappa value between IHC- RT-PCR and ACE- RTPCR determined 0.61 and 0.493 respectively. The results have shown that IHC is more effective method for
detection of PI calves than ACE. Ear notch is an easy, accurate and less expensive ante mortem diagnostic test
for detecting PI calves. But the results confirmed that using double ACE and confirming its results by RT-PCR
is better than using IHC and RT-PCR for screening of PI calves.
Key words: BVDV, RT-PCR, Immunohistochemistry, ear notch, PI calves
Sažetak
BVDV uzrokuje česte infekcije u goveda koje se manifestiraju različitim sindromima. Prenatalna infekcija
može kod teladi prouzrokovati imunotoleranciju i perzistentnu infekciju (PI), kao i bolest sluznice. Telad s
perzistentnom infekcijom je najveći prenositelj bolesti unutar i između stada. Tako se strategije spriječavanja
BVDV-a većinom svode na identifikaciju i eliminaciju takve teladi. Cilj ovog istraživanja bio je utvrditi
pouzdanost i provodljivost imunofistokemijskih metoda koristeći uzroke rezova uha, te ih usporediti s ELISA
tehnikom za detekciju BVDV PI životinja (potvrđenih s RT-PCR).
Materijali i metode: Uzorci krvi od 552 Holsteinse teladi i krava starosti od 6 do 24 mjeseci, sa 15 različitih
farmi iz teheranske regije (Iran), korišteni su za dokazivanje BVDV antigena u buffy coat stanicama koristeći
ACE, RT-PCR kao i formalinom fiksiran rez uha za IHC. Rezultati su zatim analizirani s SPSS za determinaciju
senzitivnosti, specifičnosti i Kappa vrijednost ACE-a I IHC-a. Rezultati: Telad je klasificirana kao PI ako je
57
ostala pozitivna u tri zasebna, s razmakkom od tjedan dana, dvostruka ACE i RT-PCR testiranja. S RT-PCR-om
je ustanovljeno 13 PI jedinki, dok s ACE-om 6 jedinki, 46,15% (6/13) I IHC 10 slučajeva, 76,92% (10/13). S
obzirom na RT-PCR, specifičnost ACE-a I IHC-a bila je 100% i 84,21%. Kappa vrijednost između IHC-RT-PCR
I ACE-RT-PCR je iznosila 0,61 i 0,493.
Zaključak: Rezultati IHC-a I RT-PCR-a se nisu podudarali kod 6 teladi. Kod 3 teleta , IHC je bio pozitivan,
dok je RT-PCR bio negativan. S obzirom da se virusni antigen može dokazati u tkivima i duže vrijeme nakon što
virus više nije prisutan u krvi, vjerojatno je telad ranije imala epizodu akutne infekcije te se rezidualni virusni
antigen još uvijek mogao dokazati u tkivima. Tri teleta pozitivna RT-PCR-om nisu bila pozitivna s IHC-om.
To je vjerojatno virus te teladi nije bio otkriven označenim protutijelima ili pak virus nije bio prisutan u koži.
Ovi su rezultati pokazali da je IHC metoda dijagnostike uspješnija za detekciju PI teladi od ACE-a. Ušni rez je
jednostavna, točna i jeftina posmortalna metoda otkrivanja PI teladi. Rezultati su pak pokazali da je za skrining
PI teladi bolje korištenje dvostruke ACE i provjera rezultata RT-PCR-om nego korištenje IHC I RT-PCR-a.
Ključne riječi: BVDV, RT-PCR, imunohistokemija, ušni rez, PI telad
Introduction
Bovine viral diarrhea virus (BVDV) is a common pestiviruse infection of cattle causing many
of disease syndromes (2, 6, 15). Prenatal infection can also result immunotolerance and persistent
infection (PI) in calves and mucosal disease. PI calves are regarded as the major source of spreading
BVDV within and among herds. Therefore, eliminating BVDV strategies are most relying in part
on accurate identification and removal of PI calves from herds(12, 18, 19, 20). The objective of this
study was to evaluate the reliability and feasibility of immunohistochemistry (IHC) using ear notch
samples, comparing to an antigen-capture ELISA (ACE) technique for the detection of BVDV PI
animals (confirmed by RT-PCR).
Materials and methods
Blood samples of 552 Holstein calves and cows with 6-24 months old from 15 dairy farms
located in Tehran province (Iran), submitted for detection of BVDV antigen in their buffy coat cells
using ACE, RT-PCR and also their formalin fixed ear notch samples by IHC. The results analyzed
with SPSS for determination of sensitivity, specificity and Kappa value of ACE and IHC. Blood
samples were collected from jugular vein in 10 ml vacutainer tubes contain 1 ml of 3.85% sodium
citrate and delivered to the laboratory in the ice containers (4 °C) maximum within 24 h. The skin
biopsies were collected from the distal part of the ear using an “ear notcher” to obtain a cylindrical
1 cm diameter of the ear pinna. Notcher was washed with water and disinfected with 2% formalin
solution between each collection. Samples were fixed in 10% buffered formalin solution.
3-1) Antigen-Capture ELISA (ACE): Detection of BVDV antigen in Buffy coat cells was
performed using a commercially available kit (Pestivirus antigen detection kit, Moredun Scientific
Limited, UK). According to the manufacturer’s instructions, after sample preparation and antigen
extraction, assay protocol at 450 nm within 30 minutes and based on recommended OD limits (C1
>0.8, C2 = 0.4-0.6, C3 = 0.2-0.4, C4<0.2) was performed.
3-2) Reverse Transcription–PCR (RT-PCR): Reverse transcription–PCR, as described (22)
and modified previously (14), was performed on buffy coat samples from all examined calves.
TriPure isolation reagent (Roche diagnostic GmbH, Mannheim, Germany) was employed for
RNA extraction. After this stage cDNA was synthesized and then PCR procedure was performed
(14, 22)
58
One primer set, forward (5’-ATGCCCTTAGTAGGACTAGCA-3’) and reverse
(5’-TCAACTCCATGTGCCATGTAC-3’) specific for all of pestiviruses was used for RT-PCR
according to Vilcek et al (1994) which was modified by Kargar Moakhar et al (2004)(14). In this
PCR process, one positive cDNA derived from NADL strain and one negative cDNA obtained from
non-infected cell culture was used as positive and negative control, respectively. The electrophoresis
analysis of the PCR products was run in 1.5% agarose gel using TAE buffer at 100V for 45 min.
Visualization of ethidium bromide stained DNA bands was performed by a UV transilluminator and
gel images were printed using video camera and thermal printer (Figure1).
3-3) Immunohistochemistry (IHC): From formalin fixed ear notch samples referred to
pathology lab serial sections were performed. Five-micrometer tissue sections were mounted on
poly-L-lysine-coated slides and stained for BVDV by using a manually procedure adapted from a
previously described technique (11). Anti-BVDV (pesti) monoclonal antibody labelled with fluorescein
isothiocyanate (BIO 316, Bio-X diagnostics kit, Belgium) was used. Stained sections were examined
by fluorescent microscopy. Positive Immunofluorescent (IF) staining for BVDV was green fluorescent
evidnce within the cytoplasm of keratinocytes of epidermis and hair follicles, sebaceous epithelial
cells, mononuclear cells in dermis, vascular smooth muscle cells and chondrocytes (Figure2).
Results
Calves were classified as PI if they remained positive by 3 separate weeks double ACE or RTPCR. Accordingly, RT-PCR confirmed 13 PI but ACE detected 6 cases, 46.15% (6/13) and IHC 10
cases, 76.92% (10/13), correctly. According to RT-PCR, specificity of ACE and IHC was determined
100% and 84.21% respectively. Kappa value between IHC- RT-PCR and ACE- RT-PCR determined
0.61 and 0.493 respectively (table).
Figure 1) Gel electrophoretic analysis of PCR products using a specific primer for pestiviruses. Lane 1 positive control, lane 2-7: positive samples with 288bp band, lane 8: negative control and M: 100bp marker.
59
P Value
84.21
SE□
76.92
Kappa value
Negative predictive
value
76.92
Positive predictive value
Sensitivity %
16
Specificity %
Non PI and true negative
detected
10
Non PI but false positive
IF‫٭‬
PI but false negative
Tests
PI and true positive
detected
Table) Comparison of results of Immunofluorescent and ACE with Rt-PCR
0.61
0.145
0.001
ACE♣
6
7
0
19 46.15
100 100
70.83 0.493 0.144
‫(٭‬IF) Immunofluorescent ,♣ Antigen-Capture ELISA (ACE) , □Standard Error
0.001
3
3
84.21
Figure 2) Positive IHC staining for BVDV. Green fluorescent evidence within the cytoplasm of keratinocytes
(A1, A2, B3), sebaceous epithelial cells (C5, D6), mononuclear cells of dermis (C4), chondrocytes (D7).
60
Conclusions
Surprisingly, the lowest sensitivity was obtained with ACE, which resulted in higher numbers of
false negatives. Several factors could account for this; occasionally, PI valves can produce neutralizing
antibodies which will reduce viruses to the undetectable levels by ACE, but Rt-PCR will not affect
(3). Rt-PCR can detect trace amounts of viruses in blood of transient infected animals (8) and finally
it is likely, our positive cases were not being enough for evaluation of used kit efficacy.
IHC technique has been described for detection of acute (1, 5, 17, 21) or persistent infection
(4, 10, 11, 13, 16) with the various performance. Results of IF and Rt-PCR of 6 calves were in
disagreement. In 3 calves, IF were positive but Rt-PCR was negative. Because viral antigen may
be detectable in tissues for an extended time after the virus has been cleared from the blood (4, 17),
it is likely, these calves had undergone an acute infection prior and that residual viral antigen was
still detectable in their tissues. Three PI calves which were detected by Rt-PCR were not positive by
IF. It is likely, the viral antigens of these PI calves were undetectable by used labelled monoclonal
antibody (the used monoclonal antibody is directed against the NS3 protein) or may be undetectable
as a cause of long lasting formalinization (2) or lack of sufficient viral antigens in the examined skin
sections (1, 11).
IF staining is inherently subjective in interpretation, even in the hands of experienced
diagnosticians (5). This is compounded by the relatively poor definition of cells and tissues afforded
by poorly prepared tissue sections. In addition, the immunohistochemical staining procedure uses
proteolytic enzymes that may allow the recognition of viral antigens that are masked as a result
of autolysis and therefore not detectable using the routine FA testing method (5). Use of different
monoclonal antibodies may have accounted for some of the disparity in results between the FA and
Rt-PCR and even other IHC studies.
The results represent, IF is more effective method for detection of PI calves than ACE. Ear notch
is an easy, accurate and less expensive ante mortem diagnostic test for detecting PI calves. But the
results confirmed that using double ACE and confirming its doubtful results by Rt-PCR is better than
using IHC and Rt-PCR for screening of PI calves.
According to this study, the sensitivity of IF is greater than ACE for detection of PI animals
(76.92% versus 41.15%). Kappa value between Rt-PCR and IF is 0.61 which represent a good
agreement (P value=0.001) (9). IF could be used as a screening test but false negative cases would
be missed because it is a single step test. Despite of simple sampling, transporting, inexpensive and
other advantages mentioned, it is better to use conventional protocol, double ACE with 3 weeks
separation for screening PI animals in herds (7).
References
1. Baszler, TV; Evermann, JF; Kaylor, PS; Byington, TC and Dilbeck, PM (1995). Diagnosis of naturally
occurring bovine viral diarrhea virus infections in ruminants using monoclonal antibody-based
immunohistochemistry.Vet. Pathol. 32, PP: 609-618.
2. Brock, KV (2004). The many faces of bovine viral diarrhea virus. Veterinary Clinics of North America:
Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 115-169.
3. Brock, KV; Grooms, DL; Ridpath, JF and Bolin, SR (1998). Changes in levels of viremia in cattle
persistently infected with bovine viral diarrhea virus. J. Vet. Diagn. Invest.10(1),PP: 22-26
4. Cornish, TE; Olphen, AL; Cavender, JL; Edwards, JM; Jaeger, PT; Vieyra, LL; Woodard, LF; Miller, DF
and O’Toole D (2005).Comparison of ear notch immunohistochemistry, ear notch antigen-capture ELISA,
61
and buffy coat virus isolation for detection of calves persistently infected with bovine.viral diarrhea virus.
J. Vet. Diagn . Invest. 17, PP: 110–117.
5. Ellis, JA; Martin, K; Norman, GR and Haines, DM (1995). Comparison of detection methods for bovine
viral diarrhea virus in bovine abortions and neonatal death. J Vet Diagn Invest. 7: 433-436.
6. Hemmatzadeh, F; Mommtaz, H; Keyvanfar, H and Bani-hasan, E (2006). Antigenic pattern of BVDV
isolated in IRAN. Indian Veterinary Journal. 82(10), PP: 1048-1050.
7. http://www.oie.int/eng/normes/mmanual/A_00132.htm. (2004): BOVINE VIRAL DIARRHOEA, Manual
of Diagnostic Tests and Vaccines for Terrestrial Animals. CHAPTER 2.10.6.
8. Gogorza LM, Moran PE, Larghi JL, Segue R, Lissarrague C, Saracco M, Braun M, Esteban EM (2005):
Detection of bovine viral diarrhea virus (BVDV) in seroposetive cattle. Preventive veterinary medicine. 72,
49-54.
9. Gordis L (2000): Epidemiology. 2nd edition. WB Saunders Company. 77-79.
10. Grooms, DL and Keilen, ED (2002).Screening of Neonatal Calves for Persistent Infection with Bovine
Viral Diarrhea Virus by Immunohistochemistry on Skin Biopsy Samples. Clin. Diagn. Lab. Immunol. July;
9(4), PP: 898–900.
11. Haines, DM; Clark, EG and Dubovi, EJ (1992). Monoclonal antibody-based immunohistochemical
detection of bovine viral diarrhea virus in formalin-fixed, paraffin-embedded tissues. Vet. Pathol.29, PP:
27-32.
12. Houe, H; Lindberg, A and Moennig, W (2006). Test Strategies in Bovine Viral Diarrhea Virus
Control and Eradication Campaigns in Europe. J. Vet. Diagnos. Invest. 18, PP: 427-436.
13. Luzzago, C; Frigerio, M; Tolari, F; Mazzei, M; Salvadori, C; Del Piero, F and Arispici M (2006). Indirect
immunohistochemistry on skin biopsy for the detection of persistently infected cattle with bovine viral
diarrhoea virus in Italian dairy herds. New Microbiology. 29, PP: 127-131.
14. Moakhar, KR; Akhavizadegan, MA; Hemmatzadeh, F and Amini, F (2004). Genotyping of Different
Pestivirus Isolates by RT-PCR and RLFP technique. Arch. Razi Ins. 58, PP: 1-8.
15. Nettleton, PF and Entrican, G (1995). Ruminant pestiviruses. Br Vet J. 151, PP: 615-642.
16. Njaa, BL; Clark, EG; Janzen, EJ; Ellis, JA and Haines, DM (2000). Diagnosis of persistent bovine viral
diarrhea virus infection by immunohistochemistry staining of formalin-fixed skin biopsies. J. Vet. Diagn.
Investigation. 12,PP: 393-399.
17. Ridpath, JF; Hietala, SK; Sorden, S and Neill, JD (2002). Evaluation of the reverse transcriptionpolymerase chain reaction/probe test of serum samples and immunohistochemistry of skin
sections for detection of acute bovine viral diarrhea infections. Journal of Veterinary Diagn
Investigation. 14 (4), PP: 303-307.
18. Sagar, MG and Ridpath, JF (2005): Bovine Viral Diarrhea Virus: Diagnosis, Management and Control.
Blackwell Science Ltd. London, UK. PP: 123-124.
19. Saliki, JT and DuBois, WR (2004). Laboratory diagnosis of bovine viral diarrhea virus infections. Veterinary
Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 69-83.
20. Sandvik, T (2005). Selection and use of laboratory diagnostic assays in BVD control programs. Preventive
Vet. Med. 72, 1-2, 3-16.
21. Thur, B; Zlinszky, K and Ehrensperger, F (1996). Immunohistochemical detection of bovine viral diarrhea
virus in skin biopsies: a reliable and fast diagnostic tool. J. Vet.med. B 43, PP: 163-166.
22. Vilcek, S; Herring, AJ; Nettlton, PF; Lowings, JP and Paton, DJ (1994). Pestiviruses isolated from pigs,
cattle and sheep can be allocated into at least three genogroups using polymerase chain reaction and
restriction endonuclease analysis. Arch. Virol. 136, PP: 309-323.
62
Investigation of Bovine Herpesvirus-1 (BHV-1) Infection in
Relation to Fertility in Repeat Breeder Cows
Istraživanje infekcije goveđim herpes-virusom-1 u
odnosu na plodnost krava koje se preganjuju
Ayhan ATA1, Mesih KOCAMÜFTÜOĞLU 2, Sibel HASIRCIOĞLU 3, *, Mehmet KALE 3
Dept. of Theriogenology and Artificial Inseminatiom, Faculty of Veterinary Medecine, Mehmet Akif Ersoy
University, 15100, Burdur, TURKEY. 2 Dept. of Gynecology and Reproduction, Faculty of Veterinary
Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. 3 Dept. of Virology, Faculty of Veterinary
Medecine, Mehmet Akif Ersoy University, 15100, Burdur, TURKEY. * Represent author:sibel_has04@hotmail.
com
1
ABSTRACT
The aim of this study was to determine the seroprevalence of BHV-1 and investigate the relation between
BHV-1 infection and fertility in repeat breeder ( RB ) cows in Burdur province, Turkey. For this purpose,
serum samples were collected from 108 RB cows and tested by enzyme linked immunosorbent assay (ELISA)
for antibodies against BHV-1. Seroprevalence was 9.25% (10/108) in these animals. Although no significant
difference was detected between ages of seropositive and seronegative RB cows, the difference between
seropositive and seronegative RB cows for open days (OD) was statistically significant (P<0.01). The difference
for conception rate (CR) between these groups was statistically found insignificant (P=0.37). The difference
between ages of seropositive and seronegative pregnant RB cows was found significant (P<0.001) whereas OD
of these pregnant RB cows was not statistically different (P> 0.05). Also, the difference between non-pregnant
seropositive and seronegative RB cows for calving to fourth insemination date interval (CFIDI) was statistically
significant whereas the difference between ages of these non-pregnant animals was statistically insignificant.
In conclusion, the results of this study showed that there was a close relation between BHV-1 infections and
fertility in RB cows and seropositivity for BHV-1 in these animals affected the fertility of herds negatively.
Keywords: Dairy cattle, BHV-1, repeat breeder, fertility, ELISA
Sažetak:
Cilj ove studije je utvrditi serološku nadmoć BHV-1 virusa i istražiti odnos infekcije BHV-1 i plodnosti
mliječnih krava u provinciji burdar u Turskoj. Stoga su prikupljeni uzorci 108 krava s preganjanjem i testirani
ELISA testom za titar antitijela protiv BHV-1. Serološka nadmoć ( seroprevalencija je utvrđena u devet.25%
(10/108 ispitivanih životinja. Iako nije uočena signifikantna razlika između životne dobi seropozitivnih
i seronegativnih krava, razlika u broju dana seropozitivnih i seronegativnih je bila statistički signifikantna
(p<0.05 , P=0.02 S druge stran erazlika postotka koncepcije (CR između ovih dviju skupina nije bila statistički
signifikantna ( P=0.36. Zaključili smo da su rezultati ove studije pokazali da postoji bliska povezanost u infekciji
BHV-1 s neplodnošću mliječnih krava koje se preganjaju. Također je očito da seropozitivnost na BHV-1 utječe
negativno na plodnost čitavog stada.
Ključne riječi: Mliječna goveda, preganjanje, plodnost, ELISA
INTRODUCTION
The bovine herpesvirus–1 is a member of the genus Varicellovirus within the subfamily
Alphaherpesvirinae, which belongs to the family Herpesviridae (Murphy et al. 1999). This virus
causes respiratory disease- Infectious bovine rhinotracheitis (IBR) -in cattle, genital diseasesinfectious pustular vulvovaginitis (IPV) in females or infectious pustular balanoposthitis (IPB) in
63
males- and other clinical syndroms such as conjunctivitis, metritis, mastitis, encephalitis, abortion,
enteritis, loss in milk production and generalized systemic infections. Many infections run with a
subclinical course (Straub 1990).
BHV–1, like other alphaherpesviruses, can set up a latent infection in neurons of sensory ganglia
(Ackermann and Wyler 1984). Due to stressful conditions or corticosteroid treatment latent BHV–
1 can be reactivated and re-excreted at irregular intervals. Therefore, cattle latently infected with
BHV–1 can also be a source of infection (Pastoret et al. 1984).
IBR/IPV infections cause substantial economic losses such as weight loss, decrease in milk
production, abortion, neonatal and embryonic death, stillbirth and fertility disorders such as
endometritis and repeat breeder (Hage et al 1998, Miller 1991). The most important reproductive
disorders that the genital form of disease cause in infected cows are necrotising endometritis and
necrotising oophoritis. Also, these disorders can lead to the problems of repeat breeder and infertility
in infected cows (Kendrick and McEntree 1987).
In many study done, infertility problems have been associated with BHV–1 infections (Elezhary
et al. 1980, Miller 1991). Miller (1991) reported that the use of semen contaminated with IBR
virus for natural/artificial insemination probably would cause temporary infertility, lasting one to
two weeks.
The aim of this study was to determine the seroprevalence of BHV–1 and investigate the relation
between BHV–1 infection and fertility in RB cows in Burdur province, Turkey.
Farm: The study period started on March 10, 2006 and ended on April 25, 2007. The samples of
this study comprised 108 Holstein-Fresian RB cows (aged 2 to 10 yrs for cows ) kept at 30 different
dairy farms in Burdur, southwest Turkey. The main cattle-rearing activity is mixed (crop-livestock),
small-scale (2–10 cattle) dairy production. Cattle are primarily kept for milk production. Average
annual milk production on these farms was 6,000 L per cow. All animals on each farm were housed
in the same free stall barn with intensive contact between animals. Data were collected at individual
cattle and farm levels.
Animals: RB cow reproductive status was determined by palpation and condition of the fetus
was recorded. All the dairy cows in this study were examined vaginally, and were healthy and free
of anatomical abnormalities of the reproductive tract. To exclude the possible effects of reproduction
problems related to nutrition deficiency RB cows with body condition lower than 2.5 score were
not included in this study. Body condition scores were allocated on a scale of 0–5 (in increments of
0.25), with a score of 0 representing extremely thin or emaciated cows and 5 representing extremely
fat or obese cows (Domecq et al. 1997, Loeffler et al. 1999). During the study none of the RB cows
exhibited any overt clinical signs of BHV–1 or any other disease. None of the animals had ever been
vaccinated against BHV–1.
Data collection and artificial insemination (AI): Interviews were performed in order to gather
information about the farms. Information regarding the herd and each animal sampled were recorded
through a personal interview with the farmer or farm manager. AI dates, presence of pregnancy
following 6–8 weeks insemination by rectal palpation records were recorded by the inseminator.
All inseminations were performed by the same experienced veterinarian using BHV–1 free frozenthawed semen containing at least ten million of motile spermatozoa (Consorzio Semenzoo-Italy Via
Masaccio, 11- 42010 Mancasale, Italy) of proven fertility from a single bull (VANZETTI VALENT
64
RAUL ET). Fourth insemination was carried out on the day of spontaneous estrus. The stage of the
estrus cycle was determined by rectal palpation and observation of the secondary signs of estrus. The
insemination coincided with mid-estrus, as evidenced by cervical mucous discharge (CMD) and high
myometrial tone and contractility. The semen was placed into the corpus uteri. They were subjected
to AI according to the routine a.m.-p.m. scheme and used for fertility assessment. Breeding day (day
0) equals the day of onset of strong estrus signs. Calving dates were obtained from the farmer’s
records.
Pregnancy control and calculations of conception rate: Eight weeks postinsemination, rectal
examinations to determine pregnancy were carried out. When an insemination led to a positive
pregnancy check, it was defined as successful. If the outcome of an insemination was not known (e.g.
due to slaughter before pregnancy diagnosis) this observation was omitted from the calculations. If two
inseminations had occurred less than 10 days apart, they were recorded as only one insemination. CR
was calculated as the percentage of inseminations resulting in pregnancy lasting at least 8 weeks.
Serology: Blood samples (10 ml) were collected from the tail vein of each RB cow at estrus period
before fourth AI, using disposable needles (21x1.5 mm) and vacutainer tubes. After centrifugation
at 1700 g for 15 min, separated sera were stored at -20°C until analysis. BHV–1 antibodies were
determined by using a commercial available ELISA kit (Institute Pourquire IBR-ELISA). ELISA
was performed according to procedure described by the manufacturer. Test results were expressed as
positive and negative.
Statistics analyses: The mean values and standard errors of means were calculated for both
BHV–1 serologically-positive and BHV–1 serologically-negative groups. The data were determined
by Chi-square test and student’s t-test, and values of P<0.05 were regarded as significant (SPSS
software, version 11.0).
RESULTS
BHV–1 seroprevalence was 9.25% (10/108) in RB cows in Burdur province. Conception rate
was higher in BHV–1 serologically negative cows (58.62%) than BHV–1 serologically positive RB
cows (50.00%) but was not statistically significant (P>0.05). Average for OD (open days) of BHV–1
serologically-positive RB cows (344.00 ± 35.11d) were different from those of BHV–1 serologically
negative cows (184.37 ± 5.96d) and was statistically significant (P<0.01). The difference for CFIDI
between seropositive and seronegative non-pregnant RB cows was found significant (P<0.01). OD
of seropositive and seronegative pregnant RB cows was not statistically different (P=0.114). Also, no
significant difference was detected between ages of seropositive and seronegative RB cows. But, this
difference between seropositive and seronegative pregnant RB cows was found significant (P<0.001).
The difference between ages of seropositive and seronegative non-pregnant animals was statistically
insignificant (P=0.091). Reproductive parameters of BHV–1 seropositive and seronegative RB cows
are presented in Table 1. and 2.
65
Table 1. Reproductive parameters of RB cows with BHV-1 (seropositive) and BHV-1 (seronegative)
Parameters
ODa
Age (day)
CRb
a
BHV-1 (seropositive)
BHV-1 (seronegative)
n=10
n=98
P<
COWS
344.00 ± 35.11
184.37± 5.96
P=0.001**
2448.00 ± 316.58
1738.78 ± 58.57
P=0.053 NS
50.0
58.62
P=0.37 NS
Open days (day), b Conception rate (%), NS= not significant, **P<0.01, Values are mean ± SE.
Table 2. Reproductive parameters of pregnant and non-pregnant RB cows with BHV-1 (seropositive) and BHV-1
(seronegative)
Parameters
ODa
Age (day)
Parameters
CFIDIb
Age (day)
n=4
n=54
PREGNANT COWS
319.25± 60.00
187.03 ± 8.61
1800.00±0.00
1586.67± 55.91
n=6
n=44
NON-PREGNANT COWS
373.28 ± 40.97
182.14 ± 9.00
2880.00 ± 455.37
1925.45 ± 105.05
P<
P=0.114 NS
P=0.000***
P<
P=0.003**
P=0.091 NS
Open days (day), b Calving to fourth insemination date interval (CFIDI), NS*= not significant, **P<0.01,
***P<0.001 Values are mean ± SE.
a
DISCUSSION
IBR/IPV is a important disease treating genital tract and causing the problems of infertility in cows as
a result of this. Consequently, it cause substantial production and economic losses in livestock/dairy
cattle industry.
Up to now, several studies have been done to detect the relationship between IBR infections and
infertility problems of cows (especially RB cows) in Turkey and the world.
Çabalar and Akça (1994) collected 624 serum samples from cows with infertility problems (repeat
breeder, metritis, abortion) and tested for the presence of IBR/IPV antibodies by microneutralization
assay. They found to be 425 (68.10%) of 624 serum samples for IBR/IPV virus neutralizing antibodies.
They suggested that IBR virus may be an etiological agent in infertility problems of cows since high
incidence against IBR/IPV virus had been detected at herds.
Özkul et al. (1995) collected 538 serum samples from cows with infertility problems (repeat
breeder, abortion, metritis ) which were housed in 19 closed dairy herds and tested by serum
neutralisation (SN) for the presence of neutralizing antibodies against IBR/IPV virus. They found to
be seropositive 113 (21%) of 528 serum samples tested for IBR/IPV virus. They reported that IBR/
IPV virus might cause infertility in cows produced in closed dairy herds.
Bulut et al. (2003) collected serum samples from 120 RB cows and 85 healthy cows to investigate
frequency of BHV–1 infections in RB cows and tested by ELISA. They found that 85 (70.8%) of
66
120 RB cows and 59 (73.7%) of 85 healthy cows were seropositive for BHV–1. According to the
result of investigation, they concluded that there was no significant relation between seropositivity of
BHV–1 and repeat breeder statistically (P>0.05).
Biuk-Rudan et al. (1999) investigated the prevalance of antibodies to IBR and BVD viruses in
dairy cows (mostly RB cows) with reproductive disorders in four different farms. For this purpose,
they collected serum samples from 73 cows with reproductive disorders and 47 cows without
reproductive disorders and examined for IBR and BVD viruses by SN. They found that seroprevalance
of IBR was 8.2% (6/73) in cows with reproductive disroders where as seroprevalance of IBR was
14.9 (7/47) in cows without reproductive disroders. In tested all cows, they found that seroprevalance
of IBR was 85.8. Also, they found that 80.8% of cows with reproductive disorders and 46.8% cows
without reproductive disorders had antibodies to both IBR virus and BVD virus. They reported
that differences in antibody prevalance among groups with/without reproductive disorders was
statistically significant (P<0.01) and suggested to be a connection between reproductive disorders
and simultaneous infections with IBR and BVD viruses in dairy cows.
In this study, it was determined the seroprevalenceof BHV–1 and investigate the relation between
BHV–1 infection and fertility in RB cows. The seroprevalence of BHV-1 in RB cows was detected as
9.25% (10/108). Although this rate detected was found in agreement with the rate detected by BiukRudan et al. (1999), it was found lower than ones by reported Çabalar and Akça (1994), Özkul et al.
(1995) and Bulut et al. (2003). That is why sensivity of tests used as well as many factors such as the
structure and size of herd sampled, individual and regional differences.
Magana-Urbina et al. (2005) investigated the risk factors affecting serological prevalence such
as age, flooring type, origin of replacement heifers (same location, different location), herd size,
abortion history. They reported that the highest risk of IBR positive serology was found in animals
>4 years, in herds with >10 cows and in herds which replacement heifers come from other locations.
However, they explored that IBR serological prevalence increased as animal age increased. In the
current study, it was not in agreement with the results of Magana-Urbina et al. (2005) since factor
of age among seropositive and seronegative cows was statically insignificant (P=0.053). But, all
seropositive cows were aged 4 years and older as reported by Magana-Urbina (2005). In this study,
the other reason of low seroprevalence of IBR virus can be related to be chosen from small herds
(from herds with <10 cows) with low population densities and not to be entered animals from other
herds.
According to restriction endonuclease analysis (REA), BHV-1 has been reported to be three
different subtypes (1, 2 and 3). Types 2 are divided into subtypes 2a and 2b. BHV-1 subtypes 1 and 2a
are the main causes of the respiratory form of the disease and abortion. Sub-type 2b is responsible for
the venereal form of disease (IPV and IPB). Common serological tests do not discriminate between
the different BHV-1 subtypes. The BHV-1 detected are described as IBRV’s (Buik-Rudan et al. 1999,
Hage et al. 1998, Miller et al. 1991). Since BHV-1 causes infections in both respiratory and genital
system, the presence of antibody detected in this study might not be originated from an infection only
in genital system.
Miller et al. (1988) and Chiang et al. (1990) have described a decrease in the CR of initially
seronegative animals after experimental BHV-1 infection. Elazhary et al. (1980) reported that the
reason of the low CR and the high number of services per pregnancy in a herd having abortion
and infertility problems could be due to the virus infection of the embryo resulting in its death and
absorption in the early stage of pregnancy. But, Hage et al. (1998) reported that it is doubtful that
early pregnancies are terminated by BHV-1 infection although they detected a significant decrease in
67
the number of successful insemination in seronegative and seropositive dairy cows in a study which
they carried out.
Allan et al. (1975) reported that BHV-1 infection was no effects on pregnancy. In a study carried
out by Ata et al. (2006) in Burdur province, it was reported that the difference for CR among these
groups was statistically insignificant although CR was higher in BHV-1 serologically negative cows
than BHV-1 positive cows. Our result was in agreement with with the results reported by Ata et al.
(2006) in this study, a difference for CR between seropositive and seronegative animals was not
found statistically. It was concluded that BHV-1 seropositivity did not affect CR of RB cows.
In a study carried out by Ata et al. (2006), it was reported that there was a difference for open days
(OD) between seropositive and seronegative cows and BHV-1 serologically positive cows required
a longer time to conceive. But, in a study done by Magana-Urbina et al. (2005) in Mexico, it was
found no difference for OD between seropositive and seronegative cows. Our results agreed with the
results of Ata et al. (2006), concerning the OD. It has reported that Holstein cow is profitable if she
has a calving interval of 12 to 13.5 months, if milk yield exceeds 13.500 kg milk per lactation and the
ideal number of OD is 90. Among animals examined herein, the numbers of OD in seropositive and
seronegative cows were too long than this time stated (Jainudeen and Hafez 2000).
In conclusion, the results of this study showed that there was a close relation between BHV-1
infections and fertility in RB cows and seropositivity for BHV-1 in these animals affected the fertility
of herds negatively. Especially, in this study, since OD period is found long (P<0.01) in seropositive
RB cows, we consider that BHV-1 infections cause substantial economic losses by prolonged the
calving interval.
REFERENCES
Ackermann M, Wyler R, 1984, The DNA of an IPV stain of bovid herpesvirus-1 in sacral ganglia during latency
after intravaginal infection, Vet Microbiol, 9, 53-63.
Allan PJ, Dennett DP, Johnson RH, 1975, Studies on the effects of infectious bovine rhinotracheitis virus on
reproduction in heifers, Aust Vet J, 51, 370-3.
Ata A, Kale M, Yavru S, Bulut O, Buyukyoruk U, 2006, The Effect of subclınıcal bovıne herpesvırus 1 infectıon
on fertılıty of cows and heıfers, Acta veterinaria,56, 267-273
Biuk-Rudan N, Cvetníc S, Madic J, Rudan D, 1999, Prevalence of antibodies to IBR and BVD viruses in dairy
cows with reproductive disorders, Theriogenology, 51, 875-81.
Bulut H, Rısvanlı A, Tonbak S, Gulactı I, Azkur K, Bolat Y, 2003, Dol tutmayan ineklerde bovine virus 1
infeksiyonlarının sıklıgı, F U Saglık Bil Derg, 17, 23-6.
Chiang BC, Smith PC, Nusbaum KE, Stringfellow DA, 1990, The effect of infectious bovine rhinotracheitis
vaccine on reproductive efficiency in cattle vaccinated during oestrus, Theriogenology, 33, 1113–1120.
Çabalar M, Akça Y, 1994, Fertilite problemli ineklerde enfeksiyöz bovine rhinotracheitis/ enfeksiyöz pustular
vulvovaginitis (IBR/IPV) virus izolasyonu ve seropidemiyolojisi. Ankara Üniv Vet Fak Derg, 41 (3–4),
337–349.
Domecq JJ, Skidmore AL, Lloyd JW, Kaneene JB, 1997, Relationship between body condition scores and
conception of first artificial insemination in a large dairy herd of high yielding Holstein cows, J Dairy Sci,
80, 113-20.
Elazhary MASY, Lamothe P, Silim A, Roy RS, 1980, Bovine herpes virus type 1 in the sperm of a bull from a
herd with fertility problems. Can Vet J, 21, 336–339.
68
Hage JJ, Schukken YH, Dijkstra TH, Barkema HW, Van Valkengoed PHR, Wentink GH, 1998, Milk production
and reproduction during a subclinical bovine herpesvirus 1 infection on a dairy farm, Prev Vet Med, 34,
97–106.
Jainudeen MR, Hafez ESE, 2000, Cattle and buffalo, In: Hafez ESE, Hafez B, editors, Reproduction in Farm
Animals, 7th edition, Lippincott Williams & Wilkins. Maryland, USA, 159-71.
Kendrick JW, McEntree K, 1987, The effect of artificial insemination with semen contaminated with IBR/IPV
virus. Cornell Vet, 57, 3-11.
Loeffler SH, de Vries MJ, Schukken YH, de Zeeuw AC, Dijkhuizen AA, de Graaf FM, Brand A,, 1999, Use of
technician scores for body condition, uterine tone and uterine discharge in a model with disease and milk
production parameters to predict pregnancy risk at first AI in Holstein dairy cows. Theriogenology, 51,
1267–1284.
Magana-Urbina A, Rivera JLS, Segura-Correa JC, 2005, Infectious bovine rhinotracheitis in dairy herds in the
Cotzio-Tejaro region of Michoacan, Mexico, Tec Pecu Mex, 43, 27-37.
Miller JM, Van der Maaten MJ, Whetstone CA, 1988, Effects of a bovine herpesvirus 1 isolate on reproductive
function in heifers: classification as a type-2 infectious pustular vulvovaginitis virus by restriction
endonuclease analysis of viral DNA, Am J Vet Res, 49, 1653–56.
Miller JM, 1991, The effects of IBR virus infection on reproductive function of cattle, Vet Med, 95-98.
Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ, (1999), Herpesviridae, Vet Virol, Third Edition, Chapter
18, 301-311.
Özkul A, Çabalar M, Bilge S, Akça Y, Burgu İ, 1995, Süt sığırcılığı işletmelerinde rastlanan IBR ve BVD virus
enfeksiyonlarının infertilite olgularındaki rolü, Ankara Üniv Vet Fak Derg, 42, 381-387.
Pastoret PP, Thiry E, Brochier B, Derboven G, Vindevogel H, 1984, The role of latency in the epizootology
of infectious Bovine Rhinotracheitis. In: Witteman, G., Gaskell, R.M., Rziha, H.J. (Eds.), Latent Herpes
Virus Infections in Veterinary Medicine. Nijhoff Martinus, Dordrecht, 211-227.
Straub OC, 1990, Infectious bovine rhinotracheitis virus, Virus Infections of Ruminants, Edited by Z Dinter and
Morein B, Chapter 11, 71-109.
69
70
PrPsc ANALISYS IN SICILIAN SCRAPIE OUTBREAKS
Analiza PrPsc kod pojave svrbeža u ovaca na siciliji
Tiziana Lupo, Daniele Macrì, Vitale Maria, Antonella Migliazzo, Stefano Reale,
Fabrizio Vitale
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” – Palermo, Italy
AIM OF THE STUDY
The analysis with rapid test for the presence of prion protein revealed positive animals in more
then 35 outbreaks in Sicily. The initial outbreaks had been managed by stamping out the entire flocks
but lately the genetic analysis on prion gene had been performed to eliminate only the animals with
genotypes sensitive to the TSE. Moreover a genetic selection plan has also started in Sicily involving
autochthon breed since 2 years. The identification and genetic selection of resistant animals will be
useful to the sanitary qualification of the flocks targeted to important implications of commercial
nature and represents the new sanitary management of the ovine TSE within the Europe. The genetic
selection is based on molecular tests revealing some polymorphic sites in the PrP gene targeting the
susceptibility or the resistance status. The aim of this work is the increasing of the frequency for the
genetic resistance in the ovine population. It could be useful for the eradication of the TSE ovine and
to the selection of flocks with “low risk level” for the safeguard of human and animal health. The
Decision (EC) 2003/100 of the European Commission starts the realization in the Member States, of
regional plans of genetic selection in ovine and the guidelines concerning the sanitary monitoring of
the breeding and the genetic test for the selection of the subjects with resistant genotype.
BACKGROUND
Transmissible Spongiform Encephalopathy are natural degenerative neural disorders present
in human but also in several other animal species and in ruminant. The disorders have long time
period incubations and so only aged animals can manifest symptoms since the etiological agent is
represented by a different structure of a protein (Prion protein) naturally present in many different
tissues. The protein is specie-specific and passage from one animal specie to other one is a very rare
event in experimental conditions. But The prion strain of the Bovine Spongiform Encephalopathy
(BSE) showed to be particularly virulent and passed from cows to man as showed by the appearance
of the new variant of Creuzfeldt Jacobs. The Scrapie is a tissue disorder of sheep and goat analogous
to the BSE for the neural aspects but it doesn’t seem to be transferable to the man. The illness takes
the name from an intense itch that induces animals to rub against any surface. In Italy eradication
planning has included the scrapie in the list of the impeachable infectious illnesses from 1991 and
the first case was officially notified in 1995. The causative agent of Scrapie is a protein called PrP;
the illness is influenced by the charge of the PrP and the susceptibility of the individual. In sheep
the susceptibility is linked to the genetic profiles at the PrP gene of the single ovine subjects as
confirmed by experimental infections studies first and the analysis of data coming from the active
surveillance on TSE, lately. The aminoacids at positions 136, 154 and 171 of sheep prion protein
are particularly important and the genotype ARR/ARR is the more resistant to TSE disease. For this
reason the European Community decided a plan for genetic selection for TSE resistance on ovine
flocks in Europe.
71
In Sicily samples collections for molecular screening have been carried out in the IZS laboratories
in collaboration with Veterinary Organizations competent in the countryside.
The used method is based on the DNA extraction from whole blood with EDTA. DNA was
extracted from the blood samples by Gene Elute mammalian kit ( Sigma cat N° G1N- 350) following
manufacture’s instructions. The DNAs, after electrophoresis on agarose gel, were amplified by three
different primer sets targeted to the polymorphic sites. The amplicons were employed in reverse
hybridization tests using special strips exposing specific biotinylated labelled probes homologue
to allelic discriminants. Moreover A Real time test based on allelic discrimination, was applied on
the dubious cases too, to confirm the previous results. This method permitted us to distinguish the
homoziogote or heterozygote status by comparison of detected fluorescence signal.
RESULTS AND CONCLUSIONS
The tests were performed in Molecular Biology Department of the IZS Institute in Palermo. 3400
animals were tested during a period from 2005 to 2007.
The general percentages of PrP genotypes are described in Figure 1
Figure 1. Percentage of Scrapie genotype in general populations
The results in the general population showed that the resistance genotypes ARR/ARR is present
at 19,7% and the heterozygous ARR/ARQ is present at 41,8%. These percentages are quite high and
so it is possible that genetic selection can be reached in a short time.
New genetic analysis was finalized to the individuation of resistant animal subjects as reproducers
and in different Sicilian autochthon breeds: Comisana, Valle del Belice and Pinziritta
Analysis on individuals of specific autochthon breeds showed differential percentages but still
quite high presence of the “good genotypes” as shown in figure 2
72
It is noteworthy that highest percentages for resistant genotypes (class 1 ARR/ARR) are present
in Comisana and Pinzeritta breeds while in Valle del Belice that derived by a cross with Sarda sheep
also, is reduced to 11%
The project will allow to realize in brief times the genetic selection for the resistance to the
scrapie
Figure 2: Distribution of relative genotypes in individuals of pure breeds present in Sicilian territory.
REFERENCES
1) Bossers A, Schreuder BEC, Smits MA (1996) PrP genotype contributes to determinino survival times of
sheep with natural scapie J.Gen. Virol 77: 2669-2673.
2) Hunter N (1997) PrP genetics in sheep and the implications for scrapie and BSE. Trends Microbiol 5: 331334
3) Vaccari G., Petraroli R., Agimi U., Eleni C., Perfetti M.G., Perfetti M.A., Di Bari M.A., Morelli L., Ligios
C., Busani L., Nonno R. and Di Guardo G.. 2001: PrP Genotype in Sarda breed sheep and its relevance to
scrapie. Arch Virol. 146: 2029-2037
ACKNOWLEDGEMENTS: The authors wish to thank Dr. Alberti Placido and Mr. Giangrosso Ezio for
technical assistant.
73
74
SEROLOGICAL, VIROLOGICAL AND HAEMATOLOGICAL
EXAMINATION OF CORONAVIRUS INFECTION IN CALVES WITH
DIARRHEA AND THEIR DAMS
Serološka, virusološka i hematološka pretraga na
koronavirusnu infekciju u teladi s proljevom te
njihovih majki
S. YAVRUa,*, O. YAPICIa, M. KALEb, Ş. ŞAHİNDURANc, F. PEHLİVANOĞLUd, M.K.
ALBAYc, O. AVCIa
Selçuk University, Faculty of Veterinary Medecine, Dept. of Virology, 42075, Konya-TURKEY. b Mehmet Akif
Ersoy University, Faculty of Veterinary Medecine, Dept. of Virology, 15100, Burdur-TURKEY. c Mehmet Akif
Ersoy University, Faculty of Veterinary Medecine, Dept. of Internal Medecine, 15100, Burdur-TURKEY. d Mehmet Akif Ersoy University, Faculty of Veterinary Medecine, Dept. of Microbiology, 15100, Burdur-TURKEY.
*
Corresponding author. E-mail: [email protected]
a
ABSTRACT
In this study, following clinical examination of 3500 cattle and their calves from 25 number of dairy farms.
184 calves (<1 - ≤6 months age, a twin calf) with diarrhea and their dams (183) (≥2 - ≤6 age) were sampled for
coronavirus presence by ELISA (investigated for antigen in faecal samples and antibody in blood serum samples
of calves and only antibody presence in blood samples of their dams). Additionally, all blood samples were
examined by hematological methods. One hundred seventy two (%93.99) cows and 172 (%93.99) calves were
found seropositive. While the high level of antibodies for coronaviruses were detected as 36.05 % in dams 6
years and older ages, the lower level of antibodies were detected in ages between ≥2 - <3 and ≥5 - <6. In the
calves, Ab to coronavirus were found at the highest level (25.26%) in the female calves ≥5 - ≤6 months age but
the lowest level (11.69%) antibody was found in the male calves ≥2 - <4 months of ages. Coronavirus (Ag) was
detected in only faecal sample of a (%0.54) calf. hen the haematological parameters were compared between Ab
(+) and Ab (-) dams, only White Blood Cell (WBC) values were found statistically significant (p<0.05). When
the haematological parameters were compared between Ab (+) and Ab (-) calves, WBC (p<0.05), Lymphocyte
(p<0.01) and Granulocyte (p<0.01) values were found statistically important. When haematological parameters
were compared between each positivity degrees of coronavirus Ab (+) dams and Ab (+) calves no statistical
difference were detected. When the haematological parameters were compared between coronavirus Ab (+)/Ag
(+) and Ab (-)/Ag (-) calves, both lymphocyte and granulocyte values were statistically important (p< 0.01).
Acoording to haematological parameters, Ab (+) calves had lymphocytosis when compared to Ab (-) calves.
Sažetak
U ovom pokusu praćeno je 3500 krava i njihova telad s 25 mliječnih farmi. 184 teleta (<1 - ≤6 mjeseci starosti,
blizanci) s proljevom te njihove majke (183) (≥2 - ≤6 ??? starosti) uključeno je u pretragu na koronaviruse ELISA
metodom (dokazivanje antigena u uzorku fecesa i antitijela u uzorcima krvnog seruma teladi te dokazivanje samo
prisutnosti antitijela u organizmu njihovih majki). Dodatno, na svim uzorcima krvi sprovedena je hematološka
pretraga krvi. Sto i sedamdeset i dvije (%93.99) krave i 172 (%93.99) teleta uključenih u ovu pretragu su
bili seropozitivni. Dok je visoka razina antitijela za koronaviruse otkriven u 36,05 % krava starih 6 godina i
starijih, niža razina antitijela je otkrivena u krava starih između ≥2 - <3 i ≥5 - <6 godina. U teladi, antitijela za
koronaviruse pronađena su u najvećem postotku (25,26 %) u ženske teladi starosti 5 – 6 mjeseci, dok je najniža
razina antitijela (11,69 %) pronađena u muške teladi starosti 2 – 4 mjeseca. Koronavirus (antigen) je otkriven
75
samo u uzorku fecesa u 0,54 % teladi. Kada su parametri hematološke pretrage uspoređeni između Ab(+) i Ab(-)
teladi, samo su vrijednosti bijelih krvnih stanica (WBC) bili statistički signifikantni (p<0.05). Kada su parametri
hematološke pretrage uspoređeni između Ab(+) i Ab(-) teladi, vrijednosti bijelih krvnih stanica (WBC), limfocita
(p<0.01) i granulocita (p<0.01) su bili statistički značajni. Kada su parametri hematološke pretrage uspoređeni
između koronavirusa Ab(+)/Ag(+) i Ab(-)/Ag(-) u teladi, vrijednosti i limfocita i granulocita su bili statistički
značajni (p< 0.01).
Ključne riječi : Koronavirus, proljev, serološka pretraga, virusološka pretraga, hematološka pretraga, mliječna
goveda.
INTRODUCTION
Coronaviruses, described the first time with EM in 1968 (Mostl, 1990), are in Nidovirales
(Van Regenmortel et al., 2000) order Coronaviridae family (Park et al., 2006, Park et al., 2007a).
Coronaviruses posses the largest genome among RNA viruses and linear, nonsegmented, single
stranded, positively polaritated (De Viries et al., 1997, Kapil et al., 1999). Virions have had 5 major
proteins, nucleokapsid (N) protein, peplomer (S), transmembrane (M) and small transmembrane (E)
glycoprotein, and hemagglutinin-esterase (HE) (Lai and Cavanagh, 1997, Chouljenko et al., 1998).
Coronaviruses, identified as a diarrhetic agent in calves the first time by Mebus et al. (1972) in
1973 in USA, cause diarrhea in calves (Cho et al., 2000, Bridger et al., 1978), winter dystenteria in
adult cattle (Durham et al., 1989, Benfield and Saif 1990, Saif et al., 1991, Clark, 1993, Fukutomi et
al., 1999, Cho et al., 2000, Park et al., 2007b), and respiratory system infections in various aged cattle
(McNulty et al., 1984, Hasoksuz et al., 2005).
In this study, the presence of Coronaviridae infections in both calves and their dams in private dairy
managements with diarrhea problems. Additionally, the animals were evaluated haematologically.
FECAL SAMPLES- The fecal samples were collected from 184 calves with diarrhea signs
determined with clinical examinations in 25 private cattle managements in Burdur. The fecal samples
were transferred under cold chain in a cooler to the laboratory and kept at -80ºC until tested.
SERUM SAMPLES- The blood samples were collected from 184 calves with diarrhea signs
determined with clinical examinations and their dams in 25 private cattle managements in Burdur.
The blood samples collected in normal sterile vacuum tubes were transferred under cold chain in a
cooler to the laboratory and santrifuged at 2000-3000 rpm for 10 min. for serum separation. Then, the
serum samples were inactivated at 56ºC for 30 min. and kept at -80ºC until tested.
ELISA- Serum samples of both calves and their dams were analyzed for presence of antibody
to coronaviruses by indırect ELISA (Bio-X Diagnostics,Belgium) according to test prosedure. The
fecal samples of calves were thawed and tested for presence of coronavirus antigen by direct ELISA
(Bio-X Diagnostics, Belgium).
HAEMATOLOGICAL PARAMETERS- The blood samples were collected in the sterile tubes
with EDTA from v. jugularıs. For determination of blood parameters, MS9 Cell Counter Equipment
(USA) was used. The samples were tested at the same day.
RESULTS
While the highest amount of antibody to coronavirus was detected in female calves with ≥ 5 - ≤6
months of age, the lowest amount of antibody was detected in male calves ≥2- <4 months of age.
76
Coronavırus antigen was detected in only one calf fecal sample (0.54%) among 184 fecal samples
by direct ELISA.
Total 172 (93.99 %) calves and 172 (93.99 %) cows were found seropositive to coronaviruses.
While the highest seropositivity (36.05 %) was detected in the dams with 6 years and older ages, the
lowest antibody level (11.05%) was found in the dams ≥2- <3 and ≥ 5-<6 years of ages.
According to haematological outcomes, total leucocyte counts increased in antibody positive
dams and calves (p<0.05). Lymphocyte (%) rate did not change in dams but the rate (%) was higher
in Ab (+) calves than Ab(-) calves (p<0.01). While no change was seen in granulocytes in Ab (+) and
Ab (-) dams, the number of the granulocytes decreased in Ab(+) calves as compared the number of
granulocytes in Ab (-) calves (p<0.01).
When haematological parameters of Ab (+)/Ag (+) and Ab(-)/Ag (-) calves were compared, Ab
(+)/Ag (+) calves had decreased lymphocytes (%) and increased granulocytes (%), Ab (-)/Ag (-)
calves had increased lymphocytes (%) and decreased granulocytes. Between two groups, statistically
important difference was detected (p<0.01).
When haematological parameters were compared between each positivity degrees of coronavırus
Ab (+) dams/Ab (-) dams and Ab (+) calves/ Ab (-) calves no statistical difference were detected.
DISCUSSION Coronavirus infectıon is one of the infections causing important economical
loses in cattle managements (Bridger et al.,1978, Saif 1993).
ELISA used for detection of antibodies to coronaviruses can also be used for detection
of coronavirus antigen (Gaber and Kapil 1999, Hasoksuz et al., 2005, Reynolds et al., 1984,
Schoenthaler and Kapil 1999). Sato and Akashı (1993) have been stated that ELISA can be used
both rutin coronavirus detection in fıeld fecal samples and virus isolation from diarrhetic faeces. The
researchers (Sato and Akashi, 1993) examined 202 fecal samples with ELISA and found 40 fecal
samples positive for coronavirus antigen.
Abraham et al. (1992) stated that the probability of calves to succumb to BCV infection in the
fırst 5 weeks of their life is quite high and especially in the fırst week antigen detection rate was
51.5%. The researchers examined 108 fecal samples from diarrhetic calves by ELISA and found
38.9% of the samples were positive for coronavirus antigen.
Snodgrass et al. (1986) examined 302 fecal samples from diarrhetic calves from 32 farms and 11
samples were found positive for coronavirus antigen.
In Turkey, cattle coronavirus infections was reported the first time by Alkan (1998). The researcher
collected 83 fecal samples from diarrhetic calves (1-30 days of age) in 6 managements and 15 calves
were found positive by ELISA to BCV antigen. Eight of them had coronavırus alone and 7 of them
had bovine rotavirus together with coronavirus.
In this study, 184 calves feces were tested by ELISA and only one fecal samples was found
positive for coronavirus antigen. The reason of low antigenity can be related to maternal antibodies
gained their dam.
In the study, the highest antibody to coronavirus was found in 5 - ≤6 months of age female calves
and the lowest antibody was found in ≥2- <4 months of age male calves.
Alkan et al. (2003) examined 116 fecal samples from adult cattle in 5 dairy mamagements for
coronavirus antigen by ELISA, and 919 blood serum samples from adult cattle in 9 managements
77
by microneutralısation. The researchers did not detect any positive cattle for coronavirus antigen by
ELISA and but in these managements the seropositivity changed between 4.4 -100%.
In our study, 172 calves and 172 dams were found seropositive. While the highest seropositivity
rate was found in the cattle 6 years and older, the lowest antibody presence was found in ≥2- <3 and ≥
5-<6 years old dams. The reason of high seropositivity in calves can be related to maternal antibodies
gained their dam, but not infection.
Hasoksuz et al. (2005) allocated the diarrhetic cattle in 29 managements in 23 villages to 3 age
groups (0-30 days, 4-12 months, 2-7 years). The fecal samples from these animals were tested by
using 3 different monoclonal antibodies by indirect antigen capture ELISA. At the end of the study,
fecal shedding rates of the virus were found as 37.1% in 0-30 days group, as 25.6% in 4-12 months
group and as 18.2% in 2-7 years group.
Hasırcıoglu (2005) tested the fecal samples from 63 calves and 77 adult cattle by ELISA and
found 3% seropositivity in calves and no seropositivity in adult cattles. Hasırcıoglu (2004) found
25% seropositivity in 36 calves blood sera and 76% seropositivity in 46 dam blood sera.
Important haematological changes does not occur in coronavirus infections. But, if the infection
courses with persistent dystenteria more for more than one day, anemia can develop. In this situation,
blood clots can be seen in feces of the cattle (Murray and Guard 1990). In our study, no fecal clot was
seen in any of the fecal samples collected. Also, anemia was not detected in any animals. However, in
our study, leucocytes (%) in seropositive calves were found higher than leucocyte (%) in seronegative
calves. This increase depends on the increase in lymphocytes (%). From this data, we can conclude
that in Ab (+) calves had lymphocytosis when compared to Ab (-) calves.
Hematological investigations showed that in the conventionally contaminated Trakai district the
levels of erythrocytes, hemoglobin, leukocytes and segmented neutrophiles were decreased, while
those of eosinophil and methemoglobin (2–4% by total hemoglobin) increased in the blood of healthy
bovine and in coronavirus-infected cows (P < 0.05) than those in the conventionally clearer Ukmergë
district (Dringeliene et al., 2004). When haematological values of Ab+/Ag+ and Ab-/ Ag- calves
are compared, in Ab+/Ag+ calves lymphocyte (%) decreased and granulocyte (%) increased. In Ab/ Ag- calves, lymphocyte increased and granulocyte decreased. This was also found statistically
important (P<0.01). This results is compatible with the results of the study conducted by Dringeliene
et al. (2004).
REFERENCES
Abraham G, Roeder PL and Zewdu R (1992) Agents associated with neonatal diarrhoea in Ethiopian dairy
calves,Trop Anim Hlth Prod, 24, 74-80.
Alkan F (1998): Buzağı ishalllerinde rotavirus ve coronavirusların rolü Ankara Üniv Vet Fak Derg, 45, 29-37.
Alkan F, Bilge-Dağalp S, Can Şahna K, Özgünlük İ (2003) Sığırlarda coronavirus enfeksiyonunun epidemiyolojisi.
Ankara Üniv Vet Fak Derg, 50, 59-64.
Benfield DA and Saif LJ (1990) Cell culture propagation of a coronavirus isolated from cows with winter
dysentery, J Clin Microbiol, 28, 1454-1457.
Bridger JC, Woode GN and Meyling A (1978) Isolation of coronaviruses from neonatal calf diarrhoea in Great
Brıtain and Denmark,Vet Microbiol, 3, 101-113.
Cho KO, Halbur PG, Bruna JD, Sorden SD, Yoon KJ, Janke BH, Chang KO, Saif LJ (2000) Detection and
isolation of coronavirus from feces of three herds of feedlot cattle during outbreaks of winter dysntery-like
disease. J.Am.Vet.Med.Assoc.217, 1191-1194.
78
Chouljenko VN, Kousoulas KG, Lin X, Storz J (1998) Nucleotide and predicted amino acid sequences of all
genes encoded by the 3ı genomic portion (9.5 kb) of respiratory bovine coronaviruses and comparisons
among respiratory and enteric coronaviruses. Virus Genes, 17, 33-42.
Clark MA (1993) Bovine Coronavirus. Br Vet J, 149:51-70.
De Vries AAF, Horzinek MC, Rottier PJM, De Groot RJ (1997) The genome organization of the Nidovirales:
Similarities and differences between Arteri-, Toro-, and Coronaviruses. Semin. Virol., 8, 33-47.
Durham PJK, Hasard LE, Armstrong KR and Naylor JM (1989) Coronavirus- associated diarrhea (Winter
dysentery) in adult cattle, Can Vet J, 30, 825-827.
Dringeliene, A., Markevieius A., Aeite, J. (2004). Cellular immunity of coronavirus-infected bovine from
ecologically different districts of Lithuania. Ekologija, 4, 1-5.
Fukutomi T, Tsunemitsu H, Akashi A (1999): Detection of bovine coronaviruses from adult cows with epizootic
diarrhea and their antigenic and biological diversities. Arch Virol, 144, 997-1006.
Gaber F and Kapil S (1999) Development of antigen spot test for detection of coronavirus in bovine fecal
samples, Clin Diag Lab Immunol, 6, 542-544.
Hasöksüz M, Kayar A, Dodurka T and Ilgaz A (2005) Detection of respiratory and enteric shedding of bovine
coronaviruses in cattle in Northwestern Turkey, Acta Veterinaria Hungarica, 53, 1, 137-146.
Hasırcıoğlu S. (2005) Buzağılarda enterik bovine coronavirus enfeksiyonlarının araştırılması ve epidemiyolojide
klinik olarak sağlıklı sığırların rolü. S.Ü. Sağlık Bilimleri Enstitüsü, Konya, pp. 1-59.
Kapil S, Richardson KL, Maag TR and Goyal SM (1999) Characterization of bovine coronavirus isolates/from
eight different states in the USA, Vet Microbiol, 67, 221-230.
Lai MMC and Cavanagh D (1997) The molecular biology of coronavirus, Adv Virus Res, 48, 1-100.
McNulty MS, Bryson DG, Allan GM and Logan EF (1984) Coronavirus infection of the bovine respiratory tract,
Vet Microbiol, 9, 425-434.
Mebus CA, White R, Stair EL, Rhodes MB, Twiehaus MJ (1972): Neonatal calf diarrhea: results of a trial using
a reo-like virus vaccine. Vet.Med/Small Anim Clin, 67, 173-178.
Mostl K (1990) Coronaviridae, Pathogenetic and Clinical Aspects: An Update, Comp Immun Microbiol Infect
Dis, 13, 4, 169-80.
Park S. J., G. K. Lim, S. I. Park, H. H. Kim, H. B. Koh and K. O. Cho (2007a) Detection and Molecular
Characterization of Calf Diarrhoea Bovine Coronaviruses Circulating in South Korea during 2004–2005.
Zoonoses and Public Health, 54, 223–230.
Park SJ, Kim GY, Choy HE, Hong YJ, Saif LJ, Jeong JH, Park SI, Kim HH, Kim SK, Shin SS, Kang MI, Cho
KO (2007b). Dual enteric and respiratory tropisms of winter dysentery bovine coronavirus in calves. Arch
Virol.;152(10):1885-900. Epub 2007 Jun 14.
Reynolds DJ, Chasey D, Scott AC, Bridger JC (1984) Evaluation of ELISA and electron microscopy for the
detection of coronavirus and rotavirus in bovine feces. The Veterinary Record, 114, 397-401.
Saif LJ, Brock KV, Redman DR, Kohler EM (1991): Winter dysentery in dairy herds: electron microscopic and
serological evidence for an association with coronavirus infection. Vet Rec, 128, 447-449.
Saif LJ (1993) Coronavirus immunogens, Vet Microbiol, 37, 235-297.
Sato M and Akashi H (1993) Detection of bovine coronavirus by ELISA using monoclonal antibodies, J Vet
Med Sci, 55, 5, 771-774.
Schoenthaler SL and Kapil S (1999) Development and Applications of a Bovine Coronavirus Antigen Detection
Enzyme-Linked Immunosorbent Assay. Clinical and Diagnostic Laboratory Immunology, 6 (1), 130-132.
Snodgrass DR, Terzolo HR, Sherwood D, Campbell I, Menzies JD, Synge BA (1986) Aetiology of diarrhoea in
young calves. The Veterinary Record, 119, 31-34.
79
Park Su-Jin, Cheol Jeong, Soon-Seek Yoon, Hyoun E. Choy, Linda J. Saif, Sung-Hee Park, You-Jung Kim, JaeHo Jeong, Sang-Ik Park, Ha-Hyun Kim, Bong-Joo Lee, Ho-Seong Cho, Sang-Ki Kim, Mun-Il Kang, and
Kyoung-Oh Cho (2006) Detection and Characterization of Bovine Coronaviruses in Fecal Specimens of
Adult Cattle with Diarrhea during the Warmer Seasons. Journal Of Clınıcal Mıcrobıology, 44 (9). 3178–
3188.
Van Regenmortel MHV, Fauquet CM, Bishop DHL, Cartens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA,
McGeoch DJ, Pringle CR, Wickner RB (2000) Virus Taxonomy. Academic pres, San Diago, CA, 827.
Murray, M.J., Guard, C. (1990). Diseases of Alimentary System. In Ed. Smith, B.P. Large Animal Internal
Medecine, C.V. Mosby Company, Missouri, USA. pp. 816-817.
80
GH and some haematochemical parameters variation
during the first two months of lactation in mouflon
(Ovis gmelini musimon)
GH I VARIJACIJE NEKIH HEMATOKEMIJSKIH PARAMETARA
TIJEKOM PRVA DVA MJESECA LAKTACIJE U MUFLONA
(OVIS GMELINI MUSIMON)
Carcangiu V. 1, Mura M.C. 1, Vacca G.M. 1, Parmeggiani A. 2, Pazzola M. 1, Dettori M.L.
1
, Bini P.P. 1
Dipartimento di Biologia Animale, Università degli Studi di Sassari, Via Vienna 2, Sassari;
1
2
DIMORFIPA, Università degli Studi di Bologna, Via Tolara di Sopra 50, Ozzano dell’Emilia (BO)
ABSTRACT
The aim of the research is, starting to one of the most important physiological phases of the mouflon, such
as lactation, to observe the behaviour of GH, PRL and some metabolic parameters. Eighteen female mouflon
were used (10 lactating and 8 dry) aged between 5 ± 3 years. The animals were kept in a large roofed pen, where
they were fed with 400 g/die of concentrate food for ovine. The female lambed, between March and April, only
one cub (Group A), which was suckled for the whole period of the observation. Following the 7th day after
lambing, for two months, every week, from each animal blood samples was taken. The same procedures, with
regular blood samples, were followed for the females that did not lambed (Group B). GH plasma level were
dosed by radioimmunassay. Concentration of glucose, triglycerides, total cholesterol, total protein, albumin,
urea, Ca, P, Mg, Fe, Cu, Zn, Cl, were quantified with colorimetric method, Na and K were quantified using
flame spectrophotometer. The results were subjected to statistical analysis (ANOVA). GH blood concentrations
within the dry group animals showed a constant state, while in lactating animals there was a marked increase
in the second, fifth, and seventh blood samples. Moreover the lactating animals presented higher values of GH
compared to the dry. The blood levels of glucose proved to be higher in the dry animals, with significant statistical
differences compared to the other group at the first, third, fifth, seventh and eighth blood sample for P<0.05 and
at the second and fourth blood sample for P<0.01. The triglycerides plasmatic levels showed variations (P<0.01)
among the blood samples in the lactating animals only, while between the two groups significant differences
were noticed for P<0.01 at the first and fourth blood sample, and for (P<0.05) at the fifth and eighth blood
sample. The total cholesterol, the total protein and the albumin have not shown variations, neither among the
blood samples, nor between the groups, while urea levels presented differences in both groups (P<0.01) among
the blood samples. The minerals examined in the lactating animals showed variations on: Ca (P<0.05), Mg
(P<0.01), Zn, (P<0.01), while the other group of animals presented variations on Mg (P<0.01) and Zn (P<0.01).
The comparison between the two groups of animals demonstrated significant results within the values of Ca at
the first and second blood sample, Mg at the first and at the fifth, and Fe at the first and last blood samples. With
regards to Cu and Zn the higher values were recorded in the dry animals with significant differences for all the
samples (P<0,01). P, Cl, Na and K remained constant for all the observation period without significant variation
in both groups. The differences detected during examination in the GH plasmatic concentrations, and in many
other parameters, as above evidenced, show how the lactating mouflon are subjected to an intense organic effort
with the aim to produce milk for their lambs. Therefore, in order to guarantee an optimal management of this
faunistic patrimony it is to be hoped that there will be interventions for assure and improve availability of food,
which, as proved here, is absolute necessary during lactation for the animal wellbeing.
81
Sažetak
Cilj istraživanja bio je, počevši sa jednom od najvažnijih fizioloških faza u muflona, kao što je laktacija,
proučiti kretanje GH, PRL i nekih metaboličkih parametara. Korišteno je 18 ženki muflona (10 u laktaciji i 8 u
zasušenju) u dobi od 5 ± 3 godine. Životinje su držane u velikom natkritom oboru te su hranjene sa 400g/dan
koncentrata za ovce. Ženke su janjile, između ožujka i travnja, samo jedno mlado (Grupa A), koje je sisalo
cijelo vrijeme trajanja istraživanja. Počevši sa 7-im danom nakon janjenja, uzimana je krv svim životinjama
svaki tjedan tijekom 2 mjeseca. Isti postupak primjenjen je i na ženke koje se nisu janjile (Grupa B). Nivo GH
u plazmi je određivan RIA-om. Koncentracije glukoze, triglicerida, ukupnog kolesterola, ukupnih bjelančevina,
albumina, ureje, Ca, P, Mg, Fe, Cu, Zn i Cl su određivane kolorimetrijski, Na i K plamenim spektrofotometrom.
Rezultati su podvrgnuti statističkoj obradi (ANOVA). Koncentracije GH u krvi životinja koje se nisu janjile
imale su stalnu razinu, dok su u životinja u laktaciji zabilježeni značajni porasti u 2., 5. i 7. uzorku krvi. Štoviše,
životinje u laktaciji imale su više vrijednosti GH u usporedbi s onima koje se nisu janjile. Razine glukoze u
krvi bile su više u životinja van laktacije, sa znakovitim statističkim razlikama (P<0,05) u usporedbi sa drugom
skupinom u 1., 3., 5., 7. i 8. uzorku krvi te sa P<0,01 za 2. i 4. uzorak. Razine plazmatskih triglicerida su
pokazale varijacije (P<0,01) između uzoraka samo unutar skupine životinja u laktaciji, dok je između skupina
utvrđena razlika P<0,01 u 1. i 4. uzorku krvi te P<0.05 u 5. i 8. uzorku. Ukupni kolesterol, bjelančevine i
albumini nisu pokazali varijacije niti između uzoraka krvi, niti između grupa, dok je razina ureje pokazala
razlike u objema grupama (P<0.01) između krvnih uzoraka. U životinja u laktaciji utvrđena je varijacija u
sljedećim mineralima: Ca (P<0,05), Mg (P<0,01) i Zn (P<0,01), dok je druga skupina imala razlike u Mg
(P<0,01) i Zn (P<0,01). Usporedbom među grupama utvrđena je znakovita razlika unutar razina Ca u 1. i 2.
uzorku, Mg u 1. i 5. te Fe u 1. i zadnjem uzorku krvi. Glede Cu i Zn zabilježene su više vrijednosti u životinja
van laktacije, sa znakovitom razlikom u svim uzorcima (P<0,01). P, Cl, Na i K su zadržali stalnu razinu tijekom
cijelog istraživanja bez znakovitih razlika među grupama. Razlike utvrđene tijekom istraživanja u plazmatskoj
koncentraciji GH te u mnogim drugim parametrima, kako je gore zabilježeno, su pokazale da su muflonke
u laktaciji podvrgnute snažnom pritisku na organe s ciljem produkcije mlijeka za janjad. Stoga, kako bi se
osiguralo optimalno rukovođenje ovog faunističkog naslijeđa, neophodno je intervenirati kako bi se osigurala
i poboljšala dostupnost hrani, koja je, kako se pokazalo ovdje, neophodna tijekom laktacije za zadovoljenje
dobrobiti životinja.
INTRODUZIONE
Lo sfruttamento agricolo e industriale della superficie terrestre ha provocato cambiamenti
ambientali tali che hanno determinato una selezione restrittiva nei confronti di diverse popolazioni di
animali selvatici. Infatti, la riduzione e la frammentazione delle aree da loro occupate e il conseguente
ridotto scambio genetico, ha provocato la scomparsa di alcune importanti specie di animali silvestri e
la riduzione numerica di molte altre. Gli effetti dell’antropizzazione hanno sortito, anche in Sardegna,
notevoli modificazioni ambientali con una diminuzione della già scarsa mammofauna presente.
Tra queste specie il muflone (Ovis gmelini musimon) riveste un ampio interesse faunistico, che
non è circoscritto solo alla nostra isola ma si estende a tutto il bacino del mediterraneo, in quanto
solo in Sardegna e in Corsica è sopravvissuto all’estinzione (Cugnasse, 1994). Per questo motivo,
tale ovino, suscita l’interesse di molti ricercatori sensibili alla conservazione di questa biodiversità
(Shackleton e Lovari, 1997). Infatti, molti sono stati i progressi fatti per la salvaguardia di questo
patrimonio genetico ma occorre, senza dubbio, una conoscenza maggiore dei loro ritmi biologici, dei
loro assetti metabolici ed ormonali al fine di migliorarne le condizioni di vita. Questo monitoraggio
risulta particolarmente utile per gli animali selvatici che vivono allo stato libero, nei quali non è facile
verificare con certezza la qualità e la quantità di alimento introdotto, e per quelli tenuti in cattività,
per le particolari condizioni alle quali si devono adattare. La conoscenza dell’assetto metabolico e
minerale assume un’ulteriore importanza in particolari stadi fisiologici quali la lattazione. Quindi, lo
82
scopo della ricerca è quello di studiare, il comportamento del GH e di diversi parametri metabolici
in mufle in lattazione e in asciutta.
MATERIALI E METODI
Per la ricerca sono state utilizzate 18 mufle (10 in lattazione e 8 in asciutta) dell’età di 5 ± 3
anni. Gli animali venivano tenuti presso la Facoltà di Medicina Veterinaria in un ampio recinto,
provvisto di tettoia, dove ricevevano 400 g/die di concentrato del commercio, l’acqua e il fieno
erano ad libitum. Le mufle avevano partorito tra Marzo e Aprile, un solo redo, e lo allattavano per
tutto il periodo delle osservazioni. A partire dal settimo giorno dopo il parto, per due mesi, a cadenza
settimanale, da ciascun animale, sono stati effettuati prelievi di sangue dalla vena giugulare. Con la
stessa cadenza sono stati eseguiti anche i prelievi agli animali che non avevano partorito (Gruppo 2).
Il sangue veniva subito centrifugato e il plasma ottenuto veniva congelato a -20 °C fino al momento
delle analisi. Le concentrazioni plasmatiche del GH sono state quantificate è stato dosato mediante
metodica radioimmunologica (Gaiani e Mongiorgi, 1984). Il glucosio, trigliceridi, colesterolo
totale, proteine totali, albumine, urea, Ca, P, Mg, Fe, Cu, Zn e Cl sono stati definiti con metodiche
colorimetriche (Sentinel Chemical, Milano); il Na e K con spettrofotometro a fiamma. I dati sono
stati sottoposti ad analisi della varianza (ANOVA).
RISULTATI
Le concentrazioni ematiche del GH in entrambi i Gruppi hanno mostrato un andamento costante
durante le osservazioni (Grafico 1). Nel confronto trai due Gruppi quello in lattazione ha presentato
i valori maggiori di GH (P<0,01), in tutti i prelievi, rispetto a quelli in asciutta. I tassi plasmatici
del glucosio risultano più alti nei soggetti in asciutta con differenze statisticamente significative
rispetto all’altro gruppo al primo, terzo, quinto, settimo ed ottavo prelievo per P<0,05 e al secondo e
quarto per P<0,01 (Tabella 1). I livelli plasmatici dei trigliceridi hanno mostrato variazioni (P<0,01)
tra i prelievi solo negli animali in lattazione mentre tra i gruppi sono state riscontrate differenze
9
significative
per P<0,01 al primo e al quarto prelievo e per P<0,05 al quinto e all’ottavo.
8
7
GH ng/ml
6
5
4
3
2
1
0
1
2
3
4
5
6
7
8
S a m p le
G ru p p o A
G ru p p o B
Figure 1 – Andamento del GH nei due gruppi nel corso dell’osservazione in osservazione
83
Il colesterolo totale, le proteine totali e le albumine non ha mostrato variazioni ne tra i prelievi ne
tra i gruppi mantenendo un andamento costante per tutta l’osservazione (Tabella 1, 2). I tassi ematici
dell’urea hanno presentato differenze significative in entrambi i gruppi (P<0,01) e tra i prelievi
(Tabella 2), mentre tra i gruppi non si è osservata alcune differenza. Tra i minerali esaminati nel
Gruppo 1 hanno mostrato variazioni il Ca (P<0,05), il Mg (P<0,01), lo Zn (P<0,01) mentre nell’altro
gruppo il Mg (P<0,01) e lo Zn (P<0,01) (Tabelle 3, 4). Nel confronto tra i due gruppi sono risultati
significativi i valori del Ca al primo (P<0,05) e secondo prelievo (P<0,01), del Mg al primo (P<0,05)
e al quinto (P<0,01) prelievo. Invece, per quanto riguarda il Cu e lo Zn i valori maggiori sono stati
registrati negli animali in asciutta con differenze significative (P<0,01). Il P, il Cl, il Na e il K (Tabelle
3, 4, 5) si sono mantenuti costanti per tutto il periodo delle osservazioni senza variazioni significative
in entrambi i Gruppi.
Tabella 1 - Valori medi del glucosio, trigliceridi e colesterolo totale.
Glucosio (mg/dl)
Prel.
1
2
3
4
5
6
7
8
Gruppo 1
93,25
83,42
106,95
102,42
94,58
116,67
87,35
81,42
*
**
*
**
*
n.s.
*
*
Trigliceridi (mg/dl)
Gruppo 2 Gruppo 1
187,53
16,22A
139,57
10,82A
165,40
27,35AB
168,98
13,52A
163,46
12,58A
125,42
39,67AB
147,74
51,08B
146,88
18,77A
**
n.s.
n.s.
**
*
n.s.
n.s.
*
Colesterolo totale (mg/dl)
Gruppo 2 Gruppo 1
61,27
41,18
17,10
56,85
37,84
47,83
40,96
56,65
28,44
71,25
40,10
83,40
65,10
54,55
46,12
54,30
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
Gruppo 2
39,47
50,20
40,86
47,22
62,82
49,82
43,60
47,00
Sulle colonne lettere maiuscole indicano differenze significative per P<0,01. Sulle righe * = P<0,05; ** =
P<0,01; n.s. = non significativo.
Tabella 2 - Valori medi delle proteine totali, albumine e urea.
Proteine totali (g/dl)
Albumine (g/dl)
Urea (mg/dl)
Prel. Gruppo 1
Gruppo 2 Gruppo 1
Gruppo 2 Gruppo 1
gruppo 2
1
6,58
n.s.
6,20
4,05
n.s.
4,03
13,96A n.s.
16,03A
A
2
6,80
n.s.
5,97
3,70
n.s.
3,85
12,88
n.s.
16,30A
B
3
6,80
n.s.
6,42
3,70
n.s.
3,88
16,19
n.s.
22,62B
4
7,15
ns
6,52
4,03
n.s.
4,52
24,82C n.s.
27,23C
5
7,05
n.s.
6,76
3,68
n.s.
4,04
17,26B n.s.
18,02A
6
6,87
n.s.
6,66
3,98
n.s.
4,24
22,42C n.s.
24,05B
C
7
7,52
n.s.
6,90
4,15
n.s.
4,24
27,32
n.s.
31,28C
C
8
6,91
n.s.
6,58
4,40
n.s.
4,38
29,64
n.s.
35,47C
Sulle colonne lettere maiuscole indicano differenze significative per P<0,01; minuscole per P<0,05. Sulle righe
* = P<0,05; n.s. = non significativo.
84
Tabella 3 - Valori medi del calcio, fosforo e magnesio.
Calcio (mg/dl)
Prel. Gruppo 1
1
7,20a
2
7,10a
3
7,82a
4
8,20b
5
8,62b
6
7,95b
7
8,55b
8
8,01b
Fosforo (mg/dl)
Gruppo 2 Gruppo 1
*
**
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
8,47
8,15
8,96
8,24
8,22
8,28
9,04
8,42
6,85
4,87
3,75
5,45
4,63
3,05
3,45
4,30
Magnesio (mg/dl)
Gruppo 2 Gruppo 1
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
5,83
5,00
5,38
4,92
4,60
3,40
3,60
4,78
1,82
1,12A
1,37A
1,20A
1,40B
1,10A
1,52B
1,45B
C
gruppo 2
*
n.s.
n.s.
n.s.
**
n.s.
n.s.
n.s.
1,40B
1,07A
1,26A
1,26A
1,10A
1,12A
1,56B
1,38B
* = P<0,05; ** = P<0,01; n.s. = non significativo.
Tabella 4 - Valori medi (± d.s.) del ferro, rame e zinco.
Ferro (µg/dl)
Gruppo
Prel.
1
1
193,25
n.s
2
181,75
n.s.
3
173,50
n.s.
4
167,50
n.s.
5
131,00
n.s.
6
175,75
n.s.
7
210,00
n.s.
8
189,50
n.s.
Rame (µg/dl)
Gruppo Gruppo
2
1
182,67 73,28
**
189,75 76,27
**
09,60b 76,42
**
194,60 82,87
**
156,20 81,50
**
195,80 78,72
**
211,80 84,17
**
191,60 82,85
**
Zinco (µg/dl)
Gruppo Gruppo
2
1
91,53 71,45A
**
90,67 73,03A
**
94,32 72,15A
**
93,72 74,90A
**
93,90 71,97A
**
93,96 78,52B
**
98,18 81,42B
**
95,80 82,85B
**
Gruppo
2
89,53A
89,52A
90,18A
91,24AB
92,01AB
90,94AB
95,06B
96,40B
* = P<0,05; ** = P<0,01; n.s. = non significativo.
Tabella 5 - Valori medi (± d.s.) del cloro, sodio e potassio.
Prel.
Cloro (mEq/l)
Gruppo 1
1
93,28
n.s.
2
98,22
n.s.
3
96,95
n.s.
4
95,98
n.s.
5
96,97
n.s.
6
99,40
n.s.
7
100,67
n.s.
8
101,52
n.s.
n.s. = non significativo.
Sodio (mEq/l)
Gruppo 2 Gruppo 1
96,30
97,45
96,14
96,98
99,30
99,84
103,34
98,88
141,45
133,03
142,15
134,90
131,97
138,52
131,42
142,85
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
Potassio (mEq/l)
Gruppo 2 Gruppo 1
139,53
135,52
140,18
131,27
139,21
140,24
135,36
138,34
4,04
3,85
4,12
4,01
3,95
4,03
3,92
4,25
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
Gruppo
2
4,15
3,87
4,08
3,95
4,01
4,10
3,98
4,00
85
DISCUSSIONE
Nella lattazione dei ruminanti una funzione abbastanza importante viene svolta dalla somatotropina
che attraverso il suo effetto omeoretico favorisce la secrezione mammaria (Bauman and Currie, 1980).
Infatti, questo ormone determina una condizione anabolica del metabolismo favorendo appunto la
produzione lattea (Chilliard et al., 1998a). Tale effetto viene esplicato, principalmente, contrastando
l’azione dell’insulina, inibendo appunto il trasporto del glucosio all’interno delle cellule (Vernon
e Finley, 1988). Inoltre, questo ormone fa si che l’animale possa andare in bilancio energetico
negativo attraverso la mobilizzazione di sostanze di deposito al fine di soddisfare la richiesta della
ghiandola mammaria (Bauman e Vernon, 1993). Pertanto, i livelli maggiori di GH riscontrati nelle
mufle in lattazione sono da imputare a questa importante funzione svolta dal GH nel favorire la
produzione lattea. Tale comportamento della somatotropina è in accordo con quanto si rileva anche
negli ovini domestici (Carcangiu et al., 2004). I livelli più bassi di glucosio osservati negli animali
in lattazione sono da ricondurre ad un maggiore utilizzo della mammella di questo substrato per la
formazione del lattosio (Manunta, 1981). Inoltre, i tassi riscontrati risultano elevati in entrambi i
gruppi, particolarmente in quello in asciutta, e possono essere dovuti all’azione stressante causata
dal confinamento degli animali in uno spazio ristretto per poter facilmente effettuare la cattura e il
prelievo. Infatti, la glicemia viene modificata notevolmente durante lo stress, in quanto gli ormoni
che intervengono in queste condizioni hanno spiccata azione iperglicemizzante (Carcangiu et al.,
2004). I tassi di proteine totali e albumine sono risultati simili a quanto ritrovato nella medesima
specie da Naitana et al. (1988) e leggermente più bassi di quanto riscontrato da Coda et al. (1987).
I livelli del Ca e del P si sono tenuti nei limiti fisiologici per la specie (Naitana et al., 1988). I tassi
più bassi del Ca negli animali in lattazione sono dovuti alla notevole escrezione di questo minerale
nel latte. Infatti, il Ca è il minerale che presenta le più alte concentrazioni nel latte e svolge un ruolo
importante nella stabilizzazione delle micelle caseiniche (Naitana et al., 1992). Le concentrazioni più
basse del rame e dello zinco negli animali in lattazione sono da attribuire alla secrezione di questi
minerali con il latte (Cousin, 1985). Cl, Fe, P, Na e K si sono mantenuti costantemente nei limiti
fisiologici in entrambi i gruppi senza subire variazioni legate allo stato produttivo degli animali.
Le differenze riscontrate per le concentrazioni plasmatiche di GH, di glucosio, trigliceridi, Ca,
Cu e Zn evidenziano come anche le mufle in lattazione siano soggette ad un intenso sforzo organico
al fine di garantire la produzione del latte per i loro redi. Pertanto, per una ottimale gestione di
questo patrimonio faunistico, anche per gli animali allo stato libero, sono auspicabili mirati interventi
sull’alimentazione, ancor più necessari nel periodo in cui vi sono soggetti in lattazione.
BIBLIOGRAFIA
Naitana S., Nuvole P., Marongiu A. (1992) La lattazione. In: Aguggini G., Beghelli V., Giulio L.F. Fisiologia
degli animali domestici con elementi di etologia. pp 781-806 UTET, Torino
Bauman D.E., Currie W.B. (1980). Partitioning of nutrients during pregnancy and lactating: A review of
mechanism involving homeostasis and homeorhesis. J.Dairy Sci. 63, 1514-1529;
Bauman, D. E., and R. G. Vernon. 1993. Effects of exogenous bovine somatotropin on lactation. Annu. Rev.
Nutr. 13:437.
Carcangiu V., Vacca G.M., Parmeggiani A., Mura M.C., Fanari U., Bini P.P. (2004). Relazioni tra GH, BCS e
livelli produttivi in ovini di razza sarda durante la lattazione. S.I.P.A.O.C., XVI Siena 29/9-2/10 2004, in
c.d.s.
Chilliard, Y., F. Bocquier, and M. Doreau. 1998a. Digestive and metabolic adaptations of ruminants to
undernutrition, and consequences on reproduction. Reprod. Nutr. Dev. 38,131–152.
86
Coda S., Ximenes L., Petruzzi V., Tarantini S., Varia G., Bolla G. (1987) Il nuovo Progresso Veterinario, 22, 3-6;
Carcangiu V., Vacca G.M., Parmeggiani A., Mura M.C.;
Dettori M.L., Bini P.P. (2004). Effect of age and sex on plasmatic levels of cortisol and some haematic parameters
in sheep subjected to shearing. Procedings of the 55th EAAP, 2004, 148.
Cousin R.J. (1985) Physiol. Rev., 65, 238-309; Manunta G. (1981) Tinarelli, Bologna. 1565-1662; Cugnasse
J.M., 1994. Révision taxonomique des mouflons des iles méditerraées. Mammalia 58, 507-512
Gaiani R., Mongiorgi S., 1984. GH, PRL and insulin variation in lactating goats. Proceeding of Annual Meeting
Società Italiana delle Scienze Veterinarie XLI, 269-273
Naitana S., Ledda S., Loi P., Bomboi G., Falchi S. (1988) La Clinica Veterinaria, 111(3), 158-162.
Shackleton D.M., Lovari S., 1996. Conservation of Eurasian wild sheep. An overview. Proceding of the second
International symposium on meditettanean mouflon, 2, 20-36
Vernon R.G., Finley E, (1988). Roles of insulin and growth hormone in the adaptations of fatty acid synthesis in
white adipose tissue during the lactation cycle in sheep.Biochem J. 256, 873-878.
87
88
Serological detection of a Bovine herpesvirus 1 related
infection in buffaloes (Bubalus bubalis) by using BoHV-1
blocking ELISA
Serološko otkrivanje goveđeg herpesvirusa 1
povezanog s infekcijom u bufala ((Bubalus bubalis)
Romero Tejeda A., Thiry J.1, Preziuso S., Thiry E. 1, Petralia P., Valente C. 2, Cuteri V.*
Department of Veterinary Science, Faculty of Veterinary Medicine, University of Camerino, Italy
1
Department of Infectious and Parasitic Diseases, Virology and Immunology, Faculty of Veterinary Medicine,
University of Liege, Belgium.
2
Department of Diagnostic Pathology and Veterinary Clinic, Faculty of Veterinary Medicine, University of
Perugia, Italy.
ABSTRACT
Among the subfamily alphaherpesvirinae, Bovine herpesvirus 1 (BoHV-1) is responsible for genital and
respiratory tract infections in cattle. The infectious bovine rhinotracheitis (IBR) is one of the most important
causes of economical losses in the cattle industry in association with the related Bovine herpesvirus 5. The
BoHV-1 envelope includes at least ten glycoproteins (g), where gB, gC and gD are present in large amounts,
meanwhile the less abundant gE is important for virus cell-to-cell transmission. To control the disease, IBR
marker vaccines based on gE deletion mutants of BoHV-1 and BoHV-1 blocking ELISA detecting specifically
gB or gE antigens have been developed in Europe and used in different voluntary eradication programs in order
to differentiate between infected and vaccinated animals. Several ruminant alphaherpesviruses have been shown
to be antigenically and genetically closely related to BoHV-1. These viruses are not restricted to their natural
host species. Thus, buffaloes can be successfully cross-infected with BoHV-1 under experimental conditions and
can express high antibody levels against BoHV-1 as demonstrated in cattle. Recently, the host specific Bubaline
herpesvirus 1 (BuHV-1) has been isolated after a latency reactivation treatment with dexamethasone in Italy
and has been shown responsible of a subclinical genital infection in buffaloes. Taking into account the close
relationship between BoHV-1 and BuHV-1, it can be hypothesised that a BoHV-1 gB blocking ELISA could
detect a BoHV-1 related infection in buffaloes. Thus, the prevalence of such infection has been investigated
in 415 unvaccinated buffaloes from Central Italy. Knowing that gE is genetically less conserved than gB, a
BoHV-1 blocking gE ELISA has been used to try to discriminate BuHV-1 and BoHV-1 infections. The apparent
seroprevalences obtained were 95.66% and 72.05% for gB and gE respectively, meanwhile 72.05% of animals
were positive to both tests. In other hand, 16.87% of animals were positive to gB and negative to gE, presuming
that these animals are probably infected with BuHV-1 due to the lack of gE antibodies production, converting
the serology in a possible tool to differentiate between infections. These results demonstrate a high prevalence of
a ruminant alphaherpesvirus infection in buffaloes in Central Italy. This suggests a previous contact of animals
with BoHV-1 or the closely related BuHV-1. Due to the detection of antibodies against both glycoproteins,
a BoHV-1 cross-infection of buffaloes can be suggested although, as BoHV-1 and BuHV-1 are genetically
closely related, a BuHV-1 infection is currently the most consistent hypothesis. The survey of the prevalence
and the differentiation of both viruses could offer important knowledge about the herpesvirus epidemiology
in buffalo, and for that purpose it is necessary to complete the differentiation between BoHV-1 and BuHV1 infections using molecular methods. BoHV-1 infection in buffalo could interfere systematically with the
serologic diagnosis developed for the IBR control programs. These animals could be a dangerous reservoir of
BoHV-1 for uninfected bovines, mainly in regions where the disease has been previously eradicated. At the same
time, and for the closely phylogenetic relationship of BuHV-1 with BoHV-5, an evaluation of the susceptibility
of BoHV-5 infection in buffaloes could be an interesting research to develop in the future.
89
Sažetak
Unutar subfamilije Alphaherpesvirinae, goveđi herpes virus je odgovoran za infekcije spolnog i dišnog
sustava goveda, pogotovo goveđeg rinotraheitisa (IBR), koji je zajedno s goveđim herpesvirusom 5, jedan od
najznačajnijih uzroka ekonomskih gubitaka u govedarskoj industriji. Ovojnica se goveđeg HV-1 sastoji od deset
glikoproteina (g), od kojih su gB, gC i gD prisutni u velikim kojičinama, dok s manjeprisutni gE važni prilikom
prenošenja na druge stanice. Kako bi se bolest kontrolirala, u Europu su uvedene marker vakcine dobivene od
delecijom mutiranih gE goveđeg HV-1, kao I ELISA analize kojima se detektiraju specifični gB I gE antigeni
korištene u različitim eradikacijskim programima kako bi diferencirali inficirane od vakciniranih životinja.
Više se vrsnonespecifičnih goveđih alfaherpesvirusa pokazalo antigenskii genetski povezanim s goveđim
herpesvirusom. Tako se bufali mogu zaraziti križnom infekcijom s goveđim herpes virusom i razviti viši titar
antitijela od goveda. Nedavno je herpesvirus bufala izoliran u Italiji nakon latentne reaktivacije terapijom
deksametazona , te se smatra de je taj virus bio odgovoran za subklinički spolnu infekciju bufala. Uzevši u
obzir usku povezanost BoHV-1 i BuHV-1, smatra se da bi BoHV-1 gE detektirani ELIS-om mogli detektiratu
istu i kod bufala. Tako je istražena prisutnost ove infekcije u 415 nevakciniranih bufala u centralnoj Italiji.
Znajući da je gE genetskii promjenjljiviji od gB, BoHV-1 blocking gE ELISA se koristila za razlikovanje
BuHV-1 and BoHV-1 infekcija. Utvrđena seroprevalencija iznosila je 94,7% i 72,05% za gB i gE, dok je 71,8%
životinja bilo pozitivno na oba testa. S druge strane, 16,87% životinja bilo je pozitivno nag B I negativno nag E
, predpostavljajući da su te životinje bile inficirane sa BuHV-1 zbog manjka stvaranja gE protutijela, što dovodi
do mogućnosti korištenja serologije u diferencijaciji infekcija. Na osnovu ovih rezultata možemo dokazati
prisutnost visoke koncentracije alfaherpesvirusa preživača u bufalaCentralne Italije. Pretpostavlja se prijašnji
kontakt s životinjama koje su imale BoHV-1, ili pak neki njemu vrlo sličan virus. Pomoću dokaza protutijela
protiv oba glikoproteina, može se predpostaviti I kros-infekcija s BoHV-1, s obzirom da su BoHV-1 i BuHV-1
genetski vrlo srodni, no hipoteza s BuHV-1 je prihvatljivija. Pregled učestalosti pojave i razlikovanja dvaju
virusa donosi važna saznanja o epidemiologiji herpesvirusa u bufala. Stoga je važno diferencirati BoHV-1 i
BuHV-1 koristeći molekularne metode. Infekcija BoHV-1 bufala može utjecati na serološku dijagnostiku koja se
koristi kod IBR kontrolnih programa. Te životinje mogu biti opasni rezervoari BoHV-1, pogotovu u područjima
gdje je virus eradiciran. Zbog bliske filogenetske povezanosti između BuHV-1i BuHV-5, buduća bi istraživanjea
bilo zanimljivo provesti na osjetljivosti bufala na BuHV-5
INTRODUCTION
Herpesviridae family is formed by double-stranded DNA viruses, which includes nearly two
hundred viruses isolated from different hosts as molluscs, fishes, amphibians, reptiles, birds and
mammals. In nature most herpesvirus are closely associated with a single host species, and almost
all the animal hosts investigated so far support infections by at least one herpesvirus species 15-18. All
members of the family Herpesviridae share a common virion morphology based on an icosahedral
capsid symmetry, a cell-derived envelope containing virally encoded membrane proteins and a
protein-made matrix 6,10. Viral glycoproteins (g) of herpesviruses play an important role in the
interactions between these viruses and their host-cells and they are involved in several steps of the
viral cycle, such as the attachment, penetration and maturation. Most of the Bovine herpesvirus 1
(BoHV-1) glycoproteins have already been characterised. The gB, gC and gD are present in large
amounts, meanwhile the less abundant gE is important for virus cell-to-cell transmission 6,14.
According to their biological behaviour, members of the family Herpesviridae have been
classified into three subfamilies, the Alpha-, Beta- and Gamma- herpesvirus. The alpha-herpesvirinae
are characterised by a rapid replication, lysis of the infected cells and the establishment of latency
mainly in neurones of sensory ganglia 6,17. Seven ruminant alpha-herpesviruses form a cluster of
antigenically and genetically related viruses. BoHV-1, a cattle pathogen associated with infectious
bovine rinotracheitis (IBR), infectious pustular vulvovaginitis, balanopothitis and abortion, is the
prototype. The cluster is formed by Bovine herpesvirus 5 (BoHV-5) causing meningoencephalitis in
90
calves, Caprine herpesvirus 1 (CpHV-1) inducing systemic disease in kids and abortion in adults,
Cervid herpesvirus 1 (CvHV-1) responsible for conjunctivitis in red deer, Cervid herpesvirus
(CvHV-12), Elk herpesvirus 1 (ELKHV-1) causing subclinical genital infections in reindeer and elk
respectively, and Bubaline herpesvirus 1 (BuHV-1) responsible for subclinical infections in water
buffaloes 15-18.
Phylogenetic studies of conserved herpesvirus sequences showed that BoHV-5 and BuHV-1 are
most closely related to BoHV-1, followed by ElkHV-1, CvHV-1, CvHV-2 and CpHV-1 18. BoHV-1
related ruminant alphaherpesviruses are not always restricted to their natural host species, indeed,
goat, sheep, red deer, reindeer and buffalo are successfully infected with BoHV-1 under natural and
experimental conditions18. The cross-serological relationship between these viruses and BoHV-1 was
also demonstrated by seroneutralization and ELISA 6,18. Cross-infection studies have been performed
in order to gain greater knowledge about risks of acute and latent infections in cattle with other
ruminant alphaherpesviruses and about potential BoHV-1 reservoirs among ruminant species other
than cattle. In this case, serological studies have suggested that buffalo is susceptible to BoHV-1
and can be successfully cross-infected with BoHV-1 under experimental conditions, expressing high
antibody levels as demonstrated in cattle 4,18. A study using the seroneutralization test to indicate a
BoHV-1 infection in 43 different species from 7 countries of Southern Africa wildlife showed that
high antibodies levels against BoHV-1 were found in buffalo, revealing that this animal plays an
important role in the maintenance of the virus 8. In Italy, few serological surveys have been realized
about the BoHV-1 infection in buffalo, even if infection is present in this country 4.
In the other hand, not only serologic evidence of BoHV-1 infection in buffalo has been reported.
BoHV-1 has been isolated in 1971 from prepuces and semen from healthy water buffalo in Australia
7
and Malaysia 9. However, the identification of the specific-buffalo’s herpesvirus (BuHV-1) closely
correlated to BoHV-1 has been demonstrated in different researches, where using Restriction
Endonuclease DNA Fingerprints, and Restriction Fragment Patter Analysis, it was concluded that
BuHV-1 presented a different DNA migration profile comparing with bovine strains1,2. In Egypt,
7.3% of buffaloes were BoHV-1 positive using a Nested-PCR in isolated viruses from clinical
samples, however, the nested-PCR negative viral isolates were regarded as antigenically ruminant
Herpesviruses related5. Recently, BuHV-1 was isolated from nasal swabs in two buffaloes after a
latency reactivation treatment for five consecutive days with dexamethasone in Italy4. Only slight
diarrhoea and serous nasal discharge were observed. Unfortunately, there are few data to clarify the
pathogenic role of the BuHV-1, knowing that is responsible of subclinical infections18.
Due to the preceding results obtained about serological positivity in buffalo, the propose of a
previous contact with the BoHV-1 and the possibility of the contemporary presence in the animals
of both related viruses, BoHV-1 and BuHV-1, must be studied, also because for the important
immunological benefit for BoHV1, that masks the antibodies production against BuHV-1. For
this reason and taking into account the close genetically relationship between both viruses, it can
be hypothesised that a BoHV-1 gB blocking ELISA could detect a BoHV-1 related infection in
buffaloes. In the other hand, a PCR assay based on the amplification of a DNA fragment of the gE
gene in different Herpesvirus strains have demonstrated that the expected fragment is not amplified
in BuHV-1 and other correlated alphaherpesvirus13. Based on this understanding and knowing that
gE is genetically less conserved than gB18, gE blocking ELISA could be used as a tool to identify
animals that are probably infected with BuHV-1 due to the lack of gE antibodies production and the
contemporary presence of gB antibodies, converting the serology in a possible tool to differentiate
between both infections.
91
In other hand, the properties shared by BoHV-1 related alphaherpesviruses could unfortunately
interfere with the IBR eradication program in cattle since the buffalo could be a potential reservoir
for the virus8,18. In this context, and when the risk of infection for cattle is high, a better knowledge
of these alphaherpesviruses is essential to successfully eradicate IBR, which causes important
economical losses in the cattle industry6,10. In Italy the breeding of buffalo is increasing, principally in
Central-South parts of the Country, reaching about 360.000 animals, and in some cases the buffalo’s
milk production and transformation is more profitable than milk obtained from dairy cows12.
Experimental data confirm that BuHV-1 affects the Italian buffalo population 4, and the identification,
differentiation and survey of the prevalence of both BuHV-1 and BoHV-1 infections in these animals
could offer important knowledge about the herpesvirus epidemiology.
MATERIALS AND METHODS
a) Animals
Four hundred fifteen female unvaccinated buffaloes belonging from 7 farms in central Italy, with
an average age between 18 months and 20 years old were sampled. In order to simplify the data,
animals were stratified in 2 groups according to their age: younger and older than 2 years. According
to this categories, 178 and 237 animals corresponded to each group respectively.
b) Serological Test
In order to obtain sera samples, 6 ml of blood were collected in tubes without anticoagulant
and centrifuged at 2500 rpm for 20 minutes. The sera were tested immediately or stored at 4°C until
their use. Samples were tested with two ELISA Antibody test kit (IBR gB / gE IDEXX Herd Check
Laboratories) in order to detect antibodies to the BoHV-1 gB and gE. The serological tests were
carried out following the manufacturer’s instructions, having both BoHV-1 blocking ELISA’s the
same principle. Briefly, the sera incubation in antigen-coated wells for 1 hour in case of gB ELISA
and overnight for gE ELISA was required. After washing unbound materials, a competitive reaction
was obtained using a peroxidise-conjugated antibody directed to the BoHv-1 gB or gE coated in
the plate. This antibody does not bind to the BoHv-1 antigen when the antigenic determinant has
been previously blocked by antibodies present in the serum. Following this incubation period, the
un-reacted conjugate is removed by washing, and a substrate/chromogen solution is added. In the
presence of enzyme, the substrate is converted to a product which reacts with the chromophore to
generate a blue colour if no gE/gB antibodies are present in the sample. The substrate-chromogen
reaction was measured using a spectrophotometer (Labsystem Multiscan) at a single wavelength of
450 nm for gB ELISA and 650 nm for gE ELISA.
RESULTS
The serological survey carried out in buffaloes from central Italy demonstrated that from a total
number of 415 animals sampled, 397 (95.66%) were positive to BoHV-1 gB and 299 (72.05%)
were positive to BoHV-1 gE. In other hand, 17 (4.09%) and 85 (20.48%) animals were negative to
gB and gE ELISA respectively (Table 1). The serology results obtained according to the age were
that in the group of animals younger than 2 years, 171 (96.06%) of animals were positive to gB
ELISA, meanwhile 109 (61.23%) were positive to gE. In the group of animals older than 2 years, 226
(95.35%) and 190 (80.16%) were positive to gB and gE ELISA respectively (Table 2).
92
Table 1. General serological results using blocking ELISA gB and gE in buffaloes
No. of animals
BoHV-1 gB
+
397
415
17
BoHV-1 gE
+/1
+
299
85
+/31
Table 2. Serological results according to the age group using blocking ELISA gB and gE in buffaloes
Animals
↓ 2 years
old
↑ 2 years
old
Total
Total
+
BoHV-1 gB
-
+/-
+
BoHV-1 gE
-
+/-
178
171
6
1
109
53
16
237
226
11
0
190
32
15
415
397
17
1
299
85
31
In addition, 299 (72.05%) of animals were positive meanwhile 14 (3.37%) were negative to both
tests. In other hand, 70 (16.87%) of animals were positive to gB and negative to gE (Table 3). In the
case of group of animals younger than 2 years, 109 (61.23%) were positive to both tests, meanwhile
6 (3.37%) were negative. In the same group, 46 (25.84%) animals were positive to gB and negative
to gE. In the second group of animals older than 2 years, 190 (80.16%) were positive to both tests,
meanwhile 8 (3.37%) were negative. Twenty four (10.12%) animals were positive to gB and negative
to gE ELISA (Table 4).
Table 3. General BoHV-1 gB and gE serological results.
BoHV-1 gE
+
299
70
28
397
+
+/Total
BoHV-1 gB
0
14
3
17
Total
+/0
1
0
1
299
85
31
Table 4. BoHV-1 gB and gE serological results by group of age.
BHV-1 gE
+
+/Total
+
109
46
16
171
↓2 years old
0
6
0
6
BoHV-1 gB
+/0
1
0
1
+
190
24
12
226
↑2 years old
0
8
3
11
Total
+/0
0
0
0
299
85
31
93
DISCUSSION
Several researches have demonstrated that buffalo is susceptible to BoHV-1 infection in natural
and experimental conditions 4,6,18. In Italy, even the few serological surveys that have been realized
to study this phenomena, it has been demonstrated that buffaloes are infected with BoHV-1, and
also with the specie-specific BuHV-11,2 which has been isolated from nasal swabs in experimental
immunosuppressed animals 4. Due to the lack of prevalence reports and to the high risk of interference
that could represent buffaloes in the IBR eradication program, the main objectives of this research
were the use of both blocking BoHv-1 ELISA gB and gE in buffalo in order to study the relative
prevalence of BoHv-1 infection in these animals, and the possible use of serology to differentiate
between BoHv-1 and BuHv-1 infections. Taking into account the close relationship between both
viruses, it can be hypothesised that a BoHV-1 gB blocking ELISA could detect a BoHV-1 related
infection in buffaloes. Knowing that gE is genetically less conserved than gB and that this glycoprotein
is not expressed in BuHv-1, a BoHV-1 blocking gE ELISA has been used to try to discriminate
between infections.
It is important to consider that in order to exclude interferences in the seroprevalence evaluation,
all animals included in this research were unvaccinated. The relative seroprevalence obtained were
94.70% and 72.05% for gB and gE respectively. These results strongly demonstrate the presence of a
ruminant alphaherpesviruses infection in buffaloes in Central Italy at a high prevalence, suggesting
also a previous contact of animals with BoHV-1 or the closely related BuHV-1, due to the detection of
antibodies against both viral glycoprotein. Few researches have been carried out in Italy about BoHv1 prevalence in buffalo, reporting a gE seroprevalence of 31.94% in buffaloes from Salerno (Italy),
but the discrimination between both viruses using serology was not realized4. In other hand, different
and important seroprevalence have been reported in Africa wildlife, concluding that buffalo is an
important reservoir of the BoHV-15,8. About gB / gE results of seroprevalence obtained by groups
of age, in animals younger than 2 years showed a 96.06% and 61.23%, meanwhile in the second
group, animals showed a 95.35% and 80.16% of prevalence respectively. There is not significantly
difference between gB prevalence between groups, but younger animals presented a lower gE
seroprevalence than older animals. This phenomena could be due to that possibly adults animals
have been more exposed in their life to others related alphaherpesviruses than younger animals, but
in some way, the presence of antibodies in young animals could corroborate the presence of recent
and the maintenance of infections within farms.
In other hand, a high percentage of animals (72.05%) were positive to both tests, meanwhile
16.87% (70/415) of a total number of animals were positive to gB and negative to gE. Due to this fact,
we presume that these animals are probably infected with BuHV-1 due to the lack of gE antibodies
production and the contemporary presence of gB antibodies, and although, BoHV-1 and BuHV1 are genetically closely related, a BuHV-1 infection is currently the most consistent hypothesis.
Some works have reported the lack of amplification of an expected product of the gE gene by PCR
in different Herpesvirus strains, including BuHV-1 and other correlated alphaherpesvirus13. This
phenomena possibly converts the serology in a possible tool to discriminate between infections. The
same methodology, using both blocking ELSA’s has been applied to discriminate between BoHv-1
and BoHv-5 infection in cattle, but the sensibility and specificity have been tested only on a very
limited number of samples17,18. The survey of the prevalence and the differentiation of both viruses
could offer important knowledge about the herpesvirus epidemiology in buffalo, and for that purpose
it is necessary to complete and confirm the differentiation between BoHV-1 and BuHV-1 infections
94
using molecular methods as Restriction Endonuclease Analysis, Restriction Fragment Patter Analysis
and Phylogenetic analyses by sequencing PCR products1,2,4,18
In the case of the results obtained according to the group of age, younger animals showed a lower
percentage (61.23%) of positive animals to both tests than group of older animals (80.16%). The
contrary was observed about animals positive to gB and negative to gE ELISA, showing a 25.84%
in contrast with 10.12% in older animals. This significantly difference probably could demonstrate
that younger animals are more frequently infected by the specie-specific BuHV-1, meanwhile older
animals could be infected with both related viruses.
