Przeg Epidem 4-2014.indb - Przegląd Epidemiologiczny

Transcription

Przegląd Epidemiologiczny
Epidemiological Review
QUARTERLY
JOURNAL OF THE NATIONAL INSTITUTE OF PUBLIC HEALTH
– NATIONAL INSTITUTE OF HYGIENE
AND THE POLISH SOCIETY OF EPIDEMIOLOGY AND INFECTIOUS DISEASES
Index Copernicus 9
VOLUME 68
MNiSW 7pkt
2014
No 4
CONTENTS
Full text: www.przeglepidemiol.pzh.gov.pl
EDITORIALS
A Zieliński: Diet and cancer risk/association between diet and risk of cancer ................................................ 609
M Wróbel-Harmas, M Krysińska, J Postupolski, M J Wysocki: Food supplement – related risks in the
light of Internet and RASFF data .......................................................................................................... 613
PROBLEMS OF INFECTIONS
J E Drozd-Sokołowska, G Dulny, A Waszczuk-Gajda, W W Jędrzejczak: An isolated outbreak of influenza A H1N1 in a Haematological Department during post-pandemic period ..................................... 621
K W Pancer, W Gut, E Abramczuk, B Lipka, B Litwińska: Non-influenza viruses in acute respiratory
infections among young children, high prevalence of HMPV during the H1N1V. 2009 pandemic in
Poland .................................................................................................................................................... 627
K Piekarska, M Rzeczkowska, W Rastawicki, A Dąbrowska-Iwanicka, I Paradowska-Stankiewicz: Usefulness of laboratory methods in diagnosis of pertussis in adult with paroxysmal cough .................... 633
T M Zielonka: Risk factors of tuberculosis and specific manifestations of disease ........................................ 637
L Kępa, B Oczko-Grzesik, A Boroń-Kaczmarska: Cerebrospinal fluid interleukin-6 concentration in patients with purulent, bacterial meningitis - own observations ............................................................... 645
K W Pancer, M T Szkoda, W Gut: Imported cases of dengue in Poland and their diagnosis ......................... 651
P Kajfasz, M Bartoszcze, P K Borkowski, W Basiak: Retrospective review of the case of cutaneous anthrax – malignant pustule from 1995 in 15-year old girl ....................................................................... 657
Z Wolak, M Z Wałaszek, W Dobroś, M J Wałaszek, B Jagiencarz-Starzec: Prevalence of gastrointestinal
system infections acquired in provincial hospital in 2004-2013 ........................................................... 661
A Schneider, A Mól, K Lisowska, M Jax-Dambek, D Lachowicz, P Obuch-Woszczatyński, H Pituch:
Three-step diagnostic algorithm in diagnosing patients suspected of Clostridium difficile – associated diarrhea .......................................................................................................................................... 669
PUBLIC HEALTH
M Krzyżak, D Maślach, K Piotrowska, A E Charkiewicz, A Szpak, J Karczewski: Perinatal mortality in
urban and rural areas in Poland in 2001-2012 ....................................................................................... 675
K Dudek: Impact of biodiversity on tick-borne diseases ................................................................................. 681
J Kluz-Zawadzka, A Hartmann-Ksycińska, B Lewandowski: Emergent management of scorpion sting ....... 685
I Strużycka, E Rusyan, A Bogusławska-Kapałą: Prevalence of dental erosion in young adults aged 18
years in Poland ....................................................................................................................................... 689
HISTORY OF MEDICINE
M Gromulska: Ludwik Hirszfeld in National Institute of Hygiene in 1920-1941 .......................................... 695
REPORTS
Coordination of public institution response to a threat epidemic. Workshop held in the National Institute
of Public Health – National Institute of Hygiene on 11st September 2014 .............................................703
List of reviwers ................................................................................................................................................ 705
Contents vol. 68 (insert)
INSTRUCTION FOR AUTHORS
707
ARTICLES IN POLISH
Przegląd Epidemiologiczny
Epidemiological Review
K WAR TALN I K
NARODOWEGO INSTYTUTU ZDROWIA PUBLICZNEGO
– PAŃSTWOWEGO ZAKŁADU HIGIENY
I POLSKIEGO TOWARZYSTWA
EPIDEMIOLOGÓW I LEKARZY CHORÓB ZAKAŹNYCH
Index Copernicus 9
TOM 68
Punktacja MNiSW 7
2014
NR 4
TREŚĆ
Pełne teksty: www.przeglepidemiol.pzh.gov.pl
ARTYKUŁY REDAKCYJNE
A Zieliński: Dieta a czynniki ryzyka nowotworów ......................................................................................... 713
M Wróbel-Harmas, M Krysińska, J Postupolski, M J Wysocki: Zagrożenia związane ze stosowaniem
suplementów diety w świetle analizy danych z Internetu i systemu RASFF ........................................ 717
PROBLEMY ZAKAŻEŃ
J E Drozd-Sokołowska, G Dulny, A Waszczuk-Gajda, W W Jędrzejczak: Ognisko epidemiczne grypy A
H1N1 w oddziale hematologii po zakończonej pandemii ..................................................................... 723
K W Pancer, W Gut, E Abramczuk, B Lipka, B Litwińska: Czynniki wirusowe ostrych zakażeń dróg oddechowych u małych dzieci. Wzrost zachorowań wywołanych przez metapneumowirusy podczas
pandemii grypy 2009 w Polsce .............................................................................................................. 729
K Piekarska, M Rzeczkowska, W Rastawicki, A Dąbrowska-Iwanicka, I Paradowska-Stankiewicz: Przydatność diagnostyki mikrobiologicznej w rozpoznaniu krztuśca u osoby dorosłej z napadowym
kaszlem .................................................................................................................................................. 735
T M Zielonka: Czynniki ryzyka gruźlicy i szczególne postacie choroby ........................................................ 739
L Kępa, B Oczko-Grzesik, A Boroń-Kaczmarska: Stężenie interleukiny-6 (IL-6) w płynie mózgowo-rdzeniowym chorych z ropnymi, bakteryjnymi zapaleniami opon i mózgu – obserwacje własne ...... 743
K Pancer, M T Szkoda, W Gut: Zawleczenia zakażeń wirusem denga w Polsce i ich rozpoznanie ............... 747
P Kajfasz, M Bartoszcze, P K Borkowski, W Basiak: Retrospektywne omówienie przypadku skórnego
wąglika – czarnej krosty z 1995 roku u 15-letniej dziewczynki ........................................................... 751
Z Wolak, M Z Wałaszek, W Dobroś, M J Wałaszek, B Jagiencarz-Starzec: Występowanie szpitalnych
zakażeń przewodu pokarmowego w latach 2004-2013 w szpitalu wojewódzkim ................................ 755
A Schneider, A Mól, K Lisowska, M Jax-Dambek, D Lachowicz, P Obuch-Woszczatyńsaki, H Pituch:
Zastosowanie trójstopniowego algorytmu w diagnostyce pacjentów z podejrzeniem biegunki poantybiotykowej o etiologii Clostridium difficile hospitalizowanych w szpitalu klinicznym im.Przemienienia Pańskiego Uniwersytetu Medycznego w Poznaniu .............................................................. 759
ZDROWIE PUBLICZNE
M Krzyżak, D Maślach, K Piotrowska, A E Charkiewicz, A Szpak, J Karczewski: Umieralność okołoporodowa noworodków w mieście i na wsi w Polsce w latach 2002-2012 .............................................. 763
K Dudek: Wpływ poziomu bioróżnorodności na zagrożenie chorobami odkleszczowymi ............................ 767
J Kluz-Zawadzka, A Hartman-Ksycińska, B Lewandowski: Postępowanie ratownicze po ukłuciu skor
piona ...................................................................................................................................................... 771
I Strużycka, E Rusyan, A Bogusławska-Kapała: Występowanie erozji szkliwa w populacji młodych dorosłych w wieku 18 lat w Polsce ............................................................................................................... 775
HISTORIA MEDYCYNY
Ludwik Hirszfeld w Państwowym Zakładzie Higieny w latach 1920-1941 ................................................... 779
SPRAWOZDANIA
Koordynacja działań instytucji publicznych w przypadku zagrożenia epidemią. Konferencja w Narodowym Instytucie Zdrowia Publicznego−PZH w dniu 11 września 2014 roku ........................................ 787
Materiały przygotowane na Konferencję przez Ministerstwo Zdrowia: .................................................. 789
Gorączka krwotoczna Ebola – definicja przypadku (zaadaptowana do krajowego nadzoru epidemiologicznego). Wersja definicji przypadku z dnia 09 września 2014
Algorytm diagnostyczny EVD z ECDC wersja PL z dnia 09.09.2014
Interpretacja wybranych elementów algorytmu postępowania w zakresie prowadzenia laboratoryjnej diagnostyki pacjentów podejrzanych o zakażenie wirusem Ebola (dotyczy osób z objawami klinicznymi, które spełniają kryteria definicji przypadku EVD)
Gorączka Ebola – informacja dla lekarzy POZ i służb medycznych
Załącznik A. Szczegółowe zalecenia w zakresie środków ochrony osobistej do stosowania w kontakcie
z podejrzanymi lub chorymi na EVD i zwłokami
Ministerstwo Zdrowia: Osoba powracająca z krajów Afryki Zachodniej, gdzie odnotowano przypadki
goraczki krwotocznej Ebola
Spis recenzentów ............................................................................................................................................. 797
Spis tomu 68 (wkładka)
INSTRUKCJA DLA AUTORÓW799
Editorials
PRZEGL EPIDEMIOL 2014; 68: 609 - 611
Andrzej Zieliński
DIET AND CANCER RISK/ ASSOCIATION BETWEEN DIET
AND RISK OF CANCER
Department of Epidemiology, National Institute of Public Health-National Institute of Hygiene
ABSTRACT
The article discusses problem of the association between diet and risk of cancer. Author shows methodological
concerns arising from the difficulty of selecting the study groups, and also those dependent on ascertainment of
the composition of the diet for a long period of time necessary to establish the statistical associations.
Sources of carcinogenic substances in food include environmental contaminants, chemicals synthesized in
some plants and those which infiltrate the food or are produced during the food processing.
It is strongly advisable to limit the content of carcinogenic substances in food by imposing Regulation (EC)
No 1881/2006 not only regarding products exported to the EU countries, but also those intended for local market.
Key words: carcinogens, diet, individual risk, societal risk
INTRODUCTION
Studies aimed at identifying risk factors of cancer
represent a serious challenge for epidemiologists.
Firstly, it is affected by a multitude of potential factors
as well as their coexistence in various combinations.
Furthermore, their effects may be observed many years
following repeated exposure. Generally, exposure assessment is an approachable task if exposed population
and exposure level are easy or at least feasible to define.
Examples of such exposures may be: contact with tobacco smoke or working with asbestos.
Having considered the exposure associated with
diet, the situation is even more problematic for researchers. The first problem is that everyone is ‘exposed’ to
eating. Selection of an unexposed population is rarely
possible and may be applied to rather limited proportion of meals. Possible assignation of diet composition,
both in retrospective and prospective studies, is usually
restricted to a slight extent. Interval between exposure to
carcinogenic substances and cancer occurrence amounts
frequently to many years. In this period, persons may
often modify their diet with respect to its quantity and
quality. Furthermore, meals may include substances
which increase as well as decrease the risk of cancer.
In such conditions, not only an attempt to correlate diet
with cancer but even to reconstruct diet raise difficulties
due to poor recollection of meals eaten over years and
the fact that respondents are not entirely aware of the ingredients of meals consumed even at the time of eating.
What are the prerequisites for a researcher to determine the relation between diet and cancer? How to link
diet composition with cancer?
Even in the countries where there is a high prevalence of cancer, individual risk is relatively low. Cohort
studies would require a large number of study participants and long-term observation period accompanied
by difficult and unreliable verification of exposure
resulted from meals consumed. Another difficulty
consists in selecting control group. Having considered
a high prevalence of exposure with the example being
consumption of meat products, control group selected
from vegetarians could differ considerably from study
group in terms of eating habits and other characteristics.
Consequently, selection of one particular variable to the
analysis would raise many reservations of methodological nature.
However, there are data which indirectly suggest
the relation between the prevalence of cancer in a
particular population and eating habits being typical
of this population. Namely, various populations living
in different geographical areas and having diverse eating habits show rather considerable disparities in the
distribution of cancer types. Such relations should not
be considered as evidence due to possible ‘ecological
fallacy’ occurrence. In population where there is a
© National Institute of Public Health – National Institute of Hygiene
610
Andrzej Zieliński
high prevalence of exposure and disease, exposure is
not necessarily restricted to persons who contracted a
disease. Having considered initial data, however, it is
much easier to investigate this individual relation in
case-control studies where not the consumption of a
particular meal but its estimated intake is considered
to be a variable.
Even if we assume that knowledge obtained is of
limited probability, recommendations and preventive
measures should always stand on the side of prevention
of diseases, not the food industry interests.
Nevertheless, there is a counter-argument which
should not be neglected. Persons have the right to use
all existing doubts to be on a diet which is harmful for
them. An example could be tobacco smoking. Impact
of smoking on developing cancers and coronary heart
diseases is well documented. There are no legal or moral
basis, however, for forbidding an adult to smoke. At the
most, it is possible to promote anti-smoking measures
and forbid smoking in places where tobacco smoke
may affect non-smokers. Similarly, food which includes
high concentration of substances whose carcinogenic
properties have been established with high probability
should be adequately labeled as posing a threat for
developing a cancer.
Such meals, on no account, should be served to
children.
CANCER RISK ATTRIBUTED TO DIET
From public health perspective, the basic division
of risk factors for diseases refers to the prevention of
diseases by their elimination or reduction of their impact. A list of factors which are not modifiable include:
genetics and age-dependent factors while risk factors
for developing cancers such as chemical substances
included in food may and should be eliminated from
a diet. In some cases, however, it is very difficult (1).
Chemical substances of carcinogenic properties
may be present in food if environment or the surfaces
of vegetables or livestock feed were contaminated. In
the majority of cases, mechanical contamination may
be removed while cleaning fruits and vegetables. As
in case of metal ions, penetration of many organic
carcinogenic substances, including polycyclic aromatic
hydrocarbons (PAH) to the inner tissues of vegetables,
especially roots and bulbs is observed irrespective of the
existing biological barriers (2). Environmental effects
of contamination on cancer are hard to assess, excluding high-contaminated areas. Consequently, they are of
little significance as individual risk factors of cancer.
Even in low-contaminated areas, however, their effect
on local population should be considered (3).
No 4
Some of this substances are synthesized in edible
plants, however, their low concentrations do not pose
any threat to humans (4). Furthermore, some plants
contain substances which may inhibit the development
of some forms of cancer, including organic sulphur
compounds, flavonoids, tannins and carotenoids. They
are present in some fruits and cruciferous vegetables
such as broccoli or cauliflower. Their concentrations,
however, are not enough to state that the consumption
of these vegetables and fruits is of anticancer effect (5).
The most serious threats are attributed to preparation
of meat meals at high temperatures, especially during
food grilling or smoking (4). Since a number of years,
smoking of food is becoming more and more popular in
Poland. Usually, it is affected by customs, technicalities
of professional or homemade food smoking equipment.
Supervision of sanitary institutions, however, is not
sufficient enough in this respect. Grilling is a custom
which gained greater recognition in the last decades.
Its popularity is still on the increase. Grilled meat, its
products and fish are served during outdoor meetings.
Yet, both heat and smoke trigger formation of substances
of confirmed carcinogenic properties in meat, including
polycyclic aromatic hydrocarbons (6).
Neither the Ministry of Health nor the Polish sanitary institutions responded adequately to a triumphant
tone of politicians who secured derogation of ‘Polish
traditionally smoked meat and meat products’ for local
production and consumption from the provisions of the
Regulation (EC) No 1881/2006 regarding maximum
levels of polycyclic aromatic hydrocarbons in traditionally smoked meat and meat products. Furthermore,
no Polish maximum levels of PAH for meat products
intended for local production and consumption were
introduced which may be interpreted that there is a
discretion in smoking techniques which consequently
may lead to risky PAH concentration.
For non-smokers, diet and physical activity are basic
modifiers of risk of internal organ cancers. Their occurrence is dependent on individual health behaviours.
Therefore, it is an important domain of health promotion. If polycyclic aromatic hydrocarbon concentrations
in meat products are subject to EC regulations, and they
should be also regulated by Polish law, then the amount
of carcinogenic substances contained in meals is associated with the frequency and quantity of their intake.
According to the American Cancer Society, obesity
per se increases the risk of occurrence of many forms
of cancer, including breast cancer in postmenopausal
women, colorectal cancer, renal cell cancer, esophageal
cancer, pancreatic cancer, endometrial cancer, thyroid
cancer and gallbladder cancer. Furthermore, association
between other forms of cancer was also established,
however, it is not of statistical significance. Nearly 1/3
of cancers in the United States are potentially attributed
No 4
611
Diet and cancer risk
to obesity. Moreover, not only obesity in adulthood
increases the risk of cancer but also high birth weight.
Stable and sustained weight loss decreases the probability of cancer while cyclic weight loss and gain is a
risk factor of cancer.
Obesity affect the risk of cancer via mechanisms
such as levels and modifications of hormone effects
and activity of factors such as interleukins subsequent
to immune and inflammatory reactions (7).
CONCLUSIONS
1. In health promotion and cancer prevention activities,
factors associated with diet are not given sufficient
attention compared to their importance. Beside
tobacco smoking prevention, they represent the
most important domain of practically free of charge
preventive measures.
2. It is of importance to raise the awareness of authorities and politics on the liability for introduction of
regulation regarding the launch of products containing low concentrations of substances of confirmed
carcinogenic properties intended for local consumption.
3. Promotion of healthy eating should cover the strategy of tackling obesity with regard to the prevention
of type 2 diabetes, coronary heart diseases as well
as cancer.
REFERENCES
1. US Department of Health and Human Services. Natio-
2.
3.
4.
5.
6.
7.
nal Institutes of Health. List of Cancer-Causing Agents
Grows. http://www.nih.gov/news/pr/jan2005/niehs-31.
htm
A.M. Kipopoulou, E. Manoli, C. Samara. Bioconcentration of polycyclic aromatic hydrocarbons in vegetables
grown in an industrial area. Environmental Pollution
1999;106 (3): 369–380.
Nyberg F, Boffetta P. Contribution of environmental
factors to cancer risk. Br Med Bull 2003; 68 (1): 71-94.
Polycyclic Aromatic Hydrocarbons in Cereals, Cereal
Products, Vegetables, and Traditionally Smoked Foods.
Food Survey Information Sheet; Number 01/12 April
2012, Food Standards Agency (food.gov.uk) http://
multimedia.food.gov.uk/multimedia/pdfs/poly-aromatic-hydrocarbons.pdf
National Cancer Institute (NIH). Cruciferous Vegetables
and Cancer Prevention http://www.cancer.gov/cancertopics/factsheet/diet/cruciferous-vegetables
National Cancer Institute (NIH). Chemicals in Meat Cooked at High Temperatures and Cancer Risk. http://www.
cancer.gov/cancertopics/factsheet/Risk/cooked-meats
Kushi LH, Doyle C, Cullough M et al. American Cancer
Society Guidelines on Nutrition and Physical Activity
for Cancer Prevention Reducing the Risk of Cancer
With Healthy Food Choices and Physical Activity. http://
onlinelibrary.wiley.com/doi/10.3322/caac.20140/pdf
Received: 31.07.2014
Accepted for publication: 27.08.2014
Address for correspondence:
Prof. Andrzej Zieliński
Department of Epidemiology
National Institute of Public Health-National Institute of
Hygiene
Chocimska 24, 00-791 Warsaw
tel. 22 542 12 04
E-mail: [email protected]
Editorials
Monika Wróbel-Harmas 1, Magdalena Krysińska 2, Jacek Postupolski 3, Mirosław J. Wysocki4
FOOD SUPPLEMENT–RELATED RISKS
IN THE LIGHT OF INTERNET AND RASFF DATA
Department of Social Communication and Marketing
Department of Organization, Health Economics and Hospital Management
3
Department of Food Safety
4
Department of Health Promotion and Postgraduate Education
National Institute of Public Health – National Institute of Hygiene
1
2
ABSTRACT
OBJECTIVE. Based on legal acts and RASFF information, this paper aimed at evaluating available facts on food
supplements in comparison to the most popular data accessible via Internet for future and present consumers.
MATERIAL AND METHODS. Having analyzed legal acts and RASFF (Rapid Alert System for Food and Feed)
database, the authors attempted to verify what kind of information on food supplements may be found by an Internet user, using the first webpage of Google.pl. This search engine was used in this study as it gained the highest
popularity among Internet users. It was decided that exclusively search results displayed on the first webpage
would be subject to analysis as 91.5% of Internet users limit their search to the first 9-10 results. Internet was
searched using the following two terms: ‘supplement’ and ‘supplements’ as well as terms suggested by Google.
pl. Subsequently, the results were subject to qualitative and quantitative analyses.
RESULTS. On the Internet, the most frequently searched terms were: ‘supplements’ (243 000 000), ‘supplement’
(9 290 000), ‘supplements shop’ (8 200 000). Having analyzed the content of particular websites, information
on certain products, given by their manufacturers may be found. Then, data on supplement itself were provided,
i.e. what is a supplement and when it should be used. Expert articles (written by physicians, dieticians, pharmacists) on a risk resulting from these products, including therapeutic indications or the presence of unauthorized
substances were identified considerably less frequently. No warnings regarding the necessity of purchasing the
products in legal and verified places were found.
CONCLUSIONS. There is a necessity of systemic education of consumers on reasonable use of food supplements.
It is also advisable to consider the organization of alert system whose objective would be to monitor adverse
reactions caused by an intake of food supplements or novel food launched into the country. To obtain reliable
information on the composition and effects of food supplements, potential consumer should contact physician or
dietician. Additionally, complementary information, using different sources with an example being health-related
portals, presenting articles written by physicians or pharmacists, may be also searched.
Key words: food supplements, food supplement use, food supplement effect
INTRODUCTION
Food supplements are becoming more popular. Furthermore, they are also more accessible. It may be purchased not only in a grocery, which seems to correspond
to its definition, but also in chemist’s, gym, but above all
on the Internet. Having analyzed the advertisements, it may
be concluded that these products cure all of the possible
conditions, ranging from hair loss, potency problems to the
quick loss of unwanted kilograms. Manufacturers eagerly
inform of the lack of adverse reactions to supplement and
its natural origin. Additionally, launching new products
into a market is accompanied by aggressive marketing
and advertising campaigns. Consequently, consumers may
consider that if they are concerned about their health, they
should increase the intake of supplements. Therefore, it is
high time for reflection on dietetic and medical reasons of
such high consumption of food supplements.
614
Monika Wróbel-Harmas, Magdalena Krysińska, et al.
Except for certain physiological conditions, e.g.
immunodeficiency or pregnancy, the intake of food
supplements is not recommended if the principles of
healthy diet are observed. An emphasis should be put
on the fact that the composition of supplement may
be different from what is on its label. Furthermore,
it may contain hazardous substances. From the study
conducted in the USA transpires that 20-90% of patients
diagnosed with cancer use food supplements, however,
their intake is not always approved by physicians. Not
only the shortage of evidence suggesting the effectiveness of supplements, but also their questionable safety
and possible interactions with medicinal products are
raised. In this respect, a key element is good contact
between patient and physician. It is also advisable to
develop the guidelines for patients regarding the use of
food supplements (1).
No 4
in Polish language and addressee of the first notification. All required documents are accessible on the CSI
website (6). Prior to the launch of food supplement,
investigation procedure is initiated by the CSI to verify
whether a supplement meets the criteria specified in the
provisions of law as well as to determine if it does not
have properties indicative of medicinal products. In the
latter, such product is subject to other provisions of law
and is not to be considered as a foodstuff.
It should be noted, however, that prior to the launch
of a food supplement, its manufacturer is not required to
present and accomplish detailed and expensive registration procedures and clinical trials which could confirm
its effectiveness, quality and safety profile as it is in the
case of medicinal products. Furthermore, manufacturer
is not also obliged to inform on interactions with other
substances, alcohol and medicinal products. Nevertheless, pursuant to the article 30 of the Act on Food and
Nutrition Safety (4), for food supplements, containing
LEGAL ACTS PROTECTING THE
vitamins, minerals or other substances with a nutritional
CONSUMERS FROM THE RISK
or physiological effect, the CSI may initiate investigaOF UNLIMITED ACCESS
tion procedures to verify the composition, properties
TO FOOD SUPPLEMENTS
of particular excipients and indications for use prior to
the launch of product.
In case of food supplements, a special attention
Pursuant to the provisions of the Directive 2002/46/
should
be paid to the information provided for consumEC on the approximation of the laws of the Member
States relating to food supplements, ‘food supplement’ ers. The majority of food supplements is labelled and
is defined as “any food the purpose of which is to advertised using nutrition and health claims. Pursuant to
supplement the normal diet and which is a concentrated the provisions of the Regulation on nutrition and health
source of vitamins or minerals or other substances with a claims made on foods (7) ‘nutrition claim’ is defined as
nutritional or physiological effect, alone or in combina- “any claim which states, suggests or implies that a food
tion, marketed in dose form” (2). Definition of ‘food- has particular beneficial nutritional properties”; ‘health
stuff’, which is specified in the Regulation (EC) No claim’ means “any claim that states, suggests or implies
178/2002 of the European Parliament and of the Council that a relationship exists between a food category, a
of 28 January 2002, is as follows: “food (or foodstuff) food or one of its constituents and health” while ‘reducmeans any substance or product, whether processed, tion of disease risk claim’ denotes “any health claim
partially processed or unprocessed, intended to be, or that states, suggests or implies that the consumption
of a food category, a food or one of its constituents
reasonably expected to be ingested by humans” (3).
Composition of food supplements, most frequently, significantly reduces a risk factor in the development
includes vitamins, mineral substances, as well as plant- of a human disease”. Manufacturers cannot arbitrarily
or animal-derived ingredients, which are present in place such information on product’s packaging or use
food and consumed as its part. In this case, provisions, them in advertisements.
It is allowed to use exclusively nutrition claims,
referring to medical devices, are not effective.
In Poland, the basic legal acts, regulating the launch which are specified in the register of nutrition claims,
of food supplements into the market, are the Act on constituting an annex to aforesaid regulation. Having
Food and Nutrition Safety (4) and Regulation of the received a positive opinion of the European Food Safety
Minister of Health on the composition and labelling Authority (EFSA), which is based on scientific evidence
of food supplements (5). Chief Sanitary Inspectorate provided by manufacturer and confirms that the claims
(CSI) is an institution which is liable for registering made are truthful, the European Commission should
food supplements in Poland. CSI is also obliged to run include a claim in the register.
Health claims may be used if the following informathe register of food supplements. If a food supplement
tion
is provided: a statement suggesting the significance
is to be launched into the market, the entity introducof
balanced
diet and healthy lifestyle; food quantity or
ing it should first submit a notification form to the CSI.
Such form should contain the following information, i.e. its pattern of consumption ensuring beneficial effect
the names of a supplement and notifying entity, label specified in a claim; a statement for persons who should
No 4
Food supplement – related risks in the light of Internet
refrain from consuming particular food, if deemed
appropriate and adequate warning in case of products
which can be hazardous to health if consumed excessively.
It is not permitted to use claims which suggest that
health may be affected if certain products are not consumed. It is also prohibited to use claims referring to
the pace or level of weight loss as well as those making
reference to the recommendations of particular physicians, health professionals or associations, different
from the ones listed in the aforesaid regulation.
In the light of increasing supply of food supplements
on the local market (8), it is a liability of manufacturers
to provide consumers with reliable and comprehensive
information on the effect and purpose of products offered. In fact, consumers have to analyze the information on food supplements and investigate the market
on their own as to purchase appropriate products of
authorized composition and controlled origin. In Poland,
the Cluster of Vegetable Medicinal Products and Food
Supplements was constituted by the National Medicines
Institute to grant Quality Certification. According to the
regulation, accessible on the website - www.klasterzdrowia.pl (9): “The objective of Quality Certification
granting is to promote products of documented, scientifically confirmed quality and safety profile, mainly
to allow consumers to identify them on the market by
using Quality Certification Mark”.
SAFETY PROFILE OF FOOD SUPPLEMENTS
UNDER RASFF
To eliminate the sources of risk associated with the
consumption of food potentially hazardous to human
health, the European Union introduced the Rapid Alert
System for Food and Feed (RASFF) (10) whose objective is to protect consumers from the risk of diseases.
Since 1978, this system allows for the exchange of
information in the EU. Having become an important
element of public health protection policy, it consists
in collecting and rapid communicating the information on foodstuffs, materials and devices designed for
contact with food and feed which could be harmful for
the health of consumers.
Within the Rapid Alert System for Food and Feed
(RASFF), there are three types of notifications, i.e.:
• alert notification – notification on a risk which requires or may require rapid actions undertaken by
other members of the RASFF;
• information notification - notification on a risk which
does not require rapid actions.
Information notification may be sent with regard to a
product for which a serious risk has been identified,
however, it is available only on a local market, on a
615
limited territory, or it was not launched into a market
or it is no longer present on a market.
• border rejection.
Furthermore, any information which has not been
sent as alert, information or border rejection notifications, but is considered to be important for the safety of
food and feed, is communicated as News.
Within the frames of RASFF, a risk to human health,
resulting from the appearance of food, feed, materials
and devices for contact with food, which could be harmful for both human health and environment, is assessed.
Regulation (EC) No 178/2002 of the European
Parliament and of the Council of 28 January 2002 stipulates the criteria for the notification of risk to human
health deriving from food or feed (3). According to the
provisions of this Regulation, the Member States immediately notify the Commission, under the rapid alert
system, of any actions undertaken to limit the launch
into the market or to recall the food and feed to protect
human health and requiring rapid action as well as any
rejections related to a risk to human health, food and
feed at a border of the European Union.
Notifications should include the events of a direct
or indirect risk to human health. RASFF does not cover
events in which there is no direct or indirect risk to
human health. It should be interpreted that in case of
inconsistencies with the law regarding food safety, it is
not required to communicate other Member States. As
it was stated earlier, the fact whether there is a risk for
human or not should be considered as a decisive factor.
Having analyzed the provisions of law on food
supplements and RASFF data, it should not be forgotten that irrespective of the fact that such information
is accessible on the Internet for anyone, exclusively
professionals are familiar with it. Furthermore, based
on these data, only professionals can draw appropriate
conclusions. Therefore, the authors decided to verify
what kind of information on food supplements may be
found by consumer, using the first webpage of Google.
pl (11).
MATERIAL AND METHODS
Analysis of information, which can be found on the
Internet, was performed on 18-19 September 2014. Due
to its popularity, Google.pl was employed for analysis
(11). It was decided to analyze exclusively search results
displayed on the first webpage, i.e. about 9-10 results. It
is dictated by the fact that 91.5% of persons limit their
search to the first webpage. Only 4.8% Internet users
look for the results on the next web pages (12).
Two search terms were entered into Google.pl, i.e.
‘supplement’ and ‘supplements’. The only difference
is the usage of grammatical number - singular versus
616
plural. Subsequently, all the results (portals) were
investigated with regard to the information on supplements. Results, similar to supplement/supplements,
suggested by Google.pl were also analyzed. Additionally, the number of results for particular search terms
was examined. No results, marked as advertisements,
were subject to analysis.
RESULTS
Having analyzed the search terms ‘supplement’ and
‘supplements’, and then those suggested by Google.pl,
no terms regarding sexual potency/erection occurred.
From table I transpires that these terms are on the last
position. Internet users were mostly interested in supplements for weight loss and shops with supplements.
Table. I Number of search results by search term.
No.
1.
2.
3.
4.
5.
6.
7.
8.
9.
Search term entered into Google.pl
Supplements
Supplement
Supplements shop
Supplements for weight loss
Food supplement
Supplements for muscle building
Supplements for sexual potency
Food supplements
Supplements for erection
Approximate
number of results
243 000 000
9 290 000
8 200 000
3 670 000
2 720 000
816 000
436 000
380 000
164 000
Figure 1 presents the results of search. The first
search term was ‘supplement’. Search results that were
displayed as first related to a supplement meaning a
separate section added to a publication. The next term
displayed was food supplement. As many as 3 out of
10 results applied for food supplements.
Fig.1
Percentage of search results concerning food supplements (search term - ‘supplement’).
Having analyzed information on supplements accessible on websites, it may be concluded that these
are products used to complement everyday diet by
lacking nutrients, including i.a. vitamins or minerals.
These products, however, should not be considered as
No 4
medicinal products, but foodstuffs. Nevertheless, the
fact that they may be purchased in chemist’s gives an
impression that these are medicinal products. From
the survey conducted by the Centre for Public Opinion
Research TNS OBOP „Self-healing through awareness
in Poland” transpires that 41% of respondents consider
supplements to have therapeutic properties (13). There
are also products being on the borderline of definition
of medicinal product and food (14). During the search,
the website of the association – the Polish Council for
Supplements and Nutritional Foods (KRSiO) was also
displayed. This association was instituted to act for the
adjustment of legal regulations, assist in the researches
on food supplements and other activities protecting the
interests of associated manufacturers as well as to provide reliable information for consumers. Manufacturers
being the members of the KRSiO were also listed (15).
Information suggesting that supplements are to
complement normal diet may be also found. However,
if our diet is healthy, we do not need to use them. Furthermore, they are only applied in certain situations
with an example being immunodeficiency. In a group of
persons who administered food supplements within the
last year, more than a half of them used these products
to complement everyday diet (54%) and strengthen
immune system (52%) while for only 13% persons
its intake was recommended by physician (13). Other
information indicates that excessive vitamin consumption may affect the health and supplements for weight
loss do not result in the reduction of adipose tissue (16).
Advertisements available on the Internet, however, do
not suggest that supplements should be purchased from
credible sources. It also applies to the products bought
via Internet. In this respect, a possibility of control
is rather limited. Thus, the products offered on the
Internet may be falsified or contain substances which
are not listed in their composition. They may also be
composed of active substances or their analogues which
are used in medicinal product manufacturing or even
substances whose usage is forbidden by law provisions.
Consequently, it may lead to health-and life-threatening
conditions.
Out of 8 terms, Google suggested 5 terms concerning the content of this article, i.e. diet, weight loss or
‘supplements for joints’. Having analyzed the search
results for ‘food supplements’, Internet user may encounter a broad scope of information, ranging from
legal regulations (6), online shopping, manufacturer’s
websites to the portals with articles warning against the
risk of unreasonable use of supplements or hazardous
substances identified in some weight loss products (17,
18). A list of search results for ‘supplement for weight
loss’ includes mainly shops, forums/online social networking services, where the information on products
available on the market can be exchanged. Exclusively
No 4
617
two search results referred to opinions based on scientific evidence, i.e. what are ‘supplements for weight
loss’ and what is their mechanism of action. In case of
‘supplement for joints’, similar situation was observed
(Fig.2).
Fig.4
Google.pl suggestions for ‘supplements’- percentages.
Having entered the search term - ‘supplements’,
the majority of results were with regard to diet. Most
frequently, the searched supplements were designed
for sportsmen (referred to as supplements for body
composition, physical performance, muscle building).
Fig.2 Google.pl suggestions for ‘supplement’.
These websites, however, do not serve as the basis of
Having modified the search term by ‘supplements’ information and education on food supplements. These
(singular replaced by plural form), 100% of results are the websites concerning food supplement shops, then
referred to food supplements. Additionally, one search – those presenting general information on such products
result concerned the definition while the remaining and finally those regarding the products for weight loss.
ones were with regard to shops. The latter concentrated
on the sale of supplements for sportsmen and gym’s
DISCUSSION
clients. These products are also referred to as sport
nutrients (Fig.3).
Pursuant to the provisions of law, food supplements
are a kind of foodstuffs. Therefore, they are subject to
legal acts different from those applying for medicinal
products. Such a fact may be used by unfair manufacturers. Furthermore, 50% of respondents wrongly claimed
that the quality of food supplements is equally controlled as it is in the case of over-the-counter medicinal
products (13). Consequently, it may lead to negative
consequences for health.
Due to the introduction of RASFF, aimed at protecting the consumers against hazardous products, the European Union allowed for the exchange of information on
Fig.3 Percentage of links referring to food supplements i.a. food supplements in the EU and EEA countries. In
(search term - ‘supplements’).
2013, a total of 3,205 initial notifications were sent. For
a group of the following products – ‘dietetic foods, food
Suggestions for ‘supplements’ were mainly portals supplements, fortified foods’, 160 events were notified,
with information for persons interested in body compo- including 33, 19 and 55 alert, information and border
sition, physical performance, muscle building or weight rejection notifications, respectively while the remaining
loss. Search results included shops, forums and website ones concerned information on follow-up activities.
of manufacturer of nutrients for sportsmen and persons
Having considered chemical contamination, a
attending gyms (Fig.4).
special attention should be paid to high concentrations
of toxic metals (mercury - 9 notifications, lead - 9 notifications, arsenic - 4 notifications). It should be highlighted that several notifications concerned exceeding
the maximum permissible concentrations for more than
618
one element. For one case, too high contamination with
polycyclic aromatic hydrocarbons (PAH) was reported.
Four notifications were with regard to poor microbiological quality of products.
A specific reason, in fact limited to the use of food
supplements, consists in using physiologically active, unauthorized substances to trigger metabolic or
medicinal actions (about 60% of initial notifications).
The most frequently listed chemical compounds are:
DMMA (3,4-dimethoxy-N-methylamphetamine) - 7
notifications, phenolphthalein (7 notifications), sildenafil and its derivatives (13 notifications), synephrine
(16 notifications), yohimbine (4 notifications), sibutramine (5 notifications) and other (10 notifications).
Such substances were identified in herbal products or
those containing plant extracts, frequently referred to
as ‘natural’ or ‘traditional’. They were not, however,
declared on their label. Such substances were identified
in products for weight loss (DMMA, phenolphthalein,
synephrine, sibutramine) and erection (sildenafil and
derivatives, yohimbine).
Substances such as DMMA and other derivatives of
amphetamine may trigger cardiac arrhythmia, which in
extreme situations, may lead to circulatory failure and
emaciation. Similarly, the analogues of ephedrine, e.g.
synephrine may have such effects. Phenolphthalein is
a compound of rapid laxative effect. Sildenafil use is
contraindicated in persons diagnosed with ischaemic
heart disease, hypertension, arrhythmia and with a history of recent myocardial infarction (19).
Official Medicines Control Laboratory report,
regarding the study of food supplements for weight
loss, provided similar results concerning illegal and
unauthorized active substances use (20).
Supplements contain also materials which should
be authorized as novel food. These are mainly products
employed in the medicine of the Far East, which are not
used as food in Europe. Scientific evidence, confirming
the effect of these elements, is limited with an example
being Corilus versicolor. Anti-cancer properties are attributed to this fungus, however, such action as well as
its safety profile have not been scientifically confirmed.
In case of food supplements, a problematic issue
is the use of unauthorized active substances. Thus, it
constitutes a challenge for the authorities liable for
food control. There is a necessity of implementing a
new range of tests, which so far have not been routinely
associated with food safety. Such tests would allow for
identification and quantitation of active substances as
well as identification of unauthorized compounds.
No 4
CONCLUSIONS
1. There is a necessity of systemic education of consumers on reasonable use of food supplements.
2. To obtain reliable information, confirming the composition and effect of food supplement, a potential
consumer should first contact physician or dietician.
Consumer may also search other sources for information with an example being health-related portals,
where articles written by physicians or pharmacists
are also accessible.
3. It is of importance to consider the initiation of alert
system which would monitor adverse reactions resulting from the use of food supplements and novel
food.
4. For official controls and food supplement monitoring, it is required to perform tests for identification
and quantitation of active substances, identification
of unauthorized compounds as well as drawing attention to a risk associated with microbiological and
chemical contamination.
REFERENCES
1. Frenkel M, Sierpina V. The use of Dietary Supplements
in Oncology, Current Oncology report 2014.
2. Dyrektywa 2002/46/WE Parlamentu Europejskiego
i Rady z dnia 10 czerwca 2002 r. w sprawie zbliżenia
ustawodawstw Państw Członkowskich odnoszących się
do suplementów żywnościowych.
3. Rozporządzenie (WE) nr 178/2002 Parlamentu Europejskiego i Rady z dnia 28 stycznia 2002 r. ustanawiające
ogólne zasady i wymagania prawa żywnościowego,
powołujące Europejski Urząd ds. Bezpieczeństwa
Żywności oraz ustanawiające procedury w zakresie
bezpieczeństwa żywności. Dz.Urz. WE L 31, s.1.
4. Ustawa o bezpieczeństwie żywności i żywienia z dnia
25 sierpnia 2006r. (Dz.U. z 2010 r. Nr 136, poz. 914 z
późn. zm.).
5. Rozporządzenie Ministra Zdrowia w sprawie składu oraz
oznakowania suplementów diety z dnia 9 października
2007r. (Dz. U. z 2007 r. Nr 196, poz. 1425 z późn. zm.).
6. http://gis.gov.pl/
7. Rozporządzenie (WE) Nr 1924/2006 Parlamentu Europejskiego i Rady z dnia 20 grudnia 2006 r. w sprawie
oświadczeń żywieniowych i zdrowotnych dotyczących
żywności (Dz.U. L 404 z 30.12.2006, str. 9).
8. Rynek produktów OTC w Polsce 2014, Prognozy rozwoju na lata 2014-2019, PMR, 2014.
9. http://klasterzdrowia.pl/
10. http://ec.europa.eu/food/safety/rasff/index_en.htm
11. http://www.marketing-news.pl/message.php?art=40949
12. http://www.macmoney.pl/statystyki-internetu-czyliglobalna-siec-w-liczbach/
13. TNS OBOP „Świadome samoleczenie w Polsce
www.lekiczysuplementy.pl 2014”.
No 4
14. http://pl.wikipedia.org/wiki/Suplement_diety
15. http://www.krsio.org.pl/site/18
16. http://portal.abczdrowie.pl/suplementy-diety
17. http://www.poradnikzdrowie.pl/zdrowie/domowaapteczka/suplementy-diety-czy-moga-byc-niebezpieczne_37522.html
18. http://www.doz.pl/tagi/t2982-suplement_diety
19. http://ec.europa.eu/food/safety/rasff/docs/rasff_annual_report_2013.pdf
20. Fijałek Z., National Medicines Institute Poland, Official
Medicines Control Laboratories.
619
Magdalena Krysińska
National Institute of Public Health – National Institute of
Hygiene
Department of Organization, Health Economics and Hospital Management
Tel.48 22 54 21 295, 48 22 54 21 245
e-mail:[email protected]
Problems of infections
Joanna Ewa Drozd-Sokołowska1, Grażyna Dulny2, Anna Waszczuk-Gajda1,
Wiesław Wiktor-Jędrzejczak1
AN ISOLATED OUTBREAK OF INFLUENZA A H1N1
IN A HAEMATOLOGICAL DEPARTMENT DURING POST-PANDEMIC PERIOD
Department of Haematology, Oncology and Internal Diseases, Medical University of Warsaw,
Poland
2
Epidemiological Service, Central Clinical Hospital, Medical University of Warsaw, Poland
1
ABSTRACT
INTRODUCTION AND OBJECTIVE. Influenza A H1N1 virus strain was associated with the pandemic outbreak
of febrile respiratory infections worldwide in 2009, however in August 2010, the WHO announced that the world
had entered the postpandemic period. It offered specific recommendations for this period, including the identification of clusters of severe respiratory disorders and deaths. Here we report the fulminant course of influenza
A H1N1 infection in the postpandemic period in a group of patients in a single hematology department. We
make an attempt to identify potential risk factors and the mode of spreading, and to provide recommendations
for best practice.
MATERIAL AND METHODS. We conducted a retrospective analysis of a cluster of patients diagnosed with or
suspected of influenza A H1N1 infection in the period from December 2010 to March 2011.
RESULTS. Fourteen patients with hematological disorders unexpectedly developed acute respiratory failure ARDS
(Acute Respiratory Distress Syndrome). Of them, nine tested positive for influenza A H1N1 in a screening test
and eight in confirmatory polymerase chain reaction. The infection was fatal in nine patients, despite artificial
ventilation in eight and oseltamivir administration in 11. Ten were in reverse isolation according to CDC. No
similar cases occurred in the whole hospital concurrently, or in the hematology wards at any other time.
CONCLUSIONS .The occurrence of A H1N1 epidemics in a hematological ward in the post-pandemic period
highlights the importance of awareness of this complication, prompt testing and antiviral treatment. Furthermore,
it confirms the importance of vaccinating patients and personnel against influenza as a prophylactic measure.
Key words: influenza A H1N1, disease outbreak, complications
INTRODUCTION
In 2009, the influenza A H1N1 virus strain was
associated with the outbreak of febrile respiratory
infections worldwide, as declared by the World Health
Organization (WHO). H1N1 infections were reported in
more than 214 countries; there were more than 500,000
cases and 18,849 deaths (as of 1 August 2010) (1). In
Poland, 400 laboratory-confirmed cases were reported
from May 2009 to September 2010, resulting in 131
deaths (2). In August 2010, the WHO announced that
the world had entered the postpandemic period and offered specific recommendations for action that should
be taken during this period, including the identification
of clusters of severe respiratory disorders and deaths
(3). These recommendations were adopted in Poland.
According to the data of the National Institute of Public
Health, Warsaw, Poland, from the 6th of September
2010 to the 27th of March 2011, 226 A/H1(v) infections
were confirmed in Poland. The data did not reveal either
an increased frequency or severity of respiratory tract
infections in the general population in this period (2).
However, unexpectedly, from December 2010 to
March 2011, a cluster of influenza A H1N1-positive
cases occurred in a single hematology department.
Herein, we describe and analyse this cluster.
622
No 4
Joanna Ewa Drozd-Sokołowska, Grażyna Dulny, et al.
MATERIALS AND METHODS
The study was approved by Medical University of
Warsaw Review Board.
Patients. Influenza A H1N1 infection with a fulminant
course was diagnosed or strongly suspected in 14 hematological patients in the Department of Hematology,
Oncology and Internal Diseases, Medical University
of Warsaw (Warsaw, Poland) between December 2010
and March 2011. During this period, 358 patients were
hospitalised in our unit (190 female, 168 male; median
age: 62 years, range: 18–97 years). Concurrently, only
four patients in all other hospital departments (992
beds, 12,748 hospitalisations) tested positive for H1N1
by polymerase chain reaction (PCR) and experienced
only mild symptoms. There were no cases with a
similar clinical course that were not tested for H1N1.
Furthermore, there was no influenza A H1N1 epidemic
in Warsaw or the rest of Poland at this time.
The Division of Hematology. The Division of Hematology, in which the influenza outbreak occurred,
comprises three wards adjacent to each other but with
limited traffic between them. Ward A has 17 beds,
Ward B 16 and Ward C 26. Each has separate nursing
staff and two (Wards A and B) follow the procedures
of reverse isolation. However, patients were admitted
to these wards without quarantine providing they were
asymptomatic for acute infections. In Ward C, there was
open access for families and patients could walk freely
outside the ward, including to the hospital cafeteria.
Patient observation. Patients with symptoms that
suggested a respiratory tract infection, including fever,
dyspnoea, cough, and radiological signs suggesting interstitial pneumonia in high resolution computed tomography underwent a screening test for influenza A after
the first patient tested positive for influenza A H1N1 (the
second patient in the described cohort). Confirmatory
PCR for influenza A H1N1 was performed in all patients
who tested positive in the screening test. PCR was also
performed for some patients whose screening test was
negative but whose symptoms strongly suggested influenza infection. Other necessary blood tests and scans
were performed, depending on particular circumstances
and indications. PCR testing for the clearance of viruses
from respiratory secretions after the symptoms of infection had been eliminated was not performed routinely.
Tests used for laboratory diagnosis of influenza A H1N1
virus infection
Influenza screening test. The Influenza A/B 2 Panel
Test 4A470 by Gecko Pharma Vertrieb GmbH (Ahrensburg, Germany) was used for the initial diagnosis of
influenza. The sensitivity of the test is 76.3%, while the
specificity 92% according to the manufacturer.
Polymerase chain reaction test. Mucosal smears from
nose and throat were the source of viral genetic material.
Nucleic acids were extracted from the samples using a
High Pure Viral Nucleic Acid Kit (Roche Applied Science, Penzburg, Upper Bavaria, Germany) according
to the manufacturer’s instructions. Real-time reverse
transcription (RT)-PCR was performed using a Quantification of Swine H1N1 Influenza Human Pandemic
Strain Advanced Kit and Precision OneStepTM qRTPCR MasterMix (PrimerDesign Ltd., Southampton
UK). The reaction mix was prepared according to the
manufacturer’s instructions with minor modifications. A
β-actin gene fragment was amplified for each sample to
confirm the extraction of a valid biological template and
to exclude PCR inhibition. One-step real-time RT PCR
was performed in a Light Cycler® 2.0 (Roche Applied
Science). Reverse transcription (55°C, 10 minutes) and
enzyme activation (95°C, 8 minutes) were followed by
50 cycles of denaturation at 95°C for 10 seconds and
primer annealing and extension at 60°C for 1 minute;
data was collected at the end of the final step.
Method of retrospective analysis. The medical records
of patients diagnosed with or suspected of having influenza A H1N1 were analysed to collect data on the type
and status of underlying primary hematological disorder, complete blood count abnormalities, complications,
effect of treatment on survival, and overall survival. In
addition, the means of transmission was investigated.
Statistical analysis. STATISTICA 9.0 software (StatSoft, Inc., Tulsa, OK, USA) was used for basic calculations. Continuous variables are expressed as the median
and range. No statistical tests were performed, because
of the small sample size.
RESULTS
Of the 14 patients analysed, eight tested positive for
influenza A H1N1 by PCR and six either were not tested
in the initial phase of the outbreak, or tested negative
despite presenting symptoms that strongly suggested
influenza. PCR-confirmed patients are described separately from other patients. None of the patients had been
vaccinated against influenza in the preceding year. Of
the hospital personnel, about half of the nurses and the
majority of doctors were vaccinated, but unvaccinated
personnel worked on every ward.
The timing and mode of influenza A H1N1 transmission. Probably the first cases of influenza occurred
throughout January and at the beginning of February
2011. Initially, two patients (one male, one female)
with no formal confirmation of influenza developed
respiratory insufficiency. In one, no diagnostic tests
were performed; in the other, negative screening results
were obtained and PCR testing was not performed. They
were hospitalised in the reverse isolation ward (A) in
our division, as described in the Patients and Methods.
No 4
An isolated outbreak of influenza AH1N1
Both patients required mechanical ventilation for respiratory failure. The clinical course in the male patient
(with negative screening results) was complicated by
intracranial hemorrhage and multiorgan failure with
disseminated intravascular coagulation in the early post
transplantation period. In the female patient, respiratory
insufficiency remained the primary problem.
At the end of January, two new cases occurred in
the second (B) reverse isolation ward (one confirmed,
one highly suggestive; both negative on screening tests;
both with severe respiratory insufficiency that required
mechanical ventilation following clinically overt extensive bleeding in the respiratory tract. Approximately 1
week later, a new case was diagnosed in the free-access
ward (C). Notably, at the same time, another patient
visited an outpatient unit located on the same floor and
died shortly afterwards from respiratory failure, in a
regional hospital.
The two patients in whom influenza was suspected
had been hospitalised in a reverse isolation unit for a
long time, so it is unlikely that they were infected by
other patients. There were following possibilities of
occurrence of such infections, either (i) patients were
infected by asymptomatic staff, or (ii) they had latent
infections and the pathogens were activated as a result
of decreased immunity, or (iii) they were infected in the
out-hospital environment and admitted to the hospital
before development of symptoms, which could be the
case of a female patient. It is worth mentioning, that
during that period there was no increase in influenza
incidence in the general population.
The second outbreak of influenza occurred in early
March 2011, with the majority of cases being diagnosed
in Ward B (four PCR-confirmed cases in two adjacent
rooms), one in reverse isolation Ward A and two (positive screening, negative PCR) in free-access Ward C.
Representative case. A 48-year-old woman was admitted to our department in December 2010 with relapsed
acute myeloid leukaemia (AML) following allogeneic
hematopoietic stem cell transplantation (SCT). Flow
cytometry of the cerebrospinal fluid revealed the presence of blasts, which indicated treatment with highdose cytosine arabinoside. During the pancytopaenia
period following treatment, the patient experienced
fever but there was no obvious local infection. She
received broad-spectrum antibiotics and was tested for
influenza, with a negative result. High-resolution computed tomography was performed to locate the cause
of fever; this revealed ground-glass opacities, which
suggested alveolar hemorrhage. Initially, the patient did
not complain of dyspnoea, but her condition deteriorated
within hours and blood gas analysis revealed respiratory failure, with an arterial oxygen partial pressure of
36.5 mm Hg. Oxygen therapy and glucocorticosteroids
were initiated. Mechanical ventilation was implemented
623
4 days later for respiratory arrest. Despite intensive
antibiotic and symptomatic treatment, the patient’s
condition did not improve: she bled actively from the
respiratory tract and blood gas analysis showed increasing CO2 retention, with continuously low O2 pressure.
Diagnostic tests for influenza were repeated and both
screening and confirmatory PCR tests were positive.
The patient received oseltamivir at a standard dose
administered through nasogastric feeding tube from the
day of positive screening results, which was 7 days after
initiation of mechanical ventilation. However, her status
deteriorated and she died on the next day, with signs of
bleeding in the respiratory tract. It is worth mentioning
that the patient was the first in the analyzed cohort with
confirmed A H1N1 infection.
Patients with confirmed influenza A H1N1 infection.
Influenza A H1N1 infection was confirmed in two males
and six females (median age: 57.5 years). Four patients
had AML (one in first complete remission during consolidation chemotherapy, two during induction chemotherapy and one in relapse after allogeneic SCT); two had
acute lymphoblastic leukaemia (ALL; 77 and 155 days,
respectively, after allogeneic SCT); one had myelodysplastic syndrome with accompanying tuberculosis; and
one had light chain amyloidosis with heart involvement,
treated by autologous peripheral blood SCT.
The median time from the first onset of symptoms
to the diagnosis of influenza was 3 days (range: 0–11
days). One patient was asymptomatic. The time from
the onset of symptoms to the start of treatment with
oseltamivir ranged from 0 to 11 days (median: 2 days).
At diagnosis, three patients had neutropaenia
<0.5 G/l, three had a neutrophil count from 0.5–1.5 G/l
and two had a normal neutrophil count. Five patients had
lymphopaenia <0.8 G/l (Grade ≥2 based on the Common Terminology Criteria for Aderse Events version 3.0
(4) prior to the onset of influenza, while only three had
lymphopaenia below 0.3 G/l (as defined in the work of
Ljungman (5)). The median duration of lymphopaenia
<0.8 G/l was 10 days (range: 3–25 days) and 0 days
(range: 0-25 days) for lymphopaenia <0.3 G/l. Seven patients were thrombocytopaenic (median: 27 G/l; range:
2–68 G/l) and seven were anaemic (median: 9.7 g/dl;
range: 6.8–10.6 g/dl). All patients except one had elevated acute-phase proteins (C-reactive protein). Four
patients had concomitant respiratory disease (pneumonia of different aetiology). High-resolution computed
tomography revealed ground-glass opacities, alveolar
opacities, thickening of the septa and possible alveolar
hemorrhage. Six patients developed respiratory insufficiency; four of these required mechanical ventilation.
The major problem in these patients was CO2 retention.
In addition, three patients experienced renal failure (one
requiring hemodialysis) and four experienced hypotension and septic shock.
624
Five patients died as a result of complications to
their underlying hematological disease that were due to
influenza. The cause of death was multiorgan failure in
two patients, septic shock caused by Enterococcus species
in one, respiratory system hemorrhage in one and sudden cardiac death in one patient who was suffering from
amyloidosis with heart involvement. Three patients who
survived received oseltamivir for 11–17 days (median:
11 days). A clearance PCR test was performed in only
one patient and was negative after treatment was stopped.
Notably, four nonhematological patients who were
confirmed by PCR to have influenza A H1N1, treated
outside our division in the same hospital at approximately the same time, and treated in internal medicine
departments rather than in intensive care units recovered
quickly. All of these were discharged after 5–14 days
of hospitalisation.
Patients with symptoms that suggested influenza
infection, i.e. unexplained fever, dyspnoea, cough,
bleeding in the respiratory tract and respiratory
insufficiency. Four male and two female patients had
such symptoms. Their median age was 49 years (range:
41–69) and were suffering from the following diseases:
AML, ALL, multiple myeloma, chronic myelomonocytic
leukaemia, T-cell prolymphocytic leukaemia and diffuse
large B-cell lymphoma. Two patients showed symptoms
that suggested influenza after allogeneic SCT (during the
procedure and 1 year thereafter) and one following autologous peripheral blood SCT (+14 days). Two patients
had a positive screening test but negative confirmatory
PCR; one had a negative screening test with no PCR; one
did not have any tests performed for technical reasons;
and one died of fulminant respiratory failure shortly after
visiting an outpatient unit in a regional hospital.
Before the onset of symptoms that suggested influenza, five patients experienced lymphopaenia <0.8 G/l
and two <0.3 G/l. The median duration of lymphopaenia
<0.8 G/l was 3 days (range: 2–19 days), while for <0.3
G/l it was 0 days (range: 0-12 days). At the onset of
infection, two patients were severely neutropaenic (0
G/l), one had a neutrophil count of 0.7 G/l and two had a
normal neutrophil count. Five patients were thrombocytopaenic (median: 34 G/l; range: 4–53 G/l) and five were
anaemic (median hemoglobin concentration: 8.7 g/dl;
range: 8.6–11.3 g/dl).
Five patients required oxygen therapy for respiratory insufficiency; four of these required mechanical
ventilation. Similarly to the ‘confirmed group’, one
patient developed renal failure and one patient bled
from the respiratory system.
Four patients died in the course of suspected influenza: three from respiratory failure and one from multiorgan failure. Both surviving patients had a positive
screening test (one was lost to follow-up after several
months).
No 4
DISCUSSION
We have described the dramatic course of influenza
A H1N1 infection in the postpandemic period in a group
of patients in a single hematology department. It is important to stress that, at the time, there was no outbreak
of influenza in the general population. Furthermore,
when there was an outbreak of influenza A H1N1 in
the season 2009-2010 in the general population, we
experienced only a few cases with a benign course and
a similar situation did not occur during the subsequent
18 months.
It is not possible to establish the origin of infection
in particular patients, but three mutually compatible possibilities must be considered. Firstly, patients could have
been infected asymptomatically prior to admission and
have developed full-blown disease after chemotherapy
or as the result of immunodeficiency in the course of
their underlying blood disorder. Secondly, they could
have been infected by infected personnel who were
asymptomatic, particularly those who violated isolation
procedures. Thirdly, patients could have been infected
by each other, especially as there was no contact isolation. None of these possibilities can be excluded and
more than one may well have been operative. It is
highly unlikely that there was a single point of origin
for the outbreak, for example, a single infected patient
or member of staff who was case zero, because patients
and personnel in different wards do not have contact
with each other. Only during the second outbreak of
influenza the majority of affected were patients hospitalised in the reverse isolation unit (B); patients were
housed in adjacent rooms and allowed to leave them,
which rendered it possible for them to infect each other.
That patients infected one another is very likely in this
situation.
Although the virus usually causes acute infection
and does not persist in infected individuals (6), the
activation of latent infection cannot be excluded in at
least some immunocompromised patients. There is little
published data on A H1N1 virus biology in severely
immunocompromised patients, e.g. after hematopoietic stem cell transplantation, but on the basis of such
data as there is, some authors suggest prolonged viral
shedding (7,8). Souza et al. (9) showed that the median
duration of viral shedding in a population of influenza
A H1N1-infected cancer patients receiving immunosuppression was 23 days, with the full range being from
11 to as many as 63 days. Therefore, in our opinion, it
is possible that some patients acted as reservoirs for
the virus. There is no way of determining the relative
likelihood that the virus was spread by asymptomatic
patients or personnel, or by patients who were already
showing symptoms (the third possibility). However,
No 4
625
An isolated outbreak of influenza AH1N1
in the absence of such determination, these possibilities must be afforded equal consideration. Under such
circumstances, it seems worth considering whether it
would be economically feasible to test all patients and
medical staff entering these wards each day, especially
during the typical influenza season.
Defining risk factors for severe or fatal influenza
infection in hematological patients is crucial. Unlike
Ljungman et al. (5), who found lymphopaenia to be an
important risk factor for death in stem cell transplant
recipients with influenza A H1N1 infection, lymphopaenia, defined both as below 0.8 G/l and below 0.3 G/l,
did not seem to affect survival in our patients. However,
there were only two SCT recipients in our group, the
majority of whom were nontransplanted hematological
patients, so the groups of patients were not strictly comparable. Thrombocytopaenia was observed to affect survival time adversely in our patients, a phenomenon also
observed by Cordero et al. (10). In our patients, none
with a platelet count of <50 G/l survived the acute phase
of infection. This may be explained by fairly frequent
alveolar bleeding that complicated a lower respiratory
tract infection, which led to respiratory insufficiency
and finally death. Severely anaemic patients also died
more frequently in our group. Notably, we observed
hypoxemia in 66.7%, in contrast to Cordero et al. (10),
who observed it in only 10.7% of immunosuppressed
infected patients. In summary, the principal risk factors
seem to be thrombocytopaenia and anaemia.
It is extremely difficult to diagnose acute influenza
infection in the postepidemic/ postpandemic period in
immunocompromised patients, who frequently develop
neutropaenic fever and are able to develop infection
with almost any known pathogen. Nevertheless, hematologists should be encouraged to stay alert to the
possibility of influenza infection, especially in febrile
patients with respiratory tract infections, and to initiate antiviral treatment without delay. Cordero et al.
(10) showed that prompt antiviral treatment improves
survival rates. Even when the vaccination rate in the
general population is low (11) vaccination should be
recommended to health-care workers, families of patients and immunocompromised patients, because of
the potential health gains, however limited these may
be (12-14).
SUMMARY AND CONCLUSIONS
We described an unusual outbreak of influenza A
H1N1 in a single hematology department, which could
not be predicted by the situation in the country general
population and is not a standard infectious risk in the
care of hematological patients. Nine of the 14 affected
patients died.
Although there is, as yet, no empirical confirmation,
the risk of such an outbreak could be reduced by routine
vaccination of hematological patients, their families
and personnel against influenza. Moreover, awareness
among doctors, immediate testing and prompt administration of oseltamivir could reduce the frequency of
fatal complications.
ACKNOWLEDGEMENTS
We would like to thank Jaroslaw Paciorek M.D
Ph.D, from the Voivodship Sanitary and Epidemiological Station in Warsaw, who performed PCR tests and
contributed data on the procedures.
REFERENCES
1. World Health Organization. Pandemic (H1N1) 2009 update 112. 2010 Aug [cited 2013 March 5]. Available
from: http://www.who.int/csr/don/2010_08_06/en/index.
html.
2. National Institute of Public Health. Influenza and influenza-like illness in Poland. 2013 [cited 2013 January 5].
Available from: http://www.pzh.gov.pl/oldpage/epimeld/
grypa/aindex.htm.
3. World Health Organization. WHO recommendations for
the post-pandemic period. 2010 Aug [cited 2013 January 5]. Available from: http://www.who.int/csr/disease/
swineflu/notes/briefing_20100810/en/index.html
4. Blood/Bone Marrow. Common Terminology Criteria for
Adverse Events v3.0 (CTCAE), 2006: 4.
5. Ljungman P, de la Camara R, Perez-Bercoff L, et al.
Outcome of pandemic H1N1 infections in hematopoietic
stem cell transplant recipients. Haematologica 2011; 96:
1231-1235.
6. Hayden FG, Belshe R, Villanueva C, et al. Management
of influenza in households: a prospective, randomized
comparison of oseltamivir treatment with or without
postexposure prophylaxis. J Infect Dis 2004; 189: 440449.
7. Centers for Disease Control and Prevention (CDC)
Oseltamivir-resistant novel influenza A (H1N1) virus
infection in two immunosuppressed patients - Seattle,
Washington, 2009. MMWR Morb Mortal Wkly Rep
2009; 58: 893-896.
8. Weinstock DM, Gubareva LV, Zuccotti G. Prolonged
shedding of multidrug-resistant influenza A virus in an
immunocompromised patient. N Engl J Med 2003; 348:
867-868.
9. Souza TM, Salluh JI, Bozza FA, et al. H1N1pdm influenza infection in hospitalized cancer patients: clinical
evolution and viral analysis. PLoS One 2010; 5: e14158.
10. Cordero E, Aydillo T, Fariñas MC, et al. Novel Influenza A(H1N1) Study Group of the Spanish Network for
Research in Infectious Diseases (REIPI). Immunosuppressed patients with pandemic influenza A 2009 (H1N1)
626
virus infection. Eur J Clin Microbiol Infect Dis 2009;
31: 547-556.
11. Chin-Yee BH, Monkman K, Hussain Z, et al. Attitudes
toward vaccination for pandemic H1N1 and seasonal
influenza in patients with hematologic malignancies. J
Support Oncol 2011; 9: 156-160.
12. Monkman K, Mahony J, Lazo-Langner A, et al. The
pandemic H1N1 influenza vaccine results in low rates
of seroconversion for patients with hematological malignancies. Leuk Lymphoma 2011; 52: 1736-1741.
13. Mackay HJ, McGee J, Villa D, et al. Evaluation of pandemic H1N1 (2009) influenza vaccine in adults with
solid tumor and hematological malignancies on active
systemic treatment. J Clin Virol 2011; 50: 212-216.
14. Mariotti J, Spina F, Carniti C, et al. Long-term patterns of
humoral and cellular response after vaccination against
influenza A (H1N1) in patients with hematologic malignancies. Eur J Haematol 2012; 89: 111-119.
Received: 2.07.2014
Wiesław Wiktor-Jędrzejczak
Department of Haematology,
Oncology and Internal Medicine
The Medical University of Warsaw
Ul. Banacha 1a
Tel. 0 22 599 28 18, Fax. 0 22 599 14 18
e-mail: [email protected]
No 4
Katarzyna W. Pancer1, Włodzimierz Gut1, Edyta Abramczuk1, Bożena Lipka2, Bogumiła Litwińska1
NON-INFLUENZA VIRUSES IN ACUTE RESPIRATORY INFECTIONS AMONG
YOUNG CHILDREN. HIGH PREVALENCE OF HMPV DURING THE H1N1V.2009
PANDEMIC IN POLAND
Department of Virology National Institute of Public Health,
National Institute of Hygiene, Warsaw, Poland
2
The Children’s Memorial Health Institute (IP-CZD), Warsaw, Poland
1
ABSTRACT
In Poland the majority of hospitalized cases of pneumonia (annually more than 70000) were reported without
determination of an aetiological agent (J18 of ICD-10), also because diagnosis of viral ARTI is limited to identification of influenza viruses or sometimes RSV.
MATERIAL AND METHODS. For determination the contribution of non-influenza viruses in ARTI among children, 381 nasopharyngeal swabs from hospitalized in period X.2008-IV.2011y. children (aged 1 day – 5 y.o.)
were tested for RSV, HMPV, HEV/HRV, HPIV 1-3, HAdV, HBoV.
RESULTS. At least one viral agent was detected in 72.7% of patients. The most predominant was RSV infection
(49%), followed by HEV/HRV (15.5%); HMPV (8.7%), Adenoviruses (7.4%), HPIVt.1-3 (5.8%) and HBoV
(5.5%). Seven periods based on the median of examined children/month were determined: 3 with increased
number of ARTI. RSV infections, diagnosed in all periods, were predominate in five periods, mainly in LRTI
cases. In the 3thperiod - HMPV was predominant, in the 5th – HEV/HRV. It was found that clinical manifestation
of HMPV infections varied depending on the period.
CONCLUSIONS. Relatively high prevalence of HBoV or HMPV cases of ARTI, especially different clinical
picture in some periods (ARTI without pneumonia or bronchiolitis), indicated necessary of more detailed molecular and epidemiological studies. Also our results indicate the need for improved diagnostic capabilities of
virological tests in acute upper and lower respiratory tract infections in children.
Key words: acute viral respiratory tract infection in young children; seasonality; activity of RSV and HMPV
and HBoV;
INTRODUCTION
Diseases of respiratory tract, including infections,
are one of the main reasons of annual hospitalization in
Poland (7-8%). Among babies and children this ratio is
usually higher: in children aged 1 – 4 about 30%, among
infants - 15-17% (J00-J99 according to International
Statistical Classification of Diseases and Related Health
