THÈS EE - Université Toulouse III

THÈSE
En vue de l'obtention du
DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE
Délivré par l'Université Toulouse III - Paul Sabatier
Discipline ou spécialité : Cancérologie
Présentée et soutenue par Marina Bousquet
Le 26 Juin 2008
Titre : Identification et caractérisation de nouvelles translocations chromosomiques
observées dans les hémopathies malignes
JURY
Mme. le Dr Françoise Moreau-Gachelin (Rapporteur)
M. le Pr François-Xavier Mahon (Rapporteur)
M. le Dr Pascal Barbry (Examinateur)
Mme le Dr Nicole Dastugue (Examinateur)
M. le Pr Georges Delsol (Président du jury)
M. le Pr Pierre Brousset (Directeur de thèse)
Ecole doctorale : Biologie-Santé-Biotechnologie
Unité de recherche : INSERM U563
Directeur(s) de Thèse : M. le Pr Pierre Brousset
Rapporteurs : Mme. le Dr Françoise Moreau-Gachelin
M. le Pr François-Xavier Mahon
1
2
A ma grand-mère
3
4
REMERCIEMENTS Le travail présenté dans ce manuscrit a été réalisé au sein de l’équipe « Mécanismes
moléculaires de l’oncogenèse », co-dirigé par les Professeurs Georges Delsol et Pierre
Brousset, à l’INSERM U563, Toulouse.
Il est de tradition de remercier les personnes ayant contribué, plus ou moins
directement, à ce travail de thèse. Cependant, je me rends compte qu’il est difficile d’exprimer
ma gratitude envers les personnes en qui j’ai trouvé un soutien. Connaissant mon franc parlé,
soyez assurés que ces remerciements sont sincères.
Je tiens tout d’abord à remercier Monsieur le Professeur Georges Delsol de la
confiance qu’il m’a accordée en m’accueillant au sein de son laboratoire et en me permettant
d’effectuer cette thèse. Je vous remercie de votre gentillesse et de votre enthousiasme.
Je remercie très sincèrement Monsieur le Professeur Pierre Brousset, mon directeur de
thèse, pour son soutien et pour la relation de confiance qui s’est instaurée. Je vous remercie de
m’avoir fait découvrir et aimer la recherche et d’avoir supporté mon caractère durant ces
quatre années. Vous m’avez laissé la liberté nécessaire à l’accomplissement de mes travaux,
tout en y gardant un œil critique et avisé. Vous avez toujours été présent dans les moments
difficiles et de stress. Pour toutes ces raisons, je considère que j’ai eu la chance d’avoir
l’encadrant qui me correspondait.
Je remercie tout particulièrement Madame le Docteur Françoise Moreau-Gachelin,
Directeur de Recherche à l’INSERM U830, dans l’équipe « Génétique et biologie des
cancers » à l’Institut Curie, Paris, ainsi que Monsieur le Professeur François-Xavier Mahon,
Professeur des universités praticien hospitalier à l’INSERM U876, dans l’équipe
« Hématopoïèse leucémique et cibles thérapeutiques » à l’Université Victor Segalen Bordeaux
2, d’avoir accepté de juger ce travail et d'en être les rapporteurs.
Je suis très sensible à la présence dans ce jury de Monsieur le Docteur Pascal Barbry,
Directeur de l’institut de Pharmacologie moléculaire et cellulaire et Directeur de recherche
dans l’équipe « Physiologie Génomique des Eucaryotes » à Valbonne Sophia Antipolis.
Je remercie également Madame le Docteur Nicole Dastugue de participer à ce jury,
mais surtout de sa contribution essentielle à ce travail. Je tiens à souligner votre enthousiasme
communicatif pour la cytogénétique. Les relations que vous entretenez avec les autres centres
de cytogénétique ont permis de recruter de nombreux cas et de faire avancer ce travail et sont,
sans aucun doute, liées à vos qualités scientifiques et humaines. C’est pourquoi, je tiens à
vous remercier de votre gentillesse, votre disponibilité, vos conseils et surtout pour votre
sourire permanent.
5
Bien entendu, je remercie tous les membres de l’équipe sans qui cette thèse n’aurait
pas été aussi sympathique :
Cathy : ma moitié au laboratoire ! Mon amie dans la vie ! Merci pour tout, tant sur le plan
scientifique que personnel. Merci pour tout ce que tu es, pour toutes les soirées partagées,
pour le ‘vin’ et les gâteaux bretons aux pruneaux… Future maman, je te souhaite plein de
bonheur, entourée de Arnaud et « son p’tit nez » !
JF : compagnon du début, coloc’ d’ordi. J’ai été ravie de partager ces quatre années avec toi et
de notre relation. La fin est proche également pour toi, mais l’issue différente. Je te souhaite
beaucoup de courage pour la suite et je suis sure que tu seras excellent.
Fabienne : merci pour ta disponibilité, tes conseils, ton soutien, tes relectures de dernière
minute. Plein de bonheur avec Ema.
Estelle et Laurence : les drôles de dames. Merci pour vos conseils et vos sourires.
Eric : merci pour tes conseils toujours très justes et ta bonne humeur.
Cyril : merci pour ton écoute et d’avoir été ma doublure pour tous les mails en anglais !
Julie : la jolie Julie. Merci pour ta bonne humeur, tes « Tu, tu, tu », « tac, tac » et autres
bizarreries..
Etienne : notre Chabat à nous. Merci pour tous les fous rires, pour ta disponibilité et ta
gentillesse.
Jeannine : la fée du labo, toujours disponible pour les commandes ou relier des thèses à la
dernière minute. Merci pour votre gentillesse, votre bonne humeur et vos « bonjouuur »
inimitables !
Julien : le seul fan au monde de « La tour Montparnasse infernale ». Merci pour toutes les
bonnes soirées et pour tes blagues (pas toujours drôles !). Au fait, « C’est trois nains…
Alan : le breton. Sache que je suis la première fan de ton humour décalé et pas toujours
volontaire !
Gilles : merci pour toutes nos discussions scientifiques mais aussi sur cette belle année de
1982 !
Michelle, Jeannie et Ashraf : merci pour tous vos conseils et votre disponibilité.
Sylvie, Cécile et Fred : les futures mamans. Bonne chance à vous.
Je remercie bien entendu tous les membres passés ou présents de l’équipe : Pascal,
Florence, Nathalie, Marie, Virginie, Alex, Camille, Nais, Emilie D, Jérome, Sandrine, Laurie,
Ruth, Jahouar, Marianne, Delphine, Céline, Daniel…
6
Je remercie tous les membres du laboratoire de cytogénétique (Toulouse Purpan), en
particulier Blandine et Franscisca, pour leur accueil et leurs sourires.
Je remercie également tous les membres des équipes de Bernard Payrastre, JeanJacques Fournié et Guy Laurent en particulier Véronique et Cécile pour leurs conseils et leur
disponibilité, ainsi que les étudiants qui ont partagé le bureau avec nous (Ludivine, Samar, les
Emilies,…)
Je remercie toutes les personnes qui ont contribué à ce travail : les différents centres de
cytogénétique français, le groupe français de cytogénétique hématologique (GFCH), le centre
de cytogénétique de Pérouse (Italie) et en particulier Cristina Mecucci et Roberto Rosati, les
différentes plateformes de Toulouse Purpan.
Je garde pour la fin les personnes de mon cœur. Je ne cesserai donc de remercier Max
qui m’a accompagné, supporté et soutenu tout au long de cette thèse. Le chemin est encore
long mais je ne doute pas que nous saurons surmonter les difficultés ensemble.
Je remercie ma famille, ma belle-famille et mes amis d’avoir su m’entourer au cours
de ces années d’une inestimable affection.
J’adresse un clin d’oeil particulier à ma belle Emilie et mon cher David pour notre
amitié sincère.
Enfin, cette thèse n’aurait pas été aussi facile sans le soutien inconditionnel de mes
parents. Je profite de cette occasion pour vous dire combien je vous aime et combien je suis
fière d’être votre fille.
7
8
TABLE DES MATIERES
CHAPITRE 1 : INTRODUCTION ................................................................. 13
I. Les hémopathies malignes............................................................................. 15
A. Les leucémies aiguës lymphoblastiques .......................................................................... 17
1. Leucémies aiguës lymphoblastiques de la lignée B .................................................................. 17
2. Leucémies aiguës lymphoblastiques de la lignée T................................................................... 17
B. Les leucémies aiguës myéloblastiques............................................................................. 17
C. Les syndromes myélodysplasiques .................................................................................. 18
D. Syndromes myéloprolifératifs ......................................................................................... 19
II. Les anomalies chromosomiques................................................................. 21
A. Les anomalies chromosomiques ...................................................................................... 21
B. Les translocations chromosomiques ................................................................................ 22
C. Origine des translocations chromosomiques ................................................................... 22
D. Les translocations chromosomiques dans les leucémies ................................................. 23
E. Intérêt de la recherche de translocations chromosomiques.............................................. 24
1. Intérêt clinique dans la prise en charge du patient..................................................................... 25
a) Diagnostic : .......................................................................................................................... 25
b) Pronostic et traitement: ........................................................................................................ 25
c) Le suivi :............................................................................................................................... 26
2. Intérêt scientifique..................................................................................................................... 26
III. Les protéines tyrosines kinases.................................................................. 27
A. Les récepteurs à activité Tyrosine kinase ........................................................................ 28
1. Structure .................................................................................................................................... 28
2. Activation .................................................................................................................................. 28
B. Les protéines tyrosine kinase cytoplasmiques ................................................................. 29
1. Structure) ................................................................................................................................... 29
2. Activation .................................................................................................................................. 29
3. Exemple : JAK2 ........................................................................................................................ 30
9
C. Translocations chromosomiques et tyrosine kinase......................................................... 32
1. Translocations chromosomiques et RTKs:................................................................................ 32
2. Translocations chromosomiques et TK cytoplasmiques: ..................................................... 34
a) BCR-ABL .................................................................................................................. 34
b) JAK2 .................................................................................................................................... 35
(1) La translocation chromosomique t(9;12)(p24;p13)........................................................ 35
(2) La translocation chromosomique t(9;22)(p24;q11.2)..................................................... 36
(3) La mutation V617F ........................................................................................................ 37
IV. Les facteurs de transcription ..................................................................... 38
A. Protéines de fusion avec effet dominant négatif.............................................................. 39
1. La fusion TEL-AML1 (Golub et al., 1995; Romana et al., 1995):............................................ 39
2. La fusion PML-RARα ............................................................................................................... 40
B. Protéines de fusions avec un effet d’activateur transcriptionnel ..................................... 42
1. La fusion E2A-PBX1 ................................................................................................................ 42
2. La fusion NUP98-HOXA9 ........................................................................................................ 42
C. Les translocations chromosomiques impliquant la famille des gènes PAX dans les cancers
humains .................................................................................................................................. 43
1. Les translocations chromosomiques impliquant les gènes PAX3 et PAX7 dans le
Rhabdomyosarcome alvéolaire ..................................................................................................... 45
2. PAX8 dans les tumeurs folliculaires de la thyroïde .................................................................. 48
3. PAX5......................................................................................................................................... 50
a) Le développement B............................................................................................................. 51
b) Expression de PAX5 au cours du développement B............................................................ 53
c) Régulation de PAX5............................................................................................................. 55
d) Répression transcriptionnelle par PAX5.............................................................................. 56
e) Activation transcriptionnelle par PAX5 ............................................................................... 58
f) Rôle oncogénique de PAX5.................................................................................................. 59
(1) PAX5-IgH ...................................................................................................................... 60
(2) PAX5-ETV6................................................................................................................... 61
V. Les microARNs............................................................................................. 62
A. Découverte des microARNs ............................................................................................ 62
B. Biogenèse des microARNs .............................................................................................. 62
C. Mode d’action des microARNs ....................................................................................... 64
1. Inhibition de la traduction médiée par les microARNs ............................................................. 64
a) Régulation au niveau de l’initiation de la traduction ........................................................... 64
10
b) Les protéines Argonautes..................................................................................................... 65
c) Les protéines GW182........................................................................................................... 66
d) Les Processing Bodies (PBs) ............................................................................................... 66
e) Répression post-initiation..................................................................................................... 67
2. Dégradation des ARNm cibles .................................................................................................. 67
3. Activation de la traduction ........................................................................................................ 68
4. Questions restantes .................................................................................................................... 69
D. Prédiction et évaluation des ARNm cibles de microARNs ............................................. 70
E. MicroARNs et cancer....................................................................................................... 70
1. Mutations des microARNs ........................................................................................................ 72
2. Régulation épigénétique de l’expression des microARNs ........................................................ 72
3. Altérations des protéines intervenant dans la biogenèse des microARNs................................. 73
4. Variations dans la séquence des sites de liaisons microARN : ARNm..................................... 74
5. Translocations chromosomiques et microARNs ....................................................................... 75
CHAPITRE 2 : OBJECTIF DU TRAVAIL ................................................... 77
CHAPITRE 3 : RESULTATS EXPERIMENTAUX .................................... 81
La translocation t(8;9)(p22;p24) dans les leucémies myéloïdes chroniques
atypiques................................................................................................................. 83
La translocation t(7;9)(q11;p13) dans les leucémies aiguës lymphoblastiques B 87
La translocation chromosomique t(2;11)(p21;q23) dans les leucémies aiguës
myéloblastiques et les myélodysplasies.................................................................. 91
CHAPITRE 4 : DISCUSSION ET CONCLUSION ..................................... 97
CHAPITRE 5 : CONCLUSION GENERALE ............................................ 119
CHAPITRE 6 : REFERENCES BIBLIOGRAPHIQUES ......................... 123
CHAPITRE 7 : ANNEXES ........................................................................... 153
11
LISTE DES ABREVATIONS UTILISEES
ABL
ADN
ADNc
AML1
ARN
ATP
BAC
BAK1
BCL-2
BCR
BCR
BLK
BLNK
ChIP
ELN
FGFR
FISH
IL
JAK
LAL
LAM
LDI-PCR
LEF1
LMC
MB1
MDS
miARN
MLL
NBT
NLS
NSE
PAX
pb
PBD
PCM1
PDGFR
RACE
RT-PCR
siARN
STAT
TEL
TCR
Abelson
Acide Désoxyribo-Nucléique
ADN complémentaire
Acute Myeloid Leukemia 1
Acide RiboNucléique
Adénosine Tri-Phospate
Bacterial Artificial Chromosome
BCL-2 antagonist/killer 1
B-cell leukemia/lymphoma 2
Breakpoint Cluster Region
B Cell Receptor
B Lymphoid Kinase
B-cell Linker
Chromatin Immunoprecipitation
Elastine
Fibroblast Growth Factor Receptor
Fluorescent in situ Hybridization
Interleukine
Janus Kinase
Leucémie aiguë lymphoblastique
Leucémie aiguë myéloblastique
Long Distance Inverse Polymerase Chain Reaction
Lymphoid Enhancer binding Factor 1
Leucémie myéloïde chronique
Membrane bound; B lymphocyte-specific (=CD79a; Igα)
Myélodysplasie
microARN
Mixed Lineage Leukemia
Nitroblue Tetrazolium
Nuclear Localization Signal
Non Specific Esterase
Paired Box Gene
paires de bases
Paired Box Domain
Pericentriolar Material 1
Platelet Derived Growth Factor Receptor
Rapid Amplification of cDNA Ends
Reverse Transcription Polymerase Chain Reaction
Small interfering ARN
Signal Transducer and Activator of Transcription
Translocated ETS Leukemia (=ETV6)
T Cell Receptor
12
CHAPITRE 1 :
INTRODUCTION
13
Introduction
I. Les hémopathies malignes
La dérégulation de l'homéostasie hématopoïétique peut être à l'origine des
hémopathies malignes (Hanahan and Weinberg, 2000; Sawyers et al., 1991). L’hématopoïèse
dont le nom signifie « formation du sang » est le processus par lequel l’organisme produit et
renouvelle tous les éléments figurés du sang. Ce processus s’effectue au sein de la moelle
osseuse par étapes successives. Toutes les cellules sanguines sont produites à partir d’une
même cellule indifférenciée : la cellule souche hématopoïétique. Cette cellule a deux
propriétés essentielles : l’auto-renouvellement et le pouvoir de différenciation. En réponse à
un signal exogène, elle est capable de se différencier en globule rouge (ou hématie), en
globule blanc (lignée myéloïde ou lymphoïde) ou en plaquettes (ou thrombocyte). On
distingue ainsi quatre compartiments (Figure 1):
Les cellules souches hématopoïétiques
Les progéniteurs : ils sont engagés vers un lignage cellulaire
Les précurseurs : ils se divisent et maturent
Les cellules matures : elles sont fonctionnelles et peuvent passer dans le sang.
Figure 1 :
Hématopoïèse
15
Introduction
L’hématopoïèse nécessite un micro-environnement médullaire adapté et l’intervention
de facteur de croissance tels que l’IL-7 (interleukine 7), l’EPO (érythropoïétine), le TPO
(thrombopoïétine) ou le GM-CSF (granulocyte-monocyte colony stimulating factor). Enfin,
les cellules hématopoïétiques se différencient et déterminent leur lignage sous l’influence de
facteurs de transcription tels que PAX-5 (Paired-box gene 5), PU-1 ou GATA-1.
La perturbation de l’hématopoïèse peut donc être à l’origine d’une hémopathie
maligne. Ce dysfonctionnement peut être consécutif à une expression inadaptée ou à des
altérations structurales de certains gènes suite à des mutations ponctuelles ou à des anomalies
de structures telles que les translocations chromosomiques. On entend par hémopathie
maligne un groupe de pathologies regroupant les leucémies et les lymphomes.
Les lymphomes sont des hémopathies lymphoïdes caractérisées par une infiltration
ganglionnaire ou extra-ganglionnaire, par des cellules lymphoïdes malignes et monoclonales
issues soit de la lignée B (70% des cas) soit de la lignée T. La morphologie des cellules
lymphomateuses et l’architecture de la prolifération définissent le type histologique du
lymphome (exemple : lymphome de Burkitt, lymphome de Hodgkin) (DeVita and Canellos,
1999).
Parmi les leucémies, on distingue les leucémies aiguës des leucémies chroniques. Les
leucémies aiguës sont caractérisées par un blocage de la maturation des cellules médullaires.
Cette immaturité traduit une anomalie de la différenciation. De plus, les leucémies aiguës
diffèrent des leucémies chroniques par leur rapidité évolutive spontanée. Les leucémies sont
également classées selon le type cellulaire affecté et sont, le plus fréquemment, divisées en
leucémies lymphoblastiques et myéloblastiques (Rabbitts, 1991).
Les hémopathies malignes sont classées en fonction de leur degré de sévérité et du
stade de maturation représenté. Nous détaillerons uniquement les quatre groupes suivants:
Les leucémies aiguës lymphoblastiques
Les leucémies aiguës myéloblastiques
Les syndromes myélodysplasiques
Les syndromes myéloprolifératifs
16
Introduction
A. Les leucémies aiguës lymphoblastiques
1. Leucémies aiguës lymphoblastiques de la lignée B
Les leucémies aiguës lymphoblastiques de la lignée B impliquent des précurseurs
lymphoïdes engagés dans la différenciation B. Ces affections touchent essentiellement les
enfants (75% des cas avant 6 ans). On distingue quatre groupes de LAL-B selon le stade de
blocage de différenciation des précurseurs B. La positivité pour au moins deux marqueurs
parmi cCD79, CD19 et CD22 est nécessaire pour la classification en lignée B :
B1: cCD79+ et/ou CD19+ et/ou CD22+
B2: cCD79+ et/ou CD19+ et/ou CD22+, CD10+
B3: cCD79+ et/ou CD19+ et/ou CD22+, CD10+/-, chaîne µ cyto+
B4: cCD79+ et/ou CD19+ et/ou CD22+, CD10+/-, chaîne µ cyto+/-, Ig cyto+
2. Leucémies aiguës lymphoblastiques de la lignée T
Elles impliquent des précurseurs lymphoïdes engagés dans la différenciation T. Ces
hémopathies à précurseurs T représentent environ 15% des cas des LAL de l'enfant,
retrouvées plus fréquemment chez les adolescents que chez les jeunes enfants, et touchent
majoritairement les garçons. Elles représentent également environ 25% des LAL de l'adulte.
B. Les leucémies aiguës myéloblastiques
Les leucémies aiguës myéloblastiques sont des maladies malignes liées à la
prolifération monoclonale et au blocage de la différenciation des précurseurs médullaires des
lignées granuleuses, monocytaires, érythroïdes ou plaquettaires.
Le caryotype est le facteur prédictif le plus important :
Favorable : t(15;17), t(8;21), inv(16)
17
Introduction
Défavorable : -5, 5q-, -7, anomalies 3q, t(6;9), t(9;22) et anomalies complexes
Intermédiaire : caryotype normal ou avec d'autres anomalies.
Le classement des LAM est basé sur des critères cytogénétiques, moléculaires et
morphologiques (tableau 1).
Tableau 1 : Classification OMS 2001
LAM, Leucémie aiguë myéloblastique ; AML1 : Acute Myeloid Leukemia 1 ; CBF : Core binding factor ;
ETO : eigth twenty one ; PML : Promyelocytic leukemia ; RAR : Retinoic acid receptor ; MYH11 :
myosin heavy chain ; MLL : Mixed Lineage Leukemia (Flandrin G, Revue Médicale Suisse, N° 2389)
C. Les syndromes myélodysplasiques
Les syndromes myélodysplasiques (SMD) sont le résultat d'anomalies qualitatives et
quantitatives du fonctionnement médullaire se traduisant par des anomalies de maturation de
18
Introduction
la cellule souche et par des degrés divers d'hématopoïèse inefficace. Un trouble de la
production des globules rouges, des polynucléaires et des plaquettes est observé, entraînant
habituellement une cytopénie périphérique malgré une moelle hypercellulaire. Les SMD
évoluent fréquemment en LAM. Les SMD sont caractérisés par un taux de blastes médullaires
inférieur à 20% (un taux supérieur à 20% de blastes définissant les LAM). Les SMD
surviennent essentiellement chez les sujets âgés. Un nombre croissant de SMD et de LAM en
tant qu’affections secondaires sont diagnostiquées, conséquence des traitements par
chimio/radiothérapie des affections malignes.
Différents types de SMD sont décrits selon la classification OMS :
Anémie réfractaire simple (AR)
Anémie réfractaire avec un excès de sidéroblastes (ARS) (Le sidéroblaste est un
érythroblaste chargé de fer.)
Cytopénie réfractaire avec une dysplasie multilignée
Anémie réfractaire avec excès de blastes (5 à 20%) (AREB)
Syndrome myélodysplasique associé à une anomalie chromosomique isolée du del(5q)
Syndrome myélodysplasique, inclassifiable
D. Syndromes myéloprolifératifs
Les syndromes myéloprolifératifs sont des affections clonales des cellules souches
caractérisées par une hématopoïèse «effective» s'exprimant par l'élévation dans le sang
périphérique d'une ou plusieurs lignées cellulaires et par une moelle hypercellulaire avec une
maturation (Albitar and Freireich, 2000; Dickstein and Vardiman, 1995). Contrairement aux
leucémies aiguës, les SMP sont chroniques c'est-à-dire que les cellules gardent un potentiel de
différenciation terminale normal ou quasi-normal. Parmi les SMP le prototype est la leucémie
myéloïde chronique (LMC) Ph1 positive (BCR/ABL+). Les autres entités de ce groupe sont la
polyglobulie vraie (Polycythemia vera) (PV), la myélofibrose idiopathique (MF) et la
thrombocytémie essentielle (TE).
L’origine de ces pathologies n’est pas toujours connue. Cependant, il a clairement été
démontré que les hémopathies malignes sont fréquemment associées à des anomalies
19
Introduction
chromosomiques affectant la régulation et la structure des gènes. L’identification des gènes
affectés par ces anomalies a permis une meilleure connaissance de ces pathologies et une
meilleure compréhension de leurs mécanismes d’apparition.
20
Introduction
II. Les anomalies chromosomiques
L'expression anormale de gènes normaux, l'expression de gènes anormaux soit par
mutation soit par fusion entre deux gènes ou la disparition de gènes (gènes suppresseurs de
tumeur) contrôlant le processus mutagène représentent les trois mécanismes principaux de la
transformation maligne dans les hémopathies malignes. Ces anomalies génétiques acquises
ont été généralement identifiées à partir d'anomalies chromosomiques décelables au
microscope.
A. Les anomalies chromosomiques
Les cellules malignes contenant des anomalies chromosomiques proviennent toutes d’un
même clone cellulaire (Hanahan
and
Weinberg,
anomalies
2000).
Ces
chromosomiques
peuvent être de nombre (perte /
gain d’un chromosome) ou de
structure
(cassures
réarrangements,
suivies
de
d’amplifications
ou de délétions) (Figure 3). Parmi
les anomalies de structure, on
retrouve
les
translocations
chromosomiques qui se définissent
par le transfert d’un segment
d’ADN d’un chromosome vers un
autre.
Elles
réciproques,
peuvent
être
impliquant
deux
chromosomes (échange de matériel
chromosomique)
et
équilibrées,
c’est à dire sans perte de fragment
d’ADN ou déséquilibrées avec
perte ou duplication de matériel.
Figure 3 : Anomalies de structure
(d’après Huret JL, Atlas Genet Cytogenet Oncol Haematol, 2000)
21
Introduction
B. Les translocations chromosomiques
Les translocations conduisent à un réarrangement au niveau de l’organisation des
gènes. Dans certains cas, l’expression de ces gènes peut être modifiée. En effet, certaines
translocations sont à l’origine de nouveaux gènes de fusion transcrits en un ARNm
chimérique, lui-même traduit en une nouvelle protéine hybride douée de propriétés
oncogéniques (anomalie qualitative). La translocation d’un gène dans une région active en
transcription peut aussi conduire à une surexpression de ce gène ou à une expression
ectopique dans un type cellulaire où il est normalement absent (anomalie quantitative).
Ces gènes donnant lieu à un avantage prolifératifs sont généralement des gènes qui
contrôlent la survie et / ou la croissance cellulaire (Hanahan and Weinberg, 2000). Ainsi, les
oncogènes ou proto-oncogènes ont été classiquement définis comme des gènes qui, lorsque
leur expression est dérégulée ou lorsque leur structure est altérée, contribuent à l’apparition
d’un phénotype malin. Actuellement, plus de 100 oncogènes différents ont été découverts et
décrits dans les hémopathies malignes humaines. Ces gènes codent des protéines de fonctions
très diverses. Un grand nombre code des facteurs de transcription tel que PAX5, des coactivateurs ou corépresseurs transcriptionnels comme ETV6, mais aussi des tyrosines kinases
(KIT, PDGFRβ, ….), des protéines intervenant dans le contrôle du cycle cellulaire (cycline
D1…) ou enfin des protéines anti-apoptotiques, comme la molécule BCL2.
C. Origine des translocations chromosomiques
Actuellement, il est particulièrement difficile de définir avec certitude l’origine des
translocations chromosomiques. Toutefois, l’apparition d’une translocation donnée est
dépendante à la fois, de la probabilité de rapprochement spatial des deux régions et de la
probabilité de réalisation de cassures doubles brins. On estime ainsi que les cellules humaines
génèrent environ 10 cassures ADN double brin à chaque division (Haber, 1999). L’apparition
de translocation peut cependant être favorisée par certaines structures chromatiniennes
(despiralisation), par des sites spécifiques de coupure des DNA topoisomérase II, par des sites
hypersensibles à la DNAse I ou par des séquences répétées du type Alu (Strissel et al., 1998).
Les erreurs de réparation des cassures doubles brins par le système de recombinaison
homologue via des séquences de reconnaissance de type RSS (Recombination Signal
22
Introduction
Sequence) ou le système non homologue (Non Homologous End Joining), peut également être
à l’origine de ces translocations (Richardson and Jasin, 2000).
Il est à noter que de nombreuses translocations impliquent les gènes des
immunoglobulines (Ig) ou des récepteurs des lymphocytes T (TCR). L’immunité adaptative
dépend de la génération d’un vaste répertoire d’Ig et de TCR exprimés respectivement par les
lymphocytes B et T. La diversité de ces récepteurs antigéniques est générée grâce à un
processus de réarrangement somatique par les recombinases RAG1 et RAG2 (RecombinationActivating Gene 1 et 2). Il s’agit de la recombinaison V(D)J (Variable, Diversité, Jonction)
(Gellert, 1997). Ainsi, des accidents de recombinaison somatique peuvent être à l’origine de
translocations chromosomiques (Hiom et al., 1998) (Exemple : réarrangement BCL2-IGH
dans des lymphomes folliculaires porteurs de la translocation t(14;18). BCL2 code une
protéine anti-apoptotique. Sa juxtaposition à l’enhancer des immunoglobulines conduit à une
surexpression de BCL2 (Tsujimoto et al., 1984)).
D. Les translocations chromosomiques dans les leucémies
Plus de 300 translocations récurrentes ont été rapportées dans les hémopathies
malignes. La liste de ces remaniements peut être consultée dans l’« Atlas of genetics and
cytogenetics in oncology and haematology » (http://atlasgeneticsoncology.org//index.html).
23
Introduction
Voici une liste non exhaustive de translocations chromosomiques fréquemment
rencontrées dans les hémopathies malignes :
Translocations
Gènes impliqués
Pathologies
(1) Translocations avec MLL
Translocations
Gènes impliqués
Pathologies
(3) Translocation avec RARA
t(4;11)(p12;q23)
AF4p12/MLL
LAL-T
t(15;17)(q22;q21)
t(6;11)(q21;q23)
AF6q21/MLL
LAM, LAL-T
(4) Translocations avec E2A
t(9;11)(p22;q23)
AF9/MLL
LAM, LAL
t(1;19)(q23 ;p13)
t(10;11)(p12;q23)
AF10/MLL
LAM
(5) Translocations avec des tyrosines kinases
t(10;11)(p12;q14)
AF10/CALM1
LAM, LAL-T
t(9;22)(q34;q11)
ABL/BCR
LMC, LAL
t(11;19)(q23;p13.1)
MLL/ELL
LAM
t(5;12)(q33; p13)
PDGFRB/TEL
LMMC
t(11;19)(q23;p13.3)
MLL/ENL
LAM, LAL
(6) Translocation avec NUP98
(2) Translocations avec AML1 (CBF) et TEL (ETV6)
PML/RARA
PBX1/E2A
LAP
LAL-B
t(7;11)(p15;p15)
HOXA9/NUP98
LAM
DEK/NUP214(CAN)
LAM
IGH/c-MYC
LAL
t(8;21)(q22;q22)
ETO/AML1
LAM
t(6;9)(p23;q34)
t(12;21)(p12;q22)
TEL/AML1
LAL
(7) Translocation avec IgH
inv(16)/t(16;16)(p13;
MYH11/CBFB
LAM
t(8;14)(q24;q32)
Tableau 2 : Translocations chromosomiques et hémopathies malignes LAL : Leucémie aiguë
lymphoblastique ; LAM : Leucémie aiguë myéloblastique ; LMC : Leucémie myéloïde chronique ;
LMMC : Leucémie myélomonocytaire chronique ; MLL : Mixed lineage leukemia ; AF4, AF9, AF10 :
ALL1 fused gene from chromosome, 4, 9, 10 ; ELL : eleven nineteen lysin rich leukemia gene ; ENL :
eleven nineteen leukemia ; AML1 : Acute Myeloid Leukemia 1 ; TEL : Translocated ETS Leukemia ;
ETO : eigth twenty one ; CBF : Core binding factor ; PML : Promyelocytic leukemia ; RAR : Retinoic
acid receptor ; MYH11 : myosin heavy chain ; PBX1 : Pre-B cell leukemia transcription factor 1 ; BCR :
Breakpoint cluster region ; ABL : Abelson ; PDGFR : Platelet Derived Growth Factor Receptor :
HOXA9 : Homeobox A9 ; NUP98 : Nucleoporin 98 kDa ; IgH : Immunoglobulin Heavy chain ; MYC :
Myelocytomatosis viral related oncogene
E. Intérêt de la recherche de translocations chromosomiques
La recherche des anomalies chromosomiques acquises dans les hémopathies malignes
est un élément essentiel dans la prise en charge de ces maladies. Les anomalies sont détectées
par des techniques de cytogénétique conventionnelle et moléculaire (caryotype, FISH
(Fluorescent in situ hybridization)) réalisées sur prélèvement médullaire ou sang dans les
leucémies, ganglionnaire dans les lymphomes. Les modifications du caryotype sont des
modifications acquises (limitées aux cellules malignes), clonales (un clone se définit par deux
métaphases au moins ayant le même chromosome surnuméraire ou la même anomalie de
24
Introduction
structure, ou de trois métaphases dépourvues d'un chromosome identique), primaires ou
secondaires, qu'elles soient numériques et/ou de structure, elles ne se font pas toujours au
hasard : elles sont non-aléatoires, certaines sont spécifiques d'une entité pathologique. La
découverte des anomalies chromosomiques dans les hémopathies malignes est primordiale à
double titre: intérêt clinique dans la prise en charge du patient d'une part, intérêt scientifique
d'autre part.
1. Intérêt clinique dans la prise en charge du patient
a) Diagnostic :
Les anomalies primaires observées représentent un critère majeur du classement de ces
affections. Par exemple, dans la leucémie myéloïde chronique (LMC), le chromosome
Philadelphie (ou Ph1) a été la première anomalie identifiée spécifique d'un processus malin
(1960). C'est en 1973 que Rowley découvre que ce Ph1 est issu d'une translocation
t(9;22)(q34;q11) présente dans 90% des cas. Cette translocation conduit à un réarrangement
entre le gène BCR et la kinase abelson (BCR-ABL1) (Rowley, 1973). L’observation au
caryotype d’un chromosome Ph1 associé à une hyperleucocytose conduit au diagnostic de
LMC. La cytogénétique est une approche essentielle dans le diagnostic de ces pathologies,
cependant, les techniques de biologie moléculaire sont parfois indispensables lorsqu’il s’agit
d’anomalies cryptiques, comme cela est le cas dans 5% des LMC pour la translocation BCRABL1 (Pelz et al., 2002).
b) Pronostic et traitement:
La cytogénétique apporte souvent un paramètre pronostique et un élément de choix du
traitement. Dans les cas de LAL de l'enfant, les formes associées à un Ph, à une translocation
t(4;11) ou à une translocation t(1;19) ont une potentialité de rechute élevée et un espoir de
curabilité faible justifiant le recours à une allogreffe de moelle osseuse dès l'obtention d'une
première rémission complète. Dans les LAM, les formes avec inversion du 16 ou
translocation t(8;21) ont au contraire une potentialité de curabilité importante avec la
chimiothérapie seule.
25
Introduction
L’identification des gènes impliqués dans ces translocations peut également permettre
une orientation thérapeutique plus ciblée. Par exemple dans la leucémie aiguë
promyélocytaire (APL), la translocation t(15;17)(q22;q11) est aujourd'hui reconnue comme
étant associée de façon spécifique à cette pathologie. Elle juxtapose un gène appelé PML
(promyelocytic leukemia) situé normalement en 15q23 au gène codant pour le récepteur de
l'acide rétinoïque (RARalpha) en 17q21. La protéine hybride PML-RARα résultant de cette
fusion empêche l'action des rétinoïdes endogènes sur la différenciation de la lignée
promyélocytaire qui reste bloquée à un stade précoce. L’utilisation d’acide rétinoïque dans le
traitement de cette affection permet de cibler spécifiquement les cellules porteuses de la
translocation (Chen et al., 1996).
c) Le suivi :
La cytogénétique permet d'apprécier l'évolution de la maladie (maladie résiduelle ou
rémission complète) et d'apprécier l'efficacité d'un traitement. Dans la LMC, au cours de
l'évolution de la maladie des anomalies additionnelles peuvent apparaître témoignant d'une
évolution clonale (duplication du Ph, trisomie 8, isochromosome du 17, perte de l'Y),
phénomènes de mauvais pronostic. Inversement, la reprise d'une hématopoïèse Ph négative
sous interféron constitue une amélioration pronostique. La cytogénétique peut également être
complétée par les techniques de biologie moléculaire telle que la RT-PCR. En effet, la
recherche de maladie résiduelle après traitement peut être appréhendée par RT-PCR si l’on
connait la nature du transcrit de fusion résultant d’une translocation.
2. Intérêt scientifique
La caractérisation de nouvelles translocations chromosomiques a toujours mis au jour
des gènes importants pour comprendre l’oncogenèse (MYC, BCL2, BCL1, PML, MLL, ABL,
PDGFRβ….).
Nous nous intéresserons par la suite à deux grandes familles de gènes majoritairement
impliqués dans les translocations : les gènes codant des tyrosines kinases et les gènes codant
des facteurs de transcription. Enfin, nous nous intéresserons aux microARNs, classe de petits
ARN non codants, qui manifestement pourraient jouer un rôle prépondérant en oncologie.
26
Introduction
III. Les protéines tyrosines kinases
Les protéines kinases représentent environ 2% des protéines codées par le génome des
eucaryotes. Elles représentent la 3ème catégorie de protéines la plus commune dans le
génome humain. Il existe plus de 500 protéines avec une activité kinase mais seulement 90
sont des tyrosines kinases (Manning et al., 2002). Ces dernières catalysent le transfert du
dernier phosphate (en position γ) de l’ATP sur des résidus tyrosines (Tyr) de protéines cibles.
Les protéines tyrosines kinases interviennent dans le contrôle du cycle cellulaire, de la
migration cellulaire, du métabolisme cellulaire, de la prolifération et la différentiation
cellulaire. On distingue deux types de protéines tyrosines kinases : les protéines tyrosines
kinases cytoplasmiques et nucléaires et les récepteurs transmembranaires (Figure 4).
Figure 4 : Les protéines tyrosine kinase (d’après Cell Signaling)
27
Introduction
A. Les récepteurs à activité Tyrosine kinase
1. Structure
Les récepteurs à activité tyrosine kinase sont composés de trois domaines :
Un domaine extracellulaire généralement glycosylé, avec un domaine de liaison du
ligand,
Un domaine transmembranaire (une simple hélice),
Un domaine cytosolique qui possède une activité protéine tyrosine kinase (PTK)
La Figure 5 représente les différentes familles de récepteurs tyrosines kinases, classées selon
leur structure.
Figure 5 : Les récepteurs tyrosines kinases (RTK) (d’après Blume-Jensen P, Nature, 2001)
2. Activation
L’ensemble des ces récepteurs (sauf le récepteur à l’insuline) se trouve à l’état inactif à
la surface des cellules sous la forme de monomères. La présence de ligand va induire, dans la
majorité des cas, une dimérisation de ces récepteurs, ce qui va entraîner une autophosphorylation des tyrosines du domaine cytosolique. Les tyrosines phosphorylées seront
des sites de liaison d’une variété de molécules possédant des domaines SH2 (Src homology2)
28
Introduction
ou PTB (phosphotyrosine binding) qui serviront de protéines d’ancrage pour le recrutement
d’autres molécules de la voie de signalisation.
B. Les protéines tyrosine kinase cytoplasmiques
Les protéines kinase cytoplasmiques n’ont pas de fonction réceptrice et sont localisées
au niveau du cytoplasme ou à la face interne de la membrane plasmique. On distingue
différentes familles de tyrosine kinase cytoplasmiques :
Tableau 3 :
Famille
Membres
Famille
Membres
SYK
SYK, ZAP70
JAK
JAK1, JAK2, JAK3, TYK2
BTK
BTK, ATK, BPK, TEK, ITK
FAK
FAK, PYK2
SRC, YES, FYN, FGR,
Les TK
cytoplasmiques.
SRC
FPS
ABL
LCK, HCK, LYN, BLK
FPS/FES, FER, FLK
ABL, ARG
CSK, MTK, HYL, ISK,
CSK
CTK, HTK
1. Structure (Lewin B, Gènes VI, 1998)
Les protéines kinases cytoplasmiques contiennent dans certains cas en plus de leur
domaine catalytique, des domaines de type SH2 et SH3. Les domaines de type SH2 ont la
particularité de se fixer sur des séquences caractéristiques contenant un résidu tyrosine
phosphorylé. Les domaines SH3 interagissent avec des séquences riches en prolines.
2. Activation (Lewin B, Gènes VI, 1998)
Les protéines tyrosines kinases cytoplasmiques vont être recrutées au niveau des
récepteurs activés via leur domaine SH2 (Figure 6). Ces domaines jouent un rôle essentiel
dans les phénomènes de relocalisation intracellulaire en reconnaissant spécifiquement les
tyrosines phosphorylées. Les domaines SH2 ne présentent pas d'affinité pour des résidus non
phosphorylés. Ce domaine a une structure tridimensionnelle compatible avec celle du
récepteur. Pour que la fixation se fasse de manière stable, on observe au sein du domaine SH2
29
Introduction
une suite d'acides aminés créant un environnement de charge positive. C'est dans cette
"poche" que vient se loger le phosphate de charge négative porté par la tyrosine du récepteur.
L'attraction des charges contraires assure ensuite une forte stabilité à cette association ce qui
entraîne une phosphorylation des tyrosines kinases cytoplasmiques qui permet la transmission
du signal.
Figure 6 : Activation de la tyrosine kinase cytoplasmique Abl. Le domaine SH2 de Abl se fixe sur
le résidu phosphorylé et/ ou le domaine SH3 se fixe sur les séquences consensus, entraînant ainsi
une phosphorylation sur ses tyrosines 245 et 412. (d’après Cayatte PA, 2006)
3. Exemple : JAK2
JAK2 appartient à la famille des Janus kinases qui compte quatre membres : JAK1,
JAK2, JAK3 et TYK2. Ce sont de grandes protéines d’environ 1000 acides aminés ayant des
poids moléculaires oscillant entre 120 et 130 kDa. Leur structure est caractérisée par la
présence d’un domaine catalytique (ou JH1) en position C terminale qui est responsable de la
phosphorylation des substrats (Leonard and O'Shea, 1998); il est suivi d’un domaine
pseudokinase (ou JH2) qui exerce une fonction inhibitrice (Chen et al., 2000; Saharinen et al.,
2000; Saharinen et al., 2003). On retrouve dans la région N-terminale un domaine nommé
FERM (Four-point-one, Ezrin, Radixin, Moesin) (Hilkens et al., 2001; Zhou et al., 2001) qui
permet l’attachement au récepteur et qui régule également l’activité catalytique. Ce domaine
est variable d’une JAK à l’autre. Finalement, les JAKs ont un domaine SH2 entre les
domaines FERM et pseudokinase (O'Shea et al., 2002).
30
Introduction
Figure 7 : Structure des protéines JAK. FERM : Four-point-one, Ezrin, Radixin, Moesin ; SH2 : SRC
homology domain ; JH : JAK homology domain (Yamaoka K, Genome Biology, 2004)
Les différentes JAKs ont généralement des fonctions non-redondantes in vivo. JAK1
est abondamment exprimée et interagit avec des récepteurs aux interleukines et facteurs de
croissance tels que ceux de l’IL-2, -4, -6, -11 et –13, du G-CSF (Granulocyte colony
stimulating factor). Elle se lie aussi aux récepteurs des trois types d’IFN (Liu et al., 1998).
JAK2 est également largement exprimée. Elle semble essentielle à la signalisation induite par
l’IL-3, le GM-CSF, l’IL-5, l’érythropoïétine, la thrombopoïétine et l’IFNγ (Liu et al., 1998;
O'Shea et al., 2002). D’ailleurs, les souris déficientes en Jak2 meurent au stade embryonnaire
et ceci à cause de l’absence d’érythropoïèse. JAK3 ne se lie qu’aux récepteurs de l’IL-2, -4, 7, -15 et -19 (Liu et al., 1998). Son absence chez la souris provoque un phénotype SCID.
Enfin, TYK2 est impliquée dans la signalisation reliée aux IFNα/β, à l’IL-6, à l’IL-10 et à
l’IL-12 (Liu et al., 1998).
Le mécanisme d’activation de la voie JAK/STAT est relativement simple. Tout
d’abord, les protéines JAKs sont liées aux récepteurs via leur domaine FERM. Lors de la
liaison du ligand à son récepteur, il y a induction de l’oligomérisation de ce dernier. Le
rapprochement des chaînes du récepteur provoque l’autophosphorylation et/ou la
transphosphorylation des JAKs associées sur des résidus tyrosine. Les JAKs phosphorylent
également le récepteur sur des résidus tyrosines. Ces résidus sont ensuite reconnus par des
protéines contenant des domaines SH2 telles les protéines de la famille STAT. Ces dernières
se fixent au récepteur et sont ensuite phosphorylées sur leurs résidus tyrosines par les JAKs
(O'Shea et al., 2002). L’étape suivante est la dimérisation de deux protéines STATs
phosphorylées (le domaine SH2 de l’une se liant à la tyrosine phosphorylée en C-terminal de
l’autre et inversement (Kisseleva et al., 2002)) et la translocation du facteur de transcription
au noyau.
31
Introduction
Figure 8: Voie JAK/STAT
a)
A l’état inactif, les récepteurs
sont sous la forme de monomères,
JAK et STAT sont déphosporylés.
b) En présence du ligand les
récepteurs se dimérisent entrainant
successivement une activation des
JAKs
puis
des
STATs
par
phosphorylation, une dimérisation
des STATs phosphorylées, et enfin
une activation de la transcription
des
gènes
cibles
des
STATs
(d’après Shuai K, Nature Review
Immunol, 2003)
C. Translocations chromosomiques et tyrosine kinase
Les gènes codant des protéines tyrosine kinase sont fréquemment réarrangés dans les
hémopathies malignes. Les gènes de fusion issus de ces translocations sont composés dans la
majorité des cas d’une partie 5’ codant pour des domaines d’oligomérisation et d’une partie 3’
codant pour les domaines catalytiques des tyrosines kinases (Rodrigues and Park, 1994). Les
domaines d’oligomérisation vont permettre la dimérisation des protéines et donc le
rapprochement des domaines catalytiques ce qui va entraîner une transphosphorylation
constitutive des tyrosines kinases.
1. Translocations chromosomiques et RTKs:
Les gènes codant pour des récepteurs à activité tyrosine kinase sont fréquemment
réarrangés suite à des translocations réciproques (Schlessinger and Ullrich, 1992). A titre
d’exemple, on peut citer le récepteur PDGFRβ (Platelet derived Growth Factor) dans la
leucémie chronique myélomonocytaire associé à la translocation t(5;12) (Golub et al., 1994),
et le récepteur ALK (anaplastic lymphoma kinase), dérégulé suite à la translocation t(2;5)
32
Introduction
dans les lymphomes non-hodgkinien (Hernandez et al., 1999; Morris et al., 1994).
Les protéines de fusion résultant de ces translocations ont perdu les séquences codant
pour les domaines extracellulaires des RTKs mais ont conservé les séquences codant pour le
domaine catalytique. Les nouvelles séquences juxtaposées en N-terminal favorisent la
dimérisation, comme dans les fusions TEL-PDGFRβ où la partie du gène TEL (ou ETV6)
code pour une région "Helix-Loop-Helix" (HLH).
Figure 9 : Structure de la protéine de fusion TEL-PDGFRβ dans la LMMC.
LMMC :
Leucémie
myélomonocytaire
chronique ;
HLH :
Helix-Loop-Helix,
TM :
domaine
transmembranaire, TK1 et TK2 : domaines kinases. (d’après Golub TR, Cell, 1994)
Ceci est également retrouvé dans les fusions NPM-ALK et TPM3-ALK où le domaine
NH2 terminal contenant des hélices hydrophobes ou motifs "Coiled-Coil" est responsable de
la dimérisation et de l'activation constitutive de la kinase (Bai et al., 1998). Les conséquences
de ces réarrangements sont importantes pour la fonction du RTK (Blume-Jensen and Hunter,
2001). En effet, l'activation du récepteur devient constitutive, non régulée, et indépendante de
la fixation du ligand. Les séquences de dimérisation engendrent une activation constitutive du
domaine tyrosine kinase.
La localisation peut également être affectée par la formation de la protéine de fusion.
Par exemple, lorsque la chimère NPM-ALK forme un hétérodimère avec NPM, sa localisation
devient nucléaire, alors que sous la forme NPM-ALK/NPM-ALK elle est cytoplasmique
(Espinos, E, Hematologie, 2005).
Enfin, la structure de la protéine de fusion peut également permettre l’activation de
nouvelles cibles.
33
Introduction
2. Translocations chromosomiques et TK cytoplasmiques:
a) BCR-ABL1
Parmi les protéines kinases cytoplasmiques impliquées dans les translocations, la
fusion BCR-ABL1 est la mieux documentée. Dans les années soixante, Nowell et Hungerford
observent la présence d’un chromosome court appelé chromosome Philadelphie associé à la
leucémie myéloïde chronique (Nowell, 2007). En 1973, Rowley identifie ce chromosome
comme étant le résultat d’une translocation chromosomique entre les chromosomes 9 et 22
(Rowley, 1973). En 1983, Reddy et coll. découvrent que cette translocation fusionne le gène
BCR (breakpoint cluster region) situé sur le chromosome 22 avec le gène abelson (ABL1)
situé sur le chromosome 9. Le gène de fusion BCR-ABL1 code une protéine avec une activité
tyrosine kinase (Reddy et al., 1983). Puis en 1990, Daley et coll. démontrent que des souris
irradiées et greffées avec des cellules souches hématopoïétiques de moelle osseuse
transfectées avec l’ADNc codant pour BCR-ABL1 développent une maladie proche de la
leucémie myéloïde chronique (Daley et al., 1990).
A l'état normal, l'oncogène ABL1 est transcrit en un ARN messager qui produit une
protéine de 145 kDa à activité tyrosine kinase (Smith and Mayer, 2002). Le gène de fusion
BCR-ABL1 est transcrit en un ARNm de 8.5 kb, qui produit une protéine de 210 kDa. Cette
protéine est composée du domaine d’oligomérisation de BCR et du domaine catalytique de
ABL1 (Figure 10).
Figure 10 : Structure de la protéine de fusion BCR-ABL. SH : Src-Homology, DBL : domaine
d’homologie avec la protéine DBL, TK : domaine tyrosine kinase, NLS : séquence de localisation
nucléaire, DB : domaine de liaison à l’ADN.
Le domaine d'oligomérisation est crucial pour les propriétés transformantes des
protéines de fusion (Golub et al., 1996; McWhirter et al., 1993). En effet, suite à leur
oligomérisation, il y a activation constitutive du domaine kinase de ABL1 et stimulation des
voies de transduction (Okuda et al., 1996; Voss et al., 2000). De plus, la présence de la
chimère BCR-ABL1 délocalise ABL1 du noyau vers le cytoplasme.
34
Introduction
Cette translocation définit la LMC. Cependant on la retrouve également dans des
leucémies aiguës myéloblastiques ou lymphoblastiques (Deininger et al., 2000; Kantarjian et
al., 1991). Dans certains cas, elle peut être associée à un caryotype plus complexe tel que la
t(1;9;22) ou être cryptique (détectable seulement grâce aux techniques de biologie
moléculaire). Enfin, c’est en 1996 que Drucker et coll. identifièrent un nouveau composé issu
de la classe des phénylamino-pyrimidines agissant comme un inhibiteur spécifique de
l’activité tyrosine-kinase de BCR-ABL : l’imatinib ou Glivec (Druker et al., 1996). L’imatinib
est un inhibiteur compétitif car il agit en se fixant dans la poche à ATP de ABL. Il est
également utilisé comme inhibiteur d’autres tyrosines kinases telles que KIT, PDGFRα ou
PDGFRβ. Ce médicament est très efficace, cependant des phénomènes de résistance, liés à
des mutations dans la poche à ATP de ABL, sont rencontrés dans certains cas.
b) JAK2
Un autre exemple de protéine tyrosine kinase cytoplasmique dérégulée suite à des
translocations chromosomiques est la protéine JAK2.
(1) La translocation chromosomique t(9;12)(p24;p13)
En 1997, Lacronique et coll. observent une translocation t(9 ;12)(p24 ;p13) chez un
enfant de 4 ans atteint de leucémie aiguë lymphoblastique T (Lacronique et al., 1997). Par
Southern blot, ils démontrèrent que le gène TEL (ou ETV6) situé en 12p13 était réarrangé
avec un fragment de chromosome 9. Le gène TEL (Translocated ETS Leukemia) est un gène
de la famille ETS qui code pour des régulateurs de la transcription. La protéine TEL est
composée d'un domaine d'oligomérisation HLH en N-terminal et d'un domaine ETS de liaison
à l'ADN. Par RACE PCR (Rapid Amplification of cDNA Ends), ils identifièrent JAK2
comme partenaire de TEL. La translocation conduit à la fusion du codon 337 de TEL avec le
codon 811 de JAK2. La protéine de fusion TEL-JAK2 conserve le domaine d’oligomérisation
HLH de TEL et les domaines catalytiques JH1 et pseudo-kinase JH2 de JAK2.
Figure 11 : Structure de la protéine de fusion TEL-JAK2
HLH : Helix loop helix, JH : JAK homology domain (d’après Lacronique V, Science, 1997)
35
Introduction
Par des expériences de co-immunoprécipitation et à l’aide de mutants, ils démontrèrent
que la chimère TEL-JAK2 conservait la propriété d’oligomérisation grâce à la présence des
domaines HLH de TEL (Lacronique et al., 1997). De plus, la chimère présente un fort niveau
de phosphorylation, in vitro. Enfin, les propriétés transformantes furent observées dans le
système cellulaire Ba/F3 (lignée murine dépendante de l’IL3). Les cellules transfectées
stablement avec TEL-JAK2 prolifèrent même en absence d’IL3 et la voie STAT5 en aval de
JAK2 est activée de façon constitutive (Lacronique et al., 1997). Cette translocation a été
également retrouvée dans des leucémies aiguës lymphoïdes pré-B et leucémies myéloïdes
chroniques atypiques (Peeters et al., 1997). En 2000, Carron et coll. établirent des souris
transgéniques en clonant l’ADNc de TEL-JAK2 sous le contrôle du promoteur/enhancer
EµSRα, spécifique des lignées B et T. Ces souris développent des leucémies aiguës
lymphoblastiques T et meurent dans un délai de 4 à 20 semaines (Carron et al., 2000). La
transduction rétrovirale de TEL-JAK2 de cellules de moelle osseuse réimplantées dans des
souris irradiées conduit à un développement de leucémies mixtes myéloïdes et lymphoïdes
(Schwaller et al., 1998). Enfin les souris transgéniques EµSRα-TEL-JAK2 / Cd3ε-/développent des leucémies/lymphomes B (dos Santos and Ghysdael, 2006). Les propriétés
oncogéniques de TEL-JAK2 ont donc été démontrées in vitro et in vivo. Les voies de
signalisation mises en jeu sont diverses (extracellular signal–regulated kinase (ERK), stressactivated protein/Jun kinase (SAPK/JNK) et p38 (Ho et al., 2002)), mais la principale
demeure la voie JAK/STAT avec une activation constitutive de STAT5.
(2) La translocation chromosomique t(9;22)(p24;q11.2)
La translocation chromosomique t(9;22)(p24;q11.2) a été retrouvée chez une patiente
qui présentait des signes cliniques de leucémie myéloïde chronique (Griesinger et al., 2005).
La translocation BCR-ABL1 était suspectée, mais les résultats indiquèrent que le gène BCR
était bien réarrangé mais que le gène ABL1 n’était pas impliqué dans la pathologie. La
recherche de gènes candidats a permis de mettre en évidence un réarrangement entre les gènes
BCR et JAK2. La protéine de fusion obtenue conserve le domaine d’oligomérisation HLH de
BCR et le domaine tyrosine kinase JH1 de JAK2. La patiente traitée par imatinib n’a pas
répondu du au fait que la kinase JAK2 n’est pas sensible à l’imatinib (Griesinger et al., 2005).
36
Introduction
(3) La mutation V617F
L’activation constitutive de JAK2 est un phénomène classique dans les translocations
chromosomiques par rapprochement des domaines catalytiques de JAK2 grâce à la
dimérisation des parties NH2 de la chimère (TEL ou BCR). Cependant, il a été démontré
récemment qu’une mutation dans le domaine pseudo-kinase JH2 de JAK2 était à l’origine
d’une activation constitutive dans les syndromes myéloprolifératifs (James et al., 2005;
Kralovics et al., 2005).
Il s’agit d’une mutation ponctuelle (G en T) qui résulte en la
substitution d’une valine par une phénylalanine (V617F) retrouvée dans plus de 90% des
polyglobulies vraies (PV), 60% de thrombocytémies essentielles et 60% de myélofibroses
idiopathiques (James et al., 2005). Dans quelques cas la mutation est homozygote, en
particulier dans les PV. Le mécanisme reste à éclaircir, cependant on peut penser que cette
mutation lève l’inhibition exercée par le domaine JH2 entraînant une activation constitutive
de la kinase. En effet, il a déjà été démontré qu’une délétion du domaine JH2 entraînait une
activation constitutive de JAK2 (Saharinen et al., 2003).