IBR is a disease of major economic concern in many parts of the world especially in European
countries, where control programs are achieving. Because ruminant alphaherpesviruses are not
restricted to their natural host species, and buffaloes can be successfully cross-infected with BoHV1, we believed that it is important to study the role of buffaloes in the epidemiology of the IBR.
Experimental data confirm that BuHV-1 affects the Italian buffalo population4 and in addition, the
results obtained in this research allow to conclude that buffaloes in central Italy are expressing high
levels of antibodies against BoHV-1 glycoprotein, suggesting a previous contact with the BoHV-1
and the contemporary presence in the animals of both related virus, BoHV-1 and BuHV-1. This
situation could interfere with the IBR eradication program in cattle since the buffalo could be a
potential reservoir for the virus, being more important the risk in regions where the disease has been
previously eradicated8,18,19. In this context, and when the risk of infection for cattle is high, a better
knowledge of these alphaherpesviruses is essential to successfully eradicate IBR. The identification,
discrimination and survey of the prevalence of both BuHV-1 and BoHV-1 infections in these animals
will offer important knowledge about their infection and epidemiology.
In the same way, diagnostic tools, including molecular protocols, able to distinguish between
ruminant alphaherpesviruses related to BoHV-1 and BoHV-1 itself are of great interest to reduce the
false negative or positive diagnosis. Finally and for the closely phylogenetic relationship of BuHV1 with BoHV-5, an evaluation of the susceptibility of BoHV-5 infection in buffaloes could be an
interesting research to develop in the future.
REFERENCES
1. Brake F. and Studdert MJ. Molecular epidemiology and pathogenesis of ruminant herpesviruses including
bovine, buffalo and caprine herpesviruses 1 and bovine encephalitis herpesvirus. 1985. Aust. Vet. J. Oct;
62 (10):331-4.
2. Bulach DM and Struddert MJ. Comparative genome mapping of bovine encephalitis herspervirus, bovine
herpesvirus 1 and buffalo herpesvirus. 1990. Arch. Virol. 113(1-2): 17-34.
3. Claus MP, Alfieri AF, Folgueras-Flatschart AV, Wosiacki SR, Medici KC, Alfieri AA. Rapid detection and
differentiation of bovine herpesvirus 1 and 5 glycoprotein C gene in clinical specimens by multiplex-PCR.
2005. J Virol Methods. Sep;128(1-2):183-8.
4. De Carlo E, Re GN, Letteriello R, Del Vecchio V, Giordanelli MP, Magnino S, Fabbi M, Bazzocchi C, Bandi
C, Galiero G. Molecular characterization of a field strain of bubaline herpesvirus isolated from buffaloes
(Bubalus bubalis) after pharmacological reactivation. 2004. Vet Rec. Feb 7;154(6):171-4.
5. El-Kholy AA. Molecular and immunological detection of bovine herpesvirus-1 in clinical specimens. 2005.
Egypt J. Immunology. 12 (2): 125-136
6. Engels M, Ackermann M. Pathogenesis of ruminant herpesvirus infections. Vet Microbiol. 1996 Nov;53(12):3-15.
95
7. George TD and Philpott M. Isolation of infectious bovine rhinotracheitis virus from the prepuce of water
buffalo bulls in Australia. 1972. Aust Vet J. Mar;48(3):126.
8. Hedger RS and Hamblin C. Neutralizing antibodies to bovide herpesvirus 1 (infectious bovine rhinotracheitis
/infectious pustular vulvo-vaginitis) in African wildlife with special reference to the cape buffalo (Syncerus
capper). 1978. Journal of comparative pathology. April, 88 (2): 211-218
9. Ibrahim A, Saw SP, Fatimah I, Saharee AA. Isolation of infectious bovine rhinotracheitis virus from buffalo
in Malaysia. 1983. Vet Rec. Mar 26;112(13):303-4.
10. Muylkens B, Thiry J, Kirten P, Schynts F, Thiry E. Bovine herpesvirus 1 infection and infectious bovine
rhinotracheitis. 2007. Vet Res. Mar-Apr;38(2):181-209.
11. Ros C, Belak S. Characterization of the glycoprotein B gene from ruminant alphaherpesviruses. Virus
Genes. 2002 Mar;24(2):99-105.
12. Rosati A and L.D Van Vleck. Estimation of genetic parameters for milk, fat, protein and mozzarella cheese
production for the Italian river buffalo Bubalus bubalis population. 2002. Livestock Production Science.
(74): 185-190
13. Schynts F., Baranowsky E, Lemairy M and Thiry E. A specific PCR to differentiate between gE negative
vaccine and wildtype bovine herpesvirus type 1 strains. 1999. Veterinary Microbiology, 66: 187-195.
14. Thange S, G Vanroose1, A Van Soom, L Duchateau, M T Ysebaert, P Kerkhofs, E Thiry, S van Drunen
Littel-van den Hurk, P Van Oostveldt and H Nauwynck. Inhibition of bovine sperm–zona binding by bovine
herpesvirus-1. 2005. Reproduction. 130: 251–259
15. Thiry E, Muylkens B, Meurens F, Gogev S, Thiry J, Vanderplasschen A, Schynts F. Recombination in the
alphaherpesvirus bovine herpesvirus 1. 2006. Vet Microbiol. Mar 31;113(3-4):171-7.
16. Thiry E, Meurens F, Muylkens B, McVoy M, Gogev S, Thiry J, Vanderplasschen A, Epstein A, Keil G,
Schynts F. Recombination in alphaherpesviruses. 2005. Rev Med Virol. Mar-Apr;15(2):89-103.
17. Thiry J, Widen F, Gregoire F, Linden A, Belak S, Thiry E. Isolation and characterization of a ruminant
alphaherpesvirus closely related to bovine herpesvirus 1 in a free-ranging red deer. 2007. BMC Vet Res.
Sep 28;3(1):26
18. Thiry J, Keuser V, Muylkens B, Meurens F, Gogev S, Vanderplasschen A, Thiry E. Ruminant alphaherpesviruses
related to bovine herpesvirus 1. 2006. Vet Res. Mar-Apr;37(2):169-90.
19. Thiry J, Tempesta M, Camero M, Tarsitano E, Bellacicco AL, Thiry E, Buonavoglia C. A live attenuated
glycoprotein E negative bovine herpesvirus 1 vaccine induces a partial cross-protection against caprine
herpesvirus 1 infection in goats. 2006. Vet Microbiol. Mar 31;113(3-4):303-8.
96
Epidemiological data of intrammamary infection in
cattle - a quantitative analysis of published data and
comparison with data in Croatia
Epidemiološki podatci rasprostranjenosti mastitisa u
goveda – analiza publiciranih podataka i usporedba s
podatcima pojave mastitisa u Hrvatskoj
Marina Pavlak1, Miroslav Benić2, Denis Cvitković1, Marko Tadić1
Department of Veterinary Economics and Analytic Epidemiology, School of Veterinary Medicine, University
of Zagreb
1
2
Croatian Veterinary Institute
Abstract
Mastitis is defined as an inflammatory reaction of udder tissue to bacterial, chemical, thermal or mechanical
injury. It is a common disease in dairy herd in many different counties and the most costly one in dairy cattle
breeding causing serious economic losses due to the decreasing milk production and lower quality of milk.
The aim of this study is to summarise the literature data on the prevalence and incidence level of spontaneous
intramammary infection in dairy cattle and to compare it with the epidemiological data of cattle intramammary
infection in Croatia. Analysed data include 118 available published papers on the Current Contents database
in the10-years period (from 1997 to 2007) describing epidemiological methods for determining occurence of
intrammamary infection worldwide. The data relating to occurrence of mastitis in Croatia have been collected
from Croatian Livestock Center, Laboratory for Milk Control, Križevci, Croatian Veterinary Institute, Zagreb
and Department for Veterinary Science, Ministry of Agriculture, Fisheries and Rural Development from 2002 to
2007. Three main categories of comparison were used: the frequency of intrammamary infection (subclinical and
clinical mastitis), the frequency of pathogen specific mastitis and the somatic cell count (SCC). In 55 countries,
about 30% the prospective studies of incidence rate, about 46% studies of prevalence rate and about 26% studies
of molecular epidemiology and risk factors were done. The level of subclinical mastitis varied from 9% to 70%
and clinical mastitis from 6.1% to 63.49% depending on milk gland status (dry or lactation period) and a parity.
The most frequently isolated pathogens from infected quarters were Staphylococcus aureus, and Streptococcus
uberis, followed by coagulase-negative staphylococci, Streptococcus agalactiae, Streprococcus dysgalactiae and
coliform bacteria. Staphylococcus aureus, Streptococcus agalactiae and Streptococcus dysgalactiae occurred
more often in herds with a high bulk milk SCC but coliform bacteria in herds with a low bulk milk SCC. In
Croatia SCC as well as number of pathogens from 2003 to 2007 decreased. Mean SCC in 2003 and 2007 were
209.063 and 165.216 respectively and mean number of pathogens microbes in raw milk were 236.958 and
54.049 respectively. In 1996 number of intrammamary infections caused by contagious-pathogens were 14.6%
and by environmental pathogens 5.9%, but in 2004 they were 13.6% and 8.4% respectively.
Sažetak
Mastitis je bolest mliječne žlijezde uzrokovana mikrobiološkim, kemijskim, toplinskim ili mehaničkim
čimbenicima. To je bolest koja se učerstalo javlja u mliječnih krava i dovodi do značajnih ekonomskih gubitaka
koji se izražavaju smanjenom proizvodnjom i kvalitetom mlijeka. Zbog velikih gospodarskih gubitaka koje
mastitis uzrokuje, a u cilju sprječavanja nastalih šteta, važno je poznavati epidemiološko stanje mastitisa u
zemlji. Stoga je cilj ovog rada bio sakupiti i obradititi podatke prevalencije i incidencije prirodnih infekcija
mliječne žlijezde u svijetu i usporediti ih s epidemiološkim podatcima u Hrvatskoj. Analizirano je i obrađeno
118 radova objavljenih u Current Contents bazi podataka zadnjih 10 godina. (od 1997. do 2007.) koji opisuju
97
rasprostranjenost i učestalost pojavljivanja mastitisa u svijetu. Ti podatci su uspoređeni s podatcima prikupljenih
za Hrvatsku (podatci dobiveni od Laboratorija za kontrolu mlijeka Hrvatskog stočarskog centra, Hrvatskog
veterinarskog instituta i Uprave za veterinarstvo Ministarstva poljoprivrede, ribarstva iruralnog razvoja) od
2002. do 2007. godine. Uspoređivani podatci odnosili su se na: stopu prevalencije i incidencije subkliničkog i
kliničkog mastitisa, učestalost pojavljivanja mastitisa prema uzročniku, učestalost pojavljivanja mastitisa prema
broju somatskih stanica. Ustanovljeno je da se oko 30% radova odnosilo na istraživanje stope incidencije
mastitisa, 46% na istraživanje prevalencije i oko 26% radova može se svrstati u područje molekularne
epidemiologije i procjene rizika. Stopa prevalencije subkliničkog mastitisa kretala se od oko 9% do 70%, a
kliničkog mastitisa od 6.1% do 63.49% ovisno o rizičnim čimbenicima (stanje mliječne žlijezde, broj parenja,
dob životinje). S etiološkog gledišta najveći broj mastitisa uzrokovan je s bakterijama vrsta Staphylococcus
aureus i Streptococcus uberis, te koagulaza negativnim stafilokokima kao i nekim streptokokima poglavito
vrstama Streptococcus agalactiae i Streprococcus dysgalactiae. Podatci su pokazali da mastitis uzrokovan sa
Staphylococcus aureus, Streptococcus agalactiae i Streptococcus dysgalactiae učestalije se javlja u krava s
povećanim brojem somatkih stanica u stajskom uzorku mlijeka, dok su koliformne bakterije češće uzročnik
infekcije u krava koje imaju manji broj somatskih stanica. Uspoređujući navedene podatke s podatcima za
Hrvatsku može se vidjeti da su podatci za Hrvatsku u okviru svjetskih podataka te da od 2003 do 2007 ukupan
broj somatskih stanica se smanjivaoo kao i ukupan broj mikroorganizama. Godine 1996. u Hrvatskoj je bilo
14.6% mastitisa uzrokovanih kontagioznim uzročnicima, dok je 2004. godine taj broj iznosio 13.4%., dok je
broj mastitisa uzrokovan okolišnim čimbenicima nešto rastao, od 5.9% na 8.4%.
Introduction
Mastitis is defined as an inflammatory reaction of udder tissue to bacterial, chemical, thermal or
mechanical injury. Clinical mastitis, in wich abnormal milk is detected, as well as subclinical mastitis,
in which no changes in milk are apperent, are common diseases in dairy herds in many different
countries. Both mastitis are the most costly in dairy cattle breeding causing serious economic losses
due to the decreasing milk production and lower quality of milk (White et al., 2001; Gröhn et al.,
2004; Wolfowa et al., 2006). Some epidemiological data indicated that mastitis is the most important
cause of culling. In Swiss dairy herds, up to 13% of all culling are duo to mastitis (Aeberhard et al.,
1997). In Ethiopia 27% of cows were removed from herds because of intramammary infection (IMI)
(Degraaf and Dwinger, 1996; Workineh et al., 2002). Therefore, in order to reduce the occurrence of
IMI in dairy herds as well as the overall cost of the udder health problem, in many countries mastitis
control program have been implemented (Kaneene and Hurd, 1990; Ekesbo et al., 1994; Bartlett et
al., 2001; Sviland and Waage, 2002; Sommerhauser et al., 2003). Information about the distribution
of IMI as well as specific pathogen mastitis in the dairy cows is of great importance for strategic
decision-making and optimal planning of mastitis control programs. However, the epidemiological
characterisation of mastitis pathogens is important for implementation of IMI control measures.
Therefore numerous epidemiological studies in many countries have been performed in order to
monitor a frequency of IMI occurrence as well as to identify reservoirs of specific pathogens and
the route of infection.
The aim of this study is to summarise the literature data on the prevalence and incidence level of
spontaneous intramammary infection in dairy cattle and to compare it with the epidemiological data
of cattle intramammary infection in Croatia.
Material and methods
Analysed data include 118 available published papers on the Current Contents database indexed
from 1997 to 2007 describing epidemiological methods to determine occurence of IMI worldwide.
The data relating to occurrence of mastitis in Croatia have been collected from Croatian Livestock
98
Center, Laboratory for Milk Control, Križevci, Croatian Veterinary Institute, Zagreb and Department
for Veterinary Science, Ministry of Agriculture, Fisheries and Rural Development from 2002 to
2007. Three main categories of comparison were used: the frequency of IMI (subclinical and clinical
mastitis), the frequency of pathogen specific mastitis and the somatic cell count (SCC). Key words
used in the search included IMI, mastitis, epidemiology, incidence and prevalence. The papers taken
into consideration were original studies and reports on the incidence of spontaneous IMI cases.
Results and discussion
Table 1. Epidemiological studies of prevalence of IMI (subclinical mastitis) in some countries compared with
available data in Croatia
Country
Time of the
study
CROATIA
1996 and 2004
Denmark
1999 and 2000
Number of herds/cows/quarters/
tests included into study
34 farms/250 cows/1000 quarters
47 farms/304 cows/1204 quarters
Prevalence rate
1996 2004 1999 2000 -
34%
28.7%
16.2%
42.2%
Switzerland
Germany
1988 and 1995
4495 i 2648 cows/17111 i 10410
samples
2001
216 herds/3282 cows/12661 quarters
1995-1997
118 herds/1816 samples
1997
152 herds/1907 cows**
1990-1996
10 herds/1074 cows
1389 heifers
(5 weeks after calving)
21.6%
2529 cows/9919 samples
26.4%
25 herds/3166 cows
52.7%
1997
Estonia
USA (Ohio)
1985-1991
542 cows
Chile
1998
26 cows***
46 cows/185 mammary gland
523 herds
Ethiopia
1996-1997
162 herds/307 cows
Brazil
Benić, 2005
Sampimon et al., 2007
Aarestrup and Jensen,
1997
20 herds/180 cows/3382 quarters*
Finland
Authors
1988 - 47.8%
1995 - 37.8%
31%
47% of the herds
6.1% of cows
21,2 and 34,5%
Myllys et al., 1998
Pitkala et al., 2004
Burnens et al., 1999
Busato et al. 2000
Fleicher et al, 2001
Edinger et al., 1999
Out of 374
environmental
steptococcal IMI 45.2% CM
59.9% ***
69.5%
55.3%
40.4% (CM: 37.1%,
SCM: 62.9%)
Tenhagen et al., 2006
Haltia et al., 2006
Todhunter et al., 1995
Benites et al., 2003
Tadich et al., 2003
Dego and Tareke, 2003
* 4 weeks before and 4 weeks after calving; ** 7-100 and 101-305 day after calving; ***94 samples of milk,
184 samples of mammary gland, 168 samples of gland and 168 samples of teat cistern :positive results:
67% of the milk ; 70.1% of mammary parenchymas; 55.7% of gland cistern; 48.8% of teat cistern
99
Table 2. Epidemiological data of prospective studies of incidence rate of clinical mastitis in some countries
Country
Time of the
study
Great Britain
1992-1993
1994-1996
1990-2001
1995-1997
1993-1994
France
Denmark
Number of herds/cows/
quarters/tests included
into study
144 cows
20084 cows
205 herds
2146 herds
274 herds/5827 cows/7594
quarters
Netherlands
171 herds
Norway
1992-1995
New Zealand
28 herds
137 periparturient Holstein
cows
1084 tests
USA
1990-1991
USA
(Wisconsin)
1994-2001
77.172 samples
Tanzania
2003/05
Uruguay
Rate
32.1 saces/100 cow year at risk
39.9 cases/100 cows year at risk
20.1 cases/100 cows yr
44.1 cases /100 cows year at risk
36-48 cases/100cows year at risk
0.263 cases/365 cow days at risk
mean number of CM cases per herd
during 1.5-yr period =30.8
12.7 cases/100 cow year at risk
49 cases/100 cows year at risk
12.70%
Authors
Kossaibati et al., 1998
Barnouin et al., 2005
Fourichon et al., 2001
Barlet et al., 2001
Barkema et al, 1999
Elbers et al., 1998
Sviland and Waage 2002
McDougall et al., 2007
28% of tests
Detilleux et al., 1995
20.6 -9.5%
Makovec and Ruegg,
2003
85 herds/318 cows/6057
quarters
38.4 cases/100 quarters year at risk
or 43.4 cases/100 cow year ar risk
Kivaria et al., 2007
40 cows and 1077
cows/4300 quarters *
Gianneechini
CM: 1.2 cases/100 cows year at risk
2002
SCM: 52.4% of cows
et
al.,
*4 weeks before and 4 weeks after calving
Out of 118 analysed papers, 71 (60.2%) covered epidemiological studies of incidence and
prevalence of IMI, in 15 (12.7%) papers risk factors have been studied and in 12 (10.2%) studies
of molecular epidemiology have been done. Out of 71 papers studying occurrence of IMI in
different countries, in 57 papers prevalence of IMI have been investigated covering 25 countries.
Epidemiological studies of incidence or incidence rates of clinical mastitis (CM) in 15 countries are
described in 34 articles. Most articles describing molecular epidemiology analysis had references
to genomic typing of Staphylococcus aureus and Streptococcus uberis followed by Escherichia
coli and coagulase negative staphyloccoci (CNS). Most frequently analysed risk factors were
influence of hygiene, management practises, feeding, dry therapy, breed, age, parity, lactation
stage, teat stage, body condition, leaking milk, type of milking system and seasons.
Overview of occurrence of intrammamary infection (IMI)
Epidemiological data of occurrence of IMI and clinical mastitis in some countries are presented
in Tables 1 and 2. Subclinical (SCM) and clinical mastitis (CM), according to these data, have
been present in dairy cows during the whole period of lactation as well as in dry period. However,
especially high incidence of SCM and CM in dairy cows has been found in the peripartutient
period when the immune response is impeded and cows are metabolically stressed. Dego and
Tareke (2003) found that prevalence of mastitis was significantly higher in non-lactating than
100
Table 3. The most frequently isolated pathogens in cows with subclinical intramammary infection (SCM) and
clinical mastitis (CM) in some countries compared with available data in Croatia
Country
Time of
the
study
The most frequently isolated pathogens
CROATIA
SCM
Contagious pathogens:
Environmental pathogens:
Denmark
SCM
CNS
SCM
Finland
SCM
SCM
Switzerland
SCM
SCM
Germany
SCM
SCM
SCM
Netherlands
CM
CM
Estonia
SCM
New Zealand
USA
CM
CM
U
S
A
CM
(Wisconsin)
Uruguay
CM
Brazil
Chile
SCM
SCM
SCM
Ethiopia
SCM
7.3 and 14.1%
14.6 % and 13.6%
5.9% and 8.4%
Authors
Benić, 2005
Sampimon et al., 2007
Staph. aureus:
2% before and 16-48% after partus
Aarestrup and Jensen, 1997
Str. dysgalactiae: 20% before and 3-35% after partus; Str.
chromogenes
CNS:
26.6 and 49.7%;
Myllys et al., 1998
Staph. aureus:
36.9 and 63.6%
CNS;
Pitkala et al., 2004
C. bovis
Burnens et al., 1999
Staph. aureus:
16.% and 7.4%;
Busato et al. 2000
C. bovis:
25.7% and 45.1%
Fleicher et al, 2001
Streptococci
12%;
Edinger et al., 1999
Staphylococci
69%
E coli
5%
CNS
9.1%;
C. bovis
7.3%;
Tenhagen et al., 2006
Staph.. aureus :
5.7% (21.8% of positive);
Str uberis :
1% (3.7% of positive)
Staph. aureus; CNS; Str. uberis;
Barkema et al, 1999
Str. agalactiae; Str. dysgalactiae
Staph. aureus
Elbers et al., 1998
Haltia et al., 2006
Staph. aureus, CNS, Str. agalactiae, Str. dysgalactiae,
C. bovis
Str. uberis
McDougall et al., 2007
Detilleux et al., 1995
CNS -23.7% of tests and 86% of positive tests
Staph aureus :
17.7 – 9.7%
Makovec and Ruegg, 2003
CNS :
12.7-17.5 %
Str. agalactiae :
8.1-3.0 %
E. coli :
3.1-6.7%
Staph. aureus : CM: 37.5% SCM 62.8%
Str, agalactiae: CM 5%;
SCM 1.3%
Gianneechini et al., 2002
Str. uberis :
CM 2.5%, SCM 6.4%
E. coli :
CM 12.5%, SCM 1.5 %
CNS 35.7%; CPS 12.2%; C. bovis 2.4%
CNS 53.8%; CPS 7.6%
Tadich et al., 2003
Staph. aureus 36.7% ; Str. agalactiae 13.1% ;
Dego and Tareke, 2003
E. coli 10.1%; Str. dysgalactiae 5.6%; Str. uberis 5.1%
101
Table 4. Distribution of pathogens isolated in cow with IMI in some Europena coutries
Country
S. aureus
S. agalactiae
CROATIA
20.85 -33.36%
1.41-4.20%
Italy
22.6%
2.30%
Germany
24%
S. uberis
S. dysgalactiae
29% of herds
1% (3,7% of
positive
samples)
Tenhagen et al.,
2006
E. coli 5%
Schwizerland
E. coli 0.4 – 1 %
7.4-16 %
10.2 % heifers
6.7 % cow
Netherland
Finland
18.26%
36.9 i 63.6%
Norwey
54.9-65.9%
14.2-15.2%
8.2% at quarter
level,
22.2% at cow
level
22.7% -in
correllation
with culling
0,4% at
quarter level
1.42 % at
cow level
Litva
102
20.32%
E. coli 16.7% in heifers
Haas et al., 2002
and 21.5% in cows
Koivula et al.,
2007
Myllys et al.,
1998
Whist et al.,
2007
1.2%, at quarter
level
1.17% at cow
level
Osteras et al.,
2006
20% prior partus
3-35%
postpartus
Poland
8.60%
Einger et al.,
1999
Busato et al.,
2000
Reksen et al
2006
4-6%
Denmark
Authors
E. coli 1.69-6.56%
P.aeruginosa 0-0.77%
Benić, 2003
Klebsiella spp. 0.140.73
Ferguson et al.,
2.9%
2007
Serratia marcescens
Guardo et al.,
20.8% - corelation with
1997
SCC higher than
500000cells/ml
Stefel and
Philipp, 2007
30%
5.7%
(21.8% of
positive
samples)
Enterobacteriace
koliform
50%
19.70%
Aarestrup and
Jensen , 1997
E. coli 52.30%
P. aeruginosa 3.60%
K. pneumoniae 4.10%
E. cloacae 3.60%
S. marcescens 3.10%
P. mutocida 3.10%
Acinetobacter lwofti
3.10%
Malinowski et
al., 2006
Aniiulis et al.,
2003
Table 5. Frequency of contagious and environmental pathogens isolated in dairy cows in Croatia
(Benić, 2003,2005)
Year
1990
1991
1992
1994
1995
1996
1998
2001
2002
2004
No of samples
2068
839
641
1046
1067
1537
6853
8704
11566
1197
47.14
44.46
44.77
43.78
41.71
46.52
40.33
38.68
36.54
22.0
37.57
32.42
30.9
32.89
23.43
24.72
26.4
24.71
24.3
13.6
33,36
29.32
26.7
28.68
22.02
21.05
24.78
20.85
20.31
...
4.21
3.1
4.2
4.21
1.41
3.67
1.62
3.86
3.99
...
6.09
8.58
8
5.64
9.75
7.37
8.56
10.06
7.56
...
9.61
11.92
13.03
10.9
18.28
10.6
13.91
13.77
11.56
8.4
1.69
2.26
2
3.63
6.56
2.36
3.03
2.2
2.4
...
0.24
0.36
0
0.29
0.28
0.39
0.77
0.55
0.42
...
0.14
0.24
0.73
0.38
0.47
0.28
0.51
0.34
0.39
...
0.04
0.12
0.3
0.1
0.19
0
0.07
0.02
0
...
% of positive
samples
Contagious
pathogens (%)
Staph. aureus
(%)
Str. agalactiae
(%)
Other
Streptococci
(%)
Environmental
pathogens (%)
E. coli (%)
P. aeruginosa
(%)
Klebsiella spp.
(%)
C. pyogenes
(%)
Table 6:Data of of the milk quality cotrol based on the BMSCC and TBC (Dakić et al., 2007)
BMSCC
TBC
2003
209.063
236.958
2004
185.468
180.515
2005
169.546
111.089
2006
166.728
76.122
2007
165.216
59.049
Epidemiological data of prevalence of SCM (Tab. 1) showed that this IMI is present in many
countries both developed and developing. The level of prevalence of IMI in some European countries
varied approximately from 9-53%. However, in other countries, especially developing ones like
Ethiopia (Dego and Tareke, 2003) and Tansania (Mdegela et al., 2004), prevalence of SCM increased
up to 70%. The level of occurrence of IMI in Croatia according to data studied by Benić (2005) in
1996 and 2004 (Tab. 1 and 3) stayed within the framework of the frequency of occurrence of IMI in
European countries. According to the paper report of Croatian Department for Veterinary Science,
Ministry of Agriculture, Fisheries and Rural Development on the performed California mastitis test
(CMT) in 2007 (from Semptember until December), the following was found: out of 31.813 samples
examined on the IMI infection using CMT, 12.975 (40.79%) were CMT positive. Out of 15.689
samples examined bacteriologically, 9795 (62.43%) samples were positive. Out of 6947 control
samples (samples taken after therapy and carence period), 1845 (26.56%) were positive.
Since the occurrence of IMI also depends on management system and a type of farming, studies
of influence of conventional and organic farms on the prevalence of IMI were done. Prevalence of
SCM in the organic farms in Switzerland at the cow level were 47.8% to 61.5% depending on the
103
period (days) postpartum. (Busato et al., 2000). Roesch at al. (2007) also showed higher prevalence
of California mastitis test (CMT)-positive quarter in cows from organic farms. The most SCM were
caused by Staphylococci, Streptocococi, Escherichia coli and Corynebacterium bovis (Tab. 1).
According to data by Jayarao et al. (1999), Str. uberis was the main pathogen isolated in cow with
SCM in the United States. The most frequent causes of IMI in Croatia were contagious pathogens
including Staphylococcus aureus and Streptococcus agalactiae (Benić, 2005).
According to analysed data, incidence rate for CM varied approximately from 20 to 50 cases per
100 cow-years at risk (Tab. 2). Reported data were very similar in European countries as well as
other countries like the United States or Tansania and Uruguay (Detilleux et al., 1995; Gianneechini
et al., 2002; Makovec and Ruegg, 2003; Kivaria et al., 2004, 2007). Therefore, it could be concluded
that SCM is more prevalent than CM in developing countries, as reported by Karimuribo et al.
(2006). On the other side, in developed countries with incorporated control program, prevalence
of SCM was reduced but CM continues to be a great problem (Barkema et al., 1998). In Croatia no
epidemiological data of prospective studies of incidence rate of CM were found.
There are many risk factors causing CM. Several studies have investigated CM risk factors (Elbers
et a., 1998; Barkema et al., 1999a; 1999b; Waage et al., 1998; Peeler et al., 2003; Giovannini and
Zecconi, 2002; Mungube et al., 2004; Barnouin et al., 2005). High milk production, very low bulkmilk SCC, leaking milk and use of post milking teat disinfection are the main factors associated with
increased incidence of CM. Study of influence of close monitoring of dairy cows on the incidence of
CM and SCM in Croatia performed by Cergolj et al. (2004), showed promising results in prevention
and eradication of SCM.
Overview of the frequency of pathogens cousing IMI
According to epidemiological characteristics, the bacterial pathogens responsible for IMI
are divided into two main categories: contagious and environmental pathogens. Infection with
contagious pathogens results in clinical illness as well as strong inflammatory responses and reduces
milk production. Environmental pathogens usually cause sublinical intramammary infection. The
most important contagious mastitis pathogens spreading rapidly within a herd and resulting in a large
number of infected quarters are Staphylococcus aureus, Streptococcus agalactiae and Mycoplasma
spp. Environmental pathogens include coliform bacteria and environmental Streptococci. The most
frequent coliform bacteria causing IMI are E. coli and Klebsiella and the most prevalent environmental
Streptococci isolated from udder are S. uberis, S. dysgalactiae (Benić, 2003).
Distribution and frequency of pathogens isolated from cow with SCM or CM in some European
countries are presented in Table 3. Presented data covered the period from 1990 to 2004. From the
data presented in the Table it could be seen that the obtained results showed very similar data of
frequency of pathogens in Europe, except of the data on the frequency of Staph. aureus in Finland
and Norway (Myllys et al., 1998; Whist et al., 2007). Percentage of isolated mastitis pathogens in
Croatia were also very similar to the results obtained in other European countries (Tab. 3 and 4). The
data of epidemiological studies performed in Croatia from 1990 to 2002 reported by Benić (2003,
2005) are presented in Table 5.
The frequency of Staph. aureus in Finland and Norway obtained in the studies performed by
Myllys et al. (1998) and Whist et al. (2007) were higher than in the papers by other authors (Table
3). In Norway in 95% of 178 dairy herds, Staph. aureus was isolated and the prevalence of Staph.
aureus at the herd level was about 18% (Whist et al., 2007). Reksen et al. (2006) reported that Staph.
aureus is predominant mastitis pathogens in Norway and is estimated to be responsible for 47% of
clinical cases of mastitis. Except in Europe, Staph. aureus is also predominant mastitis pathogen in
104
the United States where it causes significant mastitis in heifers. In the United States the prevalence of
mastitis in dairy heifers (n=233) was 56.5% at the quarter level and 15.4% of quarters were infected
with Staph. aureus (Owens et al., 2001). In Croatia during the whole observed period from 1990 to
2002 Staph. aureus was the most frequently isolated pathogen from udder secretion (Topolko and
Benić, 1997; Benić, 2003).
Analysing the risk factors for Staph. aureus mastitis Zadoks et al. (2001) showed that Staph.
aureus infection was higher in bovine herpesvirus 4-seropositive cows, in right quarters, in quarters
that had recovered from Staph. aureus or Str. uberis infection and in quarters with extremely callused
teat ends.
Prevalence of Str. agalactiae in European countries was up to 6%, but the higher prevalence
(17.7%) has been reported in 1992 in Canada (Keefe et al., 1997). In Croatia, prevalence rate of Str.
agalactiae between 1990 and 2002 varied from 1.41 to 4.2% (table 4), which is in accordance with
the results of other authors.
The most commonly isolated Coagulase negative staphylococci (CNS) worldwide are Staph.
chromogenes, Staph. epidermidis and Staph. similans. In heifers 3 weeks before and 3 weeks after
parturition Staph. chromogenes was isolated in 15 % and both Staph. similans and Staph. epidermidis
in 1-3% of quarters (Aarestrup and Jansen, 1997). The proportion of Staph. epidedimis-infected cows
in Sweden was 22-31% (n=145 cows) (Thorberg et al., 2006). Although the Staph. epidermidis is
not very often found in the normal bacterial flora of bovine skin or mucosal membranes (White et
al., 1989), from epidemiological point of view, Staph. epidermidis has the great importance because
it is most prevalent staphyloccoci found on human skin. Therefore it has been suggested that bovine
Staph. epidermidis mastitis may be a zoonosis with human origin. (Thorberg et al., 2006).
The most important environmental pathogens causing IMI are Str. uberis, Str. dysgalactiae and
coliform pathogens including Escherichia coli and Klebsiella spp. (Tab. 1-3). From the data presented
in the Table 3, it could be seen that there are different results of prevalence of study of Str. uberis
and Str. dysgalactiae. Pankey et al (1996) found that about 90% of total cases of environmental
streptococcal mastitis (12.2%) in heifers in the first 5 days of lactation were caused by Str. uberis.
Aarestrup and Jansen (1997) isolated Str. uberis (n=180 heifers) much higher in the first 4 weeks of
lactation than in last 2 weeks prepartum. Jayarao et al. (1999) reported that the prevalence of Str.
uberis IMI was higher in cow with 4 or greater lactations than in cow with 3 or lower lactation. In
the United States the percentage of cows infected with Str. uberis ranged from 12 to 18% of cow/year
(Todhunter et al., 1995; Jayarao et al., 1999) and more than 50% of total IMI were coused by Str.
uberis (Todhunter et al., 1995). In Norwey out of 178 dairy herds, 45% of the herds showed Str.
dysgalactiae positive cows (Whist et al., 2007).
The Enterobacteriaceae is classified as a opportunistic environmental pathogens causing IMI,
especially in the dry period. In the United States 60% of all new IMI occurred in the dry period
(Todhunter et al 1995). Study of enterobacterial IMI in the dry period (3 weeks precalving and
postcalving) performed in Great Britain by Bradley and Green (2002) showed that out of 153 CM
(n= 629), 40.5% of these mastitis cases were caused by enterobacterial species including E. coli,
Klebsiella spp, Serratia spp and Citrobacter spp (Bradley and Green, 2000). The prevalence of
the Enterobacteriaceae in some countries are presented in Table 3. In Croatia the most frequently
isolated Enterobacteriaceae are E. coli, P. aeruginosa and Klebsiella spp. The prevalence rates of
these pathogens during observed period (1990-2002) is presented in the Table 5. Comparing this data
105
with the data of other authors, it could be concluded that the prevalence rate of these pathogens was
in correspondence with this data.
From the epidemiological point of view, the dry period is the very important for environmental
streptoccocal mastitis because the rate of IMI in this period is approximately 5.5-fold greater than
the rate in lactating period and about 55% of environmental streptococcal IMI present in the first half
of the dry period persist to lactation. (Todhunter et al., 1995).
Epidemiological study performed in Germany in period between 2001 and 2002 showed that out
of 26.4% (n=2614) of samples contained mastitis pathogens, Corynebacterium bovis with CNS was
predominant findings, accounting for 62.2% of the positive samples (Tenhagen et al., 2006). In Croatia
were isolated Corynebacterium pyogenes (Table 4) with a very low prevalence rate. Comparing the
microbiological status of different sites (milk (n=94), mammary parenchima (n= 184), gland cystern
(n=168) and teat cistern (n=168)) collected from slaughtered naturally infected dairy cows, (positive
results were obtained in 67.0%, 70.1%, 55.9% and 48.8% respectively), Corynebacterium bovis was
the predominant pathogen in milk compared to other sites (Benites et al., 2002).
Overview of the somatic cell count (SCC)
In the most breeding programs, SCC was used as indicator for mastitis susceptibility (Emanuelson
and Funke, 1991; Wilson et al., 1997). The dairy industry worldwide has imposed regulatory limits
for bulk milk somatic cells count (BMSCC). This limit in Croatia is 400.000 cells/ml (NN 102/2000
and NN 134/2007), in Chile 330.000 cells/ml (Tadich et al., 2003), in th USA 750.000 cells/ml
(Wilson et al., 1997). In the Netherlands arithmetic mean BMSCC per herd ranged from 67.000
cells/ml to 422.000 cells/ml for the 274 herds (average 204.000 cells/ml) (Barkema et al., 1998).
Factors associated with the high BMSCC are infection status of the quarter, number of quarters
infected, age of cows, stage of lactation, season of the year, stress, management (Wilson et al., 1997;
Barkema et al., 1999b). De Haas et al. (2002) showed that SCC was high shortly after parturition and
in the end of the lactation. Multiparous cows had generally higher SCC than heifers. CM caused by
Gram-negative pathogens such as E. coli, Klebsiella spp or Pseudomonas spp occurred much more
in herds with low BMSCC (Barkema et al., 1998). Therefore, low SCC herds are considered to have
higher levels of environmental mastitis or CM caused by Staph aureus has been observed much
more in herds with BMSCC lower than 150.000 cells/ml (Erskine et al., 1988; Elbers et al., 1998).
Barkema et al. (1998) also found lower values in BMSCC in cows infected with Staph aureus in the
study. In bacteriologically positive cows in Swiss (n=142) having from 190.000 to 566.000 cells/
ml Staph aureus (28.9%) and Coagulase-negative streptococci (28.2%) were the most frequently
isolated pathogens (Roesch et al., 2007). Although the IMI caused by contagious pathogens like
Staph. aureus and Str. agalactiae has been associated with high BMSCC (Keefe et al., 1997; Wilson,
et al., 1997; Tadich et al., 2003), some studies suggested that low SCC was also associated with high
incidence rate of CM (Elbers et al., 1998; Beaudeau et al., 2002). These opposite results depend on
many factors such as the accuracy of CM evaluation (Peeler et al., 2003), SCC measurement level
(Beaudeau et al., 2002) or management practices (Elbers et al., 1998). Erskine et al. (1988) compared
herds with a very high BMSCC (>700.000 cells/ml) and with a low BMSCC (<150.000 cells/ml)
and found a higher incidence of CM in herds with the low BMSCC. According to type of farm
management or management practices statistical higher values in SCC was found in organic than in
conventional farms (Roesch et al., 2007).
In Swiss, SCC showed linearly increase with increasing numbers of CMT-positive quarters and
there was close association between SCC and the number of CMT-positive quarters. About 85% of
the analyzed milk samples ranging from 190.000 to 566.000 cells/ml were bacteriologically positive
106
(Roesch et al., 2007). Suriyasathaporn et al. (2000) and Beaudeau et al. (2002) have noted that herds
with high proportion of cows with low SCCs appeared to be at increased risk of CM. Herds infected
with Str. agalactiae had higher BMSCC than uninfected herds (Keefe et al., 1997)
In some countries has been noted a decrease in BMSCC in dairy herds in recent years. In Dutch
dairy industry has been noted a decrease in BMSCC from 310.000 cells/ml in 1985 to 221.000
cells/ml in 1995 (Barkema et al., 1998). Osteras et al. (2006) also observed decreas in BMSCC from
173.000 to 113.000 cells /ml, but incidence of CM has increased. The reason for this is targeted
therapy of cows with the high SCC.
The same situation was observed in Croatia where SCC as well as total bacterial count (TBC)
decreased from 2003 to 2007 (Table 6). Mean SCC in 2003 and 2007 were 209.063 and 165.216
respectively and total bacterial count in raw milk 236.958 and 54.049 respectively (Dakić et al,
2007). According to the data of Laboratory for Milk Control in Križevci it could be seen that during
the observed period (2003-2007), about 70-80% of bulk milk contained less than 400.000cells/ml.
In 2003 and 2004 about 15% of samples had more than 600.000cells/m, but in 2005 and 2006 this
percentage was about 10%. During this period the mean of TBC of bulk tank milk samples containing
less than 100.000 was increased from about 25% in 2003 to about 65% in 2006. In January 2003 was
noted the highest percentage (about 70%) of milk samples containing TBC more than 400.000. In
December 2006 this percentage was about 20% (Dakić at al., 2007).
Influence of season on the level of BMSCC has been also observed. Busato et al. (2000) showed
that BMSCC in SCM in organic herds ranged from 79.000 to 142.000 cells/ml depending on season
of year and management. In winter BMSCC was lower (79.000 cells/ml) than in summer (94.000
cells/ml). In 300 Dutch dairy farms (Riekernik et al., 2007) the highest BMSCC was found in August
and September, but individual cow SCC was the highest in August and May. Dakić et al. (2007) also
reported seasonal variation in milk quality. Number of milk samples which fulfil the standards of EU
quality, was the highest in March and in December.
Conclusion
Accordinig to analysed epidemiological data, it could be concluded that the IMI is present in many
countries both developed and developing. The level of prevalence of SCM in some European countries
varied approximately from 9-53% but in developing countries increased up to 70%. Incidence rate
for CM varied approximately from 20 to 50 cases per 100 cow-years at risk. In developed countries
with incorporated control program, prevalence of SCM was reduced but CM continues to be a great
problem. On the other side, in developing countries SCM is more prevalent than CM. The level of
occurrence of IMI in Croatia stayed within the framework of the frequency of occurrence of IMI in
European countries. The most SCM were caused by Staphylococci, Streptocococi, Escherichia coli
and Corynebacterium bovis. The most frequent causes of IMI in Croatia were Staphylococcus aureus
and Streptococcus agalactiae. The most commonly isolated Coagulase negative staphylococci (CNS)
worldwide are Staph. chromogenes, Staph. epidermidis and Staph. similans. From the epidemiological
point of view, the dry period is the very important for environmental streptoccocal (Str. uberis and
Str. dysgalactiae) mastitis as well as for the Enterobacteriaceae (E. Coli, Klebsiella spp, Serratia
spp and Citrobacter spp) classifing as a opportunistic environmental pathogens. In Croatia the most
frequently isolated Enterobacteriaceae are E. coli, P. aeruginosa and Klebsiella spp.
In the most breeding programs, SCC was used as indicator for mastitis susceptibility. Factors
associated with the high BMSCC are infection status of the quarter, number of quarters infected, age
107
of cows, stage of lactation, season of the year, stress, management. CM caused by Gram-negative
pathogens such as E. coli, Klebsiella spp or Pseudomonas spp occurred much more in herds with
low BMSCC. IMI caused by contagious pathogens like Staph. aureus and Str. agalactiae has been
associated with high BMSCC, but some studies suggested that low SCC was also associated with
high incidence rate of CM caused by these pathogens. In some countries has been noted a decrease
in BMSCC in dairy herds in recent years. The same situation was observed in Croatia.
Despite of the decreasing trend some pathogen IMI in dairy cows, CM as well as streptococcal
and staphylococcal mastitis remain the most common IMI. The most important risk factors associated
with increased prevalecne of SCM are early lactation period, lesions on the skin of teat and /or udder,
rainy season, at least 8 parities and poor body conditions. The main risk factors associated with
increased incidence of CM are high milk production, very low bulk-milk SCC, leaking milk and
use of post milking teat disinfection. Obtained results differ in different counties because of specific
climatic, housing and dairy breed conditions. Since the results of risk analysis depend on country to
country, it could be useful to perform studies of risk analysis for IMI in Croatian climatic, housing and
dairy breed conditions. Although in Croatia some epidemiological studies were done, there is still a
need for additional epidemiological observational studies on risk for IMI as well as on prevalence of
SCM and incidence rate of CM in order to prevent udder health problem in dairy herds in Croatia.
References
1. Aeberhard K., R. Bruckmaier, J. W. Blum (1997): High-yielding dairy cows in Schwizerland. Agraforschung
4, 277-280
2. Aarestrup F. M., N. E. Jensen (1997): Prevalence and duration of intramammary infection in Danish heifers
during the peripartum period. Journal of Dairy Science. 80(2):307-312
3. Barkema H.W., Y. H. Schukken, T. J. G. M. Lam, M. L. Beiboer, G. Benedictus, A.Brand (1998): .
Management practice associated with low, medium and high somatic cell count in bulk milk. Journal of
Dairy Science. 81(7):1917-1927.
4. Barkema H.W., Y. H. Schukken, T. J. G. M. Lam, M. L. Beiboer, G. Benedictus, A.Brand (1999a):
Management practices associated with the incidence rate of clinical mastitis Journal of Dairy Science.
82(8):1643-1654
5. Barkema H.W., J. D. Van der Ploeg, Y. H. Schukken, T. J. G. M. Lam, G. Benedictus, A. Brands (1999b):
Management style and its association with bulk milk somatic cell count and incidence rate of clinical
mastitis Journal of Dairy Science. 82(8):1655-1663
6. Barnouin J, S. Bord, S.Bazin, M. Chassagne (2005): Dairy mamagement practices associated with
incidenece rate of clinical mastitis in low somatic dell score herds in France. J Dairy Sci 88, 3700-3709
7. Bartlett P.C., G. Y.Miller, S. E. Lance, L. E. Heider, (1992): Clinical mastitis and intramammary infections
on Ohio dairy farms. Prev Vet Med 12, 59-71
8. Beaudeau F., C. Fourichon, H. Seegers, N. Bareille (2002): Risk of clinical mastitis in dairy herds with a
high proportion of low individual milk somatic-cell countsVeterinary Medicine. 53(1-2):43-54
9. Benić, M. (2003): Mikrobiološki nalazi uzročnika upala mliječne žlijezde. Veterinarski dani 2003. Šibenik,
9-12. 10. 2003. Zbornik radova, 125-131
10. Benić, M. (2005): Učestalost mastitisa prije i nakon donošenja Pravilnika o kakvoći svježeg sirovog
mlijeka. Veterinarska stanica, 4, 233-238.
11. Benites, N. R., J. L. Guerra, P. A. Melville, E. O. Costa (2002): Aetiology and histopathology of bovine
mastitis of espontaneous occurence. J. Vet. Med. B, 49, 366-370
108
12. Benites, N. R., P. A. Melville, E. O. Costa (2003): Evaluation of the microbiological status of milk and
various structures in mammary glands from naturally infected dairy cows. Tropical Animal health and
Production, 35, 301-307
13. Bradley A. J., M. J. Green (2002): A study of the incidence and significance of intramammary enterobacterial
infections acquired during the dry period. Praktische Tierarzt. 83(8):724
14. Burnens A. P., P. Bonnemain, U. Bruderer, L. Schalch, L. Audige, D. Le Grand, F. Poumarat, J. Nicolet (1999):
Study on the seroprevalence of infections by Mycoplasma bovis in Swiss cattle including epidemiological
analysis of risk factors in a local population (Jura region). Schweizer Archiv fur Tierheilkunde. 141(10):455460
15. Busato A., P. Trachsel, M. Schallibaum, J. W. Blum (2000): Udder health and risk factors for subclinical
mastitis in organic dairy farms in Switzerland. Preventive Veterinary Medicine, 44(3-4):205-220
16. Cergolj, M., A. Tomašković, J. Grizelj, N. Prvanović, M. Benić, I. Curik, N. Maćešić, N.; Z. Geci (2004):
Influence of close monitoring of dairy cows on the incidence of clinical and subclinical mastitis // The 5th
middle-european buiatrics congress / Brydl, Endre (ur.),Budimpešta: Szolgaltato Kft, 2004. 352-354
17. Dakić, A., K. Kuterovac, I. Jakopović, D. Blažek, N. Pintić-Pukec, D. Lončar, D. Stručić, I. Runtić (2007):
Sustav kontrole mlijeka u RH od ideje do realizacije. Povodom 5. obljetnice rada. Hrvatski stočaski centar,
Križevci,
18. Degraaf T., R. H Dwinger (1996): Estimation of milk production losses dou to sub-clinical mastitis in
dairy cattle in Costa Rica . Preventive Veterinary Medicine, 26(3-4):215-222
19. Dego O. K., Tareke F (2003): Bovine mastitis in selected areas of southern Ethiopia Tropical Animal
Health & Production, 35(3):197-205.
20. Detilleux J. C., M. E. Kehrli, A. E. Freeman, L. K. Fox, D. H. Kelley (1995): Matitis of periparturient
Holstein cattle- a phenotypic and genetic study. Journal of Dairy Science. 78(10):2285-2293.
21. De Haas Y., H. W., Barkema, R. F. Veerkamp (2002):The effect of pathogen-specific clinical mastitis on the
lactation curve for somatic cell count. Journal of Dairy Science. 85(5):1314-1323
22. Edinger D., B. A. Tenhagen, W. Heuwieser, P. Kalbe, G. Klunder, B. Baumgartner (1999): Effect of early
puerperal mastitis in primiparous cows on production, somatic cell count and culling. Deutsche Tierarztliche
Wochenschrift. 106(11):470-474
23. Elbers A. R.W. J. D. Miltenburg, D. Delange, A. P. P. Crauwels, H. W. Barkema, Y. H. Schukken (1998):
Risk factor for clinical mastitis in a random sample of dairy herds from the southern part of the Netherland.
Journal of Dairy Science. 81(2):420-426
24. Ekesbo I., P. A. Oltenacu, B. Vilson , J. Nilsson (1994): A disease monitoring system for dairy herds. Vet
Rec 134, 270-273
25. Emanuelson U., H. Funke (1991): Effect of milk yield on the relatrionship between bulk somatic cell count
and prevalernce of mastitis. J Dairy Sci 74, 2479-2483.
26. Erskine, R. J., R. J. Eberhart, L. J. Hutchinson, S. B. Spencer, M. A. Cambell (1988): Incidence and type of
clinical mastitis in dairy herds with high and low somati cell counts. JAVMA 190:761-765
27. Ferguson J. D., G. Azzaro, M. Gambina, G. Licitra (2006): Prevalence of mastitis pathogens in Ragusa,
Sicily, from 2000 to 2006 Journal of Dairy Science. 90(12):5798-5813
28. Fourichon C., F Beaudeau, N. Bareille, H. Seegers (2001): Incidence of health disorders in dairy farming
systems in western France. Livestock Production Science, 68 (2-3):157-170.
29. Gianneechini R., C. Concha, R. Rivero, I. Delucci, J. M. Lopez (2002): Occurrence of clinical and subclinical mastitis in dairy herds in the West Littoral Region in Uruguay Acta Veterinaria Scandinavica.
43(4):221-230
109
30. Giovannini G., A.Zecconi (2002): Field study on epidemiology of clinical mastitis in five Italian dairy
herds Milchwissenschaft-Milk Science International. 57(1):3-6
31. Gröhn Y. T., D. J.Wilson, R. N. Gonzalez, J. A. Hertl, H. Schulte, G. Bennett, Y. H. Schukken (2004):
Effect of pathogen-specific clinical mastitis on milk yield in dairy cows. Journal of Dairy Science.
87(10):3358-3374, 2004 Oct.
32. Guardo G. D., A. Battisti, U. Agrimi, R. Forletta,M. E. Reitano, P. Calderini (1997): Pathology of Serratia
marcescens mastitis in ccattle. Journal of Veterinary Medicine Series B. 44(9):537-546
33. Haltia L., T. Honkanen-Buzalski, I. Spiridonova, A. Olkonen, V. Myllys (2006):A study of bovine mastitis,
milking procedures and management practices on 25 Estonian dairy herds. Acta Veterinaria Scandinavica.
48:22
34. Jayarao B. M., B. E. Gillespie, M. J. Lewis, H. H. Dowlen, S. P. Oliver (1999): Epidemiology of
Streptococcus uberis intramammary infections in a dairy herd Journal of Veterinary Medicine Series B.
46(7):433-442
35. Kaneene J.B., H. S. Hurd (1990): The National Animal Health Monitoring System in Michigan. I Design,
data and frequencies of selected dairy cattle diseases. Prev Vet Med 8, 103-114
36. Karimuribo E. D., J. L. Fitzpatrick, C. E. Bell, E. S. Swai, D. M Kambarage, N. H. Ogden, M. Bryant, N. P.
French (2006): Clinical and subclinical mastitis in smallholder dairy farms in Tanzania: Risk, intervention
and knowledge transfer Preventive Veterinary Medicine. 74(1):84-98
37. Keefe G. P., I. R. Dohoo, E. Spangler (1997):Herd prevalence and incidence of Streptococcus agalactiae
in the dairy industry of Prince Edward Island . Journal of Dairy Science. 80(3):464-470
38. Kivaria F., B. Kabula, A. Manjurano, T. Loken, D. M. Kambarage (2994): Prevalence and determinants of
mastitis and milk-borne zoonoses in smallholder dairy farming sector in Kibaha and Morogoro districts in
eastern Tanzania Journal of Veterinary Medicine Series B. 51(3):123-128
39. Kivaria F. M., J. P. T. M. Noordhuizen, M. Nielen (2007): Interpretation of California mastitis test scores
using Staphylococcus aureus culture results for screening of subclinical mastitis in low yielding smallholder
dairy cows in the Dar es Salaam region of Tanzania Preventive Veterinary Medicine. 78(3-4):274-285
40. Kossaibati M. A., M. Hovi, R. J. Esslemont (1998): Incidence of clinical mastitis in dairy herds in England
Veterinary Record. 143(24):649-653
41. Makovec J. A., P. L. Ruegg (2003): Results of milk samples submitted for microbiological examination in
Wisconsin from 1994 to 2001 Journal of Dairy Science. 86(11):3466-3472.
42. Malinowski E., H. Lassa, A. Klossowska, S. Smulski, H. Markiewicz, A. Kaczmarowski (2006): A.
Etiological agents of dairy cows’ mastitis in western part of Poland Polish Journal of Veterinary Sciences.
9(3):191-194
43. McDougall S., D. G. Arthur, M. A. Bryan, J. J. Vermunt, A. M. Weir (2007): Clinical and bacteriological
response to treatment of clinical mastitis with one of three intramammary antibiotics New Zealand
Veterinary Journal. 55(4):161-170
44. Mdegela R.H., L. J. M. Kusiluka, A. M. Kapaga, E. D. Karimuribo, F. M. Turuka, A. Bundala, F. Kivaria,
B. Kabula, A. Manjurano, T. Loken, D. M. Kambarage (2004): Prevalence and determinants of mastitis
and milk-borne zoonoses in smallholder dairy farming sector in Kibaha and Morogoro districts in eastern
Tanzania Journal of Veterinary Medicine Series B. 51(3):123-128
45. Mungube E.O., B. A. Tenhagen, T. Kassa, F. Regassa, M. N. Kyule, M. Greiner, M. P. O. Baumann
(2004): Risk factors for dairy cow mastitis in the central highlands of Ethiopia Tropical Animal Health &
Production. 36(5):463-472
46. Myllys V., K. Asplund, E. Brofeldt, V. Hirvelakoski, T. Honkanenbuzalski, J. Junttila, L. Kulkas, O.
Myllykangas, M. Niskanen, H. Saloniemi, M. Sandholm, T. Saranpaa (1998): Bovine mastitis in Finland
110
in 1988 and 1995 – changes in prevalence and antimicrobial resistance. Acta Veterinaria Scandinavica.
39(1):119-126.
47. Osteras O., L. Solverod, O. Reksen (2006): Milk culture results in a large Norwegian survey - Effects of
season, parity, days in milk, resistance, and clustering Journal of Dairy Science. 89(3):1010-1023
48. Owens W.E., SD. C. Nickerson, R. L. Boddie, G. M. Tomita, C. H. Ray (2001): Prevalence of mastitis in
dairy heifers and effectiveness of antibiotic therapy Journal of Dairy Science. 84(4):814-817
49. Pankey J. W., R. P. Pankey, B. M. Barker, J. H. Williamson, M. W. Woolford, (1996): The prevalence of
mastitis in primiparous heifers in eleven Waikato dairy herds. N. Z. Vet. J. 44, 41-44.
50. Peeler E.J., M. J. Green, J. L. Fitzpatrick, L. E. Green (2003): The association between quarter somatic-cell
counts and clinical mastitis in three British dairy herds Preventive Veterinary Medicine. 59(3):169-180
51. Pitkala A., M. Haveri, S. Pyorala, V. Myllys, T. Honkanen-Buzalski (2004): Bovine mastitis in Finland 2001
- Prevalence, distribution of bacteria, and antimicrobial resistance Journal of Dairy Science. 87(8):24332441
52. Reksen O., L. Solverod, A. J. Branscum, O. Osteras (2006): Relationships between milk culture results and
treatment for clinical mastitis or culling in Norwegian dairy cattle Journal of Dairy Science. 89(8):29282937
53. Riekerink R. G. M. O., H. W. Barkema, H. Stryhn (2007): The effect of season on somatic cell count and
the incidence of clinical mastitis Journal of Dairy Science. 90(4):1704-1715
54. Roesch M., M. G. Doherr, W. Scharen, M. Schallibaum, J. W. Blum (2007): Subclinical mastitis in dairy
cows in Swiss organic and conventional production systems Journal of Dairy Research, 74(1):86-92
55. Sampimon O. C., J. C. A. Vernooij, D. J. Mevius, J. Sol (2007): Sensitivity to various antibiotics of
coagulase-negative staphylococci isolated from samples of milk from Dutch dairy cattle Tijdschrift voor
Diergeneeskunde. 132(6):200-204
56. Sommerhauser J., B Kloppert, W. Wolter, M. Zschock, A. Sobiraj, K. Failing (2003): The epidemiology
of Staphylococcus aureus infections from subclinical mastitis in dairy cows during a control programme
Veterinary Microbiology. 96(1):91-102
57. Steffl M., W. Philipp (2007): Experience in eliminating Staphylococcus aureus intramammary infections
from a high yielding dairy herd.Tieraerztliche Umschau. 62(5):255-261
58. Suriyasathaporn W., C. Heuer, E. N. Noordhuizen-Stassen, Y. H. Schukken (2000): Hyperketonemia and
the impairment of udder defense: a review . Veterinary Research. 31(4):397-412
59. Sviland S., S. Waage (2002): Clinical bovine mastitis in Norway Preventive Veterinary Medicine. 54(1):6578.
60. Tadich N., J. Kruze, G. Locher, L. E. Green (2003): Risk factors associated with BMSCC greater than
200,000 cells/ml in dairy herds in southern Chile Preventive Veterinary Medicine. 58(1-2):15-24
61. Tenhagen B. A., G. Koster, J. Wallmann, W. Heuwiese (2006): Prevalence of mastitis pathogens and their
resistance against antimicrobial agents in dairy cows in Brandenburg, Germany Journal of Dairy Science.
89(7):2542-2551
62. Thorberg B. M., I. Kuhn, F. M. Aarestrup, B. Brandstrom, P. Jonsson, M. L. Danielsson-Tharn (2006):
Pheno- and genotyping of Staphylococcus epidermidis isolated from bovine milk and human skin Veterinary
Microbiology. 115(1-3):163-172
63. Todhunter D. A., K. L. Smith, J. S. Hogan (1995):Environmental Streptococcal intramammary infection of
the bovine mammary gland. Journal of Dairy Science. 78(11):2366-2374.
64. Topolko S., M. Benić (1997.):Aktualni problemi i epizootiološko stanje subkliničkih mastitisa u
minifarmskoj proizvodnji mlijeka. (Actual problems and epizootiological state of subclinic mastites in
mini-farm milk production). Praxis veterinaria 45 (1-2) 69-76
111
65.Waage S., S. Sviland, S. A. Odegaard (1998): Identification of risk factors for clinical mastitis in dairy
heifers. Journal of Dairy Science. 81(5):1275-1284
66.Watts, J. L., W. E. Owens (1989): Prevalence od staphylococcal species in four dairy herds. Res. Vet. Sci.
41, 1-4
67.Whist, A. C., O. Osteras, L. Solverod (2007): Staphylococcus aureus and Streptococcus dysgalactiae
in Norwegian herds after introduction of selective dry cow therapy and teat dipping Journal of Dairy
Research. 74(1):1-8.
68.White, D. G., R. J. Harmon, J. E. S Matos, B. E. Langlois (1989): Isolation and identification of colagulase
negative Staphyloccocus species from bovine sites and streak canals of nulliparous heifers. J. Dairy Sci,
72, 1886-1892.
69.White L. J., Y. H. Schukken. T. J. Lam, G. F. Medley, M. J. Chappell (2001): A multispecies model for
the transmission and control of mastitis in dairy cows Epidemiology & Infection, 127(3):567-576
70.Wilson D. J., R. N. Gonzalez, H. H. Das (1997): Bovine mastitis pathogens in New York and Pennsylvania:
Prevalence of effects on somatic cell count and milk production. Journal of Dairy Science. 80, 2592-2598
71.Workineh S., M. Bayleyegn, H. Mekonnen, L. N. D Potgieter (2002): Prevalence and aetiology of
mastitis in cows from two major Ethiopian dairies. Tropical animal health and production, 34(1):19-25
72.Wolfova, M., : Stipkova, J. Wolf (2006): Incidence and economics of clinical mastitis in five Holstein
herds in the Czech Republic Preventive Veterinary Medicine. 77(1-2):48-64
73. Zadoks R. N., H. G. Allore, H. W. Barkema, O. C. Sampimon, G. J. Wellenberg, Y. T. Grohn , Y. H.
Schukken (2001): Cow- and quarter-level risk factors for Streptococcus uberis and Staphylococcus aureus
mastitis Journal of Dairy Science. 84(12):2649-2663
112
Bovine MHC Class II Structure-Function Relationships:
Implications for Vaccine Development
ODNOSI GRAĐE I ULOGE GOVEĐIH MHC KLASE II: IMPLIKACIJE
ZA RAZVOJ VAKCINE
Immunology Section, Department of Pathobiology, Faculty of Veterinary Medicine,&3Biotechnology research
institute, Ferdowsi University of Mashhad, Iran. [email protected]
1
Department of Immunology, Institute of Infectious Diseases & Immunology, Utrecht University, Netherlands
2
Abstract
T cell mediated immunoregulation plays an important role in protective immunity. The central molecular
interaction, which dictates the selection of the specificity of T cells, depends on the interaction between MHC
molecules and peptides derived from degraded antigenic structures. Here, we studied this interaction between
bovine MHC class II molecules and peptides derived from foot and mouth disease virus (FMDV). Progress
during the last decade in our understanding of the mechanisms underlying antigen recognition by T lymphocytes,
opens the possibility to apply this knowledge in new approaches for the development of vaccines.
Key words: BoLA-DR molecules, MHC-peptide binding assay, T cell epitopes, FMDV
Sažetak
Imunoregulacija posredovana T stanicama ima važnu ulogu u imunosti. Središnja molekulska interakcija,
koja određuje vrstu specifičnosti T stanica, ovisi o interakciji između MHC molekula i peptida koji potječu
od razgrađenih antigenih struktura. U ovoj studiji proučavane su interakcije goveđih MHC molekula klase II i
peptida nastalih od virusa slinavke i šapa (FMDV). Napredak ostvaren tijekom zadnjeg desetljeća u shvaćanju
mehanizama koji su temelj antigenog prepoznavanja od strane T limfocita, otvara mogućnost primjene tog
znanja u novim pristupima za razvoj vakcina.
Ključne riječi: BoLA-DR molekule, test vezanja MHC-peptida, epitopi T stanice, FMDV
Introduction:
Progress during the last decade in our understanding of the mechanisms underlying antigen
recognition by T lymphocytes, opens the possibility to apply this knowledge in new approaches for
the development of vaccines. Vaccines induce protective immunity: a status of long-lasting pathogenspecific immunological memory protecting against disease caused by the pathogen. T cell mediated
immunoregulation plays an important role in protective immunity. This paper highlights fundamental
aspects of T cell mediated immunity in the bovine species. The central molecular interaction, which
dictates the selection of the specificity of T cells, depends on the interaction between MHC molecules
and peptides derived from degraded antigenic structures. Here, we studied this interaction between
bovine MHC class II molecules and peptides derived from foot and mouth disease virus (FMDV).
Although bovine immunology does not offer us all the tools and reagents that are available in species
like man and mouse, cattle and FMDV together offer a unique combination of tools for our goals.
FMDV is a disease causing a major threat to cattle farming, and extensive efforts have been made to
control the disease, including attempts to use vaccines prepared from short peptides covering areas
of the virus where dominant antibody binding sites are located. As a matter of fact, cattle is the only
species with so many reported studies on vaccination with peptides. This information is instrumental
for our approach. The MHC in cattle is well defined, and our access to animals homozygous for
their MHC haplotypes is instrumental. When animals are heterozygous, and therefore two different
113
haplotypes are expressed, it is almost impossible to analyse the function of individual molecules at
the molecular level. The combination of FMDV and cattle allows us to study the vaccination against
a viral disease in its natural host from the molecular level in vitro up to in vivo immunisation and
challenge. Previous work on the use of peptides derived from the protein VP1 of FMDV, containing
the major B cell epitope of the virus, which lack solid protection, has generated the question whether
an anti-viral T cell helper response is required for protection against FMDV at the time of challenge.
Bovine T cell responses against. Several T cell epitopes of FMDV were defined and studied by us
in the context of animals homozygous for their MHC. By applying an in vitro priming-restimulation
assay with bovine T cells, the potential T cell epitopes of FMDV were identified in the context of
three frequently expressed BoLA-DRB3 alleles. Furthermore we studied whether these epitopes can
stimulate a T cell response cross-reactive with virus as antigen, in our opinion a prerequisite for
protection. At least one T cell epitope, namely VP4 [20-34] appeared to be cross-reactive with the
virus and also to be promiscuous in the context of the three haplotypes tested.
Materials & Methods:
The animals used in this study were Holstein-Frisian cattle, homozygous for both MHC class I
and II haplotypes. Viral antigen was prepared as described by Van Lierop et al. The sequence of all
peptides used in this study was based on the published sequence of FMDV strain A10Holland.. They
were prepared by automated simultaneous multiple peptide synthesis (SMPS). In vitro priming of T
lymphocytes and lymphocyte proliferation assays were performed as described by Haghparast et al.
The purification of bovine DR molecules and the development of a MHC class II-peptide binding
assay was performed as described by Haghparast et al.
Results & Discussion:
The first major issue that we addressed in the present study was to determine the restriction on
antigen presentation by bovine MHC class II molecules in relation to their polymorphism. In order
to study the molecular interactions between antigenic peptides and bovine MHC class II DR (BoLADR) molecules, we developed a competitive MHC class II-peptide binding assay with bovine MHC
class II molecules. Emphasis was given to DR molecules, since previous studies from our laboratory
suggested that the presentation of the T cell epitopes of FMDV was primarily mediated by BoLA-DR
molecules. The suggestion was substantiated by blocking experiments with a monoclonal antibody
specific for BoLA-DR molecules. For the conclusive results, the MHC-peptide binding assay was
used. Restriction of the T cell epitopes to certain MHC class II haplotypes was indeed reflected at the
level of MHC-peptide interaction. Besides the fact that we developed a tool that can contribute to the
improvement of our knowledge on bovine immunology, it confirmed our previous hypothesis on the
presentation of the defined T cell epitopes of FMDV at the molecular level. This explained that the
bovine MHC molecules can dictate whether an epitope becomes available for recognition or not in
the context of that MHC haplotype. This has direct consequences for the use of peptides in outbred
species, as vaccine candidates as well as in other applications.
The mimicry of T cell responses induced by the retro-inverso(RI) peptides corresponding to
the defined T cell epitopes of FMDV and whether this response might be cross-reactive with the Lpeptides and the virus was also analysed in this study. Due to their higher resistance to proteolytic
degradation and their ability to induce high and cross-reactive antibody titers, RI-peptides seemed to
be interesting candidate structures to mimic the cognate epitopes and thereby persist in the biological
fluid for longer periods of time. The successful attempt of Muller to induce high antibody titers by
the RI-VP1 [141-159] peptide, which were cross-reactive with the natural L-peptide and the virus,
stimulated us to use this concept in the context of T cell mediated immunity. To explore the possibility
114
to generate T cell responses against RI-peptide and to study cross-reactivity to the natural epitope,
we used the same strategy that was applied in the first part of this study. An extremely poor T cell
response and lack of mimicry to the natural L-peptides was found. Consequently, we investigated the
RI-peptides by our established competitive MHC-peptide binding assay. We analysed the interaction
of RI-analogues of the FMDV derived peptides with purified bovine DR molecules in all possible
combinations, and showed that the weak T cell response and lack of mimicry was accompanied by
an insufficient MHC-peptide interaction. Our study showed that the RI-peptides are not suitable to
be used as peptidomimetics of T cell epitopes, because of poor binding to MHC class II molecules,
which is a prerequisite for T cell stimulation. However, one can not exclude their application as
therapeutic agents when targeted to other interactions than with the MHC molecules. In the context
of the previously successful attempts on antibody induction by the RI-peptides, our findings suggest
that the help for the antibody response in those cases most likely came from the carrier molecules
that were coupled to these peptides.
The experimental lack of mimicry between the natural L-peptides of defined T cell epitopes of
FMDV and their RI-counterparts due to insufficient MHC-peptide binding was analysed in more
detail by molecular modelling. Employing this approach, we were able to elucidate in more detail,
how RI-peptides interact with MHC class II molecules. First, the three dimensional structure of the
bovine MHC class II was modelled. The BoLA structures were modelled using the knowledge of
the crystal structure of HLA-DR1 complexed with the influenza haemagglutinin (HA) epitope. We
observed that it was possible to use the bovine MHC class II models as a basis to design peptide
binding motifs. The prediction of the motifs for the three BoLA-DR structures was based only
on MHC structural information. There was no defined motif for bovine MHC class II molecules
reported so far. The biological properties of the predicted motifs were verified by the competitive
MHC-peptide binding assay. The structural and biological results were compatible and correlated in
three out of four motifs. This implied that the models could be used for further analysis. Molecular
analysis of interaction patterns of RI-peptides with MHC class II molecules revealed loss of both
energy interactions and hydrogen bonding patterns of RI-peptides with MHC class II molecules.
A motif prediction based solely on MHC structure can pave the way for further applications
in more species, and it might have an impact on finding potential candidate epitopes for vaccine
development.
References:
1. Batalia, M. A., and E. J. Collins. 1997. Peptide binding by class I and class II MHC molecules. Biopolymers.
43:281-302.
2. Benkirane, N., M. Friede, G. Guichard, J. P. Briand, M. H. Van Regenmortel, and S. Muller. 1993.
Antigenicity and immunogenicity of modified synthetic peptides containing D-amino acid residues.
Antibodies to a D-enantiomer do recognize the parent L-hexapeptide and reciprocally. J Biol Chem.
268:26279-85.
3. Benkirane, N., G. Guichard, J. P. Briand, S. Muller, F. Brown, and M. H. Van Regenmortel. 1996.
Mimicry of viral epitopes with retro-inverso peptides of increased stability. Dev Biol Stand. 87:283-91.
4. Benkirane, N., G. Guichard, M. H. Van Regenmortel, J. P. Briand, and S. Muller. 1995. Crossreactivity of antibodies to retro-inverso peptidomimetics with the parent protein histone H3 and chromatin
core particle. Specificity and kinetic rate-constant measurements. J Biol Chem. 270:11921-6.
5. Briand, J. P., N. Benkirane, G. Guichard, J. F. Newman, M. H. Van Regenmortel, F. Brown, and S.
Muller. 1997. A retro-inverso peptide corresponding to the GH loop of foot-and-mouth disease virus elicits
high levels of long-lasting protective neutralizing antibodies. Proc Natl Acad Sci U S A. 94:12545-50.
115
6. Briand, J. P., G. Guichard, H. Dumortier, and S. Muller. 1995. Retro-inverso peptidomimetics as new
immunological probes. Validation and application to the detection of antibodies in rheumatic diseases. J
Biol Chem. 270:20686-91.
7. Chorev, M., and M. Goodman. 1995. Recent developments in retro peptides and proteins--an ongoing
topochemical exploration. Trends Biotechnol. 13:438-45.
8. Fletcher, M. D., and M. M. Campbell. 1998. Partially Modified Retro-Inverso Peptides: Development,
Synthesis, and Conformational Behavior. Chem. Rev. 98:763 - 795.
9. Jameson, B. A., J. M. McDonnell, J. C. Marini, and R. Korngold. 1994. A rationally designed CD4
analogue inhibits experimental allergic encephalomyelitis. Nature. 368:744-6.
10. Jardetzky, T. S., J. H. Brown, J. C. Gorga, L. J. Stern, R. G. Urban, J. L. Strominger, and D. C. Wiley.
1996. Crystallographic analysis of endogenous peptides associated with HLA- DR1 suggests a common,
polyproline II-like conformation for bound peptides. Proc Natl Acad Sci U S A. 93:734-8.
11. Jensen, P. E. 1997. Peptide binding and antigen presentation by class II histocompatibility glycoproteins.
Biopolymers. 43:303-22.
12. Marino, M., A. Ippolito, and G. Fassina. 1999. Inhibition of experimental autoimmune encephalomyelitis
in SJL mice by oral administration of retro-inverso derivative of encephalitogenic epitope P87-99. Eur J
Immunol. 29:2560-6.
13. Muller, S., G. Guichard, N. Benkirane, F. Brown, M. H. Van Regenmortel, and J. P. Briand. 1995.
Enhanced immunogenicity and cross-reactivity of retro-inverso peptidomimetics of the major antigenic site
of foot-and-mouth disease virus. Pept Res. 8:138-44.
14. Stern, L. J., J. H. Brown, T. S. Jardetzky, J. C. Gorga, R. G. Urban, J. L. Strominger, and D. C. Wiley.
1994. Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus
peptide. Nature. 368:215-21.
15. Van Lierop, M. J., P. R. Nilsson, J. P. Wagenaar, J. M. Van Noort, J. D. Campbell, E. J. Glass, I. Joosten,
and E. J. Hensen. 1995. The influence of MHC polymorphism on the selection of T-cell determinants of
FMDV in cattle. Immunology. 84:79-85.
16. van Lierop, M. J., K. van Maanen, R. H. Meloen, V. P. Rutten, M. A. de Jong, and E. J. Hensen.
1992. Proliferative lymphocyte responses to foot-and-mouth disease virus and three FMDV peptides after
vaccination or immunization with these peptides in cattle. Immunology. 75:406-13.
17. van Lierop, M. J., J. M. van Noort, J. P. Wagenaar, V. P. Rutten, J. Langeveld, R. H. Meloen, and E.
J. Hensen. 1994. T cell-stimulatory fragments of foot-and-mouth disease virus released by mild treatment
with cathepsin D. J Gen Virol. 75:2937-46.
18. van Lierop, M. J., J. P. Wagenaar, J. M. van Noort, and E. J. Hensen. 1995. Sequences derived from the
highly antigenic VP1 region 140 to 160 of foot-and-mouth disease virus do not prime for a bovine T-cell
response against intact virus. J Virol. 69:4511-4.
19. Van Regenmortel, M. H., G. Guichard, N. Benkirane, J. P. Briand, S. Muller, and F. Brown. 1998. The
potential of retro-inverso peptides as synthetic vaccines. Dev Biol Stand. 92:139-43.
20. Van Regenmortel, M. H., and S. Muller. 1998. D-peptides as immunogens and diagnostic reagents. Curr
Opin Biotechnol. 9:377-82.
21. Haghparast A, Wauben MH, Grosfeld-Stulemeyer MC, van Kooten P, Hensen EJ. 2000. Selection of
T-cell epitopes from foot-and-mouth disease virus reflects the binding affinity to different cattle MHC class
II molecules. ImmunogeneticsJul;51(8-9):733-42.
116
Parasitology
Parazitologija
117
118
ANALYSIS OF THE PREVALENCE AND PARASITIC INTENSITY BY
LUNG NEMATODA IN ROE DEER (Capreolus capreolus) HUNTED
IN GALICIA (NW SPAIN): EFFECT OF AGE
ANALIZA POJAVNOSTI I INTENZITETA INVAZIJE PLUĆNIM
NEMATODIMA U SRNA (Capreolus capreolus) ODSTRIJELJENIH
U GALICIJI (SZ ŠPANJOLSKA): UTJECAJ DOBI
Díez-Baños, P., Dacal, V., Vázquez, L., Pardo, M., Cienfuegos, S., Díez-Baños, N. **,
López, C., Panadero, R., Morrondo, P.
Parasitología y Enfermedades Parasitarias. Dpto. Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002. Lugo.
** Parasitología y Enfermedades Parasitarias. Dpto. Sanidad Animal. Facultad de Veterinaria. Universidad
de León. 24071. León.
ABSTRACT
Total of 75 roe deer hunted in different forest districts in Lugo province (NW Spain) within May – October
2007, were necropsied and the respiratory tracts examined for bronchopulmonary nematodes. The recovery
of lung nematodes was realized by longitudinally opening the trachea and big bronchia to collect adults of
Dictyocaulidae. Lung surface was also examined, and the localization and distribution of the lesions caused
by nematode Protostrongylidae were recorded. Finally, the lesion areas tissue were cut up into small pieces,
weighed and homogenized prior to use the Baermann-Wetzel method to recover the 1st stage larvae (L1) and to
assess the number of L1 per gram of lung (lpg). Data were analyzed by taking into account the age of animals,
considering three groups: G-1 (< 3 yr), G-2 (3-5 yr) and G-3 (>6 yr). On the pulmonary surface, especially in
the apexes of caudal lobes, macroscopic lesions characteristic of V. capreoli infection were observed in 90.
3% of the animals. Nor lesions or broncopulmonary nematoda larvae were observed in the other lungs. The
prevalence of D. noerneri was 16% by the larval migration probe, and a low infection intensity was achieved.
When considering age, a similar percentage of infection was obtained in young animals (G-1= 16. 7%) and in
the adult ones (G-2= 19. 2%). However, a low nematode larvae burden was recovered. D. noerneri larvae were
not observed in roe deer from G-3. Fifty-one percent of the animals had L1 of V. capreoli and no significant
differences were achieved by considering the age of roe deer. The number of lpg was significantly higher in G-1
and G-2 than in G-3.
Sažetak
Sveukupno je razudbom pretražen nalaz bronhopulmonarnih nematoda u dišnom sustavu 75
srna odstrijeljenih u različitim šumovitim područjima, u provinciji grada Luga (sjeverozapadna
Španjolska) od svibnja do listopada 2007. Plućni nematodi dobiveni su longitudinalnim otvaranjem
traheje i velikih bronha kako bi se dobili adulti Dictyocaulidae. Pretraživana je površina pluća, te
su bilježene lokalizacija i raspored lezija uzrokovanih nematodima Protostrongylidae. Na kraju,
tkivo u području lezija je isecirano u male komadiće, izvagano i homogenizirano prije nego li je
primijenjena Baermann - Wetzel metoda dobivanja ličinki 1 stupnja (L1) i određen broj L1 po gramu
pluća (lpg). Podatci su analizirani uzimajući u obzir dob životinja, koje su u tom smislu podijeljene
u 3 skupine: G1 (<3 god.), G2 (3-5god.) i G3 (>6god.). Na površini pluća, posebno u apeksima
kaudalnih režnjeva, primijećene su makroskopske lezije karakteristične za invaziju V. capreoli u
90,3% životinja. U preostalim plućima nisu primijećene ni lezije ni ličinke bronhopulmonarnih
nematoda. Utvrđena je pojavnost D. noerneri probom migracije ličinki od 16%, pri čemu je intenzitet
119
invazije bio nizak. Glede dobi, slični postotci invadiranosti primijećeni su u mladih (G1 = 16,7%)
i u odraslih životinja (G2 = 19,2%). Ipak, dobiveno je malo ličinki nematoda. Ličinke D. noerneri
nisu primijećene u skupini srna iz skupine G3. 51% životinja imalo je L1 V. capreoli pri čemu nisu
primijećene znakovite razlike glede dobi srna. Broj lpg bio je znakovito viši u skupinama G1 i G2,
nego u G3.
INTRODUCTION
Roe deer, the smallest of Spanish cervids, are widespread in the northwest of Spain and especially
in Galicia, where roe deer are of considerable economic value as a source of meat. In addition, they
are a sport hunting species, which also generates economic advantages.
The main lungworms of roe deer are Dictyocaulus noerneri, located in the bronchi and
bronchioles, and Varestrongylus capreoli found in the lung tissue parenchyma. Both nematodes were
reported for the first time in Spain by Carrillo et al. (1995).
The work described herein is part of a larger study examining the parasite fauna of roe deer in
northwest Spain. The main objective was to establish the prevalence and intensity of infection by
bronchopulmonary nematodes in roe deer, as well as the influence of age of animals.
Between May and October 2007, a total of 75 roe deer were necropsied and the respiratory tracts
examined for bronchopulmonary nematodes.
The respiratory tract, including lungs and trachea, was recovered from each animal. The trachea
and main bronchi were opened longitudinally with a pair of scissors, carefully examined and, after
placing them under running water, the lavage was poured into a container to collect the larvae present.
A visual inspection of dorsal and basal edges of the lungs was carried out and the presence and
distribution of verminous nodules were recorded. After that we dissected carefully the pulmonary
parenchyma, specially damaged areas, under a dissecting microscope to extract specimens adults of
V. capreoli. Immediately after we, cut up then tissue pulmonary into small pieces and placed in 8–10
small bags, using the Baermann–Wetzel method to assess the number of first stage larvae (L-1) per
gram (lpg). The L-1 count was carried out using Favati or McMaster chambers.
Data were analyzed by taking into account the age of animals, considering three groups: G-1 (<
3 yr), G-2 (3-5 yr) and G-3 (>6 yr).
RESULTS
As reflected in Table 1 when considering age, a similar percentage of infection by D. noerneri
was obtained in young animals and in the adult ones, and the same results are seen so in the parasitic
burden. Statistical differences in the prevalence and intensity of infection by V. capreoli by taking
into account the age of the roe deers were not recorded.
Table 1: Lungworm infection in roe deer from Galicia during 2007
Age
G-1
G-2
G-3
120
Prevalence (%)
D. noerneri
16. 7
19. 2
0
V. capreoli
50
50
54. 5
Intensity (lpg)
D. noerneri
1. 7
1. 5
0
V. capreoli
5. 7
4. 9
0. 2
On the pulmonary surface, especially on the border of caudal lobes, macroscopic lesions (Figure
1) characteristic of V. capreoli infection were observed in 90. 3% of the examined animals.
Figure 1: Locations of the main spot lesions caused by Varestrongylus capreoli
The prevalence (16%) and intensity of infection ( x = 1. 6 lpg) of D. noerneri was low that of V.
capreoli (51%, x = 3. 6 lpg).
Discussion
In this study, we have identified two different species of bronchopulmonary nematodes in roe
deer: V. capreoli and D. noerneri. Both species are considered highly specific for roe deer. Those
species were previously reported in Spain by Carrillo et al. (1994, 1995), and Panadero et al. (2001).
These results agree with those of Drózdz et al. (1992), who also recorded these two species in roe
deer from Poland.
V. capreoli is considered a specific parasite of roe deer, in which it causes important
pathomorphological changes in their lungs. The distribution and intensity of the lesions found in the
lungs are in agreement with previous studies developed in the same area (Carrillo et al., 1994, 1995,
Panadero et al., 2001).
V. capreoli was much more abundant than D. noerneri. The tendency of prevalence to increase
with host age seems to be a common pattern in Protostrongylids parasitizing domestic ruminants.
Bidoveç et al. (1985) reported that the lungs of the oldest animals were the most parasitized. This
is of great epizootiologic interest, since the oldest roe deer would play a very active part in the
maintenance of the infection, among young animals.
In the case of Dictyocaulus, an acquired immunity could have two consequences first becoming
effective against establishment of reinfection, and secondly can affect the mortality rate of developing
larvae (Scott et al. 1996), so this would explain the low infection rate and larval counts found in this
study. Larvae from Dictyocaulus were not found in the oldest roe deer, which agrees with previous
121
data on bronchopulmonary parasites in chamois (Rupicapra rupicapra), (Díez-Baños et al., 1990).
The absence of Dictyocaulus in chamois was related to the age of examined animals
Our results seem to indicate that the youngest animals had the greatest prevalence and
intensity of infection by D. noerneri and V. capreoli. Besides this, although the high prevalences of
bronchopulmonary nematodes in roe deer from Galicia, parasitic burdens are at low levels, and in
general, do not represent a direct risk for their lives. However, it is possible that lung lesions, caused
by the former worms, facilitate the appearance of problems due to other pathogen agents that reduce
the respiratory function in the animals.
ACKNOWLEDMENTS
We are grateful to Food and Agrarian National Technology Institute (MEC), Spain by the concession of the
Research Project FAU2006-00006-00-00, and Xunta de Galicia (Spain) by the Research Project 07MRU034261PR
and especially to Galician hunters and Federación Galega de Caza.
REFERENCES
Bidoveç, A., Valentincić, S., Kuses, M. (1985). Parasitic pneumonia in chamois (Rupicapra rupicapra L.) in
Slovenia. In: Lovary, S. (Ed.), The Biology and Management of Mountain Ungulates. pp. 240–242.
Carrillo, E. B., Morrondo, P., Díez-Baños, N., Díez-Baños, P., López, J. L. (1994). First report of Dictyocaulus
noerneri Railliet et Henri, 1907 (Nematoda: Trichostrongyloidea) in Spain. Research and Reviews in
Parasitology, 54: 265–267.
Carrillo, E. B., Díez-Baños, N., Morrondo, P., López, J. L., Díez-Baños, P. (1995). Infección por Varestrogylus
capreoli (Stroh and Schmid, 1938) Dougherty, 1945, en pulmones de corzo (Capreolus capreolus) en
Galicia. IV Congreso Ibérico de Parasitología. Santiago de Compostela, España. 24-28 julio 1995.
Díez-Baños, P., Díez-Baños, N., Morrondo, M. P., Cordero Del Campillo, M., (1990). Bronchopulmonary
helminths of chamois (Rupicapra rupicapra parva) captured in northwest Spain: assessment from first
stage larvae in faeces and lungs. Annales de Parasitologie Humaine et Comparée, 65: 74–79.
Drózdz, J., Demiaszkiewicz, A. W., Lachowicz, J. (1992). The helminth fauna of the roe deer Capreolus
capreolus (L.) in a hunting area inhabited by red deer, elk and European bison (Borecka Forest, Poland)
over the yearly cycle. Acta Parasitologica Polonica, 37: 83–88.
Panadero, R., Carrillo, E. B., López, C., Díez-Baños, N., Díez-Baños, P., Morrondo, P. (2001). Bronchopulmonary
helmintos of roe deer (Capreolus capreolus) in the northwest of Spain. Veterinary Parasitology, 99: 221229.
Scott, C. A., McKeand, J. B., Devaney, E. (1996). A longitudinal study of local and peripheral isotype/subclass
antibodies in Dictyocaulus viviparus-infected calves. Veterinary Immunology and Immunopatholog, 53:
235–247.
122
INFLUENCE OF THE LIVER FLUKE-CONTROL PRACTICES ON THE
PREVALENCE AND EGG-OUTPUT IN SEMIEXTENSIVE BEEF CATTLE
HERDS
UTJECAJ POSTUPAKA KONTROLE JETRENIH METILJA NA
POJAVNOST I POLUČIVANJE JAJAŠACA U SEMIEKSTENZIVNO
DRŽANIH STADA TOVNIH GOVEDA
Díaz, P., J. Pedreira, J. L. Suárez, R. Sánchez-Andrade, R. Panadero, A. Paz-Silva,
P. Díez-Baños, P. Morrondo
Animal Pathology Department. Faculty of Veterinary Medicine. University of Santiago of Compostela.
Campus Universitario s/n. 27002 LUGO (Spain). E-mail: [email protected]. Tel. 34982285900.
ABSTRACT
In order to assess the influence of the parasite-control methods on the Fasciola hepatica-prevalence and eggexcretion values, 1158 faecal samples were collected from 173 semiextensive beef cattle farms. Samples were
directly taken from the rectum of each animal, and they were examined by means of the sedimentation technique.
A questionnaire was developed that asked producers for information on their parasite control practices. It was
showed that the only control practice used in the farms was chemotherapy, and 31% of the owners reported to
never use dewormers. Most of the farmers followed the veterinary advice (98%) for choosing the anthelmintic
product, mainly benzimidazoles (80%) in autumn (59%). Nevertheless, it must be pointed out that none of
the interviewed owners carried out coprological examinations neither before nor after anthelmintic treatments,
and quarantine is not a usual management measure.Herd-level prevalence was slightly lower in farms where a
fasciolicide was administered (62%) than in those where an anthelmintic with no efficacy against the trematode
was employed (65%). On the contrary, egg-output values were higher in herds dewormed with fasciolicides
(Me= 9 epg) than in the rest of farms (Me= 6 epg). The limited fasciolicide efficacy detected in the present study
is due to the no adoption of suitable complementary measures for the control of fasciolosis. For this reason,
application of integrated control measures is needed, just as a correct diagnosis of the disease, employment of
suitable treatments and an appropriate management for control of F. hepatica external stages. It is worth noting
the importance of the application of management measures which change the habitats of the intermediate host,
the freshwater snail Lymnaea spp., as draining or whitewashing of humid or flooded pastures.
Sažetak
U svrhu određivanja učinkovitosti antiparazitskih tretmana na pojavnost Fasciola hepatica i količinu
polučenih jajašaca, sakupljeno je 1158 uzoraka fecesa sa 173 farme semiekstenzivno držanih tovnih goveda.
Uzorci su uzimani izravno iz rektuma svake od životinja te su pretraženi sedimentacijskom tehnikom. Izrađena
je anketa za farmere u svezi informacija o provođenim antiparazitskim tretmanima. Utvrđeno je kako je jedini
postupak bio (kemo)terapijski, a 31% vlasnika je potvrdilo da nikada nije koristilo antiparazitike. Većina je
farmera prihvatila veterinarski savjet (98%) u izboru antihelmintika, uglavnom benzimidazola (80%) u jesen
(59%). Ipak, važno je istaknuti da nijedan od intervjuiranih vlasnika nije proveo koprološku pretragu kako prije,
tako niti nakon antihelmintskog tretmana te da karantena nije uobičajena mjera u upravljanju farmom. Razina
pojavnosti na razini stada je bila lagano niža na farmama gdje je apliciran fasciolicid (62%), nego na onima gje
je apliciran antihelmintik neučinkovit prema trematodima (65%). Nasuprot tome, količina izlučenih jajašaca bila
je viša u stadima tretiranim fasciolicidima (Me = 9epg), nego na preostalim farmama (Me = 6epg). Ograničena
učinkovitost fasciolicida koja je utvrđena u ovoj studiji posljedica je nepostojanja prikladnih komplementarnih
mjera za kontrolu fascioloze. Zbog toga je neophodna primjena sustavnih kontrolnih mjera, jednako kao i
123
korektna dijagnoza bolesti, korištenje prikladnog tretmana te prikladnog upravljanja kontrolom vanjskih stadija
F. hepatica. Bitno je istaknuti važnost primjene mjera koje mijenjaju habitat domaćinu posredniku, vodenom
pužu Lymnaea spp., isušivanjem ili kloriranjem vlažnih ili naplavnih pašnjaka.
INTRODUCTION
Rubia Gallega is an autochthonous beef cattle breed which is located mostly in Galicia (NW
of Spain). Its meat has an excellent quality and it is employed to make good use of mountainous
pastures because its rusticity and easy adaptation to difficult environments. These animals are mainly
managed in a semiextensive system of breeding, and for this reason, the risk of parasite infection is
high.
Fasciolosis is a parasitic disease caused by the trematode Fasciola hepatica, which has an
important negative impact on the animal health, producing substantial economic losses (GonzálezLanza et al., 1989; Díaz et al., 2001).
High prevalences by F. hepatica were detected in cattle from Spain, and particularly from Galicia
(Díez et al., 1994; Morrondo et al., 2003; Paz et al., 2003; Díaz, 2006). However, there are no studies
about methods to keep under control this important parasitic disease. For this reason, a questionnaire
was developed to know the parasite control methods employed and the possible relationship between
the application of different anthelmintics and the prevalence of infection by F. hepatica in Rubia
Gallega cattle from Galicia.
From 2002 to 2004, 1158 faecal samples of autochthonous Rubia Gallega cattle breed were taken
in 173 semi-extensive farms from Lugo (NW Spain). The period elapsed between the last deworming
treatment and the collection of the samples was never inferior to six months.
Sedimentation technique was employed to determine the F. hepatica egg output (Tienpont et al.,
1979); the results were expressed as number of eggs per gram of faeces (epg). The sensibility of the
technique was 3 epg.
An epidemiologic survey was designed with the aim of obtaining information about the main
parasitic control measures used. So, in the present work we solicited answers from the farm owners in
a questionnaire with questions about frequency of treatment per year, time of treatment, anthelmintic
used, advice for the election of the drug and dosage calculation. Cooperation with the farmers was
fully satisfactory, and all of them participated in the survey. The answers refer to the year before the
sampling.
The statistical analysis was performed by means of the chi-square and the Kruskal-Wallis tests,
performed by the statistical package SPSS (v.14). Median (Me) was determined as tendency marker
and the lower and upper quartiles (Q1 and Q3) as dispersion measures.
RESULTS
The results obtained in the present work showed that the only parasitic control measure used
were the application of anthelmintic treatments (69%), following the veterinary advice (98%). Most
of farmers administered a benzimidazole (80%), mainly in autumn (59%). The dosage was always
calculated depending on the age of the animals. It is worth mentioned that eighty nine percent of the
owners who applied a treatment employed a product effective against the trematode. The different
drugs used by the farmers are summarized in Table 1.
124
Table 1. Classification of the drugs employed by the farmers depending on their effectiveness against the liver
fluke Fasciola hepatica.
FASCIOLICIDE
Albendazole
Fenbendazole
Triclabendazole
Netobimin
Oxyclozanide
Clorsulon
NO EFFECTIVE AGAINST F. hepatica
Ivermectin
Eprinomectin
Moxidectin
Levamisole
Finally, none of the surveyed farmers asked for a coprological analysis either before the treatment
or after. Owners neither routinely use coprological examinations to ascertain the presence of parasites
nor deworm new animals before introducing them onto the farm.
Individual percentage of infection by F. hepatica, as well as herd-level prevalence, was lower
in farms where a fasciolicide treatment was administered (Table 2), but the differences were no
significant.
Table 2. Percentages of infection by F. hepatica taking into account the administration of an effective anthelmintic treatment.
INDIVIDUAL
PREVALENCE
HERD-LEVEL PREVALENCE
No effective anthelmintic
26%
65%
Fasciolicide
23%
62%
TREATMENT
When the possible relation between the intensity of egg excretion (epg) and the application of
different anthelmintics were investigated (Table 3), slightly higher values of Me, Q1 and Q3 were
observed in the farms where a fasciolicide was used.
Tabla 3. F. hepatica egg output al taking into account the administration of an effective anthelmintic treatment.
TREATMENT
No effective anthelmintic
Fasciolicide
Me (epg)
Q1 (epg)
Q3 (epg)
6
9
3
6
12
15
DISCUSSION
Our results are similar to those reported in cattle from Sardinia (Italy) by Scala et al. (2001), who
observed a higher prevalence and egg output in treated than in no dewormed animals.
The high F. hepatica prevalences despite of the administration of a fasciolicide drug could be
due to the application of no measures for the control of the external phase of the trematode biologic
cycle. Previous works showed that the likelihood of cattle reinfection was very high when animals
still grazing in pastures contaminated with F. hepatica-metacercariae (Díaz et al., 2001; SánchezAndrade et al., 2001). Nevertheless, these results could also be due to the appearance and development
of anthelmintic resistance, as a result of the repetitive application of drugs like triclabendazole or
albendazole (Kilgore et al., 1985; Moll et al., 2000, Elitok et al., 2006; Vara del Río, 2007).
125
Data obtained in the current work show the need for the application of integrated F. hepatica
control measures. Farmers must employ measures to change the trematode intermediate host habitats
–like liming or draining of humid or flooded pastures- in addition to the collection of samples for a
suitable diagnose of the disease and the administration of a proper treatment. The application of these
control measures would reduce the values of prevalence and intensity of excretion by F. hepatica in
beef cattle from Galicia maintained in a semiextensive management system.
ACKNOWLEDGEMENTS
This work was supported by the Research Project PGIDT04RAG261009PR (Xunta de Galicia, Spain).
REFERENCES
Díaz, P.; Arias, M.; Pedreira, J.; Moledo, J.A.; Paz-Silva, A.; Suárez, C.; Panadero, R.; SánchezAndrade, R. (2001). Incidencia de la fasciolosis. El boletín de A.C.R.U.G.A., 15: 12-14.
Díaz, P. (2006). Estudio epidemiológico de las principales endoparasitosis del ganado vacuno
de raza Rubia Gallega de la provincia de Lugo. Tesis Doctoral. Universidade de Santiago de
Compostela.
Díez-Baños, P.; Morrondo, P.; Sánchez-Andrade, R.; Prieto, M.; López, C.; Panadero, R. (1994).
Prevalencia de infestación por diferentes formas parasitarias en el ganado vacuno de lugo. IV
Congreso Nacional de Buiatría, La Coruña, 10-12 Marzo.
Elitok, B.; Elitok, O.M.; Kabu, M. (2006). Field trial on comparative efficacy of four fasciolicides
against natural liver fluke infection in cattle. Veterinary Parasitology, 135: 279-285.
González-Lanza, C.; Manga, Y.; Del Pozo, P.; Hidalgo, R. (1989). Dynamics of elimination of the
eggs of Fasciola hepatica (Trematoda, Digenea) in the faeces of cattle in the Porma Basin,
Spain. Veterinary Parasitology, 34: 35-43.
Kilgore, R.L.; Williams, M.L.; Benz, G.W.; Gross, S.J. (1985). Comparative efficacy of clorsulon
and albendazole against Fasciola hepatica in cattle. American Journal of Veterinary Research,
46: 1553-1555.
Moll, L.; Gaasenbeek, C.P.; Vellema, P.; Borgsteede, F.H. (2000). Resistance of Fasciola hepatica
against triclabendazole in cattle and sheep in The Netherlands. Veterinary Parasitology, 91: 1538.
Morrondo, P.; Díaz, P.; Pedreira, J.; Paz-Silva, A.; Sánchez-Andrade, R.; Suárez, J.L.; Arias, M.;
Díez-Baños, P. (2003). Digestive parasitosis affecting to the autochthonous Rubia Gallega cattle.
XI Congresso Internazionale della Federazione Mediterranea Sanità e Produzione Ruminanti
(Fe.Me.S.P.Rum.), Olbia (Sassari).
Paz-Silva, A.; Sánchez-Andrade, R.; Suárez, J.L.; Pedreira, J.; Arias, M.; López, C.; Panadero, R.;
Díaz, P.; Díez-Baños, P.; Morrondo, P. (2003). Prevalence of natural ovine fasciolosis shown by
demonstrating the presence of serum circulating antigens. Parasitology Research, 91: 328-331.
Sánchez-Andrade Fernández, R.; Suárez, J.L.; Paz-Silva, A.; Panadero, R.; Martínez, M.J.; Pedreira,
J.; Díez-Baños, P.; Morrondo, P. (2001). Seroprevalence of Fasciola hepatica by direct-ELISA
(enzyme-linked immunosorbent assay) and indirect-ELISA of bovine from Galicia (NW
Spain) according to their origin. Revista Ibérica de Parasitología (Research and Reviews in
Parasitology), 61: 97-101.
126
Scala, A.; Carfagna, G.; Uras, P.; Poglayen, G.; Gianetto, S.; Gaglio, G. (2001). Rilievi parassitologici
in bovini allevati in Gallera (Sardegna). 18th Internacional Conference of The World Association
for the Advancement of Veterinary Parasitology (WAAVP). Stresa, Italy.
Tienpont, D.; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen
coprológico. Janssen Research Foundation.
Vara Del Río, M.P. (2007). Control de la Fasciolosis ovina: estudio sobre la fasciolosis ovina y
desarrollo de técnicas para su detección y métodos de control. Tesis Doctoral. Universidad de
León.
127
128
ROE DEER (Capreolus capreolus) AS A RESERVOIR OF
PARASITIC INFECTIONS IN DOMESTIC RUMINANTS UNDER FIELD
CONDITIONS IN GALICIA
SRNA (Capreolus capreolus) KAO REZERVOAR PARAZITSKIH
INVAZIJA ZA PAŠNO DRŽANE DOMAĆE PREŽIVAČE U GALICIJI
Morrondo, P., Vázquez, L., Pardo, M., Dacal, V., Díaz, P., Paz, A., Sánchez-Andrade, R.,
Arias, M.S., Uriarte, J.*, Díez-Baños, P.
Parasitología y Enfermedades Parasitarias. Dpto. Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002 Lugo (Spain).
*Centro de Investigación y Tecnología Agroalimentaria de Aragón. 50059 Zaragoza (Spain).
ABSTRACT
From May to October 2007 individual faecal samples from the rectum of 184 roe deer were collected. The
alimentary tracts examined were dissected out of the animals killed during hunts in different forest districts from
NW Spain. The presence of coccidian oocysts and gastrointestinal nematode and cestode eggs was identified by
the flotation technique, trematode eggs by using the sedimentation test and that of bronchopulmonary nematode
by migration. Results were expressed as the number of oocysts per gram of faeces (opg), the number of eggs
per gram (epg) and the number of larvae per gram (lpg). The presence of infection by coccidian, gastrointestinal
nematoda and cestoda was diagnosed in 74% of the animals; trematode infection was not detected, and these
results disagree with that from previous investigations carried out in ruminants from Galicia maintained in
pastures. The lowest prevalence was achieved in cestoda (3.3%) and the intensity of infection was moderate (308
epg). Higher values for the prevalence and infection intensity for Eimeria coccidian were observed (54.1%).
The percentage of roe deer with lung nematoda was elevated (54.1%). We observed 25.7% of the animals had
larvae from Dictyocaulus and 44.8% from Varestrongylus. In both cases, low infection intensity was obtained
(14 lpg and 3.9 lpg, respectively). The highest prevalence was obtained in gastrointestinal nematode (66.3%)
with a moderate egg-output ( x = 136 epg). We identified eggs from Trichostrongylidae (64.7%;
Nematodirus (2.7%;
x = 132 epg),
x = 80 epg), Trichuris (2.7%; x = 50 epg) and Capillaria (2.2%; x = 75 epg).
Sažetak
Sakupljani su pojedinačni uzorci fecesa iz rektuma 184 srne od svibnja do listopada 2007. godine.
Pretraživani probavni trakt je egzenteriran iz životinja odstrijeljenih tijekom lova u različitim šumskim
područjima sjeverozapadne Španjolske. Prisutstvo kokcidijskih oocista, gastrointestinalnih nematoda i jajašaca
cestoda je utvrđivano tehnikom flotacije, jajašca trematoda testom sedimentacije, a ona bronhopulmonarnih
nematoda migracijom. Rezultati su izraženi kao broj oocista po gramu fecesa (opg), brojem jajašaca po gramu
(epg) te brojem larvi po gramu (lpg). Prisutstvo invazije kokcidijama, gastrointestinalnim nematodima i
cestodima je dijagnosticirano u 74% životinja; invazija trematodima nije utvrđena, a ti rezultati nisu u skladu
s onima prethodnih istraživanja provedenih u pašno držanih preživača u Galiciji. Najnižu pojavnost su imali
cestodi (3,3%) pri čemu je intenzitet invazije bio umjeren (308epg). Više vrijednosti pojavnosti i intenziteta
invazije primijećene su za Eimeria kokcidije (54,1%). Postotak srna sa plućnim nematodima je bio povišen
(54,1%). Primijetili smo da je 25,7% životinja imalo larve Dictyocaulus, a 44,8% Varestrongylus. U oba slučaja
intenzitet invazije je bio nizak (14 lpg i 3,9 lpg). Najveću su pojavnost imali gastrointestinalni nematodi (66,3%)
sa umjerenim nalazom jajašaca ( x = 136 epg). Pronašli smo jajašca Trichostrongylidae (64,7%;
Nematodirus (2,7%;
x = 132 epg),
x = 80 epg), Trichuris (2,7%; x = 50 epg) i Capillaria (2,2%; x = 75 epg).
129
INTRODUCTION
Galicia is the Community of Spain with a most roe deer density, although are territorial differences
to concern their density, and Lugo is the Spanish and Galician province with a more number of roe
deer, because of it, in current season permit to hunting already of 4.500 these specimens. Because of
it, to deduce that in Galicia we have a population more than 22,500 roe deer.
In studies carried out in Spain and in other European countries showed up that parasitic infections
are the principal reason of diseases in cervids and roe deer is the most sensible ungulate to parasitic
process.
In Galicia, roe deer and extensive domestic ruminants share pasture and it can be favourable
to exchange the parasitic forms. Because of it, we suspect that wild ruminants and, specifically roe
deer, can be a reservoir of parasitic diseases of domestic ruminants in extensive management. In
consequence, the knowledge of parasitic species that share roe deer and domestic ruminants will be
important and will contribute some solves for cattle and other ruminants that employ the pastures
and improve their health.
Individual faecal samples were collected between May to October of 2007. The faecal samples
were collected directly of intestine of 184 roe deer hunting in different hunting reserves of the
province of Lugo.
The coprologic analyses (flotation, sedimentation and migration) were made (MAFF, 1986) with
faecal samples. Flotation technique was used to demonstrate coccidian ooquists and gastrointestinal
eggs of cestoda and nematoda; while sedimentation technique was used to detect eggs of trematode
and the method of larvae migration to obtain and to count pulmonary nematode larvae.
Later, each sample was examined to the microscope with McMaster cameras, and it calculated
the number of ooquists by gram of faeces (opg), the number of eggs by gram of faeces (hpg) and also
larvae by gram of faeces (lpg).
RESULTS
In 74% of the analyzed faeces samples we obtain, in different amounts, ooquists of protozoa,
gastrointestinal eggs of cestoda and nematoda and larvae of broncopulmonary nematoda; on the
contrary, in no one of studied samples were eggs of trematoda.
As it is observed in Table 1, the animals presented a high prevalence and intensity of infection by
Eimeria, whereas the prevalence and intensity of infection by eggs of cestoda were little.
130
Table 1: Percentage of infected animals and parasitation intensity.
PROTOZOA
CESTODA
PULMONARY
NEMATODA
GASTROINTESTINAL
NEMATODA
Eimeria
Moniezia
Dictyocaulus
Varestongylus
Trichostrongylidae
Nematodirus
Trichuris
Capillaria
Prevalence
(%)
34.8
3.3
25.7
44.8
64.7
2.7
2.7
2.2
Intensity
(opg/hpg/lpg)
913
308
14
3.9
132
80
50
75
Also, in Table 1 details to prevalence and intensity of infection of main genera of broncopulmonary
and gastrointestinal nematoda. However, it was observed that prevalence of infection of
broncopulmonary nematoda was elevated (54.1%), the intensity of infection was low (10 lpg); on the
contrary, the animals presented a high prevalence of infection by gastrointestinal nematoda (66.3%)
and the intensity of infection was considered like moderate (136 epg).
DISCUSION
When comparing the results obtained in this study with previous found by us (DÍAZ et al., 2005,
2007) in extensive cattle of Galicia, we verified that, as wild ruminants as domestic ones, eliminated
coccidian ooquists and cestoda and gastrointestinal nematoda eggs and pulmonary nematoda larvae.
In the roe deer, the prevalence and intensity of coccidian infection and cestoda were inferior to
found by DÍAZ et al. (2005) in cattle of Rubia Gallega in Lugo province (79.8%, x = 44.9 opg for
Eimeria and 26%, x = 33,4 hpg for Moniezia).
Strongilid infection prevalence in roe deer was less to obtained by DÍAZ et al. (2007) in Rubia
Gallega cows (96%); on the contrary, in cattle, DÍAZ et al. (2007) indicates infection prevalences for
Nematodirus (1%), Trichuris (1%) and Capillaria (9%) similar to found ones in the samples coming
from roe deer.
In infected cattle for nematodes have not been observed broncopulmonary nematoda
(Dictyocaulus), possibly must that not collected calves smaller than one year themselves they are
more parasited generally for pulmonary nematoda. On the contrary, high prevalence of Dictyocaulus
noerneri in roe deer can be caused because this species of broncopulmonary nematoda does not
produce a protective immunity as happens to Dictyocaulus viviparus in the cattle.