Problems, 10th Revision [ICD-10]). In recent years,
respiratory infections per year were approximately
40% of all hospitalizations associated with respiratory
diseases (in 2009 - 43.6%; in 2010 – 42.7%.). However,
this ratio reached 90% in infants (91% in 2009; 89.5% in
2010) or 70% among children aged 1-4 (73.5% in 2009;
72.8% in 2010) (J00-J22 of ICD-10). Different bacteria
and viruses may be an agent of acute respiratory tract
infections (ARTI). Viruses are very common aetiological agents of pneumonia, bronchiolitis, bronchitis and
other respiratory infections. In Poland the majority of
hospitalized cases of pneumonia were reported as pneumonia without determination of an aetiological agent
(J18 of ICD-10). In 2009 – 75 191 of such cases were
reported, in 2010 – 72 694 (1). Diagnosis of viral acute
respiratory infections is still a problem. There are some
reasons related to difficulties in conducting diagnosis
of viral infections: high number of possible aetiological agents, similar symptoms of disease, emerging new
variants of described viruses or new viruses and high
cost of examinations. Moreover, in Poland diagnosis of
viral respiratory infections is very often still limited to
628
identification of influenza viruses or sometimes RSV.
In such a situation, every year in Poland the origin of
aetiology for over 50% of cases of acute viral respiratory
infection is uncertain. The surveillance of ARTI caused
by viruses other than influenza and RS is done in many
countries (Canada, USA) and the profile of examined
viruses is often upgraded and enlarged (2-4).
The aims of our studies were: 1. to determine the
contribution of non-influenza viruses in acute respiratory viral infections among hospitalized infants and children; 2. To analyse the activity of different respiratory
viruses tested in particular years, months and seasons
of increased number of cases.
MATERIAL
Nasopharyngeal swabs collected from 381 infants
and children from the first day of life to the 5th year,
hospitalized with acute viral respiratory tract infection
between October 2008 - April 2011.
Data on the age of examined children and main
clinical symptoms were obtained from 346 patients.
Almost all children (96%) were below 3 years old, and
the majority of them were below 6 months old (62%)
or belonged to 6-12 months age group (30%). The boys
amounted to 57.5% of examined children.
METHODS
Number
50
45
40
35
30
25
20
15
10
5
0
Number
PCR. Nucleic acids were isolated from all 381 nasopharyngeal swabs using QIAamp Viral RNA mini kit
(for prospective examinations) and QIAamp DNA mini
10
8
6
4
2
0
40
Number
No 4
Katarzyna W Pancer, Włodzimierz Gut, et al.
30
20
kit (257 swabs - selected specimens collected in period
I.2009-IV.2011 – retrospective tests). Specific fragments
of viral genome were detected by PCR method for DNA
viruses: Adenoviruses (HAdV) and Bocavirus (HBoV)
or PCR with reverse transcription step (rt-PCT) for
Respiratory Syncytial Virus (RSV), Human metapneumovirus (HMPV), Enteroviruses/Rhinoviruses (HEV/
HRV) and parainfluenza viruses type 1, 2 and 3 (HPIV
t.1,2,3) using primers previously described (5-9).
Detection of viral antigens. HMPV antigen was detected in 273 specimens by Biotrin hMPV Antigen EIA
(Ireland) according to manufacturer instruction (10).
Statistical analysis of demographic data, seasonality
and detected viruses were done using Statgraphics for
Windows, Centurion, v.XV. StatPointTech.Inc.USA.
For qualitative/categorical data crosstabulation, tests of
independence (χ2 or Fisher’s exact tests), analyses of the
degree of association between rows and columns (Contingency Coeff., Lambda test and Pearson’s correlation)
were conducted. For determination of periods with
increased number of respiratory infections the median
number of patients examined every month was used.
RESULTS
Generally, at least one viral aetiological agent was
detected by PCR and/or antigen test in 277 out of 381
examined patients (72.7%). The highest number of
children was infected with RSV – 187/ 381 children
(49%), followed by Enteroviruses (Enteroviruses/Rhinoviruses) – 59/381 (15.5%); HMPV – 33/381 (8.7%),
Adenoviruses – 19/257 (7.4%), HPIV 1,2,3 – 22/381
(5.8%) and HBoV – 14/257 (5.5%). In specific years,
Children tested for RNA viruses
RSV-positive
Mediane of ill children
period IV
period II
period III
p.I
p.VI
p.V
HMPV-positive
EV-positive
p.VII
HPIV-positive
Children tested for DNA viruses
AdV-posisitive
BoV-posisitive
10
0
Fig.
1.1. Udział
Monthly
distribution
of detected
viruses (RSV,
HMPV,
HEV/HRV,
HPIV
t.1-3, HAdV,
HBoV) in
children hospiRycina
badanych
wirusów (RSV,
HMPV, HEV/HRV,
HPIV t.1-3,
HAdV,
HBoV) w ostrym
zakażeniu
dróg oddechowych
u dzieci
talized
in
X.2008
and
IV.2011.
Separated
periods
based
on
the
number
of
hospitalized
children
with
suspicion of
hospitalizowanych w okresie X.2008-IV.2011, z uwzględnieniem miesięcy i zwiększonej liczby pacjentów.
acute viral respiratory infection.
Figure 1. Monthly distribution of detected viruses (RSV, HMPV, HEV/HRV, HPIV t.1-3, HAdV, HBoV) in children hospitalized in X.2008 and
IV.2011. Separated periods based on the number of hospitalized children with suspicion of acute viral respiratory infection.
No 4
629
Non-influenza viruses in acute respiratory infections
Detected viral agent (%) in
the period
the distribution of particular viruses was varied and
significant differences were mainly found for HMPV
(2% in 2011 vs. 21.2% in 2009) and HEV/HRV (2.9% in
2008 vs. 33.3% in 2011). Significant differences in the
frequency of adenoviral, bocaviral and HPIV t.1,2,3 infections in different years were not detected (Po >0.05).
Another study regarding virus distribution by
consecutive 31 months indicated that for all viruses,
except HBoV, the relation between number of diagnosed
cases and months of sample collection was significant
(Po<0.05). The distribution of viruses during the following 31 months of the study is presented on Figure
1. The distribution of identified viruses in consecutive
weeks was also analysed. The significant differences
(Po<0.05) in week distribution during all study were
found for all viruses, except HAdV. However, there were
some differences about the particular years of the study.
The highest differences in week distribution of RSV
were found in 2010 (Po=0.0026), for HMPV – in 2009
(Po=0.0000) and for HEV/HRV – 2011y. (Po=0.0027).
RSV infections mainly were observed from December to April. In our study, the distribution of RSV
during 3 consecutive winter-spring seasons was examined (Fig. 2). The RSV epidemic curve during those 3
seasons varied from sharp curve in the season of 20092010 with one-peak in March 2010 and to two-peaks
curve in the season of 2008-2009 (peak in December
2008 and February 2009). The epidemic curve of RSV
infection observed in the season of 2010-2011 seems to
Number of hospitalized chidren
with main symptoms
in particular periods
A
100
90
80
70
60
50
40
30
20
10
0
B
RSV pos
HMPV pos
X-XI.2008 (1st) XII.2008-II.2009
(2nd)
EV pos
III.-XII.2009
(3rd)
90
be flat with the low peak in March 2011, however, the
possibility of the increased number of RSV infections
in May 2011 cannot be rejected.
Fig. 2.
2.RSVRSV
infections
3 epidemic
seasons2009-2010
2008- i 2010-2011
Figure
infections
during 3during
epidemic
seasons 2008-2009,
2009, 2009-2010 i 2010-2011
Then, the periods of increased number of acute viral
respiratory infections were determined. The division into
periods was based on the median of examined babies
and children per month (10 children per month) (Fig.1).
There were months when the number of examined
children exceeded the median of patients per months.
Finally, seven periods were determined. There were
periods with increased number of hospitalized children:
second (XII.2008 – II.2009), fourth (I-VI.2010) and
sixth (XII.2010-III.2011). There were periods with lower
HPIV 1-3 pos
HAdV pos
HBoV pos
I-VI.2010 (4th) VII-XI.2010 (5th) XII.2010-III.2011 IV.2011 (7th)
(6th)
P/PB
80
Bronchitis without P/PB
70
URTI
60
50
40
30
20
10
0
X-XI.2008 (1st) XII.2008-II.2009 III.-XII.2009 (3rd) I-VI.2010 (4th) VII-XI.2010 (5th) XII.2010-III.2011 IV.2011 (7th)
(2nd)
(6th)
Abbreviations: P/PB - pneumonia, bronchiolitis or pneumobronchiolitis cases; Bronchitis witout P/PB – cases of bronchitis only;
Abbreviations:
P/PB
- pneumonia, bronchiolitis or pneumobronchiolitis cases; Bronchitis witout P/PB – cases of
URTI – upper respiratory
tract
infection
Fig. 3.
bronchitis only; URTI – upper respiratory tract infection
Participation (%) of tested viruses (A) and main clinical manifestation (B) in 7 periods separated on the basis of
the number of hospitalized children with respiratory tract infections
Rycina 3. Udział (%) badanych wirusów (A) oraz stwierdzanych głównych objawów (B) w 7
okresach, wyróżnionych na podstawie liczby dzieci hospitalizowanych z powodu zakażeń
dróg oddechowych
630
No 4
observed in the 4th and 2nd periods. 75% of all bronchiolitis were recognized in the 4th period when very high
<6m (URTI)
number of RSV infection was also observed. It should
20
>=12 m (Bronch.)
be pointed out that in the periods with increased number
6-<12m (Bronch.)
of hospitalized children, the higher frequency of more
severe LRTI cases was observed.
15
<6m (Bronch.)
Acute upper respiratory tract infections were rec>=12m (P/PB)
ognized in 60 hospitalized patients. Among them 20
10
6-<12m (P/PB)
was caused by RSV (only 1.2% of all RSV positive), 7
<6m (P/PB)
– by HMPV (23% of all HMPV pos), 7 – by HEV/HRV
5
(14%), 5 – by HBoV (38.5%), 4 - by HPIV t.1-3 (18.2%)
and 3 – by HAdV (only 9.4% of all HAdV positive).
Unexpected increase of HMPV infections in 2009 y.
0
required more detailed analysis. In 2009 year, the ma2008
2009
2010
2011
jority of HMPV infections were found among children
Year of the study
from 6 months to 1 y. (60%), and below 6 months (36%).
Abbreviations: URTI – upper respiratory tract infections;
In other periods the majority of children with HMPV
Bronch..- bronchitis;
– pneumonia
or Bronch..pneumobronAbbreviations:
URTI – upperP/PB
respiratory
tract infections;
bronchitis; P/PB – pneumonia or
infections were below 6 months (75%). In general, the
chiolitis
pneumobronchiolitis
clinical manifestation in children infected with HMPV
Fig.
duedue
to HMPV
in period
2008-2011
by age
and main
Fig.4.4. Infections
Infections
to HMPV
in period
2008-2011
byof children
were mainly upper respiratory tract infections (URTI)
age
of
children
and
main
recognition
recognition
– 23%, followed by bronchitis (30%) and pneumonia
(27%). However, children with acute URTI caused by
number of hospitalized patients: first (X-XI.2008), third HMPV were hospitalized only in 2009 and in the 3th
(III-XII.2009), fifth (VII-XI.2010) and seventh (IV.2011). period. This difference was significant (Po=0.0000)
The analysis of percentage of babies and children although a small number of cases was analysed (Fig. 4).
with identified viral agent of infection, as well as the Also HBoV infections were more often detected in
distribution of particular viruses in particular periods URTI or bronchitis cases than in pneumonia and/or
were conducted. The percentage of patients with identi- bronchiolitis (Po=0.0123). In the 2nd season all 5 detected
fied viral agent of infection in the periods was higher HBoV infections manifested as URTI or bronchitis.
than 50% (except the first period- in 2008y.) and reached
87.5% in the 7th period and 85% in the 3rd period. The
DISCUSSION
distribution of tested viruses in particular periods varied.
RSV infections were diagnosed in all particular periods.
The surveillance system of viral respiratory infecThose infections were predominant in five periods (1st,
nd
th
th
th
2 , 4 , 6 and 7 ). Infections caused by other viruses tious diseases in Poland is limited to influenza. Problem
were predominant in summer and fall time: in the 3th of other than influenza viral respiratory infections, is
period (HMPV) and the 5th period (HEV/HRV or HPIV). still unrecognised, especially among young children.
Moreover, high involvement of other viruses was ob- In some other countries confirmed cases of viral respiserved also: HAdV – in 3-4th periods and HBoV – in ratory infections are reported and analysed. There are
2nd period. The strongly significant increase in HMPV some differences in panel of monitored viral activity:
infections in the 3rd period and HEV/HRV infections in in Canada – infections of influenza viruses (A and B),
RSV, HPIV type 1-4, HMPV, HRV, HAdV and corothe 6th period was found (Fig.3.A).
The analysis of the main clinical manifestations naviruses; in the USA: influenza viruses, RSV, HPIV,
was also done. It was recognized that pneumonia was HAdV; in England and Wales the activity of influenza
the most common (51%) followed by acute bronchitis viruses, HAdV, RSV, HPIV and HRV is monitored (2-4).
The aim of our study was to determine the oc(19%), acute upper respiratory infections (18%) and
bronchiolitis (7%) or pneumobronchiolitis (5%). The currence other than influenza virus infections among
recognition of pneumonia was in more than 50% of children hospitalized in one hospital in Warsaw during
cases in the following periods: 3th, 4th, 5th, 6th and 7th. 31 months of the study (2008-2011) and to analyse the
In the 1st and 2nd period “other ARTI” (bronchitis and seasonality of the identified viruses. The high percentURTI together) were mainly diagnosed, however the age of detected viruses in collected samples (72.7%
ratio of pneumonia in these periods remained also positive) was an effect of a wide panel of examined
high (Fig. 3.B). The most severe infections of lower viruses (RSV, HMPV, HEV/HRV, HPIV type 1,2,3
respiratory tracts were not numerous. Bronchiolitis and and HAdV, HBoV), and a good cooperation with the
pneumobronchiolitis were significantly more frequently clinicians. The panel of being detected viruses didn’t
Number of detected infections due to HMPV
25
6-<12m (URTI)
No 4
Non-influenza viruses in acute respiratory infections
include influenza viruses in our study because of age of
patients. The number of influenza cases among children
below 5 usually was lower in comparison with RSV or
other respiratory viruses (11-15). Moreover, during A/
H1N1v.2009 pandemic, tests for influenza were usually
done by GPs prior to admission to the hospital.
Generally, in our study, RSV was the main aetiological agent of acute viral infections and was the main
reason for children’s hospitalization, but mainly those
patients with LRTI. Among patients with diagnosed
RSV infections only 1.2% have got symptoms of URTI.
High prevalence of RSV determined among acute
viral lower respiratory tract infections was related to
examined group: the majority of patients were below 6
months of life (including preterm infants), followed by
patients below 3 years old and only 4% of all of them
were 3-5 y.o. In such age-groups the prevalence of RSV
is usually very high. Moreover, the most severe LRTIs
(bronchiolitis, pneumobronchiolitis, pneumonia) were
also caused by RSV, especially in RSV epidemic season
– as it was described by other authors (9,16). However,
as it was found in our study, severe LRTI cases might
have been caused by other, than RSV, viruses, especially
in summer months when pneumonia was mainly caused
by HEV/HRV. Our results are similar to data collected
during many years of monitoring of viral activity in
USA, Canada and the UK (2-4). In those countries,
spring and summer time is usually connected with
parainfluenza viruses (mainly type 3), Enteroviruses,
Rhinoviruses, Adenoviruses and HMPV infections. Furthermore, in our studies, Enteroviruses, HMPV, HPIV
and HAdV infections were detected in summer/fall time,
however some single RSV cases were also identified. In
opposite, human bocavirus infections, observed mainly
in winter time, were rather connected with bronchitis or
URTI than to pneumonia or bronchiolitis.
In our studies, the very high number of HMPV infections (21.2%) was observed in 2009. In other years,
the frequency of HMPV was much lower. According to
2012 - 15th ESCV meeting data the increased number
of HMPV cases in 2009 also was observed in other
countries: England, Greece, Germany, Spain (13,17,18).
The question is whether the increased frequency of
HMPV infections across Europe in 2009 might have
been caused by the increased number of paediatric
consultations and hospitalization as a possible impact
of “swine influenza” emergency, as it was observed in
some countries (19). This thesis may explain our results
indicating that patients with HMPV infection in 2009
were older than in other periods and that the main recognition in these patients (and only in this season) was
acute URTI due to HMPV.
Usually, a peak of respiratory infections is observed
in period between November - April every year in the
European countries and other countries on the northern
631
Hemisphere like the USA and Canada (2-4). In those
months, the increased number of influenza viruses, RSV,
HMPV, Rhinovirus, HPIV (mainly type 1), adenoviruses
and other viruses infections are expected. Activity of
some respiratory viruses might overlap in the winterspring season, some viruses might be followed by another, and some viruses might be replaced by ones other.
Similar epidemiological situation occurred every year,
however, some differences are observed. Although, the
activity of RSV and influenza viruses takes place at the
same time, usually when one virus is predominant, the
activity of the second one decreases. Such phenomenon
was also described in the season 2009-2010, when A/
H1N1v2009 appeared, one of the best examined season.
In Italy few RSV infections were notified in November 2009, the number of cases increased in December
with a peak in February and decrease in March 2010.
At the same time, when the number of RSV infections
increased - the number of identified cases of influenza
(A/H1N1v2009) decreased (12). Similar viral activity
was also observed in New York. When number of RSV
infections increased in November 2009 (peak in January) number of influenza cases decreased, especially
among babies and children (13). As for Central England
very high peak of RSV cases was observed in JanuaryFebruary 2010 (14).
In our study, the beginning of the RSV epidemic
season was different in examined years, and for example
it was delayed in 2009-2010 in comparison with two
other examined seasons. It might have been connected
with high number of HMPV infections in the Fall of
2009 or with high activity of influenza virus (not examined), which were replaced by RSV cases. Another
explanation of this phenomenon may be connected to
biennial cycle of RSV outbreak, as it was described in
Croatia. As result of monitoring of RSV activity during
12-years, it was found that RSV outbreaks occurred
in two-year cycles, which were repeated every 23-25
months - after one large RSV epidemic season, the next
one was smaller (20). Moreover, according to CDC data
– the duration of RSV season may vary depending on the
year and geographic region. In the USA the duration of
RSV season 2010-2011 varied from 15 weeks (Kansas
City) to 27 weeks (Florida) (3).
Even though, RSV is a predominant viral agent of
respiratory infections in winter-spring season in children, the beginning of this season may differ from the
occurrence of RSV infections and it should be taken into
consideration the activity of other viruses. That was the
reason why periods with increased number of all acute
viral respiratory infections were separated. Duration
of these periods with increased number of hospitalized
children differed from 3 months in the first year of the
study (XII.2008-II.2009), through 6 months – in the
second (I.2010-V.2010) to 4 months – in third year
632
(XII.2010-III.2011). Variability of virus activity was
observed in all periods: these with higher number of
ARTI and those with lower number of patients. Also an
unexpected increase of occurrence of particular viruses
(like HBoV in 2008y., HMPV in 2009y. and HAdV in
2010y.) was found. Observed differentiation of clinical manifestations of LRTI was rather connected with
the number of patients than with the kind of detected
viruses. In opposite, the high frequency of URTI was
rather connected to high activity of some viruses like
HMPV and HBoV in the periods.
CONCLUSIONS
Observed variability of viruses activity might have
been partially explained by temporary predomination
of particular viruses in our region in different years.
Relatively high prevalence of acute URTI or bronchitis
caused by HBoV or HMPV in some periods indicated
necessary of more detailed molecular and epidemiological studies. Also our results indicate the need for
improved diagnostic capabilities of virological tests
in acute upper and lower respiratory tract infections
in children.
REFERENCES
1. Tabele wynikowe Badania Chorobowości Szpitalnej
Ogólnej. http://www.statystyka.medstat.waw.pl/wyniki/
wyniki.htm
2. Public Health Agency of Canada, The Respiratory Virus
Detection Surveillance.http://www.phac-aspc.gc.ca/bidbmi/dsd-dsm/rvdi-divr/index-eng.php.
3. Mutuc JD, Langley GE. Respiratory Syncytial Virus — United States, July 2007–June 2011. MMWR
2011;35:1203-06.
4. Health Protection Agency, Respiratory Pathogen Circulation, England and Wales, 2004-2013. http://www.hpa.
org.uk/Topics/InfectiousDiseases/InfectionsAZ
5. De Nos D, Vankeerberghen A, Vaeyens F et al. Simultaneous detection of human bocavirus and adenovirus
by multiplex real-time PCR in a Belgian paediatric
population. European J Clin Microbiol Infect Dis 2009;
28:1305-10.
6. Jacques J, Moret H, Renois F, et al. Human Bocavirus
quantitative DNA detection in French children hospitalized for acute bronchiolitis. J Clin Virol 2008; 43:142147.
7. Roca A, Loscertales MP, Quinto L, et. al. Genetic variability among group A and B respiratory syncytial viruses
in Mozambique: identification of a new cluster of group
B isolates. J Gen Virol 2001; 82:103-11.
8. Cordey S, Thomas Y, Cherpillod P, et al. Simultaneous
detection of parainfluenza viruses 1 and 3 by real-time
reverse transcription- polymerase chain reaction. J Virol
Meth 2009; 156:166-168.
No 4
9. Echevarŕia J, Erdman DD, Swierkosz EM, et al. Simultaneous Detection and Identification of Human Parainfluenza Viruses 1, 2 and 3 from Clinical Samples by
Multiplex PCR. J Clin Microbiol 1998; 36:1388-1391.
10. Panasik A, Pancer K. Zakażenia metapneumowirusem
człowieka (hMPV) u małych dzieci. Przegl Epidemiol
2009;63:369-374
11. Ambrosioni J, Bridevaux P-O, Wagner G, et al. Epidemiology of viral respiratory infections in a tertriary care
centre in the era of molecular diagnosis, Geneva, Switzerland, 2011-2012. Clin Microbiol Infect. Published online:
30 December 2013. doi:10.1111/1469-0691.12525
12. Pierangeli A, Scagnolari C, Selvaggi C, et al. Virological
and clinical characterization of respiratory infections in
children attending an emergency department during the
first autumn- winter circulation of pandemic A (HINI) 2009
influenza virus. Clin Microbiol Infect 2011; 18:366-373.
13. Tanner H, Boxall E, Osman H. Respiratory viral infections during the 2009-2010 winter season in Central
England, UK: incidence and patterns of multiple virus
co-infections. European J Clin Microbiol Infect Dis 2012;
31:3001-6.
14. Westheimer E, Paladini M, Balter S, et al. Evaluating
the New York Emergency Department Syndromic Surveillance for Monitoring Influenza Activity during the
2009-10 Influenza Season. PLoS Currents. Published
online: 17 August 2012. doi:17(4):e500563f3ea181.
15. Pogka V, Kossivakis A, Kalliaropoulos A, et al. Respiratory viruses involved in influenza-like illness in a Greek
pediatric population during the winter period of the years
2005-2008. J Med Virol 2011; 83:1841-8.
16. Gouyon J-B, Roze J-C, Guillermet-Froemntin C, et al.
Hospitalizations for respiratory syncytial virus bronchiolitis in preterm infants at <33 weeks gestation without
bronchopulmonary dysplasia: the CASTOR study. Epidemiol Infect 2013, 141: 816-826.
17. García-García ML, Calvo C, Pozo F, et al. Spectrum of
respiratory viruses in children with community-acquired
pneumonia. Paediatrics Infect Dis J 2012; 31:808-813.
18. Bierbaum, S, Forster J, Berner R, et al. Detection of respiratory viruses using a multiplex real-time PCR assay
in Germany, 2009/10. Arch Virol 2013, Published online:
doi: 10.1007/s00705-013-1876-3
19. Keramarou M, Cottrell S, Evans MR, et al. Two waves of
pandemic influenza A(H1N1)2009 in Wales – the possible impact of media coverage on consultation rates, April
– December 2009. Eurosurveillance 2011;16:pii=19772.
20. Mlinaric-Galinovic G, Welliver RC, Vilibic-Cavlek T,
et al. The biennial cycle of respiratory syncytial virus
outbreak in Croatia. Virol J 2008; 5:1-5.
K. Pancer, Department of Virology
National Institute of Public Health
- National Institute of Hygiene,
Chocimska 24, 00-791 Warsaw, Poland;
Katarzyna Piekarska1, Magdalena Rzeczkowska1, Waldemar Rastawicki1,
Anna Dąbrowska-Iwanicka3, Iwona Paradowska-Stankiewicz 2
USEFULNESS OF LABORATORY METHODS IN DIAGNOSIS OF PERTUSSIS
IN ADULT WITH PAROXYSMAL COUGH*
Department of Bacteriology, National Institute of Public Health-National Institute of Hygiene
in Warsaw
2.
Department of Epidemiology, National Institute of Public Health-National Institute of Hygiene
in Warsaw
3.
Oncology Centre - Maria Skłodowska-Curie Institute in Warsaw
1.
ABSTRACT
INTRODUCTION. Pertussis is an acute, highly contagious bacterial infection of respiratory system caused by
Bordetella pertussis. Principally, disease affects young children, however, recently it is also reported in adolescents and adults. Symptoms of pertussis in adults are non-specific, i.e. dry, paroxysmal and protracted cough.
Thus, it is rarely diagnosed in this group.
AIM. This paper aimed at evaluating the usefulness of the laboratory methods in diagnosis of pertussis in adults
based on a case presenting with dry, paroxysmal and chronic cough.
MATERIAL AND METHODS. Sputum (collected on 25th January 2013) and paired serum samples (collected on
13th February and 19 April 2013) were tested. Pertussis diagnostics involved culture, in-house PCR, real-time
PCR and ELISA.
RESULTS. Sputum culture, using commercial medium Bordetella Selective Medium by Oxoid did not reveal the
presence of B. pertussis. Real-time PCR and PCR, however, confirmed the presence of insertion sequence IS481
and pertussis toxin promoter sequence ptx-Pr, markers indicative of B. pertussis infection. Serological testing
revealed the high titres of IgA, IgG and IgM antibodies to B. pertussis in the first sample. In the second sample,
collected 2 months following the first one, a significant decrease in IgA antibodies was reported.
CONCLUSIONS. These data suggest a high usefulness of the laboratory methods in the diagnosis of pertussis in
adults with chronic cough. Application of such methods ensures adequate diagnosis of disease, quick introduction
of proper treatment and implementation of procedures preventing the spread of infection.
Key words: pertussis in adult, Bordetella pertussis, microbial diagnostics of pertussis, paroxysmal cough
INTRODUCTION
Pertussis is an acute, highly contagious respiratory disease, caused by Bordetella pertussis, a Gramnegative, aerobic coccobacillus. Pathogenic mechanism
of Bordetella pertussis consists mainly in releasing
toxins, including pertussis toxin (PT) which damage
ciliated respiratory epithelial cell, leading to the onset
of characteristic symptoms. Transmission of pathogen
occurs via aerosolized droplets or direct contact with
respiratory secretions from infected persons. Pertussis
incubation period ranges from 7 to 10 days. Dependent
on disease course, the following stages may be listed:
catarrhal, paroxysmal and convalescent (9, 12, 16).
A list of specific symptoms of pertussis include: paroxysmal cough with characteristic inspiratory wheezing sound (whooping cough), sputum expectoration
and post-tussive vomiting. These are most commonly
reported in infants and young children. Currently, in
many developed countries, including Poland, pertussis
is more frequently reported in older age groups (2, 3, 5,
8, 12, 13). Contrary to infants, the course of pertussis is
* paper was executed within objective no. 6/EM/2013.
634
No 4
Katarzyna Piekarska, Magdalena Rzeczkowska, et al.
usually mild and less symptomatic in adolescents and
adults. They may often present with only dry, persistent,
protracted cough, occurring especially at night (www.
who.int). It should be highlighted that early diagnosis
of pertussis in adults is of importance as they may be
a source of B. pertussis infection to infants which may
be a life-threatening condition for them.
Laboratory testing for pertussis include: bacterial
culture, serological and molecular methods.
According to ECDC (www.ecdc.europa.eu), in
addition to clinical criteria, for pertussis case confirmation, a positive test result is required by at least one
of the following three methods, i.a. culture, molecular
or serological methods as well as documented epidemiological link with laboratory-confirmed pertussis
case. In Poland, pertussis is subject to mandatory
reporting under the Act on Preventing and Combating
Human Infections and Infectious Diseases (dated as of
5th December 2008). It is mainly confirmed based on
symptoms and/or serological test results.
Pertussis is still relatively prevalent infectious disease, with cyclic increase in reported pertussis cases,
occurring every 3-5 years (www.cdc.gov). From the
WHO data transpires that approximately 16 million
pertussis cases are reported annually worldwide. Of
them, nearly 195,000 die. ECDC (1) estimates suggest
that a total of 19,743 (16,897 confirmed cases) pertussis
cases were notified by 27 EU/EEA countries in 2011.
diagnosis of pertussis and determine the dynamics of specific antibody titres, paired serum samples were collected
from the patient (13th February and 19th April 2013).
Diagnostic methods applied:
1. Culture. Bacteriological testing of sputum for the
presence of Bordetella, using commercial culture
medium Bordetella Selective Medium by Oxoid.
2. Molecular methods. Preparation of genomic DNA
from sample tested was obtained, using commercial
”High Pure PCR Template Preparation Kit” (Roche),
following the manufacturer’s procedures.
B. pertussis DNA was detected using commercial “Bordetella pertussis/parapertussis Real-Time
Kit’’ by Diagenode. Real-time PCR was performed
according to the manufacturer’s procedures.
In-house PCR was also used to detect the presence of Bordetella DNA. For identification, chromosomal markers were used, i.e. insertion sequence
IS481 and pertussis toxin promoter sequence ptx-Pr.
Table I presents primer sequences and expected size
of PCR products. The following thermal conditions
were used for amplification of selected markers:
initial DNA denaturation at 94°C for 10 minutes,
and then 35 reaction cycles, including three stages:
DNA denaturation at 94°C for 45 seconds, primer
binding at 68°C for 45 seconds, DNA polymerization
at 72°C for 60 seconds and final polymerization at
72°C for 5 minutes.
Table I. Diagnostics of paroxysmal cough in adult suspected of pertussis.Primer oligonucleotides used for PCR with
expected size of PCR products.
Marker
ptx-Pr
IS481
Primer
BPpr-1
BPpr-2
BP-1
BP-2
Nucleotide sequence (5’-3’)
CGCCAAGCTGAAGTAGCA
AAGGAGCGTTCATGCCG
GATTCAATAGGTTGTATGCATGGTT
TTCAGGCACACAAACTTGATGGGCG
Expected size of PCR products
References
172 bp
4
180 bp
4
ptx-Pr – pertussis toxin promoter; IS481 – insertion sequence IS481, indicative of i.a. B. pertussis.
Incidence remained at 5.57 per 100,000 population. In
2011 and 2012, 1,669 (4.33 per 100,000 population)
and 4,684 (including 32%, i.e. 1,501 hospitalized cases;
incidence-12.16 per 100,000 population) pertussis cases
were reported in Poland, respectively (10).
This paper aimed at demonstrating the usefulness
of the laboratory methods in diagnosis of pertussis in
adults based on a case presenting with dry, paroxysmal
and chronic cough.
Sample material. Sputum sample, collected from a
non-hospitalized 43-year-old female presenting with
dry, persistent cough on 25th January 2013, was subject
to bacteriological and molecular testing. To confirm the
In PCR, DNA isolated from reference strains:
Bordetella pertussis TohamaI (CIP 81.32=NCTC
13251=ATCC BAA-589) and Bordetella parapertussis (CIP12822=NCTC 13253=ATCC BAA-587)
were used as positive controls.
3. Enzyme-linked immunosorbent assay - ELISA:
Quantitation of antibodies to B. pertussis toxin and
filamentous haemagglutinin in three immunoglobulin classes, using commerical assay - ELISA NovaLisa Bordetella (NovaTec Immunodiagnostica),
according to the manufacturer’s procedures.
RESULTS AND DISCUSSION
For many physicians, pertussis is still an infectious
childhood disease which is rarely taken into account in
No 4
Laboratory methods in diagnosis of pertussis
differential diagnosis of chronic cough in adults. In the
light of trends in the epidemiology of pertussis observed
worldwide, however, it is of importance to consider
Bordetella as possible etiological agents of respiratory
system diseases in adolescents and adults (2, 3, 5, 11).
In the case discussed, patient presented with dry,
persistent, paroxysmal cough, causing abdominal pain.
She experienced approximately 12 attacks in a day, occurring in the morning and night and lasting for a few
or several minutes. Fever or other clinical symptoms
were not present. Sputum was collected from patient
about two weeks following the onset of cough. Material
was sent to the Laboratory of the Department of Bacteriology of the NIPH-NIH. Medical history revealed
that 9-year-old child of the patient, who completed a
full course of vaccination, at the beginning of 2013
presented with dry, persistent and paroxysmal cough,
leading to vomiting. Furthermore, serological test results suggested a history of infection with Bordetella
pertussis. Therefore, sputum sample collected from
patient was tested by molecular methods for the presence of atypical pathogens causing respiratory system
infections and Bordetella pertussis.
Irrespective of the fact that isolation of B. pertussis
by culture is recommended by the WHO and considered
to be a gold standard in laboratory confirmation of pertussis, the attempts to isolate B. pertussis from clinical
material failed. It could result from the fact that sputum
sample was collected at a late stage of disease (more
than two weeks following the onset of disease) as the
probability of B. pertussis isolation rapidly decreases
with time (3, 5). Another reason could be a clinical material itself. Sputum is not entirely adequate material for
diagnosing pertussis, however, it is acceptable in adults
(3, 14). The most reliable and recommended samples for
identification of Bordetella are nasopharyngeal aspirates
or nasopharyngeal swabs (9, 16). Additionally, patient’s
age could have an effect on the negative result of culture.
It is thought that the probability of B. pertussis isolation
in adults is lower compared to children (3).
Currently, culture is replaced by polymerase chain
reaction (PCR) in a number of laboratories involved in
diagnosis of pertussis worldwide. PCR enables to detect
Bordetella DNA from the clinical material collected in
the period ranging from early stage of disease to the
week 5 of its duration. Compared to culture, PCR is of
considerably higher sensitivity (especially in the late
stage of disease or following the initiation of antimicrobial therapy) (7, 14). Furthermore, PCR provides test
results in a short period of time, i.e. 1-2 days which is
of importance as proper therapy may be initiated (7).
Real – time PCR is a method which is recommended
and applied to the largest extent by reference centers.
There is a number of commercial kits for real – time
PCR which are available on the market and these include
635
primers which amplify one target sequence, i.e. insertion
sequence IS481 of B. pertussis. According to the latest
literature data, if exclusively sequence IS481 is to be
used, false positive PCR results may be obtained. It was
concluded that IS481 may be present in the genome of
other Bordetella species, i.e. B. bronchiseptica and B.
holmesii (4, 14). Therefore, specialist from reference
centres recommend to use additional target sequence,
i.e. pertussis toxin promoter region to increase the sensitivity of B. pertussis identification.
In the case discussed, B. pertussis DNA from the
patient’s sputum was detected by both commercial real
– time PCR and own-developed PCR which confirmed
also the presence of the second characteristic marker of
B. pertussis, i.e. pertussis toxin promoter.
Based on molecular test results, the patients was
subject to 7-day therapy with clarithromycin, administered in a dosage of 500 mg two times a day and then
250 mg two times a day.
In Poland, serological testing is predominantly applied in the diagnostics of pertussis. These tests detect
specific antibodies in the serum of infected patients.
Commercial immunoenzymatic test – ELISA is the
most commonly used test in routine serum diagnostics.
It allows for determining antibodies to B. pertussis toxin
and/or filamentous haemagglutinin in immunoglobulin
classes. Contrary to molecular tests, which allow for
confirmation of infection at its early stage, serological testing provides etiology at later stage, usually 2-3
weeks following the onset of symptoms. In addition,
interpretation of serological test results of persons
suspected of pertussis is hindered by the presence of
vaccine-induced antibodies, especially of IgG class.
Therefore, serological diagnostics of pertussis should
aimed at detecting seroconversion, i.e. diagnostically
significant increase in antibody titres in at least two
serum samples collected at 2-4 week intervals (6). It
should not be forgotten, however, that if the first sample
is collected at a later stage of disease, antibody titres
may be so high that significant increase in antibody
titres should not be expected in the second sample. It
is assumed that an increase in antibody titres by 100%
or their decrease by 50% in the next sample is the best
possible evidence of active infection with B. pertussis
(6). In the case analyzed, the first serum sample collected from the patient on 13th February, diagnostically
significant increase in antibody titres for B. pertussis
(> 11 NTU) was detected in three immunoglobulin
classes, i.e. IgA (20.26), IgG (17.52) and IgM (20.08).
Second serum sample, collected on 19th April, revealed
diagnostically significant decrease in antibody titres
of IgA class (9.87 NTU). Furthermore, a decrease in
antibody titers was also noted in IgG and IgM classes
(13.44 and 19.65, respectively).
636
Katarzyna Piekarska, Magdalena Rzeczkowska, et al.
SUMMARY
Having considered an increase in the number of
pertussis cases, which is observed in many countries,
including Poland, this infection should be referred to
as re-emerging threat for public health, not only in
the population of children, but also adolescents and
adults. Increasing number of pertussis cases in older
age groups is an important risk factor of B. pertussis
transmission to unvaccinated or partially vaccinated
infants and young children for whom this infection may
be a life-threatening condition. Furthermore, failure to
detect and diagnose pertussis in adolescents and adults
may lead to underestimation of epidemiological data
(15). Adults, presenting with protracted cough, which
is a predominant and frequently the only symptom of
disease, are rarely tested for infection with B. pertussis.
It may be affected by difficulties associated with pertussis diagnostics, i.e. the cost of diagnostic tests or the
possibility to perform exclusively serological testing.
Such situation is also determined by the prevalent use
of empiric antimicrobial therapy in respiratory system
diseases which eliminates the possibility to detect etiological agent. Case discussed presents the usefulness of
microbial laboratory methods in pertussis diagnosis,
especially in adults. Performance of diagnostic tests
and proper selection of methods, considering disease
stage, enable to initiate adequate therapy and implement
procedures preventing the transmission of infection.
REFERENCES
1. Annual epidemiological report. Reporting on 2011
surveillance data and 2012 epidemic intelligence data.
(www.ecdc.europa.eu)
2. Beynon KA, Young SA, Laing RT, et al. Bordetella
pertussis in adult pneumonia patients. Emerg Infect Dis
2005;11:639-41.
3. Boulouffe C, Vanpee D. Increasing cause of cough among
adults. Emerg Med Australas 2008;20:280-3.
4. Dalby T, Krogfelt KA, Wirsing von Koenig CH, et al.
Guidance and protocol for the use of real-time PCR in
laboratory diagnosis of human infection with Bordetella
pertussis or Bordetella parapertussis. As part of the
EUpert-Labnet surveillance network. ECDC Technical
Report. 2012.
5. Doleh TY, Rehm SJ, Isaacson HJ. A 49-year-old woman
with a persistent cough. Cleve Clin J Med 2011;78:521-8.
No 4
6. Guiso N, Berbers G, Fry NK, et al. What to do and what
not to do in serological diagnosis of pertussis: recommendations from EU reference laboratories. Eur J Clin
Microbiol Infect Dis 2011;30:307-12.
7. He Q, Schmidt-Schläpfer G, Just M, et al. Impact of
polymerase chain reaction on clinical pertussis research: Finnish and Swiss experiences. J Infect Dis
1996;174:1288-95.
8. Lasserre A, Laurent E, Turbelin C, et al. Pertussis incidence among adolescents and adults surveyed in general
practices in the Paris area, France, May 2008 to March
2009. Euro Surveill 2011;16. pii: 19783.
9. Mattoo S, Cherry JD. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infectious
due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 2005;18:326-82.
10. Meldunki roczne o zachorowaniach na choroby zakaźne
i zatrucia w Polsce w 2012. Meldunki epidemiologiczne
– EPIMELD – (www.pzh.gov.pl)
11. Paradowska-Stankiewicz I, Rudowska J. Pertussis in
Poland in 2011. Epidemiological Review 2013;67,199202.
12. Paradowska-Stankiewicz I. Krztusiec in: Choroby
zakaźne i pasożytnicze-epidemiologia i profilaktyka. ed.
VII, Alfa-medica Press, 2014: 231-6.
13. Rastawicki W, Rokosz N, Jagielski M. Częstość wykrywania przeciwciał klasy IgA, IgG i IgM dla toksyny
krztuścowej w rutynowo prowadzonej serodiagnostyce
krztuśca u osób ze stanami zapalnymi układu oddechowego w Polsce. Przegl Epidemiol 2009;63:513-8.
14. Riffelmann M, Wirsing von König CH, Caro V, et al.
Nucleic acid amplification tests for diagnosis of Bordetella infections. J Clin Microbiol 2005;43:4925-9.
15. Stefanoff P., Paradowska-Stankiewicz I., Lipke M. et al.,
Incidence of pertussis in patients of general practitioners
in Poland. Epidemiol.Infect. 2013; 1-10.
16. Tozzi AE, Celentano LP, Cioci degli Atti ML, et al.
Diagnosis and management of pertussis. CMAJ 2005;
172:509-15.
Received: 3.06.2014
Dr Katarzyna Piekarska
Department of Epidemiology
– National Institute of Hygiene
Chocimska 24
00-791 Warsaw
Tadeusz M Zielonka
RISK FACTORS FOR TUBERCULOSIS AND SPECIFIC MANIFESTATIONS
OF DISEASE
Department of Family Medicine, Warsaw Medical University
ABSTRACT
In countries with good epidemiological situation, incidence of tuberculosis (TB) is relatively high in immigrants, prisoners, the homeless and unemployed. In a number of regions, co-infection of Mycobacterium
tuberculosis and HIV raises difficulties in controlling TB epidemic. A problematic issue is also drug resistance,
especially in the countries of the former Union of Soviet Socialist Republics (USSR). Neither co-infection of
M.tuberculosis and HIV nor drug resistance are of special concern in Poland. Incidence of extrapulmonary TB
is very diverse (6-44%), however, in Poland such manifestation of tuberculosis is diagnosed rarely. There is a
necessity of monitoring local epidemiological trends and developing appropriate diagnostic and therapeutic
models for better control of infection.
Key words: tuberculosis, epidemiology, immigrants, prisoners, homeless people, HIV, extrapulmonary tuberculosis, MDRTB
Abbreviations: AFR – WHO African Region, AMR – WHO Region of the Americas, EMR – WHO Eastern
Mediterranean Region, EUR – WHO European Region, SEAR – WHO South-East Asia Region, WPR – WHO
Western Pacific Region
INTRODUCTION
Control of tuberculosis epidemic is hindered by
the transmission of this disease in high-risk groups.
Economic migrations resulted in an increase of TB
incidence in immigrants in countries with good epidemiological situation. Since centuries, tuberculosis is
associated with poverty and overcrowding. Conditions
leading to a decrease of cell-mediated immunity, especially HIV infections, constitute a significant risk factor
for tuberculosis. Nevertheless, an important issue is also
infection with multi-drug and extensively-drug resistant
strains of Mycobacterium tuberculosis. Extrapulmonary
tuberculosis is not of epidemic potential, however,
it causes diagnostic problems. Persons infected with
M.tuberculosis, presenting with abundant expectoration of this pathogen, are especially dangerous source
of infection.
GROUPS AT HIGH RISK OF DEVELOPING
TUBERCULOSIS
In several environments, incidence of tuberculosis
is considerably higher compared to the general population. Risk of contracting infections increases by 4-180
fold in some groups (1). It refers mainly to prisoners,
homeless people and immigrants (2,3,4). High incidence
rates were reported in a group of prisoners. Initially,
such problem was noted in overcrowded, poorly ventilated Russian prisons, in which TB incidence rates
amounted to 7,000/100,000 (5). A specific programme,
that has been operating for many years in Russia, shows
measurable effects. Since the last decade, incidence in
prisons is decreasing at a faster pace compared to the
general population (Fig. 1). Irrespective of significant
improvement, incidence in prisons is still 11-fold higher
compared to the general population (6). High incidence
rates were also observed in the prisons of the former
USSR countries – Azerbaijan – 2,500/100,000, Kirghizia – 3,000/100,000 and Georgia – 3,500/100,000
638
Tadeusz M Zielonka
5000
4500
4000
incidence per 100 000
3500
3000
2500
2000
1500
1000
Prisoners
500
Total
0
1999
Fig. 1.
2005
2011
Dynamics of TB epidemiological changes in Russia
and Russian prisons in 1999-2011 - incidence rates
per 100,000 population [based on WHO report
2013 (6)].
(2,7,8). Even higher incidence rates were reported in
prisons in African countries, i.e.: 7,200/100,000 in Ivory
Coast and 5,200/100,000 in Malawi (9). Such problem
is also present in the USA, where there is 50-fold difference between TB incidence in the general population and prisoners. Furthermore, these discrepancies
are on the increase (2). In the WHO European Region
(EUR), a correlation between TB incidence and the
number of prisons was demonstrated (10). Therefore,
WHO requires European countries to register all TB
cases occurring in prisons. In Poland, TB incidence
rate in prisoners is 15-fold higher compared to national
average. It amounts to 288/100,000 (11). Compared to
2011, the number of infections in this group increased
by 40% (12).
Another high risk group of developing TB is the
homeless. It is a marginalized social group, however,
incidence rates are considerably higher collated with the
general population. Statistics relating to this groups are
only available in highly developed countries in which
there is a good epidemiological situation. Due to the attempts undertaken, the USA succeeded in reducing TB
incidence rate in the homeless, i.e. from 270/100,000
in 1994 to 36/100,000 in 2010 (13). In the USA, homeless people account for 6% of all TB cases (14) while
in Canada - 3%, but 39% of them are immigrants (15).
In 1992-2006, the percentage of latent tuberculosis in
this group decreased from 58% to 31% in New York
(16). In London, TB incidence rate in the homeless
was estimated at 788/100,000 while in drug users and
prisoners - 354/100,000 and 208/100,000, respectively
(17). In Poland, a significant increase in the percentage
of homeless people in a group of TB cases is observed.
No 4
However, no official data from the National Tuberculosis Register are available. Prior to 1989, they were not
included in the statistics while only 20 years later they
accounted for 10% of male (18) and 3% of female TB
cases (19). From one article, where TB incidence rate in
the homeless in Poland was calculated, transpires that
it was 720/100,000 in 2008 (20).
In highly developed countries, tuberculosis occurs
significantly more frequently in immigrants than autochthonous population. In several countries, persons
of different ethnicity are predominant with examples
being Turks in Germany, Indians in Great Britain, and
refugees from Maghreb, Libya and Russia in France,
Italy and Israel, respectively. A percentage of them
stay in these countries illegally which hinders a precise estimation of TB incidence in these populations.
In the following countries: Great Britain, Switzerland,
Netherlands and Scandinavian countries, immigrants
account for more than a half of all TB cases (21) while in
the Czech Republic, Finland and other Baltic countries
only a few percents of new TB infections are reported
in immigrants (22). In Great Britain and France, TB
incidence in immigrants is 10-fold higher compared to
autochthonous population. Furthermore, it significantly
affects the average incidence rate in these countries
(23,24). TB incidence in the general population of Great
Britain is 13/100,000 while in persons born there it does
not exceed 5/100,000 (24). In Poland, it is a marginal
problem as from the central register only 0.6% of all TB
cases constitute immigrants. Since 2004, however, they
are officially subject to registration (12). To the largest
extent, they come from Ukraine, Vietnam, Russia and
other former USSR countries (25).
A number of conditions favour the progress of
tuberculosis with the most important ones being haematopoietic cancers, lung cancer, head and neck cancer,
pneumoconiosis, chronic kidney disease and diabetes
(26-29). Of importance are also organ transplantation,
immunosuppression, glucocorticoid and tumour necrosis
factor antagonist use, and history of gastrectomy (30-34).
CO-INFECTION OF MYCOBACTERIUM
TUBERCULOSIS AND HIV
Co-infection with M.tuberculosis and HIV becomes
one of the most important health-related problems. For
the recent years, WHO runs a separate statistics for
TB cases with positive HIV (+) and negative HIV (-)
status. Due to actions undertaken, a significant increase
of the percentage of TB cases with known HIV status
was reported. Nearly a half of all TB cases were tested
for HIV while in WHO African Region (AFR) – even
¾ (6). In the last 20 years, the percentage of persons
infected with HIV in TB cases was stable, amounting
No 4
Risk factors of tuberculosis
639
70%
60%
50%
40%
30%
20%
10%
0%
Fig. 2.
Percentage of Mycobacterium tuberculosis and HIV co-infections in the countries with the poorest epidemiological
situation [based on WHO report 2013 (6)].
to 13%. However, in the AFR, 76% of M.tuberculosis
and HIV co-infections are reported (6). As many as
92% of co-infections with M.tuberculosis and HIV were
identified in the AFR and WHO South-East Asia Region
(SEAR). In the remaining regions, these co-infections
account for 1-2% (6). Considerable regional differences
in the occurrence of these infections are observed. In
Swaziland, 77% of TB cases are concomitantly infected
with HIV while in Angola and Ethiopia – only 9.6% (6).
Especially high discrepancies are reported in countries
with the poorest epidemiological situation (Fig. 2). In a
group of new TB cases, only 200, 300 and 500 persons
are infected with HIV in Bangladesh, Afghanistan and
Philippines, respectively while their numbers amount
to 330,000 in the South Africa, 130,000 in India and
83,000 in Mozambique. In a number of European countries, M.tuberculosis and HIV co-infection rate does not
exceed 0.1/100,000, however, in Russia and Moldova
and Ukraine - it is 6.5/100,000 and 10/100,000, respectively (6). HIV infection leads to an increase in the
fatality of TB. In this group, it rises up to 29%. There are
significant regional differences in the number of fatal
TB cases infected with HIV (Fig. 3). Tuberculosis is one
of the leading cause of death in AIDS cases. In 2012,
only 57% of TB cases infected with HIV were subject
to antiretroviral therapy, however, a year earlier, their
number did not exceed 50% (6). Thus, it was feasible
to reduce TB fatality in persons infected with HIV,
however, the pace of this decrease is significantly lower
compared to HIV negative persons. Not earlier than in
2003, this situation was improving, which was later
compared to HIV non-infected persons (1998). Only the
AFR and SEAR succeeded in reducing the number of
Fig. 3.
Number of fatal cases (in thousands) due to tuberculosis in the group of HIV(+) and HIV(-) patients
in different WHO regions [based on WHO report
2013 (6)].
TB in HIV cases. In the EUR and WHO Region of the
Americas (AMR), an increase in the number of these
cases is reported. In Poland, it is a marginal problem.
In 2012, tuberculosis was an indicator disease for only
26 persons infected with HIV (12).
640
No 4
Tadeusz M Zielonka
MDR primary
MDR secondary
45%
33%
22%
11%
2,3%
AFR
Fig. 4.
16,0%
14%
2,2%
AMR
3,5%
EMR
20%
16%
2,2%
EUR
SEAR
4,3%
WPR
3,6%
Total
Percentage of primary and secondary multi-drug-resistant M.tuberculosis strains in different WHO regions [based
on WHO report 2013 (6)].
MULTI-DRUG-RESISTANT TUBERCULOSIS
(MDRTB)
Resistance of M.tuberculosis to single drugs does
not pose any risk, however, its increasing resistance to
isoniazid and rifampicin (MDRTB) becomes a challenge from health and economic perspective as longterm treatment of such forms is very expensive and not
always effective. In 2012, 450,000 MDRTB cases were
reported worldwide, of whom 170,000 died (6). Fatality
in this group amounts to 38% while in case of infections
with non-resistant M.tuberculosis – only 7% (6).
MDRTB cases account for 3.6% and 20% of all
new and previously treated infections, respectively (6).
Situation is highly diverse in different regions (Fig. 4).
It results from non-compliance with therapeutic recommendations or poor control over infection. From epidemiological perspective, it is more advisable not to treat
TB cases than treat them poorly, i.e. not long enough,
in an intermittent manner and without the use of several
drugs. The majority of MDRTB cases are reported in the
Eastern Europe and Central Asia. In several countries,
MDRTB cases account for more than 20% and 50%
of new and previously treated infections, respectively
(6). In Belarus, MDRTB accounts for 35% of new cases
and 69% of previously treated cases. In Uzbekistan, it is
23% and 63% while in Russia - 23% and 49%, respectively (6). In countries with very poor epidemiological
situation, the frequency of MDRTB does not have to
be always high, e.g. in Ethiopia it is reported in only
1.6% of new cases and 12% of relapse cases while in
Indonesia – 1.9% and 12% and India – 2.2% and 15%
(6). In the EUR, the former USSR countries make an
important contribution to the percentage of MDRTB
(Fig. 4). Irrespective of very good epidemiological situation in many countries of Western Europe, in which the
percentage of MDRTB in new cases does not exceed 1%
(e.g. in Ireland – 0.4%, Austria – 0.3%, Denmark and
Finland – 0.2% while in Luxembourg, Netherlands and
Switzerland – it is below 0.1%), the share of MDRTB
in new cases for the whole EUR is 4-fold higher than
global average and amounts to 16% (6). In the EUR,
similarly poor epidemiological situation is observed
with regard to MDRTB in previously treated cases as
it accounts for 45% of all such cases. It results from a
high percentage of MDRTB in countries with the highest
number of infections.
In Poland, MDRTB is not of special concern. In
2012, only 31 such cases were reported. It accounted for
0.6% of new cases and 3% of previously treated cases.
Only one case in paediatric population was noted (12).
In the recent years, the number of extensively
drug-resistant tuberculosis (XDRTB) is on the increase
worldwide. Currently, it accounts for 9.6% of MDRTB
cases (6). A total of 92 countries have already reported
such cases. In Poland, XDRTB was diagnosed in immigrants (35).
EXTRAPULMONARY TUBERCULOSIS
Significant differences are also observed in case
of extrapulmonary tuberculosis (Fig. 5). In WHO
Western Pacific Region (WPR), extrapulmonary tuberculosis was reported only in 5% of patients while
in WHO Eastern Mediterranean Region (EMR) in 22%
(6). Except for involving larynx, trachea and bronchi,
extrapulmonary TB is not an infectious disease. Therefore, a number of countries do not run a register of
such cases which would allow for precise assessment
of epidemiological situation. Difficulties arising from
specimen collection for testing and low sensitivity of
bacteriological methods result in a high percentage of
undetected cases. In case of patients infected with HIV,
extrapulmonary TB is more frequently reported (36).
No 4
641
70%
60%
50%
AFB(+)
40%
AFB (-)
30%
AFB unknown
Extrapulmonary TB
20%
10%
0%
AFR
Fig. 5.
AMR
EMR
EUR
SEAR
WPR
Percentage of tuberculosis confirmed by bacterioscopy and extrapulmonary tuberculosis in different WHO regions
[based on WHO report 2013 (6)].
Probably, the frequency of extrapulmonary TB in the
AFR is considerably higher compared to other regions,
however, there is no evidence for such assumption. In
highly developed countries, a decrease in TB incidence
is accompanied by an increase in the percentage of its
extrapulmonary localization. In Canada, the percentage of extrapulmonary TB increased from 18% to 25%
within 20 years (37). In countries, where co-infection
with M.tuberculosis and HIV is rarely reported, the
percentage of extrapulmonary TB is low. In Finland,
Sweden, Great Britain and Netherlands, extrapulmonary
TB accounts for more than 1/3 of infections (38,39). In
Baltic countries and Hungary, this percentage is several
times lower (5-9%) (39).
In Poland, the percentage of extrapulmonary TB is
only 6.9% (12). The majority of infections is accompanied by involvement of pleura (36%), lymph nodes,
bones and joints and also urinary system (12). Partially,
it results from the low frequency of M.tuberculosis
and HIV co-infections in Poland, low percentage of
immigrants and predominance of males at older age
in TB cases (40), while young age and female gender
favour extrapulmonary localization (41). It may not be
excluded, however, that extrapulmonary TB is to some
extent underestimated.
TUBERCULOSIS CASES WITH ABUNDANT
EXPECTORATION OF M.TUBERCULOSIS
Detection of M.tuberculosis by direct sputum
smear microscopy is indicative of abundant expectoration of this pathogen (at least 10,000 bacilli in 1 ml
of sputum). From epidemiological perspective, it is
especially dangerous manifestation of disease as longterm contact with such TB cases poses a considerable
threat of M.tuberculosis transmission to their con-
tacts. WHO strategy of TB prevention is concentrated
especially on detection and treatment of TB cases of
such manifestation. Identification of acid-fast bacilli
(AFB) under microscope does not prejudge a diagnosis
of tuberculosis. Thus, it is recommended to perform
molecular diagnostic test which allows for differentiating between M.tuberculosis and other bacilli (6). The
highest number of patients with abundant expectoration
of M.tuberculosis is reported in the AMR – 59% and
SEAR – 53% while the lowest one in the EUR - 32%
(Fig. 5). It is difficult to decide whether it results from
good epidemiological situation in Western Europe or
low level of bacteriological diagnostics in Eastern Europe. Epidemiological situation in the AMR is affected
by the situation in the countries of South America which
is considerably poorer compared to North America.
Undoubtedly, high percentage of patients with abundant
expectoration of M.tuberculosis in the AFR (47%) is a
reflection of poor epidemiological situation there. TB
cases confirmed by bacterioscopy predominate in the
majority of regions with the exceptions of the EUR and
WPR, where more patients have negative test results by
this method (Fig.5).
In Poland, significant differences in the percentage of patients with abundant expectoration of
M.tuberculosis are reported between provinces. In
Kujawsko-pomorskie, Wielkopolskie and Zachodniopomorskie provinces, they account for more than 50%
of TB cases while in Łódzkie and Lubuskie provinces,
the percentages amount to 16% and 27.6%, respectively
(Fig. 6). It may not be excluded that these differences
are not a real reflection. To some extent, detection of
M.tuberculosis by direct sputum smear microscopy depends on the quality of laboratory equipment as well as
qualifications and experience of personnel. In Kujawsko-pomorskie province, tuberculosis is confirmed by
culture in 90% of cases and 56% by bacterioscopy while
642
No 4
Tadeusz M Zielonka
100,0%
90,0%
AFB (+)
Culture (+)
80,0%
70,0%
60,0%
50,0%
40,0%
30,0%
20,0%
10,0%
0,0%
Fig. 6.
Percentage of tuberculosis confirmed by bacterioscopy and culture in Poland. Provinces were listed from the
lowest to the highest incidence rate [based on the Institute of Tuberculosis and Lung Diseases report 2013 (12)].
in Łódzkie province it is 62% and 16%, respectively
(Fig.6). A special attention should be paid to the low
percentage of bacteriologically confirmed tuberculosis
in provinces with the poorest epidemiological situation
and low percentage of bacteriologically confirmed cases
in Lubuskie province with the best epidemiological situation. A reason of such situation may be poor quality of
bacteriological tests and precipitant diagnosis of TB in
some provinces (42).
SUMMARY
There are regional differences in the epidemiological situation of tuberculosis worldwide. Furthermore, it
is subject to dynamic changes. It is associated not only
with the general health of citizens, but also financial capacity of particular countries, organization of healthcare
system, infection control, cultural problems favouring
the transmission of HIV infection. Referring to average
epidemiological indicators results in underestimation of
the problem. Therefore, it is necessary to analyze local
epidemiological situation. In the light of epidemiological data presented, the significance of tuberculosis
should neither be neglected nor overemphasized. There
is a necessity of monitoring epidemiological trends
and developing appropriate diagnostic-therapeuticpreventive models.
REFERENCES
1. Menzies D, Schwartzman K, Pai M. Immune-based tests
for tuberculosis. In: Schaaf HS, Zumla A, red. Tuberculosis a comprehensive clinical reference. Saunders Europe;
2009:179-97.
2. Baussano I, Williams BG, Nunn P, et al. Tuberculosis
incidence in prisons: a systematic review. PLoS Med
2010;7:e1000381.
3. Klinkenberg E, Manissero D, Semenza JC, et al. Migrant
tuberculosis screening in the EU/EEA: yield, coverage
and limitations. Eur Respir J 2009;34:1180-9.
4. van Hest NA, Aldridge RW, de Vries G, et al. Tuberculosis control in big cities and urban risk groups in the
European Union: a consensus statement. Euro Surveill
2014;19(9) pii: 20728.
5. Balabanova Y, Nikolayevsky V, Ignatyeva O, et al. Survival of civilian and prisoner drug-sensitive, multi- and
extensive drug-resistant tuberculosis cohorts prospectively followed in Russia. PLoS One 2011;6(6):e20531.
6. WHO Report. Global Tuberculosis Control. Surveillance
planning financing. WHO Press Geneva 2013.
7. Aerts A. Prevalence of infectious tuberculosis in the
prison population of Georgia. Int J Tuberc Lung Dis
1998;2(suppl 2):S193.
8. Coninx R, Pfyffer GE, Mathieu C. Drug resistant tuberculosis in prison in Azerbaijan: case study. BMJ
1998;316:1423-5.
9. Maher D, Grzemska M, Coninx R, et al. Guidelines for
the control of tuberculosis in prisons. Geneva: World
Health Organisation; 1998. WHO/TB/98.250.
10. Basu S, Stuckler D, McKee M. Addressing institutional
amplifiers in the dynamics and control of tuberculosis
epidemics. Am J Trop Med Hyg 2011;84:30-7.
11. Janicka-Sobierajska G. Gruźlica wśród więźniów w
latach 1999-2003. Pneumonol Alergol Pol 2004;72:258.
12. Korzeniewska-Koseła M. Gruźlica i choroby układu
oddechowego w Polsce w 2012 r. Instytut Gruźlicy i
Chorób Płuc w Warszawie 2013.
13. Moss AR, Hahn JA, Tulsky JP, et al. Tuberculosis in the
homeless. A prospective study. Am J Respir Crit Care
Med 2000;162:460-4.
14. Bamrah S, Yelk Woodruff RS, Powell K, et al. Tuberculosis among the homeless, United States, 1994-2010. Int
J Tuberc Lung Dis 2013;17:1414-9.
No 4
15. Khan K, Rea E, McDermaid C, et al. Active tuberculosis
among homeless people, Toronto, Ontario, Canada, 19982007. Emerg Infect Dis 2011;17:357-65.
16. McAdam JM, Bucher SJ, Brickner PW, et al. Latent
tuberculosis and active tuberculosis disease rates among
the homeless, New York, USA, 1992-2006. Emerg Infect
Dis 2009;15:1109-11.
17. Story A, Murad S, Roberts W, et al. Tuberculosis in
London: the importance of homelessness, problem drug
use and prison. Thorax 2007;62:667-71.
18. Jagodziński J, Zielonka TM, Błachnio M. Status
społeczno-ekonomiczny i czas trwania objawów u
mężczyzn chorych na gruźlicę leczonych w Mazowieckim Centrum Leczenia Chorób Płuc i Gruźlicy w
Otwocku. Pneumonol Alergol Pol 2012;80:533-40.
19. Błachnio M, Zielonka TM, Błachnio A, et al. Status
społeczno-ekonomiczny i czas trwania objawów u kobiet
chorych na gruźlicę leczonych w Mazowieckim Centrum
Leczenia Chorób Płuc i Gruźlicy w Otwocku. Pneumonol
Alergol Pol 2014;81:3-9.
20. Romaszko J, Buciński A, Wasiński R, et al. Incidence
and risk factors for pulmonary tuberculosis among the
poor in the northern region of Poland. Int J Tuberc Lung
Dis 2008;12:430-5.
21. Coker R, Bell A, Pitman R, et al. Tuberculosis screening
in migrants in selected European countries shows wide
disparities. Eur Respir J 2006;27:801-7.
22. Kubin M, Prikazsky V, Havelkova M, et al. Present state
of tuberculosis in the Czech Republic and in central European and Baltic countries. Central Eur J Public Health
1999;7:109-15.
23. Che D, Cailhol J, Campese C, et al. Situation epidemiologique de la tuberculose en Ile-de-France en 2001. Rev
Mal Respir 2004;21:272-8.
24. Pareek M, Abubakar I, White PJ, et al. Tuberculosis
screening of migrants to low-burden nations: insights from evaluation of UK practice. Eur Respir J
2011;37:1175-82.
25. Jagodziński J, Zielonka TM. Obcokrajowcy leczeni na
gruźlicę w Mazowieckim Centrum Leczenia Chorób
Płuc i Gruźlicy w Otwocku. Pneumonol Alergol Pol
2010;78:399-406.
26. Kim HR, Hwang SS, Ro YK, et al. Solid organ malignancy as a risk factor for tuberculosis. Respirology
2008;13:413-9.
27. Rees D, Murray J. Silica, silicosis and tuberculosis. Int
J Tuberc Lung Dis 2007;11:474-84.
28. Klote MM, Agodoa LY, Abbott KC. Risk factors for Mycobacterium tuberculosis in US chronic dialysis patients.
Nephrol Dial Transplant 2006;21:3287-92.
29. Jeon CY, Murray MB. Diabetes mellitus increases the
risk of active tuberculosis: a systematic review of 13
observational studies. PLoS Med 2008;5:e152.
30. Aguado JM, Torre-Cisneros J, Fortun J, et al. Tuberculosis in solid-organ transplant recipients: consensus
643
statement of the group for the study of infection in
transplant recipients (GESITRA) of the Spanish Society
of Infectious Diseases and Clinical Microbiology. Clin
Infect Dis 2009;48:1276-84.
31. Kim DK, Lee SW, Yoo CG, et al. Clinical characteristics
and treatment responses of tuberculosis in patients with
malignancy receiving anticancer chemotherapy. Chest
2005;128:2218-22.
32. Jick SS, Lieberman ES, Rahman MU, et al. Glucocorticoid use, other associated factors, and the risk of
tuberculosis. Rheum Arthritis 2006;55:19-26.
33. Wallis RS, Broder MS, Wong JY, et al. Granulomatous
infectious diseases associated with tumor necrosis factor
antagonists. Clin Infect Dis 2004;38:1261-5.
34. Kim CH, Im KH, Yoo SS, et al. Comparison of the
incidence between tuberculosis and nontuberculous
mycobacterial disease after gastrectomy. Infection
2014;42(4):697-704.
35. Kozińska M, Brzostek A, Krawiecka D, et al. MDR, preXDR i XDR oporna na leki gruźlica w Polsce 2000-2009.
Pneumonol Alergol Pol 2011;79:278-87.
36. Gomes T, Vinhas SA, Reis-Santos B, et al. Extrapulmonary tuberculosis: Mycobacterium tuberculosis strains
and host risk factors in a large urban setting in Brazil.
PLoS One 2013;8:e74517.
37. Long R, Njoo H, Hershfield E. Tuberculosis: epidemiology of the disease in Canada. CMAJ 1999;160:1185-90.
38. Kruijshaar ME, Abubakar I. Increase in extrapulmonary
tuberculosis in England and Wales 1999-2006. Thorax
2009;64:1090-5.
39. Sandgren A, Hollo V, van der Werf MJ. Extrapulmonary
tuberculosis in the European Union and European Economic Area, 2002 to 2011. Euro Surveill 2013;18:20431.
40. Rowińska-Zakrzewska E, Korzeniewska-Koseła M,
Roszkowski-Śliż K. Gruźlica pozapłucna w Polsce w
latach 1974-2010. Pneumonol Alergol Pol 2013;81:121-9.
41. Forssbohm M, Zwahlen M, Loddenkemper R, et
al. Demographic characteristics of patients with extrapulmonary tuberculosis in Germany. Eur Respir J
2008;31(1):99-105.
42. Korzeniewska- Koseła M. Gruźlica w Polsce w 2009
roku. Przegl Epidemiol 2011;65:301-5.
Author declares that there are no conflicts of interest.
Accepted for print: 17.10.2014
Tadeusz M Zielonka
Department of Family Medicine, Warsaw Medical University
02-097 Warsaw, Banacha 1a
tel.: (22) 599 2190
Lucjan Kępa, Barbara Oczko-Grzesik, Anna Boroń-Kaczmarska
CEREBROSPINAL FLUID INTERLEUKIN-6
CONCENTRATION IN PATIENTS WITH PURULENT, BACTERIAL
MENINGITIS – OWN OBSERVATIONS
Department of Infectious Diseases in Bytom
Medical University of Silesia in Katowice
ABSTRACT
AIM. This study aimed at evaluating the usefulness of determining cerebrospinal fluid (CSF) interleukin-6 (IL-
6) concentration in adults with purulent, bacterial meningoencephalitis.
MATERIAL AND METHODS. A study group consisted of 16 patients hospitalized in the Department of Infectious
Diseases of the Medical University of Silesia in Bytom in 2008 – 2012 due to purulent, bacterial meningoencephalitis. All of them were classified into two groups based on clinical severity, assessed on admission: group
I – severe condition, group II – moderately severe or mild condition. CSF IL-6 concentration was measured in
all patients on the first day of hospitalization.
RESULTS. Mean concentrations of IL-6 in CSF were assessed at 391.54 pg/mL and 110.51 pg/mL in patients in
severe (group I) and moderately severe or mild condition (group II), respectively. Differences between CSF mean
concentrations of this cytokine in both groups were statistically significant (p<0.01). No correlations between
CSF IL-6 concentrations and other CSF inflammatory parameters were determined. Control testing performed
in 5 patients of group I revealed only slight decrease of CSF IL-6 concentration in fatal cases. In case of patients
who recovered from disease, IL-6 concentration in CSF was evidently decreased compared to its initial value.
CONCLUSIONS. Results suggest the usefulness of determining CSF interleukin-6 concentration to estimate
inflammation intensity in the subarachnoid space, and indirectly, patient’s clinical severity. IL-6 concentration
may be also of prognostic importance in purulent, bacterial meningoencephalitis.
Key words: interleukin-6, cerebrospinal fluid, purulent, bacterial meningoencephalitis
INTRODUCTION
Bacterial infections of the central nervous system
(CNS) are still an important clinical problem of modern
medicine. Irrespective of advances in pharmacotherapy
and intensive care, bacterial, purulent meningoencephalitis remains a condition of uncertain prognosis
and relatively high mortality. Furthermore, permanent,
neurological sequelae of infection are commonly
reported (1). Results of routine laboratory testing of
cerebrospinal fluid (CSF), i.e. pleocytosis and cytogram,
concentration of protein, glucose, chloride, and to a
lesser extent, lactic acid seem not to entirely reflect the
actual inflammation of the brain in such diseases (1,2).
Cytokines play an important role in the pathogenesis
of inflammation of the central nervous system, including
i.a. tumour necrosis factor alpha, interleukin 1-beta and
interleukin-6 (2,3,4).
Interleukin-6 (IL-6) is a multifunctional cytokine of
various properties in both physiological and pathological processes. It is produced by different cells, including
monocytes, pulmonary alveolar macrophages, fibroblasts, endothelial cells, mesangial cells, keratinocytes,
B and T cells, eosinophiles and in the central nervous
system (CNS) – astrocytes and glial cells. Production of
IL-6 is induced by endotoxins, DNA and RNA viruses
and several cytokines (interleukin-1, tumour necrosis
factor, lymphotoxin, PDGF – platelet-derived growth
factor, TGF-β – transforming growth factor beta). A list of
the most important biological activities of IL-6 includes:
- stimulation of B cells for antibody production (humoral immune response),
646
No 4
- T cell activation mainly by inducing the synthesis
of interleukin 2 receptor (IL-2) and stimulating the
cytokine production, in the presence of IL-2 IL-6 it
induces cytotoxic T cell proliferation and differentiation,
- participation in activating T cells by monocytes,
- regulation of platelet formation,
- participation in the initiation of acute-phase response,
- induction of fever by stimulating prostaglandin
production (5-10).
It was demonstrated that IL-6 plays a role in the
pathophysiology of several conditions such as injuries,
burns, rheumatoid arthritis, septic shock, acute pancreatitis, ocular inflammatory disease and AIDS (8-10)
This paper aimed at evaluating the usefulness of
determining cerebrospinal fluid (CSF) interleukin-6 (IL6) concentration in diagnosing patients with purulent,
bacterial meningoencephalitis.
A total of 16 patients hospitalized in the Department of Infectious Diseases of the Medical University
of Silesia in Bytom in 2008 – 2012 were enrolled in the
study. This group consisted of 12 males (75%) and 4
females (25%) with the youngest and oldest participant
aged 18 and 71 years; mean age was about 48 years. Patients were admitted to the department from a suspicion
of meningoencephalitis. On a basis of CSF analysis,
all patients were diagnosed with purulent, bacterial
meningoencephalitis. Streptococcus pneumoniae and
Neisseria meningitidis etiology were determined in 6
(37.5% ) and 2 (12.5% ) patients, respectively. In case
of 8 patients (50%), etiological agents of meningoencephalitis were not determined.
Patient were classified based on clinical severity,
assessed on admission. Group I consisted of 10 patients in severe condition (7 males and 3 females; mean
age-about 55 years), presenting with disturbances of
consciousness, symptoms of focal CNS injury, generalized seizures (in the period preceding hospitalization
or at 1 day of hospitalization). In case of these patient,
the number of points in Glasgow Coma Scale (GCS)
did not exceed 9. The etiological agents of infections
were: Streptococcus pneumoniae in 4 patients and
Neisseria meningitidis in one patient. Etiology was
not determined for 5 patients. Group II was composed
of 6 patients in moderately severe or mild condition (5
males and 1 female; mean age-about 40 years). These
patients did not present with severe disturbances of
consciousness. No symptoms of focal CNS injury or
generalized seizures were reported. The number of
points in GCS exceeded 10. Infections were caused by
Streptococcus pneumoniae (2 patients) and Neisseria
meningitidis (1 patient). In case of 3 patients, etiology
was not determined.
On admission, all patients were subject to lumbar
puncture and CSF analysis, including pleocytosis and
cytogram, concentration of protein, glucose, lactic
acid and interleukin-6 (IL-6). Quantikine Human IL-6
Immunoassay, R&D Systems Inc. (USA) was used to
measure the concentration of IL-6.
Furthermore, at day 10 of treatment, 5 patients from
group I were subject to control CSF analysis. Of them,
2 patients recovered from disease and 3 patients died.
Student’s t-test was used to compare mean pleocytosis, concentration of protein, glucose, lactic acid and
interleukin-6 in analyzed groups. Statistical significance
was set at p (α) < 0.05 and p (α) < 0.01. Pearson’s
correlation coefficient was employed to analyze the
correlation between CSF parameters in both groups.
RESULTS
Table I presents the results of CSF analysis in
patients with purulent, bacterial meningoencephalitis,
obtained on admission.
In group I, mean pleocytosis was 639 cells/mm3. In
all patients, polymorphonuclear neutrophils predominated in cytogram (from 70% to 100% of all cells), mean
concentration of protein was 1820 mg/L, glucose – 0.56
mmol/L, lactic acid – 10.75 mmol/L and interleukin-6
– 391.54 pg/mL. On admission, the general health of
these patients and the course of disease were assessed
as severe. Of these patients, three experienced acute respiratory distress syndrome. It was required to intubate
these patients or perform tracheotomy and use respirator
Table 1. Results of CSF analysis in patients with purulent, bacterial meningoencephalitis on admission.
Group of patients
Group I
(n = 10)
Group II
(n = 6)
Pleocytosis
(cell/mm3)
639 ± 444
(80 – 1210)
398 ± 244
(78 – 494)
Protein
(mg/L)*
1820 ± 760
(831 – 2540)
841 ± 303
(470 – 1539)
Table presents the mean values of analyzed parameters,
* - statistically significant difference (p<0.05)
** - statistically significant difference (p>0.01)
Glucose
(mmol/L)
0.56 ± 0.40
(0 – 1.3)
0.91 ± 0.57
(0.4 – 2.3)
Lactic acid
(mmol/L)**
10.75 ± 4.80
(2.7 – 19.4)
3.24 ± 1.02
(2.6 – 5.6)
Interleukin-6
(pg/mL)**
391.54 ± 199.29
(79.02 –1624.31)
110.51 ± 73.28
(43.22 – 611.31)
No 4
Interleukin-6 concentration in patients with meningitis
to induce artificial respiration on intensive care unit. Of
them, two patients died. A total of 3 fatal cases were
reported. In case of other three patients, permanent,
neurological sequelae of infection were observed, i.e.
deafness or partial deafness. As many as four patients
recovered from disease. The highest concentrations of
protein, lactic acid and interleukin-6 in CSF were noted
in fatal cases.
In group II, mean pleocytosis was 398 cells/1 mm3.
In case of these patients, polymorphonuclear neutrophils also predominated in cytogram (from 65% to
88% of all cells). The mean concentrations of other
CSF parameters were as follows: protein-841 mg/L,