Figure 12 : Activation de la
protéine kinase cytoplasmique
JAK2. A) Inhibition du domaine
kinase JH1 par le domaine JH2.
B) Fixation du ligand (EPO :
érythropoiétine)
Changement
au
récepteur.
conformationnel.
JH2 n’inhibe plus le domaine
kinase JH1. Activation de JAK2.
C) La mutation V617F dans le
domaine JH2 ne lui permet plus
d’inhiber
JH1.
constitutive de JAK2.
Activation
(Bennett M, Journal of translationnal medecine, 2006)
37
Introduction
IV. Les facteurs de transcription
Un facteur de transcription se définie comme toute protéine nécessaire à l’initiation de
la transcription. La plupart des facteurs de transcription agissent en reconnaissant directement
des séquences cis-régulatrices au niveau des régions promotrices des gènes. Cependant, la
liaison à l’ADN n’est pas toujours requise pour l’action d’un facteur de transcription. Un
facteur de transcription peut ainsi reconnaître un autre facteur de transcription liant
directement l’ADN, ou bien reconnaître directement l’ARN polymérase. Les facteurs de
transcription sont très conservés au cours de l’évolution et jouent des rôles prédominants dans
le développement et l’hématopoïèse normale.
Les facteurs de transcription sont fréquemment réarrangés dans les hémopathies
malignes, en particulier les protéines appartenant à la famille ETS (ex : TEL), à la famille
HOX (ex : HOXA9), les protéines AML1 ou RARα (Dash and Gilliland, 2001). D’une
manière générale, on peut distinguer deux mécanismes d’action de ces chimères :
Effet dominant négatif sur la protéine native (Hiebert et al., 2001):
-
fusion entre un domaine d’oligomérisation et un domaine d’activation transcriptionnel
-
chimère conservant le domaine de liaison à l’ADN et perte du domaine de
transactivation
Activateur transcriptionnel ou facteur de transcription aberrant:
-
fusion entre le domaine de liaison à l’ADN d’un partenaire avec le domaine de
transactivation de l’autre partenaire
Nous citerons quelques exemples de réarrangements impliquant des facteurs de
transcription fréquemment rencontrés dans les leucémies puis nous détaillerons l’implication
de la famille de facteur de transcription PAX (Paired Box gene) dans les translocations
chromosomiques.
38
Introduction
A. Protéines de fusion avec effet dominant négatif
1. La fusion TEL-AML1 (Golub et al., 1995; Romana et al., 1995):
Comme nous l’avons vu précédemment, le gène TEL code un régulateur
transcriptionnel composé d’un domaine d’oligomérisation et d’un domaine de liaison à
l’ADN. Le gène AML1 (Acute Myeloid leukemia 1 ou CBFA2 ou RUNX1) code une des sousunités du Core Binding Factor (CBF) en association avec CBFB. CBF est un facteur de
transcription régulant l’expression de gènes impliqués dans la différentiation hématopoïétique
normale tels que l’IL-3, le GM-CSF (granulocyte-macrophage colony stimulating factor), le
récepteur au M-CSF (macrophage colony stimulating factor), le TCRβ (T-cell receptor beta)
ou les IGH (immunoglobulin heavy chain). AML1 est composé d'un domaine RUNT qui lui
permet de se lier à l'ADN, d’avoir une localisation nucléaire et d’interagir avec CBFb.
La translocation t(12;21)(p13;q22) est retrouvée dans 20 à 25% des leucémies aiguës
lymphoblastiques pré-B de l’enfant (Ferrando and Look, 2000) et fusionne les gènes TEL et
AML1. La protéine de fusion TEL-AML1 comporte les domaines d'oligomérisation de TEL et
le domaine RUNT d'AML1.
Figure 13 : Structure de la protéine de fusion TEL-AML1 dans les LAL (d’après Romana SP,
Blood, 1995)
Hiebert et coll. ont montré que la protéine de fusion TEL-AML1 inhibe la
transactivation d'un gène rapporteur placé sous le contrôle de l'enhancer du TCRβ et interfère
avec l'activation de cet enhancer par AML1. Ainsi la protéine TEL-AML1 a un effet
dominant négatif sur les propriétés normales d'AML1 et cette activité de répression est
dépendante de l'intégrité du domaine HLH de TEL (Hiebert et al., 1996). Cependant, les
souris transgéniques TEL-AML1 n’induisent pas de LAL-B mais une augmentation de l’autorenouvellement des progéniteurs B (Andreasson et al., 2001; Morrow et al., 2004; Tsuzuki et
al., 2004), ce qui suggère que la présence de TEL-AML1 n’est pas suffisante pour induire un
39
Introduction
phénotype malin sans mutations additionnelles.
2. La fusion PML-RARα
La translocation t(15;17)(q22;q11.2) est retrouvée chez des patients atteints de
leucémies aiguës promyélocytaires dans 95% des cas. La protéine de fusion issue de cette
translocation est la protéine PML-RARα. PML, pour promyelocytic leukemia, code une
protéine composée de domaines en doigt de zinc, de 2 domaines B Box (liaison à l’ADN),
d’un domaine de dimérisation et d’une séquence de localisation nucléaire. PML a un effet
suppresseur de tumeur, intervient dans l’apoptose et se localise au niveau de corps nucléaires
(Guo et al., 2000). De plus, PML a des effets antiprolifératifs et bloque la transformation de
fibroblastes embryonnaires par des oncogènes. Le gène RARα (récepteur à l’acide rétinoïque)
code un facteur de transcription dépendant de la présence d’acide rétinoïque (ATRA). En
absence d’ATRA, il est associé à des corépresseurs transcriptionnels. En présence d’ATRA, il
s’associe avec des co-activateurs transcriptionnels tels que TIF1, CBP… (Chakravarti et al.,
1996; Le Douarin et al., 1995)
La protéine chimère PML-RARα bloque la fonction de RARα comme celle de PML :
PML-RARα, agissant comme un mutant dominant négatif de RARα, bloque la différenciation
des cellules hématopoïétiques au stade de promyélocyte (He et al., 1998). L'expression de
PML-RARα conduit à la perte de la localisation de PML au niveau des corps nucléaires par
la formation d'hétérodimères PML-RARα-PML. La perte de la localisation spécifique de
PML au sein du noyau serait associée à une incapacité à bloquer la prolifération. Ainsi, la
maladie aurait deux facettes : inhibition de la différenciation (liée à un effet dominant négatif
sur RARα) et induction de la prolifération (liée à une perte du contrôle assuré par PML sur la
croissance cellulaire).
Le traitement par l'acide rétinoïque induit la différenciation des cellules leucémiques et
provoque la dégradation de PML-RARα (Chen et al., 1996; Yoshida et al., 1996) (Figure 14).
Cette dégradation est associée à la reformation des corps nucléaires PML. En association avec
la chimiothérapie, l’acide rétinoïque permet de guérir environ 75 % des LA promyélocytaires
(Tallman et al., 2002). De plus, certaines études ont mis en évidence un effet thérapeutique de
l'arsenic chez les malades atteints par ce type de leucémie (Chen et al., 1997). Contrairement à
l'acide rétinoïque, qui déclenche la différenciation cellulaire, l'arsenic induit la mort
40
Introduction
programmée, ou apoptose. L’arsenic, comme l'acide rétinoïque, provoque la dégradation de
l'oncogène PML-RARα, soulignant une surprenante similitude des effets de ces deux agents.
Si l'acide rétinoïque agit sur la partie RARα de la fusion, l'arsenic, lui, agit sur sa partie PML
(Figure 14). Ces données permettent l'élaboration d'un modèle physio-pathologique de cette
maladie, dans lequel RARα contrôlerait la différenciation et PML l'apoptose.
Figure 14:
Structure
de
la
protein
PML-RARα et traitement. a)
Le site de liaison au corépresseur
transcriptionnel
SMRT (silencing mediator for
retinoid and thyroid hormone
receptors) et le site de liaison
à l’acide rétinoïque de RARα
sont
conservés
protéine
de
dans
fusion
la
PML-
RARα. Pour PML, sa partie
N-terminale riche en sérine,
son domaine RING finger,
ses domaines B1 et B2 de
fonction
domaine
inconnue
et
coil-coiled
son
sont
conservés dans la chimère.
L’arsenic (As2O3) et l’acide rétinoïque ciblent respectivement PML et RARα. b) A forte concentration,
l’acide rétinoïque se lie à PML-RARα entraînant un changement conformationnel qui a pour
conséquences la dissociation des SMRT et le recrutement de co-activateur transcriptionnel permettant
à RARα de déréprimer la transcription de ses gènes cibles. L’acide rétinoïque permet également le
recrutement du protéasome entraînant la dégradation de PML-RARα. En revanche l’arsenic permet la
sumoylation sur l’acide aminé 160 de PML entraînant un recrutement du protéasome 11S et donc la
dégradation de PML-RARα. (Lallemand-Breitenbach V., Nature reviews cancer, 2005)
41
Introduction
B. Protéines de fusions avec un effet d’activateur transcriptionnel
1. La fusion E2A-PBX1
Le gène PBX1, codant une protéine à homéodomaine, est réarrangé avec le facteur de
transcription E2A, de la famille bHLH (basic Helix-Loop-Helix), dans la t(1;19) associée à
des leucémies aiguës lymphoblastiques pré-B (Kamps et al., 1990). La protéine de fusion
obtenue conserve le domaine de transactivation de E2A fusionné au domaine de liaison à
l’ADN de PBX1.
Le rôle oncogénique de la chimère a été démontré par la transformation de la lignée de
fibroblastes murins NIH3T3 et le blocage de différenciation par immortalisation des
myéloblastes (Kamps et al., 1996; Monica et al., 1994). Les propriétés transformantes de la
protéine de fusion dépendent de la partie amino-terminale de E2A, responsable de l'activation
de la transcription (Kamps et al., 1996). La chimère E2A-PBX1 active la transcription des
gènes cibles de PBX1.
2. La fusion NUP98-HOXA9
Un autre exemple est la translocation t(7;11) associée à une leucémie aiguë
myéloblastique, qui fusionne le gène NUP98 (codant pour une nucléoporine, un composant du
complexe du pore nucléaire qui permet le transport bi-directionnel des protéines et de l'ARN
entre le noyau et le cytoplasme) à un gène HOXA9 codant pour une protéine à homéodomaine
(Borrow et al., 1996). Le domaine N-terminal de NUP98, impliqué dans les interactions
protéine-protéine au pore nucléaire, et le domaine C-terminal de HOXA9, contenant
l’homéodomaine impliqué dans la fixation à l’ADN, sont conservés dans la protéine chimère.
In vitro, NUP98-HOXA9 induit la croissance de progéniteurs murins et le blocage de
différenciation (Calvo et al., 2002). Dans la lignée myéloïde K562, NUP98-HOXA9 agit
comme un facteur de transcription aberrant en activant la transcription des gènes cibles de
HOXA9 (Ghannam et al., 2004; Kasper et al., 1999). De plus, la transplantation de moelle
osseuse transduite par NUP98-HOXA9 dans des souris induit une leucémie aiguë
myéloblastique (Kroon et al., 2001).
42
Introduction
C. Les translocations chromosomiques impliquant la famille des gènes PAX
dans les cancers humains
Les gènes PAX appartiennent à la famille des gènes du développement codant des
facteurs de transcription. Ils interviennent notamment au cours de l’embryogenèse en
contrôlant le développement d’un grand nombre de structures telles que le tissu neural,
musculaire ou lymphoïde. Ces facteurs de transcription contrôlent l’expression de gènes
impliqués dans des processus cellulaires tels que la différenciation, la prolifération, l’apoptose
ou la mobilité cellulaire. Il existe neuf gènes PAX caractérisés par la présence d’un domaine
de liaison à l’ADN, le domaine Paired Box, très conservé au cours de l’évolution et décrit
pour la première fois chez la drosophile. Ces gènes peuvent être répartis dans quatre classes
différentes selon la présence ou non de deux autres motifs : le motif octapeptide hautement
conservé mais de fonction inconnue et le domaine de type homeobox entier ou tronqué qui est
un domaine de liaison à l’ADN. On distingue ainsi les familles PAX1/PAX9, PAX3/PAX7,
PAX4/PAX6 et PAX2/PAX5/PAX8.
Figure 15 : Localisation et structure des gènes de la famille PAX
(Robson EJD, Nature Reviews Cancer, 2006)
Cette conservation de séquence dans une même famille leur confère une fonctionnalité
similaire permettant ainsi de se substituer l’un à l’autre in vivo. Cependant le profil
d’expression est propre à chacun, même s’il existe de fortes similarités au sein d’une même
famille (Tableau 4). Par exemple, les gènes PAX2, PAX5 et PAX8 sont co-exprimés dans le
43
Introduction
système nerveux central, mais seul PAX5 intervient dans le développement de la lignée
lymphocytaire B. Ainsi, une inactivation de PAX5 affecterait uniquement la lignée B. Le rôle
central de la famille PAX dans le développement permet de comprendre l’importance de ces
gènes dans les processus malins. Ainsi, les gènes PAX sont altérés dans différentes
pathologies (Tableau 4).
Gènes
Expression
Pathologies associées
PAX1
Squelette, thymus
PAX2
SNC, rein
Rénal-coloboma syndrome
PAX3
SNC, crête neurale, muscle squelettique
Syndrome de Waardenburg, Rhabdomyosarcome
PAX4
Pancréas
PAX5
SNC, testicules, lignée B
Lymphome B, LAL-B
PAX6
SNC, yeux, pancréas
Aniridie, cataracte
PAX7
SNC, cranio-facial, muscle squelettique
Rhabdomyosarcome
PAX8
SNC, rein, thyroïde
Carcinome folliculaire de la thyroïde
PAX9
Squelette, cranio-facial, dent
Oligodentia
Tableau 4 : Expression et pathologies associées aux gènes de la famille PAX
Nous nous intéresserons plus particulièrement aux translocations chromosomiques
impliquant les gènes de la famille PAX.
44
Introduction
1. Les translocations chromosomiques impliquant les gènes PAX3 et
PAX7 dans le rhabdomyosarcome alvéolaire
Le rhabdomyosarcome (RMS) est une tumeur des parties molles dérivant des cellules
musculaires striées et représente environ 7% des cancers en pédiatrie. Il existe deux types
histologiques distincts : embryonnaire et alvéolaire. Ce dernier est caractérisé par la présence
dans 80% des cas d’anomalies cytogénétiques telles que la translocation t(2;13)(q35;q14) ou
son variant t(1;13)(p36;q14). Ces translocations conduisent respectivement à la formation des
protéines de fusion PAX3-FKHR et PAX7-FKHR (Figure 16). La détection de ces
translocations permet d'établir le diagnostic de RMS alvéolaire dans les cas les plus difficiles.
Les gènes PAX3 et PAX7 appartiennent à la même sous-famille des gènes PAX et
interviennent dans le développement du système nerveux central, de la crête neurale et du
muscle (Tableau 4). Ils sont composés du paired box domaine, du motif octapeptide et d’un
homéodomaine complet (Figures 15 et 16).
L’implication de ces gènes dans cette pathologie a débuté en 1993 par la
caractérisation de la translocation t(2;13)(q35;q14) (Barr et al., 1993). Barr et coll. ont
démontré que le gène PAX3 est réarrangé entre ses exons 9 et 10. Puis, par northern blot avec
une sonde PAX3, ils ont observé la présence d’un nouveau transcrit de 7,2kb dans les lignées
avec une t(2;13) correspondant à la partie 5’ de PAX3 fusionnée à une partie 3’ inconnue
provenant du chromosome 13. Grâce aux banques de données, une homologie entre cette
partie inconnue et les gènes de la famille fork head a pu être démontrée. Cette famille est
composée de facteurs de transcription caractérisés par la présence d’un domaine de liaison à
l’ADN appelé le domaine fork head. Le gène identifié dans cette fusion fut donc appelé
FKHR pour ForK Head in Rhabdomyosarcoma.
Le transcrit de fusion PAX3-FKHR conserve les exons 1 à 7 de PAX3 et 2 et 3 de
FKHR. La protéine de fusion obtenue est composée des domaines paired box, octapeptide et
homéodomaine de PAX3 et d’une partie du fork head domaine de FKHR ainsi que de la
totalité de son domaine de transactivation (Figure 16).
45
Introduction
Figure 16 :
Structure des protéines PAX3, PAX7
et FKHR et des protéines de fusion
PAX3-FKHR et PAX7-FKHR. DBD :
DNA
Binding
Domain ;
TAD :
Transactivation domain, PB : Paired
Box domain, HD : Homeodomain ; FD :
fork head domain (d’après Ahn EH,
Atlas
Genet
Cytogenet
Oncol
Haematol, 2006)
La translocation t(2;13)(q35;q14) avait été décrite dans 70% des cas de RMS
alvéolaires, cependant une autre translocation t(1;13)(p36;q14) avait été rapportée dans
quelques cas. Afin de vérifier qu’il ne s’agissait pas d’une translocation cryptique conduisant
à la formation d’une fusion entre PAX3 et FKHR, Davis et al. ont recherché par RT-PCR la
présence du transcrit de fusion (Davis and Barr, 1997). PAX3-FKHR n’étant présent dans
aucun cas, il s’agissait d’une nouvelle translocation impliquant un autre gène en 1p36. Or,
dans cette région le gène PAX7, appartenant à la même sous famille que PAX3, était présent.
Des expériences de RT-PCR et de Southern blot ont permis d’identifier PAX7 comme un
autre partenaire de FKHR. Le transcrit de fusion obtenu correspond à la partie 5’ de PAX7 et à
la partie 3’ de FKHR sur le même modèle que PAX3-FKHR (Figure 16). La translocation
t(2;13)(q35;q14), retrouvée dans environ 70% des cas, est associée à un mauvais pronostic,
alors que la translocation t(1;13)(p36;q14), représentant entre 8 et 15% des cas, est de
meilleur pronostic (Sorensen et al., 2002).
Afin de mieux comprendre le rôle de ces protéines de fusion, l’étude a tout d’abord
porté sur la capacité de transactivation de PAX3-FKHR par rapport à PAX3 sauvage. Le
domaine fork head étant tronqué dans la chimère, il semble que le domaine de liaison à
l’ADN important soit le domaine paired box. Des expériences ultérieures ont montré que
PAX3 pouvait se lier aux séquences e5 du gène eye de la drosophile. Des expériences de cotransfections avec les constructions PAX3 ou PAX3-FKHR et un plasmide e5-CAT ont montré
que les capacités de transactivation de PAX3-FKHR sont bien supérieures à celles de PAX3
(Fredericks et al., 1995). Afin de comprendre cette différence de capacité à transactiver les
46
Introduction
gènes cibles de PAX3, Bennicelli et coll. ont étudié la structure de la protéine chimère ce qui
a permis de localiser des régions inhibitrices au niveau du paired box domaine et de
l’homéodomaine de PAX3 (Bennicelli et al., 1995). La protéine de fusion PAX3-FKHR est
donc plus active que PAX3 car son domaine de transactivation est moins sensible aux
régulations négatives provenant des séquences inhibitrices de PAX3. La translocation
t(2;13)(q35;q14) conduit à un gain de fonction pour la chimère PAX3-FKHR. Ce gain de
fonction s’est révélé identique dans le cas de translocations t(1;13)(p36;q14) conduisant à la
chimère PAX7-FKHR (Bennicelli et al., 1999).
Afin d’évaluer le pouvoir transformant de la chimère, des fibroblastes embryonnaires
de poulet ont été transfectés par la chimère PAX3-FKHR. Un changement morphologique est
observé : les cellules transfectées sont plus larges et poussent sous forme d’agrégats. De plus,
elles ont acquis la capacité à former des colonies en agar mou ce qui reflète une croissance
indépendante de l’ancrage (Scheidler et al., 1996).
D’un point de vue thérapeutique, il est important de comprendre le mécanisme
d’action de ces chimères, et notamment les gènes dérégulés, afin d’identifier des cibles
potentielles. Par exemple, PAX3-FKHR régulerait positivement le gène BCL-XL, connu pour
ses propriétés anti-apoptotiques (Margue et al., 2000) et le récepteur MET, impliqué dans la
croissance et la motilité (Ginsberg et al., 1998). De même, les gènes PDGFRα (Epstein et al.,
1998; Ginsberg et al., 1998) et le gène codant le récepteur IGF-I qui joue un rôle important
dans le développement musculaire et l’étiologie des sarcomes de l’enfant serait également des
cibles de PAX3-FKHR (Ayalon et al., 2001).
47
Introduction
2. PAX8 dans les tumeurs folliculaires de la thyroïde
Les carcinomes folliculaires de la thyroïde représentent 10 à 20% des cancers de la
thyroïde et sont généralement associés, dans 50% des cas, à la translocation t(2;3)(q13;p25).
Cette anomalie chromosomique conduit à la formation d’une protéine de fusion, juxtaposant
le facteur de transcription PAX8 avec le récepteur nucléaire PPARγ (peroxisome proliferatoractivated receptor γ) (Kroll et al., 2000).
Le facteur de transcription PAX8 est exprimé au niveau du système nerveux central,
du rein et joue un rôle central dans l’organogenèse de la thyroïde en contrôlant notamment la
transcription de gènes spécifiques de la thyroïde, la thyroglobuline (TG) et la thyropéroxidase
(TPO). Situé en 2q13, ce gène code une protéine composée des domaines Paired box,
octapeptide et d’un homéodomaine tronqué.
Le gène PPARγ, situé en 3p25, appartient à la famille des PPAR (peroxisome
proliferator activated receptors) et fait partie de la superfamille des récepteurs nucléaires
hormonaux. Les PPAR, une fois activés par leurs ligands spécifiques, se retrouvent sous la
forme d’hétérodimères avec les récepteurs de l’acide rétinoïque (RXR) et vont pouvoir
réguler la transcription de gènes cibles en se fixant sur des éléments de réponse spécifiques de
l’ADN, les PPRE (Peroxysome Proliferator response element). Les PPAR interviennent
principalement dans le métabolisme lipidique, l’homéostasie glucidique et la différenciation
cellulaire. PPARγ, fortement exprimé dans le tissu adipeux, joue un rôle central dans la
différenciation adipocytaire. De plus, il intervient dans l’homéostasie du glucose, ainsi que
dans la réponse inflammatoire et immunitaire.
La chimère obtenue conserve les domaines Paired Box et homeobox de PAX8 et tous
les domaines de PPARγ (domaine de liaison à l’ADN, au ligand, domaine de dimérisation
avec l’acide rétinoïque, domaine de transactivation) (Kroll et al., 2000) (Figure 17). Le
domaine de transactivation de PAX8 est perdu.
Figure 17 : Structure de la protéine de fusion PAX8-PPARγ
La protéine de fusion PAX8-PPARγ concerve le domaine paired box (PD) et l(homéodomaine (HD) de
PAX8 et tous les domaines récepteurs nucléaires (A à F) de PPARγ. (Kroll TG, Science, 2000)
48
Introduction
Afin de déterminer la fonction de la chimère PAX8-PPARγ, les auteurs ont testé sa
capacité à transactiver les gènes cibles de PPARγ en utilisant différentes constructions de
PPRE associées au gène rapporteur de la luciférase, sous l’effet du ligand de PPARγ, la
troglitazone. L’expérience a montré que la chimère perd sa capacité de transactivation des
gènes cibles de PPARγ par comparaison avec le PPARγ sauvage. De plus, la co-transfection
de PAX8-PPARγ et de PPARγ sauvage (1:1) résulte en une totale inhibition de la capacité de
transactivation de PPARγ. PAX8-PPARγ agit comme un dominant négatif de PPARγ
sauvage. Cependant le rôle unique de PAX8-PPARγ en tant que dominant négatif de PPARγ a
été remis en question par une étude du profil d’expression des gènes dans les tumeurs de la
thyroïde portant la translocation t(2;3)(q13;p25). En effet, cette étude montre que certaines
cibles de PPARγ telles que l’angiopoietin-like 4 ou l’aquaporine 7, régulées positivement par
PPARγ en temps normal, sont surexprimées dans ces tumeurs (Lacroix et al., 2005).
L’effet de PAX8 dans la chimère a également été étudié permettant ainsi de démontrer
que la transcription des gènes cibles de PAX8 tels que SLC5A5 (Solute Carrier Family 5),
TPO (Thyroid Peroxidase) et TG (Thyroglobulin) était altérée en présence de la chimère (Au
et al., 2006).
49
Introduction
3. PAX5
PAX5 est un facteur de transcription qui joue un rôle important dans la différenciation
cellulaire et dans le développement embryonnaire. Il est localisé en 9p13 et possède deux
promoteurs distincts (Busslinger et al., 1996). Les ARNm issus de ces deux promoteurs se
distinguent par leurs séquences au niveau de l’exon1 (1a et 1b). PAX5b est exprimé au niveau
du système nerveux central, des testicules et de la lignée lymphoïde B. En revanche PAX5a
est restreint à la lignée lymphoïde B et code une protéine appelée BSAP (B-cell specific
activator protein).
La structure de PAX5 est semblable à celle des autres gènes de la famille PAX avec un
paired-box domaine, le motif octapeptide et un homéodomaine tronqué. Sa région C-terminale
contient un domaine de transactivation et un domaine répresseur (Figure 18a). Le domaine
paired box est divisé en deux sous-domaines contenant un motif hélice-boucle-hélice
homéodomaine-like et il est caractérisé par une séquence consensus définissant son affinité
pour les promoteurs de ses gènes cibles (Figure 18b).
Figure 18 : Structure de PAX5 : a) Représentation de la protéine PAX5 et de ses intéractions
protéiques. b) Séquence consensus du domaine de liaison à l’ADN Paired Box de PAX5. (Holmes ML,
Immunology and cell biology, 2008)
La partie N-terminale de PAX5 est capable de recruter les protéines de la famille ETS
au niveau du promoteur de certains gènes tel que CD79a (Fitzsimmons et al., 1996). La
collaboration de PAX5 et des protéines Ets permet d’augmenter l’expression de CD79a (Nutt
et al., 1998). L’activité transcriptionnelle de PAX5 peut également faire intervenir d’autres
partenaires en les recrutant via son domaine central et C-terminal. En effet, PAX5 s’associe
50
Introduction
au co-activateur transcriptionnel CBP grâce à son domaine de transactivation C-Terminal
(Emelyanov et al., 2002). Cependant PAX5 peut également s’associer via son domaine
octapeptide aux co-répresseurs de la famille Groucho entraînant une répression
transcriptionnelle (Eberhard et al., 2000) (Figure 18a).
PAX5a/BSAP est exprimé du stade Pro-B jusqu’au stade B mature puis son expression
s’éteint pour permettre la différenciation plasmocytaire (Figure 19). Dans les souris Pax5-/-,
la lymphopoïèse B est complètement stoppée au stade Pro-B suggérant ainsi un rôle majeur de
PAX5 dans la différenciation B.
Figure 19 : Expression de PAX5 au cours du développement B
PAX5 est exprimé du stade Pro-B jusqu’au stade B mature. Il régule positivement l’expression de
CD19 et réprime Notch1. Son expression s’éteint après le stade B mature pour permettre la
différenciation plasmocytaire. (Holmes ML, Immunology and cell biology, 2008)
a) Le développement des cellules B
La cellule B dérive d’une cellule souche hématopoïétique multipotente. Son
développement s’effectue au sein de la moelle osseuse chez l’adulte et dans le foie fœtal au
stade embryonnaire. La première étape de différentiation se définit par l’apparition du
marqueur B220 sur les cellules appelées « pré-pro-B » et par l’expression de gènes
spécifiques du développement B. L’apparition du marqueur CD19, cible de PAX5,
correspond au stade pro-B. A ce stade se produit le réarrangement des gènes du locus de la
chaîne lourde des Ig (d’abord une recombinaison entre un segment D et J, puis un second
réarrangement entre un segment V et le complexe DJ). Si ce réarrangement est fonctionnel la
51
Introduction
chaîne lourde d’isotype µ est synthétisée et tout autre réarrangement du locus de la chaîne
lourde est stoppé. La chaîne lourde µ intracellulaire s’associe avec une pseudo-chaîne légère,
composée des 2 protéines λ5 et VpréB, et les chaînes Igα et Igβ pour former le récepteur préB
(ou
pré-BCR
(B
cell
receptor)). Une fraction de
récepteurs est exportée à la
surface cellulaire et la cellule
progresse pour devenir une
cellule pré-B. L’expression
transitoire du pré-BCR est le
premier point de contrôle du
développement B (seules 55%
des cellules atteignent le stade
pré-B). Puis, on observe une
étape de prolifération générant
de multiples cellules pré-B
identiques.
Chaque
cellule
pourra
effectuer
un
Figure 20 : Différenciation B (d’après Winkler T)
réarrangement différent au niveau des gènes de la chaîne légère. Lorsque l’arrêt de
l’expression de la pseudo-chaîne légère se produit, il y a disparition du récepteur pré-B de la
surface des cellules et réarrangement du locus de la chaîne légère, d’abord sur le locus κ, et
s’il n’y a pas eu de réarrangement κ fonctionnel, sur le locus λ. Un réarrangement fonctionnel
d’un locus de chaîne légère permet la progression des cellules vers un stade B immature. Les
cellules n’ayant pas effectué un réarrangement fonctionnel sont éliminées. Les cellules B
immatures expriment des IgM de surface correspondant au BCR. Ces cellules sont capables
de reconnaître et de répondre à un antigène (Ag) via le BCR. Ce stade correspond également à
l’étape de sélection négative permettant d’acquérir un répertoire de cellules B tolérantes. Les
marqueurs CD22, CD23 et CD40 apparaissent à ce stade. Les cellules B matures naïves sont
caractérisées par la présence des IgM et IgD de surface. Ces cellules circulent en permanence
entre les différents organes lymphoïdes secondaires à la rencontre de l’Ag spécifique. Leur
demi-vie est courte en absence de rencontre de l’Ag spécifique (3 jours).
52
Introduction
Si la rencontre avec l’Ag spécifique a lieu, on passe à la seconde étape du
développement dépendante de l’Ag. La coopération du LB avec le LT CD4+ Th2 spécifique
du même Ag est nécessaire à la différenciation en LB effecteur. Cette collaboration fait
intervenir des protéines de membranes (CD40 du LB avec CD40L du LT) et des cytokines
sécrétées (IL4, IL5, IL6 et IL10). Une petite partie de ces cellules B se transforme rapidement
en plasmocytes sécréteurs d’Ac de faible affinité. Une grande partie de ces cellules B vont
effectuer la commutation isotypique (switch) de la chaîne lourde de l’Ig (changement de la
classe de l’Ig) et l’hypermutation somatique (modification de l’affinité pour l’Ag). Les
cellules B matures dont le BCR présente une maturation d’affinité pour l’Ag seront
sélectionnées positivement et poursuivront leur différenciation soit en plasmocytes sécréteurs
d’Ac, soit en cellules mémoires qui permettront une réponse secondaire plus rapide et plus
efficace.
b) Expression de PAX5 au cours du développement B
La différentiation des cellules B dépend des protéines E2A, EBF1 et PAX5. En effet,
l’inactivation d’un de ces gènes entraîne un blocage de différenciation précoce (Busslinger,
2004). La lymphopoïèse B est stoppée avant le stade des progéniteurs B220+ dans le foie
fœtal des embryons Pax5-/-. Par contre, la différenciation B atteint le stade pro-B (c-Kit+,
B220+) dans la moelle osseuse des souris Pax5-/-, suggérant une différence de régulation par
Pax5 entre la lymphopoïèse B fœtale et adulte (Nutt et al., 1997; Urbanek et al., 1994). Les
cellules pro-B Pax5-/- sont incapables de se différencier en cellules matures sans une
restauration de l’expression de Pax5. Ces cellules peuvent être maintenues en culture sur des
cellules stromales et proliférer en présence de l’interleukine IL-7.
De façon surprenante, lorsqu’on remplace l’IL-7 par des cytokines spécifiques d’autres
lignées, les cellules pro-B Pax5-/- sont capables in vitro de se différencier en macrophages,
granulocytes, cellules Natural Killer, cellules dendritiques et ostéoclastes (Nutt et al., 1999)
(Figure 21). Transplantées dans la moelle osseuse de souris porteuses, ces cellules pro-B
Pax5-/- sont également capables de se renouvelées et de développer tous les types cellulaires
mentionnés précédemment (Nutt et al., 1999; Rolink et al., 1999). De plus, ces cellules
peuvent complètement restaurer le développement des thymocytes de souris Rag2-/- (Rolink
et al., 1999) et se différencier in vitro en cellules T sur une monocouche de cellule stromale
53
Introduction
OP9 exprimant DL1 (Notch ligand Delta-like 1) (Hoflinger et al., 2004). PAX5 joue un rôle
crucial dans la différenciation B en inactivant les autres voies de différenciation.
Figure 21 : Plasticité des cellules pro-B Pax5-/L’inactivation de Pax5 bloque la différenciation à un stade Pro-B. Ces cellules sont capables de se
différencier en granulocytes, en cellules dendritiques, en macrophages, en ostéoclastes, en cellules
NK et en cellules T. (Cobaleda C, Nature Immunology, 2007)
Récemment, l’équipe de
Busslinger
a
démontré
que
l’inactivation de Pax5 dans les
cellules B matures entraine une
dédifférenciation jusqu’au stade
pro-B d’un pool de cellules au
bout d’une semaine. Ces cellules
sont
également
capables
de
reconstituer le compartiment T de
souris (cellules T -) (Cobaleda et
al., 2007) (Figure 22).
Figure 22 : Dédifférenciation des cellules B Pax5-/- en
cellules T. (Nutt SL, New England Journal of Medecine, 2008)
En revanche, Pax5 n’est pas capable d’induire une différenciation B si l’on force son
expression dans les cellules souches hématopoïétiques ou dans les progéniteurs erytro-
54
Introduction
myéloïdes (Anderson et al., 2007; Cotta et al., 2003). Cependant, une expression précoce de
Pax5 dans les progéniteurs lymphoïdes entraîne une forte différenciation vers la lignée B au
dépend de la lignée T (Cotta et al., 2003; Souabni et al., 2002). Ainsi, selon le contexte, Pax5
semble dépendre d’une collaboration avec d’autres facteurs de transcription lymphoïdes pour
promouvoir la différenciation B.
c) Régulation de PAX5
La régulation de l’expression de Pax5 est très peu connue. La chronologie
d’expression des facteurs de transcription lymphoïdes place PU.1, Ikaros, E2A et EBF1 en
amont de Pax5 étant donné qu’ils sont exprimés dans les cellules Pro-B Pax5-/- (Nutt et al.,
1997) (Figure 23).
Figure 23 : Expression et régulation des protéines PU.1, Ikaros, E2A, EBF1 et PAX5 dans les
stades précoces de différenciation B. PU.1 régule le récepteur à l’IL-7, FLT3, le marqueur B220 et
EBF1. Ikaros régule FLT3. E2A régule EBF1. EBF1 régule PAX5 et la formation du pré-BCR. PAX5
régule EBF1, le marqueur CD19 et la formation du pré-BCR. (Nutt SL, Immunity, 2007)
Le niveau d’expression de Pax5 est diminué dans les cellules pro-B E2a+/-,Ebf1+/- de
souris (O'Riordan and Grosschedl, 1999) et l’expression de Ebf1 dans les souris E2a-/- induit
une différenciation jusqu’au stade pro-B en activant Pax5 (Seet et al., 2004). Ces résultats
suggèrent une régulation de Pax5 par Ebf1. De plus, EBF1 et STAT5 sont capables de se lier
sur les séquences en amont de l’exon 1A de Pax5 (Hirokawa et al., 2003; O'Riordan and
55
Introduction
Grosschedl, 1999). Ces résultats ont besoin d’être complétés par une caractérisation
fonctionnelle du promoteur de Pax5 et des éléments enhancers pour définir précisément la
régulation de Pax5.
De manière intéressante, EBF1 est capable d’activer la transcription de PAX5, mais
PAX5 est lui-même capable de réguler l’expression de EBF1, permettant de maintenir son
expression dans les lymphocytes B (Fuxa et al., 2004; Nera et al., 2006; Roessler et al., 2007).
Afin de déterminer la régulation de l’expression de Pax5, Fuxa et coll. ont mis en
place un modèle de souris transgéniques dans lequel chacun des deux allèles de Pax5 contient
dans sa partie 3’ non traduite un site IRES suivi soit du gène codant la GFP, soit du gène
indicateur CD2 (antigène de surface des lymphocytes T) humain tronqué dans sa partie
intracellulaire, permettant ainsi de suivre l’expression de chaque allèle indépendamment. Ce
modèle a permis de démontrer une expression bi-allélique de Pax5 tout au long du
développement, du stade pro-B jusqu’au stade B mature (Fuxa and Busslinger, 2007).
d) Répression transcriptionnelle par PAX5
PAX5 joue donc un rôle déterminant dans l'ontogenèse B et dans l'engagement
irréversible vers la voie de différenciation B. Le pouvoir de dédifférenciation des cellules proB Pax5-/- s’explique par la capacité de Pax5 à réprimer l’expression de gènes contrôlant les
autres voies de différenciation. En effet, il est capable de réprimer la transcription de Notch1
(Souabni et al., 2002), nécessaire à la différenciation T, ou la transcription de M-CSF-R (Nutt
et al., 1999) ce qui rend les précurseurs B insensibles aux cytokines myéloïdes telles que MCSF. Ce mécanisme n’est pas complètement compris, mais il a été démontré que Pax5 était
capable de recruter les corépresseurs de la famille Groucho afin d’entraîner une répression
transcriptionnelle. Les cibles réprimées par Pax5 ont été recherchées par l’étude du
transcriptome. Delogu et coll. ont identifié 110 gènes codant des protéines impliquées dans la
communication intercellulaire, dans l’adhésion, la migration, ainsi que dans le métabolisme
cellulaire (Delogu et al., 2006) (Tableau 5).
56
Introduction
Tableau 5 : Cibles de PAX5.
En rouge les cibles réprimées
par PAX5, en vert les cibles
activées par PAX5.
(Cobaleda C, Nature
Immunology, 2007)
Certains de ces gènes tel que Cd28 sont exprimés avant l’expression de Pax5 puis
réexprimés lors de la différenciation plasmocytaire. Pax5 réprime l’expression de gènes
codant des récepteurs de surface et des protéines de transduction de signal qui interviennent
dans les progéniteurs très précoces ou dans différentes lignées hématopoïétiques. Parmi les
protéines de surface on retrouve le récepteur Flt3 (Delogu et al., 2006; Holmes et al., 2006) ou
la protéine Ly6a (Sca1) qui contrôlent la prolifération et la différenciation des progéniteurs
hématopoïétiques, la sous-unité Ramp1 du récepteur CGRP (calcitonin gene-related peptide)
qui est impliqué dans le développement myéloïde, ou le récepteur Gp49b (Lilrb4) qui est
exprimé par les cellules NK (Delogu et al., 2006).
Les molécules de signalisation réprimées par Pax5 comprennent la molécule
adaptatrice Grap2 (Mona) du (pré) récepteur T et du récepteur M-CSF et l’adaptateur
transmembranaire NTAL (Lat2) des récepteurs Fcγ et Fcε (Delogu et al., 2006).
Les progéniteurs lymphoïdes modifient leurs propriétés adhésives et migratoires au
cours du développement étant donné que les cellules pré-pro-B et pro-B se logent dans des
niches différentes au sein de la moelle osseuse (Tokoyoda et al., 2004). En accord avec cette
observation, Pax5 réprime l’expression des chimiokines CCL3 et CCL9, des récepteurs aux
chimiokines CCR2 et CCR5, de la sous-unité αL du récepteur aux intégrines (Itgal) LFA-1 ou
de la protéine associée aux intégrines CD47 (Delogu et al., 2006).
57
Introduction
Holmes et coll. ont transduit des cellules souches hématopoïétiques avec un rétrovirus
permettant l’expression de Flt3. Les auteurs démontrent que la présence de Flt3 empêche un
développement B et que donc la répression de Flt3 par Pax5 est essentielle à la différenciation
B (Holmes et al., 2006). De plus, l’identification de Flt3 et de M-Csf-R comme cibles de Pax5
a permis de démontrer que Pax5 était capable de réprimer ces cibles en se liant à leurs
promoteurs (Holmes et al., 2006; Tagoh et al., 2006).
e) Activation transcriptionnelle par PAX5
L’activation de gènes spécifiques de la lignée B est la seconde fonction tout aussi
importante de PAX5. L’identification de gènes activés par PAX5 a permis de révéler un rôle
essentiel
de
PAX5
dans
le
contrôle de la transduction du
signal via le pre-BCR (Figure 24)
et le BCR (Busslinger, 2004). En
effet, PAX5 active l’expression de
CD79a
(MB1
ou
Igα)
(Fitzsimmons et al., 1996; Nutt et
al.,
1997),
activateurs
des
CD19
corécepteurs
et
CD21
(Horcher et al., 2001; Kozmik et
al., 1992; Nutt et al., 1998), du
corécepteur
inhibiteur
CD72
(Ying et al., 1998) et de la
Figure 24 : Régulation du pré-BCR par Pax5.
protéine
En rouge, les gènes régulés par Pax5.
adaptatrice
(Schebesta et al., 2002).
BLNK
(Holmes ML, Immunology and cell biology, 2008)
L’expression de Cd19 et de Blnk semble être complètement dépendante de Pax5 étant donné
que les cellules des souris Cd19-/-Blnk-/- sont bloquées à la transition pro-B/pré-B (Hayashi
et al., 2003). PAX5 régule également l’expression du facteur de transcription LEF-1 (Nutt et
al., 1998), la tyrosine kinase BLK ou la recombinase RAG2 et maintient l’expression de
EBF1 (Fuxa et al., 2004; Roessler et al., 2007).
58
Introduction
Schebesta et coll. ont comparé le profil d’expression des cellules pro-B de souris
Pax5+/+ et Pax5-/- (Schebesta et al., 2007). 170 gènes sont décrits comme étant dépendants
de Pax5. Cette étude confirme une régulation par Pax5 de cibles déjà décrites telles que Mb1,
Cd19, Blnk ou Bcl-xL. Cette étude révèle que Pax5 régule des gènes codant des protéines de
fonctions très diverses telles que des récepteurs de surface, protéines de signalisation, des
protéines nucléaires. Ces protéines nucléaires incluent Spib, Irf4, Irf8, Bach2, and Ikzf3
(Aiolos), qui régulent la formation du centre germinatif B. D’autres cibles de Pax5 codent des
protéines impliquées dans la régulation du cycle cellulaire, le trafic protéique, le
cytosquelette, la migration cellulaire et l’adhésion. Afin de déterminer l’importance du
maintien de l’expression de Pax5 dans les cellules pro-B, les auteurs ont utilisé un modèle de
souris Cre-récepteur aux œstrogènes permettant de déléter Pax5 en présence d’œstrogènes.
Après délétion de Pax5, beaucoup de cibles identifiées sont réprimées, confirmant les
résultats obtenus.
Enfin, les cellules pro-B Pax5-/- présentent un réarrangement des IgH inefficace et
une absence de réarrangement des chaines légères. Pax5 est donc indispensable à la
différenciation B et au réarrangement des immunoglobulines (Urbanek et al., 1994).
Pax5 est essentiel tout au long de la différentiation B jusqu’au stade B mature,
cependant l’extinction de Pax5 est nécessaire pour permettre la différentiation plasmocytaire.
Schebesta et coll. (2007) ont étudié par RT-PCR le transcriptome des populations
plasmatiques et ont démontré que la moitié des cibles de Pax5 étaient réprimées. Cependant,
certaines cibles de Pax5 telles que Nedd9, Blnk et Irf4 continuent à être exprimées en absence
de Pax5. Pax5 n’est donc pas indispensable au stade plasmocytaire pour maintenir
l’expression de certaines de ses cibles. De plus, il semblerait que l’extinction de Pax5 soit
suffisante pour permettre le passage du stade B mature vers le préplasmocyte (Kallies et al.,
2007).
f) Rôle oncogénique de PAX5
PAX5 est impliqué dans différentes translocations, notamment dans certains cas de
lymphomes non hodgkiniens porteurs de la t(9;14)(p13;q32) où le gène PAX5 est juxtaposé au
59
Introduction
gène codant pour la chaîne lourde des immunoglobulines. D’autres variantes de
réarrangements de PAX5 permettent l’obtention d’une protéine de fusion, notamment PAX5ETV6 dans les LAL-B.
(1) PAX5-IgH
La translocation t(9;14)(p12;q32) est retrouvée dans 2% des lymphomes non
hodgkiniens et plus précisément dans des lymphomes lymphoplasmocytaires (LPL). Cette
translocation a tout d’abord été décrite dans la lignée KIS-1 établie à partir d’un patient atteint
de lymphome diffus à grandes cellules (Ohno et al., 1990). L’étude de cette lignée a permis de
démontrer que le locus de la chaîne lourde des immunoglobulines était réarrangé avec une
région chromosomique située en 9p13. L’utilisation de sondes correspondant aux séquences
en 14q32, proches du point de cassure, révèle la présence d’un transcrit d’environ 11kb par
Northern Blot dans les cellules porteuses de la translocation t(9;14) (Ohno et al., 1990). En
1996, Busslinger et coll. démontrèrent par Southern blot que le point de cassure sur le
chromosome 9 se situait à 1807 pb du 1er exon de PAX5. La translocation t(9;14) juxtapose les
gènes PAX5 et IgH en sens opposé de transcription. L’exon 1A de PAX5 se retrouve à
proximité de l’enhancer Eµ ce qui entraîne une surexpression de PAX5 dans la lignée KIS-1
11 fois supérieure à l’expression basale de PAX5 (Iida et al., 1996) (Figure25).
Figure 25 : Structure du réarrangement PAX5-IGH. La translocation conduit à la juxtaposition de l’enhancer
Eµ des IGH en amont de l’exon 1A de PAX5. (Cobaleda C, Nature Immunology, 2007)
Cette translocation a par la suite été décrite dans des lymphomes du manteau,
folliculaires et les lymphomes spléniques de la zone marginale. Souabni et coll. ont
reconstitué la translocation t(9;14) dans des souris knock in (KI) en insérant un minigène dans
le locus des IgH. Dans ce modèle, Pax5 est exprimé dans la lignée lymphoïde où il interfère
avec le développement T en activant les gènes spécifiques de la lignée B et en réprimant les
60
Introduction
gènes du développement T. Ces souris Igh-Pax5 développent des lymphomes T agressifs, ce
qui démontre que la lignée T est très sensible à l’action oncogénique de Pax5 (Souabni et al.,
2007).
(2) PAX5-ETV6
La
translocation
dic(9;12)(p13;p13)
est
associée
à
des
leucémies
aiguës
lymphoblastiques B. Ce réarrangement conduit à la formation d’un chromosome dicentrique
(dic) qui contient deux centromères. Afin d’identifier les gènes impliqués dans cette
translocation, Cazzanigga et coll. ont tout d’abord recherché quels pouvaient être les bons
candidats. ETV6, situé en 12p13, au niveau du point de cassure, était déjà décrit dans de
nombreux réarrangements (18 rapportés). Le réarrangement de ETV6 dans cette translocation
a été démontré par FISH et Northern Blot (Tosi et al., 1998). L’utilisation de cosmides a
permis de démontrer que le point de cassure se situait entre les exons 2 et 3 de ETV6. Afin
d’identifier le partenaire de ETV6, les auteurs ont utilisé la technique de RACE PCR (Rapid
Amplification of cDNA Ends). Après séquençage, ils ont pu identifier PAX5 comme
partenaire de ETV6. La translocation dic(9;12) fusionne l’exon 4 de PAX5 à l’exon 3 de
ETV6. Au niveau protéique, la chimère conserve le domaine paired box de PAX5 et les
domaines de dimérisation HLH et de liaison à l’ADN ETS de ETV6. De plus, les transcrits
PAX5A-ETV6 et PAX5B-ETV6, correspondant aux deux promoteurs de PAX5, ont pu être
détectés (Cazzaniga et al., 2001). Le niveau d’expression de CD19, une cible de PAX5, a été
évalué par RT-PCR chez les patients porteurs de la dic(9;12), mais aucune différence
significative n’a pu être observée. Ce résultat suggère que PAX5-ETV6 n’a pas d’effet sur
CD19 et que l’autre allèle de PAX5 est suffisant à son expression (Strehl et al., 2003).
Figure 26 : Structure de la protéine de fusion PAX5-ETV6 (TEL)
(Cobaleda C, Nature, 2007)
61
Introduction
V. Les microARNs
A. Découverte des microARNs
Les microARNs (ou miARN) ont été découverts grâce à l’étude de lin-4, un gène
connu pour réguler le développement larvaire de C. Elegans. Ce gène ne codait pas pour une
protéine, mais conduisait à la formation de deux ARNm de 22 et 61 nucléotides. Le plus
grand semblait être le précurseur du plus petit (Lee et al., 1993).
Puis, il a été démontré que la séquence de lin-4 était inversement complémentaire de
régions situées dans la partie 3’ UTR de l’ARNm de lin-14. La présence de lin-4 réduisait le
taux de protéine lin-14 sans en affecter le niveau d’expression de l’ARNm de lin-14. Ainsi, il
a été proposé que lin-4 régulait négativement la traduction de lin-14 par sa fixation sur les
régions 3’ UTR de l’ARNm de lin-14.
lin-4 est désormais reconnu comme appartenant à la famille des microARNs. Cette
famille contrôlerait la prolifération cellulaire, la mort cellulaire, le métabolisme chez les
mouche, le développement neural des nématodes, la différenciation des lignées
hématopoïétiques chez les mammifères ainsi que le développement des feuilles et des fleurs
chez les plantes.
B. Biogenèse des microARNs
Les microARNs peuvent être localisés soit dans les introns ou exons de gènes codants
ou non codants, soit dans des régions intergéniques. Leur transcription est majoritairement
dépendante de l’ARN polymérase II (Lee et al., 2004), mais il a également été décrit une
transcription ARN pol III dépendante (Borchert et al., 2006). La génération des microARNs
est initiée par la production de longs transcrits endogènes cappés et polyadénylés. Ces longs
transcrits se replient sur eux-mêmes pour former une structure d’ARNdb en tête d’épingle
appelée microARN primaire (pri-miARN). Lorsque les microARNs sont localisés au sein de
gènes, le pri-miARN correspond au pré-messager de son gène hôte (40% des cas). Ils peuvent
également être transcrits à partir de leur propre promoteur.
62
Introduction
La maturation des microARNs débute par le clivage nucléaire du pri-miARN en un
fragment en tige boucle de 60-70 nt, le pré-miARN, par l’endonucléase RNase III Drosha. Le
pré-miARN a alors un 5’ phosphate et 2 nucléotides en 3’ sortant, caractéristique d’un clivage
par une RNase III. Ce pré-miARN est ensuite transporté activement du noyau vers le
cytoplasme par le récepteur exportin-5 et Ran-GTP. Le pré-miARN est ensuite clivé en
microARN mature, de 20 à 23 nucléotides, par l’endonucléase RNase III Dicer (Figure 27).
Les microARNs interagissent alors avec des protéines spécifiques, telles que les protéines
Argonautes, pour former un complexe ribonucléoprotéique stable nommé RISC-miRNP
(RNA-induced silencing complex-micro-ribonucleoprotein) (Figure 27) (Hammond et al.,
2001; Hutvagner and Zamore, 2002; Martinez et al., 2002; Mourelatos et al., 2002; Tomari
and Zamore, 2005). Au sein de ce complexe, le microARN, par un jeu d’appariement de
bases, interagit avec les ARNm cibles. De tels appariements prennent place généralement
dans la région 3’ non traduite des ARNm (ou 3’UTR), mais il a également été montré des
régulations en 5’UTR (Lytle et al., 2007).
Figure 27 : Biogenèse des microRNAs (d’après Marek Mráz)
63
Introduction
C. Mode d’action des microARNs
Les modalités d’action du complexe RISC-miRNP sont relativement mal comprises,
mais semblent contrôlées par la qualité du duplex miARN-ARNm mis en jeu. Le complexe
RISC-miRNP se fixe sur l’ARNm cible, au niveau de régions spécifiques plus ou moins
complémentaires de la séquence des microARNs, appelées MREs pour miRNA Recognition
Elements (Ambros, 2004; Bartel, 2004; Mello and Conte, 2004). Si cette complémentarité est
parfaite, le complexe RISC-miRNP induit alors un clivage au milieu de l’hybride miARNARNm entraînant la dégradation rapide de l’ARNm (Elbashir et al., 2001; Hutvagner and
Zamore, 2002; Liu et al., 2004; Meister et al., 2004). Ainsi, non seulement les microARNs
partagent la même voie de biosynthèse que les siARNs mais, tout comme eux, ils peuvent
promouvoir la dégradation de l’ARNm cible. En revanche, si cette complémentarité est
imparfaite (présence de mésappariements dans le duplex miARN-ARNm), on observe alors
une inhibition de la traduction de l’ARNm cible (Figure 27).
1. Inhibition de la traduction médiée par les microARNs
a) Régulation au niveau de l’initiation de la traduction
L'extrémité 5’ des ARNm eucaryotes possède une structure coiffe qui joue un rôle
important dans l’initiation de la traduction et protège contre la dégradation précoce des
ARNm. La coiffe est formée d’une guanosine modifiée par ajout d’un méthyl en position 7
(m7G). L’interaction de cette coiffe avec les facteurs d’initiation (eIFs : eukaryotic Initiation
Factors) permet de recruter la sous unité 40S en 5’UTR des ARNm. Cette étape fait intervenir
au moins onze facteurs protéiques (Gingras et al., 1999) dont eIF4E, eIF4G et eIF4A qui
forment le complexe eIF4F, une cible clé pour réguler l’initiation de la traduction.
Différentes équipes ont démontré que la coiffe et la queue poly A des ARNm cibles
sont nécessaires à l’inhibition de la traduction médiée par les microARNs. (Humphreys et al.,
2005; Pillai et al., 2005; Wang et al., 2006). Mathonnet et coll. ont utilisé une construction
permettant la transcription d’un ARNm rapporteur avec des séquences spécifiques du
microARN let-7 dans son 3’UTR et ont démontré que let-7 empêche le recrutement des
ribosomes au niveau de l’ARNm rapporteur (Mathonnet et al., 2007). En revanche, l’addition
64
Introduction
du complexe eIF4F lève l’inhibition ce qui démontre l’importance de la coiffe.
b) Les protéines Argonautes
Les protéines Argonautes (AGO) appartiennent à une famille de protéines de 95kDa
qui contiennent deux motifs caractéristiques PAZ et PIWI retrouvés chez de nombreux
organismes (Carmell et al., 2002). Les protéines AGO se lient directement aux microARNs et
sont les protéines principales du complexe RISC-miRNP (Hammond et al., 2001; Hutvagner
and Zamore, 2002; Martinez et al., 2002; Meister et al., 2004; Mourelatos et al., 2002; Tomari
and Zamore, 2005). Des études de biochimie, de génétique et de cristallographie ont montré
que le domaine PIWI est un domaine RNase H (Ribonucléase H) (Parker et al., 2004; Song et
al., 2004; Yuan et al., 2005) et que certaines protéines AGO, telle que AGO2 ont une activité
endonucléase qui catalyse le clivage du duplex miARN-ARNm (Liu et al., 2004; Meister et
al., 2004). Cependant certaines expériences montrent que les protéines AGO induisent un
blocage de traduction mais pas une dégradation de l’ARNm cible (Pillai et al., 2004; Pillai et
al., 2005).
eIF4E appartient au complexe d’initiation de la traduction. Elle s’associe directement à
la coiffe des ARNm et son intéraction
est essentielle à l’initiation de la
traduction (Gebauer and Hentze,
2004; Richter and Sonenberg, 2005).
Or, Kiriakidou et coll. ont montré que
la
protéine
AGO2
contenait
également un domaine de liaison à la
coiffe m7G. Ainsi, AGO2, au sein du
complexe RISC-miRNP, agit par
compétition avec eIF4E afin de
bloquer l’initiation de la traduction
(Kiriakidou et al., 2007) (Figure 28).
Figure 28 : Compétition entre eIF4E et Ago2
(Meister G, Cell, 2007)
65
Introduction
c) Les protéines GW182
Les protéines GW182 ont été découvertes en 2002 comme une famille de protéines de
182kDa contenant beaucoup de répétitions glycine-tryptophane et un motif permettant de
reconnaître les ARNs (RRM : RNA Recognition Motif). De plus, GW182 est capable de
recruter des enzymes de déadénylation. De nombreuses études ont permis de démontrer que
ces protéines, très conservées au cours de l’évolution, sont capables de s’associer aux
protéines Argonaute et font partie du complexe RISC.
