Referencias Montaje Resultados Especificidad

Comments

Transcription

Referencias Montaje Resultados Especificidad
Especificidad
• El Xpert® MTB/RIF emplea tres primeros específicos y 5 sondas únicas
para detectar sus blancos de amplificación.
• No se detectaron reacciones cruzadas con un amplio panel de otras
bacterias, incluidas varias micobacterias no tuberculosas.
EL GEN rpoB GENE 81 pb DETERMINA LA REGIÓN DE RESISTENCIA A LA RIFAMPICINA
Referencias
PROBE D
PROBE A
PROBE C
51 - GCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG - 31
31 - CGTGGTCGGTCGACTCGGTTAAGTACCTGGTCTTGTTGGGCGACAGCCCCAACTGGGTGTTCGCGGCTGACAGCCGCGAC - 51
PROBE B
PROBE E
• WHO report 20081.
http://www.who.int/tb/publications/global_report/2008
• Reducing the Global Burden of Tuberculosis: The Contribution of
Improved Diagnostics. Nature 444 (2006): 49-57
Montaje
Las muestras a analizar deben ser enviadas al laboratorio lo más pronto posible
para su proceso. El montaje de la prueba se realiza durante todos los días del
año, las 24 horas del día.
Resultados
• Helb et al. 2010. Rapid Detection of Mycobacterium tuberculosis
and Rifampin Resistance by Use of On-Demand, Near-Patient
Technology. JCM 48(1): 229-37
• Boehme et al. 2010. Rapid Molecular Detection of Tuberculosis
and Rifampin Resistance. NEJM 10.1056/NEJMoa0907847
Los resultados de la prueba son emitidos en las ocho horas después de
recibida la muestra en el laboratorio.
Conmutador: 682 1000 Ext. 2050/2051
Carrera 38A No. 5A-109
www.imbanaco.com
Cali, Colombia
Xpert
TM
Solución
Beneficios de la prueba
Diagnóstico molecular
• Los resultados del Xpert® MTB/RIF proporcionan oportunidad en las
respuestas de los exámenes generando seguridad a los pacientes y sus
familias para reducir la ansiedad.
El GeneXpert® ofrece la prueba MTB/RIF que hace diagnóstico de
Mycobacterium del complejo tuberculoso y simultáneamente resistencia a
Rifampicina en el mismo dispositivo, en dos horas, a partir de muestras
respiratorias y líquido cefalorraquídeo.
Características
Integrado: El GeneXpert® es el único sistema que combina la preparación de
la muestra con amplificación y detección con PCR (Reacción en Cadena de
la Polimerasa) en tiempo real, para un análisis completamente integrado y
automatizado. El sistema purifica, concentra, detecta e identifica las secuencias
de ácidos nucleicos blancos en aproximadamente dos horas.
La ventaja Xpert® MTB/RIF
• Es un proceso completamente automatizado que reduce el tiempo de
proceso técnico a unos pocos minutos.
• La R a Rifampicina puede usarse como marcador indirecto de R a isoniazida
y para MDR-TB.
• Los resultados rápidos permiten que los pacientes infectados pueden ser
aislados y tratados eficientemente antes de que tengan oportunidad de
contaminar otras personas.
• La detección rápida de la R a Rifampicina ayuda no solamente como guía
en el tratamiento de los pacientes sino también en el control de la infección
y en actividades de prevención de salud pública.
Sensibilidad
• La PCR anidada incrementa la sensibilidad.
• Es altamente sensible para confirmar extendidos positivos y negativos.
• Resultados rápidos.
• El procedimiento de extracción de ADN está basado en el proceso de
sonicación.
• Método validable para otro tipo de muestras.
• El control interno de extracción asegura la eficiencia de extracción.
ENSAYO MTB/RIF VERSUS TINCIÓN Y ESTADO DEL CULTIVO
Tinción -
Sensibilidad:
98.0%
Especificidad: 98.3%*
En América Latina se
presentan de 250 a 300 mil
nuevos casos y de 20 a 25 mil
muertes por año, ocupando el
tercer lugar de incidencia por
debajo de África y Asia, número uno y dos, respectivamente,
y se ubican Brasil, Haití y Perú como los de mayor incidencia.
www.paho.org/Spanish/HCP/HCT/TUB/tuberculosis.htm
En Colombia se registraron 11.671 casos de TBC en 2009, 9.632 de tipo pulmonar
(con bacilos copia positiva, negativa, recaídas, abandonos entre otros) y 2039
fueron extrapulmonares. Mostrando una incidencia de TBC en el país de 25,9
casos de TBC por cada 100.000 habitantes. La tasa de multidrogo-resistencia
(MDR-TB) para TBC en Colombia es de 2.38%.
• La prueba detecta mutaciones en el gen
rpoB, que codifica para la subunidad b
de la RNA polimerasa bacteriana durante
la transcripción.
• Varias mutaciones generan RNA polimerasas
resistentes a la acción inhibitoria de la
rifampicina.
Xpert®
GBS
Tinción +
Cultivo
Cultivo
Cultivo
POSITIVO
NEGATIVO
POSITIVO
MTB
DETECTADO
70
3
275
MTB
NO DETECTADO
7
171
0
• La sensibilidad de la prueba en pacientes clasificados como tinción negativa
y cultivo positivo es 90.9% (70/77) y 100% para las otras clasificaciones.

Similar documents

SUSCEPTIBILIDAD A DROGAS DE Mycobacterium tuberculosis

SUSCEPTIBILIDAD A DROGAS DE Mycobacterium tuberculosis Preparación de la solución de trabajo. - Dispensar 2 mL de caldo 7H9+OADC a los 4 pozos A, B, C, y D de la columna 2 de la microplaca. - Empleando una micropipeta, retirar 200 μL del pozo “C” de ...

More information