glucose-0.91 mmol/L, lactic acid-3.24 mmol/L and IL6-110.5l pg/mL. The general health of these patients and
the course of disease were determined as moderately
severe or mild. Compared to group I, the outcomes of
treatment were significantly better in these patients.
A total of 5 cases recovered from disease. Only one
patient experienced infection-induced deafness. During
hospitalization there were neither patients presenting
with respiratory distress nor fatal cases.
Control CSF analysis performed in 5 patients of
group I revealed significant decrease of IL-6 concentration in two patients who recovered from disease. Compared to initial results, the reduction of pleocytosis and
concentrations of protein and lactic acid were reported
in all cases. The results of IL-6 concentration were
as follows: testing I- 852.41 pg/mL, testing II-131.09
pg/mL in the first patient and testing I-799.11 pg/mL,
testing II-112.00 pg/mL in the second patient. In case
of three patients who died, a slight decrease of IL-6
concentration in CSF was reported: testing I-1624.31
pg/mL, testing II-1344.28 pg/mL; testing I-1311.29
pg/mL, testing II-1011.21 pg/mL, testing I-924.68 pg/
mL, testing II-624.36 pg/ml, respectively. In all these
cases, a high PNM pleocytosis and high concentration
of protein and lactic acid in CSF were reported. Table
II presents control CSF interleukin-6 concentrations in
the course of disease in group I.
Table II. CSF interleukin-6 concentrations in the course of
disease in group I.
Patient
1.
2.
3.
4.
5.
Interleukin-6 (pg/mL)
Testing I
Testing II
852.41
131.09
779.11
112.00
1624.31
1344.28
1311.29
1011.21
924.68
624.36
Outcome
recovery
-„death
-„-„-
Differences between mean pleocytosis and concentrations of glucose in CSF in both groups were not statistically significant. However, statistically significant
differences in the mean CSF concentration of protein
647
(p<0.05), lactic acid (p<0.01) and interleukin-6 (p<0.01)
in these groups were observed.
DISCUSSION
Cerebrospinal fluid analysis is the basic test in the
diagnostics of the central nervous system infections.
In the majority of laboratories, pleocytosis, cytogram,
the concentrations of protein, glucose, chlorides, and
to a lesser extent, lactic acid are routinely tested (1,2).
Since many years, attempts aimed at extending the
range of diagnostic tests in CNS infections were undertaken. A list of additional CSF parameters included,
i.a. the concentration of lysozyme, immunoglobulin,
inflammatory cytokines, chemokines, arachidonic acid
metabolites (prostaglandins, thromboxanes, leukotrienes), procalcitonin (PCT), lactate dehydrogenase
(LDH), creatine kinase (CK), neuron specific enolase
(NSE), ciliary neurotrophic factor (CNTF) and S100B
protein. Such tests allowed for more accurate assessment of inflammation intensity and course in the
subarachnoid space of patient. Such diagnostic tests,
however, require considerable financial resources and
well-appointed laboratories. Thus, they are not routinely
performed (11-16).
Interleukin-6 is one of the most important cytokines
involved in the inflammatory response in the central
nervous system. It is produced within the central nervous system, i.a. by endothelial cells, astrocytes and
glial cells as a response to initiated or ongoing infection.
Its production is also affected by other cytokines, i.a.
TNF and IL-1. IL-6 has predominantly proinflammatory properties. It induces the synthesis of acute-phase
proteins and contributes to blood-brain barrier damage
(17,18). Studies of other authors suggest that IL-6 may
act as an anti-inflammatory cytokine. It is demonstrated
by leukocyte transmission from blood to CSF (19).
Nevertheless, the majority of researchers claim that
proinflammatory properties of IL-6 predominate in the
course of bacterial CNS infections (3,4,17,18).
Concentration of IL-6 was measured in the course
of a number of central nervous system diseases. Aiba
et al. demonstrated that IL-6 concentration in serum
is a predictor in the course and outcome of influenza
virus-associated encephalopathy (20). Elevated IL-6
concentration was also observed in CSF in the course
of traumatic brain injuries (21). Concentration of this
cytokine in CSF, as well as other cytokines (IL-1β,
TNF-α, IL-8), was an important diagnostic marker in
CNS infections in neurosurgical patients (22).
IL-6 role in the course of bacterial meningoencephalitis was mainly analyzed in paediatric population (23-25). In the pathophysiology of bacterial CNS
infections, inflammation intensity in the subarachnoid
648
space is a decisive factor in the course of disease. IL-6,
synthesized within CNS, is also involved in this process
(2,3,26).
Studies conducted in children with bacterial
meningoencephalitis suggested an increase in CSF
IL-6 concentration. Azuma et al. concluded that IL-6
concentration in CSF is the best diagnostic marker of
CNS infections in children (22). The majority of authors
claim that this cytokine is used for the differential diagnosis of bacterial and viral meningoencephalitis (23,24).
From the studies of Mukai et al. exclusively transpires
that there is no statistically significant difference in
CSF IL-6 concentrations between bacterial and viral
meningoencephalitis (25). IL-6 concentration in CSF in
the early stage of disease correlated with the severity of
patient’s condition. Control testing revealed a decrease
of IL-6 concentration in CSF in patients who recovered
from disease (24).
Similar observations on IL-6 concentration were
made for adults with purulent, bacterial meningoencephalitis, especially with regard to the correlation between
the severity of patient’s condition and reduction of this
cytokine concentration in CSF in cases who recovered
from disease (27-29).
No correlation was observed between IL-6 concentration in CSF and etiology of bacterial meningoencephalitis (23,24,27-29). Such observations neither
were made in studied patients.
No significant correlation was also observed between IL-6 concentration in CSF and other, routinely
tested CSF parameters. In case of patients who recovered from disease, decrease of IL-6 concentration was
reported concurrently with normalization of other CSF
parameters in control testing (pleocytosis, protein and
glucose) (23,24,27-29).
In group I, positive correlation was observed between IL-6 concentration and the concentration of lactic
acid in CSF. No significant correlation was reported
between PNM pleocytosis and the concentrations of
protein and glucose. Observation of group II did not
reveal the correlation between concentration of this
cytokine and other parameters of CSF.
An interesting issue is the relation between IL-6
concentration in CSF and severity of clinical condition
of patient with purulent, bacterial meningoencephalitis.
The highest concentration of this cytokine in CSF was
noted in patients in the most severe conditions. It suggests intense inflammation in the subarachnoid space
which leads frequently to irreversible brain damage,
resulting from bacterial infection. Changes in the concentration of this cytokine in the course of bacterial
meningoencephalitis demonstrate a relation with further
progression and course of infection. Control testing
during hospitalization, however, showed significant
decrease of IL-6 concentration in CSF in patients whose
No 4
clinical condition was improving and results of routine
CSF analysis were subject to normalization. IL-6 concentration in CSF remained at a high level, comparable
to its value in the first testing, in patients whose clinical
condition did not improve (24,27-29).
From our observations transpires that the highest
concentration of IL-6 in CSF was reported in patients
in severe clinical condition (group I). No statistically
significant differences were observed between average
PNM pleocytosis and glucose concentration in CSF in
groups I and II. The highest average concentrations of
protein and lactic acid were noted in patients in severe
condition, especially in fatal cases.
Results demonstrate that there is a significant correlation between IL-6 concentration and the severity of
clinical condition of patient on admission and further
course of disease. Control testing suggest a relation
between IL-6 concentration in CSF and outcome of
infection. In case of patients who recovered from disease, IL-6 concentrations were reduced. In majority of
cases, it preceded clinical improvement and normalization of other CSF parameters. In fatal cases, however,
IL-6 concentrations were slightly reduced compared
to the first testing. Concomitantly, CSF inflammatory
parameters remained at a high level and clinical condition of patients did not improve. Relatively low number
of patients studied hinders a more in-depth statistical
analysis of results. Consequently, it does not allow for
drawing unequivocal and far-reaching conclusions.
Nevertheless, it substantiates a necessity for further
studies in this respect.
SUMMARY
To a large extent, IL-6 concentration in CSF seems
to demonstrate the severity of brain damage resulting
from bacterial infection. Increase of this cytokine in CSF
suggest the intensity of inflammation in subarachnoid
space of patient, blood-brain barrier damage and consequently brain damage (2-4,18,26,28-30).
Quantitation of IL-6 concentration in CSF in patients with purulent, bacterial meningoencephalitis
may be of importance in both the assessment of actual
inflammation intensity in subarachnoid space, which affects the course and outcome of disease, as well as infection prognosis. It may also be relevant in monitoring the
course and treatment of purulent meningoencephalitis.
Furthermore, it is of certain prognostic significance.
REFERENCES
1. Roos KL, Tunkel AR, Scheld WM. Acute bacterial
meningitis. In: Scheld WM, Whitley RJ, Marra CM, ed.
No 4
Interleukin-6 concentration in patients with meningitis
Infections of the Central Nervous System. Philadelphia:
Lippincott, Williams and Wilkins;2004:346-422.
2. Leib SL, Täuber MG. Pathogenesis and pathophysiology of bacterial infections. In: Scheld WM, Whitley
RJ, Marra CM, ed. Infections of the Central Nervous System.Philadelphia: Lippincott, Williams and
Wilkins;2004:331-346.
3. Low PS, Lee BW, Yap HK , et al. Inflammatory response
in bacterial meningitis: cytokine levels in the cerebrospinal fluid. Ann Trop Paediatr 1995;15:55-59.
4. Täuber MG, Moser B. Cytokines and chemokines in
meningeal inflammation. Biology and clinical implications. Clin Infect Dis 1999;28:1-12.
5. Gołąb J, Jakubisiak M, Lasek In. Immunologia. Warszawa: Wyd Nauk PWN, 2002.
6. Hirano T. Interleukin-6. In: Thompson A, ed. The Cytokine Handbook. London: Academic Press Harcourt
Brace & Company; 1994: 145-168.
7. Kishimoto T. The biology of interleukin-6. Blood
1989;74:1-10
8. Robak T. Biologia i farmakologia cytokin. Warszawa:
Wyd Nauk PWN, 1995:122-136.
9. Gradient RA, Otten UH. Interleukin-6 (IL-6) – a molecule
with both beneficial and destructive potentials. Prog
Neurobiol 1997;52:379-390.
10. van Snick J. Interleukin-6: an overview. Annu Rev Immunol 1990;8:253-278.
11. Kępa L, Oczko-Grzesik B, Błędowski D. Prokalcytonina
(PCT) w płynie mózgowo-rdzeniowym i w surowicy
chorych z bakteryjnymi ropnymi i limfocytarnymi zapaleniami opon i mózgu u dorosłych – obserwacje
własne. Przegl Epidemiol 2005;59,3:703-709.
12. Kępa L, Oczko-Grzesik B, Błędowski D. Ocena
aktywności dehydrogenazy mleczanowej (LDH) w
płynie mózgowo-rdzeniowym i surowicy chorych z
ropnymi, bakteryjnymi zapaleniami opon i mózgu. Przegl
Epidemiol 2006;60,1:291-298.
13. Kępa L, Oczko-Grzesik B, Błędowski D. Ocena
aktywności kinazy kreatynowej (CK) w płynie mózgowo-rdzeniowym i w surowicy chorych z ropnymi, bakteryjnymi zapaleniami opon i mózgu. Przegl Epidemiol
2007;61,4:693-700.
14. Kępa L. Ocena stężenia enolazy neuronowo-swoistej
(NSE) w płynie mózgowo rdzeniowym i w surowicy
chorych z ropnymi, bakteryjnymi zapaleniami opon i
mózgu. Przegl Epidemiol 2009;63,1:23-25.
15. Kępa L. Ocena stężenia rzęskowego czynnika neurotropowego (CNTF) w płynie mózgowo-rdzeniowym chorych z ropnymi, bakteryjnymi zapaleniami
opon i mózgu-obserwacje własne. Przegl Epidemiol
2012;66,3:425-430.
16. Kępa L, Oczko-Grzesik B. Ocena stężenia białka S100B
(S100B) w płynie mózgowo-rdzeniowym chorych z
ropnymi, bakteryjnymi zapaleniami opon i mózgu – obserwacja własne. Przegl Epidemiol 2013;67,3:525-529.
17. Gruol DL, Nelson TE. Physiological and pathological
roles of interleukin-6 in the central nervous system. Mol
Microbiol 1997;15:307-339.
649
18. Kanah Y, Oktani H. Levels of interleukin-6, CRP and
alpha-2 macroglobulin in cerebrospinal fluid and serum
as indicator of blood-brain damage. Biochem Mol Biol
Int 1997;43:269-278.
19. Paul R, Koedel U, Winkler F, et al. Lack of IL-6 augments
inflammatory response but decreases vascular permeability in bacterial meningitis. Brain 2003;126:1873-1882.
20. Aiba H, Mochizuki M, Kimura M , et al. Predictive value
of serum interleukin-6 level in influenza virus-associated
encephalopathy. Neurology 2001;57:295-299.
21. Morganti-Kossmann MC, Rancon M, et al. Inflammatory
response in acute traumatic brain injury: a double-edged
sword. Curr Opin Crit Care 2002;8:101-105.
22. López-Cortés LF, Marquez-Arbizu R, Jimenez-Jimenez
LM, et al. Cerebrospinal fluid tumour necrosis factoralpha, interleukin-1 beta, interleukin-6 and interlekin-8
as diagnostic markers of cerebrospinal fluid infections in
neurosurgical patients. Crit Care Med 2000;28:215-219.
23. Gendrel D, Raymond J, Coste J, et al. Comparison of
procalcitonin with C-reactive protein, interleukin-6 and
interferon-alpha for differentation of bacterial vs viral
infections. Pediatr Infect Dis 1999;18:875-881.
24. Hsieh C-C, Lu J-H, Chen S-J, et al. Cerebrospinal fluid
levels of interleukin-6 and interleukin-12 in children with
meningitis. Child’s Nerv Syst 2009;25:461-465.
25. Mukai AO, Krebs VLJ, Bertoli CJ, et al. TNF-α and IL-6
in the Diagnosis of Bacterial and Aseptic Meningitis in
Children. Pediatr Neurol 2006;34:25-29.
26. Møller K, Tofteng F, Quist T, et al. Cerebral output of
cytokines in patients with pneumococcal meningitis. Crit
Care Med 2005;33:979-983.
27. Jabłonowski E, Lisiewicz J, Kuydowicz J, et al.. Stężenie
interleukiny-6 w płynie mózgowo-rdzeniowym u chorych na zapalenie opon mózgowo-rdzeniowych. Neur
Neurochir Pol 1999;32, supl.6:161-165.
28. Zajkowska J, Grygorczuk S, Pryszmont JM, et al.
Stężenie interleukiny-6 i 10 w kleszczowym oraz ropnym
zapaleniu mózgu i opon mózgowo-rdzeniowych. Pol
Merk Lek 2006;21,121:29-34.
29. Vázquez JA, Adduci MC, Coll C, et al. Acute meningitis
prognosis using cerebrospinal fluid Interleukin-6 levels.
J Emerg Med 2012;43,2:322-327.
30. Kleine TO, Zwerenz P, Zöfel P, et al. New and old diagnostic markers of meningitis in cerebrospinal fluid
(CSF). Brain Res Bulletin 2003;61:287-297.
Received: 3.02.2014
Dr Lucjan Kępa
Department of Infectious Diseases in Bytom
Medical University of Silesia in Katowice
Al.Legionów 49, 41-902 Bytom
Katarzyna Pancer, Marek Tomasz Szkoda, Włodzimierz Gut
IMPORTED CASES OF DENGUE IN POLAND AND THEIR DIAGNOSIS
Department of Virology
National Institute of Public Health – National Institute of Hygiene, Warsaw
ABSTRACT
Infections with dengue virus are transmitted by mosquitoes. In tropical areas, it is mainly spread by Aedes
aegypti while in countries with lower temperatures by Aedes albopictus. Since 2010, autochthonous cases of dengue are also reported in Europe. There are 4 serotypes of dengue virus (DENV). No correlation between clinical
presentation of disease and virus type, however, were determined. Nevertheless, reinfection with different type
of DENV may lead to a serious, life-threatening condition. An estimated 100 million persons are infected with
dengue virus per year. Of them, approximately a half (mainly children) develop the symptoms of dengue fever
(DF), dengue haemorrhagic fever (DHF) or dengue shock syndrome (DSS). Fatality is high in case of severe
dengue. Dengue is a serious condition provided there is a presence of IgG antibodies directed against antigens of
particular DENV serotypes, associated with primary infection caused by different serotype or transferred from
infected mother to her child. For adequate dengue laboratory diagnosis, it is required to apply a set of various
diagnostic methods. Within the family Flaviviridae, cross-reactivity is reported, which may lead to the occurrence of false-positive results. In Poland, differential diagnosis with different Flavivirus species is of special
importance as it is an endemic area for tick-borne encephalitis (TBE). Thus, data regarding history of patient’s
immunization against TBE or yellow fever should be also taken into consideration as important in interpretation
of results of serological examination.
Key words: infection with dengue virus, introduction of dengue to Poland, infection diagnosis
INTRODUCTION
A few billion persons live in dengue (DENV) endemic areas. Aedes aegypti, a mosquito living in tropical
and subtropical regions, is the primary vector of dengue,
transmitting the virus to humans. Infections caused by
other mosquitoes belonging to the genus Aedes are
reported less frequently. Infected persons serve as a reservoir of dengue virus for 4-5 days, maximum 12 days
of symptoms, but also 2 days prior to their occurrence.
In this period, virus may be transmitted from infected
person to a feeding mosquito. Incubation of virus in
mosquito organism lasts for 4-10 days, however, once
infected mosquitoes are a source of the virus for the
rest of their life [1,2].
Aedes albopictus may also transmit dengue virus.
Primarily, it was living in Asia. Due to its tolerance to
lower temperatures, however, now it is also present in
North America and Europe. Expansion of Ae.albopictus
to new areas may result in new geographical distribution
of dengue viruses, consequently leading to a modified
epidemiological situation of dengue in Europe. Currently, this mosquito lives on Madeira islands, where
infections with dengue virus in humans were reported
in 2012. Furthermore, Ae.albopictus has spread to the
areas around the Mediterranean Sea and Black Seas
[3,4], which are attractive for tourists from Poland.
This article aimed at presenting the issues concerning the diagnosis of imported dengue cases in Poland
and assessing the risk of dengue introduction to Poland.
EPIDEMIOLOGICAL SITUATION
OF DENGUE AROUND THE WORLD AND
IN POLAND
Infections with dengue virus are reported in more
than 100 countries worldwide, ranging from the SouthEast Asia Region, the countries of the Middle East,
Africa, Central and South America to the countries of
652
No 4
2500000
2204516
2000000
1451083
1279668
1500000
925896
1000000
500000
122174
295554
479848
2010
2009
2008
2000-.07
1990-99
1980-89
1970-79
15497
1960-69
0
908
1955-59
Number of reported cases of
Dengue infection
Katarzyna W Pancer
Figure 1. Number of reported to WHO cases of Dengue virus infections around the World [1,4] (DF = Dengue fever; DHF
= Dengue Haemorrhagic
Rycina 1. Liczbafever).
zgłoszonych do WHO zachorowań wywołanych przez wirusy
denga na świecie [1,4].
Table 1. Dengue case classification for the purpose of epidemiological surveillance in Poland (according to the National
Number– of
reported to WHO cases of Dengue virus infections around the
Institute ofFigure
Public1.Health
NIH)
Acute
disease,
accompanied
by rash,
temperature
lasting for
2-7 days, and at least two of the
World
[1,4]
(DF =
Dengue fever;
DHFhigh
= Dengue
Haemorrhagic
fever).
following symptoms: headache, retroorbital pain, myalgia, arthralgia, rash, haemorrhagic manifestation
and leucopoenia.
Possible case
NA
Any person meeting the clinical and laboratory criteria, i.e. the presence of dengue-virus-specific IgM
Probable case
antibodies in serum and/or high dengue-virus-specific IgG antibody titers in serum.
Any person meeting the clinical criteria with at least one of the following laboratory results:
• isolation of dengue virus from serum, plasma, leukocytes or autopsy tissue specimen
Confirmed case • at least 4-fold increase of IgM or IgG titers, excluding cross-reactivity with other flaviviruses
• detection of dengue virus antigen
• detection of dengue virus genome
Clinical criteria
in the Philippines. Since the 70s, dengue fever cases of
more severe course were notified in 9 countries while
beginning from the 80s, large outbreaks were reported
in the Caribbean, South America and Asia. In the USA,
autochthonous dengue infections were first noted in the
21st century. Currently, the highest incidence occurs
in the countries of the Americas (<50%) and Western
Pacific (Fig.2) [1,4-8].
In Europe, dengue cases were reported in the Balkans and Mediterranean countries up to 1928. Since this
231498
565 510
1 468 873
764 032
117944
126425
144539
164947
166107
168460
Paraguay
18860
2012
Brasil*
75454
50222
El Salvador Nicaragua Colombia
39063
42945
49361
33207
2011
30499
11888
Mexico
77179
Lao PDR Philippines Viet Nam
28877
41793
20836
67918
60588
77618
64532
9639
3775
Australia Cambodia
44171
16722
41704
15761
1762
1541
817
Number of reported cases of Dengue (DF/DS/DFS)
Western Pacific Region. According to the WHO, the
geographical distribution of infections with DENV
suggest that approximately a half of global population is at risk of contracting dengue. Since 50 years, a
significant, sustained increase in the number of dengue
cases notified to the WHO is observed. In 2010, a total
of 2.3 million cases were reported. Compared to 2008,
it was a 1.7-fold increase. Furthermore, an increasing
tendency is still observed (Fig.1). In the 50s of the 20th
century, dengue outbreaks were reported predominantly
Indie
2013
Figure 2. Number of reported denga fever (DF) and severe denga cases (DSS or DHF) in selected countries in 2011-2013
Rycina 2. Liczba zgłoszonych zakażeń wirusem denga w wybranych krajach w latach 2011-2013 [5-8].
years [5-8].
Figure 2. Number of reported denga fever (DF) and severe denga cases (DSS or DHF) in selected countries in 2011-2013 years [5-8].
No 4
Imported cases of dengue in Poland
year, only imported cases were noted until 2010, where
local transmission of this infection occurred in Croatia
and the south of France [4,9]. Infection was transmitted
by Aedes albopictus which is tolerant to colder than
tropical and subtropical climates and hibernation. In
October 2012, dengue outbreak in Madeira islands was
described, in which more than 2,000 human cases were
identified from 26th September 2012 to 4th February
2013. Furthermore, a total of 78 cases imported to the
European countries were notified, including: England –
23, Germany - 19, France – 3, Sweden – 5, Finland – 7,
Denmark – 2, Austria – 2, Norway – 2, and one case in
Croatia, Slovenia, Spain and Switzerland [3,4].
Increased human mobility across the countries of
all continents poses a threat of dengue introduction to
new areas. The number of dengue cases imported to the
European countries, probably also to Poland, is still on
the increase. Exposure to DENV during a stay in dengue
endemic areas may progress into infection while being
abroad or following return to the country. A proportion
of these infections may remain undetected. Exclusively
more severe cases are diagnosed and confirmed by
laboratory methods. In 2009-2012, a total of 1,234
cases were laboratory confirmed in England, Wales and
Northern Ireland, i.e. in 2009 - 177, 2010 - 449, 2011
- 235 and 2012 - 373 (including 20 infections acquired
in Madeira islands). Between January and April 2013,
a total of 141 cases were reported, including 3 persons
infected during a stay in Madeira islands [10]. Unfortunately, in several European countries, i.a. Portugal,
DENV infections are not subject to mandatory notification. Therefore, epidemiological data are incomplete.
In the light of aforesaid information, analysis of
dengue cases reported each year in Poland probably
suggest underestimation of data. In 2005-2013, a total
of 29 cases were reported in Poland, including 6, 5, 5
and 0 in 2010, 2011, 2012 and 2013, respectively. Of
22 patients diagnosed with dengue and hospitalized in
the Warsaw’s Hospital for Infectious Diseases in 20022011, the majority were persons travelling to India and
Indochina (Vietnam, Laos, Thailand) [11].
SYMPTOMS OF DENGUE (1,2,12)
There are three main clinical presentations of
dengue:
1. Asymptomatic or influenza-like infection, clinically
similar to cold
2. Dengue fever (DF)
3. Severe dengue (DS), including dengue haemorrhagic
fever (DHF) and dengue shock syndrome (DSS).
Dengue fever (DF) is an acute disease, accompanied by rash, high temperature (40°C) lasting for 2-7
days, and at least two of the following symptoms: severe
653
headache, retroorbital pain, myalgia, arthralgia, rash,
nausea, vomiting, enlarged lymph nodes and leucopoenia. Most frequently, dengue fever is diagnosed in
infants, small children and adults. In case of children,
it may be of fatal course.
Severe dengue (DS), formerly referred to as dengue
haemorrhagic fever (DHF), is a potentially fatal presentation of disease due to fluid loss, renal and respiratory
failure, accompanied by haemorrhagic manifestations
and those indicative of multiple-organ failure. Early
diagnosis and adequate medical treatment may decrease
the risk of death from 20% to 1%.
For severe presentation of infection (including dengue haemorrhagic fever), a presence of IgG antibodies
directed against antigens of particular DENV serotypes
is required, which results from:
1. a past infection with virus of different serotype (irrespective of the presentation of primary infection/
past infection)
2. a past infection in pregnant woman or breastfeeding
mother – in case of infants, the presence of maternal
specific IgG antibodies modifies the primary infection in child to its severe presentation.
A list of other factors affecting the severity of
dengue includes: immune status of infected person,
associated with age (poorer response in case of very
young and older persons), and co-existence of chronic
diseases [2,13].
No correlation between a serotype of DENV (types
1-4) and severity of infection was found.
Predominantly, the number of notified cases refers
to symptomatic infections. High fatality is reported
mainly in dengue haemorrhagic fever and dengue shock
syndrome. Furthermore, higher fatality rates are noted
at the beginning of epidemics. An estimated 100 million
dengue cases occurred in 2007, of whom approximately
500,000 were diagnosed and notified, and 12,500 died
[1,4]. In the period between January and April 2014,
more than 272,000 dengue fever cases and 2,708 infections of severe course, including 87 fatal cases, were
reported in the countries of the Americas [7].
Due to the effect of specific IgG antibodies on the
severity of infection, no active immunization is applied.
A lack of specific treatment also raises difficulties. In
severe cases, only supportive treatment is used.
DENGUE LABORATORY TESTING
Infection with dengue virus should be suspected
by a physician in Poland if a patient reports a stay in
dengue endemic areas. Dengue laboratory testing is performed exclusively in case of symptomatic infections,
i.e. dengue fever or severe dengue, including dengue
haemorrhagic fever [1].
654
Katarzyna W Pancer
Differential diagnosis of these infections, based on
medical history and physical examination, accompanied
by microbiological and serological tests, allows for
proper differentiating between infections of different
viral aetiology. It results from the fact that haemorrhagic
fever may be caused by other RNA viruses belonging to
the families: Arenaviridae, Bunyaviridae, Filoviridae.
A separate problematic issue consists in differential
diagnosis of infections caused by genetically or antigenically closely related Flaviviruses. Dengue virus,
yellow fever virus or tick-borne encephalitis virus belong to the numerous Flaviviridae family, comprising of
more than 50 species. Symptoms of infections with these
viruses depend on pathogen-host interactions. They may
range from mild fever, sometimes accompanied by rash,
to organ damage and generalized immunopathologic
changes, resulting in coagulation defects to central nervous system infection [13]. Laboratory confirmation of
dengue is dependent on a number of factors, of which
one of the most important is initial clinical diagnosis,
based on epidemiological data, allowing for proper
selection of laboratory methods [1,2,4,14]
Dengue laboratory testing includes the following
methods (Fig.3):
Phase of disease
Febrile phase
objawy
Acute phase
5days
6days
Convalescent phase
years
90 days
10 days
Viremia
Primary infection
Non-structural protein 1 (NS1)
IgM
IgG
Secondary infection with other DENV serotype
Non-structural protein 1 (NS1)
IgM
IgG
Laboratory testing
Serum: RTPCR; IgM/IgG,
AntigenNS1.
Other samples:
RT-PCR
Serum:
IgG/IgM
Seroconversion in paired serum specimens by different phase of infection:
Primary infection: significant increase of IgM (change from negative to positive result)
or significant increase of IgG
Secondary infection: significant increase of IgG
1. virological tests (molecular tests, isolation of the
virus *),
2. serological tests (detection of IgM, IgG),
3. identification of viral antigen.
*
- isolation of dengue virus in Poland and many European countries may be exclusively performed in biosafety level 3 or 4
(BSL3/4) laboratory.
No 4
Selection of methods as well as test results are affected by:
1. interval between the exposure and collection of
specimen for testing,
2. type of specimen collected for testing,
3. specimen storage and transport conditions,
4. availability of diagnostic methods in particular
laboratory.
Reverse transcription-polymerase chain reaction
(RT–PCR) allows for identification of virus genome.
Specimens for RT-PCR testing are serum, plasma, cerebrospinal fluid or tissue collected during acute phase
of infection, accompanied by fever. DENV infection,
using PCR, may be diagnosed during the first 5 days
of symptoms.
As detection of viral RNA is possible exclusively
in the first days of infection (when patient usually is
abroad), the majority of imported cases is confirmed by
serological testing. Immunological response to dengue
infection results in the production of specific IgM and
IgG antibodies which are mainly directed against the
envelope proteins of virus. Immunological response
may differ and is dependent on whether a patient is
infected with DENV for the first or subsequent time as
well as it is infection with the same or other serotype
of virus. Due to antigenic affinity of Flaviviruses, the
results of diagnostic tests may be significantly affected
by a history of past infections or immunizations against
Flaviviruses, including tick-borne encephalitis and
yellow fever.
For primary infection with DENV, slow increase in
IgM and IgG titers is characteristic. IgG antibodies are
detectable at low titers at the end of week 1. Then, its
titers slowly increase. During secondary infection, IgG
titers increase very quickly and high cross-reactivity
with antigens of other Flaviviruses is reported. IgM
kinetics is more changeable. IgM titers are significantly
lower in secondary DENV infection. Therefore, IgM
negative results are sometimes reported in case of subsequent infections (Fig.3).
In case of primary and secondary infections, it
is recommended to analyze paired serum specimens,
collected at different stages of disease. Unfortunately
comparison of paired serum specimens, i.e. acute and
convalescent specimens, as well as monitoring of IgG
and IgM titer dynamics is not always feasible in practice.
Cross-reactivity with other Flaviviruses in serum
of infected patients should also be highlighted. Due
to endemicity of tick-borne encephalitis in Poland
and availability of immunization against TBE, crossreactivity raises diagnostic difficulties. Furthermore,
immunization against yellow fever, especially in
travelers, is applied since many years. Differentiation
between homologous (specific for dengue virus) and
heterologous antibodies, cross-reacting with other
No 4
Imported cases of dengue in Poland
flaviruses, requires methods based on virus neutralization (neutralization test, plaque reduction test), which
are performed under conditions of increasedbiosafety
level (BSL3/4) laboratory. [1,2,4,14].
Tests used to identify envelope antigen or nonstructural protein 1 (NS1) of dengue virus are applied
primarily in acute phase of primary infection (until day
9 of symptoms) as immunocomplex virus-IgG are present in the serum of patient during secondary infection.
Furthermore, these tests do not allow for differentiation
of virus serotypes. Currently introduced commercial
kits, intended to identify NS1 (ELISA or tests based on
histological techniques), are subject to assessment of
their diagnostic accuracy and possibility of use during
primary and secondary dengue infections [1,14].
Dengue case classification. Both interpretation
of test results and classification of case by attending
physician raise difficulties. Recently, the World Health
Organization (WHO) introduced new schemes of case
classification and diagnostic management which are
verified in selected countries [4]. In Poland, a classic
ECDC classification of 2008 is binding (Tab.1) [2].
SUMMARY
In Poland, dengue laboratory testing requires a special attention due to endemicity of tick-borne encephalitis (TBE). Infections with this virus and availability
of active immunization may lead to the occurrence of
false-positive results by serological tests (ELISA etc.),
intended to detect anti-dengue antibodies, resulting
from numerous cross-reactions within the viruses of
family Flaviviridae.
REFERENCES
1. World Health Organization. Dengue: guidelines for diagnosis, treatment, prevention and control -- New edition.
WHO/HTM/NTD/DEN/2009.1. 2009, http://whqlibdoc.
who.int/publications/2009/9789241547871_eng.pdf
2. Gut W. Denga. In: Baumann-Popczyk A, Sadkowska-Todys M, Zieliński A, ed. Choroby zakaźne i
pasożytnicze –epidemiologia i profilaktyka. Wyd.VII.
2014. Warszawa: α-medica press; 87-89
3. Wilder-Smith A, Quam M, Sessions O, Rocklov J, LiuHelmersson J, Franco L, Khan K. The 2012 dengue outbreak in Madeira: exploring the origins . Euro Surveill.
655
2014; 19(8) :pii=20718. http://www.eurosurveillance.
org/ViewArticle.aspx?ArticleId=20718
4. WHO. Dengue in the WHO European region. Fact
sheets-WHO 2014 http://www.euro.who.int/en/about-us/
who/world-health-day-2014/how-to-avoid-vector-bornediseases
5. Western Pacific Regional Office of the World Health Organization WPRO Dengue Situation Update, 15 January
2014 ii, http://www.wpro.who.int/emerging_diseases/
DengueSituationUpdates/en/index.html
6. World Health Organization Regional Office for South
East Asia. Reported cases and deaths from the SEA countries 2000-2011. [accessed 8 May 2013]. http://www.
searo.who.int/entity/vector_borne_tropical_diseases/
Reported CasesDeaths.pdf
7. PAHO. Number of Reported Cases of Dengue and
Severe Dengue (SD) in the Americas, by Country.
http://www.paho.org/hq/index.php?option=com_
docman&task=doc_view&gid=25370&I temid
8. Government of India. National Vector Borne Disease
Control Programme. Dengue Cases and Deaths in the
Country since 2007 [accessed 8 May 2013]. http://www.
nvbdcp.gov.in/den-cd.html
9. Schmidt-Chanasit J, Haditsch M, Schöneberg I, Günther
S, Stark K, Frank C. Dengue virus infection in a traveller returning from Croatia to Germany. Euro Surveill.
2010;15(40):pii=19677. http://www.eurosurveillance.
org/ViewArticle.aspx?ArticleId=19677
10. Public Health England. Dengue fever 2012. PHE Travel
and Migrant Health Section: May 2013 http://www.hpa.
org.uk/webc/HPAwebFile/HPAweb_C/1317138961007
11. Olszyńska-Krowicka M, Switaj K. Dengue in patients
hospitalized in the hospital ward of zoonoses and tropical
diseases in Warsaw in years 2002-2011. Przegl Epidemiol. 2011;65(4):571-575
12. Olszyńska-Krowicka M. Denque as haemorrhagic fever.
Przegl Epidemiol. 2011;65(4):567-569
13. Ho T-S, Wang S-M, Anderson R, Liu C-C. Antibodies
in dengue immunopathogenesis. J Formosan Med Association (2013) 112, 1e2 / http://dx.doi.org/10.1016/j.
jfma.2012.11.009
14. CDC. Laboratory Guidance and Diagnostic Testing.
http://www.cdc.gov/dengue/clinicallab/laboratory.html
Katarzyna Pancer
Department of Virology, NIPH-NIH
Piotr Kajfasz1, Michał Bartoszcze2, Piotr Karol Borkowski1, Wojciech Basiak1
RETROSPECTIVE REVIEW OF THE CASE OF CUTANEOUS
ANTHRAX – MALIGNANT PUSTULE FROM 1995 IN 15-YEAR OLD GIRL
1
Department of Zoonoses and Tropical Diseases, Medical University of Warsaw, Poland
2
Biological Threats Identification and Coutermeasure Center of Military Institute
of Hygiene and Epidemiology, Puławy, Poland
ABSTRACT
A 15-year-old girl was admitted to our Department with cutaneous lesion resembling black eschar. Anamnesis
revealed that before getting ill she was wearing pullover made of rough sheep’s wool and ornaments made of
leather like straps. Cutaneous anthrax was confirmed by identification of B. anthracis in specimens from weeping
ulceration, culture from black eschar, thermoprecipitation test, and bioassay on guinea pig. The girl was treated
with crystalline Penicillin. She responded well to the therapy and recovered after 28 days. What attracts attention in presented case is the fact that the girl didn’t belong to high risk group of human anthrax, which might
lead to misdiagnosis.
In 1990-1999, Poland there were reported 22 cases of anthrax - it was almost exclusively cutaneous form. In
the years following 1999 antrax was reported even less often - in the period 1991-2013 it was recorded a total
of 26 cutaneous anthrax cases.
Key words: black eschar, cutaneous anthrax, Bacillus anthracis
INTRODUCTION
Anthrax is an acute infectious disease (zoonosis)
caused by Bacillus anthracis, large, Gram-stained,
aerobic, nonmotile, encapsulated, chain-forming rods
which form centrally located oval spores in culture
but not in vivo. The source of pathogens are first of all
herbivorous animals like cattle, horses, sheep, goats.
The major reservoir of anthrax is soil contaminated by
feces, urine and saliva of infected animals. In the environmental outside the host organism, Bacillus anthracis
produces spores (1-3). The anthrax spores can persist for
a long time in the environment. Meteorological factors
such as floods, heavy spring rains, shifts between rainy
and dry periods can contribute to migration of anthrax
spores on the surface of pasture land (1, 4-7). Anthrax is
significantly more common among grazing herbivores
in agricultural regions in sub-Saharan Africa, Latin
America, southwestern Asia, and southeastern Europe
(1). People may be infected by direct contact with ill or
dead because of anthrax animals or their contaminated
products - hair, wool, leather or other materials. In most
cases human anthrax affects farmers, vets, tanners,
butchers, workers handling imported and unprocessed
animal products, gardeners using bone meal as fertilizers. Males are more often infected then females-3:1. In
Europe, human anthrax is relatively common in Turkey,
Greece, Balkan countries, Romania, Bulgaria, and the
Russian Federation (1, 3, 4, 8-12). Clinical features are
determined by means of entering the microorganisms
into the host. The most common and also the mildest
type of human anthrax is cutaneous form (1). Other
forms of human anthrax – gastrointestinal, inhalational
or injectional are seen very rarely. In the last five years,
several reports of anthrax infections in heroin drug users have been reported in European countries (13-15).
The spores of B. anthracis remain a significant agent of
bioterrorism. Soon after terrorist attacks on New York
City and Washington, D.C. on September 11, 2001 letters containing anthrax spores were sent through the
U.S. Postal Service to several news media offices and
two Democratic U.S. Senators, killing five people and
infecting 17 others (1, 16).
658
CASE REPORT
A 15-year-old girl was referred to our Department
with local cutaneous lesion of 4 cm. in diameter looking
like black eschar and located on the neck on the left side,
below angle of the mandibule. She gave a two weeks’
history of clinical manifestations. The initial lesion was
in the shape of red macule, later papule. Next, the lesion
evolved through vesicle to ulcer. Eventually, the change
went dry and assumed form of black eschar (pustula
maligna, carbuncle malignant, black crust). The black
eschar was surrounded by indurated, painless, extensive
swelling and tiny satellite vesicles-pearl wreath. (Fig.1)
Fig.1.
No 4
Piotr Kajfasz, Michał Bartoszcze, et al.
Black eschar
Anamnesis revealed that girl had contact with animal products. Before getting ill she was wearing pullover made of rough sheep’s wool which irritated neck’s
skin and made its reddening. The pullover had been
bought on the country market in the south of Poland
some days earlier. Besides she used to wear ornaments
made of leather like straps.
Suspicion of anthrax was established on the ground
of clinical picture. The diagnosis was confirmed as
follows:
1. Specimens, which were taken from weeping
ulceration and Gram-stained revealed abundant spores
of B.anthracis. 2. Anthrax bacilli sensitive to Penicillin
were cultured from black eschar. 3. Culture on solid
and fluid medium was characteristic for B.anthracis.
4. Thermoprecipitation test (Ascoli test) was positive
with sera obtained from patient and with control positive
sera. 5. Biological assay on guinea pig was positive- the
laboratory animal died. The diagnosis was carried out
by Biological Threats Identification and Coutermeasure
Center of Military Institute of Hygiene and Epidemiology in Puławy.
The girl received crystalline Penicillin in daily doses
of 12 million units intravenously (3 million every 6
hours). The patient responded well to therapy, however
Penicillin treatment had to last up to 28 days. Separation
of blackened necrotic eschar occurred after 10 days of
Penicillin treatment. Detachment of black crust revealed
weeping crateriform base. Finally lesion became dry
and we could observe healing of ulceration.
DISCUSSION
In Poland human anthrax occurs sporadically. In
years 1991-2013 26 cases of cutaneous anthrax were
reported (17, 18). The danger of anthrax infection is
slight but permanent. Spores of B.anthracis remain
viable for years in dry soil and that’s why cattle have
may become infected by grazing in field where animals
died of anthrax decades before. Control of the disease
in humans fundamentally depends on control of the
disease in animals and control of animal products. Animals dying of anthrax should be buried intact deeply
(below 2 metres) or cremated. Necropsies shouldn’t be
performed because sporulation of B.anthracis occurs
only in presence of oxygen (1, 3).
Because today the disease is so rare in Europe,
sporadic cases of anthrax are easily overlooked as the
diagnosis often is not considered. In fact, small early
skin lesions may be difficult to recognize but in any
patient with a painless ulcer with vesicles, oedema,
and a history of exposure to animal or animal products, cutaneous anthrax should be considered (2, 8).
The goat-hide souvenirs such as goat-hide drums from
tropical and subtropical countries can be contaminated
with Bacillus anthracis spores. Cases of cutaneous and
inhalation anthrax have been reported among people
who have handled or played drums made with contaminated goat hide from countries endemic for anthrax (2).
The differential diagnosis includes cowpox virus
infections, staphylococcal skin infections, erysipelas,
tularemia, scrub typhus, actinomycosis, zoster, orf (1,
3, 19). In extraordinary cases cutaneous anthrax may
mimic severe, acute insect bite reaction (20).
It should be reminded that there is more rare form
of cutaneous anthrax - oedema malignum. It occurs
first of all within face on the border of skin and mucosa. Oedema developes rapidly around the infected
spot and the skin turns violet. The appearance of black
eschar is never observed. Cutaneous anthrax is usually
a self-limited. However, in 10 to 20% of untreated
cases the infection generalizes and leads to fatal course.
Penicillin G (benzylpenicillin) and Ciprofloxacin are
first-line drugs. Antibiotics that may be also given
include tetracyclines, macrolides, aminoglycosides,
chloramphenicol, first-generation (but not second- or
third-generation) cephalosporins (1, 2, 3).
B.anthracis may be identified in smears by Gram’s
stain or direct fluorescent antibody test. It’s worth
mentioning that culture and smears may be unreliable
No 4
Retrospective review of the case of cutaneous anthrax
when patient had been given antibiotics earlier. For confirmation of the infection we can also perform thermoprecipitation test (Ascoli test), more sensitive indirect
microhemagglutination test (IMH test), or bioassay on
guinea pig. PCR (polymerase chain reaction) method,
as a sensitive and specific test, may be used for rapid
confirmation or exclusion of anthrax in potentially infected animal or contaminated animal products (1, 2, 3).
What attracts attention in presented case is the fact
that the girl didn’t belong to high risk group of human
anthrax, which might lead to misdiagnosis. On grounds
of this case it’s worth reminding that cutaneous form of
anthrax can occur at persons wearing things or ornaments made of wool, leather or other animal products,
or using their i.e. drums. The healing was slow but
progressive. Therefore, you shouldn’t give up antibiotic
treatment too early.
REFERENCES
1. Martin GJ, Friedlander AM. Bacillus anthracis. In:
Mandell, Douglas, and Bennett’s Principles and Practice
of Infectious Diseases. 7th ed. (Mandell GL, Bennett
JE, Dolin R. - 7th ed.) Churchill Livingstone Elsevier
2010;208:2715-25.
2. Shadomy SV. Anthrax. In: CDC Health Information for
International Travel. The Yellow Book 2012 (Kozarsky
PhE, Magill AJ, Shlim DR. medical eds.) Oxford University Press 2012;137-9.
3. Jaroszewicz J. Wąglik (anthrax) In: Choroby zakaźne
i pasożytnicze (Cianciara J, Juszczyk J. ed.) Wyd.2.
Lublin: Wydaw Czelej, 2012;873-6.
4. Durić P, Ćosić G, Rajcĕvić S, Petrovic V, Tomković M,
Subić Ž, Dimitrić M. Three probable cases of cutaneous
anthrax in autonomous province of Vojvodina, Seria, June
2011 Euro Surveill. 2012;17(1):pii=20050. Available
online http://www.eurosurveillance.org/ViewArticle.
aspx?Articleld=20050
5. Dragon D, Rennie PR. The ecology of anthrax spores:
tough but not invincible. Can Vet J 1995;36(5):295-301.
6. Turnbull P, Lindeque M, Le Roux J, Bennet M, Parks S.
Airborne movement of anthrax spores from carcass sites
in the Etosha National Park, Namibia. J. Appl Microbiol.
1998;84(4):667-76.
7. Titball RW, Turnbull P, Hutson RA. The monitoring and
detection of Bacillus antracis in the environment. Soc
Appl Bacteriol Symp Ser. 1991;20:9S-18S.
8. Van den Enden E, Van Gompel A, Van Esbroeck M.
Cutaneous anthrax, Belgian traveler. Emerg Infect Dis
2006 Mar;12(3):523–5.
9. Kolbe A, Yuen MG, Doyle BK. A case of human cutaneous anthrax. Med J Aust 2006; 185(5):281-2.
659
10. Stefos A, Gatselis NK, Goudelas A, Mpakarosi M,
Papaparaskevas J, Dalekos GN, Petinaki E. Cutaneous infection caused by Bacillus anthracis in Larissa,
Thessaly, Central Greece, July 2012. Euro Surveill
2012;17(32):pii=20245. Available online http://www.
eurosurveillance.org/ViewArticle.aspx?Articleld=20245
11. Karahocagil MK, Akdeniz N, Akadeniz H, Calka O,
Karsen H, Bilici A, Bilgili SG, Evirgen O. Cutaneous
anthrax in Eastern Turkey: a review of 85 cases. Clin
Exp Dermatol 2008 Jul;33(4):406-11.
12. Popescu R, Pistol A, Militaru L, Caplan D, Cucuiu R,
Popovici F. Two cases of infection with Bacillus anthracis, Romania, October 2011. Euro Surveill 2011;16(45).
Available from: http://www.eurosurveillance.org/ViewArticle.aspx?Articleld=20008
13. Hicks CW, Sweeney DA, Cui X, Li Y, Eichacker PQ.
An overview of anthrax infection including the recently
identified form of disease in injection drug users. Intensive Care Med 2012;38(7):1092-104.
14. Health Protection Scotland. An outbreak of anthrax
among drug users in Scotland, December 2009 to December 2010. Glasgow. Health Protection Scotland;
December 2011. Available from: http://www.documents.
hps.scot.nhs.uk/giz/anthrax-outbreak/anthrax-outbreakreport-2011-12.pdf
15. Holzmann T, Frangoulidis D, Simon M, Noll P, Schmoldt
S, Hanczaruk M, et al. Fatal anthrax infection in a heroin
user from southern Germany, June 2012. Euro Surveill
2012;17(26):pii=20204. Available from: http://www.
eurosurveillance.org./ViewArticle.aspx?Articled=20204
16. Lane HC, Fauci AS. Bioterroryzm mikrobiologiczny. W:
Harrison Choroby zakaźne (red. Kasper DL, Fauci AS,
red. nauk. wyd. pol. R Flisiak. Lublin: Wydaw Czelej,
2012;(I):83-9.
17. Biuletyny: 1991, 1992, 1993, 1994, 1995. Choroby
zakaźne i zatrucia pokarmowe w Polsce. PZH INB
Zakład Epidemiologii. MZiOS Departament Zdrowia
18. National Institute of Public Health. National Institute of
Hygiene. Department of Epidemiology. Laboratory of
Monitoring and Epidemiological Analysis. Infectious
diseases and poisonings in Poland. 1996-2013. http://
www.pzh.gov.pl/oldpage/epimeld/index_a.html
19. Mackowiak PhA. A 17-Year-Old Girl with a Black Eschar. Clin Infect Dis 2009;48(1):91-2,133-4.
20. Mallon E., McKee P.H. Extraordinary case report: cutaneous anthrax. Am.J.Dermatopath 1997; 19(1):79-82.
Piotr Kajfasz, MD, PhD.
Department of Zoonoses and Tropical Diseases,
Medical University of Warsaw.
Wolska 37, 01-201 Warsaw, Poland.
email: [email protected]
Zdzisław Wolak, Marta Z. Wałaszek, Wiesław Dobroś, Michał J. Wałaszek, Barbara Jagiencarz-Starzec
PREVALENCE OF GASTROINTESTINAL SYSTEM INFECTIONS ACQUIRED
IN PROVINCIAL HOSPITAL IN 2004-2013
St. Lukas Provincial Hospital in Tarnów
ABSTRACT
INTRODUCTION. Gastrointestinal system infection (GI) is an infection which is frequently acquired in healthcare settings. In Poland, there are limited data on the distribution of gastrointestinal system infections in the
epidemiology of healthcare-associated infections (HAIs). Therefore, a study was initiated with the objective
to assess the prevalence and distribution of healthcare-associated gastrointestinal system infections in patients
hospitalized in St. Lukas Provincial Hospital in Tarnów.
MATERIAL AND METHODS. Data of 297,545 patients hospitalized in 2004-2013 were subject to analysis. Standard epidemiological methods and unified definitions of healthcare-associated infections issued by the European
Centre for Disease Prevention and Control (ECDC) were employed in the analysis.
RESULTS. A total of 944 healthcare-associated gastrointestinal system infections were indentified in the material
analyzed. In a 10-year observation of HAI prevalence, GIs predominated over other HAIs registered in St. Lukas
Provincial Hospital in Tarnów. Cumulative incidence rate (CIR) and incidence density rate (IDR) for GIs were
0.35% and 0.57/1,000 person-days, respectively. Infections with Clostridium difficile (GI-CDI), also referred
to as C. difficile-associated diarrhoea (CDAD) were diagnosed in 301 patients. For GI-CDI, CIR and IDR were
0.11% and 0.18/1,000 person-days, respectively. Gastroenteritis excluding CDI (GI-GE) was identified in 643
patients with CIR and IDR amounting to 0.24% and 0.39/1,000 person-days, respectively. Gastroenteritis of
rotavirus (CIR-0.11% and IDR-0.18/1,000), adenovirus (CIR-0.01% and IDR-0.02/1,000) and norovirus (CIR0.01% and IDR-0.01/1,000) etiology was identified in 292, 32 and 17 patients, respectively. The highest number
of infections was reported in paediatric ward, i.e. 307 persons (32.5%) (CIR-1.84% and IDR-2.79/1,000) and
internal medicine and nephrology ward - 202 infections (21.4%) (CIR-1.47% and IDR- 1.66/1,000).
CONCLUSIONS. A 10-year observation of healthcare-associated infections showed a change in the distribution
of HAIs. In recent years, GIs predominated over all infections acquired in healthcare settings. The most prevalent
etiological agent identified was Clostridium difficile.
Key words: healthcare-associated infection (HAI), gastrointestinal system infection (GI), rotavirus (GI-GE),
Clostridium difficile infection (CDI).
INTRODUCTION
According to literature data, the number of infections with C. difficile (Clostridium difficile) in hospitalized patients is on the increase. Such problem is
observed in Poland as well as in other European and
non-European countries (1 - 5) These infections have
epidemiological and economic consequences associated with patient’s stay in hospital which contribute
to an extension of hospitalization, patient’s suffering
and stress. They may also be considered as a threat for
public health (6). In Poland, marginal data on health-
care-associated gastrointestinal system infections exist.
Available data discuss mainly diarrhoeas caused by
rotaviruses identified in paediatric wards (7, 8). There
is a lack of Polish epidemiological studies on the frequency of CDIs. Furthermore, information on long-term
monitoring of CDIs in Polish hospitals is also lacking
(9). Since 2004, however, St. Lukas Provincial Hospital
in Tarnów registers healthcare-associated infections as
separate causes of diarrhoeas with determination of
etiological agents. Therefore, we decided to perform
a comprehensive analysis of these infections using
standard, uniform tools such as cumulative incidence
662
No 4
Zdzisław Wolak, Marta Z Wałaszek, et al.
rates (CIRs) and incidence density rates (IDRs). Results
obtained may serve as a base for comparing and evaluating epidemiological situation in Polish hospitals as well
as high-specialist wards.
In 2004-2013, patients hospitalized in St. Lukas Provincial Hospital in Tarnów were subject to epidemiological surveillance. As many as 21 surgical, conservative
and paediatric wards were monitored. In the analysis,
wards with no healthcare-associated gastrointestinal
system infections detected were excluded. Diagnosis
of infections was made on a basis of recommendations
issued by the expert groups of CDC (Centres for Disease
Control and Prevention) and then ECDC (European
Centre for Disease Prevention and Control). Healthcareassociated infections identified (HAIs) were subject to
analysis and classified according to ECDC definitions
(10, 11). While registering the infections, the following classification of clinical manifestations was used:
surgical site infection (SSI), pneumonia (PN), urinary
tract infection (UTI), bloodstream infection (BSI), gastrointestinal system infection (GI) and other infections
(OTH). Cumulative incidence rate (CIR per 100 and
1,000 hospitalizations) was calculated using the number
of new cases of GI in the analyzed population over a
specified time period: the number of GIs divided by the
number of hospitalizations and multiplied by 100 or
1,000. Incidence density rate (IDR/1,000 person-days)
was calculated as follows: the number of GIs divided
by the number of person-days and multiplied by 1,000.
Gastrointestinal system infections (GIs) were
grouped into: infections caused by C. difficile (GICDI) and those excluding C. difficile etiology (GI-GE).
Subsequently, gastroenteritis/excluding CDI (GI-GE)
was classified into subgroups by etiological agents
identified, i.e. rotaviruses, noroviruses, adenoviruses, C.
albicans and unspecified agent. Pursuant to provisions
of law in force, patient suspected of infection or infected
should be subject to adequate isolation. Etiological
agents of GIs such as rotaviruses, noroviruses, C. difficile were monitored and analyzed within the frames
of surveillance over alert pathogens.
Faeces sample testing was performed using the
following culture media: chromogenic medium Chromid ID CPS, MacConkey agar, Hektoen agar, sodium
selenite medium (bioMérieux media), Sorbitol MacConkey agar (selective isolation of E. coli O157:H7
– Grasso media), Sabouraud agar (with gentamicin and
chloramphenicol). Furthermore, tests for the presence
of rotaviruses and adenoviruses (VIKIA® Rota-Adeno
by bioMériux) and C. difficile (C. DIFF QUIK CHEK
COMPLETE by TECHLAB) were also performed.
RESULTS
In a 10-year period, a total of 297,545 patients were
hospitalized in St. Lukas Provincial Hospital in Tarnów.
Of them, 5,167 (1.7%) were diagnosed with HAI, including 944 GIs. In this period, 52 outbreaks of GI were
detected where 404 out of 944 patients were affected.
The remaining cases of GI, i.e. 540 out of 944 patients
were not involved in these outbreaks. A systematic
increase in the number of GI cases compared to the
total number of HAIs was observed with the highest
increase noted in internal medicine and nephrology and
urology wards. The number of GIs in particular years
ranged from 14 (2005) to 155 (2013) (Tab. I). In a 10year observation, there was a shift in the distribution
of GIs in HAIs. In 2004-2006, these infections were
placed as 5th in hospital after SSI, BSI, PN, UTI while
in 2010-2013 they moved to the first position (Tab. II).
For all 944 GIs detected, cumulative incidence rate
(CIR) was 0.35% while incidence density rate (IDR)
amounted to 0.57/1,000 person-days (Tab. III). From
the group of GIs, infections with C. difficile (GI-CDI)
and those excluding C. difficile etiology (GI-GE) were
distinguished.
A total of 301 patients were diagnosed with CDI
with CIR and IDR amounting to 0.11%, 1.13/1,000 hospitalizations and 0.18/1,000 person-days, respectively.
Table I. Number of gastrointestinal system infections (GIs) in all healthcare-associated infections (HAIs) in 2004-2013
Clinical manifestation of HAI
SSI
PN
UTI
BSI
GI
OTH
Total
2004
119
40
37
59
21
4.0
280
Number of GIs in all HAIs in 2004-2013
2005
2006
2007
2008
2009
102
85
97
107
128
65
48
86
77
65
53
67
94
128
115
69
93
109
130
117
14
48
98
76
117
29
31
54
91
111
332
372
538
609
653
2010
121
55
122
68
116
54
536
2011
127
61
101
76
155
61
581
2012
137
58
91
108
140
124
658
2013
137
64
77
73
159
98
608
Total
1160
619
885
902
944
657
5167
HAI - healthcare-associated infection, SSI - surgical site infection, PN - pneumonia, UTI - urinary tract infection, BSI - bloodstream infection,
GI - gastrointestinal system infection, OTH - other infection.
No 4
663
Prevalence of gastrointestinal system infection
Table II. Distribution (%) of gastrointestinal system infections (GIs) in all healthcare-associated infections (HAIs) in 20042013
Clinical manifestation of HAI
SSI
%
PN
%
UTI
%
BSI
%
GI
%
OTH
%
Total
%
2004
42.5
14.3
13.2
21.1
7.5
1.4
100
2005
30.7
19.6
16.0
20.0
4.2
8.7
100
Disribution of GIs in all HAIs
2006
2007
2008
2009
22.8
18.0
17.6
19.6
12.9
16.0
12.6
10.0
18.0
17.5
21.0
17.6
25.0
20.3
21.3
17.9
12.9
18.2
12.5
17.9
8.3
10.0
14.9
17.0
100
100
100
100
2010
22.6
10.3
22.8
12.7
21.6
10.1
100
2011
21.9
10.5
17.8
13.1
26.7
10.5
100
2012
20.8
8.8
13.8
16.4
21.3
18.8
100
2013
22.5
10.5
12.7
12.0
26.2
16.1
100
Total
23.9
12.5
17.0
18.0
16.9
1.6
100.0
HAI - healthcare-associated infection, SSI - surgical site infection, PN - pneumonia, UTI - urinary tract infection, BSI - bloodstream
infection, GI - gastrointestinal system infection, OTH - other infection.
Table III.Healthcare-associated gastrointestinal system infections (GIs) by cumulative incidence rates (CIRs) and incidence
density rates (IDRs) in 2004-2013
Year
Hospitalizations
Person-days
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
Total
24278
24260
25559
26864
29232
28572
20341
29490
28858
29571
267025
160297
163004
171295
167202
165406
167168
171256
165146
159897
157249
1647920
N
21
14
48
98
76
117
116
155
140
159
944
CIR/100
hospitalizations
0.09
0.06
0.19
0.36
0.26
0.41
0.57
0.53
0.49
0.54
0.35
HAI case (GI)
CIR /1,000
hospitalizations
0.82
0.54
1.75
3.41
2.43
3.87
3.69
4.74
4.41
4.90
3.17
IDR/1,000
person-days
0.13
0.09
0.28
0.59
0.46
0.70
0.68
0.94
0.88
1.01
0.57
HAI - healthcare-associated infection, GI - gastrointestinal system infection, N – number of infections, CIR/100 hospitalizations – cumulative incidence rate, CIR/1,000 hospitalizations - cumulative incidence rate, IDR/1,000 person-days- incidence density rate.
Table IV. Healthcare-associated gastrointestinal system infections (GIs) by cumulative incidence rates (CIRs) and incidence
density rates (IDRs) for infections with C. difficile (CDI) and other gastrointestinal system infections (GE) in
2004-2013
Year
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
Total
Healthcare associated GIs as CDI and GE
CDI – infections with C. difficile
GE- infections excluding C. difficile etiology
CIR
CIR
IDR
CIR
CIR
IDR
Number
Number
CDI/100
CDI/1,000
CDI/1,000
GE/100
GE/1,000
GE/1,000
of CDIs
of GE
hospitalizations hospitalizations person-days
hospitalizations hospitalizations person-days
1
0
0.04
0.01
20
0.08
0.82
0.12
1
0
0.04
0.01
13
0.05
0.54
0.08
8
0.03
0.31
0.05
40
0.16
1.57
0.23
14
0.05
0.52
0.08
84
0.31
3.13
0.5
22
0.08
0.75
0.13
54
0.18
1.85
0.33
28
0.1
0.98
0.17
89
0.31
3.11
0.53
33
0.16
1.62
0.19
83
0.41
4.08
0.48
65
0.22
2.2
0.39
90
0.31
3.05
0.54
51
0.18
1.77
0.32
89
0.31
3.08
0.56
78
0.26
2.64
0.5
81
0.27
2.74
0.52
301
0.11
1.13
0.18
643
0.24
2.41
0.39
CDI: gastrointestinal system infections with C. difficile, GE: gastrointestinal system infections (excluding CDI etiology), CIR/100 hospitalizations - cumulative incidence rate, CIR/1,000 hospitalizations - cumulative incidence rate, IDR/1000 person-days- incidence density rate.
664
No 4
Table V. Gastrointestinal system infections (GE) of viral etiology by cumulative incidence rates (CIRs) and incidence
density rates (IDRs) in 2004-2013
Year
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
Total
Healthcare-associated gastrointestinal system infections by viral etiological agents in GI-GE group
Rotaviruses
Noroviruses
Adenoviruses
Total
Number of
Number of
Number of
Number of
HAI-GE
CIR
IDR
HAI-GE
CIR
IDR
HAI-GE
CIR
IDR
HAI-GE
CIR
9
0.04
0.06
0
0.00
0.00
0
0.00
0
9
0.04
13
0.05
0.08
0
0.00
0.00
0
0.00
0
13
0.05
21
0.08
0.12
3
0.01
0.02
0
0.00
0
24
0.09
47
0.17
0.28
0
0.00
0.00
0
0.00
0
47
0.17
31
0.11
0.19
0
0.00
0.00
3
0.01
0.02
34
0.12
42
0.15
0.25
5
0.02
0.03
6
0.02
0.04
53
0.19
36
0.18
0.21
3
0.01
0.02
5
0.02
0.03
44
0.22
40
0.14
0.24
0
0.00
0.00
9
0.03
0.05
49
0.17
27
0.09
0.17
5
0.02
0.03
7
0.02
0.04
39
0.14
26
0.09
0.17
1
0.00
0.01
2
0.01
0.01
29
0.10
292
0.11
0.18
17
0.01
0.01
32
0.01
0.02
341
0.13
IDR
0.06
0.08
0.14
0.28
0.21
0.32
0.26
0.30
0.24
0.18
0.21
HAI - healthcare-associated infection, GI-GE: gastrointestinal system infections (excluding GI-CDI), CIR/100 hospitalizations- cumulative incidence rate, IDR/1,000 person-days - incidence density rate.
Table VI.Etiological agents of healthcare-associated gastrointestinal system infections (GIs) identified in hospital in 20042013
Etiological agent
Clostridium difficile
Rotaviruses
Noroviruses
Adenoviruses
Candida albicans
Lack of data
Total
%
%
%
%
%
%
%
2004
4.76
42.9
0.0
0.0
0.0
52.4
100
Distribution of HAIs (GIs) by etiological agents
2005 2006 2007 2008
2009
2010
7.14 16.7 14.3 28.9
23.9
28.4
57.1 43.8 48.0 40.8
35.9
31.0
0.0
6.25
0.0
0.0
4.27
2.59
0.0
0.0
0.0
3.95
5.13
4.31
0.0
0.0
5.10 3.90
1.71
0.00
35.8 33.3 32.7 22.4
29.1
33.6
100
100
100
100
100
100
2011
41.9
25.8
0.00
5.81
1.94
24.5
100
2012
36.4
19.3
3.57
5.00
5.00
30.7
100
2013
49.1
16.4
0.63
1.26
0.63
32.1
100
Total
31.9
30.4
1.80
3.39
2.22
30.3
100
Lack of data – etiological agent was not determined or material was not collected from patient
Table VII. Number of healthcare-associated gastrointestinal system infections (GIs) by etiological agents identified in
particular wards in 2004-2013
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Total
Type of units
Ophthalmology
Neurosurgery
Urology
Cardiology
Internal medicine and nephrology
Internal medicine and acute
intoxication
Trauma and orthopaedic
Surgery
Gynaecology and obstetrics
Anaesthesiology
Rehabilitaion
Oncology
Paediatric
Paediatric surgery
Neurology
Radiotherapy
Number of HAIs (GIs) in 2004-2013
CDI Viral
GE C. difficile
GE*
C. albicans
N
N
N
0
2
0
7
1
0
53
7
3
2
3
1
145
19
1
10
16
23
2
15
4
2
0
0
21
1
301
0
4
2
0
1
13
0
259
22
8
0
341
1
0
2
2
5
0
1
0
0
4
1
21
GI – agent
unspecified
N
7
22
20
8
37
GI
Total
N
9
30
83
14
202
8
52
8
5
6
13
2
48
25
20
0
281
19
72
35
9
27
30
5
307
47
53
2
944
(%) GI
N
1.0
3.2
8.8
1.5
21.4
2.0
7.6
3.7
1.0
2.9
3.2
0.5
32.5
5.0
5.6
0.2
100.0
N - number, *rotaviruses, noroviruses, adenoviruses, agent unspecified- etiological agent was not detected or material was not collected
from patient; GI – gastrointestinal system infection, GE - gastrointestinal system infection (excluding CDI).
No 4
665
Table VIII. Cumulative incidence rate (CIR) for gastrointestinal system infections (GIs) by type of units and etiological
agents in 2004-2013
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Total
Type of units
Ophthalmology
Neurosurgery
Urology
Cardiology
Internal medicine and
nephrology
Internal medicine (II)
Surgery
Anaesthesiology
Rehabilitaion
Oncology
Paediatric
Paediatric surgery
Neurology
Radiotherapy
Cumulative incidence rate (CIR) for GIs in 2004- 2013
CDI GE Viral GE*
C.difficile
C. albicans
Number of
N=341
N=301
N=21
hospitalizations
%
%
%
23345
0.00
0.01
0.00
15414
0.05
0.01
0.00
15749
0.34
0.04
0.02
20267
0.01
0.01
0.00
13759
19637
14358
32028
32165
3182
5513
16601
16730
15233
19000
4044
267025
1.05
0.05
0.11
0.07
0.01
0.47
0.07
0.01
0.00
0.00
0.11
0.02
0.11
0.14
0.00
0.03
0.01
0.00
0.03
0.24
0.00
1.55
0.14
0.04
0.00
0.13
0.01
0.01
0.00
0.01
0.01
0.16
0.00
0.01
0.00
0.00
0.02
0.02
0.01
GI - agent
unspecified
N=281
%
0.03
0.14
0.13
0.04
Total N=944
%
0.04
0.19
0.53
0.07
0.27
0.04
0.36
0.02
0.02
0.19
0.24
0.01
0.29
0.16
0.11
0.00
0.11
1.47
0.10
0.50
0.11
0.03
0.85
0.54
0.03
1.84
0.31
0.28
0.05
0.35
* rotaviruses, noroviruses, adenoviruses, agent unspecified- etiological agent was not detected
N = number of infections, GI - gastrointestinal system infection, GE - gastrointestinal system infection (excluding CDI),
CIR/100 hospitalizations - cumulative incidence rate (%).
Table IX.Incidence density rate (IDR) for gastrointestinal system infections (GIs) by type of units and etiological agents in
2004-2013
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Total
Type of units
Ophthalmology
Neurosurgery
Urology
Cardiology
Internal medicine and
nephrology
Internal medicine (II)
Surgery
Anaesthesiology
Rehabilitaion
Oncology
Paediatric
Paediatric surgery
Neurology
Radiotherapy
Incidence density rate (IDR) for GIs in 2004- 2013
CDI GE - C.
Viral GE*
C.difficile
albicans
Number of
N=341
N=301
N=21
person-days
‰
‰
‰
69189
0.00
0.03
0.00
113018
0.06
0.01
0.00
79259
0.67
0.09
0.04
111301
0.02
0.03
0.01
121730
124063
116727
194822
173218
18911
109591
55619
110595
54282
138425
57170
1647920
1.19
0.08
0.14
0.12
0.01
0.79
0.04
0.04
0.00
0.00
0.15
0.02
0.18
0.16
0.00
0.03
0.01
0.00
0.05
0.12
0.00
2.34
0.41
0.06
0.00
0.21
0.01
0.01
0.00
0.01
0.01
0.26
0.00
0.02
0.00
0.00
0.03
0.02
0.01
* rotaviruses, noroviruses, adenoviruses, agent unspecified- etiological agent was not detected
GI - gastrointestinal system infection, GE - gastrointestinal system infection (excluding CDI),
N = number of infections, IDR/1,000 person-days- incidence density rate (‰)
GI - agent
unspecified
N=281
‰
0.10
0.19
0.25
0.07
0.30
0.06
0.45
0.04
0.03
0.32
0.12
0.04
0.43
0.46
0.14
0.00
0.17
Total N=944
‰
0.13
0.27
1.05
0.13
1.66
0.15
0.62
0.18
0.05
1.43
0.27
0.09
2.78
0.87
0.38
0.03
0.57
666
GE was identified in 643 patients with CIR – 0.24%,
2.41/1,000 hospitalizations and IDR – 0.39/1,000
person-days (Tab. IV). For 341 patients, GI-GE were
grouped based on the viral etiological agents identified. In this case, CIR and IDR amounted to 0.13% and
0.21/1,000 person-days, respectively. Of them, the following infections were identified: GE caused by rotaviruses – 292 patients (CIR-0.11%, IDR-0.18/1,000); adenoviruses - 32 patients (CIR-0.01%, IDR-0.02/1,000);
noroviruses - 17 patients (CIR-0.01%, IDR-0.01/1,000)
(Tab. V). At the beginning of study (2004-2010), infections of rotavirus origin predominated over other GIs.
Their distribution ranged from 31.0% to 57.1% in all
etiological agents of GIs. In the later phase of study
(2011-2013), infections caused by C. difficile were
placed as 1st with their distribution ranging from 36.4%
to 49.1%. The distribution of C. albicans infections in
other GIs stretched from 0 to 5.1%. For many GI cases,
etiological agents were not determined (from 22.4%
to 52.4%) (Tab. VI).
Having considered the type of wards, the majority
of infections were detected in the following wards:
paediatric – 307 infections (32.5%); internal medicine
and nephrology - 202 (21.4%); urology - 83 (8.8%)
and others (Tab. VII). The highest value of cumulative
incidence rate (CIR) was observed in the following
wards: paediatric - 1.84%; internal medicine and nephrology – 1.47%; anaesthesiology and intensive care unit
– 0.85% and others (Tab. VIII). High incidence density
rate (IDR) was noted in the following wards: paediatric
– 2.79/1,000 person-days; internal medicine and nephrology – 1.66/1,000; anaesthesiology and intensive care
unit – 1.43/1,000 (Tab. IX). Viral infections were most
common in paediatric wards - 259 cases (CIR - 1.55%,
IDR – 2.34/1,000). GI-CDI predominated in internal
medicine and nephrology - 145 patients (CIR – 1.05%,
IDR – 1.19/1,000) (Tab. VII - IX).
DISCUSSION
In wards enrolled in the study, surveillance over
healthcare-associated infections (HAIs) is conducted
since 2001. At the beginning of HAI monitoring, a
special attention was given to the most important clinical manifestations of healthcare-associated infections,
i.e. SSI, BSI, PN, UTI. In a routine medical practice,
however, GIs were commonly reported to the Infection
Control Team as adverse events associated with patient’s
treatment. These infections were also problematic with
regard to care and treatment. Since 2004, GIs were
added to the list of healthcare-associated infections
under surveillance. An organizational problem consisting in ensuring GI cases adequate isolation conditions
occurred as sanitary facilities were not present in all
No 4
patient rooms. Provided there is no possibility for patient’s isolation or lack of adequate sanitary conditions,
etiological agents of gastrointestinal system infection
may spread quickly in healthcare settings leading to
the occurrence of epidemic outbreaks. Such situation
contributes to an increased demand for nursing care,
especially in case of bedridden patients. Furthermore,
it generates additional treatment costs, deteriorates
patient’s state of being and makes patients losing confidence in medical personnel and methods of treatment.
If a diagnosis of GI in hospitalized patient is made,
urgent activities such as meticulous compliance with
principles of hygiene, especially hand washing and
disinfection and effective decontamination of equipment
and rooms where patients stayed should be undertaken.
The prevalence of GIs vary with regard to the types
of wards. In Poland, these infections are often of viral
etiology (7, 8, 12). In the majority of cases, these infections are attributed to rotaviruses, noroviruses and
adenoviruses. In our study, viral GIs were mainly caused
by rotaviruses for which typical are high infectivity
and resistance to adverse conditions. The reasons of
spread of healthcare-associated rotavirus infections
are the presence of patients infected with rotaviruses,
overcrowded wards, inappropriate hygiene behaviour
in children, parents and medical personnel, failed or
delayed patient’s isolation, lack of adequate conditions
for patient’s isolation. According to Nitsch-Osuch et al.
(13), incidence density rate of rotaviral diarrrhoea in the
European Union amounts to 0.7-10/1,000 person-days
while in 6-year own studies conducted in Poland in a
group of patients aged 0-18 years CIR was 0.91% and
IDR – 2.05/1,000 person-days. In paediatric ward of
St. Lukas Provincial Hospital in Tarnów, CIR and IDR
for rotavirus infections were 1.55% and 2.34/1,000
person-days, respectively. It indicates that the number
of new cases in hospital studied was higher than in the
hospital compared. However, the duration of stay in
hospital carried similar risk of contracting an infection
in hospitals compared. According to the data of Ołdak
et al. (8), of the material collected in 2006-2009, the
prevalence of infections caused by rotaviruses amounted
to 31.4% of all healthcare-associated infections. In
St. Lukas Provincial Hospital in Tarnów, distribution
of GIs (including infections caused by rotaviruses) in
the total number of healthcare-associated infections
(HAIs) was 16.9% while the distribution of rotavirus
infections in GIs amounted to 30.4%. In the analysis
of gastrointestinal system infections conducted by the
Provincial Sanitary and Epidemiological Station in
Cracow (14,15), infections with norovirus (24%) and
rotavirus (10%) predominated in Małopolskie province.
Łoś-Rycharska et al. (16) state that infections caused by
rotaviruses occur frequently and account for even more
than 50% of acute gastrointestinal system infections.
No 4
667
It is estimated that in 30% of cases, etiology determination of acute diarrhoea is not feasible. It should be
highlighted that in hospital studied, the percentage of
unspecified etiological agents of infections amounted
to 30% as well. High infectivity of virus is attributed to
high incidence of rotaviral diarrhoea. One microgram of
faeces or respiratory tract secretion is sufficient enough
for infection spread (17).
A systematic decrease in the prevalence of infections caused by rotaviruses and increase in the number
of C. difficile infections are observed. In recent years,
this pathogen is responsible for infection spread in
wards more frequently. Bandoła et al. (14, 15) state that
the distribution of C. difficile infections in the gastrointestinal system infections in Małopolskie province
in 2012 was 7%. In St. Lukas Provincial Hospital in
Tarnów, the distribution of C. difficile infections in gastrointestinal system infections was 31.9%. Elixhauser et
al. (2), who evaluated the incidence of CDIs in American
hospitals, state that 0.77% of hospitalized patients were
diagnosed with this infection. In 2009, the results of
similar studies showed prevalence at 0.9% and there
was a 4-fold increase in the number of patients infected
with C. difficile (18). In St. Lukas Provincial Hospital
in Tarnów, 4-fold increase of CDI patients was also observed. An average incidence was 0.11% while in 2013
its value was the highest, i.e. 0.26%. There are many
rates describing the prevalence of healthcare-associated
infections, including GIs. Barbut et al. (1) estimated the
incidence of CDIs in a study conducted in 2002 in 212
European hospitals at 1.1/1,000 hospitalizations. In St.
Lukas Provincial Hospital in Tarnów, we obtained the
same incidence of CDIs, i.e. 1.1/1,000 hospitalizations.
In the prevention of GIs of viral etiology, the
simplest method is broadly defined compliance with
principles of hygiene, especially hand washing and disinfection (17). Of importance is also hospitalization of
patients in adequate conditions with possibility to ensure
effective isolation (16). In case of GI-CDI, the reasons
of increased incidence of CDIs are not unequivocally
determined. In literature, the most important risk factor
specified is frequent use of antibiotics (1, 9, 19, 21, 22).
Monitoring of healthcare-associated infections in
Poland is obligatory. However, the scope of surveillance over HAIs as well as criteria for their diagnosis
may vary. The type of data collected and their analysis
should be considered by the Infection Control Team.
Identification of the scale of GIs, their distribution
and risk factors may lead to their effective prevention.
However, the most important element of prevention of
GIs is informing medical personnel, patients and their
families as well as heads of wards. Only then, data collected may serve as useful tool for raising the awareness
of healthcare-associated infections. Furthermore, these
data should be the base for undertaking prevention activities following determination of priority areas.
SUMMARY AND CONCLUSIONS
1. Gastrointestinal system infections are the most
prevalent healthcare-associated infections.
2. Infections with C. difficile and rotaviruses predominated in adult and paediatric wards, respectively.
3. Rationalization of antibiotic use should result in the
reduction of C. difficile infections.
4. Compliance with hygiene principles and effective
isolation of patients may lead to the decrease of
rotavirus infections.
REFERENCES
1. Barbut F, Delmee M, Brazier JS. et al. A European survey
of diagnostic methods and testing protocols for Clostridium difficile. Clin Microbiol Infect 2003; 9:989-96.
2. Elixhauser A, Jhung M. Clostridium difficile Diseases
in US Hospital 1993-2005; AHRQ, Centre for Delivery,
Organization and Markets, Healthcare Cost an Utilization
Project. Nationwide Inpatient Sample, april 2008. http://
www.hcup-us.ahrq.gov/reports/statbriefs/sb50.pdf. Data
wejścia: 15.04.2014.
3. McDonald LC, Owings M, Jernigan DB. Clostridium difficile infection in patients discharged from US short-stay
hospital, 1996-2003. Emerg Infect Dis. 2006; 12:409-15.
4. Redelings MD Sorvillo F, Mascola L. Wzrost Clostridium difficile wskaźników śmiertelności związanych,
Stany Zjednoczone, 1999-2004. Emerg Infect Dis. 2007;
13:1417-9.
5. Burckhardt F, Friedrich A, Beier D, et al. Clostridium
difficile surveillance trends, Saxony, Germany. Emerg
Infect Dis. 2008;14:691-2.
6. Lessa FC, Gould CV, McDonald LC. Current status of
Clostridium difficile infection epidemiology.Clin Infect
Dis 2012; 55:65-70.
7. Kuchar E, Nitsch-Osuch A, Szenborn L. Rotavirusy jako
ważna przyczyna zakażeń szpitalnych na oddziałach
dziecięcych. Zakażenia, 2011,12(6),64-70.
8. Ołdak E, Rożkiewicz D, Sulik A. et al. Hospital-acquired
rotavirus gastroenteritis at the University Children’s Hospital of Northeastern Poland:5 year retrospective study,
ESPID 2011, abstracts CD; poz. P473.pdf
9. Mięgoć H, Łucejko M, Flisiak R. Przyczyny zakażeń
Clostridium difficile- czy tylko antybiotykoterapia.
Zakażenia 2013;13(6): 34-43.
10. European Centre for Disease Prevention and Control.
Point prevalence survey of healthcare – associated infections and antimicrobial use in European acuta care
hospitals – protocol version 4.3. Stockholm: ECDC;
2012. http://www.ecdc.europa. eu/en/publications/
publications/0512-ted-pps-hai-antimicrobial-use-protocol.pdf. Data wejścia: 10.02.2014.
668
11. Grzesiowski P, Gudzińska-Adamczyk M, Lejbrant E. et
al. Definicje zakażeń szpitalnych na podstawie decyzji
wykonawczej Komisji Europejskiej nr 2012/506/UE
z dnia 8.08.2012r. Z komentarzem ekspertów SHL.
Stowarzyszenie Higieny Lecznictwa. Warszawa 2013;