L’équipe de Wakiyama et coll. a établi une lignée HEK293 qui surexprime AGO2 et
GW182. En utilisant des ARNm biotinylés, cappés et polyadénylés contenant 6 sites
spécifiques pour let-7, ils ont montré que les protéines AGO2 et GW182 étaient
spécifiquement recrutées et que l’ARNm rapporteur était déadénylé de façon let-7 dépendante
(Wakiyama et al., 2007). De plus, une inactivation des protéines GW182 par ARNi entraîne
une diminution de la répression microARN dépendante (Jakymiw et al., 2005; Liu et al.,
2005; Meister et al., 2005).
Il a également été montré que ces protéines étaient localisées dans les processing
bodies (PBs), tout comme les protéines Argonautes et que leur inactivation empêchait la
formation des PBs (Jakymiw et al., 2005).
d) Les Processing Bodies (PBs)
Les PBs sont des lieux de stockage cytoplasmiques d’ARNm, enrichis en enzymes
(Sheth and Parker, 2003). Les ARNm peuvent y être décappés et dégradés. Dans les cellules
HeLa, Pillai et coll. ont montré que le microARN let-7 inhibe l’initiation de la traduction de
son ARNm cible en le séquestrant dans les processing bodies (PBs) de façon cap-dépendante
(Pillai et al., 2005) (Figure 29). Il a également été démontré que les microARNs peuvent être
séquestrés dans ces PBs (Liu et al., 2005; Pillai et al., 2005; Sen and Blau, 2005) (Figure 29).
Dans certaines conditions cette séquestration est réversible, par exemple dans les cellules
Huh7 (hépatome humain), miR-122 inhibe l’initiation de la traduction de sa cible CAT-1 et la
séquestre dans les PBs (Bhattacharyya et al., 2006). Cependant, cette inhibition est réversée
quand les cellules sont soumises à un stress, ce qui entraîne le relargage de l’ARNm de CAT-
66
Introduction
1 et le recrutement des polysomes (Bhattacharyya et al., 2006).
Figure 29 : Adressage des ARNm dans les processing bodies par le complexe RISC. Les ARNm
ciblés par le complexe RISC peuvent être séquestrés dans les PBs de façon réversible. (Ding L,
TRENDS in Cell Biology, 2007)
e) Répression post-initiation
La régulation de la traduction par les microARNs est désormais bien documentée au
niveau de l’étape d’initiation de la traduction. Cependant, différentes études montrent que les
microARNs cosédimentent avec les polysomes suggérant une régulation au stade d’élongation
(Maroney et al., 2006; Nottrott et al., 2006; Olsen and Ambros, 1999; Petersen et al., 2006;
Seggerson et al., 2002). Il a également été montré que les polypeptides naissants sont
rapidement dégradés lorsque les ARNm sont sous le contrôle des microARNs (Nottrott et al.,
2006). Enfin, certains microARNs sont capables d’inhiber la liaison des ribosomes sur
l’ARNm cible (Petersen et al., 2006).
2. Dégradation des ARNm cibles
Les microARNs peuvent également induire la degradation de leur ARNm cible,
comme les siARN. Si la complémentarité avec l’ARNm cible est parfaite alors le microARN
67
Introduction
peut induire sa degradation (Hutvagner and Zamore, 2002; Zeng et al., 2002; Doench et al.,
2003). La coupure se fait toujours au même endroit entre les nucleotides 10 et 11 du
microARN (Elbashir et al., 2001; Hutvagner and Zamore, 2002; Llave et al., 2002).
Cependant, il semblerait que chez les mammifères, la dégradation des ARNm cibles soit
moins fréquente que l’inhibition de la traduction médiée par les microARNs. En effet, la
majorité des microARNs affecte le niveau de protéines sans pour autant diminuer le niveau
d’ARNm. (Brennecke et al., 2003). Cependant, la dégradation des ARNm cibles peut-être une
étape secondaire. Mathonnet et coll. ont utilisé une construction permettant la transcription
d’un ARNm rapporteur avec des séquences spécifiques du microARN let-7 dans son 3’UTR.
Ils ont démontré que le niveau d’expression de l’ARNm rapporteur ne varie pas dans un
premier temps, puis que son expression diminue de façon let-7 dépendante. Ces résultats
suggèrent que l’inhibition de la traduction est un évènement précoce mais que la dégradation
de l’ARNm peut être une étape secondaire (Mathonnet et al., 2007). En effet, la stabilité de
l’ARNm cible dépend de la structure du duplexe microARN-ARNm. Les duplexes contenant
une boucle sortante (Figure 30a) conduisent à une inhibition de la traduction mais ne
déstabilisent pas l’ARNm cible alors que les duplexes contenant deux boucles opposées
(Figure 30b) conduisent à une dégradation de l’ARNm cible (Kiriakidou et al., 2004;
Schmitter et al., 2006).
Figure 30 : Dégradation secondaire médiée par les microARNs selon le duplexe miARN-ARNm
a) une boucle sortante. b) deux boucles opposées (d’après Kiriakidou M., Genes and development,
2004)
3. Activation de la traduction
En décembre 2007 dans Science, Vasudevan et coll. ont démontré que les microARNs
n’étaient pas exclusivement des répresseurs traductionnels, mais qu’ils pouvaient également
68
Introduction
jouer un rôle d’activateur traductionnel selon les stades du cycle cellulaire (Vasudevan et al.,
2007). Ils ont utilisé le modèle du TNFα qui contient des séquences ARE (AU-Rich Element).
Ces séquences sont situées dans les régions 3’ non traduites des ARNm comme les sites de
liaison des microARNs et elles permettent une régulation post-transcriptionnelle des ARNm.
Or, dans des conditions de privation de sérum et donc d’arrêt du cycle cellulaire, le complexe
AGO2-FXR1 (fragile X mental retardation-related protein 1) est recruté au niveau des
séquences ARE du TNFα ce qui entraîne une activation de sa traduction (Vasudevan and
Steitz, 2007). AGO2 intervenant également dans le complexe RISC-miRNP, ils ont recherché
les microARNs complémentaires des séquences ARE du TNFα. Parmi les candidats, ils ont pu
démontrer que miR369-3 est nécessaire à l’activation de la traduction du TNFα, via sa liaison
aux séquences ARE, dans des conditions de privation de sérum. Afin de vérifier si les
microARNs sont capables d’activer la traduction de leurs cibles, ils ont utilisé le modèle let-7
et sa cible HMGA2 et un modèle artificiel avec un microARN synthétique et un gène
rapporteur contenant dans son 3’UTR 4 sites de liaison à ce microARN. Ainsi, ils ont pu
démontrer que les microARNs sont capables d’induire la traduction de leurs cibles en
recrutant le complexe AGO2-FXR1 dans des conditions de privation de sérum (Vasudevan et
al., 2007). Les microARNs sont donc des répresseurs traductionnels lorsque les cellules
prolifèrent et des activateurs traductionnels lorsque les cellules sont bloquées en G1/G0.
4. Questions restantes
On peut supposer que les microARNs agissent de façon différente selon les ARNm
cibles ou selon le stade de développement. Il faut rester prudent quant aux conclusions car la
majorité des études a été réalisée en utilisant des constructions contenant des gènes
rapporteurs avec des MREs artificielles ou isolés. Ces rapporteurs ont été très utiles dans la
compréhension des mécanismes de régulation par les microARNs, cependant ces fonctions
diffèrent peut-être in vivo. Les régions 3’UTR natives contiennent peut-être des sites de
liaison à des cofacteurs importants dans la régulation de la traduction par les microARNs.
69
Introduction
D. Prédiction et évaluation des ARNm cibles de microARNs
474
microARNs
sont
annotés
dans
la
database
miRBase
(http://microrna.sanger.ac.uk/) et plus de 10 000 ARNm sont de potentielles cibles de
microARNs (Brennecke et al., 2005; Lewis et al., 2005; Lim et al., 2005). De nombreux
programmes ont été développés afin d’identifier les cibles de microARNs. Les critères de
prédiction utilisés sont le degré de complémentarité entre le microARN et l’ARNm, la
stabilité thermodynamique du complexe miARN-ARNm et le degré de conservation des sites
de liaison au cours de l’évolution (Zhang et al., 2006). Cependant les différents programmes
n’utilisent pas les mêmes algorithmes et donc génèrent des résultats différents. Il est donc
nécessaire de vérifier la validité de chaque cible prédite par des tests biologiques. La méthode
la plus employée est l’utilisation de plasmide contenant un gène rapporteur (ex : luciférase)
auquel on ajoute dans sa partie 3’ non traduite la séquence cible à tester. Ce plasmide est
ensuite co-transfecté dans une lignée avec le microARN d’intérêt et le niveau de luciférase est
mesuré. Si la cible et le microARN interagissent, on doit observer une diminution de
luciférase (Voorhoeve et al., 2006). Comme contrôle, on utilise une construction contenant la
séquence cible mutée. Une autre technique est l’utilisation d’inhibiteur spécifique du
microARN à tester et l’évaluation directe de l’expression de la cible prédite.
E. MicroARNs et cancer
Chaque microARN régulerait plus de 100 ARNm différents, il est donc évident qu’une
dérégulation de leur expression peut avoir de multiples conséquences biologiques. En effet,
certains microARNs sont impliqués dans la différenciation, la survie ou la prolifération
cellulaire. A l’heure actuelle, il a clairement été démontré l’implication de microARNs dans
les cancers. On distingue les microARNs suppresseurs de tumeur et les « oncomiR »
(microARNs oncogènes). En effet, certains microARNs contrôlent l’expression d’oncogènes
et leur répression conduit à la surexpression de cet oncogène (ex : let-7 et RAS), ce sont les
TSmiRs (Tumor suppressor miRNAs). Par contre, certains microARNs sont surexprimés dans
les cancers, les oncomiRs, susceptibles d’inhiber l’expression de suppresseurs de tumeurs.
Les mécanismes dérégulant l’expression de ces microARNs sont nombreux et peuvent être
70
Introduction
corrélés aux mécanismes classiques de dérégulation de gènes : amplifications, translocations,
délétions, mutations ponctuelles, dérégulations épigénétiques.
La première description de microARNs dans les cancers a débuté par l’étude de Calin
et coll. chez des patients atteints de leucémie lymphoïde chronique. Cette pathologie est
associée, dans plus de la moitié des cas, à une délétion de 30kb en 13q14. Or, dans cette
région se situent les microARNs miR-15 et miR-16. L’évaluation de leur niveau d’expression
a permis de montrer que ces microARNs sont sous-exprimés dans 68% des LLC (Calin et al.,
2002). Ces deux microARNs peuvent être définis comme des TSmiRs. En effet, miR-15 et
miR-16 régulent l’expression de l’oncogène BCL2. Une répression de ces microARNs induit
donc une surexpression de la protéine anti-apoptotique BCL2. La transfection de miR-15 et
miR-16 dans des lignées leucémiques surexprimant BCL2 permet de réverser ce phénomène
par une diminution de BCL2 et une induction de l’apoptose (Cimmino et al., 2005).
Récemment, Garzon et coll. ont montré que la diminution de BCL2 et RAS par le traitement à
l’ATRA était corrélée à une activation de miR-15a et miR-16-1 (Garzon et al., 2007).
Un autre exemple est l’implication de la famille de microARNs let-7 dans les cancers.
Johnson et coll. ont montré que let-7 régulait l’oncogène RAS. Or, dans les cancers du
poumon, let-7 est sous-exprimé et une forte expression de RAS est observée (Johnson et al.,
2005). Il a également été rapporté une sous-expression de let-7 dans les cancers du colon
(Akao et al., 2006a).
De nombreuses études ont montré d’autres sous-expressions de microARNs dans les
cancers tels que miR-143 et miR-145 dans les cancers colorectaux (Akao et al., 2006b), miR145 dans les cancers du sein (Iorio et al., 2005) ou miR-29b dans les LLC (Pekarsky et al.,
2006) et LAM (Garzon et al., 2007).
Par opposition aux TSmiRs, les oncomiRs sont souvent surexprimés dans les cancers
et entraînent des effets prolifératifs ou anti-apoptotiques. L’un des premiers oncomiR à avoir
été identifié est miR-155. Sa surexpression est retrouvée dans les lymphomes B diffus à
grandes cellules, les LLC, les cancers du sein et du colon. Dans les souris transgéniques, la
surexpression de miR-155 (sous le contrôle de l’enhancer des immunoglobulines) conduit à
une leucémie aiguë lymphoblastique ou à un lymphome de haut grade (Costinean et al.,
2006). O’Connell et coll. ont montré que dans des souris reconstituées, la surexpression de
miR-155 conduit à des syndromes myéloprolifératifs (O'Connell et al., 2008).
71
Introduction
Les membres du cluster miR-17-92 sont fréquemment surexprimés dans les
lymphomes. Ce cluster comprend 7 microARNs : miR-17-5p, 17-3p, 18, 19a, 19b1, 20 et 92
et est situé en 13q31.3, locus fréquemment amplifié (Hayashita et al., 2005; Ota et al., 2004).
He et coll. ont montré grâce à des souris transgéniques surexprimant c-Myc que le cluster
miR-17-92 augmente la tumorigénicité en inhibant l’apoptose (He et al., 2005). Des études
complémentaires ont permis de démontrer que le cluster miR-17-92 est directement régulé par
c-Myc. De plus, miR-17-5p et miR-20 inhibe l’expression du facteur de transcription E2F1
entraînant une activité anti-apoptotique et une prolifération accrue (O'Donnell et al., 2005).
De nombreuses études démontrent que plus de la moitié des microARNs se situent
dans des régions chromosomiques fréquemment impliquées dans les cancers (Calin et al.,
2004). La dérégulation de ces microARNs implique différents mécanismes :
1. Mutations des microARNs
Comme nous l’avons décrit précédemment, les microARNs miR-15 et miR-16 se
situent dans une région fréquemment délétée dans les LLC. Cependant, une mutation
germinale a été identifiée dans le pri-miARN miR-16-1-miR-15a et dont la présence est
associée à une faible expression des microARNs matures et une délétion du second allèle. Le
mécanisme n’est pas élucidé, mais il semblerait que la mutation affecte la formation de la tige
boucle. Cette mutation est retrouvée dans 2 cas sur 75 de LLC. 73% des patients porteurs de
cette mutation ont des LLC ou autres cancers dans leur famille, suggérant une prédisposition
associée à cette mutation (Calin et al., 2005).
2. Régulation épigénétique de l’expression des microARNs
L’expression des microARNs peut également être modulée par les mécanismes
d’hyperméthylation du promoteur ou de deacétylation des histones de la chromatine. En effet,
ce phénomène a pu être observé dans certains cancers. Dans la lignée SKBr3 de cancer du
sein, le traitement avec un inhibiteur d’histone déacétylase (HDAC) tel que le LAQ824
entraîne un changement significatif du profil d’expression des microARNs. Parmi les
72
Introduction
microARNs dérégulés, miR-27 est réprimé et ses cibles, telles que la protéine pro-apoptotique
RYBP ou le répresseur Sp1 ZBTB10, sont surexprimées (Scott et al., 2006).
Saito et coll. ont également montré en utilisant différents traitements de modification de
la chromatine (inhibiteur de HDAC, acide phenyl butyrique, 5-aza-2-deoxycytidine) que le
microARN miR-127 est sous-exprimé dans différentes lignées cancéreuses (sein, pancréas,
colon, rate, poumon, lymphome de Burkitt). Ce dernier régule l’expression du proto-oncogène
BCL6, souvent surexprimé dans les lymphomes B et qui inhibe l’expression de TP53.
L’activation de miR-127 par des thérapies épigénétiques permet de réprimé BCL6 en
diminuant le niveau de protéines, sans affecter le niveau d’ARNm de BCL-6 (Saito et al.,
2006).
Une autre étude a montré que le microARN miR-124a est inactivé par méthylation de
son promoteur dans différents cancers, tels que les cancers du colon, du sein, du poumon ou
hématopoïétiques. La cycline-dépendante kinase 6 (CDK6), qui accélère la progression du
cycle cellulaire en phosphorylant RB (Retinoblastoma), est une cible de miR-124a. En effet,
l’hyperméthylation de miR-124a est associée à une activation de CDK6 et une
phosphorylation de RB (Lujambio et al., 2007).
Cependant, malgré le fait que ces études démontrent l’importance des régulations
épigénétiques des microARNs, les traitements par des inhibiteurs de HDAC et de DNA
méthyltransférases (DNMT) ne semble pas avoir d’effet dans les cancers du poumon comme
le souligne l’étude de Diederichs et coll., malgré les nombreux microARNs réprimés dans ces
cancers (Diederichs and Haber, 2006). Actuellement, les inhibiteurs de HDAC et de DNMT
sont utilisés dans le traitement des cancers. Des études sur les cas traités permettraient de
mieux comprendre l’influence de ces drogues sur l’expression des microARNs in vivo.
3. Altérations des protéines intervenant dans la biogenèse des
microARNs
Comme nous l’avons décrit précédemment, le pri-miARN est clivé dans le noyau par
DROSHA en pré-miARN lui-même clivé par DICER dans le cytoplasme. Or, de récentes
études montrent un changement du niveau d’expression de ces enzymes. Dans les cancers de
73
Introduction
l’œsophage, une forte expression de DROSHA est observée et corrélée avec une courte survie
postopératoire. Le mécanisme de surexpression de cette enzyme n’a pas été étudié, cependant
il est à noter que le gène codant pour DROSHA est localisé en 5q12.3, une région souvent
amplifiée dans ces cancers (Sugito et al., 2006).
Une autre étude démontre un faible niveau d’expression de l’enzyme DICER dans les
cancers du poumon associée avec une courte survie postopératoire. Or, le gène DICER est
localisé en 14q qui est une région fréquemment délétée, ce qui pourrait expliquer la sousexpression observée (Karube et al., 2005).
Ces études démontrent un rôle potentiel des enzymes contrôlant la biogenèse des
microARNs, cependant des expériences complémentaires sont nécessaires afin de prouver que
ces altérations ont des conséquences directes sur l’expression des microARNs.
4. Variations dans la séquence des sites de liaisons microARN :
ARNm
Une variation dans la séquence du 3’UTR de l’ARNm cible ou dans la séquence du
microARN mature est un autre mécanisme de dérégulation des voies des microARNs. En
effet, si le TSmiR ne peut plus se lier correctement à sa cible, la régulation négative
d’oncogènes n’est plus maîtrisée. A l’inverse l’acquisition d’une mutation d’un oncomiR peut
accentuer sa fonction inhibitrice au niveau de gènes suppresseurs de tumeurs ou modifier son
panel de cibles.
Par exemple, dans les cancers de la thyroïde, la perte de la protéine KIT est associée à
une forte expression des microARNs miR-221, miR-222 et miR-146b et à un changement de
polymorphisme dans la région 3’UTR de KIT dans la moitié des cas (He et al., 2005). Ce
changement pourrait être à l’origine d’une dérégulation médiée par les microARNs,
prédisposant à ces cancers.
Une variation de la séquence d’un microARN mature a également été observée pour
miR-30c-2, surexprimé dans plusieurs tumeurs solides (Iwai and Naraba, 2005).
74
Introduction
5. Translocations chromosomiques et microARNs
De nombreuses études soulignent la localisation des microARNs au niveau de régions
fréquemment altérées dans les cancers, suggérant un rôle de ces microARNs dans les
translocations chromosomiques. Peu d’études rapportent l’implication des microARNs dans
les translocations chromosomiques. Cependant, il existe quelques exemples.
Le premier exemple est la translocation t(8;17). Cette translocation juxtapose le
microARN miR-142 à l’oncogène MYC. Comme dans les translocations impliquant MYC et le
locus des immunoglobulines, MYC se retrouve sous le contrôle du promoteur de miR-142, ce
qui entraîne une surexpression de la protéine MYC dans les lymphomes B (Lagos-Quintana et
al., 2002).
Un autre exemple est la juxtaposition du microARN miR-125b au gène de la chaîne
lourde des immunoglobulines dans un cas de leucémie aiguë lymphoblastique B (Sonoki et
al., 2005). L’ARNm de ce patient n’étant pas disponible, des analyses du niveau d’expression
de miR-125b n’ont pas pu être menées. Néanmoins, il est probable que ce réarrangement
conduise à une surexpression de miR-125b, comme c’est le cas dans les réarrangements
impliquant les IgH.
Une implication indirecte d’un microARN dans une translocation a été rapportée dans
l’étude des translocations impliquant le gène HMGA2. Les réarrangements au niveau du gène
HMGA2, situé en 12q15, sont fréquents et retrouvés dans différents cancers (adénomes,
carcinome, leucémies, lipomes, sarcomes..). Dans la plupart des cas, les trois domaines de
liaisons à l’ADN de HMGA2 sont conservés dans les chimères et associés à des séquences
variées (gènes FHIT, LPP, LHFP, RAD51L1, CMKOR1, EBF, RDC1, NFIB, …). Cependant,
dans certains cas, le point de cassure au sein du gène HMGA2 se situe en dehors de sa région
codante et est associé à une forte expression de la protéine (Geurts et al., 1997; Inoue et al.,
2006; Schoenmakers et al., 1995). En 2001, Borrmann et coll. observent, en utilisant une
construction contenant le gène rapporteur luciférase associé à la région 3’ non traduite de
HMGA2, une sous-expression du gène rapporteur, suggérant la présence d’éléments
répresseurs dans le 3’UTR de HMGA2 (Borrmann et al., 2001). De plus, les souris
transgéniques surexprimant Hmga2 sauvage développent des lipomatoses abdominales, puis
des lymphomes et des adénomes, autant que les souris exprimant Hmga2 tronqué (Baldassarre
et al., 2001; Battista et al., 1999; Fedele et al., 2002). Or, HMGA2 contient 7 sites
75
Introduction
complémentaires à let-7 dans sa région 3’UTR (Lewis et al., 2005). L’étude de Mayr et coll. a
permis de mieux comprendre ces phénomènes. En effet, ils ont pu démontrer que HMGA2 est
régulé par let-7 en se liant sur sa partie 3’ non traduite (Mayr et al., 2007). Les translocations
conduisant à l’élimination de la partie 3’ non traduite de HMGA2, empêchent la répression par
let-7, ce qui conduit à une surexpression de la protéine HMGA2.
Un autre exemple d’implication indirecte de microARNs dans les translocations
chromosomiques a été rapporté dans l’étude de la protéine de fusion AML1-ETO. Comme
nous l’avons vu précédemment, AML1 code une des sous-unités du Core Binding Factor
(CBF) qui intervient dans l’hématopoïèse. ETO, pour Eight Twenty One, code un facteur de
transcription putatif, exprimé au niveau du cerveau. La translocation t(8;21) conduisant à la
formation de la protéine de fusion AML1-ETO est l’anomalie caryotypique la plus fréquente
des leucémies aiguës myéloblastiques. Elle est détectée dans 15% des LAM et représente 40%
du sous-groupe M2. L’étude de Fazi et coll. a permis de démontrer que le microARN miR223 est sous-exprimé dans ces pathologies (Fazi et al., 2007). Des études bioinformatiques
suggère la présence d’un site de liaison de AML1 au niveau du promoteur de miR-223. Par
des expériences d’immunoprécipitation de chromatine, les auteurs ont pu démontrer que la
protéine de fusion AML1-ETO est capable de se lier au promoteur de miR-223 suggérant une
régulation de la transcription de miR-223 par l’oncoprotéine AML1-ETO. Des expériences
complémentaires utilisant des constructions contenant le gène rapporteur luciférase sous le
contrôle des régions promotrices de miR-223 et des quantités croissantes de AML1-ETO
transfectées dans la lignée 293T, ont permis de définir précisément les sites nécessaires à la
régulation de la transcription de miR-223 par AML1-ETO. AML1-ETO recrute des protéines
de remodelage de la chromatine telles que des histones deacétylases ou des DNA
méthyltransférases entraînant une répression transcriptionnelle de miR-223 (Fazi et al., 2007).
76
Objectifs du travail
CHAPITRE 2 :
OBJECTIFS DU TRAVAIL
77
Objectifs du travail
78
Objectifs du travail
Les translocations chromosomiques sont fréquemment associées aux hémopathies
malignes. Comme nous l’avons vu précédemment, elles peuvent conduire à des anomalies
qualitatives (ex : création d’une protéine de fusion) ou quantitatives (ex : surexpression d’une
protéine). L’identification et la caractérisation de ces translocations chromosomiques dans les
leucémies sont des outils utiles pour le diagnostic, le pronostic, la recherche de la maladie
résiduelle après traitement et l’orientation thérapeutique. De plus, la caractérisation des gènes
impliqués dans les translocations a permis d’identifier un grand nombre de gènes importants
en oncogenèse (MYC, BCL2, PML, MLL, ALB1, PDGFRβ….).
Lors d’analyses cytogénétiques d’hémopathies en routine, de nombreux patients
présentent des réarrangements chromosomiques rares, déjà répertoriés, mais dont le point de
cassure n’a pas encore été caractérisé au niveau génique. Ainsi, mon travail de thèse a porté
sur l’identification et la caractérisation de nouvelles translocations chromosomiques associées
aux hémopathies malignes. Nous nous sommes intéressés à trois translocations
chromosomiques associées à des hémopathies malignes :
La translocation t(8;9)(p22;p24) dans les leucémies myéloïdes chroniques atypiques
La translocation t(7;9)(p11;q13) dans les leucémies aiguës lymphoblastiques B
La translocation t(2;11)(p21;q23) dans les leucémies aiguës myéloblastiques et les
myélodysplasies
L’identification des gènes impliqués dans ces trois translocations pourrait permettre
d’identifier des oncogènes importants en cancérogénèse hématologique.
En pratique médicale, l’identification des divers gènes impliqués dans ces trois
translocations devrait permettre d’améliorer la classification de ces leucémies et
myélodysplasies, ainsi que d’en faciliter le diagnostic. Il est clairement établi que la prise en
charge thérapeutique de ces affections est conditionnée par les anomalies cytogénétiques
qu’elles présentent. Ces anomalies orientent le traitement mais fournissent aussi des
indicateurs pronostiques importants.
Par ailleurs, la connaissance des gènes impliqués dans ces translocations doit permettre
de rechercher par RT-PCR des cellules leucémiques résiduelles après traitement. Cela est le
cas, par exemple, pour la leucémie myéloïde chronique (BCR-ABL1) où la recherche de
maladie résiduelle est effectuée par RQ-PCR.
79
Objectifs du travail
D’autre part, l’étude de ces translocations chromosomiques, même si elles sont rares,
peut permettre l’identification de mutations cryptiques plus récurrentes.
Dans une perspective plus thérapeutique, on peut imaginer, comme pour la leucémie
myéloïde chronique, traitée par un inhibiteur de tyrosine kinase comme l’imatinib (qui bloque
la poche à ATP d’Abelson), que les gènes dérégulés par ces translocations puissent servir de
cibles pour de nouvelles drogues. D’autres exemples de décryptage de translocations ont
permis de traiter efficacement certaines leucémies. Par exemple, la majorité des cas de
leucémies promyélocytaires (LAM3) qui présentent une translocation t(15;17)(PML-RARα)
sont mis en rémission par un traitement à l’acide rétinoïque qui lie la protéine chimère PMLRARα et assure sa dégradation par le protéasome, ce qui inhibe son effet dominant négatif sur
la protéine PML.
80
Résultats expérimentaux
CHAPITRE 3 :
RESULTATS EXPERIMENTAUX
81
Résultats expérimentaux
82
Résultats expérimentaux
Article 1
The t(8;9)(p22;p24) translocation in atypical chronic myeloid
leukaemia yields a new PCM1-JAK2 fusion gene
Marina Bousquet, Cathy Quelen, Véronique De Mas, Eliane Duchayne, Blandine
Roquefeuil, Georges Delsol, Guy Laurent, Nicole Dastugue, et Pierre Brousset
Oncogene. 2005 ; 24 : 7248-7252
83
Résultats expérimentaux
84
Résultats expérimentaux
La translocation t(8;9)(p22;p24) dans les leucémies myéloïdes chroniques
atypiques
La translocation t(8;9)(p22;p24) a été observée chez deux patients atteints de
leucémies myéloïdes chroniques (LMC) atypiques. La leucémie myéloïde chronique est
caractérisée par la présence du chromosome Philadelphie résultant de la translocation entre les
gènes BCR et ABL1. La protéine de fusion BCR-ABL1 se dimérise grâce aux domaines de
dimérisation de BCR ce qui conduit à une activation constitutive de la kinase abelson. Parmi
les LMC atypiques, on retrouve les réarrangements BCR-PDGFRα (Baxter et al., 2002; Safley
et al., 2004; Trempat et al., 2003), TEL-PDGFRβ (Golub et al., 1994), SPTBN1-FLT3 (Grand
et al., 2007), TP53BP1-PDGFRβ (Grand et al., 2004), BCR-FGFR1 (Demiroglu et al., 2001;
Fioretos et al., 2001)… Comme pour BCR-ABL1, ces réarrangements conduisent à une
activation constitutive d’une protéine tyrosine kinase fusionnée à une protéine contenant des
domaines d’oligomérisation. C’est pourquoi nous avons recherché dans les régions 8p22 et
9p24 des gènes codant des tyrosines kinases. Or, en 9p24, se situe le gène codant pour la
protéine tyrosine kinase cytoplasmique JAK2 (Janus kinase 2). Afin de vérifier si ce gène était
réarrangé chez nos patients, nous avons utilisé la technique de FISH (Fluorescent in situ
Hybridization). Cette technique consiste à utiliser des BACs (Bacterial Artificial
Chromosomes) correspondants à des régions chromosomiques précises. Ces BACs sont
marqués par nick-translation par l’incorporation de dUTP couplés à des fluorochromes, puis
sont hybridés sur les lames contenant les chromosomes métaphasiques de nos patients.
L’observation est réalisée au microscope à fluorescence. Cette technique nous a permis de
mettre en évidence un réarrangement de JAK2 chez nos deux patients.
Afin de rechercher le partenaire de JAK2 dans cette translocation, nous avons émis
l’hypothèse que ce partenaire contiendrait des domaines de dimérisation ce qui permettrait
une activation constitutive de JAK2, comme pour la chimère BCR-ABL. Le gène PCM1
(Pericentriolar Material 1) semblait être un bon candidat car il était situé en 8p22 d’une part et
d’autre part il codait une protéine contenant des domaines coiled coil, domaines de
dimérisation. PCM1 est impliquée dans l'assemblage des protéines du centrosome et dans
l'organisation des microtubules. Afin de vérifier cette hypothèse, nous avons effectué une RTPCR avec des amorces gènes spécifiques, PCM1-JAK2 et JAK2-PCM1. Cette expérience nous
a permis d’obtenir un produit PCR avec les amorces PCM1-JAK2 qui après séquençage nous
85
Résultats expérimentaux
a permis d’identifier la fusion PCM1-JAK2. Nous avons confirmé ces résultats par FISH en
montrant un réarrangement de PCM1 chez nos deux patients.
La protéine de fusion PCM1-JAK2 obtenue conserve la totalité des domaines de
dimérisation de PCM1 et du domaine kinase de JAK2. On peut supposer que cette protéine se
dimérise grâce à ses domaines coiled coil, entraînant ainsi une activation constitutive de JAK2
sur le même modèle que BCR-ABL1 dans la LMC.
86
Translocation in atypical CML yields a new PCM1-JAK2 fusion gene
M Bousquet et al
7249
granulocytes, 4% of blasts and 1% of erythroblasts.
Bone marrow aspiration was hypercellular and exibited
54% of myeloblasts with positive peroxydase and 24%
of eosinophils. No signs of myelodysplasia were
observed. The diagnosis of AML M2 with eosinophilia
developed on the setting of an atypical CML was made.
Chromosomal analysis revealed an abnormal karyotype
with an isolated t(8;9)(p22;p24) translocation. The
patient was treated with a combination chemotherapy
including Idarubicin and Aracytin associated with
meningeal prophylaxis. He achieved a complete remission after a month. The treatment was completed with
radiotherapy on solid mass diagnosed at admittance.
Different FISH probes specific for ABL and FGFR1
(8p11) were tested and confirmed the lack of rearrangement of these genes in the two cases (data not shown).
Therefore, we looked for the presence of candidate genes
at 8p22 and 9p24. The examination of the multiple genes
reported at 9p24 strongly suggested that JAK2 coding
for a tyrosine kinase was involved. In addition, JAK2
had been reported in a t(9;12)(p24;p13) in a few cases of
acute lymphoblastic leukaemia and chronic myeloproliferative disorders (Lacronique et al., 1997; Peeters
et al., 1997). For these reasons we tested metaphase
chromosomes by FISH with the corresponding JAK2
BAC probe (RP11-927H16) labelled by nick translation
with biotin as already reported (Trempat et al., 2003).
In both cases, a split signal was noticed: one part
on chromosome 9p24 and the other part at 8p22
(Figure 1, 1a).
When looking at locus 8p22, it appeared that the best
candidate was the pericentriolar material 1 (PCM1)
gene, which had been previously described in a
reciprocal translocation generating a fusion gene with
RET at 10q11 (Corvi et al., 2000). Therefore, we
designed primer sets within the 30 coding sequences of
JAK2 (corresponding to the TK domain) and within the
50 coding region of PCM1 and set up an RT–PCR
analysis of total RNA from tumour cells of both
patients. A 4 kb product was obtained with patient 1’s
RNA (Figure 2). After sequencing, this product
corresponded to a putative 9401 bp mRNA. The
structure of the open reading frame of the chimeric
PCM1-JAK2 transcript showed that PCM1 exon 37
(NM_006197) was in-frame with JAK2 exon 9
(NM_004972). This structure demonstrates the preservation of all the coiled-coil domains of PCM1 and the
tyrosine kinase domain of JAK2 (Figure 3). The reverse
transcript JAK2-PCM1 was detectable with the corresponding primers (Figure 2). A PCR product of
approximately 700 bp was obtained from a 2363 bp
long fusion in-frame transcript. As a result of an
important degradation of the RNA, RT–PCR remained
unsuccessful in patient 2. However, the fusion of PCM1
with JAK2 was confirmed by FISH in both patients
(Figures 1b, 2a, b).
Our results demonstrate that PCM1-JAK2 is a new
fusion gene implicated in the development of myeloproliferative disorders. Our cases corresponded to atypical
CML in which this abnormality was isolated and thus
corresponded to the main oncogenic event. JAK2 is the
Patient 1
A
B
a
a
b
b
Patient 2
Figure 1 FISH analysis: Fluorescence in situ hybridisation with
the JAK2 probe (BAC RP11-927H16) and the PCM1 probe (BAC
RP11-484L21) labelled with biotin and digoxigenin respectively,
using the nick translation kit (Amersham pharmacia biotech)
according to the manufacturer’s instructions. Patient 1: (1a) FISH
with JAK2 probe (Baxter et al.), the signal is split between derived
chromosomes 9 and 8 (arrows). (1b) FISH with JAK2 (green) and
PCM1 (red) probes, the two signals are split (arrows: fusion signals
on derived chromosomes 8 and 9). Patient 2: metaphase (2a) and
corresponding FISH (2b) with JAK2 (green) and PCM1 (red)
probes, the two signals are split (arrows: fusion signals). The other
signals correspond to the untranslocated chromosomes 8 and 9.
JAK2 and PCM1 are rearranged in the two cases
predominant JAK kinase activated in response to
several growth factors and cytokines such as IL-3,
GM-CSF and erythropoietin (Barber and D’Andrea,
1994; Carron et al., 2000; Valdembri et al., 2002).
Moreover, JAK2 has been previously implicated in rare
cases of T-ALL (Lacronique et al., 1997), B-ALL and
atypical CML (Peeters et al., 1997), and was found to be
fused with TEL/ETV6. This fusion gene codes for a
chimeric protein with oncogenic properties related to the
tyrosine kinase activity of JAK2. TEL/ETV6 belongs to
a family of genes with ETS DNA binding domains and
helix loop helix domains that allow oligomerisation of
these proteins. Indeed, TEL-JAK2 fusion entails a
constitutive activation of the tyrosine kinase domains
of JAK2 (Lacronique et al., 1997). It has been shown
that this construct was able to induce the growth of
Ba/F3 cells in an IL-3-independent manner (Lacronique
et al., 1997). In addition, TEL-JAK2 activates the PI 30 Kinase/AKT pathway (Nguyen et al., 2001). Interestingly, transgenic mice for TEL-JAK2 develop fatal
CD8 þ acute T-cell leukaemia with a constitutive
activation of STAT1 and STAT5 (Carron et al., 2000).
Recent publications have reported a high incidence of a
single-activating mutation in the JH2 domain of JAK2
Oncogene
Translocation in atypical CML yields a new PCM1-JAK2 fusion gene
M Bousquet et al
Marker
Blank
JAK2-PCM1
PCM1-JAK2
Marker
7250
4Kbp
700bp
Figure 2 RT–PCR analysis of the chimeric PCM1-JAK2 transcript: Total RNA was extracted according to the Trizol method
(Gibco-BRL) and reverse transcribed using the Marathon cDNA
Amplification kit (BD Biosciences). PCR were performed with the
BD advantage 2 PCR enzyme system (BD Biosciences) according
to the manufacturer’s instructions. A 4 kbp product and a 700 bp
PCR product were obtained with primers PcmF/JakK and JakC/
PcmO, respectively (see sequences below). Each PCR reaction was
processed with a blank corresponding to mix PCR without input
cDNA. The blank shown in the picture correspond to the negative
control of the PCM1-JAK2 reaction PCR. PCR products
were purified using the QIAquick PCR Purification kit (Qiagen).
The internal primer JakF was used to sequence the breakpoint
between PCM1 and JAK2, using the ABI Prism Dye Terminator
kit (Perkin-Elmer Applied Biosystem). PcmF 50 -TACAGCTGT
CAGCTGCTAGTGTGGG-30 ; PcmO 50 -TGGGCTCCCACCGT
TTCACCTTCTT-30 ; JakK 50 -CATCTGGGCATCCATCTGGTC
TTGG-30 ; JakF 50 -CTCGTCTCCACAGACACATACTCCAT-30 ;
JakC 50 -ACTGGAAACGGTGGAATTCAGTGGTC-30
a
(Baxter et al., 2005; James et al., 2005; Levine et al.,
2005). This reinforces the implication of this kinase in
the development of myeloproliferative disorders. However, this mutation is mainly observed in chronic
myeloproliferative disorders other than CML or atypical CML. The situation is similar for PDGFRA which
can be activated by a single mutation in gastroinstestinal
stromal tumours (Heinrich et al., 2003) or by a
rearrangement in some cases of chronic myeloproliferative disorders (Baxter et al., 2002; Cools et al., 2003;
Trempat et al., 2003).
In our study, the partner gene of JAK2 is PCM1
which encodes a 228kD protein containing several
potential coiled-coil domains in its amino-terminal part
(Balczon et al., 1994). This protein is localized in cytoplasmic granules referred to as centriolar satellites.
Experiments aimed at blocking PCM1 activity with
either anti-PCM1 antibodies or small interference RNA
lead to a disorderly assembly of centrosomal proteins
and microtubules organisation, suggesting that PCM1
plays a pivotal role in these processes (Dammermann
et al., 2004), in particular in the progression of the cell
cycle (Balczon et al., 2002). PCM1 gene corresponds to
a chromosomal region frequently lost in cancers (Emi
et al., 1992; Bhattacharya et al., 2003), but its implication in the t(8;10)(p22;q11) translocation in a case of
thyroid papillary carcinoma has drawn our attention to
its possible implication in chimerical proteins such as
PCM1-RET. In addition, its partner in the latter case is
a receptor with tyrosine kinase activity (Corvi et al.,
2000).
Since there is a relative ubiquitous expression of
PCM1, it is likely that the PCM1 promoter overrides the
expression of the PCM1-JAK2 fusion gene, in which the
carboxy-terminus corresponds to the catalytic activity of
PCM1 exon37
Jak2 exon9
CCA GTG TTA GTG AAT GAC TAT CGA GAA AAT GTC ATT GAA TAT
b
6124bp 6671bp
PCM1 mRNA
3’
5’
CCD
1
2
3
4
5
6
7 8
9
9401bp
PCM1-JAK2 mRNA
5’
JH2
PTK domain
3’
JH2
PTK domain
3’
JAK2 mRNA
5’
1820bp
5097bp
Figure 3 Sequence of the new fusion transcript: (a) Open reading frame of the chimeric PCM1-JAK2 gene. (b) Structure of PCM1,
PCM1-JAK2 and JAK2 mRNAs. CCD, coiled coil domain; JH2, JAK homology/pseudokinase domain of JAK2; PTK, protein
tyrosine kinase
Oncogene
Translocation in atypical CML yields a new PCM1-JAK2 fusion gene
M Bousquet et al
7251
JAK2. As a result of the presence of multiple coiled-coil
domains in the amino-terminal part of PCM1, it is
conceivable that the PCM1-JAK2 chimera undergoes an
oligomerisation resulting in an activation of the tyrosine
kinase domain of JAK2. Further in vitro experiments are
needed to confirm that the JAK/STAT and the PI 30 Kinase/AKT pathways are constitutively activated in
response to PCM1-JAK2 autophosphorylation.
We described herein two cases of a new translocation
variant involving PCM1 and JAK2 genes. The identification of these two partner genes would help in further
characterising new cases of myeloproliferative disorders
with such a translocation and in monitoring the residual
disease after treatment. The clinical presentation of our
patients was slightly different, but both had a background of atypical CML. However, one patient was
diagnosed in chronic phase without hypereosinophilia
while the second was investigated at an acute phase
(circulating immature cells from the bone marrow with
blast crisis and hypereosinophilia).
In a more prospective point of view, one can suspect
that JAK2 will be a good target for new compounds
with antityrosine kinase activity.
Note added in proof
During the submission of this manuscript, we have
been aware of similar results published by Reiter et al.
(2005). In their report, they found the same PCM1JAK2 rearrangement in seven patients with identical
and distinct breakpoints. Clinically, their patients
had atypical CML, chronic eosinophilic leukaemia,
secondary acute myeloid leukaemia and pre-B cell
acute lymphoblastic leukaemia. However, contrary
to our study, they did not find reverse transcripts in
all cases.
Acknowledgements
We thank Dr Storlazzi, University of Milano, and Dr Max
Chaffanet, INSERM U119, Marseille, for the generous gift of
the BAC JAK2 (RP11-927H16) and PCM1 (RP11-484L21),
respectively. Special thanks to Drs Fabienne Meggetto and
Jean-Pierre Jaffrezou, INSERM U563 CPTP, Toulouse,
France, for critical reading of the manuscript.
Grants: Cancéropole Grand Sud Ouest, Ligue contre le
Cancer, Comités du Gers et de la Haute Garonne
References
Balczon R, Bao L and Zimmer WE. (1994). J. Cell Biol., 124,
783–793.
Balczon R, Simerly C, Takahashi D and Schatten G. (2002).
Cell Motil. Cytoskeleton., 52, 183–192.
Barber DL and D’Andrea AD. (1994). Mol. Cell. Biol., 14,
6506–6514.
Baxter EJ, Hochhaus A, Bolufer P, Reiter A, Fernandez JM,
Senent L, Cervera J, Moscardo F, Sanz MA and Cross NC.
(2002). Hum. Mol. Genet., 11, 1391–1397.
Baxter EJ, Kulkarni S, Vizmanos JL, Jaju R, Martinelli G,
Testoni N, Hughes G, Salamanchuk Z, Calasanz MJ,
Lahortiga I, Pocock CF, Dang R, Fidler C, Wainscoat JS,
Boultwood J and Cross NC. (2003). Br. J. Haematol., 120,
251–256.
Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N,
Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N,
Scott MA, Erber WN and Green AR. (2005). Lancet, 365,
1054–1061.
Bhattacharya N, Tripathi A, Dasgupta S, Sabbir MG, Roy A,
Sengupta A, Roy B, Roychowdhury S and Panda CK.
(2003). Indian J. Med. Res., 118, 77–85.
Carron C, Cormier F, Janin A, Lacronique V, Giovannini M,
Daniel MT, Bernard O and Ghysdael J. (2000). Blood, 95,
3891–3899.
Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD,
Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD, Cross
NC, Tefferi A, Malone J, Alam R, Schrier SL, Schmid J,
Rose M, Vandenberghe P, Verhoef G, Boogaerts M,
Wlodarska I, Kantarjian H, Marynen P, Coutre SE,
Stone R and Gilliland DG. (2003). N. Engl. J. Med., 348,
1201–1214.
Corvi R, Berger N, Balczon R and Romeo G. (2000).
Oncogene, 19, 4236–4242.
Dammermann A, Muller-Reichert T, Pelletier L, Habermann
B, Desai A and Oegema K. (2004). Dev. Cell., 7, 815–829.
Druker BJ, Sawyers CL, Kantarjian H, Resta DJ, Reese SF,
Ford JM, Capdeville R and Talpaz M. (2001). N. Engl. J.
Med., 344, 1038–1042.
Emi M, Fujiwara Y, Nakajima T, Tsuchiya E, Tsuda H,
Hirohashi S, Maeda Y, Tsuruta K, Miyaki M and
Nakamura Y. (1992). Cancer Res., 52, 5368–5372.
Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen
CJ, Joseph N, Singer S, Griffith DJ, Haley A, Town A,
Demetri GD, Fletcher CD and Fletcher JA. (2003). Science,
299, 708–710.
Heisterkamp N, Stephenson JR, Groffen J, Hansen PF, de
Klein A, Bartram CR and Grosveld G. (1983). Nature, 306,
239–242.
James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F,
Lacout C, Garcon L, Raslova H, Berger R, BennaceurGriscelli A, Villeval JL, Constantinescu SN, Casadevall
N and Vainchenker W. (2005). Nature, 434,
1144–1148.
Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT,
Mauchauffe M, Berthou C, Lessard M, Berger R,
Ghysdael J and Bernard OA. (1997). Science, 278,
1309–1312.
Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G,
Huntly BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S,
Adelsperger J, Koo S, Lee JC, Gabriel S, Mercher T,
D’Andrea A, Frohling S, Dohner K, Marynen P,
Vandenberghe P, Mesa RA, Tefferi A, Griffin JD, Eck
MJ, Sellers WR, Meyerson M, Golub TR, Lee SJ and
Gilliland DG. (2005). Cancer cell, 7, 387–397.
Nguyen MH, Ho JM, Beattie BK and Barber DL. (2001).
J. Biol. Chem., 276, 32704–32713.
Peeters P, Raynaud SD, Cools J, Wlodarska I, Grosgeorge J,
Philip P, Monpoux F, Van Rompaey L, Baens M,
Van den Berghe H and Marynen P. (1997). Blood, 90,
2535–2540.
Oncogene
Translocation in atypical CML yields a new PCM1-JAK2 fusion gene
M Bousquet et al
7252
Reiter A, Walz C, Watmore A, Schoch C, Blau I, Schlegelberger B, Berger U, Telford N, Aruliah S, Yin JA, Vanstraelen
D, Barker HF, Taylor PC, O’Driscoll A, Benedetti F,
Rudolph C, Kolb HJ, Hochhaus A, Hehlmann R, Chase A
and Cross NC. (2005). Cancer Res., 65, 2662–2667.
Oncogene
Trempat P, Villalva C, Laurent G, Armstrong F, Delsol G,
Dastugue N and Brousset P. (2003). Oncogene, 22,
5702–5706.
Valdembri D, Serini G, Vacca A, Ribatti D and Bussolino F.
(2002). FASEB J., 16, 225–227.
Résultats expérimentaux
Article 2
A novel PAX5-ELN fusion protein identified
in B-cell acute lymphoblastic leukemia acts as
a dominant negative on wild-type PAX5
Marina Bousquet, Cyril Broccardo, Cathy Quelen, Fabienne Meggetto, Emilienne
Kuhlein, Georges Delsol, Nicole Dastugue, et Pierre Brousset
Blood. 2007 ; 109(8) : 3417-3423
87
Résultats expérimentaux
88
Résultats expérimentaux
La
translocation
t(7;9)(q11 ;p13)
dans
les
leucémies
aiguës
lymphoblastiques B
La translocation t(7;9)(q11;p13) a été observée chez deux patients atteints de leucémie
aiguë lymphoblastique B (LAL-B). L’étude de cette translocation a été abordée par la
recherche de gènes candidats au niveau des points de cassures. Or, en 9p13 se situe le gène
PAX5. Comme nous l’avons vu dans l’introduction, le gène PAX5 code un facteur de
transcription membre de la famille Paired Box. Il joue un rôle crucial dans la différenciation
des lymphocytes B. Il est exprimé du stade pro-B jusqu’au stade B mature puis son expression
s’éteint pour permettre leur différenciation en plasmocytes. PAX5 régule un certain nombre
de gènes tels que CD19, BLK, MB1, LEF-1, N-MYC ou RAG2. Il peut agir en tant
qu’activateur ou répresseur ; il a été démontré qu’il régulait positivement la transcription de
CD19, N-MYC, MB1 ou LEF-1 et réprimait celle de PD-1. PAX5 est impliqué dans différentes
translocations chromosomiques. Dans certains cas de lymphomes non hodgkiniens porteurs de
la t(9;14)(p13;q32), le gène PAX5 est juxtaposé au gène codant pour la chaîne lourde des
immunoglobulines ce qui entraîne une surexpression de la protéine. PAX5 est également
impliqué dans la formation d’une protéine de fusion PAX5-ETV6 dans des leucémies aiguës
lymphoblastiques B résultant de la translocation dic(9;12)(p13;p13).
Le gène PAX5 semblait donc être un bon candidat dans la translocation t(7;9). Afin de
vérifier cette hypothèse, nous avons utilisé la technique de FISH, en utilisant des BACs
marqués correspondants à la région chromosomique de PAX5. Lorsque l’on hybride ces
sondes sur les chromosomes métaphasiques des patients porteurs de la t(7;9) on observe une
division du signal entre les deux chromosomes pathologiques der(7) et der(9). PAX5 est
réarrangé chez nos deux patients. De plus, l’utilisation de sondes chevauchantes, nous a
permis de localiser le point de cassure au sein de PAX5 entre ses exons 7 et 10. PAX5 semble
être impliqué dans la formation d’une nouvelle protéine de fusion étant donné qu’il est
réarrangé au sein de son gène. La protéine de fusion obtenue pourrait être composée de la
partie 5’ de PAX5 et de la partie 3’ du gène situé sur le chromosome 7, afin que PAX5
conserve son domaine PBD de liaison à l’ADN nécessaire, comme dans les autres
translocations, au potentiel oncogénique.
89
Résultats expérimentaux
L’éventuel partenaire de PAX5 dans cette translocation a été recherché par la
technique de RACE PCR (Rapid Amplification of cDNA Ends). Cette technique consiste à
retro-transcrire l’ARNm total grâce à une amorce oligo-dT couplée à une queue flottante.
L’ADNc obtenu est alors amplifié par PCR en utilisant une amorce sens spécifique de PAX5
et une amorce antisens correspondant à la séquence de la queue flottante. Le séquençage du
produit obtenu permet ainsi de déterminer directement le partenaire de PAX5. Cette technique
nous a permis de mettre en évidence le réarrangement de PAX5 avec le gène de l’élastine
(ELN). Cette translocation conduit à la juxtaposition du domaine de liaison à l’ADN de
PAX5, sans ses domaines de transactivation et de répression, à la quasi-totalité de l’élastine
qui est une protéine de la matrice extra-cellulaire.
Afin de comprendre le rôle de cette nouvelle protéine de fusion dans la pathologie,
nous avons cloné le cDNA de PAX5-ELN, puis nous l’avons transfecté dans des fibroblastes
de souris (NIH3T3) ainsi que dans une lignée de lymphome de Burkitt (DG75). En
microscopie confocale, nous avons observé une localisation nucléaire de la chimère PAX5ELN. Par immunoprécipitation de chromatine, nous avons démontré que PAX5-ELN garde
les propriétés de liaison à l’ADN de PAX5. En effet, elle est toujours capable de se lier sur les
promoteurs des gènes cibles de PAX5 tels que CD19 ou BLK. Différentes co-transfections,
dans des cellules HeLa, avec les constructions PAX5, PAX5-ELN et le gène rapporteur
luciférase sous le contrôle du promoteur CD19, nous ont permis de mettre en évidence un rôle
de dominant négatif de PAX5-ELN sur le PAX5 sauvage. Cet effet semble se confirmer dans
les cellules leucémiques des patients où l’on observe, par PCR quantitative, une diminution de
la transcription de CD19 et BLK. Cependant, aucune variation d’expression n’a été observée
pour les cibles de PAX5 telles que MB1, LEF-1 et BLNK dans les cellules leucémiques des
patients. Enfin, la transfection de PAX5-ELN dans la lignée DG75 exprimant PAX5 de façon
endogène, nous a permis d’observer une diminution de l’expression de BLNK, MB1 et LEF-1,
mais aucun changement pour CD19 et BLK.
Cette étude a permis de démontrer que la chimère PAX5-ELN exerce un rôle de
dominant négatif sur PAX5 sauvage, dans un contexte d’haploinsuffisance. Il s’agit de la
première description d’une fusion entre un facteur de transcription et une protéine structurale
dans les tumeurs lymphoïdes.
90
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
2007 109: 3417-3423
Prepublished online Dec 19, 2006;
doi:10.1182/blood-2006-05-025221
A novel PAX5-ELN fusion protein identified in B-cell acute lymphoblastic
leukemia acts as a dominant negative on wild-type PAX5
Marina Bousquet, Cyril Broccardo, Cathy Quelen, Fabienne Meggetto, Emilienne Kuhlein, Georges
Delsol, Nicole Dastugue and Pierre Brousset
Updated information and services can be found at:
http://bloodjournal.hematologylibrary.org/cgi/content/full/109/8/3417
Articles on similar topics may be found in the following Blood collections:
Oncogenes and Tumor Suppressors (791 articles)
Signal Transduction (1922 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://bloodjournal.hematologylibrary.org/misc/rights.dtl#repub_requests
Information about ordering reprints may be found online at:
http://bloodjournal.hematologylibrary.org/misc/rights.dtl#reprints
Information about subscriptions and ASH membership may be found online at:
http://bloodjournal.hematologylibrary.org/subscriptions/index.dtl
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published
semimonthly by the American Society of Hematology, 1900 M St, NW, Suite
200, Washington DC 20036.
Copyright 2007 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
NEOPLASIA
A novel PAX5-ELN fusion protein identified in B-cell acute lymphoblastic
leukemia acts as a dominant negative on wild-type PAX5
Marina Bousquet, Cyril Broccardo, Cathy Quelen, Fabienne Meggetto, Emilienne Kuhlein, Georges Delsol, Nicole Dastugue,
and Pierre Brousset
1Institut National de la Santé et de la Recherche Médicale (INSERM) U563, Centre de Physiopathologie de Toulouse Purpan, Toulouse, France; 2Université Paul
Sabatier, Toulouse, France; 3Laboratoire d’Anatomie Pathologique, Centre Hospitalier Universitaire (CHU) Purpan, Toulouse, France
We report a novel t(7;9)(q11;p13) translocation in 2 patients with B-cell acute
lymphoblastic leukemia (B-ALL). By fluorescent in situ hybridization and 3ⴕ rapid
amplification of cDNA ends, we showed
that the paired box domain of PAX5 was
fused with the elastin (ELN) gene. After
cloning the full-length cDNA of the chimeric gene, confocal microscopy of transfected NIH3T3 cells and Burkitt lymphoma cells (DG75) demonstrated that
PAX5-ELN was localized in the nucleus.