In roe deer, trematode infection was not detected, and these results disagree with that from
previous investigations (DÍAZ et al., 2007; MORRONDO et al., 2005) carried out in Rubia Galega
cattle (24% Fasciola hepatica; 12.9% Calicophoron daubneyi and 6.2% Dicrocoelium dendriticum)
from Galicia maintained in common or near pastures with roe deer.
Although it is necessary to continue deepening in parasitic species that affect roe deer, in this
study we have verified when roe deer and cows share common habitats have identified more genera
of protozoan, cestoda and nematoda of which it is possible to be deduced that roe deer could act like
reservoir of parasitic infections that affect cattle when it is maintained in extensive pastures.
131
Our findings support the interest for studies about cross-infections and their epidemiological
consequences which are needed to be known to get a better control.
ACKNOWLEDMENTS
We are grateful to Food and Agrarian National Technology Institute (MEC), Spain by the concession of the
Research Project FAU2006-00006-00-00, and Xunta de Galicia (Spain) by the Research Project 07MRU034261PR
and especially to Galician hunters and Federación Galega de Caza.
REFERENCES
DÍAZ, P.; PEDREIRA, J.; ARIAS, M.S.; LOMBA, C.; SUÁREZ, J.L.; PAZ, A.; MORRONDO, P. (2005).
Infecciones parasitarias en vacas de raza Rubia Gallega de la provincia de Lugo: influencia de la edad.
Buiatría Española, 10: 231-234.
DÍAZ P, PEDREIRA J, ARIAS M, PAINCEIRA A, LOMBA C, SANCHEZ-ANDRADE R, MORRONDO
P, DIEZ-BANOS P. (2007). Prevalencia de infección por nematodos gastrointestinales en vacas Rubia
Gallega explotadas en semiextensivo. Información Técnica Económica Agraria (ITEA), Volumen: Extra
(28): 549-551.
DÍAZ P, PAZ-SILVA A, SÁNCHEZ-ANDRADE R, SUÁREZ JL, PEDREIRA J, ARIAS M, DÍEZ-BAÑOS P,
MORRONDO P. (2007). Assessment of climatic and orographic conditions on the infection by Calicophoron
daubneyi and Dicrocoelium dendriticum in grazing beef cattle (NW Spain). Veterinary Parasitology, 149:
285-289.
MAFF, (1986). Manual of Veterinary Parasitological Laboratory Techniques. Ministry of Agriculture, Fisheries
and Food, Technical Bulletin Nº18, London, HMSO, 2-67.
MORRONDO, P.; DÍAZ, P.; PEDREIRA, J.; SANCHEZ-ANDRADE, R.; PAZ, A.; DÍEZ-BAÑOS, P. (2005).
Trematodosis prevalence in Rubia Gallega cattle from different climatic areas. 13 Congresso Internazionale
della Federazione Mediterranea Sanità e Produzione Ruminanti (Fe.Me.S.P.Rum). Bari (Italia), 1-3
Septiembre 2005.
132
A SEROEPIDEMIOLOGICAL SURVEY OF BOVINE
PARAMPHISTOMOSIS BY USING THE Cd2 ELISA
SEROEPIDEMIOLOŠKO ISTRAŽIVANJE GOVEĐE
PARAMFISTOMOZE METODOM Cd2 ELISA
Francisco, I., M. Arias, J. Pedreira, A. Paz-Silva, R. Francisco, R. Sánchez-Andrade,
P. Díaz, J. L. Suárez, P. Díez-Baños, P. Morrondo.
Parasitology and Parasitic diseases, Animal Pathology Department, Veterinary Faculty, Santiago de
Compostela University. Campus Universitario s/n. 27002-Lugo, SPAIN. E-mail: [email protected]. Tel.
34982285900
Abstract
With the aim of gaining more knowledge about the epidemiology of the bovine paramphistomosis, a
serological survey was conducted in beef cattle maintained under field conditions. From February 2006 to
February 2007, blood samples were collected from 453 autochthonous Rubia Gallega cattle in NW Spain.
These are cattle kept under field conditions in semi-extensive management, going out to grazing areas daily and
brought into the paddocks during the night. The prevalence of paramphistomosis was calculated by means of
an ELISA test to the detection of IgG antibodies against Calicophoron daubneyi. For this purpose, excretory/
secretory antigens (CdES) were fractionated by electrophoresis and a 52-kDa protein recovered by electroelution
(Cd2). Data were analyzed by taking into account the age of animals, grazing area, number of cattle in the
farm, administration of antiparasites and frequency of chemotherapy. The overall percentage was 63% (59,
67). The highest seroprevalence was observed in the youngest animals (71%; 67, 75). When the percentages
of paramphistomosis were analyzed by considering the grazing area, the greatest values were observed in the
coastal region (84%; 81, 87) and the lowest in the mountainous ones (62%; 58, 66). By using the Chi square test,
significant differences were achieved (χ2= 6.380, p= 0.041). The analysis of the effect of the number of cattle
in the farms on the seroprevalence showed higher percentages of paramphistomosis on flocks with more than
25 animals (96%; 94, 98) and lower in that with 15-25 (73%; 69, 77), and these differences were significant
(χ2= 6.763, p= 0.046). The seroprevalence was significantly greater in farms where an antiparasitic treatment
was administrated (82%; 78, 86) (χ2= 5.977, p= 0.048). Finally, the frequency of deworming did not affect to
the infection by C. daubneyi, and similar percentages (82%; 78, 86) were obtained by treating 1 or 2 times per
year.
Sažetak
U cilju dobivanja novih spoznaja o epidemiologiji goveđe paramfistomoze, izvedeno je serološko
istraživanje na pašno držanim tovnim govedima. Uzorci krvi uzimani su od veljače 2006. do veljače 2007., na 453
goveda autohtone Rubia Gallega pasmine u sjeverozapadnoj Španjolskoj. Goveda su držana semiekstenzivno,
tijekom dana na pašnjacima, a noću u štalama. Pojavnost paramfistomoze računata je ELISA testom kojim su se
određivala IgG antitijela za Calicophoron daubneyi. U tu svrhu frakcionirani su ekskretorni/sekretorni antigeni
(CdES) elektroforezom, a 52-kDa bjelančevina elektroelucijom (Cd2). Podatci su analizirani uzimajući u obzir
dob životinja, pašne površine, broj životinja na farmi, aplikaciju antiparazitika i učestalost terapije.Sveukupni
postotak iznosio je 63%. Najviša je seroprevalencija primijećena u najmlađih životinja (71%). Kada su postotci
paramfistomoze analizirani uzimajući u obzir pašnu površinu, najviše su vrijednosti primijećene u obalnoj regiji
(84%), a najniže u planinskim (62%). Korištenjem Chi square testa dosegnute su signifikantne razlike (χ2= 6,380;
p=0,041). Analiza utjecaja broja goveda na farmi na seroprevalenciju pokazala je viši postotak paramfistomoze
u stadima sa više od 25 grla (96%), a niži u onima sa 15-25 grla (73%), a te su razlike bile signifikantne (χ2=
133
6,763, p= 0,046). Seroprevalencija je bila znakovito viša na farmama gdje se primjenjivao antiparazitski tretman
(82%; χ2= 5,977, p= 0,048). Napokon, učestalost antiparazitskih tretmana nije utjecao na invaziju C. daubneyi,
a slični su postotci (82%) dobiveni i kod tretmana 1 ili 2 puta godišnje.
Introduction
The infection by the Paramphistomum spp is frequente in areas with oceanic climate, where
mild temperatures and frequent rainfall throughout the year provide the adequate conditions for the
survival of Lymanaea spp snails, their intermediate host.
Calicophoron daubneyi (Digenea: Paramphistomidae) is a gastric trematode affecting young
ruminants especially. The immature stages of Paramphistomidae can cause severe pathology and
even kill the host in heavy infections, because they are attached to the wall of the small intestine
causing important inflammation, characterized by focal infiltration of macrophages and lymphocytes
in the lamina propia and in the interstitial tissue of Brunner’s gland (Silvestre et al., 2000). Digestion
and absorption are damaged, and appetite is also depressed, resulting in diarrhoea, anorexia, anaemia
and weakness (Spence et al., 1996). There is little evidence regarding the pathogenicity of the adult
worms to their hosts, but severe damage to the mucosa of the rumen is provoked in heavy infections
(Rolfe et al., 1994).
In the present work, the IgG humoral immune response against C. daubneyi in bovine from
Galicia (NW Spain), where mild temperatures and high precipitations are present throughout the
year, allowing the development of C. daubneyi (Abrous et al., 1999). For this reason, C. Daubneyi
excretory/secretory antigens were obtained and purified by electrophoresis and electroelution. A
serological epidemiology was developed by using an ELISA test and a 52 kDa protein to the detection
of IgG antibodies in cattle under field conditions.
The present investigation was developed in Galicia (NW Spain) with mild temperatures and
high precipitations, which favour the proliferation of Lymnaea snails, the intermediate host for
Paramphistomidae flukes (Augot et al., 1996). From February 2006 to September 2007, blood
and faecal samples were randomly collected at the same time from 453 female Rubia Gallega
autochthonous breed cattle in Lugo (Northwest of Spain) (42º 20’ – 43º 45’ N, 6º 49’ – 8º 00’ W).
These are animals kept under field conditions, most of flocks are maintained outside and are only
brought into the paddocks during the night. The grazing flock is generally fed on natural pastures,
characterised mainly by annual grass species.
The results obtained with the ELISA were analyzed by taking into aacount the age of the animals
(G-1, <3 years old; G-2, 3-6); G-3, >6); grazing area (coastal, center and mountainous); number of
animals per farm (C1, 0-15; C2, 15-25; C3, >25); chemoprophilaxys and frequence of antiparasitic
treatment.
The IgG humoral immune response was analyzed by means of an ELISA test with a 52-kDa
protein (Díaz et al., 2006). For this purpose, excretory/secretory antigens from adult C. daubneyi
were obtained and purified by electrophoresis and electroelution (Francisco et al., 2006).
Results
By using the immunoenzymatic probe, a seroprevalence of 63% was obtained. The influence of the age on the
prevalence of paramfistomosis is drawn in Figure 1. The highest seroprevalence was observed in the youngest
134
animals (71%), whereas a similar percentage in the animals of the G-2 (3-8 years old) and G-3 (older than 8
years old) was obtained. No significant differences were proved related to the age of the cattle.
47%
71%
G -1 (< 3)
G -2 (3-8)
G -3 (> 8)
44%
Figure 1. Prevalence of cattle paramhistomosis according to the age of the animals.
As can seen in figure 2, a percentage of 84% prevalence was achieved in the samples form the
coastal areas, whereas the prevalence in mountainous ones was 62%. By using the Chi square test,
significant differences were achieved (χ2= 6.380, p= 0.041).
100
90
80
%
87%
70
60
84%
62%
50
40
30
20
10
0
Coas t
Centre
Mountain
Fig. 2. Prevalence of cattle paramphistomosis by considering the grazing area.
The highest percentage of seroprevalence was obtained in the flocks with more than 25 animals
(Fig. 3), and the lowest in that with 15-25 cattle. These differences were significant by means of the
Chi square test (χ2= 6.763, p= 0.046).
135
Fig. 3. Prevalence of paramphistomosis according to the number of cattle per flock.
The seroprevalence was significantly greater in farms where an antiparasitic treatment was
administrated (82%;) than in that without chemoprophylaxis (60%) (χ2= 5.977, p= 0.048). We also
observed that the frequency of deworming did not affect to the infection by C. daubneyi, and similar
percentages were obtained by treating 1 or 2 times per year (82 and 83%, respectively).
Discussion
In the current investigation a survey to get more knowledge about the prevalence of cattle
paramphistomosis was developed by using an ELISA with a 52 kDa protein from C. daubneyi
excretory/secretory antigens. A notable seroprevalence of cattle paramphistomosis was observed,
which is in agree with data obtained in the same area of study by using native C. daubneyi excretory/
secretory antigens (Díaz et al., 2006). In previous reports a widespread distribution of L. truncatula
has been noted in the area of study (Morrondo et al., 1994), which explains the elevated prevalence
of F. hepatica-infected cattle (Sánchez-Andrade et al., 2000, 2002). The snail Lymnaea truncatula
acts as an intermediate host in the life cycle of the trematoda C. daubneyi and F. hepatica (Augot et
al., 1996).
It is remarkable that bovine were maintained in the pastures where usually they graze for allowing
their reinfection. Neverhteless, strong immunity to Paramphistomidae-infections is developed in cattle
(Urquhart et al., 1996), and repeated infections generally produce an almost complete immunity,
resulting in a marked reduction in the fluke burdens from challenge infection. In bovine trematodosis
as fasciolosis, dicrocoeliosis or schistosomosis, the presence of elevated IgG values has been also
noted (Wedrychowicz et al., 1995; Boulard et al., 1995).
Our results proved an important percentage of cattle contacted to this trematode in the area of
study, and suitable measures for preventing this relationship must be considered. The infection of
cattle with C. daubneyi enhances a notable IgG response assessable by an ELISA, which can be
estimated by using purified antigens like the 52-kDa CdES protein. This seems to be very useful
because of the possibility for standarization of the ELISA tests to the detection of infections by the
C. daubneyi trematode.
Acknowledgements
This work was partly supported by the Research Project XUGA PGIDT04RAG261009PR (Xunta de Galicia,
Spain).
136
References
Abrous, M., Rondelaud, D., Dreyfuss, J., Cabaret, J., 1999. Infection of Lymaea truncatula and Lymnaea glabra
by Fasciola hepatica and Paramphistomum daubneyi in farms of central France. Vet. Res., 30:113-118
Augot, D., Abrous, M., Rondelaud, D., Dreyfuss, G., 1996. Paramphistomum daubneyi and Fasciola hepatica:
the redial burden and cercarial shedding in Lymnaea truncatula subjected to successive unimiracidial crossexposures. Parasitol. Res., 82: 623-627
Boulard, C., Carreras, F., Van Gool, F., 1995. Evaluation of nitroxynil and closantel activity using ELISA and
egg counts against Fasciola hepatica in experimentally and naturally infected cattle. Vet. Res., 26: 249255.
Díaz, P.; Lomba, C.; Pedreira, J.; Arias, M.; Sánchez-Andrade, R.; Suárez, J.l.; Díez-Baños, P.; Morrondo,
P.; Paz-Silva, A. (2006). Analysis of the IgG antibody response against Paramphistomidae trematoda in
naturally infected cattle. Application to serological surveys. Vet. Parasitol., 140: 281-288.
Francisco, I.; Lomba, C.; Pardo, M.; Pedreira, J.; Suárez, J.L.; Sánchez-Andrade, R.; Díaz, P.; Arias, M.; PazSilva, A.; Morrondo, P.; Díez-Baños, P. (2006). Getting parasitic antigens for the diagnosis of bovine
trematodoses by electroelution. 14th Congress of the Mediterranean Federation for Health and
Production of Ruminants. Lugo (Spain), 12-15 July.
Morrondo-Pelayo, P.; Sánchez-Andrade, R.; Díez-Baños, P.; Pérez-Verdugo, L.; López-Sández, C. (1994).
Dynamics of Fasciola hepatica egg elimination and Lymnaea Truncatula populations in cattle farms in
Galicia (North-West Spain). Reasearch and Reviews in Parasitology, 54: 47-50.
Rolfe, P.F., Boray, J.C., Collins, G.H., 1994. Pathology of infection with Paramphistomum ichikawai in sheep.
Int. J. Parasitol., 24: 995-1004.
Sánchez-Andrade, R., Paz-Silva, A., Suárez, J., Panadero, R., Díez-Baños, P., Morrondo, P., 2000. Use of a
sandwich-enzyme-linked immunosorbent assay (SEA) for the diagnosis of natural Fasciola hepatica
infection in cattle from Galicia (NW Spain). Vet. Parasitol., 93: 39-46.
Sánchez-Andrade, R., Paz-Silva, A., Suárez, J.L., Panadero, R., Pedreira, J., López, C., Díez-Baños, P.,
Morrondo, P., 2002. Influence of age and breed on natural bovine fasciolosis in an endemic area (Galicia,
NW Spain). Vet. Res. Commun., 26: 361-370.
Silvestre, A., Sauvé, C., Cabaret, J., 2000. Caprine Paramphistomum daubneyi (Trematoda) infection in Europe.
Vet. Rec., 146: 674-675.
Spence, S.A., Fraser, G.C., Chang, S., 1996. Response in milk production to the control of gastro-intestinal
nematode and paramphistome parasites in dairy cattle. Austral. Vet. J., 74: 456-459.
Urquhart, G. M., Armour, J., Duncan, J.L., Jennings, F.W., Dunn, A.M., 1996. Veterinary Parasitology, Blackwell
Science Inc., Oxford (UK).
Wedrychowicz, H., Ducommun, D., Gorski, P., Pfister, K., 1995. Somatic antigens of adult Dicrocoelium
dendriticum recognised by bile antibodies of naturally infected cattle. Vet. Parasitol., 56: 47-56.
137
138
OCURRENCE OF TREMATODE EGGS IN SHEEP FROM GALICIA
(N.W. SPAIN)
Učestalost nalaza jajašaca metilja u ovaca iz pokrajine
Galicija ( sjevero-zapadna Španjolska)
Vázquez, L.; Dacal, V.; Cienfuegos, S.; Díaz, P., Lago, N., Panadero, R., Fernández, G.,
Morrondo, P., López, C.
Área de Sanidad Animal del Departamento de Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002 Lugo. SPAIN. [email protected]
ABSTRACT
From February to December 2007, a total of 1403 faecal samples were collected from 59 ovine farms. All the
examined animals were older than 3 months and they were maintained in a semi extensive management system.
Coprological examinations were conducted by the Sedimentation method and the egg output was quantified
using the modified McMaster technique. Sheep from 31 farms (52.5%) were positive for trematodes, although
the individual prevalence was much lower (7.5%), with a mean intensity of parasitation of 106.3±18.49 eggs per
gram (e.p.g.). When considering the different Genera, the liver fluke, Fasciola was the most common, present
in 42.4% of the examined flocks, with an individual prevalence of 6.3%. Dicrocoelium eggs were present in
only 11 animals from 7 farms. Eggs from a ruminal fluke of the Family Paramphistomidae were found in 10
animals, with a prevalence per farm of 8.5%. This is the first citation of this trematode in ovines from Galicia.
The mean intensity of egg output in infected animals was 111.6±22.07, 76.1±22.09 and 68.0±12.27 for Fasciola,
Dicrocoelium and Paramphistomidae, respectively. Co infection was only detected in 2 animals, belonging to
the same flock, that were infected simultaneously by Fasciola and Paramphistomidae. In general, we can affirm
that the oldest animals were more infected by trematodes, however the differences between the prevalences and
the intensities of parasitation of the different age groups were not significant (P>0.05).
Sažetak:
U razdoblju od veljače do listopada 2007. godine skupljeno je 1403 uzorka fecesa sa 59 farmi ovaca. Sve
životinje su bile starije od 3 mjeseca a držane so poluekstenzivno. Koprološka pretraga izvedena je pomoću
sedimentacije a dobivena jajašca su kvantificirana pomoću McMasrer metode. KodUkupno (52.5%) ovaca
nađena su jajašca metilja sa srednjom razimon invazije od 106+/-18.49 jajašaca po gramu. Uzevši u obzir različite
rodove metilja, Facciola je bila najučestalija sa 42.2 % pretraženih uzoraka. Jajašca Dicrocoeliuma nađena su
kod samo 11 životinja sa 7 farmi. Paramphistomidae su nađene kod 10 životinja prilikom pretrage buragovog
sadržaja. Ovoj je prvi nalaz ovih metilja u ovaca iz Galicije. Srednji intenzitet izlučivanja jajašaca u invadiranih
životinja bio je 111.6±22.07, 76.1±22.09 i 68.0±12.27 za Fasciolu, Dicrocoelium I Paramphistomonidae.
Mješovita invazija sa Fasciolom I Paramphistomom zamijećena je kod 2 životinje. Zaključujemo, da su odrasle
životinje više invadirane metiljima a također nema signifikantne razlike u učestalosti paratitarnih invazija kod
različitih dobnih skupina (P>0.05).
INTRODUCTION
Trematodosis are important parasitic diseases with negative effects over the health and sheep
production. The most common trematodes of sheep in Spain are the liver flukes Fasciola hepatica
and Dicrocoelium dendriticum. The distribution and abundance of both parasites depends on the
environmental requirements of their intermediate hosts, an aquatic snail (Lymnaea sp.) for Fasciola
and a land snail and an ant for Dicrocoelium. Whilst in humid regions of Northern Spain Fasciola is
139
the most prevalent (Paz et al., 2003) in dry regions predominates Dicrocoelium (Hernández, et al.,
2000; Dominguez et al., 2000; Díez et al., 2006).
Sheep are more susceptible to Fasciola than cattle, and acute disease has long been associated
with high mortality in sheep flocks. Dicrocoelium located in the bile ducts of liver cause less damage
but in severe infections there may be extensive hepatic cirrhosis and distension of the bile ducts.
Paramphistomidae are gastric trematodes whose immature stages can cause severe damages and
even kill the host in heavy infections. Fasciola hepatica and Paramphistomidae have a similar life
cycle and the periods of high risk are also analogous. The first citation of rumen flukes in sheep from
Spain was made by Martínez-Gómez and Hernandez (1971) in Córdoba. Recently, Morrondo et al.
(2003) have cited for the first time the presence of Paramphistomum spp-eggs in cattle from Galicia.
Soon after, this parasite was identified as Calicophoron daubneyi (Díaz et al. 2006). While the
distribution of Fasciola and Dicrocoelium is well defined in sheep from most Spanish regions, to our
knowledge there are only one previous report signalling the parasitation of ovine by Paramphistomidae
(Martínez-Gómez and Hernández, 1971). According to recent reports its prevalence is increasing in
cattle from temperate areas (Szmidt-Adjidé et al., 2000 and Mage et al, 2002), thus in our opinion its
presence in Spain could be underestimated.
The main purpose of this study was to determine the prevalence and intensity of infection by the
trematodes Fasciola, Dicrocoelium and Paramphistomidae in sheep from Galicia (N.W. Spain).
From February to December 2007 a total of 1.403 faecal samples were collected from 59 ovine
farms. Samples were individually collected from the rectal ampoule and individually examined.
Coprological examinations were conducted by the Sedimentation method and the egg output was
quantified using the modified McMaster technique. The egg-counts are presented as the number of
eggs per gram of faeces (e.p.g.). The different Trematoda eggs were identified according to Tienpont
et al. (1979).
All the examined animals were older than 3 months and in order to study the influence of the
age, 3 groups were considered: 3-12 month-old (G-1), 13-48 month-old (G-2) and >48 month-old
(G-3). Generally, those animals received antiparasitic treatment in spring and fall after coprological
analysis.
Data were analysed using the SPSS, Version 13.0 (SPSS Inc., Chicago, IL). The Chi-squared
test (χ2) was used to determine significant differences in prevalence when considering the age of the
animals. ANOVA was used to find out differences in the intensity of infestation when considering the
different age groups (P< 0.05). When the ANOVA test revealed differences the Bonferroni multiple
comparison test was applied to localize these differences.
RESULTS AND DISCUSSION
Sheep from 31 farms (52.5%) were positive for trematodes, although the individual prevalence
was much lower (7.5%), with a mean intensity of parasitation of 106.3±18.49 e.p.g.
140
50
Floc ks
Indiv idual
Prevalence
40
30
20
10
0
Fas c iola
Dic roc oelium
Paramphis tomidae
Fig. 1. Percentage of flocks and animals infected by Fasciola, Dicrocoelium and Paramphistomidae.
When considering the different Genera, Fasciola was the most common, present in 42.4% of
the examined flocks, with an individual prevalence of 6.3%. Dicrocoelium eggs were present in only
11 animals (0.8%) from 7 farms (11.9%). Those results are consistent with climatic conditions in
Northern Spain that favoured the development of the life cycle of Fasciola. But the epidemiology of
fasciolosis is also influenced by the grazing habits of the animals; so, sheep grazing in wet marshy
areas, habited by Lymnaea, are more likely to become infected.
The relation Fasciola/Dicrocoelium found in Galicia (6.3/0.8%) is inverted in the study by Díez
et al. (2006) in the drier province of León (9.3%/14.45%) and by Hernández in the Mediterranean
area (9.4%/32.3%). It must be pointed that in the study by Domínguez et al. (2000) in sheep from
Central Spain Dicrocoelium was the only trematode with a prevalence of 3.4%.
Eggs from a ruminal fluke of the Family Paramphistomidae were found in 10 animals (0.7%),
with a prevalence per farm of 8.5%. It must be pointed that this is the first citation of this trematode
in ovines from Galicia. Taking into consideration that the species infecting cattle in Galicia was
identified as Calicophoron daubneyi (Díaz et al, 2006) it is probable that this species also parasites
sheep; nevertheless further studies are necessary for a properly identification.
The mean intensity of egg output in infected animals was 111.6±22.07, 76.1±22.09 and
68.0±12.27 for Fasciola, Dicrocoelium and Paramphistomidae, respectively. Compared with the
results obtained by Hernández, et al. (2000); Domínguez et al. (2000) and Díez et al. (2006) in
other regions of Spain, the mean egg output of infected sheep can be considered as elevated. That
finding has clinical and epidemiological importance, because those animals will contribute to the
maintenance and dispersion of the life cycle of these trematodes, and, in the case of fasciolosis, the
course of the disease is determinated by the number of metacercariae ingested over a short period
of time. In sheep, acute fasciolosis occurs seasonally and is manifested by a distended, painful
abdomen, anemia, and sudden death. Chronic fasciolosis is seen in all seasons; signs include anemia,
unthriftiness and submandibular edema. Sheep do not appear to develop resistance to infection, and
chronic liver damage is cumulative over several years.
141
200
Intensity
150
100
50
0
Fas c iola
Dic roc oelium
Paramphis tomidae
Fig. 2. Intensity of parasitation by different trematodes in sheep from Galicia
Mix infections were only detected in 2 animals from the same flock, which were infected
simultaneously by Fasciola and Paramphistomidae. Coinfection by Fasciola and Paramphistomidae
could be considered as normal because they have a similar life cycle and the periods of high risk are
also analogous (Díaz et al., 2006).
30
25
Prevalence
20
15
10
5
0
3-12 months
13-48 months
>48 months
Fig. 3.- Prevalence of trematode eggs in faeces of ovine with different ages.
As we can observe in Fig. 3 the infection by trematodes was more frequent in adults than in
lambs. However, those differences were no significant (χ2= 2.782; p=0.249).
142
400
Intensity
300
200
100
0
3-12 months
13-48 months
>48 months
Fig. 4.- Intensity of parasitation by trematode eggs in faeces of ovine with different ages.
Contrary to the prevalence, faecal egg counts were more elevated in young animals (Fig. 4).
However, as occurred with the prevalence the differences between groups were no significant (F=
0.753; p=0.474).
30
3-12 months
13-48 months
>48 months
25
Prevalence
20
15
10
5
0
Fas c iola
Dic roc oelium
Paramphis tomidae
Fig. 5.- Prevalence by different Genera of trematodes in sheep with different ages.
When considering the different Genera, we observed that Fasciola was more prevalent in
adults (Fig 5). Those results agree with several authors (Morrondo et al., 1997; Sanchez-Andrade
et al. 2002) who found in cattle that the prevalence in calves was lower than in adults, whereas the
intensity of elimination (Fig. 6) was more elevated in calves. According to Sanchez-Andrade et al.
(2002) adults are more frequently infected by Fasciola because they spend more time on pasture or
because they are feed with grass or hay contaminated with metacercariae, whereas young animals
have less opportunities to become infected. However, the development of an acquired resistance with
age provokes that adults have an inferior faecal egg output.
143
3-12 months
400
13-48 months
>48 months
Intensity
300
200
100
0
Fas c iola
Dic roc oelium
Paramphis tomidae
Fig. 6.- Intensity of parasitation by different genera of trematodes in sheep with different ages.
With respect to Dicrocoelium, according to Otranto and Traversa (2002) there is no correlation
between age and the susceptibility to the infection by this trematode. However, most studies carried
out in cattle pointed out higher prevalence in adults than in calves. In our study is remarkable the
absence of Dicrocoelium in animals between 3-12 months old.
Despite the scarce number of studies working on the relation between age and the prevalence
by Paramphistomidae, all of them in cattle, it is considered that adults are more frequently infected
by this trematode. The absence of infection in lambs between 3-12 months of age found in our study
could be due to the long prepatent period of this fluke or to the fact that they had fewer opportunities
to become infected on pasture.
In general, we can affirm that adults were more frequently infected by trematodes, although the
differences between the prevalences and the intensities of parasitation of the different age groups
were not significant (P>0.05).
Taking into account that the infection by Fasciola, considered the most pathogenic for ovine,
is the most prevalent in flocks from Northwestern Spain, it is necessary to establish a control plan
involving appropriate therapeutic and prophylactic measures against this trematode.
ACKNOWLEDGEMENTS
Authors are very grateful for the collaboration of shepherds and veterinarians of the Asociación de
criadores de ganado ovino y caprino de Galicia (OVICA). This study was supported by the research project
PGIDIT06RAG26101PR (Xunta e Galicia).
REFERENCES
Díaz, P.; Lomba, C.; Pedreira, J.; Arias, M.; Sánchez-Andrade, R.; Suárez, J.L.; Díez-Baños, P.; Morrondo,
P.; Paz-Silva, A. (2006). Análisis of the IgG antibody response against Paramphistomidae trematoda in
naturally infected cattle. Application to serological surveys. Veterinary Parasitology, 140 (3-4): 281-288.
Díez-Baños, N.; Martínez-Delgado, A.; Hidalgo-Argüello, M.R. (2006). Estudio parasitológico del ganado
ovino en la provincia de León (España) mediante análisis coprológico. En: Veinte años de Buiatría. Edita
Universidad de Santiago de Compostela: 380-383.
144
Domínguez, I.A.; Gómez, M.T.; De la Fuente, C.; Carpintero, M.; Cuquerella, M.; Alunda, J.M. (2000) Parasitosis
gastrointestinales en ganando ovino de la zona centro: modelo de estructura poblacional y distribución
etaria. Medicina Veterinaria, 17(6): 147-154.
Hernández, S.; Muela, N.; Ferre, I. (2000). Helmintos parásitos del ganado ovino en la Comunidad Valenciana.
Medicina Veterinaria, vol 17(3): 69-74.
Mage, C.; Bourgne, H.; Toullieu, J.M.; Rondelaud, D.; Dreyfuss, G. (2002). Fasciola hepatica and
Paramphistomum daubneyi: changes in prevalences of natural infections in cattle and in Lymnaea truncatula
from central France over the past 12 years. Veterinary research, 33: 439-447.
Martínez-Gómez, F. and Hernández-Rodríguez, S. (1971). Helminth parasites from sheep (Ovis ovis) in Córdoba
(Spain). 1er Multicol. Europ. Parasit., Rennes: 344-346
Morrondo, P.; Díaz, P.; Pedreira, J.; Paz, A.; Sánchez-Andrade, R.; Suárez, J.L.; Arias, M.; Díez-Baños, P. (2003).
Digestive parasitosis affecting to the autochthonous Rubia Gallega cattle. XI Congresso Internazionale
Della Federazione Mediterranea de Sanitá e produzione Ruminanti (Fe.mes.S.P.Rum), Olbia (Sassari).
Morrondo, P.; Moledo, J.A.; Paz, A.; Sánchez-Andrade, R.; Díez-Baños, P. (1997). Estudio de la distribución
de la infección por Fasciola hepatica en el ganado vacuno de las provincias gallegas por medio del ensayo
inmunoenzimático ELISA. Medicina Veterinaria, 14: 234-239.
Otranto, D.; Traversa, D. (2002). Dicrocoeliosis of ruminants: a little known fluke disease. Trends in Parasitology,
19: 12-15.
Paz, A.; Sánchez-Andrade, R.; Suárez, J.L.; Pedreira, J.; Arias, M.S.; López, C.; Panadero, R.; Díaz, P.; Díez, P.;
Morrondo, P. (2003). Prevalence of natural ovine fasciolosis shown by demostrating the presence of serum
circulating antigens. Parasitology Research, 91 (8-9): 328-331.
Sánchez-Andrade, R.; Paz, A.; Suárez, J.L.; Panadero, R.; Pedreira, J.; López, C.; Díez-Baños, P. Morrondo, P.
(2002). Influence of age and breed on natural ovine fasciolosis in an endemic area (Galicia, NW Spain).
Veterinary Research Communications, 26: 361-370.
Szmidt-Adjide, V.; Abrous, M.; Adjide, C.C.; Dreyfuss, G.; Lecompte, A.; Cabaret, J.; Rondelaud, D. (2000).
Prevalence of Paramphistomum daubneyi infection in cattle in central France. Veterinary Parasitology, 87:
133-138.
Tienpont, F; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen coprológico. Ed.
Cansen Research Foundation.
145
146
INFECTION BY INTESTINAL CESTODES IN SHEEP FROM GALICIA
(N.W. SPAIN)
Infekcija ovaca iz područja Galicije crijevnim
trakavicama
Dacal, V., Vázquez, L., Cienfuegos, S., Panadero, R., Pato, J., Fernández, G.,
Díez-Baños, P., López, C.
Área de Sanidad Animal del Departamento de Patología Animal. Facultad de Veterinaria. Universidad de
Santiago de Compostela. 27002. Lugo. Spain. [email protected]
ABSTRACT
In this study we investigate the presence of tapeworms in 1549 ovine faecal samples from 59 ovine farms
in Galicia (N.W. Spain). In this region, sheep are maintained on pasture for most part of the year. In order to
study the influence of the age, 3 groups were considered: 3-12 month-old (G-1), 13-48 month-old (G-2) and >48
month-old (G-3). Coprological examinations were conducted by visual inspection of faeces to detect proglottids
and by the Flotation in saturated saline solution method, the egg output was quantified using the modified
McMaster technique. Sheep from 31 farms (52.5%) were positive for cestode eggs, being Moniezia the only
Genus identified. Seventy-one animals out of 1549 (4.6%) eliminated Moniezia eggs in their faeces, with a
mean intensity of infection of 376.0±89.64 eggs per gram. Four animals from 2 farms eliminated spontaneously
individual segments in the faeces that were identified as Moniezia expansa proglottids. When considering the
different age groups, we observed that prevalence in lambs (G-1, 11.3%) was higher than in adults (3.8% and
4.2% for G-2 and G-3, respectively) with significant statistical differences. In the same manner, the intensity of
parasitation was significantly more elevated in lambs than in adults.
Sažetak
Mali preživači, a osobito njihova mladunčad mogu biti invadirani različitim vrstama trakavica iz pododice
Anoplocephalidae. U našem radu istraživali smo prisustvo trakavica u 1549 uzoraka ovčjeg fecesa sa 59 ovčjih
farmi u Galiciji????.U ovom području, ovce se većinom godine drže na ispaši. Odlučili smo istražiti utjecaj dobi
na invadiranost životinja. Životinje su bile podijeljene u 3 skupine: 1. skupina- od 3-12 mjeseci starosti, 2. skupina
od 13-48 mjeseci starosti, 3. skupina jedinke starije od 48 mjeseci.Koprološka pretraga bila je potkriepljena
vizualim pregledom fecesa I pomoću flotacije. Konačni rezultat koprološke pretrage kvantificiran je pomoću
modificirane McMaster metode. U ovaca sa 31 farme (52.5%) pronađena su jajašca trakavice Moniezia??.
Sedamdeset I jedna životinja izlučivala je jajašca Moniezae u svom izmetu a prosječni intenzitet infekcije je bio
376.0+/- 89.64 jajašca u gramu izmeta. Četiri životinje sa 2 farme spontano su fecesom izlučivale proglotide
koje su kasnije identificirane kao Moniezia expansa. Uzimajući u obzir različite dobne skupine, primjetili smo
da je prevalencija u janjadi ( 1. skupina, 11.3&) veća nego u odraslih jedinki ( 3.8% I 4.2% za 2. I 3. skupinu)
sa statistički značajnom razlikom P=0.0001, F=16.973). Također, intenzitet parazitarne invazije je statistički
značajan ( P=0.03, F=3.691) u janjadi ( 766.8+/-1019.8) naspram odraslih (326.4+/-920.0 I 178.1 +/-246.2 za 2.
I 3. skupinu). Naši rezultati ukazuju na potrebu prihvaćanja mjera kontrole kako bi se smanjio rizik pojavnosti
jakih infekcija sa trakavicama, posebno u mladih životinja.
INTRODUCTION
Galicia is a humid region in the Northwest of Spain with around 240.000 sheep distributed
in more than 24.000 flocks. Traditionally, in this region sheep are maintained in an extensive or
semiextensive husbandry system that increases the probability of acquiring some parasitic infections.
147
Small ruminants, especially young animals between 1-6 months, can be affected by different
tapeworm Genera of the family Anoplocephalidae (Moniezia, Avitellina, Thysaniezia and Stilesia)
which are localized in the small intestine, being the most prevalent and pathogenic Moniezia sp. The
pathogenic action of these cestoda depends on the number of adults in the small intestine and the
nutritional state of the animal.
Animals became infected when they feed on grass that harbours mites of the Oribatid Family
containing cisticercoid larvae. The activity of oribatids is seasonal under template conditions and
especially in cool climates. Tapeworm segments can be visible in the faeces, with a white rice grainlike appearance. Adult worms, often up to a meter or more in length, can also be seen on post-mortem
or, when expelled, as passed in the environment, typically in yards or other areas where sheep are
concentrated. This species have a mechanical, irritative and nutritional-subtractive effect on its hosts,
and can cause considerable economic losses, especially in young animals. Normally, they provoke a
chronic process with intestinal disturbs, lack of appetite and emaciation.
Tapeworm eggs can be detected in faecal samples using the standard worm egg count procedure.
Those of the Moniezia Genus have a typical tri- or quadrangular shape with a characteristic piriform
apparatus.
In the last years, there is a continued and increasing evidence of significant resistance to
anthelmintics used in sheep. For this reason the inclusion of tapeworm control in a flock health plan
would require evidence of their deleterious effect over the health and the production of the animals.
The purpose of this study was to study the prevalence and intensity of parasitation by adult
cestodes in sheep from Galicia in order to determine the necessity of including routinely tapeworm
control measures in our flocks.
From February to December 2007 we took a total of 1.549 ovine faecal samples from 59 ovine
flocks from Galicia (N.W. Spain). Faecal samples were taken individually from de rectum to avoid
contamination. Coprological examinations were conducted by macroscopic inspection of faecal
material to detect proglottids and by the Flotation in saturated saline solution method (ρ= 1.2); the
egg output was quantified using the modified McMaster technique. The egg-counts are presented as
the number of eggs per gram of faeces (epg). Moniezia eggs were identified according to Tienpont
et al. (1979).
In order to study the influence of the age, 3 groups were considered: 3-12 month-old (G-1), 13-48
month-old (G-2) and >48 month-old (G-3).
Data were analysed using the SPSS, Version 13.0 (SPSS Inc., Chicago, IL). The Chi-squared
test (χ2) was used to determine significant differences in prevalence when considering the age of the
animals. ANOVA was used to find out differences in the intensity of infestation when considering the
different age groups (P< 0.05). When the ANOVA test revealed differences the Bonferroni multiple
comparison test was applied to localize these differences.
In our study, a high number of flocks (31 out of 59) were positive for cestode eggs (Figure 1),
whereas only 71 out of 1.549 sheep (Figure 2) eliminated cestode eggs in their faeces, with a mean
intensity of infection of 376.0±89.64 eggs per gram.
148
p o sitive
4,6%
n e g a tive
47,5%
p o sitive
52,5%
n e g a tive
95,4%
Fig. 1. Farms infected by Moniezia Fig. 2. Animals infected by Moniezia
All cestode eggs that were detected in this study were identified as Moniezia eggs. Moreover,
four animals from 2 farms eliminated spontaneously individual segments in the faeces that were
identified as Moniezia expansa proglottids. Confirming that in sheep from the Northwest of Spain
Moniezia expansa is the most prevalent tapeworm. Those results agree with those of Hernández et al.
(2000), Domínguez et al. (2000), Díez-Baños et al. (2006) and others, who identified Moniezia as the
unique Cestode eliminated by ovines in different regions of Spain.
The high percentage of flocks that eliminate Moniezia eggs can be propitiated by the fact that
in Galicia sheep are maintained on pasture for most part of the year, facilitating the ingestion of the
intermediary hosts. Moreover, humid conditions present in Northern Spain can favour the survival of
eggs in the environment and the activity of mites acting as intermediate hosts.
Despite the high prevalence per flock, the total number of infested animals is scarce, being
inferior to the 6.29% found by Díez-Baños et al. (2006) in the neighbouring province of León and
the 9.97% observed by Dominguez et al. (2000) in sheep from central Spain, but higher to the 1.04%
found by Hernández, et al. (2000) in the Mediterranean area.
When considering the different age groups, we observed that prevalence in lambs (G-1; 11.3%)
was higher than in adults (3.8% and 4.2% for G-2 and G-3, respectively) with significant statistical
differences (P<0.001, χ2=16.973).
12
10
PREVALENCE %
8
6
4
2
0
G-1
G-2
G-3
Figure 3.- Prevalence of Moniezia in the different groups of age
149
It is well known that young lambs, 1 to 3 month-old are more intensely parasitized than older
animals. Reduction of levels of parasitation with the age is related with the development of a partially
protector immune response. According to Elliot (1986) lambs between 4 to 5 months of age commonly
pass proglotids or mass of whole worms and tend to expel infection. Those results are in agreement
with our findings where both, prevalence and intensity of parasitation are more elevated in young
animals. The fact that young lambs were the most infected could be the cause of the scarce number
of parasitized animals found in this study, as we only sampled animals older than 3 months of age.
Surprisingly, Domínguez et al. (2000) did not detect Moniezia in the group of lambs younger than 1
year, being animals between 1-2 years the most parasitized.
In the same manner, the intensity of parasitation was significantly (P=0.03, F=3.691) more
elevated in lambs (766.8±1019.8) than in adults (326.4±920.0 and 175.1±246.2 for G-2 and G-3,
respectively).
Cordero et al. (1999) affirmed that the scarce presence of these parasites in ovine is generally
harmless, although the coincidence in spring of high concentration of oribatids and young animals
on pasture could provoke the apparition of some clinical cases. Adult sheep show a certain degree of
resistance, so that it is unusual to find infections with more than 1-2 specimens/animal, whereas young
lambs can harbour a greater number (more than 10-12 tapeworms) with very high egg outputs.
2000
INTENSITY OF PARASITATION (EPG)
1800
1600
1400
1200
1000
800
600
400
200
0
G-1
G-2
G-3
Figure 4.- Intensity of parasitation by Moniezia considering the age of the animals
Taking into consideration our results, it would be necessary to adopt some prophylactic or
control methods to avoid the risk of apparition of massive infections in young animals that could be
presented under favourable epidemiologic conditions for oribatid mites. Those measures would be
orientated to reduce the contamination of pastures and could include strategic treatments to pregnant
ewes and 1-2 month-old lambs. It must be also taken into consideration that, despite its low levels of
infection, adults act as a constant source of contamination, making necessary their treatment in fall
and spring and the adoption of control measures to avoid the contamination of pastures with faeces
from those treated animals.
ACKNOWLEDGEMENTS
Authors are very grateful for the collaboration of shepherds and veterinarians of the Asociación de
criadores de ganado ovino y caprino de Galicia (OVICA). This study was supported by the research project
PGIDIT06RAG26101PR (Xunta de Galicia).
150
REFERENCES
Cordero del Campillo, M. (1985). Principales problemas parasitarios debidos al pastoreo del Ganado ovino en
la cuenca del Duero. Comunicaciones INIA. Serie Higiene y Sanidad (11): 19-35.
Díez-Baños, N.; Martínez-Delgado, A.; Hidalgo-Argüello, M.R. (2006). Estudio parasitológico del ganado
ovino en la provincia de León (España) mediante análisis coprológico. En: Veinte años de Buiatría. Edita
Universidad de Santiago de Compostela: 380-383.
Domínguez, I.A.; Gómez, M.T.; De La Fuente, C.; Carpintero, M.; Cuquerella, M.; Alunda, J.M. (2000)
Parasitosis gastrointestinales en ganando ovino de la zona centro: modelo de estructura poblacional y
distribución etaria. Medicina Veterinaria, 17(6): 147-154
Elliot, D.C. (1986). Tapeworm (Moniezia expansa) and its effect on sheep production: the evidence reviewed.
New Zealand Veterinary Journal, 34: 61-65.
Hernández, S.; Acosta, I.; Becerra, C. (2003). Cestodosis imaginales. En: Enfermedades parasitarias del ganado
ovino y caprino. Ediciones Gea, Barcelona. 176pp.
Ramajo, V.; Muro, A. (1999). Cestodosis digestivas. En: Parasitología Veterinaria. Edit McGraw-Hill
Interamericana, Madrid: 229-235.
Tienpont, F.; Rochette, F.; Van Parjis, O. (1979). Diagnóstico de las verminosis por el examen coprológico. Ed.
Cansen Research Foundation.
151
152
Toxoplasma gondii screening, by molecular and
serological methods, in a farm with a rural
management in Sicily
Istraživanje Toxoplasmae gondii molekularnim i
serološkim metodama na farmama sa zastarijelom
tehnologijom na području Sicilije
Vitale Maria, Scatassa Maria Luisa, La Giglia Maria, Giangrosso Giuseppe, Currò Vittoria, Vitale Fabrizio, and Caracappa Santo
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” Palermo, Italy
AIM OF THE WORK:
The purpose of this work was to establish a pilot study on a farm with a high rural management
and poor hygienic conditions, for comparison on Toxoplasma gondii detection by serology and
molecular biology methods. The farm is family managed, and contains sheep, goats and cows in the
same place and cats and dogs that are freely running. All these conditions determine a favourable
environment for the oocysts spreading and the parasite circulation among different animal species.
Sažetak:
Cilj ovoga rada bio je provesti ishodišnu studiju na farmama sa lošim higijenskim uvjetima te to komparirati
sa učestalošću nalaza Toxoplasmae gondii putem seroloških i molekularnih metoda. Istraživanje smo proveli
obiteljskim gospodarstvima na kojem zajedno obitavaju ovce, koze, krave te psi i mačke koji nisu pod nadzorom.
Svi tu uvjeti doprinose širenju oocista i širenju parazita među različitim vrstama životinja.
Toxoplasma gondii je protozoa koja može inficirati sve toplokrkvne životinje i različite vrste tkiva kod
njih. Zbog toga je seroprevalencija te bolesti u svijetu od 20 do 80% i kod ljudi i kod životinja. U životnom
ciklusu T. gondii postoji seksualna i aseksualna faza. Tahitoiti predstavljaju invazijski oblik ovog parazita ( brzo
se razmnožavaju a akutnoj fazi infekcije ), bradizoiti ( stvaraju ciste u tkivima), i konačno sporulirane oociste
koje u okoliš dospijevaju mačijim fecesom. Toksoplazmoza se širi ingestijom encistiranih bradizoita u tkivima,
unosom hrane iv ode koje su kontaminirane mačjim fecesom koji sadrži sporulirane oociste ili transplacentalno.
Infekcija najčešće protiče asimptomatski ali može biti opasna za fetus tijekom gravidnosti.U koza i ovaca može
uzrokovati pobačaj i probleme pri porodu.Serološkim istraživanjem populacija ovaca na Siciliji utvrđeno je
preko 60% pozitivnih životinja što je bilo u svezi sa dobi i držanjem istih te prisustvu mačaka.
Materijali i metode: Uzorci su uzimani na nasumično odabranoj farmi sa lošim higijenskim uvjetima te su
skupljani od različitih životinja tijekom cijele godine. Molekularan analiza provedena je putem PCR metode.
Rezultati i rasprava: Prosječna dob ovaca bila je oko 2 godine. Istraživanje je započelo na ovcama u laktaciji
zbog toga što se PCR-om dobivaju pozitivni rezultati za vrijeme jutarnje mužnje i negativni rezultati kod
poslijepodnevne mužnje. Metodom ELISA-e utvrđeno je 40% pozitivnih životinja.PCR analiza krvi i seruma
istih 20 ovaca dala je negativne rezultate. Zboč činjenice da se tahizoiti nalaze u krvi samo u akutnoj fazi bolesti
ili u reaktiviranoj toksoplazmozi rezultati upućuju da su inficirane životinje vjerojatno u kroničnij fazi bolesti
što će biti potvrđeno PCR metodom nakon uzimanja uzoraka tkiva nakon klanja životinja. Konačno u tijeku
je razvoj metode za analizu individualnog uzorka mlijeka seropozitivnih životinja u različitim vremenskim
razmacima.
153
BACKGROUND:
Toxoplasma gondii is a coccidian protozoa that can infect all warm blood animals and all
different cells. For this reason seroprevalence ranging from 20 to 80 % is quite spread world wide in
both human and animals. The protozoa perform a sexual life cycle in the intestine of felids, while an
asexual life cycle is present in all animals resulting in tissues cysts formations. The infectious forms
are represented by tachyzoites, (rapidly dividing in the acute phase of the infection), bradyzoites
(slowing growing inside tissue cysts) and sporulated oocysts eliminated in the faeces of infected
felines. (1)
Evidences from multi-centres analysis have shown that the major risk factors for T. gondii
transmission in humans are connected with contaminated food and water assumption (2).
Toxoplasmosis can be spread by ingestion of tissue with encysted bradyzoites, ingestion of food or
water contaminated by sporulated oocysts, and transplacental transmission. Infections are quite often
asymptomatic but can be particularly dangerous for the foetus when the primary infection occurs
during pregnancy (congenital toxoplasmosis). In both sheep and goats congenital toxoplasmosis can
cause abortion and birth defects. Because of the Sicilian territorial characteristics a number of small
farms is present in which few cows are maintained with sheep and goats in a rural type, family run
management.
A general serological screening on ovine populations, revealed positive serology up to more then
60% in several ovine flocks depending from the age of the animals, the type of the management and
the presence of cats (3).
The farm was chosen among several for the type of management and the poor hygienic
conditions.
Collection of samples from all different animals are planned in different time period all year
around.
The first screening was performed winter time in sheep bulk milk samples and animal sera.
Molecular analysis were performed by a nested PCR targeting the rRNA region on both sera, blood
and milk samples.
DNA was extracted from the different samples by Gene Elute mammalian kit ( Sigma cat N°
G1N- 350) following manufacture’s instructions. Analyses were performed by a first direct PCR using
NC 18S RNA sense primer (5’TGCGGAAGGATCATTCACACG 3’, Invitrogen) and NC25S RNA
antisense primer (5’CCGTTACTAAGGGAATCATAGTT3’, Invitrogen). The amplified fragment is
approx. 1000bp.This PCR was performed for 7 min at 95°C followed by 40 cycles of 40 s at 94°C, 30
s at 58°C, 1 min at 72°C and a final extention of 7 min at 72°C. A nested PCR using Toxo ITS1sense
primer(5’GATTTGCATTCAAGAAGCTGATAGTAT 3’, Invitrogen) and Toxo ITS1 antisense pri
mer(5’AGTTAGGAAGCAATCTGAAAGCACATC, Invitrogen) was performed for 7 min at 95°C
followed by 40 cycles of 40 s at 94°C, 30 s at 60°C, 1 min at 72°C and a final extention of 7 min at
72°C. The fragment amplified approx. is 333bp. Amplifed products were loaded on 2% agarose gel
and visualised on chemi doc (BIORAD).
154
The sera samples (10 µl) were assayed by the Toxoplasmosis indirect multi-specie ELISA
diagnostic kit (ID.VET, code TOXOS 0907) following manufacture’s instructions.
RESULTS AND DISCUSSION.
The average age of the sheep are almost 2 years. The screening started on lactating sheep only
because PCR analysis on bulk milk samples gave positive results on morning milking and negative
results in afternoon milk. (Figure 1).
Figure 1: PCR on ovine bulk milk samples taken in morning (m) and afternoon milking (a): Negative control
with water only (k-) and DNA toxoplasma positive control (k+). DNA molecular ladder of 100bp (M)
The different results between morning and afternoon milking is not clear and further analysis
will be performed in the same farm and in other farms as well.
The results by ELISA on the 25 lactating ewes showed 44% positive animals. (table 1)
Table 1: Results of Elisa screening.
Total sera
Positive
Negative
25
%
11
14
44
56
Further analysis will be performed on sera of the goats and the cows present also in the farm.
PCR analysis on blood and sera of the same 25 sheep gave negative results. Since T. gondii
tachyzoites are circulating in the blood only in acute phase or reactivation following immunodepression, the results indicate that infected animals are probably in a stage of chronic toxoplasmosis
and tissue sampling for PCR analysis will be performed whenever some animals will be slaughtered.
Moreover analysis are in progress on individual milk samples from the seropositive animals and in
different time period.
The focusing on a farm with a highly rural type of management, with animal promiscuity and
poor hygienic conditions that favours Toxoplasma gondii spreading can be propedeutic not only for
155
epidemiological analysis but also for the setting up of highly sensitive methods to detect the parasite
on different sources.
Reference
1) D. Correa, I. Cañedo-Solares, L. B. Ortiz-Alegría, H. Caballero-Ortega, C. P. Rico-Torres (2007) Congenital
and acquired toxoplasmosis: diversity and role of antibodies in different compartments of the host. Parasite
Immunology 29 (12) , 651–660
2) A J C Cook, R E Gilbert,W Buffolano, J Zufferey, E Petersen, P A Jenum, W Foulon, A E Semprini, and D
T Dunn, 2000 Sources of toxoplasma infection in pregnant women: European multicentre case-control
study BMJ. July 15; 321(7254): 142–147.
3) Vesco, G; Buffolano, W; La Chiusa, S; Mancuso, G; Caracappa, S; Chianca, A; Villari, S; Currò, V; Currò,
V; Liga, F; Petersen, E (2007) Toxoplasma gondii infections in sheep in Sicily, southern Italy Veterinary
Parasitology, 146(1)
ACKNOWLEDGEMENTS: The authors wish to thank Mr. Salvatore Marceca and Mr. Giulio Verro for
sampling collection.
156
Genetical markers of resilience to tick borne diseases
(TBD) - a research project for the improvement of sheep
breeding and management strategies
Genetski markeri rezistencije na bolesti prenosive
krpeljima (BPK)-istraživački project sa ciljem napredka
uzgoja ovaca i srategija upravljanja
Pieragostini E1., Alloggio I1., de Ruvo G1., Rubino G2., Petazzi F2.
Dept. PROGESA- Università di Bari. Via Amendola, 165/A, Bari (BA) - Italy.
1
Dept. SBA - Università di Bari - Strada provinciale per Casamassima km 3 - 70010 Valenzano (Bari) – Italy
2
Abstract
Traditional phenotype-based selection methods have been very successful in improving traits
that are easily recorded, such as milk yield and growth rates. Little progress has been also made in
traits that are more difficult to measure such as response to disease and reproductive competence.
Indeed, the intensive selection for increased production has resulted in a decline in other commercially
important traits eg in Holstein cattle there has been a steady decline in fertility that mirrors the
increase in milk production. The selection for high yielding animals potentially creates management
problems where individuals have a higher production capacity than they are able to sustain, leading
to metabolic stress, which in turn results in decreased efficiency of production, high disease incidence
and impaired reproductive success. Therefore, it is important that in the future selection strategies do
not focus on production traits alone, but consider the whole animal.
Sažetak
Tradicionalne selekcijske metode, bazirane na fenotipu, korisne su u poboljšanju obilježja koja se
jednostavno bilježe, poput dobitka mlijeka i prirasta. Mali napredci su također dobiveni kod obilježja koja
su teže mjerljiva, poput otpornosti na bolesti i rasplodne sposobnosti. Naprotiv, intenzivna selekcija prema
povećanoj prduktivosti je dovela do pada ostalih komercijalno vrijednih svojstava. Npr. kod holsteinskih krava
nađeno je smanjenje stupnja plodnosti što odražava povećanje mliječnosti. Selekcija prema visokom stupnju
mliječnosti može dovesti do problema kada jedinke imaju potencijal proizvodnje koji nadmašuje mogućnosti
njihovog organizma, te dolazi do metaboličkog stresa, što pak naposlijetku dovodi do smanjenja produkcije,
učestalosti oboljenja i smanjenja reproduktivnih sposobnosti. Stoga je važno da se se buduće strategije selekcija
ne usredotočuju jedino na reprodukcijska obilježja, već da uzmu u obzir životinje u cjelini.
Introduction
A project, aiming to the improvement of animal breeding by the use of molecular genetics and
lasting from 2007-2010, has been sponsored by the Italian Ministry for Agriculture and Forestry
Policy (MIPAF). A part of this project concerns the resistence to stress and diseases in various domestic
animal species and this work describe the activity plan of the part concerning the improvement of
sheep breeding by the use of genetical markers of resilience to TBD. Apulian native sheep show
the ability to thrive in areas of high tick borne disease (TBD), but attempts to improve the their
productivity by crossing them with exotic breeds has failed due to the high mortality in generations
F1 and F2, as a result of TBD. Since now there are indications suggestive of factors which may limit
157
the effects of the infection; particularly, the phenomenon seems to be linked to the ability to cope
with anaemia per se as well as to the presence of extra α-globin genes. However, the response to TBD
diseases like Trypanosomosis and Theileriosis are known to be under multi-factorial regulation. In
this study Apulian and exotic breeds as well as sheep characterized by different alpha and beta globin
genotypes will be used as a model for investigating genetic responses to the disease obtained by an
experimental infection with Babesia ovis.
The timing of activities are being managed starting from the research of animals suitable for
the trials which will include, first an experimental infection of Apulian native sheep and sheep of
Northeren exotic breeds, then, Apulian native sheep characterized by different alpha and beta globin
genotypes.
The selection of individuals belonging to native breeds and carrying the appropriate alpha globin
haplotypes will be performed by a population survey.
Animals. Forty selected animals less than one year of age will be involved in this study. They
will be purchased and housed at the Medical Clinics of the Department of Animal Health and
Welfare of the University of Bary. Upon arrival at the Faculty of Veterinary Medicine, the animals
will be weighed, and faecal samples will be obtained to establish their worm burdens. The feet will
be checked as to foot rot. The animals will be dewormed with a broad spectrum anthelmintic. All
animals will be housed in a tick proof isolation unit.
Parasites. Babesia ovis will be isolated from a sheep immunosuppressed with high-dose cortisone
treatment and allowed to be naturally infected pasturing in tick areas. At the peak of parasitaemia in
the sheep, a blood sample will be obtained from the jugular vein and parasitaemia estimated by the
buffy coat method. Thirty/fifty ml of blood will be then obtained from the donor sheep and 10 sheep
of each group will be inoculated i/v with 2 ml of infected blood by the jugular route.
Experimental design The 40 animals of Apulian and exotic breeds as well as sheep characterized
by different alpha and beta globin genotypes will be divided into four groups according to their breed
and hemoglobin genotype. Ten weeks after arrival at the isolation unit, 5 animals of each group will
be infected with B. ovis by i/v injection via the jugular vein while the other 5 animals will act as
uninfected controls. All animals will be weighed once a week using a sheep weighing scale and 5
ml of blood will be collected into tubes containing ethylene diamine tetra acetic acid (EDTA) as an
anticoagulant 3 times a week. Following microhaematocrit centrifugation, the PCV will be measured
and parasites will be identified and quantified by examination of the buffy coat.
Clinical evaluation will be done on a daily basis and rectal temperatures will be recorded every
morning for 4 weeks post inoculation. Blood and serum samples will be collected regularly during
the observation period.
The host responses in different sheep groups artificially infected will be compared mainly on
typical high fever periods, microscopic observation, antibody response. Particular attention will be
given to native sheep carriers of alfa globin extra genes and to their behaviour under experimental
infection when compared to that of native and imported sheep with normal alfa gene arrangement.
Uvod
Projekt (2007-2010) s ciljem poboljšanja produkcijskih obilježja uporabom molekularne genetike,
sponzoriran od strane talijanskog ministarstva poljoprivrede i šumarske djelatnosti (MIPAF). Dio se ovog projekta
odnosi na odpornost prema stresu i bolestima različitih domaćih životinja i ovaj rad opisuje plan napredka
uzgoja ovaca uporabom genetskih markera otpornosti na bolesti prenosive krpeljima. Apulijanske izvorne ovce
pokazuju sposobnost napredka u područjima s visokom učestalošću bolesti prenosive krpeljima, ali su pokušaji
158
križanja takvih ovaca sa egzotičnim pasminama doveli do povećanog mortaliteta u F1 i F2 generacijama,
kao posljedica BPK. Do sada postoje predpostavke da određeni faktori spriječavaju infekciju. Ova se pojava
posebice odnosi na mogućnost borbe protiv anemije po sebi ili kao prisutost posebnih α-globin gena. Kako god,
poznato je da je osjetljivost na bolesti prenosive krpeljima, poput tripanosomijaze i tajlerioze, multikauzalne
regulacije. U ovom istraživanju su korištene apulijanske i egzotične pasmine, kao i ovce s razlličitim alfa i
beta globinskim genotipovima kao modeli u istraživanju genetskog odgovora na eksperimentalno uzrokovanu
infekciju Babesiom ovis.
Početak istraživanja bio je usredotočen na pronalazak najprimjenljjivijih jedinki koje su podvrgnute
prvo eksperimentalnoj infekciji apulijanske izvorne ovce, karakterizirane različitim alfa i beta globinskim
halotipovima, i ovce sjevernih egzotičnih pasmina. Odabir jedinki izvornih pasmina sa odgovarajućim alfa
globinskih halotipovima proveden je istraživanjem populacije.
Životinje. U ovom ćese istraživanju koristiti četrdeset životinja starosti do godinu dana. Životinje će biti
nabavljene, te smještene u Klinikama Zavoda za zdravlje I dobtrobit životinja , fakulteta u Bariju. Dolaskom
na fakultet, životinje će se biti izvagane, uzet će im se uzorak az koprološku pretragu, pregledat će im se
papci. Izvršit će se dehelmintizacija antiparazitikom širokog spectra. Sve će životinj ebiti smještene u nastambe
provjereno slobodne od krpelja.
Paraziti. Babesia ovis će biti izolirana iz ovce koja je predhodno imunosuprimirana viisokim dozama
kortizonai puštena prirodnoj infekciji na infestirani pašnjacima. Na vrhuncu parazitemije ivce, iz jugularne
vene će se uzeti uzorak krvi i potvrdit će se parazitemija uporabom “buffy coat” metodom. Trideset do pedeset
mililitara krvi će se uzeti iz ovce donora u deset ovaca iz svake skupine će se u venu jugularis aplcirati po 2 ml
inficirane krvi.
Opis postupka. 40 životinja apulijske i egzotičnih pasmina , kao i one karakterizirane različitim alfa i beta
globinskim genotipovima, bit će podijeljene u 4 grupe, s obzirom na pasminu i hemoglobinski genotiop. Deset
tjedana nakon dolaska u izolacijsku jedinicu, inficirat će se 5 životinja iz svake skupine intravenskom aplikacijom
u venu jugularis, ostalih 5 životinja u skupine koristit će se kao kontrolna skupina. Ovce će biti vagane jednom
tjednoi, a tri puta tjedno će se 5ml krvi uzeti u EDTA epruvete. Nakon centrifugiranja mikrohematokrita, odredit
će se hematokrit i paraziti će se identificirati uporabom “buffy coat “ medode. Klinički pregled će se vršiti
svakodnevno, rektalna temperature će se bilježiti svako jutra u 4 tjedna nakon inokulacije. Za to će se vrijeme
redovito sakupljati uzorci krvi i seruma. Odgovor organizma u različitim grupama usporedit će se s obzirom
na razdoblja visoke temperature, mikroskopske nalaze, odgovore protutijela. Posebna će se pozornost posvetiti
ovcama s alfa globinskim genima i njihovom ponašanju u uvjetima eksperimentane infekcije, te ih usporediti sa
nativnim i uvezenim ovcama s normalnim rasporedom alfa gena.
159
160
PASSIVE MONITORING EXPERIENCES ON CYSTIC
ECHINOCOCCOSIS IN ITALY
ISKUSTVA PASIVNOG MONITORINGA CISTIČNE EHINOKOKOZE U
ITALIJI
Poglayen Giovanni*, Stancampiano Laura*, Varcasia Antonio**, Anna Paola Pipia**,
Caterina Bio***, Costanza Romanelli*
*Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale, Ozzano dell’Emilia, Bologna Italy.,**Dipartimento di Biologia Animale, Sassari -Italy; *** AUSL 8 Arezzo - Italy,
Introduction – Cystic Echinococcosis (CE) due to Echinococcus granulosus is still the main
parasitic zoonoses, typical of the Mediterranean basin (Eckert et al, 2001). Recent updating of the
Italian situation (Garippa, 2006) shows different prevalence levels that led to divide the territory in
sporadic (north) endemic (center) and hyper endemic (south and islands). With the aim to have more
epidemiological information on sporadic and endemic areas this paper reports the results of passive
monitoring of CE arising from the analysis of the slaughter data of a small abattoir in Tuscany. For
a better definition of the circulating strains, the collection of some specimen in order to perform
biomolecular analysis completed the work.
Sažetak
Uvod-Cistična ehinokokoza, uzrokovana Echinococcus granulosus je i dalje najčešća parazitarna zoonoza,
tipična za mediteranske krajeve (Eckert et al, 2001). Noviji podaci stanja u Italiji (Garippa 2006) ukazuju na
različite stupnjeve prevalencije čime se područje dijeli na sporadična (sjever),endemska (centar) i hiperendemska
( jug i otoci). S ciljem dobivanja više epidemioloških podataka o sporadičnim i endemskim područjima ovaj
rad govori o rezultatima pasivnog monitoringa CE dobivenih na osnovu analiza potataka pri klanju u jednoj
maloj klaonici u Toskani. Kako bi dobili uvid u rasprostranjenost sojeva, izvršene su i biomolekularne analize
nekih uzoraka. Materijali i metode-Analizom podataka o klanju u razdoblju od tri godine (2004-2005-2006)
obuhvaćene su 1271 odrasle ovce iz 464 farme, 1209 (95%) domaćih i 62(5%) uvezene (Austrija, Francuska,
Njemačka, Nizozemska, Poljska). Ukupan broj ovaca iznosio je 16.999, 14982 (88%) domaćih i 2.017 uvezenih
ovaca. Kao što je I bilo za očekivati, ženskih jedinki je u našemi straživanju bilo više (9959. Statistička anliza
provedena je u skladu sa Armitageom (1971). Iz dva uzorka germinativnog sloja protoskoleksa sa šest farmi,
dobiveno je jedanaest cisti iz kojih je komercijalnim kitom izolirana DNA i PCR protokolom (Dinkel i sur. 2004)
razlikovane pojedine skupine sojeva E. granulosus (Eckert i sur. 2001). Rezultati dobiveni PSR-ompotvrđeni su
slijedom COI i NADH mitohondrijskih gena (Bowles J, Mcmanus DP, 1993, Int.; Bowles J et al, 1994).
Rezultati i diskusija-S obzirom na organizaciju rada u klaonici, podaci o jetri I plućima odnosili su se na
skupine, a ne na pojedine životinje. Korelacijska analiza je pokazala pozitivnu korelaciju između broja pozitivnih
uzoraka u skupini Pearson’s r 0.82 P<0.001). Ipak ,učestalost pozitivnih uzoraka je bila viša kod pluća (37,5%),
odnosno značajno viša (Χ 2 =7639 P< 0.001) nego kod uzoraka jetre (24,5%). Prevladavanje pozitivnih uzoraka
pluća razlikovao se od 27,2 % (inozemstvo) do čak 40%u centralnom dijelu i Sardiniji, no te razlike nestaju u
nacionalnim razmjerima (Χ 2 = 4.39 P>0.1). Naši rezultati potvrđuju usko razlikovanje sojeva PCR protokolom
(Dinkel i sur. 2004), čime su identificirana 11Eg uzorka iz skupine G1-G2-G3. Sekvenca mitohondrijskih gena
NADH i COI, dokazala je da svi uzorci pripadaju skupini G1 (obične ovce), osim dva uzorka koji pripadaju
G3, ili Bufalo skupini. Sa sociološkog, no i praktičnog stajališt, možemo reći da je proširenost CE visoka gdje
postoji neuravnoteženost socio-ekonomskog razvoja I broja uzgajanih ovaca. Svijet uzgajivača se uvijek čini
nepropusan za zdravstvenu edukaciju što dovodi do komunikacijskih poteškoća prema veterinarskim službama.
161
Materials and methods – The analysis of three years (2004 – 2005 – 2006) of slaughter data
allowed to check 1271 stocks of adult sheep coming from 464 farms, 1209 (95%) of national
origin and 62 (5%) from abroad (Austria, French, Germany, Holland, Poland). The total number of
inspected sheep was 16.999, 14982 (88%) of national origin and 2.017 (12 %) from foreign countries.
As expected, the female are more represented (99%) in our sample. Statistical data analysis was
performed according to Armitage (1971).
Two specimen of germinal layer and protoscoleces from six farms was collected and from
eleven viable cysts DNA was extracted with a commercial kit (High pure PCR template preparation
kit, Roche) and PCR protocols pointed out by Dinkel A et al (2004) applied for discrimination of the
various clusters of strains of E. granulosus (Eckert J et al, 2001). Nested PCR results were confirmed
by sequencing of COI and NADH mithocondrial genes (Bowles J, Mcmanus DP, 1993, Int.; Bowles
J et al, 1994).
Results and discussion – Due to the work organization in the abattoir the data about livers
and lungs was collected for each stock and not for each animal but the correlation analysis showed
a positive correlation between the number of positive livers and lungs in stocks (Pearson’s r 0.82
P<0.001). However the observed lung prevalence (37,5%) resulted significantly higher (Χ 2 =7639
P< 0.001) than the liver one (24.5%). Lung prevalences calculated for different areas ranged from
27,2 % (abroad) to almost 40 % in center and Sardinia but this difference disappears as national
areas only were considered (Χ 2 = 4.39 P>0.1).
Our data confirming the higher Strain typing obtained by PCR protocols pointed out by Dinkel
A et al (2004) lead us to identify the 11 Eg sampleas as belonging to the G1-G2-G3 Cluster. The
subsequently sequencing of mithocondrial genes NADH and COI, has determined that all samples
belong to G1 (common sheep) strain except for 2 samples that belongs to the G3 or Buffalo strain.
Strain typing obtained by PCR protocols pointed out by Dinkel A et al (2004) lead us to identify the
11 Eg sample as belonging to the G1-G2-G3 Cluster. The subsequently sequencing of mithocondrial
genes NADH and COI, has determined that all samples belong to G1 (common sheep) strain except
for 2 samples that belongs to the G3 or Buffalo strain.
From a sociological, but also operative, point of view the key of lecture of these results highlights
the CE diffusion with high prevalence levels everywhere sheep are bred independently of the socioeconomic development of the area and the number of sheep raised. The breeder world appear to be
always impervious to health education and it is a considerable communication trouble for veterinary
services but also for category associations that do not reach to realize control programs even if of
low profile
162
A Field Report to Compare the Responses in calves
with diarrhoea associated with Cryptosporidiosis
when treated with Electrolytes with or without
Betacyclodextrin
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG SA
KRIPTOSPORIDIOZOM PROVEDENU ELEKTROLITIMA SA I BEZ BCIKLODEKSTRINA
Bruce Pauling
B.V.Sc., Director, Professional Veterinary Distributors Ltd., Titirangi, New Zealand & Richard Tiddy B.V.Sc.,
M.Sc., Vet Resource, Te Awamutu, New Zealand
Aim
A double blind trial to examine whether a commercial electrolyte with added β-cyclodextrin will
improve the rate of recovery of diarrhoea from natural field infections of Cryptosporidium parvum
in a commercial calf rearing unit.
Background:
Calves affected with cryptosporidiosis diarrhoea are reported to exhibit clinical signs typically
lasting 7 days or more (Fayer et al 1998; Castro-Hermida et al 2002). Farmers offer supportive fluid
replacement therapy until the calves start to improve. β-Cyclodextrin activity against Cryptosporidium
parvum has been reported in vitro and in vivo in a range of species including mice, lambs, and calves
(Castro-Hermida et al, 2000-2004). On many calf units infections are complicated with significant
death rates attributed to mixed infections. β-Cyclodextrin is reported as ‘virtually tasteless’ and
should be readily palatable to a young calf with reduced appetite.
Hypothesis
Diarrhoeic, dehydrated calves with cryptosporidiosis when treated with an electrolyte
supplemented with betacyclodextrin will have an improved rate of recovery compared with a nonsupplemented electrolyte. It was proposed that the improved rate of recovery will be measured with
an earlier return of appetite and a reduced volume of electrolyte to reach full recovery onto a full
milk diet.
Materials
Two electrolyte formulations were prepared, one a commercial isotonic electrolyte (“Enervade™”)
with soluble dietary fibre (resistant maltodextrin) added (Ep) and the second being an identical
electrolyte mix to which 10 gm betacyclodextrin was also added (EpBCD).
Method
A commercial calf unit raising 1600 Jersey/Friesian cross calves per year with a history of
cryptosporidial diarrhoea presented 25 simultaneously diarrhoeic calves for the study. The presence
of cryptosporidial oocysts was confirmed in cases prior to the trial, in subsamples of enrolled calves,
163
and sentinel calves were also monitored to a limited extent for cryptosporidial oocysts and other
pathogens associated with neonatal calf diarrhoea. The calves were typically aged 6 – 12 days of
age, and weighed 24-32 kg. Treatments were blinded to both the herd manager and trial monitor and
randomised. Following assignment, calves were placed alternately into one of two adjacent hospital
pens and fed from communal electrolyte/milk feeders. Treatment started by withholding milk for 24
hours. Calves in each pen were then offered one of either electrolyte treatments at least twice daily
for 24 hours according to “demand” (ie consumption rate). Calves were then offered milk twice
daily to assess the return of appetite, and were fed milk if they desired, otherwise electrolyte was
continued. Each group continued to receive the assigned electrolyte at least once daily over a three
day period. Voluntary electrolyte consumption was encouraged.
Results
Cryptosporidiosis was confirmed among affected diarrhoeic calves. Calves treated with βcyclodextrin electrolyte (EpBCD) recovered their appetite more quickly than the control electrolyte
(Ep) (P < 0.001), and the total electrolyte volume required was significantly lower in the EpBCD
formulation - 33% less on day 5, (95% CI 25-40%) . Relapse diarrhoea cases occurred in each group
following the re-introduction of milk.
G r a p h Sh o w in g Pr o p o r tio n o f C a lv e s r e tu r n e d to
s o le ly m ilk fe e d s
Proportion of calves
returned to solely milk
feeds
1 .0
p = .0 0 1
0 .8
0 .6
Ep
0 .4
EpBC D
0 .2
0 .0
1
2
3
4
5
6
Da y
Average Litres of Electrolyte
consumed per calf over 6 days
Av e r a g e Ele c tr o lyte C o n s u m p tio n o f v a r io u s
Ele c tr o lyte s p e r c a lf s u r v iv in g to 6 d a ys
16
14
12
10
8
6
4
2
0
se
se
L itre s C o n s u m e d
Ep
EpBC D
Legend Ep – Commercial electrolyte without β-cyclodextrin. EpBCD – commercial electrolyte with β-cyclodextrin.. Death rates were 5/13 in Ep electrolyte, and 3/12 in the EpBCD group being typical of the death
rates on the property for this type of case.
164
Conclusions
There was
1. A significant increase in the rate of recovery of appetite in the group of calves treated
with the electrolyte formulation containing betacyclodextrin compared with the control electrolyte
formulation.
2. A significant (33%) reduction in the total volume of electrolyte used in the time to full
calf recovery onto a milk diet.
3. No significant difference in death rates between treatment groups, however numbers were
low and numerically, fewer EpBCD affected calved died.
*** Don’t know that this is important here – might be better leaving high impact statements
alone at end. Some of this could go in the intro. Loss of appetite for milk feeds is common in calves
with cryptosporidiosis, and is an important sign that increases weight loss and slows recovery. An
improvement in the rate of recovery is an important factor for farmers in reducing the impact of this
disease in calves. During recovery and at re-introduction of milk feeds some effort may be required
to only offer small volumes of milk.
* corresponding author; # Kryptade is a registered veterinary medicine in New Zealand
USPOREDBA ODGOVORA NA TERAPIJU PROLJEVA POVEZANOG
SA KRIPTOSPORIDIOZOM PROVEDENU ELEKTROLITIMA SA I BEZ BCIKLODEKSTRINA
Bruce Pauling
* B. V. Sc., Director, Professional Veterinary Distributors LTD; Titirangi, New Zeland & Richard
Tiddy B. V. Sc., M. Sc., Vet Resource, Te Awamutu, New Zeland
Cilj: Dvostruka slijepa proba za određivanje komercijalnog elektrolita uz dodavanje ß-cyclodextrin
će poboljšati stupanj oporavka od proljeva uzrokovanog prirodnom infekcijom Cryptosporidium
Parvum u zemaljskom uzgoju.
Opis slučaja: Prijavljano je da telad pogođena kriptosporidiozom pokazuje kliničke znakove
u trajanju od 7 dana ili više (Fayerlet al 1998; Castro-Hermida et al 2002). Uzgajivači primjenjuju
potpornu terapiju tekućinama dok telad ne počne pokazivati znakove oporavka. Aktivnost ßcyclodextrina protiv Cryptosporidium Parvum-a se pokazala efektivnom in vitro i in vivo u više
životinjskih vrsta, uključujući miševe, janjad i telad (Castro-Hermida et al, 2000-2004). U mnoštva
teladi prijavljene su komplikacije sa visokom smrtnošću pripisane miješanim infekcijama. ßcyclodextrin navodno je bez okusa, te se može upotrijebiti peletiran čak i u teladi sa smanjenim
apetitom.
Hipoteza: Dehidrirana telad sa riptosporidijama uzrokovanom dijarejom pokazuju kod terapije
elektrolitima sa ß-cyclodextrinom pojačan stupanj oporavka od neterapirane. Predloženo je da
se brzina oporavka mjeri ranijim povratkom apetita i količinom utrošena elektrolita do potpunog
povratka na prehranu mlijekom.
Materijal: Pripremljene su dvije vrste elektrolita – komercijalni izotonični elektrolit („Enervade
TM“) sa dodanim otopljenim dijetnim vlaknima (otporni maltodekstrin) (Ep), i, kao drugo, isti taj
elektrolit sa dodanih 10 g/ml ß-cyclodextrina (EpBCD).
165
Metoda: Komercijalni uzgoj sa 1600 Jersey/Friesian križane teladi sa povijesti kriptosporidijske
dijareje odvojio nam je 25 bolesne teladi koja su počela pokazivati simptome u isto vrijeme, za
istraživanje. Prisutnost oocisti kriptosporidija dokazana je prije početka pokusa, u umatičene i
kontrolne teladi u koje je također utvrđena manja količina oocisti kriptosporidija i ostalih patogena
utvrđenih u neonatalnim dijarejama. Telad je bila stara 6-12 dana i težine 24-32 kg. Terapije su davane
nasumično i bez informiranosti upravitelja stada i mjerača rezultata. Terapirani su u oba veterinarska
centra (lječilišta) i hranjeni iz hranilica koje se uobičajeno koriste. Terapija je počela uskraćivanjem
mlijeka 24 sata. U oba centra nakon toga im je ponuđen jedan od dva elektrolita dva puta na dan u
24 sata, ovisno o želji. Nakon toga nuđeno im je mlijeko 2x dnevno za procjenu povratka apetita, te
im je isto dano ukoliko su ga htjeli, a u suprotnom je nastavljena terapija elektrolitima. Obje grupe
nastavile su dobivati elektrolite barem jednom na dan kroz period od 3 dana. Poticano je dobrovoljno
uzimanje elektrolita.
Rezultati: Kriptosporidioza je potvrđena u teladi pogođenom dijarejom. Telad tretirana ßcyclodextrinom u elektrolitu (EpBCD) povratila je apetit znatno brže nego telad koja je primila
kontrolni elektrolit (Ep) (P<0,001), a ukupna količina utrošenog elektrolita je značajno manja u
EpBCD grupi – 33% manje petog dana, (95% CI 25-40%). Recidivi su se pojavili u obje skupine
prilikom ponovnog uvođenja mlijeka u prehranu.
166
Metabolic Diseases - Nutrition
Metaboličke bolesti - Hranidba
167
168
NEUROLOGICAL MANIFESTATIONS AND LIVER DISEASE IN DAIRY
COWS
Neurološki poremećaji i bolesti jetre u muznih krava
Marisa Masucci, Michela Pugliese, Alessio Scardillo, Antonio Sutera*; Ferrantelli V.*,
Giuseppe Licitra**
Departement of Veterinary Pubblic Health, University of Messina - *Zooprophilactic Institute of Palermo**ASL n. 7 – Ragusa (Italy)
Summary
The liver cannot be examinated directly in large animals and the signs of liver disease – among them the
hepatic encephalopathy - caused by failure of its functions may not appear in the early stages of disease or may
be very subtle. Many blood constituents may be altered because of failure of the metabolic functions of the liver
and of hepatocyte damage. This study evaluates the relationship between serum parameters changes indicative
of hepatic damage and alterated nervous system functions in dairy cows.
Sažetak
Jetru je nemoguće direktno pregledati u velikih životinja pa je ponekad teško na vrijeme prepoznati bolesti
jetre kao što je npr. hepatička encefalopatija koja nastaje zbog poteškoća u funkciji jetre jer su simptomi vrlo
blagi ili ih uopće nema. Različiti sastojci krvi mogu biti promijenjeni usljed metaboličkih poremećaja jetre i
oštećenja hepatocita. Svrha ovog rada je utvrditi povezanost između promjena u krvi koji ukazuju na oštećenje
jetre sa poremećajima živčanog sustava u mliječnih krava.
Introduction
Hepatic encephalopathy is a clinical syndrome, characterized by neurological symptomatology,
that occurs when portal blood bypasses the liver (congenital or acquired shunts) or when the blood
goes through an inadequately functioning liver (hepatic insufficiency) (Pearson, 2002; Lorenz and
Kornegay, 2004). It occurs because the liver cannot adequately metabolize and detoxify substances
that are normally absorbed form the gastrointestinal tract (ammonia, mercaptans, short-chain fatty
acids, aromatic amino acids) and thus their blood levels increase (Pearson, 2002; Lorenz and
Kornegay, 2004). They cross the blood-brain barrier and act as false neurotransmitters or alter the
balance between inhibitory and excitatory neurotrasmitters (Pearson, 2002; Lorenz and Kornegay,
2004). A variety of clinical signs may be present: lack of coordination, beahvioural changes, mental
status alterations (hyper-excitability or depression, stupor or coma), seizures, blindness (Pearson,
2002; Lorenz and Kornegay, 2004). Signs of hepatic encephalopathy are often subtle and not specific
and frequently the clinical picture waxes and wanes (Pearson, 2002; Lorenz and Kornegay, 2004).
The goals of this study is evaluate a possible relationship between serum parameters changes
indicative of hepatic damage and neurological signs in dairy cows.
Eighty-nine cows, between the 4th and the 74th week of lactation, were examined: 83 Friesian, 3
Red-dappled, 2 Brown, 1 Friesian – Red-dappled cross.
All the animals were healty in herdsmen’s opinion.
169
Neurological examination (observation of posture, gait, mental status and examination of cranial
nerves) was carried out in all the animals.
In all the cows the following serum parameters were determinated: urea, aspartate aminotransferase
(AST), γ-glutamyl transferase (GGT), total and conjugated bilirubin, triglycerides, cholesterol, total
proteins and electrophoresis of proteins.
The following ranges were considered normal: urea: 10-45 mg/dl; AST: 0-130 U/l; GGT: 2-18
U/l; total bilirubin: 0.01-0.5 mg/dl; conjugated bilirubin: 0.04-0.44 mg/dl; triglycerides: 15-45 mg/
dl; cholesterol: 80-140 mg/dl, total proteins: 6-8 g/dl; albumin 3.1-3.7 g/dl; α1 globulins: 0.1-0.3 g/dl;
α2 globulins 0.5-0.7 g/dl; β globulins: 1-1.6 g/dl; γglobulins: 1.8-2.5 g/dl; albumin/globulins ratio:
0.4-1.2 (Fioretti et al., 1983; Kaneko, 1989b).
Statistical analysis was made using the Fisher’s exact test and linear regression test. Differences
were considered to be significant when P< 0.05.
Results
Eight cows (9%) showed neurological deficit: pelvic limbs proprioceptive ataxia (3 animals),
hyper-reactivity to environmental stimuli (1 animal), bilateral amaurosis (1 animal), monolateral
amaurosis (3 animals).
The animals with neurological signs had the following biochemical alterations:
• decreased amounts of: cholesterol (2 cows), triglycerides (6 cows), albumin (6 cows), β
globulins (2 cows), γ globulins (2 cows);
• increased levels of: GGT (5 cows), AST (2 cows), cholesterol (7 cows), total proteins (4
cows), α1 globulins (8 cows), α2 globulins (4 cows), γ globulins (1 cow).
There was a statistically significant difference between animals with neurological signs (group
A) and without neurological signs (group B) with regard to:
• hypotriglyceridemia (P = 0.0162), which was found in 75% of the animals of group A (X
13.6 + 5.4) and in 30% of the animals of group B (X 17.4 + 5.4);
• hypocholesterolemia (P = 0.0072), which was found in 25% of the animals of group A (X
182 + 75.8) and in any animal of group B (X 188 + 60.7);
• increased levels of AST (P = 0.0205), which was found in 25% of the animals of group A
(X 89 + 31) and in 1% of the animals of group B (X 74 + 17).
There was no significant difference for the prevalence of high levels of: GGT (62% of the cows
of group A and 85% of group B), cholesterol (87% of the cows of group A and 79% of group B),
total proteins (50% of the cows of group A and 21% of group B ), α1 globulins (100% of the cows
of group A and 99% of group B), α2 globulins (50% of the cows of group A and 54% of group B), γ
globulins (12% of the cows of group A and 10% of group B). There was no significant difference for
the prevalence of decreased amounts of: albumin (75% of the cows of group A and 52% of group
B), β globulins (25% of the cows of group A and 48% of group B), γ globulins (25% of the cows of
group A and 60% of group B).
There was a positive linear regression between:
• triglyceride and α2 globulins ( r = 0.3645, P = 0.0004)
170
• cholesterol and urea (r = 0.3369; P = 0.0012)
• cholesterol and albumin (r = 0.6482; P < 0.0001)
• AST and total proteins ( r = 0.2999; P = 0.0043)
• AST and γ globulins ( r = 0.2689; P = 0.0108)
There was a negative linear regression between:
• trygliceride serum levels and GGT (r = - 0.2675; P = 0.0113)
• cholesterol and total bilrubin (r = - 0.2368; P = 0.0263)
• cholesterol and total proteins (r = - 0.3930; P = 0.0001).
Discussion
The results show a significantly higher prevalence of hypotrigliceridemia, hypocholesterolemia
and high levels of AST in the cows with neurological signs and a significant correlation between this
and other serum parameters indicative of hepatic damage.
Triglyceride serum levels are sometimes lower in hepatic lipidosis, because of the inability of
the liver to secrete them, that are deposited within the epatocytes (Pearson, 2002; Aubadie-Ladrix,
2004). The liver secretes triglycerides as VLDL lipoproteins, which migrate in to the α2 globulins
position (Kaneko, 1989a). This explains the positive correlation between triglyceride serum levels
and α2 globulins. GGT in cattle is the most valuable serum marker for disorders of the hepatobiliary
system (cholestasis, hepatic lipidosis, hepatocyte necrosis) (Verrièle and Bedouet, 2000). The
negative regression between GGT and triglycerides may be due to a progressive decrease in blood
triglycerides when the hepatic damage increases.
The low cholesterol levels are due to its decreased hepatic synthesis and/or its inability to leave
the liver (Schouvert, 2001; Pearson, 2002). Urea provides a non toxic means of excreting ammonia
generated by amino acid catabolism and the intestinal microflora and its production occurs almost
exclusively in the liver (Carlson, 2002). Albumin is synthesized by liver too. The failure of the
metabolic hepatic functions may be a determining factor of decrease in blood cholesterol, urea and
albumin and of positive regression betwen cholesterol and urea and cholesterol and albumin. The
negative regression between cholesterol and bilirubin may be due to a impairment of excretory
function of the liver associated with failure of metabolic functions. The negative regression between
cholesterol and total proteins may be due to association between hepatic failure and inflammatoryinfectious diseases.
AST is used rather ALT in cattle (liver of large animals contain only insignificant amounts of
ALT) and, althoug it is not liver specific, is useful in measuring hepatic necrosis, although is not liver
specific (Cornelius, 1989). The positive regression between AST and total proteins and γglobulins
may be due to association between hepatic damage and inflammatory-infectious diseases.
This study suggests a relationship between hepatic damage and neurological manifestations
and shows a significantly higher prevalence of hypotrigliceridemia and hypocholesterolemia in the
cows with neurological signs.It would be interesting to clarify if these lipidic disorders are simply
a marker of liver failure, responsible of neurological symptoms (hepatic encephalopathy), or if you
do not have a direct role in the symptoms (lipids are a very important role in formation of structural
neuronal membranes and mielinic sheaths.
171
The subtle clinical signs showed by animals were not perceived by herdsmen or in a superficial
observation and were detected only by an accurate neurological examination. So it is likely that the
neurological system involvement in hepatic failure is under-estimated, and that it may occur not only
in the terminal stages of disease (Lorenz and Kornegay, 2004).
References
1. Aubadie-Ladrix M. Esami biochimici ematici nella bovina da latte. Summa numero monotematico: Esami
complementari in clinica bovina, 2004, n.9, pp.13-19.
2. Carlson G.P: Clinical Chemistry Tests. In: Smith B.P. Large animal internal medicine. Third edition, Mosby,
St Louis, 2002, pp. 389-412.
3. Cornelius C.E.: Liver function. In: Kaneko J.J. Clinical biochemistry of domestic animlas. Academic Press,
Inc., San Diego, 1989, pp. 364-391.
4. Fioretti M., Antonimi S., Bertoli M. Diagnostica in medicina veterinaria. Attualità in laboratorio. EdiErmes, Milano 1983
5. Kaneko J.J. Serum proteins and dysprotidemias. In: Kaneko J.J. Clinical biochemistry of domestic animlas.
Academic Press, Inc., San Diego, 1989a, pp. 142-165.
6. Kaneko J.J. Appendixes. In: Kaneko J.J. Clinical biochemistry of domestic animlas. Academic Press, Inc.,
San Diego, 1989b, pp. 877-901.
7. Lorenz M.D., Kornegay J.N. Handbook of veterinary neurology. Fourth edition. Saunders, St Louis 2004.
8. Pearson E.G. Diseases of the hepatobiliary system. In: Smith B.P. Large animal internal medicine. Third
edition, Mosby, St Louis, 2002, pp. 790-823
9. Schouvert F. La steatosi epatica nella vacca da latte. Summa, 2001, n.8, pp. 21-27
10. Verrièle M., Bedouet J.: Gli esami ematici nei bovini. 1. Le chiavi per utilizzare la biochimica clinica.
Summa, 2000, n.5, pp. 27-31
172
Effects of sex on histological characteristics of skin
in Lori sheep
Utjecaj spola na histološke osobitosti kože u Ovaca
pasmine lori
ABBASI, M1, and GHARZI, A.2
1
Department of Basic Sciences, School of Veterinary Medicine, University of Lorestan,Khorram-Abad, Iran
Department of Biology, Faculty of Basic Sciences, University of Lorestan, Khorram-Abad, Iran
2
Abstract
Skin is a remarkable and versatile organ, which not only covers the whole body but also has a number of
other important functions. About 15% of the body weight in mammals is skin. This organ is composed of two
principle layers, epidermis and dermis. Epidermis is ectodermal in origin and forms most of the cutaneous
appendages including glands, nail, hair and wool follicles. It consists mainly of a multilayer of keratinocytes.
Beneath of the epidermis is dermis a thick and tough layer of connective tissue. It has been indicated that the
detailed anatomy and histology of the skin and its appendages varies not only in different species but various
parts of the body in an individual also shows considerable changes regarding these factors. In present study we
aimed to compare some characters of skin, including the epidermis and dermis thickness, density and diameter
of primary and secondary wool follicles (PF & SF), in the various parts of skin in male and female of Lori sheep.
To fulfill this task we were provided 20 sheep skin and removed our samples as small pieces from their different
regions. The samples were first observed by a binocular microscope to examine the density of wool fibers per
square millimeter. Afterwards, they were fixed in formalin saline and processed for more histological scrutiny.
To improve our survey, we stained the 7 µm cut sections with H&E method. The sections were observed under a
light microscope equipped with a graded graticule (to the nearest 1 µm) and several informative characters, which
were already mentioned, were recorded. Observations, which were made here, showed that the mean density
of wool fiber in this breed is 6 per mm2. Moreover, although no significant difference was observed regarding
the thickness of epidermis and dermis, some clear differences were showed in the case of follicles diameters
between two sexes. In general, we demonstrated here that in lori sheep the sex influences on quantitative and
qualitative characters of skin and its main epidermal appendages namely, wool follicles.
Key words; Sheep, Skin, Histology
Sažetak:
Koža je svestran organ koji ne samo da pokriva čitavo tijelo nego sadrži mnogo važnih funkcija. Otprilike
15% tjelesne mase sisavaca čini koža. Načelno ovaj organ se sastoji od dva osnovna sloja: epiderme i derme.
Epiderma je ektodermalnog podrijetla i čini većinu kutanih tvorbi uključujući, žlijezde, nokte, kosu i dlačne
folikule. Sastoji se uglavnom od višeslojnih keratinocita. Ispod epiderme i derme leži debeo i čvrst sloj vezivnog
tkiva. U ovom istraživanju željeli smo usporediti neke osobitosti kože, uključujući debljinu epiderme i derme,
gustoću i promjer primarnih i sekundarnih dlačnih folikula na različitim dijelovima kože mužjaka i ženki
pasmine Lori. Kako bi izvršili ovu zadaću dostavljeno nam je 20 ovaca kojima smo uzeli male uzorke kože
i različitih dijelova tijela.Uzorci su prvotno pregledani binokularnim mikroskopom kako bi ispitali gustoću
vunenih vlakana u kvadratnom milimetru.Rezovi su pretraženi svjetlosnim mikroskopom koji je mikronsku
skalu, a neke od značajnih promjena su primljene. Naša zapažanja su pokazala da je prosječna gustoća vunenog
vlakna u ove pasmine 6 mikrona u kvadratnom milimetru. Štoviše, iako nije uočena signifikantna razlika
između debljine epidermisa i dermisa uočena je jasna raznolikost u promjeru dlačnih folikula među spolovima.
Općenito uzevši dokazali smo da se utjecaj spola na kvantitativne i kvalitativne karakteristike kože lori ovaca
manifestiraju kroz dimenzije dlačnih folikula.
173
Introduction
Skin is a remarkable and versatile organ which not only covers the whole body but also has
plays a number of other important roles for the body (Dellman, 1993). This organ is composed of
two principle layers, epidermis and dermis. Epidermis is ectodermal in origin and forms most of
the cutaneous appendages including glands, nail, hair and wool follicles. It consists mainly of a
multilayer of keratinocytes. Beneath of the epidermis is dermis a thick and tough layer of connective
tissue ( Junqueira and Camerio, 2003).
One of skin appendages in mammals is wool that covers the body of sheep and some others in
this class. The wool fiber is product of wool follicles, an epidermal appendage which penetrates deep
into the underling dermis (Carter, 1955). Histologically, there are two types of wool follicles: primary
follicles which produce thicker fibers than their secondary counterparts (Brown et al, 1968). Of main
characters that determine quality and quantity of wool produced by sheep are density of follicles and
the ratio of secondary to primary follicles (the so-called S/P ratio). There are some documents that
in sheep sex affects the density of follicles (P & S) as in females is higher than males and this is a
reflection of having more weight and greater skin surface in female (Buttler, 1981).
One of main area in breeding of sheep in Iran is Lorestan province in southwest of the country.
The sheep which is bred in this region is called Lori sheep. In this research we aimed to investigate
some characters relating the skin of this breeds. It was also tried to find whether the sex has any
impact on quality of produced wool or not?
Twenty reproductively mature Lori sheep (10 ewes and 10 rams) were identified according to their
phenotypic features. The sheep were killed in a local slaughterhouse and their skins were dissected
out. By using a punch, small pieces, with total area of 2 cm2, were removed from different regions
of the skin, including left and right flanks, left and right shoulders, left and right hips and mid-back.
The specimens were immediately placed in formalin saline. Afterwards, by a binocular microscope
the total number of wool follicles (P & S) in these pieces was counted. The specimens were then
processed through a serial steps for histology examinations. Hematoxylin and eosin method were
used for staining of histological sections. The sectioned were examined under a microscope which
was equipped with a graded graticule by which the diameter of follicles (P & S) and the thickness of
epidermis and dermis layers were measured. In general, 8 parameter, including density of wool fibers
per mm2 (FD), number of primary follicles (PFN) and secondary follicles (SFN) per mm2, diameter
of primary follicles (PFD) and secondary follicles (SFD), thickness of epidermis (ET) and dermis
(DT) as well as the S/P ratio in both sexes in above-mentioned regions were measured (Humason,
1979).
The data provided were later analyzed statistically. All statistic analyses were processed in SAS
software (SAS Institute, 1998).
Results
After examining the punched pieces with a total area of 6 cm2 under a binocular microscope and
counting the wool fibers which exist in this area we found a mean density of 6.063 per mm2 (with
a standard error of 0/166). Considering sex and region, no significant differences were observed in
fiber density between two sexes and different regions (P > 0.05).
174
Epidermis in both male and female and also in different regions shows a thickness between
minimum 8 and maximum 45 µm with an average of 17.54 µm. The highest thickness of epidermis
is seen in female (18.69 µm) and the thinnest epidermis exists on the hip region (16.63 µm). The
epidermis is made of 3-8 cell layers and regarding its thickness a significant difference was observed
between two sexes (P < 0.0082). In general, the epidermis in female is thicker than its counterpart
in male.
Dermis is a tough and thick (1- 4.9mm) connective tissue that forms projections termed papillae
which interdigitate with downward projections of epidermis. Within the dermis wool follicles, sweet
and sebaceous glands and arrector pilli muscle are clearly observed. Compared to female, the male
shows a thicker dermis. The wool follicles are seen in groups and each group consists of a large
primary follicle and several smaller secondary follicles. The sex has a distinct effect on the number
of secondary follicles (P < 0.05) and S/P ratio (P <0.01) but not on the primary follicles number (P >
0.05). The mean value of both factors was higher in female compared to male. Moreover, sex showed
a clear outcome on the diameter of primary (P < 0.01) and secondary (P < 0.05) follicles. In regard to
the diameter of primary follicles, a significant discrepancy was observed at various regions of skin (P
< 0.01) as in back region the follicles were thicker. However, such correlation was not seen in case
of secondary follicles (P >0.05).
Discussion
It has been shown that the structure and the thickness of skin vary in different breeds of sheep.
For example, in Bulgarian breeds, Native Karnoboat and Karakachen, skin has a 3.3 and 2.5 mm
thick, from which the epidermal layer forms on average 18 µm (Stankov et al, 2004), while in Merino
sheep, the epidermis constitutes 24.9 µm of whole skin (Britt et al 1985). We here demonstrated
that in lori sheep the skin on average is 2.4 mm thick including a 18 µm epidermis the remaining is
composed of the dermis. Also, in relation to epidermis thickness, a significant difference was found
between two sexes as in females this layer is thicker than its counterpart in male. Moreover, in
female, dermis was also thicker than male. However, regarding the thickness of the dermis in various
portions of the skin, a distinct difference was not observed between these parts.
It has been documented that the quality of wool depends on the SF/PF ratio so that a higher
ratio means a better quality for the wool (Hynd, 1995 and Clarke et al 1997) and the highest ratio is
found in Merino sheep which mounts to 16.5. In other breeds this ratio is lower as a six months old
Awassi fat-tailed sheep displays a ratio of 4.2. Another point revealed by these researchers in this
particular sheep was that the SF/PF ratio in male has been higher than male (Fayez et al, 1976). There
are some indications that this ratio is hereditary but diet can have an effect on it too (Gifford et al,
1995). In present study, we showed that in lori sheep the mean SF/PF ratio is 2.26, which means in
comparison to other breeds, such as Barki, Sannen and Togenburg that show a ratio of 2.4, 3.9 and
2.4 respectively, the quality of the produced wool is nearly satisfactory but is not ideal, of course, if
compared to Merino sheep. Moreover, in female this ratio was higher than male, once again a clear
discrepancy was not observed in different parts of skin. The undesired quality of the wool in lori
sheep is also reflected in a low density of wool fiber per mm2 (6/mm2) since this density is much
higher in well-known breeds.
Considering the diameter of wool follicles, the current study showed that in male sheep the
follicles are thicker and since there is a straight relationship between follicle diameter and fiber
thickness, it can be concluded that in lori sheep the females grow and produce finer or better wool.
175
Again various parts of skin in both sexes are closely similar and for this parameter and no considerable
difference was seen in these regions.
In general, in this survey, we introduced macroscopic and microscopic characters of lori sheep
skin and showed that in these aspects there are some differences among male and female. However,
the quality of the wool produced in this specific breed is not very satisfactory and is comparable with
many endemic uro-asian breeding.
Acknowledgement
The authors would like to thank research department of Lorestan University for financial support.
References
Britt, A.G., Cotton, C.L., Kellet, B.N., Pitman, I. and Traska, A.J. (1985): Structure of the epidermis of Australian
merino sheep over 12-month period. Aus. J. Bio. Sci. 38: 165-174.
Brown, G.H., Turner, N.H. and Dolling, C.H.S. (1968): Vital statistics for an experimental flock of merino
sheep. V. the effects of age of ram, maternal handicap and year of measurement on 10 wool and body
charactristics for unselected rams. Aust. J. Agric. Res. 19: 825-835.
Buttler, L.G. (1981): Effect of sex and birth status on the wool folicle polpulation in unselected Corridale sheep.
Anim. Prod. 33: 67-70.
Carter, H.B. (1955): The hair follicle group in sheep. Anim. Breed. Abst. 23(2): 101-116.
Clarke, C., Roberts, G., Behrend, R., Marland, D. and Dolling, M. (1997): Quality management for wool
growers: Sheep Breeding and Selection. Ararar, DNRE, Victoria.
Dellman, H.D.(1993): Text book of veterinary histology. 4th ed .,Lea and Febiger, Philadelphia.USA. pp:285295.
Fayez, I., Marai, M. and Taha, A.H.(1976): Wool follicle characteristics in the Awassi fat-tailed sheep. Acta
Anat. 96(1): 55-69.
Gifford, D. R., Ponzoni, R. W., Anoell, M. C., Hynd, P. I., Walkley, R. W. and Grimson, R. J. (1995): Genetic
studies on wool quality and skin characters of Merino. Wool Technology and Sheep Breeding, 43(1): 2429.
Humason, G.L.(1979): Animal tissue techniques. 4th ed.,W.H.Freeman and Commpany, Sanfrancisco,USA.
pp:113-118.
Hynd, P. I. (1995): Skin and follicle-based selection for wool production and quality. Wool technology and sheep
breeding. 43: 15-23.
Junqueira, L.C. and Camerio.J.(2003): Basic histology. 10th ed, The McGraw-Hill Companies,USA.pp: 368381.
SAS Institute. (1998): SAS user’s guide. Rev. G. 04, SAS Institute, Cary, NC.
Stankov, I., Tjankov, S., Slavov, R. and Pamukova, D.(2004): Study of the histological structure of the skin of
lambs from aboriginal breeds in Bulgaria. Trakia journal of sciences. 2(2): 49-51.
176
Metabolic profile determination in calves from
different management in NW Spain
ODREĐIVANJE METABOLIČKOG PROFILA TELADI S RAZLIČITIH
UZGOJA SJEVEROZAPADNE ŠPANJOLSKE
Blanco-Penedo, I.1; López-Alonso, M.1; Miranda, M.2; Castillo, C.1, Hernández, J.1,
Prieto Montaña, F.3, Benedito, J. L.1
1
2
Universidade de Santiago de Compostela, Departamento de Patoloxía Animal, Facultade de Veterinaria,
27002 Lugo, Spain
Universidade de Santiago de Compostela, Departamento de Ciencias Clínicas Veterinarias, Facultade de
Veterinaria, 27002 Lugo, Spain
Universidad de León, Departamento de Patología Animal: Medicina, Cirugía y Anatomia Veterinaria. Facultad de Veterinaria, León, Spain
3
ABSTRACT
Blood biochemical parameters were used to identify constraints on farm type, geographical area and age in
beef-cattle in NW Spain. Blood samples (n = 199) of calves aged between 2 to 10 months and reared on farms
with different feeding strategies and management (intensive, organic, conventional) were collected during their
whole life cycle production. Levels of glucose (GLU), total serum protein (TP), urea (PUN), creatinine (CRE),
cholesterol (C), albumin (Alb), total billirrubin (TBIL), triglycerides (TG) and non-esterified fatty acids (NEFAs)
and activities of the liver specific enzymes aspartate transaminase (GOT), glutamate dehydrogenase (GLDH)
and creatin kinase (CK); were determined. In general all groups of calves presented safe blood metabolite ranges
according with references. The study of blood metabolites can help in understanding the peculiar features of
animals in many different physiological, environmental and management conditions in order to adjust farming
and feeding systems to animals needs. Feed ration must be appropriately constituted for ruminants in all the life
cycle and animal requirement should be covered to keep physiology balance on the animals.
Sažetak
Krvni biokemijski parametri korišteni su u određivanju stupnja obuzdanosti tovnih goveda u sjeverozapadnoj
Španjolskoj, u različitim farmskim uvjetima, zemljopisnim područjima i dobi. Uzorci krvi (n=199) teladi, u
dobi od 2 do 10 mjeseci, držanih na farmama sa različitim hranidbenim protokolima i uzgojem (intenzivni,
organski, uobičajeni) uzimani su tijekom cijelog proizvodnog ciklusa. Određivane su razine glukoze (GLU),
ukupnih serumskih bjelančevina (TP), ureje (PUN), kreatinina (CRE), kolesterola (C), albumina (Alb), ukupnog
bilirubina (TBIL), triglicerida (TG), neesterificiranih masnih kiselina (NEFA) te aktivnosti specifičnih jetrenih
enzima aspartat transaminaze (GOT), glutamat dehidrogenaze (GLDH) i kreatin kinaze (CK). Sveukupno
gledajući, sve skupine teladi imale su normalne razine krvnih metabolita, u skladu s referentnim vrijednostima.
Analiza krvnih parametara može pomoći u shvaćanju osobitosti životinja u različitim fiziološkim okolišnim
i uzgojnim uvjetima kako bi se sustavi držanja i hranidbe prilagodili potrebama životinja. Obroci krmiva za
preživače moraju biti prikladno sastavljeni u svim životnim ciklusima. Moraju se zadovoljiti životinjske potrebe
kako bi se održala fiziološka ravnoteža životinja.
INTRODUCTION
Animal welfare is becoming essential for achieving an integrated animal health, that implies
a good quality of life and the possibility to perform a natural behaviour getting feed suitable to its
177
physiology (Lund, 2006; Haas et al., 2007). This is one of the goals of organic farming approach,
where ruminant diet should be based on locally or in-farm produced forage with a low concentrate
feed-supplementation (IFOAM, 2002).
It is well assumed that grazing offers a quality of diet to cover cattle and calf requirements
when these are well matched with grass growth (Andrews, 1991; Bengtsson et al., 2003). In fact,
the nutritional value of well-managed grass is high and on good quality pasture a cow’s welfare can
be maintained with low levels of concentrate supplementation or even none (Kennedy et al., 2006).
However, during seasonal deficiencies, the limited feed stuffs can cause imbalances in the diets
(Sundrum, 1997) expecting to have negative effects on animals if it causes an increasing mobilisation
of body reserves and a more negative energy balance (Buttler and Smith, 1989). In this respect,
there is a conflict in the basic organic ideology between the aim of good individual animal health
and welfare versus environmental concerns and food safety. During such situation, supplemental
or replacement feeding is necessary to meet production goals (Mathis and Sawyer, 2007), so, the
supplementation of organically grazing cattle can be used to fill the gaps and provide nutrients that
are inadequate or missing in the forage (Loy, 2007).