5-50.
12. Wałaszek M, Wolak Z, Dobroś W. Zakażenia szpitalne
u pacjentów hospitalizowanych w latach 2005-2011.
Szpital Wojewódzki im. Św. Łukasza w Tarnowie. Przegl.
Epidemiol. 2012;66:615-619
13. Nitsch-Osuch A, Kuchar E, Kosmala A. et al. Nosocomial
Rotavirus gastroenterocolitis in a large tertiary paediatric
hospital I Worsow, 2006-2010. Arch Med Sci. Jun 20,
2013; 9(3): 493–498.
14. Bandoła K, Bryg E, Bryndas L. et al. Stan sanitarny
małopolski w 2012 r. Wojewódzka Stacja SanitarnoEpidemiologiczna w Krakowie. Kraków 2013:7-90.
15. Bandoła K, Seweryn M, Pokrzywa P. Ogniska zakażeń
szpitalnych w województwie małopolskim w latach
2006-2010. Zakażenia 2012; 12(4):81-86.
16. Łoś-Rycharska E, Czerwionka-Szaflarska M. Biegunki
rotawirusowe – dlaczego warto im zapobiegać ? Przegląd
Gastroenterologiczny 2011; 6 (2): 60–68.
17. Hjelt K. Nosocomial virus infections in pediatric departments. Rotavirus and respiratory syncytial virus. Ugeskr
Laeger 1991; 153: 2102-4. 18. Lucado J, Gould C, Elixhauser A. Clostridium difficile
Infections (CDI) in Hospital Stays, 2009 AHRQ, Healthcare Cost an Utylization Project. Statistical brief 124;
2012. http://www.hcup-us.ahrq.gov/reports/ statbriefs/
sb124.pdf Data wejścia: 15.04.2014.
No 4
19. Cohen S, Gerding DN, Johnson S. et al. Wytyczne
postępowania w zakażeniach Clostridium difficile wg
SHEA i IDSA z komentarzem i aktualizacją ekspertów
SHL’ 2012. Autorzy komentarza: Dulny G, Grzesiowski
P, Gałdzińska-Adamczyk M. Stowarzyszenie Higieny
Lecznictwa 2012.
20. Hryniewicz W, Gayane M, Ozorowski T. Zakażenia
Clostridium difficile. Ministerstwo Zdrowia; Narodowy
Program Ochrony Antybiotyków 2011. http://www.
antybiotyki.edu.pl/pdf/Clostridium-difficile-v6_10.pdf.
Data wejścia: 25.02.2014.
21. Mertz D, Frei R, Plagge H. et al. Stronger correlation
between antibiotic use and the incidence of Clostridium
difficile determined by culture results instead of faecal
toxin detection only, Eur J Clin Microbiol Infect Dis
2010; 29(12);1578-8.
22. Dulny G, Zalewska M, Młynarczyk G. Analiza stosowania antybiotyków jako czynnika ryzyka zakażeń
Clostridium difficile. Forum zakażeń 2013;4(4):223-228.
Zdzisław Wolak
St. Lukas Provincial Hospital
Lwowska 178a
33-100 Tarnów
tel. 14/6315 461
Anna Schneider1, Anna Mól1, Katarzyna Lisowska1, Maria Jax-Dambek2 ,
Dominika Lachowicz3, Piotr Obuch-Woszczatyński3, Hanna Pituch3
THREE-STEP DIAGNOSTIC ALGORITHM IN DIAGNOSING PATIENTS
SUSPECTED OF CLOSTRIDIUM DIFFICILE –ASSOCIATED DIARRHEA
Microbiology Clinical Laboratory,
Section for Healthcare-associated Infection Control University Hospital of Lord’s Transfiguration in Poznań
3
Department of Medical Microbiology, Warsaw Medical University
1
2
ABSTRACT
Clostridium difficile is a predominant etiological agent of healthcare-associated infectious diarrhea. Immunoenzymatic tests for detecting toxins A/B from faecal samples are still used in routine diagnosis of Clostridium
difficile-associated diseases in a number of healthcare centers in Poland. Recently, however, new diagnostic
tests were introduced which allow for detecting toxigenic strains of C. difficile in a more effective and precise
manner. It is of importance, especially in the light of hypervirulent strain occurrence.
AIM. The aim of the present paper was to evaluate the efficacy of three-step algorithm in the diagnosis of Clostridium difficile-associated diseases (CDAD), considering the occurrence of false negative test results for toxins
while using exclusively immunoenzymatic tests.
MATERIALS AND METHODS. In the present study, faecal samples collected from patients presenting diarrhea
were tested. Immunoenzymatic tests were used for detecting glutamate dehydrogenase (GDH) and toxins A/B.
Culture and RT-PCR were also employed.
RESULTS. Of 615 study participants, toxigenic strains GDH (+) TOX (+) were identified in 108 patients while
for 67 patients, test results remained unspecified GDH (+) TOX (-). Further analysis of unspecified samples
revealed 32 patients infected with toxigenic strains, i.e. 22.9% of all positive test results (n=140).
CONCLUSION. Three-step diagnostic algorithm is an effective and reliable tool for diagnosing C.difficileassociated diseases.
Key words: Clostridium difficile-associated disease, three-step diagnostic algorithm for CDAD, PCR - ribotyping
INTRODUCTION
Clostridium difficile (CD) is a predominant etiological agent of healthcare-associated infectious diarrhea
worldwide. A list of the most important risk factors
of C.difficile-associated disease includes: antibiotic
therapy, long-term hospitalization and advanced age
(older than 65 years). Disease may affect patients in all
age groups (1,2). According to Barlett et al., 15-25%
of antibiotic-associated diarrheas (AAD) and nearly
100% of pseudomembranous colitis (PMC) cases are
attributed to C.difficile (3).
Recently, an increasing tendency in the prevalence
of CDAD is observed worldwide. In the United States,
Canada and Europe, a 4-fold increase in the number of
CDAD cases was reported. Furthermore, the number
of CDAD cases of severe course also increased. It may
result from the emergence of new, virulent C. difficile
strains (4-8). An estimated 10-30% of adult patients
are colonized by C. difficile. Not all of them, however,
would present diarrhea (9).
Accurate diagnosis of healthcare-associated infectious
diarrhea is essential in identification of patients infected
with C.difficile. Consequently, it could reduce the risk of
transmission of potentially virulent strains. Currently, rapid
and simple tests for detecting the markers of infection with
toxigenic C.difficile strains directly from faecal samples are
available. These tests differ in terms of sensitivity, specificity,
duration and costs borne by hospitals (10-15).
This paper aimed at evaluating the efficacy of three-step
algorithm in diagnosis of Clostridium difficile-associated
diseases (CDAD). CDAD may not be identified if tests for
detection of toxins are exclusively used in routine diagnosis.
670
No 4
Anna Schneider, Anna Mól, et al.
A total of 615 diarrheal faecal samples collected from
adults hospitalized in the University Hospital of Lord’s
Transfiguration in Poznań between January 2011 and the
end of February 2013 were tested. Study participants
were hospitalized in the following departments: Vascular
Surgery, Surgical Oncology, Cardiology, Cardiac Surgery, Anaesthetics and Critical Care, Haematology with
Transplantation Section, Pulmonology, Chemotherapy,
Internal Medicine and Palliative Medicine. An analysis of
diagnostic management of faecal samples was performed,
using three-step algorithm (number of faecal samples
tested was equal to the number of patients). Figure 1
presents diagnostic algorithm employed.
For laboratory testing, immunoenzymatic tests by
TechLab (Blacksburg, USA, VA 24060) for detecting glutamate dehydrogenase (GDH), i.e. C. difficile somatic antigen
and toxins A/B were used. In the phase I, the following tests
were applied: C.DIFF CHEK60, C.DIFF CHEK TOX A/B
(to the end of November 2012). Since the launch of new test,
which is more rapid and of higher sensitivity (December
2012), C.DIFF QUIK CHEK, C.DIFF QUIK TOX A/B,
C.DIFF QUIK COMPLETE were used. Provided test results
were unspecified GDH (+), toxins A/B (TOX A/B) (-), faecal samples were cultured on solid media and/or molecular
testing was performed using Xpert CD, Cepheid, Sunnyvale,
CA, USA. Media by bioMérieux SA, Marcy l’Etole, France
were used for culture.
In the first period (to a half of 2012), Columbia agar
with 5% sheep blood with a mixture of antibiotics: cyclo-
serine – 100 mg/L, cefoxitin - 8 mg/L and amphotericin B
- mg/L (CLO) and Columbia agar with 5% sheep blood were
employed. To enhance the accuracy of method used, faecal
samples were exposed to ethanol (equal volume of faeces
and ethanol 96%) for one hour. Consequently, it limited the
growth of other non-endospore-forming bacteria. In this period, isolation of C. difficile strains raised difficulties. Since the
launch of chromogenic medium - ChromID C.difficile (CDIF,
bioMérieux SA, Marcy l’Etole, France) in a second half of
2012, containing i.a. sodium taurocholate, the frequency of
CD isolation considerably increased. Media were incubated
under anaerobic conditions for 48–72 hours (CCA medium)
and 24 hours (chromogenic medium) at temperature of 37ºC.
Strains isolated were identified on a basis of characteristic
growth, para-cresol odour, assessment of preparation with
Gram’s method and biochemical tests (ANC, bioMérieux
SA, Marcy l’Etole, France).
Toxigenicity of strains was analyzed using ELISA for
toxin detection (C.DIFFICILE TOX A/B II) or molecular
tests - RT-PCR (Xpert CD, Cepheid, Sunnyvale, CA, USA)
for detecting C. difficile toxins B gene fragment, binary toxin
and specific deletion at position 117 of tcdC gene acting as
negative regulator. Selection of diagnostic test was dependent
on patient’s symptoms and general health.
Isolated C. difficile strains were subject to PCR-ribotyping. PCR-ribotyping was conducted in the Anaerobe Laboratory of the Department of Medical Microbiology at Warsaw
Medical University. Reference strains were obtained from
the Cardiff-ECDC collection. Strains which could not be
classified to any PCR ribotype strains were sent to the reference centre in Leiden (Leiden University Medical Center,
Leiden, the Netherlands).
Phase 1- detection of Clostridium difficile
antigen GDH
－
＋
Phase II – detection of C. difficile toxins
C. difficile (-)
－
Phase III – culture/ molecular test
＋
C. difficile tox (+)
＋
－
C. difficile tox (-)
Fig. 1.
Phase I – Detection of antigen from faecal sample tested – glutamate dehydrogenase (GDH) produced by both
toxigenic and nontoxigenic C. difficile strains; negative test result excluded C. difficile infection.
Phase II – Testing of faecal sample where GDH for C.difficile toxins A and/or B was detected; positive test result
was indicative of toxigenic strain infection.
Phase III – Evidence for toxigenicity of C. difficile strain isolated from faecal sample using immunoenzymatic
test or molecular test for detecting the C. difficile toxins gene fragment.
No 4
671
Three-step diagnostic algorithm
RESULTS
In the period between 1st January 2011 and 28th February 2013, a total of 615 faecal samples collected from
patients presenting diarrhea and intestinal obstruction,
hospitalized in different departments, were tested (data
were included in Table I).
Fig. 2 presents the results of three-step diagnostic
algorithm employed.
C.difficile toxins and/or toxigenic strains were
identified in 140 faecal samples collected from patients
with diarrhea, i.e. 22.7% of all tests performed. Of them,
26.4% (n=37) and 73.6% (n=103) were females aged
26-87 years (average-60 years, median-63 years) and
males aged 21-88 years (average-62 years, median-63
years), respectively. In the group analyzed (n=140),
hospitalization ranged from 1 to 76 days (average-14
days, median-10 days). In the majority of patients
(131/140), diarrhea occurred between 3 and 76 days of
hospitalization. Patients were hospitalized due to heart
diseases, heart defects, vascular diseases, myeloproliferative disorders and respiratory diseases.
Screening using test for detecting glutamate dehydrogenase revealed that GDH was present in 175
(28.45%) samples. Such marker was not identified in
440 (71.54%) samples. Based on negative test result
for the presence of GDH, infection with C.difficile was
excluded. Samples, where GDH was detected (n=175),
were further analyzed using ELISA for detecting C. difficile toxins. C.difficile toxins A/B were detected in 106
(17.23%) faecal samples while 67 samples were toxin-
Table I. Number of faecal samples tested with positive test
results for C.difficile toxins A and B in patients
hospitalized in the University Hospital of Lord’s
Transfiguration in Poznań.
Departments
Anaesthetics and Critical
Care
General and Vascular
Surgery
Cardiac Surgery with
Postoperative Section
Cardiology
Internal Medicine
Haematology with
Transplantation Section
Pulmonology
Palliative Medicine
Chemotherapy,
Surgical Oncology and
Gynaecologic Oncology
Number
Number/percentage
of faecal
of positive faecal
samples tested
samples
84
13/15.47%
153
48/31.37%
75
29/19.33%
45
2
9/20%
1/50%
207
30/14.49%
6
31
2/33.33%
9/29.03%
13
0
free. Due to severe general health of patients, RT-PCR
was performed for 2 faecal samples which revealed the
presence of C. difficile toxin B gene fragment (tcdB).
No fragments of binary toxin were detected. As many as
67 samples, which were toxin-free in the phase II, were
subject to further testing. A total of 59 faecal samples
were cultured. Due to the general health of patients and
the need for rapid test result, molecular test - RT-PCR
was performed for 8 samples. Having used RT-PCR,
toxin gene fragments tcdB, cdtA and/or cdtB and dele-
GDH
N=615 (100%)
GDH (-)
N=440 (71.54%)
GDH (+)
N=175 (28.45%)
TOX A/B
PCR
N=2 (0.32%)
N=173 (28.13%)
TOX (+)
N=2 (0.32%)
TOX (+)
TOX (-)
N=106 (17.23%)
N=67 (0.89%)
TOX (+)
PCR
N=8 (1.3%)
N=6 (0.97%)
TOX (-)
N=2 (0.32%)
Fecal culture
N=59 (9.59%)
TOX (+)
N=140
(22.7%)
ELISA
Negative culture
CultureTOX(-)
N=16 (2.6%)
N=18 (2.92%)
PCR
N=4 (0.65%)
Fig. 2.
TOX (+)
N=25 (4.06%)
TOX (+)
N=1 (0.16%)
Results of three-step diagnostic algorithm in patients suspected of C. difficile–associated diarrhea between 1st
January 2011 and 28th February 2013.
672
No 4
Table II. Genotyping results using PCR – ribotyping of C.
difficile strains isolated from faecal samples GDH
(+) TOX (-).
No. Strain No. Isolation date
1.
2.
2835/11
9954/11
3.
13904/11
4.
14672/11
5.
19034/11
6.
19930/11
7.
3318/12
8.
6857/12
9.
12421/12
10.
14859/12
11.
12.
13.
14.
16221/12
18759/12
19757/12
21283/12
15.
21307/12
16.
23383/12
17.
18.
19.
766/13
4735/13
3837/12
Department
12 Feb 2011 Cardiac Surgery
01 June 2011 Cardiac Surgery
Anaesthetics and
31 July 2011
Critical Care
General and
15 Aug 2011
Vascular Surgery
General and
18 Oct 2011
Vascular Surgery
General and
30 Oct 2011
Vascular Surgery
General and
12 Feb 2012
Vascular Surgery
General and
22 Mar 2012
Vascular Surgery
Internal
04 June 2012
Medicine
Cardiac Surgery
09 July 2012
Section
26 July 2012 Cardiac Surgery
02 Sep 2012
Haematology
12 Sep 2012
Haematology
02 Oct 2012
Haematology
Cardiac Surgery
04 Oct 2012
Section
Anaesthetics and
05 Nov 2012
Critical Care
09 Feb 2013
Haematology
27 Feb 2013
Haematology
17 Feb 2013
Cardiology
PCRribotype
176
176
027
005
027
027
027
027
027
027
027
012
002
087
005
015
014
014
027
tion at position 117 of tcdC gene were detected in 3
samples. In 3 samples, exclusively toxin gene fragments
tcdB were identified. C.difficile strains were isolated
from 43 faecal samples. Toxigenicity was confirmed
for 25 strains using ELISA for detecting toxins. Having
considered the symptoms and risk factors of CDI, for 4
out of 18 potentially nontoxigenic strains in ELISA, RTPCR was additionally performed. Gene fragment tcdB
was identified in one strain. Isolated strains for whose
the following test result was obtained - GDH(+) TOX(-)
were subject to PCR–ribotyping. It was determined
that 8 strains belonged to hypervirulent PCR-ribotype
027 and the next two – to PCR-ribotype 176 which is
genetically related to PCR-ribotype 027. The remaining strains belonged to other ribotypes, i.e. 002 (n=1),
005 (n=2), 012 (n=1), 014 (n=2), 015 (n=1), and 087
(n=1). Results of ribotyping were presented in Table
II. All C. difficile strains subject to PCR-ribotyping
were toxigenic which was confirmed by proper tests
for detecting toxins A/B.
DISCUSSION
Occurrence of symptoms and detection of toxins
A/B in gastrointestinal tract of patients serve as a basis
for diagnosis of C.difficile infection. A number of laboratories use rapid commercial immunoenzymatic tests
for detecting C. difficile toxins A and/or B. Sensitivity
of these methods, however, is not sufficient enough
for identification of C.difficile infection in all patients.
Application of proper diagnostic algorithm seems to be
a solution to this problem.
In 2009, the experts of the European Society of
Clinical Microbiology and Infectious Diseases (ESCMID) and a year later, the experts of the Society
for Healthcare Epidemiology of America (SHEA),
Infectious Diseases Society of America (IDSA) and
American Society of Microbiology formulated the
guidance for diagnosing Clostridium difficile infection
(16,17,18). Screening tests for detection of glutamate
dehyrogenase (GDH) were recommended. In case of
positive test result, it was advocated to perform confirmatory test for detecting toxins A/B using ELISA or
molecular test. High sensitivity (ranging from 97.6%
to 100%) and negative predictive value (NPV 99%) are
typical of tests for detecting somatic antigen GDH. It
may be assumed that negative test result excludes the
presence of C.difficile in faecal sample analyzed. It
should not be forgotten that detection of antigen GDH
does not allow for differentiating between infection with
toxigenic and nontoxigenic strains (11,14,17,19,20).
Cell cytotoxicity assay is considered to be a gold
standard in detecting toxin B. It is a time-consuming,
expensive method, requiring tissue culture and confirmation by neutralization test. Thus, it is not routinely
executed (16,17,18). Studies conducted by the European
scientific group revealed that the percentage of laboratories whose diagnostic methods of CDI are based on
commercial tests for detecting toxins A/B from faecal
samples amounts to 93%. Of them, approximately 80%
analyze the toxigenicity using immunoenzymatic test
while 41.6% apply both ELISA and culture (21). Tests
based on immunoenzymatic reactions (ELISA) are easyto-perform. Furthermore, test results can be provided
quickly. ELISA is of very good specificity, however,
it is not sensitive enough. Consequently, it may lead
to underestimating the number of infections (22). It
is also confirmed by the results of the present paper.
Having adopted diagnostic algorithm, further analysis
of 67 samples which were initially toxin-free by ELISA
ensured detection of infection with potentially toxigenic
C. difficile strain in the next 32 (22.9%) patients presenting symptoms indicative of infection. All of the strains
isolated from patients, in whom exclusively antigen
GDH was detected, were toxigenic. Similar results were
obtained in the study by Nurzyńska et al. where two-step
No 4
673
Three-step diagnostic algorithm
algorithm was used for testing samples which initially
were considered as negative GDH (+) TOX (-) (23).
Patients whose test results were false negative may
be a potential source of cross infection, leading to hospital outbreaks. Lack of proper, effective microbiological
diagnostic methods results in failure to diagnose patients
which consequently triggers the consequences of clinical and epidemiological nature. Introduction of proper
diagnostic methods may contribute to an increase in the
number of detected infections.
Faecal culture for C. difficile may be useful as a
supplementary method to immunoenzymatic tests in
case of patients whose symptoms are indicative of C.
difficile infection and if exclusively antigen GDH is
identified in them. Culture is a sensitive method, however, it is time-consuming and requires confirmation
of toxigenicity of isolated strain. Nevertheless, strains
which are isolated in culture may be subject to a number
of additional tests with an example being: determination of genes which allows for more precise analysis of
epidemiology of C.difficile infection.
Testing of samples in the period between January 2011 and a half of 2012 raised difficulties consisting in failure to isolate C. difficile strain from
faecal sample where antigen GDH was identified.
No reasons of such situation were determined. It could
result from the presence of agents inhibiting the growth
of strain in faeces under in vitro conditions or lower sensitivity of culture medium which was used initially (24).
Molecular methods seems to be the prospects in
the diagnosis of CDAD. Currently, tests based on Real
-Time PCR are available. They allow for detection of
toxin gene fragments: toxin B (tcdB), binary toxin (cdtA
and cdtB) and specific deletion tcdC at position 117,
occurring in strains important from epidemiological
perspective, i.e. strains belonging to PCR-ribotype 027.
It is a commercial method which was approved by the
American Food and Drug Administration (FDA). From
studies by Novak-Weekley et al. transpires that RT-PCR
is of higher sensitivity (94.4%) and negative predictive
value NPV (98.8%) compared to immunoenzymatic
tests (83.1%) and cell cytotoxicity assay (55.6%) (25).
Such method provides quickly (45 min) test results
which are decisive for initially negative or inconclusive
test results in case of the presence of specific symptoms and suspicion of C.difficile infection. It should
not be forgotten, however, that detection of C.difficile
toxin gene fragment is not indicative of toxin expression but it may suggest C.difficile carriage. Therefore,
concomitant interpretation of molecular test result and
symptoms if of importance.
In the present paper, genetic typing of isolated
C.difficile strains, using PCR-ribotyping, was performed. Genetic diversity of C.difficile strains isolated
from patients presenting diarrhea and intestinal obstruc-
tion was demonstrated. Of 8 different ribotypes identified, two belonged to PCR-ribotypes 027 and 176 being
of high virulence. Detection of ribotype 176, closely
related to ribotype NAP1/BI/027, which emerged in
Poland at the turn of 2008 and 2009, should be highlighted (26). Increased virulence of C.difficile strains
pose a threat for colonization of this pathogen in hospital
settings, leading to higher risk of CDAD infections.
CONCLUSIONS
Diagnosis of patients infected with toxigenic C. difficile strains, using exclusively ELISA for detecting toxins
A/B from faecal samples, is not sufficient enough. Results
of the present paper confirm the usefulness of molecular
methods and culture in diagnostic algorithm of CDAD.
Acknowledgements: The authors would like to
thank Prof. J. Brazier (Anaerobe Reference Laboratory,
Cardiff, the Great Britain) and Prof. Edward Kuijper
(Leiden University Medical Center, Leiden, the Netherlands) for the provision of reference strains for PCRribotyping. We would like to thank Prof. E. Kuijper and
Celina Hamanus for their assistance in PCR-ribotyping
of selected strains. PCR- ribotyping, performed in the
Anaerobe Laboratory of the Department of Medical Microbiology at Warsaw Medical University, was financed
by the resources of the National Science Centre (NCN)
in Cracow within 2011/01/B/NZ7/02720grant.
REFERENCES
1. McFarland LV., Beneda HW, et al. Implications of the
changing face of Clostridium difficile disease for health
care practitioners. Am J Infect Control 2007 May;
35(4):237-53.
2. Barlett JG. Narrative review: the new epidemic of Clostridium difficile – associated enteric disease. Ann Intern
Med .2006 Nov 21; 145(10):758-64.
3. Bartlett JG. Clostridium difficile: history of its role as
an enteric pathogen and the current state of knowledge
about the organism. Clin Infect Dis1994;18(Suppl.4):
S265e72.
4. Kuijper EJ, Coignard B, Tüll P et al. Emergence of Clostridium difficile associated disease in North America and
Europe. ClinMicrobiol Infect 2006;12 Suppl 6:2–18.
5. Pepin J, Valiquette L, Alary ME et al. Clostridium difficile associated diarrhea in region of Quebec from 1991
to 2003: a changing pattern of disease severity. CMAJ
2004; 171: 466-472.
6. Pearson A. Historical and changing epidemiology of
healthcare-associated infections.
7. Rupnik M, Wilcox MH., Gerding DN. Clostridium difficile infection: new developments in epidemiology and
pathogenesis. Nat Rev Microbiol 2009 : Jul;7(7):526-36.
674
8. McDonald CL, George E, M.D, Killgore Dr.PH et al.
An Epidemic, Toxin Gene–Variant Strain of Clostridium
difficile N Engl J Med 2005;353:2433-41.
9. McFee RB, Abdelsayed GG. Clostridium difficile. Dis
Mon. 2009, 55:439-470.
10. Fenner, L, Widmer AF, Goy G, Rudin S and Frei R. Rapid
and reliable diagnostic algorithm for detection of Clostridium difficile. J. Clin. Microbiol 2008: 46:328–330.
11. Gilligan P.H. Is a two-step glutamate dehydrogenase
antigen-cytotoxicity neutralization assay algorithm superior to the Premier Toxin A and B enzyme immunoassay
for laboratory detection of Clostridium difficile? J Clin
Microbiol 2008: 46:1523–1525.
12. Reller ME, Lema CA, Perl TM, Cai M. et al. Yield of
stool culture with isolate toxin testing versus a two-step
algorithm including stool toxin testing for detection of
toxigenic Clostridium difficile. JClin Microbiol 2007:
45:3601–3605.
13. Reller ME, Alcabasa RC, Lema CA and Carroll KC.
Comparison of two rapid assays for Clostridium difficile
common antigen and a C.difficile toxin A/B assay with
the cell culture neutralization assay. Am J Clin Pathol
2010: 133:107–109.
14. Sharp SE, Ivie WM, Buckles MR et al. A simple 3-step
algorithm for improved laboratory detection of Clostridium difficile toxin with out the need for tissue culture
cytotoxicity neutralization assays. Diagn Microbiol
Infect Dis 2009: 64:344–346.
15. Sloan LM, Dureski BJ, Gustafson DR et al. Comparison
of real-time PCR for detection Of the tcdC gene with
four toxin immunoassays and culture in diagnosis of
Clostridium difficile infection. J Clin Microbiol 2001:
46:1996–2001.
16. Cohen SH, Gerding DN, Johnson S et al. Clinical practice
guidelines for Clostridium difficile infection in adults:
2010 update by the Society for Healthcare Epidemiology
of America (SHEA) and the Infectious Diseases Society
of America (IDSA). Infect Contr Hosp Epidemiol 2010:
31:431e55.
17. Crobach M, Dekkers O, Wilcox M et al. European Society
of Clinical Microbiology and Infectious Diseases (ESCMID): Data review and recommendations for diagnosing
Clostridium difficile-infection (CDI). Clin Microbiol
Infect 2009: 15:1053-1066.
No 4
18. American Society of Microbiology: A practical Guidance
Document for the Laboratory Detection of Toxigenic
Clostridium difficile. September 21, 2010.www.asm.org
19. Quinn CD, Sefers SE, Babiker W, et al. C.Diff Quik
Chek Complete enzyme immunoassay provides a reliable
first-line method for detection of Clostridium difficile
in stool specimens. J Clin Microbiol February 2010 :
vol. 48 no. 2 603-605.
20. Sharp S, Ruden LO, Pohl JC et al. Evaluation of the
C.DIFF Quik Chek Complete assay a new glutamate
dehydrogenase and A/B combination lateral flow assay
for use in rapid, simple diagnosis of Clostridium difficile
disease. J Clin. Microbiol 2010: 48:2082-2086.
21. Hryniewicz W, Martirosian G, Ozorowski T. Zakażenia
Clostridium difficile. Diagnostyka, profilaktyka, terapia.
2011 www.antybiotyki.edu.pl
22. Rosemary CS, MD, Robert J. Durrant, MT, and Cathy
A. Petti, MD. Evaluation of enzyme immunoassays to
detect Clostridium difficile toxin from anaerobic stool
culture. Am J Clin Pathol 2009: 131:81-84.
23. Nurzyńska G. Pituch H. Kamola R et al. Zastosowanie
dwustopniowego algorytmu w diagnostyce chorych z
niskim poziomem toksyn A/B Clostridium difficile w
kale potwierdzonym testem immunoenzymatycznym.
Med Dośw Mikrobiol 2013: 65:263-268.
24. Perry JD, Asir K, Halimi D et al. Evaluation of a chromogenic culture medium for isolation of Clostridium
difficile within 24 hours. J Clin Microbiol 2010: 48:
3853-8.
25. Novak-Weekley SM, Marlowe EM, Miller JM et al.
Clostridium difficile testing in the clinical laboratory
by use of multiple testing algorithms. J Clin Microbiol
2010: 48:889-93.
26. Nyc O, Pituch H, Matějková J, Piotr Obuch-Woszczatynski b, Kuijper Ed J. Clostridium difficile PCR ribotype
176 in Czech Republic and Poland. The Lancet 2011:
377(9775): 1407.
Address for correspondence: Anna Schneider
Microbiology Clinical Laboratory
University Hospital Przemienienie Pańskie
½ Długa Street, 61-848 Poznań
Tel. +48 61 854 92 25
Public health
Michalina Krzyżak1, Dominik Maślach1, Katarzyna Piotrowska2,
Angelika E. Charkiweicz1, Andrzej Szpak1, Jan Karczewski2
PERINATAL MORTALITY IN URBAN AND RURAL AREAS
IN POLAND IN 2002-2012
Department of Public Health, Medical University of Bialystok
Department of Hygiene and Epidemiology, Medical University of Bialystok
1
2
ABSTRACT
AIM. The aim of this study was to analyze the level and trends of perinatal mortality by mother’s place of resi-
dence (urban vs rural area) in Poland in 2002–2012.
MATERIAL AND METHOD. This study was based on the data of the Central Statistical Office on the number of
live births, infant deaths (0-6 days) and stillbirths by mother’s place of residence (urban vs rural area), reported
in 2002–2012 in 16 provinces and Poland in general. Joinpoint model was used to analyze perinatal mortality
rate trends over time and average annual percent change (APC). Urban/rural ratio was employed to demonstrate
the differences in perinatal mortality between urban and rural areas.
RESULTS. In the period analyzed, perinatal mortality in Poland decreased by 3.4% (p<0.05) and 2.7% (p<0.05) per
year in urban and rural areas, respectively. Having considered urban areas, perinatal mortality rate was decreasing
at the fastest pace in the following provinces: Pomorskie (APC) = -6.6%, p<0.05), Warmińsko-Mazurskie (APC)
= -5.4%, p<0.05), Lubuskie i Świętokrzyskie (APC = -4.5%, p<0.05) while for rural areas – Dolnośląskie (APC =
-4.3%, p<0.05), Wielkopolskie, Zachodniopomorskie (APC = -3.7%, p<0.05) and Śląskie (APC = -3.2%, p<0.05).
CONCLUSIONS. In the study period, a decrease in perinatal mortality was reported in Poland, both in urban and
rural areas. The level of perinatal mortality rate as well as the pace of these changes differed between provinces.
Key words. perinatal mortality, urban-rural differences, joinpoint analysis
INTRODUCTION
AIM
Perinatal mortality is an important indicator used for
evaluating the health care quality for mothers and their
newborns. It serves as a reflection of living conditions
and general health of mothers and their children. It allows policy makers for identification of major problems
associated with perinatal care. Furthermore, it enables
to monitor time and territorial trends in mortality and
consequently to plan and introduce organizational
changes to the health care system (1).
Perinatal care requires interdisciplinary interventions, involving the cooperation of obstetricians,
neonatologists and other professionals (pediatricians,
surgeons, dieticians, social workers). It should cover
such components as health care, health promotion and
therapeutic activities undertaken in preconceptional
period, pregnancy, at childbirth and postpartum with
regard to mother, fetus and newborn (2, 3, 4, 5).
This paper aimed at analyzing the level and trends
of perinatal mortality by mother’s place of residence
(urban vs rural area) in Poland in 2002–2012.
Analysis was based on the data of the Central Statistical Office (CSO) on the number of live births, infant
deaths (0-6 days) and stillbirths reported in Poland in
2002–2012 (6).
Perinatal mortality rate was calculated as a quotient
of the total of infant deaths within the first seven days of
life (0-6 days) and stillbirths (death preceding the complete expulsion or extraction from mother’s organism;
provided it occurred at week 22 of gestation or later) to
the total of births per 1000 births. Rates were calculated
676
No 4
Michalina Krzyżak, Dominik Maślach, et al.
separately for each of 16 provinces by mother’s place
of residence (urban vs rural area).
Mother’s place of residence was defined by the
CSO pursuant to the Act of 29 August 2003 on official
names of localities and physiographic objects (Journal
of Laws of 2003, No. 166, item 1612).
Statistical analysis. Urban/rural ratio was used
to demonstrate the differences in perinatal mortality
between urban and rural areas. It was calculated as a
quotient of perinatal mortality rate in urban and rural
areas. The values of urban/rural ratio and 95% confidence interval were determined, using Health Disparities Calculator (Version 1.2.4. – October 2013) (7).
Analysis of trends in perinatal mortality over time,
i.e. in 2002-2012 was performed. Time trends were
investigated for Poland in general and each province
by mother’s place of residence (urban vs rural area).
Joinpoint model was used to determine the changes
in perinatal mortality rate. Such method is an extension
of linear regression, in which time trends are expressed
by lines connected together at the joinpoints where there
is a statistically significant change in trend direction
(p<0.05) (8).
Based on linear regression model, where natural
logarithm of perinatal mortality rate was a dependent
variable while calendar year was an independent variable (y = a + bx, where y = ln (perinatal mortality rate),
x = calendar year), annual percent change (APC) of
perinatal mortality rates for each trends, was calculated
as follows:
APC = 100 * (expb - 1).
To determine the statistical significance of APC,
95% confidence interval was adopted in analyzed period. As the border of statistical significance, p<0.05
was established. Joinpoint Regression Program (Version
4.0.1 – January 2013) was used to analyze trends and
APC values (9).
RESULTS
Table I presents the trends of perinatal mortality
rate in 2002-2012 in Poland in general and provinces,
in urban and rural areas.
In Poland, perinatal mortality was decreasing
systematically by 3.4% in urban areas (p<0.05), and
Table I. Trends in perinatal mortality rate in urban and rural areas in 2002 – 2012.
Urban area
Perinatal mortality
rate
Rural area
Perinatal mortality
rate
Trend
2002-2012 -3.4* (-3.9; -2.8)
8.7
6.9
Differencea
(%)
-21.3
Trend
Poland
8.7
6.2
Differencea
(%)
-28.7
Dolnośląskie
Kujawsko - pomorskie
Lubelskie
11.3
7.0
-37.8
2002-2012 -4.3* (-5.4; -3.1) 11.0
7.5
-31.7
8.6
7.2
-17.0
2002-2012 -0.8
(-3.2; 1.7)
9.9
7.2
-27.0
7.3
6.1
-16.1
2002-2012 -3.0* (-4.6; -1.3)
8.0
6.2
-22.8
2002-2012 -4.3*
2002-2007 -10.1*
2007-2012 +4.5
2002-2012 -2.8*
Lubuskie
9.1
7.7
-15.8
2002-2012 -4.5* (-7.2; -1.8)
6.4
6.2
-3.7
2002-2012
-0.5
(-4.2; 3.3)
Łódzkie
8.0
6.2
-22.4
2002-2012 -2.8
(-4.5; -1.0)
9.6
6.7
-30.2
2002-2012
-2.6
*
(-5.1; -0.1)
Małopolskie
7.7
6.0
-21.8
2002-2012 -2.5* (-4.6; -0.4)
8.3
6.7
-19.4
2002-2012
-3.1*
(-4.9;-1.2)
Mazowieckie
7.7
5.8
-25.0
2002-2012 -2.1
(-3.6; -0.7)
8.4
7.1
-15.6
2002-2012
-2.3
(-3.6; -1.0)
Opolskie
9.3
8.5
-8.9
2002-2012 -2.2
(-6.7; 2.7)
9.2
6.1
-33.4
2002-2012
-2.5
Podkarpackie
8.2
6.1
-25.7
2002-2012 -4.1
(-7.9; -0.2)
8.7
7.0
-19.4
2002-2012
-2.1
(-4.6; 0.5)
Podlaskie
8.2
5.8
-29.4
2002-2012 -3.5* (-5.5;-1.4)
8.2
6.7
-18.4
2002-2012
-2.6*
(-4.6;-0.6)
Pomorskie
10.0
5.2
-47.7
-14.6
2002-2012
-1.4
(-5.0; 2.3)
6.6
-33.7
8.3
6.2
-25.0
2002-2012
-3.2*
(-4.9; -1.2)
Świętokrzyskie
Warmińsko - mazurskie
Wielkopolskie
Zachodniopomorskie
9.7
5.1
-47.3
(-8.5; -4.6)
(-5.7; 3.6)
(-11.0;-2.3)
(-7.2; -1.7)
7.0
10.0
-6.6*
-1.2
-6.8*
-4.5*
8.1
Śląskie
2002-2012
2002-2007
2007-2012
2002-2012
9.1
7.2
-21.4
2002-2012
-1.8
(-5.2; 1.6)
9.0
4.1
-55.2
2002-2012 -5.4* (-8.2; -2.5)
9.5
10.3
+8.5
2002-2012
-1.3
(-4.9; 2.4)
7.4
6.2
-17.3
2002-2012 -3.5* (-5.5; -1.4)
8.5
5.9
-30.3
2002-2012
-3.7*
(-6.1; -1.2)
7.5
6.8
-9.5
2002-2012 -0.1
8.2
7.1
-13.5
2002-2012
-3.7*
(-5.9; -1.4)
2002 2012
Period
APC
(%)
*
*
*
95% CI
(-1.8; 1.7)
2002 2012
* APC is statistically significantly different from zero (p<0.05)
a – change in perinatal mortality rate between 2002 and 2012 (%) (based on data observed)
Period
APC
(%)
95% CI
2002-2012
-2.7*
(-3.3; -2.1)
(-6.2; -2.3)
(-16.2;-3.6)
(-2.5; 12.0)
(-5.3; -0.4)
*
(-5.2; 0.3)
No 4
677
Perinatal mortality in urban and rural areas in Poland
slightly more slowly in rural areas, i.e. by 2.7% on annual basis (p<0.05).
In analyzed period, statistically significant decrease
of perinatal mortality in urban areas was noted in
the following provinces: Dolnośląskie (APC=-4.3%,
p<0.05), Lubelskie (APC= -3.0%, p<0.05), Lubuskie
(APC= -4.5%, p<0.05), Łódzkie (APC= -2.8%, p<0.05),
Małopolskie (APC= -2.5%, p<0.05), Mazowieckie
(APC= -2.1%, p<0.05), Podkarpackie (APC= -4.1%,
p<0.05), Podlaskie (APC= -3.5%, p<0.05), Pomorskie
(APC= -6.6%, p<0.05), Świętokrzyskie (APC= -4.5%,
p<0.05), Warmińsko-mazurskie (APC= -5.4, p<0.05)
and Wielkopolskie (APC= -3.5, p<0.05). Since 2007,
a significant acceleration of the pace of changes was
noted in Śląskie province, which in 2007–2012 was
6.8% annually (p<0.05).
In rural areas, perinatal mortality rate decreased
considerably in 2002-2012 in the following provinces:
Dolnośląskie (APC= -4.3%, p<0.05), Lubelskie (APC=
-2.8%, p<0.05), Łódzkie (APC= -2.6%, p<0.05),
Małopolskie (APC= -3.1%, p<0.05), Mazowieckie
(APC= -2.3%, p<0.05), Podlaskie (APC= -2.6%,
p<0.05), Śląskie (APC= -3.2%, p<0.05), Wielkopolskie (APC= -3.7%, p<0.05) and Zachodniopomorskie
(APC= -3.7%, p<0.05). In Kujawsko–pomorskie
province, perinatal mortality was decreasing by 10.1%
annually to 2007 (p<0.05). Subsequently, trend changed
and perinatal mortality rate increased by 4.5% annually.
Following 2007, the increase of perinatal rate was not
of statistical significance.
Table II demonstrates the difrences in perinatal
mortality rate between urban and rural areas. Average
perinatal mortality rate in a year in Poland was higher
by 6% (p<0.05) in rural compared to urban areas. Sta-
tistically significantly increased perinatal mortality rate
in rural areas was reported in the following provinces:
Dolnośląskie (by 9%, p<0.05), Małopolskie (by 11%,
p<0.05), Mazowieckie (by 17%, p<0.05), Warmińsko–
mazurskie (by 13%, p<0.05), Wielkopolskie (by 7%,
p<0.05) and Zachodniopomorskie (by 17%, p<0.05).
In Śląskie province, perinatal mortality was higher by
11% (p<0.05) on average in urban areas. In the remaining provinces, no statistically significant differences
between urban and rural areas were reported.
DISCUSSION
Since the post-war period, perinatal mortality in
Poland was a reason of substantial decline in the population aged up to one year old. In 1952, it was 80/1000
births (10). Currently, perinatal mortality rates show a
decreasing tendency. In the 90s of the last century, it
amounted to 20/1000 births while at the beginning of
this century, it is 10/1000 births. In 2012, it was 6.5/1000
births (11).
In the European countries, the decrease in perinatal
mortality is also reported, i.e. from 42.8–19.7/1000
births in 1960 to 2.6–11.0/1000 births in 2012 (12, 13).
Our studies also confirm the decrease of perinatal
mortality in Poland in 2002 – 2012. Perinatal mortality rate decreased by nearly 28.7% and 21.3% in urban
and rural areas, respectively. According to Troszyński’s
report, perinatal mortality rate in 1999 was 10.8/1000
births while in 2010-6.9/1000 births. It suggests 38%
decrease within 12 years, i.e. about 3% annually (14).
The pace of perinatal mortality rate, however, is lower
compared to 1950–1995 (4, 15).
Table II. Urban/rural ratio of perinatal mortality in Poland in 2002–2012.
Poland
Dolnośląskie
Kujawsko - pomorskie
Lubelskie
Lubuskie
Łódzkie
Małopolskie
Mazowieckie
Opolskie
Podkarpackie
Podlaskie
Pomorskie
Śląskie
Świętokrzyskie
Warmińsko - mazurskie
Wielkopolskie
Zachodniopomorskie
U/R
1.00
1.03
0.87
0.90
1.42
0.84
0.93
0.92
1.01
0.94
1.00
1.23
1.20
1.07
0.95
0.87
0.91
2002
95% CI
(0.93;1.07)
(0.80;1.32)
(0.65;1.16)
(0.66;1.24)
(0.88;2.29)
(0.63;1.11)
(0.73;1.19)
(0.75;1.13)
(0.65;1.57)
(0.69;1.27)
(0.67;1.51)
(0.92;1.63)
(0.94;1.55)
(0.73;1.56)
(0.68;1.33)
(0.69;1.11)
(0.64;1.31)
a –average urban/rural ratio in a year as of 2002–2012; *p < 0.05
U/R
0.91*
0.94
0.99
0.98
1.24
0.93
0.90
0.81
1.38
0.86
0.87
0.75
1.06
0.72
0.39*
1.04
0.95
2012
95% CI
(0.84;0.98)
(0.70;1.26)
(0.72;1.36)
(0.70;1.39)
(0.77;2.01)
(0.67;1.28)
(0.69;1.17)
(0.66;1.01)
(0.85;2.26)
(0.61;1.22)
(0.54;1.40)
(0.54;1.04)
(0.81;1.40)
(0.44;1.16)
(0.26;0.60)
(0.80;1.34)
(0.65;1.40)
2002 – 2012a
U/R
95% CI
0.94*
(0.92;0.96)
0.91*
(0.84;0.98)
0.93
(0.85;1.02)
0.93
(0.84;1.02)
1.03
(0.90;1.19)
0.91
(0.83;1.00)
0.89*
(0.83;0.96)
0.83*
(0.78;0.89)
1.02
(0.88;1.18)
0.93
(0.84;1.02)
0.93
(0.81;1.06)
1.02
(0.94;1.12)
1.11*
(1.03;1.20)
0.90
(0.79;1.01)
0.87*
(0.78;0.97)
0.93*
(0.86;0.99)
0.83*
(0.75;0.92)
678
Michalina Krzyżak, Dominik Maślach, et al.
From the study transpires that there are disparities between the level and pace of perinatal mortality
between provinces. Differences are also reported with
regard to mother’s place of residence (urban vs rural
area). It is also confirmed by the results of Troszyński’s
report which demonstrates that in 1999-2010 the highest
perinatal mortality rates were reported in Dolnośląskie
province (from 13.7/1000 births in 1999 to 8.2/1000
births in 2009), while the lowest in Lubelskie province
(from 7.6/1000 births in 2001, 7.7/1000 births in 2002
to 6.9/1000 births in 2007). In 2009-2010, the highest
increase of perinatal mortality rates was noted in the
following provinces: Podkarpackie, Świętokrzyskie
and Podlaskie, while the lowest in Łódzkie and Śląskie
provinces (14). It may be presumed that it partially
results from health-related disparities in population
living in different areas which are observed in Poland
since many years (16, 10, 15), including women during pregnancy as well as throughout reproductive life.
From the National Health Programme (NHP) for
the years 2007—2015 transpires that the primary objectives of care for pregnant women should be ensuring a
normal course of pregnancy and possibly the quickest
identification of risk factors. Consequently, women
would receive a care which is tailored to their health
needs (17). It would ensure the continuation of positive
trends in perinatal mortality presented in the analysis.
An indispensible element for meeting the aforesaid
rights of women and sustaining a decreasing tendency of
perinatal mortality rates is a properly functioning 3-tier
perinatal care system, which grants highly-specialist
medical care, consistent with current knowledge (3).
The authors of NHP 2007-2015 put an emphasis on
the fact that the care for pregnant women and access
to specialist testing in many areas is not satisfactory.
Consequently, it leads to the situation in which not all
women have a possibility of early visit to the physician. It is also confirmed by our own observations. In
analyzed period, in Poland in general and six provinces, i.e.: Dolnośląskie, Małopolskie, Mazowieckie,
Warmińsko–mazurskie, Wielkopolskie and Zachodniopomorskie, perinatal mortality rate was considerably higher in rural areas. This 3-tier perinatal care
system does not function comprehensively throughout
Poland. Furthermore, the lifestyle of pregnant women
does not correspond to health requirements (17, 2). It
may be concluded that there is no comprehensive approach to perinatal care in Poland which would cover
community studies, social and health care, especially
in neglected environments. It indicates a necessity of
proper systemic solutions, especially those referring
to organization (5, 3). In Poland, there are still areas,
where there is limited or the lack of obstetric care. Such
statement is confirmed by the findings of the Supreme
Audit Office control regarding the midwifery activities
No 4
within primary care system. Based on the analysis of the
access to midwives in communes located in provinces
subject to control, it was confirmed that the inhabitants
of large cities and urban-rural communes, in which there
are health care centers, have the most optimal access
to obstetric care. In some rural communes, the services
rendered by midwives in primary care system are not
contracted. Consequently, women have to benefit from
the midwifery services in neighbouring communes. It
may result in disparities in perinatal mortality rates by
mother’s place of residence, which was demonstrated
in this study, to the disadvantage of rural areas (18).
Therefore, it is necessary to draw policy makers attention to the essential role of midwives, especially in rural
areas with regard to medical, social and psychological
aspects, including monitoring women and their children
throughout the pregnancy, at childbirth and postpartum,
taking care of newborns and preparing the women to
childbirth and parenthood. Such activities would ensure
equal access to medical services and elimination of
health disparities in different areas. Furthermore, such
system would ensure more optimal access to medical
services rendered with concomitant safety provision
and effective management of funds (3).
A special attention should be paid to the necessity
of constant improvement of 3-tier perinatal care system
by focusing on early identification of high-risk pregnancies and referring such women to specialist centers. It
should not be forgotten that for a properly functioning
perinatal care system, out-patient clinics and obstetric
wards as well as neonatal intensive care units and
neonatal pathology units need to be equipped with the
most optimal devices. Furthermore, medical personnel
working in these units should be adequately educated
and trained (5, 15). An important issue is also to raise
the awareness on health culture in society with regard
healthy diet, non-smoking and healthy lifestyle (15). All
of these recommendations are required for sustaining a
decreasing tendency of perinatal mortality in Poland.
For evaluation and monitoring of perinatal health,
adequate reporting forms and meticulous documentation
of data on births and neonatal deaths are required. These
data should correspond to indicators recommended by
EURO-PERISTAT (19). It is also necessary to conduct
systemic epidemiological studies on pregnant women
and newborns from high-risk groups as well as those
regarding the quality of medical services. Furthermore,
Poland should be involved in specialist European registers with the objective to ensure constant, multifaceted
analysis of perinatal mortality which is essential for
establishing the direction of activities aiming at improving perinatal care in Poland.
No 4
Perinatal mortality in urban and rural areas in Poland
CONCLUSIONS
1. In analyzed period, perinatal mortality was subject
to improvement in Poland, both in urban and rural
areas.
2. Perinatal mortality rate and the pace of changes differed between provinces.
3. The highest decrease of perinatal mortality in urban areas was reported in Pomorskie, Warmińsko-mazurskie, Lubuskie and
Świętokrzyskie provinces while in urban areas
- Dolnośląskie, Wielkopolskie, Zachodniopomorskie and Śląskie provinces.
4. A negative change in perinatal mortality trend was
reported in rural areas in Kujawsko–pomorskie
province.
5. Analysis of perinatal mortality suggests a necessity
of undertaking reproductive and perinatal healthrelated activities, aiming at reducing regional health
disparities regarding the health of mothers, fetus and
newborns in Poland.
REFERENCES
1. Neonatal and Perinatal Mortality: Country, Regional and
Global Estimates. WHO – Geneva 2006: 20.
2. Gadzinowski J. Rola systemu trójstopniowej opieki perinatalnej w opiece medycznej nad noworodkiem w Polsce.
[in:] Raport: Zdrowie kobiet w wieku prokreacyjnym 1549 lat. Polska 2006. Program Narodów Zjednoczonych
ds. Rozwoju, Warszawa 2007: 115 – 119.
3. Iwanowicz-Palus GJ, Stadnicka G, Bień A. Organizacja opieki przedkoncepcyjnej i okołoporodowej
determinantą zdrowia rodziny i społeczeństwa. Medycyna Ogólna i Nauki o Zdrowiu 2013, 19(3): 313-318.
4. Maciejewski T. Rozwój opieki perinatalnej na przełomie
XX i XXI wieku. Perinatologia, Neonatologia i Ginekologia 2013, 6(3): 136-140.
5. Troszyński M. Czy prowadzenie pogłębionej analizy
umieralności okołoporodowej może być pomocne w
podniesieniu jakości opieki perinatalnej? Medycyna
Wieku Rozwojowego 2010, 14(2): 138 – 149.
6. http://www.stat.gov.pl/bazademografia/Tables.aspx
7. Health Disparities Calculator, Version 1.2.4 - October
29, 2013, Division of Cancer Control and Population
Sciences, Surveillance Research Program and Applied
Research Program, National Cancer Institute.
8. Kim HJ, Fay MP, Feuer EJ, et al. Permutation tests for
joinpoint regression with applications to cancer rates.
679
Statics in Medicine 2000, 19(3): 335-351 (correction:
2001; 20: 655).
9. Joinpoint Regression Program, Version 4.0.1. January
2013, Statistical Research and Applications Branch,
National Cancer Institute.
10. Troszyński M. Umieralność okołoporodowa wczesna.
[in:] Raport: Zdrowie kobiet w wieku prokreacyjnym 1549 lat. Polska 2006. Program Narodów Zjednoczonych
ds. Rozwoju, Warszawa: 2007, 106-119.
11. Główny Urząd Statystyczny Departament Badań Demograficznych i Rynku Pracy. Podstawowe informacje
o rozwoju demograficznym Polski do 2013 roku. GUS
2014.
12. Pietrzycka D, Gadzinowski J. Opieka perinatalna w
krajach Europy Środkowej i Wschodniej. Kliniczna
Perinatologia i Ginekologia 2007, 43(3): 7-14.
13. Richardus JH, Graafmans WC, Verloove-Vanhorick
SP, Mackenbach JP. The perinatal mortality rate as an
indicator of quality of care in international comparisons.
Medical Care 1998, 36(1): 54-66.
14. Troszyński M (ed). Umieralność okołoporodowa wczesna (0-6) płodów i noworodków Polska – 2010 oraz
1999-2010. Instytut Matki i Dziecka, Warszawa 2011.
15. Troszyński M. Umieralność okołoporodowa płodów i
noworodków w latach 1999 – 2008 w Polsce. Medycyna
Wieku Rozwojowego 2010, 14(2): 129-137.
16. Wojtyniak B, Stokwiszewski J,Goryński P, et al. Długość
życia i umieralność ludności Polski. [in:] Sytuacja zdrowotna ludności Polski i jej uwarunkowania. Wojtyniak
B, Goryński P, Moskalewicz B (red). Narodowy Instytut
Zdrowia Publicznego – Państwowy Zakład Higieny,
Warszawa 2012: 96-102.
17. Narodowy Program Zdrowia na lata 2007-2015.
Załącznik do Uchwały Nr 90/2007 Rady Ministrów z
dnia 15 maja 2007 r.
18. Iwanowicz – Palus GJ, Krysa J, Bień A. Rola położnej
rodzinnej w Polsce. Medycyna Ogólna i Nauki o Zdrowiu
2013, 19(3): 272 – 278.
19. Szamotulska K. Stan zdrowia matek i dzieci w okresie
okołoporodowym w Polsce na tle krajów Unii Europejskiej. Opracowanie na podstawie wskaźników EuroPeristat. Medycyna Wieku Rozwojowego 2010, 14(2):
113-128.
Adress for correspondence:
Dr Michalina Krzyżak
Department of Public Heath, Medical University of Bialystok
Szpitalna 37, 15 – 295 Białystok
tel. /fax (85) 686 50 55
e – mail: [email protected]
Public health
Krzysztof Dudek
IMPACT OF BIODIVERSITY ON TICK-BORNE DISEASES
Institute of Zoology, Poznań University of Life Sciences
ABSTRACT
It is a well-known fact that high biodiversity is related to the health and proper functioning of environment.
Recently, the attempts to search the relations between biodiversity and human health are also undertaken. A
number of studies demonstrate that people living in undegraded environment are less exposed to the diseases of
affluence. However, they are at a higher risk of contracting zoonoses. It is believed that the higher the number of
animals, the higher is the number of ticks. Consequently, there is a serious risk of borreliosis and other tick-borne
diseases. Such assumption, however, may be erroneous. A number of studies suggest a decreasing prevalence
of tick-borne disease pathogens in high-biodiversity areas. In this paper, a promising hypothesis explaining this
relation is discussed.
Key words: Lyme disease, ticks, biodiversity, dilution effect
INTRODUCTION
Castor bean tick (Ixodes ricinus) is a common
ectoparasite of terrestrial animals. Ticks parasitize birds
and reptiles. To the largest extent, they infest mammals
which are decisive hosts for their survival. Small mammals, mainly rodents, are the most common hosts for
ticks’ larvae and nymphs. Adults feed on large mammals, especially those belonging to the family Cervidae.
Ticks may feed on each vertebrate species. Thus, they
are common parasites in humans. Ticks are considered
to be dangerous as they are the vectors of many pathogens, including viruses (tick borne encephalitis), protozoa (Babesia sp.) and bacteria (Borrelia burgdorferi,
Anaplasma phagocytophilum) (1,2,3). Ticks become
infected while feeding on infected hosts. Animal whose
population predominantly carries pathogens but does
not present with symptoms is a natural reservoir of
infection. Infection with Borrelia burgdorferi in human
(horse or dog), however, may lead to Lyme disease. In
Poland, an increasing number of Lyme disease cases is
observed (4,5). Moreover, studies on the prevalence of
antibodies to B. burgdorferi in humans suggest that this
number is underestimated (6,7). Probably, it results from
unspecific symptoms of disease, except for erythema
chronicum migrans. However, such symptom is not
always reported (8,9). An increasing role of ticks in the
epidemiology of diseases is attributed to the changes
in natural environment such as wetland drainage and
wasteland forestation (10). It may also be affected by
the phenomenon of global warming. From researches
transpires that the increase of global temperature leads
to the extension of geographic distribution of many tick
species (11). Recently, a relation between the decrease
of tick host biodiversity and the higher risk of tick-borne
diseases is widely discussed (12-14). The objective of
this article is to investigate this relation.
DILUTION EFFECT HYPOTHESIS
Until now, it was a common belief that the higher
the number of ticks, the higher is the risk of tick-borne
diseases (10). However, it should be noted that tick
hosts differ from one another with regard to reservoir
competence (15) with an example being B. burgdorferi
whose list of hosts includes a number of mammals, bird
and reptiles species. Rodents are the most competent
reservoir of B. burgdorferi. The majority of rodents are
infected with this bacterium (3). Large mammals such
as those belonging to the family Cervidae and carnivores are considered to be less competent reservoirs
(15) while even less competent are reptiles (16-18).
It was assumed that poorly competent reservoirs can
dilute the effect of competent reservoirs by ensuring
alternative areas for tick infestation in which the risk of
infection is lower (19,20). On a basis of this, American
parasitologists of the team of Richard Ostfeld from the
682
Krzysztof Dudek
Cary Institute of Ecosystem Studies developed a dilution effect hypothesis which correlates biodiversity with
the prevalence of vector-borne diseases on a particular
area (12-14). For dilution effect to be present in environment, four criteria are to be met: (I) vector must be
a generalist which means that it has to feed on different
host species, not only on selected ones; (II) hosts species must differ from one another concerning reservoir
competence; (III) the most competent reservoirs must
predominate in environment and feed the majority of
vector population; (IV) there is no transovarial transfer
of pathogens (from female to her offspring) in vector
(12). All of these criteria are met in case of Borreliatick-vertebrate model. Furthermore, studies suggest the
occurrence of dilution effect in natural environment
(21-23). Computer modelling is also supportive in this
respect. It enables to operate with the number of tick
host species. It unambiguously demonstrates that the
increase in the number of species in environment leads
to the decrease of pathogen prevalence in ticks (19).
Field works also confirmed the phenomenon of dilution
effect. It is well-illustrated by the studies on tick-borne
encephalitis virus. The results suggest that the decrease
in the number of Cervidae population, which is a poorly
competent reservoir, but simultaneously an important
host of ticks, leads to the significant increase in the
prevalence of this virus in natural environment (31).
Researches on other species with the examples being
Trypanosome and West Nile Virus which are transmitted
by bugs (24) and mosquitoes, respectively (25-27) also
No 4
confirmed the dilution effect hypothesis. These studies
demonstrate that the higher the biodiversity, the lower
the percentage of vectors are infected with pathogens.
IMPLICATIONS FOR ENVIRONMENT
PROTECTION AND TICK-BORNE DISEASE
PREVENTION
Studies on dilution effect refute the opinion that the
higher the number of vector hosts, the higher is the risk
of tick-borne diseases. Rodents such as voles, mice and
rats which are the most competent Borrelia reservoirs
occur in all, even extensively degraded environments of
low biodiversity. Thus, these animals are associated with
the highest risk of infection. Increasing biodiversity,
resulting from the appearance of new species, which
are predominantly poorly competent reservoirs (e.g.
lizards, large and medium-sized mammals, birds), leads
to a decreasing probability of tick infestation of rodents.
Consequently, a risk of infection is reduced (Fig.1.).
Such phenomenon calls for a change of the approach
to tick-borne diseases prevention. Actions undertaken
with the objective to reduce the number of tick hosts
seem to be inappropriate as finally the effect could
be different from the one expected. A good example
can be the process of fox population reduction. These
animals are common tick hosts, however, they are
poorly competent Borrelia reservoir. In fact, a few of
them transmit Borrelia (12). Thus, they dilute the high
Fig. 1. Dilution effect scheme. Ticks (white dots) in low-biodiversity environment (A) have a great chance to feed on
a competent reservoir host (quadrangles), which with high probability would be infected with pathogens (grey).
As a consequence, the majority of ticks will become infected (grey dots). In high-biodiversity environment (B)
ticks have a great chance to feed on poorly competent reservoir host (triangles). Probably, they would not become
infected.
No 4
Impact of biodiversity on tick-borne diseases
prevalence of pathogens in rodents. Furthermore, as
foxes feed on rodents, they reduce the population of
the most competent reservoir. Therefore, it might be
possible that the increasing number of foxes has a positive effect on the epidemiology of tick-borne diseases,
consequently reducing the risk of infection in humans.
It should not be forgotten, however, that the presence
of foxes is associated with other risks such as infection
with Echinococcus granulosus or rabies virus. A different relation between parasite and host is observed
in case of Cervidae population. These animals play an
important role in tick life cycle as here adult ticks most
frequently reproduce (28). Moreover, ticks to the largest
extent feed on Cervidae population (28). Until now, it
was thought that the reduction of Cervidae population
contributes to the decrease of tick-borne disease risk.
However, recent studies suggest a contrary relation (28).
It results from the fact that ticks are rarely infected while
feeding on these animals (15,29).
Another species which may contribute to borreliosis
prevention are lizards. Sand lizard Lacerta agilis and
viviparous lizard Zootoca vivipara, which are common
in Poland, are poorly competent Borrelia reservoirs.
Simultaneously, however, they are hosts for a number
of ticks (16,30). Moreover, it is assumed that viviparous
lizards may eliminate this bacterium during hibernation
when their body is totally frozen. Thus, they may serve
as filters where ticks may be cleared of pathogens.
Further studies are required in this respect for better
understanding of mechanisms in pathogen-parasite-host
model. So far, the initial results are promising. They
suggest that healthy and more diversified environment
may improve human health.
ACKNOWLEDGMENTS
I would like to thank Professor Piotr Tryjanowski
for his critical remarks to this article and inspiring
discussions.
REFERENCES
1. Dutkiewicz J. Study on the occurrence of Borrelia
burgdorferi sensu lato and tick-borne encephalitis virus
(TBEV) in ticks collected in Lublin region (eastern Poland). Ann Agric Environ Med 2002;9:105-10.
2. Cieniuch S, Stanczak J, Ruczaj A. The first detection of
Babesia EU1 and Babesia canis canis in Ixodes ricinus
ticks (Acari, Ixodidae) collected in urban and rural areas
in northern Poland. Pol J Microbiol 2009;58(3):231-6.
3. Richter D, Matuschka FR. “Candidatus Neoehrlichia
mikurensis,” Anaplasma phagocytophilum, and Lyme
disease spirochetes in questing European vector ticks and
683
in feeding ticks removed from people. J Clin Microbiol
2012;50(3):943-7.
4. Paradowska-Stankiewicz I, Chrześcijańska I. Borelioza z Lyme w Polsce w 2009 roku. Przegl Epidemiol
2011;65:279-80.
5. Paradowska-Stankiewicz I, Chrześcijańska I. Borelioza z Lyme w Polsce w 2010 roku. Przegl Epidemiol
2012;66(2):303-6.
6. Chmielewski T, Tylewska-Wierzbanowska S.
Występowanie przeciwciał swoistych dla Borrelia
burgdorferi u ludzi zdrowych na terenie Polski. Przegl
Epidemiol 2002;56:33-8.
7. Dybowska D, Kozielewicz D, Abdulgater A. Rozpowszechnienie boreliozy wśród pracowników lasów
województwa kujawsko-pomorskiego. Przegl Epidemiol
2007;61(1):67-71.
8. Błażejewicz-Zawadzińska M, Brochocka A, Lisińska J,
et al. Retrospektywna analiza objawów klinicznych 973
osób chorych na boreliozę W województwie kujawskopomorskim W latach 2000-2005. Przegl Epidemiol
2012;66:581-6.
9. Kiewra D, Dobracki W, Lonc E, et al. Ekspozycja
na ukłucia przez kleszcze a występowanie rumienia
wędrującego u pacjentów z boreliozą z Lyme na terenie
Dolnego Śląska. Przegl Epidemiol 2004;58:281-8.
10. Zajkowska J. Transmisja i krążenie patogenów odkleszczowych (KZM i boreliozy) i rola zmieniającego się
środowiska. Przegl Epidem 2010;64:525-31.
11. Gray JS, Dautel H, Estrada-Peña A, et al. Effects of climate change on ticks and tick-borne diseases in Europe.
Interdiscip Perspect Infect Dis 2009;593232.
12. Ostfeld RS, Keesing F. Biodiversity series: the function
of biodiversity in the ecology of vector-borne zoonotic
diseases. Can J Zool 2000;78(12):2061-78.
13. Ostfeld RS, Keesing F. Biodiversity and disease risk: the
case of Lyme disease. Conserv Biol 2000;14(3):722-8.
14. Schmidt KA, Ostfeld RS. Biodiversity and the dilution
effect in disease ecology. Ecology, 2001;82(3):609-19.
15. Gern L, Estrada-Pena A, Frandsen F, et al. European Reservoir Hosts of Borrelia burgdorferi sensu lato. Zentralbl
Bakteriol 1998;287(3):196-204.
16. Ekner A, Dudek K, Sajkowska Z, et al. Anaplasmataceae
and Borrelia burgdorferi sensu lato in the sand lizard
Lacerta agilis and co-infection of these bacteria in hosted
Ixodes ricinus ticks. Parasite Vector 2011;4(1):1-7.
17. Tijsse-Klasen E, Fonville M, Reimerink JH, et al. Research Role of sand lizards in the ecology of Lyme and
other tick-borne diseases in the Netherlands. Parasite
Vector 2010;3:42.
18. Giery ST, Ostfeld RS. The role of lizards in the ecology
of Lyme disease in two endemic zones of the northeastern
United States. J Parasitol 2007;93(3):511-7.
19. Van Buskirk J, Ostfeld RS. Controlling Lyme disease by
modifying the density and species composition of tick
hosts. Ecol Appl 1995;5(4):1133-40.
20. Van Buskirk J, Ostfeld RS. Habitat heterogeneity, dispersal, and local risk of exposure to Lyme disease. Ecol
Appl 1998;8(2):365-78.
21. Johnson PT, Preston DL, Hoverman JT, et al. Species
diversity reduces parasite infection through cross-
684
Krzysztof Dudek
generational effects on host abundance. Ecology,
2012;93(1):56-64.
22. Johnson PTJ, Thieltges DW. Diversity, decoys and the
dilution effect: how ecological communities affect disease risk. J Exp Biol 2010;213(6):961-70.
23. LoGiudice K, Duerr ST, Newhouse MJ, et al. Impact
of host community composition on Lyme disease risk.
Ecology, 2008;89(10):2841-9.
24. Xavier SCC, Vaz VC, D’Andrea PS, et al. Mapping of the
distribution of Trypanosoma cruzi infection among small
wild mammals in a conservation unit and its surroundings
(Northeast-Brazil). Parasitol Int 2007;56(2):119-28.
25. Johnson BJ, Munafo K, Shappell L, et al. The roles of
mosquito and bird communities on the prevalence of
West Nile virus in urban wetland and residential habitats.
Urban Ecosyst 2012;15(3):513-31.
26. Loss SR, Hamer GL, Walker ED, et al. Avian host community structure and prevalence of West Nile virus in
Chicago, Illinois. Oecologia 2009;159(2):415-24.
27. Swaddle JP, Calos SE. Increased avian diversity is
associated with lower incidence of human West Nile
infection: observation of the dilution effect. PloS one
2008;3(6):e2488.
28. Hartfield M, White KJ, Kurtenbach K. The role of deer
in facilitating the spatial spread of the pathogen Borrelia
burgdorferi. Theoretical Ecology 2011;4(1):27-36.
No 4
29. Telford SR, Mather TN, Moore SI, et al. Incompetence
of deer as reservoirs of the Lyme disease spirochete. Am
J Trop Med Hyg 1998;39(1):105-9.
30. Gryczyńska-Siemiątkowska A, Siedlecka A, Stańczak J,
et al. Infestation of sand lizards (Lacerta agilis) resident
in the Northeastern Poland by Ixodes ricinus (L.) ticks
and their infection with Borrelia burgdorferi sensu lato.
Acta Parasitol 2007;52(2):165-70.
31. Cagnacci F, Bolzoni L, Rosà R, Carpi G, Hauffe H, Valent
M, Rizzoli A. Effects of deer density on tick infestation
of rodents and the hazard of tick-borne encephalitis. I:
Empirical assessment. Int J Parasitol 2012;42(4):365372.
Krzysztof Dudek
Institute of Zoology
Poznań University of Life Sciences
Wojska Polskiego 71 C
60-625 Poznań
+48 61-848-76-51
Public health
Jolanta Kluz-Zawadzka, Anna Hartman-Ksycińska, Bogumił Lewandowski
EMERGENT MANAGEMENT OF SCORPION STING
Department of Emergency Medicine, Institute of Obstetrics and Emergency Medicine
University of Rzeszów
ABSTRACT
Scorpionism (syndrome of scorpion stings) is an important public health problem in many regions of the
world, not only in tropics and subtropics. As scorpions may be unintentionally transported to any place in the
world and keeping scorpions as pets is becoming more popular, scorpion stings occur also in Poland. Therefore,
health professionals should have the knowledge on the management of scorpion stings. This article discusses a
case who was stung by scorpion and proposes an algorithm of management with such patients.
Key words: scorpion, scorpion sting, anti-scorpion venom serum
INTRODUCTION
Scorpion stings pose a considerable threat for public
health in many regions of the world, especially in lessdeveloped countries of tropics and subtropics. A list
of high risk areas includes: Saharan Africa, Sahelian
Africa, South Africa, the Near and Middle East, South
India, Mexico, and South Latin America, to the east of
the Andes. Cumulatively, a total of 2.3 billion persons
are exposed to scorpion stings. Furthermore, scorpions
inhibit also the south areas of the Unites States and
Southern Europe. An estimated 1.2 million persons are
stung by scorpion per year. Of them, ca 3,250 persons
(0.27%) die. In fact, an actual incidence is unknown as
the majority of scorpion stings occur in less-developed
countries, in remote rural areas, jungles and deserts,
remaining unreported. Furthermore, scorpion stings are
not subject to notification (1,2).
As scorpions may be unintentionally transported
to any place in the world with air, sea luggage or food
transportation and their popularity as pets is on the
increase, the natural range of scorpion distribution is
becoming blurred. In Poland, a group of hobbyists
concentrated around the website: www.scorpiones.pl
is composed of more than 500 active users. Relevance
of the problem is confirmed by periodic news in media
with the examples being: appearance of scorpion in psychiatric ward of hospital in Bolesławiec in Septemebr
2013 and subsequent evacuation of patients and finding
a scorpion of the genus Centruroide in a parcel with
clothing bought online by a female living in Warsaw
in October 2013.
CASE PRESENTATION
On 8th May 2006, a 22-year-old female, A.M., living
near Łańcut, was transported by ambulance in evening
hours to the admission room of the infectious diseases
ward in Łańcut. Following evening bath, the patient
left shower stall and stood on clothing on the floor with
her bare feet. Then, she experienced a painful sting in
the shin. Having searched the clothing, a scorpion was
found and catched. A previous day, patient’s mother
bought garden soil and potted plants on the market
stall. Then, she placed it in the boxes on the bathroom’s
windowsills.
On admission, patient complained of severe stinging, stabbing pain of the shin and pain sensation following skin-clothing contact. There were no signs of respiratory or cardiovascular distress. Examination revealed
pallor, sweating, accelerated heart rate of 120/min
and increased blood pressure of 160/90 mm Hg. At
the site of sting, hard, painful and red swelling with a
tendency to extend was reported. Stress of the physician
on duty was intensified by the fact that the patient was
6 months pregnant.
A standard symptomatic treatment was initiated,
assuming that in addition to inflammation and pain,
anaphylactic reaction may occur. Intravenous access
686
was obtained. Patient was administered hydrocortisone,
calcium, analgesics and 0.9% NaCl. Ice was applied to
the sting site. It was changed systematically. Furthermore, an obstetrician was consulted. Examination and
CTG did not reveal any direct threat to the life of foetus.
Physician on duty consulted via telephone a physician at the tropical diseases ward and gynecology &
obstetrics at the Institute of Maritime and Tropical Medicine in Gdynia. Patient’s management was approved by
the consulting physician. Furthermore, he informed that
the Institute of Maritime and Tropical Medicine did not
have antivenom. He suggested, however, that zoological
gardens in Wrocław, Płock, Łódź and the Institute of
Tropical Medicine in Hamburg could have it. He gave
telephone numbers to aforesaid institutions. Irrespective of multiple attempts, however, none of them was
contacted as these telephone numbers were inactive at
night hours. Later telephone calls revealed that Polish
zoological gardens did not have antivenom. Due to the
relatively good general health of patient and predicted
difficulties and long time required to transport the serum
from Hamburg, it was decided not to contact the Vaccine
and Serum Research Institute there.
General health of patient and foetus was stable.
Within a few days, it was systematically improved.
Patient was discharged after 3 days of hospitalization
in good general health and with considerably smaller
local skin reaction. Three months later, she delivered
a healthy, full-term boy. Any visible sequelae of this
incident to a newborn were reported.
Figure 1. Scorpion, which was delivered to hospital in a
closed glass container, was transported to a professional terrarium.
EMERGENT MANAGAMENT
A case discussed constitutes a reason for whose
healthcare workers in Poland should know the consequences of scorpion stings and the principles of man-
No 4
agement of such patients. It also confirms that such information should be easily accessible, e.g. on websites.
Of 1,500 scorpion species, exclusively 50 are considered to be dangerous for humans. All of them, except
for Hemiscorpius, belong to the family of Buthidae.
Generally, scorpions are not aggressive. They do not
hunt for prey but wait for it. They are active at night.
Thus, scorpion stings in humans are primarily due to
accidental contact when scorpion is touched or stepped
on. Usually, feet or hands are sting sites (2,3).
Scorpion venom is a water-soluble, heterogenous
mixture of multiple toxins and other compounds. It
contains neurotoxins, cardiotoxins, nephrotoxins, hemolytic toxins, phosphodiesterases, phospholipases, hyaluronidases, glycosaminoglycans, histamine, serotonin,
tryptophan and cytokine releasers. The most important
effects of envenomation refer to neuromuscular system and autonomic nervous system. Scorpion venom
modifies the function of ion channels, especially sodium
channels by maintaining sodium channels open and subsequently leading to prolonged neuron hyperexcitability.
Consequently, it affects neuromuscular system and
hinders normal transmission of nerve impulses. Then,
it contributes to an excessive release of neurotransmitters such as epinephrine, norepinephrine, acetylcholine,
glutamate and aspartate. Concomitantly, short-chain
polypeptide neurotoxin blocks potassium channels (4).
Furthermore, serotonin, which is present in venom,
triggers severe pain. Effects of venom are of reversible
and finite nature. Duration of venom activity, however,
depends on the quantity of venom injected, sting site
and human’s individual susceptibility (4,5).
Dependent on the species, scorpion sting may cause
a multitude of symptoms, ranging from mild, temporary
local reactions to multiple organ failure (4,5).
Fatal cases due to scorpion sting result most commonly from respiratory or cardiovascular failure within
24 hours following sting. The highest risk of death is
observed in children and the elderly, i.e. ca 20%, 10%
and 1% in untreated small children, school children
and adults, respectively. Disparities in envenomation
course result from individual genetic predisposition.
No race-related differences are observed (1).
Following scorpion sting, a sharp, severe, burning
pain at the sting site is reported. It lasts for 30 minutes
and may be accompanied by local inflammation and
tissue swelling. Other symptoms occur 30 minutes or
even 4-12 hours following sting. Their severity progresses within 24 hours. These are: paresthesia, burning and stabbing sensation in the region of hands, feet,
face and scalp, skin hypersensitivity to contact with
clothing and bedclothes and sound hypersensitivity.
Furthermore, ataxia, failure of muscular coordination,
abnormalities of gait, involuntary movements, tremor
and muscle weakness are reported. Heart rate increases
No 4
Emergent management of scorpion sting
up to 100-150 beats per minute, especially in case of
Parabuthus granulatus while it decreases below 50/
min with Parabuthus transvaalicus envenomation.
Increased heart rate is accompanied by an increase of
blood pressure. Furthermore, dysphagia, speech disorders, excessive sweating, headache, nausea, vomitting,
diarrhea, ptosis, retention of urine, finally respiratory
disorders which may lead do death are observed (3).
Venom of Hemiscorpius may result in severe haemolysis. High concentration of venom may also lead
to severe coagulopathy (5).
Due to possible occurrence of scorpion stings in
our latitude, the authors of the present paper propose
an algorithm of management with such patients and
principles of hospital care.
Emergent management:
1. Assessment of the airway, breathing and circulation
(ABC algorithm).
2. Venom extraction from the sting site using suction
mini pumps (Aspivenin, Venimex) applied in case
of insect stings. Effectiveness of such method has
not been analyzed. It is not allowed to extract the
venom by mouth.
3. Application of ice to the sting site is recommended.
4. Intubation and IV access, if necessary.
5. Detailed review of the medical history; if it is feasible, a scorpion should be preserved to determine
its species, such information is required to select
proper antivenom (5)
In-patient hospital care
In all cases, symptomatic treatment should be initiated. Administration of venom is required in severe
cases. To assess the severity of symptoms, specific
scales are employed (i.a. envenomation severity scale
for Centruroides, HECTOR Emergency Scale for Androctonus australis and others).
As clinical symptoms and their severity may differ, it is required to monitor the patient to identify
life-threatening symptoms. Of importance is to ensure
a patent airway and homeostasis functions. Antivenom
should be administered and symptomatic treatment
should be initiated provided it is required.
Local treatment consists in applying ice to the sting
site, immobilization of extremity and positioning it below the heart line to limit the spread of venom; calming
the patient (high blood pressure and tachycardia accelerate the distribution of venom). An injectable or topical
anesthetic may be applied to the region of sting site. In
case of possible infection, local or systemic administration of antibiotics may be used. If recommended, tetanus
prophylaxis and muscle relaxants for severe muscle
spasms should be administered (5,7).
If local treatment is not sufficient enough and
general symptoms occur, a patent airway should be
687
established and, if necessary, intubation or mechanical ventilation should be applied. Of importance is to
establish ventilation and perfusion equal to the needs
of patient. Patient should be routinely monitored while
unstable patient should be monitored using invasive
methods. Passive or active oxygen therapy should be
initiated. For hypercapnia, intubation or mechanical
ventilation are to be instituted. Intravenous administration of fluids should be applied to prevent hypovolemia
resulting from vomiting and diarrhea (5).
Occurrence of hyperdynamic cardiovascular
symptoms (tachycardia, hypertension) requires expert
administration of a combination of beta-blockers with
alpha-adrenergic-antagonists. Beta-blocker-based monotherapy should be avoided to prevent alpha-adrenergic
effect. In case of hypertension and myocardial ischemia,
nitrates (nitroglycerin, sodium nitroprusside) may be
applied (6,7).
In case of hypodynamic symptoms, fluid infusion
is applied with afterload reduction using drugs such as
prazosin, nifedipine, sodium nitroprusside, hydralazine,
or angiotensin-converting-enzyme inhibitors. Prazosin
is a drug whose effectiveness is documented to the largest extent. It is a cheap drug. Furthermore, contrary to
antivenom, it is available even in poor regions of the
world. In contrast to antivenom, it is of cardioprotective
effect. It also prolongs patient’s survival (6-9).
Digitalis is of no clinical effect while dopamine
aggravates the damage of cardiac muscle. To obtain
optimal inotropic effect, dobutamine is used. If effect is
too weak, norepinephrine should be administered (6,7).
Atropine should be applied to prevent the symptoms
of excessive activity of parasympathomimetic nervous
system.
Novel data suggest that insulin may be used for the
purpose of enhancing the tissue metabolism. These reports, however, are not confirmed by studies on humans.
Provided a patient is excessively stimulated, barbiturates
and benzodiazepines should be administered. Benefits
resulting from the administration of steroids aimed at reducing shock and swelling have not been proven (6,7,8).
Administration of antivenom is the treatment of
choice in severe envenomation. Due to disparities in
venom composition of scorpions belonging to particular
species, administration of proper antivenom is required. Thus, it is very important to catch and preserve
scorpion for its identification. Attempts to produce
one antivenom which would have an effect of venoms
of several scorpion species are undertaken. So far, no