Chromatin immunoprecipitation clearly in-
dicated that PAX5-ELN retained the capability to bind CD19 and BLK promoter
sequences. To analyze the functions of
the chimeric protein, HeLa cells were
cotransfected with a luc-CD19 construct,
pcDNA3-PAX5, and with increasing
amounts of pcDNA3-PAX5-ELN. Thus, in
vitro, PAX5-ELN was able to block CD19
transcription. Furthermore, real-time
quantitative polymerase chain reaction
(RQ-PCR) experiments showed that PAX5ELN was able to affect the transcription of
endogenous PAX5 target genes. Since
PAX5 is essential for B-cell differentiation, this translocation may account for
the blockage of leukemic cells at the
pre–B-cell stage. The mechanism involved in this process appears to be, at
least in part, through a dominantnegative effect of PAX5-ELN on the wildtype PAX5 in a setting of PAX5 haploinsufficiency. (Blood. 2007;109:3417-3423)
© 2007 by The American Society of Hematology
Introduction
PAX5 is a member of the highly conserved paired-box (PAX)
domain family of transcription factors. The PAX5 gene plays an
important role in both cell differentiation as well as in embryonic
development, and is located on chromosome 9p13.1 This locus
contains 2 distinct promoters, resulting in 2 alternative 5⬘ exons (1a
and 1b).2 PAX5b is transcribed in the central nervous system and
testis as well as in the B-lymphoid lineage, while PAX5a, also
named B-cell–specific activator protein (BSAP), is specifically
transcribed in the lymphoid lineage. PAX5a/BSAP is expressed
from early stages of B-cell development up to mature B cells and is
down-regulated during terminal differentiation into plasma cells.3
In bone marrow of Pax5⫺/⫺ mice, B lymphopoiesis is completely
arrested at the pro-B stage, revealing the essential role of this gene
in early B-cell lymphopoiesis.4
PAX5-binding sites have been identified in the regulatory
sequences of a number of genes, including CD19,5 BLK,6 BLNK,7
MB1 (Ig␣), N-myc, LEF1,8 and RAG2.9 PAX5 can act as an
activator or a repressor of transcription. It has been shown to
activate CD19, N-myc, MB1, and LEF1 expression and to repress
PD-1 transcription.8 PAX5 plays an essential role in B-cell lineage
commitment by suppressing alternative lineage choices.10-12 Indeed, it represses the transcription of Notch1, which is necessary
for the commitment of lymphoid progenitors to the T-cell pathway,13 and the transcription of M-CSFR, thus rendering B-cell
precursors unresponsive to the myeloid cytokines such as macrophage colony-stimulating factor (M-CSF).12
Chromosomal translocations involving the PAX5 gene have
been described in different types of B-cell malignancies. The
t(9;14)(p13;q32) translocation in B-cell non-Hodgkin lymphoma
results in juxtaposition of the complete coding sequence of PAX5 to
the IGH gene cluster, and leads to elevated PAX5 expression.14,15
Moreover, PAX5 is involved in the chimeric transcript PAX5-ETV6
in patients with B-cell acute lymphoblastic leukemia (B-ALL) who
have a dic(9;12)(p13;p13) translocation.16,17 The latter fusion
protein retains the paired-box domain of PAX5 fused to the
helix-loop-helix and DNA-binding domain of ETV6. In this case,
the chimeric protein most probably acts as an aberrant transcription
factor.17 The paired box is a DNA-binding domain that is highly
conserved during evolution in all PAX genes.18-20 This domain is
conserved in all fusion transcripts involving a PAX gene, including
PAX5-ETV6 and others described, such as PAX3-FKHR21 and
PAX8-PPARG1.22 PAX5 also contains a conserved octapeptide
motif and a partial homeodomain. The C-terminal region
contains a transcriptional activation domain, and the extreme
C-terminal region acts as a repression domain.23 Furthermore,
PAX5 displays aberrant hypermutation in more than 50% of
diffuse large B-cell lymphomas.24
In this study, we report the molecular characterization of a new
chromosomal t(7;9)(q11;p13) translocation in 2 patients with
B-ALL. This translocation juxtaposes the 5⬘ region of PAX5 (at
9p13), including its paired-box domain (PBD) and almost the entire
sequence of elastin (ELN) (at 7q11.3).
Submitted May 23, 2006; accepted December 9, 2006. Prepublished online
as Blood First Edition Paper, December 19, 2006; DOI 10.1182/blood-200605-025221.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The online version of this manuscript contains a data supplement.
© 2007 by The American Society of Hematology
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
3417
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
3418
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
BOUSQUET et al
Patients, materials, and methods
Patients
Patient 1 is a 38-year-old male who presented with a B-ALL of pre-B3
phenotype (CD10⫹ C␮⫹). Cells were obtained from a bone marrow
aspiration. The karyotype showed an isolated t(7;9)(q11;p13) translocation:
46, XY, t(7;9)(q11;p13)[17].
Patient 2 is a 16-year-old male with B-ALL of pre-B2 phenotype
(CD10⫹ C␮⫺). Cells were obtained from a bone marrow aspiration. The
karyotype displayed a balanced t(7;9)(q11;p13) translocation associated
with a deletion 9p on the other chromosome 9: 46, XY, t(7;9)(q11;p13),
del(9)(p11p13)[14]/46, XY[1].
In parallel, 6 other patients with B-ALL were selected to serve as
controls. All these patients had a pre–B-cell phenotype (pre-B1 to
pre-B4).25 Their karyotypes were as follows: C1 (pre-B4): 46,XY, del(6)
(q13q23),der(19)t(1;19)(q23;p13)[10]/46, idem,der(21)t(1;21)(q12;p11)[2]/
46, XY[4]; C2 (pre-B2): 46, XY, t(9;22)(q34;q11)[11]; C3 (pre-B1): 46,
XX, t(4;11)(q21;q23)[19]/46, XX[1]; C4 (pre-B3): 46, XY, del(11)(q21),
dup(21)(q?)[2]/46, XY[10]; C5 (pre-B2): 46, XX, t(1;22)(q11;p11)[10]/46,
XX, t(1;22)(q11;p11), del(11)(q14q23)[1]/ 46, XX[8]; and C6 (pre-B2/3):
46, XY, t(9;22)(q34;q11)[3]/45, idem,⫺7[7].
The approval of the French equivalent of the Institutional Review Board
(Comité Consultatif de Préservation des Personnes en Recherche Biologique [CCPPRB]) is not required for investigations based on archived
materials that have been routinely used for diagnostic purposes.
Cell lines
DG75, HeLa, and NIH3T3 cells were grown at 37°C, 5% CO2, in RPMI
medium or Dulbecco modified Eagle medium (DMEM; Invitrogen-Gibco,
Carlsbad, CA) with 10% decomplemented fetal calf serum (FCS; InvitrogenGibco), 2 mM L-glutamine, 1 mM sodium pyruvate, 50 U/mL penicillin,
and 50 ␮g/mL streptomycin.
FISH
The bacterial artificial chromosome (BAC) clones spanning the PAX5
gene (RP11-243F8, RP11-297B17, and RP11-344B23) and the ELN
gene (CTD-2278A11) were obtained from the Welcome Trust Sanger
Institute (http://www.sanger.ac.uk). DNA was labeled with biotin-16dUTP or digoxigenin-11-dUTP (Roche, Indianapolis, IN) using a
nick-translation kit (Amersham Biosciences, Arlington Heights, IL)
according to the manufacturer’s instructions. Slides were observed
under a Zeiss Axioplan 2 microscope (Zeiss, Jena, Germany) equipped
with a 100⫻/1.3 numerical aperture (NA) oil objective. Images were
acquired with a high-resolution JAIM3000 camera (Metasystems,
Altlussheim, Germany) and were processed using ISIS3 software
(Metasystems).
3ⴕ RACE PCR and RT-PCR
Total RNA was extracted according to the TRIZOL method (InvitrogenGibco). Total RNA (1 ␮g) from Patient 1 was reverse-transcribed into
cDNA using an oligo dT-anchor primer (5⬘/3⬘ rapid amplification of cDNA
ends [RACE] kit, 2nd generation; Roche). The cDNA product was used as
template in a polymerase chain reaction (PCR) experiment using the BD
Advantage 2 PCR enzyme system (BD Biosciences, Palo Alto, CA), a PCR
anchor primer (5⬘-GACCACGCGTATCGATGTCGAC-3⬘), and a PAX5specific forward primer, PAXF (5⬘-CATAGTGTCCACTGGCTCCGTG3⬘), corresponding to the nucleotides spanning exons 4 and 5 junction of
PAX5 mRNA (NM_016734, National Center for Biotechnology Information [NCBI]). PCR was carried out with a GeneAmp PCR system 9600
(Perkin Elmer, Shelton, CT) according to the following cycling parameters:
95°C initial denaturation for 2 minutes, 5 cycles of 95°C for 5 seconds,
72°C for 3 minutes, 5 cycles of 95°C for 5 seconds, 70°C for 3 minutes, and
25 cycles of 95°C for 5 seconds, 68°C for 3 minutes. A final extension was
performed at 72°C for 10 minutes. The PCR product was purified using the
QiaQuick PCR Purification kit (Qiagen, Valencia, CA). An internal PAXG
primer (5⬘-GGTATTCAGGAGTCTCCGGTGC-3⬘) was used to sequence
the PCR product using the ABI Prism Dye Terminator kit (Perkin-Elmer;
Applied Biosystems, Foster City, CA).
The PAX5a-ELN transcript was amplified using PAXQ (5⬘-CCCTGTCCATTCCATCAAGTCCTG-3⬘), and ELN9 (5⬘-ATGAGGTCGTGAGTCAGGGGTC-3⬘) primers; and the PAX5b-ELN transcript was amplified
using PAXQ and PAXR (5⬘-CCGGCCTGCAGTCTGGAGCG-3⬘) primers.
Cloning of PAX5-ELN
Full-length PAX5-ELN and wild-type (wt)–PAX5 cDNA was amplified from
patient 1 using PAXQ or ELN9 and PAXQ or PCR5 (5⬘-GGCTGGGCTGGGGCTGCGGTTATTT-3⬘) primers, respectively, and was cloned in the
pCRII vector (TA cloning kit, Dual Promoter; Invitrogen-Gibco). After
digestion with EcoRI, PAX5-ELN was cloned into a pcDNA3 vector
(Invitrogen-Gibco). PAX5 was also cloned in pcDNA3 after digestion using
HindIII and NotI. The constructs were sequenced and tested using the
Transcend Non-Radioactive Translation Detection Systems (Promega,
Madison, WI).
Cell transfections
Transient transfections were performed on DG75 with 15 ␮g pcDNA3PAX5-ELN by electroporation as described previously.26 HeLa and NIH3T3
cells were transfected using FuGENE 6 Transfection Reagent (Roche).
For real-time quantitative (RQ)–PCR experiments, 5 ⫻ 106 DG75 cells
were cotransfected with 30 ␮g pcDNA3 or pcDNA3-PAX5-ELN constructs
and 1 ␮g of a green fluorescence protein (GFP) expression construct
(pmaxGFP; Amaxa Biosystems, Cologne, Germany). GFP positive cells
were sorted, 1 day after transfection, using an EPICS ALTRA cell sorter
(Beckman Coulter, Hialeah, FL).
Western blotting
Cells were lysed with Passive Lysis Buffer (PLB; Promega) for 30 minutes
at 4°C on a rocking platform and then sonicated 3 times for 10 seconds.
Total proteins were separated by 7.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred onto
nitrocellulose membranes. The membranes were blocked with a solution of
1% milk and 1% bovine serum albumin (BSA) in TBST (0.1% Tween 20 in
TBS) and probed with appropriate primary and secondary antibodies
diluted in TBST. The immunoreactive bands were visualized using the
enhanced chemiluminescence (ECL) lighting system (Perkin Elmer).
Confocal microscopy
Cells were labeled as described previously,27 24 hours after transfection,
using the anti-PAX5 N-terminal rabbit polyclonal antibody (ab12000;
Abcam, Cambridge, MA) or the anti-PAX5 mouse monoclonal antibody
(sc-13146; Santa Cruz Biotechnology, Santa Cruz, CA) and the anti-ELN
rabbit polyclonal antibody (sc-25736; Santa Cruz Biotechnology). They
were then incubated with the appropriate secondary antibody (Alexa Fluor
488 anti-rabbit antibody and Alexa Fluor 594 goat anti-mouse antibody).
Slides were observed under a Zeiss LSM 510 confocal inverted microscope
equipped with a 63⫻/1.4 NA oil objective. Images were processed using
Zeiss LSM 510 software.
ChIP
Chromatin immunoprecipitation (ChIP) assays were performed using a
ChIP assay kit (Upstate Biotechnology, Lake Placid, NY) following the
manufacturer’s instructions. Briefly, DG75 cells were transiently transfected with 15 ␮g of pcDNA3-PAX5-ELN, pcDNA3-PAX5, or pcDNA3
alone (negative control). After 40 hours of growth, 1% formaldehyde was
added directly to the culture medium to cross-link proteins to DNA. The
cell pellet was lysed with SDS lysis buffer and sonicated to shear DNA to a
size range between 200 and 1000 bp. After centrifugation, the supernatant
was diluted 10-fold in ChIP dilution buffer and incubated and rotated
overnight at 4°C with anti-ELN, anti-PAX5, mouse IgG2a (DAKO,
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
PAX5-ELN FUSION GENE IN B-ALL
3419
Carpinteria, CA), normal rabbit IgG (Upstate Biotechnology), or without
antibody. Protein A agarose/salmon sperm DNA were then used to
immunoprecipitate the antibody/protein/DNA complex. After washing, the
complex was incubated at 65°C for 4 hours to reverse the protein/DNA
cross-links. The DNA was then purified by phenol/chloroform extraction
and used as a template for PCR amplification. PCR was performed using the
BD Advantage 2 PCR enzyme system (BD Biosciences), CD19F (5⬘GTGGTAGTGAGAGCTGGGATGAA-3⬘), and CD19R (5⬘-CAGCTTCGCGCAGGGGATGCT-3⬘) primers to amplify the region spanning the
PAX5-binding site of the CD19 promoter, BLKPrF (5⬘-GAGGCTCTGAGATCCAAGTCAAC-3⬘) and BLKPrR (5⬘-TGTGCCATCTGTGTGCACCAGG-3⬘) primers for the BLK promoter, and SERPINA1PrF
(5⬘-AGCCCAGATGCTGCAATAGA-3⬘) and SERPINA1PrR (5-AGCAGGTGAGGCAAGTAAGG-3⬘) for the SERPINA1 promoter. PCR products
were resolved on 2% agarose gels, visualized after ethidium bromide
staining, and subsequently sequenced.
Luciferase assay
HeLa cells were transfected with 5 ␮g luc-CD19, 1 ␮g pcDNA3-PAX5,
increasing amounts of pcDNA3-PAX-ELN (0.3-9.0 ␮g), and 0.4 ␮g
pRL-CMV (Promega). Cells were lysed, 40 hours after transfection, with 1
mg/mL BSA in PLB. Firefly luciferase gene expression normalized for
Renilla luciferase activity was analyzed using the Dual-luciferase Reporter
assay system (Promega). Additional experiments using 5 ␮g luc-CD19,
increasing amounts of pcDNA3-PAX5 (1.3-10.0 ␮g), and 0.4 ␮g pRLCMV were performed as a control of specificity (Figure S1, available on
the Blood website; see the Supplemental Figure link at the top of the
online article).
Quantitative RT-PCR
cDNA was synthesized using Moloney murine leukemia virus (M-MLV)
reverse transcriptase (RT; Invitrogen) according to the manufacturer’s
instructions. Quantitative PCR was performed on an ABI7000 (Applied
Biosystems) using qPCR MasterMix Plus for SYBR green (Eurogentec,
Herstal, Belgium). CD19A (5⬘-CTTCA TCTTCAAAGAGCCCTGG-3⬘)
and CD19B (5⬘-CTTTGAAGAATCTCCTGGTGGG-3⬘) primers were used
to amplify the CD19 cDNA. BLKF (5⬘-CCTGGAAATGGAAAGGTGG
TTC-3⬘) and BLKR (5⬘-GGAGAAGGCACCTTTGTTGGTT-3⬘) amplified
the BLK cDNA. BLNKA (5⬘-CTGCCAAGATTTACAGAAGGGG-3⬘) and
BLNKB (5⬘-AACGCCAGCTTC CTGTTCTGAA-3⬘) amplified the BLNK
cDNA. MB1A (5⬘-CTGCTGCTGTTCAGGAAA CG-3⬘) and MB1B (5⬘GTCCAGGTTCAGGCCTTCAT-3⬘) amplified the MB1 cDNA. LEF1A
(5⬘-ACACCCGTCACACATCCCAT-3⬘) and LEF1B (5⬘-CACCCGGAGACAA GGGATAA-3⬘) amplified the LEF1 cDNA. The presented data
correspond to the mean of 2⫺⌬⌬Ct from 3 independent reactions, normalized
to the MLN51 and S14 reference genes.
Results
Rearrangement of PAX5
The investigations were based on the assumption that PAX5,
located at 9p13, was rearranged in the 2 patients. As PAX5 plays an
important role in the B-cell lineage commitment, its deregulation
could explain the differentiation blockage of the leukemic cells. We
therefore tested metaphase chromosomes of the 2 patients by FISH
(fluorescent in situ hybridization) with PAX5 BAC probes. When
we used the probe RP11-243F8 corresponding to the entire
sequence of PAX5 gene, we observed a split signal in both patients:
one part on chromosome 9p13 and the other part on chromosome
7q11 (Figure 1Ai-ii). With additional probes (RP11-297B17 and
RP11-344B23), we observed that PAX5 was split between exons 7
and 10 in both patients (Figure 1Bi-ii).
Figure 1. Rearrangement of the PAX5 gene detected by FISH. FISH with PAX5
probes on both patients. (Ai-ii) FISH with PAX5 probe A: the RP11-243F8 BAC probe
corresponds to the entire sequence of PAX5 gene. The signal of this probe is split
between derived chromosomes 7 and 9 (arrows). (Bi-ii) FISH with PAX5 probe B: the
BAC RP11-297B17 and RP11-344B23 correspond respectively to the 5⬘ part of the
PAX5 gene up to intron 7 and the 3⬘ part of PAX5 from intron 7. FISH only shows a
split of the RP11-344B23 probe. Thus, PAX5 is rearranged in both patients between
exons 7 and 10.
Identification of the partner of PAX5
Several lines of evidence indicated that a new chimeric gene was
created, composed of the 5⬘ part of PAX5 containing the PBD
domain and the 3⬘ part of another gene. To identify the partner of
PAX5, we performed 3⬘ RACE PCR using primers located upstream from exon 7. A 1000-bp product was obtained from the
RNA of Patient 1 (Figure 2A). Sequencing revealed that this
product corresponded to the 5⬘ part of PAX5 fused to ELN. FISH
confirmed involvement of ELN with a specific BAC probe (Figure
2B). For both patients, the structure of the open reading frame of
the chimeric PAX5-ELN transcript showed that PAX5 exon 7
(NM_016734, NCBI) was fused in frame with ELN exon 2
(NM_000501) (Figure 3A).
RT-PCR analysis revealed the presence of 2 alternative fusion
transcripts, PAX5a-ELN and PAX5b-ELN, as shown in Figure 2C.
However, we were unable to detect the reverse fusion transcript
ELN-PAX5, which may be explained by differential promoter
activity, as we observed the presence of wild-type PAX5 mRNA but
not ELN mRNA (M.B., unpublished results, July 2006).
The structure of the chimeric protein therefore comprised the
PAX5 PBD (DNA-binding domain) and its nuclear localization
sequence (NLS) fused to ELN without its signal peptide (Figure 3B).
Nuclear localization of PAX5-ELN
Due to the structure of PAX5-ELN, we postulated that this fusion
protein should be localized to the nucleus. To confirm this
hypothesis, we cloned the full-length cDNA amplified from Patient
1’s material in a pcDNA3 vector. The pcDNA3-PAX5a-ELN
construct was selected for further experiments because PAX5a
corresponds to BSAP, specific to the B lineage. The construct was
sequenced and successfully tested in in vitro transcriptiontranslation experiments (M.B., unpublished results, October 2005).
Transient transfections with this construct were performed in
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
3420
BOUSQUET et al
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
staining, it remains difficult to categorically state that both proteins
colocalized (Figure 4B). Transfection experiments on HeLa cells
further support the nuclear localization of the PAX5-ELN protein
(M.B., unpublished results, April 2006).
Binding of PAX5-ELN on CD19 and BLK gene promoters
Since PAX5-ELN is localized to the nucleus, we sought to
determine whether PAX5-ELN was able to bind the promoter of
PAX5 target genes. The CD19 gene was chosen because it is
described as a specific target of PAX5. Therefore, we transfected
DG75 cells with pcDNA3-PAX5-ELN or pcDNA3-PAX5 constructs. ChIP experiments on transfected DG75 cells were performed using anti-ELN or anti-PAX5 antibodies. PCR reactions
with specific primers clearly showed that PAX5-ELN was able to
bind endogenous CD19 promoter sequences, as was PAX5 (Figure
5A). The same experiments were performed for BLK promoter
sequences, another known target of PAX5. We observed the same
results: both PAX5-ELN and PAX5 were able to bind to BLK
promoter sequences (Figure 5B).
Dominant-negative effect of PAX5-ELN on PAX5
Figure 2. Rearrangement of the ELN gene. (A) 3⬘ RACE PCR was performed using
a PAX5-specific primer and an anchor primer. We obtained a 1000-bp product that
corresponds after sequencing to a part of PAX5 fused to the ELN transcript from its
exon 2. (B) FISH analysis with the ELN BAC probe (CTD-2278A11). (C) Amplification
of the 2 alternative transcripts by RT-PCR: PAX5a-ELN and PAX5b-ELN from the
mRNA of patient 1.
NIH3T3 cells. Because NIH3T3 cells do not contain PAX5, we
used an anti-PAX5 N-terminal antibody to visualize the PAX5ELN protein. As shown in Figure 4A, we observed a nuclear
localization of PAX5-ELN. This result was expected since PAX5ELN retains the nuclear localization signal of wt-PAX5. Similar
results were obtained in DG75-transfected cells (Figure 4B).
Conversely, DG75 cells do not contain ELN, so we used an
anti-ELN antibody to visualize the PAX5-ELN protein. An antibody directed against the C-terminal region of PAX5 was used to
visualize the endogenous protein. Confocal microscopy confirmed
that PAX5-ELN and PAX5 were both localized in the nucleus.
However, although there was an overlap of PAX5 and PAX5-ELN
Given the structure of PAX5-ELN (which lacks the transactivation
domain of PAX5), we postulated that the chimeric protein might
block CD19 transcription. We cotransfected HeLa cells with the
luc-CD19 construct,23 pcDNA3-PAX5, and increasing amounts of
pcDNA3-PAX5-ELN. PAX5 alone activated the transcription of
the luciferase reporter gene (Figure 6A). Concomitant transfection
of the pcDNA3-PAX5-ELN led to a down regulation of PAX5driven CD19 transcription (Figure 6A). Taken together, the results
of the ChIP and the luciferase assay indicated that PAX5-ELN
could function in a dominant-negative manner over PAX5.
Furthermore, RQ-PCR experiments on DG75 cells were also
carried out to test the role of PAX5-ELN on endogenous target
genes. As shown in Figure 6B, PAX5-ELN was able to down
regulate BLNK, LEF1, and MB1. Unexpectedly, CD19 and BLK
transcription appeared unaffected by the presence of PAX5-ELN
(Figure 6B).
Down-regulation of the transcription of PAX5 targets
in patients’ leukemic cells
To confirm our results, we extracted RNA from the marrow of 6
patients with B-ALL but with distinct cytogenetic abnormalities.
RQ-PCR showed that the levels of CD19 expression were lower in
PAX5-ELN–positive tumors compared with those in the other
patients with B-ALL (Figure 7A). The study of another target of
PAX5, the BLK gene, corroborated our results since its expression
Figure 3. Schematic representation of PAX5-ELN. (A) Open reading frame
of the chimeric PAX5-ELN gene. (B) Structure of PAX5, PAX5-ELN and ELN
proteins. OCT indicates octapeptide; TD, transactivation domain; and RD,
repressor domain.
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
PAX5-ELN FUSION GENE IN B-ALL
3421
Figure 4. Localization of PAX5-ELN by confocal microscopy. (A) Nuclear localization of PAX5-ELN in NIH3T3 cells (anti-PAX5; green) (B) Nuclear localization of
PAX5-ELN and endogenous PAX5 in DG75 cells (anti-elastin [H-300] is green; anti–PAX-5 [A-11], red).
was clearly lower in PAX5-ELN–positive patients compared with
the 6 other patients (Figure 7B). However, contrary to results
obtained from DG75 cells, BLNK, MB1, and LEF1 expression did
not significantly vary in PAX5-ELN–positive patients compared
with PAX5-ELN–negative cases (M.B., unpublished results, October 2006).
Last, we did not find a correlation between gene transcription
and CD19 protein expression. We could retrieve pellets of cells
from only 1 patient (patient 1 [P1]) carrying the PAX5-ELN fusion
gene and 2 patients with B-ALL previously investigated by
RQ-PCR (C3 and C5). The levels of CD19 protein (detected by
fluorescence-activated cell sorter [FACS]) were not significantly
different in all 3 patients (Table S1). However, no definitive
conclusion can be drawn from these data since only 3 patients were
tested. In addition, it is worth noting that the 2 PAX5-ELN–
negative patients had the lowest level of CD19 transcription in the
series of control cases. Moreover, one cannot exclude differential
posttranscriptional regulation of CD19 in those patients.
chromosome 7 was ELN, which encodes an extracellular matrix
protein. We next demonstrated that the chimeric PAX5-ELN gene
was identical in the 2 patients carrying the t(7;9)(q11;p13) translocation. The 2 patients reported in this study were retrieved from a
collection of 147 other patients with adult B-ALL in our chromosome bank, suggesting that the t(7;9)(q11;p13) translocation is not
an exceptional event. For comparison, in a series of 250 pediatric
patients with B-ALL, we could retrieve only 2 patients with a
dic(9;12)(p13;p13) translocation, the incidence of which is estimated at about 1%. Larger cohorts of cases are necessary to assess
the real incidence of the t(7;9)(q11;p13) translocation. However,
we think that this abnormality is underestimated, and that its
characterization will favor further reports.
In all previously described chimeras involving PAX genes, the
partner is a transcription factor. This is true in solid tumors such as
Discussion
Chromosomal translocations are frequently observed in cancers,
particularly in leukemia. They lead to gene rearrangements and, in
some instances, dramatically alter gene expression. Since PAX5 is
crucial for B-cell differentiation, we postulated that in the 2 patients
with B-ALL carrying a t(7;9)(q11;p13) translocation, the differentiation arrest at the pre-B stage was the result of PAX5 deregulation.
By FISH analysis, we confirmed the hypothesis that PAX5 was
rearranged: a genomic breakpoint between exons 7 and 10 was
observed using PAX5 BAC probes. This indicated that PAX5 was
involved in a chimeric gene, a part of which retained sequences
coding for the DNA-binding PBD of the protein. Unexpectedly,
using a 3⬘ RACE method, we found that the partner gene on
Figure 5. ChIP experiments on CD19 and BLK promoters. (A) PCR amplification
of the CD19 promoter fragments after ChIP: PAX5-ELN binds CD19 promoter
sequences as PAX5. (B) PCR amplification of the BLK promoter. PAX5-ELN binds
BLK promoter sequences as PAX5. (C) Non-PAX5 target sequence PCR control.
PCR amplification of the SERPINA1 promoter.
Figure 6. Repression of PAX5-dependent transactivation by PAX5-ELN. (A) The
plasmids luc-CD19 (5 ␮g), pcDNA3-PAX5 (1 ␮g), and the reference pRL-CMV (0.4
␮g; transfection efficiency control) were transfected together into HeLa cells with
increasing amounts of pcDNA3-PAX5-ELN. The luc-CD19 plasmid contains 3 copies
of the high-affinity PAX5-binding site of CD19 upstream of the TATA box and the
luciferase gene. Luciferase activity in 3 independent transfection experiments was
normalized to the measured Renilla activities and are shown as average values
relative to the basal activity observed with pcDNA3 alone (results are mean ⫾ SD;
Student t test; *P ⬍ .05, **P ⬍ .01 compared with DG75 transfected with pcDNA3PAX5, without PAX5-ELN). (B) DG75 cells were transfected with pcDNA3-PAX5-ELN
and pmaxGFP. GFP-positive cells were sorted 24 hours after transfection. CD19,
BLK, BLNK, MB1, and LEF1 mRNA levels were evaluated by RQ-PCR (Results are
mean ⫾ SD; Student t test: *P ⬍ .05, **P ⬍ .01).
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
3422
BOUSQUET et al
Figure 7. Comparative transcription of the PAX5 target genes CD19 and BLK by
RQ-PCR in PAX5-ELN–positive and –negative patients with B-ALL. (A) CD19
mRNA levels: CD19 transcription in Patient 1 (P1) and Patient 2 (P2) is lower
compared with the other patients with B-ALL (C1, C2, C3, C4, C5, and C6). (B) BLK
mRNA levels: P1 and P2 display lower levels of BLK transcripts than the other
patients with B-ALL. (Results are mean ⫾ SD; Student t test: *P ⬍ .05, **P ⬍ .01
compared with Patient 1).
thyroid carcinoma, with the PAX8-PPARG1 oncogene,22 and in
rhabdomyosarcoma, with the PAX3-FKHR21 or PAX7-FKHR
proteins.28 In all of these disorders, the various chimeras may act
both as transdominant-negative proteins and as abnormal and/or
ectopic transcription factors. Regarding the only previously reported translocation involving PAX5 in B-ALL that yields a
PAX5-ETV6 hybrid gene,16 Stehl et al17 suggested that the corresponding protein could be an aberrant transcription factor. Interestingly, in the patients reported here, PAX5-ELN expression is likely
to yield an aberrant transcription factor retaining the DNA-binding
properties of wild-type PAX5, but without its transactivation and
repressor domains, which are replaced by ELN. The discovery of
ELN as the partner gene of PAX5 was somewhat unexpected, as its
product is a 72-kDa insoluble extracellular matrix protein. It is the
main component of elastic fibers, which are crucial for the
elasticity of structures such as skin, blood vessels, heart, lungs,
intestines, tendons, and ligaments.29 ELN is composed largely of
glycine, proline, and other hydrophobic residues, and contains
multiple lysine-derived cross-links, such as desmosines and isodesmosines.30 A defect in elastin is implicated in several genetic
disorders: Williams-Beuren syndrome (WBS), supravalvular aortic
stenosis (SVAS), and Cutis Laxa. SVAS is a rare obstructive arterial
disease characterized by the narrowing of the large elastic vessels.31 Patients with WBS have additional clinical manifestations,
including typical facial anomalies, neurodevelopmental abnormalities, growth retardation, and cardiovascular manifestations.32 Mutations or deletions limited to the ELN gene appear to result in SVAS,
whereas deletions spanning at least 114-kb around the gene lead to
WBS. Moreover, ELN is implicated in other chromosomal translocations. Curran et al described a t(6;7)(p21.1;q11.23) translocation
that disrupts the ELN gene with a breakpoint in exon 28 in a patient
with SVAS.33 Von Dadelszen et al reported a case of SVAS with a
t(6;7)(q27;q11;23) translocation and with the same breakpoint on
ELN, but with different breakpoints on chromosome 6.34 In 2002,
Duba et al35 described 5 patients with the same balanced translocation t(7;16)(q11.23;q13) associated with a variable expression of
WBS. This translocation disrupts the ELN gene within intron 5 and
creates a fusion gene with intron 1 of the TM7XN1 gene.35
However, in all these disorders, alterations of the ELN gene are
transmitted in the germ line and are frequently accompanied by a
defect in the organization of the elastin network. In contrast, in our
observations, the rearrangement of ELN occurs in somatic cells and
curiously involves cell types that do not express this gene. This
may be the reason why the reverse ELN-PAX5 hybrid gene was not
transcribed. The fact that the breakpoints observed in the tumors
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
are identical in the 2 patients strongly suggests that this rearrangement is not completely sporadic. Interestingly, the fact that the
breakpoints between germinal and somatic alterations of the ELN
gene are distinct also suggests that the mechanisms underlying
these chromosomal rearrangements are completely different.
Although particularly aberrant, the chimeric protein PAX5ELN is probably functional in leukemic cells. To confirm this point,
we transfected Burkitt lymphoma cells (DG75) with a construct
containing the full-length cDNA of the chimeric gene. Thus, we
showed that PAX5-ELN was localized to the nucleus, as was
PAX5. The same result was obtained in other transfected cell types
(eg, HeLa cells, NIH3T3, etc). This was expected since PAX5-ELN
retained the NLS of PAX5 and lost the signal peptide of ELN. ChIP
experiments clearly demonstrated that PAX5-ELN was able to bind
CD19 and BLK promoter sequences, as was wild-type PAX5,
suggesting that it could act in a dominant-negative manner. To
further demonstrate this, we then cotransfected HeLa cells with a
luc-CD19 construct, pcDNA3-PAX5, and pcDNA3-PAX5-ELN.
We observed a down-regulation of PAX5-driven CD19 transcription proportional to the amounts of the transfected pcDNA3-PAX5ELN construct. Thus, PAX5-ELN was able to block PAX5dependent transactivation by competing on PAX5-binding sites.
However, RQ-PCR experiments (on DG75 cells) revealed that the
effect of PAX5-ELN on PAX5 endogenous targets is probably
more complex than expected. In our hands, PAX5-ELN was able to
down-regulate BLNK, LEF1, and MB1, but failed to affect CD19
and BLK transcription. This is in agreement with the data of Nutt et
al,8 showing that when transfected in RAC65 embryonic carcinoma
cells, the sole DNA-binding domain (paired box) of PAX5 can act
in a transdominant negative manner on luc-CD19 construct expression.8 Nevertheless, the same domain fails to interfere with the
expression of the endogenous CD19 gene in B-cell lines, even if
it is expressed at a 50-fold higher level compared with the
endogenous PAX5 protein (Dr. Meinrad Busslinger, written
personal communication, October 2006).
As B-cell differentiation is not altered in Pax5⫹/⫺ animals,36 it is
probable that the haploinsufficiency observed in such tumors may
not alone account for the maturation blockage. Nevertheless, some
degree of haploinsufficiency may be involved in this process, since
1 allele is interrupted and the transcription of PAX5 is supposed to
be biallelic at this stage.36 Concerning the tumor cells, we observed
that both CD19 and BLK genes were expressed at lower levels in
PAX5-ELN–positive tumors compared with other patients with
B-ALL with different chromosomal abnormalities, whereas BLNK,
MB1, and LEF1 genes were not significantly affected (M.B.,
unpublished results, October 2006). These results do not correlate
with the data obtained on DG75 transfected cells, suggesting that
the regulation of PAX5 target gene transcription is context dependent, being different in mature (DG75 post–germinal-center B
cells) and in leukemic pre-B cells. Further experiments are needed
to unravel the subtle mechanisms underlying these differences.
One can assume that PAX5-ELN rearrangement is, to a large
extent, an early event in the process of transformation of leukemic
cells. The competition of PAX5-ELN with PAX5 may interfere
with the process of B-cell differentiation, which is tightly linked to
PAX5 expression. Moreover, as this translocation is isolated in 1 of
the 2 patients and associated with a chromosomal deletion
[del(9)(p11p13)] outside the PAX5 locus in the other patient, it is
probable that this phenomenon represents a key event in the
process of B-cell transformation. We suspect that additional
(secondary) molecular events are involved in the process of
transformation of normal B cells into leukemic cells. In this
From www.bloodjournal.org at BIBL SANTE on April 16, 2008. For personal use only.
BLOOD, 15 APRIL 2007 䡠 VOLUME 109, NUMBER 8
PAX5-ELN FUSION GENE IN B-ALL
regard, further biochemical experiments are needed to understand the consequences of the presence of ELN in the nucleus,
since this protein is usually exclusively located in the extracellular compartment.
In conclusion, we report herein a new chromosomal translocation in patients with B-ALL that yields a chimeric PAX5-ELN
protein with a dominant-negative function on PAX5 in a background of haploinsufficiency. To the best of our knowledge, this is
only the second description of such an oncogenic process involving
a transcription factor and a structural protein in hematologic
malignancies,37 and the first in human lymphoid tumors.
Acknowledgments
We thank Prof Meinrad Busslinger (Vienna, Austria) for providing
the luc-CD19 construct and fruitful discussion on our results.
Special thanks to Neil Ledger, Charles A. Stewart, Jean-Pierre
Jaffrézou, and Brian Huntly for critical reading of the manuscript.
Supported by grants from l’Institut National du Cancer (INCa),
3423
France; l’ARC contrat no. 3705; La ligue nationale contre le
Cancer (Comités de Haute-Garonne et du Gers); and Cancéropole
Grand Sud-Ouest.
Authorship
Author contributions: M.B., C.B., and C.Q. performed most of the
experiments described in this study. N.D. performed and interpreted all experiments on chromosome metaphases (karyotypes,
FISH). F.M. played an important role in the management of all
molecular biology experiments (PCR, RT-PCR, RACE, ChIP).
E.K. performed FACS analysis on leukemic cells. G.D. and P.B.
designed the study and wrote the manuscript. M.B. and C.B.
contributed equally to this work.
Conflict-of-interest statement: The authors declare no competing financial interests.
Correspondence: Pierre Brousset, Department of Pathology,
CHU Purpan, Place Baylac, 31059 Toulouse Cedex, France;
e-mail: [email protected].
References
1. Stapleton P, Weith A, Urbanek P, Kozmik Z, Busslinger M. Chromosomal localization of seven
PAX genes and cloning of a novel family member,
PAX-9. Nat Genet. 1993;3:292-298.
2. Palmisano WA, Crume KP, Grimes MJ, et al. Aberrant promoter methylation of the transcription
factor genes PAX5 alpha and beta in human cancers. Cancer Res. 2003;63:4620-4625.
3. Adams B, Dorfler P, Aguzzi A, et al. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS,
and adult testis. Genes Dev. 1992;6:1589-1607.
4. Urbanek P, Wang ZQ, Fetka I, Wagner EF, Busslinger M. Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP. Cell. 1994;79:
901-912.
5. Nutt SL, Thevenin C, Busslinger M. Essential
functions of Pax-5 (BSAP) in pro-B cell development. Immunobiology. 1997;198:227-235.
6. Libermann TA, Pan Z, Akbarali Y, et al. AML1
(CBFalpha2) cooperates with B cell-specific activating protein (BSAP/PAX5) in activation of the B
cell-specific BLK gene promoter. J Biol Chem.
1999;274:24671-24676.
7. Schebesta M, Pfeffer PL, Busslinger M. Control of
pre-BCR signaling by Pax5-dependent activation
of the BLNK gene. Immunity. 2002;17:473-485.
8. Nutt SL, Morrison AM, Dorfler P, Rolink A, Busslinger M. Identification of BSAP (Pax-5) target
genes in early B-cell development by loss- and
gain-of-function experiments. EMBO J. 1998;17:
2319-2333.
9. Miranda GA, Villalvazo M, Galic Z, et al. Combinatorial regulation of the murine RAG-2 promoter
by Sp1 and distinct lymphocyte-specific transcription factors. Mol Immunol. 2002;38:1151-1159.
10. Delogu A, Schebesta A, Sun Q, Aschenbrenner
K, Perlot T, Busslinger M. Gene repression by
Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells. Immunity. 2006;24:269-281.
11. Nera KP, Kohonen P, Narvi E, et al. Loss of Pax5
promotes plasma cell differentiation. Immunity.
2006;24:283-293.
12. Nutt SL, Heavey B, Rolink AG, Busslinger M.
Commitment to the B-lymphoid lineage depends
on the transcription factor Pax5. Nature. 1999;
401:556-562.
13. Souabni A, Cobaleda C, Schebesta M, Busslinger
M. Pax5 promotes B lymphopoiesis and blocks T
cell development by repressing Notch1. Immunity. 2002;17:781-793.
14. Busslinger M, Klix N, Pfeffer P, Graninger PG,
Kozmik Z. Deregulation of PAX-5 by translocation
of the Emu enhancer of the IgH locus adjacent to
two alternative PAX-5 promoters in a diffuse
large-cell lymphoma. Proc Natl Acad Sci U S A.
1996;93:6129-6134.
15. Iida S, Rao PH, Nallasivam P, et al. The t(9;
14)(p13;q32) chromosomal translocation associated with lymphoplasmacytoid lymphoma involves the PAX-5 gene. Blood. 1996;88:41104117.
16. Cazzaniga G, Daniotti M, Tosi S, et al. The paired
box domain gene PAX5 is fused to ETV6/TEL in
an acute lymphoblastic leukemia case. Cancer
Res. 2001;61:4666-4670.
17. Strehl S, Konig M, Dworzak MN, Kalwak K, Haas
OA. PAX5/ETV6 fusion defines cytogenetic entity
dic(9;12)(p13;p13). Leukemia. 2003;17:11211123.
18. Dahl E, Koseki H, Balling R. Pax genes and organogenesis. Bioessays. 1997;19:755-765.
19. Mansouri A, Goudreau G, Gruss P. Pax genes
and their role in organogenesis. Cancer Res.
1999;59:1707s-1709s.
20. Walther C, Guenet JL, Simon D, et al. Pax: a murine multigene family of paired box-containing
genes. Genomics. 1991;11:424-434.
21. Galili N, Davis RJ, Fredericks WJ, et al. Fusion of
a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet.
1993;5:230-235.
22. Kroll TG, Sarraf P, Pecciarini L, et al. PAX8PPARgamma1 fusion oncogene in human thyroid
carcinoma [corrected]. Science. 2000;289:13571360.
23. Dorfler P, Busslinger M. C-terminal activating and
inhibitory domains determine the transactivation
potential of BSAP (Pax-5), Pax-2 and Pax-8.
EMBO J. 1996;15:1971-1982.
24. Pasqualucci L, Neumeister P, Goossens T, et al.
Hypermutation of multiple proto-oncogenes in
B-cell diffuse large-cell lymphomas. Nature.
2001;412:341-346.
25. Bene MC, Castoldi G, Knapp W, et al. Proposals
for the immunological classification of acute leukemias: European Group for the Immunological
Characterization of Leukemias (EGIL). Leukemia.
1995;9:1783-1786.
26. Armstrong F, Duplantier MM, Trempat P, et al.
Differential effects of X-ALK fusion proteins on
proliferation, transformation, and invasion properties of NIH3T3 cells. Oncogene. 2004;23:60716082.
27. Honorat JF, Ragab A, Lamant L, Delsol G, Ragab-Thomas J. SHP1 tyrosine phosphatase
negatively regulates NPM-ALK tyrosine kinase
signaling. Blood. 2006;107;4130-4138.
28. Davis RJ, D’Cruz CM, Lovell MA, Biegel JA, Barr
FG. Fusion of PAX7 to FKHR by the variant t(1;
13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res. 1994;54:2869-2872.
29. Gray WR, Sandberg LB, Foster JA. Molecular
model for elastin structure and function. Nature.
1973;246:461-466.
30. Davis NR, Anwar RA. On the mechanism of formation of desmosine and isodesmosine crosslinks of elastin. J Am Chem Soc. 1970;92:37783782.
31. Ewart AK, Jin W, Atkinson D, Morris CA, Keating
MT. Supravalvular aortic stenosis associated with
a deletion disrupting the elastin gene. J Clin Invest. 1994;93:1071-1077.
32. Ewart AK, Morris CA, Atkinson D, et al. Hemizygosity at the elastin locus in a developmental disorder, Williams syndrome. Nat Genet. 1993;5:1116.
33. Curran ME, Atkinson DL, Ewart AK, Morris CA,
Leppert MF, Keating MT. The elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis. Cell. 1993;73:159-168.
34. von Dadelszen P, Chitayat D, Winsor EJ, et al. De
novo 46, XX, t(6;7)(q27;q11;23) associated with
severe cardiovascular manifestations characteristic of supravalvular aortic stenosis and Williams
syndrome. Am J Med Genet. 2000;90:270-275.
35. Duba HC, Doll A, Neyer M, et al. The elastin gene
is disrupted in a family with a balanced translocation t(7;16)(q11.23;q13) associated with a variable expression of the Williams-Beuren syndrome. Eur J Hum Genet. 2002;10:351-361.
36. Nutt SL, Vambrie S, Steinlein P, et al. Independent regulation of the two Pax5 alleles during Bcell development. Nat Genet. 1999;21:390-395.
37. Liu P, Tarle SA, Hajra A, et al. Fusion between
transcription factor CBF beta/PEBP2 beta and a
myosin heavy chain in acute myeloid leukemia.
Science. 1993;261:1041-1044.
Résultats expérimentaux
Article 3
Myeloid cell differentiation arrest by miR-125b-1
in myelodysplasic syndrome and acute myeloid leukemia
with the t(2;11)(p21;q23) translocation
Marina Bousquet, Cathy Quelen, Véronique Mansat-De Mas, Christian Bastard,
Eric Lippert, Pascaline Talmant, Marina Lafage-Pochitaloff, Dominique Leroux,
Carine Gervais, Franck Viguié, Jean-Luc Lai, Christine Terre, Georges Delsol,
Nicole Dastugue, et Pierre Brousset
Manuscrit soumis à Journal of experimental medecine
91
Résultats expérimentaux
92
Résultats expérimentaux
La translocation chromosomique t(2;11)(p21;q23) dans les leucémies
aiguës myéloblastiques et les myélodysplasies
La translocation chromosomique t(2;11)(p21;q23) a été retrouvée chez 14 patients
atteints de myélodysplasies (6) et de leucémies aiguës myéloblastiques (8). Les translocations
impliquant la région 11q23 sont très fréquentes dans les hémopathies malignes. En effet, elles
représentent 5 à 6% des leucémies aiguës myéloblastiques, 7 à 10 % des leucémies aiguës
lymphoblastiques et 60 à 70% des leucémies aiguës de l’enfant. Dans 95% des cas, c’est le
gène MLL pour mixed lineage leukaemia qui est impliqué dans ces translocations. Ce gène
peut former des protéines de fusions avec différents partenaires tels que AF9, AF6, ELL…Plus
de cinquante partenaires de MLL ont étés identifiés à ce jour (Meyer et al., 2006). L’analyse
du gène MLL par la technique de FISH a permis de conclure que ce gène n’était pas réarrangé
chez nos patients, suggérant qu’il existait très probablement un autre gène important dans
cette région.
Nous avons donc cherché à localiser les points de cassures situés sur les chromosomes
2 et 11 pathologiques par FISH. Grâce à cette technique, nous avons pu réduire la région du
point de cassure sur les deux chromosomes pathologiques. Sur le chromosome 11, l’utilisation
de fosmides comme sondes nous a permis de délimiter cet intervalle à 30kb. Sur le
chromosome 2, les points de cassures sont plus hétérogènes et se répartissent sur un intervalle
de 300kb. Afin de déterminer plus précisément les points de cassures sur les chromosomes
pathologiques, nous avons utilisé la technique de LDI-PCR (Long distance inverse PCR).
Cette méthode mise au point par l’équipe de Martin Dyer permet de cloner les points de
cassures de translocations chromosomiques, à partir de l’ADN des patients (Willis et al.,
1997). Il est nécessaire, pour cette méthode, de connaitre une des régions du point de cassure.
Le principe consiste à digérer l’ADN avec des enzymes à 6pb et à re-liguer les fragments
obtenus sur eux-mêmes. Ces fragments circularisés seront ensuite amplifiés par PCR en
utilisant des amorces en sens inverse correspondants à la région connue. Ainsi, on peut
obtenir une amplification du fragment circularisé contenant le point de cassure. Nous
disposions de l’ADN de deux patients pour lesquels nous avons pu cloner les points de
cassures.
93
Résultats expérimentaux
Afin de déterminer quels pouvaient être les gènes impliqués, nous avons dans un
premier temps identifié les gènes situés au niveau des points de cassures. Aucun gène connu
et uniquement quelques EST sont présents. Nous nous sommes donc intéressés aux gènes
situés dans les régions voisines susceptibles d’être dérégulés dans ces pathologies. Nous
disposions de l’ARN pour six patients (3 LAM et 3 MDS). Le niveau d’expression de
BRCC2, THADA, MTA3 et STS-1 a été évalué par RT-PCR quantitative et aucune
dérégulation n’est apparue.
Puis, nous nous sommes intéressés à 3 microARNs situés au niveau du point de
cassure sur le chromosome 11. Par RT-PCR quantitative, nous avons observé la surexpression
de l’un d’entre eux : hsa-mir-125b (x 10 à x 90 chez les patients porteurs de la t(2;11) par
rapport à 6 autres cas de LAM ou de myélodysplasies sans réarrangement t(2;11) et à 3
moelles osseuses saines).
Cependant, miR-125b mature est transcrit à partir de deux loci dont un situé sur le
chromosome 11 qui correspond à hsa-mir-125b-1 et l’autre sur le chromosome 21
correspondant à hsa-miR-125b-2. La technique de RT-PCR quantitative utilisée ne permet pas
de discriminer entre les deux précurseurs, c’est pourquoi nous avons effectué des RT-PCR
quantitative correspondant aux séquences EST situées de part et d’autre du microARN hsamir-125b-1 en supposant qu’il s’agissait du pri-microARN correspondant. Ces expériences
nous ont permis de constater que le microARN hsa-mir-125b-1 n’est pas transcrit dans les
moelles osseuses saines et dans les LAM et myélodysplasies sans réarrangement t(2;11). En
revanche il est fortement exprimé dans les 6 cas de t(2;11) testées.
Afin de mieux comprendre les conséquences de la surexpression de miR-125b dans
ces myélodysplasies et leucémies aiguës myéloïdes, nous avons émis l’hypothèse que ce
microARN jouait un rôle dans le blocage de différenciation observé dans ces pathologies.
Afin de vérifier cette hypothèse, nous avons utilisé les lignées NB4 et HL-60 (lignée
myéloblastique) qui nous ont permis d’établir un modèle de différenciation in vitro. En effet,
le traitement au DMSO pendant 5 jours de HL-60 conduit à une différenciation monocytaire
et le traitement à l’acide rétinoïque de NB4 induit une différenciation granulocytaire. Nous
avons transfecté ces lignées avec le microARN miR-125b mature ou un microARN contrôle,
puis nous les avons traité pendant 5 jours soit avec le DMSO, soit avec l’acide rétinoïque et
nous avons évalué leur niveau de différenciation par différentes approches.
94
Résultats expérimentaux
Pour la lignée HL-60, l’observation morphologique après coloration au MayGrunwald-Giemsa révèle un blocage de différenciation en présence de miR-125b par rapport
au miR contrôle après 5 jours de traitement. Par FACS (Fluorescence-activated cell sorting),
la présence du marqueur membranaire monocytaire CD14 est significativement diminuée en
présence du miR-125b : 72% des cellules sont CD14+ avec le miR-contrôle alors que
seulement 24% des cellules avec miR-125b sont CD14+. Enfin, l’activité enzymatique NSE
(non specific esterase), spécifique de la lignée monocytaire, est détectée dans 26% des
cellules avec le miR-contrôle alors que seulement 3% des cellules sont positives en présence
de miR-125b.
Pour la lignée NB4, l’observation morphologique après marquage au May-GrunwaldGiemsa révèle un blocage de différenciation granulocytaire en présence de miR-125b par
rapport au miR contrôle. En FACS, nous avons étudié la présence des marqueurs
membranaires CD11b (lignée myéloïde) et CD15 (lignée granulocytaire). Dans les cellules
NB4 transfectées avec le miR-contrôle et traitées à l’acide rétinoïque seulement 7% des
cellules sont encore double négatives pour CD11b et CD15, alors que 26% des cellules le sont
avec miR-125b. Enfin, le test NBT (Nitroblue tetrazolium) caractéristique de la lignée
granulocytaire est positif dans 95% des cellules avec le miR-contrôle contre 39% des cellules
avec miR-125b.
Nous avons donc démontré que la translocation t(2;11)(p21;q23) conduit à la
surexpression du microARN miR-125b dans des leucémies aiguës myéloblastiques et des
myélodysplasies. Cette surexpression entraine un blocage de différenciation monocytaire et
granulocytaire in vitro.
95
Résultats expérimentaux
96
Myeloid cell differentiation arrest by miR-125b-1 in myelodysplasic syndrome and acute
myeloid leukemia with the t(2;11)(p21;q23) translocation
Marina Bousquet1, Cathy Quelen1§, Roberto Rosati2§, Véronique Mansat-De Mas1,3,4 , Roberta
La Starza2, Christian Bastard5, Eric Lippert6, Pascaline Talmant7, Marina Lafage-Pochitaloff8,
Dominique Leroux9, Carine Gervais10, Franck Viguié11, Jean-Luc Lai12, Christine Terre13,
Berna Beverlo14, Costantina Sambani15 , Anne Hagemeijer16, Peter Marynen16, Georges
Delsol1,3,4, Nicole Dastugue1,4, Cristina Mecucci2 & Pierre Brousset1,3,4
From 1INSERM, U563, CPTP, Toulouse, France, 2Cytogenetic and Molecular Genetic Unit,
Division of Hematology, IBiT Foundation, University of Perugia, Perugia, Italy, 3Université
Paul Sabatier, Toulouse, France and
4
Département de Pathologie et d’Hématologie
Biologique, CHU Purpan 31059 Toulouse, Cedex, France. 5Département de Génétique,
Centre Henri Becquerel, 76038 Rouen, France. 6Laboratoire d’Hématologie-Cytogénétique,
Hôpital Haut-Lévêque, 33604 Pessac, France. 7Laboratoire de Cytogénétique Hématologique,
Hôtel Dieu, 44035 Nantes, France. 8Laboratoire de Cytogénétique Hématologique, CHU La
Timone, 13005 Marseille, France. 9Laboratoire d’Hématologie Cellulaire et moléculaire, site
EFS-CHU,
38043
Grenoble,
10
France.
Laboratoire
d’Hématologie
Cellulaire
et
Cytogénétique, CHU Haute-Pierre, 67098 Strasbourg, France. 11Laboratoire de Cytogénétique
et d’Hématologie biologique, Hôtel Dieu, 75181 Paris, France.
Médicale, CHU, 59037 Lille, France.
13
15
Laboratoire de Génétique
Laboratoire de Cytogénétique et Transfusion
sanguine, BP122, 78150 Le-Chesnay, France.
MC, Rotterdam, The Netherlands.
12
14
Department of Clinical Genetics, Erasmus
Laboratory of Cytogenetics, NSCR « Demokritos »,
Athens, Greece. 16Department of Human Genetics and VIB, KUL Leuven, Belgium.
§ CQ and RR equally contributed to this work
Running title: Mir-125b and myeloid cell transformation, Total character counts: 17276
1
Abbreviations: FISH, fluorescent in situ hybridization; MDS, myelodysplastic syndromes ;
AML, acute myeloid leukemia; LDI-PCR, long distance inverse PCR
Correspondence to: Pierre Brousset, MD, PhD, Department of Pathology, CHU Purpan,
Place Baylac, 31059 Toulouse Cedex, France; Phone: +33561772255; Fax : +33561777603;
E-mail: brousset.p@chu-toulouse
2
Abstract
Most chromosomal translocations in myelodysplastic syndromes (MDS) and acute myeloid
leukemia (AML) involve oncogenes which are either up-regulated or form part of new
chimeric genes. The t(2;11)(p21;q23) translocation has been cloned in 19 cases of MDS and
AML. In addition to this, we have shown that this translocation is responsible for a strong upregulation of miR-125b (6 to 90 fold). In vitro experiments revealed that miR-125b was able
to block monocytic and granulocytic differentiation of leukemic cells and primary CD34+
human blasts. Therefore, miR-125b up-regulation represents a new mechanism of myeloid
cell transformation and myeloid neoplasms carrying the t(2;11) translocation define a new
clinico-pathological entity.
3
Introduction
MicroRNAs belong to a class of small non-coding RNAs of approximately 21 nucleotides (nt)
which control the expression of many genes (1, 2). MicroRNAs are preferentially transcribed
by RNA polymerase II and can be derived from individual microRNA genes, from introns of
protein-coding genes, or from polycistronic transcripts. They are first transcribed as primicroRNAs which correspond to capped and polyadenylated transcripts of approximately
1000 nt. Pri-microRNAs are processed in the nucleus by the RNase Drosha into 70–80 nt,
hairpin-shaped precursors, called pre-MicroRNAs (1, 2). They are then exported in the
cytoplasm by exportin5, cleaved into mature MicroRNAs (21 nt) by the RNase III
endonuclease Dicer and incorporated in the RNA-induced silencing complex (RISC) (1, 2). If
the sequence alignment is perfect, the duplex microRNA:mRNA leads to degradation of the
mRNA. If the alignment is incomplete, translation of the target mRNA is inhibited but its
stability is not affected (1).
As microRNAs are involved in the regulation of many genes, they are suggested to control
fundamental processes, such as differentiation, proliferation and apoptosis. The disruption of
their expression is now associated with several human diseases, including cancers (3-6). More
than half of microRNAs are located at fragile sites and genomic regions implicated in cancer
(7). A few reports have described chromosomal translocations that involve microRNAs (7, 8).
The t(8;17)(q24;q22) translocation fuses miR-142 to the c-MYC oncogene and leads to
overexpression of c-MYC in acute prolymphocytic leukemia (8, 9). Recent studies have
shown that let-7 multiple target sites were located on the 3’UTR of HMGA2 (10). This is an
example of suppression of an oncogene by a tumor-suppressive microRNA (10). One
mechanism of oncogene activation is the occurrence of chromosomal translocations that
eliminate the oncogene's 3'UTR with the let-7 target sites. This impairs the repression by let-7
4
and leads to overexpression of HMGA2 (10). To the best of our knowledge, there is no report
mentioning chromosomal translocations leading to up-regulation of microRNAs in
myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML).