In conventional farms supplementary extra concentrate feeding is routinely given to achieve
an economic production level, even tough when the quality (and quantity) is high. Nevertheless,
this concentrate feed supplementation can be uneconomic if the supply of good quality pasture is
sufficient to meet herd demand and the increased concentrate mostly substitutes grass.
On the opposite situation than organic and conventional farming are intensive production systems
where diets are based on high levels of concentrate feed without any grazing. In regards to nutrition,
the main energy source for calves fed with a high-concentrate feed is non-structural carbohydrates
(NSC) instead fibber from pasturage in grazing cattle. With the introduction of cereal grains into the
diet, the principal substrates for microbial fermentation are no longer slowly digested plant-cellwall components (e.g. cellulose and hemicellulose), but rather rapidly digested starch. Consequently,
these diets often induce unstable fermentation conditions that favour the accumulation of acids in
the rumen and lead to ruminal dysfunction (Owens et al., 1998). The excessive production of acid in
the rumen is often either the cause of or a significant contributing factor to metabolic and nutritional
disorder in feedlots. It is known that decreasing the percentage of highly fermentable concentrates
in feedlot diets by increasing roughage level or limiting feed intake should decrease the incidence of
these disorders (Galyean and Rivera, 2003).
It has been stated that the study of blood metabolites can help in understanding the peculiar
features of animals in many different physiological, environmental and management conditions in
order to adjust husbandry and feeding practices to animals needs (Grasso et al., 2004). In connection
with this, blood chemistry can give us such information on many metabolic processes and the welfare
of the animal which otherwise would be difficult or impossible to know due to subclinic courses
(Mannimen et al., 2007). The aim of this study is to determine the influence of different management
and feed practices (organic, conventional and intensive) on blood parameters in beef-cattle in NW
Spain.
Farm selection. Livestock practices are highly standardised in intensive beef-cattle farms in NW
Spain; basically the feed ration consists of a high-grain diet based on 80-90% concentrate (ca. 16
%CP-DM basis and 5-8 %CF-DM basis) and 10-20% of roughage with an indoor management. On
conventional and organic farms, on the contrary, milk intake dominates calf performance in the first
178
3 months; during the growing phase (3-6 months) calves were fed with ryegrass/clover pasture with
different rotation on each farm, milk and a small percentage of concentrate and the based finishing
diets is roughage (fresh grass or harvested) and concentrate (5-30%).
Farm selection was made in the districts of Baralla (latitude 42º52´, longitude 7º23), Montederramo
(latitude 42º16´, longitude 7º30´) and Vilalba (latitude 43º18´, longitude 7º40´). In each district, an
organic, conventional and intensive farm located in the neighbourhood were selected, finding farms
and conditions that were similar in other respects for the comparison. All the components of the diet
were in according to the practices and legislation of each system.
Sample collection. Blood samples were collected during one year corresponding to whole life
cycle of calves with age-range from 2 to 11 months. All blood samples (10 ml approximately) were
taken from the jugular vein using heparinised vacutainer tubes. Serum was obtained by centrifugation
(3,000 g for 15 minutes) of clotted samples within 6 hours after collection. Three aliquots of serum
were stored in acid-washed (10% nitric acid) tubes at -20ºC until analyzed, except enzymatic
determinations which were refrigerated and analyzed within 7 hours after collection.
Weight of carcass were collected when the animals were slaughtered.
Sample analysis. Glucose (GLU), total serum protein (TP), urea (PUN), creatinine (CRE),
cholesterol (C), albumin (Alb), total billirrubin (TBIL), triglyceride (TG), were determined by
enzymatic-colorimetric methods, employing standards kits (Spinreact Laboratories, Spain; Human
HR Laboratories, Germany; Gernon Laboratories, Spain). Serum non-esterified fatty acids (NEFAs)
was assayed by an enzymatic technique using a standardized method (Randox Laboratories, United
Kingdom). Activities of the liver specific enzymes aspartate transaminase (GOT), glutamate
dehydrogenase (GLDH) and creatin kinase (CK) were measured in serum by using commercial
diagnostic kits (Gernon Laboratories, Spain).
Data analysis.All statistical analyses were done using the program SPSS for Windows (v.15.0).
Normal distribution of data was checked using Kolmogorov-Smirnov test. Analysis of variance
(general linear model) was used to evaluate the influence of type of farm (intensive, organic,
conventional), zone (Baralla, Montederramo, Vilalba), and age on the metabolic profiles in calves;
with farm, zone as fixed-effect factors and age (in months) as a covariate. Tukey´s honest significant
difference (HSD) test were used to determine the significance of differences in the metabolic profile
between farm type and zone. Pearson rank correlation was used to analyse the relationship between
metabolic parameters concentrations and proportion of concentrate on the ration and weight carcass.
In all analyses statistical significance was taken to be indicated by p<0.05.
Blood metabolic parameters assessed in calves from intensive, organic and conventional farms
in this study are presented in Table 1. Most of the calves in all farms were within physiological
limits. The concentrations of glucose were little higher than the range described by Kaneko et al.
(1997), Radostits et al. (2002) and Smith (2007) for this specie (45-75 mg/dL) and similar than
previously reported for grazing and housing beef calves by Aoki et al. (2006) and Doornenbal et al.
(1988) for beef calves. Total serum protein, urea and creatinine levels in our study were within the
ranges described by Kaneko et al. (1997), Radostits et al. (2002) and Smith (2007). Mean Alb levels
registered on this study were within the range described by Kaneko et al. (1997) for this specie (4-4.4
mg/dL). All triglycerides levels assessed on this study were higher than the range described (0-14
mg/dL) by Kaneko (1997) and similar than those previously reported by Arai et al. (2006) for calves.
Cholesterol levels were on the range described by Radostits et al. (2002) for this specie (65-220
179
mg/dl). All the groups presented levels of total billirrubin within the reference levels (Radostits et al.
2002; Smith, 2007). NEFAs were within the range described for this specie (0-0.6 mmol/L; Radostits
et al.; 2002). In relation with hepatic enzymes, GLDH and CK were within the references levels of
our laboratory. GOT levels were lower than the references levels for this specie (Kaneko et al., 1997)
but similar than previous studies for calves (Gregory et al., 1999; Castillo et al., 2008).
Table 1. Metabolic parameters in calves from this study.
Glucose (mg/dL)
Total Protein (g/dL)
Urea (mg/dL)
Creatinine (mgdL)
Triglycerides (mg/dL)
Cholesterol (mg/dL)
Albumin (mg/dL)
Total Bilirubin (mg/dL)
Nonesterified fatty acids
(mEq/mL)
Glutamate
dehydrogenase (UI/L)
Aspartate
aminotransferase (UI/L)
Creatine kinase (UI/L)
N
199
199
199
199
199
199
199
199
Media
87.2
6.98
22.1
1.16
27.5
129
4.09
0.412
GSE
(85.7-88.5)
(6.93-7.03)
(21.8-22.4)
(1.15-1.17)
(26.9-28.1)
(128-131)
(4.09-4.10)
(0.407-0.416)
Median
85.4
6.95
21.4
1.18
26.6
126
4.1
0.4
Minimum
45.8
5.56
8.13
0.74
15.4
77.9
3.55
0.28
Maximum
157.6
9.84
33.7
1.61
72.9
193
4.45
0.66
CV
22.1
10.4
20.9
13.4
31.2
16.8
2.67
15.7
185
0.389
(0.385-0.394)
0.39
0.26
0.53
15.5
132
7.07
(6.98-7.15)
7.19
5.16
9.05
13.4
188
188
35.6
133
(34.9-36.2)
(131-134)
33.4
138
19.9
87.3
54.2
160
24.6
13.6
Table 2. Results of the general linear model analysis of metabolic parameters with factors zone and farm type
and the covariate age.
GLU
TP
PUN
CRE
TG
C
Alb
TBIL
NEFAs
GLDH
GOT
CK
R2
0.132
0.161
0.032
0.078
0.040
0.105
0.012
0.123
0.014
0.057
0.783
0.357
Age
F(1,199)=0.885
F(1,199)=0.313
F(1,199)=0.094
F(1,199)=2.124
F(1,199)=2.114
F(1,199)=0.325
F(1,199)=0.051
F(1,199)=0.177
F(1,185)=0.545
F(1,132)=0.957
F(1,188)=3.761
F(1,188)=78.12***
Farm
F(2,199)=1.242
F(2,199)=11.16***
F(2,199)=1.531
F(2,199)=5.721**
F(2,199)=1.225
F(2,199)=5.281**
F(2,199)=0.066
F(2,199)=9.274***
F(2,185)=0.299
F(2,132)=0.938
F(2,188)=275***
F(2,188)=0.084
Zone
F(2,199)=3.389*
F(2,199)=2.207
F(2,199)=1.278
F(2,199)=0.855
F(2,199)=0.521
F(2,199)=0.518
F(2,199)=0.093
F(2,199)=0.489
F(2,185)=0.025
F(2,132)=1.099
F(2,188)=1.734
F(2,188)=0.132
Interactions
F(4,199)=4.423**
F(4,199)=2.744*
F(4,199)=0.132
F(4,199)=0.523
F(4,199)=0.640
F(4,199)=2.780*
F(4,199)=0.411
F(2,199)=2.819*
F(4,185)=0.281
F(4,132)=0.075
F(4,188)=0.587
F(4,188)=0.142
The results of the general linear modelling to determine if the type of farm (intensive, organic,
conventional) in the different zones (Baralla, Montederramo, Vilalba) was a significant source of
variation in metabolic profiles of calves in this study are presented in Table 2. Significant interactions
between type of farm and zone were observed for glucose, total serum protein, cholesterol and total
billirrubin concentrations, which indicates that variation of these metabolites in calves in our study
showed a different behaviour by farm in the different zones, and for this reason is not possible to
180
CRE
1,24
1,22
1,2
1,18
1,16
1,14
1,12
1,1
1,08
1,06
1,04
1,02
int
GOT
Org
Conv
50
45
40
35
30
25
20
15
10
5
0
int
Org
Conv
Figure 1. Effect of farm on CRE and GOT concentrations on calves from intensive, organic and conventional
farms.
establish a common metabolic pattern related to the farming type. Zone by itself was not a significant
factor for any of the parameters analysed in this study Type of farm was a significant factor in
the analysis for creatinine (p<0.01) and GOT (p=0.000). Significantly lower creatinine levels were
observed in calves from organic farms (7%) compared to the other groups (Figure 1). The significant
differences among organic and conventional or intensive groups for creatinine probably are indicative
of differences on muscle mass due to the origin of the amount of creatinine released on blood that
is the striated muscle (Doornenbal et al.; 1988); in fact, significant correlations were found between
creatinine levels vs percentage of concentrate on the ration (p=0.004) and between creatinine levels
vs. the weight of the carcass (Rs=0.163, p=0.021). With regard to GOT activity, significantly higher
enzymatic activities were found in intensive farms (151-155 %; p=0.000) compared to the other
181
groups. Mori et al. (2007) pointed out higher levels of GOT on beef calves fed on larger amount
of concentrate diet than fed on pasture, and may indicate slight liver damage by slightly acidotic
conditions associated to diet, as a consequence of accelerated function of liver for more nutrients
metabolism. Furthermore, as it was mentioned before, the source of energy on concentrate (NSC) is
a significant contributing factor to metabolic disorders in feedlot (Galyean and Rivera, 2003). These
pronounced higher concentrations of GOT on intensive farms could be explained for the higher
demand on hepatic metabolism fed with a high-concentrate feed, for this reason, higher activity
of this enzyme was positive strongly correlated with higher percentage of concentrate on the diet
of calves of our study (Rs=0.730, p=0.000). A significant effect of age on calves as a covariate in
the analysis was observed on CK activity, a downward trend on CK levels being observed with the
progress of the age (p=0.000) in all groups (Figure 2).
CK
CK (UI/l)
(UI/l)
180
160
140
120
100
80
60
40
20
0
2
3
4
5
6
7
8
9
10
age ((months
months )
Figure 2. CK downtrend progress with the age of calves of our study.
CONCLUSIONS
Our results indicate that feeding practices is the factor that projects the bigger differences on
the metabolic profiles of calves for different farm systems in our study. These results may represent
a useful tool for the improvement on the formulating diets and the prevention of possible disorders
conditioned for the diet and followed by the management.
REFERENCES
Andrews, T. (1991). Suffering animals in a green landscape? Dairy Farmer 38, 26-28.
Aoki, Y.; Nakanishi, N.; Yamada, T. (2006). Basal levels and responses to glucose infusion of plasma glucose
and insulin in beef steer before and after the end of the growing phase on pasture. Anim. Sci. J. 77: 338346.
Arai, T.; Tanaka, Y.; Urabe, S.; Kusaba, A.; Tazaki, H., Ozawa, T.; Kimura, N.; Jung, K.; Waragaya, K.; Yuyama,
T.; Haseba, Y.; Imai, S. (2006). Changes in peripheral leukocytes enzymes activity and plasma metabolite
concentrations in growing Holstein calves. Res. Vet. Sci. 81: 19-23.
182
Bengtsson, H.; Öborn, I.; Jonsson, S.; Nilsson, I.; Andersson, A. (2003). Field balances of some mineral nutrients
and trace elements in organic and conventional dairy farming—a case study at Öjebyn, Sweden. Eur J
Agron 20:101-116.
Buttler, W.R:; Smith, R.D. (1989). Interrelationships between energy balance and postpartum reproductive
function in dairy cattle. J. Dairy Sci. 72: 767-783.
Castillo, C.; Benedito, J.L., Pereira, V.; Méndez, J.; Vázquez, P.; López-Alonso, M.; Hernández, J. (2008).
Effects of malate supplementation on acid-base balance and productive performance in growing/finishing
bull calves fed a high-grain diet’, Arch. Anim. Nutr. 62(1): 70 - 81
Doornenbal, H.; Tong, A.K.W.; Murray, N.L. (1988). Reference values of blood parameters in beef cattle of
different ages and stages of lactation. Can J Vet Res 52: 99-105.
Galyean, M.L. and Rivera, J.D. (2003). Nutritionally related disorders affecting feedlot cattle. Can J Anim Sci
83(1): 13-20.
Grasso, F.; Terzano, G.M.; De Rosa, G.; Tripaldi, C.; Napolitano, F. (2004). Influence of housing conditions and
calving distance on blood metabolites in water buffalo cows. Ital. J. Anim. Sci. 3: 275-282.
Gregory, L.; Birgel, E.H.; Mirándola, R.M.S.; Araujo, W.P.; Birgel, E.H. (1999). Valores de referencia da
actividade enzimática da aspartato-aminotrasnferase e da gama-glutamiltrasnferase em bovinos de raça
Jersey. Influencia dos fatores etários, sexuais e da infecçao pelo virus da leucose dos bovinos. Arquivo
Brasileiro de Medicina Veterinaria e Zootecnia 51(6).
Haas, G.; Deittert, C.; Köpke, U. (2007). Impact of feeding pattern and feed purchase on area- and cow-related
dairy performance of organic farms. Livest. Sci. 106: 132-144.
IFOAM, 2002. IFOAM Norms. II. IFOAM Basic Standards for organic production and processing. International
Federation of Organic Movements, Tholey-Theley, Germany. (http://www.ifoam.org/standard/norms/ibs.
pdf).
Kaneko, J.J.; Harvey, J.W.; Bruss, M.L. (1997). Clinical biochemistry of domestic animals. 5th ed. Ed. Academic
Press, Orlando.
Kennedy, E.; O´Donovan, M.; Murphy, J.P.; Delaby, L.; O´Mara, F. (2006). Effects of grass pasture and
concentrate-based feeding systems for spring-calving dairy cows in early spring on performance during
lactation. Grass Forage Sci. 60(3): 310-318.
Loy, D. (2007). By-product feed utilization by grazing cattle. Vet. Clin. North Am. Food Anim. Pract. Mar
23(1):41-52.
Lund, V. (2006). Natural living- a precondition for animal welfare in organic farming. Livest. Sci. 100, 71-83.
Mannimen, M.; Sankari, S.; Jauhiainen, L.; Kivinen, T.; Soveri, T. (2007). Insulated, uninsulated and outdoor
housing for replacement beef heifers on restricted grass silage-based diet in a cold environment. Livest.
Sci. 107, 113-125.
Mathis, C.P.; Sawyer, J.E. (2007). Nutritional management of grazing beef cows. Vet. Clin. North Am. Food
Anim. Pract. Mar 23 (1):1-19.
Mori, A.; Urabe, S.; Asada, M.; Tanaka, Y.; Tazaki, H.; Yamamoto, I.; Kimura, N.; Ozawa, T.; Morris, S. T.;
Hickson, R.; Kenyon, P. R.; Blair, H.; Choi C. B.; Arai, T. (2007): Comparison of plasma metabolite
concentrations and enzyme activities in beef cattle raised by different feeding systems in Korea, Japan and
New Zealand. J. Vet. Med. Ser. A 54, 342-345.
Owens, F.N., Secrist, D.S., Hill, W.J., Gill, D.R. (1998). Acidosis in cattle: A review. J. Anim. Sci. 76, 275286.
Radostits, O.M.; Gay, C.C.; Blood, D.C.; Hinchcliff, K.W. (2002). Veterinary Medicine: a Textbook of the
Diseases of Cattle, Sheep, Pig, Goats and Horses. Ed. WB Saunders Company, London.
Smith, B.P. (2007). Large Animal Internal Medicine. 3 ed. Ed. Mosby.
Sundrum, A. (1997). Assessing animal welfare standards of housing conditions-possibilities and limitations. In:
Sörensen, J., Livestock Farming Systems. More than Food Production. EAAP, Publ. 89:238-246.
183
184
A field outbreak of Aflatoxicosis with high fatality
rate in feedlot calves in Tehran Province - Iran
IZBIJANJE AFLATOKSIKOZE S VISOKOM STOPOM SMRTNOSTI U
TELADI UZGAJANIH U ZABRANU PROVINCIJE TEHERAN U IRANU
Tooloei, M.1 Nadalian, M.1, Khosravi, A.2, Helan, J. A.3, Najafie, R.4
Department of Clinical Science, Faculty of Veterinary Medicine, University of Tabriz, Iran
1
2
Department of Mycology, Faculty of Veterinary Medicine, University of Tehran, Iran
Department of Pathbiology, Faculty of Veterinary Medicine, University of Tabriz, Iran
3
Doctor of Veterinary Medicine
4
Corresponding author ’s E-mail: [email protected]
Abstract
Aim of the study: To identify a deathly problem of feedlot calves in a farm and to treat it. Background:
Aflatoxicosis is caused by the aflatoxins and is the most important disease due to the ingestion of the feed
contaminated with Aspergillus spp. especially A.flavus, A.parasiticus and some specious of Penicillium.
AflatoxinB1, a hepatotoxic metabolite, is the most important in the pathogenesis of the disease. All animal
species are susceptible, but outbreaks occur mostly in cattle, sheep and pigs. Hepatosis and hepatic insufficiency
are the principle effect, but mutagenic and teratogenic effects are recorded. Material and Methods (case
report): In January 2007, several stall-fed calves from a farm at the suburb of the Goum city in Iran were
examined. The farm had approximately 200 crossbreed and Holstein calves. The calves were suffering from
chronic diarrhea, and about 35 calves had died during 4 months. Different antibiotics such as OTC, penicillin,
lincospectin and … had been administered by farmers but there were any responses. In the clinical examination
of the about 20 affected calves, the following signs were found: anorexia, weight loss, mild to severe chronic
diarrhea, dysentery, severe tenesmus, rough hair cout, fever (until 40 °c), braxism, bradycardia (40-50 bit per
min.), hyperpnoea, blindness, keratoconjunctivitis, ataxia and falling. Terminally recumbence and death were
followed by convulsions. All breeds had affected but 5-8 months old Holstein calves were most susceptible. At
the inspection of the environment and the feed, the sunflower cake, with abnormal smell and appearance (dark
color and slightly mouldy smell) were found as a part of the calves feed. The animals were feed with the cake
from 6 months ego. Blood samples were obtained from 3 affected calves for hematological and serological
examinations. The mycological tests were applied on the cake sample and the calf’s serums. Results.At
the necropsy of the two died calves, swelling of the liver and kidneys, mild enteritis, as well as
thickening and parakeratosis – like lesions of the ruminal walls, were observed. Neutrophilia and
monocytosis were found at the hematological examination. The levels of the SDH, ALP and SGOT
in the calf’s serums had been increased. Serological examinations for detection of the leptospira and
BVD antibodies were negative. Toxicogenic specious of the aspergillus (mainly A. flavus) grew in
the culture of the cake specimen. Aflatoxins B1 were demonstrated in the cake and serum samples.
Histopathologic examination revealed congestion, zonal (periacinar) hepatocellular necrosis, fatty
change and severe megalocytosis in the liver. Severe congestion and acute focal tubulointerstitial
nephritis were present in the kidney. Conclusions: The diagnosis of Aflatoxicosis was confirmed
by the evaluation of the clinical, hematological, serological and mycological findings as well as
histopathologic changes. Providing of aflatoxin- free feed to all animal and therapy for liver failure
in affected calves prevented further clinical cases.
Key words: Aflatoxicosis, feedlot calves, Tehran
185
Sažetak
Cilj istraživanja bio je utvrditi uzrok smrtnosti teladi na farmi te izliječiti bolesne. Aflatoksikoza se razvija
prilikom uzimanja hrane kontaminirane toksinima vrste Aspergillus (pogotovo A. Flavus, A. Parasiticus) i
nekim vrstama Penicilliuma. Aflatoksin B1, hepatotoksični metabolit najbitniji je u patogenezi bolesti. Primljive
su sve vrste domaćih životinja, ali se epizootije najčešće javljaju u goveda, ovaca i svinja. Iako su hepatoze i
zakazivanje jetre najčešća poslijedica, opisane su pojave mutagenih i teratogenih učinaka. Materijal i metode
(opisani slučaj): U siječnju 2007. g. Pregledali smo nekoliko teladi iz štalskog uzgoja okolice grada Gouma. Na
farmi je držano cca 200 križanih i Hollstein teladi. Telad je patila od kroničnog proljeva, a tijekom četiri mjeseca
uginulo je 35-oro teladi. Različiti antibiotici kao OTC, Penicilin i Linkospektin prepisivani su stočarima, ali
nije uočena pozitivna reakcija na terapiju. Kliničkim pregledom 20 oboljele teladi uočeni su slijedeći simptomi:
anoreksija, gubitak težine, blaga do ozbiljna kronična dijareja, dizenterija, tenezam, ogrubljela dlaka, febra (do
40oC), braksizam, bradikardija (40-50 udaraca bila u minuti), hiperpneja, sljepilo, keratokonjunktivitis, ataksija
i padanje. Terminalni stadij bolesti bio je obilježen konvulzijama i uginućem. Bolest zahvaća sve pasmine, no
telad Hollsteina u dobi od 5 do 8 mjeseci bila je klinički najsumnjivija. Pregledom držanja i hranidbe, u krmi
su uočene suncokretove pogače sumnjiva izgleda i mirisa (tamna boja i memljiv miris). Životinje su hranjene
tom hranom kroz proteklih šest mjeseci. Uzeti su krvni uzorci tri oboljela teleta za hematološku i serološku
analizu. Na krvnim uzorcima i uzorcima suncokretove pogače učinjene su mikološke pretrage. Rezultati:
Sekcijom dva uginula teleta uočena su otečenja jetre i bubrega, blagi enteritis, kao i parakeratoza i zadebljanje
buražne stijenke. U serumu je uočena neutofilija i monocitoza. Razine SHH, ALP i SGOT u serumu su porasle.
Serološkom pretragom nisu dokazana antitijela za leptospirozu i BVD. Toksogeni sojevi aspergilusa (uglavnom
A. Flavus) izolirani su iz svih uzoraka suncokretove pogače. Aflatoksin B1 je uočen u svim uzorcima pogače
i seruma. Histološkom pretragom utvrđene su kongestija jetre, zonalna hepatocelularna nekroza, omašćenje i
znatna megalocitoza. Također su uočeni značajno otečenje bubrega, fokalna tubulointersticijalna upala bubrega.
Zaključci: Dijagnoza aflatoksikoze potvrđena je vrednovanjem kliničkih, hematoloških, seroloških i mikoloških
nalaza, kao i histopatoloških promjena. Opskrba oboljele teladi hranom slobodnom od aflatoksina i terapijom
insuficijentne jetre spriječili smo pojavu novih slučajeva bolesti.
Ključne riječi: aflatoksikoza, telad u zabrani, Teheran
Introduction
Aflatoxicosis is caused by the aflatoxins and is the most important disease due to the ingestion of
the feed contaminated with Aspergilus spp. especially A.flavus, A.parasiticus and some specious of
Penicillium. Aflatoxins (AF) include AFB1, B2, G1, G2, M1 and M2 which related chemically to and
probably derived from dicoumarin compounds.(1,12,3) Other important toxins produced by the fungi
include Ochratoxin, Patulin and Sterigmatocystin.(2,1,12) A great deal of aflatoxin ingested in the
feed by cattle is physically bound to ruminal content and as little as 2 to 5% reaches the intestine(3).
AFB1, a hepatotoxic metabolite, is the most important in the patogenesis of the disease. Level of
AFB1 in excess of 100 µg/kg of feed are considered to be poisonous for cattle(12). Aflatoxicosis
has been reported in most country and on many feeds such as: peanuts, cottonseed meal, sorghum
grain, corn, sweet corn and moldy bread(4,6,12) The mycotoxin (AF) is not destroyed by milling of
the grain. All animal species are susceptible, but outbreaks occur mostly in cattle, sheep and pigs.
3-6 months old calves are the most susceptible animals. Pregnant and growing cattle are also more
susceptible than adults. The disease has public health importance due to excretion of the toxin into the
cows’ milk in the form of AM1 and present in meat of animals eating contaminated feed which can
cause the human hepatocellular carcinoma. The toxin residues in the milk are approximately equal to
1-2% of the dietary level.(13) A maximum level of 0.5 ppb of the aflatoxin is permitted in bulk tank
milk. Hepatosis - hepatic insufficiency and renal damages are principle effects of the mycotoxin, but
mutagenic, carcinogenic and teratogenic effects through binding to DNA and protein to form adducts,
development of monoclonal antibodies and mutational specificity of the genotoxic compounds have
186
also been recorded. Role of AFB1 in the etiology of nasal tumors in cattle through Bioactivation of
the toxin in the bovine olfactory mucosa and consequently DNA binding, mutagenicity and induction
of sister chromatid exchanges have been demonstrated.(5,14) The nasal olfactory mucosa has a
much higher capacity than the liver to form lipid-soluble, water-soluble and tissue-bound AFB1metabolites because of the differences in the cytochrome P-450 isoenzymes. Hemorrhagic disease
with increased prothrombin time, depression of the immune system functions and impaired protein
formation and coagulation are the other recorded effects of the toxicosis. Effects of aflatoxin ingestion
on the development of Moraxella bovis infectious bovine keratoconjunctivitis(11) and on absorption
of zinc (7,17) through the intestine have been also discussed.
In cattle clinical signs include: anorexia and weight gains, blindness, walking in circles, ear
twisting, braxim, frothing at the mouth, diarrhea and dysentery, sever tenesmus and anal prolapse,
abortion, phothsensetive dermatitis, staring hair coat, keratoconjunctivitis, hemorrhagic disease,
convulsion, recumbency and death. (15) The disease is confirmed by detection of AFs in feed
materials, blood, urine and liver and measurement of serum hepatic enzymes. AFs in Feed materials
may be detected by Black light and Chromatography techniques including thin-layer chromatography
(TLC), gas-liquid chromatography (GLC) and high-pressure liquid chromatography (HPLC) as
well as serological methods such as ELISA and immunoaffinity chromatography. Grain infected
with Aspergillus flavus produces a compound called Kojic acid, which characteristically produces a
greenish-yellow fluorescence when examined in a dark room under long-wave ultraviolet light (black
light). Symptomatic treatment of hepatic insufficiency, administration of a broad-spectrum antibiotic
to prevent of secondary infections, detoxification of aflatoxin by phyllosilicate clay (10) and hydrated
sodium calcium aluminosilicate(9), avoiding of the other types of stress as well as providing of a
clean uncontaminated (toxin-free) medium-to high-energy protein feed help to improve the disease.
The aim of the study was to identify the causative agent of death of feedlot calves in a farm and to
resolve the problem.
Material and Methods (Case history)
In January 2007, several stall-fed calves from a farm at the suburb of the Goum city in Iran were
examined. The farm had approximately 200 crossbreed and Holstein calves. The calves were suffering
from chronic diarrhea, and about 35 calves had died during 4 months ego. Different antibiotics
such as OTC, trimetoprim, penicillin and lincospectin had been administered by farmers but there
were any responses. In the clinical examinations of about 20 affected calves, the following signs
were found: anorexia, weight loss, mild to severe diarrhea, dysentery, fever (up to 40°c), braxism,
bradycardia (40-50 bit per min), hyperpnoea, blindness, keratoconjunctivitis, ataxia and falling.
Terminally recumbency and death were followed by convulsions. All of the breeds were affected but
5-8 months old Holstein calves were most susceptible. At the inspection of the environment and the
feed, the sunflower cake, with abnormal smell and appearance (dark color and slightly moldy smell)
were found as a part of the calves feed. The animals were feed with the cake from 6 months ego.
Ten and three ml of blood samples were obtained from jugular veins of three affected calves for
haematological and serological examinations, respectively. Haematological tests such as total cell
blood count and differentiated count were achieved by standard procedures. Level of the serum SDH,
ALP and SGOT were evaluated through biochemical enzymatic colorimetric kit.
Mycological evaluations were applied on the sunflower meal samples and the calves' serums
so that meal samples cultured on SGA medium and both of serum and the meal samples were
187
analyzed for Aflatoxins B1 by standard sandwich Elisa- Gibco co. The sera were also analyzed for
anti leptospiral and anti bovine viral diarrhea virus antibodies by Microscopic Agglutination Test and
Pestivirus Kit Elisa Morden UK, respectively.
Results
At the necropsy of the two died calves, slightly swelling of the liver and kidneys, mild enteritis,
as well as thickining and parakeratosis–like lesions on the ruminal walls were observed.
Neutrophilia( 42, 51 and 73%) and monocytosis (5, 7 and 3%) were found at the hematological
examination. the level of serum ALP and SGOT had been increased and were ~540 u/l and ~420u/l,
respectively. Anti leptospiral and Bovine Viral Diarrhea disease antibodies were not detected by the
serological studies. Fig 1 and 2 show the toxicogenic specious of the aspergillus (mainly A. flavus)
which grew in the culture of the cake specimen on SGA medium and microscopic view of Aspergillus
flavus, respectively.
Fig 1: Powdered or granular appearance colonies of Aspergillus flavus which have grew in the culture of the
infected meal samples on SGA medium. The colonies were Wight color in first time and intense yellow to yellow – green color at the time of spore production.
Fig 2: Microscopical views of Aspergillus flavus. Thick-walled, coarsely roughened long conidiophores. Globose and fertile vesicle. Biserata or uniserata phialiders
188
Fig 3: Fatty changes in liver. Small and large fatty vacuoles within the hepatocytes. (H& E Staining, Magnification ×40)
Fig 4. Fatty changes in liver. small and large fatty vacuoles within the hepatocytes (H& E Staining, Magnification ×1000)
Fig 5: Severe megalocytosis in the liver. enlargement of cytoplasm and nuclei of the hepatocytes due to the
inhibitory effects of aflatoxins on cell division especially division of nucleus. (H& E Staining, Magnification
×1000)
189
flatoxin B1 were demonstrated in the meal and serum samples. The sunflower meal was infested
with A.flavus and contained AFB1 with total levels as high as160 ppm.
Histopathologic examination revealed congestion, zonal (periacinar) hepatocellular necrosis,
severe fatty change and megalocytosis in the liver (fig3to5). Severe congestion and acute focal
tubulointerstitial nephritis were present in the kidney. Discussion and Conclusion
The diagnosis of Aflatoxicosis was confirmed by the evaluation of the clinical, hematological,
serological and mycological examination as well as histopathologic findings. In this outbreak,
similar to the other reports (8,3), 5-8 months old Holstein calves were most affected animals with
aflatoxicosis. Clinical signs in the affected calves such as: anorexia, weight loss, mild to severe
diarrhea, dysentery, fever (up to 40°c), braxism, blindness, keratoconjunctivitis, ataxia, falling
and terminally convulsive recumbency and death were also similar to signs reported in the other
world surveys(16,13,15). With attention to the young calves suffering from chronic diarrhea and
eye problems as well as renal lesions the animals tested to anti BVD-MD virus and anti leptospiral
antibodies, respectively but they were not detected by the serological studies. Mycological findings
such as growing of toxicogenic specious of the aspergillus (mainly A. flavus) in the culture of the
meal specimen on SGA medium, and detection of Aflatoxin B1 in the meal samples as high as160
ppm and sera as well as histopathological finding such as hepatic lesions especially severe fatty
change and megalocytosis in the liver confirmed occurrence of aflatoxicosis in the calves. Only by
providing of aflatoxin- free feed to all animal and therapy for liver failure in affected calves such as
infusion of 5%dextrose solutions prevented further clinical cases during approximately 30 days
Acknowledgements
The authors would like to thank Miss Hashemian M., the employee of University of Tehran in Veterinary
Mycological department for her kindly help in the mycological evaluations.
References
1. Andrews, A.H., Blowy, W., Boyd, H. and Eddy, R.G. (2003) Bovine medicine. 2th ed. Blackwell science,
Oxford . PP:933-4.
2. Blood, D.C., Studdert, V.P. (2000) Bailliers comparative veterinary dictionary. Baillier Tindall, WB Saunders.
3th edd. Pp: 75.
3. Colvin, B M; Harrison, L R; Gosser, H S; Hall, R F (1984) Aflatoxicosis in feeder cattle, JAVMA, 184 (8):
956-958.
4. Hall, R F; Harrison, L R; Colvin, B M (1989) Aflatoxicosis in cattle pastured in a field of sweet corn, JAVMA,
194 (7): 938.
5. Larsson, P; Pettersson, H; Tjälve, H (1989) Metabolism of aflatoxin B1 in the bovine olfactory mucosa,
Carcinogenesis, 10 (6): 1113-1118.
6. McKenzie, R A; Blaney, B J; Connole, M D; Fitzpatrick, L A (1981) Acute aflatoxicosis in calves fed peanut
hay, Aust. Vet. J., 57 (6): 284-286.
7. Neathery, M W; Moos, W H; Wyatt, R D; Miller, W J; Gentry, R P; George, L W (1980) Effects of dietary
aflatoxin on performance and zinc metabolism in dairy calves, J. Dairy Sci. 63 (5): 789-789.
8. Osweiler, G D; Trampel, D W (1985) Aflatoxicosis in feedlot cattle, JAVMA.187 (6): 636-637.
9. Phillips, T D; Clement, B A; Kubena, L F; Harvey, R B (1990) Detection and detoxification of aflatoxins:
prevention of aflatoxicosis and aflatoxin residues with hydrated sodium calcium aluminosilicate, Vet. And
Hum. Toxicol. 32, Supp.: 15-19.
190
10. Phillips, T D; Sarr, A B; Grant, P G (1995) Selective chemisorption and detoxification of aflatoxins by
phyllosilicate clay, Natural Toxins, 3(4): 204-213
11. Pugh, G W, Jr; Richard, J L; Kopecky, K E; McDonald, T J (1984) Effects of aflatoxin ingestion on the
development of Moraxella bovis infectious bovine keratoconjunctivitis, The Cornell Veterinarian, 74 (2):
96-110.
12. Radostitis, O.M., Gay, C.C., Hinchcliff, K.H. and Constable, P.D. (2007) Veterinary medicine. 10th ed.,
Saunders Elsevier, London. PP: 1624,1687-1689, 1698.
13. Robens, J F; Richard, J L (1992) Aflatoxins in animal and human health, Reviews of Environmental
Contamination and Toxicolo. 127: 69-94.
14. Tjälve, H; Larsson, P; Andersson, C; Busk, L (1992) Bioactivation of aflatoxin B1 in the bovine olfactory
mucosa: DNA binding, mutagenicity and induction of sister chromatid exchanges, Carcinogenesis, 13 (8):
1345-1350
15. Vaid, J; Dawra, R K; Sharma, O P; Negi, S S (1981) Chronic aflatoxicosis in cattle, Vet. And Hum. Toxicol.
23 (6): 436-438.
16. Van Halderen, A; Green, J R; Marasas, W F; Thiel, P G; Stockenström, S A (1989) field outbreak of chronic
aflatoxicosis in dairy calves in the western Cape Province, J. South African Vet. Asso. 60(4): 210-211.
17. Wyatt, R D; Neathery, M W; Moos, W H; Miller, W J; Gentry, R P; Ware, G O (1985) Effects of dietary
aflatoxin and zinc on enzymes and other blood constituents in dairy calves, J. Dairy Scie., 68 (2): 437442.
191
192
Subacute rumen acidosis in dairy herds: diagnostics
tools
Subakutna acidoza buraga u mliječnih krava:
dijagnostički postupci
Morgante M., Stelletta C., Cannizzo C., Casalone M., Coppola L., Gianesella M.
Dipartimento di Scienze Cliniche Veterinarie, University of Padua, Viale dell’Università 16, 35020, Legnaro
(PD), Italy
ABSTRACT
Subacute rumen acidosis (SARA) represent one of the most important metabolic disorders in intensive
dairy farms that affects rumen fermentations, animal welfare, productivity and profitability. The aim of the
present study was to study SARA in intensive Italian dairy herds and to determine the correct clinical approach
to diagnose this disease. During the last four years forty commercial dairy herds were investigated. Twelve
cows in good body condition, between 5 and 60 day in milk and without clinical signs of disease were selected
randomly from each herd, to perform rumenocentesis and obtain rumen fluid. Ruminal pH was determined
immediately after sampling and concentration of SCFA in ruminal fluid was determined on samples after
storage. Blood samples for hematochemical and hematological profiles were obtained from the same cows that
had rumenocentesis performed by jugular venipuncture. Milk yield quality was determined in the cows were
we performed the rumenocentesis. The herds were divided into three groups depending on the mean rumen pH:
group A counted farms with average ruminal pH > 5.8 (normal), group B included farms with average ruminal pH
between 5.6 and 5.8 (risk), and in group C, dairy farms presented an average ruminal pH < 5.6 (acidosis). Results
were subject to ANOVA and correlation analysis using SIGMA STAT 3.05. We had no sampling problems with
the 480 cows of our study series, and no animal developed any health problem during or after the procedure. In
particular dairy herds show an average SCFA concentration of 121, 147 and 162 mmol/L for normal, risk and
acidosis herds, respectively. The differences among particle size showed a light discordance between the three
class of herd, a result which suggests more attention in TMR preparation and management, especially in large
herds where the attitude of the personnel responsible for feeding the cows is of paramount importance. Milk
yield quality were not statistical different in three groups. Statistically significant differences (p < 0.05) were
observed for various blood parameters observed: these data suggest that modifications of some haematological
parameters can be observed and in particular the total and differential WBC count were significantly higher in
the dairy cows belonging to the farms affected by SARA.
Sažetak
U radu je proučavana subakutna acidoza buraga miječnih krava. Riječ je o kompleksnoj bolesti utječe
istovremeno na fermentaciju u buragu, dobrobit životinja, proizvodnju i profitabilnost. Promatrano je 40
komercijalnih stada u intenzivnom uzgoju tijekom 4 godine kako bi se ustanovilo ispravan klinički pristup
dijagnostici navedenog stanja. u svakom je stadu odabrano 12 krava koje nisu pokazivale znakove bolesti a
bile su u dobroj tjelesnoj kondiciji i 5. do 60. dana laktacije. Na tim je kravama provedena ruminocenteza i
uzet je buragov sadržaj. U buragovom sadržaju je određen ph i SCFA a paralelno je uzeta i krv iz v. jugularis i
određeni hematološki i biokemijski pokazatelji. Ukupno je pregledano 480 krava, a nijedna nije imala nikakvih
zdravstvenih poteškoća nakon pokusa. Na osnovi rezultata za Ph buraga, SCFA i rezultate krvnih pretraga
podijelili smo krave u zdrave (ph buraga preko 5,8) rizične (ph buraga 5,6-5,8) i bolesne (ph buraga ispod
5,6). razine SCFA su za navedene skupine iznosile 121, 147 i 162 mmol/l. na osnovi promjena krvne slike u
navedenih bolesnih životinja, zaključili smo da je diferencijalna krvna slika odnosno njene alteracije siguran
pokazatelj subakutne acidoze buraga.
193
INTRODUCTION
Subclinical rumen acidosis, also known as subacute rumen acidosis (SARA), represents one of
the most important metabolic disorders in intensive dairy farms that affects rumen fermentations,
animal welfare, productivity and eventually farm profitability. The onset of SARA is linked to the
intake of low fiber high energy diets, often combined with a ruminal environment not yet adapted
to highly fermentable feeds. Under these conditions, rumen papillae are not fully developed with
consequent slower absorption of SCFA. The concentration of these latter thus increases, leading to
a decrease in ruminal pH below physiological limits (Kleen et al., 2003). According to Nordlund
and Garrett (1994), SARA can be defined as a condition characterized by rumen pH below 5.8,
increased total concentration of SCFA, ratio between acetic, propionic and butyric acid shifted
towards propionic and butyric acid, and elevated concentration of lactic acid in the rumen fluid
not exceeding 5-10 mmol/l (Hibbard et al., 1995). Clinical signs of SARA include decreased DMI,
laminitis, rumenitis, liver abscesses, pulmonary bacterial emboli (Nordlund, 1995) and, furthermore,
displacement of the abomasum (Sarashina et al., 1990), mastitis and metritis (Enemark et al., 2002),
low fertility (Britt, 1995). These problems are linked to rumen pathology because of the exceptional
osmotic capacity shown by the rumen and the increase in the adsorption rate of ruminal products,
which may have toxic and vasomotor effects. However, the factors associated with SARA vary,
and provide ambiguous clinical signs, thus defying definitive diagnosis based only on clinical signs
(Garrett et al., 1999), but the only way to obtain a correct diagnosis is to observe and correlate many
aspects (Oetzel, 2000; Morgante et al., 2007): correct collection of the history and clinical analysis
of the herd, diet evaluation (NDF, NDF from forages, NFC) and examination of ruminal fluid; this is
the most important test because it is the only one that allows us to assess the condition of the rumen in
that particular moment (Nordlund and Garrett, 1994). The determination of ruminal pH is a key factor
for the diagnosis of SARA (Enemark et al., 2002). Common field techniques for collecting rumen
fluid for SARA diagnosis include rumenocentesis, by percutaneous needle aspiration (Nordlund
and Garrett, 1994) and oral stomach tube (Nocek, 1997). According various researcher (Garret et al.
1999, Duffield et al. 2004, Morgante et al., 2007), rumenocentesis may be useful for the collection of
rumen fluid for pH determination.
During the last four years forty commercial Italian dairy herds were investigated. The visit to each
herd was organized in cooperation with the local veterinarian and the farmer to obtain the rumen fluid
samples just 4-6 hours after feed distribution. In each farm a general investigation was performed,
with particular attention to herd management and presence of typical clinical signs of SARA. Farms
were selected with these characteristics: high average milk production (about 10000 Kg for year),
over 100 lactating cows, housed in free stalls and in the early part of their lactations (first 60 DIM), use
of TMR and adoption of steaming-up in the final part of the dry period. Twelve cows without clinical
signs of disease, with good body condition and between 5 and 60 DIM, were randomly selected from
each herd to perform rumenocentesis. Ruminal fluid was sampled from each cow 4 to 8 hours after
TMR distribution, a timeframe chosen because ruminal pH likely reaches its minimum. According
the procedure of Edmonson et al. (1989) body condition score (BCS) was recorded for all the cows
studied. Ruminal fluid was obtained by rumenocentesis as described by Nordlund and Garret (1994)
without sedation, using a 13G 105 mm needle (figure 1-4). Rumenocentesis was chosen because it
is most the used technique, providing the most accurate results (Garrett et al., 1999; Enemark et al.,
2002; Duffield et al., 2004). Ruminal pH was determined immediately after sampling using a portable
pHmeter (Piccolo, Hanna Instruments). An aliquot of 8 ml of rumen fluid was immediately acidified
194
with metaphosphoric acid (25%wt/vol) and stored at 4°C until the samples arrived to the laboratory
where they were stored at –80°C until subsequent determination of concentration of SCFA by high
performance liquid cromatography (HPLC). A TMR samples were taken after TMR distribution:
feed samples were stored –20°C until subsequent analysis by near infrared spettroscopy (NIRS)
and a TMR sample taken was sieved with a modified Penn State method (Lammers et al., 1995) to
determine particle size. Blood samples were collected from the same cows by jugular venipuncture;
hematology profile, hematochemical parameters and serum total proteins were determined. Milk
yield quality was determined in the cows were we performed the rumenocentesis. The herds were
divided into three groups depending on the mean rumen pH: group A counted farms with average
ruminal pH > 5.8 (normal), group B included farms with average ruminal pH between 5.6 and 5.8
(risk), and in group C, dairy farms presented an average ruminal pH < 5.6 (acidosis). Data obtained
were analyzed by ANOVA to verify the effect of farm using the statistical package SIGMA STAT 3.5
according the following model: “Yij = µ + FARMi + eij” Where: Yijk = dependent variable, µ = overall
mean; FARMi = effect of different class of herds, and eij = error term. Pearson linear correlations were
also calculated between the parameters.
RESULTS
We had no sampling problems with the 480 cows of our study series, and no animal developed
any health problem during or after the procedure. The three groups (Normal, Risck and Acidosis)
were homogeneous for average DIM (32 ± 29, 38 ± 25, and 34 ± 32, respectively), BCS (3.05 ± 0.30,
3.08 ± 0.27, and 3.06 ± 0.29, respectively), and all the animals were on absence of external clinical
signs of disease.
Table 1. History and milk (production and quality) on three class of herd
N° lactacting cow
Dry-off
Laminitis
Diarrhoea
Ketosis
Mastitis
Riproduct.
problems
Note
Milk production
(Kg)
Fat (%)
Protein (%)
Normal
275
56
Low
Low
Low
No signific
Risck
294
55
10-15%
20%
Low
No signific
Acidosis
330
57
25-30%
25-30%
Low
No signific
No signific
No signific
No signific
/
/
Management
problems
1153
1116
1101
3,8
3,3
3,6
3,3
3,5
3,3
195
Table 2. Chemical composition (%) of diets used during steaming-up (S-UP) and during early lactation
(LACT) on three class of herd
CRUDE PROTEIN
ETHREAL EXTRACT
ASH
NDF
NFC
DRY METTER (% s.s.)
ADF
STARCH
CALCIUM
PHOSFORUS
MAGNESIUM
SODIUM
POTASSIUM
CLORUM
DCAD (meq)
S-UP
13,75
4,88
7,79
40,12
34,475
59,63
24,56
15,6
0,955
0,38
0,315
0,255
1,595
0,32
30,725
Normal
LACT
15,96
5,21
7,28
31,28
40,27
69,375
18,52
25,25
1,095
0,44
0,325
0,58
1,375
0,36
38,245
S- UP
13,355
4,725
8,54
39,86
33,525
60,78
24,12
17,845
0,9
0,43
0,34
0,545
1,45
0,42
37,065
Risck
Acidosis
S-UP
LACT
13,22
16,405
4,235
5,41
9,63
7,61
42
32,12
30,91
38,45
59,51
68,83
27,74
20,195
15,655
24,665
1,03
1,105
0,44
0,47
0,36
0,365
0,42
0,68
1,765
1,495
0,305
0,36
38,705
35,525
LACT
15,762
4,92
7,702
34,51
36,992
52,956
21,358
23,298
1,01
0,468
0,314
0,628
1,326
0,374
37,996
Table 3. Results (%) of particle size of sampling on three class of herd
SIEVE
HOLES
DIAMET.
SIEVE I
SIEVE II
SIEVE III
SIEVE IV
PAN
22 mm
19 mm
8 mm
5 mm
/
OPTIMUM
QUANTITY
15 gr
5 gr
3%
1%
>200 gr
> 40%
< 200 gr
< 40%
Normal
Risck
Acidosis
gr
%
Gr
%
Gr
%
8,5
8
107,5
155
132,5
1,9
2,05
24,95
40,75
30,3
12,5
8
122
138,5
140,5
1,36
1,85
31,45
32,35
31,3
21
6,8
87,6
153,2
230,8
4,22
1,44
17,36
31,06
46,2
Table 4. Mean values of principal short chain fatty acids (mmol/L) of rumen fluid on three class of herd
total SCFA
Acetic Acid
Propionic Acid
N-Butyric Acid
N-Valerate Acid
196
Normal
121.4
76.4
28.8
13.5
1.9
Risck
142.3
87.3
32.4
15.5
2.1
Acidosis
167.2
90.5
38.1
15.2
2.3
Table 5. Average values of haematological and haematochemical profiles, expressed in their conventional
units together with the related standard deviations on three class of herd, and statistical significance observed.
Normal
Risck
WBC (10 /µl)
5.58 ± 1.67
5.55 ± 2.61
RBC (106/µl)
5.91 ± 0.60
6.00 ± 0.78
MCV (fl)
49.81 ± 3.36
50.09 ± 3.85
Albumin (g/l)
33.32 ± 2.56
30.11 ± 2.82*
Alpha-1 (g/l)
4.76 ± 0.75
5.83 ± 0.88*
Alpha-2 (g/l)
8.89 ± 0.91
7.96 ± 0.89*
Beta-1 (g/l)
6.05 ± 0.82
6.37 ± 1.10
Gamma (g/l)
18.88 ± 4.16
22.79 ± 5.12*
Albumin/Globulin
0.88 ± 0.14
0.85 ± 0.16*
Significance: * vs Group A p < 0.05; † vs Group B p < 0.05
3
Acidosis
8.09 ± 1.56*†
6.29 ± 0.64
46.50 ± 2.80*†
30.45 ± 3.05
4.76 ± 0.89†
8.67 ± 0.96†
6.79 ± 0.55*
21.39 ± 4.74
0.86 ± 0.16
DISCUSSION
The aim of this study was to survey the incidents of SARA syndrome in dairy herds in Northern
Italy. Therefore the farms were chosen based on their correspondence to the established parameters
and not in relation to previous suspect of SARA. Herds were homogeneous for several characteristics
(table 1): Holstein cows (except herd 5, where we had also Jersey cows), high production, presence
of more than 100 lactating cows, free stalling, a feeding group in early lactation (first 60 days),
utilization of TMR and utilization of steaming-up at the end of the dry period. However we also stress
that information given by farmers does not always correspond to the real situation. Several herds
showed an unfit flooring and a poor system of effluents ejection; this situation can induce limping
or influence the welfare of animals, a key factor for the onset of numerous diseases, including those
studied here. The data of the initial chemical analysis of diets (table 2), showed that cows were fed
correctly; the value of NDF, ADF, NFC, starch and crude protein, resulted on three class of herd
similar to the values reported in the literature (Nordlund, 2001). However, the particle size of diet
at sampling (table 3) showed a large portion of residual feed on the last sieve (more than 40% is the
optimal value) in acidosis herds. This indicates the presence of large quantities of small particles
(especially concentrates) in feed, or excessive grinding of TMR. A large quantity of concentrates
promotes the development of amylolitic bacteria and decreases chewing, with consequent curtailed
salivary secretion, a situation that can facilitate the occurrence of SARA. We observed smaller than
optimum quantities of NDF from forage (essential portion, because able to chewing stimulation)
in several herds. In fact, previous studies (Mertens, 1997; Stone, 2004) showed that the best value
of peNDF (physically effective NDF) should be about 22% of ration DM to maintain an average
ruminal pH of 6.0. We had no sampling problems with the 480 cows of our experimental series,
and no animal developed any health problem during or after the procedure, including peritonitises,
local abscesses or even decrease in milk production. An analysis of SCFA determination reported in
table 4 show that the concentration of acetate in rumen fluid resulted higher than reference values
reported by Murphy et al. (2000). Propionate values varied between 28 and 38 mmol/l, thus resulting
higher than the concentration of 25 mmol/l reported by Murphy et al. (2000). In all farms, butyrate
concentration seemed to be slightly lower than range values (13-16 mmol/l) reported by Murphy et
al., 2000. Valerate and isovalerate showed values higher than those reported in the literature where
197
traces of these SCFA are taken into account (Kristensen et al., 2000; Allen et al., 2004). From our data
total valerate concentration ranged between a minimum mean value of 3.73 mmol/l and a maximun
value of 5.25. N-valerate is a toxic acid, derived from proteins (rather than from carbohydrates) that
is absorbed by the rumen wall (Kristensen et al., 2000; Allen et al., 2004). Little is known about its
metabolism. N-valerate reaches the liver (where it may induce damage) or the mammary gland when
it is released into the blood stream. A previous study (Morgante et al., 2004) showed a significant
correlation between N-valerate levels in the rumen and the presence of somatic cells in the milk.
Although our study didn’t show a statistic correlation between herds with low ruminal pH and high
levels of valerate concentration, we think it is important to extend the investigation and define the role
of valerate in respect to SARA. Subacute ruminal acidosis is certainly related to management errors,
especially in large herds where the attitude of the personnel responsible for feeding the cows is of
paramount importance. Substitution or replacement of feeding personnel may lead to differences in
feeding schedules, proportion of roughage and concentrate, with consequent considerable impact on
unstable ruminal environments. These problems, although mainly reported in feedlots (Elam, 1976),
may apply also to high-producing dairy herds and should therefore be regarded as a potential hazard
for the health management of the herd.
Milk yield quality were not statistical different in three groups: in particular we showed an
average of 3.8, 3.6 and 3.5 of milk-fat % for normal, risk and acidosis herds, respectively, and the same
values (3.3) of milk protein %. Although ruminal pH is reported to drop in experimental situations of
inducing low milk-fat, this alone does not justify those situations to be characterized as being SARA.
The three groups were homogeneous for average values of DIM (32 ± 29, 38 ± 25, and 34 ± 32,
respectively), BCS (3.05 ± 0.30, 3.08 ± 0.27, and 3.06 ± 0.29, respectively), therefore the variations
about haematological and haematochemical profiles between groups are more likely to be related
to different ruminal pH values. The calculated erythrocytic indices showed that the values obtained
for MCV, MCH and MCHC were within expected normal ranges. Although no substantial changes
in the level of RBC, MCH, MCHC, and MCV were observed, dairy cows with SARA in the present
study exhibited a significant decrease in MCV and MCH, and an increase in MCHC, in contrast to
observations made by other authors (Akinbamijo et al., 1998; Omer et al., 2002). It is possible that the
slight increase in MCHC observed in the herd with low ruminal pH is a compensatory erythropoietic
action in response to the slowly decline in the HCT. The values of these factors were essential for
the classification of anemia. Although anemia is an important symptom reported by other authors
(Bonfanti et al., 2004; Mbassa et al., 1994), its precise link with subacute ruminal acidosis is still
unknown. White blood cells were significantly higher in the dairy cows belonging to the farms of
group C (acidosis). As suggested in previous studies (Jacob et al., 2001), this involves an increase of
cortisol levels that are significantly involved in various events during periparturient period including
initiation of parturition. In effect, according this previous work (Jacob et al., 2001), were the study
was conducted to estimate the serum cortisol concentration in cows and the neonatal calves in order
to correlate the effect of cortisol on certain haematological and biochemical parameters such as blood
glucose level, total plasma protein, lymphocyte:neutrophil ratio and mitogen induced lymphocyte
proliferative response, our study confirmed that the dam at the time of parturition and neonatal calf
before taking colostrum are under a high risk of infection and diseases (for example subacute ruminal
acidosis) because of the low profile of immune status.
198
REFERENCES
Akinbamijo OO, Bennison JJ, Jaitner J, Dempfle L, 1998. Haematological changes in N’Dama and Gobra
Zebu bulls during Trypanosoma congolense infection maintained under a controlled feeding regimen. Acta Trop
69: 181-192. Allen MS, Voelker JA, Oba M, 2004. Physically effective fiber and regulation of ruminal pH: more
than just chewing. Proceedings of the 12th international conference. East Lansing, Michigan USA, July 2004.
Britt JH, 1995. Relationship between postpartum nutrition, weight loss and fertility. Cattle practice (BVCA),
Jan. 79-83. Duffield T, Plaizier JC, Fairfield A, Bagg R, Vessie G, Dick P, Wilson J, Aramini J, McBride B,
2004. Comparison of techniques for measurement of rumen pH in lactating dairy cows. Journal of Dairy Science
87: 59-66. Edmonson AJ, Lean IJ, Weaver LD, Farver T, Webster G, 1989. A Body Condition Scoring
Chart for Holstein Dairy Cows. J. Dairy Sci. 72: 68-78. Elam CJ, 1976. Acidosis in feedlot cattle: practical
observations. J. Anim. Sci. 43: 898–901. Enemark JMD, Jørgenssen RS, Enemark PS, 2002. Rumen acidosis,
with special emphasis on diagnostic aspects in subclinical rumen acidosis. A review. Veterinary Zootecnie 20:
16-29. Garrett EF, Perreira MN, Nordlund KV, Armentano LE, Goodger WJ, Oetzel GR, 1999. Diagnostic
methods for the detection of subacute ruminal acidosis in dairy cows. J. Dairy Sci. 82: 1170–1178. Hibbard
B, Peters JP, Chester ST, Robinson JA, Kotarski SF, Croom WJ Jr, Hagler WM Jr, 1995. The effect of
slaframine on salivary output and subacute and acute acidosis in growing beef steers. Journal of Animal Science
73: 516–525. Jacob SK, Ramnath V, Philomina PT, Raghunandhanan KV, Kannan A, 2001. Assessment
of physiological stress in periparturient cows and neonatal calves. Indian. J. Physiol. Pharmacol. 45: 233 – 238.
Kleen JL, Hooijer GA, Rehage J, Noordhuizen JP, 2003. Subacute ruminal acidosis (SARA): a review. J.
Vet Med A Physiol Pathol Clin Med 50: 406-414. Kristensen NB, Pierzynowski SG, Danfær A, 2000. Net
portal appearance of volatile fatty acids in sheep intraruminally infused with mixtures of acetate, propionate,
isobutyrate, butyrate, and valerate. J. Anim. Sci. 78: 1372–1379. Lammers BP, Buckmaster DR, Heinrichs
AJ, 1995. A simple method for the analysis of particle size of forage and total mixed rations. J. Dairy Sci. 79:
922-928. Mbassa GK, Balemba O, Maselle RM, Mwaga NV, 1994. Severe anemie due to haematopoietic
precursor cell dedestruction in field cases of East Coast Fever in Tanzania. Vet Parasitol 52: 243 – 256. Mertens
DR, 1997. Creating a system for meeting the fiber requirements of dairy cows. Journal Dairy Science 80: 14631481. Morgante M, Stelletta C, Tacchio G, Lettig I, Berzaghi P, 2004. Subclinical rumen acidosis in Italian
rd
dairy herds. 23 World Buiatrics Congress, July 11-16, 2004-Quèbec (Canada); S. 566. Morgante M, Stelletta
C, Berzaghi P, Gianesella M, Andrighetto I, 2007. Subacute rumen acidosis in lactating cows: an investigation
in intensive Italian Dairy herds. Journal of Animal Physiology and Animal Nutrition 91: 226-234. Murphy M,
Akerlind M, Holtenius K, 2000. Rumen fermentation in lactating cows selected for milk fat content fed two
forage to concentrate ratios with hay or silage. J. Dairy Sci. 83: 756–764. Nocek JE, 1997. Bovine Acidosis:
Implications on Laminitis. J. Dairy Sci. 80: 1005–1028. Nordlund KV, Garrett EF, 1994. Rumenocentesis – a
technique for collecting rumen fluid for the diagnosis of subacute rumen acidosis in dairy herds. The Bovine
Prac. 28: 109–112. Nordlund K, 1995. Questions and answers regarding rumenocentesis and the diagnosis of
herd-based subacute rumen acidosis. Proc. 4-State Applied Nutrition and Management Conference. La Crosse,
WI, USA. Nordlund K, 2001. Herd based diagnosis of subacute ruminal acidosis. Preconvention seminar
8: Dairy herd problem investigations American Association of Bovine Practitioners 34th Annual Convention,
September 11-12, 2001-Vancouver, BC. Oetzel GR, 2000. Clinical aspects of ruminal acidosis in dairy cattle.
Proceedings of the 33rd Annual Convention of the Americn Association of Bovine Practitioner, Rapid City, pp.
46–53. Omer OH, El-Malik KH, Mahmoud OM, Haroun EM, Hawas A, Sweeney D, Magzoub M, 2002.
Haematological profiles in pure bred cattle naturally infected with Theileria annullata in Saudi Arabia. Vet.
Parasitol. 107: 161 – 168. Sarashina T, Ichijo S, Takahashi J, Osame S, 1990. Origin of abomasum gas in cow
with displaced abomasum. Jpn. J. Vet. Sci. 52: 371-378. Stone WC, 2004. Nutritional approaches to minimize
subacute ruminal acidosis and laminitis in dairy cattle. Journal Dairy Science 87 (E.supp.): E13-E26
199
200
INFLUENCE OF PROPYLEN GLYCOL IN FEED FOR PROPHYLAXIS
OF KETOSIS IN PERIPARTAL PERIODS OF DAIRY COWS
utjecaj PROPiLEN GLikOLa u hrani na spriječavanje
ketoze u muznih krava prije poroda
Biljana Radojičić1, B. Dimitrijević1, A. Krasnić2
Ketosis is a relatively frequent metabolic disorder of dairy cows with high milk yield, which
mostly occurs as a consequence of the nutritive-metabolic inadequancy of an organism. It manifests
itself in amassing of free fatty acids in the blood, in decrease of the glucose concentration in the blood,
and a considerable presence of aceto-bodies in the blood and the urine. It can take a sub-clinical (more
frequently), or clinical form (accompanied with the loss of appetite, decrease in milk yield and acetobodies in the urine). It occurs as a primary or secondary disease, mostly during the puerperium of
high yield dairy cows (Blood, 1994). In prevention and treatment of ketosis various substances have
beeen used (molasses, nicotinaamid, Na-propionat, glycosol, propylene glycol) as additions to dairy
cows’meals, in different quantities and at different times, before and after delivery (Markovic, 1991,
Studer et al., 1993 Formigoni et al., 1996). Propylen glycol is a dominant substance in the Glucolac
plus energetic compound, which contains some vitamines from the B vitamine group and some
oligo-elements, which basically is a gluco-genoplastic substance aimed at prevention of ketosis, and
which is used in variously recomended dosages of 100-300 g per, at different times, but generally 30
to 15 times per days before delivery (Sauer et al., 1989; Formigoni et al., 1996; Krasnic, 2005).
The way in which propylen glycol works is through enzime inclusion and intermediary metabolism
which takes place within the liver cells.
Simultaneous evaluation of metabolisnm and the liver functional activities can be followed
using certain biochemical parameters in the blood and the blood serum (metabolic profile), and by
way of them a sub-clinical ketosis can be revealed, so it can be timely prevented (Blood 1994;
Samanc et al., 2004, Radojicic Biljana et al., 2007). Since numerous parameters are used in these
researches, the objective of some of them was to determine parameters exactly and reduce thewi
number to achieve a better diagnostic significance in evaluating metaphylaxis of the liver. So many
researchers have determined that the suimulataneous finding of hypoglycemia, hypoalbuminemia,
hyperbilibirubinemia and higher activity of AST in a blood serum, is a valid indicator of the disturbed
metabolism and liver disorder (Brugere-Picoux Jeane and H. Brugere 1987: Lotthammer, 1991;
Kasagic, 2005; Krasnic, 2005; Radojicic Biljana et al., 2002; Radojicic Biljana, 2007; Radojicic
Biljana et al., 2007).
Sažetak
Ketoza (acetonemija) je dobro poznata bolest uzrokovana neadekvatnom prehranom krava
muzara, posebice pri visokoj proizvodnji mlijeka, u krava bilo koje dobi, uglavnom tijekom prvih 30
dana laktacije, rijetko u prvoj laktaciji. Profilaksa i terapija ketoze koristi različite peroralne preparate:
nikotin amid, propionat, glicerol i propilenglikol. Aplikacija propilenglikola, zajedno sa nekim
vitaminima B skupine pozitivno utječe na glikemiju u krava u peripartalnom razdoblju. Istraživanje
je provedeno na kravama holstein pasmine, u kasnoj gravidnosti, starih 4-6 godina, koje su imale
ketozu u nekoliko ranijih navrata. Životinje su podijeljene u 3 skupine. Prva skupina (10 krava) je
dobivala propilenglikol i neke vitamine B grupe u jednokratnoj dnevnoj dozi od 200g u obroku, 14
201
dana prije poroda. Druga skupina (10 krava) dobivala je propilenglikol počevši 7 dana prije poroda
pa do 7 dana nakon poroda, također kao jednokratna dnevna doza od 200g u krmivu. Treća skupina
krava (10 krava) je bila kontrolna grupa kojoj nije dodavan propilenglikol prije poroda. Uzorci krvi
uzimani su za određivanje metaboličkih parametara prije i nakon pokusa venepunkcijom v. subcutanea
abdominis. U krvnom serumu određivana je razina glukoze, albumina, ukupnog bilirubina te aktivnost
enzima AST testom „Reneal Finechemical Co“. Takođeer tijekom pokusa redovito je praćena razina
ketonskih tijela u mokraći Rhotera-Ross testom. Analizom dobivenih rezultata zaključili smo da u
kontrolnoj skupini krava nakon pororda razina bilirubina ima statistički znakovit rast (p<0.05), kao
i razina aktivnosti AST, a razina albumina pada, što se potvrdilo u pojavi kliničke ketoze u dviju
krava (pozitivan nalaz ketonskih tijela u mokraći). U prvoj grupi životinja aktivnost AST enzima
je stabilna, kako prije, tako i nakon pokusa te unutar fizioloških vrijednosti (x=62,37 ± 15,32 : 72 ±
24,36 U/l). U prvoj skupini krava nije došlo do pojave ketoze nakon poroda. Ipak, razina glikemije
je bila niža (x=1,97 ± 0,65 mmol/l) u odnosu na kontrolnu i drugu grupu. Vrijednosti razine AST u
prvoj skupini u odnosu na drugu i kontrolnu skupinu su pokazale kako je AST znakovit parametar
kontrole statusa jetara krava u peripartalnom razdoblju. Dobivanje propilenglikola u hrani najmanje
2 tjedna prije poroda ima hepatoprotektivnu ulogu u profilaksi ketoze. Hiperbilirubinemija i visoka
aktivnost AST u serumu indikatori su subkliničkog oblika acetonemije u krava.
Ključne riječi: propilenglikol, profilaksa, ketoza, metabolički parametri
Investigation were conducted in the high yield cows, Holstein breed (n=30), ages 4-6 years,
divided into tree groups, in the farm »Kopovo«, Starčevo. Prior the experiment cows have been one
or two time in ketosis in the earlier lactation period.
The first experimetal group (n=10) two weeks prior delivery intake with the feed Glucolac plus,
200 g, in single dosis per day. The second group (n=10) 7 day prior and 7 days after delivery intake
with feed Glucolac plus, 200 g in single dosis per day, and control group od cattle (n=10) stand
without Glucolac plus in feed.
Blood sampling for analyses was provided prior and after experiment with venepunction from
vena abdominis subcutanea always in the morning. In the blood sera we determined concentrations
of glucose, total bilirubine, albumine and activity of enzime AST with spectrophotometar Basic
Secoman, using comercials tests »Reneal Finechemical Co«. Every morning we controled urine
by Rother-a test to establish presence of aceto-bodies. In the ketotic cows we provided standard
therapeutical treatment. Results of biochemical analyses in the blood sera were statisticaly processed
with description methods, and statistical significance were determined using Studen t test.
Results
After conducted examination and blood sera analysis, results were statisticaly processed,
interpreted, and showed in table 1, 2, 3 and 4.
In table 1. it can be seen that mean values of glucose concentration in cows blood serum of I
experimental group was the lowest (x=1.28±0.35 mmol/l), while the second day after delivery it was
x=1.97±0.65 mmol/l , which was significantly higher compared with the beginning of experiment (p<
0.05). In II experimental group dropping of glycemia occured at seventh day postpartum, compared
with the glycaemia at the beginning of experiment, namely before propylen glycol application
202
(x=1.84±0.87 : 1.55±0.63 mmol/l). In control group, mean values of glycaemia were in physiological
range (x=3.08± 1.4 mmol/l), but in that group two cows were with glycaemia 1.17 and 1.22 mmol/l,
i.e., it was clinically manifested ketosis (findings of aceto-bodies in urine samples).
Table 1. The mean values of glucose concentrations (mmol/l) in blood sera of cows in experimental and
control group
Stat. param.
x
SD
SY
Minimum
Maximum
CV (%)
* (p< 0.05)
I group
prior
1.28
0.35
0.1105
0.75
1.75
27.26
I group
after
1.97*
0.65
0.2068
1.23
3.31
33.17
II group
prior
1.84
0.87
0.2760
1.10
3.73
47.76
II group
after
1.55
0.63
0.2000
0.86
2.96
40.82
Control
group
3.08
1.04
0.3033
1.17
4.69
33.57
Table 2. The mean values of total bilirubin concentrations in the blood sera (μmol/l) of cows in experimental
and control group
Stat. param.
x
SD
SY
Minimum
Maximum
CV (%)
I group
prior
9.32
4.21
1.3314
4.91
18.13
45.18
I group
after
13.61
3.58
1.1322
7.50
20.10
26.30
II group
prior
9.44
2.97
0.9397
5.11
15.00
31.47
II group
after
13.84
7.37
2.3291
4.89
26.70
53.24
Control group
9.00
5.18
1.6372
4.92
21.51
57.50
In table 2. it can be seen that mean values of total bilirubine concentrations were higher than
physiological values (>8.0 μmol/l), in all of animals during all the time (experimental and control
group), although the cows of second experimental group, at seventh day after delivery has the highest
values, x=13.84±7.37 μmol/l .
Table 3. The mean values activity of AST (U/l) in blood sera of cows in experimental and control group
Stat.
param.
x
SD
SY
Minimum
Maximum
CV (%)
** (p< 0.01)
I group
prior
I group
after
II group
prior
II group
after
Control
group
62.37
15.31
4.8420
42.10
88.50
24.55
72.00
24.36
7.7026
4.850
123.50
33.83
82.46
43.79
13.8487
49.10
182.00
53.11
100.55
48.53
15.3462
46.70
200.10
48.26
116.23**
54.90
17.3602
67.10
225.10
47.23
203
In table 3., it can be seen that activity of AST in blood sera was significantly higher (p<0.01)
in control group, and was x=116.23±54.23 U/l. The highest values of AST activity were noticed in
two cows with clinically manifested ketosis ( 225.10 and 210.2 U/l). Decidedly stability of AST
activity was in I experimental group before and after experiment x=62.37±15.31 : 72.0±24.36 U/l ,
respectively it was in physiological range (up to 80 U/l) during the both period of examination.
Table 4. The mean values concentration of albumin (g/l) in the blood sera of cows in experimental and control
group.
Stat. param.
x
SD
SY
Minimum
Maximum
CV (%)
** (p< 0.01)
I group
prior
37.28
7.51
2.3760
31.50
57.90
20.16
I group
after
43.34**
11.55
3.6509
24.60
58.10
26.64
II group
prior
33.34
3.26
1.0294
28.00
37.70
9.76
II group
after
35.43
3.44
1.0872
29.40
40.70
9.70
Control group
36.58
4.09
1.2930
31.80
46.50
11.18
In table 4. it can be seen that mean values of albumin concentration, in all of examined groups,
were in physiological range, although it was significantly higher (p< 0.01) in cows of I experimental
group (x=43.34±11.5 g/l ) at the end of experiment, compared with the II experimental group before
experiment (x=33.34±3.26 g/l). In cows of control and I experimental group, albumin concentrations
were somewhat lower compared with the cows of I experimental group, but it is out of statistical
significance.
Discussion
Ketosis, as one of most frequent metabolic disorder in high-yield dairy cows, occurs in 20-38
%, as a consequence of the nutritive-metabolic inadequacy of an organism (Krasnić, 2005). It occurs
mainly in older cows, after delivery, in a period when they should be in a most productive time ( at
3.-5. lactation). Ketosis carry out to dropped milk production, bearing calves in neonatal acidosis, as
well as reproductive disabilities, what is reflected in important economical loses. It manifests itself in
decrease of the glucose concentration in the blood, and a considerable presence of aceto-bodies in the
blood and the urine. It occurs as a primary or secondary disease, mostly during the puerperium of high
yield dairy cows For clinical form of ketosis is hypoglycaemia and aceto-bodies in urine. It can take
sub-clinical (more frequently), or clinical form. Detectione of ketosis is posible with determination
biochemical parametres indicate in the same time status of metabolism and functional activity od
liver cells (Šamanc et al., 2004; Radojičić Biljana et al. 2007). Among of many parameters it is
established that four of them can be used for validation of metaphylaxis of liver status in order to
prevent ketosis (Brugere-Picoux Jeane and H. Brugere 1987; Krasnić, 2005; Radojičić Biljana
et al., 2002; Radojičić Biljana, 2007). Glucolac plus is energetic compound, which contains some
vitamines from the B vitamine group, and some oligo-elements, as couper, which basically is a glucogenoplastic substance aimed at prevention of ketosis, and which is used in variously doses and diffrent
time. recomanded of may authors (Sauer et al., 1989; Studer et al., 1993; Formigoni et al., 1996,
Krasnić, 2005). Lotthammer (1991) sugested that for ketosis in clinical form the level of glycaemia
is lower then phisiological value (2.2 mmol/l) , i.e. it was 1.8 mmol/l, but, Blood (1994) sugested that
204
level of glicaemia is 1.6 mmol/. However, in our investigation in the condition of hypoglicaemia we
did not find clinical form of ketosis into first group, where mean values of glucose concentration prior
application of Glucolac plus was x=1.28±0.35 mmol/l. Application of Glucolac plus two weeks before
delivery lead to statisticaly important increase (p<0.05) of glycaemia level, x=1.97±0.65 mmol/l, in
the first group. In the control group we found statisticaly important increase activity of enzime AST
x=116.23 ±54.23 U/l, and hyperbiliruminemia and hypoalbuminemia in the two cows in clinical
form of ketosis. In the cows before delivery hypoalbuminemia, hyperbilirubinemia and high activity
of AST is valid parameters for detection of subclinical form of ketosis (Brugere-Picoux Jeane and
H. Brugere 1987; Lotthammer, 1991; Kasagić, 2005; Krasnić, 2005; Radojičić Biljana et al.,
2007).
Stabile activity of enzime AST in the first group in peripratal period indicate that Glucolac plus
have hepatoprotective role, and AST can be used as valid parameter for metaphylaxis of status liver
in cattle (Krasnić, 2005 ; Radojičić Biljana, 2007). Conclusion
Application of Glucolac plus in feed for high yield cows, in single dosis at 200 g per day (100
g propylen glycol) two weeks before delivery, resulted with imoprtant increase of glycaemia level,
stabile activity of AST in the blood sera, prior and after delivery, which was not case in the second
and control group. Determination of AST activity is good parameter for functional evaluation of
status liver in high yield cows in peripartal period.
References:
Blood D.C. (1994): Pocket Companion to Veterinary Medicine. Chapter 7. Disease of the liver and pancreas.
Baillere Tindal
Brugere-Picoux Jeane and H. Brugere (1987): Particularites de la biochemie clinique des ruminants. Rec. Vet.
Med., 163 (11), 1043-1053
Formigoni A.M.C., Cornil A., Proudi A., Mordenti A., Rossi D., Portetelle and R Removille (1996): Effect
of propylen glycol supplementation around parturition on milk yield reproduction perfomans and some
hormonal and metabolic ccharacteristics in dairy coes. J. Dairy Res., 63: 11-24
Krasnić A. (2005): Primena propilen glikola i nekih vitamina B grupe u preveniranju ketoze visoko mlečnih
krava. Specijalistički rad, Fakultet veterinarske medicine, Beograd
Kasagić D. (2005): Koncentracija trijodtironina, tiroksina, insulinu sličnog faktora rasta I i biohemijskih
pokazatelja metabolizma u krvnom serumu junica pre i posle partusa. Magistarska teza. Fakultet veterinarske
medicine, Beograd
Lotthammer, K.H. (1991) : Uticaj i posledice neizbalansirane ishrane na zdravlje i plodnost mlečnih krava.
Zbornik predavanja XX seminara za inovaciju znanja veterinar, 71-102, Fakultet veterinarske medicine,
Beograd
Marković S. (1991) : Uticaj amida nikotinske kiseline i L-metionina na metabolizam lipida krava u visokom
graviditetu i ranom puerperijumu. Magistarska teza, Fakultet veterinarske medicine, Beograd
Radojičić Biljana, J. Bojkovski, D. Janković (2003): Neki biohemijski parametri kontroli metabolizma visoko
mlečnih krava, Veterinarski žurnal Republike Srpske, Vol. 2., br./No 1-2, 31-35, 2002
Radojičić Biljana (2007): Opšta klinička dijagnostika kod domaćih papkara. Naučna »KMD«, ISBN 978-8684153-76-2
Radojičić Biljana, Bosiljka Đuričić, D. Matarugić, D. Kasagić (2007): Značaj hematološko biohemijskih analiza
u diferencijalnoj dijagnostici oboljenja kod visokomlečnih krava. II Kongres veterinara Republike Srpske
24-27. okotobar 2007, Veterinarski žurnal Republike Srpske, Vol 7, Broj 2, str. 128-134
205
Sauer F. D., J.K.G. Kramer, and W. J. Cautwell (1989): Antiketogenic effect of monensin and propylen glycol
in aerly lactation. J. Dairy Sci. 72:436-442
Studer V.A., R.R. Grummer and S.J. Bertics (1993): Effect of prepartum propylen glycol adminstration on
periparturient fatty liver in dairy cows. J. Dairy Sci. 76: 2931.2939
Šamanc H., Radojičić Biljana, Mira Kovačević i R. Đoković, (2004): Some endocrino-metabolic parameters in
the blood serum of healthy and ketotic cows. The 12th Congress of Mediterrranean Federation for Health
and Production of Ruminants, Abstract book, 26 Istanbul, Turky, 16-19 september, 5.
206
Electrophoretic study of plasma proteins in dairy
cows with clinical and subclinical mastitis by
Agarose gel procedure
Istraživanje proteina plazme elektroforezom u
mliječnih krava s kliničkim i subkliničkim mastitisom
postupkom gel Agara
Tabrizi1, Afshin Davasaz; Roozali Batavani2, Siamak Asri-Rezaei2, Malahat Ahmadi2
1
Department of Clinical Sciences, Faculty of Veterinary Medicine, Islamic Azad University of Tabriz, Iran
2
Faculty of Veterinary Medicine, University of Urmia, Urmia, Iran
Abstract
The mastitis is one the most important diseases from point view of economy in milk cow breeding industry,
which it causes reduction in milk producing, treatment expenses, reduction in cattle genetic progress and fall in
milk combination quality. The aim of this study was to survey Holstein dairy cow plasma with different protein
bounds ratio changes in the case of clinical and subclinical mastitis. Samples from dairy farms around TABRIZ
were taken. For recognizing subclinical cases Californian Mastitis Test (CMT) was used, and instances of two
positives and three positives were considered. In the case of clinical mastitis one group in the name of mild (sub
acute) diagnosed, Which had milk containing abnormality and clots, and other group in the name of moderate
(acute) determined which in addition to milk, they had inflammation changes in udder tissue. The numbers
of samples in every 4 groups were 25 . Besides of these affected 4 groups, we chose 25 healthy cows which
both their (CMT) tests were negative and it was not separated in their milk culture pathogenic bacteria. In all
groups blood samples from jugular vein were obtained, using vacuum tube and containing of EDTA and plasma
separated. The next phase, the samples by using protein hydragel by electrophoresis were measured. The results
on albumin bound although the mean amounts of these protein in affected groups were lower than control group,
it does not show significant difference (P>0.05). In alpha-1 bound , there was significant difference between
CMT2+ group and control group (P<0.05), also it showed significant difference with clinical mastitic groups.
In alpha-2 bound clinical mastitic groups had difference with healthy group (P<0.05). However, there was not
difference between clinical and subclinical groups (P>0.05). In beta-1 bound it showed difference only in the
affected to clinical moderate mastitis group (acute) with other groups (P<0.05). In Beta-2 bound there were not
any difference among groups (P>0.05). In gamma-1 bound , there was significant difference between control
group and CMT3+ group (P<0.05), And in gamma-2 bound there were not any differences among groups. In
conclusion, regarding to the results obtained this is what understood, with increasing the inflammation and
infection intensity, the increase in proteins amount, especially in alpha-2 and beta-1 bounds are significant .
Sažetak
Mastitis je jedna od najizraženijih bolesti koja utječe na mljekarsku industriju uzrokujući pad mliječnosti,
rast troškova držanja, genetsko nazadovanje i pad kvalitete mlijeka.Cilj ovog istraživanja je procijeniti omjere
proteina u plazmi Holštajn mliječnih krava sa subkliničkim i kliničkim mastitisom. Uzimani su uzorci krava
s mliječnih farmi u okolici Tabriza. Za dokaz subkliničkog mastitisa korišten je Kalifornijski tesz za mastitis
(CMT) te su u obzir uzeti slučajevi dvije i tri pozitivne reakcije. U slučajevima s kliničkim mastitisom jedna
skupina je bila blaga kod koje je mlijeko sadržavalo krpice i grudice, dok su u drugoj umjerenoj skupini uz
promjene u mlijeku uočene upalne promjene u tkivu vimena.
207
INTRODUCTION
Mastitis is the most frequent and expensive disease associated with current intensive dairying
It has adverse effects on the economics of milk production by reducing the quantity and quality of
milk (De Graves et al., 1993), and increasingly through the imposition of financial penalties by milk
purchasers for high numbers of somatic cells in milk which increase as a result of intramammary
infection (Booth, 1997). Per acute clinical mastitis has also been recognized as the major cause of
mortality in adult dairy cows (Menzies et al., 1995). Mastitis can be caused by a large number of
bacterial species. Subclinical infections are those for which no visible changes occur in the appearance
of milk or the udder, but milk production decreases, somatic cell count increases, pathogens are
present in the secretion, and composition is altered. Clinical mastitis is recognized by abnormal
milk, varing degrees of mammary gland inflammation (redness, heat, swelling, pain) and with or
without illness of the cow. Milk production declines, bacteria are present in the milk and the milk can
vary from having a few milk clots to serum with clumps of fibrin in the secretion (Tyler and cullor,
1990). Early identification of udder health problems is essential for dairy farmers and veterinarians to
ensure not only animal well-being but also milk quality and dairying productivity. Economic aspects
interfere with the routine application of bacteriologic examination of quarter milk samples. For this
reason, alternative parameters are used to identify trends in the development of the udder health in a
dairy herd, although these parameters indicate inflammation.
Animals were selected from two Holstein dairy herds located Tabriz in east Azerbaijan province
of Iran. Cows were milked three times daily by machine milking. All cows were subjected to postmilking teat disinfection, those were dried off approximately 2 months before expected calving and
all quarters of cows were infused with an antibiotic preparation approved for use in non lactating
cows following the last milking of lactation. Milk samples were collected from cows just before
morning milking. Teats were washed thoroughly and dried with a single-use paper towel. The first
three streams of milk from each teat were discarded. The teat end and orifice was sanitized with
cotton swabs soaked in 10% ethyl alcohol and approximately 10 ml foremilk sample were collected
from each quarter of cow in a sterile tube held horizontally. Clinical mastitis was recognized by
the dairymen on each farm in the usual way, by observation and palpation of the udder. In 25 case
mastitis was diagnosed by the presence of clots in the milk (defined as mild mastitis), and in 25
case by the presence of clots and observable inflammation in the infected quarter such as heat, pain,
redness or swelling (defined as moderate mastitis). Subclinical mastitis was determined by California
mastitis test (CMT). The CMT results were interpreted as negative (O), 1+ (traces), 2+(gel) and
3+(clumps), (Busato et al., 2000). CMT 1+ cases were eliminated from this study. CMT 2+ and CMT
3+ cases (25 case from each score) were submitted in the research. CMT(0) and culture negative
cases were considered healthy (Control). Milk samples were also taken from an unaffected, nonmastitic, diagonally opposed quarter of the udder of the healthy and mastitic cows, as intra-animal
controls. The number of samples in each group were 25 case. Jugular blood samples were taken
from each dairy cow. Venoject tubes with EDTA and For bacteriological examinations, standard
procedures was performed according to the guidelines described by sears et al.(2003) and Quinn et
al.(1994).
To investigate protein fractions in the serum and uterine fluid, the samples were diluted (1:10)
with normal saline and run on agarose gel media (commercial kits, sebia Performance, France) with
a buffer consisting of barbital (1.8g/l), tris [tris(hydroxymethyl)amino methane] (7.2g/l), sodium azid
208
(0.1g/l) and sidium barbital (10.3g/l) included in the kits, at 100 V and starting flow of 25mA for
25 min.The gel was rinsed with double distilled water, fixed 15 min in fixing solution and dried in
a hot air current ,then, stained in the staining solution (acid violet, 2g/l asetic acid 10%,water 90%)
for 15 min and cleared by repeated washing in the de-staining solution (acetic acid, 10ml; ethanol
95%,350ml; water up to 11).After drying in the hot air the amount of each protein fraction was
calculated.
RESULTS
Bacteria isolated from the mastitic cows included the usual range of pathogens. The isolates
from subclinical mastitis cases were coagulase negative staphylococci (40%), staphylococcus aureus
and corynebacterim bovis (each 12%), streptococcus spp. (6%), Serratia marcescens, Enterobacter
aerogenes and Proteus spp. (each 4%). 18% from subclinical mastitis cases showed no growth on
bacteriological examination.
Clinical mastitis cases had the following bacteria isolated from them: taphylococcus aureus
(26%), coagulase negative staphylococcus (18%), streptococcus spp.(10%), corynebacterium bovis
and E.coli (each 8%), Pasteurella multocida (6%), Bacillus cereus and Arcanbacterium pyogenes
(each 4%). 16% from clinical mastitic cases showed no growth on bacteriological examination. The
somatic cell count in milk from quarters with subclinical and clinical mastitis were significantly
(P<0.01) greater than in the milk of the control cows, also was significant difference between each
four mastitic groups (P<0.01). (Table 1).
The level of albumin in affected group did not differ from control group (P> 0.05). there was
considerable difference between CMT 2+ group and control group in Alpha-1 fragment (P<0.05).
Alpha-2 fragment showed meaningful difference in both mild and moderate clinical groups (P<0.05),
but there was no difference in subclinical mastitis groups. Considerable difference was only observed
in moderate group relative to control group in Beta 1 fragment (P<0.05). Other affected groups did
not show any significant difference.
There was meaningful difference between CMT3+ and control group in gamma-1 fragment
(P>0.05) but other affected groups did not show any meaningful difference relative to control group.
Any meaningful difference have not been considered between affected group and control group in
gamma 2 fragment (P>0.05).
Table 1: Mean concentration of protein fractions in plasma in different groups (Mean ± SE, gr/dl)
Albumin
α1
α2
β1
β2
γ1
γ2
Control
2.98±0.35
0.44±0.2
0.6±0.2
0.19±0.12
0.57±0.1
1.27±0.19
1.48±0.32
CMT 2+
2.66±0.47
0.66±0.22*
0.73±0.14
0.33±0.27
0.63±0.19
1.62±0.4
1.99±0.57
CMT 3+
2.55±0.46
0.55±0.1
0.81±0.2
0.29±0.08
0.71±0.15
1.96±0.42*
2.12±0.43
Mild
2.84±0.17
0.41±0.09
0.96±0.2*
0.43±0.29
0.73±0.27
1.66±0.44
1.77±0.62
Moderate
2.43±0.8
0.45±0.16
0.95±0/32*
0.52±0.31*
0.78±0.35
1.59±0.35
1.64±0.53
Groups
*: Significant difference with control group (P<0.05)
209
DISCUSSION
The bacteriological results from the subclinical cases was showed coagulase negative staphylococci
(CNS) were most frequent isolate bacteria. CNS organisms, group of staphylococcal species, have
become the predominant pathogens causing bovine mastitis in many countries (Pitkala et al., 2004).
Although the CNS usually cause only subclinical or mild clinical mastitis, they are harmful since
they increase somatic cell count (SCC) in milk (chaffer et al., 1999) and may slightly decrease
milk production (Timms and Schultz, 1987). Mastitis caused by CNS responds well to antimicrobial
treatment (McDougall, 1998). Staphylococcus aureus was the next more causative organisms of
subclinical mastitic cows. Staphylococcus aureus still as one of the most infectious agents which
produces mastitis in cattle. Other bacteria that was often isolated corynebacterium bovis. C.bovis
are generally considered as opportunistic pathogens and inhabitants of teat canals (Rainard, 1987).
The infection causes minor hispathological alterations in the udder parenchyma without affecting
the secretory function of the tissue. Environmental streptococci from 6% of subclinical and 10% of
clinical mastitis were isolated. In countries where the prevalence of intramammary infections due to
the contagious pathogens has been reduced or eradicated, the proportion of intramammary infections
associated with environmental streptococci has increased markedly (Radostits et al., 2007). The
bacteriological results from the clinical cases of mastitis shows the staphylococcus aureus is the most
frequent organism. S.aureus is ubiquitous in the environment of dairy cattle. The infected mammary
gland of lactating cows is the major reservoir and source of the organism. Transmission between
cows occurs at the time of milking by contaminated milker’s hands and teat cup liners (Radostits et
al., 2007).
Inflammation of the mammary gland leads to a variety of compositional changes in milk either
because of local effects or because of serum components entering the milk and the movement of
some normal milk components out of the alveolar lumen into the perivascular space (Harmon 1994).
Theoretically, all changes in mammary secretion during inflammation might be used to measure
the effects of mastitis, but problems of instrumentation and standardization have prevented farm
application of most tests. In dairy herds, mastitis is a production disease of major importance. Cows
with clinical signs of mastitis are easily spotted by farmers and proper treatment can be applied.
However, subclinical infections may not be observed and remain untreated. Cow-side tests, such as
the California Mastitis Test, are available but laboursome and time consuming if applied to a large
number of animals (Petersen et al., 2004). For the screening of herds, the somatic cell counts (SCC) are
used despite the fact that high levels do not necessarily reflect mastitis. In order to detect subclinical
infections, APP might be applied. For a test be useful in routine investigations for mastitis, it is
important that it can be applied to milk samples which are readily available than serum or plasma.
Plasma albumin concentration is higher than other proteins, so that 55-66 percent of plasma
total protein consists of albumin. Synthetic albumin level in liver corresponds to nutrition and its
concentration in plasma. Because of small size, albumin is easily observable in urine relative to
other proteins in glomerular damages. Albumin decreases in liver disease, inflammatory states,
malnutrition and urinary secretion. It is not valuable to diagnosis alpha 1 globulin increase in animals
while Alpha 2 globulin increase indicate important sign of acute inflammatory disease. It mostly
belongs to acute phase protein. Beta globulin increase is not solely high in animals. It is usually seen
in active liver disease, infectious skin damages and sometimes it is observed in nephritic syndrome.
Gamma globulin increase in chronic inflammatory diseases like chronic liver inflammation, liver
abscess, septic diseases, and immunologic diseases. The results of plasma proteins fragment study
showed that there is no meaningful statistical difference between treatment and control groups in
210
albumin level (P>0.05). Albumin is a negative acute phase protein, and it is reduced in infections and
inflammatory states.
In current study, albumin average level is lower in mastitis suffering cows, than healthy cows. But
this reduction did not lead to meaningful statistical difference among groups. There was meaningful
difference between clinical mastitis suffering group and treatment group in Alpha 2 fragment.
According to this fact that the main acute phase proteins in cows are in this fragment from increase
in haptoglobulin, serum amyloid a point of view, this considerable difference is explained easily. So
haptoglobulin level increase related directly to inflammation severity. Meaningful difference between
moderate mastitis suffering group and control group was considered in Beta 1 fragment (P>0.05).In
spite of higher average protein level in affected group, there was no meaningful difference in Beta 2
fragment (P>0.05).
There was meaningful difference between CMT3+ and control group in gamma 1 fragment.
This difference was not related to severity and inflammation level of course, in other group’s, in
spite of meaningful difference, gamma 1 fragment average was higher treatment group. In study
of gamma 2 fragment, according to this fact that protein average level was high in affected group
relative to control group meaningful difference was not considered. In conclusion, regarding to the
results obtained this is what understood, with increasing the inflammation and infection intensity, the
increase in proteins amount, especially in alpha-2 and beta-1 bounds are significant .
REFERENCES
Booth, J.M., 1997. Is mastitis being reduced in the 1990s? cattle pract. 5, 61-65.
Chaffer, M., G.Leitner, M. Winkler and A. Glickman, 1999. Coagulase- negative staphylococci and mammary
gland infections in cows. J. Vet. Med. B 46, 707-712.
Chassagne, M., J. Barnouin and J.P. Chacornac, 1998. Biological predictors for early clinical mastitis occurrence
in Holstein cows under filed conditions in france. Prev. Vet. Med., 35: 29-38.
Conner, J.G., P.D. Eckersall, M. Doherty and T.A. Douglas, 1986. Acute phase response and mastitis in the cow.
Res. Vet. Sci., 41: 126-128.
De Graves, F.J. and J. Fetrow, 1993. Economics of mastitis and mastitis control.Vet. Clin. North. Am. Food
Anim. Pract., 9: 421-434.
Eckersall P., F.J. Young, C. Mc comb,C.J. Hogarth, S. Safi, A. Weber, T. McDonald, A.M. Noland and J.L.
Fitzpatrick, 2001. Acute phase proteins in serum and milk from dairy cows with clinical mastitis. Vet. Rec.,
148: 35-41.
Giesecke W.H. and M.H. Vilijoen, 1974. The diagnosis of subclinical mastitis in lactating cows: a comparison of
cytological methods and a monovalent radial immuodiffusion test. J. Vet. Res., 41: 51-74.
Hirvonen, J., S. Pyorala and H. Jousimies- Somer, 1996. Acute phase response in heifers with experimentally
induced mastitis. J. Dairy Res., 63: 351-360.
Mc Dougall, S., 1998. Efficasy of two antibiotic treatments in curing clinical and subclinical treatments in
curing clinical and subclinical mastitis in lactating dairy cows. N.Z. Vet., 46: 226-232.
Menzies, F.D., D.G. Brison, T. Mccallion, and D.I. Mathews, 1995. A study of mortality among suckler and
dairy cows in Northern Ireland. Vet. Rec., 137: 531-536.
Murata, H., N. Shimada and M. Yoshika, 2004. Current research on acute phase proteins in veterinary diagnosis:
an overview. Vet. J., 168: 28-40.
Petersen, H.H., J.P. Nielsen, P.M.H. Heegard, 2004. Application of acute phase protein measurements in
veterinary clinical chemistry. Vet. Res., 35: 163-187.
211
Pitkala, A., M. Haveris, S. Pyorala, V.Myllys and T. Honkanen Buzalski, 2004. Bovin mastitis in finland 2001prevalence, distribution of bacteria, and antimicrobial resistance.J. Dairy. Sci., 87: 2433-2442.
Pyorala, S., 2003. Indicators of inflammation in the diagnosis of mastitis. Vet. Res., 34: 565-578.
Quinn, P.J., M.E. carter, B.M. Maarkey and G.R. Carter, 1994. Clinical Veterinary Microbiology. Wolfe
Publication company, UK, PP: 327-344.
Radostits, O.M., C.G. Gay, K.W. Hinchcliff and P.D. Constable, 2007. Veterinary medicine. 10th ed. Saunders
publication company, UK, PP: 697-721Rainard, P., 1987. Shoud mammary infections caused by
corynebacterium bovis and coagulas – negative staphylococci be eliminated?Ann. Rech. Vet, 18: 355-364
Sears, P.M. and K.K. Mccarthy, 2003. Diagnosis of mastitis for therapy decisions. Vet. Clin. North Am. Food
Anim., 19: 93-108.
Thomas, J.S., 2000. Over view of plasma proteins. In: Feldman, B.F., J.G. Zinkl and N.C. Jain (Eds.), Schalm’s
veterinary Hematology, fifth edition. Lippincott Williams, Wilkins, Philadelphia: 891-898.
Timms, L.L., L.H. Schultz, 1987. Dynamics and significance of coagulase – negative staphylococcal intra
mammary infections. J. Dairy Sci., 70: 2648-2657.
Tyler, J.W. and J.S. Cullor, 1990. Mammary gland health and disorders. In large animal internal medicine. 3rd
Edn. (Eds. By smith BP), Mosby, London: 1019-1022.
212
SECONDARY COPPER DEFICIENCY IN CATTLE FROM
MOLYBDENUM INTOXICATION: CLINIC AND PATHOLOGICAL
STUDY.
[HIPOCUPROSIS BOVINA SECUNDARIA A MOLIBDENOSIS: ESTUDIO
CLÍNICO, HISTOPATOLÓGICO Y HEMATOLÓGICO
Sekundarna deficijencija bakra u goveda otrovanih
molibdenom: Klinički i patološki nalaz
Bustamante Cano J1, Hernández Arroyave W.2, Gutiérrez Chávez A. J.3, Alonso Alonso
P.3, González Montaña J.3
1
2
Facultad de Ciencias Agrarias. Universidad de Pamplona. Pamplona (Colombia)
Escuela de Medicina Veterinaria y Zootecnia. Universidad de la Paz. Barrancabermeja (Colombia)
3
Departamento de Medicina, Cirugía y Anatomía Veterinaria. Universidad de León. León (España)
SUMMARY
Copper deficiency in cattle it’s the second important disease only after of phosphorus around the world,
especially in grazing conditions. There are two types of copper disorder, one for molybdenum-induced followed
for their interaction with iron (Fe), sulphur (S) and zinc (Zn) and direct copper deficiency. In Colombia region,
soils and grass have high concentrations of molybdenum and frequently to observe toxicosis cases caused for
this element. However, there are few clinical reports about this condition in this country. Therefore, the objective
for this work is described the clinic and pathological findings and changes observed in secondary copper
deficiency. All animals are reared in extensive conditions with local pastures, water and common salt. Soils
have not been applied some fertilization treatment. It was observed in some animals poor growth rates, infertility
and reproductive failure. In a lot of sixty Zebu crossbred female and males animals between 2 and 3 years old
were observed clinical signs suggested for copper deficiency. It was chosen three females and three males for
pathology study. Soil and forage samples were taken for determined molybdenum and copper levels by mean
Atomic Absorption Spectrophotometer (AAS). Some clinical signs as poor growth rates, achromotrichia, fragile
skeletal systems, anemia, infertility and reproductive failure were recorded for these animals. In four of six
animals it was observed a decrease of blood cell pack and hemoglobin concentrations. Histopathology changes
as slimming of epidermis atrophy in hair follicles and sebaceous glands, hepatic sinusoids were engorged with
blood. Most hepatocytes were degenerate or necrotic with eosinophilic cytoplasm, glomerular congestion and
lymphocyte infiltrate in parenchyma and cortex kidney. Molybdenum and copper concentrations in soil and
forage in dry season were 3.9 mg/kg and 9.0 mg/kg, respectively. Copper and molybdenum high concentrations
in soil and forage with additional information about clinic and pathological findings observed and recorded in this
study suggested the presence of secondary copper deficiency was induced for previous molybdenum toxicosis.
The bovines with symptoms were quickly recovered with copper borogluconat treatment by subcutaneous
route.
Sažetak
Nedostatak bakra u goveda je po važnosti druga bolest nakon nedostatka fosfora . Rasprostranjena je diljem
svijeta posebno u pašno držanih goveda.Postoje dva tipa poremećaja u metabolizmu bakra, prvi je uzrokovan
molibdenom, a drugi je uzrokovan zbog djelovanja iona željeza, sumpora i cinka.U regiji Columbia, zemlja i
trave sadrže visoke koncentracije molibdena i često uzrokuju otrovanja tim elementom. Zbog toga, ovaj rad
213
opisuje kliničke i patološke nalaze koji su utvrđeni kod sekundarne deficijencije bakra. Sve životinje su držane
u ekstenzivnim uvjetima pri čemu su se hranile sa autohtonom vegetacijom uz dodatak mineralnih soli. U
pojedinih životinja primjećeno je zaostajanje u rastu, neplodnost i problemi u reprodukciji. U populaciji od 60
križanih Zebu goveda različiog spola, u dobi između 2 i 3 godine starosti zamijećeni su klinički simptomi koji su
upućivali na nedostatak bakra.Za istraživanje odabrne su po tri jedinke muškog i ženskog spola. Uzeti su uzorci tla
i krme za utvrđivanje koncentracije molibdena i bakra pomoću atomske apsorpcijske spektrofotometrije(AAS).
Kod ispitivanih životinja zamijećena je kržljavost, akronotrihia, anemija, fragilan koštani sustav, neplodnost te
reproduktivne poremetnje. Kod 4 od 6 životinja primjećen je smanjen volumen krvnih stanica i koncentracija
hemopglobina. Patohistološke promjene ukjlučivale su atrofiju epidermisa, dlačnih folikula i žlijezda lojnica,
a jetrene sinusoide bile su prepunjene krvlju. Većina hepatocita bilo je degenerirano ili nekrotično , primjećena
je i kongestija glomerula i limfocitna infiltracija parenhima i srži bubrega. Utvrđena koncentracija molibdena
i bakra u tlu i krmi za vrijeme sušne sezone iznoslia je 3.9 mg/kg za molibden i 9.0 mg/kg za bakar. Visoke
koncentracije bakra i molibdena u tlu i krmi zajedno sa kliničkim i patohistološkim nalazima ukazuju na
sekundarnu deficijenciju bakra. Životinje sa simptomima otrovanja brzo su se oporavile nakon potkožne
aplikacija bakar-boroglukonata.
RESUMEN
En los rumiantes las deficiencias de cobre, después de las de fósforo, son las más frecuentes a nivel
mundial. La absorción del cobre se ve antagonizada por algunos microminerales, siendo quizá el moblideno
(Mo) el más importante, seguido del hierro (Fe), azufre (S) y zinc (Zn). Por ello en muchas ocasiones las
concentraciones elevadas de molibdeno, frecuentemente, desembocan de forma secundaria en hipocuprosis. En
algunas zonas de Colombia la intoxicación en bovinos en pastoreo por concentraciones excesivas de molibdeno
en el suelo es muy alta, aunque apenas existen estudios sobre la patología en este país. Por ello el objetivo
del presente trabajo es describir el cuadro clínico, los cambios hematológicos y las lesiones histopatológicas
halladas en algunos órganos. Todos los bovinos del hato, de raza cebú comercial, eran explotados de forma
extensiva, en praderas naturales y sin ningún programa de fertilización, disponiendo de forma permanente tanto
de agua como de sal común. La mayoría del ganado presentaba mal estado de carnes y diarrea, deficiencias
reproductivas y las hembras alcanzaban su madurez sexual tardíamente. Se seleccionaron 60 cebuinos, de ambos
sexos, con edades de dos y medio a tres años, que presentaban sintomatología compatible con molibdenosis y
de ellos se escogieron seis animales (tres machos y tres hembras) en los que se cuantificó el hematocrito y la
hemoglobina. Posteriormente se sacrificaron y se recogieron algunos órganos para el correspondiente estudio
histopatológico. Asimismo, mediante espectrofotometría de absorción atómica, se midieron las concentraciones
de molibdeno y cobre en suelo y en pastos. Los signos clínicos hallados en los animales enfermos fueron
diarrea profusa, enflaquecimiento progresivo, retardo en el crecimiento, disminución en el porcentaje de
fecundidad, dolores articulares y acromotriquia. Cuatro de los seis bovinos que fueron sacrificados presentaron
disminución en el hematocrito y en la hemoglobina, y se evidenciaron cambios histopatológicos tales como
adelgazamiento de epidermis, atrofia de anexos, folículos pilosos y glándulas sebáceas, tumefacción turbia
de hepatocitos, hiperplasia de células de Pkuffer, presencia de polimorfonucleares en sinusoides, congestión
glomerular, descamación del epitelio tubular renal y focos linfocitarios en el parénquima cortical renal. n la
época seca, en la cual se realizó el estudio, la cantidad de moblideno en el suelo fue de 3,9 ppm, mientras que el
pasto su concentración fue de 9 ppm. La valoración de las concentraciones de Cu y Mo en suelo, acompañada
de los signos clínicos y de los hallazgos hematológicos e histopatológicos permiten concluir se trata de una
hipocuprosis secundaria a una molibdenosis. Es importante destacar que el resto de animales afectados que
presentaron sintomatología respondieron positivamente al tratamiento con borogluconato de cobre por vía
subcutánea, recuperándose rápidamente.
Sažetak
Copper deficiency in cattle it’s the second important disease only after of phosphorus around the world,
especially in grazing conditions. There are two types of copper disorder, one for molybdenum-induced followed
for their interaction with iron (Fe), sulphur (S) and zinc (Zn) and direct copper deficiency. In Colombia region,
214
soils and grass have high concentrations of molybdenum and frequently to observe toxicosis cases caused for
this element. However, there are few clinical reports about this condition in this country. Therefore, the objective
for this work is described the clinic and pathological findings and changes observed in secondary copper
deficiency. All animals are reared in extensive conditions with local pastures, water and common salt. Soils
have not been applied some fertilization treatment. It was observed in some animals poor growth rates, infertility
and reproductive failure. In a lot of sixty Zebu crossbred female and males animals between 2 and 3 years old
were observed clinical signs suggested for copper deficiency. It was chosen three females and three males for
pathology study. Soil and forage samples were taken for determined molybdenum and copper levels by mean
Atomic Absorption Spectrophotometer (AAS). Some clinical signs as poor growth rates, achromotrichia, fragile
skeletal systems, anemia, infertility and reproductive failure were recorded for these animals. In four of six
animals it was observed a decrease of blood cell pack and hemoglobin concentrations. Histopathology changes
as slimming of epidermis atrophy in hair follicles and sebaceous glands, hepatic sinusoids were engorged with
blood. Most hepatocytes were degenerate or necrotic with eosinophilic cytoplasm, glomerular congestion and
lymphocyte infiltrate in parenchyma and cortex kidney. Molybdenum and copper concentrations in soil and
forage in dry season were 3.9 mg/kg and 9.0 mg/kg, respectively. Copper and molybdenum high concentrations
in soil and forage with additional information about clinic and pathological findings observed and recorded in this
study suggested the presence of secondary copper deficiency was induced for previous molybdenum toxicosis.
The bovines with symptoms were quickly recovered with copper borogluconat treatment by subcutaneous
route.
INTRODUCCIÓN
En todas las especies domésticas se ha descrito la presentación de efectos adversos por deficiencias
de Cu (Radostis y cols, 1994). Los rumiantes presentan con frecuencia concentraciones inadecuadas
de este elemento bajo una amplia diversidad de suelos, condiciones nutricionales y climáticas. Se
considera que las deficiencias de Cu son las segundas mas frecuentes en los rumiantes en todo el
mundo después del fósforo (Wikse y cols, 1992).
La carencia de este microelemento posee incidencia geográfica y ocasiona serias pérdidas
productivas en sistemas extensivos de cría bovina basados en el consumo de pasturas naturales
(Rearte, 2004; Underwood, 1997).
En los suelos de Colombia se presenta una deficiencia generalizada de cobre. De más de 500
suelos analizados por el INPEC, el 68% presentaba un contenido deficiente de este microelemento.
Estudios realizados por el Instituto Colombiano Agropecuario en la región del litoral Atlántico y en el
Valle del Magdalena Medio, demostraron la existencia de bajos niveles de cobre debido a deficiencia
primaria o secundaria (Bernal 2000, De la Cruz 1983).
Como otras deficiencias minerales, la hipocuprosis puede ser causada por un bajo aporte del
elemento en la dieta, deficiencia primaria, o bien puede ocurrir que ese aporte sea adecuado pero
que otros factores de la dieta interfieran con el aprovechamiento del Cu ingerido, en cuyo caso se
puede referir a una deficiencia secundaria o condicionada (De Rosa 2002; Quiroz 2000). En los
rumiantes, el Cu es el microelemento que mayor número de antagonistas presenta. Uno de ellos,
quizás el principal, es el molibdeno (Mo), seguido del hierro (Fe), azufre (S) y zinc (Zn) (Gooneratne
1997; Humphires y cols 1983, Keen y Graham 1989). Cuando existen concentraciones elevadas
de molibdeno, frecuentemente se presentan casos de hipocuprosis (Humphires y cols 1983). El
mecanismo por el cual se presenta esta interferencia es principalmente a nivel de rumen por la
formación de compuestos (thiomolibdatos) que se unen al Cu impidiendo su absorción (Gooneratne
1997; Humphires y cols 1983).