human studies have been conducted in this respect.
Another difficult issue consists in determination of
proper dose of antivenom – too small doses would not
ensure a desired effect while overdosing may lead to
hypersensitivity (6-9).
688
Administration of antivenom reduces the concentration of circulating venom within a few hours. It
does not, however, neutralize toxins which are already
bound to organ receptors. Therefore, administration of
antivenom is applied concomitantly with symptomatic
treatment (8-11).
Severe neurologic symptoms disappear within
15-30 minutes after administration of antivenom to
Centruroides venom while other symptoms resolve
in 45-90 minutes. Having considered antivenom to
non-Centuroides venoms, severe pain reverse in the
first hour; other symptoms such as agitation, sweating
and hyperglycemia disappear within 6-12 hours while
cardiovascular symptoms - 6-24 hours following antivenom administration (10,11).
Compared to other antivenoms, occurrence of
anaphylactic reaction following administration of antiscorpion venom serum is considerably less probable.
It results from a large release of endogenous catecholamines induced by scorpion venom toxins .
In countries, where scorpion stings are reported
frequently, antivenom is available in poison centres
which are localized in large cities. In the United States
and Mexico, Anascorp (RDT) is used. Pursuant to producer’s instructions, initial dose of Anascorp is 3 vials
which should be administered as soon as possible after
scorpion sting, i.e. within 10 minutes. Provided symptoms are still present, additional doses may be used at
intervals of 30 to 60 minutes. Other antivenoms are also
available with the examples being Scorpion Antivenom
Product in the Kingdom of Saudi Arabia and Scorpion
Antivenom in the Republic of South Africa [10, 11].
From the telephone interviews performed by the
authors transpires that currently no zoological gardens
in Poland have anti-scorpion venom serum. Thus, in
case of scorpion sting exclusively symptomatic treatment may be initiated.
No 4
REFERENCES
1. Cheng D., Alcock J. Scorpion Envenomation, emedecine.
medscape.com/article/168230
2. Chippaux J.P., Goyffon M. Epidemiology of scorpionism:
A global appraisal, http.dx.doi.org/10.1016/j.actatropica.2008.05.021
3. Larsen N. Scorpion stings and venoms, www.biodiversityexplorer.org/arachnids/scorpions, The web of life in
Southern Africa
4. Auerbach P. Scorpion envenomation, Wilderness Medicine, Sixth edition, Chapter 53, 996-1011 e.4
5. Pełka G. Postępowanie po ukłuciu przez skorpiona, www.
scorpiones.pl
6. Thirunavukkarasu A B, Chandrasekaran V. Efficacy
of anti-scorpion venom serum over prazosin in severe
scorpion envenomation: Is the current evidence enough?.
J Postgrad Med 2011;57:83-4
7. Bawaskar HS, Bawaskar PH. Indian red scorpion envenoming. Indian J Pediatr 1998;65:383-91. 8. Mahadevan S. Scorpion Sting. Indian Pediatr
2000;37:504-14
9. Bawaskar HS, Bawaskar PH. Utility of scorpion antivenin vs prazosin in the management of severe Mesobuthustamulus (Indian red scorpion) envenoming at rural
setting. J Assoc Physicians India 2007;55:14-21.
10. Bond GR. Antivenin administration for Centruroides
scorpion sting: Risks and benefits. Ann Emerg Med
1992;21:788–791
11. Bernstein J N. Antidotes in Depth, Antivenom (Scorpion
and Spider), The Clinical Basis of Medical Toxicology,
Goldfrank’s Manual of Toxicologic Emergencies,.The
McGraw-Hill Companies, Inc., USA, 2007; 1623-1628.
Accepted for publication:22.09.2014
Jolanta Kluz-Zawadzka
Słoneczna 17, 37-100 Łańcut
Public health
Izabela Strużycka1, Ewa Rusyan2, Agnieszka Bogusławska-Kapała1
PREVALENCE OF DENTAL EROSION IN YOUNG ADULTS AGED 18 YEARS
IN POLAND
1. Department of Integrated Dentistry, Warsaw Medical University
2. Department of Conservative Dentistry, Warsaw Medical University
ABSTRACT
AIM. The aim of this study was to assess the prevalence of tooth wear in young adults in Poland.
METHODS. A total of 1,886 persons aged 18 years, selected on a basis of multistage sampling, were examined
within the Nationwide Dental Health Monitoring Programme. Previously calibrated dentists measured tooth wear
using the BEWE-scoring system (Basic Erosive Wear Examination).
RESULTS. Out of 1,886 young adults, 42.2% presented the signs of dental erosion. Considered the severity of
erosion, it was graded as 1, 2 and 3 in 28.9%, 11.9% and 1.5% of 18-year-olds, respectively.
CONCLUSIONS. Results of clinical assessment of dental erosion in 18-year-old young adults revealed that
erosive tooth wear is an important problem in this age group. Of them, 13.4% had signs of advanced tooth wear
which may lead to serious clinical problems in the future.
Key words: epidemiology, tooth wear, young adults
INTRODUCTION
Recent changes in the lifestyle, eating habits,
personal hygiene, which are observed in developed
countries, resulted in an increased number of patients
presenting non-carious lesions of dental hard tissues.
There was a considerable increase in the consumption
of acidic foods and beverages. It refers to the amount as
well as the frequency of their intake. An increase in the
consumption of acidic beverages is especially reported
in a group of children and school children. Due to difficulties in conducting further studies on the prevalence
of erosion, there is an appreciable disparity in the results presented in the literature of Western countries.
An estimated 6 – 50% of children aged between 2-5
years presented erosion on deciduous teeth. Of children
aged between 5 and 9 years, nearly 14% had erosion on
permanent teeth. Prevalence of erosion in adolescents
(9-17 years) ranged from 11 to 100% (1).
Available data suggest limited knowledge on dental
erosion in a group of young patients. From one of the
English studies, published in 2003, transpires that only
34% of children were aware of the problem of dental
erosion. Of them, 40% considered regular tooth brushing to be the most effective method of erosion preven-
tion. Only 8% of examined children were informed of
this issue by their dentists (2). Many factors may affect
such situation, including i.a. information deficiency,
in comprehension of this problem and low quality of
health education. Dental personnel and patients seem to
be still inadequately informed on dental erosion.
Dental erosion is one of the non-carious lesions
of dental tissues. Destructive processes affecting teeth
include abrasion, attrition, abfraction and erosion. Abrasion is defined as a mechanical process of wearing away
enamel or dentine resulting from tooth to foreign body
or external substance contact. Strenuous and incorrect
brushing, especially accompanied by the use of hard
toothbrush and high-abrasive toothpaste (e.g. toothpaste
for smokers, whitening toothpaste) is the common reason of abrasion. According to widespread hypothesis,
excessive stress along tooth’s vertical line may be a
reason of straining in the region of tooth cervix which
is frequently referred to as cementoenamel junction.
Consequently, it may lead to microfractures and loss of
tissues in this region. Such type of dental hard tissues
wearing is called abfraction. Attrition is the successive
form of enamel wearing which occurs frequently. It
consists in direct, tooth to tooth contact without any interactions with foreign bodies. It may be a consequence
690
Izabela Strużycka, Ewa Rusyan, Agnieszka Bogusławska-Kapała
of parafunctional activity (bruxism) which is manifested
by unintentional teeth grinding and gnashing, mainly
while sleeping. Erosion is defined as the loss of dental
hard tissues which is attributed to acidic substance or
chelating agent effect. Acidic substances may be extrinsic or intrinsic and have an effect on plaque-free tooth
surfaces. In contrast to caries, acidic substances are not
produced by bacteria. Furthermore, any microorganisms
are involved in the process of erosion (3-5).
In the early stages of erosion, the enamel surface of
frontal teeth is smooth and glazed. Glossy areas which
may become concave over time also appear. Such appearance is also observed in lateral teeth. In the later
stages of erosion, cupping and grooving on occlusal
surfaces of molar and premolar teeth are reported.
Tooth cusps may become rounded and cupped lesions
may appear on occlusal surfaces. Provided there are
restorations in teeth, they rise above the level of the adjacent tooth surfaces. Usually dentine is exposed which
appears as dark-yellowish areas. Patients who visit
dentist complain frequently of dentine hypersensitivity
or defects of cosmetic significance. In the most severe
erosion cases, the whole enamel surface and partially
the dentine may be destroyed.
As mentioned previously, acidic substances reduce
the microhardness of enamel. Due to the significant loss
of mineral content, dental hard tissues show decreased
resistance to physical factors. Soft surface of tooth,
which was exposed to the effect of erosive factors, is
more prone to wearing. Consequently, erosion is often
accompanied by atrition, abrasion and abfraction. Simultaneous appearance of different non-carious defects
hinders their clinical assessment. Therefore, the term
proposed by Lussi et al. is more frequently used, i.e.
‘erosive tooth wear’ (6).
General health or the presence of some diseases may
have a significant impact on progression and course
of dental erosion. Diseases accompanied by reduced
salivary secretion are of special importance here. Typical reasons of hyposalivation are diseases of salivary
glands (inflammation of salivary glands, sialolithiasis
and some other diseases). Reduced salivary secretion is
observed in patients diagnosed with diabetes (especially
uncontrolled type 1 diabetes), autoimmune disease
(Sjogren’s syndrome, sarcoidosis, rheumatoid arthritis),
depression, bulimia, anorexia nervosa and nutritional
deficiencies (vitamin B, A and iron deficiencies) (7,8).
Reduced salivary secretion appears as a side effect
of the treatment of head and neck cancers as these areas
are exposed to radiation therapy. Most severe cases of
hyposalivation are reported in patients treated with
such method. In case of these patients, dental erosion
progresses due to oral dryness as well as radiotherapyinduced changes of dental hard tissues. It should be also
No 4
noted that reduction of salivary secretion is observed as
drug side effects in case of many diseases.
Gastric acid, whose pH level is less than 1.5, is
another important intrinsic cause of erosion. Erosive
lesions caused by gastric acid may be observed in patients suffering from dysfunctions of lower esophageal
sphincter, cardia or hiatus hernia. Patients with motor
disorders of lower esophageal sphincter experience the
episodes of regurgitation of gastric contents (gastrooesophageal reflux disease). The most common symptoms of reflux are: heartburn, eructation, odynophagia,
chest pain, nausea and vomiting. Regurgitated gastric
contents firstly affect palatal surfaces of incisal teeth
while in more severe and chronic cases - palatal surfaces
and cusps of molar and premolar teeth (9).
Other, commonly reported reasons of dental erosion
are eating disorders accompanied by vomiting, including bulimia and anorexia nervosa. In patients suffering
from bulimia, erosive lesions appear mainly on the
palatal surfaces of incisal teeth as well as buccal and
occlusal surfaces of lower molar and premolar teeth.
Dental erosion is also a common phenomenon in
patients with alcoholism. Reasons of erosion in alcoholics are: gastro-oesophageal reflux, unhealthy diet,
dehydration and vomiting. In this group of patients,
attrition is also reported, i.e. pathologic wear of teeth
associated with bruxism (10). Higher risk of dental erosion occurrence is also observed in pregnant females.
It results from the modifications of diet and vomiting,
especially noted in the first trimester of pregnancy.
Relation between dental erosion and gastro-oesophageal reflux disease, bulimia and other disorders
consisting in regurgitation of gastric contents is well
documented. Such disorders are not common reasons
of erosion, however, if they occur, tooth wear is more
severe and consequently hard to heal. In such cases,
cooperation between dentists and physicians of different
medical specialties is required.
This study aimed at assessing the occurrence of noncarious lesions due to erosion in young adults in Poland.
Clinical assessment of dental erosion in the population of 18-year-olds in Poland was conducted within the
Nationwide Dental Health Monitoring Programme in
2012. Overall, 1,886 persons were recruited, including
956 females and 930 males. Approximately 55.3% of
participants were living in urban areas. Dentition was
assessed using the criteria of BEWE-scoring system
(Basic Erosive Wear Examination). Presence of noncarious, erosive lesions was observed on labial/buccal,
lingual/palatal and occlusal surfaces of all teeth, excluding third molars. Visual inspection was conducted in
No 4
691
Prevalence of dental erosion in young adults
six sextants into which oral cavity and dentition were
divided: 17-14, 13-23, 24-27, 37-34, 33-43, 44-47.
BEWE-scoring system is composed of four levels of
erosion severity: 0 (no wear), 1 (early surface loss),
2 (surface loss < 50%) and 3 (surface loss > 50% in
sextant examined) (11). RESULTS
Clinical assessment showed that non-carious,
erosive lesions of dental hard tissues were reported in
nearly 42% of 18-year-olds. Initial lesions of enamel
surface appeared more frequently in males (29.1%)
compared to females (28.6%) likewise other types of
lesions according to BEWE-scoring system. Lower
percentage of persons with initial enamel changes was
reported in persons living in rural than urban areas.
More advanced changes in dental hard tissues involving less than 50% of tooth surface were noted in
11.9% of examined persons living in urban areas. Such
lesions were more frequently observed in males (14.5%)
than females (9.3%). Advanced changes on examined
tooth surfaces were rarely noted. Its distribution did not
exceed 1.5% of the population of young adults (Table I).
commonly noted in Kujawsko-pomorskie (45.2%) and
Lubelskie (41.8%) provinces. In Kujawsko-pomorskie
province, the most frequent changes observed were
those graded as 2. In the majority of provinces, low
percentage of examined persons with BEWE=3 (0.3%0.5%) was reported. The highest value of BEWEscoring system, i.e. BEWE=3, for whose typical is the
extensive tissue loss, was observed in 8.3% of examined
persons exclusively in Mazowieckie province while
no persons with advanced, non-carious lesions were
reported in two provinces.
DISCUSSION
In recent years, interest in non-carious lesions,
especially those resulting from erosion has raised.
Compared to the erosion prevalence specified in Polish
literature, its value obtained in studies conducted within
the Nationwide Dental Health Monitoring Programme
was higher (12,13).
Study conducted by Waszkiel in 2000 in a group
of 540 persons revealed that the prevalence of erosion
differ significantly with regard to age and place of residence. The highest percentage of persons with erosion
Table I. BEWE-scoring system values in persons aged 18 years, recorded within the Nationwide Dental Health Monitoring
Programme in 2012.
BEWE = 0
BEWE = 1
BEWE = 2
BEWE = 3
males
54.3%
29.1%
14.5%
2.0%
females
urban area
rural area
Total
61.0%
55.7%
60.2%
57.7%
28.6%
30.5%
26.9%
28.9%
9.3%
12.0%
11.7%
11.9%
1.0%
1.8%
1.2%
1.5%
Comparison
(chi-squared test)
p < 0.001
p = 0.17
BEWE - Basic Erosive Wear Examination.
Table II. BEWE-scoring system values in persons aged 18 years, recorded within the Nationwide Dental Health Monitoring
Programme in 2012 in seven selected provinces.
Provinces
Dolnośląskie
Kujawsko-Pomorskie
Lubelskie
Lubuskie
Mazowieckie
Podkarpackie
Warmińsko-Mazurskie
Comparison (chi-squared test)
Total
BEWE = 0
BEWE = 1
BEWE = 2
BEWE = 3
52.0%
30.1%
51.8%
68.7%
65.7%
88.8%
56.5%
32.8%
45.2%
41.8%
22.2%
11.7%
10.8%
31.8%
15.2%
24.4%
6.1%
8.6%
14.3%
0.4%
11.4%
0
0.3%
0.3%
0.5%
8.3%
0
0.3%
57.7%
28.9%
11.9%
1.5%
p < 0.001
Table II presents the values of BEWE-scoring system in persons aged 18 years noted in seven selected
provinces. The highest number of young adults who
scored BEWE=0, i.e. no wear was reported in Podkarpackie province. Initial enamel changes were most
was reported in the age groups 25-30 years (19.44%)
and 18-20 years (15%) while the lowest in the age group
35-44 years (6.11%). Persons living in large urban areas
were exposed to erosive factors to the largest extent. In
the age group 18-24 years, erosive changes appeared in
692
Izabela Strużycka, Ewa Rusyan, Agnieszka Bogusławska-Kapała
33.33% of examined persons (12). The present study
suggest higher values of erosion prevalence (44%).
From the observation on the prevalence of noncarious lesions in the population of Cracow transpires
that relatively low percentage of persons presented the
symptoms of dental erosion. They were mainly reported
in elder persons while in the age group 15-18 years it
was assessed at 2.4% (13). The results of the Nationwide Dental Health Monitoring Programme suggest
that the prevalence of erosion in adolescents increased
significantly in the last decade.
Erosive lesions of dental tissues were observed in a
significant percentage of persons aged 18 years (42.3%).
Its value was considerably higher compared to the one
noted in adolescents aged 15 years (24.7%), population
examined in 2011 (15). The most common were initial
enamel changes which did not require invasive treatment. Advanced enamel changes (13.4%) suggested the
necessity for adherence to dietary and hygiene recommendations with the objective to increase the resistance
of dental tissues to acidic substances, monitoring the
patient, attending visits every 6-12 months and in many
cases considering reconstructive treatment of teeth.
Facts that nearly a half of young adults had at least one
tooth with erosive lesions and that such problem is noted
in younger persons in Poland raise concerns.
Similar observations were made in many European
and American countries. Their results unequivocally
suggest that the prevalence of erosion, especially in
adolescents is on the increase. It is mainly attributed
to the changes in lifestyle, eating habits and personal
hygiene.
Prevalence of dental erosion in the population of
18-year-olds is comparable to the one described in
foreign literature. From studies conducted in Oslo,
Norway transpires that more than 54% of population
at this age had dental erosion (15). Similar results are
reported by Bartlett et al. on the basis of European studies conducted in seven countries in a group of 3,187
persons aged 18-35 years. BEWE-scoring system equal
to 0 was reported in 42.9% of examined persons. In the
remaining persons, changes which did not exceed 50%
of tooth surface were predominant (BEWE=1 - 27.7%
and BEWE=2 – 26.1%) (16). Considerably higher
prevalence and severity of non-carious lesion was suggested in the Swedish studies conducted in a group of
young adults aged 20 years. Of them, 75% had signs of
non-carious lesions which represents an exceptionally
adverse phenomenon in such young age group (17).
Dental erosion is a widespread phenomenon in
highly developed countries. However, the comparison
of epidemiological studies results is hindered by the
use of different standards, calibration and indices as
well as heterogeneity of groups studied. Independent
observations are of special importance to identify the
No 4
threats and determine the trends as to initiate adequate
prophylactic measures. An increase in the prevalence of
dental erosion implies that there is a necessity to implement widespread education and prophylactic actions.
Severe dental changes are associated with irreversible
dental tissue lesions and consequently require expensive
and long-term treatment aiming at restoring the function
and aesthetics of dentition.
CONSLUSIONS
Erosive tooth wear is reported in a significant percentage of examined persons aged 18 years in Poland
with males predominated over females.
In the recent decade, an increase in the prevalence
of dental erosion, especially in adolescents, is observed.
REFERENCES
1. T Jaeggi, A Lussi. Prevalence, Incidence and Distribution
of Erosion, Lussi (ed): Dental Erosion. Monographs in
Oral Science. Basel, Karger 2006; 20: 44-65. Based: T
Jaeggi, A Lussi: Prevalence, Incidence and distribution
of Erosion. Monogr. Oral Sci. Basel, Karger 2006; 20:
44-63.
2. S Moss. Dental Erosion. Inter Dental J 1998; 48: 529-539.
3. M Addy, R P Shellis. Interaction between Attrition,
Abrasion and Erosion in Tooth Wear, Lussi (ed): Dental
Erosion. Monographs in Oral Science. Basel, Karger
2006; 20: 17-31.
4. S Brauman-Furmanek. Ubytki niepróchnicowego pochodzenia, w: Kariologia współczesna, postępowanie
kliniczne, praca zbiorowa (ed): D Piątowskiej. Med Tour
Press International 2009: 349-355.
5. C Ganss. Definition of Erosion and Links to Tooth Wear,
Lussi (ed): Dental Erosion. Monographs Oral Science.
Basel, Karger 2006; 20: 9-16.
6. A Lussi. Dental erosion. From diagnosis to therapy.
Monographs in Oral Science. GM Whiteford. Vol 20 .
7. B Gandara, E Truelove. Diagnosis and Management of
Dental Erosion. J. Contemp. Dent. Pract. 1999; 1: 16-23.
8. B Nauntofte, J Tenovuo, F Lagerlöf. Wydzielanie i
skład śliny. W: Próchnica zębów. Choroba próchnicowa
i postępowanie kliniczne (ed): O Fejerskova i E Kidd.
Wyd Med Urban & Partner 2006: 5-28.
9. D Barlett. Intrinsic Causes of Erosion, Lussi (ed): Dental
Erosion. Monographs in Oral Science. Basel, Karger
2006; 20: 117-139.
10. K Gibiński, E Nowakowska-Duława. Choroby przełyku,
w: Choroby wewnętrzne, praca zbiorowa pod red. F
Kokota. Warszawa: PZWL 2001: 257-271.
11. D Bartlett, C Ganss, A Lussi. Basic Erosive Wear Examination (BEWE): a new scoring system for scientific
and clinical needs. Clinical Oral Invest 2008;12:65-68.
12. D Waszkiel. Nadżerki nietypowe szkliwa-etiopatogeneza,
klinika i zapobieganie w świetle badań własnych. Ro-
No 4
Prevalence of dental erosion in young adults
zprawa habilitacyjna. Akademia Med. Bialostocensis,
Białystok 2000.
13. D Fijał, A Kaczmarczyk-Stachowska, Z KnychalskaKarwan, M Chomyszyn-Gajewska, M Ciesielska, B
Gawrzewska, H Kwapińska, A Sendur. Występowanie
ubytków niepróchnicowego pochodzenia w populacji
wieku 15-80 lat w Krakowie. Czas Stomat 2001;
54(10):636-641.
14. M Wierzbicka, F Szatko, I Strużycka, E Rusyan, M
Ganowicz, M Zawadziński, A Garus-Pakowska. Stan
zdrowia jamy ustnej i jego uwarunkowania oraz potrzeby profilaktyczno-lecznicze dzieci wieku 5,7,15 lat.
Monitoring Zdrowia Jamy Ustnej 2011. ISBN 978-837637-115-3.
15. A Mulic, R Skudutyte-Ryssstad, AB Tveit, AB
Skaare. Risk indicators for dental erosive wear among
18-yr-old subjects in Oslo, Norway. Eur J Oral Sci
2012;120(6):531-538.
693
16. DW Bartlett, A Lussi, NX West, P Bouchard, M Sanz, D
Bourgeois. Prevalence of tooth wear on buccal and lingual surface and possible risk factors in young European
adults. J Dent 2013;41(11);1007-1013.
17. H Isakssen, D Birkhed, LK Wendt, A Alm, M Nilsson, G
Koch. Prevalence of dental erosion and association with
lifestyle factors in Swedish 20-year olds. Acta Odontol
Scand, 2013, Nov 28.
Assoc.prof. Izabela Strużycka
Department of Integrated Dentistry
Medical University of Warsaw
Miodowa 18, 00-246 Warsaw
Tel. 22 502 20 32
History of medicine
Marta Gromulska
LUDWIK HIRSZFELD IN THE NATIONAL INSTITUTE OF HYGIENE
IN 1920-1941
Department of Epidemiology of the National Institute of Public Health-National Institute
of Hygiene, Warsaw, Poland
ABSTRACT
In this year, we commemorate the 130th anniversary of birth and 60th of death of Ludwik Hirszfeld, a prominent Polish scientist. Since 1920, he was the head of the Department of Bacteriology and Experimental Therapy
of the National Institute of Hygiene (NIH). During the absence of Ludwik Rajchman in Poland, who was assigned to the League of Nations, he was a factual director of the NIH. Ludwik Hirszfeld governed the scientific,
organizational and didactic activities in the Institute. Concurrently, he collaborated with research centres abroad,
especially within the field of public health. Mission of the NIH was concentrated on a broadly defined issues
aimed at combating infectious diseases, initiating and developing the production of sera and vaccines, their
controlling and introducing to the country as well as training health care personnel.
INTRODUCTION
Prior to the First World War, Ludwik Hirszfeld
stayed abroad, where he worked in different research
centres. In 1907-1909, he was an assistant in the Department of Parasitology at the Cancer Research Centre
in Heidelberg while in 1909-1911 in its Serologic Department. Ludwik Hirszfeld was a co-discoverer (with
Emil von Dungern) of blood group inheritance; he also
determined their nomenclature: A,B,AB, 0 (1911). He
established a new discipline: seroanthropology by predicting and analyzing serologic conflict between mother
and foetus. Until 1920, he held the position of assistant
in the Faculty of Hygiene at the University in Zurich,
where in 1914 he habilitated on hygiene and immunity
(relation between immunological response and blood
coagulability). In 1915, he was granted a military leave
for participation in typhus epidemic control in Serbia.
On the Macedonian front line, he established and managed microbiological laboratory and trained personnel
to combat infectious diseases.
In this period, he discovered paratyphoid fever
bacillus C, referred to as Salmonella hirszfeldi.
At the beginning of 1920, the National Department of
Sera and Vaccines Evaluation at the NIH was established,
modelled on the Ehrlich’s Institute for Experimental
Therapy in Frankfurt am Main. Ludwik Hirszfeld was
appointed to be the head of this Department.
Initially, the National Department of Sera and Vaccines Evaluation was an independent unit, in which
sera and vaccines produced in the NIH and private
factories were tested. In 1925, it was merged with the
Department of Bacteriology, forming the Department
of Bacteriology and Experimental Therapy of the NIH
which was in charge of Ludwik Hirszfeld. In the subsequent years, the following departments were formed:
Microbiological Diagnostics, Serum Evaluation, Parasitology and Vaccine Evaluation. Each of the departments
conducted researches into different pathogen species,
causing infectious diseases, isolated during epidemics,
including typhus, typhoid fever, dysentery, diphtheria,
scarlet fever, syphilis. Research findings were used in
the diagnosis of these diseases, description and control
of epidemics and production of sera and vaccines.
NIH AS A RESEARCH CENTER IN CHARGE
OF HIRSZFELD
“I have achieved what I dreamt of: I could work for
the country, possessing the most beautiful apparatus
which Polish researcher have ever had at disposal” (1,
p.118).
Ludwik Hirszfeld managed the scientific activities
of the NIH, using but also introducing new discoveries
in the field of microbiology and immunology. He be-
696
No 4
Marta Gromulska
lieved that a magnitude of practical tasks in the Institute
hindered “…establishment of research centres, creativity and disinterested curiosity, required for theoretical
work…” (2).
“Entirely pure science, without applied science, is
impossible in institutes like ours as they serve for direct
sanitary tasks: they have to form scientific basis for
health protection” (1, p.160). Ludwik Hirszfeld decided
to complete such tasks.
In the “Report on scientific activities of the National
Institute of Hygiene and National Department of Sera
and Vaccines Evaluation in Warsaw (for the 5th anniversary of its establishment)”, L.Hirszfeld discussed
the activities undertaken by particular departments and
presented the possibilities of their development as well
as scientific progress of his colleagues (2).
In this period, researches were mainly focused on
typhus, typhoid fever, dysentery, diphtheria, scarlet
fever whose epidemics constantly occurred in Poland.
Having analyzed the blood smear of patients suffering from typhus, Ludwik Anigstein concluded that
band leukocytes in the first phase of disease accounted
for 30-45% of all white blood cells and its number was
decreasing in its second phase. Such phenomenon was
to serve as an indicator in the first phase of disease. He
also studied jaundice of non-bacterial origin.
In diphtheria laboratory, established in 1927, Julia
Seydel investigated biology and morphology of different strains of Corynebacterium diphtheriae and
their variability. In this laboratory, Ludwik and Hanna
Hirszfeld and paediatrician Henryk Brokman analyzed
the transmission principles of diphtheria and other childhood infectious diseases.
Stanisław Sierakowski with his assistants (H.
Rabinowiczówna, Z. Modrzewska, E. Salomonówna)
studied the effects of external conditions on bacterial
growth: thickness of culture medium, temperature,
medium Ph.
Helena Sparrow conducted researches on vaccines
against typhus and scarlet fever. It consisted in immunization by administering pathogen together with
convalescent’s serum.
Under guidance of Hirszfeld, researches on streptococci and their poisons were performed.
In this respect, Hirszfeld collaborated with dr Feliks
Przesmycki. He employed him in the Department of
Bacteriology and Experimental Therapy and appointed
him for the position of the head in the Microbiological Diagnostics. Dr Przesmycki carried out researches
on antisera in animals and production of antibodies,
pathogenesis of scarlet fever, diphtheria, pneumococcal
infections, virulence of bacillary dysentery.
Hirszfeld claimed that for bacteriologists the most
important tasks are to investigate the sensitivity and
variability of pathogens.
Feliks Przesmycki recalled that the years between
1925 and 1933 were the most creative in the scientific
activities of the NIH (3).
Researches conducted in the Department of Bacteriology and Experimental Therapy constantly referred
to the previous discoveries and Hirszfeld’s interest in
blood groups; biochemical, immunological and anthropological researchers were associated with serology.
Wanda Halberówna was the closest colleague of
Hirszfeld in this field. She studied serological groups
while during researches on cancer, commenced in the
NIH in the 30s, she was involved in the analysis of
antigenic properties of normal and cancerous tissues.
Hirszfeld expected that experimental studies on
cancerous tissues would result in receiving antiserum.
“Based on these experiments, I made an assumption
that morphological changes in blood may result from
the presence of immunity cells directed against different blood cells of somebody’s own body” (1, p.172).
Hirszfeld’s passion for ‘pure science’ did not affect
didactic activities within hygiene and epidemiology in
the branches of the National Hygiene School.
Training courses were the domain of the National
Hygiene School. For the successive decades, the authorities in the field of hygiene, social medicine, sanitary
administration, biochemistry, statistics, epidemiology,
occupational hygiene and sanitary engineering such
as Marcin Kacprzak, an incomparable propagator and
promoter of hygiene, Stanisława Adamowiczowa, an
expert in statistics and epidemiology of infectious disease not only in Poland but also in the whole Europe,
were trained in its branches.
LUDWIK HIRSZFELD AND HIS
COLLEAGUES IN THE NIH
Physician-biologists, pharmacists, chemists, laboratory technicians with practice in hospitals, who were
trained in foreign universities in the times of partition,
and frequently, as it was in case of Ludwik Hirszfeld,
also persons practising in microbiological laboratories and quarantine stations during and after the First
World War: Helena Sparrow, Feliks Przesmycki, Wiera
Głowacka, Józef Celarek were employed in the NIH.
In “The Story of One Life”, Hirszfeld recalled his
colleagues from the NIH as scientific elite:
Ludwik Anigstein – the first parasitologist in the
NIH, expert in subtropical medicine, Stanisław Sierakowski – an expert in microbiological methods, Marcin
Kacprzak – “hot heart and excellent pen” of professor
and promoter of hygiene, Brunon Nowakowski – a hygienist, expert in occupational hygiene, Stanisława Adamowiczowa – an activist of the international women’s
movement, Józef Lubczyński, Aleksander Szniolis – the
No 4
Ludwik Hirszfeld in National Institute of Hygiene in 1920-1941
best sanitary engineers in Poland, Edward Grzegorzewski – initially, a volunteer in the NIH, Rockefellerist,
co-founder of the WHO, Witold Chodźko – a director of
the National Hygiene School, Jerzy Morzycki – a good
organizer of the NIH branches, Tadeusz Sporzyński – a
head of factory producing cowpox. Following the Second World War, a number of these persons worked in
the NIH for many years and formed scientific personnel
at universities and medical academies.
A separate beautiful part of the NIH history was
made by the assistants of Ludwik Hirszfeld: Róża
Amzelówna, Helena Rabinowiczówna, Wanda Halberówna, Julia Seydel - colleagues and co-authors of
his publications.
Scientific climate in the NIH. The most important
task of a head is to create a climate. Not everyone can
do this. I attempted to create this internal climate for
20 years (1, p.151-152).
“….a head should not only propose subjects but also
make young persons to create them spontaneously. How
it should be done? A head should be delighted when a
young person figures out or discovers something. These
are the main tasks of head: to induce excitability in
young persons and be pleased with the results… Scientific climate disappears when the efforts of creative
spirit are no longer respected….”
Ludwik Hirszfeld perceived science as a “mystery
of scientific reasoning”, discerning a relation between
scientific and artistic creativity. He claimed that science
is an autonomous virtue and a good of universal nature.
He was open to course participants and volunteers
– e.g. in 1926-27, a total of 25 and 10 volunteers worked
in the Department of Bacteriology and Department
of Chemistry, respectively, of whom many were later
employed in the head office of the NIH or its branches.
Irrespective of the fact that training courses were
organized by the National Hygiene School, Ludwik
Hirszfeld predominated over other lecturers. He lectured, inspired, introduced the researches conducted in
the NIH to course participants. Of eight participants of
courses on bacteriology and immunization for officer
cadets of military reserve force in 1934, a few were
employed in the NIH - Kazimierz Lachowicz, Juliusz
Rychard, Leontyn Dmochowski, Wacław Mirkowski
(5), who committed their professional life to the work
in the Institute.
Every week, personnel meetings were convened to
discuss the results of own researches and investigate
foreign publications. Ludwik Hirszfeld undertook
efforts to publish articles in Polish journals: Warsaw
Medical Journal (Warszawskie Czasopismo Lekarskie),
Polish Doctor (Lekarz Polski), Social and Medical
News (Nowiny Społeczno-Lekarskie), Health (Zdrowie), Cancers (Nowotwory) and foreign journals,
most frequently in German language: Zeitschrift für
697
Immunforschung, Klinische Wochenschrift, and French
language: Comptes rendus de la Société de biologie. Of
importance, however, was for him to create an archival
journal, issued by the NIH.
Since 1920, the Epidemiological Review (Przegląd
Epidemiologiczny) was issued whose name was converted to the Experimental and Social Medicine (Medycyna Doświadczalna i Społeczna) after a few years.
Ludwik Hirszfeld made the NIH journal available for
academic scientific workers and promoted its reading
in students.
L.Hirszfeld was a member of international scientific associations, he also formed such institutions in
Poland - Polish Biological Association. In 1931-35, he
held the position of president of the Polish Society of
Microbiologists and Epidemiologists (Polish Society of
Microbiologists) established by Roman Nitsche, Feliks
Przesmycki and Zygmunt Szymanowski in 1927. He
participated in their sessions.
ORGANIZATIONAL
INITIATIVES IN THE NIH IN THE 30S
All objectives defined in NIH Statute as of 1927
were completed in the 30s.
One of the objectives was development of NIH
branches, whose number increases to 13 in 16 provinces. Cooperation between NIH branches and field
units of health was improved. Heads of the branches
served as the official counsellors of health division
chiefs while physicians-epidemiologists of the branches
were concomitantly the officers of provincial health
offices. Ludwik Hirszfeld remembers: “By dint of this
cooperation, we not only participated in the control of
epidemic but we were also on the best way to develop
the epidemiology for Poland” (1, p. 158).
Another accomplishment was development of database of official data on hospitals, social institutions,
governmental and academic units, where samples could
be tested in case of infectious disease detection. So far,
many emerging cases of diseases were not bacteriologically tested. In this way Ludwik Hirszfeld’s postulates
on organization of epidemiological surveillance system,
outlined in the article “Microbiological services in the
country” („Obsługa bakteriologiczna państwa”) (Lekarz
Polski 1934, 10, No. 5, p.31), were realized.
Merging the Departments of Food Evaluation with
NIH appeared to be an organizational success, because
sanitary monitoring of water and food was thus started.
Uniform methods of water and food examination based
on “Outline of bacteriological technique” („Zarys
techniki bakteriologicznej”) by Feliks Przesmycki and
many other NIH publications were developed in NIH
main premises, and implemented. They were also used
698
Marta Gromulska
in infectious diseases bacteriological diagnostics. Developed methodology was used in NIH branches and
cooperating field units.
New branches of the National Hygiene School,
such as: Occupational hygiene, Psychological hygiene
and Sanitary engineering were developed. Since the
National Hygiene School was formed, i.e. in 1926 until
1938, a total of 161 training courses were organized,
in which 8,614 persons participated, including 2,455
physicians. Of these courses, those concerning public
hygiene for physicians – candidates for public health
care, medical microbiology as well as courses for sanitary inspectors were predominant.
NIH activities were financed by ministerial subsidies, but also, in considerably small proportion, by NIH
itself. Unit of Sera and Vaccines Production oh NIH
became a company in 1927 and all of its costs were
covered by the profits gained from the sale of biological
preparations: sera, vaccines, preparations for veterinary
purposes and organ-based preparations (insulin). Sera,
vaccines and other biological preparations (insulin,
preparations for veterinary purposes) were ordered
by state, civil and military authorities and distributed
in home market by wholesalers and pharmacies. This
activity was particularly important for NIH as it did not
avoid financial difficulties.
The Institute in collaboration with Association of
Preventive Medicine (managed by Witold Chodźko
PhD) together with Warsaw Health Division, which
granted the funding, conducted mass vaccination campaigns against diphtheria and scarlet fever.
INTERNATIONAL COLLABORATION
OF THE NIH IN THE TIMES OF LUDWIK
HIRSZFELD
“National Institute of Hygiene was placed in the
orbit of great sanitary movement (1, p.115), and development of the Institute proceeded under close contact
with the Hygiene Committee of the League of Nations”.
In 1920, a conference concerning the control of
epidemic in the East, where its beginning was observed,
was convened by the League of Nations in Warsaw.
A speech was delivered by dr Ludwik Rajchman. In
this conference, researchers from all parts of the world
were present. The Hygiene Committee of the League of
Nations initiated international work on the standardization of anti-dysentery serum, serodiagnosis of syphilis.
During a scientific conference in Copenhagen in 1928,
Stanisław Sierakowski and Helena Rabinowiczówna
were awarded the second place (after England). Experiences of particular institutes from Europe and America
were shared as well as the most optimal methods of testing were developed. Ludwik Hirszfeld was a permanent
No 4
member of the Standardization Committee of the League
of Nations and took part in its annual sessions. On the
commission of the League of Nations, the collaboration
with the Serological Institute in Copenhagen with regard
to the standardization of serum titration methods was
initiated. Prof. Th.Madsen from Copenhagen – ‘a genius
of standardization’ coordinated this work.
On a request of other research centres, the Unit of
Sera and Vaccines of the NIH sent them standard sera.
Such form of collaboration was present in the whole
Europe.
Two congresses were held with regard to the control
of diphtheria and scarlet fever, in 1929 in Paris and in
1931 in London, in which the NIH actively participated.
Dr Witold Chodźko, the director of the National Hygiene School, as a member of the Hygiene Committee
of the League of Nations, took part in the sessions of the
Committee and delivered speeches on the programmes
of the Hygiene Schools in Zagreb and Budapest. He
represented the Polish Government in the International
Office of Public Hygiene by submitting memorials on
sanitary issues.
Stanisława Adamowiczowa from the National
School Hygiene was a permanent connection between
the NIH and Hygiene Section of the League of Nations,
reporting data on infectious diseases in Poland.
Collaboration with the Institut Pasteur consisted in
awarding stay grants – dr Helena Sparrow was given a
grant following her successful experiments with vaccines against typhoid fever in the NIH. She collaborated
with Charles Nicolle.
Helena Rabinowiczówna, an alumnus of the Medical Univeristy in Geneva, also was awarded the Institute’s grant.
The Rockefeller Foundation organized international scientific exchange and funded grants for young
researchers.
Rockefellerists from the NIH: Feliks Przesmycki –
a physician, microbiologist, co-organizer of the NIH,
the head of the Diagnostics Division, branch inspector,
after the Second World War – the director of the NIH
(1945-1963), Józef Celarek – a physician, bacteriologist, head of the Production Division in the NIH, Marcin
Kacprzak – a physician, hygienist, promoter of hygiene,
professor, rector of Medical Academy in Warsaw, Edward Grzegorzewski – a physician, working in the NIH
as the volunteer and then in sanitary services, after the
Second World War, the co-founder of the World Health
Organization, Bruno Nowakowski – a hygienist (Occupational Hygiene in the National Hygiene School,
professor of hygiene in Vilnius and Cracow, Stanisław
Sierakowski – a bacteriologist – who studied in the 20s
at the Johns Hopkins University in Baltimore.
Having used a grant from the Rockefeller Foundation, in 1923-27 Kazimierz Funk conducted in the NIH
No 4
Fig 1.
699
Director of the National Institute of Hygiene – Dr Ludwik Rajchman (the first row, the fourth person from the
right) with his colleagues. Ludwik Hirszfeld - the first person from the right next to Stanisława Adamiczowa.
Dr Feliks Przesmycki behind them. Stanisław Sierakowski, Julia Seydel and Helena Sparrow – the second, third
and fourth person from the left and other unrecognized persons, including assistants, physicians and laboratory
technicians. Early 1920s.
biochemical research on insulin, which were adopted by
the Production Division in the NIH since 1925.
Ludwik Hirszfeld participated in the international
sessions and he always supported his colleagues in their
attempts to participate in delegations abroad (permission was given by the Ministry of Public Health, and
then by the Department of Health Care in the Ministry
of the Interior) for the purpose of scientific exchange,
learning on processes of serum and vaccine production
(dr Józef Celarek visited microbiological institutes in
Paris, Berlin, London, Oslo, Vienna), Ludwik Anigstein
participated in the control of infectious and tropical
diseases in Kuala Lumpur, he was invited there following his highly-assessed research on typhus in the
Parasitology Division in the NIH.
NIH also held the sessions of the heads liable for
producing sera and vaccines from the National Institutes of Hygiene in Warsaw, Prague, Zagreb, Sofia and
Bucharest (1937).
Stanisław Weil, representing the Chemistry Division, participated in the deliberations on intoxicants
of the Expert Committee of the International Office of
Public Hygiene in Paris while in 1928 in the Congress of
the International Union of Pure and Applied Chemistry
in Hague and Congress of the Industrial Chemistry in
Barcelona.
Researchers from different countries visited as
well as were employed in the NIH (in 1926-28, a total
of 100 researchers and sanitary officers worked in or
analyzed the results of researches or the organization
of the Institute) (8).
LUDWIK HIRSZFELD AS A DIDACTICIAN
In “The Story of One Life”, Ludwik Hirszfeld wrote
that teaching activities were of the highest importance
for him. “I have never separated teaching from upbringing factors” (preface to the “General immunology”).
For Hirszfeld, a lecture was like ‘expedition for young
spirits’ and he compared it to a concert. Having discussed a disease, he referred to the parts of concert:
– andante (the basic tone, epidemics or individual
disease, each disease has its own dramatic tension)
presto (clinical course, unrelenting effects of infection),
adagio (etiology), finale (prophylaxis) (1, p.154-155).
He gave lectures during courses in the NIH and at the
Polish University (Wszechnica Polska). He attempted to
give lectures at the Divisions of Medicine and Pharmacy.
He was allowed to lecture there after being awarded
tenure and then following promotion to professor – at
700
No 4
Marta Gromulska
the University of Warsaw. During war period, he gave
lectures for the participants of sanitary sections.
To the largest extent, he liked to gave lectures on
bacteriology – to provide basic information without
presenting the details that could be found in books – he
talked about new discoveries. For illustrations, he preferred to use tables rather than epidiascope. Participants
of his lectures could investigate their content for a longer
time and consequently could remember more. In his
lectures, he tried to present the horizons of knowledge
and induce interest, curiosity, admiration and fascination in the listeners.
“The eyes of the listener are the test for the professor, whether he managed to attract him as the emotion
enhance the absorbency of mind” (1, p.155).
In the Hygiene School of the NIH, he wished to
combine the teaching of epidemiology – theoretical
knowledge with practice in the field. “This internal
ardour in describing the epidemic may have only one
who have experienced this epidemic” (p.129).
Remarkable skills of Ludwik Hirszfeld in passing on the knowledge, his personality and fascination
with scientific discoveries were especially reflected in
the “General immunology”, issued in 1949. Professor
transcribed all his lectures prior to 1941 when he was divested of his apparatus in the NIH and moved to ghetto.
Preface is a lecture on understanding the immunology. “Immunology is a basis of bacteriology, epidemiology and pathology of infectious diseases while serology
constitutes its section” (p.6).
This book serves as a course book, comprising
microbiological knowledge from historical and modern
perspective.
The first two lectures are devoted to the history of
medical microbiology from ancient times to the 40s. of
he 20th century and application of bacteriology in the
field of immunization.
Lecture XXXXII includes the immunological assessment of vaccination, where the methods of medical
statistics are also discussed.
Lectures are provided with illustrations, tables from
factual and chronological perspective.
Definition of epidemiology: Lecture VI, concerning
the routes of infection, includes the definition of epidemiology: “Epidemiology is a science on equilibrium and
imbalance between visible and invisible world” (p.62).
SUMMARY
National Institute of Hygiene in charge of Ludwik
Hirszfeld became a well-organized institution, included
in a range of international initiatives in the field of public
health. Furthermore, researches were conducted there
pursuant to the standards issued by scientific institu-
tions in Europe and United States and by the League
of Nations on a basis of the recent discoveries. Science,
cultivated by Hirszfeld and his colleagues in the NIH,
was not considered separately from life. It had practical
application. Hirszfeld’s contribution to science and his
achievements are still actual and subject to discussions.
Ludwik Hirszfeld expressed the assessment of his
research activity in the preface to the “General immunology”: “Nevertheless, some of the issues emerged
or developed in my department became a subject for
modern science. Here I will only mention constitutional
serology and blood groups, serologic specificity of
tissues, reverse and productive processes, serologic
analysis of blood coagulability, coagulase reaction,
aspects of latent infections. As well as an interpretation of vaccination and finally general approach to the
biology of infections”.
REFERENCES
1. Hirszfeld L. Historia jednego życia. Kraków: Wydawnictwo Literackie, 2011.
2. Hirszfeld L. Sprawozdanie z działalności naukowej
Państwowego Zakładu Higieny i Państwowego Zakładu
Badania Surowic w Warszawie z okazji 5-letniej rocznicy
ich powstania. Med. Dośw Społ, 1924;V.3, issue 3-4.
3. Przesmycki F. Wspomnienia. Maszynopis w Bibliotece
PZH.
4. Hirszfeld L. Immunologia ogólna, 1949.
5. Lachowicz K. PZH, jakim go poznałem przed blisko
półwieczem. Maszynopis w Bibliotece PZH.
6. Hirszfeld L. Działalność naukowa Organizacji Higieny
Ligi Narodów. Zdrowie, 1931, V.46, p.1196-1202.
7. Działalność PZH. In: Sprawozdanie o stanie zdrowotnym
Rzeczypospolitej Polskiej oraz o działalności władz i
instytucyj zdrowia publicznego w latach 1928-1929.
Warszawa: Min.Spraw Wewn., 1931, p.122-76.
8. Hirszfeld L. Wspomnienia i rozważania z okazji 10-lecia Niepodległości Państwa Polskiego. Warsz Czas Lek
1928, 5, No 38-39, p.825-827.
9. Państwowy Zakład Higieny. Wykaz publikacji 19181967. Warszawa 1968.
10. Sprawozdania PZH – lata 1924-1938.
PAPERS WRITTEN BY LUDWIK
HIRSZFELD AND PUBLISHED IN THE
EPIDEMIOLOGICAL REVIEW AND
EXPERIMENTAL AND SOCIAL MEDICINE
Ludwik Hirszfeld is an author of approximately
400 publications.
A number of his articles were published in the
Epidemiological Review and Experimental and Social
Medicine - quarterly journals issued by the NIH.
No 4
EPIDEMIOLOGICAL REVIEW
HIRSZFELD L, HIRSZFELD H.: Badania serologiczne nad
rasami ludzkimi. Speech delivered in the Section of general
pathology of the Medical Association in Warsaw on 7th April
1920. Epidemiological Review 1920; 1 (2): 1-13 (81-93).
HIRSZFELD L.: Badania nad istotą dopełniacza. Epidemiological Review 1921; 1 (4): 376-383. Abstract in German.
BIAŁOSUKNIA W., HIRSZFELD L.: Badania nad
aglutynacją normalną. Report I-III. Epidemiological Review
1921; 1 (5): 437-465. Abstract in German.
HIRSZFELD L., SEYDEL J.: Z bakteriologii durów rzekomych. Epidemiological Review 1921; 1 (6): 532-548, 4 tab.
Abstract in English.
HIRSZFELD L., SEYDEL J.: O własnościach zlepnych
szczepów durowych. Epidemiological Review 1922; 2 (2):
139-167. Abstract in German.
HIRSZFELD L., PRZESMYCKI F.: Badania nad aglutynacją
normalną. Report IV. O izoaglutynacji u koni. Epidemiological Review 1921; 1 (6): 577-583. Abstract in German.
HIRSZFELD L., PRZESMYCKI F., SEYDEL J., SIERAKOWSKI S. O miareczkowaniu surowic i jadów czerwonkowych. Epidemiological Review 1922; 2: 273-274.
Scientific session of the employees of PZE and PZB Sur.
in Warsaw on 17th June 1922. p.255-282
HIRSZFELD L., PRZESMYCKI F.: O znaczeniu transfuzji
dla wydajności zwierząt szczepiennych. Abstract.ref. Epidemiological Review 1922; 2: 265-266.
EXPERIMENTAL AND SOCIAL MEDICINE
HIRSZFELD L.: Stan współczesny serodiagnostyki kiły (w
związku z ankietą Komitetu Higieny Ligi Narodów). Experimental and Social Medicine 1924; 3 (5-6).
HIRSZFELD L. Zagadnienie konstytucjonalizmu w świetle
badań serologicznych. Experimental and Social Medicine
1924; 3 (5-6).
HIRSZFELD H, HIRSZFELD L., BROKMAN H. Wrażliwość
na błonicę w świetle badań nad konstytucją i dziedzicznością.
Experimental and Social Medicine 1924; 2 (3-4): 125-242.
HIRSZFELD L. Sprawozdanie z działalności naukowej
Państwowego Zakładu Higieny i Państwowego Zakładu
Badania Surowic w Warszawie z okazji 5-letniej rocznicy
ich powstania. Experimental and Social Medicine 1924; 3
(3-4): 1-24.
701
BROKMAN H., HIRSZFELD L. Odczyn maleinowy u ludzi.
Experimental and Social Medicine 1930; 12 (1-2)
The same article in German language in Klin.Wschr. 1929;
No. 32, p.1499.
HALBER W., HIRSZFELD L., MAYZNER M.: Badania nad
powstawaniem ciał odpornościowych u dzieci. Experimental
and Social Medicine 1925; 9 (1-2): 27-38.
HIRSZFELD L., HALBER W.: Badania nad nad antygenem
Forssmana w związku z teorią powstawania przeciwciał.
Experimental and Social Medicine 1925; 5 (1-2).
HIRSZFELD L., PROKOPOWICZ-WIERZBOWSKA M.:
Badania doświadczalne nad istotą idiosynkrazji. Experimental and Social Medicine 1925; 4: 278-283.
HIRSZFELD L., ZBOROWSKI H. O współżyciu serologicznym matki i płodu. Report 4. Experimental and Social
Medicine 1926; 6 (5-6).
HIRSZFELD L. O istocie zakażalności. Experimental and
Social Medicine 1927; 7 (3-4).
HIRSZFELD H., HIRSZFELD L. Badania nad dziedziczeniem wrażliwości i odporności na choroby zakaźne. Experimental and Social Medicine 1928; 9 (1-2).
HIRSZFELD L., HALBER W., LASKOWSKI J. Badania
serologiczne nad nowotworami. Experimental and Social
Medicine 1929; 10 (5-6).
HIRSZFELD L., HALBER W. O wzajemnym stosunku grup
krwi u ludzi i zwierząt. Experimental and Social Medicine
1930; 12: 413-414.
HIRSZFELD L. Badania nad grupami krwi w związku z
zagadnieniem serologii konstytucyjnej.
HIRSZFELD L. O sposobach i technice stwierdzania
właściwości grupowych w plamach krwi i płynach ustroju.
HIRSZFELD L.,HALBER W. O własnościach serologicznych tkanki embrionalnej i rakowej. Experimental and
HIRSZFELD L., HALBER W. O odczynie Bordet-Wassermanna w tyfusie plamistym. Przyczynek do teorii odczynu
Wassermanna. Experimental and Social Medicine 1933; 17:
3-4.
HIRSZFELD L., AMZEL R. W spawie standaryzacji odczynu Widala. Amplituda cieplna surowic przeciwdurowych.
HIRSZFELD L.: Sprawozdanie z prac nad bakteriologią
duru brzusznego, wykonanych w Państwowym Zakładzie
702
Marta Gromulska
No 4
Higieny dla Komitetu Higieny Ligi Narodów. Experimental
and Social Medicine 1934; 17 (1-2).
HIRSZFELD L. Rola i ewolucja zakażeń w przyrodzie. Experimental and Social Medicine 1938; 23 (1-2).
HIRSZFELD L. O określaniu odporności w chorobach
cywilizacyjnych,specjalnie w błonicy (abstract). Experimental and Social Medicine 1935; 20 (5-6).
HIRSZFELD L. AMZEL R. W sprawie standaryzacji odczynu
Widala na terenie międzynarodowym. Experimental and
HIRSZFELD L., HALBER W. Serologia tkanek patologicznych. Experimental and Social Medicine 1935; (5-6).
Received: 1.10.2014
HIRSZFELD L. Prawa szerzenia się błonicy i innych chorób
wieku dziecięcego. Experimental and Social Medicine 1936;
21 (1-2), 20 (5-6).
Marta Gromulska
Editorial assistant of “Przegląd Epidemiologiczny”
-National Institute of Hygiene
24 Chocimska Street, 00-791 Warsaw,Poland
Tel.+48 22 54 21 217
HIRSZFELD L., HALBER W. O własnościach serologicznych tkanek normalnych i tkanek patologicznie
zmienionych. Report 1. O własnościach serologicznych
zserowaciałej tkanki gruźliczej. Report 2. Badania nad
immunobiologią ropy. Experimental and Social Medicine
1936; 21 (3-4).
Reports
COORDINATION OF PUBLIC INSTITUTION
RESPONSE TO A THREAT OF EPIDEMIC
Workshop held in the National Institute of Public Health – National Institute of Hygiene
on 11th September 2014
Having considered the dynamics of Ebola virus
disease epidemic (EVD) in the West African countries,
on 11th September 2014, a workshop regarding the coordination of public institution response to a threat of
epidemic was held in the National Institute of Public
Health – National Institute of Hygiene (NIPH-NIH).
Meeting was intended for the organs of the State Sanitary Inspectorate, the representatives of the provincial
emergency management centers, provincial physicianscoordinators of medical rescue, national and provincial
consultants of the following specialties: family medicine, internal diseases, paediatrics, emergency medicine,
epidemiology, infectious diseases and epidemiology
nursing.
Representatives of the Ministry of National Defence,
i.e.: the Chief Sanitary Inspector of the Polish Army
, the Director of the Military Institute of Hygiene and
Epidemiology, the Chief of the Epidemiological Response Centre of the Polish Armed Forces, the representatives of the Government Centre for Security, the
Chief Sanitary Inspector of the Ministry of the Interior
(MOI), the State Provincial Sanitary Inspectors of the
MOI, physician-epidemiologist of the Headquarters of
Polish Border Guard as well as the representatives of
airport medical centers and National Health Fund also
participated in this meeting.
Prof. Mirosław Wysocki, MD, PhD, the Director of
the NIPH-NIH, and dr Igor Radziewicz-Winnicki, PhD,
the Undersecretary of State in the Ministry of Health,
jointly presided at workshop.
Workshop was composed of three thematic sessions:
- Session 1 was dedicated to an analysis of patient suspected of haemorrhagic fever (HI) in the District Hospital in Cieszyn. Dr Grzegorz Hudzik, State Provincial
Sanitary Inspector in Katowice, State District Sanitary
Inspector in Cieszyn and Chief Medical Officer of the
Hospital in Cieszyn presided at this session.
The representatives of Śląskie province precisely
discussed the management and response to the occurrence of first patient suspected of Ebola virus disease,
finally non-confirmed, in Poland.
An emphasis was put on both strong and weak
points of preparedness plans adopted. Problematic is-
sues and advantages of well-organized health care unit
were subject to discussion.
Furthermore, dr Dariusz Cichy, State Provincial
Sanitary Inspector in Gdańsk, discussed cases suspected
of EVD, reported in Pomorskie province.
- Session 2, held in the form of panel discussion and
moderated by dr Marek Posobkiewicz, Chief Sanitary
Inspector, concerned the coordination of prophylactic
response in Poland.
Chief Sanitary Inspector discussed fundamental
elements of response to the occurrence of case of highly
dangerous and contagious disease, focusing on legal
basis of actions undertaken by services, inspectorates
and other institutions as well as different response elements, including:
- provision of personal protective equipment for health
care personnel,
- transport of suspected or confirmed HI cases to
designated hospitals,
- organization of health care, focusing on hospital
isolation,
- transport of specimen collected from suspected or
confirmed EVD cases to the NIPH-NIH for diagnostic purposes,
- management of persons in contact with suspected
or confirmed EVD cases, especially organization
of quarantine settings for persons in contact with
such patients,
- organization of work and principles of information
exchange in situations of the occurrence of passenger presenting with symptoms indicative of HI on
international airports,
- methods of information exchange, including principles of media policy.
Participants of meeting shared their own experience
and reflections regarding current healthcare policy,
necessities induced by current and potential global
epidemiological situation of infectious diseases and
opportunities resulting from current healthcare-related
provisions. Discussions were held with regard to the
organization of prophylactic actions in Poland as well as
704
approach to an epidemic threat specified in emergency
management plans.
- Session 3 related to epidemiological and clinical
aspects of EVD. Dr Iwona Paradowska-Stankiewicz,
MD, PhD, the National Consultant in Epidemiology,
was a moderator of this session.
Prof. Andrzej Zieliński, MD, PhD, representing the
Department of Epidemiology, discussed an epidemic
of EVD in west Africa with EVD-related risk for the
EU countries.
Prof. Andrzej Horban, MD, PhD, the National Consultant in Infectious Diseases, illustrated the clinical
presentation of EVD as well as the principles of patient’s
isolation and protection of healthcare personnel.
Assoc. Prof. Bogumiła Litwińska, PhD, the Head
of the Department of Virology, focused on the rules and
national capacity regarding laboratory diagnostics of
EVD. Assoc. Prof. Rafał Gierczyński, PhD, the Deputy
Director for Epidemiology and Microbiology, discussed
the role of NIPH-NIH in the formation of substantive
and educational grounds in such events.
Speech delivered by Mrs. Monika Wróbel-Harmas,
MA, Public Relations Officer of the NIPH-NIH, finalized this session. PRO presented the importance of
information policy and contact with media.
Prof. Mirosław Wysocki, MD, PhD, summarized
the findings of this workshop.
Having considered the questions and technical
doubts raised (diagnostics, treatment, response to epidemic, exchange information), Professor emphasized
that up-to-date materials, recommendations, algorithms
of management and other information on EVD epidemic
in west Africa, which were elaborated jointly by the
experts of the NIPH-NIH, national consultants and CSI
representatives, are accessible on the official websites
of the NIPH-NIH and CSI.
As the information available on these websites are
continually updated, users are advised to track them on
a regular basis. Each person may verify the relevance
of data as each document in Polish language is marked
by the date of its latest modification.
Assoc. Prof. Rafał Gierczyński, PhD, who was
also involved in the summary part of the workshop,
reminded that in 2001, during terrorist attacks with
the endospores of Bacillus anthracis in the USA, the
NIPH−NIH processed more than 300 samples. From the
perspective of current epidemic situation in west Africa,
No 4
it may suggest that the number of cases suspected of
EVD in Poland may be also high, even, if none of these
cases would finally be confirmed.
CONCLUSIONS
1. So far, all actions undertaken by different institutions
in country with reference to the management of suspected EVD cases, suggest both positive aspects of
healthcare-related provisions, as well as fields that
require further discussions and implementation of
explicit complementary actions.
2. Having referred to the Art. 42 of the Act on Preventing and Combating Human Infections and Infectious
Diseases of 5 December 2008, the Minister of Health
would officially designate hospitals for infectious
diseases in Poland which would be prepared for
admission and treatment of patients suspected of
highly contagious and dangerous infectious diseases.
Such solution is of measurable benefits, including
permanent training of personnel for professional
and safe management of patients, sustained funding
for preparedness, routine provision of professional
equipment and rooms meeting the safety standards,
designation of specialist institutions, which could
serve as national specialist centers for highly dangerous diseases, consequently leading to elimination
of barriers associated with anxiety raised by having
contact with highly infectious disease case.
3. Similarly to other EU countries, constant, systemadjusted preparedness regarding microbiological
diagnostics of highly infectious diseases should be
sustained. Having considered the previous engagement of the NIPH-NIH in this respect (monitoring
of epidemiological situation during EURO 2012,
execution of agreement on testing for MERS-CoV
in 2013 and current involvement in EVD diagnostics), for the Minster of Health, the Institute, could
maintain a constant state of readiness with regard
to diagnostics of highly infectious diseases as well
formulate recommendations for the purposes of epidemiological surveillance and trainings for healthcare personnel within the operation of the National
Research Institute.
4. Organizers of this workshop, as well as its participants, remarked that there is a necessity of more frequent convoking of such meetings by the NIPH-NIH,
not only those with regard to EVD-related threat.
List of revievers
LIST OF REVIEWERS OF MANUSCRIPTS SENDING TO EDITOR
OF PRZEGLĄD EPIDEMIOLOGICZNY – EPIDEMIOLOGICAL REVIEW
IN 2014
Mgr ANNA BAUMANN
Prof.dr hab. PIOTR BŁĘDOWSKI
Prof.dr hab. JADWIGA CHARZEWSKA
Prof.dr hab. SŁAWOMIR CHLABICZ
Dr hab. TOMASZ CHMIELEWSKI, Prof.NIZP-PZH
Dr GRAŻYNA CHOLEWIŃSKA
Dr hab. DOROTA CIANCIARA, Prof.NIZP-PZH
Mgr MIROSŁAW P CZARKOWSKI, NIZP-PZH
Dr inż. DOROTA CZERWIŃSKA
Dr GRAŻYNA DULNY
Prof.dr hab.ANTONI K GAJEWSKI
Prof.dr hab. ANDRZEJ GAMIAN
Prof.dr hab. JAKUB GAWOR
Dr hab. ELŻBIETA GOŁĄB, Prof.NIZP-PZH
Dr PAWEŁ GORYŃSKI
Dr ALEKSANDRA HILT
Prof dr hab. STANISŁAW IGNATOWICZ
Dr hab.WIESŁAWA JANASZEK-SEYDLITZ, Prof.NIZP-PZH
Prof. dr hab. Płk MAREK JANIAK
Dr JANUSZ JANIEC, NIZP-PZH
Dr LUCJAN KĘPA
Prof.dr hab. PIOTR JÓZEF KNAP
Prof.dr hab. JAN KOPCZYŃSKI
Prof.dr hab. MARIA KORZENIEWSKA-KOSEŁA
Prof.dr hab. Płk KRZYSZTOF KORZENIEWSKI
Mgr ELŻBIETA LEJBRANDT
Dr JERZY T MARCINKOWSKI
Prof.dr hab. MAGDALENA MARCZYŃSKA
Dr DOMINIK MAŚLACH
Prof.dr hab. HALINA MAZUR
Dr hab. DANIEL MŁOCICKI
Prof.dr hab. GRAŻYNA MŁYNARCZYK
Dr hab. DOROTA MROŻEK-BUDZYN
Prof.dr hab. PRZEMYSŁAW MYJAK
Dr WACŁAW LESZEK NAHORSKI
Dr MARIA OLSZYŃSKA-KROWICKA
Prof.dr hab. MAŁGORZATA PAWŁOWSKA
Dr LIDIA PIECHOWICZ
Dr EDYTA PODSIADŁY
Prof.dr hab. WALDEMAR RASTAWICKI
Prof.dr hab. KAZIMIERZ ROSZKOWSKI-ŚLIŻ
Dr IWONA RUDNICKA
Dr RUSŁAN SAŁAMATIN
Doc.dr hab. DANUTA SEROKA
Prof.dr hab. EDWARD SIŃSKI
Dr PAWEŁ STEFANOFF
Dr hab. MAGDALENA STRUS
706
Prof.dr hab. LESZEK SZENBORN
Prof.dr hab. ANDRZEJ SZKARADKIEWICZ
Prof.dr hab. DANUTA WASZKIEL
Prof.dr hab. HALINA WEKER
Prof.dr hab. ALICJA WIERCIŃSKA-DRAPAŁO
Dr BOGDAN WOJTYNIAK, Prof. NIZP-PZH
Dr JADWIGA WÓJKOWSKA-MACH
Prof.dr hab. JACEK WYSOCKI
Prof.dr hab. JOANNA ZAJKOWSKA
Dr hab. ALEKSANDRA ANNA ZASADA
autor
No 4
No 4
Instruction for authors
707
INSTRUCTION FOR AUTHORS
PRINCIPLES FOR PREPARATION OF MANUSCRIPTS SUBMITTED FOR
PUBLICATION IN PRZEGLĄD EPIDEMIOLOGICZNYEPIDEMIOLOGICAL REVIEW
The copyrights for articles published in Przegląd
Epidemiologiczny - Epidemiological Review are reserved for the publisher – the National Institute of Public
Health-National Institute of Hygiene. This means that
the articles or their fragments cannot be published or reproduced elsewhere without permission of the publisher.
Przegląd Epidemiologiczny - Epidemiological Review is a bilingual (English and Polish) journal.
Przegląd Epidemiologiczny- Epidemiological
Review publishes:
a) Experimental and methodological studies and reports from the area of epidemiology, prevention and
control of communicable and noncommunicable
diseases; epidemiological analysis and estimations;
b) Studies in the field of public health;
c) Studies and clinical reports of communicable diseases;
d) Review papers from the area of epidemiology,
prevention and diagnosis of communicable diseases
and public health;
e) Reviews of books and journals in the fields mentioned above and letters to Editor.
1. Rules for the acceptance of the article sent for
publication
Manuscript should be sent to the Editor with the
covering letter, in which the corresponding Author
declares his intention to publish the article, giving its
title and listing the names of the authors and his own
place of employment, address, phone number and
e-mail. In the case of original (research) articles the
covering letter must include the approval of the head of
the institution (department) where research was done,
confirmed by his signature.
The covering letter must be accompanied by a
written statement that:
A.Work has not published before and will not be
submitted for publication prior to its publication
in Przegląd Epidemiologiczny - Epidemiological
Review.
B. The contribution of each author to the article should
be described.
C. A statement that the work does not infringe the copyrights or other rights of third parties and there is no
conflict of interest with other persons or institutions.
2. Instructions for the preparation of the manuscript
The manuscript should be prepared in accordance
with the instruction for authors.
Note! The content of the manuscript cannot exceed 12
pages, including abstract, references, figures and tables.
2.1. Printed manuscript intended for publication should
be sent to the editor in 1 copy in the format A4, written
on one side with a margin 4 cm on the left side and 1.5
spacing between lines (28-31 lines per page). The pages
of the manuscript should be numbered.
The manuscript must be accompanied by copies of
the article in the electronic form (CD-ROM or sent by
e-mail: [email protected]).
By providing a CD, authors should make sure that the
text is identical with the text of the manuscript and give
a clear file name of the stored article.
The materials should be prepared using Arial fonts to
the figures, diagrams and photographs (10-12 pts) and
Times New Roman font for figure captions and the
written text.
2.2. The first text page should contain the following
sequence centered on the page: the full name of the
author(s) in italics, the title (in bold capital letters) and
name(s) the institution(s) where the work was made.
2.3. The editors reserve the right to correct stylistic
errors and terminology and with the consent of the
authors make the abridgments in the text.
In the article the following parts should be present:
Introduction, Objective, Material and Methods, Results, Discussion, Conclusions, References, Address
for correspondence. Abstract should be composed of
the following parts: Introduction, Objective, Material
and Methods, Results, Conclusions (capital letters,
bold 10 points).
The particular parts of the article may include subtitles
provided the structure of the article would be of higher
transparency then.
ABSTRACT. Abstract should recapitulate the facts
and conclusions contained in the article – ca 250 words
(Times New Roman 10-12 points).
Abstract should be attached to the manuscript on a
separate, unnumbered pages.
KEYWORDS (3-5) should be placed under the abstract, e.g.
Key words: Hib vaccination, the effectiveness
708
INTRODUCTION - provides the need (justification) of
the study and clearly specifies the purpose of research.
The literature quoted in the introduction should be limited only to positions that have a direct relationship with
the content of this study. In the introduction, the results
or conclusions from the research should not be included.
MATERIAL AND METHODS - in the case of commonly known methods, indicate the position of literature, together with statistical methods used in study.
If the methods are already published but not widely
known, give a brief description, while for new or substantially modified methods - delivers a full description.
In the epidemiological articles information should be
provided about the plan (protocol) of the study covering
the study population (age, sex, history of immunization
and other important characteristics), procedures of randomization and criteria used for allocation of persons
to each group.
RESULTS - should be given in a logical sequence in the
text, with a possible reference to the tables and figures.
Data from the tables and figures should not be repeated
in the text where the most important information should
be summarized.
DISCUSSION - is to highlight new or important aspects
of research results and discuss their implications and
indicate their limitations. The results of own research
should be evaluated against the background of the literature quoted by the authors. Do not repeat the detailed
data presented in the previous parts of the article.
CONCLUSIONS - should be specified in points or
presented briefly in a narrative form. Conclusions should be logically connected with the objectives of the
research outlined in the introduction. Statements and
conclusions not based on the obtained results should
be avoided. Authors should refrain from statements
about the costs or benefits, if their work does not contain
economic data and their analysis. If the hypothesis is
expressed, it must be clearly stated that it is a hypothesis.
Do not present the results in conclusions!
REFERENCES - should be limited only to the items
mentioned in the text and directly related to the topic
of the work - no more than 30 items.
References should be arranged in order of their
citation. When quoting the publication in the text only
the serial number of it should be given in parentheses.
The publications cited in tables or figures legend should
be included in the references and should be numbered
after the citations in the text.
Work accepted for publication but not yet published,
should be marked as “in press”; authors should obtain
No 4
written permission to cite such a position, as well as
confirmation that the work cited has been accepted
for publication.
When listing the references following sequence
should be maintained:
a) the name of the author(s) and the first letters of their
names. If the number of authors does not exceed
three, list all authors, if more than three, list the first
three authors followed by et al.
b) the full title of the work;
c) recognized abbreviation of journal title (according
to The List of Journals Indexed in Index Medicus);
d) year;
e)volume:
f) first and last page of work.
Do not use italics, bold or underlining.
For non periodic publications (e.g. books), give the
author(s) chapter title, book title, name and initials of
the editor, place of publication, publisher and year of
publication and page number(s) of the cited chapter.
EXAMPLES:
Articles from the journal:
Schmitt-Grohe S, Cherry JD, Heininger U, et al. Pertussis in German adult. Clin Infect Dis 1995;21:860-6.
Vega KJ, Pina J, Krevsky B. Heart transplantation is
associated with an increased risk for pancreatobiliary
disease. Ann Intern Med 1996; 124 (11): 980-3.
Items without the author: should be cited as anonymous or editorial. For example: Cancer in South Africa
[editorial]. S Afr Med J 1994;84:15.
Books and monographs:
Note! Be sure to specify the page to which the author
refers.
1. Juszczyk J, Gladysz A. Differential diagnosis of
infectious diseases. 2nd ed Warsaw: PZWL, 1996:
page(s)
2. Material published by institution: World Health Organization / United Nations Children’s Fund. State
of the world’s vaccines and immunization. Geneva:
WHO, 1996: page(s).
3. Chapter in the book: Krotochwil-Skrzypkowa M.
Postvaccinal reactions and complications. In: Debiec
B, Magdzik W, eds. Vaccinations. 2nd ed. Warsaw:
PZWL: 1991:76-81.
4. Report from the conference: Bengtsson S, Solheim
BG. Enforcement of data protection, privacy and se
curity in medical informatics. In: Lun KC, Degoulet
P, Piemme TE, Rienhoff O, editors. MEDINFO 92
Proceedings of the 7th World Congress on Medical
Informatics, 1992 Sep 6-10, Geneva, Switzerland.
Amsterdam: North-Holland, 1992,1561-5.
No 4
5. Quoting articles distributed electronically on the
internet can be done by listing their web address and
bibliographic data of the printed version, if any, eg.
Outbreak of bacterial conjunctivitis at the CollegeNew Hampshire. MMWR 2002; 51:205-7 http://
www.cdc.gov/mmwr/
Address for correspondence - should include the name
and institutional or personal address of the Author(s)
and provide phone numbers and e-mail.
Tables - should be typed on separate pages and numbered in sequence of Roman numbers. The numbering
of the tables should correspond to the sequence of the
appearance in the text. Tables should be provided with
titles (top).
Each column of the table should have a short header, a
broader explanation should be given in footnotes below
the table, not in the header. It should be given statistical measure of variability, such as standard deviation
or standard error of the mean. The number of tables
should be limited to really necessary for documentation
of results.
Figures – should be saved in TIF, Corel, jpg, PDF (in
the correct resolution) and submitted along with the
printout on separate pages.
Figures should be provided with captions. References
to figures or tables should be given in a form of consecutive numbers in parentheses, for example (Fig. 1)
or (Table I). Places to include illustrative material in the
text should be marked on the margin of the manuscript.
709
THE REVIEW PROCESS
Each article is evaluated by at least two independent
reviewers.
Reviewers and authors do not know their identities
(“double-blind review process”). Review must be provided in writing and ends with an explicit proposal to
approve the article for publication, approve if amended,
or reject it. Rules on acceptance, acceptance following
amendments or rejection of the publication and reviewing form are available to the public on the website of
the journal.
Once a year the editors makes public a list of reviewers
cooperating with the journal.
OTHER
For works published in Przegląd Epidemiologiczny Epidemiological Review there is no fee.
Authors of original papers and review papers will receive 15 complimentary copies of the article. Publisher
reserves the right to use some reprints for trade.
PL ISSN 0033-2100
PRZEGLĄD
EPIDEMIOLOGICZNY
EPIDEMIOLOGICAL REVIEW
ZDROWIE PUBLICZNE, EPIDEMIOLOGIA
I PROBLEMY KLINICZNE CHORÓB ZAKAŹNYCH
Kwartalnik
Narodowego Instytutu Zdrowia Publicznego
-Państwowego Zakładu Higieny
i Polskiego Towarzystwa Epidemiologów
i Lekarzy Chorób Zakaźnych
Rok 2014 Tom 68 Nr 4
NARODOWY INSTYTUT ZDROWIA PUBLICZNEGO
-PAŃSTWOWY ZAKŁAD HIGIENY
WARSZAWA
Artykuł redakcyjny
Andrzej Zieliński
DIETA A CZYNNIKI RYZYKA NOWOTWORÓW
Zakład Epidemiologii Narodowego Instytutu Zdrowia Publicznego – Państwowego Zakładu Higieny
w Warszawie
STRESZCZENIE
Artykuł dotyczy problemu związku między dietą a ryzykiem zachorowań na nowotwory. Autor pokazuje
trudności metodologiczne wynikające z doboru grup badawczych, a także te, które są związane z określeniem
składu diety w długim okresie niezbędnym do ustalenia związków statystycznych.
Źródła substancji rakotwórczych w żywności stanowią zanieczyszczenia środowiska, chemiczne związki
syntetyzowane w niektórych roślinach i te, które są dodawane do żywności lub są wytwarzane w trakcie jej
przetwarzania.
Zdecydowanie zaleca się ograniczenie zawartości znanych substancji rakotwórczych w żywności, przez