Chromosomal translocations are frequent in MDS and AML and to date only rare
abnormalities remain uncharacterized. Among them, the t(2;11)(p21;q23) chromosomal
translocation is a rare event, although regularly reported (http://atlasgeneticsoncology.org),
and specifically observed in patients with MDS and AML. In some cases, the translocation is
isolated, suggesting that it could be the cause of deregulation of genes particularly relevant in
myeloid cell transformation. Thus, we collected a series of 19 cases of AML or MDS carrying
the t(2;11)(p21;q23) translocation. This translocation entailed an elevated expression of the
microRNA miR-125b-1. In vitro transfections of miR-125b blocked the differentiation of
leukemic cell lines upon chemical treatment. This property may account for the differentiation
blockage observed in leukemic cells in vivo.
Results and Discussion
The t(2;11)(p21;q23) chromosomal translocation is a clinico-pathological entity
The t(2;11)(p21;q23) chromosomal translocation was found in 19 patients with acute myeloid
leukemia (AML) (n=10) or myelodysplastic syndromes (MDS) (n=9) (Fig. 1B and
supplemental Table S1). The median age of patients was 60 years. The MDS were classified
as refractory cytopenia with multilineage dysplasia (RCMD), refractory cytopenia with
multilineage dysplasia with ring sideroblasts (RCMD-RS) and refractory anemia with excess
blasts (RAEB). The AMLs were classified in AML with multilineage dysplasia in 5 patients
or in AML evolving from myelodysplasia in 3 others. In 2 patients with AML,
myelodysplastic signs could not be assessed. We can infer from these morphologic data that
AMLs with t(2;11) were acute phases of MDS in most patients.
5
The t(2;11) translocation was observed as a single abnormality in 5 patients and
associated with other changes in 14. Since the t(2;11) was found to be the only change and
because it was never observed as a secondary change, we can infer that this translocation was
the primary change in all karyotypes. In two patients, the normal chromosome 11 was lost and
the derivative (11) was duplicated, which reinforces the critical role of chromosome 11 in the
translocation. The secondary abnormalities associated with the t(2;11) translocation were the
most frequent changes reported in myelodysplastic syndromes : deletion of the long arm of
chromosome 5, del(5q) in 8 patients and chromosome 7 abnormalities in 4 others, either
complete monosomy 7 or partial deletion of the long arm, -7/del(7q). Both del(5q) and -7
were found in one patient. There was no correlation between morphologic and cytogenetic
features since the isolated t(2;11) was found both in AML and in MDS, and since the
complexity of karyotypes was similar in both hemopathies. Furthermore, in all patients
diagnosed either as AML or MDS, the t(2;11) translocation was present in major clones
whereas normal metaphases were either absent or present in minor cell populations suggesting
that the t(2;11) conferred a high proliferative advantage and was present in most dividing
bone marrow cells. Both morphologic and cytogenetic data suggest that the t(2;11)
translocation characterizes a single genetic entity with the phenotype either of MDS or AML.
The breakpoints on chromosomes 2 and 11 cloned by FISH, long distance PCR and long
distance inverse-PCR do not involve candidate genes
Material for fluorescent in situ hybridization (FISH) was available in all cases whereas
molecular techniques were possible in only 6 cases. MLL, located on 11q23, was not involved
in the t(2;11) translocation in this type of pathology. By FISH we showed that the breakpoint
on chromosome 11 was located downstream from this gene (data not shown). In order to
determine the genes involved in this translocation, we progressively reduced the breakpoint
regions on the two pathological chromosomes. The smallest interval was 10 megabases (Mb)
6
on chromosome 11. By FISH, using bacterial artificial chromosome (BAC) probes, we
showed that the breakpoint occurred in the same chromosomal regions in all patients (n=14)
(Fig. 1A and supplemental Table S2). The BAC probe RP11-382J20 mapping on
chromosome 11 gave a split signal on both chromosomes, meaning that the breakpoint was
within this area (on an interval of approximately 150kb) (Fig. 1C and supplemental Table S2).
To reduce this interval, we used fosmids (40kb) which enabled us to shorten the breakpoint
region on chromosome 11 to 40kb (Fig. 1D and supplemental Table S2). The same strategy
was adopted for chromosome 2 and allowed us to define an interval of 300kb (supplemental
Table S2 and supplemental Fig. S1). Unexpectedly, no known genes were shown to map to
these regions. By long distance inverse-PCR (LDI-PCR) and long distance PCR (LD-PCR),
we found the exact breakpoints for four patients (P6, P12, P17, P18) (Fig. 1A, supplemental
Fig. S1 and supplemental Fig. S2).
MiR-125b-1 is overexpressed in patients with the t(2;11) translocation
Then, we tested by quantitative RT-PCR the status of genes/expressed sequence tag
(ESTs) located around the breakpoint region (THADA, STS-1, BRCC2 and MTA3) that could
be deregulated in these pathologies, but we did not observe significant modifications of their
expression (data not shown). We focused our attention on the 3 microRNAs (miR-125b-1, let7a-2, miR-100) located near the breakpoint area on chromosome 11 (Fig. 1A). By quantitative
RT-PCR, we compared their level of expression in patients with the t(2;11) translocation to 6
patients with MDS and 5 patients with AML without the t(2;11). We also compared the
results with 3 bone marrow samples from healthy individuals. Among the 19 patients, mRNA
was available for 6 MDS patients (P11, P12, P16, P17, P18, P19) and for 5 AML patients (P3,
P7, P8, P9, P10). These experiments showed an elevated expression of the miR-125b (from 6
to 90 fold) in patients with the translocation compared to healthy individuals or individuals
with MDS and AML lacking the t(2;11)(p21;q23) translocation (Fig. 2A and 2B). However,
7
the production of the mature miR-125b depends on two loci located on chromosomes 11q23
and 21q21, and the RQ-PCR technique used did not allow discrimination between them. This
prompted us to determine which could be the pri-microRNA of miR-125b-1. Figure 1A
indicates that many mRNAs could be at the origin of miR-125b-1. RQ-PCR confirmed that
mature miR-125b was transcribed from chromosome 11 (miR-125b-1 locus) since a strong
expression of the mRNA AK123947 located on chromosome 11 was observed in patients with
the translocation compared with control cases (Fig. 2C and 2D).
MiR-125b overexpression significantly affects blasts differentiation
The
mechanisms
accounting
for
miR-125b-1
up-regulation
through
the
t(2;11)(p21;q23) translocation remain to be elucidated. However, such a high level of
expression implies that miR-125b-1 could play a pivotal role in the pathogenesis of subsets of
MDS and AML. Of note, in addition to the t(2;11) translocation, 10 cases also had a deletion
of the 5q31 region. However, since there were some cases (n=5) with isolated t(2;11), we
suspected that this translocation was sufficient to interfere with the differentiation of myeloid
cells. To address this question, we tested whether, in transfection experiments, miR-125b was
able to block the differentiation of HL60 and NB4 leukemic cells upon chemical treatment.
The experimental conditions allowed us to get a predominant maturation of HL60 into
monocytic cells (after DMSO treatment) whereas NB4 cells treated with retinoic acid (RA)
underwent characteristic granulocytic differentiation. After transient transfections, miR-125b
significantly prevented the differentiation towards both lineages (Fig. 3 and 4). Regarding
monocytic differentiation, the arrest of maturation was shown by both morphology (Fig. 3A,
3B and 3C) and reduced expression of CD14 in HL60 cells (Fig. 3D, 3E and 3F). These
results were corroborated by those of the non specific esterase (NSE) staining (Fig. 3G). Of
note, it seemed that the blockage occurred between the expression of CD11b and CD14, i.e.,
in late stages of monocytic differentiation. As far as the granulocytic differentiation was
8
concerned, the acquisition of CD11b was clearly affected by miR-125b transfection in NB4
cells upon RA treatment (Fig. 4D, 4E and 4F). The maturation blockage was confirmed by
morphologic analysis (Fig. 4A, 4B and 4C) and nitroblue tetrazolium (NBT) staining (Fig.
4G).
MiR-125b overexpression affects CD34+ primary blasts differentiation
Several experimental conditions were used to transfect pools (106 cells) of human
CD34+ primary blasts (4 experiments). The most significant effect was seen in transient
transfections as described for leukemic cells (see above). Taking into account the criteria
applied to myeloid cells in vitro, the results obtained with primary blasts revealed a blockage
of differentiation particularly obvious with regard to morphological features. Roughly, we got
half of differentiated cells upon miR-125b transfection compared to controls (Fig. 5). This
was evaluated 8 days after induction of differentiation (upon GM-CSF treatment inducing
both granulocytic and monocytic differentiation). Regarding the FACS results, in all
experiments, there was a trend towards a delay in the acquisition of CD11b (variations of 510%, data not shown) but the results did not exactly fit with the morphological features as
seen for leukemic cells. This clearly suggests that the effect of miR-125b is greatly dependent
on the stage and the pathway of differentiation of targeted cells. As seen in HL-60 cells (with
monocytic differentiation), miR-125b affected less significantly CD11b expression than in
NB4 cells (upon granulocytic maturation).
Among the candidate microRNAs located at fragile sites, in particular at 11q23, miR125b-1 has been already reported but its direct implication still remained hypothetical (7). A
sporadic case of B acute lymphoblastic leukemia with a chromosomal translocation that
rearranged miR-125b-1 with the IGH locus was reported, but no quantitative experiments
were performed to determine whether this microRNA was deregulated (11). MiR125-b is
9
critical in different processes of cell proliferation and differentiation but most of the
knowledge about its functions has been obtained from studies on its putative homolog lin-4 in
Caenorhaditis elegans (12). In particular, mutations in lin-4 are associated with
developmental defects (10, 12, 13). The potential targets of miR-125b are listed in
supplemental data (supplemental Table S4). Since this miR has not been extensively studied,
descriptions of target genes involved in hematopoietic differentiation are seldom. We used a
bioinformatic approach based on the combination of the 4 main softwares available to date
(TargetScan, RNAhybrid, PicTar and miRanda softwares). Among the list of putative targets
of miR-125b, MLF2 (myelodysplasia/myeloid leukemia factor 2) and MCL1 (myeloid cell
leukemia 1) look promising.
The role of several microRNA sets in the molecular mechanisms that control
myelomonocytic cell proliferation and differentiation has been documented (5, 14-18). In a
very recent report (15), the authors demonstrated a strong repression of the myelopoiesis
regulator miR-223 by the AML1/ETO chimeric protein in AML. In the latter study, the
molecular event was an epigenetic silencing of that microRNA. It is noteworthy that in
normal conditions miR-223 promotes myeloid cell differentiation (15, 16). In the cases with
the t(2;11) translocation, there is an up-regulation of miR-125b which is directly linked to the
chromosomal changes. In addition, miR-125b acts in an opposite direction by blocking the
process of differentiation. This is a novel and so far unknown function for miR-125b.
In the study by Garzon et al, 60 untreated AML patients were tested for microRNA
transcription profiles (19). A small subset of microRNAs correlated with survival and some of
them were associated with cytogenetic and molecular abnormalities (19). Eight microRNAs
were up-regulated and 14 down-regulated in cases with 11q23 balanced translocations.
However, these profiles corresponded to cases with t(6;11) or t(9;11) translocations, usually
involving MLL gene. The fact that in the latter study (19), miR-125b was not identified as a
10
target, strongly suggests that the up-regulation observed in our patients is specific to the
t(2;11) translocation. This conclusion is reinforced by the very high level of expression (6 to
90 fold) of miR-125b-1 in tumor cells carrying the t(2;11) translocation. To strengthen the
hypothesis that miR-125b is a key player in myeloid cell disorders, we retrieved cases with
chromosomal abnormalities involving 21q21-22 (the region containing miR-125b-2).
Interestingly, in one patient with acute myeloid leukemia, we observed that miR-125b-2was
strongly up-regulated (x450)(supplemental Fig. S3).
We report herein the first chromosomal translocation up-regulating a microRNA in
MDS and AML. The targeted microRNA miR-125b is capable of blocking the
myelomonocytic differentiation of cell lines in vitro, a previously unknown function.
Therefore, miR-125b up-regulation represents another mechanism of myeloid cell
transformation which could be used as a diagnostic marker and therapeutic target in subsets of
MDS and AML.
11
Materials and Methods
Fluorescent in situ Hybridization:
BAC and fosmid clones were obtained from the Welcome Trust Sanger Institute
(http://www.sanger.ac.uk). DNA was labeled with biotin-16-dUTP or digoxigenin-11-dUTP
(Roche), using a nick-translation kit (Amersham Biosciences) according to the manufacturer’s
instructions.
Long distance inverse PCR:
DNA was digested with PstI or ApaI and purified by standard methods. The DNA was
diluted to a concentration of 1 ng/µl and incubated at 14°C overnight in the presence of 1 unit
of T4 DNA ligase. The self-ligated circular DNA was used as template in PCR experiments
using the BD Advantage 2 PCR enzyme system (BD Biosciences) and primers listed in Table
S2. Nucleotide sequencing of PCR products was performed with the ABI Prism Dye
Terminator kit (Perkin-Elmer, Applied Biosystem).
Quantitative RT-PCR on microRNAs:
Reverse transcription was performed for each microRNA using the TaqMan®
MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s
instructions. Quantitative PCR was performed on an ABI7300 (Applied Biosystems) using
TaqMan® MicroRNA Assays (Applied Biosystems). The presented data correspond to the
mean of 2-∆∆Ct from three independent reactions, normalized to the RNU43 reference gene.
12
Quantitative RT-PCR on mRNAs:
cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen) according to
the manufacturer’s instructions. Quantitative PCR was performed on an ABI7300 (Applied
Biosystems) using qPCR MasterMix Plus for SYBR green (Eurogentec). AKf (5'agctcaacggaggattgtgcc-3') and AKr (5'-tcagtctttgtccttgcactgg-3') primers were used to amplify
the AK123947 cDNA. The presented data correspond to the mean of 2-∆∆Ct from three
independent reactions, normalized to the MLN51 and ACTIN reference genes.
Cell lines and treatments
The HL60 and NB4 cell lines were cultured respectively in IMDM medium (Gibco)
supplemented with 20% fetal bovine serum and in RPMI-1640 medium (Gibco) supplemented
with 10% of fetal bovine serum, -glutamine, penicillin and streptomycin.
Transient transfections were performed on 3x106 HL60 and NB4 cells with 22.5 µl of PremiRTM miRNA Precursor-miR-125b (50 µM), Pre-miRTM miRNA Precursor-Negative control
#1 (50 µM) (Applied Biosystems) or H2O by electroporation at 950 µF and 280 V. After 24h,
HL60 and NB4 cells were differentiated into monocytes by treatment with dimethyl sulfoxide
(DMSO, 1.25%, Sigma) and into granulocytes with retinoic acid (RA, 1 µM, Sigma)
respectively, for 5 days. We observed that in HL60 and NB4 cell lines miR-125b was neither
spontaneously up-regulated nor modulated during differentiation (data not shown).
CD34+ primary blast (StemCell Technologies) were cultured in IMDM medium
(Gibco) supplemented with 10% fetal bovine serum, penicillin, streptomycin, SCF (50ng/ml),
FLT-3 Ligand (50ng/ml), IL-3 (10ng/ml) and GM-CSF (50ng/ml). Transient transfections
were performed on 106 cells, after 5 days of differentiation, with 7,25 of Pre-miRTM miRNA
Precursor-miR-125b (50 µM) or Pre-miRTM miRNA Precursor-Negative control #1 (50 µM)
13
(Applied Biosystems) by electroporation using the Human CD34 Cell Nucleofector Kit
(Amaxa biosystems).
Evaluation of myeloid differentiation
Monocytic differentiation was evaluated by cell morphology with May-GrunwaldGiemsa-stained cytocentrifuge slides, non specific esterase (NSE) staining as described (20)
and expression of CD11b and CD14. Granulocytic differentiation was evaluated by cell
morphology with May-Grunwald-Giemsa-stained cytocentrifuge slides, nitroblue tetrazolium
(NBT) reduction activity (21) and expression of CD11b and CD15. CD34+ primary blast
differentiation was evaluated by cell morphology with May-Grunwald-Giemsa-stained
cytocentrifuge slides and expression of CD11b (FACS). Tree hundred cells were counted in
each reaction (NSE, NBT and morphology). For flow cytometry staining, the following antihuman monoclonal antibodies were used: CD11b-PE-Cy7 (1/100, BD Pharmingen), CD14PE-Cy5 (1/50, Immunotech), CD15-FITC (1/30, BD Pharmingen). Flow cytometry analysis
was performed using an LSRII flow cytometer (BD Biosciences) and data were analyzed with
the BD FACSDiva software (BD Biosciences). A minimum of 10,000 events were collected
for each sample.
Statistical analysis
For RQ-PCR experiments, the different groups were compared by a Kruskal-Wallis test.
Significance level was P<0.05.
Online supplemental material
In Table S1, clinical data and complete karyotypes of the 19 patients are listed. In
Table S2, results of FISH in all patients are shown. In Table S3, primers used in LDI-PCR
14
experiments are listed. In Table S4, putative targets of miR-125b are listed. Fig. S1 describes
breakpoint regions on chromosome 2 and shows FISH experiments on chromosome 2. Fig. S2
shows chromatograms of the breakpoint regions in four patients obtained by LDI-PCR or LDPCR. Fig. S3 shows an up-regulation of miR-125b in a case of AML with amplification at
21q.
.
15
Acknowledgments
We thank the “plateau technique de cytométrie en flux” of IFR30 (Dr Fatima L'Faqihi-Olive),
Dr Jean-Jacques Fournié, Inserm U563 for providing antibodies. We thank Jason Iacovoni
and Cécile Desjobert for bioinformatics researches and analysis of putative target genes. We
thank Eric Delabesse and Cyril Broccardo for their fruitful comments on this work. Special
thanks to Pr Christine Chomienne, St Louis Hospital Paris, for her comments and for
providing us with NBT and Kelly Thornber for reading and correcting the manuscript. This
work was supported by grants from l’Institut National du Cancer (INCa), France, l’ARC
contrat N° 3705, La ligue nationale contre le Cancer (comité du Gers), la Fondation pour la
Recherche Médicale (FRM) and Cancéropole Grand Sud-Ouest.
The authors have no conflicting financial interests.
16
References
1.
Bartel, D.P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116:281-297.
2.
Esquela-Kerscher, A., and F.J. Slack. 2006. Oncomirs - microRNAs with a role in
cancer. Nature reviews 6:259-269.
3.
Calin, G.A., and C.M. Croce. 2006. MicroRNA signatures in human cancers. Nature
reviews 6:857-866.
4.
Calin, G.A., C.G. Liu, M. Ferracin, T. Hyslop, R. Spizzo, C. Sevignani, M. Fabbri, A.
Cimmino, E.J. Lee, S.E. Wojcik, M. Shimizu, E. Tili, S. Rossi, C. Taccioli, F.
Pichiorri, X. Liu, S. Zupo, V. Herlea, L. Gramantieri, G. Lanza, H. Alder, L. Rassenti,
S. Volinia, T.D. Schmittgen, T.J. Kipps, M. Negrini, and C.M. Croce. 2007.
Ultraconserved regions encoding ncRNAs are altered in human leukemias and
carcinomas. Cancer cell 12:215-229.
5.
Kluiver, J., B.J. Kroesen, S. Poppema, and A. van den Berg. 2006. The role of
microRNAs in normal hematopoiesis and hematopoietic malignancies. Leukemia
20:1931-1936.
6.
Zhang, L., J. Huang, N. Yang, J. Greshock, M.S. Megraw, A. Giannakakis, S. Liang,
T.L. Naylor, A. Barchetti, M.R. Ward, G. Yao, A. Medina, A. O'Brien-Jenkins, D.
Katsaros, A. Hatzigeorgiou, P.A. Gimotty, B.L. Weber, and G. Coukos. 2006.
microRNAs exhibit high frequency genomic alterations in human cancer. Proceedings
of the National Academy of Sciences of the United States of America 103:9136-9141.
7.
Calin, G.A., C. Sevignani, C.D. Dumitru, T. Hyslop, E. Noch, S. Yendamuri, M.
Shimizu, S. Rattan, F. Bullrich, M. Negrini, and C.M. Croce. 2004. Human
microRNA genes are frequently located at fragile sites and genomic regions involved
17
in cancers. Proceedings of the National Academy of Sciences of the United States of
America 101:2999-3004.
8.
Calin, G.A., and C.M. Croce. 2007. Chromosomal rearrangements and microRNAs: a
new cancer link with clinical implications. The Journal of clinical investigation
117:2059-2066.
9.
Gauwerky, C.E., K. Huebner, M. Isobe, P.C. Nowell, and C.M. Croce. 1989.
Activation of MYC in a masked t(8;17) translocation results in an aggressive B-cell
leukemia. Proceedings of the National Academy of Sciences of the United States of
America 86:8867-8871.
10.
Lee, Y.S., and A. Dutta. 2007. The tumor suppressor microRNA let-7 represses the
HMGA2 oncogene. Genes & development 21:1025-1030.
11.
Sonoki, T., E. Iwanaga, H. Mitsuya, and N. Asou. 2005. Insertion of microRNA-125b1, a human homologue of lin-4, into a rearranged immunoglobulin heavy chain gene
locus in a patient with precursor B-cell acute lymphoblastic leukemia. Leukemia
19:2009-2010.
12.
Parry, D.H., J. Xu, and G. Ruvkun. 2007. A whole-genome RNAi Screen for C.
elegans miRNA pathway genes. Curr Biol 17:2013-2022.
13.
Lee, Y.S., H.K. Kim, S. Chung, K.S. Kim, and A. Dutta. 2005. Depletion of human
micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated
cells but not for the down-regulation of putative targets during differentiation. The
Journal of biological chemistry 280:16635-16641.
14.
Chen, C.Z., L. Li, H.F. Lodish, and D.P. Bartel. 2004. MicroRNAs modulate
hematopoietic lineage differentiation. Science (New York, N.Y 303:83-86.
15.
Fazi, F., S. Racanicchi, G. Zardo, L.M. Starnes, M. Mancini, L. Travaglini, D.
Diverio, E. Ammatuna, G. Cimino, F. Lo-Coco, F. Grignani, and C. Nervi. 2007.
18
Epigenetic silencing of the myelopoiesis regulator microRNA-223 by the AML1/ETO
oncoprotein. Cancer cell 12:457-466.
16.
Fazi, F., A. Rosa, A. Fatica, V. Gelmetti, M.L. De Marchis, C. Nervi, and I. Bozzoni.
2005. A minicircuitry comprised of microRNA-223 and transcription factors NFI-A
and C/EBPalpha regulates human granulopoiesis. Cell 123:819-831.
17.
Fontana, L., E. Pelosi, P. Greco, S. Racanicchi, U. Testa, F. Liuzzi, C.M. Croce, E.
Brunetti, F. Grignani, and C. Peschle. 2007. MicroRNAs 17-5p-20a-106a control
monocytopoiesis through AML1 targeting and M-CSF receptor upregulation. Nature
cell biology 9:775-787.
18.
Georgantas, R.W., 3rd, R. Hildreth, S. Morisot, J. Alder, C.G. Liu, S. Heimfeld, G.A.
Calin, C.M. Croce, and C.I. Civin. 2007. CD34+ hematopoietic stem-progenitor cell
microRNA expression and function: a circuit diagram of differentiation control.
Proceedings of the National Academy of Sciences of the United States of America
104:2750-2755.
19.
Garzon, R., S. Volinia, C.G. Liu, C. Fernandez-Cymering, T. Palumbo, F. Pichiorri,
M. Fabbri, K. Coombes, H. Alder, T. Nakamura, N. Flomenberg, G. Marcucci, G.A.
Calin, S.M. Kornblau, H. Kantarjian, C.D. Bloomfield, M. Andreeff, and C.M. Croce.
2008. MicroRNA signatures associated with cytogenetics and prognosis in acute
myeloid leukemia. Blood 111:3183-9
20.
Yam, L.T., C.Y. Li, and W.H. Crosby. 1971. Cytochemical identification of
monocytes and granulocytes. American journal of clinical pathology 55:283-290.
21.
Eppinger, T.M., J. Buck, and U. Hammerling. 1993. Growth control or terminal
differentiation: endogenous production and differential activities of vitamin A
metabolites in HL-60 cells. The Journal of experimental medicine 178:1995-2005.
19
Figure legends
Figure 1: Identification of the breakpoints on chromosome 11.
(A) Mapping of the BAC and fosmid probes on the breakpoint area and positions of the
several mRNAs and microRNAs in this region. Vertical arrows show the exact position of the
breakpoint for 2 patients obtained by long distance inverse-PCR (LDI-PCR). (B) FISH:
chromosome painting of the t(2;11)(p21;q23) translocation in patient P1. Chromosome 2 is
stained in green (biotin-streptavidin-FITC) and chromosome 11 in red (digoxigenin-anti-digRhodamin). (C) FISH with RP11-382J20 (green) as illustrated in Fig. 1A. The second BAC
(red) is RP11-142I2 located at 11q23. Note that RP11-382J20 is split (Patient P1). Of note,
this BAC is split in 16 out of 19 patients (see supplemental Table S1). (D) FISH with fosmid
G248P85412D12 (green) as illustrated in Fig. 1A and RP11-391M15 (red) mapping on
chromosome 2p21 (Patient P12). This fosmid is split in 3 patients (see supplemental Table
S1).
Figure 2: Overexpression of the mature miR-125b and one of its putative pri-microRNA
(AK123947) in patients with the t(2;11)(p21;q23) as shown by RQ-PCR.
(A) Up-regulation of the mature miR-125b in 5 AML patients with the translocation (P3, P7,
P8, P9, P10) compared to controls (5 cases of AML without the t(2;11) and 3 bone marrow
(BM) samples from healthy individuals). P<0.05. (B) Same results obtained in 6 MDS
patients (P11, P12, P16, P17, P18, P19). Controls are 6 MDS patients lacking the t(2;11) and
3 normal bone marrow samples. P<0.05. (C) The putative pri-microRNA AK123947 is also
up-regulated in the AML patients (P3, P7, P8, P9) compared to controls. P<0.05. (D) Same
results in MDS patients (P11, P12, P16, P17, P18). P<0.05.
20
Figure 3: Transient transfection with miR-125b blocks the differentiation of HL60 cells
induced by DMSO
(A)(B)(C) Changes in morphology of May-Grunwald-Giemsa stained cells (day 5):
(A) HL60 cells electroporated with water (without DMSO), (B) HL60 electroporated with the
microRNA negative control (with DMSO), (C) HL60 electroporated with miR-125b (with
DMSO). A representative experiment is shown. (D)(E)(F) Corresponding FACS experiments.
A representative experiment is shown. (G) Non specific esterase staining (NSE). The
presented data correspond to the mean from three independent experiments. Nota bene: the
results obtained with HL60 alone (treated with DMSO) are shown in Fig. 3G but the
morphological and FACS analysis were carried out and gave similar results to those of the
microRNA negative control (data not shown).
Figure 4: Transient transfection with miR-125b blocks the differentiation of NB4 cells
induced by retinoic acid (RA).
(A)(B)(C) Changes in morphology of May-Grunwald-Giemsa stained cells (day 5):
(A) NB4 cells electroporated with water (without RA), (B) NB4 electroporated with the
microRNA negative control (with RA), (C) NB4 electroporated with miR-125b (with RA). A
representative experiment is shown. (D)(E)(F) Corresponding FACS experiments. A
representative experiment is shown. (G) Nitroblue tetrazolium staining (NBT). The presented
data correspond to the mean from three independent experiments. Nota bene: the results
obtained with NB4 alone (treated with RA) are shown in Fig. 4G but the morphological and
FACS analysis were carried out and gave similar results to those of the microRNA negative
control (data not shown).
21
Figure 5: Transient transfection with miR-125b blocks the differentiation of CD34+ primary
cells. Differentiation was evaluated by cell morphology with May-Grunwald-Giemsa-stained
cytocentrifuge slides after 8 day of differentiation induced by IL-3 and GM-CSF treatment.
The number of differentiated cells includes myelocytes, metamyelocytes, neutrophils,
monocytes and macrophages compared with the number of undifferentiated cells (blasts,
myeloblasts and promyelocytes). The presented data correspond to the mean of four
independent experiments.
22
23
24
25
26
27
Supplemental tables and supplemental figures
Supplemental Tables:
Table S1: Clinical data and complete karyotypes of the 19 patients carrying the
t(2;11)(p21;q23) translocation.
Patients Sexe Age
P1
M
53
Diagnosis (WHO)
AML-M1
AML-M4
Karyotypes
46,XY,t(2;11)(p21;q23)[15]
P2
M
72
P3
F
56
P4
M
73
P5
M
57
P6
M
69
P7
M
56
P8
M
74
P9
F
71
P10
M
52
P11
P12
M
M
53
71
AML with multilineage
dysplasia (M0)
AML with multilineage
dysplasia (M4)
AML evolving from a
CMML
AML evolving from a
RAEB
RAEB-1
RAEB-2
P13
M
69
RCMD-RS
P14
M
62
RCMD
46,XY,t(2;11)(p21;q23)[2]/46,idem,del(5)(q23q32)[10]/46,X
Y[1]
P15
M
60
RCMD
46,XY,t(2;11)(p21;q23)[16]
P16
M
54
RAEB-2
P17
F
71
RAEB
P18
F
52
RAEB
P19
M
58
MDS-U
46,XY,t(2;11)(p21;q23)[1]/46,idem,add(7)(q32)[15]
AML with multilineage
dysplasia (M2)
AML evolving from a
MDS
AML with multilineage
dysplasia (M2)
47,XX,t(2;11)(p21;q23),del(5)(q13q31),+21[12]/45,sl,-7,21[7]/ 46,XX[1]
46,XY,t(2;11)(p21;q23)[2]/46,sl,del(5)(q23q34)[6]/46,sdl1,
del(6)(q15q25)[2]
AML with multilineage
dysplasia (M2)
45,XY,t(2;11)(p21;q23),-7,-11,
+der(11)t(2;11)(p21;q23)[20]
/44,idem,-Y[3]
47,XY,t(2;11)(p21;q23),del(5)(q13q32),+mar[11]/46,XY[3]
46,XY,t(2;11)(p21;q23)[16]
46,XY,t(2;11)(p21;q23),del(7)(q21q36),t(18;21)(q21;q22)[1
8]
46,XX,t(2;11)(p21;q23)
46,XY,t(2;11)(p21;q23),del(5)(q21q33),del(7)(q21q35)[2]/4
6,idem,t(4;17)(p11;q11)[18]
46,XY,t(2;11)(p21;q23),del(5)(q21q34)[20]
46,XY,t(2;11)(p21;q23),del(5)(q14q33)[10]
46,XY,t(2;11)(p21;q23)[10]/46,XY,idem,del(5)(q2122q35)[8]/46,XY[2]
46,XY,t(2;11)(p21;q23)[11]/46,idem,
del(5)(q23q32)[13]
46,XX,t(2;11)(p21;q23),del(5)(q14q33)
46,XX,t(2;11)(p21;q23),del(5q)[12]/46,sl,11,+der(11)t(2;11)(p21;q23)[6]/46,XX,t(2;11)(p21;q23),der(
5)del(5q)add(5)(q36),-7,+mar[2]
46,XY,t(2;11)(p21;q23)
WHO: world health organization; AML: acute myeloid leukemia, MDS: Myelodysplastic
syndrome, RA: refractory anemia, RAEB: RA with excess of blasts, CMML: chronic
myelomonocytic leukemia, RCMD: refractory cytopenia with multilineage dysplasia, RCMDRS: refractory cytopenia with multilineage dysplasia with ring sideroblasts, MDS-U:
Myelodysplastic syndrome-unclassified.
28
Table S2: Identification of the breakpoint regions on chromosomes 2 and 11 by FISH with
BAC and fosmid probes.
Patients
FISH on chromosome 11
RP11-382J20
P1
P2
P3
P4
P5
P6
P7
P8
P9
P10
P11
P12
P13
P14
P15
P16
P17
P18
P19
G248P85412D12
Split
Split
Split
Split
Split
Split
Split
Split
Split
FISH on chromosome 2
RP11-391M15
RP11-183F15
Split
Split
Split
Split
Split
chr 11
Split
Split
Split
Split
Split
chr 11
Split
Split
chr 2
chr 11
chr 11
Split
Split
chr 11
Split
Split
chr 2
chr 2
chr 2
chr 2
RP11 are BAC probes and G248P85412D12 is a fosmid. Of note, there is no split of the BAC
RP11-382J20 for patient P16 which can be explained by a deletion. Of interest, FISH revealed
2 distinct breakpoint areas on chromosome 2 (split either within RP11-391M15 or between
RP11-391M15 and RP11-183F15) (See supplemental Figure.1).
Table S3: Primers used in LDI-PCR experiments
PCR Forward Primer
PCR Reverse Primer
Nested Forward Primer
Nested Reverse Primer
PstI digestion
ApaI digestion
5'-agcagccaaaccagcactcaaatc-3'
5'-tagaggttggctagagcatatctca-3'
5'-gaagcacggctgaaggttcgatg-3'
5'-agtggccactctgccttcaggat-3'
5'-attaggaaacagcagagacacccc-3'
5'-gaagcacggctgaaggttcgatg-3'
5'-atgtgtcagtatggctgacacgc-3'
5'-aagctagtgtttgggataccctgc-3'
29
Table S4: Bioinformatic researches of miR-125b target genes using TargetScan, RNAhybrid,
PicTar and miRanda softwares
gene
overlap
symbol
title
10257
targetscan,rnahybrid,pictar,
ABCC4
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
10057
targetscan,rnahybrid,pictar,
ABCC5
171586
targetscan,rnahybrid,pictar,
ABHD3
abhydrolase domain containing 3
57406
targetscan,rnahybrid,pictar,
ABHD6
abhydrolase domain containing 6
80325
targetscan,rnahybrid,pictar,
ABTB1
ankyrin repeat and BTB (POZ) domain containing 1
41
targetscan,rnahybrid,pictar,
ACCN2
amiloride-sensitive cation channel 2, neuronal
9507
targetscan,rnahybrid,pictar,miranda
ADAMTS4
ADAM metallopeptidase with thrombospondin type 1 motif, 4
rnahybrid,pictar,miranda,
ADD2
adducin 2 (beta)
8165
targetscan,rnahybrid,pictar,
AKAP1
A kinase (PRKA) anchor protein 1
290
targetscan,rnahybrid,pictar,
ANPEP
alanyl (membrane) aminopeptidase (aminopeptidase N,
aminopeptidase M, microsomal aminopeptidase, CD13, p150)
anthrax toxin receptor 2
119
118429
targetscan,rnahybrid,pictar,
ANTXR2
63941
targetscan,rnahybrid,pictar,
APBA2BP
79754
targetscan,rnahybrid,pictar,
ASB13
84913
targetscan,rnahybrid,pictar,
ATOH8
atonal homolog 8 (Drosophila)
517
targetscan,rnahybrid,pictar,
ATP5G2
575
targetscan,rnahybrid,pictar,
BAI1
ATP synthase, H+ transporting, mitochondrial F0 complex,
subunit C2 (subunit 9)
brain-specific angiogenesis inhibitor 1
8314
targetscan,rnahybrid,pictar,
BAP1
7862
targetscan,rnahybrid,pictar,
BRPF1
54014
targetscan,rnahybrid,pictar,
BRWD1
bromodomain and WD repeat domain containing 1
26099
targetscan,rnahybrid,pictar,miranda,
C1orf144
chromosome 1 open reading frame 144
55262
targetscan,rnahybrid,pictar,
C7orf43
chromosome 7 open reading frame 43
286343
targetscan,rnahybrid,pictar,
C9orf150
chromosome 9 open reading frame 150
amyloid beta (A4) precursor protein-binding, family A, member
2 binding protein
ankyrin repeat and SOCS box-containing 13
BRCA1 associated protein-1 (ubiquitin carboxy-terminal
hydrolase)
bromodomain and PHD finger containing, 1
55684
targetscan,rnahybrid,pictar,
C9orf86
chromosome 9 open reading frame 86
782
targetscan,rnahybrid,pictar,
CACNB1
calcium channel, voltage-dependent, beta 1 subunit
64793
targetscan,rnahybrid,pictar,
CCDC21
coiled-coil domain containing 21
rnahybrid,pictar,miranda,
CD34
CD34 molecule
56882
947
targetscan,pictar,miranda,
CDC42SE1
CDC42 small effector 1
30850
targetscan,rnahybrid,pictar,
CDR2L
cerebellar degeneration-related protein 2-like
1952
targetscan,rnahybrid,pictar,
CELSR2
57530
targetscan,rnahybrid,pictar,miranda,
CGN
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo
homolog, Drosophila)
cingulin
64708
targetscan,rnahybrid,pictar,
COPS7B
7464
targetscan,rnahybrid,pictar,
CORO2A
10391
COP9 constitutive photomorphogenic homolog subunit 7B
(Arabidopsis)
coronin, actin binding protein, 2A
targetscan,rnahybrid,pictar,
CORO2B
coronin, actin binding protein, 2B
7812
targetscan,rnahybrid,miranda,
CSDE1
cold shock domain containing E1, RNA-binding
1457
targetscan,rnahybrid,pictar,
CSNK2A1
casein kinase 2, alpha 1 polypeptide
256643
targetscan,rnahybrid,pictar,
CXorf23
chromosome X open reading frame 23
9802
targetscan,rnahybrid,pictar,
DAZAP2
DAZ associated protein 2
1639
targetscan,rnahybrid,pictar,miranda,
DCTN1
dynactin 1 (p150, glued homolog, Drosophila)
DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
11325
targetscan,rnahybrid,pictar,
DDX42
129563
targetscan,rnahybrid,pictar,
DIS3L2
DIS3 mitotic control homolog (S. cerevisiae)-like 2
54567
targetscan,rnahybrid,pictar,
DLL4
delta-like 4 (Drosophila)
25822
targetscan,rnahybrid,pictar,
DNAJB5
DnaJ (Hsp40) homolog, subfamily B, member 5
85406
targetscan,rnahybrid,pictar,
DNAJC14
DnaJ (Hsp40) homolog, subfamily C, member 14
10126
targetscan,rnahybrid,pictar,
DNAL4
dynein, axonemal, light chain 4
5977
targetscan,rnahybrid,pictar,
DPF2
D4, zinc and double PHD fingers family 2
30
10570
targetscan,rnahybrid,pictar,
DPYSL4
dihydropyrimidinase-like 4
1848
targetscan,rnahybrid,pictar,
DUSP6
dual specificity phosphatase 6
endothelin 1
1906
targetscan,rnahybrid,pictar,
EDN1
27161
targetscan,rnahybrid,pictar,
EIF2C2
eukaryotic translation initiation factor 2C, 2
1978
targetscan,rnahybrid,pictar,
EIF4EBP1
eukaryotic translation initiation factor 4E binding protein 1
79071
targetscan,rnahybrid,pictar,
ELOVL6
129080
targetscan,rnahybrid,pictar,
EMID1
ELOVL family member 6, elongation of long chain fatty acids
(FEN1/Elo2, SUR4/Elo3-like, yeast)
EMI domain containing 1
9583
targetscan,rnahybrid,pictar,
ENTPD4
ectonucleoside triphosphate diphosphohydrolase 4
2101
targetscan,rnahybrid,pictar,
ESRRA
estrogen-related receptor alpha
2104
targetscan,pictar,miranda,
ESRRG
estrogen-related receptor gamma
55007
targetscan,rnahybrid,pictar,
FAM118A
family with sequence similarity 118, member A
219287
targetscan,rnahybrid,pictar,
FAM123A
family with sequence similarity 123A
64855
targetscan,rnahybrid,pictar,
FAM129B
family with sequence similarity 129, member B
79137
targetscan,rnahybrid,pictar,
FAM134A
family with sequence similarity 134, member A
23344
targetscan,rnahybrid,pictar,
FAM62A
6468
targetscan,rnahybrid,pictar,
FBXW4
family with sequence similarity 62 (C2 domain containing),
member A
F-box and WD repeat domain containing 4
2263
targetscan,rnahybrid,pictar,
FGFR2
2286
targetscan,rnahybrid,pictar,
FKBP2
fibroblast growth factor receptor 2 (bacteria-expressed kinase,
keratinocyte growth factor receptor, craniofacial dysostosis 1,
Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss
syndrome)
FK506 binding protein 2, 13kDa
2307
targetscan,rnahybrid,pictar,
FKHL18
forkhead-like 18 (Drosophila)
401172
targetscan,rnahybrid,pictar,
FLJ33360
FLJ33360 protein
168455
targetscan,rnahybrid,pictar,
FLJ36031
hypothetical protein FLJ36031
153129
targetscan,rnahybrid,pictar,
FLJ90709
hypothetical protein FLJ90709
2319
targetscan,rnahybrid,pictar,
FLOT2
flotillin 2
94234
targetscan,rnahybrid,pictar,
FOXQ1
forkhead box Q1
79623
targetscan,rnahybrid,pictar,miranda,
GALNT14
10634
targetscan,rnahybrid,pictar,
GAS2L1
UDP-N-acetyl-alpha-D-galactosamine:polypeptide
N-acetylgalactosaminyltransferase 14 (GalNAc-T14)
growth arrest-specific 2 like 1
2686
sami,targetscan,rnahybrid,pictar,
GGTL3
gamma-glutamyltransferase-like 3
2697
targetscan,rnahybrid,pictar,
GJA1
gap junction protein, alpha 1, 43kDa
9950
targetscan,rnahybrid,pictar,
GOLGA5
golgi autoantigen, golgin subfamily a, 5
2239
targetscan,rnahybrid,pictar,
GPC4
glypican 4
29841
targetscan,rnahybrid,pictar,miranda,
GRHL1
grainyhead-like 1 (Drosophila)
54676
targetscan,rnahybrid,pictar,
GTPBP2
GTP binding protein 2
10021
targetscan,rnahybrid,pictar,
HCN4
3067
targetscan,rnahybrid,pictar,
HDC
hyperpolarization activated cyclic nucleotide-gated potassium
channel 4
histidine decarboxylase
84641
targetscan,rnahybrid,pictar,
HIATL1
hippocampus abundant transcript-like 1
3097
targetscan,rnahybrid,pictar,
HIVEP2
57594
targetscan,rnahybrid,pictar,
HOMEZ
human immunodeficiency virus type I enhancer binding protein
2
homeobox and leucine zipper encoding
3223
targetscan,rnahybrid,pictar,
HOXC6
homeobox C6
9592
targetscan,rnahybrid,pictar,
IER2
immediate early response 2
51124
targetscan,rnahybrid,pictar,
IER3IP1
immediate early response 3 interacting protein 1
3680
targetscan,rnahybrid,pictar,
ITGA9
integrin, alpha 9
3728
targetscan,rnahybrid,pictar,
JUP
junction plakoglobin
90134
targetscan,rnahybrid,pictar,
KCNH7
targetscan,rnahybrid,pictar,miranda,
KCNS3
54442
targetscan,rnahybrid,pictar,
KCTD5
potassium voltage-gated channel, subfamily H (eag-related),
member 7
potassium voltage-gated channel, delayed-rectifier, subfamily
S, member 3
potassium channel tetramerisation domain containing 5
9798
targetscan,rnahybrid,pictar,
KIAA0174
KIAA0174
57698
targetscan,rnahybrid,pictar,
KIAA1598
KIAA1598
64837
targetscan,rnahybrid,pictar,
KLC2
kinesin light chain 2
3790
31
114294
targetscan,rnahybrid,pictar,
LACTB
lactamase, beta
81606
targetscan,pictar,miranda,
LBH
limb bud and heart development homolog (mouse)
8861
targetscan,rnahybrid,pictar,
LDB1
LIM domain binding 1
431707
targetscan,rnahybrid,pictar,
LHX8
LIM homeobox 8
4012
targetscan,rnahybrid,pictar,
LNPEP
leucyl/cystinyl aminopeptidase
4016
targetscan,rnahybrid,pictar,
LOXL1
lysyl oxidase-like 1
targetscan,rnahybrid,pictar,miranda,
LYPLA2
lysophospholipase II
4074
targetscan,rnahybrid,pictar,
M6PR
mannose-6-phosphate receptor (cation dependent)
11313
8567
targetscan,rnahybrid,pictar,
MADD
MAP-kinase activating death domain
256691
targetscan,rnahybrid,pictar,
MAMDC2
MAM domain containing 2
11253
targetscan,rnahybrid,pictar,
MAN1B1
mannosidase, alpha, class 1B, member 1
4294
targetscan,rnahybrid,pictar,
MAP3K10
mitogen-activated protein kinase kinase kinase 10
4296
targetscan,rnahybrid,pictar,
MAP3K11
mitogen-activated protein kinase kinase kinase 11
1432
targetscan,rnahybrid,pictar,
MAPK14
mitogen-activated protein kinase 14
4139
targetscan,pictar,miranda,
MARK1
MAP/microtubule affinity-regulating kinase 1
5648
targetscan,rnahybrid,pictar,
MASP1
4144
targetscan,rnahybrid,pictar,
MAT2A
mannan-binding lectin serine peptidase 1 (C4/C2 activating
component of Ra-reactive factor)
methionine adenosyltransferase II, alpha
4170
targetscan,pictar,miranda,
MCL1
myeloid cell leukemia sequence 1 (BCL2-related)
51586
targetscan,rnahybrid,pictar,
MED15
mediator complex subunit 15
51072
targetscan,rnahybrid,pictar,miranda,
MEMO1
mediator of cell motility 1
55669
targetscan,rnahybrid,pictar,
MFN1
mitofusin 1
25988
targetscan,rnahybrid,pictar,
MIZF
MBD2-interacting zinc finger
8079
targetscan,rnahybrid,pictar,
MLF2
myeloid leukemia factor 2
4320
targetscan,rnahybrid,pictar,
MMP11
matrix metallopeptidase 11 (stromelysin 3)
4661
targetscan,rnahybrid,pictar,
MYT1
myelin transcription factor 1
4685
targetscan,rnahybrid,pictar,
NCAM2
neural cell adhesion molecule 2
9612
targetscan,rnahybrid,pictar,
NCOR2
nuclear receptor co-repressor 2
4739
targetscan,rnahybrid,pictar,
NEDD9
4741
targetscan,rnahybrid,pictar,
NEFM
neural precursor cell expressed, developmentally downregulated 9
neurofilament, medium polypeptide 150kDa
4758
targetscan,rnahybrid,pictar,
NEU1
sialidase 1 (lysosomal sialidase)
11270
targetscan,rnahybrid,pictar,
NRM
nurim (nuclear envelope membrane protein)
221294
targetscan,rnahybrid,pictar,
NT5DC1
5'-nucleotidase domain containing 1
9253
targetscan,rnahybrid,pictar,
NUMBL
numb homolog (Drosophila)-like
sami,targetscan,rnahybrid,pictar,
NUP210
nucleoporin 210kDa
targetscan,rnahybrid,pictar,
OAZ2
ornithine decarboxylase antizyme 2
targetscan,rnahybrid,pictar,miranda,
OSBPL9
oxysterol binding protein-like 9
targetscan,rnahybrid,pictar,
PABPC1
poly(A) binding protein, cytoplasmic 1
23225
4947
114883
26986
84108
targetscan,rnahybrid,pictar,
PCGF6
polycomb group ring finger 6
9159
targetscan,rnahybrid,pictar,
PCSK7
proprotein convertase subtilisin/kexin type 7
5127
targetscan,rnahybrid,pictar,
PCTK1
PCTAIRE protein kinase 1
58488
targetscan,rnahybrid,pictar,
PCTP
phosphatidylcholine transfer protein
phosphatase and actin regulator 3
116154
targetscan,rnahybrid,pictar,
PHACTR3
1912
targetscan,rnahybrid,pictar,miranda,
PHC2
polyhomeotic homolog 2 (Drosophila)
8929
targetscan,rnahybrid,pictar,
PHOX2B
paired-like homeobox 2b
phytanoyl-CoA 2-hydroxylase interacting protein
9796
targetscan,rnahybrid,pictar,
PHYHIP
55300
targetscan,rnahybrid,pictar,
PI4K2B
phosphatidylinositol 4-kinase type 2 beta
8502
targetscan,rnahybrid,pictar,
PKP4
plakophilin 4
5325
targetscan,rnahybrid,pictar,
PLAGL1
pleiomorphic adenoma gene-like 1
51054
targetscan,rnahybrid,pictar,
PLEKHA9
1263
targetscan,rnahybrid,pictar,
PLK3
pleckstrin homology domain containing, family A
(phosphoinositide
binding specific) member 9
polo-like kinase 3 (Drosophila)
32
5471
targetscan,rnahybrid,pictar,
PPAT
phosphoribosyl pyrophosphate amidotransferase
51400
targetscan,rnahybrid,pictar,
PPME1
protein phosphatase methylesterase 1
5499
targetscan,rnahybrid,pictar,
PPP1CA
protein phosphatase 1, catalytic subunit, alpha isoform
5515
targetscan,rnahybrid,pictar,
PPP2CA
7799
rnahybrid,pictar,miranda,
PRDM2
protein phosphatase 2 (formerly 2A), catalytic subunit, alpha
isoform
PR domain containing 2, with ZNF domain
8575
targetscan,rnahybrid,pictar,
PRKRA
26469
targetscan,rnahybrid,pictar,
PTPN18
5792
targetscan,rnahybrid,pictar,miranda,
PTPRF
protein kinase, interferon-inducible double stranded RNA
dependent activator
protein tyrosine phosphatase, non-receptor type 18 (brainderived)
protein tyrosine phosphatase, receptor type, F
9545
targetscan,rnahybrid,pictar,
RAB3D
RAB3D, member RAS oncogene family
51195
targetscan,rnahybrid,pictar,
RAPGEFL1
Rap guanine nucleotide exchange factor (GEF)-like 1
RAS protein activator like 2
9462
targetscan,rnahybrid,pictar,
RASAL2
221002
targetscan,rnahybrid,pictar,
RASGEF1A
RasGEF domain family, member 1A
221662
targetscan,rnahybrid,pictar,
RBM24
RNA binding motif protein 24
55544
targetscan,rnahybrid,pictar,
RBM38
RNA binding motif protein 38
10179
targetscan,rnahybrid,pictar,
RBM7
RNA binding motif protein 7
5993
targetscan,rnahybrid,pictar,
RFX5
regulatory factor X, 5 (influences HLA class II expression)
8625
targetscan,rnahybrid,pictar,
RFXANK
regulatory factor X-associated ankyrin-containing protein
89941
targetscan,rnahybrid,pictar,
RHOT2
ras homolog gene family, member T2
55298
targetscan,rnahybrid,pictar,
RNF121
ring finger protein 121
9810
targetscan,rnahybrid,pictar,
RNF40
ring finger protein 40
6195
targetscan,rnahybrid,pictar,miranda,
RPS6KA1
ribosomal protein S6 kinase, 90kDa, polypeptide 1
140700
targetscan,rnahybrid,pictar,
SAMD10
sterile alpha motif domain containing 10
6337
targetscan,rnahybrid,pictar,
SCNN1A
sodium channel, nonvoltage-gated 1 alpha
23541
targetscan,rnahybrid,pictar,
SEC14L2
SEC14-like 2 (S. cerevisiae)
10509
targetscan,rnahybrid,pictar,
SEMA4B
54910
targetscan,rnahybrid,pictar,
SEMA4C
10507
targetscan,rnahybrid,pictar,
SEMA4D
10505
rnahybrid,pictar,miranda,
SEMA4F
29946
sami,targetscan,rnahybrid,pictar,
SERTAD3
sema domain, immunoglobulin domain (Ig), transmembrane
domain (TM) and short cytoplasmic domain, (semaphorin) 4B
sema domain, immunoglobulin domain (Ig), transmembrane
domain (TM) and short cytoplasmic domain, (semaphorin) 4C
sema domain, immunoglobulin domain (Ig), transmembrane
domain (TM) and short cytoplasmic domain, (semaphorin) 4D
sema domain, immunoglobulin domain (Ig), transmembrane
domain (TM) and short cytoplasmic domain, (semaphorin) 4F
SERTA domain containing 3
23677
targetscan,rnahybrid,pictar,
SH3BP4
SH3-domain binding protein 4
80851
targetscan,rnahybrid,pictar,
SH3BP5L
SH3-binding domain protein 5-like
51547
targetscan,rnahybrid,pictar,
SIRT7
57030
targetscan,rnahybrid,pictar,
SLC17A7
10999
sami,targetscan,rnahybrid,pictar,
SLC27A4
sirtuin (silent mating type information regulation 2 homolog) 7
(S. cerevisiae)
solute carrier family 17 (sodium-dependent inorganic
phosphate cotransporter), member 7
solute carrier family 27 (fatty acid transporter), member 4
113829
targetscan,rnahybrid,pictar,
SLC35A4
solute carrier family 35, member A4
55334
targetscan,rnahybrid,pictar,
SLC39A9
solute carrier family 39 (zinc transporter), member 9
28232
targetscan,rnahybrid,pictar,
SLCO3A1
solute carrier organic anion transporter family, member 3A1
84189
targetscan,rnahybrid,pictar,
SLITRK6
SLIT and NTRK-like family, member 6
sami,targetscan,rnahybrid,pictar,
SMARCD2
55671
targetscan,rnahybrid,pictar,
SMEK1
SWI/SNF related, matrix associated, actin dependent regulator
of chromatin, subfamily d, member 2
SMEK homolog 1, suppressor of mek1 (Dictyostelium)
6615
targetscan,rnahybrid,pictar,
SNAI1
snail homolog 1 (Drosophila)
6272
targetscan,pictar,miranda,
SORT1
sortilin 1
targetscan,rnahybrid,pictar,
SP7
Sp7 transcription factor
6603
121340
92369
targetscan,rnahybrid,pictar,
SPSB4
splA/ryanodine receptor domain and SOCS box containing 4
7903
targetscan,rnahybrid,pictar,
ST8SIA4
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
6839
targetscan,rnahybrid,pictar,
SUV39H1
suppressor of variegation 3-9 homolog 1 (Drosophila)
84787
sami,targetscan,rnahybrid,pictar,
SUV420H2
suppressor of variegation 4-20 homolog 2 (Drosophila)
84447
targetscan,rnahybrid,pictar,
SYVN1
synovial apoptosis inhibitor 1, synoviolin
33
51616
targetscan,rnahybrid,pictar,
TAF9B
23216
targetscan,rnahybrid,pictar,
TBC1D1
TAF9B RNA polymerase II, TATA box binding protein (TBP)associated factor, 31kDa
tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial
fibroelastosis 2; Barth syndrome)
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
6901
targetscan,rnahybrid,pictar,
TAZ
9496
targetscan,rnahybrid,pictar,
TBX4
T-box 4
6996
targetscan,rnahybrid,pictar,
TDG
thymine-DNA glycosylase
TEA domain family member 2
8463
targetscan,rnahybrid,pictar,
TEAD2
11011
targetscan,rnahybrid,pictar,
TLK2
tousled-like kinase 2
54732
targetscan,rnahybrid,pictar,
TMED9
transmembrane emp24 protein transport domain containing 9
124842
targetscan,rnahybrid,pictar,
TMEM132E
transmembrane protein 132E
153396
targetscan,rnahybrid,pictar,
TMEM161B
transmembrane protein 161B
84141
targetscan,rnahybrid,pictar,miranda,
TMEM166
transmembrane protein 166
64418
targetscan,rnahybrid,pictar,
TMEM168
transmembrane protein 168
79847
targetscan,rnahybrid,pictar,
TMEM180
transmembrane protein 180
targetscan,rnahybrid,pictar,miranda,
TMEM77
transmembrane protein 77
84000
targetscan,rnahybrid,pictar,
TMPRSS13
transmembrane protease, serine 13
7292
targetscan,pictar,miranda,
TNFSF4
51499
targetscan,rnahybrid,pictar,
TRIAP1
tumor necrosis factor (ligand) superfamily, member 4 (taxtranscriptionally activated glycoprotein 1, 34kDa)
TP53 regulated inhibitor of apoptosis 1
28951
128338
targetscan,rnahybrid,pictar,miranda,
TRIB2
tribbles homolog 2 (Drosophila)
283989
targetscan,rnahybrid,pictar,
TSEN54
tRNA splicing endonuclease 54 homolog (S. cerevisiae)
23554
targetscan,rnahybrid,pictar,
TSPAN12
tetraspanin 12
81619
targetscan,rnahybrid,pictar,
TSPAN14
tetraspanin 14
7283
targetscan,rnahybrid,pictar,
TUBG1
tubulin, gamma 1
80019
targetscan,rnahybrid,pictar,
UBTD1
ubiquitin domain containing 1
unc-5 homolog C (C. elegans)
8633
targetscan,rnahybrid,pictar,
UNC5C
23353
targetscan,rnahybrid,pictar,
UNC84A
unc-84 homolog A (C. elegans)
219333
targetscan,rnahybrid,pictar,
USP12
ubiquitin specific peptidase 12
84640
targetscan,rnahybrid,pictar,
USP38
ubiquitin specific peptidase 38
9924
targetscan,rnahybrid,pictar,
USP52
ubiquitin specific peptidase 52
79720
targetscan,rnahybrid,pictar,
VPS37B
vacuolar protein sorting 37 homolog B (S. cerevisiae)
9525
targetscan,rnahybrid,pictar,
VPS4B
vacuolar protein sorting 4 homolog B (S. cerevisiae)
9948
targetscan,rnahybrid,pictar,
WDR1
WD repeat domain 1
55625
targetscan,rnahybrid,pictar,
ZDHHC7
zinc finger, DHHC-type containing 7
53349
sami,targetscan,rnahybrid,pictar,
ZFYVE1
zinc finger, FYVE domain containing 1
23528
targetscan,rnahybrid,pictar,
ZNF281
zinc finger protein 281
25946
targetscan,rnahybrid,pictar,
ZNF385
zinc finger protein 385
51058
targetscan,rnahybrid,pictar,
ZNF691
zinc finger protein 691
7629
targetscan,rnahybrid,pictar,
ZNF76
zinc finger protein 76 (expressed in testis)
34
Supplemental figures
Figure S1: Breakpoint regions on chromosome 2. (A) Mapping of the BAC probes. Vertical
arrows show the exact position of the breakpoint for 4 patients obtained by long distance
inverse-PCR or long distance-PCR (P6, P12, P17, P18). (B) FISH: split between RP11391M15 (red) and RP11-183F15 (green), patient P8. (C) FISH: split of RP11-391M15 (red),
patient P5.