Son descritos varios signos clínicos en la hipocuprosis tales como anemia, infertilidad variable,
diarrea, acromotriquia, mala estructura de lana, predisposición a enfermedades infecciosas, crisis
215
hemolíticas, úlceras abomasales, polioencefalomalacia, claudicación, mala condición corporal,
disminución en la ganancia de peso y muerte súbita (E.E. A INTA 2004; NRC 1999).
Las plantas utilizadas como forrajes contienen en promedio de 8 a 11 ppm de Cu y de 3 a 5
ppm de Mo (en M.S.). Se ha comprobado que aparece molibdenosis cuando, encontrándose normal
el valor de cobre en los vegetales, el contenido de molibdeno en la planta se eleva de 6 a 10 ppm
(Radostits y cols, 1994).
MATERIAL Y MÉTODOS
En una explotación dedicada a la cría de ganado, localizado en el municipio de Yondó, Antioquia,
Colombia (75 m altitud) con una temperatura promedio entre 26ºC y 35ºC, con una humedad relativa
superior al 85% y una pluviosidad de mas de 2500 mm/año, correspondiente a bosque húmedo
tropical, se seleccionaron seis animales (tres machos y tres hembras), entre dos y medio y tres años
de edad, de un total de sesenta bovinos de la raza cebú comercial.
Estos bovinos eran manejados en sistema de producción extensiva, en praderas naturales sin
ningún programa de fertilización. La sal común (ClNa) y el agua estaban a disposición permanente
para todos los animales.
Casi todos los bovinos presentaban mal estado de carnes y diarrea. El estado reproductivo del
hato era muy bajo y las hembras alcanzaban su madurez sexual tardíamente. A estos animales se
les realizaron exámenes clínicos y a las hembras adultas se les practicó un chequeo ginecológico, a
través de palpación rectal. Adicionalmente fue realizado un examen de hemoparásitos y muestreo de
materia fecal para determinar la carga parasitaria.
Tras el examen clínico, medición del hematocrito y hemoglobina y de realizado el examen
parasitológico, se sacrificaron los seis bovinos y les fue practicado un estudio histopatológico.
Igualmente se tomaron muestras de suelo y fueron enviadas al laboratorio del Instituto Colombiano
Agropecuario (ICA), ubicado en Tibaitatá (Cundinamarca) para la cuantificación de molibdeno y
cobre a través de la técnica de espectrofotometría de absorción atómica (EAA).
En una fincas cercanas, donde las condiciones de manejo eran similares, se seleccionados al
azar 16 cebú, de un grupo de 50 bovinos machos de raza cebú comercial, y con edades entre 30 y 34
meses.
Cuantificación de cobre en el suero de los bovinos
Para la obtención del cobre sérico, a cada uno de los 16 bovinos le fueron extraídos 10 ml de
sangre sin anticoagulante mediante venopunción en yugular. Las muestras de sangre fueron remitidas
inmediatamente laboratorio de la Universidad Industrial de Santander, en Bucaramanga, donde luego
fueron centrifugadas a 3000 rpm para la separación del suero. La determinación del cobre sérico
se realizó, utilizando la técnica de espectrofotometría de absorción atómica, obteniendo valores
expresados en µmol/l.
Cuantificación del cobre en hígado
Para la cuantificación de los niveles de Cu en hígado los 16 bovinos fueron marcados y rastreados
hasta el matadero municipal. Allí se obtuvieron fragmentos de hígado, aproximadamente de 2 cm
de espesor, de cada animal. Estos fragmentos fueron conservados para su posterior procesamiento,
utilizando la técnica de espectrofotometría de absorción atómica, expresando los valores resultantes
en pates por millón (ppm).
Cuantificación de cobre y molibdeno en el suelo en el municipio de Yondó
216
Se tomaron muestras del suelo de varias fincas, en el municipio de Yondó, para cuantificar
los niveles de cobre y de molibdeno. Las muestras fueron enviadas al laboratorio del Instituto
Colombiano Agropecuario (ICA) localizado en Tibaitatá (Cundinamarca). Se utilizó la técnica de
espectrofotometría de absorción atómica con horno de grafito y se expresaron los valores en ppm.
Determinación de Cobre y Molibdeno en forrajes
Para la cuantificación de niveles de Cu y Mo en los forrajes de las fincas en estudio, se
tomaron muestras representativas tanto de gramíneas como de leguminosas que sirven como base
de la alimentación para los bovinos objeto de estudio y fueron procesadas aplicando la técnica de
espectrofotometría de absorción atómica en el laboratorio del Instituto Colombiano Agropecuario en
un equipo Perkin – Elmer con lámpara de cátodo hueco, reportando sus valores en mg/kg (ppm). Para
la recolección del material vegetal se emplearon bolsas plásticas con sellado hermético y se enviaron
refrigeradas con el fín de evitar la fuga de algún material volátil. El material vegetal fue recolectado
en las horas de la mañana y se guardó en refrigeración hasta el momento de su análisis.
CASO CLINICO
Casi la totalidad de los animales del hato, correspondiente al municipio de Yondó, presentaron
mal estado de carnes, con pelaje amarillento y mucosas pálidas. Además mostraron diarrea profusa,
de color oscuro y con espuma abundante. La diarrea se agudizó en los periodos con abundantes
lluvias. Algunos animales presentaban adelgazamiento extremo, sin embargo ninguno de los bovinos
estudiados presentó anorexia.
Tabla 1. Hallazgos histopatológicos en los bovinos del estudio en el municipio de Yondó.
Tejido
Alteración microscópica
nº de casos
Piel
Adelgazamiento de epidermis
6
Atrofia de anexos folículos pilosos y glándulas sebáceas
6
Hiperplasia de células de Pkuffer
3
Tumefacción turbia de hepatocitos
4
Presencia de polimorfonucleares en sinusoides
6
Hígado
Congestión glomerular
Riñón
Descamación epitelio tubular hacia la luz
Focos linfocitarios en parénquima cortical
Inflamación aguda
Bazo
Alta concentración de hemosiderina
6
6
6
6
2
El examen ginecológico, realizado por palpación rectal, reveló deficiente actividad ovárica.
La mayoría de las hembras adultas presentaron un útero de tamaño muy pequeño y no mostraban
manifestaciones propias del celo. El porcentaje de preñez era inferior al 50%.
Los frotis sanguíneos para evaluar hemoparásitos dieron resultados negativos, así como el resto
exámenes parasitológicos que no evidenciaron de carga parasitaria alguna.
217
El examen sanguíneo (de los 6 cebú) reveló una disminución del hematocrito en cuatro de ellos
(20%, 23%, 23% y 20%) y una reducción en la hemoglobina (6,6 mg/dl, 7,0 mg/dl, 6,7 mg/dl y 6,0
mg/dl) respectivamente.
Ante la sospecha de una posible hipocuprosis y como ensayo terapéutico, algunos bovinos del
rebaño fueron tratados con cobre vía parenteral, obteniéndose la desaparición de la diarrea dos días
después de la aplicación.
Durante la necropsia no fueron encontradas lesiones macroscópicas relevantes. En la tabla 1 se
puede apreciar como los cambios mas frecuentemente se localizaron en piel, hígado, bazo y riñón.
La medición de cobre y de molibdeno en el suelo de las fincas estudiadas arrojó una concentración
de 4,57 ppm y de 3,90 ppm, respectivamente. La concentración media del cobre en pasto fue de 10
ppm (resultado de los niveles obtenidos en los diferentes pastos muestreados).
DISCUSIÓN
Los resultados del examen clínico practicado a los bovinos, asociados a los hallazgos de las
necropsias, invitan a pensar que estos animales estaban padeciendo una deficiencia de cobre. La
alta concentración de molibdeno, presente en los suelos de la zona donde se realizó este estudio,
implica un alto consumo de este mineral por parte de los animales, dada la interrelación suelo - planta
– animal para cada elemento en particular.
En general el cuadro clínico presentado por los bovinos, es coincidente con el comunicado por
otros autores acerca de la hipocuprosis secundaria a molibdenosis (Balbuena y Mastandrea 1992;
Brem y cols 2002; Quiroz y Bouda 2000).
Es importante destacar el mal estado de carnes presentado por la mayoría de los animales, e incluso
con adelgazamiento extremo en algunos casos, a pesar de la exuberancia de las pasturas. Similares
condiciones corporales fueron observadas en recientes estudios al provocar experimentalmente
una hipocuprosis al suministrar molibdeno, en forma oral, en bovinos de raza Brangus (Brem et al,
2002).
La presentación del cuadro diarreico, con heces de coloración verde oscura y presencia de
espuma, es frecuentemente observada en la hipocuprosis secundaria ocasionada por un exceso de
molibdeno. Se mencionan dos mecanismos fisopatologicos, una atrofia acinar pancreática debida
a la excesiva peroxidación de los lípidos de membrana y la infiltración de proteasas séricas o bien
una alteración en la conformación de la mucosa intestinal. La lisil oxidasa participa en la síntesis de
colágeno y elastasa, por lo que su deficiencia causa una mala conformación del tejido; además, la
disminución de citocromo oxidasa promueve la atrofia de vellosidades (Suttle 1986).
La acromotriquia posiblemente se debe a la deficiencia de cobre en el organismo. Es conocido
que el cobre es necesario en la síntesis de la polifenil oxidasa tirosinasa. Esta enzima es utilizada en
la transformación de la tirosina en melanina y dopamina. La melanina es responsable del color de la
piel y del pelo. En la hipocuprosis el pelo de color negro se torna rojizo, mientras que los pelajes rojos
adquieren un aspecto amarillento (Grace 1994).
La anemia observada, en estos bovinos, es coincidente con la hallada por otros autores (Brem y
cols 2002; Humphires y cols 1983; Quiroz y Bouda 2000) y puede ser ocasionada por la deficiencia
de cobre; pues este elemento participa de manera crucial en el metabolismo del hierro, fundamental
para la formación de hemoglobina principal componente del eritrocito (Balbuena y Mastandrea 1992;
Quiroz y Bouda 2000). Cuando la hemoglobina disminuye, se limita la absorción del cobre, así como
su contenido total en el cuerpo y por tanto se ven la movilización a los tejidos se ven disminuidas. El
218
hierro se absorbe como Fe++ y se transporta como Fe+++, pero esta conversión requiere de una enzima
dependiente del cobre, la ferroxidasa II (Tanner y cols 1988; Tocarnia 1968). El resultado final, es
una anemia microcítica hipocrómica grave.
Aunque todavía es incierto el papel de la hipocuprosis en la infertilidad, se ha sugerido que el
problema es debido más al aumento de molibdeno que a la deficiencia primaria de cobre. Sin embargo,
existen informes que señalan a la hipocuprosis secundaria a la molibdenosis como causa directa de
problemas en la fertilidad (Phillipo 1987). Entre los efectos adversos que causa la hipocuprosis está
la alteración de la duración del ciclo estral llegando a veces al anestro, retrasos en la pubertad,
alteraciones en la ovulación, presencia de ovarios quísticos y reducción de los índices de concepción
(Brem y cols 2002; Graham 1991; Under 1997). La reducción o supresión del estro y la muerte
embrionaria han sido identificadas como síntomas comunes en la deficiencia de cobre en ganado
de carne (Underwood 1997; Suttle 1986). En un estudio reportado por Phillipo et al (1987) novillas
consumiendo una dieta con niveles marginales de Cu y altas en molibdeno exhibieron retraso en la
pubertad, baja índices de ovulación y baja tasa de concepción comparadas con novillas que recibieron
una dieta conteniendo altos niveles de cobre. Igualmente, en estudios realizados en la región del
nordeste argentino en suelos ricos en molibdeno, el suministro de cobre vía oral a novillas provocó
resultados muy positivos sobre la fertilidad (De Rosa 2002). En la misma línea, en Cuba, se demostró
que la aplicación de cobre en ganado lechero afectado de hipocuprosis mejoró ostensiblemente la
fertilidad de las hembras (Garcia y cols 2006).
Los hallazgos anatomopatológicos indican alteraciones provocadas por una deficiencia de cobre
(Blakley 1987; Graham 1991; Gooneratne 1989). En este sentido Tokarnia et al (1987) describen
hemosiderosis en hígado, bazo y ganglios linfáticos de bovinos con deficiencia de cobre.
Por tanto, bajo las condiciones de este estudio, es posible señalar que el cuadro clínico, los hallazgos
histopatológicos y los cambios hematológicos encontrados en los bovinos en el municipio de Yondó
corresponden a una hipocuprosis secundaria a molibdenosis. Además, las altas concentraciones de
molibdeno encontradas en el suelo de este municipio, pueden estar reafirmando este diagnóstico.
Como hemos indicado la concentración media del cobre en pasto fue de 10 ppm, alterándose
la normal relación que según algunos autores (Radostits y cols, 1994; de Rosa, 2002) debe tener
normalmente el suelo y las plantas (Cu:Mo 2:1).
BIBLIOGRAFIA
Balbuena O, Mastandrea R. Clinical symptoms of cattle grazing on melilutus alba with high molybdenum
concentration in the central Chaco area. Vet Arg. 1992; 9: 612-615.
Bernal J. El cobre en los suelos, pastos y animales. Asociación Colombiana de Criadores de Ganado Cebú. 2000;
315: 28 – 33.
Blakley BR, Hamilton, DL. The effect of copper deficiency on the immune response in mice. Drug Nutr Interact
1987; 5: 103-111
Brem JJ, Mestre J, Pochon D.O, Trulls HE. Alteraciones del ciclo estral provocadas por un alto ingreso de
molibdeno en vaquillonas Brangus y su respuesta a la suplementación con cobre. Rev Vet Arg. 2002; 13:
2001-2002
De la Cruz ML, GIL A. Contenido de molibdeno y cobre en pastos y su relación con algunos tejidos y enzimas
del bovino en el litoral Atlántico Colombiano. Rev ICA 1983; 18: 279-281.
DE Rosa, Mattioli GA. Metabolismo y deficiencia de cobre en los bovinos. Analecta Veterinaria. 2002; 22: 716.
E.E.A INTA. Animales sin cobre. Rev Brangus. 2004; 26:64-66.
219
Garcia J, Cuesta Mario, Pedroso R, Gutierrez M, Mollineda A, et al. Efecto del cobre sobre la reproduccion en
novillas lecheras de Cuba. Rev MVZ Cordoba. 2006; 11: 790 - 798.
Gooneratne SR, Buckley WT, Christensen DA. Review of copper deficiency and metabolism in ruminants. Can
J Anim Sci. 1989; 69: 819-845.
Gooneratne SR, Howell JMc, Gamthorne JM. Intracellular hepatic distribution of copper in normal and copper
loaded sheep. Res Vet Sci. 1997; 27: 30-37.
Grace N. Managing trace elements deficiencies New Zealand: Ag Research, New Zealand Pastoral Agriculture
Research Institute Ltd. 1994.
Graham TW. Trace element deficiencies in cattle. Vet Clin North Am: Food Anim Pract. 1991; 7: 153-215.
Hill R, Thambyah R, Wan SP, Shanta CS. The copper status of cattle and buffalo in Malaya. J Agric Sci. 1962;
59: 409-414.
Humphires WR, Phillippo M, Young BW, Bremner I. The influence of dietary iron and molybdenum on copper
metabolism in calves. Br Nutr. 1983; 49: 77-86.
Keen CL, Graham TW. Trace elements. In: Kaneko JJ, editor. Clinical biochemistry of domestic animals. 4th ed.
San Diego (Ca): Academic Press. 1989: 271-83.
NRC. Nutrient Requirements of Beef Cattle. 7th ed. National Research Council, National Academy Press,
Washington, DC; 1996.
Phillippo M, Humphries WR, Garthwaite PH. The effect of dietary molibdenum and iron on copper status,
puberty, fertility and estrous cycles in the cattle. J Agric Sci. 1987; 109: 321-336.
Quiroz-Rocha GF, Bouda J. Fisiopatología de las deficiencias de cobre en rumiantes y su diagnóstico. Vet Méx.
2000; 32: 289-296.
Radostis O.M, Blood D.C, Gay C.C. Veterinary Medicine 8th ed London (UK): Bailliêri Tindall. 1994.
Rearte D. Situación de la Ganadería Argentina. Instituto Nacional de Tecnología Agropecuaria, INTA. URL:
www.inta.gov.ar/expo/intaexpone/charlas.htm. 2004
Suttle NF. Problems in the diagnosis and anticipation of trace element deficiencies in grazing livestock. Vet Rec.
1986; 119: 148-152
Tanner DQ, Stedinick J.D, Leininger W.C Minimal herd sample size for determination of blood copper status of
cattle. J Vet Med Assoc. 1988;192: 1074-76.
Tokarnia CH, Canella CFC, Guimarães JÁ, Döbereiner J. Deficiência de cobre e cobalto em bovinos e ovinos
no Nordeste e Norte do Brasil. Pesq Agropec Bras. 1968; 3: 351-360.
Underwood EJ. Trace Elements in Human and Animals Nutrition. 4th ed. New York. Academic Press. 1997.
Under AP. Some nutritional factors affecting the fertility of dairy cattle. New Zealand Vet J. 1997; 25: 305308.
Wikse SE, Herd D, Field R, Holland P. Diagnosis of copper deficiency in cattle. J Am Vet Med Assoc. 1992;
200: 1625-29.
220
NEONATAL PERIOD AND HAIR CORTISOL IN CATTLE AS A MARKER
OF STRESs
NEONATALNO RAZDOBLJE I DLAČNI KORTIZOL U GOVEDA KAO
MARKER STRESA
Comin A.1, Tidu L.2, Cornacchia G.3, Cappa A.4, Renaville B.1, Prandi A.1
Dipartimento Scienze degli Alimenti, Sezione Fisiologia Veterinaria e Nutrizione, Università Degli Studi di
Udine, Italy
1
Centro Veterinario Militare Veterinary, Grosseto, Italy
2
Veterinary Mantova, Italy
3
4
Agronomist, Vicenza, Italy
ABSTRACT
Cortisol is a key component of the physiological response to stress. It is involved in several events during
peripartum period and it is very important for the beginning of parturition. The aim of this work was to test
cortisol in the hair of neonatal calves and cows to determine its significance as biomarker of neonatal stress. The
cortisol was assessed on new hair growth samples from 21 calves on the day of parturition and to six months
old; from 49 cows after the parturition and 257 non pregnant dry cows not exposed to stress and healthy
(controls). Hair cortisol was extract by methanol and analysis was carried out using the RIA method. The
hair cortisol concentration in calves on the day of parturition was significantly higher (P<0.0001) than at six
months (24.30 ± 2.18 vs 5.90 ± 0.56 pg/mg) and than controls (3.96 ± 0.16 pg/mg). The cortisol level in calves
at 6 months was similar than in cows after the parturition (5.74 ± 0.37 pg/mg) and significantly higher than in
controls. These results suggest that neonatal but also postnatal period in calves are very stressing conditions and
hair cortisol is a potential stress biomarker which could be very useful in valuate the cow welfare. Grant MIUR
2005
KEY WORDS: hair cortisol, stress, cattle
Sažetak
Kortizol je ključna komponenta fiziološkog odgovora na stres. On je uključen u nekoliko procesa tijekom
peripartalnog razdoblja, a veoma je bitan i za sam početak poroda. Cilj ovog rada bio je odrediti kortizol u dlaci
novorođene teladi te u krava kako bi se odredila njegova uloga biomarkera stresa u novorođenih životinja.
Kortizol je određivan na uzorcima novoizrasle dlake 21-og teleta, na dan poroda te nakon 6 mjeseci; na 49 krava
nakon poroda te u 257 negravidnih, zasušenih, zdravih krava neizloženih stresu (kontrola). Dlačni kortizol je
ekstrahiran metanolom, a analiza je učinjena RIA postupkom. Razina kortizola u dlaci teladi bila je znakovito
viša na dan poroda (P<0,0001), nego nakon 6 mjeseci (24,30 ± 2,18 vs 5,90 ± 0,56 pg/mg) i u kontrolnoj skupini
(3,96 ± 0,16 pg/mg). Razina kortizola u teladi nakon 6 mjeseci bila je slična kao u krava nakon poroda (5,74 ±
0,37 pg/mg) i znakovito viša nego u kontrolnoj grupi. Ovi rezultati ukazuju da je neonatalno kao i postnatalno
razdoblje u teladi veoma stresno stanje te je dlačni kortizol mogući biomarker stresa koji može biti veoma
koristan u procjeni stanja dobrobiti krava.
Ključne riječi: dlačni kortizol, stress, govedo
INTRODUCTION
Transition from pregnancy to lactation in dairy cow involves considerable metabolic adaptation
that induce stress in the animals. Many different hormones are involved in the stress response
221
(Matteri et al, 2000). Among these ones, cortisol is recognized as a stress hormone and is involved
in initiation of parturition and in various events during peripartum period. Indeed the timing of
parturition is dependent on a cascade of endocrine signals from fetal hypothalamo-pituitary-adrenal
axis (McMillen et al 1995) and it is a physiological event that involves stress in mother and calf.
As well neonatal period is a critical phase of the animal’s life cycle. In this period, the metabolic
adaptation which requires immediate changes in the endocrine regulatory molecules, would be
compromised by postparturient mastitis or other infections as well as by environmental changes as
social regrouping or relocation or by weaning. All these events are responsible of noticeable stress.
The concentration of cortisol is widely used an indicator of stress and the hormone is currently tested
in blood, saliva, urine and faeces (Negrao et al, 2004; Mostl et al., 2002; Hay et al., 1998). Blood,
saliva and urine collection needs manipulation of the animal which cause stress and might alter the
cortisol levels.in the samples.
An alternative source for hormones may be found in hair, which can be collected noninvasively.
Hair is easy to obtain, to store and to transport. The analysis is unaffected by the stress of capture
(Yang 1998) or by acute stress. Incorporation of hormones in hair is thought to occur mainly via
blood circulation during the formation of the hair shaft (Conn, 1996).
The measurement of cortisol in hair has already been validated in humans, rhesus macaques,
dogs and cats (Davenport et al., 2006; Accorsi et al, 2008; Villain et al., 2004). Since hair grows
approximately 0.4 cm/week, a hair sample of 2-4 cm reflect average hormone levels over months and
it is used to evaluate cortisol variations in the long-term and a condition of chronic stress.
The aim of this work was to measure cortisol in hair of neonatal calves and cows to determine
its significance as biomarker of neonatal stress.
The cortisol was assessed on new hair growth samples from 21 calves on the day of parturition
and to six months old; from 49 cows after the parturition and 257 non pregnant dry cows not exposed
to stress and healthy (controls).
The hair samples were carefully taken with clippers from the animal’s forehead. The calves were
shaved at birth and then six months later, always in the same area. The hair samples were stored
in dry tubes at room temperature until analysis. Hair strands were washed in 5 ml isopropanol, as
suggested by Davenport et al. 2006 and hair cortisol extraction was determined as described by
Koren et al. (2002), modified by Accorsi et al. (2007). Hair cortisol analysis was carried out using the
RIA method described by Tamanini et al. (1983). Intra-assay and inter-assay were 5.45% and 9.6%,
respectively. The sensitivity of the method was 0.21 pg/mg.
RESULTS
The concentrations of hair cortisol in newly born calves were very high (24.30 ± 2.18 pg /mg)
and significantly different (P <0.0001) than those detected in the same animals to six months old
(5.90 ± 0.56 pg /mg) (Figure 1). Hair cortisol in cows after the parturition (5.74 ± 0.37 pg/mg)
was similar to concentration in calves to six month old. The value in calves and in cow after the
parturition was significantly higher (P<0.001) with respect to levels detected in non pregnant dry cow
(3.96 ± 0.16 pg/mg) (Figure 2).
222
30
hair cortisol pg/mg
25
20
15
10
P<0.0001
5
0
c alv es at parturition
s ix -month old c alv es
Figure 1. Hair cortisolo level in calves.
30
hair cortisol pg/mg
25
20
15
10
P<0.001
5
0
c ow at parturition
non pregnant dry c ow s
Figure 2. Hair cortisolo level in cow.
DISCUSSION
In this study we used a new matrix for measurement of cortisol levels in cow. This assay has
limitations but also notable advantages associated with method of sample collection, storage and
sending. The hair hormone concentrations reflect average levels over month and non acute levels.
Hair cortisol level has potential as biological marker for chronic stress.
Critical phases of cows life cycle, which may induce stress, include neonatal period, postpubertal
reproduction and lactation. In this study we analyzed the hair cortisol levels in calves and cows on
the day of parturition and we compared them with those in non-pregnant dry cows. The non-pregnant
dry cows are animals not exposed to stress and healthy and can be considered a representative
control.
We haven’t chosen calves as control because, in high yielding dairy farms, during the first years
of life calves are subject to changes in biological state (weaning and puberty) and management.
223
Pregnancy and parturition can be considered a highly stressful period for the calves which contributes
to increase hypercortisolemia. The mechanism of labour coincides with a highly stressful time for
the calf. High cortisol concentrations found in calves at labour are essential for the beginning of
parturition and are the expression of stress period. The process that led to this high incorporation in
the hair, had a significant duration comparable to a chronic stress. In six months old calves, cortisol
levels decreased about four times. Hence, it may be inferred that the stress associated at birth is
overcame. However, the cortisol concentrations found at six months of age are statistically lower than
those found at birth but similar to those of cows at parturition. Stressful conditions in livestock like
weaning, social regrouping and relocation, factors typical of neonatal period, can explaine these high
levels. Indeed changes in social groups, new animals introduction into a group, resulting in increased
social stress and reduction feed intake (Boe and Faerevik, 2003). Frequent regrouping may to lead to
signs of chronic stress, such reduced growth rate, immune responses and health, although less than
other species (Veissier et al., 2001). An increased susceptibility to disease in neonatal calves may be
attributable to high corticoid levels that influence immune reaction (Anderson et al., 1999). Disease
incidence is a major cause of reduced performances and survival of neonatal dairy animals (McGuire
et al,1976).
In conclusion hair cortisol level has potential as biological marker for chronic stress during
pregnancy and neonatal period and can be used to evaluate animal welfare.
REFERENCES
Accorsi PA, Carloni E, Valsecchi P, Viggiani R, Gamberoni M, Tamanini C, Seren E. 2008. Cortisol determination
in hair and faeces from domestic cats and dogs. Gen Comp Endocrinol. 155(2):398-402.
Anderson B.H., Watson D.L. and Colditz I.G. 1999. The effect of dexamethasone on some immunological
parameters in cattle. Vet. Res. Commun. 23: 399-413.
Boe K.E. and Faerevik G. 2003 Grouping and social preferences in calves, heifers and cows. Appl. Anim. Behav.
Sci. 80: 175-190.
Conn P.M. 1996. Mechanisms of drug incorporation into hair. Ther. Drug Monit. 18: 434-443.
Davenport MD, Tiefenbacher S, Lutz CK, Novak MA, Meyer JS. 2006. Analysis of endogenous cortisol
concentrations in the hair of rhesus macaques. Gen Comp Endocrinol. 147: 255-61.
Hay M., Mormede P. 1998. Urinary excretion of catecholamines, cortisol and their metabolites in Meishan
and large white sows: validation as a non-invasive and integrative assessment of adrenocorrtical and
sympathoadrenal axis activity. Vet res. 29: 119-128.
Koren L., Mokady o., Karaskov T., Klein J., Koren G., Gleffen E. 2002. A novel method using hair for determining
hormonal levels in wildlife. Anim. Behav. 63: 403-406.
Matteri R.L., Carroll J.A., Dyer C.J. 2000. Neuroendocrine responses to stress. In: Morberg GP, Mench JA,
editors. The biology of animal stress. CABI Publishing, p. 123-146.
McGuire T.C., Pfeiffr J.M., Weikel J.M., and Bartsch R.C. 1976. Failure of colostral immunoglobulin transfer in
calves dying of infectious disease. J. Am. Vet. Med. Assoc. 169: 713.
McMillen I.C., Phillips I.D., Ross J.T., Robinson J.S., Owens J.A. 1995. Chronic stress—the key to parturition.
Reprod. Fertil. Dev. 7: 499-507.
Mostl E., Maggs J.L., Schrotter G., Besenfelder U., Palme R. 2002. Measurement of cortisol metabolites in
faeces of ruminants. Vet. Res. Comm. 26: 127-139.
Negrao J.A., Porcionato M.A., de Passille A.M., Rushen j. 2004. Cortisol in saliva and plasma of cattle after
ACTH administration and milking. J. Dairy Sci. 87:1713-1718.
224
Tamanini C, Giordano N, Chiesa F, Seren E. 1983. Plasma cortisol variations induced in the stallion by mating.
Acta Endocrinol 102:447-450
Veissier I., Boissy A., dePassilé A.M., Rushen J., van Reenen C.G., Roussel S., Andanson S., and Pradel P. 2001.
Calves’responses to repeated social regrouping and relocation. J. Anim. Sci. 79:2580-2593.
Villain M., Cirimele V., Kintz P. 2004. Hair analysis in toxicology. Clin.Chem. Lab. Med. 42: 1265-1272.
Yang H.Z., Lan J., Meng Y.J., Han D.W.1998. A preliminary study of steroid reproductive hormones in human
hair. J. Steroid Biochem. 67: 447-450.
225
226
Diseases of sheep on Croatian islands
Bolesti ovaca na hrvatskim otocima
Kostelić1, A., Branka Artuković2, R. Beck2, M. Benić3, M. Cergolj2, I. Štoković2,
Z. Barać3
Faculty of Agriculture, University of Zagreb, 10 000 Zagreb, Svetošimunska 25, Croatia
1
Faculty of Veterinary medicine, University of Zagreb, 10 000 Zagreb, Heinzlova 55, Croatia
2
3
Croatian Veterinary Institut, Zagreb, Savska cesta 143, Croatia
Croatian livestock center, Zagreb, Ilica 101, Croatia
4
Contact: Mr.sc. Antun Kostelić, DVM,University of Zagreb Faculty of Agriculture. Phone +385 12393915;
E-mail: [email protected]
Abstract
According to the Croatian Livestock Centre’s data (2006) over 100.000 sheep are bred on the islands for
the purpose of producing meat (lambs) and milk (cheese). The majority are raised on the islands of Krk, Cres,
Rab, Pag and Brač. Autochthonous (island) breeds predominate on these islands while Istrian and crossbreed
sheep are represented in smaller numbers. The sheep are kept extensively and feed on the numerous types of
Mediterranean plants there. During the winter period, they are fed on hay, concentrats and pelleted alfalfa.
The aim of our research was to establish which diseases affect the health of sheep on Croatian islands. The
study was carried out on 40 flocks on the islands of Cres, Krk, Rab, Pag and Brač from 2004 to 2007. The
following diagnostic methods were used: clinical examination, necropsy, serological blood tests and coprology
tests. It was established that they most frequently suffered from parasitical, infectious and digestive system
diseases. The following internal parasites were found: gastrointestinal nematodes, Eimeria sp., Protostongylus
sp., Dicrocoelium dendriticum, Fasciola hepatica, Paramphistomum sp., Nematodirus sp., Moniezia
sp, Haemmonchus contortus. and Trichuris sp.. As far as external parasites are concerned, the presence of
Rhipicephalus and Ixodes ticks were established. Invasion of Melophagus ovinus was identified on the island of
Rab. The parasites most frequently affect the health of lambs and young sheep. The presence of abscesses caused
by puncture wounds was also established in the sheep. Clinical mastitis was diagnosed on all islands indicating
the bacteria Staphylococcus aureus as the major causative agent. The following infectious diseases were found:
enterotoxemia, actinobacillosis, contagious ecthyma, footrot and the Brucella ovis infection. As far as diseases
of the digestive system are concerned, bloat was found, as well as various forms of indigestion, which are a
consequence of overfeeding on green grass, figs or acorns. Diarrhoea widely occurs in sheep since they lick
sea salt the so-called posolica drifted by a north-eastern wind to the areas where sheep are bred. Most diseases
identified in the study can be prevented and controlled by implementing elaborate safety precautions. When
choosing precautions, both breeders and veterinarians have to take account of the size of a flock, objective and
stage of production, breeding area, epizootiological situation, diseases identified in the flock so far and season.
Key words: diseases, sheep, Croatian islands
SAŽETAK
Prema podacima Hrvatskog stočarskog centra (2006) na hrvatskim otocima se uzgaja preko 100 000 ovaca
s ciljem proizvodnje mesa (janjetine) i mlijeka (sira). Većina populacije se uzgaja na Krku, Cresu, Rabu, Pagu
i Braču. U uzgojima prevladavaju autohtone (otočke) pasmine: paška, creska, krčka, rapska (škraparica), dok
su istarska i križane ovce zastupljene u manjem broju. Ovce su držane ekstenzivno pri čemu se hrane brojnim
vrstama mediteranskog bilja. U zimskom razdoblju dohranjuju se sijenom, smjesom i peletiranom djetelinom.
Cilj našeg istraživanja bio je utvrditi bolesti koje ugrožavaju zdravlje ovaca na hrvatskim otocima. Istraživanje je
227
provedeno u 40 stada ovaca na Krku, Cresu, Rabu, Pagu i Braču u razdoblju od 2004. do 2007 godine. Korištene
su slijedeće dijagnostičke metode: klinički pregled, razudba, serološka pretraga krvi i koprološka pretraga.
Koprološkom pretragom utvrđeni su slijedeći paraziti: gastrointestinalni nematodi, Eimeria sp., Protostongylus
sp., Dicrocoelium dendriticum, Fasciola hepatica, Paramphistomum sp. Nematodirus sp., Moniezia sp.,
Haemmonchus contortus i Trichuris sp. Od vanjskih parazita na otocima je utvrđena invazija krpeljima rodova
Rhipicephalus i Ixodes. Na otoku Rabu je utvrđena invazija i Melophagus ovinus. Utvrđeno je da paraziti najviše
ugrožavaju zdravlje janjadi i mladih ovaca. Zatim je utvrđena prisutnost apscesa koji najčešće nastaju kao
posljedica ubodnih rana. Klinički oblik mastitisa je utvrđen na svim otocima, a kao najčešći uzročnik je izoliran
Staphylococcus aureus. Od zaraznih bolesti dijagnosticirane su: enterotoksemija, aktinobaciloza, zarazni
ektim, zarazna šepavost i infekcija ovnova Brucellom ovis. Od bolesti probavnog sustava dijagnosticirani su
pjenušavi nadam i različiti oblici indigestija koji nastaju kao posljedica prežderavanja zelenom travom, žirom
ili smokvama. U ovaca se često javlja proljev zbog lizanja morske soli tzv. posolice koju je bura nanijela na
površine gdje se drže. Većina bolesti utvrđenih našim istraživanjem može se spriječiti i suzbiti provedbom
temeljitih preventivnih mjera. Kod odabira mjera uzgajivači i veterinari moraju uzeti u obzir veličinu stada, cilj
i stadij proizvodnje, područje držanja, epizootiološku situaciju, dosadašnje bolesti utvrđene u stadu i godišnje
doba.
Ključne riječi: ovce, bolesti, hrvatski otoci
Introduction
According to the Croatian Livestock Centre’s data (2006) over 100.000 sheep are bred on the
islands for the purpose of producing meat (lambs) and milk (cheese). The majority are raised on the
islands of Krk, Cres, Rab, Pag and Brač. Autochthonous (island) breeds predominate on these islands
while Istrian and crossbreed sheep are represented in smaller numbers.The sheep are kept extensively
(Pict. 1) and feed on the numerous types of Mediterranean plants there.
Picture 1
During the winter period, they are fed on hay, concentrats and pelleted alfalfa.Such sheep
breeding favours development of numerous diseases bringing a fall in production and sheep deaths
quite often. Supported by the Centre for Sustainable Development of Northern Adriatic Islands and
228
Ministry of Agriculture, Fisheries and Rural Development a study was carried out objective of which
was to determine which diseases exist among sheep flocks on the islands. Apart from diseases, safety
precautions have been identified that might fight and prevent them.
Materials and working methods
The study was carried out on 40 flocks of native and crossbreed island sheep breeds on the islands
of Cres, Krk, Rab, Pag and Brač from 2004 to 2007. The flock size ranged between 20 and 400 sheep.
The following diagnostic methods were employed: clinical examination, autopsy, serological blood
test and parasitological and bacteriological tests. Some diseases were determined on the strength of
data on development and course acquired from breeders.
The study found diseases among flocks of native and crossbreed sheep breeds in most cases to be
a consequence of an extensive way of breeding and insufficient feeding. Diseases occur individually
and only rarely a larger number of sheep or a whole flock develop a disease. Sheep health on the
islands is primarily harmed by parasitic invasions, insufficient feeding and watering while infectious
diseases occur rarely.
Coprological tests proved sheep on the islands of Cres, Krk, Rab, Pag and Brač to be most
often exposed to invasions of mostly identical parasites. A sheep breeding location on single islands
provokes invasions of single parasites. Coprological tests and necropsy identified the following
parasites: gastrointestinal nematodes, Eimeria sp., Protostongylus sp., Dicrocoelium dendriticum,
Fasciola hepatica, Paramphistomum sp. Nematodirus sp., Haemmonchus contortus,Moniezia sp. i
Trichuris sp. Kostelić et. al.(2005) mention the majority of sheep flocks on the island of Rab and Pag
is invaded by gastrointestinal parasites andEimeria sp. On the island of Rab as against the island of
Pag a larger number of sheep is invaded by a small fluke (D. dendriticum) whereas a larger number
of Nematodirus sp was determined on the island of Pag. Our study revealed the presence of D.
dentriticum, Protostongylus sp., Moniezie sp., Eimerie sp. and gastrointestinal parasites on all the
islands included in the study. Not only coprological tests, but also dissection proved sheep were
invaded by a small fluke in which process a large number of D. dendriticum was found in bilial ducts
of sheep and lambs from the island of Cres. Čanković and Džakula (1988) quote D. dendriticum
invasions are determined in craggy areas and on the islands of Cres and Brač as well as the fact the
disease is rarely visible in clinical terms. Our study found the presence of D. dendriticum in sheep
flocks on all the islands included in the study. Čanković and Džakula (1988) and Jensen and Swift
(1982) claim most determined parasites pose a threat to lamb and younger sheep health while causing
clinical signs to elderly sheep only in certain circumstances such as insufficient feeding.
So far as external parasites on the islands are concerned tick invasion of Rhipicephalus and Ixodes
genus were identified causing allergic reactions on the spot stung and anaemia and the so called
“tick paralysis” in lambs, if invasions were stronger. Invasion of Melophagus ovinus was identified
on the island of Rab. The dissection of several sheep found verminous pneumonia following an
infestation by small lungworms. Parasitological invasions are mainly caused by both slow growth
and productivity of native island sheep breeds.In rare cases these may lead to death, as this is the case
of verminous pneumonia.
With respect to infectious diseases, enterotoxemia, contagious ecthyma, footrot, actinobacillosis
and ram infection Brucellom ovis were identified. Enterotoxemia was diagnosed on all islands
occurring individually as a result of lamb’s overeating milk or cereals used for supplemental feeding.
Cvetnić (2002) and Pugh (2002) say mortality of a two-to-three-week-old lamb is 100%, which
was also proved by our study. Our study revealed the presence of contagious ecthyma on all the
islands included in the study. On the island of Krk infectious sheep footrot was diagnosed that has
229
not been eradicated yet. According to the data acquired from breeders, the disease occurred some
ten years ago after infected sheep were transported to the island from the mainland causing spread
of the disease in several flocks around Malinska. Cvetnić (2002) says the disease is to fight most
successfully in summer by removing a wall horn and treating a hoof with 5% copper sulphate or
formalin. Additionally, he mentions vaccination as one of the measures; however, immunity lasts
from 4 to 12 weeks so that the author raises the question over economic cost-effectiveness of such
a prophylaxis. Actinobacillosis (PicT. 2) was diagnosed in one case of a two-year-old sheep on the
island of Rab.
Picture 2
The Croatian Veterinary Institute data report on a ram infection by Brucella ovis identified on
the island of Krk. It was established that the infected rams had been purchased in the area of Istria
and then transported to the island of Krk without veterinary surveillance. Cvetnić (2002) alludes to B.
ovis as the commonest cause of infection in rams releasing the bacteria by sperm, which significantly
reduces their fertility. B. ovis and infectious footrot occur strictly due to the vicinity of and connection
to the mainland of the island of Krk as well as ignorance and veterinary regulation infringement by
single breeders. Clinical mastitis was diagnosed on all islands indicating the bacteria Staphylococcus
aureus as the major causative agent. When dealing with dairy animals, owners seek veterinarian’s
help while they do not do so when sheep aimed at producing lamb are involved. Ruminal bloat
was found to occur in sheep occasionally as a consequence of their overeating of acorns and figs.
Forenbacher (1975) says ruminal bloat is a rare and more dangerous sheep disease when compared
to bovine cattle. He adds the disease develops fast and may cause death of a larger number of sheep.
Breeders treat acute ruminal bloat quite successfully by applying olive oil to rumen. Necropsy of a
ram from the island of Pag found pieces of a plastic bag in the rumen contents (Pict. 3).
230
Picture 3
Forenbacher (1975) says the existence of foreign objects in the rumen indicates monotonous
nutrition or meals lacking in some minerals and proteins. Since the aforementioned ram was bred in
the area of sparse vegetation it may be concluded that the cause of its peculiar appetite was monotonous
nutrition that is lacking in both quality and quantity. Diarrhoea widely occurs in sheep since they lick
sea salt the so-called posolica drifted by a north-eastern wind to the areas where sheep are bred.
Breeders have to provide sheep with larger amounts of drinkable water to prevent dehydration caused
by diarrhoea. Abscesses were found on all islands mostly on sheep’s heads. These were identified
to be a result of a puncture wound received when sheep pass through the bushes. In most cases a
bacteria Archanobacterium pyogenes was isolated from the abscesses contents (pus). A rare case of
basosquamosa skin carcinoma (Pict. 4) was reported in a four-year-old sheep on the island of Cres.
The same sheep also developed verminous pneumonia.
Picture 4
231
On the island of Cres a similar death of 9 sheep was detected that were caused by urea poisoning
used in spreading manure on the olive-groves. Deaths of three sheep and two lambs caused by
lightning in bed weather were reported on the island of Rab. Non-native game inflicts untold damage
to sheep breeding on the island of Cres (wild boars) and Rab (jackal). Damage done by wild boars is
multiple: they knock down dry stone walls (a part of cultural heritage), frighten sheep causing them
severe injuries (bone fractures), make sheep produce up to 40% less milk due to stress and eat lamb
and attack sheep in the lambing period. Although it is an unknown how jackals have appeared on the
island of Rab, they have slaughtered more than 200 sheep and lambs over the last two years. Sheep
breeders seek veterinary help rarely, except when a larger number of head is involved since service
charge is (too) high and often exceeding the value of the animal. Most diseases identified in the
study can be prevented and controlled by implementing elaborate safety precautions. When choosing
precautions, both breeders and veterinarians have to take account of the size of a flock, objective and
stage of production, breeding area, epizootiological situation, diseases identified in the flock so far
and season. The fighting of parasitic invasions must be systematic and continuous while choosing a
drug and treatment season should be based on the results of coprological tests and production stage.
Making sheep used to green pasture and cereals within ten days can fight various forms of indigestion.
A sufficient amount of drinkable water must be provided without regard to pasture quality and the
sheep breeding area. As far as the fight against the occurrence of contagious diseases is concerned,
such as footrot and B. ovis, breeders are obliged to adhere to veterinary regulations when purchasing
and introducing new sheep to a flock i.e. to the island. Taking into account the population size, way
of breeding and diseases identified in flocks of native island sheep breeds the study has proved a wellknown fact that we are dealing with modest yet quite resistant animals.
References
Cvetnić, S. (2002): Bakterijske i gljivične bolesti životinja, Medicinska naklada, Zagreb.
Čanković, M., N. Džakula(1988).Invazione bolesti ovaca i koza. U «Bolesti ovaca i koza», Spectrum, Zagreb,
133-188.
Forenbacher, S. (1975): Klinička patologija probave i mijene tvari domaćih životinja, svezak I/1 klinička
patologija probave i resorpcije. JAZU i Sveučilišna naklada Liber, Zagreb.
Hrvatski stočarski centar (2007): Godišnje izvješće 2006. Ovčarstvo i kozarstvo. Zagreb.
Jensen, R., B.L. Swift(1982). Diseases of sheep, LEA&FEBINGER, Philadelphia.
Kostelić, A., Dagny Stojčević, V. Rupić, D. Karolyi, K. Salajpal, Z. Barać, G. Kiš, R. Beck (2005): Sheep
internal parasites on Pag and Rab, Italian Journal of Animal Science, Proceedings of the 13th Internatonal
Symposium “ Animal Scinece Days”, Vol.4-2005, Supplement 3.
Pugh, D.G. (2002): Sheep and goat medicine. W.B. Saunders Company, str. 341-358.
232
The influence of calcium-propionate in diet on energy
status in dairy cows
Utjecaj dodavanja propionata u hrani na energetski
status mliječnih krava
Stojević, Z.1, Natalija Filipović1, Z. Tuček2, Blanka Beer Ljubić1, K. Dolanski3,
Lina Bačar-Huskić4
1
Department of Physiology and Radiobiology, Faculty of Veterinary Medicine University of Zagreb, Heinzelova 55, Zagreb 10 000, Croatia
2
3
Center for Animal Reproduction of Croatia, Planinska 2b, Zagreb 10 000, Croatia
Osatina proizvodnja promet i usluge u poljoprivredi, K. Tomislava bb, Semeljci 31 402, Croatia
4
VETERINA, Animal Health, Inc., Svetonedjeljska 2, Rakov Potok 10 436, Croatia
Abstrac
The energy metabolism in dairy cows in the beginning of lactation is a metabolically most demanding
period, because of rapid increase of milk production. The ruminant is completely denied of glucose, since all
carbohydrates are converted to volatile fatty acids, by digestion in the forestomach. The vital glucose needs,
necessary for metabolic demands and lactose synthesis, are satisfied by the gluconeogenesis in liver, primarily
from propionate. The quantity of propionate, which originates from the fermentative digestion in rumen, is
often insufficient to satisfy the need for glucose. In relation to above mentioned, we wanted to investigate the
influence of the calcium-propionate supplement to diet of dairy cows on the energy metabolism in the beginning
of lactation, by measuring of blood serum indicators of energy status. The research was conducted on HolsteinFriesian cows during the first 30 days of lactation. Control group was fed with a standard diet, which was adapted
to the phase of lactation. Experimental group was fed equally, with addition of 80 g of calcium propionate twice
a day, beginning from the first to the 30th day of lactation. Samples for blood analyses were taken on day 1,
day 10 and day 30 after calving in plain vacutainer tubes. In separated blood serum, the concentrations of nonesterified fatty acids (NEFA), beta hydroxybutyrate (BHB), total cholesterol, triglycerides, glucose and urea
were determined. The concentration of NEFA and BHB was significantly lower in experimental in comparison
with control group, on day 10 of lactation (p<0.002 and p<0.03, respectively). On day 30, significant differences
of concentration of NEFA and BHB between control and experimental group were not observed. In the same
period, experimental group has had significantly lower concentration of total cholesterol and urea (p<0.01 and
p<0.001, respectively) and higher concentration of glucose in serum (p<0.001). The milk yield was not different
in control and experimental group. The presented data indicate that addition of 160 g of calcium propionate
diminish mobilisation of body fat stores and production of ketones, and keeps the stabile concentration of blood
glucose around the day 10 of lactation. Observed decrease in concentration of urea on day 30 of lactation is
probably a result of the diminished protein degradation. We conclude that the addition of calcium-propionate as
a supplement to diet of dairy cows has positive influence on energy status. In the same time, we conclude that
the higher doses of calcium-propionate are needed after day 10 of lactation. Additional investigations should
include the dry period and the later stages of lactation and the precise determination of optimal dose of calcium
propionate for different periods of lactation.
Key words: calcium-propionate supplements, dairy cows, energy status, blood serum
Sažetak
Energetski metabolizam krava u početnom razdoblju laktacije metabolički je najzahtjevnije razdoblje,
zbog naglog povećanja proizvodnje mlijeka. Specifičnost probave u preživača onemogućuje opskrbu organizma
glukozom prijeko potrebnom za vlastiti metabolizam kao i sintezu mliječnoga šećera, laktoze. Svu potrebnu
233
glukozu krava namiruje glukoneogenezom, prvenstveno iz propionske kiseline, koja nastaje procesom vrenja
u buragu. Nastale količine propionske kiseline često nisu dovoljne za podmirenje potreba za glukozom. S tim
u vezi željeli smo istražiti utjecaj dodavanja kalcijeva propionata u hrani na energetski metabolizam krava
početkom laktacije, praćenjem biokemijskih pokazatelja u krvi. Pokusi su obavljeni na kravama holštajnske
pasmine tijekom prvih 30 dana laktacije. Kontrolna skupina dobivala je hranu prilagođenu proizvodnom
ciklusu. Pokusna skupina hranjena je istom hranom uz dodatak 80g Ca-propionata svaki dan dvokratno, počevši
od prvog do tridesetog dana laktacije. Krv za analizu uzimana je prvi, deseti i trideseti dan po porodu punkcijom
vratne vene u vacutainer epruvete. U izdvojenom serumu određena je koncentracija neesterificiranih masnih
kiselina (NEFA), beta-hidroksi maslačne kiseline (BHB), ukupnog kolesterola, triglicerida i glukoze. Rezultati
pokusa pokazali su značajno nižu koncentraciju NEFA (p<0.002) i BHB (p<0.03) kod pokusnih krava desetog
dana laktacije. U tridesetom danu laktacije ne postoji značajna razlika u koncentraciji ova dva pokazatelja. U
toj fazi laktacije pokusna skupina krava imala je značajno nižu koncentraciju ukupnog kolesterola u plazmi
(p<0,01) i ureje (p<0,001). Istovremeno zabilježena je značajno viša koncentracija glukoze u plazmi pokusne
skupine (p<0,001). Količina mlijeka nije pokazala značajne razlike u kontrolnih i pokusnih skupina krava.
Na osnovi dobivenih rezultata može se prepostaviti kako dvokratni dodatak 160g Ca- propionata umanjuje
razgradnju tjelesnih masti te stvaranje ketonskih tijela oko desetog dana laktacije (NEFA-BHB), održava
konstantnu koncentraciju glukoze u krvi. Pad koncentracije ureje tridesetog dana laktacije može se pripisati
smanjenoj razgradnji tjelesnih bjelančevina. U zaključku, primjenjena doza Ca-propionata pokazuje pozitivan
učinak na energetski status mliječnih krava. Istovremeno preporuča se povećanje doze Ca-propionata poslije
desetog dana laktacije te proširenje istraživanja na period kasnog suhostaja te do tridesetog dana laktacije.
Ključne riječi: propionat u hrani, energetski status, krvna plazma, mliječne krave
Uvod
Početak laktacije prijelazno je razdoblje u kojem dolazi do naglog povećanja potreba za tvarima
nužnim za sintezu mlijeka, osobito energetskih; glukoza, masne tvari, bjelančevine. Specifičnosti
probave u preživača onemogućuju dotok jednostavnih metabolita iz probavila, posebice glukoze.
Naime, probava ugljikohidrata odvija se u predželucima fermentativnim procesima. Tako konačni
produkt razgradnje ugljikohidrata nije glukoza već niže masne kiseline, ponajprije octena, propionska
i maslačna. Glukoza prijeko potrebna za osnovne životne procese kao i za sintezu mliječnog šećera,
laktoze nastaje glukoneogenezom najvećim dijelom iz propionske kiseline. Kronični nedostatak
glukoze, osobito u početku laktacije, povećava učestalost metaboličkih poremećaja (Goff i Horst,
1997; Hardeng i Edge, 2001). Pad razine inzulina s posljedičnim porastom koncentracije glukagona
rezultira povećanim opsegom lipolize i ß-oksidacije nastalih masnih kiselina. Nastali acetil-CoA
ulazi u ciklus limunske kiseline, ali samo u količini koja je ovisna o raspoloživosti oksal-acetata,
a koji ovisi o količini glukoze. Preostali acetil CoA skreće u ketogenezu (Bruss, 1997). Osobitost
metabolizma preživača je niska koncentracija oksal-acetata u mitohondrijima (Vernon, 2005) što
dalje pridonosi nastanku ketonskih tijela. Dakle, osnovna prevencija u sprečavanju metaboličkih
poremetnji je dovoljna količina glukoplastičnih tvari. To može biti laktat (mliječna kiselina) koja vrlo
lako prelazi u glukozu. Međutim, mliječna kiselina može polučiti jak toksični učinak. Vrlo široku
primjenu ima i propilen glikol, no novija istraživanja ukazuju kako i taj pripravak ima toksični učinak
(Filipović i sur., 2008). Preostaje jedino propionat (propionska kiselina) koja fiziološki nastaje
vrenjem u predželucima. S tim u vezi željeli smo istražiti utjecaj dodavanja propionata u hranu na
energetski metabolizam krava u početku laktacije.
234
Materijal i metode
Pokusi su obavljeni na kravama holštajnske pasmine tijekom prvih 30 dana laktacije. Kontrolna
skupina dobivala je hranu prilagođenu proizvodnom ciklusu. Pokusna skupina hranjena je istom
hranom uz dodatak 80 g Ca-propionata po kravi u obliku komercijalnog pripravka Biomax®tranzit
(200 g po kravi dva puta dnevno). Krv za analize uzimana je prvi, deseti i trideseti dan laktacije
punkcijom vratne vene. U izdvojenom serumu određena je koncentracija neesterificiranih masnih
kiselina (NEFA), beta-hidroksimaslačne kiseline (BHB), ukupnog kolesterola, triglicerida, glukoze i
ureje komercijalnim kompletima.
Rezultati
Rezultati pokusa prikazani su na slikama 1-6. Rezultati pokusa pokazali su značajno nižu
koncentraciju NEFA (p<0.002) i BHB (p<0.03) kod pokusnih krava desetog dana laktacije. U
tridesetom danu laktacije ne postoji značajna razlika u koncentraciji ova dva pokazatelja. U toj fazi
laktacije pokusna skupina krava imala je značajno nižu koncentraciju ukupnog kolesterola u plazmi
C H OLESTER OL
7,09
6,09
Control
P ropionate
mmol/L
mmol/L
T R IG L YC E R ID E S
0,16
0,15
0,14
0,13
0,12
0,11
0,10
0,09
5,09
Control
4,09
P ropionate
3,09
1
2
2,09
3
1
p e rio d
6,09
4,09
Control
3,09
P ropionate
2,09
mmol/L
mmol/L
5,09
1,09
0,09
2
8,50
8,00
7,50
7,00
6,50
6,00
5,50
5,00
Control
P ropionate
1
3
2
3
p e rio d
p e rio d
NEFA
BHB
1,49
1,09
0,89
1,09
Control
0,89
P ropionate
0,69
mmol/L
1,29
mmol/L
3
UREA
GLU C OSE
1
2
p e rio d
0,69
Control
0,49
P ropionate
0,29
0,49
0,09
1
2
p e rio d
3
1
2
3
p e rio d
235
(p<0,01) i ureje (p<0,001). Istovremeno zabilježena je značajno viša koncentracija glukoze u plazmi
pokusne skupine (p<0,001). Količina mlijeka nije pokazala značajne razlike u kontrolnih i pokusnih
skupina krava.
Rasprava
Rezultati pokusa ukazuju na pozitivno djelovanje dodavanja Ca-propionata u hranu mliječnih
krava. Na osnovi kretanja biokemijskih pokazatelja u krvi može se pretpostaviti kako primjenjena
doza propionata umanjuje razgradnju tjelesnih masti na što upućuje niža koncentracija NEFA
desetog dana laktacije uz izdašniju sintezu triglicerida. Koncentracija glukoze u krvi tretiranih krava
bila je konstantna kroz pokusno razdoblje iako nešto niža prvog dana, ali značajno viša tridesetog
dana laktacije. Ovi rezultati upućuju na učinak propionata u održavanju normoglikemije. Kretanja
koncentracija BHB nedvojbeno ukazuju na protektivni učinak propionata u sprečavanju ketoze. Niže
koncentracije ureje u krvi pokusnih krava upućuju na zaključak da upotreba propionata smanjuje
obim razgradnje tjelesnih bjelančevina u svrhu glukoneogeneze. Ovakvo mišljenje temelji se na
činjenici da su obje skupine krava hranjene istom hranom dok u proizvodnji mlijeka nije bilo
razlike. U zaključku, primjenjena doza Ca-propionata pokazuje pozitivan učinak na energetski status
mliječnih krava. U isto vrijeme, rezultati upućuju kako bi se istraživanja trebala proširiti na veće
količine propionata u hrani poslije desetog dana laktacije kao i na period suhostaja.
Literatura
Bruss, M. L. (1997): Lipids and ketones. In: Clinical biochemistry of domestic animals. 5th ed. Kaneko, J. J., J.
W. Harvey, M. L. Bruss. Academic Press. pp. 83-115.
Filipović Natalija, Z. Stojević, Blanka Beer Ljubić und Nina Poljičak-Milas (2008): Der Fettstoffwechsel bei
Holstein-Kühen in der Trockenstehzeit und zu Laktationsbeginn. Tierärtzl. Umschau 63, 59-64
Goff, J. P., R. L. Horst (1997): Phisiological changes at parturition and their relationship to metabolic disorders.
J. Dairy Sci. 80. 1260-1268.
Hardeng, F. V., L. Edge (2001): Mastitis, ketosis and milk fever in 31 organic and 93 conventional Norvegian
dairy herds. J. Dairy Sci. 2673-2679.
Vernon, R. G. (2005): Lipid metabolism during lactation: a review of adipose tissue-liver interactions and the
development of fatty liver. J. Dairy Res. 72. 460-469.
236
The Clinical Efficiency of Minerasol® Which is a New
Trace Element Combination on Sheep
Učinak kombinacije minerala u pripravku Minerasol na
nivo nekih elemenata u ovaca
KAYAR1, A., Mehmet Erman OR1, Remzi GONUL1, Banu DOKUZEYLUL1, Ali Rıza
KIZILER2, Birsen AYDEMIR2, Abdullah AKSU3, Cağla PARKAN1, TAMERCAN
MORKOC4 , and BORA BARUTCU2
Istanbul University, Faculty of Veterinary Medicine, Department of Internal Medicine, 34320
Avcilar-Istanbul/TURKEY
2
Istanbul University, Cerrahpaşa Medicine Faculty, Department of Biophysics, Cerrahpaşa-Istanbul/TURKEY
3
Chemical Oceanography, University of İstanbul, Enstitute of Marine Science and Management
Vefa-Istanbul/TURKEY
4
Interhas Limited Company, Ankara/TURKEY.
1
Introduction
The importance of many inorganic elements classified as macro and micro elements in nourishing and
growing of animals is accepted (2,19). Trace elements have an important role on growth, reproduction and
productivity of domestic animals. Mineral deficiency or imbalance observed in nearly everywhere in the world
causes significant losses in terms of both production and economy (3, 5, 7, 8, 9, 19). It is reported that the losses
caused by trace elements are as important as the losses caused by infectious and parasitic diseases (19). Although
trace elements are very important for increasing resistance to diseases in living organisms (4,19). Minerasol®
used in this study, is a hypertonic infusion solution that includes calcium, phosphate, potassium, magnesium
and sodium salts and iodine, iron, cobalt and zinc trace elements. Mineral substances and trace elements are
critical co-enzymes necessary for the activation of the effects of biologically important substances like hormone,
enzyme, vitamine and other functional proteins (21). Any deficiency causes specific or non-specific disorders in
cells’ metabolism.
In this study planned under the light of all these information, the effects of Minerasol®
application which is a new mineral combination, on blood serum parameters were examined, its efficiency on
sheep breeding and its safety on the treatments of diseases caused by macro and micro element deficiencies.
Sažetak
Uzgoj ovaca zauzima važno mjesto u gospodarstvu države. Ovce nam daju mlijeko, meso i vunu te na taj
način čine industrijski značaj u stočarstvu naše zemlje. Bolesti uzrokovane nedostatkom makro i mikroelemenata
su vrlo važne. Debilizam, anoreksija, pad produktivnosti, anemija, proljev i poremetnje plodnosti su najvažniji
klinički znakovi uočeni na životinjama. U ovoj studiji cilj je odrediti učinkovitost Minerasola, koji je
kombinacija minerala na nivou nekih elemenata ( Fe, Cu, Zn, Mg, Ca ( .S tom namjerom otprilike 10 ml krvi
bez antikoagulanata izvađeno je ukupno 40 ovaca na Fakultetskom dobru te su određene razine elemenata u
serumu. Nakon toga smo intravenozno aplicirali 6ml Minerasola razrijeđenog fiziološkom otopinom. Tjedan
dana kasnije ponovo smo izvadili krv i ustanovili promjene. Nakon toga ponovo smo aplicirali 6ml pripravaka
intravenozno. Nakon tjedan dana ponovo smo odredili razinu elemenata u serumu bez aplikacije Minerasola.
Svi elementi određivani su pomoću AA-680 Schimatzu Atomic Apsorption spektrofotometrom na Zavodu za
biofiziku medicinskog fakulteta Sveučilišta Cerrahpas u Istambulu i dobiveni podavi su statistički obrađeni.
Usporedbom razine elemenata u serumu prije i poslije tretiranja pripravkom uočen je porast razine Fe, Cu, Zn,
237
Mg i Ca. Za Zn i Mg uočen je signifikantni porast (p<0.001 razine u serumu. Konačno, zaključili smo da je
tretman minerasolom kroz program dnevne njege moguće isključiti probleme vezane za nedostatak minerala u
tragovima čime je moguće prevenirati predispozicije za bakterijske, virusne i parazitarne bolesti.
Ključne riječi: Ovce, Minerasol, serum, Fe, Cu, Zn, Mg, Ca
Material and Methods
This study was carried out in Istanbul University Veterinary Faculty Farm. 40 sheep that were
determined to be healthy after the clinical examination were included to the study. About 10 ml
of blood without anticoagulant was drawn from the animals before drug administration and serum
element levels were determined. Then, each animal were administered IV 6 cc Minerasol® that
includes calcium phosphonate 65.00 mg, potassium chloride 4 282 mg, calcium gluconat 300.00 mg,
potassium lodide 50.00 mg, sodium iodide 50.00 mg, magnesium chloride 6 H2O 19.64 mg, iron (II)
chloride 4 H2O 12.96 mg, cobalt (II) chloride 6 H2O 0.164 mg, zinc chloride 0,1355 mg in one ml,
blood was drawn one week later and the variations were determined. Then 6 ml of Minerasol® was
again applied intravenously. After one week, without applying IV injection of Minerasol®, blood was
drawn and serum element levels were determined. All the element levels were measured in AA-680
Shimadzu atomic absorption spectrophotometry in Biophysics Department of Istanbul University
Cerrahpaşa Faculty of Medicine, hemogram parameters were measured in Istanbul University
Veterinary Faculty Central Analysis Laboratory and the data were statistically assessed.
Results
When the Minerasol® levels before and after the application were examined, it was determined
that there was no statistically significant change in hemogram levels but there were increases in Fe,
Cu, Zn, Mg and Ca element levels and that the increases of Zn, Mg and Ca were significant in p <
0.001 level (Table 1).
Table 1: The changes in blood serum levels in sheep before the application and one and two weeks later after
Minerasol® (n=40).
Before injection
1 week after injection
2 weeks after injection
Fe (µg/dL)
X ± Sx
120,815 ± 9,30
X ± Sx
122,19 ± 5,60
X ± Sx
110,944 ± 5,45
N.S.
Cu (µg/dL)
61,91 ± 3,77
61,34 ± 2,01
70,13 ± 2,70
N.S.
Zn (µg/dL)
92,44 ± 4,77
76,44 ± 1,81
79,06 ± 2,29
***
Mg
3,64± 0,057
3,52±0,064
3,30 ± 0,07
***
Ca
8,02± 0,13
7,76±0,16
7,12 ± 0,20
***
N.S.= p > 0.05, ***p<0.001
Discussion
Compared to other countries, while our country is one of the leading countries in terms of
economically valuable animal count, its place is much worse than expected in terms of products like
meat, milk and skin obtained from these animals (1, 4). Deficiency of trace elements plays as much
role as infectious and parasitic diseases in the formation of this table (19, 20). A similar appearance
was observed in Northwest Turkey and after discussions with breeders and veterinary physicians
it was reported that there were many diseases caused by parasites and trace element deficiencies.
238
Particularly, complaints like walking disorders in calves, fertility related problems, loss of weight,
diarrhea, predisposition to infections, decrease in fleece quality were compatible with symptoms
reported in literature (2,15).
Calcium is present in the structure of tissue and bones and is necessary for healthy bone,
muscle and nerve function. It is essentially responsible for blood clotting. It enables the interaction
of reticuloendolthelial system and suprarenal gland (21). It has a regulatory effect on acute and
chronic metabolic abnormalities and reproduction activities due to its effect on phosphate interim
metabolism. It is necessary for healthy bone and dental growth and its maintenance (21). It is also
known that, calcium and phosphate deficiencies cause many metabolic diseases (5, 9, 17). In our
study, when the changes in calcium level of blood serum was observed, it was a significant increase
seen in calcium quantity, statistically. It was decided that injections of calcium with phosphate could
decrease the risk of metabolic diseases.
Copper has an important role in hemoglobin shaping and body growth, symptoms like failure in
metabolic funstions like immune function, increase in mortality rate, debility, depigmentation, walking
disorders, demyelinization in nerve tissues, low osteoblastic activity and loss of weight caused by
the failure of oxidation in tissued and diarrhea are reported (16,19). Copper and zinc are the most
important essential minerals necessary for the normal functioning of animals’ reproduction functions
(11, 22). Zinc is an essential mineral for healthy skin, hair and nail situation, reproduction, bone and
cartilage growth, carbonhydrate, lipid and protein metabolism, enzyme and immune system. It has a
vital role in DNA synthesis. Decrease in consumption, decrease in growth rate, growth retardation,
anormal estrus behaviour, decrease in testicle magnitude, spermatogenesis malfunction, decrease in
the development of secondary sex organs and fertility, decreases in resistance to infections, significant
compression on immune response, pathological changes in skin and hair, parakeratosis are observed
in the animals with zinc deficiency (19,21).
Magnesium is necessary for bone and tooth formation and the maintenance of normal muscle
functions. It was reported that the inclusion of Zn, Cu and Mg to the ration in sufficient rates plays an
important role for fertilization and increasing the life chance of embryo (22). In this study we observed
that serum Cu, Zn and Mg levels increased after injection and it might be efficient on preventing the
diseases related to these minerals. Although half of the researchers reported that the risk of enzootic
ataxia increased with the blood copper levels under 50 µg/dL, it was observed that no such risk was
present in the animals in our farm and Minerasol® administration completely eliminated this risk by
increasing the serum copper level more.
Fe deficiency along with the Cu deficiency is known to cause violent anemiae and predisposition
to parasitic diseases. Iron enters the structure of hemoglobin necessary for moving oxygen from
lungs to body cells. In case of insufficiency, decrease in immune response, cell mediated immune
abnormalities may be seen and the killing ability of neutrophilia can be significantly reduced (21).
Authors (1,14) reported that high amount of cobalt, zinc, cadmium, mangane and copper found in
ration decreased the absorption of iron. In our study, it was observed that the blood erythrocyte count,
haematocrit level and hemoglobin level before and after the injection did not change and all the
parameters were reported as normal (18) in sheep and all that this was compatible with the presence
of blood serum Fe and Cu levels within normal limits before injection.
Potassium administered to the animals with Minerasol® administration are necessary for the
maintenance of cellular integrity and for healthy nerve and muscle function (21). Sodium and
Chlorine are necessary for the maintenance of healthy nerve and muscle function (21). İodine is
the structural component of thyroid hormones called Thyroxine (T4) and triiodothyronine (T3) and
239
has a regulatory and activating effect on metabolism. The normal growth and proper functioning
of reproduction organs depend on the thyroid situation. Since blind and hairless calves, abortus in
cows can be seen in its deficiency, iodine supplementation in various concentrations has a positive
effect on reproduction performance (21) . Cobalt is necessary for Vitamin B12 synthesis in the large
intestine of pigs and horses and the rumen of cattle. The field experiences indicate that the population
performance in sheep and cattle is deteriorated and ovarium function is deteriorated in cattle, the rate
of getting pregnant, deliveries and milk and wool production decreased (21). However, although we
did not have the chance to examine the changes in K, Na, Cl, I and Co levels in blood serum after the
injection, it was decided that these were increased similarly to the others and this may be effective on
preventing diseases due to mineral deficiencies.
Minerasol is used for treating, preventing specific or non-specific diseases and disorders caused
by deficiency, lack or imbalance of the components ( Zinc, Cobalt, Iodine, Iron, Sodium, Potassium,
Phosphor, Calcium and Magnesium ) in its constitution and supporting the animal (21).
It’s specific areas of use are grass tetany, milk fever, bone disorders, disorders in hair and skin
related to zinc, anemia related to iron and cobalt deficiency (Vitamin B12), hairless calves due to
iodine deficiency and it is used for removing the negative situations caused by the deficiency of
substances in its constitution mentioned in pharmacological properties section (21).
It can be used for prophylaxis during pregnancy and lactation for the prevention of diseases
which are likely to develop since the need of animals for substances within Minerasol® is increased
during these periods (21).
Consequently, it was decided that with the inclusion of Minerasol® which is a new trace element
combination into the routine care and nourishment program, the problems related to the deficiency of
trace elements would be eliminated in a short time and predisposition in terms of bacterial, viral and
parasitic diseases would be prevented.
References
1. AGAOGLU, ZT 1991: Ülkemiz hayvancılığında bazı iz elementler ve önemleri, Veteriner Hekimler Vakfı
Dergisi, 57-62.
2. ALTINTAS, A, UYSAL, H, YILDIZ, S, GONCAGUL, T 1990: Situation comparee des Mineraux urles
echantillons du serum et des poils chez les brebis hybride et d’Akkaraman- ANKARA. J Lalahan Livestock
Res Ins 30, 40-57.
3. BLOOD, DC, RADOSTITS OM, 1989: Diseases caused by nutritional deficiencies, In:Bailliere Tindall
editor, Veterinary Medicine, 7th ed., W.B. Saunders, London, Part Two, 1150-229.
4. CAMAS, H, BILDIK A, GULSER, F 1994: Toprak, bitki ve koyunların kanında bazı iz elementlerle (Cu, Mo,
Zn, Co, Mn) Sülfat (SO4) miktarlarının araştırılması, Pro.no: VHAG- 966. Van.
5. DAKKA, AA, ABDEL-ALL, THS 1992: Studies on minerals picture in the blood sera of egyptien Sheep.
Assiut Vet Med J 28, 242-249.
6. GHOSAL, AK, MATHUR, GN 1992: Zinc, copper and iron contents of blood serum of cattle, sheep in
semiarid Tract of Rjasthan. Ind J Anim Sci 62, 441-442.
7. GRAHAM, TW 1991: Trace element deficiencies in cattle. Vet Clin North Am Food Anim Pract 7, 153-215.
8. IMREN, HY, SAHAL, M 1990: Metabolizma hastalıkları, In: Veteriner İç Hastalıkları, Aydoğdu ofset matb.
Ankara, 841-1000.
9. JONES, HC, FONTENOT, JP, VEIT, HP 1990: Physiological and pathological effects of feeding high levels
of magnesium to steers, J Anim Sci 68, 4400-4413.
240
10. KENDALL, N.R., MACKENZIE, A.M., TELFER, S.B. (2001): Effects of a copper, cobalt and selenium
soluble glass bolus given to grazing sheep. Livestock Prod. Sci. 68;31-39.
11. KENDALL, N.R., MCMULLEN, S., GREEN, A., RODWAY, R.G. (2000): The effect of a zinc, cobalt and
selenium soluble grass bolus on trace element status and semen quality of ram lambs. Animal Reproduction
Sci. 62;277-283.
12. MARTIN, DW, MAYES, PA, RODWELL, VW 1983: Harper’s Review of Biochemistry. 19th ed., Lance
Medical Publications, Los Altos, California.
13. NELSON, DR, WOLFF, WA, BLODGETT, DJ, LEUCKE, B, ELY, RW, ZACHARY, JF 1987: Zinc
deficiency in sheep and goats: Three Field Cases J Am Vet Med Assoc 184, 1480-1485.
14. PIRKLE, JL, SCHWARTZ J.LANDIS, R, HARLAN, RW 1985: The relationshipbetween blood lead and
blood pressure and it’s cardiovasculer risk implications. Am J Epidemiol 121, 246-258.
15. RULS, R 1990, Mineral levels in animal health diagnostic data. 3rd ed., The Iowa State University Press
Ame.
16. SHARMA, MC, CHINMAY, J, PATHAK, NN, KAUR, H 2005: Copper status and enzyme, hormone,
vitamin and immune function in heifers. Res Vet Sci 79, 113-123.
17. SHUPE, JL, BUTCHER, JE, CALL, JW, OLSON, AE, BLAKE, JT 1988: Clinical signs and bone changes
associated with phosphorus deficiency in beef cattle. Am J Vet Res 49, 1629-1636.
18. SMITH, BP 2002: Large animal internal medicine. Mosby, Inc. 3rd ed., USA.
19. SAHIN, T 1999: Investigation of some trace element levels and biochemical parameters in sheep with
endoparasite. PhD thesis. Univ Yüzüncü Yıl, Van-Turkey.
20. UNDERWOOD, EJ 1997: Trace elements in human and animal nutrition. Academic Press, London.
21. www.interhas.com/interhas/ilaclar/minerasol.jpg
22. YILDIZ, A, BALIKCI, E 2004: Association between some mineral and embryonic mortality in the sera of
cows. J Fac Vet Med Univ Yüzüncü Yıl, 15, 11-15.
241
242
Possibilities for teaching reproductive clinical
anatomy using laparoscopy
Primjena laparoskopije u nastavi reproduktivne
kliničke anatomije
P. Trojacanec1, T. Dovenski2, V. Ilieski3, S. Trojacanec4, K. Ilievska1, L. Pendovski3
1
Faculty of Veterinary Medicine, Department of Surgery, Orthopedics & Ophthalmology
2
Faculty of Veterinary Medicine, Department of Reproduction
3
Faculty of Veterinary Medicine, Department of Anatomy
Faculty of Agricultural Sciences and Food, Department of Anatomy
4
Abstract
Teaching anatomy at the veterinary schools is based on anatomical specimens and preserved
cadavers, in the first two years, as well as on live animals for teaching clinical anatomy. However,
clinical anatomy is restricted only to exterior body markers, allowing the students only mental
depicting of the deeper body structures. Aim of this study was to establish the value of laparoscopy
for visualization of the reproductive organs within the scope of teaching abdominal gross anatomy
of cows, allowing the students live real time image of the abdominal organs and their position in the
abdominal cavity.
For that purpose, we used one non lactating dairy cow, planned for culling. The animal was
lightly sedated with Xylazine (Xyla, Inter Chemie, Holland) 5 mg/100kg BW and left in a standing
position. The left and the right Fossa paralumbalis were selected as the most appropriate site for
trocar insertion. Both regions were surgically prepared and local infiltration anaesthetic was infused
under the skin and in the deeper structures of the abdominal wall. Two stab incisions were made at
distance of 10 cm for trocar insertion. . The sharp trocars were removed and replaced by a 10 mm ×
33 cm, 90° laparoscope (Karl Storz Veterinary Endoscopy) connected to a 300-W xenon light source
(Karl Storz Veterinary Endoscopy) and laparoscopic camera (Karl Storz Veterinary Camera Pal) and
laparoscopic atraumatic Babcock grasping forceps was inserted through the other cannula.
Pneumo peritoneum was achieved with continuous insuflation of filtered air. Following this, the
demonstration was projected on a monitor so that all students could participate, visualize and discuss
the abdominal structures.
In this way, all structures of the cow’s inner reproductive system could be observed, as well as the
caudal sections of the rumen, intestines as well as the urinary bladder with its adnexa. Furthermore,
simultaneously, an assistant attempted to make an endorectal palpation of the uterus and ovaries, in
order to enable the students visualize the procedure.
The dissector had the opportunity to manipulate laparoscopic tools in a live animal closely paralleling
operative experience, and the students had an opportunity to learn abdominal anatomy as well as
some features of the reproductive examination from a clinical perspective.
Laparoscopic examination and dissection of fresh and embalmed cadavers has been used for training
surgeons on new procedures such as colon resection, antireflux procedures, and cholecystectomy.
There is no report of this same technology used in farm animals to teach clinical anatomy or
reproduction. This approach allows first and third-year veterinary medical students to learn the
243
anatomy while exposing them to the technology currently used in surgical practice, and it affords
students to visualize some examination procedures that are routinely performed by manual endorectal
palpation.
Sažetak
Savladavanje anatomije na veterinarskim fakultetima temelji se na anatomskim preparatima i lešinama
na prve dvije godine studija, a na živim životinjama savaladava se klinička anatomija. Međutim, klinička je
anatomija ograničena samo na vanjske tjelesne oznake, ostavljajući studentu samo zamišljanje i projiciranje
unutarnjih tjelesnih struktura. Svrha ove studije je utvrditi vrijednost laparoskopije u vizualizaciji reproduktivnih
organa, u okviru savladavanja abdominalne makroanatomije krava, omogučujući studentima realni i živi prikaz
trbušnih organa i njihovog položaja u trbušnoj šupljini.
Za tu svrhu koristili smo zasušenu kravu muzaru, namijenjenu isključenju iz uzgoja. Životinja je lagano
sedirana Xylazine-om (Xyla, Inter Chemie, Nizozemska) 5 mg/100kg TT, a prilikom postupka je stajala. Lijeva
i desna paralumbalna jama odabrane su kao najprikladnije mjesto za aplikaciju troakara. Obje regije su kirurški
pripremljene, primjenjena je lokalna infiltrativna anestezija pod kožu te u dublje strukture trbušnog zida. Dvije
ubodne incizije su učinjene s razmakom od 10cm za postavljanje troakara. Oštri troakari zatim su zamjenjeni
10 mm × 33 cm, 90° laparoskopom (Karl Storz Veterinary Endoscopy) spojenim na 300W izvor ksenonskog
svjetla (Karl Storz Veterinary Endoscopy) i laparoskopsku kameru (Karl Storz Veterinary Camera Pal) te
laparoskopskim atraumatskim Babcock forcepsom koji je apliciran kroz drugu kanilu.
Pneumoperitoneum je ostvaren stalnom insuflacijom filtriranog zraka. Nakon toga započela je demonstracija,
projiciranjem slike na monitoru pri čemu su svi studenti mogli sudjelovati, vizualizirati i raspravljati o trbušnim
strukturama.
Na taj način moguće je prikazati sve strukture unutarnjeg reproduktivnog sustava krave, jednako kao
kaudalne partije buraga, crijeva i mokraćnog mjehura sa pripadajućim strukturama. Nadalje, istovremeno je
jedan asistent izvodio endorektalnu palpaciju maternice i jajnika, kako bi omogućio studentima da vide kako se
izvodi taj postupak.
Operater na ovaj način ima mogućnost baratati laparoskopskim instrumentarijem u živoj životinji, živo
simulirajući operativne uvjete, a studenti su imali priliku savladati abdominalnu anatomiju kao i neke osobitosti
reproduktivnog pregleda s kliničkog gledišta.
Laparaskopska pretraga te sekcija svježih i konzerviranih leševa korištena je u edukaciji kirurga novim
postupcima kao što je resekcija kolona, postupci antirefluksa i kolecistektomije. Nema izvješća o istim
postupcima korištenim na farmskim životinjama u edukaciji kliničke anatomije ili reprodukcije. Ovaj pristup
omogućuje studentima prve i treće godine veterine savladavanje anatomije izlažući ih tehnologijama koje se
upravo koriste u kirurškoj praksi, a ujedno im omogućuje vizualizaciju nekih pregleda koji se rutinski izvode
manualnom endorektalnom palpacijom.
244
Reproduction, Obstretic and Udder Health
Reprodukcija, porodništvo i zdravlje vimena
245
246
PREGNANCY TOXEMIA IN EWES: ALTERNATIVE THERAPEUTIC IN
EXTENSIVE SYSTEM CONDITIONS
GESTOSIS OVINA SUBCLÍNICA: ALTERNATIVAS TERAPÉUTICAS EN
CONDICIONES DE EXPLOTACIÓN EXTENSIVA
GRAVIDITETNA TOKSEMIJA U OVACA: ALTERNATIVNA TERAPIJA U
EKSTENZIVNOM OVČARENJU
González Montaña JR1, Cal L2, Benech A2, Lataste V2, Grille L2, Rodas E.2
1. Dpto. Medicina, C. y A. Veterinaria. Facultad de Veterinaria. Universidad de León. León, Spain
2. Facultad de Veterinaria. Universidad de la República. Montevideo, Uruguay
SUMMARY
The objective of this study was compared the efficacy of alternative therapeutics for pregnancy toxemia
ewe cases which can be used in extensive farming conditions. It was used 30 double purpose ewes (meatwool) maintained in extensive conditions with local pastures; it was recorded the specific breed date and all
animals had single lamb. At the 130-d of pregnancy, animals were divided in three groups, which were exposed
starved period until glycemia level were reached risk values (28.62±4.33 mg/dl) and animals showed subclinical
toxaemia signs. The feeding was restarted and designed one treatment for each group during four days. The
animals of the first group received once at day 50 ml glucose hypertonic solution (I.V.) and 20 IU of insulin
(S.C.). The second group was applied twice at day 100 ml of glycerol-propilenglycol suspension (P.O.), and
animals of the third group were feeding with 150 g/head/d of grain corn. From 130-d of pregnancy to end of
experiment were determined twice at day glycemia and urine pH values, and once at day seric β-hydroxibutirate
(BOHB) concentration in each animal of all groups. Glycemia values increase in the three groups just after
received treatment, but animals of the second group (glycerol-propilenglycol) showed quickly reestablish of
glucose levels. Before the treatments, BOHB levels were <3.0 mmol/L, which could be subclinical pregnancy
toxemia symptom, however, the BOHB concentration decreased when animals received respective treatment,
especially the glycerol-propilenglycol group’s animals. Similar results were showed for urinary pH values. The
three alternative treatments recorded a good efficacy to recovered glucose and BOHB blood concentrations. The
glycerol-propilenglycol treatment was more efficiency than others.
RESUMEN
Se comparan algunas alternativas terapéuticas aplicadas a la toxemia de la gestación ovina, teniendo en
cuenta que puedan ser aplicadas a ganaderías ovinas extensivas. Se utilizaron 30 ovejas de aptitud carne-lana,
con fecha de cubrición conocida y con un solo feto. Las ovejas se alimentaron exclusivamente con pasto natural.
En el día 130 de gestación se dividieron en tres grupos a los que se sometió a ayuno total de alimento hasta que
la glicemia alcanzó un “valor de riesgo (28,62 ± 4,33 mg/dl)” indicativo de toxemia de gestación subclínica.
Además de reiniciar la alimentación, a cada grupo se le administró uno de los tratamientos ensayados durante 4
días. Al primer grupo se le aplicó 50 ml de glucosa hipertónica i/v junto con 20 UI de insulina s/c/animal/día; al
segundo grupo se trató con glicerol-propilenglicol p/o, 100 ml cada 12 horas y al tercer grupo fue suplementada
su dieta con 150 g/animal/cada 12 horas de maíz triturado. A partir del día 130 de gestación y durante todo el
protocolo experimental se valoraron cada 12 horas la glucemia y el pH urinario y diariamente el ß-hidroxibutirato
(BOHB) sérico. La glucemia se incrementó en los tres grupos al instaurarse los tratamientos, si bien las ovejas
a las que se administró glicerol-propilenglicol normalizaron la glucemia más precozmente. Antes de comenzar
los terapias los valores de BOHB sérico fueron inferiores a 3 mmol/l, que puede ser indicativo de Toxemia de
247
la gestación subclínica. Tras instaurarse los tratamientos el BOHB disminuyó en todos los grupos. El grupo
tratado con propilenglicol fue el que mostró una disminución más pronunciada y más precoz de este cuerpo
cetónico. El pH urinario evolucionó de forma similar a la mostrada por el BOHB sérico. Los tres tratamientos
ensayados lograron restablecer la concentración normal de glucosa y de ß-hidroxibutirato en sangre, siendo la
administración de glicerol-propilenglicol el que logró normalizar estos parámetros en menor tiempo.
SAŽETAK
Uspoređivana je alternativna terapija primjenjena u gestacijskoj toksemiji ovaca, imajući na umu
da budu primjenjive u ekstenzivnom tipu ovčarenja. Korišteno je 30 ovaca kombiniranih proizvodnih
svojstava (meso-vuna), sa poznatim datumom parenja i sa samo jednim plodom. Ovce su hranjene
isključivo dostupnim prirodnim krmivima. U 130. danu gravidnosti ovce su podijeljene u 3 skupine
koje su podvrgnute alimentarnom postu sve dok razina glikemije nije dosegnula rizični nivo (28,62
± 4,33 mg/dL), indikativan za subkliničku gestacijsku toksemiju. Osim ponovnog započinjanja
hranidbe, svaka je grupa podvrgnuta jednoj od zacrtanih terapija tijekom 4 dana. Prvoj se skupini i/v
apliciralo 50mL hipertonske glukoze zajedno sa 20 i.j. inzulina s/c po ovci na dan. Druga skupina
tretirana je glicerol – propilenglikolom p/o, 100mL svako 12h, a trećoj je skupini obroku bilo
nadodano 150g mljevenog kukuruza po ovci svako 12 sati. Počevši sa 130. danom gravidnosti i
tijekom cijelog eksperimentalnog protokola određivane su razine glikemije i pH urina svako 12h te
serumskog ß-hidroksibutirata (BOHB) jednom dnevno. Razina glikemije je rasla u sve 3 skupine
sa započetim tretmanom, iako se u skupini ovaca u kojih je primijenjen glicerol – propilenglikol ta
razina normalizirala najranije. Prije početka terapije, vrijednosti serumskog BOHB bile su niže od
3mmol/L, što se može smatrati subkliničkom gestacijskom toksemijom. Sa započetom terapijom
došlo je do pada BOHB u svim skupinama. Skupina tretirana propilenglikolom imala je najizraženije
i najranije sniženje tog ketonskog tijela. Urinski pH mijenjao se slično serumskom BOHB. Sva 3
tretmana uspjela su uspostaviti normalnu razinu glukoze i ß-hidroksibutirata u krvi, pri čemu je
aplikacija glicerol – propilenglikola navedene parametre normalizirala u najkraćem vremenu.
SUMMARY
The objective of this study was compared the efficacy of alternative therapeutics for pregnancy toxemia
ewe cases which can be used in extensive farming conditions. It was used 30 double purpose ewes (meatwool) maintained in extensive conditions with local pastures; it was recorded the specific breed date and all
animals had single lamb. At the 130-d of pregnancy, animals were divided in three groups, which were exposed
starved period until glycemia level were reached risk values (28.62±4.33 mg/dl) and animals showed subclinical
toxaemia signs. The feeding was restarted and designed one treatment for each group during four days. The
animals of the first group received once at day 50 ml glucose hypertonic solution (I.V.) and 20 IU of insulin
(S.C.). The second group was applied twice at day 100 ml of glycerol-propilenglycol suspension (P.O.), and
animals of the third group were feeding with 150 g/head/d of grain corn. From 130-d of pregnancy to end of
experiment were determined twice at day glycemia and urine pH values, and once at day seric β-hydroxibutirate
(BOHB) concentration in each animal of all groups. Glycemia values increase in the three groups just after
received treatment, but animals of the second group (glycerol-propilenglycol) showed quickly reestablish of
glucose levels. Before the treatments, BOHB levels were <3.0 mmol/L, which could be subclinical pregnancy
toxemia symptom, however, the BOHB concentration decreased when animals received respective treatment,
especially the glycerol-propilenglycol group’s animals. Similar results were showed for urinary pH values. The
three alternative treatments recorded a good efficacy to recovered glucose and BOHB blood concentrations. The
glycerol-propilenglycol treatment was more efficiency than others.
248
INTRODUCCIÓN
La Toxemia de la Gestación es un trastorno metabólico que afecta a las ovejas preñadas durante
el último tercio de la gestación, especialmente en las últimas seis semanas, como consecuencia de la
incapacidad del organismo para mantener la homeostasis energética al enfrentarse, en esta etapa, a un
balance energético negativo (Harmeyer y Schlumbohm, 2006; West, 1996; González Montaña y Rejas
López, 1995). La causa determinante de esta patología es una alteración del metabolismo energético
y aunque la etiopatogenia no es completamente conocida, esta enfermedad es esencialmente una
forma severa de cetosis, caracterizada por una baja circulación de glucosa en sangre y altos niveles
de cuerpos cetónicos (Rook, 2000; Andrews, 1997).
Se han descrito varios tratamientos para la Toxemia de la gestación, obteniéndose resultados
variables, que además son muy costosos cuando la enfermedad afecta a un número elevados de
animales. La respuesta a los tratamientos son generalmente decepcionantes al ser los resultados,
como hemos indicado, muy variables con alta proporción de mortalidad materna (West, 1996).
Los resultados obtenidos por diferentes autores han sido además contradictorios y a menudo
desconcertantes (Andrews, 1997; Marteniuk y Herdt, 1988).
Únicamente es posible obtener una respuesta efectiva cuando el tratamiento se instaura en
los primeros estadios de la enfermedad, cuando aún no se han establecido lesiones neurológicas
irreversibles y cuando el animal aún no está en decúbito (González Montaña y Rejas López, 1995;
Marteniuk y Herat, 1988; Bonino y col, 1987). Por ello es muy importante el diagnóstico precoz de la
enfermedad, ya que permitirá una terapéutica racional y efectiva. González Montaña y Rejas López
(1995) sugieren que el objetivo prioritario en el tratamiento de esta enfermedad es el aumento de la
formación de glucosa y su utilización a nivel tisular, debiendo incrementar también la utilización de
los cuerpos cetónicos, a lo que Ford (1988), Marteniuk y Herdt (1988) y Bonino y col (1987) agregan
combatir la acidosis y los trastornos hidroelectolíticos. Herdt y Emery (1992) sugieren que la mayor
meta en la terapia de la cetosis es restablecer el apetito normal, lo cual depende de que se restablezca
la concentración normal de glucosa y cuerpos cetónicos en sangre.
MATERIAL Y MÉTODOS
Fueron utilizadas 50 ovejas Corriedale adultas, de entre 4 y 6 años, identificadas por medio de
crotales numerados y dos carneros de la misma raza de 5 años. Se seleccionaron animales con una
condición corporal por encima de 2,5, valorados en un rango de 1 a 5.
Los celos de las ovejas fueron sincronizados con esponjas intravaginales conteniendo 60 mg de
medroxiprogesterona (Sincrovin®, Santa Elena) durante 12 días. Una vez retiradas las esponjas se
realizó el servicio por monta natural usando 2 carneros de la misma raza con arneses marcadores.
Se registró el día de la monta como el día cero (0) de gestación. Entre los días 50 y 70 se realizó el
diagnostico de gestación por ultrasonografia, descartándose las ovejas vacías y las portadoras de dos
o mas fetos, seleccionando de esta forma 30 ovejas gestando un solo feto.
Posteriormente a la cubrición todas las ovejas pasaron a alimentarse durante todo el día a cielo
abierto en una pradera con pasto natural. A los 130 días de gestación fueron divididas al azar en
tres grupos de 10 animales cada uno. A partir de este momento las ovejas de los tres grupos fueron
encerradas en corrales techados con piso de hormigón. Durante el encierro fueron sometidas a un
ayuno total de forraje hasta que la glicemia alcanzó valores considerados de riesgo (28,62 ± 4,33
mg/dl) (Cal Pereyra, 2007). Todos los animales tuvieron agua ad libitum. Al retirarlas del ayuno se
les aplicó uno de los tratamientos siguientes durante 4 días.
249
Grupo A (n=10): se administraron 50 ml de glucosa hipertónica intravenosa (Dextrolena®, Santa
Elena) junto con 20 UI de insulina en forma subcutánea (Caninsulin®) por oveja y por día. Este
tratamiento se realizó tras obtener las muestras de sangre, a la hora 06:00.
Grupo B (n=10): se administraron 100 ml de glicerol-propilenglicol (Acetolena®, Santa Elena),
vía oral, a cada oveja y cada 12 horas. Estos tratamientos se realizaron después de obtener las muestras
de sangre, a las 06:00 y 18:00 horas.
Grupo C (n=10): se suplementó el pasto con 300 g de maíz triturado a cada oveja repartido en
dos tomas diarias. Estas se suministraron a los animales tras obtener las muestras de sangre (a las
06:00 y 18:00 horas).
A partir del encierro (día 130 de gestación) y hasta terminar los tratamientos se sangraron
diariamente, en yugular, todas las ovejas a la hora 06:00 para valorar ß-hidroxibutirato (BOHB) y
cada 12 horas para determinar glicemia. Estas últimas muestras fueron obtenidas a las 06:00 y 18:00
horas.
La sangre para determinación de glicemia se colectó en tubos con fluoruro de sodio, mientras que
para las demás determinaciones se recolectó en tubos secos, almacenándose hasta su procesamiento.
A partir del encierro y hasta terminar los tratamientos se obtuvieron cada 12 horas, muestras de
orina de todas las ovejas (06:00 y 18:00 horas por el método de apnea momentánea) y se procesaron
inmediatamente mediante el empleo de tiras reactivas de orina (Human-Test Combina®, Human),
para determinar el pH.
Se analizó la significación de las diferencias entre grupos en los niveles séricos de glicemia,
de BHOB y del pH urinario mediante el test de t para grupos independientes con estimaciones
independientes de la varianza. Los análisis estadísticos se realizaron con el programa STATISTICA
6.0. Se consideraron diferencias significativas cuando p<0,05. Todos los valores se presentan como
media ± desviación estándar ( x ± ds).
RESULTADOS
Los valores de glicemia tomados en el momento de retirar a las ovejas del ayuno y comenzar los
tratamientos, así como los tiempos transcurridos desde el comienzo del ayuno hasta alcanzar estos
valores de glicemia en los tres grupos no mostraron diferencias estadísticamente significativas entre
ellos (A = 23,8 ± 5,8, B = 27,2 ± 7,1 y C = 26,7 ± 6,5 mg/dl.
Una vez iniciados los tratamientos los valores de glicemia comenzaron a aumentar en los tres
grupos. En las ovejas pertenecientes al grupo B, la glicemia aumento más precozmente y sus valores
fueron superiores a los de los demás grupos durante todo el tratamiento. La glicemia de este grupo
presentó diferencia estadísticamente significativa (p<0,001) con la del grupo C a las 12 hasta de
comenzado el tratamiento, diferencia que se mantuvo durante 24 horas más. Al comparar la glicemia
de los animales del grupo B con los del grupo A se observa que ésta aumenta anteriormente en el
grupo B, aunque esa diferencia es significativa a partir de las 24 horas de instaurados los tratamientos
(p<0,0001). A partir de este momento y hasta finalizar las terapias, ambos grupos mostraron diferencia
significativa en los valores de glicemia, cuando habían transcurrido 24 horas de aplicar tratamiento en
el grupo A y no mostraron diferencia estadística en aquellos muestreos en los que habían trascurrido
12 horas de aplicar tratamiento en el grupo A. Cuando comparamos la glicemia de los grupos A y C,
vemos que solamente tuvieron diferencia significativa a las 12 horas de instaurada la terapia (p<0,01)
no mostrando diferencias hasta el último muestreo (p<0,001).
250
Al retirar los animales del ayuno los valores de este cuerpo cetónico no presentaron diferencias
significativas entre los grupos, siendo de 2,32 ± 0,53; de 2,54 ± 0,53 y de 2,62 ± 0,80 mmol/l para
A, B y C respectivamente. En los tres grupos el BHB comenzó a descender una vez aplicados los
tratamientos, aunque este descenso fue más precoz y pronunciado en el grupo B. Ya desde el segundo
día, se encontraron diferencias significativas con el grupo A (p<0,01) y con el grupo C (p<0,05)
diferencias que se mantuvieron hasta el final. Entre los grupos A y C los valores séricos de BHB no
mostraron, sin embargo, diferencia significativa durante todo el ensayo.
Al comienzo del ayuno el pH descendió en los tres grupos. Al iniciar los tratamientos la media de
los valores de pH para los distintos grupos no presentaron diferencias estadísticamente significativas
entre ellos y fueron de 5,8 ± 0,6 de 5,8 ± 0,4 y de 5,6 ± 0,5. El pH comenzó a ascender a las 24 horas
de iniciados los tratamientos en los grupos A y B, mientras que en el grupo C este ascenso comenzó
12 horas más tarde, sin que esta diferencia fuera significativa.
DISCUSIÓN
Si tenemos en cuenta los valores medios observados en la glicemia y el BOHB en el momento de
retirar las ovejas del ayuno (glicemia: A = 23,8 ± 5,8; B = 27,2 ± 7,1 y C= 26,7 ± 6,5 mg/dl; BOHB:
A = 2,32 ± 0,53; B = 2,54 ± 0,53 y C = 2,62 ± 0,80 mmol/l) y que no se observaron síntomas clínicos,
podemos asumir que estos animales previo al comienzo de los tratamientos, se encontraban en una
Toxemia de la gestación subclínica (Duffield, 2000).
Considerando que uno de los objetivos prioritarios del tratamiento de la Toxemia de la gestación
es el aumento de la glicemia (González Montaña y Rejas López, 1995; Herdt y Emery, 1992;
Marteniuk y Herdt, 1988), se observa que una vez iniciado los tratamientos la glicemia comenzó a
aumentar en los tres grupos experimentales. Sin embargo en las ovejas tratadas conjuntamente con
glucosa intravenosa e insulina y en las tratadas con glicerol-propilenglicol, este ascenso fue más
precoz que en las ovejas tratadas mediante la suplementación con maíz. Esta diferencia se puede
explicar si tenemos en cuenta las distintas velocidades de absorción y/o transformación en glucosa de
los precursores utilizados para el tratamiento. En respuesta al tratamiento con glicerol-propilenglicol
la glicemia se elevó de 32,2 ± 13,5 a 58,6 ± 8,6 mg/dl a las 12 horas de iniciado el tratamiento. El
propilenglicol, es absorbido en su mayoría intacto directamente desde el rumen a una tasa de 40
% por hora (Herdt y Emery, 1992) y alcanza su nivel máximo en sangre dentro de los 30 minutos
de su administración, logra su máxima conversión en glucosa sanguínea alrededor de las 4 horas
después de su administración. Cuando a las ovejas se les administró maíz, la glicemia se elevó
de 33,0 ± 11,5 a 36,0 ± 16,1 mg/dl a las 12 horas de iniciado el tratamiento, alcanzando los 54,0
± 13,0 mg/dl a las 48 horas de iniciado el mismo. El maíz al administrarse como suplemento del
forraje debe primero ser atacado por los microorganismos ruminales y transformado en ácidos grasos
volátiles, especialmente ácido propiónico. El propionato una vez formado, debe ser absorbido a nivel
de las papilas ruminales, siendo en parte transformado en lactato en la pared del rumen y ambos son
transformados en glucosa en el hígado vía neoglucogénesis. Los valores de glucosa en sangre de
las ovejas del grupo tratado con glicerol-propilenglicol fueron superiores a los de los demás grupos
durante todo el tratamiento. Este comportamiento de la glucosa es debido a que mientras que el
propilenglicol produce un incremento rápido de la glucosa, el glicerol es degradado lentamente en el
rumen produciendo una elevada proporción de propionato, principal precursor de la glucosa vía NG,
dando como resultado una elevación de la glicemia por un período relativamente prolongado (Bonino
y col, 1987; Hunt, 1976). Las ovejas tratadas con glucosa intravenosa no lograron mantener una
concentración de glicemia estable, produciéndose elevaciones rápidas post-administración seguidas
251
de importantes descensos de la misma Este mismo comportamiento de la glicemia fue descrito por
González Montaña y col (2001) quienes lo atribuyeron a la eliminación renal de glucosa cuando ésta
se administró vía intravenosa.
Teniendo en cuenta que otro de los principales objetivos del tratamiento de la Toxemia de la
gestación es restablecer la concentración normal de cuerpos cetónicos en sangre (González Montaña
y Rejas López, 1995; Herdt y Emery, 1992) los resultados de este experimento muestran que si bien
el BOHB sanguíneo descendió en los tres grupos experimentales una vez aplicados los tratamientos,
este descenso fue más precoz y pronunciado en las ovejas tratadas con glicerol-propilenglicol,
observándose además que en estos animales el BOHB se mantuvo significativamente más bajo
durante todo el ensayo.
Si observamos el comportamiento del pH urinario después de iniciados los tratamientos vemos
que presentó una tendencia paralela a la del BOHB en sangre. Como era de esperar a medida que
disminuía el BOHB sanguíneo aumentaron valores del pH urinario.
REFERENCIAS
Andrews A (1997). Pregnancy toxaemia in the ewe. In Practice, 19, 6, 306-312.
Bonino J, Sienra R, Sorondo L (1987). Enfermedades causadas por trastornos metabólicos: toxemia de la preñez.
En: Enfermedades de los lanares II. Ed. Bonino J, Durán del Campo A, Mari J, Hemisferio Sur, 239-265.
Cal Pereyra L (2007). Inducción Experimental de Toxemia de la Gestación Ovina. Aplicación a la explotación
ovina en Uruguay. Tesis Doctoral. Universidad de León, León, España.
Duffield T (2000). Subclinical ketosis in lactating dairy cattle. Vet Clin of North Am: Food Animal Practice, 16,
2, 231-251
Ford E J (1988). Toxemia de la gestación En: Martin W B, Enfermedades de la oveja. Ed. Acribia, Zaragoza,
159-164.
González-Montaña J R, Rejas López J (1995).Toxemia de la Gestación. Med Vet, 12, 9, 513–522.
González Montaña J R, Alonso Diez A J, López Mendez S, Cal Pereyra L, Prieto Montaña F (2001). Utilización
de la glucosa vía oral para el tratamiento de la gestosis ovina. Fase preliminar. En: IX Congreso Internacional
de la Federación Mediterranea de Sanidad y Producción de Rumiantes, León, España.
Harmeyer J, Schlumbohm C (2006). Pregnancy impairs ketone body disposal in late gestating ewes: Implications
for onset of pregnancy toxaemia. Research in Veterinary Science, 81, 2, 254-264.
Herdt T H, Emery R S (1992). Therapy of diseases of ruminant intermediary metabolism. Vet Clin of North Am:
Food Anim Pract, 8 ,1, 91-106.
Hunt E R (1976). Treatment of pregnancy toxaemia in ewes by induction of parturition. Australian Veterinary
Journal, 52, 338-339.
Marteniuk J V, Herdt T H (1988). Pregnancy toxemia and ketosis of ewes and does. Vet Clin of North Am: Food
Animal Pract, 4, 2, 307-315.
West H J (1996). Maternal undernutrition during late pregnancy in sheep. Its relationship to maternal condition,
pregnancy length, hepatic physiology and glucose metabolism. Br J Nutr, 75, 593-605.
252
A Survey of Teat End Hyper Keratosis Prevalence in the
Tabriz Dairy Herds
Hiperkeratoza sisa u stadima mliječnih krava u
provinciji Tabriz
Hamali H.1, S. Mosafery2
1
Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tabriz, Iran, Fax:
+984113357834, E-mail: [email protected]
Department of Clinical sciences, Faculty of Veterinary Medicine, University of Tabriz Azad Islamic, Iran
2
Abstract
Teat end hyperkeratosis is a very important problem which affects cows in the farms of Iran and many other
countries. This disease mainly caused by the over milking and defects in the milking machine function. In a
survey focusing on the 4 large dairy Holstein herds in suburb of Tabriz (north-west of Iran), prevalence of teat
end hyperkeratosis, was evaluated. In the herds of A (n=300) and B (n=160), cows were milked 3 times/day. In
the herds of C (n=162) and D (n=190) cows were milked 2 times/day. Prevalence of the teat end hyperkeratosis
in the herds of A and B were recorded as 63.38%. In the herds of B and C this prevalence was 24.86%. Also,
according to the wilson’s grading schedule (1986) the grades of 2 and 3 of hyperkeratosis more prevalent
between the cows which were milked 3 times/day, than cows milked 2 times/day. Statistical analyses indicated
significant differences between the herds of A and B (3 times milking/day) and herds of C and D (2 times
milking/day). In conclusion, according to our results, significant relationship exists between the cow’s teat end
hyperkeratosis and milking frequency/day.
Key words: Hyperkeratosis, Holstein, milking, cow, teat
Sažetak:
Hiperkeratoza vrha bradavice je ozbiljan problem koji zahvaća mliječne krave u Iranu i mnogim drugim
zemljama. Bolest je najčešće uzrokovana zbog prekomjernog dojenja te greškama u strojevima za mužnju.
Ispitivanja su provedena na 4 velike farme mliječnih Holstein goveda u okolici Tabriza ( sjevero-zapadni dio
Irana). U stadima A (n=300) i B (n=160) krave su mužene 3 puta dnevno. U stadima C (n=162) i D (n=190)
krave su mužene 2 puta dnevno. Učestalost hiperkeratoze u stadima A i B iznosila je 63.38%. U stadima Bi
D učestalost je bila 24.86%. Prema Wilsonovoj klasifikaciji (1986) 2. i 3. stupanj hiperkeratoze učestaliji su
između krava koje su mužene 3 puta dnevno nego kod krava koje su mužene 2 puta dnevno. Statističke analize
ukazuju na značajne razlike između stada A i B ( mužene 3 puta dnevno) i stada C i D ( mužene 2 puta dnevno).
Zaključno, u skladu sa našim rezultatima postoji signifikantna povezanosz između hiperkeratoze vrha bradavice
i broja mužnji po danu.
Ključne riječi: Hiperkeratoza, Holstein, mužnja, krava
Introduction
Milk production in the dairy farms is the basic economic source, which guaranties the life span
of these farms. Therefore udder of the cow is the most important organ, which may be attacked by
environmental or infectious pathogens. In this case, the main entrance for pathogens is the teat end
orifice. Naturally, teat end have many defensive mechanisms, including sphincter and keratinized
epidermis, which later one, is extended into the teat canal (4). After every milking, keratinized
epidermis, excretes some keratin which in turn closes the sphincter orifice by forming a keratinized
253
plaque(10). Hyper stimulation of the teat end by over milking, defects in milking machine function,
and unsuitable teat dippers utilization, lead to teat end hyperkeratosis (11). On the other hand, keratin
projection from the teat sphincter, will be result in colonization of pathogens such as Fusobacterium
necroforum, and finally lead to diseases such as black spot and acute mastitis.
The objective of this research was evaluation of teat end hyperkeratosis prevalence in the Tabriz
dairy herds and indication of its probable relationship with milking frequency/day.
Material and method
This research was carried out on May 2007 in the four large dairy herds (A, B, C and D) of Tabriz
suburb (north-west of Iran) with the Mediterranean climate and nearly 2000 meter altitude above sea
level.
Herd A, included of 300 dairy Holstein cows, with mean milk production of 32Kg/day/cow and
3 times milking/day (8 am and 14, 22 pm). Herd B, included of 160 dairy Holstein cows, with mean
milk production of 30 kg/day/cow and 3 times milking/day (5 am and 13, 21 pm).
Herd C, included of 162 dairy Holstein cows with, mean milk production of 28 kg/day/cow and
2 times milking/day (8 am and 16 pm).
Herd D, included of 190 dairy Holstein cows with mean milk production of 31 kg/day/cow and
2 times milking/day (7 am and 17 pm).
Nutrition of herds was the same and consisted of hay, corn, cottonseed, concentrates and mineral
supplements.
In all of the herds, milking procedure was performed by West Valia Company milking
machines,
Before the milking, teats of the cows were washed and dried by special papers and then, were
inspected very carefully and categorized according to the Wilson’s grading schedule.
According to this schedule, grade 1, is the normal teat end, and grade 4 is the maximum teat end
hyperkeratosis.
Finally, collected data were analyzed by soft ware of SPSS version 13 and statistical method of
chi-square and Mann-Whitney tests.
Results
Summarize of results are shown in figures (Fig.1, Fig.2, Fig.3 and Fig.4). Overall rate of teat end
hyperkeratosis in the 4 groups (a total number of 807 cows) was 43.84% (fig 5-1).