wprowadzenie w życie rozporządzenia (UE) nr 1881/2006 nie tylko w odniesieniu do produktów wywożonych
do krajów UE, ale także przeznaczonych na rynek wewnętrzny.
Słowa kluczowe: czynniki rakotwórcze, dieta, indywidualne ryzyko, ryzyko społeczne
WSTĘP
Badanie czynników ryzyka nowotworów należy
do najtrudniejszych wyzwań dla epidemiologów. Jest
to spowodowane, po pierwsze, dużą liczbą tych czynników i ich jednoczesnym występowaniem w różnych
kombinacjach, a także tym, że efekty ich działania
występują nieraz po wielu latach powtarzającego się
narażenia. Stosunkowo najłatwiej jest badać narażenia,
co do których zdefiniowanie populacji narażonych
i określenie poziomu narażenia jest łatwe lub choćby
możliwe. Przykładami takiego narażenia są: ekspozycja
na dym tytoniowy oraz praca z azbestem.
W przypadku narażeń związanych z dietą sytuacja
badacza jest dużo trudniejsza. Pierwszy problem stanowi to, że na jedzenie „narażeni” są wszyscy. Wyróżnienie grupy nie- narażonych jest rzadko możliwe i dotyczy
stosunkowo ograniczonej liczby potraw. Zarówno
w badaniach retrospektywnych, jak i prospektywnych
określenie składu diety w długiej perspektywie czasu
jest zwykle ograniczone do małego jej wycinka. Czas
trwania narażenia na substancje o potencjale rakotwórczym do chwili wystąpienia nowotworu wynosi często
wiele lat, i w tym okresie ludzie mogą wielokrotnie
zmienić dietę zarówno pod względem jakościowym,
jak i ilościowym. Ponadto w pokarmach zawarte są
zarówno substancje, które mogą zwiększać prawdopodobieństwo występowania nowotworów, jak i takie,
które to prawdopodobieństwo zmniejszają. W tych
warunkach nie tylko próba powiązania diety z powstawaniem nowotworów, ale nawet samego odtworzenia
sposobu odżywiania się napotyka na trudności spowodowane niedokładnym pamiętaniem zjadanych przed
laty potraw oraz tym, że osoby ankietowane często
nawet w czasie spożywania posiłków nie wiedziały
dokładnie, jakie składniki występowały w zjadanych
przez nie potrawach.
Z jakich więc przesłanek może wyjść badacz stawiający pytanie o istnienie związków między dietą
a występowaniem nowotworów? I jak powiązać skład
diety z ryzykiem powstawania nowotworów?
Nawet w krajach o dużym rozpowszechnieniu
nowotworów indywidualne ryzyko zachorowania na
określony nowotwór jest stosunkowo niskie i badania
kohortowe wymagałyby wielkiej liczby uczestników
oraz wieloletniej obserwacji z trudnym i zawodnym
sprawdzaniem narażenia, jakie stanowią spożywane
pokarmy. Kolejny problem stwarza dobranie grupy
kontrolnej. Przy niemal powszechnym występowaniu
narażenia, jakim jest spożywanie np. wędlin, grupa
kontrolna dobrana spośród wegetarian mogłaby się
różnić od grupy badanej tak wieloma nawykami ży-
© Copyright Narodowy Instytut Zdrowia Publicznego – Państwowy Zakład Higieny
714
Andrzej Zieliński
wieniowymi, a także innymi cechami, że wybranie do
analizy jednej określonej zmiennej budziłoby wiele
metodologicznych zastrzeżeń.
Są jednak dane, które pośrednio wskazują na
związek między rozpowszechnieniem nowotworów
w danej populacji a dominującymi w tej populacji obyczajami żywieniowymi. Mianowicie różne populacje
zamieszkujące różne obszary geograficzne i różniące
się zwyczajami żywieniowymi wykazują dość znaczne
różnice w występowaniu różnych typów nowotworów.
Nie można tych związków traktować jako dowód,
ze względu na możliwość występowania tzw. „błędu
ekologicznego”. W populacjach o dużym rozpowszechnieniu narażenia i dużym rozpowszechnieniu choroby,
narażenie nie musi koniecznie dotyczyć tych samych
osób, u których występuje choroba. Ale mając powyższe
wstępne dane jest już łatwiej zbadać to indywidualne
powiązanie w badaniach kliniczno-kontrolnych traktując jako zmienną nawet nie sam fakt spożywania danego
typu potrawy, ale oszacowany poziom spożycia.
Nawet jeżeli uznamy, że tak uzyskana wiedza ma
ograniczone prawdopodobieństwo, wnioski dla zdrowia
publicznego i działania zapobiegawcze powinny zawsze
stać po stronie zapobiegania chorobom, a nie po stronie
interesów grupowych producentów żywności.
Po stronie przeciwnej jest jednak argument, którego lekceważyć nie należy. Ludzie, którzy wszystkie
wątpliwości chcą wykorzystać do pozostania przy
szkodliwej dla nich diecie, mają do tego prawo. Tak jak
ma to miejsce w przypadku palenia papierosów, których
szkodliwe efekty w stosunku do nowotworów i chorób
serca są dowiedzione ponad wszelką wątpliwość, jednak
nie ma prawnych ani moralnych podstaw, aby osobie
dorosłej zabronić palenia. Co najwyżej można promować niepalenie papierosów i zakazywać palenia tam,
gdzie dym może oddziaływać na inne niepalące osoby.
Podobnie potrawy zawierające w odpowiednio dużych
stężeniach substancje, których efekt karcinogenny
został dowiedziony z wysokim stopniem prawdopodobieństwa, powinny być oznakowane, jako powodujące
zagrożenie zachorowaniem na nowotwór.
I zdecydowanie nie powinny być podawane dzieciom i młodzieży.
CZYNNIKI RYZYKA NOWOTWORÓW
ZWIĄZANE Z DIETĄ
Z punktu widzenia zdrowia publicznego podstawowy podział czynników ryzyka chorób dotyczy
możliwości zapobiegania chorobom przez eliminację
tych czynników lub zmniejszenie ich oddziaływania.
Przykładem czynników, na które nie można wpływać, są
czynniki genetyczne oraz zależne od wieku. Natomiast
czynniki ryzyka nowotworów o charakterze substancji
Nr 4
chemicznych zawarte w pokarmach mogą i powinny być
eliminowane z diety. Chociaż w niektórych przypadkach
jest to naprawdę trudne (1).
Substancje chemiczne o potencjale karcinogennym
mogą trafiać do potraw przez zanieczyszczenie nimi
środowiska i powierzchni warzyw lub paszy zwierząt
hodowlanych. Zanieczyszczenia mechaniczne w większości przypadków dają się usunąć w procesie mycia
owoców i warzyw.
Podobnie jak w przypadku jonów metali penetracja
wielu organicznych substancji rakotwórczych, w tym
wielopierścieniowych węglowodorów aromatycznych
(WWA) do tkanek warzyw, szczególnie korzeni i bulw
następuje mimo istnienia barier biologicznych (2).
Trudne do dokładnego oszacowania wpływy środowiskowych zanieczyszczeń na powstawanie nowotworów,
poza obszarami bardzo wysokiego skażenia, nie mają
wielkiego znaczenia jako indywidualne czynniki ryzyka nowotworów. Lecz nawet w obszarach niskiego
skażenia trzeba brać pod uwagę ich wpływ na niemal
całą lokalną populację (3).
Niektóre z tych substancji są syntetyzowane w roślinach jadalnych, jednak występują w nich w tak małych
stężeniach, że nie stanowią istotnego zagrożenia (4).
Z drugiej strony, niektóre produkty roślinne zawierają
substancje, które mają właściwości hamujące pewne
postacie raka. Są to: organiczne związki siarki, flawonoidy, taniny i karotenoidy. Występują one w niektórych
owocach oraz w warzywach kapustnych (cruciferous
vegetables), jak brokuły czy kalafiory. Nie są to jednak
stężenia wystarczające do tego, aby móc zasadnie orzec,
że spożywanie tych warzyw i owoców ma wpływ hamujący na powstawanie nowotworów (5).
Najpoważniejsze zagrożenia związane są z przygotowywaniem potraw mięsnych w wysokich temperaturach, a szczególnie w czasie grillowania i wędzenia (4).
W Polsce wędzenie było stosowane od niepamiętnych
czasów, zwykle w sposób „regulowany” obyczajami
i warunkami technicznymi trwałych lub improwizowanych urządzeń, ale w niedostatecznym stopniu
kontrolowane przez służby sanitarne. Natomiast grillowanie jest zwyczajem, który na szerszą skalę rozpowszechnił się w ostatnich dekadach i nadal zyskuje na
popularności. Na wielu spotkaniach towarzyskich na
świeżym powietrzu podawane jest grillowane mięso
i jego przetwory oraz ryby. Tymczasem zarówno żar, jak
i dym są przyczyną występowania w mięsie substancji
o potwierdzonym działaniu rakotwórczym, w tym wielopierścieniowych węglowodorów aromatycznych (6).
Triumfalistyczny ton polityków, którzy uzyskali
zwolnienie „tradycyjnych polskich wędlin” produkowanych na rynek wewnętrzny od zawartych w Regulacji
EC No. 1881/2006 ograniczeń zawartości w produktach mięsnych wielopierścieniowych węglowodorów
aromatycznych, nie spotkał się z odpowiednią reakcją
Nr 4
715
Dieta a czynniki ryzyka nowotworów
ani ze strony Ministerstwa Zdrowia, ani polskich służb
sanitarnych. Nie zostały również wprowadzone polskie
limity stężeń WWA dla wędlin produkowanych na rynek
wewnętrzny, co może być interpretowane jako zupełna
dowolność w stosowaniu technik wędzenia, prowadzących do niebezpiecznych stężeń WWA.
Tymczasem u osób, które nie palą papierosów,
właśnie dieta i aktywność fizyczna są podstawowymi
modyfikatorami ryzyka zachorowania na nowotwory
narządów wewnętrznych, które zależą od postępowania
indywidualnych osób i dlatego stanowią istotną domenę
promocji zdrowia. Bo jeżeli stężenia wielopierścieniowych węglowodorów aromatycznych w produktach
mięsnych podlegają regulacjom Komisji Europejskiej,
i powinny podlegać regulacjom krajowym, to ilość
spożywanych substancji rakotwórczych zawartych
w tych potrawach zależy też od tego, jak często są one
spożywane i w jakich ilościach.
W opinii American Cancer Society otyłość sama
w sobie jest czynnikiem ryzyka powstawania szeregu
nowotworów, a mianowicie: raka piersi u kobiet po
menopauzie, jelita grubego, nerek, przełyku, trzustki, endometrium, tarczycy i pęcherzyka żółciowego,
a w stosunku do kilku innych stwierdzono powiązanie
statystyczne niespełniające wymogów znamienności.
Niemal 1/3 nowotworów występujących w USA wśród
potencjalnych przyczyn zachorowania ma otyłość.
Z większym prawdopodobieństwem zachorowania na
nowotwór wiąże się nie tylko otyłość, która wystąpiła
w wieku dojrzałym, ale także wysoka waga urodzeniowa. Utrwalona redukcja masy ciała zmniejsza prawdopodobieństwo wystąpienia nowotworu, ale cykliczne
przybieranie na wadze i chudnięcie jest czynnikiem
ryzyka nowotworu.
Wśród mechanizmów wiążących otyłość z zapadalnością na nowotwory wymieniane są poziomy i modyfikacje działania hormonów, reakcje immunologiczne
i zapalne oraz związana z nimi aktywność szeregu
czynników, w tym interleukin (7).
WNIOSKI
1. W promocji zdrowia i działaniach związanych
z zapobieganiem nowotworom czynniki związane
z dietą zajmują nieproporcjonalnie mało miejsca
w stosunku do ich ważności, a obok zwalczania
palenia tytoniu stanowią najważniejszą sferę praktycznie bezkosztowych działań zapobiegawczych.
2. Konieczne jest też stałe uświadamianie władz administracyjnych i sił politycznych o odpowiedzialności
za wprowadzenie właściwej regulacji w zakresie
dopuszczania na rynek wewnętrzny produktów
żywnościowych o niskiej zawartości substancji
o potwierdzonym działaniu rakotwórczym.
3. Promocja zdrowego odżywiania powinna koniecznie
obejmować walkę z otyłością nie tylko w aspekcie
zapobiegania cukrzycy typu II oraz chorobom serca,
ale również w prewencji nowotworów.
Otrzymano: 31.07.2014 r.
Zaakceptowano do publikacji: 27.08.2014 r.
Adres do korespondencji:
Prof. Andrzej Zieliński
Zakład Epidemiologii Narodowego Instytutu
Zdrowia Publicznego-PZH
ul,Chocimska 24, 00-791 Warszawa
tel.22 54 21 204
XX JUBILEUSZOWY ZJAZD
Polskiego Towarzystwa Epidemiologów
i Lekarzy Chorób Zakaźnych
BYDGOSZCZ, OPERA NOVA
17-19 września 2015 r.
Serdecznie zapraszamy i zachęcamy Państwa
do udziału w tym spotkaniu naukowym
Zarząd Główny PTEiLChZ
Program Zjazdu oraz wszystkie informacje organizacyjne zostaną zamieszczone
wkrótce na stronie www.pteilchz.org.pl oraz www.batumi-agency.pl
Artykuł redakcyjny
Monika Wróbel-Harmas 1, Magdalena Krysińska 2, Jacek Postupolski 3, Mirosław J. Wysocki4
ZAGROŻENIA ZWIĄZANE ZE STOSOWANIEM SUPLEMENTÓW DIETY
W ŚWIETLE ANALIZY DANYCH Z INTERNETU
I DONIESIEŃ SYSTEMU RASFF
Samodzielna Pracownia Komunikacji Społecznej i Marketingu
Zakład Organizacji i Ekonomiki Ochrony Zdrowia oraz Szpitalnictwa
3
Zakład Bezpieczeństwa Żywności
4
Zakład Promocji Zdrowia i Szkolenia Podyplomowego
Narodowego Instytutu Zdrowa Publicznego - Państwowego Zakładu Higieny
1
2
STRESZCZENIE
CEL. Celem pracy jest ocena dostępnych informacji o suplementach diety na podstawie aktów prawnych oraz
RASFF w porównaniu z najbardziej popularnymi danymi dostępnymi w Internecie dla przyszłych i obecnych
konsumentów.
MATERIAŁ I METODY. Po dokonaniu analizy aktów prawnych oraz bazy RASFF (Rapid Alert System for Food
and Feed), autorzy postanowili sprawdzić, jakie informacje na temat suplementów diety może znaleźć internauta, mając do dyspozycji pierwszą stronę w wyszukiwarce Google.pl. Wyszukiwarka ta stanowiła narzędzie
badania, ponieważ jest najpopularniejsza wśród użytkowników Internetu. Postanowiono poddać analizie wyniki
wyszukiwania wyświetlone tylko na pierwszej stronie, czyli ok. 9-10 wyników, ponieważ na tym poszukiwania
treści internetowych kończy 91,5% użytkowników Internetu. Wzięto pod uwagę dwa hasła: „suplement” i „suplementy”, oraz sugerowane przez wyszukiwarkę hasła pod każdym z nich. Następnie poddano wyniki analizie
jakościowej i ilościowej.
WYNIKI. Najczęściej internauci wyszukiwali hasła: Suplementy (243 000 000), suplement (9 290 000), suplementy sklep (8 200 000). Z analizowanych treści zawartych na poszczególnych stronach można znaleźć informacje
o określonych danych produktach podane przez producentów, następnie informacje ogólne wyjaśniające czym
są suplementy i kiedy należy je stosować. Zdecydowanie rzadziej znajdujemy artykuły pisane przez ekspertów
(lekarzy, dietetyków, farmaceutów) o niebezpieczeństwach związanych z tymi produktami: zasadnością przyjmowania, czy problemem z znajdującymi się w preparatach niezadeklarowanych substancji. Nie znaleziono
ostrzeżeń, dotyczących konieczności dokonywania zakupu z legalnych i sprawdzonych źródeł.
WNIOSKI. Konieczna jest systematyczna edukacja konsumentów w zakresie racjonalnego stosowania suplementów diety. Celowe jest rozważenie zorganizowania systemu ostrzegawczego, monitorującego objawy niepożądane,
związane ze spożyciem suplementów diety i nowej w żywności w kraju. Potencjalny konsument w celu uzyskania
rzetelnych informacji, potwierdzających skład i działanie suplementów, powinien przede wszystkim zasięgnąć
opinii lekarza lub dietetyka. Względnie uzupełnić je z różnych źródeł, np. portali zajmujących się zdrowiem,
gdzie są umieszczane także artykuły przygotowywane przez lekarzy czy farmaceutów.
Słowa kluczowe: suplementy diety, stosowanie suplementów diety, działanie suplementów diety
WSTĘP
Suplementy diety są coraz bardziej popularne, a także
coraz częściej dostępne. Można je nabyć nie tylko w sklepach spożywczych, co wydaje się zgodne z ich definicją,
ale także w aptece, na siłowniach, a przede wszystkim
w Internecie. Zapoznając się z reklamami, można dojść
do wniosku, że produkty te pomagają na wszystkie możliwe schorzenia od wypadania włosów, przez problemy
z potencją do szybkiej utraty zbędnych kilogramów.
Producenci chętnie piszą o braku efektów ubocznych
i naturalnym pochodzeniu preparatu. Dodatkowo wej-
718
Monika Wróbel-Harmas, Magdalena Krysińska i inni
ściu wielu produktom na rynek towarzyszą agresywne
kampanie marketingowo-reklamowe. W rezultacie
konsumenci mogą dojść do wniosku, że w celu dbania
o własne zdrowie należy spożywać jak największe ilości
suplementów. W tym momencie konieczna jest refleksja,
dotycząca uzasadnienia dietetycznego i medycznego tak
szerokiego stosowania suplementów diety.
Poza szczególnymi stanami fizjologicznymi, np.
obniżona odporność, ciąża, nie zaleca się przyjmowania
suplementów diety przy prawidłowym odżywianiu. Należy także zwrócić uwagę na fakt, że skład preparatów
może różnić się od deklarowanego i zawierać nawet
substancje niebezpieczne. Jak wynika z badań wykonanych w USA 20-90% pacjentów ze zdiagnozowanymi
nowotworami używa suplementów diety, przy czym
stosowanie ich nie zawsze jest uzgodnione z lekarzem.
Podnoszony jest problem nie zawsze udowodnionej
skuteczności i podważania bezpieczeństwa produktów,
jak również możliwość interakcji lek-suplement diety.
Kluczowe znaczenie ma dobre porozumienie między
pacjentem i lekarzem. Celowe jest opracowanie zasad
stosowania suplementów diety przez pacjentów (1).
REGULACJE PRAWNE CHRONIĄCE
KONSUMENTÓW PRZED POWYŻSZYMI
ZAGROŻENIAMI ZE STRONY
NIEOGRANICZONEGO DOSTĘPU
DO SUPLEMENTÓW DIETY
Zgodnie z definicją podaną w Dyrektywie 2002/46/
WE w sprawie zbliżenia ustawodawstw Państw Członkowskich, odnoszących się do suplementów żywnościowych, suplementy diety to „środki spożywcze,
których celem jest uzupełnienie naturalnej diety, będące
skoncentrowanym źródłem witamin lub składników
mineralnych lub innych substancji wykazujących efekt
odżywczy, lub inny fizjologiczny, pojedynczych lub
złożonych, wprowadzane do obrotu w formie umożliwiającej dawkowanie” (2). Środki spożywcze definiowane są przez Rozporządzenie (WE) nr 178/2002 Parlamentu Europejskiego i Rady z dnia 28 stycznia 2002 r.:
„żywność (środek spożywczy) oznacza jakiekolwiek
substancje lub produkty, przetworzone, częściowo
przetworzone lub nieprzetworzone, przeznaczone do
spożycia przez ludzi, lub których spożycia przez ludzi
można się spodziewać” (3).
Najczęściej w skład suplementów diety wchodzą
witaminy, substancje mineralne, jak również składniki
roślinne i zwierzęce, jednakże występujące w żywności
i spożywane jako jej część. Przepisy, które stosuje się do
wyrobów medycznych, w tym wypadku nie obowiązują.
W naszym kraju podstawowymi aktami prawnymi
regulującymi aspekty związane z wprowadzeniem do
Nr 4
obrotu suplementów diety jest ustawa o bezpieczeństwie
żywności i żywienia (4) oraz rozporządzenie Ministra
Zdrowia w sprawie składu oraz oznakowania suplementów diety (5). Instytucją zajmującą się rejestracją
suplementów diety w Polsce jest Główny Inspektorat
Sanitarny (GIS), który zobowiązany jest do prowadzenia rejestru suplementów diety. Wprowadzanie po raz
pierwszy do obrotu suplementów diety odbywa się na
podstawie wniosku przedsiębiorcy, gdzie należy wskazać nazwę suplementu oraz producenta, przedstawić
również treść etykiety w języku polskim oraz adresata
pierwszego powiadomienia. Wszystkie niezbędne dokumenty znajdują się na stronie internetowej GIS (6).
Kolejnym krokiem przed dopuszczeniem do obrotu
suplementu diety jest przeprowadzenie przez Główny
Inspektorat Sanitarny postępowania wyjaśniającego,
którego celem jest sprawdzenie, czy ten suplement
diety spełnia wymagania określone w przepisach prawa, jak również w celu stwierdzenia, że suplement nie
posiada właściwości produktu leczniczego. W drugim
przypadku produkt podlega innym przepisom prawa
i nie jest traktowany jak środek spożywczy.
Warto jednak zaznaczyć, że od producentów suplementów diety nie wymaga się przed wprowadzeniem
do obrotu przedstawienia i wykonania szczegółowych
i kosztownych procedur rejestracji, jak również badań
klinicznych, które mogłyby potwierdzić skuteczność,
jakość oraz bezpieczeństwo ich stosowania, tak jak
w przypadku produktów leczniczych. Producenci nie
mają także obowiązku zamieszczania informacji o interakcjach z innymi substancjami, alkoholem czy lekami.
Jednakże zgodnie z art.30, ustawy o bezpieczeństwie
żywności i żywienia (4), w stosunku do suplementów
diety zawierających witaminy, składniki mineralne
lub inne substancje wykazujące efekt odżywczy lub
inny fizjologiczny, GIS może przeprowadzić procedurę wyjaśniającą skład, właściwości poszczególnych
składników oraz przeznaczenie przed dopuszczeniem
do obrotu.
W przypadku suplementów diety szczególną uwagę
należy poświęcić informacji przekazywanej konsumentowi. Zdecydowana większość suplementów diety
jest etykietowana i reklamowana przy wykorzystaniu
oświadczeń żywieniowych i zdrowotnych. Zgodnie
z definicjami podanymi w Rozporządzeniu w sprawie
oświadczeń żywieniowych i zdrowotnych dotyczących
żywności (7) „oświadczenie żywieniowe” oznacza każde oświadczenie, które stwierdza, sugeruje lub daje do
zrozumienia, że dana żywność ma szczególne właściwości odżywcze; „oświadczenie zdrowotne” oznacza
każde oświadczenie, które stwierdza, sugeruje lub daje
do zrozumienia, że istnieje związek pomiędzy kategorią
żywności, daną żywnością lub jednym z jej składników
a zdrowiem, a „oświadczenie o zmniejszaniu ryzyka
choroby” oznacza każde oświadczenie zdrowotne,
Nr 4
Zagrożenia związane ze stosowaniem suplementów diety
które stwierdza, sugeruje lub daje do zrozumienia, że
spożycie danej kategorii żywności, danej żywności
lub jednego z jej składników znacząco zmniejsza jakiś
czynnik ryzyka w rozwoju choroby dotykającej ludzi.
Producenci nie mogą dowolnie umieszczać takich
informacji na opakowaniach swoich produktów bądź
wykorzystywać ich w reklamie.
Dozwolone jest posługiwanie się tylko tymi oświadczeniami żywieniowymi, które zostały wymienione
w wykazie oświadczeń żywieniowych, stanowiącym
załącznik do ww. rozporządzenia. Komisja Europejska
dokonuje takiego wpisu po uzyskaniu pozytywnej opinii
EFSA (European Food Safety Authority), uzyskanej na
podstawie dostarczonych przez producenta dowodów
naukowych, potwierdzających prawdziwość proponowanego oświadczenia.
Oświadczenia zdrowotne są dopuszczalne jedynie
pod warunkiem umieszczenia następujących informacji:
stwierdzenie wskazujące na znaczenie zrównoważonego sposobu żywienia i zdrowego trybu życia; ilość środka spożywczego i poziom jego spożycia niezbędny do
uzyskania korzystnego działania, o którym mówi dane
oświadczenie; w stosownych przypadkach, stwierdzenie skierowane do osób, które powinny unikać danego
środka spożywczego i odpowiednie ostrzeżenie w przypadku produktów, które mogą stanowić zagrożenie dla
zdrowia, jeżeli są spożywane w nadmiarze.
Niedozwolone są oświadczenia, które sugerują, że
niespożycie danej żywności mogłoby mieć wpływ na
zdrowie; oświadczenia, które odwołują się do szybkości lub wielkości obniżenia masy ciała; oświadczenia,
które odwołują się do zaleceń poszczególnych lekarzy
lub specjalistów w zakresie zdrowia i innych stowarzyszeń, innych niż wymienione w powyżej przytoczonym
rozporządzeniu.
Wobec zwiększającej się podaży suplementów
żywności na rynku krajowym (8), na producentach
spoczywa szczególna odpowiedzialność dostarczenia
konsumentowi rzetelnej i wyczerpującej informacji
odnośnie działania i przeznaczania oferowanych produktów. Konsumenci są skazani na samodzielne studiowanie informacji na temat suplementów i szerokie
zapoznanie się z rynkiem, aby kupić właściwe preparaty: czyli o sprawdzonym składzie i z kontrolowanego
źródła. W Polsce został powołany Klaster Zdrowia przez
Narodowy Instytut Leków, przyznający certyfikat jakości. Zgodnie z regulaminem dostępnym na stronie www.
klasterzdrowia.pl (9): „Celem przyznania Certyfikatu
Jakości jest promocja produktów o udokumentowanej
i potwierdzonej badaniami jakości i bezpieczeństwie
stosowania, głównie w celu ich identyfikacji na rynku
przez konsumentów, poprzez wykorzystanie Znaku
Certyfikatu Jakości”.
719
BEZPIECZEŃSTWO SUPLEMENTÓW DIETY
W SYSTEMIE RASFF
Celem usunięcia źródeł zagrożeń związanych ze
spożyciem żywności potencjalnie niebezpiecznej dla
zdrowia ludzi, Unia Europejska wprowadziła System
Wczesnego Ostrzegania o Niebezpiecznej Żywności
i Paszach - RASFF (10), który powinien chronić konsumentów przed ryzykiem wystąpienia zachorowań.
System ten, mający charakter sieci wymiany informacji
istnieje w UE od 1978 roku. Stał się on ważnym elementem polityki ochrony zdrowia ludności, który polega na zbieraniu i szybkim przekazywaniu informacji
o produktach żywnościowych, materiałach i wyrobach
przeznaczonych do kontaktu z żywnością i środkach
żywienia zwierząt, mogących stanowić zagrożenie dla
zdrowia konsumentów.
W ramach Systemu Wczesnego Ostrzegania o Niebezpiecznej Żywności i Paszach (RASFF) istnieją trzy
typy powiadomień:
• powiadomienie alarmowe - oznacza powiadomienie
o zagrożeniu, które wymaga lub może wymagać
natychmiastowego działania przez innego krajowego
członka sieci RASFF;
• powiadomienie informacyjne - oznacza powiadomienie o zagrożeniu, które nie wymaga natychmiastowego działania.
Powiadomienie informacyjne może być związane
z produktem, w którym wykryto poważne ryzyko,
jednak znajduje się on jedynie w obrocie lokalnym,
na ograniczonym terenie, nie został wprowadzony do
obrotu lub już nie znajduje się w obrocie:
• powiadomienie o odrzuceniu produktu na granicy.
Ponadto wszelkie informacje, które nie zostały
przesłane w formie powiadomienia alarmowego informacyjnego lub o odrzuceniu na granicy, a są uznane za
istotne pod względem bezpieczeństwa żywności i pasz,
są przekazywane jako News.
W ramach Systemu RASFF dokonywana jest
ocena stopnia zagrożenia dla zdrowia ludzi w wyniku
zaistnienia w obrocie żywności, pasz lub materiałów
i wyrobów do kontaktu z żywnością, szkodliwych dla
zdrowia jak również niebezpiecznych z punktu widzenia
ochrony środowiska.
Kryteria zgłaszania produktów niebezpiecznych
zostały określone w Rozporządzeniu (WE) nr 178/2002
Parlamentu Europejskiego i Rady z dnia 28 stycznia
2002 r. (3). Rozporządzenie to przewiduje, że Państwa
Członkowskie niezwłocznie powiadamiają Komisję,
w ramach systemu wczesnego ostrzegania, o każdym
podjętym działaniu, którego celem jest ograniczenie
wprowadzania na rynek lub wycofanie żywności lub
pasz dla ochrony zdrowia ludzkiego i wymagającym
szybkiego działania, jak również każdym odrzuceniu,
720
związanym z ryzykiem dla zdrowia żywności lub pasz,
na granicy Unii Europejskiej.
Zakres powiadomień obejmuje przypadki bezpośredniego lub pośredniego ryzyka dla zdrowia człowieka. RASFF nie obejmuje sytuacji, w których brak jest
bezpośredniego lub pośredniego ryzyka dla zdrowia
człowieka. Oznacza to, że w określonych sytuacjach,
kiedy doszło do niezgodności z ustawodawstwem dotyczącym bezpieczeństwa żywności, nie ma konieczności
powiadamiania innych Państw Członkowskich - kryterium decydującym, jak wspomniano powyżej, jest brak
ryzyka dla zdrowia człowieka.
Analizując regulacje prawne dotyczące suplementów diety i RASFF, należy pamiętać, że choć są to źródła
informacji dostępne dla wszystkich, gdyż są w Internecie, ale wiedzą o nich i potrafią z nich wyciągnąć
właściwe wnioski jedynie specjaliści. Dlatego autorzy
postanowili sprawdzić, jakie informacje może znaleźć
konsument, mając do dyspozycji pierwszą stronę w wyszukiwarce Google.pl (11).
MATERIAŁ I METODY
Badanie informacji, które może odnaleźć internauta
na stronach www przeprowadzono 18-19 września
2014 roku. Narzędziem badania była wyszukiwarka
Google.pl jako najpopularniejsza wśród użytkowników
Internetu (11). Postanowiono poddać analizie wyniki
wyszukiwania wyświetlone tylko na pierwszej stronie,
czyli ok. 9-10 wyników, ponieważ na tym poszukiwania
treści internetowych kończy 91,5% ludzi. Na kolejne
strony przechodzi 4,8% (12).
Do Google.pl postanowiono wpisać dwa hasła: suplement oraz suplementy, czyli różnicą jest tylko liczba
pojedyncza versus mnoga. Następnie przeanalizowano
wyniki (portale) pod względem rodzaju treści, jakie
prezentują na temat suplementów. Wzięto pod uwagę
wyszukiwania podobne do suplement/suplementy, czyli
to co sugeruje wyszukiwarka pod każdym wpisywanym
hasłem. Dodatkowo przeanalizowano liczbę wyników
wyszukiwania dla haseł. Nie wzięto pod uwagę wyników wyszukiwania oznaczonych, jako „reklama”.
WYNIKI
Po analizie haseł „suplement” oraz „suplementy”,
a następnie tych sugerowanych przez Google.pl, nie
pojawiły się hasła dotyczące potencji/erekcji i jak widać
z danych z tabeli I. są one na ostatnim miejscu, a najbardziej internauci są zainteresowani odchudzaniem
i sklepami z suplementami.
Wyniki wyszukiwania przedstawia ryc. 1. Pierwsze
wyszukiwane hasło to „suplement”. Wyniki wyszukiwa-
Nr 4
nia, które pojawiły się na pierwszym miejscu dotyczyły
suplementu, jako dodatku (uzupełnienia) w wydawnictwach. Dopiero kolejnym hasłem był suplement diety.
Na 10 wyników, 3 wyniki dotyczyły suplementów diety.
Analizując pod względem zawartych informacji
strony o suplementach, można się dowiedzieć, że są to
produkty, które służą do uzupełnienia codziennej diety
o brakujące składniki typu witaminy czy składniki
mineralne. Nie są to jednak leki, tylko żywność, choć
obecność w aptece utożsamia je w oczach konsumentów z produktami leczniczymi. Jak wynika z badań
przeprowadzonych przez TNS OBOP „Świadome
samoleczenie w Polsce” 41% respondentów uważa, że
suplementy diety mają działanie lecznicze (13). Istnieją
także produkty z pogranicza definicji leku i żywności
(14). Wyświetla się również strona stowarzyszenia
Krajowej Rady Suplementów i Odżywek (KRSiO),
którego celem jest oddziaływanie na tworzenie regulacji
prawnych, wspieranie prac badawczych i inne działania chroniące interesy zrzeszonych producentów oraz
rozpowszechnianie rzetelnych informacji wśród konsumentów. Wymienieni są także producenci należący do
stowarzyszenia (KRSiO), (15).
Można znaleźć informacje, że suplementy służą
do uzupełnienia normalnej diety, natomiast, jeżeli
prawidłowo się odżywiamy, nie musimy ich zażywać,
a znajdują one zastosowanie tylko w wyjątkowych sytuacjach, np. przy obniżonej odporności. Wśród osób
przyjmujących suplementy diety w ciągu ostatniego
roku ponad połowa przyjmowała je, by uzupełnić codzienną dietę (54%) i zwiększyć odporność organizmu
(52%) u zaledwie 13% polecił je lekarz (13). Kolejne
dostarczane dane mówią, że za dużo witamin może
zaszkodzić, a suplementy odchudzające nie powodują
likwidacji istniejącej tkanki tłuszczowej (16). Internauta
zapoznając się z reklamami dostępnymi w Internecie
nie dowie się jednak, że suplementy muszą być kupowane z wiarygodnych źródeł, także w przypadku
zakupu w sklepach internetowych. Z uwagi na nader
ograniczone możliwości kontroli preparaty oferowane
w tych sklepach mogą być podrabiane, zawierać substancje niezadeklarowane w składzie, substancje czynne
lub ich analogi używane w produkcji leków, a nawet
substancje zakazane przez prawo, co może doprowadzić
do groźnych następstw dla zdrowia i życia.
Google poleca na 8 sugerowanych haseł 5 dotyczących tematu niniejszego artykułu, czyli diety, odchudzania, czy „suplementu na stawy”. Przeszukując stronę
z wynikami dla „suplement diety” internauta znajdzie
szeroki zakres informacji, od regulacji prawnych (6),
poprzez kupno przez Internet, strony producentów do
portali z artykułami ostrzegającym o niebezpieczeństwie nieprzemyślanego przyjmowania suplementów,
czy niebezpiecznymi substancjami znajdowanymi
w niektórych preparatach na odchudzanie (17, 18).
Nr 4
Zagrożenia związane ze stosowaniem suplementów diety
W wynikach „suplement na odchudzanie” znajdują się
głównie sklepy, fora/społeczność, gdzie można wymienić informacje odnośnie preparatów dostępnych na rynku. Tylko dwa wyniki zawierały oparte na podstawach
naukowych opinie, czym są i jak działają „suplementy
na odchudzanie”. Podobnie było w przypadku rezultatów przy wyszukiwaniu informacji o „suplement na
stawy” (ryc.2).
Po zmianie hasła na „suplementy” (zmiana liczby
pojedynczej na mnogą) 100% wyników dotyczyło
suplementów diety. Dodatkowo, jeden wynik dotyczył
definicji, pozostałe dotyczyły sklepów i koncentrowały się na sprzedaży suplementów dla sportowców,
czy klientów siłowni, nazywanych także odżywkami
(ryc.3).
Sugerowane hasła do wyszukania dla „suplementy”
dotyczyło głównie portali z informacjami dla osób,
którym zależy na zwiększeniu „masy”, czy „siły”, „zbudowaniu rzeźby” oraz na odchudzaniu. Wymienione
były sklepy, fora, a także strona producenta odżywek dla
sportowców, osób uczęszczających na siłownię (Ryc.4).
Najwięcej wyników dotyczących diety pojawia się
po wpisaniu hasła „suplementy”. Najczęściej wyszukiwane suplementy przeznaczone są dla sportowców
(określane jako „na masę, rzeźbę, siłę”). Jednak nie są
to strony informująco-edukujące o produktach, tylko
sklepy. Na drugim miejscu są ogólne strony zawierające informacje o suplementach diety, a na trzecim - na
odchudzanie.
DYSKUSJA
Suplementy diety według prawa są środkami spożywczymi, czyli podlegającymi innej regulacji prawnej
niż produkty lecznicze, fakt ten może być wykorzystany
przez nieuczciwych producentów. Dodatkowo niesłuszną opinię o tym, że suplementy diety poddawane są takiej samej kontroli jakości jak leki bez recepty wyraziło
50% badanych (13).W efekcie może to za sobą nieść
negatywne konsekwencje dla zdrowia.
Unia Europejska wprowadzając RASFF, w celu
ochrony konsumentów przed niebezpiecznymi produktami, umożliwiła wymianę informacji w krajach
UE i EEA dotyczącymi m.in. suplementów diety.
W 2013 roku łącznie przekazano 3205 zgłoszeń pierwotnych. Dla grupy produktów „żywność dietetyczna,
suplementy diety, żywność wzbogacona” (dietetic
foods, food supplements, fortified foods). Zgłoszono
160 przypadków, w tym 33 powiadomienia alarmowe,
19 powiadomień informacyjnych, 55 powiadomień
o odrzuceniu produktu na granicy, resztę stanowiły
informacje o podjętych działaniach (follow - up).
W zakresie zanieczyszczeń chemicznych zwracają
uwagę wysokie poziomy zanieczyszczenia metalami
721
szkodliwymi dla zdrowia (dotyczyły one rtęci - 9 zgłoszeń, ołowiu - 9 zgłoszeń, arsenu 4 zgłoszenia. Należy
zauważyć, że niektóre zgłoszenia dotyczyły przekroczenia najwyższych dopuszczalnych poziomów dla
więcej niż jednego pierwiastka). W jednym przypadku
stwierdzono zbyt wysokie poziomy zanieczyszczenia
wielopierścieniowymi węglowodorami aromatycznymi (WWA). Cztery zgłoszenia dotyczyły złej jakości
mikrobiologicznej produktów.
Specyficzną przyczyną, ograniczoną w zasadzie do
suplementów diety, jest stosowanie aktywnych fizjologicznie, nieautoryzowanych substancji w celu wywołania działania metabolicznego lub medycznego (około
60% zgłoszeń pierwotnych). Najczęściej wymieniane są
następujące związki: DMMA (3,4- dimetoksy - N- metyloamfetamina) (3,4-Dimethoxy-N-methylamphetamine) 7 zgłoszeń, fenyloftaleina (7 zgłoszeń), sildenafil
i pochodne (13 zgłoszeń), synefryna (16 zgłoszeń),
johimbina (4 zgłoszenia), sibutramina (5 zgłoszeń),
inne 10 zgłoszeń. Substancje te były stwierdzane w produktach ziołowych lub zawierających wyciągi roślinne,
często deklarowanych jako „naturalne” lub „tradycyjne”
i nie były deklarowane na etykietach. Substancje te
były stwierdzane w preparatach wspomagających odchudzanie (DMMA, fenoloftaleina, synefryna, sibutramina) i poprawiających erekcję (sildenafil i pochodne,
johimbina).
Substancje takie jak DMMA i inne pochodne
amfetaminy mogą powodować arytmię serca, mogącą
w skrajnych przypadkach prowadzić do niewydolności
krążenia i wycieńczenia organizmu. Podobne działanie
mogą wywierać analogi efedryny, np. synefryna. Fenoloftaleina jest związkiem o gwałtownym działaniu
przeczyszczającym. Stosowanie sildenafilu jest niewskazane u osób z chorobą niedokrwienną serca, nadciśnieniu tętniczym, arytmii oraz po świeżo przebytym
zawale serca (19).
Podobne wyniki dotyczące nielegalnych i niedeklarowanych substancji aktywnych były podane w raporcie
OMCL (Official Medicines Control Laboratory) dotyczącym badania suplementów diety wspomagających
odchudzanie (20).
W suplementach stwierdza się również surowce,
które powinny być autoryzowane jako nowa żywność (novel food). Są to głownie produkty używane
w medycynie Dalekiego Wschodu, niestosowane jako
żywność w Europie. Również dowody naukowe na
deklarowane działania tych składników są bardzo ograniczone. Przykładem może być grzyb Corilus versicolor
(wrośniak różnobarwny). Przypisywane jest mu działanie przeciwnowotworowe, które jak i bezpieczeństwo
jego stosowania, nie jest naukowo potwierdzone.
Niezdeklarowane stosowanie substancji aktywnych
jest poważnym problemem dotyczącym suplementów
diety, jak również stanowi wyzwanie dla organów
722
urzędowej kontroli żywności. Konieczne jest wdrożenie
nowych zakresów badań, rutynowo ni związanych do
tej pory z bezpieczeństwem żywności, dotyczących
identyfikacji i ilościowego oznaczania składników aktywnych i wykrywania substancji nieautoryzowanych.
WNIOSKI
1. Konieczna jest systematyczna edukacja konsumentów w zakresie racjonalnego stosowania suplementów diety.
2. W celu uzyskania rzetelnych informacji, potwierdzających skład i działanie suplementów, potencjalny
konsument powinien przede wszystkim zasięgnąć
opinii lekarza lub dietetyka. Może również wesprzeć się informacjami z różnych źródeł, np. portali
zajmujących się zdrowiem, gdzie są umieszczane
także artykuły przygotowane przez lekarzy czy
farmaceutów.
3. Celowe jest rozważenie zorganizowania systemu
ostrzegawczego, monitorującego objawy niepożą-
Nr 4
dane związane ze spożyciem suplementów diety
i nowej żywności w kraju.
4. W przypadku urzędowej kontroli i monitoringu
suplementów diety konieczne jest wykonywanie
badań, dotyczących identyfikacji i ilościowego
oznaczania składników aktywnych i wykrywania
substancji nieautoryzowanych, jak również zwrócenie uwagi na niebezpieczeństwo mikrobiologiczne
i zanieczyszczenia chemiczne.
Otrzymano:29.09.2014 r.
Magdalena Krysińska
Narodowy Instytut Zdrowa Publicznego - Państwowy
Zakład Higieny
Zakład Organizacji i Ekonomiki Ochrony Zdrowia oraz
Szpitalnictwa
ul. Chocimska 24, 00-791 Warszawa
Tel.48 22 54 21 295, 48 22 54 21 245
Problemy zakażeń
Joanna Ewa Drozd-Sokołowska1, Grażyna Dulny2, Anna Waszczuk-Gajda1,
Wiesław Wiktor-Jędrzejczak1
OGNISKO GRYPY A H1N1 W ODDZIALE HEMATOLOGII
PO ZAKOŃCZONEJ PANDEMII
Department of Haematology, Oncology and Internal Diseases,
Medical University of Warsaw, Poland
2
Epidemiological Service, Central Clinical Hospital, Medical University of Warsaw, Poland
1
STRESZCZENIE
WSTĘP. W 2009 roku rozpoznano pandemię grypy A H1N1, w przebiegu której na całym świecie doszło do
rozwoju infekcji układu oddechowego. W sierpniu 2010 roku Światowa Organizacja Zdrowia oficjalnie ogłosiła, że zakończył się okres pandemii, wydała równocześnie zalecenia postępowania w tym okresie, obejmujące
między innymi ścisły nadzór nad nowymi ogniskami epidemicznymi infekcji dróg oddechowych i zgonów.
W artykule przedstawiamy wystąpienie ogniska epidemicznego grypy A H1N1 w okresie popandemicznym
w oddziale hematologicznym. Analizujemy potencjalne czynniki ryzyka, sposób szerzenia się zakażenia, jak
również podejmujemy próbę sformułowania zaleceń postępowania w analogicznej sytuacji.
MATERIAŁ I METODY Retrospektywna analiza pacjentów hospitalizowanych w okresie od grudnia 2010 do
marca 2011 roku, u których rozpoznano grypę A H1N1, lub u których na podstawie obrazu klinicznego rozpoznanie to było bardzo prawdopodobne.
WYNIKI U czternastu pacjentów doszło do nagłego wystąpienia ostrej niewydolności oddechowej. W tej grupie
u 9 chorych stwierdzano dodatni test paskowy przesiewowy w kierunku grypy, u 8 uzyskano dodatni wynik testu
potwierdzającego PCR. Pomimo mechanicznej wentylacji stosowanej u 8 chorych i oseltamiwiru u 11 chorych, 9
pacjentów zmarło z powodu ciężkiej niewydolności oddechowej. 10 pacjentów z tej grupy było leczonych w oddziałach zamkniętych z izolacją ochronną wg CDC. Równoczasowo nie stwierdzano zakażenia grypą w innych
oddziałach szpitala. Nie odnotowaliśmy również podobnych zachorowań na grypę w późniejszym okresie czasu.
WNIOSKI Wystąpienie ogniska epidemicznego grypy w oddziale hematologicznym wskazuje, że w okresie
po zakończonej pandemii możliwe jest wystąpienie tego rodzaju ostrej infekcji. Niezbędne jest bezzwłoczne
wykonanie badań diagnostycznych i szybkie wdrożenie leczenia. Zdarzenie to ponadto potwierdza konieczność
profilaktycznego szczepienia pacjentów i personelu przeciwko grypie.
Słowa kluczowe: grypa A H1N1, ognisko epidemiczne, powikłania
WSTĘP
W 2009 roku zgodnie z obwieszczeniem Światowej Organizacji Zdrowia (WHO) wirus grypy A H1N1
doprowadził na całym świecie do wystąpienia ognisk
epidemicznych zakażeń układu oddechowego przebiegających z gorączką. Zakażenie wirusem grypy
odnotowano łącznie w 214 krajach; ponad 500 000 osób
zachorowało, z czego 18 849 zmarło (dane na dzień 1
sierpnia 2010) (1). W Polsce w okresie od maja 2009
do września 2010 r. odnotowano 400 potwierdzonych
zachorowań, które doprowadziły do 131 zgonów (2).
W sierpniu 2010 r. WHO ogłosiła, że zakończył się
okres pandemii i wydała zalecenia postępowania na ten
czas, obejmujące między innymi identyfikację ognisk
epidemicznych ciężkich infekcji układu oddechowego
i zgonów z tym związanych (3). Zalecenia te wprowadzono również w Polsce. Według danych Narodowego
Instytutu Zdrowia Publicznego, Warszawa, Polska,
w okresie od 6 września 2010 do 27 marca 2011 roku
zarejestrowano 226 zakażeń wirusem A/H1(v) w Polsce.
W tym okresie nie obserwowano ani zwiększenia częstości występowania, ani cięższego przebiegu zakażenia
w populacji ogólnej (2).
724
Joanna Drozd-Sokołowska, Grażyna Dulny i inni
Jednak w okresie od grudnia 2010 do marca 2011
roku niespodziewanie doszło do pojawienia się ogniska
epidemicznego grypy A H1N1 w oddziale hematologii.
W artykule przedstawiamy poniższą sytuację.
MATERIAŁ I METODY
Badanie zostało zaakceptowane przez Komisję Bioetyczną przy Warszawskim Uniwersytecie Medycznym.
Pacjenci. Rozpoznanie lub podejrzenie grypy o ciężkim
przebiegu wysunięto łącznie u 14 chorych na choroby
układu krwiotwórczego, leczonych w Klinice Hematologii, Onkologii i Chorób Wewnętrznych Warszawskiego Uniwersytetu Medycznego (Warszawa, Polska)
w okresie od grudnia 2010 do marca 2011 roku. W tym
czasie w klinice hospitalizowano łącznie 358 chorych
(190 kobiet, 168 mężczyzn; mediana wieku: 62 lata,
zakres: 18–97 lat). W tym samym czasie zaledwie u 4
pacjentów leczonych w innych oddziałach (992 łóżka,
12 748 hospitalizacji) rozpoznano grypę na podstawie dodatniego testu reakcji łańcuchowej polimerazy
(PCR). Przebieg kliniczny zakażenia był łagodny w tej
grupie chorych. Nie hospitalizowano w tym okresie
pacjentów o przebiegu klinicznym mogącym sugerować rozpoznanie grypy, u których nie wykonano testu
w kierunku grypy H1N1, jak również nie odnotowano
epidemii w Warszawie, czy w innych regionach kraju.
Struktura oddziału hematologii. Oddział Hematologii, w którym doszło do wystąpienia ogniska epidemicznego grypy, zbudowany jest z 3, przylegających do
siebie pododdziałów. Możliwość przemieszczenia się
pomiędzy poszczególnymi odcinkami jest ograniczona. Odcinek A jest oddziałem 17-, odcinek B 16-, zaś
odcinek C 26-łóżkowym.W każdym z pododdziałów
zatrudniony jest odrębny personel pielęgniarski. W pododdziałach A i B obowiązują zasady ochronnej izolacji.
Chorzy przyjmowani do tych oddziałów nie przechodzą
okresu kwarantanny, pod warunkiem, że nie występują
u nich objawy aktywnej infekcji. Rodziny mogą odwiedzać pacjentów hospitalizowanych w pododdziale
C; pacjenci z tego pododdziału mogą wychodzić poza
oddział, w tym do szpitalnej restauracji.
Badania diagnostyczne. U chorych z objawami sugerującymi infekcję układu oddechowego, takimi jak
gorączka, duszność, kaszel, jak również zmianami
radiologicznymi w tomografii komputerowej wysokiej
rozdzielczości, sugerującymi śródmiąższowego zapalenia płuc, przeprowadzano badania diagnostyczne w kierunku grypy A H1N1. Wykonywanie badań na szeroką
skalę rozpoczęto po uzyskaniu pierwszego dodatniego
wyniku badania u chorego (drugi chory w analizowanej
grupie). Chorzy, u których uzyskano dodatni wynik
testu przesiewowego mieli wykonywane badanie potwierdzające PCR. Badanie PCR wykonano również
Nr 4
u chorych, u których pomimo ujemnego wyniku testu
przesiewowego, istniało duże kliniczne prawdopodobieństwo grypy. Pozostałe badania, zarówno z krwi,
jak i obrazowe wykonywane były odpowiednio do potrzeb. Nie wykonywano rutynowo badania PCR w celu
potwierdzenia wyeliminowania wirusa po ustąpieniu
objawów klinicznych.
Badania stosowane do laboratoryjnego potwierdzenia
zakażenia wirusem A H1N1.
Test przesiewowy w kierunku grypy. Do badań przesiewowych używano paskowego testu Influenza A/B 2
Panel Test 4A470 firmy Gecko Pharma Vertrieb GmbH
(Ahrensburg, Germany), o czułości 76.3% i swoistości
92% wg producenta.
Badanie łańcuchowej reakcji polimerazy (PCR).
Materiał biologiczny do oceny laboratoryjnej pozyskiwano z wymazów z błony śluzowej gardła i nosa.
Kwasy nukleinowe izolowano z próbek za pomocą zestawu High Pure Viral Nucleic Acid Kit (Roche Applied
Science, Penzburg, Upper Bavaria, Germany) zgodnie
z wytycznymi producenta. Badanie PCR z odwrotną
transkryptazą w czasie rzeczywistym przeprowadzano
przy użyciu Quantification of Swine H1N1 Influenza
Human Pandemic Strain Advanced Kit i Precision
OneStepTM qRT-PCR MasterMix (PrimerDesign Ltd.,
Southampton UK). Mieszaninę reakcyjną przygotowywano zgodnie z zaleceniami producenta, z niewielkimi
modyfikacjami. Fragment genu ß-aktyny był powielany
w każdym badaniu, żeby potwierdzić jakość matrycy
i wykluczyć zahamowanie reakcji PCR. Jednostopniową reakcję real-time RT PCR przeprowadzano w cyklerze Light Cycler® 2.0 (Roche Applied Science). Po
odwrotnej transkrypcji (55°C, 10 minut) i aktywacji
enzymu (95°C, 8 minut) następowało 50 cykli denaturacji w 95°C przez 10 sekund, a następnie przyłączenie
starterów i elongacja w 60°C przez 1 minutę; dane
gromadzono po zakończeniu wszystkich etapów.
Metoda analizy retrospektywnej. Historie chorób pacjentów z rozpoznaną grypą albo wysokim klinicznym
prawdopodobieństwem zakażenia były analizowane pod
kątem: rozpoznania i stopnia zaawansowania choroby
podstawowej, parametrów morfologii krwi obwodowej,
powikłań zakażenia, wpływu leczenia na przeżycie,
i całkowitego czasu przeżycia chorych. Dodatkowo
przeprowadzono analizę możliwości dróg rozprzestrzenienia się wirusa grypy w trakcie wystąpienia ogniska
epidemicznego.
Analiza statystyczna. Do podstawowych obliczeń
wykorzystano oprogramowanie STATISTICA 9.0
software (StatSoft, Inc., Tulsa, OK, USA). Zmienne
ciągłe przedstawiono jako medianę i zakres. Ze względu na małą liczebność grupy nie wykonywano testów
statystycznych.
Nr 4
Ognisko grypy AH1N1 w Oddziale Hematologii
WYNIKI
U 8 z 14 badanych chorych uzyskano dodatni
wynik badania PCR w kierunku grypy A H1N1. U pozostałych 6 chorych nie wykonano testu (początkowy
okres epidemii), albo uzyskano wynik ujemny pomimo
bardzo sugestywnego obrazu klinicznego. Chorzy z potwierdzonym rozpoznaniem grypy za pomocą badania
PCR są w dalszej części artykułu przedstawieni jako
oddzielna grupa. Żaden z chorych nie został zaszczepiony przeciwko grypie w roku poprzedzającym zachorowanie. Wśród personelu medycznego, około połowa
pielęgniarek i większość lekarzy była szczepiona,
aczkolwiek we wszystkich pododdziałach pracowały
osoby nieszczepione.
Czas wystąpienia grypy i sposób szerzenia się zakażenia wirusem grypy A H1N1. Prawdopodobnie do
pierwszych zachorowań doszło w styczniu i na początku
lutego 2011 roku. W początkowym okresie u dwojga
chorych (kobiety i mężczyzny), bez formalnego potwierdzenia grypy, wystąpiła niewydolność oddechowa.
U jednego z tych chorych nie wykonano badań w kierunku grypy, podczas gdy u drugiej osoby wykonano jedynie test przesiewowy (wynik ujemny). Pacjenci ci byli
hospitalizowani w pododdziale z ochronną izolacją (A).
U obojga niezbędne było zastosowanie mechanicznej
wentylacji z powodu niewydolności oddechowej. U pacjenta z ujemnym wynikiem testu przesiewowego we
wczesnym okresie poprzeszczepowym dodatkowo doszło do krwawienia do ośrodkowego układu nerwowego
i niewydolności wielonarządowej z towarzyszącym
zespołem rozsianego wykrzepiania śródnaczyniowego,
podczas gdy u pacjentki niewydolność oddechowa była
głównym problemem medycznym.
Pod koniec stycznia wystąpiły dwa nowe zachorowania w drugim z pododdziałów (B) z odwrotną izolacją
(jedno potwierdzone, drugie bardzo prawdopodobne;
obydwa z ujemnym wynikiem badania przesiewowego; obydwa przebiegające z ciężką niewydolnością
oddechową i jawnym klinicznie krwawieniem do
pęcherzyków płucnych wymagających mechanicznej
wentylacji). Około tydzień później pojawiło sie nowe
zachorowanie u pacjenta na oddziale otwartym (C).
Warto wspomnieć, że w tym samym czasie wizytę ambulatoryjną w oddziale dziennym, zlokalizowanym na
tym samym piętrze odbył kolejny chory, który w ciągu
kilku dni po tej wizycie zmarł z powodu niewydolności
oddechowej w szpitalu rejonowym.
Dwoje pacjentów, u których podejrzewano grypę
było hospitalizowanych w oddziale z ochronną izolacją, na długo przed tym podejrzeniem, dlatego mało
prawdopodobne wydaje się zakażenie tych pacjentów
przez innych chorych. Istniały następujące możliwości
wystąpienia tych zakażeń – pacjenci ci albo (i) zostali
zakażeni przez bezobjawowy personel, albo (ii) na
725
skutek upośledzenia odporności doszło u nich do aktywacji latentnego zakażenia, albo (iii) że chorzy zostali
zakażeni w środowisku pozaszpitalnym i przyjęci do
szpitala przed rozwinięciem się objawów, co mogło
dotyczyć omawianej pacjentki. Jak jednak wspomniano,
nie odnotowywano w tym czasie zwiększenia zachorowań na grypę w populacji ogólnej.
Do kolejnej epidemii grypy doszło na początku
marca 2011 roku. Większość zakażeń rozpoznano
u chorych w pododdziale B (cztery zachorowania potwierdzone badaniem PCR w dwóch przylegających do
siebie salach chorych), 1 zachorowanie w pododdziale
z odwrotną izolacją (A) i 2 (dodatni wynik testu przesiewowego, ujemny testu PCR) w oddziale otwartym (C).
Opis reprezentatywnego przypadku. 48-letnia chora
została przyjęta do kliniki w grudniu 2010 roku z powodu wznowy ostrej białaczki szpikowej (AML) po
zabiegu przeszczepienia allogenicznych macierzystych
komórek krwiotwórczych (SCT). W badaniu cytometrycznym płynu mózgowo-rdzeniowego stwierdzono
obecność blastów. Wdrożono leczenie wysokimi dawkami arabinozydu cytozyny. W okresie mielosupresji
po chemioterapii chora gorączkowała, nie stwierdzano
natomiast innych cech zakażenia. Stosowano antybiotykoterapię o szerokim spektrum; wykonany test
przesiewowy w kierunku grypy był ujemny. W celu
wyjaśnienia przyczyny gorączki wykonano również
badanie tomografii komputerowej wysokiej rozdzielczości (HRCT), w którym opisano zagęszczenia typu
matowej szyby sugerujące krwawienie do pęcherzyków
płucnych. Początkowo chora nie zgłaszała duszności,
niemniej w ciągu kilku godzin doszło do gwałtownego
pogorszenia się stanu chorej; w badaniu gazometrycznym krwi tętniczej stwierdzono cechy niewydolności
oddechowej, z ciśnieniem parcjalnym tlenu 36.5 mm
Hg. Rozpoczęto tlenoterapię, podano glikokortykosteroidy. Cztery dni później po nagłym zatrzymaniu oddechu
chorą zaintubowano i rozpoczęto mechaniczną wentylację. Pomimo stosowania leczenia przeciwbakteryjnego
i intensywnego leczenia objawowego nie uzyskano
poprawy stanu chorej. Chora aktywnie krwawiła do
układu oddechowego, w badaniu gazometrycznym
obserwowano narastającą hiperkapnię przy niskim
ciśnieniu parcjalnym tlenu. Powtórzono badania w kierunku grypy, uzyskując dodatni wynik zarówno testu
przesiewowego, jak i potwierdzającego. W momencie
uzyskania dodatniego wyniku badania przesiewowego,
tj. po 7 dniach od rozpoczęcia mechanicznej wentylacji,
do leczenia natychmiast dołączono oseltamiwir w standardowej dawce podawany przez zgłębnik żołądkowy.
Pomimo to stan chorej uległ dalszemu pogorszeniu
i następnego dnia chora zmarła wśród objawów krwawienia do układu oddechowego. Na uwagę zasługuje
fakt, że była to pierwsza chora z analizowanej grupy
z potwierdzonym rozpoznaniem grypy.
726
Pacjenci z potwierdzonym rozpoznaniem grypy
A H1N1. Zakażenie wirusem grypy A H1N1 potwierdzono u dwóch mężczyzn i 6 kobiet (mediana wieku:
57.5 roku). Czterech chorych chorowało na ostrą
białaczkę szpikową (jeden był w pierwszej remisji
całkowitej w trakcie leczenia konsolidującego, dwóch
w trakcie leczenia indukcyjnego, u jednej osoby rozpoznano nawrót po allogenicznym przeszczepieniu
komórek krwiotwórczych); dwóch na ostrą białaczkę
limfoblastyczną (77 i 155 dni po zabiegu alloSCT); jedna osoba na zespół mielodysplastyczny z towarzyszącą
gruźlicą, jedna na amyloidozę łańcuchów lekkich z zajęciem serca, leczoną wysokodawkowaną chemioterapią
wspomaganą przeszczepieniem własnych komórek
krwiotwórczych uzyskanych z krwi obwodowej.
Mediana czasu od wystąpienia objawów do rozpoznania grypy w badanej grupie wyniosła 3 dni (0-11).
U jednego chorego nie występowały objawy zakażenia.
Czas od wystąpienia objawów do rozpoczęcia leczenia
oseltamiwirem mieścił się w zakresie od 0 do 11 dni
(mediana 2 dni).
W momencie rozpoznania trzech pacjentów miało
neutropenię <0.5 G/l, trzech liczbę neutrofilów mieszczącą się w zakresie 0.5-1.5 G/l, dwóch prawidłową
liczbę neutrofilów. Pięciu chorych miało limfopenię
<0.8 G/l (≥2 stopień w klasyfikacji Common Terminology Criteria for Adverse Events, wersja 3.0 (4))
przed wystąpieniem grypy, w tym 3 poniżej 0.3 G/l (jak
w analizie Ljungmana i wsp (5)). Mediana czasu trwania
limfopenii wyniosła odpowiednio: dla <0.8 G/l - 10 dni
(3-25), dla <0.3 G/l - 0 dni (0-25). U 7 chorych występowała małopłytkowość (mediana 27 G/l, 2-68 G/l),
u 7 niedokrwistość (mediana: 9.7 g/dl; 6.8–10.6 g/dl).
Wszyscy chorzy z wyjątkiem jednego mieli zwiększone
stężenie białka CRP (C-reactive protein). U czterech
chorych występowała dodatkowo inna choroba układu
oddechowego (zapalenie płuc o różnej etiologii).
W badaniach tomografii komputerowej wysokiej
rozdzielczości stwierdzano zagęszczenia typu matowej
szyby, zagęszczenia pęcherzykowe, pogrubienie przegród międzyzrazikowych i możliwość krwawienia do
pęcherzyków płucnych. U 6 chorych rozwinęła się niewydolność oddechowa, u 4 wymagająca mechanicznej
wentylacji. Najczęściej stwierdzaną nieprawidłowością
w badaniu gazometrycznym krwi tętniczej była retencja
CO2. Trzech pacjentów rozwinęło dodatkowo niewydolność nerek (jeden wymagał leczenia nerkozastępczego),
4 wstrząs septyczny z towarzyszącą hipotensją.
Pięciu chorych zmarło w wyniku powikłań grypy.
Bezpośrednią przyczyną zgonu była niewydolność wielonarządowa u 2 chorych, i u pojedynczych chorych:
wstrząs posoczniczy o etiologii Enterococcus spp.,
krwawienie do układu oddechowego, nagła śmierć
sercowa u chorego na amyloidozę z zajęciem mięśnia
sercowego. Trzech pacjentów, którzy przeżyli, otrzy-
Nr 4
mywało oseltamiwir przez 11-17 dni (mediana 11 dni).
Badanie PCR oceniające eliminację wirusa po zakończeniu leczenia wykonano jedynie u jednego chorego.
Uzyskano wynik ujemny.
Godny zaznaczenia jest fakt, że czworo pacjentów
hospitalizowanych poza naszym oddziałem w podobnym okresie, u których rozpoznano grypę A H1N1
potwierdzoną badaniem PCR, miało łagodny przebieg
choroby i zostało wypisanych do domu po 5-14 dniach
hospitalizacji. Chorzy ci byli leczeni głównie w oddziałach internistycznych, nie w oddziale intensywnej
terapii.
Chorzy z objawami sugerującymi rozpoznanie grypy
(tj. niewyjaśnioną gorączką, dusznością, kaszlem,
krwawieniem do układu oddechowego i niewydolnością oddechową). Powyższe objawy wystąpiły u 4
mężczyzn i 2 kobiet. Mediana wieku wyniosła 49 lat
(41-69). Rozpoznania hematologiczne obejmowały:
ostrą białaczkę szpikową, ostrą białaczkę limfoblastyczną, szpiczaka plazmocytowego, przewlekłą białaczkę mielomonocytową, białaczkę prolimfocytową
T-komórkową i chłoniaka rozlanego z dużych komórek
B. Dwóch chorych było po zabiegu alloSCT (w trakcie
procedury i rok po zabiegu), jeden chory po zabiegu
autoPBSCT (+14 doba). U dwóch chorych uzyskano
dodatni wynik badania przesiewowego w kierunku
grypy, podczas gdy wynik badania potwierdzającego
PCR był ujemny; jeden chory miał ujemny wynik badania przesiewowego i niestety nie wykonano u niego
badania potwierdzającego, u kolejnego chorego nie
wykonano ani badania przesiewowego ani potwierdzającego z przyczyn logistycznych, zaś jeden chory zmarł
w innym szpitalu z powodu niewydolności oddechowej
wkrótce po wizycie w oddziale dziennym.
Przed wystąpieniem objawów mogących sugerować rozpoznanie grypy, u pięciu chorych występowała
limfopenia <0.8 G/l, u dwóch <0.3 G/l. Mediana czasu
trwania limfopenii wyniosła odpowiednio: dla <0.8 G/l
– 3 dni (2-19), dla <0.3 G/l – 0 dni (0-12). w momencie
wystąpienia zakażenia dwóch pacjentów było w agranulocytozie (0 G/l), u jednego liczba neutrofilów wynosiła
0.7 G/l, zaś kolejnych dwóch miało prawidłową liczbę
neutrofilów. U pięciu chorych występowała małopłytkowość (mediana: 34 G/l, 4-53 G/l), u pięciu niedokrwistość – (mediana stężenia hemoglobiny wynosiła
8.7 g/dl, 8.6–11.3 g/dl).
Pięciu chorych wymagało tlenoterapii z powodu
niewydolności oddechowej; z tego 4 – mechanicznej
wentylacji. Podobnie jak w grupie chorych z potwierdzonym rozpoznaniem – również w tej grupie jeden
chory rozwinął niewydolność nerek, jeden krwawił do
układu oddechowego.
Czterech chorych z podejrzeniem grypy zmarło:
trzech z powodu niewydolności oddechowej, jeden
z powodu niewydolności wielonarządowej. Dwóch
Nr 4
Ognisko grypy AH1N1 w Oddziale Hematologii
pacjentów, którzy przeżyli, mieli dodatni wynik testu
przesiewowego. Jeden chory został utracony z dalszej
obserwacji po kilkunastu miesiącach.
DYSKUSJA
W artykule opisujemy dramatyczny przebieg zakażenia wywołanego wirusem grypy A H1N1 u pacjentów
oddziału hematologicznego w okresie po zakończonej
pandemii. Podkreślenia wymaga fakt, że w tym okresie
nie stwierdzano zwiększenia częstości zachorowań
na grypę w populacji ogólnej. Ponadto, w okresie
kiedy w populacji ogólnej stwierdzano epidemię grypy A H1N1 w sezonie 2009-2010, zaledwie kilkoro
„naszych” chorych przebyło infekcję o łagodnym
przebiegu. Również w okresie kolejnych 18 miesięcy
po wystąpieniu relacjonowanego ogniska epidemicznego w naszym oddziale nie odnotowano zachorowań
o podobnym przebiegu.
Nie jest możliwe precyzyjne ustalenie źródła
zakażenia u poszczególnych chorych, niemniej trzy
potencjalne możliwości muszą być brane pod uwagę.
Po pierwsze bezobjawowi pacjenci, będący w okresie
wczesnym zakażenia przed przyjęciem do kliniki,
mogli rozwinąć pełnoobjawową infekcję czy to po
chemioterapii, czy też wskutek upośledzenia odporności z powodu choroby podstawowej. Po drugie,
źródłem zakażenia mógł być bezobjawowy personel,
szczególnie osoby nie w pełni przestrzegające zasad
izolacji. Po trzecie pacjenci mogli zakażać się jeden
od drugiego, gdyż wobec pacjentów nie stosowano
izolacji kontaktowej. Nie można wykluczyć żadnej
z powyższych możliwości, jak również należy mieć
na uwadze, że mogła zaistnieć więcej niż jedna z nich.
Jest mało prawdopodobne, żeby jedna osoba – pacjent
lub członek personelu - była przyczyną wystąpienia
ogniska epidemicznego. Zarówno chorzy jak i personel
z poszczególnych pododdziałów nie mają możliwości
kontaktu ze sobą. Jedynie w trakcie drugiego epizodu
epidemii większość zakażonych chorych hospitalizowana była w oddziale z ochronną izolacją (B); chorzy
przebywali w sąsiadujących salach i mogli je opuszczać,
co w konsekwencji mogło skutkować zakażaniem kolejnych chorych. Scenariusz ten wydaje się najbardziej
prawdopodobny w tym przypadku.
Mimo iż zakażenie wirusem grypy wywołuje ostrą
infekcję i z reguły nie przebiega w postaci bezobjawowego przetrwałego zakażenia (6), nie można całkowicie
wykluczyć reaktywacji takiego zakażenia u pacjentów
z obniżoną odpornością. W dostępnej literaturze mało
jest danych na temat biologii wirusa A H1N1 u chorych
z ciężkim niedoborem odporności, np. po przeszczepieniu macierzystych komórek krwiotwórczych, niemniej
część autorów sugeruje przedłużone wydalanie wirusa
727
w tej grupie pacjentów (7,8). Souza i wsp. (9) wykazali,
że w grupie chorych na nowotwory, otrzymujących
leczenie immunosupresyjne czas wydalania wirusa
wynosił 23 dni, z zakresem sięgającym od 11 do aż
63 dni. Z tego względu w naszej opinii część chorych
mogła służyć za rezerwuar wirusa. Nie jest możliwe
ustalenie, która z zaproponowanych wcześniej możliwości i z jakim prawdopodobieństwem była odpowiedzialna za wystąpienie ogniska epidemicznego. Wydaje
się, że wszystkie te możliwości należy traktować jako
równie prawdopodobne i w konsekwencji rozważyć
opłacalność codziennego badania chorych i personelu
medycznego przed wejściem na oddział w kierunku
zakażenia wirusem grypy, szczególnie w typowym dla
występowania grypy sezonie.
Niezwykle ważnym zagadnieniem jest zdefiniowanie czynników ryzyka ciężkiego przebiegu i zgonu
w przebiegu grypy pacjentów hematologicznych.
W odróżnieniu od Ljungmana i wsp. (5), którzy stwierdzili, że limfopenia jest istotnym czynnikiem ryzyka
zgonu w grupie chorych po zabiegu przeszczepienia
macierzystych komórek krwiotwórczych, nie zaobserwowaliśmy takiej zależności u naszych chorych,
zarówno dla limfopenii poniżej 0.8 G/l jak i poniżej
0.3 G/l. Warto zaznaczyć jednak, że w analizowanej
przez nas grupie chorych było tylko dwóch pacjentów
po zabiegu SCT, zaś zdecydowaną większość stanowili
chorzy niepoddani transplantacji. Dlatego grupy te nie
są w pełni porównywalne. Małopłytkowość w istotny
sposób negatywnie wpływała na prawdopodobieństwo przeżycia. Analogiczne zjawisko obserwowali
Cordero i wsp. (10). W analizowanej przez nas grupie,
żaden chory z małopłytkowością poniżej 50 G/l nie
przeżył zakażenia. Można to wytłumaczyć częstym
krwawieniem do pęcherzyków płucnych, wikłającym
zakażenie dolnych dróg oddechowych, doprowadzającym w konsekwencji do niewydolności oddechowej
i ostatecznie zgonu. Ponadto częściej dochodziło do
zgonu u pacjentów z ciężką niedokrwistością. W odróżnieniu od Cordero i wsp. (10), stwierdzaliśmy hipoksemię u 66.7% chorych, podczas gdy w ich badaniu
zaledwie 10.7% chorych z upośledzeniem odporności
i zakażeniem rozwijało hipoksemię. Podsumowując,
najważniejszymi czynnikami ryzyka są małopłytkowość
i niedokrwistość.
U pacjentów z obniżoną odpornością niezwykle
trudne jest różnicowanie ostrych objawów zakażenia
w okresie po zakończonej epidemii/ pandemii grypy.
Często rozwijają oni gorączkę neutropeniczną lub może
u nich dojść do zakażenia spowodowanego większością
znanych patogenów. Pomimo to powinno się zachęcać hematologów do przeprowadzania diagnostyki
w kierunku infekcji grypowej, szczególnie u chorych
gorączkujących, z zakażeniem układu oddechowego
i szybkiego wdrożenia leczenia przeciwwirusowego.
728
Cordero i wsp. (10) wykazali, że wczesne rozpoczęcie
leczenia przekłada się na poprawę przeżycia. Pomimo
iż wyszczepialność w ogólnej populacji jest niska (11),
powinno się zalecać szczepienia pracownikom ochrony zdrowia, członkom rodziny pacjentów i pacjentom
z upośledzeniem odporności, nawet jeżeli ich skuteczność będzie ograniczona (12-14).
PODSUMOWANIE I WNIOSKI
W artykule opisaliśmy nietypowe ognisko epidemiczne grypy A H1N1 w oddziale hematologii, którego
wystąpienia nie można było przewidzieć na podstawie
sytuacji epidemiologicznej w populacji ogólnej kraju.
Dziewięciu z 14 chorych zmarło. Grypa A H1N1 nie
stanowi typowego czynnika ryzyka zakażeń w grupie
chorych hematologicznych.
Pomimo iż brak jest formalnego potwierdzenia,
wydaje się, że rutynowe szczepienie chorych hematologicznych, ich rodzin i personelu ochrony zdrowia
mogłoby zmniejszyć ryzyko wystąpienia ognisk epidemicznych grypy. Ponadto edukacja lekarzy, wczesne
Nr 4
wykonywanie badań diagnostycznych i bezzwłoczne
wdrożenie leczenia oseltamiwirem mogłoby przełożyć
się na zmniejszenie śmiertelności.
PODZIĘKOWANIA
Chcielibyśmy podziękować panu dr n. med.
Jarosławowi Paciorkowi z Wojewódzkiej Stacji Sanitarno-Epidemiologicznej w Warszawie, który był
odpowiedzialny za badanie PCR i udostępnił nam dane
dotyczące procedury.
Wiesław Wiktor-Jędrzejczak
Klinika Hematologii, Onkologii i Chorób Wewnętrznych
Warszawski Uniwersytet Medyczny
Ul. Banacha 1a
Tel. 0 22 599 28 18, Fax. 0 22 599 14 18
Problemy zakażeń
Katarzyna W. Pancer1, Włodzimierz Gut1, Edyta Abramczuk1, Bożena Lipka2, Bogumiła Litwińska1
CZYNNIKI WIRUSOWE OSTRYCH ZAKAŻEŃ DRÓG ODDECHOWYCH
U MAŁYCH DZIECI. WZROST ZACHOROWAŃ WYWOŁANYCH PRZEZ
METAPNEUMOWIRUSY PODCZAS PANDEMII GRYPY 2009 W POLSCE
Zakład Wirusologii Narodowego Instytutu Zdrowia Publicznego
-Państwowego Zakładu Higieny w Warszawie
2
Instytut Pomnik - Centrum Zdrowia Dziecka w Warszawie
1
STRESZCZENIE
W Polsce w większości hospitalizowanych przypadków zapaleń płuc (ogółem ponad 70 000 rocznie) nie określono czynnika etiologicznego (J18 z ICD -10). Ponadto diagnostyka wirusowych zakażeń dróg oddechowych
ograniczona jest do grypy, ewentualnie RSV.
CELEM badań było określenie czynników wirusowych, innych niż grypa, będących przyczyną hospitalizacji
381 dzieci w wieku od 1 dnia do 5 lat, w okresie X.2008 - IV.2011.
MATERIAŁ I METODY. W próbkach z nosogardzieli poszukiwano RSV, HMPV, HEV/HRV, HPIV 1-3, HAdV
oraz HBoV.
WYNIKI. Wynik dodatni uzyskano u 72,7% pacjentów. Dominującym zakażeniem było RSV (49 %), a następnie HEV/HRV (15,5% ); HMPV (8,7%), adenowirusy (7,4%), HPIVt.1 -3 (5,8%) i HBoV (5,5%). W oparciu
o medianę liczby hospitalizowanych dzieci w miesiącu wyróżniono 7 okresów, w tym 3 ze zwiększoną liczbą
zachorowań (powyżej mediany). Zakażenia RSV występowały w każdym okresie ale dominowały w 5 spośród
7, szczególnie w przypadkach zakażeń dolnych dróg oddechowych. Natomiast w 2 pozostałych okresach dominowały inne wirusy: hMPV (3 okres) oraz HEV/HRV (5). Stwierdzono, że obserwowane objawy zakażenia HMPV
zmieniały się w zależności od okresu badań. W okresie dominacji HMPV wykrywano także liczne zakażenia
górnych dróg oddechowych wywołane tym wirusem.
WNIOSKI. Stosunkowo duża częstość ostrych zakażeń górnych dróg oddechowych lub zapaleń oskrzeli, spowodowanych przez HBoV lub HMPV u małych dzieci wymaga dodatkowych badań epidemiologicznych oraz
poszerzenia możliwości diagnostycznych o badania wirusologiczne, wykrywające także inne niż grypa i RSV
wirusy.
Słowa kluczowe: ostre zakażenie dróg oddechowych u małych dzieci, sezonowość RSV, HMPV, HBoV
WSTĘP
Zakażenia i choroby układu oddechowego są jedną
z głównych przyczyn hospitalizacji w Polsce (rocznie
ok. 7-8 %). Wśród niemowląt i dzieci wskaźnik ten jest
zazwyczaj wyższy: u niemowląt 15-17 %, a u dzieci
w wieku 1-4 r.ż. ok.30% (J00 - J99 wg. Międzynarodowej Statystycznej Klasyfikacji Chorób i Problemów
Zdrowotnych, 10 edycji [ICD- 10]). W ostatnich latach
zakażenia te były przyczyną ok. 40% wszystkich hospitalizacji związanych z chorobami układu oddechowego rocznie (2009 - 43,6%; 2010 - 42,7%). Jednak
wskaźnik ten osiągnął 90% u niemowląt (91% w 2009
roku; 89,5% w 2010 r.) a 70% wśród dzieci w wieku
1-4 r.ż. (73,5% w 2009 r.; 72,8% w 2010 r.) (J00 - J22
z ICD - 10). W tych grupach pacjentów, wirusy są częstym czynnikiem etiologicznym ostrych zakażeń dróg
oddechowych, w tym zapaleń płuc, zapaleń oskrzelików
płucnych czy zapalenia oskrzeli. W Polsce w większości tych przypadków wymagających hospitalizacji nie
określono czynnika etiologicznego (J18 z ICD - 10).
W roku 2009 – odnotowano ogółem 75 191 takich
przypadków, a w roku 2010 - 72 694 (1). Diagnostyka
ostrych wirusowych zakażeń układu oddechowego
wciąż napotyka na trudności w naszym kraju. Może to
być spowodowane kilkoma czynnikami: dużą liczbą
730
Nr 4
Katarzyna W Pancer, Włodzimierz Gut i inni
możliwych czynników etiologicznych, podobnymi
objawami w przebiegu zakażenia różnymi wirusami,
pojawiającymi się nowymi wariantami wirusów lub nowych wirusów. Wszystko to powoduje, ze koszty badań
diagnostycznych są znaczne. Z tego powodu, w Polsce
diagnostyka wirusowych zakażeń dróg oddechowych
jest często ograniczona do identyfikacji wirusów grypy, a czasem RSV. W takiej sytuacji, co roku w Polsce
nieznana jest etiologia ponad 50% przypadków ostrego
wirusowego zakażenia dróg oddechowych. Natomiast
w wielu krajach (Wielka Brytania, Kanada, USA itp.)
prowadzony jest nadzór nad zakażeniami dróg oddechowych i czynnikami je wywołującymi, takimi jak
wirusy grypy, RSV oraz szeregiem innych wirusów,
a profil badanych czynników wirusowych jest stale
uaktualniany (2-4).
Celem naszych badań było: 1. Określenie udziału
czynników wirusowych (innych niż grypa) w ostrych
wirusowych zakażeniach dróg oddechowych wśród
hospitalizowanych niemowląt i dzieci; 2. Analiza
aktywności wirusów wywołujących zakażenia układu
oddechowego badanych w poszczególnych latach,
miesiącach i okresach zwiększonej liczby zachorowań.
Okresy zwiększonej liczby hospitalizacji wyróżniono
na podstawie mediany liczby hospitalizowanych dzieci
w danym miesiącu.
WYNIKI
Co najmniej jeden czynnik wirusowy zakażenia wykryto u 277 spośród 381 badanych pacjentów (72,7%).
Dominowały zakażenia RSV (187/381 dzieci; 49%), następnie wywołane przez enterowirusy (15,5%); HMPV
(8,7%), adenowirusy (7,4%), HPIV typ 1,2,3 - (5,8%)
i HBoV (5,5%). Stwierdzono różnice w aktywności poszczególnych wirusów w kolejnych latach. Najwyższe
zróżnicowanie udziału wirusów w zakażeniach dróg
oddechowych stwierdzono dla HMPV – zachorowania
wywołane przez te wirusy stanowiły 2% w 2011 r., ale
21,2% w 2009 r. Podobnie istotne różnice stwierdzano w częstości zakażeń HEV/HRV (2,9% w 2008 r.
vs. 33,3% w 2011 r.). Natomiast istotnych różnic
w częstości zakażeń HAdV, HBoV i HPIV typu 1-3
w kolejnych latach nie stwierdzono (Po>0,05), a istotne
zróżnicowanie aktywności wirusów w kolejnych 31
miesiącach stwierdzono dla wszystkich badanych wirusów, z wyjątkiem HBoV (Fig.1), i w kolejnych tygoMATERIAŁ I METODY
dniach – z wyjątkiem HAdV. Najwyższe zróżnicowanie
częstości zakażeń w kolejnych tygodniach stwierdzono
Materiał do badań stanowiły wymazy z nosogar- dla RSV w 2010 r. (Po = 0,0026), HMPV – w 2009 r.
dzieli pobrane od 381 dzieci i niemowląt w wieku od (Po = 0,0000) oraz HEV/HRV – w 2011r. (Po = 0,0027).
pierwszego dnia życia do 5 lat, hospitalizowanych
Zakażenia RSV występowały głównie w okresie od
z powodu ostrej wirusowej infekcji dróg oddechowych grudnia do kwietnia, jednak stwierdzono, że podczas
w okresie od października 2008 r. do kwietnia 2011 r. 3 kolejnych sezonów zimowo-wiosennych krzywa
Dane na temat wieku badanych dzieci i głównych ob- epidemiczna zachorowań RSV znacznie się różniła
jawów uzyskano od 346 pacjentów.
(Fig. 2) i miała różny przebieg. W sezonie 2009-2010
Większość badanych dzieci stanowiły dzieci naj- liczba zachorowań RSV narastała nagle i gwałtownie
młodsze - poniżej 6 miesiąca życia (62%), następnie aż do maksimum w marcu 2010 r., natomiast w sezonie
w wieku 6-12 m. (30%). Chłopcy stanowili 57,5% 2008-2009 wzrost liczby zachorowań był wolniejszy
wszystkich badanych.
i stwierdzono dwa szczyty tych zachorowań (w grudniu
W próbkach wymazu poszukiwano metodą PCR 2008 r. i lutym 2009 r.). Najwolniej narastała liczba
swoistych fragmentów genomu DNA wirusów: ade- zakażeń RSV w sezonie 2010-2011, choć nie można
nowirusów (HAdV) i bokawirusów (HBoV) oraz RNA wykluczyć kolejnego szczytu zachorowań w maju 2011
wirusów takich jak: RSV, metapneumowirus człowieka – już po zakończeniu badań.
(HMPV), enterowirusy/rinowirusy (HEV/HRV), wiruPonieważ ostre zakażenia dróg oddechowych mogą
sy paragrypy typu 1-3 (HPIV t.1-3) z zastosowaniem być wywołane przez różne wirusy, wyróżniono okresy
opisanych wcześniej starterów (5-9).
zwiększonej liczby hospitalizowanych dzieci – bez
Ponadto w 273 próbkach wymazu poszukiwano względu na określony (lub nie) czynnik etiologiczny
antygenu HMPV (Biotrin HMPV antygen EIA; Irlan- zachorowania. Podział na okresy oparto na wartości
dia) (10).
mediany liczby hospitalizowanych dzieci w danym
Analiza statystyczna danych demograficznych, miesiącu (mediana wynosiła 10 pacjentów/miesiąc). Na
sezonowości występowania wirusów wykonano przy tej podstawie wyróżniono 7 okresów (Fig.1), w tym 3
użyciu STATGRAPHICS dla Windows, Centurion, okresy o zwiększonej liczbie hospitalizowanych dzieci
v.XV. StatPointTech.Inc.USA. Do jakościowej/katego- oraz 4 – gdy liczba dzieci hospitalizowanych z powodu
rycznej analizy zastosowano tabele krzyżowe danych, ostrych zakażeń dróg oddechowych nie przekraczała
testy niezależności (χ2 lub dokładne testy Fishera). 10 w danym miesiącu. Okresy o zwiększonej liczbie
Ponadto przeprowadzono analizy stopnia powiązań. zachorowań to: drugi (XII.2008 - II.2009), czwarty
Nr 4
Czynniki wirusowe ostrych zakażeń dróg oddechowych u małych dzieci
(I-VI.2010) i szósty (XII.2010 - III.2011), natomiast
okresy o niższej liczbie pacjentów to: pierwszy (X XI.2008), trzeci (III - XII.2009), piąty (VII - XI.2010)
i siódmy (IV.2011).
Następnie przeprowadzono analizę częstości
zakażeń poszczególnymi wirusami w wyróżnionych
okresach. We wszystkich okresach odsetek pacjentów,
u których zidentyfikowano co najmniej jeden czynnik
etiologiczny wynosił >50% (z wyj. pierwszego okresu
w 2008r.), natomiast najwyższy zanotowano w okresie
siódmym (87,5%) oraz trzecim (85%). Udział badanych
wirusów w poszczególnych okresach zmieniał się. Zakażenia RSV stwierdzono we wszystkich 7 wyróżnionych okresach, ale dominowały w pięciu (1,2 ,4, 6 i 7)
i były to na ogół miesiące od późnej jesieni do wiosny.
Zakażenia wywołane przez inne wirusy dominowały
w lecie i jesienią – w 3 okresie HMPV , natomiast w 5
- HEV/HRV oraz HPIV). Ponadto w poszczególnych
okresach zaobserwowano wysoki udział innych wirusów np.: HAdV - w okresach 3 i 4-tym; HBoV - w 2
oraz HEV/HRV – w 6 (ryc.3.A).
Przeprowadzono także analizę głównych objawów
klinicznych w zależności od okresu oraz czynnika etiologicznego zakażeń. Najczęściej dzieci były hospitalizowane z powodu zapalenia płuc (51%), a następnie
ostrego zapalenia oskrzeli (19%) i ostrych infekcji górnych dróg oddechowych (18%). Natomiast najcięższe
postacie zakażenia dolnych dróg oddechowych były
nieliczne i były to zapalenie oskrzelików płucnych (7%)
i pneumobronchiolitis (5%). Zapalenia płuc rozpoznano
u ponad 50% pacjentów w 5 okresach (3-7), natomiast
w okresie pierwszym i drugim dominowały przypadki
obejmujące zapalenie oskrzeli i ostre zakażenie górnych
dróg oddechowych („ inne ARTI”) (Fig.3.B). Zapalenie
oskrzelików płucnych i pneumobronchiolitis znamiennie częściej obserwowano w 4. i 2 okresie – aż 75%
wszystkich przypadków bronchiolitis zaobserwowano
w 4 okresie, gdy również obserwowano bardzo wysoką
liczbę zakażeń RSV. Należy zauważyć, że w okresach
o zwiększonej liczbie hospitalizowanych pacjentów
obserwowano także wyższą częstość i zróżnicowanie
ciężkich zakażeń dolnych dróg oddechowych. Ostre
zakażenie górnych dróg oddechowych były przyczyną
hospitalizacji 60 pacjentów, spośród 20-tu przyczyną był RSV (tylko 1,2% wszystkich RSV dodatnich
przypadków), u 7 - hMPV (23% hMPV dodatnich),
u 7 - HEV/HRV (14% ), u 5 - HBoV (38,5 %), u 4 HPIV typu 1-3 (18,2 %) oraz u 3 - HAdV (tylko 9,4%
wszystkich HAdV dodatnich).
Bardziej szczegółowej analizy wymaga nieoczekiwany wzrost zakażeń HMPV w 2009 r. W okresie
tym większość zakażeń HMPV stwierdzono wśród
dzieci od 6 miesięcy do 1 r. ż. (60%) oraz poniżej 6
miesiąca życia (36%). Natomiast w innych okresach
większość dzieci z zakażeniem HMPV było młodszych
731
niż 6 m.ż. (75%). Ogółem u dzieci zakażonych HMPV
stwierdzano głównie ostre infekcje górnych dróg oddechowych (23%), a następnie zapalenie oskrzeli (30%)
i zapalenie płuc (27%). Jednak dzieci z rozpoznaniem
ostrego zakażenia górnych dróg oddechowych były
hospitalizowane wyłącznie w 2009 roku i tylko w trzecim okresie. Różnica ta jest istotna statystycznie, mimo
że analizowana grupa HMPV-dodatnich pacjentów
nie była liczna (Po=0,0000) (Fig.4). Zakażenia HBoV
również znamiennie częściej były wykrywane wśród
przypadków z ostrym zakażeniem górnych dróg oddechowych lub oskrzeli niż w przypadkach zapaleń płuc
i/ lub bronchiolitis (Po = 0,0123). W drugim okresie we
wszystkich zdiagnozowanych zakażeniach HBoV obserwowano zakażenia górnych dróg oddechowych lub
zapalenie oskrzeli, jako główne objawy zachorowania.
DYSKUSJA
System nadzoru wirusowych chorób zakaźnych
układu oddechowego w Polsce ograniczony jest właściwie do grypy. Problem zakażeń innymi niż wirus
grypy, czynnikami wirusowymi jest wciąż niedoceniany, zwłaszcza wśród małych dzieci. W innych krajach
system nadzoru nad wirusowymi zakażeniami układu
oddechowego obejmuje więcej czynników. W Kanadzie
zgłaszane są zakażenia wirusami grypy (A i B), RSV,
HPIV typu 1-4, HMPV, HRV, HAdV i koronawirusami.
W USA zgłaszane są zachorowania wywołane przez
wirusy grypy, RSV, HPIV i HAdV, natomiast w Anglii
i Walii bada się aktywność wirusów grypy, HAdV, RSV,
HPIV i HRV (2-4).
Celem naszej pracy było określenie częstości występowania zakażeń dróg oddechowych, wywołanych
przez wirusy inne niż grypa, wśród dzieci hospitalizowanych w warszawskim szpitalu przez 31 miesięcy trwania
badania (2008-2011). Ponadto przeprowadzono analizę
sezonowości występowania zidentyfikowanych wirusów. Wysoki odsetek wykrytych wirusów w zebranych
próbkach (72,7% dodatnich) jest efektem zastosowania
szerokiego panelu badanych wirusów (RSV, HMPV,
HEV/HRV, HPIV typu 1,2,3 oraz HAdV i HBoV) oraz
dobrej współpracy z lekarzami. Ze względu na wiek
pacjentów (<5 r.ż.) nie uwzględniono wirusów grypy
w panelu wykrywanych czynników. Liczba zachorowań
na grypę wśród dzieci poniżej 5 r.ż. zazwyczaj była
niższa w porównaniu z liczbą zakażeń RSV lub innymi
wirusami oddechowymi (11-15). Co więcej, podczas
pandemii grypy A/H1N1v.2009 w większości szpitali/w przychodniach stosowano przesiewowe badania
w kierunku grypy.
W naszych badaniach zakażenia RSV były dominującym czynnikiem ostrych zakażeń dróg oddechowych,
szczególnie dolnych dróg oddechowych i przyczyną
732
Katarzyna W Pancer, Włodzimierz Gut i inni
hospitalizacji pacjentów. Wśród pacjentów hospitalizowanych z powodu ostrego zakażenia górnych dróg
oddechowych udział RSV był niższy niż wśród pacjentów z zakażeniem dolnych dróg oddechowych. Nasze
wyniki potwierdzają doniesienia o istotnym udziale
RSV w ciężkich zakażeniach dolnych dróg oddechowych u małych dzieci (< 5 r.ż.), a szczególnie wśród
najmłodszych - do 6 miesiąca, w tym wcześniaków.
W naszych badaniach większość pacjentów była wieku
poniżej 6 m.ż., a w takiej grupie częstość RSV jest zazwyczaj bardzo wysoka. Ponadto najcięższe zakażenia
dolnych dróg oddechowych (zapalenie oskrzelików,
pneumobronchiolitis, zapalenie płuc) były również
spowodowane przez RSV, zwłaszcza podczas sezonu
epidemicznego tych zakażeń (9,16).
W naszych badaniach stwierdziliśmy, że w okresie
letnim zapalenia płuc powodowane były przez inne niż
RSV wirusy, zwłaszcza przez HEV/HRV. Wyniki te są
podobne do danych zebranych podczas wieloletniego
monitorowania aktywności tych wirusów w USA,
Kanadzie i Wielkiej Brytanii (2-4), co wskazuje, ze
aktywność badanych wirusów w Polsce jest prawdopodobnie zbliżona. W krajach tych, wiosną i latem, zazwyczaj obserwuje się wzrost zachorowań wywołanych
wirusami paragrypy (głównie typ 3), enterowirusami,
rinowirusami, adenowirusami i HMPV. Jednak w przeciwieństwie do tych danych, w naszych badaniach
zakażenia HBoV identyfikowane były głównie w zimie
i były one raczej związane z zapaleniem oskrzeli lub
górnych dróg oddechowych, niż z zapaleniem płuc lub
zapaleniem oskrzelików.
Ponadto analizowano wystąpienie znacznego
wzrostu liczby zakażeń HMPV w 2009r. (21,2% badanych pacjentów) w stosunku do pozostałych lat, gdy
częstość HMPV była znacznie niższa (2%). Wzrost
liczby zakażeń HMPV widoczny był także w szeregu
krajów europejskich (Anglii, Grecji, Niemczech, Hiszpanii) (13,17,18) – zgodnie z danymi prezentowanymi
w 2012r. podczas Kongresu Europejskiego Towarzystwa
Wirusologów klinicznych (ESCV). Należy zadać sobie
pytanie czy obserwowany wzrost liczby wykrytych zakażeń HMPV wiąże się ze wzrostem liczby konsultacji
pediatrycznych oraz hospitalizacji w związku z wystąpieniem pandemii grypy A/H1N1v.2009. Podobny efekt
wzrostu liczby wykrywanych wirusów oddechowych
w tym okresie obserwowany był w niektórych krajach
(19). Hipoteza ta może wyjaśnić istotnie różny udział