35
Figure S2: Sequence analysis of the breakpoints obtained in four patients (A) patient P10, (B)
patient P6, (C) patient P17 and (D) patient P18 after LDI-PCR or LD-PCR.
36
Figure S3: Overexpression of miR-125b-2 in a case of AML with a 21q amplification.
(Karyoptype:
47,XY,dup(21)(q?),+dup(21)(q?)[16].ish
trp(21)(q11q22)(AML1x3),+trp
(21)(q11q22)(AML1x3)[10] nuc ish amp(AML1x7)[90/100]) (A) RQ-PCR experiments on
miR-125b. Up-regulation of the mature miR-125b (x450) in a patient with AML and
amplification of the AML1 gene region (at 21q where miR-125b-2 is located) compared to
controls (5 cases of AML and 3 bone marrow (BM) samples from healthy individuals).
P<0.05. (B) RQ-PCR experiments on AML1 mRNA. The results show an overexpression of
AML1 mRNA explained by multiples copies of the region (x7). The level of miR-125b-2
expression (x450) is not explained by the latter abnormality but rather by an intrinsic
overexpression.
A
AML: RQ-PCR miR-125b
B
AML: RQ-PCR AML1
15
500
400
2-∆∆ ∆∆Ct
2-∆∆ ∆ Ct
10
300
200
5
100
0
0
x AML1
other AML
healthy BM
x AML1
other AML
healthy BM
Figure S3
37
Discussion et conclusion
CHAPITRE 4 :
DISCUSSION ET CONCLUSION
97
Discussion et conclusion
98
Discussion et conclusion
La translocation t(8;9)(p22;p24) dans les leucémies myéloïdes chroniques
atypiques
A ce jour, 14 cas de translocation t(8;9)(p22;p24) ont été rapportés (Tableau 6).
Comme nous l’avons démontré ce réarrangement conduit à la formation d’une protéine de
fusion PCM1-JAK2 qui conserve les domaines coiled coil de PCM1 et le domaine tyrosine
kinase de JAK2.
Cette translocation a été retrouvée dans différentes pathologies : 5 leucémies
myéloïdes chroniques atypiques, 2 leucémies aiguës myéloblastiques, 2 leucémies chroniques
à éosinophiles, 1 leucémie aiguë lymphoblastique B, 1 syndrome myéloprolifératif atypique
avec dysgranulopoïese, 1 érythroleucémie, 1SMP/SMD et 1 lymphome T (Adelaide et al.,
2006; Murati et al., 2005; Reiter et al., 2005) (Tableau 6). L’identification de la fusion PCM1JAK2 dans des pathologies lymphoïdes et myéloïdes montre qu’il n’y a pas de spécificité de
lignage ce qui est cohérent avec l’idée que les pathologies associées à cette translocation
soient relatifs à une anomalie des cellules souches.
La translocation t(8;9)(p22;p24) est isolée dans 11 cas sur 14 suggérant que ce
réarrangement est l’anomalie primaire. Les anomalies secondaires sont différentes selon les
cas : ins(1;1)(p34;p36p34), del(21)(q21q22) ou del(12)(p13p13).
Il semblerait que cette translocation soit préférentiellement retrouvée chez les hommes
(13 cas sur 14) de plus de 30 ans (30 à 72 ans). La seule exception est le cas d’une enfant de
12 ans atteinte d’érythroleucémie associée à des tumeurs multiples des os.
Les points de cassures au sein des gènes PCM1 et JAK2 sont variables. Les différents
points de cassures au sein de PCM1 permettent tous de conserver la totalité des domaines
coiled coil de PCM1 dans la chimère. Pour JAK2, la totalité des domaines kinase et pseudokinase est conservée, excepté pour le cas C2 où le point de cassure se situe au sein du
domaine pseudo-kinase de JAK2. De plus, le domaine SH2 de JAK2 est totalement (patients
A2 et A3) ou partiellement (patients A4, A5, A6 et B1) conservé selon les cas (Figure 31).
99
Discussion et conclusion
Tableau 6 : Patients porteurs de la translocation t(8;9)(p22;p24) Patients A (Reiter et al., 2005) ,
patients B (Bousquet, 2005), patients C (Murati et al., 2005).
100
Discussion et conclusion
La translocation PCM1-JAK2 est la troisième translocation impliquant le gène JAK2.
Comme nous l’avons vu en introduction, JAK2 est impliqué dans les translocations
t(9;12)(p24;p13) dans les LMC atypiques et LAL et t(9;22)(p24;q11.2) dans un cas de LMC
atypique qui conduisent respectivement aux protéines de fusion TEL-JAK2 et BCR-JAK2.
Chacun des partenaires de JAK2 contient des domaines d’oligomérisation. Des études
fonctionnelles sur la protéine de fusion TEL-JAK2 ont démontré que la chimère est capable
de transformer la lignée lymphoïde B murine Ba/F3 in vitro et d’induire des leucémies aiguës
T dans les souris transgéniques. De plus, la fusion TEL-JAK2 induit une activation
constitutive de la kinase JAK2 ce qui entraine une activation constitutive des voies
JAK/STAT et PI3K/AKT. On peut donc supposer que la chimère PCM1-JAK2 a les mêmes
propriétés oncogéniques que TEL-JAK2. En effet, la protéine PCM1 grâce à ces domaines
coiled coil doit permettre la dimérisation de la chimère, permettant un rapprochement des
domaines kinases de JAK2 et donc une activation constitutive de JAK2 comme dans le
modèle bien connu de la chimère BCR-ABL dans la LMC. Des études fonctionnelles sont à
envisager afin de vérifier cette hypothèse.
Figure 31 :
Localisation des points de
cassures
des
différents
variants PCM1-JAK2
Patients A, B, C, cf Tableau 6.
Patient D, PCM1-RET.
Patients E, ETV6-JAK2.
STYKc, pseudo-kinase JH2 ;
TyrKc, domaine kinase JH1
(d’après Murati A, Leukemia,
2005)
101
Discussion et conclusion
Cependant le partenaire de JAK2 dans ces différentes translocations joue peut-être un
rôle important.
PCM1 code une protéine de 228 kDa qui contient dans sa partie N-terminale de
nombreux domaines coiled coil, domaines d’oligomérisation (Balczon et al., 1994). PCM1 est
une protéine centrosomale, localisée dans des granules cytoplasmiques appelées satellites
centriolaires. Une inactivation de cette protéine conduit à un dysfonctionnement dans
l’assemblage des protéines centrosomale et une désorganisation des microtubules, suggérant
un rôle important dans ces processus ainsi que dans la progression du cycle cellulaire
(Balczon et al., 2002; Dammermann and Merdes, 2002). La région chromosomique contenant
le gène PCM1 est fréquemment délétée dans les cancers. De plus, PCM1 est impliqué dans la
translocation t(8;10)(p22;q11) dans les carcinomes papillaires de la thyroïde (Corvi et al.,
2000). Cette translocation conduit à la formation d’une fusion entre les gènes PCM1 et le
gène RET codant une tyrosine kinase. Dans ces tumeurs, le niveau d’expression de PCM1
sauvage est fortement diminué et sa localisation subcellulaire est altérée.
Une dérégulation de PCM1 résultant de la translocation PCM1-JAK2 pourrait donc
avoir également une répercussion au niveau de l’organisation du centrosome et donc des
conséquences oncogéniques. Cette hypothèse est renforcée par le fait que différents gènes
codant des protéines centrosomales sont impliqués dans les syndromes myéloprolifératifs. En
effet, les gènes CDK5RAP2 (Walz et al., 2006), CEP1 (Yamamoto et al., 2006), FOP
(Popovici et al., 1999), NDE1 (La Starza et al., 2007), NIN (Vizmanos et al., 2004), PDE4DIP
(Wilkinson et al., 2003) et TRIP11 (Abe et al., 1997) codent des protéines centrosomales
impliquées dans différentes translocations et associées aux gènes PDGFRα, FGFR1, FLT3 et
PDGFRβ. L’implication de ces protéines centrosomales dans ces translocations peut
s’expliquer par leur expression ubiquitaire permettant ainsi une transcription permanente des
chimères, mais aussi par la présence des domaines d’oligomérisation induisant une activation
constitutive des tyrosines kinases.
Cependant, comme nous l’avons vu précédemment, la présence de ces protéines
centrosomales peut modifier la localisation normale des tyrosines kinases. En effet, des études
ont permis de démontrer que la protéine de fusion FOP-FGFR1 se localise au niveau du
centrosome (Delaval et al., 2005). Le centrosome est une organelle qui régule la division
cellulaire, la polarité des cellules et la migration. Une activation constitutive de tyrosines
kinases au niveau du centrosome peut donc perturber les fonctions du centrosome et la
102
Discussion et conclusion
régulation du cycle cellulaire. De plus, la tyrosine kinase pourrait phosphoryler directement
son partenaire de fusion et donc modifier sa fonction. Enfin, la présence d’une protéine
centrosomale tronquée dans la protéine chimérique pourrait jouer un rôle de dominant négatif
sur la protéine centrosomale native.
103
Discussion et conclusion
La
translocation
t(7;9)(q21;p13)
dans
les
leucémies
aiguës
lymphoblastiques B
L’étude de cette translocation, nous a permis de mettre en évidence un réarrangement
entre les gènes PAX5 et ELN. La chimère PAX5-ELN agit comme dominant négatif sur la
protéine PAX5 sauvage.
Le rôle crucial de PAX5 dans l’oncogenèse B, suspecté grâce à son identification dans
les translocations t(9;12) PAX5-ETV6 et t(7;9) PAX5-ELN, a été renforcée par une publication
analysant la perte d’hétérozygotie à haute densité dans 192 cas de LAL-B de l’enfant
(Mullighan et al., 2007). Des mutations somatiques de PAX5 ont été retrouvées dans 38,9%
des cas :
• des anomalies de nombre (29,7%)
• des translocations (2%)
• des mutations ponctuelles (7,2%)
Parmi les anomalies de nombre, on distingue les délétions mono-alléliques (53 cas),
bi-alléliques (3 cas) et les amplifications (1 cas). Les délétions peuvent être restreintes au gène
PAX5 (PAX5 seul ou portions de PAX5) (25 cas), toucher PAX5 et les gènes proximaux (7
cas), déléter une large partie 9p dont la partie 3’ de PAX5 (5 cas) ou déléter la totalité du
chromosome 9 ou la totalité de la région 9p (19 cas). Ces anomalies aboutissent soit à une
haploinsuffisance de PAX5, soit à la formation d’allèles hypomorphes ayant perdu le domaine
de liaison à l’ADN ou de transactivation.
Parmi les translocations chromosomiques, la fusion PAX5-ETV6, déjà identifiée, a été
retrouvée chez deux patients. Cette étude a également permis de mettre en évidence deux
nouveaux partenaires de PAX5 : FOXP1 et ZNF521.
104
Discussion et conclusion
Parmi les mutations ponctuelles (Figure 32), la majorité se situe au sein du domaine
de liaison à l’ADN ou du domaine de transactivation de PAX5.
Figure 32 : Mutations ponctuelles de PAX5. Mutations faux sens (flèche) ; Insertion, délétion
(rond) ; changement du cadre de lecture (carré) : Paired box domain : PD ; Octapeptide : O ;
Homéodomaine : H ; Domaine de transactivation : TD-A ; Domaine inhibiteur : I. (Mullighan CG,
Nature, 2007)
L’étude de Mullighan est coll. dénombre 38,9% de mutations PAX5 dans les LAL-B
de l’enfant. Cependant, de nombreuses variations existent entre les LAL-B de l’enfant et de
l’adulte. En effet, on retrouve de façon prédominante (22%) des réarrangements TEL-AML1
dans les LAL-B de l’enfant alors que BCR-ABL est l’anomalie chromosomique la plus
récurrente dans les LAL-B de l’adulte (25%). Cette divergence a conduit notre équipe vers
l’étude des mutations de PAX5 dans les LAL-B de l’adulte afin de vérifier l’incidence et la
valeur pronostique de ces mutations.
Cette étude a été réalisée sur 117 patients (adultes) atteints de LAL-B appartenant au
protocole GRAALL03. Les délétions de PAX5 ont été recherchées par PCR quantitative sur
chacun des exons de PAX5 et les mutations ont été identifiées après séquençage de chaque
exon. Le bilan de ce travail a permis de mettre en évidence des anomalies de nombre dans
31% des cas et des mutations ponctuelles dans 6% des cas. Ces résultats sont similaires à ceux
obtenus par Mullighan et coll. ce qui suggèrent que les mutations de PAX5 sont généralisées à
l’ensemble des LAL-B.
105
Discussion et conclusion
L’ensemble de ces données démontre un rôle central de PAX5 dans les processus
oncogénique B. Cependant les mécanismes transformants associés aux mutations de PAX5
dans les LAL-B ne sont pas clairement identifiés. Il semblerait qu’il existe deux mécanismes
oncogéniques différents liés à ces mutations :
Haploinsuffisance
Les délétions totales ainsi que l’inactivation de PAX5 par mutations ponctuelles ou
délétions partielles, en particulier au niveau du domaine de liaison à l’ADN de PAX5,
correspondent à des situations d’haploinsuffisance. Or, les souris Pax5+/- présentent un
phénotype normal suggérant que l’haploinsuffisance de PAX5 seule n’est pas suffisante pour
induire un phénotype malin. Nous pouvons supposer que ces mutations sont en fait des
anomalies secondaires aggravant le processus malin ou des anomalies primaires favorables au
développement leucémique.
Effet dominant négatif ou facteur de transcription aberrant
Comme nous l’avons démontré pour PAX5-ELN, les formes mutantes peuvent jouer
un rôle de dominant négatif sur PAX5 sauvage, bloquant ainsi la différenciation B. Les
mutations pouvant conduire à un effet dominant négatif sont les translocations
chromosomiques ou les délétions partielles aboutissant à une protéine PAX5 tronquée sans
son domaine de transactivation et les mutations ponctuelles dans le domaine de
transactivation ou au niveau des domaines d’intéraction avec les corépresseurs ou coactivateurs transcriptionnels. Enfin, dans les translocations chromosomiques le rôle du
partenaire de PAX5 n’est pour le moment pas connu. Nous pouvons supposer que les
chimères agissent comme des facteurs de transcription aberrants, régulant anormalement les
gènes cibles de PAX5 ou des partenaires mais aussi de nouvelles cibles.
106
Discussion et conclusion
Il serait intéressant d’étudier l’impact des différents partenaires dans la pathologie. A
ce jour cinq partenaires de PAX5 ont été identifiés : ETV6, ELN, FOXP1, ZNF521 et plus
récemment PML (Nebral et al., 2007) (Figure 33):
Figure 33 : Translocations chromosomiques impliquant PAX5. PD, Paired box domain ; O,
octapeptide ; H, homéodomaine ; TD-A et I, domaine de transactivation activateur et inhibiteur ; HLH,
helix loop helix ; ETS, domaine de liaison à l’ADN Ets ; R, réticulation ; CC ou C, coiled coil ; Zn,
domaine en doigt de zinc ; FH, Forkhead domaine ; BRE, SMAD et EBF, domaine d’intéraction ;
RING, ’really interesting new gene’ finger ; B, B Box ; N, séquence de localisation nucléaire ; S/P,
région riche en sérine et proline (d’après Mullighan CG, Nature, 2007)
Comme nous l’avons vu en introduction, le gène ETV6 (ou TEL) code un facteur de
transcription appartenant à la famille ETS. La protéine ETV6 est composée d'un domaine
d'oligomérisation HLH en N-terminal et d'un domaine ETS de liaison à l'ADN. ETV6 est
transcrit de façon ubiquitaire avec une plus forte expression dans la moelle osseuse, le thymus
et la rate. Il joue un rôle important dans l’angiogenèse vitelline et dans l’hématopoïèse
médullaire. Il est impliqué dans un grand nombre de translocations chromosomiques
retrouvées dans les LAM, LMC, LAL, MDS. Plus de 26 partenaires de ETV6 ont été identifiés
à ce jour. Dans la majorité des cas, la partie N-terminale contenant le domaine HLH de ETV6
est conservée dans les chimères conférant ainsi un pouvoir de dimérisation. Dans la
107
Discussion et conclusion
translocation dic(9;12)(p13;p13), ETV6 est fusionné à PAX5 et se retrouve en C-terminal. La
chimère conserve le domaine paired box de PAX5 et les domaines d’oligomérisation HLH et
de liaison à l’ADN Ets de ETV6 (Figure 33). Mullighan et coll. ont utilisé le même système
que nous, c'est-à-dire le gène rapporteur luciférase sous le contrôle du promoteur CD19, afin
de démontrer l’effet dominant négatif de PAX5-ETV6 sur PAX5 sauvage. Les auteurs ont
également utilisé la lignée murine plasmocytaire 558LµM qui n’exprime pas Pax5 et Cd79a.
Cd79a est décrit comme étant une cible de Pax5 et est un des quatre composants du BCR
(Cd79a, chaine lourde, la chaine légère et Ig-β). Lorsque Pax5 est transfecté dans cette lignée,
il y a production d’IgM. La co-transduction de ces cellules avec PAX5 et PAX5-ETV6 ne
restaure pas totalement la production d’IgM suggérant que PAX5-ETV6 est un fort
compétiteur sur PAX5 sauvage (Mullighan et al., 2007). La chimère PAX5-ETV6 conserve
les domaines de recrutement des corépresseurs mSinA3, NCoR et HDAC de ETV6.
Récemment, Fazio est coll. ont démontré par co-immunoprécipitation que la chimère est
capable de recruter mSinA3 (Fazio et al., 2008). PAX5-ETV6 serait donc un répresseur
transcriptionnel exerçant une compétition « active » avec PAX5 sauvage. Les auteurs ont
également observé une répression de B220, Cd19, Blnk, Mb1 et Flt3 dans des cellules pro-B
de souris transduites avec PAX5-ETV6. Afin de vérifier si les cellules PAX5-ETV6 étaient
capables de proliférer en absence de cytokines, ils ont transduit les cellules pré-BI de souris
avec PAX5-ETV6 et les ont cultivées en absence d’IL-7. Les cellules transduites avec PAX5ETV6 semblent mieux résister à l’absence d’IL-7 que les cellules contrôles, mais finissent par
mourir (Fazio et al., 2008). Ces résultats suggèrent que la présence de PAX5-ETV6 confère
un avantage sur la survie mais ne permet pas une indépendance aux cytokines. Enfin, les
cellules pré-BI transduites avec PAX5-ETV6 résistent au traitement au TGFβ1, cytokine ayant
des effets antiprolifératif et proapoptotique (Fazio et al., 2008).
Le gène de l’élastine localisé en 7q11.2 code une protéine insoluble de 72kD de la
matrice extracellulaire (Rosenbloom, 1984). C’est le composant principal des fibres élastiques
nécessaires à l’élasticité des structures telles que la peau, les vaisseaux sanguins, le cœur, les
poumons, les intestins, les tendons et les ligaments (Gray et al., 1973). Ces fibres se
présentent comme un entrelacement serré et tridimensionnel de fibrilles, intimement
entrecroisées avec les fibres de collagènes. L'origine des propriétés élastiques serait liée à la
présence d'un agent réticulant, la desmosine, un tétrapeptide de la lysine dont le rôle est
analogue aux ponts disulfures dans les kératines, tout en étant plus flexible (Davis and Anwar,
1970). Un déficit de la fonction de ELN a des conséquences pathologiques comme la sténose
108
Discussion et conclusion
aortique supra-valvulaire (SVAS), le syndrome de Williams-Beuren (WBS) et la Cutis Laxa.
La sténose aortique supra-valvulaire est une maladie rare d’obturation des artères par
rétrécissement des vaisseaux (Ewart et al., 1994). Chez les patients souffrant du syndrome de
Williams-Beuren, la sténose est associée à des anomalies de la face, des anomalies du
développement neural, des retards de croissance et des insuffisances cardiovasculaires (Ewart
et al., 1993). Enfin, la Cutis Laxa est caractérisée par une peau d’aspect très lâche donnant
une idée de vieillissement précoce (Tassabehji, 1998). Ces pathologies sont la conséquence de
la dérégulation de la fonction de l’élastine, le SVAS serait lié à des mutations ou délétions
limitées au seul gène de l’élastine alors que WBS serait associé à une délétion couvrant 114
kb dans la région génomique de ELN. Une mutation dans ELN est également responsable du
Cutis Laxa. Enfin, une translocation germinale équilibrée t(7;16)(q11.23;q13) réarrangeant le
gène ELN dans le cadre du syndrome de Williams-Beuren a été également rapportée (Duba et
al., 2002). Jusqu’alors aucune implication de ce gène n’avait été rapportée dans des
translocations somatiques. Nous décrivons ici le réarrangement de PAX5 et ELN dans deux
cas de LAL-B porteurs de la translocation t(7;9)(q11;p13). La chimère conserve les domaines
paired box, octapeptide et homéobox de PAX5 et la quasi-totalité de ELN sans son peptide
signal (Figure 33). La chimère agit comme dominant négatif sur PAX5 sauvage.
FOXP1 est situé en 3p14 et appartient à la famille de facteurs de transcription
Forkhead Box (FOX) impliquée dans la régulation de gènes contrôlant le développement.
FOXP1 est composé de nombreux domaines coiled coil, d’un domaine en doigt de zinc et
d’un domaine de liaison à l’ADN spécifique de la famille, le forkhead domaine. Son
expression est ubiquitaire, cependant une plus forte expression de FOXP1 est observée dans
les stades terminaux de la différentiation B, au niveau du muscle squelettique et des tissus
gastro-intestinaux. Le KO de Foxp1 dans les souris est létal au stade embryonnaire (Wang et
al., 2004). Les cellules Foxp1-/- présentent un blocage de différenciation B au niveau de la
transition pro-B/pré-B (Hu et al., 2006). Dans ce modèle, les auteurs observent une
diminution des réarrangements VDJ et du niveau d’expression des IgM, de Rag1 et Rag2.
FOXP1 est réarrangé avec le locus des IgH dans les lymphomes B diffus à grandes cellules ou
de type MALT dans la translocation chromosomique t(3;14)(p14;q32) (Streubel et al., 2005).
Ce réarrangement conduit à la surexpression de FOXP1. Dans la translocation impliquant
PAX5, la protéine de fusion PAX5-FOXP1 conserve les domaines paired box, octapeptide et
homéodomaine de PAX5 et les domaines coiled coil et en doigt de zinc, ainsi que le domaine
109
Discussion et conclusion
forkhead de FOXP1 (Figure 33). Comme PAX5-ELN et PAX5-ETV6, PAX5-FOXP1 exerce
un effet de dominant négatif sur PAX5 sauvage (Mullighan et al., 2007).
ZNF521 est localisé en 18q11.2 et code une protéine contenant de nombreux domaines
en doigt de zinc de type Krüppel et un motif de 12-AA dans sa partie N-terminale permettant
sa liaison au complexe NuRD (nuclear remodelling and histone Deacetylation). Ce motif est
retrouvé fréquemment dans les protéines ayant une activité de corépresseur transcriptionnel.
ZNF521 est exprimé dans le cerveau, le muscle, le cœur, le rein, la rate, le placenta, le
thymus et le foie fœtal. Au niveau du système hématopoïétique, il est exprimé exclusivement
dans les cellules CD34+. ZNF521 inhibe l’activité transcriptionnelle de EBF1 (early B-cell
factor), gène essentiel à la différenciation lymphoïde B précoce. Différentes études sur le
profil d’expression de ZNF521 ont permis de mettre en évidence une expression de ZNF521
dans 71% des LAM de l’adulte (Bullinger et al., 2004), 47% des LAM de l’enfant (Lacayo et
al., 2004), 57% des LAL-T et seulement 2,5% des LAL-B (Ross et al., 2003). Les souris
surexprimant Evi3 (=ZNF521 humain) développent des leucémies et des lymphomes B
(Hentges et al., 2005; Warming et al., 2003). Dans la translocation t(9;18)(p13;q11) retrouvée
chez un patient atteint de LAL-B, ZNF521 est réarrangé avec le gène PAX5. La chimère
conserve les domaines paired box, octapeptide, homéodomaine et une partie du domaine de
transactivation de PAX5 et les domaines de liaison à l’ADN et d’intéraction avec les protéines
BMP2, SMAD et EBF de ZNF521 (Figure 33). Il n’y a pas eu d’étude fonctionnelle pour
cette protéine de fusion.
Comme nous l’avons vu en introduction, PML, pour promyelocytic leukemia, code
une protéine composée de domaines en doigt de zinc, de 2 domaines B Box (liaison à l’ADN),
d’un domaine de dimérisation et une séquence de localisation nucléaire. Son expression est
ubiquitaire et elle est localisée au niveau de corps nucléaires (Guo et al., 2000). Ces derniers
régulent la transcription, l’apoptose, la réparation de l’ADN, le contrôle de la stabilité
génomique, la sénescence cellulaire et la réponse antivirale (Dellaire and Bazett-Jones, 2004;
Zhong et al., 2000). PML a un effet suppresseur de tumeur et intervient dans l’apoptose. Il est
impliqué dans la translocation t(15;17)(q22;q11.2) conduisant à la formation de la chimère
PML-RARα dans les leucémies aiguës promyélocytaires. L’équipe de Nébral et coll. ont
décrit récemment l’implication de PML dans la translocation t(9;15)(p12;q24) dans deux cas
de LAL-B fusionnant l’exon 6 de PAX5 à l’exon 2 de PML (Nebral et al., 2007). La chimère
conserve les domaines paired box, octapeptide et une partie de l’homéodomaine de PAX5 et
la totalité des domaines de PML excepté sa région N-terminale riche en proline (Figure 33).
110
Discussion et conclusion
Une étude fonctionnelle sera nécessaire afin de déterminer si PAX5-PML est un dominant
négatif de PAX5 sauvage.
Nous pouvons souligner que dans toutes les translocations impliquant PAX5 et même
dans les translocations impliquant un des gènes de la famille PAX (PAX3-FKHR, PAX7FKHR, PAX8-PPARγ), le domaine paired box est conservé dans les protéines de fusion.
L’effet dominant négatif des chimères PAX5-X sur PAX5 sauvage est médié par ce domaine,
associé à la perte du domaine de transactivation. En effet, lorsque l’on transfecte le domaine
PBD seul, ce dernier est capable d’induire une diminution de la transactivation du promoteur
de CD19 (Nutt et al., 1998). Cependant, nous ne pouvons pas exclure un rôle des partenaires
dans les processus oncogéniques étant donné que certains d’entre eux sont récurrents (plus
d’un cas répertorié pour ETV6 et ELN). Parmi les cinq partenaires décrits quatre sont des
facteurs de transcription ou des corépresseurs ou co-activateurs transcriptionnels. Nous
pouvons donc supposer que les chimères dérégulent également les gènes cibles de ces
partenaires ou les fonctions biologiques des partenaires natifs. Par exemple, quels sont les
effets d’une expression précoce de FOXP1 alors qu’il n’est normalement plus exprimé dans
les stades terminaux de la différenciation B ? De même, quelles sont les conséquences de la
présence de ZNF521 au stade pré-B alors qu’il est normalement absent ? Nous pouvons
supposer qu’il exerce son pouvoir de corépresseur transcriptionnel sur sa cible EBF1,
essentielle à la différenciation B dans les stades précoces, bloquant ainsi la différenciation
cellulaire. D’autre part, il serait intéressant d’étudier les conséquences de la présence de
PAX5-PML sur la fonction de PML. En effet, la chimère conserve le domaine de dimérisation
de PML permettant peut-être la formation d’hétérodimères PAX5-PML/PML pouvant ainsi
entrainer une délocalisation de PML sauvage. Or, la perte de la localisation spécifique de
PML au sein des corps nucléaires a été décrite comme étant associée à une incapacité à
bloquer la prolifération dans le cas des réarrangements PML-RARα. Cependant, le
réarrangement de PAX5 avec ELN, protéine de la matrice extracellulaire, renforce l’idée que
PAX5 est l’élément clé de ces pathologies. Le rôle des partenaires de PAX5 est surement de
potentialiser l’effet transformant des chimères. Il serait donc intéressant de comparer les
potentiels oncogéniques de ces chimères ainsi que des mutants PAX5 (délétions partielles ou
mutations ponctuelles).
111
Discussion et conclusion
L’identification de nouveaux partenaires de PAX5 permettra de mieux comprendre le
rôle de ces partenaires dans la pathologie. C’est pourquoi, nous avons recherché de façon
systématique les réarrangements de PAX5 par technique de FISH chez les patients atteints de
LAL-B avec un réarrangement en 9p13. Cette étude nous a permis pour le moment de mettre
en évidence un réarrangement de PAX5 dans cinq nouveaux cas de LAL-B.
Des résultats préliminaires nous ont permis de mettre en évidence un nouveau
réarrangement de PAX5 avec le gène TAOK1 chez un patient porteur de la dic(9;17)(p13;q11)
; der(20)t(17;20)(q11;q11). TAOK1 (ou MARKK ou PSK2) code une serine-thréonine kinase
exerçant un rôle dans l’apoptose (Zihni et al., 2006). Les points de cassure se situent dans
l’intron 6 de PAX5 en 9p13 et dans l’intron 19 de TAOK1 en 17q11. Dans cette translocation,
les gènes PAX5 et TAOK1 se retrouvent juxtaposés mais en sens opposé de transcription. Il
semblerait que la conséquence de ce réarrangement soit la production d’une protéine PAX5
tronquée après son exon 6. La connaissance du point de cassure en 17q11 nous permettra
peut-être d’identifier la région réarrangée en 20q11.
L’identification des différents mutants PAX5 (translocations, mutations, délétions) doit
permettre l’étude du rôle de PAX5 dans l’oncogenèse B.
Les patients porteurs de ces mutations ont leurs cellules leucémiques bloquées au stade
pré-B. L’effet dominant négatif des mutants PAX5 pourrait être à l’origine de ce blocage.
Afin de vérifier cette hypothèse, nous avons développé au laboratoire un modèle de
différenciation in vitro, précédemment décrit par Rolink (Rolink, 2004). Ce modèle consiste à
cultiver des cellules murines pro-B sur une monocouche de cellules stromales OP9 en
présence d’IL7. Le retrait d’IL7 du milieu induit la différenciation de ces cellules jusqu’à un
stade d’expression des IgM. Nous souhaitons transduire ces cellules avec PAX5-ELN et les
différents mutants PAX5 et vérifier ainsi si la présence de la chimère seule suffit à induire un
blocage de différenciation en absence d’IL7. L’utilisation de modèles murins est également à
envisager afin de vérifier si les mutants PAX5 sont capables de développer des leucémies.
Récemment, Fazio et coll. ont utilisé ce modèle de différenciation in vitro et ont
démontré que les cellules pré-BI de souris, transduites avec PAX5-ETV6 et cultivées en
absence d’IL7, n’exprimaient pas la chaine lourde µ des IgM, caractéristique du stade pré-BII,
suggérant un blocage de différenciation (Fazio et al., 2008).
112
Discussion et conclusion
Enfin, l’étude de PAX5-ELN soulève quelques points obscurs concernant la régulation
des cibles de PAX5 dans le développement B. En effet, CD19 et BLK sont décrites comme
des cibles spécifiques de PAX5. Or, dans notre étude, nous avons transfecté la chimère PAX5ELN dans des cellules DG75 (lymphome de Burkitt) afin d’observer l’effet dominant négatif
de la chimère. Les résultats que nous avons obtenus sont une répression des cibles de PAX5,
BLNK, MB1 et LEF-1 en présence de PAX5-ELN, mais pas de variation de l’expression de
CD19 et BLK. Chez les patients, nous observons l’effet inverse : diminution de CD19 et BLK,
pas de changements pour BLNK, MB1 et LEF-1. Ces résultats contradictoires ont été
confirmés par le Pr Meinrad Busslinger, expert de PAX5 (Communication personnelle). En
effet, il nous a indiqué que lorsqu’il transfectait le domaine PBD seul à de fortes
concentrations (x50) dans des lignées B matures, il n’obtenait aucun changement du niveau
d’expression du CD19 endogène. Ces résultats suggèrent que la régulation de certaines cibles
de PAX5 diffère selon le stade de différenciation et le type cellulaire.
113
Discussion et conclusion
La translocation chromosomique t(2;11)(p21;q23) dans les leucémies
aiguës myéloblastiques et les myélodysplasies
La translocation t(2;11)(p21;q23) avait précédemment été rapportée dans différentes
publications. Au total, 20 patients dont 14 myélodysplasies et 6 LAM avaient été décrits
(http://atlasgeneticsoncology.org//Anomalies/t0211ID1109.html). Pour deux d’entre eux, un
réarrangement du gène MLL avait été observé. Le gène MLL, situé en 11q23, est fréquemment
réarrangé, c’est pourquoi nous avons, dans un premier temps, considéré qu’il pouvait être un
bon candidat. Notre étude nous a permis de définir précisément les points de cassures sur les
chromosomes 2 et 11 chez nos 14 patients et donc d’exclure un réarrangement MLL. En effet,
le point de cassure sur le chromosome 11 se situe à 3,7Mb de MLL dans une région pauvre en
gènes. Les expériences de RT-PCR quantitative, nous ont permis d’identifier une dérégulation
du microARN mir-125b-1 par la translocation. Cependant, nous ignorons encore par quels
mécanismes ce microARN est surexprimé : la translocation conduit-elle à la perte d’un
silencer ? A la juxtaposition de miR-125b avec un enhancer provenant du chromosome 2 ? A
un changement dans la conformation de la chromatine facilitant l’accès à la machinerie de
transcription au niveau du promoteur de miR-125b-1 ?
Les conséquences de la surexpression de miR-125b, de x10 à x90 selon les patients,
ont été étudiées en utilisant deux modèles de différenciation myéloïde. Nous avons démontré
que miR-125b est capable de bloquer la différenciation monocytaire et granulocytaire induite
in vitro dans les lignées HL-60 et NB4. Cependant, le rôle de miR-125b dans la
différenciation ne semble pas être restreint à la lignée myéloïde. En effet, Mizuno et coll. ont
démontré que la surexpression de miR-125b inhibe la différenciation ostéoblastique (Mizuno
et al., 2008). D’autre part, le niveau d’expression de miR-125b augmente au cours de la
différenciation neuronale (Wu and Belasco, 2005). Enfin, miR-125b semble être
préférentiellement exprimé dans les cellules différenciées où il activerait la prolifération (Lee
et al., 2005).
MiR-125b avait été initialement décrit comme un TSmiR (tumor suppressor miR) car
il est réprimé dans les cancers du sein (Iorio et al., 2005). En effet, le niveau d’expression de
miR-125b est particulièrement diminué dans les cancers du sein avec une amplification ou
une surexpression de ERBB2 (Mattie et al., 2006). Scott et coll. ont démontré que ERBB2 et
114
Discussion et conclusion
ERBB3 sont des cibles de miR-125b (Scott et al., 2007). La surexpression de miR-125b dans
la lignée de cancer du sein SKBR3 est capable de réprimer la traduction de ERBB2 et ERBB3
induisant une inactivation des voies ERK1/2 et AKT. MiR-125b est également réprimé dans
les carcinomes anaplasiques de la thyroïde (Visone et al., 2007) et les cancers de l’ovaire
(Yang et al., 2008). Le rôle oncogénique de miR-125b a été démontré grâce à différentes
études de profil d’expression des microARNs dans différents cancers. En effet, miR-125b est
surexprimé dans les cancers du pancréas (Bloomston et al., 2007), dans les tumeurs
oligodendrogliales (Nelson et al., 2006), dans les syndromes de Down (Kuhn et al., 2008) et
dans les cancers de la prostate. L’étude de Shi et coll. a permis de mieux comprendre le rôle
de miR-125b dans les cancers de la prostate (Shi et al., 2007). En effet, ils ont démontré que
l’expression de miR-125b est augmentée dans les lignées cellulaires positives pour le
récepteur aux androgènes, surexprimé (x5) dans les lignées devenues androgèneindépendantes et chez la majorité des patients atteints de cancers de la prostate. Or, le
traitement de ces cancers débute par une thérapie ciblant les androgènes. Cependant les
cancers androgène-dépendants aboutissent tous à un cancer androgène-indépendant pour
lequel il n’existe aucun traitement spécifique. Les auteurs ont démontré que les androgènes
sont capables d’induire l’expression de miR-125b et que la transfection de miR-125b dans les
cellules androgène-indépendantes stimule la croissance de ces cellules (Shi et al., 2007).
Comme nous l’avons exposé en introduction, miR-125b est également impliqué dans
la translocation chromosomique t(11;14)(q24;q32) chez un patient atteint de leucémie aiguë
lymphoblastique B. Cette translocation juxtapose miR-125b au locus des IgH. Le niveau
d’expression de miR-125b n’a pas été évalué chez ce patient, mais nous pouvons supposer
que cette translocation aboutit à la surexpression de miR-125b comme souvent observée dans
les réarrangements avec le locus des IgH. Il se pourrait que miR-125b joue également un rôle
dans la différenciation lymphoïde.
Afin de vérifier le rôle oncogénique de miR-125b, il serait intéressant d’établir des
modèles murins. L’injection de cellules souches hématopoïétiques transduites avec miR-125b
dans des souris irradiées permettrait d’observer le blocage de différenciation. Par ailleurs, il
est important de préciser si la surexpression de miR-125b induit à elle seule une leucémie
chez la souris par transgénèse du microARN sous le contrôle d’un promoteur soit constitutif,
115
Discussion et conclusion
soit spécifique de tissu (dans notre cas de la lignée myéloïde), soit inductible (si la
surexpression est létale).
Enfin, il serait intéressant d’identifier les cibles de miR-125b dérégulées dans les
LAM et les myélodysplasies. Comme nous l’avons vu précédemment, ERBB2 et ERBB3 sont
des cibles de miR-125b, cependant leur implication dans les LAM et myélodysplasies est à
exclure étant donné qu’elles n’y sont pas exprimées. Une cible intéressante est BAK1. Shi et
coll. ont démontré dans les cancers de la prostate que BAK1 est une cible de miR-125b (Shi et
al., 2007). Or, BAK1 code une protéine pro-apoptotique qui appartient à la famille BCL2. La
répression de BAK1 associée à celle de BAX bloque l’apoptose des cellules induites par
différents agents pro-apoptotiques.
Chez C. Elegans, lin-4, premier microARN à avoir été identifié, est l’orthologue de
miR-125b. lin-4 régule le développement de C. elegans. Le cycle de développement de ce ver
comporte six stades successifs: l’embryogenèse, quatre stades larvaires (L1 à L4) et le stade
adulte. Chez le nématode, à la fin du stade L1, le gène lin-4 est exprimé afin de permettre la
répression de lin-14. La protéine lin-14 est un répresseur de la transition du stade larvaire L1
vers le stade L2. Le développement des mutants lin-4 est bloqué au stade larvaire L1.
L’orthologue de lin-14 n’est pas connu chez les mammifères, cependant lin-28, contrôlant le
stade larvaire L2 de différenciation, est une autre cible de lin-4 dont l’orthologue chez les
mammifères est LIN-28. Le profil d’expression de LIN-28 chez l’homme semble être restreint
aux stades précoces de développement. De plus, LIN-28 n’est pas détecté chez HL-60 (Moss
and Tang, 2003) suggérant qu’elle n’est pas une bonne cible dans la t(2;11).
L’anomalie génétique t(2;11) semble être l’évènement primaire dans la pathologie
étant donné qu’elle est retrouvée isolée chez trois patients. Cependant, des évènements
secondaires sont généralement nécessaires au développement d’un clone malin. Une
translocation en soi n’est pas toujours suffisante pour le développement d’une leucémie. Par
exemple, les fusions AML1-ETO et TEL-AML1 initient mais sont insuffisantes pour générer
des leucémies en l’absence de lésions génétiques complémentaires (Greaves and Wiemels,
2003). Au contraire, l’activité tyrosine kinase constitutive de la protéine BCR-PDGFRA
semble suffisante pour mimer une LMC humaine chez les animaux transgéniques (Daley et
116
Discussion et conclusion
al., 1990). Son action est cependant restreinte puisque la progression de la LMC vers une
phase aiguë avec un arrêt de la différenciation est clairement associée à des changements
génétiques secondaires (Deininger et al., 2000). Ainsi, les remaniements du chromosome 5 et
du chromosome 7 associés fréquemment à la translocation t(2;11) sont des anomalies
secondaires qui accentuent la prolifération de ces cellules malignes. Le gène délété dans les
réarrangements du chromosome 5 vient d’être identifié, il s’agit du gène RPS14 (Ebert et al.,
2008).
RPS14
est un
composant
essentiel
de la sous-unité ribosomique 40S.
L’haploinsuffisance de RPS14 retrouvées dans les syndromes 5q- démontre son rôle
suppresseur de tumeur.
117
Discussion et conclusion
118
Conclusion générale
CHAPITRE 5 :
CONCLUSION GENERALE
119
Conclusion générale
120
Conclusion générale
Le clonage d’une translocation récurrente d’une pathologie, même rare, et la
compréhension de ses conséquences moléculaires permettent de préciser les processus
physiologiques normaux et oncogéniques des gènes impliqués. De plus, l’étude des
translocations peut permettre l’identification de nouveaux oncogènes ou de réarrangements
cryptiques plus récurrents. Par exemple, l’étude d’un patient porteur d’une translocation t(1;4)
a révélée l’existence d’une délétion cryptique sur le chromosome 4 qui conduit à la formation
d’une protéine de fusion FIPL1-PDGFRα dans environ 10% des hyperéosinophilies (Cools et
al., 2003).
Ainsi,
ce
travail
a
permis
de
caractériser
trois
nouvelles
translocations
chromosomiques dans les hémopathies malignes. L’identification de PAX5 dans la
translocation t(7;9)(q11;p13) a permis de renforcer l’hypothèse du rôle crucial de PAX5 dans
les LAL-B et de mettre en évidence son action de dominant négatif par la fusion PAX5-ELN.
L’étude des translocations impliquant PAX5 vont permettre de mieux comprendre l’ontogénie
B à l’instar de l’étude de la translocation t(1;19)(q23;p13) impliquant E2A, gène crucial des
phases tardives de la différenciation B. L’étude de la translocation t(8;9) souligne le rôle
majeur de la protéine tyrosine kinase JAK2 dans les syndromes myéloprolifératifs. Enfin, la
translocation t(2;11)(p21;q23) est le premier exemple de la surexpression d’un microARN
induite par une translocation dans des hémopathies malignes. Cette étude démontre également
un nouveau rôle de miR-125b dans la différenciation myéloïde. Enfin, il semblerait que cette
translocation retrouvée chez 14 patients constitue une nouvelle entité morphologique.
En pratique médicale, l’identification des gènes impliqués permettra la recherche par
RT-PCR des cellules leucémiques résiduelles chez les patients après traitement, ce que la
technique de FISH ne permet pas, étant donné le peu de cellules leucémiques. De plus,
l’utilisation de la RT-PCR permettra d’identifier la translocation, même lorsqu’elle est
indétectable par les techniques de cytogénétique conventionnelles (anomalies cryptiques),
comme cela est le cas dans 5% des leucémies myéloïdes chroniques pour la translocation
t(9;22)(BCR-ABL1). Dans une perspective plus thérapeutique, on peut imaginer que les gènes
dérégulés par ces translocations puissent à moyen terme servir de cibles pour de nouvelles
drogues, notamment JAK2 qui beneficie d’un regain d’intérêt actuellement du fait de son
implication dans trois syndromes myéloprolifératifs chroniques, la polyglobulie primitive, la
thrombocytémie essentielle et la myélofibrose idiopathique.
121
Conclusion générale
122
Références bibliographiques
CHAPITRE 6:
REFERENCES BIBLIOGRAPHIQUES
123
Références bibliographiques
124
Références bibliographiques
Abe, A., Emi, N., Tanimoto, M., Terasaki, H., Marunouchi, T. and Saito, H.
(1997) Fusion of the platelet-derived growth factor receptor beta to a
novel gene CEV14 in acute myelogenous leukemia after clonal
evolution. Blood, 90, 4271-4277.
Adelaide, J., Perot, C., Gelsi-Boyer, V., Pautas, C., Murati, A., Copie-Bergman,
C., Imbert, M., Chaffanet, M., Birnbaum, D. and Mozziconacci, M.J.
(2006) A t(8;9) translocation with PCM1-JAK2 fusion in a patient with Tcell lymphoma. Leukemia, 20, 536-537.
Akao, Y., Nakagawa, Y. and Naoe, T. (2006a) let-7 microRNA functions as a
potential growth suppressor in human colon cancer cells. Biol Pharm
Bull, 29, 903-906.
Akao, Y., Nakagawa, Y. and Naoe, T. (2006b) MicroRNAs 143 and 145 are
possible common onco-microRNAs in human cancers. Oncol Rep, 16,
845-850.
Albitar, M. and Freireich, E.J. (2000) Molecular defects in chronic
myeloproliferative disorders. Mol Med, 6, 555-567.
Ambros, V. (2004) The functions of animal microRNAs. Nature, 431, 350-355.
Anderson, K., Rusterholz, C., Mansson, R., Jensen, C.T., Bacos, K., Zandi, S.,
Sasaki, Y., Nerlov, C., Sigvardsson, M. and Jacobsen, S.E. (2007) Ectopic
expression of PAX5 promotes maintenance of biphenotypic myeloid
progenitors coexpressing myeloid and B-cell lineage-associated genes.
Blood, 109, 3697-3705.
Andreasson, P., Schwaller, J., Anastasiadou, E., Aster, J. and Gilliland, D.G.
(2001) The expression of ETV6/CBFA2 (TEL/AML1) is not sufficient for
the transformation of hematopoietic cell lines in vitro or the induction of
hematologic disease in vivo. Cancer Genet Cytogenet, 130, 93-104.
Au, A.Y., McBride, C., Wilhelm, K.G., Jr., Koenig, R.J., Speller, B., Cheung, L.,
Messina, M., Wentworth, J., Tasevski, V., Learoyd, D., Robinson, B.G.
and Clifton-Bligh, R.J. (2006) PAX8-peroxisome proliferator-activated
receptor gamma (PPARgamma) disrupts normal PAX8 or PPARgamma
transcriptional function and stimulates follicular thyroid cell growth.
Endocrinology, 147, 367-376.
Ayalon, D., Glaser, T. and Werner, H. (2001) Transcriptional regulation of IGFI receptor gene expression by the PAX3-FKHR oncoprotein. Growth
Horm IGF Res, 11, 289-297.
Bai, R.Y., Dieter, P., Peschel, C., Morris, S.W. and Duyster, J. (1998)
Nucleophosmin-anaplastic lymphoma kinase of large-cell anaplastic
lymphoma is a constitutively active tyrosine kinase that utilizes
125
Références bibliographiques
phospholipase C-gamma to mediate its mitogenicity. Mol Cell Biol, 18,
6951-6961.
Balczon, R., Bao, L. and Zimmer, W.E. (1994) PCM-1, A 228-kD centrosome
autoantigen with a distinct cell cycle distribution. J Cell Biol, 124, 783793.
Balczon, R., Simerly, C., Takahashi, D. and Schatten, G. (2002) Arrest of cell
cycle progression during first interphase in murine zygotes
microinjected with anti-PCM-1 antibodies. Cell Motil Cytoskeleton, 52,
183-192.
Baldassarre, G., Fedele, M., Battista, S., Vecchione, A., Klein-Szanto, A.J.,
Santoro, M., Waldmann, T.A., Azimi, N., Croce, C.M. and Fusco, A.
(2001) Onset of natural killer cell lymphomas in transgenic mice
carrying a truncated HMGI-C gene by the chronic stimulation of the IL2 and IL-15 pathway. Proc Natl Acad Sci U S A, 98, 7970-7975.
Barr, F.G., Galili, N., Holick, J., Biegel, J.A., Rovera, G. and Emanuel, B.S.
(1993) Rearrangement of the PAX3 paired box gene in the paediatric
solid tumour alveolar rhabdomyosarcoma. Nat Genet, 3, 113-117.
Bartel, D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and
function. Cell, 116, 281-297.
Battista, S., Fidanza, V., Fedele, M., Klein-Szanto, A.J., Outwater, E., Brunner,
H., Santoro, M., Croce, C.M. and Fusco, A. (1999) The expression of a
truncated HMGI-C gene induces gigantism associated with lipomatosis.
Cancer Res, 59, 4793-4797.
Baxter, E.J., Hochhaus, A., Bolufer, P., Reiter, A., Fernandez, J.M., Senent, L.,
Cervera, J., Moscardo, F., Sanz, M.A. and Cross, N.C. (2002) The
t(4;22)(q12;q11) in atypical chronic myeloid leukaemia fuses BCR to
PDGFRA. Hum Mol Genet, 11, 1391-1397.
Bennett, M. and Stroncek, D.F. (2006) Recent advances in the bcr-abl negative
chronic myeloproliferative diseases. J Transl Med, 4, 41.
Bennicelli, J.L., Advani, S., Schafer, B.W. and Barr, F.G. (1999) PAX3 and PAX7
exhibit conserved cis-acting transcription repression domains and
utilize a common gain of function mechanism in alveolar
rhabdomyosarcoma. Oncogene, 18, 4348-4356.
Bennicelli, J.L., Fredericks, W.J., Wilson, R.B., Rauscher, F.J., 3rd and Barr, F.G.
(1995) Wild type PAX3 protein and the PAX3-FKHR fusion protein of
alveolar rhabdomyosarcoma contain potent, structurally distinct
transcriptional activation domains. Oncogene, 11, 119-130.
126
Références bibliographiques
Bhattacharyya, S.N., Habermacher, R., Martine, U., Closs, E.I. and Filipowicz,
W. (2006) Relief of microRNA-mediated translational repression in
human cells subjected to stress. Cell, 125, 1111-1124.
Bloomston, M., Frankel, W.L., Petrocca, F., Volinia, S., Alder, H., Hagan, J.P.,
Liu, C.G., Bhatt, D., Taccioli, C. and Croce, C.M. (2007) MicroRNA
expression patterns to differentiate pancreatic adenocarcinoma from
normal pancreas and chronic pancreatitis. Jama, 297, 1901-1908.
Blume-Jensen, P. and Hunter, T. (2001) Oncogenic kinase signalling. Nature,
411, 355-365.
Borchert, G.M., Lanier, W. and Davidson, B.L. (2006) RNA polymerase III
transcribes human microRNAs. Nat Struct Mol Biol, 13, 1097-1101.
Borrmann, L., Wilkening, S. and Bullerdiek, J. (2001) The expression of HMGA
genes is regulated by their 3'UTR. Oncogene, 20, 4537-4541.
Borrow, J., Shearman, A.M., Stanton, V.P., Jr., Becher, R., Collins, T., Williams,
A.J., Dube, I., Katz, F., Kwong, Y.L., Morris, C., Ohyashiki, K., Toyama,
K., Rowley, J. and Housman, D.E. (1996) The t(7;11)(p15;p15)
translocation in acute myeloid leukaemia fuses the genes for
nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet, 12,
159-167.
Brennecke, J., Stark, A., Russell, R.B. and Cohen, S.M. (2005) Principles of
microRNA-target recognition. PLoS Biol, 3, e85.
Bullinger, L., Dohner, K., Bair, E., Frohling, S., Schlenk, R.F., Tibshirani, R.,
Dohner, H. and Pollack, J.R. (2004) Use of gene-expression profiling to
identify prognostic subclasses in adult acute myeloid leukemia. N Engl J
Med, 350, 1605-1616.
Busslinger, M. (2004) Transcriptional control of early B cell development. Annu
Rev Immunol, 22, 55-79.
Busslinger, M., Klix, N., Pfeffer, P., Graninger, P.G. and Kozmik, Z. (1996)
Deregulation of PAX-5 by translocation of the Emu enhancer of the IgH
locus adjacent to two alternative PAX-5 promoters in a diffuse large-cell
lymphoma. Proc Natl Acad Sci U S A, 93, 6129-6134.
Calin, G.A., Dumitru, C.D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler,
H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini, M.,
Bullrich, F. and Croce, C.M. (2002) Frequent deletions and downregulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic
lymphocytic leukemia. Proc Natl Acad Sci U S A, 99, 15524-15529.
Calin, G.A., Ferracin, M., Cimmino, A., Di Leva, G., Shimizu, M., Wojcik, S.E.,
Iorio, M.V., Visone, R., Sever, N.I., Fabbri, M., Iuliano, R., Palumbo, T.,
Pichiorri, F., Roldo, C., Garzon, R., Sevignani, C., Rassenti, L., Alder, H.,
127
Références bibliographiques
Volinia, S., Liu, C.G., Kipps, T.J., Negrini, M. and Croce, C.M. (2005) A
MicroRNA signature associated with prognosis and progression in
chronic lymphocytic leukemia. N Engl J Med, 353, 1793-1801.
Calin, G.A., Sevignani, C., Dumitru, C.D., Hyslop, T., Noch, E., Yendamuri, S.,
Shimizu, M., Rattan, S., Bullrich, F., Negrini, M. and Croce, C.M. (2004)
Human microRNA genes are frequently located at fragile sites and
genomic regions involved in cancers. Proc Natl Acad Sci U S A, 101, 29993004.
Calvo, K.R., Sykes, D.B., Pasillas, M.P. and Kamps, M.P. (2002) Nup98-HoxA9
immortalizes myeloid progenitors, enforces expression of Hoxa9, Hoxa7
and Meis1, and alters cytokine-specific responses in a manner similar to
that induced by retroviral co-expression of Hoxa9 and Meis1. Oncogene,
21, 4247-4256.
Carmell, M.A., Xuan, Z., Zhang, M.Q. and Hannon, G.J. (2002) The Argonaute
family: tentacles that reach into RNAi, developmental control, stem cell
maintenance, and tumorigenesis. Genes Dev, 16, 2733-2742.
Carron, C., Cormier, F., Janin, A., Lacronique, V., Giovannini, M., Daniel, M.T.,
Bernard, O. and Ghysdael, J. (2000) TEL-JAK2 transgenic mice develop
T-cell leukemia. Blood, 95, 3891-3899.
Cazzaniga, G., Daniotti, M., Tosi, S., Giudici, G., Aloisi, A., Pogliani, E.,
Kearney, L. and Biondi, A. (2001) The paired box domain gene PAX5 is
fused to ETV6/TEL in an acute lymphoblastic leukemia case. Cancer Res,
61, 4666-4670.
Chakravarti, D., LaMorte, V.J., Nelson, M.C., Nakajima, T., Schulman, I.G.,
Juguilon, H., Montminy, M. and Evans, R.M. (1996) Role of CBP/P300 in
nuclear receptor signalling. Nature, 383, 99-103.