254
54
53.16
52
50
Ne g itive
48
46.84
46
Po s itive
46.84
53.16
Ne g itive
Po s itive
44
42
Fig.1. Prevalence of teat end hyperkeratosis in all of the herds (A, B, C and D)
But in detail, the rate of teat end hyperkeratosis in the groups of 2 time’s milking/day/cows was
24.86% and in the groups of 3 time’s milking/day/cows was 63.68% (Fig.2 and Fig.3).
80
75.14
60
Ne g itive
40
24.86
Ne g itive
Po s itive
Po s itive
24.86
20
75.14
0
Fig.2. Prevalence of teat end hyperkeratosis in the herds with 2 times milking/day (C and D)
70
63.68
60
50
Ne g itive
40
30
26.32
Po s itive
36.32
63.68
Ne g itive
Po s itive
20
10
0
Fig.3. Prevalence of teat end hyperkeratosis in the herds with 3 times milking/day (A and B)
255
The rates of teat end hyperkeratosis in the two groups analyzed by Crosstab and Chi-square
tests. The difference between two groups of cows (3 times milking/day vs 2 times milking/day) was
significant (P<0.01) (Table 1 and Table 2).
Table 1. Comparing the rates of teat end hyperkeratosis in the 2 and 3 times milking/day herds by crosstab
tests (Crosstab)
Disease
Total
Negative Count
Expected conunt
% within Disease
% within MILKING
% of Total
Positive Count
Expected conunt
% within Disease
% within MILKING
% of Total
Count
Expected conunt
% within Disease
% within MILKING
% of Total
MILKING
3
2
248
181
296.1
132.9
57.8%
42.2%
44.5%
72.4%
30.7%
22.4%
309
69
260.9
117.1
81.7%
18.3%
55.5%
27.6%
38.3%
50.6%
557
250
557.0
250.0
69.0%
31.0%
100.0%
100.0%
69.0%
31.0%
Total
429
429.0
100.0%
53.2%
53.2%
378
378.0
100.0%
46.8%
46.8%
807
807.0
100.0%
100.0%
100.0%
Table 2. Comparing the rates of teat end hyperkeratosis in the 2 and 3 times milking/day herds
by Chi-Square Tests (P<0.01) Chi-Square Tests
Value
Pearson Chi-Square
Continuity Correctiona
Likelihood Ratio
Fisher’s Exact Test Linear-byLinearAssociation
N of Valid Cases
a.Computed only for a 2×2 table
53.848b
52.735
55.474
53.782
807
df
Asymp. Sig.
(2-sided)
1
1
1
.000
.000
.000
1
.000
Exact Sig.
(2-sided)
.000
Exact Sig.
(1-sided)
.000
b.0 cells (.0%) have expected count less than 5. The minimum expected conunt is 117.
10.
On the other hand, according to the Wilson’s grading schedule, the rate of grades 2 teat end
hyperkeratosis was more prevalent than grades 3 and 4, in the herds (fig.4).
256
35
33.4
30
25
20
15
12.8
10
5
1.5
0
G2
G3
G4
Fig.4. Prevalence of grades 2, 3 and 4 in the herds (A,B, C and D)
By using the Mann-Whitney U test for all of the quarters, it was revealed that, the intensity of
teat end hyperkeratosis in the 3 times milking/day cows is more than of 2 times milking/day cows
(P<0.01) (table 3).
Table 3. Comparing intensity of the hyperkeratosis in the herds with 2 and 3 times/day by Mann-Whitney U
tests (P<0.01) Ranks
Milking
Rcr
Rca
Lcr
Lca
3
2
Total
3
2
Total
3
2
Total
3
2
Total
N
Mean Rank
Sum of Ranks
456
350
506
457
349
806
456
349
805
456
350
806
444.02
350.71
202471.50
122749.50
454.99
336.08
207930.50
117290.50
444.13
349.26
202525.00
121890.00
440.46
355.34
200852.00
124369.00
Test Statisticsa
Mann-Whitney U
Wilcoxon W
Z
Asymp. Sig. (2-tailed)
Rcr
Rca
Lcr
Lca
61324.500
122749.5
-7.533
.000
56215.500
117290.5
-9.233
.000
60815.000
121890.0
-7.763
.000
62944.000
124369.0
-6.975
.000
a. Grouping Variable: milking
257
Discussion
Teat end hyperkeratosis is a very important complication in the dairy herds of Iran and many
other countries. Wilson (1986), categorized the forms of teat end hyperkeratosis into 4 grades, which
grade 1 was the normal teat end and grade 4 was the teat end with the maximum hyperkeratosis (9).
In the 2004, Gleeson and William in a study, reported that, the rate of teat end hyperkeratosis in the
Irish Holstein dairy herds is 31.4%, and the rates of grades 2,3 and 4 hyperkeratosis are 20%, 5.5%
and 0.5% respectively (6).
Kirk (2004) reported that, the rate of teat end hyperkeratosis in the dairy farms of California is
23.8% and the rates of grades 2, 3 and 4 are 24%, 4.4% and 0.25% respectively (7).
In contrast with the above mentioned data, our results showed high rate teat end hyperkeratosis
prevalence in the Tabriz dairy herds, especially in the herds with 3 times milking/day.
Also, the rates of grades 2, 3 and 4 teat end hyperkeratosis more prevalent than of other countries
(3).These differences partly are related to the utilization of non-standard milking machines and
non-standard teat dippers. But the most important factor in this case, is the milking frequency/day
(Fig4).
The following factors could be affec the rate of teat end hyperkeratosis in a herd (1, 2):
1- Teat shape: convex teat ends are more susceptible to the hyperkeratosis than flat teat ends.
2- Incidence of teat end hyperkeratosis is more prevalent in the cold seasons (winter and
spring), than warm seasons.
3- Defect in the milking machine function, directly lead to hyperkeratosis.
4- Hyper sensitivity to the teat dippers could be cause hyperkeratosis.
5- Increases in the cow age.
6- High milk production.
7- Finally according to our results, milking frequency/day has a direct effect on the rate of teat
end hyperkeratosis in the herds (Tables 1 and 2). In other word, Increase in the milking frequency/day
lead to increase in the teat end hyperkeratosis and consequent diseases such as black spot and mastitis
in the herd.
References
1. Andrews, A.H., Blowey, R.W., Boyd, H., Eddy, R.G., 1992, Bovine medicine disease and husbandary of
cattle, Sanders London, pp: 7-28.
2. Blowey, R., Edmondson, P.,1995, Mastitis control in dairy herds an illustrated and practical guide, pp: 3268.
3. Bakken, G., 1981, Relationship between udder and teat morphology, mastitis and milk, production in
Norwegian Red cattle. Acta Agric, pp: 25-32.
4. Craven, N, & Williams, M.R., 2004, Defences of the bovine mammary gland against infection and prospects
for their enhancement. Veterianry Immunology and Immunopathology, pp: 10-71.
5. Dyce, Sack, Wensing, 1995, Text book of veterinary anatomy. By W. B. Sanders Company. pp: 9-45.
6. Gleeson, David, E., Meaney, J., William, 0., 2004, Callaghan Edmond J, Rath. Mylesv, Effect of teat
hyperkeratosis on somatic cell counts of dairy cows - teagasc, moorepark production center, fermoy, co,
cork, Ireland -vol: 2, No 2, pp: 41-52.
7. Kirk, John H., 2003, Risk factors for Excessive Hyperkeratosis of teat end- Extension veterinarian school
of medicine university of California Davis Tulare. C A, pp: 16-26.
258
8. Mein, G.A, Neijenhuis, F., Morgan, W.F., Reinemann, D.J., Hillerton, J.E., Baines, J.R., Ohxstad, I.,
Rasmussen, M.D., Timms, L., Britt, J.S., Farnsworth, R., Cook, N., Hemling, T., 2001, Evaluation of bovine
teat condition in commercial dairy herds (Non infectious Factors) - Teat ceub international of Netherlands,
pp: 28-35.
9. Neijenhuis, F., Mein, G.A., Britt, J.S., Reine, unn. DJ., Hillerton, J.E., Faransworth, R., Baines, J.R.,
Hemling, T., ohnstad, I., Cooks, N.B., and Morgan, W.F., 2001, Relationship between teat-end callosity or
hyperkeratosis and mastitis, Paper presented at the proceeding, AABP-NMC International symposium on
Mastits and milk quality, Vancouver, bcm Canada, September, pp: 41-50.
10. Radostits, M., Otto, Y., 2000, Veterinary Medicine, Sanders London, pp: 46-59.
11. Shearn, M.F., Hillerton, J .E., 2002, Hyperkeratosis of the teat duct orifice in the dairy cow, Institute for
animal health, Compton laboratory, Newbury, U.K pp: 18-25.
12. Swenson, K., Melvin, J. and Reece., William, O., 1996, Duke’s Phisiology of domestic animals eleventh
edition. By Cornell university, pp: 34-49.
259
260
PERACUTE STAPHYLOCOCCUS AUREUS MASTITIS IN EWES
PERAkutni STAPHYLOCOCCUS AUREUS MASTITIS u ovaca
Pengov A*, Podpečan O.**
*Institute for microbiology, Veterinary faculty of Ljubljana, Gerbičeva 60, 1000 Ljubljana, E-mail: andrej.
[email protected]
** Savinjska veterinarska postaja, Celjska c. 3/a 3310 Žalec, Slovenia
Abstract
Staphylococci are the main etiological agents of intramammary infections in ewes. Staphylococcus aureus
is the predominant organism isolated in ovine clinical mastitis, while coagulase-negative staphylococci,
traditionally considered as non-pathogenic or of low pathogenicity for the mammary gland of domestic
ruminants, are the most prevalent isolates in subclinical intramammary infections. The annual incidence of
clinical mastitis in ewes is usually lower than 5%, however severe mastitis outbreaks caused by Staphylococcus
aureus are not uncommon. Antibiotic therapy regimes generally formulated for the bovine mammary gland
are often unsuccessful in eliminating existing Staphylococcus aureus udder infections. At the time of weaning
and start of milking (6-8 weeks after parturition) in a flock of 180 dairy ewes, 29 cases of peracute gangrenous
clinical mastitis appeared, during a 10 days period. In 26 cases (90%), Staphylococcus aureus was determinate
as the causative agent. In the described case, diseased animals were treated intramammary and parenteral with
a cephalosporin preparation designed for cows, immediately after detection of inflammatory changes in the
mammary gland. Despite of immediate treatment, which was based on results of laboratory findings, 9 of the
animals (31%) died, 14 (48%) lost the affected udder half and only in 6 cases (21%) functional recovery was
achieved.
Key words: clinical mastitis, ewes, Staphylococcus aureus, treatment
Sažetak:
Stafilokoki su glavni etiološki uzročnici intramamarnih infekcija u ovaca. Staphylococcus aureus je
najčešće izolirani mikroorganizam u ovaca sa kliničkim mastitisom, dok se koagulaza negativni stafilokoki
nalaze ka one patogeni ili slabo patogeni mikroorganimi najčešće u ovaca sa subkliničkim mastitisom. Godišnja
učestalost klinički evidentnog mastitisa u ovaca je obično manja od 5%, isto tako učestalog teških oblika
mastitisa uzrokovanog sa Staphylococcus aureus nije učestala. Antibiotici koji se koriste u liječenju mastitisa
kod krava često ne uspijevaju eliminirati infekciju vimena ovaca uzrokovanih sa Staphylococcus aureus. U
vrijeme odbića te početkom sisanja u stadu od 180 mliječnih ovaca zabilježili smo 29 slučajeva gangrenoznog
mastitisa u razmaku od 10 dana. U 26 slučajeva izoliran je Staphylococcus aureus . Oboljele životinje liječene
su intramamarnom I parenteralnom aplikacijom cefalosporina namijenjenim za liječenje mastitisa kod krava.
Unatoč brzo započetom liječenju 9 životinja je uginulo, 14 životinja je uzgubilo vime a kod samo 6 životinja
zamijećen je potpuni oporavak.
Ključne riječi: Klinički mastitis, ovce, liječenje, Staphylococcus aureus
INTRODUCTION
The increasing demand for ewe’s milk and milk products has been reflected in recent years in
fresh interest in raising small ruminants. With increasing production and the introduction of more
intensive breeding methods, questions connected with inflammation of the udder and the quality of
milk from small ruminants have become more actual in the last decade (Pengov, 2001).
261
The incidence of clinical mastitis cases is mostly less than 5%, both in dairy and in meat flocks
of ewes. As a general rule, the overall level of infection within a flock is consistently less than that
found in a herd of dairy cows. Where ewes are used primarily for meat production outbreaks, mostly
associated with some predisposing factors (teat lesions), have been reported occasionally. When
ewes are milked commercially the prevalence of clinical and subclinical mastitis is usually higher.
As it is the case in dairy cows, the increase in milk production by dairy ewes has resulted in a similar
increase in the prevalence and severity of mastitis and other diseases of the udder (Watson and
Buswell, 1984).
In spite of the variety of organisms, which may be isolated from the ovine udder, there is a basic
pattern of distribution, which pertains, in broad terms, irrespective of geographical location, but is
affected to some degree by the stage of lactation at which udders are sampled. Thus, regarding clinical
mastitis Staphylococcus aureus is the predominant organism, with Pasteurellaceae, Corynebacteria,
Streptococci and Mycoplasmas of secondary importance (Kirk et al., 1996). Coagulase-negative
staphylococci, which have been previously considered to be non-pathogenic, are definitely capable
of producing clinical mastitis in ewes and are the most prevalent causative agent isolated from
subclinical mastitis cases (Albenzio et al., 2002).
Clinically, mastitis in small ruminants is normally connected with serious disorders in the general
health state of the animal resulting in the animal’s death or in complete or partial sloughing of the
udder (Calavas et al., 1998).
The objective of the present study was to describe an outbreak of peracute gangrenous mastitis in
a separate sheep flock, to elucidate the causes and to establish reasonable treatment regimes.
Animals. At the time of the mastitis outbreak 180 ewes (domestic dairy breed) were included in
the described flock. During a 10 days period 29 cases (16% of the animals in the flock) of peracute
clinical mastitis appeared. In 26 (90%) cases, Staphylococcus aureus was isolated as the causative
agent.
Bacteriology. Immediately before treatment, milk samples from the infected udder halves, were
collected into autoclaved glass tubes following teat swabbing with 70% alcohol and after discarding
the first streams of milk. The samples were kept cool and streaked, using a sterile swab, within
24 hours on quarter plates of washed ovine blood agar and were incubated at 37oC. Plates were
examined at 24 and 48 hours for aerobic bacterial growth. Gram-positive cocci were considered as
Staphylococcus or Micrococcus species if they were catalase-positive. Differences in haemolysin
production were classified visually by an experienced observer as either β-haemolysin-positive
(incomplete haemolysis with a sharply defined margin) or β-haemolysin-negative (no haemolysis or
another type of haemolysis) (Jasper and Jain, 1966).
The slide coagulase test was performed as described by the manufacturer of the rabbit coagulase
plasma (Difco). The slide coagulase test, which detects bound coagulase, was considered positive if
clumping was observed within 10 s. If the reaction was weak, or if it occurred after 10 s, the sample
was judged as doubtful (Lam et al., 1995).
To determine Staphylococcal isolates at the species level the API-Staph test (Bio Merieux) was
used (Jasper et al., 1985).
Antimicrobial susceptibility testing. The agar diffusion test was used to determine the antimicrobial
susceptibility of the isolated S. aureus strains. With a sterile loop the tops of 4-5 colonies of S. aureus
262
from pure culture were picked up. The colonies were suspended in 5 ml of sterile physiologic saline.
The inoculum turbidity was standardized to equivalent of a 0,5 McFarland standard. The entire
surface of a Mueller-Hinton agar plate was inoculated using a sterile swab. Disks containing various
antibiotics (penicillin, ampicillin, cefquinome, amoxicillin/clavulanic acid and kanamycin) were
placed using a sterile forceps onto the agar surface and gently pressed down to ensure contact. Plates
were incubated at 35oC for 20 hours. Subsequently the diameter of the zone of inhibition around each
disk was measured. This procedure is conforming to the National Committee for Clinical Laboratory
Standards (NCCLS) documents M31-A2 and M2-A7.
Treatment protocol. In the described mastitis outbreak, all animals were treated intramammary
and parenteral with a cephalosporin preparation designed for cows. For intramammary applications
a complete syringe for each udder half was used. For parenteral treatment doses prescribed by the
manufacturer were used. In all cases treatment was introduced immediately after the finding of
inflammatory changes in the udder. The infected udder halves were treated at least for five days (at
ten consecutive milking) and within this period animals received also two intramuscular injections.
In the most severe cases the therapy was supported with intravenous applications of trimethoprim.
The factors predisposing to peracute gangrenous mastitis outbreaks in sheep flocks are not
always clearly evident. Ruminants are unique in that they have a “dual” digestive system: microbial
fermentation and digestion in the rumen and intestinal digestion similar to other mammals.
Especially the rumen digestion is very sensitive to rapid changes in nutrition. In high producing
animals, disturbances in the general metabolic processes can have a severe influence on the function
of the mammary gland (Bocklisch and Wetzstein, 1994). Heavy feeding for increased production
can produce clinical mastitis in animals where subclinical mastitis or latent infections had existed
previously.
In our case, several days before the outbreak of mastitis, the owner of the flock practically
overnight changed the feed ration. The sheep were in that period on fresh pasture, and the ration was
supplement with hay and protein concentrates. Unbalanced rations in the most vulnerable period after
parturition in connection with a number of physical and psychological stressors can be undoubtedly a
serious risk factor for the development and course of udder infections (Maisi et al., 1987).
The described mastitis outbreak was characterized by a sudden onset at the time of weaning;
good milking ewes were particularly affected. Animals were depressed; anorexia and an increased
body temperature (41oC and more) were also present. At the early stage of the disease hyperaemia,
swelling, pain and severe oedema of the infected udder half was observed. Sick animals remained
behind the flock. In the following days two different clinical courses of the disease became evident.
Table 1: Prevalence of clinical and subclinical mastitis in the flock over a five year period
YEAR
2001
2002
2003
ANIMALS
N
157
168
180
CLIN. M.
N
%
9 (5,7%)
11 (6,5%)
29 (16,1%)
S.aureus
N %
7 (4,5%)
8 (4,8%)
26 (14,4%)
SUBCL. M.
N
%
29 (18,5%)
24 (14,3%)
16 (8,9%)
S.aureus
N %
7 (4,5%)
3 (1,8%)
6 (3,3%)
263
2004
2005
195
209
7 (3,6%)
5 (2,4%)
4 (2,1%)
5 (2,4%)
22 (11,3%)
19 (9,1%)
6 (3,1%)
5 (2,4%)
Clin. m. = Clinical mastitis; Subcl. m. = Subclinical mastitis
Table 2: Mastitis outbreak (2003)
TOTAL NUMBER OF CLINICAL
CASES
ISOLATION OF
S. AUREUS
GANGRENOUS FORM
N
%
29
100
26
89,7
16
55,2
In the majority of cases the gangrenous form developed and despite the immediate treatment,
which was based on results of laboratory examinations, 9 of the animals (31%) died during the first
five days. In 16 (55%) cases a separation of the gangrenous tissue occurred, which gradually falls off.
This process lasted a number of weeks and, during this time, the animals constantly lost weight. In
the remaining cases an indurative process was observed, edema of the udder and the blue coloration
of the skin gradually fade, but because of induration, the diseased udder half was lost. For economic
reasons, these animals were no longer suitable for further breeding after recovery.
Table 3: Antimicrobial drug susceptibility (Agar disk diffusion test) N = 26
ANTIBIOTIC
S
%
73,1
76,9
88,5
92,3
96,2
Penicillin
Ampicillin
Kanamycin
Amoxicillin/clav.acid
Cefquinome
I
%
R
%
26,9
23,1
11,5
7,7
3,8
S = Sensitive; I = Intermediate; R = Resistant
Table 4: Treatment results
NUMBER OF TREATMENTS
COMPLETE CURE
CULLING AFTER RECOVERY
DEATH
N
29
6
14
9
%
100
20,7
48,3
31,0
Staphylococcus aureus mastitis in ewes is in most cases clinically identical with the peracute
form in cattle (Bergonier et al., 2003). The course of the disease is rapid and its effects severe.
Treatment is therefore invariably directed at saving the life of the ewe in the full knowledge that
lesions within the affected udder tissue are often irreversible (Buswell and Barber, 1989). However,
early detection of clinical signs and immediate treatment, sometimes enable functional recovery of
infected udder halves.
264
CONCLUSIONS
Considering the achieved recovery rate in the present study, the average mastitis treatment costs
exceeded the culling value of the animals. Because of the unpredictable course of the disease and
consecutive low cure rates concerning ewes mastitis, permanent and effective prophylaxis is even
more important than in other animal species.
REFERENCES
1. Albenzio, M., Taibi, L., Muscio, A., Sevi, A., 2002. Prevalence and etiology of subclinical mastitis in
intensively managed flocks and related changes in the yield and quality of ewe milk. Small Rumin. Res.
(43) 219-226.
2. Bergonier, D., De Cremoux, R., Rupp, R., Lagriffoul, G., Berthelot, X., 2003. Mastitis of dairy small
ruminants. Vet. Res. (34) 689 - 716.
3. Bocklisch, H., Wetzstein, D., 1994. Klinische, labordiagnostische und therapeutische Untersuchungen zur
Mastitis in einem großen Schafzuchtbestand. Tierärztl. Prax. (22) 524-528.
4. Buswell, J.F., Barber, D.M.L., 1989. Antibiotic persistence and tolerance in the lactating sheep following a
course of intramammary therapy. Br. Vet. J. (145) 552-557.
5. Calavas, D., Bugnard, F., Ducrot, C., Sulpice, P., 1998. Classification of the clinical types of udder disease
affecting nursing ewes. Small Rumin. Res. (29) 21-31.
6. Jasper, D.E., Jain, N.C., 1966. Hemolytic behaviour of staphylococci isolated from cows milk. Can. J.
Comp. Vet. Med. Sci. (30) 63-70.
7. Jasper, D.E., Infante, F., Dellinger, J.D., 1985. Efficacy of the API Staph-Ident system for identification of
staphylococcus species from milk. Am. J. Vet. Res. (46) 1263-1267.
8. Kirk, J.H., Glenn, J.S., Maas, J.P., 1996. Mastitis in a flock of milking sheep. Small Rumin. Res. (22) 187191.
9. Lam, T.J., Pengov, A., Schukken, Y.H., Smit, J.A.H., Brand, A., 1995. The differentiation of Staphylococcus
aureus from other Micrococcaceae isolated from bovine mammary glands. Appl. Microbiol. (79) 69-72.
10. Maisi, P., Junttila, J., Seppänen, J., 1987. Detection of subclinical mastitis in ewes. Br. Vet. J. (143) 402409.
11. Pengov, A., 2001. The role of coagulase-negative Staphylococcus spp. and associated somatic cell counts
in the ovine mammary gland. J. Dairy Sci. (84) 572-574.
12.Watson, D.J., Buswell, J.F., 1984. Modern aspects of sheep mastitis. Br. Vet. J. (140) 529-534.
265
266
Onset of ovulation analysis in dairy cows
Analiza vremena nastupa ovulacije u mliječnih
plotkinja
Zobel Robert (1), Darko Gereš (2), Romana Turk (2), Damjan Gračner (2), Damir
Žubčić (2)
(1)Vetmed d.o.o. Stružec,
(2) Veterinarski fakultet Sveučilišta u Zagrebu
ABSTRACT
The research was conducted from December, 1st 2004 to December, 1st 2006, in Moslavina, a part of
Sisak-Moslavina county situated in Central Croatia. Veterinary service in this concession area are covered by
the veteinary ambulance VETMED Ltd. In their covering area there are over 2000 dairy cows and heifers.
The research has included 1088 cows , 218 heifers and 870 cows. 598 (54,96%) of them were symenthal
breed, 27,39% were holstein-friesian breed , 9% were red holstein, 2,57% were montafon breed and 6,1% were
crossbred, dominantly in the type of holstein friesian breed. After detecting the beginning of oestrus, the cows
were examined gynecologicaly and by using of ultrasound, in the morning and in the evening. According to
the findings, they have been inseminated artificially, till gynecological and ultrasound detection of ovulation.
Cows with reproductive disorders weren’t observed, but only those with regular cyclus, e.i. the cows which
have concepted after the insemination . Even 64,28% montafon breed cows ovulated within 24 hours from
the beginning of estrus, and 49,17% of the symenthal breed, 36,24% of holstein-friesian breed, 33,33% of
crossbred and 32,65% of red holstein. Incidence of ovulation manifestation between the 24th and 48th hour was
high in symenthal breed (36,46%), and somewhat lower and equal in red holstein, montafon breed and holsteinfriesian breed (22,45%; 21,43% and 20,13%). Average incidence of the delayed ovulation (48 to 72 hours) in
red holstein, cross breeds and holstein-friesian breed was 36,74%; 34,85%; 33,89%. Average incidence of the
delayed ovulation from 72 to 96 hours was detected in 3,68% symenthal breed, 9,06% holstein-friesian breed,
7,14% of red holstein and 27,27% cross breeds, with the remark that none of the cases of the delayed ovulation
has been found in montafon breed. Cows with the delayed ovulation over 96 hours have also been detected
(holstein-friesian breed 0,67%, red holstein 1,02% and cross breeds 1,51%). The results of this research suggest
that the average oestrus length is extended, and that the ovulation is late in holstein breed. Almost the same
values in cows and heifers which were fenotypicali and genotypicali dominantly of holstein crossbred, are the
proof of unresonable cross breeding. High average percentage (85,71%) of the early ovulations to 48 hours,
tells of a good reproductive health of the montafon breed, even more because of the fact that only cows were
represented. It is explicable, since the montafon breed are of the low productivity cows in this area.
SAŽETAK
Istraživanje je provedeno u razdoblju od 1. prosinca 2004. godine do 1. prosinca 2006. godine u dijelu Moslavine, sastavnice Županije sisačko-moslavačke, smještene u središnjoj Hrvatskoj. To je koncesijski teritorij
koji veterinarskim djelovanjem pokriva Veterinarska ambulante VETMED doo.. Na terenu ambulante obitava
preko 2000 mliječnih krava i junica. Istraživanjem je obuhvaćeno 1088 plotkinja, (218 junica i 870 krava), od
čega 598 (54,96%) u tipu domaćeg simentalca, 27,39% crno-šarog holštajna , 9% crvenog holštajna, 2,57%
montafonskog goveda i 6,1% križanih, dominantno u tipu crno-šarog holštajna. Po detektiranom početku
estrusa plotkinje su ginekološki i ultrazvučno pregledavane ujutro i navečer. Sukladno nalazu, umjetno su
osjemenjavane sve do ginekološke i ultrazvučne detekcije ovulacije Krave sa reprodukcijskim poremećajima
nisu opservirane već samo one sa regularnim ciklusom koje su nakon osjemenjavanja koncipirale . Čak 64,28%
plotkinja montafonske pasmine ovuliralo je unutar 24 sata od početka estrusa, u simentalca49,17%, crno-šarih
267
36,24%, križanih33,33% i crvenog holštajna 32,65%. Incidencija pojavnosti ovulacija između 24. i 48. sata
bila je visoka u simentalaca (36,46%), a nešto niža i ujednačena u crvenog holštajna, montafonca i crno-šarog
holštajna (22,45%; 21,43% i 20,13%). Prosječna incidencija kasnijih ovulacija (48 do 72 sata) u crvenog
holštajna, križanaca i crno-šarog holštajna bila je (36,74%; 34,85%; 33,89%). Prosječni nastup kasnih ovulacije
u razdoblju 72 do 96 sati bio je u 3,68% plotkinja tipa simentalaca, 9,06% crno-šarog goveda, 7,14% crvenog
holštajna i 27,27% križanih, uz napomenu da u montafonca nije bilo plotkinja sa zakašnjelom ovulacijom.
Registrirane su i plotkinje sa kasnom ovulacijom iznad 96 sati (crno-šaro govedo 0,67%, crveni holštajn
1,02% i križane 1,51%). Rezultati istraživanja sugeriraju kako je prosječno trajanje estrusa produljeno odnosno
nastup ovulacije kasniji, u plotkinja koje su holštajnske pasmine. Podjednake vrijednosti u krava i junica koje
su fenotipski i genotipski dominantno holštajnski križanci, dokaz su nerezonskog križanja. Prosječni visoki
postotak (85,71%) ranih ovulacija do 48 sati, govori o dobrom reprodukcijskom zdravlju montafonaca, tim
više što su bile zastupljene samo krave. To je objašnjivo budući su montafonci u ovom podneblju krave niske
proizvodnje. UVOD
Jedan od uvjeta za postizanje zadovoljavajuće plodnosti je rasplođivanje u optimalno vrijeme. Loš
postotak koncepcije djelomično je i posljedica osjemenjavanja u krivo vrijeme. Autori pretpostavljaju
da bi vrijeme inseminacije bilo bolje određivati obzirom na ovulaciju, a ne temeljem estrusa, ali na
žalost, u praksi još ne postoje metode kojima bi se vrijeme ovulacije moglo predvidjeti. Stoga su
istraživali korelaciju između karakteristika estrusa i vremena ovulacije (Roelofs i sur. 2006).
Ovulaciju inicira porast LH hormona koji rezultira rupturom folikula i otpuštanjem jajne stanice
(Espey, 1994). Nakon ovulacije je kratak period u kojem jajna stanica može biti fertilizirana (Brackett
i sur.,1980). Trimberger (1948) smatra da je optimalno vrijeme za fertilizaciju između 6 do 12 sati
nakon ovulacije, dok je vrijeme preživljavanja spermija u reprodukcijskom traktu 24 do 30 sati.
Kako je godišnji gubitak mliječne industrije USA, samo zbog grešaka u detekciji estrusa, veći
od 300 milliona dolara, učinkovita detekcija i točno vrijeme inseminacije od najvećeg je značenja za
poboljšanje reprodukcijske efikasnosti stada (Senger, 1994).
Prema Trimberger-u (1948) trajanje estrusa u mliječnih krava kreće se u rasponu od 2.5 do
28 sati, prosječno 18 sati, u krava vizualno opserviranih triput dnevno. Ovulacija se obično javlja
otprilike 28 to 32 sati od početka estrusa (Trimberger 1948; Walker i sur., 1996). Roelofs i sur. (2006)
ustanovili su da je prosječno trajanje estrusa 18 sati (4 do 24 sata), a ovulacija nastupa oko 30 sati
od početka estrusa (10-15 sati po završetku estrusa). Prema tome, pretpostavljeno vrijeme ovulacije
je 29.3±3.9 sati, budući je prosječni nastup estrusa bio 26.4±5.2 sati prije ovulacije. Zaključili su
da inseminacija 24 do 12 sati prije ovulacije rezultira najvećim brojem kvalitetnih embrija 7. dana,
odnosno da je najbolje vrijeme inseminacije 5 do 17 sati od početka estrusa.
Trimberger (1948) smatra da je optimalno vrijeme za inseminaciju u mliječnih krava između 6.
and 24. sata prije ovulacije, a postotak koncepcije drastično pada kod UO nakon ovulacije. Postotak
koncepcije bio je viši u krava inseminiranih unutar 24 sata od početka estrusa nego u prvih 12 sati
nakon početka estrusa (Saacke i sur., 2000). S druge strane, krave inseminirane 12 - 24 sata od
početka estrusa imale su viši postotak degeneriranih embrija u odnosu na osjemenjene do 12. sata od
početka estrusa.
Prema istraživanju Nalbandov i Casida-e, (1942) i Trimberger-a, (1948) mliječne krave ovuliraju
10-15 sati po završetku estrusa ili 27.6 ± 0.6 sati od početka estrusa (Walker et al., 1996). Najbolji
postotak koncepcije bio je kada su inseminirane između 4. i 12.sata nakon početka estrusa (Dransfield
et al., 1998).
Trimberger (1948) je ustanovio da ovulacija u mliječnih junica nastupa 10,5 sati po završetku
estrusa. Mliječne krave mogu ovulirati ranije od početku estrusa nego mesne krave. Tako mliječne
krave ovuliraju 27.6 ± 0.6 sati nakon početka estrusa (Walker i sur.,1996). Yelich i sur., (1999)
268
ustanovili su da Angus, Brahman, and Senepol krave ovuliraju 30.8 sati od početka estrusa. Skraćen
interval od početka estrusa do ovulacije u mliječnih krava u odnosu na mesne krave uvjetovan je
managementom, hranidbom, laktacijskim stresom i pasminskim specifičnostima.
U posljednjih 50 godina istraživano je optimalno vrijeme za UO u odnosu na stadij estrusa.
Ustanovljeno je da je koncepcija bila viša u krava inseminiranih između 6 i 24 sata prije ovulacije,
pa je preporučan sustav osjemenjavanja “a.m.–p.m” (Trimberger, 1948). To znači da bi krave u
kojih je estrus počeo prijepodne trebale biti osjemenjene u poslijepodnevnim satima, a krave koje
su se počele tjerati poslijepodne, trebalo bi inseminirati sljedećeg prijepodneva. Ipak, istraživanja su
pokazala da se maksimalna koncepcija nije postizala ”a.m.-p.m.” sustavom već osjemenjavanjem
u srednje prijepodne u krava koje su se počele tjerati prethodne noći ili istog jutra (Foote 1979).
Također, krave inseminirane jednokratno (između 8 i 11 sati prijepodne) imale su podjednak postotak
koncepcije kao krave osjemenjene sustavom “a.m.-p.m.” (Nebel i sur. 1994). Prema Dransfield-u i
sur. (1998) krave treba osjemeniti ranije nego po sustavu “a.m.-p.m.” jer je postotak koncepcije u
krava osjemenjenih između 4. i 12. sata od početka estrusa, bio viši nego u krava inseminiranih 16
sati od početka estrusa.
Dransfield i sur. (1998) koristeći metodu kontinuirane opservacije estrusa radiotelemetričkim
sustavom (HeatWatch), ustanovili su da je prosječno trajanje estrusa 7 sati. Walker i sur. (1996) su u
holštajnskih krava, 42.-49.dana postpartalno, determinirali su početak spontanih i induciranih estrusa
HeatWatch sustavom, a vrijeme ovulacije detektirali ultrasonografski 12, 20 i 24 sata od inicijalne
pojave, potom svaka 2 sata sve do 40. sata od početkatjeranja. U prosječnom nastupu ovulacije
(27,6+-5,4 sata od početka estrusa) nije bilo razlike između spontanih i induciranih estrusa.
Cilj istraživanja bio je odrediti vrijeme nastupa ovulacije u 1088 mliječnih krava u ekstenzivnim
i poluekstenzivnim uvjetima držanja, na području koje veterinarskim djelovanjem pokriva privatna
ambulanta.
MATERIJALI I METODE
Istraživanje je provedeno u razdoblju od 1. prosinca 2004. godine do 1. prosinca 2006. godine.
Na terenu ambulante obitava preko 2000 mliječnih krava i junica. U istraživanju je opservirano
1088 plotkinja, od čega 218 junica i 870 krava, sljedećeg pasminskog sastava: 598 (54,96%) u tipu
domaćeg simentalca, 27,39% crno-šarog holštajna, 9% crvenog holštajna, 2,57% montafonskog
goveda i 6,1% križanih krava i junica, dominantno u tipu crno-šarog frizijca. U svih plotkinja
temeljem anamneze registriran je početak estrusa. Krave su ginekološki i ultrazvučno pregledavane
ujutro i navečer, a prema nalazu umjetno osjemenjavane sve do ginekološke i ultrazvučne detekcije
ovulacije. U istraživanju nisu opservirane krave sa reprodukcijskim poremećajima, samo krave sa
regularnim ciklusom koje su nakon osjemenjavanja koncipirale.
U svih je plotkinja temeljem anamneze registriran početak estrusa. Držaoci prijavljuju plotkinje
koje se tjeraju do 8 sati ujutro, uz opasku da li su znakove tjeranja primijetili navečer ili tek ujutro.
Krave i junice su ginekološki i ultrazvučno pregledavane prvi puta ujutro, a potom ujutro i navečer.
Prema nalazu umjetno su osjemenjavane sve do ginekološke i ultrazvučne detekcije ovulacije. U
istraživanju nisu opservirane krave sa reprodukcijskim poremećajima, samo krave sa regularnim
ciklusom i isključivo one koje su su nakon završenog osjemenjavanja koncipirale.
Podaci o vremenu ovulacije bilježeni su za svaku kravu.
269
REZULTATI
U plotkinja montafonske pasmine najviše ovulacija nastupilo je unutar 24 sata (64,28%), nešto
manje u simentalca (49,17%), a u ostalih crno-šarih (36,24%), križanih 33,33% i crvenog holštajna
(32,65%). Incidencija pojavnosti ovulacija između 24. i 48. sata bila je šarolika, visoka u simentalaca
i (36,46%), nešto niža i ujednačena u crvenog holštajna, montafonca i crno-šarog holštajna (22,45%;
21,43% i 20,13%). Viska incidencija kasnijih ovulacija (48 do 72 sata) bila je crvenog holštajna,
križanaca i crno-šarog holštajna (36,74%; 34,85%; 33,89%).
Unutar 48 sati od početka estrusa ovulralo je 61,32% simentalki, 42,95% frizijaca, 40,13%
holštajna, 71,42% montafonaca i 34,34% križanih.
U razdoblju od 48-72 sata od početka estrusa ovuliralo je 10,70% simentalki, 33,89% frizijaca,
36,73% holštajna, 14,29% montafonca i 34,85% križanih.(komentar-kasna ovulacija u frizijaca i
križanih frizijaca,; utjecaj mliječnosti!!!)
Unutar 24 sata od početka estrusa ovulirale su 122 (55,97%) junice i 352 (40,46%) krava.
Indeks osjemenjavanja po non-return metodi bio je za 598 goveda u tipu domaćeg simentalca
1,202, crno-šarog holštajna (298) 1,517, crvenog holštajna (98) 1,704, montafonca (28) 1,429 i
križance (66) 1,545. Istim načinom indeks za 218 junica bio je 1,353, za 870 krava 1,362, a ukupno
(1088) 1,360.
Tablica 1. Pasminska distribucija nastupa ovulacije od početa estrusa
VRIJEME OD POČETKA ESTRUSA DO OVULACIJE (sati)
PASMINA
(n;%)
Simentalac
(598)
Frizijac (298)
Holštajn (98)
Montafonac
(28)
Križanac (66)
UKUPNO
(1088)
do 12
12 - 24
24 - 48
48 - 72
72 - 96
96 - 120
8 (1,34%)
286 (47,83%) 218 (36,45%)
64 (10,70%)
22 (3,68%)
0 (0%)
13 (4,36%)
7 (7,14%)
95 (31,88%)
25 (25,51%)
60 (20,13%)
22 (22,45%)
101 (33,89%)
36 (36,73%)
27 (9,06%)
7 (7,14%)
2 (0,67%)
1 (1,02%)
2 (7,14%)
16 (57,14%)
6 (21,43%)
4 (14,29%)
0 (0%)
0 (0%)
2 (3,03%)
20 (30,30%)
2 (3,03%)
23 (34,85%)
18 (27,27%)
1 (1,51%)
32 (2,94%)
442 (40,62%) 308 (28,31%) 228 (20,95%)
74 (6,80%)
4 (0,37%)
Tablica 2. Nastup ovulacije od početka estrusa u junica i krava
VRIJEME OD POČETKA ESTRUSA DO OVULACIJE (sati)
do 12
12 - 24
24 - 48
48 - 72
iznad 72
Junice (218)
18 (8,26%)
104 (47,71%)
16 (7,34%)
72 (33,02%)
8 (3,67%)
Krave (870)
UKUPNO
(1088)
14 (1,61%)
338 (38,85%)
292 (33,56%)
156 (17,93%)
70 (8,04%)
32 (2,94%)
442 (40,62%)
308 (28,31%)
228 (20,95%)
78 (7,17%)
270
DISKUSIJA
Jedan od uvjeta za postizanje zadovoljavajuće plodnosti je rasplođivanje u optimalno vrijeme. Loš
postotak koncepcije djelomično je i posljedica osjemenjavanja u krivo vrijeme. Autori pretpostavljaju
da bi vrijeme inseminacije bilo bolje određivati obzirom na ovulaciju, a ne temeljem estrusa, ali na
žalost, u praksi još ne postoje metode kojima bi se vrijeme ovulacije moglo predvidjeti. Stoga su
istraživali korelaciju između karakteristika estrusa i vremena ovulacije (Roelofs i sur. 2006).
Ovulaciju inicira porast LH hormona koji rezultira rupturom folikula i otpuštanjem jajne stanice
(Espey, 1994). Nakon ovulacije je kratak period u kojem jajna stanica može biti fertilizirana (Brackett
i sur.,1980). Trimberger (1948) smatra da je optimalno vrijeme za fertilizaciju između 6 do 12 sati
nakon ovulacije, dok je vrijeme preživljavanja spermija u reprodukcijskom traktu 24 do 30 sati.
Kako je godišnji gubitak mliječne industrije USA, samo zbog grešaka u detekciji estrusa, veći
od 300 milliona dolara, učinkovita detekcija i točno vrijeme inseminacije od najvećeg je značenja za
poboljšanje reprodukcijske efikasnosti stada (Senger, 1994).
Prema Trimberger-u (1948) trajanje estrusa u mliječnih krava kreće se u rasponu od 2.5 do
28 sati, prosječno 18 sati, u krava vizualno opserviranih triput dnevno. Ovulacija se obično javlja
otprilike 28 to 32 sati od početka estrusa (Trimberger 1948; Walker i sur., 1996). Roelofs i sur. (2006)
ustanovili su da je prosječno trajanje estrusa 18 sati (4 do 24 sata), a ovulacija nastupa oko 30 sati
od početka estrusa (10-15 sati po završetku estrusa). Prema tome, pretpostavljeno vrijeme ovulacije
je 29.3±3.9 sati, budući je prosječni nastup estrusa bio 26.4±5.2 sati prije ovulacije. Zaključili su
da inseminacija 24 do 12 sati prije ovulacije rezultira najvećim brojem kvalitetnih embrija 7. dana,
odnosno da je najbolje vrijeme inseminacije 5 do 17 sati od početka estrusa.
Trimberger (1948) smatra da je optimalno vrijeme za inseminaciju u mliječnih krava između 6.
and 24. sata prije ovulacije, a postotak koncepcije drastično pada kod UO nakon ovulacije. Postotak
koncepcije bio je viši u krava inseminiranih unutar 24 sata od početka estrusa nego u prvih 12 sati
nakon početka estrusa (Saacke i sur., 2000). S druge strane, krave inseminirane 12 - 24 sata od
početka estrusa imale su viši postotak degeneriranih embrija u odnosu na osjemenjene do 12. sata od
početka estrusa.
Prema istraživanju Nalbandov i Casida-e, (1942) i Trimberger-a, (1948) mliječne krave ovuliraju
10-15 sati po završetku estrusa ili 27.6 ± 0.6 sati od početka estrusa (Walker et al., 1996). Najbolji
postotak koncepcije bio je kada su inseminirane između 4. i 12.sata nakon početka estrusa (Dransfield
et al., 1998).
Trimberger (1948) je ustanovio da ovulacija u mliječnih junica nastupa 10,5 sati po završetku
estrusa. Mliječne krave mogu ovulirati ranije od početku estrusa nego mesne krave. Tako mliječne
krave ovuliraju 27.6 ± 0.6 sati nakon početka estrusa (Walker i sur.,1996). Yelich i sur., (1999)
ustanovili su da Angus, Brahman, and Senepol krave ovuliraju 30.8 sati od početka estrusa. Skraćen
interval od početka estrusa do ovulacije u mliječnih krava u odnosu na mesne krave uvjetovan je
managementom, hranidbom, laktacijskim stresom i pasminskim specifičnostima.
U posljednjih 50 godina istraživano je optimalno vrijeme za UO u odnosu na stadij estrusa.
Ustanovljeno je da je koncepcija bila viša u krava inseminiranih između 6 i 24 sata prije ovulacije,
pa je preporučan sustav osjemenjavanja “a.m.–p.m” (Trimberger, 1948). To znači da bi krave u
kojih je estrus počeo prijepodne trebale biti osjemenjene u poslijepodnevnim satima, a krave koje
su se počele tjerati poslijepodne, trebalo bi inseminirati sljedećeg prijepodneva. Ipak, istraživanja su
pokazala da se maksimalna koncepcija nije postizala ”a.m.-p.m.” sustavom već osjemenjavanjem
u srednje prijepodne u krava koje su se počele tjerati prethodne noći ili istog jutra (Foote 1979).
271
Također, krave inseminirane jednokratno (između 8 i 11 sati prijepodne) imale su podjednak postotak
koncepcije kao krave osjemenjene sustavom “a.m.-p.m.” (Nebel i sur. 1994). Prema Dransfield-u i
sur. (1998) krave treba osjemeniti ranije nego po sustavu “a.m.-p.m.” jer je postotak koncepcije u
krava osjemenjenih između 4. i 12. sata od početka estrusa, bio viši nego u krava inseminiranih 16
sati od početka estrusa.
Dransfield i sur. (1998) koristeći metodu kontinuirane opservacije estrusa radiotelemetričkim
sustavom (HeatWatch), ustanovili su da je prosječno trajanje estrusa 7 sati. Walker i sur. (1996) su u
holštajnskih krava, 42.-49.dana postpartalno, determinirali su početak spontanih i induciranih estrusa
HeatWatch sustavom, a vrijeme ovulacije detektirali ultrasonografski 12, 20 i 24 sata od inicijalne
pojave, potom svaka 2 sata sve do 40. sata od početka tjeranja. U prosječnom nastupu ovulacije
(27,6+-5,4 sata od početka estrusa) nije bilo razlike između spontanih i induciranih estrusa.
Hurnik i sur.(1975) smatraju da mnogi čimbenici u managementu mliječnih krava utječu na
osobine estrusa u mliječnih krava. Tako Britt i sur. (1986) te Vailes i Britt (1990) tvrde da krave
na mekoj stelji imaju jače izražen i dulji estrus od onih držanih na betonu. Također su potvrdili
nepovoljni utjecaj visoke temperature na estrusne aktivnosti. Sezonost i toplinski stres imaju štetno
djelovanje na reprodukcijsku efikasnost u mliječnih goveda (Gwazdauskas i sur.,1975; Cavestany
i sur., 1985) negativno utječući na razvoj folikula i endokrine funkcije (Wolfenson i sur., 1995;
Wolfenson i sur., 1997; Wilson i sur., 1998). U mesnih pasmina utjecaj sezone na osobine estrusa
nije ustanovljen. Gwazdauskas i sur. (1983) i Gwazdauskas (1985) ustanovili su da su manifestacie
estrusa jače izražene u mliječnih krava, opservirano dvaput dnevno, pri dnevnim temperaturama
nižim od 25C u usporedbi s temperaturama iznad 30C. U našem radu plotkinje su opservirane
dvaput dnevno
Prema Xu-u i sur. (1998), doba dana ne utječe na estrusnu aktivnost, za razliku od De Silva-e
i sur. (1981) koji su ustanovili da mliječne krave imaju najjaču estrusnu aktivnost tijekom jutarnjih
sati, ali na intenzitet estrusa mogu utjecati varijacije u vremenu mužnje i hranjenja, temperatura
okoliša (Pennington i sur., 1985; Britt i sur., 1986). Borges i sur. (2004) istraživali su utjecaj sezone
na folikularnu dinamiku i ovulaciju u domaćih autohtonih goveda. Nakon detektiranog estrusa UZV
su pregledavali krave svakih šest sati do detekcije ovulacije. Nije uočen utjecaj pasmine niti sezone
na dinamiku folikulogeneze, a vrijeme od početka estrusa do ovulacije bio je kraći u krava sa dva
vala folikula. Većinom je estrus detektiran ujutro (57.3%) a 28.0%) kasno poslijepodne. Prosječni
nastup ovulacije od početka estrusa za gir i nelore goveda bilo je 23,1±5,6 sati.
Sezona nije utjecala na vrijeme početka ovulacije (Trimberger, 1948).
Rae i sur. (1999) su ustanovili učinak pasmine na trajanje estrusa u Angus, Brahman, i križanih
krava. Tako je prvi postpartalni estrus u primipara Angus x Hereford (Ciccioli i sur., 2001) i odraslih
mesnih krava (Lents i sur., 2000) bio je kraći 4 do 6 sati.
Visoka incidencija ranih ovulacija (do 48 sati, 85,71%) govori o dobrom reprodukcijskom zdravlju
montafonaca, tim više što su zastupljene bile samo krave. To je objašnjivo budući su montafonci u
ovom podneblju krave niske proizvodnje. Dok je u simentalaca i montafonaca postotak krava sa
nastupom ovulacije unutar 72 sata identičan, oko 85%, u holštajna crnog i crvenog on je gotovo
podjednak i oko 50% niži nego u simentalca (56,37% i 55,10%), a isto toliko viši nego u križanih
goveda (36,36%). Iz istraživanja se može zaključiti kako duljina estrusa podudara sa činjenicom da
su holštajnske krave više opterećene subfertilnošću. Podatak da je trajanje estrusa do ovulacije dulje
navodi na zaključak da je riječ o kravama koje su fenotipski i genotipski dominantno holštajni, ali i
upozorava na štetnost nerezonskog križanja.
272
LITERATURA
Borges, A.M. C.A.A. Torres, V.R. Rocha Júnior, J.R.M. Ruas, M.M. Gioso, J.F. Fonseca, G.R. Carvalho, V.V.
Maffili (2004): Dinâmica folicular e momento da ovulação em vacas não lactantes das raças Gir e Nelore
durante duas estações do ano. Arq. Bras. Med. Vet. Zootec. 56 (3).
Brackett, B.G., Y.K. Oh, J.F. Evans, W.J. Donawick (1980): Fertilization and early development of cow ova.
Biol. Reprod. 23:189.
Britt, J. H., R. G. Scott, J. D. Armstrong, M. D. Whitacre (1986): Determinants of estrous behavior in lactating
Holstein cows. J. Dairy Sci. 69:2195–2202.
Cavestany, D., A. B. El-Wishy, R. H. Foote (1985): Effect of season and high environmental temperature on
fertility of Holstein cattle. J. Dairy Sci. 68:1471–1478.
Ciccioli, N. H., R. P. Wettemann, L. J. Spicer, D. H. Keisler, C. A. Lents, F. J. White (2001): Postpartum
nutrition influences concentrations of leptin, IGF-I, and pregnancy rate of primiparous beef cows. J. Anim.
Sci. 79(Suppl. 1):34 (Abstr.).
De Silva, A. W. M. V., G. W. Anderson, F. C. Gwazdauskas, M. L. McGilliard, J. A. Lineweaver (1981):
Interrelationships with estrous behavior and conception in dairy cattle. J. Dairy Sci. 64:2409–2418
Dransfield, M.B.G., R.L. Nebel, R.E. Pearson, L.D. Warnick (1998): Timing of insemination for dairy cows
identified in estrus by a radiotelemetric estrus detection system. J. Dairy Sci. 81:1874.
Espey, L.L. (1994): Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory
reaction. Biol. Reprod. 50:233.
Foote, R.H. (1979): Time of artificial insemination and fertility in dairy cattle. J. Dairy Sci. 62:355.
Gwazdauskas, F. C., C. J. Wilcox, W. W. Thatcher (1975): Environmental and management factors affecting
conception rate in a subtropical climate. J. Dairy Sci. 58:88–92.
Gwazdauskas, F.C., J.A. Lineweaver, M.L. McGilliard (1983): Environmental and management factors affecting
estrous activity in dairy cattle. J. Dairy Sci. 66:1510.
Gwazdauskas, F.C. (1985): Effects of climate on reproduction in cattle. J. Dairy Sci. 68:1568.
Hurnik, J.F., G.J. King, H.A. Robertson (1975): Estrous and related behavior in postpartum Holstein cows. Appl.
Ethol. 2:55.
Lents, C. A., F. J. White, D. L. Lalman, R. P. Wettemann (2000): Effects of body condition of beef cows at
calving and protein supplementation on estrous behavior and follicle size. Available:http://www.ansi.
okstate.edu/research/2000rr/30htm.
Nalbandov, A., L.E. Casida (1942): Ovulation and its relation to estrus in cows. J. Anim.Sci. 1:189–198.
Nebel, R.L., W.L. Walker, M.L. McGilliard, C.H. Allen, G.S. Heckman (1994): Timing of artificial insemination
of dairy cows: fixed time once daily versus morning and afternoon. J. Dairy Sci. 77:3185.
Pennington, J. A., J. L. Albright, M. A. Diekman (1985): Sexual activity of Holstein cows: Seasonal effects. J.
Dairy Sci. 68:3023–3030.
Rae, D.O., P.J.Chenoweth, M.A. Giangreco, P.W. Dixon, F.L. Bennett (1999): Assessment of estrus detection by
visual observation and electronic detection methods and characterization of factors associated with estrus
and pregnancy in beef heifers. Theriogenology 51:1121–1132.
Roelofs, J.B. N.M. Soede, B. Kemp (2006): Insemination strategy based on ovulation prediction in dairy cattle.
Vlaams Diergeneeskundig Tijdschrift 75, 2.
Saacke, R. G., J. C. Dalton, S. Nadir, R. L. Nebel, J. H. Bame (2000): Relationship of seminal traits and
insemination time to fertilization rate and embryo quality. Anim. Reprod. Sci.60–61:663–677.
Senger, P.L. (1994): The estrus detection problem: new concepts, technologies, and possibilities. J. Dairy Sci.
77:2745.
273
Trimberger, G.W. (1948): Breeding efficiency in dairy cattle from artificial insemination at various intervals
before and after ovulation. Univ. Nebraska Ag. Exp. Sta. Res. Bull. 153:3.
Vailes, L.D., J.H. Britt (1990): Influence of footing surface on mounting and other sexual behaviors of estrual
Holstein cows. J. Anim. Sci. 68:2333.
Walker, W.L., R.L. Nebel, M.L. McGilliard (1996): Time of ovulation relative to mounting activity in dairy
cattle. J. Dairy Sci. 79 (9):1555-1561.
Wilson, S. J., C. J. Kirby, A. T. Koenigsfeld, D. H. Keisler, M. C. Lucy (1998): Effects of controlled heat stress
on ovarian function of dairy cattle. 2. Heifers. J. Dairy Sci. 81:2132–2138.
Wolfenson, D., W. W. Thatcher, L. Badinga, J. D. Savio, R. Meidan, B. J. Lew, R. Braw-Tal, A. Berman
(1995): Effect of heat stress on follicular development during the estrous cycle in lactatingdairycattle.Biol.
Reprod.52:1106–1113.
Wolfenson, D., B. J. Lew, W. W. Thatcher, Y. Graber, R. Meidan (1997): Seasonal and acute heat stress effects
on steroid production by dominant follicles in cows. Anim. Reprod. Sci. 47:9–19.
Xu, Z. Z., D. J. McKnight, R. Vishwanath, C. J. Pitt, L. J. Burton (1998): Estrus detection using radiotelemetry
or visual observation and tail painting for dairy cows on pasture. J. Dairy Sci. 81:2890–2896.
Yelich, J. V., C. L. Barnett, J. K. Fullenwider, J. R. Kempfer, J. W. Lemaster, C. C. Chase, Jr. (1999): Effect of
season on behavioral estrus, ovulation, and estrous cycle length in Angus, Brahman and Senepol cows in a
subtropical environment. J. Anim. Sci. 77(Suppl. 1):230 (Abstr.).
274
Influence of breed, parity and lactation on PAG and
progesterone profiles in pregnant saanen and boer
goats
Utjecaj pasmine, pariteta i laktacije na koncentraciju
PAG i progesterona tijekom gravidnosti sanskih i
burskih koza
Prvanović, N., D. Đuričić, S. Vince, J. Sulon, J. F: Beckers, N. Filipović, M. Cergolj, J.
Grizelj, M. Samardžija, T. Dobranić, M. Lipar
Klinika za porodništvo i reprodukciju, Veterinarskog fakulteta Sveučilišta u Zagrebu
Klinika za kirurgiju, ortopediju i oftalmologiju, Veterinarskog fakulteta Sveučilišta u Zagrebu
Zavod za fiziologiju i radiobiologiju, Veterinarskog fakulteta Sveučilišta u Zagrebu
Laboratorij za fiziologiju reprodukcije, Veterinarski fakultet, Sveučilište u Liege-u
Veterinarska stanica Đurđevac
Abstract
The aim of the study was to investigate role of breed, parity and lactation on PAG and progesterone profiles
in pregnant saanen and boer goats. All saanen goats were in lactation and milked twice daily till the last trimester
of pregnancy. All boer goats were separated from previous kidds and had no milk production. We had two herds
of goats, boer goats (n=25) and saanen goats (n=22). We subdivided herds in 2 subgroups each: pluriparous
pregnant (boer goats n=17, saanen goats n=14) and primiparous pregnant goats (boer goats n=8, saanen goats
n=8). We monitored natural mating of all goats during november 2006. We monitored pregnancy 35 days after
mating and monthly later to follow fetal development and detect embrionic mortality using ultrasound probe.
The fetuses were identified, counted by ultrasound and later the numbers were compared with the kidding rate.
Only goats who kidded at the end of the study were taken in final consideration and used in study. Blood samples
(10 ml) were collected from the jugular vein in heparinized vacutainer tubes at weeks 0, 1, 2, 3, 4, 6, 8, 10, 12,
14, 16, 18, and 20 after mating and on the day of parturition. Plasma was removed by centrifugation (at 1500
g for 15 min) immediately after collection and stored at -20°C until assayed for PAG and progesterone. Level
of progesterone and PAG in sera samples was determined using standard RIA method. PAG was determined
by method described by Zoli and modified by Beckers. Progesterone was determined using standard procedure
with conjugated steroids (Coat-A-Count TKPG, Diagnostic Product Corporation) without preincubation. The
125
I in the pellet was quantified using gamma counter (LKB Wallac 1261 Multigamma counter, LKB, Turku,
Finland) with a counting efficiency of 75%. All samples were analysed in duplicate with middle value like
result and all suspect results were repeated. Program Statistica and ANOVA to perform variance analysis and
linear correlations were used. PAG and progesterone level were compared between primiparous and pluriparous
groups according to breed, parity and lactation differences. Progesterone and PAG level curve was significantly
higher in pregnant pluriparous goats of both breeds comparing to summarized results for both primiparous
group (p<0,05). Number of kidds didn’t differ between all four groups (2,4 and 2,6 for saanen groups versus 2,6
and 2,8 kidds for boer groups) and couldn’t influence progesterone nor PAG level. Primiparous goats of both
breeds had statistically significant higher individual variations (maximum and minimum) for both parameters
(progesterone and PAG) during pregnancy (p<0,05). We compared levels of progesterone and PAG from
lactating saanen goats with pluriparous nonlactating boer goats in the same stage of pregnancy and didn’t find
275
any significant difference. We concluded that parity influences both level of progesterone and PAG in pregnant
goats of both breeds but lactation and breed had no significance.
Key words: goat, pregnancy, parity, lactation, progesterone, PAG
Sažetak
Svrha istraživanja je ustanoviti utjecaj pasmine, pariteta i laktacije na razine PAG i progesterona
u gravidnih burskih i sanskih koza. Sve sanske koze su bile u laktaciji i muzene su dvaput dnevno
sve do posljednje trećine gravidnosti. Burske koze su bile odvojene od jarića i nisu bile u laktaciji. U
istraživanju su promatrana dva stada: bursko (n=25) i sansko (n=22) koji su dodatno podijeljeni na
dvije podskupine_pluriparnu (burske n=17, sanske n=14) i primiparnu skupinu (burske n=8, sanske
n=8). Sve koze su pripuštene tijekom studenog 2006.Ptom je 35 dana nakon parenja sprovedena
ultrazvučna dijagnostika gravidnosti. Za pregled je korišten ultrazvučni aparat Sonovet 2000 a
koze su pregledavane transabdominalno i transrektalno (kod svih dubioznih slučajeva) sa sondom
frekvencije 7,5 Mhz. Koze su prije pregleda fiksirane a sonda se nakon obilatog premazivanja gelom postavljala
na bazu vimena. Koze su pregledavane s obe strane vimena. Nakon pozitivne dijagnostike gravidnosti koze su
pregledavane jednom mjesečno u svrhu praćenja razvoja plodova i dijagnostike embrionalne/fetalne smrtnosti.
Plodovi su pobrojani za svaku kozu i kasnije uspoređeni s brojem ojarenih jarića. U konačno razmatranje uzete
su samo koze koje su se doista i ojarile. Paralelno s ultrazvučnim praćenjem sprovedeno je i uzorkovanje krvi.
Krv je uzimana iz v. jugularis u heparinizirane vacutainer epruvete od 10 ml. i to 0, 1, 2, 3, 4, 6, 8, 10, 12, 14, 16,
18, i 20. tjedna po parenju te prilikom poroda. Plazma je odvojena centrifugiranjem na 1500 g kroz 15 minuta
neposredno po uzorkovanju a potom je spremljena na -20°C do pretrage. Razina progesterona i PAG je određena
pomoću standardne RIA pretrage. PAG je određivan po metodi koju je opisao Zoli, modificiranu po Beckersu.
Progesteron je određen pomoću standardne RIA procedure sa konjugiranim steroidima (Coat-A-Count TKPG,
Diagnostic Product Corporation) bez predinkubacije. Pri tome je radioaktivni 125I kvantificiran primjenom
gamma countera (LKB Wallac 1261 Multigamma counter, LKB, Turku, Finland) čija osjetljivost iznosi 75%.
Svi su uzorci analizirani u duplikatu pri čemu je srednja vrijednost predstavljala konačan rezultat a svi sumnjivi
rezultati su ponovljeni. Svi rezultati su statistički obrađeni u programu Statistica pri čemu je sprovedena analiza
varijance i linearne korelacije. Razine PAG i progesterona su uspoređene između primiparih i pluriparih koza s
obzirom na dob, pasminu i laktaciju. Razina progesterona i PAG bila je značajno viša u gravidnih pluriparih koza
obje pasmine u usporedbi s zajedničkim rezultatima za primipare koze (p<0,05). Broj jarića nije se značajno
razlikovao između skupina iako su burske u pravilu imale više jarića ( 2,4 i 2,6 za sanske naprama 2,6 i 2,8 za
burske koze) te stoga nije mogao utjecati na razine PAG i progesterona. Primipare koze obaju skupina imale
su statistički značajne individualne varijacije (maksimum i minimum) za oba parametra(p<0,05) . Usporedili
smo razine za oba parametra s obzirom na laktaciju ( pluripare burske i sanske) ali nije bilo značajnije razlike.
S obzirom na činjenicu da su koze u našem istraživanju imale ne samo veći broj jarića od koza u radovima
nekih ranijih autora nego i konzekutivno više koncentracije progesterona i PAG definitivno smo potvrdili kako
placenta visokogravidnih koza igra značajnu ulogu u hormonalnom očuvanju gravidnosti. Također, zaključili
smo kako paritet utječe na razinu progesterona i PAG u gravidnih koza obje pasmine ali laktacija i pasmina pri
tome ne igraju nikakvu značajniju ulogu..
Ključne riječi: graviditet, koza, paritet,laktacija progesteron, PAG
Uvod
Poznato je da paritet utječe na različite parametre vezane na gravidnost u domaćih životinja.
Naime kako su opisali još Ashdell i sur. (1964.) dob i paritet koze utječu na tijek i duljinu gravidnosti
budući da je graviditet najkraći a broj oplođenih koza najmanji u prvoj rasplodnoj sezoni u životu koze
i postepeno raste do maksimuma u dobi od 6 godina ( Ashdell, 1964). Nadalje Prvanović i sur. (2007.)
su opisali kako paritet izravno djeluje na postotak gravidnosti i razinu cirkulirajućeg progesterona
276
u gravidnih burskih koza, dok kod negravidnih koza ranija gravidnost nema posljedično nikakav
utjecaj na kasnije lučenje progesterona. U svakom slučaju poznato je da je visoka koncentracija
cirkulirajućeg progesterona neophodna za uspostavu i održavanje graviditeta kod koza. Pri tome je
žuto tijelo na jajniku gravidne koze za razliku od ovce, po svemu sudeći ovisno o hipofizi. Naime,
neka ranija istraživanja su pokazala da uklanjanje hipofize u bilo kojem stadiju graviditeta kod koza
rezultira pobačajem ( Cowie et al, 1963). dok u gravidne ovce, posebice u zadnjem tromjesečju
gravidnosti hipofizektomija ne rezultira pobačajem, već se gravinost normalno nastavlja do poroda.
Pri tome je važno napomenuti da je u ovaca placenta vrlo važan izvor progesterona u kasnoj
gravidnosti pa tako broj plodova ( a time i placenti) pozitivno djeluje na rast progesterona u serumu
gravidne ovce. Iako je placenta koze i ovce jako slična u mnogim morfološkim i strukturalnim
detaljima, nema dokaza za postojanje proizvodnje progesterona u placenti koze (Thorburn and
Schneider, 1972). Čak i ako dođe do stvaranja progesterona, to je premalo za održavanje graviditeta
u odsutnosti žutog tijela. Currie (1977) je smatrala, ali tad nije dokazano, da placentalni laktogen kod
koza sudjeluje u regulaciji sekrecije progesterona iz žutog tijela. Istraživanja Maleckog i sur. ( 1987)
iz Australije pokazuju da kozi nije potreban materinji hipofizni LH kako bi održala graviditet između
50.-og i 130.-og dana gravidnosti. Isti autori su zaključili da funkcija žutog tijela može biti održana
luteotropinima ili antiluteoliticima proizvedenih u maternici. Nadalje, Sousa i sur (1999) opisuju
kako je krivulja PAG (glikoproteini gravidnosti s antiluteolitičkim djelovanjem) značajno viša kod
gravidnih koza nego u gravidnih ovaca. Također su naglasili mogućnost da žuto tijelo koze može biti
sposobno proizvoditi progesteron nezavisno o luteotropinima kao što je ranije utvrdio i Rotschild
(1981). Razina progesterona u plazmi, kojeg gotovo u cijelosti proizvodi žuto tijelo gravidne koze,
ostaje visoka do otprilike 4 dana prije poroda ( Gordon, 1997). Isti autor navodi da je 19 do 22
dana nakon parenja, koncentracija progesterona u plazmi gravidne koze uobičajeno je veća od 1.4
ng/ml. Koze koje nisu gravidne vratit će se u estrus u tom razdoblju i mogu se očekivati minimalne
koncentracije progesterona, sigurno manje od 1 ng/ml. Koncentracija progesterona u mlijeku koza
prate koncentraciju progesterona u plazmi, zbog činjenice da je progesteron hormon topiv u mastima
pa su njegove koncentracije više u mlijeku. Progesteronski testovi se mogu upotrebljavati na različite
načine kod dijagnosticiranja graviditeta koza. Kada je nepoznat datum parenja, može se uzimati
nekoliko uzoraka zaredom. Restall i sur. (1990) izvještavao je o dijagnozi gravidnosti tajlandskih
domaćih koza, što su pokušali mjereći koncentraciju progesterona u plazmi s 4 sedmodnevna intervala
nakon parenja; 96,2% koza sa sve 4 koncentracije progesterona >2 ng/ml su bile gravidne. Na Kubi,
Carmenate i sur. (1992) pratili su koncentraciju progesterona u krvi 8 i 21 dan nakon osjemenjivanja
koza; 21.-og dana gravidnost je točno dijagnosticirana u 77.4% koza i negravidnih 95.7%.
Materijal i metode
Sve sanske koze su bile u laktaciji i muzene su dvaput dnevno sve do posljednje trećine gravidnosti.
Burske koze su bile odvojene od jarića i nisu bile u laktaciji. U istraživanju su promatrana dva stada:
bursko (n=25) i sansko (n=22) koji su dodatno podijeljeni na dvije podskupine_pluriparnu (burske
n=17, sanske n=14) i primiparnu skupinu (burske n=8, sanske n=8). Sve koze su pripuštene tijekom
studenog 2006.Potom je 35 dana nakon parenja sprovedena ultrazvučna dijagnostika gravidnosti.
Za pregled je korišten ultrazvučni aparat Sonovet 2000 a koze su pregledavane transabdominalno i
transrektalno (kod svih dubioznih slučajeva) sa sondom frekvencije 7,5 Mhz. Koze su prije pregleda
fiksirane a sonda se nakon obilatog premazivanja gelom postavljala na bazu vimena. Koze su
pregledavane s obe strane vimena. Nakon pozitivne dijagnostike gravidnosti koze su pregledavane
jednom mjesečno u svrhu praćenja razvoja plodova i dijagnostike embrionalne/fetalne smrtnosti.
Plodovi su pobrojani za svaku kozu i kasnije uspoređeni s brojem ojarenih jarića. U konačno razmatranje
277
uzete su samo koze koje su se doista i ojarile. Paralelno s ultrazvučnim praćenjem sprovedeno je i
uzorkovanje krvi. Krv je uzimana iz v. jugularis u heparinizirane vacutainer epruveteod 10 ml. i to
0, 1, 2, 3, 4, 6, 8, 10, 12, 14, 16, 18, i 20. tjedna po parenju te prilikom poroda. Plazma je odvojena
centrifugiranjem na 1500 g kroz 15 minuta neposredno po uzorkovanju a potom je spremljena na
-20°C do pretrage. Razina progesterona i PAG je određena pomoću standardne RIA pretrage. PAG je
određivan po metodi koju je opisao Zoli, modificiranu po Beckersu. Progesteron je određen pomoću
standardne RIA procedure sa konjugiranim steroidima (Coat-A-Count TKPG, Diagnostic Product
Corporation) bez predinkubacije. Pri tome je radioaktivni 125I kvantificiran primjenom gamma
countera (LKB Wallac 1261 Multigamma counter, LKB, Turku, Finland) čija osjetljivost iznosi 75%.
Svi su uzorci analizirani u duplikatu pri čemu je srednja vrijednost predstavljala konačan rezultat a
svi sumnjivi rezultati su ponovljeni. Svi rezultati su statistički obrađeni u programu Statistica pri
čemu je sprovedena analiza varijance i linearne korelacije. Razine PAG i progesterona su uspoređene
između primiparih i pluriparih koza s obzirom na dob, pasminu i laktaciju.
Rezultati
Razina PAG (pregnancy associated glycoproteins) bila je značajno viša u gravidnih pluriparih
koza obje pasmine u usporedbi s zajedničkim rezultatima za primipare koze (p<0,05). Pri tome se ne
može reći da su pluripare koze imale više razine PAG, već su samo imale veće individualne varijacije
koje su dovele do navedene razlike. Krivulje PAG za sve 4 podskupine prikazane su u grafikonu
1. Progesteron je bio ukupno nešto viši kod gravidnih pluriparih koza obaju pasmina, neovisno o
laktaciji. Prosječna razina progesterona u primiparih koza iznosila je 15 ng/ml ( minimalna 9,6
a maksimalna 15,2 ng/ml) za obje pasmine Te su se vrijednosti donekle razlikovale za primipare
koze koje su u prosjeku imale 13,4 ng/ml progesterona u krvi, ali su minimalna i maksimalna
vrijednost bile u većem rasponu (6,5 prema 18,2 ng/ml). Iako je jedno od mogućih tumačenja za tu
pojavu mogao biti povećani broj jarića za pluripare koze, nije bilo tako. Broj jarića nije se značajno
razlikovao između skupina iako su burske u pravilu imale više jarića ( 2,4 i 2,6 za sanske naprama
2,6 i 2,8 za burske koze) te stoga nije mogao utjecati na razine PAG i progesterona. Primipare koze
obaju skupina imale su statistički značajne individualne varijacije (maksimum i minimum) za oba
parametra(p<0,05) . Usporedili smo razine za oba parametra s obzirom na laktaciju ( pluripare burske
i sanske) ali nije bilo značajnije razlike.
G ra fiko n 1: K re ta n je ra z in e P A G tije ko m g ra vid n o sti u sve 4 p o d sku p in e
ko z a
PAG ng/ml
600
p lu r ip ar e s an s k e
400
p lu r ip ar e b u r s k e
200
p r im ip ar e b u r s k e
p r im ip ar e s an s k e
0
tje d n i g r avid n o s ti o d k o n ce p cije d o p o r o d a
278
Prog. ng/ml
G ra fiko n 2: K re ta n je ra z in e p ro g e ste ro n a p o p o d sku p in a m a
20
p lu r ip ar e s an s k e
10
p lu r ip ar e b u r s k e
0
p r im ip ar e b u r s k e
tje d n i o d k o n ce p cije d o p o r o d a
p r im ip ar e s an s k e
Rasprava
Sudeći prema podacima koje je objavio Ashdell (1964), nema sumnje da paritet i dob utječu
na stopu gravidnosti domaćih pasmina koza. Štoviše, isti autor opisuje rast stope gravidnosti do
6. godine života kada dostiže maksimum. U našem istraživanju stopa gravidnosti je bila statistički
značajno veća u pluriparih nego u primiparih koza, no valja napomenuti kako nijedna koza u
našem istraživanju nije bila starija od 6 godina. Unatoč tome, broj jaradi se nije značajno razlikovao
između primipare i pluripare skupine ( 2,4 prema 2,6 jaradi po leglu). Mi smo u našem istraživanju
također proučavali i utjecaj pariteta na razinu progesterona u gravidnih sanskih i burskih koza. Kako
bismo isključili utjecaj individualnih varijacija i lažno pozitivnih rezultata pribjegli smo tjednom
uzimanju krvi tokom čitave gravidnosti nakon čega smo usporedili rezultate između skupina ( u
svim kombinacijama primiparih i pluriparih za obje pasmine). Kako bismo bili sigurni u točnost
rezultata, za sve smo uzorke radili dvostruko testiranje s uzimanjem srednje vrijednosti kao približno
najtočnije a uzorkovali smo krv čak 10 puta tijekom gravidnosti. Upotrijebili smo RIA metodu koja
je vrlo pouzdana i precizna a točnost mjerenja joj za kvantitativne metode prelazi 75%. Sve smo koze
također i ultrazvučno pratili što je dalo 100% pouzdane rezultate što su potvrdili i podaci o jarenjima.
Prosječna razina progesterona u primiparih koza iznosila je 15 ng/ml ( minimalna 9,6 a maksimalna
15,2 ng/ml) za obje pasmine Te su se vrijednosti donekle razlikovale za primipare koze koje su u
prosjeku imale 13,4 ng/ml progesterona u krvi, ali su minimalna i maksimalna vrijednost bile u
većem rasponu (6,5 prema 18,2 ng/ml). Pri tome pasmina i laktacija nisu igrale nikakvu ulogu između
skupina. Naši se rezultati uvelike razlikuju od onih koje je objavio Bon Durant (1981) koji je dobio
bitno niže vrijednosti za gravidne koze. Tu razliku u rezultatima možemo objasniti brojem jaradi.
Naime, u njegovom istraživanju su koze jarile u prosjeku 1,5 jaradi, dok su naše jarile prosječno 2,6
jaradi po leglu (2,4 do 2,8), što se sigurno odrazilo i na koncentraciju progesterona u krvi. Slično
je i sa rezultatima koje je objavila Sousa (1999) na brazilskim kozama. Ona je dobila signifikantno
niže vrijednosti za PAG i progesteron, no njezine su koze u pravilu jarile 1,6 jaradi po kozi. Mi
nismo pronašli pozitivnu korelaciju između broja jaradi i koncentracije progesterona iz jednostavnog
razloga što je većina koza u svim grupama ojarila isti broj jaradi. Iz svega navedenog zaključili smo
kako paritet utječe na razinu progesterona i PAG a posebice uzrokuje veće individualne varijacije u
gravidnih koza obje pasmine ali laktacija i pasmina pri tome ne igraju nikakvu značajniju ulogu..
Literatura:
Asdell, S.A: (1964): Patterns of Mammalian Reproduction. Cornell University Press, Ithaca, pp623-630
Carmenate C, Pedroso, R., Gonzalez, N., Arencibia J. and Alvarez T. (1992): Pregnancy diagnosis in goats on
the basis of blood progesterone concentration, using radioimmunoassay. Revista Cubana dr Reproducion
Animal 17-18 (1-2), 93-100
Cowie A. T., DAniel, P. M., Pritchard, m., M., L. and Tindal J. S. (1963): Hypophysectomy in pregnant goats and
section of the pituitary stalk in pregnant goats and sheep. Journal of Endocrinology 28, 93-98
279
Currie W.B. and Thorburn, G.D. (1977) The fetal role in timing the initiation of parturition in the goat. In:
Wolstenholme, G.E:W. and Knight, J. (eds) The Fetus and Birth Ciba Foundation Symposium No. 47,
Associated Scientific Publishers, Amsterdam
Gordon I. (1997): Controlled Reproduction in Sheep and Goats, CAB International
Malecki J., Jenkin G:, and Thornburn G.D. (1987):Passive immunization of pregnant goats against ovine LH,
Journal of Endocrinology, 114, , 413-436
Prvanović N., D. Duricic,A. Tomaskovic, J. Grizelj, S. Vince, JF Beckers, J. Sulon, M. Cergolj, T. Dobranic, M.
Samardžija (2007):Influence of parity on pregnancy rate and progesterone level in boer goats, Rev. Rom.
Med.. Vet. 3/2007, 197-203
Restall B.J., Milton J.T:B, Klong Jutti, P., Kochapakdee, S. (1990): Pregnancy diagnosis in Thai native goats,
Theriogenology, 34, 313-317
Rotschild, I (1981):The regulation of the mammalian corpus luteum. Recent Progress in Hormone Research,
37, 183-298
Sousa N.M.; Garbayo J.M.; Figueiredo J.R.; Sulon J.; Goncalves P.B.D.; Beckers J.F. (1999) Pregnancyassociated glycoprotein and progesterone profiles during pregnancy and postpartum in native goats from the
north-east of Brazil Small Ruminant Research, Volume 32, Number 2, 12 April 1999 , pp. 137-147(11)
Thorburn G.D. and Schneider W 81972) The progesterone concentration in the plasma of the goat during the
oestrus cycle and pregnancy, Journal of Endocrinology 52, 23-28
280
An outbreak of Mycoplasma bovis mastitis on a diary
cows farm in Croatia
Epizootija mastitisa uzrokovanog bakterijom
Mycoplasma bovis u mliječnih krava u Hrvatskoj
B. Šeol1*, T. Naglić1, H. Ball2, D. Finlay2, K. Matanović1, M. Martinec3
Department of Microbiology and Infectious Diseases, Veterinary Faculty University of Zagreb, Heinzelova
55, 10000 Zagreb, Croatia
1
Veterinary Research Laboratories, Stoney Road, Stormont, Belfast, BT4 3SD
2
3
Veterinarska stanica Remetinec, 10257 Hrvatski Leskovac, Brezovička 105, Croatia
Corresponding author
1*
Summary
This paper presents our observations during the second outbreak of bovine mastitis in Croatia. On a farm
with approximately 700 dairy cows in different stages of lactation a significant increase in severe clinical
mastitis cases resistant to antibiotic therapy was observed. The animals were of Friesian Holstein breed and
some had been purchased from Western Europe. The acute form of mastitis was characterised by a rapid
decrease in milk production, and a rapid spread of infection from affected to adjacent quarters. The animals were
unsuccessfully treated with different antibiotics for several months. Combinations of tetracycline, neomycin
and bacitracin; penicillin G, dihydrostreptomycin, novobiocin and neomycin; clavulanic acid-amoxicillin,
cephalosporines; and lincomycin were used. To investigate a possible role of mycoplasma as a causative agent of
a large number of mastitis cases, 421 udder secretions were microbiologically examined. Mycoplasma colonies
of typical appearance were cultured from 77 milk samples. Mycoplasmas were identified directly from milk
samples by antigen capture ELISA test and polymerase chain reaction for routine identification of M. bovis.
All isolated mycoplasmas were identified as Mycoplasma bovis. Mastitic bovine milk originated from a large
number of farms in Croatia has been routinely cultured for mycoplasma on appropriate media at Department of
Microbiology and Infectious diseases for the last 30 years. On this basis, it is likely that mycoplasma mastitis
in Croatia was brought into the country with the imported animals. As bovine mycoplasma mastitis might be
a major udder health problem in dairy cattle there is an urgent necessity of coordinated action of veterinary
diagnostic laboratories and veterinary authorities in identifying the distribution and control of this infection in
Croatia.
Sažetak
U radu je prikazana epizootija mikoplazmalnog mastitisa u mliječnih krava u Hrvatskoj. Na farmi sa 700
mliječnih krava u različitim stadijima laktacije zablježen je značajan porast broja kliničkih mastitisa koji nisu
reagirali na liječenje antibioticima. Krave su bile holštajnsko frizijske pasmine, a podrijetlom iz zapadne Europe.
U akutnom obliku mastitis se očitovao naglim padom mliječnosti i brzim širenjem infekcije sa oboljelih na zdrave
četvrti vimena. Životinje su liječene antibioticima nekoliko mjeseci bez uspjeha. Korištene su kombinacije
tetraciklina, neomicina i bacitracina; penicilina G, dihidrostreptomicina, novobiocina i neomicina; amoksicilina
s klavulanskom kiselinom, cefalosporina; i linkomicin. 421 uzorak mlijeka je mikrobiološki pretražen kako bi se
ispitala moguća uloga mikoplazmi kao uzročnika mastitisa. Mikoplazme su izdvojene na hranjivoj podlozi iz 77
pretraženih uzoraka mlijeka. Mikoplazme su također identificirane izravno iz uzoraka mlijeka imunoenzimnim
pokusom. Sve izdvojene mikoplazme identificirane su kao Mycoplasma bovis. Mlijeko krava s mastitisom
podrijetlom s velikog broja farmi u Hrvatskoj na odgovarajućem je mediju rutinski pretraživano na prisutnost
mikoplazmi tijekom zadnjih 30 godina na Zavodu za mikrobiologiju i zarazne bolesti s klinikom, no mikoplazme
nisu izdvojene. Na temelju tih rezultata može se zaključiti da je mikoplazmatski mastitis unesen u Hrvatsku
uvezenim kravama. Smatra se da je mikoplazmatski mastitis veliki problem u uzgojima mliječnih krava te je
281
nužno brzo i koordinirano djelovanje veterinarskih dijagnostičkih laboratorija i veterinarskih tijela kako bi se
utvrdila proširenost i omogućila kontrola ove bolesti u Hrvatskoj.
Introduction
Since the first isolation from mastitic milk in USA (Hale and others 1962, Jasper 1977)
Mycoplasma bovis and M. californicum (Mackie and others, 1982) have been recorded increasingly
frequently as causative agents of bovine mastitis worldwide. M. bovis is considered one of the most
pathogenic bovine udder mycoplasmas (Pfützner and Sachse 1996) in Europe and North America
resulting in significant economic losses in countries with intensive milk and meat production (Ter
Laak and others 1992). This kind of mastitis is highly contagious, affecting more than 20% up to 70%
of cows independently of the stage of lactation (Pfützner and Sachse 1996, Kirk and Mellenberger
2001, Nicholas and Ayling 2003). A rapid decline in milk production with visible changes in milk
consistency and increased incidence of cases resistant to standard therapy are characteristic clinical
symptoms of acute M. bovis udder infection (Kirk and Mellenberger 2001). Subclinical and chronic
infection may go undetected if not evidenced by mycoplasma examination of suitable sensitivity
(Bulletine 1987). Although predominantly associated with mastitis in cows (Pfützner and Sachse
1996), M. bovis can cause systemic infection with polyarthritis, synovitis and pneumonia in feedlot
calves (Langford 1977, Gagea and others 2006, Gevaert 2006), conjunctivitis (Alberti and others
2006), otitis, meningitis and a variety of genital disorders such as abortion and low fertility in cows
and bulls (Howard and others 1987, Bocklisch and others 1986, Kinde and others 1993, Stipkovits
and others 1993, Kirk and Lauermann 1994, Kirby and others 1996, Waltz and others 1997). This
paper presents our observations during the outbreak of bovine M. bovis mastitis in Croatia.
To investigate a possible role of mycoplasma as a causative agent of a large number of mastitis
cases in cows on a several farms in Croatia, 421 udder secretion samples were microbiologically
examined for mycoplasma presence. For that purpose, 3 ml of PPLO broth media with horse serum
and glucose (Hayflick 1965) were inoculated with 0.1 ml of udder secretions, and three further 10fold dilutions in PPLO broth prepared from these. The PPLO-broths were incubated at 37 0C and
plated on solid PPLO media after 4 d and again at 7 d if the first plating was negative. The plates were
incubated for 4 to 10 d at 37 0C in a candle jar. At the same time, the same milk samples collected
from mastitis herd were used for antigen capture (sandwich) ELISA. The sandwich ELISA was
carried out in microtitre plates described by Ball and others (1994). Microtitre plates were coated
with polyclonal antibodies against M. bovis. In each well 200 µl of PPLO broth media with horse
serum and glucose (Hayflick 1965) was used. Duplicate samples of milk were diluted 10-1 do 10-3
in mycoplasma medium. In a combined capture and enrichment stage, the plates were incubated for
three days. The stages to demonstrate capture consisted of one hour incubation with biotinylated
purified M. bovis monoclonal antibodies, one hour incubation with streptavidin-peroxidase (Sigma),
and finally 10 to 20 minutes incubation with substrate 3,3’, 5,5’ tetramethylbenzidine (TMB, Sigma).
The substrate reaction was stopped with 50 µl per well of 2.5 M sulphuric acid and the absorbance
measured at 450 nm with an ELISA plate reader. Positive controls consisted of broth cultures of
M. bovis, and phosphate buffered saline replaced the test sample for the negative control. Positive
reactions were easily determined. The negative controls always had an absorbance of less than 0.06
and the positive reactions always had an absorbance more than 0.4.
Polymerase chain reaction for routine identification of M. bovis described by Ghadersohi and
others (1997) and Ayling and others (1997) was used to confirm isolated strains as M. bovis.
282
Results
With the present ELISA procedure, M. bovis was specifically detected from 77 (18.29%) out of
421 milk samples. A total of 421 milk samples were investigated by ELISA and conventional culture
techniques. In three milk samples M. bovis was not isolated by conventional culture techniques, but
ELISA gave very strong positive reactions. Those milk samples, which were kept in refrigerator at
40 C, were resubmitted to ELISA and conventional culture techniques and at that time, both ELISA
and conventional culture on PPLO agar were positive for M. bovis. Ten out of 77 isolates, previously
identified as M. bovis (sandwich ELISA), were randomly selected and confirmed as M. bovis using
PCR.
Discussion
The supposition from consideration of the clinical characteristics of a herd mastitis problem,
where a large number of animals were resisting antibiotic therapy, could be caused by mycoplasma,
was confirmed by microbiological examination. Mastitic bovine milk originated from a large number
of farms in Croatia has been routinely cultured for mycoplasma on appropriate media at Department
of Microbiology and Infectious diseases for the last 30 years (Naglić and others, unpublished data).
On this basis, it is likely that the first case of mycoplasma mastitis in Croatia (Naglic and others,
2005) was brought into the country with the imported animals. Mycoplasma bovis is a major, often
overlooked, cause of calf pneumonia, mastitis, arthritis, and other conditions (Nicholas and Ayling,
2003). After its first isolation in 1961 in the USA from a case of severe mastitis in cattle (Hale et al.,
1962), M. bovis was isolated in many countries: Israel (1964), Spain (1967), Australia (1970), France
(1974), Britain (1975), Czech Republic (1975), Germany (1977), Denmark (1981), Switzerland
(1983), Morocco (1988), South Korea (1989), Northern Ireland (1993), Republic of Ireland (1994),
Sudan (1996), Chile (2000), Argentina (2002), Croatia (2002), Greece (2007). Our findings are in
complete agreement with published data according to clinical appearance, poor response to antibiotic
treatment and microbiological findings. All cows in this study found infected by M. bovis had been
purchased from other European countries suggesting that mycoplasma mastitis could be a problem
of herds that import replacement animals. According to Rebhun (1995) the disease is spread between
herds by transfer of infected animals, mechanical transmission of mycoplasma via milking equipment
subsequently occurring within a herd. This survey confirmed the association of M. bovis with clinical
mastitis in dairy herds in Croatia.
As bovine mycoplasma mastitis might be a major udder health problem in dairy cattle there is an
urgent necessity of coordinated action of veterinary diagnostic laboratories and veterinary authorities
in identifying the distribution and control of this infection in Croatia.
Acknowledgments
The Croatian part thanks to Dr. Hywel Ball and Mr. David Finlay for supplying monoclonal and polyclonal
Mycoplasma bovis antibodies and their assistance, advices and supervision.
References
Ayling, R. D., Nicholas, R. A. J. & Johansson, K. E (1997) Application of the polymerase chain reaction for the
routine identification of Mycoplasma bovis. Veterinary Record 141, 307-308.
Alberti, A., Addis, M. F., Chessa, B., Cubeddu, T., Profiti, M., Rosati, S., Ruiu, A. & Pittau, M. (2006)
Molecular and antigenic characterization of Mycoplasma bovis strain causing an outbreak of infectious
keratoconjunctivitis. Journal of Veterinary Diagnostic Investigation 18, 41-51.
283
Ball, H. J., Mackie, D. P., Finlay, D. A., Gunn, J., McFarland, E. A, Reilly, G. A. C. & Pollock, D. (1994) An
antigen-capture ELISA for the detection of Mycoplasma bovis in milk. Irish Veterinary Journal 47, 45-52
Bisping, W. & Amtsberg, G. (1988) Colour atlas for the diagnosis of bacterial pathogen in animals. Verlag Paul
Parey. Berlin, Hamburg. 306-320.
Bocklisch, H., Pfützner, H., Martin, J., Templin, G. & Kreusel, S. (1986) Mycoplasma-bovis -Aborte bei
Küchen nach experimental Infektion. Archives für Experimentalle Veterinarmedizin 40, 48-55.
Bulletine (1987) Bovine mastitis. Definition and guidelines for diagnosis. Int. Dairy Fed. Bull. 211, Brussels.
Gagea, M. I., Bateman, K. G., Shanahan, R. A., van Dreumel, T., McEwen, B. J., Carman, S., Archambault, M.
& Caswell, J. L. (2006) Naturally occurring Mycoplasma bovis-associated pneumonia and polyarthtritis in
feedlot beef calves. Journal of Veterinary Diagnostic Investigation 18, 29-40.
Gevaert, D. (2006) The importance of Mycoplasma bovis in bovine respiratory disease. Tijdschrift voor
Diergeneeskunde 131, 124-126.
Ghadersohi, A., Coelen, R. J., & Hirst, R. G. (1997) Development of a specific DNA probe and PCR for the
detection of Mycoplasma bovis. Veterinary Microbiology 56, 87-98.
Hale, H. H., Helmboldt, C. F. , Plastridge, W. N. &. Stula, V. (1962) Bovine mastitis caused by Mycoplasma
species. Cornell Veterinarian 52, 582-591.
Hayflick, L (1965) Tissue cultures and mycoplasmas. Texas Reports on Biology and Medicine 23, 285-303.
Hale, H. H., C. F. Helmboldt, W. N. Plastridge i E. F. Stula (1962) Bovine mastitis caused by a Mycoplasma
species. Cornell Veterinarian 52, 582-91.
Howard, C. J., Stott, Thomas, V, L. H., Gourlay, R. N. & Taylor, G. (1987) Protection against respiratory
diseases in calves induced by vaccines containing respiratory syncytial virus, parainfluenza type 3 virus,
Mycoplasma bovis and M. dispar. The Veterinary Record 121, 372-376.
Infante-Martinez, F., J. Aguado, D. & Eduard-Jasper (1999) Mastitis outbreak due to Mycoplasma californicum
and Mycoplasma canadense in a commercial dairy herd in the state of Jalisco, Mexico. Revista
Latinoamericana de Microbiologia. 41(3), 117-120.
Jasper, D. E. (1977) Mycoplasma and mycoplasmal mastitis. Journal of American Veterinary Medical Association
170, 1167-1172.
Kinde, H., Daft, B. M., Walker, R. L., Charlton, B. R. & Petty, R. (1993) Mycoplasma bovis associated with
decubital abscesses in Holstein calves. Journal of Veterinary Diagnostic Investingation 5, 194-197.
Kirby, F. D. & Nicolas, R. A. (1996) Isolation of Mycoplasma bovis from bullocks’s eyes. The Veterinary Record
138, 552.
Kirk, J. H., & Lauermann, L. H. (1994) Mycoplasma mastitis in dairy cows. Compendium on Continuing
Education for the Practicing Veterinarian 16, 541-551.
Kirk, J. & Mellenberger, R. (2001) Mastitis control program for mycoplasmal mastitis in dairy cows. Extension
Bulletin. Veterinary Medicine Extension Website. August 2001.
Langsford, E. U. (1977) Mycoplasma agalactiae subsp bovis in pneumonia and arthritis of bovines. Canadian
Journal of Comparative Medicine 41, 89-94.
Mackie, D. P., Ball, H. J. & Logan, E. F. (1982) Isolation of Mycoplasma californicum from an outbreak of
bovine mastitis and the experimental reproduction of the disease. The Veterinary record, 110, 578-580
Miles, R. & Nicholas, R. (1988) Mycoplasma protocols. Humana Press. Totowa, New Ywersey.
Nakamura, R. M., Walt, M. L. & Bennett, R. H. (1977) Studies on bovine genital tracts: Mycoplasma isolation
from dairy cows. Teriogenology 7, 351-355.
Naglic, T., H. Ball, B. Seol, D. Finlay, M. Benic, G. Galic (2005) The incidence of Mycoplasma bovis mastitis in
Croatia. Acta Microbiologica et Immunologica Hungarica, Supplement / Akademiai Kiado (ur.). - Budapest:
Akademiai Kiado, 2005. 103-103.
284
Naglic, T., B. Seol, H. Ball, D. Finlay, M. Benic, A. Galov, M. Bedekovic: An outbreak of Mycoplasma bovis
and Mycoplasma californicum mastitis and calf-pneumonia on a dairy cows farm in Croatia (unpublished
data)
Nicholas, R. A. J. & Ayling, R. D. (2003) Mycoplasma bovis: disease, diagnosis and control. Research in
Veterinary Science, 74, 2, 105-112.
Pfützner, H. & K. Sachse (1996) Mycoplasma bovis as an agent of mastitis, pneumonia, arthritis, and genital
disorders in cattle. Revue Scientifique et Technicque de l Office International des Epizooties 15, 14771494.
Rebhun, W. C. (1995) Diseases of the teats and udder. In: diseases of Dairy Cattle. Lippincott Williams and
Wilkins, Philadelphia, pp. 253-308.
ter Laak, E. A., Wentink, G. H. & Zimmer, G. M. (1992) Increased prevalence of Mycoplasma bovis in the
Netherlands. Veterinary Quarterly 15, 100-104.
Stipkovits, L., Rady, V & Glavitzs, R. (1993) Mycoplasmal arthritis and meningitis in calves, Acta Veterinaria
Hungarica 41, 73-88.
Walz, P. H., Mullaney, T. P., Render, J. A., Walker, R. D., Mosser, T. & Baker, J. C. (1997) Otitis media
preweaned Holstein dairy calves in Michigan due to Mycoplasma bovis. Journal of Veterinary Diagnostic
Investingation 9, 250-254.
285
286
THE ULTRASONIC EXAMINATION OF OVARIES AS A TOOL IN GOAT
SUPEROVULATION PROCEDURES
ULTRAZVUČNA PRETRAGA JAJNIKA U SUPEROVULACIJSKIM
PO¹STUPCIMA U KOZA
Grizelj, J.¹, S. Vince¹, A. González de Bulnes², M. Karadjole¹, T. Dobranić¹, M.
Samardžija¹, I. Getz¹, N.Prvanović¹, M. Belić¹, A.Tomašković¹, M. Lipar¹, D. Cvitković¹
¹Veterinary faculty, University of Zagreb, Croatia; [email protected], [email protected]
²INIA, Dpto. de Reproducción Animal y Conservación de Recursos Zoogenéticos, Madrid, Spain
Abstract
The aim of this research was to establish the importance and accuracy of the ultrasonic examination of
donor goats submitted to superovulation procedures. For this reason 9 goats were systematically examined by
ultrasound: 1) to monitor development of the follicles on the ovaries after hormonal treatement started; 2) to
confirm the ovulation(s) and 3) to assess the quality of the corpus/ora luteum/ea (CL) on the respective ovaries.
To perform the ultrasonic examination the animals were placed in dorsal recumbency and 7,5MHz ultrasound
probe was placed into the rectum.The accuracy of the ultrasound exams was measured by comparing the number
of follicles counted on ovaries with number of corpora lutea presented after laparatomy was done to accomplish
the lavage of uterus and collection of the 7 days old embryos.The absence of follicle(s) on ovaries after ovulation
was expected and does mated was considered as a sign of occured ovulation. The rate of follicles found on the
ovaries by ultrasound / number of corpora lutea counted when the uterus was rinsed was 57,86%. If there were
less then 10 follicles per ovary the results were even better. The ultrasonic exams of donor goats is appreciable
tool by which follicular dynamics can be followed and the success of superovulation procedure predicted and
measured.
Key words: ultrasonic examination, ovary, goat, superovulation, ovulation, follicle, corpus luteum
Sažetak
Cilj ovoga rada bio je utvrditi važnost i točnost ultrazvučnog pregleda koza davateljica u postupcima
superovulacije. U tu svrhu 9 je koza sustavno pregledavano ultrazvukom: 1) kako bi se pratio razvoj folikula na
jajnicima nakon započetog hormonalnog tretmana; 2) kako bi se potvrdila/e ovulacija/e i 3) kako bi se procijenila
kvaliteta žutog/ih tijela (CL) na jajnicima. Prilikom izvođenja ultrazvučne pretrage životinje su polegnute
na leđa, a 7,5MHz linearna ultrazvučna sonda aplicirana je rektalno. Točnost ultrazvučnih nalaza mjerena je
usporedbom broja ultrazvukom utvrđenih folikula na jajnicima sa brojem žutih tijela prisutnih na jajnicima
prilikom laparotomijskog ispiranja maternice koza u svrhu dobivanja 7 dana starih zametaka. Ultrazvukom
utvrđeno neprisutstvo folikula na jajnicima nakon očekivane ovulacije i parenja smatrano je potvrdom nastupa
ovulacije. Stopa ultrazuvučno utvrđenih folikula na jajnicima / broj žutih tijela izbrojanih prilikom ispiranja
maternica je iznosila 57,86%. Ukoliko je na jajnicima bilo sveukupno manje od 10 folikula rezultati su bili i
bolji. Ultrazvučne pretrage koza davateljica značajna su metoda za praćenje folikularne dinamike te za procjenu
i mjerenje uspjeha superovulacijskog hormonalnog postupka.
Ključne riječi: ultrazvučna pretraga, jajnik, koza, superovulacija, ovulacija, folikul, corpus luteum
287
Introduction
The ultrasonic examination of the ovaries allows the visualization and measuring of ovaries
and its cyclic structures (follicles, corpora lutea). The use of transabdominal pregnancy diagnostic
(5MHz) in the countries where intensive goat industry has been practiced is done routinely.
Nevertheless, transrectal exams of the ovaries are restricted to the scientific purposes mostly. The
detailed ultrasonographic patterns of preovulatory and ovulatory follicles in goats has not been
performed until recently (González de Bulnes et al., 2004). The frequency used to obtain a detailed
view of the ovarian structures are higher (7,5MHz) than those used for transabdominal purposes.
Although the ovulatory size of follicles is 6-8mm, the ultrasound exams allows the small antral
follicles (2-3mm) to be detected as anechoic structures of sphery shape and thin wall and their growth
and development (González de Bulnes et al., 1994).
Riesenberg et al. (2001) found that small follicles began to rise immediately after the
superovulatory stimulus and reach its maximum size during late proestrus or oestrus.
It is considered that the ovulation occurs if the absence of follicular antrum was noticed after
exams were performed once a day and the presence of increased heterogeneous echogenicity in its
site was found (González de Bulnes et al., 2004). It is so due to the fact that the ultrasound structure
of corpus haemorragicum does not differ from the rest of the ovarian parenchym (González de Bulnes
et al., 1999). The process of the corpus luteum formation allows it to be clearly detected as normo
and hiperechoic pattern.
It should be mentioned that aproximatively 33% of CL have a central cavity (González de Bulnes
et al., 1999) which must not be confused with small follicles. The most important difference is the
presence of typical thick wall of CL. Also to be considered is the occurence of partial or total early
luteolysis of corpora lutea in 10-35% of does (Chemineau et al., 1999), which as a consequence has
a big percentage of retarded and degenerated, non- transferable embryos.
The aim of this study was to evaluate the possibility of the prompt detection of ovulation and the
efficacy of accurate detection of follicles created after the goats were submitted to superovulatory
treatements.
Methods
Nine females, assigned to produce the embryos by superovulation procedure were systematically
examined by ultrasound to monitor development of follicules on their ovaries and to confirm the
ovulations.
The study was performed during the breeding season (February) using 9 young nanny goats of
Boer breed, in average age of one year. The animals were held outdoors and by the beginning of the
study they were put indoors, at the facilities of Veterinary faculty in Zagreb, Croatia at a lattitude of
45°N.
To perform the ultrasonic exam the goats were placed in dorsal recumbency, restrained in a
cradle as used for laparoscopy and 7,5MHz lubricated linear array ultrasound probe was placed into
the rectum (Sonovet 2000, Medison Co., Ltd., South Korea).
It is known that probes with outer dimensions of 10cm length, 3cm height and 2cm width can be
introduced into the rectum without difficulties (Kaspar, 1988).
It is necessary that probe can be rotated laterally. If the probe to be used is not attached to a
sufficiently stiff cable which can advance the probe into the rectum, a pipe or concave rod should be
used to stiff the probe (Kähn, 2004).
288
After the probe has been placed into the rectum, with transductor directed ventrally, it is
pushed cranially to find out the urinary bladder which, due to tipically anechoic shade, represent the
orientation point. After reaching it, the probe is turned a little bit cranially and then laterally on both
directions in order to localise the ovaries, which are situated within the curves of the uterine horns.
The Boer does were submitted to ultrasonic exams once a day through a 3 days superovulatory
treatement with porcine follicle-stimulating hormone (pFSH; Folltropin®–V, Vetrepharm, Canada)
and on the day of oestrus detection. The hormonal treatement was divided into 6 parts in decreasing
concentration and applied at 12 hours intervals. The doses used were 2 times 50mg pFSH and 2 times
25mg for the second and the third day as well. The ovaries were examined in order to confirm the
ovulation 2days after the goats were hand mated as well.
Table 1. The accuracy of ultrasound exams of goat ovaries submitted to hormonal superovulation
by 3 days FSH treatement. The comparison of number of follicles ≥6mm counted on ovaries on
the day of oestrus detection with number of corpora lutea present after laparatomy was done to
accomplish the collection of embryos.
n° of nanny goat
1
2
3
4
5
6
7
8
9
n° of follicles ≥6mm
9
12
7
8
7
8
8
11
11
n° of CL
17
28
14
19
10
9
8
18
17
% of accuracy
52,94
42,86
50,00
42,11
70,00
88,89
100,00
61,11
64,71
Σ
81
140
57,86
The ultrasound accuracy was found to be 57,86% which is in accordance with Kähn (2004) who
pointed out that sonographic examination could only enable the researcher to establish the tendency
in follicle numbers and makes counting the exact number of follicles impossible.
González de Bulnes et al. (1999) explained such difference as a consequence of follicular
superposition. The follicles placed one next to another could mask each other (Fig. 1., 2.) and
consequently provoke mistakes. Moreover, they mentioned that transversal, anechoic section of
blood vessels could also be, by mistake, considered as follicles. To avoid it, the probe should always
be rotated a little bit to obtain the elongated longitudinal section of blood vessel and thereby prevent
the mistakes.
The absence of follicle(s) on ovaries, established by ultrasound exam 48h after onset of oestrus,
is considered as sign of occured ovulation (Fig. 4).
289
Fig. 1., 2. Ultrasonographic image of superovulated ovary with many follicles present
Fig. 3. Image of superovulated ovaries after laparatomy has been performed
Fig. 4. Ultrasonographic image of ovary 48 h after onset of oestrus; the absence of follicles is considered as
occured ovulation
290
We also found out that some minor number of follicles did not ovulate and therefore were present
on the respected ovaries after ovulation of the great majority of follicles was confirmed. Nevertheless,
their presence do not influence the quality of created CL and collected embryos as measured by
serum progesterone concentration and quality assessment of embryos.
On the other hand, frequent appearance (10-35%) of early luteolysed CL significantly diminish
the quality and development potential of embryos (Chemineau et al., 1999).
Pierson and Ginther (1988) defined the difficulties of determing the corpora haemorragica by
ultrasound due to the very similar ultrasound pattern as a ovarian parenchym.
González de Bulnes et al. (1999) pointed out the problem of superposed corpora lutea what
disable the corpora lutea to be counted.
This study confirmed those difficulties and furthermore affirmed the inability to differenciate the
formed corpora lutea one from each other due to their merged outlines, despite hyperechoic pattern
attained.
Conclusions
Although it is impossible to determine by ultrasound the exact number of follicles arised after
pFSH treatement was done, the ultrasound examination was found to be very useful tool to estimate
the tendency of individual follicular development. It is also a suitable device to determine the
occurance of the ovulation of the respective follicles.
In this way the ultrasound exams of the ovaries could save the time and the money due to
elimination of those animals who did not respond to the treatement or did not ovulated as well before
the laparatomy and collection of embryos start.
References
Chemineau P, Baril G, Leboeuf B, et al. Implications des progres recents en physiologie de la reproduction pour
la conduite de la reproduction dans l’espece caprine. INRA Prod.Anim. 1999; 12(2): 135-146.
González de Bulnes, A., Díaz-Delfa, C., Urrutia, B., Carrizosa, J.A., López Sebastián, A. (2004): Ultrasonographic
screening of the ovulatory proces sin goats. Small Ruminant Research 52: 165-168.
González de Bulnes, A., Santiago Moreno, J., García López, M., Gómez Brunet, A., López Sebastián, A.
(1994): Observación del ovario en la oveja y eficacia en la detección de folículos y cuerpos lúteos mediante
ecografía transrectal: Investigación Agraria, 9: 319-329.
González de Bulnes, A., Santiago Moreno, J., López Sebastián, A. (1999): Exploración del aparato genital
femenino. Monografías Ovis, 61: 21-33.
Kähn, W. (2004): Veterinary Reproductive Ultrasonography, Special ed. Reprint from 1994. Schlütersche
Verlagsgesellschaft. Hannover. pp. 189-193.
Kaspar, B. (1988): Beitrag zur Sonographie in der gynäkologischen Diagnostik, insbesondere zur Feststellung
der Gravidität bei Schaf und Ziege. Tagungsbericht «Krankheiten der kleinen Wiederkäuer» der DVG,
Gieβen.
Pierson, R.A. and Ginther, O.J. (1988): Follicular populations during the oestrus cycle in heifers III. Time of
selection of ovulatory follicle. Animal Reproduction Science, 16: 81-95.
Riesenberg, S., Meinecke-Tillmann, S., Meinecke, B. (2001): Ultrasonic survey of follicular development
following superovulation with a single application of pFSH, eCG or hMG in goats. Small Ruminant
Research, 40(1): 83-93.
291
292
SYNCHRONIZATION OF OESTRUS IN KARADI EWES: THE USE OF
DIFFERENT PMSG DOSES
Sinkronizacija estrusa u karadi ovaca: uporaba
različitih PMSG DOza
SAIF A. BALIOS
Department of Surgery and Veterinary Medicine, College of Veterinary Medicine, University
Of Dohuk, Kurdistan Region, Iraq.
Abstract:
The experiment was performed on 80 karadi ewes. The ewes were randomly divided into 4 groups.
Intravaginal sponges containing 40 mg of FGA, were left in the vagina of groups 2,3 and 4 for 14 d. Immediately
after removal of the sponges,PMSG hormones at the doses of 500 IU (T1), 600 IU (T2) and 700 IU (T3)
respectively were administered intramuscularly. The first group served as control. Conception rate was slightly
higher (p<0.05) in control group (90%) compared with the treated groups ( 80%). Ewes in T1, T2 and T3 groups
exhibited the highest ( 12.5, 18.75 and 12.5 respectively) twinning percentage (p<0.01) and litter size (1.12, 1.18
and 1.12 respectively) (p<0.05). In conclusion the implementation of 500, 600 and 700 IU of PMSG in karadi
sheep warrants improvement of the reproductive efficiency of karadi ewes during the mating season.
Key words: Karadi ewe, PMSG,Reproductive performance.