zakażeń górnych dróg oddechowych wywołanych przez
HMPV w 2009 r. - w okresie pandemii grypy inny niż
w pozostałych okresach.
W naszej strefie klimatycznej szczyt zakażeń układu
oddechowego obserwuje się na ogół w okresie od listopada do kwietnia (2-4) . W tych miesiącach oczekuje się
wzrostu liczby zachorowań wywołanych przez wirusy
grypy, RSV, HMPV, rinowirusy oraz HPIV (głównie
Nr 4
typu 1), adenowirusy i inne. Aktywność niektórych
wirusów oddechowych może pokrywać się w okresie
zimowo-wiosennym, innych wirusów może następować
po sobie, a jeszcze innych czynników - wymieniać się.
Wzrost zachorowań występuje co roku, jednak pewne
różnice w profilu wykrywanych wirusów są odnotowywane. Chociaż ogólnie aktywność RSV pokrywa się
często w czasie z aktywnością wirusa grypy, to zwykle
gdy zachorowania wywołane przez jednego z tych
wirusów rośnie, to jednocześnie maleje liczba zakażeń
drugim. Takie zjawisko zostało odnotowane również
w sezonie 2009-2010 – jednym z najlepiej opisanym ze
względu na pojawienie się nowego wariantu wirusa grypy (A/H1N1v2009). We Włoszech liczba zachorowań
wywołanych przez RSV narastała od listopada 2009 r.,
a szczyt zachorowań zaobserwowano w lutym 2010 r.
W czasie gdy liczba zakażeń RSV wzrastała – spadała
liczba zachorowań wywołanych przez A/H1N1v2009
(12). Podobną zmianę w aktywności tych wirusów
odnotowano również w Nowym Yorku. Gdy liczba
zakażeń RSV wzrosła w listopadzie 2009 r. (szczyt
w styczniu) - liczba zachorowań na grypę zmniejszyła się, zwłaszcza wśród niemowląt i dzieci (13).
W Centralnej Anglii szczyt zachorowań RSV wystąpił
w styczniu-lutym 2010r. (14).
Jak stwierdzono w naszych badaniach, początek
sezonu epidemicznego RSV każdego roku był inny,
a w sezonie 2009-2010 znacznie opóźniony w stosunku
do pozostałych lat. Zjawisko to może być związane
z wysoką aktywnością innych wirusów oddechowych
jesienią 2009r. – znacząco wyższym udziałem zakażeń
HMPV w tym okresie lub z wysoką aktywnością wirusa
grypy. Wirusy te zostały zastąpione następnie przez
RSV. Innym wytłumaczeniem tego zjawiska jest prawdopodobieństwo występowania dwuletniego cyklu aktywności RSV, tak jak to zostało opisane w Chorwacji.
Po 12-letnim monitorowaniu aktywności RSV w tym
kraju, stwierdzono występowanie cykli co 23-25 miesięcy – po bardzo wysokim szczycie zachorowań RSV
w jednym sezonie, w następnym występuje znacznie
niższa liczba zachorowań i w dłuższym okresie (20).
Ponadto, zgodnie z danymi CDC, czas trwania sezonu epidemicznego zachorowań RSV może się różnić
w zależności od roku i obszaru geograficznego. W USA
podczas sezonu 2010-2011 okres zwiększonej liczby
zachorowań RSV wahał się od 15 tygodni (w Kansas
City) do 27 tygodni (na Florydzie)(3).
Mimo, że RSV był dominującym czynnikiem wirusowych zakażeń dróg oddechowych w każdym sezonie
zimowo-wiosennym u małych dzieci, to ze względu
na różnice w przebiegu krzywej epidemicznej tych zachorowań, rożnego czasu ich rozpoczęcia, należy brać
pod uwagę aktywność innych wirusów. Z tego powodu wyróżniono okresy o zwiększonej liczbie ostrych
zakażeń wirusowych dróg oddechowych bez względu
Nr 4
Czynniki wirusowe ostrych zakażeń dróg oddechowych u małych dzieci
na identyfikację czynnika wirusowego. Czas trwania
okresów o zwiększonej liczbie hospitalizowanych
dzieci różnił się i obejmował od 3 miesięcy (XII.2008
- II.2009), przez 4 miesiące (XII.2010 - III.2011) do 6
miesięcy - (I.2010 - V.2010). We wszystkich wyróżnionych okresach (o zwiększonej i niższej liczbie hospitalizowanych dzieci) stwierdzano zmienną aktywność
wirusów, w tym nieoczekiwany wzrost występowania
niektórych czynników, takich jak HBoV w 2008 r.,
HMPV w 2009 r., oraz HAdV w 2010 r. Ponadto, obserwowano zróżnicowanie objawów/ciężkości przebiegu
zakażeń dolnych dróg oddechowych w zależności od
liczby hospitalizowanych pacjentów, a nie od rodzaju
wykrytego wirusa. Natomiast wysoka częstość ostrych
zakażeń górnych dróg oddechowych powiązana była
z wysoką aktywnością niektórych wirusów, takich jak
HMPV i HBoV w tych okresach.
733
WNIOSKI
Obserwowana zmienność aktywności badanych
wirusów może być częściowo wyjaśniona okresową
przewagą występowania poszczególnych patogenów.
Stosunkowo wysoka częstość ostrych zakażeń górnych
dróg oddechowych lub zapalenia oskrzeli spowodowanych przez HBoV lub HMPV, tylko w niektórych
okresach, wskazuje na konieczność przeprowadzenia
bardziej szczegółowych badań epidemiologicznych.
Uzyskane wyniki wskazują na konieczność poszerzenia
możliwości diagnostycznych o badania wirusologiczne, wykrywające także inne niż grypa i RSV wirusy,
w ostrych zakażeniach górnych i dolnych dróg oddechowych u dzieci.
Dr Katarzyna Pancer
Zakład Wirusologii NIZP-PZH
Chocimska 24, 00-791 Warszawa
tel: +48 22 54 21 308
Problemy zakażeń
Katarzyna Piekarska1, Magdalena Rzeczkowska1, Waldemar Rastawicki1,
Anna Dąbrowska-Iwanicka3, Iwona Paradowska-Stankiewicz 2
PRZYDATNOŚĆ DIAGNOSTYKI MIKROBIOLOGICZNEJ W ROZPOZNANIU
KRZTUŚCA U OSOBY DOROSŁEJ Z NAPADOWYM KASZLEM *
Zakład Bakteriologii Narodowego Instytutu Zdrowia Publicznego
– Państwowego Zakładu Higieny w Warszawie
2.
Zakład Epidemiologii Narodowego Instytutu Zdrowia Publicznego
3.
Centrum Onkologii – Instytut
1.
STRESZCZENIE
WSTĘP. Krztusiec jest ostrą, wysoce zaraźliwą chorobą układu oddechowego człowieka, wywoływaną przez pałeczki Bordetella pertussiss. Choroba występuje głównie u dzieci, choć w ostatnich latach coraz częściej stwierdza
się ją także u młodzieży i osób dorosłych. Ze względu na nietypowe objawy krztuśca u osób dorosłych, ograniczające się do suchego, napadowego i przedłużającego się kaszlu, choroba ta rzadko jest u nich rozpoznawana.
CEL PRACY. Celem pracy było wykazanie przydatności laboratoryjnej diagnostyki mikrobiologicznej w rozpoznaniu krztuśca u osób dorosłych na przykładzie osoby z suchym, napadowym, przewlekłym kaszlem.
MATERIAŁ METODY. Materiał do badań stanowiła plwocina (pobrana 25 stycznia 2013 roku) i dwie próbki
surowicy (pobrane odpowiednio, 13 lutego i 19 kwietnia 2013 roku). Do mikrobiologicznej diagnostyki krztuśca
zastosowano hodowlę, metodę in-house PCR, real-time PCR oraz test ELISA.
WYNIKI. Bakteriologiczne badanie plwociny przeprowadzone przy użyciu komercyjnego podłoża Bordetella
Selective Medium firmy Oxoid nie wykazało obecności pałeczek B. pertussis. Badania przeprowadzone techniką
real-time PCR, jak i PCR potwierdziły natomiast w badanej próbce plwociny obecność sekwencji insercyjnej
IS481 oraz sekwencji promotora toksyny krztuścowej ptx-Pr, markerów typowych dla pałeczek B. pertussis.
Badania serologiczne wykazały także diagnostycznie znamienny poziom swoistych przeciwciał klasy IgA, IgG
i IgM dla pałeczek B. pertussis już w pierwszej uzyskanej próbce surowicy. W drugiej próbce surowicy, uzyskanej
po ponad dwóch miesiącach od pierwszej, stwierdzono dodatkowo diagnostycznie znamienny spadek poziomu
przeciwciał klasy IgA.
WNIOSKI. Przedstawione dane wskazują na wysoką przydatność laboratoryjnych metod w diagnostyce krztuśca u osób dorosłych z przewlekłym kaszlem. Zastosowanie tych metod umożliwia prawidłowe rozpoznanie
choroby, szybkie wdrożenie właściwego leczenia, jak i zastosowanie odpowiednich procedur zapobiegających
szerzeniu się zakażenia.
Słowa kluczowe: krztusiec u osoby dorosłej, Bordetella pertussis, diagnostyka mikrobiologiczna krztuśca, napadowy kaszel
WSTĘP
Krztusiec jest ostrą, wysoce zaraźliwą chorobą
układu oddechowego, wywoływaną przez Bordetella
pertussis, Gram-ujemną, tlenową pałeczkę. Działanie
patogenne pałeczek krztuśca polega głównie na wy-
twarzaniu toksyn, w tym toksyny krztuścowej – pertussis toxin (PT), które uszkadzają urzęsiony nabłonek
oddechowy i są odpowiedzialne za występowanie
charakterystycznych objawów choroby. Transmisja
drobnoustroju następuje drogą powietrzno-kropelkową
lub w wyniku bezpośredniego kontaktu z wydzieliną
* praca została wykonana w ramach zadania nr 6/EM/2013.
736
Katarzyna Piekarska, Magdalena Rzeczkowaska i inni
dróg oddechowych osoby zakażonej. Okres wylęgania
krztuśca wynosi średnio od 7 do 10 dni. W zależności
od stopnia zaawansowania choroby, w jej przebiegu
wyróżnić można fazy: nieżytową, kaszlu napadowego
i zdrowienia (9, 12, 16).
Charakterystyczne objawy krztuśca tj. napadowy
kaszel ze świstem wdechowym (tzw. „pianiem koguta”),
wykrztuszaniem śluzu i następującymi po ataku kaszlu
wymiotami, najczęściej występują u niemowląt i małych
dzieci. Obecnie w wielu rozwiniętych krajach, w tym
także i w Polsce, na krztusiec coraz częściej chorują
osoby ze starszych grup wiekowych (2, 3, 5, 8, 12, 13).
W odróżnieniu od małych dzieci, u młodzieży i osób
dorosłych krztusiec przebiega z reguły łagodnie i mniej
charakterystycznie. Często jedynym zauważalnym
objawem choroby jest suchy, męczący i przedłużający
się kaszel, występujący zwłaszcza w nocy (www.who).
Należy podkreślić, że wczesna diagnostyka krztuśca
u osób dorosłych jest niezmiernie istotna ze względu na
to, że mogą oni stanowić źródło zakażenia pałeczkami
B. pertussis dla niemowląt, wywołując u nich chorobę
potencjalnie zagrażającą życiu.
Diagnostyka laboratoryjna stosowana w rozpoznawaniu krztuśca obejmuje: izolację drobnoustroju na podłożach sztucznych, metody serologiczne i molekularne.
Według ECDC (www.ecdc.europa.eu), oprócz
kryteriów klinicznych, potwierdzeniem rozpoznania
krztuśca jest dodatni wynik badania laboratoryjnego,
uzyskany przynajmniej jedną z trzech metod, tj. hodowli, technik molekularnych lub serologicznych, jak również udowodniony związek epidemiologiczny z osobą
z laboratoryjnie potwierdzonym krztuścem. W Polsce,
zgodnie z ustawą o zapobieganiu oraz zwalczaniu
zakażeń i chorób zakaźnych u ludzi (z dn. 5 grudnia
2008 r.) krztusiec podlega obowiązkowi zgłaszania,
a potwierdzany jest głównie na podstawie objawów
klinicznych i/lub wyników badań serologicznych.
Krztusiec nadal jest dość powszechnie występującą
chorobą zakaźną, z okresowym wzrostem zachorowań
pojawiającym się co 3 - 5 lat (www.cdc.gov). Według
danych WHO, obecnie na całym świecie rocznie notuje
się około 16 mln przypadków krztuśca, przy czym blisko
195 tys. kończy się zgonem. Według danych ECDC (1)
w 2011 roku w 27 krajach UE i EEA, zgłoszono 19 743
(w tym 16 897 potwierdzonych) przypadków zachorowań na krztusiec, co dało zapadalność 5,57 na 100 tys.
ludności. W Polsce, w 2011 roku, zarejestrowano 1 669
przypadków, przy zapadalności wynoszącej 4,33 na 100
tysięcy, natomiast w 2012 roku zarejestrowano 4 684
zachorowań, (w tym aż 32% - 1 501 osób wymagało hospitalizacji, przy zapadalności 12,16 na 100 tysięcy (10).
Celem pracy było wykazanie przydatności laboratoryjnej diagnostyki mikrobiologicznej w rozpoznaniu
krztuśca u osób dorosłych na przykładzie badania osoby
z suchym, napadowym, przewlekłym kaszlem.
Nr 4
MATERIAŁ I METODY
Materiał do badań. Materiał do badań bakteriologicznych i genetycznych stanowiła próbka plwociny
uzyskana 25 stycznia 2013 roku od niehospitalizowanej, 43 letniej kobiety z suchym, męczącym kaszlem.
W celu potwierdzenia krztuśca i określenia dynamiki
poziomu swoistych przeciwciał, od pacjentki dwukrotnie uzyskano próbkę surowicy (tj. 13 lutego i 19
kwietnia 2013 roku).
Zastosowane metody diagnostyczne:
1. Hodowla. Bakteriologiczne badanie plwociny w kierunku pałeczek Bordetella przeprowadzono przy
użyciu komercyjnego podłoża Bordetella Selective
Medium firmy Oxoid.
2. M etody molekularne. Preparat genomowego
DNA badanej próbki uzyskano przy użyciu komercyjnego zestawu ,,High Pure PCR Template Preparation Kit” (Roche) postępując zgodnie z zaleceniami
producenta.
DNA B. pertussis poszukiwano przy zastosowaniu
komercyjnego zestawu ,,Bordetella pertussis/parapertussis Real-Time Kit’’ firmy Diagenode. Reakcję
real-time PCR przeprowadzono zgodnie z dołączoną
do zestawu instrukcją producenta.
Obecności DNA pałeczek Bordetella poszukiwano również przy użyciu metody in-house PCR. Do
identyfikacji wykorzystano chromosomalne markery,
tj. poszukiwano sekwencji insercyjnej IS481 oraz
sekwencji promotora toksyny krztuścowej ptx-Pr. Sekwencje użytych starterów oraz oczekiwaną wielkość
produktów PCR podano w tabeli I. W celu amplifikacji
wybranych markerów zastosowano następujące warunki
termiczne: wstępna denaturacja DNA w temperaturze
94°C przez 10 min., a następnie 35 cykli reakcyjnych
obejmujących trzy etapy: denaturację DNA w 94°C
przez 45 s, przyłączanie starterów w temperaturze 68°C
przez 45 s, polimeryzację DNA prowadzono w 72°C
przez 60 s oraz końcową polimeryzację przebiegającą
w temperaturze 72°C przez 5 min.
Jako kontrole dodatnie w reakcji PCR wykorzystano DNA wyizolowane ze szczepów referencyjnych:
Bordetella pertussis TohamaI (CIP 81.32=NCTC
13251=ATCC BAA-589) oraz Bordetella parapertussis
(CIP12822=NCTC 13253=ATCC BAA-587).
3. Odczyn immunoenzymatyczny ELISA: Oznaczenie poziomu przeciwciał dla toksyny krztuścowej
i włókienkowej hemaglutyniny pałeczek B. pertussis
w trzech klasach immunoglobulin przeprowadzono
komercyjnym odczynem ELISA NovaLisa Bordetella (NovaTec Immunodiagnostica), zgodnie
z instrukcją podaną przez producenta.
Nr 4
Diagnostyka mikrobiologiczna w rozpoznawaniu krztuśca u osoby dorosłej
WYNIKI I DYSKUSJA
Przez wielu lekarzy krztusiec nadal utożsamiany jest
z chorobą zakaźną wieku dziecięcego, rzadko uwzględnianą w diagnostyce różnicowej przewlekłego kaszlu
u osób dorosłych. Jednakże w świetle zachodzących
zmian obserwowanych na świecie dotyczących epidemiologii krztuśca, konieczne wydaje się uwzględnienie
pałeczek Bordetella wśród potencjalnych czynników
zakażeń układu oddechowego także u młodzieży i osób
dorosłych (2, 3, 5, 11).
W omawianym przypadku, u pacjentki występował
powodujący ból mięśni brzucha suchy, męczący kaszel
o charakterze napadowym, z liczbą ok. 12 ataków na
dobę, pojawiający się zarówno w dzień, jak i w nocy,
trwających od kilku do kilkunastu minut. Atakom kaszlu
nie towarzyszyła gorączka ani inne objawy kliniczne. Po
około dwóch tygodniach od pojawienia się kaszlu, od
pacjentki pobrano plwocinę, którą przekazano do Laboratorium Zakładu Bakteriologii NIZP-PZH. W przeprowadzonym wywiadzie ustalono, że na początku stycznia
2013 roku u 9 letniego dziecka pacjentki, które przeszło
pełny cykl szczepień wg programu, występował suchy,
męczący i napadowy kaszel kończący się wymiotami,
zaś wyniki badań serologicznych sugerowały przebyte
zakażenie pałeczkami krztuśca. W związku z tym,
otrzymaną od pacjentki próbkę plwociny zbadano metodami biologii molekularnej w kierunku atypowych
czynników powodujących zakażenie dróg oddechowych
oraz krztuśca.
Pomimo, że hodowla pałeczek B. pertussis jest metodą zalecaną przez WHO i nadal uznawaną jako „złoty
standard” w laboratoryjnym potwierdzeniu krztuśca,
w omawianym przypadku z badanego materiału klinicznego, tj. plwociny nie udało się wyhodować pałeczek
B. pertussis. Mogło to się wiązać z faktem, że próbka
plwociny została pobrana do badania w późnym okresie
choroby (ponad dwa tygodnie od początku objawów
klinicznych), gdy prawdopodobieństwo wyhodowania
B. pertussis gwałtownie spada (3, 5). Przyczyną braku
sukcesu w uzyskaniu hodowli mógł być także nie do
końca właściwy, choć u dorosłych dopuszczalny (3,
14), materiał kliniczny przeznaczony do diagnostyki
krztuśca tj. plwocina. Najbardziej wiarygodną i zalecaną próbką do badań w kierunku wykrywania pałeczek
Bordetella jest aspirat lub wymaz z nosogardła (9, 16).
Dodatkowym czynnikiem, mogącym mieć wpływ na
ujemny wynik hodowli, był również wiek pacjentki.
Uważa się bowiem, że szansa wyhodowania pałeczek B.
pertussis od osób dorosłych jest niższa niż u dzieci (3).
Obecnie, w wielu laboratoriach na świecie zajmujących się diagnostyką krztuśca, hodowla zastępowana
jest przez łańcuchową reakcję polimerazy (PCR - polymerase chain reaction). Przy jej użyciu możliwe jest
wykrywanie DNA Bordetella w próbkach materiału
737
klinicznego uzyskanego już od wczesnego etapu choroby aż do 5 tygodnia jej trwania. W porównaniu z hodowlą, PCR jest metodą zdecydowanie bardziej czułą
(zwłaszcza w późnej fazie choroby, czy po rozpoczętej
antybiotykoterapii) (7, 14). Ponadto, metoda ta pozwala
na uzyskanie wyniku w krótkim czasie, tj. 1-2 dni, co
jest bardzo istotne ze względu na możliwość wdrożenia odpowiedniego leczenia (7). Najbardziej zalecaną
i najczęściej stosowaną przez ośrodki referencyjne
techniką jest real – time PCR. Na rynku dostępnych
jest wiele zestawów komercyjnych do real – time
PCR, zawierających primery amplifikujące tylko jedną
sekwencję docelową, tj. sekwencję insercyjną IS481 B.
pertussis. Według najnowszych danych piśmiennictwa
przy zastosowaniu tylko sekwencji IS481, uzyskać
można fałszywie dodatnie wyniki. Stwierdzono bowiem, że IS481 może występować także w genomie
innych gatunków Bordetella, tj. B. bronchiseptica i B.
holmesii (4, 14). W świetle tych informacji specjaliści
z ośrodków referencyjnych, w celu zwiększenia czułości
wykrywania B. pertussis, zalecają stosowanie dodatkowej sekwencji docelowej, tj. regionu promotora genu
toksyny krztuścowej.
W omawianym przypadku, w plwocinie pacjentki,
DNA B. pertussis wykryto zarówno komercyjnym zestawem real – time PCR, jak i opracowanym we własnym
zakresie testem PCR, w którym potwierdzono również
obecność drugiego markera charakterystycznego dla
pałeczki krztuśca, tj. promotora toksyny krztuścowej.
Na podstawie wyników uzyskanych metodami molekularnymi u pacjentki wdrożono 7 dniowe leczenie
klarytromycyną, początkowo w dawce 2 x 500 mg/
dzień, a następnie 2 x 250 mg/dzień.
W Polsce, w mikrobiologicznej diagnostyce krztuśca stosowane są przede wszystkim badania serologiczne wykrywające w surowicy osób chorych swoiste
przeciwciała. W rutynowej serodiagnostyce najczęściej
używany jest komercyjny test immunoenzymatyczny
– ELISA, umożliwiający określenie poziomu przeciwciał w poszczególnych klasach immunoglobulin
dla toksyny krztuścowej i/lub włókienkowej hemaglutyniny. W przeciwieństwie do badań genetycznych,
które umożliwiają potwierdzenie zakażenie już w jego
początkowej fazie, badania serologiczne pozwalają na
potwierdzenie etiologii choroby w późniejszej fazie,
zazwyczaj dopiero w 2-3 tygodniu od wystąpienia objawów klinicznych. Dodatkową trudność w interpretacji
wyników badań serologicznych u osób podejrzanych
o krztusiec, stanowi obecność w krwi przeciwciał
poszczepiennych, szczególnie klasy IgG. Tak więc,
podstawową zasadą w serologicznej diagnostyce krztuśca powinno być dążenie do wykazania serokonwersji,
tj. diagnostycznie znamiennego przyrostu poziomu
przeciwciał w co najmniej dwóch próbkach surowicy
uzyskanych w odstępie 2-4 tygodni (6). Trzeba mieć
738
Katarzyna Piekarska, Magdalena Rzeczkowaska i inni
jednak na uwadze fakt, że w przypadku uzyskania
pierwszej próbki surowicy do badań w późniejszym
okresie choroby, poziom przeciwciał może być już
na tyle wysoki że nie można oczekiwać znamiennego
przyrostu jego poziomu w drugiej próbce. Przyjmuje
się więc, że wzrost poziomu przeciwciał o 100% lub
spadek tego poziomu o 50% w kolejnej próbce surowicy jest najlepszym dowodem na aktualne zakażenie
pałeczkami krztuśca (6). W opisywanym przypadku,
w pierwszej próbce surowicy uzyskanej od pacjentki
13 lutego, diagnostycznie znamienny poziom swoistych
przeciwciał dla pałeczek B. pertussis (powyżej 11 jednostek NTU) wykryto w trzech klasach immunoglobulin,
tj. IgA (20,26), IgG (17,52) i IgM (20,08). W drugiej
próbce surowicy, uzyskanej 19 kwietnia, stwierdzono
diagnostycznie znamienny spadek poziomu przeciwciał
w klasie IgA (9,87 jednostek NTU). Ponadto, odnotowano również spadek poziomu przeciwciał w klasie
IgG i IgM (odpowiednio 13,44 i 19,65).
PODSUMOWANIE
Ze względu na obserwowany w wielu krajach, w tym
także i w Polsce, wzrost liczby zachorowań na krztusiec,
chorobę tę należy oceniać jako powracające zagrożenie dla zdrowia publicznego, nie tylko wśród dzieci,
ale również młodzieży i osób dorosłych. Wzrastająca
liczba osób chorych na krztusiec w starszych grupach
wiekowych stanowi istotny czynnik transmisji zakażeń
występujących u nieuodpornionych lub nie w pełni
uodpornionych noworodków i małych dzieci, dla których choroba ta może stanowić poważne zagrożenie dla
Nr 4
życia. Ponadto, nierozpoznawanie i niediagnozowanie
krztuśca u młodzieży i osób dorosłych przekładać się
może na niedoszacowanie danych epidemiologicznych
(15). Osoby dorosłe z długotrwającym kaszlem, który
jest dominującym i często jedynym objawem choroby,
rzadko badane są w kierunku zakażenia pałeczkami B.
pertussis. Może to być uwarunkowane trudnościami
związanymi z diagnostyką krztuśca, tj. kosztem badań
diagnostycznych czy możliwością wykonania tylko
oznaczeń serologicznych. Na obserwowaną sytuację
wpływa także powszechnie stosowana w leczeniu
chorób układu oddechowego antybiotykoterapia empiryczna, która eliminuje możliwość wykrycia etiologicznego czynnika odpowiedzialnego za zakażenie.
Przedstawiony przypadek pokazuje, jak pomocna okazuje się diagnostyka mikrobiologiczna w rozpoznaniu
krztuśca, zwłaszcza u osób dorosłych. Wykonanie badań
diagnostycznych oraz właściwy dobór metod w zależności od fazy choroby umożliwia szybkie wdrożenia
ukierunkowanego leczenia, jak również pozwala na
zastosowanie odpowiednich procedur zapobiegających
szerzeniu się zakażenia.
Dr Katarzyna Piekarska
Zakład Bakteriologii
Narodowy Instytut Zdrowia Publicznego
-Państwowy Zakład Higieny
ul. Chocimska 24
00-791 Warszawa
Problemy zakażeń
Tadeusz M Zielonka
CZYNNIKI RYZKA GRUŹLICY I SZCZEGÓLNE POSTACIE CHOROBY
Katedra i Zakład Medycyny Rodzinnej, Warszawski Uniwersytet Medyczny
STRESZCZENIE
W krajach o dobrej sytuacji epidemiologicznej stosunkowo wysoka jest zapadalność na gruźlicę wśród imigrantów, więźniów, osób bezdomnych i bezrobotnych. Poważnym utrudnieniem w opanowaniu epidemii gruźlicy
stało się w wielu regionach współistnienie zakażenia prątkiem gruźlicy i HIV. Trudności sprawia także oporność
na leki, szczególnie w krajach byłego Związku Radzieckiego. Współistnienie zakażenia prątkiem gruźlicy i HIV
oraz oporność na leki nie są istotnymi problemami w Polsce. Częstość występowania pozapłucnej gruźlicy jest
bardzo zróżnicowana (6-44%). W Polsce rzadko rozpoznaje się pozapłucne lokalizacje choroby. Konieczne jest
śledzenie lokalnych trendów epidemiologicznych i opracowanie stosowanych do tego modeli diagnostycznych
i terapeutycznych pozwalających na lepszą kontrolę zakażenia.
Słowa kluczowe: gruźlica, epidemiologia, imigranci, więźniowie, bezdomni, HIV, pozapłucna gruźlica, gruźlica
wielolekooporna
Stosowane skróty: AFR – afrykański region WHO, AMR – amerykański region WHO, EMR – region wschodniośródziemnomorski WHO, EUR – europejski region WHO, SEAR – region południowo-wschodniej Azji WHO,
WPR – region zachodniego Pacyfiku WHO
WSTĘP
Opanowanie epidemii gruźlicy utrudnia szerzenie
się choroby w środowiskach zwiększonego ryzyka
zachorowania na tę chorobę. Migracja zarobkowa spowodowała w krajach o dobrej sytuacji epidemiologicznej wzrost zachorowań na gruźlicę wśród imigrantów.
Gruźlica od dawna wiąże się z biedą i stłoczeniem
na małej powierzchni. Szczególnie duże zagrożenie
zachorowania na gruźlicę powodują stany obniżające
odporność komórkową, a wśród nich najważniejsze
jest zakażenie HIV. Niemniej istotnym problemem jest
zakażenie prątkami wielolekoopornymi i o rozszerzonej
oporności. Pozapłucna lokalizacja zmian gruźliczych
nie stanowi zagrożenia epidemicznego, ale stwarza
problemy diagnostyczne. Szczególnie niebezpieczną
grupą, stanowiącą ważne źródło zakażenia, są obficie
prątkujący chorzy na gruźlicę.
GRUPY ZWIĘKSZONEGO RYZYKA
ZACHOROWANIA NA GRUŹLICĘ
W niektórych środowiskach zapadalność na gruźlicę
jest znacznie wyższa niż w ogólnej populacji. Ryzyko
zachorowania wzrasta w pewnych grupach od 4 do 180
razy (1). Szczególnie dotyczy to więźniów, bezdomnych
i imigrantów (2,3,4). Wysokie wskaźniki zapadalności
odnotowano u osób osadzonych. Początkowo problem
ten dostrzeżono w zatłoczonych, źle wentylowanych
więzieniach rosyjskich, w których opisano zapadalność
na gruźlicę dochodzącą do 7000/100 tys. (5). Podjęty
przed laty w Rosji specjalny program przynosi efekty
i w ostatniej dekadzie zapadalność w więzieniach
zmniejsza się w tempie większym niż w ogólnej populacji (ryc. 1). Pomimo znaczącej poprawy, wskaźnik
ten w więzieniach jest wciąż 11-krotnie wyższy niż
w ogólnej populacji (6). Wysokie wskaźniki odnotowano także w więzieniach byłych republik Związku
Radzieckiego - w Azerbejdżanie 2500/100 tys., w Kirgizji 3000/100 tys., w Gruzji 3500/100 tys. (2,7,8).
Jeszcze wyższe wskaźniki zapadalności stwierdzono
w więzieniach afrykańskich: 7200/100 tys. na Wy-
740
Tadeusz M Zielonka
brzeżu Kości Słoniowej i 5200/100 tys. w Malawi
(9). Problem ten widoczny jest również w USA, gdzie
różnice między zapadalnością na gruźlicę w ogólnej
populacji a w więzieniach są 50-krotne i stale rosną (2).
W Europejskim Regionie WHO (EUR) stwierdzono
korelację pomiędzy zapadalnością na gruźlicę a liczbą
więzień (10). Z tego powodu WHO wymaga w krajach
europejskich rejestracji przypadków zachorowania na
gruźlicę wśród osób osadzonych. W Polsce wskaźnik
zapadalności na gruźlicę w populacji więźniów jest 15
razy większy niż średnia krajowa i sięga 288/100 tys.
(11). W stosunku do roku 2011 liczba zachorowań w tej
populacji wzrosła ostatnio o 40% (12).
Podobną grupą wysokiego ryzyka zachorowania na
gruźlicę są osoby bezdomne. Jest to marginalna grupa
społeczna, ale wskaźniki zapadalności na gruźlicę
wśród nich są wielokrotnie wyższe niż w ogólnej
populacji. Statystyki z tej grupy pochodzą jedynie
z krajów wysoko rozwiniętych, w których jest dobra
sytuacja epidemiologiczna. Dzięki podjętym działaniom w Stanach Zjednoczonych udało się wyraźnie
zmniejszyć wskaźnik zapadalności na gruźlicę wśród
bezdomnych z 270/100 tys. w 1994 r. do 36/100 tys.
w 2010 r. (13). W USA stanowią oni 6% wszystkich
chorych na gruźlicę (14), a w Kanadzie 3%, ale aż 39%
z nich to imigranci (15). W latach 1992-2006 odsetek
gruźlicy utajonej w tej grupie zmniejszył się w Nowym
Yorku z 58% do 31% (16). W Londynie stwierdzono
wskaźnik zapadalności na gruźlicę wśród bezdomnych
788/100 tys., podczas gdy u narkomanów wynosił on
354/100 tys., a u więźniów 208/100 tys. (17). W Polsce
również obserwuje się wyraźny wzrost odsetka bezdomnych wśród chorych na gruźlicę. Nie ma jednak
oficjalnych danych pochodzących z krajowego rejestru
gruźlicy. Przed 1989 r. nie byli oni odnotowywani w statystykach, a po 20 latach stanowili już 10% chorych na
gruźlicę mężczyzn (18) i 3% kobiet (19). W jedynym
opracowaniu, w którym wyliczono wskaźnik zapadalności na gruźlicę u bezdomnych w Polsce w roku 2008
wynosił on 720/100 tys. (20).
W krajach wysoko rozwiniętych gruźlica znacznie częściej występuje u imigrantów niż u rdzennej
ludności. W poszczególnych krajach dominują przedstawiciele różnych narodowości. W Niemczech są to
przede wszystkim Turcy, w Wielkiej Brytanii Hindusi,
we Francji uchodźcy z Maghrebu, we Włoszech z Libii, a w Izraelu z Rosji. Część z nich przebywa w tych
krajach nielegalnie, co osłabia możliwość precyzyjnego
określenia skali zjawiska zachorowań na gruźlicę w tej
populacji. W Wielkiej Brytanii, Szwajcarii, Holandii
i w krajach skandynawskich imigranci stanowią ponad
połowę wszystkich chorych na gruźlicę (21). Z kolei
w Czechach, w Finlandii i innych krajach bałtyckich
tylko kilka procent nowych zachorowań stwierdza się
wśród imigrantów (22). W Wielkiej Brytanii i we Fran-
Nr 4
cja wskaźnik zapadalności na gruźlicę u obcokrajowców
jest 10-krotnie wyższy niż wśród rdzennej ludności
i znacząco wpływa na średni wskaźnik zapadalności
w tych krajach (23,24). Wskaźnik zapadalności na
gruźlicę w ogólnej populacji Wielkiej Brytanii wynosi 13/100 tys., ale u osób urodzonych na Wyspach
Brytyjskich jest on poniżej 5/100 tys. (24). W Polsce
problem ten jest marginalny, gdyż w centralnym rejestrze imigranci stanowią zaledwie 0,6% chorych
na gruźlicę, ale dopiero od 2004 r. są oni oficjalnie
rejestrowani (12). Najczęściej pochodzą oni z Ukrainy,
Wietnamu, Rosji lub innych byłych republik ZSRR (25).
Wiele chorób sprzyja rozwojowi gruźlicy. Do
najważniejszych z nich należą nowotwory układu
krwiotwórczego, rak płuca lub w obrębie głowy i szyi,
krzemica, przewlekła choroba nerek i cukrzyca (26-29).
Duże znaczenie ma również przeszczepienie narządów,
stosowanie immunosupresji, glikokortykosteroidów,
antagonistów czynnika martwicy nowotworów i stan
po gastrektomii (30-34).
WSPÓŁISTNIENIE ZAKAŻENIA PRĄTKIEM
GRUŹLICY I HIV
Współistnienie zakażenia prątkiem gruźlicy i HIV
stało się jednym z ważniejszych problemów zdrowotnych. W ostatnich latach WHO prowadzi odrębną statystykę chorych na gruźlicę HIV (+) i HIV (-). Dzięki
podjętym działaniom znacząco wzrósł odsetek chorych
na gruźlicę ze znanym statusem zakażenia HIV. Prawie
u połowy wszystkich chorych na gruźlicę wykonano test
w kierunku zakażenia HIV, a w afrykańskim regionie
WHO (AFR) nawet u ¾ (6). Ogółem odsetek osób zakażonych HIV wśród chorych na gruźlicę w ostatnim
dwudziestoleciu był stały i wynosił 13%, ale 76% przypadków zakażenia prątkiem gruźlicy i HIV stwierdza
się w AFR (6). Aż 92% ko-infekcji prątkiem gruźlicy
i HIV rozpoznano w AFR i SEAR, a w pozostałych regionach przypadki takie stanowią 1-2% (6). Utrzymują
się istotne różnice regionalne we współistnieniu obu
tych infekcji. W Suazi 77% chorych na gruźlicę jest HIV
(+), a w Angoli i Etiopii tylko 9,6% (6). Szczególnie
jaskrawe są różnice w krajach o najgorszej sytuacji
epidemiologicznej (ryc. 2). Wśród nowych przypadków
gruźlicy w Bangladeszu tylko 200 osób jest zakażonych HIV, w Afganistanie 300, a na Filipinach 500.
Równocześnie w Afryce Południowej jest ich 330 tys.,
w Indiach 130 tys. a w Mozambiku 83 tys. W Europie
wiele krajów ma wskaźnik ko-infekcji gruźlicy i HIV
poniżej 0,1/100 tys., ale w Rosji wskaźnik ten wynosi
6,5/100 tys., w Mołdawii i na Ukrainie 10/100 tys. (6).
Zakażenie HIV jest odpowiedzialne za wzrost śmiertelności chorych na gruźlicę, która osiąga w tej grupie
29%. Liczba zgonów u chorych na gruźlicę zakażonych
Nr 4
Czynniki ryzyka gruźlicy – szczególne postacie choroby
HIV różni się znacznie w poszczególnych regionach
(ryc. 3). Gruźlica jest jedną z ważnych przyczyn śmierci
chorych na AIDS. W 2012 r. tylko 57% chorych na gruźlicę i zakażonych HIV otrzymywało leczenie antyretrowirusowe, ale rok wcześniej było ich mniej niż połowa
(6). Dzięki temu udało się zmniejszyć umieralność na
gruźlicę u osób zakażonych HIV, ale tempo spadku jest
znacznie mniejsze niż u chorych niezakażonych. Poprawa w tym względzie rozpoczęła się dopiero w 2003 r.,
później niż wśród osób niezakażonych HIV (1998 r.).
Zmniejszenie liczby zachorowań na gruźlicę u osób
zakażonych HIV udało się jedynie w AFR i w regionie
południowo-wschodniej Azji (SEAR), podczas gdy
w EUR i AMR obserwuje się wzrost tych przypadków.
W Polsce problem jest marginalny i nie odgrywa istotnej roli. W 2012 r. gruźlica była chorobą wskaźnikową
zaledwie u 26 osób zakażonych HIV (12).
GRUŹLICA WIELOLEKOOPORNA (MDRTB)
Oporność prątków na pojedyncze leki nie jest
groźna, ale narastająca oporność łącznie na izoniazyd
i ryfampicynę (MDRTB) staje się ważnym problemem
zdrowotnym i ekonomiczny, gdyż długotrwałe leczenie tych postaci jest bardzo kosztowne i nie zawsze
skuteczne. W 2012 r. stwierdzono na świecie 450 tys.
przypadków MDRTB i 170 tys. tych chorych zmarło (6).
Śmiertelność w tej grupie wynosi 38%, a przy zakażeniu
prątkami wrażliwymi na leki jedynie 7% (6).
Przypadki MDRTB stanowią 3,6% wszystkich
nowych zachorowań i 20% uprzednio leczonych (6).
Sytuacja w tym zakresie jest lokalnie bardzo zróżnicowana (ryc. 4) i wiąże się z nieprzestrzeganiem zleceń
terapeutycznych lub ze złą kontrolą zakażenia. Z epidemiologicznego punktu widzenia lepiej jest nie leczyć
chorych na gruźlicę niż leczyć ich źle, czyli zbyt krótko,
w sposób przerywany i nie stosując kilku leków. Najwięcej przypadków MDRTB stwierdza się w Europie
Wschodniej i Azji Środkowej. W niektórych krajach
ponad 20% nowych zachorowań i ponad 50% uprzednio
leczonych stanowi MDRTB (6). Na Białorusi MDRTB
stanowi 35% nowych zachorowań i 69% u chorych
uprzednio leczonych, w Uzbekistanie odpowiednio 23%
i 63%, a w Rosji 23% i 49% (6). Nie zawsze w krajach
z bardzo złą sytuacją epidemiologiczną często występuje również MDRTB, np. w Etiopii stwierdzana jest tylko
u 1,6% nowych zachorowań i u 12% we wznowach,
w Indonezji odpowiednio 1,9% i 12%, a Indiach 2,2%
i 15% (6). Znaczny jest udział krajów byłego Związku
Radzieckiego w odsetku MDRTB w EUR (ryc. 4).
Mimo bardzo dobrej sytuacji epidemiologicznej w wielu
krajach zachodnioeuropejskich, w których MDRTB
wśród nowych zachorowań stanowi mniej niż jeden
procent (np. w Irlandii 0,4%, w Austrii 0,3%, w Danii
741
i Finlandii 0,2%, a w Luksemburgu, Holandii i Szwajcarii poniżej 0,1%) w całym regionie europejskim odsetek
MDRTB wśród nowych zachorowań jest 4 razy większy
niż średnia światowa i sięga 16% (6). Równie zła jest
sytuacja epidemiologiczna w EUR w zakresie MDRTB
u chorych uprzednio leczonych przeciwprątkowo, gdyż
stanowi 45% wszystkich takich przypadków. Wynika
to z dużego odsetka MDRTB w krajach z największą
liczbą zachorowań.
Gruźlica wielolekooporna nie stanowi dużego problemu w Polsce, gdyż w 2012 r. stwierdzono zaledwie
31 takich przypadków. Stanowiło to 0,6% wśród nowych zachorowań i 3% chorych uprzednio leczonych.
Wśród nich było tylko jedno dziecko (12).
W ostatnich latach wzrastała na świecie liczba
zachorowań na gruźlicę o rozszerzonej oporności
(XDRTB), która stanowi obecnie 9,6% przypadków
MDRTB (6). Już w 92 krajach zarejestrowano takie
zachorowania. W Polsce również opisano przypadki
XDRTB u imigrantów (35).
GRUŹLICA POZAPŁUCNA
Duże różnice obserwuje się także w występowaniu
gruźlicy pozapłucnej (ryc. 5). W WPR pozapłucną lokalizację odnotowano jednie u 5% chorych a w EMR
u 22% (6). Z wyjątkiem zajęcia krtani, tchawicy
i oskrzeli gruźlica pozapłucna nie jest chorobą zakaźną. Z tego powodu w wielu krajach nie są prowadzone
statystki umożliwiające precyzyjne określenie sytuacji
epidemiologicznej. Trudności z uzyskaniem materiału
do badań i mała czułość metod bakteriologicznych powodują, że wiele przypadków nie jest rozpoznanych.
U chorych zakażonych HIV częściej dochodzi do pozapłucnych lokalizacji gruźlicy (36). Prawdopodobnie
w AFR odsetek gruźlicy pozapłucnej jest znacznie
większy niż innych regionach, ale brak na to dowodów. W krajach wysoko rozwiniętych zmniejszeniu
zapadalności na gruźlicę towarzyszy wzrost odsetka
pozapłucnej lokalizacji. W Kanadzie w ciągu 20 lat
odsetek pozapłucnej lokalizacji gruźlicy wzrósł z 18%
do 25% (37). W krajach z rzadkim współistnieniem
zakażenia prątkiem gruźlicy i HIV odsetek gruźlicy
pozapłucnej jest niski. W Finlandii, Szwecji, Wielkiej
Brytanii i Holandii pozapłucna lokalizacja stanowi
ponad 1/3 zachorowań (38,39). W krajach bałtyckich
i na Węgrzech odsetek ten jest kilka razy mniejszy (59%) (39).
W Polsce gruźlica pozapłucna stanowi zaledwie
6,9% (12). Najwięcej jest przypadków zajęcia opłucnej
(36%), węzłów chłonnych, kości i stawów oraz układu
moczowego (12). Częściowo wynika to z rzadkiego
w Polsce współistnienia zakażenia HIV, niewielkiego
odsetka imigrantów i przewagi mężczyzn w starszym
742
Nr 4
Tadeusz M Zielonka
wieku wśród chorych na gruźlicę (40), podczas gdy
młody wiek i płeć żeńska sprzyjają pozapłucnej lokalizacji (41). Nie można jednak wykluczyć, że w pewnym
stopniu gruźlica pozapłucna jest niedodiagnozowana.
PRZYPADKI GRUŹLICY OBFICIE
PRĄTKUJĄCEJ
Wykrycie prątków w preparacie bezpośrednim
rozmazu z plwociny świadczy o obfitym prątkowaniu
(co najmniej 10 tys. prątków w 1 ml odkrztuszonej
wydzieliny). Z epidemiologicznego punktu widzenia
jest to szczególnie groźna postać choroby, gdyż długotrwały kontakt z tymi chorymi stanowi duże zagrożenie
zakażenia prątkami osób z kontaktu. Strategia zwalczania gruźlicy opracowana przez WHO skupiona jest na
wykrywaniu i leczeniu szczególnie tej postaci choroby.
Stwierdzenie prątków kwasoopornych pod mikroskopem nie przesądza o rozpoznaniu gruźlicy i zaleca się
wykonanie w takich przypadkach badania genetycznego
odróżniającego zakażenie prątkiem gruźlicy od innych
niegruźliczych prątków (6). Najwięcej obficie prątkujących chorych stwierdza się w regionie amerykańskim
– 59% i SEAR – 53%, a najmniej w europejskim – 32%
(ryc. 5). Trudno rozstrzygnąć czy wynika to z dobrej
sytuacji epidemiologicznej w Europie Zachodniej czy
z niskiego poziomu diagnostyki bakteriologicznej
w Europie Wschodniej. Z kolei na wynik w regionie
amerykańskim wpływ ma sytuacja w krajach Ameryki
Południowej, znacznie gorsza niż w Ameryce Północnej. Z pewnością duży odsetek chorych obficie prątkujących w regionie afrykańskim (47%) jest odbiciem
złej sytuacji epidemiologicznej. W większości regionów
dominują przypadki z potwierdzonym w bakterioskopii
rozpoznaniem gruźlicy. Wyjątkiem są EUR i WPR,
w których więcej chorych ma ujemny wyniki w badaniu
bakterioskopowym (ryc. 5).
W Polsce obserwuje się duże lokalne różnice w odsetku chorych obficie prątkujących. W województwie
kujawsko-pomorskim, wielkopolskim i zachodniopomorskim stanowią oni ponad 50% chorych na gruźlicę,
podczas gdy w województwie łódzkim 16%, a w lubuskim 27,6% (ryc. 6). Nie można wykluczyć, że nie
są to rzeczywiste różnice. Wykrywalności prątków
w preparacie bezpośrednim zależy w pewnej mierze
od jakości posiadanego sprzętu, a także kwalifikacji
i doświadczenia personelu. W województwie kujawsko-pomorskiego aż w 90% przypadków gruźlica jest
potwierdzona w hodowli a w 56% w bakterioskopii,
podczas gdy w województwie łódzkim odpowiednio
w 62% i 16% (ryc. 6). Zwraca uwagę niski odsetek
potwierdzonej bakteriologiczne gruźlicy w województwach o najgorszej sytuacji epidemiologicznej
i niewielki odsetek potwierdzeń bakteriologicznych
w województwie lubuskim o najlepszej sytuacji epidemiologicznej. Przyczyną tego może być zła jakość
badań bakteriologicznych i pochopne rozpoznawanie
gruźlicy w niektórych regionach (42).
PODSUMOWANIE
Sytuacja epidemiologiczna gruźlicy na świecie
jest zróżnicowana regionalnie i podlega dynamicznym
zmianom. Wiąże się to nie tylko ze stanem zdrowia
obywateli, ale także z możliwościami finansowymi
poszczególnych krajów, z organizacją służby zdrowia,
szczelnością kontroli zakażeń, z problemami kulturowymi wpływającymi na szerzenie się zakażenia HIV.
Uśrednianie wskaźników epidemiologicznych powoduje spłaszczanie problemu i konieczna jest analiza
lokalnej sytuacji. W świetle przedstawionych danych
epidemiologicznych nie można ani bagatelizować,
ani wyolbrzymiać znaczenia gruźlicy. Niezbędne jest
śledzenie trendów epidemiologicznych i opracowanie
odpowiednich modeli diagnostyczno-terapeutyczno-kontrolnych.
Autor nie zgłasza konfliktu interesów
Zaakceptowano do druku: 17.10.2014 r.
Adres do korespondencji: Tadeusz M Zielonka
Katedra i Zakład Medycyny Rodzinnej Warszawski
Uniwersytet Medyczny
02-097 Warszawa ul. Banacha 1a, tel.: (22) 599 21 90;
Problemy zakażeń
STĘŻENIE INTERLEUKINY-6 (IL-6) W PŁYNIE MÓZGOWO-RDZENIOWYM
CHORYCH Z ROPNYMI, BAKTERYJNYMI
ZAPALENIAMI OPON I MÓZGU – OBSERWACJE WŁASNE
Katedra i Oddział Kliniczny Chorób Zakaźnych w Bytomiu
Śląskiego Uniwersytetu Medycznego w Katowicach
STRESZCZENIE
CELEM pracy była ocena przydatności oznaczania stężenia interleukiny-6
w płynie mózgowo-rdzeniowym (pmr) w diagnostyce ropnych, bakteryjnych zapaleń opon i mózgu u dorosłych.
MATERIAŁ I METODA. Badania przeprowadzono u 16 chorych leczonych w Oddziale Chorób Zakaźnych
Śląskiego Uniwersytetu Medycznego w Bytomiu w latach 2008 – 2012 z rozpoznaniem ropnego bakteryjnego
zapalenia opon i mózgu. W oparciu o ciężkość stanu klinicznego ocenianego w dniu przyjęcia do Oddziału chorzy
zostali podzieleni na dwie grupy: I – chorzy w stanie bardzo ciężkim i II – chorzy w stanie średnio – ciężkim
i lekkim. U wszystkich oznaczano w pierwszej dobie hospitalizacji stężenie interleukiny-6 w pmr. .
WYNIKI. U chorych w bardzo ciężkim stanie klinicznym przy przyjęciu (grupa I) średnie stężenie interleukiny-6
w płynie wynosiło 391,54 pg/mL, a u chorych w stanie średnio-ciężkim i lekkim (grupa II) – 110,51 pg/mL.
Różnice średnich stężeń tej cytokiny w pmr między grupami chorych były statystycznie znamienne (p<0,01).
Nie stwierdzono korelacji między stężeniami interleukiny-6 i innymi parametrami zapalnymi pmr. Badania kontrolne wykonane u 5 chorych grupy I wykazały jedynie nieznaczne obniżenie się stężenia interleukiny-6 w pmr
w przypadkach zakończonych zgonem Natomiast w przypadkach zakończonych wyzdrowieniem stężenia tej
cytokiny w pmr były wyraźnie obniżone w porównaniu z badaniem wstępnym.
WNIOSKI. Uzyskane wyniki wskazują na przydatność oznaczania stężenia interleukiny-6 w płynie mózgowo-rdzeniowym w ocenie nasilenia stanu zapalnego toczącego się w przestrzeni podpajęczynówkowej i, pośrednio,
ciężkości stanu klinicznego chorego. Wielkość stężenia tej cytokiny w pmr może mieć także pewne znaczenie
prognostyczne w ropnych, bakteryjnych zapaleniach opon i mózgu.
Słowa kluczowe : interleukina-6, płyn mózgowo-rdzeniowy, ropne, bakteryjne zapalenie opon i mózgu
WSTĘP
Bakteryjne zakażenia ośrodkowego układu nerwowego (OUN) nadal stanowią istotny problem współczesnej medycyny. Pomimo postępów farmakoterapii
i intensywnej opieki medycznej, bakteryjne, ropne
zapalenia opon i mózgu pozostają chorobami o niepewnym rokowaniu i stosunkowo wysokiej śmiertelności;
w wielu przypadkach dochodzi ponadto do wystąpienia
trwałych, neurologicznych następstw pochorobowych
(1). Wyniki rutynowo wykonywanych badań płynu mózgowo-rdzeniowych (pmr), tzn. pleocytoza i cytogram,
stężenie białka, glukozy, chlorków i, rzadziej, kwasu
mlekowego, wydają się nie zawsze w pełni odzwierciedlać rzeczywiste natężenie procesu zapalnego tkanki
mózgowej w tych chorobach (1,2).
W patofizjologii procesów zapalnych ośrodkowego
układu nerwowego istotną rolę odgrywają cytokiny. Należą
do nich między innymi: czynnik martwicy nowotworów-α,
interleukina-1β, a także interleukina-6 (2,3,4).
Interleukina-6 (IL-6) jest wielofunkcyjną cytokiną,
wykazującą różnorodne działania, zarówno w stanach
fizjologii, jak i patologii. Jest produkowana przez
różne komórki, w tym przez monocyty, makrofagi pęcherzyków płucnych, fibroblasty, komórki śródbłonka
i mezangium, keratynocyty, limfocyty B i T, eozynofile,
a w ośrodkowym układzie nerwowym (OUN) – także
przez astrocyty i komórki glejowe. Wytwarzanie IL-6
jest stymulowane przez endotoksyny, wirusy DNA
i RNA, niektóre inne cytokiny (interleukinę-1, czynnik
martwicy nowotworów, limfotoksynę, PDGF – komórkowy czynnik wzrostu pochodzący z płytek, TGF-β –
744
czynnik wzrostu limfocytów T). Do najważniejszych
aktywności biologicznych IL-6 należą:
- stymulacja limfocytów B do komórek wytwarzających przeciwciała (udział w odpowiedzi humoralnej),
- wpływ na limfocyty T, głównie poprzez indukcję
syntezy receptora dla interleukiny-2 (IL-2) oraz
stymulację wytwarzania tej cytokiny, w obecności
IL-2 IL-6 indukuje proliferację i różnicowanie cytotoksycznych limfocytów T,
- pośredniczenie w oddziaływaniu monocytów na
aktywowanie limfocytów T,
- regulacja trombocytopoezy,
- udział w zapoczątkowywaniu reakcji ostrej fazy,
- wywoływanie reakcji gorączkowej poprzez stymulację wytwarzania prostaglandyn (5-10)
Wykazano udział interleukiny-6 w patofizjologii
szeregu procesów chorobowych takich jak urazy, oparzenia, reumatoidalne zapalenie stawów, wstrząs septyczny, ostre zapalenie trzustki, stany zapalne w obrębie
gałki ocznej, AIDS (8-10).
Celem pracy była próba oceny przydatności oznaczania stężenia interleukiny-6 w płynie mózgowo-rdzeniowym chorych, w diagnostyce ropnych, bakteryjnych
zapaleń opon i mózgu.
MATERIAŁ I METODA
Badania przeprowadzono u 16 chorych leczonych
w Oddziale Chorób Zakaźnych Śląskiego Uniwersytetu Medycznego w Bytomiu w latach 2008 – 2012.
W grupie tej było 12 mężczyzn (75%) i 4 kobiety (25%).
Najmłodszy chory miał 18 lat, najstarszy – 71; średnia
wieku wynosiła około 48 lat. Chorzy byli kierowani do
Oddziału z podejrzeniem zapalenia opon mózgowo-rdzeniowych i mózgu. Na podstawie wyniku badania
pmr w każdym przypadku postawiono rozpoznanie
ropnego, bakteryjnego zapalenia opon i mózgu. Jako
czynniki etiologiczne zachorowania stwierdzono: Streptococcus pneumoniae u 6 chorych (37,5%), Neisseria
meningitidis w 2 przypadkach (12,5%); u pozostałych
8 chorych (50%) nie udało się ustalić czynnika etiologicznego zapalenia opon i mózgu.
Ze względu na ciężkość stanu klinicznego, ocenianego w dniu przyjęcia do Oddziału, chorzy zostali
podzieleni na dwie grupy:
- grupa I – 10 chorych w stanie bardzo ciężkim (7
mężczyzn i 3 kobiety; średnia wieku około 55 lat),
u których występowały zaburzenia świadomości,
objawy ogniskowego uszkodzenia OUN, uogólnione
drgawki (w okresie bezpośrednio poprzedzającym
hospitalizację lub w jej pierwszej dobie), liczba
punktów w skali śpiączkowej Glasgow (GCS) nie
przekraczała 9; czynnikami etiologicznymi były:
Streptococcus pneumoniae w 4 przypadkach,
Nr 4
w jednym Neisseria meningitidis, w pozostałych 5
przypadkach etiologii nie ustalono.
- grupa II – 6 chorych w stanie średnio – ciężkim i lekkim (5 mężczyzn i 1 kobieta; średnia wieku około 40
lat), u których nie występowały istotne zaburzenia
świadomości, nie obserwowano objawów ogniskowego uszkodzenia OUN ani drgawek; liczba punktów
w skali GCS przekraczała 10; czynniki etiologiczne
zapalenia opon i mózgu: Streptococcus pneumoniae
(2 przyp.), Neisseria meningitidis (1 przyp.), w pozostałych 3 przypadkach etiologii nie ustalono.
U wszystkich chorych w dniu przyjęcia do Oddziału
wykonano nakłucie lędźwiowe i badanie pmr, które
obejmowało oznaczenie pleocytozy i cytogramu, stężenia białka, glukozy i kwasu mlekowego oraz stężenia
interleukiny-6 (IL-6).
Do pomiaru stężenia IL-6 metodą immunoenzymatyczną stosowano zestawy Human IL-6 kit Quantikine
firmy R&D Systems Inc. (USA).
Ponadto, w 10. dobie leczenia u 5 chorych z grupy
I wykonano kontrolne badanie płynu mózgowo-rdzeniowego. Wśród tych pacjentów 2 osoby zostały wyleczone, a 3 chorych – zmarło.
Porównanie średnich wielkości pleocytozy, stężeń
białka, glukozy, kwasu mlekowego i interleukiny-6
między badanymi grupami chorych przeprowadzono za
pomocą testu t Studenta. W badaniach statystycznych
przyjęto poziom istotności p (α) < 0,05 i p (α) < 0,01.
Oceniano także korelacje między parametrami płynu
mózgowo-rdzeniowego w obu grupach chorych stosując
współczynnik korelacji Pearsona.
WYNIKI
Wyniki badania pmr chorych z ropnymi, bakteryjnymi zapaleniami opon i mózgu uzyskane w dniu przyjęcia
do Oddziału przedstawiono w tabeli I.
W grupie I średnia pleocytoza wyniosła 639 komórek w 1 mm3, u wszystkich chorych w cytogramie
przeważały krwinki białe obojętnochłonne wielojądrzaste (od 70% do 100% ogółu komórek), średnie stężenie
białka 1820 mg/L, glukozy – 0,56 mmol/L, kwasu
mlekowego – 10,75 mmol/L, a stężenie interleukiny-6
– 391,54 pg/mL. Stan tych pacjentów oceniany w chwili
przyjęcia i przebieg choroby był bardzo ciężki. W 3
przypadkach doszło do wystąpienia ostrej niewydolności oddechowej, konieczne było zaintubowanie chorych
lub wykonanie tracheotomii i stosowanie wentylacji
mechanicznej za pomocą respiratora w warunkach
oddziału intensywnej opieki medycznej; dwóch z tych
chorych zmarło. Ogółem w tej grupie zmarło 3 chorych, a u 3 wystąpiły trwałe neurologiczne następstwa
pochorobowe w postaci głuchoty lub niedosłuchu, wy-
Nr 4
Stężenie interleukiny-6 (IL-6) w płynie mózgowo-rdzeniowym chorych
leczono 4 pacjentów. Najwyższe stężenia białka i kwasu
mlekowego oraz interleukiny-6 w pmr obserwowano
w przypadkach zakończonych zgonem.
W grupie II średnia pleocytoza wynosiła 398 komórek
w 1 mm3, w cytogramie wszystkich chorych dominowały
również krwinki białe obojętnochłonne wielojądrzaste
(od 65% do 88% ogółu komórek). Średnie stężenia pozostałych parametrów pmr przedstawiały się następująco:
białko 841 mg/L, glukoza 0,91 mmol/L, kwas mlekowy
3,24 mmol/L, a stężenie interleukiny-6 – 110,5l pg/mL.
Stan chorych i przebieg choroby w tej grupie był średnio-ciężki lub lekki, a wyniki leczenia zdecydowanie lepsze
w porównaniu z grupą I; pełne wyleczenie uzyskano w 5
przypadkach, u jednego chorego doszło do wystąpienia
niedosłuchu jako następstwa neuroinfekcji. U żadnego
chorego w trakcie hospitalizacji nie obserwowano zaburzeń oddychania, żaden z chorych nie zmarł.
Wyniki kontrolnych badań pmr wykonanych u 5 chorych grupy I były następujące: u 2 chorych, którzy zostali
wyleczeni, stwierdzono wyraźne obniżenie się stężenia
interleukiny-6. We wszystkich przypadkach obserwowano także obniżenie wielkości pleocytozy, stężenia białka
i kwasu mlekowego w porównaniu z badaniem wstępnym.
Wyniki oznaczania stężenia IL-6: I badanie 852,41 pg/mL,
II badanie 131,09 pg/mL w jednym przypadku oraz
I badanie 799,11 pg/mL, II badanie 112,00 pg/mL
w drugim przypadku. Natomiast u 3 chorych, którzy
zmarli, stwierdzono jedynie nieznaczne obniżenie się
stężenia interleukiny-6 w pmr: I badanie 1624,31 pg/mL,
II badanie 1344,28 pg/mL, I badanie 1311,29 pg/mL,
II badanie 1011,21 pg/mL, I badanie 924,68 pg/mL, II
badanie 624,36 pg/ml, odpowiednio. We wszystkich
tych przypadkach stwierdzono utrzymującą się wysoką
pleocytozę wielojądrzastą, wysokie stężenia białka i kwasu mlekowego w płynie. Wyniki kontrolnych oznaczeń
interleukiny-6 w pmr w przebiegu choroby u chorych
z I grupy przedstawiono w tabeli II.
Różnice średnich wielkości pleocytozy i stężeń
glukozy w pmr między badanymi grupami chorych
nie były statystycznie istotne. Natomiast stwierdzono
istnienie istotnych statystycznie różnic średnich stężeń
białka (p<0,05), kwasu mlekowego (p<0,01) oraz interleukiny-6 (p<0,01) w pmr między grupą I i II.
OMÓWIENIE
Podstawowym badaniem w diagnostyce zakażeń
ośrodkowego układu nerwowego jest badanie płynu
mózgowo-rdzeniowego. W większości laboratoriów rutynowe badanie obejmuje oznaczenie wielkości pleocytozy i cytogramu, stężenia białka, glukozy i chlorków,
rzadziej – stężenia kwasu mlekowego (1,2).
Od wielu lat podejmowano próby poszerzenia
zakresu badań diagnostycznych w zakażeniach OUN
745
o oznaczanie dodatkowych parametrów pmr. Oznaczano, między innymi, stężenia lizozymu, immunoglobulin, cytokin zapalnych, chemokin, produktów przemiany
kwasu arachidonowego (prostaglandyn, tromboksanów,
leukotrienów), prokalcytoniny (PCT), dehydrogenazy
mleczanowej (LDH), kinazy kreatynowej (CK) enolazy neuronowo-swoistej (NSE), rzęskowego czynnika
neurotropowego (CNTF) i białka S100B. Badania
te pozwalały na dokładniejszą ocenę rzeczywistego
nasilenia i przebiegu procesu zapalnego toczącego się
w przestrzeni podpajęczynówkowej chorego, ale ich
wykonanie często wymaga znaczących nakładów finansowych i dobrze wyposażonego laboratorium, dlatego
nie są często wykonywane (11-16).
Interleukina-6 jest jedną z ważniejszych cytokin
uczestniczących w procesach zapalnych toczących się
w obrębie ośrodkowego układu nerwowego. Jest ona produkowana wewnątrz OUN, między innymi przez komórki
śródbłonka, astrocyty i komórki glejowe, w odpowiedzi
na rozpoczynające się i już trwające zakażenie, wpływ na
jej produkcję mają także inne cytokiny, między innymi
TNF oraz IL-1. IL-6 wykazuje przeważające działanie
prozapalne, indukuje syntezę białek ostrej fazy, odpowiada także za uszkodzenie bariery krew-mózg (17,18).
Badania innych autorów wskazują również na możliwość
działania przeciwzapalnego tej cytokiny, co ma przejawiać
się hamowaniem migracji leukocytów z krwi do płynu
mózgowo-rdzeniowego (19). Niemniej większość badaczy uważa, że w przebiegu bakteryjnych zakażeń OUN
dominuje działanie prozapalne IL-6 (3,4,17,18).
Stężenia IL-6 badano w różnych chorobach ośrodkowego układu nerwowego. Aiba i wsp. wykazali, że
w przebiegu pogrypowej encefalopatii, poziom IL-6
w surowicy ma znaczenie w przewidywaniu przebiegu
i zejścia choroby (20). Obserwowano także wzrost stężenia
tej cytokiny w pmr w przebiegu pourazowych uszkodzeń
mózgu (21). Stężenia tej cytokiny w płynie mózgowo-rdzeniowym, obok innych cytokin (IL-1β, TNF-α, IL-8),
były istotnym markerem diagnostycznym w zakażeniach
OUN związanych z zabiegami neurochirurgicznymi (22).
Badania roli interleukiny-6 w przebiegu bakteryjnych zapaleń opon i mózgu były prowadzone głównie
w populacji dziecięcej (23-25). W patofizjologii bakteryjnych zakażeń OUN istotne znaczenie dla przebiegu
procesu chorobowego ma nasilenie procesu zapalnego
toczącego się w przestrzeni podpajęczynówkowej.
W procesie tym uczestniczy także interleukina-6, która
jest syntetyzowana głównie w obrębie OUN (2,3,26).
Badania przeprowadzone u dzieci z bakteryjnymi
zapaleniami opon i mózgu wykazały wzrost stężenia interleukiny-6 w pmr. Azuma i wsp. stwierdzili, że poziom
IL-6 w pmr jest najlepszym markerem zakażenia OUN
u dzieci (22). Większość autorów uważa, że cytokina ta
ma znaczenie w różnicowaniu bakteryjnych od wirusowych zapaleń opon i mózgu (23,24), jedynie Mukai
746
i wsp. nie wykazali znamienności statystycznej różnicy
stężeń IL-6 w pmr między bakteryjnymi i wirusowymi
zapaleniami opon i mózgu (25). Wielkość stężenia tej cytokiny w pmr, we wczesnym okresie choroby korelowała
z ciężkością stanu klinicznego chorych. W przypadkach
zakończonych wyleczeniem obserwowano obniżanie
się stężenia IL-6 w pmr w badaniach kontrolnych (24).
Badania stężenia interleukiny-6 przeprowadzone
u dorosłych z ropnymi, bakteryjnymi zapaleniami
opon i mózgu wykazały podobne wyniki jak u dzieci;
a w szczególności korelację z ciężkością stanu klinicznego chorego i obniżanie się stężenia tej cytokiny w pmr
w przypadkach zakończonych wyleczeniem (27-29).
Nie stwierdzono wyraźnej zależności między
wielkością stężenia interleukiny-6 w pmr a etiologią
bakteryjnego zapalenia opon i mózgu (23,24,27-29).
Wśród obserwowanych przez nas chorych także nie
stwierdziliśmy takich zależności.
Nie wykazano również istnienia wyraźnych korelacji między stężeniem tej cytokiny w pmr a innymi, rutynowo oznaczanymi parametrami płynu. W przypadkach
zakończonych wyleczeniem w badaniach kontrolnych
obserwowano spadek stężenia IL-6 równolegle z normalizacją innych parametrów pmr (pleocytozy, białka
i glukozy) (23,24,27-29).
Wśród obserwowanych przez nas chorych z grupy
I stwierdziliśmy istnienie dodatniej korelacji między
stężeniami interleukiny-6 i stężeniem kwasu mlekowego w płynie, nie było natomiast wyraźnej korelacji
z wielkością pleocytozy wielojądrzastej, stężeniami
białka i glukozy. W grupie II nie obserwowaliśmy
korelacji między stężeniami tej cytokiny a innymi parametrami płynu mózgowo-rdzeniowego.
Interesującym zagadnieniem jest zależność stężenia
interleukiny-6 w pmr od ciężkości stanu klinicznego chorego z bakteryjnym, ropnym zapaleniem opon i mózgu.
Najwyższe stężenia tej cytokiny w pmr stwierdzano u chorych będących w najcięższym stanie klinicznym. Wydaje
się to wskazywać na istnienie znacznego nasilenia procesu
zapalnego obecnego w przestrzeni podpajęczynówkowej,
prowadzącego w konsekwencji do często nieodwracalnego
uszkodzenia tkanki mózgowej, będącego następstwem
zakażenia bakteryjnego. Natomiast zmiany stężenia
tej cytokiny w przebiegu bakteryjnego zapalenia opon
i mózgu wykazują pewien związek z dalszym rozwojem
i przebiegiem procesu chorobowego. Badania kontrolne
wykonywane w trakcie hospitalizacji wykazywały wyraźnie obniżone stężenia interleukiny-6 w pmr u chorych,
których stan kliniczny ulegał poprawie, a wyniki rutynowych badań płynu także się normalizowały. Natomiast
u chorych, których stan kliniczny nie ulegał poprawie,
stężenia tej cytokiny w pmr nadal były wysokie, porównywalne z pierwszym badaniem (24,27-29).
W przeprowadzonych przez nas badaniach obserwowaliśmy najwyższe stężenia interleukiny-6 w płynie
Nr 4
mózgowo-rdzeniowym u chorych w bardzo ciężkim
stanie klinicznym (grupa I). Średnie wielkości pleocytozy
wielojądrzastej i stężenia glukozy w płynie nie różniły
się w sposób statystycznie istotny między grupą I i II.
Natomiast najwyższe średnie stężenia białka i kwasu
mlekowego obserwowaliśmy u chorych w bardzo ciężkim stanie klinicznym, szczególnie tych, którzy zmarli.
Uzyskane wyniki wskazują, że stężenia IL-6 w pmr
wyraźnie korelowały z ciężkością stanu klinicznego
chorego w chwili przyjęcia do Oddziału i dalszym przebiegiem choroby. Wykonane badania kontrolne wykazały
pewną zależność zachowania się stężenia tej cytokiny
w płynie mózgowo-rdzeniowym a zejściem choroby.
W przypadkach zakończonych wyleczeniem stężenia
interleukiny-6 były obniżone, co u większości chorych
poprzedzało poprawę kliniczną i postępującą normalizacją innych parametrów pmr. Natomiast u chorych, którzy
zmarli, stężenia tej cytokiny ulegały jedynie niewielkiemu obniżeniu w porównaniu z pierwszym badaniem,
równocześnie utrzymywały się wysokie parametry zapalne pmr, a stan kliniczny nie ulegał poprawie. Niewielka
stosunkowo liczebność grup badanych chorych utrudnia
przeprowadzenie dokładniejszej analizy statystycznej
uzyskanych wyników i wyciągnięcie jednoznacznych,
dalej idących wniosków, ale może uzasadniać celowość
prowadzenia dalszych badań.
PODSUMOWANIE
Stężenie interleukiny-6 w płynie mózgowo-rdzeniowym wydaje się w znacznym stopniu odzwierciedlać
natężenie uszkodzenia mózgu wywołanego zakażeniem
bakteryjnym. Wzrost jej stężenia w pmr wskazuje na
nasilenie procesu zapalnego toczącego się w przestrzeni
podpajęczynówkowej chorego, uszkodzenie bariery
krew-mózg i w następstwie tych zjawisk, uszkodzenia
tkanki mózgowej (2-4,18,26,28-30).
Oznaczanie stężenia interleukiny-6 w płynie mózgowo-rdzeniowym chorych z ropnymi, bakteryjnymi
zapaleniami opon i mózgu może zatem mieć znaczenie
zarówno w ocenie rzeczywistego nasilenia stanu zapalnego toczącego się w przestrzeni podpajęczynówkowej,
mającego znaczenie dla przebiegu i zejścia choroby, jak
i w prognozowaniu zejścia tej choroby. Może to okazać się
przydatne w monitorowaniu przebiegu i leczenia ropnych
zapaleń opon i mózgu i mieć pewne znaczenie rokownicze.
Dr n.med. Lucjan Kępa
Katedra i Oddział Kliniczny Chorób Zakaźnych
Śląskiego Uniwersytetu Medycznego
Al.Legionów 49, 41-902 Bytom
Problemy zakażeń
Katarzyna Pancer, Marek Tomasz Szkoda, Włodzimierz Gut
ZAWLECZENIA ZAKAŻEŃ WIRUSEM DENGA W POLSCE
I ICH ROZPOZNANIE
Zakład Wirusologii Narodowego Instytutu Zdrowia Publicznego
STRESZCZENIE
Zakażenia wirusem denga przenoszone są przez komary: w krajach tropikalnych wektorem jest najczęściej
Aedes aegypti, w krajach chłodniejszych - Aedes albopictus. Począwszy od 2010r. rodzime zakażenia wirusem
denga wykrywane są także w Europie. Wyróżnia się 4 serotypy DENV, ale nie stwierdzono zależności między
postacią choroby a typem wirusa. Jednak kolejne zakażenie innym typem DENV niż pierwotne może prowadzić
do ciężkiego, zagrażającego życiu, zachorowania. Szacuje się, że zakażeniu wirusem denga ulega rocznie ok.
100 milionów osób, z tego u około połowy (głównie dzieci) rozwijają się objawy gorączki denga (GF), postaci
krwotocznej (DHF) lub postaci septycznej (DSS). Śmiertelność w ciężkich postaciach dengi jest wysoka. Warunkiem koniecznym do wystąpienia ciężkiej postaci choroby jest obecność przeciwciał klasy IgG skierowanych
przeciwko antygenom określonego serotypu wirusa denga, związanych z uprzednim zachorowaniem wywołanym
innym serotypem; lub przekazanych dziecku przez zakażoną matkę. Prawidłowo przeprowadzona diagnostyka
wymaga zastosowania różnych metod diagnostycznych. W obrębie Flaviviridae obserwuje się krzyżowe reakcje,
które mogą prowadzić do uzyskania fałszywie dodatniego wyniku badania Stosowanie diagnostyki różnicującej
z zakażeniami innymi flawiwirusami jest szczególnie ważne na terenie Polski, rejonie endemicznego występowania zakażeń wirusem kleszczowego zapalenia mózgu, z uwzględnieniem historii dotychczasowych szczepień
pacjenta przeciw KZM lub żółtej gorączce.
Słowa kluczowe: zakażenia wirusem denga, zawleczenia wirusa denga do Polski, rozpoznanie zakażeń
WSTĘP
Kilka miliardów ludzi stale zamieszkuje rejony
występowania zakażeń wirusami denga (DENV). Głównym wektorem przenoszącym zakażenia wirusa denga
na ludzi jest komar Aedes aegypti, bytujący w tropikach
i na obszarach subtropikalnych, rzadziej inne komary
z rodzaju Aedes. Głównym rezerwuarem wirusa są zakażeni ludzie, którzy mogą stanowić rezerwuar zarazka
przez 4-5 dni, maksymalnie do 12 dni od wystąpienia
pierwszych objawów klinicznych, ale także 2 dni przed
wystąpieniem pierwszych objawów. W tym okresie
może dojść do transmisji wirusa na żerującego komara.
W organizmie komara okres wylęgania wirusa trwa 4-10
dni, ale zakażone komary są zdolne do przenoszenia
zakażenia przez resztę swojego życia [1,2].
Komarem, który może być także wektorem wirusów denga jest Aedes albopictus, pierwotnie występujący w Azji, który obecnie rozprzestrzenił się także
w Ameryce Północnej i Europie dzięki zdolnościom
adaptacyjnym do chłodniejszych warunków środowiska. Zasiedlanie przez Ae.albopictus nowych terenów
może prowadzić do introdukcji wirusów denga na nowe
obszary zmieniając tym samym sytuację epidemiczną
gorączki denga w Europie. Aktualnie komar ten występuje na Maderze, na której w 2012 roku zaobserwowano
zachorowania wywołane wirusem denga u ludzi. Ponadto komar Ae.albopictus zasiedlił obszary nad Morzem
Śródziemnym i Czarnym [3,4] - tereny turystycznie
atrakcyjne dla osób podróżujących z Polski.
Celem pracy było przedstawienie zagadnień
związanych z rozpoznaniem importowanych zakażeń
wirusami denga oraz ocena ryzyka zawleczenia tych
zakażeń do Polski.
748
Katarzyna W Pancer
SYTUACJA EPIDEMIOLOGICZNA
ZAKAŻEŃ WIRUSEM DENGA NA ŚWIECIE
I W POLSCE
Zakażenia wirusem denga występują w ponad 100
krajach świata, od regionu Azji Południowo-Wschodniej poprzez kraje Bliskiego Wschodu, Afrykę, Amerykę Środkową i Południową po kraje zachodniego
Pacyfiku. WHO szacuje, że zasięg występowania zakażeń tym wirusem obejmuje około połowy populacji
ludzkiej. Od 50 lat obserwuje się znaczny i stały wzrost
liczby zgłaszanych do WHO przypadków. Ogółem
w 2010 roku zgłoszono ok. 2,3 mln zachorowań, tym
samym stwierdzono 1,7-krotny wzrost w stosunku
do danych z 2008r. i ta tendencja nadal się utrzymuje
(ryc.1). W latach 50 XX wieku ogniska zachorowań
obserwowano głównie na Filipinach, w latach 70 XX
wieku przypadki gorączki denga o cięższym przebiegu
zgłaszano w 9 krajach, a począwszy od lat 80 XX wieku
obserwowano liczne ogniska zachorowań na Karaibach,
w Ameryce Południowej oraz w Azji. W USA rodzime
zakażenia wirusem denga zaczęto zgłaszać dopiero
w XXI wieku. Obecnie najwięcej zakażeń zgłaszane
jest w krajach obu Ameryk (<50%) oraz Zachodniego
Pacyfiku (ryc.2) (1,4-8).
W Europie do 1928 r. zakażenia wirusem denga
obserwowano na Bałkanach oraz w krajach śródziemnomorskich. W latach późniejszych notowano jedynie
importowane przypadki zachorowań, aż do 2010r., gdy
doszło do lokalnych transmisji zakażenia w Chorwacji
oraz w południowej Francji (4,9). Wektorem zakażenia
był Aedes albopictus, który dobrze znosi chłodniejszy
niż tropikalny lub subtropikalny klimat oraz hibernację. W październiku 2012r. opisano ognisko zakażeń
wirusem denga na Maderze. Łącznie od 26 września
2012 do 4 lutego 2013r. zgłoszono tam ponad 2 tys.
przypadków u ludzi. Ponadto zgłoszono 78 przypadków
importowanych do krajów europejskich, w tym: do
Anglii – ogółem 23, Niemiec- 19, Francji – 3, Szwecji
– 5, Finlandii – 7, Danii – 2, Austrii – 2, Norwegii – 2,
oraz po jednym do Chorwacji, Słowenii, Hiszpanii,
Szwajcarii (3,4).
Narastający ruch osobowy pomiędzy krajami na
wszystkich kontynentach wiąże się z możliwością
zawleczenia zakażenia. Liczba importowanych do
krajów europejskich, w tym prawdopodobnie także do
Polski, zachorowań wywołanych przez wirusa denga
stale rośnie. Zachorowania wywołane zakażeniem
podczas pobytu na terenie endemicznego występowania wirusa denga mogą wystąpić podczas pobytu za
granicą, jak również po powrocie do kraju. Część tych
zachorowań może pozostać nierozpoznana, a tylko
cięższe przypadki są diagnozowane i potwierdzane
laboratoryjnie. W Anglii, Walii i Irlandii Płn. w la-
Nr 4
tach 2009-2012 potwierdzono laboratoryjnie ogółem
1 234 zachorowania: w 2009 r. – 177; w 2010r. – 449,
w 2011 r. – 235; w 2012 r. – 373 (w tym 20 nabytych
na Maderze). W okresie I-IV. 2013 r. zgłoszono 141
przypadki, w tym 3 nabyte podczas pobytu na Maderze
(10). Niestety w niektórych krajach europejskich, m.in.
w Portugalii, zachorowania wywołane przez wirusy
denga nie podlegają obowiązkowi zgłaszania, dlatego
dane epidemiologiczne są niekompletne.
Na tym tle analiza zgłaszanych co roku w Polsce
zachorowań wywołanych przez wirusa denga wskazuje
na prawdopodobne niedoszacowanie. Ogółem w Polsce
w latach 2005-2013 zgłoszono 29 zachorowań, w tym
w 2010 r.- 6, 2011r. – 5 i w 2012 r.-5, a w 2013 – 0.
Spośród 22 pacjentów z rozpoznaniem zakażenia wirusem denga hospitalizowanych w Szpitalu Zakaźnym
w Warszawie w okresie 2002-2011 większość stanowiły
osoby podróżujące do Indii oraz Indochin (Wietnam,
Laos, Tajlandia) (11).
OBJAWY ZAKAŻENIA WIRUSEM DENGA
(1,2,12)
Wyróżnia się trzy podstawowe postacie zakażenia
wirusem denga:
1. Zakażenie bezobjawowe lub skąpoobjawowe, klinicznie przypominające przeziębienie
2. Gorączka denga (DF)
3. Ciężka postać dengi (DS) obejmująca zarówno
postać krwotoczną denga (DHF) oraz postać wstrząsową (DSS)
Gorączka denga (DF) jest to ostra choroba wysypkowa z wysoką gorączką (40°C) trwającą 2-7 dni, obejmująca 2 lub więcej spośród następujących objawów
klinicznych: silne bóle głowy, ból oczu, bóle mięśni
i stawów, wysypka, nudności, wymioty, powiększenie
węzłów chłonnych lub leukopenia. Gorączkę denga
najczęściej rozpoznaje się u niemowląt, małych dzieci
i dorosłych. U dzieci może być przyczyną zgonu.
Ciężka postać zakażenia wirusem denga (DS),
określana dawniej jako gorączka krwotoczna denga
(DHF), jest potencjalnie śmiertelną chorobą z powodu
utraty płynów, niewydolności nerek oraz niewydolności
oddechowej z towarzyszącymi objawami krwotocznymi
i uogólnionej niewydolności narządowej. Odpowiednio
wczesne rozpoznanie i wprowadzone leczenie może
zmniejszyć ryzyko zgonu z 20% do 1%.
Warunkiem koniecznym do wystąpienia ciężkiej postaci zakażenia (w tym gorączki krwotocznej) jest obecność przeciwciał klasy IgG skierowanych przeciwko
antygenom określonego serotypu wirusa związanym z:
1. uprzednim zakażeniem pacjenta wywołanym przez
wirusa należącego do innego serotypu (bez względu
na postać pierwotnego/wcześniejszego zakażenia)
Nr 4
Zawleczenia zakażeń wirusem denga w Polsce
2. uprzednim zakażeniem kobiety w ciąży lub matki karmiącej - w przypadku niemowląt obecność
matczynych swoistych IgG modyfikuje pierwotne
zakażenie dziecka do ciężkiej postaci.
Inne czynniki wpływające na ciężkość przebiegu
zakażenia wirusami denga to status immunologiczny
zakażonego, związany zarówno z wiekiem (słabsza
odpowiedź u osobników bardzo młodych i u osób
starszych), jak i występowaniem innych przewlekłych
chorób (2,13).
Nie stwierdzono wpływu serotypu wirusa denga
(1-4) na ciężkość zakażeń.
Liczba zgłaszanych przypadków dotyczy przede
wszystkim zakażeń objawowych. Wysoka śmiertelność
w zakażeniach wirusem denga dotyczy przede wszystkim osób z objawami krwotocznej gorączki lub postaci
wstrząsowej. Ponadto wyższą śmiertelność obserwuje
się na początku wystąpienia ogniska epidemicznego.
Szacuje się, że w 2007r. doszło do ok. 100 mln zakażeń
wirusem denga, z tego ok. 500 tys., zostało zdiagnozowanych i zgłoszonych, a 12,5 tys. chorych zmarło
(1,4). Natomiast w okresie I-IV.2014 r. w krajach obu
Ameryk zgłoszono ponad 272 tys. przypadków gorączki
denga i 2708 zachorowań z objawami ciężkiej postaci,
w tym 87 zgonów (7).
Ze względu na wpływ swoistych IgG na ciężkość
zakażenia nie stosuje się czynnej immunoprofilaktyki.
Dodatkowym problemem jest brak swoistego leczenia,
w przypadkach ciężkich zachorowań stosuje się terapię
objawową.
DIAGNOSTYKA ZAKAŻEŃ WIRUSEM
DENGA
Podstawowym kryterium sugerującym lekarzowi
w Polsce zakażenie wirusem denga jest pobyt chorego w rejonie występowania zakażeń tym patogenem.
Diagnostyka zakażeń wirusami denga prowadzona
jest tylko w przypadkach objawowych czyli gorączki
denga lub ciężkiej postaci choroby, w tym gorączki
krwotocznej (1).
Diagnostyka różnicowa tych zakażeń, oparta o badanie przedmiotowe i podmiotowe wsparta mikrobiologiczną i serologiczną diagnostyką, pozwala na prawidłowe różnicowanie z zakażeniami wywoływanymi
przez inne wirusy. Gorączki krwotoczne mogą bowiem
być wywoływane także przez RNA wirusy należące do
rodzin: Arenaviridae, Bunyaviridae, Filoviridae.
Odrębny problem stanowi różnicowanie zakażeń
w obrębie spokrewnionych ze sobą genetycznie i antygenowo flawiwirusów. Wirusy denga, żółtej gorączki
oraz kleszczowego zapalenia mózgu należą do licznej,
obejmującej 53 gatunki rodziny Flaviviridae. Objawy zakażenia tymi wirusami zależą od wzajemnych
749
interakcji pomiędzy drobnoustrojem i gospodarzem
i mogą obejmować postacie od łagodnych stanów
gorączkowych z dołączającą się niekiedy wysypką,
poprzez uszkodzenie narządów wewnętrznych i uogólnione zmiany immunopatologiczne objawiające się
począwszy od zaburzenia krzepnięcia - aż do zakażenia
ośrodkowego układu nerwowego (13). Laboratoryjne
potwierdzenie zakażenia uzależnione jest od wielu
czynników, jednym z najważniejszych jest wstępne
rozpoznanie kliniczne, wsparte danymi epidemiologicznymi, które pozwalają właściwie ukierunkować
diagnostykę laboratoryjną (1,2,4,14).
Diagnostyka laboratoryjna zakażeń wirusem denga
obejmuje (ryc.3):
1. badania wirusologiczne (badania molekularne, izolacja wirusa*),
2. badania serologiczne (wykrywanie IgM, IgG),
3. wykrywanie antygenu wirusa.
*- izolacja wirusa denga w Polsce i w wielu krajach
europejskich jest możliwa jedynie w laboratorium
o podwyższonym poziomie bezpieczeństwa (BSL3/4).
Na wybór metody oraz wynik badania laboratoryjnego mają wpływ:
1. czas jaki upłynął od zakażenia do chwili pobrania
materiału do badań,
2. rodzaj pobranego do badań materiału,
3. sposób jego przechowywania, warunki transportu,
4. metody diagnostyczne możliwe do wykonania w danym laboratorium.
Potwierdzenie obecności genomu wirusa możliwe
jest przy użyciu techniki PCR z etapem odwrotnej
transkrypcji (RT-PCR). Materiałem do badań mogą być
próbki surowicy, osocza, płynu mózgowo-rdzeniowego
lub tkanki pobranej w trakcie fazy ostrej choroby z gorączką. Rozpoznanie zakażenia DENV metodą PCR
jest możliwe w ciągu pierwszych 5 dni od wystąpienia
objawów.
Ponieważ wykrycie RNA wirusa jest możliwe
jedynie w pierwszych dniach zakażenia (gdy pacjent
najczęściej przebywa za granicą), większość rozpoznań
przypadków importowanych oparto o wyniki badań
serologicznych. Odpowiedź immunologiczna na zakażenie wirusem denga prowadzi do powstania swoistych
przeciwciał IgM i IgG skierowanych głównie przeciw
białkom osłonki wirusa. Charakter odpowiedzi immunologicznej zależy od tego, czy dana osoba przechodzi
zakażenie DENV po raz pierwszy czy po raz kolejny
w swoim życiu oraz czy jest to zakażenie tym samym
czy też innym typem serologicznym wirusa. Ze względu
na podobieństwo antygenowe flawiwirusów ogromny
wpływ na wyniki badań diagnostycznych ma historia
przebytych zakażeń lub szczepień przeciw flawiwirusom, w tym przeciwko kleszczowemu zapaleniu mózgu
oraz żółtej gorączce.
750
Nr 4
Katarzyna W Pancer
Pierwotne zakażenie DENV charakteryzuje się
powolnym narastaniem mian przeciwciał IgM i IgG.
Przeciwciała IgG wykrywane są w niskim mianie na
koniec pierwszego tygodnia choroby i miano tych
przeciwciał powoli wzrasta. Natomiast podczas wtórnego zakażenia, miano przeciwciał IgG rośnie bardzo
szybko i nasilone są reakcje krzyżowe z antygenami
innych flawiwirusów. Kinetyka przeciwciał IgM jest
bardziej zmienna. Stwierdzany poziom IgM jest znacznie niższy podczas wtórnego zakażenia DENV, a tym
samym w niektórych przypadkach kolejnych zakażeń
obserwowane są ujemne wyniki oznaczeń poziomu
swoistych IgM (ryc.3).
W zakażeniu pierwotnym, jak i wtórnym wskazane
jest badanie pary surowic pobranych w różnych etapach
zachorowania. Niestety w praktyce badanie par surowic
z wczesnego okresu choroby wraz z surowicą pobraną
od ozdrowieńca lub też śledzenie dynamiki zmian miana przeciwciał w klasach IgG i IgM jest praktycznie
niemożliwe.
Należy także zwrócić uwagę, na występujące krzyżowe reakcje w surowicach chorych zakażonych innymi
flawiwirusami. Ponieważ w Polsce endemicznie występuje wirus kleszczowego zapalenia mózgu i dostępne są
szczepienia przeciw KZM, więc zjawisko krzyżowych
reakcji stanowi podstawowy problem diagnostyczny.
Ponadto od wielu lat stosowane są, szczególnie u osób
podróżujących, szczepienia przeciwko żółtej gorączce.
Rozróżnienie przeciwciał homologicznych (swoistych
dla wirusa denga) i heterologicznych czyli reagujących
krzyżowo z innymi flawiwirusami, wymaga zastosowania metod opartych o neutralizację wirusa (test
neutralizacji, test redukcji łysinek) przeprowadzanego
w warunkach podwyższonego bezpieczeństwa biologicznego (laboratorium BSL3/4) (1,2,4,14).
Testy do poszukiwania antygenu osłonki wirusa lub
białka NS1 wirusa denga mają zastosowanie głównie
w fazie ostrej pierwotnego zakażenia (do 9 dnia od
wystąpienia objawów), ponieważ podczas zakażenia
wtórnego występują już immunokompleksy wirus-IgG
w surowicy pacjenta. Ponadto testy te nie pozwalają
na zróżnicowanie typu wirusa. Obecnie wprowadzane
komercyjne zestawy do wykrywania białka NS1 (testy
ELISA lub oparte o techniki histologiczne) są poddawane ocenie pod względem dokładności diagnostycznej
oraz możliwości badania w przypadkach pierwotnych
i wtórnych zakażeń wirusem denga (1,14).
Klasyfikacja przypadku zakażenia wywołanego
przez wirusy denga. Odrębnym problemem jest interpretacja wyników oraz klasyfikacja przypadku przez
lekarza prowadzącego. Ostatnio Światowa Organizacja
Zdrowia (WHO) zaproponowała nowe schematy klasyfikacji przypadków i postępowania diagnostycznego,
które są w trakcie testowania w wybranych krajach (4).
W Polsce obowiązuje klasyczna klasyfikacja ECDC
z 2008 r. (tab.1) (2).
PODSUMOWANIE
Diagnostyka zakażeń wirusem denga w Polsce
wymaga szczególnej uwagi ze względu na endemiczne
występowanie w naszym kraju wirusa kleszczowego
zapalenia mózgu (KZM). Zakażenia tym wirusem
oraz stosowanie czynnej immunoprofilaktyki może
spowodować uzyskanie fałszywie dodatniego wyniku
w teście serologicznym (ELISA itp.) ukierunkowanym
na wykrywanie przeciwciał anty-denga - w wyniku
licznych krzyżowych reakcji w obrębie Flaviviridae.
Otrzymano:12.05.2014 r
Katarzyna Pancer
Zakład Wirusologii NIZP-PZH
Chocimska 24, 00-791 Warszawa
Problemy zakażeń
Piotr Kajfasz1, Michał Bartoszcze2, Piotr Karol Borkowski1, Wojciech Basiak1
RETROSPEKTYWNE OMÓWIENIE PRZYPADKU SKÓRNEGO WĄGLIKA –
CZARNEJ KROSTY Z 1995 ROKU U 15-LETNIEJ DZIEWCZYNKI
Klinika Chorób Odzwierzęcych i Tropikalnych, Warszawski Uniwersytet Medyczny
Ośrodek Diagnostyki i Zwalczania Zagrożeń Biologicznych, Wojskowy Instytut Higieny
i Epidemiologii, Puławy
1
2
STRESZCZENIE
15-letnia dziewczynka została przyjęta do naszej Kliniki ze zmianą skórną odpowiadającą czarnej kroście.
Wywiad epidemiologiczny ujawnił, że przed zachorowaniem pacjentka nosiła sweter z szorstkiej owczej wełny
oraz ozdoby wykonane ze skóry zwierzęcej. Kliniczne rozpoznanie skórnego wąglika zostało potwierdzone identyfikacją B. anthracis w materiale pobranym z owrzodzenia spod czarnej krosty, posiewem i hodowlą, odczynem
termoprecypitacji oraz próbą biologiczną na świnkach morskich. U chorej zastosowano penicylinę krystaliczną
dożylnie uzyskując efekt terapeutyczny. Kuracja antybiotykiem trwała 28 dni. W przedstawionym przypadku
klinicznym zwraca uwagę fakt, że pacjentka pochodziła spoza grupy ryzyka zachorowania na wąglik, co mogło
doprowadzić do chybionej diagnozy i zagrożenia uogólnieniem procesu chorobowego.
W latach 1990-1999 zgłoszono w Polsce ogółem 22 zachorowania na wąglik – była to prawie wyłącznie
postać skórna. W następnych latach zachorowania występowały jeszcze rzadziej – ogółem w latach 1991-2013
odnotowano 26 przypadków postaci skórnej waglika.
Słowa kluczowe: czarna krosta, wąglik skórny, Bacillus anthracis
WSTĘP
Wąglik (anthrax) jest ostrą chorobą zakaźną ludzi
i zwierząt (antropozoonozą) wywołaną przez Bacillus
anthracis, dużą, tlenową, zarodnikującą, Gram-dodatnią
otoczkową laseczkę. Poza organizmem żywiciela, B.
anthracis wytwarza endospory (przetrwalniki) bardzo
odporne na czynniki fizyczne, które mogą przetrwać
w glebie przez dziesiątki lat. W hodowlach, patogen
formuje długie łańcuchy z centralnie położonymi owalnymi przetrwalnikami.
Źródłem zakażenia B. anthracis są zwierzęta chore
na wąglik, głównie zwierzęta roślinożerne - bydło,
konie, owce, kozy. Rezerwuarem przetrwalników jest
gleba zanieczyszczona kałem, moczem, śliną chorych
lub padłych na wąglik zwierząt (1-3). Czynniki
atmosferyczne i środowiskowe, takie jak podtopienia,
powodzie, wiosenne ulewy, długie deszczowe
wiosny, sprzyjają wypłukiwaniu przetrwalników na
powierzchnię pastwiskowej gleby (1,4-7). Przypadki
wąglika wśród zwierząt roślinożernych znacznie częściej
odnotowuje się w krajach Afryki Subsaharyjskiej,
Ameryki Łacińskiej, południowo-zachodniej Azji oraz
południowo-wschodniej Europy (1).
Do zakażenia człowieka dochodzi przez bezpośredni kontakt z chorym lub padłym zwierzęciem oraz
z jego produktami skażonymi przetrwalnikami wąglika
– skórą, włosiem, wełną, itp. W większości przypadków wąglik występuje wśród rolników, weterynarzy,
rzeźników, garbarzy, pracowników sortujących importowane niewyprawione skóry, ogrodników stosujących
zwierzęcą mączkę kostną jako nawóz. Mężczyźni
stanowią 75% ogółu chorych na waglik. W Europie,
zachorowania na wąglik relatywnie częściej występują
w Turcji, Grecji, Rumunii, Bułgarii, Federacji Rosyjskiej i krajach Bałkańskich (1,3,4, 8-12).
Postać kliniczna waglika zależy od drogi zakażenia. Najczęstszą i najłagodniejszą postacią jest wąglik
skórny (1). Postacie: jelitowa, płucna (wziewna) oraz
związana ze stosowaniem dożylnych środków odurzających zdarzają się rzadko. Jednakże, w ciągu ostatnich
5 lat odnotowano w Europie kilka przypadków wąglika
u osób uzależnionych od heroiny (13-15). Przetrwalniki B. anthracis są wykorzystywane przez organizacje
752
Nr 4
Piotr Kajfasz, Michał Bartoszcze i inni
terrorystyczne. W Stanach Zjednoczonych Ameryki
Północnej wkrótce po ataku z 11 września 2001 roku
terroryści rozesłali drogą pocztową listy zawierające
przetrwalniki wąglika. Celem ataku bioterrorystycznego były instytucje związane z mediami oraz dwaj
Senatorowie Partii Demokratycznej. Bilans to 22 osoby
zakażone, z których 5 zmarło (1, 16).
W Polsce w latach 1990-1999 zgłoszono 22 zachorowania na wąglik.
OPIS PRZYPADKU
W 1995 roku do naszej Kliniki została przyjęta
15-letnia dziewczynka ze zmianą o średnicy 4 centymetrów na skórze szyi, po stronie lewej poniżej kąta
żuchwy, odpowiadającą wyglądem czarnej kroście.
Z wywiadu wynikało, że proces chorobowy trwa już
2 tygodnie. Zmiana ewoluowała, początkowo miała charakter czerwonej plamki, następnie grudki, pęcherzyka,
przyjmując w końcu postać owrzodzenia. Przyschnięcie
zmiany stworzyło obraz czarnej krosty (black eschar,