Chen, G.Q., Shi, X.G., Tang, W., Xiong, S.M., Zhu, J., Cai, X., Han, Z.G., Ni,
J.H., Shi, G.Y., Jia, P.M., Liu, M.M., He, K.L., Niu, C., Ma, J., Zhang, P.,
Zhang, T.D., Paul, P., Naoe, T., Kitamura, K., Miller, W., Waxman, S.,
Wang, Z.Y., de The, H., Chen, S.J. and Chen, Z. (1997) Use of arsenic
trioxide (As2O3) in the treatment of acute promyelocytic leukemia
(APL): I. As2O3 exerts dose-dependent dual effects on APL cells. Blood,
89, 3345-3353.
Chen, M., Cheng, A., Candotti, F., Zhou, Y.J., Hymel, A., Fasth, A.,
Notarangelo, L.D. and O'Shea, J.J. (2000) Complex effects of naturally
occurring mutations in the JAK3 pseudokinase domain: evidence for
interactions between the kinase and pseudokinase domains. Mol Cell
Biol, 20, 947-956.
128
Références bibliographiques
Chen, Z., Tong, J.H., Dong, S., Zhu, J., Wang, Z.Y. and Chen, S.J. (1996)
Retinoic acid regulatory pathways, chromosomal translocations, and
acute promyelocytic leukemia. Genes Chromosomes Cancer, 15, 147-156.
Cimmino, A., Calin, G.A., Fabbri, M., Iorio, M.V., Ferracin, M., Shimizu, M.,
Wojcik, S.E., Aqeilan, R.I., Zupo, S., Dono, M., Rassenti, L., Alder, H.,
Volinia, S., Liu, C.G., Kipps, T.J., Negrini, M. and Croce, C.M. (2005)
miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad
Sci U S A, 102, 13944-13949.
Cobaleda, C., Jochum, W. and Busslinger, M. (2007) Conversion of mature B
cells into T cells by dedifferentiation to uncommitted progenitors.
Nature, 449, 473-477.
Cobaleda, C., Schebesta, A., Delogu, A. and Busslinger, M. (2007) Pax5: the
guardian of B cell identity and function. Nat Immunol, 8, 463-470.
Cools, J., DeAngelo, D.J., Gotlib, J., Stover, E.H., Legare, R.D., Cortes, J., Kutok,
J., Clark, J., Galinsky, I., Griffin, J.D., Cross, N.C., Tefferi, A., Malone, J.,
Alam, R., Schrier, S.L., Schmid, J., Rose, M., Vandenberghe, P., Verhoef,
G., Boogaerts, M., Wlodarska, I., Kantarjian, H., Marynen, P., Coutre,
S.E., Stone, R. and Gilliland, D.G. (2003) A tyrosine kinase created by
fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of
imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med, 348,
1201-1214.
Corvi, R., Berger, N., Balczon, R. and Romeo, G. (2000) RET/PCM-1: a novel
fusion gene in papillary thyroid carcinoma. Oncogene, 19, 4236-4242.
Costinean, S., Zanesi, N., Pekarsky, Y., Tili, E., Volinia, S., Heerema, N. and
Croce, C.M. (2006) Pre-B cell proliferation and lymphoblastic
leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc
Natl Acad Sci U S A, 103, 7024-7029.
Cotta, C.V., Zhang, Z., Kim, H.G. and Klug, C.A. (2003) Pax5 determines Bversus T-cell fate and does not block early myeloid-lineage
development. Blood, 101, 4342-4346.
Daley, G.Q., Van Etten, R.A. and Baltimore, D. (1990) Induction of chronic
myelogenous leukemia in mice by the P210bcr/abl gene of the
Philadelphia chromosome. Science, 247, 824-830.
Dammermann, A. and Merdes, A. (2002) Assembly of centrosomal proteins
and microtubule organization depends on PCM-1. J Cell Biol, 159, 255266.
Dash, A. and Gilliland, D.G. (2001) Molecular genetics of acute myeloid
leukaemia. Best Pract Res Clin Haematol, 14, 49-64.
129
Références bibliographiques
Davis, N.R. and Anwar, R.A. (1970) On the mechanism of formation of
desmosine and isodesmosine cross-links of elastin. J Am Chem Soc, 92,
3778-3782.
Davis, R.J. and Barr, F.G. (1997) Fusion genes resulting from alternative
chromosomal translocations are overexpressed by gene-specific
mechanisms in alveolar rhabdomyosarcoma. Proc Natl Acad Sci U S A,
94, 8047-8051.
Deininger, M.W., Goldman, J.M. and Melo, J.V. (2000) The molecular biology
of chronic myeloid leukemia. Blood, 96, 3343-3356.
Delaval, B., Letard, S., Lelievre, H., Chevrier, V., Daviet, L., Dubreuil, P. and
Birnbaum, D. (2005) Oncogenic tyrosine kinase of malignant hemopathy
targets the centrosome. Cancer Res, 65, 7231-7240.
Dellaire, G. and Bazett-Jones, D.P. (2004) PML nuclear bodies: dynamic
sensors of DNA damage and cellular stress. Bioessays, 26, 963-977.
Delogu, A., Schebesta, A., Sun, Q., Aschenbrenner, K., Perlot, T. and
Busslinger, M. (2006) Gene repression by Pax5 in B cells is essential for
blood cell homeostasis and is reversed in plasma cells. Immunity, 24,
269-281.
Demiroglu, A., Steer, E.J., Heath, C., Taylor, K., Bentley, M., Allen, S.L.,
Koduru, P., Brody, J.P., Hawson, G., Rodwell, R., Doody, M.L.,
Carnicero, F., Reiter, A., Goldman, J.M., Melo, J.V. and Cross, N.C.
(2001) The t(8;22) in chronic myeloid leukemia fuses BCR to FGFR1:
transforming activity and specific inhibition of FGFR1 fusion proteins.
Blood, 98, 3778-3783.
DeVita, V.T., Jr. and Canellos, G.P. (1999) The lymphomas. Semin Hematol, 36,
84-94.
Dickstein, J.I. and Vardiman, J.W. (1995) Hematopathologic findings in the
myeloproliferative disorders. Semin Oncol, 22, 355-373.
Diederichs, S. and Haber, D.A. (2006) Sequence variations of microRNAs in
human cancer: alterations in predicted secondary structure do not affect
processing. Cancer Res, 66, 6097-6104.
Ding, L. and Han, M. (2007) GW182 family proteins are crucial for microRNAmediated gene silencing. Trends Cell Biol, 17, 411-416.
dos Santos, N.R. and Ghysdael, J. (2006) A transgenic mouse model for TELJAK2-induced B-cell lymphoma/leukemia. Leukemia, 20, 182-185.
Druker, B.J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G.M., Fanning, S.,
Zimmermann, J. and Lydon, N.B. (1996) Effects of a selective inhibitor of
the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med,
2, 561-566.
130
Références bibliographiques
Duba, H.C., Doll, A., Neyer, M., Erdel, M., Mann, C., Hammerer, I., Utermann,
G. and Grzeschik, K.H. (2002) The elastin gene is disrupted in a family
with a balanced translocation t(7;16)(q11.23;q13) associated with a
variable expression of the Williams-Beuren syndrome. Eur J Hum Genet,
10, 351-361.
Eberhard, D., Jimenez, G., Heavey, B. and Busslinger, M. (2000)
Transcriptional repression by Pax5 (BSAP) through interaction with
corepressors of the Groucho family. Embo J, 19, 2292-2303.
Ebert, B.L., Pretz, J., Bosco, J., Chang, C.Y., Tamayo, P., Galili, N., Raza, A.,
Root, D.E., Attar, E., Ellis, S.R. and Golub, T.R. (2008) Identification of
RPS14 as a 5q- syndrome gene by RNA interference screen. Nature, 451,
335-339.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T.
(2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in
cultured mammalian cells. Nature, 411, 494-498.
Emelyanov, A.V., Kovac, C.R., Sepulveda, M.A. and Birshtein, B.K. (2002) The
interaction of Pax5 (BSAP) with Daxx can result in transcriptional
activation in B cells. J Biol Chem, 277, 11156-11164.
Epstein, J.A., Song, B., Lakkis, M. and Wang, C. (1998) Tumor-specific PAX3FKHR transcription factor, but not PAX3, activates the platelet-derived
growth factor alpha receptor. Mol Cell Biol, 18, 4118-4130.
Ewart, A.K., Jin, W., Atkinson, D., Morris, C.A. and Keating, M.T. (1994)
Supravalvular aortic stenosis associated with a deletion disrupting the
elastin gene. J Clin Invest, 93, 1071-1077.
Ewart, A.K., Morris, C.A., Atkinson, D., Jin, W., Sternes, K., Spallone, P., Stock,
A.D., Leppert, M. and Keating, M.T. (1993) Hemizygosity at the elastin
locus in a developmental disorder, Williams syndrome. Nat Genet, 5, 1116.
Fazi, F., Racanicchi, S., Zardo, G., Starnes, L.M., Mancini, M., Travaglini, L.,
Diverio, D., Ammatuna, E., Cimino, G., Lo-Coco, F., Grignani, F. and
Nervi, C. (2007) Epigenetic silencing of the myelopoiesis regulator
microRNA-223 by the AML1/ETO oncoprotein. Cancer Cell, 12, 457-466.
Fazio, G., Palmi, C., Rolink, A., Biondi, A. and Cazzaniga, G. (2008) PAX5/TEL
acts as a transcriptional repressor causing down-modulation of CD19,
enhances migration to CXCL12, and confers survival advantage in preBI cells. Cancer Res, 68, 181-189.
Fedele, M., Battista, S., Kenyon, L., Baldassarre, G., Fidanza, V., Klein-Szanto,
A.J., Parlow, A.F., Visone, R., Pierantoni, G.M., Outwater, E., Santoro,
M., Croce, C.M. and Fusco, A. (2002) Overexpression of the HMGA2
131
Références bibliographiques
gene in transgenic mice leads to the onset of pituitary adenomas.
Oncogene, 21, 3190-3198.
Ferrando, A.A. and Look, A.T. (2000) Clinical implications of recurring
chromosomal and associated molecular abnormalities in acute
lymphoblastic leukemia. Semin Hematol, 37, 381-395.
Fioretos, T., Panagopoulos, I., Lassen, C., Swedin, A., Billstrom, R., Isaksson,
M., Strombeck, B., Olofsson, T., Mitelman, F. and Johansson, B. (2001)
Fusion of the BCR and the fibroblast growth factor receptor-1 (FGFR1)
genes as a result of t(8;22)(p11;q11) in a myeloproliferative disorder: the
first fusion gene involving BCR but not ABL. Genes Chromosomes Cancer,
32, 302-310.
Fitzsimmons, D., Hodsdon, W., Wheat, W., Maira, S.M., Wasylyk, B. and
Hagman, J. (1996) Pax-5 (BSAP) recruits Ets proto-oncogene family
proteins to form functional ternary complexes on a B-cell-specific
promoter. Genes Dev, 10, 2198-2211.
Fredericks, W.J., Galili, N., Mukhopadhyay, S., Rovera, G., Bennicelli, J., Barr,
F.G. and Rauscher, F.J., 3rd. (1995) The PAX3-FKHR fusion protein
created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a
more potent transcriptional activator than PAX3. Mol Cell Biol, 15, 15221535.
Fuxa, M. and Busslinger, M. (2007) Reporter gene insertions reveal a strictly B
lymphoid-specific expression pattern of Pax5 in support of its B cell
identity function. J Immunol, 178, 3031-3037.
Fuxa, M., Skok, J., Souabni, A., Salvagiotto, G., Roldan, E. and Busslinger, M.
(2004) Pax5 induces V-to-DJ rearrangements and locus contraction of the
immunoglobulin heavy-chain gene. Genes Dev, 18, 411-422.
Garzon, R., Pichiorri, F., Palumbo, T., Visentini, M., Aqeilan, R., Cimmino, A.,
Wang, H., Sun, H., Volinia, S., Alder, H., Calin, G.A., Liu, C.G.,
Andreeff, M. and Croce, C.M. (2007) MicroRNA gene expression during
retinoic acid-induced differentiation of human acute promyelocytic
leukemia. Oncogene, 26, 4148-4157.
Gebauer, F. and Hentze, M.W. (2004) Molecular mechanisms of translational
control. Nat Rev Mol Cell Biol, 5, 827-835.
Gellert, M. (1997) Recent advances in understanding V(D)J recombination. Adv
Immunol, 64, 39-64.
Geurts, J.M., Schoenmakers, E.F. and Van de Ven, W.J. (1997) Molecular
characterization of a complex chromosomal rearrangement in a
pleomorphic salivary gland adenoma involving the 3'-UTR of HMGIC.
Cancer Genet Cytogenet, 95, 198-205.
132
Références bibliographiques
Ghannam, G., Takeda, A., Camarata, T., Moore, M.A., Viale, A. and Yaseen,
N.R. (2004) The oncogene Nup98-HOXA9 induces gene transcription in
myeloid cells. J Biol Chem, 279, 866-875.
Gingras, A.C., Raught, B. and Sonenberg, N. (1999) eIF4 initiation factors:
effectors of mRNA recruitment to ribosomes and regulators of
translation. Annu Rev Biochem, 68, 913-963.
Ginsberg, J.P., Davis, R.J., Bennicelli, J.L., Nauta, L.E. and Barr, F.G. (1998) Upregulation of MET but not neural cell adhesion molecule expression by
the PAX3-FKHR fusion protein in alveolar rhabdomyosarcoma. Cancer
Res, 58, 3542-3546.
Golub, T.R., Barker, G.F., Bohlander, S.K., Hiebert, S.W., Ward, D.C., BrayWard, P., Morgan, E., Raimondi, S.C., Rowley, J.D. and Gilliland, D.G.
(1995) Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in
acute lymphoblastic leukemia. Proc Natl Acad Sci U S A, 92, 4917-4921.
Golub, T.R., Barker, G.F., Lovett, M. and Gilliland, D.G. (1994) Fusion of PDGF
receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic
leukemia with t(5;12) chromosomal translocation. Cell, 77, 307-316.
Golub, T.R., Goga, A., Barker, G.F., Afar, D.E., McLaughlin, J., Bohlander, S.K.,
Rowley, J.D., Witte, O.N. and Gilliland, D.G. (1996) Oligomerization of
the ABL tyrosine kinase by the Ets protein TEL in human leukemia. Mol
Cell Biol, 16, 4107-4116.
Grand, F.H., Burgstaller, S., Kuhr, T., Baxter, E.J., Webersinke, G., Thaler, J.,
Chase, A.J. and Cross, N.C. (2004) p53-Binding protein 1 is fused to the
platelet-derived growth factor receptor beta in a patient with a
t(5;15)(q33;q22) and an imatinib-responsive eosinophilic
myeloproliferative disorder. Cancer Res, 64, 7216-7219.
Grand, F.H., Iqbal, S., Zhang, L., Russell, N.H., Chase, A. and Cross, N.C.
(2007) A constitutively active SPTBN1-FLT3 fusion in atypical chronic
myeloid leukemia is sensitive to tyrosine kinase inhibitors and
immunotherapy. Exp Hematol, 35, 1723-1727.
Gray, W.R., Sandberg, L.B. and Foster, J.A. (1973) Molecular model for elastin
structure and function. Nature, 246, 461-466.
Greaves, M.F. and Wiemels, J. (2003) Origins of chromosome translocations in
childhood leukaemia. Nat Rev Cancer, 3, 639-649.
Griesinger, F., Hennig, H., Hillmer, F., Podleschny, M., Steffens, R., Pies, A.,
Wormann, B., Haase, D. and Bohlander, S.K. (2005) A BCR-JAK2 fusion
gene as the result of a t(9;22)(p24;q11.2) translocation in a patient with a
clinically typical chronic myeloid leukemia. Genes Chromosomes Cancer,
44, 329-333.
133
Références bibliographiques
Guo, A., Salomoni, P., Luo, J., Shih, A., Zhong, S., Gu, W. and Pandolfi, P.P.
(2000) The function of PML in p53-dependent apoptosis. Nat Cell Biol, 2,
730-736.
Haber, J.E. (1999) DNA recombination: the replication connection. Trends
Biochem Sci, 24, 271-275.
Hammond, S.M., Boettcher, S., Caudy, A.A., Kobayashi, R. and Hannon, G.J.
(2001) Argonaute2, a link between genetic and biochemical analyses of
RNAi. Science, 293, 1146-1150.
Hanahan, D. and Weinberg, R.A. (2000) The hallmarks of cancer. Cell, 100, 5770.
Hayashi, K., Yamamoto, M., Nojima, T., Goitsuka, R. and Kitamura, D. (2003)
Distinct signaling requirements for Dmu selection, IgH allelic exclusion,
pre-B cell transition, and tumor suppression in B cell progenitors.
Immunity, 18, 825-836.
Hayashita, Y., Osada, H., Tatematsu, Y., Yamada, H., Yanagisawa, K., Tomida,
S., Yatabe, Y., Kawahara, K., Sekido, Y. and Takahashi, T. (2005) A
polycistronic microRNA cluster, miR-17-92, is overexpressed in human
lung cancers and enhances cell proliferation. Cancer Res, 65, 9628-9632.
He, H., Jazdzewski, K., Li, W., Liyanarachchi, S., Nagy, R., Volinia, S., Calin,
G.A., Liu, C.G., Franssila, K., Suster, S., Kloos, R.T., Croce, C.M. and de
la Chapelle, A. (2005) The role of microRNA genes in papillary thyroid
carcinoma. Proc Natl Acad Sci U S A, 102, 19075-19080.
He, L.Z., Guidez, F., Tribioli, C., Peruzzi, D., Ruthardt, M., Zelent, A. and
Pandolfi, P.P. (1998) Distinct interactions of PML-RARalpha and PLZFRARalpha with co-repressors determine differential responses to RA in
APL. Nat Genet, 18, 126-135.
Hentges, K.E., Weiser, K.C., Schountz, T., Woodward, L.S., Morse, H.C. and
Justice, M.J. (2005) Evi3, a zinc-finger protein related to EBFAZ,
regulates EBF activity in B-cell leukemia. Oncogene, 24, 1220-1230.
Hernandez, F., Lopez, O., Estivill, C., Baiget, M., Pujol, R.M., Bordes, R. and
Nomdedeu, J.F. (1999) NPM/ALK rearrangements in indolent cutaneous
lesions. Leukemia, 13, 1291-1292.
Hiebert, S.W., Lutterbach, B. and Amann, J. (2001) Role of co-repressors in
transcriptional repression mediated by the t(8;21), t(16;21), t(12;21), and
inv(16) fusion proteins. Curr Opin Hematol, 8, 197-200.
Hiebert, S.W., Sun, W., Davis, J.N., Golub, T., Shurtleff, S., Buijs, A., Downing,
J.R., Grosveld, G., Roussell, M.F., Gilliland, D.G., Lenny, N. and Meyers,
S. (1996) The t(12;21) translocation converts AML-1B from an activator
to a repressor of transcription. Mol Cell Biol, 16, 1349-1355.
134
Références bibliographiques
Hilkens, C.M., Is'harc, H., Lillemeier, B.F., Strobl, B., Bates, P.A., Behrmann, I.
and Kerr, I.M. (2001) A region encompassing the FERM domain of Jak1
is necessary for binding to the cytokine receptor gp130. FEBS Lett, 505,
87-91.
Hiom, K., Melek, M. and Gellert, M. (1998) DNA transposition by the RAG1
and RAG2 proteins: a possible source of oncogenic translocations. Cell,
94, 463-470.
Hirokawa, S., Sato, H., Kato, I. and Kudo, A. (2003) EBF-regulating Pax5
transcription is enhanced by STAT5 in the early stage of B cells. Eur J
Immunol, 33, 1824-1829.
Ho, J.M., Nguyen, M.H., Dierov, J.K., Badger, K.M., Beattie, B.K., Tartaro, P.,
Haq, R., Zanke, B.W., Carroll, M.P. and Barber, D.L. (2002) TEL-JAK2
constitutively activates the extracellular signal-regulated kinase (ERK),
stress-activated protein/Jun kinase (SAPK/JNK), and p38 signaling
pathways. Blood, 100, 1438-1448.
Hoflinger, S., Kesavan, K., Fuxa, M., Hutter, C., Heavey, B., Radtke, F. and
Busslinger, M. (2004) Analysis of Notch1 function by in vitro T cell
differentiation of Pax5 mutant lymphoid progenitors. J Immunol, 173,
3935-3944.
Holmes, M.L., Carotta, S., Corcoran, L.M. and Nutt, S.L. (2006) Repression of
Flt3 by Pax5 is crucial for B-cell lineage commitment. Genes Dev, 20, 933938.
Holmes, M.L., Pridans, C. and Nutt, S.L. (2008) The regulation of the B-cell
gene expression programme by Pax5. Immunol Cell Biol, 86, 47-53.
Horcher, M., Souabni, A. and Busslinger, M. (2001) Pax5/BSAP maintains the
identity of B cells in late B lymphopoiesis. Immunity, 14, 779-790.
Hu, H., Wang, B., Borde, M., Nardone, J., Maika, S., Allred, L., Tucker, P.W.
and Rao, A. (2006) Foxp1 is an essential transcriptional regulator of B
cell development. Nat Immunol, 7, 819-826.
Humphreys, D.T., Westman, B.J., Martin, D.I. and Preiss, T. (2005) MicroRNAs
control translation initiation by inhibiting eukaryotic initiation factor
4E/cap and poly(A) tail function. Proc Natl Acad Sci U S A, 102, 1696116966.
Hutvagner, G. and Zamore, P.D. (2002) A microRNA in a multiple-turnover
RNAi enzyme complex. Science, 297, 2056-2060.
Iida, S., Rao, P.H., Nallasivam, P., Hibshoosh, H., Butler, M., Louie, D.C.,
Dyomin, V., Ohno, H., Chaganti, R.S. and Dalla-Favera, R. (1996) The
t(9;14)(p13;q32) chromosomal translocation associated with
135
Références bibliographiques
lymphoplasmacytoid lymphoma involves the PAX-5 gene. Blood, 88,
4110-4117.
Inoue, N., Izui-Sarumaru, T., Murakami, Y., Endo, Y., Nishimura, J.,
Kurokawa, K., Kuwayama, M., Shime, H., Machii, T., Kanakura, Y.,
Meyers, G., Wittwer, C., Chen, Z., Babcock, W., Frei-Lahr, D., Parker,
C.J. and Kinoshita, T. (2006) Molecular basis of clonal expansion of
hematopoiesis in 2 patients with paroxysmal nocturnal hemoglobinuria
(PNH). Blood, 108, 4232-4236.
Iorio, M.V., Ferracin, M., Liu, C.G., Veronese, A., Spizzo, R., Sabbioni, S.,
Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., Menard, S., Palazzo,
J.P., Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G.A.,
Querzoli, P., Negrini, M. and Croce, C.M. (2005) MicroRNA gene
expression deregulation in human breast cancer. Cancer Res, 65, 70657070.
Iwai, N. and Naraba, H. (2005) Polymorphisms in human pre-miRNAs.
Biochem Biophys Res Commun, 331, 1439-1444.
Jakymiw, A., Lian, S., Eystathioy, T., Li, S., Satoh, M., Hamel, J.C., Fritzler, M.J.
and Chan, E.K. (2005) Disruption of GW bodies impairs mammalian
RNA interference. Nat Cell Biol, 7, 1267-1274.
James, C., Ugo, V., Le Couedic, J.P., Staerk, J., Delhommeau, F., Lacout, C.,
Garcon, L., Raslova, H., Berger, R., Bennaceur-Griscelli, A., Villeval, J.L.,
Constantinescu, S.N., Casadevall, N. and Vainchenker, W. (2005) A
unique clonal JAK2 mutation leading to constitutive signalling causes
polycythaemia vera. Nature, 434, 1144-1148.
Johnson, S.M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A.,
Labourier, E., Reinert, K.L., Brown, D. and Slack, F.J. (2005) RAS is
regulated by the let-7 microRNA family. Cell, 120, 635-647.
Kallies, A., Hasbold, J., Fairfax, K., Pridans, C., Emslie, D., McKenzie, B.S.,
Lew, A.M., Corcoran, L.M., Hodgkin, P.D., Tarlinton, D.M. and Nutt,
S.L. (2007) Initiation of plasma-cell differentiation is independent of the
transcription factor Blimp-1. Immunity, 26, 555-566.
Kamps, M.P., Murre, C., Sun, X.H. and Baltimore, D. (1990) A new homeobox
gene contributes the DNA binding domain of the t(1;19) translocation
protein in pre-B ALL. Cell, 60, 547-555.
Kamps, M.P., Wright, D.D. and Lu, Q. (1996) DNA-binding by oncoprotein
E2a-Pbx1 is important for blocking differentiation but dispensable for
fibroblast transformation. Oncogene, 12, 19-30.
Kantarjian, H.M., Talpaz, M., Dhingra, K., Estey, E., Keating, M.J., Ku, S.,
Trujillo, J., Huh, Y., Stass, S. and Kurzrock, R. (1991) Significance of the
136
Références bibliographiques
P210 versus P190 molecular abnormalities in adults with Philadelphia
chromosome-positive acute leukemia. Blood, 78, 2411-2418.
Karube, Y., Tanaka, H., Osada, H., Tomida, S., Tatematsu, Y., Yanagisawa, K.,
Yatabe, Y., Takamizawa, J., Miyoshi, S., Mitsudomi, T. and Takahashi, T.
(2005) Reduced expression of Dicer associated with poor prognosis in
lung cancer patients. Cancer Sci, 96, 111-115.
Kasper, L.H., Brindle, P.K., Schnabel, C.A., Pritchard, C.E., Cleary, M.L. and
van Deursen, J.M. (1999) CREB binding protein interacts with
nucleoporin-specific FG repeats that activate transcription and mediate
NUP98-HOXA9 oncogenicity. Mol Cell Biol, 19, 764-776.
Kiriakidou, M., Nelson, P.T., Kouranov, A., Fitziev, P., Bouyioukos, C.,
Mourelatos, Z. and Hatzigeorgiou, A. (2004) A combined
computational-experimental approach predicts human microRNA
targets. Genes Dev, 18, 1165-1178.
Kiriakidou, M., Tan, G.S., Lamprinaki, S., De Planell-Saguer, M., Nelson, P.T.
and Mourelatos, Z. (2007) An mRNA m7G cap binding-like motif within
human Ago2 represses translation. Cell, 129, 1141-1151.
Kisseleva, T., Bhattacharya, S., Braunstein, J. and Schindler, C.W. (2002)
Signaling through the JAK/STAT pathway, recent advances and future
challenges. Gene, 285, 1-24.
Kozmik, Z., Wang, S., Dorfler, P., Adams, B. and Busslinger, M. (1992) The
promoter of the CD19 gene is a target for the B-cell-specific transcription
factor BSAP. Mol Cell Biol, 12, 2662-2672.
Kralovics, R., Passamonti, F., Buser, A.S., Teo, S.S., Tiedt, R., Passweg, J.R.,
Tichelli, A., Cazzola, M. and Skoda, R.C. (2005) A gain-of-function
mutation of JAK2 in myeloproliferative disorders. N Engl J Med, 352,
1779-1790.
Kroll, T.G., Sarraf, P., Pecciarini, L., Chen, C.J., Mueller, E., Spiegelman, B.M.
and Fletcher, J.A. (2000) PAX8-PPARgamma1 fusion oncogene in
human thyroid carcinoma [corrected]. Science, 289, 1357-1360.
Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T. and Sauvageau, G.
(2001) NUP98-HOXA9 expression in hemopoietic stem cells induces
chronic and acute myeloid leukemias in mice. Embo J, 20, 350-361.
Kuhn, D.E., Nuovo, G.J., Martin, M.M., Malana, G.E., Pleister, A.P., Jiang, J.,
Schmittgen, T.D., Terry, A.V., Jr., Gardiner, K., Head, E., Feldman, D.S.
and Elton, T.S. (2008) Human chromosome 21-derived miRNAs are
overexpressed in down syndrome brains and hearts. Biochem Biophys Res
Commun.
137
Références bibliographiques
La Starza, R., Rosati, R., Roti, G., Gorello, P., Bardi, A., Crescenzi, B., Pierini,
V., Calabrese, O., Baens, M., Folens, C., Cools, J., Marynen, P., Martelli,
M.F., Mecucci, C. and Cuneo, A. (2007) A new NDE1/PDGFRB fusion
transcript underlying chronic myelomonocytic leukaemia in Noonan
Syndrome. Leukemia, 21, 830-833.
Lacayo, N.J., Meshinchi, S., Kinnunen, P., Yu, R., Wang, Y., Stuber, C.M.,
Douglas, L., Wahab, R., Becton, D.L., Weinstein, H., Chang, M.N.,
Willman, C.L., Radich, J.P., Tibshirani, R., Ravindranath, Y., Sikic, B.I.
and Dahl, G.V. (2004) Gene expression profiles at diagnosis in de novo
childhood AML patients identify FLT3 mutations with good clinical
outcomes. Blood, 104, 2646-2654.
Lacroix, L., Lazar, V., Michiels, S., Ripoche, H., Dessen, P., Talbot, M., Caillou,
B., Levillain, J.P., Schlumberger, M. and Bidart, J.M. (2005) Follicular
thyroid tumors with the PAX8-PPARgamma1 rearrangement display
characteristic genetic alterations. Am J Pathol, 167, 223-231.
Lacronique, V., Boureux, A., Valle, V.D., Poirel, H., Quang, C.T., Mauchauffe,
M., Berthou, C., Lessard, M., Berger, R., Ghysdael, J. and Bernard, O.A.
(1997) A TEL-JAK2 fusion protein with constitutive kinase activity in
human leukemia. Science, 278, 1309-1312.
Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W. and
Tuschl, T. (2002) Identification of tissue-specific microRNAs from
mouse. Curr Biol, 12, 735-739.
Lallemand-Breitenbach, V., Zhu, J., Kogan, S., Chen, Z. and de The, H. (2005)
Opinion: how patients have benefited from mouse models of acute
promyelocytic leukaemia. Nat Rev Cancer, 5, 821-827.
Le Douarin, B., Zechel, C., Garnier, J.M., Lutz, Y., Tora, L., Pierrat, P., Heery,
D., Gronemeyer, H., Chambon, P. and Losson, R. (1995) The N-terminal
part of TIF1, a putative mediator of the ligand-dependent activation
function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic
protein T18. Embo J, 14, 2020-2033.
Lee, R.C., Feinbaum, R.L. and Ambros, V. (1993) The C. elegans heterochronic
gene lin-4 encodes small RNAs with antisense complementarity to lin14. Cell, 75, 843-854.
Lee, Y., Kim, M., Han, J., Yeom, K.H., Lee, S., Baek, S.H. and Kim, V.N. (2004)
MicroRNA genes are transcribed by RNA polymerase II. Embo J, 23,
4051-4060.
Lee, Y.S., Kim, H.K., Chung, S., Kim, K.S. and Dutta, A. (2005) Depletion of
human micro-RNA miR-125b reveals that it is critical for the
138
Références bibliographiques
proliferation of differentiated cells but not for the down-regulation of
putative targets during differentiation. J Biol Chem, 280, 16635-16641.
Leonard, W.J. and O'Shea, J.J. (1998) Jaks and STATs: biological implications.
Annu Rev Immunol, 16, 293-322.
Lewis, B.P., Burge, C.B. and Bartel, D.P. (2005) Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes are
microRNA targets. Cell, 120, 15-20.
Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A., Schelter, J.M., Castle, J.,
Bartel, D.P., Linsley, P.S. and Johnson, J.M. (2005) Microarray analysis
shows that some microRNAs downregulate large numbers of target
mRNAs. Nature, 433, 769-773.
Liu, J., Carmell, M.A., Rivas, F.V., Marsden, C.G., Thomson, J.M., Song, J.J.,
Hammond, S.M., Joshua-Tor, L. and Hannon, G.J. (2004) Argonaute2 is
the catalytic engine of mammalian RNAi. Science, 305, 1437-1441.
Liu, J., Rivas, F.V., Wohlschlegel, J., Yates, J.R., 3rd, Parker, R. and Hannon,
G.J. (2005) A role for the P-body component GW182 in microRNA
function. Nat Cell Biol, 7, 1261-1266.
Liu, K.D., Gaffen, S.L. and Goldsmith, M.A. (1998) JAK/STAT signaling by
cytokine receptors. Curr Opin Immunol, 10, 271-278.
Lujambio, A., Ropero, S., Ballestar, E., Fraga, M.F., Cerrato, C., Setien, F.,
Casado, S., Suarez-Gauthier, A., Sanchez-Cespedes, M., Git, A., Spiteri,
I., Das, P.P., Caldas, C., Miska, E. and Esteller, M. (2007) Genetic
unmasking of an epigenetically silenced microRNA in human cancer
cells. Cancer Res, 67, 1424-1429.
Lytle, J.R., Yario, T.A. and Steitz, J.A. (2007) Target mRNAs are repressed as
efficiently by microRNA-binding sites in the 5' UTR as in the 3' UTR.
Proc Natl Acad Sci U S A, 104, 9667-9672.
Manning, G., Whyte, D.B., Martinez, R., Hunter, T. and Sudarsanam, S. (2002)
The protein kinase complement of the human genome. Science, 298,
1912-1934.
Margue, C.M., Bernasconi, M., Barr, F.G. and Schafer, B.W. (2000)
Transcriptional modulation of the anti-apoptotic protein BCL-XL by the
paired box transcription factors PAX3 and PAX3/FKHR. Oncogene, 19,
2921-2929.
Maroney, P.A., Yu, Y., Fisher, J. and Nilsen, T.W. (2006) Evidence that
microRNAs are associated with translating messenger RNAs in human
cells. Nat Struct Mol Biol, 13, 1102-1107.
139
Références bibliographiques
Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R. and Tuschl, T. (2002)
Single-stranded antisense siRNAs guide target RNA cleavage in RNAi.
Cell, 110, 563-574.
Mathonnet, G., Fabian, M.R., Svitkin, Y.V., Parsyan, A., Huck, L., Murata, T.,
Biffo, S., Merrick, W.C., Darzynkiewicz, E., Pillai, R.S., Filipowicz, W.,
Duchaine, T.F. and Sonenberg, N. (2007) MicroRNA inhibition of
translation initiation in vitro by targeting the cap-binding complex
eIF4F. Science, 317, 1764-1767.
Mattie, M.D., Benz, C.C., Bowers, J., Sensinger, K., Wong, L., Scott, G.K.,
Fedele, V., Ginzinger, D., Getts, R. and Haqq, C. (2006) Optimized highthroughput microRNA expression profiling provides novel biomarker
assessment of clinical prostate and breast cancer biopsies. Mol Cancer, 5,
24.
Mayr, C., Hemann, M.T. and Bartel, D.P. (2007) Disrupting the pairing
between let-7 and Hmga2 enhances oncogenic transformation. Science,
315, 1576-1579.
McWhirter, J.R., Galasso, D.L. and Wang, J.Y. (1993) A coiled-coil
oligomerization domain of Bcr is essential for the transforming function
of Bcr-Abl oncoproteins. Mol Cell Biol, 13, 7587-7595.
Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G. and
Tuschl, T. (2004) Human Argonaute2 mediates RNA cleavage targeted
by miRNAs and siRNAs. Mol Cell, 15, 185-197.
Meister, G., Landthaler, M., Peters, L., Chen, P.Y., Urlaub, H., Luhrmann, R.
and Tuschl, T. (2005) Identification of novel argonaute-associated
proteins. Curr Biol, 15, 2149-2155.
Meister, G. (2007) miRNAs get an early start on translational silencing. Cell,
131, 25-28.
Mello, C.C. and Conte, D., Jr. (2004) Revealing the world of RNA interference.
Nature, 431, 338-342.
Meyer, C., Schneider, B., Jakob, S., Strehl, S., Attarbaschi, A., Schnittger, S.,
Schoch, C., Jansen, M.W., van Dongen, J.J., den Boer, M.L., Pieters, R.,
Ennas, M.G., Angelucci, E., Koehl, U., Greil, J., Griesinger, F., Zur Stadt,
U., Eckert, C., Szczepanski, T., Niggli, F.K., Schafer, B.W., Kempski, H.,
Brady, H.J., Zuna, J., Trka, J., Nigro, L.L., Biondi, A., Delabesse, E.,
Macintyre, E., Stanulla, M., Schrappe, M., Haas, O.A., Burmeister, T.,
Dingermann, T., Klingebiel, T. and Marschalek, R. (2006) The MLL
recombinome of acute leukemias. Leukemia, 20, 777-784.
Mizuno, Y., Yagi, K., Tokuzawa, Y., Kanesaki-Yatsuka, Y., Suda, T., Katagiri,
T., Fukuda, T., Maruyama, M., Okuda, A., Amemiya, T., Kondoh, Y.,
140
Références bibliographiques
Tashiro, H. and Okazaki, Y. (2008) miR-125b inhibits osteoblastic
differentiation by down-regulation of cell proliferation. Biochem Biophys
Res Commun, 368, 267-272.
Monica, K., LeBrun, D.P., Dedera, D.A., Brown, R. and Cleary, M.L. (1994)
Transformation properties of the E2a-Pbx1 chimeric oncoprotein: fusion
with E2a is essential, but the Pbx1 homeodomain is dispensable. Mol Cell
Biol, 14, 8304-8314.
Morris, S.W., Kirstein, M.N., Valentine, M.B., Dittmer, K.G., Shapiro, D.N.,
Saltman, D.L. and Look, A.T. (1994) Fusion of a kinase gene, ALK, to a
nucleolar protein gene, NPM, in non-Hodgkin's lymphoma. Science, 263,
1281-1284.
Morrow, M., Horton, S., Kioussis, D., Brady, H.J. and Williams, O. (2004) TELAML1 promotes development of specific hematopoietic lineages
consistent with preleukemic activity. Blood, 103, 3890-3896.
Moss, E.G. and Tang, L. (2003) Conservation of the heterochronic regulator
Lin-28, its developmental expression and microRNA complementary
sites. Dev Biol, 258, 432-442.
Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L.,
Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) miRNPs: a novel class
of ribonucleoproteins containing numerous microRNAs. Genes Dev, 16,
720-728.
Mullighan, C.G., Goorha, S., Radtke, I., Miller, C.B., Coustan-Smith, E., Dalton,
J.D., Girtman, K., Mathew, S., Ma, J., Pounds, S.B., Su, X., Pui, C.H.,
Relling, M.V., Evans, W.E., Shurtleff, S.A. and Downing, J.R. (2007)
Genome-wide analysis of genetic alterations in acute lymphoblastic
leukaemia. Nature, 446, 758-764.
Murati, A., Gelsi-Boyer, V., Adelaide, J., Perot, C., Talmant, P., Giraudier, S.,
Lode, L., Letessier, A., Delaval, B., Brunel, V., Imbert, M., Garand, R.,
Xerri, L., Birnbaum, D., Mozziconacci, M.J. and Chaffanet, M. (2005)
PCM1-JAK2 fusion in myeloproliferative disorders and acute erythroid
leukemia with t(8;9) translocation. Leukemia, 19, 1692-1696.
Nebral, K., Konig, M., Harder, L., Siebert, R., Haas, O.A. and Strehl, S. (2007)
Identification of PML as novel PAX5 fusion partner in childhood acute
lymphoblastic leukaemia. Br J Haematol, 139, 269-274.
Nelson, P.T., Baldwin, D.A., Kloosterman, W.P., Kauppinen, S., Plasterk, R.H.
and Mourelatos, Z. (2006) RAKE and LNA-ISH reveal microRNA
expression and localization in archival human brain. Rna, 12, 187-191.
141
Références bibliographiques
Nera, K.P., Kohonen, P., Narvi, E., Peippo, A., Mustonen, L., Terho, P.,
Koskela, K., Buerstedde, J.M. and Lassila, O. (2006) Loss of Pax5
promotes plasma cell differentiation. Immunity, 24, 283-293.
Nottrott, S., Simard, M.J. and Richter, J.D. (2006) Human let-7a miRNA blocks
protein production on actively translating polyribosomes. Nat Struct Mol
Biol, 13, 1108-1114.
Nowell, P.C. (2007) Discovery of the Philadelphia chromosome: a personal
perspective. J Clin Invest, 117, 2033-2035.
Nutt, S.L. (2008) B-cell identity--commitment is not forever. N Engl J Med, 358,
82-83.
Nutt, S.L. and Kee, B.L. (2007) The transcriptional regulation of B cell lineage
commitment. Immunity, 26, 715-725.
Nutt, S.L., Heavey, B., Rolink, A.G. and Busslinger, M. (1999) Commitment to
the B-lymphoid lineage depends on the transcription factor Pax5.
Nature, 401, 556-562.
Nutt, S.L., Morrison, A.M., Dorfler, P., Rolink, A. and Busslinger, M. (1998)
Identification of BSAP (Pax-5) target genes in early B-cell development
by loss- and gain-of-function experiments. Embo J, 17, 2319-2333.
Nutt, S.L., Urbanek, P., Rolink, A. and Busslinger, M. (1997) Essential
functions of Pax5 (BSAP) in pro-B cell development: difference between
fetal and adult B lymphopoiesis and reduced V-to-DJ recombination at
the IgH locus. Genes Dev, 11, 476-491.
O'Connell, R.M., Rao, D.S., Chaudhuri, A.A., Boldin, M.P., Taganov, K.D.,
Nicoll, J., Paquette, R.L. and Baltimore, D. (2008) Sustained expression of
microRNA-155 in hematopoietic stem cells causes a myeloproliferative
disorder. J Exp Med, 205, 585-594.
O'Donnell, K.A., Wentzel, E.A., Zeller, K.I., Dang, C.V. and Mendell, J.T. (2005)
c-Myc-regulated microRNAs modulate E2F1 expression. Nature, 435,
839-843.
O'Riordan, M. and Grosschedl, R. (1999) Coordinate regulation of B cell
differentiation by the transcription factors EBF and E2A. Immunity, 11,
21-31.
O'Shea, J.J., Gadina, M. and Schreiber, R.D. (2002) Cytokine signaling in 2002:
new surprises in the Jak/Stat pathway. Cell, 109 Suppl, S121-131.
Ohno, H., Furukawa, T., Fukuhara, S., Zong, S.Q., Kamesaki, H., Shows, T.B.,
Le Beau, M.M., McKeithan, T.W., Kawakami, T. and Honjo, T. (1990)
Molecular analysis of a chromosomal translocation, t(9;14)(p13;q32), in a
diffuse large-cell lymphoma cell line expressing the Ki-1 antigen. Proc
Natl Acad Sci U S A, 87, 628-632.
142
Références bibliographiques
Okuda, K., Golub, T.R., Gilliland, D.G. and Griffin, J.D. (1996) p210BCR/ABL,
p190BCR/ABL, and TEL/ABL activate similar signal transduction
pathways in hematopoietic cell lines. Oncogene, 13, 1147-1152.
Olsen, P.H. and Ambros, V. (1999) The lin-4 regulatory RNA controls
developmental timing in Caenorhabditis elegans by blocking LIN-14
protein synthesis after the initiation of translation. Dev Biol, 216, 671-680.
Ota, A., Tagawa, H., Karnan, S., Tsuzuki, S., Karpas, A., Kira, S., Yoshida, Y.
and Seto, M. (2004) Identification and characterization of a novel gene,
C13orf25, as a target for 13q31-q32 amplification in malignant
lymphoma. Cancer Res, 64, 3087-3095.
Parker, J.S., Roe, S.M. and Barford, D. (2004) Crystal structure of a PIWI
protein suggests mechanisms for siRNA recognition and slicer activity.
Embo J, 23, 4727-4737.
Peeters, P., Raynaud, S.D., Cools, J., Wlodarska, I., Grosgeorge, J., Philip, P.,
Monpoux, F., Van Rompaey, L., Baens, M., Van den Berghe, H. and
Marynen, P. (1997) Fusion of TEL, the ETS-variant gene 6 (ETV6), to the
receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and
t(9;15;12) in a myeloid leukemia. Blood, 90, 2535-2540.
Pekarsky, Y., Santanam, U., Cimmino, A., Palamarchuk, A., Efanov, A.,
Maximov, V., Volinia, S., Alder, H., Liu, C.G., Rassenti, L., Calin, G.A.,
Hagan, J.P., Kipps, T. and Croce, C.M. (2006) Tcl1 expression in chronic
lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res,
66, 11590-11593.
Pelz, A.F., Kroning, H., Franke, A., Wieacker, P. and Stumm, M. (2002) High
reliability and sensitivity of the BCR/ABL1 D-FISH test for the detection
of BCR/ABL rearrangements. Ann Hematol, 81, 147-153.
Petersen, C.P., Bordeleau, M.E., Pelletier, J. and Sharp, P.A. (2006) Short RNAs
repress translation after initiation in mammalian cells. Mol Cell, 21, 533542.
Pillai, R.S., Artus, C.G. and Filipowicz, W. (2004) Tethering of human Ago
proteins to mRNA mimics the miRNA-mediated repression of protein
synthesis. Rna, 10, 1518-1525.
Pillai, R.S., Bhattacharyya, S.N., Artus, C.G., Zoller, T., Cougot, N., Basyuk, E.,
Bertrand, E. and Filipowicz, W. (2005) Inhibition of translational
initiation by Let-7 MicroRNA in human cells. Science, 309, 1573-1576.
Popovici, C., Zhang, B., Gregoire, M.J., Jonveaux, P., Lafage-Pochitaloff, M.,
Birnbaum, D. and Pebusque, M.J. (1999) The t(6;8)(q27;p11)
translocation in a stem cell myeloproliferative disorder fuses a novel
gene, FOP, to fibroblast growth factor receptor 1. Blood, 93, 1381-1389.
143
Références bibliographiques
Rabbitts, T.H. (1991) Translocations, master genes, and differences between
the origins of acute and chronic leukemias. Cell, 67, 641-644.
Reddy, E.P., Smith, M.J. and Srinivasan, A. (1983) Nucleotide sequence of
Abelson murine leukemia virus genome: structural similarity of its
transforming gene product to other onc gene products with tyrosinespecific kinase activity. Proc Natl Acad Sci U S A, 80, 3623-3627.
Reiter, A., Walz, C., Watmore, A., Schoch, C., Blau, I., Schlegelberger, B.,
Berger, U., Telford, N., Aruliah, S., Yin, J.A., Vanstraelen, D., Barker,
H.F., Taylor, P.C., O'Driscoll, A., Benedetti, F., Rudolph, C., Kolb, H.J.,
Hochhaus, A., Hehlmann, R., Chase, A. and Cross, N.C. (2005) The
t(8;9)(p22;p24) is a recurrent abnormality in chronic and acute leukemia
that fuses PCM1 to JAK2. Cancer Res, 65, 2662-2667.
Richardson, C. and Jasin, M. (2000) Frequent chromosomal translocations
induced by DNA double-strand breaks. Nature, 405, 697-700.
Richter, J.D. and Sonenberg, N. (2005) Regulation of cap-dependent translation
by eIF4E inhibitory proteins. Nature, 433, 477-480.
Robson, E.J., He, S.J. and Eccles, M.R. (2006) A PANorama of PAX genes in cancer and
development. Nat Rev Cancer, 6, 52-62.
Rodrigues, G.A. and Park, M. (1994) Oncogenic activation of tyrosine kinases.
Curr Opin Genet Dev, 4, 15-24.
Roessler, S., Gyory, I., Imhof, S., Spivakov, M., Williams, R.R., Busslinger, M.,
Fisher, A.G. and Grosschedl, R. (2007) Distinct promoters mediate the
regulation of Ebf1 gene expression by interleukin-7 and Pax5. Mol Cell
Biol, 27, 579-594.
Rolink, A.G. (2004) B-cell development and pre-B-1 cell plasticity in vitro.
Methods Mol Biol, 271, 271-281.
Rolink, A.G., Nutt, S.L., Melchers, F. and Busslinger, M. (1999) Long-term in
vivo reconstitution of T-cell development by Pax5-deficient B-cell
progenitors. Nature, 401, 603-606.
Romana, S.P., Mauchauffe, M., Le Coniat, M., Chumakov, I., Le Paslier, D.,
Berger, R. and Bernard, O.A. (1995) The t(12;21) of acute lymphoblastic
leukemia results in a tel-AML1 gene fusion. Blood, 85, 3662-3670.
Rosenbloom, J. (1984) Elastin: relation of protein and gene structure to disease.
Lab Invest, 51, 605-623.
Ross, M.E., Zhou, X., Song, G., Shurtleff, S.A., Girtman, K., Williams, W.K.,
Liu, H.C., Mahfouz, R., Raimondi, S.C., Lenny, N., Patel, A. and
Downing, J.R. (2003) Classification of pediatric acute lymphoblastic
leukemia by gene expression profiling. Blood, 102, 2951-2959.
144
Références bibliographiques
Rowley, J.D. (1973) Letter: A new consistent chromosomal abnormality in
chronic myelogenous leukaemia identified by quinacrine fluorescence
and Giemsa staining. Nature, 243, 290-293.
Safley, A.M., Sebastian, S., Collins, T.S., Tirado, C.A., Stenzel, T.T., Gong, J.Z.
and Goodman, B.K. (2004) Molecular and cytogenetic characterization of
a novel translocation t(4;22) involving the breakpoint cluster region and
platelet-derived growth factor receptor-alpha genes in a patient with
atypical chronic myeloid leukemia. Genes Chromosomes Cancer, 40, 44-50.
Saharinen, P., Takaluoma, K. and Silvennoinen, O. (2000) Regulation of the
Jak2 tyrosine kinase by its pseudokinase domain. Mol Cell Biol, 20, 33873395.
Saharinen, P., Vihinen, M. and Silvennoinen, O. (2003) Autoinhibition of Jak2
tyrosine kinase is dependent on specific regions in its pseudokinase
domain. Mol Biol Cell, 14, 1448-1459.
Saito, Y., Liang, G., Egger, G., Friedman, J.M., Chuang, J.C., Coetzee, G.A. and
Jones, P.A. (2006) Specific activation of microRNA-127 with
downregulation of the proto-oncogene BCL6 by chromatin-modifying
drugs in human cancer cells. Cancer Cell, 9, 435-443.
Sawyers, C.L., Denny, C.T. and Witte, O.N. (1991) Leukemia and the
disruption of normal hematopoiesis. Cell, 64, 337-350.
Schebesta, A., McManus, S., Salvagiotto, G., Delogu, A., Busslinger, G.A. and
Busslinger, M. (2007) Transcription factor Pax5 activates the chromatin
of key genes involved in B cell signaling, adhesion, migration, and
immune function. Immunity, 27, 49-63.
Schebesta, M., Pfeffer, P.L. and Busslinger, M. (2002) Control of pre-BCR
signaling by Pax5-dependent activation of the BLNK gene. Immunity, 17,
473-485.
Scheidler, S., Fredericks, W.J., Rauscher, F.J., 3rd, Barr, F.G. and Vogt, P.K.
(1996) The hybrid PAX3-FKHR fusion protein of alveolar
rhabdomyosarcoma transforms fibroblasts in culture. Proc Natl Acad Sci
U S A, 93, 9805-9809.
Schlessinger, J. and Ullrich, A. (1992) Growth factor signaling by receptor
tyrosine kinases. Neuron, 9, 383-391.
Schmitter, D., Filkowski, J., Sewer, A., Pillai, R.S., Oakeley, E.J., Zavolan, M.,
Svoboda, P. and Filipowicz, W. (2006) Effects of Dicer and Argonaute
down-regulation on mRNA levels in human HEK293 cells. Nucleic Acids
Res, 34, 4801-4815.
Schoenmakers, E.F., Wanschura, S., Mols, R., Bullerdiek, J., Van den Berghe, H.
and Van de Ven, W.J. (1995) Recurrent rearrangements in the high
145
Références bibliographiques
mobility group protein gene, HMGI-C, in benign mesenchymal
tumours. Nat Genet, 10, 436-444.
Schwaller, J., Frantsve, J., Aster, J., Williams, I.R., Tomasson, M.H., Ross, T.S.,
Peeters, P., Van Rompaey, L., Van Etten, R.A., Ilaria, R., Jr., Marynen, P.
and Gilliland, D.G. (1998) Transformation of hematopoietic cell lines to
growth-factor independence and induction of a fatal myelo- and
lymphoproliferative disease in mice by retrovirally transduced
TEL/JAK2 fusion genes. Embo J, 17, 5321-5333.
Scott, G.K., Goga, A., Bhaumik, D., Berger, C.E., Sullivan, C.S. and Benz, C.C.
(2007) Coordinate suppression of ERBB2 and ERBB3 by enforced
expression of micro-RNA miR-125a or miR-125b. J Biol Chem, 282, 14791486.
Scott, G.K., Mattie, M.D., Berger, C.E., Benz, S.C. and Benz, C.C. (2006) Rapid
alteration of microRNA levels by histone deacetylase inhibition. Cancer
Res, 66, 1277-1281.
Seet, C.S., Brumbaugh, R.L. and Kee, B.L. (2004) Early B cell factor promotes B
lymphopoiesis with reduced interleukin 7 responsiveness in the absence
of E2A. J Exp Med, 199, 1689-1700.
Seggerson, K., Tang, L. and Moss, E.G. (2002) Two genetic circuits repress the
Caenorhabditis elegans heterochronic gene lin-28 after translation
initiation. Dev Biol, 243, 215-225.
Sen, G.L. and Blau, H.M. (2005) Argonaute 2/RISC resides in sites of
mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol, 7,
633-636.
Sheth, U. and Parker, R. (2003) Decapping and decay of messenger RNA occur
in cytoplasmic processing bodies. Science, 300, 805-808.
Shi, X.B., Xue, L., Yang, J., Ma, A.H., Zhao, J., Xu, M., Tepper, C.G., Evans,
C.P., Kung, H.J. and deVere White, R.W. (2007) An androgen-regulated
miRNA suppresses Bak1 expression and induces androgen-independent
growth of prostate cancer cells. Proc Natl Acad Sci U S A, 104, 1998319988.
Shuai, K. and Liu, B. (2003) Regulation of JAK-STAT signalling in the immune
system. Nat Rev Immunol, 3, 900-911.
Smith, J.M. and Mayer, B.J. (2002) Abl: mechanisms of regulation and
activation. Front Biosci, 7, d31-42.
Song, J.J., Smith, S.K., Hannon, G.J. and Joshua-Tor, L. (2004) Crystal structure
of Argonaute and its implications for RISC slicer activity. Science, 305,
1434-1437.
146
Références bibliographiques
Sonoki, T., Iwanaga, E., Mitsuya, H. and Asou, N. (2005) Insertion of
microRNA-125b-1, a human homologue of lin-4, into a rearranged
immunoglobulin heavy chain gene locus in a patient with precursor Bcell acute lymphoblastic leukemia. Leukemia, 19, 2009-2010.
Sorensen, P.H., Lynch, J.C., Qualman, S.J., Tirabosco, R., Lim, J.F., Maurer,
H.M., Bridge, J.A., Crist, W.M., Triche, T.J. and Barr, F.G. (2002) PAX3FKHR and PAX7-FKHR gene fusions are prognostic indicators in
alveolar rhabdomyosarcoma: a report from the children's oncology
group. J Clin Oncol, 20, 2672-2679.
Souabni, A., Cobaleda, C., Schebesta, M. and Busslinger, M. (2002) Pax5
promotes B lymphopoiesis and blocks T cell development by repressing
Notch1. Immunity, 17, 781-793.
Souabni, A., Jochum, W. and Busslinger, M. (2007) Oncogenic role of Pax5 in
the T-lymphoid lineage upon ectopic expression from the
immunoglobulin heavy-chain locus. Blood, 109, 281-289.
Strehl, S., Konig, M., Dworzak, M.N., Kalwak, K. and Haas, O.A. (2003)
PAX5/ETV6 fusion defines cytogenetic entity dic(9;12)(p13;p13).
Leukemia, 17, 1121-1123.
Streubel, B., Vinatzer, U., Lamprecht, A., Raderer, M. and Chott, A. (2005)
T(3;14)(p14.1;q32) involving IGH and FOXP1 is a novel recurrent
chromosomal aberration in MALT lymphoma. Leukemia, 19, 652-658.
Strissel, P.L., Strick, R., Rowley, J.D. and Zeleznik-Le, N.J. (1998) An in vivo
topoisomerase II cleavage site and a DNase I hypersensitive site
colocalize near exon 9 in the MLL breakpoint cluster region. Blood, 92,
3793-3803.
Sugito, N., Ishiguro, H., Kuwabara, Y., Kimura, M., Mitsui, A., Kurehara, H.,
Ando, T., Mori, R., Takashima, N., Ogawa, R. and Fujii, Y. (2006)
RNASEN regulates cell proliferation and affects survival in esophageal
cancer patients. Clin Cancer Res, 12, 7322-7328.