Sažetak
Pokus je proveden na 80 ovaca koje su nasumično podijeljene u 4 grupe. Vaginalne spužvice sa 40 mg FGA
su aplicirane u 2., 3. i 4. skupini ovaca te su držane tijekom 14 dana. Odmah po vađenju spužvica, intramuskularno
je apliciran PMSG hormon u dozi od 500 i.j. (G1), 600 i.j. (G2) i 700 i.j. (G3). Prva je skupina ovaca bila
kontrolna. Stopa koncepcije je bila lagano viša (p<0,05) u kontrolnoj skupini (90%), nego u tretiranim grupama
ovaca (80%). Ovce u G1, G2 i G3 su pak imale viši (p<0,01) postotak dvojaka (12,5; 18,75 i 12,5) i veličinu
legla (1,12; 1,18 i 1,12) (p<0.05). Zaključeno je kako uporaba 500, 600 i 700 i.j. PMSG u Karadi ovaca jamči
poboljšanje rasplodne učinkovitosti Karadi ovaca tijekom sezone spolne aktivnosti.
Ključne riječi: Karadi ovca, PMSG, rasplodna svojstva
Introduction:
Sheep are considered to be one of the first domesticated mammals and are known to have been
closely associated with man from a very early date. Sheep offer the potential of making an important
contribution to providing food and fiber for a growing world population. The fact that most ewes in
the agriculturally productive countries are seasonal breeders and in general produce smaller lamb
crops than farmers may wish has made sheep an obvious target for the reproductive physiologist’s
attention (20).
To increase fertility in sheep and thus to benefit more from facilities, melatonin, PGf2 alpha and
progestogens are used to stimulate and synchronize oestrus. Progestogens can be used alone or with
FSH and PMSG (13).
An intravaginal progestogen sponge, followed by PMSG injection has been applied to ewes to
synchronize oestrus during the breeding season (17,21). Intramuscular administration of 400 IU and
293
500- 700 IU of PMSG at day when intravaginally applied sponges were removed increased the ratio
of ovulation and twinning (10, 11).
There is no information regarding synchronization efficiency and fertility induced by
administration of hormones in karadi ewes during breeding season. Thus the purpose of this study
was to investigate the influences of intravaginally applied FGA and intramuscularly injected different
doses of PMSG on fertility, twinning rate and litter size in karadi sheep in mating season in Dohuk
Governorate.
Materials and Methods:
The experiment was conducted at the Department of Animal Production Faculty of Agriculture
College, Dohuk University, in Kurdistan Region in the north of Iraq during 2006 mating season.
Eighty karadi breed ewes (2-4 years old) were used. Animals were allowed to graze cereal
stubble and barley grains (400 g for ewe per day) according to their requirements (18).
Animals were randomly divided into four groups. The first group (n=20) was served as control
(C), and ewes of groups 2, 3 and 4 (n=20) for each of them were intramuscularly injected with
500(T1), 600 (T2) and 700 (T3) IU PMSG ( SYNCRO-PART PMSG, Ceva, France) . The injections
were carried out 14 days after the withdrawal of the vaginal sponges impregnated with 40 mg of FGA
(SYNCRO-PART sponge, Ceva, France).
Active fertile rams (1:10) were introduced to ewes, 24 hrs. after the withdrawal of the sponges.
Rams were left with the ewes for 3 estrul cycles together with the control group.
For this experiment, fertility (%), litter size and the rates of conception, lambing and twinning
were together calculated according to Al-Saigh and Al-Kass(1992) (7).
Data were analyzed by using GLM procedures (SAS, 1996) (19). Chi-square test was performed
to test the significance of the differences.
Results:
Effects of FGA vaginal sponge which used to synchronize oestrus and different doses of PMSG
on fertility parameters were presented in table 1.
Fertility rate was not affected significantly by PMSG treatment. Though it tended to be higher
in control group (85 %) (Table 1). Conception rate on the other hand was higher (p< 0.05) in control
group (90%) compared with PMSG treated groups (80 %) (Table 1).
Lambing rate tended to be higher in T2 group than in T1, T2 and C group. T1, T2 and T3 groups
exhibited the highest (p<0.01) twinning rates in relation with C group (Table 1).Treatment with
PMSG caused significant (p<0.05) in litter size of treated ewes (1.12, 1.18, vs. 1.05).
294
Table 1: Effects of FGA and PMSG treatment on reproductive performance in Karadi ewes
Treatment
Traits
No. of ewes
No. of Lambs
No. of ewes aborted
(1) Fertility ( % )
(2) conception rate ( % )
No. of lambs born
No. of twins born
(3) Lambing rate ( % )
(4)Twinning rate ( % )
(5)Liters_size
C
20
17
1.00
85
90
18
1
90
5.88
1.05
T1
20
16
0.00
80
80
18
2
90
12.5
1.12
T2
20
16
0.00
80
80
19
3
95
18.75
1.18
T3
20
16
0.00
80
80
18
2
90
12.5
1.12
Level of significance
N.S
*
N.S
**
*
* = p < 0.05
** = p < 0.01
N.S = Non significant.
(1) No. of ewes lambed /No. of ram-exposured of ewes X100.
(2) No. of ewes lambed and aborted / No. of ram-exposured X 100.
(3) No. of lambs born/ No. of ram –exposured ewes X 100.
(4) No. of twin born / No. of ewes lambed X100.
(5) No. of lambs born / No. of ewe lambed.
Discussion:
Results of the present study revealed a high rate of fertility (85%) compared with those previously
reported by Alkass et al.,(72%) (5) and Al-Khzraji et al.,(45-70%) (6) and in line with that of Imm and
Juma (85%) (14).In retrospect,these findings are lower than the previous results obtained by Alkass
et al.,(92.2%)(4 ) and Timurkan and Yildiz (100%) (21).One could argue that the main reasons for
the reduction of fertility in PMSG treated ewes compared with control group (85%) in the present
study could be attributed to both uterine and ovarian causes. This may be due in part,to differences in
responsiveness of the ovaries to PMSG (16) reduced sperm transport (15) as well as to alteration in
the cleavage rate (2) or in circulating hormonal milieu (8).
Considering the present values of conception rates, the low rates (80%) as compared with those
reported by Alkass et al, (98.7%) (4) experimented on adult ewes using 600 IU PMSG. Differences
as such may reflect the differences in the potency between analogues as well as in the management
practices followed .On the other hand the conception rate was similar to the previous finding of
Alkass et al.,(84%) (5).
Lambing rate in the treated ewes was 90-95% this similar to (90-100%) reported by Timurkan
and Yildiz (21) and 90% reported by Crosby and O’callaghan (9). Similar improvement in twinning
rate was also observed by Ageel (1) using 500 IU PMSG for adult Awassi ewes. It was pointed out
that administration of PMSG increased the number of follicles and therefore raised the twinning
rates(12).
295
Collectively, increasing lambing and twinning rates would certainly increase the number of
lambs born and consequently increase farmers profits under Iraqi farm condition. Treatment with
PMSG caused a significant increase in litter size among treated ewes. These results data are consistent
with the finding of Al-Haboby et al.,(3).
These data indicated that 500,600 and 700 IU of PMSG is a supportive tool in improving some
of the reproductive output of Karadi ewes raised semi extensively during breeding season in north
of Iraq.
References:
1-Ageel, H.M. (1998).Effect of breeding group and hormonal treatment on
Reproductive performance of
Awassi sheep. M.Sc.Thesis. College of Agriculture, University of Baghdad (Arabic).
2- Ahmed, N., Schrick, F.N., Butcher, R.L. and Inskeep, k. (1995). Effect of Persistent follicles on early
embryonic losses in beff cows. Biol. Reprod. 52: 1129- 1138.
3- Al-Haboby,A.H.,Al-salman,M.H., Hassan,H.A. and Faraj,H. (1992). Estrus synchronization and superovulation
of Awassi sheep. IPAJ.Agric.Res.2: 126- 174.
4-Alkass,J.E.,Abdulkareem,T.A. and Al-Anbari,N.N.(1999).The combined Effect of PMSG and Vitamin A
administration on some
Reproductive performance of Awassi ewes .2nd Scientific Conference for
Agriculture Research (Animal Production ) Baghdad. Pp.128-135.
5-Alkass,J.E.,Abdulkareem,T.A. and Al-Mjamei,S.M.(2004).Reproduction Performance of Iraqi Awassi ewes
in response to treatment with Equine chorionic gonadotropin .J.Agri.Investment.2:74-77.
6- Al-Khazraji,A.A., Abu-Tabeigh,S.M.,Abdulkareem,T.A. and Mahdi, U.A.(2000).Reproductive response s of
Awassi ewes to different Level of PMSG administration .Iraqi J. Agric.Sci.31:681-687.
7-Al-saigh, M.N. and Alkass,J.E.(1992).Sheep and goat production Dar Al-Hikma Press.(Arabic).
8-Chow,L.A.,Thatcher,W.W.,Karla,P.S.,Wilcox,C.J. and Chenault,J.R. (1982).Peripheral progesterone,estradiol
and luteinizing hormone Plasma levels during and after estrus synchronization in dairy Heifers with
melengestrol acetate .Arq.Esc.Vet.34:545-556.
9- Crosby,T.F. and O’Callghan,D.(1991) .Effect of rumen degradable Bolus containing melatonin or progesterone
plus PMSG on oestrus Response and lambing rates in ewes.Theriogenology.35:747-752.
10- Cruz,D.G.,DeLa Castaneda,M.J.and Rocha,C.G.(1991).Effects of Oestrus synchronization by means of
FGA-impregnated sponges On the fertility and prolificacy of partly housed pelibuey ewes. Anim. Breed
Abstr.59:1052.
11-Gonzalez Lopez,J.,Espejo Diaz,M.,Serrano Garride,A. and Alvarez Martinez,Aj.(1987).Increasing lambing
frequency by means of Techniques for controlling the oestrus cycle in Merino and Merino x Romanov
ewes. Anim. Breed Abstr.55:5083.
12-Gulyuz,F. and Kozat,S. (1995). Synchronization of oestrus in sheep and The effect of PMSG dose on lambs
number.YYU J Faculty Vet. Med. 6:64-66.
13-Hafez,E.S.E.(1993). Reproductive cycles. In: Reproduction in Farm Animals. Hafez E.S.E.(Ed),Lea &
Febiger, Philadelphia.pp.94-113.
14-Imm,A.A.and Juma,F.T.(1987). Estrus synchronization with hormones And its influence on Karadi ewes.
Iraqi J.Agric.Sci.(Zanco)5(3): 71-79.
15- Lauderdale, J.W. and Ericsson, R.J.(1970). Physiological conditions Affecting the ability of cattle uteri to
influence the fertilizing Capacity of sperm . Biol.Reprod.2:179-188.
16-Mann,G.E., McNelly,A.S. and Baird,D.T.(1992).Hormone production In vivo and in vitro from follicles at
different stages of the estrus Cycle in sheep .J.Endocrinol.132:225-235.
296
17- Mutiga,E.R.and Mukasa-Mugerwa,E.(1992).Effect of method of estrus Synchronization and PMSG dosage
on estrus and twinning in Ethiopian Menz sheep .Theriogenology 38:727-734.
18-NRC.(1975).Nutrients Requirement of Domestic Animals .No.5.Nutrient Requirement of sheep .Fifth edn.
National Academy of sciences. National Research Council .Washington,D.C.
19-SAS.(1996).Users Guide statistics.SAS Inst. Cary.NC. 20-Shelon,M.(1995). Harnessing the biological
potential of sheep in Providing protein for growing world population .J.Anim.Sci.73: 243.
21-Timurkan,H.and Yildiz,H.(2005).Synchronization of oesrtus in Hamdan Ewes : The use of different PMSG
doses .Bull.Vet.Inst.Pulawy.49: 311-314.
297
298
Surgery - Miscellaneus
Kirurgija - Ostalo
299
300
Role of Bovine Digital Dermatitis (BDD) on service period
of dairy cattle
Utjecaj bovinog digitalnog dermatitisa na servis period
krava muzara
Gjino P.¹, Koleci Xh.¹, Turmalaj L.¹, Grizelj J.², Vince S.2, Lika E.¹
¹Agricultural University of Tirana, Faculty of veterinary medicine, Albania
²Veterinary faculty, University of Zagreb, Croatia
Abstract
Several conditions of foot infections of cattle; bovine interdigital dermatitis, bovine interdigital
necrobacillosis, bovine digital dermatitis (BDD), lamellar suppuration are described in the literature (5, 6). The
bovine digital dermatitis is the most frequent one causing a painful and severe lameness; economic loss due to
decreased milk production and reproduction performance (4, 5, 7). The disease was described for the first time
in Italy in 1974 as Mortellaro’s disease. It occurs primarily in dairy cattle and have been reported as a cause of
lameness worldwide, including Albania. BDD is generally considered as infectious disease (4). This study is
focused on the role of bovine digital dermatitis on service period of affected cows. The study was carried out on
dairy cattle herd in Tirana, Albania. The prevalence of this condition was evaluated, the main bacterial causes
were isolated and the time of successful insemination was surveyed. The animals were divided in two groups.
Each group consisted of six cows in same physiological status and management conditions. The first group was
composed of cows not affected, while the second group comprised the animals affected by foot infections. The
prevalence of foot infections on the farm was 18,67%. The main bacterial agents implicated were Fusobacterium
necrophorum, Dicolobacterium nodosus and Arcanobacterium pyogenes. A significant difference between two
groups was established. The cows from the first group were successfully inseminated 91,5 ± 13,3 days after
delivery. The affected group of cows was successfully inseminated 139 ± 143 days after parturition.
Key words: cattle, foot infection, service period, successful insemination
Sažetak
U literaturi je opisano nekoliko zaraznih stanja papaka; bovini interdigitalni dermatitis, bovina interdigitalna
nekrobaciloza, bovini digitalni dermatitis (BDD) i lamelarna supuracija. Bovini digitalni dermatitis je najčešći,
uzrokujući bol i jako šepanje te gospodarske gubitke zbog smanjenja proizvodnje mlijeka i smanjenih
reproduktivnih parametara. Bolest je prvi puta opisana u Italiji 1974. kao Mortellaro-va bolest. Prvenstveno se
javlja u krava muzara, a potvrđena je širom svijeta kao uzrok hromosti, uključujući Albaniju. BDD se općenito
smatra zaraznom bolesti. Ova je studija usmjerena na proučavanje utjecaja BDD-a na servis period u zahvaćenih
krava, a provedena je na stadu krava muzara u Tirani, Albanija. Proučavana je pojavnost ovog stanja, izolirani
su glavni bakterijski uzročnici te je promatrano vrijeme do uspješnog osjemenjivanja. Životinje su podijeljene u
dvije supine. Svaka grupa sastojala se od 6 krava istog fiziološkog statusa i držanih u jednakim uvjetima. Prvu
skupinu su sačinjavale krave nezahvaćene bolešću, dok su drugu skupinu sačinjavale krave sa bolesnim papcima.
Ukupna pojavnost bolesti papaka na farmi iznosila je 18,67%. Dominantni izolirani bakterijski uzročnici bili
su Fusobacterium necrophorum, Dicolobacterium nodosus i Arcanobacterium pyogenes. Utvrđena je znakovita
razlika između dviju supina - krave iz prve skupine uspješno su osjemenjene 91,5 ± 13,3 dana nakon teljenja, a
s druge strane, zahvaćena supina životinja uspješno je osjemenjena 139 ± 143 dana nakon poroda.
Ključne riječi: govedo, infekcija papka, servis period, uspješno osjemenjivanje
301
Introduction
Bovine digital dermatitis (BDD) is a bacterial infection of the epidermal skin of the claw (4, 7).
Early lesions are circumscribed, with a red, granular appearance. Lameness is severe, and economic
losses are due to decreased milk production and suboptimal reproductive performance (4).
Etiology
A mixed population of Gram-negative bacteria including anaerobic, microaerofilic organisms
and spirochetes has been identified and isolated (1, 2, 3). At least five different spirochetal phylotypes
within genus Treponema have been identified whereas Treponema denticola-like spirochetes were
the most common (5). Spirochetes isolated from cases of severe virulent ovine foot rot (SVOFR)
in Australia, UK and Ireland are closely related to a treponeme isolated from human periodontitis
and bovine digital dermatitis. This suggests the possibility of cross-species transmission (3, 5).
There are reports about combination between spirochetes, Campylobacter faecalis, Fusobacterium
necrophorum and Borrelia burgdopheri. The two spirochetes most likely to be implicated are the
Treponemes designated 2-1498 and 1-9185 MED. Experimental transmission of BDD has been
achieved by applying fresh BDD exudates on scarified, through eight consecutive days soaked
calf skin, using gauze. This shows the extreme importance of wet environmental conditions for the
development of the disease.
Risk factors
Host risk factors. The prevalence increases with age. At the age of one, almost all animals
have some epiderman skin lesions of the claw of at least one foot. The clinical disease is much more
common in first calf heifer and young cows. The first parity cows have the highest odds of BDD. The
odds decrease, in a dose-effect manner, as parity increases. The odds of BDD increase as lactation
progresses. The plantar and palmar regions of foot may be more conductive to the development of
BDD because these anatomical sites are more exposed to moisture (1, 5, 7).
Environmental risk factors. The BDD is about 20 times more likely to be found in dairy herds
with muddier corrals than in farms with drier ground surface in corrals. The disease is more common
in the freestall confined herds due to the fact that feet are constantly exposed to moisture so they
become coated with layer of dried feces. Purchased heifers increased 4,7 times the risk of disease
occurrence in comparison with the herds where heifers were not purchased on such a manner. The
disease is more likely to appear in the herds were the footbaths are not used regularly. It is more
frequent in the herds where the cows are housed in the slatted floor than in animals housed in straw.
Feeding with a large variety of dietary present a protective measure (5).
Pathogen risk factors. The Treponema strains have adhesion properties and produce high levels
of Chymotrypsine-like protease and high level of praline iminopeptidase which present a major
virulence factor.
Economic importance. The BDD positive herds experience an economic loss due to reduced
total milk production per lactation, longer calving to conception interval and higher number of
services per conception (5).
302
The study was carried out during the years of 2006 and 2007 on dairy cattle of Frisian / Holstein
breed in Tirana district. Firstly, the prevalence of foot root infections on the herd have been evaluated.
Thereafter, the cows were divided in two groups. The first group consisted of cows not affected and
the second group comprised the animals affected by BDD. The samples were collected with purpose
of isolating the bacterial pathogens which were involved on the apparition of digital dermatitis. There
was no opportunity to carry out the examination of the histologic smears on dark field microscopy to
evaluate the presence of Treponema serovar which may be involved. This study comprised the cows
in the last month of pregnancy and raised in the same management conditions. The period of time
from calving to conception was evaluated and compared between groups.
The prevalence of BDD was 18,67% (48 out of 257 cows). The most affected were first parity
heifers. The data are presented in the chart below.
Incide nce of B ov ine D igital D e rmatitis in D airy cows according
to parity
4
4
Parity
3
3
2
1
2
8
9
num ber of affec ted c aw s
Num ber of parity
13
18
0
Num be r of a ffe c te d c ow s
The high incidence of digital dermatitis in young cows is considered as a consequence of
farmer’s manner of supplying the heifers from the market. The animals were exposed to different
stable conditions and management, as well as stress factors like delivery, first lactation and different
feed.
Mixed bacterial flora was isolated from submitted samples, most prevalently Fusobacterium
necrophorum. The main objective of the study was to determine the impact of BDD on reproduction
performance. The emphasis was put on their influence on calving to conception interval as well as on
number of services per conception.
303
Dairy cattle
Ear tag No
035 692
035 166
035 210
035 070
035 139
035 327
Digital Dermatitis
The data for the control group (healthy cows) are presented below.
Calving to conception period
Date of calving
Date of successful service
(days)
06. 03. 2006.
08. 06. 2006.
108
12. 02. 2006.
19. 05. 2006.
106
03. 01. 2006.
28. 03. 2006.
84
27. 02. 2006.
15. 05. 2006.
77
11. 02. 2006.
02. 05. 2006.
80
23. 05. 2006.
04. 09. 2006.
94
The data for the second group (affected cows) are presented below.
Ear tag No
035 174
035 228
035 479
035 462
035 511
035 613
304
Date of calving
Date of service of
conception
03. 04. 2006.
11. 01. 2006.
16. 02. 2006.
18. 01. 2006.
24. 02. 2006.
18. 04. 2006.
03. 09. 2006.
24. 05. 2006.
30. 06. 2006.
26. 06. 2006.
24. 06. 2006.
28. 09. 2006.
Calving to conception
period (days)
153
133
134
159
120
135
The data indicated a significant difference between two groups. The service period was 91,5 ±
13,3 days for the first group and 139 ± 14,38 days for the second. We concluded that the prevalence
of digital dermatitis is high in our farm. The absence of control program allows and predisposes the
high prevalence. The BDD have a big impact on duration of calving to conception period.
A control program for the foot rot infection in the farm should be established as a routine
procedure, as animals with lesions act as reservoirs of infection for other animals. The important
attention should be pointed to environmental factors and disinfection which should be carried out
regularly.
References:
1. Berberi P. et al. (2003): Diseases of Ruminants
2. Çabeli P. (2006): Microbiology Veterinary
3. Dwight C. Hirsh and Yan Chung Zee., P J. (1999): Veterinary Microbiology
4. Irish Veterinary Journal (2007) Vol.60. Nr.2
5. O. M. Rodostits et al. (2007): Veterinary Medicine, Saunders Co. Ltd., London, Great Britain
6. P. J. Quinn, B. K. Markey, M. E. Carter, W. J. Donnelly and F. C. Leonard, Quinn P.J. et al. (1994): Clinical
Microbiology
305
306
INFLUENCE ON PREVALENCE OF THE DERMATITIS DIGITALIS
PAPILLOMATOSA IN THE DAIRY HERDS
UTJECAJ NA POJAVNOST PAPILOMATOZNOG DIGITALNOG
DERMATITISA U MLIJEČNIH KRAVA
Borut Zemljič
Dr. Vet. Med. MrSci, PhD, Dipl ECBHM;Veterinary Polyclinic Ormož d.o.o., Ljutomerska 25, SI2270 Ormož,
Slovenia, Phone: +386 41 639 087, E-mail: [email protected]
Abstract
The trial was performed on six dairy farms with total number of 652 animals. All animals in our trial were
twice a year systematically corrected and during this procedure not only correction of the defects, but also
inventarisation of all changes on all four feet was made. First systemic correction was made at the end of the
winter period, just before on the three farms animals were put on the pasture, on three other farms animals were
not on pasture any time. Second corrections were mostly done at the end of October or in begin of November. In
between every two weeks material from the manager or the owner of the farm was collected with the data about
obvious seen changes during the milking procedure on the claws of the animals. Every individual procedure was
reported and all the data were at the end statistical evaluated. On all six farms system of disinfection of the claw
was changes during the trial, so we were in the position to measure effect on appearance of dermatitis digitalis
papilomatosa. Data were compared and statistical evaluated. There were no statistical significant improvement;
only on one farm we observed significant changes in prevalence of dermatitis digitalis papilomatosa.
Sažetak
Istraživanje je provedeno na šest farmi mliječnih krava s ukupnim brojem od 652 grla.Sve
promatrane životinje godišnje su dva puta bile obuhvaćene pregledom i korekcijom papaka a izvršena
je zabilježba svih nađenih promjena na sva četiri ekstremiteta.Prvi pregled i korekcija izvedeni su
krajem zimskog perioda,pri čemu u tri farme neposredno prije ispusta na pašnjak a u preostale tri
farme krave su držane u stajama.Drugi pregled i korekcija su obavljeni krajem listopada ili početkom
mjeseca studenog.U međuvremenu svaka dva tjedna rukovoditelj farme ili vlasnik farme je tijekom
mužnje bilježio zamjećene promjene na papcima.Svi podaci su statistički obrađeni. U svih šest
promatranih skupina dezinfekcija papaka je obavljana, no različitim načinima, a mi smo obradili
dobivene rezultate glede pojavnosti papilomatoznog digitalnog dermatitisa.Podaci su statistički
obrađeni i međusobno uspoređeni.Nismo naišli na statistički značajne promjene osim na jednoj
farmi.
Introduction
Dermatitis digitalis (DD) or papilomatous dermatitis digitalis (PDD) of cattle has been identified
as a major cause of lameness and economic looses in dairy herd production world wide. Dermatitis
digitalis is a multifactorial, superficial dermatitis of the digital skin above the coronet in cattle.
Dermatitis digitalis was first diagnosed 1974 in Italy by Mortellaro and after that successively in
different parts of the world, where intense dairy production is present, was reported. In Colour Atlas
of Affections of Bovine Digit from 1984 four diseases were described: Dermatitis digitalis, Dermatitis
interdigitalis, Dermatitis verrucosa and Interdigitalis phlegmon, Zemljic reported in 1994 about
307
presence of Spirochete like organisms as potential cause of the disease and two years latter same
group founded out, that papilomatous changes on the lesions were actually chronic development of
the disease; therefore disease was named dermatitis digitalis papilomatosa or papilomatous digital
dermatitis (PDD).
Dermatitis digitalis papilomatosa (PDD) could be one of the major causes for diminishing
production in modern dairy herds. Especially in loos house systems and in Holstein Frisian breed
PDD could be reason of the financial problems in the production. In such herds it is necessary to
have overview on prevalence of PDD. Anywhere where the prevalence of the disease is over 20 %
we must understand PDD as herd problem, where systemic measures must be taken also not only
treatment of individual animals must be performed.
On the second hand prevalence of 20% is not sharp border between health and disease, between
financial success and flap. In some cases we can observe prevalence of 10% with typical herd problem
and on other hand we can observe herds where even 20% could not perform problem.
In any case it is necessary to treat herd as unit and additionally individual animals.
The trial was performed at the commercial dairy farms all around Slovenia on six different
locations.
On first farm - No1- were 132 dairy cows and 35 heifers in production stall in two groups
with average production of 7125 kg milk per standard lactation in last year. They used 10% cooper
sulphate. At begin of winter period 2006 they changed to KOVEX®, which is used every second day
on the way to the milking parlour. Systemic trimming were performed once a year, normally in the
spring time.
On farm No.2 there were 46 dairy cows and 25 heifers with average production of 9102 kg/
milk per standard lactation. They introduced KOVEX® in November 2006 and they use foam every
second month and nothing in between. Systemic correction is made before dry off period and after
150 days in milk.
Farm No3 keeps 55 dairy cows and 15 heifers with average production of 8207 kg milk per
standard lactation. The mode of KOVEX® use was same as on farm No.2. They do not use any
systemic claw trimming procedure, only according to needs in the herd.
Herd No4. Have 280 dairy cows and 50 heifers with average production of 7356 kg/milk per
standard lactation. They use systemic trimming every year at the end of the winter period and after
end of pasture period. At begin of the last winter period (2006) they introduced KOVEX®. They used
foam every second day till they began with spring systemic trimming in February. Than they abandon
KOVEX® and start to use 10% cooper sulphate. They change solution twice weekly, after the barrier
passed about 1300 animals.
Farm No5. keep 60 dairy cows and 35 heifers with average production of 8870 kg of milk per
standard lactation. They start to use KOVEX® foam at begin of November 2006 in the mode for
three weeks, than they pause for next three weeks with disinfection with 5% formalin every second
day in between.
Farm No6. keeps 198 dairy cows and no heifers on the farm with average production of 8312 kg
of milk per standard lactation (305 days in milk). They start to use KOVEX® in November 2006,
but they changed back to 10% cooper sulphate after 5 months, because incidence of PDD increased
dramatically.
308
Prior to the trial and also for at least last two years before, cows have been walking through
10% cooper sulphate or 5% formalin solution at least three times per week. All the data about
infectious claw diseases were registered and twice in the year individually examined and registered
by veterinarian during the systemic foot trimming procedures or during expert v visit on the farm.
All six farms housing systems consisted of free stalls and in two cases they have concreted floors
scraped with automatic scrapers twice a day and in all other four stalls they have grated floor, where
twice a day cleaning were performed manually. In two cases there was pre rinse baths installed before
footbath entering in all other cases footbath was changed depending on farm policy, but at least twice
weekly. At the begin of this year winter period in all six farms KOVEX® system were introduced
to avoid legal problems with using cooper sulphate or formalin in the near future. In five cases
KOVEX® systems were introduced at the entrance of the milking parlour on one farm they installed
KOVEX® system after the milking parlour, unfortunately in most cases there were no enough free
space to obtain application area big enough, but in such cases they try to produce KOVEX® foam
of good quality and on such way ensure at least five minutes contact time of the foam on the skin
above the coronet. The positive circumstance in all cases was also that foaming area was organised
on such way, that dairy cows were not able to jump over, because foam areas were just in front of the
entrance to the milking parlour, so animals were obliged to make sharp turn of 90ş from corridor to
the milking parlour. Foam was implicated for at least three weeks continuously every day and after
that three weeks of break with no disinfection were performed. In two cases they continue to use
foam constantly every day for four months. On those two farms, in between and after systemic claw
trimming were performed, foot bath with 10% cooper sulphate was introduced again.
Every fortnight the registered data were physically controlled by veterinarian during the milking
period and data were compared with data produced by milking persons and dairy herdsmen they
reported every day.
Results
After first inventarisation in first cycle of claw correction in spring 2006 we found out on farm
No.1 that 12.57% of animals on farm show signs of PDD. After introduction of KOVEX® incidence
is diminish to 10.78% what was not significant drop of incidence. On farm No2. the incidence in
spring 2006 was 9.865 and after introduction of new disinfectant method it drop to 8.45%, what
was also statistical not significant. The situation on farm No.3 stayed the same before and after
introduction of new disinfectant method. Incidence of PDD on these farms was not major problem
of the production and treatment of individual cows was enough to control problem in reasonable
borders.
More interesting was the development of the disease on farm No.4 and farm No.6. On farm
No. 4 the incidence of PDD before introducing the new method of disinfection was 38.79% and in
winter correction session the incidence increased to 42.12% what was not statistical significant. After
that we introduced 10% cooper sulphate solutions with every day walk trough foot bath and in one
month we observed rise of clinical cases of PDD to 54.55%. Because of recent health, production
and welfare problems we introduced topical therapy with 2% oxytetracycline and after 14 days the
incidence drop to 22.2% and additional after 14 days to 8.8 % what was significant drop to all
parameters of incidence in the herd.
On farm No.6 the incidence in spring 2006 was 28.79% and raised in six months to incredible
52.02 % what was statistical significant rise and what also produce lot of problems in the herd. Those
problems appear not only as health problem but also as production problem with diminish production
309
of milk and raised problem on the reproduction in picture of diminished NR 60 -90 days. Therefore
we introduced again 10% cooper sulphate foot bath as walking trough bath and incidence dropped
to 27.27% till end of winter period of 2007 and even diminished after introducing pasture in April of
2007 to 12.63 of obvious clinical cases.
Table 1. Distribution of PDD before and after introduction of KOVEX® foams
Disease
PDD
PDD
Time
of
evaluation
Before introd.
KOVEX®
After
introduction of
KOVEX®
No1
No2
No3
No4
No5
No6
12,57 %
9,86 %
10,0 %
38,79 %
15,79 %
28,79%
% 8,45 %
(nons.)
10,0 %
(nons.)
4 2 , 1 2 % 16,84
(nons.)
(nons.)
10,78
(nons.)
% 52,02%
(sign)
Table 2. : Development of incidence of PDD in herd No4.
%
before %
after
intorduction
of months of
Disease
KOVEX®
KOVEX®
1
2
42,12%
PDD
38,79%
(nons to 1)
two
After 1 month of After 2 weeks of
individual topical
10% CUSO4
th.
3
4
54,55%
22,1 %
(nons to 2,
(sign to 1,2,3
sign to 1)
After add. 2 weeks
of topical th.
5
8,8 %
(sign to 1,2,3,4)
Discussion
On four farms in our trial we do not found any significant changes in the all year distribution of
PDD what was actually expected. The most interesting farms in our trial were farm No.4 and No.6.
Those two farms were the biggest in our trial with lot of outside working force. That could be the
reasons of high incidences of PDD also before because level of herd hygiene was not on highest
level also at begin of our trial. The introduction of new disinfectant method with KOVEX® was
not satisfactory. The place of the disinfection barrier was not satisfactory; the time of introducing
of the foam was not long enough and on one farm the quality of the foam was because of technical
problems unsatisfactory.
We observe statistical significant change in the case of use of topical therapy with 2% OTC
solution. We can agree that with footbaths there is essential to keep stall and herd hygiene on
substantial level, what was effectively performed in our trial on farm No4. Additional to topical
therapy with 2% OTC solution during the milking procedure, we undertake serious consultation with
the management to keep more attention on careful cleaning procedure with manual correction after
automatic scrapping were introduced and also special attention was given to manipulation of the
cows before milking (no hurrying, no violence and raised voices). It was also established, that person
who deals with claw trimming must undergo special education and new crush for fixing the cows
was introduced. With this trial was also practically performed, that when we have to deal with herd
310
incidence higher than 20%, introducing of new even more efficient preventative solution can only
produce exacerbation of the clinical picture and lead to significant increase of clinical cases. It was
proven, that prophylactic measures are not therapeutic ones.
It was obvious, that in the herds where good management and stall hygiene were performed, there
is no difference which and what kind of footbaths was used. In the stalls where a lot of employed
working power is involved in the working process, special problem is motivation of those persons
and equivalent knowledge and understanding of the dairy process is necessary.
The trial also perform very successful, that also novel formulas successfully exchange old footbath
solutions, for which we thought that are the only ones for such purposes, but only as prophylactic
measure, not as wonder therapeutic formula. We proved, that only prophylactic foot bathing could
not guaranty success and that also other conventional hygiene measures are very successful more
important as foot bathing procedure itself.
References
1. Blowey R. (2004). Use of novel foot foam in the control of digital dermatitis. Proc.13th Int. Symp. and 5th
Conference on Lameness in Ruminants, Maribor, Slovenia
2. Fiedler A.(2004). Investigation of the efficacy of a kovex-foam-system in the decrease of the incidence of
Dermatitis digitalis, dermatitis interdigitalis and erosio ungulae. Proc.13th Int. Symp. and 5th Conference on
Lameness in Ruminants, Maribor, Slovenia
3. Holzhauer M. et al.(2006) Herd- and Cow level prevalence of Digital dermatitis in The Netherlands and
associated risk factors. J. Dairy Science 89: 580 – 588
4. Manske T., Hultgren J., Bergsten C.: (2002) Topical treatment of digital dermatitis associated with severe
heel horn erosion in a Swedish dairy herd. Prev.Vet.Med. 53(3) 215 – 231
5. Somers JGCJ, Frankena K, Noordhuizen Stassen EM, Metz JHM (2005) Risk factors for digital dermatitis
in dairy cows kept in cubicle houses in The Netherlands. Prev Vet.Med.71:11-21
6. Seymour J et al. (2002) Foot bathing in the management of digital dermatitis. Proc.12th Int.Symp. and 4th
Conference on Lameness in Ruminants, Orlando, Florida, USA
7.
Vermunt J (2004) Herd Lameness: a review, major casual factors and guidelines for prevention and control.
Proc.13th Int. Symp. and 5th Conference on Lameness in Ruminants, Maribor, Slovenia
8. Zemljic B (1994) Current investigations in to the cause of dermatitis digitalis in cattle. Proc. 7th Int.Symp.
on Lameness in Ruminants, Banff, Canada
9. Zemljic B (2000) Aetiology of digital dermatitis in one dairy farm in Slovenia, Proc. 7th Congress of
FeMeSPRum, Giardini Naxos, Italy 86 –89
10. Zemljic B (1997) Causes and risk factors for occurrence of lameness in cattle, Praxis veterinaria. 451
–2:123 – 129
11. Zemljic B (2004) Influence of foot bathing on prevalence of digital dermatitis after introducing of diseased
animal into healthy dairy herd. Proc.13th Int. Symp. and 5th Conference on Lameness in Ruminants, Maribor,
Slovenia
12. Zemljic B (2006) Digital dermatitis – the costs and benefits of the control. Proc.14th Int. Symp. and 6th
Conference on Lameness in Ruminants, Colonia, Uruguay
13. Zemljic B (2007) Impact of different footbath solutions on Claw health in dairy herds. Cattle Practice Vol.
15-3: 320 - 322
311
312
Unilateral scrotal hernia in ram
JEDNOSTRANA SKROTALNA HERNIJA U OVNA
Capak, D1., B. Radišić1, D. Vnuk1, I. Harapin2, J. Kos1, T. Babić1, Marija Lipar,1
and D. Matičić1
1
Clinic for Surgery, Orthopedics and Ophtalmology, Faculty of Veterinary Medicine, University of Zagreb,
Zagreb, Croatia
2
Clinic for Internal Diseases, Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia
Sažetak
Radilo se o ovnu, virtemberške pasmine starom 8 godina koji je doveden na kliniku za kirurgiju, ortopediju
i oftalmologiju sa abnormalno povečanim skrotumom. Vlasnik je primijetio oteklinu u području mošnje prije
par mjeseci. Po njegovim riječima oteklina se pomalo povečavala, a posljednjih mjesec dana je prestala rasti. Pri
dolasku na kliniku utvrđeno je da je skrotum abnormalno povećan, asimetričan i umjereno bolan, a lijeva strana
s testisom veća je od desne. Skrotum je veličine ragbi lopte a lijevi ingvinalni otvor je proširen (9 puta 4,5cm).
Kao hernijalni sadržaj pipaju se tanka crijeva u mnogo tekučine, atrofičan testis i tvrde tvorbe poput užeta u
području funikulusa (najvjerovatnije vene ispunjene krvnim ugrušcima). Rutinskim operacijskim zahvatom u
općoj anesteziji hernija je operacijski sanirana dok je desni testis je po želji vlasnika sačuvan.
Ključne riječi: ovan, skrotalna hernija
Abstract
This article is about ram württenberg breed, 8 years old, suffered from unilateral scrotal hernia. Ram
was presented at surgery, orthopaedics and ophthalmology clinic. A few months ago owner observed oedema
in scrotal region. Oedema had been slowly enlarging. In a period of one month, oedema had stopped to grow.
Clinical observation was done. The enlarged scrotum was in a shape of rugby ball observed. Scrotum was
asimetric, the left side was significantly bigger in comparison to the right side. Scrotal region was painful. Left
inguinal chanel was enlarged (9x4,5 cm). Sac contents were: small intestine, liquid, athrophic left testes and
indured funiculus. Funiculus vesles were full of blood trombs. Surgery was performed in general anaesthesia.
Hernial sac was resected and left testes extracted. The owner wanted that right testes stay in scrotum.
Key words: scrotal hernia, ram
Uvod
Skrotalna hernija u muških preživaća je doista rijetka bolest. U nama dostupnoj literaturi pronašli
smo svega nekoliko izvješća. Izvješća se odnose na ovnove pasmine Merino (Carr, 1972; Dennis i
Leipold, 1968; Orr, 1956; Roberts, 1988) i Hampshire (Braun i Cole, 1985). Svi autori sugeriraju da
je bolest vjerovatno nasljedna.
Zbog iznimne rijetkosti bolesti i zbog našeg slučaja u kojem se javlja hernija u ovna pasmine
Wirtenberg odlučili smo ga opisati.
Materijal i metode
Radilo se o ovnu, virtemberške pasmine starom 8 godina koji je doveden na kliniku za kirurgiju,
ortopediju i oftalmologiju sa abnormalno povečanim skrotumom. Vlasnik je primijetio oteklinu u
313
području mošnje prije par mjeseci. Po njegovim riječima oteklina se pomalo povečavala, a posljednjih
mjesec dana je prestala rasti.
Slika 1. Abnormalno povećani skrotum u ovna
Pri dolasku na kliniku utvrđeno je da ovan ima abnormalno povećan, asimetričan i umjereno
bolan skrotum, a lijeva strana s testisom veća je od desne. Skrorum je veličine ragbi lopte a lijevi
ingvinalni otvor je proširen (9 puta 4,5cm). Kao hernijalni sadržaj pipaju se tanka crijeva u mnogo
tekučine, atrofičan testis i tvrde tvorbe poput užeta u području funikulusa (najvjerovatnije vene
ispunjene krvnim ugrušcima).
Nakon otvaranja venskog puta izvađena je krv s namjerom da se utvrdi status životinje.
Potom je životinja uvedena u anesteziju, intubirana te je aplicirana epiduralna anestezija.
Anestezija
Životinja je ispoštena 18 sati prije operacije, a voda joj je uskraćena 8 sati prije operacije.
Za premedikaciju je korišten ksilazin (Xylapan, Vetoquinol) u dozi 0,1 mg/kg IM. Postavljena je
kanila u v. cephalica antebrachii. Za indukciju je korišten tiopental u dozi 5 mg/kg IV te je životinja
intubirana. Anestezija je održavana smjesom izoflurana u kisiku. Za analgeziju je apliciran lidokain
(Lidokain 2%, Belupo) u dozi 1 ml/5 kg tjelesne težine epiduralno između zadnjeg lumbalnog i prvog
sakralnog kralješka. Za postoperacijsku analgeziju apliciran je ketoprofen (Ketofen 10%, Merial) u
dozi 1 mg/kg SC.
Operacijski zahvat
Ovan je postavljen u dorzalni položaj (na leđa). Operacijsko polje je pripremljeno uobičajeno,
očišćeno, oprano te dezinficirano povidonom i alkoholom. Nakon pripreme operacijskog polja i
oblačenja u operacijske krpe, operacija je započeta rezom na koži iznad lijevog ingvinalnog kanala.
314
Rez je produžen na povećani skrotum u duljini oko 50 centimetara. Potom je pažljivo i tupo
otpreparirana unutarnja hernijalna vreća (tunica vaginalis communis) s hernijalnim sadržajem. Kroz
tuniku koja je veoma zadebljana prosijavaju tanka crijeva, funikulus i testis koji se nalaze u velikoj
količini tekućine. Na vrhu hernijalne vreće načinjena je punkcija te ispušten dio tekućine. Budući da
je istjecanje serozne tekučine iz hernijalne vreće bilo sporo načinjen je na istom mjestu rez skalpelom
dužine oko 2 centimetara te je iz vreće isteklo mlazom oko 3 litre serozne žučkaste prozirne tekućine.
Nakon otvaranja hernijalne vreće tanko crijevo je vraćeno u trbušnu šupljinu. Na najvišem mogućem
mjestu načinjena je ligatura funikulkusa spermatikusa zajedno s unutarnjom hernijalnom vrećom, te
su zajedno odstranjeni. Ingvinalni kanal je rekonstruiran pojedinačnim čvorastim šavima Dexon-om
veličine 2. Koža lijevog skrotuma je skoro u potpunosti resecirana i rekonstruirana svilom veličine 2,
jer je vlasnik tražio da ovnu ostane desni skrotim i testis očuvan. U ranu je postavljen dren. Pacijent
je držan pod antibiotikom (amoksicilin) sedam dana po operaciji.
Nakon što je životinja probuđena secirali smo odstranjeni testis i funikulus. Na vrhu funikulusa
(dijela koji je bio neposredno pri ingvinalnom kanalu) pronašli smo splet krvnih žila, najvjerovatnije
vena koje su ispunjene lističavim krvnim ugrušcima.
Rasprava
Petog dana po operaciji dren je izvađen, rana zaraštava bez komplikacija. Dvanaesti dan po
operaciji izvađene su kožne niti. Rana je zarasla per primam.
Ingvinalna odnosno skrotalna hernija je rijetka bolest u svakodnevnoj veterinarskoj praksi. Da
li je bolest nasljedna traje diskusija u literaturi već pola stoljeća. Uglavnom autori koje smo naveli
se slažu da je u ovna nasljedna predispozicija za ingvinalnu herniju kao što je to dokazano u svinja
(Vogt i Ellersieck, 1990).
Slika 2. Ugrušci u venama funikulusa spermatikusa.
315
U našem slučaju interesantan je nalaz ugrušaka u venama koji je najvjerovatnije doveo do
povećane količine tekućine u unutrašnjoj hernijalnoj vreći.
Osim toga, svi opisi u literaturi se do sada odnose na ovnove pasmine Merino. To su uglavnom
razlozi zašto smo se odlučili prikazati našeg ovna pasmine virtemberg.
Literatura:
Braun, W.F., W.J: Cole (1985): Unilateral scrotal hernia in a ram lamb. J. Am. Vet. Med. Ass. 187, 500.
Carr, P. M. (1972): An apparently inhererited inguinal hernia in a Merino ram. Aust. Vet. J. 48, 126-127.
Dennis, S. M., H. W. Leipold (1968): Congenital hernias in sheep. J. Am. Vet. Med. Ass. 152, 999-1003.
Wright, J. G. (1963): The surgery of the inguinal canal in animals. Vet. Rec. 75, 1352-1363.
Orr, A. E. (1956): Inguinal hernia in sheep. Vet. Rec. 68, 2-4.
Roberts, S. J. (1988): Scrotal hernia in rams. A case report. Cornell Vet. 78, 351-352.
Vogt, D. W., M. R. Ellersieck (1990): Heritability of susceptibility to scrotal herniation in swine. Am. J. Vet.
Res. 51, 1501-1503.
316
Infectious Keratoconjunctivitis (Pink Eyes) in Sardinian
Goats: Clinical, Diagnostics and Epidemiological
Considerations
Zarazni Keratokonjunktivitis (Pink Eyes) u sardinijskih
koza: klinička, dijagnostička i epiemiološka razmatranja
Cabras*, P. A., A. Firinu*, S. Tola*, A. Orrù*, A. M. Deiana*, S. Usai***, S. R. Poddighe*, V. Petruzzi**
* Esperimental Zooprophilactic Institute of Sardinia
**Veterinary Faculty -University of Sassari
*** Local Health Enterprise – Veterinary Service – Lanusei
ABSTRACT
Infectious keratoconjunctivitis (IKC) is a highly contagious ocular disease that effects small
and large domestic ruminants (V. Petruzzi et al. 2004 ) worldwide. IKC has never before reported
in Italy in goats. This report describes microbiological, diagnostic and clinical features of naturally
occurring caprine keratoconjunctivitis observed during three outbreaks involving separated goat
populatio. The findings suggest that Mycoplasma conjunctivae is the primary agent causing infectious
keratoconjunctivitis in the caprine species.
Sažetak
Visoko kontagiozne pojave keratokonjuktivitisa se pojavljuju u sardinijskih koza uglavnom u proljeće te
početkom jeseni i zime. Simptomi mogu različiti i najčešće traju skoro cijeli mjesec. Morbiditet je visok pa
bolest obično zahvaća cijelo stado. U nekoliko slučajeva (2-3% ozljede oka su bile posebno ozbiljne te su mogle
dovesti do prolazne ili trajne sljepoće. U ovom razmatranju opisali smo neke slučajeve infektivnog keratokon
juktivitisa(IKC) uočene na području istočne Sardinije usredotočivši se na kliničke, dijagnostičke i epizootske
podatke. Tipični znaci keratokonjuktivitisa uočeni su na svim proučavanim životinjama, uz rjeđe opažanje čira
rožnice.Keratokonjuktivalni bris,krv, mlijeko i feces su uzorkovani. Izolacijom, laboratorijskim pretragama i
PCR metodologijom izdvojen je uzročnik Mycoplasma conjuctivae.
INTRODUCTION
Infectious keratoconjunctivitis or PINK EYE is a highly contagious ocular disease affecting
small and large ruminants domestic worldwide and wild caprine species in the European Alps and in
New Zealand (Giacometti at al 2002; Mothe at al 2003).
Its occurrence in goats has never been reported in Italy. The aetiological role of Mycoplasma
conjunctivae in IKC has been established in well-documented studies of experimental infectious in
sheeps and goats (Trotter SC – FRANKLIN RM – BAAS EJ – BARILE MF – Epidemic caprine
keratoconjunctivitis; Experimentally induced disease with a pure culture of M. cong. – Infect immune.
1977, 18 – 816 – 822 – G.E. JONES – The pathogenicity of some ovine or caprine mycoplasma in
the lactating mammary gland of sheep and goats –J. COMP. PATH. 1985 – Vol. 95).
317
However the aetiology of IKC it’s a much debated question by other authors.. Several bacteria
have been described in association with IKC in both domestic and wild ruminants, including
Mycoplasma conjunctivae, Chlamydia, Branhamella ovis (vedi Bibl. In MAYER NICOLET GIAC
ecc).
In the reported case the disease was characterized by a high rate of contagious , rapid onset,
intense lacrimation, conjunctival hyperaemia and corneal opacity with neovascularization; in a few
cases corneal ulcers.
This report describes the microbiological, diagnostic and clinical features of naturally occurring
caprine keratoconjunctivitis observed during three outbreaks involving separated flocks of goat.
Three flocks of about 150 animals were investigated: all 392 adult females were in the last phase
of pregnancy.
Two of the affected herds were territorially closeness; all subjects showed more or less serious
ocular lesions.
Some animals showed also joints lesions. Ocular lesions first appeared at the beginning of
October; kids had ocular lesion in milder form then adults.
Recurring mild forms were observed on 30% of cases after two months of symptom remission;
death occurred in four cases.
Health status of the flocks was characterised by Chlamydia, Herpes virus and Caev seropositivity
with gastrointestinal and pulmonary parasites.
48 double ocular swabs were collected (48 for cultural detection and 48 in order to check
Chlamydia, Q fewer, Rickettsia by PCR.
Some subjects were treated locally conjunctiva lower fornix with two drops a day for 5 days with
ossitetraciclina (PANTERRAMICINA PFIZER)
The conjunctival specimen was obtained by cotton swabs (CULTIPLAST) in a rotating motion
if possible from between the third eyelid and the cornea or from the conjunctiva of the lower eyelid.
In general both eyes were swabbed.
The swabs were inoculated in blood agar and Hayflick for mycoplasma and incubated at 37°C
for 5 days in wet medium.
Other swabs were inoculated in Mac Conkey, mannitol agar salt and incubated at 37°C for 24
-48 h.
Moraxella has been isolated by a blood agar medium, where it needed 24 hours to grow; further
identification tests were carried out by API 20 system.
DNA extraction – the mycoplasma conjunctivae reference strain HCRC/581 was cultured in
standard PPLO broth medium (DIFCO) supplemented with 20% horse serum, 2,5% yeast extract and
1% glucose at 37°C until exponential growth phase. DNA was extracted from culture, purified by
standard protocols (Ausbel et al., 1992) and concentration determined by UV absorption (Sambrook
et al., 1989).
Strains and nested-PCR- All isolates were confirmed to belong to the species Mycoplasma.
conjunctivae using a nested PCR method as described by Giacometti al al. (1999). Two primer sets:
MOLIGEN1-L/16SUNI-R and McoR1/McoF1, were used to amplify a fragment from 16S rRNA
318
gene. In the first PCR, 5 µl of M. conjunctivae total DNA were added in 25 µl reaction mix containing
2.5 µl buffer 1o (Roche) plus 25 mM MgCl2, 1 µl of MOLIGEN –L and 1 µl of 16SUNI-R at final
concentration of 25 pmoli/µl, 0.5 µl of 1.25 mM dNTPs, 0.5 µl of 5 U/µl Taq polymerase (Roche) and
14.5 µl of H2O. PCR was carried out in a DNA thermal cycler (GenAmp 9700, Applid Biosystems)
using the following parameters: 35 cycles with each 30s annealing at 51°C and 1 min elongation at
72°C. In nested PCR (two step PCR) 1 µl of amplicon from the first reaction was used as template
in the second step. In nested PCR were used the primers McoF1 at final concentration of 25 pmoli/
µl. DNA was amplified using the following parameters: 35 cycles with each 30s denaturation at
94°C, 30s annealing at 54°C and 1 min elongationat 72°C. A final extension at 72°C for 10 min
was used. Amplicons from PRC (1063 bp) and from the second PCR (748 bp) were analyzed by gel
electrophoresis on 1% agarose gels and visualized after straining with ethidium bromide on a UV
transilluminator. (figure 1)
1
748 bp
2
3 4 5
6 7
8
M
1063 bp
Figure 1 – Agarose gel electrophoresis of amplicons from first step PCR (lanes 1 and 5) and lfrom the second step
nested-PCR (lanes 2 and 3).M, marker lambda Hindiii (Roche)
RESULTS
CLINICAL SIGNS
The following clinical signs were often observed: blefarospasm, photophobia and frequent
blinking, epiphora, conjunctivitis with injection of the scleral blood vessels, follicles in the third
eyelid and micopurulent exudates.
Corneal opacity always began at the margin of the cornea. In more advanced stages the process
extended ever the whole cornea, causing a blue-greyish turbidity vascularization began as a “brush
border” of vessels from the conjunctive and spread centrally into the cornea.
The mild form of the disease appeared to be self-limiting with the usual course of disease taking
about 10 days. In severe cases the disease persisted for as long as 12 weeks.
Three of the goats developed severe keratoconjunctivitis with deep ulceration of the cornea.
Most animals developed unilateral ocular disease, but bilateral involvement was seen in 30% or more
goats examinated. Some subjects were treated locally( conjunctival lower fornix) with two drops a
day for five days with ossitetracicline ( Panterramicine Pfizer)
319
There were six cases of recurrent eye disease.
Mycoplasma Conjuntivae was isolated from 21 out 48 ocular swabs; it has to be considered that
7 out 11 cases other ocular pathogens were found: Moraxella in 4 cases, Staphylococcus Aureus in 2
cases and one case unidentificated microbial flora.
CONCLUSIONS
In goats clinical signs were similar to symptoms observed in other domestic and wild species.
Mycoplasma conjunctivae seems to be the main, sometime only one, causative agent for
keratoconjunctivitis in observed cases.
The role played by Moraxella and S. aureus is not easy to understand at present .The recurrence
of the eye disease in some animals tends to indicate that little protective immunity is obtained after
Keratoconjunctivitis or that immunity is of short duration, because of the recurrent disease appeared
to be less severe , some grade of protection may have occurred. Moraxella ovis is generally regarded
as an organism without an obvious pathogenic significance in ovine IKC, often isolated from flocks
without signs of IKC; for this reason further investigations in order to know its real role in goats IKC
will be needes.
Why kids show a mild form of disease?
As reported by many authors severity and development of IKC ocular lesions are not strictly
dependent by aetiological agent, but environmental and sanitary conditions with immunitary status
of animals play a fundamental role. In fact ocular lesions of animals in which were found more than
a germ were not more serious than those in which has been isolated only Mycoplasma.
The better immunitary status of kids could explain why the ocular lesions were less serious and
more short without recurring symptoms.
About the important role of environmental conditions it has to be considered Petruzzi et al,
referred a Pinkeye case affecting with particular impact fattening calves of 4-6 months of age bred
in insufficient space.
In most cases the infection is resolved naturally; however treatment should be applied in severe
cases; preferably treatment should be specific to microrganism identified. To date, no vaccine exists
to treat pineye in goats.
A PCR reaction based on unique sequences of the 16S rRNA of M.conjunctivae was use for
the identification of the species. This method, described by Giacometti et al. 1999, has permitted to
identify M.conjunctivae isolates also from eye swabs of our flock.
REFERENCES
1) Ausbel F. et al., 1992- Current protocols in molecular biology.-Wiley interscience
2) Bass E.J. et al., 1977-Infection and Immunity-18,906-815
3) Giacometti M. et al., 1999 –J.Vet.Med.B. ,46;173-180
4) Giacometti M. et al., 2002, J. Wild Life disease
5) JonesG.E. et al., 1985 J. Comp. Path. Vol 95
6) Laak E.A. et al., 1988 the vet. Quartrly,1,73-83
7) Mayer D. et al., 1996, J.Vet. Med. , 43,155-161
8) Petruzzi V.et al., 2004 , 12° congress Femesprum –Istanbul
9) Sambrook J. et al., 1989-Cold Spring harbour Lab. NY
10) Surman P.G. 1973 , Ajebak, 51, 589-607
11) Trotter SC. Et al., 1977- Infection and Immunità,18,816-822
320
THE FIGURATIVE OUTLINE OF HORN DEFORMATION AND
HORN INJURIES OF THE FARM CATTLE TREATED IN THE WIDER
SURROUNDING COUNTRYSIDE OF ZAGREB
SLIKOVIT PRIKAZ DEFORMACIJA I OZLJEDA ROGOVA FARMSKIH
GOVEDA OBRAĐENIH U ŠIROJ OKOLICI ZAGREBA
Babić, T., Kos J., Smolec O.
Klinika za Kirurgiju, ortopediju i oftalmologiju, Veterinarskog fakulteta, sveučilišta u Zagrebu
SAŽETAK
Budući da je odrožnjavanje goveda na farmama i individualnim gospodarstvima uzelo maha u Republici
Hrvatskoj tijekom posljednjih pet godina, omjer zahvata na ženskoj teladi u odnosu na broj starijih kategorija
mliječnih krava podvrgnutih kupiranju rogova (tzv. «horn tipping») znatno se promijenio u korist odrožnjene
teladi. Stoga se sve rjeđe uočavaju deformacije i ozljede rogova odraslih goveda, te je broj intervencija na
odraslim pacijenticama znatno opao. Hrvatski stočari su pod dojmom informacija stočara iz zemalja razvijenijih
ekonomija, prvenstveno iz Europske Unije, bitno podigli svijest o nužnosti odrožnjavanja goveda uključenih u
intenzivnu proizvodnju. Zaključili smo da bi bilo vrijedno prikazati fotozapis zabilježen tijekom zahvata vezanih
za problematiku rogova u goveda, kao trajan dokument rastućoj potrebi za odrožnjavanjem u intenzivnom
uzgoju goveda, kako bi slična klinička stanja postala predmetom povijesti i u hrvatskom stočarstvu.U našem
izlaganju prikazat ćemo i opisati odabir od 24 fotografije različitih kliničkih manifestacija, vezanih uz rogove
goveda, koje su prikupljene tijekom višegodišnjeg praćenja i liječenja takovih stanja u široj okolici Zagreba.
SUMMARY
Considering that dehorning of cattle in dairy farms is more engaged in our country for the last five years,
the ratio of dehorning performed on female cattle compared with the number of dehorning of the other (older)
cathegories of the dairy cows has been changed in the favor of the young animals. Therefore the malformations
and injuries of the horns are less frequently observed. The number of interventions on the horns of fully grown
dairy cows also decreased. Croatian stockholders, under the influence of informations from their collegues from
economically better developed countries (primaryly from the EU) have significantly upraised their understanding
of importance of dehorning. We estimated that fotodocumentation of our previous experiences in solving horn
issued clinical states would be contribution in making those situations history in our stockholding presence as
same as it is in EU. In our presentation we will present and coment the choice of 25 photographies collected
during several years of our field work in the wider surrounding countryside of Zagreb.
UVOD
Odrožnjavanje je općeprihvaćen postupak u većini zemalja s razvijenim stočarstvom, budući
da smanjuje mogućnost samoozljeđivanja i međusobnog ozljeđivanja životinja u intenzivnom
uzgoju, olakšava manipulaciju stokom tijekom transporta i olakšava držanje životinja (1). Potreba za
odrožnjavanjem uočena je već krajem 19. stoljeća, a do sredine prošlog stoljeća razvijene su različite
tehnike izvođenja zahvata. Usporedo s razvojem raznolikih tehnika odrožnjavanja provedena su
istraživanja utjecaja zahvata na zdravlje pacijenata poslije operacije. U našem prošlom izlaganju (2)
utvrdili smo da bez obzira na objavljene radove koji sugeriraju nepotrebnost preoperativne anestezije
prilikom izvođenja zahvata na određenim dobnim skupinama pacjenata, naše iskustvo pokazuje da
je anestezija n. cornualis po Emersonu tijekom odrožnjavanja ne samo preporučljiva, nego i nužna.
Cilj ovog izlaganja nije bilo polemizirati s rezultatima ostalih istraživanja, već samo komentirati
321
niz patoloških stanja vezanih uz rogove, koja smo zabilježili tijekom višegodišnjeg terenskog rada.
Na taj način željeli smo sačuvati trajan dokument o kliničkim promjenama na rogovima, koja u
zemljama EU pripadaju prošlosti.
MATERIJALI I METODE
Građa koju prikazujemo prikupljena je tijekom izvođenja nastave na Ambulantnoj klinici,
veterinarskog fakulteta, sveučilišta u Zagrebu. Obilazeći individualna gospodarstva s mliječnim
govedima u intezivnom uzgoju zabilježili smo svaki slučaj malformacije ili ozljede rogova, pri tom
liječeći akutna klinička stanja ukoliko je to pojedinačni slučaj zahtijevao.
Pri tome smo skupili više stotina fotografija, od kojih smo sačinili izbor, koji vam prikazujemo.
Izbor uključuje dio pacijentica koje su odmah obrađene, kao i posljedice različitih ozljeda roga. Među
dokumentiranim stanjima nalaze se i reznolike deformacije u izrastanju roga, svježe ozljede, kao i
posljedice spontanog cjeljenja ili nestručno izvedenog odrožnjavanja. Također smo zabilježili način
na koji vlasnici mliječnih krava pokušavaju riješiti moguću problematiku međusobnog ozljeđivanja
rogatih životinja. Budući da smo u ovom segmentu našeg rada obrađivali mahom odrasla goveda,
koristili smo jednu od uobičajenih metoda odrožnjavanja za tu kategoriju životinja. Pacijentice su
sedirane intramuskularnom aplikacijom 2% Xillazina (Xillapan, vetoquinol, Švicarska) u dozi od
0,25 ml/ 100 kg tjelesne težine 15-20 minuta prije aplikacije vodiljne anestzije. Sediranoj
životinji aplicirano je 10 ml 2% lidokaina po rogu (lidokain 2%, Belupo, Koprivnica, Hrvatska)
ispod lateralnog ruba čeone kosti na sredini između lateralnog očnog ruba i baze roga. Otprilike 15
minuta nakon aplikacije vodiljne anestezije izvršili smo kupiranje roga između mjesta traumatizacije
i baze roga. Kupiranje roga («horn tipping») učinjeno je embriotomskom žičanom pilom, a na rog
je postavljen kompresijski suhi zavoj. Postoperacijski apliciran je depot – antibiotik i TAT serum.
Prilikom obrade slučaja avulzije dijela čeone kosti ispod baze roga, učinili smo eliptičan rez oko baze
roga te u cjelosti ekstirpirali odlomljenu kost i dio čeone kosti.
Fotografije su snimljene kamerom Olimpus – mju, te skenirane i digitalno obrađene za
prezentaciju.
REZULTATI I DISKUSIJA
Tijekom našeg rada izabrano je 25 fotografija najupečatljivijih malformacija u rastu rožine roga
i najdramatičnije ozljede na rogovima farmskih goveda. Budući da je trend odrožnjavanja ženske
teladi u Republici Hrvatskoj u porastu (barem u odnosu na naša prošla razmatranja) (2,3) ovakvih
će promjena biti sve manje. S obzirom da odrožnjavanje još uvijek nije postalo standard u našoj
zemlji, a u široj regiji vjerojatno još dugo neće postati, mislili smo da bi bilo korisno prikupiti
fotodokumentaciju koja će govoriti u prilog ovom zahvatu.
Prikazujući odabir najdrastičnijih problema koji prozlaze zbog držanja rogate stoke u
poluzatvorenom držanju mliječnih goveda (tzv. «lauf štale») željeli smo argumentiraqti opravdanost
ovog zahvata, kao bitnog čimbenika u smanjenju mogućih šteta i ozljeda u sustavu intenzivnog
uzgoja goveda.
322
slika 1. (fig. 5) – kupiranje deformiranog roga
slika 2. (fig. 13) – anestezija n. cornualis prije kupiranja deformiranog roga
slika 4. (fig. 24) – eliptičan rez oko baze roga na
kojem je nastupila avulzija processus cornualis od
čeone kosti prije godinu dana
slika 3. (fig. 20) – “izuvanje rožine” uz frakturu processus cornualis čeone kosti
LITERATURA
1. Agricultural animal Care guide. 1988. Guide foe the Care and Use of Agricultural Animals In agricultural
Recearch and Teaching, ASAS/ADSA Association Headquarters, Champaign, IL
2. Kos J., T. Babić, A. Brkić and D.Capak: Our Experiences in Dehorning of the Cattle. III Middle - European
Congress for Buiatrics, congress reports, 2001. pp. 168 – 171
3. Babić T., J. Kos, D. Vnuk, M. Kreszinger, A. Brkić, D. Capak, O. Smolec: The importance of continuing
education in the advancing of dehorning cattle in croatia. Monograph of lectures and the papers presented
on VI Middle-European Buiatrics Congres in Cracow 2005. 511- 514
323
324
PENALTIES FOR BREACH OF EC FOOD LAW IN ITALY
Kazne za kršenje EC zakona o hrani u Italiji
Morelli C.1, Cubeddu M.G.2, Calabrò G. 3, Russo M.1, Di Pietro C.1, Passantino A.4
1
Research Doctorate in “EC countries’ norms concerning animal welfare and protection” - University of
Messina;
Istituto di Patologia Speciale e Clinica Medica, University of Sassari, Italy;
2
Department RIAM, Faculty of Economy, University of Messina - Piazza Pugliatti 1 98124 Messina, (Italy);
3
Department of Veterinary Public Heath, University of Messina - Polo Universitario Annunziata. 98168
Messina, (Italy)
4
Summary
In order to ensure a high level of protection of human life and health and consequently the safety of
food, the Community legislator has established with the EC regulation 178/2002 the general principles and
requirements of food law. Member States will also lay down the rules on measures and penalties applicable to
infringements of food law. In Italy, a penalty system (Legislative Decree no. 190, 5th April, 2006) for the breach
of some of the provisions of EC regulation 178/02 has been established in order to facilitate accountability and
enforcement. The Italian legislative system imposes monetary penalties for the food business operators who do
not fulfil the obligations of articles 18-20 of EC regulation 178/2002. The new penalties apply only if the act
does not constitute an offence. In case law, this offence exception applies when the act is the same as the one
which is governed by criminal law. On the basis of these considerations, the Authors carried out an analysis
about the obligations and responsibilities of food business operator and on penalties.
Sažetak:
Kako bi osigurao visoku razinu zaštite ljudskog zdravlja i posljedično sigurnosti kakvoće hrane zakonodavac
Europske unije donio je EC-propis 178/2002. kojim se osiguravaju opća načela i zahtjevi zakona o hrani.
Države članice su usvojile, pravila, ciljeve i kazne za prkršitelje zakona o hrani. U Italiji je ustanovljen sustav
kažnjavanja ( Zakonska odredba br. 190,5. Travnja, 2006. za prekršitelje odredbi EU regulative 170/02 kako bi
se olakšalo provođenje zakona. Talijanski zakonski sustav nameće novčane kazne za proizvođeče i distributere
hrane koji ne ispunjavaju članke 18-20 propisa EU 178/2002. Nove kazne se primjenjuju samo ukoliko čin ne
sačinjava prekršaj. U sudskom slučaju se izuzeće prekršaja se primjenjuje ukoliko je čin kažnjivo djelo.
Introduzione:
Con il regolamento (CE) n. 178/2002, il legislatore comunitario, tenuto conto della necessità
di garantire la sicurezza degli alimenti, ha stabilito i principi e i requisiti generali della legislazione
alimentare, rimettendo però agli Stati membri il compito di determinare le sanzioni da applicare in
caso di violazione della normativa.
Il legislatore italiano ha ottemperato a tale dovere con il Decreto Legislativo 5 aprile 2006, n. 190
che definisce la disciplina sanzionatoria da applicare in presenza di violazioni degli obblighi previsti
dalla normativa comunitaria agli artt. 18,19 e 20.
Destinatari degli obblighi e, di conseguenza, delle relative sanzioni, sono gli operatori del settore
alimentare (OSA) e dei mangimi (OSM).
In particolare, il Decreto Legislativo 190/2006 prevede che gli operatori del settore alimentare
che non rispettano gli adempimenti relativi alla rintracciabilità degli alimenti, previsti dagli artt. 18XVI Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum), Zadar, Croatia, 2008
325
21 del Regolamento CE 178/2002, siano puniti con sanzioni pecuniarie amministrative di diversa
entità, a seconda della fattispecie e della gravità dell’infrazione, salvo che il fatto costituisca reato.
Gli autori effettuano una disamina degli obblighi che gravano sugli operatori del settore e le
relative sanzioni.
Normativa
L’art. 2 del D.Lvo n. 190/2006 fa riferimento alla sanzione che viene comminata laddove gli
operatori del settore alimentare e dei mangimi non ottemperino agli obblighi previsti dall’art.18 del
regolamento CE n.178/2002.
L’art.18, prevede al I comma, l’obbligo di garantire la rintracciabilità “in tutte le fasi della
produzione, della trasformazione e della distribuzione, degli alimenti, dei mangimi, degli animali
destinati alla produzione alimentare e di qualsiasi altra sostanza destinata o atta a entrare a far
parte di un alimento o di un mangime”.
La “rintracciabilità” è lo strumento attraverso il quale il legislatore comunitario si propone
di raggiungere l’obiettivo di permettere alle Autorità di controllo la possibilità di avere tutte
le informazioni necessarie in presenza di un eventuale rischio sanitario, al fine di poter attuare
correttamente le procedure di ritiro ed eventualmente il richiamo del prodotto alimentare o del
mangime, laddove non fossero state già poste in essere dagli operatori, per quanto di competenza.
I commi successivi dell’art.18 puntualizzano gli adempimenti che gli operatori del settore
alimentare e dei mangimi devono attuare per facilitare il raggiungimento dell’obiettivo sopra
illustrato.
In primis, si richiede che gli OSA e OSM siano in grado di “individuare chi abbia fornito loro
un alimento, un mangime, un animale destinato alla produzione alimentare o qualsiasi sostanza
destinata o atta a entrare a far parte di un alimento o di un mangime”. Tale disposizione sta ad
indicare che l’OSA o l’OSM, nel momento in cui riceve un prodotto, sia esso alimento, mangime,
animale o sostanza destinata all’alimentazione, deve essere in grado di indicare il soggetto fornitore
(sia esso singolo che impresa). “A tal fine detti operatori devono disporre di sistemi e di procedure
che consentano di mettere a disposizione delle autorità competenti, che le richiedano, le informazioni
al riguardo”. Gli operatori dovrebbero tenere, dunque, adeguati registri dei fornitori di materie prime
e di ingredienti in modo da consentire di identificare la fonte di un problema. Tali informazioni,
nonostante la lacuna normativa, dovranno essere conservate per un congruo periodo di tempo.
Una politica alimentare efficace richiede la rintracciabilità dell’intero percorso dei mangimi e
degli alimenti nonché dei loro ingredienti; pertanto, l’OSA o l’OSM nel momento in cui cede i propri
prodotti, deve essere in grado di indicare esclusivamente le imprese a cui ha fornito i prodotti.
A tal proposito il III comma dell’art.18 stabilisce che: “Gli operatori del settore alimentare e dei
mangimi devono disporre di sistemi e procedure per individuare le imprese alle quali hanno fornito
i propri prodotti. Le informazioni al riguardo sono messe a disposizione delle autorità competenti
che le richiedano”.
Dalla normativa risulta evidente la volontà del legislatore comunitario di obbligare gli OSA e gli
OSM di garantire la rintracciabilità dei prodotti destinati al consumo alimentare sia a monte che a
valle, pur essendo evidente che per l’ultimo anello della filiera vale solo l’obbligo della rintracciabilità
del prodotto a monte ma non a valle.
In caso di inosservanza di tali obblighi il D.L.vo 190/2006 prevede una sanzione amministrativa
pecuniaria da € 750,00 a € 4.500,00.
326
L’art. 3 del decreto disciplina le sanzioni da applicarsi agli OSA e agli OSM nel caso in cui,
avendo fondato dubbio o, addirittura, la certezza che un prodotto alimentare o un mangime da loro
importato, prodotto o commercializzato, non risponda ai requisiti di sicurezza, secondo i requisiti
previsti dagli artt. 14 e 15 del Regolamento (CE) n. 178/200, non attivino le procedure per il ritiro
degli stessi.
Infatti, laddove dovesse verificarsi tale ipotesi l’OSA o l’OSM, per agire correttamente e non
essere passibile di sanzione dovrebbe identificare il prodotto o mangime, identificare l’ambito di
commercializzazione (nazionale, comunitario e/o verso Paesi Terzi) e provvedere all’immediato
ritiro del prodotto.
La sanzione amministrativa pecuniaria prevista in caso di violazione di tali obblighi va da
3.000,00 euro a 18.000,00 euro.
È previsto, inoltre, l’obbligo per gli OSA e gli OSM di informare immediatamente le autorità
competenti territorialmente (AA.SS.LL.) dell’avvio delle procedure di ritiro e le motivazioni che
hanno determinato tale evenienza, pena l’applicazione di una sanzione amministrativa pecuniaria il
cui ammontare verrà determinato, tenuto conto delle circostanze e della gravitò del caso, tra i 500.00
euro e i 3.000,00 euro.
L’art. 3 del D.L.vo 190/2006 disciplina un ulteriore obbligo posto a carico degli OSA e degli
OSM, la cui inadempienza è punita con una sanzione amministrativa pecuniaria il cui valore è
ricompresso tra i 2.000,00 euro e i 12.000,00 euro, è quello di fornire alle autorità competenti tutte le
notizie utili e una piena collaborazione.
A garanzia della tutela degli interessi dei consumatori è previsto, sempre a carico degli OSA e
degli OSM, un obbligo di informazione nei confronti dei consumatori; l’informazione dovrà essere
efficace, accurata, tempestiva e dovrà indicare i motivi che hanno reso necessario il ritiro del prodotto
dal mercato. In caso di mancata ottemperanza di tale obbligo, l’art. 4 del D.L.vo 190/06 prevede
l’applicabilità di una sanzione amministrativa pecuniaria da 2.000,00 euro a 12.000,00 euro.
L’art. 5 prevede invece l’applicazione di una sanzione pecuniaria amministrativa (da 500,00
euro a 3.000,00 euro) nei confronti degli operatori della vendita al dettaglio o della distribuzione
che non incidono sulla sicurezza o integrità del prodotto (attraverso una manipolazione diretta, quale
ad esempio lo sconfezionamento, riconfezionamento, porzionatura o attraverso l’apposizione di un
etichetta sul prodotto), nel caso in cui, venuti a conoscenza della non conformità dei prodotti ai
requisiti di sicurezza, non avviano le procedure per il ritiro.
L’art. 6, invece, si rivolge solo agli OSM statuendo che: “Fatte salve le eventuali diverse
disposizioni impartite dall’autorità competente, gli operatori del settore dei mangimi i quali, dopo il
ritiro dal mercato di mangime non conforme ai requisiti di sicurezza, non provvedono alla distruzione
della partita, del lotto o della consegna di tale mangime, sono soggetti al pagamento di una sanzione
amministrativa pecuniaria da cinquecento euro a tremila euro”.
Il decreto prevede, inoltre, nell’ipotesi di reiterazione delle violazioni esaminate, in aggiunta alla
sanzione amministrativa pecuniaria, la sospensione del provvedimento di autorizzazione all’esercizio
dell’attività, causa dell’illecito, per un periodo non inferiore ai 10 giorni e non superiore ai 20.
L’accertamento delle violazione e l’irrogazione delle relativa sanzioni è rimesso, nel rispetto
delle proprie competenze, alle regioni e province autonome.
La normativa considera, infine, il rinvio, per quanto non espressamente disciplinato, alle
disposizioni della legge 24 novembre 1981, n. 689 e successive modificazioni, in quanto
compatibili.
327
Conclusioni
L’impianto sanzionatorio italiano si presenta chiaro, preciso e puntuale.
È, pertanto, auspicabile che gli organi a cui è stato affidato il compito di accertare le violazioni e,
conseguentemente, irrogare le relative sanzioni assicurino una corretta applicazione della normativa
anche attraverso l’espletamento di controlli sui sistemi utilizzati dagli OSA e dagli OSM per garantire
la rintracciabilità dei prodotti zootecnici.
Bibliografia:
Regolamento (CE) N. 178/2002 del Parlamento Europeo e del Consiglio del 28 gennaio 2002 che stabilisce i
principi e i requisiti generali della legislazione alimentare, istituisce l’Autorità Europea per la sicurezza
Alimentare e fissa procedure nel campo della sicurezza alimentare. Pubblicato sulla Gazzetta Ufficiale delle
Comunità Europee L 31 del 1.2.2002, pp. 1-24.
Accordo 28 luglio 2005 - Accordo, ai sensi dell’articolo 4 del decreto legislativo 28 agosto 1997, n. 281, tra il
Ministro della Salute e i Presidenti delle Regioni e delle Province autonome sul documento recante «Linee
guida ai fini della rintracciabilità degli alimenti e dei mangimi per fini di sanità pubblica», volto a favorire
l’attuazione del regolamento (CE) n. 178 del 2002 del Parlamento e del Consiglio del 28 gennaio 2002.
(Rep. atti n. 2334). Pubblicato in G.U. n. 294 del 19.12.2005.
Decreto Legislativo 5 aprile 2006, n. 190. “Disciplina sanzionatoria per le violazioni del regolamento (CE) n.
178/2002 che stabilisce i principi e i requisiti generali della legislazione alimentare, istituisce l’Autorità
europea per la sicurezza alimentare e fissa procedure nel settore della sicurezza alimentare”. Pubblicato in
G.U. n. n.118 del 23 maggio 2006.
Legge 24 novembre 1981, n. 689 Modifiche al sistema penale (Testo coordinato ed aggiornato con le modifiche
introdotte dalla Legge 23 dicembre 2000, n. 388, dal D.lgs. 11 aprile 2002, n. 61, dal D.P.R. 14 novembre
2002, n. 313, dalla Legge 12 giugno 2003, n. 134, dal D.lgs. 30 giugno 2003, n. 196, dal D.L. 30 dicembre
2005, n. 272 e dal D.lgs. 2 febbraio 2006, n. 40).
www.fao.org
www.europa.eu.int/comm/food
www.efsa.eu.int
328
Penal and Civil Cases in the matter of cattle: forensic
observations - Il contenzioso penale e civile in materia
di bovini: osservazioni medico-legali
KRIVIČNE I GRAĐANSKE PARNICE S PREDMETOM GOVEDA:
SUDSKI OSVRTI
Cubeddu G.M.,*Lai M.G., Coda S., **Fois G.M.
Istituto di Clinica Medica veterinaria-Università di Sassari.
*Veterinario libero professionista.
**Avvocato.
Summary: the authors make a set of forensic observation on the nth legal case regarding animals, in
particular cattle (bull). They take as a starting point the civil and criminal cases regarding a lawsuit for the
grant of the right of property of a bull, ended after nine long years, when both the plaintif and the defendant,
besides the animal, that now it would have had a lawful owner and its own shelter, died. The criminal trial for
the presumed theft of the animal purpose of the case, the withdrawal of the action from the plaintif, let the
two civil judges decided on the right of property of the bull, the latter in November 2007 granted the right of
property of the animal to one of the involved parties, without knowing that the law of nature had already put and
end to the judicial case. In the case in point, the authors weigh up the difficulties of interpretation of the rules
on the guarantee for the buying and selling of animals, on the damages caused by animals, on the aspects of a
sure identification of the cattle, besides the modern rules about the animal wellbeing. They refer to the articles
of the Civil and Criminal Code enforced to the case, theme of the discussion, making a careful examination on
every controversial aspect of the cases. In the end the authors, trying to avoid the slowness of justice in the cases
regarding animals, propose some modifications to the present rules, that in some case, run the risk of saying that
who breaks the principles of legitimacy is right. In the end, they address an invitation to the legislator to resolve
these problems, both revising the competence of the justice of the peace and finally, foreseeing to issue the so
many hoped for the ‘Special Rules’ on the subject of guarantee for the animals.
Sažetak
Autori su predstavili niz sudskih osvrta u parnicama sa predmetom životinja, posebice goveda (bikovi).
Kao polaznu točku uzimaju građansku i krivičnu parnicu u kojima se tražilo pravo vlasništva nad bikom, što je
završilo nakon 9 godina kad su obojica, i tuženik i tužitelj, osim životinje, koja bi danas mogla imati zakonski
određenog vlasnika i štalu, umrli. Kriminalistički sudski proces glede pretpostavljene krađe životinje, ostavilo
je sudcima odluku o pravu vlasnosti nad bikom, te su kasnije, u studeom 2007. dodijelili pravo vlasnosti nad
životinjom jednoj od uključenih strana, bez da su znali da je zakon prirode već donio svoju presudu u tom
sporu. U konkretnom slučaju autori procjenjuju problematiku interpretacije pravila garancija pri kupnji i prodaji
životinja, štetama uzrokovanih od strane životinja, probleme pouzdane identifikacije stoke, te napose suvremena
pravila o dobrobiti životinja. Referiraju se na članke građanskog i krivičnog zakona vezanih za slučaj, temu
diskusije te iznoseći pažljiv pregled svih kontroverzija slučaja. Na koncu autori, pokušavajući izbjeći sporost
pravde u sporovima sa životinjama, predlažu neke izmjene važećih pravila, koja u nekim slučajevima staju na
stranu onoga koji krši legalističke principe. Osim toga, upućuju poziv zakonodavcu da riješi te probleme, kako
revizijom ovlasti prava na mir te predviđaju izdavanje dugo očekivanih posebnih pravila glede garancija za
životinje.
329
Riassunto
Gli autori compiono una serie di osservazioni medico-legali sull’ennesimo episodio di contenzioso
giuridico riguardante animali, in particolare bovini ( toro ). Prendono lo spunto da una causa civile
e penale riguardante una lite per l’assegnazione del diritto di proprietà di un toro, conclusasi dopo
nove lunghi anni, quando, sia l’attore, sia il convenuto, oltre all’animale, che ora avrebbe avuto un
legittimo proprietario ed un ricovero tutto suo, sono venuti a morte. Il processo penale per presunto
furto dell’animale in oggetto, la remissione della querela da parte dell’attore, lasciavano a decidere
sulla proprietà del toro due giudici civili, il secondo dei quali, nel novembre del 2007, assegnava la
proprietà dell’animale ad uno dei contendenti, senza sapere che la legge della natura aveva già posto
fine alla vicenda giudiziaria. Nella fattispecie, gli autori valutano le difficoltà interpretative delle
norme sulla garanzia per la compravendita degli animali, sui danni cagionati da animali, sugli aspetti
dell’identificazione certa dei bovini, oltre alle moderne normative in tema di benessere animale. Fanno
riferimento agli articoli del Codice Civile e del Codice Penale in applicazione alla causa in oggetto,
facendo una disamina su tutti gli aspetti controversi della vicenda. Infine gli autori, nel tentativo
di evitare lungaggini della giustizia nelle cause riguardanti animali, propongono alcune modifiche
alle leggi attuali, che in qualche caso rischiano di dar ragione a chi viola i principi di legittimità.
Rivolgono da ultimo un invito al legislatore per risolvere queste problematiche, sia rivedendo le
competenze dei giudici di pace, sia prevedendo di emanare, finalmente, le tanto auspicate “Leggi
Speciali”in tema di garanzia per gli animali.
Introduzione
L’amministrazione della giustizia in Italia sempre più spesso assume connotazioni particolarmente
delicate, sia sotto il profilo della ricerca di una giusta sentenza, ma soprattutto sotto l’aspetto dei
tempi lunghissimi di risoluzione dei vari tipi di contenzioso. In particolare quando ci si trova, sempre
più frequentemente, di fronte a processi civili e penali che riguardano gli animali, si assiste ad
un continuo e reiterato andirivieni di giudici, consulenti del tribunale e di parte, a frequenti rinvii
del processo per assenza del giudice ( nel frattempo sostituito ), o per richiesta degli avvocati, i
quali, ad arte, chiedono l’acquisizione di ulteriori elementi di valutazione, sino ad arrivare a casi
limite di processi per la stima di danni da e/o ad animali durati la bellezza di trentaquattro anni. In
Sardegna il comparto zootecnico rappresenta una fetta importante dell’economia regionale, e sempre
più frequentemente veniamo chiamati a dirimere contenziosi riguardanti danni da cani randagi, da
intossicazioni alimentari da mangime, da calamità naturali, da incidenti stradali che coinvolgono
animali, da richieste di risoluzioni contrattuali per vizi redibitori e/o mancanza di qualità etc.
Materiale e metodi
La vicenda giudiziaria ha inizio nel 1998, quando l’attore, il quale rivendica da subito la proprietà
del vitello di cui è causa, denuncia ai carabinieri il furto di due vitelli con segni padronali U.B. che
rappresentavano i propri nome e cognome. Qualche tempo dopo uno dei due vitelli fa ritorno ( da
solo !) in azienda, mentre l’altro viene reperito in un terreno di un comune confinante, non distante
dalla zona delle smarrimento. L’attore, credendo di riconoscere sull’animale i segni padronali,
ne rivendica la proprietà, e il torello inizialmente viene preso in consegna dalle forze dell’ordine.
Seguirono, nell’ordine, due sequestri e altrettanti provvedimenti di dissequestro ed un processo penale
per presunto furto. Da quel momento si alternano attestazioni di proprietà, si attribuisce al vitello un
codice comunale e una data di nascita (gennaio 1997 ), e l’animale viene sottoposto a visita da parte
di tre veterinari. Il primo ( A.S.L. ) non nota sull’animale segni particolari, il secondo rileva alcuni
330
segni di abrasione sulla groppa, oltre tracce sulla groppa di marchio a fuoco, peraltro imperfetto e
indecifrabile. In sede di processo penale, a seguito della denunzia per furto, il terzo veterinario (
CTU ), rileva nella coscia Sn. dell’animale un marchio a fuoco secondo lui sovrapponibile ad una U,
ed una serie di cicatrici che potevano essere riconducibili ad una B. Nel frattempo, durante tutte le
indagini, il vitello subiva costanti e ripetute tricotomie, nella ricerca di un qualche segno che potesse
fornire utili indicazioni al riconoscimento della proprietà. Un anno e mezzo più tardi, nel corso del
procedimento penale, compariva anche un investigatore privato, il quale esternava ai giudici alcuni
dubbi su una presunta compravendita dell’animale da parte del convenuto; lo Sherlock Holmes della
situazione non portava alcun contributo utile alla causa, lasciando ancora una volta le parti e i giudici
nel più profondo dubbio. Le spese giudiziarie sempre più crescenti, oltre ad estenuanti comparizioni
in tribunale, l’intervento di terzi, facevano sì che si raggiungesse un accordo in sede penale, con
la remissione della querela. A quel punto l’attore, stanco di perseguire il convenuto si rivolgeva al
tribunale civile rivendicando comunque la proprietà del vitello ormai diventato adulto. Dopo circa
quattro anni dall’inizio della vicenda si decideva, con l’accordo delle parti, di macellare l’animale,
frattanto diventato pericoloso, ed il ricavato veniva messo a disposizione dell’autorità giudiziaria. Il
tutto anche perché l’unica prova che avrebbe potuto consentire l’effettivo riconoscimento dell’animale
(DNA), non si era potuta effettuare in quanto i supposti genitori del vitello erano stati a suo tempo
regolarmente macellati. Nel frattempo, sempre in vigenza della causa civile, venivano a morte, nel
2004, l’attore della causa e nel 2005 il convenuto. Ma la giustizia decideva comunque di chiudere
ugualmente il caso con la sentenza depositata in cancelleria nel 2007, a firma di un altro giudice, che
assegnava la proprietà dell’animale all’attore.
Osservazioni personali
I fatti suesposti offrono lo spunto per fare alcune considerazioni critiche, peraltro già espresse in
altri lavori precedenti, sulle evidenti lacune legislative in tema di contenziosi riguardanti gli animali.
Il caso descritto rappresenta la punta dell’iceberg sulla lungaggine della giustizia nelle cause civili
e penali riguardanti animali. Paradossalmente questi impedimenti burocratici favoriscono spesso
chi, nelle cause come questa in oggetto, ignora e/o viola i principi di equità. Per questa ragione
pratica, nelle fattispecie giuridiche come queste ( compravendita, stima di danni da e/o ad animali,
certificazioni di proprietà, garanzia per vizi ), sarebbe necessario rivedere in tempi brevi alcuni dei
punti nodali del Codice Civile, nel IV libro delle obbligazioni, soprattutto per offrire una maggiore
tutela delle parti che siano state danneggiate. La vicenda, tra l’altro, si sarebbe potuta complicare
ulteriormente attraverso risvolti giuridici quali la vendita di animale altrui e/o i danni provocati
dall’animale ( pericoloso ), non potendosi peraltro, in questo caso, attribuire le responsabilità di cui
all’art. 2052 del Codice Civile ( danno cagionato da animali ). Si sperava che l’avvento dei giudici
di pace ( Legge n. 374 del 3/11/91 e successive modifiche ), i quali hanno iniziato la loro attività dal
1/5/1995, avrebbe portato sostanziali cambiamenti per apportare i giusti correttivi alle problematiche
di questo tipo. Ma già un primo ostacolo si è interposto al cammino della giustizia: i giudici di pace
hanno competenza per cifre non superiori ai cinque milioni di vecchie lire, con rare eccezioni per
l’incidentistica stradale e pratiche condominiali. Ma nelle cause riguardanti i nostri animali, nella
maggior parte dei casi, si raggiungono cifre nettamente superiori a quelle di competenza degli stessi
giudici di pace. Basti pensare ai danni da mangime in grossi allevamenti ovini, a compravendite
di equini, arieti e/o tori di pregio e di alta genealogia. A tutt’oggi, la lungaggine delle cause non
favorisce senz’altro la parte danneggiata, la quale si trova in posizione di netto svantaggio, costretta
ad aspettare anni per vedere riconosciuti i propri diritti, con tutti gli oneri e i doveri nei confronti
degli animali di cui è causa, soprattutto oggi, con le normative in materia di benessere animale, che
331
pongono l’animale stesso, in quanto essere senziente, al centro dell’attenzione e delle cure amorevoli
da parte del proprietario.
Conclusioni
Nel tentativo di dare una risposta alla migliore amministrazione della giustizia nelle cause
riguardanti animali, proponiamo alcune brevi riflessioni utili alla risoluzione del problema. Intanto è
auspicabile che venga attuato quanto prima in Italia il “Progetto Idea” ( identification elettronique
des animaux ), avviato dalla Commissione Europea nel 1998, attraverso il quale, con l’applicazione
di un trasponder endoruminale nei bovini, si garantirebbe, oltre alla tracciabilità dei prodotti , anche
e soprattutto la legittima appartenenza dell’animale; questo cancellerebbe immediatamente qualsiasi
dubbio sull’identificazione del proprietario. In alternativa, il legislatore dovrebbe prevedere un
aumento delle competenze in denaro per i giudici di pace nelle cause sugli animali: in questo modo si
raggiungerebbe una maggiore rapidità nella risoluzione delle cosiddette “questioni civili” riguardanti
animali, offrendo peraltro in tempi brevi il giusto ristoro economico all’effettiva parte danneggiata.
Ma non solo attraverso l’aumento di competenze per i giudici di pace si potrebbe arrivare rapidamente
alla soluzione di questi contenziosi. L’art. 1496 del Codice Civile, trattando della garanzia nella
compravendita di animali, così recita: nella vendita di animali la garanzia per i vizi è regolata
dalle leggi speciali o, in mancanza, dagli usi locali. Se neppure questi dispongono, si osservano
le norme che precedono. in forza a quest’articolo, ove la garanzia è regolata da Leggi speciali, che
a tutt’oggi non esistono, si può senz’altro prevedere un arbitrato rituale, con la costituzione di un
collegio di 3-5 arbitri, che in tempi brevissimi porterebbe facilmente alla risoluzione di problematiche
di questo tipo. Questa soluzione, applicata per estensione a tutti i contenziosi riguardanti animali,
potrebbe finalmente assumere il carattere di legge speciale, così da costituire una rapida soluzione
alle controversie in oggetto, oggi sempre più numerose. Auspichiamo infine che, prendendo lo spunto
da quello che nei processi penali rappresenta l’incidente probatorio, si possa in tempi brevi rendere
obbligatorio, in cause civili riguardanti animali, l’accertamento tecnico preventivo, già previsto
dall’art. 696 C.P.C. Questo è uno strumento alternativo di risoluzione delle controversie, con finalità
strettamente conciliativa, non assimilabile “quoad effectum” alla relazione del CTU, da espletare nel
corso del giudizio di cognizione. Con questi correttivi riteniamo che si potrebbero colmare quelle
gravi lacune legislative che, in ultima analisi, si ripercuotono in maniera determinante anche sul
benessere degli animali.
Bibliografia
1) Canuto e Tovo: Medicina legale 1970; 2) Cinotti S., Peccolo.G.:Protezione animale-Utet-1997; 3) Codice
Civile – Libro IV delle obbligazioni; 4) Codice Penale: articoli 638 e 727, legge 189/2004; 5) Cubeddu G.M.,
Pintori G., Bassu G., Maninchedda G.-Differenti valutazioni sul danno e risarcimento in ovini di razza sarda.
Atti del VIII Congresso SIPAOC., Sezione Patologia, pag. 397, 1988; 6) Gasparini U.: Appunti di Medicina
Legale Veterinaria, Legislazione Veterinaria e Deontologia-Ed. Esculapio 1983; 7) Ghisleni P., Ghisleni G.:
Trattato di Medicina Veterinaria Legale. UTET, Torino 1925; Mainardi, D., Papalia, S., Etologia e protezione
animale, Editoriale grasso (1991); 8) Nisini: Comp. Infort. La tribuna 1978 tratato di diritto privato; 9) Pezza
F.: Diritto e Legislazione Veterinaria-Utet-1997; 11) Ruffo G.: Legislazione Veterinaria-Poletto Editore-luglio
2003; 12) Torrente A.: Manuale di Diritto Privato. Giuffrè, Milano 1981.
332
EPIDEMIOLOGICAL DATA ON INFECTIOUS KERATOCONJUNTIVITIS
(IKC) OF SHEEP AND GOAT IN SICILY
EPIDEMIOLOški pokazatelji zaraznog
KERATOkonjUNTIVITISa (IKC) ovaca i koza na Siciliji
Pugliese A., Tortorella A., Di Marco V.*, Di Pietro S., Russo M.*, Gruppillo A.,
Scardillo A., Niutta P.P.
Departement of Veterinary Pubblic Health – University of Messina
Zooprophilactic Institute of Barcellona P.d.G. (Messina)- Italy
Abstract
The authors in this study show the results about the epidemiological diffusion of the sheep and goat
infectious keratoconjuntivitis (IK) on Sicilian territory. The animals were subjected at clinical evaluations and
serological tests were performed, applying the cytological and microbiological analysis on conjunctivae tissues.
Out of 7664 sheep and goat examined, belonging to 32 Sicilian breeding, 539 subjects showed ocular lesions
at different stages of evolution, related to the disease. The various animals showed corneal lesions similar in
clinical aspect in despite of the variety of the isolated microrganisms. The Authors report the results of the
performed clinical, microbiological and serological tests. Some microrganisms, such as Mycoplasma agalactiae
and Moraxella sub-genus branhamella ovis, were isolated as aetiological agents of the keratoconjuntivitis, while
other microrganisms (Rickettsiae and Chlamydiae) were absent.
Abstract
U ovoj studiji autori analiziraju rezultate epidemiološke rasprostranjenosti zaraznog keratokonjuktivitisa
u ovaca i koza na Siciliji. Kod navedenih životinja izvršena su klinička i serološka istraživanja, te je učinjena
citološka i mikrobiološka analiza tkiva očne spojnice. Pregledano je 7664 ovaca i koza koje iz 32 uzgoja. U
539 životinja nađeni su različiti stupnjevi oštećenja očiju koji se mogu povezati sa tom bolešću. Oštećenja
rožnice uočena kod različitih životinja ovisila su o vrsti izoloiranog mikroorganizma. Tako su kao uzročnici
keratokonjuktivitisa izolirani mikroorganizmi kao što su Mycoplasma agalactiae i Moraxella sub-genus
branhamella ovis, dok Rickettsiae i Chlamydiae nisu nađene.
INTRODUCTION
Infectious keratoconjunctivitis (IKC) is a highly contagious ocular inflammation frequently
reported in domestic sheep and goats; it is reported also in bovine and in wild Caprinae. This disease
is caused by various microorganisms (11;1;8;), which establish ocular inflammation.
This pathology is widespread into the ovine and caprine farms on the Sicilian territory and it
has a marked impact on the same farms, determining much economic losses. So, we considered
important to perform a retrospective study on the incidence of the IKC in Sicily, in order to identify
the major etiological agents and to evaluate the epidemiological diffusion of this pathology among
the Sicilian farms.
Infectious keratoconjunctivitis in small ruminants is included into the “contagious Agalactia
complex”: a pathology that determine mastitis, arthritis and ocular involvement.
The ocular lesions are characterized by different stages on the basis of severity:
333
First stage, 1-4 days: acute conjunctivitis, with hyperaemia of the eyelids and the bulbar
conjunctiva, ocular lacrimation, blepharospasm and photophobia;
Second stage, 4-12 days: diffuse corneal oedema, improvement of the conjunctiva symptoms;
Third stage, 12-25 days: formation of corneal ulceration with hypopion and total loss of visual
function;
Fourth stage, after 25th days (improvement phase): spontaneously regression of the ocular lesions
without therapy until to the return of the visual capacity, if an irreversible damage there wasn’t.
Sometimes the ocular lesions can be very serious, such as corneal erosions, deep ulcers and
panophthalmitis.
In recent years there has been increasing recognition of the prevalence and importance of disease
syndromes of multifactor aetiology. It is often difficult to elucidate the role of each of the infecting
microorganisms, especially because the relative importance of each may vary in different cases.
Synergism between Mycoplasma ssp and other bacteria or viruses in ruminants has been frequently
described. However, the organisms may act sequentially rather than in concert and may not be present
in the lesion or the affected organ at the same time. In sheep and goats the role of Chlamydia spp. as
a major etiological agent in IKC is well established and Mycoplasma spp. And Rickettsia spp. is also
considered a primary pathogen in establishing eye inflammation (3;2;15;4;).
From the corneal sac of sick or clinically healthy animals various microorganisms also be
isolated as Pasteurella spp, Achromobacter spp., Acinetobacter spp., Bacillus spp., Staphylococcus
spp., Streptococcus spp., Branhamella spp. (8).
Among other microorganisms, usually Branhamella ovis (9;14) or Moraxella ovis are frequently
isolated on healthy animals (12) and some Authors (8;7) confirm the pathogen role of Branhamella
ovis in small ruminants infectious keratoconjunctivitis.
The study is performed on 32 farms of sheep and goats on the province of Palermo, Caltanissetta,
Trapani, Messina e Catania.
N° 7674 free reared animals were visited, which presented keratoconjunctivitis at different
stages of evolution. Various serological, microbiological and cytological test were performed in
order to obtain a diagnosis and to relate the symptomatology to the presence of a specific aetiological
agent.
On all animals that showed ocular symptoms referred to the disease and on 5% of healthy animals
the tests were performed.
The serological test to identify the anti- Mycoplasma agalactiae antibodies by ELISA test and
the anti- Chlamydia antibodies by Complement Fixation were performed, considering positives the
results superior to a dilution of 1:16.
The affected animals were submitted to ocular swabs and conjunctival scrubs, after the instillation
of hydrochloride ossibuprocaine in the conjunctival sac.
The collected materials were inoculated into Agar blood and McConkeey’s media. The cultures
were propagated at 37°C and examined after 24, 48, 72 hours. The collected materials were inoculated
also into PPLO medium, with addition of penicillin, thallium acetate and equine serum 20%. The
media, were incubated at 37°C with CO2 and examined after 48 hours and daily for 7-10 days. The
334
conjunctival scrubs were coloured with Gram coloration, with May-Grunwlad Giemsa to finding
Mycoplasma spp. and with Gimenez coloration to finding Rickettsia spp. or Chlamidia spp.
The identification of mycoplasma isolates was made by Polymerase Chain Reaction (PCR) for
Mycoplasma agalactiae and Mycoplasma mycoides sub. mycoides LC (10).
RESULTS
The controls, performed on 7674 animals belonging to 20 ovine and 12 caprine farms, showed
on n° 539 animals the presence of ocular lesions, as keratoconjunctivitis at different stages.
Totally, on 20 examined ovine farms eleven were positive to Mycoplasma agalactiae, eight to
Moraxella sub-genus Brahnamella ovis and one at Mycoplasma mycoides sub. Mycoides.
On 12 caprine farms eight were positive to Moraxella branhamella ovis, two to Mycoplasma
agalactiae and two to Mycoplasma mycoides sub. mycoides. Moraxella branhamella ovis.
Serological tests for Mycoplasma agalactiae by ELISA technique showed always positive results
except into the outbreaks where Mycoplasma mycoides sub. Mycoides was isolated, because the
antibodies used in the test were species-specific.
The tests to research the antibodies anti- Chlamydia showed negative results.
The swabs on blood agar allowed the isolation of Moraxella sub-genus Branhamella ovis.
The bacteriological test performed on samples of conjunctival sac of healthy sheep and goats
resulted negatives to finding Branhamella ovis.
The cytological test showed the presence of neutrophils and conjunctival epithelial cells. A lot
of Mycoplasms were attached on the surface of the epithelial cells (5;6). The presence of this type of
cells can be related with their phagocytic activity against the neutrophils present on the samples.
The ocular lesion, mono or bilateral were more severe in the adult subjects; the clinical signs
vary from a light conjunctivitis to a serious form with lacrimation, photophobia and corneal oedema.
Different degree of corneal opacity with new vascularization, before superficial and then very deep,
was observed.
The IKC appeared during the May and June months and the ocular lesions remained for 20
days.
Generally the outbreaks of IKC in the affected farms disappeared into two months.
CONSIDERATIONS AND CONCLUSIONS
The results of this study show that infectious keratoconjunctivitis of small ruminants is caused
by various etiological agents considered endemic into the Sicilian farms. Furthermore, the obtained
results about the positivity to Moraxella branhamella ovis, Mycoplasma agalactiae, Mycoplasma
mycoides sub. mycoides. Moraxella branhamella ovis are according to the literature , showing a
major percentage of morbility in the goats than the sheep (11).
The ELISA test and the microscopic examination for Chlamidia spp. negative results always
provided, such as all the samples. The absence of anti-Chlamydia antibodies proves the negativity of
the tests to direct identify the etiological agent. In fact, the presence of other secondary microorganisms
can determine the disappearance of the Chlamidia organisms by the conjunctival tissue and it can
causes the negativity of the conjunctival samples by sick animals (13).
335
The results of bacteriological tests confirm that the major etiological agents in IKC in domestic
sheep and goats into Sicilian farms is Branhamella ovis.
The endemic presence of Contagious Agalactia in Sicily justify the major frequency of
Mycoplasma agalactiae as cause of IKC into the Sicilian farms of sheep and goats. Although it is
important underline the isolation of Mycoplasma mycoides sub. mycoides as etiological agent of IKC
into 4 examined farms without a clinical pattern related to contagious Agalactia .
The clinical examination and the microbiological tests on milk of the affected animals showed
the absence of clinical signs at udders and joints and the absence of the microorganism in the milk.
The findings of severe forms of keratoconjiunctivitis in adult subjects is related to a hypersensibility
reaction due to a precedent exposition of the eye at the etiological agent.
In recent years the studies on the etio-pathogenesis and the epidemiology of the infectious
keratoconjunctivitis of small ruminants are processing, considering the wide diffusion of the
pathology in the Sicilian territory. These researches need to further surveys in order to define in detail
the etiological agents and the clinical evolution of IKC in Sicily, considering the severe economic
losses into the affected farms.
REFERENCES
1. Andrews A.H., Goddard P. C., Wilsmore A.J.,(1987); Vet. Rec. 120,238-239
2. Beveridge W.I.B.,(1942) Investigation on contagious ophtalmia of sheep, with special attention to the
epidemiology of infection by Rickettsia conjunctivae-Australian Veterinary Journal 16, 155-164.
3. Coles J.D.W.A. (1936)A Rickettsial-like organism in the conjunctival epithelium of cattle. Journal of South
African Veterinary Medical Association 7, 221-225;
4. Cooper B. S. (1974) Transmission of a chlamydia-like agent isolated from contagious conjunctivo-keratitis
of sheep. New Zealand Veterinary Journal 22, 181-184.
5. Dagnall G. J. R, Br.Vet.J., (1994), 150, 65-71.
6. Dagnall G.J.R., Vet. Rec., (1994), 135, 127-130.
7. Di marco V., Lo verde V, Cristodaro G., Palazzo P., Imburgia M., Guercio A. (1998) Cheratocongiuntivite
infettiva degli ovini e dei caprini in Sicilia Atti Fe.Me.S.P.Rum
8. Egwu G. O. (1991): Vet. Bulletin, 61, 6 , 547-559.
9. Fairlie, G. (1966) The Isolation of a haemolytic Neisseria from cattle and sheep in the North of Scotland.
Veterinary Record 78, 649-650.
10. Hotzel H.(1996), Veterinary Microbiology, 49, 31-43.
11. Jones G.E., Foggie A.,Sutherland A., Harcher D.B.(1976);.Vet. Rec. 99, 137-141
12. Langford, E.V. (1971). Mycoplasma and associated bacteria isolated from ovine pink eye. Canadian Journal
of Comparative Medicine 35, 18-21.
13. Pedrini A., Cerri D., Andreani E., Farina R. (1991)Atti XLV SiSvet Palermo 24/28 settembre Palermo.
14. Spradbrow, P.B.; Marley, J. (1971) Ovine Keratoconjunctivitis: possible T-strain in the conjunctival sac.
Australian Veterinary Journal 47, 116-118.
15. Surman, P.G. Cytology of pink eye of sheep including a reference to trachoma of man, by employing
acridine orange stains, end isolation of Mycoplasma agents in infected sheep eyes. Australian Journal of
Biological Science 21, 447-467.
336
THE ECONOMICS OF EXTENSIVE BEEF PRODUCTION IN SPAIN
Isplativost ekstenzivnog uzgoja goveda u Španjolskoj
Robles-Robles, R. (1); Revuelta, J.F. (1) (2), González-Montaña, J.R.(1)
(1)
(2)
University of Leon (Spain)
CSIC. Estación Agrícola Experimental de León (Spain)
Abstract
Cattle, plays an important role in many Spanish mountain or less-developed regions, as it’s the case of
Castile and Leon, contributing to the sustainability of both, local economies and environment, but the continued
existence of this activity is certainly conditioned by its economical results. In this sense, this study aims to
analyze the economical results of dfferent kinds of extensive beef holdings applying the European Account
System, as a metholodogical approach, to the data obtained by a statistical survey representing all the different
holdings in this region. Results manifest the existence of many different economical situations depending on the
livestock’s size and on the complementation of this activity with other agricultural productions(2).
(2)
This study has been financed by Junta de Castilla y León, Consejería de Educación y Cultura (Castile
and Leon Regional Governments, Education and Culture Council), through the annual programm to support
research projects (Order EDU/1143/2004).
Sažetak
Uzgoj goveda zauzima važnu ulogu u ruralnim, planinskim područjima Španjolske kao što su
Castile i Leon. S tim u svezi ovaj rad analizira ekonomske učinke različitih načina ekstenzivnog
držanja goveda koji vrijedi za European Account System. Na osnovu statističkih podataka iz različitih
područja zaključili smo da ekonomska isplativost ovisi o broju grla te o suradnji sa drugim vidovima
poljoprivredne proizvodnje.
1.- Introducción y objetivos
Desde hace varios años, las explotaciones de vacuno de carne en España se hallan inmersas en
un proceso de reestructuración motivado por distintos factores: Elevada competencia internacional,
excedentes de producción en la Unión Europea, crisis alimentarias –EEB-, y por último, aspectos
relacionados con el bienestar animal y el respeto al medioambiente, que cuestionan las producciones
de tipo intensivo.
Varios mecanismos han tratado de poner solución a la problemática anteriormente descrita,
abogando por una extensificación de los métodos de producción, aunque no siempre los resultados
obtenidos han estado en consonancia con los objetivos propuestos. Así, la reforma de la PAC del
92 abordó un primer intento para mejorar la situación a través de la reducción del sostenimiento
de los precios, compensando los menores ingresos de los agricultores mediante ayudas directas a
la renta e introduciendo medidas para estimular la extensificación. Más adelante, la Agenda 2000
profundiza en estos aspectos, de modo que la reforma de la Organización de Mercado de la carne
de vacuno, aprobada por el Reglamento (CE) 1254/1999, que establece la nueva OCM, tiene por
objeto, entre otros: Incentivar en mayor medida a los productores a fin de que se orienten hacia la
extensificación.