pustula maligna). Zmiana na skórze otoczona była
stwardniałym, niebolesnym obrzękiem. Na obrzeżach
czarnej krosty widoczny był wieniec z bardzo drobnych
pęcherzyków (pearl wreath). Zdjęcie 1.
Dochodzenie epidemiologiczne ujawniło, że
pacjentka miała kontakt z produktami pochodzenia
zwierzęcego, a właściwie przed zachorowaniem nosiła
sweter z szorstkiej owczej wełny, który drażnił skórę
szyi i powodował jej zaczerwienienie. Sweter został kupiony kilka dni wcześniej na wiejskim targu na Podhalu.
Ponadto, dziewczynka miała zwyczaj noszenia ozdób
(rzemyków) wykonanych ze skóry zwierzęcej.
Wywiad epidemiologiczny oraz obraz kliniczny
nasunął podejrzenie skórnego wąglika. Wstępne rozpoznanie zostało potwierdzone wynikami następujacych
badań:
1. W próbkach pobranych z sączącego się owrzodzenia spod czarnej krosty stwierdzono liczne Gram-dodatnie przetrwalniki B. anthracis. 2. Z posiewu treści
zmiany skórnej uzyskano hodowle laseczek wąglika,
wrażliwych na penicylinę. 3. Hodowle na stałym i płynnym podłożu były charakterystyczne dla B. anthracis.
4. Odczyn termoprecypitacji (test Ascoliego) dał wynik
pozytywny z surowicą chorej, jak i z dodatnią surowicą
kontrolną. 5. Próba biologiczna na świnkach morskich
wypadła dodatnio – zakażone zwierzęta laboratoryjne
padły. Badania zostały przeprowadzone w Ośrodku Diagnostyki i Zwalczania Zagrożeń Biologicznych Wojskowego Instytutu Higieny i Epidemiologii w Puławach.
U chorej, zastosowano penicylinę krystaliczną dożylnie, 12 milionów jednostek na dobę w 4 dawkach
podzielonych (3 miliony co 6 godzin) uzyskując efekt
terapeutyczny. Leczenie trwało 28 dni. Odpadnięcie
czarnego, nekrotycznego strupa nastąpiło 10 dnia penicylinowej terapii i uwidoczniło kraterowate sączące się
owrzodzenie. W końcu zmiana przyschła i zagoiła się.
DYSKUSJA
W Polsce, wąglik u ludzi występuje sporadycznie.
W latach 1991 – 2013 odnotowano w naszym kraju
26 przypadków skórnej postaci tej antropozoonozy
(17, 18). Zagrożenie chorobą jest niewielkie, ale stałe.
W suchej glebie przetrwalniki B. anthracis pozostają
żywotne przez dziesiątki lat i mogą doprowadzić do
zakażenia pasących się zwierząt.
Ryzyko wystąpienia choroby u ludzi ściśle związane jest z nadzorem weterynaryjnym nad zwierzętami
i produktami pochodzenia zwierzęcego. Zwierzęta,
które padły z powodu wąglika, należy spopielić lub
pochować nienaruszone głęboko w ziemi - poniżej 2
metrów. Nie wolno wykonywać badań autopsyjnych,
gdyż w obecności tlenu szybko dochodzi do tworzenia
się przetrwalników (1, 3).
W Europie, przypadki wąglika są rzadkie i mogą być
nieuwzględnione w diagnostyce różnicowej. Wczesne,
małe zmiany skórne są niecharakterystyczne, jednakże
ewolucja w kierunku czarnej krosty i takie elementy
jak brak tkliwości, otaczający twardy obrzęk, wieniec
z drobnych pęcherzyków powinny nasuwać podejrzenie
wąglika. Dopełnieniem jest wywiad epidemiologiczny
wskazujący na kontakt ze zwierzętami lub produktami
pochodzenia zwierzęcego (2, 8). Pamiątki z koziej
skóry przywiezione lub pochodzące z krajów endemicznych dla tej jednostki chorobowej mogą być niebezpieczne, bo skażone endosporami wąglika. W krajach
tropikalnych, przypadki skórnego i wziewnego wąglika
były opisywane u osób wyrabiających bębenki z koziej
skóry oraz u grających na tychże instrumentach (2).
W diagnostyce różnicowej należy uwzględnić paciorkowcowe i gronkowcowe zakażenia skóry i tkanki
podskórnej, w tym postać krwotoczną róży, zakażenie
ospą kocią/krowią, wirusem ospy owczej (orf), tularemię, półpasiec, zakażenie wywołane przez Orientia
tsutsugamushi (scrub typhus) (1, 1,3, 19). W wyjątkowych przypadkach wąglik skórny może przypominać
ostre reakcje alergiczne po ukłuciach owadów (20).
Warto wspomnieć o bardzo rzadkiej odmianie skórnego wąglika, czyli o obrzęku złośliwym. Występuje on
zwykle w obrębie twarzy na granicy skóry i błon śluzowych. Obrzęk wokół miejsca inokulacji szybko narasta,
a skóra zmieniona zapalnie przyjmuje odcień fioletowy.
W tych razach nie obserwuje się czarnej krosty. Wąglik
skórny jest zwykle samoograniczającą się infekcją.
Jednakże, w 10 do 20% nieleczonych przypadków dochodzi do uogólnienia się procesu zapalnego i zejścia
śmiertelnego. Lekami z wyboru są penicylina krysta-
Nr 4
Retrospektywne omówienie przypadku skórnego wąglika z 1995 roku
liczna i ciprofloksacyna. Efekt terapeutyczny uzyskuje
się również po zastosowaniu tetracyklin, makrolidów,
aminiglikozydów, chloramfenikolu oraz cefalosporyn
pierwszej generacji. Cefalosporyny drugiej i trzeciej
generacji są nieskuteczne (1-3).
Laseczki wąglika można ujawnić w rozmazach barwionych metodą Grama. Odczynem immunofluorescencji bezpośredniej wykrywa się antygeny B.anthracis.
Posiewy z wymazów oraz hodowla mogą nie dać odpowiedzi, jeśli pacjent otrzymał wcześniej antybiotyk.
Ponadto, w celu potwierdzenia zakażenia wąglikiem
wykonuje się test termoprecypitacji (Ascoliego), czulszy
od niego odczyn mikrohemaglutynacji pośredniej (IMH
test), ponadto próbę biologiczną na świnkach morskich.
Technika polimerazowej reakcji łańcuchowej (PCR polymerase chain reaction) jest czułą i swoistą metodą
diagnostyczną, służącą do szybkiego rozpoznania bądź
wykluczenia wąglika u podejrzanego zwierzęcia oraz
do wykrycia przetrwalników w badanych materiałach
pochodzenia zwierzęcego (1- 3).
753
W przedstawionym przypadku klinicznym zwraca
uwagę fakt, że pacjentka nie należała do grupy ryzyka
zachorowania na wąglik. Mogło to doprowadzić do
chybionego rozpoznania. Na bazie tego doniesienia
warto przypomnieć, że osoby zakładające odzież z naturalnych materiałów (wełniane swetry, skórzane płaszcze
itp.), noszące ozdoby ze skór zwierzęcych oraz grające
na importowanych z krajów tropikalnych niektórych
instrumentach muzycznych mogą być narażone na
zakażenie wąglikiem. Gojenie zmiany skórnej było
powolne, ale postępujące. Z tego też względu antybiotykoterapia powinna trwać odpowiednio długo.
Dr Piotr Kajfasz
Klinika Chorób Odzwierzęcych i Tropikalnych
Warszawskiego Uniwersytetu Medycznego
01-201 Warszawa ul. Wolska 37.
Problemy zakażeń
Zdzisław Wolak, Marta Z. Wałaszek, Wiesław Dobroś, Michał J. Wałaszek, Barbara Jagiencarz-Starzec
WYSTĘPOWANIE SZPITALNYCH ZAKAŻEŃ PRZEWODU POKARMOWEGO
W LATACH 2004-2013 W SZPITALU WOJEWÓDZKIM
Szpital Wojewódzki im. Św. Łukasza w Tarnowie
STRESZCZENIE
WSTĘP. Zakażenia układu pokarmowego często występują jako zakażenia szpitalne. W Polsce istnieją ograniczone
dane dotyczące udziału zakażeń GI w epidemiologii zakażeń szpitalnych. W związku z tym podjęto badania,
którego celem jest: ocena występowania i struktury zakażeń szpitalnych HAI (Healthcare-Associated Infections)
przewodu pokarmowego GI (Gastrointestinal System Infection) u pacjentów hospitalizowanych w Szpitalu im.
Św. Łukasza w Tarnowie.
MATERIAŁ i METODY. Analizowano dane dotyczące 297 545 pacjentów hospitalizowanych w latach od 2004
do 2013. W analizie materiału wykorzystano standardowe metody epidemiologiczne i ujednolicone definicje
zakażeń szpitalnych wydane przez European Center for Disease Prevention and Control (ECDC).
WYNIKI W zanalizowanych materiale wykryto 944 szpitalne zakażenia typu GI. W ciągu dziesięcioletniej
obserwacji trendu występowania zakażeń HAI, zakażenia typu GI wysunęły się na pierwszą pozycję wśród
wszystkich postaci zakażeń szpitalnych zarejestrowanych w Szpitalu Wojewódzkim im. Św. Łukasza w Tarnowie.
Dla zakażeń typu GI Współczynnik Zachorowalności Skumulowanej (WZS) wynosił 0,35%, a Współczynnik
Gęstości Zachorowań (WGZ) 0,57/1000 osobodni pobytu. Zakażenia GI-CDI (Clostridium difficile infection)
zwane również CDAD (C. difficile-associated diarrhea) wykryto u 301 pacjentów, WZS wynosił 0,11%, a WGZ
0,18/1000 osobodni pobytu. Zakażenia GI-GE (Gastroenteritis/excluding CDI) wykryto u 643 pacjentów, WZS
wynosił 0,24%, WGZ 0,39/1000 osobodni pobytu. Zakażenia typu GE-wywołane Rotawirusami wykryto u 292
pacjentów (WZS wynosił 0,11%, a WGZ 0,18/1000); GE-Adenowirusowe wykryto u 32 pacjentów (WZS wynosił 0,01%, a WGZ 0,02/1000); GE-Norowirusowe wystąpiły u 17 pacjentów (WZS wynosił 0,01%, a WGZ
0,01/1000). Najwięcej zakażonych było w Oddziale Dziecięcym, 307 (32,5%) zakażeń (WZS 1,84%, WGZ
2,79/1000) oraz w Oddziale Chorób Wewnętrznych i Nefrologii (202 wykrytych zakażeń tj. 21,4% , WZS 1,47%,
WGZ 1,66/1000).
WNIOSKI. Dziesięcioletnia obserwacja zakażeń występujących w szpitalu wykazała zmianę struktury zakażeń
szpitalnych HAI. W ostatnich latach zakażenia GI zajęły pierwszą pozycję wśród wszystkich HAI występujących
w szpitalu. Najczęstszym czynnikiem etiologicznym zakażeń GI było Clostridium difficile.
Słowa kluczowe: zakażenia szpitalne (HAI), zakażenia przewodu pokarmowego (GI), Rotawirus (GI-GE), zakażenia Clostridium difficile (CDI).
WSTĘP
W piśmiennictwie coraz częściej ukazują się doniesienia o wzrastającej liczbie zakażeń spowodowanych
przez C. difficile (Clostridium difficile) wśród pacjentów hospitalizowanych. Problem narastających zakażeń
CDI występuje nie tylko w Polsce, ale również w wielu
krajach Europy i Świata (1 - 5) Zakażenia te stanowią
problem epidemiologiczny i ekonomiczny związany
z pobytem pacjenta w szpitalu, powodują przedłużenie
pobytu chorego, cierpienie, stres, a także mogą być
postrzegane jako zagrożenie zdrowia publicznego (6).
W Polsce istnieją nieliczne opracowania omawiające
zagadnienia związanie z zakażeniami szpitalnymi
układu pokarmowego, głównie dotyczące biegunek
wywołanych przez rotawirusy zwłaszcza w oddziałach pediatrycznych (7,8). Brak jest polskich badań
epidemiologicznych na temat częstości występowania
zakażeń CDI. W dostępnej literaturze brak jest też
informacji dotyczących długotrwałego monitorowania
756
Nr 4
Zdzisław Wolak, Marta Z Wałaszek i inni
zakażeń CDI w polskich szpitalach (9). Natomiast
w Szpitalu Wojewódzkim im. Św. Łukasza w Tarnowie zakażenia szpitalne, jako samodzielne przyczyny
biegunek z uwzględnieniem czynników etiologicznych,
rejestrowano już od 2004 r. Dlatego też postanowiliśmy
dokonać wszechstronnej analizy tych zakażeń w oparciu
o standardowe, jednolite narzędzia w postaci Współczynników Zachorowalności Skumulowanej (WZS)
i Współczynników Gęstości Zachorowań (WGZ).
Uzyskane wyniki mogą służyć do porównania i oceny
sytuacji epidemiologicznej w polskich szpitalach, jak
również w oddziałach wysokospecjalistycznych.
MATERIAŁ I METODY
W latach 2004-2013 prowadzono nadzór epidemiologiczny pacjentów, którzy byli hospitalizowani
w Szpitalu Wojewódzkim im. Św. Łukasza w Tarnowie.
Monitorowaniem objęto 21 oddziałów szpitalnych
o specyfice zabiegowej, zachowawczej oraz oddziały
dziecięce. Z analizy wyłączono oddziały, w których nie
zanotowano zakażeń szpitalnych przewodu pokarmowego. Rozpoznawanie zakażeń prowadzono kierując
się wytycznymi opracowanymi przez grupę ekspertów
z CDC (Centers for Disease Control and Prevention),
a następnie ECDC (European Center for Disease
Prevention and Control). Wykryte zakażenia szpitalne
(HAI - Healthcare-Associated Infections) poddano
analizie i pogrupowano zgodnie z definicjami ECDC
(10, 11). W rejestracji wykrytych zakażeń stosowano
podział na kliniczne formy zakażeń: zakażenia miejsca
operowanego (SSI - Surgical Site Infection), zapalenia
płuc (PN - Pneumonia), zakażenie układu moczowego
(UTI - Urinary Tract Infection), zakażenia krwi (BSI
- Bloodstream Infection), zakażenia układu pokarmowego (GI - Gastrointestinal System Infection), inne
zakażenia (OTH - Other). Współczynnik Zachorowalności Skumulowanej (WZS/100 hospitalizacji i na 1000
hospitalizacji) wyliczono opisując liczbę nowych przypadków GI w badanej populacji w jednostce czasu wg
wzorów: liczba GI dzielona przez liczbę hospitalizacji
pacjentów razy 100 lub 1000. Współczynnik Gęstości
Zachorowań (WGZ/1000 osobodni pobytu) wyliczono
wg wzorów: liczba GI dzielona przez liczbę osobodni
pobytu razy 1000.
Zakażenia układu pokarmowego (GI) podzielono
na: zakażenia wywołane przez C. difficile (GI-CDI);
zakażenia przewodu pokarmowego inne niż C. difficile (GI-GE). Następnie zakażenia typu GI-GE (Gastroenteritis/excluding CDI) podzielono na podgrupy
z uwzględnieniem czynników etiologicznych zakażeń,
takich jak: rotawirusy, norowirusy, adenowirusy, C.
albicans oraz brak czynnika etiologicznego. Zgodnie
z obowiązującymi aktami prawnymi pacjenta, u którego
wystąpiło podejrzenie zakażenia lub zakażenie poddawano właściwej izolacji. Czynniki etiologiczne zakażeń
takie jak: rotawirusy, norowirusy, C. difficile, które
spowodowały zakażenia GI, monitorowano i analizowano w ramach nadzoru nad czynnikami alarmowymi.
Badania stolca wykonywano z użyciem następujących podłoży: chromogennych Chromid ID CPS, agar
Mac Conkeya, agar Hektoen, podłoże z seleninem sodu
(podłoża firmy bioMérieux), podłoże Mac Conkey z dodatkiem sorbitolu (wybiórcza izolacja E. coli O157:H7
- podłoże firmy Grasso) podłoże Sabouraud (z dodatkiem gentamycyny i chloramfenikolu). W diagnostyce
stosowano również testy diagnostyczne na obecność
Rotawirusów i Adenowirusów (VIKIA® Rota-Adeno
firmy bioMériux S.A.) oraz test C. difficile (C. DIFF
QUIK CHEK COMPLETE firmy TECHLAB).
WYNIKI
W ciągu 10 lat leczono w Szpitalu Wojewódzkim
im. Św. Łukasza w Tarnowie 297 545 pacjentów. U 5167
(1,7%) chorych rozpoznano zakażenie szpitalne HAI,
w tym u 944 zakażenia typu GI. W okresie tym w szpitalu rozpoznano 52 ogniska szpitalnych GI, w których
zachorowało 404 z 944 pacjentów. Pozostałe zachorowania na szpitalne GI występowały poza ogniskami
zakażeń u 540 z 944 pacjentów. Zaobserwowano systematyczny wzrost liczby pacjentów z zakażeniami typu
GI w ogólnej puli osób z zakażeniem HAI, największy
wzrost szpitalnych GI zanotowano w Oddziale Chorób
Wewnętrznych i Nefrologii oraz Oddziale Urologii.
Liczba zakażeń GI w poszczególnych latach wynosiła od 14 (2005 r.) do 155 (2013 r.) (Tab. I). W ciągu
dziesięcioletniej obserwacji zmianie uległa częstość
występowania zakażeń GI w ogólnej puli zakażeń HAI,
w latach od 2004 do 2006 zakażenia te zajmowały piątą
pozycję w szpitalu po SSI, BSI, PN, UTI, a w latach od
2010 do 2013 zakażenia te wysunęły się na pierwszą pozycję (Tab. II). Dla wykrytych zakażeń GI w liczbie 944,
Współczynnik Zachorowalności Skumulowanej (WZS)
wynosił 0,35%, a Współczynnik Gęstości zachorowań
(WGZ) 0,57/1000 osobodni hospitalizacji (Tab. III).
Z grupy zakażeń GI wyodrębniono zakażenia wywołane
C. difficile (GI-CDI) i inne nie wywołane C. difficile
(GI-GE). Zakażenia typu CDI wykryto u 301 pacjentów,
WZS wynosił 0,11%, 1,13/1000 hospitalizacji, a WGZ
0,18/1000 osobodni hospitalizacji. Zakażenia GE wykryto u 643 pacjentów, WZS wynosił 0,24%, 2,41/1000
hospitalizacji, a WGZ 0,39/1000 osobodni hospitalizacji
(Tab. IV). Zakażenia układu pokarmowego typu GI-GE
podzielono z uwzględnieniem wirusowych czynników
etiologicznych, które dotyczyły 341 pacjentów, gdzie
WZS wynosił 0,13%, a WGZ 0,21/1000 osobodni pobytu. Wśród tych zakażeń wyróżniono: GE –rotawiru-
Nr 4
Występowanie szpitalnych zakażeń przewodu pokarmowego
sowe wykryte u 292 pacjentów (WZS wynosił 0,11%,
a WGZ 0,18/1000); GE – adenowirusowe wykryte u 32
pacjentów (WZS wynosił 0,01%, a WGZ 0,02/1000);
GE – norowirusowe wystąpiły u 17 pacjentów (WZS
wynosił 0,01%, a WGZ 0,01/1000) (Tab. V). W początkowym okresie badania (2004-2010 r.) w czynnikach
etiologicznych zakażeń GI przeważały zakażenia wywołane przez rotawirusy, które wykryto w odsetku od
31,0% do 57,1% wśród wszystkich czynników etiologicznych zakażeń GI. W późniejszych latach badania
(2011-1013 r.) pierwsze miejsce zajmowały zakażenia
spowodowane przez C. difficile, które stanowiły od
36,4% do 49,1%. Zakażenia wywołane przez C. albicans występowały z częstością od 0 do 5,1% wśród
wszystkich zakażeń GI. W znacznym odsetku zakażeń
GI nie wykryto czynnika etiologicznego zakażenia.
W całej populacji badanych pacjentów z GI problem
ten dotyczył od 22,4% do 52,4% (Tab. VI).
Uwzględniając specyfikę oddziałów szpitalnych,
najwięcej zakażeń wystąpiło w oddziałach: Dziecięcym
- 307 zakażeń (32,5%); Chorób Wewnętrznych i Nefrologii - 202 (21,4%); Urologii - 83 (8,8%) i innych (Tab.
VII). Współczynnik Zachorowalności Skumulowanej
(WZS) osiągnął najwyższą wartość w oddziałach:
Dziecięcym 1,84%; Chorób Wewnętrznych i Nefrologii 1,47%; Anestezjologii i Intensywnej Terapii 0,85%
i innych (Tab. VIII). Współczynnik gęstości zachorowań
(WGZ) na wysokim poziomie dotyczył następujących
oddziałów: Dziecięcego 2,79/1000 osobodni hospitalizacji; Chorób Wewnętrznych i Nefrologii 1,66/1000;
Anestezjologii i Intensywnej Terapii 1,43/1000 (Tab.
IX). Zakażenia wywołane przez wirusy występowały
najczęściej w Oddziale Dziecięcym, wykryto je u 259
(WSZ wynosił 1,55%, a WGZ 2,34/1000). Zakażenia
GI-CDI dominowały w Oddziale Chorób Wewnętrznych i Nefrologii, zakażenia te dotyczyły 145 pacjentów (WSZ wynosił 1,05%, a WGZ 1,19/1000) (Tab.
VII - IX).
DYSKUSJA
W oddziałach objętych badaniem nadzór nad zakażeniami szpitalnymi (HAI) prowadzony jest od 2001 r.
W początkowym okresie monitorowania zakażeń HAI,
zwracano uwagę na najistotniejsze klinicznie formy
zakażeń szpitalnych typu SSI, BSI, PN, UTI. Jednak
w codziennej praktyce zakażenia typu GI były bardzo
często zgłaszane do Zespołu Kontroli Zakażeń, jako
zdarzenie niepożądane, związane z leczeniem pacjenta.
Stanowiły też one istotny problem pielęgnacyjny i leczniczy. Od roku 2004 włączono zakażenia typu GI w stały
nadzór nad zakażeniami szpitalnymi. Istotny problem
organizacyjny rysował się w kwestii zapewnienia pacjentom z GI właściwych warunków izolacji, ponieważ
757
nie wszystkie sale pacjentów są wyposażone w węzeł
sanitarny. W przypadku braku możliwości izolacji pacjentów oraz niewłaściwych warunków sanitarnych,
czynniki etologiczne zakażeń układu pokarmowego
szybko rozprzestrzeniają się w środowisku szpitalnym
powodując występowanie ognisk epidemicznych.
Sytuacja taka powoduje zwiększone zapotrzebowanie
na opiekę pielęgniarską, zwłaszcza wśród pacjentów
obłożnie chorych, generuje dodatkowe koszty leczenia,
pogarsza samopoczucie pacjenta oraz utratę zaufania do
personelu i metod leczenia. Rozpoznanie zakażenia GI
u hospitalizowanego pacjenta powoduje konieczność
uruchomienia działań alarmowych w postaci skrupulatnego przestrzegania zasad higieny, szczególnie w zakresie mycia i dezynfekcji rąk oraz prowadzenia rzetelnych
procesów dekontaminacji sprzętów i pomieszczeń
pobytu pacjenta. Zakażenia GI występują z różną
częstotliwością w oddziałach szpitalnych. W Polsce
często mają etiologię wirusową (7,8,12). Wśród wirusów najczęściej za zakażenia odpowiadają: rotavirusy,
norovirusy, adenowirusy. W naszych badaniach zakażenia wirusowe GI były powodowane głównie przez
rotawirusy, które charakteryzuje wysoka zakaźność
i odporność na niekorzystne warunki środowisk. Wśród
przyczyn rozprzestrzeniania się szpitalnych zakażeń
rotawirusowych wymienia się: obecność w oddziale
pacjentów zakażonych rotawirusem, nadmierne zagęszczenie pacjentów w oddziale, niewłaściwe zachowania
higieniczne dzieci, rodziców i personelu medycznego,
zaniechanie lub opóźnienia we wprowadzeniu izolacji,
brak warunków do właściwej izolacji pacjentów. Według Nitsch-Osuch i wsp. (13) gęstość występowania
biegunki rotawirusowej w Unii Europejskiej występuje
na poziomie 0,7-10/1000 osobodni a w sześcioletnich
badaniach własnych przeprowadzonych w Polsce
w grupie pacjentów 0-18 lat na WZS wynosił 0,91%,
natomiast WGZ 2,05/1000 osobodni. W Oddziale Dziecięcym Szpitala Wojewódzkiego im. Św. Łukasza uzyskaliśmy dla zakażeń rotawirasami WZS na poziomie
1,55%, a WGZ wynosił 2,34/1000 osobodni. Oznacza
to, że liczba nowych przypadków zakażeń w badanym
szpitalu była większa niż w porównywanym, jednak
długość pobytu pacjenta w szpitalu wiązała się z podobnym ryzykiem wystąpienia zakażenia w porównywanych szpitalach. Zgodnie z danymi opracowanymi
przez Ołdak i wsp. (8) w materiale obejmującym lata
2006-2009, zakażenia spowodowane rotawirusami
stanowiły 31,4% wszystkich zakażeń szpitalnych.
W Szpitalu Wojewódzkim im. Św. Łukasza w Tarnowie
udział zakażeń układu pokarmowego GI (w tym zakażeń
wywołanych przez rotawirusy) w ogólnej puli zakażeń
szpitalnych (HAI) wynosił 16,9%, natomiast udział
zakażeń spowodowanych rotawirusem w puli zakażeń
GI uzyskaliśmy na poziomie 30,4%. W analizie zakażeń
pokarmowych przeprowadzonej przez Wojewódzką
758
Zdzisław Wolak, Marta Z Wałaszek i inni
Stację Sanitarno-Epidemiologiczna w Krakowie (14,15)
w obszarze województwa małopolskiego dominował
norovirus (24%), rotavirus (10%). Łoś-Rycharska i wsp.
(16) określa, że zakażenia wywołane przez rotawirusy
występują niezwykle często i odpowiadają za nawet
ponad 50% ostrych zakażeń przewodu pokarmowego,
szacuje, że aż w 30% ustalenie etiologii ostrej biegunki
nie jest możliwe. Należy zaznaczyć, że w badanym szpitalu również w 30% przypadków nie udało się ustalić
czynników etiologicznych zakażeń. Za przyczynę tak
wysokiej zachorowalności na biegunki rotawirusowe
uważana jest bardzo duża zaraźliwość wirusa. Jeden mikrogram stolca lub wydzieliny dróg oddechowych jest
wystarczającą ilością do spowodowania zakażenia (17).
Obserwuje się systematyczną zmianę zmniejszenia
udziału zakażeń wywołanych przez rotawirusy na rzecz
wzrastającej liczby zakażeń wywołanych C. difficile.
W ciągu ostatnich lat patogen ten coraz częściej wywołuje zakażenia w oddziałach szpitalnych. Bandoła
i wsp. (14, 15) opisuje udział C. difficile w puli zakażeń
pokarmowych w województwie małopolskim w 2012
r. na poziomie 7%. W Szpitalu Wojewódzkim im. Św.
Łukasza w Tarnowie udział C. difficile wśród zakażeń
układu pokarmowego wynosił 31,9%. Elixhauser i wsp.
(2), który prowadził ocenę zachorowalności na CDI
w amerykańskich szpitalach podaje, że zakażenie to
było stwierdzone u 0,77% hospitalizowanych pacjentów. W 2009 r. w podobnym badaniu wynosiła 0,9%,
a liczba pacjentów z CDI wzrosła czterokrotnie (18).
W Szpitalu Wojewódzkim im. Św. Łukasza w Tarnowie uzyskano podobny cztero-krotny wzrost liczby
pacjentów z CDI, średnia zachorowalność wynosiła
0,11%, a w roku 2013 była najwyższa 0,26%. Jest wiele
współczynników oceniających częstość występowania
zakażeń szpitalnych w tym GI. Barbut i wsp. (1) ocenił
zachorowalność na CDI w badaniu przeprowadzonym
w 2002 r. w 212 europejskich szpitalach 1000 hospitalizacji uzyskując zachorowalność na poziomie 1,1.
W Szpitalu Wojewódzkim im. Św. Łukasza uzyskaliśmy
identyczną zachorowalność na CDI, która wynosiła
1,1/1000 hospitalizacji.
Wśród działań profilaktycznych zakażeń GI
o etiologii wirusowej najprostszą metodą profilaktyki
zakażeń są szeroko pojęte zasady higieny, zwłaszcza
higieniczne mycie i dezynfekcja rąk (17). Istotne
znaczenie ma hospitalizacja pacjentów w dobrych
Nr 4
warunkach lokalowych z możliwością zapewnienia
skutecznej izolacji (16). W przypadku zakażeń GI-CDI
brak jest jednoznacznej odpowiedzi, co odpowiada za
zwiększoną zachorowalność na CDI. Najczęściej w literaturze wymienia się częste stosowania antybiotyków
jako najistotniejszy czynnik ryzyka (1, 9, 19, 21, 22).
Monitorowanie szpitalnych zakażeń w Polsce należy do działań obligatoryjnych, jednak różny może być
zakres nadzoru nad zakażeniami i przyjęte kryteria ich
rozpoznawania. Do rozważenia przez Komitet Kontroli
Zakażeń pozostaje również zakres zbieranych danych
i ich analiza. Zidentyfikowanie skali zakażeń GI,
ich struktury oraz określenie obszarów ryzyka może
przyczynić się do skutecznego ich zwalczania. Jednak
najistotniejszym elementem profilaktyki zakażeń GI jest
przekazywanie informacji do personelu medycznego,
pacjentów i ich rodzin oraz kierowników oddziałów
szpitalnych. Dlatego też, zebrane dane mogą być użytecznym narzędziem nie tylko w aspekcie poszerzenia
wiedzy z zakresu zakażeń szpitalnych, ale również
po określeniu obszarów priorytetowych powinny służyć
podejmowaniu działań zapobiegawczych.
PODSUMOWANIE I WNIOSKI
1. Zakażenia układu pokarmowego należą obecnie do
najczęściej występujących zakażeń szpitalnych.
2. W oddziałach dla dorosłych dominowały zakażenia
wywołane przez C. difficile, a w oddziałach dziecięcych źródłem zakażenia był rotawirus.
3. Racjonalizacja stosowania antybiotyków powinna
przyczynić się do obniżenia liczby zakażeń wywołanych przez C. difficile.
4. Przestrzeganie zasad higieny i skuteczna izolacja
pacjentów mogą przyczynić się do obniżenia liczby
zakażeń rotawirusowych.
Zdzisław Wolak
Szpital Wojewódzki im. Św. Łukasza w Tarnowie
ul. Lwowska 178a
33-100 Tarnów
tel. 14/6315 461
Problemy zakażeń
Anna Schneider1, Anna Mól1, Katarzyna Lisowska1, Maria Jax-Dambek2 ,
Dominika Lachowicz3, Piotr Obuch-Woszczatyński3, Hanna Pituch3
ZASTOSOWANIE TRÓJSTOPNIOWEGO ALGORYTMU W DIAGNOSTYCE
PACJENTÓW Z PODEJRZENIEM BIEGUNKI POANTYBIOTYKOWEJ
O ETIOLOGII CLOSTRIDIUM DIFFICILE
Laboratorium Mikrobiologii, 2Sekcja ds. Kontroli Zakażeń Szpitalnych
Szpital Kliniczny im. Przemienienia Pańskiego Uniwersytetu Medycznego w Poznaniu
3
Katedra i Zakład Mikrobiologii Lekarskiej, Warszawski Uniwersytet Medyczny w Warszawie
1
STRESZCZENIE
Clostridium difficile jest wiodącym czynnikiem szpitalnych biegunek zakaźnych. W wielu ośrodkach w Polsce rutynowa diagnostyka zakażeń Clostridium difficile opiera się nadal na testach immunoenzymatycznych do
wykrywania toksyn A/B w kale. W ostatnich latach pojawiły się nowe testy diagnostyczne, których zastosowanie
przyśpiesza i zwiększa czułość wykrywania toksynotwórczych szczepów C.difficile, co jest szczególnie ważne
wobec pojawienia się szczepów hiperepidemicznych.
CEL PRACY. Ocena przydatności trójstopniowego algorytmu w diagnostyce chorób związanych z Clostridium
difficile (CZCD) ze względu na obserwowane w praktyce diagnostycznej przypadki uzyskiwania wyników fałszywie ujemnych przy zastosowaniu jedynie testów immunoenzymatycznych
do wykrywania toksyn.
MATERIAŁ I METODY. Materiał stanowiły próbki kału otrzymane od pacjentów z objawami biegunki. W diagnostyce zakażeń zastosowano testy immunoenzymatyczne wykrywające dehydrogenazę glutaminianową (GDH)
i toksyny A/B, a także metodę hodowlaną i testy RT-PCR.
WYNIKI. W rutynowej diagnostyce wśród przebadanych 615 pacjentów u 108 chorych wykryto szczep toksynotwórczy GDH (+) TOX (+), a u 67 otrzymano wynik nieokreślony GDH (+) TOX (-). Próby z wynikiem
nieokreślonym poddano dalszej analizie, która pozwoliła dodatkowo wykryć u 32 pacjentów szczep toksynotwórczy, co stanowiło 22,9 % wszystkich dodatnich próbek (n=140).
WNIOSKI. Trójstopniowy algorytm zapewnia wiarygodną i dokładną diagnostykę chorób związanych z C.difficile.
Słowa kluczowe: zakażenie Clostridium difficile, trójstopniowy algorytm diagnostyczny zakażeń C.difficile,
PCR - rybotypowanie
WSTĘP
Clostridium difficile (CD) jest wiodącym czynnikiem etiologicznym szpitalnych biegunek zakaźnych na
całym świecie. Do najważniejszych czynników ryzyka
rozwoju zakażenia C. difficile zalicza się: antybiotykoterapię, długotrwałą hospitalizację oraz zaawansowany
wiek pacjenta (powyżej 65 roku życia). Choroba może
dotyczyć pacjentów we wszystkich grupach wiekowych
(1,2). Jak wykazał Barlett i wsp. C.difficile odpowiada
za 15-25% przypadków biegunki poantybiotykowej
(AAD- antibiotic-associated diarrhoea) i praktycznie
za wszystkie przypadki rzekomobłoniastego zapalenia
jelita grubego (PMC, pseudomembranous colitis ) (3).
W ostatnich latach zaobserwowano na całym
świecie stałą tendencję wzrostową zakażeń C.difficile
. W Stanach Zjednoczonych, Kanadzie i Europie odnotowano czterokrotny wzrost liczby zakażeń C. difficile,
a także wzrost liczby przypadków o ciężkim przebiegu.
Może to być związane z pojawieniem się nowych, epide-
micznych szczepów C. difficile (4-8). Ocenia się, że10-30%
chorych, dorosłych pacjentów jest skolonizowana przez C.
difficile. Jednak nie u wszystkich rozwija się biegunka (9).
Prawidłowa diagnostyka szpitalnych biegunek
zakaźnych ma kluczowe znaczenie w identyfikacji
pacjenta z zakażeniem C.difficile, wpływając tym samym na zmniejszenia ryzyka transmisji potencjalnie
epidemicznych szczepów. Obecnie na rynku dostępne
są szybkie i proste testy do wykrywania markerów
760
Nr 4
Anna Schneider, Anna Mól i inni
zakażenia toksynotwórczymi szczepami C.difficile
bezpośrednio w próbkach kału. Testy te różnią się czułością, swoistością, czasem wykonania oraz kosztami
ponoszonymi przez szpital (10-15).
Celem pracy była ocena przydatności trójstopniowego
algorytmu w diagnostyce chorób spowodowanych zakażeniem C. difficile (CZCD). Przy stosowaniu w rutynowej
diagnostyce jedynie testów wykrywających toksyny zdarzają
się przypadki nie wykrycia zakażęnia CD.
MATERIAŁ I METODY
Badaniami objęto 615 próbek kału biegunkowego,
które pobrano od dorosłych chorych, hospitalizowanych
w Szpitalu Klinicznym im. Przemienienia Pańskiego
Uniwersytetu Medycznego w Poznaniu, w okresie od
stycznia 2011 r. do końca lutego 2013 r. Pacjenci objęci
badaniami byli leczeni na oddziałach: chirurgii naczyń
i chirurgii onkologicznej, kardiologii i kardiochirurgii, intensywnej terapii, hematologii z pododdziałem
transplantologii, pulmonologii, chemioterapii oraz na
oddziale internistycznym i opieki paliatywnej. Analizę postępowania diagnostycznego z zastosowaniem
trójstopniowego algorytmu diagnostycznego przeprowadzono badając niepowtarzalne próbki kału (liczba
zbadanych próbek kału była równa liczbie pacjentów).
Algorytm diagnostyczny przedstawiono na rycinie 1.
W diagnostyce laboratoryjnej zastosowano immunoenzymatyczne testy firmy TechLab (Blacksburg,
USA, VA 24060) do wykrywania dehydrogenazy glutaminianowej (GDH) czyli antygenu somatycznego C. difficile oraz toksyn A/B. W pierwszym etapie diagnostyki
stosowano testy: C.DIFF CHEK60, C.DIFF CHEK
TOX A/B (do końca XI 2012 roku). Od wprowadzenia
przez producenta nowego, szybszego testu o większej
czułości (XII 2012 roku) zastosowano testy: C.DIFF
QUIK CHEK, C.DIFF QUIK TOX A/B, C.DIFF QUIK
COMPLETE. W przypadku wyników nieokreślonych
GDH (+), toksyny A/B (TOX A/B) (-) posiewano
próbki kału na podłoża stałe i/lub wykonywano testy
genetyczne z zastosowaniem testu (Xpert CD, Cepheid,
Sunnyvale, CA, USA). Do hodowli użyto podłóż firmy
bioMérieux SA, Marcy l’Etole, Francja.
W pierwszym okresie (do I połowy 2012 roku)
zastosowano pożywkę Columbia agar z 5% krwią
baranią z mieszanką antybiotyków: cykloseryną – 100
mg/L, cefoksytyną - 8 mg/L i amfoterycyną B - mg/L
(CLO) oraz Columbia agar z 5% krwią baranią. W celu
zwiększenia precyzyjności metody próbki kału poddano
działaniu alkoholu etylowego (równa objętość kału
i etanolu 96%) przez 1 godzinę, co ograniczyło wzrost
innych nieprzetrwalnikujących bakterii. W tym okresie
napotykano na problem z izolacją szczepu C. difficile.
Od pojawienia się na rynku w II połowie 2012 roku,
podłoża chromogennego - ChromID C.difficile (CDIF,
bioMérieux SA, Marcy l’Etole, Francja), zawierającego
m.in. taurucholan sodu zdecydowanie zwiększono częstość izolacji CD. Podłoża inkubowano w warunkach
beztlenowych przez 48 – 72 godz. (pożywka CCA) i 24
godz. (pożywka chromogenna) w temperaturze 37ºC.
Wyhodowane szczepy identyfikowano na podstawie
charakterystycznego wzrostu, zapachu para-krezolu,
oceny preparatu barwionego metodą Grama i identyfikacyjnych testów biochemicznych (ANC, bioMérieux
SA, Marcy l’Etole, Francja).
Toksynotwórczość szczepów badano przy pomocy
testów ELISA do wykrywania toksyn (C.DIFFICILE
TOX A/B II) lub testów genetycznych RT-PCR (Xpert
CD, Cepheid, Sunnyvale, CA, USA) do wykrywania
fragmentów genów toksyny B, toksyny binarnej oraz
charakterystycznej delecji w genie regulacji negatywnej tcdC w pozycji 117. Wybór testu diagnostycznego
zależał od objawów i stanu klinicznego pacjenta.
Wyhodowane szczepy C. difficile poddano PCR-rybotypowaniu. PCR-rybotypowanie przeprowadzono
w Pracowni Beztlenowców w Katedrze i Zakładzie
Mikrobiologii Lekarskiej Warszawskiego Uniwersytetu
Medycznego w Warszawie, stosując jako wzorce szczepy referencyjne pochodzące z kolekcji Cardiff-ECDC.
Szczepy, których nie można było zakwalifikować do
żadnego z posiadanych wzorców PCR-rybotypów przesłano do ośrodka referencyjnego w Leiden (Leiden University
Medical Center, Leiden, Holandia).
WYNIKI
W okresie od 1 stycznia 2011 roku do 28 lutego
2013 roku zbadano 615 próbek kału pobranych od
chorych z biegunką i niedrożnością jelit, leczonych na
różnych oddziałach szpitalnych (dane przedstawiono
w tabeli I).
Wyniki zastosowania trójstopniowego algorytmu
zamieszczono na ryc. 2.
W 140 próbkach kału pobranych od pacjentów
z biegunką wykryto toksyny C.difficile i/lub wyhodowano szczepy toksynotwórcze, co stanowiło 22,7%
wszystkich badań. Wśród tych pacjentów 26,4% (n=37)
stanowiły kobiety w wieku od 26 do 87 lat (średnia wieku 60 lat, mediana 63 lata), a 73,6% (n=103) stanowili
mężczyźni w wieku od 21 do 88 lat (średnia wieku 62
lata, mediana 63 lata). W analizowanej grupie (n=140)
okres hospitalizacji wynosił od 1 do 76 dni (średnio 14
dni, mediana 10 dni). U większości chorych (131/140)
objawy biegunki wystąpiły między 3 do 76 dniem hospitalizacji. Przyczyną hospitalizacji pacjentów były
choroby i wady serca, choroby naczyniowe, rozrostowe
krwi i inne związane z układem oddechowym.
Nr 4
Trójstopniowy algorytm w diagnostyce pacjentów podejrzeniem biegunki poantybiotykowej
W badaniu przesiewowym z zastosowaniem testu
do wykrywania dehydrogenazy glutaminianowej GDH
wykryto w 175 (28,45%) próbkach, a w 440 (71,54%)
nie wykryto tego markera. Na podstawie uzyskania
ujemnego wyniku GDH wykluczono zakażenie C.difficile. Próbki, w których stwierdzono obecność GDH
(n=175) poddano dalszej analizie z zastosowaniem
testu ELISA do wykrywania toksyn C. difficile. W 106
(17,23%) próbkach kału wykryto toksyny A/B C.difficile, a w 67 nie wykryto toksyn. W przypadku 2 próbek
kału, ze względu na ciężki stan kliniczny pacjenta, wykonano test RT-PCR i wykryto fragment genu toksyny
B ( tcdB ), natomiast nie wykryto fragmentu toksyny
binarnej. W 67 próbkach, w których w II etapie nie
wykryto toksyn, przeprowadzono następny etap diagnostyki. Z 59 próbek kału wykonano posiew natomiast
w 8 próbkach, zastosowano metodę genetyczną RT-PCR
ze względu na stan badanych pacjentów i potrzebę pilnego uzyskania wyniku. Stosując metodę RT-PCR w 3
próbkach stwierdzono fragmenty genów toksyn tcdB,
cdtA i/lub cdtB oraz delecję w genie tcdC w pozycji
117, a w 3 tylko fragment genów toksyny tcdB. Z 43
próbek kału wyhodowano szczepy C.difficile. Toksynotwórczość szczepów potwierdzono w 25 szczepach
stosując test ELISA do wykrywania toksyn, natomiast
dla 4 spośród 18 przypuszczalnie nietoksynotwórczych
szczepów w teście ELISA wykonano dodatkowo test
RT-PCR, ze względu na objawy kliniczne i czynniki ryzyka wskazujące na CDI. Fragment genu tcdB wykryto
w jednym szczepie. Wyhodowane szczepy dla których
uzyskano wynik GDH(+ ) TOX(-) poddano PCR – rybotypowaniu i ustalono, że 8 z nich należy do hiperepidemicznego PCR - rybotypu 027 oraz dwa szczepy do
genetycznie spokrewnionego z PCR-rybotypem 027 tj.
do PCR-rybotypu 176. Pozostałe szczepy 8 szczepów
należało do innych rybotypów tj. 002 (n=1), 005 (n=2),
012 (n=1), 014 (n=2), 015 (n=1), i 087 (n=1). Wyniki
rybotypowania przedstawiono w tabeli II. Wszystkie
szczepy C. difficile poddane PCR-rybotypowaniu były
toksynotwórcze, co wykazano stosując odpowiednie
testy do wykrywania toksyn A/B.
DYSKUSJA
Podstawą rozpoznania zakażenia C.difficile są objawy kliniczne i stwierdzenie obecności toksyn A/B
w przewodzie pokarmowym pacjenta. Wiele laboratoriów do wykrywania toksyn A i/lub B C. difficile
stosuje szybkie testy komercyjne oparte na reakcji
immunoenzymatycznej. Czułość tych metod jest niewystarczająca do identyfikacji wszystkich chorych
z zakażeniem C.difficile. Sposobem na rozwiązanie tego
problemu jest zastosowanie odpowiedniego algorytmu
diagnostycznego.
761
W 2009 roku przedstawiciele towarzystwa europejskiego ,,European Society of Clinical Microbiology and Infectious Diseases” (ESCMID) a w 2010
towarzystw amerykańskich ,,Society for Healthcare
Epidemiology of America” (SHEA) i ,,The Infectious
Diseases Society of America” (IDSA) oraz ,,American
Society of Microbiology” opracowali wytyczne dotyczące diagnostyki chorób związanych z C.difficile
(16,17,18). Zaproponowano zastosowanie przesiewowych testów do wykrywania dehydrogenazy glutaminianowej (GDH), a następnie w przypadku uzyskania
wyniku dodatniego potwierdzenie z zastosowaniem
testów do wykrywania toksyny A/B testem ELISA lub
testem genetycznym. Testy do wykrywania antygenu
somatycznego GDH charakteryzuje wysoka czułość
(od 97,6% do 100%) oraz wysoka ujemna wartość predykcyjna (NPV 99%). Zatem można przyjąć, że ujemny
wynik wyklucza obecność C.difficile w badanej próbce
kału. Należy pamiętać, że wykrycie antygenu GDH nie
pozwala rozróżnić zakażenia szczepem toksynotwórczym od kolonizacji szczepem nietoksynotwórczym
(11,14,17,19,20).
Złotym standardem w wykrywaniu toksyny B
jest test cytotoksyczności - metoda czasochłonna,
kosztowna, wymagająca hodowli tkankowych i potwierdzenia w teście neutralizacji, dlatego też nie jest
rutynowo stosowana (16,17,18). Europejska grupa
badawcza na podstawie przeprowadzonych badań
wykazała, że 93% laboratoriów opiera diagnostykę
CDI na komercyjnych testach do wykrywania toksyn
A/B bezpośrednio w próbkach kału. Około 80% bada
toksynotwórczość metodą immunoenzymatyczną
a 41,6% stosuje zarówno testy ELISA jak i hodowlę
(21). Testy oparte na reakcji immunoenzymatycznej
(ELISA) są proste w wykonaniu a wynik uzyskuje
się w krótkim czasie. Metoda ELISA wykazuje bardzo
dobrą swoistość, lecz jest niewystarczająco czuła, co
może prowadzić do zaniżenia liczby rozpoznawanych
zakażeń (22). Potwierdzają to wyniki uzyskane w niniejszej pracy. Kontynuacja dalszego etapu badania
diagnostycznego próbek pochodzących od 67 chorych,
u których wstępnie nie wykryto toksyn testem ELISA,
z zastosowaniem algorytmu diagostycznego umożliwiła rozpoznanie zakażenia szczepem potencjalnie
toksynotwórczym C. difficile dodatkowo u 32 (22,9%)
pacjentów objawami klinicznymi zakażenia. Wszystkie
wyhodowane szczepy pochodzące od chorych, u których wykryto tylko antygen GDH były toksynotwórcze.
Podobne wyniki uzyskała Nurzyńska i wsp. stosując
dwustopniowy algorytm do badania próbek , które
wstępnie uznano za ujemne GDH (+) TOX (-) (23).
Pacjenci, u których uzyskano wyniki fałszywie
ujemne stanowią potencjalne źródło zakażenia krzyżowego i mogą przyczyniać się do wybuchu epidemii
szpitalnej. Brak właściwej, skutecznie przeprowadzonej
762
Nr 4
Anna Schneider, Anna Mól i inni
diagnostyki mikrobiologicznej pociąga za sobą niezdiagnozowanie pacjenta i konsekwencje kliniczne oraz
epidemiologiczne. Wdrożenie odpowiednich metod
diagnostycznych może przyczynić się do wzrostu liczby
wykrytych zakażonych pacjentów.
Posiew kału w kierunku C. difficile może być
przydatny jako metoda uzupełniająca wyniki testów immunoenzymatycznych w przypadku pacjentów, którzy
mieli objawy kliniczne wskazujące na zakażenia C. difficile i u których stwierdzono obecność tylko antygenu
GDH. Metoda hodowlana jest czuła, lecz czasochłonna
i wymaga potwierdzenia toksynotwórczości wyhodowanego szczepu. Jednakże otrzymanie szczepu w hodowli
pozwala na wykonanie szeregu dodatkowych badań np:
ustalenie typu genetycznego co pozwala na pełniejsze
rozpoznanie epidemiologii zakażeń C.difficile.
W badaniach wykonywanych w okresie od stycznia
2011 roku do połowy 2012 roku spotykano się z problemem braku wyhodowania szczepu C. difficile z próbki
kału, w której wykryto antygen GDH. Nie zidentyfikowano przyczyny zaistniałej sytuacji. Powodem mogła
być obecność w kale związków hamujących wzrost
szczepu w warunkach in vitro lub mogło wiązać się
to z niższą czułością użytego w początkowym okresie
badań podłoża hodowlanego (24).
Przyszłością w diagnostyce CZCD wydają się być
metody genetyczne. Obecnie na rynku dostępne są
testy oparte na metodzie Real -Time PCR dające możliwość wykrycia fragmentów genów toksyn: toksyny
B, (tcdB), toksyny binarnej (cdtA i cdtB) oraz charakterystycznej delecji tcdC w pozycji 117 występującej
w szczepach o ważnym znaczeniu epidemiologicznym
tj. w szczepach należących do PCR-rybotypu 027. Jest
to metoda komercyjna zaaprobowana przez Amerykańską Agencję ds. Żywności i Leków (FDA – Food
andDrug Administration). Novak-Weekley i wsp. wykazali w swojej pracy większą czułość (94,4%) i wysoką
ujemną wartość predykcyjną NPV (98,8%) dla RT-PCR
w porównaniu z badaniami immunoenzymatycznymi
(83,1%) i testem cytotoksyczności (55,6%) (25). Metoda ta pozwala na uzyskanie w krótkim czasie (45
min) wyniku, rozstrzygającego w przypadku uzyskania
wstępnie wyników ujemnych lub wątpliwych w sytuacji
wystąpienia określonych objawów klinicznych i podejrzenia zakażenia C.difficile. Należy jednak pamiętać,
że wykrycie fragmentów genów toksyn C.difficile nie
jest dowodem świadczącym o ekspresji toksyn, a może
wskazywać na stan nosicielstwa. Dlatego istotna jest interpretacja wyniku badania genetycznego w połączeniu
z objawami klinicznymi.
W niniejszej pracy przeprowadzono typowanie
genetyczne wyhodowanych szczepów C.difficile metodą PCR-rybotyping. Wykazano, że szczepy C.difficile wyhodowane od pacjentów z objawami biegunki
i niedrożności jelit były zróżnicowane genetycznie.
Wykryto 8 różnych rybotypów, w tym dwa należące do
PCR-rybotypów 027 i 176 o podwyższonym potencjale epidemicznym. Na uwagę zasługuje fakt wykrycia
u pacjentów rybotypu 176, blisko spokrewnionego
z rybotypem NAP1/BI/027, który pojawił się w Polsce
na przełomie 2008 i 2009 roku (26). Podwyższony
potencjał epidemiczny szczepów C.difficile stwarza
zagrożenie zasiedlenia się tego drobnoustroju w środowisku szpitalnym i zwiększa ryzyko zakażeń CZCD.
WNIOSKI
Diagnostyka pacjentów zakażonych toskynotwórczym szczepem C. difficile z zastosowaniem jedynie
testów ELISA do wykrywania toksyn A/B w próbkach
kału jest niewystarczająca. Wyniki badań przedstawione
w niniejszej pracy uzasadniają celowość uwzględnienia w algorytmach diagnostyki laboratoryjnej CZCD
metod genetycznych i hodowlanych.
Podziękowanie: Pragniemy złożyć podziękowanie
dla Prof. J. Braziera (Anaerobe Reference Laboratory,
Cardiff, Wielka Brytania) oraz Prof. Edwarda Kuijpera
(Leiden University Medical Center, Leiden, Holandia)
za przekazanie wzorców szczepów referencyjnych do
PCR-rybotypowania. Prof. E. Kuijperowi i Celinie
Hamanus za pomoc w przeprowadzeniu PCR-rybotypowania wybranych szczepów. PCR- rybotypowanie przeprowadzone w Pracowni Beztlenowców, w Katedrze
i Zakładzie Mikrobiologii Lekarskiej, Warszawskiego
Uniwerysytetu Medycznego finansowane było ze środków Narodowego Centrum Nauki (NCN) w Krakowie
w ramach grantu 2011/01/B/NZ7/02720.
Otrzymano: : 14.05.2014 r.
Anna Schneider
Laboratorium Mikrobiologii
Szpital Kliniczny im.Przemienienia Pańskiego
Uniwersytetu Medycznego w Poznaniu
Ul.Długa ½, 61-848 Poznań
Tel. 61 854 92 25
Zdrowie publiczne
Michalina Krzyżak1, Dominik Maślach1, Katarzyna Piotrowska2, Angelika E. Charkiewicz1,
Andrzej Szpak1, Jan Karczewski2
UMIERALNOŚĆ OKOŁOPORODOWA NOWORODKÓW W MIEŚCIE
I NA WSI W POLSCE W LATACH 2002-2012
Zakład Zdrowia Publicznego, Uniwersytet Medyczny w Białymstoku
Zakład Higieny i Epidemiologii, Uniwersytet Medyczny w Białymstoku
1
2
STRESZCZENIE
CEL. Celem pracy była analiza poziomu oraz trendów umieralności okołoporodowej noworodków w Polsce
w latach 2002-2012 z uwzględnieniem miejsca zamieszkania matki (miasto-wieś).
MATERIAŁ I METODA. Materiał do przeprowadzenia badań stanowiły informacje Głównego Urzędu Sta-
tystycznego o liczbie urodzeń żywych i zgonów noworodków (do 1 tygodnia życia) oraz urodzeń martwych,
zarejestrowanych na terenie 16 województw i Polski ogółem, z uwzględnieniem miejsca zamieszkania matki
(miasto–wieś) w latach 2002 – 2012. Analizę trendów czasowych współczynnika umieralności okołoporodowej
oraz wartości średniej rocznej zmiany (APC - annual percent change) współczynnika umieralności okołoporodowej obliczono za pomocą modeli joinpoint. Różnice w umieralności okołoporodowej pomiędzy miastem
i wsią przedstawiono za pomocą wskaźnika miasto/wieś.
WYNIKI. W analizowanym okresie umieralność okołoporodowa w Polsce obniżała się, w mieście o 3,4% rocznie
(p˂0,05), na wsi o 2,7% rocznie (p˂0,05).
Najszybsze tempo redukcji wartości współczynników w mieście odnotowano w województwie pomorskim (APC=
-6,6%, p˂0,05), warmińsko - mazurskim (APC= -5,4%, p˂0,05) oraz lubuskim i świętokrzyskim (APC= -4,5%,
p˂0,05), na wsi w województwie dolnośląskim (APC= -4,3%, p˂0,05), wielkopolskim i zachodnio - pomorskim
(APC= -3,7%, p˂0,05) oraz śląskim (APC= -3,2%, p˂0,05).
WNIOSKI. W badanym okresie obserwowano redukcję umieralności okołoporodowej noworodków w Polsce,
zarówno w mieście jak i na wsi. Poziom umieralności i tempo zmian były zróżnicowane pomiędzy województwami.
Słowa kluczowe: umieralność okołoporodowa, zróżnicowanie miasto–wieś, analiza jointpoint
WSTĘP
Umieralność okołoporodowa noworodków jest
bardzo ważnym wskaźnikiem wykorzystywanym
do oceny opieki zdrowotnej nad matką i dzieckiem.
Odzwierciedla warunki życia oraz stan zdrowia matki
i dziecka. Umożliwia decydentom identyfikację głównych problemów związanych z opieką perinatalną,
a także pozwala śledzić trendy czasowe i terytorialne
umieralności oraz planować i wprowadzać zmiany organizacyjne w sektorze ochrony zdrowia (1).
Opieka perinatalna wymaga interdyscyplinarnego
działania z udziałem położników, neonatologów oraz
innych specjalistów (pediatrów, chirurgów, dietetyków,
pracowników socjalnych), na które składa się opieka
medyczna, promocja zdrowia oraz czynności lecznicze
w okresie przedkoncepcyjnym, podczas ciąży, porodu
i połogu, obejmującego matkę, płód i noworodka (2 - 5).
CEL
Celem pracy była analiza poziomu oraz trendów
umieralności okołoporodowej noworodków w Polsce
w latach 2002-2012 z uwzględnieniem miejsca zamieszkania matki (miasto-wieś).
MATERIAŁ I METODA
Materiał do przeprowadzenia analizy stanowiły
informacje Głównego Urzędu Statystycznego (GUS)
o urodzeniach żywych i zgonach noworodków (do 1
764
Nr 4
Michalina Krzyżak, Dominik Maślach i inni
tygodnia życia) oraz urodzeniach martwych zarejestrowanych w Polsce w latach 2002-2012 (6).
Obliczono współczynnik umieralności okołoporodowej, jako iloraz sumy zgonów noworodków do 1
tygodnia życia (0-6 dni) oraz liczby urodzeń martwych
(zgon następujący przed całkowitym jego wydaleniem
lub wydobyciem z ustroju matki – o ile nastąpił po upływie dwudziestego drugiego tygodnia ciąży lub później)
do liczby urodzeń ogółem, który wyrażono na 1000
urodzeń ogółem. Obliczenia wykonano oddzielnie dla
każdego z 16 województw z uwzględnieniem miejsca
zamieszkania matki (miasto-wieś).
Miejsce zamieszkania matki zostało zdefiniowane
przez GUS zgodnie z ustawą z dnia 29 sierpnia 2003
r. o urzędowych nazwach miejscowości i obiektów
fizjograficznych (Dz. U. z 2003 r., Nr 166, poz. 1612.
Analiza statystyczna. Różnice w poziomie umieralności okołoporodowej przedstawiono za pomocą
wskaźnika miasto/wieś, który obliczono jako iloraz
współczynnika umieralności okołoporodowej w mieście
i na wsi. Wartości wskaźnika miasto/wieś oraz 95%
przedziału ufności obliczono za pomocą programu
Health Disparities calculator (Version 1.2.4. – October
2013) (7).
Wykonano analizę trendów czasowych współczynnika umieralności okołoporodowej w latach 2002-2012.
Trendy analizowano w Polsce ogółem oraz w województwach z uwzględnieniem miejsca zamieszkania
matki (miasto-wieś).
Zmiany wartości współczynników umieralności
okołoporodowej oszacowano wykorzystując modele
joinpoint. Metoda ta jest rozszerzeniem regresji liniowej, w której trend czasowy jest wyrażony odcinkami
połączonymi ze sobą w punktach (joinpoint), w których
trend zmienia swój kierunek w sposób istotny statystycznie (p˂0,05) (8).
Na podstawie modelu regresji liniowej, w której
logarytm naturalny współczynnika umieralności okołoporodowej był zmienną zależną, a rok kalendarzowy
zmienną niezależną (y = a + bx, gdzie y = ln(wsp.
umieralności okołoporodowej), x = rok kalendarzowy)
wyznaczono roczną procentową zmianę (APC – annual
percent change) wartości współczynników umieralności
okołoporodowej dla każdego trendu, zgodnie z formułą:
APC = 100 * (expb - 1).
Dla określenia istotności statystycznej APC wyznaczono 95% przedział ufności w analizowanym okresie.
Za graniczny poziom istotności statystycznej przyjęto
wartość p<0,05. Analizy trendów oraz wartości APC
obliczono za pomocą programu Joinpoint Regression
Program (Version 4.0.1 – January 2013) (9).
WYNIKI
W tabeli I przedstawiono trendy współczynnika
umieralności okołoporodowej w latach 2002-2012
w Polsce ogółem i w województwach, w mieście i na
wsi.
Umieralność okołoporodowa w Polsce obniżała się
systematycznie, w mieście o 3,4% rocznie (p˂0,05), na
wsi nieco wolniej, o 2,7% rocznie (p˂0,05).
W mieście w analizowanym okresie istotne statystycznie obniżanie umieralności okołoporodowej odnotowano w województwach: dolnośląskim (APC=-4,3%,
p˂0,05), lubelskim (APC= -3,0%, p˂0,05), lubuskim
(APC= -4,5%, p˂0,05), łódzkim (APC= -2,8%, p˂0,05),
małopolskim (APC= -2,5%, p˂0,05), mazowieckim
(APC= -2,1%, p˂0,05), podkarpackim (APC= -4,1%,
p<0,05), podlaskim (APC= -3,5%, p<0,05), pomorskim
(APC= -6,6%, p˂0,05), świętokrzyskim (APC= -4,5%,
p<0,05), warmińsko-mazurskim (APC= -5,4, p˂0,05)
i wielkopolskim (APC= -3,5, p<0,05). W województwie
śląskim po 2007 roku odnotowano istotne przyspieszenie tempa zmian, które w latach 2007 – 2012 wynosiło
6,8% rocznie (p<0,05).
Na wsi w latach 2002-2012 współczynnik umieralności okołoporodowej istotnie obniżał się w województwach: dolnośląskim (APC= -4,3%, p˂0,05), lubelskim
(APC= -2,8%, p˂0,05), łódzkim (APC= -2,6%, p˂0,05),
małopolskim (APC= -3,1%, p˂0,05), mazowieckim
(APC= -2,3%, p˂0,05), podlaskim (APC= -2,6%,
p˂0,05), śląskim (APC= -3,2%, p˂0,05), wielkopolskim (APC= -3,7%, p˂0,05), zachodniopomorskim
(APC= -3,7%, p˂0,05). W województwie kujawsko –
pomorskim do 2007 roku umieralność okołoporodowa
obniżała się o 10,1% rocznie (p<0,05), następnie trend
zmienił kierunek i wartość współczynnika wzrastała
o 4,5% rocznie. Wzrost wartości współczynnika po
2007 roku nie był istotny statystycznie.
W tabeli II przedstawiono różnice w wartości
współczynnika umieralności okołoporodowej pomiędzy miastem i wsią. Średnioroczny poziom umieralności w Polsce był o 6,0% (p˂0,05) wyższy na wsi
niż w mieście. Istotnie wyższy poziom umieralności
na wsi odnotowano w następujących województwach:
dolnośląskim (o 9%, p˂0,05), małopolskim (o 11%,
p˂0,05), mazowieckim (o 17,0%, p˂0,05), warmińsko
– mazurskim (o 13%, p<0,05), wielkopolskim (o 7%,
p<0,05) i zachodnio – pomorskim (o 17%, p<0,05).
W województwie śląskim umieralność okołoporodowa
była średnio o 11% (p˂0,05) wyższa w mieście. W pozostałych województwach nie odnotowano istotnych
statystycznie różnic pomiędzy umieralnością okołoporodową w mieście i na wsi.
Nr 4
Umieralność okołoporodowa noworodków w mieście i na wsi w Polsce
DYSKUSJA
Umieralność okołoporodowa w Polsce od okresu
powojennego była przyczyną znacznych ubytków w populacji do pierwszego roku życia. W 1952 roku osiągała
wartość ok. 80/1000 urodzeń (10). Obecnie wartości
współczynników umieralności okołoporodowej wykazują tendencję spadkową. W latach 90. ubiegłego
wieku kształtowały się na poziomie 20/1000 urodzeń,
na początku obecnego stulecia 10/1000 urodzeń, zaś
w roku 2012 osiągnęły wartość 6,5/1000 urodzeń (11).
W państwach europejskich zauważalna jest
również redukcja umieralności okołoporodowej z 42,8
– 19,7/1000 urodzeń w 1960 roku do poziomu 2,6 –
11,0/1000 urodzeń w 2012 roku (12, 13).
Wyniki badań własnych potwierdzają redukcję
umieralności okołoporodowej w Polsce w latach 2002
– 2012. W mieście współczynnik obniżył się o prawie
28,7%, a na wsi o 21,3%. Zgodnie z raportem Troszyńskiego współczynnik umieralności okołoporodowej
w 1999 roku był równy 10,8/1000 urodzeń, zaś w 2010
roku 6,9/1000 urodzeń z czego wynika, że na przestrzeni 12 lat spadek wyniósł 38%, co stanowi około 3%
rocznie (14). Jednak tempo zmniejszania umieralności
okołoporodowej jest obecnie wolniejsze w porównaniu
do okresu 1950 – 1995 (4, 15).
Wyniki przeprowadzonych badań wykazały także
międzywojewódzkie różnice w poziomie oraz tempie
zmian umieralności okołoporodowej noworodków, jak
również w zależności od miejsca zamieszkania matki
(miasto-wieś). Fakt ten potwierdzają wyniki raportu
Troszyńskiego, który wskazuje iż w okresie od 1999
roku do 2010 roku najwyższe współczynniki umieralności okołoporodowej noworodków odnotowano
w województwie dolnośląskim (od 13,7/1000 urodzeń
w 1999 roku do 8,2/1000 urodzeń w 2009 roku), zaś
najniższe w województwie lubelskim (od 7,6/1000
urodzeń w 2001 roku, 7,7/1000 urodzeń w 2002 roku
do 6,9/1000 urodzeń w 2007 roku). Natomiast w latach
2009 – 2010 najwyższy wzrost współczynników umieralności okołoporodowej odnotowano w województwach: podkarpackim, świętokrzyskim i podlaskim,
zaś najwyższy spadek wykazały województwa łódzkie
i śląskie (14). Można domniemywać, iż w pewnym stopniu związane to jest z występującym w Polsce od wielu
lat zróżnicowaniem stanu zdrowia ludności według
miejsca zamieszkania (16, 10, 15), w tym kobiet, także
w czasie ciąży oraz w całym okresie reprodukcyjnym.
Narodowy Program Zdrowia na lata 2007 – 2015
wskazuje, iż nadrzędnym celem opieki zdrowotnej
nad kobietą ciężarną powinno być zapewnienie prawidłowego przebiegu ciąży oraz jak najwcześniejsza
identyfikacja czynników ryzyka, która umożliwi objęcie
tych kobiet opieką adekwatną do potrzeb zdrowotnych
(17), co umożliwi kontynuację wykazanych w analizie
765
pozytywnych trendów w umieralności okołoporodowej
noworodków. Niezbędnym warunkiem do zrealizowania wspomnianych praw kobiet jak i utrzymanie
tendencji spadkowej współczynników umieralności
okołoporodowej jest prawidłowo funkcjonujący system
trójstopniowej opieki okołoporodowej, umożliwiający
skorzystanie z wysokospecjalistycznej, zgodnej z aktualnym stanem wiedzy medycznej, opieki (3).
Autorzy NPZ 2007-2015 podkreślają również, iż
opieka profilaktyczna nad ciężarną, jak i dostępność
badań specjalistycznych na wielu terenach jest niezadowalająca, co powoduje, że nie wszystkie kobiety mają
zapewnioną możliwość wczesnego zgłoszenia się do
lekarza, na co wskazują także wyniki badań własnych.
W analizowanym okresie w Polsce jak i w sześciu
województwach: dolnośląskim, małopolskim, mazowieckim, warmińsko – mazurskim, wielkopolskim oraz
zachodnio – pomorskim współczynnik umieralności
okołoporodowej był znacznie wyższy na obszarach
wiejskich. Nie wszędzie także funkcjonuje w pełni
trójstopniowy system opieki perinatalnej, a ponadto
styl życia części kobiet ciężarnych nie odpowiada wymogom zdrowotnym (17, 2). Można więc stwierdzić,
że w Polsce brakuje kompleksowego podejścia do
zdrowia perinatalnego, obejmującego badania środowiskowe, pomoc społeczną oraz medyczną, zwłaszcza
w środowiskach zaniedbanych, co wskazuje na potrzebę
prawidłowo funkcjonujących rozwiązań systemowych,
zwłaszcza organizacyjnych (5, 3). W Polsce nadal
występują miejsca, które charakteryzuje ograniczona
lub całkowity brak opieki położniczej. Stwierdzenie te
potwierdza kontrola realizacji zadań położnych środowiskowych w zakresie podstawowej opieki zdrowotnej przeprowadzona przez Najwyższą Izbę Kontroli.
W oparciu o analizę dostępności położnej w gminach
z kontrolowanych województw potwierdzono, że
najlepszy dostęp do opieki położnej mają mieszkanki
dużych miast i ośrodków miejsko-wiejskich, w których
znajdują się podmioty wykonujące działalność leczniczą. W niektórych gminach wiejskich świadczenia
położnej podstawowej opieki zdrowotnej nie są zakontraktowane, w konsekwencji czego pacjentki zmuszone
są do korzystania ze świadczeń położnej środowiskowej
w gminach sąsiednich. Wynikiem takiej sytuacji mogą
być wykazane w badaniu własnym dysproporcje w występowaniu umieralności okołoporodowej noworodków
z uwzględnieniem miejsca zamieszkania matki na
niekorzyść obszarów wiejskich (18). Dlatego w celu zapewnienia równego dostępu do świadczeń zdrowotnych
oraz eliminacji nierówności zdrowotnych związanych
z miejscem zamieszkania należy częściej zwracać uwagę decydentów na istotną rolę położnej w szczególności
na obszarach wiejskich zarówno w aspekcie medycznym, społecznym oraz psychologicznym, polegającą
na prowadzeniu fizjologicznej ciąży, porodu, połogu,
766
Nr 4
Michalina Krzyżak, Dominik Maślach i inni
opiece nad noworodkiem, przygotowaniu do porodu
i rodzicielstwa. System ten umożliwi lepszą dostępność
świadczeń medycznych przy jednoczesnym zapewnieniu bezpieczeństwa i efektywnego wykorzystania
zasobów finansowych (3).
Na uwagę zasługuje konieczność ciągłego usprawniania systemu trójstopniowej opieki perinatalnej poprzez nacisk na wczesne rozpoznawanie i kierowanie
kobiet z ciążą podwyższonego ryzyka do specjalistycznych ośrodków. Nie należy także zapominać, że
z prawidłowym funkcjonowaniem opieki perinatalnej
wiąże się konieczność najlepszego wyposażenia poradni, oddziałów położniczych oraz stworzenia lepiej
wyposażonych oddziałów intensywnej terapii i patologii
noworodka z równoczesnym przygotowaniem i edukacją personelu pracującego na tych oddziałach (5, 15).
Ważnym zagadnieniem jest też konieczność podniesienia świadomości kultury zdrowotnej społeczeństwa
w zakresie prawidłowego żywienia, niepalenia tytoniu
i zdrowego trybu życia (15). Wszystkie wymienione
zalecenia są konieczne w utrzymaniu występującej
w Polsce tendencji spadkowej w zakresie umieralności
okołoporodowej.
W ocenie i monitorowaniu zdrowia okołoporodowego niezbędne jest również zapewnienie odpowiednich
formularzy sprawozdawczych oraz skrupulatne prowadzenie dokumentacji dotyczącej urodzeń noworodków
i zgonów, uwzględniających wszystkie wskaźniki zalecane przez projekt EURO-PERISTAT (19). Konieczna
jest realizacja systematycznych badań epidemiologicznych dotyczących kobiet w ciąży i noworodków z grup
ryzyka, a także badań jakości usług medycznych oraz
uczestnictwo w specjalistycznych rejestrach europejskich, co umożliwi ciągłą, wieloaspektową analizę
umieralności okołoporodowej istotną dla określenia
kierunków stałego udoskonalania opieki perinatalnej
w Polsce.
WNIOSKI
1. W analizowanym okresie umieralność okołoporodowa w Polsce poprawiała się, zarówno w mieście
jak i na wsi;
2. Poziom umieralności i tempo zmian wykazały zróżnicowane międzywojewódzkie;
3. Największą redukcję umieralności w mieście odnotowano w województwie pomorskim, warmińsko mazurskim oraz lubuskim i świętokrzyskim, zaś na
wsi w województwie dolnośląskim, wielkopolskim
i zachodnio – pomorskim oraz śląskim;
4. Negatywne odwrócenie trendów umieralności okołoporodowej odnotowano na wsi w województwie
kujawsko - pomorskim;
5. Przedstawiona w pracy sytuacja w zakresie umieralności okołoporodowej podkreśla konieczność dalszej intensyfikacji działań związanych ze zdrowiem
prokreacyjnym i zdrowiem perinatalnym, mających
na celu redukcję zróżnicowania regionalnego stanu
zdrowia matek, płodu i noworodków w Polsce.
Dr n. med. Michalina Krzyżak
Zakład Zdrowia Publicznego
Uniwersytet Medyczny w Białymstoku
ul. Szpitalna 37, 15 – 295 Białystok
tel. /fax (85) 686 50 55
e – mail: [email protected]
Zdrowie publiczne
Krzysztof Dudek
WPŁYW POZIOMU BIORÓŻNORODNOŚCI NA ZAGROŻENIE CHOROBAMI
ODKLESZCZOWYMI
Instytut Zoologii, Uniwersytet Przyrodniczy w Poznaniu
STRESZCZENIE
Od dawna wiadomo, że wysoka bioróżnorodność środowiska związana jest z jego zdrowiem i prawidłowym
funkcjonowaniem. Ostatnimi czasy zaczęto ponadto szukać związków bioróżnorodności ze zdrowiem ludzi. Wiele
badań wskazuje, że ludzie żyjący w niezdegradowanym środowisku są mniej narażeni na choroby cywilizacyjne,
lecz zazwyczaj wskazywano na większe zagrożenie zoonozami. Popularny jest pogląd, że więcej zwierząt musi
oznaczać więcej kleszczy, a co za tym idzie większe zagrożenie boreliozą i innymi przenoszonymi przez kleszcze chorobami. Okazuje się jednak, że to przekonanie może być fałszywe. Coraz więcej badań wskazuje na fakt
zmniejszania się prewalencji patogenów odkleszczowych na terenach o większej bioróżnorodności. W niniejszym
opracowaniu przedstawiono obiecującą hipotezę wyjaśniającą ten związek.
Słowa kluczowe: borelioza, kleszcze, bioróżnorodność, efekt rozcieńczenia rezerwuaru
WSTĘP
Kleszcz pospolity (Ixodes ricinus) jest ektopasożytem zwierząt lądowych. Populacje kleszczy pasożytują
na ptakach i gadach, a najliczniej ssakach, które to
mają dla ich przeżycia kluczowe znaczenie. Większość
larw oraz nimf żeruje na niewielkich ssakach, głównie
gryzoniach, a po osiągnięciu dorosłości zasiedlają duże
ssaki, głównie jeleniowate. Kleszcze mogą żywić się
na prawie każdym gatunku kręgowca, na który trafią.
Dlatego też są częstymi pasożytami człowieka. Uważane są za groźne zwierzęta z racji bycia wektorami
licznych drobnoustrojów chorobotwórczych, zarówno
wirusów (wirus odkleszczowego zapalenia mózgu),
pierwotniaków (Babesia sp.), a także bakterii (Borrelia burgdorferi, Anaplasma phagocytophilum) (1,2,3).
Kleszcze pobierają patogeny podczas żerowania na
zakażonych gospodarzach. Naturalny rezerwuar stanowią te gatunki zwierząt znajdujące się w środowisku,
u których patogeny występują powszechnie, ale nie
wywołują objawów choroby. Natomiast zakażenie
krętkami B. burgdorferi człowieka (ale też psa czy konia), może być przyczyną zachorowania na boreliozę.
Liczba wykrywanych w Polsce przypadków tej choroby ma ogólną tendencję wzrostową (4,5), przy czym
jak pokazują dane z badań na obecność przeciwciał
przeciw B. burgdorferi jest chorobą niedoszacowaną
(6,7) z powodu nieswoistych objawów za wyjątkiem
rumienia wędrującego, który jednak nie zawsze występuje (8,9). Wzrost znaczenia epidemiologicznego
kleszczy w ostatnich latach przypisuje się zmianom
zachodzącym w środowisku naturalnym, jak osuszanie
terenów podmokłych, czy zalesianie nieużytków (10).
Innym, bardzo ważnym obecnie czynnikiem może być
także ocieplanie się klimatu. Jak wykazały badania,
wzrost globalnej temperatury powoduje zwiększenie
zasięgów występowania wielu gatunków kleszczy (11).
Szeroko dyskutowanym ostatnimi czasy czynnikiem
powodującym zwiększenie zagrożenia chorobami
odkleszczowymi jest zmniejszenie bioróżnorodności
zwierząt będących ich gospodarzami (12-14). W niniejszym artykule omawiam to zagadnienie.
HIPOTEZA EFEKTU ROZCIEŃCZENIA
Jeszcze do niedawna powszechny był pogląd, że im
więcej w środowisku gospodarzy kleszczy, tym większe
jest zagrożenie przenoszonymi przez nie patogenami
(10). Należy jednak zauważyć, że gospodarze kleszczy
różnią się między sobą, jako rezerwuary patogenów (15).
Biorąc za przykład krętki boreliozy, jako jej nosicieli,
rozpoznano wiele gatunków ssaków, ptaków oraz gadów.
Okazuje się jednak, że nie wszystkie gatunki w równym
768
Krzysztof Dudek
stopniu są w stanie ulegać zakażeniu i być źródłem
zakażenia wektorów. Najlepszym rezerwuarem B. burgdorferi są gryzonie, których znaczna część populacji jest
zakażona tymi bakteriami (3). Okazuje się, że znacznie
słabszym rezerwuarem są większe ssaki jak jeleniowate
i drapieżne (15), a bardzo słabym są gady (16-18). Wyrażono przypuszczenie, że słabe rezerwuary mogą znosić
wpływ silnych poprzez tworzenie alternatywnych miejsc
żerowania dla kleszczy, w których istnieje mniejsza
szansa na zakażenie (19,20). Na tej podstawie amerykańscy parazytolodzy z zespołu Richarda Ostfelda z Cary
Institute of Ecosystem Studies, wysunęli hipotezę efektu
rozcieńczenia (ang. dilution effect) wiążącą różnorodność
gatunków zwierząt z prewalencją chorób odwektorowych
na danym terenie (12-14). Aby zjawisko rozcieńczenia
mogło zachodzić, muszą być spełnione cztery podstawowe warunki: (I) wektor musi być generalista, czyli
musi odżywiać się na różnych gatunkach gospodarzy,
a nie tylko na wybranych; (II) gatunki gospodarzy muszą
różnić się między sobą jako rezerwuary; (III) gatunki będące najlepszymi rezerwuarami muszą być dominantami
w środowisku i żywić większą część populacji wektora;
(IV) nie może występować transowarialny (z samicy
na jej potomstwo) transfer patogenów w wektorze (12).
Wszystkie te warunki są spełnione w przypadku modelu
borelioza-kleszcz-kręgowce i badania wykazały, że efekt
ten rzeczywiście występuje w środowisku naturalnym
(21-23). Bardzo dobrze wypadają testy modeli komputerowych, które pozwalają manipulować liczbą gatunków
gospodarzy kleszczy. Dają one jednoznaczne wskazanie,
że zwiększenie liczby gatunków w środowisku powoduje
zmniejszenie prewalencji patogenów w kleszczach (19).
Także prace terenowe potwierdziły występowanie efektu
rozcieńczenia. Dobrze ilustrują to badania przeprowadzone na wirusie odkleszczowego zapalenia mózgu.
Eksperymentalne zmniejszenie populacji jeleniowatych,
które są słabym rezerwuarem, a jednocześnie ważnym
gospodarzem kleszczy, powoduje zwiększenie prewalencji wirusa w środowisku naturalnym (31). Rozszerzone
badania na inne gatunki, także spełniające podane kryteria jak np. Trypanosoma przenoszona przez pluskwiaki
(24), czy Wirus Zachodniego Nilu przenoszony przez
komary (25-27) wykazały, że także w przypadku tych
modeli hipoteza efektu rozcieńczenia wydaje się słuszna wskazując, że im większa jest bioróżnorodność tym
mniejsza część wektorów jest zakażona patogenami.
IMPLIKACJE DLA OCHRONY
ŚRODOWISKA I PREWENCJI
EPIDEMIOLOGICZNEJ
Badania nad efektem rozcieńczenia obalają pogląd,
zgodnie z którym większa liczba gatunków będących
gospodarzami kleszczy zwiększa zagrożenie przenoszo-
Nr 4
nymi przez nie chorobami. Gryzonie, takie jak norniki,
myszy i szczury, które stanowią najlepsze rezerwuary
boreliozy, występują licznie nawet w najbardziej zdewastowanych ekosystemach o niskiej bioróżnorodności
i to one stanowią największe zagrożenie zakażając występujące w środowisku kleszcze. Zwiększając bioróżnorodność dodając do środowiska kolejne gatunki, które
w większości są słabymi rezerwuarami (np. jaszczurki,
średnie i duże ssaki, ptaki), zmniejszamy prawdopodobieństwo żerowania kleszczy na gryzoniach, a tym
samym szansę na jego zakażenie (Ryc.1). Zjawisko
to wymusza zmianę podejścia do kwestii zwalczania
chorób odkleszczowych. Nieprawidłowe wydaje się
działanie polegające na ograniczeniu gospodarzy kleszczy, ponieważ zmniejszając ich liczbę możemy osiągnąć
skutek odwrotny do oczekiwanego. Dobrym przykładem może być ograniczenie populacji lisów. Zwierzęta
te są częstymi gospodarzami kleszczy, jednak są słabymi rezerwuarami i niewiele osobników jest nosicielami
krętków boreliozy (12). W związku z tym pełnią one
rolę gatunku rozcieńczającego efekt dużej prewalencji
patogenów w gryzoniach, a ponadto poprzez żerowanie
na nich, zmniejszają liczbę najlepszego rezerwuaru.
Może się więc okazać, że obserwowane obecnie zwiększanie się liczebności lisów wywiera pozytywny efekt
na sytuację epidemiologiczną chorób odkleszczowych
i powoduje mniejsze zagrożenie nimi dla człowieka.
Oczywiście nie należy przy tym zapominać, że obecność lisów wiąże się z innymi zagrożeniami, jak choćby
tasiemcem bąblowcowym, czy wścieklizną. Inna od
powyżej opisanej zależności między gospodarzami,
a chorobami występuje w przypadku jeleniowatych.
Zwierzęta te pełnią ważną rolę w cyklu życiowym
kleszczy, ponieważ to na nich najczęściej dochodzi do
spotkania samic z samcami i kopulacji kleszczy (28).
Ponadto jeleniowate odżywiają większą część populacji
kleszczy (28). Dotychczas sądzono, że ograniczając
liczebność jeleniowatych, zmniejsza się zagrożenie
chorobami odkleszczowymi, jednak ostatnie badania
pokazują wręcz coś przeciwnego (28), a związane jest to
z faktem, że od tych zwierząt kleszcze rzadko zakażają
się patogenami (15, 29).
Innym gatunkiem, który okazuje się ważnym sprzymierzeńcem w walce z boreliozą są jaszczurki. Pospolite
w naszym kraju jaszczurka zwinka Lacerta agilis i jaszczurka żyworodna Zootoca vivipara są bardzo słabymi
rezerwuarami krętków, a jednocześnie odżywiają dużą
liczbę kleszczy (16,30). Co więcej, przypuszcza się,
że jaszczurki żyworodne potrafią usuwać ze swojego
organizmu te bakterie podczas hibernacji, kiedy ich
ciało całkowicie przemarza, a więc mogą pełnić w środowisku rolę swego rodzaju filtrów, na których żerując
kleszcze oczyszczają się z patogenów. Konieczne są
jednak dalsze badania nad tymi zagadnieniami, aby
w pełni zrozumieć mechanizmy panujące w układach
Nr 4
Wpływ poziomu bioróżnorodności na zagrożenie chorobami odkleszczowymi
patogen-pasożyt-żywiciel. Jednak pierwsze wyniki są
obiecujące i ponownie pokazują, ze zdrowsze i bardziej
różnorodne środowisko może przyczyniać się do poprawy zdrowia ludzi.
PODZIĘKOWANIA
Dziękuję prof. dr. hab. Piotrowi Tryjanowskiemu za
krytyczne uwagi do niniejszego artykułu oraz za wiele
inspirujących dyskusji.
Otrzymano: 26.05. 2014 r.
Krzysztof Dudek
Instytut Zoologii
Uniwersytet Przyrodniczy w Poznaniu
Wojska Polskiego 71 C
60-625 Poznań
tel. 61-848-76-51
769
Zdrowie publiczne
POSTĘPOWANIE RATOWNICZE PO UKŁUCIU SKORPIONA
Katedra Ratownictwa Medycznego, Instytut Położnictwa i Ratownictwa Medycznego
Uniwersytet Rzeszowski
STRESZCZENIE
Ukłucia skorpiona stanowią duży problem dla zdrowia publicznego w wielu rejonach świata, nie tylko strefy
tropikalnej i subtropikalnej. Z powodu łatwości nieumyślnego przewiezienia w dowolne miejsce kuli ziemskiej
żywego skorpiona, a także rosnącej popularności hodowli tych pajęczaków w domowych terrariach, przypadki
ukłucia zdarzają się również na terenie Polski. Dlatego niezbędna jest wiedza wśród pracowników ochrony
zdrowia na temat schematów postępowania w przypadku ukłucia przez skorpiona. W artykule przedstawiono
opis przypadku oraz zaproponowano schemat postępowania.
Słowa kluczowe: skorpion, ukłucie skorpiona, surowica przeciwjadowa
WSTĘP
Ukłucia skorpiona stanowią duży problem dla
zdrowia publicznego w wielu rejonach świata, szczególnie w słabo rozwiniętych krajach strefy tropikalnej
i subtropikalnej. Rejonami wysokiego ryzyka są Afryka
saharyjska, kraje Sahelu, Afryka Południowa, kraje
Bliskiego i Środkowego Wschodu, Indie południowe,
Meksyk oraz południe Ameryki Łacińskiej na wschód
od Andów. Łącznie kraje te stanowią obarczoną ryzykiem ukłucia przez skorpiona populację 2,3 miliarda
ludzi. Poza tym obszarem skorpiony występują także
na południu Stanów Zjednoczonych Ameryki Północnej, a także w Europie Południowej. Ocenia się, że
rocznie ukłutych przez skorpiona zostaje około 1,2
miliona ludzi, z czego około 3250 osób (0,27%) umiera.
W rzeczywistości prawdziwa skala zjawiska nie jest
znana, ponieważ większość ukłuć zdarza się w krajach
słabo rozwiniętych, w odległych okolicach wiejskich,
w dżungli, na pustyni i nie jest zgłaszana. Nie istnieje też
formalny obowiązek zgłaszania ukłuć skorpiona (1,2).
Te naturalne granice geograficzne ulegają jednak
zatarciu z powodu łatwości nieumyślnego przewiezienia
w dowolne miejsce kuli ziemskiej żywego skorpiona
z lotniczym lub morskim bagażem podróżnym czy
transportem żywności, a także z powodu rosnącej
popularności hodowli tych skorupiaków w domowych
terrariach. W Polsce grupa takich hobbystów skupionych wokół internetowej strony: www.scorpiones.pl,
liczy ponad 500 aktywnych użytkowników. O aktualności problemu świadczą pojawiające się okresowo
doniesienia medialne, jak to z września 2013 dotyczące
konieczności ewakuacji chorych z Oddziału Psychiatrycznego Szpitala w Bolesławcu z powodu znalezienia
w nim skorpiona, czy też z października tego samego
roku informujące o znalezieniu przez mieszkankę Warszawy w paczce z ubraniami kupionymi w internecie
skorpiona z gatunku Centruroides.
OPIS PRZYPADKU
W dniu 08.05.2006 r. w godzinach wieczornych do
Izby Przyjęć Oddziału Zakaźnego w Łańcucie przywieziono karetką 22-letnią pacjentkę A.M, mieszkankę pobliskiej miejscowości. Pacjentka po wieczornej kąpieli
wyszła z kabiny prysznicowej, stanęła bosymi nogami
na leżącej na posadzce odzieży i doznała silnego ukłucia
w podudzie. Przeszukanie ubrania ujawniło ukrywającego się w nim skorpiona, który został schwytany.
Dzień wcześniej matka pacjentki zakupiła na targu
ziemię ogrodową i rośliny doniczkowe i umieściła je
w skrzynkach na parapetach łazienki.
Przy przyjęciu pacjentka zgłaszała bardzo silny piekący i kłujący ból podudzia, miała uczucie urażania skóry przy każdym kontakcie z ubraniem. Pacjentka była
wydolna oddechowo i krążeniowo, stwierdzono blada,
spoconą skórę, przyspieszoną do 120/min czynność
772
serca, podwyższone ciśnienie tętnicze krwi 160/90 mm
Hg, W miejscu ukłucia znajdował się twardy, bolesny,
zaczerwieniony obrzęk z tendencją do poszerzania się.
Stres lekarza dyżurnego dodatkowo pogłębiał fakt, że
pacjentka była w 6 miesiącu ciąży.
Wdrożono typowe postępowanie objawowe zakładające możliwość wystąpienia – poza reakcją zapalną
i bólową- reakcji anafilaktycznej. Założono dostęp
dożylny, podano hydrocortison, calcium, leki przeciwbólowe, przetoczono 0,9% NaCl. Miejsce ukłucia
obłożono lodem, który systematycznie wymieniano.
Poproszono o konsultację lekarza położnika, który po
zbadaniu pacjentki i wykonaniu zapisu KTG nie stwierdził bezpośredniego zagrożenia dla płodu.
Lekarz dyżurny skonsultował się telefonicznie
z lekarzem dyżurnym Kliniki Chorób Tropikalnych
i Pasożytniczych Akademickiego Centrum Medycyny
Morskiej i Tropikalnej w Gdyni. Konsultujący lekarz
zaakceptował wdrożone dotąd postępowanie oraz
poinformował, że Instytut Medycyny Morskiej i Tropikalnej nie posiada surowic przeciwjadowych, ale
mogą je posiadać ogrody zoologiczne we Wrocławiu,
Płocku i Łodzi oraz Instytut Medycyny Tropikalnej
w Hamburgu. Lekarz podał również numery telefonów
tych placówek. Niestety, pomimo wielokrotnych prób,
nie uzyskano połączenia. Okazało się, ze numery te są
w godzinach nocnych nieczynne. Późniejsze rozmowy
telefoniczne z polskimi ogrodami zoologicznymi wyjaśniły, że nie ma tam surowic przeciwjadowych. Wobec
niezłego ogólnego stanu pacjentki i przewidywanych
trudności oraz długiego czasu koniecznego na sprowadzenie surowicy z Hamburga, odstąpiono od zamiaru
kontaktowania się z tamtejszym Instytutem Surowic
i Szczepionek.
Stan pacjentki i płodu pozostał stabilny, a w ciągu
następnych dni uległ systematycznej poprawie. Po 3
dniach hospitalizacji pacjentkę wypisano do domu w dobrym stanie ogólnym, ze znacznie mniejszym odczynem
miejscowym. Po 3 miesiącach od incydentu pacjentka
urodziła zdrowego, donoszonego syna, u którego nie
stwierdzono żadnych uchwytnych następstw zdarzenia.
Skorpion - dostarczony do szpitala w zamkniętym
szklanym naczyniu - został przekazany do profesjonalnego terrarium. Był to skorpion karpacki (Euscorpius
carpathicus), co zostało potwierdzone przez zoologa.
POSTĘPOWANIE RATOWNICZE
Opisany przypadek stanowi powód, dla którego
znajomość skutków ukłucia przez skorpiona i zasady
postępowania w takiej sytuacji powinny być również
w Polsce znane pracownikom ochrony zdrowia oraz
łatwo dostępne np. na stronach internetowych.
Nr 4
Spośród 1500 gatunków skorpionów tylko 50 jest
naprawdę niebezpiecznych dla człowieka. Wszystkie
one, poza jednym gatunkiem Hemiscorpius należą do
rodziny Buthidae. Skorpiony nie są z zasady agresywne,
nie polują na zdobycz, lecz biernie jej wyczekują i są
aktywne w porze nocnej, dlatego przypadkowe ukłucia
człowieka zdarzają się najczęściej, gdy skorpion zostanie potracony lub nadepnięty, a miejscem ukłucia jest
zwykle noga lub ręka (2,3).
Jad skorpiona jest rozpuszczalną w wodzie, heterogenną mieszaniną licznych toksyn i innych składników.
Zawiera neurotoksyny, kardiotoksyny, nefrotoksyny,
toksyny hemolityczne, fosfodiesterazy, fosfolipazy, hialuronidazę, glikozoaminoglikany, histaminę, serotoninę,
tryptofan i aktywatory cytokin. Najpoważniejsze skutki
działania jadu dotyczą układu nerwowo-mięśniowego
oraz nerwowego układu autonomicznego. Jad skorpiona
zmienia funkcję kanałów jonowych, przede wszystkim
sodowych, utrzymując je w stanie ciągłego otwarcia
i powodując przedłużoną, nadmierną aktywację neuronów prowadzącą do stymulacji układu nerwowo-mięśniowego i uniemożliwiającą normalne przewodzenie
impulsów nerwowych. W konsekwencji prowadzi to do
nadmiernego uwalniania neurotransmiterów, takich jak
epinefryna, norepinefryna, acetylocholina, glutaminian
i asparginian. Równocześnie krótkołańcuchowa neurotoksyna wielopeptydowa blokuje kanały potasowe (4).
Dodatkowo obecność w jadzie serotoniny przyczynia się do silnego bólu. Działanie toksyn jest odwracalne
i przemijające w czasie, ale długość działania zależy od
ilości wstrzykniętego jadu, miejsca ekspozycji i indywidualnej wrażliwości (4,5).
Ukłucie skorpiona może – w zależności od gatunku
skorpiona – powodować cała gamę objawów-od niegroźnych, szybko przemijających reakcji miejscowych
aż do niewydolności wielonarządowej (4,5).
Do zgonu po ukłuciu skorpiona dochodzi zazwyczaj
w mechanizmie niewydolności oddechowej lub krążeniowej w ciągu pierwszych 24 godzin. Ryzyko zgonu
jest najwyższe u dzieci i osób starszych – około 20%
u nieleczonych małych dzieci, 10% u nieleczonych
dzieci w wieku szkolnym i 1% u nieleczonych dorosłych. Różnice w przebiegu zachorowania wynikają
przede wszystkim z indywidualnych predyspozycji
genetycznych i nie są zależne od rasy (1).
Po ukłuciu skorpiona pojawia się nagły, silny, palący ból w miejscu ukłucia. Trwa on do 30 minut, mogą
mu towarzyszyć miejscowe objawy zapalne i obrzęk
tkanek. Inne objawy pojawiają się po 30 minutach,
a czasem dopiero po 4 do 12 godzin, a ich intensywność
narasta w ciągu doby. Są to parestezje, uczucie palenia
i kłucia w obrębie rąk, stóp, twarzy i skóry głowy,
nadwrażliwość skóry na dotyk ubrania i pościeli oraz
nadmierna wrażliwość na dźwięki. Pojawia się ataksja,
brak koordynacji mięśniowej, zaburzenia chodu, ruchy
Nr 4
Postępowanie ratownicze po ukłuciu skorpiona
mimowolne, drżenia i osłabienie siły mięśniowej. Częstość akcji serca wzrasta do 100-150 uderzeń na minutę,
szczególnie przy Parabuthus granulatus lub zwalnia
poniżej 50 - Parabuthus transvaalicus. Przyspieszeniu
akcji serca towarzyszy wzrost ciśnienia tętniczego.
Obserwuje się zaburzenia połykania, trudności w mówieniu, silne poty, ból głowy, nudności, wymioty, biegunkę, opadanie powiek, zatrzymanie moczu, w końcu
zaburzenia oddychania, które mogą doprowadzić do
zgonu (3). Jad gatunków Hemiscorpius może wywołać
silną hemolizę krwinek czerwonych. Duże stężenie
jadu może spowodować ciężkie zaburzenia krzepnięcia
krwi (5).
Ze względu na realną możliwość zetknięcia się
z ukłuciem przez skorpiona również w naszej szerokości geograficznej autorki niniejszego opracowania
przedstawiają algorytm postępowania ratowniczego
i zasady opieki szpitalnej.
Postępowanie ratownicze:
1. Ocena drożności dróg oddechowych, wydolności
oddychania, krążenia (algorytm ABC)
2. Można spróbować wysysania jadu z miejsca ukłucia
pompkami ssącymi (Aspivenin, Venimex) stosowanymi przy ukłuciach owadów. Skuteczność tej
metody nie została jedn

Przeg Epidem 4-2014.indb - Przegląd Epidemiologiczny

Transcription

Similar documents

Polska

Pobierz darmowy fragment

turkana - Kombonianie

Renowacja obiektów dziedzictwa kulturowego na terenie Wyspy

Pokaż treść!

Poziom 1 - Wojskowe Studium Nauczania Języków Obcych

77-80 - Polskie Stowarzyszenie Biomateriałów

silesia - Katowice Airport

Bioinformatyczne modele i algorytmy infekcji wirusowych

trzustka

Krystian Adrych ADIPOKINY PROZAPALNE I PRZECIWZAPALNE