Tagoh, H., Ingram, R., Wilson, N., Salvagiotto, G., Warren, A.J., Clarke, D.,
Busslinger, M. and Bonifer, C. (2006) The mechanism of repression of
the myeloid-specific c-fms gene by Pax5 during B lineage restriction.
Embo J, 25, 1070-1080.
Tallman, M.S., Andersen, J.W., Schiffer, C.A., Appelbaum, F.R., Feusner, J.H.,
Woods, W.G., Ogden, A., Weinstein, H., Shepherd, L., Willman, C.,
Bloomfield, C.D., Rowe, J.M. and Wiernik, P.H. (2002) All-trans retinoic
acid in acute promyelocytic leukemia: long-term outcome and
prognostic factor analysis from the North American Intergroup
protocol. Blood, 100, 4298-4302.
147
Références bibliographiques
Tokoyoda, K., Egawa, T., Sugiyama, T., Choi, B.I. and Nagasawa, T. (2004)
Cellular niches controlling B lymphocyte behavior within bone marrow
during development. Immunity, 20, 707-718.
Tomari, Y. and Zamore, P.D. (2005) MicroRNA biogenesis: drosha can't cut it
without a partner. Curr Biol, 15, R61-64.
Tosi, S., Giudici, G., Mosna, G., Harbott, J., Specchia, G., Grosveld, G.,
Privitera, E., Kearney, L., Biondi, A. and Cazzaniga, G. (1998)
Identification of new partner chromosomes involved in fusions with the
ETV6 (TEL) gene in hematologic malignancies. Genes Chromosomes
Cancer, 21, 223-229.
Trempat, P., Villalva, C., Laurent, G., Armstrong, F., Delsol, G., Dastugue, N.
and Brousset, P. (2003) Chronic myeloproliferative disorders with
rearrangement of the platelet-derived growth factor alpha receptor: a
new clinical target for STI571/Glivec. Oncogene, 22, 5702-5706.
Tsujimoto, Y., Yunis, J., Onorato-Showe, L., Erikson, J., Nowell, P.C. and
Croce, C.M. (1984) Molecular cloning of the chromosomal breakpoint of
B-cell lymphomas and leukemias with the t(11;14) chromosome
translocation. Science, 224, 1403-1406.
Tsuzuki, S., Seto, M., Greaves, M. and Enver, T. (2004) Modeling first-hit
functions of the t(12;21) TEL-AML1 translocation in mice. Proc Natl Acad
Sci U S A, 101, 8443-8448.
Urbanek, P., Wang, Z.Q., Fetka, I., Wagner, E.F. and Busslinger, M. (1994)
Complete block of early B cell differentiation and altered patterning of
the posterior midbrain in mice lacking Pax5/BSAP. Cell, 79, 901-912.
Vasudevan, S. and Steitz, J.A. (2007) AU-rich-element-mediated upregulation
of translation by FXR1 and Argonaute 2. Cell, 128, 1105-1118.
Vasudevan, S., Tong, Y. and Steitz, J.A. (2007) Switching from repression to
activation: microRNAs can up-regulate translation. Science, 318, 19311934.
Visone, R., Pallante, P., Vecchione, A., Cirombella, R., Ferracin, M., Ferraro, A.,
Volinia, S., Coluzzi, S., Leone, V., Borbone, E., Liu, C.G., Petrocca, F.,
Troncone, G., Calin, G.A., Scarpa, A., Colato, C., Tallini, G., Santoro, M.,
Croce, C.M. and Fusco, A. (2007) Specific microRNAs are
downregulated in human thyroid anaplastic carcinomas. Oncogene, 26,
7590-7595.
Vizmanos, J.L., Novo, F.J., Roman, J.P., Baxter, E.J., Lahortiga, I., Larrayoz,
M.J., Odero, M.D., Giraldo, P., Calasanz, M.J. and Cross, N.C. (2004)
NIN, a gene encoding a CEP110-like centrosomal protein, is fused to
148
Références bibliographiques
PDGFRB in a patient with a t(5;14)(q33;q24) and an imatinib-responsive
myeloproliferative disorder. Cancer Res, 64, 2673-2676.
Voorhoeve, P.M., le Sage, C., Schrier, M., Gillis, A.J., Stoop, H., Nagel, R., Liu,
Y.P., van Duijse, J., Drost, J., Griekspoor, A., Zlotorynski, E., Yabuta, N.,
De Vita, G., Nojima, H., Looijenga, L.H. and Agami, R. (2006) A genetic
screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular
germ cell tumors. Cell, 124, 1169-1181.
Voss, J., Posern, G., Hannemann, J.R., Wiedemann, L.M., Turhan, A.G., Poirel,
H., Bernard, O.A., Adermann, K., Kardinal, C. and Feller, S.M. (2000)
The leukaemic oncoproteins Bcr-Abl and Tel-Abl (ETV6/Abl) have
altered substrate preferences and activate similar intracellular signalling
pathways. Oncogene, 19, 1684-1690.
Wakiyama, M., Takimoto, K., Ohara, O. and Yokoyama, S. (2007) Let-7
microRNA-mediated mRNA deadenylation and translational repression
in a mammalian cell-free system. Genes Dev, 21, 1857-1862.
Walz, C., Curtis, C., Schnittger, S., Schultheis, B., Metzgeroth, G., Schoch, C.,
Lengfelder, E., Erben, P., Muller, M.C., Haferlach, T., Hochhaus, A.,
Hehlmann, R., Cross, N.C. and Reiter, A. (2006) Transient response to
imatinib in a chronic eosinophilic leukemia associated with
ins(9;4)(q33;q12q25) and a CDK5RAP2-PDGFRA fusion gene. Genes
Chromosomes Cancer, 45, 950-956.
Wang, B., Love, T.M., Call, M.E., Doench, J.G. and Novina, C.D. (2006)
Recapitulation of short RNA-directed translational gene silencing in
vitro. Mol Cell, 22, 553-560.
Wang, B., Weidenfeld, J., Lu, M.M., Maika, S., Kuziel, W.A., Morrisey, E.E. and
Tucker, P.W. (2004) Foxp1 regulates cardiac outflow tract, endocardial
cushion morphogenesis and myocyte proliferation and maturation.
Development, 131, 4477-4487.
Warming, S., Liu, P., Suzuki, T., Akagi, K., Lindtner, S., Pavlakis, G.N.,
Jenkins, N.A. and Copeland, N.G. (2003) Evi3, a common retroviral
integration site in murine B-cell lymphoma, encodes an EBFAZ-related
Kruppel-like zinc finger protein. Blood, 101, 1934-1940.
Wilkinson, K., Velloso, E.R., Lopes, L.F., Lee, C., Aster, J.C., Shipp, M.A. and
Aguiar, R.C. (2003) Cloning of the t(1;5)(q23;q33) in a myeloproliferative
disorder associated with eosinophilia: involvement of PDGFRB and
response to imatinib. Blood, 102, 4187-4190.
Willis, T.G., Jadayel, D.M., Coignet, L.J., Abdul-Rauf, M., Treleaven, J.G.,
Catovsky, D. and Dyer, M.J. (1997) Rapid molecular cloning of
149
Références bibliographiques
rearrangements of the IGHJ locus using long-distance inverse
polymerase chain reaction. Blood, 90, 2456-2464.
Wu, L. and Belasco, J.G. (2005) Micro-RNA regulation of the mammalian lin-28
gene during neuronal differentiation of embryonal carcinoma cells. Mol
Cell Biol, 25, 9198-9208.
Yamamoto, K., Kawano, H., Nishikawa, S., Yakushijin, K., Okamura, A. and
Matsui, T. (2006) A biphenotypic transformation of 8p11
myeloproliferative syndrome with CEP1/FGFR1 fusion gene. Eur J
Haematol, 77, 349-354.
Yamaoka, K., Saharinen, P., Pesu, M., Holt, V.E., 3rd, Silvennoinen, O. and
O'Shea, J.J. (2004) The Janus kinases (Jaks). Genome Biol, 5, 253.
Yang, H., Kong, W., He, L., Zhao, J.J., O'Donnell, J.D., Wang, J., Wenham,
R.M., Coppola, D., Kruk, P.A., Nicosia, S.V. and Cheng, J.Q. (2008)
MicroRNA expression profiling in human ovarian cancer: miR-214
induces cell survival and cisplatin resistance by targeting PTEN. Cancer
Res, 68, 425-433.
Ying, H., Healy, J.I., Goodnow, C.C. and Parnes, J.R. (1998) Regulation of
mouse CD72 gene expression during B lymphocyte development. J
Immunol, 161, 4760-4767.
Yoshida, H., Kitamura, K., Tanaka, K., Omura, S., Miyazaki, T., Hachiya, T.,
Ohno, R. and Naoe, T. (1996) Accelerated degradation of PML-retinoic
acid receptor alpha (PML-RARA) oncoprotein by all-trans-retinoic acid
in acute promyelocytic leukemia: possible role of the proteasome
pathway. Cancer Res, 56, 2945-2948.
Yuan, Y.R., Pei, Y., Ma, J.B., Kuryavyi, V., Zhadina, M., Meister, G., Chen,
H.Y., Dauter, Z., Tuschl, T. and Patel, D.J. (2005) Crystal structure of A.
aeolicus argonaute, a site-specific DNA-guided endoribonuclease,
provides insights into RISC-mediated mRNA cleavage. Mol Cell, 19, 405419.
Zhang, B., Pan, X., Wang, Q., Cobb, G.P. and Anderson, T.A. (2006)
Computational identification of microRNAs and their targets. Comput
Biol Chem, 30, 395-407.
Zhong, S., Salomoni, P. and Pandolfi, P.P. (2000) The transcriptional role of
PML and the nuclear body. Nat Cell Biol, 2, E85-90.
Zhou, Y.J., Chen, M., Cusack, N.A., Kimmel, L.H., Magnuson, K.S., Boyd, J.G.,
Lin, W., Roberts, J.L., Lengi, A., Buckley, R.H., Geahlen, R.L., Candotti,
F., Gadina, M., Changelian, P.S. and O'Shea, J.J. (2001) Unexpected
effects of FERM domain mutations on catalytic activity of Jak3:
structural implication for Janus kinases. Mol Cell, 8, 959-969.
150
Références bibliographiques
Zihni, C., Mitsopoulos, C., Tavares, I.A., Ridley, A.J. and Morris, J.D. (2006)
Prostate-derived sterile 20-like kinase 2 (PSK2) regulates apoptotic
morphology via C-Jun N-terminal kinase and Rho kinase-1. J Biol Chem,
281, 7317-7323.
151
Références bibliographiques
152
Annexes
CHAPITRE 7:
ANNEXES
153
Annexes
154
Correspondence
maternal and paternal alleles at microsatellites at Xq11.2–13
and Xq21.1. The presence of paternal DNA at these loci as well
as at the factor IX gene (shown by heterozygous presence of the
normal gene sequence) ruled out maternal isodisomy of the
entire X chromosome (i.e. two copies of the same X
chromosome from the mother). An explanation that is
consistent with the data is that the patient has segmental
isodisomy for the X chromosome, having inherited one
complete X chromsome from her mother (harbouring a factor
IX mutation), while the other ‘paternal’ X chromosome
actually consists of maternal X chromsome from Xq27.3 down
(Fig 1A).
The patient would in this case still have a normal paternal
factor IX sequence, so to account for the disease phenotype,
X-inactivation studies were again pursued using the GRIA3
locus (at Xq25–26) (Gecz et al, 1999) (see Fig 1B). It can be
seen that the modified paternal chromosome with a maternal
qter is completely inactivated, suggesting that the modification has rendered the chromosome non-viable. This has
allowed complete expression of the maternal X harbouring
the factor IX mutation and hence the haemophilia phenotype.
This is the first report of segmental isodisomy of the X
chromosome.
L. N. Sellner1
P. J. Price2
Departments of 1Molecular Genetics and 2Haematology, Princess
Margaret Hospital for Children, Perth, Australia.
E-mail: [email protected]
References
Gecz, J., Barnett, S., Liu, J., Hollway, G., Donnelly, A., Eyre, H.,
Eshkevari, H., Baltazar, R., Grunn, A., Nagaraja, R., Gilliam, C.,
Peltonen, L., Sutherland, G., Baron, M. & Mulley, J. (1999) Characterization of the human glutamate receptor subunit 3 gene
(GRIA3), a candidate for bipolar disorder and nonspecific X-linked
mental retardation. Genomics, 62, 356–368.
Quan, F., Janas, J., Tith-Fejel, S., Johnson, D.B., Wolford, J.K. &
Popovich, B.W. (1997) Uniparental disomy of the entire X chromosome in a female with Duchenne muscular dystrophy. American
Journal of Human Genetics, 60, 160–165.
Shetty, S., Ghosh, K. & Mohanty, D. (2001) Hemophilia B in a female.
Acta Haematologica, 106, 115–117.
Keywords: haemophilia molecular biology, X-inactivation.
Assessment of somatic mutations in phosphatidylinositol
3-kinase gene in human lymphoma and acute leukaemia
The phosphoinositide 3-kinases (PI3Ks) belong to a group
of lipid kinases that are critical in the regulation of
signalling pathways frequently disrupted in human cancers.
The PI3Ks increase the intracellular concentration of phosphatidylinositol 3,4,5-trisphosphate (PIP3) by phosphorylating PIP2 (Cantley, 2002). The intracellular level of PIP3 is
tightly controlled via the action of PI3Ks and also via the
activation of the PTEN PIP3 phosphatase and the SHIP
phosphatase (Cantley, 2002). Genetic alteration (mutations)
in genes that encode components of class IA PI3Ks are
frequent in certain types of cancers, particularly colorectal
cancers (Samuels et al, 2004). PI3KCA encoding the catalytic
subunit p110a of class IA PI3Ks is either amplified or
overexpressed in tumours (Shayesteh et al, 1999) while the
gene encoding the regulatory subunit p85 of PI3K is
frequently mutated (Philp et al, 2001). Recent observations
(Samuels et al, 2004) showed a high frequency of somatic
missense mutations in the PI3KCA gene in a significant
percentage of brain tumours, colon and gastric carcinomas
whereas they were rarely or not observed in lung and
pancreatic carcinomas. Of interest, in colorectal tumours,
these mutations were much less frequent in tubulovillous
adenomas than in carcinomas strongly suggesting that they
arise late in tumour progression, i.e. during or just before
invasion (Samuels et al, 2004). The latter mutations were
clustered in exons 9 and 20 with three hot spots in residues
E542 (E542K/exon 9), E545 (E545K/exon 9) and H1047
(H1047R/exon 20) (Samuels et al, 2004). More recent
experiments have confirmed the oncogenic properties of
these three mutations leading to constitutive phosphorylation of Akt and activation of the target of rapamycin (TOR)
kinase (Kang et al, 2005). PI3Ks are also implicated in
downstream signalling in lymphoid cells through B and
T-cell receptors (Miller & Berg, 2002). Thus, following
receptor stimulation, s a phosphoinositide 3-kinase (PI3-K)dependent increase in PIP3 levels within the cell membrane
is observed (Miller & Berg, 2002).
Therefore, it is tempting to hypothesise that this enzyme
may play a pivotal role in the development of certain types of
acute leukaemia and lymphoma by bypassing either receptors
ª 2005 Blackwell Publishing Ltd, British Journal of Haematology, 131, 410–413
411
Correspondence
tyrosine kinases, such as FLT3, or BCR and TCR signalling.
Interestingly, PTEN, which shows an inverse effect to PI3Ks,
presents somatic mutations in about 3% of primary non
Hodgkin lymphoma (NHL) (Butler et al, 1999). The low
incidence of PTEN mutations in these tumours suggests that
the PI3-kinase-Akt signalling pathway is elevated, as the
growth regulatory defect in PTEN-mutated cells resemble the
PI3-kinase gain of function mutants (Kang et al, 2005).
The present work screened large series of different subtypes
of NHL and acute myeloid leukaemia (AML) classified
according to the World Health Organization and French–
American–British classifications for the presence of oncogenic
mutations in the PIK3CA gene. Archived tissue of 130 cases of
acute leukaemia, including 14 cases bearing the
t(8;21)(q22;q22) translocation, 20 cases with an inversion of
chromosome 16 (inv16) and 33 cases with an internal tandem
duplication of the FLT3 gene (Table I) was studied. Eighty
cases of NHL of various subtypes were tested in parallel
(Table I). The three mutations of p110a described above were
investigated by polymerase chain reaction (PCR) TaqMan
single-nucleotide polymorphism (SNP) Genotyping Assays
(TaqMan SNP Genotyping Assays are ready-to-use,
TaqMan probe-based assays for genotyping single nucleotide
polymorphisms) (see Supplementary Material). This product
used the 5¢ nuclease assay to discriminate between two alleles
of a specific SNP for use in genotyping studies. Each assay was
a 20· mix of forward primer, reverse primer, 6FAMTM dye Table I. Details of the cases of NHL and AML tested in this study.
Cases
Number
FLT3
t(8;21)
inv16
AML
AML1
AML2
AML4
AML5
AML Biph
NHL
Follicular
MCL
MZL
B-CLL
DLBCL
PTC NOS
ALCL
-ALK+
-ALK)
Rosai Dorfman
Hyperplastic lymph nodes
130
54
38
25
11
2
80
11
9
7
8
18
14
13
11
2
6
4
33
17
5
7
4
0
14
2
12
0
0
0
20
5
4
11
0
0
MGB labelled probe and VIC dye – MGB labelled probe
(http://www.appliedbiosystems.com/). Each probe bound preferentially to one of the alleles. Three controls cases for each
mutation were run in parallel with the latter technique along
with two negative controls (reactive lymph nodes) (Supplementary Material). The positive controls were three cases of
colorectal carcinoma, each with one of the three mutations
(determined by direct sequencing). None of the 210 tumours
tested in this study presented one of the three mutations
(Table S1). Ten cases in each series were randomly controlled
by direct automatic sequencing. Our data strongly suggests
that, in contrast to solid tumours, the PIK3CA gene is not
mutated in haematological malignancies. This information
does not dismiss PIK3CA as irrelevant in cell signalling, as the
integrity of the PI3K-AKT pathway was reported in cell lines
from haematological malignancies (Abbott et al, 2003), but
suggests that other subclasses of kinases might be mutated or
deregulated in haematological malignancy, namely the other
members of classIA PI3Ks (p110b or p110d).
Acknowledgements
This study was supported by grants from l’Institut National du
Cancer (INCa), France.
Marina Bousquet1
Christian Recher1
Cathy Quelen1
Cecile Demur1
Bernard Payrastre1
PierreBrousset1,2
1
AML, acute myeloid leukaemia; Biph, biphenotypic; MCL, mantle cell
lymphoma; MZL, marginal zone lymphoma; DLBCL, diffuse large Bcell lymphoma; PTC NOS, peripheral T-cell lymphoma, not otherwise
specified; ALCL, anaplastic large cell lymphoma; ALK, anaplastic
lymphoma kinase; FLT3, Internal tandem duplication of FLT3 gene;
t(8;21), patients carrying the t(8;21)(q22;q22); inv16, inversion of
chromosome 16; non Hodgkin lymphoma.
412
INSERMU563 CPTP, CHU Purpan, Toulouse and
Department of Pathology, Toulouse Cedex, France.
E-mail: [email protected]
2
References
Abbott, R.T., Tripp, S., Perkins, S.L., Elenitoba-Johnson, K.S. & Lim,
M.S. (2003) Analysis of the PI-3-Kinase-PTEN-AKT pathway in
human lymphoma and leukemia using a cell line microarray.
Modern Patholology, 16, 607–612.
Butler, M.P., Wang, S.I., Chaganti, R.S., Parsons, R. & Dalla-Favera, R.
(1999) Analysis of PTEN mutations and deletions in B-cell nonHodgkin’s lymphomas. Genes Chromosomes Cancer, 24, 322–327.
Cantley, L.C. (2002) The phosphoinositide 3-kinase pathway. Science,
296, 1655–1657.
Kang, S., Bader, A.G. & Vogt, P.K. (2005) Phosphatidylinositol
3-kinase mutations identified in human cancer are oncogenic. Proceeding of the National Academy of Science of the United States of
America, 102, 802–807.
Miller, A.T. & Berg, L.J. (2002) New insights into the regulation and
functions of Tec family tyrosine kinases in the immune system.
Current Opinion in Immunology, 14, 331–340.
Philp, A.J., Campbell, I.G., Leet, C., Vincan, E., Rockman, S.P.,
Whitehead, R.H., Thomas, R.J. & Phillips, W.A. (2001) The phosphatidylinositol 3¢-kinase p85alpha gene is an oncogene in human
ovarian and colon tumors. Cancer Research, 61, 7426–7429.
ª 2005 Blackwell Publishing Ltd, British Journal of Haematology, 131, 410–413
Correspondence
Samuels, Y., Wang, Z., Bardelli, A., Sager, J., Szabo, S., Ptak, J., Silliman, N., Peters, B.A., van der Heijden, M.S., Parmigiani, G., Yan,
H., Wang, T.L., Riggins, G., Powell, S.M., Willson, J.K., Markowitz,
S., Kinzler, K.W., Vogelstein, B. & Velculescu, V.E. (2004) High
frequency of mutations of the PIK3CA gene in human cancers.
Science, 304, 554.
Shayesteh, L., Lu, Y., Kuo, W.L., Baldocchi, R., Godfrey, T. & Collins,
C. (1999) PIK3CA is implicated as an oncogene in ovarian cancer.
Nature Genetics, 21, 99–102.
Supplementary Material
Keywords: acute leukaemia, lymphoma, mutations, PI3-kinase.
doi:10.1111/j.1365-2141.2005.05784.x
The following supplementary material is available for this
article online:
Table S1. Details of the primers and probes used to
investigate three mutations of p110a.
This material is available as part of the online article from
http://www.blackwell-synergy.com
ª 2005 Blackwell Publishing Ltd, British Journal of Haematology, 131, 410–413
413
Human Pathology (2006) 37, 1458 – 1464
www.elsevier.com/locate/humpath
Original contribution
Frequent detection of the JAK2 V617F mutation in
bone marrow core biopsy specimens from chronic
myeloproliferative disorders using the TaqMan polymerase
chain reaction single nucleotide polymorphism genotyping
assay. A retrospective study with pathologic correlationsB
Marina Bousquet PhD1, Sophie Le Guellec MD1, Cathy Quelen MS,
Françoise Rigal-Huguet MD, Georges Delsol MD, Pierre Brousset MD, PhD*
Department of Pathology, INSERM U563 CPTP, CHU Purpan, 31059 Toulouse, Cedex, France
Received 24 February 2006; revised 11 May 2006; accepted 16 May 2006
Keywords:
JAK2;
Mutation;
Bone marrow core biopsy;
Myeloproliferative
disorders
Summary A retrospective investigation of the JAK2 V617F mutation was carried out in DNA samples
from 131 bone marrow (BM) core biopsy specimens corresponding to patients with polycythemia vera
(PV) (n = 31), essential thrombocythemia (ET) (n = 31), chronic idiopathic myelofibrosis (CIM) (n = 18),
as well as patients with normal BM and secondary reactive hyperplasia. We used the TaqMan
polymerase chain reaction single nucleotide polymorphism genotyping assay to detect the specific JAK2
mutation. This technique allowed us to detect the JAK2 V617F mutation in a population containing at
least 5% of homozygous mutants. Overall, the incidence of the JAK2 V617F mutation was 87% in PV,
67% in ET, and 66% in CIM. This approach proved to be reliable and more sensitive in detecting the
mutation compared with that of initial studies on different materials but similar to that of recent work
with various polymerase chain reaction–based techniques. Two essential findings arose from our study.
First, this technique could be carried out with DNA samples, even partially degraded, from routinely
processed BM core biopsy specimens. Second, after correlation with morphological features, it turned
out that the characteristics of the megakaryocytes were more specific than the mutational status of JAK2
in characterizing ET and CIM. Concerning PV, as expected, the incidence of the JAK2 mutation
was higher, but the morphological criteria were misleading in some cases, strongly suggesting that
the combination of both histologic and molecular data would enable the characterization of virtually
all cases.
D 2006 Elsevier Inc. All rights reserved.
B
This study was supported by grants from l’Institut National du Cancer (INCa), Cancéropole Grand Sud Ouest France, and Association pour la Recherche
sur le Cancer (ARC): contrat no. 3705.
* Corresponding author.
E-mail address: [email protected] (P. Brousset).
1
These authors have contributed equally to this work.
0046-8177/$ – see front matter D 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.humpath.2006.05.006
Detection of JAK2 mutation in bone marrow biopsies
1. Introduction
Until the discovery of the specific JAK2 V617F mutation
in the 3 main chronic myeloproliferative disorders [1-4], their
diagnosis relied on several clinical, biologic, and morphological criteria [5]. Among these criteria, the bone marrow
(BM) aspirate and core biopsy examination were of some
help to settle the diagnosis. In particular, polycythemia vera
(PV), chronic idiopathic myelofibrosis (CIM), and essential
thrombocythemia (ET) share common traits such as hypercellularity and also frequently display megakaryocytic
proliferation with atypia, giving rise to clusters of cells with
abnormally lobulated nuclei. However, it appears that some
cases of true chronic myeloproliferative disorders (CMD)
lack the JAK2 mutation [1-4], whereas other cases of true
CMD that cannot be clearly identified on morphological
evaluation of BM core biopsy (BMCB) specimens are more
seldom. Interestingly, the JAK2 V617F mutation is uncommon in cancers and in myeloid malignancies other than the
CMD [6].
In this study, we carried out a retrospective study of 80
BMCB specimens with overt CMD for the presence of the
JAK2 V617F mutation. In parallel, we included biopsy
specimens from patients with secondary erythrocytosis or
thrombocytosis. The incidence of the JAK2 mutation
reported to date is around 75% in PV, 35% in ET, and
40% to 45% in CIM [1-4]. All these results have been
obtained using different starting materials such as blood,
BM cells, and selected cell populations obtained from blood
and BM. Recent studies mainly based on polymerase chain
reaction (PCR) assays reported a higher incidence of the
mutation in PV but also in ET and CIM [7-12].
We carried out a retrospective study of classic CMD for
which a BM biopsy had been performed. This approach
combined the advantage of investigating all cell types
present in the tissue samples together with the assessment of
the morphological criteria usually required to make the
diagnosis of CMD.
1459
nucleotide polymorphism (SNP) genotyping assay. TaqMan SNP genotyping assays are ready-to-use and contain
TaqMan probe–based assays for genotyping SNPs. This
approach uses the 5V nuclease assay to discriminate between 2 alleles of a specific SNP for use in genotyping
studies. Each assay is a 20 mix of forward primer,
reverse primer, 6FAM dye–MGB labeled probe, and VIC
dye–MGB labeled probe (Applied Biosystems, Foster
City, CA, http://www.appliedbiosystems.com/). Each probe
binds preferentially to 1 of the alleles. Three cases
included in this study, together with the HEL cell
line, served as internal controls, along with 2 negative
controls (reactive lymph nodes). (See Table 2 for the
primer design of the G1849T JAK2 mutation.) Of note, the
size of the amplified DNA fragment was 92 base pairs.
This allowed us to test BMCB specimens with partially degraded DNA. (Some tissue samples were fixed in
Duboscq-Brazil fixative).
2.3. Assay performance characteristics
This step was designed to determine the theoretical limit
of detection using irrelevant DNA (from normal BM cells),
in which DNA from the HEL cell line (homozygous for the
mutation) was diluted. Serial dilutions were tested: 0%
(negative control), 5%, 10%, 25%, 50%, 75%, 90%, 95%,
and 100% (positive control). The results are reported in
Table 2. We were able to detect 5% of HEL cells diluted in
unmutated cells. These results were similar to that reported
by Murugesan et al [11] (Fig. 1).
2.4. Histology
All samples were examined and classified with the
usual criteria for CMD, in particular, according to the
World Health Organization classification [5], also used by
others [9].
3. Results
2. Materials and methods
2.1. Case selection
One hundred thirty-one BMCBs were retrieved from our
tissue bank at Purpan Hospital in Toulouse, France. They
were fixed in 10% buffered formalin and were paraffin
embedded, and they corresponded to normal BM (n = 10),
ET (n = 31), CIM (n = 18), PV (n = 31), secondary
erythrocytosis (n = 33), secondary thrombocytosis (n = 5),
and secondary myelofibrosis (n = 3). (See Table 1 for the
characteristics of patients with PV, ET, or CIM).
2.2. Genotyping
Deoxyribonucleic acid was extracted as already described [13] and was subjected to a TaqMan PCR single
The TaqMan probe–based assay for genotyping SNPs
proved to be a reliable method for detecting point
mutations in human DNA obtained from formalin-fixed
and paraffin-embedded blocks. In addition, it allowed the
high throughput screening of samples because nearly 100
of them could be passed in 1 experiment. For this reason,
all the samples could be controlled several times, thus
providing straightforward results. In this study, all experiments were repeated twice. Overall, the incidence of the
mutation was as follows: PV = 87% (27/31) (Fig. 2), ET =
67% (21/31), CIM = 66% (12/18) (Table 1). Ten cases (5
mutated and 5 unmutated) were selected randomly and
were directly sequenced. A perfect correlation was found
between the 2 techniques (not shown). As for the PCR
technique, we were unable to distinguish with absolute
certainty the cases with heterozygous from those with
1460
Table 1
M. Bousquet et al.
Characteristics of patients with PV, ET, and CIM
PV
Age/sex
Hb
CM
MEG
Reticulin
JAK2
Blood cells
17.7
20.5
18
23
20
18.8
15
15.1
18.2
21.6
22
19.1
18.6
17.4
19
18
21.5
17.3
20
20
21
18.9
20.3
17.8
22
18
20.3
19
16.9
21
19
40
61
40
39
37
44
37
33
46
42
40
46
35
38
37
40
64
39
59
55
65
33
40
38
40
38
45
40
37
45
39
+++
+++
++
+++
+++
+++
o/+
++
+++
+++
+++
++
o/+
+++
+++
+++
++
+++
+++
+++
+++
++
o/+
+++
++
+++
++
+++
+++
+++
+++
+
o
o
+
o
+
o
+
o
o
o
o
o
o
o
+
o
o
o
o
o
o
o
o
o
o
o
o
o
+
++
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Wt
Mutated
Mutated
Mutated
Mutated
Wt
Mutated
Wt
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Wt
Mutated
Mutated
Mutated
Mutated
27/31 (87%)
LC
LC + TH
LC + TH
Age/sex
Platelets
MEG
Reticulin
JAK2
Blood cells
21/F
72/F
72/M
76/M
69/M
56/M
58/F
52/F
57/M
64/F
65/F
74/F
84/F
61/F
66/F
75/F
74/F
35/F
37/F
730 000
833 000
600 000
1 700 000
794 000
655 000
696 000
900 000
840 000
550 000
881 000
580 000
700 000
540 000
700 000
1183 000
700 000
1 200 000
750 000
+++
+++
+++
+++
++
+++
+++
+++
+++
+++
+++
++
+++
+++
+++
+++
+++
+++
+++
o
+
+
+
o
+
+
o
o
o
o
o
o
o
o
o
o
o
o
Mutated
Mutated
Wt
Wt
Mutated
Mutated
Mutated
Wt
Mutated
Mutated
Mutated
Wt
Wt
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Erythro
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Erythro
Normal
1
72/M
2
78/F
3
80/F
4
51/F
5
67/F
6
68/F
7
59/M
8
74/F
9
70/M
10
49/M
11
54/M
12
52/M
13
69/M
14
70/M
15
62/M
16
71/F
17
72/M
18
56/M
19
60/F
20
73/M
21
62/M
22
70/F
23
68/M
24
58/F
25
41/M
26
52/F
26
73/F
28
68/M
29
58/M
30
69/M
31
75/F
Total: mutated/all cases
ET
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
LC + TH
LC
TH
TH
TH
TH
TH
TH
TH
LC + TH
Detection of JAK2 mutation in bone marrow biopsies
1461
Table 1 continued
ET
20
21
22
23
24
25
26
27
28
29
30
31
Total: mutated/all cases
Age/sex
Platelets
MEG
Reticulin
JAK2
Blood cells
26/M
52/F
54/F
56/M
70/M
71/M
37/F
66/M
60/F
67/M
89/F
77/F
725 000
1 240 000
568 000
550 000
1 062 000
1 470 000
1 000 000
815 000
551 000
1 000 000
985 000
712 000
++
+++
++
+++
+++
+++
+++
+++
+++
+++
+++
+++
o
o
o
o
o
o
+
+
+
+
o
o
Wt
Wt
Wt
Mutated
Wt
Mutated
Wt
Mutated
Mutated
Mutated
Mutated
Mutated
21/31 (67%)
Normal
Normal
Normal
Normal
Normal
Erythro
Normal
Normal
Normal
Normal
Normal
Erythro
Age/sex
MEG
Reticulin
JAK2
72/F
80/F
52/M
70/M
44/F
50/F
58/F
82/M
39/M
64/M
87/M
44/M
57/M
54/M
65/M
71/M
46/M
65/M
+++
+++
+++
+++
++
+++
+++
+++
++
+++
+++
+++
+++
+++
+++
+++
+++
+++
++
++
+/++
++
++
++
+++
+++
++
++
++
+++
+/+
++
+++
++/+++
++/+++
+
Mutated
Mutated
Wt
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Mutated
Wt
Wt
Wt
Wt
Mutated
Wt
Mutated
12/18 (66%)
CIM
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Total: mutated/all cases
NOTE. Results of the detection of the JAK2 V617F mutation.
Abbreviations: Hb, hemoglobin (in grams per liter); CM, cellular mass; MEG, megakaryocytes with features of CMD (according to the World Health
Organization classification) (o, normal; +, poorly marked; ++, marked; +++, very marked); reticulin, reticulin network (o, no increase; +, slight increase; ++,
moderate increase; +++, strong increase); M, male; LC, leukocytosis; F, female; TH, thrombocytosis; Wt, wild type; Erythro, erythrocytosis.
homozygous mutations because of the samples being
contaminated with stromal cells. Lastly, none of the
reactive lymph nodes and biopsy specimens with secondary erythrocytosis, thrombocytosis, and secondary myelofibrosis scored positively for the mutation.
When comparing the mutational status of the cases with
the morphological features, it appeared that all cases of ET
and CIM were strongly suggestive of the diagnosis
(prominent megakaryocytic proliferation with cluster formation and abnormally lobulated nuclei or naked nuclei
[5]). In PV, however, 3 cases without classical morphological features of CMD were JAK2 mutated. Conversely, in
4 cases with typical morphological features, the detection of
mutated JAK2 remained negative.
4. Discussion
The incidences of the JAK2 V617F mutation in the
3 main CMDs were higher than those published by others in
different types of material [1- 4]. These data confirmed the
reliability of the technique applied in this study, which, in
addition, appeared more sensitive. This could be explained
by the fact that the experiments were carried out on DNA
1462
Table 2
M. Bousquet et al.
Primers used for detecting the JAK2 G1849T (V617F) mutation
TaqMan SNP genotyping assay
Forward primer
Reverse primer
Normal probe (VIC)
Mutated probe (FAM)
AAGCTTTCTCACAAGCATTTGGTTT
AGAAAGGCATTAGAAAGCCTGTAGTT
TCTCCACAGACACATAC
TCCACAGAAACATAC
PCR and sequencing
Forward primer
Reverse primer
Primer used for sequencing
GGGTTTCCTCAGAACGTTGA
TCATTGCTTTCCTTTTTCACAA
GCAGAGAGAATTTTCTGAACTAT
NOTE. Primer sets used for the TaqMan PCR assay and for direct sequencing.
extracted from routinely processed BMCB. Because of the
nature of the DNA extracted from the whole biopsy
specimen, one could expect to increase the sensitivity of
the technique in recruiting all cell types present in the
marrow. The reverse side of this issue is that all samples are
contaminated with unmutated DNA from stromal cells, thus
preventing to distinguish with certainty cases with homozygous or heterozygous mutations. However, in some
experiments, the presence of homozygous cases was
suspected because of particular patterns in which the signal
of the mutated allele was significantly higher than that of the
wild type (not shown). We think that this information is
difficult to obtain in tissues with variable contamination
with unmutated stromal cells. In their study, Murugesan et al
[11] reported the detection of 5 homozygotes among
47 mutants. However, it was not indicated if the DNA
was extracted from peripheral blood or from BM biopsy
specimens [11]. Others have used BMCB to detect the
mutation [9-11]. In the study by Jelinek et al [10], the
authors investigated a short series of BMCB from patients
with chronic myeloproliferative disorders together with
cases of chronic myeloid leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, and myelodysplasia. They demonstrated the feasibility of this approach, but
no strict correlation with morphological features was looked
for, at least for PV, ET, and CIM [10].
When correlating the detection rate of the mutant JAK2
with morphological data, it appeared that the most robust
marker for retaining the diagnosis of CMD was the presence
of a prominent megakaryocytic proliferation with cluster
formation and abnormally lobulated nuclei or naked nuclei
[5]. Of interest, 10 of 31 cases of ET and 6 of 18 cases of
CIM with characteristic morphological criteria lacked the
JAK2 mutation. This indicated that the detection of the
mutation was sufficient to make the diagnosis of ET and
CIM but could miss at least one third of the cases. We agree
with the results of Campbell et al [14] that the morphological features of the megakaryocytes in ET do not allow
distinction between patients with mutated or wild-type
JAK2. This was also the case for patients with CIM.
The presence of the mutation turned out to be associated
with 87% of the cases of PV (Table 1), which was similar or
slightly higher than previously reported [1- 4]. In this
disorder, the situation was more complex than in ET or
CIM because 3 cases remained difficult to diagnose on the
basis of morphological criteria, and 4 cases with typical
morphological and biologic features of PV were unmutated.
Two interpretations can be put forward from these data. First,
the detection of the JAK2 mutation tends to confirm that
morphological abnormalities of the megakaryocytes are less
marked in PV compared with ET and CIM, as previously
suspected [5]. Second, as for ET and CIM, there is no
correlation between the mutational status of JAK2 and the
morphological features, in particular, regarding the megakaryocytes, because the 4 cases with wild-type JAK2
presented with abnormal megakaryocytes, similar to those
of the most mutated cases. Herein, we clearly show that the
JAK2 V617F mutation can be quickly and reproducibly
detected on DNA obtained from BMCB of patients with
putative CMD with a TaqMan probe–based assay. In our
hands, this approach appeared very sensitive when compared
with the initial reports [1-4]. However, our results match up
well with a number of very recent reports [7-12] using similar
or different methods of detection. However, in our hands, the
Fig. 1 Results of the TaqMan SNP genotyping assay in PV.
Profiles of the cases obtained with the TaqMan PCR assay.
Detection of JAK2 mutation in bone marrow biopsies
1463
Fig. 2 The two extreme patterns of detection of the JAK2 V617F mutation. In 1 experiment (top), 5% of DNA from HEL cells were
diluted in unmutated DNA. One sees similar patterns of PCR amplification for both curves (normal and mutated alleles). At the bottom,
100% of HEL DNA was tested. Note that there is no amplification of the normal allele. Rn indicates fluorescent FAM or VIC signal
normalized to ROX reference signal.
1464
TaqMan strategy proved to be efficient in all cases, even in
samples with partially degraded DNA, because the template
amplified for genotyping was of small size.
The discussion is still open on what approach should
be used to test JAK2 mutations at the routine medical
practice level. Guidelines/recommendations are now being
formulated for JAK2 testing [15], assuming that mutation
screening for JAK2 is diagnostically most useful in the
evaluation of polycythemia. The definition of an adequate
sensitive mutation screening assay is that it detects at
least 5% of the homozygous mutants [11,16]. The studies
by Campbell et al [7], McClure et al [8], and Murugesan
et al [11] presented similarities with our work because
they used DNA samples from BMCB, which were tested
with PCR-based methods. Although technically slightly
different from the TaqMan technique, these methods also
displayed similar sensitivity (5% of homozygous mutants)
and the possibility to perform high throughput analysis [11].
The latter characteristic is not necessarily an advantage
because routine analyses do not involve hundreds of cases
at the same time. We agree that sequencing, albeit
considered as the criterion standard, is time consuming
and sometimes less sensitive in detection of the JAK2
V617F mutation [11]. In their review, Tefferi and Pardanani
[15] designed an interesting and modern algorithm that put
forward the detection of JAK2 V617F mutation.
The originality of our study lies on the attempt to correlate
molecular results obtained with the TaqMan technique with
morphological features. In this regard, we found that the
morphological characteristics of CMD were more robust than
the mutational status of JAK2 in defining diseases such as ET
and CIM. Regarding PV, we confirmed that the incidence of
the JAK2 mutation was higher, but the morphological criteria
might be misleading, suggesting that the combination of both
pathologic and molecular data would enable the characterization of almost all cases.
Acknowledgments
We thank Neil Ledger for critical reading of the manuscript and Daniel Roda and Delphine Lhuillier for expert
technical assistance. Special thanks to Prof Eric Delabesse
for providing DNA samples from the HEL cell line.
M. Bousquet et al.
References
[1] Baxter EJ, Scott LM, Campbell PJ, et al. Acquired mutation of the
tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet
2000;365:1054 - 61.
[2] James C, Ugo V, Le Couedic JP, et al. A unique clonal JAK2 mutation
leading to constitutive signalling causes polycythaemia vera. Nature
2005;434:1144 - 8.
[3] Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the
tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 2005;
7:387 - 97.
[4] Kralovics R, Passamonti F, Buser AS, et al. A gain-of-function
mutation of JAK2 in myeloproliferative disorders. N Engl J Med
2005;352:1779 - 90.
[5] World Health Organization classification of the tumours. In: Jaffe ES,
Harris NK, Stein H, Vardiman JM, editors. Tumours of haematopoietic and lymphoid tissues. Lyon7 IARC Press; 2001.
[6] Scott LM, Campbell PJ, Baxter EJ, et al. The V617F JAK2 mutation
is uncommon in cancers and in myeloid malignancies other than the
classic myeloproliferative disorders. Blood 2005;106:2920 - 1.
[7] Campbell PJ, Scott LM, Baxter EJ, Bench AJ, Green AR, Erber WN.
Methods for the detection of the JAK2 V617F mutation in human
myeloproliferative disorders. Methods Mol Med 2006;125:253 - 64.
[8] McClure R, Mai M, Lasho T. Validation of two clinically useful
assays for evaluation of JAK2 V617F mutation in chronic myeloproliferative disorders. Leukemia 2006;20:168 - 71.
[9] Steensma DP, Dewald GW, Lasho TL, et al. The JAK2 V617F
activating tyrosine kinase mutation is an infrequent event in both
atypical myeloproliferative disorders and myelodysplastic syndromes.
Blood 2005;106:1207 - 9.
[10] Jelinek J, Oki Y, Gharibyan V, et al. JAK2 mutation 1849G(T) is rare
in acute leukemias but can be found in CMML. Philadelphia-negative
CML, and megakaryocytic leukaemia. Blood 2005;106:3370 - 3.
[11] Murugesan G, Aboudola S, Szpurka H, et al. Identification of the
JAK2 V617F mutation in chronic myeloproliferative disorders using
FRET probes and melting curves analysis. Am J Clin Pathol 2006;
125:625 - 33.
[12] James C, Delhommeau F, Marzac C, et al. Detection of JAK2 V617F
as a first intention diagnostic test for erythrocytosis. Leukemia 2006;
20:350 - 3.
[13] Bousquet M, Recher C, Queleen C, Demur C, Payrastre B, Brousset P.
Assessment of somatic mutations in phosphatidylinositol 3-kinase
gene in human lymphoma and acute leukaemia. Br J Haematol 2005;
131:411 - 3.
[14] Campbell PJ, Scott LM, Buck G, et al. Definition of subtypes of
essential thrombocythaemia and relation to polycythaemia vera based
on JAK2 V617F mutation status: a prospective study. Lancet 2005;
366:1945 - 53.
[15] Tefferi A, Pardanani A. Mutation screening for JAK2V617F: when
to order the test and how to interpret the results. Leuk Res 2006
[in press].
Downloaded from jcp.bmj.com on 16 April 2008
CD5-positive diffuse large B cell lymphoma arising
from a CD5-positive follicular lymphoma
José Vassallo, Marina Bousquet, Cathy Quelen, Talal Al Saati, Georges Delsol and
Pierre Brousset
J. Clin. Pathol. 2007;60;573-575
doi:10.1136/jcp.2005.032896
Updated information and services can be found at:
http://jcp.bmj.com/cgi/content/full/60/5/573
These include:
References
Rapid responses
Email alerting
service
This article cites 15 articles, 5 of which can be accessed free at:
http://jcp.bmj.com/cgi/content/full/60/5/573#BIBL
You can respond to this article at:
http://jcp.bmj.com/cgi/eletter-submit/60/5/573
Receive free email alerts when new articles cite this article - sign up in the box at the
top right corner of the article
Notes
To order reprints of this article go to:
http://journals.bmj.com/cgi/reprintform
To subscribe to Journal of Clinical Pathology go to:
http://journals.bmj.com/subscriptions/
Downloaded from jcp.bmj.com on 16 April 2008
573
C D5-positive follicular lymphoma
CD5-positive diffuse large B cell lymphoma arising from a
CD5-positive follicular lymphoma
José Vassallo, Marina Bousquet, Cathy Quelen, Talal Al Saati, Georges Delsol, Pierre Brousset
...................................................................................................................................
J Clin Pathol 2007;60:573–575. doi: 10.1136/jcp.2005.032896
Follicular lymphoma (FL) is a neoplasm originating from
germinal centre cells, corresponding to 25–40% of nonHodgkin’s lymphomas. Transformation into diffuse large B cell
lymphoma (DLBCL) occurs in about one-third of cases. CD5 is
expressed in B-chronic lymphoid leukaemia/small lymphocytic
lymphoma and mantle cell lymphoma, but can rarely be
expressed in conjunction with CD10 in well-documented cases
of FL. In this report one case of grade 1 FL is described, which
transformed into a DLBCL 6 months after initial diagnosis, with
both tumours expressing CD5. In both specimens, neoplastic
cells were strongly positive for CD20, CD79a, bcl-2, bcl-6 and
CD5 in virtually all cells. CD10 was strongly positive in initial
specimens and weakly positive in the DLBCL. Investigation using
the PCR confirmed the derivation of the DLBCL from the FL as
they presented the same immunoglobulin heavy chain gene
rearrangement and the same BCL2-JH break point.
F
ollicular lymphoma (FL) is a neoplasm originating from
germinal centre cells, corresponding to 25–40% of nonHodgkin’s lymphomas.1 At morphology it is mostly constituted by a majority of small cleaved lymphoid cells, with
variable numbers of centroblasts with a nodular growth
pattern.1 FL expresses B cell markers and CD10, whereas it is
typically negative for CD5.1–5 Translocation t(14;18)(q32;q21)
involving rearrangement of the BCL2 gene is present in 70–95%
of the cases.1 Transformation into diffuse large B cell lymphoma
(DLBCL) occurs in about one-third of the cases, mainly in
patients with adverse prognostic factors or in those who do not
achieve complete remission after initial treatment.6
CD5 is a molecule present in T lymphocytes and in a subset of
B lymphocytes and B lymphoproliferations.1 3 4 7 Rarely CD5 has
been expressed in conjunction with CD10 in cases with welldocumented diagnoses of FL.8–12 It is our purpose to describe
one case of FL which transformed into a DLBCL 6 months after
initial diagnosis, both tumours strongly expressing CD5, with
the same BCL2-JH break point.
CASE REPORT
A patient in their 40s was referred to the hospital for an
enlarged inguinal lymph node (2 cm), which was apparently
isolated, without any other clinical and biological symptoms.
The lymph node was removed and the diagnosis of grade 1 FL
was made. She was considered as Ann Arbor stage I-A and was
not treated. After 6 months, the patient consulted for the
presence of a spinal lymph node with rapid growth. This lymph
node was removed and the diagnosis of DLBCL was retained.
Both tumours were then compared from phenotypic and
molecular points of view.
MATERIALS AND METHODS
Tissue specimens were fixed in 10% formalin and embedded
paraffin wax. Histological sections stained with H&E from
initial diagnosis and lymphoma transformation were reviewed.
Immunohistochemical staining was performed using a Ventana
immunostainer (Ventana-Biotech, Tucso, Arizona, USA). The
panel included antibodies to CD20, CD79a, CD3, CD5, CD10,
CD21, CD23, bcl-2, bcl-6, CD138, MUM-1, cyclin D1 and Ki-67.
Revelation was achieved using a streptavidin–biotin–peroxidase
detection system and staining with diaminobenzidine.
For genetic analysis of immunoglobulin and BCL2-JH
rearrangements, 10 mm thick sections of both paraffin wax
blocks were processed for PCR as described elsewhere.13 14 The
sets of primers used were FR1c, FR2a and FR3a. PCR products
were then sequenced to verify whether the amplified regions
matched, using the procedure reported previously.15
RESULTS
Histopathology of the first lymph node specimen was diagnostic of an FL, grade 1. In the specimen from tumour relapse a
diffuse proliferation of large cells consistent with centroblasts
was present, intermingled with frequent mitotic figures,
diagnostic of a diffuse large cell lymphoma.
In both specimens, neoplastic cells were strongly positive for
CD20, CD79a, bcl-2, bcl-6 and CD5 in virtually all cells. CD10
was strongly positive in initial specimens and weakly positive in
the DLBCL (figs 1, 2). Neoplastic cells were negative for CD3,
CD21, CD23, cyclin D1, MUM-1 and CD138 in both specimens.
Proliferation marker Ki-67 was expressed in ,10% of the cells
in the initial biopsy and in .70% in the second biopsy.
PCR investigations confirmed a common clonal derivation for
both tumours with the same pattern of rearrangement for
immunoglobulin heavy genes (FR1c2, FR2a+ approximate
length 250 kilobase pairs, FR3a2) and BCL2-JH approximate
length 190 kilobase pairs. Sequencing of PCR products showed
the same pattern in both specimens, FL and DLBCL, with fusion
of BCL2-JH: BCL2-MBR position 3063–JH segment J6 2951.
DISCUSSION
The case reported here corresponds to a rare CD5+ FL, which
progressed into a CD5+ DLBCL within 6 months. The initial
diagnosis of FL, grade 1, is assured by morphological features,
immunoexpression of CD10 and bcl-6. DLBCL presented a
germinal centre profile, CD10+/bcl-6+/MUM-12/CD1382, which
is in accordance with the progression from an FL.
Among reports on the expression of CD5 in FL, two reports
present data from molecular analysis. In the first, expression of
CD5 in 4 of 11 cases of ‘‘floral’’ FL is reported.8 In three cases,
expression of CD5 was shown by immunohistochemistry, one
with weak to moderate intensity on paraffin wax sections and
two with weak intensity on frozen sections; no immunohistochemical expression of CD5 was shown in one case. In three
cases, variable intensity of CD5 expression was detected by flow
cytometry, including two also positive by immunohistochemistry.
Molecular analysis demonstrated clonal heavy chain immunoglobulin gene rearrangement in three and BCL2-JH products
derived from the t (14;18) translocation in all four CD5-positive
cases.
Abbreviations: DLBCL, diffuse large B cell lymphoma; FL, follicular
lymphoma
www.jclinpath.com
Downloaded from jcp.bmj.com on 16 April 2008
574
Vassallo, Bousquet, Quelen, et al
A
B
C
D
Figure 1 (A) Follicular lymphoma, grade I in the first specimen (H&E). (B) Expression of CD10 by neoplastic cells. (C) Only reactive T lymphocytes express
CD3. (D) Strong expression of CD5 in neoplastic cells (A and B: 6200; C and D: 61000).
Another report was based on three FLs, all with weak
expression of CD5 both on paraffin wax sections and by flow
cytometry.10 All three cases revealed clonal heavy chain
immunoglobulin gene rearrangement, and two showed BCL2
gene rearrangement. These authors further supported the rarity
of CD5 expression in large series of FL studied by flow
cytometry. This technique was considered more suitable for
this conclusion, as positivity for CD5 might be underestimated
by immunohistochemistry, owing to the low intensity of
staining of this marker in these FL. In contrast with these
studies, our case presented strong expression of CD5 in both FL
and DLBCL. At last, PCR investigations clearly showed the same
A
B
C
D
Figure 2 (A) Diffuse large B cell lymphoma in the second specimen (H&E). (B) Strong expression of CD20, (C) weak expression of CD10 and (D) strong
expression of CD5 (A and B: 6400; C and D: 61000).
www.jclinpath.com
ABSTRACT
Chromosomal translocations are frequently implicated in hematological malignancies
and involve oncogenes which are either up-regulated (quantitative abnormality) or form part
of new chimeric genes (qualitative abnormality). The characterization of chromosomal
translocations in hematological malignancies is essential for the diagnosis, the prognosis, the
detection of residual disease and therapeutic choices. During my thesis, I characterized three
new chromosomal translocations.
The t(8;9)(p22;p24) translocation fused the PCM1 (Pericentriolar Material 1) gene to
the JAK2 (Janus kinase 2) gene in cases of atypical chronic myeloid leukemia. The fusion
protein conserved the oligomerization domains of PCM1 and the tyrosine kinase domain of
JAK2. We can suppose that PCM1-JAK2 allows constitutive activation of JAK2 as in the
BCR-ABL model.
The t(7;9)(q11;p13) translocation was found in cases of B-acute lymphoblastic
leukemia and fused the transcription factor PAX5 (Paired box gene) to the elastin, an
extracellular matrix protein. We demonstrated that PAX5-ELN was localized in the nucleus
and was able to bind promoters of several PAX5 targets. In fact, PAX5-ELN acts as a
dominant negative on PAX5, accounting for the block of differentiation in leukemic cells.
The translocation t(2;11)(p21;q23) found in 14 patients with myelodysplasia or acute
myeloid leukemia.is the first translocation that leads to an up-regulation of a microRNA in
hematological malignancies. Indeed, we showed that miR-125b was overexpressed (x10 to
x90) among patients carrying the t(2;11)(p21;q23) and that this up-regulation leads to a block
of myelomonocytic differentiation in vitro.
In conclusion, the characterization of chromosomal translocations, even rare, allows
deciphering new oncogeneic pathways in hematological malignancies.
AUTEUR : Marina BOUSQUET
TITRE : Identification et caractérisation de nouvelles translocations chromosomiques
observées dans les hémopathies malignes
DIRECTEUR DE THESE : Professeur Pierre BROUSSET
LIEU et DATE DE SOUTENANCE : Toulouse, le 26 Juin 2008
RESUME :
Les translocations chromosomiques sont fréquemment associées aux hémopathies
malignes. On distingue des anomalies qualitatives pouvant conduire à la création d’une
protéine de fusion et des anomalies quantitatives qui altèrent le taux de transcription des
gènes. L’identification et la caractérisation des translocations chromosomiques dans les
hémopathies malignes sont essentielles au diagnostic, au pronostic, à la recherche de la
maladie résiduelle et à l’orientation thérapeutique. Ainsi, nous avons caractérisé trois
nouvelles translocations chromosomiques.
La translocation t(8;9)(p22;p24) retrouvée chez des patients atteints de leucémie
myéloïde chronique atypique juxtapose les gènes PCM1 (Pericentriolar Material 1) et JAK2
(Janus kinase 2). La protéine de fusion obtenue conserve les domaines d’oligomérisation de
PCM1 et le domaine kinase de JAK2. Nous pouvons supposer que PCM1-JAK2 permet
l’activation constitutive de JAK2 comme dans le modèle BCR-ABL.
La translocation t(7;9)(q11;p13) retrouvée chez des patients atteints de leucémie aiguë
lymphoblastique B fusionne le facteur de transcription PAX5 à l’élastine, protéine de la
matrice extracellulaire. Nous avons démontré que la chimère PAX5-ELN était localisée au
niveau du noyau et qu’elle était capable de se lier aux gènes cibles de PAX5. Nous avons
également démontré que la chimère agissait en dominant négatif sur PAX5 sauvage.
Enfin, l’étude de la translocation t(2;11)(p21;q23) retrouvée chez 14 patients atteints
de myélodysplasie ou de leucémie aiguë myéloblastique a permis de décrire pour la première
fois la surexpression d’un microARN associée à une translocation dans des hémopathies
malignes. En effet, nous avons démontré que miR-125b était surexprimé (x10 à x90) chez les
patients porteurs de la t(2;11)(p21;q23) et que cette surexpression aboutissait à un blocage de
différenciation myélomonocytaire in vitro et probablement in vivo.
En conclusion, l’identification et la caractérisation de translocations chromosomiques,
même rares, peuvent conduire à la découverte de nouveaux oncogènes impliqués dans les
hémopathies malignes.
MOTS-CLES : Translocations chromosomiques, hémopathies malignes, JAK2, PAX5, miR125b
DISCIPLINE : Cancérologie
LABORATOIRE : INSERM U563-Centre de Physiopathologie Toulouse Purpan