337
Sin embargo, aunque los mecanismos de gestión del mercado aprobados en la Agenda 2000
parecían haber sido lo bastante sólidos y flexibles para facilitar la recuperación del mercado de
vacuno, y la extensificación de la producción fue ganando terreno, gracias a la redefinición de la
prima por extensificación, se aprecia que los instrumentos de la OCM no han conseguido desalentar la
producción intensiva tanto como se esperaba. El hecho de que los pagos sean por cabeza, que la carga
ganadera esté basada en las primas solicitadas y no necesariamente en el número real de animales,
la exención del requisito de carga ganadera en el caso de los “pequeños ganaderos” (máximo 15
UGM), fueron algunos de los factores que favorecieron la persistencia de la intensificación de la
producción. Por ello, la Comisión propuso eliminar los pagos por cabeza y sustituirlos por un único
pago de apoyo a la renta por explotación, basado en los derechos históricos, junto a exigencias de
condicionalidad más estrictas. Ésto rebajaría la presión que conduce a la práctica de una producción
intensiva y contribuiría a equilibrar el mercado (COMISIÓN EUROPEA, 2002).
Asimismo, se considera esencial que los incentivos que reciban los agricultores estén ligados
de alguna manera a los objetivos relacionados con el medio ambiente, el bienestar de los animales,
la seguridad y la calidad alimentaria. Introducir medidas de este tipo en los procesos de producción
habituales supone un aumento del coste y una pérdida de eficiencia de los agricultores comunitarios,
con relación a sus homólogos internacionales, que de alguna manera hay que limitar, lo que determina
que los pagos directos continúen siendo imprescindibles.
Finalmente, en junio de 2003 con la reforma de la PAC se aprobó el régimen de pago único (RPU),
un sistema de ayudas anuales pagadas a los productores sin vínculo con la producción («disociadas»)
y que constituye la principal característica de la PAC reformada. El RPU combina varios pagos
directos percibidos actualmente por los agricultores en un único pago calculado a partir de los pagos
recibidos durante un período de referencia (REGLAMENTO (CE) n° 1782/2003).
No obstante, los Estados miembros podían optar por la introducción del RPU en su totalidad,
combinando todas las ayudas en un único pago, o decidir mantener una parte de las ayudas directas
pagadas a los agricultores bajo su forma actual («disociación parcial»), cuando consideren que
el tránsito al RPU pueda implicar perturbaciones en los mercados agrícolas o un abandono de
producción. Así, en el caso de España, aunque se decidió desacoplar totalmente algunas ayudas como
la prima al bovino macho, sin embargo, otras decidieron mantenerse acopladas total o parcialmente
(prima a la vaca nodriza, sacrificio). Mientras es de esperar que el desacoplamiento total repercuta en
una disminución de las producciones intensivas, el mantenimiento de las primas acopladas, podría
repercutir en una mayor extensificación de la producción (COMISIÓN EUROPEA, 2005).
En cualquier caso, para que este proceso se convierta en una realidad, el ganadero, como cualquier
otro empresario, debe percibir un beneficio en los resultados económicos de su explotación, bien sea
a través de los precios del mercado, bien a través de los soportes y políticas institucionales, que
tratan de compensar la ausencia de remuneración de los servicios sociales aportados por este tipo de
empresa. En este sentido, el objetivo del presente trabajo, es precisamente analizar los resultados
económicos de este tipo de empresa.
2.- Metodología
2.1.- Obtención de la información
La realización de cualquier investigación requiere en un primer paso, de la obtención de la
información que permita conseguir los objetivos establecidos, que en este caso procede tanto de
fuentes primarias (encuestas), como de fuentes secundarias (censos, estadísticas y publicaciones
relacionadas con el objeto de la investigación). Las primeras constituyen la base de los resultados
338
presentados en este trabajo, mientras que las segundas se han utilizado fundamentalmente para el
diseño del plan de muestreo, así como para el contraste e interpretación de los resultados.
De este modo, tras realizar un estudio previo y pormenorizado de la situación y problemática del
sector, se procedió a elaborar el correspondiente cuestionario, formulado en su mayor parte a base
de preguntas abiertas, y tomando como base para el diseño de las mismas, estudios desarrollados
por otros autores, que han llevado a cabo investigaciones similares en otros sectores (SOLER y
PERDIGUER, 1992; PUENTE, T, 1995; REVUELTA et al, 1998; ROBLES et al 2001a; ROBLES
et al 2001b).
A continuación, a partir del censo de explotaciones de carne de tipo extensivo en Castilla y León,
se procedió a la selección de la muestra objeto de estudio. Para ello se utilizó un muestreo aleatorio
simple. De acuerdo con este método, se procedió a la determinación del tamaño muestral, teniéndose
en cuenta que no siempre una muestra más grande proporciona mejores resultados, sino que a partir
de cierto tamaño, apenas se reduce el error y, sin embargo, aumentan los costes y pueden aumentar
los errores ajenos al muestreo. Por otro lado, la investigación debe buscar un compromiso entre el
coste de una muestra grande y la fiabilidad de los resultados (GRANDE y ABASCAL, 1995). Para
las encuestas a ganaderos la expresión utilizada ha sido:
e=k⋅
n − n pq
⋅
n −1 n
Donde:
e = Error absoluto.
N = tamaño de la población
n= Tamaño de la muestra.
p = q = 0,50.
K= 2, aproximadamente equivalente al 95,5% del intervalo de confianza de una distribución
normal.
En este sentido, se ensayaron distintos tamaños muestrales, calculando para todos ellos el
correspondiente error muestral, y se decidió adoptar un tamaño de muestra constituido por 250
explotaciones, lo que supone un error de 6,2%. La muestra se obtuvo mediante el método de los
números aleatorios, quedando distribuida como sigue (tabla 1).
Tabla 1. Distribución de la muestra a ganaderos. Fuente: Elaboración propia.
Provincia
av
bu
le
va
pa
sa
se
so
za
Total
0-20
20
8
11
21-50
7
9
2
51-100
12
4
2
101-300
10
8
4
1
19
4
3
5
71
3
20
6
3
3
20
6
3
50
50
4
32
5
1
4
68
301-500
1
501
1
7
2
3
1
10
5
total
51
29
19
0
11
101
24
10
9
254
339
En cuanto al modo de administración más conveniente para llevar a cabo la encuesta, a la hora
de elegir éste, se consideraron distintos factores, como: el objetivo del estudio, las características
de la población, y el presupuesto disponible. Se optó por la encuesta personal, como modo de
administración más adecuado, ya que aunque puede presentar algunos inconvenientes, como:
(i) Un coste de obtención elevado debido a la lentitud del proceso y al tiempo empleado en la
recogida de datos, y fundamentalmente, en nuestro caso, debido a los gastos correspondientes a los
desplazamientos, dada la dispersión de los distintos municipios y la distancia geográfica;
(ii) Lentitud del proceso, debida en parte, a las pérdidas de tiempo en los desplazamientos, a
la imposibilidad de concentrar las citas, dados los quehaceres de los ganaderos y a la duración de la
propia encuesta, que dada la diversidad de datos, la concreción y la dificultad que suponían algunos
de los aspectos, llegó, en ocasiones, a superar las dos horas de duración.
Sin embargo, presenta asimismo algunos puntos fuertes de considerable importancia, que
animaron a realizarla de este modo, como la posibilidad de obtener un porcentaje de respuesta
más alto que el obtenido a través de otros métodos (GRANDE y ABASCAL, 1995), característica
de notoria importancia en el caso que nos ocupa, dada la tendencia de parte del encuestado a la
desconfianza y al rechazo de las encuestas, sobretodo en el caso de preguntas relacionadas con datos
de naturaleza económica.
2.2.- Obtención de los resultados económicos
Una vez realizadas las encuestas, se procedió a la determinación, para cada una de las
explotaciones, de una serie de indicadores de naturaleza económica, de cara a evaluar la situación
económica de las mismas. El objetivo final es disponer de los principales indicadores de las rentas
generadas por la actividad productiva en las explotaciones ganaderas. Para la obtención de estos
indicadores se utilizó la metodología de la Red Contable Nacional (MAPA, 2003). A continuación,
se resume el cálculo de los principales indicadores:
Producción Bruta Vegetal: Refleja en € el valor de la producción agrícola. Incluye el valor de la
producción generado por la agricultura.
Producción Bruta Animal: Refleja el valor en € de todo lo producido por la ganadería.
Producción Bruta Total: Suma de la animal y la vegetal
Producción Final Agraria, PFA: Es la Producción Bruta Total menos el Reempleo.
VAB a precios de mercado: Se obtiene restando a la PFA los costes de fuera de la explotación y
los impuestos y tasas.
VAB a coste de factores: VAB a precios de mercado + Subvenciones
VAN a coste de factores: VAB a coste de factores menos amortizaciones.
340
Disponibilidad empresarial: Se obtiene restando al anterior los salarios de la mano de obra
contratada, y los arrendamientos/alquileres. Refleja lo que queda disponible al empresario para
remunerar la mano de obra familiar (no pagada), los intereses del capital (propio o prestado) y su
propio beneficio por la gestión.
2.3.- Resultados
La tabla 2 resume los principales indicadores económicos de las explotaciones encuestadas
agrupados por tamaño de la explotación (según número de vacas nodriza).
Tabla 2. Valor de las variables económicas en los distintos estratos. Elaboración propia.
Estratos
(Número Producción Producción Producción
Vacas Bruta Vegetal Bruta Animal Bruta Total
Nodriza)
0-21
Promedio
4053
3967
8020
varianza
89936677
9885861
20-51
Promedio
6589
11206
varianza 163227251 220346794
50-101
Promedio
7198
27946
varianza 168797346 331388991
100-301
Promedio
22271
68163
varianza 1331853893 1472237569
300-501
Promedio
100320
160330
varianza 2947239467 688278873
>500
Promedio
52800
416904
varianza
0
0
PFA
VAB a
precios de
mercado
6804
1420
5401
4605
3779
106019513 88178364
52373433
89964684
83936949
79671556
17795
14810
284756405 245823957
35144
31286
527944391 452045746
90433
78808
3848613803 2706452608
260650
194996
5920157720 5529162713
469704
416904
0
0
1883
200412009
9599
555432288
34290
1780183578
114743
1360492713
181399
0
16269
286792398
37314
502654727
97141
4053458564
283263
573040938
399111
0
13896
274928096
34801
498251404
90894
3781147645
271770
357227847
396111
0
11004
250534904
29089
562080040
76075
2847585744
199272
420871988
361111
0
VAB a coste VAN a coste Disponibilidad
de factores de factores
empresarial
Entre los principales rasgos socio-económicos, merece destacar los siguientes hechos:
 El valor de la producción total aumenta con el tamaño de la explotación, debido
fundamentalmente al aumento de la producción animal. La participación de la agricultura sobre
la producción total es muy variable, alcanzando los valores más altos en cuanto a participación
en las ventas y en la Producción Total en las explotaciones ganaderas más pequeñas (menos de 50
animales), en base a una mayor diversificación de la actividad. En el estrato de 300 a 500 vacas
nodriza, la producción agrícola vuelve a ganar peso, pero en este caso motivada por el reempleo de
las producciones agrícolas en la alimentación animal. La mayor producción agrícola por hectárea
cultivada, corresponde a las explotaciones ganaderas de mayor tamaño (más de 300 animales),
que son las que presentan asimismo un mayor porcentaje de superficie de regadío. Asimismo, la
Producción Animal por UGM aumenta con el tamaño de la explotación.
 El mayor peso de los gastos fuera de la explotación sobre la Producción Bruta Total (PBT),
tiene lugar en las explotaciones con menos de 51 vacas madre (especialmente en las de 20 a 51).
Para las explotaciones con más de 50 vacas nodriza, el peso relativo de los gastos de fuera de la
341
explotación disminuye a medida que aumenta el tamaño de la explotación ganadera, minimizándose
en el caso de las explotaciones más grandes.
 Las subvenciones tienen un peso notable sobre el conjunto de la actividad, especialmente
en las explotaciones más pequeñas (las explotaciones con menos de 100 animales son las que
presentan una mayor participación de las subvenciones sobre el Valor Añadido bruto a coste de
factores, disminuyendo ésta en los restantes estratos a medida que aumenta el tamaño). En cuanto
a la participación de la agricultura y la ganadería sobre el total percibido a través de la subvención,
evidentemente, destacan las subvenciones vinculadas a la ganadería, que suponen entre un 66 y
un 97% de las subvenciones totales, aumentando su participación lógicamente con el tamaño de la
explotación ganadera.
 La casi totalidad de las explotaciones utiliza mano de obra familiar, sólo en las explotaciones
de más de 300 animales la contratación de asalariados reviste cierta importancia, el resto recurre a
este factor de forma esporádica.
2.4.- Conclusiones
Aunque la actividad refleja resultados positivos en todos los estratos analizados, sin embargo
debe tenerse en cuenta que no han sido deducidos los costes correspondientes a la mano de obra
familiar, ni los intereses del capital. De deducir éstos de cara a obtener una aproximación al beneficio
empresarial, los importes correspondientes se sitúan en niveles claramente inferiores e incluso
reflejan pérdidas en las explotaciones más pequeñas, en las que la actividad es un mero complemento
de otras rentas.
Cabría distinguir tres tipos de explotaciones: Aquellas donde la actividad tiene carácter
empresarial, reflejando resultados económicos positivos, capaces de competir por sí mismas en los
mercados, aumentando este rasgo con el tamaño de la cabaña ganadera (más de 300 animales), y
aquellas otras (menos de 100 animales) en la que los beneficios económicos son escasos, o incluso
en algunas ocasiones llegan a reflejar pérdidas. Entre ambas existe un estrato intermedio (101-300
animales), que reúne características intermedias entre ambas.
Dentro de las primeras (“explotaciones empresariales”), encontramos negocios bien organizados,
donde la presencia de la mano de obra familiar va disminuyendo en importancia frente a la mano de
obra contratada, a medida que aumenta el tamaño de la cabaña ganadera; Son explotaciones capaces
de subsistir por sí mismas generando beneficios independientemente de la percepción de subvenciones
relacionadas con la actividad. En las segundas, la actividad ganadera, no genera siempre beneficios, e
incluso en el caso de las más pequeñas (menos de 50 animales) no permite la adecuada remuneración
del trabajo familiar y los capitales invertidos, aunque supone un complemento de otras rentas, no
siempre procedentes de la agricultura, que contribuyen al mantenimiento de la población en el medio
rural, y a la aportación de servicios sociales y medioambientales.
En cualquier caso, la supervivencia de la mayor parte de las explotaciones (menos de 300 animales)
pasa por el mantenimiento de las subvenciones existentes; sin éstas sólo aquellas explotaciones
mayores de 300 animales podrían generar beneficios.
2.5.- Bibliografía
COMISIÓN EUROPEA (2002). Communication from the Commission to the Council and the European
Parliament. Mid Term review of the Common Agricultural Policy. Bruselas.
COMISIÓN EUROPEA (2005). Prospects for agricultural markets and income 2005-2012. Julio, 2005.
342
GRANDE, I. y ABASCAL, E. (1995). Fundamentos y técnicas de investigación comercial. 2ª edición. ESIC
Editorial. Madrid.
MAPA (2003). Red contable agraria nacional, Secretaría General Técnica.
PUENTE, T. (1995). Simulación de políticas ganaderas en las comarcas agrarias de León. Tesis doctoral. Escuela
Superior y Técnica de Ingeniería Agraria. León.
REGLAMENTO (CE) 1254/1999, del Consejo de 17 de mayo de 1999 por el que se establece la organización
común de mercados en el sector de la carne de vacuno. DO L 160 de 26.6.1999.
REGLAMENTO (CE) N° 1782/2003 del Consejo de 29 de septiembre de 2003, por el que se establecen
disposiciones comunes aplicables a los regímenes de ayuda directa en el marco de la política agrícola
común y se instauran determinados regímenes de ayuda a los agricultores y por el que se modifican los
Reglamentos (CEE) n° 2019/93, (CE) n° 1452/2001, (CE) n° 1453/2001, (CE) n° 1454/2001, (CE) n°
1868/94, (CE) n° 1251/1999, (CE) n° 1254/1999, (CE) n° 1673/2000, (CEE) n° 2358/71, (CE) n° 2529/2001
y n° 1156/2006. DO L 270 de 21.10.2003.
REVUELTA, J.F.; PUENTE, T.; FERNÁNDEZ-RODRÍGUEZ, F. (1998). Costes de producción en las
explotaciones ganaderas vacunas en la comarca de Laciana (provincia de León). 6º Congreso de Economía
Regional de Castilla y León. Zamora. Comunicaciones 3, pp. 1698-1714.
ROBLES R.; PUENTE T. and REVUELTA J.F. (2001a). Explotaciones de vacuno en el Páramo de León:
Estructura y Orientación Técnico-Económica. Ganadería, Nº 10, pp 26-29.
ROBLES R.; PUENTE T. y REVUELTA J.F. (2001b). Importancia socioeconómica de la ganadería bovina en la
comarca del Páramo leonés. Paper. Fe.Me.S.P.Rum. IX International Congress. León (Spain).
SOLER, P. y PERDIGUER, A. (1992). Prácticas de investigación de mercados. Siete investigaciones completas.
Ed. Deusto. Bilbao.
343
344
CERTAIN FEATURES OF RAW SKIN FROM LARGE DOMESTIC
HOOFED ANIMALS
NEKA SVOJSTVA SIROVIH GOVEĐIH KOŽA
P. Džaja1., M.Čuljak2, J. Bagarić 3., V. Vrkić4., K. Rukavec5, F. Martinković6., E.
Šatrović7 ,M. Radačić8, I. Vranješ9., A. Lokin10., I. Semren11
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u
1
Veterinarska stanica Oborovo
2
Veterinarski ured,, Sarajevo
3
4. Student
Veterinarska stanica Sesvete
5
6.
Zavod za parazitologiju i invazijske bolesti s klinikom, Veterinarski fakultet u Zagrebu
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Sarajevu
7
Dalmacija vino, Split
8
Veterinarska stanica Križevci
9
Veterinaska ambulanta Pakoštane
10
Student-diplomski rad
11
Summary
Criteria for raw skin quality are defined by the standard from 1985. Large domestic hoofed animals include
calf’s skin, baby-beef’s skin, cow-hide and buffalo-skin. Specified skins classified in 4 category. Feedstock (raw
material) characteristic depends on the form, structure, pile coat and integrity of the pile. Age, sex and breed
affect on size, fatness, structure and pile coat. A the skin we should distinguish admittance weight, weight of
salted skin, weight of dry salted and salted skin. Utilization rate of raw skin is percentage of raw skin weight
against body weight. Abatement of skin we define as losing skin weight during preservation in salt and storage,
as well as after preservation in salt.
Key words: raw skin, hoofed animals, features
Sažetak
Standardom iz 1985.g. određeni su uvjeti kvalitete za sirovu kožu domaćih velikih papkara u koju spada:
teleća, juneća, goveđa i bivolska koža. Teleća koža razvrstava se u 4 klase kao juneća, goveđa i bivolska.
Sirovinska svojstva kože ovise o obliku, građi, dlačnom pokrivaču i potpunosti kože. Starost, spol, pasmina
utječu na veličinu, debljinu, građu i dlačni pokrivač kože. Kod kože treba razlikovati ulaznu težinu, težinu soljene
kože, težinu suho slane i suhe kože. Radman sirove kože je postotak težine sirove kože naspram težine tijela.
Pod kalom kože podrazumijevamo gubitak težine kože za vrijeme soljenja i skladištenja te nakon soljenja.
Ključne riječi: sirove kože, papkari, svojstva
UVOD
Krupna koža stavlja se u promet bez kože glave, donjeg dijela nogu i repa te se s nje mora odsjeći
koža vimena, mošnica, čmar i stidnica i uvijek mora imati dvije podjednake polovice (jedna polovica
kravlja može biti nešto veća). Tako je teleća koža definirana kao koža mladih goveda, potpuno ili
pretežno pokrivena mekom dlakom, koja su se isključivo hranila mlijekom, a nema razlika u debljini
na leđima i vratu. Pod junećom kožom isti standardi podrazumijevaju kožu mladih goveda obaju
345
spolova, koji nisu upotrebljavani za rasplod i imaju jednolično razvijenu dlaku, a koža nema izrazito
deblje niti tanje okrajine u odnosu na kožu leđa, zatim koža vrata nije izrazito deblja ni tanja od kože
leđa. Pod goveđom kožom podrazumijeva se koža odraslih goveda koja je pokrivena oštom dlakom
različite duljine a razlike postoje i u debljini na leđima, vratu i okrajinama. Bivolska je koža bivola
obaju spolova.
Prema standardima koji su vrijedili na ovim prostorima teleće se kože sortiraju u mliječne i
slamožderske kože težine do 3,5-4 kg svježe težine i iznad te težine. Teleće kože po kvaliteti, prema
navedenim standardima, razvrstava se u 4 klase i onu koja ne može udovoljiti uvjetima 4. klase
razvrstava se u škart. Teleća koža prve klase vrjednija je od kože druge klase za 10%, od treće klase
za 20%, od kože četvrte klase za 50%, a od kože pete klase za 80%. Juneće kože razvrstavaju se u
dvije kategorije: kože junadi-obična i kože tovne junadi (baby beef). Juneća koža razvrstava se u 4
klase, a one koje ne ispunjavaju uvjete 4. klase, spadaju u škart. Juneće kože prve klase vrjednije
su od koža druge klase za 10%, treće klase za 20%, četvrte klase za 40%. Goveđa koža dijeli se na
kravlju, volovsku i bikovsku. Bivolske kože u promet se stavljaju odvojene, dok se kravlje i volovske
kože mogu staviti skupa. Kravlja koža ima izrazito velike i tanke okrajine i kožu vrata tanju od kože
leđa. Volovska koža ima izrazito debelu kožu leđa i razmjerno male okrajine, a koža vrata je tanja od
kože leđa. Bikovska koža ima masu veću od 34 kg svježa i slana oko 30 kg, koža leđa joj je tanja u
odnosu na debelu kožu okrajina i vrata. Goveđe kože razvrstavaju se u klase kao juneće kože, s tim
da je goveđa koža prve klase za 7% vrjednija od kože druge klase, 15% od kože treće klase i 40 % od
kože četvrte klase. Bikovske kože razvrstavaju se u dvije kategorije prema masi: -od 34 kg svježe ili
30 kg slane mase do 63 kg svježe ili 55 kg slane mase i iznad 63 kg svježe ili 55 kg slane mase.
VAŽNA SVOJSTVA KOŽE ZA OBRADU
Sirovinska svojstva kože, kao što su oblik, građa, dlačni pokrivač i potpunost kože, odlike su
koje koži daju mogućnost prerade u kožu ili kožno krzno. Oblik kože određen je njenom površinom
(dužina, širina i debljina), građu predstavljaju tkiva a dlačni pokrivač čine sve dlake koje su na njoj
izrasle. Pod pojmom potpunosti kože podrazumijevamo stupanj zastupljenosti prirođenih svojstava
i neoštećenja. Životinjska koža dobiva oblik sirove kože skidanjem sa životinje, a prirodna svojstva
trebaju biti sačuvana do početka njene prerade u kože ili krzno (Bayer 1978.). Koža pobačenih
teladi mala je, tanka, siromašne građe i potpuno gola ili tek slabo pokrivena rijetkim dlačicama. Kod
novorođenoga teleta koža je pokrivena prvom dlakom, nema razlika u debljini pojedinih dijelova, a
repna je dlaka fina i priliježe uz rep. Koža teleta hranjenoga samo mlijekom imat će razlike u građi
ovisno o pasmini, dobu i spolu i ta je razlika jedva zamjetna. Razlike će biti veće što je tele starije i
što se duže hrani drugom hranom. Prema navedenim standardima nema razlika u debljini kože (leđa,
vrat i okrajine), a dlaka je meka kod teladi hranjenih samo mlijekom i razvrstava se u dvije kategorije
po masi do 4 kg svježe ili 3,5 kg slane mase i više od 4 kg svježe ili više od 3,5 kg slane mase. Muške
su teleće kože nešto deblje od ženskih telećih koža iste dobi i pasmine, a leđni je dio deblji od vratnog
i trbušnog dijela te ima tendenciju stvaranja nabora. Trbušni su dijelovi kože su uski i tek nešto tanji
od leđnog dijela. Ženska telad ima široke i tanke trbušne dijelove i tanak vratni dio. Bikovske kože
imaju vrlo tanak leđni dio i široke i debele trbušne dijelove te debeli vratni dio s brojnim naborima.
Kravlje su kože u području vrata tanke s naborima koji rastezanjem nestaju, kao i trbušni dio, dok je
leđni dio uzak, ali deblji od vratnog i trbušnog dijela kože. Volovska koža ima debeo i široki leđni dio,
tanje i uže trbušne dijelove i vratni dio tanji od leđnog, a deblji od trbušnog dijela. Manje pasmine
goveda imaju zbijeniju i deblju kožu nego mliječna goveda, a goveda uzgojena u hladnim predjelima
imaju deblju kožu od goveda uzgojenih u toplim predjelima. Postoji utjecaj dobi, spola i pasmine
na građu telećih i goveđih koža. Teleće kože imaju finija vlakna, gušćeg su spleta od goveđih. Splet
346
vlakana volovskih koža gušći je nego u bikovskih ili kravljih koža. Kože muških životinja imaju
deblje snopiće vlakana nego kože ženskih životinja iste dobi. Mliječne pasmine imaju labaviju građu
od mesnih i radnih pasmina. Goveda intenzivno hranjena krmom koja sadrži mnogo masnih sastojaka
imaju spužvastu građu u usporedbi s kožom goveda uzgajanih na pašnjacima. Gladovanje smanjuje
debljinu kože i čini njenu građu siromašnom.
Postoje razlike u dlačnom pokrivaču prema dobi, spolu i pasmini goveda. Mlade životinje imaju
finiju jednolično po koži rasprostranjenu dlaku, neznatne razlike u duljini i debljini. Odrasla goveda
imaju grublju dlaku, deblju u bikova nego u volova i krava. Repna je dlaka teleta fina, ravna i priliježe
uz rep, goveđa je repna dlaka kovrčava, gruba i strši od repa. Goveđe kože iz hladnih predjela imaju
deblju i gušću dlaku od onih iz toplijih predjela. Dobro hranjena goveda imaju gustu i sjajnu dlaku
koja priliježe uz tijelo, a gladna goveda imaju tamnu, čupavu i rijetku dlaku.
Epidermalno područje sirove teleće kože zauzima najmanje polovicu od cijele debljine kože,
a kod odraslog goveda to područje zauzima trećinu debljine kože. Korijum teleće kože ima gušće
snopiće vlakana negoli korijum goveđe kože, ali pletež vlakana korija kod goveđe kože jasnije
je izražen (razvijeniji je). Ukupna debljina kože raste od teleće ka goveđoj koži. Izgleda da je
epidermalno područje teleće i goveđe kože relativno isto a glavni dio rasta odvija se u području
korija. Apsolutni broj dlačnih mješića isti je na telećim i goveđim kožama, ali je razmak između njih
na telećim kožama manji.
Klaonička ili ulazna masa kože masa je kože koju svježa koža ima nakon skidanja sa životinje.
Vaganje svježe kože vrši se tek kada je koža izgubila tjelesnu toplinu, tj. pošto je primila temperaturu
okolice u kojoj se nalazi. Svježa masa vaga se pošto je s nje odstranjeno sve što standardi traže. Kada
je na mesnoj strani kože vidljiva krv, voda ili prljavština, od ustanovljene mase odbija se najmanje
5%, a ako je mokra i zaprljana dlačna strana, najmanje 10%.
težina suhoslane, suhe kože x 100
Ulazna težina:----------------------------------------------------------
100 – dopušteni kalo (60 ili 45)
Soljena je koža bilo koja koža koja je 48 sati potpuno potopljena u zasićenu otopinu NaCl, ili
je stajala najmanje 14 dana potpuno prostrana i nasoljena dovoljnom količinom soli. Masa soljene
kože dobije se nakon toga što je presoljena zasićenom otopinom soli te se ocijedila za 48 sati, ili je
soljena suhom soli te se nakon istresanja preostale soli važe 24 sata nakon toga postupka. Suho-slana
koža –koža je koja je nakon soljenja na zraku osušena tako da su rep i uši otvrdnuli. Suha koža -koža
je koja se na zraku potpuno osuši tako da rep i uši otvrdnu. Masa suhe kože masa je koja se postigne
vaganjem kože nakon toga što rep i uši potpuno otvrdnu.
Radman sirove kože goveda podrazumijeva postotak težine sirove kože (skinuta koža s glave i
nogu) naspram težine tijela i ovisan je o pasmini goveda (primitivne pasmine imaju viši radman),
spolu, dobu (ženska i mlada goveda imaju obično niži radman sirove kože u usporedbi sa starijim i
muškim govedima), težini (što je govedo manje i mršavije to je radman manji) i kondiciji životinje.
Tako se smatra da je kod goveda u intenzivnom uzgoju radman sirove kože 7%, a kod primitivnih
pasmina 10%. Ovo se može raščlaniti i reći da je u krava 6- 6,5%, junadi 6,5-7%, volova 7- 7,5% i
bikova 7,5-8%.
Sirovu kožu vrlo brzo zahvaćaju raspadni procesi, a kad se kuha u vodi, raspada se u tutkalo ili
kelj, dok potpuno uštavljena koža teško trune i vrlo se kasno raspada, a kuhanjem u vodi ne mijenja
se. Životinjska se koža sastoji se od vode, bjelančevine, masti i mineralnih soli. Ako neka koža sadrži
više masti, sadrži manje vode. No najvažniji su sastojak kože bjelančevine, a od osobite su važnosti
347
kolagen i kreatinin. Od kolagena su građena kožna vlakna, a od keratina orožnjeli dijelovi epiderme,
dlaka i ostale rožnate tvorevine (nokti, kandža, papci, kopita i rogovi). Kolagen je nositelj štavnih
sposobnosti sirove kože i ima svojstvo da privlači vodu i da s njom nabubri. On osim u vodi bubri i
u kiselinama i lužinama, a kuhanjem se polagano pretvara u želatinu koja nema štavne sposobnosti i
zbog čega treba izbjegavati svaki dodir kože s vrućom vodom. Dok su neke kože osjetljive na vruću
vodu, neke podnose, bez ikakvih posljedica, i toplinu od 65 stupnjeva. Bayer (1950) navodi kako
u pravilu pri radu sa sirovim kožama nikada ne treba upotrebljavati vodu topliju od 30 stupnjeva.
Juneća i goveđa koža dovezena sortirana i
kategorizirana i spremna za soljenje i slaganje u tzv.
štos.
Juneća koža, nasoljena i složena u štos
Teleća soljena koža složena na paletu za trnsport na
preradu
Juneća soljena koža složena na paletu za transport na
preradu.
Osnovni sastav kože je: 50% ugljika, 25% kisika, 7% vodika, 17,8 % dušika i oko 0,2% ostalih
mineralnih sastojaka.
Danas nema postupka konzerviranja kojim bi se sirove kože potpuno i neograničeno dugo
sačuvale od raspadanja bez ikakvih šteta za sirovinska svojstva koža. Za dobar rezultat konzerviranja
jedan od bitni uvjeta je da je koža svježa, a da bi se dobila dobra kondicija kože, uz navedeno, treba
voditi računa o načinu prestanka života životinje, vremenu od smrti životinje do skidanja kože i do
348
trenutka kada se koža počinje konzervirati. Raspadni procesi na koži počinju prije negoli se okom
mogu vidjeti. Glavni su znakovi raspadanja: promjena prirodnog mirisa kože (miris kože, pojava
mrlja na lešini), popuštanje dlake u korijenu, promjena boje mesne strane kože te gubitak elasticiteta
i čvrstoće sirove kože. Ako se koža ostavi na životinji, ona će se pod istim uvjetima brže raspadati
nego ako je odmah neposredno poslije prestanka života odvojena od tijela. Svježa koža ima jednak
miris kao za života, a ako koža poprimi zadah po lešini, znak je da su u njoj počeli razgradni procesi.
U slučaju gubljenja dlake zbog raspadanja, mjestimice ili na cijeloj koži ispadaju sve vrste dlaka
i ostaju gola mjesta, što se razlikuje od mijenjanja dlake (linanja) kada se na koži razlikuju dlake
različite dužine i debljine. Kod manipulacije kožama pri ispadanju dlake zamjećujemo to na svim
mjestima istodobno, a najprije na onim dijelovima na kojima su zadržani ostatci mekanih dijelova
(meso, potkožje, slanina, žlijezde i sl.). Također ponekada dlaka ispala zbog kožne bolesti životinja,
što treba razlučiti i istaknuti da to nije posljedica mijenjanja dlake, odnosno raspadanja kože. Kod
kožnih bolesti ispadanje dlake prate i druge patološke promjene kože na mjestu ispadanja (boja, otok,
krasta, rana, čir i sl.). Svježa koža koja potječe od dobro iskrvavljene životinje ima sjajnu, glatku,
bijelu, svijetloružičastu boju mesne strane, koja s raspadanjem postaje zagasitije boje. Raspadanjem
kože javljaju se mrlje koje su u početku svjetlije boje, a daljnjim raspadanjem ta boja prelazi u tamnu
boju. Tako od svijetložutih, crvenkastih i smeđih mrlja nastaju zelenkaste, tamnozelene, plave i crne
mrlje. One su u početku raspadanja malene i odvojene od okolice, a s razvojem raspadanja, osim
promjene boje, postaju veće te se međusobno spajaju i zauzimaju sve veću površinu na mesnoj strani
kože. Kože uginulih, ubijenih i ustrijeljenih životinja koje nisu iskrvarile imat će glatku i sjajnu
mesnu stranu u kojoj će biti vidljivi tragovi neiskrvarenja i bit će crvenija strana mesnog dijela kože.
Kože životinja uginulih od bedrenice karakterizira mesni dio kože hladatinasto nabubrio ili prožet
crnom katranastom krvlju. Neće biti razlike u boji i karakteristikama kože životinja koje su zaklane
i kože životinja koje su stradale tako da su iskrvarile. Ostala krv u koži, uzrok uginuća i vrijeme
proteklo od uginuća utječe na bržu pojavu raspadanja na takvim kožama. Na takvim kožama brže
će se razviti znakovi neugodna zadaha, popuštanja dlake na koži, promjena boje mesine negoli na
iskrvarenim životinjama.
Toplina, vlaga i mikroorganizmi ubrzavaju raspadanje životinjske kože, pa tako pri temperaturi
od 10 ºC ostat će sirova koža tijekom 48 sati bez mikroskopski vidljivih promjena. Ako koža ostane
na temperaturi 10-12 ºC, već za 24 sata uočavaju se promjene u građi kože, a koje se nakon tri dana
mogu uočiti tako što se potkožje i epidermalne tvorbe pokriju tankim slojem sluzi. Pri temperaturama
od 23 ºC ova se promjena može uočiti već nakon 6 sati stajanja kože, a što je to vrijeme duže, to
je jače pokrivanje sa sluzi. Ako koža stoji na vlazi od 70%, onda se ta pojava može ustanoviti i
pri temperaturi nižoj od 23 ºC. Nakon smrti životinje na koži se mogu naseliti razne bakterije i
gljivice hraneći se sastojcima kože, uz istodobnu razgradnju. Samo one bakterije koje znatno utječu
na razgradnju kože znatno utječu i na kvalitetu kože kao kožarske sirovine.
Konzerviranje kože treba obaviti čim je koža skinuta sa životinje. Danas se konzerviranje
uglavnom provodi soljenjem, sušenjem, hlađenjem i dezinfekcijom. Soljenje je dobro obavljeno
ako dana koncentracija soli, i to što prije, da počne kočiti razvoj bakterija i aktivnost proteolitičnih
enzima. Pri pravilno obavljenom soljenju na ohlađenoj koži navedena se koncentracija postiže u
koži pri temperaturi zraka od 10 do 20 oºC već za 34 sata. Ako je okolna temperatura viša od 30 ºC,
razgradnja je kože brža nego zasićenje vode kože solju. Ako je relativna vlaga zraka iznad 90%,
rezultat soljenja će biti slabiji, a ako je preniska –tj. ispod 75%, koža će se početi sušiti prije nego
se stvori dovoljno salamure na mesnoj strani. Konzerviranje soljenjem zasniva se na oduzimanju
vode (15%) pomoću kuhinjske soli, a ostala voda u koži prelazi u zasićenu otopinu NaCl. Na koži
nastaje stanje koje nepovoljno utječe na rad enzima i razvoj bakterija. Ovaj način konzerviranja ima
349
dobru stranu jer se tkivo kože ne mijenja a koža vrlo brzo primi izgubljenu vodu kod konzerviranja
bez oštećenja kožne supstance, i tako možemo, osobito kod debljih koža, dugo sačuvati kožarska
svojstva kože. Negativnosti koje proizlaze nakon konzerviranja kože soljenjem jesu što koža zadrži
mnogo vode, a to je opterećenje pri transportu. Sve to traži veliku pozornost pri uskladištenju jer
se lako kvare. Tanke kože bujne dlake, ako stoje duže od 30 dana, u manjoj ili većoj mjeri počinju
gubiti dlaku a jačina ispadanja je jačina što je temperatura prostorije viša. Konzerviranje sirovih koža
soljenjem obavlja se u hladnim prostorijama s temperaturom nižom od 15 ºC, a rok konzerviranih
krznarskih sirovina je do 30 dana za uobičajenu manipulaciju. Soljenje suhom soli jeftin je i
jednostavan postupak konzerviranja i traje od 4 do 6 dana (ponekada 14) na 5-20 ºC, a soljenjem u
slanoj otopini svi se dijelovi kože ravnomjerno izlažu soli i proces traje od 24 do 48 sati, sirove kože
prije soljenja otopinom moraju se oprati te zbog toga imaju manji postotak nečistoće. Kod soljenja
suhom soli sol se otapa samo na mesnom dijelu kože. Kože soljene suhom soli sadrže od 9,5 do
14% soli nakon soljenja, a kože soljene otopinom soli od 11 do 13%. Koža za vrijeme soljenja gubi
određenu količinu vlage koja je veće mase od mase soli koja se difundirala u kožu. Ovaj gubitak mase,
koji se nastavlja kasnije skladištenjem i sušenjem (isparivanjem), za vrijeme soljenja i skladištenja
nakon soljenja, nazivamo kalo. Kalo ovisi o vrsti kože (s obzirom na životinjsku vrstu), količini
masti, dlačnom pokrivaču, vrsti soli te o dobi životinje. Kože s većom količinom masti (ovce) imat
će manji gubitak mase nego kože koje ne sadrže mast (juneće) pod istim uvjetima soljenja. Masa
kože nakon soljenja povećava se kod koža s debelom vunom, a kod koža mlađih životinja, kod kojih
kolagen ima veću sposobnost da bubri, gubitak je vode manji negoli u starijih životinja pod istim
uvjetima soljenja i skladištenja. Ovaj je kalo manji kod mladih i dobro uhranjenih životinja. Kad kalo
prijeđe 20 % ulazne težine, znak je da se dio soli ponovno kristalizirao iz kožne vode, kože prelaze u
suho-slano stanje. Za konzerviranje krznarskih sirovina soljenjem suhom soli treba uzeti 30 do 50%
soli od težine svježe kože, a pri salamurenju treba na svakih 100 litara vode dodati 30 kg soli, a za
svaki kg kože u salamuri 0,25 kg soli. Tako Bayer navodi da je za prvo soljenje goveđih, bivolskih
i konjskih koža potrebno najmanje 25% soli od ulazne težine, a za svinjske teleće, pseće, ovčje,
janjeće, kozje i jareće najmanje 30% soli od ulazne težine kože.
Literatura
Bayer, Z. (1947.): Sirove kože divljači-Priručnik za izobrazbu stručnih kadrova, II nadopunjeno i prerađeno
izdanje. Nakladni Zavod Hrvatske Zagreb.
Bayer, Z. (1950.): Domaće sirove kože za krznarsku preradbu. Tehnička knjiga Zagreb.
Bayer, Z. (1978.):Sirova koža. Zagreb.
Standard GB1.001/1961.
Standad GB1.006/1985.
350
THE MOST COMMON JURIDICAL CASSES OF CATTLE SINCE
1923 -2007
NAJČEŠĆI SUDSKI SLUČAJEVI IZ GOVEDARSTVA OD 1923-2007.
Džaja P1., Z. Perić2, M. Vujić3, J. Kos4, Ž. Grabarević5, E. Šatrović6, J. Bagarić7, M.
Radačić8, B. Artuković5, A. Lokin9, *T. Zubak10
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Zagrebu
1
Veterinarska stanica grada Zagreba
2
student
3
Klinika za kirurgiju, ortopediju i oftalmologiju, Veterinarski. fakultet. u Zagrebu
4
Zavod za opću patologiju i patološku morfologiju, Veterinarski fakultet u Zagrebu
5
Zavod za sudsko i upravno veterinarstvo, Veterinarski fakultet u Sarajevu
6
7
Uprava za veterinarstvo, Sarajevo
Dalmacija vino, Split
8
9
Veterinarska ambulanta Pakoštane
student diplomski rad
10
ABSTRACT:
At the Department for forensic and juridical veterinary medicine, Faculty of Veterinary medicine, University
of Zagreb there were elaborated up to 440 juridical expertise of cattle related issues since 1923rd to 2007th
or approximately 5.17 cases over the year. The earliest juridical expertise of cattle related issues were made in
1930-1, 1931-4, 1932-1, 1933-1, 1936-1, 1937-1, 1938-1 etc. The most common juridical cases are related to the
fattening of beefs and calves 90 (20,45%), then follow 53 (12,61%) cases related to calving problems, 39 (8,86%)
cases related to digestion system, 34 (7,72%) cases of infective diseases, 26 (5,90%) cases of intoxication, 20
(4,54%) cases are associated to assessment of meat validity, then there were 22 (5%) cases of abortions, and 21
(4,77%) of other cases. From the rest of 135 (30,69%) cases, there were 13 (2,95%) most common cases related
to parasitological diseases, then 12 (2,72%) cases of liver, kidney and spleen diseases, problems related to
artificial insemination and absence of placenta, 11 (2,5%) cases of determination of fatherhood and fertility,and
10 (2,27%) cases of udder disease and prolepsis of vaginae. From the rest of 56 (12, 72%) cases there are 8 (1,
85%) problems associated with castration of bulls, 7 (1, 59%) related to transport, 6 (1, 36%) related to puerperal
paresis, deficiency diseases, respiratory diseases and veterinary service responsibilities, and 4 (0, 9%) cases
associated to assessment of age, eyes diseases and gravity diagnostic. On the rest of 11 expertise goes 2,5%.
Key words: cattle, juridical cases
SAŽETAK
U Zavodu za sudsko i upravno veterinarstvo Veterinarskog fakulteta u Zagrebu u razdoblju od 1923.
do 2007.g. izrađeno je ukupno 440 sudskih ekspertiza iz govedarske problematike ili prosječno 5,17 slučajeva
godišnje. Najranije sudske ekspertize iz govedarske problematike izrađene su 1930.-1, 1931.-4, 1932.-1,1933.1,1936.-1,1937.-1,1938.-1 itd. Najučestaliji su sudski slučajevi vezani za tov junadi i teladi- 90 (20,45%),
u svezi s teljenjem bilo ih je 53(12,61%), probavnim sustavom 42 (9,5%), zaraznim bolestima 34 (7,72%),
intoksikacijama 23 (5,2%), procjenom valjanosti mesa 20 (4,54%), pobačajem 22 (5%)i ostalim 21 (4,77%).
Od ostalih slučajeva 135 (30,69%) najučestaliji su oni vezani za parazitarne bolesti- 13 (2,95%), bolesti jetre,
bubrega i slezene, problemi vezani za U.O. i zaostajanje posteljice imali su po 12 slučajeva (2,72%), određivanje
očinstva i neplodnosti 11 (2,5%) i bolesti vimena i izvala rodnice po 10 (2,27%). Od ostalih 56 slučajeva
351
(12,72%) na probleme vezane za kastraciju bikova otpada 8 (1,85), transport 7 (1,59%), ležanje poslije poroda,
deficitarne bolesti, bolesti dišnog sustava i odgovornost veterinarske službe po 6 (1,36%), procjenu starosti,
bolest očiju i dijagnostiku graviditeta po 4 (0,9%) slučajeva. Na ostalih 11 ekspertiza otpada 2,5%.
Ključne riječi: goveda, sudski slučajevi
UVOD
Od prvih održanih predavanja školske godine 1923./24. iz predmeta sudsko veterinarstvo prof.
dr. sc. Ljudevita Juraka navodi se da se izrađuju sudske ekspertize iz sporova u trgovini stokom iz
cijele bivše države, a o kojima se redovito raspravljalo na sjednicama Profesorskog vijeća. One su
uglavnom imale obilježje fakultetskog nadmišljenja-superarbitrija. Kasniji nastavnik predmeta toga
prof. dr. sc. Ivo Babić, koji preuzima nastavu sudskog veterinarstva školske godine 1929./30., počinje
s prikupljanjem materijala za forenzičku zbirku, i to ne samo ekspertiza izrađenih na Fakultetu već i
sudskih presuda kotarskih sudova na kojima se raspravljalo o sporovima u trgovini stokom i stočnim
proizvodima. Iako se navodi da je prve ekspertize izradio prof. Jurak, ipak je vidljivo da su prve
ekspertize u Zavodu za sudsko veterinarstva iz govedarstva izrađene 1930. g., to jest za vrijeme
prof.dr. Ive Babića. Poslije će sudski slučajevi s Fakulteta biti prosljeđivani stručnjacima Zavoda.
Ako broju sudskih slučajeva iz govedarske prakse (440), koji su izrađeni u Zavodu za sudsko i
upravno veterinarstvo, dodamo 233 sudska slučaja vezana za konjogojstvo (od 1927.—1994.) i 82
slučaja izvan suda, proizlazi da je u Zavodu izrađeno ukupno 440 +233 +82 sudska slučaja vezanih
za govedarstvo i konjogojstvo, ili prosječno 8,8 slučajeva godišnje, plus svi drugi sudski slučajevi
vezani za drugu problematiku u svezi sa životinja, proizvodima, sirovinama, otpadom i dr. Za vrijeme
drugog svjetskog rata od 1940. do 1946.g. ne postoji ni jedna sačuvana izrađena ekspertiza, pa prvi
sudski slučajevi počinju pristizati na Fakultet 1946.-2, 1947.-3 itd., a svoj vrhunac dosegnut će od
1970. do 1980. godine.
REZULTATI i RASPRAVA
Razdvajanje sudskih ekspertiza po tematici nije uvijek bilo jednostavno zato što se u jednom
slučaju navodi različita problematika, to jest ponekada je uzrok uginuća tražen u više dijagnoza,
odnosno više je problema koji su uzrok sudskog slučaja. Kroz navedeno razdoblje izrađeno je 440
sudskih ekspertiza, od čega najviše otpada na tov junadi (20,45%), zatim na probleme pri teljenju
(12,34%), na probavni sustav 9,5%, zarazne bolesti 7,72%, otrovanje 5,2%, pobačaje 5% i procjenu
valjanosti mesa 3,54%. Svi gore navedeni razlozi zbog kojih se vode sudski slučajevi zastupljeni
su po 20 i više puta. Od deset do trinaest sudskih slučajeva zastupljeni su zbog parazitarnih bolesti
(2,95%), bolesti jetre, bubrega i slezene, zbog problema vezanih za U.O., zaostajanja posteljice po
2,72%, određivanje očinstva 2,5% te zbog bolesti vimena i izvale rodnice po 2,27%. Na ove sudske
slučajeva otpada ukupno 364 (83,58%). Problemi vezani za kastraciju bikova rješavali su se 8 puta
(1,8%), transport 7 (1,59), odgovornost veterinarski organizacija, deficitarne bolesti , ležanje poslije
poroda i dišni sustav po 6 (1,36%). Po 4 puta (0,95%) rješavani su problemi vezani za procjenu
starosti, bolesti očiju i dijagnostiku graviditeta. Iz dolje navedene tablice nije teško zaključiti da
na ginekološke probleme, probleme i bolesti produkcije otpada ukupno 148 sudskih slučajeva ili
33,63%.
352
Tablica 1. broj sudski slučajeva razvrstani prema problemu nastanka
01
02
03
04
05
06
70
08
09
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
Tema
Tov junadi i teladi
Teško teljenje
Probavni sustav
Zarazne bolesti
Otrovanja
Pobačaj
Procjena valjanosti mesa
Ukupno
Parazitarne bolesti
Bolesti jetre, bubrega i slezene
Problemi vezani za UO
Zaostajanje posteljice
Određivanje očinstva i neplodnosti
Bolesti vimena
Izvala rodnice
Ukupno
broj sudskih slučajeva
90
53
42
34
23
22
20
284
13
12
12
12
11
10
10
80
8
Kastracija bikova
Transport
Odgovornost veterinarski organizacija
Deficitarne bolesti
Ležanje poslije poroda
Dišni sustav
Procjena starosti
Bolest očiju
Dijagnostika graviditeta
Ukupno
Svi ostali
7
6
6
6
6
4
4
4
51
25
%
20,45
12,61
9,5
7,72
5,2
5
4,54
64,54
2,95
2,72
2,72
2,72
2,5
2,27
2,27
18.18
1,8
1,59
1,36
1,36
1,36
1,36
0,9
0,9
0,9
9
5,68
Iz tablice 2 vidljivo je da najviše sudskih slučajeva iz govedarske problematike otpada na tov
junadi -90 (20,45), od čega zbog neispunjenja očekivanih rezultata otpada 46 (51,11%), pneumonije
14 (15,55%), prevelikog utroška hrane u tovu 9 (10%), nekvalitetne krmne smjese u tovu 6 (6,66%).
Na ove slučajeve otpada ukupno 75 (83,33%) od broja slučajeva u tovu ili 17% od ukupnog broja
slučajeva. Na svu ostalu problematiku u tovu otpada 16,66%.
Tablica 2. Sudski slučajevi u svezi s problemom tovu junadi.
Tov teladi i junadi
Problem
Tov teladi i junadi problemi vezani za neočekivan rezultat
Pneumonije
Prevelik utrošak hrane
Nekvalitetna krmna smjesa
Produžen tov
Nedostatak hrane u tovu
Tov zimi
Otuđivanje junadi
Neredovito napajanje
Problem ulazne težine
Nepovoljni zooh. uvjeti
Bakteriološki loša hrana
Utrošak kukuruza u tovu
Prehrana sušenom sirutkom
Ukupno
Broj 90
46
14
9
6
4
2
2
1
1
1
1
1
1
1
90
% od broja
vezanih za
probavni sustav
51,11
15,55
10
6,66
4,44
2,22
2,22
1,11
1,11
1,11
1,11
1,11
1,11
1,11
% od
ukupnog broja
slučajeva
20,45
10,45
3,18
2,04
1,36
0,9
0,45
0,45
0,225
0,225
0,225
0,225
0,225
0,225
0,225
353
Iz tablice 3. vidljivo je da na probleme vezane za pomoć pri teškom teljenju otpada 53
slučajeva (12,045%), od čega je najučestaliji problem vezan za stručnu pogrješku pri pomoći kod
teljenja- 16 (30,18%), na rupturu uterusa pri teljenju, bez obzira na odgovornost, 14 (26,41%),
uginuće krave nakon teljenja 5(9,43%), te na teško teljenje nepoznata razloga 4 slučaja (7,54%).
Navedena problematika zastupljena je s 39 slučajeva (73,58%), a na sve ostale otpada 14slučajeva
(26,42%).
Tablica 3. Sudski slučajevi u svezi s teškim teljenjem
Sudski slučajevi
Stručna pogreška
Ruptura uterusa
Uginuće krave nakon teljenja
Teško teljenje
Trauma poslije teljenja
Prevelik plod
Carski rez
Torzija maternice
Iskrvarenje nakon teljenja
Ozljeda laika pri teljenju
Odbijanje pružanja pomoći
Loša pomoć bolničara
Asfiksija ploda
Teljenje uz pomoć laika
Broj 53
16
14
5
4
3
2
2
2
1
1
1
1
1
1
% od broja slučajeva
vezani za probavni sustav
30,18
26,41
9,43
7,54
5,66
3,77
3,77
3,77
1,88
1,88
1,88
1,88
1,88
1,88
% od ukupnog broja
slučajeva
12,045
3,63
3,18
1,13
0,90
0,68
0,45
0,45
0,45
0,225
0,225
0,225
0,225
0,225
0,225
U tablici 4 prikazani su sudski slučajevi nastali u svezi s problemom probavnog sustava- 42
(9,54%). Najbrojniji su problemi vezani za strano tijelo -26 (61,90%), upala crijeva i akutni nadam
po 4 (9,52%), a na svu ostalu problematiku vezanu za probavni sustav otpada 8 (19,1%) slučajeva.
Tablica 4. Sudski slučajevi nastali u svezi s probavnim sustavom
Problem u svezi probavnog
sustava
Strano tijelo
Upala crijeva
Akutni nadam
Alimentarna inoksikacija
Opstrukcija jednjaka
Alimentarna indigestija
Začep
vezani za probavni sustav
Broj 42
26
4
4
3
2
2
1
61,90
9,52
9,52
7,14
4,76
4,76
2,38
% od ukupnog broja
slučajeva
9, 54
5,90
0,90
0,90
0,68
0,45
0,45
0,225
Tablica 5 prikazuje sudske slučajeve vezane za zarazne bolesti kojih je bilo 34 (7,72%), od čega
su problemi vezani za tuberkulozu i tuberkulinizaciju zastupljeni s 13 (38,23%), liječenje bedrenice
i cijepljenje protiv bedrenice 9 (26,47%), slučajeva a dok na sve ostale bolesti otpada 12 (35,29%)
slučajeva.
354
Tablica 5. Sudski slučajevi svezi s pojavom zaraznih bolesti
Zarazne bolesti
Tuberkuloza i tuberkulinizacija
Bedrenica i cijepljenje bedrenice
Parainfluenca
Enzootska leukoza
Aujeczsky
Aktinomikoza
Trihomonijaza
Šuštavac
Parašuštavac
Slinavka i šap
Rinotraheitis
Spolni osip
Broj 34
13
9
2
2
1
1
1
1
1
1
1
1
% od broja slučajeva vezani za probavni sustav
38,23
26,47
5,88
5,88
2,94
2,94
2,94
2,94
2,94
2,94
2,94
2,94
% od ukupnog broja
slučajeva
7,72
2,95
2,04
0,45
0,45
0,225
0,225
0,225
0,225
0,225
0,225
0,225
0,225
Problemi vezani za intoksikaciju goveda bili su predmet 23 (5,22%) sudska slučaja, od čega je
najbrojnija pitanje, jesu li životinje otrovane- 5 (21,73%) slučajeva, te odgovornost za otrovanje i
otrovanje protumetiljom bili su predmet po 3 (13,04%) slučaja te otrovanje urejom i kuhinjskom
solju 2 (8,69%) slučajeva. Na ostale probleme otpada 8 slučajeva (34,78%).
Tablica 6. Sudski slučajevi u svezi s intoksikacijom goveda
Problem Trovanje
Otrovanje
Odgovornost za otrovanje
Otrovanje protumetiljom
Otrovanje urejom
Otrovanje NaCl
Otrovanje Pb
Otrovanje meksakloretanom
Otrovanje kreazanom
Otrovanje neguvanom
Otrovanje severinom
Otrovanje distocidom
Otrovanje umjetnim gnojivom
Otrovanje tiadanom
Boj 23
5
3
3
2
2
1
1
1
1
1
1
1
1
vezani za probavni
sustav
21,73
13,04
13,04
8,69
8,69
4,35
4,35
4,35
4,35
4,35
4,35
4,35
4,35
% od ukupnog broja
slučajeva
5,22
1,13
0,68
0,68
0,45
0,45
0,225
0,225
0,225
0,225
0,225
0,225
0,225
0,225
Iz tablice 7 proizlazi da su problemi vezani za pobačaj zastupljeni u 22 (5%) sudske
ekspertize, od čega su najbrojniji određivanje uzroka pobačaja u -6 (27,27%), traumatski pobačaj u
4 (18,18%) te određivanje odgovornosti za pobačaj, određivanje uzroka uginuća ploda, te pobačaj
nakon tuberkulinizacije u po 3 (13,63%) ekspertize. Na ostale problemi odnose se 3 slučaja.
355
Tablica 7. Sudski slučajevi nastali zbog problema vezanih za pobačaj goveda
Problem-pobačaj
Pobačaj-uzrok
Traumatski pobačaj
Odgovornost za pobačaj
Uginuće ploda
Brucelozni pobačaj
Pobačaj nakon tuberkulinizacije
Pobačaj nakon cijepljenja protiv bedrenice
Pobačaj-hernia uterusa
Broj 22
6
4
3
3
1
3
1
1
% od broja slučajeva vezani
za probavni sustav
27,27
18,18
13,63
13,63
4,54
4,54
4,54
4,54
% od ukupnog broja slučajeva
5
1,36
0,90
0,68
0,68
0,225
0,225
0,225
0,225
U tablici 8. prikazano je 17 (3,86%) sudskih slučajeva koji se odnose na procjenu valjanosti
mesa, od čega se 8 (47,05%) odnosi na valjanost procjene mesa, procjenu mesa -klanje iz nužde 3
(17,64%), 2 (11,76%) slučaja odnose se na prodaju nepregledana mesa. Na ostale probleme odnose
se 4 sudska slučaja.
Tablica 8. Sudski slučajevi vezani za procjenu valjanosti mesa
Problem: procjena valjanosti mesa
Je li procjena mesa valjana
Klanje iz nužde
Prodaja nepregledana mesa
Odgovornost za pregled
Nesavjestan pregled
Pregled-privredni pijrestup
Ritualno klanje
Broj 17
8
3
2
1
1
1
1
vezanih za probavni sustav
47,05
17,64
11,76
11,76
5,88
5,88
5,88
3,86
1,81
0,68
0,45
0,45
0,225
0,225
0,225
U tablici 9. prikazano je 13 (2,95%) sudskih slučajeva, od čega se na metiljavost odnosi
9 (69,23%) slučajeva, dok se ostala 4 slučaja odnose na ehinokokozu, cisticerkozu, distamozu i
sarkosporidiozu.
Tablica 9. Sudski slučajevi vezani za zarazne bolesti
PARAZITI
Metiljavost
Ehinokokoza
Sarkosporidioza
Cisticerkoza
Distomatoza
13
9
1
1
1
1
vezanih za probavni sustav
69,23
7,69
7,69
7,69
7,69
2,04
0,225
0,225
0,225
0,225
U tablici 10 prikazano je 12 slučajeva vezanih za bolesti bubrega, jetre i slezene. Na krvavo
mokrenje odnose se 6 (50%), na pijelonefritis 3 (25%)a na kronične upale jetre, apscedirajuću upalu
slezene i nefritis odnose se tri sudska slučaja.
356
Tablica 10. Sudski slučajevi vezani za bolesti jetre, slezene i bubrega
BOLESTI JETRE, SLEZENE I BUBREGA
Hematuria
Pijelonefritis
Kronična upala jetre
Apscedirajuća upala slezene
Nefritis
Broj 12
6
3
1
1
1
50
25
8,33
8,33
8,33
1,36
0,68
0,225
0,225
0,225
U tablicama 11,12,13 prikazano je po 12 (2,72%) sudskih slučajeva vezanih za umjetno
osjemenjivanje, određivanje neplodnosti i očinstva te zaostajanje posteljice.
Od 12 slučajeva vezanih za umjetno osjemenjivanje 9 (75%) se odnosi na stručnu pogrešku
pri liječenju, a 2 (16,66%) na pobačaj nakon umjetnog osjemenjivanja.
Tablica 11. Sudski slučajevi vezani umjetno osjemenjivanje
UO
Sručna pogjreška
Pobačaj nakon UO-stručna pogrješka
UO-negravidnost
Broj 12
9
2
1
75
16,66
8,33
2,72
2,04
0,45
0,225
Tablica 12. Sudski slučajevi vezani za određivanje neplodnosti
Određivanje neplodnosti i očinstva
Procjena neplodnosti bika
Određivanje valjanosti pedigrea
Određivanje očinstva
Određivanje proizvodnih svojstava
12
8
2
1
1
66,66
16,66
8,33
8,33
2,72
1,81
0,45
0,225
0,225
Tablica 13. Sudski slučajevi vezani za zaostajanje posteljice u krava
Retencija sek.
Retenciaj sec.
Hidrops plodnih ovojnica i ret. Sec.
Retencija-Piometra
Retencija-ruptura uterusa
Retencija-endometritis
12
7
2
1
1
1
58,33
16,66
8,33
8,33
8,33
2,72
1,59
0,45
0,225
0,225
0,225
Tablica 14. Sudski slučajevi vezani za izvalu rodnice
Izvala rodnice
Izvala rodnice-pružanje pomoći pri
teljenju
Izvala rodnice-pogrješka u liječenju
10
8
2
80
20
2,27
1,81
0,45
357
Tablica 15. Sudski slučajevi vezani za bolest i nedostatke vimena
Bolesti i nedostaci vimena
Mastitis
Jamstvo za mliječnost
Nerazvijeno vime
Jamstvo za bolest sise
Jamstvo za zdravo vime
Nedostaci na sisama
10
5
1
1
1
1
1
2,27
1,13
0,225
0,225
0,225
0,225
0,225
50
10
10
10
10
10
Tablica 16. Sudski slučajevi vezani za kastraciju bikova
Kastracija bikova
Kastracija burdizzo kliještima
Katracija-stručna pogrješka
Sepsa poslije kastracije
Odgovornost za kastraciju
Katracija-šuštavac
Kastracija-parašuštavac
8
2
2
1
1
1
1
25
25
12,5
12,5
12,5
12,5
1,81
0,45
0,45
0,225
0,225
0,225
0,225
Tablica 17. Sudski slučajevi vezani za transport
Transport
Uginuće u transportu
Određivanje kala u transportu
Transport-akutna slabost srca
Transport teladi –kaznena odgovornost
7
3
2
1
1
42,85
28,57
14,28
14,28
1,59
0,68
0,45
0,225
0,225
Tablica 18. Sudski slučajevi u svezi s dišnim sustavom
Bolesti dišnog sustava
Upala pluća 5
Emfizem
6
5
1
83,33
16,67
1,36
1,13
0,225
Tablica 19. Ostali sudski slučajevi
Ležanje poslije poroda
Ležanje poslije poroda-uginuće i klanje
6
5
1,36
1,13
Defiicitarne bolesti
6
1,36
4
4
4
6
35
0,90
0,90
0,90
1,36
Procjena starosti prema zubima
Određivanje graviditeta
Bolesti očiju
Odgovornost veterinarski organizacija
Ostalo
U tablicama 14, 15 i 16 prikazani su sudski slučajevi vezani za izvalu rodnice, bolesti i
nedostatke vimena te kastraciju bikova. Od 10 sudskih slučajeva vezanih za izvalu rodnice 8 ih se
odnosi na optužbu veterinara koji je pomagao pri teškom porodu i nakon čije je intervencije nastala
izvala rodnice, a u 2 slučaja veterinar je optužen da je napravio pogrješku u liječenju. Od 10 sudskih
slučajeva vezanih za bolest i nedostatke vimena 5 se odnosi na mastitis, ostalih pet zastupljeno je po
jedanput, a odnose se na jamstvo za mliječnost, nerazvijeno vime, jamstvo za bolest sise, na jamstvo
za zdravo vime i sise. Od 8 sudskih slučajeva vezanih za kastraciju bikova po dva se odnose na
358
kastraciju burdizzo kliještima te stručne pogrješke koje su nastale obavljanjem kastracije. Ostala 4
slučaja odnose se na sepsu poslije kastracije, na odgovornost za kastraciju te na nastanak parašuštavca
i šuštavca nakon kastracije.
U tablici 17 prikazani su sudski slučajevi nastali zbog transporta životinja, a koji se odnose
na uginuće poslije transporta- u 3 slučaja, određivanje transportnog kala u 2 slučaja, te na akutnu
slabost srca i kaznenu odgovornost za transport junadi u po jedan slučaj. U tablici 18 prikazani su
sudski slučajevi vezani za probleme dišnog sustava, a koji se odnose na upalu pluća u 5 i emfizem
pluća u jednom slučaju. U tablici 19 prikazani su sudski slučajevi koji se odnose na ležanje poslije
poroda i deficitarne bolesti, na odgovornost veterinarskih organizacija u po 6 slučajeva, ležanje
poslije poroda u 5 slučajeva, te na procjenu starosti prema zubima, određivanje graviditeta i bolest
očiju u po 4 slučaja.
LITERATURA
Džaja P., J Perić (1994.). Pregled forenzičkih slučajeva zbog bolesti i mana u konja. Vet. st. 25,6,1994.
Pismohrana Zavoda za sudsko i upravno veterinarstvo.
Winterhalter M. Spomenica 1919-1969.. Zagreb 1969.
359
360
Outbreak of the BVDV induced gastro-neuropathy in a
feedlot calves around Tehran (Iran)
POJAVA BVDV-OM INDUCIRANE NEFROPATIJE KOD TELADI U
OKOLICI TEHERANA (IRAN)
Bazargani T.T.1, Hemmatzadeh F.2, Nadjafi J.3 and Sadeghi-Nasab A.*4
Department of Clinical Science, Faculty of Veterinary Medicine, University of Tehran, Iran.
2
3
Department of Microbiology, Faculty of Veterinary Medicine, University of Tehran, Iran.
Department of Pathobiology, Veterinary Reference Laboratory, Iran Veterinary Organization, Tehran, Iran.
4
Junior school of veterinary medicine, Bu-Ali Sina University, Clinical Sciences, Hamedan, Iran
*Corresponding author’s e-mail: [email protected]
Abstract
After an out break of a lethal disease with the signs of the CNS as well as the GI system (GIs) engagement
in 4-6 month old Holstein calves of a feedlot around Tehran, necropsy samples of GIs, liver, kidney, spleen and
lung from 3 died animals referred for histopathologic examination. Blood and formalin fixed ear notch samples
of 6 sick calves submitted for RT-PCR, Antigen-Capture ELISA (ACE) and Immunohistochemistry (IHC) of the
BVDV. Results of ACE of buffy coats were negative but RT-PCR of all 6 cases and IHC of 4 cases were positive
for BVDV infection. In the presence of clinical signs, macroscopic and microscopic pathology findings in the
GI and brain and laboratory results, we strongly suggest that the BVDV may represent a gastro-neuropathogen
strain. To the best of our knowledge, this is the first outbreak report of gastro-neuropathogenic BVDV infection,
maybe acquired postnatally.
Key words: BVDV, Gastro- neuropathogen strain, RT-PCR, Immunohistochemistry, Histopathology
Sažetak
Ustanovljena je pojava atipičnog i značajno težeg oblika infekcije BVDV-a, koja je zahvatila sve dobne
kategorije goveda. U ovom radu opisana je pojava BVDV-a u obliku nefropatije teladi.
Materijali i metode
Nakon pojave febrilne, letalne bolesti, sa znakovima CNS-a i gastrointestinalnim poremećajima kod teladi
Holsteinske pasmine u dobi od 4-6 mjeseci, izvršena je razudba, te su od tri uginule životinje uzeti uzorci
probavnog sustava, jetre, bubrega, slezene i pluća za patohistološku dijagnostiku. Od 6 bolesnih životinja uzet
je uzorak krvi, te uzorak uha fiksiran formalinom za različite anlize BVDV-a, tj. za RT-PCR, Antigen-Capture
ELISA (ACE) i imunohistokemiju (IHC) analizu. Klinička slika se sastojala od stomatitisa sa nekrozama na
nepcu, desnima, na dorzalnoj i ventralnoj strain jezika, običnih ili hemoragičnih proljeva i izrazite depresije,
ležanja i uginuća. Neka telad je pokazivala znakove nekoordinacije i konvulzija, te je takva uvijek i uginula.
Rezultati
Nađena je izrazita hiperemija, proširena i vrlo izražena hidropična degeneracija mukoznog sloja usta i
jednjaka, hiperemijai i infiltracija upalnim stanicama submukoze papilla buraga. U sirištu je pronađen jaki
edem, hiperemija s infiltracijom upalnih stanica i nekroza i erozije mukoze. Na mukozi debelog i tankog crijeva
nađeni su znakovi su cistične degeneracije. U uzorku mozga nađena je hiperemija meningi, glioza te neutrofilna
infiltracija leukocita infiltracija, dok je u malom mozgu prevladvala hiperemija.
Zaključak
Na osnovu kiničke slike, makroskopskih te mikroskopskih nalaza u probavnom sustavu i mozgu zaključili
smo da se radi o gastro-neurološkom soju BVDV-a. Akutni neurološki znakovi su se podudarali sa spomenutim
361
mikroskopskim i laboratorijskim nalazima. Uzevši u obzir stupanj lezija, zaključili smo da su životinje
uginule od akutnog meningoencefalitisa. Koliko nam je poznato, ovo je prvi opisani slučaj pojave postnatalne
neuropatogene BVDV infekcije.
Ključne riječi: BVDV, gastro-neuropatogen, RT_PCR, imunohistokemija, histopatologija
Introduction
Bovine viral diarrhea virus (BVDV) belongs to the Pestivirus genus, Flaviviridae family which
is an important worldwide viral pathogen of cattle causing many of disease syndromes (Brock, 2004;
Hemmatzadeh et al., 2006; Nettleton and Entrican, 1995). The virus has been described as affecting
the reproductive, respiratory, gastrointestinal, circulatory, immune, lymphatic, musculoskeletal,
integument and the central nervous systems (Brock, 2004). Prenatal infection of the BVDV can also
result in homologous immunotolerance and persistent infection (PI) and its complications as mucosal
disease (MD) in PI animals (Brock, 2004; Nettleton and Entrican, 1995).
In a Holstein breed feedlot around Tehran, with 800 populations which 270 of them stabled
in 3 separate yards, 4-6 month old calves were affected in severe outbreak of a fatal disease. At
risk animals transported in different party to the feedlot from dairy farms of around Tehran after
weaning. These calves fed on alfalfa, hay, corn silage, ground corn, ground oat, cotton seed meal,
soy bean meal, beet pulp. For dealing with disease at the first step, after history taking, at least 25
cases clinically examined carefully and 3 dead cases were necropsied. At the second step and nearly
3 weeks later, blood and ear notch samples were collected from 6 Holstein calves 4 to 6 months old
with the same clinical and macroscopic signs. Blood samples were collected from jugular vein in 10
ml vacutainer tubes contain 1 ml of 3.85% sodium citrate and delivered to the laboratory in the ice
containers (4 °C) maximum within 24 h.
The skin biopsies were collected from the distal part of the ear using an “ear notcher” to obtain a
cylindrical 1 cm diameter of the ear pinna. Notcher was washed with water and disinfected with 2%
formalin solution between each collection. Samples were fixed in 10% buffered formalin solution.
Formalin fixed specimens of palatine, esophagus, rumen, abomasum, small and large intestines,
brain, kidney, lung, liver, spleen 3 dead cases of disease were performed and referred to pathology
lab for sectioning and Hematoxylin-and-eosin staining.
3-1) Antigen-Capture ELISA (ACE): Detection of BVDV antigen in Buffy coat cells was
performed using a commercially available kit (Pestivirus antigen detection kit, Moredun Scientific
Limited, UK). According to the manufacturer’s instructions, after sample preparation and antigen
extraction, assay protocol at 450 nm within 30 minutes and based on recommended OD limits (C1
>0.8, C2 = 0.4-0.6, C3 = 0.2-0.4, C4<0.2) was performed.
3-2) Reverse Transcription–PCR (RT-PCR): Reverse transcription–PCR, as described (Vilcek
et al., 1994) and modified previously (Moakhar et al., 2004), was performed on buffy coat samples
from all examined calves.
TriPure isolation reagent (Roche diagnostic GmbH, Mannheim, Germany) was employed for
RNA extraction. After this stage cDNA was synthesized and then PCR procedure was performed
(Moakhar et al., 2004; Vilcek et al., 1994)
One primer set, forward (5’-ATGCCCTTAGTAGGACTAGCA-3’) and reverse
(5’-TCAACTCCATGTGCCATGTAC-3’) specific for all of pestiviruses was used for RT-PCR
362
according to Vilcek et al (1994) which was modified by Kargar Moakhar et al (2004). In this PCR
process, one positive cDNA derived from NADL strain and one negative cDNA obtained from noninfected cell culture was used as positive and negative control, respectively. The electrophoresis
analysis of the PCR products was run in 1.5% agarose gel using TAE buffer at 100V for 45 min.
Visualization of ethidium bromide stained DNA bands was performed by a UV transilluminator and
gel images were printed using video camera and thermal printer.
3-3) Immunohistochemistry (IHC): From formalin fixed ear notch samples referred to pathology
lab serial sections were performed. Five-micrometer tissue sections were mounted on poly-L-lysinecoated slides and stained for BVDV by using a manually procedure adapted from a previously
described technique (Haines et al., 1992). Anti-BVDV (pesti) monoclonal antibody labelled with
fluorescein isothiocyanate (BIO 316, Bio-X diagnostics kit, Belgium) was used. Stained sections
were examined by fluorescent microscopy. Positive IHC staining for BVDV was green fluorescent
evidnce within the cytoplasm of keratinocytes of epidermis and hair follicles, sebaceous epithelial
cells, mononuclear cells in dermis, vascular smooth muscle cells and chondrocytes.
Results
4-1) Clinical findings: Fever (40-42 ˚C), sever anorexia, hyperpnoea and coughing, nose
mucopurulent discharge, conjunctivitis, stomatitis with erosions in the palatine, gum, dorsal and
ventral side of tongue, simple or hemorrhagic diarrhea with or without melena and progressive weight
loss and severe depression, recumbency and death were the most important signs in the affected
calves. In addition, some calves showed incoordination and severe convulsion. All of calves with
these later signs died.
4-2) Macroscopic pathology findings: Besides the lesions mentioned in clinical findings section,
single and multifocal erosions of esophagus, ruminitis with clumping of its villie, multifocal erosive
abomasitis with dark containing were observed. Enteritis in small and large bowels with zebra line
and some time melna in large intestine were obvious sings. Hyperemia of the brain and cerebellum
surface was another symptom (Figure 1A).
4-3) Laboratory examination findings:
4-3-1) Microscopic pathology: Hyperemia, widespread and severe hydropic degeneration of
mucosal layer of mouth and esophagus and edema, hyperemia of submucosal layer with infiltration
of inflammatory cells in rumen villie were remarkable.
Severe edema, hyperemia, with infiltration of inflammatory cells to submucosal layer and
widespread necrosis and erosion of mucosal layer of abomasums were seen. Severe edema, hyperemia,
with extention of inflammatory cells to submucosal layer and widespread necrosis and erosion of
mucosal layer of small and large intestine with cystic degeneration of mucosal layer were obvious
signs.Hyperemia of meninges, gliosis and mild neutrophilic lymphocytic PVC in the brain specimen
(Figure 1B-D) as well as hyperemia of cerebellum were nervous microscopic pathology signs.
363
Figure 1) Hyperemia of the brain surface (A), meninges (B), Hyperemia & mild neutrophilic lymphocytic
PVC (C), gliosis (D) in the brain specimen (H&E staining, 10.20×)
Abnormalities of lung specimen including hyperemia, atelectasia and emphysema, hyperplasia
of pneumocytes and severe interstitial pneumonia, were observed. Interstitial nephritis with dilatation
of tubules, squamous forming of tubular cells as a reason of hyperemia and proteinuria (nephritic
syndrome) were detected in the kidney samples.
4-3-2) ACE, RT-PCR and IHC: Results of ACE test were negative in all of 6 cases, but 4 cases
were positive in IHC (Figure 2) and all cases were positive in RT-PCR.
364
Figure 2) Positive IHC staining for BVDV. Green fluorescent evidence within the cytoplasm of keratinocytes
(A1, A2, B3), sebaceous epithelial cells (C5, D6), mononuclear cells of dermis (C4), chondrocytes (D7).
Discussion
According to history, clinical, macroscopic and microscopic pathology findings and severity of
the outbreak, the disease is highly resembled to BVDV infection.
It is likely that the 4 IHC positive calves were undergoing an acute BVDV infection and were
viremic at the time of testing. Detection of BVDV in skin by IHC following acute or persistent
infection has been reported to be inconsistent (Baszler et al., 1995; Brodersen, 2004; Brock et
al., 1998; Cornish et al., 2006; Fredriksen et al., 1999; Grooms and Keilen, 2002; Haines et al.,
1992; Luzzago et al., 2006; Njaa et al., 2000; Ridpath et al., 2002; Thur et al., 1996). Principally,
interpretation of IHC sections is highly objective and this problem will be worsening when these
sections are prepared badly (Ellis et al., 1995), more than 2 weeks formalin fixation (Luzzago et al.,
2006), lack of sufficient virus antigen (Njaa et al., 2000) and presence of virus-antibody complex in
the examined skin sections (Baszler et al., 1995) are the likely reason for these results.
RT-PCR can detect genome of neutralized and semi neutralized viruses, in contrast, neutralizing
antibodies can mask viruses and make negative ACE results (Brock, 2004; Brock et al.,1998; Cornish
et al.,2006; Houe et al., 2006; Saliki and DuBois ,2004; Sandvik, 2005), and this might be the reason
for different results of RT-PCR and ACE. In contrast of, viral antigen may be detectable in tissues
for an extended time after the virus has been cleared from the blood (Cornish et al., 2005; Grooms
365
and Keilen, 2002) and is not affected by maternal (Grooms and Keilen, 2002) or humoral antibodies
(Brodersen, 2004).
It is speculated that cold, high velocity wind and remarkable difference between night and day
temperature stress and immunosuppressant effect of BVDV, accompanied by decline of maternal
immunity might be the reason for this severe incidence. Different type of GI tract lesions from mouth
to terminal intestine is the pathogenesis effect of BVDV (Brock, 2004; Nettleton and Entrican, 1995).
Furthermore, BVDV Type 2–Induced Meningoencephalitis in a 15-month-old, female Angus Heifer,
with a 48-hour history of central nervous system engagement is reported (Blas-Machado et al., 2004)
and to the best of our knowledge, this article is the second report of neuropathy of BVDV infection,
and first outbreak of gastro-neuropathy due to this virus infection acquired postnatally.
In general, little is known about the mechanisms of neuropathy and neurovirulence of BVDV in
cattle. The most commonly reported brain lesion in calves with transplacental infection of BVDV
is cerebellar hypoplasia often associated with hydranencephaly, hydrocephaly, microencephaly and
or porencephaly. The acute neurological signs observed in these cases were consistent with the
microscopic and laboratory findings described before and the severity of the lesions indicates that
these animals died from acute meningoencephalitis associated with BVDV infection (Blas-Machado
et al., 2004).
Like the first report (Blas-Machado et al., 2004) on the basis of our findings, we propose that
the BVDV detected in these cases may represent a neurovirulent strain of the virus. Additional
studies are needed to corroborate such proposed mechanisms of BVDV type 2 neurovirulence and
neuropathogenicity in cattle. Additional studies are needed to determine genotype and biotype of
virus and confirm such neuropathogenicity mechanisms of BVDV in cattle.
Acknowledgments
With the best thanks of Dr. Parvaneh Seifoori, Miss Tybeh Ghasemi and Mr. Mohammad Mehdi Ghaffari for
their experted supports and technical procedure in the microbiology and pathobiology lab.
References
Baszler, TV; Evermann, JF; Kaylor, PS; Byington, TC and Dilbeck, PM (1995). Diagnosis of naturally occurring
bovine viral diarrhea virus infections in ruminants using monoclonal antibody-based immunohistochemistry.
Vet. Pathol. 32, PP: 609-618.
Blas-Machado, U; Saliki, JT; Duffy, JC and Caseltine SL (2004). Bovine Viral Diarrhea Virus Type 2–Induced
Meningoencephalitis in a Heifer. Vet. Pathol. 41, PP: 190-194.
Brock, KV (2004). The many faces of bovine viral diarrhea virus. Veterinary Clinics of North America: Food
Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 1-3 & 76.
Brock, KV; Grooms, DL; Ridpath, JF and Bolin, SR (1998). Changes in levels of viremia in cattle persistently
infected with bovine viral diarrhea virus. J. Vet. Diagn. Invest.10(1),PP: 22-26
Brodersen, BW (2004). Immunohistochemistry used as a screening method for persistent bovine viral diarrhea
virus infection. Veterinary Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus.
20, PP: 85-93.
Cornish, TE; Olphen, AL; Cavender, JL; Edwards, JM; Jaeger, PT; Vieyra, LL; Woodard, LF; Miller, DF and
O’Toole D (2005).Comparison of ear notch immunohistochemistry, ear notch antigen-capture ELISA, and
buffy coat virus isolation for detection of calves persistently infected with bovine.viral diarrhea virus. J.
Vet. Diagn . Invest. 17, PP: 110–117.
Ellis, JA; Martin, K; Norman, GR and Haines, DM (1995). Comparison of detection methods for bovine viral
diarrhea virus in bovine abortions and neonatal death. J Vet Diagn Invest. 7: 433-436.
366
Fredriksen, B; Press, CM; Sandvik, T; Odegaard, SA and Loken, T (1999). Detection of viral antigen in placenta
and fetus of cattle acutely infected with bovine viral diarrhea virus.Vet. Pathol.36, PP: 267-275.
Hemmatzadeh, F; Mommtaz, H; Keyvanfar, H and Bani-hasan, E (2006). Antigenic pattern of BVDV isolated
in IRAN. Indian Veterinary Journal. 82(10), PP: 1048-1050.
Grooms, DL and Keilen, ED (2002).Screening of Neonatal Calves for Persistent Infection with Bovine Viral
Diarrhea Virus by Immunohistochemistry on Skin Biopsy Samples. Clin. Diagn. Lab. Immunol. July; 9(4),
PP: 898–900.
Haines, DM; Clark, EG and Dubovi, EJ (1992). Monoclonal antibody-based immunohistochemical detection of
bovine viral diarrhea virus in formalin-fixed, paraffin-embedded tissues. Vet. Pathol.29, PP: 27-32.
Houe, H; Lindberg, A and Moennig, W (2006). Test Strategies in Bovine Viral Diarrhea Virus Control and
Eradication Campaigns in Europe. J. Vet. Diagnos. Invest. 18, PP: 427-436.
Luzzago, C; Frigerio, M; Tolari, F; Mazzei, M; Salvadori, C; Del Piero, F and Arispici M (2006). Indirect
immunohistochemistry on skin biopsy for the detection of persistently infected cattle with bovine viral
diarrhoea virus in Italian dairy herds. New Microbiology. 29, PP: 127-131.
Moakhar, KR; Akhavizadegan, MA; Hemmatzadeh, F and Amini, F (2004). Genotyping of Different Pestivirus
Isolates by RT-PCR and RLFP technique. Arch. Razi Ins. 58, PP: 1-8.
Nettleton, PF and Entrican, G (1995). Ruminant pestiviruses. Br Vet J. 151, PP: 615-642.
Njaa, BL; Clark, EG; Janzen, EJ; Ellis, JA and Haines, DM (2000). Diagnosis of persistent bovine viral
diarrhea virus infection by immunohistochemistry staining of formalin-fixed skin biopsies. J. Vet. Diagn.
Investigation. 12,PP: 393-399.
Ridpath, JF; Hietala, SK; Sorden, S and Neill, JD (2002). Evaluation of the reverse transcription-polymerase
chain reaction/probe test of serum samples and immunohistochemistry of skin sections for detection of
acute bovine viral diarrhea infections. Journal of Veterinary Diagn Investigation. 14 (4), PP: 303-307.
Sagar, MG and Ridpath, JF (2005): Bovine Viral Diarrhea Virus: Diagnosis, Management and Control.Blackwell
Science Ltd. London, UK. PP: 123-124.
Saliki, JT and DuBois, WR (2004). Laboratory diagnosis of bovine viral diarrhea virus infections. Veterinary
Clinics of North America: Food Animal Practice. Bovine Viral Diarrhea Virus. 20, PP: 69-83.
Sandvik, T (2005). Selection and use of laboratory diagnostic assays in BVD control programs. Preventive Vet.
Med. 72, 1-2, 3-16.
Thur, B; Zlinszky, K and Ehrensperger, F (1996). Immunohistochemical detection of bovine viral diarrhea virus
in skin biopsies: a reliable and fast diagnostic tool. J. Vet.med. B 43, PP: 163-166.
Vilcek, S; Herring, AJ; Nettlton, PF; Lowings, JP and Paton, DJ (1994). Pestiviruses isolated from pigs, cattle
and sheep can be allocated into at least three genogroups using polymerase chain reaction and restriction
endonuclease analysis. Arch. Virol. 136, PP: 309-323.
367
368
Comparison of conventional and digital radiography of
phalangeal bone and soft tissue in cattle
Usporedba konvencionalne i digitalne radiografije
kosti i mekih česti falangi goveda
M. Šehić1, V. Butković, D. Stanin1, B. Škrlin1, B. Radišić2, J. Kos2
1
Department of Radiology, Ultrasound Diagnostics and Physical Therapy Faculty of Veterinary Medicine,
University of Zagreb, Heinzelova 55
2
Department of Surgery, Orthopaedics and Ophthalmology, Faculty of Veterinary Medicine, University of
Zagreb, Heinzelova 55
Abstract
Conventional radiological diagnostics using imaging on an x-ray film has been in use for more than a
century. The principle of this diagnostics lies in the detection of x-ray radiation on film which is then developed
relatively slowly, manually or mechanically, in dark rooms and then stored in overcrowded archives. The
diagnostic image is obtained by using cassettes in which the x-ray films are placed. The cassettes contain
fluorescent foils which transform the incoming x-ray radiation into light radiation of a certain spectrum. As the
film and the foil are in contact, this leads to a direct exposure of the x-ray film. The exposed film is developed by
a chemical process and contains a permanent recording of the organic structure which is of diagnostic interest.
New radiological diagnostic devices, contrary to the previous ones, do not use recording on the cassette, but
have digital detectors instead. Digital detectors transform the incoming x-ray into an analogous signal of a
certain level, which is then digitalized by means of an A/D converter. In this form the signal is being sent to
and is processed in adjoining computers. An image so obtained, displayed on the monitor, directly serves the
diagnostic purposes. It can be stored in the archive, shared with other computers in a network or printed on a
special printing device. Developed countries of the world in the last several years also use mobile digital devices
in large animal practice. We demonstrated the advantages of digital radiography over the conventional one by
imaging the bovine phalanxes using both methods. Digital radiography proved significantly better in the imaging
of fine structures of soft and bone parts of bovine phalanxes. The radiograms show the fine resolutions of digital
radiography images which have a higher quality than the xeroradiogram. The picture obtained in digital form is
ready for various kinds of subsequent processing which provides us with extraordinary possibilities for a faster
and more reliable diagnostics.
Sažetak
Konvencionalna radiološka dijagnostika koristi x-zrake i film već više od jednog sstoljeća.Princip je ove
dijagnostike u prolsasku x-zraka kroz tkiva i prenosi se na film koji se nakon toga razvija manuelno ili mehanički u
tamnoj komori a nakon toga se pohranjuje u zatvorenoj arhivi rendgenskih filmova. Nova radiološka dijagnostika
koristi digitalnu detekciju koja transformira ulazne x-zrake u analogni signal koji se potom digitalizira preko
A/D konvertera.Tako dobivena slika se čuva u kompjuteriziranom obliku ili se ispiše posebnim pisačem.
Razvijene zemlje svijeta zadnjih nekoliko godina koriste mobilne digitalne radiografske aparate osobito u
dijagnostci bolesti velikih životinja.Mi smo prikazali prednosti digitalne radiografije nad konvencionalnom u
prikazu članaka prsta goveda i to koštanih struktura i mekih česti.Napominjemo da slikedobivene digitalnom
radiografijom daju mogućnost dodatnog kompjuterskog procesuiranja koji će omogućiti još bržu i kvalitetniju
dijagnostiku
369
Introduction
The limping of cattle, regardless of the conditions of keeping, is usually due to diseased distal
parts of extremities. The hoofs are exposed to non-hygienic conditions, are infrequently trimmed and
are often traumatized. The diseases of hoofs and other phalanxes of various etiology demand thorough
clinical and radiological examinations. The outcome of radiological diagnostics is closely related to
the technique of imaging, the choice of foils and films and preparation of hoofs for radiography. Present-day radiology uses more and more frequently the digital systems for imaging of human
or animal bodies and these systems gradually substitute analog devices in clinical practice. Digital
technology has been in use for quite a long time in computerized tomography (CT), ultrasonography,
magnetic resonance (MRI) and nuclear medicine. Experiences gained so far are mostly based on
analog imaging. An analog image is the standard radiographic recording on an x-ray film.
Conventional diagnostic image is obtained by using a cassette in which x-ray films are inserted.
Cassettes contain fluorescent foils which convert the incoming x-ray beam into light of a certain
spectrum. As the film and the foils are in contact, the x-ray film is directly exposed. After that, the
exposed film is developed by chemical means and it provides a lasting recording of the diagnostically
interesting organic structure.
Analog images are permanent. For instance, the black-and-white x-ray image of the thorax is
an analog image because it represents a permanent configuration of the intensity of light patches as
functional positions on the radiograph. In photography images are created when the light is focused
onto a film. In radiography x-rays pass through the patient and are projected on the x-ray film. The digital procedure of image processing was first developed in NASA’s Jet Propulsion
Laboratory in the California Institute of Technology. The technology of digital processing continued
to spread quickly and found its application in fields such as astronomy, geology, forestry, agronomy,
cartography, military science and medicine. In medicine, a particularly fertile soil for this technology
is diagnostic imaging (Huang, 1999). Digital image processing is a multidisciplinary affair including
physics, mathematics, mechanical engineering and computer science.
Digital images are numerical representations or pictures of an object. The forming of digital
images requires a digital computer. Any kind of data entering the computer must first be digitalized,
i.e. converted into numbers. An important component here is the Analog to Digital Converter – ADC
which converts a permanent signal into individual signals or digital data (Luiten, 1995). The computer
receives digital data and processes them as required. The results of such processing are always digital
and can be shown as a digital image (Seeram, 1985). The future of digital imaging promises various
applications such as 3D imaging (Huang, 1999).
Digital radiographic systems are divided according to types of detectors into computed
radiography (CR) and direct digital radiography (DDR).
Computed radiography (CR) uses cassettes just as the standard radiography, but instead of film
and foil it uses plates coated with phosphorescent material, often called simply phosphorus plates,
though this term is not quite precise. The means of working with such cassettes is very similar to
conventional radiography, formats are the same, and the digital image is obtained on common points
which substitute the dark rooms. CR can be attached to existing radiographic devices for which
reason its implementation in a hospital environment is cheaper than the DR.
Direct digital radiography (DDR) uses special flat-panel detectors. The panel is installed in the
table or fixed onto a vertical gantry. DR systems can use an indirect conversion by means of a
glittering screen and a deposit of amorphous silicon or a direct conversion by means of amorphous
370
selenium. When the phosphorus plate is exposed to x-rays an analog latent image is formed. By
means of digitalizer and a scanner it is then transformed by digital conversion into a digital image.
The scanner in the digitalizer reads the data from the phosphorus plate line by line until the entire
plate is displayed.
The bovine phalanxes from the slaughterhouse were first filmed by conventional radiography,
and then by computed radiography (CR) or direct digital radiography (DDR). Radiography was
made in two basic projections. Analog radiographs were scanned and digitally processed. Computed
radiography and direct digital radiography were done in university hospital centres.
Computed radiography or the CR system uses a plate over and over again to obtain the image
instead of film. This plate contains a layer of photo-stimulating phosphorus in which the image is
stored. When the plate is exposed to x-rays, the electrons within the phosphorus crystals are set in
motion and find themselves in a state of semi-stable high energy. The CR scanner scans the plate by
means of laser beams. The laser energy releases the blocked electrons, creating a visible, emitting
light. This light is stored and converted into a digital bit sequence which encodes the digital image.
Phalanxes were imaged by the FUJIFILM PROFECT CS device, and the processing was done in the
software of the same device. The elements of imaging were the same as in the imaging of a human
knee.
Direct digital radiography uses devices with in-built FD – flat detector plates 35 x 43 cm in
size. DR system was designed to improve the possibilities of examination on two levels. First, the
system enables a significantly faster course of examination and, in addition, an examination can be
immediately repeated. Secondly, within and between the examinations, these systems can enhance
the course of work by means of network distribution of diagnostic images. After the imaging, itself
lasting only a few seconds, the images are ready for viewing on a monitor, and can be always be
retrieved from computer memory. Due to the fact that they are digital, they are always identical
enabling the production of multiple identical copies.
Amorphous selenium plate uses the amorphous selenium coating, a thin-film transistor (TFT) to
receive and convert the energy of x-rays directly into digital signals without the use of a scintillator
or phosphorus. As there is no scattering and an optimal signal to noise ratio, the quality of the image
roughly corresponds to a medium-grain film.
The amorphous silicon (a Si) flat plate uses a scintillator which consists of caesium iodide or Gadolini oxysulphide which converts incoming x-rays into visible light. This light becomes
electricity by means of distribution of sensors of amorphous silicon. Earlier developments of the
detector of amorphous silicon manifested a high level of noise which makes amorphous silicon
usable only in real time.
Results
Conventional radiography of phalangeal bones of a cow from slaughterhouse was done in
two basic projections using the Bucky grid (foils and films are from the green spectre). In sagittal
projection elements of imaging 55 kV and 22 mAs were used (Fig. 1). The same elements were
used in the profile projection (Fig. 2). The same phalangeal bones were also imaged in two basic
projections by means of the direct digital radiography (DDR). The elements of imaging were similar
to those of conventional radiography (Figs. 3 and 4).
371
Fig. 1. Sagittal image of a cow’s phalangeal bone obtained by conventional radiography
Fig. 2. Sagittal image of the phalanx of the same cow obtained by computed radiography
The phalangeal bones of the second cow from the slaughterhouse were imaged by conventional
and computed radiography (CR). Elements of imaging by conventional radiography were 53 kV and
22 mAs in both projections (Figs. 5 and 6). The same projections were used in computed radiography
with approximately the same elements (Figs. 7 and 8).
Fig. 3. Profile image of a cow’s phalangeal bone obtained by conventional radiography
372
Fig. 4. Profile image of the phalanx of the same cow by computed radiography
Fig. 5. Sagittal image of a cow’s phalangeal bone obtained by conventional radiography
Fig. 6. Sagittal image of the phalanx of the same cow obtained by direct digital radiography
Fig. 7. Profile image of a cow’s phalangeal bone obtained by conventional radiography
Fig. 8. Profile image of the phalanx of the same cow by direct digital radiography
373
Comment
Computed radiography is classified as a system of digital imaging because it uses a computer
in the creation of the image. X-rays pass through the patient and reach appropriate detectors which
convert photons of x-rays into electrical or analog signals. These signals are stored and digitalized
(converted into numerical forms) for further computer processing. The process of digitalization of
data and the image processing are done with appropriate computers according to the type of image
processing required.
Numerous types of digital imaging in radiology use the processes of image processing, including
digital radiography and fluoroscopy, nuclear medicine, imaging by magnetic resonance, ultrasound
and computerized tomography.
The main objective of digitalization is that the digital image can be computer-processed, which
yields numerous advantages. These are:
- the image can be made to look more satisfactory for the viewer. Certain characteristics, such as
contours and shapes can be enhanced to improve the quality of the image;
- lower quality images can be filtered to remove the unwanted “noise”. Filtering can also help to
remove unnecessary fine details in the image, known in the technique as “soft”;
- the analysis of the image is also called the scan analysis. This procedure “aims to separate the
data contained in various objects in the scan” (Marion, 1991);
- the image offers the observer the possibilities to view specific shapes, contours or structures,
disregarding the others;
- sample recognition. A computer may “see” the structure and recognize the sample;
- geometric transformation. The image may be rotated or adapted to the screen by changing the
position of pixels;
- compressing of data. Compressing of a digital image is significant for the storing and transmitting
of data.
The last generation of digital detectors of x-rays are matrix detectors of x-rays. The main feature
of matrix detectors is that they consist of a large number of sub-millimetre detectors of x-rays,
electrically connected so as to form a matrix of a certain number of rows and columns which are
individually displayed.
The advantages of matrix detectors in relation to conventional radiography consist in the
following characteristics:
- high quality of the image. Matrix detectors have a superb sensitivity to incoming x-ray beams,
much better than the standard combination of x-ray film-plus-foil. A very small pixel size and a good
modulation transfer function enable a superb sharpness of diagnostic images;
- relatively high sensitivity of matrix detectors to x-rays and the possibilities of subsequent
digital processing of the image mean that these techniques will use smaller doses of radiation than
standard examination;
- a relatively simple integration of the matrix detector module with the classical radiographic
system and image processing in real time speeds up the diagnostic procedures many times over and
gives a simultaneous possibility of later digital image processing.
Due to the ability of matrix detectors to process static radiographic images, currently are being
developed matrix detectors which will serve to digitalize dynamic images (diascopy, angio procedures
374
and the like). Existing matrix detectors are capable of digitalizing 25 images per second. The quality
of the image remains equally good.
Digital images offer numerous advantages in the form of processing and handling the images.
In spite of numerous advantages, it is necessary to weigh numerous factors when deciding to switch
from conventional to digital radiography. This paper has given an overview of various imaging of
the phalangeal bone of cows by means of conventional and digital radiography. The images obtained
by the above methods were compared. Digital images have a higher quality in terms of greater
resolution, while the histogram was similar in both techniques. From the spectrum of digital imaging
techniques, CR and DDR systems were used.
Computed radiography and direct digital radiography have specific fields of application by using
various types of flat detectors. Present-day technology offers advantages of digital radiography over
the film-based ones.
375
376
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO
(NORTH-WEST SPAIN)
SEROLOGICAL SURVEY OF MAEDI-VISNA IN SHEEP IN LUGO
(NORTH-WEST SPAIN)
Fernández, G.*; Lago, N.*; Pato, J.*;López, C.M.*; Díez-Baños, P.*; Cienfuegos, S*;
Viña, M.**
*Dpto. Patología Animal. Facultad de Veterinaria Universidad de Santiago de Compostela.
27002. Lugo. Spain. E mail: [email protected]
**ACIVO. Regional Association of Ovine Flocks. Galicia.Spain.
INTRODUCTION
Small ruminant lentiviruses (SRLV) are non-oncogenic and heterogeneous group of infectious
agents belong to the lentivirus subgroup and family of Retroviridae, causing multisystem diseases
in sheep and goats: maedi-visna (MV) and caprine arthritis encephalitis (CAE). Maedi-Visna virus
(MVV) causes chronic inflammatory disease in the lungs, joints, mammary glands and central
nervous system in sheep. Clinical disease caused by SRLV infection develops slowly and about 30%
of infected animals develop clinical disease.
The general consensus was that economic losses due to SRLV infection are significant.
MMV and the disease have been recognized in most major sheep-producing countries. No
country has data about MV seroprevalence in the entire state and only in France there is a national
accreditation scheme of MV-free flocks.
In Spain, MV was first described in 1984. The extent of the disease seroprevalence in the entire
country is not known, as Lugo district. The mayority of realized research in others districts of Spain
are about dairy sheep with an more intensive handling. These research show high percentages of
infection, so that in some districts it is difficult to find an uninfected flock. In some districs of Spain
there is an accreditation scheme of MV-free flocks.
Lugo is in northwest of Spain. In Lugo the ovine production are based in meat sheep and with
semiintensive handing. All important breeders have joined the regional association ACIVO and
participated in this study.
Transmission in a flock takes place predominantly between dam and lambs via infected
mononuclear cells in colostrum and milk. Horizontal transmission does occur, especially among
housed sheep.
All the sheep >6 month of age 6490 animals altogether, from 38 surveillance flocks from Lugo
district were sampled in the 2007 survey.
The sera was frozen to -20ºC until its processing.
All the sera were examined for MVantibodies with the Institut Pourquier maedi-visna/CAEV
ELISA test kit (Institut Pourquier, France) according to the manufacturer’s instructions. The true
377
individual prevalence was calculated with sensibility (Se) of 98,0 and specificity of 97,4 (Tolf et al.,
2007)
RESULTS AND CONCLUSIONS
The positive results of the serological research are shown in Table 1. The role of colostrum
and milk and horizontal repsiratory in SRLV transmission depend of several factors particularly the
sheep production system (Radostits et al., 2000). The production system of the flocks of this study
is semi-intensive, and the animals are several hours in the pasture every day and are not housed for
long periods in close confinement as in the dairy sheep. In the Spanish Autonomous Community
of the Basque Country (ACBC), infection is present in over 95% of dairy sheep flocks and 54% of
sheep with more than one year old were seropositive (González, 1989) and Autonomus Community
of Aragon with an 100% de flocks with seropositive sheeps (Rubio et al, 2005). The results of this
study show a flock prevalence lower than results found in other region of Spain.
Table 1. Prevalence of animals and flocks
Apparent individual prevalence (%)
True individual prevalence (%) (Se= 98,0; Sp=97,4)
Apparent flock prevalence (%)
24,8
28,7
81,6%
Apparent seroprevalences in herds of different sizes are shown in Table 2. These results indicate
that the prevalence of seropositive animals increases significantly with increasing flock size. In other
studies made in other regions of Spain, the average size of the flocks was high than in this study
(265 animals in Aragon). If consider only the breeders with more than 100 animals, flocks prevalece
is near to other studies made in Spain. It is logical to think than herds with less than 100 animals
have introduced less animals of another breeders and it has permitted that the disease didn´t come
so easily.
Table 2. Prevalence in herds of different sizes
Size (>6
month of age Nº flocks
1-100
13
101-200
15
>200
10
Nº flocks with
seropositive
animals
7
14
9
Apparent
seroprevalence
Apparent flock of total flocks
prevalence (%)
(%)
53,8
3,9
93,3
14,6
90,0
35,0
Apparente
seroprevalence
of positive
flocks (%)
6,4
15,4
37,1
If only considerer the prevalence of positive breeders, we can see that it increase clearly with the
size of the flock (table 2). So the size of the flock relates with the possibility of presenting the disease
and with the seropositive animals percentage. To the program of control will be very important keep
the sanitary status of negative flocks, thinking as a source of replacement animals to other breeders in
spite of his smaller size. Also including in the serological studies small flocks with higher probability
378
of being free of MV can be interesting and they can be used as a source of replacement animals to
bigger flocks.
Flocks with apparent prevalence < 10%with different sizes are listed in table 3. The number of
flocks with prevalence < 10% decreases in the >200 animals group.
Table 3. Flocks with apparent prevalence < 10%
Size (>6 month of age)
1-100
101-200
>200
Nº flocks with apparent
prevalence < 10%
6
7
2
% flocks with apparent
prevalence < 10%
46,1
46,7
20,0
In view of the specificity of the test, there are difficulties to classify breeders with very low
seroprevalence as free or not free. This fact make necessary to establish other criterions to know
the sanitary status of these breeders, like the origin of positive animals, results of later serological
controls (as much seropositive animals as hole flock), etc.
The flocks seroprevalence in Galicia (North of Spain) do necessary to establish a control program
of MV disease.
It is therefore important to clarify the actual routes utilised by the virus so that attempts to control
or eradicate SRLV infections could be made more efficient because it may allow developing specific
control strategies for particular sheep production systems.
REFERENCES
Gonzalez, L., Badiola, J.J., Gelabert, J.L., 1984. Neumonia progresiva (Maedi) en el ganado ovino del Pais
Vasco. Medic. Vet. 1,
277–284.
Lujan, L., Badiola, J.J., García Marín, J.F., Moreno, B., Vargas, M.A., Fernández de Luco, D., Pérez, V. 1993.
Seroprevalence of maedi-visna infection in sheep in the north-east of Spain. Prev. Vet. Med. 15, 181-190.
Ruz Ruvio, J.M., Picazo Purroy, R.M.(2005). Control del Medi-Visna: evolución de la seroprevalencia en
rebaños de raza Ojinegra (período 2002-2005). Jornadas SEOC.S. Spain. 322-324.
Toft, N., Akerstedt, J., Tharaldsen, J., Hopp, O. 2006. Evaluation of three serological test for diagnosis of MaediVisna virus investion using latent class analysis. Vet. Microbiol. 120, 77-86
__________________________________________________________________________
This study was supported by the Research Project PGIDIT06RAG26101PR from Xunta de Galicia
379
380
Posters
Posteri
381
382
SPINAL CORD TISSUE DETECTION IN COMMINUTED BEEF IN A
PRIVATE ABATTOIR IN SOUTHERN TURKEY
Detekcija tkiva leđne moždine u usitnjenoj govedini iz
privatne mesnice u južnoj Turskoj
M. Kale a*, Ö. Kurşunb, A. S. Akcan Kalec, F. Pehlivanoğlud, S. Hasırcıoğlua, S. Yavrue
Department of Virology a, Food Hygiene and Technology b, Microbiology d, Faculty of Veterinary Medecine,
University of Mehmet Akif Ersoy, 15100, Burdur, TURKEY. c Ministry of Agriculture, State Control Laboratory, 15100, Burdur, TURKEY. Department of Virology e, Faculty of Veterinary Medecine, University of Selcuk,
42075, Konya, TURKEY. *Corresponding author. [email protected]
Abstract
In this study, the distribution of Central Nervous System (CNS) tissue contamination on the joints of beef
during cutting of 88 carcass halves into edible meat parts in a private slaughterhouse was investigated. The high
level contamination (>0.4) was detected at the highest ratio on the neck (75.0%), antre cote steak (62.5%) and
thick flank (50.0%) areas. The moderate level contamination (< 0.4) was detected at the highest ratio on the
contre-filet (87.5%), sirloin steak (50.0%) and silver side (50.0%) areas. The low level contamination (< 0.3)
was detected at the highest ratio on the rump (62.5%) and contre-nuar (75.0%) areas. Both the moderate and
the low level contamination were found at the similar and highest ratio on the topside (37.5%) areas. The high
level contamination (>0.4) was found at the highest ratio on the knives (62.5%), cutting tables (62.5%), moving
cutting tables (100.0%) and aprons (100.0%). In conclusion, by this study the first time in Turkey, the level
of contamination of spinal cord tissue as CNS tissue on the joints of beef during cutting the carcasses into the
parts was shown. Additionally, the high level contamination risk was found on the knives used for cutting the
carcasses, cutting tables, moving cutting tables and aprons.
Keywords: SRM; spinal cord; joints of beef; edible meat; ELISA
Sažetak:
U ovom istraživanju ispitana je rasprostranjenost tkiva središnjeg živčanog sustava kroz zagađenost
zglobova toplih polutki 88 goveda, koja su rasječena u konzumno meso u privatnoj klaonici. Visok stupanj
prisutnosti živčanog tkiva (>0.4 uočen je na vratu (75,0% antre cote odresku ( 62,5% i području flama ( 50,0%.
Umjereno prisustvo tkiva SŽS-a (<0.4 je uočeno kod contre-fileta ( 87.5%, i mjestu rasjeka ( 50,0% . nizak
stupanj prisutnosti SŽS tkivom uočen je na sapima ( 62,5% i kontranuar području (75,0% . I umjerena i niska
kontaminacija utvrđena su u najvećem omjeru na površinskim područjima ( 37,5% toplih polutki. Visok stupanj
kontaminacije ( >0,4 je uočen najviše na noževima (62.5% , stolovima za rasijecanje ( 62,5%, pokretnim
radnim površinama (100%. Ovim istraživanjem smo po prvi put u Turskoj pokazali kontaminaciju tkivom
leđne moždine (SŽS) u zglobovima prilikom rasijecanja goveda u konzumnu govedinu. Dodatno je uočen visok
stupanj rizičnosti kontaminacije na noževima, radnim plohama, pokretnim radbim plohama i pregačama.
Ključne riječi:Leđna moždina, goveđe meso, ELISA
INTRODUCTION
Contamination of beef with CNS tissue including spinal cord has been a concern from the food
safety standpoint because of potential human health implications in relation to bovine spongiform
encephalopathy (BSE). Introducing CNS tissue (i.e., brain and spinal cord materials) to the edible
portion of the carcass is suspected of increasing the risk of human infection with new variant
Creutzfeldt-Jakob disease (vCJD). In an effort to prevent CNS tissue from being introduced into the
383
human food chain, the European Commission (EC) in 1997 endorsed a proposal to regulate the use
of specified risk materials (SRMs) such as brain and spinal cord presenting a BSE risk, and decided
that specified risk material (SRM) must not to be

Untitled - Università di Bologna

Transcription

Similar documents

IJCA 44A(8) 1565

Pressures generated in vitro during Stabident intraosseous

Posters Posteri - Università di Bologna

26th September 19

097 - 128 (Dozza)

ReportOfTheInspector... - Lenus, The Irish Health Repository

Participation list

0 - Backhill online

4. Enjinier Dis2005 - school of materials and mineral resources

Medicina e Storia 15_08.p65

LP 17 FST 1 2000 Abstract